FROM SYNTHESIS TO BEHAVIORAL ACTIVITY IN STREAMS: INVESTIGATIONS OF
PUTATIVE SEA LAMPREY PHEROMONE COMPONENTS
By
Cory Olaf Brant

A THESIS
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
MASTER OF SCIENCE
Fisheries & Wildlife
2011

ABSTRACT
FROM SYNTHESIS TO BEHAVIORAL ACTIVITY IN STREAMS: INVESTIGATIONS OF
PUTATIVE SEA LAMPREY PHEROMONE COMPONENTS
By
Cory Olaf Brant
The sea lamprey (Petromyzon marinus L.) has become a model species in the study of
bile acid production and release into the environment where these compounds function as
intraspecific chemical signals. Throughout the later stages of their life history, sea lampreys have
been shown to rely upon pheromone communication to mediate reproduction. Laboratory and
stream behavioral bioassays have implicated 3-keto petromyzonol sulfate (3kPZS) as a lamprey
mating pheromone, but the full function of this bile alcohol derivative remains to be elucidated.
Further, the biosynthesis, regulation, and release of 3kPZS and other putative components of the
pheromone remain only partially characterized. In Chapter 1 of this thesis, I observed the
behaviors of migratory females to the presence of 3kPZS in streams across a typical migratory
season. In Chapter 2, the synthesis, transport, and release of several steroid-derived compounds
in adult male sea lampreys were further examined using analytical chemistry and molecular
biology-based approaches in adult males. The data presented here further characterize the male
mating pheromone in sea lamprey, contribute to the understanding of pheromone communication
in vertebrates, and provide implications for controlling the invasive species in the Laurentian
Great Lakes.

AKNOWLEDGEMENTS

I would like to thank my advisor Dr. Weiming Li, and members of my graduate
committee Dr. Michael Wagner and Dr. Thomas Getty, for intellectual and technical support
throughout this research. I thank all personnel at the United States Geological Survey Hammond
Bay Biological Station, Millersburg, Michigan, the Department of Fisheries and Oceans, Canada,
and the United States Fish and Wildlife Service Marquette Biological Station, Marquette,
Michigan, for their assistance in animal capture, housing, maintenance, and technical support
during these projects. I also thank Dolly Trump and Lydia Lorenz for the use of their private
land to access field stream field sites. Special thanks are well deserved of all field technicians
and colleagues for their hard work, suggestions, and dedication regarding these projects: A. S.
Chun, D. Partyka, D. Strohm, J. Olds, K. Hill, T. O’Meara, T. Buchinger, T. Meckley, A. Scott,
and H. Kruckman. Thanks to Dr. Yu-Wen Chung-Davidson for assistance and expertise related
to gene studies, and to Dr. Ke Li and Dr. Huiyong Wang for providing expertise and assistance
with analytical chemistry techniques. I thank the Great Lakes Fishery Commission for funding
and supporting animal behavior and analytical chemistry research, and National Institute of
Health (NIH Award 1R24GM083982-01A1) for funding gene work in Chapter 2 of this thesis.

iii

TABLE OF CONTENTS

AKNOWLEDGEMENTS.................................................................................................. iii
LIST OF TABLES .............................................................................................................. v
LIST OF FIGURES ........................................................................................................... vi
INTRODUCTION TO THESIS .................................................................................................. 1
REFERENCES ............................................................................................................................ 7
CHAPTER 1
A MALE SEA LAMPREY PHEROMONE COMPONENT MODULATES THE EFFECT OF
STREAM TEMPERATURE ON UPSTREAM MIGRATION OF IMMATURE FEMALES
ABSTRACT .............................................................................................................................. 12
INTRODUCTION ..................................................................................................................... 13
METHODS................................................................................................................................ 16
RESULTS.................................................................................................................................. 26
DISCUSSION ........................................................................................................................... 30
ACKNOWLEDGMENTS ......................................................................................................... 34
APPENDIX A
SUPPLEMENTAL TABLES .................................................................................................... 36
APPENDIX B
SUPPLEMENTAL FIGURES .................................................................................................. 37
REFERENCES .......................................................................................................................... 39
CHAPTER 2
PRODUCTION AND SELECTIVE RELEASE OF BILE ACIDS BY THE ADULT MALE
SEA LAMPREY (PETROMYZON MARINUS L.)
ABSTRACT .............................................................................................................................. 45
INTRODUCTION ..................................................................................................................... 46
METHODS................................................................................................................................ 48
RESULTS.................................................................................................................................. 57
DISSCUSSION ......................................................................................................................... 65
ACKNOWLEDGMENTS ......................................................................................................... 68
APPENDIX A
SUPPLEMENTAL TABLES .................................................................................................... 70
APPENDIX B
SUPPLEMENTAL FIGURES .................................................................................................. 71
REFERENCES .......................................................................................................................... 73

iv

LIST OF TABLES

Table 1-1S. Mixed and fixed effects examined during upstream movement of migratory sea
lamprey in streams in relation to pheromones component 3kPZS……………………..……..…36
Table 2-1. Mean concentration (ng/ml) of bile acids from wash water collected from separate
bodily regions of male sea
lamprey………..………………………………………………………………….……………...60
Table 2-2. Mean concentration of bile acids detected in the body of pre-spermiating male sea
lamprey…………………………………………………………………………………..………61
Table 2-3. Ratios of bile acids detected in the body of, and subsequently released from, male sea
lamprey…………………………………………………………………………………..………62
Table 2-4S. Bile acids, bile alcohols, and their derivatives produced and released by the sea
lamprey (Petromyzon marinus)…………………………………………………………...……...70

v

LIST OF FIGURES

Figure 1-1. The section of the Upper Ocqueoc River, Millersburg, MI, U.S.A. (T35N, R3E, Sec.
27) used as the in-stream experimental system for observing upstream movement of migratory
phase female sea lamprey in relation to male-released pheromone component 3kPZS. (a) Full
250 m-long section showing release point. (b) Close-up of system showing naturally bisected
sub-channels with respective right channel (OR) and left channel (OL) odorant administration
points (red boxes). Odorants were alternated in each sub-channel per trial. At the downstream
confluence of the bisected channels, copper wire antennas recorded proportions of PIT-tagged
animals moving into either the right (AR) or the left (AL) sub-channels. Scale bars, 25 m..…….20
Figure 1-2. Effects of a pheromone component (3kPZS) on the proportion of migratory female
o
sea lamprey that swam upstream across stream temperatures between 12.4 – 23.0 C. □: Trials
-13
where synthesized 3kPZS (5x10 molar [M]) was administered to the stream. ▲: Trials where
methanol (vehicle) was administered to the stream. The solid regression line represents methanol
trials (R² = 0.70), and the dashed regression line represents 3kPZS trials (R² = 0.14). Trials were
conducted at night in the Upper Ocqueoc River, Millersburg, Michigan, U.S.A……….………28
Figure 1-3S. Hemotoxylin and eosin stained sections of sea lamprey oocytes taken from a subsample of animals used in migratory field trials. A) Oocytes appearing pear-shaped (arrow) that
were 5-10 days from ovulation. B) Higher magnification showing location of the plasma
membrane (PM) and yolk granules (Y). A distinct vitelline membrane (VM) with peripheral
striations, a follicular cell layer (F) intact, and vacuole build-up (V) under the vitelline membrane
indicate a pre-ovulatory oocyte. C) The left oocyte was 5-10 days from ovulation, while the
right shows a buildup of ovulatory fluid (FlOv) between the vitelline membrane and follicular
layer (F), 3-5 days from ovulation. Nucleus (N) is shown. D) A mature (ovulatory) oocyte for
reference that was taken from a female actively spawning in a nest (Cheboygan River dam,
Michigan, U.S.A.) showing a degraded follicular layer (debris at top) and symmetrical shape.
No ovulatory oocytes were observed in all animals sampled for migratory trials, Ocqueoc River,
Michigan, U.S.A. For interpretation of the references to color in this and all other figures, the
reader is referred to the electronic version of this thesis…………………..…………………….37
Figure 1-4S. Stream temperature taken during each nightly behavioural trial in the experimental
system designed to observe upstream movements of migratory female sea lamprey in relation to
-13
synthesized 3kPZS, or methanol-control. □: Trials where synthesized 3kPZS (5x10 molar [M])
was administered to the stream. ▲: Trials where methanol (vehicle) was administered to the
stream. Day temperatures were not available. Ocqueoc River, Millersburg, MI….…………….38
Figure 2-1. Nesting pair of sea lamprey showing a male (M) and female (F), as well as the male
secondary sexual characteristic known as the rope (R). Scale bar = 20 mm, Photo by C. Brant…
…………………………………………………………………………………………………...49
vi

Figure 2-2. A) Schematic of a bisected chamber used to collect lamprey-conditioned water from
the head (h) and tail (t) region of the animal following Siefkes et al. (2003), with slight
modification. The anterior end of the animal was inserted into a perforated acrylic tube (a),
securing the body with an adjustable gasket. The mid-region of the animal was suspended across
an air space divider (s), assuring no possible leakage between h and t. The posterior was inserted
into a perforated rubber tube (p), secured by an adjustable gasket. B) Schematic of basic 20 l
washing chamber that collected lamprey-conditioned water from the entire body of the animal
(b). *: Air stone, cm: centimeter…………………………………………………...…..………..51
Figure 2-3. Quantification of bile acids: 3-keto petromyzonol sulfate (3kPZS), 3-keto allocholic
acid (3kACA), petromyzonol sulfate (PZS), allocholic acid (ACA), and petromyzonamine
disulfate (PADS) from spermiating male sea lamprey using LC-MS/MS. a) Release rate
(ng/hr/g-sea lamprey) of compounds from wash water samples taken from the whole body (W; N
= 14) of individuals and from just the head region (H; N = 6). b) Concentration of compounds
from liver (L) and gill (G) tissues (ng/g-tissue), and plasma (P; ng/ml-plasma) from a sub-sample
of a (N = 12). Different lower-case letters indicate statistically significant differences between
vertical columns within each group (i.e. compound). A different upper-case letter indicates
statistically significant differences between groups of columns across compounds. Columns
indicate means ± 1 standard error (vertical bars), and were compared using Student’s t-test
(significantly different at P < 0.05). Petromyzosterol disulfate (PSDS) was not detected in
spermiating males..………………………………………………………………………………63
Figure 2-4. Quantitative Reverse Transcription PCR (QRT-PCR) analyses of gene transcripts in
the gill (G) and liver (L) tissues from pre-spermiating (PSM, N = 15) and spermiating (SM, N =
15) males. a) Transcripts of cholesterol 7 alpha-hydroxylase (CYP7A1 gene). b) CYP7A1
expression standardized by 40S ribosomal DNA. c) Transcripts of sulfotransferase family
cytosolic 1C1 (SULT1C1 gene). d) Transcripts of 40S ribosomal DNA (standard). Vertical
columns represent mean transcripts ± 1 standard error. Different lower-case letters indicate
statistically significant differences between vertical columns, which were compared using
ANOVA and post-hoc Fisher’s PLSD (significantly different at P < 0.05)………….......……...64
Figure 2-5S. Standards and primers for Quantitative Reverse Transcription PCR (QRT-PCR)
from liver and gill tissues of the sea lamprey (Petromyzon marinus). a) CYP7A1 primer design,
b) SULT1C1 primer design, c) 40S ribosomal RNA primer design. Sequencing for 5’ primer is
shown in the yellow block, sequence for TaqMan MGB probe in green block, and sequence for
3’ primer in blue block. Designed by Y-W. Chung-Davidson, Michigan State University, East
Lansing, MI, USA………………………………………………………………………....……..71
Figure 2-6S. Chemical structures of bile acids, alcohols, and steroidal derivatives of the sea
lamprey. Structure illustrations courtesy of Dr. Ke Li, Michigan State University, USA. Refer to
Table 2-4S for references regarding structure identification..………….………………….….....72

vii

INTRODUCTION TO THESIS

1

INTRODUCTION TO THESIS

Pheromone communication is often employed by animals to mediate and synchronize
their reproductive activities. Many of the reproductive strategies enabled by pheromones have
been described in aquatic vertebrate species (Hoar, 1965; Lambert and Resink, 1991; Kobayashi
et al., 2002; Li et al., 2003; Stacy, 2003). However, there are very few aquatic vertebrate species
with structurally-identified pheromone components, and fewer with identified functions of these
components or blends (Stacy, 2003). The sea lamprey (Petromyzon marinus L.) has been shown
to use pheromones to mediate migration (Teeter, 1980; Bjerselius et al. 2000), and reproduction
(Teeter 1980; Siefkes et al., 2005), with over six bile acid and bile alcohol derivatives
hypothesized to be pheromone components (Haslewood and Tokes, 1969; Li et al., 1995; 2002,
Yun et al., 2003; Sorensen et al., 2005). As a result, sea lampreys have rapidly become a model
species for studies of bile acid biosynthesis, transport pathways, and subsequent release into the
environment (Siefkes et al., 2003; Sorensen et al., 2005). In addition, related studies pertaining to
behavioral activities mediated by these compounds in aquatic environments have proliferated
(Teeter, 1980; Li et al., 1995; 2002; Siefkes et al., 2005; Johnson et al., 2009; Wagner et al.,
2006; 2009).
Once a male sea lamprey matures (spermiating), they begin to release a mating
pheromone blend that attracts sexually mature (ovulatory) females to the male sender (Siefkes et
al. 2005). The most abundant constituent of the mating pheromone has been described as 3-keto
petromyzonol sulfate (3kPZS; Li et al., 2002, Yun et al., 2003). 3kPZS is released across gill
epithelia of spermiating males (Siefkes et al. 2003), and has been shown to induce upstream
movement of ovulatory females and attract them to within proximity of a nesting male (Siefkes

2

et al., 2005; Johnson et al., 2009). 3kPZS is therefore hypothesized to function as an indicator of
male mate-readiness to the female receiver (Siefkes et al., 2005).
In-stream tests that examined immature adult (migratory) female sea lamprey indicated
that 3kPZS was capable of influencing the movements of test subjects (Johnson, 2008 PhD.
Dissertation), which was found to contradict previous studies that examined migratory female
preference response to 3kPZS in a maze (Siefkes et al. 2005). The discrepancies in the data may
be due to the fact that maze studies were conducted in the daytime when migratory sea lampreys
are less active (Applegate, 1950; Vrieze et al. 2011). Environmental variables such as natural
light/dark cycles and ranges of stream temperatures have both been shown to effect (in addition
to migratory pheromone) activity patterns of migratory lamprey (Binder and McDonald, 2008;
Wagner et al., 2009); therefore, nighttime stream testing may be more suitable when examining
behavioral activity of migratory females in relation to a pheromone component such as 3kPZS,
as it relates to natural environmental factors (Johnson and Li, 2010).
Additional evidence that 3kPZS may be a behaviorally active compound among
migratory females sea lamprey is as follows: (1) higher proportions of males arrive at spawning
grounds before females during the establishment of nesting sites, where they then release 3kPZS
(Applegate, 1950; Manion and Hanson, 1980), (2) nesting males release 3kPZS at higher rates
compared to other identified components (Siefkes et al., 2003) suggesting that 3kPZS functions
at longer distances in streams, and (3) 3kPZS is a steroid-derived compound that is stable for
over several weeks in stream water (Yun et al. 2003; K. Li, personal communication), and is
therefore capable of reaching longer distances downstream. The behavioral activities of
migratory females in relation to 3kPZS are yet to be fully characterized.

