MOLECULAR AND FUNCTIONAL STUDIES OF PARTHENOGENETIC
EMBRYONIC STEM CELLS
By
Neli Petrova Ragina

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
DOCTOR OF PHILOSOPHY
Genetics
2011

ABSTRACT
MOLECULAR AND FUNCTIONAL STUDIES OF PARTHENOGENETIC
EMBRYONIC STEM CELLS
By
Neli Ragina
Parthenogenetic Embryonic Stem Cells (P-ESCs) are derived from
Parthenogenetically activated embryos (PgEs) at the blastocyst stage. PgEs are
created without sperm contribution, followed by inhibition of the second polar
body extrusion which renders the PgE genome diploid, consisting of duplication
of only the maternal genomic complement. Due to their exclusively maternal
genomic complement, PgEs cannot develop to term. However, P-ESCs can be
successfully derived. P-ESCs are morphologically indistinguishable from normal
fertilized biparental embryonic stem cell (B-ESCs), they are pluripotent, i.e. can
be propagated in vitro for prolong period of time while still keeping their
embryonic stem cells characteristics, and when differentiated in vivo can give rise
to tissues from the three germ layers – ectoderm, endoderm and mesoderm.
Despite their broad differentiation plasticity, P-ESCs, exhibit some limitations to
contribute to endoderm and mesoderm muscle tissues. This phenomenon has
been attributed to deregulation of imprinted genes. Imprinted genes are subset of
genes which are differentially expressed from the maternal and paternal alleles.
H19 is a paternally imprinted gene whose expression in P-ESCs is highly

upregulated. A great body of literature suggests that H19 is critical for proper
development of PgEs since parthenogenetic offspring has been successfully
derived by deleting the H19 coding region from one of the maternal
chromosomes. H19 has been found to play an important role for P-ESCs
differentiation potential as well. Therefore we hypothesized that modulation of
H19 gene expression in P-ESCs by using a small hairpin RNA (shRNA)
approach, will enhance the ability of these cells to give rise to endoderm and
mesoderm-muscle derivatives in in vivo and in vitro assays.
Our study focuses on developing a model for stable and efficient downregulation
of H19 in human, primate and mouse P-ESCs. We further follow the
differentiation potential of mouse P-ESCs using an in vivo teratoma formation
assay and an in vitro study whereby the P-ESCs are induced to give rise to
beating cardiomyocytes.
Our data revealed that P-ESCs with stable H19 downregulation can be derived
from human, primate and mouse P-ESCs. Moreover, we showed for the first
time, to our knowledge that suppression of H19 in P-ESCs resulted in an
increased propensity of the cells to give rise to endoderm and mesoderm muscle
derivatives in vivo as well as to higher incidence of beating embryo bodies in an
in vitro differentiation assay.
In conclusion, our study provides further knowledge to the biology of P-ESCs and
the effect of the imprinted genes, H19 in particular. Future studies would
elucidate the molecular mechanism through which H19 exerts its effect and the
potential applicability of P-ESCs for autologous stem cell therapy.

COPYRIGHT BY
NELI PETROVA RAGINA
2011

ACKNOWLEDGMENTS

I would like to acknowledge my mentor Dr. Jose B. Cibelli (Cellular Reprogramming
Laboratory, Department of Animal Science, Michigan State University, East Lansing,
Michigan, USA) for the privilege to be his graduate student and for all his help and
guidelines throughout my study. I would like to thank my committee members; Dr. Vilma
Yuzbasiyan-Gurkan (Department of Microbiology and Molecular Genetics, Michigan
State University, East Lansing, Michigan, USA), Dr. Laura McCabe (Department of
Radiology, Michigan State University, East Lansing, Michigan, USA), Dr. Pamela
Swiatek (Division of Biology and Medicine, Brown University, Providence, Rhode Island,
USA) and Dr. Pat Venta (Department of Microbiology and Molecular Genetics, Michigan
State University, East Lansing, Michigan, USA), who was appointed to my committee as
a Genetic program representitative, for their valuable scientific input and support. I
would like to thank the Genetic Program, and specifically Dr. Barbara Sears and
Jeannine Lee for leading one of the best graduate programs that ensures that each
student gets the best of knowledge and research opportunities necessary to build up a
successful scientific career. I would like to also acknowledge Karianne Schlosser
(Division of Hematology/Oncology, Children’s Hospital, Boston, Massachusetts, USA),
Dr. Jason G. Knott (Developmental Epigenetics Laboratory, Department of Animal
Science, Michigan State University, East Lansing, Michigan, USA), Dr. Arif Kocabas
(Yale School of Medicine, Connecticut, USA), Dr. Zeki Beyhan (Sher Institute for
Reproductive Medicine, Nevada, USA), Dr. Patricia K. Senagore (Department of
Physiology, Michigan State University, East Lansing, Michigan, USA), Dr. Eun Ah
v

