. . . .
. . .
a . . . .
. . . .
u . .
. . . .

. .
A . . . .

. . .
u . . ‘ ,

p u . . . . .

. . . . . . v

a . ..

. A . .
. ..

t . .

~ . . .

n , . . .

. . . . .

. . . . . . .
. .
. . . .
. . . .
. . . ‘ .

. . . . . .

. . . . . .

. . . . .

u . . .

. , . . . .

.. . . . . .

. . . . . . ..

s . .

r .. . . . . .

. . . . . . . . . ‘ . .
. . . . .
u . . .

. ‘ . . . .

u . . . . . . ‘ . .

. . . .

. . . .
5 . . . . . . .
. . c . . .

y . .

u . . .. . . .
o . . . . . . . . . . . .

. . . .

. .

. . . . . . .

. . . . .
u . ‘ .

. . .
. , . .
.. o
. . . . .
. . . . .
. .. . . .
‘ . v
. A. . _
. . . .
. . . . .
. . .
. . .
. . . .
. . . . .
o . .
. . .
p . ‘ . .
. o
. . . ~ .
. .
. . .
. . . .

c .

. . .

. . .
. . .
.
. .

. -

 

This is to certify that the
dissertation entitled

Phylogenetic Revision of the North American Asidini
(Coleoptera: Tenebrionidae)

presented by
Aaron Dennis Smith

has been accepted towards fulfillment
of the requirements for the

degree in Entomology and Ecology,
Evolutionary Biology and
Behavior

Doctoral

 

    

 

 

    
 

 

\
M J

.-3 ,

 

  

 

‘4, i // O
/ Major Professor's SW
23 June 2010
Date

MSU is an Affirmative Action/Equal Opportunity Employer

 

 

LIBRARY
Michigan State
University

 

 

 

-. -“~‘_ _
L—fi _‘

-»._ _
<—--- ._._...-

uh -——._-—5 .

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

 

*

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

‘

5/08 K:/Proj/Acc&PresJCIRC/DateDue.indd

 

 

 

PHYLOGENETIC REVISION OF THE NORTH AMERICAN ASIDINI

(COLEOPTERA: TENEBRIONIDAE)

By

Aaron Dennis Smith

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Entomology
and Ecology, Evolutionary Biology and Behavior

2010

 

 

 

 

 

 

 

 

ABSTRACT

PHYLOGENETIC REVISION OF THE NORTH AMERICAN ASIDINI
(COLEOPTERA: TENEBRIONIDAE)

By

Aaron Dennis Smith

A phylogenetic revision of the North American Asidini based on molecular and
morphological data is presented. Evolutionary relationships within and between the North
American Asidini (Coleoptera: Tenebrionidae) genera were reconstructed using a
combined dataset containing partial sequences of mitochondrial COI (660bp) and nuclear
28s (492bp), and 100 morphological characters for 50 North American asidine species,
representing 20 of the 27 previously described genera and one new genus. Species from
two additional tenebrionid tribes (Branchini and Coniontini) and the South American
asidine genus Cardiogem’us were chosen as outgroups. Analyses were performed using
maximum parsimony and Bayesian inference methods. Clade support was inferred based
on the posterior probability distribution of tree topologies, nonparametric bootstrap
analysis, and partitioned Bremer support indices. The generic classification of the North
American Asidini was revised based on the results.

Twenty previously described genera are placed in synonymy and ten genera are
recognized. Seven current genera: Craniotus LeConte, Heterasida Casey, Litasida Casey,
Microschatia Solier, Pelecyphorus Solier, Philolithus Lacordaire, Stenomorpha Solier,
are redescribed and three new genera: Micrasida, Ardamimicus, and F erveoventer are
described, including three new species: Micrasida obrienorum, Ardamimicus cognatoi,

and F erveoventer browni.

 

 

 

 

A taxonomic revision of the North American genus Pelecyphorus Solier is
presented. Eight subgenera are erected and described, seven based on previously
described Asidini genera: Pelecyphorus Solier sensu stricto, Astrotus LeConte,
Stenosides Solier, Ucalegon Champion, Zaleucus Champion, Plesiasida Smith
(=Parasida Casey),and Sicharbas Champion and one new subgenus: Variodorsus.

Forty species of Pelecyphorus are recognized as valid, including seven new
species described herein: P. cavatus, P. cifirentesi, P. crypticus, P. deaztlani, P. doyem',
P. owcacensis, and P. triplehorni. All valid species are described or redescribed, along
with diagnoses, distributions, and images of each. An illustrated key to the subgenera and
species is also provided.

The Asidini, like all members of the subfamily Pimeliinae, lack defensive glands.
Instead, several morphological and behavioral traits are found within the tribe which may
help limit predation. These include the contrasting defensive strategies of crypsis, either
through background matching or pattern disruption, and Batesian mimicry of the
chemically defended tenebrionid genus Eleodes. A phylogenetic analysis of the North
American asidines is presented and the evolution of defensive strategies exhibited within

the group is examined.

This work is dedicated to Tonantzin DeAztlan
for her understanding and constant support.

 

 

 

 

ACKNOWLEDGIVIENTS

This work would not have been possible without the support and guidance of my
major professor, Dr. Anthony Cognato. I would also like to thank my Ph.D. committee
members Dr. Barbara Lundrigan, Dr. Alan Prather, and Dr. James Smith for their
guidance and review. This research was also aided by the advice and assistance of Gary
Parsons, collection manager at the A.J. Cook Arthropod Research Collection, and my
fellow graduate students in the Holistic Insect Systematics Laboratory: Stephanie Dole,
Jiri Hulcr, and Sarah Smith. I also give thanks to all of the tenebrionid taxonomists who
kindly provided advice and specimens throughout this project: Rolf Aalbu, Kirby Brown,
Kojun Kanda, Fran Keller, Paulina Cifuentes-Ruiz, Warren Steiner, and Charles
Triplehorn. I am deeply indebted to all of the museum curators and staff who provided
most of the specimens upon which this study is based, especially Max Barclay, Cheryl
Barr, Ed Riley, Norman Penny, James Boone, and again Warren Steiner and Charles
Triplehorn for providing me with space and equipment in their museums. In the MSU
Department of Entomology I would like to thank our wonderful office staff, for helping
me over many of the bureaucratic pitfalls which graduate students so often fall into. And
finally, I would like to thank my parents H. Dennis Smith and Barbara A. Haenelt for

equipping me with the motivation and skills to pursue my passion for entomology.

 

 

TABLE OF CONTENTS

LIST OF TABLES ................................................................................. vii

LIST OF FIGURES ................................................................................ viii

CHAPTER 1

PHYLOGENETIC REVISION OF THE NORTH AMERICAN ASIDINT

(COLEOPTERAzTENEBRIONIDAE) ............................................................ 1
Abstract ...................................................................................... 2
Introduction .................................................................................. 4
Materials and Methods ................................................. ' ................... 10
Results ....................................................................................... 26
Discussion .................................................................................. 29

CHAPTER 2

REVISION OF THE GENUS PELECYPHOR US SOLIER, 1836 (COLEOPTERA:

TENEBRIONTDAE: ASIDINT) .................................................................. 123
Abstract .................................................................................... 124
Introduction ............................................................................... 125
Materials and Methods .................................................................. 127
Results and Discussion ........................................................................................ 127

CHAPTER 3

THE EVOLUTION OF CONTRASTING DEFENSIVE STRATEGIES WITHIN THE

NORTH AMERICAN ASIDIN I (COLEOPTERA: TENEBRIONIDAE) ................ 298
Abstract ................................................................................... 299
Introduction ............................................................................... 300
Materials and Methods .................................................................. 306
Results ..................................................................................... 309
Discussion ................................................................................. 311

LITERATURE CITED .......................................................................... 320

 

 

 

 

 

LIST OF TABLES

Table 1.1: Specimens sequenced, collecting data, and Genbank numbers ................. 91
Table 1.2: Partitioned Bremer support values from TreeRot v.3 ............................. 95
Table 1.3: Support for selected clades from parsimony and Bayesian analyses. Numbers

represent bootstrap/Bremer supports for parsimony analysis or posterior probabilities for
Bayesian analysis. N/A = not applicable or not found in the resulting

tree(s) ................................................................................................. 96
Table 1.4: Morphological character matrix of 100 characters for 58 OTUs. Characters
and their scores in Materials and Methods ........................................................ 99

 

 

LIST OF FIGURES

{ Figure 1.1: Phylogeny of the North American Asidini based on 288, C01, and adult
i morphology (58 OTUs, 1252 characters). The strict consensus of four most parsimonious
trees (L=3615, CI=O.22, RI=0.47) is shown bootstrap values above the branches and
average partitioned Bremer support values below .............................................. 87

Figure 1.2: Phylogeny of the North American Asidini based on 288, C01, and adult
morphology (58 OTUs, 1252 characters). One of four most parsimonious trees (L=3615,
CI=O.22, RI=0.47) is shown with bootstrap values above the branches and average
partitioned Bremer support values below. ...................................................... 88

Figure 1.3: Phylogeny of the North American Asidini based on 28S, C01, and adult
morphology (58 OTUs, 1252 characters). One of four most parsimonious trees (L=3615,
CI=O.22, RI=0.47) is shown with node numbers above the branches and average
partitioned Bremer support values below .......................................................... 89

Figure 1.4: Phylogeny of the North American Asidini based on 288, C01, and adult
morphology (58 OTUs, 1252 characters). The Bayesian majority rule consensus tree is
shown (GTR+I+F model; 6,000 sampled trees from 5,000,000 generations, -LogL =

 

16,269) with posterior probability values above the branches (* = 100% pp.) ............ 90
Figure 1.5: Dorsal habitus of Ardamimicus cognatoi Smith, 11. gen. and n.sp., Q
(L=12.1mm) ......................................................................................... 111
Figure 2.6: Dorsal habitus of Craniotus pubescens LeConte, 6‘ (L=8.9mm) ............ 112
Figure 3.7: Dorsal habitus of F erveoventer browm' Smith, 11. gen. and n.sp.

(L=9.4mm) .......................................................................................... 113
Figure 4.8: Dorsal habitus of F erveoventer planatus (Champion), (L=7.9mm) .........114
Figure 5.9: Dorsal habitus of Heterasida bifirrca (LeConte), 6 (L=9.6mm) ............ 115

Figure 6.10: Dorsal habitus of Heterasida connivens (LeConte), 6‘ (L=8.4mm) ....... 116
Figure 7.11: Dorsal habitus of Litasida townsendi Casey, 6‘ (L=11.0mm) ............... l 17

Figure 8.12: Dorsal habitus of Micrasida obiernorum Smith, n. gen. and n.sp.,
(L=5.9mm) .......................................................................................... 118

Figure 9.13: Dorsal habitus of Microschatia rockefelleri Pallister, (L=l4.0mm) ....... 119

Figure 10.14: Dorsal habitus of Pelecyphorus mexicanus Solier,
(L=16.3mm) ........... 120

viii

l - .1 g -

 

 

 

Figure 11.15: Dorsal habitus of Philolithus aegrotus (LeConte), (L=14.lmm)

........... 121

Figure 12.16: Dorsal habitus of Stenomorpha obovata (LeConte), 6‘ (L=19.6mm)

. . ....122

Figure 2.1: Dorsal habitus of Pelecyphorus (Astrotus) alveolatus (Casey), holotype, 6‘
(L=1 1.5mm) ....................................................................................... 258
Figure 2.2: Dorsal habitus of Pelecyphorus (Astrotus) contortus (LeConte), 6‘

(L=l 1.3mm) ........................................................................................ 259
Figure 2.3: Dorsal habitus of Pelecyphorus (Astrotus) regularis (Horn), S? (L=12.2mm)
........................................................................................................ 260
Figure 2.4: Dorsal habitus of Pelecyphorus (Aslrotus) hebes (Champion), 6‘
(L=18.3mm) ........................................................................................ 261
Figure 2.5: Dorsal habitus of Pelecyphorus (Astrotus) crypticus Smith, n. sp., 6‘
(L=9.5mm) ......................................................................................... 262
Figure 2.6: Dorsal habitus of Pelecyphorus (Stenosides) anastomosis (Say), 92

(L=l 1.9mm) ....................................................................................... 263
figure 2.7: Dorsal habitus of Pelecyphorus (Stenosides) cavatus Smith, n. sp.,
(L=12.5mm) ....................................................................................... 264
Figure 2.8: Dorsal habitus of Pelecyphorus (Stenosides) deaztlam' Smith, n.sp., 9
(L=10.5mm) ....................................................................................... 265
Figure 2.9: Dorsal habitus of Pelecyphorus (Stenosides) triplehorni Smith, n. sp., 6‘
(L=10.8mm) ....................................................................................... 266

Figure 2.10: Dorsal habitus of Pelecyphorus (Stenosides) limosus (Champion), holotype
(L=7.8mm) ......................................................................................... 267

Figure 2.11: Dorsal habitus of Pelecyphorus (Stenosides) graciliformis (Solier),
(L=9.7mm) .......................................................................................... 268

Figure 2.12: Dorsal habitus of Pelecyphorus (Stenosides) texanus (W ickham),
(L=7.7mm) .......................................................................................... 269

Figure 2.13: Dorsal habitus of Pelecyphorus (Sicharbas) lobatus (Champion), holotype
6‘ (L=10.6mm) ..................................................................................... 270

 

 

 

‘-

Figure 2.14: Dorsal habitus of Pelecyphorus (Sicharbas) oaxacensis Smith, n. sp.,

 

 

holotype 6‘ (L=11.3mm) .......................................................................... 271
Figure 2.15: Dorsal habitus of Pelecyphorus (Sicharbas) debilis (Champion), 6‘
(L=7.4mm) .......................................................................................... 272

3 Figure 2.16: Dorsal habitus of Pelecyphorus (Sicharbas) seticornis (Champion), 6‘

‘ (L=6.6mm) .......................................................................................... 273
Figure 2.17: Dorsal habitus of Pelecyphorus (Sicharbas) erosus (Champion), holotype SB
(L=9.6mm) .......................................................................................... 274
Figure 2.18: Dorsal habitus of Peleqphorus (Sicharbas) undatus (Champion), lectotype
$2 (L=11.6mm) ..................................................................................... 275
Figure 2.19: Dorsal habitus of Pelecyphorus (Pelecyphorus) mexicanus Solier, SB
(L=l3.9mm) ........................................................................................ 276
Figure 2.20: Dorsal habitus of Pelecyphorus (Ucalegon) pulchellus (Champion), 92

£ (L=l3.8mm) ........................................................................................ 277

t Figure 2.21: Dorsal habitus of Pelecyphorus (Zaleucus) dilatatus (Champion), lectotype
Q (L=15.8mm) ..................................................................................... 278
Figure 2.22: Dorsal habitus of Pelecwhorus (Zaleucus) platesthoides (Champion),
lectotype (L=l4.3mm) ........................................................................... 279

, Figure 2.23: Dorsal habitus of Pelecyphorus (Zaleucus)f0veolatus Solier, 6‘

‘ (L=l3.5mm) ........................................................................................ 280
Figure 2.24: Dorsal habitus of Pelecyphorus (Zaleucus) doyenz' Smith, n. sp., 6‘
(L=13.lmm) ........................................................................................ 281
Figure 2.25: Dorsal habitus of Pelecyphorus (Variodorsus) guanajuatensis (Champion),
6‘ (L=1 1.3mm) ..................................................................................... 282
Figure 2.26: Dorsal habitus of Pelecyphorus (Variodorsus)fasciculatus (Champion), 6‘
(L=1 1.7mm) ........................................................................................ 283
Figure 2.27: Dorsal habitus of Pelecwhorus (Plesisida) liratus (LeConte), 6‘
(L=12.8mm) ........................................................................................ 284
Figure 2.28: Dorsal habitus of Peleqrphorus (Plesisida) dispar (Champion), 6‘
(L=11.5mm) ........................................................................................ 285

x

 

gm. _ . u

 

 

Figure 2.29: Dorsal habitus of Pelecyphorus (Plesisida) bibasalis (Casey), (L=17.5mm)

......................................................................................................... 286
Figure 2.30: Dorsal habitus of Pelecyphorus (Plesisida) sexcostatus LeConte, 6‘
(L=11.2mm) ........................................................................................ 287
Figure 2.31: Dorsal habitus of Pelecyphorus (Plesisida) cifitentesi Smith, n. sp., 6‘

(L=1 1.1mm) ........................................................................................ 288
Figure 2.32: Dorsal habitus of Pelecyphorus (Plesisida) longipennis (Champion), 6‘
(L=10.5mm) ........................................................................................ 289

Figure 2.33. Dorsal habitus of Pelecyphorus (Plesisida) indutus (Champion), holotype 6‘
(L=12. 0mm) ........................................................................................ 290

Figure 2.34: Dorsal habitus of Pelecyphorus (Plesisida) tristis (Champion), lectotype 6‘
(L=12.lmm) ........................................................................................ 291

Figure 2.35: Dorsal habitus of Peleqyphorus (Plesisida) asidoides Solier, S2 (L=13.3mm)
......................................................................................................... 292

Figure 2.36: Dorsal habitus of Pelecyphorus (Plesisida)fallax (Champion) (L=15.0mm)
......................................................................................................... 293

Figure 2.37: Dorsal habitus of Pelecyphorus (Plesisida) intricatus (Champion), holotype
SB (L=17.7mm) ..................................................................................... 294

Figure 2.38: Dorsal habitus of Pelecyphorus (Plesisida) laticollis (Champion)
(L=l7.4mm) ........................................................................................ 295

Figure 2.39: Dorsal habitus of Pelecyphorus (Plesisida) obliviosus (W ilke), $2
(L=20.3mm) ........................................................................................ 296

Figure 2.40: Dorsal habitus of Pelecyphorus (Plesisida) scutellaris (Champion)
(L=15.2mm) ........................................................................................ 297

Figure 3.1: Phylogeny of the North American Asidini based on 28S, C01, and adult
morphology (58 OTUs, 1252 characters). One of four most parsimonious trees (L=3615,
CI=O.22, RI=0.47) is shown with Bootstrap values listed above the branches and Bremer
support shown below the branches. Orange “+HS” indicates species known to exhibit

headstanding ....................................................................................... 315

Figure 3.2: Pelecjyphorus (Astrotus) alveolatus (Casey); top: encrusted SB, lefi; cleaned

92, right. bottom: Astrotus-type stellate setae ................................................... 316
xi

 

 

 

Figure 3.3: Webbing on Pelecaphorus (Astrotus) regularis (Horn) 9, 1-8 hours after
emergence ........................................................................................... 317

Figure 3.4: Philolithus (Gonasida elata difirormis (LeConte) 6‘, left; Eleodes obscurus
szdcipennis Mann. 6‘, right; both collected AZ: Cochise Co., August 22, 2006 ......... 318

Figure 3.3: Stenomorpha convexicollis (LeConte) 9, left; Eleodes longicollis LeConte
2, right; both collected NM: Luna Co., August 21, 2006 .................................... 319

 

 

 

    
   

:20!) L .1

" '1
"fl'. .. h .6.
~ .13‘ ETCAMI.
.nlgo ‘
_a-'- ELI .

0' "

_l'i '.
legumes. . . - _.

Jr», CHAPTERONE

1‘

Jamar”:

d‘3+\"=.'--.*n ~

' . .-'.I .~ .
.-_ < .‘ ._ ' ‘ ' 1
- rer,.~v...~.r...:- . - .- ..

7 ~, ; psi otthe North American Asidini (Coleoptera: Tenebriuldrlae)

 

 

 

 

ABSTRACT

The asidine darkling beetles (Coleoptera: Tenebrionidae: Asidini) are a diverse
tribe of flightless tenebrionids found in many arid and sub-arid habitats around the world.
The nearly 300 currently described North American species are contained in 27 genera,
all of which are restricted to the western half of the continent.

Evolutionary relationships within and between the North American Asidini
(Coleoptera: Tenebrionidae) genera were reconstructed using a combined dataset
containing partial sequences of mitochondrial COI (660bp) and nuclear 28S (492bp), and
100 morphological characters for 50 North American asidine species, representing 20 of
the 27 currently described genera and one new genus. Species fi'om two additional
tenebrionid tribes (Branchini and Coniontini) and the South American asidine genus
Cardiogenius were chosen as outgroups. Analyses were performed using maximum
parsimony and Bayesian inference methods. Clade support was inferred based on the
posterior probability distribution of tree topologies, nonparametric bootstrap analysis, and
partitioned Bremer support indices. The generic classification of the North American
Asidini was revised based on the results.

Ten genera are recognized. Seven current genera: Craniotus LeConte, Heterasida
Casey, Litasida Casey, Microschatia Solier, Pelecyphorus Solier, Philolithus Lacordaire,
Stenomorpha Solier, are redescribed and three new genera: Micrasida, Ardamimicus,
and Ferveoventer are described, including three new species: Micrasida obrienorum,

Ardamimicus cognatoi, and Ferveoventer browni.

 

 

20 genera are placed in synonymy; new synonyms: Asidina Casey
(=Stenomorpha Solier), Asidopsis Casey (=Stenomorpha Solier), Bothrasida Casey
(=Stenomor'pha Solier), Megasida Casey (= Stenomorpha Solier), Notiasida Casey
(=Stenomorpha Solier), Platasida Casey (=Stenomorpha Solier), Pycnomorpha
Motschulsky (=Sten0morpha Solier), Stethasida Casey (=Stenomorpha Solier),

T richiasida Casey (=Stenomorpha Solier), Glyptasida Casey (=PhiIolithus Lacordaire),
Gonasida Casey (= Philolithus Lacordaire), Herthasida Wilke (=Philolithus Lacordaire),
T isamenes Champion (=Philolithus Lacordaire), Astrotus LeConte (=Pelecyphorus
Solier), Parasida Casey (=Pelecyphorus Solier), Poliorcetes Champion (=Pelec1phorus
Solier), Sicharbas Champion (=Pelecyphorus Solier), Stenosides Solier (=Pelec3phorus
Solier), Ucalegon Champion (=Pelecyphorus Solier), Zaleucus Champion

(=Pelec1phorus Solier).

 

 

 

 

INTRODUCTION

Darkling beetles (Coleoptera: Tenebrionidae), with over 19,000 described species,
represent one of the greatest known radiations of biodiversity in the world. They are
present in nearly every terrestrial ecosystem due to the amazing array of forms, feeding
habits, and life histories exhibited within the family. Nowhere are they more conspicuous
than in the world’s deserts. Many tenebrionids have adapted to life in arid environments
through changes in behavior (nocturnal activity), morphology (flightlessness to prevent
water loss), or life history (subterranean larvae). One of the most successful, in terms of
biodiversity and distribution, but least studied groups of tenebrionids is the tribe Asidini.
The asidine darkling beetles are a large tribe of flightless midsized (4.5mm-35mm)
tenebrionids found in many arid and semi-arid regions around the world. The North
American component of the tribe contains nearly three hundred species in 27 genera and
makes up approximately 20% of the total North American tenebrionid fauna (Aalbu et al.
2002). Despite their significant contribution to the biodiversity of Mexico and the
western United States, no revisionary work has adequately dealt with the entire North
American asidine fauna and no attempt has been made to examine their generic
classification in a phylogenetic context. Consequently, the validity of most current genera

and species has not been tested since their initial descriptions.

Taxonomic History
The creation and application of generic names within the North American Asidini

has a long and varied history. Asidini was originally erected by Fleming (1821) to

 

 

 

contain the Mediterranean genus Asida Latreille. Thomas Say (1824) described the first
three North American asidine species (Stenomorpha opaca, Stenomorpha polita, and
Stenosides anastomosis), which he collected from “under dried bison dung in the
extensive region bordering the Rocky Mountains”. Say placed all three species in Asida.
Solier (1836) erected the first four North American genera (Microschatia, Pelecyphorus,
Stemmorpha, and Stenosides) to contain eight Mexican species and one African species
(Afiasida capensis (Solier)) that he considered too divergent to place in Asida.

In 1851 J. L. LeConte provided a replacement name for Stenomorpha (Euschides
LeConte, 1851) due to the name’s similarity to Stenomorphus Dejean, 1831. He also
removed the genus Asida from North America by transferring A. polita and A. opaca into
Euschides and transferring A. anastomosis into Pelegphorus before moving it into
Microschatia two years later (LeConte 1853). LeConte later described two new
monotypic genera, Astrotus (LeConte 185 8a) for Microschatia contorta LeConte and
Pactostoma (LeConte, 1858a) for Microschatia anastomosis (Say), and published
Lacordiare’s new genus Philolithus (Leconte 1858b) while giving Lacordaire full credit
for the genus. The next year Lacordaire (1859) provided a more complete description of
Philolithus and the replacement name Ologlyptus for Stenosides due to that name’s
similarity to Stenosis Herbst, 1799. Lacordaire included Asida anastomosis in his
description of Ologlyptus, which prompted LeConte to sink Pactostoma in favor of
Ologbptus a few years later (LeConte, 1866). The last North American asidine genus to
be described in the 18008 was Pycnomorpha Motschulsky (1870).

Between 1851 and 1870 the species compositions of many of the genera were in

flux as species were shifted between them. Horn (1870) was the first author to

 

 

consolidate the isolated species descriptions for the asidines north of Mexico into a single
paper including keys for the genera and the tribe. He concluded that no characters
l reliably separated most of the North American genera from Asida and, instead of
i “erecting these into genera as numerous as the species”, he sank all but Astrotus,
Ologlmtus, and Microschatia back into Asida.
The Mexican asidine fauna was treated in the massive Biologia Centrali-
Americana series by Champion (1884, 1893). Champion (1884) followed Horn by
placing most of the asidines in Asida, but erected the monotypic genera Poliorcetes,

Sicharbas, T isamenes, Ucalegon, and Zamolxis. However, in a supplement Champion

 

(1893) suppressed all of the genera that he had described except Sicharbas, while
suggesting that if they were maintained a number of other species would also have to be
placed in new genera He also provided the replacement name Zaleucus Champion for

Zamolxis (preoccupied), to be used in the event that his genera were maintained by later

 

authors.

. The next revisionary work to examine most of the North American asidine genera
was Casey (1912). Casey described approximately 60% of the current valid species and
subspecies in his monograph and established much of the modern taxonomy within the
group. To contain the 212 taxa he treated, Casey erected 14 new genera (Asidina,
Asidopsis, Bothrasida, letasida, Gonasida, Heterasida, Litasida, Megasida,
Pycnonotida, Notiasida, Parasida, Platasida, Stethasida, and T richiasida) and
resurrected five genera (Euschides, Pactostoma, Pelecyphorus, Stenomorpha, and
Stemsides). Casey never saw many of the Mexican species, but he did move most of

them back into resurrected genera or into his new genera based on their descriptions or

6

l,“ . -

 

 

 

 

 

 

images in the Biologia Centrali-Americana. He also expressed his opinion that most of
Champion’s genera would need to be resurrected and that at least 15 new genera would
eventually need to be described “for known aberrant Mexican types”.

Ten years later, the German coleopterist Siegfiied Wilke (1922) added to Casey’s
concept of the North American asidine genera by placing the remaining Mexican species
and 14 new species into Casey’s classification. Wilke also resurrected Champion’s
suppressed genera (Poliorcetes, Tisamenes, Ucalegon, and Zaleucus) and described one
new genus (Herthasida) and one subgenus (A croschatia). Wilke disagreed with Casey in
two instances by synonymizing Pactostoma under Stenosides and Euschides under
Stenomorpha.

Blaisdell (1923) reviewed the Asidini of Baja California and applied Casey’s
generic names as subgenera of Asida without explanation. However, 20 years later
(Blaisdell 1943), he applied the generic names used in Casey (1912) to the same Baja
Californian fauna as genera, again without explanation. The one exception was
Stethasida catalinae Blaisdell, 1923, where he continued to use Stethasida as a subgenus
of Asida. Whether or not the use of Casey and Wilke’s generic names in the world
catalog of Tenebrionidae (Gebien 1938-1944) played a part in Blaisdell’s decision is
Imknown.

Several changes were also made to the North American asidine genera in the
latter half of the 20th century. Pycnonotida and Acroschatia were synonymized under
Microschatia (Brown and Doyen 1991), Philolithus was resurrected (Brown 1971b),
Pycnomorpha was resurrected (Aalbu et a1. 1995), and the North American tribe

Craniotini was synonymized under Asidini (Aalbu et a1. 2002), thus adding the genus

I
’9’ .
I‘.‘.I _______

 

 

Craniotus LeConte. Brown (1971b) also provided the first key to the genera since Casey
(1912), which pointed out some of the taxonomic problems underlying the current
generic classification as no adequate characters were found to group all of the species in

many of the genera.

Systematics

The tribe Asidini, in the tenebrionid subfamily Pimeliinae, currently contains
approximately 1000 described species in 46 genera. The tribe is diagnosed from other
pimeliines by the unique combination of the following characters (Aalbu et al. 2002,
Doyen 1993): apterous; eyes ovate to elongate, slightly reniform or not; head not
significantly constricted behind eyes; antennae eleven segmented; antenna] segment 10
large, subquadrate or conical, with two simple tomentose apico-lateral sensilla, sensilla
sometimes coalesced into a single apical band; Antennal segment 11 smaller than 10th,
with a single simple tomentose apical sensillum, segment slightly or deeply amplected
into antennal segment 11; submentum not concealed; prementum narrower than mentum,
mostly membranous with the ligula scleritized, one-half or less mentum length, exposed
or concealed beneath apical margin of mentum; mentum large, cordate to trapazoidal or
hexagonal, width greater then length, filling half or more of buccal cavity; tentoral bridge
absent; apical maxillary palp large, securiform to scalene; labrum exposed, wider than
long; right mandible without dorsolateral tooth; two apical spurs on each tibia; mesocoxal
cavities with trocantin visible or not; ovipositor nearly as long as abdomen, coxite lobes

fused and heavily sclerotized.

 

 

 

 

 

 

 

Asidini is potentially a highly derived tribe within the Pirneliinae (Doyen 1993), a
subfamily characterized by having the membranes between abdominal ventrites three to
five concealed, the aedeagus inverted, and by their lack of defensive glands. All the
major arid regions of the world have their own diverse and distinct pimeliine fauna, with
the exception of Australia which has a relatively limited pimeliine fauna (Matthews
2000). In the only pimeliine phylogenetic analysis to date, Doyen (1993) recovered an
asidine clade (Asidini, Branchini, Coniontini, Physogasterini, Praocini, Nyctelini, and
Elenophorus) that represents one of the largest radiations of tenebrionids. However, the
clade is entirely restricted to the New World with the exception of the Asidini and the
genus Elenophorus. This would seem to indicate that the Asidini are basal within their
clade, however the tribe was consistently recovered as highly derived. Internally, the tribe
contained four clades with each corresponding to a geographic region (Mediterranean,
southem Afiica, southern South America, and North America).

In this study I present the first phylogenetic analyses for the North American
Asidini, examine evolutionary relationships within and between the genera, and revise
the generic classification based on partial sequences of two genes, C01 and 288, and
adult morphology from representative species for 20 of the 27 currently described genera.
Revisionary changes were guided by the resulting inferences and genera are maintained,

synonymized, or erected accordingly.

 

 

 

MATERIALS AND METHODS

Approximately 6,850 specimens were examined for this study, including the type
material for over 90% of the previously described species. Specimens were graciously
loaned by the following collectors and institutions; collection abbreviations follow
Evenhuis (2007):

AMNH American Museum of Natural History, New York, NY, USA. (Lee
Herman)

BFLC Brackenridge Field Laboratory Insect Collection, University of Texas,
Austin, TX, USA. (John Abbott)

BMNH The Natural History Museum, London, United Kingdom. (Max Barclay)

BYUC Monte L. Bean Life Science Museum, Brigham Young University, Provo,

 

‘ UT, USA. (Shawn Clark)

CASC California Academy of Sciences, San Francisco, CA, USA. (Dave
Kavanaugh)
CIDA Orma J. Smith Museum of Natural History, College of Idaho, Caldwell,

11), USA. (William Clark)

CNIN Coleccién Nacional de Insectos, Mexico City, Mexico. (Harry Brailovsky)
CSCA California State Collection of Arthropods, Sacramento, CA, USA.
(Charles Bellamy)
EGRC Edward G. Riley Collection, College Station, TX, USA.
EMEC Essig Museum of Entomology, University of California, Berkeley,

10

 

 

 

 

——-~—— ~ va—

 

 

CA, USA. (Cheryl Barr)

FMNH Field Museum of Natural History, Chicago, IL, USA. (James Boone)
KSUC Kansas State University Collection (Gregory Zolnerowich)

KWBC ' Kirby W. Brown Collection, Paradise, CA, USA.

MCZ Museum of Comparative Zoology, Harvard University, Cambridge, MA,
USA. (Philip Perkins)

MNIIN Museum National d'Histoire Naturelle, Paris, France. (Olivier Montreuil)
MRSC Marion R Smith Collection, Austin, TX, USA.

MSUC Albert J. Cook Arthropod Research Collection, Michigan State University,
East Lansing, MI, USA. (Gary Parsons)

NMNH National Museum of Natural History, Smithsonian Institution,
Washington, DC, USA. (Warren Steiner and David Furth)

OSUC C. A. Triplehom Insect Collection, Ohio State University, Columbus, OH,
USA. (Charles Triplehom and Norm Johnson)

TAMU Texas A&M University Insect Collection, College Station, TX, USA.

(Edward Riley)
TTUZ Invertebrate Zoology Collection, Texas Tech University, Lubbock, TX,

USA. (James Cokendolpher)

UCDC Bohalt Museum of Entomology, University of California, Davis,
CA, USA. (Fran Keller and Steve Heydon)

UMMZ Museum of Zoology, University of Michigan, Ann Arbor, MI,

USA. (Barry O’Connor)

ll

 

 

 

 

 

-fifi A

—— — \o -

WFBM W. F. Barr Entomological Collection, University of Idaho, Moscow, ID,

USA. (James Johnson)

ZMBB Museum filr Naturk'lmde der Humboldt-Universittit, Berlin, Germany.
(Bemd J aeger)
‘ Phylogenetic Analysis
Taxon Sampling

Most asidine species are rarely encountered and many species are known fiom
only one or a handful of collecting events. Specimens sequenced for this study were
either collected by the author directly into 95% ethanol or donated by colleagues.
Additional specimens of each species were also scored for morphology and used to
examine potential intraspecific variability within the dataset. Fifty North American
asidine species were included in the analyses (Table 1.1) representing 20 current asidine
genera and two potentially undescribed genera. Outgroup taxa were selected fiom the
South American Asidini (Cardigenius Iaticollis Solier) and the closely related tribes

Coniontini (Eusattus reticulatus (Say)) and Branchini (Branchus n. sp.).

DNA Sequencing and Alignment
Tissue was removed fi'om either the head or a leg of each specimen and the DNA
was extracted using DNeasyTM Tissue Kits (Qiagen). After extraction, DNA samples
were stored at -20°C and specimens were either pinned or left in 95% ethanol at -80°C.
All specimens were vouchered in the A.J. Cook Arthropod Research Collection at

Michigan State University.

 

12

 

 

 

 

 

 

~>

,_ ~fiv. —_

 

 

The purified DNA was used to amplify portions of the mitochondrial cytochrome
c oxidase I (COI) and nuclear ribosomal 288 (D2 region) genes. PCR amplifications for
COI used the published primers (Hebert et al. 2003) LC01490 (5’GGTCAACAA
ATCATAAAGATATTGG-3’) and HC02198 (5’-TAAACTTCAGGGTGACCA
AAAAATCA-3’) and contained 15.75 pl ddeO, 2.5 pl 5X T anNA polymerase buffer
(Promega, Madison, WI), 2.0 pl 25 mM Promega MgClz, 0.5 pl 40 mM dNT'Ps
(deoxynucleotide triphosphates), 0.25 pl Promega T aq DNA polymerase, 1 p1 of 10
pM/pl LC01490 primer, 1 pl of 10 pM/ pl HC02198 primer, and 2 pl of DNA template.
PCR reactions for 288 used the published primers (Dole et al. 2010) 3665 (5’-
AGAGAGAGTTCAAGAGTACGTG-3 ’) and 4068 (5 ’-
TTGGTCCGTGTTTCAAGACGGG -3 ’). PCR reactions contained 15.7 5 pl ddI-IzO, 2.5
pl 10X T anNA polymerase buffer (Qiagen Inc., Santa Clara, CA), 2.0 pl 25 mM
MgC12, 0.5 pl 40 mM dNTPs (deoxynucleotide triphosphates), 0.25 p1 Qiagen Hotstar
Taq DNA polymerase, 1 pl of 10 pM/pl 3665 primer, 1 pl of 10 pM/ pl 4068 primer, and
2 pl of DNA template. I

PCR amplifications for both genes were performed using a MJ thermal cycler (MJ
Research, Waltham, MA) under the following conditions: activation (95°C, 5min.) for 1
cycle; denaturation (94°C, 303), annealing (45-55°C, 45$), extension (72°C, 60s) for 35-
40 cycles; final extension (72°C, 5min.). Negative controls were used to monitor for
potential contamination and PCR products were examined using gel electrophoresis. PCR
products were cleaned using ExoSAP-IT and the manufacturer’s protocols (U SB Corp.,
Cleveland, OH). The cleaned PCR products were sequenced in both directions, using the

same primers as were used in amplification, with a BigDye® Terminator v1.1 cycle

13

 

sequencing kit (Applied Biosystems, Foster City, CA) at the Research Support Facility at
Michigan State University. The resulting DNA sequences were examined and edited
using Sequencer 4.5 (Genecodes, Ann Arbor, MI) and consensus sequences were created
from the sense and antisense sequences.
The COI sequences showed no length variability and were aligned manually in
Mega 4 (Tamura et al. 2007) since the alignments were unambiguous. 28S sequences
were initially aligned using Clustal W (Thompson et al. 1994) in Mega 4 then manually
adjusted in reference to a model of beetle 28$ secondary structure (Gillespie et al. 2004)
to correct misaligned conserved regions and to remove unalignable regions in the 288 i

dataset.

 

Morphological Characters

A total of 100 morphological characters were included in the analyses (42 binary,
i 58 multistate) and coded using the program Mesquite 2.5 (Maddison and Maddison,
I 2008). Characters include those previously used in asidine species and generic
descriptions (Solier 1836; LeConte, 1853, 1858; Champion 1884, 1892; Casey 1912;
Wilke 1822) and new characters identified in this study. All measurements were taken
using digital calipers or an optical micrometer attached to a Leica M2125 microscope.
Overall body length was measured along the midline from the anterior margin of the
pronotum to the apex of the elytra. Width was measured across the widest point of the
elytra. Images of specimens or characters were taken with a Leica DFC320 camera
mounted on a Leica MZ16 microscope. Montaged images were assembled with Helicon

Focus 3.5 (HeliconSofi) software. Dissection of specimens to examine internal structures

14

Lunar—A

 

 

   

 

 

\__.

-‘_-.~__ __

 

 

followed established methods (Tschinkel & Doyen 1980, Flores 1997) for the subfamily
and descriptive terminology followed Doyen (1966, 1993) and Harris (1979).
Characters were coded for both male and female specimens unless otherwise
specified. Consistency index (CI) and retention index (RI) scores for the characters are
based on one of four recovered most parsimonious trees. Images of characters and states
are online at httn://www.hisl.ent.msu.edu/research/asidini/ along with additional
supplemental information.
Antennae

1. Apical tomentose sensillum on antenna] segment 11 (CI = 0.33; RI = 0.64) / O:
confined to tip, less than one-fourth of segment/ 1: one-fourth to half of segment / 2:
more than half of segment

2. Antennal segment 11 laterally asymmetric (CI = 0.33; R1 = 0.00) / 0: no / 1: yes

3. Antennal segment 10 encasing segment 11 past basal constriction (CI = 0.25; R1 =
0.25)/ 0: no / 1: yes

4. Tomentose sensilla on antenna] segment 10 (CI = 0.33; R1 = 0.67) / 0: separate / 1:
separate, outer sometimes divided / 2: sometimes meeting on one side / 3: complete
tomentose band

5. Tomentose sensillum on antenna] segment 9 (CI = 1.00; R1 = 1.00) / 0: present/ 1:
absent

6. Male antenna] segment 9 (CI = 0.25; R1 = 0.82) / 0: sub equal to segment 10 / 1:
smaller than segment 10

7. Antennal shape, segments 3 to 7 (CI = 0.11; R1 = 0.65) / 0: rounded / 1: laterally

flattened

15

 

 

 

8. Antennal segment 3 length (CI = 0.33; R1 = 0.75) / 0: short, length less than 2.5 X
width/ 1: medium, length greater than 2.5 X width / 2: long, length greater than 4 X
width
9. Female antenna] length (CI = 0.6; RI = 0.33) / 0: short, not exceeding head capsule
base / 1: normal, 3-5 segments past headcapsule base / 2: long, nearly twice as long as
head capsule / 3: normal in female, long in male
10. Antennal setae, predominate color (CI = 0.19; R1 = 0.59) / 0: white or clear / 1:
golden or light brown / 2: brown / 3: black

Head
11. Clypeal membrane (CI = 0.17; R1 = 0.69) / 0: exposed/ 1: concealed
12. Labrum, medial tormal process (CI = 0.11; R1 = 0.60) / 0: shorter than posterior
tormal process / 1: equal to or longer than posterior tormal process
13. Labrum, emargination (CI = 0.17; R1 = 0.50) / 0: none or very slight / 1: rounded
emargination
14. Labrum, unsclerotized setal sensorium (CI = 0.40; R1 = 0.89) / O: concealed in
depressions / l: protruding past labral margin, visible on dorsal surface / 2: entire margin
unsclerotized
15. Mentum reaching mandibles (CI = 0.50; R1 = 0.75) / 0: no / 1: yes
16. Mentum type (CI = 0.88; R1 = 0.96) / 0: Type I, Astrotus/ 1: Type H, Sicharbas / 2:
Type III, Philolithus / 3: Type IV, Stenomorpha / 4: Type V, Megasida/ 5: Type VI,
Stenosides / 6: Type VII, Cardiogenius / 7: Type VIII, Asbolus / 8: Type D(,

Microschatia/ 9: Type X, Pelecyphorus

l6

 

 

 

 

17. Ligula position and apex shape (CI = 0.75; R1 = 0.96) / 0: concealed, almost always
straight, thin / 1: partially exposed, flush with anterior margin of mentum, curved, thin /
2: exposed, rising above anterior margin of mentum, curved, thick / 3: raised,
membranous, long / 4: exposed, rising above anterior margin of mentum, long

18. Maxillary segment 2 proportion (CI = 0.50; RI = 0.00) / 0: seg.2 subequal to seg.3 /
1: seg.2 shorter than seg.3

19. Female maxillary palp shape (CI = 0.43; R1 = 0.64) / 0: rectangular / 1: securiform/
2: triangular or slightly scalene / 3: scalene / 4: scalene, greatly enlarged

20. Male maxillary palp shape (CI = 0.21; R1 = 0.67) / 0: rectangular/ 1: securiform / 2: ‘
triangular or slightly scalene / 3: scalene / 4: scalene, greatly enlarged

21. Maxilla, lacinial uncus (CI = 1.00; R1 = 1.00) / 0: bifid/ 1: single, pointed

22. Submentum width (CI = 0.50; R1 = 0.83) / 0: nearly equal to buccal cavity basal
width, cardos concealed / 1: ~4/5 buccal cavity width, cardos partially concealed / 2: less
than 4/5 buccal cavity width, cardos exposed / 3: app. 1/2 buccal cavity width, cardos
completely exposed

23. Submentum shape (CI = 0.50; R1 = 0.82) / 0: flat, apex straight or nearly straight / 1:
flat, apex shallowly concave or emarginate / 2: medially depressed to apex, apex
emarginate / 3: depressed, apex straight / 4: concealed or absent

24. Postgenal process swollen (CI = 0.25; R1 = 0.79) / 0: yes / 1: no

25. Postgenal process reaching mentum apex (CI = 1.00; R1 = 0.00) / 0: no / 1: yes

26. Postgenal process, viewed laterally (CI = 0.40; R1 = 0.83) / 0: not or barely

produced/ 1: broadly rounded, extending past middle of mentum / 2: acute, extending

 

17

l.» __

 

   

 

past middle of mentum / 3: broadly rounded or truncate, entending to middle of mentum

or less / 4: acute, extending to middle of mentum or less

27. Gena] suture (CI = 0.4; RI = 0.57) / 0: curved underneath eye / 1: long, extending

past mandible base / 2: short, not exceeding mandibular base

28. Postgenal anterior margin (CI = 0.33; R1 = 0.83) / 0: concealing mandibular

protuberance / 1: exposing mandibular protuberance / 2: exposing mandibular

protuberance, strongly emarginate below mandibles

29. Eye shape (CI = 0.25; R1 = 0.57) / 0: elongate or elongate reniform/ 1: round or

broad ova]

30. Frons sculpturing (CI = 0.22; R1 = 0.68) / 0: impunctate/ 1: shallow punctures or

fovae / 2: large deep dense fovea / 3: tuberculate, scattered punctures

31. Frons median depression (CI = 0.25; R1 = 0.57) / 0: absent or faintly indicated / 1:

present

32. Supra-orbital carina (CI = 1.00; R1 = 1.00) / 0: absent / 1: present

33. Gena laterally projecting, acute (CI = 1.00; R1 = 0.00) / 0: no / 1: yes

34. Tentorial bridge (corpotentorium) (CI = 1.00; R1 = 0.00) / 0: absent / 1: present
Prothorax

35. Posterior lateral margins of prothorax (CI = 1.00; R1 = 1.00) / 0: tomentose

patches absent / 1: tomentose patches present

36. Posterior pronotal apicies (CI = 0.33; R1 = 0.60) / 0: broadly rounded, projecting

over sides of elytra/ 1: broadly rounded to obsolete, not projecting / 2: acute, not or

weakly projecting / 3: acute, distinctly prolonged, projecting over elytra / 4: acute,

divergently projecting

18

 

 

 

37. Pronotal anterior apicies (CI = 0.14; R1 = 0.57) / 0: not or slightly produced / 1:
produced, acute / 2: produced, broadly rounded
38. Pronotum posterior margin shape (CI = 0.21; R1 = 0.61) / 0: straight/ I: concave /
2: convex / 3: sinuate or convex with median dip / 4: straight with a protruding medial
tooth
' 39. Pronotum tumid (CI = 0.10; R1 = 0.47) / 0: no / 1: yes
40. Pronotal discal tuberacles (CI = 0.25; R1 = 0.40) / 0: absent / 1: present
41. Median longitudinal pronotal ridge (CI = 0.67; R1 = 0.00) / 0: absent or faint ‘
unraised line / 1: partially raised / 2: complete carinae
42. Pronotal fossa (CI = 0.40; R1 = 0.25) / 0: absent or, rarely, very faintly indicated / 1:
present, form rounded fossa/ 2: present, two c-shaped fossa
43. Pronotum median longitudinal furrow (CI = 0.50; RI = 0.50) / 0: absent / 1:
present
44. Pronotal posterior margin with visible golden fringe of setae (CI = 0.40; R1 =
0.63) / 0: absent / 1: present, arising from lateral face / 2: present, arising from interior
margin
45. Pronotal marginal costa (CI = 0.33; R1 = 0.27) / 0: absent/ 1: present, always
strongly reflexed / 2: present, not or weakly reflexed / 3: present, weakly to stongly
reflexed / 4: present, broadly reflexed, medially expanded and acute
46. Prosternal process height (CI = 0.29; R1 = 0.44) / 0: declivous/ 1: porrect / 2: sub-

porrect, thickened at base

 

19

l...___—____ A

 

 

 

47. Base of prosternal process expanded behind procoxa (CI = 0.10; R1 = 0.63) / 0:
not or barely in a few specimens / 1: yes
48. Prosternal process sagittate (CI = 0.33; R1 = 0.00) / 0: no / 1: yes
49. Prosternum depressed anterior to procoxal cavities (CI = 1.00; R1 = 1.00) / 0: yes
/ 1: no
50. Prosternum length anterior to procoxal cavities (CI = 0.50; R1 = 0.88) / 0: equal or
greater than coxal cavity length / 1: less than coxal cavity length
51. Prosternal tubercules (CI = 0.14; R1 = 0.40) / 0: absent / 1: present
52. Prosternum punctation (CI = 0.21; R1 = 0.66) / 0: smooth, miniscule punctures / 1: 5
foveate / 2: densely, nearly confluently foveate / 3: regularly punctate
53. Anterior projecting hypomeron tuberacle (CI = 1.00; R1 = 0.00) / 0: absent / 1:
present
54. Suture between hypomeron and prosternum (CI = 0.11; R1 = 0.62) / 0: complete
visible over entire length / l: partly to totally obscured
55. Pronotal length to width ratio (CI = 1.00; R1 = 1.00) / 0: much wider than long , L
divided by W less than .60 / 1: L divided by W greater than .60

l Pterothorax

l 56. Scutellum raised above scutum (CI = 0.40; R1 = 0.81) / 0: no / 1: gradual, 45 degree

migle / 2: sharp, 90 degree angle
57. Mesonotal depressions (CI = 0.47; R1 = 0.76) / 0: absent / 1: tomentose, faint,
transverse / 2: tomentose, usually deep, transverse, separated by medial carinae / 3:

tomentose, deep, triangular / 4: tomentose, deep, triangular / 5: tomentose, deep, circle /

20

L.» i ‘ ‘44

 

 

 

 

 

6: tomentose, deep, rounded, open at base / 7: tomentose, faint, rounded, open at base / 8:
tomentose, deep, continuous band / 9: glaberous or with spines, transverse, open at base
58. Elytral insertion on mesonotum (CI = 0.40; R1 = 0.87) / 0: grooves on sides of
scutellum/ 1: grooves underneath scutellum / 2: grooves in elytra] sides / 3: grooves on
top and sides of scutellum

59. Tomentose depression on mesepistemum (CI = 0.25; R1 = 0.59) / 0: absent / 1:
large, curved, posterior margin well defined or costate / 2: large, curved, posterior margin
poorly defined / 3: thin, straight, posterior margin well defined / 4: thin, straight, posterior
margin poorly defined

60. Stellate elytra] setae (CI = 1.00; R1 = 0.00) / 0: absent/ 1: present, Astrotus type / 2:
present, Pelecyphorus type

61. Squamate setae (CI = 0.25; R1 = 0.50) / 0: absent/ 1: present

62. Hairlike elytra] setae (CI = 0.38; R1 = 0.58) / 0: absent, otherwise / 1: present
including disc, short stout / 2: present, not on disc, short stout / 3: present including disc,
long

63. Decumbent lanceolate scalelike setae (CI = 0.16; R1 = 0.67) / 0: absent / 1: present
64. Tuberacles on elytra] disc (CI = 0.15; R1 = 0.52) / 0: absent/ 1: present / 2: present,
minute

65. Metepimeron (CI = 1.00; R1 = 1.00) / 0: concealed / l: visible

66. Epipleura (CI = 0.50; R1 = 0.50) / 0: thin throughout, often obscured/ 1: not

obscured, expanded at elytra] base

21

 

 

o—‘v —o—-<‘v""'—- - ——'——-A

 

 

 

67. Elytral marginal costa (CI = 0.19; R1 = 0.43) / 0: absent, except near humera
occasionally/ 1: present / 2: present, divided, inner carina raised / 3: present, divided,
inner carina row of tubercles / 4: present, base formed by epipleura ‘

68. Elytral discal costa (CI = 0.27; RI = 0.56) / 0: absent / 1: present / 2: present, divided
into two branches / 3: present, confused, rugose / 4: present divided, almost completely
eroded / 5: present, faint/tuberclues, 3 branches

69. Elytral sutural costa (CI = 0.20; R1 = 0.00) / 0: absent / 1: present

70. Transverse elytra] costae (CI = 0.20; R1 = 0.47) / 0: absent / 1: present, carinate and
sometimes lines of tubercles / 2: present only as lines of tubercles / 3: rugose, confused
71. Elytral humeral carina strongly expanded at base, usually reflexed (CI = 0.20; R1
= 0.33) / 0: yes/ 1: no

72. Elytral humeri sharply constricted before base (CI = 1.00; R1 = 1.00) / 0: yes / 1:
no

73. Elytra sharply declivous and tomentose near base (CI = 1.00; RI = 0.00) / 0: no /
1: yes

74. Distinct elytra] setal color patterns (CI = 1.00; R1 = 0.00) / 0: none / 1: white or
multicolor longitudinal lines between costa / 2: Ucalegon patterned / 3: Tisamenes
Memed

75. Mesocoxal cavity closure (CI = 0.20; R1 = 0.60) / 0: open, closed by mesepistemum
or mesepimeron/ 1: apparently closed, closed by sternites

76. Metendosternite stem (CI = 1.00; R1 = 1.00) / 0: short, twice as wide as tall, sides

straight / 1: approximately square / 2: halfas tall as wide, V-shaped

22

 

 

 

 

 

77. Metendosternite (CI = 1.00; R1 = 1.00) / 0: longer than mesepisternite, not fused to
coxal cowlings/ 1: equal or shorter than mesepisernite, fused to mesocoxal cowlings
78. Metendosternite base forming an external sclerite (CI = 1.00; R1 = 1.00) / 0: no /
1: yes.
Legs

79. Protibial latero-apical spine (CI = 0.20; R1 = 0.58) / 0: absent to small, apically
setose/ 1: length < tibial midwidth, apically glaberous / 2: present, length app. => than
tibial midwidth, apically glaberous
80. Protibial apical spurs (CI = 0.40; R1 = 0.85) / 0: subequal in length / l: anterior
larger than posterior / 2: anterior smaller than posterior
81. Latero-apical spines on meso- and meta- tibia (CI = 1.00; RI = 0.00) / 0: absent/ 1:
present
82. Tarsal venter setae (CI = 0.18; R1 = 0.47) / 0: spiniform setae only / 1: hairlike setae
only / 2: combination of spiniform and hairlike setae
83. Parempodia (CI = 0.10; R1 = 0.64) / 0: absent or rarely present, not extending past
tarsal apex / 1: present, extending past tarsal apex
84. Mesotrochantin (CI = 0.67 ; R1 = 0.67) / 0: apparently absent, concealed / 1: present,
visible / 2: minute, barely visible

Abdomen
85. Punctation on abdominal ventrites 1-4 (CI = 0.10; RI = 0.67) / 0: absent/minute/ 1:
present
86. Setae on abdominal ventrites 1-4 (CI = 0.16; R1 = 0.64) / 0: absent/minute/ 1:

present

23

 

 

l._..___

87. Spermathecal common duct shape (CI = 0.67; R1 = 0.50) / 0: long, tubular/ 1:
short, protrusion opposite accessory gland / 2: absent / 3: small, rounded protrusion
88. Spermathecae arrangement (CI = 0.50; R1 = 0.91) / 0: apex of duct / 1: serial along
one side to apex / 2: serial, fiom accessory gland to apex / 3: single spermathaca
89. Spermathecae number (CI = 0.43; R1 = 0.79) / 0: one / 1: three to nine / 2: ten or
more / 3: two
90. Spermathecal accessory gland (CI = 0.50; R1 = 0.33) / 0: not branching / 1:
branching, small side branches / 2: branching, branch size equal
91. Enlarged chamber on spermathecal accessory gland (CI = 0.25; R1 = 0.86) / 0:
present/ 1: absent
92. Spermathecal accessory gland connection to common duct (CI = 1.00; R1 = 0.00)/
0: thickened ring off common duct / 1: directly onto common duct / 2: thickened
93. Spermathecae size (CI = 1.00; RI = 1.00) / 0: all approximately equal / 1: much
larger towards accessory gland / 2: single spermathecae
94. Spiculum ventrale (CI = 1.00; R1 = 0.00) / 0: short, half or less length of abdomen /
1: long, two-thirds or more length of abdomen

, 95. Female apical coxite ventral surface shape (CI = 0.67; R1 = 0.93) / 0: asidine type,

flat/ 1: asidine type, rounded / 2: non-asidine

.——-a—\ _

96. Abdominal intercoxal process interal connection to metepisternum (CI = 0.64; R1
= 0.86) / 0: raised bifid sclerite/ 1: raised medial membranous patch / 2: no raised area/
3: raised sclerotized patch / 4: raised, membranous patch poorly defined / 5: raised, no
patch / 6: raised, membranous patch with M-shaped sclerite above / 7: broad-slight raise,

transverse or bifid patch / 8: single sclerotized knob

24

 

   

 

__~_._..— _——— ~I

 

 

General
97. Densely evenly encrusted with debris dorsally (CI = 0.33; R1 = 0.33) / 0: no / 1: yes
98. Elytral setae barbed (CI = 1.00; R1 = 0.00) / 0: no / 1: yes
99. Eleodes mimic (CI = 0.15; R1 = 0.54) / 0: not mimetic / 1: potentially mimetic / 2:
mimetic
100. Defensive posture (CI = 0.42; R1 = 0.50) / 0: legs pulled in / 1: legs scissored / 2:
legs extended under body, stilted / 3: legs spread out to sides or front / 4: headstand / 5:

no posture, moves

Phylogenetic Analysis

Morphological and sequence data (100 morphological characters, 1152bp) for 55
North American asidine OTUs and 3 outgroup taxa were concatenated in Mesquite 2.5
and exported in Nexus format for analyses in PAUP* 4.0b10 and MrBayes 3.1.

Heuristic maximum parsimony analyses in PAUP* were implemented with
10,000 random stepwise additions and TBR branch swapping, and all multistate
morphological characters treated as non-additive. Initial analysis was performed with
equal weight assigned to all characters. A second analysis was performed with all
characters weighted a posteriori based on their consistency index scores. Branch support
was determined for both parsimony analyses using the nonparametric bootstrap
(Felsenstein 1985) with 1000 replicates in PAUP* and Bremer support indices in
TmeRot.v3 (Sorenson & F ranzosa 2007). Bremer support was assessed for the entire

dataset and for three data partitions (C01, 288, and morphology).