3

Therefore, in Chapter 1 of this thesis titled, “A male sea lamprey pheromone component
modulates the effect of stream temperature on upstream migration of immature females,” a
working hypothesis that 3kPZS indicates the onset of the spawning season is further examined. I
predicted that presence of 3kPZS in a stream will induce behavioral responses from migratory
females that increase their probabilities of locating mates, similar to ovulatory females (Johnson
et al., 2009). Using a proven in-stream experimental system (Siefkes et al., 2005; Johnson et al.,
2009), I examined upstream, and directional, movements of migratory-phase female sea lamprey
in relation to the presence of 3kPZS (5x10

-13

molar [M]) across a migratory season. Results

show that 3kPZS induces upstream movement of migratory-phase female sea lamprey by over
o

40% during cold (12-15 C) stream temperatures, when migratory sea lamprey are less likely to
move upstream movement (Binder and McDonald, 2008), but does not induce finer-scale
movement towards or around the source of 3kPZS. The result suggests an additional function of
3kPZS, dependent upon the life history phase of the sea lamprey. Presence of 3kPZS in streams
may function to stimulate upstream movement of migratory-phase female sea lamprey during
otherwise inactive periods by modulating the effects of cold stream temperatures, perhaps as an
adaptive behavior that increases the likelihood of females locating spawning grounds and mating
successfully. Chapter 1 is currently in preparation for its submittal to Animal Behaviour, and is
therefore written in accordance with the guide for authors.
While the current understandings of the functions of pheromone components from sea
lamprey have been advanced throughout the past decade through stream behavioral testing
(Johnson and Li, 2010), the biochemical pathways, regulation, and release mechanisms of
pheromone components have only begun to be elucidated (Siefkes et al., 2003; Venkatachalam et

4

al., 2004; Venkatachalam, 2005). Understanding these processes will further elucidate the
function and regulation of these components of the sea lamprey pheromone.
In Chapter 2, “Production and selective release of bile acids by the adult male sea
lamprey (Petromyzon marinus L.),” I hypothesized that the system for biosynthesis, transport,
and release of multiple components of the mating pheromone, based on what has been described
with release studies examining 3kPZS (Siefkes et al., 2003), is dramatically up-regulated during
or after sexual maturation of male sea lamprey. I predicted that male sea lamprey produce steroid
derived pheromone components from cholesterols in the liver, only after reaching sexual
maturity. Additionally, I predicted that the final stages of biosynthesis and release of the novel
component 3kPZS occurs in their gill epithelia cells before release. Using analytical techniques, I
discovered that the production and transport of multiple bile acids and bile alcohols occurs
specifically after sexual maturation in male sea lamprey, and several components, previously
thought only to be released by larval sea lamprey, are released by sexually mature males from
gills. Finally, I present evidence that the final conversion of petromyzonol sulfate (PZS) into
3kPZS likely occurs in the gills, and this final conversion is likely necessary for the selective
release of 3kPZS into the environment once a male matures. Chapter 2 is written in accordance
with the guide for authors for Journal of Chemical Ecology, and is currently in preparation for
that journal.
The studies presented in this thesis support further characterization of the biosynthesisthrough-biological functions of 3kPZS and other compounds unique to sea lamprey.
Additionally, 3kPZS and other compounds continue to show potential in terms of designing
pheromone-based control methods of the non-indigenous sea lamprey in the Laurentian Great

5

Lakes (Twohey et al., 2003; Li et al., 2007), a major goal of the Great Lakes Fishery
Commission and partners.

6

REFERENCES

7

REFERENCES

Applegate, V. C, 1950. The natural history of the sea lamprey (Petromyzon marinus) in
Michigan, Washington: U.S Department of the Interior Fish and Wildlife Service, Special
Scientific Report, No. 55.
Binder, T. R. and McDonald, D. G. 2008. The role of temperature in controlling diel activity in
upstream migrant sea lampreys (Petromyzon marinus). Canadian Journal of Fisheries
and Aquatic Sciences, 65, 1113-1121.
Bjerselius, R., Li, W., Teeter, J. H., Seelye, J. G., Johnsen, P. B., Maniak, P.J, Grant, G. C.,
Polkinghorne, C. N., and Sorensen, P. W. 2000. Direct behavioral evidence that unique
bile acids released by larval sea lamprey (Petromyzon marinus) function as a migratory
pheromone. Canadian Journal of Fisheries and Aquatic Sciences, 57, 557-569.
Haslewood, G. A. D. and Tokes, L. 1969. Comparative studies of bile salts: Bile salts of the
lamprey Petromyzon marinus L. Journal of Biochemistry, 114, 179-184.
Hoar, W. S. 1965. Comparative physiology: Hormones and reproduction in fishes. Annual
Review of Physiology, 27, 51-70.
Johnson, N. S. and Li, W. 2010. Understanding behavioral responses of fish to pheromones in
natural freshwater environments. Journal of Comparative Physiology A, 196, 701-711.
Johnson, N. S. 2008. In-stream behavioral responses of female sea lampreys to pheromone
components. Ph.D. East Lansing, MI: Michigan State University.
Johnson, N. S., Yun, S-S., Thompson, H. T., Brant, C. O., and Li, W. 2009. A synthesized
pheromone induces upstream movement in female sea lamprey and summons them into
traps. Proceedings of the National Academy of Sciences of the United States of America,
106, 1021-1026.
Kobayashi, M., Sorensen, P. W., and Stacey, N. E. 2002. Hormonal and pheromonal control of
spawning behavior in the goldfish. Fish Physiology and Biochemistry, 26, 71-84.
Lambert, J. and Resink, J. 1991. Steroid glucuronides as male pheromones in the reproduction of
the African catfish Clarias gariepinus - a brief review. The Journal of Steroid
Biochemistry and Molecular Biology, 40, 549-556.
Li, W., Twohey, M., Jones, M., and Wagner, C. M. 2007. Research to guide use of pheromones
to control sea lamprey. Journal of Great Lakes Research, 33, 70-86.
Li, W., Sorensen, P. W. and Gallaher, D. 1995. The olfactory system of migratory adult sea
lamprey (Petromyzon marinus) is specifically and acutely sensitive to unique bile-acids
released by conspecific larvae. Journal of General Physiology, 105, 569-587.
8

Li, W., Scott, A. P., Siefkes, M. J., Yan, H., Liu, Q., Yun, S-S., and Gage, D. A. 2002. Bile acid
secreted by male sea lamprey that acts as a sex pheromone. Science, 296, 138-141.
Li, W., Scott, A. P., Siefkes, M. J., Yun, S-S., and Zielinski, B. 2003. A male pheromone in the
sea lamprey (Petromyzon marinus): An overview. Fish Physiology and Biochemistry, 28,
259-262.
Li, W. 2005. Potential multiple functions of a male sea lamprey pheromone. Chemical Senses,
30, I307-I308.
Manion, P. J. and Hanson, L. H. 1980. Spawning behavior and fecundity of lampreys from the
upper three Great Lakes. Canadian Journal of Fisheries and Aquatic Sciences, 37, 16351640.
Siefkes, M. J., Scott, A. P., Zielinski, B., Yun, S-S., and Li, W. 2003. Male sea lampreys,
Petromyzon marinus L., excrete a sex pheromone from gill epithelia. Biology of
Reproduction, 69, 125-132.
Siefkes, M. J., Winterstein, S. R. and Li, W. 2005. Evidence that 3-keto petromyzonol sulphate
specifically attracts ovulating female sea lamprey, Petromyzon marinus. Animal
Behaviour, 70, 1037-1045.
Sorensen, P. W., Fine, J. M., Dvornikovs, V., Jeffery, C. S., Shao, F., Wang, J., Vrieze, L. A.,
Anderson, K. R. and Hoye, T. R. 2005. Mixture of new sulfated steroids functions as a
migratory pheromone in the sea lamprey. Nature Chemical Biology, 1, 324-328.
Stacey, N. 2003. Hormones, pheromones and reproductive behavior. Fish Physiology and
Biochemistry, 28, 229-235.
Teeter, J. 1980. Pheromone communication in sea lampreys (Petromyzon marinus): Implications
for population management. Canadian Journal of Fisheries and Aquatic Sciences, 37,
2123-2132.
Twohey, M., Sorensen, P. W., and Li, W. 2003. Possible applications of pheromones in an
integrated sea lamprey management program. Journal of Great Lakes Research, 29, 794800.
Venkatachalam, K. V., Llanos, D. E., Karami, K. J., and Malinovskii, V. A. 2004. Isolation,
partial purification, and characterization of a novel petromyzonol sulfotransferase from
Petromyzon marinus (lamprey) larval liver. Journal of Lipid Research, 45, 486-495.
Venkatachalam, K. V. 2005. Petromyzonol sulfate and its derivatives: The chemoattractants of
the sea lamprey. BioEssays, 27, 222-228.
Vrieze, L. A., Bergstedt, R. A. & Sorensen, P. W. 2011. Olfactory-mediated stream-finding
behavior of migratory adult sea lamprey (Petromyzon marinus). Canadian Journal of
Fisheries and Aquatic Science, 68, 523-533.
9

Wagner, C. M. Jones, M. L., Twohey, M. B. & Sorensen, P. W. 2006. A field test verifies that
pheromones can be useful for sea lamprey (Petromyzon marinus) control in the Great
Lakes. Canadian Journal of Fisheries and Aquatic Sciences, 63, 475-479.
Wagner, C. M., Twohey, M. B. & Fine, J. M. 2009. Conspecific cueing in the sea lamprey: do
reproductive migrations consistently follow the most intense larval odour? Animal
Behaviour, 78, 593-599.
Yun, S-S., Scott, A. P., and Li, W. 2003. Pheromones of the male sea lamprey, Petromyzon
marinus L.: Structural studies on a new compound, 3-keto allocholic acid, and 3-keto
petromyzonol sulfate. Steroids, 68, 297-304.

10

CHAPTER 1

A MALE SEA LAMPREY PHEROMONE COMPONENT MODULATES THE EFFECT OF
STREAM TEMPERATURE ON UPSTREAM MIGRATION OF IMMATURE FEMALES

11

ABSTRACT

This study examines whether a male-released sea lamprey (Petromyzon marinus L.)
mating pheromone modulates the effects of temperature on behaviours of immature female
conspecifics during their spawning migration. Mature (spermiating) male sea lamprey secrete a
sex pheromone, 3-keto petromyzonol sulfate (3kPZS), that indicates mate-readiness and attracts
mature (ovulatory) females to the male sender. 3kPZS may influence behaviors of immature
(migratory) females over long distances in streams, based on the high rate of release by males
and stability of 3kPZS in stream water. Here, we determined: (1) whether upstream movement of
migratory females changes in the presence or absence of 3kPZS over a wide range of
temperatures, and (2) whether migratory females will change directions towards the source of
3kPZS once they arrive upstream. Using an in-stream bioassay, we showed that the proportion of
migratory females that moved upstream increased by over 40% in cold stream temperatures
-13

(~14.5oC) when 3kPZS (5x10

M) was consistently administered into the stream (ANCOVA:

F1,12 = 7.02, P = 0.021). The effects of 3kPZS and temperature on upstream movement were no
o

longer distinguishable in warmer stream temperatures (>16 C). Migratory females that moved
upstream did not change their direction towards the odorant source when 3kPZS was
administered, but did so when a migratory pheromone blend (extracted from larval sea lamprey)
was administered, indicating a general upstream response induced by 3kPZS. 3kPZS appears to
function in multiple ways, dependent upon the phase of life history of receiving females, to
synchronize reproduction in the sea lamprey.