Chang (Cellular Reprogramming Laboratory, Department of Animal Science, Michigan
State University, East Lansing, Michigan, USA), Dr. Walid D. Fakhouri (Department of
Microbiology and Molecular Genetics, Michigan State University, East Lansing,
Michigan, USA), Dr. Brian C. Schutte (Department of Microbiology and Molecular
Genetics, Michigan State University, East Lansing, Michigan, USA) and Dr. Matti Kiupel
(Department of Pathobiology and Diagnostic Investigation, Michigan State University,
East Lansing, Michigan, USA) for being great teachers, mentors and scientific advisors.
I would also like to acknowledge the HistoPathology Laboratory at Michigan State
University and especially Amy S. Porter and Kathy A. Joseph for their help with
processing my teratoma samples.
I would like to acknowledge Dr. Hasan H. Otu, (Harvard University, MA, USA) for his
assistance with predicting mir675 target genes
I would like to acknowledge Dr. Juan Pedro Steibel, Animal Science Department,
Michigan State University for his assistance with the statistical data.
I would like to acknowledge all past and present members of the Cellular
Reprogramming Laboratory, Michigan State University.
I would also like to acknowledge the “Van Andel Institute”, Grand Rapids, MI, for their
cooperation.

I appreciate the support from the Michigan State University (MSU) Foundation, MSU’s
Vice President of Research, and the Michigan Agricultural Experiment Station (MAES),
as well as the Naylor Family Foundation.

vi

This study was funded in part by US National Institutes of Health grant DE13513
(B.C.S.).

vii

TABLE OF CONTENTS

LIST OF TABLES..…………………………………………………...x
LIST OF FIGURES…………………………………………………...xi
KEY TO ABBREVIATIONS………………………………………...xv
CHAPTER 1: LITERATURE REVIEW……………………………...1
Abstract…………………………………………………………………2
Introduction…………………………………………………………….3
Conclusion……………………………………………………...........35
Figures and Tables…………………………………………............38
References…..…………………………………..............................50
CHAPTER 2: MODULATION OF H19 EXPRESSION IN
PRIMATE (Cynomolgus macaque) PARTHENOGENETIC
EMBRYONIC STEM CELLS (Cyno1 P-ESCs) USING
H19ShRNA……………………………………………………….......61
Abstract……………………………………………………………….62
Introduction…………………………………………………………...64
Materials and Methods…………………………............................68
Results and Discussion……………………………………………..74
Conclusion……………………………………………………...........78
Figures and Tables…………………………………………………..81
References….……………………………………………….............97

viii

CHAPTER 3: H19 CONTROLS THE DIFFERENTIATION
POTENTIAL OF MOUSE P-ESCs UPON DIFFERENTIATION IN
VIVO…………………………………………………………...........115
Abstract……………………………………………………………...116
Introduction………………………………………………………….117
Materials and Methods…………………………..........................119
Results and Discussion……………………………………...........131
Conclusion…………………………………………………………..140
Figures and Tables ………………………………………………..146
Supplemental Figures and Tables….........................................175
References….………………………………………………...........197
CHAPTER 4: CONCLUSIONS, FUTURE DIRECTIONS AND
PRELIMINARY RESULTS………………………………………..207
Dissertation Conclusions…………………………………………..208
Future Directions………………………………….........................213
Preliminary results (Human P-ESCs)…………..........................216
A. Aims…………………………………………………………...216
B. Materials and Methods………………………………………216
C. Results and Discussion……………………………………...222
D. Figures and Tables…………………………………………..228
E. References……………………………………………………249