25

L...

   

For the Bayesian analysis the dataset was partitioned as follows: COI (partitioned
by codon position), 28S, and morphology. MrModeltest 2.3 (N ylander 2004) was used to
select the substitution models for the nucleotide data partitions using the Akaike
Information Criterion (AIC). GTR+I+I‘ was selected for both genes. The morphology
partition used a fixed state fiequency model with all states treated as equal. Flat priors
were chosen for all partitions. Two searches were performed with four chains each for 5
million generations and trees were sampled every 1000 generations. Clade support was

inferred based on the posterior probability distribution of tree topologies.

RESULTS
The Asidini were recovered as monophyletic in all analyses, with the South
American genus Cardigenius as sister to the North American asidines. Three large clades,
the “Stenomorpha”, “Philolithus”, and “Pelecyphorus” were also recovered in all three
phylogenetic analyses; however the relationships between them were conflicted between
the analyses and poorly supported. Together, these clades contained all but two of the
North American asidine genera included in the analyses.
Unweighted cladistic analysis yielded 4 most parsimonious trees (L=3615,
l CI=O.22, RI=0.47), of which the strict consensus tree (Fig 1.1) and one of the most
i parsimonious trees (Fig 1.2, Fig 1.3) are shown. Weighted parsimony analysis found one
tree (L=760.53, CI=0.3 8, RI=0.55, not shown) with the same branching pattern as one of
the most parsimonious unweighted trees. Partitioned and average Bremer support values
found in the unweighted parsimony analysis are listed in Table 1.2 with node numbers

corresponding to one of the most parsimonious trees (Fig 1.3).

 

l.» A .4:

 

«—- ~r“_——.—-—‘

 

 

Average standard deviation of split fiequencies between the two Bayesian
searches reached 0.01 before the “burn-in”, which was set at 2 million generations and a
majority rule consensus (Fig 1.4) was made for 6,000 sampled trees (-LogL= 16269).
Bootstrap (BS), averaged Bremer, and posterior probability (p.p.) values for select clades
from both analyses are listed in Table 1.3.

The “Stenomorpha” clade was recovered in both Bayesian and parsimony
amlyses with relatively strong support (Table 1.3). The relationship of the
“Stenomorpha” clade within the tribe was indeterminate with “Stenomorpha” +
“Pelecyphorus” weakly supported in the cladistic analysis (Bremer = 1) and
“Stenomorpha” + “Philolithus” weakly supported (p.p. = 67) in the Bayesian analysis.
Most of the terminal nodes within the clade were well supported in both analyses,
however many of the deeper nodes were poorly supported (BS<50, Bremer = 0-2, pp.
<80) and varied between the two inference methods.

The “Philolithus” clade was also strongly supported (BS = 100, Bremer = 23, pp.
= 100) in both analyses, though its placement within the tribe varied. In the Bayesian the
clade was sister to the “Stenomorpha” clade. In the parsimony analyses it was sister to
(H. bifitrca + H. connivens) in a clade sister to “Stenomorpha” + “Pelecyphorus”.
Relationships within the clade were the same in both analyses with Gonasida elata as
sister to the rest of the group and Philolithus paraphyletic with respect to Glyptasida
aegra + G. sordida.

The “Pelecyphorus” clade was found in both analyses with moderate support
(B860, Bremer = 5, pp. = 80). It was sister to the “Stenomorpha” clade in the

parsimony analysis and part of a basal polytomy “Pelecyphorus” + ((H. bifitrca + H.

27

 

 

 

connivens) Craniotus pubescens) + (“Stenomorpha” + “Philolithus”) in the Bayesian
analysis. Ardamimicus cognatoi n. gen. n. sp. was sister to the rest of the clade in both
analyses. Internally the clade differed between the analyses primarily in the placement of
members of the genus Parasida and Astrotusfasciculatus + Astrotus guanajuatensis.

In the parsimony topology Parasida was polyphyletic, with Parasida lirata sister
to most of the “Pelecyphorus” clade, P. n. sp. + P. sexcostata supported as sister species,
and P. longicollis recovered as sister to Microschatia rockefelleri in a more derived
position within the clade. The Bayesian consensus tree returned Parasida as a
monophyletic group sister to the rest of the clade, excluding A. cognatoi.

Astrotus was not recovered as a monophyletic group in either analysis. Astrotus
was polyphyletic in the most parsimonious trees with Astrotusfasciculatus + Astrotus
guanajuatensis outside of the clade (((U. pulchellus + P. mexicanus) + ((P. longicollis +
M. rockefelleri) + (Z. dilatatus (A. regulais + S. anastomosis)))). In the Bayesian analysis
Astrotus was paraphyletic with respect to Stenosides.

The genus Heterasida was not recovered as monophyletic in any of the analyses.
H. subvittata was consistently recovered as a sister taxon to Stethasida obsoleta in the
“Stenomorpha” clade. H. bifirrca + H. connivens were recovered as a sister group to the
“Philolithus” clade in parsimony analyses and sister to Craniotus in the Bayesian
analysis. Craniotus was sister to (Heterasida bifitrca + H. connivens) in the Bayesian

analysis and basal to the rest of the North American Asidini in the parsimony analysis.

28

 

DISCUSSION
Generic concept
Changes to the generic classification were made primarily on the basis of
monophyly. All of the asidine genera maintained or described as new are defined by
synapomorphic characters and/or a unique combination of homoplastic characters, and
delimit monophyletic groups based on the currently available data. Synonymies were
made in cases where a previously described genus was clearly not monophyletic and/or
' when a larger clade to which the genus belongs was well supported in the phylogenetic
l analyses, including the presence of morphological synapomorphies or a unique '
combination of homoplastic characters.
Species concept
The phylogenetic species concept of Wheeler and Platnick (2000) is employed to
define a species as “the smallest aggregation of (sexual) populations or (asexual) lineages
diagnosable by a unique combination of character states”. This species concept is
appropriate due to its emphasis on character transformations between species and the lack
of data, beyond adult morphology, available for many of the asidine species. Species
were maintained or erected based on the presence of morphological synapomorphic
characters and/or a unique combination of homoplastic characters shared by all of the
l specimens assigned to a species. Recognized species should be considered as scientific
hypotheses based on the available data and, as such, their validity can be tested as more
information is gathered. Previously described species were synonymized in instances
where the morphological features used to define them were found to be variable traits

within a larger sampling of specimens bound by invariant characters.

29

L... e

 

   

~‘« 1‘...- -

 

Biogeography

Few geographic patterns can be discerned fi'om the phylogenetic relationships
proposed in the analyses. The ranges of the “Stenomorpha” and “Philolithus” clades
roughly correspond, with both groups being poorly represented in central and southern
Mexico and appearing to reach their greatest species diversity in northern Mexico and the
southwestern United States. Both clades are also represented throughout the western US
on both sides of the Rocky Mountains and as far north as British Colombia and Alberta,
Canada. The majority of genera and species in the “Pelecyphorus” clade on the other
hand occur only from central Mexico south to Oaxaca and only two species (Astrotus
alveolatus Casey and Stenosides anastomosis (Say)) have ranges that extend as far north
as Kansas and Colorado. Microschatia is the only genus in the clade represented in
California or Baja California, with the exception of two Parasida species (P. sexcostata
and P. n.sp.), both of which are restricted to the Cape region of Baja California Sur.

“Stenomorpha” clade

The “Stenomorpha” clade consists of the genera Stenomorpha, Asidina, Platasida,
Megasida, Asidopsis, Trichiasida, Pycnomorpha, Stethasida, one species currently in the
genus Heterasida (H. subvittata), and the undescribed taxon “Pseudoglyptasida”. This is
the most specious clade of North American asidines and, while variable in dorsal habitus,
the group contains several synapomorphies based on internal morphology (76:1, 57: 6 or
7; 88:1) and a unique combination of symplesiomorphic characters (8:1, 14:1, 16:3 or 4,
17:2, 31 :0, 84:1, 95:1). Many of the current Stenomorpha clade genera, all of which were
described by Casey (1912) with the exception of Stenomorpha and Pycnomorpha, were

described based upon a gestalt of relatively variable dorsal characters (elytral costae,

30

 

 

 

 

pronotal shape, and the presence/absence of setae). None of the Stenomorpha clade
genera that were represented by more than a single taxon were recovered as
monophyletic in either analysis. Due to the lack of internal support within the clade, the
paraphyletic or polyphyletic makeup of most of the genera, the high amount of
homoplasy in characters previously used to separate the genera, and the diagnosability of
the “Stenomorpha” clade as a whole, the constituent genera making up the clade are
placed in synonymy with Stenomorpha Solier herein. A more detailed analysis of the
clade, including increased taxon sampling, will most likely result in the maintenance of
many of the previous genera as subgenera within Stenomorpha, with modifications in the
placements of a number of species.
“Philolithus” clade

The “Philolithus” clade is composed of the genera Philolithus, Gonasida, and
Glyptasida in the current dataset, but likely includes the monotypic and extremely rare
genera Herthasida and Tisamenes (not in phylogeny) based on a suite of shared
morphological characters (1:0; 4:1, 16:2, 17:0, 19:4, 23:0, 46:0, 50:0). This clade has
previously been hypothesized (Brown 1971b, Brown & Doyen 1991) but this is the first
time that it has been confirmed using quantitative phylogenetic methods. Gonasida was
sister to Philolithus + Glyptasida in both analyses; however Philolithus was paraphyletic
with respect to Glyptasida, though branch support was low. The genus Glyptasida was
recently revised (Lockwood and Pollock 2009) and reduced fi'om 22 species-group names
to 3, mostly through the synonymy of species described by Casey (1912). The remaining
Gbptasida species share two synapomorphies (35:1 and 72:0) and should be considered a

subgenus within Philolithus. Given that the morphological synapomorphies (16:2, 50:0,

31

 

 

 

 

57:0, 93:1, 96:7) or symplesiomorphies (17:0, 20:4, 23:0, 26:0, 56:4, 79:0, etc.) that
define the clade are present in all three of the genera in the analysis, and that the external
characters were confirmed as present in Herthasida and Tisamenes, the genera Gonasida,
Gljptasida, Herthasida, and T isamenes are synonymized with Philolithus herein, but
maintained as subgenera pending further studies.
“Pelecyphorus” clade

The “Pelecyphorus” clade is the most morphologically heterogeneous and least
supported of the three major clades recovered. In the current dataset it is composed of the
genera Ardamimicus n.gen., Astrotus, Parasida, Pelecyphorus, Microschatia, Stenosides,
Ucalegon, and Zaleucus. It is worth noting that the clade includes the only previously
described genera (Astrotus, Microschatia, Stenosides) that were not synonymized with
Asida by Horn (1870).
Ardamimicus cognatoi n.gen. n.sp. was placed at the bases of the “Pelecyphorus”
clade in all resulting topologies. It is a difficult species to place within the current generic
classification due to its unique combination of morphological characters (6: 1, 16:3, 17:1,
20:3, 39:1, 57:5, 61:1, 64:1, 76:0) and three autapomorphic characters (lanceolate setae
arising from the apex of micropunctate tubercles on pronotum, squarnate scales on the
legs, and prosternal process wider than procoxal cavities) not included in the analyses.
Hence, Ardamimicus is formally erected below as a new monotypic genus.

Microschatia was placed as either sister to Parasida longicollis (parsimony
analysis) or as part of a large polytomy (Bayesian analysis) within the “Pelecyphorus”
clade. In a separate analysis (not shown) of the C01 and 28S datasets, Microschatia was

sister to the rest of the North American Asidini. Hence, the placement of Microschatia

32

 

 

within the “Pelecyphorus” clade is questionable and appears to be due to the number of
homoplasious morphological character states that they share. Microschatia, which was
revised in Brown and Doyen (1991), is a well defined genus within the Asidini based on
a unique combination of characters (16:8, 46:1, 66:1, 87:1). Microschatia and its
presumed sister genus, the monotypic Litasida (not in analysis), share a unique
configuration of the spermathecal common duct (87:1) within the Asidini and are the
only known asidine genera outside of the Mediterranean region that have the epiplura
(66: 1) visible, basally expanded, and forming a marginal carina in some species. Further
analyses that include Mediterranean specimens are needed to ascertain the relationships
between the Palearctic and North American Asidini. Microschatia is maintained as a
valid genus within this study.

Astrotus was para- or polyphyletic with respect to Stenosides in both analyses.
However, morphology indicates that Astrotus should be divided into two separate groups,
both of which are distinct from Stenosides. Astrotus sensu strictu, represented in the
analyses by Astrotus regularis Horn, contains several autapomorphic characters (16:0,
53:1, 57:9, 60:1) in the current dataset that are synapomorphic for the species in Astrotus
sensu strictu. Astrotusfasciculatus and Astrotus guanajuatensis share a unique
combination of symplesiomorphies (10:2, 13:1, 16:9, 31:1, 42:1, 59:4, 68:2) and are
included in the subgenus Variodorsus n.s.gen. described herein.

The monotypic genera Pelecyphorus, Ucalegon, and Zaleucus vary in their
positions between the analyses, though Ucalegon + Pelecyphorus was consistently
recovered. All three genera are identified by autapomorphic characters and are

morphologically distinct fi'om each other as well as other asidine species groups.

33

 

The genus Parasida was monophyletic in the Bayesian analysis (p.p. = 90), but
polyphyletic in the most parsimonious trees. The placement of P. longicollis with
Microschatia in the parsimony analysis was surprising and is not supported by
morphological data. The model-based approach did recover Parasida as a monophyletic
group, which contains a unique combination of sympleisiomorphic character states (16:9,
17:1, 22:2, 23:2, 31:1, 46:0, 57:1 or 2, 62:2, 63:1, 89:1). Increased taxon sampling within
the group and the inclusion of more gene regions are warranted to clarify the validity of
Parasida. The genus is maintained as a subgenus of Pelecyphorus in the current study,
pending future analyses. A separate issue relating to Parasida is nomenclatural. The
genus name is a junior homynym of an earlier crustacean genus, thus the replacement
name Plesiasida is provided below.

While the dorsal habitus of different subgroups can be highly variable within the
“Pelecyphorus” clade, all groups, excluding Ardamimicus and Microschatia, share two
synapomorphies on the mesonotum (56:0, 57:1, 2, or 9) and a unique combination of
symplesiomorphies (6:1, 7:0, 17:0 or 1; 26:1 or 2, 58:1, 76:0, 80:0, 85:1; 88:0, 89:1,
95:0). Due to the lack of internal support within the clade, the paraphyletic or
polyphyletic makeup of most of the genera, the high amount of homoplasy in characters
previously used to separate the genera, and the diagnosability of the “Pelecyphorus”
clade as a whole, the constituent genera, excluding Ardamimicus and Microschatia (as
discussed above), making up the clade are synonymized or reduced to subgeneric status

within Pelecyphorus Solier herein.

34

Heterasida
The genus Heterasida was not recovered as monophyletic in any of the analyses.
H. subvittata was consistently recovered within the “Stenomorpha” clade, while H.
bifilrca + H. connivens were recovered outside of the three named clades and as a sister
group to either the “Philolithus” clade or Craniotus. All three Heterasida species are
endemic to the Baja Sur Cape region, which is one of the reasons given by Casey (1912)
for hesitantly placing them into the same genus. However, H. subvittata is clearly part of
the “Stenomorpha” clade based on both morphology (discussed above) and DNA, while
H. bifixrca and H. connivens share three morphological synapomorphies (9:2, 32:1, 89:3)
found nowhere else in the tribe.
Craniotus
The genus Craniotus currently contains two species (C. pubescens and C.
blaisdelli), one of which (C. pubescens) was included in the analyses. Craniotus was
sister to (Heterasida bifilrca + H. connivens) in the Bayesian analysis and basal to the
rest of the North American Asidini in the parsimony analysis. Historically Craniotus was
placed in its own tribe, Craniotini. Doyen (1993) recognized its similarity to the Asidini

and the tribe was subsequently synonymized under Asidini (Aalbu et al. 2002).

Key to the North American Asidini genera [modified from Brown 1971b]

1 Epiplura widening towards base; epiplural fold distinct over entire length,
forming a marginal costa or not; prostemal process strongly raised and produced

behind procoxa ........................................................................................................ 2

35

2(1)

3(1’)

4(3’)

5(4’)

Epiplura thin over entire length, epiplural fold weakly or not indicated beyond 3rd
abdominal ventrite; prostemal process variable ...................................................... 3
Mentum small, cordate, exposing maxillary cardos; antenna long and slender;
posterior pronotal apicies projecting over elytra .............................. Litasida Casey
Mentum large, sub-trapazoidal, concealing maxillary cardos; antennae compact;
posterior pronotal apicies not projecting over elytra ............... Microschatia Solier
Inflated, hemispherical reddish-orange setae present on abdominal ventrite 1;
minute tomentose sensilla generally present on lateral apicies of antenna] segment
9 ............................................................................................... F erveoventer, n. gen.
Abdominal ventrite 1 setose or not, but never with hemispherical setae; antennal
segment 9 without tomentose sensilla. ..................................................................... 4
Epistoma acutely laterally produced, mesotrocantin minute and concealed; apical
segment of maxillary palpi rectiform and not enlarged in female, greatly enlarged
and scalene in male; antennal segment 11 conical, tapering to apex
................................................................................................... Craniotus LeConte
Epistoma rounded, not acutely produced, mesotrocantin variable; apical segment
of maxillary palpi enlarged in both sexes, securiform, isotriangular, or scalene;
apex of antennal segment 11 broadly rounded ....................................................... 5
Eyes small and nearly round; protibial outer lateral margin carinate and serrated;

posterior protibial spur greatly reduced, less than 1/8 length of anterior spur;

pronotum lacking marginal costa;length less than 6.5 mm; Nuevo Leon ..................
...................................................................................................... Micrasida, n. gen.
36

6(5’)

7(6’)

3(7)

Eyes elongate, slightly reniform or rarely broadly oval; protibial outer lateral
margin rounded, with or without small tubercles; posterior protibial spur at least
1/2 length of anterior spur; pronotum with marginal costa; length greater than 6.5
mm ........................................................................................................................... 6
Legs densely clothed with whitish squamate scales; prostemal process wider than
width of procoxal cavity; pronotal disc tuberculate iwith decurnbent lanceolate or
squamate scales arising from apex of tubercles ..................... Ardamimicus, n. gen.
Legs glabrous or with hair-like setae; prostemal process width less than width of
procoxal cavity; pronotal disc rarely with tubercules, if tuberculate then never
with lanceolate or squamate scales arising from apex of tubercles ................. 7
Ligula exposed, tumid, length 3X width or less; scutellum raised above scutum,
mesonotum with two rounded tomentose depressions ............................................. 8
Ligula partially exposed or concealed, not tumid, length 4X width or more;
scutellum rarely raised above scutum, if raised then lacking tomentose
depressions on mesonotum ...................................................................................... 9
Supraorbital costae present fi'om apices of eyes to gena; antennae long, tomentose
sensilla on antenna] segment 10 coalesced into a continuous band, segment 11
deeply amplected into segment 10; pronotum medially longitudinally impressed;
Baja California Sur ..................................................................... Heterasida Casey
Supraorbital costae absent or present only above eyes; tomentose sensilla on
antennal segment 10 separate or sometimes meeting on one side only, segment 11
slightly or not amplected into segment 10; pronotum not medially longitudinally

impressed ................................................................................. Stenomorpha Solier

37

9(7’) Mentum broadly hexagonal; head nearly hypognathous; ligula small, straight, and

concealed underneath mentum; apical protibial spurs subequal; ........... mesonotum
lacking paramedia] depressions .......................................... Philolithus Lacordaire

- Mentum broadly cordate or subtrapazoida]; head nearly prognathous; ligula small,
straight or curved, concealed underneath mentum or partially exposed; anterior
protibial spur longer than posterior spur; mesonotum with two transverse deep or
faint tomentose depressions often leaving a medial carina running to scutellum ......

.................................................................................................. Pelecyphorus Solier

Generic Descriptions

Ardamimicus Smith, New Genus
Type species: Ardamimicus cognatoi Smith, n. sp.

Description (see fig. 1.5). Length: 8.3-12.8mm, width: 4.3-7.7mm; integument black;
body obovate; head retractable into pronotum to epistoma; elytra wider than pronotum
and 2.9-4.1times longer. Head: Mentum cordiform, mid-width more than 2X basal width,
not reaching postgena or mandibles, anterior margin slightly medially emarginate. Ligula
sclerotized small, less than one-fourth mentum width, slightly curved and partially visible .
above mentum emargination. Apical segment of maxillary palps enlarged, triangular to
scalene. Submentum narrow and raised, laterally exposing maxillary cardos. Postgenal
processes slightly produced, acute or rounded. Labrum broadly shallowly emarginate;

medial tormal process shorter than posterior tormal process; clypeal membrane exposed.
38

DN':

l
ls“

\...

v“ a

0.

it]

Dr»

«4&1

 

Clypeal margin straight. Eyes elongate, broadly oval to slightly reniform, approximately
two-thirds of eye above epistoma. Antenna weakly clavate; nearly moniliform; segments
9-11 flattened, forming a club; antennal segment 10 subquadrate; two tomentose sensilla
present at lateral apices; antennal segment 11 with a broad apical tomentose sensillum,
approximately one-half size of and slightly amplected into segment 10. Prothorax:
Pronotum tumid and tuberculate, each tubercle bearing a single apical or lateral scale,
lacking median costa and fossae; lateral costae present, anterior margins acute or broadly
rounded, basal margins obtuse; posterior pronotal margin convex. Prostemal process
broader than procoxa] cavity, declivous behind procoxae. Pterothorax: Apterous.
Scutellum triangular, gradually raised above scutum; mesonotum with two rounded
tomentose depressions. Elytra rugose, with irregular anastomizing ridges and
protuberences. Epipleura indistinct. Metendosternite stem approximately as twice wide as
tall. Legs: Black to ferruginous, tarsal formula 5-5-4; coxae globular; mesotrocantin
clearly visible; femura rugose-punctate, tibia shallowly nearly confluently foveolate, both
densely clothed with scales; protibia with outer apical margin flared, occasionally
forming a small distinct spine, inner apical margin with two unequal spurs, anterior spur
larger than posterior. Abdomen: Punctate and setose; intercoxal process broader than
mesostemal apex, anterior margin nearly straight. Female apical coxites ventrally
rounded; 10 or more spermathecal branches present, emerging from apex of common
duct.

Diagnosis. Ardamimicus is distinguished from all other asidine genera by a unique
combination of the following characters: mentum cordiform, not reaching postgena or

mandibles; ligula thin and partially concealed or flush with mentum; pronotum tumid

39

with decurnbent lanceolate or squamate scales arising from the apex of pronotal
tubercles; dorsal and lateral sides of femura and tibia densely clothed with squamate
scales; and prostemal process wider than procoxal cavity.

Distribution. The only know species of Ardamimicus, A. cognatoi, has been collected

. from the Mexican states of Chihuahua and Durango and the western portion of Texas in
the United States.

Etymology. The name Ardamimicus is derived fiom the Greek words “arda meaning
dirt or filth, and “mimicus”, meaning mimic or imitator, in reference to the species strong

dorsal resemblance to a clod of dirt or jackrabbit droppings. It is in the masculine form.

Species Description

Ardamimicus cognatoi Smith, New Species

Type Material. HOLOTYPE (female) labeled: a) “USA: TX: Reeves County /
Balmorhea, Lake Balmorhea / Co. Rd. 319 N30°58’22.7” / W102°33’01.1”, 05.D(.2005 /
Under rocks, Coll. ADSmi ”; b) on red paper, “HOLOTYPE /Ardamimicus / cognatoi
9 /Aaron D. Smith” (MSUC). PARATYPES (54 specimens) [all bearing the label
“PARATYPE /Ardamimicus / cognatoi / Aaron D. Smith” on yellow paper]: 15 (3-
MSUC; 4-ADSC; 3-BMNH; 4-CN1N) with same label data as holotype. 11 paratypes
(MRSC) labeled a) “Texas: Reeves Co. / Balmorhea Lake, Co.Rd.319 / Found under
hillside rocks / 05-September-2005 / Coll. Marion R Smith H”. l paratype (ADSC)
labeled a) “USA: TX: Presidio Co. / Big Bend Ranch SP / 29°32'58.8"N 104°10'7.2"W/

05.D(.2005, ADSmith”. 1 paratype (F MNH) labeled a) “3mi. NE of Porvenir, / Presidio

4O

 

Co., TEX / D(:26:1946”; b) “F M Pale. Exp. / B—Pattersen—Se / J H Quinn Col.”. 1
paratype (UN SM) labeled a) “Presidio, Texas / J .W.Dollahite / Sept.1960 #1 /
Gutierrezia”; b) “60.25015”; c) “USNM”. 1 paratype (OSUC) labeled a) “Marfa / VII 12
Tex”; b) “JW Green / Collector”; c) “H. W. Wenzel / Collection”. 1 paratype labeled a)
“Ft. Davis / Jeff Davis Co., TEXAS / VII-2/3-1966, Tradeseantia / eeeielentalis, J .D.
Pinto & / G.E. Bertrnoed. Notes 8—664”. 2 paratypes (UN SM) labeled a) “Midland / Tex
XI-12-14”; b) “Bishopp /No 3978”; c) “USNM” 1 paratype (F MNH) labeled exactly as
other F MNH paratype except collection date “X:27: 1946”. 1 paratype (UMMZ) labeled
a) “70 Texas / Ft. Davis 7-29 1914 / C. Thompson”; b) “UMMZ”. 1 paratype (TAMU)
labeled a) “Alpine, Tex. / VIII-10-1961 / H.RBurke”; b) “Texas A&M College /
Collection”; c) “Morphology drawing / Genus A 6 / date XI-2 K. Brown”. 2 paratypes
(TTUZ) labeled a) “10 mi. E / Fort Stockton, Tx. / Pecos Co. / lS-IX-1978”; b) “J. K.
Wangberg / Coll. 046-01”. 1 paratype (KSUC) labeled a) “TEXAS, Howard Co / 28 XII
58 / R.L. Hayes”. 4 paratypes (KWBC) labeled a) “TEX: Howard Co. 4mi. / S. Big
Spring, Hwy87 / X-14-1971 C. / O’Brien & Marshall”; b) ex. collection / Charles W.
O’Brien / 1972 by exchange”; c) green paper circle denoting the KWBC. 2 paratypes
(KWBC) labeled a) “TEX: Howard Co., / 4 mi. S. Big Spring / on Hwy. 33 III-25-1973”;
b) “C.W. & L.B. O’Brien / under stones”; c) green paper circle denoting the KWBC. 2
paratypes (KWBC) labeled a) “TEX. Howard Co. 10 / mi. S. Big Spring / Hwy 33 X-14-
1971 C. / O’Brien & Marshall”; b) ex. collection / Charles W. O’Brien / 1972 by
exchange”; c) green paper circle denoting the KWBC. 5 paratypes (KWBC) labeled a)
“TEX: Howard Co.,/ 10 mi. S. Big Spring / on Hwy. 33 III-25-1973”; b) “C.W.

O’Brien, dead / under stones & dung”; c) green paper circle denoting the KWBC. 1

41

paratype (CASC) labeled a) “MEX. Dgo. / 20 mi. S. of / Rodeo / 2l-VIII-60”; b) P. H.
Arnaud, Jr. /E. S. Ross / D. C. Rentz”; c) “Calif. Acad. Sci. / Collection”; d)
“Morphology drawing / Genus A 6 / date XI-2 K. Brown”; e) “102”. l paratype (UCDC)
labeled a) “6 mi S / Villa Matamoros / Chih. Mex. / VIII-8-1967”; b) R.C. Gardner / C.R.
Kovacic / K. Lorenzen”.

Additional material examined. 72 specimens (ADSC) with same locality data as

holotype were excluded from the type material due to missing legs, antennae, etc.

Description (female, see fig. 1.5). Length: 9.8-12.8 mm, width: 5.3-7.7 mm (holotype
length: 11.9mm, width: 7.0mm). Body ovate, black, generally coated in debris. Head:
Frons tuberculate, tubercules small or nearly eroded with each bearing a single scale;
median depression faintly or not impressed; frontoclypea] suture broadly impressed;
epistoma punctate, lateral margin notched; dorsal sulcus present above apices of eyes;
maxillary palps setose, apical segment expanded, triangular to slightly scalene; mentum
densely foveate with erect spiniform setae at anterior apicies and whitish-yellow scales at
base extending onto submentum; antennae black to ferruginous, clothed in erect brown
spiniform setae; antennal segment 3 1.2-1.3X longer than segment 4, antennal segment 9
asymetrical, outer margin wider than inner. Prothorax: Pronotal margin costate, broadly
actuate, widest near middle; marginal costa partially eroded in most specimens, visible as
line of setiferous tubercules; pronotal disc densely tuberculate, circularly impressed
around tubercles in basal half, with a single decurnbent yellowish-white scale arising
from the apex or side of each tubercle; hypomeron deeply punctate with setiferous

tubercles; prostemum punctate and setose; prostemal process with scattered tubercles,

42

depressed between coxae, truncate at base. Pterothorax: Scutellum small, partially
covered by elytra; elytra clothed with decumbent lanceolate scales arising from tubercles
or not; discal costae generally present on basal fourth of elytra, otherwise reduced to
irregular anastomizing ridges and protuberences bearing setiferous tubercles; marginal
elytra] costa present as slightly raised dense line of tubercles. Elytral humera obsolete.
Legs: Tarsi venter with stout spiniform setae; protarsal segments 2-4 compact, width
greater than length.

Distribution. Same as generic distribution.

Sexual dimorphism. Males generally smaller, length: 8.3-10.7mm, width: 4.3-6.2mm;
apical segment of maxillary palps strongly scalene.

Etymology. The species is named in honor of Anthony 1. Cognato for supporting the
study of Coleoptera in general and this research specifically.

Biology. Specimens have been collected from underneath rocks and plant debris.

Craniotus LeConte 1851

Type species: Craniotus pubescens LeConte 1851: 142, by monotypy.

Redescription (see fig. 1.6). Length: 8.3-11.2mm, width: 4.0-5.9mm; integument black;
body obovate; head retractable to hind margin of eye; elytra wider than pronotum and 3-
3.5X longer. Head: Densely punctate and setose, punctures occasionally subtended by
minute marginal tubercles; frontoclypeal suture obscured, slightly impressed. Mentum

cordiform, not reaching postgena or mandibles, anterior margin broadly emarginate.

43

Ligula sclerotized, visible above mentum emargination; width approximately one-third
that of mentum, length 3X width; medially depressed at apex. Apical segment of
maxillary palps rectiform in females, enlarged and scalene in males. Submentum apex
raised, approximately three-fifths as wide as buccal cavity, exposing maxillary cardos
laterally. Postgenal processes not or slightly produced. Anterior labral margin straight,
setal brush not medially interrupted; media] tormal process shorter than posterior tormal
process; clypeal membrane concealed. Clypeal margin straight or broadly emarginate.
Epistoma laterally expanded, slightly reflexed, and acute; apicies impunctate and
glaberous, with a shallow, elongate, setose depression posteriorly. Eyes broadly oval,
slightly tapering towards vertex. Antenna weakly clavate, nearly filiforrn, reaching base
of pronotum; antennal segment 3 longer than segments 4 and 5 combined, length more
than 5X width; antennal segment 10 rounded, length ~ 1.5X width, tomentose sensilla
forming an indistinct band around the apex; antennal segment llconical and deeply
amplected into segment 10, tapering to apex, tomentose sensillum present on apical half.
Prothorax: Pronotum convex and tumid, setation and punctation variable; lateral costa
absent or represented as an acute, divergent, tooth on anterior margin; posterior pronotal
margin convex. Prostemal process slightly, laterally, expanded over procoxa, declivous
behind. Pterothorax: Apterous. Scutellum triangular, obliquely raised from scutum;
mesonotum with two deep rounded tomentose depressions. Elytra convex, setation and
punctation variable; elytra] humera obsolete; epipleura indistinct. Metendosternite stem
approximately as twice wide as tall. Legs: Color black to ferruginous; tarsal formula 5-5-
4; coxae globular; mesocoxal cavities closed by sternites, mesotrocantin minute and

concealed; protibia with outer apical margin unarmed or occasionally forming a small

distinct spine, inner apical margin with two subequal spurs. Abdomen: Setose; intercoxal
process straight or broadly rounded apically. Female apical coxites ventrally rounded; 10
or more spermathecal branches present, emerging from apex of common duct; accessory
gland long, with an enlarged chamber medially.

Diagnosis. Craniotus is distinguished from all other asidine genera by a unique
combination of the following characters: epistoma acutely laterally produced,
mesotrocantin minute and concealed; antenna] segment 11 conical, tapering to apex,
tomentose sensilla on antennal segment 10 coalesced into a complete apical band.

Distribution. Mexico: Baja California Norte. USA: Arizona, California, Nevada,

Craniotus Species Checklist
Craniotus blaisdelli Tanner 1963:169. Type: BYUC

Craniotus pubescens LeConte 1851:142. Type: MCZ

Ferveoventer Smith, New Genus

Type species: F erveoventer browni Smith, n. sp.

Description (see fig. 1.7). Length: 7.9-12.0 mm, width: 4.1-6.7 mm; integument black to
ferruginous; body obovate; head retractable into pronotum to epistoma; elytra wider than
pronotum and 1.7-2.7 times longer. Head: Mentlun sub-trapazoidal, not reaching
postgena or mandibles, anterior margin slightly medially emarginate. Ligula sclerotized

small, less than one-fourth mentum width, slightly curved and partially visible above

45

 

mentum emargination. Apical segment of maxillary palps enlarged, securiform to
triangular. Submentum barely projecting, approximately four-fifths width of buccal
cavity, partially exposing maxillary cardos laterally. Postgenal processes slightly
produced, acute or rounded. Labrum broadly shallowly emarginate; clypeal membrane
exposed. Clypeal margin straight or slightly emarginate. Eyes broadly ova] not
emarginate. Antenna weakly clavate; nearly moniliform; segments 9-11 flattened,
forming a club; antennal segment 9 with two minute tomentose sensilla present at lateral
apices; antennal segment 10 subquadrate with two tomentose sensilla present at lateral
apices; antenna] segment 11 nearly as large as segment 10, with a broad apical tomentose
sensillum. Prothorax: Pronotum lacking median costa and fossae; lateral costae present,
anterior margins acute or broadly rounded, basal margins obtuse; posterior pronotal
margin convex. Prostemal process declivous behind procoxae. Pterothorax: Apterous.
Scutellum triangular, not raised above scutum; mesonotum lacking tomentose
depressions. Elytra broadly convex or planate, without discal costae; marginal costa
present or absent. Epipleura indistinct. Legs: Black to ferruginous, tarsal formula 5-5-4;
coxae globular; mesotrocantin large, clearly visible; protibia with outer apical margin
flared or not, rarely forming a small spine, inner apical margin with two short sub-equal
spurs, length one-third or less basitarsa] length. Abdomen: Punctate and setose,
abdominal ventrite 1 medially clothed with hemispherical inflated reddish-orange setae;
apex of intercoxal process broadly rounded.

Diagnosis. F erveoventer is distinguished from all other asidine genera by a unique
combination of the following characters: inflated, hemispherical reddish-orange setae

present on abdominal ventrite 1; minute tomentose sensilla generally present on lateral

46

apicies of antenna] segment 9; ligula small and partially concealed; discal elytra] costae
absent; protibia lacking distinct apical spine.

Distribution. Mexico: Morelos (Cuemavaca). United States: Texas (Culberson,
Presidio, and Val Verde counties), New Mexico (Eddy county).

Etymology. The name F erveoventer is derived from the Greek words “ferveo meaning
boil, and “venter”, meaning abdomen, in reference to the inflated, hemispherical reddish-

orange setae present on abdominal ventrite 1. It is in the masculine form.

Key to Species of F erveoventer
1 Pronotum tuberculate; elytra] marginal costa present; Morelos, Mexico ..................
............................................................ E planatus (Champion), new combination
- Pronotum without tubercules; elytra] marginal costa absent; New Mexico and

Texas, USA ......................................................................... 1". browni Smith, n. sp.

Species Descriptions

F erveoventer browni Smith, New Species

Type Material (see fig. 1.7). HOLOTYPE (sex undetermined) labeled: a) “TEXAS.
Langtry, / Val Verde Co., / III-l9-1960”; b) “W.J. Gertsch & / R. Schrammel /
Collectors”; c) on red paper, “HOLOTYPE / Ferveoventer / kirbyi / Aaron D. Smith”
(AMNH). PARATYPES (3 specimens) [all bearing the label “PARATYPE/

F erveoventer / kirbyi / Aaron D. Smith” on yellow paper]: 1 paratype (AMNH) labeled

a) “White’s City, / Eddy Co., N.M. / 3600 ft. / Sept. 24, 1950”; b) “M.Cazier / W.Gertsch

47

/ Collectors”. 1 paratype (NMNH) labeled a) “Culberson Co / D(.l6 Tex.”; b)
“GeoMGreene / collection”. 1 paratype (KWBC) labeled a) “TEX. 4mi. / SW. Shafter/
Presidio Co. / IV-19-1970 / [printed along right side] 2600’ ”; b) “Collector: L& / C.W.
O’Brien”; c) ex. collection / Charles W. O’Brien / 1972 by exchange”; (1) green paper

circle denoting the KWBC. 1 paratype (ZMHB) labeled a) “Mexico / J .Flohr G.”

Description. Length: 9.4-12.0 mm, width: 5.6-7.3 mm (holotype length: 9.4 mm, width:
5.6 mm). Body ovate, black, generally coated in debris. Head: Densely punctate,
punctures subtended by stout, erect, pale setae; median depression absent; frontoclypeal
suture weakly impressed; dorsal sulcus present above apices of eyes; genal suture thin,
extending to base of mandibles; postgenal processes produced and acute; maxillary palps
setose, apical segment expanded, securiform in females to triangular in males, distal
angle prolonged and acute; mentum punctate with erect pale spiniform setae, slightly
medially emarginate at apex; antennae ferruginous, clothed in erect pale spiniform setae;
antenna] segment 3 1.7-1.8X longer than segment 4, antennal segments 9-11 nearly equal
in size. Prothorax: Pronotum sinuate, widest just behind middle; marginal costa
crenulate, straight or slightly reflexed, anterior apicies acute and projecting, posterior
apicies broadly rounded, not projecting; pronotal disc densely punctate, punctures
subtended by stout, erect, pale setae; posterior margin convex. Hypomeron and
prostemum densely punctate, with longer decurnbent setae. Pterothorax: Scutellum
small, partially covered by elytra; elytra] disc nearly planate with scattered punctures,
erect spiniform setae, and faintly coalesced patches of erect squamate setae; marginal

carina absent, margins and apical third of elytra with yellowish or clear setae arising fiom

48

minute tubercles. Legs: Color ferruginous; tarsi venter with stout spiniform setae;
protarsal segments 2-4 compact, width greater than length.

Diagnosis. Separated fiom F. planatus by the larger size, lack of pronotal tubercles,
absence of a marginal elytra] costa, and distribution.

Distribution. Texas: Culberson, Presidio, and Val Verde counties; New Mexico: Eddy
County.

Etymology. The species is named in honor of Kirby W. Brown for his work on the
Asidini and the guidance he has provided to the next generation of tenebrionid workers.

Biology. Unknown.

F erveoventer planatus (Champion), New Combination

Ologlyptus planatus Champion 1884:69

Stenosides planatus (Champion). Wilke 1922:268

Type Material. LECTOTYPE (sex undetermined, BMNH), designated here, labeled: a)
[orange bordered white circle] “Type”; b) “CUERN / AVACA”; c) “Ologlyptus /
planatus, Champ”; d) “Sp. figured”; e)“B.C.ACol.IV.1./ Ologlyptus / planatus.”. One
PARALECTOTYPE (BMNI-I) labeled as lectotype, except lacking “sp. figured” label
and bearing the label “PARALECTOTYPE / Ologlyptus / planatus Champion / Aaron D.

Smith” on yellow paper].

Desription (see fig. 1.8). Length: 7.9-9.0 mm, width: 4.1-5.5 mm (holotype length: 9.0

mm, width: 5.5 mm). Body ovate, black. Head: Densely punctate, punctures subtended

49

by decurnbent, brown setae; median depression faintly impressed; fiontoclypeal suture
impressed; dorsal sulcus present above apices of eyes; genal suture thin, extending to
base of mandibles; maxillary palps setose, apical segment expanded, securiform in
females to triangular in males; postgena] processes produced and rounded; mentum
punctate with erect brownish spiniform setae, medially notched at apex; antennae
ferruginous, clothed in erect brownish spiniform setae; antennal segment 3 slightly longer
than segment 4, antennal segments 9-11 nearly equal in size. Prothorax: Pronotum
sinuate, widest at middle; marginal costa crenulate, nearly absent in apical third, straight,
anterior apicies barely projecting and broadly rounded, posterior apicies broadly rounded,
not projecting; pronotal disc densely punctate, punctures subtended by tubercles bearing
stout, erect, brownish setae; posterior margin slightly convex. Hypomeron and
prostemum densely foveate with brownish hair-like setae. Pterothorax: Scutellum small,
partially covered by elytra; elytra] disc slightly convex with scattered punctures and small
setae bearing tubercles; setae erect, spiniform or squamate; marginal carina present and
tuberculate. Legs: Color ferruginous; outer apical protibial margin not flared or forming a
spine; tarsi venter with stout black spiniform setae; protarsal segments 2-4 compact,
width greater than length.

Diagnosis. See F. browni diagnosis.

Distribution. Known only from the vicinity of Cuemavaca in the Mexican state of
Morelos.

Biology. Unknown.

50

Heterasida Casey

Heterasida Casey 1912: 165. Type species: Heterasida bifirrca (LeConte), 1861, by

original designation.

Redescription (see fig. 1.9). 7.6-16.6mm long, 3.3-8.0 wide. Integument black to
ferruginous. Head: Mentum cordiform, not reaching post-genal processes or mandibles;
anterior margin medially emarginate. Ligula large, approximately one-fourth mentum
width, broadly curved and raised above apical margin of mentum. Apical segment of
maxillary palps iso-triangular to slightly scalene. Submentum narrow and raised, laterally
exposing maxillary cardos. Postgenal processes produced and acute. Labrum with apical
margin broadly emarginate; medial tormal process equal to posterior tormal process;
clypeal membrane exposed. Clypeal margin straight. Frons densely foveate, each fovea
bearing a single seta; median depression deep or faintly impressed; fi'ontoclypeal suture
obscurred; dorsal sulcus present above apices of eyes; Supraorbital costae present from
apices of eyes to gena. Eyes elongate, broadly oval to slightly reniform. Antenna weakly
clavate, nearly filiform, extending past pronotal base in males; antennal segment 10
subquadrate, with tomentose sensilla forming a complete band around the apex; antennal
segment 11 with a broad apical tomentose sensory patch, deeply amplected into segment
10. Prothorax: Pronotum tumid, medially longitudinally impressed, and foveate, anterior
margin of each fovea bearing a single decurnbent seta; lateral costae present, anterior
margins acute and projecting, basal margins acute or projecting; posterior margin

medially convex. Prostemal process broad, declivous behind procoxae. Pterothorax:

51

Apterous. Scutellum triangular, obliquely raised at 45° from scutum; mesonotum with
two rounded setae lined depressions. Elytra broadly convex, sparsely foveate, clothed in
short decumbent lanceolate setae. Marginal costa present, divided in basal half of elytron;
inner branch carinate, curved towards midline, abruptly ending in apical fourth of elytron.
Disca] costae absent. Epipleura thin and slightly raised. Mesostemum basally nearly flat,
then sharply raised at base of mesocoxal cavities. Metendosternite stem approximately as
twice wide as tall. Legs: Black to ferruginous; coxae globular; mesotrocantin clearly
visible; femura rugose-punctate, setose; tibia shallowly nearly confluently foveolate,
setose; protibia with indistinct row of erect golden-brown spiniform setae along inner
margin from base to apex, outer apical margin slightly flaired, but lacking a distinct
spine, two inner apical spurs present, subequal. Abdomen: Densely punctate setose;
intercoxal process broader than mesostemal apex, anterior margin nearly straight. Female
apical coxites ventrally rounded; two long thin spermathecal branches present, emerging
from apex of common duct.

Diagnosis. Heterasida species are easily distinguished from members of all other asidine
genera by a unique combination of the following characters: Antennae long, nearly
reaching pronotal base in females and extending past pronotal base in males; antenna]
segment 10 with a complete apical tomentose sensilla band, antenna] segment 11 deeply
amplected into apex of segment 10; mentum cordiform, not contacting postgena; ligula
approximately one-forth width of mentum, raised above anterior margin of mentum;
pronotum with a median longitudinal depression; elytra] marginal costae present and

divided; discal elytra] costae absent.

52

Distribution. Heterasida species are restricted to the Cape Region of Baja California Sur
from sea level to approximately 500 meters elevation. A single specimen of H. connivens
has also been collected from Isla Cerralvo, an island approximately 17 km off the coast
from La Paz.

Sexual dimorphism. Males smaller, rarely as large as conspecific females, some only
half the size of females; antenna longer, extending past pronotal base. Other differences
follow general sexual characteristics as previously described for the tribe.

Discussion. Heterasida subvittata (Horn, 1894:416) was hesitantly placed within the
genus by Casey (1912), though he stated that it most likely represented a new genus. The
species was sister to Stethasida obsoleta (LeConte) in both phylogenetic analyses and
morphologically falls well within the expanded genus Stenomopha sensu Iato redescribed

herein.

Key to Species of Heterasida

l Elytra with decumbent lanceolate setae and erect spiniform setae; pronotal
posterior lateral margins always prolonged, acute and reflexed; dorsum generally
evenly coated with debris .................................................. H. connivens (LeConte)

- Elytra with decurnbent lanceolate setae only; pronotal posterior lateral margins
angulate, rarely prolonged; dorsum not or incidentally coated with debris ...............

................................................................................................ H. bifurca (LeConte)

53

Heterasida bt/‘urca (LeConte)

Pelecyphorus bifirrcus LeConte, 1861: 337. Holotype female, designated here by
monotypy, labeled “P. bifurcus/ LeC./ S. Lucas”, “Type/ 4533” (MCZ)

Heterasida bifitrca (LeConte); Casey 1912: 166

Diagnosis (see fig. 1.9). H. bifilrca specimens are easily differentiated from specimens of
H. connivens by their lack of erect spiniform setae on the elytra, less prolonged and

reflexed pronotal posterior margins, and cleaner dorsal surface.

Heterasida connivens (LeConte), Raised from Synonymy

Pelecyphorus connivens LeConte 1866:110
Heterasida connivens (LeConte). Casey 1912:166
=Heterasida exilis Casey 1912:168, New Synonym

=Heterasida tantilla Casey 1912:167, New Synonym

Diagnosis (see fig. 1.10). See differences listed under H. bifilrca.

Discussion. H. connivens and H. tantilla were synonymized under H. bifitrca by Blaisdell
(1943) without explanation. H. tantilla and Heterasida exilis were both described by
Casey (1912) fi'om single specimens, both of which are small male specimens of H.

connivens.

54

Litasida Casey

Litasida Casey, 1912: 184. Type species: Litasida townsendi Casey, 1912: 185, by

original designation. Holotype, by monotypy, male labeled: “Mex” (NMNH).

Redescription (see fig. 1.11). Length: 10.0-14.0 mm, width: 5.3-7.5 mm; integument
black; body obovate; elytra barely wider than pronotum and 2.5-2.6 times longer. Head:
Mentum small and cordate, not reaching postgena or mandibles, anterior margin broadly
shallowly emarginate. Ligula sclerotized tumid and thick, width approximately 2.5X
length, width approximately one-fourth that of mentum, sharply depressed medially and
exposed above anterior margin of mentum. Apical segment of maxillary palps enlarged
and triangular, larger in males. Submentlrm projecting and approximately two-thirds
width of buccal cavity, exposing maxillary cardos laterally, apex nearly straight.
Postgenal processes barely produced and rounded. Labra] margin medially emarginate,
setal brush present on rounded apicies; labral medial tormal process shorter than posterior
tormal process; clypeal membrane concealed. Clypeal margin straight or slightly
emarginate. Eyes elongate and reniform, posterior margin straight. Antenna long,
extending approximately to base of pronotum, longer in males, weakly clavate and
laterally flattened; antennal segment 10 subquadrate with two tomentose sensilla at lateral
apices, nearly meeting on outer side in some speciemns; antennal segment 11
approximately one-half size of segment 10, apical tomentose sensilla covering nearly
one-fourth of segment. Prothorax: Pronotum laterally arcuate, widest in basal half,

narrowing towards apex; pronotal margin costate and reflexed, anterior apicies slightly

55

produced and rounded, basal apicies acute and projecting over elytra] humera, posterior
margin straight or slightly convex. Prostemal process raised and projecting behind
procoxal cavities, apex broadly rounded and received in emargination between
mesocoxae. Pterothorax: Apterous. Scutellum triangular, broader than wide, sharply
raised above scutum; mesonotum with continuous depressed tomentose hand between
scutellum and scutum. Elytra convex, lacking discal costae; epipleura distinct over entire
length, epiplural fold forming a marginal costa and reflexed at elytra] humera.
Metendosternite stem approximately as twice wide as tall. Legs: Ferruginous to nearly
black, tarsal formula 5-5-4; pro- and mesocoxae globular, metacoxae transverse;
mesocoxal cavities open, mesotrocantin large, exposed; femora and tibia laterally
flattened; protibia with outer apical margin slightly flaired, but not forming a distinct
spine; inner apical margin of protibia with two spurs, posterior spur shorter than anterior
spur, anterior spur approximately one-half length of basitarsi; tarsi venter with two lateral
rows of stout spiniform setae, medially glabrous. Abdomen: Intercoxa] process
triangular, narrowing to rounded apex. Female apical coxites ventrally flattened; three to
nine spermathecal branches present, emerging from apex of common duct, common duct
with short rounded protrusion opposite accessory gland; accessory gland long, enlarged
media] chamber present.

Diagnosis. Litasida is distinguished from all other asidine genera by a unique
combination of the following characters: Epiplura widening towards base, epiplural fold
forming a marginal costa; prostemal process strongly raised and produced behind
procoxa; mentum small, cordate, exposing maxillary cardos; antenna long and slender;

posterior pronotal apicies projecting over elytra.

56

 

Distribution. Mexico: Chihuahua; United States: southeastern Arizona.
Discussion. Litasida is currently a monotypic genus, represent by the high elevation
(6000 ft. +) species L. townsendi.

Etymology. Litasida is in the feminine form.

Micrasida Smith, New Genus

Type species: Micrasida obrienorum Smith, n. sp.

Description (see fig. 1.12). Length: 5.1-6.5 mm, width: 3.0-3.8 mm; integument
ferruginous to nearly black; body obovate; elytra barely wider than pronotmn and 2.0-2.7
times longer. Head: Mentum sub-trapazoidal, contacting postgena but not reaching
mandibles. Ligula sclerotized small, less than one-fifth mentum width, slightly curved
and exposed above anterior margin of mentum. Apical segment of maxillary palps
enlarged and securiform. Submentum barely projecting, approximately four-fifths width
of buccal cavity, partially exposing maxillary cardos laterally. Postgenal processes
produced and rounded. Labral margin straight, medial tonnal process shorter than
posterior tormal process; clypeal membrane concealed. Clypeal margin straight or
slightly emarginate. Eyes small, diameter approximately 0.2 mm, and round. Antenna
weakly clavate; nearly moniliform; segments 10-11 flattened, forming a club; antennal
segment 10 with two tomentose sensilla present at lateral apices; antennal segment 11
approximately two-thirds as large as segment 10, apical tomentose sensilla small,

covering less than one-fourth of segment. Prothorax: Pronotum convex, lacking median

57

costa and fossae; anterior margins slightly produced and rounded, basal margins oblique;
marginal costa absent; posterior pronotal margin convex. Prostemal process thin, one-half
width of procoxa] cavity, declivous and slightly expanded behind procoxae.
Pterothorax: Apterous. Scutellum triangular, not raised above scutum; mesonotum
lacking tomentose depressions. Elytra broadly convex, without discal or marginal costae;
epipleura indistinct. Metendosternite stem approximately as twice wide as tall. Legs:
Ferruginous to nearly black, tarsal formula 5-5-4; coxae globular; mesocoxal cavities
open; mesotrocantin minute, concealed; protibia with outer apical margin forming a large
glabrous spine, longer than protibia] width; protibial outer lateral margin carinate and
serrated; inner apical margin of protibia with two spurs, posterior spur greatly reduced,
less than 1/ 8 length of anterior spur, anterior spur longer than basitarsi, curved and acute;
outer apical margins of meso- and metatibia each armed with a small, shorter than tibial
width, setose spine. Abdomen: abdominal ventrite 4 reduced, medially approximately
two-fifths length of ventrite 3, and strongly curved; apex of intercoxal process broadly
rounded. Female apical coxites ventrally flattened; three spermathecal branches present,
emerging fiom apex of common duct; accessory gland long, enlarged medial chamber
absent.

Diagnosis. Micrasida is distinguished from all other asidine genera by a unique
combination of the following characters: Pronotum lacking marginal costa; eyes small
and nearly round; protibial outer lateral margin carinate and serrated; posterior protibial
spur greatly reduced, less than 1/8 length of anterior spur; length less than 6.5 mm

Distribution. Mexico: Nuevo Leon.

58

Etymology. The name Micrasida is derived from the Greek word “micro meaning
small, and the name of the type genus for the tribe. The name refers to the extremely

small size of the specimens and is in the feminine form.

Species Description

Micrasida obrienorum Smith, n. sp.

Type Material. HOLOTYPE (female) labeled: a) “Mex. N.L. 3 mi. / E. Jcn. 57 & 60 /
VI-23-1971 / L. & C.W. O’Brien”; b) on red paper, “HOLOTYPE / Micrasida/
obrienorum 9 /Aaron D. Smith” (TTUZ). PARATYPES (228 specimens) [all bearing
the label “PARATYPE / Micrasida / obrienorum / Aaron D. Smith” on yellow paper]:
221 paratype (IO-OSUC; 5-RLAC; AWH) bearing the same locality data as the
holotype. 4 paratypes (CASC) labeled a) “MEX: Nuevo Leon / 6mi. E.Est.Roberto / V-
27-1981 J.Doyen”;. 3 paratypes (CASC) labeled a) “MEX:Nuevo Leon / Rte. 58 6.4

mi..E / Est. San Roberto / 26-27 May 1981 / J .K. Liebherr / El. 6500 11.”.

Description (see fig. 1.12). Length: 5.1-6.5 mm, width: 3.0-3.8 mm (holotype length: 6.4
mm, width: 3.5 mm); often coated in debris. Head: Hypognathous; clothed in
decurnbent, elongate, squamiform setae, most arising fiom the side or apex of small
tubercles; frons without median depression; frontoclypeal suture weakly impressed at
sides; epistoma laterally nearly straight; dorsal sulcus absent or thin above apices of eyes;
setal brush on labral margin complete or exposing a small space medially; genal suture

not indicated; postgena] processes produced and rounded; apical segment of maxillary

59

palp expanded, securiform in both sexes, slightly larger in males; mentum punctate with
long yellowish setae, not or slightly medially emarginate at apex; submentum deeply
emarginate at apex; antennae ferruginous, sparsely clothed in erect yellowish, nearly
transparent spiniform setae; antennal segment 3 equal to 1.2X longer than segment 4,
antennal club two segmented, segment 9 equal in size to segment 8. Prothorax: Lateral
margins arctuate, widest at middle; disc tuberculate, tubercles minute, increasing in size
towards margins; decurnbent, elongate, squamate or lanceolate setae arising fi'om
tubercles, becoming erect and lanceolate at lateral margins. Hypomeron and prostemum
with setose tubercles similar to pronotal disc, except prostemal setae longer and hair-like.
Pterothorax: Scutellum small, partially covered by elytra; elytra] humera oblique, not
reflexed; elytra evenly coated in decurnbent, elongate, squamiform setae arising from
minute tubercles; elytra gradually declivous in apical third, tapering to caudally. Legs:
Color ferruginous; femora and tibia foveate and setose, lacking socketed spiniform setae;
tarsi venter with sparse pale spiniform setae; protarsal segments combined approximately
two-thirds length of protibia. Abdomen: irnpunctate, clothed in pale-yellowish hair-like
setae, most arising fi'om minute tubercles.

Diagnosis. See generic diagnosis.

Distribution. Mexico: Nuevo Leon.

Etymology. The species is named in honor of Charles and Lois O’Brien for collecting the
vast majority of the type series and for their contributions to the study of Coleoptera.

Biology. Unknown.

60

Microschatia Solier

Alicroschatia Solier, 1836: 474. Type species: Microschatia punctata Solier 1836: 475,
by monotypy.
=Pycnonotida Casey, 1912: 89. Synonymized in Doyen and Brown 1991: 546.

=Acroschatia Wilke, 1922: 269. Synonymized in Doyen and Brown 1991: 546.

