EXPLORING THE ROLE OF THE GR/RTE1 FAMILY IN ETHYLENE
SIGNALING
By

Qian Ma

A DISSERTATION
Submitted to
Michigan State University
In partial fulfillment of the requirements
For the degree of
DOCTOR OF PHILOSOPHY
Plant Breeding, Genetics, and Biotechnology-Horticulture
2012

ABSTRACT
EXPLORING THE ROLE OF THE GR/RTE1 FAMILY IN ETHYLENE SIGNALING
By
Qian Ma
The gaseous plant hormone ethylene influences many aspects of plant development and mediates
responses to biotic and abiotic stresses. A framework of the ethylene signaling pathway has been
assembled using a combination of genetic and biochemical analysis in Arabidopsis (Arabidopsis
thaliana) although this pathway is not completely understood. Furthermore, ethylene influences
developmental processes and responses to environmental challenges that are not part of the
Arabidopsis life cycle. Mutation at the Green-ripe (Gr) and reversion to ethylene sensitivity 1
(rte1) loci, which encode homologous proteins of unknown biochemical function, influence
ethylene responses in tomato (Solanum lycopersicum) and Arabidopsis thaliana, respectively. In
Arabidopsis, RTE1 is required for function of the ETR1 ethylene receptor and acts
predominantly through this receptor isoform via direct protein-protein interaction. In tomato,
mutation at the Gr locus causes ectopic expression of GR leading to reduced ethylene
responsiveness in a subset of tissues, which can be recapitulated by over-expression of GR
driven by the CaMV35S promoter. The tomato genome contains two additional GR homologs
designated GREEN RIPE LIKE 1 (SlGRL1) and GREEN RIPE LIKE 2 (SlGRL2), whose function,
and role in ethylene signaling remain unknown.
In this study, the potential role of SlGRL1 and SlGRL2 in ethylene signaling was investigated
together with their relationship to SlGR and RTE1 of Arabidopsis. SlGR, SlGRL1 and SlGRL2 are
differentially expressed during development and in response to ethylene treatment and each
protein is predominantly localized in the Golgi. A combination of over-expression in tomato and

complementation of the rte1-3 mutant allele indicates that SlGR and SlGRL1 influence distinct
ethylene responses suggesting the existence of separate ethylene-signaling modules in tomato
that are influenced either individually by SlGR or SlGRL1 or together by both proteins. In
contrast, over-expression of SlGRL2 in tomato did not reveal any altered ethylene-related
phenotypes suggesting that this gene may not be involved in ethylene signaling. Interestingly,
over-expression of AtRTE1 in tomato leads to reduced ethylene responsiveness in a subset of
tissues, which more closely resemble the SlGRL1 lines than SlGR lines.
Phylogenetic and sequence analysis indicated an expansion of the GR/RTE1 family within the
Solanaceae family of the eudicot lineage. Typically eudicot species contain a single gene closely
related to AtRTE1 and SlGRL1. In contrast, members of the Solanaceae family contain a second
more divergent gene, defined by SlGR that appears to be restricted to this plant family.
Furthermore, putative GR orthologs are relatively divergent when compared to putative
GRL1orthologs of the Solanaceae family leading to the hypothesis that they may exhibit altered
functional properties. This hypothesis was confirmed through over-expression of putative GR
orthologs in tomato and through complementation of the rte1-3 mutant allele. Utilizing a
comparative approach, a series of amino acid residues were identified that correlate with the
ability of the Solanaceae GR and GRL1 proteins to complement the rte1 mutant phenotype and
these were tested through the expression of synthetic constructs which carry altered amino acids
leading to the identification of a set of 10 amino acids that are important for the ability of
Solanaceae GR and GRL1 orthologs to complement the rte1 mutant phenotype. Together, these
data provide considerable new insight into the role of the GR/RTE1 family in controlling
ethylene responses in plants.

ACKNOWLEDGMENTS

I would like to thank my advisor, Dr. Cornelius Barry, for providing me with interesting research
projects, and for continuous support for my study, research, and writing of this thesis. I also
would like to express my gratitude to my committee members, Dr. Rebecca Grumet, Dr. Wayne
Loescher, Dr. Federica Brandizzi, for their encouragement, insightful comments, and help
throughout my graduate studies.

I also want to thank all past and present members of the Barry lab for their help and support: Dr.
Eliana Gonzales-Vigil, Dr. Sungbeom Lee, Swathi Nadakuduti, Krystle Wiegert, Matt Bedewitz,
David E. Hufnagel, Bill Holdsworth, Julia Miller, Priyanka Pandey, and Michael Mazur.

I sincerely thank the laboratory of Dr. Jim Giovannoni at the Boyce Thompson Institute for Plant
Research and in particular, Dan Spatt and Patricia Keen for their expertise in performing tomato
transformations and Ruth White, Dr. Julia Vrebalov (Boyce Thompson Institute for Plant
Research) and Dr. Teh-hui Kao (Penn State University) for access to BAC library resources. I
also thank Dr. Caren Chang (University of Maryland) for providing etr1-2 and etr1-2/rte1-3
seeds of Arabidopsis.

Special thanks to my friends, Dr. Guo-qing Song, Dr. Veronia A Vallejo, Wenyan Du, Dongyan
Zhao, Dongmei Yin, Carolina Contreras, Ann Armenia, Jessica Taft, and Dr. Menghan Liu for
helping me get through the difficult times, and for their help with my comprehensive
examination and my experiments.
iv

I also thank Dr. Melinda Frame (MSU Center for Advanced Microscopy) and Wenyan Du for
their help with confocal microscopy, and the Dr. Jeff Landgraf (MSU Research Technology
Support Facility) for his help with qRT-PCR.

I would like to thank Dr. Dave Douches and Dr. Guo-qing Song for their help and patience when
I worked with them as a teaching assistant.

I thank the Plant Breeding, Genetics, and Biotechnology program and the Department of
Horticulture for offering me the opportunity to study at Michigan State University. I thank the
faculty, staff, and students of the Plant Breeding, Genetics, and Biotechnology program and the
Department of Horticulture for their help and support throughout my study at MSU.

I am deeply thankful to my parents, parents in law, brother, husband and my son for their
complete understanding, encouragement and support.

v

TABLE OF CONTENTS

LIST OF TABLES. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ix
LIST OF FIGURES. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .x
LIST OF ABBREVIATIONS. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xii
Chapter 1 Introduction- Exploring the role of the GR/RTE1 family in ethylene signaling. . . . . .1
Advances in plant hormone biology. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .2
The role of ethylene in plant development. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .4
The role of ethylene in fruit ripening and its control in horticultural crops. . . . . . . . . . . . . .6
The regulation of ethylene biosynthesis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .10
Ethylene signaling in Arabidopsis. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
Genetic screens for identifying ethylene signaling mutants . . . . . . . . . . . . . . . . . . . .13
Ethylene receptors in Arabidopsis and ethylene perception . . . . . . . . . . . . . . . . . . . .14
An endomembrane localized ethylene signaling complex . . . . . . . . . . . . . . . . . . . . .17
Ethylene signaling events in the nucleus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 21
A model for ethylene signaling in Arabidopsis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
Ethylene receptor signaling in diverse plant species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27
Downstream ethylene signaling components in diverse plant species . . . . . . . . . . . . . . . . 31
GR/RTE1 family proteins regulate a subset of ethylene responses . . . . . . . . . . . . . . . . . . .35
Hypothesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .36
Thesis rationale and overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .37
References. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .42
Chapter 2 Functional divergence of SlGR, SlGRL1, SlGRL2 and AtRTE1. . . . . . . . . . . . . . . . . .72
Abstract. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 74
Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 77
Over-expression of SlGRL1 in tomato does not recreate the Gr mutant phenotype but
influences a subset of ethylene responses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .77
Combining Gr with CaMV35S::SlGRL1 enhances ethylene insensitivity in a subset of
responses. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
Over-expression of SlGRL2 in tomato does not confer reduced ethylene
responsiveness . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .80
Over-expression of AtRTE1 in tomato does not confer reduced ethylene
responsiveness in all plant tissues. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
SlGR is unable to fully complement the rte1 mutant phenotype. . . . . . . . . . . . . . . . .81
Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
Variation
in
ethylene
signaling
components
and
evidence
for
subfunctionalization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83
Evidence for the existence of distinct ethylene signaling modules in tomato . . . . . 106
vi

SlGRL2 is unlikely to play a role in ethylene signaling . . . . . . . . . . . . . . . . . . . . . . 108
Materials and methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .108
Plant growth and treatments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
qRT-PCR analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .110
DNA constructs and plant transformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111
DNA sequence analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 113
Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .113
References. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .114
Chapter 3 Exploring putative functional domains in GR/RTE1 proteins . . . . . . . . . . . . . . . . . 120
Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 121
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122
Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126
Putative SlGR orthologs within the eudicot lineage are restricted to the Solanaceae
family . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 126
Over-expression of PhGR in tomato phenocopies the Never-ripe mutant . . . . . . . .127
PhGR and SmGR can complement the rte1-3 loss of function in Arabidopsis . . . . 128
Identification of amino acids within the GR proteins required for complementation of
the rte1-3 mutant allele . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .129
The last 9 amino acids of SlGRL1 including the highly conserved tyrosine and lysine
residues are not required for the ability of SlGRL1 to complement the rte1-3
allele . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 131
Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132
Variation in gene copy number and functional heterogeneity of the GR/RTE1 family
in plants . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 132
Utilizing a comparative approach to identify functional amino acids in GR/RTE1
proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 134
The functional importance of membrane-spanning domains within GR/RTE1
proteins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 137
Materials and methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .138
Plant materials and growth conditions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 138
Bacterial artificial chromosome library screening and isolation of genomic and cDNA
clones . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 139
qRT-PCR analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .140
DNA constructs and plant transformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141
DNA sequence, phylogenetic analysis, and multiple sequence alignments . . . . . . .143
Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .144
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
Chapter 4 Gene expression analysis and subcellular localization of GR/RTE1 proteins . . . . . 181
Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 182
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 183
Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
SlGR, SlGRL1 and SlGRL2 are differentially expressed during tomato
development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
vii

SlGR, SlGRL1 and SlGRL2 are differentially expressed in response to ethylene, but
not in response to wounding . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .188
Transient expression of YFP-gene fusions in tobacco suggests that GR/RTE1 related
proteins are localized to the Golgi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 189
Predominant Golgi localization of SlGR, SlGRL1, and PhGR proteins was confirmed
by stable expression in Arabidopsis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 190
Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 191
Differential expression of the GR/RTE1 family of tomato. . . . . . . . . . . . . . . . . . . . 191
Discrepancies in the subcellular localization of the GR/RTE1 family . . . . . . . . . . .193
The potential for interaction between GR/RTE1 family proteins and the tomato
ethylene receptors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .194
Materials and methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .195
Plant growth and treatment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195
qRT-PCR analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .197
Construct assembly . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .198
Transient expression in Nicotiana tabacum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
Stable expression in Arabidopsis thaliana . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 199
Confocal laser scanning microscopy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 200
DNA sequence analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 201
Statistical analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .201
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 222
Chapter 5 Conclusions and future directions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 229
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 230
Discrepancies in the subcellular localization of GR/RTE1 proteins . . . . . . . . . . . . . . . . .231
Potential protein-protein interactions between the GR/RTE1 family and the ethylene
receptors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .233
Identifying amino acid residues and domains of GR/RTE1 proteins that are important for
their functional characteristics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .234
GR/RTE1 proteins have an undefined biochemical functions . . . . . . . . . . . . . . . . . . . . . .235
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 237

viii

LIST OF TABLES

Table 2.1 Statistical analysis of the seedling triple response assay in CaMV35S::SlGRL1 lines of
tomato . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 97
Table 2.2 Statistical analysis of the seedling triple response assay in Gr ×35S::SlGRL1 line of
tomato. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
Table 2.3 Statistical analysis of the seedling triple response assay in SlGRL2 over-expression
lines of tomato. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .99
Table 2.4 Statistical analysis of the seedling triple response assay in CaMV35S::AtRTE1 lines of
tomato. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100
Table 2.5 Statistical analysis of the seeding triple response assay in etr1-2/rte1-3 lines of
Arabidopsis transformed with either CaMV35S::MYC-SlGR or CaMV35S::MYC-SlGRL1. . . .101
Table 2.6 Oligonucleotide primers used in this study. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 103
Table 3.1 GR/RTE1 family proteins utilized for phylogenetic analysis . . . . . . . . . . . . . . . . . . .164
Table 3.2 Percent amino acids identity between GR and GRL1 related proteins from selected
Solanaceae species. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .167
Table 3.3 Statistical analysis of the seeding triple response assay in etr1-2/rte1-3 lines of
Arabidopsis transformed with either CaMV35S::MYC-PhGR or CaMV35S::MYC-SmGR. . . . 168
Table 3.4 Statistical analysis of the seedling triple response assay in CaMV35S::PhGR lines of
tomato. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169
Table 3.5 Oligonucleotide primers used in this study. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
Table 4.1 Oligonucleotide primers used in this study. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 220

ix

LIST OF FIGURES

Images in this dissertation are presented in color.

Figure 1.1 A model of the proposed ethylene signaling pathway in Arabidopsis in the presence
and absence of ethylene. Pathway connections that are currently disputed in the literature are
indicated by dashed lines. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
Figure 1.2 Phylogenetic analysis of GR/RTE1 family proteins (Barry and Giovannoni, 2006).
At2G26070 and At3G51040 correspond to RTE1 and RTH of Arabidopsis, respectively. . . . . .41
Figure 2.1 Phenotypic evaluation of SlGRL1 over-expression lines of tomato . . . . . . . . . . . . . . 85
Figure 2.2 Petiole epinasty in response to ethylene in CaMV35S::SlGR lines . . . . . . . . . . . . . . .87
Figure 2.3 Phenotypic analysis of SlGRL1 over-expression in the Gr mutant background . . . . .88
Figure 2.4 Analysis of ethylene responses in CaMV35S::SlGRL2 lines . . . . . . . . . . . . . . . . . . . 90
Figure 2.5 Phenotypic evaluation of AtRTE1 over-expression lines of tomato . . . . . . . . . . . . . . 92
Figure 2.6 Differential complementation of the Arabidopsis rte1-3 allele by SlGR and
SlGRL1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94
Figure 2.7 Differential complementation of rte1-3 by untagged versions of SlGR and
SlGRL1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 96
Figure 3.1 Phylogenetic analysis of the GR/RTE1 family of proteins . . . . . . . . . . . . . . . . . . . .145
Figure 3.2 Phenotypic analysis of PhGR over-expression lines of tomato . . . . . . . . . . . . . . . . .147
Figure 3.3 Complementation of the Arabidopsis rte1-3 allele by PhGR and SmGR . . . . . . . . . 149
Figure 3.4 Amino acid alignments highlighting conserved amino acids in Solanaceae orthologs
of SlGR and SlGRL1 that correlate with the ability to complement the rte1 mutant
phenotype . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 151
Figure 3.5 Complementation of the Arabidopsis rte1-3 allele by SlGR-PhGR . . . . . . . . . . . . . 153
Figure 3.6 Complementation of the Arabidopsis rte1-3 allele by SlGR-SmGR . . . . . . . . . . . . .155
x

Figure 3.7 The C-terminus of SlGR is important for conferring ethylene-insensitivity . . . . . . .157
Figure 3.8 Complementation of the Arabidopsis rte1-3 allele by SlGRL1Δ9 . . . . . . . . . . . . . . 158
Figure 3.9 Complementation of the Arabidopsis rte1-3 allele by SlGRL1Y235A . . . . . . . . . . . 160
Figure 3.10 Complementation of the Arabidopsis rte1-3 allele by SlGRL1K238A . . . . . . . . . . 162
Figure 4.1 Expression of SlGR, SlGRL1 and SlGRL2 during tomato development . . . . . . . . . 202
Figure 4.2 Expression of SlGR, SlGRL1 and SlGRL2 in response to ethylene and wounding . .206
Figure 4.3 Subcellular localization of SlGR, SlGRL1, and SlGRL2 in tobacco epidermal leaf
cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208
Figure 4.4 Subcellular localization of PhGR, PhGRL1, and SmGR in tobacco leaf epidermal
cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 210
Figure 4.5 Differential complementation of rte1-3 by YFP-tagged versions of SlGR, SlGRL1, and
PhGR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .212
Figure 4.6 Lack of co-localization of SlGR, SlGRL1, and PhGR with an ER membrane marker
line in Arabidopsis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 214
Figure 4.7 Subcellular localization of SlGR, SlGRL1, and PhGR at the Golgi membrane in
Arabidopsis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .216
Figure 4.8 SlGR, SlGRL1, and PhGR are not associated with the trans-Golgi network
(TGN) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 218

xi

LIST OF ABBREVIATIONS

1-MCP – 1-methylcyclopropene
35S – Cauliflower mosaic virus 35S promoter
ACC – 1-aminocyclopropane-1-carboxylic acid
ACO – ACC oxidase
ACS – ACC synthase
bar – BASTA resistant
BIFC – Bimolecular fluorescence complementation
BLAST – Basic Local Alignment Sequence Tool
bp – base pairs
Col-0 – Columbia ecotype 0
C-terminus – Carboxy terminus
e.g. – example
EMS – Ethyl methanesulfonate
ER – Endoplasmic reticulum
GFP – Green fluorescent protein
MET – methionine
NCBI – National Center Biotechnology Information
N-terminus – Amino terminus
PCR – Polymerase Chain Reaction
UBQ – Ubiquitin
YFP – Yellow fluorescent protein
xii

Chapter 1 Introduction - Exploring the role of the GR/RTE1 family in ethylene signaling

1

Advances in plant hormone biology

Plant hormones are small molecules that regulate multiple aspects of plant growth and
development together with a variety of responses to biotic and abiotic stresses. Nine major
classes of plant hormones have been identified and characterized in depth: abscisic acid (ABA),
ethylene, cytokinins (CKs), auxins, gibberellins (GAs), jasmonoyl-isoleucine (JA-Ile),
brassinosteroids (BRs), salicylic acid (SA), and strigolactones (SLs) (Browse, 2005; Vert et al.,
2005; Loake and Grant, 2007; Gomez-Roldan et al., 2008; Umehara et al., 2008). Over the past
20 years, significant progress has been made in understanding the mechanisms of plant hormone
biosynthesis and signaling. Much of this progress is due to the adoption of Arabidopsis thaliana
as a model system for studying plant hormone biology. In particular, the ability to perform
genetic screens for altered hormone responses on large numbers of mutagenized seeds coupled
with the ability to rapidly progress from mutant phenotype to isolation of candidate gene has
revolutionized understanding of the mechanisms plant hormone signaling and biosynthesis
(Meyerowitz and Pruitt, 1985; Estelle and Somerville, 1986; Meyerowitz, 1987, 2001; Browse,
2009; Lin et al., 2009; Morant et al., 2010).

Although each hormone has varied roles and mediates different responses, several share common
biosynthetic origins and action mechanisms. For example, ethylene, auxin, salicylic acid and
jasmonoyl-isoleucine are derived from the amino acids methionine, tryptophan, phenylalanine,
and isoleucine, respectively (Wichner and Libbert, 1968; Owens et al., 1971; Hanson and Kende,
1976; MauchMani and Slusarenko, 1996; Staswick and Tiryaki, 2004). In addition,
strigolactones and abscisic acid are isoprenoids derived from carotenoids (Parry and Horgan,
1992; Tan et al., 1997; Matusova et al., 2005). Common regulatory processes also control
2

aspects of hormone signaling and biosynthesis. For example, protein phosphorylation plays a
role in the signaling of several hormones including abscisic acid, brassinosteroids, cytokinin and
ethylene (Kieber et al., 1993; Eckardt, 2005; Mahonen et al., 2006; Fujii et al., 2007; Yoo et al.,
2008). The ubiquitin-proteasome system has also emerged as an important regulatory mechanism
that controls the perception, signaling and biosynthesis of nearly all the major plant hormones
and often acts at multiple steps within these pathways (Moon et al., 2004; Santner and Estelle,
2010; Wang and Deng, 2011). F-box proteins serve directly as hormone receptors in the case of
auxin and JA-Ile, as components of the receptor complex for gibberellins, or at the control of
turnover of receptors or additional signaling components in the case of ethylene and
strigolactones and ABA (Stirnberg et al., 2002; Guo and Ecker, 2003; Potuschak et al., 2003;
Wang et al., 2004; Dharmasiri et al., 2005; Kepinski and Leyser, 2005; Zhang et al., 2005;
Griffiths et al., 2006; Stone et al., 2006; Thines et al., 2007; Christians et al., 2009; Qiao et al.,
2009).

Although classic physiological experiments defined specific roles for individual hormones, it is
widely accepted that plant hormones do not act in isolation but are interrelated by synergistic or
antagonistic cross-talk. This crosstalk between hormones can occur at the level of biosynthesis,
transport and signal transduction. For example, ethylene, jasmonate, and auxin are involved in
the apical hook development. Jasmonate inhibits hook formation in a COI1-dependent manner
(Ellis and Turner, 2002). Ethylene causes apical hook development by increasing HOOKLESS1
(HLS1) mRNA level (Lehman et al., 1996; Li et al., 2004). HLS1 decreases AUXIN
RESPONSE FACTOR 2 (ARF2) protein level, which is an auxin response transcription factor,
required for apical hook formation (Li et al., 2004). Similarly, GA and ABA have antagonistic

3

effects on cell expansion which is mediated through GA and ABA alteration in stability of the
DELLA regulatory protein, whereby ABA increases the stability of the DELLA protein RGA,
while GA promotes its degradation (Achard et al., 2006). As a result, ABA suppresses GAinduced cell expansion. Multiple hormones are also known to interact to stimulate the onset of
senescence and fruit ripening (Fischer, 2012). For example, ethylene, ABA and JA-Ile are known
to stimulate the onset of senescence whereas cytokinins and GA treatment can delay the onset of
senescence.

The role of ethylene in plant development

Manipulation of ethylene to influence crop quality has been used for centuries. The ancient
Egyptians would gash figs in order to stimulate ripening whereas the Chinese would burn
incense in closed rooms to enhance the ripening of pears (Abeles et al., 1992). In the nineteenth
century, it was observed that leaks from illuminating coal gas caused defoliation of trees. In
1901, Neljubov discovered that the active component of these leaks was ethylene, demonstrating
that ethylene caused the horizontal growth of etiolated pea seedlings, compared with the typical
vertical growth of seedlings in air (Abeles et al., 1992). Doubt discovered that ethylene
stimulated abscission in 1917 and in 1924, Denny demonstrated that smoke from kerosene
combustion in lanterns used to de-green citrus fruits contained ethylene as the active ingredient
and demonstrated that ethylene is a fruit-ripening agent that can act at very low concentrations
(Doubt, 1917; Denny, 1924). Ethylene synthesis by plant material was first demonstrated in
apple fruit suggesting that ethylene may have a natural role in plant tissues rather than simply
acting as an exogenous compound that can elicit responses in plant tissues (Gane, 1934). In

4

1962, it was reported that applied ethylene hastens mango ripening even after the climacteric has
begun (Burg and Burg, 1962). These results demonstrated that fruit ripening is related with the
production and action of ethylene.

Ethylene is now known to regulate a wide range of physiological responses (Abeles et al., 1992;
Bleecker and Kende, 2000; Guo and Ecker, 2004). For example, ethylene influences leaf
epinasty, induces lateral cell expansion, inhibits nodulation, promotes leaf and flower
senescence, breaks seed and bud dormancy in some species, induces fruit ripening and abscission
(Goodlass and Smith, 1979; Abeles et al., 1992; Lee and Larue, 1992; Bleecker and Kende,
2000; Guo and Ecker, 2004). Ethylene promotes internode and petiole elongation of submerged
aquatic species (Kende et al., 1998; Sauter, 2000). An agriculturally important example is rice
(Oryza sativa). Submergence retards ethylene diffusion (Jackson, 1985). Ethylene enhances plant
sensitivity to GA causing cell elongation and cell division, and suppresses ABA accumulation,
which is a negative regulator of shoot elongation (Hoffmann-Benning and Kende, 1992; Azuma
et al., 1995). As a result, submergence induces rapid internode elongation of submerged rice
(Kende et al., 1998; Benschop et al., 2006). Ethylene induces adventitious root formation in
leaves and vegetative stems, and suppression of ethylene sensitivity reduces adventitious root
formation in petunia leading to cuttings that have reduced rooting capacity and poor horticultural
performance (Phatak et al., 1981; Robbins et al., 1983; Gubrium et al., 2000). In Arabidopsis,
ethylene induces root hair formation at atypical positions of the root and inhibitors of ethylene
action, i.e., silver ions (Ag+) or the ethylene biosynthesis inhibitor, aminoethoxyvinylglycine
(AVG) inhibit root hair formation (Masucci and Schiefelbein, 1994; Tanimoto et al., 1995; Cao
et al., 1999; Dolan, 2001). Ethylene induces flowering in pineapple (Ananas comosus Merr.) and

5

its relatives (Burg and Burg, 1966). In agricultural applications, pineapple trees are normally
sprayed with an ethylene-releasing compound, e.g. 2-chloroethanephosphonic acid, to
synchronize flowering (Cooke and Randall, 1968). Ethylene also influences sex expression in
some species, particularly cucurbits. For example, ethylene promotes formation of female
flowers in cucumber, melon, and squash (McMurray and Miller, 1968; Rudich et al., 1969;
Augustine et al., 1973; Takahashi et al., 1983; Papadopoulou et al., 2005). The developmental
fate of flowers in these plants is not only affected by the exposed ethylene amount at the time of
sex determination, but also affected by the perceptiveness sensitivity of specific floral organs to
ethylene (Yin and Quinn, 1992, 1995; Little et al., 2007). In melon, ethylene perception
sensitivity of the stamen (or petal) primordial, is critical in promoting femaleness (carpel
development) (Little et al., 2007). Ethylene is also well known to regulate responses to biotic
stresses (for example, pathogen infection) and abiotic stresses, such as wounding, hypoxia,
ozone, chilling, or freezing (Abeles et al., 1992; Bleecker and Kende, 2000; Guo and Ecker,
2004).

The role of ethylene in fruit ripening and its control in horticultural crops

During fruit ripening, a series of biochemical changes occur, which typically include softening,
starch hydrolysis, sugar accumulation, formation of brightly colored pigments, production of
aroma volatiles and the disappearance of organic acids and phenolic compounds, and loss of
chlorophyll (Adams-Phillips et al., 2004; Giovannoni, 2004; Barry and Giovannoni, 2007).
These biochemical changes convert an unpalatable fruit into one that is desirable for animal
consumption and therefore facilitate seed dispersal.

6

Depending on the ability to undergo a transient increase in respiration and ethylene biosynthesis
at the onset of fruit ripening, fruits are classified as climacteric or non-climacteric (Biale, 1964;
Abeles et al., 1992). Climacteric fruits, including apple, banana, peach, and tomato, undergo a
significant transient increase in respiration that signifies the onset of ripening (Burg and Burg,
1962, 1965). Treatment with ethylene can stimulate the respiratory climacteric and the rate of
ripening in climacteric fruits and climacteric fruits are able to ripen off the vine (Burg and
Thimann, 1959; Adato and Gazit, 1977; Karikari et al., 1979; Woodrow and Rowan, 1979). In
contrast, non-climacteric fruits which include citrus, grapes and strawberries do not ripen off the
vine and show no significant increase in respiration and ethylene production during ripening
(Biale, 1964; Aharoni, 1968; Abeles et al., 1992). However, when exposed to exogenous
ethylene, some non-climacteric fruits show enhanced respiration rates and can respond to
ethylene through changes in gene expression and biochemical properties, including pigment
changes (Stewart and Wheaton, 1972; Purvis and Barmore, 1981; Goldschmidt et al., 1993; ElKereamy et al., 2003; Katz et al., 2004).

Several physiological, biochemical and genetic studies have illustrated the important role of
ethylene in regulating fruit ripening. Fruit ripening is inhibited by ethylene synthesis inhibitors
including AVG and Aminooxyacetic acid (AOA) and ethylene action inhibitors including Ag+
and 1-methylcyclopropene (1-MCP) (Sisler and Serek, 1997; Rogiers et al., 1998; Saltveit, 2005;
Kumar et al., 2009). Suppression of ethylene biosynthesis by antisense RNA to 1aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) and ACC oxidase (ACO) also
represses fruit ripening in tomato and other species (Hamilton et al., 1990; Oeller et al., 1991;

7

Picton et al., 1993; Ayub et al., 1996; Flores et al., 2001; Flores et al., 2002; Dandekar et al.,
2004; Silva et al., 2004; Lopez-Gomez et al., 2009; Hao et al., 2011). The tomato ethylene
receptor mutant Never-ripe (Nr) displays a dramatic inhibition of fruit ripening and overexpression of a dominant negative mutant form of the Arabidopsis ETR1 ethylene receptor also
inhibits fruit ripening in tomato (Wilkinson et al., 1995; Wilkinson et al., 1997).

Variation in ethylene biosynthesis and signaling also impacts fruit ripening in apple and peach
and melon. For example, MdACS1-1 and MdACS1-2 are alleles ACS1 that are present in the
Golden Delicious cultivar of apple (Sunako et al., 1999). A short interspersed DNA element
(SINE) is specific in the 5' region of MdACS1-2, which prevents MdACS expression at the onset
of apple fruit ripening (Sunako et al., 1999). As a result, apple cultivars that are homozygous for
the MdACS1-2 allele have reduced ACS1 expression, lower ethylene production, and enhanced
storage properties (Harada et al., 2000; Oraguzie et al., 2004; Sato et al., 2004). In addition, a
second apple ACS gene, MdACS3, also influences fruit ripening in apple (Wang et al., 2009).
Three MdACS3 alleles have been identified in apple. MdACS3a represents the functional allele
and MdACS3a-G289V and Mdacs3a are non-functional (Wang et al., 2009). In MdACS3aG289V, an amino acid substitution (glycine-289/valine) lies within the active site of the enzyme
and is catalytically inactive whereas Mdacs3a is a null allele whose molecular basis remains
unclear. Apple cultivars homozygous or heterozygous for the mutant alleles, show reduced
ripening-related gene expression and maintain fruit firmness (Wang et al., 2009). For example,
Kitaro and Koukou that contain Mdacs3a/MdACS3a-G289V, have much lower ethylene
production and longer fruit shelf life than Kotaro and Gala that contain MdACS3a/MdACS3aG289V (Wang et al., 2009).

8

Similar natural variation in ethylene biosynthesis occurs in peach cultivars carrying recessive
stony hard (hd) mutation, PpACS1 expression is eliminated in hd varieties during ripening
causing reduced softening (Haji et al., 2001; Tatsuki et al., 2006). Although the mechanism
underlying the hd phenotype is unclear, it is possible that a SNP or small deletion or insertion
may disrupt a ripening-specific transcription factor binding site in the PpACS1 promoter or that
the hd phenotype may be caused by a mutation in a ripening-specific transcription factor (Tatsuki
et al., 2006). Melon is a phenotypically diverse fruit crop. Cantaloupe type of melons are
climacteric fruit, whereas Honey Dew type of melons are nonclimacteric, and produce little or no
ethylene during ripening (Miccolis and Saltveit, 1991; Hadfield et al., 1995). Genetic analysis of
a population of recombinant cantaloupe Charentais × PI 161375 (a nonclimacteric melon) inbred
lines indicated that fruit abscission and ethylene production were controlled by two recessive
independent loci designated Abscission layer (Al)-3 and Al-4 (Zheng and Wolff, 2000; Perin et
al., 2002). The relationship between these two loci and ethylene production and sensitivity
remains to be defined.

Controlling the effects of ethylene is important in horticultural crops both to stimulate ripening
and improve quality, but also to control the rate of ripening and prevent over-ripening,
senescence and postharvest deterioration (Abeles et al., 1992; Bleecker and Kende, 2000; Barry
and Giovannoni, 2007). Ethylene treatment is used commercially to facilitate uniform ripening in
tomato, banana, and melon; degreening of citrus fruits. However, it is more common to reduce
the effects of ethylene to limit postharvest deterioration and extend shelf-life of horticultural
produce by adopting handling and storage strategies that reduce ethylene biosynthesis and / or

9

responsiveness including low temperature and controlled atmosphere storage, which involves
decreasing oxygen concentration and increasing carbon dioxide concentration during storage
which reduces respiration rate, ethylene biosynthesis and decreases sensitivity to ethylene (Kader
et al., 1989; Beaudry, 1999; Dilley, 2006). Furthermore, the ethylene action inhibitor 1-MCP is
now widely used to block ethylene responses to prolong apple storage and is being
experimentally evaluated in other crops (Sisler, 2006; Watkins, 2006; Barry and Giovannoni,
2007).

The regulation of ethylene biosynthesis

Ethylene is synthesized from methionine (MET) by a 3-step process (Adams and Yang, 1979;
Kende, 1993; Bleecker and Kende, 2000). The first step converts MET to S-adenosylmethionine
(SAM) which is catalyzed by the enzyme SAM synthetase at the expense of ATP (Chou and
Talalay, 1972; Ravanel et al., 1998). The second step converts SAM to 1-aminocyclopropane-1carboxylic acid (ACC) and 5’-methylthioadenosine (MTA), catalyzed by ACC synthase (ACS)
(Yu et al., 1979; Bleecker et al., 1986). MTA is reutilized for the synthesis of methionine via the
Yang cycle, which allows for the regeneration of methionine which may be particularly
important in tissues that synthesize large quantities of ethylene when demand for MET is high
(Miyazaki and Yang, 1987). In the third step, ACC is oxidized to ethylene (C2H4), CO2, and
hydrogen cyanide (HCN) by ACC oxidase (ACO) (Hamilton et al., 1991). The HCN is
detoxified to β-cyanoalanine by β-cyanoalanine synthase to prevent toxicity of accumulated
cyanide during high rates of ethylene synthesis (Peiser et al., 1984; Yip and Yang, 1988).
Ethylene synthesis is normally limited by the supply of the immediate precursor, ACC, which is

10

formed by ACS. SAM synthetase, ACS, and ACO, are encoded by multigene families in all plant
species examined, allowing the plant flexibility to differentially regulate ethylene biosynthesis at
different stages of development or in response to individual stimuli (Sato and Theologis, 1989;
Yip et al., 1992; Zarembinski and Theologis, 1994; Whittaker et al., 1997; Bleecker and Kende,
2000). Indeed, many experiments have revealed differential temporal and spatial expression of
ACS and ACO gene families in different tissues at various stages of development and in response
to different environmental stimuli (Rottmann et al., 1991; Barry et al., 1996; Blume and Grierson,
1997; Nakatsuka et al., 1998; Barry et al., 2000; Liu and Zhang, 2004; Chae and Kieber, 2005;
Peng et al., 2005; Sell and Hehl, 2005; Wang et al., 2005).

Notably, two systems of ethylene production exist in plant tissues. System 1 operates during
vegetative growth and in immature fruits and flowers and is under negative feedback regulation
by ethylene (autoinhibitory). In contrast, system 2 operates during the ripening of climacteric
fruits and during flower senescence in some plant species and is under positive feedback
regulation by ethylene (autocatalytic) (McMurchie et al., 1972). Autocatalytic ethylene synthesis
may operate to facilitate rapid ripening and senescence to complete the life cycle of those tissues
as efficiently as possible. Research on the tomato fruit ripening system has provided insight into
the molecular mechanisms that operate during system 1 and system 2 ethylene biosynthesis. For
example, LeACS1A and LeACS6 are responsible for system 1 ethylene biosynthesis in green
tomato fruit and ethylene treatment inhibits their expression (Barry et al., 2000). LeACS1A and
LeACS4 function in the transition between system 1 and system 2 and both LeACS2 and LeACS4
are involved in system 2 ethylene biosynthesis and are positively regulated by ethylene (Olson et
al., 1991; Rottmann et al., 1991; Yip et al., 1992; Lincoln et al., 1993; Nakatsuka et al., 1998;

11

Barry et al., 2000). The ACC oxidase genes, LeACO1 and 4, are also involved in system 2
ethylene production (Nakatsuka et al., 1998). The MADS box transcription factor RIPENING
INHIBITOR (RIN) is required for the normal ripening of tomato fruit, including autocatalytic
ethylene synthesis mediated by increased expression of LeACS2 and LeACS4 (Tigchelaar et al.,
1978; Vrebalov et al., 2002; Ito et al., 2008; Fujisawa et al., 2011). RIN directly binds to the
promoters of LeACS2 and LeACS4 to regulate their expression during fruit ripening (Ito et al.,
2008; Fujisawa et al., 2011).

In addition to regulation at the transcriptional level, ethylene biosynthesis can also be regulated
post-translationally at the level of enzyme activity and protein stability (Liu and Zhang, 2004;
Chae and Kieber, 2005). For example, ethylene overproducer 1 (eto1) is a recessive mutation
that possesses a triple response phenotype due to increased production of ethylene (Guzman and
Ecker, 1990; Wang et al., 2004). ETO1 encodes a BTB-TPR (broad-complex, tramtrack, bric-abrac/tetratricopeptide repeat) protein that targets Arabidopsis ACS5 for protein degradation
through the 26S proteasome (Wang et al., 2004). Therefore, loss-of-function mutants at the eto1
locus overproduce ethylene due to increased stability of ACS5 (Chae et al., 2003). The dominant
eto2 and eto3 mutants also increase ethylene production in Arabidopsis by increasing the
stability of ACS proteins (Chae et al., 2003). The eto2 mutant is caused by a single nucleotide
insertion in the ACS5 gene, resulting in a frameshift that alters the last 12 residues of the ACS5
protein. The eto2-1 mutation does not alter the expression of ACS5 although ethylene production
is 20-fold higher than in wild type, suggesting that the increased ethylene production is the result
of altered enzyme activity or protein stability (Vogel et al., 1998). Similarly, the eto3 mutant is

12

due to a missense mutation in the C-terminal of ACS9 that increases protein stability (Chae et
al., 2003).

Insight into the mechanism of the eto2-1 mutation was derived from studies of the tomato
LeACS2, which is phosphorylated in response to wounding (Tatsuki and Mori, 2001). The
phosphorylation site of LeACS2 (Ser-460) is equivalent to the site of Arabidopsis ACS5 (Ser400), which is mutated in eto2-1 (Tatsuki and Mori, 2001). It is reported that LeCDPK2, and
other protein kinases that are still unknown, is activated by the increase of stress stimuli and is
involved in the phosphorylation of Ser-460 in LeACS2 (Tatsuki and Mori, 2001; Kamiyoshihara
et al., 2010). The phosphorylation of LeACS2 by protein kinases leads to ACS accumulation and
subsequent ethylene production in tomato (Tatsuki and Mori, 2001; Kamiyoshihara et al., 2010).
Ethylene overproduction in eto2-1 Arabidopsis mutant may be caused by the phosphorylation of
the mutated ACS5.

Ethylene signaling in Arabidopsis

Genetic Screens for Identifying Ethylene Signaling Mutants

Phenotypic screens for altered ethylene responsiveness, performed on mutagenized populations
of Arabidopsis, have defined the mechanisms that regulate ethylene perception and signaling. In
the presence of ethylene, dark-grown Arabidopsis seedlings show inhibition of root and
hypocotyl elongation, increased radial swelling of the hypocotyl and exaggeration of the apical

13

hook, phenotypes collectively known as the triple response (Bleecker et al., 1988; Guzman and
Ecker, 1990).

The triple response has been widely used in different genetic screens to identify mutants with
compromised ethylene responses. For example, several mutants have been reported which are
insensitive to ethylene and therefore lack the triple response phenotype in the presence of
exogenous ethylene (Bleecker et al., 1988; Guzman and Ecker, 1990; Kieber and Ecker, 1993;
Roman et al., 1995). A variation of this screen identified mutants that possess a constitutive
triple response in the absence of ethylene leading to the identification of mutants involved in
ethylene signaling and biosynthesis (Guzman and Ecker, 1990; Kieber et al., 1993).
Characterization of these mutants has led to the identification of many genes involved in
ethylene signaling and analysis of epistatic interactions has facilitated placement of these genes
within a signaling pathway (Kieber et al., 1993; Roman et al., 1995; Chao et al., 1997).

Ethylene Receptors in Arabidopsis and ethylene perception

Five ethylene receptors are present in Arabidopsis: ETHYLENE RESPONSE 1 (ETR1),
ETHYLENE RESPONSE SENSOR 1 (ERS1), ETHYLENE RESPONSE 2 (ETR2),
ETHYLENE RESPONSE SENSOR 2 (ERS2), and ETHYLENE INSENSITIVE 4 (EIN4)
(Bleecker et al., 1988; Hua et al., 1995; Hua et al., 1998; Sakai et al., 1998). The receptors are
functionally redundant as single loss-of-function receptor mutants lack evident phenotypes, with
the exception of etr1-7 that shows relatively slow hypocotyl elongation (Cho and Yoo, 2007).
Double, triple, and quadruple loss-of-function mutants show constitutive ethylene responses

14

when grown in air, indicating that binding of ethylene inactivates receptor function rather than
activates ethylene signaling, and also implying the ethylene receptors act as negative regulators
of the ethylene response pathway (Hua and Meyerowitz, 1998). The ethylene receptors are
similar in structure to bacterial two-component receptor kinases (Chang et al., 1993). They
possess a modular structure which includes N-terminal transmembrane domains containing the
ethylene binding domain, a GAF domain, which may be involved in mediating heteromeric
interactions among the receptors, and signal output domains in the C-terminal region, which
include a histidine kinase domain (or Ser/Thr kinase domain) and in some cases a receiver
domain (Chang et al., 1993; Schaller and Bleecker, 1995; Gamble et al., 1998; Gao et al., 2008).
ERS1 and ERS2 lack the receiver domain at the C-terminus.

The ethylene receptors are divided into two subfamilies. Subfamily-1 (ETR1 and ERS1) has
three N-terminal membrane-spanning domains and a conserved histidine kinase domain at the Cterminus (Chang et al., 1993; Hua et al., 1995; Gamble et al., 1998). Subfamily-2 receptors
(ERS2, ETR2 and EIN4) have an extra N-terminal hydrophobic domain, and possess Ser/Thr
kinase activity (Moussatche and Klee, 2004). However, ERS1, a subfamily-1 receptor, has both
histidine kinase and Ser/Thr kinase activity (Moussatche and Klee, 2004). In Arabidopsis,
subfamily-1 receptors have stronger effects on ethylene responses than subfamily-2. For example,
loss-of-function of subfamily-1 receptors in Arabidopsis results in a stronger constitutive
ethylene-response phenotype in air-grown plants than loss of subfamily-2 receptors (Hua and
Meyerowitz, 1998; Hall and Bleecker, 2003; Wang et al., 2003; Qu et al., 2007).

15

Ethylene receptors localize to the endoplasmic reticulum (ER) and Golgi membranes, (Chen et
al., 2002; Ma et al., 2006; Dong et al., 2008). Localization to the ER and Golgi membrane may
allow the ethylene signaling to interact with other pathways. Cytokinin receptors are also
histidine kinases and structurally related with ethylene receptors (Inoue et al., 2001; Ueguchi et
al., 2001; Yamada et al., 2001). Recent experiments using cytokinin binding assays, fluorescent
protein fusions, and biochemical fractionation revealed that the cytokinin receptors are also
localized in the ER (Wulfetange et al., 2011). Localization of both receptors in the ER may
facilitate the cross talk between cytokinin and ethylene. However, ethylene receptors may also
localize to other cellular compartments. For example, NTHK1, an ethylene receptor in tobacco,
has been reported to localize to the plasma membrane (Xie et al., 2003). Ethylene binding does
not appear to affect subcellular localization of receptors (Chen et al., 2002).

Binding of ethylene to the receptors is mediated by a copper cofactor (Rodriguez et al., 1999).
The ethylene receptor ETR1 can form a disulfide-linked homodimer, with two receptor
monomers binding to a single copper ion (Rodriguez et al., 1999). RESPONSE TO
ANTAGONIST 1 (RAN1) delivers copper to the ethylene receptors (Hirayama et al., 1999;
Woeste and Kieber, 2000). Mutations at the ran1 locus lead to non-functional ethylene receptors
that lack a copper ion leading to constitutive ethylene responses (Hirayama et al., 1999; Woeste
and Kieber, 2000).

Seven amino acids (I62, C65, H69, D25, Y32, I35, and P36) within the first and second
transmembrane helices of each receptor monomer are thought to be involved in chelating the
copper ion based on analysis of etr1-1(C65Y), etr1-3(A31V), etr1-4(I62F) mutant alleles, and

16

additional site-directed mutagenesis (Chang et al., 1993; Schaller and Bleecker, 1995; Hall et al.,
1999; Rodriguez et al., 1999; Wang et al., 2006). The mutated receptors are locked in the
signaling state, leading to ethylene-insensitive plants, so mutations within the ethylene binding
domain typically lead to dominant ethylene insensitivity. These types of dominant point
mutations have been isolated in the ETR1, ETR2, and EIN4 genes. Similar mutations introduced
into ERS1 and ERS2 also confer dominant insensitivity (Hua et al., 1995; Hua et al., 1998).

As mentioned above, ETR1 functions as a disulfide-linked homodimer, and Cys-4 and Cys-6 are
the sites that form disulfide bonds in the homodimer (Schaller et al., 1995). Formation of a
disulfide-linked ERS1 homodimer has also been detected and the existence of heterodimers
proposed (Schaller et al., 1995; Hall et al., 2000; Cancel and Larsen, 2002; Liu et al., 2010).
These heteromeric receptor interactions require the GAF domain of the receptors (Gao et al.,
2008). Moreover, results in transiently transformed tobacco cells and in yeast mating-based splitubiquitin system indicated that all five Arabidopsis ethylene receptors form both homodimers
and heterodimers in all possible combinations (Grefen et al., 2008).

Control of the receptors can occur at the transcriptional level as the expression of some receptors
(ERS1, ETR2 and ERS2) is responsive to ethylene (Hua et al., 1998). In addition, ETR2 may also
be a target for degradation by the 26S proteasome in response to ethylene binding (Chen et al.,
2007).

An endomembrane localized ethylene signaling complex

17

Recent research has revealed the existence of an ethylene signaling complex located within the
endomembrane system that includes the ethylene receptor ETR1 together with at least three
components that physically and genetically interact with this receptor isoform, including
CONSTITUTIVE TRIPLE RESPONSE 1 (CTR1), ETHYLENE INSENSITIVE 2 (EIN2), and
REVERSION TO ETHYLENE SENSITIVITY 1 (RTE1) (Clark et al., 1998; Chen et al., 2002;
Dong et al., 2008; Bisson et al., 2009).

