. ..a. . :0. .....1 ... ..qtr . . . . . .. ... L4...04.......v....1<..
.— . . ....o 4 i... ... 4”. 0.0.30.9“. 0. . .
4. 9 . . . .. I... .. .. 9.... .0... ....
.. . . . . .0. "0.
. 9. ..1u..00~....0 .440 . ..l ..0...0.. ...0 .. . ._ . .0 . . .
v. 0 . . . . . . .
0&9‘000900 . . 004 . 0 . 7 . . . .7..‘.7.7....0.404~0£..
. . . .0310... 0.4. . .0. ..0. 70.0... . . . . .
.00 00.90.0. . .0 000:”; O0 0 .00 0 o 40300009 I . .. .
..v .. 30.4.0091. . . 9k “000 0 .9
...4 0.0.9.. o

...1 u n.
.0... . . . 300‘. 004. A . .. . . 4 a. o. .
......P.i..-.’Sno.4.:’. . .. . . . ”4.20“”..qu012...(.3.4.»-.. .. o: 4. 4. ...70
040. 04 7 44 .. . .

...0. ...; ... .0. ..ILJ.
.0... 700000. 0
407.0..400900:1.\~0 0.. .

.9}: ..0 s... . . ..

 

.0000 Q4,
. . .1039...—
. .. . 3 8 10.4.20”! 0000.59”
. . . . . . ... . ... 0. . . . . .0009: 4.4 « .. ...m
. . . . . . .. . .. . . . . . . 740. .49“...- u. . . ..04 .. . 9.4). c a 4.4.9“?!
. . . ... .. ..... . 7 .. . . 7. .7.. A... .. ...: a . _ . . 7 7 7 . . . . . ..n......:r?.:.9:...~77.. 7 .... ... ..P:.....:.....H.m .2
. . . 000. 0104.000. 0 ... . . .1 0.\ . . . . . 230.0 0.. 49‘ ...0 .14":
00.. .... . ... . .0310 . 7 “.9011.
. .90... ...0 . .M30000004..0 .0 4. . 7
0 0 .00.; 0 .....u . 7. . . . . . ....PJ; . .0...
3.....[. .- . 0.. ... 7 . . . 7 . 7 . .
2 . . . 7 . 71....“ 0.0.”. . . . a loom ..
3.: 3.3.00. 3.000;... . . . . . 7 0.0... 4.904..- . . .
.‘no..0..d.. .a.. ..4 44 . .. . . .. . . . .00.}...0. . .. . . 30...... o 0:33...
... 0. [.4u0 . 4 0.: .. 00 3.00.900 n . 7 .7 . . 0. n 0 ...... .0 ..a 0040.00 0.9 . 00
.7 9...: 0.... 00. .l . 7 . .10.... {.30 03K. . . . . . . . . . ~
. . 0.09.9: 4.00... . . .
7 9000.0.-

 

Q . ...930.

 

 

. 0 90 O D 0:. I
.10. 90.0.04. V.

 

490.. ... 00.090. .0072... 90004
. .u .o...0.u n: . 0 $.1..29u.0~$..f._4 ......0’:
.000. .40. .0. .00... .040 #9.. ...“, ...90000 0

. 9. O 09000 .

4w.
.Pn9Lm

$19.09...."

.7.-cw. . 0.3L .99."?
. 40.”..44.4. ...u 99. ."u400.0.9:.a7 £.lJMk0¥.?0 404 0...“..4. 99.. I“
. . . 00. u . .900 ....
. . . . . . . . .. . . . . . . .«. p. . .70."...uv.z.31. ...!on”...94 4 n ”4084...; um
. . . _ . . . . 7 . . . . . .. . . . 3.30.4». . .4. .. ...x..u......uz...m$u .mua.u. ...: ...J?

...-.... . 05.300313... 0 .0. 0. 0.0. 000300. 0 ..0. .... . . . . : .. . . . . .. p . 7 . 44.0.“.00. 11...; 4?...u0r702?
...0...0o.<.1..4 ....”h'fl..7..o .. . ...... 0.80 3'90...‘ 3 .00... 0.... 0.0.2”... .... ..I. .7 _ . . . . 7 . . . . 3.. . .930 . .. ..u 39.0.0. . m...
. . . o . . t 4 .. .094. 4.0.4 o. .. 0.0.0... . ....1.o.. . 3.0 . . . 7 . . .. . ... .0. ..u._...1-«..0me... ...
. .. . .7 3.7.9. 7. . . . . 0...". 3.... 10.4.. . 451...]. 09.0.00. .40.c0.0..:p0 00o .. .43... .9 . .....003 9.. 9 34.. . . . 7 7 . . .. . .00. 4. 0.. ...9 ...
30.0 . .. . {1.00.900 1.. 3 ... .. 04...... . 0 .. 81. S . ..7 423...!09 3.3.0. . 19.1.5." I . . . . . $.04“ 2.409..“
n 7 ... ... a... 6. . .. ... ..0.. 0...: .0 . .. .030: . ...... .7u.0..l. 3.0.0 3.14.0... . .90. L0... . .0 7 . . . . ....o .2. o .0 I. .33...

907 00.0.9.0..9000 00 . . 090. .0 0.00. .n 7 . . . . . 7.44 I. .lnMSJ‘0 n g 0.
4 ..00‘0073 . u . . .. 7 . . . . 7 . . . . . . . . .0 0...“... . .
... .... o. . 7 .. . . . . .. . . . . . .
02:. 1-.9:‘..0 ....‘4090 .00.

 

 

. ...-0.. 30. v. .....9030. “......9: 0.0.
.99. . . . . . . . 9-. 990.0.‘...'..¢l
9.0.0.0 0 ...0: ..0. (00.0020.- . , . . .93.- ...o. 0 .
304.000.30.99 :0 004.099.... . . .
. 9.... .01.... .. .99.... .00 .1...
0.0 ... 9'0. 0.0...

. .0190... 000. 0 v .0... 0.

. S- . ... 1 9.0...

.300. 0: 4 .

.... 9 -
...-...... 3.4.7.930. . . .vw

 

04 .0...
. 400.."00-0 < .4“

. ~90..- ‘
. . . ...!!‘o .93.? . o0. . c ..r ; . . . _ . . 7. . . “......03590 «Huron-4... 53.9 a. a 4 ."......
. . . . 7 . . . . 4 . 20.0. . .04 a. 4 09 01.0.. 7 . ....4. 0. ("0993‘ ”c.34- 0.1090 ......00: 00400:. 0.
.359... ...40.... ......o...... . . . .. . . s .. ...... .2. ... ...}..9! 85.41““. rag Jaut.
...0 .... .2300. . 4 . . .. . . 7 . 7.04.... 2100...}; [9.0.1.8. 404040409..Q..

. . .."ruwu fin.h.000.94§v9yr.vznop.o_m1

. . . . 9001.40 30.. 0...... 4 .. 9,909.2...0.‘ 10..40‘.0..o.,l.404
. . . . . . . 4. .4 .3 . 004 . 06.1934211309 094 2.0... 0. 00.3! .0000 J. .00-000000..0A4 000;: .915
. . . . . . .7 . .. . .... .. ... :7... .0 ..2. .. ...”...t2 3 7...-3.9.3.... 3.4... .32.... .W.....7. 1.». 1 801...}... 0.3.3.9 290.8. 0.0.
. . . . u o . u. 2 .20 . 0.... 4 o. .9 .0: 9 0 . 4 0 ... .. .... .3 0 n
....40’? .000.4. 0 ..o. . 7 . . . .. ... .l 0000... u. .0 0.0 . o. .0. .w: . ..«p. . ‘0 . 7 9 0.9th can-“0 09.19.00. . . . 0.. Q”. .0" .0 .504 0:10
.. I» v .....I 91”.... . . .3. ... l ..a .0... ... .0... 9

 

 

0,:
.0.. .. .... . q . 0
.30....- 00. ......00009. 4 u. a . .0... ..9.
0
0.4.... -0004:
.0. 0.0 0'). 09. . .. .‘0: .00.... 0. .09....
O .0 . . . 00 .0.

 

...«. c. . 0)! .0.
I... 02.0”“...

 

'. 941i30‘9100: .0. .00
.0“.-940.01.00.3’49..30....003...‘
. . ...» ...:

. . .. 7 . ...
. 00. .0 0 0 7. . . . . ,,
.00 0. 4 n . 00.0.:- 4.0.’0-... -. 9 .0: . . . .
7. 00?. u: .o 0. .0... ...... 0.00... .
.0 0. 0 ... ...8. 1.9.0.9.. 5. -..... .....010 4. .. .. . .
9.9 0009.000 4:0: .0 14.00 0.0.9 0 .0 . 040nv 0.09.0900: .000 00. 0....

90.1.9... . .970
19.0.: a :9. 00.0.. ....

. . . . . . ...ONZ £00
...... .103... . . . 3. a .74. . . . . .. .. . . . . . .. . . . 7. .

 

"9
.060...“ 0.. 9“
3900...! 044.909.. 0
..0.00010. v 00:00 0.. .

. ....
7 . . .. . . . . . 7 .. .9900. 0.09. 400.094
. . . . . . 7 . . . . ’. 05.300900390000‘0 0.04. 0
7.... .. .. .. . . . . .. .3. 4.. . 9.0:. .o . ......
o 00 .Oh . .... ..0. . . . . . . . . . . . .. . . . .0
d” 7 .00. .... . . .
9.1.04.1 .0..I . .. .

 

I .

.7.! .900... 0.
.0... ......0
‘00. 0 .

0.. 009100 ...-Ivan:
. 0. .u 0.000 4

. 1’4 00.. .19...” ... .
.0:. 090.0107 .9 . .

 

. . . o. .9. .. .0.. 98 01.909 0.0“ .0033}. .9 90.04
. .. 0 . . .. . ,I09.0=.0o0... . . ...: .«9 .. 79.4.34. .... .0“... 0
7... .........0 . . . _ 7 0... J

.0900: .9. 00.0 . . . . . . .0..090o 0.7.39.30 . 4. . ."n..§. . do; .u' 0: .000. 0 00’ “

00.00.0040.- . . . 7 . . .o 1000.109... 100......0. 0. . .
.000 .. 0 90.0 ...}.7 ...-000 :00 0 .00 .9
......- ..:o... . .....4...7..o......:. 7..

0000900099000"

......a.0....0

t.“ ‘5)..."

. . 9.... ...0
. . . .9. 9. .0 .
. . . . . 0...; .0. .9..0P040.. ; . . . . 0. .0 0. 0.

.0 . .4... 4.0 0000. . 0 .07 .0. . . 7 . . 0.. 0. 0.0001 '0. 0-. ......lw‘ 200'. o. _ . . .....n9
. 3.. ..90093102 . . . . . . .o...0. .7 . .. . 70......
o. u u . 4. .... .000. 9... I. . . .. . . . ..90.. .0... ..0...0 0 9.00.13.0" . 00.... C 0.4 7 .. . .. . . .. . .. .. . . .. .. . . . . .
. 9w. ...... .... . . . . . . I . . . .05.. I 0009... . 9. 0:0 o.70.0...1.0..’l90v0...0?.. . . . 7 .

. . . . . . .‘.0.090.0.H0..”. 000’ 7 . . .

 

.. . .. ..
.0... o O... .90.. .
.. .004. .9 . O; ..1. ..

W '9'!" 7'

. . .‘ ... .00. .0.’...J¢u. 904)...70\..000000
. . . . . . . _ . . . 0...... . 27.30... ... ...-11.9.9.1.43fi L.u...~‘
. . . . . . . . . . . . . . 0.27.3110: . 7. .00.? .
. . . . . . 7 . . _ . _ . . . 30.0. 3.1129! .
109.0 ....091 . . . . . . . . . . . . .
. 0.. O 0, . ..
. 0.0.0,...00 . .. .

' 7

0 ‘ 9......H. O.
7 . . . .... ... 9.. 0. .
0 0 30.0.. 1.3. .00 . I .. . . . 0.0. w.~....09..>0 .41, 0.90.. .
. . . .
. 0.0 0:900:13. .. 000 .. . . . . 0.0. 0 2.00.39
._ .....0... 00.0.... 0. . . 7 7 7 . . .. (”3.02. .0...k1.0..
7 . . . . . . . v.7;
£90054... . 7 7 2
. ..07 70. 9 .300 30.9
.0: ..0 .. o ..0...
...0.. .... ...

‘ .

OI

.S\.’0:090.0. O 00. ’09.“.
.40... 1... .0...

1m:-

 

‘0.

01.9.. . 0...
.0... o. .9...- .....0...0.00 o.

 

.41. 0.. 0”“...
30.0....
9‘00.
.9... .... .9:

2r-

...0 50.0. .
.0... .004...s..0u... . .. 00..

00.000r0

W.-. ..

. 7 .9.000I..000‘0.07.
. 7 . . . . . . . .. 4. 0.
04......0 04....- . . . . . .. . .
. ... 1......0. up . . . .. . . . . . .

0. . . . . . . . .
. o o . .07.. . 7 . .‘0. . . .
choiu... ...4 . ... .019... .

.9
0

 

.
0

. .l.‘
J.

nomnnmfl"

.l .
...-4... . . .

"1170-90009

1" ...—{€341 -

.

.4-

.... ....4 .. .
00- .009‘

.73 "

 

03010!
7 O

 

O '09“.

 

..

      

7.0

 

      

    

    

    

   
   

 
  

  

   
 

. . v on 49 I000. 00. Wuuaol. c é”...wa.0m A. affix-...“.lwm.
. o. .00 \— . 4 V‘. 400 0 .0 .Mnmmfl 4. ’4. 3”“ . .3“
. . _ _. . ... .... in... ...... . 5...... .... ...... .......... ...... .....é..mk.§....._§? 7 fix. air... _ 7 ...
r . .. 5; a id‘fi‘bwLF.‘ . .3... I... 0.....3" .1993... ....‘a. ...? Janus... .. ...: v. : “finnima. ......Jfirt hflnafinfidxafivuun... .. .7”..0w........ . ......l.0.1.. .... : ~ _. . .
o c. 0.“! 9 J» a .51. J. nNsrfw.1".-r: . ..1 7 . “thbfi It. I «I .u. immodmofl 6......4u79..... ..u... 329.... .... . . 4 9...... ... 31...... ..7 . ..0
ul.' . 0| ..u0119. . v '0 _ 9.1-. V0 009. I olo. 09010.. 0' '00. .0
. 7.. . .40 . .. ...-004 4 “1.... 000.900 404 . .. 0- ..9.
v .0 0 00... . .. 0.; 0 u I . . 7.

 

{ 0| ’.

r!

 

 

 

mm LIBRARY
3 Michigan State
7 UNI University

This is to certify that the
thesis entitled

QUANTITATIVE ANALYSIS OF K-RAS MUTATION IN URINE
AS AN INDICATOR OF DISEASE STATUS IN PATIENTS
WITH STAGE II OR HIGHER COLORECTAL CANCER

presented by

Shital Darshan Parikh

has been accepted towards fulfillment
of the requirements for the

MS. degree in Clinical Laboratory Sciences

 

 

9N,

MaonvF‘rofessor’s Signature

1 1/26/08

 

Date

MSU is an Aflinnative Action/Equal Opportunity Employer

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 KrlProj/Acc8PresICIRC/DateDue.indd

QUANTITATIVE ANALYSIS OF K-RAS MUTATION IN URINE AS AN
INDICATOR OF DISEASE STATUS IN PATIENTS WITH STAGE II OR
HIGHER COLORECTAL CANCER

BY

Shital Darshan Parikh

A.THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE
Clinical Laboratory Sciences

2008

ABSTRACT
QUANTITATIVE ANALYSIS OF K-RAS MUTATION IN URINE AS AN

INDICATOR OF DISEASE STATUS IN PATIENTS WITH STAGE II OR
HIGHER COLORECTAL CANCER

BY

Shital Darshan Parikh
Colorectal cancer (CRC) is the 3rd most commonly diagnosed
cancer and the 4th most frequent cause of cancer deaths
worldwide. Sequential mutation in various genes can lead to
CRC. K-ras mutation is seen in about 50% of CRC patients
and is acquired early and remains throughout the process of
tumorigenesis. Therefore, detection of mutant K-ras in
combination with various screening and surveillance tests
may provide early diagnosis, which may enhance the survival
rate as well as provide a new tool for determination of
prognosis and identification of proper treatment in
patients with mutated K—ras. The objective of this study
was to develop a validated method to detect and quantitate
mutant K-ras in biological specimen. A Restriction Enriched
Polymerase Chain Reaction was developed to selectively
amplify mutant K-ras, which was then qualitatively detected
using gel electrophoresis and quantified using capillary
electrophoresis (CE) method. CE method was developed and
validated to selectively quantify mutant K-ras at a level

as low as 0.05%.

ACKNOWLEDGEMENTS

I wish to acknowledge my advisor, Dr. John A. Gerlach,
for tflxs excellent guidance, supervision, inspiration, and
patience throughout the course of my research and thesis
write-up. I would like to thank Dr. Gerlach and Michigan
State University for providing me research assistantship.

I thank all my committee members, Dr. David Thorne,
Dr. Kenneth Schwartz, and Dr. Barbara Conley for their
helpful suggestions and support during my research. I thank
Dr. David Thorne for his valuable suggestions during my
course work.

I thank Dr. Samuil Umansky for helping with urine
isolation method. I thank Dr. Mengiun Wang for providing
helpful technical information in isolating DNA from urine
specimen.

I thank Ann, Ari, Sue, and Michelle for their support.
I acknowledge my friends for their cooperation and support.