Redescription (see fig. 1.13); [modified fi'om Brown and Doyen 1991]. Length: 10.7-
19.7 mm, width: 5.5-12.0 mm; integument black; body obovate; elytra barely wider than
pronotum. Head: Mentum large, completely filling buccal cavity, sub-trapezoidal;
anterior margin broadly emarginate, with or without a narrow median notch; lateral
margins curved inward at apicies. Ligula small, approximately one-fouth mentum width,
curved and partially visible above anterior margin of mentum. Apical segment of
mEmillary palps enlarged, isotriangular or slightly scalene, larger in males. Submentum
broad, laterally contacting or nearly postgena, concealing maxillary cardos, apex broadly
emar‘ginate. Postgenal processes produced and rounded. Labral margin narrowly notched,
broadly emarginate, or straight; medially without setal brush; labral medial tormal
pro<>ess shorter than posterior tormal process; clypeal membrane concealed. Clypeal
mal‘gin straight or emarginate. Epistoma with anterior border arcuately emarginate. Eyes
e1Otrgate, oval or weakly reniform, concealed when head is retracted. Antenna compact,
Weakly clavate and laterally flattened; antennal segment 10 subquadrate with two
t‘OInentose sensilla at lateral apices; antennal segment 11 approximately one-fourth size of

and amplected into segment 10 ; apical tomentose sensilla on antennal segment 11 small,

61

asymmetrical or not. Prothorax: Pronotum laterally arcuate, widest in basal half and
narrowing towards apex or widest near middle; pronotal margin costate and not reflexed,
anterior apicies slightly produced and rounded, posterior apicies obtuse or acute,
projecting over elytra] humera or not, posterior margin convex to bisinuate or biangulate,
occasionally with paramedian basal gibbosities. Prostemal process raised and projecting
behind procoxal cavities, apex subtruncate to sagittate and received in shallow or
moderate emargination between mesocoxae. Pterothorax: Apterous. Scutellum
triangular, 1.5-2.0 times as wide as long, sharply raised above scutum; mesonotum with
continuous depressed tomentose band between scutellum and scutum. Elytra] sculpturing
variable; epipleura widening towards base and distinct over entire length, epiplural fold
forming a marginal costa or not. Metendosternite stem approximately as twice wide as
tall. Legs: Ferruginous to nearly black, tarsal formula 5-5-4; pro- and mesocoxae
globular, metacoxae more transverse; mesocoxal cavities open, mesotrocantin large,
exposed; femora and tibia laterally flattened; protibia with outer apical margin forming a
distinct spatulate process or spine; inner apical margin of protibia with two spurs,
posterior spur subequal or shorter than anterior spur; tarsi venter with two lateral rows of
stout spiniform setae, medially glabrous. Abdomen: Intercoxal process impressed around
margin, rounded or truncate at apex. Female apical coxites ventrally flattened; three to
nine spermathecal branches present, emerging from apex of common duct, common duct
with short rounded protrusion opposite accessory gland; accessory gland long, enlarged

medial chamber present.

62

Dir

« an!
Div ~4-

h\an

D'rl

'li.

"a4 n:

"‘0‘”?

Diagnosis. Microschatia is distinguished from all other asidine genera by a unique
combination of the following characters: Epiplura widening towards base, epiplural fold
distinct over entire length; prostemal process strongly raised and produced behind
procoxa; mentum large, sub-trapezoidal and completely filling buccal cavity. Most easily
confused with the genus Litasida, but separated by the configuration of the mouthparts.
Distribution. Central and northern Mexico, including Baja California Norte, and the
adjacent US states (Arizona, California, New Mexico, and Texas).

Discussion. Microschatia was revised Brown and Doyen (1991).

Microschatia Species Checklist
Microschatia cedrosensis Brown and Doyen, 1991 :568
Microschatia costulata Brown and Doyen, 1991:570
Microschatia championi Horn, 1893 : 140
Microschatia inaequalis LeConte, 1 851 : 129
Microschatia morata Horn, 1878:56
Microschatia planata Doyen and Brown, 1991:576
Microschatia polita Horn, 1893:141
Microschatia punctata Solier, 1836:475
Microschatia rockefelleri Pallister, 1954: 1 5
Microschatia robusta Horn, 1893 : 142
Microschatia solieri Brown and Doyen, 1991:552

Microschatia sulcipennis LeConte, 1858: 1 8

63

Pelecyphorus Solier

Pelecyphorus Solier 1836:467. Type species: Pelecyphorus mexicanus Solier, 1836:469,

by subsequent designation, Casey 1912:105. Lectotype (MNHN).

subgenus Astrotus LeConte 1858:19. Type species: Microschatia contorta LeConte,

1853:446, by original designation. Revised Status.

subgenus Pelecyphorus Solier 1836:467. sensu stricto. '

subgenus Stenosides Solier 1836:484. Type species: Stenosides graciliformis Solier,
1836, by monotypy. Revised Status.

=Pactostoma LeConte 1858:19. Type species: Asida anastomosis Say, 1824, by
original designation.

=Ologlyptus Lacordaire 1859: 158 (unnecessary replacement name).

subgenus Ucalegon Champion 1884:65. Type species: Ucalegon pulchellus

Champion, 1884. Revised Status.

subgenus Pleisiasida Smith, (=Parasida Casey 1912: 126, junior homonym). Type

species: Parasida laciniata Casey, 1912. New Replacement Name.

subgenus Sicharbas Champion 1884:67. Type species: Sicharbas lobatus Champion,

1884. Revised Status.

subgenus Zaleucus Champion 1892:491. Type species: Zamolxis dilatatus Champion,

1884. Revised Status.

Redescription (see fig. 1.14). Length: 6.0-22.9 mm, width: 2.3-11.1 mm; integument
ferruginous to black; body obovate to elongate and nearly parallel sided; generally
densely setose, occasionally setae inconspicuous; setae often modified, lanceolate,
squamate, or stellate in shape. Head: Mentum variable, trapezoidal to broadly cordate;
contacting postgenal processes or not, if tightly contacting postgenal processes then also
reaching mandibles when closed; lateral margins straight or curved inward at apicies;
anterior margin straight to weakly emarginate, medially notched or not. Ligula;
sclerotized small, one-fourth to one-sixth mentum width, and thin, length approximately
5X width; slightly curved and partially visible above anterior margin of mentum or
straight and concealed. Apical segment of maxillary palps enlarged, securiform to scalene
in shape, more expanded in males. Submentum barely or distinctly projecting into buccal
cavity; width two-thirds to equal that of buccal cavity, concealing or partially exposing
maxillary cardos laterally. Postgena concealing mandibular protuberance; postgenal
processes slightly to greatly swollen; produced, extending to middle of mentum or
beyond, acute to broadly rounded. Labral margin straight or broadly emarginate, medially
without setal brush; medial tormal process of labrum shorter than posterior tormal

process; clypeal membrane concealed or rarely exposed. Clypeal margin straight or

65

emarginate. Eyes elongate, oval or reniform, partially concealed when head is retracted.
Antenna weakly clavate; nearly moniliform; segments 10-11 rounded or laterally
flattened , forming a slight club; tomentose sensilla absent on antennal segment 9; apical
tomentose sensilla present on antennal segment 10, separated into two patches at lateral
apices or coalesced into a single band; antennal segment 11 one-fourth to two-thirds size
of segment 10, apical tomentose sensillum covering one-sixth to one-half of segment.
Prothorax: Pronotal shape and sculpturing variable, with or without a median costa or
paramedial fossae, lacking paramedial basal gibbosities; pronotal margin costate,
medially acutely expanded or not; anterior apicies produced, acute or rounded, posterior
apicies obtuse or acute, projecting over elytra] humera or not; posterior margin straight,
slightly convex, or weakly bisinuate, often with a medial tooth projecting posterad.
Prostemal process thin, declivious behind procoxae or raised and projecting behind
procoxal cavities, apex truncate, broadly rounded, or sagittate; if raised then received in
shallow or moderate emargination between mesocoxae. Pterothorax: Apterous.
Scutellum triangular, visible or mostly concealed underneath elytra, not raised above
scutum; mesonotum with two faint or deep transverse depressions, often leaving a thin
medial ridge between the scutellum and scutum. Elytral sculpturing variable, discal
costae present or faintly indicated, marginal costae rarely lacking; epipleura indistinct.
Metendosternite stem approximately as twice wide as tall. Legs: Ferruginous to nearly
black, tarsal formula 5-5-4; pro- and mesocoxae globular, metacoxae more transverse;
mesocoxal cavities open or externally closed by sternites; mesotrocantin small to minute,
concealed or exposed; protibia with outer apical margin forming a spine; protibial outer

lateral margin not carinate; inner apical margin of protibia with two spurs, posterior spur

66

shorter than anterior spur. Abdomen: Intercoxal process impressed around margin or not,
rounded or truncate at apex. Female apical coxites ventrally flattened; three to twelve
spermathecal branches present, emerging fiom apex of common duct; accessory gland
short or long, with an enlarged chamber absent or rarely present near apex.

Diagnosis. Pelecyphorus is distinguished from all other asidine genera by a unique
combination of the following characters: Ligula small, one-fourth to one-sixth mentum
width, and thin, length approximately 5X width; partially visible above anterior margin of
mentum or straight and concealed. Scutellum not raised above scutum; mesonotum with
two faint or deep transverse depressions. Anterior protibial spur longer than posterior.
Distribution. Mexico: representatives are known from every state with the exceptions of
Chiapas, Yucatan, Tabasco, and Baja California Norte. United States: Arizona, Colorado,

Kansas, New Mexico, Texas.

Pelecyphorus Species Checklist
Pelecyphorus (Pelecyphorus) mexicanus Solier, 1836:469
Pelecyphorus (Ucalegon) pulchellus (Champion, 1884:65), NEW COMBINATION
Pelecyphorus (Zaleucus) dilatatus (Champion, 1884:70), NEW COMBINATION
Pelecyphorus (Zaleucus) platesthoides (Champion, 1884:71), NEW COMBINATION

Pelecyphorus (Sicharbas) lobatus (Champion, 1884:67), NEW COMBINATION

Pelecyphorus (Astrotus) alveolatus (Casey 1912:83), NEW COMBINATION
Pelecyphorus (Astrotus) contortus (LeConte, 1853:446), NEW COMBINATION
Pelecyphorus (Astrotus) debilis (Champion 1884:66), NEW COMBINATION

Pelecyphorus (Astrotus) erosus (Champion 1892:504), NEW COMBINATION

67

Pelecyphorus (Astrotus) fasciculatus (Champion, 1892:495), NEW COMBINATION
Pelecyphorus (Astrotus) guanajuatensis (Champion, 1884:56), NEW COMBINATION
Pelecyphorus (Astrotus) limosus (Champion, 1884:66), NEW COMBINATION
Pelecyphorus (Astrotus) nosodennoides Champion), 1892:505, NEW COMBINATION
Pelecyphorus (Astrotus) regularis (Horn, 1870:290), NEW COMBINATION
Pelecyphorus (Astrotus) seticomis (Champion, 1884:67), NEW COMBINATION

Pelecyphorus (Astrotus) undaIus (Champion, 1892:504), NEW CONIBINATION

Pelecyphorus (Plesiasida) asidoides Solier, 1836:471, NEW COMBINATION
Pelecyphorus (Plesiasida) bibasalis (Casey, 1912: 128), NEW COMBINATION
Pelecyphorus (Plesiasida) cristatus (Pallister 1954:24), NEW COMBINATION
Pelecyphorus (Plesiasida) esperanzae (W ilke, 1922:271), NEW COMBINATION
Pelecyphorus (Plesiasida) dissimilis (Champion, 1884:59), NEW COMBINATION
Pelecyphorus (Plesiasida)fallax (Champion, 1884:57), NEW COMBINATION
Pelecyphorus (Plesiasida)favosus (Champion, 1884:58), NEW COMBINATION
Pelecyphorus (Plesiasida) similatus (Champion, 1884:58), NEW COMBINATION
Pelecyphorus (Plesiasida) foveolatus Solier, 1836:472, NEW COMBINATION
Pelecyphorus (Plesiasida) indutus (Champion, 1884:56), NEW COMBINATION
Pelecyphorus (Plesiasida) laciniatus (Casey, 1912:128), NEW COMBINATION
Pelecyphorus (Plesiasida) Iaticollis (Champion, 1884:58), NEW COMBINATION
Pelecyphorus (Plesiasida) liratus (LeConte, 1854:223), NEW COMBINATION
Pelecyphorus (Plesiasida) longipennis (Champion, 1884:56), NEW COMBINATION

Pelecyphorus (Plesiasida) mixtecae (Wilke, 1922:271), NEW COMBINATION

68

Pelecyphorus (Plesiasida) obliviosus (W ilke, 1922:270), NEW CONIBINATION
Pelecyphorus (Plesiasida) purpusi (Wilke, 1922:271), NEW COMBINATION
Pelecyphorus (Plesiasida) planatulus (Casey, 1912: 129), NEW COMBINATION
Pelecyphorus (Plesiasida) scutellaris (Champion, 1884:57), NEW COMBINATION
Pelecyphorus (Plesiasida) sexcostatus LeConte, 1861:337, NEW COMBINATION
Pelecyphorus (Plesiasida) similata (Champion, 1884:58), NEW COIVIBINATION
Pelecyphorus (Plesiasida) spinimanus (Champion, 18922494), NEW COMBINATION
Pelecyphorus (Plesiasida) tenebrosus (Champion, 1892:495), NEW COMBINATION
Pelecyphorus (Plesiasida) tolucanus Casey, 1912:130), NEW COMBINATION
Pelecyphorus (Plesiasida) tristis (Champion, 1884:55), NEW COMBINATION
Pelecyphorus (Plesiasida) trisinuatus (Pallister, 1954:22), NEW COMBINATION

Pelecyphorus (Plesiasida) zacualpanicolus (W ilke, 1922:272), NEW COMBINATION

Pelecyphorus (Stenosides) anastomosis (Say, 1824:256), NEW COMBINATION
Pelecyphorus (Stenosides) bicarinatus (Champion, 1884:69), NEW COMBINATION
Pelecyphorus (Stenosides) bisinuatus (Pallister, 1954:13), NEW COMBINATION
Pelecyphorus (Stenosides) breviuscula (Casey, 1912:87), NEW COMBINATION
Pelecyphorus (Stenosides) canus (Champion, 1884:68), NEW COMBINATION
Pelecyphorus (Stenosides) exoleta (Casey, 1912:87), NEW COMBINATION
Pelecyphorus (Stenosides) gracilrformis (Solier, 1836:486), NEW COMBINATION
Pelecyphorus (Stenosides) hebes (Champion, 1892:506), NEW COMBINATION
Pelecyphorus (Stenosides) luteotecta (Casey, 1912:88), NEW COMBINATION

Pelecyphorus (Stenosides) kulzeri (Pallister, 1954: 12), NEW COMBINATION

69

Pelecyphorus (Stenosides) monticola (Casey, 1912:88), NEW COMBINATION
Pelecyphorus (Stenosides) obtecta (Casey, 1912:89), NEW COMBINATION
Pelecyphorus (Stenosides) planatus (Champion, 1884:69), NEW COMBINATION
Pelecyphorus (Stenosides) sigillata (Casey, 1912:89), NEW COMBINATION
Pelecyphorus (Stenosides) sinuaticollis (Champion, 1884:69), NEW COMBINATION

Pelecyphorus (Stenosides) texanus (W ickham, 1903:72), NEW COMBINATION

Philolithus Lacordaire

Philolithus Lacordaire 1858: 18; Lacordaire 1859:157. Type species: Pelecyphorus

carinatus LeConte, 1851:128, by subsequent designation, Casey 1912:105.

subgenus Glyptasida Casey, 1912:95. Type species: Pelecyphorus sordidus LeConte

1853:445, by original designation . Revised Status.

subgenus Gonasida Casey, 1912:117. Type species: Pelecyphorus elatus LeConte

1853:445, by original designation. Revised Status.

subgenus Herthasida Wilke, 1922:69. Type species: Asida ingens Champion

1892:503, by monotypy. Revised Status.

subgenus Philolithus Lacordaire, 1858:18, sensu stricto.

7O

subgenus Tisamenes Champion, 1884:64. Type species: T isamenes truquii Champion

1884:64, by monotypy. Revised Status.

Redescription (see fig. 1.15); [modified from Brown 1971b]. Length 10.8-35.0mm,
width 5.9-13.0. Integument black to ferruginous. Head: Nearly hypognathous. Mentum
transversely hexagonal to broadly cordate, not or barely contacting postgena, not
reaching mandibles, anterior margin medially notched. Ligula small, approximately one-
fifih mentum width, straight and concealed beneath apical margin of mentum. Apical
segment of maxillary palps enlarged and scalene, much larger in males with proximal
angle acute and prolonged. Submentum raised, apex straight, width less than four-fifths
buccal cavity width, laterally exposing maxillary cardos. Postgenal processes not or
slightly produced, rounded or acute. Labral margin broadly emarginate; medially without
setal brush; labral medial tormal process equal or shorter than posterior tormal process;
clypeal membrane exposed or concealed. Clypeal margin nearly straight or broadly
emarginate. F rons sculpturing variable; median depression absent or faintly impressed;
frontoclypeal suture obscured or faintly impressed; small dorsal sulcus present above
apices of eyes or lacking . Eyes elongate, broadly oval, not emarginate. Antenna weakly
clavate and laterally flattened; antennal segment 10 subquadrate with two tomentose
sensilla at lateral apices, outer sensillum usually divided in females; antennal segment 11
approximately one-half or less size of segment 10; apical tomentose sensilla on antennal
segment 11 small, asymmetrical or not. Prothorax: Pronotal shape and sculpturing
variable; pronotal margin costate, medially acutely expanded or not; anterior apicies

slightly produced and rounded, posterior apicies obtuse or acute, not projecting over

71

elytral humera, posterior margin straight to slightly bisinuate. Prostemal process broad,
laterally impressed between procoxa, declivous behind procoxae and often expanded at
base. Pterothorax: Apterous. Scutellum triangular, gradually raised above scutum;
mesonotum without tomentose depressions. Elytral sculpturing variable; marginal and
discal costa present or absent; glabrous or with simple setae, usually inconspicuous,
rarely long and forming a contrasting color pattern. Epipleura thin and indistinct.
Metendosternite stem approximately as twice wide as tall. Legs: Black to ferruginous;
F erruginous to nearly black, tarsal formula 5-5-4; procoxae large, length greater than
anterior prostemal length, pro- and mesocoxae globular, metacoxae more transverse;
mesocoxal cavities open, mesotrocantin large, exposed; protibial outer apical margin
flared, forming a small setose spine; inner apical margin of protibia with two subequal
spurs; tarsi venter with two lateral rows of stout spiniform setae, medially glabrous.
Abdomen: Intercoxal process impressed around margin, rounded or truncate at apex.
Female apical coxites ventrally rounded; ten or more spermathecal branches present,
serially arranged along one side of common duct to apex, largest near accessory gland
and decreasing in size to apex; accessory gland long, with an enlarged chamber medially.
Diagnosis. Philolithus species are distinguished from members of all other asidine
genera by a unique combination of the following characters: Mentum transversely
hexagonal to broadly cordate with a small median notch apically; ligula small and
concealed; postgenal process not or barely produced; eyes broadly oval and not
emarginate; head nearly hypognathous, prostemal process declivious behind procoxa;

apical maxillary palps large and scalene, much more expanded in males.

72

Distribution. Philolithus species occur from central Mexico to southern Canada, from
the west coast to western Kansas.

Discussion. The genera now reduced to subgeneric status under Philolithus (Glyptasida,
Gonasida, Herthasida, and T isamenes) are differentiated almost entirely by
homoplasious dorsal characters, particularly pronotal shape. Brown (1971b) noted that
the genera shared many derived characters between them; including a reduction of the
urogomphi in the larvae, which is so far unique within the tribe. Brown also noted that
many of the Philolithus species described by Casey are likely to be synonymized when

the genus is revised.

Philolithus Species Checklist
Philolithus (Philolithus) abscissus (Casey, 1912: 109)
Philolithus (Philolithus) aegrotus (LeConte, 1861 :337)
Philolithus (Philolithus) corporalz's (Casey, 1912:107)
Philolithus (Philolithus)fizmosus (Casey, 1912:109)
Philolithus (Philolithus) morbillosus (LeConte, 1858b:74)
Philolithus (Philolithus) parvus (Casey, 1912:110)
Philolithus (Philolithus) piceus (Casey, 1912:111)
Philolithus (Philolithus) reptans (Casey, 1912: 108)
Philolithus (Philolithus) snowi (Casey, 1912:108)
Philolithus (Philolithus) socer (Casey, 1912:108)
Philolithus (Philolithus) subtenuis (Casey, 1912:112)

Philolithus (Philolithus) carinatus (LeConte, 1851:128)

73

Philolithus (Philolithus) quadripennis (Casey, 19122113)

Philolithus (Philolithus) sophistes (Casey, 19122113)

Philolithus (Philolithus) actuosus (Horn, 1870:284)

Philolithus (Philolithus) adversus (Casey, 1912:114)

Philolithus (Philolithus) corrosus (Casey, 19122117)

Philolithus (Philolithus) densicollis (Horn, 1894:417)

Philolithus (Philolithus) hamspex (Casey, 19122115)

Philolithus (Philolithus)jaegeri (Papp, 1961a:107)

Philolithus (Philolithus) opimus (Casey, 19122115)

Philolithus (Philolithus) pantex (Casey, 1912:116)

Philolithus (Philolithus) porcatus (Papp, 1961b: 109)

Philolithus (Philolithus) reflexus (Casey, 1912:114)

Philolithus (Philolithus) rugosus (Papp, 1961a:157)

Philolithus (Philolithus) uteanus (Casey, 19242308)

Philolithus (Glyptasida) aegra (LeConte, 1858219), NEW COMBINATION
Philolithus (Glyptasida) rugosissima (Champion, 1884253), NEW COMBINATION
Philolithus (Glyptasida) sordida (LeConte, 18532445), NEW COMBINATION
Philolithus (Gonasida) alaticollis (Casey, 1912:122), NEW COMBINATION
Philolithus (Gonasida) aucta (Casey, 1912:122), NEW COMBINATION
Philolithus (Gonasida) compar (Casy, 19122120), NEW COMBINATION
Philolithus (Gonasida) elata (LeConte, 1853:445), NEW COMBINATION
Philolithus (Gonasida) inferna (Casey, 1912:119), NEW COMBINATION

Philolithus (Gonasida) gravida (Casey, 1912:119), NEW COMBINATION

74

Philolithus (Herthasida) ingens (Champion, 18922503), NEW CONEBINATION

Philolithus (T isamenes) truquii (Champion 1884:64), NEW COMBINATION
Stenomorpha Solier

Stenomorpha Solier 1836:487. Type species: Stenomorpha costata Solier 18362490

(MNHN), by subsequent designation, Casey 1912278.

subgenus Asidina Casey 19122169. Type species: Pelecyphorus parallela LeConte,

18512128, by original designation. Revised Status.

subgenus Asidopsis Casey 1912:185. Type species: Asida opaca Say, 18242254, by

original designation. Revised Status.

subgenus Bothrasida Casey 19122122. Type species: Asida clathrata Champion,

1884:54, by original designation. Revised Status.

subgenus Megasida Casey 1912:202. Type species: Asida obliterata Champion,

1892:497, by original designation. Revised Status.

subgenus Notiasida Casey 19122124. Type species: Notiasida abstrusa Casey,

19122125, by original designation. Revised Status.

75

subgenus Platasida Casey 19122182. Type species: Asida embaphionides Horn,

18942419, by original designation. Revised Status.

subgenus Pycnomorpha Motschulsky 18702398. Type species: Pycnomorpha

californica Motschulsky 1870: 399, by monotypy. Revised Status.

subgenus Stenomorpha Solier 1836:487, sensu stricto.

subgenus Stethasida Casey 1912:203. Type species: Pelecyphorus muricatulus

LeConte 1851:129, by original designation. Revised Status.

subgenus Trichiasida Casey 1912:172. Type species: Pelecyphorus hirsutus LeConte

18512127, by original designation. Revised Status.

Redescription (see fig. 1.16). Length: 9.4-27.0 mm, width: 4.6-14.9 mm; integument
ferruginous to black; body obovate to elongate and nearly parallel sided; generally
glaberous or setae inconspicous, occasionally setose; setae simple or, rarely, lanceolate in
shape. Head: Mentmn variable, trapezoidal to cordate; laterally reaching postgena or not,
never contacting mandibles when closed; lateral margins straight or curved outward at
apicies; anterior margin emarginate medially. Ligula; sclerotized, prominent and tumid;
width one-fourth or more mentum width, length approximately 3X width; strongly
curved or notched and raised above anterior margin of mentum. Apical segment of

maxillary palps enlarged, isotriangular to scalene in shape, more expanded in males.

76

Submentum distinctly projecting into buccal cavity; width four-fifihs or less that of
buccal cavity, completely or partially exposing maxillary cardos laterally. Postgena
exposing mandibular protuberance; postgenal processes not or slightly produced,
extending to middle of mentum or less, acute to broadly rounded. Labral margin broadly
emarginate, medially without setal brush; length of medial tormal process of labrum
variable, greater to less than posterior tormal process length; clypeal membrane exposed
or rarely concealed; clypeal margin broadly emarginate. Eyes elongate, oval or reniform;
median depression on frons absent or faintly indicated. Antenna weakly clavate, laterally
flattened or not, segments 8-11 always flattened; length of segment 3 2.5X or more
width; tomentose sensilla absent on antennal segment 9; apical tomentose sensilla present
on antennal segment 10, separated into two patches at lateral apices or meeting on one
side; antennal segment 11 one-third size of segment 10 to nearly equal, apical tomentose
sensillum covering one-third or more of segment. Prothorax: Pronotal shape and
sculpturing variable, with or without a median costa or paramedial fossae, lacking
paramedial basal gibbosities; pronotal margin costate, medially acutely expanded or not;
anterior apicies produced, acute or rounded, posterior apicies obtuse or acute, projecting
over elytra] humera or not; posterior margin straight, slightly convex, or weakly
bisinuate, often with a medial tooth projecting posterad. Prostemal process declivious
behind procoxae, rarely raised and projecting behind procoxal cavities. Pterothorax:
Apterous. Scutellum triangular, visible or mostly concealed underneath elytra, gradually
raised above scutum; mesonotum with two rounded paramedial depressions, shallow or
deep. Elytral sculpturing variable, discal and marginal costae present or absent; epipleura

indistinct. Metendosternite stem approximately as wide as tall. Legs: Ferruginous to

77

nearly black, tarsal formula 5-5-4; pro- and mesocoxae globular, metacoxae more
transverse; mesocoxal cavities open or externally closed by sternites; mesotrocantin large
and exposed; protibia with outer apical margin forming a spine; protibial outer lateral
margin not carinate; inner apical margin of protibia with two subequal spurs. Abdomen:
Intercoxal process impressed around margin or not, rounded or truncate at apex. Female
apical coxites ventrally rounded; eight or more spermathecal branches present, serially
arranged along one side of common duct to apex or rarely emerging only from the apex;
accessory gland long, with an enlarged chamber medially.

Diagnosis. Stenomorpha is distinguished from all other asidine genera by a unique
combination of the following characters: Ligula large and tumid, width one-fourth or
more mentum width, length approximately 3X width; strongly curved or notched and
raised above anterior margin of mentum. Scutellum raised above scutum; mesonotum
with two faint or deep rounded depressions. Protibial spurs subequal. Mesotrocantin large
and exposed.

Distribution. Stenomorpha species occur from central Mexico to southern Canada, fi'om

the west coast to western Kansas, Nebraska, etc.

78

Stenomorpha Species Checklist
Stenomorpha (Stenomorpha) advena (Casey, 19122143)
Stenomorpha (Stenomorpha) amplicollis (Casey, 1912: 153)
Stenomorpha (Stenomorpha) angulata (LeConte, 1851:127)
Stenomorpha (Stenomorpha) blanda (Champion, 1884263)
Stenomorpha (Stenomorpha) blapsoides Solier, 1836:491
Stenomorpha (Stenomorpha) brevimargo (Casey, 19122134)
Stenomorpha (Stenomorpha) caliginosus (Casey, 19122137)
Stenomorpha (Stenomorpha) captiosa (Horn, 18702287)
Stenomorpha (Stenomorpha) clarissae (Wilke, 18212273)
Stenomorpha (Stenomorpha) compressa (Horn, 1870:287)
Stenomorpha (Stenomorpha) congruens (Casey, 19122164)
Stenomorpha (Stenomorpha) consobrina (Horn, 1870:287)
Stenomorpha (Stenomorpha) consors (Casey, 19122162)
Stenomorpha (Stenomorpha) consueta (Casey, 1912: 161)
Stenomorpha (Stenomorpha) convexa (LeConte, 1859214)
Stenomorpha (Stenomorpha) convexicollis (LeConte, 18542223)
Stenomorpha (Stenomorpha) corrugans (Casey, 1912: 143)
Stenomorpha (Stenomorpha) costata Solier, 18362490
Stenomorpha (Stenomorpha) costipennis (LeConte, 1859276)
Stenomorpha (Stenomorpha) crassa (Casey, 19122154)
Stenomorpha (Stenomorpha) cressoni (Blaisdell, 19332191)

Stenomorpha (Stenomorpha) cribratus (Casey, 1912: 140)

79

hi" 1 L- a"?!

Stenomorpha (Stenomorpha) crinz'ta (Casey, 19122148)
Stenomorpha (Stenomorpha) deceptor (Casey, 19122154)
Stenomorpha (Stenomorpha) directa (Casey, 19122141)
Stenomorpha (Stenomorpha) evanescens (Casey, 19122146)
Stenomorpha (Stenomorpha)facilis (Casey, 19122165)
Stenomorpha (Stenomorpha)fastigiosa (Casey, 19122157)
Stenomorpha (Stenomorpha) globicollis (Casey, 19122158)
Stenomorpha (Stenomorpha) gracilior (Casey, 19122160)
Stenomorpha (Stenomorpha) gravidioes (Casey, 19122155)
Stenomorpha (Stenomorpha) huachucae (Casey, 1912:162)
Stenomorpha (Stenomorpha) inhabilis (Casey, 19122156)
Stenomorpha (Stenomorpha) integer (Casey, 19122153)
Stenomorpha (Stenomorpha) lecontei (Horn 1866212)
Stenomorpha (Stenomorpha) lecontella (Blaisdell 1936:227)
Stenomorpha (Stenomorpha) luctata (Horn, 18702286)
Stenomorpha (Stenomorpha) marginata (LeConte, 18512128)
Stenomorpha (Stenomorpha) maritima (Casey, 19122151)
Stenomorpha (Stenomorpha) mckittricki (Pierce, 1954)
Stenomorpha (Stenomorpha) montezuma (W ilke, 19212272)
Stenomorpha (Stenomorpha) musiva (Wilke, 19212273)
Stenomorpha (Stenomorpha) neutralis (Casey, 19122146)
Stenomorpha (Stenomorpha) oblonga (Casey, 19242309)

Stenomorpha (Stenomorpha) obovata (LeConte, 18512127)

80

Stenomorpha (Stenomorpha) oregonensis (Casey, 19242309)
Stenomorpha (Stenomorpha) orizabae (W ilke, 1921:273)
Stenomorpha (Stenomorpha) papagoana (Casey, 19122163)
Stenomorpha (Stenomorpha) pollens (Casey, 19122134)
Stenomorpha (Stenomorpha) procurrens (Casey, 19122137)
Stenomorpha (Stenomorpha) puncticollis (LeConte, 18662111)
Stenomorpha (Stenomorpha) rimata (LeConte, 18542223)
Stenomorpha (Stenomorpha) rudis (Casey, 19122139)
Stenomorpha (Stenomorpha) rugata (Casey, 19122138)
Stenomorpha (Stenomorpha) rustica (Casey, 1912: 135)
Stenomorpha (Stenomorpha) satiata (Casey, 1912: 138)
Stenomorpha (Stenomorpha) semirufa (Casey, 1912:140)
Stenomorpha (Stenomorpha) severa (Casey, 19122144)
Stenomorpha (Stenomorpha) socialis (Casey, 19122162)
Stenomorpha (Stenomorpha) speculatus (Blaisdell, 19362225)
Stenomorpha (Stenomorpha) sponsor (Casey, 19122135)
Stenomorpha (Stenomorpha) spurcans (Casey, 19122145)
Stenomorpha (Stenomorpha) strigulosa (Casey, 19122163)
Stenomorpha (Stenomorpha) subcruenta (Casey, 19122140)
Stenomorpha (Stenomorpha) subcylindrica (Horn, 18702288)
Stenomorpha (Stenomorpha) subelegans (Casey, 19122152)
Stenomorpha (Stenomorpha) tetrica (Casey, 19122149)

Stenomorpha (Stenomorpha) tularensis (Casey, 19122152)

81

Stenomorpha (Stenomorpha) uhdei (W ilke, 19212273)

Stenomorpha (Stenomorpha) umbrosa (Champion 1884262)

Stenomorpha (Stenomorpha) vigens (Casey 19122159)

Stenomorpha (Asidina) confluens (LeConte, 18512128), NEW COMBINATION
Stenomorpha (Asidina)fi4rcata (Champion, 18922499), NEW COMBINATION
Stenomorpha (Asidina) parallela (LeConte, 18512128), NEW COMBINATION
Stenomorpha (Asidina) rugicollis (Triplehom and Brown, 1971276), NEW
COMBINATION

Stenomorpha (Asidina) semilaevis (Horn, 1870:284), NEW COMBINATION
Stenomorpha (Asidina) wickhami (Horn, 18942420), NEW COMBINATION
Stenomorpha (Asidopsis) abbreviata (Casey, 19122198), NEW COMBINATION
Stenomorpha (Asidopsis) cochisensz’s (Casey, 1912:188), NEW COMBINATION
Stenomorpha (Asidopsis) coenosa (Casey, 19122199), NEW COMBINATION
Stenomorpha (Asidopsis) collega (Casey, 19122198), NEW COMBINATION
Stenomorpha (Asidopsis) consentanea (Casey 19122192), NEW COMBINATION
Stenomorpha (Asidopsis) divaricata (Blaisdell 19232255), NEW COMBINATION
Stenomorpha (Asidopsis) dolosa (Casey 19122194), NEW COMBINATION
Stenomorpha (Asidopsis) durangoensis (Casey 19122201), NEW COMBINATION
Stenomorpha (Asidopsis) eximia (Casey 19122187), NEW COMBINATION
Stenomorpha (Asidopsis) gracilipes (Casey 19122189), NEW COMBINATION
Stenomorpha (Asidopsis) humeralis (Triplehom and Flores 20022288), NEW
COMBINATION

Stenomorpha (Asidopsis) immunda (Casey 19122199), NEW COMBINATION

82

Stenomorpha (Asidopsis) macra (Horn) 18822304), NEW COMBINATION
Stenomorpha (Asidopsis) mancipata (Horn) 1878256), NEW COMBINATION
Stenomorpha (Asidopsis) collarz's (Champion, 18922499), NEW COMBINATION
Stenomorpha (Asidopsis) nitidula (Casey, 19122196), NEW COMBINATION
Stenomorpha (Asidopsis) obsidiana (Casey, 19122193), NEW COMBINATION
Stenomorpha (Asidopsis) olsoni (Triplehom and Flores, 20022286), NEW
COMBINATION

Stenomorpha (Asidopsis) opaca (Say, 18242254), NEW COMBINATION
Stenomorpha (Asidopsis) pinalica (Casey, 1912: 190), NEW COMBINATION
Stenomorpha (Asidopsis) planata (Horn, 18942415), NEW COMBINATION
Stenomorpha (Asidopsis) polita (Say, 18242255), NEW COMBINATION
Stenomorpha (Asidopsis) quadricollis (Horn, 18802151), NEW COMBINATION
Stenomorpha (Asidopsis) servilis (Casey, 19122193), NEW COMBINATION
Stenomorpha (Asidopsis) suavis (Casey, 19122189), NEW COMBINATION
Stenomorpha (Asidopsz's) tensa (Casey, 19122197), NEW COMBINATION
Stenomorpha (Asidopsis) woodgatei (Casey, 19122197), NEW COMBINATION
Stenomorpha (Bothrasida) baroni (Casey 19122124), NEW COMBINATION
Stenomorpha (Bothrasida) clathrata (Champion) 1884254 (Casey, 1912276), NEW
COMBINATION

Stenomorpha (Bothrasida)fimesta (Champion, 1884:53), NEW COMBINATION
Stenomorpha (Bothrasida) mucorea (W ilke 19222270), NEW COMBINATION
Stenomorpha (Bothrasida) sanctae-agnae (Wilke, 19222270), NEW COMBINATION

Stenomorpha (Megasida)foeda (Champion, 18922498), NEW COMBINATION

83

Stenomorpha (Megasida) latissima (Champion, 1892:500), NEW COMBINATION
Stenomorpha (Megasida) magnifica (Pallister, 195430), NEW COMBINATION
Stenomorpha (Megasida) moricoides (Champion, 18922497), NEW COMBINATION
Stenomorpha (Megasida) obliterata (Champion, 18922497), NEW COMBINATION
Stenomorpha (Megasida) rufipes (Champion, 1884:62), NEW COMBINATION
Stenomorpha (Megasida) segregata (Champion, 18922497), NEW COMBINATION
Stenomorpha (Megasida) tarda (Champion, 1892:498), NEW COMBINATION
Stenomorpha (Megasida) tenuicollis (Triplehom, 1967240), NEW COMBINATION
Stenomorpha (Megasida) zacatecensis (Pallister, 1954:32), NEW COMBINATION
Stenomorpha (Megasida) tenebrosa (Champion, 18922495), NEW COMBINATION
Stenomorpha (Notiasida) abstrusa (Casey, 19122125), NEW COMBINATION
Stenomorpha (Notiasida) evertissima (Casey, 1912:125), NEW COMBINATION
Stenomorpha (Notiasida) intricate: (Champion, 18922493), NEW COMBINATION
Stenomorpha (Notiasida) lata (Champion, 1884260), NEW COMBINATION
Stenomorpha (Notiasida) lugubris (W ilke, 19222269), NEW COMBINATION
Stenomorpha (Notiasida) geminata (Champion, 18922492), NEW COMBINATION
Stenomorpha (Notiasida) suturalis (Champion, 1884:55), NEW COMBINATION
Stenomorpha (Platasida) embaphionides (Horn, 18942419), NEW COMBINATION
Stenomorpha (Platasida)flaccida (Horn, 18972379), NEW COMBINATION
Stenomorpha (Pycnomorpha) calzfornica (Motschulsky, 1870: 399), NEW
COMBINATION

Stenomorpha (Pycnomorpha) gibbicollis (Horn, 1870: 288), NEW COMBINATION

84

Stenomorpha (Pycnomorpha) tumidicollis (Blaisdell, 1943: 226), NEW
COMBINATION

Stenomorpha (Stethasida) adumbrata (Casey, 19122208), NEW COMBINATION
Stenomorpha (Stethasida) angustula (Casey, 1890: 370), NEW COMBINATION
Stenomorpha (Stethasida) brevipes (Casey, 19122206), NEW COMBINATION
Stenomorpha (Stethasida) convergens (Casey, 19122207), NEW COMBINATION
Stenomorpha (Stethasida) discreta (Casey, 19122207), NEW COMBINATION
Stenomorpha (Stethasida) longula (Casey, 19122207), NEW COMBINATION
Stenomorpha (Stethasida) muricatula (LeConte, 18512129), NEW COMBINATION
Stenomorpha (Stethasida) obsoleta (LeConte, 18512128), NEW COMBINATION
Stenomorpha (Stethasida) occulta (Casey, 19122208), NEW COMBINATION
Stenomorpha (Stethasida) pertinax (Casey, 19122211), NEW COMBINATION
Stenomorpha (Stethasida) socors (Casey, 19122212), NEW COMBINATION
Stenomorpha (Stethasida) stricta (Casey, 19122210), NEW COMBINATION
Stenomorpha (Stethasida) tarsalis (Casey, 19122208), NEW COMBINATION
Stenomorpha (Stethasida) tenax (Casey, 19122213), NEW COMBINATION
Stenomomha (Stethasida) torpida (Casey, 19122206), NEW COMBINATION
Stenomorpha (Stethasida) unica (Casey, 19122209), NEW COMBINATION
Stenomorpha (Stethasida) vergrandis (Casey, 19122213), NEW COMBINATION
Stenomorpha (T richiasida) acerba (Horn, 1878256), NEW COMBINATION
Stenomorpha (Trichiasida) difi‘icilis (Champion, 1884261), NEW COMBINATION
Stenomorpha (T richiasida) duplex (Casey, 19122178), NEW COMBINATION

Stenomorpha (T richiasida) eremica (Wilke, 19222274), NEW COMBINATION

85

Stenomorpha (T richiasida) hirsuta (LeConte, 18512127), NEW COMBINATION
Stenomorpha (T richiasida) hispidula (LeConte, 18512127), NEW COMBINATION
Stenomorpha (T richiasida) horrida (Champion, 1892:500), NEW COMBINATION
Stenomorpha (Trichiasida) idahoensis (Boddy, 19572187), NEW COMBINATION
Stenomorpha (Trichiasida) ignava (Casey, 1912:180), NEW COMBINATION
Stenomorpha (T richiasida) impetrata (Horn, 18942418), NEW COMBINATION
Stenomorpha (T richiasida) impotens (Casey, 19122180), NEW COMBINATION
Stenomorpha (Trichiasida) lineatopilosa (Casey, 19122175), NEW COMBINATION
Stenomorpha (T richiasida) Iutulenta (Doyen, 19882225), NEW COMBINATION
Stenomorpha (Trichiasida) palmeri (Champion, 1884259), NEW COMBINATION
Stenomorpha (T richiasida) pubescens (Champion, 1884:61), NEW COMBINATION
Stenomorpha (T richiasida) subpilosa Solier, 18362490, NEW COMBINATION
Stenomorpha (T richiasida) tenella (Casey, 19122177), NEW COMBINATION
Stenomorpha (Trichiasida) thoracica (Champion, 1884:62), NEW COMBINATION
Stenomorpha (T richiasida) unicostata (Champion, 18922501), NEW COMBINATION
Stenomorpha (T richiasida) villosa (Champion, 1884:60), NEW COMBINATION
Stenomorpha (Trichiasida) spinimana (Champion, 18922494), NEW COMBINATION

Stenomorpha (incertae sedis) subvittata (Horn, 18942416), NEW COMBINATION

86

93
12

83

53 Asidina oonfluens

 

2 100 Megasida tenuioollts 1
3 23 Megasida tenuioollis 2
Megasida obliterata

Asidina parallela
Platasida embaphionides
Stenomorpha oostipennis
Stenomorpha obovata
Stenomorpha n.sp.1
100.— Stenomorpha rimatus
12b Stenomorpha marginata

 

 

 

”Pseudoglyptasida" n.sp.1
67 99 Asldopsls mandpata
1 14 Asidopsis opaea

 

6 L— Asidopsis polita
Asidopsis macra

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Asidopsis divaricata
2 63 Heterasida subvittata
_ 4 Stethasida obsoleta
1 1 LE Stenomorpha luctata
3 Trichiasida hispidula
1 Trichiasida acerba
74 96 Asidina fumta
8 E Triohlasida unicostata
1 Pycnomorpha gibbicollis
2 Trlchlasida pubescens
100.—— Trichiasida hirsuta 1
23h Tn'chiaslda hirsuta 2
55 r— Astrotus fasciculatus
3 ‘— Astrotus guanajuatensis
Astrotus regularis
Stenosides anastomosis 1
._. Stenosides anastomosis 2
2 Stenosides anastomosis 3
Zaleucus dilatatus
I-— Microschatia rockefelleri

  

 

 

4|— Parasida longicollis
62'— Pelecyphorus mexicanus
41— Ucalegon pulchellus
100 l—— Parasida sexcostata
13!— Parasida n.sp.

 

 

 

 

Parasida lirata

100I-— Ardamlmicus cognatoi n. gen n. sp. 1
'— Ardamimious cognatoi n. gen n. sp. 2

Glyptasida aegra

Glyptasida sordida

Philolithus aegrotus

Philolithus actuosus

Philolithus densioollis

Philolithus morbillosus

Philolithus n.sp.

Gonasida elata

 

 

 

 

 

5| 100,— Heterasida bifurca
'-— Heterasida connivens

 

Craniotus pubescens

 

Cardigenius Iaticollis

 

 

Branchus n.sp.

 

Eusattus reticulatus

Figure 1.1: Phylogeny of the North American Asidini based on 28S, COI, and adult
morphology (58 OTUs, 1252 characters). The strict consensus of four most parsimonious
trees (L=3615, CI=O.22, RI=0.47) is shown bootstrap values above the branches and
average partitioned Bremer support values below.

87

91 Stenomorpha obovate
Stenomorpha n.sp.1
Stenomorpha costipennis
Asidina parallela

5 Platasida embaphionides
Stenomorpha rimatus

Stenomorpha marginata

100 Megasida tenuioollis 1

23 Megasida tenuioollis 2
Asidina confluens
Megasida obliterata
”Pseudoglyptasida" n.sp.1

99 Asidopsis mancipata
:67 14 _: Asidopsis opaca
. 6 Asidopsis polita
0 Asidopsis maora

63 Heterasida subvittata
Stethasida obsoleta
Asidopsis divariczta
Stenomorpha luctata
Trichiasida hispidula

1 Triehiasida aoerbe

96 Asidina fureata
f Trichiasida unicostata
1 mo ha ibbioollis
2 mar. am...

100 .-—- Trichiasida 111181113 1
23l— Trichiasida hirsute 2

   
  
  
      
   
 
  

 

_.|

 

,eudrowouers,

Al

 
  
 
  

 

 

V
.I.

 

 

100 Stenosides anastomosls 1
71 10° 16 Stenosides anastomosisZ
25 Stenosides anastomosts 3
3 Astrotus regularis
— 1 Zaleucus dilatatus
1 1 Microschatia rockefelleri
4 Parasida longicollis
1 62 Pelecyphorus meximnus
2 4 Ucalegon pulchellus
55 Astrotus fasciculatus
1 3 Astrotus guanajuatensis
100 Parasida sexcostata
1 13 Parasida n.sp.
‘ 1 ‘ Parasida lirata
— 5 100 Ardamimicus cognatoi n. gen n. sp. 1
20 Ardamimicus cognatoi n. gen n. sp. 2
Glyptasida aegra
Glyptaslda sordida
Philolithus aegrotus
Philolithus actuosus
Philolithus densioollis
Philolithus morbillosus
Philolithus n.sp.
Gonasida elata
Heterasida blfurea
25 Heterasida connivens
Craniotus pubescens
Cardigenius Iaticollis
Branchus n.sp.
Eusattus reticulatus

,smoquoe/ed,

 

 

  
 
 
 
 
  
 
  
 

o 8
.3" (Ill/Olllld .

 

 

193 1
12 5

 

 

 

 

 

 

Figure 1.2: Phylogeny of the North American Asidini based on 28S, C01, and adult
morphology (58 OTUs, 1252 characters). One of four most parsimonious trees (L=3615,
CI=O.22, RI=0.47) is shown with bootstrap values above the branches and average

partitioned Bremer support values below.

88

10 1 Stenomorpha obovate

'- Stenomorpha n.sp.1

Stenomorpha oostipennis

Asidina parallela

5 Platasida embaphionides

Stenomorpha rimatus

Stenomorpha marginata

Megasida tenuioollis 1
Megasida tenuioollis 2

Asidina oonfluens

Megasida obliterate

"Pseudoglyptasida" n.sp.1

12 Asidopsis mancipata
14 13 14 Asidopsis opaca
2 ha 6 Asidopsis polita

Asidopsis macra
16 Heterasida subvittata
Stethasida obsoleta
Asidopsis divarleata
Stenomorpha luctata
Triehiasida hispidula
1 Tn'chiasida aoerba

22 Asidina furcata
24 23 1o Tridiiasida unioostata
1 Pycnomorpha glbbioollis
2 Triehiasuda pubescens

261—— Trichiasida hirsute 1
231—— Trichiaslda hirsuta 2

   
  
   
 

23

   

 

 

 

 

 
  
   

 

 

N
GIN

 

 

28 Stenosides anastomosis 1
29 16 Stenosides anastomosls 2
31 25 Stenosides anastomosis 3
43 3 Astrotus regularis
t—~ 33 1 Zaleucus. dllatatus
35 1 32 Microschatia rockefelleri
4 Parasida longicollis
37 1 34 Pelecyphorus mexleanus
4 Ucalegon pulchellus
39 36 Astrotus fasciculatus
1 3 Astrotus guanajuatensis
4° 38 Parasida sexcostata
42 1 13 Parasida n.sp.
‘ 53 Parasida lirata
— 5 41 Ardamimicus cognatoi n. gen n. sp. 1
20 Ardamimleus cognatoi n. gen n. sp. 2
Glyptasida aegra
Glyptaslda sordlda
Philolithus aegrotus
Philolithus actuosus
Philolithus densioollis
Philolithus morbillosus
Philolithus n.sp.
Gonasida elata
Heterasida bifurm
25 Heterasida connivens
Craniotus pubescens
Cardigenius Iaticollis
Branchue n.sp.
Eusattus reticulatus

 

 

   
 
 
  
 
  
 

o‘ffl
h
(D

 

 

 

 

 

 

 

 

Figure 1.3: Phylogeny of the North American Asidini based on 28S, C01, and adult
morphology (58 OTUs, 1252 characters). One of four most parsimonious trees (L=3615,
CI=O.22, RI=0.47) is shown with node numbers above the branches and average
partitioned Bremer support values below.

89

0.1

 

 

 

 

 

7_2[

1L— Cardigenius Iaticollis

Branchus n.sp.

 

 

54 * Pelecyphorus mexicanus

* Stenomorpha obovate

Stenomorpha n.sp.1
Stenomorpha oostipennis

* r— Asidina parallela

'-— Platasida embaphionides
Stenomorpha rimatus

Stenomorpha marginata

 
 
  
  

 

 

 

 

6,1 * Asidopsis mancipata
* Asidopsis opaca
+fipsis polita
Asidopsis macra
7 21 "Pseudoglyptasida" n.sp.1
* Asidina furcata

 
   
 
  

Trichiasida unioostate
Pycnomorpha gibbicollis
Trichiasida pubescens
Megasida tenulcollls 1
Megasida tenuioollis 2
Asidina oonfluens
Megasida obliterate

9_9. * Stenomorpha Iucteta
Erichiasida hispidula
Trichiasida aoerbe

 

 

 

 

 

88 Heterasida subvittata
LE Stethasida obsolete
Asidopsis divaricata

 

___*: Trichiasida hirsute 1
Trichiasida hirsute 2 id
* G tee a a re
Glypfisida sordeigia
Philolithus aegrotus
Philolithus actuosus
Philolithus densicollis
Philolithus morbillosus
I Philolithus n.sp.
Gonasida elata
* Stenosides anastomosis 1
* Stenosides anastomosis 2
* Stenosides anastomosis 3
54 Astrotus regularis

* Astrotus fasciculatus
Astrotus guanajuatensis

  
   
   

 

.9 n lIll/OI! Ud .

    

 

 

Ucalegon pulchellus
l Microschatia rockefelleri

, Zaleucus dilatatus

* Parasida sexcostata
9 * Parasida n.sp.
Parasida lirata
Parasida longicollis
* :- Ardamlmteus cognatoi n. gen n. sp. 1
h— Ardamimicus cognatoi n. gen n. sp. 2
*J—_ Heterasida bifurca
L Heterasida connivens

Craniotus pubescens

 

 

“smoqd/{oe/ed,

 

 

Eusattus reticulatus

Figure 1.4: Phylogeny of the North American Asidini based on 288, C01, and adult
morphology (58 OTUs, 1252 characters). The Bayesian majority rule consensus tree is
shown (GTR+I+1" model; 6,000 sampled trees from 5,000,000 generations, -LogL =
16,269) with posterior probability values above the branches (* = 100% p.p.).

