)r 4. . . . Ln... 5 Iéfihrfia I I 00.. 0.0.. a 0 . \0. 0‘ .001... . ‘0 .r t. . £008 00 0.1:..- 00. 0 10.... . i. I...“ 3. .. ....nwmxn iglzmfijci .- _ 0.00. .v... ...JS . «VJ: . _ I. .0. r "V..t...u.z.1.. I I a . .. .00.. .3. 0 63:13:00. 500.. ..lt)‘.. .30.! V. o3‘0< I: . 00 fif~3000003109 L 0...... 0. on? 00” .. ..uflfii. ..00000 .00. 00w... 0‘0”"017h.0n1. 0.... 0 0 ... 0;... . I I v. 0. v. ...... .0 .l 01.. r. 0.0-7.0... ‘0’. . tog-miion \v...’00..00.l301I00-0.:u.0.00§2 0..)!. {0010.191 . . :0. 8.1.... 1 . 14.0.. .... .... 00. 1.5.2.50 900.3020 ..J .. 10.x“. .... ... ......3... ...: .I «4...: .. . . ...0. a... ..#.........1...... ..._..:.II.. .. . ......uI v | 0 C l . . C 0. 0 0.. . 00.0 .000...3.!.00: -3003}. ..‘sf.0u . 00‘0“ '0. . 0:1... .. ..00. .0. .0201 .0 .0 . .... I00, . f0. . a . I 0 "raw-.10... ..0.:. I. . 3 .... .1: .0 :0. ... .. ...0. .. 2:,0‘00 .Iv0’0l..0 .‘ . . I ...u.’0000 , . 0. ... . [.009000. A. 0000.0‘ . JI’... 0000.90 0 . 0 0 0. 0 303.000.2016 000 I. J 0 4. I. 0| 0 .fi: 000 21!. ”a... 0: 0.1. 00 020 . 00300.0 0.01...‘ 000.0020- 0:... .0 . . 0-0 ....00 I, ....‘90 0 , . 0...! 0 a. . 0...... $00.13,: 000 0005 . . v .000. .0 0 106.95: 00"“; (‘00. J’w.‘ ."00. .fl“ .0 1000...: 00‘ ... .F :80. .0300?- .0013 ‘05 .00 :00. .0. - . 000.03 . .. .0 1.00.00 21.. at. 3.... 00 ..‘l: 00 .0 00:00 30.0“!“ lufiiflhoé ...-J. 0 I’...I§6.009uu.0-P2| 0.000000 .0100 00003 . 0 .0 .01 .... £00 0 .... '0. .00 001. ...»)? . 0.6. .48.“, .0 30.0.0008 “00.30.0009”: «kl . “30‘ 300.9. 1.00.03.37.03. . .. . 0.. . a .0: .9500 .1430: . .. (1.0.0,... ... (.3 x 1.... 31‘. . . .0 ...m 02.0.. ...0 8.0.00.9... 4.6000; 1.3.0: 3.00.0. 00.0“. 3.003.009“ .0..0.0.0‘000.00 0w. 0 0.....3-000. u00000‘l..0~ I00 ...-0.86. 01 . . Inktlcx ...-.00 0000.:‘. .0001. \0.0. .YiiJ0.00000..v. 9. .1. a . .000. .ploi 0.05003 «W'Ogv20t 0.0100 33.00.90: 300 4.0. 0.0.. o0.....0.02.l .0 Q 20 0.... . .‘00.\P»Ko((00 10000008130003 0. 000.3030: .0- .0“” ‘00? . ...... 20.1.0.0th .0030... .010:- 0.‘ .80. 0 00 70.30.. 2.0.00.0. 003.910.980.01 ...0..l000$100r..000.1 000.. 3...! .1 0.00.0.1 0.0 0.". ,. .000... ._ . .0000. “03. .00. :0 . . . 2 3.60.0..03]; 30.0 .x_08010.00..00000 ... 00 .... 0 .80!!.. 2.000000000030100 ..9000001020... :00- !000 0051.912..- 000‘0. 201...; .10.! . .. 000101”... . fn.00...t02..m. 0.... ... 0'30 00.00 I (0.00: . 8.‘000‘.| 0.0"“. 0000000. .- ltg'fiSP-‘i‘a‘ .0 .5’00000730.0I.. 000‘ .l!‘ .00....00 1...... 64.0.0.0... .0. ...0.0.. . 00300.30 . ' 0.0 0.. I. . n ..20‘6 . _ ., f. ...-I .0 000.: 0000.0 9.193.125 ...0.’ ...0.‘0 .0. . 0000......3 3'00“. .00 5.” 3000.0. 0.:IJ00A0‘90 003:0 9.90.00.00.10... 00000.. 0‘ .00.0...O....00L00.‘00 0. “00.00310: 0 0:00.300. 0.00.00 . 00 02.1 I. .QF031100: :0 5.0.0513... :0...‘000 .. .0. . . 0. I001- ,00—05‘0 0.0.000 10.0.0. 0’030‘000 ‘00 .300. 009.0... I 00.0.1.0. u?....i'0lLI-0'100090.. 0‘ .m)..00 o. .. 0.90? .1000: 0000. . . 0.5. .0. .7 4. .0. J..01.u2...0... . 0.00.00.130 3.03.0.5k8 .30.. 0.30 030. .0002! ..0030 ....I..;0000...0...‘0. ...... 2 .00.. In... . 00.000500 .00... 0 20.... .2 0- .I 000 o ... 0 .00. 0.00.. .0003 ..00 00. ....030. . 00th .0. 0.0 . Q o 000:. 4:01.... ...... 01.0. 0.00.. .000 0.100.. 0.00 10.0. .... 3.000.000 0.80. 0.0.0.0.. .305! . 5:00....0000080IV. 023.00.62.00. .W. . ; 2009... 1 .... .2... 00. l ..10 ...0 0. . .II .0... 1. .. €0.00. 30:. . . . o. _ .13.... J: 2.0.000. .....: .0. “-0.503?! .060 :..’.?0-0,1l...0.3000:3 0 n..~u03.-:_..018. . 1.... .000. ..3003..u}0$-l0.0.0wnn00003:3. 500.0003... . o _ ......0.030.205.103HII03NL1. a .00. .LVO..!0..u 5.80.. . «.....u. :0...0..0..0. 527.... .. .. p :00 0. .1 0..l.0I0I..-:900... 1.000.102.70. .... 00.00... . .0233: t. ..ltatf.“.3.clll.0lvzultlfé 0.00 ...r: \llo #00030... . 1 0. 0. . .110 ...-0 . .. . 0.0.0. . . .00. .. 0 0. .0: . , $00.01.! _ I .... .0 0.. 3.0. .Q; 0 14...: . 0.2.. .. 00..» 1:0» .. .3. 00.03.2300 ....0 0003.00.35.00... 3 0... 4000.0 0‘ . 0.0.. .0 . .51. . I .l .1 . .0 0 000?. . 0‘- 00. X 00 .0030 .0 . .0004“ 00...... J! .2000...- .00 0. 0 0. . . 0.0 0. 0.0.0.0 . 0. 0300‘0...:0. ..l. . 0. 00. I ...»0‘...‘ :3... 013.11 5.0 : 30.2.}. ..8..0....¢t'b. 0.0.1.4.. 0.0.0.110! 00...... .03. 0:00. x... 3.0-8! . 6.. 1:100 1.0.0.3... ..0 .... ... I -130. 8:20.. 2003010“! .... 1. . . . 3. .. . 00. _ 310:1. .0: 0921.0. '0. 0.0.0.90. 0 0:00 00 ... 000. 1‘.“ .0... .3000000 300:0. .00:- 00 33.00.3000‘ 0 ‘9’... ’3 00 30.00 €0.00000‘o‘w0300: ..0 000. 0 0000". 0—00- 0...O¢0.0v0 .600: 0.00 0.1’f-0.‘~ 0. 0..00 . . I ...... . ...0..-. 00.000231 039...“..0‘00 0 .K. . . 0.0...' i. 0. 0.x. 0 2”...- 00. ._ 0.00000050535IZ ..0 0.00.. 010000.106. 0.0 . \9...00.C .1 ... ‘00 v ...000. 0 . 3.01000 or I 0.0.9..7000.0..- 00 301I06 0. 0.. .0000 00 . . .s. 0 0 :0 3:9... .17»... 2.0:! . v0. .30.. . .0 0.. ...“fl-l‘ 02.. far» I 00.000.000.000. .‘l‘t‘i£~..?t§o‘3 0.0.0010 1.1.31 (2’ 00.337.000.00’103 .0. .0000}! or. ‘0...0§00‘0.0.00..0.0.0. 0.0.0.:000‘00.30033.!000.0 3.0.0 ..‘fr..0.03.08 _ .tk' 0. 0 .10....- n .... .YO...‘f 0 1.001). .01000u0:v.~:0..003.03‘00 0.00 . 9“ I... 0 [(010.1“? . 0. 0 u!...0!0’0000.0..0.0 .00“..0 . ..I .00....04 00000.9... .0 .30....0... ...0.. 70.00.00 . .900. 41a . .0000... 0 10..., 40000.. ... . . ... ...S‘ ...x» 5030013000 . .0 0.0.0.0.. 10.30.010.030 fig‘t 00 00.00.1000... 00.300300205802- 00. 0.0.1:...- 0. . 0 . .... ... .... 0.- Ito 30.0.0.0...30 . 0.0100000....\00u.m ”.00 I0. I .0..~.I.u0. 0?. 0.0. .... .0 01:00 I..I\ .000 0.. 20-000. .006. ...: 0.0070‘000 .0 .0 0000.500. 00 001100.. . .1... ...-0.0!.‘t.:.0 00:10.,30030 .0 .0. "00.0.0 9.... 0.0.0.- 09.0.! 0. ... . 0.. 0:0... .090... 0.0. 00 I 40.0 . 0.. .. . 0 . . ... 0 . 00.0. 0.0.0 .0. .0 -.. .J . .0... 0.2 8.... 0.0 . ... . 6.0.1.030... .... . ...... .00 X. .18 10.0.0.0 01. fl. 0.300050 ...00. 31.300; 2000!... :0.— l. 30. .....oh. .. ,. . 0.. .... > . «, 01....0... 008.000. 03.0.... .0 . :30... .. 01.... ...A 01.80“}. 0.0.0.. . 0..0..0......u..I.. 000...... 00. 0.00 . :0 0.0%.... o. .3000: ..x. . . a: Q00: .2. . . .. p.010... ... .000. £10.00. .. .....o. ‘00. . .0 .0. . ... 0.. 070......0..:.o0.¥.0 . ... 9 . . , . . 0‘ . x .... v . :0 0.3.6. ..., 1‘r 0.. .0001 01.0.2.0. . 0070...}... ... .0. 0. (000.050.300.131! 0. (000.0 .0 4.. .‘02’0: . . . . . 000 :03... .PA.. I ... 3 52...“: 0 . .9 . .Vo. . . 0 0. 0.000000 .0 0.000300%..000. 30.0.0000 to... 0. ....00. .0 00.009}... 0 0 ...-.000 . '0 . .. '10” . .0. . 00.) 00c .. . .00.. 9000.0. 0 _ .‘0' ‘. N01 0».- .. 0) 0 ’0 ....00000 .1010.0.2l€..0 .00. 00.50-00.00 $1.000...- u 200 0 .. I00 02.0... . : . ... I .. .0u....0 . 0.. 0 0 .01 04. ".60 f I .h 00. o .90 .000..'0.I00F04.0...0.oo 0. . 3010: 70.: 00.00.1300 0.. 0.9, .0.- 0.0000000300010000"... 1. 00 .070: ~.0«...00 n. l, .30. 3.7.0.07... 0 n .00’. 0" _ .0 , 0’0 . 000.10 .04.» 00”....0. 02000.. 0. a..0.-,.0 000. 00,0 . 43-0%,. . . . 0. 0 .0) 00‘. .... 0.0 04'th a .0 d... . . 10““‘1‘ . 00 ..Y$|0-0.lo.10. .P. ... . 0000-. 2 7.00.9.0..\..0... 3:»...1. to}. ..0 0| 0. 0H ...f'ttk.u.n... , 10 33000.. . .0! .00. . I. . _ I 0.0 0 00 0.00 10000.0 MD... .2... .s 0 _ .0 a .0 030. 5030? (if “00"...”fi 0.0.20? , . . . .V . 0 (l0. 5 003-11. ‘ 0.. ..0. \0 . 10 30.70 .I "...“... ..H.’ ...-:0... 00.. 0.0000 0.0 00.10. .. l.- .‘o . .... I . 0....Q 00.0 0 0 .I .. h .... . .r.m~k' 3?}.0‘Ar40030.‘ 01‘ 0.. 0. 00. 0... 0.00 00.0.0.0”..‘9. . . .0000. I. .. I. 0 . . .. . {0.0000146 . 0.03.03” .0 0030.00.04; .‘0. 0.....0 00- . .....tvt.‘1£1 0.1!. 0.0 0.10.".V. . ‘.0.00.I...0..0 v .. .09.. 0.000 0. .0d' 0 300.000 0.. ...”000 .108 2.0.. 0.000000 .. .0; It .. I. .000 (0 b .0. (:Mwn .. . . ......J 0 0 0.0.00 .000 00..I..000’. c .00 0. . .... «‘02 .13: w0.0.0:»..........v.o«.6.....0._.0. ..0r09Lu..luvu..l ...P 0.0.0.00” .f . ,0: 0. 0 .00 .000. . , .I 3.0.- 0.0.!00’L00H'lin0u0n200n 0.. 000 00.0“”; 00.. 020.000»... . 0. 0.9000100. 000. o 04 .0 D i 0“}...00"... 0.0.0.00 . . ’ 0 .00 9 .... -.0 .07.. -.{'l§100900. ... I . 00‘“ 0.00,]...‘0200000.q0.ul~ 0 . :00. c 00000.. . .000 1.":.."..’... .... ‘0 O 0000‘" . 9.. . . 0.0 C' .01.!00I. .0 .p 00. A 0 00 I 00"].0. . 01.03020 0...! 0 u .30.? ... 0 ...-00 .0 .0 3‘..00¢00.n‘0.ifl¢i.00 00. .0 "~08... 00:00 0.0.10: .000. , 44 . . 0000 .000 9000:1501... 5.0000. 000. .0. .00. 5 .000 S 0.00 4.00040. 1' 007' p 0 .803 000 1000...... 00100.00. 11010-010011 0.00310“ 00.0000 0.} .00 0‘00. 00‘ . 1.0.050...) 032.000.. “1.20.0: ...-100.01... .... ...0 .0... 00.. 10:03:10.1.1-1 . . .0. . :7. . 0. 20000 0 120.131.00.000! . .0 0. I.‘l..a$.o00-3..OIIC.I ..19 .9330... . ‘00}: 0 0 on 0.!‘. ..00‘ ...0 .0000. 0. .94 .. 0.0-0 000003.00 000 .0 .0. ....“000’5 iiiloffinflw 0... . . 0.0 6...: 00.0. . 0&0 :0 ..000'0000. 3 0... 00.001.022.033 J 00.0.0.0 0. . 3.00.350. :0. 0.0.3000. . . .... . 0 . .f. “0830.13.00 I .0. 0 .09....- 00..005.030. .0... 00.6.1.0”..0030 . x. .2 ..R. 000.00. I c u. 0.3.... . 0070.000 3.00.00. 0500...... 0‘0000. -00 0-0 00’ _ . 00000. 00.00.0004 00000;. .000 000.3“, ...?0000-010. 10-000-‘0 00. 9'. 0. 0.00.3.0. .. .. .:....5.0«0.2.av 0.00. 19.00.0500 5.00010 ... .I .0)... .0.. .0000. . 00,10 2: I . .0. 024...- 0. 00.0.. 00.000. 0.30.. 0.532.... 0.0. .20.). 0 t #00 ..0 500000! .0. . .0532: ,0 00 a '0 ....00..0.1l...0..00.0 0.0300- .”0. .000 0-300020300000005134 001.00. 0 ...0000. 003.0000. 000. . 1.9.0.0w0oa00... , . 10.000, ‘uz...0l v 000.43.0.0.000.00010800: . . . 0.0.0.630 0:0 0:0... .0. but-0.0.0.0 (00 .Khl .0 0 .....0. 00.0.7... ...-.000 .00.; 2.0000... 0:00;...0. 0 0 18.. 301.220.00.000. ,. . 0. . .. 0.0.0.0. . .0 l3. ‘0 0:7. . .. 0. 00 .00. 0 . . 0005.050003r 003.0..007000I.0. ‘3...»0 0.0.0.000. 0' . . 0100.00.00, 30.0..0’0..§ I J . . 0. 0 . L1H. .4...‘...0...00 3000.....3 I. 1.6.00 0 00.0.9805. . 0.1...0-000‘.C.....0.00‘..J. .2000 .0. . 0.00.1303: 00.09.0200 .0 . . 00.0.0 ... v .0»... “0.... . ...- ...00..0l3..| 1.200‘Iiléti0 53.0.00.»0300530...Il‘.9.t 0.0 . 00...0a00.000l.0.iw00..0.. 0...!“ ”00".... 0.0;“; 0 . 0 . 0 I. .00 0‘0. u. . O: . 00 t I .03. 0.1.0 ..I .00. I0. 0 0,-0‘0a 0'0‘00‘00‘ ‘ 0‘ .¢ '090000-. 0.0 0’0 0-0 .. 0 I 0 . ‘ . 0 . 3030 a . . .0972. In...” . 4:500"? _ .8 L- ..x’....l:... 1...}?! , . . . . . 00 .000 -0. 0000.30. 0‘ .00.. . 00000.00 .00 00000.. .... . . . . ... .‘00. .00.. . lo.00.0£0.\. _. . . . 000.0 . 0. 00. . . . .. . . . . . 0.0... 2.0.0. 00000. . , . 0.0.0.. .. . 4 0.0.. ...-000.000.0000. {0.20. 0. 00?! .0010. , o. .0300.‘ . '3','. 0.00.3‘0 .0. . .. 00. .'00. ... 0. .0 0 0 $00.20!. .0 .01: ,0010‘0300 no. ”Digtii‘ ....00 n... . 1.1).... ...“... :l; .0 “0.0. 0: .td . 0.0. . . . I000 .. .. 0.0 . . ....0:0._‘0m..0u'3800!'fl.0I00 :2 001;? I000 . “2...... ....I.a.uv..o......,~.u._..2 1‘ u. «in... . 0 . I . 00 I - 0,-0.9...90n’. . 1... 10" L 00... ‘ I .000....... 3.0 .. a. Iva-00.0010 ‘.\.I0. 000,000 0 0. 009*.0r 00!: 0000.00...» 0.0 L0.nv.003—000...0030 000a ..0000 n 0002.00.35: .3.....0...0I. q I. 5-... n 0 . ......‘r' 03"“...“t .0...- . 5 1 0.00. Id..cl.0 . 0 o 000...: 0.0. S .I.0 1.0.0.0 .0 $0700.03 3000000000.! 0 .0. . .0 5. 300.00 . ... . 30 . 3.0.... 0:00.. .... ...0... 200:0. 1 . 3.0. .. . . u; .. ‘3 . . .. . .0 .J01 0006 0.080000%}: I .0202. ‘0 ...; no ..5003, . -1000... 0000000900003; 9.. 1.00. ..8000“iu4 0.0:... .. .0. 00.9.0 .00 . . 00 .0 . I o 0 .....0... L .. . u c .. . 2.0.0.0....4’1? 0100000.0000‘!000.\ .. .. .00.:l .0. €00.02. 0 . Y0; . v .5, v .0004 00, . . _ . . 0r00‘.000.. 1. . ..‘0-0 000.000.0092, 70.0.1000 000.”.00010». 0 0H . 0010 ...0’ 0.0 . . , .0i'0. 0,0000060‘00000‘0‘10‘ 0033‘ 010.0030; 000‘ . . . .000. .0000. 08000000000030.000“.! ...0. 00000.9..000000’000‘0 00.107.00.00. 0.0.0.00‘000330 0 I00000 0 00r030ulJ..00I000 .00 .. 0.0.. ~ 0.01.0.0. .. 2.300;. .0 0!.2000-0 5.2.0100. .00 0010.... 9.00.1.338303000000 .0. '0 00.000. 00.000.00.003) .00000.\... 0.0.0 . 53003.0.0...ro.....0...q'.£0:. ...-00000.. . 0.0.0 . 000.000.00.000. 0000-0010....0330000.0€0.0\I~.l.0l.0.3000 ~....0§3.¢.00 . ... 0 .0 0 .0000: .1“.0 0 .. 00 0|. 0.1003.0.000900.3.'.0000‘ 1.0001... "00 I. 0 0.00.00.00.31... 0.. .0. 0. .Z: 0 0’? 0.00001 0.0.00.0 00 201000. .000? 00000000 '0‘1’0000 . . . . . . Q L? .0030. 0 03300.0 0. .0... . . ....0 001....1 ...}.0 ..0 0'. 10.....0 ‘0 A :09 1000000 0. $.00: 0.0 0001000 ‘ I r . .0. . . 02“! 0.0 ... . . ... v‘..-0bn0.‘0.u ...-0 0. . 0. ..0 -,.0.00 .00 ..0-010‘. ’00 00 10.30 0.000.000..0-.0.00. . 2000.000 ..a,— . 00-0 0 ... 0 0.00 .0000... I . .... . 00:0. .0 000 . .00000 t .010 0. 3.00.00.10.05 .0..10 l0... . 0.0!(000‘ . ... ..0 0 .0 o. 00 0K0 0.00 0'. .500 . . v ’0. 0 .0‘00 ‘.1 .0 0 04 .0u(.-o . 2.00.. .0 . . $0.. ‘0.- -.000 .2110 “”00 a. . 0 . ' 00:00.?! 0000.0011000. 0100.00.00 . , 0.100 .00.... ...v... 00.0.00 . 0.0.00 .. .00000004 0.; .1000: 0.090: 0’..0...'.I ‘ I .00 .. VuLMV"... .0. . ...!00..\ .... . 040.0. .0 :00 .00.... _ 0 .040000 .0... 0.". 0. . ..vilc‘. .. I 9.. 0...... 0’." I .» 0.0.01. 00.0. . I. 00.00 051.00 0 ..-... 00 00:0 . .. .20.: . 2010.. .. .0 0.00... 5‘0: . 0000.....1 C ..0'. .0 ......0.'0.1 Q . . 00 . . 0.. . 0 0. .. 0 3000‘s. .03. 11.00.. . . '0-‘00 DIV .fi’v.2.00.§ , .02120 0‘.. I 0...! ... ~ 0 I!‘ I .0. 0 3.00'00 ,‘L . 000.00.}. ...0.....‘0. 0..§L00.:00,.K1.00.00¢ .00. .0000 ..0-‘.0.1011..IQ0000~ 6...... .0. ..0. Q... 0 00.0... . 0.....00 ‘IYI; .... ‘0. 0‘0... w I. 0. ....02 ...0. . 600.10.}. 03......1‘0‘: s . 00.: 0 0.0 1.0000(00. . . ...-0.! 0! 0C . . 04‘. 60.0.0010: 0“!— 0 . 0.0 .000»... 0...". .‘0 0“. \I 0-... 000:0. . 0... I 0 . ......0... .3): 02.0090... 0 .00‘0. 09. . .. O 0 0)....0. .720.-. .0 1.0.0.. .J...a. 0.0,. ‘1 0.70:3... . .10. 00‘ 0.0:! . ...J: 0. . .q0‘03 7’? 0. . 410.00.! 10 0... .00 0‘1 0.1.1.0010 . 3‘. 0...- .0905; .0». ...I. 0 0-.AJ00‘00000 0 i‘t......" 0.0 a... '6. ... . 12.0! 1.0.3300..." . 1&0”: 3‘00. . 000- 0 . ‘0 04,. I. . .00 I. I0. «.0. .00. 0.. 0' 0.1.. . O. ‘0 ‘0'“.‘CI' 0. ’0. 0. .0. 00. .0 .3001. . . 0.I I 0 0 0 .000. .000 0.. 000.000.! 0 I, 0‘ . '70.!01. \ 700.4 «.000 0 000.0 ...: 000.00’14 ' ..0 .0. .. . 0.00.03 I00 . ..0 .30.. 1.. .000 .10.... 0.. i . :00; 0.0 ......01... .0] 0.0.0. .000 .0 00.30.194.901... 0 Lllu‘l. . .00... 00000.0. .... .0 0.00 ‘00.. .l0\000 03.0.9.0... Q 7‘0? . 0.0.0 0.0 0 0.000.000.0f0'0 «l 0,0 10: 0.00, .0 0. 0—0.! 10...”. ...00 4‘ 000! .00 0 ._ .000. . 00 . 0... 0 0 . . . . . . o 0 I .00 .00. .0. . 0‘ 0'00...00 00'.“ 0.0" 04 0 0.0.. .00 07‘. I .0000... 00‘.- .9 . I . q 0A ‘1; 0.00- 00 0.20 00.1.0000 .0000-0-00 ..0000‘...00 00 .‘JI? {0.00.0 A. on! O0 0 0 0| ... I0 0 . ‘0‘ 'Tldbfl ““000.”0 0...”.0. 0 uric“. ”00.00..“ 00. 0 0, 0 0 . 0.. 0.0.? 0 . c . I 00. . A0 0|- 00 0 ’I 0 ’0 . . . . . l . a . .. . I .... t . ...... .0. .. v. 0 Jul”... P. . ..0. 0. . :7... :10 12.. . I . .. .. 3.100655"! . . , . . . .0 0.. 01...; 009. .0. 0...: 00:00:10,... ...0 .0000. .0. 50.000.010.000 0.0.0 010 ... 0.0.0.0.... 000 .0. . .... . w. 0 .. I. 020 0000000 3‘ 00..-. . -0 0. O 0’. .00 0... . 0.. .00 . .. 0.0.. I 0.. 0-: 0‘. :20. 300.10.. 04. 00. . .0, _ . <0. 1000. 0 .0 0 . I 0 . 0 0 0. . ..0. . Ilw' . 000. . 0 .0. 00. . 000... . . . . . .00 0 . 0.. , 0.00- 97.0 0|.I.I. 0... 00.0..- J o: 0.0.0.. o .00. 0 00:00. .00. 0 . . . i 0 A 0 .. 00. .0. 00 .. 0 . I . 0. . 0 0 0.00 .004: .. . 0......0 .. 00..) .0.t.00I 000300300 1 ‘0. . .7 . I . , I .... . . . I 0 0n . I. u I 100 _. . ... . 0 0:. 000 . . . I .‘ .000 O. 0 ‘00.. 073000.. I ... 0. ..00000 0 Q 0 . 0 ...... 0.... . ._ 00. ......5... . .308... 0., . . . 0 ..‘0 "000 . 0 0" 0 0 . . . . . .. .000 0 00 0 0. . . antic-3.41.0.0 a ..0 0'0... . _ 000.00 . . 0.0:) ... 0 . . v.10. 0 . . v 0. .. . . I \0’0000..- .90030 00 00 0 ..‘0 0 .‘I . . . . 00.. ..’.~.0 0“ 0 H .0 l0 0. o 0 0 . ...... .0 .1400 not 0.0.0 0 0.00 if ... .. . . , .o . . 3.9l“0 a 3.3.500- V :00 0 0. . . . .‘0 03.. 0 I00 0 . Ia . 0.0 ... . . . I . ...h'il 00"0‘50 |‘,0 00.00.. .. 0. .00. .1 . o . . 21.0.. 3...... , . . .... .2. zvu .0 00.0.00. 0 a 00.00.00. I .... 9o. .0.) ... .1 . 0. .. 0 0| . . . . . . I. 0. .. ... ...: .. .0 .. 0 0. 0.0.... r0."”0:10“. V. o ‘ o 00. A I .0- ....‘0 . . . . . 0... 0.0.0.003... 00.. I 00 .0. 3.0.0.000. “DA.| I. 09,‘ ‘0‘- u . 0 I 0 _ . . ...: ..l .0. . . . . . . ... 0... 0.0.0.»; 37.”. u . ‘30 0 .I . . .0 00V. ‘uqfluiu‘.1.fil: 0:90.. ........o . _ ‘I. . .... .. . . . .. ,..... ... I ., ., . .. .0 .... lit-0 " . .. .. 00:00. . . . 0. 0 I. zflhluu0\w.0 0 .- .8.....fc.. . .0. 00.. 0-! 1 0.00.. J... . 23.01. _ 0 ....h" .. ..0c'0 Y‘..Q.0 «.0000 an 0000040. ‘00... . . 0|. . . . . . . .. . 0.“ 0.0.0. 0 1.0.4 Z... 00). 0.0.0.0.... . -03.! 0.I|..\-.... . . . 0.. 3.0.4.0 400. I. .fl].I1_.0_ . , .0 00‘. 0.. 0 0 (0 0.0 I 0 0 0 . J. .. .. . . .0 D . I‘l- 0.040-000 . . 0 .0 . 0. .0ot...-.O. 00.0.. 0. . , 0. . 0.000... . 50‘.0v: . .0H‘0uu0 . . 0 a.” . . '0. 03“0 0 L’L“. '3“, 0. .. .00 0 . 00:00:00 10.. .0- 700 It. . . . 00‘ 103:0...2t .. t 0 .. v . . . . f... .9. F‘. 1, 0- 000030.“..0‘0‘ O 0 u I 40 . 0. 00300.1.0 0. .0. I .‘00‘ 0 0 .0 [.00 0. 50 . . i l: ‘0 I00 . IO. . . .0. u" \ 0 0 '3'.1_.0\2‘<. 0031‘ .0 0 00 0 0 . t 0 0 0 0‘0 C.‘Io0nl 0- .0 0‘0. .000. .0 . 0 0 .00: 0.0 050. I: 10.0 0000 . . . .. O0.-. . 0. 002,. 0 >000 ._ . . . . . 00‘. . .1 7’0, .0090..’"0!. . :00-) . . 0 . O .. . ... ...0... . 9\ 0.00008. 2.0.00.2. .0030! 00.0.. 0 J \...0011. 000000.000 000 . ... ..ua .0 00. 0.0.001 0.. 0W . . 3?. .000: . . . . I10 ‘00,. 0.0 I. ... . 0 . a 0 I , .. 0.... ... 0.. 03.000.01.030. .0. ...0 . . . . . l0 ... . I0 . .20”. . . . VHS... 0.0. . . 0.000.300.0000 . a-- .I. I . ...-u ... .. 5.12:0; 000.01.. ... . 00......w . .. “1.0.0“ . 9 o o I.0\. 00- .0..IO 00.0392... 0. [.0 . 0.00.00! . . 0 0 0.. 0 . «I... .I O . I 0 0| 0... . .... . .0. .. A . . .0 I3! .000 Po..£—“‘000 . . . I .-. . .. . . ..r; L. .. . .2. , ....43.......: 302.3%}; ... I . 0 0 70.0.0: 0 0.0.0; . . ..0 0 o .10....‘000 . . . ....‘0 .0...... _ 0,.4 . . .. . 1......"r0s03fi. V . .10 ’0‘91002 0‘ II 01 '0‘ I c .0 I .00; :00: 0.. . ... .. 0.0. .0...- .0..C.. 0800:. . . . . . .. . . 4 . I _ .0.- £020. 00. 0 0.0 . ..0.0€ '0 ’3 0.00 .0. . . 0 ..0 .4.0..:.....1!u.0 ‘0. _. . 0 .. ....30 0. o. . .. _. . . 0 . . . 0000000.. : . 30th:.“ Ianohflfmrveu 0M0 . 0 . . . . 3 . . . . v... . 0 . . 0 . u . c .06 o ...J...\.... ..«10I0...00.J . . . AFN...“ .0 0. 0... :0r 0 0. 9030.10. 0 00.1000” 5.0.10 is - . . .. ...:... . . ... ......u...u..n:.§ 3..., .... .. a. .o 0 0 . . . . t... .0. . 0 .0! ...u. I 0 07.0; .09 0’16. . 0 003000000 0 V . - 0.. I .0 . 3 . 000. 0.. . ... 00. . .N....005I.h0. .90“ ... 0. 00.0.0.0.- -‘ 00k". 2 0... .0. 0. . 0 0 L .10....1002 3:00.00 . 0.0 .300”. 0.0000 3010!...0I\000 '0:- 0.00I0 0900.... 00.10 , . 0000 000.0.0‘09‘.”0I-:10 I n . u‘ ’ 000‘ O I 0 0-0 000 00.0.0 .0000. _ 0'. ..0. .0007 :0 -‘. . . . . 00.0.0.00000.’ 0 A . O 00 . 0. o. . , . 7‘ .0 000.0: . ..‘0.0\00‘ .... 0.. o 1 0.. I 0. 0. I00}. .0 00 v I .0 I .. . . . ...: . . ...0. 30.3.0030 . . I o I .. . .u ..0 .4- . I. (:0... v.0.” “30.60...“ .. ...I 0.0 .... 2 . .x. . . 0 . .19.. ..u0.. . . . 2.... “I: .00.. 0 . 0-0. I... ..0- § .50. 0. V. 0 . II I _ 000.000 0. ... on. ,‘it. 02 0 000 000.00, ..0 ...0 .. ...-5‘ 3000.080 .0101... ..‘0 .. . ..0 .0. 0 00.1.. 0.... 0... .‘0:0<0.0.0 0.00‘000. 0. o I 0 0.. ..r. 0 . 00 . 0 .0 . . ‘ .. 2.. . .0 0 t .0 ‘ 0.00 0 .... I. ...I. x 0. .. . 000(0 ... I ‘.¢.r “0’0 .0 00 0.0 . .9I. . . ,- -...-. A. 300.0. . .00....01030 . . _ 00... . . . . . 0.00.0“ .I .0 0. . . . .. n . _, . a A. . . . . . . _ 00' I . .0 | l .0 ..0.00 400. 0.... . 0 0 .l.‘...w..l.'0u.u.l “0?...” 11.0.0. :0 .090— 0 o . .. .0 . .. . 0 1. . . ..v‘. . 00 . 0. i w 0 I . . | I . . a, .o . . .... .0 . I 0 .1 . . . .....u..000 .. .0 0‘. . .. . 11:00.4. 0.. 0‘0. .. ..00“...0u. w. . 0.". 10000.... $0.10 .. ...(3‘ 00. —II ....4 0 I. . .0. . . . ... . . '00. ... 10.2.0... 0. . 0. . . .030: F. . _ I. . I 0 .o I. .. .... . . ... s .. ,... 1000. .. 3 .. . a . . .. . . . ... o :0...2.. 0.00. .0. . . :00 .lf ... .13.... .. 0|. 0“: . .0. .. .07... .. .0 A v . 0 . \l .00 0 . 0.0... A 0 v .00.. 0 . . ..0 '0‘0'. ‘0. .. ..0 . 00.0 0 0. . 00. 0:0. ...00 .000 ,0 . . . . .0 0. ..w.. .....0 .I “00. 0 o 0 . 00 .0 0 {4.0 0 .o 0" . 0. . .1 0 r . . ..0: o I n . ...A. 00!. . ..- ....r..0..00.&0. . .1 0. V 00.. ..l. ...}.‘0; v. . . . . . . o“... 00.. . . . .0 .109.‘h.0 0. 07‘00P 0- 0 .01053.) 7!... I... I I.-. . - ...} .. .. ...: .... ..........1..... .L _ ...: . .. .. 2.; ... . T . .. . . ............Z .. kahuna... ........... ...... .. i2: h on .- 0. I. . 0 0 1 .. . 00' .0 .000. ... 0 30.. 0... .00.. 0.0.0 0 0.“ ..0 0 0.. 0 s00: . . . . .0. I 0 r. 2:. ...-.0. .- :.L..~.~S.|.l0.1.0 0uI0..000u.i~Ii fihonnor'?“ I. 0 0 .00 0 . . ... 0a. .00. . v 0... 01... . 6.10 0.0. :0 it}... ..A , . . _ . . _. 4 u . .. 0 . . o. .. . .I . . .. .- .. I . . . ,. ...); . ,_ . _. . . . a..2.......r.....fi.....flma..:qqu«.. .25.... :9. 2 x0 . . . I 0 . I. . .. . . . 000:0 . . .. .. . _. , . . ... . -.. 0 I I. I. 0.. . ..0. I 0. 0010.0 00.. an: 0. I I 04 H0...- Z0 0. ... . , . . 0 .|.n’0 0000.?th .0..00.o0‘90--.90‘”N0’J0 0.. ’. 1.0.10.4! .0 0”” 0 0 . ... . . . . . . . . . > . .. 0 0 0 00.0.0... 0 ... 0.. II 0 I40! .4. 0 0 wt 0 or“ .0. . 0 0.0 . 0. H0. ... 302.0 0 0 . . .. .‘003 {:0 . 6 0.0. .0. . 0 .0000. 0|... '0 a '. awa‘” ’Jfiu 0 0.. .. 0 \ .0. I . . ... 231...”: t .. .. 1‘0 . ._ 1000000000.... ~ 0 03.000.00.0-0 :70 . . . . I . . .. 00,0 A . .00 0000 .0. 0.. ’0... 1099.00! .Ocfll0 .I , . 0. .9 . . .. . ... 51...... ... _ . . 000.00. 0 0.! ... .00 f . . . 0.00.. 0 0 . . .. .0 . . . n . I. . 0 0|.. . ..- . . 0 0300\7000, .. . I . '0. ..‘Q. 0 . . 0 7.0.... .000.0...| . L0... 00‘ c. . .00.. 1 p 20.. n a . ... 0 .00... 1 . . 30.0 . . . 0. ... .00. w. 0. .' . 0. . . 00.0 0.0 000 0.00 ...... . .0. .0. n . 0 \ 0 . I .... . 0. i; c 01.00 . 0 .. . r q . ..0 0 . .00 ..‘l. . n . . .. u 0 . . .. . 0 . .. "H0 '4... "0.0“ 0 Q. . . . . .09. 0% 0. ”....100000 .. 0.00 .0... . . . ... 0 0 0.. .0 0.0.0. .0. . . 0.0 A. 00.0..00.1 .0... 000.... .00... . ...00... . . . 0 0 0 .0 .0 ,. .00 ‘.n.0 . .. X00 0..'...-..0 00.0... .0! .00. I. o. 0. . . x .0. . 000.. . 00.0. . .00 . . c .0 . . 00... . ..........0...'..0... . 00‘0‘00..0-.|.0 00:0 . I . I 000000. ‘0 . 0 . 0.. 4....0'001. 0.0.. . .0.I..~Vo._0103 1.. 1.00.020}... 0.. 100 I? .00.. . .0 . 0.00 no 0.0.09.0... I . 0 . 0 . . .00“ . . .. 33.0.0.0... .00. .. . .000. 0 - 0 . . 13000. . 0.. 0|."0.0..A-0|.. ‘ 0 0 I 20.00. .00 p . 000.0 .0: I . 00.0; . v . 0.. 0.. .0. 0. 00. 0.0 . 2‘. .0 ..I 0.. I ..0.000. n 00. 0.0 0 .0 ‘I .. so 0.00 ‘0: . . .0 .... 0.. . I . .0. t. . .. . . , . .l.00. ., . A 0 00 .. . . .00. 0 . u. I I I0 0 .0...0 .0 0 . . . 00.00 \0 0 0 01.0.. I. O ... 0 0 “I 0 0-. 000.30. I . . , 0 .. . 0 0.0000. ...0.010 0.. O 0.000.. . .. . 0.0- .. .0 00.0. .. .00 u s . . c. l 0 0., 0.. 0 0 V . 0.0000 0... 2000 . 1 us 0 0 VI 0 0 o. . 000! 0 ... 00...; . . . 0 0 . .I . . 0 0 0 . 0.0 0.0. 0 0 0.. . u 0.0 .0 0 . . . . . 0 ..- 00... ~ ... _. I. a . . L. 00.. 0.. .0-.. .... . . . .. .00 400000... I... .0 0 t?- 0..0.03 ...I . . . . . I . . I0» . . 0 . L.0.000.0~0 0 0. _ ,.... . . . . 0.. 0 0.... 10:0 . 0 . 0.0 .100 ... I-.. . .. I . . ..0 ...... 000 0.00.... . .. . . . .. -.. . . o 0402 . ..0 ‘ 00. 0 . . 0I00 .....0. 0 ,0 . . . . . . . 0.0. . I ..- . .... ... I . 20.0 . ... . . . . . . . ,. o. . . ; 0» . . 30.0.0 0 I00 3 . , 0 . .00. r! I 0.. V '1 ...-00 . . . .. 0...!- . 0 .0 0. . . Q. 9‘ . . . 0 . 0 . 10.0... 000.0 .10. 030:. ... I. . 0a ... 00 ... .0. .... 0 0.0. .0 O I ._ .0 .. . I .0 I ... I. . . . . .227... 0.... . ...100 .0... . 0 .0 . . 00. . . 0 0.0. 0.0L .‘JO 0 .0: 00. .00JI.00 0.0.3.0.... .0. . . .. , .. .... .. .. ‘0 .0 .. . 0. .0 . . ... .01... .1‘00; '0‘.0000.0«.. .. .. _ . . ' ...» .00.} . n . . . ... .. 0.0.. .... . .00 T! .0 0.9 . .0 00.00.0000 .u‘c...000~. 0 0 00 0 0 0 ..- _ I0. . . . ... .— 0... 0‘ v . .0 . 0 0 0 00I 0|. Y. .000 '0 Q . ... .4. u. . . .‘I. 00.. 00 I 0 .0. . 3 . ...00 . .... 4:..000 0‘ 00.. o . a. 0 . y .0. .. . 00. . ..I. . 0.0 . I. .. I 0......00 . .00 . . 0. - .0‘ 0 . . .0... . 6. 0 .0. . II .0 0 . ... .. a 0. ... .... . . 0.0!...‘0 .0 . . .2 0 . 0 n. .00 . . . ‘0 0. ll... . 0 . 0 . ..n 0 0 . . ..0 0‘ .0 . 005‘... . .0. . 0 .0 0 00 0 .. oulf 0 n. - 0 ... ‘. v 0 0 . . ... I . .00 . 0 ' 0 00 . 0.0.0.:0 000000000010 ..........0.; ..000 :00... 0.. ..I 2100: ‘1’: .... ... . . . . . .00 00. . 0.0... 0‘ 0..) .. 0.0 . .00 u v I ., c ..0 .. .0, .. . . . I. .0. 0.. :0. .0 ... . . .0: I. 0:00.. ....0-0’.‘ . \l.0.. .. .05: .00... . . ..00. . :0. .0..r..00.. . ... I... . I . .0 . . . . .0. 0110;. . . . . 0 . o .3 .. 0 001.0000... .. .0 0... .00 000- .0000. 0 0 00 0... ..I .0. . .. . . :90... ....0 .. A......0 40.01.70. . 0 T 0.. ...: O . .... .... . . . ._ .0 . .. .. 0... . . o. o .0. .. 0.000 . .00 .. '0. . ... . 0 .00... X . . .. .00. .. u 0. a 0 . .0 0.0 00 0040.0 00.. . 000.. '0. I . . .- .0! I. . ... .0000. .0 . ..0. . ‘0 I ‘.000-0..0 .. ....p' 0. 00. 0.. ... 0.- 0.. ... . 0.. 0 00 0. v 00... 0 . 000 0 .Q|.0. 0,0. . . 0 ' 000‘ . 0.. 0.. n . . A. 0000‘.0 . . 0 0.9 ....u 0.00.000. . .01 0.0... ....00..0.:..0... I .0. ’02 ‘— ... . 0.0T... . . . I .I .00..-.0000 00.90... .....000‘0‘3.’ 0. 0.0.0. 1 0 3.00u0 00.0.. 0 00-0 I0 .0... 00l 0 0.... 0 00 0 0‘. 1.! 00' I .0. It! . I 00000 0001.. 0010.00100 .0 I. 0 0 0 0 u .0 I. ..0 I. 000.00 0 .0I.. .0 . 0.. u 000. 0.00 000.!0ng 000 I . 0.... 0 ......- II .00 .0 0 0 . I ... . A .0 l I . I l . a . .— 0 0.0;. 0 . 0.0 n . . .0 ll. . .. II. o 0.20 1: 00.0003);.;I10 0.03. . .. . ..l‘ll - .. : 00:00.0. .0... ’10:.0: filfl‘ofifil .0. . 0 0 0 .J .o I .00 00.30.00‘; I I I . .I 0.00.... 00.0 ‘ . 