CTR1 encodes a protein with homology to serine threonine MAP KINASE KINASE KINASEs
(MAP3Ks) which acts downstream of the ethylene receptors as a negative regulator of ethylene
signaling (Kieber et al., 1993; Hua et al., 1995; Roman et al., 1995). CTR1 interacts with the
histidine kinase domain and receiver domains of the ethylene receptors and shows preferential
interaction with ETR1, which may possibly explain why ETR1 appears to have a more
prominent role in signaling than the other ethylene receptors (Clark et al., 1998; Hall and
Bleecker, 2003; Wang et al., 2003).

RTE1 is also required for the function of the ETR1 receptor and moreover appears to be specific
for the function of this particular receptor isoform (Resnick et al., 2006; Zhou et al., 2007;
Rivarola et al., 2009). RTE1 encodes a membrane bound protein of unknown biochemical
function with an N-terminus that lies in the cytoplasm and a C-terminus in Golgi, or both ER and
Golgi (Zhou et al., 2007; Dong et al., 2008; Dong et al., 2010). The rte1 mutant was identified as
a suppressor of the etr1-2 mutant allele which is a weak dominant receptor allele that does not
disrupt ethylene binding (Resnick et al., 2008). Mutant alleles at the rte1 locus suppress ethylene
insensitivity conferred by the etr1-2 mutant allele as well as additional dominant ethylene-

18

insensitive alleles (Resnick et al., 2006; Zhou et al., 2007; Resnick et al., 2008). However, rte1
is unable to suppress all dominant ETR1 alleles, nor alleles that confer dominant ethylene
insensitivity in additional ethylene receptors (Resnick et al., 2006; Zhou et al., 2007; Rivarola et
al., 2009).

Over-expression of RTE1 causes a weak ethylene-insensitive phenotype which is dependent of
the presence of the ETR1 receptor and can be restored by expression of the ETR1 N-terminus
(Zhou et al., 2007). RTE1 promotes ETR1 signaling by a physical association between RTE1
and the ETR1 N-terminus, an interaction which is not disrupted by ethylene treatment (Dong et
al., 2010). Together, these data indicate that RTE1 action is specific for the ETR1 receptor and
moreover is specific for certain alleles of ETR1, the significance of which is not understood
(Resnick et al., 2006; Zhou et al., 2007; Rivarola et al., 2009). The Arabidopsis genome carries a
second homolog of RTE1, known as RTE1-HOMOLOG (AtRTH), although the function of this
gene is unknown. AtRTH was reported to be localized to the ER and nucleus, which is different
from the ER and Golgi localization of RTE1(Zhang et al., 2012).

EIN2 is a positive regulator of the ethylene signaling pathway that acts genetically downstream
of CTR1(Roman et al., 1995). The ein2 loss-of-function mutant is completely ethylene
insensitive, which indicates that EIN2 is a central regulator of ethylene signaling (Guzman and
Ecker, 1990). EIN2 encodes a 12-pass transmembrane protein, which is similar to the NRAMP
family of metal transporters, with an N-terminal transmembrane domain and a C-terminal
membrane extrinsic domain (Alonso et al., 1999). Over-expression of the EIN2 C-terminus in
Arabidopsis leads to a constitutive ethylene response, which suggests that the EIN2 C-terminus

19

functions in signal transduction although the true biochemical function of EIN2 is unknown
(Alonso et al., 1999). The EIN2 protein accumulates upon ethylene exposure and in the ctr1-1
mutant, but EIN2 does not accumulate in the etr1-1 mutant background (Qiao et al., 2009). The
degradation of EIN2 is triggered by two ethylene-regulated F-box proteins EIN2 TARGETING
PROTEIN 1 (ETP1) and EIN2 TARGETING PROTEIN 2 (ETP2) (Qiao et al., 2009).

EIN2 is also located at the ER membrane where it interacts with all five ethylene receptors in
Arabidopsis (Bisson et al., 2009). The interaction between ETR1 and EIN2 is modulated by the
autokinse activity of ETR1 (Bisson and Groth, 2010). EIN2 interacts with all ethylene receptors
(Bisson and Groth, 2010). Since subfamily-2 has a different kinase domain with subfamily-1
receptors, its mechanism of interaction with EIN2 may be different. The interaction may be
mediated by phosphorylation of serine or threonine residues in subfamily-2 receptors or by
heterodimers between subfamily-1 receptors and subfamily-2 receptors, but these possibilities
remain to be determined (Bisson and Groth, 2010). In the absence of ethylene, the EIN2 at ER
membrane shows CTR1 kinase-dependent phosphorylation, while the presence of ethylene
induces dephosphorylation of EIN2 at S645, which leads to proteolytic cleavage at S645. As a
result, the carboxyl-terminal of EIN2 (EIN2-C’) is released and rapidly translocates to the
nucleus and activates the components in the downstream of signaling (Qiao et al., 2012).

A newly identified EIN2-interacting protein EIN2 C-terminus Interacting Protein 1 (ECIP1) is
thought to function together with subfamily-2 receptors (ETR2 and EIN4) and EIN2, although
the specific mechanism is unclear (Lei et al., 2011). ECIP1 is mainly localized in the cytoplasm
and acts as a negative regulator of ethylene signaling and salt tolerance (Lei et al., 2011). Loss-

20

of-function of ECIP1 resulted in enhanced ethylene responsiveness, increased plant survival rate
under salt stress, reduced cotyledon size, but lower seed germination under the salt stress (Lei et
al., 2011). Further research is required to define the exact function of ECIP1 and its role in
ethylene signaling.

Tetratricopeptide Repeat Protein1 (TRP1) is another protein, which interacts with receptor ERS1
in the yeast two-hybrid system and in vivo immuno-precipitation pull-down assays (Lin et al.,
2009). It is highly expressed in the vascular tissue, anthers and pollen, abscission zone, and
accumulates following ethylene treatment (Lin et al., 2009). Over-expression of TRP1 in wild
type Arabidopsis resulted in dwarfed plants with reduced fertility, altered leaf/silique
morphology, and enhanced expression of AtChiB (Lin et al., 2009). Although over-expression of
TRP1 in the etr1-1 mutant altered aspects of the mutant phenotypes, it did not change the
dominant ethylene insensitivity. The biochemical function of TRP1 is unclear, but it may
function as an adaptor to facilitate receptor degradation (Lin et al., 2009).

Ethylene signaling events in the nucleus

ETHYLENE INSENSITIVE 3 (EIN3) and EIN3-LIKE (EIL) proteins, which consist of five
members (EIL1-5), act downstream of EIN2 (Chao et al., 1997). EIN3 and EILs are members of
a plant specific family of transcription factors that accumulate in the nucleus (Chao et al., 1997;
Solano et al., 1998). EIN3 and EIL1 play significant roles in ethylene signaling as the ein3/eil1
double mutant displays almost complete ethylene insensitivity in the triple response assay
(Alonso et al., 2003). Furthermore, over-expression of either EIN3 or EIL1 in wild-type and the

21

ein2 mutant confers a constitutive ethylene response at all stages of development (Chao et al.,
1997). EIN3 and EIL1 are partially redundant (Chao et al., 1997; Alonso et al., 2003). EIL1
mainly functions in the leaf and stem of adult plants, but EIN3 largely regulates ethylene
responses in seedlings (An et al., 2010).

As with EIN2, the EIN3/EIL proteins accumulate after ethylene treatment (Guo and Ecker, 2003;
Potuschak et al., 2003) and EIN3/EIL protein stability is regulated by two F-box proteins, known
as EIN3 BINDING F-BOX 1 (EBF1) and EIN3 BINDING F-BOX 2 (EBF2) (Guo and Ecker,
2003; Potuschak et al., 2003; An et al., 2010). EBF1 and EBF2 are partially redundant. EBF1
mainly functions in the absence of ethylene and during the early stages of seedling responses to
ethylene, and EBF2 affects the later stages of the triple response and the recovery stage after
ethylene removal (Binder et al., 2007). Although EBF1 and EBF2 display genetic redundancy,
they also possess independent functions. EBF2, but not EBF1, is involved in negative feedback
regulation of EIN3 through direct binding of EIN3 to the EBF2 promoter which activates the
EBF2 expression promoting EIN3 degradation (Konishi and Yanagisawa, 2008).

The expression of EBF1 and EBF2 and their protein accumulation are also tightly regulated.
EBF1 and EBF2 transcript levels are regulated by ETHYLENE-INSENSITIVE5 (EIN5), which
encodes a 5’ → 3’ exoribonuclease that actively promotes EBF1 and EBF2 mRNA decay
(Olmedo et al., 2006). EBF proteins may also be regulated by 26S proteasome. It was reported
that EBF proteins are very stable in the ein2 mutant and EIN2 C -terminus interacts with a
negative regulator of the SCF complex (An et al., 2010). According to these data, EBF1 and

22

EBF2 proteins may be subject to an EIN2 mediated autoubiquitination process and degraded by
as yet unknown F-box proteins.

A second pathway has also been proposed that operates independently of EIN2 to stabilize EIN3
by way of a phosphorylation cascade involving MKK9-MPK3/MPK6 (Yoo et al., 2008). EIN3
has two phosphorylation sites (T174 and T592), which appear to have opposing functions in
mediating EIN3 stability (Yoo et al., 2008). In the absence of ethylene, CTR1 inactivates
MKK9-MPK3/MPK6, T592 is phosphorylated, by an unknown protein kinase and EIN3 is
degraded. In the presence of ethylene,

CTR1 is inactivated and repression of MKK9-

MPK3/MPK6 is released leading to phosphorylation of T174 and EIN3 stabilization (Yoo et al.,
2008). The role of this proposed bifurcated MAPK cascade in regulating ethylene responses
through EIN3 stability is still a matter for debate in the scientific literature. Several independent
studies have demonstrated that ethylene signaling lies downstream of MPK6 activation and that
the MKK9-MPK3/MPK6 module may function in the stability of ACS2 and ACS6 to control
ethylene biosynthesis (Liu and Zhang, 2004; Joo et al., 2008; Xu et al., 2008; Bethke et al.,
2009; An et al., 2010).

EIN3 functions as a dimer and binds to the PRIMARY ETHYLENE RESPONSE ELEMENT
(PERE) in the promoters of ETHYLENE RESPONSE FACTOR 1 (ERF1), ETHYLENE
RESPONSE DNA BINDING FACTOR (EDF)1, 2, 3, 4, and other early ethylene response genes
(Solano et al., 1998). EIN3/EILs has been implicated in the regulation of several genes involved
in diverse processes including those involved in light signaling, biotic stress defense, chlorophyll

23

biosynthesis, and ethylene signaling (Solano et al., 1998; Konishi and Yanagisawa, 2008; Chen
et al., 2009; Zhong et al., 2009; Boutrot et al., 2010).

ERF1 and other ERFs are members of the APETALA2 (AP2)/ERF superfamily of transcription
factors, which is one of the largest groups of transcription factors in plants (Hao et al., 1998;
Brown et al., 2003; Wessler, 2005). According to the number of AP2/ERF domains, the
AP2/ERF superfamily is divided into ERF, AP2, and related-to-ABI3/VP1 (RAV) families
(Sakuma et al., 2002; Nakano et al., 2006). In Arabidopsis, 145 genes are predicted to encode
AP2/ERF proteins and more than 80% of these genes belong to the ERF family (Sakuma et al.,
2002). The ERF family is further classified into two subfamilies: dehydration-responsive element
binding protein (DREB) subfamily and ERF subfamilies. The DREB subfamily proteins interact
with a CCGAC sequence (Jiang et al., 1996), and are involved in plant development, hormonal
signal transduction and response to abiotic stress (Hsieh et al., 2002; Narusaka et al., 2003; Qin
et al., 2008). The ERF subfamily proteins typically bind to an AGCCGCC sequence, referred to
as the GCC box, and are involved in plant defense, stress signaling, plant development, and
ethylene signaling responses (Ohme-Takagi and Shinshi, 1995; Yang et al., 2005; OnateSanchez et al., 2007; Pre et al., 2008). Arabidopsis has 122 predicted ERF genes (Nakano et al.,
2006). The N-terminus of ERF subfamily proteins contains the conserved DNA binding domain
whereas the C-terminus is more divergent and may mediate signaling specificity (Hao et al.,
1998). As ERFs are encoded by a large gene family and constitute the last step in the ethylene
signaling pathway prior to downstream target genes, they potentially contribute to functional
diversity of ethylene responses, possibly mediating tissue, development or stimulus-specific
transcription. Each ERF protein normally has more than one function. For example, The ERF1

24

protein regulates the expression of various genes including PDF1-2, prb-1b (PR1), β-1, 3glucanase (PR2), chitinase (PR3), and osmotin (PR5) etc (Ohme-Takagi and Shinshi, 1995;
Buttner and Singh, 1997; Zarei et al., 2011).

The ERF subfamily of proteins function by either activating or repressing the expression of
target genes through the interaction with the GCC box (Fujimoto et al., 2000). In Arabidopsis,
ERF1, 2 and 5 are transcriptional activators and ERF3, 4, 7, 10, 11 and 12 repress GCC-boxcontaining genes (Fujimoto et al., 2000; Ohta et al., 2000). Recently, reports have suggested that
some ERF subfamily proteins also regulate genes through additional sequence motifs within
promoters. For example, ERF Required for Nodulation (ERN), which is an ERF protein and is
required for nodulation, binds specifically to the NF-box (Andriankaja et al., 2007). Arabidopsis
RAP2.6 binds to both GCC box and the CE1 element (TGCCACCGG), which is commonly
present in the promoter region of many stress-related genes (Zhu et al., 2010). ERF proteins also
regulate gene expression by protein-protein interactions between an ERF protein and elicitorresponsive element binding factors. For example, AtEBP, which is an ERF protein, interacts with
an octopine synthase (ocs) element binding factors (OBFs), a class of basic-region leucine zipper
(bZIP) transcription factors (Buttner and Singh, 1997). In addition to mediating ethylene
responses, ERFs are also involved in controlling ABA, JA and SA mediated transcription,
suggesting that they may function in crosstalk between these plant hormone signaling pathways
(Gutterson and Reuber, 2004). For example, at least five ERFs, including ERF1, ERF2, ERF3,
ERF4, and RAP2.10, are induced by JA, suggesting that these components may be mediators of
crosstalk between the JA and ethylene signaling pathway (Brown et al., 2003; Lorenzo et al.,
2003).

25

In agreement with a dual role in both JA and ethylene signaling, manipulation of

ERF

expression in plants leads to phenotypes related to plant defense (Onate-Sanchez and Singh,
2002; Lorenzo et al., 2003; Gutterson and Reuber, 2004; McGrath et al., 2005). For example,
ERF1 over-expression in Arabidopsis leads to a stunted plant phenotype with etiolated seedlings
grown in air displaying shortening and thickening of roots and hypocotyls but no exaggeration of
the apical hook (Solano et al., 1998).

ERF1 over-expression lines also display increased

resistance to several necrotrophic fungi, including B. cinerea and P. cucumerina (Berrocal-Lobo
et al., 2002). Similarly, over-expression of ERF14 in Arabidopsis leads to reduced plant size,
loss of seed set, and enhanced defense-related gene expression whereas loss-of-function mutants
display increased susceptibility to Fusarium oxysporum (Onate-Sanchez et al., 2007).

In

contrast, erf4 loss-of-function mutants are more resistant to F. oxysporum (McGrath et al., 2005).

A model for ethylene signaling in Arabidopsis

Ethylene signaling is negatively regulated (Hua and Meyerowitz, 1998). In the absence of
ethylene, the ethylene receptors directly bind to CTR1, which is also a negative regulator of
ethylene signaling (Clark et al., 1998; Cancel and Larsen, 2002; Gao et al., 2003). RTE1 binds to
ETR1 N-terminus to promote ETR1 signaling (Dong et al., 2010). This results in a complex that
includes RTE1, an ethylene receptor dimer, and CTR1. The association between receptors and
CTR1 may prevent receptor interaction with EIN2. EIN2 is turned over by the F-box proteins
ETP1/2 and ethylene signaling is inhibited (Qiao et al., 2009). In the presence of ethylene, the
interaction between ethylene and ethylene receptors induces a conformational change (Binder et

26

al., 2010). CTR1 is released and inactivated, which allows interaction of the kinase domain of
the receptors with EIN2 (Bisson et al., 2009; Bisson and Groth, 2010). This leads to an
additional complex comprised of RTE1, a receptor dimer, and EIN2. Subsequently, the S645 of
EIN2 is dephosphorylated, leading to releasing of C-terminus of EIN2(EIN2-C’) (Qiao et al.,
2012).

The released EIN2-C’ rapidly translocates to the nucleus and activates EIN3/EILs

proteins, and in the end, the ethylene responsive target genes are transcribed (Chao et al., 1997;
Yanagisawa et al., 2003; Alonso and Stepanova, 2004; Yoo et al., 2008; Qiao et al., 2012).
Control of ethylene responses can be achieved at multiple levels including turnover of EIN3/EIL
proteins through the action of two F-box proteins, EBF1 and EBF2 (Guo and Ecker, 2003;
Potuschak et al., 2003; An et al., 2010).
Alternative pathways that bypass CTR1 and EIN2 that may function through a MKK9MPK3/MPK6 module to control EIN3 protein levels have also been proposed, although
discussion of the role of this module is debated in the literature (Hua and Meyerowitz, 1998;
Larsen and Chang, 2001; Liu and Zhang, 2004; Joo et al., 2008; Xu et al., 2008; Yoo et al.,
2008; Bethke et al., 2009; An et al., 2010).

Ethylene receptor signaling in diverse plant species

Hormone signaling pathways are generally conserved in higher plant species and components of
the ethylene signaling pathway have been isolated and functionally characterized from many
plant species (Sato-Nara et al., 1999; Takahashi et al., 2002; Guo and Ecker, 2004; Kendrick and
Chang, 2008; Ma et al., 2010; Tatsuki, 2010). However, some developmental processes or
responses to environmental signals in which ethylene is influential are unique to specific groups
of plants, e.g., the ripening of fleshy fruits, nodulation, and elongation in response to flooding.
27

As such, both ethylene biosynthesis and signaling mechanisms together with their corresponding
physiological outputs may vary between plant species, extending or challenging concepts
developed using Arabidopsis as a model system. Conservation of ethylene perception and
signaling between diverse species is probably best illustrated by transgenic expression of a
dominant mutant form of the Arabidopsis etr1-1 receptor in many plant species including
petunia, tomato, carnation, Campanula carpatica and tobacco. These experiments have
demonstrated that multiple ethylene responses in diverse species can be controlled by a single
heterologous transgene (Wilkinson et al., 1997; Knoester et al., 1998; Bovy et al., 1999;
Sriskandarajah et al., 2004). However, differences are emerging in the mechanisms that
contribute to ethylene signaling in diverse plant species. In particular, tomato, petunia and rice
serve as model systems for investigating the role of ethylene during the ripening of fleshy fruits,
flower senescence and elongation under flooding conditions, respectively.

Tomato is a powerful model system for studying the role of ethylene in plant growth and
development. Primarily, ethylene research in tomato has focused on its role in regulating fruit
ripening, but a substantial body of research has also investigated the role of ethylene in
abscission, senescence, response to flooding, wounding and various biotic stresses (Roberts et
al., 1984; Tucker et al., 1984; McNamara and Mitchell, 1991; Abeles et al., 1992; Lanahan et
al., 1994; Barry et al., 2005; Barry and Giovannoni, 2006). There are six known ethylene
receptors in tomato, LeETR1, LeETR2, NR (also referred to as LeETR3), LeETR4, LeETR5, and
LeETR6, while there are only five in Arabidopsis (Wilkinson et al., 1995; Payton et al., 1996;
Zhou et al., 1996; Lashbrook et al., 1998; Tieman and Klee, 1999; Klee, 2004). LeETR1,
LeETR2, and NR belong to subfamily-1, and LeETR4, LeETR5, and LeETR6 belong to

28

subfamily-2. NR is the only member of the tomato ethylene-receptor that lacks a receiver domain
(Tieman and Klee, 1999). LeETR1 and LeETR2 are more closely related to Arabidopsis ETR1,
NR is similar to the ERS1 (Hua et al., 1995), whereas LeETR4 , LeETR5 and LeETR6 are more
closely related to ETR2 and EIN4 (Tieman and Klee, 1999). NR was the first tomato ethylene
receptor to be identified, and the Nr mutant is ethylene insensitive in all tissues examined
(Lanahan et al., 1994; Wilkinson et al., 1995). In summary, the tomato ethylene receptors differ
in number and type between tomato and Arabidopsis.

Tomato receptor genes have distinct patterns of gene expression (Klee, 2002). For tomato
receptor genes, both LeETR1 and LeETR2 are ubiquitously expressed, although LeETR1 is
expressed at approximately a 5-fold higher level than LeETR2 (Zhou et al., 1996; Lashbrook et
al., 1998). LeETR2 expression is transiently suppressed by ozone treatment, and returns to the
same level as at the beginning of ozone exposure (Moeder et al., 2002). NR is detected in floral
ovaries and ripening fruit (Lashbrook et al., 1998). LeETR4 and LeETR5 have a higher
expression level in flowers and during fruit development than in vegetative tissues (Tieman and
Klee, 1999). Notably, LeETR4

contributes approximately

90% of the putative receptor

expression in green fruit and 50% of the putative receptor expression in ripening fruit (Tieman
and Klee, 1999). For Arabidopsis, the RNA levels of the five genes are generally low and
ubiquitous, with similar expression patterns in most of the tissues, although minor differences
exist in their expression patterns in each tissue (Hua et al., 1998; Binder, 2008).

Ethylene-related phenotypes in single loss-of-function mutants are masked by over-expression of
one or more other ethylene receptors in tomato, but not in Arabidopsis. In antisense NR tomato

29

plants where NR expression is reduced by 90%, LeETR4 was over-expressed four-fold higher
than wild type compensating for the loss of NR (Tieman et al., 2000). However, this type of
compensation does not occur LeETR4 antisense lines (Tieman et al., 2000).

Rice is a model plant species for investigating ethylene signaling in monocot species. In rice,
five ethylene receptor genes have been identified, which encode two subfamily-1 receptors
OsERS1, OsERS2 and three subfamily-2 receptors OsETR2, OsETR3, and OsETR4 (Cao et al.,
2003; Watanabe et al., 2004; Yau et al., 2004). Similarly, OsETR2 expression is induced by
flooding, IAA, ethylene, and GA, suggesting that this receptor may be responsible for the
hypoxia adaptation responses in rice (Watanabe et al., 2004; Yau et al., 2004). Strikingly, there
is no ETR1-type ethylene receptor in rice (Cao et al., 2003; Watanabe et al., 2004; Yau et al.,
2004).

Petunia serves as a model for ethylene sensitive flower senescence research. There are four
putative ethylene receptors in petunia, but only two PhERS1 and PhETR2, are characterized
(Wang and Kumar, 2007). PhETR2 regulates timing of anther dehiscence (Wang and Kumar,
2007). PhETR2 mRNA increases following wounding and salt treatment, whereas PhERS1
mRNA does not (Wang and Kumar, 2007). PhERS1 knock-down lines possess a wild-type
phenotype, suggesting some genetic redundancy between the petunia ethylene receptors (Wang
and Kumar, 2007).

In general, a more pronounced role for subfamily-2 ethylene receptors is evident in tomato, rice,
and petunia compared to Arabidopsis. In tomato, reduction in the expression level of LeETR4

30

using an antisense transgene leads to a constitutive ethylene related phenotype, leading to
increased epinasty of petioles and leaves, premature senescence of flowers, accelerated fruit
ripening, and enhanced ethylene sensitivity in dark grown seedlings (Tieman et al., 2000).
LeETR6 antisense lines have similar phenotypes to

LeETR4 antisense lines, including

accelerated ripening, epinastic leaf growth, and premature flower senescence (Kevany et al.,
2007). Similarly, over-expression and silencing of the rice subfamily-2 receptor OsETR2 caused
phenotypic changes in flowering time, ethylene responsiveness, seed weight and starch
accumulation (Wuriyanghan et al., 2009). Knock-down lines in OsETR2, OsETR3, and OsERS2
display enhanced ethylene sensitivity and early flowering (Wuriyanghan et al., 2009).
Furthermore, silencing of the subfamily-2 receptor, PhETR2 in petunia led to stomium
degeneration and anther dehiscence prior anthesis (Wang and Kumar, 2007). In contrast, loss-offunction of subfamily-1 ethylene receptors in Arabidopsis results in more dramatic phenotypic
consequences related to ethylene hypersensitivity (Hall and Bleecker, 2003; Wang et al., 2003;
Qu et al., 2007). Increased reliance on subfamily-2 receptors may be wide spread in a number of
plant species as ETR1-type receptors are also absent in wheat and maize (Ma and Wang, 2003;
Gallie and Young, 2004).

Downstream ethylene signaling components in diverse plant species

In addition to variation in the composition of ethylene receptor families and the different
emphasis on the functional characteristics of subfamily-1 and subfamily-2 receptors, functional
characterization of downstream signaling components in species other than Arabidopsis is
revealing increased complexity. While a single CTR1 protein is encoded by the Arabidopsis

31

genome; multiple CTR1-like genes are present in other species (Adams-Phillips et al., 2004; Yin
et al., 2008; Ma et al., 2010; Manzano et al., 2010). For example, three CTR1-like genes are
present in tomato, LeCTR1, LeCTR3, and LeCTR4 and each is expressed in multiple tissues with
LeCTR1 displaying increased transcript abundance in response to ethylene treatment (Leclercq et
al., 2002; Adams-Phillips et al., 2004). Each tomato CTR1-like gene possesses a differential
capability to complement the Arabidopsis ctr1-8 mutant allele. For example, LeCTR3 fully
complements the ctr1-8 allele in both seedlings and adult plants (Adams-Phillips et al., 2004). In
contrast, LeCTR4 is able to fully complement ctr1-8 allele in adult plants but fails to fully
complement the seedling phenotype whereas LeCTR1 fails to complement either the seedling or
rosette phenotype of ctr1-8 (Adams-Phillips et al., 2004). A fourth CTR1-like gene, LeCTR2, is
present in tomato (Lin, 1998; Adams-Phillips et al., 2004). However, phylogenetic analysis
indicates that LeCTR2 is more closely related to Arabidopsis ENHANCED DISEASE
RESISTANCE 1 (EDR1), which is a negative regulator of disease resistance and ethyleneinduced senescence (Frye et al., 2001; Adams-Phillips et al., 2004). Over-expression of the
LeCTR2 N-terminus in tomato resulted in enhanced susceptibility to infection by the fungal
pathogen Botrytis cinerea, due to stronger induction of pathogenesis-related genes such as
PR1b1 and chitinase B (Lin et al., 2008).

LeCTR2 has also been implicated in ethylene

signaling. LeCTR1, LeCTR3, and LeCTR4 proteins interact with the tomato subfamily-1
receptors, whereas LeCTR2 only interacts with LeETR1 and LeETR2 (Lin et al., 2008; Zhong et
al., 2008). Furthermore, interaction of LeCTR1, LeCTR3, and LeCTR4 with the NEVER-RIPE
receptor leads to recruitment of each CTR protein to the ER (Zhong et al., 2008).

32

EIN2 in tomato was also been isolated, and like other EIN2s, LeEIN2 is also a single copy gene
(Zhu et al., 2006). Down-regulation of LeEIN2 in tomato inhibits expression of ethylene-related
genes and ripening-related genes including POLYGALACTURONASE and TOMLOXB, and
further inhibited fruit ripening and sensitivity (Zhu et al., 2006; Hu et al., 2010). In petunia,
PhEIN2 mediates ethylene signaling involved in a wide range of physiological processes
including, seedling responses to ethylene, flower senescence, fruit ripening, formation
adventitious root and root hairs (Shibuya et al., 2004). Expression of PhEIN2 mRNA is spatially
and temporally regulated and is decreased by ethylene treatment in petals but not in seedlings
(Shibuya et al., 2004). Notably, EIN2 expression is not affected by treatment with ethylene in
Arabidopsis and rice (Alonso et al., 1999; Jun et al., 2004; Shibuya et al., 2004). The Medicago
truncatula ortholog of EIN2, MtEIN2/MtSkl1, is a negative regulator of bacterial infection and
nodule formation in legumes in response to symbiotic rhizobia (Penmetsa et al., 2008). Overexpression of the C-terminal domain of MtEIN2/MtSkl1 is sufficient to block nodulation
responses suggesting that ethylene inhibits nodule formation (Penmetsa et al., 2008).

Three EILs have been functionally characterized in tomato, LeEIL1–3, and they function
redundantly (Tieman et al., 2001). Reduced expression of all these three genes in transgenic
tomato resulted in delayed fruit ripening, decreased flower abscission, senescence, and leaf
epinasty (Tieman et al., 2001; Fu et al., 2005). In addition, the over-expression of LeEIL1 can
partially restore ripening in the Nr tomato mutant (Chen et al., 2004). In melon, two EILs
(CmEIL1 and CmEIL2) have been characterized and found to regulate expression of CmACO1
(Huang et al., 2010).

33

Two tomato F-box genes, SlEBF1 and SlEBF2 were reported, but the targets of SlEBF1 and
SlEBF2 are currently unknown (Yang et al., 2010). The expression of SlEBF1 and SlEBF2 is upregulated during the transition from bud to anthesis, and then decreases dramatically at the postanthesis stage, expression increases at the onset of fruit ripening and is induced by ethylene in
seedlings (Yang et al., 2010). Silencing of individual SlEBF genes does not cause dramatic
phenotypes due to functional redundancy, but silencing both SlEBF1 and SlEBF2 expression
causes a constitutive ethylene response phenotype, defects in fertility, growth inhibition,
accelerated plant senescence and fruit ripening (Yang et al., 2010).

ERF genes that act downstream of ethylene signaling, also play specialist roles in the response of
rice to submergence. Two ERF genes, SNORKEL1 (SK1) and SNORKEL2 (SK2), are responsible
for submergence-escape response in deepwater rice (Hattori et al., 2007; Hattori et al., 2008;
Hattori et al., 2009). Under deepwater conditions, ethylene accumulates in the plant. Increased
ethylene activates SK1 and SK2 genes, induces GA biosynthesis genes, and represses genes
involved in ABA biosynthesis (Hattori et al., 2011). As a result, internodes elongate and
submergence is avoided by rapid stem growth. A third ERF gene, SUB1A, confers submergencetolerance response in lowland rice (Fukao et al., 2006; Xu et al., 2006). SUB1A shares high
similarity with SK1 and SK2, but functions independently (Nagai et al., 2010). SUB1A restricts
the degradation of SLENDER RICE1 (SLR1) and SLR1-LIKE1 (SLRL1), which are DELLA
repressor proteins in GA signaling (Xu et al., 2006; Fukao and Bailey-Serres, 2008). At the same
time, Sub1A inhibits ethylene biosynthesis (Fukao et al., 2006). As a result, Plants carrying
SUB1A are stunted that avoid energy consumption associated with stem elongation under water

34

stress conditions. Normally, they could survive in water for a few weeks, and then restart to grow
after the stress.

GR/RTE1 family proteins regulate a subset of ethylene responses

GREEN RIPE (GR) is a novel protein that regulates a subset of ethylene responses in tomato and
is a homolog of Arabidopsis RTE1 (Barry and Giovannoni, 2006). The Gr mutant displays
ethylene insensitivity during fruit ripening, floral senescence, abscission, and root elongation
during the triple response. However, dark-grown hypocotyls and petiole retain a typical wild
type response to ethylene (Barry et al., 2005). The Gr mutant phenotype is caused by a 334 bp
deletion in the 5'-UTR and 5'-flanking region of GR, but does not disrupt the predicted protein
coding region (Barry and Giovannoni, 2006). GR transcripts accumulate to higher levels in the
Gr mutant background compared to wild type controls suggesting that the basis for the mutant
phenotype is ectopic expression of Gr. This hypothesis was confirmed through over-expression
of GR under the control of the CaMV35S promoter. GR over-expression lines recreated the Gr
mutant phenotype but did not lead to whole plant ethylene-insensitivity indicating the GR control
of ethylene responses occurs at the level of the protein function (Barry and Giovannoni, 2006).

GR encodes a protein of 243 amino acids with a molecular mass of ≈27.9 kDa and belongs to a
family of conserved proteins that have two or three predicted transmembrane spanning domains
that includes the ethylene signaling component RTE1 (Barry and Giovannoni, 2006; Resnick et
al., 2006). The tomato genome contains two additional GR homologs designated GREEN RIPE
LIKE 1 (GRL1) and GREEN RIPE LIKE 2 (GRL2), the function of which remain unknown

35

(Barry and Giovannoni, 2006). GR shares 53% and 37% of amino acid identity with GRL1 and
GRL2, respectively (Barry and Giovannoni, 2006). GR possesses a motif MXCXXC and an
MXXXM motif (where X is any hydrophobic residue, M is methionine and C is cysteine), which
are in C terminus and in a predicted membrane-spanning domain, respectively (Barry and
Giovannoni, 2006). These motifs may function in the binding of copper ions or copper transport
activity, but these two motifs are not conserved in other homologs (Barry and Giovannoni, 2006).

Recently the involvement of GR/RTE1 family proteins in mediating ethylene responses in rice
was reported (Zhang et al., 2012). Over-expression of OsGRL1a/OsRTH1, a homolog of RTE1,
complemented the rte1-2 loss-of-function and conferred whole-plant ethylene insensitivity when
over-expressed in Arabidopsis and rice (Zhang et al., 2012). However, over-expression of
OsGRL1b/OsRTH2 and the RTH ortholog OsGRL2/OsRTH3 did not influence ethylene
responsiveness. Both OsGRL1a/OsRTH1 and OsGRL1b/OsRTH2 appear to be localized to the
Golgi and ER membranes whereas OsGRL2/OsRTH3 is localized to the ER and the nucleus
(Zhang et al., 2012).

Hypothesis

Previous research by our laboratory identified a role for the SlGR protein in controlling ethylene
responses in tomato although the exact biochemical function of this protein remains unknown.
Furthermore, the role of the SlGR homologs, SlGRL1 and SlGRL2 remain unknown. The
objective of this research is to explore the potential role of these proteins in mediating ethylene
responses and to define their relationship to one another.

36

We hypothesize that SlGR and SlGRL1 are involved in modulating ethylene responses in tomato
but that their specific roles have diverged to influence distinct subsets of responses. Furthermore,
differences in the primary amino acid sequence of these proteins may determine functional
specificity.

To test this hypothesis a combination of transgene expression in tomato and Arabidopsis of wild
type and mutant transgenes has been performed together with a comparative approach utilizing
putative GR orthologs to attempt to identify amino acid residues and domains important for the
function of these proteins.

Thesis rationale and overview

The work presented here expands our current knowledge of the role of the GR/RTE1 family in
ethylene signaling. AtRTE1 functions in ethylene signaling. The rte1 mutant was identified as a
suppressor of the etr1-2 mutant allele (Resnick et al., 2006; Zhou et al., 2007; Resnick et al.,
2008). AtRTE1 promotes ethylene receptor ETR1 signaling by a physical association between
AtRTE1 and the ETR1 N-terminus, an interaction which is not disrupted by ethylene treatment
(Dong et al., 2010). There are three homologs of AtRTE1 in tomato; GREEN RIPE (SlGR),
GREEN RIPE LIKE 1 (SlGRL1) and GREEN RIPE LIKE 2 (SlGRL2) (Barry and Giovannoni,
2006). Previous research indicated that over-expression of SlGR influences a subset of ethylene
responses in tomato (Barry and Giovannoni, 2006). In Chapter 2, the potential role of SlGRL1
and SlGRL2 over-expression in influencing ethylene responsiveness in tomato was examined
together with ability of AtRTE1 to influence ethylene responses in tomato. In addition, the ability

37

of SlGR and SlGRL1 to complement the loss of rte1 in Arabidopsis was also tested. The results
from these experiments suggest that SlGR and SlGRL1 function in ethylene signaling, although
they function differently to influence distinct yet over-lapping ethylene responses suggesting the
existence of distinct ethylene signaling modules in tomato. Over-expression of AtRTE1 in
tomato influences ethylene responses although the phenotypes more closely resembled those of
SlGRL1 over-expression rather than SlGR over-expression. In contrast, over-expression of
SlGRL2 in tomato suggested that this gene is not involved in ethylene signaling.

Chapter 3 investigated the role of putative functional domains and amino acids in SlGR and
SlGRL1 using a combination of natural variation in putative Solanaceae orthologs together with
site-directed mutagenesis. Firstly, amino acids hypothesized to be important for functional
differences between SlGR and SlGRL1 were identified utilizing diversity within putative GR
orthologs. Several amino acids were identified that correlated with the ability of putative GR and
GRL1 orthologs to complement the rte1 mutant of Arabidopsis. Secondly, the role of the Cterminus of SlGR and SlGRL1 in controlling ethylene responsiveness was explored. Although
studies of AtRTE1 and SlGR function suggest an important role for the C-terminus of these
proteins in mediating ethylene responses, mutagenesis and deletion of highly conserved amino
acid residues within the C-terminus of SlGRL1 did not disrupt the ability of SlGRL1 to
complement the rte1-3 allele.

Chapter 4 addresses the potential differential expression of SlGR, SlGRL1 and SlGRL2
characterization and localization of GR/RTE1 family proteins. The expression level of SlGR,
SlGRL1 and SlGRL2 are differentially expressed in different tissues of tomato. SlGR is highly

38

expressed in seeds, especially in testa, with very little expression detected elsewhere in tomato.
SlGRL1 expression is also predominantly associated with the testa of developing seeds but is also
expressed throughout fruit development with an increase in transcript abundance detected at the
breaker stage of fruit ripening, in senescing flowers and in response to ethylene treatment and
following wounding. SlGRL2 is also widely expressed in tomato tissues with high expression
levels detected in seeds and anthers together with increased expression detected during fruit
ripening. In contrast to SlGR where most of the seed expression is associated with the testa, the
expression of SlGRL2 is more uniformly distributed across the embryo, testa and endosperm.
Slightly conflicting data have appeared in the literature regarding the sub-cellular localization of
AtRTE1, with different reports suggesting either Golgi localization or dual localization to both
the ER and the Golgi (Zhou et al., 2007; Dong et al., 2008). The localization of SlGR, SlGRL1
and related Solanaceae homologs was determined to test the hypothesis that differential control
of ethylene responsiveness by SlGR and SlGRL1 is mediated by different subcellular localization
of these proteins. These data revealed that SlGR, SlGRL1, SlGRL2, PhGR, PhGRL1, and SmGR
are all localized in the Golgi thereby refuting the hypothesis. Together, these data provide
considerable new insight into the role of the GR/RTE1 family in controlling ethylene responses
in plants.

39

Figure 1.1 A model of the proposed ethylene signaling pathway in Arabidopsis in the presence
and absence of ethylene. Pathway connections that are currently disputed in the literature are
indicated by dashed lines. For interpretation of the references to color in this and all other
figures, the reader is referred to the electronic version of this dissertation.

40

Figure 1.2 Phylogenetic analysis of GR/RTE1 family proteins (Barry and Giovannoni, 2006).
At2G26070 and At3G51040 correspond to RTE1 and RTH of Arabidopsis, respectively.

41

REFERENCES

42

REFERENCES
Abeles FB, Morgan PW, Saltveit ME (1992) Ethylene in Plant Biology (2nd ed.).
Academic Press: 264–296
Achard P, Cheng H, De Grauwe L, Decat J, Schoutteten H, Moritz T, Van der Straeten D,
Peng JR, Harberd NP (2006) Integration of plant responses to environmentally
activated phytohormonal signals. Science 311: 91-94
Adams-Phillips L, Barry C, Kannan P, Leclercq J, Bouzayen M, Giovannoni J (2004)
Evidence that CTR1-mediated ethylene signal transduction in tomato is encoded
by a multigene family whose members display distinct regulatory features. Plant
Molecular Biology 54: 387-404
Adams

DO, Yang SF (1979) Ethylene biosynthesis: identification of 1aminocyclopropane-1-carboxylic acid as an intermediate in the conversion of
methionine to ethylene. Proceedings of the National Academy of Sciences of the
United States of America 76: 170-174

Adato I, Gazit S (1977) Changes in the initiation of climacteric ethylene in harvested
avocado fruits during their development. Journal of the Science of Food and
Agriculture 28: 240-242
Aharoni Y (1968) Respiration of oranges and grapefruits harvested at different stages of
development. Plant Physiology 43: 99-102
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a bifunctional
transducer of ethylene and stress responses in Arabidopsis. Science 284: 21482152
Alonso JM, Stepanova AN (2004) The ethylene signaling pathway. Science 306: 15131515
Alonso JM, Stepanova AN, Solano R, Wisman E, Ferrari S, Ausubel FM, Ecker JR (2003)
Five components of the ethylene-response pathway identified in a screen for weak
ethylene-insensitive mutants in Arabidopsis. Proceedings of the National
Academy of Sciences of the United States of America 100: 2992-2997
An FY, Zhao QO, Ji YS, Li WY, Jiang ZQ, Yu XC, Zhang C, Han Y, He WR, Liu YD,
Zhang SQ, Ecker JR, Guo HW (2010) Ethylene-induced stabilization of
ETHYLENE INSENSITIVE3 and EIN3-LIKE1 is mediated by proteasomal
degradation of EIN3 binding F-Box 1 and 2 that requires EIN2 in Arabidopsis.
Plant Cell 22: 2384-2401
43

Andriankaja A, Boisson-Demier A, Frances L, Sauviac L, Jauneau A, Barker DG, de
Carvalho-Niebel F (2007) AP2-ERF transcription factors mediate nod factordependent mt ENOD11 activation in root hairs via a novel cis-regulatory motif.
Plant Cell 19: 2866-2885
Augustine JJ, Baker LR, Sell HM (1973) Female flower induction on androecious
cucumber, Cucumis sativus L. Journal of the American Society for Horticultural
Science 98: 197-199
Ayub R, Guis M, BenAmor M, Gillot L, Roustan JP, Latche A, Bouzayen M, Pech JC
(1996) Expression of ACC oxidase antisense gene inhibits ripening of cantaloupe
melon fruits. Nature Biotechnology 14: 862-866
Azuma T, Hirano T, Deki Y, Uchida N, Yasuda T, Yamaguchi T (1995) Involvement of
the decrease in levels of abscisic acid in the internodal elongation of submerged
floating rice. Journal of Plant Physiology 146: 323-328
Barry CS, Blume B, Bouzayen M, Cooper W, Hamilton AJ, Grierson D (1996)
Differential expression of the 1-aminocyclopropane-1-carboxylate oxidase gene
family of tomato. Plant Journal 9: 525-535
Barry CS, Giovannoni JJ (2006) Ripening in the tomato Green-ripe mutant is inhibited by
ectopic expression of a protein that disrupts ethylene signaling. Proceedings of the
National Academy of Sciences of the United States of America 103: 7923-7928
Barry CS, Giovannoni JJ (2007) Ethylene and fruit ripening. Journal of Plant Growth
Regulation 26: 143-159
Barry CS, Llop-Tous MI, Grierson D (2000) The regulation of 1-aminocyclopropane-1carboxylic acid synthase gene expression during the transition from system-1 to
system-2 ethylene synthesis in tomato. Plant Physiology 123: 979-986
Barry CS, McQuinn RP, Thompson AJ, Seymour GB, Grierson D, Giovannoni JJ (2005)
Ethylene insensitivity conferred by the Green-ripe and Never-ripe 2 ripening
mutants of tomato. Plant Physiology 138: 267-275
Beaudry RM (1999) Effect of O2 and CO2 partial pressure on selected phenomena
affecting fruit and vegetable quality. Postharvest Biology and Technology 15:
293-303
Benschop JJ, Bou J, Peeters AJM, Wagemaker N, Guhl K, Ward D, Hedden P, Moritz T,
Voesenek L (2006) Long-term submergence-induced elongation in Rumex

44

palustris requires abscisic acid-dependent biosynthesis of gibberellin. Plant
Physiology 141: 1644-1652
Berrocal-Lobo M, Molina A, Solano R (2002) Constitutive expression of ETHYLENERESPONSE-FACTOR1 in Arabidopsis confers resistance to several necrotrophic
fungi. Plant Journal 29: 23-32
Bethke G, Unthan T, Uhrig JF, Poschl Y, Gust AA, Scheel D, Lee J (2009) Flg22
regulates the release of an ethylene response factor substrate from MAP kinase 6
in Arabidopsis thaliana via ethylene signaling. Proceedings of the National
Academy of Sciences of the United States of America 106: 8067-8072
Biale JB (1964) Growth, maturation, and senescence in fruits. Science 146: 880-888
Binder BM (2008) The ethylene receptors: Complex perception for a simple gas. Plant
Science 175: 8-17
Binder BM, Rodriguez FI, Bleecker AB (2010) The copper transporter RAN1 is essential
for biogenesis of ethylene receptors in Arabidopsis. Journal of Biological
Chemistry 285: 37263-37270
Binder BM, Walker JM, Gagne JM, Emborg TJ, Hemmann G, Bleecker AB, Vierstra RD
(2007) The Arabidopsis EIN3 binding F-box proteins EBF1 and EBF2 have
distinct but overlapping roles in ethylene signaling. Plant Cell 19: 509-523
Bisson MMA, Bleckmann A, Allekotte S, Groth G (2009) EIN2, the central regulator of
ethylene signalling, is localized at the ER membrane where it interacts with the
ethylene receptor ETR1. Biochemical Journal 424: 1-6
Bisson MMA, Groth G (2010) New insight in ethylene signaling: Autokinase activity of
ETR1 modulates the interaction of receptors and EIN2. Molecular Plant 3: 882889
Bleecker AB, Estelle MA, Somerville C, Kende H (1988) Insensitivity to ethylene
conferred by a dominant mutation in Arabidopsis thaliana. Science 241: 10861089
Bleecker AB, Kende H (2000) Ethylene: A gaseous signal molecule in plants. Annual
Review of Cell and Developmental Biology 16: 1-18
Bleecker AB, Kenyon WH, Somerville SC, Kende H (1986) Use of monoclonal
antibodies in the purification and characterization of 1-aminocyclopropane-1-