,eudJowoueis,

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Tribe Species Collection data
Asidini 'Mrdamimicus cognatoi"; 1 USA: TX: Reeves Co., Balmorhea, Lake
Balmorhea Co. Rd. 319, N30°58’22.7”,
W102°33’01.1”, 05.D(.2005, under rocks,
ADSmith
Asidini 'Mrdamimicus cognatoi"; 2 USA: TX: Presidio Co., Big Bend Ranch SP,
29°32'58.80"N 104°10'7.23"W, 05.IX.2005,
ADSmith
Asidini "Pseudoglyptasida" n. sp. 1 USA: TX: Presidio County, Big Bend Ranch
SP, Cinco Tinajas, morning, el. 4200ft,
29°28'27"N 103°58'35.9"W, 04.1X.2005,
ADSmith
Asidini Asidina confluens (LeConte, USA: CA2 Imperial Co, Algodones dunes, e1
1851) 30011, N32°45'40”, W114°46'29", dusk,
10.XII.2007, ADSmith
Asidini Asidinafilrcata (Champion, USA: TX: Presidio Co., Big Bend Ranch SP,
1892) Ojitro Adentro, e1. 1281m, N29.4922
W104.0591, 25.V.2005, ADSmith
Asidini Asidina parallela (LeConte, USA: CA: Imperial Co, [-8 mm80, Moutain
1851) Springs Rd., 32°40'30.70"N 116° 6'1.51"W,
10.XII.2007, K.Kanda
Asidini Asidopsis divaricata MEXICO: Baja Cal. Sur, San Miguel
Blaisdell, 1923 Comondt’r, e1. 255m, N26°02.204’
W111°49.91’, BCS#20, 24.VII.2009,
ADSmith
Asidini Asidopsis macra (Horn, USA: AZ: Cochise Co., lmi NE Rustler Park,
1882) N3l°54'54.1" W109°16'08.5", el. 8210', night,
08.VIII.2006, ADSmith
Asidini Asidopsis mancipata (Horn, USA: NM: Grant Co., Airport rd. off Hwy
1878) 180, Smi S Hurley, e15355 fl, N32°37’48”
W108°08’22”, 22.VIII.2006, ADSmith
Asidini Asidopsis opaca (Say, 1824) USA: CO: Weld Co., Pawnee NG, Crow
Valley Rec. Area, N40°3 8'43.0"
W104°20'34.2", e1. 4834', 05.VIII.2006,
ADSmith
Asidini Asidopsis polita (Say, 1824) USA: ND: Billings Co., Painted Canyon
Center, under old cow dung, N46°53'42"
W103°22'56", 03.VIII.2006, ADSmith
Asidini Astrotusfascicrdatus MEXICO: Morelos, Quilamula, N1 8°30'37.1"
(Champion, 1892) W99°00'10.7", 1167m, 20.V.2007, P.
Cifuentes
Asidini Astrotus guanajuatensis MEXICO: Guanajuato, Guanajuato,
(Champion, 1884) N21°00’12”, W101°14’12”, e1. 3424’,
20.V.2006, ADSmith
Asidini Astrotus regularis Horn, USA: TX: Val Verde Co., Seminole Cyn SP,
1870 under rocks, el. 1320 ft, N29°42'2"

 

 

W101°18'42", 03.11.2006, ADSmith

 

Table 1.1 (continued on following pages): Specimens sequenced and
collecting data

91

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Tribe Species Collection date
Branchini Branchus n.sp. 1 GUATEMALA: El Progreso: San Agustin
Acasaguatlén, Rancho El Limonar. 308m,
Nl4°55.408 W90°02.406, 3.VII.2009; MJ
Paulsen
Asidini Cardigenius Iaticollis ARGENTINA: COrdoba, Alpha Corral, Ea.
Solier, 1836 Eloiea. 32°37'52"S 64°43'26"W. 1042m. 5-
7/II/O9. UV light. F.C. Ocampo, K. Sheldon
Asidini Craniotus pubescens USA: AZ: Pinal Co., rest area ofl‘ I-8 mm15 l,
LeConte 1851 17.XII.2007, ADSmith
Coniontini Eusattus reticulatus (Say, USA: TX: El Paso Co., roadside I-lOE mm46,
1824) O7.X.2005, ADSmith
Asidini Glyptasida aegra (LeConte, USA: TX: Presidio County, Big Bend Ranch
1858) SP, Cinco Tinajas, morning, e1. 420011,
29°28’27"N 103°58'35.9"W, 25.V.2005,
ADSmith
Asidini Glyptasida sordida USA: TX: El Paso Co., 2mi W F abens,
(LeConte, 1853) roadside I-10E, 22.VIII.2005, ADSmith
Asidini Gonasida elata (LeConte, USA: NM: Dona Ana Co., Jomada rd. 3mi N
1853) Hwy 70, N32°25’ 19” W106°43’36”, on
@gonomxrmex nest, 03.X.2005, ADSmith
Asidini Heterasida blfill‘Cd MEXICO: Baja Cal. Sur, 22km NW of C.San
(LeConte, 1861) Lucas, e1. 30m, N23°01.538’ W110°04.895’,
BCS#O4, 21.VII.2009, ADSmith
Asidini Heterasida connivens MEXICO: Baja Cal. Sur, 12km E Todos
(LeConte, 1866) Santos, el. 314m, N23°26.790’ W110°06.31’,
BCS#37, 28.VH.2009, ADSmith
Asidini Heterasida subvittata MEXICO: Baja Cal. Sur, Sier. de la Laguna
(Horn, 1894) trail, el 1573m, N23°32.78’
W110°00.83 ’,BCS#43, 28.VH.2009, ADSmith
Asidini Megasida obliterata USA: TX: Culberson Co., 2mi E Van Horn off
(Champion, 1892) l-lOE, 05.D(.2005, ADSmith
Asidini Megasida tenuicollis USA: TX: Brewster Co., roadside, 04.1X.2005,
Triplehom, 1967; 1 Jhulcr
Asidini Megasida tenuicollis USA: TX: Culberson Co., Guadalupe Mts,
Triplehom, 1967; 2 N31°53' W104°49', 20.VIII2006, ADSmith
Asidini Microschatia rockefelleri USA: TX: Hudspeth Co., Rest Area off I-lOE
Pallister, 1954 mm 98, 31°12’47.9”N
105°29’37 .1”W, el 464011, 13.VIII.2006,
ADSmith
Asidini Parasida lirata (LeConte, USA: AZ: Pima County, Madera Canyon,
1854) Elephant Head trail, mid-afiemoon,

 

 

31°44'21"N, 110°53'30"W, e1. 437611,
13.VIII.2006, ADSmith

 

Table 1.1 (cont): Specimens sequenced and collecting data

92

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Tribe Species Collection data
Asidini Parasida longicollis MEXICO: Puebla, Cacaloapan, elev. 6175’,
(Champion, 1884) N18°34'44" W97°35'3"W, 11.VII.2008,
ADSmith
Asidini Parasida sexcostata MEXICO: Baja Cal. Sur, 13km S of La Paz., el.
(LeConte, 1861) 191m, N23°59.768’ W110°16.24’, BCS#12,
22.VII.2009, ADSmith
Asidini Parasida n.sp. 1 MEXICO: Baja Cal. Sur, Sier. de la Laguna
trail, el 1573m, N23°32.78’
W110°00.83’,BCS#43, 28.VH.2009, ADSmith
Asidini Pelecyphorus mexicanus MEXICO: Puebla, Hwy150,3 km N
Solier, 1836 Azumbilla, Nl8°39'58" W97°22'33",
10.VII.2008, ADSmith
Asidini Philolithus actuosus (Horn, USA: NV: Clark Co., Walking Box Cyn Rd.,
1870) 35°29'56.67"N 115° 2'13.36"W, 15.XII.2007,
ADSmith
Asidini Philolithus aegrotus MEXICO: Baja Cal. Sur, 52km W of La Paz,
(LeConte, 1861) el. 265m, N24°09.164’ W110°49.91’,
BCS#27, 25.VII.2009, ADSmith
Asidini Philolithus densicollis USA: WA: Benton Co., Badger Cyn, nr
(Horn, 1894) Kennewick, N46°1 1'51" W1 19°21'59",
11X.2008, H. Lippold
Asidini Philolithus morbillosus USA: AZ: Cochise Co., Rest Area off I-lOW
(LeConte, 1858) mm 321, 32°03’41.5”N
110°04’40.7”W, e1 492011;, 03 .X.2005,
ADSmith
Asidini Philolithus n.sp. l MEXICO: Baja Cal. Norte, Sierra Libertad, El
Rancho, 28.49060°N 113.59583°W, 1143m,
09.X.2009, William H. Clark, collector
#12,270
Asidini Platasida embaphionides MEXICO: Baja Cal. Sur, 22km NW of C.San
(Horn, 1894) Lucas, e1. 30m, N23°01.538’ W110°04.895’,
BCS#04, 21.VII.2009, ADSmith
Asidini Pycnomorpha gibbicollis MEXICO: Baja Cal. Sur, 41cm W of La Paz, el.
(Horn, 1870) 29m, N24°08.525’ W110°27.91’, BCS#28,
25.VII.2009, ADSmith
Asidini Stenomorpha oostipennis USA: CA2 Kings Co., off Hwy 41, N35°56.8'
(LeConte, 1859) W120°00.4', 08.111.2008, ADSmith
Asidini Stenomorpha luctata (Horn, USA: NV: Clark Co., Boulder City, Bootleg
1870) Cyn bike trail, 35°58'58.56"N
l l4°51'29.09"W, l6.XII.2007, ADSmith
Asidini Stenomorpha rimatus USA: AZ: Cochise Co., Rest Area off I-10W
(LeConte, 1854) mm 321, 32°03’41.5”N
110°04’40.7”W, e1 492011, 03.X.2005,
ADSmith
Asidini Stenomorpha marginata Arizona: Pima County, Madera Canyon,
(LeConte, 1851) Elephant Head trail, 31°44'21"N,

 

 

110°53‘30"W, e1. 437611, 05.X.2005, ADSmith

 

Table 1.1 (cont): Specimens sequenced and collecting data

93

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Tribe Species Collection data
Asidini Stenomorpha obovata USA: New Mexico: Luna County, Rest Area
(LeConte, 1851) ofi‘ I-10W mm61, at night, N32°13’29.4”
W108°07’23.6”, e1. 456011, 21.VIII.2006,
ADSmith
Asidini Stenomorpha n.sp.1 USA: NV: Clark Co., Boulder City, Bootleg
Cyn bike trail, 35°58'58.56"N
114°51'29.09"W, l6.XII.2007, ADSmith
Asidini Stenosides anastomosis USA: TX: Presidio Co., ZH Canyon, 11.7mi
(Say, 1824); 1 W Valentine, N30.5438 W104.6856, 19-
23.V.2005, ADSmith
Asidini Stenosides anastomosis USA: TX: Culberson Co., Guadalupe Mts,
(Say, 1824); 2 N31°53' W104°49', 20.VIII.2006, ADSmith
Asidini Stenosides anastomosis USA: AZ: Graham County, Pinaleflo Mnts, off
(Say, 1824); 3 Hwy 366, el.5220ft, N32°39'54.6"
W109°47'45.5", 07.VI.2008, ADSmith
Asidini Stethasida obsoleta USA: CA: Riverside Co., Riverside, el. 721 fi,
(LeConte, 1851) 33°58'5.l3"N 117°25'24.84"W, 30.XII.2006,
ADSmith
Asidini Trichiasida acerba (Horn, USA: NV: Clark Co., Warm Springs Rd.,
1878) 36°43'04.23"N 114°43'04.74W, l6.XII.2007,
ADSmith
Asidini Trichiasida hirsuta USA: CA2 Imperial Co, Algodones dunes, e1
(LeConte, 1851); 1 3006, N32°45'40”, W114°46'29", dusk,
10.XII.2007, ADSmith
Asidini Trichiasida hirsute USA: California: Riverside Co., Palm Desert,
(LeConte, 1851); 2 el 11511, 33°46’19.46"N 116°18‘25.72"W,
13.XII.2007, ADSmith
Asidini Trichiasida hispidula USA: CA: San Diego Co., Anza Borrega
(LeConte, 1851) desert, N32°52.492’ W116°13.100’, 824fl
KK09_03, 28-30.ii.2009 , K. Kanda
Asidini Trichiasida pubescens MEXICO: Hidalgo, Pachuca, Hotel La Paz,
(Champion, 1884) el.~7800’, walls at night, O8.VII.2008,
ADSmith
Asidini T richiasida unicostata MEXICO: Guerrero, Jonathan Amith #592
(Champion, 1892)
Asidini Ucalegon pulchellus MEXICO: Oaxaca, Yagul Ruins, el. ~5600’,
Champion, 1884 N16°57‘32" W96°26'54", 12.VII.2008,
ADSmith
Asidini Zaleucus dilatatus MEXICO: Oaxaca, Hwy 190, ~53 km SE

 

(Champion, 1884)

 

Huajuapan de Leon, N17°35'41" W97°26'5"W,
11.VII.2008, ADSmith

 

Table 1.1 (cont): Specimens sequenced and collecting data

94

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Partition
Node Morphology C01 288 Total
1 0.33 1.67 0.00 2
2 12.50 -6.50 1.00 7
3 1.00 5.00 -1.00 5
4 -1.75 2.75 0.00 1
5 7.33 6.67 -2.00 12
6 -4.00 5.00 0.00 1
7 1.33 23.66 -2.00 23
8 1.17 3.83 -3.00 2
9 6.50 -1.50 -2.00 3
10 0.00 0.00 0.00 0
11 -4.00 7.00 -2.00 1
12 0.00 13.00 1.00 14
13 -2.50 8.50 0.00 6
14 0.50 -0.50 0.00 0
15 -4.00 5.00 0.00 1
16 6.00 -1.00 -1.00 4
17 4.00 -1.00 -1.00 2
18 2.50 -0.50 1.00 3

 

 

 

 

 

 

Table 1.2 (cont. following pages): Partitioned Bremer support
values from TreeRot v.3

95

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Partition
Node Morphology C01 288 Total
19 -4.00 5.67 -0.67 1
20 -4.00 5.67 -0.67 l
21 -3.50 5.00 -0.50 1
22 4.00 5.00 1.00 10
23 0.43 2.43 -l .86 1
24 2.00 0.00 0.00 2
25 -4.00 5.00 0.00 1
26 13.33 6.67 3.00 23
27 4.00 5.00 -1.00 8
28 0.50 18.75 -3.25 16
29 9.00 14.00 2.00 25
30 9.00 -7.00 1.00 3
31 12.75 -9.75 -2.00 1
32 0.53 2.18 1.29 4
33 8.50 -6.50 -1.00 l
34 -3.50 8.50 -1.00 4
35 12.75 -9.75 -2.00 1
36 9.00 -7.00 1.00 3
37 -1.50 2.50 1.00 2

 

 

 

 

Table 1.2 (cont): Partitioned Bremer support values from
TreeRot v.3

96

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Partition

Node Morphology C01 288 Total
38 2.50 15.00 0.50 18
39 -4.00 5.67 -0.67 1
40 12.25 -9.25 -2.00 1
41 3.60 16.40 0.00 20
42 0.00 1.00 4.00 5
43 6.71 -4.57 -1.14 1
44 17.25 -1.25 1.00 17
45 -0.95 3.90 0.05 3
46 19.00 -l6.00 1.00 4
47 -1.00 1.00 2.00 2
48 -0.58 4.42 -0.83 3
49 10.67 -8.67 1.00 3
50 1.00 14.00 8.00 23
51 26.00 1.00 -2.00 25
52 -0.80 3.40 2.40 5
53 2.00 2.00 1.00 5
54 0.00 1.00 8.00 9
55 19.50 -11.50 4.00 12

Total 205.35 134.98 11.66 352

 

 

 

 

Table 1.2 (cont): Partitioned Bremer support values from
TreeRot v.3

97

 

 

 

 

 

 

 

 

 

 

Clade Parsimony Bayesian
(bootstrap I Bremer) (posterior probability

%)

N. American Asidini 83 / 9 100

“Stenomorpha” 74 / 8 100

“Philolithus” 100 / 23 100

“Pelegphorus” < 50 / 5 80

“Pelecyphorus” + “Stenomorpha” < 50/ 1 N/A

“Philolithus” + “Stenomorpha” N/A 67

H. bifirrca + H. connivens 100 / 5 100

“Philolithus” (H. bifia'ca + H. < 50 / 5 N/A

connivens)

Craniotus (H. bifilrca + H. N/A 72

connivens)

 

 

 

 

Table 1.3: Support for selected clades from parsimony and Bayesian analyses. Numbers
represent bootstrap/Bremer supports for parsimony analysis or posterior probabilities for
Bayesian analysis. N/A = not applicable or not found in the resulting tree(s)

98

Characters

 

 

flooooooccccoooocoooo g
‘5
gv—i—I—uu—n—v—tu—tv—nu—t—cooc—n—u—u—n—i g
.1:
au—Iv—cv—n—iv—nv—t—Ie—tv—tI—tNNOV'fiF‘VOC 0
v3
SNNv—v—NNNNNN—v—ommmmmm :3
[—
:v—nv—‘v—Iv—tv—tv—tv—v—tv—Iv—I—Iv—tv—noo—OI—Iv—I O
00
In
fimmmmmmmmmmmm——Nm~<rv 8
‘4—1
2NNNNNNNNNNNN~~~¢~MM 12
Ev—Fflv—tv—I—Iv—tI—Fflv—v—v—II—tOI-IOI—F-lv—iv—I g
:v-r—NNNNNNNN—v-OVVNVOO ;
O
£mm¢¢mmmmmma~o~c~o~om~omm c:
O
flocccooooccco—ccccco g
:oc————uv——~~cooN—cho a
n—t—d—fl—Iv—I—is-II-II-II-Iv-IF-Iocccv-tv-lI—I E
Qccc—v—o—aocoocc—c—n—cc g
0
zooccccccoc~—~c~——~co g
SNN~~~NNNNNNN¢~~~~mm 3
O
Q—n—uu—nr—uu—u—u—t—r—Iu—t—i—no—Om—u—n— '3‘
“cam—mw—I—n—v—tv—tcccv—I—NQOO g
b—v—cco—n—v-u—m—occooo—n-n— ,,
A.
e—v—oo—acoooo—m—v—oocooo fig
0
vcc—ommoocoooommmc—u— g2
ncoocoocccoooco—n—coo GE
Nocoocoooooococoo—oo a”
“‘73
:9“ ~82 "8%
952 a E .22 =1
50502 :33. §£§fi 883379. °m
°°euR'B°°E'“g'\§N‘-=8~EOV =0
“°33=§5805-~§~¢£e8ee as
aggonscmg-fiuagfigg‘hfin v8
25° essesa‘ “gas 33 a:
asssgssssss§§§ue§§§§ 0%
-
egaasesesgsss§se§§§ fit
mQVQQQQ‘EQQVQQQmUUQGG [‘5

 

8

Characters

12345678910111213141516171819202122232425

1001

3
3

1

0

2

0 0

100
l
1
l
0
1
l

l
1

100

l
1

00 0
00 0
000

0 0

0 0
0

0 0
0 0 0
0 0 2
0 0 0
0 0 0
0 0 0
0 0 0

l

1100 2
1

1
l

2
3
0
3

0 0
0 0
0 0

l

1
l

l
0

1
1

l
l

1
l
1

000

000
000
000

l

000

 

 

Species

 

Gonasida elata

Heterasida bifia'ca

Heterasida connivens

Heterasida subvittata

Megasida obliterata

Megasida tenuioollis l

Megasida tenuicollis 2

Microschatia rockefelleri
Parasida lirata

Parasida longicollis

Parasida sexcostata
Parasida n.sp. 1

§

Pelecyphorus mexicanus

"Pseudoglyptasida" n.sp. 1
Philolithus actuosus

Philolithus aegrotus

Philolithus demicollis

Philolithus morbillosus
Philolithus n.sp. 1

rr scores in Materials

cal character matrix of 100 characters for 58 OTUs. Characters and the

Morphologi

Table 1.4 (cont)

and Methods.

wmmn

 

 

 

101

acoccccccoccocoococc—u
xv—v—e—C—v—I—v—v—Occ—tl—iv—r—te—te—Iv—Oo
aI—I—Fflv—v—I—Iv—v—INNNv—v—t—iv—le—Iv—Is—Is—IN
gN—NNNNNNOOONNNNN—t—d—O
:~—_———_—I—_fi—l___~__~~
fimmmvvmvfimmmmmmmmmmmm
ENNNNNNmN—u—v—Nmmmmmmmm
afififi—fl—lfififl—IF‘I—FflfififiF—Iflfifi
:NNNNNNNNcOONNNNNNN——
anemmmmmmmmnmmmmmvvaa
flcocccccc—r—v—nccccocooc
z—n—u—n—n—u-r—nu—ncac—Oo—r—tu—c—n—oc
amen—r—m—uu—n—tOcOv—t—v—r—nq—r—rm—IO
ewfi—fiv—o—ofiOQO—c—uc—c—v—nc—
:occcooc————cocco—c——
SN—‘MMM—ImN—n—uv—nm—r—n—rv—t—n—n—n—r
av—rv—r—n—nv—t—v—t—nr—rv—rv—Iu-t—uv—r—uv—tv—r—n—‘c
Q—tv—r—v—I—uu—n—r—Occ—u—I—v—nv—r—n—r—Io
bc——~~o——ccc°oocccooo
e—noocccco—n—v—coccooo—u—
mF-i—Is-t—IU-iv-l—I—Iiv-II—v—lv—v—II—I-I—n—ie—iv—H
vmoocccccccccc—H—coacc
m—cccoccoccoccccocoec
Naccccccocccccccococe
fiflfiflflflfiI‘U—HflflflI—fififl—‘v—HF‘
.343 6 —NM
:3? g Q ofl-fi-fl EB
z. .33 see ~N= 3
-°" 5‘03 2": Eu ”*3
3": '888e3“5 °8§
° 38 g-Hfie‘nu. E "893
& '53 ' 68 Q m
2333 333 irrrs §
" §§§8°§ ‘5
§§§§ §§§§§§sta_ts,=
-~. 6
§~E ssssa~~ assesses
fig eeeggg ££§£§£P§
3 5kg g Esppppgp'B...
~. u u u I» £~~g~~u
mméeeeeeeeeee eeeeezfi

Ir scores in Materials

cal character matrix of 43 characters for 73 species. Characters are the

Morphologi

Table 1.4 (cont)

and Methods.

Characters

26272829303132333435363738394041424344454647

484950

2
2

0
0

4

3
2
2

0
0

0

 

 

Species

 

Ardmnimicus cognatoi 1

Ardamimicus cognatoi 2
Asidina confluens
Asidinafircata

Asidina parallela

Asidopsis mancipata

Asidopsis polita

Asidopsis opaca

Asidopsis macra

Asidopsis divaricata

Astrotusfascicrdatus

Astrotus guanajuatensis
Astrotus regularis

Branchus n.sp. I

102

Cardigenius Iaticollis

Craniotus pubescens
Eusatms reticrdatus

Glyptasida aegra

betasida sordida

rr scores in Materials and

cal character matrix of 100 characters for 58 OTUs. Characters and the

: Morphologi

Table 1.4 (cont)

Methods.

Characters
26272829303132333435363738394041424344454647484950

3
3

2

0
0

 

 

Species

 

Gonasida elata

Heterasida bifiaca

Heterasida connivens

Heterasida subvittata

Megasida obliterata

Megasida tenuioollis 1

Megasida tenuicollis 2

Microschatia rockefelleri

Parasida lirata

Parasida longicollis
Parasida sexcostata

Parasida n.sp. l

"Pseudogb’ptasida" n.sp. 1

Philolitlms actuosus

Pelecyphorus mexicanus

p—s
O
U.)

Philolithus aegrotus

Philolithus densicollis

Philolithus morbillosus
Philolithus n.sp. 1

Materials and

11' SCOICS m

cal character matrix of 100 characters for 58 OTUs. Characters and the

: Morphologi

Table 1.4 (cont)

Methods.

Characters

32 33 34 35 36 37 38 39 40 41

42 43 44 45 46 47 48 49 50

26 27 28 29 30 31

2
2
2

3

1/2

1/2

2

0
4
4

l
l
1

0
0
3
3
2

 

 

 

Species

Platasida embaphionides 4

Pymomorpha gibbicollis

Stenomorpha oostipennis 4

Stenomorpha rimatus

Stenomorpha maginata
Stenomorpha Iuctata

Stenomorpha obovata
Stenomorpha n.sp.1

Stenosides mtommis l

Stenosides anastomosis 2
Stenosides anastomosis 3

Stethasida obsoleta

Trichiasida acerba
Trichiasida hirsuta 1

§

Trichiasida hirsuta 2

Trichiasida hispidula

Trichiasida pubescens

Dichiasida unicostata

Ucalegon pulchellus
Zaleucus dilatatus

Morphological character matrix of 100 characters for 5 8 OTUs. Characters and their scores in Materials and

Table 1.4 (cont)

Methods.

Characters

5152535455565758596061626364656667

68 69 70 71 72 73 74 75

0
0

l

0
0
0

0
0

0

 

 

Species

 

Ardamimicus cognatoi 1

Ardamimicus cognatoi 2
Asidina confluens
Asidinafitrcata

Asidina parallela

Asidopsis mancipata
Asidopsis polita

Asidopsis opaca

Asidopsis macra

’ata

WI

Asidopsis div

Astrotus fasciadatus

Astroms guanajuatensis
Astrotus regularis
Branchus n.sp. l

105

Cardigenius Iaticollis
Craniotus pubescens
Eusatms reticulatus

Gbptasida aegra

Glyptasida sordida

Materials and

11' SCOICS 1n

cal character matrix of 100 characters for 58 OTUs. Characters and the

: Morphologi

Table 1.4 (cont)

Methods.

Characters

5152535455565758596061626364656667

68 69 70 71 72 73 74 75

0
0
0

0
0
0

0 0/1
0 0/1
0 0/1

0
0
0

0
0

1

0

0

 

 

Heterasida subvittata

Heterasida bifitrca
Heterasida connivens
Megasida obliterata

Gonasida elata

Species

 

Megasida tenuioollis l

Megasida termicollis 2

Microschatia rockefelleri

Parasida lirata

Parasida longicollis
Parasida sexcostata

Parasida n.sp. 1

Pelecyphorus maicanus

é

"Pseudoglyptasida" n.sp. 1
Philolithus actuosus

Philolithus aegrotus
Philolithus densicollis

Philolithus morbillosus
Philolithus n.sp. 1

Morphological character matrix of 100 characters for 58 OTUs. Characters and their scores in Materials and

Table 1.4 (cont)

Methods.

Characters

585960616263646566676869707172737475

51525354555657

0

0
2
3

0

0
0

0
0
0
0
0
0
0
0

0
3
2
2
2
1
3
3

0
0
0
0
0
0

0
0
0
1
l

 

 

 

Platasida embaphionides 0
Pycnomorpha gibbicollis 0

Stenomorpha costipennis 0
Stenomorpha rimatus

Stenomorpha marginata
Stenomorpha lactata

Stenomorpha obovata
Stenomorpha n.sp.1
Stenosides anastomosis l
Stenosides anastomosis 2 0
Stenosides anastomosis 3 0
Stethasida obsoleta
Trichiasida acerba
Trichiasida hirsuta l

107

Trichiasida hirsuta 2

Trichiasida hispidrda

Trichiasida pubescens
Trichiasida unicostata

Ucalegon pulchellus

Zaleucus dilatatus

1r scores in Materials and

cal character matrix of 100 characters for 58 OTUs. Characters and the'

: Morphologi

Table 1.4 (cont)

Methods.

Characters
767778798081828384858687888990919293949596979899100

0

l

l

0

0
2

0

 

 

Species

 

Ardamimicus cognatoi l

Ardamimicus cognatoi 2 0
Asidina confluens
Asidinafltrcata

Asidina parallela

Asidopsis mancipata
Asidopsis polita

Asidopsis opaca

Asidopsis macra

Asidopsis divaricata

Astrotusfasciculatus

Astrotus guanajuatensis
Astrotus regularis

Branchus n.sp. I

Cardigenius Iaticollis

108

Craniotus pubescens

Eusattus reticulum
Glyptasida aegra

Glyptasida sordida

° Materials and

11' scores In

cal character matrix of 100 characters for 58 OTUs. Characters and the'

: Morphologi

Table 1.4 (cont)

Methods.

Characters

767778798081828384858687

888990919293949596979899100

1

l
l

0

l

0

0
l

0
0

 

 

S

 

Gonasida elata

Heterasida bifitrca

Heterasida connivens

Heterasida subvittata

Megasida obliterata

Megasida tenuicollis l

Megasida tenuioollis 2

Microschatia rockefelleri

Parasida lirata

Parasida longicollis
Parasida sexcostata

Parasida n.sp. 1

§

Pelecyphorus mexicanus

"Pseudoglyptasida" n. sp. 1
Philolithus actuosus

Philolithus aegrotus
Philolithus densicollis

Philolithus morbillosus
Philolithus n.sp. 1

' Materials and

11' SCOTCS 111

cal character matrix of 100 characters for 58 OTUs. Characters and the'

: Morphologi

Table 1.4 (cont.)

Methods.

Characters

767778798081828384858687888990919293949596979899100

l
l
1

1

l
1
l

0

0

l

l
l
l
l

0

 

 

Speci

 

Platasida embaphionides
Pycnomorpha gibbicollis

Stenomorpha costipenm's
Stenomorpha rimatus

Stenomorpha marginata
Stenomorpha Iuctata

Stenomorpha obovata

Stenomorpha n.sp.1

Stenosides anastomosis 1

Stenosides anastomosis 2 0
Stenosides anastomosis 3

Stethasida obsoleta

T richiasida acerba
Trichiasida hirsuta l

s—r
1—1
0

T richiasida hirsuta 2

Trichiasida hispidula

Trichiasida pubescens

Trichiasida unicostata

Ucalegon pulchellus

Zaleucus dilatatus

1r scores in Materials and

a1 character matrix of 100 characters for 58 OTUs. Characters and the'

: Morphologic

Table 1.4 (cont.)

Methods.

 

Figure 1.5: Dorsal habitus of Ardamimicus cognatoi Smith, n. gen. and n.sp., l]
(L=12.1mm)

111

 

Figure 1.6: Dorsal habitus of Craniotus pubescens LeConte, l] (L=-8.9mm)

112

 

Figure 1.7: Dorsal habitus of Ferveoventer browni Smith, 11. gen. and n.sp. (L=9.4mm)

113

 

Figure 1.8: Dorsal habitus of F erveoventer planatus (Champion), (L=7.9mm)

114

 

Figure 1.9: Dorsal habitus of Heterasida bifurca (LeConte), (3‘ (L=9.6mm)

115

 

Figure 1.10: Dorsal habitus of Heterasida connivens (LeConte), £2 (L=9.4mm)

116

 

Figure 1.11: Dorsal habitus of Litasida townsendi Casey, 6‘ (L=11.0mrn)

117

 

Figure 1.12: Dorsal habitus of Micrasida obiernorum Smith, n. gen. and n.sp.,
(1:5.9mm)

118

 

Figure 1.13: Dorsal habitus of Microschatia rockefelleri Pallister, (L=14.0mm)

119

 

Figure 1.14: Dorsal habitus of Pelecyphorus mexicanus Solier, (L=16.3mm)

120

 

Figure 2.15: Dorsal habitus of Philolithus aegrotus (LeConte), (L=14.1mm)

121

 

Figure 1.16: Dorsal habitus of Stenomorpha obovata (LeConte), (3‘ (L=19.6mm)

122

CHAPTER TWO
Revision of the genus Pelecyphorus Solier, 1836

(Coleoptera: Tenebrionidae: Asidini)

123

ABSTRACT

A taxonomic revision of the North American genus Peleqphorus Solier is
presented. Eight subgenera are erected and described. Seven are based on the existing
Asidini genera Pelecyphorus Solier sensu stricto, Astrotus LeConte, Stenosides Solier,
Ucalegon Champion, Zaleucus Champion, Plesiasida Smith (=Parasida Casey), and
Sicharbas Champion. One new subgenus, Variodorsus, is described.

Forty species of Peleqphorus are recognized as valid, including seven new
species described herein: P. cavatus, P. cifirentesi, P. crypticus, P. deaztlani, P. doyeni,
P. oaxacensis, and P. triplehorni. All valid species are described or redescribed, along
with diagnoses, distributions, and images of each. An illustrated key to the subgenera and
species is also provided.

Twenty-four previously described species are presented as new synonyms: P.
anastomosis (Say) (=P. breviuscula (Casey); =P. exoleta (Casey); =P. luteotecta (Casey);
=P. monticola (Casey); =P. obtecta (Casey); =P. sigillata (Casey)), P. graciliformis
(Solier) (=P. canus (Champion); = P. sinuaticollis (Charnpion)), P. erosus (Champion)
(=P. nosodermoides (Charnpion)), P. guanajuatensis (Champion) (=Stenomorpha
mucorea (Wilke)), P. dispar (Champion) (=P. bisinuatus (Pallister); =P. kulzeri
(Pallister); =P. trisinuatus (Pallister)), P. Iiratus (LeConte) (=Iaciniatus (Casey); = P.
cristatus (Pallister)), P. asidoides Solier (=zacualpanicolus (W ilke)), P. fallax
(Champion) (=P. favosus (Champion); = P. similatus (Charnpion)), P. Iaticollis
(Champion) (=P. planatulus (Casey)), P. scutellaris (Champion) (=P. tolucanus (Casey)),
P. longipennis (Champion) (=P. mixtecae (Wilke); =P. esperanzae (W i1ke)), P. tristis

(Champion) (=P. purpusi (Wilke)), P. indutus (Champion) (=P. bicarinatus (Champion)).

124

INTRODUCTION

Pelecyphorus Solier is a large morphologically diverse genus of asidine darkling
beetles (Tenebrionidae: Asidini) endemic to Mexico and the southwestern United States.
Like all asidines, Pelecyphorus species are flightless detritivores that lack defensive
glands and spend much of their lives as subterranean larvae. Solier (1 83 6) erected the
genus to hold four new species, three fi'om Mexico (P. mexicanus, P. foveolatus, and P.
asidoides) and one from South Africa (P. capensis), the last of which was subsequently
removed from the genus (Lacordaire 1859). Pelecyphorus was originally defined based
on the following characters: apical segment of the maxillary palp enlarged, antennal
segments 3-9 cylindrical, and distal tarsomere on the hind leg longer than the three
preceding segments. However, these characters are present in a majority of the nearly 300
species of North American Asidini, only three of which had been described before
Solier’s publication. Because of the overly generalized original description, nearly all of
the asidines described over thirty-four years by LeConte, were placed in Pelecyphorus.

In his revision of the Tenebrionidae north of Mexico, Horn (1870) synonymized
Pelecyphorus and several other North American asidine genera with the Mediterranean
genus Asida, citing the lack of clear boundaries separating them. During the next forty
years over 100 additional asidine species were described from Mexico and the
southwestern United States, with most placed directly into Asida. Then Casey (1912)
revised the North American asidine fauna and resurrected Pelecwhorus along with
nearly all of the previously described genera. Casey designated Pelecyphorus mexicanus
Solier as the type species for the genus based on the illustrations in Solier (1836). It is

worth noting that he had never actually examined a specimen of P. mexicanus. Casey

125

redefined the genus based on a combination of homoplastic characters and characters that
previously had delimited the genus Philolithus Lacordaire, 1859. All of the former
Philolithus species were added to Pelecyphorus, while two of the original Pelecyphorus
species (P. foveolatus, and P. asidoides) were moved into Casey’s new genus Parasida.
Brown (1971b) studied the type series of P. mexicanus and determined that it was far
removed fiom the species added to Pelecyphorus by Casey. Brown resurrected
Philolithus and restricted the genus Pelecyphorus to the type species pending further
study.
A phylogenetic analysis of the North American Asidini genera (Smith 2010, Chapter
1) determined that P. mexicanus belonged within a larger clade of asidine species, which
included the other two North American Pelecwhorus species descibed by Solier (P.
foveolatus and P. asidoides) and six previously described genera (Astrotus LeConte,
Stenosides Solier, Ucalegon Champion, Zaleucus Champion, Plesiasida Smith
(=Parasida Casey), and Sicharbas Champion). In order to maintain stability and
recognize the morphological diversity represented within this group of species, an
expanded definition of Pelecyphorus was presented and the other genera within the clade
were assigned subgeneric status within Pelecyphorus sensu lato.
In this study I revise the genus Pelecyphorus. Eight subgenera and 40 species are
described, including one new subgenus and seven new species. A key to the species is

provided along with diagnoses, distributions, and images of each.

126

METHODS AND MATERIALS

The results of this study are based on an examination of approximately 1,654
Pelecyphorus specimens, including type material from all but two species. Type
specimens for P. anastomosis and P. graciliformis are lost and presumed to be destroyed.
Neotypes were designated for both species based on their original descriptions,
illustrations, and ranges.

Only morphological characters drawn from adult specimens were used in this study
and the phylogenetic species concept as defined in Wheeler and Platnick (2000) was
employed to delimit taxa. The morphological characters and methodology used in this

revision follow those presented in Chapter 1.

RESULTS

Taxonomy of Pelecyphorus Solier
Pelecyphorus Solier
Pelecyphorus Solier, 18362467. Type species: Pelecyphorus mexicanus Solier, 18362469,
by subsequent designation, Casey 19122105. Lectotype (MNHN).

subgenus Pelecyphorus Solier, 18362467, sensu strictu.

subgenus Astrotus LeConte, 1858219. Type species: Microschatia contorta LeConte,

1858, by original designation.

127

subgenus Stenosides Solier, 1836:484. Type species: Stenosides graciliformis Solier,
1836, by monotypy.

=Pactostoma LeConte, 1858219. Type species: Asida anastomosis Say, 1824, by
original designation.

=010glwtus Lacordaire, 18592158 (unnecessary replacement name).

subgenus Ucalegon Champion, 1884265. Type species: Ucalegon pulchellus

Champion, 1884.

subgenus Pleisiasida Smith, (=Parasida Casey 19122126, junior homynym). Type

species: Parasida laciniata Casey, 1912. New Replacement Name.

subgenus Sicharbas Champion, 1884267 . Type species: Sicharbas lobatus Champion,
1 884.

subgenus Variodorsus Smith. Type species: Asida guanajuatensis Champion, 1884.
New Subgenus.

subgenus Zaleucus Champion, 18922491. Type species: Zamolxis dilatatus

Champion, 1884.

Redescription. Length: 6.0-22.9 mm, width: 2.3-11.1 mm; integument ferruginous to
black; body obovate to elongate and nearly parallel sided; densely setose or sparsely
setose, occasionally setae inconspicuous; setae ofien modified, lanceolate, squamate, or

stellate in shape. Head: Mentum variable, trapezoidal to broadly cordate; contacting

128

postgenal processes or not, if tightly contacting postgenal processes then also reaching
mandibles when closed; lateral margins straight or curved inward at apicies; anterior
margin straight to weakly emarginate, medially notched or not. Ligula; sclerotized small,
one-fourth to one-sixth mentum width, and thin, length approximately 5X width; slightly
curved and partially visible above anterior margin of mentum or straight and concealed.
Apical segment of maxillary palps enlarged, securiform to scalene in shape, more
expanded in males. Submentum barely or distinctly projecting into buccal cavity; width
two-thirds to equal that of buccal cavity, concealing or partially exposing maxillary
cardos laterally. Postgena concealing mandibular protuberance; postgenal processes
slightly to greatly swollen; produced, extending to middle of mentum or beyond, acute to
broadly rounded. Labral margin straight or broadly emarginate, medially without setal
brush; medial tormal process of labrum shorter than posterior tormal process; clypeal
membrane concealed or rarely exposed. Clypeal margin straight or emarginate. Eyes
elongate, oval or reniform, partially concealed when head is retracted. Antenna weakly
clavate; nearly moniliform; segments 10-11 rounded or laterally flattened , forming a
slight club; tomentose sensilla absent on antennal segment 9; apical tomentose sensilla
present on antennal segment 10, separated into two patches at lateral apices or coalesced
into a single band; antennal segment 11 one-fourth to two-thirds size of segment 10,
apical tomentose sensillum covering one-sixth to one-half of segment. Prothorax:
Pronotal shape and sculpturing variable, with or without a median costa or paramedial
fossae, lacking paramedial basal gibbosities; pronotal margin costate, medially acutely
expanded or not; anterior apicies produced, acute or rounded, posterior apicies obtuse or

acute, projecting over elytra] humera or not; posterior margin straight, slightly convex, or

129

weakly bisinuate, often with a medial tooth projecting posterad. Prostemal process thin,
declivious behind procoxae or raised and projecting behind procoxal cavities, apex
truncate, broadly rounded, or sagittate; if raised then received in shallow or moderate
emargination between mesocoxae. Pterothorax: Apterous. Scutellum triangular, visible
or mostly concealed underneath elytra, not raised above scutum; mesonotum with two
faint or deep transverse depressions, often leaving a thin medial ridge between the
scutellum and scutum. Elytral sculpturing variable, discal costae present or faintly
indicated, marginal costae rarely lacking; epipleura indistinct. Metendosternite stem
approximately as twice wide as tall. Legs: Ferruginous to nearly black, tarsal formula 5-
54; pro- and mesocoxae globular, metacoxae more transverse; mesocoxal cavities open
or externally closed by sternites; mesotrocantin small to minute, concealed or exposed;
protibia with outer apical margin forming a spine; protibial outer lateral margin not
carinate; inner apical margin of protibia with two spurs, posterior spur shorter than
anterior spur. Abdomen: Punctation and setation variable; intercoxal process impressed
around margin or not, rounded or truncate at apex. Female apical coxites ventrally
flattened; three to twelve spermathecal branches present, emerging from apex of common
duct; accessory gland short or long, with an enlarged chamber absent or rarely present
near apex.

Diagnosis. Pelecyphorus is distinguished from all other asidine genera by a unique
combination of the following characters: Ligula small, one-fourth to one-sixth mentum
width, and thin, length approximately 5X width; partially visible above anterior margin of
mentum or straight and concealed. Scutellum not raised above scutum; mesonotum with

two faint or deep transverse depressions. Anterior protibial spur longer than posterior.

130

Distribution. Mexico: representatives are known from every state with the exceptions of

Chiapas, Yucatan, Tabasco, and Baja California Norte. United States: Arizona, Colorado,

Kansas, New Mexico, Texas.

2(1)

3(2’)

Key to the Species of Pelecyphorus Solier
Mentum completely filling buccal cavity, tightly contacting postgenal processes
and contacting or nearly contacting mandibles at apex; submentum wide, more
than 4/ 5 buccal cavity width, reaching postgena or laterally exposing a minute
space ..................... 2
Mentum not filling buccal cavity, if contacting postgenal processes then not
reaching mandibles at apex; submentum narrower, 4/5 buccal cavity width or less,
laterally exposing a large space ............................................................................. 19
Anterior apicies of mentum expanded and curved inward towards mandibles;
mesotrocantin concealed; large tubercle present on hypomeron margin behind
eye; Astrotus-type stellate setae present; dorsal surface evenly, thickly encrusted
with debris; (subgenus Astrotus LeConte) ............................................................... 4
Anterior apicies of mentum straight or slightly curved inward, not significantly
expanded; mesotrocantin usually exposed; large tubercle absent on hypomeron;
Astrotus-type stellate setae absent; dorsal surface encrusted with debris or not; ...3
Ligula small, straight, and concealed underneath mentum; postgenal processes
broadly rounded and swollen; pronotum without tubercles; (subgenus Stenosides

Solier) ...................................................................................................................... 8

131

4(2)

5(4)

6(5)

7(5’)

3(3)

9(8’)

Ligula larger, curved, and usually exposed above anterior margin of mentum;
postgenal processes acute, not swollen; pronotum tuberculate;

(subgenus Sicharbas Champion) ........................................................................... 14
Elytral humera carinate and reflexed; pronotum with a longitudinal medial
depression; elytra with transverse costae or nodules .............................................. 5

Elytral humera obtuse; pronotum without a longitudinal medial depression; elytra

lacking transverse costae or nodules .............................. P. (A.) hebes (Champion)
Lateral margin of elytra with large or small projections .......................................... 6
Lateral margin of elytra tuberculate, but lacking projections .................................. 7

8-10 large lateral projections on elytron margin; prostemal process raised behind
procoxa ........................................................................ P. (A.) contortus (LeConte)
12 or more small lateral projections on elytron margin; prostemal process
deflexed behind procoxa ................................................. P. (A.) alveolatus (Casey)
Pronotum broadly sinuate; sutural costa not raised .......... P. (A.) regularis (Horn)
Pronotum acutely sinuate, sharply dilated near middle; sutural costa raised
................................................................................... P. (A.) cmticus Smith, n. sp.
Median ridge on pronotum strongly raised and triangularly expanded in basal half,
forming a large bifurcate process projecting past basal pronotal margin; elytral
humera prominent and reflexed; south Texas ............... P. (S.) taxanus (W ickham)
Median ridge on pronotum absent or slightly raised, never triangularly expanded
or forming a large process; elytral humera small or oblique, not reflexed .............. 9
Frontoclypeal suture deeply, transversely excavated; pronotal marginal costa

absent or faintly indicated over most of length; Mexico: Coahuila ...........................

132

..................................................................................... P. (S.) cavatus Smith, n. sp.
- Frontoclypeal suture weekly or strongly depressed, not forming a deep
excavation; pronotal marginal costa raised and distinct over entire length .......... 10

10(9’) Pronotal disc confluently foveate; antennal segment 11 small and deeply

amplected into segment 10 ........................................... P. (S.) limosus (Champion)
- Pronotal disc densely, but not confluently foveate; antennal segment 11 larger and
barely amplected into segment 10 .......................................................................... 11

11(10’) Ely1ral marginal costa densely tuberculate and setose, submentum not

transversely depressed ........................................................................................... l2
- Elytral marginal costa not tuberculate or setose, submentum deeply transversely
depressed; Mexico, Nuevo Leon ............................... P. (S.) deaztlani Smith, n. sp.

12(11) Pronotal marginal costa crenulate and reflexed; elytra without transverse costae

.................................................................................... P. (S.) graciliformis (Solier)
- Pronotal marginal costa punctate, not reflexed; elytra with irregular transverse
costae ...................................................................................................................... 13

13(12’) Transverse costae on elytra absent between discal costa and elytral suture; crests

of elytral costae densely tuberculate and setose ............. P. (S.) anastomosis (Say)
- Transverse costae on elytra present between discal costa and elytral suture; crests
of elytral costae sparsely setose and smooth .......... P. (S.) triplehorni Smith, n. sp.

14 (3 ’) Tomentose sensilla on antennal segment 10 coalesced into a broad continuous

band. ....................................................................................................................... 15

Tomentose sensilla on antennal segment 10 not forming a broad continuous band,

separate or meeting on one side ............................................................................. 17

133

15(14) Pronotum medially longitudinally depressed, apical protibial spine small and
setose to apex ......................................................................................................... 16
- Pronotum medially tuberculate, not longitudinally depressed, apical protibial
spine large and glabrous ............................................ P. (S.) seticorm’s (Champion)
16(15) Pronotum angularly sinuate, dilated before middle and forming a triangular
flange, posterior apicies projecting over elytra ............ .P. (S.) lobatus (Champion)
- Pronotum sinuate, dilated before middle and forming a broadly rounded flange,
posterior apicies not projecting over elytra ............ P. (S.) oaxacensis Smith, n. sp.
17( 14’) Pronotal disc foveate, fovea subtended by tubercles; elytra clothed with squamate
and lanceolate erect setae, elytral humera not reflexed ......................................... 18
- Pronotal disc foveate, lacking tubercles; elytra clothed with lanceolate decumbent
setae, elytral humera reflexed; Mexico, Durango ....... P. (S.) undatus (Champion)
18(17) Elytral discal costa absent; pronotal margin strongly sinuate; dark coalesced
patches of erect setae present on posterior half of elytra; Mexico, Puebla ................
....................................................................................... P. (S.) debilis (Champion)
- Elytral discal costa present in basal half or throughout; pronotal margin arctuate
or slightly sinuate; dark coalesced patches of erect setae absent on elytra; Mexico,
Hidalgo ........................................................................... P. (S.) erosus (Champion)
19(1’) Dense tomentose fringe present on abdominal ventrites 1-4; elytra costae
confused, coarsely reticulate, whitish Pelecyphorus-type stellate setae densely
packed into elytral depressions ..................... P. (Pelecyphorus) mexicanus Solier
- Tomentose fringe absent on all abdominal ventrites ; elytra costae variable;

setation variable, but never with Pelecyphorus-type stellate setae ........................ 20

134

20(19’) Squamate and erect lanceolate setae present on elytra, squamate setae white,
black, or reddish, forming a distinctive contrasting pattern with two dense black
triangular patches halfway down elytral length; pronotum usually with a broad
median depression ........................................ P.(Ucalegon) pulchellus (Champion)

- Setae variable, but lanceolate setae never erect and squamate setae, if present, not
forming a distinctive pattern; pronotum never broadly medially depressed .......... 21

2 1 (20’) Elytral humera oblique; setae sparse, hair-like or narrowly lanceolate; pronotum
lacking fossae; (subgenus Zaleucus Champion) ................................................... 22

- Elytral humera planate, often reflexed; setae dense, squamate or lanceolate, or
absent; pronotum with two or four fossae .............................................................. 25

22(21) Pronotal margin arctuate, posterior apicies obtuse; prostemal process deflexed
behind procoxae. .................................................................................................... 23

- Pronotal margin sinuate, posterior apicies acute, projecting or not; prostemal
process raised behind procoxae ............................................................................. 24

23(22) Pronotum dilated; postgenal processes greatly swollen and projecting nearly to
anterior margin of mentum; intercostal spaces on elytra smooth of weakly rugose;
Oaxaca and Puebla .................................................... P. (Z.) dilatatus (Champion)

- Pronotum not dilated; postgenal processes slightly swollen and not projecting
nearly to anterior margin of mentum; intercostal spaces on elytra strongly rugose;
Coahuila, Nuevo Leon, or Zacatecas ............................ P. (2.) doyeni Smith, n. sp.

24(22’) Posterior apicies of pronotum not projecting, apex of prostemal process rounded;
elytral marginal carina crenulate in apical third; intercostal spaces on elytra

smooth ................................................................. P. (Z.) platesthoides (Champion)

135

- Posterior apicies of pronotum projecting, apex of prostemal process acute; elytral
marginal carina smooth in apical third; intercostal spaces on elytra rugose
............................................................................................ P. (Z.)foveolatus Solier

25(21’) Mentum reaching postgenal processes; antennal segment 11 one-fourth size of
segment 10; (subgenus Variodorsus, 11. sub. gen.) ............................................... 26

- Mentum not reaching postgenal processes; antennal segment 11 approximately
one-half size of segment 10; (subgenus Plesiasida, nomen novem, =Parasida
Casey) .................................................................................................................... 27

26(25) Pronotumwith a raised medial ridge; elytra with discal costae present and
bifurcate, inner branch eroded after basal third, densely clothed in multicolored
erect squamate and lanceolate scales, forming irregular darker points and lines
across surface. ...................................................... P. (V.)fasciculatus (Champion)

- Pronotumlacking a raised medial ridge; elytra with a ntework of raised carinate
costae, densely clothed with short pale squamate scales ...........................................
......................................................................... P. (V.) guanajuatensis (Champion)

27(25’) Pronotal posterior apicies produced and projecting over elytral humera; pronotal
posterior margin with a tomentose fringe .............................................................. 28

- Pronotal posterior apicies not or weakly produced, not projecting over elytral

humera; pronotal posterior margin without a tomentose fiinge ............................. 36
28(27) Elytral base depressed and tomentose .................................................................... 29
- Elytral base not depressed or tomentose ................................................................ 31

29(28) Discal costa branches not meeting at base; abdominal punctures minute; medial

tooth present on pronotal posterior margin ............................................................ 30

136

- Discal costa branches meeting at base; abdominal punctures minute; medial tooth
absent on pronotal posterior margin .............................. P. (P.) dispar (Champion)
30(29) Pseudoepiplura punctate and tuberculate, lanceolate setae emerging from
tubercles; USA: NM, AZ, or Mexico: Chihuahua ........... P. (P.) liratus (LeConte)
- Pseudoepiplura nearly irnpunctate and not tuberculate, lanceolate setae nearly
absent; Mexico: Durango ................................................... P. (P.) bibasalis (Casey)
31(28’) Elytral costae raised and straight, intercostal regions with longitudinal lines of
squamate setae ....................................................................................................... 32
- Elytral costae barely indicated or weakly raised and reticulate, intercostal regions
setose or not, never forming longitudinal lines of squamate setae ........................ 35
32(31) Elytral costae thick and strongly raised, sides and crests of costae smooth rounded
and irnpunctate, elytra broadly convex .................................................................. 33
- Elytral costae thin and weakly raised, tubercles and scales covering sides and
occasionally crests; elytra nearly planate ................... P. (P.) Iaticollis (Champion)
33(32) Elytral costae sharply raised, transverse costae common, usually with one to six;
median row of dark intercostal scales wide, nearly reaching costae; pronotum with
brown squamate scales .................................................... P. (P.)fallax (Champion)
- Elytral costae broadly rounded, transverse costae rare, usually absent or with no
more than two; median row of dark intercostal scales thinner than lateral rows of
white scales; pronotum with pale squamate or lanceolate scales .......................... 34

34(33’) Pronotum arctuate, narrowest at apex, widening to middle, nearly parallel sided to

base; psedoepiplura tuberculate and densely clothed with squamate scales ..............
.......................................................................................... P. (P.) obliviosus (W ilke)

137

- Pronotum weakly sinuate, widest near middle; pseudoepipleura punctate and
sparsely clothed with short acuminate setae ........... P. (P.) scutellaris (Champion)
35(31’) Elytral discal costa low and reticulate; pronotal medial ridge absent or faintly
indicated; combined protarsal segments approximately two-thirds length of
protibia ................................................................................. P. (P.) asidoides Solier
- Elytral discal costa indistinct among confused network of low costae; pronotal
medial ridge present and raised; combined protarsal segments subequal to length
of protibia; Jalisco .................................................... .P. (P.) intricatus (Champion)
36 (27’) Elytral discal costa distinctly divided, inner branch raised; central continental
Mexico .................................................................................................................. 37
- Elytral discal costa absent or inner branch not raised; Baja California Sur
................................................................................................................................ 39
37(3 6) Elytra glossy black, setae minute and inconspicuous; legs ferruginous; crests of
costae smooth and irnpunctate ........................................ P. (P.) m'stis (Champion)
- Elytra dull black or ferruginous, densely setose; legs variable; crests of costae
setose, punctate or tuberculate ............................................................................... 3 8
38(37’) Labral margin emarginate; elytral costae tuberculate with erect acuminate setae;
setae on tarsal venter short and spiniform .................... P. (P.) indutus (Champion)
- Labral margin truncate; elytral costae punctate with thin decurnbent setae; setae
on tarsal venter long acuminate and golden .......... P. (P.) longipennis (Champion)
39(36’) Elytral discal and marginal costae absent; pronotal margin strongly reflexed;

elevation 4500’ or more ........................................... P. (P.) cifuentesi Smith, n. sp.

138

- Elytral discal and marginal costae present; pronotal margin straight or weakly

reflexed; elevation 1500’ or less .................................. P. (P.) sexcostatus LeConte

subgenus Astrotus LeConte, 1858
Astrotus LeConte 1858219. Type species: Microschatia contorta LeConte, 18532446, by

original designation.

Description. Length 8.7 - 22.9mm, width 4.7 - 11.1mm. Integument black or
ferruginous; densely covered in Astrotus-type stellate setae raised on small tubercles.
Head: Retractable into pronotum past eyes. Mentum large, completely filling buccal
cavity, sub-trapezoidal; anterior margin broadly emarginate or nearly straight; lateral
margins curved inward at apicies. Ligula small, less than one-fifth mentum width, straight
or slightly curved, concealed or barely visible. Apical segment of maxillary palps
securiform to triangular. Submentum broad, laterally contacting postgena, concealing
maxillary cardos. Postgenal process produced, swollen, broadly rounded. Labrum with
apical margin emarginate; clypeal membrane concealed. Clypeal margin straight. Frons
shallowly foveate and tuberculate, median pit deeply to faintly depressed; frontoclypeal
suture deeply to faintly depressed; dorsal sulcus absent above apices of eyes; eyes
elongate and slightly reniform. Antenna compact, weakly clavate; antennal segments 3-9
rounded, moniliform; segments 10 and 11 slightly flattened, forming a club; antennal
segment 10 subquadrate, two tomentose sensory patches present at lateral apices;
antennal segment 11 with a small apical tomentose sensory patch, amplected into

segment 10. Prothorax: Pronotum widest at middle, sinuate or sharply angulate; median

139

longitudinal depression present, often with a faint carina visible at over part of length and
forming a small tooth at base; lateral costae present. Large nodule projecting from
anterior margin of hypomeron. Prostemal process raised and thickened behind procoxal
cavities; apex broadly rounded or sagittate. Pterothorax: Scutellum triangular, straight
and not reaching height of scutum; mesonotum with two transverse glaberous
depressions, open at base, between the scutellum and scutum or laterally eroded. Elytral
sculpturing variable; eltral humera planate or reflexed. Marginal costa present, crenulate
with tubercles or larger projecting nodules; generally divided, inner branch reduced to
nodules. Discal costa present, reticulate or straight, serrated or not. Sutural costa present
or absent. Transverse ridges between elytral costae present or absent, position variable.
Legs: Mesotrocantin small to minute, concealed or exposed; femura and tibia shallowly
nearly confluently foveolate, both densely clothed with stellate setae. Abdomen:
tuberculate with stellate setae; intercoxal process width equal to mesostemal apex,
anterior margin nearly straight.

Diagnosis. The species in the subgenus Astrotus are distinguished fi'om all other
Pelecyphorus species based on a unique combination of the following characters: body
densely covered in Astrotus-type stellate setae raised on tubercles and usually evenly
coated with debris; mentum completely filling buccal cavity, sub-trapezoidal, anterior
margin broadly arctuate and reaching base of mandibles when closed, lateral apicies
expanded and strongly bent inward towards mandibles; ligula less than one-fifth mentum
width, concealed; apical segment of maxillary palps securiform or triangular; labral
margin straight; postgenal process produced, slightly swollen, broadly rounded; large

projecting nodule present on anterior margin of hypomeron.

140

Distribution. Arid habitats from central and southern Mexico to the western United
States. The states where they are currently known to occur are MEXICO: Coahuila,
Durango, Nuevo Leon, Tamaulipas; USA: Texas, Kansas.

Biology. Species from this subgenus have been collected from underneath rocks or plant
debris and from the area surrounding Pogonomyrmex ant nests. Specimens have been
observed feeding on plant debris in Pogonomyrmex midden heaps (Marion Smith, pers.

comm).

Species Descriptions

Pelecyphorus (Astrotus) alveolatus (Casey)

Astrotus alveolatus Casey 1912283

Pelecyphorus (Astrotus) alveolatus (Casey). Smith, 2010

Type Material. HOLOTYPE, by monotypy, (male) labeled: a) “Tex.”; b) on red paper,
“HOLOTYPE /Astrotus / alveolatus 6‘ / T.L. Casey, 1912” (NMNH).
Additional Material Examined (50 specimens). Texas: Brooks, Dirnmit, Hidalgo, Starr,

Webb Counties.

Redescription (see fig. 2.1). Length 9.8-13.6mm, width 4.7-7.1mm. Body generally
evenly thickly coated with debris. Head: Densely, shallowly foveate; fovea subtended by

Astrotus-type stellate setae, primary seta squamate; frontoclypeal suture and medial

141

depression on frons weakly impressed; epistoma broadly rounded, epistomal suture
obscured and not indented at margin; eye reniform, nearly flat, and sm'rounded by a black
callus; labrum nearly parallel sided; apical segment of maxillary palp securiform in both
sexes, slightly larger in males; mentum with erect pale spiniform setae and densely
foveate, minute tomenturn coating surface between fovea Tomentose sensilla on antennal
segment 10 broad and wrapping around apex, nearly meeting medially; apical tomentose
sensillum on antennal segment 11 covering one-third to one-half of segment. Prothorax:
Lateral margin acutely sinuate, dilated at middle and forming a triangular flange, apex of
flange reflexed; anterior apicies produced and acute, posterior apicies acute and barely
projecting over elytral humera, posterior margin nearly straight, occasionally with a
minute medial tooth. Pronotal disc densely, foveate; fovea subtended by Astrotus-type
stellate setae on small tubercles, primary seta squamate; longitudinal medial depression
usually distinct and glabrous; two elongate paramedial fossae present and glabrous.
Prostemal process broadly rounded, medially impressed, and deflexed behind procoxae.
Pterothorax: Elytra gradually widening to apical third, before sharply sloping and
tapering caudad; marginal costa present as an irregular row of small laterally projecting
tuberculate crests or nodules; elytral humera carinate and reflexed. Scutellum glabrous,
mesonotum smooth between scutellum and raised, shelf-like, scutum. Elytral disc
moderately punctate, clothed in stellate setae, and costate; sutural costa strongly raised at
base and partially covering scutellum, gradually eroding posterad and absent in apical
third; Discal costa not reaching elytral base and present as an elevated irregular row of
tuberculate crests and nodules, densely crowned with Astrotus-type stellate setae, primary

setae erect and squamate; transverse costa and nodules present between sutural costa,

142

discal costa, and marginal costae, variable in density and placement. Legs: Mesotrocantin
minute, concealed. F emora and tibia densely clothed in Astrotus-type stellate setae,
primary setae simple, decurnbent and nearly clear; tarsi venter with long pale spiniform
setae; protarsal segments combined approximately two-thirds length of protibia; anterior
protibial spur subequal to basitarsi. Abdomen: Densely shallowly foveate, fovea
subtended by Astrotus-type stellate setae, arising from minute tubercles.

Diagnosis. P. alveolatus can be separated from the other members of the Astrotus
subgenus based on the following character combination: tomentose sensilla on antennal
segment 10 large, curved around apex and nearly meeting; prostemal process declivious
behind procoxa; pronotal lateral margin acutely medially dilated and flanged, flange
reflexed; elytral marginal carinae with small laterally projecting crests and nodules.
Distribution. southern Texas.

Biology. Unknown. Collected in pitfall traps or from underneath cut yucca left out for 16-

17 months on sandy soil.
Pelecyphorus (Astrotus) contortus (LeConte)

Microschatia contorta LeConte, 1853 2446
Astrotus contortus (LeConte). LeConte, 1858219

Pelecwhorus (Astrotus) contortus (LeConte). Smith, 2010

Type Material. LECTOTYPE, designated here, (sex undetermined) labeled: a) red disc =

Texas; b) “Type / 4524”; c) “Astrotus / contortus LeC.”. (MCZ).

143

Additional Material Examined (36 specimens). Texas: Cameron, Dimmit, Jim Hogg,

Kenedy, Kleberg, San Patricio, and Willacy Counties.