0‘ . ‘ I ‘l “'1‘ :1. IJRP. ARV A): 0 Michigan State University This is to certify that the dissertation entitled ‘ INVESTIGATING DFNA20 MUTATIONS IN y-ACTIN: STUDIES IN YEAST, CELL CULTURE, AND MOUSE presented by MEGHAN CHAPMAN DRUMMOND has been accepted towards fulfillment of the requirements for the PhD. degree in Genetics fi/méww Major Professor’s Signature 3-ZU-ZO/o Date MSU is an Affirmative Action/Equal Opportunity Employer PLACE IN RETURN BOX to remove this checkout from your record. To AVOID FINES return on or before date due. MAY BE RECALLED with earlier due date if requested. DATE DUE DATE DUE DATE DUE 5/08 KlProj/AooG-PrelelRC/Dateoue.indd INVESTIGATING DFNA20 MUTATIONS IN y-ACTIN: STUDIES IN YEAST, CELL CULTURE, AND MOUSE By Meghan Chapman Drummond A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Genetics 2010 INVESTIGATING DFNA20 MUTATIONS IN y-ACTIN: STUDIES IN YEAST, CELL CULTURE, AND MOUSE By Meghan Chapman Drummond Ten dominant missense mutations in gamma-actin (ACTGl) have been reported as the cause of hearing loss in DFNA20 families. Although the mutations are located in different functional domains of y-actin, the end result is a progressive form of non-syndromic sensorineural hearing loss beginning in the high frequencies with an onset in the second to third decade of life. This shared phenotype is indicative of a common functional deficit in mutant gamma-actin protein function. To address questions pertaining to the unique function of y- actin in the inner ear, I implemented a yeast 2-hybrid screen of an inner ear library. Surprisingly, given then number of proteins in the inner ear known to interact with actin, only identified six proteins were identified more than once in the screens: y-actin, B-actin, cyclase associated protein 2, cofilin 1, cofilin 2, and a novel actin binding protein, ubiquitin E2i ligase. Furthermore, I used a directed yeast 2-hybrid to show deficits in the interaction of P264L mutant y—actin with four of the actin binding proteins from the initial library screens. Next I evaluated the localization of a y—actin specific binding protein, annexin 5a (ANXA5), in the inner ear of the mouse. My data demonstrate that in the postnatal mouse ear, annexin 5a is differentially localized to the stereocilia, cell body, and nuclear membrane of developing hair cells. Anxa5 knock-out mice do not show hearing loss by 3 months of age. Furthermore, y-actin is appropriately localized to the periphery of the stereocilia and F-actin gaps in these mice. Using a GST—pulldown assay, l confirmed that annexin 5a interacts exclusively with the y-isoform of cytoplasmic actin. Therefore, the interaction of annexin 5a and y-actin in the inner ear is not critical for establishing or maintaining proper hearing in mice. Finally, to address questions regarding the effects of these mutations on the structure and function of the inner ear and the molecular mode of action, we generated a knock-in mouse model for the p.P264L mutation. In the process, I identified a novel Actg1 transcript, enriched in skeletal muscle—containing tissues. Splicing of this alternative transcript creates a premature termination codon and is concurrent with down-regulation of Actg1. A protein product corresponding to the use of this stop codon was not found. I provide evidence that inclusion of exon 3a is means of post—transcriptionally down-regulating Actg1 via the nonsense mediated decay pathway. The knock-in mouse model recapitulates aspects of the DFNA20 deafness phenotype observed in humans. Mice homozygous for this mutation have early onset hearing loss which progresses rapidly in adolescent mice. My data demonstrate that the mutant P264L protein is stably expressed and localized properly to the stereocilia. Scanning electron micrographs support the hypothesis that hearing loss involves outer hair cell dysfunction, and provides evidence that degeneration of the stereocilia occurs in the two rows of stereocilia uniquely responsible for mechanotransduction. Copyright by MEGHAN CHAPMAN DRUMMOND 2010 This dissertation is dedicated to my beloved grandparents: Mary Sylvia Trout & Robert Manford Chapman and Rose Mary Drummond & Richard Leo Puzdrowski ACKNOWLEDGEMENTS My graduate education has been rich with interactions, many of which I would like to acknowledge here. First and foremost, I would like to thank my mentor, Karen Friderici, who is a remarkable woman in many ways. Karen is an advocate for others — students, colleagues, and friends alike have benefited from her support, love, kindness, and patience. She is confident in her intelligence and high level of success without being boastful. Likewise, Karen has taught me to be quietly confident in my work and in life, to take big risks for big rewards, to take pride in my accomplishments, the importance of communication, the value of honesty, and to not settle for mediocrity. She has pushed me to explore new techniques, pursue novel ideas, and has cultivated my love of science and research. Karen has guided me in all aspects of life and for that I am eternally grateful. I truly revere and respect her. Three individuals in particular have played indispensible roles in my graduate career. First, Mei Zhu, my first instructor in the lab, a colleague, and above all, my close friend. Mei trained me in many technical skills that are the foundation of my work, but more importantly, by her own example taught me that there is no substitute for hard work, accuracy, and high quality data. The exceptional standards that she has set for herself and others are evident in all that she does. Second, Mirna Mustapha, a colleague who taught me organ of Corti dissections and in the process became a good friend. Mirna has shown me the importance of self-sufficiency and confidence though her inarguable success. Finally, Inna vi Belyantseva, a collaborator, instructor, future co—worker, and friend. Inna demonstrates the value of being the best in the field, as her work is widely recognized by colleagues for its unparalleled quality. Many, including myself, have benefited from the support, guidance, and advice that Inna selflessly provides. She has taught me that dissections and imaging are more than a technical skill; they are an art form, one which requires attention to detail and finesse. I am so fortunate to have these strong and successful women as role- models, colleagues, and friends. I admire them dearly and endeavor to one day achieve the level of success that they continue to experience. I would also like to acknowledge my labmates, past and present: Kathy Jernigan, Ellen Wilch, Bill Payne, Mei Zhu, Soumya Korrapati, Donna Housley, Eric Schauberger, Ayo Ajibola, Andrew Riedy, Lawrence Lee, Tychele Turner, Jingyun Fang, and Stefanie Sherman. In particular, I would like to thank Ellen Wilch, Kathy Jernigan and Soumya Korrapati — my friends and support system. Thank you for all of the laughs and good times together. I am also grateful to my friends outside of the lab: Tejas, Erin, Gabby, Rachel, Rabeah, Tuddow, Arianna, Walid, and Paula. I also owe a great deal of gratitude to those who provided support in other aspects of my graduate studies: Sally Camper and Oing Fang, who provided me with a lab away from home; Dave Dolan and Karin Hasley, for helping with the ABR data; Melinda Frame, Stanley and Carol Flegler, and Abby Tirrell, for their vii invaluable instruction and assistance with imaging and microscopy; and Tom Friedman, for his insight and suggestions. I am grateful to my committee members, John Fy'fe, Steve Heidemann, Ron Patterson, Rich Schwartz, and Vilma Yuzbasiyan-Gurkan. I will remember and apply your advice and constructive criticism. You have taught me to think critically about my data, to pay attention to details, and about how to succeed as a professional in the field of research. Without the love and support of my family none of this would be possible. My parents nurtured and pushed to be successful in life. They have instilled the values of hard work and education, which continue to be indispensible as I grow as an adult. Finally, my husband, Gabe. You are my rock. You believe in me when l have doubts. You make me laugh. You not-so—quietly accept my long nights at the lab. You help me to pursue my dreams. Thank you. viii TABLE OF CONTENTS List of Tables .................................................................................................... xii List of Figures .................................................................................................. xiii List of Abbreviations ........................................................................................ xv Introduction ......................................................................................................... 1 Chapter 1 Literature Review ................................................................................................ 2 Actin .................................................................................................................. 3 Hearing Loss ..................................................................................................... 9 Structures of inner ear ..................................................................................... 18 Mouse models of deafness .............................................................................. 24 Chapter 2 Identification of actin binding proteins using a yeast 2-hybrid screen ....... 39 Abstract ........................................................................................................... 40 Introduction ...................................................................................................... 41 Materials and Methods .................................................................................... 44 Vectors ......................................................................................................... 44 Prey library ................................................................................................... 44 Western Blotting ........................................................................................... 44 Primary antibodies ....................................................................................... 45 Yeast Transformation ................................................................................... 46 Whole colony PCR ....................................................................................... 47 Isolation and identification of prey vectors ................................................... 48 Growth Assays ............................................................................................. 48 Results ............................................................................................................ 50 Identification of actin:protein interactions ..................................................... 50 Deafness associated mutant y-actin shows deficiency in interactions with prey identified in the Y2H screen ................................................................. 55 Discussion ....................................................................................................... 59 References ...................................................................................................... 64 Chapter 3 Studies of the localization of annexin 5a in the inner ear of mouse and the interaction of annexin 5a with y-actin ............................................................. 68 Abstract ........................................................................................................... 69 Introduction ...................................................................................................... 70 Materials and Methods .............................. . ..................................................... 74 Animals ........................................................................................................ 74 Primary antibodies ....................................................................................... 74 lmmunofluorochemistry ................................................................................ 75 Auditory-evoked Brainstem Response (ABR) .............................................. 76 Vectors ......................................................................................................... 77 Purification of Recombinant GST-ANXAS .................................................... 77 GST-Pulldown .............................................................................................. 78 Western Blotting ........................................................................................... 79 In vitro synthesis of proteins ......................................................................... 80 Co-sedimentation Assay .............................................................................. 80 Results ............................................................................................................ 82 Annexin 5a localization in the organ of Corti and vestibular end organs ...... 82 Annexin 53 localizes to the stereocilia and cellular membranes in auditory hair cells ....................................................................................................... 82 In vestibular hair cells, annexin 5a is present in hair cell bundles and at the nuclear membrane ....................................................................................... 87 Annexin 53 Is found associated with membranes and within the cytoplasm of supporting cells ............................................................................................ 9O Annexin 5a is on the internal leaflet of apical hair cell membranes .............. 90 y-actin localizes properly in Anxa5-null mice ................................................ 91 Annexin 5a knock-out mice do not have hearing deficits ............................. 99 GST-Pulldown shows annexin 5a is specific for y-actin in whole cell lysate399 Pure Annexin5a does not interact with monomeric or filamentous y-actin in vitro. ........................................................................................................... 101 Discussion ..................................................................................................... 106 References .................................................................................................... 110 Chapter 4 Identification and characterization of a novel y-actin regulatory transcript .......................................................................................................................... 113 Abstract ......................................................................................................... 114 Introduction .................................................................................................... 1 15 Materials and Methods .................................................................................. 118 Bioinformatics ............................................................................................. 118 Animals and Tissue Preparation ................................................................ 118 Cell Culture ................................................................................................ 118 RNA isolation and cDNA synthesis ............................................................ 119 Nuclear and Cytoplasmic RNA Isolation .................................................... 119 PCR Amplification ...................................................................................... 120 Cycloheximide ............................................................................................ 120 Protein Isolation ................................................. . ....................................... 121 Western Blotting ......................................................................................... 121 Expression Constructs ............................................................................... 122 Transfections and Mass Selection ............................................................. 122 Results .......................................................................................................... 124 Identification of a novel Actg1 transcript ..................................................... 124 Exon 3a containing transcripts are enriched in muscle .............................. 124 Exon Ba is highly conserved among mammals .......................................... 128 Developmental regulation of Actg1 alternative splicing .............................. 131 Cytoplasm contains RNA with exon 3a but no corresponding protein product ................................................................................................................... 131 Inhibition of nonsense mediated decay results in an increase of exon 33- containing transcripts ................................................................................. 135 Cells expressing exogenous human ACTG1 regulate splicing to include exon 3a during development ............................................................................... 137 References .................................................................................................... 149 Chapter 5 Characterization of a knock-in mouse model for DFNA20 deafness. ........ 151 Abstract ......................................................................................................... 152 Introduction .................................................................................................... 154 Materials and Methods .................................................................................. 158 Animals ...................................................................................................... 158 Generation of congenic mice ...................................................................... 158 Rotarod ...................................................................................................... 159 Protein isolation .......................................................................................... 159 Western Blotting ......................................................................................... 160 lmmunofluorochemistry .............................................................................. 161 Auditory-evoked Brainstem Response (ABR) ............................................ 162 Scanning Electron Microscopy (SEM) ........................................................ 163 Results .......................................................................................................... 165 The mutant P264L protein is expressed at normal levels, however, the neo cassette reduces expression ...................................................................... 165 P264L heterozygotes and homozygotes are physically fit and fertile ......... 165 P264L homozygotes have an early onset, progressive hearing loss .......... 167 Hearing loss in PL/PL mice is due to degeneration of stereocilia ............... 173 Mutant P264L y-actin is properly localized to the stereocilia in homozygous mice ........................................................................................................... 188 Discussion ..................................................................................................... 194 References .................................................................................................... 1 99 Chapter 6 Conclusions and Future Directions .............................................................. 202 Conclusions and Future Directions ................................................................ 203 Appendices Commonly used methods and reagents ....................................................... 208 A. PCR ....................................................................................................... 209 B. Polyacrylamide Gels (Reducing) ............................................................ 210 C. Continuous Native Gels ......................................................................... 211 xi LIST OF TABLES Table 1-1: Summary of previous DFNA20 studies in yeast ............................ 17 Table 1-2: Actin binding proteins and deafness ........................................... 26 Table 2-1: Actin prey identified in yeast 2-hybrid screens .............................. 54 xii Figure 1—1: Figure 1-2: Figure 1-3: Figure 1-4: Figure 1-5: Figure 2-1: Figure 2-2: Figure 2-3: Figure 3-1: Figure 3-2: Figure 3-3: Figure 3-4: Figure 3-5: Figure 3-6: Figure 3-7: Figure 3-8: Figure 3-9: Figure 4-1: Figure 4-2: Figure 4-3: Figure 4-4: Figure 4-5: LIST OF FIGURES Conservation of actin ............................................................... 5 Location of y—actin missense mutations ..................................... 13 Audiograms from DFNA20 families ........................................... 15 Components of the inner ear ................................................... 21 The organ of Corti ................................................................. 22 Western blot of actin bait ........................................................ 51 Screening strategy for yeast 2-hybrid ........................................ 52 Yeast growth assays ............................................................. 58 Annexin 5a in the organ of Corti ............................................... 84 Annexin 5a in auditory hair cell stereocilia .................................. 86 Annexin 5a in vestibular hair cell stereocilia ................................ 89 Annexin 5a is on the internal face of the cell membrane ................ 93 y-actin in wild-type and Anxa5-null mice ..................................... 96 Annexin 5a does not localize to vestibular stereocilia gaps ............. 98 GST-pulldown assay with annexin 5a ...................................... 100 Band-shift assay with in vitro synthesized annexin 5a and y-actin..103 Co-sedimentation assay with annexin 53 and F-actin .................. 105 Coding sequence of mouse and human actins ........................... 126 PCR assay for alternative transcript in mouse tissues ................. 127 Conservation of y—actin intron 3 ............................................. 130 Splicing of A0191 in C2C12 myoblasts and myotubes .................. 133 Nuclear and cytoplasmic RNA fractions from myotubes ............... 134 xiii Figure 4—6: Cycloheximide treatment of myotube cultures ........................... 136 Figure 4-7: Human ACTG1 expression constructs ..................................... 140 Figure 4-8: Mutation of 3’ acceptor site abolishes splicing ........................... 142 Figure 4-9: Conservation of intron 3a ...................................................... 148 Figure 5-1: P264L knock-in targeting vector ............................................. 157 Figure 5-2: Expression of recombinant P264L y-actin ................................. 166 Figure 5-3: Rotarod test and body weights in normal and mutant mice ........... 169 Figure 5-4: Auditory-evoked brainstem response in P264L mice .................. 172 Figure 5-5: Scanning electron micrograph overview of the cochlear bulla ....... 175 Figure 5-6: Scanning electron micrograph of the 8 kHz region ..................... 178 Figure 5-7: High magnification of outer hair cells at 8 kHz ............................ 180 Figure 5-8: Scanning electron micrograph of the 16 kHz region .................... 182 Figure 5-9: High magnification of inner hair cells at 16 kHz .......................... 183 Figure 5-10: High magnification of outer hair cells at 16 kHz ........................ 185 Figure 5-11: Scanning electron micrograph of the 32 kHz region .................. 187 Figure 5-12: Localization of P264L and wild-type y-actin in auditory hair cells..191 Figure 5-13: Abnormal actin filaments in outer hair cells of P264L mice..........193 Images in this dissertation are presented in color. xiv ABR ACTB ACTG1 ADF ADP ANXA5 ATP BSA CAP2 CCT cDNA CFL1 CFL2 CHX DAPI DC DNA DNase1 DPOAE EDTA F-actin LIST OF ABBREVIATIONS Auditory—evoked brainstem response Cytoplasmic B—actin Cytoplasmic y-actin Actin depolymerizing factor Adenosine diphosphate .Annexin 5a Adenosine 5’—triphosphate Bovine serum albumin Cyclase associated protein 2 Chaperonin containing TCP1 Complimentary DNA Cofilin 1 (non-muscle) Cofilin 2 (muscle) Cycloheximide 4’,6-diamidino-2-phenylindole Deiter’s cells Deoxyribonucleic acid Deoxyribonuclease 1 Distortion product otoacoustic emission Ethylenediaminetetraacetic acid Filamentous actin XV G-actin GFP GST HL HRP IHC ISC MPSS mRNA neo NIDCD NIH NMD OHC PBS IPC PCR PFA PS PTC PVDF qRT-PCR Globular actin Green fluorescent protein Glutathione-s-transferase Hearing loss Horseradish peroxidase Inner hair cells Inner sulcus cells Massively parallel signature sequence Messenger RNA Neomycin National Institute on Deafness and Other Communication Disorders National Institutes of Health Nonsense mediated decay Outer hair cells Phosphate buffered saline Inner pillar cells Polymerase chain reaction Paraformaldehyde Phosphatidylserine Premature termination codon Polyvinylidene difluoride quantitative reverse transcription polymerase chain reaction xvi RNA RT-PCR RUST SC SDS-PAGE SEM SSM TE TEL TEMED UBE2I UTR Ribonucleic acid Reverse transcription polymerase chain reaction Regulated unproductive splicing and translation Supporting cells Sodium dodecyl sulfate polyacrylamide gel electrophoresis Scanning electron microscopy Splice site mutation Tris-EDTA Tris-EDTA lithium acetate Tetramethylethylenediamine Ubiquitin E2i ligase Untranslated region xvii INTRODUCTION The overall goal of my doctoral research was to gain insight into the pathophysiology of mutations in y—actin that cause nonsyndromic deafness. I used several approaches to address this goal. First, I implemented two yeast 2- hybrid screens to interrogate an inner ear library to identify potentially novel 7- and B-actin binding proteins or perhaps identify ear specific isoforms of already known proteins. Next, I investigated the localization of a y-actin specific binding protein, annexin 5a, during development using immunofluorochemistry. Finally, I characterized hearing loss in a knock-in mouse model for one of the y-actin deafness mutations, p.P264L. In the course of these experiments, I also identified and characterized a novel regulatory mechanism for y-actin. The purpose of this literature review is to discuss the material that forms the basis for my study of actin and its role in hearing. I will provide a brief overview of actin, actin regulation, and differences between actin isoforms. Next, I discourse on hearing loss, in particular, DFNA20 deafness. Finally, I describe the physical structures of the inner ear and provide examples of mutations related to dysfunction of these structures. CHAPTER 1 LITERATURE REVIEW Actin Actin is a 42 kD protein that is ubiquitously expressed. In humans, six different isoforms exist; four muscle-specific actins (cardiac, skeletal and two smooth muscle) and two cytoskeletal actins, B and 7 (Figure 1-1). The two cytoplasmic actins differ by only 4 amino acids in the N-termini of the polypeptides and are perfectly conserved among vertebrates, so the protein sequence in mouse is exactly the same as in humans (Erba et al., 1986). B-actin is the predominant isoform in almost all tissues of the body with the exception of the gut epithelium and hair cells of the inner ear, in which y-actin is the predominant isoform existing at a 2:1 7:8 ratio (Khaitlina, 2001). Actin filaments in the cell provide structure and a network upon which other proteins and some organelles are trafficked. A number of proteins interact with actin and I will discuss more of these later in the context of hearing loss and deafness associated genes. Our knowledge of Actb and Actg1 regulation comes from work with mouse cardiomyocyte and myoblast cell culture. The B-actin promoter is constitutively expressed (Quitschke et al., 1989), however in muscle, expression is drastically reduced during differentiation. The details of B-actin down-regulation were first described by DePonte-Zilli et a! (1988) and Lohse et al (1988). In these two studies, a 40 bp region within the 3’UTR was demonstrated as necessary and sufficient to down-regulate B-actin expression in differentiating chick myocardiocyte cultures (DePonti-Zilli et al., 1988; Lohse and Arnold, 1988). Figure 1-1 Alignment of the protein sequence of the six actin isoforms reveals a high degree of similarity at the amino acid level in humans and are well conserved compared to the single yeast actin. From top to bottom human ACTB, ACTG1, ACTC, ACTA1, ACTA2, ACTGZ, yeast actin. Locations of DFNA20 missense mutations are denoted by arrows above the amino acid. All but one of the missense mutations, T89I, involve a amino acid residue that is perfectly conserved between the six mammalian isoforms and yeast. Alignment generated using Clustal X2. .......ohm.......omm.......omm.......ovm.......omm.......oum.......on.......oom.......omw.......omu.......OFN.......ow~..... muxmm>emaommowmoxmHzzoamaaamaqamooH3>mwxmmmaaHHM>MVmmaaqmameozmmmHoaazaawom2>nzowamxmsopooxzHmzwaaooHoammaoa>mammadmmamammzo enema/Hmmwdmowmmxmazvoo.am mm; m wm3>wwxmmmxmiHxaxcemutzia meosmozixtwsea .mquz<»:oxm oaouszmzwaammHmrmm.zaa.mtomaamaommmMZE auxmmpamawdmowuoxmt;:ooiaw.mr._ UpizymwmmmamaHax &.am«a_4a mxo moziaswcaa m zzaxqoxmaoaouxrvmzwaamm.i.mm.a mm 0a.am»umamw2w eoxmm.am.5mwxmmaam.axax awn s.a mxotmaa_ rw>ae am.rzZQwsoxmeoaouxgrmzwsemmisammLsham Gawam umtmwze auxmm>emaommowmoxmcamoODBmamqgHmeuaz>mwxmmmmaaaxwxfismmaaeaamxosmoaawm»seamuma>azawaaxmao>oumxamZaaemmHemmm.qumm0a44mmumamwzo noxmmbhmaemmowmomeEFOOBRmamaqzmuu~s>m~xmmammHwaxzamaqaaaemxozmomawawzeeuomw>azaaaoxmhosooxzHm2eaammkwemmiwaumaqu¢m8umamw2u «can*¢actaueaia au«sassy;u«eaaactetaucecace%aaci"sauteeecaceaeee"scienceeiaiue e.¢¢nasueueeeeeacnc%.. ca .as. a. s%uaente.tetcec Fabi ..omN ...... .ovm.......om~.......ONN.......OflN.......OON.......OQH.......omH.......OFH.......owH.......omH.......OVH.......OMH. HBH>.0JDme>mMm mmmdfidadzmommaqd>NUJMMXHQM?Hmxmqaammmwn mequXEQMOBAQMqun m1 Hdmmqmmwdew>>mB>OQDmQJ>HmBadmmmwdm1>£0mm>¥m¢m>2msm sacquQmeMmXMJmmwmdmdemzmaaqdzwocfimxHQ¢>mefimBB>me§MWHAHKEQHQB Qmuman.mfl . .adwmmwmmbzm9>wa mo >H398m$m¢wtmsb.0.a,kafisFZMHm wamthDmawfim m mmmmA¢ mfmzmhogmbfioquxhamyamdeah>thcmmBfiMMSEMQBJQM$¢qQ.MLammg dNOWNAADZmBMOQ mD:.4.BBmem¢M m ,rO 1-».._.Z.Bm Hanud;o.tmwmxmgmmmma.Hgmwemmai1&RENQBJQqu“0.x;mrmwt:w-mwcmwzm9 0.0. we .LHBBM mrw m-.1041_wzr..2Lam «91.0;Qn wamxm mmmm: B..sz Q.axwurxmx Ddssummrafi>tm>3mwazHMY3wQB adrito .mznzm f» wMHMiZmBCLQ mo ferBMLmdwem 30 :. 2:412:8w iHH>O :mqumxm mmmmadhafmommQQ¢>N01xmKHQK>H Nmfim.BBB£mW:mmBq HXEiHNQB Qmadqfl muwwmwadw E:Hm>BmB>aQLmQE>H Bamwmdwwmn>rarn.? . mBZDHm HBHLOUDAFHWWMNemmmmsdadJmomuQAdbwomexpQNDHNdfldaahhmemmadHKEANQBQQMCdADEd Hdmawdwm WNHm>BmB>DQCmQE>+wBBmwmdwfimH>aOFnifiinaBZham «aectcceJfiecaa. «at. «at «a. .«eceieceietseetteeceeei «siege. .iiaecaieaeiaaee. a. .eeeec... «sis aetetcieneaicieae"aeceecaaueeucc.ccai ......omu.......oaa.......ooa.......om........om........or........oo........om........ov........om........o~........oa.......a BENcasumMmemzxmamaqn>mmHMm¢>mamzwmammxAmazoozza>memHmwmaaaHummeamoo>wmoxoczo>zHwommmmB>Hmsm>¢madooommuexuzomuzoi>a¢¢>mmnxii a:hoaaxmmzaxazamamaaaaammma¢>mamzwmmzmxaxmzooazaHHemmwsameeaHammeamoe>wmoxoxsmazbuommmmeeamam><¢.xoo. {soda ssmszoc>q¢aiammmoz as aavxmmzzxtz:.4maigemmmmka-mzmzwmmmmxtxm.ooxzsaMamasmthaqqnmxmonmossumoxoise>2>mommmme>umaezwmn.on an muni.m zo 3mamommmuz ..E 09.. xmmsz za amai.asmmw1dsm mzwtammx xmzootzaHa,mmtmwmiaqHameoimoL>Mmaxo LLp>>sommqmr>H .aprm.coo aasaqumm.zoupameamomooz estoazxmmztx:zacamaaaaammmna:m.mzwhemmaaxmgaoszaa .mmaawxaaarcmxmotmocswmoxo z-9 c..>:ommo .:Hmoa.xm-:oo auuxxsqam.zos>aaaammoooz azaoasxmmzaxazAmamaaa>mmmMma>mamzwaam=3astooeza>HommHmaxHaaH mumoamoo>wmoxo.:rzzz.ammmmcbtmmi>xmw.ocean 4xaywmaon>a4¢Hmmmzii mzHoazxwmzmxm2amauaqg>mmmmm¢>mqmzweammxmezoazzs>HcmmLmwxqaaHommmammow2wmox0c$u>z>wommmMc>tmau>m¢m¢oozamnaxozumczo>>qednaoozri fittiififltii. Cit. littti. ii¢§¥¥¥¢#.¢¥#¥. ..tttiiiiiic... .tifitttt. .:¥¥¥¥i¢¥¢i¥¢#i¢itfifiitttt dz!