45

carboxylate synthase, an enzyme in ethylene biosynthesis. Proceedings of the
National Academy of Sciences of the United States of America 83: 7755-7759
Blume B, Grierson D (1997) Expression of ACC oxidase promoter-GUS fusions in
tomato and Nicotiana plumbaginifolia regulated by developmental and
environmental stimuli. Plant Journal 12: 731-746
Boutrot F, Segonzac C, Chang KN, Qiao H, Ecker JR, Zipfel C, Rathjen JP (2010) Direct
transcriptional control of the Arabidopsis immune receptor FLS2 by the ethylenedependent transcription factors EIN3 and EIL1. Proceedings of the National
Academy of Sciences of the United States of America 107: 14502-14507
Bovy AG, Angenent GC, Dons HJM, van Altvorst AC (1999) Heterologous expression of
the Arabidopsis etr1-1 allele inhibits the senescence of carnation flowers.
Molecular Breeding 5: 301-308
Brown RL, Kazan K, McGrath KC, Maclean DJ, Manners JM (2003) A role for the
GCC-box in jasmonate-mediated activation of the PDF1.2 gene of Arabidopsis.
Plant Physiology 132: 1020-1032
Browse J (2005) Jasmonate: An oxylipin signal with many roles in plants. In Plant
Hormones, Vol 72, pp 431-456
Browse J (2009) The power of mutants for investigating jasmonate biosynthesis and
signaling. Phytochemistry 70: 1539-1546
Burg SP, Burg EA (1962) Role of ethylene in fruit ripening. Plant Physiology 37: 179189
Burg SP, Burg EA (1965) Relationship between ethylene production and ripening in
bananas. Botanical Gazette 126: 200-204
Burg SP, Burg EA (1966) Auxin-induced ethylene formation: Its relation to flowering in
pineapple. Science 152: 1269-1269
Burg SP, Thimann KV (1959) The physiology of ethylene formation in apples.
Proceedings of the National Academy of Sciences of the United States of America
45: 335-344
Buttner M, Singh KB (1997) Arabidopsis thaliana ethylene-responsive element binding
protein (AtEBP), an ethylene-inducible, GCC box DNA-binding protein interacts
with an ocs element binding protein. Proceedings of the National Academy of
Sciences of the United States of America 94: 5961-5966
46

Cancel JD, Larsen PB (2002) Loss-of-function mutations in the ethylene receptor ETR1
cause enhanced sensitivity and exaggerated response to ethylene in Arabidopsis.
Plant Physiology 129: 1557-1567
Cao WH, Dong Y, Zhang JS, Chen SY (2003) Characterization of an ethylene receptor
homolog gene from rice. Science in China Series C-Life Sciences 46: 370-378
Cao XF, Linstead P, Berger F, Kieber J, Dolan L (1999) Differential ethylene sensitivity
of epidermal cells is involved in the establishment of cell pattern in the
Arabidopsis root. Physiologia Plantarum 106: 311-317
Chae HS, Faure F, Kieber JJ (2003) The eto1, eto2, and eto3 mutations and cytokinin
treatment increase ethylene biosynthesis in Arabidopsis by increasing the stability
of ACS protein. Plant Cell 15: 545-559
Chae HS, Kieber JJ (2005) Eto Brute? Role of ACS turnover in regulating ethylene
biosynthesis. Trends in Plant Science 10: 291-296
Chang C, Kwok SF, Bleecker AB, Meyerowitz EM (1993) Arabidopsis ethyleneresponse gene ETR1: similarity of product to two-component regulators. Science
262: 539-544
Chao QM, Rothenberg M, Solano R, Roman G, Terzaghi W, Ecker JR (1997) Activation
of the ethylene gas response pathway in Arabidopsis by the nuclear protein
ETHYLENE-INSENSITIVE3 and related proteins. Cell 89: 1133-1144
Chen GP, Alexander L, Grierson D (2004) Constitutive expression of EIL-like
transcription factor partially restores ripening in the ethylene-insensitive Nr
tomato mutant. Journal of Experimental Botany 55: 1491-1497
Chen HM, Xue L, Chintamanani S, Germain H, Lin HQ, Cui HT, Cai R, Zuo JR, Tang
XY, Li X, Guo HW, Zhou JM (2009) ETHYLENE INSENSITIVE3 and
ETHYLENE INSENSITIVE3-LIKE1 Repress SALICYLIC ACID INDUCTION
DEFICIENT2 Expression to Negatively Regulate Plant Innate Immunity in
Arabidopsis. Plant Cell 21: 2527-2540
Chen YF, Randlett MD, Findell JL, Schaller GE (2002) Localization of the ethylene
receptor ETR1 to the endoplasmic reticulum of Arabidopsis. Journal of Biological
Chemistry 277: 19861-19866
Chen YF, Shakeel SN, Bowers J, Zhao XC, Etheridge N, Schaller GE (2007) Ligandinduced degradation of the ethylene receptor ETR2 through a proteasome-

47

dependent pathway in Arabidopsis. Journal of Biological Chemistry 282: 2475224758
Cho YH, Yoo SD (2007) ETHYLENE RESPONSE 1 histidine kinase activity of
Arabidopsis promotes plant growth. Plant Physiology 143: 612-616
Chou T, Talalay P (1972) The mechanism of S-adenosyl-L-methionine synthesis by
purified preparations of bakers'yeast. Biochemistry 11: 1065-1073
Christians MJ, Gingerich DJ, Hansen M, Binder BM, Kieber JJ, Vierstra RD (2009) The
BTB ubiquitin ligases ETO1, EOL1 and EOL2 act collectively to regulate
ethylene biosynthesis in Arabidopsis by controlling type-2 ACC synthase levels.
Plant Journal 57: 332-345
Clark KL, Larsen PB, Wang XX, Chang C (1998) Association of the Arabidopsis CTR1
Raf-like kinase with the ETR1 and ERS ethylene receptors. Proceedings of the
National Academy of Sciences of the United States of America 95: 5401-5406
Cooke AR, Randall DI (1968) 2-Haloethanephosphonic acids as ethylene releasing agents
for the induction of flowering in pineapples. Nature 218: 974-975
Dandekar AM, Teo G, Defilippi BG, Uratsu SL, Passey AJ, Kader AA, Stow JR, Colgan
RJ, James DJ (2004) Effect of down-regulation of ethylene biosynthesis on fruit
flavor complex in apple fruit. Transgenic Research 13: 373-384
Denny FB (1924) Hastening the coloration of lemons. Journal of Agricultural Research
27: 0757-0769
Dharmasiri N, Dharmasiri S, Estelle M (2005) The F-box protein TIR1 is an auxin
receptor. Nature 435: 441-445
Dilley DR (2006) Development of controlled atmosphere storage technologies. Stewart
Postharvest Review 2: 1-8
Dolan L (2001) The role of ethylene in root hair growth in Arabidopsis. Journal of Plant
Nutrition and Soil Science-Zeitschrift Fur Pflanzenernahrung Und Bodenkunde
164: 141-145
Dong CH, Jang M, Scharein B, Malach A, Rivarola M, Liesch J, Groth G, Hwang I,
Chang C (2010) Molecular association of the Arabidopsis ETR1 ethylene receptor
and a regulator of ethylene signaling, RTE1. Journal of Biological Chemistry 285:
40706-40713

48

Dong CH, Rivarola M, Resnick JS, Maggin BD, Chang C (2008) Subcellular colocalization of Arabidopsis RTE1 and ETR1 supports a regulatory role for RTE1
in ETR1 ethylene signaling. Plant Journal 53: 275-286
Doubt SL (1917) The response of plants to illumination gas. Botanical Gazette 63: 209224
Eckardt NA (2005) Brassinosteroid perception and signaling: Heterodimerization and
phosphorylation of receptor-like kinases BRI1 and BAK1. Plant Cell 17: 16381640
El-Kereamy A, Chervin C, Roustan JP, Cheynier V, Souquet JM, Moutounet M, Raynal J,
Ford C, Latche A, Pech JC, Bouzayen M (2003) Exogenous ethylene stimulates
the long-term expression of genes related to anthocyanin biosynthesis in grape
berries. Physiologia Plantarum 119: 175-182
Ellis C, Turner JG (2002) A conditionally fertile coi1 allele indicates cross-talk between
plant hormone signalling pathways in Arabidopsis thaliana seeds and young
seedlings. Planta 215: 549-556
Estelle MA, Somerville CR (1986) The mutants of Arabidopsis. Trends in Genetics 2: 8993
Fischer AM (2012) The Complex Regulation of Senescence. Critical Reviews in Plant
Sciences 31: 124-147
Flores F, El Yahyaoui F, de Billerbeck G, Romojaro F, Latche A, Bouzayen M, Pech JC,
Ambid C (2002) Role of ethylene in the biosynthetic pathway of aliphatic ester
aroma volatiles in Charentais Cantaloupe melons. Journal of Experimental Botany
53: 201-206
Flores FB, Martinez-Madrid MC, Sanchez-Hidalgo FJ, Romojaro F (2001) Differential
rind and pulp ripening of transgenic antisense ACC oxidase melon. Plant
Physiology and Biochemistry 39: 37-43
Frye CA, Tang DZ, Innes RW (2001) Negative regulation of defense responses in plants
by a conserved MAPKK kinase. Proceedings of the National Academy of
Sciences of the United States of America 98: 373-378
Fu DQ, Zhu BZ, Zhu HL, Jiang WB, Luo YB (2005) Virus-induced gene silencing in
tomato fruit. Plant Journal 43: 299-308

49

Fujii H, Verslues PE, Zhu JK (2007) Identification of two protein kinases required for
abscisic acid regulation of seed germination, root growth, and gene expression in
Arabidopsis. Plant Cell 19: 485-494
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis ethyleneresponsive element binding factors act as transcriptional activators or repressors
of GCC box-mediated gene expression. Plant Cell 12: 393-404
Fujisawa M, Nakano T, Ito Y (2011) Identification of potential target genes for the
tomato fruit-ripening regulator RIN by chromatin immunoprecipitation. Bmc
Plant Biology 11: 26-42
Fukao T, Bailey-Serres J (2008) Submergence tolerance conferred by Sub1A is mediated
by SLR1 and SLRL1 restriction of gibberellin responses in rice. Proceedings of
the National Academy of Sciences of the United States of America 105: 1681416819
Fukao T, Xu KN, Ronald PC, Bailey-Serres J (2006) A variable cluster of ethylene
response factor-like genes regulates metabolic and developmental acclimation
responses to submergence in rice. Plant Cell 18: 2021-2034
Gallie DR, Young TE (2004) The ethylene biosynthetic and perception machinery is
differentially expressed during endosperm and embryo development in maize.
Molecular Genetics and Genomics 271: 267-281
Gamble RL, Coonfield ML, Schaller GE (1998) Histidine kinase activity of the ETR1
ethylene receptor from Arabidopsis. Proceedings of the National Academy of
Sciences of the United States of America 95: 7825-7829
Gane R (1934) Production of ethylene by some ripening fruits. Nature 134: 1008-1008
Gao Z, Wen CK, Binder BM, Chen YF, Chang J, Chiang YH, Ill RJK, Chang C, Schaller
GE (2008) Heteromeric interactions among ethylene receptors mediate signaling
in Arabidopsis. Journal of Biological Chemistry 283: 23801-23810
Gao ZY, Chen YF, Randlett MD, Zhao XC, Findell JL, Kieber JJ, Schaller GE (2003)
Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of
Arabidopsis through participation in ethylene receptor signaling complexes.
Journal of Biological Chemistry 278: 34725-34732
Giovannoni JJ (2004) Genetic regulation of fruit development and ripening. Plant Cell 16:
S170-S180

50

Goldschmidt EE, Huberman M, Goren R (1993) Probing the role of endogenous ethylene
in the degreening of citrus-fruit with ethylene antagonists. Plant Growth
Regulation 12: 325-329
Gomez-Roldan V, Fermas S, Brewer PB, Puech-Pages V, Dun EA, Pillot JP, Letisse F,
Matusova R, Danoun S, Portais JC, Bouwmeester H, Becard G, Beveridge CA,
Rameau C, Rochange SF (2008) Strigolactone inhibition of shoot branching.
Nature 455: 189-195
Goodlass G, Smith KA (1979) Effects of ethylene on root extension and nodulation of
pea (Pisum sativum L.) and white clover (Trifolium repens L.) Plant and Soil 51:
387-395
Grefen C, Stadele K, Ruzicka K, Obrdlik P, Harter K, Horak J (2008) Subcellular
localization and in vivo interactions of the Arabidopsis thaliana ethylene receptor
family members. Molecular Plant 1: 308-320
Griffiths J, Murase K, Rieu I, Zentella R, Zhang ZL, Powers SJ, Gong F, Phillips AL,
Hedden P, Sun TP, Thomas SG (2006) Genetic characterization and functional
analysis of the GID1 gibberellin receptors in Arabidopsis. Plant Cell 18: 33993414
Gubrium EK, Clevenger DJ, Clark DG, Barrett JE, Nell TA (2000) Reproduction and
horticultural performance of transgenic ethylene-insensitive petunias. Journal of
the American Society for Horticultural Science 125: 277-281
Guo HW, Ecker JR (2003) Plant responses to ethylene gas are mediated by SCF
(EBF1/EBF2)-dependent proteolysis of EIN3 transcription factor. Cell 115: 667677
Guo HW, Ecker JR (2004) The ethylene signaling pathway: new insights. Current
Opinion in Plant Biology 7: 40-49
Gutterson N, Reuber TL (2004) Regulation of disease resistance pathways by AP2/ERF
transcription factors. Current Opinion in Plant Biology 7: 465-471
Guzman P, Ecker JR (1990) Exploiting the triple response of Arabidopsis to identify
ethylene-related mutants Plant Cell 2: 513-523
Hadfield KA, Rose JKC, Bennett AB (1995) The respiratory climacteric is present in
Charentais (Cucumis melo cv. Reticulatus F1 Alpha) melons ripened on or off the
plant. Journal of Experimental Botany 46: 1923-1925

51

Haji T, Yaegaki H, Yamaguchi M (2001) Changes in ethylene production and flesh
firmness of melting, nonmelting and stony hard peaches after harvest. Journal of
the Japanese Society for Horticultural Science 70: 458-459
Hall A-E, Chen Q-G, Findell J-L, Schaller G-E, Bleecker A-B (1999) The relationship
between ethylene binding and dominant insensitivity conferred by mutant forms
of the ETR1 ethylene receptor. Plant Physiology 121: 291-299
Hall AE, Bleecker AB (2003) Analysis of combinatorial loss-of-function mutants in the
Arabidopsis ethylene receptors reveals that the ers1 etr1 double mutant has severe
developmental defects that are EIN2 dependent. Plant Cell 15: 2032-2041
Hall AE, Findell JL, Schaller GE, Sisler EC, Bleecker AB (2000) Ethylene perception by
the ERS1 protein in Arabidopsis. Plant Physiology 123: 1449-1457
Hamilton AJ, Bouzayen M, Grierson D (1991) Identification of a tomato gene for the
ethylene-forming enzyme by expression in yeast. Proceedings of the National
Academy of Sciences of the United States of America 88: 7434-7437
Hamilton AJ, Lycett GW, Grierson D (1990) Antisense gene that inhibits synthesis of the
hormone ethylene in transgenic plants. Nature 346: 284-287
Hanson AD, Kende H (1976) Methionine metabolism and ethylene biosynthesis in
senescent flower tissue of morning-glory. Plant Physiology 57: 528-537
Hao DY, Ohme-Takagi M, Sarai A (1998) Unique mode of GCC box recognition by the
DNA-binding domain of ethylene-responsive element-binding factor (ERF
domain) in plant. Journal of Biological Chemistry 273: 26857-26861
Hao JF, Niu YD, Yang BJ, Gao F, Zhang LQ, Wang J, Hasi A (2011) Transformation of
a marker-free and vector-free antisense ACC oxidase gene cassette into melon via
the pollen-tube pathway. Biotechnology Letters 33: 55-61
Harada T, Sunako T, Wakasa Y, Soejima J, Satoh T, Niizeki M (2000) An allele of the 1aminocyclopropane-1-carboxylate synthase gene (Md-ACS1) accounts for the low
level of ethylene production in climacteric fruits of some apple cultivars.
Theoretical and Applied Genetics 101: 742-746
Hattori Y, Miura K, Asano K, Yamamoto E, Mori H, Kitano H, Matsuoka M, Ashikari M
(2007) A major QTL confers rapid internode elongation in response to water rise
in deepwater rice. Breeding Science 57: 305-314

52

Hattori Y, Nagai K, Ashikari M (2011) Rice growth adapting to deepwater. Current
Opinion in Plant Biology 14: 100-105
Hattori Y, Nagai K, Furukawa S, Song XJ, Kawano R, Sakakibara H, Wu JZ, Matsumoto
T, Yoshimura A, Kitano H, Matsuoka M, Mori H, Ashikari M (2009) The
ethylene response factors SNORKEL1 and SNORKEL2 allow rice to adapt to deep
water. Nature 460: 1026-1031
Hattori Y, Nagai K, Mori H, Kitano H, Matsuoka M, Ashikari M (2008) Mapping of
three QTLs that regulate internode elongation in deepwater rice. Breeding Science
58: 39-46
Hirayama T, Kieber JJ, Hirayama N, Kogan M, Guzman P, Nourizadeh S, Alonso JM,
Dailey WP, Dancis A, Ecker JR (1999) Responsive-to-antagonist1, a
Menkes/Wilson disease-related copper transporter, is required for ethylene
signaling in Arabidopsis. Cell 97: 383-393
Hoffmann-Benning S, Kende H (1992) On the role of abscisic acid and gibberellin in the
regulation of growth in rice. Plant Physiology 99: 1156-1161
Hsieh TH, Lee JT, Yang PT, Chiu LH, Charng YY, Wang YC, Chan MT (2002)
Heterology expression of the Arabidopsis C-repeat/dehydration response element
binding factor 1 gene confers elevated tolerance to chilling and oxidative stresses
in transgenic tomato. Plant Physiology 129: 1086-1094
Hu ZL, Deng L, Chen XQ, Wang PQ, Chen GP (2010) Co-suppression of the EIN2homology gene LeEIN2 inhibits fruit ripening and reduces ethylene sensitivity in
tomato. Russian Journal of Plant Physiology 57: 554-559
Hua J, Chang C, Sun Q, Meyerowitz EM (1995) Ethylene insensitivity conferred by
Arabidopsis ERS gene. Science 269: 1712-1714
Hua J, Meyerowitz EM (1998) Ethylene responses are negatively regulated by a receptor
gene family in Arabidopsis thaliana. Cell 94: 261-271
Hua J, Sakai H, Nourizadeh S, Chen QHG, Bleecker AB, Ecker JR, Meyerowitz EM
(1998) EIN4 and ERS2 are members of the putative ethylene receptor gene family
in Arabidopsis. Plant Cell 10: 1321-1332
Huang SZ, Sawaki T, Takahashi A, Mizuno S, Takezawa K, Matsumura A, Yokotsuka M,
Hirasawa Y, Sonoda M, Nakagawa H, Sato T (2010) Melon EIN3-like
transcription factors (CmEIL1 and CmEIL2) are positive regulators of an

53

ethylene- and ripening-induced 1-aminocyclopropane-1-carboxylic acid oxidase
gene (CM-ACO1). Plant Science 178: 251-257
Inoue T, Higuchi M, Hashimoto Y, Seki M, Kobayashi M, Kato T, Tabata S, Shinozaki K,
Kakimoto T (2001) Identification of CRE1 as a cytokinin receptor from
Arabidopsis. Nature 409: 1060-1063
Ito Y, Kitagawa M, Ihashi N, Yabe K, Kimbara J, Yasuda J, Ito H, Inakuma T, Hiroi S,
Kasumi T (2008) DNA-binding specificity, transcriptional activation potential,
and the rin mutation effect for the tomato fruit-ripening regulator RIN. Plant
Journal 55: 212-223
Jackson MB (1985) Ethylene and responses of plants to soil waterlogging and
submergence. Annual Review of Plant Physiology and Plant Molecular Biology
36: 145-174
Jiang C, Iu B, Singh J (1996) Requirement of a CCGAC cis-acting element for cold
induction of the BN115 gene from winter Brassica napus. Plant Molecular
Biology 30: 679-684
Joo S, Liu Y, Lueth A, Zhang SQ (2008) MAPK phosphorylation-induced stabilization of
ACS6 protein is mediated by the non-catalytic C-terminal domain, which also
contains the cis-determinant for rapid degradation by the 26S proteasome pathway.
Plant Journal 54: 129-140
Jun SH, Han MJ, Lee S, Seo YS, Kim WT, An GH (2004) OsEIN2 is a positive
component in ethylene signaling in rice. Plant and Cell Physiology 45: 281-289
Kader AA, Zagory D, Kerbel EL (1989) Modified atmosphere packaging of fruits and
vegetables. Critical Reviews in Food Science and Nutrition 28: 1-30
Kamiyoshihara Y, Iwata M, Fukaya T, Tatsuki M, Mori H (2010) Turnover of LeACS2, a
wound-inducible 1-aminocyclopropane-1-carboxylic acid synthase in tomato, is
regulated by phosphorylation/dephosphorylation. Plant Journal 64: 140-150
Karikari SK, Marriott J, Hutchins P (1979) Changes during the respiraory climacteric
ripening plantain fruits. Scientia Horticulturae 10: 369-376
Katz E, Lagunes PM, Riov J, Weiss D, Goldschmidt EE (2004) Molecular and
physiological evidence suggests the existence of a system II-like pathway of
ethylene production in non-climacteric Citrus fruit. Planta 219: 243-252

54

Kende H (1993) Ethylene biosynthesis. Annual Review of Plant Physiology and Plant
Molecular Biology 44: 283-307
Kende H, van der Knaap E, Cho HT (1998) Deepwater rice: a model plant to study stem
elongation. Plant Physiology 118: 1105-1110
Kendrick MD, Chang C (2008) Ethylene signaling: new levels of complexity and
regulation. Current Opinion in Plant Biology 11: 479-485
Kepinski S, Leyser O (2005) The Arabidopsis F-box protein TIR1 is an auxin receptor.
Nature 435: 446-451
Kevany BM, Tieman DM, Taylor MG, Dal Cin V, Klee HJ (2007) Ethylene receptor
degradation controls the timing of ripening in tomato fruit. Plant Journal 51: 458467
Kieber JJ, Ecker JR (1993) Ethylene gas: its not just for ripening any more! Trends in
Genetics 9: 356-362
Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR (1993) CTR1, a negative
regulator of the ethylene response pathway in Arabidopsis, encodes a member of
the RAF family of protein-kinases. Cell 72: 427-441
Klee HJ (2002) Control of ethylene-mediated processes in tomato at the level of receptors.
Journal of Experimental Botany 53: 2057-2063
Klee HJ (2004) Ethylene signal transduction. Moving beyond Arabidopsis. Plant
Physiology 135: 660-667
Knoester M, van Loon LC, van den Heuvel J, Hennig J, Bol JF, Linthorst HJM (1998)
Ethylene-insensitive tobacco lacks nonhost resistance against soil-borne fungi.
Proceedings of the National Academy of Sciences of the United States of America
95: 1933-1937
Konishi M, Yanagisawa S (2008) Ethylene signaling in Arabidopsis involves feedback
regulation via the elaborate control of EBF2 expression by EIN3. Plant Journal 55:
821-831
Kumar V, Parvatam G, Ravishankar GA (2009) AgNO3 - a potential regulator of ethylene
activity and plant growth modulator. Electronic Journal of Biotechnology 12
Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1994) The Never ripe mutation blocks
ethylene perception in tomato. Plant Cell 6: 521-530
55

Larsen PB, Chang C (2001) The Arabidopsis eer1 mutant has enhanced ethylene
responses in the hypocotyl and stem. Plant Physiology 125: 1061-1073
Lashbrook CC, Tieman DM, Klee HJ (1998) Differential regulation of the tomato ETR
gene family throughout plant development. Plant Journal 15: 243-252
Leclercq J, Adams-Phillips LC, Zegzouti H, Jones B, Latche A, Giovannoni JJ, Pech JC,
Bouzayen M (2002) LeCTR1, a tomato CTR1-like gene, demonstrates ethylene
signaling ability in Arabidopsis and novel expression patterns in tomato. Plant
Physiology 130: 1132-1142
Lee KH, Larue TA (1992) Exogenous ethylene inhibits nodulation of Pisum sativum L.
cv sparkle. Plant Physiology 100: 1759-1763
Lehman A, Black R, Ecker JR (1996) HOOKLESS1, an ethylene response gene, is
required for differential cell elongation in the Arabidopsis hypocotyl. Cell 85:
183-194
Lei G, Shen M, Li ZG, Zhang B, Duan KX, Wang N, Cao YR, Zhang WK, Ma B, Ling
HQ, Chen SY, Zhang JS (2011) EIN2 regulates salt stress response and interacts
with a MA3 domain-containing protein ECIP1 in Arabidopsis. Plant Cell and
Environment 34: 1678-1692
Li H, Johnson P, Stepanova A, Alonso JM, Ecker JR (2004) Convergence of signaling of
differential cell growth pathways in the control in Arabidopsis. Developmental
Cell 7: 193-204
Lin Z, Hackett, R.M., Payton, S. andGrierson,D (1998) A tomato sequence, TCTR2
(accession no. AJ005077), encoding an Arabidopsis CTR1 homologue. Plant
Physiology 117: 1126-1126
Lin ZF, Alexander L, Hackett R, Grierson D (2008) LeCTR2, a CTR1-like protein kinase
from tomato, plays a role in ethylene signalling, development and defence. Plant
Journal 54: 1083-1093
Lin ZF, Ho CW, Grierson D (2009) AtTRP1 encodes a novel TPR protein that interacts
with the ethylene receptor ERS1 and modulates development in Arabidopsis.
Journal of Experimental Botany 60: 3697-3714
Lin ZF, Zhong SL, Grierson D (2009) Recent advances in ethylene research. Journal of
Experimental Botany 60: 3311-3336

56

Lincoln JE, Campbell AD, Oetiker J, Rottmann WH, Oeller PW, Shen NF, Theologis A
(1993) LE-ACS4, a fruit ripening and wound-induced 1-aminocyclopropane-1carboxylate synthase gene of tomato (Lycopersicon esculentum): expression in
Escherichia coli structural characterization, expression characteristics, and
phylogenetic analysis. Journal of Biological Chemistry 268: 19422-19430
Little HA, Papadopoulou E, Hammar SA, Grumet R (2007) The influence of ethylene
perception on sex expression in melon (Cucumis melo L.) as assessed by
expression of the mutant ethylene receptor, At-etr1-1, under the control of
constitutive and floral targeted promoters. Sexual Plant Reproduction 20: 123-136
Liu Q, Xu C, Wen CK (2010) Genetic and transformation studies reveal negative
regulation of ERS1 ethylene receptor signaling in Arabidopsis. Bmc Plant
Biology 10: 60-73
Liu YD, Zhang SQ (2004) Phosphorylation of 1-aminocyclopropane-1-carboxylic acid
synthase by MPK6, a stress-responsive mitogen-activated protein kinase, induces
ethylene biosynthesis in Arabidopsis. Plant Cell 16: 3386-3399
Loake G, Grant M (2007) Salicylic acid in plant defence-the players and protagonists.
Current Opinion in Plant Biology 10: 466-472
Lopez-Gomez R, Cabrera-Ponce JL, Saucedo-Arias LJ, Carreto-Montoya L, VillanuevaArce R, Diaz-Perez JC, Gomez-Lim MA, Herrera-Estrella L (2009) Ripening in
papaya fruit is altered by ACC oxidase cosuppression. Transgenic Research 18:
89-97
Lorenzo O, Piqueras R, Sanchez-Serrano JJ, Solano R (2003) ETHYLENE RESPONSE
FACTOR1 integrates signals from ethylene and jasmonate pathways in plant
defense. Plant Cell 15: 165-178
Ma B, Cui ML, Sun HJ, Takada K, Mori H, Kamada H, Ezura H (2006) Subcellular
localization and membrane topology of the melon ethylene receptor CmERS1.
Plant Physiology 141: 587-597
Ma BO, Chen SY, Zhang JS (2010) Ethylene signaling in rice. Chinese Science Bulletin
55: 2204-2210
Ma QH, Wang XM (2003) Characterization of an ethylene receptor homologue from
wheat and its expression during leaf senescence. Journal of Experimental Botany
54: 1489-1490

57

Mahonen AP, Higuchi M, Tormakangas K, Miyawaki K, Pischke MS, Sussman MR,
Helariutta Y, Kakimoto T (2006) Cytokinins regulate a bidirectional phosphorelay
network in Arabidopsis. Current Biology 16: 1116-1122
Manzano S, Martinez C, Gomez P, Garrido D, Jamilena M (2010) Cloning and
characterisation of two CTR1-like genes in Cucurbita pepo: regulation of their
expression during male and female flower development. Sexual Plant
Reproduction 23: 301-313
Masucci JD, Schiefelbein JW (1994) The rhd6 mutation of Arabidopsis thaliana alters
root-hair initiation through an auxin- and ethylene-associated process. Plant
Physiology 106: 1335-1346
Matusova R, Rani K, Verstappen FWA, Franssen MCR, Beale MH, Bouwmeester HJ
(2005) The strigolactone germination stimulants of the plant-parasitic Striga and
Orobanche spp. are derived from the carotenoid pathway. Plant Physiology 139:
920-934
MauchMani B, Slusarenko AJ (1996) Production of salicylic acid precursors is a major
function of phenylalanine ammonia-lyase in the resistance of arabidopsis to
Peronospora parasitica. Plant Cell 8: 203-212
McGrath KC, Dombrecht B, Manners JM, Schenk PM, Edgar CI, Maclean DJ, Scheible
WR, Udvardi MK, Kazan K (2005) Repressor- and activator-type ethylene
response factors functioning in jasmonate signaling and disease resistance
identified via a genome-wide screen of Arabidopsis transcription factor gene
expression. Plant Physiology 139: 949-959
McMurchie EJ, McGlasso WB, Eaks IL (1972) Treatment of fruit with propylene gives
information about biogenesis of ethylene. Nature 237: 235-236
McMurray AL, Miller CH (1968) Cucumber sex expression modified by 2-chloroethane
phosphonic acid. Science 162: 1397-1398
McNamara ST, Mitchell CA (1991) Roles of auxin and ethylene in adventitious root
formation by a flood-resistant tomato genotype. Hortscience 26: 57-58
Meyerowitz EM (1987) Arabidopsis thaliana. Annual Review of Genetics 21: 93-111
Meyerowitz EM (2001) Prehistory and history of Arabidopsis research. Plant Physiology
125: 15-19

58

Meyerowitz EM, Pruitt RE (1985) Arabidopsis thaliana and plant molecular genetics.
Science 229: 1214-1218
Miccolis V, Saltveit ME (1991) Morphological and physiological changes during fruit
growth and maturation of seven melon cultivars. Journal of the American Society
for Horticultural Science 116: 1025-1029
Miyazaki JH, Yang SF (1987) The methionine salvage pathway in relation to ethylene
and polyamine biosynthesis. Physiologia Plantarum 69: 366-370
Moeder W, Barry CS, Tauriainen AA, Betz C, Tuomainen J, Utriainen M, Grierson D,
Sandermann H, Langebartels C, Kangasjarvi J (2002) Ethylene synthesis
regulated by biphasic induction of 1-aminocyclopropane-1-carboxylic acid
synthase and 1-aminocyclopropane-1-carboxylic acid oxidase genes is required
for hydrogen peroxide accumulation and cell death in ozone-exposed tomato.
Plant Physiology 130: 1918-1926
Moon J, Parry G, Estelle M (2004) The ubiquitin-proteasome pathway and plant
development. Plant Cell 16: 3181-3195
Morant M, Ekstrom C, Ulvskov P, Kristensen C, Rudemo M, Olsen CE, Hansen J,
Jorgensen K, Jorgensen B, Moller BL, Bak S (2010) Metabolomic, transcriptional,
hormonal, and signaling cross-talk in superroot2. Molecular Plant 3: 192-211
Moussatche P, Klee HJ (2004) Autophosphorylation activity of the Arabidopsis ethylene
receptor multigene family. Journal of Biological Chemistry 279: 48734-48741
Nagai K, Hattori Y, Ashikari M (2010) Stunt or elongate? Two opposite strategies by
which rice adapts to floods. Journal of Plant Research 123: 303-309
Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF
gene family in Arabidopsis and rice. Plant Physiology 140: 411-432
Nakatsuka A, Murachi S, Okunishi H, Shiomi S, Nakano R, Kubo Y, Inaba A (1998)
Differential expression and internal feedback regulation of 1-aminocyclopropane1-carboxylate synthase, 1-aminocyclopropane-1-carboxylate oxidase, and
ethylene receptor genes in tomato fruit during development and ripening. Plant
Physiology 118: 1295-1305
Narusaka Y, Nakashima K, Shinwari ZK, Sakuma Y, Furihata T, Abe H, Narusaka M,
Shinozaki K, Yamaguchi-Shinozaki K (2003) Interaction between two cis-acting
elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A

59

gene in response to dehydration and high-salinity stresses. Plant Journal 34: 137148
Oeller PW, Wong LM, Taylor LP, Pike DA, Theologis A (1991) Reversible inhibition of
tomato fruit senescence by antisense RNA. Science 254: 437-439
Ohme-Takagi M, Shinshi H (1995) Ethylene-inducible DNA binding proteins that
interact with an ethylene-responsive element. Plant Cell 7: 173-182
Ohta M, Ohme-Takagi M, Shinshi H (2000) Three ethylene-responsive transcription
factors in tobacco with distinct transactivation functions. Plant Journal 22: 29-38
Olmedo G, Guo HW, Gregory BD, Nourizadeh SD, Aguilar-Henonin L, Li HJ, An FY,
Guzman P, Ecker JR (2006) ETHYLENE-INSENSITIVE5 encodes a 5 '-> 3 '
exoribonuclease required for regulation of the EIN3-targeting F-box proteins
EBF1/2. Proceedings of the National Academy of Sciences of the United States of
America 103: 13286-13293
Olson DC, White JA, Edelman L, Harkins RN, Kende H (1991) Differential expression
of two genes for 1-aminocyclopropane-1-carboxylate synthase in tomato fruits.
Proceedings of the National Academy of Sciences of the United States of America
88: 5340-5344
Onate-Sanchez L, Anderson JP, Young J, Singh KB (2007) AtERF14, a member of the
ERF family of transcription factors, plays a nonredundant role in plant defense.
Plant Physiology 143: 400-409
Onate-Sanchez L, Singh KB (2002) Identification of Arabidopsis ethylene-responsive
element binding factors with distinct induction kinetics after pathogen infection.
Plant Physiology 128: 1313-1322
Oraguzie NC, Iwanami H, Soejima J, Harada T, Hall A (2004) Inheritance of the MdACS1 gene and its relationship to fruit softening in apple (Malus x domestica
Borkh.). Theoretical and Applied Genetics 108: 1526-1533
Owens LD, Lieberma.M, Kunishi A (1971) Inhibition of ethylene production by
rhizobitoxine. Plant Physiology 48: 1-4
Papadopoulou E, Little HA, Hammar SA, Grumet R (2005) Effect of modified
endogenous ethylene production on sex expression, bisexual flower development
and fruit production in melon (Cucumis melo L.). Sexual Plant Reproduction 18:
131-142

60

Parry AD, Horgan R (1992) Abscisic acid biosynthesis in roots. 1. The identification of
potential abscisic acid precursors, and other carotenoids. Planta 187: 185-191
Payton S, Fray RG, Brown S, Grierson D (1996) Ethylene receptor expression is
regulated during fruit ripening, flower senescence and abscission. Plant Molecular
Biology 31: 1227-1231
Peiser GD, Wang TT, Hoffman NE, Yang SF, Liu HW, Walsh CT (1984) Formation of
cyanide from carbon-1 of 1-aminocyclopropane-1-carboxylic acid during its
conversion to ethylene. Proceedings of the National Academy of Sciences of the
United States of America-Biological Sciences 81: 3059-3063
Peng HP, Lin TY, Wang NN, Shih MC (2005) Differential expression of genes encoding
1-aminocyclopropane-1-carboxylate synthase in Arabidopsis during hypoxia.
Plant Molecular Biology 58: 15-25
Penmetsa RV, Uribe P, Anderson J, Lichtenzveig J, Gish JC, Nam YW, Engstrom E, Xu
K, Sckisel G, Pereira M, Baek JM, Lopez-Meyer M, Long SR, Harrison MJ,
Singh KB, Kiss GB, Cook DR (2008) The Medicago truncatula ortholog of
Arabidopsis EIN2, sickle, is a negative regulator of symbiotic and pathogenic
microbial associations. Plant Journal 55: 580-595
Perin C, Gomez-Jimenez M, Hagen L, Dogimont C, Pech JC, Latche A, Pitrat M,
Lelievre JM (2002) Molecular and genetic characterization of a non-climacteric
phenotype in melon reveals two loci conferring altered ethylene response in fruit.
Plant Physiology 129: 300-309
Phatak SC, Jaworski CA, Liptay A (1981) Flowering and adventitious root growth of
tomato cultivars as influenced by ethephon. Hortscience 16: 181-182
Picton S, Barton SL, Bouzayen M, Hamilton AJ, Grierson D (1993) Altered fruit ripening
and leaf senescence in tomatoes expressing an antisense ethylene-forming enzyme
transgene. Plant Journal 3: 469-481
Potuschak T, Lechner E, Parmentier Y, Yanagisawa S, Grava S, Koncz C, Genschik P
(2003) EIN3-dependent regulation of plant ethylene hormone signaling by two
Arabidopsis F box proteins: EBF1 and EBF2. Cell 115: 679-689
Pre M, Atallah M, Champion A, De Vos M, Pieterse CMJ, Memelink J (2008) The
AP2/ERF domain transcription factor ORA59 integrates jasmonic acid and
ethylene signals in plant defense. Plant Physiology 147: 1347-1357

61

Purvis AC, Barmore CR (1981) Involvement of ethylene in chlorophyll degradation in
peel of citrus-fruits. Plant Physiology 68: 854-856
Qiao H, Chang KN, Yazaki J, Ecker JR (2009) Interplay between ethylene, ETP1/ETP2
F-box proteins, and degradation of EIN2 triggers ethylene responses in
Arabidopsis. Genes & Development 23: 512-521
Qiao H, Shen Z, Huang S-sC, Schmitz RJ, Urich MA, Briggs SP, Ecker JR (2012)
Processing and subcellular trafficking of ER-tethered EIN2 control response to
ethylene gas. Science
Qin F, Sakuma Y, Tran LSP, Maruyama K, Kidokoro S, Fujita Y, Fujita M, Umezawa T,
Sawano Y, Miyazono KI, Tanokura M, Shinozaki K, Yamaguchi-Shinozaki K
(2008) Arabidopsis DREB2A-interacting proteins function as RING E3 ligases
and negatively regulate plant drought stress-responsive gene expression. Plant
Cell 20: 1693-1707
Qu X, Hall BP, Gao ZY, Schaller GE (2007) A strong constitutive ethylene-response
phenotype conferred on Arabidopsis plants containing null mutations in the
ethylene receptors ETR1 and ERS1. Bmc Plant Biology 7: 3-17
Ravanel S, Gakiere B, Job D, Douce R (1998) The specific features of methionine
biosynthesis and metabolism in plants. Proceedings of the National Academy of
Sciences of the United States of America 95: 7805-7812
Resnick JS, Rivarola M, Chang C (2008) Involvement of RTE1 in conformational
changes promoting ETR1 ethylene receptor signaling in Arabidopsis. Plant
Journal 56: 423-431
Resnick JS, Wen CK, Shockey JA, Chang C (2006) REVERSION-TO-ETHYLENE
SENSITIVITY1, a conserved gene that regulates ethylene receptor function in
Arabidopsis. Proceedings of the National Academy of Sciences of the United
States of America 103: 7917-7922
Rivarola M, McClellan CA, Resnick JS, Chang C (2009) ETR1-specific mutations
distinguish ETR1 from other Arabidopsis ethylene receptors as revealed by
genetic interaction with RTE1. Plant Physiology 150: 547-551
Robbins JA, Kays SJ, Dirr MA (1983) Enhanced rooting of wounded mung bean cuttings
by wounding and ethephon. Journal of the American Society for Horticultural
Science 108: 325-329

62

Roberts JA, Schindler CB, Tucker GA (1984) Ethylene-promoted tomato flower
abscission and the possible involvement of an inhibitor. Planta 160: 159-163
Rodriguez F-I, Esch J-J, Hall A-E, Binder B-M, Schaller G-E, Bleecker A-B (1999) A
copper cofactor for the ethylene receptor ETR1 from Arabidopsis. Science
(Washington D C) 283: 996-998
Rogiers SY, Kumar GNM, Knowles NR (1998) Regulation of ethylene production and
ripening by saskatoon (Amelanchier alnifolia Nutt.) fruit. Canadian Journal of
Botany-Revue Canadienne De Botanique 76: 1743-1754
Roman G, Lubarsky B, Kieber JJ, Rothenberg M, Ecker JR (1995) Genetic analysis of
ethylene signal transduction in Arabidopsis thaliana: five novel mutant loci
integrated into a stress response pathway. Genetics 139: 1393-1409
Rottmann WH, Peter GF, Oeller PW, Keller JA, Shen NF, Nagy BP, Taylor LP,
Campbell AD, Theologis A (1991) 1-aminocyclopropane-1-carboxylate synthase
in tomato is encoded by a multigene family whose transcription is induced during
fruit and floral senescence. Journal of Molecular Biology 222: 937-961
Rudich J, Halevy AH, Kedar N (1969) Increase in femaleness of three cucurbits by
treatment with etherel, an ethylene-releasing compound. Planta 86: 69-76
Sakai H, Hua J, Chen QHG, Chang CR, Medrano LJ, Bleecker AB, Meyerowitz EM
(1998) ETR2 is an ETR1-like gene involved in ethylene signaling in Arabidopsis.
Proceedings of the National Academy of Sciences of the United States of America
95: 5812-5817
Sakuma Y, Liu Q, Dubouzet JG, Abe H, Shinozaki K, Yamaguchi-Shinozaki K (2002)
DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs,
transcription factors involved in dehydration- and cold-inducible gene expression.
Biochemical and Biophysical Research Communications 290: 998-1009
Saltveit ME (2005) Aminoethoxyvinylglycine (AVG) reduces ethylene and protein
biosynthesis in excised discs of mature-green tomato pericarp tissue. Postharvest
Biology and Technology 35: 183-190
Santner A, Estelle M (2010) The ubiquitin-proteasome system regulates plant hormone
signaling. Plant Journal 61: 1029-1040
Sato-Nara K, Yuhashi K, Higashi K, Hosoya K, Kubota M, Ezura H (1999) Stage- and
tissue-specific expression of ethylene receptor homolog genes during fruit
development in muskmelon. Plant Physiology 120: 321-329
63

Sato T, Kudo T, Akada T, Wakasa Y, Niizeki M, Harada T (2004) Allelotype of a
ripening-specific 1-aminocyclopropane-1-carboxylate synthase gene defines the
rate of fruit drop in apple. Journal of the American Society for Horticultural
Science 129: 32-36
Sato T, Theologis A (1989) Cloning the mRNA encoding 1-aminocyclopropane-1carboxylate synthase, the key enzyme for ethylene biosynthesis in plants.
Proceedings of the National Academy of Sciences of the United States of America
86: 6621-6625
Sauter M (2000) Rice in deep water: "How to take heed against a sea of troubles".
Naturwissenschaften 87: 289-303
Schaller GE, Bleecker AB (1995) Ethylene-binding sites generated in yeast expressing
the Arabidopsis ETR1 gene. Science 270: 1809-1811
Schaller GE, Ladd AN, Lanahan MB, Spanbauer JM, Bleecker AB (1995) The ethylene
response mediator ETR1 from Arabidopsis forms a disulfide-linked dimer.
Journal of Biological Chemistry 270: 12526-12530
Sell S, Hehl R (2005) A fifth member of the tomato 1-aminocyclopropane-1-carboxylic
acid (ACC) oxidase gene family harbours a leucine zipper and is anaerobically
induced. DNA Sequence 16: 80-82
Shibuya K, Barry KG, Ciardi JA, Loucas HM, Underwood BA, Nourizadeh S, Ecker JR,
Klee HJ, Clark DG (2004) The central role of PhEIN2 in ethylene responses
throughout plant development in petunia. Plant Physiology 136: 2900-2912
Silva JA, da Costa TS, Lucchetta L, Marini LJ, Zanuzo MR, Nora L, Nora FR, Twyman
RM, Rombaldi CV (2004) Characterization of ripening behavior in transgenic
melons expressing an antisense 1-aminocyclopropane-1-carboxylate (ACC)
oxidase gene from apple. Postharvest Biology and Technology 32: 263-268
Sisler EC (2006) The discovery and development of compounds counteracting ethylene at
the receptor level. Biotechnology Advances 24: 357-367
Sisler EC, Serek M (1997) Inhibitors of ethylene responses in plants at the receptor level:
Recent developments. Physiologia Plantarum 100: 577-582
Solano R, Stepanova A, Chao QM, Ecker JR (1998) Nuclear events in ethylene signaling:
a transcriptional cascade mediated by ETHYLENE-INSENSITIVE3 and
ETHYLENE-RESPONSE-FACTOR1. Genes & Development 12: 3703-3714

64

Sriskandarajah S, Frello S, Jorgensen K, Serek M (2004) Agrobacterium tumefaciensmediated transformation of Campanula carpatica: factors affecting
transformation and regeneration of transgenic shoots. Plant Cell Reports 23: 59-63
Staswick PE, Tiryaki I (2004) The oxylipin signal jasmonic acid is activated by an
enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16: 2117-2127
Stewart I, Wheaton TA (1972) Carotenoids in citrus: their accumulation induced by
ethylene. Journal of Agricultural and Food Chemistry 20: 448-449
Stirnberg P, van de Sande K, Leyser HMO (2002) MAX1 and MAX2 control shoot lateral
branching in Arabidopsis. Development 129: 1131-1141
Stone SL, Williams LA, Farmer LM, Vierstra RD, Callis J (2006) KEEP ON GOING, a
RING E3 ligase essential for Arabidopsis growth and development, is involved in
abscisic acid signaling. Plant Cell 18: 3415-3428
Sunako R, Sakuraba W, Senda M, Akada S, Ishikawa R, Niizeki M, Harada T (1999) An
allele of the ripening-specific 1-aminocyclopropane-1-carboxylic acid synthase
gene (ACS1) in apple fruit with a long storage life. Plant Physiology 119: 12971303
Takahashi H, Kobayashi T, Sato-Nara K, Tomita K, Ezura H (2002) Detection of
ethylene receptor protein Cm-ERS1 during fruit development in melon (Cucumis
melo L.). Journal of Experimental Botany 53: 415-422
Takahashi H, Saito T, Suge H (1983) Separation of the effects of photoperiod and
hormones on sex expression in cucumber. Plant and Cell Physiology 24: 147-154
Tan BC, Schwartz SH, Zeevaart JAD, McCarty DR (1997) Genetic control of abscisic
acid biosynthesis in maize. Proceedings of the National Academy of Sciences of
the United States of America 94: 12235-12240
Tanimoto M, Roberts K, Dolan L (1995) Ethylene is a positive regulator of root hair
development in Arabidopsis thaliana. Plant Journal 8: 943-948
Tatsuki M (2010) Ethylene biosynthesis and perception in fruit. Journal of the Japanese
Society for Horticultural Science 79: 315-326
Tatsuki M, Haji T, Yamaguchi M (2006) The involvement of 1-aminocyclopropane-1carboxylic acid synthase isogene, Pp-ACS1, in peach fruit softening. Journal of
Experimental Botany 57: 1281-1289