12

INTRODUCTION

Many aquatic animals utilize pheromones to relay and/or acquire information regarding
mate readiness (Stacey 2003) or certain environmental qualities (Donahue 2006). The
semelparous sea lamprey (Petromyzon marinus L.) relies largely upon both migratory (Teeter
1980; Bjerselius et al. 2000; Sorensen et al. 2003) and mating (Teeter 1980; Li et al. 2002)
pheromones to coordinate their reproductive activities (Manion & Hanson 1980). This species is
a model for characterizing pheromone communication in aquatic vertebrates (Li 2005).
However, studies that have aimed to further characterize activity patterns of sea lamprey in
relation to pheromone components have rarely considered the impact of environmental
conditions; due to the limitations of laboratory testing (Johnson & Li 2010).
During migration, upstream movements of female sea lamprey are influenced by stream
temperatures (Beamish & Potter 1975; Binder & McDonald 2008; Wagner et al. 2009), and a
migratory pheromone (Teeter 1980; Bjerselius et al. 2000; Sorensen et al. 2005; Wagner et al.
2009). Sea lampreys do not home to natal streams (Bergstedt & Seelye 1995; Waldman et al.
2008), but instead have been shown to enter and ascend tributaries based upon the presence and
intensity of larvae-released odours upstream (Teeter 1980; Wagner et al. 2009). In controlled
laboratory settings, locomotor activity of immature adult (migratory, herein) female sea lamprey
is reduced as temperatures decrease, until inactivity occurs below 10o C (Binder and McDonald
2008). In streams, the frequency of upstream movement of migratory female sea lamprey in the
presence of the migratory pheromone is reduced during cold temperatures (Wagner et al. 2009).
Temperature-induced behaviours are proposed to represent an adaptive behaviour in sea lamprey
that increases the probability of females reaching spawning grounds across a narrow thermal
range for successful embryonic development and reproduction (Binder & McDonald 2008).
13

During the spawning season, a sulfated bile alcohol: 7α, 12α, 24-trihydroxy 5α-cholan-3one 24-sulphate (3-keto petromyzonol sulphate or 3kPZS; Li et al. 2002; Yun et al. 2003) a
major constituent of the mating pheromone blend released by mature (spermiating, herein) male
sea lamprey (Siefkes et al. 2005; see Li et al. 2003; Li 2005 for review). Siefkes et al. (2005)
and Johnson et al. (2006) used a stream behavioural bioassay to show preference responses of
mature (ovulatory, herein) females to 3kPZS; including directional changes towards the odorant
source and odorant plume tracking behaviours, respectively. Further, Johnson et al. (2009)
showed that synthesized 3kPZS alone was capable of drawing ovulatory females past natural
spermiating male odorants, and into baited riverine traps, confirming that greater concentrations
of 3kPZS could be distinguished from the whole male pheromone blend by female conspecifics.
Accordingly, the selectivity of olfactory receptors to 3kPZS was shown in female sea lamprey
based on electro-olfactographic recordings by Siefkes & Li (2004).
Males often aggregate at upstream spawning grounds in streams where migration is still
occurring (Applegate 1950; Manion & Hanson 1980). Once males reach maturity, they release
3kPZS and other compounds (Siefkes et al. 2003) to attract mates. Based on the high release rate
-1

of 3kPZS by spermiating males (~0.5 mg hr ) compared to other compounds (Li et al. 2002;
Siefkes et al. 2003), it seems likely that 3kPZS functions as a long distance chemical cue, that
my influence behaviours of migratory female conspecifics. Recent behavioral tests that examined
migratory female sea lamprey indicated that 3kPZS was capable of influencing upstream
movements of test subjects (Johnson 2008: PhD. Dissertation), which was a contradictory result
to previous studies that examined migratory female preference responses to 3kPZS in a
laboratory maze (Siefkes et al. 2005). The discrepancies in the data may be due to the fact that
laboratory maze studies were conducted in the daytime when migratory sea lamprey are less

14

active (Applegate 1950; Vrieze et al. 2011), while stream tests were conducted at night where
migration occurs naturally (Vrieze et al. 2011), and thermal ranges can be examined for a
behavioural influence on migratory activity (Binder and McDonald 2008).
Here, we hypothesize that 3kPZS influences behaviours of migratory female sea lamprey
in similar fashions (with slight modification, since migratory females are not ready to mate) to
those documented in ovulatory females (Siefkes et al. 2005; Johnson et al. 2006: 2009). We
examined two questions using stream bioassays: (1) Does 3kPZS increase the upstream
migratory movement of the female sea lamprey at low stream temperatures (Binder and
McDonald 2008); and (2) Do migratory female sea lamprey actively approach 3kPZS sources in
the stream similar to ovulatory females (Siefkes et al. 2005; Johnson et al. 2009). Our results
show that 3kPZS modulates the effects of cold stream temperatures on upstream movement of
migratory female sea lamprey; whereby, test subjects moved upstream in the presence of 3kPZS
during cold stream temperatures, but did not locate the 3kPZS source.

15

METHODS

Sea lamprey
All procedures involving sea lamprey were conducted in accordance with our Animal
Use Form number 05-09-088-00, which was approved by the Michigan State University
Institutional Animal Care and Use Committee prior to the start of the study. Migratory sea
lamprey were captured by the United States Fish and Wildlife Service throughout tributaries to
Lake Michigan, Lake Superior, and Lake Huron, U.S.A., in May-June 2009 and transported to
the United States Geological Survey-Hammond Bay Biological Station (HBBS). Females were
separated from males by applying gentle pressure to the abdomen and feeling for eggs. Their sex
was later confirmed during surgical tagging procedures. Males were removed since only females
were released for testing during this study. Females were held in 500-1000 litre-capacity flow
through tanks at HBBS until use.
To confirm that test sea lamprey were pre-ovulatory, eight females were randomly
selected on 17-May and 1-June, and 10 females were selected on 11-June-2009, and sacrificed
for dissection. Samples of oocytes were collected from the posterior, medial, and anterior
locations of the ovary. Oocytes were fixed in a 4% paraformaldehyde solution and placed in 4oC
until sectioning and hemotoxylin and eosin staining. Histological examination showed that all
oocytes sampled were pre-ovulatory according to Applegate (1951), Lewis and McMillan
(1965), and Yorke and McMillan (1980): see Figure 1-3S.

16

PIT tagging
A 23 mm-long half duplex passive integrated transponder (PIT) tag (Oregon RFID,
Portland, Oregon, U.S.A.) was surgically implanted into each experimental animal through a 2-3
mm lateral incision in the mid-abdominal region. The incision was sealed with tissue adhesive
(n-butyl cyanoacrylate, Vetbond; Minnesota Mining and Manufacturing, St. Paul, Minnesota,
U.S.A.) immediately after PIT tag insertion. No anesthesia was used in this process to avoid the
potential disruptive nature of common fish anesthetics to olfactory-mediated behaviours (Losey
& Hugie 1994). The procedure typically took less than 30 seconds. Implanted animals were
immediately transferred into aerated holding tanks with a constant flow of Lake Huron water for
up to 24 hours, until they were stocked into stream acclimation cages. Tagged individuals were
monitored throughout the day for signs of distress or mortality. Mortality was not observed
during laboratory or stream acclimation.

Test odorants
Permission to administer 3kPZS into the stream was obtained from the United States
Environmental Protection Agency via experimental use permit 75437-EUP-2. 3kPZS was
custom synthesized by Bridge Organics (Vicksburg, Michigan, U.S.A.; purity >97%) in 2007,
and stored at -80oC. An analysis was conducted on 13-March-2009 to confirm 3kPZS purity was
maintained before stream testing. The purity was determined by dissolving 0.538 mg of 3kPZS
in a 1-ml mixture of 50:50 acetonitrile:water (v:v), and then subjecting 20 µl of the solution to
high performance liquid chromatography (HPLC; Waters ACQUITY, Milford, Massachusetts,
U.S.A) coupled with an evaporative light scattering detector (ELSD, Waters). Nuclear magnetic
resonance (1H NMR) was used to confirm the chemical structure of 3kPZS. From the analysis,

17

the purity was found to be greater than 95% prior to stream testing. A 10 mg ml-1 stock solution
of synthesized 3kPZS (in 100% methanol) was prepared, vortexed (Vortex Genie 2, Daigger,
Vernon Hills, Illinois, U.S.A.), and transferred into five vials of 10-ml aliquots, each. 3kPZS
stock solution was stored at -80oC until use.
Extracted larval odour, presumably containing all larval pheromone components, was
used as a positive control to validate the experimental system. Larval extracts have been shown
to induce strong swimming directional changes towards the odorant source from migratory
female sea lamprey during past studies (Bjerselius et al. 2000; Wagner et al. 2009). Methods of
extraction followed those by Fine et al. (2006), with slight modification. Over 20 000 larval sea
lamprey were held in flowing 500 litre-capacity tanks at HBBS for collection of larval
pheromone extracts from April-August 2008. Larvae were fed yeast on a weekly basis, and
given a sand substrate for refuge. Tank flows were shut off at night allowing larval pheromone
to accumulate. The larval-conditioned water was then passed through vertical columns
containing 500 g of methanol-activated Amberlite XAD7HP resin (Sigma-Aldrich, St. Louis,
Missouri, U.S.A.) using peristaltic pumps (Cole-Parmer, Vernon Hills, Illinois, U.S.A). Loading
-1

speed was ~300 ml min . Three or more columns were loaded for up to 24 hours at a time. Each
column was then eluted with 4-l of methanol and eluants were concentrated using a model R-210
roto-evaporator (Buchi Rotovapor, Flawil, Switzerland) and stored at -80o C. All larval extracts
were fully thawed, pooled, and thoroughly mixed before further analyses were conducted.
Petromyzonamine disulfate (PADS), a component of larval extract with known chemical
structure (Sorensen et al. 2005), was used as a benchmark compound when calculating the
volume of extract to consistently apply to the stream. The concentration of PADS was
determined using high performance liquid chromatography–tandem mass spectrometry (HPLC-

18

-1

MS/MS). For reference, the PADS concentration was found to be 183.3 µg l in the larval
extract batch used (2008 batch).

Experimental site for behavioral tests
The experimental site consisted of a 250-m section of the Upper Ocqueoc River located
in Millersburg, Michigan, U.S.A (T35N, R3E, Sec. 27). The upper reaches of the Ocqueoc River
were historically infested with nesting sea lamprey (Applegate 1950). Wild populations of sea
lamprey are now physically barred from entering the Upper Ocqueoc River due to the Ocqueoc
Lake dam located ~20 km downstream. The first 45-m of the site was divided by a natural island,
which separated two sub-channels of similar hydrologic and physical qualities (Figure 1-1). Any
potential water leakage between the two sub-channels was prevented by the placement of sand
bags. Test odorants were administered from a fixed point in the stream at the upstream end of
each sub-channel. Two copper wire PIT antennas roughly 0.5 m-high x 6 m-long independently
transected the mouth of each sub-channel at their downstream confluence. Each antenna was
positioned to transect the mouth of each respective sub-channel, positioned perpendicular to the
stream bed. Antennas were tuned to a sensitivity of roughly 0.3 m from upstream and
-1

downstream directions, and scan frequencies were roughly three scans sec. . Downstream 205m from the transecting antennas was an animal acclimation and release point at a fixed location
in the centre of the stream.

19

Figure 1-1. The section of the Upper Ocqueoc River, Millersburg, MI, U.S.A. (T35N, R3E, Sec.
27) used as the in-stream experimental system for observing upstream movement of migratory
phase female sea lamprey in relation to male-released pheromone component 3kPZS. (a) Full
250 m-long section showing release point. (b) Close-up of system showing naturally bisected
sub-channels with respective right channel (OR) and left channel (OL) odorant administration
points (red boxes). Odorants were alternated in each sub-channel per trial. At the downstream
confluence of the bisected channels, copper wire antennas recorded proportions of PIT-tagged
animals moving into either the right (AR) or the left (AL) sub-channels. Scale bars, 25 m.

20

Details of treatments and trials
A latex tube was fixed to the bottom of the stream bed at the upstream end of each subchannel. Test odorants were diluted with 30 l of river water in large mixing bins. Bins were
kept consistent for each test odorant to reduce the potential for contamination during dilution.
Each solution was pumped into respective sub-channels through separate latex tubes at constant
-1

-1

rates of 167 ml min (±5 ml min ) over the span of three hours using peristaltic pumps
(Masterflex 7553-70, Cole-Parmer, Vernon Hills, Illinois, U.S.A.). A test odorant was
administered to one sub-channel (activated channel, herein) while an equal volume of methanol
was administered into the adjacent sub-channel (control channel, herein), and the activated and
control channels were alternated each trial to minimize channel bias. Test odorants included; (1)
-13

synthesized 3kPZS (5x10

M) administered into one sub-channel (methanol into the adjacent
-14

sub-channel), (2) larval extract (5x10

M PADS) administered into one sub-channel (methanol

into the adjacent sub-channel), and (3) full negative control (methanol into both sub-channels).
Stream velocity was taken every three days, or after every precipitation event, at a fixed location
in the stream using a Marsh-McBirney portable flow meter (Flo-Mate 2000, Fredrick, Maryland,
U.S.A.) to determine the volume of odorant to apply to the stream and maintain consistent
-1

concentrations across trials. Stream velocity ranged from 0.5 – 1.0 m sec with an average of
-1

-1

0.78 m sec (X + SE = 0.78 + 0.018 m sec ; N = 50).
Trials were conducted between 13-May and 11-June, 2009, at night when migrating sea
lamprey are most active (Applegate 1950). A total of 21 full negative control trials, 16
synthesized 3kPZS trials, and four larval extract trials were conducted throughout the study. Up
to two trials were conducted each night, depending upon animal availability. Twenty or 30 PITtagged sea lamprey were removed from holding tanks at HBBS and transported to their
21

respective stream acclimation cage between 0300-0500 hours (h) each night. Whether 20 or 30
animals were stocked and released per trial depended upon animal availability; however, the
number of test animals stocked was consistent between early and late trials within each night.
Early trial animals were held independently from late trial animals, in identical
acclimation/release cages. Animals were then allowed an acclimation period in the stream of
more than 15 hours, prior to a trial. No mortality occurred during acclimation. Acclimation
3

cages were solid aluminum and stainless steel (~0.25 m ), consisting of a sliding door that was
removed manually upon release. Each trial was three hours long. The early trial was conducted
from roughly 2020 h (starting at sundown) through 2320 h, and a late trial could then be run
from roughly 0010 h through 0310 h.
At the start of each trial, the stream gauge height and stream temperature were recorded.
Stream temperatures ranged from 12.4 – 23.0oC, and average stream temperature during early
trials was slightly greater than that of late trials (X+SE = 17.2 + 0.5oC and X+SD = 15.6 + 0.6oC,
respectively). Stream gauge height ranged from 0.51 – 0.62 m with an average of 0.56 m (X+SE
= 0.56 + 0.005 m; N = 50). The average rate of stream temperature decrease from early to late
-1

-1

trials was 2oC hour (X+SE = 1.99 + 0.13oC hour ). The distribution of stream temperatures
across dates can be seen in Figure 1-4S. In the first hour of each trial, the test odorant was
administered to the stream allowing the current to carry the compound to the downstream
acclimation cage prior to the release of test animals. At the start of the second hour, 20 – 30 PITtagged females were released. During the remaining two hours, animals were free to swim
throughout the experimental system while odorants were administered.
The second trial started 30 minutes after the first. Test odorants were kept consistent for
each night of trials (i.e. if 3kPZS was tested during the early trial, 3kPZS was also tested during
22

the late trial to prevent the possibility of any unwanted contamination from other test odorants).
All equipment was thoroughly rinsed with stream water prior to a new trial. No animals were
recovered from the stream after a trial. Movement data was consolidated and stored using a
multiplexor (Oregon RFID, Portland, Oregon, U.S.A.). Data was uploaded each trial night using
a hand-held Meazura model MEZ1000 personal digital assistant (Aceeca International Limited,
Christchurch, New Zealand).
Throughout the study season, all handling, transportation, lengths of stream acclimation
periods of test subjects, and the concentration of test odorants applied to the stream remained
consistent across all trials to minimize the chances of abnormal behaviours due to animal
treatment.