“Ci§¢i§¥¢it¥¥i¥fiitiitt .CCCC. Cf... . s s + + Extensive work by Lloyd and Gunning (2002) has examined cytoplasmic actin expression and over-expression in 02(312 myoblast cell culture. In these studies, ACTG1 mRNA was found to be appropriately down-regulated during myotube differentiation only when intron 3 was present in genomic DNA, though unlike B-actin, the 3’UTR was dispensable for this process (Lloyd and Gunning, 2002) Actins exist in two functional forms, globular actin (G-actin) and filamentous actin (F-actin). The X-ray crystallographic structure of B-actin has been solved (Schutt et al., 1993). There are two major domains, each with two subdomains. Actin monomers bind either ATP or ADP in the cleft between subdomains 1 and 2 (Sheterline and Sparrow, 1998). ATP-G-actin readily associates to form actin filaments under ideal conditions in vitro and with the aid of a number of actin binding proteins. Actin filaments are helical and polar, with ends designated as barbed and pointed end. F-actin “treadmills” by a process in which new ATP- actin monomers are added to the barbed end of the growing actin filament, the ATP is hydrolyzed to confer a conformational change, and ADP-actin monomers are released or severed from the pointed end of the filament (Sheterline and Sparrow, 1998). For proper cell mobility and structural regulation, F-actin must be severed, depolymerized, converted to ATP-actin, and then localized to the site of rapid polymerization. All of these processes are catalyzed by a variety of actin binding proteins. Michelot et a/ has recently shown that F-actin turnover occurs at a 155—fold higher rate in the presence of formin, profilin, and ADF/cofilin in vitro compared to studies using actin alone (Michelot et al., 2007). The current working model for F-actin turnover involves three steps. First, old actin filaments are severed and depolymerized. This process is aided by ADF/cofilin, a protein that recognizes ADP-F-actin, and then severs and depolymerizes it into G-actin (Fass et al., 2004). The second step is to sequester the ADP-G-actin monomer, exchange ADP for ATP, and prevent spontaneous repolymerization. Studies in yeast have shown that Srv2/CAP, the yeast homolog of CAP1, forms a hexameric complex to catalyze the exchange of ADP for ATP (Balcer et al., 2003). Srv2/CAP has a low affinity for ATP-actin and therefore profilin is able to compete with the Srv2/CAP complex to sequester the ATP-G-actin (Mattila et al., 2004; Bertling et al., 2007; Chaudhry et al., 2010). The final step in the turnover of actin filaments is to localize recharged ATP-actin monomers to sites of rapid F-actin polymerization. Recent work by Bergeron et al revealed subtle biochemical differences in nucleotide exchange and polymerization rates of the two cytoplasmic actins. Specifically, in the presence of calcium, y-actin exchanges nucleotides and polymerizes 50% more slowly than B-actin, however, this difference is less pronounced when magnesium is the available ion (Bergeron et al., 2010). The authors speculate that these differences may have implications for isoform specific functions in subcellular microenvironments, such as hair cell stereocilia, where there are high levels of Ca2+ Other isoform specific data include a report that arginine tRNA transferase, ATE1, interacts specifically with B-actin to arginylate the N-terminus of the polypeptide (Karakozova et al., 2006). Post-translational arginyation is a unique feature of B-actin, not shared with y-actin. The only report of a y-actin specific interacting protein is annexin 5a (ANXA5). Tzima and colleagues showed that during platelet cell activation, the actin cytoskeleton undergoes significant remodeling (Tzima et al., 1999). During this process, y-actin associates with annexin 5a at the cell membranes (Tzima et al., 2000). Annexin 5a is a member of a family of 12 annexin proteins, all of which bind reversibly to membranes in the presence of high Ca2+ (Moss and Morgan, 2004). Many of these proteins have also demonstrated F-actin binding properties, suggesting a role in membrane and cytoskeleton dynamics (Hayes et al., 2004). To date ATE1 and ANXA5 are the only proteins known to distinguish between and interact exclusively with only one of the two cytoplasmic isoforms. Understanding the specific roles of B- and y-actin is an area of active research. Differences in subcellular localization of the cytoplasmic actins in tissues and cell culture are well documented (Otey et al., 1987, 1988; Khaitlina, 2001). There are conflicting reports of y— and B-actin localization in cultured cells. Early studies showed that in myoblasts y—actin preferentially locates to stress fibers whereas B- actin is found at sites of active remodeling for cell motility (Hill and Gunning, 1993). In contrast, a recent report provides contradictory data from fibroblasts and endothelial cells that B—actin is associated with the less dynamic stress fibers and y-actin is localized to the periphery of the cells in the lamellopodia (Dugina et al., 2009). In skeletal muscle, y-actin is found exclusively in the z—disc, a region which connects adjacent myofibrils (Nakata et al., 2001; Papponen et al., 2009). Though expressed at relatively low levels in differentiated skeletal muscle compared to other tissues, y-actin is required for proper muscle function, as its absence in a skeletal muscle specific knock—out mouse caused progressive myopathy compared to wild-type littermates (Sonnemann et al., 2006). Additionally, y-actin was found up-regulated to levels 10-fold above normal in various animal models for muscular dystrophy and the authors proposed that y- actin may be involved in a compensatory remodeling process (Hanft et al., 2006). A homozygous whole body y-actin knock-out mouse was less viable, smaller, and had an overt muscular myopathy (Belyantseva et al., 2009). Furthermore, this mouse model had a progressive hearing loss apparent first in the high frequency range at 16 weeks of age. This audiological phenotype shares similarities with human patients who suffer from age related hearing loss due to missense mutations in y-actin, though in humans this hearing loss is nonsyndromic and dominant. Hearing Loss Hearing loss is the most common sensory disorder in humans. Approximately 1 in 300-500 Americans are born deaf or hard of hearing, and an additional 30% will begin to suffer some degree of hearing loss by the age of 65 (http://www.nidcd.nih.qov/health/statistics/quick.htm). Genetic hearing loss accounts for 50% of perinatal deafness and genetic factors contribute to age related hearing loss. Genetic hearing loss is a highly heterogeneous disorder and is typically described in terms of whether or not the hearing loss is accompanied by additional phenotypes in the body: syndromic versus nonsyndromic hearing loss. Both classifications can be further subdivided into categories based on age of onset, progression and whether it is a conductive or sensorineural loss. To date, mutations in over 61 genes have been shown to cause nonsyndromic deafness in humans, and an additional 53 deafness loci are mapped to specific chromosomal regions, though the particular genetic lesions of them are yet unknown (Van Camp G, 2010). Syndromic deafness accounts for roughly one third of genetic hearing loss. Two prevalent and well studied examples of syndromic deafness are Pendred Syndrome and Usher Syndrome. These syndromes exemplify both genetic and phenotypic heterogeneity. Patients with Pendred syndrome harbor mutations in pendrin, a solute carrier protein, or Fox1, a transcription factor that regulates pendrin expression (Everett et al., 1997; Hulander et al., 1998; Yang et al., 2007). When mutated, these proteins cause hearing loss and also affect the structure of the vestibular aqueduct and cause goiter (Yang et al., 2007; Pera et al., 2008). Usher Syndromes are associated with sensorineural hearing loss accompanied by vestibular dysfunction and retinitis pigmentosa (Smith et al., 1994). There are 11 loci so far implicated in Usher Syndrome, and mutations in 10 these loci result in varying degrees of deafness and vision loss (Kremer et al., 2006; Ahmed et al., 2009). Not surprisingly, less severe mutations in Usher Syndrome genes, as well as the Pendrin genes mentioned above, also cause nonsyndromic hearing loss. Much of our understanding of the cell biology of the ear has sprung from identifying genetic causes of nonsyndromic deafness. Genes involved in nonsyndromic deafness range from well characterized genes with high expression in other tissues (Kelsell et al., 1997; Morell et al., 1998), to genes primarily expressed in the cochlea whose only functional clues arise from the deafness phenotype, such as TMC1 — transmembrane cochlea-expressed 1 (Kurima et al., 2002; Friedman and Griffith, 2003; Kurima et al., 2003). When a new locus is mapped for nonsyndromic deafness, it is assigned a DFN type and number. Autosomal dominant deafness is designated DFNA, autosomal recessive is DFNB, and X-linked is DFN. Mutations in the gene encoding connexin 26 (DFNB1) are the most common cause of nonsyndromic deafness (Hilgert et al., 2009). In some instances, though certainly not all, nonsyndromic deafness is caused by mutations in proteins or isoforms that function specifically in the inner ear. By studying the aberrant phenotype these mutations cause in the cochlea, we can begin to understand the function of the wild-type protein. A number of insights into the structure and function of the inner ear have been made by studying 11 mutations in both well characterized and novel genes that are expressed in the inner ear and cause hearing loss when mutated. Many of these genes important in hearing have largely been identified by determining deafness causing mutations in families segregating hereditary deafness. The first mutation in cytoplasmic y-actin linked to progressive, nonsyndromic sensorineural hearing loss (DFNA20) was identified in our laboratory (Zhu et al., 2003). Since the initial identification of the p.T89l missense mutation in the MSU-DF1 family, an additional 9 missense mutations have been found that segregate with deafness in 9 different families (Figure 1-2) (van Wijk et al., 2003; Zhu et al., 2003; Kemperman et al., 2004; Rendtorff et al., 2006; de Heer et al., 2009; Morin et al., 2009). Though these mutations are private and not a shared ancestral allele, DFNA20 is the 5th most prevalent cause of autosomal dominant nonsyndromic deafness (Hilgert et al., 2009). Phenotypically, these missense mutations have similar clinical consequences. In all families observed, hearing loss begins at high frequencies in the 2nd to 3rd decade of life and progresses to nearly complete deafness across all frequencies by the 5th to 6th decade (Figure 1-3). These audiologic data suggest a deficit in a common functional process in which wild-type y-actin is indispensible. A sensitive test of hearing, distortion product otoacoustic emission (DPOAE), indicates that loss of the outer hair cells occurs first (JL Elfenbein, personal communication). Given that hearing is properly established in these individuals, it is most likely that these mutations interfere with a repair, rather than developmental, mechanism. 12 Subdomain ll E241 K Subdomain IV 0 051 N V370A / Subdomain l Subdomain lll Figure 1-2 Ribbon diagram of a y-actin monomer with approximate location of 10 missense mutations associated with DFNA20 deafness. The missense mutations are found in all subdomains of the protein and are not clustered within a single functional domain or protein interaction site. A number of actin binding proteins interact at the hinge located between subdomains | and Ill. Modified from Zhu et al 2003. 13 Fig u re 1-3 Aucl iograms from patients in two of the ten DFNA20 families with mutations in y- actin- The normal range of hearing is from —10 to 20 dB, as indicated by the yellow box. Missense mutations represented are T89l (A) and P264L (B). In all families hearing loss is postlingual, however there is variability in the age of onset and rate of progression between DFNA20 families with different mutations. For example, individuals with the T89| mutation have a much later onset than those with P264L. Modified from Zhu et al 2003. 14 Hearing Level (dB) Hearing Level (dB) 20 40 60 80 100 120 20 40 60 80 100 120 Frequency (Hz) O O O O O O O O l0 0 O O O O N 1.0 ‘— N <- co \ \—/ Frequency (Hz) 0 O O O O O O O O O ID 0 O O O O N '0 ‘— N V (D 15 13 yr 26 yr 46 yr 60 yr 11yr 17 yr 38 yr 59 yr The majority of our knowledge pertaining to the molecular effect of DFNA20 mutations on actin comes from in vitro, yeast, and cell culture based assays. In our laboratory, Mei Zhu synthesized 7 mutant y-actins (p.D51N, p. T89l, p.K118M, p.P264L, p.T278l, p.P332A, and p.V370A) in vitro to examine folding and stability compared to wild-type y-actin using native gel electrophoresis (Zhu PhD dissertation, 2008). In the presence of ATP, all six mutant actins folded properly, were released from the CCT-chaperone complex, and migrated as a distinct band on a native polyacrylamide gel. Without ATP present in the native gel during electrophoresis, two mutants P264L and P332A were unable to fold properly and migrated as a diffuse smear. The in vitro synthesized proteins were also utilized to examine the functionality of the four subdomains of actins with missense mutations. Using a gel—shift assay, all of the missense mutations showed association with the actin binding proteins tested. Studies done in yeast engineered to express DFNA20 mutations in the yeast actin gene have differences in growth rates. For example, in complete growth medium, only yeast with the p.K118N mutation grew normally. Similarly, when grown on medium with glycerol as the sole carbon source, only the p.T89l, p.K118N, and p.P264L thrived. In addition to growth rate, other physical and biochemical properties were examined in the mutant yeast. These experiments and results are summarized in Table 1-1. Cell culture based models have also provided insight into the pathogenesis of 6 of the DFNA20 mutations: p.T89I, p.K118M, p.P264L, p.T278l, p.P332A, and p.V307A. In this model, a kidney 16 doom E 6 £35. new doom 532331 was 29cm doom 3 B cmbm Ea: 3.3.28 2m «gamma 7—. 030... .EmEtoaxo men» 55? anau 33-2? 2 3.358 2.205.... 2.35:2» .0: an; 2...... 33205 28: 3:me5 .255 :23. x on ..uEu .mA 02 wo> 02 3.395 (95> 33208 .950: RES: 5.! mm =25 a 093. .mA 02 mo> 02 3.395 («and .950: 32 into: ac mm =95 a 092 .mA 02 «Sr 02 cognaé as"... 3.58 m8. .258 2: 3 men. 25 .mv 02 8> 8> £2.» 432 3820:. 0:0: 3:25.: 3.9.3 :23. mm mm =23 a 35. .mA 02 wo> 02 3:38. gram .250: .250: .250: .3. 3 .3 2 .a__E_o ao> oz ao> 3E8: :35. ESE: «no. 3E8: om mm =25 a 3.5. mA 02 ao> oz 3.395 333. u8m03c_ 95: .950: 0.3. 5 =2.» .mv oz mo> mm; 29.» 3a... .068: .250: .250: 9.3 on =25 .mv uo> ts W m. m m m Mum's fiupom unuoo upon-=1 009910009 “MPG ...w m opuooos u. own ‘oBueqoxo-dl ”‘10! p a): pm: Joqmnu m molmwmu unsopuuou MV I. NAWWO 17 epithelial cell line was transfected to stably expressing espin, an actin bundling protein. When confluent, these transfected cells will generate F—actin based microvilli reminiscent to stereocilia. Cells that were co-transfected with the mutant y-actins produced significantly shorter microvilli. However, assembly of F-actin was not impaired as was evident by the ability of microvilli to recover post-treatment actin destabilizing drugs (Korrapati PhD dissertation, 2009). In organ of Corti explant cultures, mutant y-actin localizes properly to the tips of stereocilia within four hours after biolistic transfection of plasmids with GFP tagged actin constructs (IA Belyantseva, unpublished personal communication). In both the explant and cell culture systems, the ovenlvhelming level of endogenous wild type y-actin may mask any effect within the observable timeframe of these experimental models. Structures of inner ear Cytoplasmic actins are an important component of the hearing process and play a central role in producing the unique structures found in the cells of the inner ear. In mammals, the inner ear has two primary components, the cochlea and the vestibular system. The cochlea is a snail shell shaped structure and contains three fluid-filled compartments: scala tympani and scala vestibule comprised of filled with perilymph, and the scala media filled with endolymph (Friedman and Griffith, 2003). Physical separation of these compartments is necessary to maintain the proper endocochlear potential. Similar to the cochlea, the vestibular system is also characterized by semi-circular canals filled with fluid similar in 18 composition to the cochlear endolymph. Together, the cochlea and vestibular system are encased within a bony labyrinth and embedded in the temporal bone of the skull. The primary organs of hearing and balance are the organ of Corti and vestibular end organs, respectively. These sensory organs are composed of polarized epithelia which contain hair cells responsible for converting mechanical displacements into neural transmissions for sound and balance processing by the brain, a process termed mechanotransduction (Figure 1-4) (Gillespie and Muller, 2009). In the mouse, inner ear development begins in utereo and is completed by postnatal day 12-14 (P12-14) (Frolenkov et al., 2004). Development of the organ of Corti occurs from base to apex. Likewise, innervation the organ of Corti is also tonotopically mapped from base to apex, encoding low to high frequencies, respectively. The hair cells of the organ of Corti can be likened to the keyboard of a piano, with each hair cell being the equivalent of ~1/60th of a piano key (Musiek and Baran, 2007). In the organ of Corti hair cells are arranged in a single row of inner hair cells and three rows of outer hair cells (Figure 1-5A). The initial processing of the sound is achieved by deflection of inner hair cell stereocilia. Outer hair cells amplify sound by prestin-mediated vertical motility which in turn generates the DPOAE, a measure of sound waves exiting the outer ear which serves as a clinical indication of outer hair cell function (Dallos, 2008). Directly adjacent to and beneath the hair cells are populations of supporting cells. In birds and reptiles, these cells are capable of re-entering the cell cycle to generate 19 Figure 1-4 Components of the mouse inner ear. Sound waves are channeled through the ear canal and create vibrations of the ear drum (A). These vibrations are transferred through the bones of the inner ear to the cochlea. The tallest row of stereocilia of hair cells is embedded in the gelatinous tectorial membrane (C). Pressure by the tectorial membrane deflects the hair bundle and opens mechanotransduction channels on the tips of the two shortest rows of stereocilia. The rapid influx of K+ and Ca2+ into the cell through the stereocilia cause depolarization and neurotransmitters are released at the basal end of the hair cell. Hair cell containing sensory epithelia (yellow) of the vestibular end organs transduce changes in gravitational forces using a similar mechanism (D). Panels A-C are from Frolenkov et a/ 2005. 20 ” ocmonE 5.8m .8; .55.. H 21 Figure 1-5 Cartoon schematic of the organ of Corti (A). Depicts a single row of inner hair cells (lHCs) and three rows of outer hair cells (OHCs) and supporting cells. Belyantseva et al 2009. Scanning electron micrograph of the hair bundle of a mouse inner hair cell (B) and outer hair cell (C). 22 new auditory hair cells (Groves, 2010). In mammals, auditory hair cells of the cochlea are terminally differentiated and vestibular hair cells have limited capacity for renewal (Groves, 2010). Thus, when several hair cells within the same tonotopic region undergo apoptosis due to insurmountable damage, permanent hearing loss for that tone results. In general, the hair cells of both the cochlea and vestibular end organs are quite similar. Both are polarized cells with a synapse at the basal end and tall hair-like projections termed stereocilia at the apical surface. Stereocilia are typically 2 pm to 15 pm in length and are arranged in an orderly staircase structure (Shin et al., 2007). Collectively, these projections are known as the hair cell bundle. Mammalian organ of Corti hair cells have three rows of stereocilia within each hair cell bundle. In the outer hair cells, the bundle has a characteristic “v” shape (Figure1— 58,0). Unlike auditory hair cells, vestibular hair cells have several rows of stereocilia (Frolenkov et al., 2004). Evidence from hair bundle purification experiments suggest that there are ~60 proteins that contribute to the structure, function, and maintenance of the stereocilia (Shin et al., 2007). By far, the most abundant proteins are the two cytoplasmic actins, y and B, which are present at roughly a 5:1 ratio (Hofer et al., 1997; Furness et al., 2005), and together account for up to 50% of the total protein content in hair cell bundles (Shin et al., 2007). Mutations in a number of actin binding proteins found in the stereocilia are the cause of syndromic and nonsyndromic deafness (Table 1-2). The pathology of these mutations in mouse models usually demonstrate a change in stereocilia 23 morphology, however, the type of change depends on the protein being mutated. Many of these proteins are myosins and/or their protein cargo. For the remainder of the introduction, I will focus primarily on these proteins, as they demonstrate a great deal about the cell biology of the hair cell, and in particular stereocilia. Mouse models of deafness The core of a stereocilium is composed largely of parallel crosslinked and bundled actin filaments (Tilney et al., 1980). Proteins responsible for crosslinking and bundling in stereocilia include fimbrin, espin, and triobp. Mutations in espin and triobp are associated with autosomal recessive nonsyndromic deafness, DFNB36 and DFNBZ8, respectively (Naz et al., 2004; Riazuddin et al., 2006; Shahin et al., 2006). Though both proteins bundle actin filaments, the subcellular localization and phenotypes associated with loss of function are different. Espin is found along the length of stereocilia in wild-type mice. In the spontaneous espin mouse mutant, jerker, stereocilia are abnormally short and thin (Sekerkova et al., 2006). Studies using GFP-B-actin and GFP-espin biolistically transferred into organ of Corti explants cultures demonstrated that espin-actin bundles in the stereocilia treadmill toward the cell body (Rzadzinska et al., 2004). In contrast to espin, triobp is confined to the rootlet of stereocilia and loss of function in an engineered knock-out mouse results in floppy stereocilia and eventual fusion and degradation, reinforcing the importance of a properly formed rootlet upon which stereocilia can deflect (Kitajiri et al., 2010). Functional assays indicate that while 24 espin bundles filaments by cross-linking, triobp wraps around the periphery of multiple filaments to create a bundle (Kitajiri et al., 2010). To build actin filaments, there must first be a nucleation event. In vitro, this can be achieved by incubating actin above the critical concentration at which spontaneous filament formation occurs after a brief lag phase. In the hair cell, actin dymanics must be tightly regulated so as to control when and where filaments form. For instance, one of the hallmarks of a dying hair cell is uncontrolled filament formation, as is observed in the shaker-2 mouse which produces long actin-rich projections termed cytocauds that protrude from the basal surface of the hair cell (Kanzaki et al., 2002). However, this phenomenon is not exclusive to the pathology observed in the presence of mutations in actin or actin binding proteins, since aberrant filament formation is also observed in aged organ of Corti cultures (IA Belyantseva personal correspondence). Some proteins serve dual functions in regulating actin dynamics, such as members of the formin family of actin cappers. In vitro evidence demonstrates that formins function to nucleate filaments as well as cap existing filaments (Zigmond, 2004). These caps, however, are considered “leaky” because they are also capable of adding monomers to the barbed end of a treadmilling filament (Goode and Eck, 2007). Mutations of diaphanous 1, a formin, is the cause of DFNA1 deafness in humans (Lynch et al., 1997). 25 .8 .555 no 53.? 2: new .9 2.33:. an 58>... .. m5 .2. ESE: 5......3 9: Eco 9.885% . .0 means: 2m to. o5 2 “3230.... ..so.>o. - 2393.. 9.. .o >89 2.. c. ..98 .055. c. nontommo 2m 239.: 30...... .mmofimoo 5 8.8.35. 2.32.. 8.25 5.2 3 29¢ Sow ...m .6 Emcecom .88 .m .0 .coaomxmw m_._oom.2m coma €30 £29.. 2838 vomzua GEE moom ...m .o .6328 20:8» .5803 .22.. 3.4.2.5 m_. 58;. 32 ...m .m 5...... a... 5.56.8: 9.38 coca 32%. P maocmfigo 28 ...m .m .. .28 ...m .m 625”. m... 8.35.828 529.8% ..ana 2.38 moon ...m 6 2398.3 . 89.... ...m .m 38.2 9.685% new... .250 522.. .20.: -omemw . coon ...m .0 Nm2 9.68.65 5,: $5.95.. coon ommzua camm Noom ...m .o 950... . moom ...m .o 23.2 9.6853 :05 cozmmco.mv 33.9.8.5 om we: 5%: .25an 5:23 Noom ...m .0 22¢; 5303 .22.. ommznfi. mm c.8»... Sow ..m .6380. .88.. ...m .6 £253.”. .282 0: _m___oo.o.m ado... m£65... zoom muman moo: o Em ...m .0 963.com 8.65.828 529.8% mmmzufi. onmo Bow ...m .m 55. co.m_oxmoSo.ocm.nEoE vmmznfi Exam”. Noon ...m .w BEE. . moom ...m .mtmcmxzo 3.82% coucmlgiogo £22.. 20th o. 2.3 .23 .m 52%. a 5:055... Bow ...m .0 m3.38.2 _ 82 ...m .0 mcm>> 3.822»... :95 522.. .20.... 8qu 9.: £832 «cow ..m .0 m.....o... _ 32 ...m .0 ..m>> 3.08.2.0. 919. £22.. ESE n F 0%... 3%: .:> cm> .moom ...m .6 2N m .2920 wow 8.0.0.85 o~ 82.283. 1 2.32.2.“— =oo ..u... 5.8.5“. 2:25.: :. .00.. 33 9E3... 532... 26 Individual stereocilia within a single hair cell bundle are adjoined to one another from the shorter to the taller via extracellular links composed a heteromeric complex of protocadherin 15 and cadherin 23 (Siemens et al., 2004; Ahmed et al., 2006; Kazmierczak et al., 2007). Recent studies using calcium imaging revealed that in mammals, the mechanotransduction channels are located in the tip of the shorter stereocilia (Beurg et al., 2009), though the composition of this channel remains elusive. Mutations in either tip-link protein cause deafness, and there exist a number of spontaneous cadherin 23 mouse and dog mutants (Schwander et al., 2009). The well characterized CS7BII6J strain has progressive, age-related hearing loss beginning around 2 months of age due to a cadherin 23 donor splice-site mutation (Johnson et al., 2006). Height regulation of stereocilia is controlled by a number of actin binding proteins and their cargo. Insights into which proteins are involved in height regulation have been made by studying mouse mutants. Most notably, three spontaneous mutants, shaker-1, shaker-2, and Snell’s waltzer are deficient in myosin 7a, myosin 15a, and myosin 6a, respectively, and each display a distinct phenotype (Table 1-2). Not surprisingly, mutations in these three myosins cause autosomal dominant and/or autosomal recessive hearing loss. Myosin 7a is found along the length of stereocilia and missense mutations cause abnormally long and disorganized stereocilia in shaker-1 mice (Self et al., 1998). 27 This phenotype may be due to improper localization of twinfilin 2, an actin capping protein that co-localizes with myosin 7a in stereocilia (Rzadzinska et al., 2009). Using a CL4 cell culture model, Peng et a/ demonstrated that twinfilin 2 is required for length regulation of the shorter rows of stereocilia (Peng et al., 2009) In contrast to myosin 7a mutants, missense and partial deletion mutations in myosin 15a cause abnormally short stereocilia in shaker-2 mice (Anderson et al., 2000). Myosin 15a delivers whirlin, a protein aptly named for its phenotype in whirling mice, to the tips of stereocilia where it is proposed to mediate elongation (Belyantseva el al., 2005). Interestingly, whirler mice also have abnormally short stereocilia reminiscent of shaker-2, and whirler/shaker-2 double homozygotes have a slightly exacerbated phenotype (Mogensen et al., 2007; Mustapha et al., 2007). Snell’s waltzer is a spontaneous mouse mutant with a myosin 6a deficiency (Avraham et al., 1995). However, the hair cell phenotype is different from either of the two myosin mutants discussed above. In Snell’s waltzer, PTPRQ, a protein important within the taper of stereocilia, is improperly localized (Sakaguchi et al., 2008). Not surprisingly, Myosin 6a and PTPRQ deficient mice have the same phenotype of enlarged stereocilia, which do not taper at the point of insertion into the cuticular plate. Another class of proteins in the stereocilia are those which associate with membranes. DFN824 deafness is caused by mutations in radixin, a protein 28 found near the base of the stereocilia that functions to link the cytoskeleton to the membrane (Khan et al., 2007). Annexin 5a is also a membrane protein highly enriched in the organ of Corti, in particular the stereocilia (Peters et al., 2007; Shin et al., 2007). Studies from other cell lines indicate a possible function in linking membrane and cytoskeletal dynamics, though a precise function in the stereocilia remains elusive. Due to the dynamic function of the hair cell and the repeated mechanical stress placed on the stereocilia, mechanisms must be in place to repair these terminally differentiated cells. Recent evidence suggests a role for y-actin in the repair of stereocilia. At the cellular level, loss of stiffness and gaps within the actin core are observed after repeated noise damage and in correlation with aged vestibular hair cells (Belyantseva et al., 2009). Proteins that are particularly abundant in these gaps are likely candidates for repair of stereocilia. Not surprisingly, proteins identified in these gaps are largely actin and actin binding proteins, including, but not limited to, y-actin, cofilin, DNasel, and espin (Belyantseva et al., 2009). These data are consistent with a model where the filamentous actin core is rebuilt and possibly “filled in” by rejoining existing actin filaments, perhaps similarly to what has been observed in the bristles of Drosophi/a (Guild ef al., 2005). 29 References Ahmed, Z. M., Goodyear, R., Riazuddin, S., Lagziel, A., Legan, P. K., Behra, M., Burgess, S. M., Lilley, K. S., Wilcox, E. R., Riazuddin, S., et al., 2006. The tip-link antigen, a protein associated with the transduction complex of sensory hair cells, is protocadherin-15. Journal of Neuroscience. 