65

Tatsuki M, Mori H (2001) Phosphorylation of tomato 1-aminocyclopropane-1-carboxylic
acid synthase, LeACS2, at the C-terminal region. Journal of Biological Chemistry
276: 28051-28057
Thines B, Katsir L, Melotto M, Niu Y, Mandaokar A, Liu GH, Nomura K, He SY, Howe
GA, Browse J (2007) JAZ repressor proteins are targets of the SCFCOl1 complex
during jasmonate signalling. Nature 448: 661-666
Tieman DM, Ciardi JA, Taylor MG, Klee HJ (2001) Members of the tomato LeEIL
(EIN3-like) gene family are functionally redundant and regulate ethylene
responses throughout plant development. Plant Journal 26: 47-58
Tieman DM, Klee HJ (1999) Differential expression of two novel members of the tomato
ethylene-receptor family. Plant Physiology 120: 165-172
Tieman DV, Taylor MG, Ciardi JA, Klee HJ (2000) The tomato ethylene receptors NR
and LeETR4 are negative regulators of ethylene response and exhibit functional
compensation within a multigene family. Proceedings of the National Academy of
Sciences of the United States of America 97: 5663-5668
Tigchelaar EC, McGlasson WB, Buescher RW (1978) Genetic regulation of tomato fruit
ripening. Hortscience 13: 508-513
Tucker GA, Schindler CB, Roberts JA (1984) Flower abscission in mutant tomato plants.
Planta 160: 164-167
Ueguchi C, Sato S, Kato T, Tabata S (2001) The AHK4 gene involved in the cytokininsignaling pathway as a direct receptor molecule in Arabidopsis thaliana. Plant and
Cell Physiology 42: 751-755
Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H,
Kamiya Y, Shirasu K, Yoneyama K, Kyozuka J, Yamaguchi S (2008) Inhibition
of shoot branching by new terpenoid plant hormones. Nature 455: 195-201
Vert G, Nemhauser JL, Geldner N, Hong FX, Chory J (2005) Molecular mechanisms of
steroid hormone signaling in plants. In Annual Review of Cell and Developmental
Biology, Vol 21, pp 177-201
Vogel JP, Woeste KE, Theologis A, Kieber JJ (1998) Recessive and dominant mutations
in the ethylene biosynthetic gene ACS5 of Arabidopsis confer cytokinin
insensitivity and ethylene overproduction, respectively. Proceedings of the
National Academy of Sciences of the United States of America 95: 4766-4771

66

Vrebalov J, Ruezinsky D, Padmanabhan V, White R, Medrano D, Drake R, Schuch W,
Giovannoni J (2002) A MADS-box gene necessary for fruit ripening at the tomato
ripening-inhibitor (Rin) locus. Science 296: 343-346
Wang A, Yamakake J, Kudo H, Wakasa Y, Hatsuyama Y, Igarashi M, Kasai A, Li TZ,
Harada T (2009) Null mutation of the MdACS3 gene, coding for a ripeningspecific 1-aminocyclopropane-1-carboxylate synthase, leads to long shelf life in
apple fruit. Plant Physiology 151: 391-399
Wang F, Deng XW (2011) Plant ubiquitin-proteasome pathway and its role in gibberellin
signaling. Cell Research 21: 1286-1294
Wang KLC, Yoshida H, Lurin C, Ecker JR (2004) Regulation of ethylene gas
biosynthesis by the Arabidopsis ETO1 protein. Nature 428: 945-950
Wang NN, Shih MC, Li N (2005) The GUS reporter-aided analysis of the promoter
activities of Arabidopsis ACC synthase genes AtACS4, AtACS5, and AtACS7
induced by hormones and stresses. Journal of Experimental Botany 56: 909-920
Wang WY, Esch JJ, Shiu SH, Agula H, Binder BM, Chang C, Patterson SE, Bleecker AB
(2006) Identification of important regions for ethylene binding and signaling in
the transmembrane domain of the ETR1 ethylene receptor of Arabidopsis. Plant
Cell 18: 3429-3442
Wang WY, Hall AE, O'Malley R, Bleecker AB (2003) Canonical histidine kinase activity
of the transmitter domain of the ETR1 ethylene receptor from Arabidopsis is not
required for signal transmission. Proceedings of the National Academy of
Sciences of the United States of America 100: 352-357
Wang Y, Kumar PP (2007) Characterization of two ethylene receptors PhERS1 and
PhETR2 from petunia: PhETR2 regulates timing of anther dehiscence. Journal of
Experimental Botany 58: 533-544
Watanabe H, Saigusa M, Hase S, Hayakawa T, Satoh S (2004) Cloning of a cDNA
encoding an ETR2-like protein (Os-ERL1) from deep water rice (Oryza sativa L.)
and increase in its mRNA level by submergence, ethylene, and gibberellin
treatments. Journal of Experimental Botany 55: 1145-1148
Watkins CB (2006) The use of 1-methylcyclopropene (1-MCP) on fruits and vegetables.
Biotechnology Advances 24: 389-409
Wessler SR (2005) Homing into the origin of the AP2 DNA binding domain. Trends in
Plant Science 10: 54-56
67

Whittaker DJ, Smith GS, Gardner RC (1997) Expression of ethylene biosynthetic genes
in Actinidia chinensis fruit. Plant Molecular Biology 34: 45-55
Wichner S, Libbert E (1968) Interactions between plants and epiphytic bacteria regarding
their auxin metabolism I. detection of IAA-producing epiphytic bacteria and their
role in long duration experiments on tryptophan metabolism in plant homogenates.
Physiologia Plantarum 21: 227-241
Wilkinson JQ, Lanahan MB, Clark DG, Bleecker AB, Chang C, Meyerowitz EM, Klee
HJ (1997) A dominant mutant receptor from Arabidopsis confers ethylene
insensitivity in heterologous plants. Nature Biotechnology 15: 444-447
Wilkinson JQ, Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1995) An ethyleneinducible component of signal-transduction encoded by Never-ripe. Science 270:
1807-1809
Woeste KE, Kieber JJ (2000) A strong loss-of-function mutation in RAN1 results in
constitutive activation of the ethylene response pathway as well as a rosette-lethal
phenotype. Plant Cell 12: 443-455
Woodrow IE, Rowan KS (1979) Change of flux of orthophosphate between cellular
compartments in ripening tomato fruits in relation to climacteric rise in respiration.
Australian Journal of Plant Physiology 6: 39-46
Wulfetange K, Lomin SN, Romanov GA, Stolz A, Heyl A, Schmulling T (2011) The
cytokinin receptors of Arabidopsis are located mainly to the endoplasmic
reticulum. Plant Physiology 156: 1808-1818
Wuriyanghan H, Zhang B, Cao WH, Ma BA, Lei G, Liu YF, Wei W, Wu HJ, Chen LJ,
Chen HW, Cao YR, He SJ, Zhang WK, Wang XJ, Chen SY, Zhang JS (2009) The
ethylene receptor ETR2 delays floral transition and affects starch accumulation in
rice. Plant Cell 21: 1473-1494
Xie C, Zhang JS, Zhou HL, Li J, Zhang ZG, Wang DW, Chen SY (2003)
Serine/threonine kinase activity in the putative histidine kinase-like ethylene
receptor NTHK1 from tobacco. Plant Journal 33: 385-393
Xu J, Li Y, Wang Y, Liu HX, Lei L, Yang HL, Liu GQ, Ren DT (2008) Activation of
MAPK kinase 9 induces ethylene and camalexin biosynthesis and enhances
sensitivity to salt stress in Arabidopsis. Journal of Biological Chemistry 283:
26996-27006

68

Xu K, Xu X, Fukao T, Canlas P, Maghirang-Rodriguez R, Heuer S, Ismail AM, BaileySerres J, Ronald PC, Mackill DJ (2006) Sub1A is an ethylene-response-factor-like
gene that confers submergence tolerance to rice. Nature 442: 705-708
Yamada H, Suzuki T, Terada K, Takei K, Ishikawa K, Miwa K, Yamashino T, Mizuno T
(2001) The Arabidopsis AHK4 histidine kinase is a cytokinin-binding receptor
that transduces cytokinin signals across the membrane. Plant and Cell Physiology
42: 1017-1023
Yanagisawa S, Yoo SD, Sheen J (2003) Differential regulation of EIN3 stability by
glucose and ethylene signalling in plants. Nature 425: 521-525
Yang YW, Wu Y, Pirrello J, Regad F, Bouzayen M, Deng W, Li ZG (2010) Silencing SlEBF1 and Sl-EBF2 expression causes constitutive ethylene response phenotype,
accelerated plant senescence, and fruit ripening in tomato. Journal of
Experimental Botany 61: 697-708
Yang Z, Tian LN, Latoszek-Green M, Brown D, Wu KQ (2005) Arabidopsis ERF4 is a
transcriptional repressor capable of modulating ethylene and abscisic acid
responses. Plant Molecular Biology 58: 585-596
Yau CP, Wang LJ, Yu MD, Zee SY, Yip WK (2004) Differential expression of three
genes encoding an ethylene receptor in rice during development, and in response
to indole-3-acetic acid and silver ions. Journal of Experimental Botany 55: 547556
Yin TJ, Quinn JA (1992) A mechanistic model of a single hormone regulating both sexes
in flowering plants. Bulletin of the Torrey Botanical Club 119: 431-441
Yin TJ, Quinn JA (1995) Tests of a mechanistic model of one hormone regulating both
sexes in Cucumis sativus (Cucurbitaceae). American Journal of Botany 82: 15371546
Yin XR, Chen KS, Allan AC, Wu RM, Zhang B, Lallu N, Ferguson IB (2008) Ethyleneinduced modulation of genes associated with the ethylene signalling pathway in
ripening kiwifruit. Journal of Experimental Botany 59: 2097-2108
Yip WK, Moore T, Yang SF (1992) Differential accumulation of transcripts for four
tomato 1-aminocyclopropane-1-carboxylate synthase homologs under various
conditions. Proceedings of the National Academy of Sciences of the United States
of America 89: 2475-2479

69

Yip WK, Yang SF (1988) Cyanide metabolism in relation to ethylene production in plant
tissues. Plant Physiology 88: 473-476
Yoo SD, Cho YH, Tena G, Xiong Y, Sheen J (2008) Dual control of nuclear EIN3 by
bifurcate MAPK cascades in C2H4 signalling. Nature 451: 789-796
Yu YB, Adams DO, Yang SF (1979) l-Aminocyclopropanecarboxylate synthase, a key
enzyme in ethylene biosynthesis. Archives of Biochemistry and Biophysics 198:
280-286
Zarei A, Korbes AP, Younessi P, Montiel G, Champion A, Memelink J (2011) Two GCC
boxes and AP2/ERF-domain transcription factor ORA59 in jasmonate/ethylenemediated activation of the PDF1.2 promoter in Arabidopsis. Plant Molecular
Biology 75: 321-331
Zarembinski TI, Theologis A (1994) Ethylene biosynthesis and action: a case of
conservation. Plant Molecular Biology 26: 1579-1597
Zhang W, Zhou X, Wen CK (2012) Modulation of ethylene responses by OsRTH1
overexpression reveals the biological significance of ethylene in rice seedling
growth and development. Journal of Experimental Botany 63: 4151-4164
Zhang XR, Garreton V, Chua NH (2005) The AIP2 E3 ligase acts as a novel negative
regulator of ABA signaling by promoting ABI3 degradation. Genes &
Development 19: 1532-1543
Zheng XY, Wolff DW (2000) Ethylene production, shelf-life and evidence of RFLP
polymorphisms linked to ethylene genes in melon (Cucumis melo L.). Theoretical
and Applied Genetics 101: 613-624
Zhong SL, Lin ZF, Grierson D (2008) Tomato ethylene receptor-CTR interactions:
visualization of NEVER-RIPE interactions with multiple CTRs at the
endoplasmic reticulum. Journal of Experimental Botany 59: 965-972
Zhong SW, Zhao MT, Shi TY, Shi H, An FY, Zhao Q, Guo HW (2009) EIN3/EIL1
cooperate with PIF1 to prevent photo-oxidation and to promote greening of
Arabidopsis seedlings. Proceedings of the National Academy of Sciences of the
United States of America 106: 21431-21436
Zhou DB, Kalaitzis P, Mattoo AK, Tucker ML (1996) The mRNA for an ETR1
homologue in tomato is constitutively expressed in vegetative and reproductive
tissues. Plant Molecular Biology 30: 1331-1338

70

Zhou X, Liu Q, Xie F, Wen CK (2007) RTE1 is a Golgi-associated and ETR1-dependent
negative regulator of ethylene responses. Plant Physiology 145: 75-86
Zhu HL, Zhu BZ, Shao Y, Wang XG, Lin XJ, Xie YH, Li YC, Gao HY, Luo YB (2006)
Tomato fruit development and ripening are altered by the silencing of LeEIN2
gene. Journal of Integrative Plant Biology 48: 1478-1485
Zhu Q, Zhang JT, Gao XS, Tong JH, Xiao LT, Li WB, Zhang HX (2010) The
Arabidopsis AP2/ERF transcription factor RAP2.6 participates in ABA, salt and
osmotic stress responses. Gene 457: 1-12

71

Chapter 2 Functional divergence of SlGR, SlGRL1, SlGRL2 and AtRTE1

72

Abstract

The factors that mediate specific responses to the plant hormone ethylene during development or
in response to individual stimuli are not fully defined. In particular, it is not known how, or
whether, signaling at the level of the receptor complex can control distinct subsets of ethylene
responses. Mutation at the Green-ripe (Gr) and reversion to ethylene sensitivity 1 (rte1) loci, that
encode homologous proteins of unknown function, influence ethylene responses in tomato
(Solanum lycopersicum) and Arabidopsis thaliana, respectively. In Arabidopsis, RTE1 is
required for function of the ETR1 ethylene receptor and acts specifically through this receptor
isoform via direct protein-protein interaction. The rte1 mutant was identified as a suppressor of
the etr1-2 mutant allele which is a weak dominant receptor allele that does not disrupt ethylene
binding. The tomato genome contains two additional GR homologs designated GREEN RIPE
LIKE 1 (SlGRL1) and GREEN RIPE LIKE 2 (SlGRL2). A combination of over-expression in
tomato and complementation of the rte1-3 mutant allele indicates that SlGR and SlGRL1
influence distinct ethylene responses suggesting the existence of separate ethylene-signaling
modules in tomato. In addition, over-expression of AtRTE1 in tomato leads to reduced ethylene
responsiveness in a subset of tissues, which more closely resemble the SlGRL1 lines than SlGR
lines. In contrast, SlGRL2 over-expression lines possess a wild type phenotype and ethylene
responsiveness appeared normal. These data suggest that SlGRL2 probably does not play a role
in ethylene signaling. Together, these data reveal heterogeneity in the control of ethylene
responses mediated by members of the GR/RTE family in tomato and in Arabidopsis.

73

Introduction

Ethylene is a plant hormone that affects plant growth and development and responses to biotic
and abiotic stresses (Bleecker and Kende, 2000; Guo and Ecker, 2004). A framework of ethylene
signaling has been assembled using a combination of genetic and biochemical analysis in
Arabidopsis (Kendrick and Chang, 2008; Stepanova and Alonso, 2009; Zhao and Guo, 2011). In
Arabidopsis, ethylene is perceived by five ethylene receptors, ETHYLENE RESPONSE 1
(ETR1), ETHYLENE RESPONSE SENSOR 1 (ERS1), ETHYLENE RESPONSE 2 (ETR2),
ETHYLENE RESPONSE SENSOR 2 (ERS2), and ETHYLENE INSENSITIVE 4 (EIN4)
(Chang et al., 1993; Resnick et al., 2006). The ethylene receptors are transmembrane proteins
located in the endoplasmic reticulum (ER) and Golgi membranes that function as homo- and
hetero-dimers (Rodriguez et al., 1999; Chen et al., 2002; Ma et al., 2006; Dong et al., 2008; Gao
et al., 2008). Ethylene signaling is conserved in higher plants, and is negatively regulated (Hua
and Meyerowitz, 1998).
In the absence of ethylene, the receptors actively suppress downstream responses through direct
binding of CONSTITUTIVE TRIPLE RESPONSE 1 (CTR1), a serine threonine MAPKKK that
acts as a negative regulator of the pathway (Kieber et al., 1993; Clark et al., 1998; Gao et al.,
2003; Huang et al., 2003). Upon ethylene binding a conformational change is thought to occur,
leading to receptor inactivation and release of CTR1-mediated suppression (Huang et al., 2003;
Zhao and Guo, 2011). Mutations within the N-terminal ethylene binding domain of the receptors
either inhibit ethylene binding or potentially disrupt the change in conformation following
ethylene binding leading to dominant ethylene-insensitive mutations which cannot be inactivated
by ethylene (Wang et al., 2006). ETHYLENE-INSENSITIVE 2 (EIN2) acts genetically
74

downstream of the ethylene receptors and CTR1 and encodes a protein with homology to the
NRAMP family of metal ion transporters (Roman et al., 1995; Alonso et al., 1999). The
biochemical function of EIN2 remains unknown although mutations at the ein2 locus lead to
strong ethylene-insensitive phenotypes and recent research has indicated that EIN2 is localized in
the ER where it interacts with the kinase domain of each ethylene receptor in an ethylene
dependent manner (Alonso et al., 1999; Bisson et al., 2009; Bisson and Groth, 2010).
Phosphorylation of EIN2 by CTR1 retains EIN2 within the ER but ethylene dependent
dephosphorylation leads to proteolytic cleavage of EIN2 resulting in translocation of the EIN2
C-terminus into the nucleus where it activates EIN3 and ethylene dependent transcription (Qiao
et al., 2012).

ETR1 receptor function requires REVERSION TO ETHYLENE SENSITIVITY 1 (RTE1), a
protein thought to facilitate the conformational change in the receptor following ethylene
binding (Resnick et al., 2008). RTE1 was identified through a mutant screen to identify
suppressors of ethylene-insensitivity mediated by the etr1-2 receptor allele of Arabidopsis
(Resnick et al., 2006). Loss of RTE1 function in Arabidopsis leads to enhanced ethylene
responsiveness whereas over-expression results in reduced sensitivity (Resnick et al., 2006).
RTE1 co-localizes with ETR1 in the ER and Golgi membranes and interacts with the N-terminal
region of the ETR1 and ERS1 receptors (Zhou et al., 2007; Dong et al., 2008; Dong et al., 2010).
Interestingly, mutations at the rte1 locus suppress ethylene-insensitivity mediated by a subset,
but not all, Etr1 mutant alleles (Resnick et al., 2006; Resnick et al., 2008). The significance of
the allele specificity of RTE1 function is unclear but is suggestive of a role for RTE1 in the
conformational changes in the receptor following ethylene binding (Resnick et al., 2008).
75

Furthermore, the effect of RTE1 appears specific for the ETR1 receptor as introduction of RTE1dependent alleles of ETR1 into additional Arabidopsis ethylene receptors fails to confer
dominant ethylene insensitivity in seedling assays, even though RTE1 is able to physically
interact with ERS1 (Rivarola et al., 2009; Dong et al., 2010).

Several other plant species also serve as model systems for investigating ethylene responses
including rice, petunia and tomato. Although the ethylene signaling pathway is generally
conserved between plant species, there are differences in the sizes of gene families and the
receptor complement in different species. For example, the GREEN RIPE/RTE1 family in tomato
and other members of the Solanaceae family is larger than in other eudicot species, including
Arabidopsis. There are three GR/RTE1 genes in tomato; GREEN RIPE (SlGR), GREEN RIPE
LIKE 1 (SlGRL1) and GREEN RIPE LIKE 2 (SlGRL2) (Barry and Giovannoni, 2006). The Gr
mutant displays ethylene insensitivity leading to inhibition of fruit ripening, flower senescence
and abscission together with reduced ethylene inhibition of root elongation (Barry et al., 2005;
Barry and Giovannoni, 2006). However ethylene responses associated with hypocotyl elongation
during the seedling triple response and petiole epinasty are normal, suggesting that GR
modulates tissue specific ethylene responses in tomato (Barry et al., 2005; Barry and Giovannoni,
2006). SlGR and AtRTE1 belong to a family of conserved proteins, but their function is unclear
(Barry and Giovannoni, 2006). In the current study, the function of SlGRL1 and SlGRL2 in
ethylene signaling, and the relationship of SlGR, SlGRL1 to AtRTE1 were investigated.

A combination of over-expression in tomato and Arabidopsis reveals that SlGR and SlGRL1
function in ethylene signaling, although they function differently, while analysis of SlGRL2
76

over-expression lines suggested this gene is not involved in ethylene signaling. Furthermore, the
function of AtRTE1 more closely resembles that of SlGRL1 rather than SlGR. These data
provide new insight into the function of SlGR, SlGRL1, and SlGRL2 in ethylene signaling.

Results

Over-expression of SlGRL1 in tomato does not recreate the Gr mutant phenotype but
influences a subset of ethylene responses

The tissue-specific reduction in ethylene responsiveness observed in the Gr mutant of tomato is
mediated through a promoter deletion in SlGR that leads to ectopic expression of SlGR and overexpression of SlGR recreates the Gr mutant phenotype (Barry and Giovannoni, 2006). Similarly,
over-expression of RTE1 in Arabidopsis leads to reduced ethylene responsiveness (Resnick et al.,
2006). These data suggest that over-expression of SlGRL1 in tomato may confer reduced
ethylene responsiveness. To examine this possibility, transgenic lines over-expressing either
SlGRL1 under the control of the CaMV35S promoter were generated.

Three homozygous independent transgenic CaMV35S::SlGRL1 lines were developed that
possess elevated SlGRL1 transcript levels in both fruit and seedlings. These homozygous lines
ripened normally and the expression of the ethylene- and ripening- regulated E4 gene (Lincoln et
al., 1987) was similar in fruit of the CaMV35S::SlGRL1 lines and AC control fruit indicating
normal ethylene responsiveness (Figure 2.1 A-D). Analysis of the seedling triple response in the
CaMV35S::SlGRL1 lines indicated that hypocotyl responses to increasing concentrations of 177

aminocyclopropane-1-carboxylic acid (ACC) are similar to those of wild type Ailsa Craig (AC),
whereas hypocotyls of the Never-ripe (Nr) mutant (Lanahan et al., 1994) display the expected
characteristic reduction in ethylene responsiveness (Figure 2.1E, Table 2.1). In contrast, root
lengths of the CaMV35S::SlGRL1 lines displayed a partial ethylene-insensitive phenotype with
root lengths intermediate between those observed in AC and Nr seedlings that are similar to
those observed in the Gr mutant (Figure 2.1F). Together, these data indicate that the
CaMV35S::SlGRL1 lines possess a triple response phenotype which is identical to that observed
in the Gr mutant and CaMV35S::SlGR over-expression lines (Figure 2.1E, F) (Barry and
Giovannoni, 2006).

The Gr mutant and CaMV35S::SlGR over-expression lines display a reduced response to
ethylene-induced floral abscission that lies between that observed in AC and Nr (Barry et al.,
2005; Barry and Giovannoni, 2006). Similarly, the CaMV35S::SlGRL1 lines have reduced rates
of ethylene-induced floral abscission, comparable to those of the Gr mutant (Figure 2.1G).
Petiole angle in response to ethylene treatment was also determined in the CaMV35S::SlGRL1
lines indicating a partial ethylene-insensitive phenotype, intermediate between AC and Nr
(Figure 2.1H). In contrast, the petiole angle in the Gr mutant and CaMV35S::SlGR lines in
response to ethylene treatment, is similar to that observed in wild type seedlings (Figure 2.1H;
Figure 2.2). Together, these data indicate that over-expression of SlGRL1 in tomato does not
phenocopy the Gr mutant but rather influences a distinct subset of ethylene responses that are at
the same time similar to the Gr mutant (triple response, floral abscission), yet also distinct (fruit
ripening, petiole epinasty). Together these data indicate over-expression of SlGRL1 in tomato
does not recreate the Gr mutant phenotype.
78

Combining Gr with CaMV35S::SlGRL1 enhances ethylene insensitivity in a subset of
responses

The data described above indicates that SlGR and SlGRL1 each influence a subset of ethylene
responses when over-expressed in tomato (Figure 2.1). However, individually neither is able to
confer reduced ethylene responsiveness in all plant tissues and in particular the response of darkgrown hypocotyls to the ethylene precursor ACC is similar to that observed in AC seedlings with
only a very mild reduction in ethylene-insensitivity observed (Figure 2.1E). In contrast, overexpression of RTE1 in Arabidopsis leads to a more pronounced, albeit weak, ethylene-insensitive
phenotype in hypocotyls (Resnick et al., 2006). To determine whether ethylene responses can be
influenced through combining SlGR and SlGRL1, the CaMV35S::SlGRL1 transgene was
introduced into the Gr mutant background through a cross and homozygous lines were recovered
through genotyping. In some tissues, the double over-expression line displays a phenotype
similar to that observed in either Gr or the single CaMV35S::GRL1 over-expression line. For
example, fruit of the Gr X CaMV35S::GRL1 line resembles that of the single Gr mutant showing
greatly inhibited fruit ripening (Figure 2.3A). Similarly, upon exposure to ethylene, petiole
epinasty in the Gr X CaMV35S::GRL1 line is identical to that observed in the single
CaMV35S::GRL1 transgenic line (Figure 2.3E). However, in response to ethylene-induced floral
abscission and during the seedling triple response, the Gr X CaMV35S::GRL1 line has an
additive phenotype that is stronger than that observed in either Gr or the single CaMV35S::GRL1
over-expression line (Figure 2.3B, C, and D, Table 2.2). In particular, the roots of dark-grown Gr
X CaMV35S::GRL1 seedlings grown in the presence of ACC also possess an additive phenotype
79

over Gr or the single CaMV35S::GRL1 over-expression line with levels of ethylene-insensitivity
comparable to that observed in the Nr mutant (Figure 2.3C).

Over-expression of SlGRL2 in tomato does not confer reduced ethylene responsiveness

The previous results and data above indicate that both SlGR and SlGRL1 function in ethylene
signaling (Barry and Giovannoni, 2006) (Figure 2.1). The Arabidopsis genome carries a second
homolog of RTE1, known as RTE1-HOMOLOG (RTH), which is the ortholog of SlGRL2 but the
function of this gene is unknown. To detect whether SlGRL2 plays a role in ethylene signaling,
transgenic lines over-expressing SlGRL2 under the control of the CaMV35S promoter were
generated and characterized using the same phenotypic responses as previously described above
for the CaMV35S::GRL1 over-expression lines.

Four homozygous independent transgenic CaMV35S::SlGRL2 lines were developed. These lines
with different SlGRL2 transcript levels did not show reduced ethylene responsiveness in the
phenotypes that were examined (Figure 2.4A-F). Fruits of CaMV35S::SlGRL2 lines ripened
normally, seedlings possessed a typical triple response phenotype when grown in the presence of
ACC (Figure 2.4A, C, D, Table 2.3). Furthermore, ethylene-induced flower abscission and
petiole epinasty were also unaltered in the CaMV35S::SlGRL2 lines (Figure 2.4E-F). Together,
these data suggest that SlGRL2 probably does not play a role in ethylene signaling.

Over-expression of AtRTE1 in tomato does not confer reduced ethylene responsiveness in
all plant tissues
80

To determine whether AtRTE1 is able to influence ethylene responses in tomato, a construct
expressing AtRTE1 under the control of the CaMV35S promoter was stably transformed into
tomato. Two independent homozygous transgenic lines were developed and both AtRTE1
independent transgenic lines showed a normal fruit ripening phenotype (Figure 2.5A). Although
the transgenic lines had elevated relative expression level of AtRTE1 in fruits, the ethylene- and
ripening-related E4 gene was expressed without any statistically significant difference with wild
type fruits in the same development stage suggesting that AtRTE1 is unable to influence ethylene
responses in tomato fruit (Figure 2.5B, C). However, the CaMV35S::AtRTE1 transgenic lines
display a partial ethylene-insensitive phenotype in both hypocotyls and roots displaying a
phenotype that is intermediate between that of wild type AC and Nr seedlings (Figure 2.5D, E,
Table 2.4). Similarly, the CaMV35S::AtRTE1 lines also possess reduced rates of ethyleneinduced flower abscission and petiole epinasty compared to that observed in AC (Figure 2.5F, G).
Together, these data indicate over-expression of AtRTE1 in tomato influences ethylene
responsiveness in a number of tissues, sharing characteristics of both SlGR and SlGRL1 overexpression lines, but not recreating the Gr mutant phenotype, or leading to a whole plant
reduction in ethylene responsiveness.

SlGR is unable to fully complement the rte1 mutant phenotype

The previous data show SlGR, SlGRL1, and AtRTE1 influence distinct subsets of ethylene
responses when over-expressed in tomato, but over-expression of these genes in tomato does not
recreate the same ethylene-related phenotypes (Barry and Giovannoni, 2006)(Figure 2.1, 2.2 and
81

2.5). To examine the relationship of SlGR, SlGRL1 and AtRTE1 in more detail, the ability of
SlGR and SlGRL1 to complement the rte1-3 allele was examined. N-terminal epitope-tagged
versions of SlGR and SlGRL1 under the control of the CaMV35S promoter were transformed in
the etr1-2/rte1-3 double mutant in which ethylene insensitivity conferred by the etr1-2 mutant
allele is suppressed by the rte1-3 allele (Resnick et al., 2006). Two homozygous
CaMV35S::MYC-SlGRL1 lines were recovered that almost fully complement the rte1-3 allele,
restoring ethylene-insensitivity in both the hypocotyls and roots of Arabidopsis seedlings to
levels comparable to those of the etr1-2 allele (Figure 2.6A, C, D, E).

In contrast, three independent lines expressing the CaMV35S::MYC-SlGR transgene did not fully
complement the rte1-3 allele (Figure 2.6A, B, D, E). However, the CaMV35S::MYC-SlGR
transgene is active as transgenic seedlings grown on low concentrations of ACC are able to
partially rescue the previously documented ethylene-hypersensitive phenotype of etr1-2/rte1-3
double mutant seedlings (Resnick et al., 2006). For example, in the absence of ACC and in the
presence of 0.1 µM ACC, hypocotyl lengths of the CaMV35S::MYC-SlGR lines are longer than
those of the etr1-2/rte1-3 double mutant and identical to those observed in Col-0 seedlings
(Figure 2.6D, Table 2.5). However, at higher concentrations of ACC this difference was
eliminated (Table 2.5). Similarly, root lengths of the CaMV35S::MYC-SlGR lines grown on low
concentrations of ACC are longer than those of the etr1-2/rte1-3 double mutant but remain
hypersensitive to ACC compared the roots of Col-0 seedlings (Figure 2.6E). Similar phenotypes
were also observed in transgenic lines expressing untagged versions of each gene (Figure 2.7).
These data further illustrate functional divergence of SlGR and SlGRL1 and indicate that SlGR is
not functionally equivalent to RTE1.
82

Discussion

Variation in ethylene signaling components and evidence for subfunctionalization

The creation and maintenance of gene families through duplication events is a driver of evolution
and increases both the potential for genetic redundancy as well as the opportunity for
subfunctionalization leading to functional plasticity (Force et al., 1999; Freeling, 2009). Such
plasticity is important during the synthesis and perception of plant hormones, which generally
control multiple aspects of plant growth and development, together with responses to
environmental perturbation and allows plants to appropriately regulate hormone responses.
Several components within the ethylene response pathway are encoded by multigene families
and subfunctionalization is observed, particularly at the level of transcriptional control. For
example, Arabidopsis EIN3 and EIL1 proteins act semi-redundantly influence separate ethylene
responses associated with seedling growth and stem and leaf expansion, respectively (An et al.,
2010). Similarly, individual members of the large ETHYLENE RESPONSE FACTOR (ERF) gene
family are known to act downstream of EIN3 to mediate distinct ethylene responses, particularly
in response to environmental stress (Hattori et al., 2009; Zhang et al., 2011). However, evidence
for subfunctionalization in the upstream components of the ethylene signaling pathway,
including the receptors, is less well defined. Furthermore, the role of gene family complexity and
diversity between species and how this influences ethylene responsiveness is not understood. For
example, when compared to Arabidopsis, tomato possesses an extra subfamily-1 ethylene
receptor, LeETR2, but lacks a copy of the subfamily 2 receptor ERS2 (Bleecker, 1999; Klee,
83

2004). Similarly, while rice and maize possesses a subfamily-1 receptor that is comparable in
structure to Arabidopsis ERS1, both lack ETR1-like subfamily-1 receptors (Rzewuski and Sauter,
2008; Chen and Gallie, 2010). Furthermore, while the subfamily-1 ethylene receptors are the
primary receptors regulating ethylene responsiveness in Arabidopsis, the subfamily-2 receptors
appear to have an important role in tomato and rice (Tieman et al., 2000; Qu et al., 2007;
Wuriyanghan et al., 2009). In addition, copy number variation is also present in CTR1-like genes
between Arabidopsis and other species, including tomato and rice with complementation studies
revealing that the tomato CTR1-like genes are not functionally equivalent (Adams-Phillips et al.,
2004; Rzewuski and Sauter, 2008). For example, LeCTR3 is able to fully complement the ctr1-8
allele of Arabidospsis whereas LeCTR1 and LeCTR4 can only partially complement loss of
CTR1 function (Adams-Phillips et al., 2004).

Variation in copy number between species is also evident for the GR/RTE1 family. Arabidopsis
have two GR/RTE1 family genes, defined by AtRTE1 and AtRTH, while there are three GR/RTE1
family genes in tomato, defined by SlGR, SlGRL1 and SlGRL2. AtRTE1 is closely related to
SlGRL1, and AtRTH is closely related to SlGRL2. The significance of gene copy number
variability between species is not known but infers the potential to form distinct ethylene
signaling networks.

Characterization of the Gr mutant and over-expression of SlGR in tomato indicated that this gene
has the ability to influence a subset of ethylene responses in tomato (Barry et al., 2005; Barry
and Giovannoni, 2006). Furthermore, over-expression of SlGRL1 in tomato causes inhibition of a
subset of ethylene responses that were distinct from those observed in the Gr mutant and
84

Figure 2.1 Phenotypic evaluation of SlGRL1 over-expression lines of tomato.

A, Fruit

phenotypes of three independent homozygous CaMV35S::SlGRL1 transgenic lines in
85

comparison to wild-type (AC) and the ethylene-insensitive Nr and Gr mutants. B, Relative
expression level of SlGRL1 in the hypocotyl of CaMV35S::SlGRL1 lines as determined by qRTPCR. C and D, Relative expression levels of SlGRL1 (C) and the ripening-related gene E4 (D) in
the fruit of CaMV35S::SlGRL1 transgenic lines at the breaker +3 stage of ripening. Data are
presented as the mean of three biological and three technical replicates for each sample. E and F,
hypocotyl and root lengths, respectively of dark-grown AC, Nr, Gr and CaMV35S::SlGRL1
seedlings germinated and grown in the presence of ACC for eight days. Data presented are the
means ± of at least 17 seedlings (Statistical analysis is presented in Table 2.1). G, Percentage
SE
floral abscission in CaMV35S::SlGRL1 lines in comparison to AC, Nr and Gr. Detached flower
trusses were immersed in water in conical flasks and treated with 2 µl l-1 of ethylene for 72 hours.
Data presented are the mean ± of three independent experiments collected from at least 417
SE
flowers per genotype. H, Petiole epinasty in CaMV35S::SlGRL1 lines in comparison to AC, Nr
and Gr. The adaxial leaf angle of four week old plants treated with 20 µl l-1 of ethylene for 16
hours was measured. Three leaves for each plant were examined and at least 11 plants were used
for each genotype and the data presented as the mean ±
SE. *In all experiments, means followed
by the same letter are not significantly different at α=0.05 level.

86

Figure 2.2 Petiole epinasty in response to ethylene in CaMV35S::SlGR lines. Petiole epinasty in
four week old CaMV35S::SlGR lines treated for 16 hours with either 20 µl l-1 (A) or 1 µl l-1 (B)
ethylene in comparison to wild type (AC) and the ethylene-insensitive Nr and Gr mutants. The
adaxial angle was measured in three petioles for each plant in at least 11 plants of each genotype
and the data are presented as the mean ± SE. * Means followed by the same letter are not
significantly different at α=0.05 level.

87

Figure 2.3 Phenotypic analysis of SlGRL1 over-expression in the Gr mutant background. A-E
Phenotypes of Gr X CaMV35S::SlGRL1 in comparison to AC, Nr and Gr, and the
CaMV35S::SlGRL1 line (15-7-11). A, the phenotype of ripe fruits of each genotype. B and C,
hypocotyl and root length, respectively of dark-grown seedlings germinated and grown in the
presence of ACC for eight days. Data presented are the means ± of at least 30 seedlings
SE
(Statistical analysis is presented in Table 2.2). D, percentage of ethylene induced floral
88

abscission. Data presented are the mean ± collected from at least 318 flowers per genotype. E,
SE
The degree of petiole epinasty in response to ethylene treatment was measured in three leaves for
each plant from at least 10 individual plants. Data presented are the mean ±
SE. Experimental
details are available in the Materials and Methods section. * Means followed by the same letter
are not significantly different at α=0.05 level.

89

Figure 2.4 Analysis of ethylene responses in CaMV35S::SlGRL2 lines. A, Ripe fruit phenotype
of four independent homozygous CaMV35S::SlGRL2 transgenic lines in comparison to wild-type
90

(AC). B, Relative expression level of SlGRL2 in the young leaves of CaMV35S::SlGRL2
transgenic lines as detected by qRT-PCR. Data are presented as the mean of three biological and
three technical replicates for each sample. C and D, hypocotyl and root lengths, respectively of
dark-grown seedlings of AC, Nr, Gr and CaMV35S::SlGRL2 seedlings germinated and grown in
the presence of ACC for eight days. Data presented are the means ± of at least 15 seedlings
SE
(Statistical analysis is presented in Table 2.3). E, Percent floral abscission in CaMV35S::SlGRL2
lines in comparison to AC. Detached flower trusses were immersed in water in conical flasks and
treated with 2 µl l-1 of ethylene for 72 hours. Data presented are the mean ± SE collected from at
least 307 flowers per genotype. F, Petiole epinasty in CaMV35S::SlGRL2 lines in comparison to
AC, Nr and Gr. The adaxial leaf angle of four week old plants treated with 20 µl l-1 of ethylene
for 16 hours was measured. Three leaves for each plant were examined and at least 13 plants
were used for each genotype. Data are presented as the mean ±
SE. * Means followed by the
same letter are not significantly different at α=0.05 level.

91

Figure 2.5 Phenotypic evaluation of AtRTE1 over-expression lines of tomato. A-G, Phenotypes
of CaMV35S::AtRTE1 lines in comparison to AC and the ethylene-insensitive Nr and Gr mutants.
92

A, The phenotypes of ripe fruit of CaMV35S::AtRTE1 lines. B and C, Relative expression levels
of RTE1 (B) and the ethylene- and ripening-related gene E4 (C) in fruit of two independent
homozygous CaMV35S::AtRTE1 transgenic lines at the breaker stage of development as
determined by qRT-PCR. Data are presented as the mean ± of three biological and three
SE
technical replicates. D and E, hypocotyl and root lengths, respectively of dark-grown seedlings
germinated and grown in the presence of ACC. Data presented are the means ± of at least 18
SE
seedlings (Statistical analysis is presented in Table 2.4). F, Percentage of ethylene-induced floral
abscission. Data presented are the mean ±SE collected from at least 352 flowers per genotype. G,
Ethylene-induced petiole epinasty in CaMV35S::AtRTE1 lines. Three leaves for each plant were
examined and at least 12 plants were used for each genotype. Data presented are the mean ± SE.
* Means followed by the same letter are not significantly different at α=0.05 level.

93

Figure 2.6 Differential complementation of the Arabidopsis rte1-3 allele by SlGR and SlGRL1. A,
The triple response phenotype of Arabidopsis seedlings from Col-0, etr1-2, etr1-2/rte1-3,
together

with

three

independent

CaMV35S::MYC-SlGR
94

lines

and

two

independent

CaMV35S::MYC-SlGRL1 lines transformed into the etr1-2/rte1-3 mutant background. Seedlings
were grown in the dark at room temperature for six days on 100 μM ACC. B and C, Relative
expression levels of SlGR (B) and SlGRL1 (C) in seedlings of CaMV35S::MYC-SlGR and
CaMV35S::MYC-SlGRL1 lines, respectively as determined by qRT-PCR analysis. Data are
presented as the mean ± of three biological and three technical replicates. D and E, dose
SE
response curve of hypocotyl (D) and root (E) lengths of Arabidopsis seedlings grown in the
presence of ACC. Each data point represents the mean ± of 15 seedlings (Statistical analysis is
SE
presented in Table 2.5). * Means followed by the same letter are not significantly different at
α=0.05 level.

95

Figure 2.7 Differential complementation of rte1-3 by untagged versions of SlGR and SlGRL1.
The triple response phenotype of Arabidopsis seedlings from Col-0, etr1-2/rte1-3, together with
three independent CaMV35S::SlGR lines and three independent CaMV35S::SlGRL1 lines
transformed into etr1-2/rte1-3 background. Seedlings were grown in the dark at room
temperature for six days on 100 μM ACC. Note, the elongated phenotype of the
CaMV35S::SlGRL1 lines demonstrating complementation of the rte1-3 mutant allele whereas the
CaMV35S::SlGR lines do not complement the rte1-3 mutant allele. See Figure 2.6 for
comparison with MYC-tagged versions.

96

Table 2.1 Statistical analysis of the seedling triple response assay in CaMV35S::SlGRL1 lines of tomato

0 μM ACC

0.5 μM ACC

10 μM ACC

Group

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

AC

108.8b*

31.67a

97.64ab

26.2a

20.57a

17.17a

Nr

111.03b

32.53a

104.83b

32.03d

80.31c

30.31c

Gr

96.44a

33.44a

91.16a

30.72cd

25.6b

25.17b

35S::SlGRL1-15-7-11

98.13a

31.17a

96.28a

27.07ab

24.04ab

23.48b

35S::SlGRL1-15-25

100.43a

31.04a

94.05a

28.75abc

21.76ab

24.35b

35S::SlGRL1-20-17

107.26b

32.3a

94.16a

29.44bcd

23.05ab

23.95b

*Means followed by the same letters are not significantly different at α=0.05 level.
Note statistically significant hypocotyl lengths in Gr and CaMV35S::SlGRL1 transgenic lines in comparison to AC in seedlings grown
in the presence of 10 μM ACC (shown in bold). Graphical representation of this data is provided in Figure 2.1.

97

Table 2.2 Statistical analysis of the seedling triple response assay in Gr ×35S::SlGRL1 line of tomato

0 μM ACC

0.5 μM ACC

10 μM ACC

Group

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

AC

103.27a

33.7a

86.47a

26.7a

18.43a

15.63a

Nr

106.03a

34.9a

102.87c

31.9cd

86.43d

29.8c

Gr

102.6a

34.9a

89.4a

30.33bc

23.4b

25.43b

35S::SlGRL1

101.2a

33.53a

89.73a

28.53ab

26.5b

24.57b

Gr ×35S::SlGRL1

102.3a

35.87a

96.33b

32.97d

40.43c

31.3c

*Means followed by the same letters are not significantly different at α=0.05 level.
Note statistically significant hypocotyl and root lengths in Gr ×35S::SlGRL1 line in comparison to Gr and 35S::SlGRL1 in seedlings
grown in the presence of 10 μM ACC (shown in bold). Graphical representation of this data is provided in Figure 2.3.

98

Table 2.3 Statistical analysis of the seedling triple response assay in SlGRL2 over-expression lines of tomato

0 μM ACC

0.5 μM ACC

10 μM ACC

Group

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

AC

98.87ab

34.93a

82.87a

27.87ab

18.8a

17.87a

Nr

103.73b

35.53a

98.33b

31.73b

89.67c

29.6c

Gr

97.93ab

34.73a

89.33ab

29.27ab

27.27b

23.93b

35S::SlGRL2-1

93.47a

34.87a

88.93ab

27.8a

18.8a

18.67a

35S::SlGRL2-2-4

96.27ab

35.07a

92.07ab

27.67a

20.13a

18.73a

35S::SlGRL2-7-10-1

100.2ab

33.93a

89.93ab

27a

18.53a

18.13a

35S::SlGRL2-13-9

102.73ab

33.4a

95.53b

26.6a

16.33a

17.2a

*Means followed by the same letters are not significantly different at α=0.05 level.
No any statistically significant differences in the hypocotyl and root lengths between CaMV35S::SlGRL2 transgenic lines and AC in
seedlings grown in the presence of 10 μM ACC (shown in bold). Graphical representation of this data is provided in Figure 2.4.

99

Table 2.4 Statistical analysis of the seedling triple response assay in CaMV35S::AtRTE1 lines of tomato

0 μM ACC

0.5 μM ACC

10 μM ACC

Group

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

AC

102.35a

34.84ab

89.11a

27.14a

20.11a

18.5a

Nr

112.19b

33.89ab

107.5c

31.43c

84.97e

29.91c

Gr

101.96a

35.11b

89.96a

30.6bc

27.67b

26.06b

35S::AtRTE1-4-3

110b

32.5a

98.41b

28.21a

46.12c

25.42b

35S::AtRTE1-19-22

112.74b

32.88ab

101.57bc

28.73ab

66.77d

26.83b

*Means followed by the same letters are not significantly different at α=0.05 level.
Note statistically significant hypocotyl and root lengths in CaMV35S::AtRTE1 transgenic lines in comparison to AC in seedlings
grown in the presence of 10 μM ACC (shown in bold). Graphical representation of this data is provided in Figure 2.5.