II thank nu! husband, Darshan, for raj; support, love,
encouragement, anui immense patience. II thank nu! parents,
in-laws, and all my family members for their continuous
support throughout nu! study. Also, last 1mm: not least I
thank my son, Anish, for giving inspiration and support in

thesis write-up.

iii

TABLE OF CONTENTS

LIST OF TABLES ........................................ vii
LIST OF FIGURES ....................................... viii
RATIONALE ............................................. 1
INTRODUCTION .......................................... 4
Cancer .............................................. 5
Molecular Genetics of Cancer ........................ 6
Gatekeepers .................................... 8
Oncogenes ................................. 8
Tumor Suppressor Gene ..................... 10
Caretakers ..................................... ll
Landscaper ..................................... 13
Colorectal Cancer ................................... 14
Epidemiology ................................... 14
Risk Factors ................................... 14
Clinical Background ............................ 17
Sporadic Colorectal Cancer ................ 17

Colorectal Cancer in Inflammatory Bowel
Disease ................................... 18
Hereditary Colorectal Cancer .............. 18
Pathogenesis of Colorectal Cancer .............. 20
Screening and Prevention ....................... 23
Staging of CRC ............................. .... 24
TNM (Tumor, Node, Metastasis) Classification... 24
Treatment and Surveillance ..................... 26
RAS Family .......................................... 28
Functional Roles of RAS Proteins in Cancer .......... 3O
K-ras Gene and CRC .................................. 31
Presence and Detection of DNA from Serum/Plasma ..... 33
Detection of DNA from Urine ......................... 34
OBJECTIVES ............................................ 36
METHODS ............................................... 37
Preparation of Samples .............................. 38
Positive Control ............................... 38
Negative Control ............................... 38

Serial Dilution of Positive and Negative

Controls to Identify Sensitivity of the Method

to Detect K-ras ................................ 39
Urine Sample ................................... 39

iv

Urine Collection ..........................
Ability of Urine Isolation Method to Detect Low
Molecular Weight Mutant K-ras sequences ........
DNA Isolation of Samples ............................
Positive and Negative Controls .................
Urine Sample ...................................
Primer Preparation ..................................
Restriction—Enriched Polymerase Chain Reaction (RE-
PCR) ................................................
First-stage PCR ................................
First-round of BstNI Digestion .................
Second-stage PCR ...............................
Second-round of BstNI Digestion ................
Polyacrylamide Gel Electrophoresis (PAGE) ...........
Detection of Bands of DNA Fragments (Qualitative
Method) .............................................
Quantitation of Mutant K—ras Sequences using
Capillary Electrophoresis ...........................
Matrix File Preparation ........................
Preparation and Capillary Electrophoresis of K-
ras DNA Fragment Samples .......................
Data Analysis ..................................
Quantitation of Mutant K-ras Sequences in Serial
Dilution Assay ..... . ................................
Intra-sample Variability .......................
Inter-sample Variability .......................

RESULTS ...............................................
DNA Isolation from Positive and Negative Controls...
Detection of K-ras Sequences after RE-PCR and Gel
Electrophoresis (Qualitative Method) ................

First-stage PCR and first-round of BstNI
Digestion ......................................
Second-stage PCR and second-round of BstNI
Digestion ......................................
Ability of Urine Isolation Method to Detect Low
Molecular Weight Mutant K-ras Sequences .............
Serial Dilution Assay ...............................
Qualitative Analysis of Mutant K-ras Sequences.
Quantivative Analysis of Mutant K-ras Sequences

in Serial Dilution Assay .......................
Intra-sample Variability ..................
Inter-sample Variability ..................

DISCUSSION ............................................

DNA Isolation from Positive and Negative Controls...

39

4O
41
41
42
45

46
46
48
48
49
49

5O

51
51

52
53

54
54
55

56
57

57
58
59
6O
62
62
64
67
69

72
73

Detection of K-ras Sequences after RE—PCR and Gel
Electrophoresis (Qualitative Method) ................
First-stage PCR and First-round of BstNI
Digestion ......................................
Second-stage PCR and Second-round of BstNI
Digestion ......................................
Ability of Urine Isolation Method to Detect Low
Molecular Weight Mutant K-ras Sequences .............
Serial Dilution Assay ...............................
Qualitative Analysis of Mutant K—ras Sequences.
Quantitative Analysis of Mutant K-ras Sequences
in Serial Dilution Assay .......................
Quantitative Analysis .....................
Intra-sample Variability ..................
Inter—sample Variability ..................

CONSLUSIONS ...........................................

APPENDIX ..............................................
Materials ...........................................
Instruments .........................................
Figure. 11 Mutant and Wild-type K-ras Sequences

during Restriction-Enriched Polymerase
Chain Reaction ...........................

REFERENCES ............................................

vi

73
73
74
76
77
77
77
77
78
79
80
84
85
89
91

96

Table

Table

Table

Table

Table

Table

Table

Table

Table

Table

10.

LIST OF TABLES

Risk factors associated with colorectal
cancer .......................................

TNM classification of CRC ....................
American Joint Committee on Cancer- Union
Internationale Contre le Cancer Tumor, Node,
Metastasis Staging of CRC ....................
PCR primers ..................................
Analysis parameters ..........................
DNA concentration in SW480 cell-line and PBLs
Intra-sample variation .......................
Intra-sample variation. Calcuation of log%
mutant and log mean area of data shown in
Table 7 ......................................
Inter-sample variation .......................
Inter-sample variation. Calculation of log

of % mutant and log mean area on data showed
in Table 9 ...........................

vfi

16

25

26

46

54

57

68

68

7O

70

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure

Figure.

LIST OF FIGURES

1. Formula for the calculation of DNA
concentration ...............................

2. A gel photograph after first-stage PCR and
first-round of BstNI digestion ..............

3. Photograph of gel electrophoresis after
second-stage PCR and second—round of BstNI
digestion ...................................

4. The photograph of gel electrophoresis after
RE-PCR ......................................

5. A gel photograph of serial dilution assay
after RE-PCR and 12% PAGE ...................

6. A fragment analysis picture of 100%, 75%,
50%, 25%, and 10% mutant K-ras sequences....

7. A fragment analysis picture of 5%, 1%, 0.5%,
0.25%, and 0.1% mutant K-ras sequences ......

8. A fragment analysis picture of 0.05%, 0.02%,
0.01%, and 0.002% mutant K-ras sequences....

9. A plot of log % mutant vs. log mean area
(Intra-sample variation) ....................

10. A plot of log % mutant vs. log mean area
(Inter—sample variation) ...................

11 Mutant and Wild-type K-ras Sequences during

Restriction-Enriched Polymerase Chain
Reaction ...................................

vfii

44

58

59

61

63

65

66

67

69

71

91

RATIONALE

Cancer is aa genetic disease characterized kn! genomic
instability. It has been estimated that cells have to
acquire at least five to seven successive mutations to
allow tumor growth, invasion, and metastasis (Fearon 1990;
Boland 1999; Luebeck 2002). Colorectal cancer (CRC) is the
third most commonly diagnosed cancer and the fourth most
frequent cause of cancer deaths worldwide. In CRC, various
cancer susceptibility genes such as oncogenes, tumor
suppressor genes and others are involved in tumor
initiation and progression in a defined series of stages
from normal mucosa to carcinoma (Fearon 1990; Vogelstein
1993). A large number of oncogenes like K-ras (v-Ki-raSZ
Kirsten rat sarcoma viral oncogene homolog), Myc [v-myc
myelocytomatosis 'viral. oncogene: homolog (avian)], SRC (v-
src sarcoma (Schmidt—Ruppin A-2) viral oncogene homolog
(avian)], beta—catenin, BRAF (v-raf' murine sarcoma ‘viral
oncogene homolog B1) have been identified to play a role in
CRC, among all these K—ras is foumd to be most frequently
mutated. In CRC, K-ras oncogene has been found mutated in
10-15% of screened adenomas <1 cm, in 30-60% of adenomas >1
cm, and in approximately 50% of adenocarcinomas (Bos J.L.
1989; Kressner U 1998; Fearon E.R. 1990; Boguski M.S.
1993). Current practice uses fecal occult blood test

(FOBT), flexible sigmoidOSCOpy, double-contrast barium

enema, and colonoscopy (Kahi C.J. 2004). FOBT is a non-
invasive test which detects the presence of hidden blood in
the stool. Such blood. may come from. anywhere along the
digestive tract. Hidden blood in stool is often the first,
and in many cases the only warning sign that a person has
colorectal disease, including CRC. ffiua main advantages of
this test are non-invasiveness and low cost. But the
disadvantages include detection of blood in stool, but not
its cause, false positive results are also common which may
cause anxiety about cancer and lead to unnecessary further
tests, and false negative results are also common and may
miss disease in its early stages. Due to the non
specificity in detecting CRC and chances of false positive
and false negative results, it would ibe (n5 interest to
develop a test that is more specific and can be used with
other techniques to identify CRC more reliably and in early
stages. We therefore propose to detect K-ras mutation for
screening using urine specimen. Urine is a sample that may
be more reliably and safely obtained (in non-invasive
manner) and in virtually unlimited amount. Also, molecular
testing would be simpler as urine contains less amount of

protein for DNA isolation.

INTRODUCTION

Cancer

One of the major characteristics of all higher
eukaryotes is the defined lifespan of the organism. Normal
cells appear to be mortal, with highly regulated growth and
division, and have potential to become terminally
differentiated (Trosko 1998; Hanahan 2000). Once the cells
are terminally differentiated they can no longer
proliferate. Unlike normal cells, cancer cells do not have
growth control enui they proliferate indefinitely if
provided with adequate nutrients, which suggests that
cancer cells may become immortal. Therefore, a cancer can

be defined as an unregulated proliferation of cells.

Cancer‘ has <different types, depending (x1 tissue .and
cell type from which they arise, (example: carcinomas,
sarcomas, lymphomas, and leukemias) but all types of cancer
share one common characteristic — uncontrolled growth that
progresses towards limitless expansion. Cancers arising
from epithelial cells are called carcinomas. The epithelial
cells form the outer layer of tissues, surface of the skin,
and line the intestines and lungs. About 90% of human
cancers are carcinomas. This may be because most of the
cell. proliferation. occurs 1J1 epithelia and time cells in

epithelial tissues are most frequently exposed to various

forms of physical and chemical damage. Sarcomas are cancers
of connective tissue or muscle cells. Leukemias are cancers
of bone marrow cells resulting in excess production of
leukocytes. Lymphomas are cancers that arise in the lymph

nodes and tissues of the body's immune system.

Cancer is a major public health problem in the United
States and other developed countries. Currently, one in
four deaths in the United States is due to cancer. A total
of 1,399,790 new cancer cases and 564,830 deaths from
cancer, corresponding to more than 1,500 deaths per day,
are expected in time United States in 2006 (Ref. Cancer

statistics, 2006).

Mblecular Genetics of Cancer

Cancer, in essence, is a genetic disease characterized
by genomic instability. Since 1960, cytogenetic and
molecular techniques have provided supporting evidence that
tumors expand as ea clone from 51 single altered cell, and
that clinical ‘progression’ is the result of sequential
somatic, genetic, or epigenetic changes followed by
selection, generating increasingly aggressive
subpopulations within the expanding clone (Nowell 1976;

Nowell 2002). This prevailing model of tumorigenesis as

somatic evolution has been confirmed by numerous molecular
studies and it has been estimated that cells have to
acquire five to seven successive mutations to allow tumor
growth, invasion, and metastasis (Fearon 1990; Boland 1999;
Luebeck 2002). The role of cancer susceptibility genes in
tumor initiation and progression is best illustrated by the
identification of sequential mutations of APC (adenomatous
polyposis coli), K—ras, Smad4 (SMAD, Inothers against DPP
homolog 4), and p53 (tumor protein p53) gene jjlaa defined
series of stages from normal mucosa to carcinoma in
colorectal tumorigenesis (Fearon 1990; Vogelstein 1993).
Even though no two cancers are genotypically
identical, they share some fundamental phenotypes. The loss
or abnormal gains in functions of cancer susceptibility
genes cause most cancers to acquire the same set of
characteristics during their development. These
characteristics are: (i) self-sufficiency in growth
signals; (ii) insensitivity' to antigrowth signals; (iii)
evading apoptosis; (iv) limitless replicative potential;
(v) sustained angiogenesis; and MAJ tissue invasion and
metastasis (Hanahan 2000). Cancer susceptible genes can be
classified into three classes: gatekeepers, caretakers, and

landscapers.

> Gatekeepers
Gatekeepers regulate cell proliferation through
oncogenes and tumor suppressor genes (Kinzler 1997; Michor
2004). The mutation in both oncogenes and tumor suppressor
genes drive the neoplastic process by increasing tumor cell
number through the stimulation of cell birth or the
inhibition of cell death or cell cycle arrest (Hanahan

2000; Vogelstein 2004).

. Oncogenes

The oncogenes hypothesis of cancer was proposed based
on the discovery that some endogenous viruses contained
transforming elements, and the activation of these
endogenous transforming elements could cause cancer
(Huebner 1969). An oncogene is the mutant form of the
proto-oncogene — a cellular gene involved in the control of
cell growth and division. These proto-oncogenes can be
classified into five broad classes based on their
functional and biochemical properties: (a) secreted growth
factors [e.g. SIS (simian sarcoma)], (b) cell surface
receptors [e.g. ErbB (avian emythroblastosis virus)], (c)
components of intracellular signal transduction systems
[e.g. the RAS (rat sarcoma) family], (d) DNA-binding

nuclear regulatory proteins, including transcription

factors [e.g. Myc, JUN (jun oncogene )], (e) components of
the network of cyclins, cyclin-dependent kinases and
kinases inhibitors that regulate process through the cell
cycle [e.g. MDMZ (Mdm2, transformed 3T3 cell double minute
2, p53 binding protein (mouse))]. Oncogenes are frequently
activated by gain of functional mutations or fusion with
other genes or they are aberrantly expressed due to
amplification, increased promoter activity, or protein
stabilization (Munger 2002), and hence they play important
roles in diverse signaling pathways that are involved in
various stages of human cancers-tumors initiation,
progression, angiogenesis and metastasis (Michor 2004). An
activating somatic mutation in one allele is generally
enough to confer a selective growth advantage on the cell.
A large number of cellular oncogenes have been identified
to play a role in colorectal cancer, such as K-ras, Myc,
SRC, beta-catenin, BRAF, and others. It has been reported
that approximately 50% of colorectal carcinomas have K-ras
gene mutated (Bos (LIN 1989; Boguski M.S. 1993). The RAS
family and association of K-ras with colorectal cancer are

discussed in details in following sections.

. Tumor Suppressor Genes

Tumor suppressor genes function to suppress
proliferation, promote apoptosis, and maintain integrity of
the genome. Mutations in these genes impair this growth-
suppressor mechanism resulting in uncontrolled growth.
Examples are time genes - Rbl (Retinoblastoma 1J,.jp53, and
p16 (cyclin dependent kinase inhibitor 2A). The tumor
suppressor genes regulate diverse cell activities including
cell cycle checkpoint response, detection and repair of DNA
damage, protein. ubiquitination. and (degradationq mitogenic
signaling, cell specification, differentiation and
migration, and tumor angiogenesis (Sherr 2004). The
activation of tumor suppressor genes is usually achieved by
deletion of one allele via.aa gross chromosomal event such
as loss of heterozygosity (LOH) coupled with an intragenic
mutation of the other allele. Most of the identified
susceptible genes responsible for familial cancer syndromes
are tumor suppressor genes. The inactivating somatic
mutations in tumor suppressor genes are also found in
sporadic counterpart of the familial cancer syndromes.
(Gailani 1996; Ponder 2001; Voglestein 2004). For example,
germline mutation of APC predisposes to familial
adenomatous polyposis (FAP), Inn: mutation in INK: is also

detected in more than 80% of sporadic colorectal cancers.

IO

The tumor suppressor genes besides APC that are found
involved ZUI pathogenesis (Hf colorectal cancer, including
p53, DPC1/Smad4 (Deleted in pancreatic carcinoma at loci 1),
STKll (Serine/threonine kinase JJJ, PTEN (phosphatase and
tensin homolog), DCC (deleted in colorectal carcinoma),

Smad4, and others.

> Caretakers

Caretakers, or stability genes, function in
maintaining the genomic integrity of the cell and regulate
DNA repair mechanisms, chromosome segregation, and cell
cycle checkpoints (Kinzler 1997). Defects in a caretaker
gene does not promote tumor initiation, but leads to
genetic instabilities that cmmtribute tx> the accumulation
of mutations in other genes, including gatekeeper genes
that directly affect cell proliferation and survival, thus
indirectly promoting tumorigenesis (Lengauer 1998;
Rajagopalan 2003; Iwasa 2005). Since deoxyribonucleic acid
(DNA) is vulnerable to many types of damage, DNA repair
systems are shown to arise early and are highly conserved,
in evoluation process (Hoeijmakers 2001). At least four
main, partly overlapping DNA repair pathways operate in
mammals: the nucleotide-excision repair (NER), base—

excision. repair (BER), and Inismatch. repair‘ (MMR) systems

11

are responsible for repairing subtle mistakes made during
normal DNA replication or induced by exposure to mutagens
(Hoeijmakers 2001; Vogelstein 2004). The homologous
recombination and non-homologous end joining (NHEJ) system
is responsible for repairing DNA damage involving large
proportions of chromosomes, such as double-strand DNA
breaks (David 2000; Hoeijmakers 2001; Vogelstein 2004).
Each DNA. repair system .is a: complex: biochemical process
that requires participation of many genes, and still
remains poorly understood.

The role of defective DNA repair systems causing
tumorigenesis is shown by the existence of human cancer
syndromes with germline nmtations in caretaker genes. For
example, inborn defects in NER cause syndromes of xeroderma
pigmentosum, Cockayne syndrome, and trichothiodystrophy
(TTD) are all characterized. by extreme sun sensitivity.
Germline mutations in MMR genes, such as hMLHl (human MutL
homolog 1 gene), hMSHZ (human MutS homolog 2 gene), and
hMSH6 (mutS homolog 63 U3. coli)), are known to predispose
to hereditary' nonpolyposis colorectal cancer (HNPCC)
(Bandipalliam P 2004). As with tumor suppressor genes, both
alleles of caretaker genes generally need to be inactivated

for a pathological effect to result.