ix

LIST OF TABLES

Table 1.1 Diseases and syndromes resulting from abnormal imprinting
mechanisms …………………………………………………………………………………...38
Table 2.1 qRT-PCR Primers Table………………………………………………………….95
Table 2.2 Summary of the Cyno1 oocyte donor (Buttercup) derived fibroblast cells at
p4, Cyno1p47 and Cyno1p60 P-ESCs (Cell Line Genetics, WI, USA)…………………..96
Supplemental Table 3.1 Cytogenetic analysis of B-ESC, P-ESC, and transgenic PESC cell ines………………………………………………………………………………….191
Supplemental Table 3.2 Mouse PCR Primer Sequences………………………………193
Supplemental Table 3.3 Mouse qRT-PCR Primer Sequences………………………..194
Supplemental Table 3.4 Bisulfate Sequencing Primers………………………………..196
Supplemental Table 3.5 H19 small hairpin RNA (shRNA) sequence information…...196
Table 4.1 Human qPCR Primers…………………………………………………………...248

x

LIST OF FIGURES

Figure 1.1 Construction of diploid embryos with genomes derived from
a single sex……………………………………………………………………………………..40
Figure 1.2 Stem cell hierarchy……………………………………………………………….42
Figure 1.3 Characterization of parthenogenetic Cyno-1 embryos and
derived cell lines……………………………………………………………………………….44
Figure 1.4 In vivo differentiation of Cyno-1 cellsCells were injected i.p.
(IntraPeritoneal) in severe combined immunodeficient mice……………………………..45
Figure 1.5 In vitro differentiation of primate Cyno-1 P-ESCs…………………………….46
Figure 1.6 Morphology, AP and Immonustaining of stem cell markers for human
Parthenogenetic Embryonic Stem -1 (hPES -1) cell line………………………………….48
Figure 2.1 Experimental Outline (part of the figure was adopted from “Stem Cells:
Scientific Progress http://stemcells.nih)..........................................................................81
Figure 2.2 Derivation (A-B) and Immunocytochemical staining (C-E) of Cyno1 P-ESCs;
Parthenogenetically activated Cyno1 oocytes ……………………………………………82
Figure 2.3 qRT-PCR Analysis of the expression levels of HcRed (A) and beta actin (B)
and the maternally expressed H19 (C) and paternally expressed IGF2 (D,E) genes….83
Figure 2.4 Teratomas from Cyno1 P-ESCs give rise to derivatives of all three germ
layers- ectoderm, endoderm, and mesoderm (A-K)……………………………………….87
Figure 2. 5 Downregulation of H19 in Cyno1 P-ESCs. Cyno1 P-ESC colony stably
transfected with H19shRNA expressing vector, 14days post Neomycin………………..88
xi

Figure 2.6 qRT-PCR Analysis of the expression levels of the maternally expressed H19
and P57 (Figure 5A and E respectively) and paternally expressed IGF2, NDN, PEG10
and SNRPN (Figure 5B, C, D and F respectively) genes…………………………………89
Figure 3.1 Alterations in H19/Igf2 expression and DMR methylation in P-ESCs……..147
Figure 3.2 Elevated levels of H19 expression persist during P-ESCs differentiation in
vivo…………………………………………………………………………………………….154
Figure 3.3 Lack of mesoderm muscle derivatives and downregulation of mesoderm
specific transcripts in P-ESCs upon differentiation in vivo……………………………….158
Figure 3.4 Stable and efficient down-regulation of H19 mRNA levels in mouse PESCs…………………………………………………………………………………………..161
Figure 3.5 Downregulation of H19 expression in P-ESCs promotes normal endoderm
and mesoderm differentiation in vivo………………………………………………………166
Figure 3.6 Derivation of beating embryo bodies (EBs) from B-ESCs, Control P-ESCs,
and Control vector (Con.vector) and H19shRNA P-ESCs……………………………….172
Supplemental Figure 3.1 Mouse Rosa 26 P-ESCs are morphologically
indistinguishable from mouse Rosa 26 biparental ES (B-ESCs) cells (A and B) and stain
positive for β-galactosidase expression (C and D)……………………………………….175
Supplemental Figure 3.2 Mouse Rosa 26 P-ESCs and Rosa 26 B-ESCs express Oct4
and SSEA1 in mouse as shown by immunocytochemical analysis…………………….176
Supplemental Figure 3.3 Hematoxylin-Eosin (H&E) staining of mouse B-ESCs and PESCs (P-ESCs 1 and P-ESCs 2) derived teratomas indicating the ability of these cells
to give rise to all three germ layers when differentiated in vivo…………………………177
Supplemental Figure 3.4 Immunohistochemical staining of teratoma sections derived
from mouse Rosa 26 B-ESC and P-ESC lines confirming the identity of the germ layer
derivatives…………………………………………………………………………………….178