100

Table 2.5 Statistical analysis of the seeding triple response assay in etr1-2/rte1-3 lines of Arabidopsis transformed with either
CaMV35S::MYC-SlGR or CaMV35S::MYC-SlGRL1
0 μM ACC
Group

Hypocoty

0.1 μM ACC

1 μM ACC

10 μM ACC

100 μM ACC

Root

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

l
COL

12.47b*

8.88bc

11.87bc

7.1d

8.36ab

4.55c

6.84a

2.33b

6.7a

1.88b

etr1-2

14.59c

8.91c

14.42e

8.38e

13.63e

7.1d

12.35c

6.22d

12.02c

4.68d

etr1-2/rte1-3

10.66a

6.48a

10.15a

4.05a

8.21a

2.27a

6.72a

1.67a

6.56a

1.41a

35S::SlGR-3

12.45b

8.04b

11.28b

5.61bc

8.97b

3.09b

6.76a

1.54a

6.69a

1.32a

35S::SlGR-5

12.5b

8.06b

11.67bc

5.46b

8.37ab

2.93b

6.84a

1.55a

6.6a

1.37a

35S::SlGR-7

12.67b

8.47bc

12.14c

6.14c

8.6ab

3.23b

6.92a

1.73a

6.87a

1.41a

35S::SlGRL1-1

13.98c

8.79bc

13.89de

8.27e

12.69d

6.78d

11.73b

5.32c

11.65bc

4.21c

35S::SlGRL1-2

13.73c

8.96c

13.25d

8.05e

11.86c

6.59d

11.36b

5.26c

11.19b

4.16c

*Means followed by the same letters are not significantly different at α=0.05 level. Note statistically significant hypocotyl lengths in
CaMV35S::MYC-SlGR transgenic lines in comparison to the etr1-2/rte1-3 in seedlings grown in the absence (0 μM) or presence of 0.1

101

μM ACC (shown in bold). In comparison, hypocotyl lengths in seedlings grown on comparatively high concentrations of ACC (10
and 100 μM ) are not statistically significant. Graphical representation of this data is provided in Figure 2.6.

102

Table 2.6 Oligonucleotide primers used in this study
Primer

Sequence

Use

GRL1OE-F

5´
-TTGGATCCGATTGCTTTCTTGTGTGCTTCATC-3´

Construct assembly

GRL1OE-R

5´
-TTGAGCTCGGTAACTTGATATTGTCCAAATTC-3´

Construct assembly

RTE1OE-F

5´
-TTGGATCCATGTCACGTGGAAGAGGAGTTC-3´

Construct assembly

RTE1OE-R

5´
-TTGTCGACCTGCTTCAAGTAATTATGTTC-3´

Construct assembly

GRL2OE-F

5´
-TTGGATCCGTGCCAACGCACAATTTTATTAGC-3´

Construct assembly

GRL2OE-R

5´
-TTGAGCTCCCATGGACAAATAAAACTTCATGTC-3´

Construct assembly

GRENT-F

5´
-CACCATGCTGCCAAGAAGATATCCTCA-3´

Construct assembly

GRENTSTOP-R

5´
-CTAATTGTCATCCTCAATCTTGC-3´

Construct assembly

GRL1ENT-F

5´
-CACCATGCCATCAGGAAGACGTTCTT-3´

Construct assembly

GRL1ENTSTOP-R

5´
-CTAGGAATCCAACAGATTTTTGA-3´

Construct assembly

GRL1Q-F

5´ TGCAAAATTTCATGTCGCCATA-3´
-

qRT-PCR(tomato)

GRL1Q-R

5´ AGGCAGGTTCCAAATCCATTAA-3´
-

qRT-PCR(tomato)

GRL2Q-F

5´ GTGCTGCTGCCTTTCTCCTT-3´
-

qRT-PCR(tomato)

103

Table 2.6 (cont’d)
GRL2Q-R

5´ AGATTCATCATGGTTCTCGACATATT-3´
-

qRT-PCR(tomato)

RTE1Q-F

5´ TCATCAGTAGTCCGCTCGTTTCT-3´
-

qRT-PCR(tomato)

RTE1Q-R

5´ AAGCACCACCCCCAAAGAC -3´
-

qRT-PCR(tomato)

E4Q-F

5´ AGGGTAATGATGTGGGAAAG-3´
-

qRT-PCR(tomato)

E4Q-R

5´ CTTCTAACGACTCCCTTGCC-3´
-

qRT-PCR(tomato)

GADPHQ-F

5´ ATGCTCCCATGTTTGTTGTGGGTG-3´
-

qRT-PCR(tomato)

GADPHQ-R

5´ TTAGCCAAAGGTGCAAGGCAGTTC-3´
-

qRT-PCR(tomato)

CACQ-F

5´ CCTCCGTTGTGATGTAACTGG-3´
-

qRT-PCR(tomato)

CACQ-R

5´ ATTGGTGGAAAGTAACATCATCG-3´
-

qRT-PCR(tomato)

GRCDSQ-F

5´ TTGCAACGGCCACTCATTC-3´
-

qRT-PCR(Arabidopsis)

GRCDSQ-R

5´ CGCATTGATCCTCTAAATGATAGC-3´
-

qRT-PCR( Arabidopsis)

GRL1CDSQ-F

5´ GGCCAAATACCTTCAACTAGACAGA -3´
-

qRT-PCR( Arabidopsis)

GRL1CDSQ-R

5´ TGTGTGCAGCAAGGTTTCGT-3´
-

qRT-PCR( Arabidopsis)

AtUBQ10Q-F

5´ AAAGAGATAACAGGAACGGAAACATAGT-3´
-

qRT-PCR( Arabidopsis)

AtUBQ10Q-R

5´ GGCCTTGTATAATCCCTGATGAATAAG-3´
-

qRT-PCR( Arabidopsis)

104

CaMV35S::SlGR lines (Figure 2.1). Notably, over-expression of SlGRL1 did not lead to
inhibition of fruit ripening, which is a feature of the Gr mutant and CaMV35S::SlGR lines (Barry
and Giovannoni, 2006). However, the CaMV35S::SlGRL1 lines displayed inhibition of ethyleneinduced petiole epinasty, which is not a feature of the Gr mutant or the CaMV35S::SlGR lines
(Figure 2.1 & Figure 2.2). These data suggest that SlGR and SlGRL1 are not truly functionally
equivalent but have evolved to influence different subsets of ethylene responses. Additional
evidence for functional divergence of SlGR and SlGRL1 is derived from their differential ability
to complement the rte1-3 mutant phenotype. SlGRL1 is able to almost fully restore ethyleneinsensitivity to the etr1-2/rte1-3 double mutant, indicating complementation of the rte1-3 allele,
whereas SlGR can only recover the ethylene-hypersensitive phenotype of rte1-3 at low
concentrations of ACC (Figure 2.6). Similarly, while over-expression of AtRTE1 in tomato leads
to reduced ethylene responsiveness in multiple tissues (Figure 2.5), it does not result in a whole
plant reduction in ethylene responsiveness and CaMV35S::AtRTE1 lines do not mimic the Gr
mutant phenotype. In addition, a recent study on members of the rice GR/RTE1 family indicated
that OsGRL1a/OsRTH1 was able to complement loss of AtRTE1 function in Arabidopsis and
confer reduced ethylene sensitivity in Arabidopsis and rice when over-expressed (Zhang et al.,
2012). In contrast, OsGRL1b/OsRTH2 and OsGRL2/OsRTH3 could not complement the rte1-2
mutant allele and over-expression lines did not display reduced ethylene responsiveness.
Together, these data point to considerable heterogeneity among the members of the GR/RTE1
family suggesting that they likely exert their influence on ethylene signaling through specific
components of ethylene pathway and have diverged to the point where no single protein can
fully substitute for another.

105

Evidence for the existence of distinct ethylene signaling modules in tomato

The ethylene receptors are known to form large heteromeric complexes and interaction
experiments with between the ethylene receptors and additional signaling components suggest
that these complexes likely contain RTE1, EIN2 and CTR1 (Clark et al., 1998; Gao et al., 2008;
Bisson et al., 2009; Chen et al., 2010; Dong et al., 2010). The presence of different receptor
isoforms and the expansion of gene families in tomato and other species, coupled with
differential expression and / or accumulation of individual signaling components are likely to
contribute to heterogeneity within these complexes that may result in the formation of distinct
signaling modules that produce diverse outputs. A model has been proposed in which RTE1 is
required to maintain the ETR1 receptor in the “on signaling state” to inhibit ethylene responses
and biochemical evidence suggests that this occurs through a direct protein-protein interaction
(Resnick et al., 2008; Dong et al., 2010). Genetic analysis indicates that the effect of RTE1 is
highly specific for the ETR1 receptor although RTE1 also weakly interacts with the ERS1
receptor (Resnick et al., 2006; Resnick et al., 2008; Rivarola et al., 2009; Dong et al., 2010).

The ability of SlGR and SlGRL1 to influence separate subsets of ethylene responses, when overexpressed in tomato and Arabidopsis, suggests that they may do so through interactions with
distinct ethylene receptors or possibly through interactions with the same receptors but with
differing affinities. The latter scenario could explain the weak ethylene-insensitive phenotype
and partial complementation observed in the etr1-2/rte1-3 double mutant expressing the
CaMV35S::MYC-SlGR transgene (Figure 2.6). Furthermore, in tissues where over-expression of
either SlGR or SlGRL1 fails to give rise to an ethylene-insensitive phenotype, it is possible that
106

the appropriate target receptor may be absent, present at reduced levels compared to other
receptors, or that the response is mediated by receptors that do not require GR/RTE1 family
proteins. The latter hypothesis is supported by the observation that the etr1-9/ers1-3 double null
mutant of Arabidopsis remains responsive to ethylene suggesting that certain ethylene responses
are therefore likely to be independent of RTE1 given that RTE1 acts specifically with the ETR1
receptor (Resnick et al., 2006; Qu et al., 2007; Rivarola et al., 2009). Similarly, over-expression
of GR/RTE1 family members in tomato does not always lead to ethylene-insensitivity of the
magnitude observed in the dominant Nr ethylene receptor mutant. For example, compare
hypocotyl lengths in Gr X CaMV35S::SlGRL1 and CaMV35S::AtRTE1 seedlings grown on ACC
with those of the Nr mutant (Figure 2.3B and 2.5D) suggesting either a failure of the GR/RTE1
proteins to completely maintain the ethylene receptors in an “on signaling state” (Resnick et al.,
2008) or that GR/RTE1 independent receptors maintain some tissue responsiveness to ethylene.

Analysis of SlGRL1 over-expression in the Gr mutant (Figure 2.3) supports the hypothesis that
distinct ethylene signaling modules are formed in different tomato tissues. For example,
expression of CaMV35S::SlGRL1 in the Gr mutant background led to three distinct classes of
phenotype; those characteristic of either the Gr mutant phenotype (inhibition of fruit ripening) or
SlGRL1 over-expression (inhibition of petiole epinasty) and a set of responses that were additive
in the double over-expression line (inhibition of floral abscission and the seedling triple
response). Therefore, the failure of SlGR to reduce the petiole response to ethylene may be
caused by lack of the appropriate target receptor complex, whereas a complex that is a target for
the SlGRL1 protein is present. Together, these data support a model in which at least two
signaling modules comprised of distinct components control ethylene responses in tomato. In
107

some tissues or responses a module susceptible to the action of either SlGR or SlGRL1 operates
while in other situations both modules operate to cooperatively influence ethylene responses.

SlGRL2 is unlikely to play a role in ethylene signaling

SlGRL2 is closely related to AtRTH, an Arabidopsis gene of unknown function (Barry and
Giovannoni, 2006). Although the function of AtRTH is still unknown, it was reported that no
bimolecular fluorescence complementation (BiFC) signal was detected from co-infiltration of
cYFP-RTH and ETR1-nYFP, suggesting that RTH does not play the same role as RTE1 in
ethylene signaling (Dong et al., 2010). Similarly the putative rice ortholog of AtRTH,
OsGRL2/OsRTH3, cannot

complement the rte1-2 mutant allele and over-expression in

Arabidopsis does not confer reduced ethylene responsiveness (Zhang et al., 2012). Our data from
over-expression analysis of SlGRL2 also suggest that this gene is not involved in regulating
ethylene responsiveness and the CaMV353::GRL2 lines possessed phenotypes that were identical
to wild type plants. The function of SlGRL2, AtRTH and OsRTH3 remain unknown and will
require additional experimentation to resolve. Interestingly, sequence and phylogenetic analysis
indicates that animals and protist genomes contain a single copy of a protein closely related to
GR/RTE1 (Barry and Giovannoni, 2006; Klee, 2006). These organisms have not been reported to
signal using ethylene and do not contain other components of the ethylene signaling pathway.
Therefore, it is possible that SlGRL2 and its putative orthologs from other plant species are
involved in processes unrelated to ethylene signaling.

Materials and Methods
108

Plant Growth and Treatments

The parental cultivar Ailsa Craig (AC), the ethylene-insensitive mutants Never-ripe (Nr) and
Green-ripe (Gr), and CaMV35S:SlGR transgenic tomato lines have been described in the
published paper (Lanahan et al., 1994; Barry et al., 2005; Barry and Giovannoni, 2006). Plants
were grown in peat-based compost supplemented with fertilizer in greenhouses equipped with
heating and cooling systems and supplemental lighting at Michigan State University, East
Lansing, MI. Experiments to evaluate the triple response phenotype in dark grown tomato
seedlings and floral abscission were performed as previously described (Barry et al., 2005) with
the exception that seedlings were measured at 8 days after sowing and flowers were induced to
abscise by treatment with ethylene at a concentration of 2 l l-1. Tomato plants for investigating
ethylene

responses

during

petiole

epinasty

were

grown

in

Jiffy-7

Peat

Pellets

(http://www.hummert.com/) for 4 weeks under 16-h light/ 8-hour dark at 28oC and 65% relative
humidity. 4-week old plants were treated with 20 l l-1 ethylene for 16 hours and the adaxial leaf
angle determined.

Seeds of Arabidopsis thaliana ecotype Columbia (Col-0) together with the ethylene-signaling
mutants etr1-2 and etr1-2/rte1-3 were sown in 1:1:1 Sure mix: Medium vermiculite: Perlite
(Michigan Grower Products Inc., www.suremix.com) and exposed to a three day cold treatment
at 4oC. Seed trays were transferred to a growth chamber at 22oC under 16-h light/ 8-hour dark at
145 µmol m-2 s-1 and 65% relative humidity. Plants were supplemented with fertilizer 0.25 X
Hoaglands solution pH 5.5. The Arabidopsis triple response screen was performed using a
109

slightly modified version of a previously published protocol (Alonso et al., 2003). Arabidopsis
seeds were sterilized with 70% ethanol for 10 minutes, followed by three washes with 100%
ethanol. Surface sterilized seeds were dried on sterile filter paper in a laminar flow hood and
dried seeds were sprinkled onto 0.8% phytagar containing 1×
Murashige and Skoog salts, pH 6.0
and 1% sucrose supplemented with 1-aminocyclopropane-1-carboxylic acid (ACC) at 0, 0.1, 1,
10, and 100 μM. Plates were placed at 4oC for 3 days, exposed to light for 12 h, and then
incubated at room temperature in the dark for 6 days. Hypocotyl and root lengths were measured
using ImageJ (http://rsbweb.nih.gov/ij/).

qRT-PCR analysis

Total RNA was extracted using the RNeasy® Mini Kit and subjected to on column DNase
treatment (Qiagen, http://www.qiagen.com). 1 µg of RNA was used for reverse transcription
using

SuperScriptTM

III

First-Strand

Synthesis

System

(Invitrogen,

http://www.lifetechnologies.com/). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was
used as the endogenous control for tomato, except the experiment in Figure 2.1 C&D, which
used the clathrin adaptor complexes medium subunit (CAC). The GAPDH and CAC primers for
qRT-PCR were as previously described (Balaji et al., 2008; Exposito-Rodriguez et al., 2008).
Primers for the ripening- and ethylene-related E4 gene were as previously described (Gimenez et
al., 2010). Polyubiquitin 10 (AtUBQ10) was used as the endogenous control for Arabidopsis, and
the primers sequences were designed according to (De Vos and Jander, 2009). Gene-specific
primers for SlGR, SlGRL1, SlGRL2, and AtRTE1 were designed by Primer Express 3.0 (Applied
Biosystems, http://www.lifetechnologies.com), and all pairs of primers used in this research are
110

listed in the Table 2.6. The PCR reactions were performed with FAST SYBR® Master Mix, 2x
(Applied Biosystems) in a 25 µL volume using an Applied Biosystems StepOnePlusTM RealTime PCR System (ABI) with the following cycling program: 10 min at 95° followed by 40
C,
cycles of 95° for 15 s and 60° for 1 min. The primer efficiency was tested by generating
C
C
standard curves and results were analyzed by comparative ΔΔCT method (Livak and Schmittgen,
2001).

DNA constructs and plant transformation

The CaMV35S::SlGRL1 construct was assembled as follows: The full-length coding sequence of
SlGRL1 was re-amplified from the EST clone cLEG37H01 using the primers GRL1OE-F and
GRL1OE-R, which contain a BamHI and SacI linker sites on the forward and reverse primer,
respectively. This fragment was cloned into the pCR2.1 vector by TOPO® cloning (Invitrogen).
The fragment was excised using the restriction enzyme sites in the linkers and ligated
downstream of the CaMV35S promoter in the binary vector pBI121, previously modified by
removal of the UidA coding region by digestion with BamHI and SacI. The CaMV35S::SlGRL2
construct was assembled in the same way except that the SlGRL2 coding was re-amplified from
the EST clone cTOD-5-M16 using the primers GRL2OE-F and GRL2OE-R. The
CaMV35S::RTE1 construct was assembled as follows: The full-length coding sequence of RTE1
was amplified by RT-PCR from Arabidopsis leaf cDNA using the primers RTE1OE-F and
RTE1OE-R, which contain a BamHI and SalI linker sites on the forward and reverse primer,
respectively. The fragment was cloned into the pCR2.1 vector by TOPO® cloning. The clone
was digested with SalI, the overhang rendered blunt by incubation with the Klenow fragment of
111

DNA polymerase I and the insert released from the vector by digestion with BamHI. The insert
ligated downstream of the CaMV35S promoter in the binary vector pBI121, previously modified
by removal of the UidA coding region by digestion with SacI followed by polishing with T4
DNA polymerase and subsequent BamHI digestion. All PCR fragments used for construct
assembly were amplified using Pfu Ultra™ DNA polymerase (Agilent Technologies,
www.agilent.com) and the fidelity of all constructs was confirmed by DNA sequencing.
Transgenic tomato plants were generated through cotyledon-derived explants via Agrobacterium
tumefaciens mediated transformation of the AC cultivar using strain LBA4404 (Fillatti et al.,
1987). The presence of transgenes in tomato and the subsequent development of homozygous
lines, was achieved using a combination of PCR screening and Southern blot hybridization using
probes or markers designed to transgenes or selection markers as previously described (Barry et
al., 2005; Barry and Giovannoni, 2006). All primers used for assembling constructs were listed
in Table 2.6.

Epitope-tagged versions of SlGR and SlGRL1 were assembled using Gateway cloning
technology. Briefly, Gateway Entry clones were developed for each gene using primers listed in
Table 2.6 to amplify the corresponding gene fragments and insert them into the pENTR-DTOPO vector (Invitrogen). The resultant clones were digested with MluI which cuts in the vector
backbone but not the insert and the digestion mix was used together with the binary vector
pEarleyGate 203 (CaMV35S::MYC-Gateway-OCS) to create two constructs: CaMV35S::MYCSlGR and CaMV35S::MYC-SlGRL1. All PCR fragments used for construct assembly were
amplified using Pfu Ultra™ DNA polymerase (Agilent Technologies) and the fidelity of the
constructs confirmed by DNA sequencing. The constructs were transferred into Agrobacterium
112

tumefaciens strain GV3101 and transformed into Arabidopsis etr1-2/rte1-3 double mutant by
floral dip (Clough and Bent, 1998). Transformants were selected by spraying with 0.1 % and
0.2 % v/v Finale® herbicide (http://www.bayercropscience.com) at 1 and 2 weeks postgermination, respectively. The presence of the transgene was confirmed by PCR and the
development of homozygous lines was achieved using a combination of herbicide selection and
PCR screening.

DNA sequence analysis

DNA sequences were assembled using Sequencher version 4.7 (Genecodes Corporation, Ann
Arbor, MI http://genecodes.com).

Statistical analysis

Statistical analyses were performed using SAS (SAS Institute, www.sas.com). The genotypic
constituents were evaluated by Student’s t-test and LS Means.

113

REFERENCES

114

REFERENCES
Adams-Phillips L, Barry C, Kannan P, Leclercq J, Bouzayen M, Giovannoni J (2004) Evidence
that CTR1-mediated ethylene signal transduction in tomato is encoded by a multigene
family whose members display distinct regulatory features. Plant Molecular Biology 54:
387-404
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a bifunctional
transducer of ethylene and stress responses in Arabidopsis. Science 284: 2148-2152
Alonso JM, Stepanova AN, Solano R, Wisman E, Ferrari S, Ausubel FM, Ecker JR (2003) Five
components of the ethylene-response pathway identified in a screen for weak ethyleneinsensitive mutants in Arabidopsis. Proceedings of the National Academy of Sciences of
the United States of America 100: 2992-2997
An FY, Zhao QO, Ji YS, Li WY, Jiang ZQ, Yu XC, Zhang C, Han Y, He WR, Liu YD, Zhang
SQ, Ecker JR, Guo HW (2010) Ethylene-induced stabilization of ETHYLENE
INSENSITIVE3 and EIN3-LIKE1 is mediated by proteasomal degradation of EIN3
binding F-Box 1 and 2 that requires EIN2 in Arabidopsis. Plant Cell 22: 2384-2401
Balaji V, Mayrose M, Sherf O, Jacob-Hirsch J, Eichenlaub R, Iraki N, Manulis-Sasson S,
Rechavi G, Barash I, Sessa G (2008) Tomato transcriptional changes in response to
Clavibacter michiganensis subsp. michiganensis reveal a role for ethylene in disease
development. Plant Physiology 146: 1797-1809
Barry CS, Giovannoni JJ (2006) Ripening in the tomato Green-ripe mutant is inhibited by
ectopic expression of a protein that disrupts ethylene signaling. Proceedings of the
National Academy of Sciences of the United States of America 103: 7923-7928
Barry CS, McQuinn RP, Thompson AJ, Seymour GB, Grierson D, Giovannoni JJ (2005)
Ethylene insensitivity conferred by the Green-ripe and Never-ripe 2 ripening mutants of
tomato. Plant Physiology 138: 267-275
Bisson MMA, Bleckmann A, Allekotte S, Groth G (2009) EIN2, the central regulator of ethylene
signalling, is localized at the ER membrane where it interacts with the ethylene receptor
ETR1. Biochemical Journal 424: 1-6
Bisson MMA, Groth G (2010) New insight in ethylene signaling: Autokinase activity of ETR1
modulates the interaction of receptors and EIN2. Molecular Plant 3: 882-889
Bleecker AB (1999) Ethylene perception and signaling: an evolutionary perspective. Trends in
Plant Science 4: 269-274
115

Bleecker AB, Kende H (2000) Ethylene: A gaseous signal molecule in plants. Annual Review of
Cell and Developmental Biology 16: 1-18
Chang C, Kwok SF, Bleecker AB, Meyerowitz EM (1993) Arabidopsis ethylene-response gene
ETR1: similarity of product to two-component regulators. Science 262: 539-544
Chen JF, Gallie DR (2010) Analysis of the functional conservation of ethylene receptors between
maize and Arabidopsis. Plant Molecular Biology 74: 405-421
Chen YF, Gao ZY, Kerris RJ, Wang WY, Binder BM, Schaller GE (2010) Ethylene receptors
function as components of high-molecular-mass protein complexes in Arabidopsis. Plos
One 5: e8640
Chen YF, Randlett MD, Findell JL, Schaller GE (2002) Localization of the ethylene receptor
ETR1 to the endoplasmic reticulum of Arabidopsis. Journal of Biological Chemistry 277:
19861-19866
Clark KL, Larsen PB, Wang XX, Chang C (1998) Association of the Arabidopsis CTR1 Raf-like
kinase with the ETR1 and ERS ethylene receptors. Proceedings of the National Academy
of Sciences of the United States of America 95: 5401-5406
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant Journal 16: 735-743
De Vos M, Jander G (2009) Myzus persicae (green peach aphid) salivary components induce
defence responses in Arabidopsis thaliana. Plant Cell and Environment 32: 1548-1560
Dong CH, Jang M, Scharein B, Malach A, Rivarola M, Liesch J, Groth G, Hwang I, Chang C
(2010) Molecular association of the Arabidopsis ETR1 ethylene receptor and a regulator
of ethylene signaling, RTE1. Journal of Biological Chemistry 285: 40706-40713
Dong CH, Rivarola M, Resnick JS, Maggin BD, Chang C (2008) Subcellular co-localization of
Arabidopsis RTE1 and ETR1 supports a regulatory role for RTE1 in ETR1 ethylene
signaling. Plant Journal 53: 275-286
Exposito-Rodriguez M, Borges AA, Borges-Perez A, Perez JA (2008) Selection of internal
control genes for quantitative real-time RT-PCR studies during tomato development
process. Bmc Plant Biology 8: 131-142
Fillatti JJ, Kiser J, Rose R, Comai L (1987) Efficient transfer of a glyphosate tolerance gene into
tomato using a binary Agrobacterium-tumefaciens vector. Bio-Technology 5: 726-730
116

Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J (1999) Preservation of
duplicate genes by complementary, degenerative mutations. Genetics 151: 1531-1545
Freeling M (2009) Bias in plant gene content following different sorts of duplication: Tandem,
whole-genome, segmental, or by transposition. In Annual Review of Plant Biology, Vol
60, pp 433-453
Gao Z, Wen CK, Binder BM, Chen YF, Chang J, Chiang YH, Ill RJK, Chang C, Schaller GE
(2008) Heteromeric interactions among ethylene receptors mediate signaling in
Arabidopsis. Journal of Biological Chemistry 283: 23801-23810
Gao ZY, Chen YF, Randlett MD, Zhao XC, Findell JL, Kieber JJ, Schaller GE (2003)
Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis
through participation in ethylene receptor signaling complexes. Journal of Biological
Chemistry 278: 34725-34732
Gimenez E, Pineda B, Capel J, Anton MT, Atares A, Perez-Martin F, Garcia-Sogo B, Angosto T,
Moreno V, Lozano R (2010) Functional analysis of the Arlequin Mutant corroborates the
essential role of the ARLEQUIN/TAGL1 gene during reproductive development of tomato.
Plos One 5
Guo HW, Ecker JR (2004) The ethylene signaling pathway: new insights. Current Opinion in
Plant Biology 7: 40-49
Hattori Y, Nagai K, Furukawa S, Song XJ, Kawano R, Sakakibara H, Wu JZ, Matsumoto T,
Yoshimura A, Kitano H, Matsuoka M, Mori H, Ashikari M (2009) The ethylene response
factors SNORKEL1 and SNORKEL2 allow rice to adapt to deep water. Nature 460: 10261031
Hua J, Meyerowitz EM (1998) Ethylene responses are negatively regulated by a receptor gene
family in Arabidopsis thaliana. Cell 94: 261-271
Huang YF, Li H, Hutchison CE, Laskey J, Kieber JJ (2003) Biochemical and functional analysis
of CTR1, a protein kinase that negatively regulates ethylene signaling in Arabidopsis.
Plant Journal 33: 221-233
Kendrick MD, Chang C (2008) Ethylene signaling: new levels of complexity and regulation.
Current Opinion in Plant Biology 11: 479-485
Kieber J-J, Rothenberg M, Roman G, Feldmann K-A, Ecker J-R (1993) CTR1, a negative
regulator of the ethylene response pathway in Arabidopsis, encodes a member of the Raf
family of protein kinases. Cell 72: 427-441
117

Klee H (2006) Highly conserved proteins that modify plant ethylene responses. Proceedings of
the National Academy of Sciences of the United States of America 103: 7537-7538
Klee HJ (2004) Ethylene signal transduction. Moving beyond Arabidopsis. Plant Physiology 135:
660-667
Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1994) The Never ripe mutation blocks ethylene
perception in tomato. Plant Cell 6: 521-530
Lincoln JE, Cordes S, Read E, Fischer RL (1987) Regulation of gene expression by ethylene
during Lycopersicon esculenlum (tomato) fruit development. Proceedings of the National
Academy of Sciences of the United States of America 84: 2793-2797
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time
quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25: 402-408
Ma B, Cui ML, Sun HJ, Takada K, Mori H, Kamada H, Ezura H (2006) Subcellular localization
and membrane topology of the melon ethylene receptor CmERS1. Plant Physiology 141:
587-597
Qiao H, Shen Z, Huang S-sC, Schmitz RJ, Urich MA, Briggs SP, Ecker JR (2012) Processing
and subcellular trafficking of ER-tethered EIN2 control response to ethylene gas. Science
Qu X, Hall BP, Gao ZY, Schaller GE (2007) A strong constitutive ethylene-response phenotype
conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1
and ERS1. Bmc Plant Biology 7: 3-17
Resnick JS, Rivarola M, Chang C (2008) Involvement of RTE1 in conformational changes
promoting ETR1 ethylene receptor signaling in Arabidopsis. Plant Journal 56: 423-431
Resnick JS, Wen CK, Shockey JA, Chang C (2006) REVERSION-TO-ETHYLENE
SENSITIVITY1, a conserved gene that regulates ethylene receptor function in
Arabidopsis. Proceedings of the National Academy of Sciences of the United States of
America 103: 7917-7922
Rivarola M, McClellan CA, Resnick JS, Chang C (2009) ETR1-Specific Mutations Distinguish
ETR1 from Other Arabidopsis Ethylene Receptors as Revealed by Genetic Interaction
with RTE1. Plant Physiology 150: 547-551
Rodriguez FI, Esch JJ, Hall AE, Binder BM, Schaller GE, Bleecker AB (1999) A copper
cofactor for the ethylene receptor ETR1 from Arabidopsis. Science 283: 996-998
118

Roman G, Lubarsky B, Kieber JJ, Rothenberg M, Ecker JR (1995) Genetic analysis of ethylene
signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress
response pathway. Genetics 139: 1393-1409
Rzewuski G, Sauter M (2008) Ethylene biosynthesis and signaling in rice. Plant Science 175: 3242
Stepanova AN, Alonso JM (2009) Ethylene signaling and response: where different regulatory
modules meet. Current Opinion in Plant Biology 12: 548-555
Tieman DV, Taylor MG, Ciardi JA, Klee HJ (2000) The tomato ethylene receptors NR and
LeETR4 are negative regulators of ethylene response and exhibit functional
compensation within a multigene family. Proceedings of the National Academy of
Sciences of the United States of America 97: 5663-5668
Wang WY, Esch JJ, Shiu SH, Agula H, Binder BM, Chang C, Patterson SE, Bleecker AB (2006)
Identification of important regions for ethylene binding and signaling in the
transmembrane domain of the ETR1 ethylene receptor of Arabidopsis. Plant Cell 18:
3429-3442
Wuriyanghan H, Zhang B, Cao WH, Ma BA, Lei G, Liu YF, Wei W, Wu HJ, Chen LJ, Chen
HW, Cao YR, He SJ, Zhang WK, Wang XJ, Chen SY, Zhang JS (2009) The ethylene
receptor ETR2 delays floral transition and affects starch accumulation in rice. Plant Cell
21: 1473-1494
Zhang LX, Li ZF, Quan RD, Li GJ, Wang RG, Huang RF (2011) An AP2 domain-containing
gene, ESE1, targeted by the ethylene signaling component EIN3 is important for the salt
response in Arabidopsis. Plant Physiology 157: 854-865
Zhang W, Zhou X, Wen CK (2012) Modulation of ethylene responses by OsRTH1
overexpression reveals the biological significance of ethylene in rice seedling growth and
development. Journal of Experimental Botany 63: 4151-4164
Zhao Q, Guo HW (2011) Paradigms and paradox in the ethylene signaling pathway and
interaction network. Molecular Plant 4: 626-634
Zhou X, Liu Q, Xie F, Wen CK (2007) RTE1 is a Golgi-associated and ETR1-dependent
negative regulator of ethylene responses. Plant Physiology 145: 75-86

119

Chapter 3 Exploring putative functional domains in GR/RTE1 proteins

120

Abstract

The gaseous plant hormone ethylene influences many aspects of plant development and mediates
responses to biotic and abiotic stresses. GREEN RIPE (SlGR) and REVERSION TO
ETHYLENE SENSITIVITY 1 (AtRTE1) are the founder members of the GR/RTE1 protein
family and function in ethylene signaling in tomato (Solanum lycopersicum) and Arabidopsis
(Arabidopsis thaliana), respectively. In tomato, SlGR and its paralog GREEN RIPE LIKE1
(SlGRL1) exhibit distinct functional characteristics when over-expressed in tomato and while
SlGRL1 is able to fully complement loss of rte1 function, SlGR is only able to recover the
ethylene hypersensitivity observed in the rte1-3 mutant allele. Putative Solanaceae orthologs of
SlGR and SlGRL1 were isolated through a combination of library screening and in silico analysis.
Phylogenetic and sequence alignments revealed that putative SlGR orthologs within the eudicot
lineage are restricted to the Solanaceae family and are more divergent than the putative SlGRL1
orthologs. A combination of over-expression in tomato and complementation of the rte1-3
mutant allele of Arabidopsis revealed that PhGR from Petunia hybrida and SmGR from eggplant
(Solanum melongena) share functional characteristics of both SlGR and SlGRL1. Utilizing a
comparative approach, a series of amino acid residues were identified that correlate with the
ability of the Solanaceae GR and GRL1 proteins to complement the rte1 mutant phenotype.
Expression of synthetic constructs in which amino acids present in SlGR were converted to those
present in either PhGR or SmGR led to the identification of a set of 10 amino acids that are
important for the ability of Solanaceae GR and GRL1 orthologs to complement the rte1 mutant
phenotype. Furthermore, previous mutant analysis demonstrated the importance of the C121

terminus of GR/RTE1 for function. In this study, the roles of two highly conserved amino acids,
Y235 and K238, that reside in the C-terminus of GR/RTE1 proteins was investigated through a
combination of site-directed mutagenesis and deletion analysis. Three SlGRL1 mutant variants,
SlGRL1Y235A, SlGRL1K238A, and SlGRL1Δ9, complemented the rte1-3 mutant allele with
the same efficiency observed using the wild-type SlGRL1 protein suggesting that although these
residues are highly conserved, Y235 and K238 are not essential for function.

Introduction

Hormone signaling pathways are generally conserved in higher plants and conservation of
ethylene perception and signaling between diverse species is probably best illustrated by
transgenic expression of a dominant mutant form of the Arabidopsis etr1-1 receptor in many
plant species including petunia, tomato, carnation, Campanula carpatica and tobacco (Wilkinson
et al., 1997; Knoester et al., 1998; Bovy et al., 1999; Sriskandarajah et al., 2004). These
experiments demonstrate that multiple ethylene responses in diverse species can be controlled by
a single heterologous transgene. The conservation of ethylene signaling mechanisms is also
supported by research demonstrating the isolation and functional characterization of ethylene
signaling components from several plant species (Sato-Nara et al., 1999; Takahashi et al., 2002;
Guo and Ecker, 2004; Kendrick and Chang, 2008; Ma et al., 2010; Tatsuki, 2010). However,
outside of Arabidopsis, a deep understanding of the role of many of these signaling components
is lacking particularly in species where ethylene influences developmental processes that are not
part of the Arabidopsis life cycle including fruit ripening, internode elongation during

122

submergence tolerance in rice, andromonoecy, and nodule formation (Oeller et al., 1991; Xu et
al., 2006; Boualem et al., 2008; Penmetsa et al., 2008; Hattori et al., 2009).

Furthermore, increasing evidence suggests that there is considerable variation in the composition
of ethylene signaling components between species. For example, compared with Arabidopsis,
tomato has an extra subfamily-1 ethylene receptor LeETR2, but lacks a copy of the subfamily-2
receptor ERS2 (Bleecker, 1999; Klee, 2004). Similarly, there is no ETR1-type ethylene receptor
in rice, wheat, and maize (Cao et al., 2003; Ma and Wang, 2003; Gallie and Young, 2004;
Watanabe et al., 2004; Yau et al., 2004). In general, gene silencing and analysis of knockout
mutants has revealed a more pronounced role for subfamily-2 ethylene receptors in tomato, rice,
and petunia compared to Arabidopsis (Tieman et al., 2000; Qu et al., 2007; Wang and Kumar,
2007; Wuriyanghan et al., 2009). In addition to variation in the ethylene receptors, variation is
also present in CTR1-like genes. While a single CTR1 protein is encoded by the Arabidopsis
genome; four CTR1-like genes are present in tomato, LeCTR1, LeCTR2, LeCTR3, and LeCTR4
(Lin, 1998; Leclercq et al., 2002; Adams-Phillips et al., 2004). In Arabidopsis, CTR1 interacts
with all Arabidopsis ethylene receptors, although the affinity between CTR1 and ETR1 is the
stronger than with the other receptors (Clark et al., 1998; Wang et al., 2003; Qu et al., 2007). In
tomato, LeCTR1, LeCTR3, and LeCTR4 proteins interact with the tomato subfamily-1 receptors,
whereas LeCTR2 only interacts with LeETR1 and LeETR2 (Lin et al., 2008; Zhong et al., 2008).
Although not fully understood, this variation in gene copy number and functional characteristics
between species suggests that subtle differences may exist in ethylene signaling cascades of
diverse species that may contribute to distinct developmental processes, or environmental
responses leading to phenotypic variation.
123

In tomato, copy number variation is also evident within the GREEN-RIPE/REVERSION TO
ETHYLENE SENSITIVITY 1 (GR/RTE1) gene family with tomato containing two paralogous
genes designated GREEN-RIPE (SlGR) and GREEN-RIPE LIKE 1(SlGRL1) whereas
Arabidopsis and other eudicot species contain a single copy gene that has higher sequence
similarity to SlGRL1 than to SlGR (Barry and Giovannoni, 2006). In Arabidopsis, RTE1 is
required for the function of the ETR1 ethylene receptor (Resnick et al., 2006; Zhou et al., 2007)
and the presence of the extra gene copy in tomato creates the potential for subfunctionalization
leading to increased complexity within the ethylene signaling pathway. This hypothesis was
supported by a combination of characterization of the Gr mutant and over-expression analysis of
SlGRL1. The Green-ripe (Gr) mutant of tomato displays reduced ethylene responsiveness in a
subset of tissues resulting in plants with impaired fruit ripening, petal senescence, floral
abscission, and an altered seedling triple response and results from a promoter deletion that
causes over-expression of GR

(Barry et al., 2005; Barry and Giovannoni, 2006).

Over-

expression of SlGR under the control of the CaMV35S promoter recreates the Gr mutant
phenotype but does not lead to a whole plant reduction in ethylene responsiveness suggesting
that SlGR modulates a subset of ethylene responses possibly at the post-transcriptional level
(Barry and Giovannoni, 2006). Similarly, over-expression of SlGRL1 in tomato also leads to
reduced ethylene responsiveness but affects distinct yet overlapping responses compared to SlGR
suggesting that these genes are not completely functionally equivalent, a hypothesis supported by
their differential ability to complement loss of rte1 function in Arabidopsis (Chapter 2).
Furthermore, over-expression of SlGRL1 in a Gr mutant background supports a model in which

124

separate ethylene responses are influenced by either SlGR or SlGRL1 or a combination of both,
suggesting the existence of distinct signaling modules in tomato (Chapter 2).

Functional analysis of ethylene signaling components in Arabidopsis is facilitated by the
availability of multiple mutant alleles in genes of interest that carry amino acid substitutions
resulting in altered phenotypic responses (Chang et al., 1993; Kieber et al., 1993; Hua et al.,
1995; Schaller and Bleecker, 1995; Hua et al., 1998; Hall et al., 1999; Rodriguez et al., 1999;
Resnick et al., 2006; Wang et al., 2006). In other species, a range of mutant alleles are typically
unavailable, limiting detailed structure-function analysis of proteins. We hypothesized that the
differences in functional properties between SlGR and SlGRL1 are the result of differences in
their primary amino acid sequences. Using a comparative approach, putative orthologs of SlGR
and SlGRL1 were isolated from several Solanaceous species. Sequence analysis revealed that
putative GRL1 orthologs share a high level of sequence conservation whereas putative GR
orthologs are more divergent. A combination of over-expression analysis in tomato together with
complementation of the rte1-3 mutant allele of Arabidopsis suggests considerable heterogeneity
in the functional characteristics of the putative GR orthologs. Sequence analysis identified amino
acid residues within select GR and GRL1orthologs that correlate with the ability of each protein
to complement the rte1-3 mutant allele of Arabidopsis. Custom gene synthesis and site-directed
mutagenesis was utilized to attempt to identify amino acids required for functional characteristics
of GR and GRL1 proteins. This analysis identified 10 amino acids that are important for the
ability of Solanaceae GR and GRL1 orthologs to complement the rte1-3 mutant allele. In
addition, highly conserved amino acids present within the C-terminus of GR/RTE1 family
members were found not to be required for functional characteristics of SlGRL1.
125

Results

Putative SlGR orthologs within the eudicot lineage are restricted to the Solanaceae family

Previously, SlGR and two additional GR homologs were identified from tomato designated
SlGRL1 and SlGRL2 with phylogenetic analysis revealing that SlGR and SlGRL1 are more
closely related to one another and to Arabidopsis AtRTE1 whereas SlGRL2 is more divergent and
similar to Arabidopsis RTE1-HOMOLOG (AtRTH) (Barry and Giovannoni, 2006; Resnick et al.,
2006). Three way sequence comparisons between SlGR and SlGRL1 with available sequences
consistently revealed that SlGRL1 displayed higher sequence homology to genes from other
eudicot species than did SlGR (data not shown). Furthermore, all eudicot species examined, even
those with available genome sequences, contain only two genes that are either highly similar to
SlGRL1 or SlGRL2 (Figure 3.1, Table 3.1). Together, these data suggest that SlGR is more
divergent and may represent a gene that is not widely distributed in eudicot families. In an
attempt to identify putative GR orthologs, bacterial artificial chromosome (BAC) libraries of
three Solanaceae species, eggplant (Solanum melongena), pepper (Capsicum annuum), and
petunia (Petunia inflata) were screened with probes to both SlGR and SlGRL1. Several clones
were identified from each library and restriction mapping coupled with hybridization was used to
group clones into families (Barry, unpublished data). DNA sequencing of representative BAC
clones using primers designed to conserved regions of SlGR and SlGRL1 followed by successive
rounds of primer walking were utilized to complete the sequence of the BAC clone covering the
predicted SlGR and SlGRL1 genomic regions. Utilizing this approach putative GR orthologs
126

from pepper, eggplant and petunia and putative GRL1 orthologs from eggplant and petunia were
identified (Table 3.1, Barry unpublished data). The subsequent release of the draft sequence of
the potato genome also revealed the presence of putative GR, GRL1 and GRL2 orthologs (Xu et
al., 2011) (Table 3.1). Phylogenetic analysis of the predicted proteins revealed that the putative
GR orthologs formed a separate subclade that only contained sequences from other Solanaceae
species whereas the putative Solanaceae GRL1 proteins clustered with RTE1 and related proteins
from other eudicot species (Figure 3.1). Furthermore, pairwise sequence comparisons and branch
lengths on the phylogenetic tree indicated that the GRL1 related proteins are highly similar to
one another, ranging between 89-95 percent identical, whereas the putative GR proteins are more
divergent, ranging between 60–89 percent identity at the amino acid level (Figure 3.1, Table 3.2).
The phylogenetic relationship of SlGR and SlGRL1 support the hypothesis that these genes
possess distinct roles within ethylene signaling.

Over-expression of PhGR in tomato phenocopies the Never-ripe mutant

Previous research has indicated that SlGR and SlGRL1 are able to influence distinct and
overlapping ethylene responses when over-expressed in tomato and also exhibit a differential
ability to complement loss of rte1 function in Arabidopsis (Barry and Giovannoni, 2006)
(Chapter 2) (Figure 2.1, 2.2, 2.6, 2.7). The amino acid identities of the putative Solanaceae
GRL1 orthologs ranges between 89-95 percent whereas the putative Solanaceae GR orthologs,
are only between 60-89 percent identical (Table 3.2). As the putative GR orthologs are
considerably

more

divergent,

we

hypothesized

that

they

have

been

subject

to

subfunctionalization resulting in an altered capacity to influence ethylene responsiveness. To test
127

this hypothesis, PhGR over-expression lines under the control of the CaMV35S promoter were
generated in tomato and analyzed for altered ethylene responsiveness. Two homozygous
independent transgenic CaMV35S::PhGR lines were developed that possess elevated PhGR
transcript levels (Figure 3.2B). Transgenic lines displayed the typical non-ripening phenotype
observed by the tomato Gr mutant and CaMV35S::GR lines (Figure 3.2A). However, unlike the
Gr mutant and the CaMV35S::GR transgenic lines, CaMV35S::PhGR etiolated seedlings grown
on the ethylene precursor ACC displayed reduced ethylene responsiveness as indicated by
significantly increased hypocotyl and root lengths (Figure 3.2C, D, Table 3.4). Similarly,
CaMV35S::PhGR over-expression lines displayed reduced rates of ethylene-induced floral
abscission and petiole epinasty (Figure 3.2E, F). Together, in all of the phenotypes and responses
examined, the PhGR over-expression lines displayed reduced ethylene responsiveness that
resembles the dominant ethylene-insensitive receptor mutant, Never-ripe (Lanahan et al., 1994).
These data contrast with previous studies on SlGR and SlGRL1 over-expression which indicate
that these genes influence only subsets of ethylene responses in tomato (Barry and Giovannoni,
2006) (Chapter 2), revealing that considerable heterogeneity in the control of ethylene responses
mediated by members of the GR/RTE family.