Redescription (see fig. 2.2). Length 8.7-13.6mm, width 4.4-7.2mm. Body generally
evenly thickly coated with debris. Head: Densely clothed with Astrotus-type stellate
setae, primary seta short and spiniform, arising fiom small tubercles; fi'ontoclypeal suture
and medial depression on frons deeply impressed; epistoma broadly rounded, epistomal
suture obscured and not indented at margin; eye reniform, nearly flat, and surrounded by
a black callus; labrum nearly parallel sided; apical segment of maxillary palp securiform
in female, slightly larger and isotriangular in males; mentum with erect pale spiniform
setae and densely foveate, minute tomentum coating surface between fovea. Tomentose
sensilla on antennal segment 10 small and oval, not wrapping around apex; apical
tomentose sensillum on antennal segment 11 small, barely visible laterally. Prothorax:
Lateral margin acutely sinuate, dilated at middle and forming a triangular flange, apex of
flange straight or slightly reflexed; anterior apicies slightly produced and broadly
rounded, posterior apicies acute and barely projecting over elytral humera, posterior
margin nearly straight with a minute medial tooth. Pronotal disc densely, foveate; fovea
subtended by Astrotus-type stellate setae on small tubercles, primary seta squamate;
longitudinal medial depression usually distinct, glabrous in basal fourth; two elongate
paramedial fossae present and setose, occasionally divided into four rounded fossae.
Prostemal process raised behind procoxae, apex broadly rounded. Pterothorax: Densely,
evenly coated with Astrotus-type stellate setae arising from minute tubercles, primary

setae absent or short and spinifOrm. Elytra gradually widening to apical third, before

144

sharply sloping and tapering caudad; cauda slightly or strongly reflexed; marginal costa
present as an irregular row of 8-10 large lateral projections; elytral humera carinate and
reflexed. Scutellum small and glabrous, mesonotum tuberculate between scutellum and
raised, shelf-like, scutum. Elytral disc moderately punctate and costate; sutural costa
strongly raised at base and partially covering scutellum, gradually eroding posterad and
absent in apical third; discal costa present and not reaching elytral base, with irregular
projections increasing in size posterad; transverse costa present between sutural and
discal costae, absent between discal and marginal costae. Legs: Mesotrocantin minute,
concealed. Femora and tibia densely clothed in Astrotus-type stellate setae, primary setae
simple, decurnbent and nearly clear; tarsi venter with long pale spiniform setae;
combined protarsal segments approximately two-thirds length of protibia; anterior
protibial spur subeqaul to basitarsi. Abdomen: Densely clothed with Astrotus-type
stellate setae, arising fiom minute tubercles.

Diagnosis. P. contortus can be separated from the other members of the Astrotus
subgenus based on the following character combination: tomentose sensilla on antennal
segment 10 small, oval; prostemal process raised behind procoxa, apex rounded; pronotal
lateral margin acutely medially dilated and flanged, flange straight or barely reflexed;
elytral marginal carinae with 8-10 large lateral projections.

Distribution. southern Texas along the Gulf coast.

Biology. Unknown. Collected in pitfall traps set in sandy soil or fiom around

Pogonomyrmex nests.

145

Pelecwhorus (Astrotus) regularis (Horn)

Astrotus regularis Horn, 18702290

Pelecyphorus (Astrotus) regularis (Horn). Smith, 2010

Type Material. LECTOTYPE, designated here, (sex undetermined) labeled: a) “Tex”; b)
“Type No. 3941” [old AN SP number]; c) “A. / regularis / Horn”; d) “MCZ TYPE /
7191”. (MCZ).

Additional Material Examined (48 specimens). USA: Texas (Atascosa, Brewster,
Kinney, Pecos, Terrell, Uvalde, Val Verde Counties). MEXICO: Coahuila, Durango, and

Nuevo Leon.

Redescription (see fig. 2.3). Length 9.7-15.4mm, width 5.0-8.1mm. Body generally
evenly thickly coated with debris. Head: Densely clothed with Astrotus-type stellate
setae arising from small tubercles, primary seta long, pale, spiniform, and decurnbent;
frontoclypeal suture laterally impressed, medial depression faintly or deeply impressed;
epistoma broadly rounded, epistomal suture obscured and not indented at margin; eye
reniform, nearly flat, and surrounded by a black callus; labrum narrowing towards apex;
apical segment of maxillary palp securiform in both sexes; mentum with erect pale
spiniform setae and densely foveate, minute tomentum coating surface between fovea.
Tomentose sensilla on antennal segment 10 small and oval, not wrapping around apex;
apical tomentose sensillum on antennal segment 11 small, barely visible laterally.

Prothorax: Lateral margin broadly sinuate, dilated near middle, but not forming an acute

146

flange; anterior apicies slightly produced and broadly rounded, posterior apicies acute
and barely projecting over elytral humera, posterior margin nearly straight, occasionally
with a minute medial tooth. Pronotal disc densely clothed with Astrotus-type stellate
setae arising from large tubercles, primary setae short and spiniform or longer and
lanceolate; longitudinal medial depression usually glabrous throughout, apical third with
a low carina; two elongate paramedial fossae present or faintly indicated and setose.
Prostemal process broadly rounded, medially impressed or not, gradually deflexed behind
procoxae. Pterothorax: Densely, evenly coated with Astrotus-type stellate setae arising
from minute tubercles, primary setae short and spiniform or longer and lanceolate. Elytra
gradually widening to apical third, before sharply sloping and tapering caudad; cauda not
reflexed; marginal costa present and tuberculate, lacking lateral projections; elytral
humera carinate and reflexed. Scutellum small and glabrous, mesonotum glabrous and
impunctate between scutellum and raised, shelf-like, scutum. Elytral disc moderately
punctate and costate; sutural costa not raised; discal costa present and reaching elytral
base, irregular projections occassionaly present near posterior edge of costa; transverse
costa short, often connecting sutural and discal costae, never connecting discal and
marginal costae. Legs: Mesotrocantin minute, concealed. F emora and tibia densely
clothed in Astrotus-type stellate setae, primary setae simple, decurnbent and nearly clear;
tarsi venter with short pale spiniform setae; combined protarsal segments approximately
two-thirds length of protibia; anterior protibial spur shorter than basitarsi. Abdomen:
Densely shallowly punctate, punctures subtended by Astrotus-type stellate setae, arising

fi'om minute tubercles.

147

Diagnosis. P. regularis can be separated fi'om the other members of the Astrotus
subgenus based on the following character combination: tomentose sensilla on antennal
segment 10 small, oval; prostemal process gradually declivios behind procoxa; pronotal
lateral margin sinuate and broadly rounded; elytral marginal carinae without lateral
projections; elytral discal costa reaching anterior elytral margin.

Distribution. Known from western Texas and northeastern Mexico.

Biology. Unknown. Collected in pitfall traps set in sandy soil, under rocks, walking on
surface, or from around Pogonomyrmex nests.

Variation. Astrotus-type stellate setae on specimens from Mexico have a long lanceolate
seta as the primary setae and larger projections on the elytral discal costa posterad.
Mexican specimens may represent an undescribed sister species to P. regularis, but
further study and increased taxon sampling are needed before any definitive

determination can be made.

Pelecyphorus (Astrotus) hebes (Champion), New Combination

Ologljptus hebes Champion, 18922506
Stenosides hebes (Champion). Wilke, 19222268

Pelecyphorus (Astrotus) hebes (Champion). Smith, 2010

Type Material. LECTOTYPE, designated here, (sex undetermined) labeled: a) Orange
bordered white circle reading “Type”; b) “Villa Lerdo, / Durango. / Hoge.”; c)

“Ologlyptus / hebes, Ch.”; d) “Sp. figured”; d) “B.C.ACol.IV.1. / Ologlyptus / hebes”.

148

(BNMH). PARALECTOTYPES [all bearing the label “PARALECTOTYPE / Ologlyptus
/hebes / Champion, 1892 / det ADSmi ” on yellow paper]: 6 specimens (BMNH) all
bearing the same locality data as the lectotype.

Additional Material Examined. Three specimens (ZMHB), two labeled: “Mexico /

J .Flohr G.”, one labeled: “Coy”.

Redescription (see fig. 2.4). Length 18.8-22.9mm, width 9.5-1 1.1mm. Body generally
evenly thickly coated with debris. Head: Densely shallowly foveate, minute tomentum
coating surface between fovea, each fovea subtended by a decurnbent, pale, squamate
setae; fi'ontoclypeal suture laterally impressed, medial depression faintly or deeply
impressed; epistoma broadly rounded, epistomal suture obscured and not indented at
margin; eye reniform, nearly flat, and surrounded by a black callus; labrum laterally
rounded; apical segment of maxillary palp securiform in both sexes; mentum with erect
pale spiniform setae and densely foveate, minute tomentum coating surface between
fovea. Tomentose sensilla on antennal segment 10 small and oval, not wrapping around
apex; apical tomentose sensillum on antennal segment 11 small, barely visible laterally.
Prothorax: Lateral margin broadly sinuate, dilated near middle, but not forming an acute
flange; anterior apicies produced and rounded, posterior apicies acute, not projecting over
elytral humera, posterior margin nearly straight, lacking a minute medial tooth. Pronotal
disc densely shallowly foveate, minute tomentum coating surface between fovea, each
fovea subtended by a short, decurnbent, squamate setae; longitudinal medial depression
and paramedial fossae absent. Prostemal process medially impressed and deflexed behind

procoxae. Pterothorax: Densely, evenly coated with Astrotus-type stellate setae arising

149

from minute tubercles, primary setae short and nearly squamate. Elytra broadly ovate,
widest near middle; and tapering caudad; cauda not reflexed; marginal costa present and
tuberculate, lacking lateral projections, inner branch present as a short distinct ridge on
disc between margin and discal costa; elytral humera obtuse and not reflexed. Scutellum
glabrous and impunctate, mesonotum with a faint costa between scutellum and raised,
shelf-like, scutum. Elytral discal costa present, evenly raised and lacking projections;
sutural costa not raised; transverse costa absent. Legs: Mesotrocantin small, exposed.
Femora and tibia densely shallowly foveate, minute tomentum coating surface between
fovea, each fovea subtended by a decurnbent, pale, squamate setae; tarsi venter medially
glabrous with two lateral rows of short pale spiniform setae; combined protarsal segments
approximately two-thirds length of protibia; anterior protibial spur shorter than basitarsi.
Abdomen: Densely clothed with Astrotus-type stellate setae, arising from minute
nfinnfles

Diagnosis. P. hebes can be separated fiom the other members of the Astrotus subgenus
based on the following character combination: tomentose sensilla on antennal segment 10
small, oval; prostemal process gradually deflexed behind procoxa; pronotal lateral
margin sinate and broadly rounded; pronotum lacking longitudinal medial depression;
elytral marginal carinae without lateral projections; elytral humera obsolete, not reflexed;
irregular transverse costa and projections lacking on elytra; mesotrocantin exposed.
Distribution. Known only from the region of Villa Lerdo in Durango, Mexico.

Biology. Unknown.

Discussion. P. hebes is currently known fiom only 12 specimens, all collected prior to

1 892.

150

Pelecyphorus (Astrotus) crypticus Smith, New Species

Type Material. HOLOTYPE (female) labeled: a) “TEX. Dickens Co. / 2 mi. SW
Dickens / X—l7-1971 pitfall / trap E. Zukauckas”; b) green paper circle denoting the
KWBC; c) on red paper, “HOLOTYPE / Pelecyphorus / (Astrotus) / crypticus SB / Aaron
D. Smi ” (CASC). PARATYPES (64 specimens) [all bearing the label “PARATYPE/
Pelecyphorus / (Astrotus) / crypticus / Aaron D. Smith” on yellow paper] with the
following locality data: same as holotype (2-KWBC); “Texas, Dickens Co. / 9mi. SE.
Dickens / Sept 3 1969” (l-KWBC); “1 Sep 70/ Lubb Co. Tx / J. Carroll” (l-TI'UZ); “12
mi SW / Post TX. / Garza Co. / 3-IX-1973” (l-TTUZ); “20 Sept 70 / Lubbock Co / Tex
D.F. Pruner” (l-TTUZ); “5 mi. S / Kermit Texas / Winkler Co. / VII.29.1979” (l-TI'UZ);
“Aug 13 / Lubbock / Brunson”(1-TTUZ); “Lubbock Tex / X-10-48 / R. W.” (2-KWBC);
“Plainview T. / 10-1-31” (l-TAMU); “Robert Lee / TEX. Geococcyx / calif. 142460” (2-
NMNH); “TEX. 2 Armstrong Co., /N. rim of Palo Duro / Cyn., 14 mi. S. of / Claude
3400 ’. /29-VIII-1971 leg. / K. Brown & P. Petrulia” (2-KWBC); “TEX. 2 Hall Co., / 6
mi. SE Turkey / l8-VI-l970 pitfalls / C.W. O'Brien” (2-KWBC); “TEX. Dickens Co. / 2
mi. SW Dickens / X-3-1971 pitfall / E. Zukauckas” (l-TTUZ); same as holotype, except
date “X.1.1971” (l-KWBC); same as holotype, except date “X.3.197l” (l-KWBC);
“TEX. Dickens Co. / 4mi. SW. Dickens / IV.17.1972 pitfall / trap E. Zukauckas” (1-
KWBC); same as last, except date “X. 10-1971” (2-KWBC); same as last, except date
“X.7.197 1” (l-KWBC); same as last, except date “XI-14-197 1” (3-KWBC); same as last,
except date “XI-l8-197 1” (l-KWBC); same as last, except date “XI-21-197l” (1-

KWBC); same as last, except date “XII-9-l97l” (l-KWBC); “TEX. Gaines Co., / abt. 18

151

mi SW / Seminole / 3-IX-1969”(1-KWBC); “TEX. Howard Co./ 10 mi. S. Big Spring /
Hwy 33, VI-13-1971 / O'Brien & Marshall” (l-KWBC, l-RLAC); same as last, except
date “VI-5-197 1” (3-KWBC); “TEX. Lubbock / X-17-1971 / C.W. O'Brien / pitfall trap”
(9-KWBC); same as last, except date “X-29-197 1” (l-KWBC); same as last, except date
“X-3-6-1971” (5-KWBC); same as last, except date “XII-30-197l ” (2-KWBC); “TEX.
Reagan Co. / 16 mi. N. BigLake / VI-13-1971 / C. W. O'Brien” (l-KWBC); “TEX.
Scurry Co. 4 / mi. N. Polar Rd. Hwy. 84 l3-XI-1970 / MD. Merritt Pitfall” (5-KWBC);
“Tex: Howard Co.,/ 10 mi. S. Big Spring on Hwy. 33 III-25-l973”, b) “C.W. O'Brien,
dead under stones and dung” (l-KWBC); “Texas, 10 mi. N / Dickens / Dickens Co. / 9-6.

1972” (l-T'I'UZ); a) “Aug 7”, b) “Clark Co / Kansas” (l-NMNH).

Description (see fig. 2.5). Length 8.7-12.0mm, width 4.3-6.9mm. Body generally evenly
thickly coated with debris. Head: Densely, shallowly foveate; fovea subtended by
tubercles with Astrotus-type stellate setae at apex, primary seta squamate, primary seta
short, pale, squamate or spiniform, and decurnbent; fiontoclypeal suture impressed,
medial depression on frons faint or deep; epistoma broadly rounded, epistomal suture
mostly obscured and not indented at margin; eye slightly reniform and surrounded by a
black callus; labrum narrowing towards apex; apical segment of maxillary palp
securiform in female, larger and isotriangular in male; mentum with erect pale spiniform
setae and densely foveate, minute tomentum coating surface between fovea. Tomentose
sensilla on antennal segment 10 small, slightly wrapping around apex; apical tomentose
sensillum on antennal segment 11 covering one-third or less of segment. Prothorax:

Lateral margin sinuate, dilated at middle and forming a broad triangular flange, apex of

152

flange straight or slightly reflexed; anterior apicies produced and acute, posterior apicies
acute and barely projecting over elytral humera, posterior margin nearly straight,
occasionally with a minute medial tooth. Pronotal disc densely, foveate; fovea subtended
by Astrotus-type stellate setae on nearly confluent tubercles, primary seta squamate;
longitudinal medial depression usually glabrous throughout, with a low carina near apical
and posterior margins; two elongate paramedial fossae present or faintly indicated and
setose. Prostemal process broadly rounded, medially impressed or not, raised behind
procoxae. Pterothorax: Elytra costate; sutural costa strongly raised at base and partially
covering scutellum, gradually eroding posterad and absent in apical third; discal costa
present and reaching elytral base; marginal costa present and tuberculate, lacking lateral
projections; elytral humera carinate and reflexed; transverse costa numerous, connecting
sutural, discal, and marginal costae, giving the elytra a honeycombed appearance.
Astrotus-type stellate setae densely clustered along crests of costae and arising from small
tubercles, primary setae short and spiniform or squamate; stellate setae and punctures
sparse between costa. Elytra gradually widening to apical third, before sharply sloping
and tapering caudad; cauda not reflexed; Scutellum small and glabrous, mesonotum
tuberculate and occasionally costate between scutellum and raised, shelf-like, scutum.
Legs: Mesotrocantin minute, concealed. F emora and tibia densely clothed in Astrotus-
type stellate setae, primary setae simple, decurnbent and nearly clear; tarsi venter with
short pale spiniform setae; combined protarsal segments approximately two-thirds length
of protibia; anterior protibial spur subequal to basitarsi. Abdomen: Densely shallowly
punctate, punctures subtended by Astrotus-type stellate setae, arising from minute

tubercles.

153

Diagnosis. P. crypticus can be separated from the other members of the Astrotus
subgenus based on the following character combination: prostemal process raised behind
procoxa, apex broadly rounded; pronotal lateral margin acutely sinuate and dilated at
middle; elytral marginal carinae without lateral projections; numerous transverse costae
present on elytra, creating an irregular pattern of cells.

Distribution. Known fiom northwestern Texas and Kansas.

Biology. Unknown.

subgenus Stenosides Solier, 1836
Stenosides Solier 18362484. Type species: Stenosides graciliformis Solier, 1836, by
monotypy.
=Pactostoma LeConte 1858219. Type species: Stenosides anastomosis (Say), 1824, by
original designation.

=Ologlyptus Lacordaire 18592158 (unnecessary replacement name).

Description. Length 7.5-13.5mm, width 3.6-6.7 wide. Integument black to ferruginous;
densely to sparsely clothed in decurnbent flattened yellowish-white lanceolate or
acuminate setae. Head: Mentum large, completely filling buccal cavity, sub-trapezoidal;
anterior margin straight to weakly emarginate, occasionally with a minute median notch;
lateral margins straight or weakly curved inward at apicies. Ligula small, less than one-
fifih mentum width, straight or slightly curved, concealed or barely visible. Apical
segment of maxillary palps securiform to triangular. Submentum broad, laterally

contacting postgena or leaving at most a minute space between them. Postgenal process

154

produced, slightly swollen, broadly rounded. Labrum with apical margin straight; medial
tormal process shorter than posterior tormal process; clypeal membrane concealed.
Clypeal margin straight or broadly emarginate. Dorsal sulcus present above apices of
eyes; eyes broadly oval to slightly reniform. Antenna weakly clavate; antennal segments
3-8 rounded, slightly moniliform; segments 9-11 flattened, forming a weak club; antennal
segment 10 subquadrate or widest at apicies; two tomentose sensory patches present at
lateral apices; antennal segment 11 with a broad apical tomentose sensory patch,
amplected into segment 10. Prothorax: Pronotum with or without distinct lateral costae;
foveate, with the anterior margin of each fovea bearing a single decurnbent yellowish-
white-setae. Prostemum medially flat, sharphly rising at base of procoxal cavites to form
prostemal process; prostemal process declivous behind procoxae. Pterothorax:
Scutellum triangular; mesonotum with two transverse setae lined depressions leaving a
thin medial ridge between the scutellum and scutum. Elytra broadly convex; sculpturing
variable. Marginal costa present, generally divided in posterior one-half to one-third of
elytron, inner branch strong, faintly indicated, or reduced to a row of tubercles. Discal
costa present, divided near elyron base, inner branch strong to faintly indicated, branches
meeting in distal third of elytron. Sutural costa slightly raised or absent. Transverse
ridges between elytron costae present or absent, position variable. Epipleuron mostly
obscured, costate from abdominal ventrite 3 or 4 to elytron apex. Legs: Setose;
mesotrocantin small, visible.

Diagnosis. The subgenus Stenosides is distinguished fiom other Pelecwhorus subgenera
by a unique combination of the following characters: mentum completely filling buccal

cavity, sub-trapezoidal, anterior margin straight or weakly emarginate, lateral apicies not

155

strongly bent inward; ligula less than one-fifth mentum width, concealed to barely
visible; apical segment of maxillary palps securiform or triangular; labral margin straight;
postgenal process produced, slightly swollen, broadly rounded; eyes broadly oval to
slightly reniform; prostemal process declivous behind procoxae; transverse setose
depressions on mesonotum; mesotrocantin small.

Distribution. Arid habitats from central and southern Mexico to the western United
States. The states where they are currently known to occur are MEXICO: Chihuahua,
Coahuila, Durango, Guanajuato, Hidalgo, Nuevo Leon, Mexico, Mexico D.F., Oaxaca,
Puebla, San Luis Potosi, Tlaxcala, Zacatecas; USA: Arizona, Colorado, Kansas, New

Mexico, Texas.

Species Descriptions

Pelecyphorus (Stenosides) anastomosis (Say)

Asida anastomosis Say, 18242256

Pelecyphorus anastomosis (Say). LeConte 1851233
Microschatia anastomosis (Say). LeConte 18532446
Pactostoma anastomosis (Say). LeConte, 1858219
Ologlyptus anastomosis (Say). Lacordaire, 18592159
Pactostoma anastomosis (Say). Casey, 1912286
Stenosides anastomosis (Say). Wilke, 19222268

Pelecyphorus (Stenosides) anastomosis (Say). Smith, 2010

156

=Stenosides anastomosis salebrosa Casey, 1912287, New Synonym
=Stenosides breviuscula Casey, 1912287, New Synonym
=Stenosides exoleta Casey, 1912287, New Synonym

=Stenosides luteotecta Casey, 1912288), New Synonym
=Stenosides monticola (Casey, 1912288), New Synonym
=Stenosides obtecta (Casey, 1912289), New Synonym

=Stenosides sigillata (Casey, 1912289), New Synonym

Type Material. NEOTYPE, designated here, (female) labeled: a) “Kan. / Snow”; b)
“Coll Hubbard / & Schwarz”; c) on red paper, “NEOTYPE /Asida / anastomosis / Say,
1824 / det. Aaron D. Smith”. (NMNH).

Additional Material Examined. (151 specimens). USA: Arizona, Colorado, Kansas,

New Mexico, Texas. MEXICO: Chihuahua.

Redescription (see fig. 2.6). Length 8.1-13.5mm, width 3.8-6.7mm. Integument black to
ferruginous, often coated with debris; setae pale, yellowish-white to golden; elytra wider
than pronotum. Head: Densely foveate, each fovea subtended by a decurnbent, lanceolate
setae; frontoclypeal suture and medial depression on flow faintly or deeply impressed;
epistoma broadly rounded, epistomal suture obscured and not indented at margin; eye
elongate, oval or slightly reniform; apical segment of maxillary palp securiform in
female, isotriangular in male. Mentum foveate with decurnbent lanceolate setae,

becoming erect and acuminate apically, anterior margin with or without a minute median

157

notch. Antenna moderately clothed in erect acuminate setae; antennal segment 10 widest
at apicies, approximately 2X larger than segment 11. Prothorax: Pronotum weakly
sinuate, widest near middle; marginal costa present, not reflexed, and gradually widening
anteriorly; anterior apicies barely produced and rounded, posterior apicies acute, not
projecting over elytral humera, posterior margin nearly straight, rarely with a minute
medial tooth. Pronotal disc densely foveate, each fovea subtended by a decumbent
lanceolate setae, ofien arising from a nrinute tubercle; medially longitudinally impunctate
and glabrous in most specimens, rarely with a faint costa. Prostemal process sharply
raised from prostemum anteriorly, deflexed behind procoxae. Pterothorax: Moderately
clothed with decumbent lanceloate setae arising from minute tubercles, denser along
crests of costae. Elytra ovate, broadly convex, and costate; marginal costa present and
tuberculate, inner branch present as a short distinct ridge on disc or reduced to a row of
tubercles; elytral humera distinct and not or slightly reflexed; discal costa present,
bifurcating near base and reunited in apical third, inner branch often eroded and barely
visible; sutural costa feebly raised or not; transverse costae present and confused between
discal and marginal costa. Legs: Mesotrocantin small, exposed. Femora and tibia densely
shallowly foveate and setose, setae short and acuminate, with stouter darker colored setae
also present along inner margins of tibia; tarsi venter with pale acuminate setae, and
stouter darker setae along lateral margins, medially nearly glabrous; combined protarsal
segments approximately two-thirds length of protibia; anterior protibial spur shorter than
basitarsi. Abdomen: Moderately punctate, punctures small and subtended by decumbent

acuminate setae.

158

Diagnosis. P. anastomosis can be separated from the other members of the Stenosides
subgenus based on the following character combination: Pronotum weakly sinuate,
marginal costa present and not reflexed; frontoclypeal suture faintly or deeply impressed;
elytra with transverse anastomizing ridges present and restricted to space between elytral
and marginal costae.

Distribution. USA: Arizona, Colorado, Kansas, New Mexico, Texas. MEXICO:
Chihuahua.

Biology. Collected from underneath rocks, plant debris, and dung.

Discussion. Thomas Say’s original specimen(s) were presumably destroyed along with
most of his collection, hence the need for a neotype. The Stenosides species synonymized
under P. anastomosis were all described by Casey (1912) from one or two specimens
each taken from disparate localities. All of the characters used to separate them vary

within any given population of P. anastomosis throughout their range.

Pelecyphorus (Stenosides) cavatus Smith, New Species

Type Material. HOLOTYPE, (sex undetermined) labeled: a) “Mexico: Coahuila / 20 mi
N of Conception / del Oro 5800' / 10 August 1993 / Collector Unknown / Cal. Acad Sci.
Collection”; b) “California Academy / of Sciences / collection”; c) on red paper,
“HOLOTYPE / Pelecyphorus / (Stenosides) / cavatus / Aaron D. Smith” (CASC).
PARATYPES (3-CASC) [all bearing the label “PARATYPE / Pelecwhorus/

(Stenosides) / cavatus / Aaron D. Smith” on yellow paper]: with same label data as

holotype.

159

Description (see fig. 2.7). Length 10.0-12.5mm, width 4.9-6.1mm (holotype length:
11.1mm, width: 5.6mm). Integument black; setae pale yellowish-white unless otherwise
noted; elytra wider than pronotum. Head: Densely foveate, each fovea with a decurnbent
acuminate or lanceolate setae arising from margin or side; frontoclypeal suture deeply
transversely excavated; clypeus swollen and sloping towards labrum, anterior margin of
clypeus broadly emarginate; medial depression on fions absent or faintly impressed;
epistoma broadly rounded, epistomal suture mostly obscured and not indented at margin;
broad sulcus present around apex of eye; eye broadly oval to slightly reniform; apical
segment of maxillary palp securiform in both sexes. Mentum foveate with erect
acuminate setae, more numerous near anteriorly, anterior margin nearly straight and
without a minute median notch. Antenna moderately clothed in erect acuminate setae;
antennal segment 10 subquadrate, approximately 1.5X larger than segment 11.
Prothorax: Pronotum nearly parallel sided, weakly sinuate, widest near middle; marginal
costa eroded and absent or nearly absent over most of length; anterior apicies barely
produced and rounded, posterior apicies acute, not projecting over elytral humera,
posterior margin straight, lacking a medial tooth. Pronotal disc densely foveate, each
fovea with a decurnbent acuminate or lanceolate setae arising fiom margin or side.
Prostemal process sharply raised from prostemmn anteriorly, medially longitudinally
impressed, and deflexed behind procoxae. Pterothorax: Sparsely and irregularly
punctate and setose, setae decurnbent and acuminate. Elytra ovate, nearly planate on disc,
and costate; marginal costa slightly raised and broadly rounded, bifurcate in apical third;

elytral humera small, obtuse, and not reflexed; discal costa present, broadly rounded and

160

slightly raised, bifirrcating near base and reunited in apical third, inner branch eroded and
barely visible; sutural costa not raised; transverse costae absent or present and slightly
raised in between discal and marginal carinae in apical third. Legs: Mesotrocantin small,
exposed. Femora and tibia densely shallowly foveate and setose, setae short and
acuminate, with stouter darker colored setae also present along inner margins of tibia;
tarsi venter with pale acuminate setae, and stouter darker setae along lateral margins,
medially nearly glabrous; combined protarsal segments approximately two-thirds length
of protibia; anterior protibial spur shorter than basitarsi. Abdomen: Moderately punctate,
punctures small and subtended by acuminate setae.

Diagnosis. P. cavatus can be separated fiom the other members of the Stenosides
subgenus based on the following character combination: Frontoclypeal suture deeply
transversely excavate; pronotum weakly sinuate, marginal costa absent or faintly
indicated over most of length.

Distribution. Known only from the type locality.

Etymology. The specific epithet is Latin and means “hollowed out”, referring to the
deeply excavated head.

Biology. Unknown.

Pelecyphorus (Stenosides) deaztlani Smith, New Species

Type Material. HOLOTYPE, (sex undetermined) labeled: a) “MEXICO. Nuevo / Leon:
Hwy 58, 13 km / E of junction with Hwy / 57, 2000 m / 5 Jun 1993.”; b) on red paper,

“HOLOTYPE / Peleryphorus / (Stenosides) / deaztlani / Aaron D. Smith” (CASC).

161

PARATYPES (2-CASC, l-KWBC) [all beefing the label “PARATYPE / Pelecyphorus/

(Stenosides) / deaztlani / Aaron D. Smith” on yellow paper]: with same label data as

holotype.

Description (see fig. 2.8). Length 9.3-10.5mm, width 4.9-5.6mm (holotype length:
9.3mm, width: 5.4mm). Integument black; setae pale yellowish-white unless otherwise
noted; elytra slightly wider than pronotum. Head: Densely foveate, each fovea with a
decurnbent acuminate or lanceolate setae arising from margin or side; frontoclypeal
suture impressed; anterior margin of clypeus slightly emarginate; medial depression on
frons faintly impressed; epistoma broadly rounded, epistomal suture mostly obscured and
not indented at margin; broad sulcus present around apex of eye; eye broadly oval to
slightly reniform; apical segment of maxillary palp securiform in both sexes. Mentum
foveate with erect acuminate setae, more numerous near anteriorly, anterior margin
nearly straight and without a minute median notch; submentum deeply transversely
impressed posteriorly, anterior margin broadly emarginate. Antenna moderately clothed
in erect acuminate setae; antennal segment 10 subquadrate, approximately 1.5-2X larger
than segment 11. Prothorax: Pronotum weakly sinuate, widest near middle; marginal
costa present , expanded, and not reflexed; anterior apicies barely produced and rounded,
posterior apicies acute, not projecting over elytral humera, posterior margin straight,
lacking a medial tooth. Pronotal disc densely foveate, each fovea with a decurnbent
acuminate or lanceolate setae arising from margin or side. Prostemal process sharply
raised from prostemum anteriorly, medially longitudinally impressed, and deflexed

behind procoxae. Pterothorax: Moderately setose, setae decumbent and lanceolate, and

162

irregularly punctate and. Elytra ovate, broadly convex, and costate; marginal costa
slightly raised and broadly rounded, bifurcate in apical third; elytral humera small,
obtuse, and not reflexed; discal costa present, broadly rounded and slightly raised,
bifurcating near base and reunited in apical third, inner branch eroded and barely visible;
sutural costa not raised; transverse costae absent or present and slightly raised in between
discal and marginal carinae in apical third. Legs: Mesotrocantin small, exposed. Femora
and tibia densely shallowly foveate and setose, setae short, acuminate, and arising from
small tubercles on tibia, with stouter darker colored setae also present along inner
margins of tibia; tarsi venter with pale acuminate setae, and stouter darker setae along
lateral margins, medially nearly glabrous; combined protarsal segments approximately
two-thirds length of protibia; anterior protibial spur shorter than basitarsi. Abdomen:
Moderately punctate, punctures small and subtended by acuminate setae.

Diagnosis. P. deaztlani can be separated from the other members of the Stenosides
subgenus based on the following character combination: Frontoclypeal suture regularly
impressed; pronotum weakly sinuate, marginal costa present, expanded, and not reflexed;
elytral costae broadly rounded, not tuberculate; submentum deeply transversely
impressed.

Distribution. Known only from the type locality.

Etymology. The species is named in honor of Tonantzin Deaztlan for supporting the
author throughout his graduate education.

Biology. Unknown.

163

Pelecyphorus (Stenosides) triplehorni Smith, New Species

Type Material. HOLOTYPE, (male) labeled: a) “MEXICO: Dgo., 2 mi / NW Nombre
de Dios / VH-12-1975”; b) “CA, WE, BW / Triplehom”; c) on red paper, “HOLOTYPE/
Pelecyphorus / (Stenosides) / triplehorni 6‘/ Aaron D. Smi ” (OSUC). PARATYPES
(IS-OSUC) [all bearing the label “PARATYPE / Pelecyphorus / (Stenosides)/

triplehorni / Aaron D. Smi ” on yellow paper]: with same label data as holotype.

Description (see fig. 2.9). Length 10.3-12.6mm, width 5.0-6.4mm (holotype length:
11.0mm, width: 5.3mm). Integument black to ferruginous, Often coated with debris; setae
yellowish-white to light brown; elytra wider than pronotum. Head: Densely foveate, each
fovea subtended by a decumbent, lanceolate setae; frontoclypeal suture faintly impressed,
medial depression on frons faintly impressed or absent; epistoma broadly rounded,
epistomal suture obscured and not indented at margin; broad sulcus present around apex
of eye; eye elongate and broadly oval; apical segment of maxillary palp securiform in
female, isotriangular in male. Mentum foveate with erect acuminate setae, anterior
margin without a minute median notch. Antenna moderately clothed in erect acuminate
setae; antennal segment 10 widest at apicies, approximately 2X larger than segment 11.
Prothorax: Pronotum weakly sinuate, widest near middle; marginal costa present, not
reflexed; anterior apicies barely produced and acute, posterior apicies acute, not
projecting over elytral humera, posterior margin nearly straight, occasionally with a
minute medial tooth. Pronotal disc densely foveate, each fovea subtended by a decurnbent

acuminate setae; medially longitudinally impunctate, glabrous, and slightly raised in most

164

specimens. Prostemal process sharply raised from prostemum anteriorly, deflexed behind
procoxae. Pterothorax: Moderately clothed with decurnbent lanceloate or acuminate
setae, sparser along rounded crests of costae. Elytra ovate, broadly convex, and costate;
marginal costa present; ely1ral humera distinct and not reflexed; discal costa present and
confused, forming a reticulating network of longitudinal and transverse costae, crests of
costae rounded, smooth, and predominately glabrous; sutural costa not raised. Legs:
Mesotrocantin small, exposed. Femora and tibia densely shallowly foveate and setose,
setae short and acuminate, with stouter darker colored setae also present along on tibia;
tarsi venter with pale acuminate setae, and stouter darker setae along lateral margins,
medially nearly glabrous; combined protarsal segments approximately two-thirds length
of protibia; anterior protibial spur shorter than basitarsi. Abdomen: Moderately punctate,
punctures small and subtended by decumbent acuminate setae.

Diagnosis. P. triplehorni can be separated from the other members of the Stenosides
subgenus based on the following character combination: Pronotum weakly sinuate,
marginal costa present and not reflexed; frontoclypeal suture faintly impressed; elytra
with a reticulated network of rounded costae, crests of costae rounded, smooth, and
nearly glaberous.

Distribution. MEXICO: Durango.

Etymology. The species is named in honor of Charles A. Triplehom, collector of the type
series and tenebrionid taxonomist extraordinaire.

Biology. Unknown.

165

Pelecyphorus (Stenosides) limosus (Champion), New Combination

Astrotus limosus Champion 1884266

Pelecyphorus (Stenosides) limosus (Champion). Smith, 2010

Type Material. HOLOTYPE, by monotypy, (sex undetermined) labeled: a) Orange
bordered white circle reading “Type”; b) “Mexico. / Salle Coll.”;c) “Astrotus / limosus/

Champ”; d) “Sp. figured.” ; e) “B.C.ACol.IV.1. / Astrotus / limosus”. (BMNH).

Redescription (see fig. 2.10). Length 7.8mm, width 3.3mm. Integument black and coated
with debris; setae predominately pale, yellowish-white; elytra slightly wider than
pronotum and approximately 2.6X longer. Head: Densely foveate, each fovea subtended
by a decumbent, lanceolate setae; frontoclypeal suture and medial depression on fi'ons
deeply impressed; epistoma broadly rounded, epistomal suture obscured and not indented
at margin; eye slightly reniform. Mentum anterior margin without a minute median notch.
Antenna moderately clothed in erect acuminate setae; antennal segment 11 deeply
amplected into segment 10; antennal segment 10 subquadrate and much larger than
segment 11. Prothorax: Pronotum weakly sinuate, widest near middle; marginal costa
present, expanded, and slightly reflexed; anterior apicies barely produced and rounded,
posterior apicies acute, not projecting over elytral humera, posterior margin nearly
straight. Pronotal disc confluently foveate, giving surface a rough uneven appearance,
with short lanceolate setae. Prostemal process sharply raised from prostemum anteriorly,

deflexed behind procoxae. Pterothorax: Sparsely clothed with short lanceloate setae,

166

denser along crests of costae. Elytra ovate, broadly convex, and costate; marginal costa
broadly rounded and reticulate, confluent with discal costa in apical third; elytral humera
small and not reflexed; discal costa present broadly rounded and reticulate, bifurcating
near base, branches not connected or reaching elytral base anteriorly, reunited in apical
third, with a small additional outer branch present behind middle, not confluent with
other costae posteriorly; sutural costa not raised. Legs: Mesotrocantin small, exposed.
Femora and tibia densely setose and coated with debis, setae short, acuminate, and arising
from small tubercles on tibia; tarsi venter with pale acuminate setae along lateral margins,
medially nearly glabrous; combined protarsal segments approximately two-thirds length
of protibia; anterior protibial spur shorter than basitarsi. Abdomen: Surface obscured by
debris, moderately clothed in acuminate setae.

Diagnosis. P. limosus can be separated from the other members of the Stenosides
subgenus based on the following character combination: Pronotum weakly sinuate,
marginal costa present and not reflexed, pronotal disc confluently foveate; antennal
segment 11 small and deeply amplected into segment 10.

Distribution. Mexico.

Biology. Unknown.

Discussion. The exact type locality is unknown. Three additional specimens labeled a)
“Mexico / Tehuautc”; b) “Fry Coll. / 1905. 100.”, were placed with Champion’s P.
anastomosis specimens in the BMNH, and may be conspecific with the P. limosus type
based on their size, pronotal sculpturing and antennal configuration. However, they vary
fiom P. limosus in elytral sculpturing. Additional specimens are needed to ascertain

whether or not they are P. limosus or an undescribed species.

167

Pelecyphorus (Stenosides) graciliformis (Solier)

Stenosides graciliformis Solier, 18362486
Ologlyptus graciliformis (Solier). LaCordaire, 18592159
Stenosides graciliformis Solier. Casey, 1912284

Pelecyphorus (Stenosides) graciliformis (Solier). Smith, 2010

=Stenosides canus (Champion, 1884268), New Synonym

=Stenosides sinuaticollis (Champion, 1884269), New Synonym

Type Material. NEOTYPE, designated here, (female) labeled: a) “Oaxaca, / Mexico. /
Hoege.” ; b) “Ologlyptus / graciliformis / Sol.”; c) “B.C.A. Col.IV.1. / Ologlyptus/
graciliformis”; d) on red paper, “NEOTYPE / Stenosides / graciliformis / Solier, 1836 /
det. Aaron D. Smi ”. (BMNH).

Additional Material Examined. (46 specimens). MEXICO: Durango, Guanajuato,

Hidalgo, Mexico, Mexico D.F., Oaxaca, Puebla, San Luis Potosi, Tlaxcala, Zacatecas.

Redescription (see fig. 2.11). Length 8.0-12.lmm, width 4.3-6.2mm (neotype length:
11.7mm, width: 6.0mm). Integument black to ferruginous, and setose; setae pale,
yellowish-white to golden, acuminate to slightly lanceolate, and decurnbent unless
otherwise noted; elytra wider than pronotum, pronotum base wider than elytral base;
ofien coated with debris. Head: Densely foveate, each fovea subtended by a setae;

frontoclypeal suture and medial depression on frons faintly or deeply impressed;

168

epistoma broadly rounded, epistomal suture obscured and not indented at margin; eye
broadly oval; apical segment of maxillary palp securiform in both sexes. Mentum foveate
. and setose, anterior margin without a minute median notch. Antenna moderately clothed
in erect setae; antennal segment 10 widest at apicies, approximately 2X larger than
segment 11. Prothorax: Pronotum sinuate, widest near middle; marginal costa expanded,
crenulate, and reflexed; anterior apicies slightly produced and acute, posterior apicies
acute, not projecting over elytral humera, posterior margin nearly straight, without a
minute medial tooth. Pronotal disc densely foveate, each fovea subtended by a setae.
Prostemal process sharply raised fiom prostemum anteriorly, deflexed behind procoxae.
Pterothorax: Moderately setose, setae denser along crests of costae, with scattered
fovea Elytra ovate, broadly convex, and costate; marginal costa present and tuberculate,
inner branch present as a short separate carina on posterior half of disc, not confluent
with discal carina; elytral humera obtuse; discal costa carinate, confluent with marginal
carina caudally; sutural costa not raised; transverse costae absent. Legs: Mesotrocantin
small, exposed. Femora and tibia densely shallowly foveate and setose; tarsi venter with
long pale setae; combined protarsal segments approximately two-thirds length of protibia;
anterior protibial spur shorter than basitarsi; outer apical spine of protibia large, length
approximately equal to protibial width, and acute. Abdomen: Densely punctate and
setose.

Diagnosis. P. graciliformis can be separated fi'om the other members of the Stenosides
subgenus based on the following character combination: Pronotum sinuate, marginal
costa expanded, crenulate and reflexed; elytra without transverse costae; protibial spine

large.

169

Distribution. MEXICO: Durango, Guanajuato, Hidalgo, Mexico, Mexico D.F., Oaxaca,
Puebla, San Luis Potosi, Tlaxcala, Zacatecas.

Biology. Unknown.

Discussion. P. graciliformis was originally described by Solier (1836), probably from a
single specimen. A specimen previously considered to be the type is housed in the
MNHN and bears the following labels: a) “TYPE”; b) “Ologlyptus / graciliformis /
[illegible, possibly Mex.] / [illegible looks like dupl.]”; c) “Mexique”; d) “Stenosides/
graciliformis / Solier / Type de Solier / Col. de Marseul / C. Girard vid. 1979”. Upon
examination it was clear that this specimen did not fit Solier’s original description or
illustrations. It was identified as a specimen of P. (Sicharbas) debilis (Champion).
MNHN stafl could not find another specimen labeled Stenosides graciliformis, nor any
specimens matching automontaged images of P. graciliformis sent to the museum. Given
the possibility that Champion may have seen the original type, a specimen matching
Solier’s description and labeled Ologlyptus graciliformis by Champion was selected from

the BMNH as the neotype.
Pelecyphorus (Stenosides) texanus (W ickham)
Ologljptus texanus Wickham, 1903272

Stenosides texanus (Wickham). Casey, 1912284

Pelecyphorus (Stenosides) texanus (W ickham). Smith, 2010

170

Type Material. HOLOTYPE (male) labeled: a) “Cameron Co. Tex. IX” ; b)
“HOLOTYPE / Ologlyptus / texanus / Wickham, 1836”. (NMNH).

Additional Material Examined. (11 specimens). Texas: Cameron and Starr Counties.

Redescription (see fig. 2.12). Length 7.4-10.1mm, width 3.9-5.3mm. Integument black
1 to ferruginous, and setose; setae pale, yellowish-white to light brown, lanceolate, and
decurnbent unless otherwise noted; elytra wider than pronotum and approximately 3X
longer; often coated with debris. Head: Densely foveate, each fovea subtended by a
setae; fi'ontoclypeal suture and medial depression on fions faintly impressed; epistoma
broadly rounded, epistomal suture obscured and indented at margin; eye elongate,
slightly reniform oval; apical segment of maxillary palp securiform in female,
isotriangular in male. Mentum foveate and setose, anterior margin without or without a
minute median notch. Antenna moderately clothed in erect acuminate setae; antennal
segment 10 widest at apicies, approximately 2X larger than segment 11. Prothorax:
Pronotum strongly sinuate, widest near middle, then constricted in basal third before
expanding at posterior apicies; marginal costa tuberculate, not reflexed; anterior apicies
produced and rounded, posterior apicies acute, slightly divergently produced, not
projecting over elytral humera, posterior margin nearly straight, medially with a large
bifurcating process emerging from disc; pronotal disc densely foveate, each fovea
subtended by a setae; longitudinal medial ridge present near apex, then strongly raised
and triangular from midline to past pronotal base, forming a large bifurcate process.
Prostemal process deflexed behind procoxae. Pterothorax: Moderately foveate and

setose, setae denser along crests of costae. Elytra slightly ovate, widest behind middle,

171

and costate; marginal costa present and tuberculate, elytral humera prominent and
reflexed; discal costa divided, not meeting at tips and parallel over entire length, not
reaching elytral base; sutural costa not or slightly raised; broadly rounded low transverse
costa present and connecting longitudinal costae or not. Legs: Mesotrocantin minute,
exposed or concealed. Femora and tibia clothed in white decurnbent lanceolate setae,
anterior margins of tibia also'with stouter dark brown spiniform setae; tarsi venter with
stout brown spiniform setae; combined protarsal segments approximately two-thirds
length of protibia; anterior protibial spur length subequal to basitarsi. Abdomen: Densely
punctate and setose.

Diagnosis. P. texanus can be separated from the other members of the Stenosides
subgenus based on the following character combination: Pronotum strongly sinuate,
widest near middle, then constricted in basal third before expanding at posterior apicies;
Median ridge on pronotum strongly raised and triangularly expanded in basal half,
forming a large bifurcate process projecting past basal pronotal margin.

Distribution. Only known from the southern tip of Texas (Cameron and Starr Counties).

Biology. Unknown.

subgenus Sicharbas Champion, 1884

Sicharbas Champion, 1884267. Type species: Sicharbas lobatus Champion, 1884267, by

monotypy.

Redescription. Length 6.0-12.3mm, width 2.3-5.7. Integument black to ferruginous;

densely to sparsely setose, setae simple, lanceolate, or squamate. Head: Mentum large,

172

completely filling buccal cavity, sub-trapezoidal; anterior margin straight to weakly
emarginate, occasionally with a shallow median notch; lateral margins straight or weakly
curved inward at apicies. Ligula small, one-fourth or less mentum width, straight or
slightly curved, concealed or visible beyond anterior margin of mentum. Apical segment
of maxillary palps securiform in both sexes. Submentum broad, laterally contacting
postgena or leaving at most a minute space between them. Postgenal process produced,
acute or rounded. Labrum with apical margin straight; medial tormal process shorter than
posterior tormal process; clypeal membrane concealed. Clypeal margin straight. Dorsal
sulcus absent or faint above apices of eyes; eyes broadly oval to slightly reniform.
Antenna weakly clavate; antennal segments rounded, nearly moniliform; entrennal
segment 10 conical or flattened, widest at apicies, two tomentose sensilla present at
lateral apices or coalesced into a continuous band; apex of antennal segment 11 with a
broad tomentose sensillum, base of segment deeply or slightly amplected into segment 10
(F ig.). Prothorax: Pronotum with a distinct marginal costa, angulate or not, reflexed or
not; pronotal disc tuberculate, with or without paramedial fossae or longitudinal medial
depression, setation and punctation variable. Prostemal process medially impressed and
declivous behind procoxae. Pterothorax: Scutellum triangular, mostly concealed beneath
elytra; mesonotum with two transverse glabrous or setae lined depressions leaving a thin
medial ridge between the scutellum and scutum. Elytra elongate-ovate, nearly parallel
sided or widest behind middle; sculpturing variable, often with irregular crests or
protrusions. Marginal costa present. Discal costa usually distinct near base or eroded and

confused Sutural costa present or absent. Transverse ridges between elytron costae

173

present or absent, position variable. Legs: Setose; mesotrocantin small, exposed or
concealed.

Diagnosis. The subgenus Sicharbas is distinguished from other Pelecyphorus subgenera
by a unique combination of the following characters: mentum completely filling buccal
cavity, sub-trapezoidal, anterior margin straight or weakly emarginate, lateral apicies not
strongly bent inward; ligula slightly curved, width one-fourth or less mentum width,
concealed or visible; apical segment of maxillary palps securiform; labral margin
straight; postgenal process produced, acute or rounded; prostemal process declivous
behind procoxae; pronotum tuberculate; elytra elongate and nearly parallel sided.
Distribution. MEXICO: Guerrero, Hidalgo, Michoacan, Mexico, Mexico D.F., Morelos,
Oaxaca, Puebla All known species appear to be restricted to high elevation localities

(above 6000’) in central and southern Mexico.

Species Descriptions

Pelecyphorus (Sicharbas) lobatus (Champion), New Combination

Sicharbas lobatus Champion, 1884267

Pelecyphorus (Sicharbas) lobatus (Champion). Smith, 2010

Type Material. HOLOTYPE, by monotypy, (male) labeled: a) Orange bordered white

circle reading “Type”; b) “1741”; c) “Truqui / Mexico”; (1) “Mexico. / Salle Coll.”;

174

“Sicharbas / lobatus / Champ”; e) “Sp. figured”; f) “B.C.ACol.IV.l. / Sicharbas/
lobatus”. (BMNH).
Additional Material Examined. (35 specimens). MEXICO: Guerrero, Mexico DR, and

Morelos.

Redescription (see fig. 2.13). Length 10.2-12.3mm, width 3.9-5.5 (holotype length:
10.6mm, width: 4.2mm). Integument black or ferruginous, often densely coated with
debris; setae pale, yellowish-white to light brown, acuminate to slightly lanceolate, and
decurnbent unless otherwise noted; elytra slightly wider than pronotum and
approximately 3X longer. Head: Confluently foveate with short erect setae emerging
from sides or margins of fovea; fiontoclypeal suture slightly impressed, clypeus elongate,
epistomal suture indented at margin; medial depression on frons deeply broadly
impressed; eye broadly oval. Menttun anterior margin straight or with a shallow median
emargination. Antenna sparsely clothed in erect acuminate setae; antennal segment 10
conical, widest at apicies, tomentose sensilla coalesced into a broad continuous band
around apical half; antennal segment 11 deeply amplected into segment 10, exposing
only the broad tomentose sensillum on apex. Prothorax: Pronotum margin costate and
angulme sinuate, dilated before middle and forming a triangular flange, apex of flange
straight or reflexed; anterior apicies slightly produced and rounded; posterior apicies
produced, straight or slightly divergent, projecting over elytral humera, rounded at tip;
posterior margin convex with a rounded emargination on each side near apicies. Pronotal
disc densely shallowly foveate; anterior margins of fovea raised, forming rounded

tubercles, each with a single seta; longitudinal medial depression usually distinct; two or

175

four rounded paramedial fossae present. Pterothorax: Elytra densely clothed with long
decurnbent lanceloate or acuminate scales, erect along crests of costae; margin nearly
parallel sided, slightly widening caudad; marginal costa tuberculate, slightly reflexed, and
often with broken up into a series of irregular crests and protrusions, flanged before
cauda and curving inward to elytral suture; elytral humera obliquely truncated; elytral
disc with numerous tuberculate protrusions or short, oblique or transverse ridges; discal
costa strongly raised in basal third, reaching basal margin of elytra; sutural costa
tuberculate and raised behind scutellum to marginal costa. Legs: Mesotrocantin small,
exposed. F emora and tibia densely punctate and setose; tarsi venter clothed with long
golden setae; combined protarsal segments approximately two-thirds length of protibia,
apical protibial spine thin and setose to tip; anterior protibial spur shorter than basitarsi.
Abdomen: Densely punctate and setose.

Diagnosis. P. lobatus can be separated from the other members of the Sicharbas
subgenus based on the following character combination: Pronotum angularly sinuate,
dilated before middle and forming a triangular flange, posterior apicies projecting over
elytra; tomentose sensilla on antennal segment 10 coalesced into a broad continuous
band.

Distribution. MEXICO: Guerrero, Mexico DR, and Morelos.

Biology. Unknown. The few specimens with elevational data were collected from 10,000

to 10,500 feet above sea level.

176

Pelecyphorus (Sicharbas) oaxacensis Smith, New Species

Type Material. HOLOTYPE (male) labeled: a)”MEX2 OAXACA / MICROO. LA
CUNIBRE / N 16° 27.277’ / W 97° 00.262’ / 29 vi 95 2130 m / D. Curoe, Hopkins”; b)
on red paper, “HOLOTYPE / Pelecyphorus / (Sicharbas) / oaxacensis 6‘/ Aaron D.

Smi ’2 (CASC). (EMEC).

Description (see fig. 2.14). Length 11.3mm, width 5.7. Integument darkly ferruginous,
nearly black; setae short, orange-browni, acuminate or lanceolate scales unless otherwise
noted; elytra wider than pronotum, nearly equal at base, and approximately 2.7X longer.
Head: Confluently foveate with short erect setae emerging from sides fovea, margins of
combined fovea forming short longitudinal ridges; frontoclypeal suture deeply impressed
at sides, epistomal suture not indented at margin; medial depression on frons deeply
broadly impressed; eye broadly oval. Mentum anterior margin with a shallow median
emargination. Antenna sparsely clothed in erect golden setae; antennal segment 10
conical, widest at apicies, tomentose sensilla coalesced into a broad continuous band
around apical half; antennal segment 11, nearly as large as, and deeply amplected into
segment 10, exposing only the broad tomentose sensillum on apex. Prothorax: Pronotum
margin costate and sinuate, dilated before middle and forming a rounded, slightly
reflexed flange; anterior apicies slightly produced and rounded; posterior apicies acute,
barely produced, slightly divergent, and not projecting over elytral humera; posterior
margin vaguely convex. Pronotal disc densely shallowly foveate; anterior margins of

fovea raised, forming rounded tubercles, each with a single seta on lateral face;

177

longitudinal medial depression distinct; two rounded paramedial fossae present.
Pterothorax: Elytra widening from base to apical third before sharply sloping and
tapering caudad; with scattered fovea and moderately clothed in erect or decurnbent setae
arising from sides of rounded tubercles; marginal costa tuberculate, slightly reflexed,
flanged before cauda and curving inward to meet elytral costa in apical third; elytral
humera oblique; discal costa tuberculate and raised over entire length, reaching basal
margin of elytra anteriorly, meeting marginal costa posteriorly; sutural costa tuberculate
and slightly raised throughout; low tuberculate protrusions or short, oblique or transverse
costa irregularly distributed across disc. Legs: Mesotrocantin small, exposed. F emora
foveate, fovea denser distally, and shiny; tibia slightly flared at apicies, densely foveate
and setose, setae stout and erect; tarsi venter with long golden setae and shorter stouter
setae laterally; combined protarsal segments approximately two-thirds length of protibia,
apical protibial spine short and setose to tip; anterior protibial spur shorter than basitarsi.
Abdomen: Densely punctate and setose.

Diagnosis. P. oaxacensis can be separated from the other members of the Sicharbas
subgenus based on the following character combination: Pronotum sinuate, dilated before
middle and forming a broadly rounded flange, posterior apicies not projecting over elytra;
tomentose sensilla on antennal segment 10 coalesced into a broad continuous band.
Distribution. Known only from type specimen.

Etymology. The species is named for the Mexican state of Oaxaca, the only state where
it is known to occur.

Biology. Unknown. The type specimen was collected at an elevation of nearly 7,000 feet.

178

Pelecyphorus (Sicharbas) debilis (Champion), New Combination

Astrotus debilis Champion, 1884266

Pelecyphorus (Astrotus) debilis (Champion). Smith, 2010

Type Material. LECTOTYPE, designated here, (female) labeled: a) Orange bordered
white circle reading “Type”; b) “Mexico. / Salle Coll.”; c) handwritten det. “Astrotus /
debilis Champ”; d) “Sp. figured”; e) “B.C.ACol.IV.1. / Astrotus /debilis”; i) d) on red
paper, “LECTOTYPE /Astrotus / debilis / Champion, 1884 / det. Aaron D. Smith”.
(BMNH). PARALECTOTYPES, designated here, (5 specimens) [all bearing the label
“PARALECTOTYPE /Astrotus / debilis / Champion, 1884 / Aaron D. Smith” on yellow
paper] with the following locality data: 2 specimens (BMNH) same data as holotype; 3
specimens (BMNH) labeled “Tehuacan, / Mexico. / Hoege.”

Additional Material Examined. (3 specimens). MEXICO: Puebla.

Redescription (see fig. 2.15). Length 7 .0-9.6mm, width 3.2-4.6 (lectotype length:
9.4mm, width: 4.6mm). Integument black or ferruginous, often densely coated with
debris; setae yellowish-white to light brown, acuminate scales unless otherwise noted;
elytra wider than pronotum, approximately equal at base, and 2.5-3.5X longer. Head:
Densely foveate, anterior margins of some fovea raised, forming rounded tubercles, each
with a single seta; frontoclypeal suture slightly impressed, epistomal suture not indented
at margin; medial depression on fi'ons shallowly impressed; eye elongate oval. Mentum

anterior margin straight or with a shallow median notch. Antenna moderately clothed in

179

erect acuminate setae; antennal segment 10 conical, widest at apicies, tomentose sensilla
meeting or nearly meeting on one side, surrounding most of apex; antennal segment 11
amplected into segment 10, exposing most of segment. Prothorax: Pronotum margin
costate and sinuate, widest near middle, costa crenulate, slightly or sharply reflexed;
anterior apicies produced and acute; posterior apicies acute, not produced; posterior
margin nearly straight, narrower than anterior margin. Pronotal disc densely foveate;
anterior margins of fovea raised, forming rounded tubercles, each with an erect squamate
setae; longitudinal medial depression distinct; two or four rounded paramedial fossae
present. Pterothorax: Elytra clothed with dark erect squamate or lanceloate scales;
margin nearly parallel sided, slightly widening caudad; marginal costa tuberculate; elytral
humera oblique; defined costae absent on disc, a few low, oblique or sinuous elevations
present and densely setose, forming several dark brown setal patches in posterior half.
Legs: Mesotrocantin small, exposed. Femora and tibia. densely punctate and setose; tarsi
venter clothed with long golden or reddish setae; combined protarsal segments
approximately two-thirds length of protibia, apical protibial spine small and setose to tip;
anterior protibial spur shorter than basitarsi. Abdomen: Densely punctate and setose,
setae short and acuminate.