xii

Supplemental Figure 3.5 Laser Capture Microdisection (LCM)………………………179
Supplemental Figure 3.6 Delta Np63 and TAp63 expression is indicative of germ layer
commitment…………………………………………………………………………………...181
Supplemental Figure 3.7 Immunohistochemical staining for delta Np63 of mouse BESCs derived teratomas using conjugated Alkaline Phosphates secondary antibody
(red color) (A-C)………………………………………………………………………………186
Supplemental Figure 3.8 Down-regulation of H19 expression in Mouse Embryonic
Fibroblasts (MEFs) infected with two different H19shRNA oligos (H19shRNA#1 and
H19shRNA#2) by qRT-PCR………………………………………………………………...187
Supplemental Figure 3.9 Down-regulation of H19 expression in mouse P-ESCs
infected with two different H19 shRNA expressing pLenti-DEST/Hygro -EGFP shRNA
expressing lentiviral and pMSCV-Hygro-EGFP shRNA expressing
retroviral vectors……………………………………………………………………………...188
Supplemental Figure 3.10 Schematic representation of the mir675 region that is a
perfect 11bp match to the TP63 Trans Activating (TA) domain and therefore may affect
the transcription or regulate the translation of TP63 mRNA……………………………..189
Supplemental Figure 3.11 EGFP fluorescence (B) and bright field (A) of mouse PGES
cells infected with pMSCV-Hygro-EGFP - H19 shRNA retroviral vector……………….190
Figure 4.1 Immunocytohemistry for the pluripotency markers NANOG (NAN), LIN28,
SSEA4, SOX2, and OCT4 in human ES cells H1 and in human
P-ESCS (LLC-6P)...........……………………………………………………………………228
Figure 4.2 Hematoxylin-Eosin (H&E) staining of human HES H1 derived teratomas
indicating the ability of these cells to give rise to all three germ layers when
differentiated in vivo………………………………………………………………………….229
Figure 4.3 Hematoxylin-Eosin (H&E) staining of human LLC-6p cells derived teratomas
indicating the ability of these cells to give rise to all three germ layers when
differentiated in vivo………………………………………………………………………….230

xiii

Figure 4.4 Quantification (%) of germ layer derivatives: ectoderm, endoderm and
mesoderm in teratomas derived from wild type HES, H1 cells and in human P-ESCs
(LLC-6p).………………………………………………………………………………………231
Figure 4.5 Fluorescent Activated Cell Sorting analysis (FACS) on the apoptotic rate of
HES H1 and human LLC-6p cells measured by Annexin V expression………………..232
Figure 4.6 Quantification of mRNA abundance of the maternally expressed H19 and
UBE3A and the paternally expressed IGF2, DIO3 and NDN in HES H1 and LLC-6p cells
by qRT-PCR…………………………………………………………………………………..233
Figure 4.7 Quantification of mRNA abundance of the maternally expressed H19 (A, B),
UBE3A (K, L) and the paternally expressed IGF2 (C, D), DIO3 (M, N), DNA
Methyltransferase1 (DNMT1) (E, F), DNA Methyltransferase3A (DNMT3A) (G, H) and
DNA Methyltransferase3B (DNMT3B) (I, J) in HES H1 and LLC-6p cells from different
passages by qRT-PCR………………………………………………………………………236
Figure 4.8 Schematic representation of H19shRNA and H19asRNA expressing plasmid
(A) and Retroviral (B-E) vector constructs…………………………………………………245
Figure 4.9 H19shRNA delivery in Hela cells…………………………………………….246
Figure 4.10 PCR-Agarose Gel Electrophoresis…………………………………………..247

xiv

KEY TO ABBREVIATIONS



Parthenogenetic Embryonic Stem Cells (P-ESCs)