26, 7022- 7034. Ahmed, Z. M., Riazuddin, S., Khan, S. M, Friedman, P. L., Riazuddin, S., Friedman, T. B., 2009. USH1H, a novel locus for type I Usher syndrome, maps to chromosome 15q22-23. Clin Genet. 75, 86-91. Anderson, D. W., Probst, F. J., Belyantseva, l. A., Fridell, R. A., Beyer, L., Martin, D. M., Wu, D., Kachar, B., Friedman, T. B., Raphael, Y., et al., 2000. The motor and tail regions of myosin XV are critical for normal structure and function of auditory and vestibular hair cells. Hum Mol Genet. 9, 1729-38. Avraham, K. B., Hasson, T., Steel, K. P., Kingsley, D. M., Russell, L. B., Mooseker, M. S., Copeland, N. G., Jenkins, N. A., 1995. The mouse Snell's waltzer deafness gene encodes an unconventional myosin required for structural integrity of inner ear hair cells. Nat Genet. 11, 369- 75. Balcer, H. l., Goodman, A. L., Rodal, A. A., Smith, E., Kugler, J., Heuser, J. E., Goode, B. L., 2003. Coordinated regulation of actin filament turnover by a high-molecular-weight Srv2/CAP complex, cofilin, profilin, and Aip1. Curr Biol. 13, 2159-69. Belyantseva, l. A., Boger, E. T., Naz, S., Frolenkov, G. l., Sellers, J. R., Ahmed, Z. M., Griffith, A. J., Friedman, T. B., 2005. Myosin-XVa is required for tip localization of whirlin and differential elongation of hair-cell stereocilia. Nat Cell Biol. 7, 148-56. Belyantseva, l. A., Perrin, B. J., Sonnemann, K. J., Zhu, M., Stepanyan, R., McGee, J., Frolenkov, G. l., Walsh, E. J., Friderici, K. H., Friedman, T. B., et al., 2009. Gamma-actin is required for cytoskeletal maintenance but not development. Proc Natl Acad Sci U S A. 106, 9703-8. Bergeron, S. E., Zhu, M., Thiem, S. M., Friderici, K. H., Rubenstein, P. A., 2010. Ion-dependent polymerization differences between mammalian beta— and gamma-nonmuscle actin isoforms. J Biol Chem. 285, 16087-95. Bertling, E., Quintero-Monzon, 0., Mattila, P. K., Goode, B. L., Lappalainen, P., 2007. Mechanism and biological role of profilin-Srv2/CAP interaction. J Cell Sci. 120, 1225-34. 30 Beurg, M., Fettiplace, R., Nam, J. H., Ricci, A. J., 2009. Localization of inner hair cell mechanotransducer channels using high-speed calcium imaging. Nat Neurosci. 12, 553-8. Chaudhry, F., Little, K., Talarico, L., Quintero-Monzon, 0., Goode, B. L., 2010. A central role for the WH2 domain of Srv2/CAP in recharging actin monomers to drive actin turnover in vitro and in vivo. Cytoskeleton (Hoboken). 67, 120-33. Dallos, P., 2008. Cochlear amplification, outer hair cells and prestin. Curr Opin Neurobiol. 18, 370-6. de Heer, A. M., Huygen, P. L., Collin, R. W., Oostrik, J., Kremer, H., Cremers, C. W., 2009. Audiometric and vestibular features in a second Dutch DFNA20/26 family with a novel mutation in ACTG1. Ann Otol Rhinol Laryngol. 118, 382-90. DePonti-Zilli, L., Seiler-Tuyns, A., Paterson, B. M., 1988. A 40-base-pair sequence in the 3' end of the beta-actin gene regulates beta-actin mRNA transcription during myogenesis. Proc Natl Acad Sci U S A. 85, 1389-93. National Institute on Deafness and other Communication Disorders. Quick Statistics. http://www.nidcd.nih.qov/health/statistics/quick.htm Bethesda, MD. Dugina, V., Zwaenepoel, |., Gabbiani, G., Clement, S., Chaponnier, C., 2009. Beta and gamma-cytoplasmic actins display distinct distribution and functional diversity. J Cell Sci. 122, 2980-8. Erba, H. P., Gunning, P., Kedes, L., 1986. Nucleotide sequence of the human gamma cytoskeletal actin mRNA: anomalous evolution of vertebrate non- muscle actin genes. Nucleic Acids Res. 14, 5275-94. Everett, L. A., Glaser, 8, Beck, J. C., Idol, J. R., Buchs, A., Heyman, M., Adawi, F., Hazani, E., Nassir, E., Baxevanis, A. D., et al., 1997. Pendred syndrome is caused by mutations in a putative sulphate transporter gene (PDS). Nature Genetics. 17, 411-422. Fass, J., Gehler, S., Sarmiere, P., Letourneau, P., Bamburg, J. R., 2004. Regulating filopodial dynamics through actin-depolymerizing factor/cofilin. Anat Sci Int. 79, 173-83. Friedman, T. B., Griffith, A. J., 2003. Human nonsyndromic sensorineural deafness. Annu Rev Genomics Hum Genet. 4, 341-402. 31 Frolenkov, G. l., Belyantseva, l. A., Friedman, T. B., Griffith, A. J., 2004. Genetic insights into the morphogenesis of inner ear hair cells. Nat Rev Genet. 5, 489-98. Furness, D. N., Katori, Y., Mahendrasingam, S., Hackney, C. M., 2005. Differential distribution of beta- and gamma-actin in guinea-pig cochlear sensory and supporting cells. Hear Res. 207, 22-34. Gillespie, P. G., Muller, U., 2009. Mechanotransduction by hair cells: models, molecules, and mechanisms. Cell. 139, 33-44. Goode, B. L., Eck, M. J., 2007. Mechanism and function of formins in the control of actin assembly. Annu Rev Biochem. 76, 593-627. Groves, A. K., 2010. The challenge of hair cell regeneration. Exp Biol Med (Maywood). 235, 434-46. Guild, G. M., Connelly, P. S., Ruggiero, L., Vranich, K. A., Tilney, L. G., 2005. Actin filament bundles in Drosophila wing hairs: hairs and bristles use different strategies for assembly. Mol Biol Cell. 16, 3620-31. Hanft, L. M., Rybakova, l. N., Patel, J. R., Rafael-Fortney, J. A., Ervasti, J. M., 2006. Cytoplasmic gamma-actin contributes to a compensatory remodeling response in dystrophin-deficient. muscle. Proc Natl Acad Sci U S A. 103, 5385-90. Hayes, M. J., Rescher, U., Gerke, V., Moss, S. E., 2004. Annexin-actin interactions. Traffic. 5, 571-6. Hilgert, N., Smith, R. J., Van Camp, G., 2009. Forty-six genes causing nonsyndromic hearing impairment: which ones should be analyzed in DNA diagnostics? Mutat Res. 681, 189-96. Hill, M. A., Gunning, P., 1993. Beta and gamma actin mRNAs are differentially located within myoblasts. J Cell Biol. 122, 825-32. Hofer, D., Ness, W., Drenckhahn, D., 1997. Sorting of actin isoforms in chicken auditory hair cells. J Cell Sci. 110 ( Pt 6), 765-70. Hulander, M., Wurst, W., Carlsson, P., Enerback, S., 1998. The winged helix transcription factor Fkh10 is required for normal development of the inner ear. Nat Genet. 20, 374-6. Johnson, K. R., Zheng, Q. Y., Noben-Trauth, K., 2006. Strain background effects and genetic modifiers of hearing in mice. Brain Res. 1091, 79-88. 32 Kanzaki, S., Beyer, L. A., Canlon, B., Meixner, W. M., Raphael, Y., 2002. The cytocaud: a hair cell pathology in the waltzing Guinea pig. Audiol Neurootol. 7, 289-97. Karakozova, M., Kozak, M., Wong, C. C., Bailey, A. 0., Yates, J. R., 3rd, Mogilner, A., Zebroski, H., Kashina, A., 2006. Arginylation of beta-actin regulates actin cytoskeleton and cell motility. Science. 313, 192-6. Kazmierczak, P., Sakaguchi, H., Tokita, J., Wilson-Kubalek, E. M., Milligan, R. A., Muller, U., Kachar, B., 2007. Cadherin 23 and protocadherin 15 interact to form tip-link filaments in sensory hair cells. Nature. 449, 87- U59. Kelsell, D. P., Dunlop, J., Stevens, H. P., Lench, N. J., Liang, J. N., Parry, G., Mueller, R. F., Leigh, l. M., 1997. Connexin 26 mutations in hereditary non-syndromic sensorineural deafness. Nature. 387, 80-3. Kemperman, M. H., De Leenheer, E. M., Huygen, P. L., van Wijk, E., van Duijnhoven, G., Cremers, F. P., Kremer, H., Cremers, C. W., 2004. A Dutch family with hearing loss linked to the DFNA20/26 locus: longitudinal analysis of hearing impairment. Arch 0tolaryngol Head Neck Surg. 130, 281-8. Khaitlina, S. Y., 2001. Functional specificity of actin isoforms. Int Rev Cytol. 202, 35-98. Khan, S. Y., Ahmed, Z. M., Shabbir, M. l., Kitajiri, S., Kalsoom, S., Tasneem, S., Shayiq, S., Ramesh, A., Srisailpathy, S., Khan, S. N., et al., 2007. Mutations of the RDX gene cause nonsyndromic hearing loss at the DFNB24 locus. Hum Mutat. 28, 417-23. Kitajiri, S., Sakamoto, T., Belyantseva, l. A., Goodyear, R. J., Stepanyan, R., Fujiwara, l., Bird, J. E., Riazuddin, S., Riazuddin, S., Ahmed, Z. M., et al., 2010. Actin-bundling protein TRIOBP forms resilient rootlets of hair cell stereocilia essential for hearing. Cell. 141, 786-98. Korrapati, 8., Functional analysis of cytoplasmic gamma-actin mutations causing non-syndromic, progressive autosomal dominant hearing loss. Genetics Program. PhD. Dissertation, 2009. Kremer, H., van Wijk, E., Marker, T., Wolfrum, U., Roepman, R., 2006. Usher syndrome: molecular links of pathogenesis, proteins and pathways. Hum Mol Genet. 15 Spec No 2, R262-70. 33 Kurima, K., Peters, L. M., Yang, Y., Riazuddin, S., Ahmed, Z. M., Naz, S., Arnaud, D., Drury, 8., Mo, J., Makishima, T., et al., 2002. Dominant and recessive deafness caused by mutations of a novel gene, TMC1, required for cochlear hair-cell function. Nat Genet. 30, 277-84. Kurima, K., Yang, Y., Sorber, K., Griffith, A. J., 2003. Characterization of the transmembrane channel-like (TMC) gene family: functional clues from hearing loss and epidermodysplasia verruciformis. Genomics. 82, 300-8. Lloyd, 0, Gunning, P., 2002. beta- and gamma-actin genes differ in their mechanisms of down-regulation during myogenesis. J Cell Biochem. 84, 335-42. Lohse, P., Arnold, H. H., 1988. The down-regulation of the chicken cytoplasmic beta actin during myogenic differentiation does not require the gene promoter but involves the 3' end of the gene. Nucleic Acids Res. 16, 2787- 803. Lynch, E. D., Lee, M. K., Morrow, J. E., Welcsh, P. L., Leon, P. E., King, M. C., 1997. Nonsyndromic deafness DFNA1 associated with mutation of a human homolog of the Drosophila gene diaphanous. Science. 278, 1315- 8. Mattila, P. K., Quintero-Monzon, 0., Kugler, J., Moseley, J. B., Almo, S. C., Lappalainen, P., Goode, B. L., 2004. A high-affinity interaction with ADP- actin monomers underlies the mechanism and in vivo function of Srv2/cyclase-associated protein. Mol Biol Cell. 15, 5158-71. Michelot, A., Berro, J., Guerin, C., Boujemaa-Paterski, R., Staiger, C. J., Martiel, J. L., Blanchoin, L., 2007. Actin-filament stochastic dynamics mediated by ADF/cofilin. Curr Biol. 17, 825-33. Mogensen, M. M., Rzadzinska, A., Steel, K. P., 2007. The deaf mouse mutant whirler suggests a role for whirlin in actin filament dynamics and stereocilia development. Cell Motil Cytoskeleton. 64, 496-508. Morell, R. J., Kim, H. J., Hood, L. J., Goforth, L., Friderici, K., Fisher, R., Van Camp, G., Berlin, C. l., 0ddoux, C., 0strer, H., et al., 1998. Mutations in the connexin 26 gene (GJB2) among Ashkenazi Jews with nonsyndromic recessive deafness. N Engl J Med. 339, 1500-5. Morin, M., Bryan, K. E., Mayo-Merino, F., Goodyear, R., Mencia, A., Modamio- Hoybjor, 8., del Castillo, |., Cabalka, J. M., Richardson, G., Moreno, F., et al., 2009. In vivo and in vitro effects of two novel gamma-actin (ACTG1) mutations that cause DFNA20/26 hearing impairment. Hum Mol Genet. 18, 3075-89. 34 Moss, S. E., Morgan, R. 0., 2004. The annexins. Genome Biol. 5, 219. Musiek, F. E., Baran, J. A., 2007. The auditory system : anatomy, physiology and clinical correlates. Pearson, Boston. Mustapha, M., Beyer, L. A., lzumikawa, M., Swiderski, D. L., Dolan, D. F., Raphael, Y., Camper, S. A., 2007. Whirler mutant hair cells have less severe pathology than shaker 2 or double mutants. J Assoc Res 0tolaryngol. 8, 329-37. Nakata, T., Nishina, Y., Yorifuji, H., 2001. Cytoplasmic gamma actin as a Z-disc protein. Biochem Biophys Res Commun. 286, 156-63. Naz, S., Griffith, A. J., Riazuddin, S., Hampton, L. L., Battey, J. F., Jr., Khan, S. N., Riazuddin, S., Wilcox, E. R., Friedman, T. B., 2004. Mutations of ESPN cause autosomal recessive deafness and vestibular dysfunction. J Med Genet. 41, 591-5. 0tey, C. A., Kalnoski, M. H., Bulinski, J. C., 1987. Identification and quantification of actin isoforms in vertebrate cells and tissues. J Cell Biochem. 34, 113- 24. 0tey, C. A., Kalnoski, M. H., Bulinski, J. C., 1988. lmmunolocalization of muscle and nonmuscle isoforms of actin in myogenic cells and adult skeletal muscle. Cell Motil Cytoskeleton. 9, 337-48. Papponen, H., Kaisto, T., Leinonen, S., Kaakinen, M., Metsikko, K., 2009. Evidence for gamma-actin as a Z disc component in skeletal myofibers. Exp Cell Res. 315, 218-25. Peng, A. W., Belyantseva, l. A., Hsu, P. D., Friedman, T. B., Heller, S., 2009. Twinfilin 2 regulates actin filament lengths in cochlear stereocilia. J Neurosci. 29, 15083-8. Pera, A., Dossena, S., Rodighiero, S., Gandia, M., Botta, 6., Meyer, G., Moreno, F., Nofziger, C., Hernandez-Chico, C., Paulmichl, M., 2008. Functional assessment of allelic variants in the SLC26A4 gene involved in Pendred syndrome and nonsyndromic EVA. Proc Natl Acad Sci U S A. 105, 18608- 13. Peters, L. M., Belyantseva, l. A., Lagziel, A., Battey, J. F., Friedman, T. B., Morell, R. J., 2007. Signatures from tissue-specific MPSS libraries identify transcripts preferentially expressed in the mouse inner ear. Genomics. 89, 197-206. 35 Quitschke, W. W., Lin, Z. Y., DePonti-Zilli, L., Paterson, B. M., 1989. The beta actin promoter. High levels of transcription depend upon a CCAAT binding factor. J Biol Chem. 264, 9539-46. Rendtorff, N. D., Zhu, M., Fagerheim, T., Antal, T. L., Jones, M., Teslovich, T. M., Gillanders, E. M., Barmada, M., Teig, E., Trent, J. M., et al., 2006. A novel missense mutation in ACTG1 causes dominant deafness in a Norwegian DFNA20/26 family, but ACTG1 mutations are not frequent among families with hereditary hearing impairment. Eur J Hum Genet. 14, 1097-105. Riazuddin, S., Khan, S. N., Ahmed, Z. M., Ghosh, M., Caution, K., Nazli, S., Kabra, M., Zafar, A. U., Chen, K., Naz, S., et al., 2006. Mutations in TRIOBP, which encodes a putative cytoskeletal-organizing protein, are associated with nonsyndromic recessive deafness. Am J Hum Genet. 78, 137-43. Rzadzinska, A. K., Nevalainen, E. M., Prosser, H. M., Lappalainen, P., Steel, K. P., 2009. MyosinVlla interacts with Twinfilin-2 at the tips of mechanosensory stereocilia in the inner ear. PLoS One. 4, e7097. Rzadzinska, A. K., Schneider, M. E., Davies, 0, Riordan, G. P., Kachar, B., 2004. An actin molecular treadmill and myosins maintain stereocilia functional architecture and self-renewal. J Cell Biol. 164, 887-97. Sakaguchi, H., Tokita, J., Naoz, M., Bowen-Pope, D., Gov, N. S., Kachar, B., 2008. Dynamic compartmentalization of protein tyrosine phosphatase receptor 0 at the proximal end of stereocilia: implication of myosin Vl- based transport. Cell Motil Cytoskeleton. 65, 528-38. Schutt, C. E., Myslik, J. C., Rozycki, M. D., Goonesekere, N. C., Lindberg, U., 1993. The structure of crystalline profilin-beta-actin. Nature. 365, 810-6. Schwander, M., Xiong, W., Tokita, J., Lelli, A., Elledge, H. M., Kazmierczak, P., Sczaniecka, A., Kolatkar, A., Wiltshire, T., Kuhn, P., et al., 2009. A mouse model for nonsyndromic deafness (DFNB12) links hearing loss to defects in tip links of mechanosensory hair cells. Proc Natl Acad Sci U S A. 106, 5252-7. Sekerkova, G., Zheng, L., Loomis, P. A., Mugnaini, E., Battles, J. R., 2006. Espins and the actin cytoskeleton of hair cell stereocilia and sensory cell microvilli. Cell Mol Life Sci. 63, 2329-41. Self, T., Mahony, M., Fleming, J., Walsh, J., Brown, S. 0, Steel, K. P., 1998. Shaker-1 mutations reveal roles for myosin VllA in both development and function of cochlear hair cells. Development. 125, 557-66. 36 Shahin, H., Walsh, T., Sobe, T., Abu Sa'ed, J., Abu Rayan, A., Lynch, E. D., Lee, M. K., Avraham, K. 8, King, M. C., Kanaan, M., 2006. Mutations in a novel isoform of TRIOBP that encodes a filamentous-actin binding protein are responsible for DFNB28 recessive nonsyndromic hearing loss. Am J Hum Genet. 78, 144-52. Sheterline, P., Sparrow, J. C. J. C., 1998. Actin. Oxford University Press, New . York. Shin, J. B., Streijger, F., Beynon, A., Peters, T., Gadzala, L., McMillen, D., Bystrom, C., Van der Zee, C. E., Wallimann, T., Gillespie, P. G., 2007. Hair bundles are specialized for ATP delivery via creatine kinase. Neuron. 53, 371-86. Siemens, J., Lillo, C., Dumont, R. A., Reynolds, A., Williams, D. S., Gillespie, P. G., Muller, U., 2004. Cadherin 23 is a component of the tip link in hair-cell stereocilia. Nature. 428, 950-5. Smith, R. J., Berlin, C. l., Hejtmancik, J. F., Keats, B. J., Kimberling, W. J., Lewis, R. A., Moller, C. G., Pelias, M. Z., Tranebjaerg, L., 1994. Clinical diagnosis of the Usher syndromes. Usher Syndrome Consortium. Am J Med Genet. 50, 32-8. Sonnemann, K. J., Fitzsimons, D. R, Patel, J. R., Liu, Y., Schneider, M. E, Moss, R. L., Ervasti, J. M., 2006. Cytoplasmic gamma-actin is not required for skeletal muscle development but its absence leads to a progressive myopathy. Dev Cell. 11, 387-97. Tilney, L. G., Derosier, D. J., Mulroy, M. J., 1980. The organization of actin filaments in the stereocilia of cochlear hair cells. J Cell Biol. 86, 244-59. Tzima, E., Trotter, P. J., Orchard, M. A., Walker, J. H., 1999. Annexin V binds to the actin-based cytoskeleton at the plasma membrane of activated platelets. Exp Cell Res. 251, 185-93. Tzima, E., Trotter, P. J., Orchard, M. A., Walker, J. H., 2000. Annexin V relocates to the platelet cytoskeleton upon activation and binds to a specific isoform of actin. Eur J Biochem. 267, 4720-30. Van Camp G, S. R., Hereditary Hearing Loss Homepage. 2010. van Wijk, E., Krieger, E., Kemperman, M. H., De Leenheer, E. M., Huygen, P. L., Cremers, C. W., Cremers, F. P., Kremer, H., 2003. A mutation in the gamma actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26). J Med Genet. 40, 879-84. 37 Yang, T., Vidarsson, H., Rodrigo-Blomqvist, S., Rosengren, S. S., Enerback, S., Smith, R. J., 2007. Transcriptional control of SLC26A4 is involved in Pendred syndrome and nonsyndromic enlargement of vestibular aqueduct (DFNB4). Am J Hum Genet. 80, 1055-63. Zhu, M., Examining the folding and stability of in vitro synthesized gamma-actin mutations. Cell and Molecular Biology. Ph.D. Dissertation, 2009. Zhu, M., Yang, T., Wei, 8., DeWan, A. T., Morell, R. J., Elfenbein, J. L., Fisher, R. A., Leal, S. M., Smith, R. J., Friderici, K. H., 2003. Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26). Am J Hum Genet. 73, 1082-91. Zigmond, S. H., 2004. Formin-induced nucleation of actin filaments. Curr Opin Cell Biol. 16, 99—105. 38 CHAPTER 2 IDENTIFICATION OF ACTIN BINDING PROTEINS USING A YEAST 2-HYBRID SCREEN 39 Abstract Mutations in y-actin cause non-syndromic sensorineural hearing loss. To identify known and novel actin:protein interactions specific to y-actin in the inner ear, two independent yeast 2-hybrid experiments were performed. In the first experiment, human y-actin was used as the bait protein to query a prey library constructed from postnatal mouse inner ear cDNA. More than million clones were screened and 395 positive interactions identified. In the second experiment, B-actin was used as the bait protein to probe the same inner ear prey library. Greater than one million clones were screened and 582 positive interactions identified. In both experiments, the majority of interacting preys were y- or B-actin. Other actin binding proteins were identified, although with much lower frequency compared to the actin prey. Prey proteins found multiple times in both screens included ubiquitin e2i (UBE2l), cyclase associated protein 2 (CAP2), cofilin 2 (CFL2), and cofilin 1 (CFL1). None of the proteins identified in the library screens were specific to B or y-actin. To determine if y-actin bearing a mutation known to cause hearing loss is able to interact with the prey identified in the initial two experiments, P264L y-actin served as the bait for a directed yeast 2-hybrid experiment. Unlike wild-type y- actin, P264L y-actin showed deficiencies in interactions with all actin binding prey tested . 4o Introduction Mutations in y-actin (ACTG1) are the cause of autosomal dominant non- syndromic sensorineural hearing loss in DFNA20 families (van Wijk et al., 2003; Zhu et al., 2003; Rendtorff et al., 2006; Liu et al., 2008; de Heer et al., 2009; Morin et al., 2009). Noting the conserved and ubiquitous nature of cytoplasmic actins (Erba et al., 1986), it is remarkable that hearing loss is the only pathology observed. Vertebrates express six isoforms of actin: o-cardiac (ACTC), a- skeletal (ACTA1), q-aortic (ACTA2), y-enteric (ACTGZ), B-cytoplasmic (ACTB), and y-cytoplasmic (ACTG1). The cytoplasmic B- and y-actins are expressed at roughly a 2:1 ratio in most tissues of the body (Otey et al., 1987). However, in the inner ear, y-actin is the predominant isoform expressed at an overall B-Zy- actin ratio of 1:2, with subcellular microdomains reaching ratios as high as 1:5, in the case in the auditory hair cell stereocilia (Hofer et al., 1997; Furness et al., 2005). The two cytoplasmic actins have nearly identical amino acid sequences with the exception of four amino acids in the N-terminal portion of the 375 amino acid polypeptide. Though expression levels of the cytoplasmic actins are well characterized in various tissues, functional differences between [3- and y-actin remain elusive. Some clues have arisen from the distinct subcelluar localization of the two isoforms. B-actin transcripts and proteins are found in dynamic regions of cells which undergo constant remodeling of the actin-based cytoskeleton, such as lamellipodia. In contrast, y-actin co-localizes with stress fibers, relatively stable actin—based structures (Hill and Gunning, 1993; Korrapati Ph.D Dissertation, 2009). However, a recent report provides conflicting data which 41 demonstrate that y-actin is concentrated to the lamellipodia and B-actin to the stress fibers (Dugina et al., 2009). Consistent with the report by Dugina and colleagues, y-actin is primarily localized to the periphery of and sites of damage to the F-actin core of hair cell stereocilia (Belyantseva et al., 2009). Given the high levels of expression in almost all cells and tissues of the body, [3- actin-null mice are predictably embryonic lethal (Shawlot et al., 1998). In contrast, y-actin knockout mice are not embryonic lethal, but have reduced viability, muscular myopathy, and progressive deafness (Belyantseva et al., 2009). It is unclear whether actin isoforms are able to substitute for the function of each other, though recent work in mice provides insight; both y-cytoplasmic and a-cardiac actins rescue muscle function in q-skeletal actin knockout mice (Jaeger et al., 2009; Nowak et al., 2009). We hypothesized that the cause of DFNA20 deafness is due to the ablation of a specific and indispensable y-actinzactin binding protein interaction in the inner ear, for which B-actin cannot substitute. To date, only two proteins have been reported to interact exclusively with only one of the cytoplasmic actin isoforms: ATE1 (Arg-tRNA protein transferase 1) and ANXA5 (annexin 5a). ATE1 arginylates B-actin polypeptides, a post-translational modification thought to hinder the association of B-actin filaments into bundles (Karakozova et al., 2006). Annexin 53 interacts exclusively with y-actin at the membrane of activated 42 platelet cells (Tzima et al., 2000). At present, the functional details of the association of annexin 53 and y-actin are unclear. To identify novel isoform-specific interactions, l implemented yeast 2-hybrid assays. Unlike many proteinzprotein interaction assays, yeast 2-hybrid experiments can be utilized to detect novel interactions without a pn'on' knowledge by screening a tissue-specific library. Yeast 2-hybrid technology can also be used to validate known interactions using a directed approach with single bait and prey proteins of interest. Both of these techniques were previously employed to interrogate postnatal mouse inner ear libraries and validate a protein interaction network. In particular, Adato et a/ performed library-based and directed yeast 2-hybrid screens to identify and validate proteins involved in Usher 1c deafness, a syndrome caused by mutations in harmonin b (Adato et al., 2005) In this chapter, I describe two yeast 2-hybrid assays in which I used y-actin and B-actin as bait proteins to identify novel actin isoform-specific protein interactions potentially relevant to y-actin related deafness. To enrich for y-actin specific proteins, as well as inner ear specific isoforms, a postnatal mouse inner ear library was Used as the prey. Furthermore, I followed the library based-screen with a directed yeast 2-hybrid experiment to determine if a mutant y-actin, P264L, is able to interact with the prey identified. 43 Materials and Methods Vectors Human y-actin (ACTG1) and B-actin (ACTB) coding sequences were obtained from previously cloned pcDNA3.1+ACTG1 and pcDNA3.1+ACTB vectors (Zhu PhD Dissertation, 2008). Ndel and EcoR1 restriction sites were attached to the coding sequence via PCR with Taq polymerase (lnvitrogen, Carlsbad, CA) and cloned into a pTOPO-PCR (lnvitrogen, Carlsbad, CA) intermediate vector, prior to ligation into the bait (pGBKT7-BD) and prey (pGADT7-AD) vectors (Clontech, Mountain View, CA). The p.P264L mutation was introduced into the intermediate pTOPO-PCR vector containing ACTG1 coding sequence via QuickChange Site-Directed Mutagenesis (Agilent Technologies, Santa Clara, CA) PCR using primers 5’CGCTGTTCCAGCTTTCCTTCCT3' and 5'AGGAAGGAAAGCTGGAACAGCG3', prior to ligation into the bait and prey vectors. All plasmids were sequence verified. Prey library The P3 mouse inner ear prey library was a gift from Dr. Erich Boger at the National Institute for Deafness and other Communication Disorders, NIH. Western Blotting Proteins were separated via SDS-PAGE on discontinuous 10% Laemmli gels (see appendix). Proteins were transferred in 10 mM Tris base, 100 mM glycine, 44 15% methanol (transfer buffer) at 4°C either overnight at a constant current of 5 mAmp or for 1.5 hours at a constant voltage of 110V onto polyvinylidene difluoride (PVDF) membranes (BioRad, Hercules, CA). Membranes were incubated in 5% non-fat milk in 0.025% Tween-20 in PBS pH 7.4 (blocking buffer) for either one hour at room temperature or overnight at 4°C. Rabbit polyclonal anti-y-actin antiserum (Belyantseva et al, 2009) was diluted 1:10,000 in blocking buffer and rabbit polyclonal anti-B-actin antiserum (Abcam, Cambridge, MA; ab8227) was diluted 1:1000 in blocking buffer. Membranes were incubated with primary antisera for either 2 hours at room temperature or overnight at 4°C. Goat polyclonal anti-rabbit lgG-HRP conjugated secondary antibody (Sigma, St. Louis, MO) was used at 1:3,000 in blocking buffer for one hour at room temperature. Proteins were detected using an ECL Detection Kit (GE Healthcare, Waukesha, WI) with Amersham HyperfilmTM MP autoradiography film (GE healthcare, Waukesha, WI). The length of exposure was determined by signal intensity observed. Primary antibodies Rabbit polyclonal anti-y-actin antiserum generated by our lab was raised against the first 15 amino acids of the mammalian y-actin polypeptide (NHz- MEEEIAALVIDNGSG), and the exsanguination bleed was affinity purified. Antibody specificity for immunofluorochemistry was demonstrated using ACTG1- null mice (Belyantseva et al., 2009). To verify that this antiserum is specific for y- actin in immunoblotting applications, HeLa cells expressing either GFP—y-actin or 45 GFP-B-actin were evaluated by western blot (Dr. Mei Zhu, unpublished data). In addition to endogenous y-actin at 42 kDa, a single band of ~70 kDa corresponding to GFP-y-actin was observed in lysate from cells transfected with GFP-y-actin, but not in lysate from cells transfected with GFP-B-actin. Similarly, a commercially available rabbit polyclonal anti-B-actin antiserum (Abcam, Cambridge, MA; ab8227) raised against a synthetic peptide containing the first 100 amino acids of mammalian B-actin, was determined to be specific for B-actin in immunoblotting applications because in addition to endogenous B-actin, a single band at ~70 kDa was detected in lysate from cells transfected with GFP-[5- actin and not in lysate from cells transfected with GFP-y-actin. Yeast Transformation The bait vectors were independently transformed into the AH109 (Clontech, Mountain View, CA) strain of S. cerevisiae using a modified lithium acetate mediated transformation (Schiestl and Gietz, 1989). Overnight cultures were diluted 1:10 and grown to an 0D600=0.6-1. Cells were centrifuged at 2,000xg for 5 minutes and washed twice with 10 mL TEL buffer (10mM Tris-HCI, pH 7.5, 1 mM EDTA, 0.1M lithium acetate). Cells were resuspended in a final volume of 100 pL TEL with 50 pg of denatured herring testis carrier DNA and 50 ng of plasmid DNA and incubated at room temperature without shaking. After 30 minutes, 700 uL of 40% PEG-4,000 (w/v) in TEL was added and samples were incubated at room temperature for an additional 45 minutes. Cells were 46 centrifuged at 1,000 xg and washed twice in TE pH 8.0 to remove lithium acetate prior to plating. Once established, bait strains were transformed with 150 ug of inner ear prey library using lithium acetate and herring testis carrier DNA (Promega, Madison, WI) and the previously described method. The transformations were plated on SDI-Adel-Hisl—Leul-Trp quadruple drop out medium containing 20ug/mL X-o- galactose (Glycosynth, Cheshire, UK), a substrate for the protein product of the MEL1 reporter gene. Incubation at 30°C was carried out for 21 days. Over 1.2 million clones were screened for both the y-actin and B-actin bait through three separate transformations per bait. Whole colony PCR Approximately 1/2 of each colony was resuspended in 100 pL of ddH20 and used for whole colony PCR to identify y-actin and B-actin prey. PCR reactions and cycling conditions are described in detail in the appendix. Two minor modifications were made: the entire volume of water and template DNA in each reaction was substituted with cell resuspension, and the initial 95°C denaturation step was extended to 10 minutes. The forward primers were situated within the prey vector and reverse primers were located in the 5’ coding sequence of the actin insert. Gamma-actin primers 5'TTGGAATCACTACAGGGATGTTT3’ and 5'CGGCGAT'I’I'CTTCTTCCAT3', and beta-actin primers 47 S'TGAAGATACCCCACCAAACC‘? and S'GCAGCGATATCGTCATCCATZ” demonstrated specificity for y-actin and B-actin prey, respectively. Isolation and identification of prey vectors Overnight cultures were Iysed using 425-600 um acid-washed glass beads (Sigma, St. Louis, MO) in a 1.5 mL microfuge tube with approximately a 1:1 (v:v) culture to bead ratio. Samples were vortexed at maximum speed for 2-3 minutes to insure complete lysis of cells. Extraction of plasmid DNA from yeast was done according to the Qiagen (Valencia, CA) QlAprep Spin Miniprep Kit instructions. The prey inserts were amplified using pGADT7-AD specific primers situated within vector sequence that flanked the prey insertion site 5'ATGATGAAGATACCCCACCAAA3' and 5'ACGATGCACAGTTGAAGTGAA3'. Each PCR product was digested with Alul restriction endonuclease to identify duplicate clones. Novel inserts were sequenced and genome wide identification analysis was performed by blastx (http://www.ncbi.nlm.nih.gov) and confirmed with a BLAT search (httpzllgenomeucscedu) using mouse genome reference sequences. Growth Assays Single colonies were selected for serial dilution growth assays. Colonies were propagated in synthetic drop-out medium lacking leucine and tryptophan. Overnight cultures were diluted 1:2 and the 00600 was measured. Cultures were further diluted to an OD500=0.1 and grown at 30°C with shaking at 250 rpm for 6 48 hours. Each culture was serially diluted 1:10, 1:100, and 111,000 in TE pH8.0 and spotted onto quadruple drop-out plates (-Leu/-Trp/-His/-Ade) using a multichannel pipettor. Plates were left upright until the 5 uL spot of liquid culture was no longer visible (approximately 10 minutes) and then incubated upside- down for 3 days at 30°C. 49 Results Identification of actin:protein interactions The particular yeast 2-hybrid system (Matchmaker 3) that I used identifies positive interactions using auxotrophic and colorometeric criteria. When the bait and prey interact, transcriptional activation of HIS3 and ADE2 allow for growth on double drop-out medium lacking histidine and arginine. TRP1 and LEU2 serve as additional nutritional selection for the presence of the bait and prey vectors. Activation of the MEL1 reporter gene is used for color-based screening of colonies. Expression of the y- and B-actin baits in AH109 yeast was evaluated by western blot (Figure 2-1). Though these antibodies distinguish between the two vertebrate cytoplasmic actins, I did observe cross-reactivity with yeast actin for both antibodies. The y-actin and B-actin clones were tested for auto-activation on synthetic triple dropout —Trp/-His/-Ade media. Growth of the bait clones was not observed after several days in culture at 30°C, confirming lack of auto-activation (data not shown). Using y-actin as the bait, l screened ~1.2 million clones through three transfections with the P3 inner ear prey library. Given the strong affinity of actin for itself, as well as the abundance of actin transcripts present in the library, I anticipated that the majority of prey identified would be actin. To easily identify these .clones, I devised a whole-colony PCR-based method to detect y- and B- actin prey (Figure 2-2A,B). For the remainder of interactions not identified as 50 "\\ "\\ ~\ 00., .000 9’00 g (:00 N 6? Q) '9 c)“ {b A Y‘g‘ h\ Qq’ B . V? Q50 0 5*. 