Diagnosis. P. debilis can be separated from the other members of the Sicharbas subgenus
based on the following character combination: pronotum margin sinuate, widest near
middle, marginal costa crenulate, slightly or sharply reflexed; tomentose sensilla on
antennal segment 10 meeting or nearly meeting on one side not forming a broad
continuous band; erect squamate setae on elytra coalesced into several distinct dark

patches in posterior half.

180

Distribution. Only known from the vecinity of Tehuacan in the Mexican state of Puebla.

Biology. Unknown.

Pelecyphorus (Sicharbas) seticornis (Champion), New Combination

Astrotus seticornis Champion, 1884267
Pelecjphorus (Astrotus) seticornis (Champion). Smith, 2010

= Astrotus seticornis humeralis Champion 1884267, New Synonym

Type Material. LECTOTYPE, designated here, (female) labeled: a) Orange bordered
white circle reading “Type”; b) “Toluca”; c) “1745; (1) “Mexico. / Salle Coll.”; e)
handwritten det. “Astrotus / seticornis, / Champ”; f) “Sp. figured”; g) “B.C.ACol.IV.1. /
Astrotus / seticornis”; h) on red paper, “LECTOTYPE / Astrotus / seticornis / Champion,
1884 / det. Aaron D. Smith”. (BMNH). PARALECTOTYPE, designated here, 1
specimen labeled a) “Mexico. / Salle Coll.”; b) handwritten det. “Astrotus / seticornis, /
Champ”; c) “B.C.ACol.IV. 1. / Astrotus / seticornis”; d) on yellow paper
“PARALECTOTYPE /Astrotus / seticornis / Champion, 1884 / Aaron D. Smith”.
(BMNH)-

Additional Material Examined. (159 specimens). MEXICO: Hidalgo, Mexico, Mexico

D.F., Michoacén, and Puebla.

Redescription (see fig. 2.16). Length 6.0-8.6mm, width 2.3-4.1 (lectotype length:

8.2mm, width: 3.9mm). Integument black or ferruginous, often densely encrusted with

181

debris; setae short, yellowish-white to brown, acuminate scales unless otherwise noted;
elytra wider than pronotum and 2.9-3.2X longer. Head: Densely foveate, anterior
margins of some fovea raised, forming rounded tubercles, each with a single seta;
frontoclypeal suture impressed, clypeus elongate, epistomal suture indented at margin;
medial depression on flow deeply broadly impressed; area around eye impressed, giving
the eye a slightly stalked appearance, eye broadly oval. Mentum anterior margin straight
or with a shallow median notch. Antenna moderately clothed in erect acuminate reddish- .
brown setae; antennal segment 10 conical, widest at apicies, tomentose sensilla coalesced
into a broad continuous band around apical half; antennal segment 11 deeply amplected
into segment 10, exposing only the broad tomentose sensillrun on apex. Prothorax:
Pronotum margin costate and sinuate, widest near middle, costa tuberculate and reflexed;
anterior apicies slightly produced and rounded; posterior apicies acute, slightly produced,
not projecting over elytra; posterior margin weakly convex, slightly emarginate on each
side near apicies. Pronotal disc densely punctate; anterior margins of punctures raised,
forming rounded tubercles, each with an erect, occassionally squamate, setae;
longitudinal medial line tuberculate, rarely depressed or punctate; two large paramedial
fossae present, two smaller fossae occasionally present posterad. Pterothorax: Elytra
parallel sided or slightly wider behind middle, clothed with squamate or lanceloate scales
arising from minute tubercles, denser along crests of costae; elytral humera oblique;
marginal costa tuberculate, slightly reflexed, flanged before cauda and sinuately curved
inward towards elytral suture in apical third; discal costa tuberculate, distinct in basal
half; sutural costa tuberculate and slightly raised throughout; additional oblique or

transverse costae present and irregularly distributed across disc, connecting all costae into

182

a confused network. Legs: Mesotrocantin small and concealed in most specimens.
Femora and tibia minutely tuberculate and clothed in long acuminate setae, anterior
margins of tibia also with stouter erect setae; tarsi venter clothed with long golden or
reddish setae; combined protarsal segments approximately one-half length of protibia,
apical protibial spine acute and glabrous; anterior protibial spur shorter than basitarsi.
Abdomen: Densely minutely tuberculate, with short acuminate setae arising fi'om
tubercles.

Diagnosis. P. seticornis can be separated fiom the other members of the Sicharbas
subgenus based on the following character combination: pronotum margin sinuate, widest
near middle, marginal costa tuberculate and reflexed; pronotum not medially longitudinal
depressed; tomentose sensilla on antennal segment 10 coalesced into a broad continuous
band around apical half; antennal segment 11 deeply amplected into segment 10; apical
protibial spine acute and glabrous.

Distribution. MEXICO: Hidalgo, Mexico, Mexico D.F., Michoacan, and Puebla.
Discussion. The subspecies humeralis was described based on a single specimen from
the same locality as the nominal subspecies. The characters used to define the subspecies
represent individual variation and are mutable within a larger series of specimens.

Biology. Unknown.

183

Pelecyphorus (Sicharbas) erosus (Champion), New Combination

Astrotus erosus Champion, 18922504
Pelecyphorus (Astrotus) erosus (Champion). Smith, 2010

= Pelecyphorus (Astrotus) nosodermoides (Champion, 18922505), New Synonym

Type Material. HOLOTYPE, by monotypy, (female) labeled: a) Orange bordered white
circle reading “Type”; b) “San Juan de / los Llanos / Mex. F lohr”; c) handwritten det.
“Astrotus / erosus, Ch.”; d) “B.C.ACol.IV .1. / Astrotus / erosus”. (BMNH).

Additional Material Examined. (5 specimens). MEXICO: Hidalgo (Real del Monte,

4mi N Tepeapulco).

Redescription (see fig. 2.17). Length 7.5-9.6mm, width 3.1-4.5 (holotype length: 9.6mm,
width: 4.5mm). Integument black or ferruginous, often densely encrusted with debris;
setae yellowish-white to brown, acuminate or apically truncate scales unless otherwise
noted; elytra wider than pronotum and 2.9-3.1X longer. Head: Densely foveate, anterior
margins of some fovea raised, forming rounded tubercles, each with a single seta;
frontoclypeal suture slightly laterally impressed, clypeus elongate, epistomal suture
indented at margin; medial depression on fi'ons vaguely impressed; eye broadly oval.
Mentum anterior margin with a shallow median notch. Antenna sparsely clothed in erect
acuminate golden setae; antennal segment 10 laterally flattened, widest at apicies,
tomentose sensilla meeting or nearly meeting on one side, surrounding most of apex;

antennal segment 11 amplected into segment 10, exposing most of segment. Prothorax:

184

Pronotum margin costate, arctuate or slightly sinuate, widest near middle, costa
tuberculate and reflexed; anterior apicies produced and rounded; posterior apicies acute,
not produced; posterior margin truncate or weakly convex. Pronotal disc densely
punctate; anterior margins of punctures raised, forming rounded tubercles, each with a
semi-erect setae; smooth longitudinal medial line not reaching base or apex; paramedial
fossae faintly indicated. Pterothorax: Elytra parallel sided or slightly wider behind
middle, clothed with squamate or lanceloate scales, most arising from minute tubercles,
denser along crests of costae or low projections; elytral humera oblique; marginal costa
tuberculate, posteriorly reduced to a row of short projecting points and ridges; discal
costa tuberculate, distinct in basal half or throughout; sutural costa not raised; additional
low, tuberculate and setose, oblique or transverse, costae and protrusions irregularly
distributed across disc. Legs: Mesotrocantin small, exposed. Femora and tibia densely
foveate and setose, setae on tibia arising from tubercles or not; tarsi venter clothed with
long golden setae; combined protarsal segments approximately two-thirds length of
protibia, apical protibial spine acute and glabrous; anterior protibial spur shorter than

basitarsi. Abdomen: Densely punctate and setose.

Diagnosis. P. erosus can be separated from the other members of the Sicharbas subgenus
based on the following character combination: pronotum margin arctuate or slightly
sinuate, widest near middle, marginal costa tuberculate and reflexed; pronotum medially
longitudinally depressed, not reaching base or apex; tomentose sensilla on antennal

segment 10 meeting or nearly meeting on one side not forming a broad continuous band;

185

apical protibial spine acute and glabrous; elytral marginal carina reduced to a series of
small setose projections in apical third.

Distribution. Known from only six specimens. The exact type locality is unknown, as
there are several regions in Mexico called San Juan de los Llanos. According to an
examination of localities listed in the B.C.A (Selander and Vaurie 1962) it may refer to a
district in Puebla between Tlaxcala and Veracruz or a village in Guanajuato (40km
northeast of Leon). Two of the other two known specimens are fiom the Mexican state of
Hidalgo (Real del Monte, 4mi N Tepeapulco), the others are labeled simple as Mexico.
Discussion. Both P. erosus and P. nosodermoides were described by Champion based on
unique specimens. Upon examination, and with the addition of four other specimens, it
was determined that the type specimen of P. nosodermoides is a male P. erosus, while the
holotype of P. erosus is a female. The sexes vary only in elytral shape, more parallel
sided in the male, and the length of the discal costa, longer in the male. Hence, P.
nosodermoides is synonymized under P. erosus.

Biology. Unknown.

Pelecyphorus (Sicharbas) undatus (Champion), New Combination

Astrotus undatus Champion, 1892:504

Pelecwhorus (Astrotus) undatus (Champion, 1892:504). Smith, 2010

Type Material. LECTOTYPE, designated here, (female) labeled: a) Orange bordered

white circle reading “Type”; b) ‘“‘Ventanas, / Durango. / Hoge.’”’; c) handwritten det.

186

“Astrotus / undatus, Ch.”; d) “Sp. figured”; e) “B.C.ACol.IV.1./ Astrotus / undatus”.
(BMNH). PARALECTOTYPES, designated here, (7 specimens) [all bearing the label
“PARALECTOTYPE /Astrotus / undatus / Champion, 1892 / Aaron D. Smith” on
yellow paper] with the same locality data as lectotype (BMNH).

Additional Material Examined. (2 specimens). MEXICO: Durango.

Redescription (see fig. 2.18). Length 8.8-12.6mm, width 4.2-6.3 (lectotype length:
11.6mm, width: 5.8mm). Integument ferruginous; setae yellowish-white lanceolate
decurnbent scales unless otherwise noted; elytra wider than pronotum and approximately
3X longer. Head: Densely foveate, each fovea subtended by a setae; frontoclypeal suture
and medial depression on frons faintly impressed; epistomal suture obscured and not
indented at margin; eye broadly oval. Mentum anterior margin with a shallow median
emargination. Submentum narrower than buccal cavity, leaving at most a minute space
laterally. Postgenal process produced and rounded. Antenna moderately clothed in erect
acuminate reddish-brown setae; antennal segment 10 laterally flattened, widest at apicies,
tomentose sensilla separate, surrounding most of apex; antennal segment 11 amplected
into segment 10, exposing most of segment. Prothorax: Pronotum margin costate and
sinuate, widest near middle, costa crenulate and reflexed; anterior apicies produced and
acute; posterior apicies acute, not produced; posterior margin truncate or weakly convex.
Pronotal disc densely foveate, each fovea subtended by a setae; smooth longitudinal
medial line thin and faint; two or four paramedial fossae present. Pterothorax: Elytra
nearly parallel sided, slightly wider behind middle, setose, some setae arising from

minute tubercles and erect; elytral humera reflexed; marginal costa tuberculate; discal

187

costa absent or distinct in basal third and tuberculate; sutural costa not raised; additional
low, tuberculate and setose, oblique or transverse, costae and protrusions irregularly
distributed across disc. Legs: Mesotrocantin small, exposed. Femora and tibia densely
foveate and setose, setae on tibia arising from tubercles or not; tarsi venter clothed with
long golden setae and shorter spiniform setae laterally; combined protarsal segments
approximately two-thirds length of protibia, apical protibial spine acute and glabrous;
anterior protibial spur shorter than basitarsi. Abdomen: Densely finely punctate and
setose.

Diagnosis. P. undatw can be separated from the other members of the Sicharbas
subgenus based on the following character combination: pronotum margin sinuate, widest
near middle, marginal costa tuberculate and reflexed; pronotum medially with a thin
smooth longitudinal line, not depressed; pronotal disc not tuberculate; tomentose sensilla
on antennal segment 10 separate; apical protibial spine acute and glabrous; elytral discal
carina absent or faintly raised in basal third; elytral humera reflexed.

Distribution. Known only fi'om the Ventanas region in Durango, Mexico.

Biology. Unknown.

subgenus Pelecyphorus Solier, 1836, sensu strictu
Pelecyphorus Solier 1836:467. Type species: Pelecyphorus mexicanus Solier, 1836:469,

by subsequent designation, Casey 1912:105. Lectotype (MNHN).

Redescription [Modified fiom Brown 1971b]. Length: 12.9-17.3mm, width: 7.5-9.5mm;

body obovate and setose, setae often modified, lanceolate or squamate, always with

188

Pelecyphorus-type stellate setae. Head: Mentum subtrapezoidal to transversely cordate;
separated from postgenal processes by a small space, not reaching mandibles when
closed; lateral slightly curved inward near apicies; anterior margin medially emarginate.
Ligula sclerotized, small, approximately one-fourth mentum width; slightly curved and
partially visible above anterior margin of mentum. Apical segment of maxillary palps
enlarged, weakly scalene in both sexes, more expanded in males. Submentum projecting
into buccal cavity; width approximately two-thirds that of buccal cavity, partially
exposing maxillary cardos laterally. Postgenal processes produced, acute, and slightly
swollen, extending beyond middle of mentum. Labral margin broadly emarginate; clypeal
membrane concealed Clypeal margin broadly emarginate. Eyes elongate, narrow,
occassionaly weakly reniform. Antenna weakly clavate, segments compact; apical
tomentose sensilla on antennal segment 10, separated into two patches at lateral apices;
antennal segment 11 one-half size of segment 10, apical tomentose sensillum covering
one-fourth of segment. Prothorax: Pronotal margin costate and arctuate; pronotal disc
without a median costa or paramedial fossae. Prostemal process thin, raised and
projecting behind procoxal cavities, longitutunally impressed or not, apex broadly
rounded. Pterothorax: Elytral sculpturing variable, marginal costa present. Mesonotum
with two deep transverse depressions, leaving a thin medial ridge between the scutellum
and scutum. Legs: Mesocoxal cavities open; mesotrocantin small and exposed.
Abdomen: Tomentose band of setae present along apical margins of ventrites 1-4.
Diagnosis. The subgenus Pelecyphorus is distinguished fi'om other Pelecyphorus
subgenera by a unique combination of the following characters: Ligula small, one-fourth

mentum width, partially visible above anterior margin of mentum. Mesonotum with two

189

deep transverse depressions. Dense tomentose fiinge present on abdominal ventrites 1-4;
Pelecyphorus-type stellate setae present.

Distribution. MEXICO: Puebla, Queretaro, Veracruz.

Species Descriptions

Pelecyphorus (Pelecyph orus) mexicanus Solier

Pelecjphorus mexicanus Solier, 18362469
Asida mexicana Solier, 1836:469. Horn, 18702282.

Pelecyphorus mexicanus Solier 18362469. Casey, 19122105.

Type Material. LECTOTYPE (male) labeled: a) “Mexica- / nus”; b) “Pelecyphor. /
mexicanus / “[illegible script], Sol” / “[illegible]”; c) “Col. Marseul / Col. Solier”; d)
“LECTOTYPE / Pelecyphorus / mexicanus Sol._6‘ / Examined by / Kirby W. Brown /
August 1968”. (MNHN).

Additional Material Examined. (61 specimens). MEXICO: Puebla.

Redescription (see fig. 2.19). Length: 12.9-17.3mm, width: 7.5-9.5mm (lectotype length:
15.1mm, width: 8.0mm). integument black, often densely coated with debris; setae pale
and yellowish-white unless otherwise noted; elytra wider than pronotum and 2.7-3X
longer, width of pronotum at base slightly less than width of elytral base. Head: Densely

punctate with decurnbent lanceolate or serrate scales, becoming erect and acuminate on

190

clypeus, emerging from sides of punctures; fiontoclypeal suture not or vaguely
impressed, epistomal suture indented at margin; medial depression on frons absent or
weakly impressed. Mentum anterior margin straight with a small median emargination at
ligula insertion. Antenna densely clothed in erect acuminate setae, nearly clear in color
on basal segments; antennal segment 10 subquadrate or slightly wider at apicies,
tomentose sensilla separated, curved and wrapping around apex; antennal segment 11 ,
weakly amplected into segment 10, exposing most of segment. Prothorax: Pronotum
margin costate and arcuate, widest near middle, not reflexed; anterior apicies produced
and acute; posterior apicies acute, not produced; posterior margin nearly straight, without
a medial tooth. Pronotal disc densely foveate and slightly rugose; each fovea with a
single lanceolate or lanceo-serrate scale emerging fi'om anterior side; longitudinal medial
depression and paramedial fossa absent. Pterothorax: Elytra broadly oval, widest behind
middle; marginal costa present, not reflexed; elytral humera rectiform, slightly reflexed
or not; disc coarsely reticulate or with elytral and sutural costae distinct; depressions
between costa and/or reticulations densely clothed with Pelecwhorus-type stellate setae
and lanceo-serrate scales, often thickly coated with debris. Legs: F emora shallowly
foveate, with short acuminate setae, and rugose; tibia densely tuberculate, pale acuminate
or darker spiniform setae emerging from tubercles; tarsi venter laterally with black
spiniform setae; apical protibial spine large, acute, and glaberous; anterior protibial spur
length subequal to basitarsi. Abdomen: Moderately punctate, punctures small, each with
a short acuminate setae; dense tomentose band of yellowish-white setae present along

apical margins of ventrites 1-4.

191

Diagnosis. P. mexicanus is the only known member of the nominate sub genus and can be
reliably separated from all other Pelecyphorus species based on its subgeneric diagnosis.
Distribution. MEXICO: Puebla, Queretaro, Veracruz.

Biology. Unknown. Collected at lights, fiom underneath rocks and plant debris, from

spider webs, or while walking.

subgenus Ucalegon Champion 1884

Ucalegon Champion 1884265. Type species: Ucalegon pulchellus Champion, 1884265, by

monotypy.

Redescription. Length: 11-15.9mm, width: 4.9-7.9mm; body obovate and setose, with
lanceolate or squamate scales. Head: Mentum subtrapezoidal to transversely cordate;
reaching postgenal processes or separated by a small space, not reaching mandibles
when closed; laterally curved inward near apicies; anterior margin medially emarginate.
Ligula sclerotized, small, approximately one-fourth mentum width, curved and partially
visible above anterior margin of mentum. Apical segment of maxillary palps enlarged,
isotriangular to weakly scalene in both sexes, more expanded in males. Submentum
projecting into buccal cavity; width approximately four-fifths that of buccal cavity,
partially exposing maxillary cardos laterally. Postgenal processes produced, acute, and
slightly swollen, extending beyond middle of mentum. Labral margin broadly
emarginate; clypeal membrane concealed. Clypeal margin broadly emarginate. Eyes
elongate, narrow, occassionaly weakly reniform. Antenna weakly clavate, segments

nearly moniliform; apical tomentose sensilla on antennal segment 10 separated into two

192

patches at lateral apices; antennal segment 11 two-thirds size of segment 10 and slightly
amplected into it, apical tomentose sensillum covering approximately half of segment.
Prothorax: Pronotal margin costate and strongly sinuate; pronotal disc with or without a
shallow median fossa. Prostemal process thin, raised and projecting behind procoxal
cavities, broadly longitudinally impressed, apex rounded or sagittate. Pterothorax:
Elytra nearly planate, lacking transverse costae or protrusions; marginal costa present;
elytral costa present and not divided; thickly clothed with multihued scales, forming a
contrasting colored pattern. Mesonotum with two deep transverse depressions, leaving a
thin medial ridge between the scutellum and scutum. Legs: Mesocoxal cavities open;
mesotrocantin prominent and exposed.

Diagnosis. The subgenus Ucalegon is distinguished from other Pelecyphorus subgenera
by a unique combination of the following characters: pronotum strongly sinuate; elytra
nearly planate, lacking transverse costae or protuberances, with elytral costa raised and
not divided; elytral disc thickly clothed with multihued scales, forming a distinct
contrasting colored pattern.

Distribution. MEXICO: Oaxaca.

Species Descriptions

Pelecyphorus (Ucalegon) pulchellus Champion

Ucalegon pulchellus Champion, 1884265
Asida pulchellus (Champion). Champion, 18922491

Ucalegon pulchellus Champion, 1884265. Wilke, 19222275

193

Pelecyphorus (Ucalegon) pulchellus (Champion), Smith, 2010

Type Material. LECTOTYPE, designated here, (male) labeled: a) Orange bordered
white circle reading “Type”; b) “Sp. figured”; c) “Mexico. / Salle Coll.”; d)
“Tehuantepec”; e) handwritten det. “Ucalegon / pulchellus, / Champ”; t) handwritten det.
“Philolithus / sumichrasti Salle / apud Salle MS”; g) “B.C.A. Col.IV .1. / Ucalegon/
pulchellus”. (BMNH). PARALECTOTYPES, designated here, (2 specimens) [all bearing
the label “PARALECTOTYPE/ Ucalegon / pulchellus / Champion, 1884 / Aaron D.
Smith” on yellow paper]: 1 (BMNH) with the same locality data as lectotype (BMNH), 1
(BMNH) labeled “Mexico”.

Additional Material Examined. (72 specimens). MEXICO: Oaxaca.

Redescription (see fig. 2.20). Length: 11.0-15.9mm, width: 4.9-7 .9mm (lectotype length:
15.1mm, width: 6.9mm). Integument black to ferruginous, rarely densely encrusted with
debris; elytra wider than pronotmn and 2.5-3.5x longer, width of pronotum at base nearly
equal to width of elytral base. Head: Densely punctate with lanceolate or squamate
scales, becoming erect and acuminate on clypeus, emerging fiom sides of punctures;
fi'ontoclypeal suture laterally impressed, impression occasionally extended longitudinally
towards eye, epistomal suture indented at margin; medial depression on frons absent or
weakly impressed. Mentum anterior margin straight with a shallow median emargination
at ligula insertion. Antenna moderately clothed in golden erect acuminate setae; antennal
segment 10 subquadrate or wider at apicies, tomentose sensilla separated, curved and

wrapping around apex; antennal segment 11 weakly amplected into segment 10, exposing

194

most of segment. Prothorax: Pronotum margin strongly sinuate, widest near middle, not
or slightly reflexed; anterior apicies produced and acute; posterior apicies acute, not
produced; posterior margin nearly straight, a medial tooth rarely lacking. Pronotal disc
densely tuberculate, tubercles rounded and shiny, each with a lanceolate scale, tubercles
near margins often with an associated puncture; longitudinal medial depression broad and
shallow or absent; paramedial fossa absent; surface densely clothed with pale and dark
squamate scales, usually forming two dense, nearly black, paramedial longitudinal lines .
Pterothorax: Elytra elongate oval, widest behind middle; marginal costa present,
tuberculate, and not reflexed; elytral humera slightly obtuse, not reflexed; discal costa
present fiom base to apical third, not divided, sinuate, and tuberculate, with widely
spaced erect acuminate setae along crest; densely clothed with pale, orange, and dark
brown squamate scales, forming several thick dark brown patches and lines, including a
large triangular patch near middle between elytral suture and discal costa, often extending
anteriorly next to elyu'al suture. Legs: F emora shallowly foveate, with short acuminate
setae, and rugose; tibia densely tuberculate, pale acuminate setae emerging from
tubercles; tarsi venter with long pale setae, stouter laterally; apical protibial spine large,
acute, and glaberous; combined protarsal segments subequal to protibial length in male,
approximately two-thirds length of protibia in female; anterior protibial spur length
shorter than basitarsi. Abdomen: Setose and slightly rugose with minute punctures and
tubercles.

Diagnosis. P. pulchellus is the only known member of the Ucalegon subgenus and can be
reliably separated from all other Pelecyphorus species based on the subgeneric diagnosis

and the presence of two dense black triangular setal patches halfway down elytral length.

195

Distribution. MEXICO: Oaxaca.
Biology. Unknown. Collected at lights, from underneath fallen cactus pads, and on fallen

tree branches.

subgenus Zaleucus Champion, 1892
Zaleucus Champion, 18922491. Type species: Zamolxis dilatatus Champion, 1884, by
monotypy.
= Zamobcis Champion 1884270 (preoccupied).
=Poliorcetes Champion, 1884270. Type species: Poliorcetes platesthoides Champion,

1884270.

Redescription. Length: 11.6-1 8.4mm, width: 5.8-9.1mm. Integument shiny, black or
rarely ferruginous, occasionally encrusted with debris; body obovate; dorsal setae
inconspicuous, lanceolate or truncate elongate scales. Head: Mentum subtrapezoidal;
reaching postgenal processes or separated by a small space, nearly reaching mandibles
when closed; laterally curved inward near apicies; anterior margin medially notched.
Ligula sclerotized, small, approximately one-fourth mentum width, curved and partially
visible above anterior margin of mentum or concealed. Apical segment of maxillary palps
enlarged, isotriangular to weakly scalene in both sexes, more expanded in males.
Submentum projecting into buccal cavity; width approximately four-fifihs that of buccal
cavity, partially exposing maxillary cardos laterally. Postgenal processes produced,
reaching middle of mentum to apex, acute, and slightly or strongly swollen. Labral

margin emarginate; clypeal membrane concealed. Clypeal margin broadly emarginate.

196

Eyes elongate, oval or weakly reniform. Antenna weakly clavate, segments nearly
moniliform; apical tomentose sensilla on antennal segment 10 separated into two patches
at lateral apices; antennal segment 11 two-thirds or more size of segment 10 and slightly
amplected into it, apical tomentose sensillum covering approximately half of segment
(Fig). Prothorax: Pronotal margin costate, arctuate or weakly sinuate; pronotal disc
broadly convex, fossae absent or faintly impressed, medial ridge absent; posterior margin
truncate or convex, without a median tooth. Prostemal process longitudinally impressed,
raised and projecting behind procoxal cavities or deflexed; apex rounded or sagittate.
Pterothorax: Elytra broadly convex, sculpturing variable, but marginal and discal costae
always present. Mesonotum mostly exposed, with two shallow transverse depressions,
leaving a thin low medial ridge between the scutellum and scutum. Legs: Mesocoxal
cavities open; mesotrocantin prominent and exposed.

Diagnosis. The subgenus Zaleucus is distinguished fi'om other Pelecyphorus subgenera
by a unique combination of the following characters: mentum subtrapezoidal, reaching
postgenal processes or separated by a small space; pronotum arctuate or weakly sinuate;
dorsal setae absent or inconspicous; mesotrocantin prominent and exposed.

Distribution. MEXICO: Coahuila, Nuevo Leon, Oaxaca, Puebla, Zacatecas.

197

Species Descriptions

Pelecyphorus (Zaleucus) dilatatus (Champion)

Zamolxis dilatatus Champion, 1884270
Asida dilatatus (Champion). Champion, 18922491
Zaleucus dilatatus (Champion). Wilke, 19222275

Pelecwhorus (Zaleucus) dilatatus (Champion), Smith, 2010

Type Material. LECTOTYPE, designated here, (female) labeled: a) Orange bordered
white circle reading “Type”; b) “Puebla”; c) “1749”; d) “Mexico. / Salle Coll.”; d)
handwritten det. “Zaleucus / dilatatus Ch”; e) “Sp. figured”; t) “Zamolxis / (Zaleucus)/
dilatatus, Ch.”; g) “B.C.ACol.IV.1. / Zamolxis / dilatatus”. (BMNH).
PARALECTOTYPE, designated here, one specimen (BMNH) with same locality data as
lectotype and bearing the label “PARALECTOTYPE / Zamolxis / dilatatus / Champion,
1884 / Aaron D. Smi ” on yellow paper.

Additional Material Examined. (18 specimens). MEXICO: Oaxaca, Puebla.

Redescription (see fig. 2.21). Length: 14.5-18.4mm, width: 6.6-9.lmm (lectotype length:
. 15.8mm, width: 7.8mm). Integument shiny, black, rarely encrusted with debris; setae
short, yellowish white, and simple unless otherwise noted; elytra barely wider than
pronotum and 3.0-3.5X longer, width of pronotum at base nearly equal to width of elytral

base. Head: Densely foveate with thin simple setae emerging from sides of fovea;

198

frontoclypeal suture faintly or laterally impressed, epistomal suture indented at margin;
medial depression on frons absent or weakly impressed. Mentum anterior margin straight
with a rounded median emargination at ligula insertion. Submentum transversely
impressed before apex, apex truncate. Postgenal processes swollen, acute, and extending
nearly to anterior margin of mentum. Antenna moderately clothed in golden erect
acuminate setae; antennal segment 10 wider at apicies, tomentose sensilla separated,
curved and wrapping around apex; antennal segment 11 weakly amplected into segment
10, exposing most of segment. Prothorax: Pronotum margin strongly arcuate, dilated
near middle, slightly reflexed; anterior apicies barely produced, broadly rounded or acute;
posterior apicies oblique, occasionally with an acute point, not produced; posterior
margin slightly convex, never with a medial tooth; paramedial fossa absent or faintly
impressed. Prostemal process longitudinally impressed, deflexed behind procoxa
Prostemum densely foveate. Pterothorax: Elytra elongate oval, widest near middle;
marginal costa not divided, smooth or with scattered punctures, not reflexed, meeting
discal costa near cauda; elytral humera obtuse, not reflexed; discal costa bifurcate near
base, branches reuniting in apical third, inner branch not raised as high as outer,
occasionally barely indicated, crests smooth and shiny; intercostal spaces smooth, with
scattered fovea and decurnbent simple setae. Legs: F emora shiny, shallowly punctate and
rugose; tibia densely foveate and setose, setae long, pale, and acuminate mixed with
stouter spiniform setae emerging from small tubercles; tarsi venter with long pale setae
and darker spiniform setae laterally; apical protibial spine large, acute, and glaberous;

combined protarsal segments approximately two-thirds length of protibia; anterior

199

protibial spur length shorter than basitarsi. Abdomen: Shiny with scattered setose fovea,
setae simple and inconspicuous; intercoxal process truncate at apex.

Diagnosis. P. dilatatus can be separated from the other members of the Zaleucus
subgenus based on the following character combination: postgenal processes strongly
swollen and nearly reaching anterior margin of mentum; pronotal margin dilated and
slightly reflex; marginal costa not divided.

Distribution. MEXICO: Oaxaca, Puebla.

Biology. Unknown. Collected at lights, from underneath plant debris, and ovipositing in

sandy soil at night.

Pelecyphorus (Zaleucus) platesthoides (Champion)

Poliorcetes platesthoides Champion, 1884271
Asida platesthoides (Champion). Champion, 18922491
Poliorcetes platesthoides (Champion). Wilke, 19222275

Pelecyphorus (Zaleucus) platesthoides (Champion, 1884271). Smith, 2010

Type Material. LECTOTYPE, designated here, (sex undetermined) labeled: a) Orange
bordered white circle reading “Type”; b) “Ticomavaca, / Mexico. / Hoege”; c)
handwritten det. “Poliorcetes / platesthoides, / Ch.”; d) “Sp. figured”; d) “B.C.A.
Col.IV.1. / Poliorcetes / platesthoides. (BMNH). PARALECTOTYPES (60 specimens)
[all bearing the label “PARALECTOTYPE/ Ucalegon / pulchellus / Champion, 1884/

Aaron D. Smith” on yellow paper]: with the same locality data as lectotype (48-BMNH,

200

2-NMNH, l-RLAC, l-KWBC); labeled “Ticomavaca, / Oaxaca. / Hoge” (7-BMNH, 1-
CASC).

Additional Material Examined. (2 specimens). MEXICO: Oaxaca.

Redescription (see fig. 2.22). Length: 12.8-16.9mm, width: 6.6-9.2mm (lectotype length:
14.3mm, width: 7.3mm). Integument shiny, black to ferruginous, rarely encrusted with
debris; setae short, yellowish white, and simple unless otherwise noted; elytra wider than

pronotum and 3.1-3.5X longer, width of pronotum at base nearly equal to width of elytral

 

W Ram-“1' '

base. Head: moderately punctate with thin simple setae emerging from sides of
punctures; frontoclypeal suture faintly impressed, epistomal suture indented at margin;
medial depression on frons absent or weakly impressed. Mentum anterior margin straight
with a median notch at ligula insertion. Submentum not impressed before apex, apex
emarginate. Postgenal processes slightly swollen, acute, and extending to middle of
mentum. Antenna moderately clothed in golden erect acuminate setae; antennal segment
10 wider at apicies, tomentose sensilla separated, curved and wrapping around apex;
antennal segment 11 weakly amplected into segment 10, exposing most of segment.
Prothorax: Pronotal margin slightly sinuate, widest near middle, not or faintly reflexed;
anterior apicies produced and acute; posterior apicies acute, not produced; posterior
margin nearly straight, never with a medial tooth; paramedial fossa absent. Prostemal
process not longitudinally impressed, raised behind procoxa, apex rounded. Prostemum
moderately foveate, anterior margin of some fovea raised and weakly tuberculate.
Pterothorax: Elytr-a elongate oval, widest near middle. Marginal costa slightly crenulate,

crenulations becoming larger posterad, meeting discal costa near cauda, and not reflexed;

201

inner branch present fi'om slightly before middle to apical third, not connecting primary
branch of marginal costa or discal costa; elytral humera obtuse, not reflexed. Discal costa
carinate, raised near elytral base and extending to apical fourth before uniting with
marginal costa; inner branch absent or very faintly indicated; crest smooth and shiny.
Intercostal spaces smooth, with scattered punctures and decurnbent simple setae. Legs:
Femora shallowly punctate and rugose; tibia densely shallowly punctate and setose, setae
short, pale, and acuminate mixed with stouter spiniform setae emerging fiom small
tubercles; tarsi venter with stout spiniform setae on laterally margins, medially glaberous,
distal tarsi with longer acuminate setae; apical protibial spine large, acute, and glaberous;
combined protarsal segments approximately two-thirds length of protibia; anterior
protibial spur length shorter than basitarsi. Abdomen: Shiny and moderately punctate,
punctures with or without simple inconspicuous setae; intercoxal process broadly
rounded at apex.

Diagnosis. P. platesthoides can be separated from the other members of the Zaluecus
subgenus based on the following character combination: postgenal processes slightly
swollen and reaching middle of mentum, submentum apex emarginate; pronotal margin
weakly sinuate and not or slightly reflex; pronotal disc punctate; marginal costae of elytra
crenulate and divided, inner branch raised from slightly before middle to apical third, not
connecting primary branch of marginal costa or discal costa.

Distribution. MEXICO: Oaxaca.

Biology. Unknown.

202

 

Pelecyphorus (Zaleucus) foveolatus Solier

Pelecyphorusfoveolatus Solier, 18362472
Asidafoveolata (Solier). Horn, 18702282. Wilke, 19222270
Parasidafoveolata (Solier). Wilke, 19222275

Pelecyphorus (Zaleucus)foveolatus Solier, 18362472. Smith, 2010

Type Material. LECTOTYPE, designated here, (male) labeled: a) “Mexico”; b)
“Pelecyphorus / foveolatus/ [illegible script] / [illegible script]) / [illegible, looks like
??61]”; c) “Col. Marseul / Col. Solier”; d) “LECTOTYPE / Pelecyphorus / foveolatus
Sol._6‘ / Examined by / Kirby W. Brown / August 1968”. (MNHN)

Additional Material Examined. (122 specimens). MEXICO: Oaxaca.

Redescription (see fig. 2.23). Length: 11.6-18.0mm, width: 5.8-8.7mm (lectotype length:
12.1mm, width: 6.0mm). Integument shiny, black, rarely encrusted with debris; setae
short, yellowish white, and simple unless otherwise noted; elytra wider than pronotum
and 2.6-3.4X longer, width of pronotum at base less than width of elytral base. Head:
moderately foveate with thin simple setae emerging from sides of punctures;
fi'ontoclypeal suture faintly laterally impressed, epistomal suture indented at margin;
medial depression on fi'ons weakly impressed. Mentum anterior margin straight with a
shallow median emargination at ligula insertion. Submentum not impressed before apex,
apex broadly emarginate. Postgenal processes swollen, acute, and extending nearly to

anterior margin of mentum. Antenna moderately clothed in golden erect acuminate setae;

203

 

antennal segment 10 wider at apicies, tomentose sensilla separated, curved and wrapping
around apex; antennal segment 11 weakly amplected into segment 10, exposing most of
segment. Prothorax: Pronotal margin slightly sinuate, widest near middle, not reflexed;
anterior apicies produced and acute; posterior apicies acute, produced, slightly projecting
over elytral humera or not; posterior margin concave, never with a medial tooth. Pronotal
disc moderately foveate, each fovea with a decumbent acuminate setae arising from
anterior face; paramedial fossa absent. Prostemal process not longitudinally impressed,

strongly raised behind procoxae, apex sagittate. Prostemmn moderately foveate, anterior

 

margin of some fovea raised and weakly tuberculate. Pterothorax: Elytra elongate oval,
widest behind middle. Marginal costa smooth, meeting discal costa near cauda, and not
reflexed; inner branch absent or low, reticulate, and present fi'om slightly before middle
to apical third, not connecting primary branch of marginal costa or discal costa; elytral
humera obtuse, not reflexed. Discal costa slightly reticulate and smooth; wealdy raised
near elytral base and bifurcate, branches reuniting in apical fourth before uniting with
marginal costa near cauda; inner branch weak or barely indicated Sutural costa weakly
raised or not. Intercostal spaces rugose, with weakly raised irregular transverse costae;
punctures widely scattered along bases of costae; short sparse nearly lanceolate scales
present and inconspicuous. Legs: Femora shallowly punctate and rugose; tibia densely
shallowly punctate and setose, setae short, pale, and acuminate mixed with stouter
spiniform setae emerging from small tubercles; tarsi venter with long acuminate setae and
stout spiniform setae on laterally margins, medially glaberous on tarsal segment 24;
apical protibial spine large, acute, and glaberous; combined protarsal segments

approximately two-thirds length of protibia; anterior protibial spur length shorter than

204

basitarsi. Abdomen: Shiny and sparsely punctate, punctures with or without simple
inconspicuous setae; intercoxal process broadly rounded at apex.

Diagnosis. P. foveolatus can be separated from the other members of the Zaluecus
subgenus based on the following character combination: postgenal processes swollen and
nearly reaching anterior margin of mentum, submentum apex emarginate; pronotal
margin weakly sinuate and not or slightly reflex; pronotal disc foveate; marginal costae
of elytra smooth and divided, inner branch weak; intercostal spaces of elytra rugose.

Distribution. MEXICO: Oaxaca.

 

Biology. Unknown. Collected from dead cactus and walking on surface during day.

Pelecyphorus (Zaleucus) doyeni Smith, n. sp.

Type Material. HOLOTYPE (female) labeled: a) “MEXICO. NUEVO / LEON: Hwy

 

58, 13 km / E of junction with Hwy / 57, 2000 m, / 5 JUN 1993.”; b) on red paper,
“HOLOTYPE / Pelecyphorus / (Zaleucus) / doyem' S? /Aaron D. Smith” (CASC).
PARATYPES (31 specimens) [all bearing the label “PARATYPE / Pelecyphorus/
(Zaleucus) / doyeni / Aaron D. Smith” on yellow paper]: 16 paratypes (CASC) with same
locality data as holotype. 5 paratypes (CASC) labeled a) “MEXICO: Coahuila / 20 mi N
of Conception / del Oro 5800’ / 10 August 1993 / Collector unknown / Cal. Acad. Sci.
Collection”; b) “California Academy / of Sciences / collection”. 6 paratypes (CASC)
labeled a) “MEXICO: Zacatecas 45 miles / NW of Matehuala 6000’ / del Oro 5800’ / 10

August 1993 / Collector unknown / Cal. Acad. Sci. Collection”; b) “California Academy /

205

of Sciences / collection”. 4 paratypes (3-EMEC, l-KWBC) labeled a) “MEX: 40 mi. / SE

Zacatecas. / Zac. VIII-25-69”; b) “J .T. Doyen / collector”.

Redescription (see fig. 2.24). Length: 13.9-17.8mm, width: 6.6-8.8mm (holotype length:
15.9mm, width: 7.5mm). Integument shiny, black, rarely encrusted with debris; setae
short, yellowish white, and simple unless otherwise noted; elytra wider than pronotum
and 2.7-3.3X longer, width of pronotum at base subequal to width of elytral base. Head:

moderately foveate with thin simple setae emerging from sides of punctures;

 

frontoclypeal suture not or faintly impressed, epistomal suture not indented at margin;
medial depression on frons absent or weakly impressed. Mentum anterior margin straight
with a median notch at ligula insertion. Submentum not impressed before apex, apex
broadly emarginate. Postgenal processes slightly swollen, acute, and extending past
middle of mentum, not reaching anterior margin of mentum. Antenna moderately clothed
in golden erect acuminate setae; antennal segment 10 wider at apicies, tomentose sensilla
separated, oval, not wrapping around apex; antennal segment 11 weakly amplected into
segment 10, exposing most [of segment. Prothorax: Pronotal margin arctuate, widest near
middle, not significantly dilated, and weakly reflexed; anterior apicies produced and
acute; posterior apicies obtuse; posterior margin concave, never with a medial tooth.
Pronotal disc moderately foveate, each fovea with a minute simple setae arising from
anterior side; paramedial fossa absent. Prostemal process longitudinally impressed,
deflexed behind procoxae. Prostemum moderately foveate, anterior margins of fovea not
raised or tuberculate. Pterothorax: Elytra elongate oval, widest near middle. Marginal

costa lightly punctate, meeting discal costa near cauda, and not reflexed; inner branch

206

absent or faintly indicated; elytral humera obtuse, not reflexed. Discal costa weakly
raised near elytral base and bifurcate, branches reuniting in apical fourth before uniting
with marginal costa near cauda, crests lightly punctate and shiny. Sutural costa not raised.
Intercostal spaces rugose, with weakly raised irregular transverse or oblique costae;
moderately and irregularly punctate with short inconspicuous simple setae. Legs: Femora
shallowly punctate and rugose; tibia rugose and setose, setae short, pale, and acuminate
mixed with stouter spiniform setae emerging from small tubercles; tarsi venter with long

acuminate setae and stout spiniform setae on laterally margins, medially setose; apical

 

protibial spine large, acute, and glaberous; combined protarsal segments approximately
two-thirds length of protibia; anterior protibial spur length shorter than basitarsi.
Abdomen: Shiny and sparsely punctate, punctures with or without simple inconspicuous
setae; intercoxal process broadly rounded at apex.

Diagnosis. P. doyeni can be separated from the other members of the Zaluecus subgenus
based on the following character combination: postgenal processes swollen, extending
past middle of mentum, not reaching anterior margin; submentum apex emarginate;
pronotal margin arctuate, widest near middle, not dilated, and slightly reflex; pronotal
disc moderately foveate, posterior apicies obtuse; marginal costae of elytra lightly
punctate and rarely divided, inner branch absent or weakly indicated; intercostal spaces
of elytra rugose.

Distribution. MEXICO: Coahuila, Nuevo Leon, and Zacatecas.

Etymology. The species is named in honor of John T. Doyen, the only known collector
of specimens in the type series.

Biology. Unknown.

207

subgenus Variodorsus Smith, New Subgenus

Type species: Asida guanajuatensis Champion, 1884256.

Description. Length: 9.5-15.1mm, width: 4.8-8.4mm. Integument black; densely setose,
with modified lanceolate and squamate scales dorsally, lacking stellate setae. Head:
Mentum subtrapezoidal; contacting postgenal processes, nearly reaching mandibles
when closed; lateral straight of slightly curved inward near apicies; anterior margin

medially emarginate. Ligula sclerotized, small, approximately one-sixth mentum width;

slightly curved, concealed or partially visible above anterior margin of mentum. Apical
segment of maxillary palps enlarged, isotriangular to weakly scalene in female, scalene in
male with interior-distal angle acute. Submentum medially depressed; apex deeply
emarginate; projecting into buccal cavity; width four-fifths that of buccal cavity, partially
exposing maxillary cardos laterally. Postgenal processes produced, acute, and slightly
swollen, extending at least to middle of mentum. Labral margin broadly emarginate;
clypeal membrane concealed. Clypeal margin emarginate. Eyes elongate, thin and weakly
reniform. Antenna weakly clavate, segments 3-8 monilifonn, length equal to width;
apical tomentose sensilla on antennal segment 10 separated into two curved patches
around apex; antennal segment 11 approximately one-fourth size of segment 10, apical
tomentose sensillum covering one-half or less of segment, distinctly amplected into
segment 10. Prothorax: Pronotal margin costate, sinuate, consticted near basal third, and
not reflexed; pronotal disc variable, two or four paramedial fossae present. Prostemal
process wide, raised and projecting behind procoxal cavities, apex broadly rounded.

Pterothorax: Elytral sculpturing variable, marginal and distal costae. Mesonotum with

208

two shallow or deep transverse tomentose depressions, leaving a thin medial ridge
between the scutellum and scutum. Legs: Mesocoxal cavities open; mesotrocantin small,
exposed or rarely concealed. Abdomen: F oveate and setose, never with a tomentose band
of setae along margins of ventrites. Intercoxal process broad, apex truncate or broadly
rounded.

Diagnosis. The subgenus Variodorsus is distinguished from other Pelecyphorus
subgenera by a unique combination of the following characters: mentum contacting
postgenal processes, nearly reaching mandibles, anterior margin medially emarginate;
submentum deeply emarginate, partially exposing maxillary cardos laterally; antennal
segment 11 one-fourth or less size of segment 10, tomentose sensilla separate; dorsal
setae lanceolate or squamate, stellate setae absent; mesotrocantin small, exposed or
concealed.

Distribution. MEXICO: Aguascalientes, Guanajuato, Hidalgo, Morelos, Puebla

Species Descriptions

Pelecyphorus (Variodorsus) guanajuatensis (Champion), New Combination

Asida guanajuatensis Champion, 1884256

Astrotus guanajuatensis (Champion). Wilke, 19222267

Pelecyphorus (Astrotus) guanajuatensis (Champion). Smith, 2010

= Stenomorpha (Bothrasida) mucorea (Wilke 19222270), new synonym

209

Type Material. LECTOTYPE, designated here, (sex undetermined) labeled: a) Orange
bordered white circle reading “Type”; b) “Guanajuato”; c) “ Mexico. / Salle Coll.”; d)
“Ologlyptus, / guanajuatensis, / apud Salle Duges.”; e) “a guanajuatensis, / Champ.”; f)
“B.C.ACol.IV .1. / Asida / guanajuatensis”. (BMNH). PARALECTOTYPES (4
specimens) [all bearing the label “PARALECTOTYPE /Asida / guanajuatensis/
Champion, 1884 / det. Aaron D. Smi ” on yellow paper]: 3 paralectotypes (BMNH) with
same locality data as holotype. l paratype (CASC) labeled a) “MEX”.

Additional Specimens Examined. (15 specimens). MEXICO: Aguascalientes,

Guanajuato, and Hidalgo.

Redescription (see fig. 2.25). Length: 9.5-14.1mm, width: 4.8-7.2mm (lectotype length:
11.6mm, width: 5.8mm). Integument black to ferruginous, rarely encrusted with debris;
elytra wider than pronotum and 2.7-3.2X longer, width of pronotum at base less than
width of elytral base. Head: Densely foveate with decurnbent lanceolate setae emerging
fi'om inside fovea; fi'ontoclypeal suture not or faintly impressed, epistomal suture not
indented at margin; medial depression on frons deeply impressed. Mentum anterior
margin straight with a median emargination at ligula insertion; basal half of mentum with
two paramedial longitudinal impressions. Submentum medially depressed, apex strongly
emarginate. Postgenal processes slightly swollen, acute, and extending past middle of
mentum, not reaching anterior margin of mentum. Antenna densely clothed in brown
erect acuminate setae; antennal segment 10 subquadrate, tomentose sensilla separated,
oval, not wrapping around apex. Prothorax: Pronotal margin sinuate, widest before

middle; anterior apicies produced and acute; posterior apicies produced and acute,

210

slightly projecting over elytral humera; posterior margin nearly straight, weakly
emarginate before apicies, lacking a medial tooth. Pronotal disc nearly confluently
foveate, each fovea with an acuminate, lanceolate, or squamate seta arising from anterior
side; four paramedial fossa present, anterior pair occasionally faintly indicated; medial
ridge absent. Prostemal process longitudinally impressed, weakly raised and projecting
behind procoxae. Prostemum densely foveate with long acuminate setae, anterior margins I
of some fovea raised and forming rounded tubercules. Pterothorax: Elytra elongate oval, ‘

widest behind middle; crests of all costae glaberous and shiny. Marginal costa reticulate,

 

meeting discal costa near cauda, with low transverse costae branching ventrally along
pseudoepiplura and dorsally onto elytra, not reflexed; elytral humera distinct, straight or
wealdy reflexed. Discal costa raised at elytral base reticulate, confused with a connected
network of transverse and oblique costae over most of length, united with marginal costa
caudally. Sutural costa raised. Intercostal spaces smooth, nearly impunctate, and
moderately clothed in squamate scales, mixed with erect lanceolate scales near margins
of costae. Legs: F emora and tibia confluently foveate, rugose in appearance, and clothed
in short acuminate setae, mixed with stouter spiniform setae emerging from small
tubercles on tibia; tarsi venter with dark brown stout spiniform setae on laterally margins,
medially glabrous; apical protibial spine large, acute, and glaberous; combined protarsal
segments approximately three-fifths length of protibia; anterior protibial spur length
shorter than basitarsi. Abdomen: Moderately foveate, fovea with short acuminate setae;
intercoxal process broadly rounded at apex.

Diagnosis. P. guanajuatensis can be separated from the other members of the

Variodorsus subgenus based on the following character combination: Pronotum without a

211

raised medial ridge; elytral with a confused network of costae, crests of costae glabrous,
intercostal regions smooth and clothed in short squamate setae.

Distribution. MEXICO: Aguascalientes, Guanajuato, and Hidalgo.

Biology. Unknown. Collected from underneath rocks and feeding on dry manure.
Discussion. Wilke (1922) described Bothrasz’da mucorea from a single specimen of P.
guanajuatensis labeled “Chi.” (presumably for Chihuahua). It is unknown whether Wilke
had ever seen a specimen of P. guanajuatensis, but his description indicates that he

placed his new species in Bothrasida based on the elytral sculpturing.

Pelecyphorus (Variodorsus)fasciculatus (Champion), New Combination

Asidafasciculatus Champion, 18922495
Astrotusfasciculatus (Champion). Wilke, 19222267

Pelecyphorus (Astroms)fasciculatus (Champion). Smith, 2010

Type Material. LECTOTYPE, designated here, (male) labeled: a) Orange bordered
white circle reading “Type”; b) “F lohr / Cuemavaca, / Morelos..”; c) handwritten det.
“Asida / fasciculatal Ch”; (1) “Sp. figured”; e) “B.C.ACol.IV.1. / Asida/ fasciculata”.
(BMNH)-

Additional Specimens Examined. (24 specimens). MEXICO: Guerrero, Hidalgo,

Mexico, Morelos, Puebla.

212

Redacription (see fig. 2.26). Length: 10.6-15.1mm, width: 5.8-8.4mm (lectotype length:
11.7mm, width: 6.6mm). Integument black to ferruginous, often lightly encrusted with
I debris; elytra wider than pronotum and approximately 2.5X longer, width of pronotum at
base less than width of elytral base. Head: Densely foveate with decurnbent lanceolate
setae emerging from inside fovea; frontoclypeal suture deeply impressed, epistomal
suture indented at margin; medial depression on fions deeply impressed. Mentum anterior
margin straight with a median emargination at ligula insertion; basal half of mentum with
two paramedial longitudinal impressions. Submentum medially depressed, apex
emarginate. Postgenal processes slightly swollen, acute, and extending past middle of
mentum, not reaching anterior margin of mentum. Antenna densely clothed in brown
erect acuminate setae; antennal segment 10 subquadrate, tomentose sensilla separated,
curved, wrapping around apex. Prothorax: Pronotal margin sinuate, widest before
middle, constricted in basal third before apicies; anterior apicies produced and rounded;
posterior apicies produced and acute, slightly projecting over elytral humera; posterior
margin nearly straight, emarginate before apicies, with a medial tooth. Pronotal disc
nearly confluently foveate, each fovea with a semi-erect, lanceolate, seta arising from
anterior side; four paramedial fossa present, posterior pair occasionally faintly indicated;
longitudinal medial ridge strongly raised throughout. Prostemal process longitudinally
impressed, weakly raised and projecting behind procoxae. Prostemum densely foveate
with long acuminate setae, anterior margins of fovea not raised or forming rounded
tubercules. Pterothorax: Elytra elongate oval, widest behind middle; crests of costae
lightly setose, mostly obscured by longer setae emerging from sides of costae. Marginal

costa not reflexed, not meeting discal costa near cauda, with short transverse costa

213

 

branching dorsally onto elytra; elytral humera distinct, slightly obtuse or weakly reflexed.
Discal costa raised at elytral base and bifurcate, inner branch visible in basal third then
eroded and faintly indicated, weakly reticulate. Sutural costa weakly raised at base or not.
Intercostal spaces smooth, moderately foveate, and setose. Costae and intercostal regions
clothed in pale and dark brown squamate and lanceolate erect scales, dark squamate
scales forming irregular points and lines across surface. Legs: Femora and tibia
confluently foveate, rugose in appearance, and clothed in short acuminate setae, mixed
with stouter spiniform setae emerging from small tubercles on tibia; tarsi venter with
short acuminate setae and dark brown stout spiniform setae on laterally margins; apical
protibial spine large, acute, and glaberous; combined protarsal segments approximately
three-fifths length of protibia; anterior protibial spur length shorter than basitarsi.
Abdomen: Moderately foveate, fovea with short acuminate setae; intercoxal process
broadly rounded or truncate at apex.

Diagnosis. P. fasciculatus can be separated from the other members of the Variodorsus
subgenus based on the following character combination: Pronotumwith a raised medial
ridge; elytra with discal costae present and bifurcate, inner branch eroded after basal
third, densely clothed in multicolored erect squamate and lanceolate scales, forming
irregular darker points and lines across surface.

Distribution. MEXICO: Guerrero, Hidalgo, Mexico, Morelos, Puebla.

Biology. Unknown. Collected in pitfall traps.

214

 

subgenus Plesiasida Smith, 2010, Name» Novum (=Parasida Casey, 1912)
Type species: Euschides liratus LeConte 18542223
=Parasida Casey, 19122126. (Junior homynym).Type species: Type species: Parasida

Iaciniata Casey, 1912, (= Pelecyphorus liratus (LeConte)), by original designation.

Redescription. Length: 9.2-22.0mm, width: 4.1-11.5mm. Integument ferruginous to
black; setose, with modified lanceolate or squamate scales dorsally, lacking stellate setae.
Head: Mentum subtrapezoidal to transversely cordate; separated from postgenal
processes, not reaching mandibles when closed; lateral straight of slightly curved inward
near apicies; anterior margin medially emarginate. Ligula sclerotized, small,
approximately one-fourth mentum width; slightly to strongly curved and partially visible
above anterior margin of mentum. Apical segment of maxillary palps enlarged,
isotriangular to strongly scalene, more expanded in males. Submentum medially
depressed; apex broadly emarginate; projecting into buccal cavity; width two-thirds to
four-fifths that of buccal cavity, partially exposing maxillary cardos laterally. Postgenal
processes produced, acute, and slightly swollen, extending at least to middle of mentum.
Labral margin broadly emarginate or truncate; clypeal membrane concealed or rarely
exposed. Clypeal margin variable. Eyes elongate, oval or weakly reniform. Antenna
wealdy clavate, segments 3-8 moniliform, longer than wide; apical tomentose sensilla on
antennal segment 10 meeting on one side or separated into two curved patches around
apex; antennal segment 11 one-half or more size of segment 10, apical tomentose
sensillum covering one-half to two-thirds of segment. Prothorax: Pronotal margin

costate, arctuate or sinuate, reflexed or not; pronotal disc variable. Prostemal process

215

 

wide, raised and projecting or deflexed behind procoxal cavities, longitutunally
impressed or not. Pterothorax: Elytral sculpturing variable, marginal costa present or
rarely absent. Mesonotum with two shallow or deep transverse tomentose depressions,
leaving a thin medial ridge between the scutellum and scutum. Legs: Mesocoxal cavities
open; mesotrocantin prominate and exposed. Abdomen: Setation and punctation
variable, never with a tomentose band of setae along margind of ventrites. Intercoxal
process broad, apex rounded or truncate.

Diagnosis. The subgenus Plesiasida is distinguished from other Pelecyphorus subgenera
by a unique combination of the following characters: mentum not reaching postgenal
processes or mandibles, anterior margin medially emarginate; antennal segment 11 one-
half or more size of segment 10, tomentose sensilla meeting on one side or not, never
forming a continous band around apex; dorsal setae lanceolate or squamate, stellate setae
absent; mesotrocantin prominent and exposed.

Distribution. MEXICO: Aguascalientes, Baja California Sur, Chihuahua, Coahuila,
Durango, Guanajuato, Hidalgo, Jalisco, Mexico, Mexico D. F., Puebla, Queretaro,

Zacatecas. USA: Arizona.