PhGR and SmGR can complement the rte1-3 loss of function in Arabidopsis

Our previous research indicates that SlGR and SlGRL1 influence distinct subsets of ethylene
responses in tomato (Chapter 2). Furthermore, while SlGRL1 was able to complement loss of
rte1 function, restoring ethylene insensitivity to the etr1-2/rte1-3 double mutant, SlGR was only
128

able to recover the ethylene hypersensitivity observed in the rte1-3 mutant allele (Chapter 2)
(Figure 2.6). Given the sequence divergence of the putative GR orthologs relative to the high
sequence conservation experienced by the putative GRL1 orthologs, the putative GR orthologs
may have different functional properties and influence diverse ethylene responses. To test this
hypothesis, the ability of PhGR and SmGR to complement the rte1-3 allele was examined. Nterminal epitope-tagged versions of PhGR and SmGR under the control of the CaMV35S
promoter were transformed in the etr1-2/rte1-3 double mutant in which ethylene insensitivity is
suppressed due to loss of RTE1 function (Resnick et al., 2006). Three homozygous
CaMV35S::MYC-PhGR lines and two homozygous CaMV35S::MYC-SmGR lines were
recovered. Analysis of the seedling triple response in these lines indicate that both PhGR and
SmGR are able to complement loss of rte1 function although PhGR has a more pronounced
affect than SmGR as highlighted by the almost complete restoration of the ethylene-insensitivity
to the etr1-2/rte1-3 seedlings (Figure 3.3, Table 3.3). These data suggest that PhGR and SmGR
possess functional characteristics more similar to SlGRL1 than SlGR. Furthermore, the relatively
weak complementation phenotype of SmGR compared to PhGR is likely caused by the closer
phylogenetic relationship to SlGR than PhGR. These data indicate that the ability to complement
loss of rte1 function is not restricted to the GRL1 orthologs and suggest that sequence differences
between SlGR and other the other putative GR orthologs are likely responsible for determining
these functional differences.

Identification of amino acids within the GR proteins required for complementation of the
rte1-3 mutant allele

129

PhGR and SmGR are able to almost fully complement loss of rte1 function in Arabidopsis
(Figure 3.3). In contrast, SlGR can only restore the ethylene-hypersensitive phenotype of the
rte1-3 mutant allele to the level of sensitivity observed in wild-type Columbia seedlings grown in
either the absence of ACC or in the presence of 0.1 µM ACC (Chapter 2). The differential ability
of GR homologs to complement the rte1 mutant coupled with their moderately high amino acid
sequence identity suggest that it might be possible to utilize a comparative approach to identify
amino acid residues or motifs that may confer the ability to complement the rte1-3 mutant allele
of Arabidopsis. Amino acid alignments were developed comparing all of the putative Solanaceae
GR and GRL1 orthologs. Given that the putative GRL1 orthologs share high amino acid
sequence identity (89-95 percent) an assumption was made that, like SlGRL1, these proteins
would be able to complement loss of rte1 function. Therefore, it was hypothesized that amino
acids that are fully conserved within the GRL1 orthologs together with SmGR and PhGR but
were divergent in SlGR would facilitate complementation of the rte1-3 mutant allele. Utilizing
this approach, 19 amino acids, which are conserved in putative GRL1 orthologs and PhGR but
differ in SlGR, were identified together with 10 amino acids that are conserved in putative GRL1
orthologs and SmGR but differ in SlGR (Figure 3.4). Utilizing custom gene synthesis, two
synthetic genes were developed that converted either the 10 or 19 amino acids in SlGR to those
present in SmGR and PhGR, respectively. These synthetic genes, referred to as SlGR-SmGR and
SlGR-PhGR, respectively, were cloned into binary vectors downstream of the CaMV35S
promoter as N-terminally tagged YFP fusions.

The CaMV35S::YFP-(SlGR-PhGR) and

CaMV35S::YFP-(SlGR-SmGR) constructs were introduced into the etr1-2/rte1-3 double mutant
which is ethylene hypersensitive due to the suppression of the etr1-2 phenotype (Resnick et al.,
130

2006) and the ability of each construct to complement rte1-3 loss of function was assessed.
Three transgenic CaMV35S::YFP-(SlGR-PhGR) lines and two transgenic CaMV35S::YFP(SlGR-SmGR) lines restored ethylene insensitivity in both hypocotyls and roots to similar levels
observed in the CaMV35S::MYC-PhGR and CaMV35S::MYC-SmGR lines, when grown in media
containing ACC (Figure 3.5, 3.6). These data indicate that the 19 amino acids changed in SlGRPhGR, and 10 amino acids changed in SlGR-SmGR are functional amino acids, and these amino
acids are required for complementation of the rte1-3 mutant allele.

The last 9 amino acids of SlGRL1 including the highly conserved tyrosine and lysine
residues are not required for the ability of SlGRL1 to complement the rte1-3 allele

The C-terminus of AtRTE1 contains a transmembrane domain, and frame shift mutations or
deletions that change the C-terminal of AtRTE1 render the corresponding proteins nonfunctional
(Resnick et al., 2006; Dong et al., 2008; Dong et al., 2010). For example, the rte1-2 mutation,
which lacks a single nucleotide in the C-terminus of coding sequence, results in a frame shift that
replaces the last 27 residues with 15 incorrect residues and a premature termination codon
leading to plants that display phenotypes indicative of enhanced ethylene responsiveness,
including shorter hypocotyl and root lengths during the seedling triple response (Resnick et al.,
2006). Furthermore a C-terminal tagged version of AtRTE1 (AtRTE1-RFP) under the control of
native RTE1 promoter region does not complement the rte1-3 mutant phenotype, whereas Nterminally tagged versions of RTE1 are fully functional (Dong et al., 2008). Similarly, a deletion
of the last 12 amino acids of SlGR, renders the truncated protein unable to confer ripening
inhibition in transgenic tomato plants (Figure 3.7A) (Barry, unpublished data). Together, these
131

data indicate that the C-terminus of GR/RTE1 proteins is important for their functional
properties.

An alignment of several GR/RTE1 family proteins revealed the presence of conserved tyrosine
and lysine motifs corresponding to residues 235 and 238 in SlGR (Figure 3.7B). Due to the
highly conserved nature of these amino acids, it was hypothesized that Y235 and K238 are
important for the function of the GR/RTE1 family. To test this hypothesis, we utilized the ability
of SlGRL1 to complement the rte1 mutant phenotype of Arabidopsis as a functional screen and
generated mutant variants of this gene in which Y235 and K238 were individually converted to
alanine residues. In addition, a third construct in which the last nine amino acids of SlGRL1 were
deleted to remove these conserved amino acids was created. N-terminal YFP-tagged versions of
these constructs were assembled transformed in to the Arabidopsis etr1-2/rte1-3 double mutant
and their ability to restore ethylene-insensitivity in the seedling triple response was assessed. All
three mutant variant constructs complemented the rte1-3 mutant allele with the similar efficiency
to that observed for SlGRL1 (Figure 3.8, 3.9, 3.10). Together, these data suggest that the last 9
amino acids of SlGRL1 including the highly conserved tyrosine and lysine residues are not
required for the ability of SlGRL1 to complement the rte1-3 allele.

Discussion

Variation in gene copy number and functional heterogeneity of the GR/RTE1 family in
plants

132

The GR/RTE1 family is conserved in plants, animals and protozoa (Barry and Giovannoni, 2006;
Klee, 2006) however, gene copy number varies between species. For example, animal and
protozoan genomes contain a single GR/RTE1 homolog of unknown function whereas most plant
species contain two or three gene copies. For example, most eudicot species contain a single
copy of a gene that is more similar to AtRTE1 and SlGRL1 together with a single copy of the
distantly related gene, defined by AtRTH and SlGRL2 (Figure 3.1), the latter of which does not
appear to influence ethylene responses in tomato (Figure 2.4). However, in addition, tomato and
other members of the Solanaceae family possess a single copy of a gene defined by SlGR which
is a phylogenetically distinct paralog of SlGRL1 (Figure 3.1; Table 3.1, 3.2). The origins of SlGR
and SlGRL1 are unclear but it is possible that they may have arisen as a result of a recent
triplication event that is present in the Solanum lineage (Sato et al., 2012) although they are fairly
divergent at the amino acid level (Table 3.2).

Similarly, most monocot species also contain two GRL1 homologs together with a copy of a
gene that is more similar to AtRTH and SlGRL2. With respect to ethylene signaling, these
homologs appear to possess distinct yet sometimes overlapping functions. For example, both
SlGR and SlGRL1 are able to influence distinct subsets of ethylene responses when overexpressed in tomato and each differentially complements the rte1-3 mutant allele (Chapter 2).
Similarly, over-expression of AtRTE1 in Arabidopsis and tomato reduces ethylene
responsiveness although AtRTE1 over-expression lines of tomato more closely resemble SlGRL1
over-expression lines (Chapter 2). In contrast, our data suggests that SlGRL2 is not involved in
mediating ethylene responses (Chapter 2). In rice, OsGRL1a/OsRTH1a influences ethylene
responsiveness when over-expressed in rice and Arabidopsis and complements the rte1-2 mutant
133

allele (Zhang et al., 2012). In contrast, in the responses examined, both OsGRL1b/OsRTH2 and
OsGRL2/OsRTH3 failed to influence ethylene responsiveness (Zhang et al., 2012).

Putative Solanaceae GR orthologs are more divergent in comparison to the putative Solanaceae
GRL1 orthologs suggesting that the putative GR orthologs may possess different functional
properties. This hypothesis was confirmed through over-expression analysis in tomato and
through complementation of the rte1-3 mutant allele. Both PhGR and SmGR are able to
complement loss of rte1 function although PhGR has a more pronounced affect (Figure 3.3).
Similarly, over-expression of PhGR, which displays considerable sequence divergence to either
SlGR or SlGRL1, in tomato led to a broad spectrum reduction in ethylene responsiveness that
closely resembles that of the Nr ethylene receptor mutant (Lanahan et al., 1994; Wilkinson et al.,
1995). These data suggest that PhGR and SmGR are functionally more similar to the putative
GRL1 orthologs than SlGR. However, when over-expressed in tomato, PhGR shared
characteristics of both the Gr mutant and SlGRL1 over-expression lines (Figure 3.2). The
mechanisms through which this functional heterogeneity occurs is not understood but based on
analysis of the functional properties of AtRTE1 (Chapter 2), may involve specific interactions
with ethylene receptors. Such specificity is also apparent with interactions between the CTR1like proteins and the ethylene receptors of tomato. For example, LeCTR1, LeCTR3, and LeCTR4
proteins interact with the tomato subfamily-1 receptors, whereas LeCTR2 only interacts with
LeETR1 and LeETR2 (Lin et al., 2008; Zhong et al., 2008).

Utilizing a comparative approach to identify functional amino acids in GR/RTE1 proteins

134

In Arabidopsis, mutagenesis is a powerful approach to identify multiple alleles in genes of
interest either through traditional forward genetic screens or by reverse genetic screens using
approaches such as TILLING (McCallum et al., 2000; Colbert et al., 2001; Henikoff et al., 2004).
For example, dissection of ethylene receptor function has been facilitated through the
identification and characterization of multiple mutant alleles either derived from EMS
populations or through targeted site-directed mutagenesis (Chang et al., 1993; Hua et al., 1995;
Schaller and Bleecker, 1995; Hua et al., 1998; Hall et al., 1999; Rodriguez et al., 1999; Wang et
al., 2006). Similarly, multiple mutant alleles have been identified for other ethylene signaling
components of Arabidopsis including CTR1, EIN2 and RTE1 (Guzman and Ecker, 1990; Kieber
et al., 1993; Roman et al., 1995; Alonso et al., 1999; Resnick et al., 2006). In contrast, there are
only a small number of mutant alleles available for ethylene signaling components in tomato
which limits detailed functional analysis of ethylene signal transduction in species beyond
Arabidopsis.

The tomato ripening mutant, Never-ripe (Nr) carries a single amino acid

substitution within the N-terminal region of an ERS1 type ethylene receptor leading to dominant
ethylene-insensitivity (Lanahan et al., 1994; Wilkinson et al., 1995) and recently two mutant
alleles within the SlETR1 receptor, designated SlEtr1-1 and SlEtr1-2, were isolated using a
TILLING approach (Okabe et al., 2011). Similar to other dominant ethylene receptor mutants,
the SlEtr1-1 and SlEtr1-2 mutants exhibited reduced ethylene responses during the seedling
triple response leaf epinasty, delayed petal abscission and reduced rates of fruit ripening leading
to prolonged fruit shelf life (Okabe et al., 2011).

In the absence of availability of mutant alleles of SlGR and SlGRL1 we considered adopting a
comparative approach to identify determinants of ethylene signaling specificity by focusing on a
135

phenotypic screen based on the differential ability of each gene to complement the rte1 mutant
phenotype. We hypothesized that the inability of SlGR to complement rte1 loss of function in
Arabidopsis, when compared to the ability of SlGRL1, PhGR, and SmGR to each complement the
rte1-3 mutant allele (Figure 2.6, 2.7, and 3.3) could be utilized as a functional screen for
identifying amino acid residues and domains important for protein function. Aligning the amino
acid sequences of SlGR, PhGR, and Solanaceae GRL1 orthologs, 19 amino acids were identified
that are conserved in putative GRL1 orthologs and PhGR, but not in SlGR (Figure 3.4A). It was
hypothesized that within these 19 amino acids, some are responsible for the ability to
complement the rte1-3 mutant allele. Similarly, 10 amino acids were identified within the SmGR
protein that correlated with the ability to complement rte1 loss of function (Figure 3.4B). The 10
amino acids identified as potentially important for activity in SmGR overlap with the 19 amino
acids selected from the sequence of PhGR (Figure 3.4). To test the hypothesis, SlGR-PhGR
construct in which the selected 19 amino acids of SlGR were changed to the corresponding
amino acids of PhGR, and SlGR-SmGR construct in which the selected 10 amino acids of SlGR
were changed to the corresponding amino acids of SmGR, were assembled and over-expressed in
the etr1-2/rte1-3 double mutant.

PhGR appears to possess an enhanced capability to

complement loss of rte1 function compared to SmGR (Figure 3.3). This was confirmed by the
ability of SlGR-PhGR and SlGR-SmGR constructs to complement the rte1-3 allele (Figure 3.5,
Figure 3.6). In total, these results reveal that the overlapping 10 amino acids may be important
for the ability of the Solanaceae GR and GRL1 proteins to complement the rte1 mutant
phenotype, and the other 9 amino acids probably enhance that function, considering the PhGR
have a more pronounced affect to complement loss of rte1 function than the SmGR. The specific
functions of each amino acid identified in this research, are still unclear, and additional
136

mutagenesis will be needed to refine important amino acid residues. However, this analysis
provides a starting point for more in depth analysis of the specific role of domains and amino
acids of SlGR and related proteins that are involved in regulating ethylene responsiveness.

The functional importance of membrane-spanning domains within GR/RTE1 proteins

Several components of the Arabidopsis ethylene signaling pathway are located within the
endomembrane system including the ethylene receptors, GR/RTE1, and EIN2 (Chen et al., 2002;
Ma et al., 2006; Zhou et al., 2007; Dong et al., 2008; Bisson et al., 2009; Dong et al., 2010).
Furthermore, the membrane location of the ethylene binding domain within receptor dimmers
highlights the importance of localization of the ethylene signaling pathway. Similarly, RTE1
encodes a membrane bound protein with an N-terminus that lies in the cytoplasm and a Cterminus that is either located in the Golgi, or both the ER and Golgi (Zhou et al., 2007; Dong et
al., 2008; Dong et al., 2010). Disruption of coding sequence in C-terminus of AtRTE1 in the
rte1-2 mutant allele as a result of a frame shift mutation inhibits protein activity and C-terminally
tagged versions of AtRTE1 cannot complement the rte1 mutant phenotype (Resnick et al., 2006;
Dong et al., 2008). These data demonstrate the importance of the C-terminus for the correct
functional properties of AtRTE1. Similarly, we have shown that deletion of the last 12 amino
acids of SlGR in tomato disrupts the ability of the GR protein to modulate ethylene
responsiveness although it is presently unknown whether this mutation disrupts membrane
localization (Figure 3.7A) (Barry, unpublished data). In the present study, we investigated the
potential role of highly conserved tyrosine and lysine residues that lie within the C-terminus of
members of the GR/RTE1 family. The ability of SlGRL1 to complement the rte1 mutant
137

phenotype was utilized together with site-directed mutagenesis and deletion of the last 9 amino
acids of SlGRL1 to assess the potential importance of these amino acids for function. In each
case, the mutated or deleted version of SlGRL1 complemented the rte1-3 mutant allele (Figure
3.8, 3.9, 3.10) suggesting that these residues, although highly conserved are not required for the
function of SlGRL1. The basis for conflicting data from our previous analysis of the SlGRΔ12
construct and the data obtained in this study using the SlGRL1Δ9 construct is currently unknown.
It is possible that the Δ12 construct does not insert into the membrane correctly whereas the Δ9
likely exhibits correct membrane localization based on its ability to complement the rte1 mutant.
Alternatively, it is possible that amino acid residues important for SlGR-mediated modulation of
ethylene responsiveness in fruit are different from those modulating SlGRL1 mediated
complementation of rte1. Additional experimentation will be required to address these
possibilities.

Materials and Methods

Plant materials and growth conditions

The parental tomato cultivar Ailsa Craig (AC), the ethylene-insensitive tomato mutants Neverripe (Nr) and Green-ripe (Gr) were previously described (Lanahan et al., 1994; Barry et al., 2005;
Barry and Giovannoni, 2006). Plants were grown in peat-based compost supplemented with
fertilizer in greenhouses at Michigan State University, East Lansing, MI. Experiments to
evaluate the triple response phenotype in dark grown tomato seedlings and floral abscission were
performed as previously described (Barry et al., 2005) with the exception that seedlings were
138

measured at 8 days after sowing and flowers were induced to abscise by treatment with ethylene
at a concentration of 2 l l-1. Tomato plants for investigating ethylene responses during petiole
epinasty were grown in growth chamber for 4 weeks at 28oC at Michigan State University, East
Lansing, MI. 4-week old plants were treated with 20 l l-1 ethylene for 16 hours and the adaxial
leaf angle determined.

Arabidopsis thaliana Columbia (Col-0) ecotype, etr1-2 (Hall et al., 1999), and etr1-2/rte1-3
(Resnick et al., 2006) transgenic plants with Col-0 background were sown in sown in 1:1:1 Sure
mix: Medium vermiculite: Perlite (Michigan Grower Products Inc., www.suremix.com) and
exposed to a three day cold treatment at 4oC. Seed trays were transferred to a growth chamber at
22oC under 16-h light/ 8-hour dark at 145 µmol m-2 s-1 and 65% relative humidity. Plants were
supplemented with fertilizer 0.25 X Hoaglands solution pH 5.5. The Arabidopsis triple response
screen was performed using a slightly modified version of a previously published protocol
(Alonso et al., 2003). Arabidopsis seeds were sterilized with 70% ethanol for 10 minutes,
followed by three washes with 100% ethanol. Surface sterilized seeds were dried on sterile filter
paper in a laminar flow hood and dried seeds were sprinkled onto 0.8% phytagar containing
1×
Murashige and Skoog salts, pH 6.0 and 1% sucrose supplemented with 1-aminocyclopropane1-carboxylic acid (ACC) at 0, 0.1, 1, 10, and 100 μM. Plates were placed at 4 oC for 3 days,
exposed to light for 12 h, and then incubated at room temperature in the dark for 6 days.
Hypocotyl and root lengths were measured using ImageJ (http://rsbweb.nih.gov/ij/).

Bacterial artificial chromosome library screening and isolation of genomic and cDNA
clones
139

Three ordered BAC libraries constructed from partial genomic DNA digests of petunia (Petunia
inflata), pepper (Capsicum annuum) and eggplant (Solanum melongena) (McCubbin et al., 2000;
Wang et al., 2008) were screened with

32

P-radiolabelled and DNA probes derived from tomato

SlGR and SlGRL1 as previously described (Barry et al., 2005; Barry and Giovannoni, 2006).
Clones were grouped based on restriction digest fragments following digestion with HinDIII,
hybridization patterns with SlGR and SlGRL1 and, in the case of BAC clones harboring putative
GR orthologs, the presence of synteny with genes previously shown to flank the Gr locus (data
not shown). Based on these data, the following individual BAC clones were selected for
sequence analysis of putative SlGR orthologs (eggplant (72L01), pepper (501K23), petunia
(21M10)) and SlGRL1 orthologs (eggplant (150M15), petunia (16J10)), respectively. Sequencing
of the genomic regions covering either SlGR or SlGRL1 orthologs was accomplished by
successive rounds of primer walking. Putative open reading frames were deduced based on
alignment with tomato and potato cDNA clones. cDNA clones corresponding to PhGR and
PhGRL1 were amplified by RT-PCR from cDNA isolated from Petunia hybrida ovary. cDNA
clones corresponding to SmGR was amplified by RT-PCR from cDNA isolated from Solanum
melongena whole fruits. Sequences are deposited in Genbank under the following accession
numbers (JQ659027-JQ659031).

qRT-PCR analysis

Total RNA was extracted using the RNeasy® Mini Kit and subjected to on column DNase
treatment (Qiagen, http://www.qiagen.com). 1 µg of RNA was used for reverse transcription
140

using

SuperScriptTM

III

First-Strand

Synthesis

System

(Invitrogen,

http://www.lifetechnologies.com/). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was
used as the endogenous control. The GAPDH primers were as previously describe (Balaji et al.,
2008). The qRT-PCR analysis for CaMV35S::PhGR transgenic lines were performed with FAST
SYBR® Master Mix, 2x (Applied Biosystems) in a 25 µ volume using an Applied Biosystems
l
StepOnePlusTM Real-Time PCR System (ABI) with the following cycling program: 10 min at
95° followed by 40 cycles of 95° for 15 s and 60° for 1 min. The primer efficiency was
C,
C
C
tested by generating standard curves and results were analyzed by comparative ΔΔCT method
(Livak and Schmittgen, 2001). The relative expression level of PhGR transgene was detected
using primers of PETGRQ-F and PETGRQ-R, which were designed by Primer Express 3.0
(Applied Biosystems, http://www.lifetechnologies.com).

Primer sequences are listed in the

Table 3.5.

DNA constructs and plant transformation

The CaMV35S::PhGR construct was assembled as follows: The full-length coding sequence of
PhGR was re-amplified from a full-length cDNA clone using the primers PHGROE-F and
PHGROE-R, which contain a BamHI and SacI linker sites on the forward and reverse primer,
respectively (Table 3.5). This fragment was cloned into the pCR2.1 vector by TOPO® cloning
(Invitrogen). The fragment was excised using the restriction enzyme sites in the linkers and
ligated downstream of the CaMV35S promoter in the binary vector pBI121, previously modified
by removal of the UidA coding region by digestion with BamHI and SacI. The PCR fragment
used for construct assembly was amplified using Pfu Ultra™ DNA polymerase (Agilent
141

Technologies, www.agilent.com) and the fidelity of the construct was confirmed by DNA
sequencing. Transgenic tomato plants were generated through cotyledon-derived explants via
Agrobacterium tumefaciens mediated transformation of the AC cultivar using strain LBA4404
(Fillatti et al., 1987). The presence of transgenes in tomato and the subsequent development of
homozygous lines were achieved using a combination of PCR screening and Southern blot
hybridization using selection marker NPTII as previously described (Barry et al., 2005; Barry
and Giovannoni, 2006).

MYC-tagged versions of PhGR and SmGR were assembled using Gateway cloning technology.
Briefly, the corresponding gene fragments were amplified using primers PETGRENT-F/
PETGRENTSTOP-R and SMGRENT-F/ SMGRENTSTOP-R respectively, and the amplified
fragments were inserted into the pENTR-D-TOPO vector (Invitrogen). The resultant clones were
digested with MluI which cuts in the vector backbone but not the insert and the digestion mix
was used together with the binary vector pEarleyGate 203 (CaMV35S::MYC-Gateway-OCS 3’)
to create the constructs: CaMV35S::MYC-PhGR, and CaMV35S::MYC-SmGR. PCR fragments
used for construct assembly were amplified using Pfu Ultra™ DNA polymerase (Agilent
Technologies) and the fidelity of the constructs confirmed by DNA sequencing. YFP-tagged
versions of SlGR-PhGR and SlGR-SmGR were also assembled using Gateway cloning. Briefly,
the mutated SlGR-PhGR and SlGR-SmGR synthetic genes were synthesized in GenScript
(http://www.genscript.com/) and the fragments were amplified using primers GRENT-F and
GRENTSTOP-R. The fragments were inserted into the pENTR-D-TOPO vector (Invitrogen),
and then inserted into the binary vector pEarleyGate 104 (CaMV35S::YFP-Gateway-OCS 3’) to
create CaMV35S::YFP-(SlGR-PhGR) and CaMV35S::YFP-(SlGR-SmGR). The fragments were
142

amplified in PCR using KOD polymerase (Novagen), and the fidelity of the constructs was
confirmed by DNA sequencing.

Mutant versions of SlGRL1 carrying amino acid substitutions at the C-terminus of the protein
were assembled as follows. The mutated SlGRL1Y235A and SlGRL1K238A sequences were
amplified from the SlGRL1 ORF clone in PCR-Blunt II vector using the primers GRL1Y235AF/GRL1Y235A-R and GRL1K238A-F/ GRL1K238A-R, respectively. The fragments were
amplified using Pfu Ultra™ DNA polymerase (Agilent Technologies). Epitope-tagged
SlGRL1Y235A and SlGRL1K238A were assembled using Gateway cloning technology. Firstly,
amplified SlGRL1Y235A and SlGRL1K238A were inserted into the pENTR-D-TOPO vector
(Invitrogen), and digested with MluI which cuts in the entry vector backbone to linearize each
entry clone. Products in the digestion mixes were inserted into the binary vector pEarleyGate 104
(CaMV35S::YFP-Gateway-OCS

3’)

to

create

CaMV35S::YFP-SlGRL1Y235A

and

CaMV35S::YFP-SlGRL1K238A constructs using the LR reaction (Invitrogen). The fidelity of the
constructs was confirmed by DNA sequencing. The SlGRL1Δ9 sequence was amplified using the
primers GRL1ENT-F and GRL1Δ9-R, and assembled into pEarleyGate 104 (CaMV35S::YFPGateway-OCS 3’) using Gateway cloning technology as SlGRL1Y235A and SlGRL1K238A. The
fidelity of all constructs was confirmed by DNA sequencing and primer sequences used for
construct assembly are summarized in Table 3.5. Constructs were transferred into Agrobacterium
tumefaciens strain GV3101 and transformed into Arabidopsis etr1-2/rte1-3 (Resnick et al., 2006)
double mutant using the floral dip method (Clough and Bent, 1998).

DNA sequence, phylogenetic analysis, and multiple sequence alignments
143

DNA sequences were assembled using Sequencher version 4.7 (Genecodes Corporation, Ann
Arbor, MI http://genecodes.com). Sequences used for comparisons and phylogenetic analysis
were

downloaded

from

organism

specific

databases

or

from

Genbank

(http://www.ncbi.nlm.nih.gov/Genbank/) (Table 3.1). A neighbor-joining phylogenetic tree was
constructed from a multiple sequence alignment of the deduced full-length amino acid sequences
of selected GR homologs using MEGA V5.0 software and bootstrap values were calculated from
1000 replicates (Tamura et al., 2011). Multiple sequence alignments were constructed using
MULTALIN (http://multalin.toulouse.inra.fr/multalin/).

Statistical analysis

Statistical analyses were performed using SAS and the differences among genotypic constituents
were evaluated by Student’s t-test and LS Means.

144

Figure 3.1 Phylogenetic analysis of the GR/RTE1 family of proteins. A neighbor-joining
phylogenetic tree derived from a multiple sequence alignment of the deduced full-length amino
145

acid sequences of GR/RTE1-related proteins of plants was constructed using MEGA V5.0
(Tamura et al., 2011). TMEM222, the human homolog of GR/RTE1 is included as an out-group.
Bootstrap values greater than 80 percent, derived from 1000 replicates are indicated above the
nodes. Circled regions indicate putative Solanaceae GR and GRL1 orthologous groups. Details
of the proteins used to construct the phylogeny are provided in Table 3.1.

146

Figure 3.2 Phenotypic analysis of PhGR over-expression lines of tomato. A, fruit ripening
phenotypes of two T1 segregating lines expressing the CaMV35S::PhGR transgene. Ripening
147

inhibition is shown in lines that contain the transgene (+ve) and normal ripening is observed in
sibling lines that have segregated away the transgene (-ve). B, Relative expression levels of
PhGR in the hypocotyl of two independent homozygous CaMV35S::PhGR transgenic lines as
determined by qRT-PCR. C, and D, hypocotyl and root lengths, respectively of dark-grown AC,
Nr, Gr, and CaMV35S::PhGR seedlings germinated and grown in the presence of ACC for eight
days at room temperature. Data presented are the means ± of at least 17 seedlings (Statistical
SE
analysis is presented in Table 3.4). E, percent floral abscission in CaMV35S::PhGR lines in
comparison to AC, Nr and Gr. Detached flower trusses were immersed in water in conical flasks
and treated with 2 µl l-1 of ethylene for 72 hours. Data presented are the mean ± of three
SE
independent experiments collected from at least 370 flowers per genotype. H, Petiole epinasty in
CaMV35S::PhGR lines in comparison to AC, Nr and Gr. The adaxial leaf angle of four week old
plants treated with 20 µl l-1 of ethylene for 16 hours was measured. Three leaves for each plant
were examined and at least 10 plants were used for each genotype and the data presented as the
mean ± * Means followed by the same letter are not significantly different at α=0.05 level.
SE.

148

Figure 3.3 Complementation of the Arabidopsis rte1-3 allele by PhGR and SmGR. A and B, The
triple response phenotype of Arabidopsis seedlings from Col-0, etr1-2, etr1-2/rte1-3, together
with three independent CaMV35S::MYC-PhGR lines (A) or two independent CaMV35S::MYCSmGR lines (B) transformed into etr1-2/rte1-3 background. Seedlings were grown in the dark at
room temperature for six days on 100 μM ACC. C and D, dose response curve of hypocotyl (C)
and root (D) lengths of Arabidopsis seedlings grown in the presence of ACC. Each data point
149

represents the mean ± of 15 seedlings. Genotypes are the same as described in (A) and (B).
SE
Statistical analyses of the dose response data is provided in Table 3.3.

150

Figure 3.4 Amino acid alignments highlighting conserved amino acids in Solanaceae orthologs of SlGR and SlGRL1 that correlate
with the ability to complement the rte1 mutant phenotype. (A) Amino acids that are conserved in PhGR and putative Solanaceae
151

GRL1 orthologs in comparison to the divergent amino acids observed in SlGR. (B) Amino acids that are conserved in PhGR, SmGR
and putative Solanaceae GRL1 orthologs in comparison to the divergent amino acids observed in SlGR. In each alignment the
sequence of a synthetic gene designated either SlGR-PhGR or SlGR-SmGR is shown. Alignments were constructed using
MULTALIN (http://multalin.toulouse.inra.fr/multalin/). Sequence details are provided in Table 3.1. Arrows highlight amino acids that
are divergent in SlGR that are changed to the corresponding residues, present in the remaining sequences, in the synthetic genes.

152

Figure 3.5 Complementation of the Arabidopsis rte1-3 allele by SlGR-PhGR. A, Triple response
phenotype of Arabidopsis seedlings from Col-0, etr1-2, etr1-2/rte1-3, together with three
153

independent CaMV35S::YFP-(SlGR-PhGR) lines transformed into etr1-2/rte1-3 background.
Seedlings were grown in the dark at room temperature for six days on 100 μM ACC. B and C,
The hypocotyl (B) and root (C) lengths of Arabidopsis seedlings grown in the presence of 100
μM ACC. Each data point represents the mean ±SE of 15 seedlings. Genotypes are the same as
described in (A). * Means followed by the same letter are not significantly different at α=0.05
level.

154

Figure 3.6 Complementation of the Arabidopsis rte1-3 allele by SlGR-SmGR. A, Triple response
phenotype of Arabidopsis seedlings from Col-0, etr1-2, etr1-2/rte1-3, together with two
155

independent CaMV35S::YFP-(SlGR-SmGR) lines transformed into etr1-2/rte1-3 background.
Seedlings were grown in the dark at room temperature for six days on 100 μM ACC. B and C,
The hypocotyl (B) and root (C) lengths of Arabidopsis seedlings grown in the presence of 100
μM ACC. Each data point represents the mean ±SE of 15 seedlings. Genotypes are the same as
described in (A). *Means followed by the same letter are not significantly different at α=0.05
level.

156

Figure 3.7 The C-terminus of SlGR is important for conferring ethylene-insensitivity. A, Fruit
phenotypes of CaMV35S:SlGR∆12 transgenic line of tomato in comparison to CaMV35S:SlGR.
B, alignment of last 20 amino acids of SlGR and its homologs, using MULTALIN
(http://multalin.toulouse.inra.fr/multalin/). Sequence details are provided in Table 3.1. Tyrosine
235 and lysine 238 are invariant amino acids within the C-terminal domain of GR-relayed
proteins.

157

Figure 3.8 Complementation of the Arabidopsis rte1-3 allele by SlGRL1Δ9. A, Triple response
phenotype of Arabidopsis seedlings from Col-0, etr1-2, etr1-2/rte1-3, together with one
158

CaMV35S::YFP-SlGRL1 homozygous line and three independent CaMV35S::YFP-SlGRL1Δ9
lines transformed into etr1-2/rte1-3 background. Seedlings were grown in the dark at room
temperature for six days on 100 μM ACC. B and C, The hypocotyl (B) and root (C) lengths of
Arabidopsis seedlings grown in the presence of 100 μM ACC. Each data point represents the
mean ± of 12 seedlings. Genotypes are the same as described in (A). * Means followed by the
SE
same letter are not significantly different at α=0.05 level.

159

Figure 3.9 Complementation of the Arabidopsis rte1-3 allele by SlGRL1Y235A. A, Triple
response phenotype of Arabidopsis seedlings from Col-0, etr1-2, etr1-2/rte1-3, together with one
160

CaMV35S::YFP-SlGRL1

homozygous

line

and

three

independent

CaMV35S::YFP-

SlGRL1Y235A lines transformed into etr1-2/rte1-3 background. Seedlings were grown in the
dark at room temperature for six days on 100 μM ACC. B and C, The hypocotyl (B) and root (C)
lengths of Arabidopsis seedlings grown in the presence of 100 μM ACC. Each data point
represents the mean ± of 12 seedlings. Genotypes are the same as described in (A). * Means
SE
followed by the same letter are not significantly different at α=0.05 level.

161

Figure 3.10 Complementation of the Arabidopsis rte1-3 allele by SlGRL1K238A. A, Triple
response phenotype of Arabidopsis seedlings from Col-0, etr1-2, etr1-2/rte1-3, together with one
162

CaMV35S::YFP-SlGRL1

homozygous

line

and

three

independent

CaMV35S::YFP-

SlGRL1K238A lines transformed into etr1-2/rte1-3 background. Seedlings were grown in the
dark at room temperature for six days on 100 μM ACC. B and C, The hypocotyl (B) and root (C)
lengths of Arabidopsis seedlings grown in the presence of 100 μM ACC. Each data point
represents the mean ± of 12 seedlings. Genotypes are the same as described in (A). * Means
SE
followed by the same letter are not significantly different at α=0.05 level.

163

Table 3.1 GR/RTE1 family proteins utilized for phylogenetic analysis.
Species name

Protein

Identifier #

Source

Arabidopsis thaliana

AtRTE1

NM_128166

www.ncbi.nlm.nih.gov

AtRTH

AY045821

www.ncbi.nlm.nih.gov

SlGR

DQ372895

www.ncbi.nlm.nih.gov

SlGRL1

DQ372898

www.ncbi.nlm.nih.gov

SlGRL2

DQ372899

www.ncbi.nlm.nih.gov

StGR

NM_001246966

www.ncbi.nlm.nih.gov

StGRL1

DQ372900

www.ncbi.nlm.nih.gov

StGRL2

NM_001246980

www.ncbi.nlm.nih.gov

PhGR

JQ659030

www.ncbi.nlm.nih.gov

PhGRL1

JQ659031

www.ncbi.nlm.nih.gov

SmGR

JQ659028

www.ncbi.nlm.nih.gov

SmGRL1

JQ659027

www.ncbi.nlm.nih.gov

Capsicum annuum

CaGR

JQ659029

www.ncbi.nlm.nih.gov

Brassica napus

BnGRL1

Bra007769

www.phytozome.org

Gossypium hirsutum

GhGRL1

TC34712

www.tigr.org/tdb/tgi

Triticum aestivum

TaGRL1

TC268045

www.tigr.org/tdb/tgi

Vitis vinifera

VvGRL1

XM_002279795

www.ncbi.nlm.nih.gov

VvGRL2

XM_002274070

www.ncbi.nlm.nih.gov

Hordeum vulgare

HvGRL1

AK249698

www.ncbi.nlm.nih.gov

subsp. vulgare

HvGRL2

AK370319

www.ncbi.nlm.nih.gov

Solanum lycopersicum

Solanum tuberosum

Petunia×hybrida

Solanum melongena

164

Table 3.1 (cont’d)
Sorghum bicolor

Si002730m

www.phytozome.org

Si023131m

www.phytozome.org

Si037556m

www.phytozome.org

OsGRL1a

AK099559

www.ncbi.nlm.nih.gov

AK102316

www.ncbi.nlm.nih.gov

AK071709

www.ncbi.nlm.nih.gov

MeGRL1

cassava4.1_027499m

www.phytozome.org

cassava4.1_015544m

www.phytozome.org

RCGRL1

XM_002516403

www.ncbi.nlm.nih.gov

RCGRL2

XM_002534086

www.ncbi.nlm.nih.gov

MtGRL1

BT051930

www.ncbi.nlm.nih.gov

MtGRL2

BT052742

www.ncbi.nlm.nih.gov

GmGRL1

NM_001254223

www.ncbi.nlm.nih.gov

GmGRL2

NM_001252770

www.ncbi.nlm.nih.gov

PpGRL1

ppa010598m

www.phytozome.org

PpGRL2
Carica papaya

SiGRL1a

MeGRL2

Prunus persica

www.ncbi.nlm.nih.gov

OsGRL2

Glycine max

XM_002466235

OsGRL1b

Medicago truncatula

www.phytozome.org

SiGRL2

Ricinus communis

Sb09g026920

SiGRL1b

Manihot esculenta

www.ncbi.nlm.nih.gov

SbGRL2

Oryza sativa

XM_002456196

SbGRL1b

Setaria italica

SbGRL1a

ppa010911m

www.phytozome.org

CpGRL1

evm.model.supercontig_7.177

www.phytozome.org

CpGRL2

evm.model.supercontig_6.192

www.phytozome.org

165

Table 3.1 (cont’d)
Citrus clementina

CcGRL1

clementine0.9_029097m

www.phytozome.org

CcGRL2

clementine0.9_020766m

www.phytozome.org

ZmGRL1a

NM_001138974

www.ncbi.nlm.nih.gov

ZmGRL1b

BT070200

www.ncbi.nlm.nih.gov

ZmGRL1c

NM_001151994

www.ncbi.nlm.nih.gov

ZmGRL2

NM_001150599

www.ncbi.nlm.nih.gov

Brachypodium

BdGRL1

XM_003569625

www.ncbi.nlm.nih.gov

distachyon

BdGRL2

XM_003557214

www.ncbi.nlm.nih.gov

Populus trichocarpa

PtGRL1

XM_002308529

www.ncbi.nlm.nih.gov

PtGRL2

XM_002310795

www.ncbi.nlm.nih.gov

Eucalyptus grandis

EgGRL1

Eucgr.C03045.1

www.phytozome.org

Antirrhinum majus

AmGRL1

SGN-U391536

www.solgenomics.net

Mimulus guttatus

MgGRL1

mgv1a012670m

www.phytozome.org

MgGRL2

mgv1a013138m

www.phytozome.org

AcGRL1

Aquca_001_00087

www.phytozome.org

AcGRL2

Aquca_010_00600

www.phytozome.org

Picea sitchensis

PsGRL1

BT122840

www.ncbi.nlm.nih.gov

Nicotiana tabacum

NtGRL2

SGN-U468505

www.solgenomics.net

Coffea arabica

CarGRL2

SGN-E1318947

www.solgenomics.net

Cucumis sativus

CsGRL2

Cucsa.201110

www.phytozome.org

Homo sapiens

TMEM222

AAL99388

www.ncbi.nlm.nih.gov

Zea mays

Aquilegia coerulea

166

Table 3.2 Percent amino acids identity between GR and GRL1 related proteins from selected Solanaceae species.
Proteins

SlGR

StGR

SmGR

CaGR

PhGR

SlGRL1 StGRL1 SmGRL1

PhGRL1 AtRTE1 AtRTH

SlGR

100

StGR

89.3

100

SmGR

74.5

80.2

100

CaGR

68.1

72.7

75.2

100

PhGR

59.5

62.8

63.4

64.0

100

SlGRL1

53.4

56.4

57.0

58.2

60.4

100

StGRL1

54.3

57.3

57.3

57.6

60.4

95.9

100

SmGRL1

53.9

57.4

57.1

57.8

59.8

91.8

92.2

100

PhGRL1

53.9

56.5

56.5

58.2

61.0

89.4

89.4

89.8

100

AtRTE1

51.9

55.2

57.1

52.9

57.6

59.4

58.2

59.8

61.3

100

AtRTH

37.1

38.6

38.3

41.9

43.7

44.6

42.3

44.7

44.6

50.5

100

SlGRL2

37.4

41.3

38.0

37.8

44.2

44.5

42.6

44.3

46.4

50.4

59.5

SlGRL2

100

Shaded boxes highlight comparisons between putative GR and GRL1 orthologs. Identity of the proteins is provided in Table 3.1.
167

Table 3.3 Statistical analysis of the seeding triple response assay in etr1-2/rte1-3 lines of Arabidopsis transformed with either
CaMV35S::MYC-PhGR or CaMV35S::MYC-SmGR

0 μM ACC

0.1 μM ACC

1 μM ACC

10 μM ACC

100 μM ACC

Group

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

COL

12.48b*

8.83b

11.78b

7.43b

9.5b

4.94b

7.19a

2.5b

6.91b

1.96b

etr1-2

14.54cde

9.07b

14.35cde

8.37c

13.32cd

6.95d

12.53c

6.19e

12.18cd

4.89e

etr1-2/rte1-3

10.68a

6.19a

10.55a

4.3a

7.9a

2.12a

6.86a

1.73a

6.7a

1.42a

35S::PhGR-2

15.4e

8.74b

15.04e

7.69bc

13.91d

6.25c

13.5d

5.07d

12.94ef

3.92cd

35S::PhGR-11

14.66de

8.8b

14.44de

8.05bc

13.56d

6.55d

12.77c

5.21d

12.32de

4.38d

35S::PhGR-6

15.36e

8.87b

14.99e

7.74bc

14.09d

6.46d

13.65d

5.09d

13.33f

3.96cd

35S::SmGR-3

13.67c

8.98b

13.52c

7.58b

12.53c

5.16b

11.59b

4.27c

11.54c

3.68c

35S::SmGR-7

14.25cd

8.96b

13.74cd

7.99bc

13.2cd

5.38b

12.19bc

4.61cd

11.69cd

3.84c

*Means followed by the same letters are not significantly different at α=0.05 level. Graphical representation of this data is provided in
Figure 3.3.
168

Table 3.4 Statistical analysis of the seedling triple response assay in CaMV35S::PhGR lines of tomato

0 μM ACC
Group

0.5 μM ACC

10 μM ACC

Hypocotyl

Root

Hypocotyl

Root

Hypocotyl

Root

AC

107.22b

34.93a

89.89ab

24.79a

18.68a

13.26a

Nr

106.48ab

34.24a

99.9c

30.07b

81.84d

28.92d

Gr

98.25a

35.18a

89.11a

27.84b

23.37b

22.6b

35S::PhGR-7-25

99.3ab

34.7a

93.14ab

28.95b

71.38c

25.92c

35S::PhGR-10-16

101.94ab

34.94a

95.52bc

29.67b

80.56d

28.6d

*Means followed by the same letters are not significantly different at α=0.05 level.
Note statistically significant hypocotyl and root lengths in CaMV35S::PhGR transgenic lines in comparison to AC in seedlings grown
in the presence of 10 μM ACC (shown in bold). Graphical representation of this data is provided in Figure 3.2.