I2

> Landscaper

Landscaper defects do not directly affect cellular
growth, Inn: generate 6N1 abnormal stromal environment that
contributes to the neoplastic transformation of cells
(Michor‘ 2004; Iwasa 2005). It is runv well accepted. that
cancer develops with malignant transformatbmu of an
epitheliuml occurring ‘within. the context <af El dynamically
evolving tissue stroma that is composed of multiple cell
types surrounded by an extracellular matrix (Bhowmick 2004;
Weaver 2004). There are many studies to show that cancers
can arise as a consequence of inherited or acquired genetic
mutations in stromal cells. It has been reported that
distinct genetic alterations and chromosomal rearrangements
were absent in the malignant carcinoma cells, but present
in neighboring stromal cells instead (Moinfar 2000).
Moreover, studies of the familial juvenile polyposis
syndrome also indicate that it is actually the genetic
alteration of the DPC/Smad4 gene in stromal cells that
predispose colonic epithelial cells tx> carcinomas (Jacoby
1997; Howe 1998). The dysfunction or deregulation of
landscaper genes can disrupt normal tissue homeostasis,
reduce Ihost immune surveillance and (defense, induce
angiogenesis and inflammation, and promote tumor growth and

migration (Muller 2004).

13

Colorectal Cancer

Epidemiology

Colorectal cancer (CRC), a cancer of colon and rectum,
is the third most commonly diagnosed cancer and the fourth
most frequent cause of cancer deaths worldwide. The World
Health Organization estimates more than 11 million new
cases diagnosed yearly, with 7 mdllion deaths. CRC is the
second leading cause of cancer-related death in the United
States; accounting for approximately 148,610 new cases with
nearly 55,170 deaths in 2006 (Cancer statistics, 2006).

This disease is inore common. in developed countries than

o\°

developing countries. The lifetime incidence is 5 in
developing countries, 1mm: the incidence and mmmtality are
now decreasing (Strward 2003; Russo MW 2004; Jemal A 2004).
The overall 5-year survival rate in the Unites States
exceeds 60%, but is less than 40% in less developed
countries (Strward 2003). This variability in disease

outcome is proportional to access to specialists and

availability of modern drug therapy (Strward 2003).

Risk Factors
The strongest risk factor for developing CRC is

advancing age. The current statistics on CRC indicate that

incidence rates rise from 13.2 per 100,000 at age 40-44 to
338.7 per 100,000 at age 75—80 (Ref. SEER data 1975—2001).
The overall lifetime risk of CRC is 1.:h1 17 for men and 1
in 18 for women (Cancer Statistics, 2005). Inflammatory
bowel disease, a personal or family history of CRC or
colorectal polyps, and certain hereditary syndromes are
also associated. with, high risk: of developing CRC. Other
factors that also contribute to the risk for CRC are: lack
of regular physical activity, low fruit and vegetable
intake, a low-fiber and high fat diet, obesity, high
alcohol consumption and use of tobacco. From a public
health perspective, prevention and screening for early
diagnosis of CRC is essential to help reduce deaths from
CRC. In addition, patients with one diagnosed colon cancer

are at risk to develop further colon cancers.

l5

Table 1. Risk factors associated with colorectal cancer.

 

 

Sporadic Colorectal cancer

Older age
Cholecystectomy (Surgical removal of the gallbladder)
Ureterocolic anastomosis

Hormonal factors

C) Nulliparity (never having carried a pregnancy),
0 late age at first pregnancy,
C) Early menopause

Environmental factors

0 Diet rich in meat and fat, and poor in fiber,
folate, and calcium

Sedentary lifestyle
Obesity

Diabetes mellitus
Smoking

Previous irradiation
Occupational hazards (e.g. asbestos exposure)
High alcohol intake

OOOOOOO

Personal history of sporadic tumors

C) History of colorectal polyps

c> History of colorectal cancer (risk is l.5-3% for
second such cancer in first 5 years)

<3 History of small bowel, endometrial, breast, or
ovarian cancer

Familial colorectal cancer

First or second degree relatives with this cancer,
criteria for hereditary colorectal cancer not
fulfilled:
0 One affected first—degree relative increases risk
by two to three fold
<3 Two or more affected first-degree relatives
increase risk by four to twenty five fold
0 Index case less than 45 years increase risk by
three to nine fold
c3 Familial history of colorectal adenoma increase
risk by two fold

 

I6

 

Table 1 (cont’d)

 

Colorectal cancer in inflammatory bowel disease

0 Ulcerative colitis
o Crohn's colitis

 

Hereditary colorectal cancers

0 Polyposis-syndromes

familial adenomatous polyposis (FAP)
Gardner’s syndrome

Turcot’s syndrome

Attenulated adenomatous polyposis coli
Flat adenoma syndrome

00000

0 Hereditary non-polyposis colorectal cancer (HNPCC)

o Hamartomatous polyposis syndromes

c> Peutz-jeghers syndrome
0 JUvenile polyposis syndrome
c> Cowden syndrome

 

 

Source: Strward B.W. 2003

 

Clinical Background

Sporadic Colorectal Cancer

Although most cases of CRC are sporadic; genetic and
environmental factors also play an important role (Table l)
(Strward B.W. 2003). The characteristic of sporadic CRC is
the step-wise progression from normal colonic epithelium to
malignant growth associated with sequential molecular
abnormalities in each step (Kinzler 1996). Fearon et al.

showed that colorectal tumors arise as a consequence of the

17

 

accumulation of activated oncogenes and inactivated tumor-
suppressor genes (Fearon E.R. 1990). About 20% of all
patients with this cancer are estimated to have some
component. of familial risk: without fulfilling‘ the strict
criteria for hereditary colorectal cancer (Lynch H.T.
2003). Therefore, family history should always be taken

into account when assessing a patient.

Colorectal Cancer in Inflammatory Bowel Disease

Colorectal cancer accounts for about a third of deaths
related to ulcerative colitis, and risk depends on disease
duration (2% of affected people by 10 years, 8% by 20
years, and 18% by 30 years), extent of inflammation,
presence of primary sclerosing cholangitis, and. backwash
ileitis (Itzkowitz S.H. 2004; Krok K.L. 2004). Crohn's
colitis is also associated. with increased risk of
colorectal cancer; the relative risk is similar to that for

ulcerative colitis (Itzkowitz S.H. 2004).

Hereditary Colorectal Cancer

Roughly 5-10% of all CRCs develop in the setting of
defined hereditary cancer syndromes. Hereditary
nonpolyposis colorectal cancer (HNPCC, also called Lynch

Syndrome) and familial adenomatous polyposis (FAP) are the

18

two :main forms (Lynch H.T. 2003). Various hamartomatous
polyposis syndromes are also associated with an jrmmeased
risk of such cancer, such as Peutz-jeghers syndrome,
juvenile polyposis syndrome, Cowden syndrome (Lynch H.T.
2003; Half E.E. 2004).

HNPCC is an autosomal dominantly inherited disorder
caused by germline mutations of mismatch repair (MMR)
genes. Tumors with HNPCC typically have a molecular
characteristic called microsatellite instability. The
microsatellite instability is defined as frequent mutations
in microsatellites, which are short repeated DNA sequences
(Grady W.M. 2003). The penetrance of colorectal cancer in
HNPCC is 70-85%. Risk is also increased for tumors of the
genitourinary system, stomach, biliary system, pancreas,
small intestine, and CNS (Lynch H.T. 2003; Half E.E. 2004;
Vasen H.F. 1999). On average, affected. patients develop
colorectal cancer by age 44, tumors tend to be right-sided,
and, have classical histological features (Bandipalliam P
2004).

FAP is an autosomal-dominant disease. In about 80% of
affected individuals, a germline mutation can be identified
in the adenomatous polyposis coli (APC) gene (Lynch H.T.
2003; Half E.E. 2004). A subset of people with FAP and

attenuated FAP, a mild form of FAP which is characterized

I9

by the occurrence of fewer colonic adenomas, has biallelic
mutations of the rmn: Y’ homolog (MYH) gene (Sieber O.M.
2003; Venesio T 2004). Patients with attenuated FAP
typically have mutations at the 5' (proximal to codon 1517)
or the 3' end (distal to codon 1900) of the APC gene (Grady
M 2003). FAP patients can develop more than 100 colorectal
adenomas (50% of patients by age 15 years, 95% by age 35
years); if left untreated, colorectal cancer arises in

almost all patients by age 40.

Pathogenesis of Colorectal Cancer

CRC develops in a series of genetic steps,
corresponding with histological progression from normal
colonic epithelium to adenomatous dysplasia through
microinvasion, adenocarcinoma and, finally metastasis. Two
major pathways are known to be involved in the
tumorigenesis of CRC. The classical pathway (sometimes
called chromosome instability syndrome), is responsible for
about 85% of sporadic CRC and is the mechanism of
carcinogenesis in patients with FAP, in which cancer cells
are characterized by chromosomal instability with mutation
of multiple cmcogenes, including KFras, (others oncogenes
such as c-myc, c-neu, c-erb-2, c-src are also involved) and

many tumor suppressor genes, such as APC, p53, DCC,

20

DPC4/Smad4, and nm32 (Chaung D.C. 2000; Calvert P.M.
2002).

Other major pathway that leads to colorectal cancer is
via mdcrosatellite instability. Microsatellite instability
occurs in approximately 15% of all CRCs and can arise
through two mechanisms (De La Chapella A 2003). In the
first mechanism, germline mutations of mismatch repair
genes (e.g. MLH1, MLH2, and MSH6) in hereditary
nonpolyposis colorectal cancer (HNPCC) leads txa deficient
DNA—mismatch repair. Nucleotide mismatches occur when two
strands of DNA replicate, but almost all such errors are
quickly corrected. by a Imolecular proofreading' mechanism.
Studies of HNPCC revealed mutation in mismatch repair
genes, which encode proteins that repair nucleotide
mismatches. Defective mismatch repair presumably
facilitates malignant transformation by allowing the rapid
accumulation, of Imitations that inactivate: genes ‘with key
functions in the cell. The defective MMR genes fail to
produce proteins that correct nucleotide mismatches during
replication enmi thus promote mutations 1J1 other genes. In
addition, genes carrying microsatellite in their coding
sequences such as BAX and TGFBR2 are also involved in

carcinogenesis via frame shift mutation.

21

In the second mechanism, epigenetic silencing of MLH1
occurs when methylation of the CpG sites in the promoter
region of MLH1 silences its transcription and when both the
alleles are affected, leads to a mismatch repair deficiency
(Herman J.G. 1998). This second mechanism is not heritable
and accounts for the majority of all sporadic CRCs that are
positive for mfltmosatellite instability (Veigl M.L. 1998;
Cunningham J.M. 1998).

Additional pathways could exist, for example, the
serrated. ‘pathway as vmfld. as distinct. pathways for
carcinogenesis of flat and depressed colorectal neoplasms
and for carcinogenesis in inflammatory bowel disease (Krok
K.I“ 2004; Jass IJJR. 2002; Soetikno IRJ4. 2003; Itzkowitz
S.H. 2004). Epigenetic mechanisms such as change in DNA
methylation, loss <mf imprinting, enmi histone acetylation,
as well as modifier genes (cyclooxygenase-Z gene and
peroxisome proliferators-activating receptor gene) also
seem to be involved in the genesis of CRC (Lynch J.P. 2002;
Kondo Y 2004; Rao M 2004; Sinicrope F.A. 2004; Harman F.S.
2004). Other genes, such as tyrosine phosphatases (Wang Z
2004), activin type2 receptor (Jung B 2004),
phophatidylinositol 3-kinases (Samuels IX 2004), enmi hCDC4
(F-box and WD repeat domain containing 7) (Rajagopalan

2004) might also contribute to colorectal carcinogenesis.

22

Screening and Prevention

Screening is effective in reducing mortality from CRC.
Reducing the number of deaths from CRC depends on detecting
and removing precancerous colorectal polyps, as well as on
detecting and treating the cancer in its early stages. CRC
can be prevented by removing precancerous polyps or growth,
which can be present in the colon for years before invasive
cancer develops (Winawer S.J. 1993). Screening pmocedures
include fecal occult blood test, flexible sigmoidoscopy,
double-contrast barium. enema, and colonoscopy (Kahi C.J.
2004). One of these options should be offered to
asymptomatic people aged 5%) years (n: older (Winawer S.J.
2003). The ideal screening method 1J5 still controversial,
with no test unequivocally better than another. The
American Cancer Society (ACS) and 0.8. Preventive Services
Task Force (USPSTF) recommend yearly stool for occult blood
tests. The colonoscopy has the advantage of allowing
assessment of the entire colon with the possibility of
simultaneous biopsy or polypectomy. For patients with
personal or familial history of colorectal neoplasms, FAP,
HNPCC or inflammatory' bowel diseases, special guidelines
exist, taking into consideration the higher risk (Winawer

S.J. 2003).

23

Staging of CRC
If CRC is suspected, various combinations of tests,

recommended by ZKXS and National Comprehensive Cancer

Network (NCCN), such as medical history and physical exam,
colonoscopy, blood count and blood chemistry,
carcinoembryonic antigen «nun blood test, liltrasound

(imaging test), computed tomography (CT or CAT scan), chest
x-ray are performed. Tissue biopsy is performed to
determine if the disease is really present. The most
reliable prognostic factor identified to date in CRC is the
staging of disease at the time that treatment is initiated.
Staging of colorectal cancer should be done using the
current TNM classification of the American Joint Committee
on Cancer (AJCC) and International Union Against Cancer

(UICC) (Ref: American Joint Committee on Cancer, 2002).

TNM (Tumor, Node, metastasis) Classification

The current joint, .AJCC-UICC staging' systeml for
colorectal cancer is now the only classification system
that should be used (Compton C.C. 2000). The TNM system
(TabLe 2 and Table 3) classifies colorectal tumors on the
basis of the invasiveness (not size) of the primary tumor
(T stage), the number (not size or location) of local and

regional lymph nodes containing metastatic cancer (N

24

stage), and the presence or absence of distant metastatic
disease (M stage) (Ref: American Joint Committee on

Cancer).

Table 2. TNM classification of CRC.

 

 

 

 

 

 

 

 

 

 

Stage Tumor (T) Lymph Nodes (N) Metastasis (M)
0 Tis N0 MO
I T1 N0 M0
T2 N0 M0
IIA T3 N0 M0
IIB T4 N0 M0
IIIA T1 - T2 N1 M0
IIIB T3 - T4 N1 M0
IIIC Any T N2 M0
IV Any T Any N Ml

 

 

 

 

* Abbreviations are in Table 3.

 

 

Source: Greene F.L. 2002

 

25

 

Table 3. American JOint Committee on Cancer- Union
Internationale Contre 1e Cancer Tumor, Node,
metastasis Staging of CRC

 

Primary Tumor (T)

TX Primary tumor cannot be assessed

T0 No evidence of primary tumor

Tis In situ adenocarcinoma (Tis): cancer confined to
the glandular basement membrane or lamina propria

T1 tumors invade into but not through the submucosa

T2 tumors invade into but not through the muscularis
propria

T3 tumors invade through the muscularis propria into

the subserosa cm: into nonperitonealized pericolic
or perirectal tissue

T4 tumors directly invade other named organs or
structures (T4a)* or: jperforate the ‘visceral
peritoneum (T4b)

Regional Lymph Nodes (N)

NX Regional lymph nodes cannot be assessed

N0 denotes that all nodes examined are negative

N1 includes tumors with metastasis in one to three
regional lymph nodes

N2 indicates metastasis in four or more regional
lymph nodes

Distant Metastasis (M)

MX Distance metastasis cannot be assessed
M0 no evidence of distant metastases is present
M1 Identification of distant metastases

 

 

Source: Greene F.L. 2002

 

 

Treatment and Surveillance
Once CRC has been detected, the main treatment for
this disease is surgical excision. Up to 50% of CRC

patients will develop a recurrence of tumors and 30-50%

26

will subsequently develop metastases (August D.A. 1984). As
80% of recurrences after resection of CRC occur within the
first two years after surgery, it is important to undertake
more intensive follow-up during this period (Cochrane
J.P.S. 1980). Therefore, after resection and initial
treatment, surveillance is necessary to address recurrence,
treatment complications, and related medical issues. This
provides at basis ix) optimally'.manage recurrent disease,
monitor the development of new primary cancers, and
precancerous polyps (Winawer ELLL 1993). The surveillance
program for CRC patients usually includes periodic history
taking and physical examinations; some combination of
laboratory tests snufll as CEA tests, liver-function tests,
complete blood counts, and fecal occult blood tests (FOBT);
diagnostic imaging studies such as chest radiography,
ultrasonography, CT, magnetic resonance imaging, and barium
enema; and endoscopic procedures such as sigmoidoscopy and
colonoscopy. There are potentially thousands of jpossible
combinations of frequency and diversity of these
surveillance tests (Kieveit J 1995). Different
recommendations of follow-up protocols has been formulated
but no consensus has been reached (Vernava A 1994; Kjeldsen
B.J} 1997; .Audisio ER 1996; Schoemaker I) 1998; Anthony 'T

2000; (3 Desch 1999; (3 Desch 2000). NCCN has cmtlined the

27

surveillance guidelines for patients with resected stage II
and III CRC. Among patients who have undergone resection
for localized CRC disease, the five-year survival rate is
90 percent; the rate decreases to 65 percent when
metastasis to regional lymph nodes is present (Jemal A
2003). Depending on the location, CRC tumors commonly
metastasize to the liver, local sites, abdomen, and lungs

(Figueredo A 2003).