Water sampling
Water samples were collected on 10-12 June 2009 during this study for analytical
confirmation of in-stream 3kPZS concentrations during a trial, and to confirm that no natural
3kPZS was currently in the system. For each sampling event, triplicate 1-l samples were
collected from a fixed location upstream of the odorant source point, and from downstream at the
acclimation/release site, during 3kPZS trials. Analytical methods to determine 3kPZS
concentrations from stream water were similar to those used by Fine and Sorenson (2005) for the
quantification of closely related sea lamprey produced compound petromyzonol sulfate (PZS) in
-1

streams. Each sample was immediately spiked with 5 ng ml (dissolved in 100 µl methanol) of
2

5-deuterated 3kPZS internal standard ([ H5]3kPZS; Bridge Organics, Vicksburg, MI, U.S.A.)
and placed in -80oC. 3kPZS was extracted from stream water with high recovery rates (> 90%)
using solid phase extraction (single cation-exchange and reversed-phase mixed-mode cartridge;
23

Oasis MCX, Waters, Milford, Massachusetts, U.S.A.). Final quantification was accomplished
using ultrahigh performance liquid chromatography-tandem mass spectrometry (UHPLC-1

MS/MS). The limit of detection was acceptably small (< 0.1 ng l ). The experimental system
was confirmed to be clear of any natural 3kPZS upstream of the field site and downstream of the
odorant source prior to the start of a trial. 3kPZS was shown to reach the acclimation cage area
of the site (250 m downstream) within one hour of active pumping, which confirmed that the
acclimating animals were exposed to 3kPZS before their subsequent release. Further, in-stream
-13

concentrations of 3kPZS were shown to be acceptable (X+SE = 5.76x10
-13

3kPZS, N = 9), in relation to our target stream concentration of 5x10

+ 7.65x10

-14

M

M 3kPZS (Xi et al. in

review).

Data analysis
Two main response variables from migratory female sea lamprey were examined in
relation to the presence of test odorants: (1) the proportion of released animals that swam
upstream (205 m) to the confluence of the two sub-channels, and (2) the proportion of upstream
animals that entered the activated sub-channel. Since we administered methanol into both subchannels for full negative control trials, we randomly assigned a sub-channel to be the
“activated” channel for each of these trials during statistical analyses. When methanol was
administered to both sub-channels during full negative control trials, the right-facing sub-channel
(facing upstream) was randomly assigned as “activated” for the first trial conducted, and
alternated between sub-channels for all trials thereafter.
An analysis of covariance (ANCOVA, α = 0.05) based on a generalized linear model was
used to test whether certain factors had an influence on the response variables of interest in
24

relation to odorant treatments. The multiple mixed factors that were examined included: (1)
stream gauge height, (2) date, (3) stream temperature, (4) rate of decreasing stream temperature
per trial, (5) time of trial, and (6) the number of animals released per trial. Models incorporating
mixed and fixed factor effects were constructed to compare residual log likelihood (LogLik) and
AIC values using SAS statistical software (SAS Incorporated, Cary, North Carolina, U.S.A.;
Table 1-1S). Differences of least squares means (unpaired t-test, α = 0.05) of the proportion of
animals moving upstream per trial were compared at the lower, median, and upper quartiles of
covariate-temperature (14.5, 17.5, and 19.5oC, respectively) to examine the interaction between
the upstream movement of test subjects and stream temperatures. Slopes of regression lines for
3kPZS and negative control trials were compared to a slope of zero, and to each other, using an
unpaired t-test (α = 0.05).

25

RESULTS

Upstream movement of migratory females in the presence of odorants
-1

The rate of stream temperature decrease per trial (oC hr ), stream gauge height (m), time
of trial (early or late), or the number of migratory females released per trial (20-30) did not
influence the proportion of migrating females moving upstream across trials in our experimental
system (ANCOVA: F1,10 = 0.97, P = 0.348; F1,12 = 0.42, P = 0.530; F1,11= 0.01, P = 0.919; F1,
12 =

0.40, P = 0.540, respectively), and were therefore removed from the final model. The final

model considered the effect of test odorant or stream temperature independently, and the
interaction between the two, for best explaining the variability in the proportion of migratory sea
lamprey moving upstream across trials. Statistical fitness values were lowest in this final model
(AIC = -6.2, logLik = -12.2; Table 1-1S). Stream temperature across all trials can be seen in
Figure 1-4S.
An average proportion of 0.61 (X+SE= 0.61+0.21, n = 233) of total released migratory
females (N = 380) moved upstream to the confluence during 3kPZS trials. Full negative control
trials showed an average proportion of 0.45 (X+SE= 0.45+0.13, n = 239) of released migratory
females (N = 500) that moved upstream to the confluence of the sub-channels. When synthesized
3kPZS was administered to the stream, greater proportions of released migratory females moved
upstream compared to full control trials (ANCOVA: F1, 12 = 9.17, P = 0.012). Specifically
during low stream temperatures (~14.5o C), higher proportions of migratory females moved
upstream during 3kPZS trials (ANCOVA: F1,12 = 7.02, P = 0.021), compared to methanolcontrol trials (Figure 1-2, and herein). The slope of the regression line corresponding to 3kPZS
2

trials (m = 0.03, R = 0.14) was not different from zero, while that of full control trials (m = 0.1,
26

2

R = 0.70) were different from zero (independent t-test: t10 = -1.87, P = 0.091; t10 = -2.88, P =
0.016, respectively). Further, the slopes of the 3kPZS and full control regression lines were
different from one-another (independent t-test: t12 = -2.65, P = 0.021).
During larval extract trials, an average proportion of 0.53 (X+SE= 0.53+0.30, n = 63) of
total released migratory females (N = 119) moved upstream 205 m to the confluence of the subchannels. There was no difference between larval extract mean swim-up proportions across
trials compared to full negative control or 3kPZS trials (ANCOVA: F2,12 = 2.29, P = 0.144).

27

1.00

Total proportion

0.80

0.60

0.40

0.20

0.00

Stream temperature (oC)
Figure 1-2. Effects of a pheromone component (3kPZS) on the proportion of migratory female
o
sea lamprey that swam upstream across stream temperatures between 12.4 – 23.0 C. □: Trials
-13
where synthesized 3kPZS (5x10 molar [M]) was administered to the stream. ▲: Trials where
methanol (vehicle) was administered to the stream. The solid regression line represents methanol
trials (R² = 0.70), and the dashed regression line represents 3kPZS trials (R² = 0.14). Trials were
conducted at night in the Upper Ocqueoc River, Millersburg, Michigan, U.S.A.

28

Directional responses to odorant sources
Of the test animals that moved upstream during 3kPZS trials, an average proportion of
0.42 (X+SE= 0.42+0.24, n = 95) moved into the respective 3kPZS-activated sub-channel.
During full negative control treatments, a proportion of 0.53 (X+SE= 0.53+0.29, n = 117)
entered the randomly assigned ‘activated’ sub-channel. Full negative control and 3kPZS trials
did not differ in terms of migratory female directional responses (ANCOVA: F1,12 = 0.09, P =
0.774). Of the migratory females that moved upstream during larval extract trials, an average
proportion of 0.86 (X+SE= 0.86+0.17, n = 55) entered the respective larval extract activated subchannel; which in turn, was a much greater mean proportion when compared to 3kPZS and
control trials (ANCOVA: F2,15 = 18.99, P < 0.0001).

29

DISCUSSION

We showed that a male pheromone component 3kPZS increases the tendency of
migratory female sea lampreys to move upstream at temperatures that typically are associated
with low upstream movement. The results of this study demonstrate that 3kPZS in streams likely
functions to induce upstream movement of migratory-phase female sea lamprey during otherwise
inactive periods by modulating the effects of cold stream temperatures. The upstream response
induced by the migratory pheromone is complimented by male released 3kPZS (Sorensen &
Stacey 2004). This is likely an adaptive behavior, which increases the likelihood that females
locate spawning grounds and mate successfully across a narrow thermal range. Our results
confirm laboratory work by Binder and McDonald (2008) and a field experiment by Wagner et
al. (2009) regarding temperature-induced effects on activity patterns of migratory sea lamprey.
Furthermore, our discovery implicates that a single component of a pheromone (3kPZS) is
capable of an aggregatory function in female sea lamprey (Sorensen & Stacey 2004) to spawning
grounds during an immature phase, as well as a mating function to mates once maturation is
reached (Li et al. 2002; Siefkes et al. 2005; Johnson et al. 2006; 2009).
The release of natural 3kPZS by male sea lamprey specifically after sexual maturation (Li
et al. 2002; Siefkes et al. 2003), along with the robust attraction of ovulatory female sea lamprey
to the male-sender (Siefkes et al. 2005; Johnson et al. 2006; 2009), indicates that 3kPZS signals
the onset of mate-readiness to females. In our study, migratory females that were several days
away from ovulation showed increased tendencies to move upstream, but did not change their
direction towards 3kPZS odorant sources by entering the 3kPZS activated channel. It is not
surprising that female sea lamprey with pre-ovulatory oocytes did not show behaviors typical of
mate searching (see; Siefkes et al. 2005; Johnson et al. 2009), as females at this stage are not
30

ready to engage in spawning activities with a mate. An increase in activity of migratory female
sea lamprey in the presence of 3kPZS is contradictory to previous maze studies described by
Siefkes et al. (2005), which found no observable preference or response. The discrepancies
between maze and stream data are likely due to the fact that maze studies were conducted in the
daytime, when migratory female sea lampreys remain inactive, while stream studies were
conducted at night where migration occurs naturally (Applegate 1950; Vrieze et al. 2011).
Environmental variables such as natural light/dark cycles and ranges of stream temperatures have
both been shown to effect (in addition to migratory pheromone) activity patterns of migratory
lamprey (Binder and McDonald, 2008; Wagner et al., 2009); therefore, nighttime stream testing
is more suitable when examining behavioral activity of migratory females in relation to a
pheromone component such as 3kPZS, as it relates to natural environmental factors (Johnson and
Li, 2010).
In this study, we provide an example of how a single component, 3kPZS, likely
compliments the migratory pheromone to the advantage of the female receiver, both during the
migratory and spawning phase of life history. 3kPZS likely functions as public information to
migratory females regarding their downstream distance from spawning grounds, and serves as an
aggregatory pheromone at this stage. Aggregatory pheromones are common among teleost
fishes, and often this form of communication is learned or kin-related for the synchronization of
reproduction (Stacey 2003; Sorensen & Stacey 2004). 3kPZS is likely inducing an adaptive
behavior in migratory females to increase their tendency to move upstream during cold stream
temperatures, continue direct upstream movement to aggregate around spawning grounds, and
increase their probabilities of successfully reproducing once females mature.

31

Finally, many teleost fish species respond to odours from conspecifics by showing
hormonal changes that promote maturation of gametes (Liley 1982; Stacey & Sorensen 2002;
Sorensen & Stacey 2004). These changes are induced by primer pheromones, which we define in
this manuscript as chemicals released by one species that induce slow physiological or
developmental changes to the receiving individual (Wilson 1970). Endocrine responses to
pheromones have been confirmed in goldfish (Carassius auratus) and in male sea lamprey
(Stacey et al. 1989; Stacey 2003; Chung-Davidson et al. 2008). In goldfish, females release
andostenedione (AD) and a 4-pregnen-17,20β-dihydroxy-3-one (17,20βP) almost exclusively
across the gills (Sorensen & Stacey 2004). 17,20βP has been shown to induce hormonal changes
in conspecific male goldfish and increase sperm and seminal fluid production (DeFraipont &
Sorensen 1993; Sorensen & Stacey 2004). It is likely that 3kPZS acts as a primer pheromone in
sea lamprey, similar to priming seen in goldfish. Migratory female sea lamprey would benefit to
continue upstream migration, aggregate around areas of 3kPZS concentrations, and reach sexual
maturity during a narrow thermal range before death. Once mature within areas of mate-ready
males, females increase their probabilities of successful reproduction. It would be interesting to
further test these theories using in-stream and molecular studies, and further characterize
aggregation and priming functions of 3kPZS in migratory female sea lamprey (Stacey 2003;
Sorensen & Stacey 2004; Li et al. 2004).
In summary, our data show that a lamprey-specific bile alcohol, 3kPZS, modulates the
temperature-induced changes of upstream movement in migratory phase female sea lamprey.
Evidently, 3kPZS exerts multiple functions depending on the life history phase of the female sea
lamprey receiver. Migratory female sea lamprey that move upstream in the presence of 3kPZS
during colder stream temperatures will likely aggregate in higher numbers to areas containing

32

3kPZS-baited traps. Once maturity is reached, trapping may be effective at removing high
proportions of females from the system for control of the non-indigenous species in the
Laurentian Great Lakes (Smith & Tibbles 1980; Twohey et al. 2003; Johnson et al. 2009).