1“. ,. -\ nun-- --- <— Actin bait—> I" M <— Yeast —> w ._ _ actin "' '" Figure 2-1 Western blot showing expression of bait proteins in transformed AH109 yeast. Transformed y-actin and P264L y-actin bait (A), and B-actin bait (B). Though the y-actin and B-actin antisera do not cross-react with each other, both recognize endogenous yeast actin. 51 (k. A B 6” /' A/ ' I . I! ' . fl 4— B-actin Prey Vector . is. #- * ' . gl.‘ 0‘ 6‘. s—v-actln C D ,6?" E $6 2: i?! - . fi - PreyVector . . ' :- EE'--“. .9 6.3 - - 44 ._- Figure 2-2 Screening strategy for the yeast 2-hybrid library screen experiments. Location of isoform specific primers to amplify y-actin and B-actin prey (A). A representative gel showing specificity of primers for each isoform (B). Clones, such as the one indicated by an asterisk, which did not amplify using either of the actin primers were identified by PCR amplification across the entire cDNA insert (C, D). Duplicate clones were identified using an Alul restriction digest prior to sequencing (E). 52 either y- or B-actin, l re-streaked these clones to verify a positive interaction. Clones that tested positive for growth after re-streaking were propagated in an overnight liquid culture, and DNA was isolated. Prey inserts were amplified by PCR using primers situated 5’ and 3’ of the insertion site within the pGADT7 vector. To eliminate duplicate clones prior to sequencing, amplicons were analyzed via RFLP using Alul restriction endonuclease (Figure 2C-E). Non- duplicate clones were sequenced and compared to existing databases using NCBl’s BLAST and UCSC Genome Browser’s BLAT programs. In total, I identified 395 positive y-actin interactions. 0f the clones identified more than one time, 276 were y-actin, 87 B-actin, 12 ubiquitin E2i ligase, 3 cofilin-1, and 3 cofilin- 2. The entire process was repeated a second time using [S-actin as the bait protein. With the assistance of an undergraduate student, Tychele Turner, we screened a total of 582 positive B-actin interactions. 0f the 582 positive prey clones identified more than once, 388 were y-actin, 143 B-actin, 9 ubiquitin E2i ligase, 3 cofilin-2, and 2 cyclase associated protein 2. As expected, the majority of the clones isolated in both screens were y- and B-actin (Table 2-1). In the organ of Corti, y- actin is the predominant cytoplasmic actin (Hofer et al., 1997; Furness et al., 2005) and my results were consistent with this observation in that the ration of 7:8 actin clones is 2.5-3.5:1. 53 Prey: total screened positive y-actin B-actin 7:8 1 225,000 143 104 30 3.521 chfin 2 320,500 57 43 13 3.321 Bait 3 609,000 195 129 44 2.921 total 1 ,1 54,500 395 276 87 3.2:1 1 324,000 239 158 62 2.521 B-actin 2 574,000 229 158 57 2.8: 1 Bait 3 308,000 114 72 24 3.021 total 1 ,206,000 582 388 143 2.7: 1 Table 3-1 Actin prey identified in yeast 2-hybrid experiments. Clones not identified as y- or B-actin were re-streaked for verification and sequenced. 54 Deafness associated mutant y-actin shows deficiency in interactions with prey identified in the Y2H screen Our lab developed a P264L knock-in mouse model that recapitulates the deafness phenotype, however, the molecular mechanism by which this mutation causes deafness is still unclear. Therefore, in vitro data using a directed yeast 2- hybrid screen may provide valuable clues pertaining to the molecular pathogenesis of P264L y-actin. Mutations were introduced into the pTOPO-PCR cloning vectors via site-directed mutatgenesis and cloned into the pGBKT7 bait vector as described in material and methods. As described earlier for wild-type y- and B-actin prey, expression of the P264L mutant bait was demonstrated using western blot (Figure 2-1A). I chose four of the prey proteins identified in the screen to test their interaction with P264L y-actin: y-actin, B-actin, ubiquitin E2i, and cofilin 2. Human y-, B—, and P264L y-actin were cloned into the pGADT7 prey vector by transferring the cDNA inserts from the corresponding bait vectors via Ndel and EcoRI restriction sites described in materials and methods. Ubiquitin E2i ligase and cofilin 2 prey were isolated from positive yeast colonies identified in the original yeast 2-hybrid screens. All prey were co-transformed into AH109 yeast expressing B-actin bait, y-actin bait, or P264L y-actin bait. Three colonies from each baitzprey combination were selected at random for serial dilution growth assays (Figure 2- 3). When P264L actin was used as the bait, there was no interaction with wild- type B-, y-actin or P264L actin; however, a weak interaction was observed with 55 the wild-type actins when P264L actin was the prey instead of the bait. Cofilin 2 and ubiquitin E2i ligase both demonstrated a weak interaction with P264L actin bait, as indicated by the low level of growth in the undiluted spots. 56 Figure 2-3 Serial dilution growth assays with B-actin, y-actin, and the DFNA20 hearing loss mutant, p.P264L (PL) y-actin as the bait protein. Overnight cultures were diluted to an ODsoo = 0.1 and grown for an additional 6 hours to achieve the exponential growth phase. Cultures were serially diluted to 1:1, 1:10, 1:100, and 121,000. Five microliters of each dilution were spotted onto —Trp/-Leu/-His/-Ade plates and grown at 30°C for three days. Each experiment was repeated with three clones, two of which are represented here. 57 Figure 3 1:100 1 :1,000 1'10 1:100 1 :1,000 1 1°10 1:100 1 :1 ,000 1'10 1:100 _; 1 :1 ,000 y-actin prey B-actin prey P264L prey CFL2 prey UBEZi prey Discussion Using a yeast 2-hybrid, I identified known and novel actin binding proteins. The large number of actin clones identified in the screen was anticipated and consistent with previous inner ear expression data that demonstrate a 2:1 ration of y:B-actin (Hofer et al., 1997; Furness et al., 2005). The two cofilins (CFL1, CFL2) and cyclase associated protein 2 (CAP2) are well characterized proteins that function cooperatively to sequester and exchange the nucleotide on an actin monomer (Balcer et al., 2003; Goode and Eck, 2007). Cofilin is involved in the severing of actin filaments and sequestering ADP-actin monomers (Fass et al., 2004). A complex of cofilin, ADP-actin, and CAP2 is formed briefly during the transfer of ADP-actin from cofilin to CAP2. CAP2 then facilitates the exchange of the ADP bound to actin for ATP and the recharged ATP-actin monomer is released. ATP-actin monomer binding proteins are either sequestered by profilin until needed or incorporated into a new filament (Bertling etaL,2007) Cofilin 1 was only identified in experiments with y-actin as the bait, however, an interaction with other actin isoforms has been described previously (Kamal et al., 2007). Similarly, CAP2 was only identified in the experiments with B-actin bait, however in vitro data (Zhu PhD Dissertation, 2008) demonstrates an interaction of cyclase associated protein with in vitro synthesized y-actin using a band-shift assay. Interestingly, both CFL2 and CAP2 are considered muscle-specific 59 isoforms yet were present in the inner ear library, a tissue which does not contain skeletal muscle. Contamination from muscle in the preparation of the cDNA library is unlikely as the organ of Corti is almost completely encapsulated in bone. This finding suggests that CFL2 and CAP2 may perform an as of yet undiscovered function in tissues other than muscle. The association with ubiquitin E2i ligase (UBE2l) was unexpected. Ubiquitin E2i ligase is an ubiquitin conjugating enzyme that targets proteins for modification or differential localization within the cell (Anckar and Sistonen, 2007). UBE2l is the only E2 ligase for the sumolyation pathway and it facilitates the addition of a SUMO moiety to specific lysine residues. Unlike ubiquitination, addition of SUMO does not target a protein for degradation by the proteosome, rather, it facilitates post-translational modification, such as phosphorylation or acetylation, or changes in localization of the targeted protein (Anckar and Sistonen, 2007). Actins are post-translationally modified (Sheterline and Sparrow, 1998), and recently it was demonstrated that SUMOlyation of actin is essential for retention in the nucleus (Hofmann et al., 2009). I expected to identify many more actin binding proteins in these screens than I actually did, given the abundance of known actin binding proteins expressed in the inner ear. Though actin is a primarily a cytoskeletal protein, it is also found in the nucleus of most cells and is proposed to aid in the regulation of transcript via association with the Poll, II and Ill initiation complexes (Miralles and Visa, 60 2006). Therefore, it is unlikely that expression of actin bait proteins in the nucleus is incompatible with a yeast 2-hybrid experiment. One possible explanation may have to do with the form of actin in the nucleus. In the cytoplasm actins exist as monomers and filaments; however, the form of actin in the nucleus is less clear. A number of actin binding proteins involved in filament dynamics are found in nuclei (Dingova et al., 2009), however, phalloidin staining has not revealed the presence of actin filaments in the nucleus. Typical filamentous actin is visualized using fluorescently labeled phalloidin, leading many to postulate that either unconventional actin filaments are present in the nucleus, or nuclear actin exists only as monomers (Pederson and Aebi, 2002; Bettinger et al., 2004; Castano et al., 2010). If the latter is true, the monomers are likely ADP-actin, not ATP-actin, so as to prevent spontaneous polymerization. Consistent with that notion, all of the actin binding proteins identified in the yeast 2-hybrid screens reported here are ADP-actin binding proteins. A final explanation may be that the SUMOlyation of actin restricts the interaction of many actin binding proteins that typically function in the cytoplasm. As mentioned earlier, Hoffman et al (2009) determined that actin lacking a SUMO moiety is readily exported from the nucleus. I would therefore expect the actin bait proteins to be SUMOlyated, as the yeast 2-hybrid assay is dependent on bait and prey proteins remaining in the nucleus. Further insight into the form and function of nuclear actin will aid in the interpretation of the results of this study. 61 A directed yeast 2-hybrid approach was recently used to characterize the interaction of five of the mutations in y-actin associated with deafness (Zhong et al., 2009). In this study, the authors constructed mutant y-actin bait and used y- actin, B-actin, and three actin depolymerizing factors: cofilin 1, cofilin 2, and destrin as the prey. Activation of the three reporter genes, LACZ, HIS3, and URA3 were tested individually. Yeast expressing the p.P264L y-actin mutant bait did not interact with any of the prey to activate the LACZ reporter gene, though a weak interaction was observed with wild-type y- and B-actin prey for the HIS3 and URA3 reporter genes. In my study, I also observed conflicting data with the p.P264L y-actin bait. When it was used as the bait, no interaction was observed with the wild-type actin prey. However, the converse was not true; y-actin and [3- actin bait did have a weak association p.P264L y-actin prey. These data may be explained by the inability of p.P264L y-actin to be SUMOIyated and therefore not retained in the nucleus. Alternatively, differences in expression levels of p.P264L y-actin as the bait versus the prey may explain the differences in activation. A third scenario may combine the first two explanations in that the mutant y-actin is not SUMOIyated, though high expression of the prey may allow for low, albeit transient, levels of p.P264L y-actin in the nucleus prior to exportation. In closing, this method of analysis provides new, albeit limited data pertaining to possible deficiencies in the function of DFNA20 y-actin mutations. A directed yeast 2-hybrid experiment may also be useful to investigate other mutant 7- actinzactin binding protein interactions. For example, a former graduate student 62 found differences in the association of in vitro synthesized y-actin mutants with CAP2 using a band-shift assay (Zhu PhD Dissertation, 2008). However, details of this association, or lack thereof, were limited due to difficulties in expressing recombinant CAP2 in bacteria. In this instance, the directed yeast 2-hybrid approach is well suited to provide additional information regarding a mutant 7- actin:CAP2 interaction, as a strain of yeast expressing CAP2 has already been isolated and described in this study. 63 References Adato, A., Michel, V., Kikkawa, Y., Reiners, J., Alagramam, K. N., Weil, D., Yonekawa, H., Wolfrum, U., El-Amraoui, A., Petit, C., 2005. Interactions in the network of Usher syndrome type 1 proteins. Hum Mol Genet. 14, 347- 56. Anckar, J., Sistonen, L., 2007. SUMO: getting it on. Biochem Soc Trans. 35, 1409-13. Balcer, H. I., Goodman, A. L., Rodal, A. A., Smith, E., Kugler, J., Heuser, J. B, Goode, B. L., 2003. Coordinated regulation of actin filament turnover by a high-molecular-weight Srv2/CAP complex, cofilin, profilin, and Aip1. Curr Biol. 13, 2159-69. Belyantseva, I. A., Perrin, B. J., Sonnemann, K. J., Zhu, M., Stepanyan, R., McGee, J., Frolenkov, G. l., Walsh, E. J., Friderici, K. H., Friedman, T. B., et al., 2009. Gamma-actin is required for cytoskeletal maintenance but not development. Proc Natl Acad Sci U S A. 106, 9703-8. Bertling, E., Quintero-Monzon, O., Mattila, P. K., Goode, B. L., Lappalainen, P., 2007. Mechanism and biological role of profilin-Srv2/CAP interaction. J Cell Sci. 120, 1225-34. Bettinger, B. T., Gilbert, D. M., Amberg, D. C., 2004. Actin up in the nucleus. Nat Rev Mol Cell Biol. 5, 410-5. Castano, E., Philimonenko, V. V., Kahle, M., Fukalova, J., Kalendova, A., Yildirim, S., Dzijak, R., Dingova-Krasna, H., Hozak, P., 2010. Actin complexes in the cell nucleus: new stones in an old field. Histochem Cell Biol. 133, 607-26. de Heer, A. M., Huygen, P. L., Collin, R. W., Oostrik, J., Kremer, H., Cremers, C. W., 2009. Audiometric and vestibular features in a second Dutch DFNA20/26 family with a novel mutation in ACTG1. Ann Otol Rhinol Laryngol. 118, 382-90. Dingova, H., Fukalova, J., Maninova, M., Philimonenko, V. V., Hozak, P., 2009. Ultrastructural localization of actin and actin-binding proteins in the nucleus. Histochem Cell Biol. 131, 425-34. Dugina, V., Zwaenepoel, I., Gabbiani, G., Clement, S., Chaponnier, C., 2009. Beta and gamma-cytoplasmic actins display distinct distribution and functional diversity. J Cell Sci. 122, 2980-8. 64 Erba, H. P., Gunning, P., Kedes, L., 1986. Nucleotide sequence of the human gamma cytoskeletal actin mRNA: anomalous evolution of vertebrate non- muscle actin genes. Nucleic Acids Res. 14, 5275-94. Fass, J., Gehler, S., Sarmiere, P., Letourneau, P., Bamburg, J. R., 2004. Regulating filopodial dynamics through actin-depolymerizing factor/cofilin. Anat Sci Int. 79, 173-83. Furness, D. N., Katori, Y., Mahendrasingam, S., Hackney, C. M., 2005. Differential distribution of beta- and gamma-actin in guinea-pig cochlear sensory and supporting cells. Hear Res. 207, 22-34. Goode, B. L., Eck, M. J., 2007. Mechanism and function of formins in the control of actin assembly. Annu Rev Biochem. 76, 593-627. Hill, M. A., Gunning, P., 1993. Beta and gamma actin mRNAs are differentially located within myoblasts. J Cell Biol. 122, 825-32. Hofer, D., Ness, W., Drenckhahn, D., 1997. Sorting of actin isoforms in chicken auditory hair cells. J Cell Sci. 110 ( Pt 6), 765-70. Hofmann, W. A., Arduini, A., Nicol, S. M., Camacho, C. J., Lessard, J. L., Fuller- Pace, F. V., de Lanerolle, P., 2009. SUMOylation of nuclear actin. J Cell Biol. 186, 193-200. Jaeger, M. A., Sonnemann, K. J., Fitzsimons, D. P., Prins, K. W., Ervasti, J. M., 2009. Context-dependent functional substitution of alpha-skeletal actin by gamma-cytoplasmic actin. Faseb J. 23, 2205-14. Kamal, J. K., Benchaar, S. A., Takamoto, K., Reisler, E., Chance, M. R., 2007. Three-dimensional structure of cofilin bound to monomeric actin derived by structural mass spectrometry data. Proc Natl Acad Sci U S A. 104, 7910-5. Karakozova, M., Kozak, M., Wong, C. C., Bailey, A. 0., Yates, J. R., 3rd, Mogilner, A., Zebroski, H., Kashina, A., 2006. Arginylation of beta-actin regulates actin cytoskeleton and cell motility. Science. 313, 192-6. Korrapati, S., 2009. Functional analysis of cytoplasmic gamma-actin mutations causing non-syndromic, progressive autosomal dominant hearing loss. Genetics Program. PhD. Dissertation Liu, R, Li, H., Ren, X., Mao, H., Zhu, 0., Zhu, Z., Yang, R., Yuan, W., Liu, J., Wang, 0., et al., 2008. Novel ACTG1 mutation causing autosomal 65 dominant non-syndromic hearing impairment in a Chinese family. J Genet Genomics. 35, 553-8. Miralles, F., Visa, N., 2006. Actin in transcription and transcription regulation. Curr Opin Cell Biol. 18, 261-6. Morin, M., Bryan, K. E., Mayo-Merino, F., Goodyear, R., Mencia, A., Modamio- Hoybjor, S., del Castillo, I., Cabalka, J. M., Richardson, G., Moreno, F., et al., 2009. In vivo and in vitro effects of two novel gamma-actin (ACTG1) mutations that cause DFNA20/26 hearing impairment. Hum Mol Genet. 18, 3075-89. Nowak, K. J., Ravenscroft, G., Jackaman, C., Filipovska, A., Davies, S. M., Lim, E. M., Squire, S. E., Potter, A. C., Baker, E., Clement, S., et al., 2009. Rescue of skeletal muscle alpha-actin-null mice by cardiac (fetal) alpha- actin. J Cell Biol. 185, 903-15. 0tey, C. A., Kalnoski, M. H., Bulinski, J. C., 1987. Identification and quantification of actin isoforms in vertebrate cells and tissues. J Cell Biochem. 34, 113- 24. Pederson, T., Aebi, U., 2002. Actin in the nucleus: what form and what for? J Struct Biol. 140, 3-9. Rendtorff, N. D., Zhu, M., Fagerheim, T., Antal, T. L., Jones, M., Teslovich, T. M., Gillanders, E. M., Barmada, M., Teig, E., Trent, J. M., et al., 2006. A novel missense mutation in ACTG1 causes dominant deafness in a Norwegian DFNA20/26 family, but ACTG1 mutations are not frequent among families with hereditary hearing impairment. Eur J Hum Genet. 14, 1097-105. Schiestl, R. H., Gietz, R. D., 1989. High efficiency transformation of intact yeast cells using single stranded nucleic acids as a carrier. Curr Genet. 16, 339- 46. Shawlot, W., Deng, J. M., Fohn, L. E., Behringer, R. R., 1998. Restricted beta- galactosidase expression of a hygromycin-lacZ gene targeted to the beta- actin locus and embryonic lethality of beta-actin mutant mice. Transgenic Res. 7, 95-103. Sheterline, P., Sparrow, J. C. J. C., 1998. Actin. Oxford University Press, New York. van Wijk, E., Krieger, E., Kemperman, M. H., De Leenheer, E. M., Huygen, P. L., Cremers, C. W., Cremers, F. P., Kremer, H., 2003. A mutation in the gamma actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26). J Med Genet. 40, 879-84. 66 Zhong, 0., Simonis, N., Li, 0. R., Charloteaux, B., Heuze, F., Klitgord, N., Tam, 8., Yu, H., Venkatesan, K., Mou, D., et al., 2009. Edgetic perturbation models of human inherited disorders. Mol Syst Biol. 5, 321. Zhu, M., 2008. Examining the folding and stability of in vitro synthesized gamma- actin mutations. Cell and Molecular Biology. Ph.D. Dissertation. Zhu, M., Yang, T., Wei, 8., DeWan, A. T., Morell, R. J., Elfenbein, J. L., Fisher, R. A., Leal, S. M., Smith, R. J., Friderici, K. H., 2003. Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26). Am J Hum Genet. 73, 1082-91. 67 CHAPTER 3 STUDIES OF THE LOCALIZATION OF ANNEXIN 5A IN THE INNER EAR OF MOUSE AND THE INTERACTION OF ANNEXIN 5A WITH GAMMA-ACTIN 68 Abstract Annexin 53 is the only protein reported to interact preferentially with y-actin and not B-actin. This interaction is of interest because missense mutations in the y- actin gene (ACTG1) result in progressive sensorineural hearing loss. Massively Parallel Signature Sequencing data and hair bundle purification experiments indicate that Anxa5 (annexin 5a) is abundant in the inner ear relative to its expression levels in other organs and tissues in mice. Annexin 53 has been implicated in the reorganization of the actin cytoskeleton, leading us to postulate that the interaction of annexin 5a with y-actin may be important in maintenance of the cytoskeleton in the organ of Corti. First, I confirmed the interaction between annexin 53 and y-actin using 3 GST- pulldown. Next, to determine if annexin 53 function is potentially relevant to cytoskeletal dynamics in the inner ear I examined the localization pattern of annexin 53 in post-natal mice. Our data show that annexin 53 is present in the stereocilia, cell body, and nuclear membrane of developing auditory and vestibular hair cells. In mature hair cells, annexin 5a is observed primarily in the tips and periphery of the stereocilia, similar to the localization of y-actin. Anxa5 knock-out mice do not have hearing loss, and y-actin is appropriately localized to the periphery of the stereocilia and F-actin gaps in these mice. In conclusion, though annexin 53 is expressed at high levels in the inner ear, it is dispensable for normal hearing or proper y-actin localization. 69 Introduction In mammals, there are two cytoplasmic actin isoforms: 8 and y (Actb and Actg1). In most tissues of the body, B-actin and y-actin are expressed at roughly a 2:1 ratio (Khaitlina, 2001). However, in the inner ear, y-actin is the predominant isoform and is reported to be expressed at a B-actinzy-actin ratio of ~1 :2 (Hofer et al., 1997; Furness et al., 2005). The two cytoplasmic actins have identical amino acid sequences with the exception of four amino acids in the N-terminal portion of the 42 kDa protein. To date, only one protein is reported to interact specifically with y-actin: annexin 5a (Tzima et al., 2000). Annexin 5a is a member of the larger annexin family of 12 proteins, annexins 1- 11 and 13. The physical structure of annexins is characterized by a concave core of relatively conserved, 80 amino acid tandem repeats that bind to both negatively charged membranes and Ca2+ (Huber et al., 19903; Huber et al., 1990b; Brisson et al., 1991; Huber et al., 1992). Annexins typically have 4 repeats in the core domain with the exception of A6, which has eight (Gerke and Moss, 2002). Most annexins reversibly associate with negatively charged membranes composed of phosphatidylserines, via the core domain; an interaction that is typically enhanced by the presence of calcium ions (Gerke et al., 2005). Upon binding to Ca” and a phosphatidylserines, conformational changes occur in the tertiary structure of the protein (Concha et al., 1993). The nature and specific function of the conformational change is not fully understood for most annexins. However, in the instance of annexin 1a, the conformational 7O > change exposes the N-terminus of the protein which interacts with profilinzactin (Rosengarth and Luecke, 2003). In fact, the specificity of an annexin for other proteins is determined by the unique composition of the N-terminus of the polypeptide (Gerke and Moss, 2002). In addition to Caziinduced changes in protein conformation, annexins also respond to calcium-mediated signaling events. In this response, annexins bring about morphological changes within the cell via coordinating changes in membrane structure with reorganization of the actin cytoskeleton. Indeed, a number of annexins are reported to interact with actin, in particular annexins 1a, 23, 4a, 5a, and 63 (Gerke and Moss, 2002; Hayes et al., 2004). The nature of the interaction of an annexin with actin is variable. Annexins 23 and 6a bundle filamentous actin (F-actin) in the presence of high 032*. Annexin 1a binds F- actin, however it also associates with profilin, a protein which sequesters actin monomers. In activated platelet cells, annexin 53 localizes to the cell membrane where it interacts with the actin-based cytoskeleton (Tzima et al., 1999). It is the only annexin to demonstrate specificity for a particular actin isoform, y-actin (Tzima et al., 2000). Annexin 53 has also been implicated in pinocytosis via a nanomechanic mechanism in which polymerized patches bend the plasma membrane to form vesicles internalized by the cell (Kenis et al., 2004). Others reported membrane channel functions of annexin 53 which are supported by both modeling and 71 experimental data (Jin et al., 2004; Trouve et al., 2007). Further underscoring the dynamic nature of annexin 53 function, in response to C32+ its subcellular localization changes from diffuse expression within the cytoplasm to association with cellular membranes, the nucleus, and stress fibers in kidney epithelial cells (Markoff and Gerke, 2005). Taken together, annexin 53 clearly plays a role in cytoskeletal and membrane dynamics, however the functional details are yet to be determined (Gerke et al., 2005). The Anx35 knock-out mouse model is viable and lacks a discernable phenotype (Brachvogel et al., 2003), suggesting functional redundancy between annexin proteins. Annexin 53 is abundant in the organ of Corti and is a prominent protein in the stereocilia of hair cells in the inner ear (Peters et al., 2007; Shin et al., 2007). In fact, when compared to the mouse reference transcriptome database, annexin 53 expression is higher in the organ of Corti than in any other tissue. While the subcellular localization of annexin 53 has been well studied in other organs and cell types (Giambanco et al., 1991; Luckcuck et al., 1995; Wang et al., 1995; Gotow et al., 1996; Luckcuck et al., 1997; Kawaminami et al., 1998; Matsuda et al., 2001), the distribution and developmental expression in the inner ear is unknown. Here I provide the first report describing annexin 53 localization during postnatal development in the mouse organ of Corti and vestibular end organs. I show that annexin 5a is expressed in developing and mature hair cells and supporting cells. 