RAS Family

A mammalian cell contains at least three distinct ras
proto-oncogenes: v—Ha-ras Harvey rat sarcoma viral oncogene
homolog (H-ras), K-ras, and neuroblastoma RAS viral (v-ras)
oncogene homolog (N-ras) (Lowy D.R. 1993). H-ras and K-ras
were first identified as viral (v-Ras) oncoproteins of
Harvey and Kirsten murine sarcoma viruses, and were found
to be capable of cellular transformation. The N-ras
oncoprotein was identified in a neuroblastoma cell line.
The human genomic DNA sequences spread over 6.6 kb (H-ras),
8 kb (N-ras), and 35 kb (K-ras) and are located in
chromosomes 11p15.5, 1p13, 12p12.1 respectively (Ref.
Website: Infobiogen). The K-ras gene is alternatively
spliced into two isoforms: K-rasA and K-rasB (Pells S

1997). Other member of the Ras family genes are M-ras, R-

28

ras, Rap 1/2 and Ral that share at least 50% sequence
identity.

H-, K-, and. N-ras have similar structure and
sequences, with four coding exons, and conserved splicing
sites, even if the introns have various dimensions and
sequences. The protein product of the ras gene is a closely
related monomeric G protein of approximately 21 kD in size,
containing 189 (H-ras, K-rasB, and N-ras) or 188 (K—rasA)
amino acids. The Ras gene protein is able to bind and
hydrolyze guanosine triphosphate (GTP). These 1%“; GTPases
are essential mediators in signaling pathways that convey
extracellular signals from surface receptors to the
interior of the cell, functioning as molecular switches in
processes governing cell proliferation, survival, and
differentiation (Malumbres M 1998; Crespo P 2000). The
three genes are ubiquitously expressed although mRNA
analysis suggests different tissue expression levels (Leon
J 1987). Variation in the expression pattern also exists
throughout embryonic development (Leon (I 1987) and during
differentiation processes (Crespo P 2000). The H-ras is
highly expressed in the skin and ixl‘Ume skeletal muscles;
K-ras is mostly expressed in the colon and thymus, and N-
ras in the male germinal tissue and the thymus suggesting

that ras family members probably are expressed in a tissue

29

specific fashion (Lowy D.R. 1993). In support to this
hypothesis, mutations in each one of these genes,
frequently found in various types of tumors, are involved
in the development of specific neoplasia, such as mutation
of K-ras in lung, colorectal, and pancreas tumors, H-ras in
bladder, kidney and thyroid tumors, and N-ras in melanoma,
hepatocellular carcinoma, hematological malignancies, and
neuroblastoma (Fujita LI 1984; Visvanathan I<Jl. 1988; B03

J.L. 1989; B03 J.L. 1987; Hesketh R 1995).

Functional Roles of RAS Proteins in Cancer

Various literature reviews, on the RAS genes and
functions, are proposed to contribute to genesis and
progression of several tumor types (Bollag G 1991; Macaluso
M 2002; McCormick F 1999; 805 J.L. 1987; Barbacid M 1987).
RAS proteins in mammalian cells are located (N1 the inner
plasma membrane layer and may be activated [Guanine
triphosphate (GTP)-bound status) or inactivated [Guanine
diphosphate(GDP)-bound status] by extracellular
physiological stimuli or signals (i.e. growth factors,
cytokines, and adhesion signals) via specific cell surface
receptors. Activation of RAS is obtained by means of
several guanine exchange factors (GEFs) able 113 induce a

RAS protein conformational change leading to GDP

30

dissociation. Ihi physiological conditions, several GTPase
activating proteins (GAPs) inactivate the RAS protein after
short time by inducing GTP hydrolysis and setting the
formation of the RAS/GDP inactive complex. Specific growth
factors (i.e. epidermal growth factor and platelet derived
growth factor) interacting with their receptor tyrosine
kinases induce receptor autophosphorylation on specific
tyrosine residues. Subsequently, adaptor proteins, like the
Growth factor Receptor-Bound protein 2, interact with
receptor phosphorylated tyrosines by their SH2 domains and
bind to RAS/GEES by the SH3 domain (Bollag G 1991; Macaluso
M 2002; McCormick F 1999; B08 J.L. 1987; Barbacid M 1987).
RAS activation by specific stimuli and specific GEFs
promote different RAS functions via several transduction

pathways including RAS/RAF, RAS/PI3-K and RAS/RAL.

K-ras Gene and CRC

The K-ras (Kirsten-rat sarcoma) gene, located on the
short arm of chromosome 12, encodes a 21 kD protein (p21ms)
which is able to bind and hydrolyze GTP. The protein acts
as a mediator in the transduction of extracellular signals
to the cytoplasm and nucleus. Mutations in K-ras, most
commonly at codons 12, 13, and 61 (B05 J.L. 1989), lead to

the formation of constitutively active (GTP-bound)

31

proteins, which trigger the transduction of proliferative
and/or differentiative signals even in the absence of
extracellular stimuli (Boguski M.S. 1993). In human
cancers, the most common mutations are found at codon 12.
For example, 90% of human pancreatic cancers, 50% of colon
cancers, and more than 30% of smoking-related lung cancers
have a mutation at codon 12 of the K-ras gene (Bos J.L.
1989; Rodenhuis S 1992; Slebos R.J. 1991).

In CRC, the K-ras oncogenes has been found mutated in
10-15% of the screened adenomas <1 cm, in 30-60% of
adenomas >1 cm, and also, in 50% of the adenocarcinomas
(Bos J.L. 1989; Kressner U 1998; Fearon E.R. 1990). The
most frequently mutated position in sporadic and familial
adenomatous polyposis (FAP) - associated colorectal tumors
is codon 12 (B05 J.L. 1989). Because these mutations are
acquired early in tumor development (Vogelstein B 1988),
and remain through out the process of tumorigenesis,
detection of the mutated K-ras in DNA of patients may
improve early detection in combination with other screening
methods, allowing removal of even small polyps. Testing
for mutated K-ras during follow-up after resection from
colorectal cancer may provide new tools for detection of
recurrence or second primary tumors. Recent evidence

implies that tumors with mutated K-ras do not respond to

32

EGFR [epidermal growth factor receptor (erythroblastic
leukemia viral (v-erb-b) oncogene homolog, avian)]
inhibitors (Van Cutsem 2008; Bokemeyer C 2008; Amado R
2008) and thus may serve to identify appropriate treatments
or tn) avoid ineffective treatments, and tflnns may increase

survival.

Presence and Detection of DNA from Serum/Plasma

During apoptosis (programmed cell death), cellular
components are dismantled and usually phagocytosed by the
macrophages or rmdghboring cells. During the early stages
of apoptosis, nuclear [HUI is degraded 1J1 nucleosomes and
their oligomers (Wyllie A.H. 1980). Taking into account
that in human adults approximately 1011 cells die daily, the
amount of released DNA should be approximately 0.6 gram/day
(g/day) (Lichtenstein AJV. 2001). However, some chromatin
(DNA) degradation products are further degraded into acid-
soluble products and are reutilized. within an organism,
whereas others escape phagocytosis and appear in the blood-
stream. Circulating DNA has been detected in serum and
plasma of both healthy and diseased individuals (Anker P
2001). DNA levels III the tflood-stremn presumably reflect
the amount (n3 cell death occurring in time whole body and

are increased during destructive pathological processes,

33

including cancer and during pregnancy (Chiu R.E. 2004). It
has been shown that the serum contains cell-free
circulating fragmented DNA iritflue size of nucleosomal DNA
(Jahr S 2001). DNA with a cancer “signature” (mutation or
hypermethylation) has been found in the plasma or serum of
patients with small cell lung cancer (Chen X.Q. 1996), head
and neck cancer (Nawroz ii 1996), clear cell renal cancer
(Goessl C 1998), pancreatic cancer (Mulcahy H.E. 1998),
breast cancer (Chen. X.Q. 1998), hepatocellular carcinoma
(Wong IHN 1999), non-small. cell lung cancer (Esteller M
1999), and colorectal carcinoma (Kopreski M 1997). It has
also been demonstrated that the mutation found in tumor
tissue is the same identical mutations found in plasma or
serum of respective patients (Chex X.Q. 1996). The
appearance of DNA in plasma from cells dying in a body was
also shown by detection of fetus-specific sequences in the
plasma of pregnant women (Lo Y.M. 1997; Bischoff F.Z.

1999).

Detection of DNA from Urine

Experiments on animals demonstrated that DNA fragments
of several hundreds base pairs originating from apoptotic
cells can cross the renal barrier and preserve their matrix

functions. in PCR (Polymerase Chain. Reaction) (Botezatu I

34

2000). This conclushmu was extrapolated IX) humans, as ii;
was possible to identify sequences filtered from the blood-
stream. through the kidney' barrier into ‘urinary’ DNA“ The
possibilities that there are two type of DNA. in ‘urine:
excreted DNA, originating from cells dying in various
tissues of an organism and second, locally degraded DNA,
originating from cells dying 1J1 the urinary tract itself.
For example, sequences specific for masculine Y chromosome
were detected in urine of women after blood transfusion
from male donors and in pregnant women with male fetuses
(Botezatu I.V. 2000). Earlier studies demonstrated the
possibility of PCR analysis of urinary DNA for diagnosis
and monitoring of tumor growth (Su Y.H. 2004). The
advantages of detecting mutant sequences in urinary DNA
over the analysis of plasma or serum DNA are obvious: it is
noninvasive, DNA can be isolated from greater volumes of
initial material and is easier to isolate due to low
concentration of total proteins (1000-fold lower" protein

content).

35

OBJECTIVES

The main objective of this research was to develop and
validate a method to identify and quantify mutant K-ras in
biological specimen. The specific objectives of this
research are:

> Isolation of DNA
. Isolation of low molecular DNA from urine sample
0 Isolation of High molecular DNA from SW480 cell
line and Peripheral Blood Leucocytes
> Adaptation of qualitative method for the detection of
mutant K-ras sequences
> Identification of the lowest concentration of mutant

K-ras that can be detected qualitatively using RE-PCR

and gel electrophoresis by serially diluting mutant K-

ras with wild-type K-ras

> Develop and validate a method to quantitate mutant K-
ras using a Capillary Electrophoresis
0 Design an anti-sense fluorescent primer to

quantify mutant K-ras using fluorescence

36

METHODS

37

All the materials and equipment mentioned in this

section are listed in the appendix.

)‘9 Preparation of Samples

. Positive Control

Genomic DNA from SW480 cell line (American Type
Culture Collection (ATCC)) possessing ea mutation 1J1 codon
12 of the K-ras proto-oncogene was used as a positive
control.

SW480 cell line cells were obtained in suspension. The
suspension was thawed at 37°C in a water—bath (Precision
Water Bath) for approximately 5 minutes. The suspension was
then centrifuged for 5 minutes at 300 x gravity (g) in a
1.5 mL microcentrifuge tube and the supernatant was removed
and discarded. The cell pellet was resuspended in PBS
(Phosphate Buffered Saline), pH 7.4 to a final volume of
200 uL. The isolation was carried out using the method

described below.

0 Negative Control

Genomic DNA from Peripheral Blood Leucocytes (PBLs)

was used as a negative control for K-ras codon 12.

38

The whole blood was collected in ACD (Acid Citrate
Dextrose), yellow-top tube. The tube was centrifuged at 655
x g tin: 10 minutes, and 200 in; of buffy coat (leucocytes)

was used for DNA isolation as described below.

0 Serial Dilution of Positive and Negative Controls to
Identify Sensitivity of the method to Detect R-ras
The serial dilution assay was performed by diluting
SW480 cell line (100% mutant) used as positive control with
PBLs (100% wild-type) used as negative control. The
dilution range for SW480 cell line was 100, 75, 50, 25, 10,
5, 1, 0.5, 0.25, 0.1, 0.05, 0.02, 0.01, and 0.002%. The RE-
PCR was performed (discussed in the sections to follow) on
all dilution samples, negative» control (PBLs, 100% wild-
type), and blank control of PCR” 11 12% PAGE was performed
(discussed in the sections to follow) after RE-PCR. The

procedure is performed in triplicate.

o Urine Sample

0 urine Collection
Twenty five 11) fifty mulliliter nmn of fresh urine
was collected (the first void of the day was not used) in a

sterile container and immediately' mixed with appropriate

39

volume of 0.5 mole per Liter (M) EDTA
(Ethylenediaminetetraacetic acid), pH 8.0 to achieve a
final EDTA concentration of 10 millimole per Liter (mM).
This concentration of EDTA is known to inhibit nuclease
activity (Milde A 1999). Urine samples were stored in 15 mL
conical polypropylene screw cap tubes in 10 ml aliquots at
-70 °C (degree centigrade). The tubes were thawed and
centrifuged (Sorvall TC6 tabletop centrifuge) at 200 x g
for 5 minutes and placed on ice before isolation. The urine

samples were obtained from a volunteer.

Ability of Urine Isolation Method to Detect Low Molecular
NeightZMutant K-ras Sequences

To evaluate the ability of the method to detect K-ras
in urine sample and to determine the sensitivity of the
method following samples were prepared: Eight 10 mL
aliquots of same urine sample, negative for mutant K-ras
were thawed. A different amount (80 uL, 15 uL, 5 uL, 1 uL,
0.1 uL, 0.01 (mg and 0.001 tun of SW480 cell line first
round PCR (discussed in the sections to follow) products
were added tx> the seven of time eight urine sample tubes.
The tubes were mixed and centrifuged at 200 x g for 5

minutes and placed on ice.

40

'> DN3.Isolation of Samples

0 Positive and Negative Controls

®

The QIAamp DNA Mini Kit, designed to isolate high

molecular weight DNA, was used to obtain genomic DNA from
PBLs and SW480.

Twenty micro—liter of QIAGEN protease (provided with
kit) and 200 in; buffer AL U1 cell lysis buffer, provided
with kit) was added to 200 uL of cells or buffy coat. The
tube was 'vortexed (Vortexer, Type 16700 Mixture) for 15
seconds, centrifuged, and the mixture then was incubated at
56°C (Precision Water bath-micro) for' 10 minutes. After
incubation, the tube was centrifuged, and precipitation of
DNA was achieved by adding 200 uL of ethanol and vortexing
the tube for 15 seconds. Tube was then centrifuged and the
mixture was transferred to the QIAamp spin column (in a 2
mL collection tube, provided with kit) and centrifuged at
9295 x g for 1 minute. The column was placed in a new clean
2 mL collection tube, 500 uL of wash buffer AWl (provided
with kit) was added to the column and centrifuged at 9295 x
g for 1 minute. The column was placed in a new clean 2 mL
collection tube, 500 In; of wash buffer AW2 (provided with

kit) was added to the column and centrifuged at 9295 x g

41

for 3 minutes. The column was placed in a clean 1.5 mL UV-
treated (90 seconds at 254 nm) (GS Gene Linker UV chamber)
microcentrifuge tube and 200 uL of buffer AE (elution
buffer, provided. with kit) was added. to the column and
allowed to incubate for 5 min at room temperature. The DNA
was collected by centrifugation at 9295 x g for 1 minute.
The GeneQuant RNA/DNA Calculator was used to measure
the optical density at 260nm. Five micro-liter of DNA was
diluted to 200 (H; with sterile deionized distilled water.
The protein contamination, purity, and 260nm/280nm ratio
were also recorded. The cancentratbmn of double stranded,
high molecular weight DNA was calculated using equation 1.
The DNA samples from SW480 cell line and PBLs were stored

at —20°C until further use.

0 ‘Urine Sample

Fragmented DNA that appears in urine due to apoptosis
has low lmolecular' weight than. the high imolecular‘ weight
genomic DNA from the positive and negative controls.
Therefore, a different method was used to isolate
fragmented DNA in urine than the isolation method used for
positive and negative control mentioned in the following
sections. DNA was isolated as described previously (Botezatu

I 2000; Ying—Hsirl Su 2004) with some lmodifications. The

42

changes to the original method were obtained via personal
communication with Samuil Umansky (Xenomics, Inc.). The
isolation method is described below.

A. 20 mu; of 6 b4 GITC (Guanidine Isothiocyanate) was
added t1) 10 mfll of urine i11 a 50 Hui conical polypropylene

screw cap tube and mixed vigorously; One mL of resin
(Wizard® Pius Minipreps DNA Purification System) was added

and the tube was incubated for 4 hours at room temperature
with gentle mixing. The resin was pelleted by
centrifugation at 200 )(i; for 10 mdnutes. The supernatant
was carefully aspirated and discarded. The resin pellet was
resuspended in 1 mL of 4 M GITC, and transferred into a 1.5

mL microcentrifuge tube. The tube was centrifuged in a
microcentrifuge (Sorvall Biofuge® Pico) at 9295 x g for 1

minute. The supernatant was removed and discarded. The

pellet was resuspended in 1 mL of column wash buffer

(Wizard®

Plus Minipreps DNA Purification System) and
suspension was transferred 11) a Promega Wizard mdnicolumn

(Wizard® Plus Minipreps DNA Purification System). The DNA

was separated from the suspension by applying vacuum. The
column was washed with. 2 'mL of column wash buffer. To
remove residual washing buffer from the column, the column-

tube assembly was centrifuged in a mdcrocentrifuge at 9295

43

x g for 3 minutes. The column was placed in a clean 1.5 mL
UV-treated (90 seconds tat 254 :nanometer (nmn)
microcentrifuge tube and 100 microliter (uL) of sterile
deionized distilled water was added to the column and
allowed to incubate for 5 min at room temperature. The DNA
was collected by centrifugation at 9295 x g for 1 minute.
The GeneQuant RNA/DNA Calculator was used to measure
the optical density at 260 nm. Fifty microliter of DNA was
diluted to 200 (n; with sterile deionized distilled water.
The protein contamination, purity, and 260nm/280nm ratio
were also recorded. The concentration of double stranded
DNA (dsDNA) was calculated using formula mentioned in
Figure 1. The DNA samples were stored at -20°C until

further use.

 

 

Formula for Double stranded DNA

 

DNA ug/uL = [ODum* X 50(ug/mL) X DF** X l mL)]+ 1000 uL

*ODmm = Optical density at 260 nm

**DF = Dilution factor

An optical density at 260nm of 1.0 corresponds to 50ug of
DNA per mL for dsDNA.