33

ACKNOWLEDGMENTS

We thank all personnel at the United States Geological Survey Hammond Bay Biological
Station, Millersburg, Michigan, the United States Fish and Wildlife Service Marquette Biological
Station, Marquette, Michigan, and the Department of Fisheries and Oceans, Canada, for their
assistance in animal capture, housing, and maintenance during this project. We also thank Dolly
Trump and Lydia Lorenz for the use of their private land as an access point to the field site.
Special thanks are well deserved of all field technicians and colleagues for their hard work,
suggestions, and dedication to this project: A. S. Chun, D. Partyka, D. Strohm, J. Olds, K. Hill,
T. O’Meara, T. Buchinger, and T. Meckley. This research was funded by the Great Lakes
Fishery Commission.

34

APPENDICES

35

APPENDIX A
SUPPLEMENTAL TABLES
Table 1-1S. Mixed and fixed effects examined during upstream movement of migratory sea
lamprey in streams in relation to pheromones component 3kPZS.
Model Fixed Effects
Interaction
logLik AIC
1
Period
-6.5
1.5
2
Temp
-12.2 -4.2
3
Gauge
-2.4
5.6
RateT
4
0.6
8.6
5
Odorant; Temp; Period
Odorant*Temp
-8.2 -2.2
6
Odorant; Temp
Odorant*Temp*Period
3.2
9.2
7
Odorant; Temp
Odorant*Temp
-12.2 -6.2 *
8
Odorant; Temp; Gauge
Odorant*Temp
-11.6 -3.6
9
Odorant; Temp
Odorant*Temp*Gauge
-3.3
4.7
Odorant; Temp; RateT
10
Odorant*Temp
-10.2
2.2
Odorant*Temp*RateT
11
Odorant; Temp
-3.6
4.4
12
Odorant; Temp; Released Odorant*Temp
-2.9
5.1
13
Odorant; Temp
Odorant*Temp*Released
11.9 19.9
14
Odorant; Period
Odorant*Period
-3.8
4.2
15
Odorant; Period
Odorant*Temp
-8.2 -2.2
16
Odorant; Period
Odorant*Period*Temp
2.7
8.7
17
Temp; Period
Temp*Period
-3.8
4.2
18
Temp; Period
Odorant*Temp
-3.5
4.5
19
Odorant; Temp; Period
Odorant*Temp
-8.2 -2.2
20
Odorant; Temp; Period
Odorant*Temp; Odorant*Period
-7.2 -1.2
21
Odorant; Temp; Period
Odorant*Period*Temp
2.7
8.7
22
Odorant; Temp; Period
Temp*Period
-4.9
3.1
23
Odorant; Temp; Period
Temp*Period; Odorant*Temp
-3.4
2.6
24
Odorant; Temp; Period
Temp*Gauge; Odorant*Temp
-2.2
5.8
25
Odorant; Temp
Odorant*Period
-7.7
0.3
26
Odorant; Temp
Odorant*Period*Temp
3.2
9.2
27
Odorant; Temp
Temp*Gauge; Odorant*Temp
-6.2
1.8
28
Odorant; Temp; Released Temp*Released; Odorant*Temp
6.7 14.7
Odorant = 3kPZS or methanol (control) treatments, Period = early (2000-2300 h) or late (0000o
0300 h) trial, Temp = stream temperature ( C), RateT = rate of stream temperature change during
o
-1
each trial ( C hr ), Gauge = stream gauge height (m), Released = number of sea lamprey
released during each trial (20-30). Fit statistics, including information criterion (AIC) and loglikelihood (logLik), are compared across models. *Model chosen using an ANCOVA in SAS
Version 9.2 (α = 0.05).
36

APPENDIX B
SUPPLEMENTAL FIGURES

Figure 1-3S. Hemotoxylin and eosin stained sections of sea lamprey oocytes taken from a subsample of animals used in migratory field trials. A) Oocytes appearing pear-shaped (arrow) that
were 5-10 days from ovulation (scale bar = 200 µm). B) Higher magnification showing location
of the plasma membrane (PM) and yolk granules (Y; scale bar = 10 µm). A distinct vitelline
membrane (VM) with peripheral striations, a follicular cell layer (F) intact, and vacuole build-up
(V) under the vitelline membrane indicate a pre-ovulatory oocyte. C) The left oocyte was 5-10
days from ovulation, while the right shows a buildup of ovulatory fluid (FlOv) between the
vitelline membrane and follicular layer (F), 3-5 days from ovulation. Nucleus (N) is shown
(scale bar = 20 µm). D) A mature (ovulatory) oocyte for reference that was taken from a female
actively spawning in a nest (Cheboygan River dam, Michigan, U.S.A.) showing a degraded
follicular layer (debris at top) and symmetrical shape (scale bar = 100 µm). No ovulatory
oocytes were observed in all animals sampled for migratory trials, Ocqueoc River, Michigan,
U.S.A. For interpretation of the references to color in this and all other figures, the reader is
referred to the electronic version of this thesis.
37

25.0

Stream temperature (oC)

23.0
21.0
19.0
17.0
15.0
13.0
11.0
9.0
7.0
5.0

Date
Figure 1-4S. Stream temperature taken during each nightly behavioural trial in the experimental
system designed to observe upstream movements of migratory female sea lamprey in relation to
-13
synthesized 3kPZS, or methanol-control. □: Trials where synthesized 3kPZS (5x10 molar [M])
was administered to the stream. ▲: Trials where methanol (vehicle) was administered to the
stream. Day temperatures were not available. Ocqueoc River, Millersburg, MI.

38

REFERENCES

39

REFERENCES

Applegate, V. C. 1950. Natural history of the sea lamprey (Petromyzon marinus) in Michigan.
Washington, D.C.: United States Department of the Interior Fish and Wildlife Service.
Applegate, V.C. 1951. Sea lamprey investigations; egg developement, maturity, egg production,
and percentage of unspawned eggs of sea lamprey, Petromyzon marinus, captured in
several Lake Huron tributaries. Washington, D.C.: United States Department of the
Interior Fish and Wildlife Service.
Beamish, F. W. H. & Potter, I. C. 1975. The biology of the anadromous sea lamprey
(Petromyzon marinus) in New Brunswick. Journal of Zoology, 177, 57-72.
Bergstedt, R. A. & Seelye, J. G. 1995. Evidence for Lack of Homing by Sea Lampreys.
Transactions of the American Fisheries Society, 124, 235-239.
Binder, T. R. & McDonald, D. G. 2008. The role of temperature in controlling diel activity in
upstream migrant sea lampreys (Petromyzon marinus). Canadian Journal of Fisheries
and Aquatic Sciences, 65, 1113-1121.
Bjerselius, R., Li, W., Teeter, J. H., Seelye, J. G., Johnson, P. B., Maniak, P. J. Grant, G.
C., Polkinghorne, C. N., & Sorenson, P. W. 2000. Direct behavioral evidence that
unique bile acids released by larval sea lamprey (Petromyzon marinus) function as a
migratory pheromone. Canadian Journal of Fisheries and Aquatic Sciences, 57, 557569.
Chung-Davidson, Y-W., Rees, C. B., Bryan, M. B., & Li, W. 2008. Neurogenic and
neuroendocrine effects of goldfish pheromones. Journal of Neuroscience, 28, 1449214499.
DeFraipont, M. & Sorensen P. W. 1993. Exposure to the pheromone 17α,20β-dihydroxy-4pregnan-3-one enhances the behavioral spawning success, sperm production, and sperm
motility of male goldfish. Animal Behaviour, 46, 245-256.
Donahue, M. J. 2006. Allee effects and conspecific cueing jointly lead to conspecific attraction.
Oecologia, 149, 33-43.
Fine, J. M., Sisler, S. P., Vrieze, L. A., Swink, W. D. & Sorenson, P. W. 2006. A practical
method for obtaining useful quantities of pheromones from sea lamprey and other fishes
for identification and control. Journal of Great Lakes Research, 32, 832.
Fine, J. M. & Sorensen, P. W. 2005. Biologically relevant concentrations of petromyzonol
sulfate, a component of the sea lamprey migratory pheromone, measured in stream water.
Journal of Chemical Ecology, 31, 2205-2210.

40

Johnson, N. S., Luehring, M. A., Siefkes, M. J. & Li, W. 2006. Mating pheromone reception
and induced behavior in ovulating female sea lampreys. North American Journal of
Fisheries Management, 26, 88-96.
Johnson, N. S. 2008. In-stream behavioral responses of female sea lampreys to pheromone
components. Ph.D. East Lansing, Michigan: Michigan State University, U.S.A.
Johnson, N. S., Yun, S-S., Thompson, H. T., Brant, C. O. & Li, W. 2009. A synthesized
pheromone induces upstream movement in female sea lamprey and summons them into
traps. Proceedings of the National Academy of Sciences of the United States of America,
106, 1021-1026.
Johnson, N. S. & Li, W. 2010. Understanding behavioral responses of fish to pheromones in
natural freshwater environments. Journal of Comparative Physiology A, 196, 701-711.
Lewis, J. C. & McMillan, D. B. 1965. The development of the ovary of the sea lamprey
(Petromyzon marinus L.). Journal of Morphology, 117, 425-466.
Liley, N. R. 1982. Chemical communication in fish. Canadian Journal of Fisheries and Aquatic
Sciences, 39, 22-35.
Li, W., Chung-Davidson, Y-W., Siefkes, M. J., Wu, H., & Rees, C. B. 2004. Pheromone
regulation of reproductive neuroendocrine in the sea lamprey. Integrative and
Comparative Biology, 44, 592-592.
Li, W. 2005. Potential multiple functions of a male sea lamprey pheromone. Chemical Senses,
30, 307-308.
Li, W., Scott, A. P., Siefkes, M. J., Yan, H. G., Liu, Q., Yun, S-S., Gage, D. A. 2002. Bile
acid secreted by male sea lamprey that acts as a sex pheromone. Science, 296, 138-141.
Li, W., Scott, A. P., Siefkes, M. J., Yun, S-S., Zielinski, B. 2003. A male pheromone in the sea
lamprey (Petromyzon marinus): an overview. Fish Physiology and Biochemistry, 28,
259-262.
Losey, G. S. & Hugie, D. M. 1994. Prior anesthesia impairs a chemically mediated fright
response in gobiid fish. Journal of Chemical Ecology, 20, 1877-1883.
Manion, P. J. & Hanson, L. H. 1980. Spawning behavior and fecundity of lampreys from the
upper three Great Lakes. Canadian Journal of Fisheries and Aquatic Sciences, 37, 16351640.
Rudinsky, J. A. 1969. Masking of the aggregation pheromone in Dendroctonus pseudotsugae
Hopk. Science, 166, 884-885.

41

Siefkes, M. J. Scott, A. P., Zielinski, B., Yun, S-S. & Li, W. 2003. Male sea lampreys,
Petromyzon marinus L., excrete a sex pheromone from gill epithelia. Biology of
Reproduction, 69, 125 -132.
Siefkes, M. J. & Li, W. 2004. Electrophysiological evidence for detection and discrimination of
pheromonal bile acids by the olfactory epithelium of female sea lampreys (Petromyzon
marinus). Journal of Comparative Physiology A. 190, 193-199.
Siefkes, M. J., Winterstein, S. R. & Li, W. 2005. Evidence that 3-keto petromyzonol sulphate
specifically attracts ovulating female sea lamprey, Petromyzon marinus. Animal
Behaviour, 70, 1037-1045.
Smith, B. R. & Tibbles, J. J. 1980. Sea lamprey (Petromyzon marinus) in Lakes Huron,
Michigan, and Superior: history of invasion and control, 1936-78. Canadian Journal of
Fisheries and Aquatic Sciences, 37, 1780-1801.
Sorensen. P. W. & Stacey, N. E. 2004. Brief review of fish pheromones and discussion of their
possible uses in the control of non-indigenous teleost fishes. New Zealand Journal of
Marine and Freshwater Research, 38, 399-417.
Sorensen, P. W., Vrieze, L. A. & Fine, J. M. 2003. A multi-component migratory pheromone
in the sea lamprey. Fish Physiology and Biochemistry, 28, 253-257.
Sorensen, P.W., Fine, J. M., Dvornikovs, V., Jeffrey, C. S., Shao, F., Wang, J.,
Vrieze, L. A., Anderson, K. R. & Hoye, T. R. 2005. Mixture of new sulfated steroids
functions as a migratory pheromone in the sea lamprey. Nature Chemical Biology, 1,
324-328.
Stacey, N. E., Sorensen, P. W., Van Der Kraak, G. J., and Dulka, J. G. 1989. Direct evidence
that 17α, 20β-dihydroxy-4-pregnen-3-one functions as a goldfish primer pheromone:
Preovulatory release is closely associated with male endocrine responses. General and
Comparative Endocrinology, 75, 62-70.
Stacey, N. E. & Sorensen, P. W. 2002. Fish hormonal pheromones. In: Hormones, brain, and
behavior (Ed. by A. P. Arnold, S. Etgen, S. Fahrbach, & R. Rubin), pp. 375-435. New
York: Academic Press.
Stacey, N. E. 2003. Hormones, pheromones and reproductive behavior. Fish Physiology and
Biochemistry, 28, 229-235.
Teeter, J. H. 1980. Pheromone communication in sea lampreys (Petromyzon marinus):
implications for population management. Canadian Journal of Fisheries and Aquatic
Sciences, 37, 2123-2132.
Twohey, M. B., Sorensen, P. W. & Li, W. 2003. Possible applications of pheromones in an
integrated sea lamprey management program. Journal of Great Lakes Research, 29, 794800.
42

Vrieze, L. A., Bergstedt, R. A. & Sorensen, P. W. 2011. Olfactory-mediated streamfinding behavior of migratory adult sea lamprey (Petromyzon marinus). Canadian
Journal of Fisheries and Aquatic Science, 68, 523-533.
Wagner, C. M., Twohey, M. B. & Fine, J. M. 2009. Conspecific cueing in the sea lamprey: do
reproductive migrations consistently follow the most intense larval odour? Animal
Behaviour, 78, 593-599.
Wilson, E. O. 1970. Chemical communication within animal species. In: Chemical ecology (Ed.
by E. Sondheimer & J. B. Simeone), pp. 133-155. New York: Academic Press.
Yorke, M. A. & McMillan, D. B. 1980. Structural aspects of ovulation in the lamprey,
Petromyzon marinus. Biology of Reproduction, 22, 897 -912.
Xi, X., Johnson, N. S., Brant, C. O., Yun, S-S., Chambers, K. L., Jones, A. D. & W. Li.
Quantification of a male sea lamprey pheromone in tributaries of the Laurential Great
Lakes by ultrahigh performance liquid chromatography – tandem mass spectrometry. In
review by: Environmental Science and Technology.
Yun, S-S., Scott, A. P. & Li, W. 2003. Pheromones of the male sea lamprey, Petromyzon
marinus L.: structural studies on a new compound, 3-keto allocholic acid, and 3-keto
petromyzonol sulfate. Steroids, 68, 297-304.