72 Additionally, I probed the Anxa5 knock-out model to look for a possible defect in localization of y-actin to the periphery of the stereocilia in the hair cells of the organ of Corti, or gaps in the stereocilia of vestibular hair cells. Finally, I investigated hearing in Anxa5 knock-out mice to determine if there is a deafness phenotype associated with a loss of annexin 53 function. Taken together, my data suggest that, in spite of its high expression in the inner ear and overlapping subcellular localization with y-actin in the stereocilia of auditory hair cells, annexin 53 function is either redundant or dispensable for hearing. 73 Materials and Methods Animals All animals used in this study were housed and euthanized using C02 according to NIH guidelines and IACUC approval. Wild-type C57Bl/6J females used for breeding were purchased from Jackson Labs (Bar Harbor, ME). Anxa5 knock- out mice were a kind gift from Dr. E. Ptjschl (Brachvogel et al., 2003). Primary antibodies Rabbit polyclonal anti-y-actin antiserum generated by our laboratory was raised against the first 15 amino acids of the mammalian y-actin polypeptide (NH2- MEEEIAALVIDNGSG), and the exsanguination bleed was affinity purified. Antibody specificity for immunofluorochemistry was demonstrated using ACTG1- null mice (Belyantseva et al., 2009). To verify that this antiserum is specific for y- actin in immunoblotting applications, HeLa cells expressing either GFP-y-actin or GFP-B-actin were evaluated by western blot (Dr. Mei Zhu, unpublished data). A second anti-y-actin antiserum used in this study was a gift from Dr. J.C. Bulinski, Columbia University, NY (Otey et al., 1986'). Similar to the antiserum raised in our laboratory, this rabbit polyclonal anti-y-actin antiserum was raised against the first 15 amino acids of the mammalian y-actin polypeptide (NH2- MEEEIAALVIDNGSG). Antibody specificity for immunofluorochemistry was demonstrated using ACTG1-null mice (Belyantseva et al., 2009). The antibody from Dr. Bulinski was only used for immunofluorochemistry. 74 A commercially available rabbit polyclonal anti-B-actin antiserum (Abcam, Cambridge, MA; ab8227) raised against a synthetic peptide containing the first 100 amino acids of mammalian B-actin, was determined to be specific for B-actin in immunoblotting applications because in addition to endogenous B-actin, a single band at ~70 kDa was detected in lysate from cells transfected with GFP-B- actin and not in lysate from cells transfected with GFP-y-actin. Rabbit polyclonal anti-annexin 53 was purchased from AbCam (Cambridge, MA; ab14196). Validation of this antibody for immunoflourochemistry and immunoblotting is provided in this study. lmmunofluorochemistry lmmunofluorochemisty was done as previously described (Belyantseva et al., 2009) with modifications. Cochleae were harvested and immediately perfused with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA). The organ of Corti and vestibular end organs were microdissected in PBS pH 7.4. Samples were permeabilized with 0.5% Triton X-100 in PBS pH 7.4 and non- specific immunoreactivity was blocked in 5% BSA and 2% goat serum (lnvitrogen, Carlsbad, CA) in PBS pH 7.4 (blocking buffer) for either one hour at room temperature or overnight at 4°C. Rabbit polyclonal anti-annexin 5a was diluted 1:200 in blocking solution and rabbit polyclonal anti-y-actin was diluted 1:300 in blocking solution. Tissues were incubated with primary antiserum for either 2 hours at room temperature or overnight at 4°C. Polyclonal anti-rabbit 75 lgG secondary antiserum conjugated to either Cy3 (Sigma, St. Louis, MO; 02306) or AlexaFluor 488 (lnvitrogen, Carlsbad, CA; A11008) was used to label primary antibodies. Secondary antiserum was used at either 1:200 (Cy3) or 1:500 (AlexaFluor 488) in blocking buffer and incubated for 30 minutes at room temperature. Samples were counterstained with either F ITO-phalloidin or rhodamine-phalloidin at 1:200 in blocking buffer and DAPI (lnvitrogen, Carlsbad, CA) at 1210,000 in PBS pH7.4. Samples were imaged using Olympus Fluoview LMS (Center Valley, PA) and either a 60x or 100x objective lens. Aside from adjustments to brightness and contrast, no image manipulation was used. Auditory-evoked Brainstem Response (ABR) Animals were anesthetized (ketamine 65 mg/kg, xylazine 3.5 mg/kg, and acepromazine 2mg/kg). Body temperature was maintained through the use of water circulating heating pads and heat lamps. Additional anesthetic (ketamine and xylazine) was administered if needed to maintain anesthesia depth sufficient to ensure immobilization and relaxation. ABRs were recorded in an electrically and acoustically shielded chamber (Acoustic Systems, Austin, TX). Needle electrodes were placed at vertex (active), the test ear (reference), and contralateral ear (ground) pinnae. Tucker Davis Technologies (TDT) System Ill hardware and SigGen/BioSig software (TDT, Alachua, FL) were used to present the stimulus and record responses. Tones were delivered through an EC1 driver (TDT, aluminum enclosure made in-house), with the speculum placed just inside the tragus. Stimulus presentation was 15 ms tone bursts, with 1 ms rise/fall 76 times, presented 10 times per second. Up to 1024 responses were averaged for each stimulus level. Responses were collected for stimulus levels in 10 dB steps at higher stimulus levels, with additional 5 dB steps near threshold. Thresholds were interpolated between the lowest stimulus level where a response was observed, and 5 dB lower, where no response was observed. Vectors Mouse Anxa5 coding sequence was obtained from IMAGE clone #3488901 (ATCC, Manassas, VA) and subsequently cloned into lnvitrogen’s Gateway® system. AttB1/BZ were attached using primers 5'GGGGACAAG'l‘l'TGTACAAAAAAGCAGGCTCCATGGCTACGAGAGGCACTG TGACT3' and 5'GGGGACCACTTTGTACAAGAAGCTGGGTCTCAGTCATCCTC- GCCCCCGCAG3'. BP recombinase enzyme was used to transfer Anan-attb1/2 products into pDONR-221 and clones were sequence verified. LR recombinase enzyme was then used to transfer the Anan insert into an N-terminal GFP fusion vector, pcDNA-DEST53, and an N-terminal GST fusion vector, pDEST15. pcDNA3.1+Human ACTG1 was cloned previously in our laboratory by Dr. Mei Zhu (Zhu PhD Dissertation, 2008). Purification of Recombinant GS T-ANXA5 BI21.AI cells (lnvitrogen, Carlsbad, CA) were transformed with 10 ng of pDEST15-Anxa5 or pDEST15 alone as 3 GST only control. Single colonies were selected and grown to an OD500=04 before induction of protein production with 77 0.2% L-(+)-3rabinose (Sigma, St. Louis, MO) per manufacturer’s instructions. Cultures were grown for an additional 4 hours before being centrifuged and snap frozen in liquid nitrogen. Pellets were resuspended in 1% Triton X-100 (Sigma, St. Louis, MO) with a protease inhibitor cocktail (Roche, Basel, Switzerland) in PBS pH 7.4 and sonicated three times in 20 second bursts on ice. Lysates were centrifuged at 14,000 x g at 4°C for 15 minutes. Both the pellet and supernatant were analyzed by SDS-PAGE. Recombinant GST-annexin 53 or GST-only containing supernatant was bound to glutathione sepharose beads (GE Healthcare, Waukesha, WI) at 4°C for one hour with end-over-end tumbling per manufacturer instruction. The beads were washed four times with ice cold PBS supplemented with Complete protease inhibitor cocktail (Roche, Basel, Switzerland). Proteins were eluted using 50 mM reduced glutathione (Sigma, St. Louis, MO) and analyzed by SDS-PAGE. GS T-Pu/ldo wn Recombinant GST-annexin 53 was bound to glutathione sepharose beads as described above. Mammalian cell lystates were prepared from pellets of 1x107 COS-1 cells (ATCC, Manassas, VA). Cell pellets were resuspended in mammalian lysis/binding buffer composed of 100 mM KCI, 10 mM PIPES, 5 mM EGTA, 1% Triton X-100, pH7.4 with Complete protease inhibitor cocktail (Roche, Basel, Switzerland) as described in (Tzima et al., 2000). Cells were sonicated three times in 20 second bursts on ice and then centrifuged at 14,000 x 9. GST- ANXA5 or GST-only columns were incubated with COS-1 cell supernatant for 78 two hours at 4°C with end—over-end tumbling. The lysates were supplemented with 0, 4.8 mM, 4.98 mM, or 6 mM CaClz, to achieve 0, 0.8pM, 6pM, or 1mM free Ca”, respectively, as described previously (Tzima et al., 2000). Beads were washed four times with binding buffer and protein complexes were eluted with 50 mM reduced glutathione. Eluted fractions were analyzed by western blotting. Western Blotting Proteins were separated via SOS-PAGE on discontinuous 10% Laemmli gels (see appendix). Proteins were transferred in 10 mM Tris base, 100 mM glycine, 15% methanol (transfer buffer) at 4°C either overnight at a constant current of 5 mAmp or for 1.5 hours at a constant voltage of 110V onto polyvinylidene difluoride (PVDF) membranes (BioRad, Hercules, CA). Membranes were incubated in 5% non-fat milk in 0.025% Tween-20 in PBS pH 7.4 (blocking buffer) for either one hour at room temperature or overnight at 4°C. Rabbit polyclonal anti-y-actin antiserum (Belyantseva et al, 2009) was diluted 1210,000 in blocking buffer, rabbit polyclonal anti-B-actin antiserum was diluted 121000 in blocking buffer, and rabbit polyclonal anti-annexin 5a antiserum was diluted 121,000 in blocking buffer. Membranes were incubated with primary antiserum for either 2 hours at room temperature or overnight at 4°C. Goat polyclonal anti- rabbit lgG-HRP conjugated secondary antibody (Sigma, St. Louis, MO) was used at 123,000 in blocking buffer for one hour at room temperature. Proteins were detected using an ECL Detection Kit (GE Healthcare, Waukesha, WI) with 79 Amersham HyperfilmTM MP autoradiography film (GE healthcare, Waukesha, WI). The length of exposure was determined by signal intensity observed. In vitro synthesis of proteins Proteins were transcribed and translated in vitro using Promega’s TnT Rabbit Reticulolysate (Madison, WI) system per manufacturer’s instructions and as previously described with minor modifications (Zhu PhD Dissertation, 2008). Five hundred nanograms of either pcDNA3.1+Hum3n ACTG1 or pcDNA- DEST53+ANXA5 plasmid were incubated with T7 RNA polymerase, amino acids (-Met), and 10 pCi/pL 35S-methionine for 60 minutes at 30°C. Equal amounts of synthesized y-actin and annexin 53 were co-incubated at room temperature for 1 minute. Samples were analyzed on either standard reducing Laemmeli gels (3% stacking, 10% separating) or native gels (10%) supplemented with 1 mM ATP, 1mM ADP and/or 1mM Ca”. Post-electorphoresis, gels were fixed in 50% methanol, 10% glacial acetic acid for 30 minutes and dried onto Whatman filter paper. Proteins were visualized using a Typhoon phosphoimager and lmageQuant software (GE Healthcare, Waukesha, WI). Co-sedimentation Assay These experiments were done by Sarah Bergeron, a graduate student at the University of Iowa; a collaboration l established while attending a national conference. Samples containing 4.8 (M [3, y, or insect actin with or without annexin V, in a 121.5 actinzannexin 53 ratio, were polymerized by the addition of 80 F-salts and incubation at room temperature for about 2.5 hrs. Samples were made with and without 1mM free CaClz. Aliquots of 60 pl were removed and centrifuged at 80,000 rpm in a Beckman TLA100 rotor for 20 min at 25 °C. The supernatant fraction of each sample was removed, and the pellets were re- suspended in an equivalent amount of F-buffer (Bergeron et al., 2010). Then, equal proportions of the supernatant and the pellet fractions were electrophoresed on a 12% SOS-polyacrylamide gel. The Coomassie-stained gels were Optically scanned using a Hewlett Packard 2750 scanner, and the intensities of the actin bands were quantified by Image J (NIH, Bethesda, MD). 81 Results Annexin 53 localization in the organ of Corti and vestibular end organs Bioinformatics suggest that Anx35 is more highly expressed in the mouse organ of Corti than in any other tissue (Peters et al., 2007; Shin et al., 2007), but no studies have examined its localization during postnatal development. Therefore, I completed a postnatal developmental expression profile for annexin 53 using wild-type C57Bl/6J mice ages P0 — P28. Annexin 5a localizes to the stereocilia and cellular membranes in auditory hair cells Auditory hair cells in the organ of Corti are key to mechanotransduction; the process by which a sound wave is converted into a neural impulse. In the inner hair cells (IHC) of the organ of Corti, annexin 53 was detected prominently in the cell body, nuclear membrane, and stereocilia. At all ages, punctate staining was observed in the region immediately below the actin rich cuticular plate and throughout the cytoplasm of the cell body (Figure 3-1A,B). lmmunofluorochemistry shows prominent localization of annexin 53 to the nuclear membrane in lHCs from P0 to P7 (Figure 3-1C, D) which becomes barely detectable by postnatal days 14-28. Annexin 53 was also found in stereocilia of the inner hair cells at P0 and persisted throughout development. Prior to differentiation into distinct stereocilia, annexin 53 appeared to occupy the entire bundle, whereas in mature IHC stereocilia, localization to the periphery of the filamentous actin core was observed (Figure 3-2). 82 Figure 3-1 Representative images of annexin 53 (red) localization in hair cells (A-D) and supporting cells (E, F) of the organ of Corti in a P7 wild-type mouse. lmmunolocalization using confocal microscopy shows that anti-annexin 53 is present immediately below the actin-rich cuticular plate of inner and outer hair cells (IHC, OHC) and in the cytoplasm of supporting cells, including Deiters cells (DC) and inner pillar cells (IPC) (A). A single slice through the center of IHC nuclei (C) and maximum intensity projection through the nuclei at P0 (D) demonstrate that annexin 53 is associated with nuclear membranes. In other supporting cells, staining was observed on the surface of inner sulcus cells (E) and at the plasma membrane of Hensen’s cells (F). Samples were counterstained with FlTC-phalloidin (green) counter-stain (B, E, F) and DAPI (blue) to label nuclei (C,D). Scale bars = 5 pm. 83 OHC O O O O O 9 O ..0 ‘0 0 0: 0 0-0“. 0 .0000-00 ...0'... ' '0, 000-. 0 a}. "003' .. .-... . 0 . 0 0 0 0° . a - 0 0 0 0 0 0 84 Figure 3-2 Confocal microscopy to show the localization of annexin 53 in the stereocilia of organ of Corti hair cells during postnatal development. Samples were labeled with anti-annexin 53 (green) (A-J) and counterstained with rhodamine-phalloidin (red) as shown in the merged images (B, D, F, H, J). P0 IHC stereocilia have annexin 53 labeling throughout the bundle, whereas it is absent in OHC (A, B). At P7 annexin 5a is apparent in OHC stereocilia and displays distinct localization to the tips and periphery of the stereocilia of IHC (C, D). At P28, annexin 53 is clearly observed at the tips and along the entire length of the stereocilia in OHC (E, F), and at the tips and periphery of the F-actin core of IHC stereocilia (G, H). Scale bars = 5 pm Anti-annexin 53 antibody does not bind non-specifically in Anan—null organ of Corti samples. P0 organ of Corti samples from Anxa5-null mice were immunolabeled with anti-annexin 53 primary and anti-rabbit lgG AlexaFIuor 488 secondary antibody (green) (I) and counterstained with rhoadamine-phalloidin (red) (J). Lack of staining in the null sample validates specificity of the anti- annexin 53 antibody used in this study. Scale bar = 5 pm. Western blot of P0 cochlear lysate (K) shows that the anti-annexin 53 antibody recognizes a single protein with a molecular weight ~32 kDa. 85 annexin 53 32 kDa In contrast to lHCs, annexin 53 expression was not detected in outer hair cells (OHCs) until P5, however, once present, it also localized to the stereocilia and cell body where it remained present through development (Figure 3-2A-D). Unlike the IHCs, annexin 53 was not detected at the nuclear membrane of OHCs at any stage of development examined (data not shown). I validated the specificity of anti-annexin 53 antibody using two methods. First, Anxa5-null mice ages P0-P28 were used for immunofluorochemistry. A representative image from a P0 knockout mouse shows that there is no signal from the anti-annexin 53 antibody when imaged with the same settings as the wild-type mice (Figure 3-2A, B, l, and J). As further validation, a cochlear lysate from control mice was probed via western blotting. Figure 3-2K demonstrates a single band at 32 kDa corresponding to endogenous annexin 53 was detected using the commercially available anti-annexin 53 antibody. In vestibular hair cells, annexin 53 is present in hair cell bundles and at the nuclear membrane Similar to the inner hair cells of the organ of Corti, vestibular hair cells expressed annexin 53 at P0. In early postnatal pups (PO-P7), annexin 5a was found to occupy the entire hair cell bundles, was present within the cytoplasm, and associated with the nuclear membrane. Localization within the stereocilia of vestibular hair cells (VHCs) was not uniform in adolescent P28 mice (Figure 3- 3). 87 Figure 3-3 Changes in the distribution of annexin 53 (green) in the bundle of vestibular hair cells. P7 saccula (A, B) and P28 saccula (C-F). Filamentous actin is labeled with rhodamine-phalloidin (red) in the merged images (B, D, F). At P7, uniform labeling of the hair bundle is noted (A,B) whereas difference in neighboring hair cell bundles are apparent at P28 (C,D). Distinct localization of annexin 53 to the tips of stereocilia is observed in mature vestibular hair cell bundles (E, F). Scale bars = 5 pm. 88 By one month of age, annexin 53 was observed to cover the entire bundle in hair cells that appeared to be either developing or degenerating. This observation is in contrast to mature, healthy hair bundles where less annexin 53 staining was observed overall and was primarily at the tips of the stereocilia. There was an apparent correlation with annexin 53 localization in the entire hair cell bundle and at the nuclear membrane; in those cells displaying annexin 53 only at the tips, nuclear membrane localization was not apparent. Annexin 53 is found associated with membranes and within the cytoplasm of supporting cells An abundance of annexin 5a was also observed in the supporting cells of the organ of Corti and vestibular end organs, though localization was more consistent throughout development. In inner sulcus cells (Figure 3-1E), pillar cells and Deiter’s cells, annexin 53 was found within the cytoplasm and associated with the plasma and nuclear membranes. Similarly, Hensen’s cells also displayed punctate staining on the plasma and nuclear membranes, though they lacked cytoplasmic annexin 53 (Figure 3-1F). Unlike inner hair cells, localization to the nuclear membrane persisted though development in all supporting cell populations. Annexin 5a is on the internal leaflet of apical hair cell membranes Shin et al (2007) reported the rapid and frequent externalization of phosphotidylserine (PS) to the outer surface of the apical hair cell membrane. 90 PS externalization was visualized using an exogenous, fluorescently labeled annexin 53 protein (Shin et al., 2007). Exogenous fluorescent-conjugated annexin 53 is frequently used as a marker for apoptosis and membrane externalization because of its high affinity for PS in the presence of calcium. To determine if exogenous circulating annexin 53 is bound to the external surface of the hair cells or is translocated to the outer surface during PS externalization, l incubated organ of Corti samples with anti-annexin 53 antibody prior to permeabilization. Samples were washed well to remove any unbound antibodies and fixed a second time in 4% paraformaldehyde to cross-link any externally. bound annexin 53 antibodies. Samples were then permeabilized with 0.5% Triton X-100 and counterstained with rhodamine-phalloidin to visualize the stereocilia. Annexin 5a was present on the surface of some supporting cells, however; there was little to no annexin 53 detected on the apical surface of the hair cells (Figure 3-4). These data indicate that annexin 53 in the stereocilia is present only on the internal, cytosolic face of the membrane. These data also demonstrate that annexin 53 staining observed in hair cell stereocilia is from endogenous proteins and not from a contaminating source such as serum components in the blocking buffer. y-actin localizes properly in Anxa5-null mice Given the similarities between the localization of annexin 5a and y-actin in the stereocilia and the proposed specific interaction of the two proteins, l hypothesized that annexin 53 may function to coordinate membranezactin 91 Figure 3-4 Annexin 53 immunofluorchemistry of P7 organ of Corti without permeablization prior to incubation with primary anti-annexin 53 antibody (green). Samples were counterstained with rhodamine-phalloidin (red) to visualize the stereocilia and cell structure. Annexin 53 only (A) and merged image (B). Note that annexin 53 is not present in the stereocilia, but some external annexin 5a is visible on the surface of some supporting cells (arrows). Scale bar = 10 pm. 92 93 dynamics during development and maturation of the stereocilia. If this is indeed the case, I expected to see an absence of or improper localization of y-actin within the stereocilia of Anxa5 knock-out mice. To investigate this hypothesis, l stained whole mount organ of Corti samples with anti—y-actin in P28 mice (Figure 3-5). No differences in localization of y-actin to the periphery of the stereocilia in the IHCs were observed. Due to restrictions in resolution, it is difficult to discern the precise location of y-actin in the OHCs, though there is no obvious change compared to wild-type controls. Gaps in the filamentous actin core of vestibular hair cells have been described previously (Belyantseva et al., 2009). Monomeric y-actin and a number of actin binding proteins required for filament assembly and dynamics were reported to co-localize with these gaps, consistent with the hypothesis that y-actin is required for stereocilia repair. I identified similar gaps in the saccula of P28 wild-type and Anxa5-null mice and used immunofluorochemistry to determine if annexin 53 also co-Iocalized to gaps. In addition, I used Anx35-null mice to establish if annexin 53 is necessary for the delivery of y-actin to these gaps. Figure 3-6 shows the presence of such gaps in the F-actin core of vestibular stereocilia; however, annexin 53 is not abundant in these gaps, though diffuse staining similar to the rest of length of the undisturbed stereocilia is present. In contrast y- actin localization to these gaps is prominent in the Anx35-null vestibular hair cells. These data suggest that annexin 53 may strictly interact with y-actin at the membrane and is not required for localization, actin filament dynamics or repair. 94 Figure 3-5 y-actin localization in P28 wild-type (A, B) and Anan-null mice (C, D). y-actin (green) is present around the periphery of the filamentous actin core (red) labeled with rhodamine-phalloidin in merged images (B, D) . At this age, the intensity of y-actin in the outer hair cells of both wild-type and Anxa5-null mice was variable. Scale bars = 5 pm. 95 96 Figure 3-6 Gaps denoted by arrows in the F-actin core (red) of vestibular hair cell stereocilia were detected in both wild-type (A, B) and Anan-null (C, D) animals at P28. Annexin 53 (green) was not found to co-localize with the gaps (B) and in the absence of annexin 5 protein, y-actin (green) was still able to co-localize (D), as was previously described. Note in A and B, annexin 53 localizes to the tips of a well developed bundle (arrow) whereas in neighboring cells with immature or degenerating bundles (asterisks) annexin 53 is found to occupy the entire bundle. 97 98 Annexin 5a knock-out mice do not have hearing deficits Annexin 53 is both developmentally regulated and highly expressed in the mouse inner ear suggesting that lack of annexin 53 might result in hearing loss. Four month old mice were evaluated by auditory-evoked brainstem response (ABR) at 8, 16, and 32 kHz (n=3). All mice tested were within the normal range of hearing, having thresholds between 15 — 30 kHz. Therefore, no detectable difference in hearing exists between wild-type and Anxa5-null mice (data not shown). GST-Pulldown shows annexin 5a is specific for y—actin in whole cell lysates To confirm the specificity of the interaction between annexin 53. and y-actin, COS-1 cell lysates were used as an actin source. Recombinant GST-annexin 53 and GST proteins were expressed in Bl21.AI cells, bound to a glutathione sepharose column and then evaluated for purity using an SDS-PAGE and coomassie blue stain (Figure 3-7C). The columns were then incubated with COS-1 cell lysate with constant end-over-end rocking for 2 hours at 4°C. Previous reports demonstrate a calcium-dependent interaction, thus the Ca”- free binding buffer was supplemented with 0, 0.8 pM, 8.8 uM and 1 mM of free Ca2+ (Tzima et al., 2000). Columns were washed to remove unbound proteins, and the GST or GST-annexin 53 complexes were eluted using reduced glutathione sepharose and probed for the presence of y-actin or B-actin using isoform specific antibodies (Figure 3-7). As expected, results from the western blots show that only the y- isoform of cytoplasmic actin was bound to GST- annexin 53. However, contrary to 99 . A9 :33 0:3 0.80808 can w0 6030.3 203 8:03:38 ..o3:§.30¢ .33 50303 9.3: tongues 20; 8233: 692w 30:3 93:3 05 5 +30 we: 3 8:33 use 8:803 05 E 6:303 0.02 .833 =8 Twoo .3338 >30 .50 can m ATAATGTTTGAAACCTTCAATACCCCAGCCATGTACGTE::§PTTCAGGCG TGCTGTCC ATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTAGCCATCCAGGCTGTGCTGTCC ATCATGTTTGAGACCTTCAACGTGCCTGCCATGTATGTGGCTATCCAGGCGGTGCTGTCC ** *******~k ******** ** ******** ** *1? ** ****~k ********* TGTATGCATCTG GCGCACCACTGGCATTGTCATGGACTCTGGTGACGGGGTCACACAC GTCGTACCACAGGCATTGTGATGGACTCCGGAGACGGGGTCACCCAC CTCTATGCTTCCGGCCGTACCACCGGCATCGTGTTGGATTCTGGGGACGGTGTCACCCAC * ***** ** ** *‘A’ ***** ***** ** **** ** *ir ***** ***** *** <— Exon 3 CCAGTGCTGCTGACCGAGGCCCCCCTGAACCCCFAGGCCAACAGAGAGAAGATGACfiCAG CCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAG CCCACCCTGCTCACCGAGGCCCCCCTCAATCCCAAGGCCAACCGCGAGAAGATGACCCAG ** ***** ************** ** ************ * *********** *i'i- Exon 4 —> ATTATGTTTGAGACCTTCAACACCCC-ATGTACGTGGCCATCCAGGCCGTGCTGTCC ATCATGTTTGAGACCTTCAACACCCCAGCCATGTACGTTGCTATCCAGGCTGTGCTATCC ATCATGTTTGAGACCTTCAACGTGCCCGCCATGTACGTGGCCATCCAGGCCGTGCTGTCC *ir ****************** ** *********** ** ******** ***** *** CTCTACGCCTCTGGGCGCACCACTGGCATgGTCATGGACTCTGGAGAchGGTCACCCAC CTGTACGCCTCTGGCCGTACCACTGGCAT GGGTCACCCAC CTCTACGCCTCCGGCAGGACCACCGGCATCGTGCTGGACTCCGGCGACGGCGTCACCCAC ** ******** ** * ***** ***~k* ** *****~k* ** ***** ********* 126 l... Skeletal Diaphragm Muscle Heart Intestine Soleen -RT +RT -RT +RT -RT +RT 391bp 292bp 147bp ~ we .102bp- . O - - . v Eye Kidney Testis ()whole Lung Brain —RT +RT -RT +RT ~RT +R’ -RT +RT -RT +RT ~O Figure 4-2 Tissue specific splicing to include exon 33 in the Actg1 transcript. The larger PCR products at ~390 bp and ~290 bp are likely nuclear heterogenous RNA and intermediate spliceforms. The 147 bp product represents exon 33- containing Actg1 transcripts, while the 102 bp product represents normally spliced Actg1 transcrips. Splicing to include exon 33 is limited to skeletal and cardiac muscle, and is not observed in the intestinal smooth muscle. 127 corresponding to the two alternatively spliced transcripts, I also observed larger amplicons that were not present in the no-RT controls. The sizes of these products are consistent with incompletely spliced, heterogeneous RNA in the nucleus. Exon 33 is highly conserved among mammals Evolutionary conservation of nucleotide sequence is typically indicative of functional significance. In silico analysis of Actg1 intron 3 shows an unusually high degree of conservation among vertebrates, including the region containing the 45 bp alternatively spliced exon and flanking splice sites (Figure 4-3A,B). To determine if splicing of the Actg1 transcript is an evolutionarily conserved event in vivo, I prepared cDNA from human, dog, and cat skeletal muscle total RNA. I designed species and isoform specific primers that are similar to the PCR assay described above (Figure 4-1B). Splicing to include exon 33 was observed in skeletal muscle cDNA from all species assayed. In dog skeletal muscle, the alternative transcript was present at nearly equal levels to the expected Actg1 transcript (Figure 4-3C). All PCR products were sequenced to confirm the imputed exon 33 sequence generated by sequence alignment and shown in Figure 4-3B. Similar to the mouse, inclusion of exon 33 introduces an in-frame termination codon in cat, cow, dog, and rat. In humans and rhesus, exon 33 is 41 nt and unlike the mouse, cat, and dog, inclusion results in a frameshift of the ACTG1 coding sequence creating a PTC in exon 4. 