216

Species Descriptions
Pelecyphorus (Plesiasida) liratus (LeConte)

Euschides Iiratus LeConte, 18542 223

Asida lirata (LeConte). Horn, 18702283

Parasida lirata (LeConte). Casey, 19122130

Pelecyphorus (Plesisida) liratus (LeConte). Smith, 2010

=Pelegphorus (Plesiasida) Iaciniatus (Casey, 1912:128), New Synonym

=Pelecmhorus (Plesiasida) cristatus (Pallister, 1954224), New Synonym

Type Material. HOLOTYPE, by monotypy, (female) labeled: a) silver LeConte locality
disc = Arizona; Valley of Gila; b) “A. lirata / LeC”; c) red MCZ type label reading “Type
4525”. (MCZ).

Additional Specimens Examined. (92 specimens). MEXICO: Chihuahua; USA:

Arizona (Cochise, Pima, and Santa Cruz Counties), New Mexico (Grant Co.).

Redescription (see fig. 2.27). Length: 10.2-15.9mm, width: 5.0-7.9mm. Integument
black to ferruginous, often lightly encrusted with debris; setae pale. yellowish-white
lanceolate scales unless otherwise noted; elytra wider than pronotum and approximately
3.5X longer, width of pronotum at base less than width of elytral base. Head: Densely
foveate with decurnbent lanceolate setae emerging fi'om inside fovea; frontoclypeal

suture impressed, epistomal suture indented at margin; medial depression on frons

217

 

impressed; labral margin broadly emarginate; clypeal membrane concealed or exposed.
Mentum anterior margin straight with a median notch at ligula insertion; basal half of
mentum with two paramedial longitudinal impressions. Apical segment of maxillary
palps expanded, weakly scalene in female, strongly scalene in male. Postgenal processes
slightly swollen, acute, and extending past middle of mentum, not reaching anterior
margin of mentum. Antenna densely clothed in brown erect acuminate setae; antennal
segment 10 subquadrate, tomentose sensilla separated and curved around apex.
Prothorax: Pronotum broadly arctuate, narrow at anterior apicies, gradually widening to
near middle, slightly sinate before posterior apicies; marginal costa reflexed; anterior
apicies produced and broadly rounded; posterior apicies produced and acute, projecting
over elytral humera; posterior margin nearly straight, emarginate before apicies, fiinged
with golden tomentose setae and with a medial tooth. Pronotal disc nearly confluently
foveate, each fovea with decurnbent lanceolate scale; four paramedial fossa present,
occasionally faintly indicated; longitudinal medial ridge thin, smooth, and weakly raised
throughout. Prostemal process longitudinally impressed, deflexed behind procoxae.
Prostemum densely shallowly foveate with acuminate setae, anterior margins of some
fovea near lateral margins raised and forming rounded tubercules. Pterothorax:
Scutellum almost entirely concealed beneath elytra, deep transverse tomentose
depressions present on mesonotum, separated by a narrow triangular ridge between
scutum and scutellum. Elytra elongate oval, widest behind middle; elytron base depressed
before costa and tomentose; costae carinate, crests glabrous. Marginal costa divided in
basal third, branches united near base or not, inner branch continuing to apical third, not

uniting with marginal or discal costa; elytral humera prominent and reflexed. Discal costa

218

 

raised and divided near elytral base; branches not united near base, parallel, and united in
apical third or not. Sutural costa raised fi'om base to cauda. Intercostal spaces smooth,
with irregular lines of fovea and decurnbent lanceolate setae, emerging from minute
tubercles or not. Legs: Femora and tibia confluently foveate, rugose in appearance, and
clothed in short acuminate setae, mixed with stouter spiniform setae emerging from small
tubercles on tibia; tarsi venter with short acuminate setae and dark brown stout spiniform a
setae on laterally margins; apical protibial spine small and glabrous; combined protarsal

segments approximately two-thirds length of protibia; anterior protibial spur length

 

shorter than basitarsi. Abdomen: Moderately punctate, punctures minute with short
acuminate setae.

Diagnosis. P. liratus can be separated fi'om the other members of the Plesiasida
subgenus based on the following character combination: Pronotumwith a thin medial
ridge; elytra with three distinct longitudinal carinae on each elytron, lacking transverse
carinae; elytral base depressed and tomentose; abdominal puntures minute and setose.
Distribution. MEXICO: Chihuahua; USA: Arizona (Cochise, Pima, and Santa Cruz
Counties), New Mexico (Grant Co.).

Discussion. Casey (1912) differentiated his new species Parasida laciniata from P. lirata
based on its description and an image in Horn (1870), both of which lacked two
distinctive characters (elytral base tomentose, intercostal spaces with a row of fovea)
noted by Casey. However, examination of the P. lirata type specimen showed that these
features are present. Likewise, Pallister’s P. cristatus was also separated fi'om P. lirata by
the lack of these features. The type specimens of both P. cristatus and laciniata are

unremarkable specimens of P. lirata.

219

Biology. Unknown. Collected along sandy trails at dusk feeding on fallen grass seeds.
Pelecyphorus (Plesiasida) dispar (Champion)

Asida dissimilis Champion, 1884259, Junior Homynym
Asida dispar Champion, 18922496, Nomen Novum i
Parasida dissimilis (Champion). Casey, 19122131

Pelecyphorus (Plesisida) liratus (LeConte). Smith, 2010

 

= Pelecyphorus (Plesisida) trisinuata (Pallister, 1954:22), New Synonym
= Pelecyphorus (Stenosides) kulzeri (Pallister, 1954212), New Synonym

= Pelecyphorus (Stenosides) bisinuatus (Pallister, 1954213), New Synonym

Type Material. LECTOTYPE, designated here, (male) labeled: a) Orange bordered
white circle reading “Type” ; b) “1747” ; c) “Mexico / Salle Coll” ; d) handwritten det.
“Asida / dissimilis, / Champ” ; e) “Sp. figured.” ; f) “B.C.ACol.IV.1. / Asida / dispar/
dissimilis.”.

Additional Specimens Examined. (41 specimens). MEXICO: Aguascalientes,

Chihuahua, Durango, Zacatecas.

Redescription (see fig. 2.28). Length: 9.2-14.2mm, width: 4.1-7.1mm (lectotype length:
10.0mm, width: 4.4mm). Integument black to ferruginous, often lightly encrusted with
debris; setae pale yellowish-white lanceolate scales unless otherwise noted; elytra wider

than pronotum and 2.8-3.0X longer, width of pronotum at base less than width of elytral

220

base. Head: Densely foveate with decurnbent lanceolate setae emerging from inside
fovea; fi'ontoclypeal suture impressed, epistomal suture indented at margin; medial
depression on fions impressed; labral margin broadly emarginate; clypeal membrane
concealed or exposed. Mentum anterior margin straight, medial notch absent or minute;
basal half of mentum with two faint paramedial longitudinal impressions. Apical segment
of maxillary palps expanded, weakly scalene in female, strongly scalene in male. ‘ g
Postgenal processes slightly swollen, acute, and extending past middle of mentum, not ‘

reaching anterior margin of mentum. Antenna densely clothed in brown erect acuminate

 

setae; antennal segment 10 subquadrate, tomentose sensilla separated and curved around
apex or barely meeting on one side. Prothorax: Pronotum broadly arctuate or slightly
sinate before posterior apicies, widest near middle; marginal costa weakly reflexed;
anterior apicies produced and broadly rounded; posterior apicies produced and acute,
projecting over elytral humera; posterior margin nearly straight, emarginate and fiinged
with golden tomentose setae before apicies, medial tooth absent. Pronotal disc nearly
confluently foveate, each fovea with decurnbent lanceolate scale; four paramedial fossa
present, occasionally faintly indicated; longitudinal medial ridge thin, smooth, and
weakly raised throughout. Prostemal process longitudinally impressed, deflexed behind
procoxae. Prostemum densely shallowly foveate with acuminate setae, anterior margins
of some fovea raised and forming rounded tubercules. Pterothorax: Scutellum almost
entirely concealed beneath elytra, deep transverse tomentose depressions present on
mesonotum, separated by a narrow triangular ridge between scutum and scutellum. Elytra
elongate oval, widest behind middle; elytron base depressed before costa and tomentose;

costae carinate, crests often setose. Marginal costa tuberculate and meeting discal costa in

221

apical fourth, divided in basal third, branches united near base or not, inner branch
continuing to apical third, not uniting with marginal or discal costa; elytral humera
prominent and reflexed. Discal costa raised and divided in basal third; branches
frequently united near base and in apical third, inner branch often eroded. Sutural costa
weakly raised or not. Intercostal spaces smooth, with scattered fovea and decurnbent
lanceolate setae, emerging from minute tubercles or not. Legs: Femora and tibia i
confluently foveate, rugose in appearance, and clothed in short acuminate setae, mixed -

with stouter spiniform setae emerging from small tubercles on tibia; tarsi venter with I}, 4

 

short acuminate setae and dark brown stout spiniform setae on laterally margins; apical
protibial spine small and glaberous; combined protarsal segments approximately two-
thirds length of protibia; anterior protibial spur length shorter than basitarsi. Abdomen:
Moderately coarsely punctate with short acuminate setae.

Diagnosis. P. dispar can be separated from the other members of the Plesiasida subgenus
based on the following character combination: pronotum with a thin medial ridge; elytra
with marginal costa divided and tuberculate, discal costa bifurcate, united near base and
apex, lacking transverse carinae; elytral base depressed and tomentose; abdomen coarsely
punctate with short acuminate setae.

Distribution. MEXICO: Aguascalientes, Chihuahua, Durango, Zacatecas.

Discussion. The three species described by Pallister (1954) and synonymized under P.
dispar were all based on specimens collected during the Rockefeller Mexican expedition
of 1947. Representative specimens were sent to Hans Kulzer, a German tenebrionid
worker, who made suggestions on the generic placement and status of the material. All

three fall well within the range of variation seen within P. dispar populations.

222

in male. Postgenal processes slightly swollen, acute, and extending to middle of mentum.
Antenna densely clothed in brown erect acuminate setae; antennal segment 10
subquadrate, tomentose sensilla separated and curved around apex or barely meeting on
one side. Prothorax: Pronotum broadly arctuate, narrow at anterior apicies and gradually
widening to middle, nearly parallel sided from middle to base; marginal costa weakly
reflexed; anterior apicies produced and broadly rounded; posterior apicies produced and
acute, projecting over elytral humera; posterior margin nearly straight, fiinged with
golden tomentose setae and emarginate before apicies, medial tooth present. Pronotal disc
nearly confluently foveate, each fovea with minute decurnbent scale; four paramedial
fossa present, posterior pair faintly indicated; longitudinal medial ridge thin, smooth, and
weakly raised throughout. Prostemal process longitudinally impressed, deflexed behind
procoxae. Prostemum densely shallowly punctate with acuminate setae, anterior margins
of fovea raised and forming rounded tubercules. Pterothorax: Scutellum almost entirely
concealed beneath elytra, deep transverse tomentose depressions present on mesonotum,
separated by a narrow triangular ridge between scutum and scutellum. Elytra elongate
oval, widest behind middle; elytron base depressed before costa and tomentose. Marginal
costa rounded and glabrous, raised to cauda and not meeting discal costa; divided in basal
third, branches not united basally, inner branch continuing to apical third, not uniting
with marginal or discal costa; elytral humera prominent and reflexed. Discal costa raised
and divided in basal third; branches rarely united near base or in apical third, crests
rounded and shiny. Sutural costa raised, crest rounded and shiny. Intercostal spaces
smooth and opaque, with sparse minute punctures and decurnbent lanceolate setae,

appearing nearly glabrous. Legs: Femora and tibia confluently shallowly foveate, rugose

224

in appearance, and clothed in short pale acuminate setae, mixed with stouter black
spiniform setae emerging from small tubercles on tibia; tarsi venter with stout black
spiniform setae on laterally margins; apical protibial spine small and glaberous;
combined protarsal segments approximately two-thirds length of protibia; anterior
protibial spur length shorter than basitarsi. Abdomen: Densely minutely punctate with
short acuminate setae, faintly rugose.

Diagnosis. P. bibasalis can be separated from the other members of the Plesiasida

subgenus based on the following character combination: pronotum with a thin medial

ridge; elytra with crests of all costae rounded and shiny, marginal costa divided, branches
completely separate, discal costa divided, branches rarely united near base or apex,
lacking transverse carinae; elytral intercostal spaces nearly glabrous and opaque; elytral
base depressed and tomentose; abdomen minutely punctate with short acuminate setae.
Distribution. Known only fiom the Promotorio region in the Mexican state of Durango.

Biology. Unknown.

Pelecyphorus (Plesiasida) smostatus LeConte

Pelecyphorus sexcostatus LeConte, 18612337

Asida sexcostata (LeConte). Horn, 1870:283

Parasida sexcostata (LeConte). Casey, 19122130

Pelecyphorus (PIesiasida) sexcostatus LeConte. Smith, 2010

225

Type Material. HOLOTYPE, by monotypy, (sex undetermined) labeled: a) “Type
4536”; b) “P. 6-costatus / S. Lucas LeC”; c) on red paper “HOLOTYPE / Pelecjphorus/
sexcostatus / LeConte, 1861 / det. Aaron D. Smith”.

Additional Specimens Examined. (31 specimens). MEXICO: Baja California Sur.

Redescription (see fig. 2.30). Length: 10.9-14.0mm, width: 5 .6-7 .Omm. Integument
black to ferruginous; setae pale yellowish-white lanceolate scales unless otherwise noted;

elytra wider than pronotum and 2.9-3.4X longer, width of pronotum at base less than I

 

width of elytral base. Head: Densely foveate with decurnbent lanceolate setae emerging
fi'om inside fovea; frontoclypeal suture impressed, epistomal suture indented at margin;
medial depression on frons weakly impressed; labral margin broadly emarginate; clypeal
membrane concealed or exposed. Mentum anterior margin straight, weakly emarginate
medially; basal half of mentum with two faint paramedial longitudinal impressions.
Apical segment of maxillary palps expanded, isotriangular in female, scalene in male.
Postgenal processes slightly swollen, acute, and extending to middle of mentum. Antenna
densely clothed in brown erect acuminate setae; antennal segment 10 subquadrate,
tomentose sensilla separated and curved around apex. Prothorax: Pronotum arctuate or
slightly sinuate before posterior apicies, widest near middle; marginal costa weakly
reflexed or nearly straight; anterior apicies produced and acute; posterior apicies slightly
produced and acute, barely projecting over elytral humera; posterior margin nearly
straight, not fiinged with golden tomentose setae and weakly emarginate before apicies,
medial tooth absent. Pronotal disc densely foveate, each fovea with a long decurnbent

lanceolate scale; paramedial fossa absent; longitudinal medial ridge absent, faintly

226

indicated by thin smooth line. Prostemal process longitudinally impressed, deflexed
behind procoxae. Prostemum moderately punctate with acuminate setae, anterior margins
of fovea raised and forming rounded tubercules. Pterothorax: Scutellum exposed,
shallow transverse tomentose depressions present on mesonotum, separated by a smooth
narrow ridge between scutum and scutellum. Elytra elongate oval, widest behind middle;
elytron base not depressed or tomentose. Marginal costa tuberculate with short erect l
setae, raised to cauda and not meeting discal costa; divided in basal third, branches not

united basally, inner branch continuing to apical third, not uniting with marginal or discal

 

costa; elytral humera slightly obtuse, weakly reflexed or not. Discal costa raised,
tuberculate with erect acuminate setae along crest, inner branch absent or faintly
indicated. Sutural costa not raised. Intercostal spaces moderately foveate and clothed in
decurnbent lanceolate scales. Legs: F emora and tibia confluently shallowly foveate,
rugose in appearance, and clothed in pale lanceolate scales, mixed with stouter darker
spiniform setae emerging from small tubercles on tibia; tarsi venter with long acuminate
setae and stout spiniform setae on laterally margins; apical protibial spine small and
glaberous; combined protarsal segments approximately two-thirds length of protibia;
anterior protibial spur length shorter than basitarsi. Abdomen: Moderately foveate with
long acuminate setae.

Diagnosis. P. sexcostatus can be separated fi'om the other members of the Plesiasida
subgenus based on the following character combination: pronotum without a medial
ridge; elytra with crests of costae tuberculate, marginal costa divided, branches

completely separate, discal costa not apparently divided, lacking transverse carinae;

227

elytral intercostal spaces foveate with decurnbent lanceolate scales; elytral base neither
depressed nor tomentose.

Distribution. Known only fi'om the Mexican state of Baja California Sur, from sea level
to approximately 1000 feet in elevation.

Biology. Unknown. Collected in pitfall traps and from underneath rocks.
Pelecyphorus (Plesiasida) crfuentesi Smith, New Species

Type Material. HOLOTYPE (male) labeled: a) “MEXICO: Baja Cal. Sur/ Sier. de la
Laguna trail / el 1495m, N23°32.78’ / W110°00.99’,BCS#41 / 28.VH.2009, ADSmith”;
b) on red paper, “HOLOTYPE / Pelecyphorus / (Plesiasida) / cifirentesi 6V Aaron D.
Smith” (CNIN). PARATYPES (5 specimens) [all bearing the label “PARATYPE/
Pelecjphorus / (Plesiasida) / cifirentesi / Aaron D. Smi ” on yellow paper] with the
following locality data: 1 paratype (MSUC) labeled same as holotype. 3 paratypes
(ADSC) labeled a) “MEXICO: Baja Cal. Sur/ Sier. de la Laguna trail / el 1573m,
N23°32.78’ / W110°00.83’,BCS#43 / 28.VH.2009, ADSmith”. 1 paratype (CASC)

labeled a) “Sierra Laguna/ Lower Cal. / VIII-15-1919”; b) “C011. by / J .R. Slevin”.

Description (see fig. 2.31). Length: 11.2-12.6mm, width: 4.8-6.0mm (lectotype length:
11.2mm, width: 5.3mm). Integument black and glossy; setae pale yellowish-white
lanceolate scales unless otherwise noted; elytra wider than pronotum and 3.3-3.7X
longer. Head: Densely foveate with long decurnbent lanceolate setae emerging from

inside fovea; fi'ontoclypeal suture weakly impressed, epistomal suture indented at margin;

228

 

Biology. Unknown.
Pelecyphorus (Plesiasida) bibasalis (Casey)

Parasida bibasalis' Casey, 19122 128

Pelecyphorus (Plesiasida) bibasalis (Casey). Smith, 2010

Type Material. LECTOTYPE, designated here, (male) labeled: a) “Promontorio
Durango.”; b) on red paper “LECTOTYPE / Parasida / bibasalis / Casey, 1912 / det.
Aaron D. Smi ”. PARALECTOTYPES, three specimens (NMNH): with same locality
information as lectotype and bearing the label “PARALECTOTYPE / Parasida/
bibasalis / Casey, 1912 / det. Aaron D. Smith”.

Additional Specimens Examined. (24 specimens). MEXICO: Durango, Promontorio.

Redescription (see fig. 2.29). Length: 14.4-19.4mm, width: 7.0-9.7mm. Integument
black to ferruginous; setae pale yellowish-white lanceolate scales unless otherwise noted;
elytra wider than pronotum and approximately 3 .5X longer, width of pronotum at base
less than width of elytral base. Head: Densely foveate with decurnbent lanceolate setae
emerging from inside fovea; frontoclypeal suture impressed, epistomal suture indented at
margin; medial depression on fions impressed; labral margin broadly emarginate; clypeal
membrane concealed or exposed. Mentum anterior margin straight, weakly emarginate
medially; basal half of mentum with two faint paramedial longitudinal impressions.

Apical segment of maxillary palps expanded, weakly scalene in female, strongly scalene

223

 

medial depression on fions weakly impressed; labral margin broadly emarginate; clypeal
membrane concealed. Mentum anterior margin straight, wealdy emarginate medially;
basal half of mentum with two faint paramedial longitudinal impressions. Apical segment
of maxillary palps expanded, isotriangular in female, scalene in male. Postgenal
processes slightly swollen, acute, and extending to middle of mentum. Antenna densely
clothed in dark brown erect acuminate setae; antennal segment 10 subquadrate,
tomentose sensilla separated and curved around apex. Prothorax: Pronotum weakly
arctuate, widest at middle, to nearly parallel sided; marginal costa strongly reflexed;
anterior apicies produced and acute; posterior apicies acute, not or slightly produced, not
projecting over elytral humera; posterior margin nearly straight, not fringed with golden
tomentose setae and weakly emarginate before apicies, medial tooth absent. Pronotal disc
densely foveate, each fovea with a long decurnbent lanceolate scale; paramedial fossa
absent; longitudinal medial ridge absent. Prostemal process longitudinally impressed,
deflexed behind procoxae. Prostemum densely foveate with acuminate setae, anterior
margins of fovea weakly raised or not. Pterothorax: Scutellum exposed, shallow
transverse tomentose depressions present on mesonotum, separated by a smooth narrow
ridge between scutum and scutellum. Elytra elongate oval, widest near middle; elytron
base not depressed or tomentose. Marginal, sutural, and elytral costae absent or faintly
indicated; elytral humera obtuse, weakly reflexed or not. Elytral disc moderately punctate
and clothed in decurnbent lanceolate scales, elytral margins with short erect acuminate
setae raised on minute tubercles. Legs: Femora and tibia confluently shallowly foveate,
rugose in appearance, and clothed in dark brown acuminate setae, mixed with stouter

darker spiniform setae emerging from small tubercles on tibia; tarsi venter with dark

229

 

 

brown acuminate setae and stout spiniform setae on laterally margins; apical protibial
spine small and glaberous; combined protarsal segments approximately two-thirds length
of protibia; anterior protibial spur length shorter than basitarsi. Abdomen: Moderately
punctate with long acuminate setae.

Diagnosis. P. cifitentesi can be separated from the other members of the Plesiasida
subgenus based on the following character combination: pronotum without a medial
ridge; pronotal margin strongly reflexed; prostemal process deflexed behind procoxa;
elytra costa absent or faintly indicated; elytral base neither depressed nor tomentose.
Distribution. Known only from Sierra de la Laguna in Mexican state of Baja California
Sur, above 4500 feet in elevation.

Biology. Unknown. Collected walking at night along trails.
Pelecyphorus (Plesiasida) longipennis (Champion)

Asida longipennis Champion, 1884:56

Parasida longipennis (Champion). Wilke, 19222270
Pelecyphorus (Plesiasida) longipennis (Champion). Smith, 2010
=P. (Plesiasida) mixtecae (W ilke, 19222271), New Synonym

=P. (Plesiasida) esperanzae (Wilke, 19222271), New Synonym

Type Material. LECTOTYPE, designated here, (male) labeled: a) Orange bordered
white circle reading “Type”; b) “1759”; c) “San Antonio / de Ariba / Mexico / Salle

Coll”; d) handwritten det. “Pelecyphorus / longipennis, Ch. / apund Salle”; e) handwritten

230

 

det. “Asida / longipennis, Champ”; f) “Sp. figured”; g) “B.C.ACol.IV .1. / Asida/
longipennis.”. (BMNH). PARATYPE, 1 specimen (BMNH) labeled “San Andres”

Additional Specimens Examined. (16 specimens). MEXICO: Puebla.

Redescription (see fig. 2.32). Length: 10.9-14.7mm, width: 5.2-6.1mm (lectotype length:
12.6mm, width: 5.6mm). Integument black to ferruginous; setae yellowish-white to
golden unless otherwise noted; elytra wider than pronotum and 2.7-3.2X longer, width of
pronotum at base nearly equal to width of elytral base. Head: Densely foveate with
decurnbent lanceolate setae emerging from inside fovea; frontoclypeal suture impressed,
epistomal suture not indented at margin; medial depression on frons weakly impressed;
labral margin truncate; clypeal membrane concealed. Mentum anterior margin straight,
medially emarginate; basal half of mentum with two faint paramedial longitudinal
impressions. Apical segment of maxillary palps expanded, isotriangular in both sexes.
Postgenal processes slightly swollen, acute, and extending to middle of mentum. Antenna
densely clothed in erect golden acuminate setae; antennal segment 10 widest at apicies,
tomentose sensilla separated and curved around apex or meeting on one side. Prothorax:
Pronotum arctuate or slightly sinuate before posterior apicies, widest near middle;
marginal costa not reflexed; anterior apicies weakly produced and rounded; posterior
apicies acute, not produced; posterior margin nearly straight, not fiinged with golden
tomentose setae, medial tooth absent. Pronotal disc nearly confluently foveate, each fovea
with a thin golden setae; four paramedial fossa present or faintly indicated; longitudinal
medial ridge absent. Prostemal process longitudinally impressed, deflexed behind

procoxae. Prostemum densely foveate with golden acuminate setae, anterior margins of

231

.hr- ._
" ctr .
V
_ _r

 

 

fovea rarely raised and forming rounded tubercules. Pterothorax: Scutellum exposed,
shallow transverse tomentose depressions present on mesonotum, separated by a smooth
narrow ridge between scutum and scutellum. Elytra elongate oval, widest behind middle;
elytron base not depressed or tomentose. Marginal costa punctate and meeting discal
costa near cauda, divided in basal third, inner branch curved towards suture and meeting
discal costa in apical third; elytral humera slightly oblique and not reflexed. Discal costa
weakly or strongly raised and divided at base, outer branch meeting inner branch of
marginal costa in apical third or not. Sutural costa weakly raised or not. Costal crests
punctate with scattered setae; intercostal spaces densely foveate and punctate with
decumbent lanceolate or acuminate setae.Legs: Femora deeply foveate, tibia confluently
shallowly foveate, rugose in appearance, and clothed in pale lanceolate setae; tarsi venter
with long pale setae; apical protibial spine large acute and glaberous; combined protarsal
segments approximately two-thirds length of protibia; anterior protibial spur length
shorter than basitarsi. Abdomen: Densely foveate with long golden setae.

Diagnosis. P. Iongipennis can be separated from the other members of the Plesiasida
subgenus based on the following character combination: pronotum without a medial
ridge, posterior apicies acute and not produced; elytra with crests of costae punctate;
elytral intercostal spaces foveate and punctate with decurnbent lanceolate scales; elytral
base neither depressed nor tomentose; tarsi venter with long golden setae only.
Distribution. MEXICO: Puebla.

Biology. Unknown. Collected from underneath dead cactus.

232

 

 

Pelecyphorus (Plesiasida) indutus (Champion)

Asida induta Champion, 1884256
Parasida induta (Champion). Wilke, 1922:270
Pelecwhorus (Plesiasida) indutus (Champion). Smith, 2010

= P. (Stenosides) bicarinatus (Champion, 1884269), New Synonym

Type Material. HOLOTYPE, by monotypy, (male) labeled: a) Orange bordered white
circle reading “Type”; b) “MEX / ICO”; c) handwritten “Characters of Pel: / 2cyphorus
but / hind angles of/ prothorax not produced”; d) handwritten det. “Asida / induta,
Champ”; e) “Sp. figured”; f) “B.C.ACol.IV .1. / Asida/ induta”. (BMNH).

Additional Specimens Examined. (1 specimen). HOLOTYPE, by monotypy, of
Ologbptus bicarinatus Champion, 1884269, (female) labeled a) Orange bordered white
circle reading “Type”; b) “Oaxaca, / Mexico. / Hoge.”; c) “Ologlyptus / bicarinatus,
Champ”; d) “Sp. figured”; e) “Belongs to / Asida”; f) “B.C.ACol.IV.1. / Ologlyptus/

bicarinatus.”

Redescription (see fig. 2.33). Length: 12.0-14.2mm, width: 5.9-8.7mm (holotype length:
12.0mm, width: 5.9mm). Integument black to ferruginous; setae yellowish-white to
golden unless otherwise noted; elytra wider than pronotum and approximately 3.2X
longer, width of pronotum at base less than width of elytral base. Head: Moderately
punctate with decurnbent acuminate setae emerging from inside punctures; fi'ontoclypeal

suture faintly impressed, epistomal suture indented at margin; medial depression on frons

233

weakly impressed; labral margin emarginate; clypeal membrane concealed. Mentum
anterior margin straight, medially emarginate; basal half of mentum with two faint
paramedial longitudinal impressions. Apical segment of maxillary palps expanded,
isotriangular in female, scalene in male. Postgenal processes slightly swollen, acute, and
extending to middle of mentum. Antenna densely clothed in erect golden acuminate
setae; antennal segment 10 widest at apicies, tomentose sensilla separated and curved
around apex. Prothorax: Pronotum arctuate or slightly sinuate before posterior apicies,

widest near middle; marginal costa slightly reflexed; anterior apicies weakly produced

 

and rounded; posterior apicies acute, not produced; posterior margin nearly straight, not
fiinged with golden tomentose setae, medial tooth absent. Pronotal disc densely punctate,
each puncture with a thin golden setae; four paramedial fossa absent or faintly indicated;
longitudinal medial ridge absent. Prostemal process longitudinally impressed, deflexed
behind procoxae. Prostemum densely foveate with golden acuminate setae, anterior
margins of some fovea raised and forming rounded tubercules. Pterothorax: Scutellum
exposed, shallow transverse tomentose depressions present on mesonotum, separated by a
smooth narrow ridge between scutum and scutellum. Elytra elongate oval, widest behind
middle; elytron base not depressed or tomentose. Marginal costa meeting discal costa
near cauda or not, divided in basal third, inner branch not connected to other costae;
elytral humera oblique and weakly reflexed. Discal costa, raised, and divided at base,
outer branch meeting inner branch of marginal costa in apical third or not, inner branch
weak or barely indicated. Costal crests tuberculate with erect acuminate setae; intercostal
spaces with scattered punctures and acuminate erect and decumbent setae. Legs: Femora

deeply foveate, rugose in appearance; tibia confluently shallowly foveate, clothed in pale

234

acuminate setae and darker stout spiniform setae emerging fi'om tubercles; tarsi venter
with pale acuminate setae and stout spiniform setae on laterally margins; apical protibial
spine large acute and glaberous; combined protarsal segments approximately two-thirds
length of protibia; anterior protibial spur length shorter than basitarsi. Abdomen:
Moderately punctate with short acuminate setae.

Diagnosis. P. indutus can be separated from the other members of the Plesiasida
subgenus based on the following character combination: pronotum without a medial
ridge, posterior apicies acute and not produced; elytra with crests of costae tuberculate
and setose, marginal costa divided, branches completely separate, discal costa divided,
lacking transverse carinae; elytral intercostal spaces punctate with erect acuminate setae;
elytral base neither depressed nor tomentose.

Distribution. MEXICO: Oaxaca.

Biology. Unknown.

Pelecyphorus (Plesiasida) tristis (Champion)

Asida tristis Champion, 1884255

Parasida tristis (Champion). Wilke, 19222270

Pelecyphorus (Plesiasida) tristis (Champion). Smith, 2010

= P. (Plesiasida) purpusi (W ilke, 1922:271), New Synonym

235

 

 

Type Material. LECTOTYPE, designated here, (male) labeled: a) Orange bordered
white circle reading “Type”; b) “1758”; c) “San Antonio / de Ariba/ Mexico / Salle
Coll”; d) handwritten det. “Pelecyphorus / tristis, Chev. / apund Salle”. (BMNH).

Additional Specimens Examined. (56 specimens). MEXICO: Veracruz, Puebla.

Redescription (see fig. 2.34). Length: 12.0-13.7mm, width: 5.3-7.5mm (lectotype length:
12.1mm, width: 5.8mm). Integument black, usually with a glossy sheen, legs ferruginous;

setae dark brown to black unless otherwise noted; elytra wider than pronotum and

 

approximately 2.8X longer, width of pronotum at base less than width of elytral base.
Head: Moderately foveate with decurnbent acuminate setae emerging fi'om inside fovea;
frontoclypeal suture faintly impressed, epistomal suture indented at margin; medial
depression on fions weakly impressed; labral margin emarginate; clypeal membrane
concealed. Mentum anterior margin straight, medially emarginate; basal half of mentum
with two faint paramedial longitudinal impressions. Apical segment of maxillary palps
expanded, isotriangular in female, scalene in male. Postgenal processes slightly swollen,
acute, and extending to middle of mentum. Antenna densely clothed in erect dark brown
acuminate setae; antennal segment 10 subquadrate, tomentose sensilla separated and
curved around apex. Prothorax: Pronotum arctuate, widest near middle; marginal costa
slightly reflexed; anterior apicies weakly produced and rounded; posterior apicies acute,
slightly produced, not projecting over elytral humera; posterior margin nearly straight,
weakly emarginate before apicies, not fringed with golden tomentose setae, medial tooth
absent. Pronotal disc densely foveate, each fovea with a minute setae; four paramedial

fossa absent or faintly indicated; longitudinal medial ridge absent. Prostemal process

236

longitudinally impressed, deflexed behind procoxae. Prostemum rugose, moderately
foveate with dark acuminate setae, anterior margins of some fovea raised and forming
rounded tubercules. Pterothorax: Scutellum exposed, deep transverse tomentose
depressions present on mesonotum, separated by a smooth narrow ridge between scutmn
and scutellum. Elytra elongate oval, widest behind middle; elytron base not depressed or
tomentose. Marginal costa meeting discal costa near cauda or not, divided in basal third,
inner branch not connected to other costae; elytral humera oblique and weakly reflexed.
Discal costa, raised, and divided at base, outer branch meeting inner branch of marginal
costa in apical fourth or not, inner branch reuniting with outer branch in apical third.
Costal crests rounded and glabrous; intercostal spaces with scattered punctures and
inconspicuous decurnbent lanceolate setae. Legs: Femora rugose; tibia tuberculate, stout
black spiniform setae emerging fi'om tubercles; tarsi venter with black stout spiniform
setae on laterally margins, medially glabrous; apical protibial spine large acute and
glabrous; combined protarsal segments approximately two-thirds length of protibia;
anterior protibial spur length shorter than basitarsi. Abdomen: Moderately punctate with
inconspicuous black acuminate setae.

Diagnosis. P. tristis can be separated from the other members of the Plesiasida subgenus
based on the following character combination: pronotumwithout a medial ridge; posterior
apicies acute, slightly produced, not projecting over elytral humera; elytra with crests of
costae rounded and glabrous, marginal costa divided, branches completely separate;
integument black and glossy, legs ferruginous; elytral base neither depressed nor
tomentose.

Distribution. MEXICO: Oaxaca, Puebla.

237

 

Biology. Unknown.

Pelecyphorus (Plesiasida) asidoides Solier

Pelecwhorus asidoides Solier, 18362471

Asida asidoides (Solier). Horn, 1870: 283

Parasida asidoides (Solier). Wilke, 19222270

=Parasida zacualpanicola Wilke, 19212272, New Synonym

Pelecyphorus (Plesiasida) asidoides (Champion). Smith, 2010

Type Material. HOLOTYPE, (male) labeled: a) “Asida / asidoides/ [illegible script] /
[illegible, looks like ??61]”; b) “Col. Marseul / Col. Solier”; c) “asidoides. Sol 471, 2
Chili”; d) on red paper “HOLOTYPE / Pelecyphorus / asidoides Sol._6‘ / Examined by /
Kirby W. Brown / August 1968”. (MNHN).

Additional Specimens Examined. (17 specimen). MEXICO: Hidalgo, Mexico,

Queretaro.

Redescription (see fig. 2.35). Length: 12.5-17.9mm, width: 6.7-9.8mm (holotype length:
14.6mm, width: 8.5mm). Integument black, opaque; setae yellowish-brown unless
otherwise noted; elytra wider than pronotum and approximately 2.9X longer, width of
pronotum at base less than width of elytral base. Head: Densely foveate with short
acuminate setae emerging from inside fovea; frontoclypeal suture not or faintly

impressed, epistomal suture indented at margin; medial depression on frons weakly

238

 

 

 

impressed; labral margin emarginate; clypeal membrane concealed. Mentum anterior
margin straight, medially emarginate; basal half of mentum with two faint paramedial
longitudinal impressions. Apical segment of maxillary palps expanded, scalene in both
sexes, distal angle more elongate in male. Postgenal processes slightly swollen, acute,
and extending to middle of mentum. Antenna densely clothed in erect dark brown
acuminate setae; antennal segment 10 subquadrate, tomentose sensilla separated and
curved around apex. Prothorax: Pronotum sinuate, widest near middle; marginal costa
straight; anterior apicies produced and acute; posterior apicies acute, produced and
projecting over elytral humera; posterior margin nearly straight, emarginate before
apicies, fringed with golden tomentose setae, medial tooth present. Pronotal disc densely
punctate, each puncture with a minute setae; four paramedial fossa absent or faintly
indicated; longitudinal medial ridge absent or thin and not raised. Prostemal process
thickened and projecting behind procoxa, gradually deflexed. Prostemum moderately
foveate with pale acuminate setae, anterior margins of some fovea raised and forming
rounded tubercules. Pterothorax: Scutellum partially exposed, deep transverse
tomentose depressions present on mesonotum, separated by a smooth narrow ridge
between scutum and scutellum. Elytra elongate oval, widest behind middle; elytron base
not depressed or tomentose; costae weakly raised or indicated by glabrous reticulate
lines. Marginal costa meeting discal costa near cauda or not, divided in basal third, inner
branch not connected to other costae; elytral humera prominent and weakly reflexed.
Discal costa divided at base, outer branch meeting inner branch of marginal costa in
apical fourth or not, inner branch reuniting with outer branch in apical third. Costal crests

rounded and glabrous; intercostal spaces rugose, with low transverse or oblique ridges.

239

 

 

 

Legs: Femora rugose; tibia tuberculate, stout spiniform setae emerging from tubercles;
tarsi venter with stout spiniform setae on laterally margins, medially glabrous; apical
protibial spine large acute and glabrous; combined protarsal segments approximately
two-thirds length of protibia; anterior protibial spur length shorter than basitarsi.

Abdomen: Rugose, minutely punctate with inconspicuous acuminate setae.

Diagnosis. P. asidoides can be separated from the other members of the Plesiasida
subgenus based on the following character combination: pronotum with a tomentose
fringe and median tooth on posterior margin, without a medial ridge, posterior apicies
acute, produced, projecting over elytral humera; elytral costa low, reticulate, connected
by low transverse costa; integument black and opaque; elytral base neither depressed nor
tomentose.

Distribution. MEXICO: MEXICO: Hidalgo, Mexico, Queretaro.

Biology. Unknown.
Pelecyphorus (Plesiasida)fallax Champion

Asidafallax Champion, 1884:57

Parasidafallax (Champion). Casey, 19122131

Pelecjrphorus (Plesiasida)fallax (Champion). Smith, 2010

=Pelecwhorus (Plesiasida)favosus (Champion, 1884258), New Synonym

=Pelecyphorus (PIesiasida) similatus (Champion, 1884258), New Synonym

240

 

 

Type Material. LECTOTYPE, designated here, (sex undetermined) labeled: a) Orange
bordered white circle reading “Type”; b) “Guanajuato”; c) “1761”; d) “Mexico / Salle
Coll”; e) handwritten det. “Asida/ fallax, / Champ”; f) “Sp. figured”; g)
“B.C.ACol.IV.1. / Asida / fallax / favosa / similata.”. (BMNH).

Additional Specimens Examined. (89 specimens). MEXICO: Guanajuato, Hidalgo,

Jalisco, Mexico, Mexico D. F., Zacatecas.

Redescription (see fig. 2.36). Length: 12.6-16.9mm, width: 5.9-8.4mm (lectotype length:
14.3mm, width: 6.9mm). Integument black to ferruginous; elytra wider than pronotum
and approximately 3X longer, width of pronotum at base subequal to width of elytral
base. Head: Densely foveate with lanceolate scales emerging from fovea; frontoclypeal
suture deeply or faintly impressed, epistomal suture indented at margin; medial
depression on frons weakly impressed; labral margin emarginate; clypeal membrane
concealed. Mentum anterior margin straight, medially emarginate; basal half of mentum
with two faint paramedial longitudinal impressions. Apical segment of maxillary palps
expanded, scalene in both sexes, distal angle more elongate in male. Postgenal processes
slightly swollen, acute, and extending to middle of mentum. Antenna densely clothed in
erect dark brown acuminate setae; antennal segment 10 subquadrate, tomentose sensilla
separated and curved around apex or meeting on one side. Prothorax: Pronotum sinuate,
widest before middle; marginal costa straight; anterior apicies produced and broadly
rounded; posterior apicies acute, produced and projecting over elytral humera; posterior
margin nearly straight, emarginate before apicies, fiinged with golden tomentose setae,

medial tooth present. Pronotal disc confluently foveate, each fovea with a brown

241

 

 

 

lanceolate scale; four paramedial fossa absent or faintly indicated; longitudinal medial
ridge thin, usually raised throughout. Prostemal process thickened and projecting behind

procoxa, gradually deflexed. Prostemum moderately foveate with short dark acuminate

setae, anterior margins of fovea not raised and forming rounded tubercules. Pterothorax:

Deep transverse tomentose depressions present on mesonotum, separated by a smooth
narrow ridge between scutum and scutellum; scutellum mostly concealed, apparently
carinate. Elytra elongate oval, widest behind middle; elytron base not depressed or
tomentose. Costae thin and sharply raised, crests glabrous; marginal costa meeting discal
costa near cauda, divided in basal third, inner branch reunited with outer and discal costa
near cauda; elytral humera prominent, straight or weakly reflexed; discal costa divided at
base, reunited in apical third; sutural costa raised throughout; transverse costae variably
present or absent between marginal and discal branches. Intercostal spaces medially
tuberculate, tubercles with semi-erect dark squamate scales, laterally with pale squamate
scales not set on tubercles, overall producing a pattern of light and dark setal lines. Legs:
Femora rugose punctate; tibia shallowly foveolate and tuberculate, with pale acuminate
setae and stout spiniform setae emerging from tubercles; tarsi venter with stout spiniform
setae on laterally margins, medially glabrous; apical protibial spine large acute and
glabrous; combined protarsal segments approximately two-thirds length of protibia;
anterior protibial spur length shorter than basitarsi. Abdomen: Sparsely punctate with
inconspicuous acuminate setae.

Diagnosis. P. fallax can be separated from the other members of the Plesiasida subgenus
based on the following character combination: pronotum with a tomentose fiinge and

median tooth on posterior margin, medial ridge present on disc, posterior apicies acute,

242

 

 

produced, projecting over elytral humera; elytral costa sharply raised, crest glabrous;
transverse costae usually present; intercostal regions with alternating rows of light and
dark scales; elytral base neither depressed nor tomentose.

MEXICO: Guanajuato, Hidalgo, Jalisco, Mexico, Mexico D. F., Zacatecas.

Biology. Unknown.

Pelecyphorus (Plesiasida) intricatus Champion, New Combination

Asida intricata Champion, 18922493
Notiasida intricata (Champion). Wilke, 19222270

Pelecyphorus (Plesiasida) inlricatus (Champion). Smith, 2010

Type Material. HOLOTYPE, by monotypy, (female) labeled: a) Orange bordered white
circle reading “Type”; b) “State of Jalisco, / Mexico. / Richardson”; c) handwritten det.

“Asida / intricata/ Ch.”; d) “Sp. figured”; g) “B.C.ACol.IV.1. / Asida / intricata.”.

(BMNH).

Redescription (see fig. 2.37). Length: 17.7mm, width: 9.7mm. Integument ferruginous;
elytra wider than pronotum and approximately 3.2X longer, width of pronotum at base
less than width of elytral base. Head: Densely foveate with decurnbent lanceolate scales
emerging from fovea; frontoclypeal suture impressed, epistomal suture not indented at
margin; medial depression on frons impressed; labral margin emarginate; clypeal

membrane concealed. Mentum anterior margin straight, medially emarginate; basal half

243

 

 

 

 

of mentum with two faint paramedial longitudinal impressions. Apical segment of
maxillary palps expanded, scalene in female, unknown in male. Postgenal processes
slightly swollen, acute, and extending to middle of mentum. Antenna densely clothed in
erect dark brown acuminate setae; antennal segment 10 subquadrate, tomentose sensilla
separated and curved around apex. Prothorax: Pronotum arctuate, widest near middle;
marginal costa straight; anterior apicies produced and broadly rounded; posterior apicies
acute, produced and projecting over elytral humera; posterior margin nearly straight,
emarginate before apicies, fringed with golden tomentose setae, medial tooth present.
Pronotal disc nearly confluently foveate, each fovea with a pale ducumbent lanceolate
scale; paramedial fossa absent; longitudinal medial ridge thin and raised. Prostemal
process thickened and projecting behind procoxa, gradually deflexed. Prostemum
moderately foveate with pale acuminate setae, anterior margins of some fovea raised and
forming rounded tubercules. Pterothorax: Scutellum partially exposed, deep transverse
tomentose depressions present on mesonotum, separated by a smooth narrow ridge
between scutum and scutellum. Elytra elongate oval, widest behind middle; elytron base
not depressed or tomentose; marginal costa not divided, nearly reaching cauda; elytral
humera prominent and slightly reflexed; elytral disc with a dense confused network of
low reticulated costae, crests glabrous; intercostal regions densely clothed in yellowish-
white decurnbent lanceolate scales, emerging from minute tubercles or not. Legs: F emora
rugose; tibia tuberculate, stout spiniform setae emerging from tubercles; tarsi venter with
stout spiniform setae on laterally margins, medially glabrous; apical protibial spine large

acute and glabrous; combined protarsal segments subequal to length of protibia; anterior

244

 

 

 

 

protibial spur length shorter than basitarsi. Abdomen: Rugose, minutely punctate with
inconspicuous acuminate setae.

Diagnosis. P. intricatus can be separated from the other members of the Plesiasida
subgenus based on the following character combination: pronotum with a tomentose
fiinge and median tooth on posterior margin, medial ridge present on disc, posterior
apicies acute, produced, projecting over elytral humera; elytral disc with a dense
confused network of low reticulated costae, crests glabrous; intercostal regions densely
clothed in yellowish-white decurnbent lanceolate scales, emerging from minute tubercles
or not; elytral base neither depressed nor tomentose.

Distribution. Only known fi'om the type specimen, collected in the Mexican state of

J alisco.

Biology. Unknown.

Pelecyphorus (Platasida) Iaticollis Champion

Asida Iaticollis Champion, 1884258
Parasida Iaticollis (Champion). Casey, 19122131
Pelecyphorus (Plesiasida) Iaticollis (Champion). Smith, 2010

=Pelecjphorus (Plesiasida) planatulus (Casey, 19122129), New Synonym

Type Material. LECTOTYPE, designated here, (female) labeled: a) Orange bordered
white circle reading “Type”; b) “Guanajuato / Mexico. / Salle Coll”; c) handwritten det.

“Asida/ Iaticollis, / Champ.”; f) “Sp. figured”; g) “B.C.ACol.IV .1. / Asida/ Iaticollis”.

245

 

 

 

(BMNH). PARALECTOTYPES, 3 specimens (BMNH) labeled: a) “MEX / ICO”; b) “F.
Bates. / 81-19.”; c) on yellow paper “PARATYPE /Asida / Iaticollis / Champion, 1884 /

det. Aaron D. Smith”

 

Additional Specimens Examined. (43 specimens). MEXICO: Durango, Guanajuato.

Redescription (see fig. 2.38). Length: 15.1-18.4mm, width: 6.6-9.2mm (lectotype length: n
- ..J

18.3mm, width: 8.5mm). Integument black to ferruginous; elytra wider than pronotum |

 

and approximately 3X longer, width of pronotum at base subequal to width of elytral
base. Head: Densely foveate with short white lanceolate scales emerging fiom fovea; I
frontoclypeal suture faintly impressed, epistomal suture indented at margin; medial

depression on fi'ons weakly impressed; labral margin emarginate; clypeal membrane

concealed. Mentum anterior margin straight, medially emarginate; basal half of mentum

with two faint paramedial longitudinal impressions. Apical segment of maxillary palps

expanded, scalene in both sexes, distal angle more elongate in male. Postgenal processes

slightly swollen, acute, and extending to middle of mentum. Antenna densely clothed in

erect dark brown acuminate setae; antennal segment 10 subquadrate, tomentose sensilla

separated and curved around apex or meeting on one side. Prothorax: Pronotum

arctuate, narrowest at apex, widening to middle, nearly parallel sided to base; marginal

costa straight; anterior apicies produced and broadly rounded; posterior apicies rounded,

produced and projecting over elytral humera; posterior margin nearly straight, emarginate

before apicies, fringed with golden tomentose setae, medial tooth present. Pronotal disc

nearly confluently foveate, each fovea with short pale squamate scale; paramedial fossae

absent or faintly indicated; longitudinal medial ridge absent or thin and partially raised.

246

Prostemal process thickened and projecting behind procoxa, gradually deflexed.
Prostemum lightly punctate with short pale acuminate setae, anterior margins of
punctures not raised. Pterothorax: Deep transverse tomentose depressions present on
mesonotum, separated by a smooth narrow ridge between scutum and scutellum;
scutellum mostly concealed, apparently carinate. Elytra elongate oval, widest behind
middle, nearly planate; elytron base not depressed or tomentose. Costae thin and weakly
raised, tubercles and scales covering sides and occasionally crests; marginal costa
extending to cauda, meeting discal costa in apical fourth or not, divided in basal third,
inner branch not connected to outer branch or discal costa; elytral humera prominent,
straight or weakly reflexed; discal costa divided at base, reunited in apical third; sutural
costa weakly raised throughout; transverse costae variably present or absent between
marginal and discal branches. Intercostal spaces medially tuberculate, tubercles with
semi-erect dark squamate scales, laterally with pale squamate scales not set on tubercles,
overall producing a pattern of light and dark setal lines. Legs: Femora rugose punctate;
tibia shallowly foveolate and tuberculate, with pale acuminate setae and stout spiniform
setae emerging from tubercles; tarsi venter with stout spiniform setae on laterally
margins, medially glabrous; apical protibial spine large acute and glabrous; combined
protarsal segments approximately three-fourths length of protibia; anterior protibial spur
length shorter than basitarsi. Abdomen: Sparsely minutely punctate with inconspicuous
acuminate setae.

Diagnosis. P. Iaticollis can be separated from the other members of the Plesiasida
subgenus based on the following character combination: pronotum with a tomentose

fringe and median tooth on posterior margin, medial ridge absent or incomplete on disc,

247

 

 

posterior apicies rounded, produced, projecting over elytral humera; elytral costa weakly
raised, crest setose; transverse costae rarely present; intercostal regions with alternating
rows of light and dark scales; elytral base neither depressed nor tomentose.
Distribution. MEXICO: Aquascalientes, Durango, Guanajuato.

Biology. Unknown.
Pelecyphorus (Plesiasida) obliviosus Wilke

Parasida obliviosa Wilke, 19222270

Pelecaphorus (Plesiasida) obliviosus (Wilke). Smith, 2010

Type Material. LECTOTYPE, designated here, (female) labeled: a) “Promontorio/
Durango”; b) “obliviosa / det. S. Wilke”; c) “SYNTYPUS / Parasida / obliviosa Wilke,
1921 / labeled by MNHUB 2008”; (1) “Museum fiir Naturkunde / Humboldt-Univ. Berlin
/ (MNHUB)”; e) “LECTOTYPE / Parasida obliviosa / Wilke, 1921 / ADSmith 2009”.
(ZMHB). .

Additional Specimens Examined. (31 specimens). MEXICO: Durango.

Redescription (see fig. 2.39). Length: 18.0-20.3mm, width: 8.0-10.7mm (lectotype
length: 18.0mm, width: 8.0mm). Integument black to ferruginous; elytra wider than
pronotum and approximately 3X longer, width of pronottun at base subequal to width of
elytral base. Head: Densely foveate with short white lanceolate scales emerging from

fovea; frontoclypeal suture faintly impressed, epistomal suture not indented at margin;

248

 

medial depression on frons weakly impressed; labral margin emarginate; clypeal
membrane concealed. Mentum anterior margin straight, medially emarginate; basal half
of mentum with two faint paramedial longitudinal impressions. Apical segment of
maxillary palps expanded, scalene in both sexes, distal angle more elongate in male.
Postgenal processes slightly swollen, acute, and extending to middle of mentum. Antenna
densely clothed in erect dark brown acuminate setae; antennal segment 10 subquadrate,
tomentose sensilla separated and curved around apex or meeting on one side. Prothorax:
Pronotum arctuate, narrowest at apex, widening to middle, nearly parallel sided to base;
marginal costa straight; anterior apicies produced and broadly rounded; posterior apicies
rounded, produced and projecting over elytral humera; posterior margin nearly straight,
emarginate before apicies, fringed with golden tomentose setae, medial tooth present.
Pronotal disc nearly confluently foveate, each fovea with short pale lanceolate scale;
paramedial fossae absent or faintly indicated; longitudinal medial ridge absent or faintly
indicated but not raised. Prostemal process thickened and projecting behind procoxa,
gradually deflexed. Prostemum minutely punctate with short pale acuminate setae,
anterior margins of punctures not raised. Pterothorax: Deep transverse tomentose
depressions present on mesonotum, separated by a smooth narrow ridge between scutum
and scutellum; scutellum mostly concealed, apparently carinate. Elytra elongate oval,
widest behind middle; elytron base not depressed or tomentose. Costae thick and strongly
rounded crests impunctate and glabrous; marginal costa extending down cauda, meeting
discal costa at apex, bifurcate in basal third, inner branch not connected to outer branch
or discal costa at apex; elytral humera prominent, straight or weakly reflexed; discal costa

divided at base, reunited in apical third; sutural costa raised throughout; transverse costae

249

 

rarely present and only between branches of marginal costa. Intercostal spaces medially

 

tuberculate, tubercles with semi-erect yellowish-white squamate scales, laterally with
white squamate scales not set on tubercles, overall producing a faint pattern of lighter and
darker setal lines. Legs: Femora rugose punctate; tibia shallowly foveolate and

tuberculate, with pale acuminate setae and stout spiniform setae emerging from tubercles;

tarsi venter with stout spiniform setae on laterally margins, medially glabrous; apical :3
protibial spine large acute and glabrous; combined protarsal segments approximately 4 T
three-fourths length of protibia; anterior protibial spur length shorter than basitarsi. I

 

Abdomen: Nearly impunctate, sparse minute punctures with inconspicuous i
paleacuminate setae.

Diagnosis. P. obliviosus can be separated from the other members of the Plesiasida

subgenus based on the following character combination: pronotum with a tomentose

fringe and median tooth on posterior margin, medial ridge absent or faintly indicated on

disc, posterior apicies rounded, produced, projecting over elytral humera; elytral costa

raised, broadly rounded, crests impunctate and glaberous; transverse costae rarely

present; intercostal regions with faint alternating rows of lighter and darker scales; elytral

base neither depressed nor tomentose; prostemum minutely punctate.

Distribution. MEXICO: Chihuahua, Durango.

Biology. Unknown.

 

250

Pelecyphorus (Plesiasida) scutellarr’s (Champion)

Asida scutellaris Champion, 1884257
Parasida scutellaris (Champion). Casey, 19122131
Pelecyphorus (Plesiasida) scutellaris (Champion). Smith, 2010

=Pelecyphorus (Plesiasida) tolucanus Casey, 19122130), New Synonym

Type Material. LECTOTYPE, designated here, (sex undetermined) labeled: a) Orange
bordered white circle reading “Type”; b) “J alapa / Mexico. / Hoge.”; c) handwritten det.
“Asida/ scutellaris, / Champ”; d) “Sp. figured”; g) “B.C.ACol.lV.1./ Asida/
scutellaris.”. (BMNH).

Additional Specimens Examined. (99 specimens). MEXICO: Durango, Guanajuato,

Hidalgo, Mexico, Mexico D. F ., Puebla, Oaxaca, Veracruz.

Redescription (see fig. 2.40). Length: 12.8-18.0mm, width: 5.7-9.4mm (lectotype length:
15.2mm, width: 7.3mm). Integument black to ferruginous; elytra wider than pronotum
and approximately 3X longer, width of pronotum at base subequal to width of elytral
base. Head: Densely foveate with decurnbent acuminate brown setae emerging from
fovea; fiontoclypeal suture faintly impressed, epistomal suture not indented at margin;
medial depression on frons weakly impressed; labral margin emarginate; clypeal
membrane concealed. Mentum anterior margin straight, medially emarginate; basal half
of mentum with two faint paramedial longitudinal impressions. Apical segment of

maxillary palps expanded, scalene in both sexes, distal angle more elongate in male.

251

 

 

 

Postgenal processes slightly swollen, acute, and extending to middle of mentum. Antenna
densely clothed in erect dark brown acuminate setae; antennal segment 10 subquadrate,
tomentose sensilla separated and curved around apex or meeting on one side. Prothorax:
Pronotum weakly sinuate, widest near middle; marginal costa straight; anterior apicies
produced and broadly rounded; posterior apicies rounded, produced and projecting over
elytral humera; posterior margin nearly straight, emarginate before apicies, fiinged with
golden tomentose setae, medial tooth present. Pronotal disc nearly confluently foveate,
each fovea with short pale squamate scale; paramedial fossae absent or faintly indicated;
longitudinal medial ridge absent or faintly indicated but not raised. Prostemal process
thickened and projecting behind procoxa, gradually deflexed. Prostemum densely foveate
with short brown acuminate setae, anterior margins of punctures not raised. Pterothorax:
Deep transverse tomentose depressions present on mesonotum, separated by a smooth
narrow ridge between scutum and scutellum; scutellum mostly concealed, apparently
carinate. Elytra elongate oval, widest behind middle; elytron base not depressed or
tomentose. Costae thick and strongly rounded crests impunctate and glabrous; marginal
costa extending down cauda, meeting discal costa at apex, bifurcate in basal third, inner
branch not (connected to outer branch or discal costa at apex; elytral humera prominent,
straight or weakly reflexed; discal costa divided at base, reunited in apical third; sutural
costa raised throughout; transverse costae rarely present and only between branches of
elytral costa. Intercostal spaces medially sparsely and weakly tuberculate, tubercles with
semi-erect light brown squamate scales, laterally with yellowish-white squamate scales
not set on tubercles, overall producing a faint pattern of lighter and darker longitudinal

setal lines between costa. Legs: Femora rugose punctate; tibia shallowly foveolate and

252

 

 

 

tuberculate, with brown acuminate setae and stout black spiniform setae emerging fiom
tubercles; tarsi venter with stout black spiniform setae on laterally margins, medially

glabrous; apical protibial spine large acute and glabrous; combined protarsal segments

 

approximately three-fourths length of protibia; anterior protibial spur length shorter than
basitarsi. Abdomen: Moderately foveate with short dark acuminate setae.
Diagnosis. P. scutellaris can be separated fiom the other members of the Plesiasida

subgenus based on the following character combination: pronotum with a tomentose

 

fiinge and median tooth on posterior margin, medial ridge absent or faintly indicated on

‘———--—~' _ j:

disc, posterior apicies rounded, produced, projecting over elytral humera; elytral costa
raised, broadly rounded, crests impunctate and glaberous; transverse costae rarely
present; intercostal regions with faint alternating rows of lighter and darker scales; elytral
base neither depressed nor tomentose; prostemum densely foveate.