 

Figure 1. Formula for the Calculation of DNA Concentration.

44

 

> Primer Preparation

Two primer sets were used for the Polymerase Chain
Reaction (PCR). The sense and antisense primers of primer
set I and sense primer of primer set II were published
sequences (Su YH 2004). The antisense primer in primer set
11 was developed specifically for this research project.
The antisense primer in the primer set II was labeled with
6-FAM (6-carboxyl fluorescein) at 5’ end. Incorporation of
6-carboxyl fluorescein. imparted. the fluorescence jproperty
needed in the detection and quantification of K-ras using

the capillary electrophoresis. Capillary electrophoresis

was performed using ABI PRISM® 310 Genetic Analyzer.

Primers were synthesized. at time Macromolecular Structure
Facility at Michigan State University. The primer sequences
of both the primer sets are listed in Table 4. The primers
were dried under vacuum.ijlaa SpeedVac SC100 system. Dried
primers were reconstituted in (Kmarm; of sterile deionized

distilled water and stored at -20°C.

45

Table 4. PCR Primers.

 

Primer Set I

 

Sense* GCTCTTCGTGGTGTGGTGTCCATATAAACTTGTGGTAGTTGGACCT

 

Antisense* CKTCTTCGTGGTGTGGTGTCCCGTCCACAAAATGATTCTGA

 

 

Primer Set II

 

Sense* ACTGAATATAAACTTGTGGTAGTTGGACCT

 

 

Antisense* is*6'FAMCTGAAGTCCACAAAATGATTCTGAATTAGC

 

 

*The primer sequence is in 5’ to 3' form.

** The antisense primer 1J1 the primer set IKE was labeled
with 6—FAM (6-carboxyl fluorescein) at 5’ end.

)> Restriction-Enriched Polymerase Chain Reaction (RE-PCR)
K-ras mutation was detected irlea two-stage PCR assay
using selective restriction enzyme digestion of an
artificially created recognition site t1) distinguiSh wild-
type and. mutant K-ras sequences. Mutant K-ras sequences

were enriched by RE-PCR.

o First-stage PCR
PCR amplification was completed in 0.2 mL thin walled

reaction tube with a total volume of 50 (AL. A master mix

46

 

containing all the PCR reagents except for the DNA template
was prepared. The reaction mixture includes 1X GeneAmp PCR
Buffer, 1.25 Units of AmpliTaq Gold DNA polymerase, 200 uM
of each <1f the deoxyadenosine triphosphate (dATP),
deoxycytosine triphosphate (dCTP), deoxyguanosine
triphosphate (dGTP), deoxythymine triphosphate (dTTP), and
0.9 in; of each of time sense and antisense primers (primer
set I, Table 1). For positive and negative controls, DNA
templates for SW480 or PBLs at a concentration of 0.1 pg
were added. For urine samples the amount of DNA present in
0.2 mL of urine was used as DNA template. Also, a blank was
included in each PCR assay, which contained only sterile
deionized distilled water instead of DNA template. In each
case the final volume of 50 (AL was adjusted with sterile
deionized distilled water.

Hot start (Perkin Elmer) PCR method was used to

produce higher yields of specific PCR amplified products.

PCR amplification was performed with the GeneAmp® PCR

System 9700 with an initial incubation at 95°C for 15
minutes. Followed by 15 cycles, each cycle included
following steps; a) denaturation at 94°C for 48 seconds, b)
annealing at 56°C for 90 seconds, and c) extension at 72°C
for 2 minutes. A final extension, 72°C for 5 mdnutes, was

done to ensure complete amplification of PCR products with

47

a 4°C temperature hold if the PCR product was to remain in
the thermal cycler. These first 15 cycles of PCR amplified
both wild-type and mutated DNA and introduced an artificial
BstNI site to the 5' end of amplified product derived from

wild-type K-ras sequences.

0 First-round of BstNI Digestion
The restriction endonuclease enzyme, BstNI [sourcez
Bacillus stearothermophilus N (D. Comb)], was used to
digest artificially created recognition site :hi wild-type
K-ras sequences.

After the first-stage PCR, the amplified products were
digested with BstNI restriction endonuclease enzyme to
eliminate amplified products derived from wild-type K-ras
sequences. The mixture of 10 uL of first-stage PCR product,
10 Units of BstNI enzyme, and 1X NEBuffer 2 in a total
volume of 20 uL (adjusted with sterile deionized distilled

water), was incubated at 60°C for 3 hours.

0 Second-stage PCR
PCR amplification was completed in 0.2 ml thin walled
reaction tube with a total volume of 50 uL. A master mix
containing all the PCR reagents except for the DNA template

was prepared. The reaction mixture includes 1X GeneAmp PCR

48

Buffer, 1.25 Units of AmpliTaq Gold DNA polymerase, 200 uM
of each of dATP, dCTP, dGTP, and dTTP, and Eilfl; of sense
and 7.5 uL of antisense primers (primer set II, Table 1).
One micro-liter of the first-round of BstNI products was
added as DNA template for second-stage PCR. The final
volume of 50 uL was adjusted with sterile deionized
distilled water.

Hot start PCR method was used and PCR amplification
was performed with the GeneAmp® PCR System 9700 with an

initial incubation at 95°C for 15 munutes. Followed by 35
cycles, each cycle included following steps; a)
denaturation at 94°C for 48 seconds, b) annealing at 56°C
for 90 seconds, and c) extension at 72°C for 2 munutes. A
final extension, 72°C for 5 minutes, was done to ensure
complete amplification of PCR products with a 4°C
temperature hold if the PCR product was to remain in the

thermal cycler.

o Second-round of BstNI Digestion
10 uL of second-stage PCR product, 1 X NEBuffer 2, 10
Units of BstNI enzyme, and 16 uL of sterile distilled water

were mixed and incubated at 60°C water-bath for 5 hours.

49

S> Polyacrylamide Gel Electrophoresis (PAGE)

The final BstNI digestion products were separated by

®

electrophoresis using a Mini-PROTEAN II Cell

electrophoresis chamber eumi a Model 1000/500 Power Supply.
A 12% polyacrylamide gel (19:1 acrylamide to bisacrylamide
ratio, 1X TAE) with the dimensions of 75 mm x 85 mm x 0.75
Imn was used. A 10 in; of final BstNI digested product was
mixed with 2 in; of 5X nucleic acid sample loading buffer
and loaded on the gel along with one lane of molecular
weight marker which contained 50-500 bps DNA fragments. The

samples were electrophoresed at 150 volts for 1 hour.

I> Detection of Bands of DNA Fragments (Qualitative Method)
Ethidium bromide dye was used to stain DNA fragments.
One drop of ethidium bromide (10 milligram per milliliter
(mg/mL)) was diluted in at least 500 mL of water. The gel
was placed into diluted ethidium bromide solution and
incubated with gentle rotation (American Rotator V) at room
temperature for about 10 minutes. The gel was washed thrice
with water to remove excess stain on the gel. DNA bands
were 'visualized. using' Chromato-Vue Transilluminator Imodel

TS-36 at the wavelength of 254 nm. The gels were

photographed with type 667 black and white Polarohfa film

50

using a Fotodyne FCR-lO camera. Film was exposed to gel
with UV light for one second at f=8 and allowed to develop

for one minute.

> Quantitation of Mutant R-ras Sequences using Capillary
Electrophoresis

DNA fragments after the second-round of BstNI enzyme

digestion were used for K-ras quantitation. The

quantification of mutant K-ras sequences was done by

capillary electrophoresis using ABI PRISM® 310 Genetic

Analyzer. The combination of the DS-30 dye set and virtual

filter set D was used for analysis of all samples.

0 Matrix File Preparation

The matrix file contains the information necessary for
software to correct the spectral overlap of the dyes in the
virtual filter set. The matrix file was generated from a
separate matrix standards run, and contains information
about how much of the collected light falling on a filter
is due to the intended light emission and how much is
contaminating light.

To generate matrix file, a matrix standard set (DS-30)

was used which contains 6-FAM (6-carboxyfluoresein), HEX

51

(4, 7, 2’, 4’, 5', 7’,-Hexachloro-6-carboxyfluorescein),
ROX (6-Carboxy-X-rhodamine,), and. NED (Applied. Biosystems
Proprietary) fluorescent dyes. Each fluorescent dye emits a
continuous spectrum of light upon laser excitation. The
matrix standards preparation and the electrophoresis on the
ABI PRISM 310 Genetic Analyzer occurred as follows: 2 uL of
each of the matrix dyes (6-FAM, HEX, NED, and ROX) was
added to 24 uL of deionized formamide in MicroAmp 0.2 mL
sample tubes. The mixture was mixed by vortexing and
centrifuging for 5 seconds, denatured (DNA Thermal Cycler)
at 95°C for 5 minutes and chilled on ice for 5 minutes. The
matrix standards were injected ill the capillary by
electrokinetic injection for 53 seconds and electrophoresed
at 15 kilo Volt (kV) for 24 minutes in Performance
Optimized Polymer (POP-4“”jpolymer) with 51 run temperature

of 60°C. The matrix standard run data were collected using

®

the .ABI PRISM 310 data collection software ‘v3.0.0. The

data collection software generated the sample file of each

matrix standard. The sample files of each matrix standard

were used to create a matrix file using ABI PRISM®

GeneScan® Analysis Software v3.7 as described in the user’s

manual (Ref. Applied Biosystems).

52

0) Preparation and Capillary Electrophoresis of K-ras DNA
Fragment Samples

The DNA fragments from the second—round of BstNI

digestion were diluted appropriately with deionized

distilled water. The appropriate amount of diluted sample

®

and 0.5 uL of GeneScannt350 ROX internal lane size

standard (vortexed and centrifuged for 5 seconds) were
added to 12 (AL of deionized formamide in MicroAmp 0.2 mL
sample tube. The mixture was vortexed and centrifuged for 5
seconds, denatured at 95°C for 5 minutes and chilled on ice
for 55 minutes. Samples were injected 1J1 a capillary' by
electrokinetic injectbmn for 5 seconds and electrophoresed
at 15 kilo Volt (kV) for 24 minutes in Performance

Optimized Polymer (POP-4TM polymer) with.aa run temperature

®

of 60°C. The data were collected using the ABI PRISM 310

data collection software application v3.0.0. The sample
file for appropriate sample was created by data collection

software.

> Data Analysis

The electrophoresis results were analyzed ‘using .ABI
PRISM® GeneScan® Analysis Software v3.7. The analysis

parameters for data processing are described in Table 5.

53

The peaks were interpreted when greater than or equal to 50
relative fluorescence units (RFUs). The matrix file was
applied to the samples before analyzing the data” The
GS350-250 size standard parameter was used for size calling
of DNA fragments. Size calling, peak height, and peak area

of samples were determined.

Table 5. Analysis Parameters

 

 

 

Analysis Parameters values
Analysis range 2500 to 4000 Data points
Size Call range 35 to 150 base pairs

 

Data Processing :Smooth options None

 

Size Calling method Local Southern Method

 

Peak Detection:
(3 Peak Amplitude Thresholds:

 

 

B 50
Y 50
(3 50
R 50
(3 Minimum Point Half Width 2 Points
<3 Polynominal Degree 3
C) Peak Window Size 15 Points
c> Slope Threshold for Peak 0.0
Start
0 Slope Threshold for Peak 0.0
end
Baselining:
BaseLine Window Size 51 Points

 

 

 

Quantitation of Mutant K—ras Sequences in Serial Dilution

Assay

54

o Intra-sample variability
The second BstNI digestion products of RE—PCR from the
serial dilution assay (described earlier) were taken to
perform the quantitative analysis of mutant K-ras sequences
using capillary electrophoresis as described above. The
procedure was performed using the same sample three times

to determine the intra-sample variability.

o Inter-sample variability
The second BstNI digestion products of RE-PCR from the
serial dilution assay ens described earlier were taken to
perform the quantitative analysis of mutant K-ras sequences
using capillary electrophoresis as described above. The
procedure was performed in triplicate; three different
sample sets were prepared. to determine the inter-sample

variability.

55

RESULTS

56

DNA Isolation from Positive and.Negative Controls

The concentration of DNA isolated from SW480 cell line
(positive control), PBLs (negative control), and urine is
shown in Table 6. The optical density at 260nm and 280 nm
measured using spectrophotometer and 260nmz280nm ratio was

calculated.

Table 6. DNA Concentration in SN480 cell-line and PBLs

 

 

 

 

 

on at on at Ratio conc.:::iti°
260 nm 280 nm 260 nut/280 nm . n
In nqlnL
SW480.Cell‘ 0.059 0.031 1.879 0.118
line
PBLs 0.160 0.085 1.892 0.320
Urine 0.038 0.021 1.815 0.0076

 

 

 

 

 

Detection of R-ras Sequences after RE-PCR and Gel
Electrophoresis (Qualitative Method)

The SW480 cell line (positive control), PBLs (negative
control), and normal urine negative for mutant K-ras were
amplified by RE-PCR as described in materials and 10 uL was

electrophoresed on a 12% PAGE as described previously.

57

 

o First-stage PCR and First- round of BstNI Digestion
The results (n? gel electrophoresis following first-

stage PCR and first-round of BstNI digestion are shown in

Figure 2.

 

Figure 2. A gel photograph after first-stage PCR and first-
round of BstNI digestion.

Well 1 — molecular ruler (50-500 bps)

Wells 2, 4, and 6 — First PCR products of SW480, PBLs, and

normal urine negative for mutant K-ras sequences,

respectively (125 bps)

Wells 3, 5, and 7 — SW480, PBLs, and normal urine negative

for mutant K-ras, respectively, after first-stage PCR

followed by first round of BstNI digestion

Well 8 - negative control for PCR (water, no DNA)

The first-stage PCR amplifies both mutant and wild-
type K-ras sequences; the amplified fragment size was 125
bps. The BstNI digestion cut the amplified wild-type K-ras

sequences in 85 and 40 bps fragments.

58

o Second-stage PCR and Second-round of BstNI Digestion
The results of gel electrophoresis following second-
stage PCR and second-round of BstNI digestion are shown in

Figure 3.

Wells: 1 2 3 4 5 6 7 8

<—-30 bps

 

Figure 3. A photograph of gel electrophoresis after second-
stage PCR and second-round of BstNI digestion.

Well 1 - molecular ruler (50-500 bps)

Wells 2, 4, and 6 - second PCR products of SW480, PBLs, and

normal urine negative for mutant K-ras sequences,

respectively (92 bps)

Wells 3, 5, and 7 — K-ras fragments after second BstNI

digestion of SW480 (92 bps), PBLs (62 and 30 bps), and

normal urine negative for mutant K-ras (62 and 30 bps),

respectively

Well 8 - negative control for PCR (water, no DNA)

The fragment sizes of amplified products after second-
stage PCR were 92 bps. The second-round of BstNI digestion
cut the amplified wild-type K-ras sequences into 62 and 30

bps fragments.

59

Ability of Urine Isolation Method to Detect Low Molecular

weight Mutant K-ras Sequences

Gel electrophoresis data for the isolation of 125 bps
fragments of SW480 cell line first-stage PCR by urine

isolation method and RE-PCR is shown in Figure 4.

6O

Amzo 0c noumzv mum you Honucoo obflpmmmc I m Ham:

.>Ho>auomamon mucmfimmum man mNH man goes:

monsoone mom momomupmuno mans demo omezm no as Hoo.o new .4: Ho.o .q: H.o .q: H .4: m .q:
me can om cue: ooxHE moan: HmEuoc Eon“ UoDMHOmH mzo mum me can .NH .HH .OH .> .m .m maamz
manlx Denyse now o>apmmoc moans Hmfinoc v Hams

meme m cam m maamz

mafia Haoo owvzm N Haw:

Amen oomuomv Hesse Hassomsos A name

.momlnm Hound edeouosmouuUOHo HOD Ho nmiumouonm GAB .v OHSUHH

man om.|v

 

won Noile - .r#:»

mob mmlv. all I I} l} .

MH NH HH OH m m b o m v m N H "maamz

61

Serial Dilution Assay

o Qualitative Analysis of Mutant R-ras Sequences
The serial dilution assay was performed to determine
the sensitivity of RE—PCR method by diluting SW480 cell
line (positive control) with PBLs (negative control) to
obtain different mutant K-ras concentration as described
previously. The gel photograph was obtained after 12% PAGE

followed by RE-PCR as showed in Figure 5.

62

moocmsomm NH coooo mmnIx How momuloaaz moofi on oonnomou mqmm

moocosomm NH coooo mmuIM How accuse wooa ou commemon omvzm

Amzo oc noumzv mom mo Houucoo o>aumooz I m

Ammo oomlomv menme Danae: amasooaofi I 232

.noam was can monies uouua manna coauuaao Hanna» mo smiuuouonm Hoe ¢_.m masons

man om

o n .. .aitl ail.ellpumxllei}_rtis use» 4

m o No . . . . .

man Nm IIV.. .. . I... .. 33?. 3:1... 35.5 13.91 } 3 i. I! _ . If...

A

 

-15.... fl... 5... a: ... .
232 name omvzm Noo.o Ho.o No.0 mo.o To mN.o m m.o H m 0H mN om me 232
a a fl. l\ {II .I\

 

 

.I..._ . ...

 

lJ\I .l/\II
pawns: w
as .33 z woes Damon: M.

63

0 Quantitative Analysis of Mutant K-ras Sequences in
Serial Dilution Assay

Quantitative analysis of the mutant K-ras was

®

performed using ABI PRISM GeneScan Analysis software. The

capillary electrophoresis followed by RE-PCR was performed

as described earlier in serial dilution assay. Figures 6-8
show the fragment analysis by ABI PRISM® GeneScan Analysis

software \7 3.7. Y-axis indicated fluorescence intensity,

while the X-axis indicated base pair size.