128 Figure 4-3 Exon 33 and sequence immediately 5’ and 3’ display a high degree of conservation between vertebrates, as shown by the UCSC genome browser vertebrate conservation track (A). Alignment of the nucleotide sequence of exon 33 in 7 mammals (B). Exon 33 is flanked by canonical splice sites in all species. The 50 bp region shown has 89% homology between species. For comparison, the 50 hp at the 3’ and of exon 3 and 50 bp at the 5’ end of exon 4 have 90% homology between species. Using species and isoform specific primers, I used RT-PCR to amplify across the exon 3-4 junction of Actg1 in humans, cat, and dog skeletal muscle cDNA (0). Similar to the assay described in Figure 2, larger products are present corresponding to intermediate splice forms. The primary Actg1 transcript corresponds to a ~100 bp product, whereas inclusion of exon 33 results in a larger, ~150 bp product, as visualized on a 3% agarose gel. 129 **¥¥¥** 0101* *Wkrumemynkr um¥¥¥01¥¥¥¢ *emkrhvnk. **:*¥¥ .1 *010101 0999 advUBU00¢¢GBUUUBUUBBHdUOUBUUB09909009909099 Umou mmzoz “mm QOQ “mu mmuom mammam :mEsm 1011!. IIIrI',rIrIIIi rtIIiLfIl 130 Developmental regulation of Actg1 alternative splicing To investigate the function of the alternative Actg1 transcript in muscle relevant tissue, l utilized a cell culture based model using the well-characterized C2C12 mouse myoblast cell line. C2C12 cells are well characterized and are frequently used to study transcriptional and proteome changes during the differentiation of myoblasts into myotubes (Kislinger et al., 2005; Casadei et al., 2009). Myoblasts were grown to ~70% confluence and then cultured in the presence of 10% horse serum for 36 hours to induce differentiation. Partially differentiated cell cultures were incubated further in 2% horse serum with 10 pM Ara-C to inhibit proliferation of undifferentiated myoblast cells (Figure 4-4A-C). Total RNA was harvested immediately prior to the addition of 10% horse serum and every 48 hours thereafter. Splicing of the transcript to include exon 33 corresponded with differentiation of myotubes (Figure 4-4D). Cytoplasm contains RNA with exon 33 but no corresponding protein product Although the PCR assay is capable of detecting intermediate splice variants, it is possible that the alternative transcript is the result of promiscuous splicing in the nucleus and not exported to the cytoplasm for translation. Total RNA was isolated from both cytoplasmic and nuclear fractions of mature myotube cultures. Using PCR, I found that the intermediate spliceforms remained in the nuclear fraction, whereas only the typical and alternatively spliced Actg1 transcripts were present in the cytoplasmic fraction (Figure 4-5A,B). 131 Figure 4-4 Splicing to include exon 33 is a developmentally regulated event in skeletal muscle. 02012 myoblasts (A) were grown to 70% confluence and induced to differentiate in DMEM + 10% horse serum. Partially differentiated cultures (B) containing both myoblasts and myotubes were observed by 2 days post- differentiation. After 36 hours, medium was replaced with DMEM + 2% horse serum and 10 uM Ara-C and cultured for an additional 4 days (0). RNA was harvested in Trizol and RT-PCR was used to assay for splicing to include exon 33 (D). As described in Figure 1, the primary Actgl transcript corresponds to a 102 bp product, whereas inclusion of exon 33 yields a 147 bp product. 132 8:88.83 8223883 8.338383 -38 m>mu m -38 m>mo v -38 £66 N 383022 eemosllirltl'll"""' en ST.- 133 8 3 +5 1‘ ‘ 4— Read through ‘ <— y-actin , g. , -_ _- , ¥ ‘— Truncated product Figure 4-5 Exon 33 transcripts are found in the nuclear (A) and cytoplasmic (B) RNA fractions of myotubes (6 days post-differentiation). Partially spliced, heterogeneous RNA intermediates remained in the nuclear fraction. Western blot using an anti-y-actin antibody demonstrates that a protein product corresponding to either a truncated product or read-through of the stop codon was not observed (0). 134 Given that the alternative transcript is exported to the cytoplasm, I used western blotting to detect a protein product. The phenol fraction of Trizol preparations used for the time-course experiment described above were further processed to obtain protein extracts. Using a anti-y-actin specific antibody directed against the N-terminal of the polypeptide, I probed western blots for the presence of a protein product from exon 33 transcripts (Figure 4-50). No peptide corresponding either to usage of the termination codon (~15 kDa) or a read-through of the termination codon in exon 33 (~45 kDa) was detected. Inhibition of nonsense mediated decay results in an increase of exon 33- containing transcripts To address the hypothesis that exon 33 is regulatory and may repress translation of Actg1 by targeting the transcript for NMD via introduction of a termination codon prior to the last exon of the typical transcript, I treated cells with cycloheximide. Cycloheximide targets the small ribosomal subunit and is used to inhibit translation-dependent NMD of PTC-containing transcripts. Cultures of proliferating myoblasts and mature myotubes were treated with either 40 ug/mL cycloheximide in ethanol or an ethanol-only control for three hours in otherwise standard growth conditions. Within the 3 hour treatment with cycloheximide, inhibition of NMD resulted in approximately 1.5x increase of exon 33 transcripts as measured by semi-quantitative analysis (Figure 4-6). These data indicate that exon 33 targets the transcript for translation-dependent NMD. Furthermore, 135 147 bp 102 bp Figure 4-6 Cycloheximide (CHX) treatment of myotubes resulted in an increase in exon 33 transcripts. Semi-quantitative RT-PCR using primers described in Figure 1 was used to evaluate relative abundance in untreated (A) and cycloheximide treated (B) cells. Experiments were repeated in triplicate. 136 splicing to include exon 33 is a frequent event in mature myotubes, given the rapid increase in the relative abundance of the alternatively spliced product. Cells expressing exogenous human ACTGl regulate splicing to include exon 33 during development It has been previously demonstrated that intron 3 is necessary to down-regulate Actg1 (Lloyd and Gunning, 2002). l established a system to determine if the presence of intron 3 is sufficient to down-regulate Actg1 via splicing to include exon 33. To this end, I generated mass-selected 02012 cell lines stably expressing either the coding region of human ACTG1 with intron 3 genomic DNA (pHs-l3), or intron 3 with an A>G transition to mutate the splice-site (pHs-SSM). Both expression constructs are driven by a CMV promoter (Figure 4-7). Using species specific primers, we were able to differentiate between endogenous mouse Actg1 and exogenous human ACTGl transcripts. As expected, proliferating myoblasts spliced intron 3 from the mature human RNA transcript in cells expressing pHs-l3 and pHs-SSM. Both cell lines appeared normal as compared to wild-type myoblasts by phase-contrast microscopy. Differentiation was induced when cells were ~70% confluent by the addition of DMEM + 10% horse serum followed by 1 week in 2% horse-serum + 10 uM Ara- 0. Both the pHs-I3 and pHs-SSM cells formed myotubes indistinguishable from wild-type. Analysis of RNA from pHs-l3 and pHs-SSM myotubes by RT-PCR shows splicing to include exon 33 in the ACTG1 mRNA from pHs-l3, but not from 137 pHs-SSM (Figure 4-8A,B). Similar to endogenous exon 33 transcripts, the level of human exon 33 transcripts increased after a 3 hours treatment with cycloheximide (Figure 4-80). 138 Figure 4-7 Diagrams of pHs-l3 (A) and pHs-SSM (B) . Both vectors contain the full length cDNA of human ACTG1 under the control of a constitutive CMV promoter. The entire genomic intron 3 was cloned into Xcml sites located in exons 3 and 4. Mutagenic primers were used to mutate the 3’ splice acceptor site as indicated. 139 pHs43 pHs-SSM 140 Figure 4-8 02012 myotubes transfected with human ACTG1 constructs splice to include exon 33 only when a proper 3’ splice acceptor site is present. Human ACTG1 is spliced to include exon 33 in cells stably expressing pHS-l3 (A), but not pHs- SSM (B). When treated with cycloheximide to inhibit translation-dependent nonsense mediated decay, an increase in exon 33-containing transcripts from pHS-l3 was observed (0). 141 0 419,43 147 bp 102 bp 142 Discussion In this study, I identified a novel Actg1 splice variant enriched in skeletal muscle containing tissues. This is the first report of alternative splicing for an actin transcript. Similar to the coding exons of Actg1, exon 33 is highly conserved in vertebrates. l demonstrated that splicing is differentially regulated in developing muscle using the well-characterized 02012 mouse myoblast cell line. Furthermore, inhibition of translation-dependent NMD results in an elevation in the level of exon 3a-containing transcripts, consistent with a regulatory function. Finally, a point mutation in the 3’ acceptor site of exon 33 completely abolished splicing of exon 33. Previous studies indicate that inhibition of splicing intron 3 from the primary Actg1 RNA is responsible for the down-regulation of y-actin during differentiation of myoblasts (Lloyd and Gunning, 1993, 2002). Here I demonstrate that this regulatory splicing incorporates an additional exon which is sufficient for down-regulation of Actg1 via a mechanism not previously shown for an actin transcript. Based on this work, I hypothesize that y-actin is down- regulated via alternative splicing to introduce a PTC and thus degrade Actg1 transcripts via NMD, a process termed RUST (Green et al., 2003; Lewis et al., 2003). During differentiation of myoblasts, multiple transcription and splicing factors are required to coordinate changes in expression required for differentiation. Thus, it is possible that the presence of the alternatively spliced Actg1 transcript is the result of “noisy splicing”. Large-scale analyses indicate that the majority of 143 alternatively spliced transcripts are likely generated in error because of their low abundance across multiple tissues and lack of correlation with expression differences in the genes examined (Pan et al., 2006; McGlincy and Smith, 2008; Melamud and Moult, 2009). Using the guidelines established by Zhang and colleagues, I evaluated whether splicing to include exon 33 is spurious or functional splicing (Melamud and Moult, 2009; Zhang et al., 2009). Our data indicate that splicing to include the alternatively spliced Actg1 transcript does maintain the proper reading frame, except in humans. Gamma-actin does not belong to a gene family which is alternatively spliced, it does include an evolutionarily conserved termination codon, which is enriched in a tissue- and development—specific manner. The premise of RUST seems inherently counter-intuitive as a regulatory mechanism, since the most efficient means of down-regulation would be to not transcribe the RNA at all. However, Soergel et 3! note that the production of large transcripts in any instance can be an inherently wasteful endeavor (Soergel et al., 2006), as introns can constitute up to 95% of a primary RNA transcript (Lander et al., 2001; Soergel et al., 2006). It is possible that RUST serves as a mechanism to modulate expression of genes that are typically highly expressed and are essential in the cell. When a particular environmental or physiologic change dictates that only moderate levels of protein are required, it is necessary to down-regulate production without switching off transcription entirely. In such an instance, post-transcriptional degradation of a portion of excess transcripts 144 I- A. produced via NMD is more energy efficient than post—translational degradation of unnecessary proteins. This model is suitable for y-actin in muscle, as it is expressed at high levels in proliferating myoblasts, but is also necessary at lower levels in differentiated myotubes and developed skeletal muscle. Of interest, three regions of 13 nt, 32 nt, and 6 nt immediately adjacent to the 5’ donor site of exon 33 are nearly perfectly conserved among vertebrates (Figure 4-9). These regions may contain recognition motifs for splicing factors such as muscleblind and muscleblind-like proteins that are necessary for coordinating gene expression changes between progenitor and differentiated muscle cells (Pascual et al., 2006; Holt et al., 2009). Finally, I have established mass selected cell lines expressing exogenous human ACTG1 with and without a functional splice site. If RUST is the mechanism by which y-actin transcripts are degraded, I should observe an increase in splicing to include exon 33 from either the exogenous or endogenous y-actin transcript in response to the amount of exogenous actin produced. A more quantitative approach, such as qRT-PCR will be necessary to investigate the intricacies of this mechanism. In closing, this report documents the first identification and characterization of an alternatively spliced actin transcript. Subtle differences in sequence of exon 33 between primates and lower mammals further support the regulatory hypothesis. 145 In humans exon 33 is only 41 nucleotides and generates a PTC in exon 4 via a frameshift in contrast to mouse which is 45 nt and includes an in-frame PTC. This finding coincides with evolutionary importance of the PTC and not a translated product. Previous studies of RUST indicate that this type of regulation is not only conserved across species, but is typically found as a regulatory mechanism for members of the same gene family. It will therefore be useful to explore RUST as a regulatory mechanism for other actin isoforms. 146 Fig u re 4-9 Conservation of intron 3a. In addition to the high degree of conservation of the nucleotide coding sequence of exon 33, the intronic region immediately 3’ of the 5’ splice donor site is well conserved. These sections of conserved sequence are good candidates for splicing enhancer or silencer motifs. 147 omuom woe msmogm cmfidz umm omsoz mm :93. mm :96 * ++k+¥*+¥*¥*¥+* *++*«¥**+* is *¥i* s * ** ****+*** #3 ****++** #+* ++s+s+i ++++sii++s UdUUHflUUT transition, resulting in a novel Alul recognition site within the amplicon that allows .for identification of wild-type, heterozygous, and homozygous mice. Primers- flanking the neo cassette 5'CCCGCTTTTGGAAAGATE and 5'GGCCACTCCTCTCAACTAAC? were used to screen for the removal of the selection cassette. Generation of congenic mice After germline transmission of the p.P264L (PL) allele was established, l backcrossed hetereozygouse males to wild-type C57Bl/6J females purchased from Jackson Labs. One backcross was to a transgenic Flpe recombinase female to remove the neo selection cassette. After removal of the neo cassette, and as soon as the animals had greater than 90% contribution from the C57Bl/6J background, I crossed +/PL by +/PL mice to generate PL/PL homozygotes. We continued to backcross to the C57Bl/6J background to obtain congenic mice. 158 Rotarod Mice were first trained on the Rotarod with daily tests for one week. Accelerating Rotarod tests were done three times per week, with three trials each day using a accelerating protocol for a total of five weeks (Crawley, 2000). Briefly, the rod accelerated from 4 rpm to 40 rpm during each 5 minute test. Latency to fall off was recorded for each three tests. The longest latency for each day was determined and averaged for all mice within a single genotype across a single week. Protein isolation Brain samples from six week old mice were harvested immediately after sacrifice and snap frozen on dry ice. Samples not immediately used were transferred to - 80°C for long-term storage. Approximately 50 mg of brain was homogenized in standard SDS-Iysis buffer mammalian lysis/binding buffer composed of 100 mM KCI, 10 mM PIPES, 5 mM EGTA, 1% Triton X-100, pH7.4 with Complete protease inhibitors (Roche, Basel, Switzerland). Brains were homogenized using a rotor homogenizer for thirty seconds at full speed and centrifuged for 15 minutes at 13,000 x g in a microcentrifuge at 4°C to pellet insoluble material. The protein concentration of each sample was determined using a Bradford assay (BioRad, Hercules, CA) with BSA as a standard. 159 Western Blotting Proteins were separated via SDS-PAGE on discontinuous 10% Laemmli gels (see appendix). Proteins were transferred in 10 mM Tris base, 100 mM glycine, 15% methanol (transfer buffer) at 4°C either overnight at a constant current of 5 mAmp or for 1.5 hours at a constant voltage of 110V onto polyvinylidene difluoride (PVDF) membranes (BioRad, Hercules, CA). Membranes were incubated in 5% non-fat milk In 0.025% Tween-20 in PBS pH 7.4 (blocking buffer) for either one hour at room temperature or overnight at 4°C. Rabbit polyclonal anti-y-actin antiserum (Belyantseva et al, 2009; see chapters 1 and 2 for description of antibody validation) was diluted 1210000 in blocking buffer and rabbit polyclonal anti-B-tubulin antiserum (Abcam, Cambridge, MA; ab6046) was diluted 1:1000 in blocking buffer. Membranes were incubated with primary antiserum for either 2 hours at room! temperature or overnight at 4°C. Goat polyclonal anti-rabbit lgG-HRP conjugated secondary antibody (Sigma, St. Louis, MO) was used at 123,000 in blocking buffer for one hour at room temperature. Proteins were detected using an ECL Detection Kit (GE Healthcare, Waukesha, WI) with Amersham HyperfilmTM MP autoradiography film (GE healthcare, Waukesha, WI). The length of exposure was determined by signal intensity observed. Pixel intensity of each band was measured using BioRad’s GelDoc software (Hercules, CA). 160 lmmunofluorochemistry lmmunofluorochemisty was done as previously described (Belyantseva et al., 2009) with modifications. Cochleae were harvested and immediately perfused with 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA). The organ of Corti and vestibular end organs were microdissected in PBS pH 7.4. Samples were permeabilized with 0.5% Triton X-100 in PBS pH 7.4 and non- specific immunoreaCtivity was blocked in 5% BSA and 2% goat serum (lnvitrogen, Carlsbad, CA) in PBS pH 7.4 (blocking buffer) for either one hour at room temperature or overnight at 4°C. Rabbit polyclonal anti-y-actin (Otey et al, 1986, Belyantseva et al, 2009; see chapters 2 and 3 for description of antibody validation) was diluted 1:300 in blocking solution. Tissues were incubated with primary antiserum for either 2 hours at room temperature or overnight at 4°C. Polyclonal antiPoncIonal anti-rabbit lgG secondary antiserum conjugated to AlexaFIuor 488 (Invitrogen, Carlsbad, CA; A11008) was used to label primary antibodies. Secondary antiserum was used at 1:500 in blocking buffer and incubated for 30 minutes at room temperature. Samples were counterstained with rhodamine-phalloidin (lnvitrogen, Carlsbad, CA) at 1:200 in blocking buffer and DAPI (Invitrogen, Carlsbad, CA) at 1210,000 in PBS pH7.4. Samples were imaged using Olympus Fluoview LMS (Center Valley, PA) and either a 60x or 100x objective lens. Aside from adjustments to brightness and contrast, no image manipulation was used. 161 Auditory-evoked Brainstem Response (ABR) These procedures were performed by Karin Halsey at University of Michigan with their animal use agreement. Animals were anesthetized (ketamine 65 mg/kg, xylazine 3.5 mg/kg, and acepromazine 2mg/kg). Body temperature was maintained through the use of water circulating heating pads and heat lamps. Additional anesthetic (ketamine and xylazine) was administered if needed to maintain anesthesia depth sufficient to insure immobilization and relaxation. ABRs were recorded in an electrically and acoustically shielded chamber (Acoustic Systems, Austin, TX USA). Needle electrodes were placed at vertex (active) and the test ear (reference) and contralateral ear (ground) pinnae. Tucker Davis Technologies (TDT) System I” hardware and SigGen/BioSig software (TDT, Alachua, FL USA) were used to present the stimulus and record responses. Tones were delivered through an EC1 driver (TDT, aluminum enclosure made in-house), with the speculum placed just inside the tragus. Stimulus presentation was 15 ms tone bursts, with 1 ms rise/fall times, presented 10 per second. Up to 1024 responses were averaged for each stimulus level. Responses were collected for stimulus levels in 10 dB steps at higher stimulus levels, with additional 5 dB steps near threshold. Thresholds were interpolated between the lowest stimulus level where a response was observed, and 5 dB lower, where no response was observed. 162 Scanning Electron Microscopy (SE M) Samples were prepared for scanning electron microscopy as described previously (Belyantseva et al., 2009) with minor modifications. Briefly, cochleae were dissected from the temporal bone of mice and immediately fixed by perfusion through the oval window with 2.5% glutaraldehyde in 0.1M sodium cacodylate pH7.3 supplemented with 1mM CaClz. After a 2 hour incubation at room temperature with vigorous shaking, samples were transferred to dilute 0.125% glutaraldehyde in cacodylate pH8.0 supplemented with 0.5mM CaClz for storage until use. Immediately prior to microdissection, the samples were rinsed in 1xPBS three times. The boney capsule of the cochlear bulla was gently removed along with the stria vascularis, Reisner’s membrane, and tectorial membrane to reveal the apical surface of the auditory hair cells. The first apical turn was also removed and mounted separately so as to reveal the second, basal turn. Samples were taken through a series of ethanol solutions (25%, 50%, 75%, 90%, 95%) with three final rinses in 100% ethanol. Cochleae were further processed in a Balzers critical point dryer with four rounds of flushing for 5 minutes each and then mounted onto carbon coated stubs. A thin coating of osmium tetroxide was applied followed by a second coating with gold. Samples were stored in a vacuum until imaged. A JOEL 6400 scanning electron microscope was used to image cochleae. I found that a working distance of 16 mm and numerical aperture 4 provided the best depth of field and 163 resolution for this type of sample. Accelerating voltage was variable and selected based on intensity of the LaBe filament. 164 Results The mutant P264L protein is expressed at normal levels, however, the neo cassette reduces expression I determined the expression of the mutant p.P264L allele by western blot analysis. Frequently, the presence of a neo selection cassette reduces the total level of a mutant protein in cells due to promiscuous splicing of the transcript to include the neo cassette; therefore animals with and without the neo cassette were analyzed. Brain samples were homogenized using a rotor homogenizer in lysis buffer supplemented with protease inhibitors and centrifuged to pellet insoluble material. One milligram of total protein from each sample was used for western blotting with a previously validated y-actin specific antibody. | quantitated the pixel intensity of each product using a BioRad Gel Doc system and normalized to the B—tubulin loading control. Figure 5-2A demonstrates that P264L y-actin is as abundant in homozygous knock-in mice (PL/PL) as y-actin in wild-type littermates (+/+). In contrast, the P264L protein produced in mice still harboring the neo selection cassette (PL-neo) show an 80% reduction compared to wild-type littermates (Figure 5-28). The remainder of the data that I present in this chapter is from mice with the full expressing (PL) allele. P264L heterozygotes and homozygotes are physically fit and fertile DFNA20 families do not show clinical signs other than hearing loss. However, the previously characterized y-actin knock-out mice are born at lower than expected ratios, are less viable, smaller, and show muscular myopathy when 165 O 00 Qv \ q\/ 000 (2" Q0 B \x Qx: X y-actin I I B-tUbUIin Western blots to determine expression of the recombinant p.P264L in the Figure 5-2 presence and absence of the neo cassette. The pixel intensity of each band was measured using Gel Doc software (BioRad). The quantity of y-actin (top panel) was normalized to a B-tubulin loading control (bottom panel). The neo cassette reduces expression of the recombinant allele to 20% of normal. Excision of cassette restores wild-type levels of expression. 166 compared to wild-type and heterozygous littermates (Belyantseva et al., 2009). In contrast, data from 10 matings of +/PL by +/PL mice indicate that these mice are born at the expected Mendelian ratio. To determine if the P264L protein causes reduced body size or muscular myopathy, we obtained weekly weight measurements and evaluated the neuromuscular health of the animals using a Rotarod test. In this test, animals are placed on a slowly accelerating spinning rod and in order to stay on they must continually walk. If a mouse has neuromuscular deficits, it will fall off prematurely. In the five weeks the mice were evaluated, there was no difference in weight or the overall performance of PL/PL mice on the Rotarod as compared to heterozygous or wild-type littermates (Figure 5—3). These data were collected by Lawrence Lee as part of a mentored undergraduate research project. P264L homozygotes have an early onset, progressive hearing loss Studying deafness in mice poses the difficulty of determining whether or not a mouse has heard a sound. The classic test is to snap or clap and observe the mouse for a whole body startle response. A more accurate method is auditory- evoked brainstem response (ABR) which allows for quantitative measurement of hearing in mice. An electrode is placed near the ear (subdermal) and the brainstem response to sound is measured. A typical response to sound is a six- peak waveform spaced at regular intervals. The intensity (dB SPL) at which a waveform is no longer detected determines the threshold of hearing in a mouse. We do not have the equipment or expertise for these experiments at Michigan 167 TI' Lt 1W Figure 5-3 PL mice do not have muscular myopathy as determined by an accelerating Rotarod test (A), nor are they smaller than heterozygous or wild-type littermates (B,C). Mice were weighed immediately prior to the first Rotarod test of the day. Additional weight data were collected from mice used for ABR. n=4 except where noted with * when n=2. 168 Time (s) 250 200 150 — 100 50 Weight (9) Weight (g) l +/+ l +/PL I PL/PL 3 4 5 Overall Weeks Avg n: + +/+ -I- +/PL -II- PL/PL 6 7 8* 9* n=4 Weeks Old + +/+ -I- +/P|_ 'i- PL/PL n=4 Weeks Old 169 State University, so I escorted mice to the University of Michigan where Karin Halsey, a technician in the Dolan laboratory, obtained these ABR data. We chose to test mice beginning at 4 weeks of age. Once animals are taken outside of Michigan State University, it is not possible to house them in our facilities again. Therefore, I sacrificed all mice immediately after ABR because obtaining serial audiograms of the same animal was not possible. P264L homozygotes had a slight threshold shift in the 8-16 kHz range and a moderate shift at 32 kHz by 4-5 weeks of age (Figure 5-4). The most important range of hearing for mice is in the ultrasonic range of 40 kHz to 80 kHz, as these are the frequencies at which they communicate (Ehret, 2001). In mice, hearing is established around postnatal days 12-14 (P12-14) when innervation of the auditory hair cells is complete. Hearing loss at 4 weeks of age is an indication of early onset deafness. By 6-7 weeks of age, hearing loss was profound across all frequencies tested and a response was not observed within the limits of the test at 32 kHz (Figure 5-4). In contrast, 6-7 week old heterozygous and wild-type littermates were within the range of normal hearing at 8 and 16 kHz. The threshold shift at 32 kHz is likely due to the AHL (age related hearing loss) allele carried by C57BI/6J mice. The high to low frequency progression of hearing loss in the PL homozygotes is similar to that observed in people with DFNA20 deafness. 170 Figure 5-4 Auditory—evoked Brainstem Response (ABR). Mice homozygous for the P264L (PL) mutation have early onset, rapidly progressing hearing loss. At 4-5 weeks of age, a moderate threshold shift is observed at 16 and 32 kHz. By 6-7 weeks of age, PL homozygotes have a profound hearing loss at 8 and 16 kHz and a complete loss at 32 kHz. It should be noted that hearing loss is also observed at 32 kHz in wild-type mice due to a mutation carried on the C57Bl/6J background. The range of normal hearing is indicated in yellow. 171 v": 3.2, We +\+l0l .3 Egret v.3 n-©._n.\l_n.lIl x3 m4. +111. 5.; 93:11 v.2, mélifialol 333... 