43

CHAPTER 2

PRODUCTION AND SELECTIVE RELEASE OF BILE ACIDS BY THE ADULT MALE
SEA LAMPREY (PETROMYZON MARINUS L.)

44

ABSTRACT
Upon reaching sexual maturation, male sea lamprey (Petromyzon marinus L.) have been
shown to release a bile alcohol-derived sex pheromone, 3-keto petromyzonol sulfate (3kPZS),
across specialized gill epithelia cells. Details of the production, transport, and the release
mechanism of 3kPZS and other steroidally-derived bile acids and bile alcohols from sea lamprey
have not yet been elucidated. Here we further characterize the production and release of: (1) 3keto allocholic acid (3kACA), (2) petromyzonol sulfate (PZS), (3) allocholic acid (ACA), (4)
petromyzosterol disulfate (PSDS), and (5) petromyzonamine disulfate (PADS), in addition to
3kPZS. Liquid chromatography–tandem mass spectrometry (LC-MS/MS) results show PZS is
present in highest quantity in the liver, plasma, and gills (~100 times) of mature males compared
to other compounds, whereas 3kPZS is present in highest quantity in washings from gills (~600
times) compared to other compounds. Bile acids and bile alcohols are transported from the liver
through the cardiovascular system to the gills where certain derivatives are selectively released
into the environment after males sexually mature. Quantitative Reverse Transcription PCR
(QRT-PCR) results indicated that the conversion of bile acids and derivatives from cholesterols,
as part of the biosynthetic pathway of these compounds, occurs in the liver of males after sexual
maturation. We conclude that CYP7A1 transcripts and bile acid/bile alcohol production are both
up-regulated in sexually mature male liver. The sea lamprey demonstrates a species with a direct
and efficient mechanism for transport and subsequent release of bile acids and bile alcohols, and
represents a model species for examining the biosynthesis of these biologically important
compounds in vertebrates.

45

INTRODUCTION

The sea lamprey (Petromyzon marinus L.) represents a model species for comparative
studies of bile acid synthesis and release through life history (Li, 2005; Vankatachalam, 2005).
This species shows life stage-specific production of bile acids (bile acids will also universally
refer to bile alcohols and derivatives, herein) that are hypothesized to function as chemical
signals, or pheromones, for migration and reproduction (Li et al., 2003; Sorenson et al., 2005).
Larval-phase sea lamprey release a lamprey-specific sulfated bile acid, petromyzonol sulfate
(PZS), and an additional bile acid-derived compound hypothesized as a likely precursor in the
biosynthesis of PZS known as allocholic acid (ACA; Haselwood and Tokes, 1969; Li et al.,
1995). Both PZS and ACA are excreted with waste as metabolic by-products from larval sea
lamprey. Sorenson et al. (2005) later identified two disulfated steroidal-derived compounds as
components of the migratory pheromone: petromyzonamine disulfate (PADS), and
petromyzosterol disulfate (PSDS; Table 2-4S), and demonstrated that these two compounds are
released exclusively by larval sea lamprey as well.
Upon reaching sexual maturation (spermiating, herein), adult male sea lamprey no longer
feed, and show a heavily atrophied intestine (Applegate, 1950), rendering the transport of bile
acids and alcohols into the intestine useless in terms of lipid digestion. Spermiating male sea
lampreys release at least two bile acids: 3-keto allocholic acid (3kACA) and 3-keto
petromyzonol sulfate (3kPZS; Li et al., 2002; Yun et al., 2003; Table 2-4S). Both compounds are
similar in structure to larval-released ACA and PZS, respectively, but instead contain a keto
moiety in place of the hydroxyl at carbon-3 (C-3). 3kPZS has been confirmed to be secreted
across the gill epithelia through specialized glandular cells (Siefkes et al. 2003); which were first

46

identified in sexually mature river lamprey, Lampetra fluviatis (Pickering, 1977). To date, the
biosynthetic pathways of PZS have been regarded as specific to larval sea lamprey, and that of
3kPZS specific to spermiating males (Venkatachalam, 2005). Further, details of the onset of
production, subsequent transport through the body, and mechanism of release of bile acids
specific to sea lamprey have not been fully elucidated (Siefkes et al., 2003; Li, 2005). Finally,
while PZS, ACA, PADS, and PSDS are confirmed to be released by larval sea lamprey, they
have not yet been examined in regards to whether they are released by adults.
In this study, we compared production and release of five known bile acids in adult male
sea lamprey before and after the onset of spermiation. In vertebrate animals, bile acids and bile
alcohols are known to be derived cholesterols largely in the liver by a suite of enzymes which
include Cholesterol 7α-hydroxilase, or cytochrome P450 7A1 (CYP7A1), as a rate limiting
enzyme during synthesis (Chiang, 2009). We speculated that lamprey bile acids are also
produced in the liver, and further hypothesized that all bile acids are transported directly to gills
where they are selectively released into the environment from sexually mature males. We
integrated biochemical and molecular techniques to examine the production and release of
3kPZS, PZS, 3kACA, ACA, PSDS, and PADS. Our data suggests that a dramatic up-regulation
in CYP7A1 transcription leads to equally dramatic up-regulation in production of bile acids in
mature males, and subsequently a substantial increase in the release of 3kPZS, a known mating
pheromone component (Li et al., 2002).

47

METHODS
Sea lamprey collection and maintenance
All handling and dissections of sea lamprey were conducted in accordance with protocols
approved by the Michigan State University Institutional Animal Care and Use Committee. Sea
lampreys were captured by the United States Fish and Wildlife Service, or Fisheries and Oceans
Canada, using traps placed near dams in tributaries to Lake Michigan, Lake Superior, and Lake
Huron. All captured lamprey were brought to the United States Geological Survey - Hammond
Bay Biological Station (HBBS) and held in 500-1000 l aerated tanks fed continuously with Lake
Huron water. The tank temperatures were kept between 17-19oC, which is similar to stream
water temperatures during a typical sea lamprey spawning season (Applegate, 1950).
Immature male sea lamprey were visually identified and separated from females by
carefully applying pressure to the lower abdomen to feel for eggs. Male sea lamprey were
3

transferred to steel holding cages, ranging from approximately 0.25 – 1.0 m in volume, in the
lower Ocqueoc River (US23 bridge, Millersburg, MI, USA) to promote natural maturation in an
actual spawning stream. Up to five acclimation cages, each containing roughly 10 – 15 male sea
lampreys, were checked daily for signs of spermiation. Spermiating males were identified by
secondary sexual characteristics (Manion and Hanson, 1980) including a pronounced rope-like
ridge that develops dorsally along the length of the back to the proximal dorsal fin (Figure 2-1),
and gamete release following gently pressure applied to the lower abdomen. Acclimation time
typically lasted 5-10 days before animals became mature.

48

Figure 2-1. Nesting pair of sea lamprey showing a male (M) and female (F), as well as the male
secondary sexual characteristic known as the rope (R). Scale bar = 20 mm, Photo by C. Brant.

49

Washings collection
Wash water samples from each male sea lamprey were collected for later quantification
of known bile acids. The putative compound 3kPZS has been specifically shown to be released
across the gill epithelia of spermiating male sea lamprey (Seifkes et al. 2003); therefore, a
bisected chamber was constructed following Siefkes et al. (2003) with slight modification. The
chamber was capable of collecting lamprey-conditioned water from the anterior and posterior
region of an individual, independently (Figure 2-2A). Once an animal was secured into the
aquarium, 3.5 l of deionized water (DI) was added to the posterior chamber, and the dividing air
space was inspected for leaks. 3.5 l of DI water was then added to the anterior chamber. An
additional non-bisected, free-swimming, washing chamber (Figure 2-2B) was used to confirm
that chamber type did not severely alter release rates of compounds of interests compared to
those of animals subjected to the bisected chamber. New individuals were transferred to a 20-l
capacity container containing 5 l of temperature acclimated DI water. A portable aerator was
used for a constant supply of oxygen. The temperature of the DI water used for washings was
acclimated to that of the holding tanks from which the animals came (17-19oC). Each chamber
was aerated while an individual was washed for 1 hr.

50

Figure 2-2. A) Schematic of a bisected chamber used to collect lamprey-conditioned water from
the head (h) and tail (t) region of the animal following Siefkes et al. (2003), with slight
modification. The anterior end of the animal was inserted into a perforated acrylic tube (a),
securing the body with an adjustable gasket. The mid-region of the animal was suspended across
an air space divider (s), assuring no possible leakage between h and t. The posterior was inserted
into a perforated rubber tube (p), secured by an adjustable gasket. B) Schematic of basic 20 l
washing chamber that collected lamprey-conditioned water from the entire body of the animal
(b). *Air stone, cm: centimeter.

51

After washing, one 1-l and three 50-ml samples were taken from each chamber (i.e. head,
tail, or whole body). All 1-l samples were immediately spiked with a 100 µl methanol 52

deuterated 3kPZS solution ([ H5]3kPZS; 5 ng/ml) that was custom synthesized by Bridge
Organics Inc., Vicksburg, MI, as an internal standard (denoted as: 3kPZS-d5 IS, herein). After
thorough mixing, the samples were stored at -20oC. All 50-ml samples were transferred directly
to a -20o C freezer. All samples were collected while wearing latex gloves, changing gloves
between samples.

Plasma and tissue collection
Males removed from both washing chamber types were euthanized with an overdose of
Tricaine methanesulfonate (MS222; Sigma-Aldrich, St. Louis, MO, USA). Blood was drawn
directly from the heart using a 10 ml syringe (needle: 0.8 x 40 mm; BD SafetyGlide, Franklin
Lakes, NJ, USA) until no more blood could be drawn. A 1.5 ml aliquot of blood from each male
was transferred to a 1.5 ml Eppendorf Snap-Cap Microcentrifuge tube and centrifuged at 1500
rpm for 15 min at 4oC. Supernatant plasma was carefully removed, transferred to a new vial, and
frozen at -80oC for later analyses.
Each male was dissected and the whole gill and liver were removed. Two sub-samples
(20-50 mg, each) of each tissue type were transferred to separate 2 ml tubes, frozen in liquid
nitrogen (N2), and stored at -80oC for later extraction of RNA (see: Quantitative real time PCR).
Sub-samples were taken from consistent locations from each tissue. The remaining tissues were
frozen at -20oC for later extraction of bile acids.

52

Sample preparation and analysis by mass spectrometry
Each 1-l washing sample was thawed at room temperature and passed twice through a
glass microfiber filter of 1.0 µm nominal pore size (Whatman, Piscataway, NJ, USA), followed
by once through a metrical grid filter of 0.45 µm pore size (Poll Corporation, Ann Arbor, MI,
USA). Solid phase extraction (SPE) was accomplished by passing each filtered sample through
a methanol-activated Oasis MCX mixed-mode polymetric sorbent cartridge (6 cc/500 mg;
Waters, Milford, MA, USA). Eluants in methanol (8 ml/sample) were evaporated using a
CentriVap Cold Trap with CentriVap Concentrator (Labconco, Kansas City, MO, USA).
Residues were reconstituted with 100 µl of 50% high performance liquid chromatography
(HPLC) grade methanol (Fisher Scientific, Fair Lawn, NJ, USA). Bile acid components were
then identified and quantified using a Waters ACQUITY LC System coupled with the Waters
Quattro Premier XE tandem quadrupole mass spectrometer (LC-MS/MS; Milford, MA, USA).
Liver and gill tissues were thawed on ice and weighed. Tissue sub-samples ranged from
15 – 60 mg. A 100 µl spike of 5 ng/ml 3kPZS-d5 IS (in 75% ethanol) was added to prespermiating male tissue samples, and a 100 µl spike of 100 ng/ml 3kPZS-d5 IS (in 75% ethanol)
was added to spermiating male tissue samples. Ethanol (75%, in de-ionized water) was then
added to each sample until the total volume reached 1 ml/100 mg of tissue. Tissues were
homogenized and subjected to over 15 hr of shaking at room temperature (~100 rpm). Each
sample was then centrifuged at 13000 rpm for 10 min at room temperature. Supernatants were
transferred to new vials and evaporated (Labconco). Residues were re-constituted in 1 ml of
deionized water for SPE. SPE procedures followed those of washing samples using Oasis MCX
cartridges. Eluants (8-mL, each) were evaporated (Labconco) down to a dry powdered state.
Residues were reconstituted with 100 µl of 1:1 methanol:DI water (v:v) before injection into LC53

MS/MS. Concentrations of each compound in each tissue was then standardized by the initial
weight of each tissue sample (ng/g-tissue).
Plasma sample extraction was based on a published method by Scherer et al. (2009), with
slight modification. Plasma samples were thawed on ice. 100 µl aliquots of plasma were
transferred to 15 ml tubes. Each aliquot was spiked with 10 µl of 5 ng/ml 3kPZS-d5 internal
standard (in methanol). For protein precipitation, plasma was mixed with 1 ml acetonitrile,
followed by 1 min of vortex-mixing. After 15 min of centrifugation (15000 rpm), the supernatant
was filtered through a polyvinylidene fluoride (PVDF) syringe filter (0.22 µm pore size, 4 mm
diameter; Membrane Solutions, Plano, TX, USA) and evaporated to a dry powered state. The
samples were re-dissolved in 1 ml of 1:1 methanol:DI water (v:v). After an additional
centrifugation (15000 rpm, 15 min), 10 µl of the methanolic supernatant was subjected to LC–
MS/MS analyses. All statistical comparisons of mean concentrations in washings, tissues, and
plasma, and pertaining to release rates, within spermiating and pre-spermiating males were
accomplished using a Student’s t-test (α = 0.05).