64

FBMWWWWB‘

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

_1 5 U ‘ 7 5 ‘ A 1 0 0 T
:3 _,.-'--.E A .-"‘-. :"f‘ '. 1 O O % M
".2 If g. , - 1 ;;L
E; 7 5 % M
a: 5 O % M
- I

.__ 1 _ _ 1
:1: 2 5 % M
= 1 0 % M

   
    

MMIIH~174flM II .E‘Culfll

 

Internal size standard (size in nucleotides)
I ) Primer peak

Wild—type K-ras sequences peak

 

 

[:1 Mutant K-ras sequences peak

 

Figure 6. A fragment analysis picture of 100%, 75%, 50%,
25%, and 10% mutant K-ras sequences. .All the
peaks in different serial dilution samples were
aligned by fragment size.

65

INCH-IF,“ ""3"“ I'“ “id-3’1 £4.0mM-h‘e". dot a III-'1‘ M. Mewm.wwuenws “ ‘-"' 'fi "'" “ " ' "‘ :1“ .- . —“ T ' '2' X]

Efl-I‘Edl Bond Sarah's” Y- undo- flab

 

A A

 

I

 

5%M

1%M

0.5% M

0.1% M

 

 

‘mlgmoummse— lac-fienn-woj .i a: "38m
5) Internal Size standard (Size in nucleotides)

ee
F

\ J

I

\

 

0
CI

Primer peak

Wild-type K-ras sequences peak

 

Mutant K-ras sequences peak

 

Figure 7. A. fragment analysis picture of 5%, 1%, 0.5%,

0.25%, and 0.1% mutant K—ras sequences. All the
peaks in different serial dilution samples were
aligned.by fragment size.

66

anwmmw—mu Ally

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

uni 50 75 100

.... 3"": .-""'-"2 5’7"; 0 - O 5 % M
'- 1 ,v'l‘. I I“). ,Il‘.

III-i ’ O . 02 % M
-: fl fo A A

a: ‘_ 1“] .1

~3 OJH% M

u ‘ lfii if“. A

’2 3 l 0 . 0 0 2 95 M

“:3 I [I _ l
- J;

--. . ___, J:
III-II EINUDUAMS‘R- "Sway-p.11 4 .2: 11:49AM

 

Internal size standard (size in nucleotides)
I ) Primer peak

Wild-type K-ras sequences peak

 

 

D Mutant K-ras sequences peak

 

Figure 8..A fragment analysis picture of 0.05%, 0.02%,
0.01%, and 0.002% mutant R-ras sequences. All the
peaks in different serial dilution samples were
aligned by fragment size.

(3 Intra-sample variability
The capillary electrophoresis followed by RE-PCR was
performed as described earlier in serial dilution assay. To
determine the intra-sample variability of analytical method,
each % mutant sample was analyzed in triplicate and peak

area was obtained as shown in Table 7. Figure 9 shows the

data range that provided the best linear relationship

67

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

between log % mutant vs. log mean area. Data on log mutant
and log mean area are shown in Table 8.
Table 7. Intra-sample variation.
% Area 1 Area 2 Area 3 Mean SD CV (%)
IMutant Area
100 25677 25515 23167 24786 1405 5.669
75 25415 25667 24712 25265 495 1.959
50 24811 23961 25885 24886 964 3.874
25 23898 23603 21818 23106 1125 4.869
10 18414 18914 15143 17490 2048 11.710
5 12471 14591 11696 12919 1499 11.603
1 6902 6807 6129 6613 422 6.381
0.5 4596 4670 4376 4547 153 3.365
0.25 4110 4179 3111 3800 598 15.737
0.1 1924 1731 1701 1785 121 6.779
0.05 974 999 989 987 13 1.317
0.02 492 478 452 474 20 4.219
0.01 460 397 497 451 51 11.308
0.002 na na 417 417 - —
Table 8. Intra-sample variation. Calculation of log % mutant
and log mean area of data shown in Table 7.
Log % Log Area Log Area Log Area Log Mean SD
IMutant 1 2 3 Area
2.000 4.410 4.407 4.365 4.394 0.025
1.875 4.405 4.409 4.393 4.402 0.009
1.699 4.395 4.380 4.413 4.396 0.017
1.398 4.378 4.373 4.339 4.363 0.021
1.000 4.265 4.277 4.180 4.241 0.053
0.699 4.096 4.164 4.068 4.109 0.049
0.000 3.839 3.833 3.787 3.820 0.028
-0.301 3.662 3.669 3.641 3.658 0.015
-0.602 3.614 3.621 3.493 3.576 0.072
-1.000 3.284 3.238 3.231 3.251 0.029
-l.301 2.989 3.000 2.995 2.994 0.006
-l.699 2.692 2.679 2.655 2.676 0.019
-2.000 2.663 2.599 2.696 2.653 0.050
-2.699 na na 2.620 2.620 -

 

 

 

 

 

 

 

68

 

 

 

l Serial Dilution (Mutantrlildrtype) Assay -
Intra-samples

, ,lllll, ,- .5 .-l

y = 0.4563x + 3.7424
4 {MM 2
R = 0.9673

LogiMean.Area
N

 

 

 

 

 

—1.5 —1 -0 5 0 O 5 1 1 5 2
Log $3Mntant J

Figure 9. A plot of log % mutant vs. log mean area (Intra-
sample variation).

(3 Inter-sample variability
Three completely different sets of samples were
prepared and analyzed to determine the repeatability of the
entire process. The data from this triplicate experiment are
shown in Table 9. Figure 10 shows the data range that
provided the best linear relationship between log % mutant
vs. log mean area. Data on log % mutant and log mean area

are shown in Table 10.

69

Table 9. Inter-sample variation.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

% Area 1 Area 2 Area 3 Mean SD CV (‘15)
IMutant Area
100 25677 26186 22591 24818 1945 7.837
75 25415 26389 26338 26047 548 2.104
50 24811 24155 21052 23339 2008 8.604
25 23898 20563 20544 21668 1931 8.912
10 18414 16587 15342 16781 1545 9.207
5 12471 14242 14525 13746 1113 8.097
1 6902 6253 6222 6459 384 5.945
0.5 4596 4557 4342 4498 137 3.046
0.25 4110 4130 3343 3861 449 11.629
0.1 1924 1850 1670 1815 131 7.218
0.05 974 917 909 933 35 3.751
0.02 492 494 409 465 49 10.538
0.01 460 397 492 450 48 10.667
0.002 414 na na 414 - -
Table 10. Inter-sample variation. Calculation of log of %
mutant and log mean area on data showed in Table
9.
Log % Log Area Log Area Log Area Log Mean SD
Mutant 1 2 3 Area
2.000 4.410 4.418 4.354 4.394 0.035
1.875 4.405 4.421 4.421 4.416 0.009
1.699 4.395 4.383 4.323 4.367 0.038
1.398 4.378 4.313 4.313 4.335 0.038
1.000 4.265 4.220 4.186 4.224 0.040
0.699 4.096 4.154 4.162 4.137 0.036
0.000 3.839 3.796 3.794 3.810 0.025
-0.301 3.662 3.659 3.638 3.653 0.013
-0.602 3.614 3.616 3.524 3.585 0.052
-1.000 3.284 3.267 3.223 3.258 0.032
-1.301 2.989 2.962 2.959 2.970 0.016
-1.699 2.692 2.694 2.612 2.666 0.047
-2.000 2.663 2.599 2.692 2.651 0.048
-2.699 2.617 Na na 2.617 -

 

 

 

 

 

 

70

 

 

 

 

Serial Dilution (Mutant:Ni1d-type) assay -
Inter-samples

 

 

I
i
i .1L~—"

-1 -O.5 0 0.5

log % Mutant

sample variation).

Figure 10..A plot of log % mutant

7]

'PM

vs.

y = 0.4505x + 3.7356

R2 = 0.9571

 

 

 

log mean area (Inter-

DISCUSSION

72

DNA Isolation from Positive and.Negative Controls

The concentration of DNA isolated from SW480 cell line
(positive control), PBLs (negative control), and III Urine
are presented in Table l. The ratio of optical density
measured at 260nm and 280nm is greater than 1.8 in all
cases, indicating good purity of DNA in the isolated

samples.

Detection of K-ras Sequences after RE-PCR and Gel
Electrophoresis (Qualitative Method)

A previously described RE-PCR method was used as a
starting mathod URI Y.H. 2004) anmi modified irl order to

achieve the goals of this study.

0 First-stage PCR.and First-round of BstNI Digestion
First-stage PCR would amplify both mutant and wild-
type K-ras sequences to 125 bps as shown in Figure 11 Sense
primer creates an artificial BstNI digestion site at codon
11 and 12 in the wild-type K-ras; since mutant K-ras
differs from wild-type at codon 12 the sense primer does
not create the artificial BstNI digestion site on the

mutant K-ras.

73

BstNI restriction enzyme would cut the wild-type K-ras
at the BstNI digestion site into 80 and 45 bps fragments.
Since, no BstNI digestion site was created in the mutant K-
ras, the fragment remains unchanged at 125 bps. However, as
observed from Figure l rm) bands were seen for' positive
control (SW480), negative control (PBLs), normal urine
negative for mutant K-ras either after the first stage PCR
or after the first BstNI digestion, this may have resulted

from the very low amount of DNA in the samples.

0 Second-stage PCR and Second-round of BstNI Digestion

The objective of the study was to qualitatively and
quantitatively identify the mutant K-ras. The RE-PCR
followed by gel electrophoresis method was developed by Su
YH to detect K-ras qualitatively. In order to
quantitatively detect both mutant and wild type K-ras
sequences using capillary electrophoresis the K-ras
sequences had to be labeled with fluorescence. In order to
separate wild—type and mutant K-ras on capillary
electrophoresis wild-type and mutant K-ras had to be
cleaved. differently' during the second. PCR. and 'BstNI. An
antisense primer, as shown in Table 1 (Antisense Primer Set
II) was specifically developed for this purpose. The

antisense primer in the primer set II was labeled with 6-

74

FAM (6—carboxy1 fluorescein) at 5' end. Incorporation of 6-
carboxyl fluorescein imparted the fluorescence property
needed 1J1 the detection anmi quantification cu? K-ras using
the capillary electrophoresis. During second stage PCR;
sense primer attaches to the K-ras sequences so that it
introduces BstNI (digestion site :u1 the wild-type K-ras,
while in mutant K-ras the base sequence is different
because of the mutation, therefore, the BstNI digestion
site is not created.

The gel picture (Figure 2) of SW480, PBL, and normal
urine negative for mutant K—ras shows the fragment sizes of
92 bps. This would have resulted from the amplification of
mutant or wild-type K—ras as explained by Figure 11. The
gel picture of PBLs and normal urine following the second-
round of BstNI digestion shows the presence of bands of 62
and 30 bps and no band of 92 bps. While the band for SW480
appear at 92 bps. This could be explained on the basis that
sense primer used during second PCR would create an
artificial BstNI digestion site at codon 11 and 12 in the
wild-type K—ras; since mutant K-ras differs from wild-type
at codon 12 the sense primer would not create the
artificial BstNI digestion site on the mutant K-ras. During
the second BstNI digestion, the BstNI restriction enzyme

would cut the wild-type K-ras into 62 and 30 bps fragments.

75

Since, no BstNI digestion site is created; the mutant K-ras

fragment remains unchanged at 92 bps.

The results show that the RE—PCR method followed by
gel electrophoresis was able IX) specifically' detect

presence of mutant K-ras in the DNA samples.

Ability of Urine Isolation Method to Detect Low Molecular
weight Mutant R-ras Sequences

Gel picture in Figure 3 shows presence of bands at 62
and 30 bps for PBL and normal urine negative for mutant K-
ras. This could be explained as described earlier (under
RE-PCR section) and presented in Figure 11. Samples of
various amounts of low molecular weight 125 bps SW480 after
first PCR mixed with normal urine shows the presence of
band at 92 bps. This could be explained as described
earlier (under RE-PCR section) and presented in Figure 11.
This data indicates that the urine isolation. method. was

able to isolate low molecular weight DNA fragments.

76

Serial Dilution Assay

o Qualitative Analysis of Mutant R-ras Sequences

As observed in Fig. 4 the density of the band for
fragment 92 bps correlates qualitatively with the
concentration of SW480 in the samples. With the decrease in
the density of band for fragment 92 bps as the
concentration of SW480 decreases in the sample, as
expected, there is a corresponding increase in the density
of the bands for fragments 62 and 30 bps obtained by second
BstNI digestion of 92 bps band of the wild type K-ras. From
the gel picture it is clear that even at the concentration
as low as 0.02% of SW480 band at 92 bps is visible. This
clearly shows that the qualitative method used to detect K-

ras is very sensitive.

0 Quantitative Analysis of Mutant R-ras Sequences in

Serial Dilution Assay

Quantitative Analysis

A typical electrpherogram is shown in figure 6. The
fragments were sized. by comparing to G8350-250 internal
size standard. The expected sizes for the mutant K-ras

sequences and wild-type K-ras sequences were 92 bps and 62

77

bps, respectively. The observed sizes were within 5 bps of
expected sizes. This difference may be due to the
conformation of the DNA or mobility variation among dyes. A
previous research study had reported a similar shift of 5
bps during the quantitative analysis of the FAM-labeled
fragment for factor V Leiden by capillary electrophoresis
using .ABI Prism. 310 (Benson. J 1999). Another study' had
reported a shift iJIJZ bps while quantifying Apolipoprotein
using capillary electrophoresis using INN: Prism 310 (Sell

S.M. 1997).

C) Intra-sample variability
Data of intra-sample variability as seen in Table 7
indicates that the analytical method was able to quantify
the mutant K-ras consistently as indicated by low standard
deviation even in the samples containing mutant K-ras as low
as 0.05%. The coefficient of variation (CV) was found to be
less than 15%.

0

Figure 9 shows plot of log 6 mutant vs. log mean area.
A high value of coefficient of determination (R2) 0.9673,
close to 1, indicates a good correlation between log %

mutant and log mean area in the range of 50 to 0.05% mutant

K-ras.

78

c) Inter-sample variability
As seen from the data in Table 9, results obtained from
all the three sample set is very consistent (low values of
standard deviation) indicating that IXXB sample preparation
method is reproducible even for the dilute samples
containing mutant K-ras as low as 0.05%. The coefficient of

O

variation (CV) was found to be less than 15%.

79

CONCLUSIONS

80

®

The QIAamp DNA Mini Kit was used to obtain genomic

DNA from PBLs (negative control) and SW480 (positive
control). Method to isolate DNA from urine sample was
adopted from previous studies and modified to achieve the
objectives of these studies.

Two stage Restriction Enriched Polymerase Chain
Reaction followed by gel electrophoresis was used to detect
mutant K—ras sequences without any interference from the
wild-type KEras sequences. This method was used as the
qualitative method for the detection of mutant K-ras.
First-stage PCR amplified both mutant and wild-type K-ras.
First-round of BstNI digestion was carried out after first
stage RE-PCR with primer set I in order to cut the
amplified wild-type K-ras sequences to 85 and 40 bps.
However, due to the lower DNA concentration; bands for
mutant and wild-type K-ras were not observed in gel
electrophoresis following first-stage RE-PCR and first-
round of BstNI digestion. Second-stage PCR amplified both
mutant and wild—type K-ras. Second-round of BstNI digestion
was carried out after second-stage PCR with primer set II.
The second-round of BstNI digestion cut the amplified wild-
type K-ras sequences in 62 and 30 bps as observed in gel
electrophoresis, while IXXE mutant K-ras kxnmi was observed

at 92 bps in SW480. Qualitative method was able to detect

8]

presence of mutant K-ras in 0.02% SW480 sample, indicating
the method is very sensitive.
Capillary electrophoresis was used as a quantitative

method for analysis of mutant K-ras; quantification was

<3

performed using ABI PRISM GeneScan Analysis software.

Capillary electrophoresis was atde IX) quantify the mmtant
K—ras consistently' even in tflue dilute samples containing
mutant K-ras as ihnv as 0.05%. IX good correlation between
log % mutant and log mean area was obtained in the range of
50 to 0.05% mutant.

The whole process of DNA isolation followed by RE-PCR
followed by quantitative analysis of' mutant K-ras using
capillary electrophoresis was feund IX) be reproducible as
indicated by Ijma low correlation of variation (CV) (<15%)
values between the three sets of samples prepared and
analyzed at a different time. Also, the intra-sample
variability was found to be low as indicated by low CV
(<15%).

A qualitative and a quantitative method was developed
to detect the presence of mutant K-ras in urine sample
which could potentially be used in combination with other
screening' methods for the early detection of colorectal

cancer in patients, which may improve the survival rate in

future. Testing' for Imutated. K-ras during follow-up after

82

resection from colorectal cancer may provide new tools for
detection of recurrence or second primary tumors and thus
may serve IX) identify appropriate treatments or IX) avoid

ineffective treatments, and thus may increase survival.

83

APPENDIX

84

Materials

10.

Positive Control, Genomic DNA from SW480 cell line
(American Type Culture Collection (ATCC)) possessing
a mutation in codon 12 of the K-ras proto-oncogene
was used as a positive control.

Negative Control, Genomic DNA from Peripheral Blood
Leucocytes (PBLs) was used as a negative control for
K-ras codon 12.

Urine Specimen

EDTA(ethylenedinitrilo) tetraacetic acid), Disodium
Salt, Dihydrate, Crystal, product # 8993-01,
Mallinckrodt Baker , Inc., Phillipsburg, NJ.

Fifteen mL Conical Polypropylene Screw Cap Tube,
part # 430052, Corning Inc., Corning, NY.

Guanidine Isothiocyanate, catalog # 15535-016,
Invitrogen Corporation, Carlsbad, CA.

Fifty mL Conical Polypropylene Screw Cap Tubes, part
# 430290, Corning, Inc., Corning, NY.

Wizard® Plus Minipreps DNA Purification Systems,
catalog # A7100, Promega Corporation, Madison, WI.

1.5 mL macrocentrifuge tube (Eppendrof tubes),
catalog # 2236411-1, Brinkmann Instruments Ltd.,
Canada.