169

Table 3.5 Oligonucleotide primers used in this study
Primer

Sequence

Use

PETGROE-F

5´
-TTTCTAGATGCTTCCAAGAAGACTTCCTATGA-3´

Construct assembly

PETGROE-R

5´
-TTGAGCTCCTAATAGTCATCCTTCACACAGT-3´

Construct assembly

PETGRENT-F

5´
-CACCATGCTTCCAAGAAGACTTCCTA-3´

Construct assembly

PETGRENTSTOP-R

5´
-CTAATAGTCATCCTTCACACAGTA-3´

Construct assembly

SMGRENT-F

5´ CACCATGTTTCCAAGAAGATTACCTGA-3´
-

Construct assembly

SMGRENTSTOP-R

5´
-CTAGTCTTCATCCTCAATCTTGAAATA-3´

Construct assembly

PETGRQ-F

5´ GGGATGATGCTCTTCGCTCTAGT-3´
-

qRT-PCR

PETGRQ-R

5´ GCAAGTGAAAGGGTTGAAGGAT -3´
-

qRT-PCR

GRENT-F

5´
-CACCATGCTGCCAAGAAGATATCCTCA-3´

Construct assembly

GRENTSTOP-R

5´
-CTAATTGTCATCCTCAATCTTGC-3´

Construct assembly

GRL1K238A-F

5´ GGTACTTACTGTCTCGCAAATCTGTTGGATTCCTAG -3´
-

Construct assembly

GRL1K238A-R

5´ CTAGGAATCCAACAGATTTGCGAGACAGTAAGTACC -3´
-

Construct assembly

GRL1Y235A-F

5´ GGTACTGCCTGTCTCAAAAATCTGTTGGATTCCTAG -3´
-

Construct assembly

GRL1Y235A-R

5´ CTAGGAATCCAACAGATTTTTGAGACAGGCAGTACC -3´
-

Construct assembly

170

Table 3.5 (cont’d)
GRL1ENT-F

5´
-CACCATGCCATCAGGAAGACGTTCTT-3´

Construct assembly

GRL1Δ9-R

5´
-TTAGCATGGTTTATTTTTGGTACTTAGGTCGACTT-3´

Construct assembly

171

REFERENCES

172

REFERENCES
Adams-Phillips L, Barry C, Kannan P, Leclercq J, Bouzayen M, Giovannoni J (2004) Evidence
that CTR1-mediated ethylene signal transduction in tomato is encoded by a multigene
family whose members display distinct regulatory features. Plant Molecular Biology 54:
387-404
Alonso JM, Hirayama T, Roman G, Nourizadeh S, Ecker JR (1999) EIN2, a bifunctional
transducer of ethylene and stress responses in Arabidopsis. Science 284: 2148-2152
Alonso JM, Stepanova AN, Solano R, Wisman E, Ferrari S, Ausubel FM, Ecker JR (2003) Five
components of the ethylene-response pathway identified in a screen for weak ethyleneinsensitive mutants in Arabidopsis. Proceedings of the National Academy of Sciences of
the United States of America 100: 2992-2997
Balaji V, Mayrose M, Sherf O, Jacob-Hirsch J, Eichenlaub R, Iraki N, Manulis-Sasson S,
Rechavi G, Barash I, Sessa G (2008) Tomato transcriptional changes in response to
Clavibacter michiganensis subsp. michiganensis reveal a role for ethylene in disease
development. Plant Physiology 146: 1797-1809
Barry CS, Giovannoni JJ (2006) Ripening in the tomato Green-ripe mutant is inhibited by
ectopic expression of a protein that disrupts ethylene signaling. Proceedings of the
National Academy of Sciences of the United States of America 103: 7923-7928
Barry CS, McQuinn RP, Thompson AJ, Seymour GB, Grierson D, Giovannoni JJ (2005)
Ethylene insensitivity conferred by the Green-ripe and Never-ripe 2 ripening mutants of
tomato. Plant Physiology 138: 267-275
Bisson MMA, Bleckmann A, Allekotte S, Groth G (2009) EIN2, the central regulator of ethylene
signalling, is localized at the ER membrane where it interacts with the ethylene receptor
ETR1. Biochemical Journal 424: 1-6
Bleecker AB (1999) Ethylene perception and signaling: an evolutionary perspective. Trends in
Plant Science 4: 269-274
Boualem A, Fergany M, Fernandez R, Troadec C, Martin A, Morin H, Sari MA, Collin F,
Flowers JM, Pitrat M, Purugganan MD, Dogimont C, Bendahmane A (2008) A
conserved mutation in an ethylene biosynthesis enzyme leads to andromonoecy in melons.
Science 321: 836-838

173

Bovy AG, Angenent GC, Dons HJM, van Altvorst AC (1999) Heterologous expression of the
Arabidopsis etr1-1 allele inhibits the senescence of carnation flowers. Molecular
Breeding 5: 301-308
Cao WH, Dong Y, Zhang JS, Chen SY (2003) Characterization of an ethylene receptor homolog
gene from rice. Science in China Series C-Life Sciences 46: 370-378
Chang C, Kwok SF, Bleecker AB, Meyerowitz EM (1993) Arabidopsis ethylene-response gene
ETR1: similarity of product to two-component regulators. Science 262: 539-544
Chen YF, Randlett MD, Findell JL, Schaller GE (2002) Localization of the ethylene receptor
ETR1 to the endoplasmic reticulum of Arabidopsis. Journal of Biological Chemistry 277:
19861-19866
Clark KL, Larsen PB, Wang XX, Chang C (1998) Association of the Arabidopsis CTR1 Raf-like
kinase with the ETR1 and ERS ethylene receptors. Proceedings of the National Academy
of Sciences of the United States of America 95: 5401-5406
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant Journal 16: 735-743
Colbert T, Till BJ, Tompa R, Reynolds S, Steine MN, Yeung AT, McCallum CM, Comai L,
Henikoff S (2001) High-throughput screening for induced point mutations. Plant
Physiology 126: 480-484
Dong CH, Jang M, Scharein B, Malach A, Rivarola M, Liesch J, Groth G, Hwang I, Chang C
(2010) Molecular association of the Arabidopsis ETR1 ethylene receptor and a regulator
of ethylene signaling, RTE1. Journal of Biological Chemistry 285: 40706-40713
Dong CH, Rivarola M, Resnick JS, Maggin BD, Chang C (2008) Subcellular co-localization of
Arabidopsis RTE1 and ETR1 supports a regulatory role for RTE1 in ETR1 ethylene
signaling. Plant Journal 53: 275-286
Fillatti JJ, Kiser J, Rose R, Comai L (1987) Efficient transfer of a glyphosate tolerance gene into
tomato using a binary Agrobacterium-tumefaciens vector. Bio-Technology 5: 726-730
Gallie DR, Young TE (2004) The ethylene biosynthetic and perception machinery is
differentially expressed during endosperm and embryo development in maize. Molecular
Genetics and Genomics 271: 267-281
Guo HW, Ecker JR (2004) The ethylene signaling pathway: new insights. Current Opinion in
Plant Biology 7: 40-49
174

Guzman P, Ecker JR (1990) Exploiting the triple response of Arabidopsis to identify ethylenerelated mutants Plant Cell 2: 513-523
Hall AE, Chen QHG, Findell JL, Schaller GE, Bleecker AB (1999) The relationship between
ethylene binding and dominant insensitivity conferred by mutant forms of the ETR1
ethylene receptor. Plant Physiology 121: 291-299
Hattori Y, Nagai K, Furukawa S, Song XJ, Kawano R, Sakakibara H, Wu JZ, Matsumoto T,
Yoshimura A, Kitano H, Matsuoka M, Mori H, Ashikari M (2009) The ethylene response
factors SNORKEL1 and SNORKEL2 allow rice to adapt to deep water. Nature 460: 10261031
Henikoff S, Till BJ, Comai L (2004) TILLING. Traditional mutagenesis meets functional
genomics. Plant Physiology 135: 630-636
Hua J, Chang C, Sun Q, Meyerowitz EM (1995) Ethylene insensitivity conferred by Arabidopsis
ERS gene. Science 269: 1712-1714
Hua J, Sakai H, Nourizadeh S, Chen QHG, Bleecker AB, Ecker JR, Meyerowitz EM (1998)
EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis.
Plant Cell 10: 1321-1332
Kendrick MD, Chang C (2008) Ethylene signaling: new levels of complexity and regulation.
Current Opinion in Plant Biology 11: 479-485
Kieber JJ, Rothenberg M, Roman G, Feldmann KA, Ecker JR (1993) CTR1, a negative regulator
of the ethylene response pathway in Arabidopsis, encodes a member of the RAF family
of protein-kinases. Cell 72: 427-441
Klee H (2006) Highly conserved proteins that modify plant ethylene responses. Proceedings of
the National Academy of Sciences of the United States of America 103: 7537-7538
Klee HJ (2004) Ethylene signal transduction. Moving beyond Arabidopsis. Plant Physiology 135:
660-667
Knoester M, van Loon LC, van den Heuvel J, Hennig J, Bol JF, Linthorst HJM (1998) Ethyleneinsensitive tobacco lacks nonhost resistance against soil-borne fungi. Proceedings of the
National Academy of Sciences of the United States of America 95: 1933-1937
Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1994) The Never ripe mutation blocks ethylene
perception in tomato. Plant Cell 6: 521-530
175

Leclercq J, Adams-Phillips LC, Zegzouti H, Jones B, Latche A, Giovannoni JJ, Pech JC,
Bouzayen M (2002) LeCTR1, a tomato CTR1-like gene, demonstrates ethylene signaling
ability in Arabidopsis and novel expression patterns in tomato. Plant Physiology 130:
1132-1142
Lin Z, Hackett, R.M., Payton, S. andGrierson,D (1998) A tomato sequence, TCTR2 (accession
no. AJ005077), encoding an Arabidopsis CTR1 homologue. Plant Physiology 117: 11261126
Lin ZF, Alexander L, Hackett R, Grierson D (2008) LeCTR2, a CTR1-like protein kinase from
tomato, plays a role in ethylene signalling, development and defence. Plant Journal 54:
1083-1093
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time
quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25: 402-408
Ma B, Cui ML, Sun HJ, Takada K, Mori H, Kamada H, Ezura H (2006) Subcellular localization
and membrane topology of the melon ethylene receptor CmERS1. Plant Physiology 141:
587-597
Ma BO, Chen SY, Zhang JS (2010) Ethylene signaling in rice. Chinese Science Bulletin 55:
2204-2210
Ma QH, Wang XM (2003) Characterization of an ethylene receptor homologue from wheat and
its expression during leaf senescence. Journal of Experimental Botany 54: 1489-1490
McCallum CM, Comai L, Greene EA, Henikoff S (2000) Targeting induced local lesions in
genomes (TILLING) for plant functional genomics. Plant Physiology 123: 439-442
McCubbin AG, Zuniga C, Kao TH (2000) Construction of a binary bacterial artificial
chromosome library of Petunia inflata and the isolation of large genomic fragments
linked to the self-incompatibility (S-) locus. Genome 43: 820-826
Oeller PW, Wong LM, Taylor LP, Pike DA, Theologis A (1991) Reversible inhibition of tomato
fruit senescence by antisense RNA. Science 254: 437-439
Okabe Y, Asamizu E, Saito T, Matsukura C, Ariizumi T, Bres C, Rothan C, Mizoguchi T, Ezura
H (2011) Tomato TILLING technology: development of a reverse genetics tool for the
efficient isolation of mutants from Micro-Tom mutant libraries. Plant and Cell
Physiology 52: 1994-2005

176

Penmetsa RV, Uribe P, Anderson J, Lichtenzveig J, Gish JC, Nam YW, Engstrom E, Xu K,
Sckisel G, Pereira M, Baek JM, Lopez-Meyer M, Long SR, Harrison MJ, Singh KB, Kiss
GB, Cook DR (2008) The Medicago truncatula ortholog of Arabidopsis EIN2, sickle, is a
negative regulator of symbiotic and pathogenic microbial associations. Plant Journal 55:
580-595
Qu X, Hall BP, Gao ZY, Schaller GE (2007) A strong constitutive ethylene-response phenotype
conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1
and ERS1. Bmc Plant Biology 7: 3-17
Resnick JS, Wen CK, Shockey JA, Chang C (2006) REVERSION-TO-ETHYLENE
SENSITIVITY1, a conserved gene that regulates ethylene receptor function in Arabidopsis.
Proceedings of the National Academy of Sciences of the United States of America 103:
7917-7922
Rodriguez FI, Esch JJ, Hall AE, Binder BM, Schaller GE, Bleecker AB (1999) A copper
cofactor for the ethylene receptor ETR1 from Arabidopsis. Science 283: 996-998
Roman G, Lubarsky B, Kieber JJ, Rothenberg M, Ecker JR (1995) Genetic analysis of ethylene
signal transduction in Arabidopsis thaliana: five novel mutant loci integrated into a stress
response pathway. Genetics 139: 1393-1409
Sato-Nara K, Yuhashi K, Higashi K, Hosoya K, Kubota M, Ezura H (1999) Stage- and tissuespecific expression of ethylene receptor homolog genes during fruit development in
muskmelon. Plant Physiology 120: 321-329
Sato S, Tabata S, Hirakawa H, Asamizu E, Shirasawa K, Isobe S, Kaneko T, Nakamura Y,
Shibata D, Aoki K, Egholm M, Knight J, Bogden R, Li CB, Shuang Y, Xu X, Pan SK,
Cheng SF, Liu X, Ren YY, Wang J, Albiero A, Dal Pero F, Todesco S, Van Eck J, Buels
RM, Bombarely A, Gosselin JR, Huang MY, Leto JA, Menda N, Strickler S, Mao LY,
Gao S, Tecle IY, York T, Zheng Y, Vrebalov JT, Lee J, Zhong SL, Mueller LA,
Stiekema WJ, Ribeca P, Alioto T, Yang WC, Huang SW, Du YC, Zhang ZH, Gao JC,
Guo YM, Wang XX, Li Y, He J, Li CY, Cheng ZK, Zuo JR, Ren JF, Zhao JH, Yan LH,
Jiang HL, Wang B, Li HS, Li ZJ, Fu FY, Chen BT, Han B, Feng Q, Fan DL, Wang Y,
Ling HQ, Xue YBA, Ware D, McCombie WR, Lippman ZB, Chia JM, Jiang K,
Pasternak S, Gelley L, Kramer M, Anderson LK, Chang SB, Royer SM, Shearer LA,
Stack SM, Rose JKC, Xu YM, Eannetta N, Matas AJ, McQuinn R, Tanksley SD, Camara
F, Guigo R, Rombauts S, Fawcett J, Van de Peer Y, Zamir D, Liang CB, Spannagl M,
Gundlach H, Bruggmann R, Mayer K, Jia ZQ, Zhang JH, Ye ZBA, Bishop GJ, Butcher S,
Lopez-Cobollo R, Buchan D, Filippis I, Abbott J, Dixit R, Singh M, Singh A, Pal JK,
Pandit A, Singh PK, Mahato AK, Dogra V, Gaikwad K, Sharma TR, Mohapatra T, Singh
NK, Causse M, Rothan C, Schiex T, Noirot C, Bellec A, Klopp C, Delalande C, Berges H,
Mariette J, Frasse P, Vautrin S, Zouine M, Latche A, Rousseau C, Regad F, Pech JC,
Philippot M, Bouzayen M, Pericard P, Osorio S, del Carmen AF, Monforte A, Granell A,
177

Fernandez-Munoz R, Conte M, Lichtenstein G, Carrari F, De Bellis G, Fuligni F, Peano
C, Grandillo S, Termolino P, Pietrella M, Fantini E, Falcone G, Fiore A, Giuliano G,
Lopez L, Facella P, Perrotta G, Daddiego L, Bryan G, Orozco M, Pastor X, Torrents D,
van Schriek K, Feron RMC, van Oeveren J, de Heer P, daPonte L, Jacobs-Oomen S,
Cariaso M, Prins M, van Eijk MJT, Janssen A, van Haaren MJJ, Jo SH, Kim J, Kwon SY,
Kim S, Koo DH, Lee S, Hur CG, Clouser C, Rico A, Hallab A, Gebhardt C, Klee K,
Jocker A, Warfsmann J, Gobel U, Kawamura S, Yano K, Sherman JD, Fukuoka H,
Negoro S, Bhutty S, Chowdhury P, Chattopadhyay D, Datema E, Smit S, Schijlen EWM,
van de Belt J, van Haarst JC, Peters SA, van Staveren MJ, Henkens MHC, Mooyman
PJW, Hesselink T, van Ham R, Jiang GY, Droege M, Choi D, Kang BC, Kim BD, Park
M, Yeom SI, Lee YH, Choi YD, Li GC, Gao JW, Liu YS, Huang SX, Fernandez-Pedrosa
V, Collado C, Zuniga S, Wang GP, Cade R, Dietrich RA, Rogers J, Knapp S, Fei ZJ,
White RA, Thannhauser TW, Giovannoni JJ, Botella MA, Gilbert L, Gonzalez R,
Goicoechea JL, Yu Y, Kudrna D, Collura K, Wissotski M, Wing R, Schoof H, Meyers
BC, Gurazada AB, Green PJ, Mathur S, Vyas S, Solanke AU, Kumar R, Gupta V,
Sharma AK, Khurana P, Khurana JP, Tyagi AK, Dalmay T, Mohorianu I, Walts B,
Chamala S, Barbazuk WB, Li JP, Guo H, Lee TH, Wang YP, Zhang D, Paterson AH,
Wang XY, Tang HB, Barone A, Chiusano ML, Ercolano MR, D'Agostino N, Di Filippo
M, Traini A, Sanseverino W, Frusciante L, Seymour GB, Elharam M, Fu Y, Hua A,
Kenton S, Lewis J, Lin SP, Najar F, Lai HS, Qin BF, Qu CM, Shi RH, White D, White J,
Xing YB, Yang KQ, Yi J, Yao ZY, Zhou LP, Roe BA, Vezzi A, D'Angelo M, Zimbello
R, Schiavon R, Caniato E, Rigobello C, Campagna D, Vitulo N, Valle G, Nelson DR, De
Paoli E, Szinay D, de Jong HH, Bai YL, Visser RGF, Lankhorst RMK, Beasley H,
McLaren K, Nicholson C, Riddle C, Gianese G (2012) The tomato genome sequence
provides insights into fleshy fruit evolution. Nature 485: 635-641
Schaller GE, Bleecker AB (1995) Ethylene-binding sites generated in yeast expressing the
Arabidopsis ETR1 gene. Science 270: 1809-1811
Sriskandarajah S, Frello S, Jorgensen K, Serek M (2004) Agrobacterium tumefaciens-mediated
transformation of Campanula carpatica: factors affecting transformation and
regeneration of transgenic shoots. Plant Cell Reports 23: 59-63
Takahashi H, Kobayashi T, Sato-Nara K, Tomita K, Ezura H (2002) Detection of ethylene
receptor protein Cm-ERS1 during fruit development in melon (Cucumis melo L.). Journal
of Experimental Botany 53: 415-422
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular
evolutionary genetics analysis using maximum likelihood, evolutionary distance, and
maximum parsimony methods. Molecular Biology and Evolution 28: 2731-2739
Tatsuki M (2010) Ethylene biosynthesis and perception in fruit. Journal of the Japanese Society
for Horticultural Science 79: 315-326
178

Tieman DV, Taylor MG, Ciardi JA, Klee HJ (2000) The tomato ethylene receptors NR and
LeETR4 are negative regulators of ethylene response and exhibit functional
compensation within a multigene family. Proceedings of the National Academy of
Sciences of the United States of America 97: 5663-5668
Wang WY, Esch JJ, Shiu SH, Agula H, Binder BM, Chang C, Patterson SE, Bleecker AB (2006)
Identification of important regions for ethylene binding and signaling in the
transmembrane domain of the ETR1 ethylene receptor of Arabidopsis. Plant Cell 18:
3429-3442
Wang WY, Hall AE, O'Malley R, Bleecker AB (2003) Canonical histidine kinase activity of the
transmitter domain of the ETR1 ethylene receptor from Arabidopsis is not required for
signal transmission. Proceedings of the National Academy of Sciences of the United
States of America 100: 352-357
Wang Y, Diehl A, Wu FN, Vrebalov J, Giovannoni J, Siepel A, Tanksley SD (2008) Sequencing
and comparative analysis of a conserved syntenic segment in the Solanaceae. Genetics
180: 391-408
Wang Y, Kumar PP (2007) Characterization of two ethylene receptors PhERS1 and PhETR2
from petunia: PhETR2 regulates timing of anther dehiscence. Journal of Experimental
Botany 58: 533-544
Watanabe H, Saigusa M, Hase S, Hayakawa T, Satoh S (2004) Cloning of a cDNA encoding an
ETR2-like protein (Os-ERL1) from deep water rice (Oryza sativa L.) and increase in its
mRNA level by submergence, ethylene, and gibberellin treatments. Journal of
Experimental Botany 55: 1145-1148
Wilkinson JQ, Lanahan MB, Clark DG, Bleecker AB, Chang C, Meyerowitz EM, Klee HJ (1997)
A dominant mutant receptor from Arabidopsis confers ethylene insensitivity in
heterologous plants. Nature Biotechnology 15: 444-447
Wilkinson JQ, Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1995) An ethylene-inducible
component of signal-transduction encoded by Never-ripe. Science 270: 1807-1809
Wuriyanghan H, Zhang B, Cao WH, Ma BA, Lei G, Liu YF, Wei W, Wu HJ, Chen LJ, Chen
HW, Cao YR, He SJ, Zhang WK, Wang XJ, Chen SY, Zhang JS (2009) The ethylene
receptor ETR2 delays floral transition and affects starch accumulation in rice. Plant Cell
21: 1473-1494
Xu K, Xu X, Fukao T, Canlas P, Maghirang-Rodriguez R, Heuer S, Ismail AM, Bailey-Serres J,
Ronald PC, Mackill DJ (2006) Sub1A is an ethylene-response-factor-like gene that
confers submergence tolerance to rice. Nature 442: 705-708
179

Xu X, Pan SK, Cheng SF, Zhang B, Mu DS, Ni PX, Zhang GY, Yang S, Li RQ, Wang J, Orjeda
G, Guzman F, Torres M, Lozano R, Ponce O, Martinez D, De la Cruz G, Chakrabarti SK,
Patil VU, Skryabin KG, Kuznetsov BB, Ravin NV, Kolganova TV, Beletsky AV,
Mardanov AV, Di Genova A, Bolser DM, Martin DMA, Li GC, Yang Y, Kuang HH, Hu
Q, Xiong XY, Bishop GJ, Sagredo B, Mejia N, Zagorski W, Gromadka R, Gawor J,
Szczesny P, Huang SW, Zhang ZH, Liang CB, He J, Li Y, He Y, Xu JF, Zhang YJ, Xie
BY, Du YC, Qu DY, Bonierbale M, Ghislain M, Herrera MD, Giuliano G, Pietrella M,
Perrotta G, Facella P, O'Brien K, Feingold SE, Barreiro LE, Massa GA, Diambra L,
Whitty BR, Vaillancourt B, Lin HN, Massa A, Geoffroy M, Lundback S, DellaPenna D,
Buell CR, Sharma SK, Marshall DF, Waugh R, Bryan GJ, Destefanis M, Nagy I,
Milbourne D, Thomson SJ, Fiers M, Jacobs JME, Nielsen KL, Sonderkaer M, Iovene M,
Torres GA, Jiang JM, Veilleux RE, Bachem CWB, de Boer J, Borm T, Kloosterman B,
van Eck H, Datema E, Hekkert BTL, Goverse A, van Ham R, Visser RGF (2011)
Genome sequence and analysis of the tuber crop potato. Nature 475: 189-197
Yau CP, Wang LJ, Yu MD, Zee SY, Yip WK (2004) Differential expression of three genes
encoding an ethylene receptor in rice during development, and in response to indole-3acetic acid and silver ions. Journal of Experimental Botany 55: 547-556
Zhang W, Zhou X, Wen CK (2012) Modulation of ethylene responses by OsRTH1
overexpression reveals the biological significance of ethylene in rice seedling growth and
development. Journal of Experimental Botany 63: 4151-4164
Zhong SL, Lin ZF, Grierson D (2008) Tomato ethylene receptor-CTR interactions: visualization
of NEVER-RIPE interactions with multiple CTRs at the endoplasmic reticulum. Journal
of Experimental Botany 59: 965-972
Zhou X, Liu Q, Xie F, Wen CK (2007) RTE1 is a Golgi-associated and ETR1-dependent
negative regulator of ethylene responses. Plant Physiology 145: 75-86

180

Chapter 4 Gene expression analysis and subcellular localization of GR/RTE1 proteins

181

Abstract

Regulation of plant hormone biosynthesis, turnover, transport, perception and signaling
pathways must be tightly controlled to ensure normal growth and development as well as
appropriate responses to environmental stimuli. Genes involved in plant hormone biosynthesis
and responses are frequently encoded by multigene families, creating the potential for
subfunctionalization of individual family members and generating flexibility in hormonal outputs
and their protein products must be efficiently and accurately transported to the correct
subcellular compartments to function appropriately. In particular, several steps of the ethylene
synthesis and perception machinery are encoded by multigene families that are differentially
expressed and studies have highlighted the importance of the endomembrane system in
mediating ethylene responses. In this study, the expression of SlGR, SlGRL1 and SlGRL2, tomato
homologs of a family of genes that influence ethylene responses, was determined during tomato
development, in response to ethylene treatment and following wounding, revealing that these
genes are differentially expressed. In addition, using a combination of transient expression in
tobacco and stable expression in Arabidopsis, fluorescently tagged versions of SlGR, SlGRL1
and SlGRL2 are predominantly localized to the Golgi. These data suggest that the differential
expression of SlGR, SlGRL1 and SlGRL2 may influence the ethylene responsiveness of
individual tissues during tomato development but that differential ethylene responsiveness is
unlikely to be associated with the differential subcellular localization of this protein family.

182

Introduction

Ethylene regulates multiple aspects plant growth and development together with a variety of
responses to biotic and abiotic stresses, and ethylene signaling is conserved in higher plants,
including rice, Arabidopsis, tomato, and petunia (Bleecker and Kende, 2000; Guo and Ecker,
2004; Kendrick and Chang, 2008). In all higher plants analyzed, genes involved in both ethylene
biosynthesis and signaling are encoded by multigene families, allowing the plant flexibility to
differentially regulate ethylene biosynthesis/signaling in different tissues at various stages of
development and in response to environmental stimuli (Sato and Theologis, 1989; Yip et al.,
1992; Zarembinski and Theologis, 1994; Wilkinson et al., 1995; Payton et al., 1996; Zhou et al.,
1996; Whittaker et al., 1997; Hua and Meyerowitz, 1998; Lashbrook et al., 1998; Tieman and
Klee, 1999; Bleecker and Kende, 2000; Klee, 2004; Barry and Giovannoni, 2006; Wang and
Kumar, 2007).

The presence of gene families encoding multiple steps of the ethylene signaling pathway
facilitates subfunctionalization and in particular creates the potential for differential expression
of individual family members. This, in turn, could lead to the formation of signaling complexes
that contain different stoichiometry in individual cell types, during developmental processes or in
response to external stimuli. Differential expression of gene families encoding the ethylene
receptors has been reported for several species. For example, each of the six tomato ethylene
receptors, LeETR1, LeETR2, NR, LeETR4, LeETR5, and LeETR6 have unique but often
overlapping expression patterns. LeETR1 and LeETR2 are ubiquitously expressed, although
LeETR1 is expressed at approximately a 5-fold higher level than LeETR2 (Zhou et al., 1996;
183

Lashbrook et al., 1998). NR is detected in floral ovaries and ripening fruit (Lashbrook et al.,
1998). LeETR4 and LeETR5 have a higher expression level in flowers and during fruit
development than in vegetative tissues (Tieman and Klee, 1999). The expression of ethylene
receptor genes can also be influenced by wounding, ozone, or other treatments. For example, in
tomato LeETR2 expression is transiently suppressed by ozone treatment (Moeder et al., 2002). In
rice, one of ethylene receptors OsETR2 is induced by flooding, IAA, ethylene, and GA and in
petunia PhETR2 expression increases following wounding and salt treatment (Watanabe et al.,
2004; Yau et al., 2004; Wang and Kumar, 2007). Similarly, downstream ethylene signaling
components are also differentially expressed during development and in response to the same
sets of treatments that modulate ethylene receptor expression (Leclercq et al., 2002; AdamsPhillips et al., 2004). For example, four CTR1-like genes are present in tomato, LeCTR1,
LeCTR2, LeCTR3, and LeCTR4 (Leclercq et al., 2002; Adams-Phillips et al., 2004; Lin et al.,
2008). LeCTR1 expression is increased in response to ethylene treatment, and during fruit
ripening, pedicel abscission, and petal senescence, but no similar increase in LeCTR3 and
LeCTR4 transcript accumulation was observed (Leclercq et al., 2002; Adams-Phillips et al.,
2004). Together, these data suggest that the ethylene signaling state of plants can be modified
during development and in response to environmental perturbation at the level of gene
expression changes that may alter the composition of signaling networks.

Several characterized members of the GR/RTE1 family influence ethylene responsiveness in
plants possibly through direct interactions with ethylene receptors (Barry and Giovannoni, 2006;
Resnick et al., 2006; Dong et al., 2010; Zhang et al., 2012). The tomato genome contains three
GR/RTE1 family members designated GREEN RIPE (SlGR), GREEN RIPE LIKE 1 (SlGRL1)
184

and GREEN RIPE LIKE 2 (SlGRL2) (Barry and Giovannoni, 2006). The Gr mutant displays
ethylene insensitivity leading to inhibition of fruit ripening, flower senescence and abscission
together with reduced ethylene inhibition of root elongation, but ethylene responses associated
with petiole epinasty are normal (Barry et al., 2005; Barry and Giovannoni, 2006). The Gr
mutant is caused by a 334 bp deletion in the promoter region of GR that leads to ectopic
expression of the gene and altered ethylene responsiveness (Barry and Giovannoni, 2006).
Therefore, appropriate control of GR expression during plant development is important to
maintain an appropriate response to ethylene. Previously, GR expression was found to be at a
low level in most tissues with transcript abundance peaking in developing seed (Barry and
Giovannoni, 2006). However, the expression pattern of SlGR, SlGRL1, and SlGRL2 during
tomato development remains undefined, and aside from the finding that ectopic expression of
GR/RTE1 genes causes altered ethylene responsiveness there is no information of how the
natural expression pattern of these genes and how this could potentially influence tomato
development.

Differential sub-cellular localization may also influence the functional properties of GR/RTE1
proteins. Components in the upstream section of the ethylene signaling pathway are localized to
the endomembrane system. The Arabidopsis ethylene receptors localize to the endoplasmic
reticulum (ER) and Golgi membranes (Chen et al., 2002; Ma et al., 2006; Dong et al., 2008). The
CONSTITUTIVE TRIPLE RESPONSE 1 (CTR1) is connected to the ER through binding to the
ethylene receptors (Clark et al., 1998; Cancel and Larsen, 2002; Gao et al., 2003). ETHYLENE
INSENSITIVE 2 (EIN2) is also located at the ER membrane where it interacts with all five
ethylene receptors in Arabidopsis (Bisson et al., 2009). The presence of ethylene leads to
185

proteolytic cleavage at the carboxyl-terminal of EIN2 (EIN2-C’), and as a result, EIN2-C’ is
released and rapidly translocates to the nucleus (Qiao et al., 2012).

Separate studies have investigated the subcellular localization of the AtRTE1 protein. Transient
expression in onion epidermal cells suggested that AtRTE1 is localized to the Golgi whereas
transient expression in Arabidopsis protoplasts and stable transformation in Arabidopsis
suggested dual localization to both the ER and the Golgi (Zhou et al., 2007; Dong et al., 2008).
The distant homolog of AtRTE1, AtRTH, was recently reported to be localized to the ER and
nucleus by transient expression in onion epidermal cells as was its putative rice ortholog,
OsGRL2/OsRTH3 (Zhang et al., 2012). In contrast, transient expression in onion epidermal cells
suggested dual localization of OsGRL1a/OsRTH1 and OsGRL1b/OsRTH2 to the Golgi and ER
membranes (Zhang et al., 2012). Together, these data suggest either considerable heterogeneity
in the subcellular localization of this protein family or that differences in experimental
approaches may have contributed to this anomalous data.

In the present study, the expression pattern of SlGR, SlGRL1, and SlGRL2 and the subcellular
localization of several GR/RTE1 proteins was assessed to determine if differential expression of
these genes could provide insight into the natural role of these genes during tomato development
and also to determine whether the GR/RTE1 proteins are differentially localized within the cell,
which could provide insight into their altered functional characteristics (Chapter 2). SlGR,
SlGRL1 and SlGRL2 are differentially expressed during tomato development with SlGR and
SlGRL1 displaying expression patterns that overlap with the corresponding AtRTE1 expression in
Arabidopsis. Reporter-gene fusions indicate that SlGR, SlGRL1, SlGRL2, PhGR, SmGR proteins
186

are predominantly localized in the Golgi, which is slightly conflicting with the reported subcellular localization of AtRTE1, AtRTH, and their rice homologs. Together, these data provide
insight into the role of this gene family in ethylene signaling, providing data to help guide
additional functional characterization.

Results

SlGR, SlGRL1 and SlGRL2 are differentially expressed during tomato development

The presence of multigene families facilitates functional plasticity allowing individual family
members to adopt specific or specialized roles. Such subfunctionalization can occur at multiple
levels but is often attributed with divergence of cis elements leading to differential expression
(Force et al., 1999). Previously, using northern blot analysis SlGR expression was shown to be
low or absent in most tomato tissues with transcripts displaying maximal accumulation in
developing seeds (Barry and Giovannoni, 2006). However, a robust and comprehensive view of
the expression of SlGR, SlGRL1 and SlGRL2 was not performed. In this study, qRT-PCR was
performed using RNA extracted from several tomato tissues. SlGR shows maximal transcript
levels accumulating in the seeds (Figure 4.1A). Dissection of the seeds revealed that the majority
of this expression was associated with the testa (Figure 4.1D). SlGRL1 expression is also
predominantly associated with the testa of developing seeds but is also expressed throughout
fruit development with an increase in transcript abundance detected at the breaker stage of fruit
ripening and in senescing flowers (Figure 4.1B, C). SlGRL2 is also widely expressed in tomato
tissues with high expression levels detected in seeds and anthers together with increased
187

expression detected during fruit ripening (Figure 4.1A, B and C). In contrast to SlGR and
SlGRL1 where most of the seed expression is associated with the testa, the expression of SlGRL2
is more uniformly distributed across the embryo, testa, and endosperm (Figure 4.1D). Although
the expression level of SlGRL2 is dramatically higher in the fruit peel of red ripening stage than
mature green stage, the expression of SlGRL2 is almost uniformly distributed across the pericarp,
peel, and flesh of dissected tomato fruits at the breaker stage of ripening (Figure 4.1E, F).
Considering the increasing expression of SlGRL2 during tomato fruit ripening, the dramatically
high expression of SlGRL2 in the fruit peel of red fruit is probably a result of the ripening
process. Similar expression patterns were observed in dissected tomato stem tissues (Figure
4.1G). Together, these data indicate that while transcripts of SlGR, SlGRL1 and SlGRL2 are
detectable in all tissues examined, the relative abundance of each differs temporally and spatially
throughout development.

SlGR, SlGRL1 and SlGRL2 are differentially expressed in response to ethylene treatment
and following wounding

Ethylene is related to the biotic and abiotic stress responses of plants (Bleecker and Kende, 2000;
Guo and Ecker, 2004). The expression of some components in ethylene signaling, such as
LeETR2, LeCTR1, OsETR2, PhETR2, is influenced by wounding, ozone, flooding, or salt
treatment etc (Leclercq et al., 2002; Moeder et al., 2002; Adams-Phillips et al., 2004; Watanabe
et al., 2004; Yau et al., 2004; Wang and Kumar, 2007). The expression pattern of SlGR, SlGRL1
and SlGRL2 in response to the ethylene and wounding was also assessed by q-RT-PCR.
Following 12 h of ethylene treatment, the expression of SlGR and SlGRL2 was slightly
188

suppressed, however the expression of SlGRL1 increased following ethylene treatment with a
peak of transcript accumulation observed after 2 h of treatment (Figure 4.2A). The expression of
SlGRL1 was also influenced by wounding with transcript accumulation occuring at 8 hours after
wounding, which is similar to the expression patterns of wounding-related genes proteinase
inhibitor 1(PIN1) (Lee et al., 1986) and PIN2 (Thornburg et al., 1987) that were utilized as
positive controls (Figure 4.2 B, C, and D). Together, SlGR, SlGRL1 and SlGRL2 are
differentially expressed in response to ethylene and wounding.

Transient expression of YFP-gene fusions in tobacco suggests that GR/RTE1 related
proteins are localized to the Golgi

Several components of the ethylene signaling pathway are localized within the endomembrane
system and separate studies have reported either dual localization of RTE1 within the Golgi and
ER membranes or exclusive localization within the Golgi (Chen et al., 2002; Gao et al., 2003;
Zhou et al., 2007; Dong et al., 2008; Bisson et al., 2009). Similarly, two GRL1 orthologs from
rice, OsGRL1a/OsRTH1 and OsGRL1b/OsRTH2 are localized to the Golgi and ER membranes
(Zhang et al., 2012). Furthermore, the Arabidopsis GRL2 ortholog AtRTH and the rice GRL2
ortholog OsGRL2/OsRTH3 have recently been reported to be dual localized to the ER and the
nucleus (Zhang et al., 2012). To determine the subcellular localization of SlGR, SlGRL1, and
SlGRL2, N-terminal yellow-fluorescent protein (YFP) fusions of each protein were constructed
and transiently expressed with the ER and Golgi marker ERD2-GFP (Boevink et al., 1998) in
tobacco (Nicotiana tabacum) leaves. The localization of each fusion protein was examined in
the transformed leaves after 48 hours expression by confocal laser scanning microscopy (CLSM).
189

These analyses revealed that SlGR SlGRL1 and SlGRL2 colocalize with the ER and Golgi
marker ERD2-GFP (Figure 4.3). However, the colocalization signal was mainly associated with
the “dot” like structures associated with the Golgi, and not the “net” like structures of the ER
(Held et al., 2008) (Figure 4.3). Together, these data suggest that SlGR SlGRL1 and SlGRL2
appear to be localized predominantly in the Golgi at steady state. In order to explore the
relationship between protein localization and functional differences of GR/RTE1 family proteins,
PhGR, PhGRL1, and SmGR were also fused to YFP and transiently expressed with ERD2-GFP
in tobacco epidermal leaves. CLSM images suggested that PhGR, PhGRL1, and SmGR are also
predominantly localized within the Golgi (Figure 4.4). Together, these data suggest that the
distinct functional properties of these proteins cannot be attributed to differential subcellular
localization.

Predominant Golgi localization of SlGR, SlGRL1, and PhGR proteins was confirmed by
stable expression in Arabidopsis

Transient expression in leaf epidermal cells of tobacco suggested that SlGR, SlGRL1, and PhGR
are predominantly Golgi localized proteins (Figure 4.3, 4.4). To confirm these data, N-terminally
tagged YFP fusions of SlGR, SlGRL1, and PhGR were transformed into the etr1-2/rte1-3 double
mutant. Transgenic lines expressing each fusion protein were confirmed by CLSM (data not
shown). In addition, the CaMV35::YFP-SlGRL1 and CaMV35::YFP-PhGR construct were able
to complement the rte1-3 allele whereas the CaMV35::YFP-SlGR construct does not fully
complement indicating that the YFP-tagged proteins behave similarly to the MYC-tagged and
non-tagged versions of the proteins (Figure 2.6, 2.7, 3.3 and 4.5). Each YFP-fusion protein line
190

was crossed with stably transformed Arabidopsis lines expressing either GFP-HDEL, ST-GFP,
or mCherry-VTI12, which target GFP/RFP to the ER, Golgi, or trans-Golgi network (TGN),
respectively (Haseloff et al., 1997; Boevink et al., 1998; Geldner et al., 2009). The localization of
each fusion protein was examined in the cotyledons or root of the F1 progeny derived from each
cross (Figure 4.6, 4.7, and 4.8). These analyses reveal that SlGR, SlGRL1, and PhGR appear to
be localized predominantly within the Golgi and not the ER or TGN as each fusion protein colocalized with the ST-GFP marker but not the GFP-HDEL or mCherry-VTI12 markers.

Discussion

Differential expression of the GR/RTE1 family of tomato

Subfunctionalization within multigene families is frequently manifest at the level of expression
variation in which individual genes assume distinct temporal or spatial patterns of expression
within a particular tissue type or at a developmental stage (Force et al., 1999; Freeling, 2009). In
regard to the ethylene signaling pathway, most characterized components, with the exception of
EIN2, are encoded by multigene families in all higher plants that have been studied and many
examples exist describing the differential expression of individual genes (Wilkinson et al., 1995;
Payton et al., 1996; Zhou et al., 1996; Hua and Meyerowitz, 1998; Lashbrook et al., 1998;
Tieman and Klee, 1999; Bleecker and Kende, 2000; Klee, 2004; Barry and Giovannoni, 2006;
Wang and Kumar, 2007). This differential expression has the potential to impact the
stoichiometry of the ethylene signaling complexes, particularly in plants like tomato where there
are multiple genes encoding the ethylene receptors, CTR1-like proteins and the GR/RTE1 family
191

(Zhou et al., 1996; Lashbrook et al., 1998; Tieman and Klee, 1999; Klee, 2002; Leclercq et al.,
2002; Moeder et al., 2002; Adams-Phillips et al., 2004; Barry and Giovannoni, 2006). The
impact of this phenomena on ethylene responsiveness is not understood but evidence that control
of gene expression is important for maintaining an appropriate ethylene response is observed
through the characterization of the Gr mutant which is caused by a promoter deletion that causes
ectopic expression of SlGR, leading to reduced ethylene responsiveness in several plant tissues
(Barry and Giovannoni, 2006) (Chapter 2). Therefore, regulation of GR/RTE1 expression is
likely important for maintaining an appropriate ethylene response and differential expression of
members of the GR/RTE1 family could potentially influence ethylene responsiveness.
Expression analysis revealed that SlGR expression relatively low in most of the tissues examined
except for in the seeds where transcript abundance peaks in the testa (Figure 4.1D). In contrast,
SlGRL1 expression is more widely expressed and is ripening and ethylene-related (Figure 4.1C
and 4.2A). In this regard, data available through the e-FP browser (http://bar.utoronto.ca/efp/cgibin/efpWeb.cgi) reveal that the expression patterns of these genes share expression
characteristics with the single copy gene AtRTE1. For example, AtRTE1 is expressed in many
Arabidopsis tissues with maximal transcript abundance in developing seed associated with the
seed coat and the endosperm and is enhanced by treatment the ethylene precursor ACC. SlGRL2
is also widely expressed in tomato tissues with high expression levels detected in seeds and
anthers together with increased expression detected during fruit ripening (Figure 4.1A, B and C).
Data

available

from

the

e-FP

browser

(http://bbc.botany.utoronto.ca/efp/cgi-

bin/efpWeb.cgi?primaryGene=AT3G51040&modeInput=Absolute) show that AtRTH is highly
expressed in many Arabidopsis tissues, and especially highly associated with seeds, which is

192

similar to the expression pattern of SlGRL2, although the functions of these two genes are still
unknown.

Discrepancies in the subcellular localization of the GR/RTE1 family

The ethylene receptors are known to form large heteromeric complexes and interaction
experiments between the ethylene receptors and additional signaling components suggest that
these complexes likely contain RTE1, EIN2 and CTR1 and occur within the ER and Golgi
membranes (Clark et al., 1998; Chen et al., 2002; Gao et al., 2003; Gao et al., 2008; Bisson et al.,
2009; Chen et al., 2010; Dong et al., 2010). Our data indicate that SlGR, SlGRL1, SlGRL2,
PhGR, PhGRL1, and SmGR are localized primarily to the Golgi membranes at steady state
(Figure 4.3, 4.4, 4.6, 4.7, and 4.8). These data are in broad agreement with previous studies that
have

localized

AtRTE1,

AtRTH,

OsGRL1a/OsRTH1,

OsGRL1b/OsRTH2,

and

OsGRL2/OsRTH3 to the endomembrane system (Zhou et al., 2007; Dong et al., 2008; Zhang et
al., 2012). However, these studies suggested that while GR/RTE1 family members were
predominantly localized to the Golgi, some fluorescence attributed fusion proteins was also
detected in the ER. Such slight discrepancies may be linked to different expression levels of the
transgenes whereby over-expression of the transgenes may lead to saturation of the export
machinery of some organelles and partial retention of the protein in that location, while under
non-saturating conditions the proteins may translocate more freely through the endomembrane
system. Nonetheless, additional experimentation, including immunolocalization or separation of
organelles by centrifugation followed by immunoblot analysis, will be required to address these
discrepancies as they may have implications to current models of ethylene receptor function as
193

well as the function of the GR/RTE1 proteins and conservation of signaling mechanisms across
species.

The potential for interaction between GR/RTE1 family proteins and the tomato ethylene
receptors

Differential expression patterns of ethylene signaling components likely leads to altered
composition of these components within plant cells resulting in the formation of variable
signaling complexes. Based on current models of the function of GR/RTE1 proteins in the
ethylene signaling pathway (Dong et al., 2010), it is possible that SlGR and SlGRL1 interact with
the tomato ethylene receptors. Furthermore, our previous data indicate that SlGR and SlGRL1
are able to influence distinct, yet overlapping ethylene responses in tomato (Barry and
Giovannoni, 2006) (Chapter 2). The mechanisms through which these differences occur are not
understood but may involve differential interaction with specific ethylene receptors or
interactions with same receptors but at different affinities. Differential interactions between
ethylene signaling components have been reported. For example, in tomato, the LeCTR1,
LeCTR3, and LeCTR4 proteins interact with the tomato subfamily-1 receptors (LeETR1,
LeETR2, and NR), whereas LeCTR2 only interacts with LeETR1 and LeETR2 (Lin et al., 2008;
Zhong et al., 2008). In Arabidopsis, functional differences between the ethylene receptors has
been proposed to be due to their different affinities for the CTR1 protein with the more
prominent role of AtETR1 attributed to a stronger interaction with CTR1 (Clark et al., 1998; Hall
and Bleecker, 2003; Wang et al., 2003). Moreover, EIN2 may also possess different interaction
affinities with individual ethylene receptors (Bisson and Groth, 2010). Bimolecular fluorescence
194

complementation (BiFC) experiments suggest that AtRTE1 may differentially interact with the
subfamily 1 receptors of Arabidopsis with interactions observed by co-expression of N-terminal
fusion cYFP-AtRTE1 and AtETR1-nYFP constructs in tobacco leaf epidermal cells, Arabidopsis
root cells, and Arabidopsis cotyledon epidermal cells (Dong et al., 2010). A weak BiFC signal
was also observed following co-expression of cYFP-AtRTE1 and AtERS1-nYFP constructs
although, as yet there is no genetic evidence to suggest that AtRTE1 function is mediated through
AtERS1 (Resnick et al., 2006; Resnick et al., 2008; Rivarola et al., 2009; Dong et al., 2010).
Potential interactions between members of the tomato GR/RTE1 family and the tomato ethylene
receptors are still unknown. Preliminary data based on CLSM imaging suggests that the tomato
ethylene receptors co-localize with ERD2-GFP within the endomembrane system of tobacco
epidermal cells, with perhaps some fluorescence associated with the Golgi (data not shown).
Taken together, with the endomembrane localization of SlGR, SlGRL1, and SlGRL2, these data
suggest that there is the potential for protein-protein interactions between these proteins and the
tomato ethylene receptors.

Materials and Methods

Plant Growth and Treatments

Tomato plants, cultivar Ailsa Craig (AC) (Barry et al., 2005) were grown in Jiffy-7 Peat Pellets
(http://www.hummert.com/) in a growth chamber for the first four weeks of growth under 16-h
light/ 8-hour dark at 28oC and 65% relative humidity, and then transferred to peat-based compost
supplemented with fertilizer in greenhouses, which equipped with heating and cooling systems
195

and supplemental lighting at Michigan State University, East Lansing, MI. Tobacco (Nicotiana
tabacum cv. Petit Havana) of 5-6 weeks old was used in transient transformation and grown in
growth chamber under 16-h light/ 8-hour dark at 22oC with 50 μE light intensity and 65%
relative humidity.