Bile acids examined
Bile acids examined include: (1) 3-keto petromyzonol sulfate (3kPZS), (2) 3-keto
allocholic acid (3kACA), (3) petromyzonol sulfate (PZS), (4) allocholic acid (ACA),
petromyzosterol disulfate (PSDS), and (5) petromyzonamine disulfate (PADS). Refer to Table
2-4S for details of each compound and Figure 2-6S for details of structure.

54

Quantitative Reverse Transcription PCR
QRT-PCR followed the procedures described by Chung-Davidson et al. (2008a, b).
Briefly, total RNA was extracted from gill and liver tissues using TRIzol Reagent (Invitrogen,
Carlsbad, CA, USA), treated with TURBO DNA-free kit (Applied Biosystems, Foster City, CA,
USA), and diluted to 100 ng/μl. RNA samples were then reverse-transcribed into cDNA using
Moloney Murine Leukemia reverse transcriptase (M-MLV RT; Invitrogen) and random
hexamers (Promega, Madison, WI, USA). RTQ-PCR was performed using the TaqMan minor
groove binder (MGB) system (Applied Biosystems). Each reaction consisted of 2 μl (5 ng/μl)
cDNA, 8 μl TaqMan Universal PCR master mix, forward and reverse primers (900 nM of each),
and 250 nM TaqMan MGB probe. Amplification plots were analyzed on an ABI-Applied
Biosystems 7900 real-time PCR thermal cycler at the Michigan State University Research
Technology Support Facility, East Lansing, Michigan, USA. Synthetic oligonucleotides were
used as standards and ran on the sample plate.
Standards were PCR-amplified using the primers for RTQ-PCR seen in Figure 2-5S,
purified with a MinElute PCR purification kit (Qiagen Inc., Valencia, CA, USA), and serially
diluted (10-fold) into 10

10

3

to 10 molecules/2 μl solutions. Genes quantified in sea lamprey gill

and liver included: (1) CYP7A1 encoding for the Cholesterol 7α-hydroxilase or cytochrome P450
7A1 (CYP7A1) enzyme. (2) SULT1C1 encoding for the sulfotransferase family cytosolic 1C1
(SULT1C1) general class of enzymes (standard), and (3) 40S ribosomal protein (standard). The
sequences for standards, primers and TaqMan MGB probe for each mRNA listed are shown in
Figure 2-5S. Transcripts/ng total RNA of genes of interest were compared across gill and liver
tissues from pre-spermiating and spermiating male sea lamprey using a generalized linear model

55

(ANOVA) and post hoc Fisher’s protected least significant difference (PLSD) analyses (α =
0.05).

56

RESULTS

Bile acids in washings, tissues, and plasma
From LC–MS/MS analyses, concentrations that were below 0.1 ng/ml were considered
too low for reliable detection and, therefore, removed from the data set. 3kPZS was detected at
the highest mean concentration (X ± SE = 122 ± 48 ng/ml, N = 6) in the head-washings of
spermiating males, which was greater than all other compounds detected (Student’s t-test: t =
2.1, P < 0.001). Minimal concentrations of compounds were detected in pre-spermiating male
head, tail, or full body washings, or in spermiating male tail-washings (Table 2-1).
In liver and plasma samples of pre-spermiating males, PADS was detected at the highest
mean concentrations (X ± SE = 593 ± 198 ng/g-liver, N = 6; and 269 ± 152 ng/l-plasma, N = 6),
compared to all other compounds detected (Student’s t-test: t = 2.06, P = 0.01 and P < 0.001,
respectively). PZS was detected in slightly greater concentrations in gills compared to all
compounds detected (Table 2-2). In spermiating males, mean concentration of PZS was found to
be substantially greater in liver, plasma, and gill samples (X ± SE = 151674 ± 26321 ng/g-liver,
N = 12; 11679 ± 2090 ng/l-plasma, N =11; and 15651 ± 4278 ng/g-gill, N = 12) when compared
to mean concentrations of all other compounds detected (Student’s t-test: t = 2.0, P < 0.0001; P <
0.0001; and P < 0.0001, respectively). All other compounds detected in the liver, gill, and
plasma of spermiating males were lower (Figure 2-3b).
All detected bile acids, 3kPZS, PZS, 3kACA, ACA, and PADS, were released from the
head-region of spermiating males. 3kPZS was released at the highest mean rate (X ± SE = 2273 ±
886 ng/hr/g-lamprey, N = 6), which was significantly higher compared to all other rates
(Student’s t-test: t = 2.05, P < 0.001). Release rates of PZS, 3kACA, ACA, and PADS were all
57

lower (3–80 ng/hr/g-lamprey) and not different from one-another (Student’s t-test: t = 2.05, P =
0.9; Figure 2-3a).
The ratios of synthesized and released bile acids differ dramatically between prespermiating and spermiating males. In pre-spermiating males, ratios could not be calculated
because these animals did not release any bile acids in detectible amounts. The ratios of
3kPZS:3kACA, 3kPZS:PZS, and 3kPZS:ACA stayed around 1:1 throughout the liver, plasma,
and gills of pre-spermiating male sea lamprey. PADS was greater in concentration throughout
liver, gill, and plasma, across all ratios. In spermiating males, the ratio of 3kPZS:3kACA shows
3kPZS to be in greater concentrations throughout the liver, plasma, and gills, and release.
However, the ratio comparisons of 3kPZS:PZS show greater concentrations of PZS in the body,
but much greater release rates of 3kPZS into the environment, similar to that seen across
3kPZS:PADS ratios (Table 2-3).

Transcripts of genes
The CYP7A1 gene was transcribed at 1000-fold higher levels in the liver tissue of
spermiating males compared to spermiating male gills, and 1000-10000-fold higher levels
compared to pre-spermiating male gills and liver, which was significant (ANOVA: F3,56 = 10.98,
P <0.0001; Figure 2-4a,b). Quantitative differences in transcripts of SULT1C1 (Figure 2-4c) and
40S ribosomal RNA (Figure 2-4d) using QRT-PCR analyses were not significant across liver
and gill of pre-spermiating and spermiating males (ANOVA: F3,56 = 1.55, P = 0.21 and F3,56 =
2.18, P = 0.10, respectively). Standardization of CYP7A1 transcripts by 40S transcripts did not

58

change the relationships (Figure 2-4b). Standards and primers for RTQ-PCR of genes from liver
and gill tissues can be seen in Figure 2-5S.

59

Table 2-1. Mean concentration (ng/ml) of bile acids from wash water collected from separate
bodily regions of male sea lamprey.

Compound

PSM
body

PSM
head

PSM
tail

3kPZS

0

0

ND

101±14 a

122±48 a

0

3kACA

ND

0

ND

2±0.6 b

1±0.4 b

0

PZS

ND

0

ND

0.2±0.06 b 0.2±0.07 b

0

ACA

0

0

ND

3±1 b

3±1 b

0

PSDS

ND

ND

ND

ND

ND

ND

PADS

0

0

ND

0.6±0.2 b

0.2±0.09 b

0

SM body

SM head

SM
tail

Abbreviations: 3kPZS = 3-keto petromyzonol sulfate, 3kACA = 3-keto allocholic acid, PZS =
petromyzonol sulfate, ACA = allocholic acid, PSDS = petromyzosterol disulfate, PADS =
petromyzonamine disulfate, PSM = pre-spermiating male (N = 22), SM = spermiating male (N =
20), body = whole body washing, head = anterior region washing only, tail = posterior washing
only, and ND = not detected. Bile acid concentrations were determined with LC-MS/MS and
expressed as mean (ng/ml) ± 1 standard error. A value of 0 was given for values less than 0.1
ng/ml. Different lower-case letters across all rows and columns indicate statistically significant
differences at P < 0.05 using Student’s t-test.

60

Table 2-2. Mean concentration of bile acids detected in the body of pre-spermiating male sea
lamprey.

Compound L (ng/g)

P (ng/ml)

G (ng/g)

3kPZS

A 27±7 b

A 6±1 b

A 30±14 ab

3kACA

B 39±18 b

B 6±1 b

A 41±11 a

PZS

A 167±38 b

B 14±2 b

B 37±3 a

ACA

A 7±3 b

A 2±0.3 b

A 7±2 b

PSDS

ND

PADS

A 593±198 a

ND
A 269±152 a

ND
B 30±15 ab

Abbreviations: 3kPZS = 3-keto petromyzonol sulfate, 3kACA = 3-keto allocholic acid, PZS =
petromyzonol sulfate, ACA = allocholic acid, PSDS = petromyzosterol disulfate, PADS =
petromyzonamine disulfate, L = liver, P = plasma, G = gill, and ND = not detected. Tissues and
plasma were collected from 6 pre-spermiating males. Concentrations were determined with LCMS/MS and expressed as mean ± 1 standard error. Different upper-case letters indicate
statistically significant differences across tissue types within each specific compound (i.e. row).
Different lower-case letters indicate statistically significant differences across compounds within
each specific tissue type (i.e. column). Significance was determined at P < 0.05 by Student’s ttest.

61

Table 2-3. Ratios of bile acids detected in the body of, and subsequently released from, male sea lamprey.
Liver (c:c)

Plasma (c:c)

Gill (c:c)

Release (r:r)

Ratio

PSM

SM

PSM

SM

PSM

SM

PSM

SM

3kPZS:3kACA

1:1

46:1

1:1

53:1

1:1

22:1

ND

126:1

3kPZS:PZS

1:6

1:142

1:2

1:43

1:1

1:9

ND

553:1

3kPZS:ACA

4:1

5:1

3:1

3:1

4:1

5:1

ND

28:1

3kPZS:PADS

1:22

1:3

1:45

1:6

1:1

1:1

ND

737:1

3kACA:PZS

1:4

1:6595

1:2

1:2336

1:1

1:196

ND

4:1

3kACA:ACA

6:1

1:9

3:1

1:19

6:1

1:4

ND

1:4

3kACA:PADS

1:15

1:151

1:45

1:296

1:1

1:18

ND

6:1

ACA:PZS

1:24

1:705

1:7

1:121

1:5

1:47

ND

19:1

ACA:PADS

1:85

1:16

1:134

1:15

1:4

1:4

ND

26:1

PADS:PZS

4:1

1:44

19:1

1:8

1:1

1:10

ND

1:1

Abbreviations: 3kPZS = 3-keto petromyzonol sulfate, 3kACA = 3-keto allocholic acid, PZS = petromyzonol sulfate, ACA = allocholic
acid, PSDS = petromyzosterol disulfate, PADS = petromyzonamine disulfate, PSM = pre-spermiating male (N = 6), SM = spermiating
male (N = 12), c:c = Concentration ratios, r:r = release ratios, and ND = not detected.

62

Figure 2-3. Quantification of bile acids: 3-keto petromyzonol sulfate (3kPZS), 3-keto allocholic
acid (3kACA), petromyzonol sulfate (PZS), allocholic acid (ACA), and petromyzonamine
disulfate (PADS) from spermiating male sea lamprey using LC-MS/MS. a) Release rate
(ng/hr/g-sea lamprey) of compounds from wash water samples taken from the whole body (W; N
= 14) of individuals and from just the head region (H; N = 6). b) Concentration of compounds
from liver (L) and gill (G) tissues (ng/g-tissue), and plasma (P; ng/ml-plasma) from a sub-sample
of a (N = 12). Different lower-case letters indicate statistically significant differences between
vertical columns within each group (i.e. compound). A different upper-case letter indicates
statistically significant differences between groups of columns across compounds. Columns
indicate means ± 1 standard error (vertical bars), and were compared using Student’s t-test
(significantly different at P < 0.05). Petromyzosterol disulfate (PSDS) was not detected in
spermiating males.

63

Figure 2-4. Quantitative Reverse Transcription PCR (QRT-PCR) analyses of gene transcripts in
the gill (G) and liver (L) tissues from pre-spermiating (PSM, N = 15) and spermiating (SM, N =
15) males. a) Transcripts of cholesterol 7 alpha-hydroxylase (CYP7A1 gene). b) CYP7A1
expression standardized by 40S ribosomal DNA. c) Transcripts of sulfotransferase 1C1
(SULT1C1 gene). d) Transcripts of 40S ribosomal DNA (standard). Vertical columns represent
mean transcripts ± 1 standard error. Different lower-case letters indicate statistically significant
differences between vertical columns, which were compared using ANOVA and post-hoc
Fisher’s PLSD (significantly different at P < 0.05).