SW480 cell line, ATCC® # CCL-228, American Type
Culture Collection (ATCC), Manassas, VA.

85

ll.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

Sodiumt Chloride, Crystals, product # 3624-05,
Mallinckrodt Baker Inc., Phillipsburg, NJ.

Potassium Chloride, Crystals, lot # 707202, Columbus
Chemical Industries, Inc., Columbus, WI.

Sodium Phosphate Monobasic (NaH2PO4), Anhydrous, lot
# 126H04925, Sigma-Aldrich, St. Louis, MO.

Potassium Phosphate Monobasic (KH2PO4), Batch #
114K0240, Sigma-Aldrich, St. Louis, MO.

QIAamp® DNA Mini Kit, catalog # 51304, QIAGEN Inc.,

Valencia, CA.

Ethyl alcohol 200 pmoof (Exhanol), catalog #
111USP200, Pharmaco Products, Brookfield, CT.

0.2 ml thin wall PCR tubes with attached cap,
catalog # 501-PCR, Dot Scientific Incorporated,
Burton, MI.

GeneAmp PCR Buffer 10X, part # N808-0240, Applied
Biosystems, Foster city, CA.

AmpliTanD Gold DNA polymerase, part # N808-0240,
Applied Biosystems, Foster city, CA.

dATP, dCTP, dGTP, and dTTP, part # N8080007, Applied
Biosystems, Foster city, CA.

Primer set I and II (Table l), Macromolecular
Structure facility, Michigan State University, East
Lansing, MI.

86

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

BstNI Endonuclease Enzyme (source: Bacillus
stearothermophilus IQ (EL Comb)), catalog It R0168S,
New England Biolabs Inc., Beverly, MA.

NEBuffer 2, 10X, catalog # R01685, New England
Biolabs Inc., Beverly, MA.

Acrylamide, lot # 14328820, Boehringer Mannheim
corp., Indianapolis, IN.

BIS (N, N’-methylene-bis-acrylamide), catalog # 161-
0201, Bio-Rad Laboratories, Hercules, CA.

Trizma®> Base, catalog II T1503-500G, Sigma-Aldrich,
St. Louis, MO.

Glacial acetic acid, lot # 39076, EM Industries
Inc., Gibbstown, NJ.

N, N, N’, N'-Tetramethylethylenediamine (TEMED), lot
# 14336120, Boehringer Mannheim Corporation,
Indianapolis, IN.

Ammonium Persulphate, Crystal, lot # C49331,
Mallinckrodt Baker, Inc., Phillipsburg, NJ.

5X Nucleic Acid Sample Loading Buffer, catalog #
161-0767, Bio—Rad, Richmond, CA. This loading dye
was received. along ‘with. EZ load 100 km) Molecular
Ruler, catalog # 170-8352.

50-500 bp Molecular Weight Marker, Ref # 74605-250,
PEL-FREEZ, Dynal Biotech, Brown Deer, WI.

Ethidium Bromide Solution (10mg/mL), catalog #
E1510, Sigma-Aldrich, St. Louis, MO.

87

33.

34.

35.

36.

37.

38.

39.

Polaroid® Type 667 Black and White Instant Pack
Film, Polaroid Incorporation, Cambridge, MA.

Matrix Standard Sets, Applied Biosystems, Foster
city, CA.
a)Fiuorescent Amidite Matrix Standards Kit
(contains one tube each of 6—FAM-, HEX-, TED—,
TAMRA-, and ROX-labeled DNA), part # 401546.
kn NED Matrix Standard, part # 402996.

Formamide, catalog # 11814320001, Roche Diagnostics,
Indianapolis, IA.

MicroAmp 0.2 mL sample tube, part # N801-0531,
Applied Biosystems, Foster city, CA.

Performance Optimized Polymer (POP—4rM polymer), part
# 402838, Applied Biosystems, Foster city, CA.

10X Genetic Analyzer Buffer with EDTA, part #
402824, Applied Biosystems, Foster city, CA.

GeneScanflLBSO ROX® Internal Lane Size Standard, part
# 401735, Applied Biosystems, Foster city, CA.

88

Instruments

1.

10.

GS Gene Linker UV chamber, serial # B05BR0581, Bio-
Rad, Richmond, CA.

Precision Water bath—micro, serial # 9503-107,
Precision Scientific Inc., Winchester, VA.

GeneQuant RNA/DNA. Calculator, Serial II 80-2111-98,
Biochrom Ltd, Cambridge Science Park, Cambridge,
England.

Sorvall TC6 tabletop centrifuge, Serial II 9204183,
Sorvall, Thermo Electron Corporation, Asheville, NC.

Lab Rotator, Model # 2314, Barnstead International,
Dubuque, IA.

Sorvall Biofuge® Pico, Serial # 40245700, Sorvall,
Thermo Electron Corporation, Asheville, NC.

Precision Water Bath, Model II 181, Precision
Scientific Inc., Winchester, VA.

Vortexer, Type 16700 Mixture, Model # M16715,
Barnstead Thermodyne, Dubuque, IA.

SpeedVac SC100 System, serial # SC100-OK47405-1A,
Savant Instruments, Farmingdale, NY.

GeneAmp® PCR System 9700, serial # A965-2050316,
Applied Biosystems, Foster city, CA.

89

ll.

12.

13.

14.

15.

l6.

l7.

Precision Shaking Water Bath, serial It 26AT-5, GCA
Corporation, Precision Scientific Group, Chicago,
IL.

Mini-PROTEAN® SKI Cell electrophoresis chamber,
serial. # 125BR 36702, aux) a Model 1000/500 Power
Supply, Bio-RAD, Richmond, CA.

American Rotator V, serial # 030467, American Dade,
American Hospital Supply Corporation, Miami, FL.

Chromato-Vue Transilluminator, Model # TS-36, UVP
Incorporated, San Gabriel, CA.

Fotodyne FCR-10 camera, Fotodyne Incorporated,
Hartland, WI.

ABI PRISM® 310 Genetic Analyzer, Serial # 310-
95080145, Applied Biosystems, Foster city, CA.

[NUX Thermal Cycler, serial It P3254, Perkin. Elmer,
Norwalk, CT.

90

IMutant and.Wild-type K-ras Sequences during Restriction

Enriched Polymerase Chain Reaction

0 Wild-type K—ras exon 1 DNA Sequence

5' ATGACTGAAT ATAAACTTGT GGTAG'ITGGA GCTGGTGGCG TAGGCAAGAG

IIIIIIIIII IIIIIIIIII IIIIIIIIII IIIIIIIIIII IIIIIIIIII
3' TACTGACTTA TA'I'ITGAACA CCATCAACCT CGACCACCGC ATCCGTTCTC

TGCCTTGACG ATACAGCTAA 'IICAGAATCA I | I IGTGGAC 3’

llllllllll IIIIIIIIII IIIIIIIIII IIIIIIIIII
ACGGAACTGC TATGTCGATT AAGTC‘I‘I’AGT AAAACACCTG 5'

0 .Mutant K—ras Sequence

Mutant K-ras sequence differs from the wild-type K-ras
at the (xxkfll 12 (GGT, highlighted 131 the sequence above)
and could have either of following sequence:

C) GAT

o GTT

C) GCT

C) AGT

0 TGT

C) CGT

> Firs t-stage PCR
Following Primers were used during the first-stage

PCR:

0 Sense Primer Set I

5' GCTCTTCGTGGTGTGGTGTCCATATAAACTTGTGGTAGTTGGACCT 3’

91

0 Antisense Primer Set I

5' GCTCTTCGTGGTGTGGTGTCCCGTCCACAAAATGATTCTGA 3'

Mutant and Wild-type K-ras amplifies to 125 bps during
the first stage PCR. Sense jprimer creates an .artificial
BstNI digestion site (by encoding G —+ C substitution at the
first position of codon 11) at codon 11 and 12 in the wild-
type K-ras (highlighted in the sequence below); since
mutant K-ras differs from wild-type at CXani 12 the sense
primer does not create the artificial BstNI digestion site

on the mutant K-ras.

0 Amplified wild-type K~ras after first-stag: PCR

5' GCT C'I'I'CGTGGTG TGGTGTCCAT ATAAACTTGT GGTAG'ITGGA CC GGTGGCG

Ill llllllllll Illlllllll IIIIIIIIII IIIIIIIIII IIIIIIIIIII
3' CGA GAAGCACCAC ACCACAGGTA TATTTGAACA CCATCAACCT GGTCACCGC

TAGGCAAGAG TGCCTTGACG ATACAGCTAA TICAGAATCA | | I IGTGGAC

IIIIIIIIII |||I||I||I ||I|||||Il I|||II||I| ||||||I|I|
Arcco'r'rcrc ACGGAACTGC TATGTCGATT AAGTCTTAGT AAAACACCTG

GGGACACCAC ACCACGAAGA GC 3'

IIIIIIIIII IIIIIIIIII II
CCCTGTGGTG TGGTGC‘I‘I’CT CG 5'

> First-round of BstNI Digestion
BstNI restriction enzyme cuts the Maid-type K-ras at
the BstNI digestion site created by sense primer used in

the first stage PCR into 80 and 45 bps fragments (shown

92

below). Since, no BstNI digestion site was created in the

mutant K-ras, the fragment remains unchanged at 125 bps.

o Wild-type K—ras 45 bps fragment following first-round
of BstNI digestion

5’ GCT CTTCGTGGTG TGGTGTCCAT ATAAACTTGT GGTAGTTGGA CC

III IIIIIIIIII IIIIIIIIII Illlllllll IIIIIIIIII ll
3' CGA GAAGCACCAC ACCACAGGTA TA‘ITTGAACA CCATCAACCT GGA

0 Wild—type K—ras 80 bps fragment following first-round
of BstNI digestion

TGGTGGCG TAGGCAAGAG TGCCTTGACG ATACAGCTAA TICAGAATCA I I | IGTGGAC

IIIIIIII IIIIIIIIII IIIIIIIIII IIIIIIIIII IIIIIIIIII IIIIIIIIII
CCACCGC ATCCG'ITCTC ACGGAACTGC TATGTCGAT‘I’ AAGTC‘I‘I’AGT AAAACACCTG

GGGACACCAC ACCACGAAGA GC 3’

IIIIIIIIII llllllllll II
CCCTGTGGTG TGGTGCTTCT cc 5'

0 Mutant K-ras 125 bps fragments

5’ GCT CTTCGTGGTG TGGTGTCCAT ATAAACTTGT GGTAGTTGGA GCTGGTGGCG

Ill IIIIIIIIII IIIIIIIIII IIIIIIIIII IIIIIIIIII Illllllllll
3' CGA GAAGCACCAC ACCACAGGTA TA'ITI'GAACA CCATCAACCT GGACCACCGC

TAGGCAAGAG TGCCTTGACG ATACAGCTAA TICAGAATCA I I | IGTGGAC

IIIIIIIIII IlIIIIlIIl IllIlIIIII IIIIIIIIII ||||I||||I
ATCCGTTCTC ACGGAACTGC TATGTCGAIT AAGTCTI'AGT AAAACACCTG

GGGACACCAC ACCACGAAGA GC 3’

IIIIIIIIII llllllllll ll
CCCTGTGGTG TGGTGCTTCT co 5’

P Second-stage PCR
In the second-stage PCR following sense and antisense

primers were used. The antisense primer was labeled with 6-

93

FAM for the quantitative detection of the K-ras using

capillary electrophoresis.

0 Sense Primer Set II
5’ ACT GAA TAT AAA CTT GTG GTA G'I‘l' GGA OCT 3’

0 Antisense Primer Set II
5' more AAG ch ACA AAA TGA TTC TGA ATT AGC 3'

Mutant and Wild-type K-ras amplifies to 92 bps during
the second stage PCR. The 92 bps sequence of wild-type K-
ras is shown below. Sense primer creates an artificial
BstNI digestion site at codon 11 and 12 in the wild-type K-
ras (highlighted in the sequence below); since mutant K-ras
differs from wild-type at codon 12 the sense primer does
not create the artificial BstNI digestion site on the

mutant K-ras.

0 Wild-type K-ras Fragment size 92 bps after second-
stage PCR

5’ ACTGAAT ATAAACTTGT GGTAGTTGGA GCTGGTGGCG TAGGCAAGAG TGCCTTGACG

lllllll IIIIIIIIII IIIIIIIIII IIIIIIIIIII IIIIIIIIII IIIIIIIIII
3' TGAC‘I‘I’A TATTTGAACA CCATCAACCT GGACCACCGC Achorrcrc ACGGAACTGC

I

ATACAGCTAA TICAGAATCA I I I IGTGGAC TTCAG 3’

IIIIIIIIII IIIIIIIIII IIIIIIIIII IIII
TATGTCGATI' AAGTCTTAGT AAAACACCTG AAGTC 5'

94

> Second-round of BstNI Digestion
BstNI restriction enzyme cuts the Maid-type K-ras at
the BstNI digestion site cmeated In; sense primer used in
the second stage PCR into 62 anmi 30 bps fragments (shown
below). Since, IX) BstNI digestion. site» was created; the

mutant K-ras fragment remains unchanged at 92 bps.

o Wild-type K-ras 30 bps fragment following second-round
of BstNI digestion

5’ ACTGAAT ATAAACTTGT GGTAGTTGGA CC 3’

IIIIIII llllllllll IIIIIIIIII ll
3' TGACTTA TA'ITTGAACA CCATCAACCT GGA 5'

0 Wild-type K—ras 62 bps fragment following second-round
of BstNI digestion

5’ TGGTGGCG TAGGCAAGAG TGCCTTGACG ATACAGCTAA TTCAGAATCA I I I IGTGGAC

||III||I II|I|||||| ||||I||III IIIIIIIIII I||||||I|| ||||II|I||
3’ CCACCGC ATCCG'ITCTC ACGGAACTGC TATGTCGATT AAGTCTTAGT AAAACACCTG

TTCAG i?

IIIII
AAGTCM 5'

0 .Mutant K-ras 92 bps following second-round of BstNI
digestion

5’ ACTGAAT ATAAACTTGT GGTAGTTGGA GCTGGTGGCG TAGGCAAGAG TGCCTTGACG

lllllll IIIIIIIIII Illlllllll IIIIIIIIII Illlllllll IIIIIIIIII
3' TGACTTA TA‘ITTGAACA CCATCAACCT GGACCACCGC ATCCGTTCTC ACGGAACTGC

ATACAGCTAA TTCAGAATCA I I | IGTGGAC TTCAG 3’

IIIIIIIIII IIIIIIIIII IIIIIIIIII IIII
TATGTCGATT AAGTCTTAGT AAAACACCTG AAGTC 5'

Figure 11. Mutant and‘Nild-type R-ras Sequences during
Restriction-Enriched Polymerase Chain Reaction

95

REFERENCS

96

Amado R, Wolf M, Peeters M, et a1. Wild-Type KRAS is
required for panitumumab efficacy in patients with

metastatic colorectal cancer. Journal of Clinical Oncology.
2008; 10: 1626-1634.

American Joint Committee on Cancer. Colon and rectum.
Philadelphia: Lippincott—Raven, 2002; 113.

Anker P, Lyautey J, Lederrey C, et a1. Circulating nucleic
acids in plasma or serum. Clin Chim Acta 2001; 313: 143-
146.

Anthony T, Fleming J, Bieligk S, et a1. Postoperative
colorectal cancer surveillance. J Am Coll Surg 2000; 190:
737—749.

Applied Biosystems
https://docs.appliedbiosystems.com/pebiodocs/00903565.pdf

 

Audisio R, Setti—Carraro P, Segela M, et al. Follow-up in
colorectal cancer patients: a cost-benefit analysis. Ann
Surg Oncol 1996; 3: 349—357.

August D.A., Ottow R.T., Sugarbaker P.H. Clinical
perspective of human colorectal cancer metastasis. Cancer
metastasis Rev. 1984; 3(4): 303-324.

Bandipalliam P, Garber J, Kolodner R.D., Syngal S, et al.
Clinical presentation correlates with the type of mismatch
repair gene involved in hereditary nonpolyposis colon
cancer. Gastroenterology 2004; 126: 936—937.

Barbacid M. ras genes. Annu. Rev. Biochem. 1987; 56: 779-
827.

Benson J, Ellingsen D, Mary A, et al. Multiplex analysis of
mutations 1J1 four genes using fluorescence scanning
technology. Thrombosis Research. 1999; 96: 57-64.

97

Bhowmick NUA.,Neilson E.G., Moses, H.L. Stromal fibroblasts
in cancer initiation and progression. Nature 2004; 432:
332-337.

Bischoff F.Z., Nguyen D.D., Marquez-Do D, et al.
Noninvasive determination of feta RhD status using fetal
DNA in maternal serum and PCR. J Soc Gynecol Investig 1999;
6: 64-69.

Boguski M.S. and McCormick F. Proteins regulating Ras and
its relatives. Nature 1993; 366: 643-654.

Bokemeyer C, Bondarenko I, Hartmann J, et al. KRAS status
and efficacy of first-line treatment of patients with
metastatic colorectal cancer (mCRC) with FOLFOX with or
without cetuximab: The OPUS experience. J Clin Oncol 26:
2008.

Boland C.R. and Ricciardiello L. How many mutations does it
take to maker a tumor? Proc Natl Acad Sci USA 1999; 96(26):
14675-14677.

Bollag M and McCormick F. Regulators and effectors of ras
proteins. Annu. Rev. Cell Biol. 1991; 7: 601-632.

Bos J.L. Ras oncogenes in human cancer: a review. Cancer
Res. 1989; 49:4682-4689.

Bos J.L., Fearon E.R., Hamilton S.R., et a1. prevalence of
ras gene mutations in human colorectal cancers. Nature
1987; 327: 293-297.

Botezatu I, Serdyuk O, Potapova G, et al. Genetic analysis
of DNA excreted in urine: a new approach for detecting
specific genomic DNA sequences from cells dying in an
organism. Clin Chem 2000; 46: 1078-1084.