5:362“. ~13. mm NI. 9 ~15. m om ov 'IdS 8P om ow cow 029.765... ¢m< omcoamom oz 172 Hearing loss in PL/Pl. mice is due to degeneration of stereocilia Hearing loss in mice can manifest in a number of ways. In order to characterize the nature of the hearing loss in PL homozygotes, I examined the apical surface of the hair cells using scanning electron microscopy. Immediately after ABR, cochleae were fixed in glutaraldehyde supplemented with 1mM CaCIz via local perfusion through the oval window. Prior to imaging, samples were coated with a thin layer of osmium tetroxide to increase conduction of fine structures and then sputter coated with a second layer of gold to increase overall transduction. In order to expose all of the auditory hair cells in the cochlea, the first apical turn was mounted separately from the remainder of the cochlear bulla (Figure 5-5A). The apical turn contains hair cells that process sounds in the 4-8 kHz range (Meyer et al., 2009). The remainder of the bulla processes sound from 8-64 kHz (Figure 5-58). Consistent with the ABR data, the least severe pathology was observed in the apical region of the cochlea. Figure 5-6 shows that the overall organization of the cochlea in mutant mice is similar to a wild-type littermate. Closer examination of the outer hair cells reveals that the two inner rows of stereocilia in the hair cell bundle of PL homozygotes are either degenerating or not properly formed (Figure 5-7). At this region of the cochlea the bundles are frequently slightly disarrayed, as can be seen in the same region from a wild-type littermate. This splaying, however, is distinct from the pattern of degeneration in mutant mice. 173 Figure 5-5 Low magnification scanning electron images of the apical turn (A), remainder of the cochlear bulla (B) and higher magnification image of inner and outer hair cells (C). I mounted the apical turn separately so as to expose more of the high frequency hair cells. The frequencies perceived by the apical portion of the cochlea range from 4 kHz at the far left to approximately 10 kHz to the right. The exposed hair cells of the intact cochlear bulla represent approximately 12 kHz to 32 kHz going clockwise from the 9 o’clock position. Scale bars = 200 nm. 174 175 Moving down to the middle turn of the cochlea, a more severe pathology of degeneration was observed in PL mice. Both outer and inner hair cells of the mutant mice show changes from the wild type. (Figure 5-8). The outer hair cells display disorientation of the bundle as well as a more severe degeneration of the bundle with prominent splaying of the outer stereocilia and shortening of the inner rows of stereocilia (Figure 5-8). Although the inner hair cells seem to maintain proper orientation, a closer examination of the inner hair cell bundles reveals a loss of tenting and increased rounding at the tips of the two shorter rows of stereocilia where the basal end of the tip link is anchored to the membrane of the adjacent taller stereocililum (Figure 5-9). Figure 5-10 is a higher magnification image of two outer hair cells from a homozygous mutant mouse and wild-type. While the inner two rows of stereocilia have disassembled, the tallest row appears mostly intact. The most basal region of the cochlea that I imaged was within the 32 kHz range. Figure 5-11 shows that degeneration of the hair bundle eventually results in loss of the hair cell. 176 .0 j? Figure 5-6 Scanning electron micrographs of the organ of Corti in the 8 kHz range from a 6 week old wild-type (A) and PL homozygous (B) mouse. At this level of magnification, there is no difference in the overall organization of the hair cells. 177 Figure 5-7 High magnification scanning electron micrographs of outer hair cell bundles in the 8 kHz range from a 6 week old wild-type (A) and PL homozygous (B) mouse. At this level of magnification, the degeneration of the two shortest rows of stereocilia is apparent in the PL homozygote. In this region of the cochlea, the outer hair cell bundles normally appear slightly disheveled; however, degeneration of stereocilia is not commonplace. Remarkably, the tallest row of stereocilia appears unaffected. 179 [11" Figure 5-8 Scanning electron micrographs of the organ of Corti in the 16 kHz range from a 6 week old wild-type (A) and PL homozygous (B) mouse. At this level of magnification, improper orientation of the bundles (asterisks) and loss of the “v” shape of the outer hair cell bundle is apparent. No obvious differences are observed in the inner hair cells. 181 ‘fl’k M T14 I“96 [51' 1‘31“" ("‘1 {K ' A!" PK m (“'4 [’19, ft», h4\mr§‘3. ”\A [N ,p‘: m w ‘ . .—\‘\\ ‘ . ‘\\ 44°9. 9 ’«i '»W‘J~v~i~t 6443””: 1’ 11,4” 1}! :‘qv‘v-fl- . M ' . 'J " K J ‘ , \‘tk r"‘ 3* \ l ‘3 “l t «’1 6"" If“). 1i 5“; fm‘ 1M '9. l. .\ _ 3 fire 2... - %~.~e"-‘.z;.~‘«*rr - ... 4w Figure 5-9 High magnification scanning electron micrographs of inner hair cell bundles in the 16 kHz range from a 6 week old wild-type (A) and PL homozygous (B) mouse. Tension from the tip links adjoining the shorter to taller stereocilia generates a “tented” appearance (arrows). The molecular machinery important for mechanotransduction is located in this structure. Marked loss of tenting and increased rounding of the tips of stereocilia is observed in PL homozygotes. 183 Figure 5-10 High magnification scanning electron micrographs of outer hair cell bundles in the 16 kHz range from a 6 week old wild-type (A) and PL homozygous (B) mouse. The characteristic “v” shape and staircase organization of outer hair cell stereocilia is apparent in wild-type but not mutant mice. At this level of magnification, disassembly of the two shortest rows of stereocilia is apparent in the PL homozygote, along with misorientation of the bundle and early signs of loss of the cell shape. 184 .j rylnl’l' ‘ - .J. l! I? .. i- K II" Figure 5-11 Scanning electron micrographs of the organ of Corti in the 32 kHz range from a 6 week old wild-type (A) and PL homozygous (B) mouse. In addition to degeneration of stereocilia and improper bundle orientation, loss of hair cells is observed in the mutant mouse. 186 {W 6 mmrxh f‘wf‘fi I'M" vi AMA/NI“: /‘\ /'\ AAA/W /‘\ «*4»... .«’\.. MAS/f “MW" vflwry’ ”3}- 4,53% i i ' ~ \ 'tlk'yflu we 1:: ..4 «J “we? 3:»4'4». - I" ;? if: t 8‘7." . -. {oi-Mr.- ’lflvy’w'fl f) ‘WWMW’) . ...: Mutant P264L y-actin is properly localized to the stereocilia in homozygous mice Given the hair cell phenotype, | hypothesized that y—actin is not properly localized to or within the stereocilia of hair cells. To investigate this, | imaged the organ of Corti whole mounts using lmmunofluorochemisty with an anti-y-actin antibody. Samples were counterstained with rhodamine-phalloidin and DAPI to visualize actin filaments and nuclei. Four week old animals were euthanized after ABR and immediately fixed in 4% paraformaldehyde via local perfusion through the oval window of the cochlea. After fine dissection to remove all supporting tissue and bone, the organ of Corti was dissociated from the modiolus and mounted onto slides in anti-fade reagent. Figure 5-12 is a representative image from a 4 week old mouse and shows that there is no difference in localization of wild-type versus P264L y-actin. As expected, wild-type mice display a high concentration of y-actin within the outer hair cell bundles (Figure 5-12A-C) and periphery of inner hair cell bundles (Figure 5—12D-F). Despite the improper orientation of several of the outer hair cell bundles in PL homozygotes, the mutant y-actin is still present in the stereocilia (Figure 5-1ZG-L). The resolution of a confocal microscope is not sensitive enough to differentiate between rows of stereocilia within a single hair cell bundle. One difference that I did observe was promiscuous actin filament formation in the body of the hair cell. One advantage of confocal imaging is the ability to visualize sections through a tissue. These sections can be compiled to create a maximum intensity projection or z-stack of cells and tissues. l implemented this technique 188 to track actin filaments through multiple focal planes (Figure 5-13). Even when over-exposed, these filaments were not observed in wild-type littermates. 189 Figure 5-12 Confocal microscopy of outer hair cell stereocilia (A-C, G-l) and inner hair cell stereocilia (D-F, J-L) labeled with anti-y-actin in green (A, D, G, J) and counter- stained with rhodamine phalloidin in red to visualize filamentous actin (C, F, I, L). B, E, H, and K are merged images. Compared to wild-type (A-F), the mutant PL protein. (G-L) localizes properly to the stereocilia in both inner and outer hair cells. Images are from P28 mice. 190 191 Figure 5-13 Maximum intensity projections of z-series taken at 5 pm intervals though the body of hair cells. Aberrant filaments are not observed in the outer hair cells from wild-type mice (A), but are abundant in PL homozygotes as indicated by arrows (B). This spurious filament formation is characteristic of unhealthy hair cells. 192 193 Discussion Mice harboring the P264L allele of Actg1 in both the heterozygous and homozygous state are born at the expected Mendelian ratios, remain viable, and do not have noticeable muscular myopathy. l evaluated the expression level of the knock-in allele using western blot and determined that the presence of the neo-selection cassette in intron 1 of the Actgt transcript results in reduced expression of the mutant protein, however, removal of the cassette restores wild- type levels of expression from the recombinant PL allele. Initial characterization of hearing shows high frequency loss in mice homozygous for the p.P264L allele at 4-5 weeks and profound deafness by 6-7 weeks. Hearing loss in homozygous mice corresponds with the lack of tenting in inner hair cells and resorption of stereocilia in outer hair cells. Loss of outer hair cells appears to be secondary and not the initial cause of deafness. Compared to the previously characterized Actg1-null mice, which have reduced viability and muscular myopathy (Belyantseva et al., 2009), mice with the P264L mutation have few or no pleiotropic effects but have a much earlier hearing loss. Additionally, the pattern of deterioration of the stereocilia is quite different between the two animal models. In the y-actin knockout mouse, stereocilia loss was not specific to only the two shorter rows of the bundle; rather it was observed in patches (Belyantseva et al., 2009). I believe that taken together, these data are more consistent with a dosage dependent dominant negative or gain of function mode of action for the missense mutation, in which the mutant 194 protein interferes with function of actin binding proteins or wild-type B-actin in the cell. If the P264L mutation causes a loss of function or haploinsufficiency, I expect that the phenotype of the knock-in mice would be more similar to y—actin knockout mice. C57Bl/6J mice are homozygous for 3 splice site mutation in exon 8 of cadherin 23 (CDH23) which results in age-related hearing loss (Johnson et al., 2006) that is progressive and begins in the high frequencies. Fortunately, hearing loss observed in P264L knock-in mice occurs well before the onset of age-related hearing loss due to CDH23 mutations. However, given a dosage dependent model, I expect that +/PL, PL-neo/PL-neo, or PL/PL-neo mice will all have a later onset of hearing loss that is outside of the limits of what can be distinguished from the typical C57Bl/6J age-related hearing loss. To address this issue, l have begun to backcross to +/PL and +/PL-neo mice to the CBA/J background. CBA/J do not carry mutations associated with hearing loss and are used as the standard of normal hearing at Jackson Labs (2010). Loss of tenting in the inner hair cells is a phenotype that is similar to what was recently reported by Shwander and colleagues (Schwander et al., 2009). In the spontaneous salsa mutant harboring missense mutations in cadherin 23, the apical component of the tip link complex, a loss of tenting in inner hair cells is observed. Due to difficulties in obtaining upright and not splayed inner hair cell bundles, l have not yet been able to characterize the progression of this defect. 195 .l ..r-r 1M .r. 41. -.-. *1. It will be useful in the future to use antibodies specific for the two tip link proteins, protocadherin 15 (Ahmed et al., 2006) and cadherin 23 (Siemens et al., 2004), to determine if these are properly localized in P264L mutant mice. Another possibility is to combine ultrahigh resolution scanning electron microscopy with backscatter electron analysis and immunogold labeling to determine if the tip link complex is properly formed. The pattern of degeneration of the outer hair cell bundle of PL homozygotes is unlike any other phenotype previously described. Mutations in myosin 7a, a motor protein found along the lengths of the stereocilia, result in uniformly longer stereocilia (Self et al., 1998). Shaker-2 mice are deficient in myosin 15a, 3 motor protein localized to the tips of stereocilia, result in very short, stubby hair cell bundles (Anderson et al., 2000). Similarly, mice with mutations in whirlin, the cargo of myosin 15a, also result in uniformly short hair cell bundles (Mogensen et al., 2007; Mustapha et al., 2007). Mutations in proteins that bundle actin filaments, such as espin and triobp, result in thin and floppy stereocilia (Zheng et al., 2000; Kitajiri et al., 2010). The pattern of degeneration that I observed in the P264L knock-in mice is the first to target specific rows of stereocilia and not the entire bundle. The observations that l have made using SEM will help to guide future functional studies. Mechanotransduction, the process by which hair bundle deflections are converted into an electrical signal, occurs via the opening of mechanically gated 196 channels located in the tips of the two shorter rows of stereocilia (Beurg et al., 2009). Therefore, much higher regional levels of calcium exist in the two shorter rows of stereocilia than the tallest. It is possible that the P264L missense mutation alters the ion requirements of a calcium- or potassium-dependent actin binding protein critical to proper stereocilia function. The aberrant actin filament formation I observed inside the hair cells using confocal microscopy (Figure 5—13) is similar to cytocauds, thick bundled actin filaments that protrude out of the base of hair cells in the previously characterized shaker-2 mouse (Beyer et al., 2000). This phenotype may or may not be specific to mutations in actin or actin binding proteins, as cytocauds are also observed in old organ of Corti explant cultures from wild-type mice (Belyantseva, unpublished personal communication). Further characterization of the development of these peculiar structures may help us understand an aspect of actin dynamics in the hair cell. One pertinent aspect of DFNA20 deafness that l have not addressed in this chapter is the lack of a vestibular phenotype. Gamma-actin is very abundant in vestibular hair cells, so one would expect that mutations which cause hearing loss would also result in a vestibular phenotype. In mice, vestibular disorders are frequently characterized by obsessive circling in cages, a behavior that I did not observe in P264L knock-in mice. Therefore, more sensitive methods of measuring vestibular dysfunction are necessary. Characterization of the 197 vestibular competence of these animals may provide information about the role of gamma actin in the vestibular hair cell. In closing, the P264L mouse model provides useful information about the pathophysiology of this particular mutation, some of which may be applicable to the phenotype observed in humans. In addition, given the very specific pattern of degeneration of the stereocilia, this mouse model may be relevant to better understanding mechanotransduction and the molecular machinery involved. 198 References Auditory-Evoked Brainstem Response (ABR) Thresholds. 2010. http://www.jax.org Ahmed, Z. M., Goodyear, R., Riazuddin, S., Lagziel, A., Legan, P. K., Behra, M., Burgess, S. M., Lilley, K. S., Wilcox, E. R., Riazuddin, S., et al., 2006. The tip-link antigen, a protein associated with the transduction complex of sensory hair cells, is protocadherin-15. Journal of Neuroscience. 26, 7022-7034. Anderson, D. W., Probst, F. J., Belyantseva, l. A., Fridell, R. A., Beyer, L., Martin, D. M., Wu, D., Kachar, B., Friedman, T. B., Raphael, Y., et al., 2000. The motor and tail regions of myosin XV are critical for normal structure and function of auditory and vestibular hair cells. Hum Mol Genet. 9, 1729-38. Belyantseva, l. A., Perrin, B. J., Sonnemann, K. J., Zhu, M, Stepanyan, R., McGee, J., Frolenkov, G. l., Walsh, E. J., Friderici, K. H., Friedman, T. B., et al., 2009. Gamma-actin is required for cytoskeletal maintenance but not development. Proc Natl Acad Sci U S A. 106, 9703-8. Beurg, M, Fettiplace, R., Nam, J. H., Ricci, A. J., 2009. Localization of inner hair cell mechanotransducer channels using high-speed calcium imaging. Nat Neurosci. 12, 553-8. Beyer, L. A., Odeh, H., Probst, F. J., Lambert, E. H., Dolan, D. F., Camper, S. A., Kohrman, D. C., Raphael, Y., 2000. Hair cells in the inner ear of the pirouette and shaker 2 mutant mice. J Neurocytol. 29, 227-40. Bryan, K. E., Rubenstein, P. A., 2009. Allele-specific effects of human deafness gamma- actin mutations (DFNA20/26) on the actin/cofilin interaction. J Biol Chem. 284, 18260-9. Bryan, K. E., Wen, K. K., Zhu, M., Rendtorff, N. D., Feldkamp, M., Tranebjaerg, L., Friderici, K. H., Rubenstein, P. A., 2006. Effects of human deafness gamma-actin mutations (DFNA20/26) on actin function. J Biol Chem. 281, 20129-39. Crawley, J. N., 2000. What's wrong with my mouse? : behavioral phenotyping of transgenic and knockout mice. Wiley-Liss, New York. de Heer, A. M., Huygen, P. L., Collin, R. W., Oostrik, J., Kremer, H., Cremers, C. W., 2009. Audiometric and vestibular features in a second Dutch DFNA20/26 family with a novel mutation in ACTG1. Ann Otol Rhinol Laryngol. 118, 382-90. Ehret, G., 2001. [Adaptation of the mouse auditory system to perception of ultrasonic communication signals]. Zh Evol Biokhim Fiziol. 37, 431-6. Johnson, K. R., Zheng, O. Y., Noben-Trauth, K., 2006. Strain background effects and genetic modifiers of hearing in mice. Brain Res. 1091, 79-88. Kitajiri, S., Sakamoto, T., Belyantseva, l. A., Goodyear, R. J., Stepanyan, R., Fujiwara, l., Bird, J. E., Riazuddin, S., Riazuddin, S., Ahmed, Z. M., et al., 2010. Actin- 199 bundling protein TRIOBP forms resilient rootlets of hair cell stereocilia essential for hearing. Cell. 141, 786-98. Korrapati, S., 2009. Functional analysis of cytoplasmic gamma-actin mutations causing non-syndromic, progressive autosomal dominant hearing loss. Genetics Program. PhD. Dissertation Liu, R, Li, H., Ren, X., Mac, H., Zhu, Q., Zhu, Z., Yang, R., Yuan, W., Liu, J., Wang, 0., et al., 2008. Novel ACTG1 mutation causing autosomal dominant non-syndromic hearing impairment in a Chinese family. J Genet Genomics. 35, 553-8. Meyer, A. 0, Frank, T., Khimich, D., Hoch, G., Riedel, D., Chapochnikov, N. M, Yarin, Y. M, Harke, 8., Hell, 8. W., Egner, A., et al., 2009. Tuning of synapse number, structure and function in the cochlea. Nat Neurosci. 12, 444-53. Mogensen, M. M, Rzadzinska, A., Steel, K. P., 2007. The deaf mouse mutant whirler suggests a role for whirlin in actin filament dynamics and stereocilia development. Cell Motil Cytoskeleton. 64, 496-508. Morin, M, Bryan, K. E., Mayo-Merino, F., Goodyear, R., Mencia, A., Modamio-Hoybjor, 8., del Castillo, l., Cabalka, J. M, Richardson, G., Moreno, F., et al., 2009. In vivo and in vitro effects of two novel gamma-actin (ACTG1) mutations that cause DFNA20/26 hearing impairment. Hum Mol Genet. 18, 3075-89. Mustapha, M, Beyer, L. A., lzumikawa, M, Swiderski, D. L., Dolan, D. F., Raphael, Y., Camper, S. A., 2007. Whirler mutant hair cells have less severe pathology than shaker 2 or double mutants. J Assoc Res Otolaryngol. 8, 329-37. Rendtorff, N. D., Zhu, M, Fagerheim, T., Antal, T. L., Jones, M, Teslovich, T. M, Gillanders, E. M, Barmada, M, Teig, E., Trent, J. M, et al., 2006. A novel missense mutation in ACTG1 causes dominant deafness in a Norwegian DFNA20/26 family, but ACTG1 mutations are not frequent among families with hereditary hearing impairment. Eur J Hum Genet. 14, 1097-105. Schwander, M, Xiong, W., Tokita, J., Lelli, A., Elledge, H. M, Kazmierczak, P., Sczaniecka, A., Kolatkar, A., Wiltshire, T., Kuhn, P., et al., 2009. A mouse model for nonsyndromic deafness (DFNB12) links hearing loss to defects in tip links of mechanosensory hair cells. Proc Natl Acad Sci U S A. 106, 5252-7. Self, T., Mahony, M, Fleming, J., Walsh, J., Brown, S. D., Steel, K. P., 1998. Shaker-1 mutations reveal roles for myosin VllA in both development and function of cochlear hair cells. Development. 125, 557-66. Siemens, J., Lillo, C., Dumont, R. A., Reynolds, A., Williams, D. S., Gillespie, P. G., Muller, U., 2004. Cadherin 23 is a component of the tip link in hair-cell stereocilia. Nature. 428, 950-5. van Wijk, E., Krieger, E., Kemperman, M H., De Leenheer, E M Huygen, P. L., Cremers, C. W., Cremers, F. P., Kremer, H., 2003. A mutation in the gamma 200 actin 1 (ACTG1) gene causes autosomal dominant hearing loss (DFNA20/26). J Med Genet. 40, 879-84. Zheng, L., Sekerkova, G., Vranich, K., Tilney, L. G., Mugnaini, E., Bartles, J. R., 2000. The deaf jerker mouse has a mutation in the gene encoding the espin actin- bundling proteins of hair cell stereocilia and lacks espins. Cell. 102, 377-85. Zhu, M, Yang, T., Wei, 8., DeWan, A. T., Morell, R. J., Elfenbein, J. L., Fisher, R. A., Leal, S. M, Smith, R. J., Friderici, K. H., 2003. Mutations in the gamma-actin gene (ACTG1) are associated with dominant progressive deafness (DFNA20/26). Am J Hum Genet. 73, 1082-91. 201 CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS 202 Conclusions and Future Directions In this dissertation I describe three approaches to investigating the pathology of mutations in y-actin and the identification of a new regulatory mechanism for y- actin. First, I used a yeast 2-hybrid protocol to screen an inner ear library to identify novel inner ear actin binding proteins or isoforms. Given that there are over 100 actin binding proteins identified to date, we expected a robust screen. Though there were over 500 clones identified per screen, not surprisingly, the large majority were identified as either y— or B-actin. Interestingly, the only other proteins identified as true positives in these two screens were cofilin 1, cofilin 2, cyclase associated protein 2, and ubiquitin E2i ligase. I anticipated that this screen would exclude proteins that interact only with filamentous actin; however, I did not expect so few actin monomer binding proteins. Directed yeast 2-hybrid experiments with the mutant actins and the six prey identified provides another experimental means for evaluating functional deficits of the mutations. This method of analysis may be particularly useful for investigating the interaction between DNFA20 mutations and cyclase associated protein (CAP). Data from band-shift assays done by Dr. Mei Zhu, a former graduate student, hint at a deficiency in this interaction; however, her attempts to investigate this directly were unsuccessful due to difficulties in expressing recombinant CAP proteins. The results of the yeast 2-hybrid screens demonstrate that CAP-prey expression is possible in yeast. 203 I also investigated the expression of annexin 5a, a y-actin specific binding protein, in the inner ear. Annexin Se is expressed at high levels in the cochlea, and its localization is very similar to y-actin. There is some skepticism in the field as to whether this is truly a y-actin specific interaction due to difficulties in detecting this interaction. In the methods I described in chapter three, purified annexins and actins were used and an interaction was not observed. Curiously, annexin 5a and y-actin are both located in the periphery of the stereocilia and 2- disc of muscle, regions that require unique linkage between membranes and actin filaments. The location of y-actin is clearly not altered by lack of annexin 5a as demonstrated using the Anxa5 knockout mouse. l hypothesize that this is likely due to functional redundancy between annexins, and that another annexin such as A2 substitutes for the function of annexin 53. What my data does not address is whether the DFNA20 mutant proteins are capable of interacting with annexin Sa. Prior to generating the P264L knock-in mouse, testing this interaction would be nearly impossible. Our y-actin antibody does not distinguish between wild-type and mutant actins, therefore, a pull-down with transfected cells would not answer this question. Furthermore, I was unable to detect an interaction using in vitro synthesized or purified actins, indicating that the interaction is dependent upon other factors not present in highly purified systems. This conundrum highlights the crux of difficulties in investigating the pathology of mutations in y-actin. in vitro systems do not address the physiological requirements in the cell, let alone a tissue with planar and apical/basal polarity. On the other hand, cell and explant cultures transfected with mutant y-actln 204 express a lot of endogenous y-actin that may mask the effects of the mutant actins in cell culture. It may be interesting to repeat a GST-pulldown with annexin 5a and tissues from the P264L knock-in mouse. The P264L knock-in mouse provides an excellent system to evaluate the pathophysiology of this missense mutation and to gain insight into the genetic mechanism by which it confers deafness. This mouse model appropriately recapitulates the human phenotype of progressive nonsyndromic deafness with normal vestibular function. Due to age-related hearing loss (AHL) mutations carried on the C57Bl/6J strain, it was impossible to study the effects of the P264L mutation in heterozygotes beyond three months of age. For this reason, we are currently working to create congenic P264L lines on the CBA/J strain. Using this ‘i‘good hearing” background, we will be able to examine the long-term effects of deafness in heterozygotes The pattern of degeneration that I observed in the PL mouse model is unique in that two rows of stereocilia within the bundle that degenerate first are those involved in mechanotransduction. We recently shipped mice to the University of Kentucky where Dr. Gregory Frolenkov, a hair cell physiologist, will investigate mechanotransduction in hair cells of these mutant mice. As mentioned previously, hearing is not established in mice until the cochlear hair cells are innervated around postnatal day 12. However, the maturation of the hair bundle is complete one week prior, and previous studies have shown that mechanotransduction currents can be measured in murine hair cells as early as 205 postnatal day 0. It will be interesting to see if the outer hair cells of P264L homozygous mice develop normally and are capable of early, pre-innervation mechanotransduction. Given the progression of hearing loss observed in these mice, I predict that postnatal hair cells will properly mechanotransduce. Another unique feature of this mouse model is the lack of a vestibular phenotype. Similar to auditory hair cells, y-actin is expressed at high levels in vestibular hair cells, so one would predict vestibular dysfunction. To address this, we established a collaboration with Dr. Sherri Jones of the University of North Carolina to measure the gravity response of P264L mice in a manner similar to that used in ABR testing. By this technique, subtle vestibular dysfunction has been observed in some mouse models of hearing loss in the absence of an overt phenotype. One very rewarding aspect of my dissertation research was identifying the novel y-actin transcript and having the opportunity to characterize its function. There are still many questions left to be answered which will require a more quantitative approach. First, I hypothesize that in response to the excess of ACTGt transcripts, endogenous transcripts, endogenous y-actin will be down regulated. Second, the NCBI mouse EST database contains traces from alternatively spliced Actg1 transcripts that were found in brain and testes. This may represent a low level of noisy splicing that is not tissue specific. Alternatively it may indicate that splicing to include exon 3a is a universal mechanism for down- 206 regulation of y-actin. In either scenario, I believe that this project highlights the need for experimental validation of RUST. 1 207 APPENDICES COMMONLY USED METHODS AND REAGENTS 208 A. PCR Mastermix: Component Volume I 20 pL Final . .... reaction Concentration 5x GoTaq® reaction buffer 4 0L 1x (7.5 mM MgCl2) 1.5 mM MgCl2 25 mM dNTPs 0.16 pL 0.2 mM 10 pM forward primer 0.5 uL 0.25 pM 10 IJM reverse primer 0.5 pL 0.25 pM GoTaq® DNA polymerase 5u/j1L 0.1 uL 0.5 units Template DNA (10-100 ng/pL) 1 9L 0.5 - 5 ng H20 13.74 “L *GoTaq® DNA polymerase and buffer are supplied by Promega©. Cycling Conditions: 1. 95°C, 3 minutes 2. 95°C, 30 seconds 59°C, 30 seconds 72°C, 1 minute/1kb product 3. 72°C, 5 minutes ] 25-35 cycles 209 B. Polyacrylamide Gels (Reducing) Stacking (3%) Volume Stock Solution 2.5 mL 0.5M Tris HCI /4% sodium dodecyl sulfate (SDS) pH6.8 1.0 mL 40% Acrylamide/Bis 19:1 6.5 mL ddHZO 10 uL Tetramethylethylenediamine (TEMED) 50 uL 10% ammonium persulfate 10 mL Final Volume Separating (10%) Volume Stock Solution 3.75 mL 1.5M Tris HCI /4°/o sodium dodecyl sulfate (SDS) pH8.8 3.75 mL 40% Acrylamide/Bis 19:1 7.5 mL dngO 10 uL Tetramethylethylenediamine (TEMED) 50 uL 10% ammonium persulfate 15 mL Final Volume 210 C. Continuous Native Gels Stacking (3%) wl CaCIz wlout CaClz Stock Solution 1 mL 1 mL 200mM Tris HCI / 2.0M glycine (do not adjust pH) 2.5 mL 2.5 mL 40% Acrylamide/Bis 19:1 6.35 mL 6.37 mL dngO 20 uL 20 “L 100 mM adenosine 5’-triphosphate 20 uL 0 ”L 100 mM CaClz 1%L 10 uL Tetramethylethylenediamine (TEMED) 50 uL 50 uL 10% ammonium persulfate 10 mL 10 mL Final Volume 211