64

DISSCUSSION

This study confirms that a rate limiting CYP7A1 enzyme is up-regulated dramatically in
the male sea lamprey liver after the animal reaches sexual maturation. We show that mature
males release substantial amounts of 3kPZS from the gills compared to other bile acids that are
up-regulated in gill tissue, indicating selective release of 3kPZS from the gills. Hepatic veins
carry blood from organs such as the liver, directly to the heart, which in turn immediately pumps
all blood through the gills (Augustinsson et al., 1956). The system comprises an effective
pathway for bile acids to reach the gills. Our LC-MS/MS data confirm a pathway of multiple bile
acids from the liver of males upon reaching sexual maturation, through the direct cardiovascular
system, to the gills for release into the environment. Finally, bile acid quantification of washings
collected from separate bodily regions of spermiating and pre-spermiating males confirm that
3kPZS, PZS, 3kACA, ACA, and PADS are released from the anterior end of spermiating males,
likely across gill epithelia as previously shown with 3kPZS by Siefkes et al. (2003). Notably,
these bile acids were detected in trace amounts, or not at all, in washings collected from the
posterior end of spermiating males, and from all regions of pre-spermiating males.
Our LC-MS/MS and QRT-PCR results implicate a probable mechanism whereby 3kPZS
is synthesized by the liver and the gills upon spermiation of a male sea lamprey, a process that
has only been hypothesized in lamprey (Siefkes et al. 2003). Since PZS is present in high
concentrations in the liver, plasma, and gill, yet 3kPZS is released across gill epithelia, it is
highly likely that PZS is a precursor to 3kPZS and the conversion largely occurs in the gills.
Venkatachalam (2005; and hereafter) suggested a pathway regarding the biosynthesis of PZS to
3kPZS from larvae to adult sea lamprey. The hypothesized pathway involves: (1) 3α, 7α, 12α,

65

trihydroxy 5α-cholan is hydroxilated at carbon-24 (C-24) forming 3α, 7α, 12α, 24 tetrahydroxy
5α-cholan (petromyzonol; PZ); (2) PZ-sulfotransferase (Venkatachalam et al. 2004) catalyzes the
addition of a sulfate to C-24 of PZ, forming PZS; and (3) 5α-OH of PZS is speculated to be
oxidized by 3α-dehydrogenase at C-3 to form 3kPZS, a male sex pheromone component (Li et
al., 2002) selectively released across specialized glandular cells in the gills (Siefkes et al., 2003).
It will be interesting and significant to confirm this biosynthetic pathway with further
biochemical and gene expression studies, including a detailed study of hydroxysteroid
dehydrogenase (3α-dehydrogenase, in this case) in spermiating male sea lamprey, and other
direct evidence for the conversion of PZS to 3kPZS by gills.
From our data, we propose that sexually mature male sea lamprey produce and release
more bile acids and bile alcohols than previously described. Until now, PZS, ACA, and PADS
have been thought only to be released by larval-stage sea lamprey (Li et al., 1995; Polkinghorne
et al., 2001; Yun et al., 2003; Sorenson et al., 2005). Our results clearly show the production of
these bile acids in mature males. PSDS and PADS are two constituents of the larval pheromone
with olfactory-stimulating capabilities based on electro-olfactographic evidence (Sorenson et al.
2005). PZS as ACA are also both potent olfactory stimuli in the adult sea lamprey (Li et al.,
1995). Interestingly, PZS, ACA, and PADS are all hypothesized as components of the migratory
pheromone released by larval sea lamprey upstream (Bjerselius et al. 2000; Sorenson et al.,
2005).
Fine and Sorenson (2010) further showed that larval lamprey release identified larval
compounds PZS, PSDS, and PADS at a rate of ~5-25 ng/hr/larva, where PSDS is released at
twice the rate of the other two compounds. This release rate was determined after larvae had
recently fed, through waste excretion. Assuming an average larval sea lamprey weighs ~1 g
66

(Applegate, 1950); we show an average release rate of 3kACA, PZS, ACA, and PADS of ~4-70
ng/hr/g-sea lamprey that is within the same range as the conspecific larvae, but from the gill
region of males. It would be interesting to examine the release mechanisms of both adult and
larvae in future studies to further characterize the biosynthesis and biological function of these
bile acids among conspecifics during different phases of life history.
In summary, the sea lamprey dramatically up-regulates CYP7A1 and subsequent bile
acids in the liver following maturation. Bile acids are transported through the direct
cardiovascular system to the gills for release. The production of bile acids and their derivatives,
including ACA, PZS, and PADS, are confirmed to be released from the head region of mature
males. A clear discrepancy in the bile acids produced in the liver, compared to those released
across gills, indicates that the mature male sea lamprey has adapted a mechanism for selective
release of male mating pheromone component 3kPZS. Further studies that elucidate the
biosynthetic pathway of bile acids, and the mechanism of release of these compounds from the
gills, will accompany this research well, and likely be applied to other vertebrate species in the
future. Knowledge of the synthesis and release of additional sea lamprey-specific compounds
may be useful in the battle to control the invasive species within the Laurentian Great Lakes.

67

ACKNOWLEDGMENTS

We thank all personnel at the United States Geological Survey Hammond Bay Biological
Station, Millersburg, Michigan and the United States Fish and Wildlife Service Marquette
Biological Station, Marquette, Michigan, and the Department of Fisheries and Oceans, Canada,
for their assistance in animal capture, housing, and maintenance during this project. Special
thanks are well deserved of all field technicians and colleagues: H. Kruckman, D. Partyka, J.
Olds, K. Hill, T. O’Meara, C-Y. Yeh, and T. Buchinger for their hard work, suggestions, and
dedication to this project. We would like to thank the Great Lakes Fishery Commission for
providing funding for this project, and the National Institute of Health for providing funding for
our gene work in this study

68

APPENDICES

69

APPENDIX A
SUPPLEMENTAL TABLES

Table 2-4S. Bile acids, bile alcohols, and their derivatives produced and released by the sea lamprey (Petromyzon marinus).

Name

Abbr.

Chemical
formula

3-keto petromyzonol sulfate

3kPZS

C24H40O8S

3-keto allocholic acid

Molecular
weight

Sources

472

Li et al., 2002; Yun et al., 2003

3kACA C24H38O5

406

Yun et al., 2002; Yun et al., 2003

allocholic acid

ACA

C24H40O5

409

Li et al., 1995

petromyzonol sulfate

PZS

C24H38O5S

474

Haselwood and Tokes, 1969; Li et al., 1995

petromyzosterol disulfate

PSDS

C28H46O9S2

509

Sorenson et al., 2005; Hoye et al., 2007

petromyzonamine disulfate

PADS

C34H60N2O9S2

704

Sorenson et al., 2005; Hoye et al., 2007

70

APPENDIX B
SUPPLEMENTAL FIGURES

a
CYP7A1
CAACATGTCGGCGCTCATCGCCCTCCGAATACAACTCAATGACACGCTGTCTCGCAT
G

b
SULT1C1
CCGTGATGCGCGACAACCCCATGACGAATTACAGCACCTTGCCCACCGACTTCTTGG
ACCACTCCGTG

c
40S RIBOSOMAL PROTEIN
ACCTACGCAGGAACAGCTATGACCATCTCGAGCAGCTGAAGCTCCAATGTGGTGGA
ATTCGTCG
Figure 2-5S. Standards and primers for Quantitative Reverse Transcription PCR (RTQ-PCR)
from liver and gill tissues of the sea lamprey (Petromyzon marinus). a) CYP7A1 primer design,
b) SULT1C1 primer design, c) 40S ribosomal RNA primer design. Sequencing for 5’ primer is
shown in the yellow block, sequence for TaqMan MGB probe in green block, and sequence for
3’ primer in blue block. Designed by Y-W. Chung-Davidson, Michigan State University, East
Lansing, MI, USA.

71

OSO3Na

OSO3Na

OSO3Na
OSO3Na

OSO3Na

NaO3SO

Figure 2-6S. Chemical structures of bile acids, alcohols, and steroidal derivatives of the sea
lamprey. Structure illustrations courtesy of Dr. Ke Li, Michigan State University, USA. Refer to
Table 2-4S for references regarding structure identification.

72

REFERENCES

73

REFERENCES

APPLEGATE, V. C. 1950. The natural history of the sea lamprey (Petromyzon marinus) in
Michigan, Washington: U.S Department of the Interior Fish and Wildlife Service, Special
Scientific Report, No. 55.
AUGUSTINSSON, K. B., FANGE R., JOHNELS, A., and OSTLUND, E. 1956. Histological,
physiological, and biochemical studies on the heart of two cyclostomes, hagfish (Myxine)
and lamprey (Lampetra). J. Physiol. 131:257Y276.
BJERSELIUS, R., LI, W., TEETER, J. H., SEELYE, J. G., JOHNSON, P. B., MANIAK, P. J.,
GRANT, G. C., POLKINGHORNE, C. N., and SORENSEN, P. W. 2000. Direct
behavioral evidence that unique bile acids released by larval sea lamprey (Petromyzon
marinus) function as a migratory pheromone. Can. J. Fish. Aquat. Sci, 57:557Y569.
CHIANG, J. Y. R. 2009. Bile acids: regulation of synthesis. J. Lipid Res. 50:1955Y1966.
CHUNG-DAVIDSON, Y-W., BRYAN, M. B., TEETER, J. H., BEDORE, C. N., and LI, W.
2008a. Neuroendocrine and behavioral responses to weak electric fields in adult sea
lampreys (Petromyzon marinus). Horm. and Behav. 54:34Y40.
CHUNG-DAVIDSON, Y-W., REES, C. B., BRYAN, M. B., and LI, W. 2008b. Neurogenic and
neuroendocrine effects of goldfish pheromones. J. Neurosci. 28:14492Y14499.
FINE, J. M. and SORENSEN, P. W. 2010. Production and fate of the sea lamprey migratory
pheromone. Fish Physiol. and Biochem. 36:1013Y1020.
HASLEWOOD, G. A. D.and TOKES, L. 1969. Comparative studies of bile salts. Bile salts of
the lamprey Petromyzon marinus L. J. Biochem. 114:179Y184.
HOYE, T. R., DVORNIKOVS, V., FINE, J. M., ANDERSON, K. R., JEFFREY, C. S.,
MUDDIMAN, D. C., SHAO, F., SORENSEN, P. W., and WANG, J. 2007. Details of the
structure determination of the sulfated steroids psds and pads:  New components of the
sea lamprey (Petromyzon marinus) migratory pheromone. J. Org. Chem. 72:7544Y7550.
LI, W., SORENSEN, P. W. and GALLAHER, D. 1995. The olfactory system of migratory adult
sea lamprey (Petromyzon-marinus) is specifically and acutely sensitive to unique bileacids released by conspecific larvae. J.Gen. Physiol. 105:569Y587.
LI, W., SCOTT, A. P., SIEFKES, M. J., YAN, H. G., LIU, Q., YUN, S-S., and GAGE, D. A.
2002. Bile acid secreted by male sea lamprey that acts as a sex pheromone. Science.
296:138Y141.
Li, W., SCOTT, A. P., SIEFKES, M. J., YUN, S-S., and ZIELINSKI, B. 2003. A male
pheromone in the sea lamprey (Petromyzon marinus): an overview. Fish Physiol.
Biochem. 28:259Y262.
74

LI, W. 2005. Potential multiple functions of a male sea lamprey pheromone. Chem. Sens.
30:i307Yi308.
MANION, P. J. and HANSON, L. H. 1980. Spawning behavior and fecundity of lampreys from
the upper three Great Lakes. Can. J. Fish. Aquat. Sci. 37:1635Y1640.
PICKERING, A. D. 1977. Sexual dimorphism in the gills of the spawning river lamprey,
Lampetra fluviatilis L. Cell Tissue Res. 180:1Y10.
POLKINGHORNE, C. N., OLSON, J. M., GALLAHER, D. G. and SORENSEN, P. W. 2001.
Larval sea lamprey release two unique bile acids to the water at a rate sufficient to
produce detectable riverine pheromone plumes. Fish Physiol. Biochem. 24:15Y30.
SCHERER, M., GNEWUCH, C., GERD, S., and GERHARD, L. 2009. Rapid quantification of
bile acids and their conjugates in serum by liquid chromatography - tandem mass
spectrometry. J. Chromatography B. 877:3920Y3925.
SIEFKES, M. J., SCOTT, A. P., ZIELINSKI, B., YUN, S-S., and LI, W. 2003. Male sea
lampreys, Petromyzon marinus L., excrete a sex pheromone from gill epithelia. Biol.
Repro. 69:125Y132.
SORENSEN, P.W., FINE, J. M., DVORNIKOVS, V., JEFFREY, C. S., SHAO, F., WANG, J.,
VRIEZE, L. A., ANDERSON, K. R. and HOYE, T. R. 2005. Mixture of new sulfated
steroids functions as a migratory pheromone in the sea lamprey. Nat. Chem. Biol.
1:324Y328.
VENKATACHALAM, K.V., LLANOS, D. E., KARAMI, K. J., and MALINOVSKII, V. 2004.
Isolation, partial purification, and characterization of a novel petromyzonol
sulfotransferase from Petromyzon marinus (lamprey) larval liver. J. Lipid Res.
45:486Y495.
VENKATACHALAM, K. V. 2005. Petromyzonol sulfate and its derivatives: the
chemoattractants of the sea lamprey. BioEssays. 27:222Y228.
YUN, S-S., SCOTT, A. P., and LI, W. 2003. Pheromones of the sea lamprey, Petromyzon
marinus L.: structural studies on a new compound, 3-keto allocholic acid, and 3-keto
petromyzonol sulfate. Steroids. 68:297Y304.

75