Distribution. MEXICO: Durango, Guanajuato, Hidalgo, Mexico, Mexico D. F., Puebla,
Oaxaca, Veracruz.

Biology. Unknown.

Pelecyphorus Species Checklist

subgenus Astrotus LeConte

Pelecyphorus (Astrotus) atveolatus (Casey 1912:83)

 

Pelecyphorus (Astrotus) contortus (LeConte, 1853 :446)
Pelecyphorus (Astrotus) regularis (Horn, 1870:290)

Pelecyphorus (Astrotus) hebes (Champion, 1892:506)

253

Pelecyphorus Mstrotus) captions Smith, new species

subgenus Stenosides Solier
Pelecyphorus (Stenosides) anastomosis (Say, 18242256)
=P. (Stenosides) breviuscula (Casey, 1912287), new synonym
=P. (Stenosides) exoleta (Casey, 1912287), new synonym
=P. (Stenosides) luteotecta (Casey, 1912:88), new synonym
=P. (Stenosides) monticola (Casey, 1912288), new synonym
=P. (Stenosides) obtecta (Casey, 1912289), new synonym
=P. (Stenosides) sigillata (Casey, 1912289), new synonym
Pelecyphorus (Stenosides) graciliformis (Solier, 18362486)
=P. (Stenosides) canus (Champion, 1884268), new synonym
=P. (Stenosides) sinuaticollis (Champion, 1884269), new synonym
Pelecyphorus (Stenosides) limosus (Champion, 1884:66)
Pelecyphorus (Stenosides) cavatus Smith, new species
Pelecyphorus (Stenosides) deaztlani Smith, new species
Pelecyphorus (Stenosides) triplehorm’ Smith, new species

Pelecyphorus (Stenosides) texanus (Wickham, 1903 27 2)

subgenus Sicharbas Champion
Pelecwhorus (Sicharbas) lobatus (Champion, 1884267)
Pelecyphorus (Sicharbas) debilis (Champion 1884266)

Pelecyphorus (Sicharbas) erosus (Champion 18922504)

254

 

 

 

=Pelecyphorus (Astrotus) nosodermoides (Champion, 18922505), new synonym
Pelecyphorus (Sicharbas) seticornis (Champion, 1884267)
Pelecyphorus (Sicharbas) oaxacensis Smith, n. sp.

Pelecyphorus (Sicharbas) undatus (Champion, 18922504)

subgenus Pelecyphorus Solier

Pelecyphorus (Peleqphorus) mexicanus Solier, 18362469

subgenus Ucalegon Champion

Peleqphorus (Ucalegon) pulchellus (Champion, 1884265)

subgenus Zaleucus Champion

Pelecyphorus (Zaleucus) dilatatus (Champion, 1884270)
Pelecyphorus (Zaleucus) platesthoides (Champion, 1884:71)
Pelecyphorus (Zaleucus)foveolatus Solier, 1836247 2

Pelecyphorus (Zaleucus) doyeni Smith, n. sp.

subgenus Variodorsus Smith, new subgenus
Pelecyphorus (Variodorsus)fasciculatus (Champion, 1892:495)
Pelecyphorus (Variodorsus) guanajuatensis (Champion, 1884256)

Stenomorpha (Bothrasida) mucorea (Wilke 19222270), new synonym

subgenus Plesiasida Smith, replacement name (=Parasida Casey)

255

 

 

 

Pelegphorus (Plesiasida) bibasalis (Casey, 19122128)
Pelecyphorus (Plesiasida) dispar (Champion, 18922496)

=Pelecyphorus (Plesiasida) dissimilis (Champion, 1884259), junior homynym

=P. (Stenosides) bisinuatus (Pallister, 1954213), new synonym

=P. (Stenosides) kulzeri (Pallister, 1954:12), new synonym

=P. (Plesiasida) trisinuatus (Pallister, 1954:22), new synonym
Pelecyphorus (Plesiasida) liratus (LeConte, 1854:223)

=Pelecyphorus (Plesiasida) laciniatus (Casey, 19122128), new synonym

=Pelecyphorus (Plesiasida) cristatus (Pallister 1954224), new synonym
Pelecyphorus (Plesiasida) asidoides Solier, 18362471

=P. (Plesiasida) zacualpanicolus (Wilke, 19222272), new synonym
Pelecyphorus (Plesiasida)fallax (Champion, 1884:57)

=Pelecjphorus (Plesiasida)favosus (Champion, 1884:58), new synonym

=Pelecyphorus (Plesiasida) similatus (Champion, 1884258), new synonym
Pelecyphorus (Plesiasida) intricatus (Champion, 18922493), new combination

Notiasida intricata (Champion) 18922493

Pelecyphorus (Plesiasida) Iaticollis (Champion, 1884258)

=Pelecyphorus (Plesiasida) planatulus (Casey, 1912:129), new synonym
Pelecyphorus (Plesiasida) obliviosus (W ilke, 19222270)
Pelecyphorus (Plesiasida) scutellaris (Champion, 1884257)

=Pelecyphorus (Plesiasida) tolucanus Casey, 19122130), new synonym
Pelecyphorus (Platasida) longipennis (Champion, 1884256)

=P. (Plesiasida) mixtecae (W ilke, 19222271), new synonym

256

 

 

 

=P. (Plesiasida) esperanzae (W ilke, 19222271), new synonym
Pelecyphorus (Plesiasida) tristis (Champion, 1884255)

=Pelecyphorus (Plesiasida) purpusi (W ilke, 1922:271), new synonym
Pelecyphorus (Plesiasida) indutus (Champion, 1884256)

=P. (Stenosides) bicarinatus (Champion, 1884269), new synonym
Pelecyphorus (Plesiasida) smostatus LeConte, 18612337

Pelecyphorus (Plesiasida) czfuentesi Smith, n. sp.

257

 

 

 

 

 

 

 

 

Figure 2.1: Dorsal habitus of Pelee-whom (Astrotus) alveolatus (Casey), holotype, 6‘
(L=1 1.5mm)

258

 

   

Figure 2.2: Dorsal habitus of Pelecyphorus (Astrotus) contortus (LeConte), (3‘
(L=1 1.3mm)

 

259

 

 

   

Figure 2.3: Dorsal habitus of Pelecyphorus (Astrotus) regularis (Horn), 2 (L=12.2mm)

260

 

 

Figure 2.4: Dorsal habitus of Pelecwhorus (Astrotus) hebes (Champion), (3‘
(L=18.3mm)

 

261

 

   

Figure 2.5: Dorsal habitus of Pelecyphorus (Astrotus) crypticus Smith, n. sp., 6‘
(L=9.5mm)

262

 

 

 

 

   

Figure 2.6: Dorsal habitus of Pelecyphorus (Stenosides) anastomosis (Say), SB
(L=11.9mm)

263

 

Figure 2.7: Dorsal habitus of Pelecyphorus (Stenosides) cavatus Smith, n. sp.,
(L=12.5mm)

264

 

 

 

 

 

Figure 2.8: Dorsal habitus of Pelecyphorus (Stenosides) deaztlani Smith, n.sp., S2
(L=1 0.5mm)

265

 

 

Figure 2.9: Dorsal habitus of Pelecyphorus (Stenosides) triplehorm‘ Smith, n. sp., 6‘
(L=10.8mm)

266

 

 

 

.‘ - k .
‘r'lf'.

 

' s") ‘ '

Figure 2.10: Dorsal habitus of Pelecwhorus (Stenosides) limosus (Champion), holotype
(L=7.8mm)

267

 

   

Figure 2.11: Dorsal habitus of Pelecyphorus (Stenosides) graciliformis (Solier),
(L=9.7mm)

 

268

 

 

Figure 2.12: Dorsal habitus of Peleqphorus (Stenosides) texanus (W ickham),
(L=7.7mm)

269

 

 

Figure 2.13: Dorsal habitus of Pelecyphorus (Sicharbas) lobatus (Champion), holotype
6‘ (L=10.6mm)

270

 

 

Figure 2.14: Dorsal habitus of Pelecyphorus (Sicharbas) oaxacensis Smith, n. sp.,
holotype 6‘ (L=11.3mm)

271

 

 

Figure 2.15: Dorsal habitus of Pelecwhorus (Sicharbas) debilis (Champion), (3‘
(L=7.4mm)

272

 

   

Figure 2.16: Dorsal habitus of Pelecyphorus (Sicharbas) seticornis (Champion), 6‘
(L=6.6mm)

273

 

 

Figure 2.17 : Dorsal habitus of Pelecyphorus (Sicharbas) erosus (Champion), holotype S?
(L=9.6mm)

274

 

 

Figure 2.18: Dorsal habitus of Pelecyphorus (Sicharbas) undatus (Champion), lectotype
S? (L=11.6mm)

275

 

 

 

 

Figure 2.19: Dorsal habitus of Pelecyphorus (Pelecyphorus) mexicanus Solier, S2
(L=13.9mm)

276

 

Figure 2.20: Dorsal habitus of Pelecjphorus (Ucalegon) pulchellus (Champion), 2
(L=1 3 . 8mm)

277

 

 

 

Figure 2.21: Dorsal habitus of Pelecyphorus (Zaleucus) dilatatus (Champion), lectotype
S? (L=15.8mm)

278

t

 

Figure 2.22: Dorsal habitus of Pelecwhorus (Zaleucus) platesthoides (Champion),
lectotype (L=14.3mm)

279

 

Figure 2.23: Dorsal habitus of Pelecyphorus (Zaleucus)foveolatus Solier, 6‘
(L=13.5mm)

280

 

 

Figure 2.24: Dorsal habitus of Pelecwhorus (Zaleucus) doyeni Smith, n. sp., 6‘
(L=13.1mm)

281

   

Figure 2.25: Dorsal habitus of Pelecyphorus (Variodorsus) guanajuatensis (Champion),
6‘ (L=11.3mm)

 

282

 

 

Figure 2.26: Dorsal habitus of Pelecwhorus (Variodorsus)fasciculatus (Champion), 6‘
(L=1 1.7mm)

283

 

Figure 2.27 2 Dorsal habitus of Pelecyphorus (Plesisida) liratus (LeConte), 6‘
(L=12.8mm)

284

 

Figure 2.28: Dorsal habitus of Pelecyphorus (Plesisida) dispar (Champion), 6‘
(L=1 1.5mm)

285

   

Figure 2.29: Dorsal habitus of Pelecyphorus (Plesisida) bibasalis (Casey),
(L=17.5mm)

 

286

 

Figure 2.30: Dorsal habitus of Peleqphorus (Plesisida) sexcostatus LeConte, 6‘
(L=1 1.2mm)

287

 

Figure 2.31: Dorsal habitus of Pelecaphorus (Plesisida) cifitentesi Smith, n. sp., 6‘
(L=1 1.1mm)

288

 

Figure 2.32: Dorsal habitus of Pelecyphorus (PIesisida) longipennis (Champion), 6‘
(L=10.5mm)

289

 

 

   

Figure 2.33: Dorsal habitus of Pelecjphorus (Plesisida) indutus (Champion), holotype 6‘
(L=12.0mm)

290

 

 

r'fiJ-‘ir‘t'F'a v'o
- “*fihr

 

Figure 2.34: Dorsal habitus of Pelecyphorus (Plesisida) tristis (Champion), lectotype 6‘
(L=12.1mm)

291

 

   

Figure 2.35: Dorsal habitus of Pelecyphorus (Plesisida) asidoides Solier, SB (L=13.3mm)

 

292

s

u.)

'3. -'.‘ .
”.3, ’4 ' ."

‘5'4'-‘3r"‘1 V

a , . _ .
' V ‘J — \ " -, a.
' 9-7'5-‘5‘F ‘r' .

 

Figure 2.36: Dorsal habitus of Pelecyphorus (Plesisida)fallax (Champion) (L=15.0mm)

293

5.1: ,

D

. ‘
I. 4
..'~v‘ ’.. l- I.
. ‘ 1/1' ‘1‘, J Li I
'.'i' ‘-, O‘. __ ‘
:2] “. . _ ",1“. ,

. ,r
‘ .e, -

 

Figure 2.37: Dorsal habitus of Pelecyphorus (Plesisida) intricatus (Champion), holotype
$2 (L=17.7mm)

294

 

Figure 2.38: Dorsal habitus of Pelecyphorus (Plesisida) Iaticollis (Champion)
(L=1 7.4mm)

295

 

 

Figure 2.39: Dorsal habitus of Pelecyphorus (Plesisida) obliviosus (W ilke), S2
(L=20.3mm)

296

 

Figure 2.40: Dorsal habitus of Pelecjphorus (Plesisida) scutellaris (Champion)
(L=1 5 .2mm)

297

CHAPTER THREE

The evolution of contrasting defensive strategies within the North American Asidini

(Coleoptera: Tenebrionidae)

298

 

- M.)

h.
fl.

 

ABSTRACT

The asidine darkling beetles (Coleoptera: Tenebrionidae: Asidini) are a
morphologically diverse tribe of flightless tenebrionids found in many arid and sub-arid
habitats around the world. The nearly 300 currently described North American species
are contained in ten genera, all of which are restricted to the western half of the continent.

The Asidini, like all members of the subfamily Pimeliinae, lack defensive glands. Instead,

 

several morphological and behavioral traits are found within the tribe that may help limit
predation. These include the contrasting defensive strategies of crypsis, either through
background matching or pattern disruption, and Batesian mimicry of the chemically
defended tenebrionid genus Eleodes. A phylogenetic analysis of the North American
asidines is presented based on data from two genes, mitochondrial cytochrome c oxidase
I (COI) and nuclear ribosomal 28S, and adult morphology; this tree supports multiple

origins for Batesian mimicry within the tribe.

299

 

 

INTRODUCTION

Many animals use multiple defensive mechanisms and strategies in order to avoid
predation, and such is the case for the asidine darkling beetles (Coleoptera:
Tenebrionidae: Asidini), a large tribe of flightless tenebrionids found in many arid and
semi-arid regions around the world. Unlike most tenebrionids, the Asidini lack defensive
glands. Instead, several traits occur within the tribe that presumably help to limit
predation. These include subterranean larvae and, in adults, cryptic or mimetic
morphologies and behaviors. The majority of asidine species are somewhat cryptic in
coloration and sculpturing, but two distinct adaptive strategies have evolved within the
North American Asidini that are so far unique or nearly unique within the tribe. One is a
precise form of background matching, including the production of adhesive chemicals to
coat themselves with soil or debris. The second is Batesian mimicry of other tenebrionids
that do have defensive glands, specifically the widespread genus Eleodes (Brown 1971a).

The term crypsis covers a broad range of primary defensive mechanisms, i. e.
traits that are used to avoid detection by predators when they are encountered (Edmunds
1974). These can include colorations or patterning that blend with the surrounding
environment (background matching) and markings that obscure or distort the true outline
or borders of the organism (pattern disruption). Cryptic coloration or morphology is also
often associated with a behavioral trait known as thanatosis, or “playing dead”, as many
visually oriented predators track movement.

Crypsis appears to be widespread in many animal groups and has been widely
cited in the literature; however reports on crypsis in insects is limited to a relatively small

number of publications. Crypsis has been examined in several groups, including the

300

 

I ..fimn‘fi 1.
1‘-

 

Hemiptera (Patra et al. 2008) and Plecoptera (Feltmate and Williams 1989), but the
majority of crypsis studies involving insects have focused on the Lepidoptera (Poulton
1892, Endler 1988, Moss et al. 2006, Canfield et a1. 2009), including the intensely
studied case of industrial melanism (Kettlewell 1955) in the peppered moth, Biston
betularia, which has recently been the subject of some debate (see Ruxton et al. 2004 for
a review). Much research remains to quantify the effectiveness of crypsis versus its
potential costs.

Most asidine species avoid predation as adults through some variation of cryptic
coloration and sculpturing. The most widespread method is background matching based
on the dry sandy substrates where they generally occur; hence many species are brown
with light colored setae and are often dusted to some extend with sand or debris. A
number of species in the genera Craniotus, Heterasida, Pelecyphorus, and Stenomorpha
exhibit this general phenotype. All species in the Pelecyphorus subgenus Astrotus also
display background matching; however they accomplish it by producing an adhesive
compound upon emergence and coating themselves with a thick layer of soil (Fig 3.2).
This allows for a precise color match to the regional substrate. In all of the Astrotus
specimens reared thus far the adhesive has been produced as long thin filaments that
become entangled in raised stellate setae (Fig. 3.3) that cover the integument, before
hardening within approximately twenty-four hours (Smith, unpublished). Crypsis within
both the subgenera Astrotus and Sicharbas is further enhanced by pronotal and elytral
flanges and tubercles, which break up the overall outline of the body. A different
camouflage strategy, disruptive coloration or pattern disruption, is exhibited within the

subgenus Plesiasida (Fig. 2.39). Many Plesiasida species have three raised costae on

301

 

each elytron with dense longitudinal rows of white and brown squamose setae filling the
space between them, making it difficult to discern their body shape by creating false
edges and boundaries on the dorsal surface.

In addition to morphological crypsis, species in the subgenera Astrotus,
Stenosides, and Zaleucus also play dead (thanatosize) when threatened. Astrotus species
position their legs and antennae flush with the body and will hold them in this position
for over thirty minutes under observation. Stenosides and Zaleucus bend their legs
underneath the body and cross them in a scissor-like pose. The reason behind this posture
is unclear, but it may either help them appear more like debris or inhibit swallowing by
predators.

In contrast to inversigating crypsis, many studies have been devoted to examining
secondary defensive mechanisms (reviewed in Edmunds 1974; Ruxton et al. 2004). The
category of secondary defenses covers a wide range of traits and behaviors that deter
predation after the prey species has been detected. These include physiological characters
such as the production of toxins, mechanical defenses such as spines or armor, and
behavioral defenses such as rapid escape and retaliation. Secondary defenses also
generally involve signals from the prey species, which advertise their unprofitability to
the predator, such as aposomatic colorations or warning displays.

One interesting variety of secondary defense is Batesian mimicry, which is when
a palatable species mimics the warning signals of a less palatable, often chemically
defended, model species and thereby gains some measure of protection from predation
without incurring the energetic costs associated with producing defensive compounds.

For example, Hetz and Slobodchikoff (1990) calculated that the energy required for an

302

Eleodes obscurus (Say) female to produce defensive secretions over the course of a year
is approximately equal to 18% of the energy expended on egg production, so a co-
occuning mimetic female could potentially receive the same protection from predation
while also devoting more energy to reproduction.

The concept of Batesian mimicry dates back to Bate’s (1862) seminal paper
documenting mimicry between Amazonian butterfly species. Several components are
generally thought to be necessary for Batesian mimicry to be an effective defensive
strategy (Ruxton et al. 2004). 1) The model species is unpalatable and displays
aposomatic signals that predators learn to avoid 2) The mimic species exhibits signals
similar enough to the model that predators avoid it. 3) The model co-occurs across the
mimic’s range. It is also expected that the model will occur in greater relative population
densities and that individuals of the mimetic species will emerge at the same time or
shortly after the peak emergence period of the model. Both hypothetically increase the
chance of a naive predator attacking a model specimen and learning to associate its
aposomatic signals with unpalatability.

It follows that the more accurate the mimic’s ability to imitate the defensive
signals of the model the greater the protection it will receive. However many mimetic
species have been shown to be inaccurate. Several theories have been put forth to
account for imperfect signaling by mimics, including an evolutionary arms race between
mimics and models (Ruxton el al. 2004), insufficient time for the mimic to converge on
the model (Gilbert 2005), or that a signal which may appear imperfect is in fact accurate
in relation to the cognitive abilities of target predators (Cuthill & Bennet 1993, Dittrich et

al. 1993, Chittka & Osorio 2007). However, it is still generally assumed that even poor

303

 

 

 

mimics will gain a selective advantage when the model is very common (Ruxton el al.
2004, Harper & Pfennig 2007). Another possibility is that in areas where multiple similar
models co-occur the optimal phenotype for a mimetic species may be intermediate
between those of the available models (Edmunds 2000, Sherratt 2002).

Darkling beetles are well known for their production of distasteful defensive
compounds, mostly a variety of quinones (Tschinkel 1975a), which are used to ward off
predators. Defensive glands appear to have independently evolved four times within the
family (Tschinkel & Doyen 1980). However, nearly half of all known tenebrionids,
including those in the tribe Asidini, belong to the chemically undefended subfamily
Pimeliinae. Doyen (1993) dissected specimens fi'om all of the pimeliine tribes and
confirmed the absence of defensive glands throughout the subfamily.

The endemic North American genus Eleodes, in the subfamily Tenebrioninae, is a
remarkably successful genus of tenebrionids in terms of individual and species numbers.
With approximately 235 species (Triplehom et al. 2010), Eleodes have diversified
throughout western North America and are a prominent portion of the desert insect fauna
fiom southern Mexico to southern Canada. All Eleodes are flightless detritivores and
secrete noxious defensive compounds. Nearly all Eleodes species are glabrous and black,
with long hind legs. Doyen & Somerby (1974) argue that, in the case of darkling beetles,
black is an aposomatic color as it makes them easily visible by increasing the contrast
between the beetles and their substrate under low lighting conditions. The majority of
Eleodes species are crepuscular, and individuals are often found on light colored sandy
soils (Slobodchikoff 1978a, Thomas 1979, pers. obser.). Many Eleodes, including some

of the most common species, also exhibit a behavior known as headstanding, which

304

involves lowering the beetle’s head and raising the tip of the abdomen by 30-90 degrees
from horizontal. This behavior is considered to be aposomatic and is often associated
with the ability to forcefully eject defensive secretions as a spray (Tschinkel 1975b).

Evidence of mimetic relationships between members of two asidine genera and
co-occurring species in the genus Eleodes have been documented in the literature. Brown
(1971a) indicates that Philolithus (Gonasida) elata (LeConte) is likely to be an accurate
mimic of Eleodes obscurus (Say) based on their overall phenetic similarity (Fig 3.4), the
observation of headstanding behavior in all P. elata individuals studied, and changes in
the dorsal patterning of the four P. elata subspecies, which match the dorsal variations
seen in the three subspecies of E. obscurus with which they occur in different parts of
both species’ ranges.

A series of papers (Slobodchikoff et al. 1987, Hetz & Slobodchikoff 1988, 1990)
examined the relationship between Stenomorpha marginata (LeConte), a large asidine
species that superficially looks like an Eleodes and that headstands when threatened, and
E. obscurus. They considered S. marginata to be an inaccurate mimic of E. obscurus,
presumably based on their differing morphologies, but found that S. marginata gained
some selective advantage from predation by mammalian predators in field studies,
especially when alternative prey were available. An inaccurate mimetic relationship was
also assumed to occur between Stenomorpha (Megasida) obliterata (Champion) and
Eleodes longicollis (LeConte) due to their overlapping ranges and activity periods,
somewhat similar phenotypes, and the presence of headstanding behavior within both

species (Eisner 1966, Eisner & Meinwald 1966).

305

In this study I examine the evolution of both mimetic and cryptic traits within the

North American asidines using a phylogeny based on data from two genes, mitochondrial

cytochrome c oxidase I (C01) and nuclear ribosomal 28S, and adult morphology.

MATERIALS AND METHODS
Taxon Sampling

Most asidine species are rarely encountered and many species are known fi'om
only one or a handful of collecting events. Specimens sequenced for this study were
either collected by the authors directly into 95% ethanol or donated by colleagues.
Additional specimens of each species were also scored for morphology and used to
examine potential intraspecific variability. Fifty North American asidine species were
included in the analysis (Table 1.1) representing seven of the ten current genera.
Outgroup taxa were selected from the South American Asidini (Cardigenius Iaticollis
Solier) and the closely related tribes Coniontini (Eusatrus reticulatus (Say)) and

Branchini (Branchus n. sp.).

DNA Sequencing and Alignment
Tissue was removed from either the head or a leg of each specimen and the DNA
was extracted using DNeasyTM Tissue Kits (Qiagen). After extraction, DNA samples
were stored a -20°C and specimens were either pinned or left in 95% ethanol at -80°C.
All specimens were vouchered in the A.J. Cook Arthropod Research Collection at

Michigan State University.

306

The purified DNA was used to amplify portions of the mitochondrial cytochrome
c oxidase I (C01) and nuclear ribosomal 28S (D2 region) genes. PCR reactions for COI
used the published primers (Herbert et al. 2003) LC01490 (5’GGTCAACAA
ATCATAAAGATATTGG—3’) and HC02198 (5’-TAAACTTCAGGGTGACCA
AAAAATCA-3’) and contained 15.75 pl ddeO, 2.5 pl 5X T anNA polymerase buffer
(Promega, Madison, WI), 2.0 pl 25 mM Promega MgClz, 0.5 pl 40 mM dNTPs
(deoxynucleotide triphosphates), 0.25 pl Promega T aq DNA polymerase, 1 pl of 10
pM/pl LC01490 primer, 1 pl of 10 pM/pl HC02198 primer, and 2 pl of DNA template.
PCR reactions for 288 used the primers 3665 (5’AGAGAGAGTTCAAGAGTACG
TG—3’) and 4068 (5’-TTGGTCCGTG'I'I‘TCAAGACGGG -3’). PCR reactions contained
15.75 pl ddeO, 2.5 pl 10X T anNA polymerase buffer (Qiagen Inc., Santa Clara, CA),
2.0 p125 mM MgC12, 0.5 pl 40 mM dNTPs (deoxynucleotide triphosphates), 0.25 pl
Qiagen Hotstar T aq DNA polymerase, 1 pl of 10 pM/pl 3665 primer, 1 pl of 10 pM/pl
4068 primer, and 2 p1 of DNA template.

PCR amplifications for both genes were performed using a M] thermal cycler (MJ
Research, Waltham, MA) under the following conditions: activation (95°C, 5min.) for 1
cycle; denaturation (94°C, 303), annealing (45-55°C, 45s), extension (72°C, 605) for 35-
40 cycles; final extension (72°C, 5min.). Negative controls were used to monitor for
potential contamination and PCR products were examined using gel electrophoresis. PCR
products were cleaned using ExoSAP-IT and the manufacturer’s protocols (U SB Corp.,
Cleveland, OH). The cleaned PCR products were sequenced in both directions, using the
same primers as were used in amplification, with a BigDye® Terminator v1.1 cycle

sequencing kit (Applied Biosystems, Foster City, CA) at the Research Support Facility at

307

Michigan State University. The resulting DNA sequences were examined and edited
using Sequencer 4.5 (Genecodes, Ann Arbor, MI) and consensus sequences were created
from the sense and antisense sequences.

The COI sequences showed no length variability and were aligned manually in
Mega 4 (Tamura et al. 2007) since the alignments were unambiguous. 28S sequences
were initially aligned using Clustal W (Thompson & Higgins 1994) in Mega 4 then
manually adjusted in reference to a model of beetle 28S secondary structure (Gillespie et
al. 2004) to correct misaligned conserved regions and to remove unalignable regions in

the 288 dataset

Morphological Characters

A total of 100 morphological characters (42 binary, 58 multistate) were included in
the analyses. Characters include those previously used in asidine species and generic
descriptions (Solier 1836; LeConte, 1853, 1858; Champion 1884, 1892; Casey 1912;
Wilke 1822) and recent characters identified by one of the authors (Smith 2010, in prep.),
including one behavioral character (defensive posture) and one character based on a
species overall resemblance to known co-occurring Eleodes species (Eleodes mimic).
Characters and their states are included in chapter 1 with a matrix of scored states for
each species. Images of states and additional supplementary material are online at
http://wwwhisl.ent.msu.edu/research/asidini/ .

All measurements were taken using digital calipers or an optical micrometer attached
to a Leica MZ125 microscope. Overall body length was measured along the midline from

the anterior margin of the pronotum to the apex of the elytra. Width was measured across

308

the widest point of the elytra. Images of specimens or characters were taken with a Leica
DFC320 camera mounted on a Leica MZ16 microscope. Montaged images were
assembled with Helicon Focus 3.5 (I-IeliconSoft) software.

Dissection of specimens to examine internal structures followed established methods
(Tschinkel & Doyen 1980, Flores 1997) for the subfamily and descriptive terminology

followed Doyen (1966, 1993) and Harris (1979).

Phylogenetic Analysis

Morphological and sequence data (100 morphological characters, 1152bp) for 55
North American asidine OTUs and 3 outgroup taxa were concatenated in Mesquite 2.5
(Maddison and Maddison, 2008) and exported in Nexus format for analyses in PAUP*
4.0b10 (Swofford, 2003). A heuristic maximum parsimony analysis was in performed in
PAUP* using 10,000 random stepwise additions, TBR branch swapping, and with all
characters given equal weight. Branch support was determined using the nonparametric
bootstrap (Felsenstein 1985) with 1000 bootstrap replicates (200 random addition
replicates each) in PAUP* and Bremer support indices in TreeRot.v3 (Sorenson &
F ranzosa 2007). Bremer support was assessed for the entire dataset and for three data

partitions (COI, 28S, and morphology).

RESULTS
The Asidini were recovered as monophyletic with the South American genus
Cardigenius as sister to the North American asidines. The phylogenetic analysis yielded

4 most parsimonious trees (L=3615, CI=O.22, RI=0.47), of which one is show below (Fig

309

3.1). Branches in the tree are colored according to the dorsal habitus of the OTUs and
their visual similarity to the genus Eleodes; red: mimetic, blue: potentially mimetic;
green: precise background matching through encrusting; black: imprecise background
matching, heavily setose, pattern disrupted, or without a potential model.

The phylogeny (Fig. 3.1) indicates that mimetic morphology has evolved multiple
times within the North American asidines. Philolithus (Gonasida) elata, the only mimetic
species that has strong biogeographical and morphological data linking it to a specific
model (Brown 1971a), is far removed from the Stenomorpha species, which have also
been implicated as mirnetic.

The majority of potentially mimetic asidines occur within Stenomorpha. Six of
the species within this genus have been observed exhibiting headstanding behavior, but
data are not currently available for most of the species. Two species, S. (Megasida)
obliterata and S. (Stenomorpha) marginata, have been cited (Slobodchikoff et al. 1987,
Eisner 1966) as inaccurate mimics of specific Eleodes species. Relationships within
Stenomorpha are poorly resolved in the current phylogeny; however the subgenera
Asidina, Asidopsis, Stenomorpha, and T richiasida are clearly not monophyletic. An
expanded analysis using more molecular data may resolve these relationships and
indicate a single origin for mimicry within the clade or provide support for multiple
radiations of mimetic asidines.

The only species in the analysis that displays precise background matching
though the chemical adhesion of soil, P. (Astrotus) regularis, was deeply embedded
within the genus Pelecyphorus. It is not possible in the current analysis to ascertain

whether there is a single or multiple origins for the trait, but the five species known from

310

the subgenus all display a unique set of morphological characters, including the presence
of Astrotus-type stellate setae, and are in all likelihood monophyletic. Thus there is some
evidence that this variation of background matching has evolved only once within the

North American asidines.

DISCUSSION

An examination of the current North American asidine phylogeny indicates that
differing adult defensive strategies have evolved multiple times within the group. Many
of the North American species display cryptic colorations and morphologies to avoid
detection, as do most known asidine species in the rest of the world.

The evolution of precise background matching through the use of chemical
adhesion may be unique to the Pelechrhorus subgenus Astrotus. Varying amounts of
encrusting are seen in other asidine species, particularly members of the Mediterranean
genus Asida and the southern Afiican genera Machla and Amachla, though the
mechanism behind their adhesion is still unclear and all lack the peculiar stellate setae
associated with all Astrotus species.

No species of asidine outside of North America have been implicated as Batesian
mimics of any chemically defended species, while fully half of the North American
asidine species included in the analysis are at least potentially inaccurate mimics of the
genus Eleodes, based on morphology, and seven species have been observed mimicking
the Eleodes warning signal of headstanding. One possible explanation for this
discrepancy is that asidines outside of North America lack potential models that inhabit

approximately the same environmental niche as the potential mimics, occur in high

311

enough densities to be more commonly encountered by predators, and are sufficiently
distasteful to induce an avoidance response in some subset of their potential predators.
The predominance of Eleodes species throughout much of Mexico and the
western United States and the presumed effectiveness of their defensive secretions, in
tandem with the ability of predators to recognize and avoid them based on their
aposomatic morphology and the associated warning display of headstanding, may
provide significant selective pressure for a species to evolve mimetic attributes based
upon the Eleodes model even though Eleodes species are not immune to predation.
Thomas (1979) studied the life history of Eleodes armatus LeConte, a large species that
headstands and sprays its defensive secretions, and found that Hadrurus arizonensis
Ewing, the desert hairy scorpion, easily feeds on E. armatus, although the scorpion’s
behavior is markedly different from its behavior when feeding on other arthropods (Bub
& Bowerman 1979). This study, coupled with the frequency of Eleodes corpses found in
spider webs (personal observation), may indicate that the defensive secretions and
aposomatic signaling employed by Eleodes are less effective against other invertebrates.
Eleodes warning signals do appear to be reasonably effective against vertebrate
predators that hunt by sight (Doyen & Somerby 1974), though some mammalian
predators have devised strategies to overcome Eleodes defenses. For example,
grasshopper mice, Onychomys spp. , grab Eleodes prey and push the beetle’ 3 abdomen
into the ground before consuming them head first (Eisner 1966). Coatis, Nasua spp.,
(Weldon et al. 2006) and striped skunks, Mephitis mephitis, (Slobodchikoff 1978b) will
roll chemically defended arthropods on the ground to wipe away the secretions before

feeding. However, there is potentially an energetic cost associated with handling

312

defended prey and even predators that can neutralize Eleodes secretions seem to prefer
undefended arthropods when given a choice (Doyen 1975, Hetz & Slobodchikoff 1988,
Slobodchikoff et al. 1987).

Other factors that bear consideration are the potentially high opportunity costs
associated with crypsis (Speed and Ruxton 2005). Foraging ranges may be restricted
based on substrate or light levels, as might an organism’s ability to search for a mate.
Thus by removing the need for crypsis, mimics may gain a selective advantage even if
the amount of predation on a species is only moderately diminished.

Of the species that exhibit mimetic morphologies and headstanding behavior, only
Philolithus (Gonasida) elata can be reliably linked to a specific model (E. obscurus) as
both are large (20-35mm) distinctive species and the dorsal patterning in subspecies of
both match throughout much of their overlapping ranges. However, the mimetic or
potentially mimetic Stenomorpha species are difficult to assign to specific models. Most
are phenetically similar (Fig. 3.5) to Eleodes species in the nominate subgenus, which
contains a majority of the Eleodes species. Most Eleodes are exceedingly difficult to
identify at the species level and many are thought to form Mullerian rings (Doyen and
Somerby 1974), so perhaps it is not surprising that Stenomorpha species are not easily
tied to specific model species, though more research is needed to confirm this.

This study is the first to place the evolution of darkling beetle defense strategies in
a phylogenetic context. However, much study is needed to quantify the relationships,
benefits, and costs associated with the defensive strategies observed in the asidine, but

given their diversity they will hopefully provide an excellent model system for further

313

research as we seek to unravel the complexities inherent in animal defensive

mechanisms.

314

- :mlmetic

- 2potentially mimetic

- 2precise background matching
encrusted

2imprecise background matching:

setose, disruptively patterned,
or without a potential model
- 2equivocal

12

AI

S. (Stenomorpha) obovata +HS
S. (Stenomorpha) n.sp.1
S. (Stenomorpha) oostipennis
S. (Asidina) parallela
S. (Platasida) embaphionides
S. (Stenomorpha) rimatus
S. (Stenomorpha) marginata +HS
100 S. (Megasida) tenuioollis 1 +HS
S. (Megasida) tenuioollis 2 +HS
S. (Asidina) oonfluens
S. (Megasida) obliterata +HS
S. (“Pseudoglyptasida“) n.sp.1

99 S. (Asidopsis) mancipata
7 14 8, (Asidopsis) opaca
6 S. (Asidopsis) polita
0 S. (Asidopsis) macra

 
   
   
 
  

  

 

"T

 

 

 

\l
..I.

 

1

 

5

«>8

 

 

 

 

Cardigenius Iaticollis
Branchus n.sp.
Eusattus reticulatus

 

63 S. (Incertae sedls) subvittata
4 S. (Stethasida) obsoleta
2 S. (Asidopsis) divaricata
61

S. (Stenomorpha) luctata
E. (Trichiasida) hlspldula
1 S. (Trichiasida) aoerba

.L

 

96 S. (Asidina) furcata +HS
—E£6: S. (T richiaslda) unicostata
1 S. P cnomo ha) ibbioollis
2 S. {frichiasrfim pIrbeecens

100.— S. (T richiasida) hirsuta 1
23!— S. (T n'chiasida) hirsute 2
100 P. (Stenosides) anastomosls 1
10° 16 P. (Stenosides) anastomods 2
25 P. (Stenosides anastomosis 3
P. (Astrotus) regularis
P. (Zaleucus) dilatatus
Mlcmsdratia rockefelleri
P. (Platasida) longicollis

71
3

 

62 P. (Pelecyphorus) mexicanus
2 4 P. (Ucalegon) pulchellus
55 P. an’odorsus) fasciculatus
3 P. ariodorsus) guanajuatensis

100 P. (Pleslaslda) sexcostata
18 P. (Plesiaslda) n.sp.
Pelecyphorus (Plesiasida) lirata

100 Ardamlmicus cognatoi 1
20

Ardamlmlcus oognatol 2

Philolithus (Glyptasida) aegra

7 Philolithus (Glyptasida) sordlda
Philolithus (P.) aegrotus

Philolithus (P.) actuosus
Philolithus (P.) densicollis

Phllolithus (P.) morbillosus

Philolithus (P.) n.sp.

Philolithus (Gonasida) elata +HS

Heterasida bifurcz

Heterasida connivens

   
 
 
  
 
  
 

25
Craniotus pubescens

Figure 3.1: Phylogeny of the North American Asidini based on 28S, C01, and adult morphology
(58 OTUs, 1252 characters). 1 of 4 most parsimonious trees (L=3615, CI=O.22, RI=0.47) is shown with

 

Bootstrap values listed above the branches and Bremer support shown below the branches. Brown “+ HS"
indicates species known to exhibit headstanding.

315

 

Figure 3.2: Pelecyphorus (Astrotus) alveolatus (Casey); top: encrusted S2, left; cleaned 82, right.
bottom: Astrotus-type stellate setae.

316

 

. ; J" '1. f ‘ .. '.,-‘ff_fi-."

Figure 3.3: Webbing on Pelecyphorus (Astrotus) regularis (Horn) S? , 1-8 hours after emergence.

317

 

Figure 3.4: Philolithus (Gonasida elata difl'ormis (LeConte) 6, left; Eleodes obscurus
sulcipennis Mann. 6, right; both collected AZ: Cochise Co., August 22, 2006.

318

 

Figure 3.5: Stenomorpha convexicollis (LeConte) 9, left; Eleodes longicollis
LeConte 32, right; both collected NM: Luna Co., August 21, 2006.

319

 

LITERATURE CITED

Aalbu, R.L., T.J. Spilman and K.W. Brown. 1995. The systematic status of Amblycyphrus
asperatus, Threnus niger, Pycnomorpha cal ifornica, Emmenastus rugosus, and
Biomorphus tuberculatus Motschulsky (Coleoptera: Tenebrionidae). Proceedings of the
Entomological Society of Washington, 97: 481-488.

Aalbu, RL., C.A. Triplehom, J. M. Campbell, K. W. Brown, R. A. Somerby, and D. B.
Thomas. 2002. Family 106. Tenebrionidae Latreille 1802, p. 463-509. In: American
Beetles. Volume 2. Polyphaga: Scarabaeoidea through Curculionoidea (R. H. Amett, Jr.,
M. C. Thomas, P. E. Skelley, and J. H. Frank, eds.). CRC Press, Boca Raton, FL.

Bates, H. W. 1962. Contributions to an insect fauna of the Amazon valley. Lepidoptera:
Heliconidae. Transactions of the Linnean Society, 232495-566.

Blaisdell, RE. 1923. Expedition of the California Academy of Sciences to the Gulf of
California in 1921. Proceedings of the California Academy of Sciences, 12: 201-288.

Blaisdell, F .E. 1943. Contributions toward a knowledge of the insect fauna of Lower
California, No.7, Coleoptera: Tenebrionidae. Proceedings of the California Academy of
Sciences, 24: 171-287, pls.10-11.

Brown, K.W. 1971a. A population approach to computer taxonomy with applications in
the genus Gonasida (Coleoptera: Tenebrionidae). Ph.D. dissertation, University of
California, Riverside, 317 pp. [unpublished]

Brown, K.W. 1971b. Redefinition of the genera Pelecyphorus and Philolithus with a key
to the genera of the tribe Asidini (Coleoptera: Tenebrionidae). The Coleopterists Bulletin,
252 17-30.

Brown, K. W. 1973. Description of immature stages of Philolithus densicollis and
Stenomorpha puncticollis with notes on their biology (Coleoptera, Tenebrionidae,
Tentyriinae). Postilla, 16221-28.

Brown, K. W. and J. T. Doyen. 1991. Review of the genus Microschatia (Solier)
(Tenebrionidae: Coleoptera). Journal of the New York Entomological Society, 992 539-
582.

Bub, K. and R. F. Bowerman. 1979. Prey capture by the scorpion Hadrurus arizonensis
Ewing (Scorpiones:Vaejovidae). Journal of Arachnology, 7 2243-253.

Canfield, M.R., S. Chang, and N. Pierce. 2009. The double cloak of invisibility:

phenotypic plasticity and larval decoration in a geometrid moth, synchloraflondaria,
across three diet treatments. Ecological Entomology, 34: 412—414.

320

 

Casey, TL. 1912. A revision of the American genera of the tenebrionid tribe Asidini.
Memoirs on the Coleoptera by Thomas L. Casey, 32 70-214.

Casey, TL. 1924. Additions to the known Coleoptera of North America. Memoires of the
Coleoptera by Thomas L. Casey, 11: 1-347.

Champion, G. C. 1884-1893. InzGodman and Salvin, eds., Biologia Centrali-Americana,
Insecta, Coleoptera. Vol. 4, pt. 12 pp. 1-88 [1884]; pp. 89-136 [1885]; pp. 137-264
[1886]; pp. 265-353 [1887]; pp. 354-476 [1888]; pp. 477-524 [1892]; pp. 525-572 and 23
pl. [1893].

Chittka, L. and D. Osorio. 2007. Cognitive dimensions of predator responses to imperfect
mimicry. PLoS Biol, 52 e339.

Cott, H. B. 1940. Adaptive coloration in animals. London, UK: Methuen & Co. Ltd.

Cuthill, LC. and A.T.D. Bennett. 1993. Mimicry and the eye of the beholder. Proceedings
of the Royal Society, Series B, 253: 203—204.

Darwin, C. 1859. On the origin of species by means of natural selection or the
preservation of favoured races in the struggle for life, John Murray, London.

Dittrich, W., F. Gilbert, P. Green, P. McGregor, and D. Grewcock. 1993. Imperfect
mimicry: a pigeon’s perspective. Proceedings of the Royal Society Series B, 251: 195—
200.

Dole, S.A, B.H. Jordal, and A.I. Cognato. 2010. Polyphyly of Xylosandrus Reitter
inferred fi'om nuclear and mitochondrial genes (Coleoptera: Curculionidae: Scolytinae).
Molecular Phylogenetics and Evolution, 542 773—782.

Doyen, J .T. 1966. The skeletal anatomy of T enebrio molitor (Coleoptera: Tenebrionidae).
Miscellaneous Publications of the Entomological Society of America, 52 103-150.

Doyen J .T. 1975. Differential predation of darkling ground beetles by Channel Island fox
(Coleoptera: Tenebrionidae). The Pan-Pacific Entomologist, 50: 86-87.

Doyen, J .T. 1993. Cladistic relationships among pimeliine Tenebrionidae (Coleoptera).
Journal of the New York Entomological Society, 1012 443-514.

Doyen, J. T. and R. E. Somerby. 1974. Phenetic similarity and Mullerian mimicry among
darkling ground beetles (ColeopterazTenebrionidae). Canadian Entomologist, 1062 759-
772.

Doyen, J .T. and W.F. Tschinkel. 1974. Population size, microgeographic distribution and

habitat separation in some tenebrionid beetles (Coleoptera). Annals of the Entomological
Society of America, 672 617-626.

321

Edmunds, M. 2000. Why are there good mimics and poor mimics? Biological Journal of
the Linnaean Society, 70:459—466.

Eisner, T. E. 1966. Beetle's spray discourages predators. Natural History Magazine, 752
42-47.

Eisner, T. and J. Meinwald1966. Defensive secretions of arthropods. Science, 1532 1341-
1 350.

Endler, J .A. 1988. Frequency-dependent predation, crypsis and aposematic coloration.
Philosophical Transactions of the Royal Society of London, Series B, 3192 505—523.

Evenhuis, N.L. 2007. Abbreviations for insect and spider collections of the world
[online] Available from http2//hbs.bishopmuseum.org/codens/codens-inst.html
[accessed 13 March 2010].

Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap.
Evolution, 392 783—791.

Fleming, J. 1821. Insecta, pp. 41—56, Supplement to the fourth, fifth and sixth editions of
the Encyclopedia Britannica. Vol. 5. A. Constable, Edinburgh.

Flores, GE. 1996. Estudio comparativo de las estructuras genitales en la tribu Nycteliini
(Coleoptera: Tenebrionidae). Revista de la Sociedad Entomologica Argentina, 5 52 33-48.

Flores, GE. 1997. Revision de la tribu Nycteliini (Coleoptera: Tenebrionidae). Revista de
la Sociedad Entomologica Argentina, 56: 1-19.

Gebien, H. 1938-1944. Katalog der Tenebrioniden. Mitteilungen der Munchener
Entomological Gesellschaft.Teil II: 28[1938], 283-428 (370-465); 29[1939], 443-474,
739-770 (446-529); 30[1940], 405-436, 755-786, 1061-1092, (530-625); 31[1941], 331-
362, 803-834, 1131-1146 (626-705); 32[1942], 308-346 (706-744). Teil III: 32[1942],
729-760 (746-777); 33[1943], 339-430, 895-926 (778-841); 34[1944], 497-555 (842-
899).

Gilbert, F. 2005. The evolution of imperfect mimicry. In: Fellowes M, Holloway G, Rolff
J, editors. Insect evolutionary ecology. Wallingford: CABI Publishing. pp. 231-288.

Gilbert, M.P.T., W. Moore, L. Melichor, M. Worobey. 2007 . DNA extraction from dry
museum beetles without confening external morphological damage. PLoS One, 22 e272.

Gillespie, J ., J. Cannone, R. Gutell, and A.I. Cognato. 2004. A secondary structural
model of the 28S rRNA expansion segments D2 and D3 from rootworrns and related leaf
beetles (Coleoptera: Chrysomelidae; Galerucinae). Insect Molecular Biology, 13: 495—

5 1 8.

322

 

Grandcolas, P. and C. D'Haese. 2003. Testing adaptation with phylogeny: how to account
for phylogenetic pattern and selective value together. Zoologica Scripta, 32: 483—490.

Harris, R. A. 1979. A glossary of surface sculpturing. Occasional Papers in Entomology
28: 31 pp., 8 plates, 44 figs.

Harlin C., and M. Harlin. 2003. Towards a historization of aposematism. Evolutionary
Ecology, 17: 197-212.

Harper, G. R, Jr. and D. W. Pfennig. 2007. Mimicry on the edge: why do mimics vary in
resemblance to their model in different parts of their geographical range? Proceedings of
the Royal Society Series B, 274: 1955-1961.

Heath, T. A., S.M. Hedtke, and D. M. Hillis. 2008. Taxon sampling and the accuracy of
phylogenetic analyses. Journal of Systematics and Evolution, 46: 23 9—257.

Hedtke, S. M., T.M. Townsend, and D. M. Hillis. 2006. Resolution of phylogenetic
conflict in large data sets by increased taxon sampling. Systematic Biology, 552 522-529.

Hebert, P. D. N., A. Cywinska, s. L. Ball, and J. K deWaard. 2003. Biological
identifications through DNA barcodes. Proceeding Royal Society London. Series B, 2702
313—321.

Hetz, M. and ON. Slobodchikoff. 1988. Predation pressure on an imperfect Batesian
Mirrricry Complex in the presence of alternative prey. Oecologia, 762570—57 3.

Hetz, M. and ON. Slobodchikoff. 1990. Reproduction and the energy-cost of defense in a
Batesian mimicry complex. Oecologia, 842 69—73.

Holm, E. and A. S. Schoeman. 1999. New sub-genera and species of Afrotropical
Acmaeodera Eschscholtz (Coleoptera: Buprestidae). Cimbebasia, 15277-97.

Horn, G.H. 1870. Revision of the Tenebrionidae of America, north of Mexico.
Transactions of the American Philosophical Society, 14: 253-404.

Jordal, B., J .J . Gillespie, and A.I. Cognato. 2008. Secondary structure alignment and
direct optimization of 28S rDNA sequences provide limited phylogenetic resolution in
bark and ambrosia beetles (Curculionidae: Scolytinae). Zoologica Scripta, 37 2 43-56.

Kettlewell, H. B. D. 1955. Selection experiments on industrial melanism in the
Lepidoptera. Heredity 92 323-342.

Lacordaire, J .T. 1859. Histoire Naturelle des Insectes. Genera des Coleopteres. Librarie
Encyclopédique de Roret. Paris, 521-750.

323

LeConte, J .L. 1851. Descriptions of new species of Coleoptera, from California. Annals
of the Lyceum of Natural History of New York, 52 125-216.

LeConte, J .L. 185 3. Descriptions of some new Coleoptera from Texas, chiefly collected
by the Mexican Boundary Commission. Proceedings of the Academy of Natural Sciences
of Philadelphia 62 43 9-448.

LeConte, J .L. 1858a. Descriptions of new species of Coleoptera, chiefly collected by the
United States and Mexican boundary commission, under Major W.H. Emory, U.S.A.
Proceedings Academy of Natural Sciences of Philadelphia, 102 59-89.

LeConte, J .L. 1858b. Catalogue of Coleoptera of the regions adjacent to the boundary
line between the United States and Mexico. J oumal of the Academy of Natural Sciences
of Philadelphia, (2)42 9-42.

LeConte, J .L. 1866a. List of the Coleoptera of North America. Prepared for the
Smithsonian Institution. Part 1. Smithsonian Miscellaneous Collections 6: 50-70.

Maddison, W. P. and DR. Maddison. 2008. Mesquite: a modular system for evolutionary
analysis. Version 2.5 http://mesquitenroiect.org

Merilaita, S., J. Tuomi, and V. Jormalainen. 1999. Optimization of cryptic coloration in
heterogeneous habitats. Biological Journal of the Linnaean Society, 67: 15 1-161.

Matthews E. G. 2000. Origins of Australian arid-zone tenebrionid beetles. Invertebrate
Taxonomy, 14: 941—951.

Moss, R., R.R Jackson, and SD. Pollard. 2006. Hiding in the grass: background
matching conceals moths (Lepidoptera: Crambidae) from detection by spider eyes
(Araneae: Salticidae). New Zealand Journal of Zoology, 332 207-214.

Motschulsky, V. 1870. Enumeration des nouvelles especes de coléoptéres rapportés de
ses voyages. Bulletin de la Société Imperiale des Naturalistes de Moscou 43: 379-407.

Nylander, J. A. A. 2004. MrModeltest v2. Program distributed by the author.
Evolutionary Biology Centre, Uppsala University.

Papp, CS. 1961. Checklist of Tenebrionidae of America north of the Panama Canal.
Opuscules Entomologiques, 26: 97-140.

Poulton , E.B . 1892. Further experiments upon the colour-relation between certain
lepidopterous larvae, pupae, cocoons, and imagines and their surroundings. Transactions
of the Royal Entomological Society of London , 1892 , 293—487 .

Rohland, N., H. Siedel, and M. Hofreiter. 2004. Nondestructive DNA extraction method
for mitochondrial DNA analyses of museum specimens. Biotechniques, 362 814-821.

324

Ronquist, F. and J. P. Huelsenbeck. 2003. MRBAYES 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics, 19: 1572-1574.

Ruxton, G. D., T. N. Sherratt, and M. P. Speed. 2004. Avoiding attack: the evolutionary
ecology of crypsis, warning signals and mimicry. Oxford Univ. Press, Oxford, UK.

Say, T. 1824. Descriptions of Coleopterous insects collected in the late expedition to the
Rocky Mountains, performed by order of Mr. Calhoun, Secretary of War, under the
command of Maj or Long [continuation]. Journal of the Academy of Natural Sciences of
Philadelphia, 32 23 8—282.

Selander, RB. and Vaurie, P. 1962. A gazetteer to accompany the "Insecta" volumes of
the "Biologia centrali-americana". American Museum novitates, no. 2099: 1-70.

Sherratt, T. N. 2002. The evolution of imperfect mimicry. Behavioral Ecology, 13: 821—
826.

Slobodchikoff, C. N. 1978a. Habitat use by coastal mimetic tenebrionid beetles.
American Midland Naturalist, 99: 45-57.

Slobodchikoff, C. N. 1978b. Experimental studies of tenebrionid beetle predation by
skunks. Behaviour, 662 313-322.

Slobodchikoff, C. N., T. A. Vaughan, and R. M. Warner. 1987. How Prey Defenses
Affect a Predator's Net Energetic Profit. Journal of Marnmalogy, 682 668-671.

Solier, A. 1836. Essai d’une Révision des Coléoptéres Hétéromeres et d’une
monographie de la famille des Collaptérides. Annales de la Société entomologique de
France, 5: 403—5 12.

Sorenson, MD. and EA. Franzosa 2007. TreeRot, version 3. Boston University, Boston,
MA.

Speed MP, and GD. Ruxton. 2005. Aposematism: what should our starting point be?
Proceedings of the Royal Society, Series B, 2722431—438.

Swofford, D.L. 2003. Paup“. Phylogenetic Analysis Using Parsimony (*and Other
Methods), version 4. Sinauer Associates, Sunderland, Massachusetts.

Tamura, K., J. Dudley, M. Nei, and S. Kumar. 2007. MEGA42 Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 242
1 596-1599.

Thomas, D. B. 1979. Patterns in the abundance of some tenebrionid beetles in the Mojave
Desert. Environmental Entomology, 82 568-574.

325

Thomas, DB. 1984. The Life History and Ecology of the Pinacate Beetle, Eleodes
armatus Leconte (Tenebrionidae). The Coleopterists Bulletin, 382 150-159.

Thompson, J .D., D.G. Higgins, and T.J. Gibson. 1994. CLUSTALW: improving the
sensitivity of progressive multiple sequence alignment through sequence weighting,
position specific gap penalties and weight matrix choice. Nucleic Acids Research, 222
4673—4680.

Triplehom, CA. 1972. A Review of the Genus Zopherus of the World (Coleoptera:
Tenebrionidae). Smithsonian Contributions to Zoology, 108: 1-24.

Triplehom, CA. and K.W. Brown. 1971. A synopsis of the species of Asidina in the
United States with description of a new species from Arizona (Coleoptera:
Tenebrionidae). The Coleopterists Bulletin, 25: 73-86.

Triplehom, C.A., D.B. Thomas, and E.G. Riley. 2009. The genus Eleodes Eschscholtz
(Coleoptera: Tenebrionidae) in Texas. The Coleopterists Bulletin, 632 413-437.

Tschinkel, W.R. 1975a. A comparative study of the chemical defensive system of
tenebrionid beetles: chemistry of the secretions. Journal of Insect Physiology, 21: 753-
783.

Tschinkel, W. R 1975b. A comparative study of the chemical defensive system of
tenebironid beetles. 11. Defensive behavior and ancillary features. Annals of the
Entomological Society of America, 68: 439-453.

Tschinkel, W. R 1975c. A comparative study of the chemical defensive system of
tenebrionid beetles. III. Morphology of the glands. Journal of Morphology, 1452 355-370.

Tschinkel, W.R. and J .T. Doyen. 1980. Comparative anatomy of the defensive glands,
ovipositors and female genital tubes of tenebrionid beetles (Coleoptera). International
Journal of Insect Morphology and Embryology, 9: 321-368.

Weldon, P.J., C. F. Cranmore, and J. A. Chatfield. 2006. Prey-rolling behavior of coatis
(Nasua spp.) is elicited by benzoquinones fi'om millipedes. Naturwissenschafien, 932 14—
16.

Wheeler, Q.D. and NI. Platnick. 2000. The phylogenetic species concept (sensu Wheeler
and Platnick). pp. 55-69. In: Q.D. Wheeler and R. Meier (editors). Species concepts and
phylogenetic theory: A Debate. Columbia University Press; New York, NY. 230 p.

Wilke, S. 1922. Beitrage zur Systematik und geographischen Verbreitung ungeflugelter
Tenebrioniden (U nterfarn-Asidinae). Archiv filr Natrrrgeschichte, 122 248-312.

326

ll
Ill
1
l
'l
[Ill

 

.....

...-