98

Calvert P.M. and Frucht H. The genetics of colorectal
cancer. Ann Intern Med 2002; 137: 603-12.

Cancer Statistics, 2005. From website:
http://www.cancer.org/downloads/STT/Cancer_Statistics_2005

Cancer Statistics, 2006. From website:
http://www.cancer.org/downloads/STT/CAFF2006PWSecured.pdf

Chaung D.C. The genetic basis of colorectal cancer:
insights into critical pathways of tumorigenesis.
Gastroenterology 2000; 119:854-865.

Chen X.Q., Bonnefoi H, Diebold-Berger C, et al. Detecting
tumor-related alterations in plasma or serum DNA of
patients diagnosed with breast cancer. Clin Cancer Res
1999; 5: 2297-2303.

Chen X.Q., Stroun M, Magnenat J.L., et a1. Microsatellite
alterations in plasma DNA of small cell lung cancer
patients. Nat Med 1996; 2: 1033-1035.

Chiu R.E. and Lo Y.M. The biology and diagnostic
applications of fetal DNA and RNA in maternal plasma. Curr
Top Dev Biol. 2004; 61: 81-111.

Cochrane J.P.S., Williams J.T., Faber R.G., et a1. Value of
outpatient follow-up after curative surgery for carcinoma
of the large bowel. BMJ 1980; 1: 593—595.

Colorectal Cancer In: Strward B.W., Kleihues P, eds. World
Cancer Report. Lyon: IARC Press, 2003; 198-202.

Compton C.C., Fielding L.P., Burgart L.J., et a1.
Prognostic factors in colorectal cancer. College of
American Pathologists Consensus Statement 1999. Arch Pathol
Lab Med 2000; 124: 979.

99

Crespo P and Leon J. Ras proteins in the control of the
cell cycle and cell differentiation. Cell Mol. Life Sci.
2000; 57(11): 1613-1636.

Cunningham J.M., Christensen E.R., Rester D.J., et al.
Hypermethylation of the hMLHl promoter in colon cancer with
microsatellite instability. Cancer Res 1998; 58: 3455-3460.

David O.F., JoAnn M.S., Sandy C, et al. The nonhomologous
end-joining pathway of DNA repair is required for genomic
stability and the suppression of translocations. Proc Natl
Acad Sci USA 2000; 97(12): 6630-6633.

De la Chapelle A. Microsatellite Instability. N Engl J Med
2003; 349: 209-210.

Desch C, Benson A, Smith T, et al. Recommended colorectal
cancer surveillance guidelines by the American society of
clinical oncology. J Clin Oncol 1999; 17: 1312—1323.

Desch C, Benson A, Smith T, et al. Update of American
Society of Clinical Oncology colorectal cancer surveillance
guidelines. J Clin Oncol 2000; 18: 3586—3588.

Esteller M, Sanchez-Cespedes M, Rosell R, et al. Detection
of aberrant promoter hypermethylation of tumor suppressor
genes in serum DNA from non-small cell lung cancer
patients. Cancer Res 1999; 59: 67-70.

Fearon E.R. and Vogelstein B. A genetic model for
colorectal tumorigenesis. Cell 1990; 61(5): 759-767.

Figueredo A, Rumble R.B., Maroun J, et a1. Follow-up of
patients with curatively resected colorectal cancer: a
practice guideline. BMC Cancer 2003; 3: 26.

I00

Fujita J, Yoshida O, Yuasa Y, et al. Ha-ras oncogenes are
activated by somatic alterations in human urinary tracts
tumors. Nature 1984; 309: 464-466.

Gailani M.R., Stahle-Backdahl M, et al. The role of the
human homologue of Drosophila patched in sporadic basal
cell carcinomas. Nat Genet 1996; 14(1): 78-81.

Goessl C, Heicappel R, Munker R, et al. Microsatellite
analysis of plasma DNA from patients with clear renal
carcinoma. Cancer Res 1998; 58: 4728-4732.

Grady W.M. Genetic testing for high-risk colon cancer
patients. Gastoenterology 2003; 124: 1574-1594.

Greene F.L., Page D.L., Fleming I.D., et al. (eds). AJCC
cancer staging manual, 6th Ed. New York: Springer—Verlag,
2002.

Half E.E. and Bresalier R.S. Clinical management of
hereditary colorectal cancer syndromes. Curr Opin
Gastroenterol 2004; 20: 32—42.

Hanahan D and Weinberg R.A. The hallmarks of cancer. Cell
2000; 100(1): 57-70.

Harman F.S., Nicol C.J., Marin H.E., et a1. Peroxisome
proliferator-activated receptor-delta attenuates colon
carcinogenesis. Nat Med. 2004; 10: 481-483.

Herman J.G., Umar A, Polyak K, et al. Incidence and
functional consequences of hMLHl promoter hypermethylation
in colorectal carcinoma. Proc Natl Acad Sci USA 1998; 95:
6870-6875.

Hesketh R. The oncogenes handbook. Academic press 1995.
Hoeijmakers J.H. Genome maintenance mechanisms for
preventing cancer. Nature 2001; 411(6835): 366-374.

101

Howe J.R., Roth S, Ringold J.C., et al. Mutations in the
SMAD4/DPC4 gene in juvenile polyposis. Science 1998;
280(5366): 1086-1088.

Huebner R.J. and Todaro G.J. Oncogenes of RNA tumor viruses
as determinants of cancer. Proc Natl Acad Sci USA 1969;
64(3): 1087-1094.

Infobiogen website:
http://www.infobiogen.fr/services/chromcancer/Genes/Genelis
te.html

Itzkowitz S.H. and Hapraz N. Diagnosis and management of
dysplasia in patients with inflammatory bowel disease.
Gastroenterology 2004; 126: 1634-1648.

Itzkowitz S.H. and Yio X. Inflammation and cancer IV.
Colorectal cancer in inflammatory bowel disease: the role
of inflammation. Am J Physiol Gastrointest Liver Physiol
2004; 287: G7—G17.

Iwasa Y, F Michor, N.L. Komarova, et al. Population
genetics of tumor suppressor genes. J Theor Biol 2005;
233(1): 15-23.

Jacoby R.E., Schlack S, Cole C.E., et al. A juvenile
polyposis tumor suppressor locus at 10q22 is deleted from
nonepithelial cells in the lamina propria. Gastroenterology
1997; 112(4): 1398-1403.

Jahr S, Hentze H, Englisch S, et al. DNA fragments in the
blood plasma of cancer patients: quantitations and evidence
for their origin from apoptotic and necrotic cells. Cancer
Res 2001; 61: 1659-1665.

James Trosko and Randall Ruch. Cell-cell communication in
carcinogenesis. Frontiers in Bioscience. 1998; 3: d208-236.

102

Jass J.R., Whitehall V.L.J., Young J, Leggett B.A. Emerging
concepts in colorectal neoplasia. Gastroenterology 2002;
123: 862-876.

Jemal A, Murry T, Samuels A, et al. Cancer statistics,
2003. CA Cancer J Clin 2003; 53: 5-26.

Jemal A, Tiwari R.C., Murray T, et al. Cancer statistics
2004. CA Cancer J Clin 2004; 54: 8-29.

Jung B, Doctolero R.T., Tajima A, et al. Loss of activin
type 2 protein expression in microsatellite unstable colon
cancers. Gastroenterology. 2004; 126: 654-659.

Kahi C.J. and Rex D.K. Current and future trends in
colorectal cancer screening. Cancer Metastasis Rev. 2004;
23: 137-144.

Kieveit J and Bruinvels D. Detection of recurrence after
surgery for colorectal cancer. Eur J Cancer 1995; 31A:
1222-1225.

Kinzler K.W. and Vogelstein B. Lessons from hereditary
colorectal cancer. Cell 1996; 87: 159-170.

Kinzler K.W. and Vogestein B. Cancer-susceptibiliy gens.
Gatekeepers and caretakers. Nature 1997; 386(6627): 761-
763.

Kjeldsen B.J., Kronborg O, Fenger C, Jorgensen O.D. A
prospective randomized study of follow-up after radical
surgery for colorectal cancer. Br J Surg 1997; 84: 666-669.

Kondo Y and Issa J.P. Epigenetic changes in colorectal
cancer. Cancer Metastasis Rev. 2004; 23: 29-39.

103

Kopreski M, Benko F, Kwee C, et al. Detection of mutant K-
ras DNA in plasma or serum of patients with colorectal
cancer. Br J Cancer 1997; 76: 1293-1299.

Kressner U, Bjorheim J, Westring S, et al. Ki-ras mutations
and prognosis in colorectal cancer. Eur J Cancer 1998; 43:
518-521.

Krok K.L., Lichtenstein G.R. Colorectal cancer in
inflammatory bowel disease. Curr Opin Gastoenterol 2004;
20: 43-48.

Lengauer C, Kinzler K.W., Vogelstein B. Genetic
instabilities in human cancers. Nature 1998; 396(6712):
643-649.

Leon J, Guerrero I, Pellicer A. Differential expression of
the ras gene family in mice. Mol. Cell Biol. 1987; 7: 1535-
1540.

Lichtenstein A.V., Melkonyan H.S., Tomei L.D., et al.
Circulating nucleic acids and apoptosis. Ann. N.Y. Acad.
Sci. 2001; 945: 239-249.

Lo Y.M., Corbetta N, Chamberlain P.F., et a1. Presence of
fetal DNA in maternal plasma and serum. Lancet 1997; 350:
485-487.

Lowy D.R., Willumsen B.M. Function and regulation of Ras.
Annu Rev Biochem 1993; 62: 851-891.

Luebeck E.G. and Moolgavkar S.H. Multistage carcinogenesis
and the incidence of colorectal cancer. Proc Natl Acad Sci
USA 2002; 99(23): 15095-15100.

Lynch H.T. and de la Chapelle A. Hereditary colorectal
cancer. N Engl J Med 2003; 348: 919-932.

104

Lynch J.P. and Hoops T.C. The genetic pathogenesis of
colorectal cancer. Hematol Oncol Clin North Am. 2002; 16:
775-810.

Macaluso M, Russo G, Cinti C, et al. Ras family genes: an
interesting link between cell cycle and cancer. J. Cell.
Physiol. 2002; 192: 125-130.

Malumbres M and Pellicer A. RAS pathways to cell cycle
control and cell transformation. Fronts. Biosci. 1998; 3:
887-912.

McCormick F. Signaling networks that cause cancer. Trends
Cell Biol. 1999; 9: M53-M56.

Michor F, Iwasa Y, Nowak M.A. Dynamics of cancer
progression. Nat Rev Cancer 2004; 4(3):197-205.

Milde A, Haas-Rochholz H, Kaatsch HJ. Improved DNA typing
of human urine by adding EDTA. Int J Legal Med. 1999; 112:
209-210.

Monifar F, Yan Gao M, Arnould L, et al. Concurrent and
independent genetic alterations in the stromal and
epithelial cells of mammary carcinoma: implications for
tumorigenesis. Cancer Res 2000; 60(9): 2562-2596.

Mulcahy H.E., Lyautey J, Lederrey C, et al. A prospective
study of K-ras mutations in plasma of pancreatic cancer
patients. Clin Cancer Res 1998; 4: 271-275.

Muller A, et al. MSI-testing in hereditary non-polyposis
colorectal carcinoma (HNPCC). Dis Markers 2004; 20(4-5):
225-236.

Munger K. Disruption of oncogene/tumor suppressor networks
during human carcinogenesis. Cancer Invest 2002; 20(1): 71-
81.

105

Nawroz H, Koch W, Anker P, et al. Microsatellite
alterations in serum DNA of head and neck cancer patients.
Nat Med 1996; 2: 1035-1037.

Nowell P.C. The clonal evaluation of tumor cell
populations. Science. 1976; 194: 23-28.

Nowell P.C. Tumor progression: a brief historic
perspective. Semin Cancer Biol. 2002; 12: 261-266.

Pells S, Divjak M, Romanowski P, et al. Developmentally-
regulated expression of murine K-ras isoforms. Oncogene
1997; 15: 1781-1786.

Ponder B.A. Cancer genetics. Nature 2001; 411(6835): 336-
341.

Rajagopalan H, Jallepalli P.V., Rago C, et al. Inactivation
of hCDC4 can cause chromosomal instability. Nature 2004;
428: 77—81.

Rajagopalan H, Nowak M.A., Vogelstein B, et al. The
significance of unstable chromosomes in colorectal cancer.
Nat Rev Cancer 2003; 3(9): 695-701.

Rao M, Yang W, Seifalian A.M., Winslet M.C. Role of
cyclooxygenase-2 in the angiogenesis of colorectal cancer.
Int J Colorectal Dis. 2004; 19: 1-11.

Rodenhuis S and Slebos R.J. Clinical significance of ras
oncogene activation in human lung cancer. Cancer Res 1992;
52: 26653-26693.

Russo M.W., Wei J.T., Thiny M.T., et al. Digestive and
liver disease statistics, 2004. Gastroentrology 2004; 126:
1448-1453.

106

Samuels A, Wang Z, Bardelli A, et al. High frequency of
mutations of the PIK3CA gene in human cancers. Science
2004; 304: 554.

Schoemaker D, Black R, Giles L, Toouli J. Yearly
colonoscopy, liver CT and chestradiography do not influence
5-year survival of colorectal cancer patients.
Gastroenterology 1998; 114: 7-14.

SEER data 1975-2001. From website:
http://seer.cancer.gov/csr/1975_2001/results_merged/sect_06
_colon_rectum.pdf

Sell S.M. and Ren K. Automated capillary electrophoresis in
the genotyping of Apolipoprotein E. Genomics. 1997; 46:
163-164.

Sherr C.J. Principles of tumor suppression. Cell 2004;
116(2): 235—246.

Sieber O.M., Lipton L, Crabtree M, et al. Multiple
colorectal adenomas, classic adenomatous polyposis, and
germ-line mutations in MYH. N Engl J Med 2003; 348: 791-
799.

Sinicrope F.A. and Gill S. Role of cyclooxygenase-2 in
colorectal cancer. Cancer Metastasis Rev. 2004; 23: 63-75.

Slebos RJ, Hruban R.H., Dalesio O, et al. Relationship
between K-ras oncogenes activation and smoking in
adenocarcinoma of the human lung. J Natl Cancer Inst 1991;
83: 1024-1027.

Soetikno R.M., Kahng L.S., Ono A, Fujii T. Flat and
depressed colorectal neoplasms. Curr Opin Gastroenterol.
2003; 19: 69-75.

107

Su Y.H., Wang M, Brenner D.E., et al. Human Urine contains
small, 150 to 250 nucleotide-sized, soluble DNA derived
from the circulation and may be useful in the detection of
colorectal cancer. J Mol Diagn. 2004; 6(2): 101-107.

Van Cutsem E, Lang I, D'haens G, et al. KRAS status and
efficacy in the first-line treatment of patients with
metastatic colorectal cancer (mCRC) treated with FOLFIRI
with or without cetuximab: The CRYSTAL experience. J Clin
Oncol 26: 2008.

Vasen H.E., Watson P, Mecklin J.P., Lynch H.T. New clinical
criteria for hereditary nonpolyposis colorectal cancer
(HNPCC, Lynch syndrome) proposed by the international
collaborative group on HNPCC. Gastroenterology 1999; 116:
1453-1456.

Veigl M.L., Kasturi L, Olechnowicz J, et al. Biallelic
inactivation of hMLHl by epigenetic gene silencing, a novel
mechanism causing human MSI cancers. Proc Natl Acad Sci USA
1998; 95: 8698-8702.

Venesio T, Molatore S, Cattaneo F, et al. High frequency of
MYH gene mutations in a subset of patients with familial
adenomatous polyposis. Gastroenterology 2004; 126: 1681-
1685.

Vernava A, Longo W, Virgo K, et al. Current follow-up
strategies after resection of colon cancer. Results of a
survey of members of the American Society of Colon and
Rectal Surgeons. Dis Colon Rectum 1994; 37: 573—583.

Visvanathan K.V., Pocock R.D., Summerhayes I.C.
Preferential and novel activation of H-ras in human bladder
carcinomas. Oncogene Res. 1988; 3: 77-86.

Vogelstein B and Kinzler K.W. The multistep nature of
cancer. Trends Genet 1993; 9(4): 138-141.

108

Vogelstein B, Fearon E.R., Hamilton S.R., et al. Genetic
alterations during colorectal-tumor development. N Engl J
Med 1988; 319: 525-532.

Vogestein B and Kinzler K.W. Cancer genes and the pathways
they control. Nat Med 2004; 10(8): 789-799.

Wang Z, Shen D, Parsons D.W., et a1. Mutational analysis of
the tyrosine phosphatome in colorectal cancers. Science
2004; 304: 1164-1166.

Weaver Z, Montagna C, Xu X, et al. Mammary tumors in mice
conditionally mutant for Brcal exhibit gross genomic
instability and centrosome amplification yet display a
recurring distribution of genomic imbalances that is
similar to human breast cancer. Oncogene 2002; 21(33):
5097-5107.

Winawer S.J., Fletcher R, Rex D.K., et al. Colorectal
cancer screening and surveillance: clinical guidelines and

rationale-update based on new evidence. Gastroenterology
2003; 124: 544-560.

Winawer S.J., Zauber A.G., Ho M.N., et al. Prevention of
colorectal cancer by colonoscopic polypectomy. The National
Polyp Study Workgroup. N Engl J Med. 1993; 329: 1977-1981.

Wong IHN, Lo YMD, Zhang J, Liew C-T, et al. Detection of
aberrant p16 methylation in the plasma and serum of liver
cancer patients. Cancer Res 1999; 59: 71-73.

Wyllie A.H. Glucocorticoid-induced thymocyte apoptosis is
associated with endogenous endonuclease activation. Nature
1980; 284: 555-556.

109

STATE UNIVERSITY LIBRARIES

Ill 1111 |

93 03062 5630

 

“111111)