Fruit tissues for gene expression analysis were harvested from greenhouse grown plants at
specific days post anthesis and at the mature green, breaker, breaker +3 days and breaker +7
stages of fruit ripening. Columella and locular gel were removed from the fruits and the pericarp
frozen in liquid nitrogen and used for subsequent analysis. Whole tomato flowers of different
stages and floral organs from flowers at anthesis were collected as previously described (Barry et
al., 1996). Tomato seeds were harvested from mature green fruits and stirred in water overnight
at room temperature to remove contaminating locular gel. Seeds were dissected into embryo,
testa and endosperm as previously described (Nonogaki et al., 1992). Dissected stem tissues were
collected from 5-week old green house grown tomato plants. For experiments designed to
determine potential ethylene regulation of gene expression, leaflets were harvested from four
week-old growth chamber grown plants (see above for details) treated with 10 µl l-1 ethylene for
the specified time periods. Wounding experiments were performed on 4 week-old growth
chamber grown plants. Wounding of leaflets was performed as previously described (Shackel et
al., 1991) with the exception that leaves were punctured by unopened small scissors tips instead
of glass microcapillary tips.

The Arabidopsis thaliana etr1-2/rte1-3 transgenic plants with Columbia (Col-0) background
(Resnick et al., 2006) were used as parent strains for CaMV35S::YFP-SlGR, CaMV35S::YFP196

SlGRL1, and CaMV35S::YFP-PhGR. Seeds of Arabidopsis thaliana ecotype Columbia (Col-0)
together with the ethylene-signaling mutants etr1-2 and etr1-2/rte1-3 (Resnick et al., 2006) and
the fluorescently tagged organelle reporter lines ST-GFP and GFP-HDEL (Haseloff et al., 1997;
Boevink et al., 1998) were grown in growth chambers at 22oC under 16-h light/ 8-hour dark at
145 µmol m-2 s-1 and 65% relative humidity, after three days cold treatment at 4oC. The
Arabidopsis triple response screen was performed using a slightly modified version of a
previously published protocol (Alonso et al., 2003). Arabidopsis seeds were sterilized with 70%
ethanol for 10 minutes, followed by three washes with 100% ethanol. Surface sterilized seeds
were dried on sterile filter paper in a laminar flow hood and dried seeds were sprinkled onto
0.8% phytagar containing 1×
Murashige and Skoog salts, pH 6.0 and 1% sucrose supplemented
with 1-aminocyclopropane-1-carboxylic acid (ACC) at 100 μM. Plates were placed at 4oC for 3
days, exposed to light for 12 h, and then incubated at room temperature in the dark for 6 days.
Hypocotyl and root lengths were measured using ImageJ (http://rsbweb.nih.gov/ij/).

qRT-PCR analysis

Total RNA was extracted using the RNeasy® Mini Kit and subjected to on column DNase
treatment (Qiagen, http://www.qiagen.com). 1µg of RNA was used for reverse transcription
using

SuperScriptTM

III

First-Strand

Synthesis

System

(Invitrogen,

http://www.lifetechnologies.com/). Gene-specific primers for SlGR, SlGRL1, and SlGRL2 were
designed by Primer Express 3.0 (Applied Biosystems, http://www.lifetechnologies.com) (Table
4.1). Wound-induced PIN1 and PIN2 genes were used as positive controls in wounding
experiments using primers previously described (Lee et al., 1986; Thornburg et al., 1987). The
197

PCR reactions were performed with FAST SYBR® Master Mix, 2x (Applied Biosystems) in a
10 µL volume containing 25 ng of cDNA template. PCR amplification was performed using an
ABI 7900HT Fast Real-Time PCR System (Applied Biosystems) at the Research Technology
Support Facility of Michigan State University, East Lansing, MI. The qRT-PCR program
included a preliminary step of 2 min at 50° 10 min at 95 ° followed by 40 cycles of 95° for
C,
C,
C
15 s and 60° for 1 min. The primer efficiency was tested by generating standard curves. Data
C
were analyzed by the comparative ΔΔCT method (Livak and Schmittgen, 2001) using the
constitutively expressed clathrin adaptor complexes medium subunit (CAC) genes of tomato for
normalization as previously described (Exposito-Rodriguez et al., 2008).

Construct assembly

DNA fragments were amplified by PCR using Pfu Ultra™ DNA polymerase (Agilent
Technologies). YFP-tagged SlGR, SlGRL1, SlGRL2, PhGR, PhGRL1, SmGR, and PhGRL1Δ9
were assembled using Gateway cloning technology. The purified PCR products were cloned into
the pENTR-D-TOPO vector (Invitrogen). After digested with MluI, they were inserted into the
binary vector pEarleyGate 104 (CaMV35S::YFP-Gateway-OCS 3’) by LR reaction (Invitrogen)
to

create

CaMV35S::YFP-SlGR,

CaMV35S::YFP-SlGRL1,

CaMV35S::YFP-SlGRL2,

CaMV35S::YFP-PhGR, CaMV35S::YFP-PhGRL1, CaMV35S::YFP-SmGR, CaMV35S::YFPSlGRL1Δ9, respectively. CFP-tagged ETR1, ETR2, NR, ETR4, ETR5, and ETR6 were assembled
in the similar way, except that the corresponding fragments were inserted into the binary vector
pEarleyGate 102 (35S-Gateway-CFP-HA tag-OCS 3'). All constructs were transferred into

198

Agrobacterium tumefaciens strain GV3101. All primers used for assembling constructs are
listed in Table 4.1. The fidelity of each construct was verified by DNA sequencing.

Transient expression in Nicotiana tabacum

Transient expression of fluorescent protein tagged versions of genes of interest in tobacco
(Nicotiana tabacum cv. Petit Havana) was performed as previously described (Batoko et al.,
2000). Briefly, 3 ml overnight cultures of recombinant A. tumefaciens (strain GV3101) grown at
28° in YEB media (per liter: 5 g of beef extract, 1 g of yeast extract, 5 g of sucrose, and 0.5 g
C
of MgSO4-7H2O; supplemented with 50 ug ml-1 kanamycin and 10 ug ml-1 rifampicin) were
harvested by centrifugation at 4000 g for 5 minutes and the pellet washed and resuspended to a
density of 0.05 OD600 in induction media (50 mM MES, pH 5.6; 2mM NaH2PO4; 0.05% w/v
glucose; 200 μM Acetosyringone). The YFP or CFP-tagged cultures (YFP–SlGR, YFP-SlGRL1,
YFP–SlGRL2, YFP–PhGR, YFP–PhGRL1, YFP–SmGR, YFP-SlGRL1Δ9, ETR1-CFP, ETR2CFP, NR-CFP, ETR4-CFP, ETR5-CFP, and ETR6-CFP) were mixed with ERD2-GFP culture
respectively, and injected into the abaxial leaf surface of 5-6 week-old plants using 1 ml
needleless syringes. Following 48 h of expression fluorescence of the reporter genes was
determined by confocal laser scanning microscopy.

Stable expression in Arabidopsis thaliana

The

Agrobacterium

tumefaciens

strain

GV3101

contained

CaMV35S::YFP-SlGR,

CaMV35S::YFP-SlGRL1, CaMV35S::YFP-PhGR constructs were transformed into Arabidopsis
199

etr1-2/rte1-3 double mutant by floral dip (Clough and Bent, 1998). Transformants were selected
by spraying with 0.1 % and 0.2 % v/v Finale® herbicide (http://www.bayercropscience.com) at 1
and 2 weeks post-germination, respectively. The presence of the transgene was confirmed by
PCR and confocal laser scanning microscopy.

Confocal laser scanning microscopy

Zeiss 510 Meta laser scanning confocal microscope and Olympus Fluoview FV41000 laser
scanning confocal microscope were used in this research. Zeiss 510 Meta laser scanning confocal
microscope (Thornwood, NY) configured with fully automated Zeiss Axio observer inverted
microscope. Blue-shifted GFP was excited with 458 nm Argon laser line and fluorescence
emission was detected with a 475-525 band pass filter. YFP was excited with the 514 nm Argon
laser line and fluorescence emission was detected with a 520-555 nm band pass filter.
Fluorescence emissions were collected sequentially to avoid fluorescence crossover. Images
were collected using the Plan Apocromat 63× oil objective (NA 1.4). Olympus Fluoview
FV41000 laser scanning confocal microscope (Center Valley, PA) configured with fully
automated IX81 olympus inverted microscope. The parameters are very similar to that of the
Zeiss Meta. The images were collected sequentially, using the PlanApoN 60x oil (NA 1.42)
objective. The blue-shifted GFP was excited using the 458 nm Argon laser line, and the
fluorescence emission was collected from 475-520 nm. The YFP was excited using the 514 nm
Argon laser line, and the fluorescence emission was collected from 530-630 nm. CFP was
excited with 514 nm wavelength, and emission collected from 530-565 nm.

200

DNA sequence analysis

DNA sequences were assembled using Sequencher version 4.7 (Genecodes Corporation, Ann
Arbor, MI http://genecodes.com).

Statistical analysis

Statistical analyses were performed using SAS (SAS Institute, www.sas.com). The genotypic
constituents were evaluated by Student’s t-test and LS Means.

201

202

Figure 4.1 (cont’d)

Figure 4.1 Expression of SlGR, SlGRL1 and SlGRL2 during tomato development. A, The relative
expression level of SlGR, SlGRL1 and SlGRL2 in various tomato tissues as determined by qRT203

PCR. BK refers to fruit at the breaker stage of development. RR-peel refers to peel isolated from
red-ripe fruits. Data are presented relative to the expression levels of SlGR in BK fruit, SlGRL1
in young leaf, and SlGRL2 in BK fruit. B, Relative expression levels of SlGR, SlGRL1 and
SlGRL2 in whole flowers at four stages of development (tight bud, bud opening, anthesis and
senescing) together with expression in floral organs isolated from flowers at anthesis. Data are
presented relative to the expression levels of SlGR, SlGRL1, and SlGRL2 in whole flowers at the
tight bud stage of development. C, Relative expression levels of SlGR, SlGRL1 and SlGRL2
during tomato fruit development and ripening. Fruit were harvested at various days post anthesis
(dpa), at the mature green (MG), breaker (BK) and 3 and 7 days post breaker (BK+3 and BK+7).
Data are presented relative to the expression levels of SlGR, SlGRL1, and SlGRL2 in 14dpa fruit.
D, Relative expression levels of SlGR, SlGRL1 and SlGRL2 in whole and dissected seeds isolated
from mature green fruits. Data are presented relative to the expression levels of SlGR, SlGRL1,
and SlGRL2 in whole seeds. E, Relative expression levels of SlGR, SlGRL1 and SlGRL2 in peels
isolated from different fruit development stages. MG-peel refers to peel isolated from mature
green fruits. RR-peel refers to peel isolated from red-ripe fruits. Data are presented relative to the
expression levels of SlGR, SlGRL1, and SlGRL2 in MG-peel. F, Relative expression levels of
SlGR, SlGRL1 and SlGRL2 in whole pericarp, peel and flesh of tomato fruits at the breaker stage
of development. Data are presented relative to the expression levels of SlGR, SlGRL1, and
SlGRL2 in whole pericarp. G, Relative expression levels of SlGR, SlGRL1 and SlGRL2 in whole
stem, stem peel and stem core of 5-week old tomato plants in green house. Data are presented
relative to the expression levels of SlGR, SlGRL1, and SlGRL2 in stem core. Experimental details
are provided in the Materials and Methods section. For all experiments, data are presented as the
mean ± of three biological and three technical replicates. *Statistical analysis is presented for
SE
204

each gene across the tissue, or developmental stages. *Means followed by the same letter are not
significantly different at α=0.05 level.

205

Figure 4.2 Expression of SlGR, SlGRL1 and SlGRL2 in response to ethylene and wounding. A,
Relative expression levels of SlGR, SlGRL1 and SlGRL2 in leaves of 4-week old plants treated
206

with 10 l l-1 ethylene for the specified time points. Data are presented relative to the expression
levels of SlGR, SlGRL1, and SlGRL2 at the 0 hour time point. B, Relative expression levels of
SlGR, SlGRL1 and SlGRL2 in leaves of 4-week old plants with wounding treatment for the
specified time points. Data are presented relative to the expression levels of SlGR, SlGRL1, and
SlGRL2 at the 0 hour time point. C and D, Relative expression levels of wounding-related genes
PIN1 (C) and PIN2 (D) in the same samples shown in (B). Data are presented relative to the
expression levels of PIN1 (C) and PIN2 (D) at the 0 hour time point. Experimental details are
provided in the Materials and Methods section. For all experiments, data are presented as the
mean ± of three biological and three technical replicates. *Statistical analysis is presented for
SE
each gene across the tissue, or developmental stages. *Means followed by the same letter are not
significantly different at α=0.05 level.

207

Figure 4.3 Subcellular localization of SlGR, SlGRL1, and SlGRL2 in tobacco epidermal leaf
cells. ERD2-GFP as an ER and Golgi marker was transiently expressed with YFP-SlGR, YFPSlGRL1, and YFP-SlGRL2, respectively. A, D, and G represent the emission channel for YFPSlGR(A), YFP-SlGRL1(B), and YFP-SlGRL2(G), while B, E, and H represent ERD2-GFP
fluorescence. The white merged color of the GFP and YFP fluorescence demonstrated the co208

localization of ERD2 with the SlGR(C), SlGRL1(F), and SlGRL2(I) at the Golgi membrane.
Images were captured using a Zeiss 510 Meta laser scanning confocal microscope. GFP emission
was excited with 458 nm wavelength, and detected with a 475-525 nm band pass filter. YFP was
excited with 514 nm wavelength, and detected with a 520-555 nm band pass filter. Note the colocalization of YFP-SlGR, YFP-SlGRL1, and YFP-SlGRL2 with ERD2-GFP in the “dot” like
structures of the Golgi (indicated by arrows) in the merged panel. Scale bar=5 μm.

209

Figure 4.4 Subcellular localization of PhGR, PhGRL1, and SmGR in tobacco leaf epidermal
cells. ERD2-GFP as an ER and Golgi marker was transiently expressed with YFP-PhGR, YFPPhGRL1, and YFP-SmGR respectively. A, D, and G represent the emission channel for YFPPhGR(A), YFP-PhGRL1(D), and YFP-SmGR(G), while B, E, and H represent ERD2-GFP
fluorescence. The white merged color of the GFP and YFP fluorescence demonstrated the co210

localization of ERD2 with the PhGR(C), PhGRL1(F), and SmGR(I) at the Golgi membranes.
Images were captured using an Olympus Fluoview FV41000 laser scanning confocal microscope.
GFP emission was excited with 458 nm wavelength, and collected from 475-520 nm. YFP was
excited with 514 nm wavelength, and collected from 530-560 nm. Note the co-localization of
YFP-PhGR, YFP-PhGRL1, and YFP-SmGR with ERD2-GFP in the “dot” like structures of the
Golgi (indicated by arrows) in the merged panel. Scale bar=10 μm.

211

Figure 4.5 Differential complementation of rte1-3 by YFP-tagged versions of SlGR, SlGRL1, and
PhGR. A, The triple response phenotype of Arabidopsis seedlings from Col-0, etr1-2, and etr1212

2/rte1-3, together with a transgenic line expressing a CaMV35S::YFP-SlGR construct. B, The
triple response phenotype of Arabidopsis seedlings from Col-0, etr1-2, and etr1-2/rte1-3,
together with a transgenic line expressing a CaMV35S::YFP-SlGRL1 construct. C, The triple
response phenotype of Arabidopsis seedlings from Col-0, etr1-2, and etr1-2/rte1-3, together with
a transgenic line expressing a CaMV35S::YFP-PhGR construct. Seedlings were grown in the
dark at room temperature for six days on 100 μM ACC. Note, the elongated phenotypes of the
CaMV35S::YFP-SlGRL1 and CaMV35S::YFP-PhGR lines demonstrating complementation of
the rte1-3 mutant allele whereas the CaMV35S::YFP-SlGR lines do not complement the rte1-3
mutant allele. See Figure 2.6 and Figure 3.3 for comparison with MYC-tagged versions of each
construct. In each case the YFP-tagged transgenic lines shown were utilized for crosses to the
organelle reporter lines utilized for subcellular localization of YFP-SlGR, YFP-SlGRL1, and
YFP-PhGR in stably transformed Arabidopsis plants (see Figure 4.6, 4.7, 4.8).

213

Figure 4.6 Lack of co-localization of SlGR, SlGRL1, and PhGR with an ER membrane marker
line in Arabidopsis. Confocal microscopy images of live cotyledon epidermal cells of F1
progeny derived from crosses between Arabidopsis plants expressing either CaMV35S::YFPSlGR(A-C), CaMV35S::YFP-SlGRL1(D-F), or CaMV35S::YFP-PhGR(G-I) with the ER marker
line 6×
CaMV35S::GFP-HDEL. Images were captured using a Zeiss 510 Meta laser scanning
214

confocal microscope. GFP emission was excited with 458 nm wavelength, and detected with a
475-525 nm band pass filter. YFP was excited with 514 nm wavelength, and detected with a 520555 nm band pass filter. Note the non-overlapping fluorescence signals in crosses incorporating
the ER marker line. Arrows highlight the “net” like structure of the ER, and “dot” like structure
of the Golgi, respectively. Scale bar=10 μm.

215

Figure 4.7 Subcellular localization of SlGR, SlGRL1, and PhGR at the Golgi membrane in
Arabidopsis. Confocal microscopy images of live cotyledon epidermal cells of F1 progeny
derived from crosses between Arabidopsis plants expressing either CaMV35S::YFP-SlGR(A-C),
CaMV35S::YFP-SlGRL1(D-F), or CaMV35S::YFP-PhGR(G-I) with the Golgi marker line
6×
CaMV35S::ST-GFP. Images were captured using a Zeiss 510 Meta laser scanning confocal
microscope. GFP emission was excited with 458 nm wavelength, and detected with a 475-525
216

nm band pass filter. YFP was excited with 514 nm wavelength, and detected with a 520-555 nm
band pass filter. Note the overlapping fluorescence signals in progeny of either CaMV35S::YFPSlGR,

CaMV35S::YFP-SlGRL1,

or

CaMV35S::YFP-PhGR

lines

expressing

ST-GFP,

demonstrating Golgi localization. Arrows highlight the “dot” like structure of the Golgi. Scale
bar=10 μm.

217

Figure 4.8 SlGR, SlGRL1, and PhGR are not associated with the trans-Golgi network (TGN).
Confocal microscopy images of live root cells of F1 progeny derived from crosses between
Arabidopsis plants expressing either CaMV35S::YFP-SlGR(A-C), CaMV35S::YFP-SlGRL1(D-F),
or CaMV35S::YFP-PhGR(G-I) together with the TGN marker line Wave13R (mCherry-VTI12),
which fused the mCherry protein with the SNARE protein VTI12. Images were captured using
an Olympus Fluoview FV41000 laser scanning confocal microscope. YFP emission was excited
218

with 514 nm wavelength, and collected from 530-560 nm. RFP emission originated from
Wave13R line was excited with 559 nm wavelength, and collected from 570-630 nm. Note the
non-overlapping fluorescence signals in crosses incorporating the TGN marker line. Scale
bar=20 μm.

219

Table 4.1 Oligonucleotide primers used in this study
Primer

Sequence

Use

PETGRL1ENT-F

5´
-CACCATGGATTTAGAACCTGCCTACA-3´

Construct assembly

PETGRL1ENTSTOP-R 5´
-CTAGGAATCCAACAGACTTTTTACAC-3´

Construct assembly

GRQ-F

5´ AGAGCTTGAGGAATCATGAATGC-3´
-

qRT-PCR

GRQ-R

5´ GGGTGAATACGCCATTGACAT-3´
-

qRT-PCR

GRL1Q-F

5´ TGCAAAATTTCATGTCGCCATA-3´
-

qRT-PCR

GRL1Q-R

5´ AGGCAGGTTCCAAATCCATTAA-3´
-

qRT-PCR

GRL2Q-F

5´ GTGCTGCTGCCTTTCTCCTT-3´
-

qRT-PCR

GRL2Q-R

5´ AGATTCATCATGGTTCTCGACATATT-3´
-

qRT-PCR

PIN1Q-F

5´ CTTCTTCCAACTTCCTTTG-3´
-

qRT-PCR

PIN1Q-R

5´ TGTTTTCCTTCGCACATC-3´
-

qRT-PCR

PIN2Q-F

5´ AATTATCCATCATGGCTGTTCAC-3´
-

qRT-PCR

PIN2Q-R

5´ CCTTTTTGGATCAGATTCTCCTT-3´
-

qRT-PCR

220

Table 4.1 (cont’d)
CACQ-F

5´ CCTCCGTTGTGATGTAACTGG-3´
-

qRT-PCR

CACQ-R

5´ ATTGGTGGAAAGTAACATCATCG-3´
-

qRT-PCR

221

REFERENCES

222

REFERENCES
Adams-Phillips L, Barry C, Kannan P, Leclercq J, Bouzayen M, Giovannoni J (2004) Evidence
that CTR1-mediated ethylene signal transduction in tomato is encoded by a multigene
family whose members display distinct regulatory features. Plant Molecular Biology 54:
387-404
Alonso JM, Stepanova AN, Solano R, Wisman E, Ferrari S, Ausubel FM, Ecker JR (2003) Five
components of the ethylene-response pathway identified in a screen for weak ethyleneinsensitive mutants in Arabidopsis. Proceedings of the National Academy of Sciences of
the United States of America 100: 2992-2997
Barry CS, Blume B, Bouzayen M, Cooper W, Hamilton AJ, Grierson D (1996) Differential
expression of the 1-aminocyclopropane-1-carboxylate oxidase gene family of tomato.
Plant Journal 9: 525-535
Barry CS, Giovannoni JJ (2006) Ripening in the tomato Green-ripe mutant is inhibited by
ectopic expression of a protein that disrupts ethylene signaling. Proceedings of the
National Academy of Sciences of the United States of America 103: 7923-7928
Barry CS, McQuinn RP, Thompson AJ, Seymour GB, Grierson D, Giovannoni JJ (2005)
Ethylene insensitivity conferred by the Green-ripe and Never-ripe 2 ripening mutants of
tomato. Plant Physiology 138: 267-275
Batoko H, Zheng HQ, Hawes C, Moore I (2000) A Rab1 GTPase is required for transport
between the endoplasmic reticulum and Golgi apparatus and for normal Golgi movement
in plants. Plant Cell 12: 2201-2217
Bisson MMA, Bleckmann A, Allekotte S, Groth G (2009) EIN2, the central regulator of ethylene
signalling, is localized at the ER membrane where it interacts with the ethylene receptor
ETR1. Biochemical Journal 424: 1-6
Bisson MMA, Groth G (2010) New insight in ethylene signaling: Autokinase activity of ETR1
modulates the interaction of receptors and EIN2. Molecular Plant 3: 882-889
Bleecker AB, Kende H (2000) Ethylene: A gaseous signal molecule in plants. Annual Review of
Cell and Developmental Biology 16: 1-18
Boevink P, Oparka K, Cruz SS, Martin B, Betteridge A, Hawes C (1998) Stacks on tracks: the
plant Golgi apparatus traffics on an actin/ER network. Plant Journal 15: 441-447

223

Cancel JD, Larsen PB (2002) Loss-of-function mutations in the ethylene receptor ETR1 cause
enhanced sensitivity and exaggerated response to ethylene in Arabidopsis. Plant
Physiology 129: 1557-1567
Chen YF, Gao ZY, Kerris RJ, Wang WY, Binder BM, Schaller GE (2010) Ethylene receptors
function as components of high-molecular-mass protein complexes in Arabidopsis. Plos
One 5: e8640
Chen YF, Randlett MD, Findell JL, Schaller GE (2002) Localization of the ethylene receptor
ETR1 to the endoplasmic reticulum of Arabidopsis. Journal of Biological Chemistry 277:
19861-19866
Clark KL, Larsen PB, Wang XX, Chang C (1998) Association of the Arabidopsis CTR1 Raf-like
kinase with the ETR1 and ERS ethylene receptors. Proceedings of the National Academy
of Sciences of the United States of America 95: 5401-5406
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant Journal 16: 735-743
Dong CH, Jang M, Scharein B, Malach A, Rivarola M, Liesch J, Groth G, Hwang I, Chang C
(2010) Molecular association of the Arabidopsis ETR1 ethylene receptor and a regulator
of ethylene signaling, RTE1. Journal of Biological Chemistry 285: 40706-40713
Dong CH, Rivarola M, Resnick JS, Maggin BD, Chang C (2008) Subcellular co-localization of
Arabidopsis RTE1 and ETR1 supports a regulatory role for RTE1 in ETR1 ethylene
signaling. Plant Journal 53: 275-286
Exposito-Rodriguez M, Borges AA, Borges-Perez A, Perez JA (2008) Selection of internal
control genes for quantitative real-time RT-PCR studies during tomato development
process. Bmc Plant Biology 8: 131-142
Force A, Lynch M, Pickett FB, Amores A, Yan YL, Postlethwait J (1999) Preservation of
duplicate genes by complementary, degenerative mutations. Genetics 151: 1531-1545
Freeling M (2009) Bias in plant gene content following different sorts of duplication: Tandem,
whole-genome, segmental, or by transposition. In Annual Review of Plant Biology, Vol
60, pp 433-453
Gao Z, Wen CK, Binder BM, Chen YF, Chang J, Chiang YH, Ill RJK, Chang C, Schaller GE
(2008) Heteromeric interactions among ethylene receptors mediate signaling in
Arabidopsis. Journal of Biological Chemistry 283: 23801-23810
224

Gao ZY, Chen YF, Randlett MD, Zhao XC, Findell JL, Kieber JJ, Schaller GE (2003)
Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis
through participation in ethylene receptor signaling complexes. Journal of Biological
Chemistry 278: 34725-34732
Geldner N, Denervaud-Tendon V, Hyman DL, Mayer U, Stierhof YD, Chory J (2009) Rapid,
combinatorial analysis of membrane compartments in intact plants with a multicolor
marker set. Plant Journal 59: 169-178
Guo HW, Ecker JR (2004) The ethylene signaling pathway: new insights. Current Opinion in
Plant Biology 7: 40-49
Hall AE, Bleecker AB (2003) Analysis of combinatorial loss-of-function mutants in the
Arabidopsis ethylene receptors reveals that the ers1 etr1 double mutant has severe
developmental defects that are EIN2 dependent. Plant Cell 15: 2032-2041
Haseloff J, Siemering KR, Prasher DC, Hodge S (1997) Removal of a cryptic intron and
subcellular localization of green fluorescent protein are required to mark transgenic
Arabidopsis plants brightly. Proceedings of the National Academy of Sciences of the
United States of America 94: 2122-2127
Held MA, Boulaflous A, Brandizzi F (2008) Advances in fluorescent protein-based imaging for
the analysis of plant endomembranes. Plant Physiology 147: 1469-1481
Hua J, Meyerowitz EM (1998) Ethylene responses are negatively regulated by a receptor gene
family in Arabidopsis thaliana. Cell 94: 261-271
Kendrick MD, Chang C (2008) Ethylene signaling: new levels of complexity and regulation.
Current Opinion in Plant Biology 11: 479-485
Klee HJ (2002) Control of ethylene-mediated processes in tomato at the level of receptors.
Journal of Experimental Botany 53: 2057-2063
Klee HJ (2004) Ethylene signal transduction. Moving beyond Arabidopsis. Plant Physiology 135:
660-667
Lashbrook CC, Tieman DM, Klee HJ (1998) Differential regulation of the tomato ETR gene
family throughout plant development. Plant Journal 15: 243-252
Leclercq J, Adams-Phillips LC, Zegzouti H, Jones B, Latche A, Giovannoni JJ, Pech JC,
Bouzayen M (2002) LeCTR1, a tomato CTR1-like gene, demonstrates ethylene signaling
225

ability in Arabidopsis and novel expression patterns in tomato. Plant Physiology 130:
1132-1142
Lee JS, Brown WE, Graham JS, Pearce G, Fox EA, Dreher TW, Ahern KG, Pearson GD, Ryan
CA (1986) Molecular characterization and phylogenetic studies of a wound-inducible
proteinase inhibitor I gene in Lycopersicon species. Proceedings of the National
Academy of Sciences of the United States of America 83: 7277-7281
Lin ZF, Alexander L, Hackett R, Grierson D (2008) LeCTR2, a CTR1-like protein kinase from
tomato, plays a role in ethylene signalling, development and defence. Plant Journal 54:
1083-1093
Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time
quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25: 402-408
Ma B, Cui ML, Sun HJ, Takada K, Mori H, Kamada H, Ezura H (2006) Subcellular localization
and membrane topology of the melon ethylene receptor CmERS1. Plant Physiology 141:
587-597
Moeder W, Barry CS, Tauriainen AA, Betz C, Tuomainen J, Utriainen M, Grierson D,
Sandermann H, Langebartels C, Kangasjarvi J (2002) Ethylene synthesis regulated by
biphasic induction of 1-aminocyclopropane-1-carboxylic acid synthase and 1aminocyclopropane-1-carboxylic acid oxidase genes is required for hydrogen peroxide
accumulation and cell death in ozone-exposed tomato. Plant Physiology 130: 1918-1926
Nonogaki H, Matsushima H, Morohashi Y (1992) Galactomannan hydrolyzing activity develops
during priming in the micropylar endosperm tip of tomato seeds. Physiologia Plantarum
85: 167-172
Payton S, Fray RG, Brown S, Grierson D (1996) Ethylene receptor expression is regulated
during fruit ripening, flower senescence and abscission. Plant Molecular Biology 31:
1227-1231
Qiao H, Shen Z, Huang S-sC, Schmitz RJ, Urich MA, Briggs SP, Ecker JR (2012) Processing
and subcellular trafficking of ER-tethered EIN2 control response to ethylene gas. Science
Resnick JS, Rivarola M, Chang C (2008) Involvement of RTE1 in conformational changes
promoting ETR1 ethylene receptor signaling in Arabidopsis. Plant Journal 56: 423-431
Resnick JS, Wen CK, Shockey JA, Chang C (2006) REVERSION-TO-ETHYLENE
SENSITIVITY1, a conserved gene that regulates ethylene receptor function in Arabidopsis.
226

Proceedings of the National Academy of Sciences of the United States of America 103:
7917-7922
Rivarola M, McClellan CA, Resnick JS, Chang C (2009) ETR1-specific mutations distinguish
ETR1 from other Arabidopsis ethylene receptors as revealed by genetic interaction with
RTE1. Plant Physiology 150: 547-551
Sato T, Theologis A (1989) Cloning the mRNA encoding 1-aminocyclopropane-1-carboxylate
synthase, the key enzyme for ethylene biosynthesis in plants. Proceedings of the National
Academy of Sciences of the United States of America 86: 6621-6625
Shackel KA, Polito VS, Ahmadi H (1991) Maintenance of turgor by rapid sealing of puncture
wounds in leaf epidermal cells. Plant Physiology 97: 907-912
Thornburg RW, An G, Cleveland TE, Johnson R, Ryan CA (1987) Wound-inducible expression
of a potato inhibitorII-chloramphenicol acetyltransferase gene fusion in transgenic
tobacco plants. Proceedings of the National Academy of Sciences of the United States of
America 84: 744-748
Tieman DM, Klee HJ (1999) Differential expression of two novel members of the tomato
ethylene-receptor family. Plant Physiology 120: 165-172
Wang WY, Hall AE, O'Malley R, Bleecker AB (2003) Canonical histidine kinase activity of the
transmitter domain of the ETR1 ethylene receptor from Arabidopsis is not required for
signal transmission. Proceedings of the National Academy of Sciences of the United
States of America 100: 352-357
Wang Y, Kumar PP (2007) Characterization of two ethylene receptors PhERS1 and PhETR2
from petunia: PhETR2 regulates timing of anther dehiscence. Journal of Experimental
Botany 58: 533-544
Watanabe H, Saigusa M, Hase S, Hayakawa T, Satoh S (2004) Cloning of a cDNA encoding an
ETR2-like protein (Os-ERL1) from deep water rice (Oryza sativa L.) and increase in its
mRNA level by submergence, ethylene, and gibberellin treatments. Journal of
Experimental Botany 55: 1145-1148
Whittaker DJ, Smith GS, Gardner RC (1997) Expression of ethylene biosynthetic genes in
Actinidia chinensis fruit. Plant Molecular Biology 34: 45-55
Wilkinson JQ, Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1995) An ethylene-inducible
component of signal-transduction encoded by Never-ripe. Science 270: 1807-1809
227

Yau CP, Wang LJ, Yu MD, Zee SY, Yip WK (2004) Differential expression of three genes
encoding an ethylene receptor in rice during development, and in response to indole-3acetic acid and silver ions. Journal of Experimental Botany 55: 547-556
Yip WK, Moore T, Yang SF (1992) Differential accumulation of transcripts for four tomato 1aminocyclopropane-1-carboxylate synthase homologs under various conditions.
Proceedings of the National Academy of Sciences of the United States of America 89:
2475-2479
Zarembinski TI, Theologis A (1994) Ethylene biosynthesis and action: a case of conservation.
Plant Molecular Biology 26: 1579-1597
Zhang W, Zhou X, Wen CK (2012) Modulation of ethylene responses by OsRTH1
overexpression reveals the biological significance of ethylene in rice seedling growth and
development. Journal of Experimental Botany 63: 4151-4164
Zhong SL, Lin ZF, Grierson D (2008) Tomato ethylene receptor-CTR interactions: visualization
of NEVER-RIPE interactions with multiple CTRs at the endoplasmic reticulum. Journal
of Experimental Botany 59: 965-972
Zhou DB, Kalaitzis P, Mattoo AK, Tucker ML (1996) The mRNA for an ETR1 homologue in
tomato is constitutively expressed in vegetative and reproductive tissues. Plant Molecular
Biology 30: 1331-1338
Zhou X, Liu Q, Xie F, Wen CK (2007) RTE1 is a Golgi-associated and ETR1-dependent
negative regulator of ethylene responses. Plant Physiology 145: 75-86

228

Chapter 5 Conclusions and future directions

229

Introduction

The GR/RTE1 family of proteins is conserved in plants animals and protozoa although with the
exception of GR and RTE1, which are known to influence ethylene responsiveness, the role of
these proteins is unknown. In this study, the role of the GR/RTE1 family proteins in ethylene
signaling was further investigated. Unlike most eudicot families that contain two GR/RTE1
homologs, with high homology to RTE1/GRL1 and RTH/GRL2, members of the Solanaceae
family also contain an additional phylogenetically distinct family member defined by SlGR that
is able to influence ethylene responses in tomato. SlGR, SlGRL1 and SlGRL2 are differentially
expressed during tomato development and in response to ethylene treatment and each encodes a
protein that is predominantly localized to the Golgi. A combination of over-expression in tomato
and complementation of the rte1-3 mutant allele indicates that SlGR and SlGRL1 influence
distinct ethylene responses suggesting the existence of separate ethylene-signaling modules in
tomato, that are influenced either individually by SlGR or SlGRL1 or together by both proteins.
In contrast, over-expression of SlGRL2 in tomato did not reveal any altered ethylene-related
phenotypes suggesting that this gene may not be involved in ethylene signaling. Phylogenetic
analysis and sequence alignments indicated that putative GR orthologs are relatively more
divergent than the putative GRL1 orthologs of the Solanaceae family. This sequence divergence
led to different functional characteristics of the putative Solanaceae GR orthologs both in terms
of their ability to influence ethylene responsiveness in tomato and to complement the rte1 mutant
of Arabidopsis. Utilizing a comparative sequence approach and mutagenesis, a set of 10 amino
acids were identified within the putative GR orthologs that are important for these proteins to
complement the rte1 mutant.
230

Together, these data provide considerable new insight into the role of the GR/RTE1 family in
controlling ethylene responses in plants, particularly, the role of these proteins in the Solanaceae
family. However, several intriguing questions and new research directions have arisen as a result
of this study.

Discrepancies in the subcellular localization of GR/RTE1 proteins

Components in the upstream section of the ethylene signaling pathway are localized to the
endomembrane system. The Arabidopsis ethylene receptors localize to the endoplasmic
reticulum (ER) and Golgi membranes (Chen et al., 2002; Ma et al., 2006; Dong et al., 2008). The
CONSTITUTIVE TRIPLE RESPONSE 1 (CTR1) is connected to the ER through binding to the
ethylene receptors (Clark et al., 1998; Cancel and Larsen, 2002; Gao et al., 2003). ETHYLENE
INSENSITIVE 2 (EIN2) is also located at the ER membrane where it interacts with all five
ethylene receptors in Arabidopsis (Bisson et al., 2009). The presence of ethylene leads to
proteolytic cleavage at the carboxyl-terminal of EIN2, and as a result, its C-terminal is released
and rapidly translocates to the nucleus (Qiao et al., 2012).

Separate studies have investigated the subcellular localization of the AtRTE1 protein. Transient
expression in onion epidermal cells suggested that AtRTE1 is localized to the Golgi whereas
transient expression in Arabidopsis protoplasts and stable transformation in Arabidopsis
suggested dual localization to both the ER and the Golgi (Zhou et al., 2007; Dong et al., 2008).
The distant homolog of AtRTE1, AtRTH, was recently reported to be localized to the ER and
231

nucleus by transient expression in onion epidermal cells as was its putative rice ortholog,
OsGRL2/OsRTH3 (Zhang et al., 2012). In contrast, transient expression in onion epidermal cells
suggested dual localization of OsGRL1a/OsRTH1 and OsGRL1b/OsRTH2 to the Golgi and ER
membranes (Zhang et al., 2012). Together, these data suggest either considerable heterogeneity
in the subcellular localization of this protein family or that differences in experimental
approaches may have contributed to this anomalous data.

In the present study, the subcellular localization of several GR/RTE1 proteins was assessed.
Reporter-gene fusions indicate that SlGR, SlGRL1, SlGRL2, PhGR, SmGR proteins are
predominantly localized in the Golgi, which is slightly conflicting with the reported sub-cellular
localization of AtRTE1, AtRTH, and their rice homologs. For example, we did not detect
localization of any of the Solanaceae GR/RTE1 homologs to the ER or the nucleus. These
discrepancies in the data between different studies have implications for current models of
ethylene signaling and need to be resolved. For example, AtRTE1 is thought to interact with the
ETR1 receptor in the ER (Zhou et al., 2007; Dong et al., 2008; Dong et al., 2010). However, we
have shown that SlGRL1 and PhGR are able to complement the rte1-3 mutant allele, suggesting
that they function in a similar way to AtRTE1, yet YFP fusions of SlGRL1 and PhGR are
localized predominantly in the Golgi and we did not observe any fluorescence in the ER. It is
possible, that a proportion of the GR/RTE1 protein pool can localize to the ER or that the
receptors may also be localized to the Golgi. A problem with current understanding of the
subcellular localization of the GR/RTE1 family of proteins and the ethylene receptors is that
some of the predictions of subcellular localization are based on interpretation of transiently
expressed fusion proteins in onion epidermal cells and protoplasts and high level of transgene
232

expression in these systems may lead to a failure of protein export from the ER to the intended
subcellular location. Similarly, in our study over-expression of the transgenes may have led to
saturation of the Golgi export machinery causing the fusion proteins to be trapped within the
Golgi. Further studies are needed using combinations of fluorescently tagged proteins and
subcellular fractionation studies, together with immunolocalization approaches to resolve the
subcellular localization of these proteins.

Potential protein-protein interactions between the GR/RTE1 family and the ethylene
receptors

Phenotypic analysis of transgenic lines over-expressing SlGR and SlGRL1 in tomato indicates
that these genes influence distinct subsets of ethylene responses. This hypothesis is supported by
the finding that SlGR and SlGRL1 possess a differential ability to complement the rte1-3 mutant
allele of Arabidopsis. Furthermore, over-expression of SlGRL1 in a Gr mutant background
defines the existence of distinct ethylene signaling modules in tomato that we hypothesize are
comprised of distinct ethylene signaling components that differentially influence ethylene
responsiveness. For example, in some tissues or responses a module susceptible to the action of
either SlGR or SlGRL1 operates while in other situations both modules operate to cooperatively
influence ethylene responses.

The identity of these modules remains unclear but based on the functional properties of AtRTE1,
which binds to the ETR1 N-terminus to promote ethylene signaling (Dong et al., 2010), we
propose that SlGR and SlGRL1 will also likely interact with the tomato ethylene receptors. It is
233

possible that SlGR and SlGRL1 will interact with different members of the ethylene receptor
family or they could potentially interact with the same receptor but with different affinities. In
support of the hypothesis that SlGR and SlGRL1 interact with separate ethylene receptors,
tomato contains two ethylene receptors that are homologous to the ETR1 receptor of Arabidopsis,
LeETR1 and LeETR2. Based on the Arabidopsis model where AtRTE1 is required for ETR1
function, it is predicted that both LeETR1 and LeETR2 will require the activity of a GR/RTE1
protein for optimal function. The potential of SlGR and SlGRL1 to interact with the tomato
ethylene receptors will need to be determined in future research, potentially using a combination
of the mating-based split-ubiquitin system (Grefen et al., 2008), Co-immunoprecipitation, or
bimolecular fluorescence complementation. In addition, we cannot completely rule out the
possibility that the protein levels derived from transgene over-expression are not equal between
or within transgenic lines and there remains a slight possibility that some of the phenotypic
variation observed between our different transgenic lines may be attributed to different levels of
protein derived from the expression of the transgenes.

Identifying amino acid residues and domains of GR/RTE1 proteins that are important for
their functional characteristics

Phylogenetic analysis and sequence alignments revealed that putative SlGR orthologs are more
divergent than the putative SlGRL1 orthologs in the Solanaceae family. The sequence divergence
of the putative GR orthologs led to the hypothesis that these proteins possess altered functional
properties and influence distinct ethylene responses. This hypothesis was confirmed through a
combination of over-expression in tomato and complementation of the rte1-3 mutant allele. SlGR
234

is unable to fully complement the rte1-3 allele whereas SlGRL1 and the putative GR orthologs,
PhGR from Petunia hybrida and SmGR from eggplant (Solanum melongena), are able to almost
fully complement loss of rte1 function. Sequence alignments coupled with site-directed
mutagenesis identified a set of 10 amino acids that are required for the ability of SmGR and
PhGR to complement the rte1 mutant.

This analysis provides a starting point for more in depth analysis of the specific role of domains
and amino acids of SlGR and related proteins that are involved in regulating ethylene
responsiveness. Additional mutagenesis will be needed to further narrow down the identity of
the important amino acid residues that influence ethylene responsiveness. Considering the
importance of these amino acids in ethylene signaling, it is possible that they may influence the
ability of the GR/RTE1 proteins to bind the ethylene receptors either qualitatively or
quantitatively by influencing binding efficiency.

GR/RTE1 proteins have an undefined biochemical function

Although several members of the GR/RTE1 family of proteins are known to influence ethylene
responsiveness in plants, possibly through direct interaction with the ethylene receptors, the
biochemical function of these proteins remains unknown. Furthermore, we have shown that
SlGRL2 appears not to influence ethylene responses when over-expressed in tomato and no role
in ethylene responsiveness has been defined for the putative orthologous proteins from
Arabidopsis and rice, AtRTH and OsRTH3 (Dong et al., 2010; Zhang et al., 2012). Furthermore,
a single GR/RTE1 family homolog is present in metazoan and protozoan genomes although the
235

function of these proteins is also unknown. However, as metazoans and protozoans are not
known to signal using ethylene, it is highly likely that the GR/RTE1 family of proteins have a
broader role in cellular physiology that may be conserved across kingdoms. Defining this role
will require additional functional studies in animal and plant systems.

236

REFERENCES

237

REFERENCES
Bisson MMA, Bleckmann A, Allekotte S, Groth G (2009) EIN2, the central regulator of ethylene
signalling, is localized at the ER membrane where it interacts with the ethylene receptor
ETR1. Biochemical Journal 424: 1-6
Cancel JD, Larsen PB (2002) Loss-of-function mutations in the ethylene receptor ETR1 cause
enhanced sensitivity and exaggerated response to ethylene in Arabidopsis. Plant
Physiology 129: 1557-1567
Chen YF, Randlett MD, Findell JL, Schaller GE (2002) Localization of the ethylene receptor
ETR1 to the endoplasmic reticulum of Arabidopsis. Journal of Biological Chemistry 277:
19861-19866
Clark KL, Larsen PB, Wang XX, Chang C (1998) Association of the Arabidopsis CTR1 Raf-like
kinase with the ETR1 and ERS ethylene receptors. Proceedings of the National Academy
of Sciences of the United States of America 95: 5401-5406
Dong CH, Jang M, Scharein B, Malach A, Rivarola M, Liesch J, Groth G, Hwang I, Chang C
(2010) Molecular association of the Arabidopsis ETR1 ethylene receptor and a regulator
of ethylene signaling, RTE1. Journal of Biological Chemistry 285: 40706-40713
Dong CH, Rivarola M, Resnick JS, Maggin BD, Chang C (2008) Subcellular co-localization of
Arabidopsis RTE1 and ETR1 supports a regulatory role for RTE1 in ETR1 ethylene
signaling. Plant Journal 53: 275-286
Gao ZY, Chen YF, Randlett MD, Zhao XC, Findell JL, Kieber JJ, Schaller GE (2003)
Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis
through participation in ethylene receptor signaling complexes. Journal of Biological
Chemistry 278: 34725-34732
Grefen C, Stadele K, Ruzicka K, Obrdlik P, Harter K, Horak J (2008) Subcellular localization
and in vivo interactions of the Arabidopsis thaliana ethylene receptor family members.
Molecular Plant 1: 308-320
Ma B, Cui ML, Sun HJ, Takada K, Mori H, Kamada H, Ezura H (2006) Subcellular localization
and membrane topology of the melon ethylene receptor CmERS1. Plant Physiology 141:
587-597
Qiao H, Shen Z, Huang S-sC, Schmitz RJ, Urich MA, Briggs SP, Ecker JR (2012) Processing
and subcellular trafficking of ER-tethered EIN2 control response to ethylene gas. Science
238

Zhang W, Zhou X, Wen CK (2012) Modulation of ethylene responses by OsRTH1
overexpression reveals the biological significance of ethylene in rice seedling growth and
development. Journal of Experimental Botany 63: 4151-4164
Zhou X, Liu Q, Xie F, Wen CK (2007) RTE1 is a Golgi-associated and ETR1-dependent
negative regulator of ethylene responses. Plant Physiology 145: 75-86

239