Androgenetic Embryonic Stem Cells (A-ESCs)



Parthenogenetic Embryo (PgE)



Androgenetic Embryo (AgE)



Biparental Embryonic Stem Cells (B-ESCs)



Inner Cell Mass (ICM)



Maturation Promoting Factor (MPF)



Cytostatic Factor (CSF)



Days post fertilization (DPF)



Days post activation (DPA)



Wild type (wt)



Fertilized embryos (FEs)



Passage (p)



Metaphase II (MII)



Dimethylaminopurine (DMAP)



IntraPeritoneal (i.p)



Macaca fasciculatis /Cynomolgus macaque derived PGESCs( Cyno1 P-ESCs)



Macaca fasciculatis /Cynomolgus macaque derived B-ESCs (CMK6)



Cyno1 transfected with the H19shRNA expressing plasmid vector (Cyno1
H19shRNA cells)

xv



Cyno1 cells transfected with the empty control plasmid vector (Cyno1 Con.vector
cells)



Human Embryonic Stem Cells (HES cells)



small hairpin RNA (shRNA)



injection- human Chorionic Gonadotrophin (hCG)



Mouse Embryonic Fibroblast (MEF)



Messenger RNA (mRNA)



Total RNA (tRNA)



Laser Capture Microdissection (LCM)



P-ESCs infected with H19shRNA expressing retroviral vector (H19shRNA cells)



P-ESCs infected with the control viral vector (Con.vector cells)



College of American Pathologists (CAP)



Low Power Fields (LPFs)



quantitative Real Time PCR (qRT-PCR)



Differentially Methylated Region (DMR)



Nuclear Transfer (NT)



Wild Type B-ESCs (WT cells)



Major Histocompatibility Complex antigens (MHC antigens)



Embryoid Bodies (EB)



micro RNA 675 (mir675)



long non coding RNAs (ncRNA)



Embryonic Stem Cells (ESCs)



Human Parthenogenetic Embryonic Stem Cells (LLC 6p)
xvi



Antisense RNA (asRNA)

xvii

DISSERTATION CHAPTER 1

TITLE
LITERATURE REVIEW

1

ABSTRACT
Parthenogenesis is a naturally occurring process where the oocyte starts embryonic
development without sperm contribution. In mammals, parthenogenetic embryos (PgE)
cannot develop to term. The most commonly used method of artificially making diploid
PgEs is via chemical activation of the egg and by preventing extrusion of the second
polar body which renders the embryo genome diploid, having only maternal genetic
material. Parthenogenetic Embryonic Stem cells (P-ESCs) are derived from the Inner
Cell Mass (ICM) of parthenogenetic (PgE) embryo at the blastocyst stage. They are
pluripotent i.e. they can differentiate into all three germ layers ecto-, meso- and
endoderm and can be propagated as stem cells in culture for prolonged periods of time.
However, P-ESCs have lower differentiation capacity in vivo (in chimeras and teratoma
formation) and in vitro (embryo body formation); contributing poorly to muscle tissues
and endoderm derivatives. P-ESCs have been derived from mouse, rabbit, monkey and
human embryos. P-ESCs offer an easily obtainable pool of stem cells that can be used
as a source of autologous tissues albeit limited to females in reproductive age. P-ESCs
derivation does not require destruction of a viable embryo and therefore bypasses the
ethical debates surrounding the use of naturally fertilized embryos.

2

INTRODUCTION
Parthenogenesis is the process by which the oocyte starts embryonic development
without paternal contribution i.e the resulting PgE consists of only maternal genome
complement. It is a natural way of reproduction in some lower organisms.
The opposite process is called Androgenesis, i.e. embryos having only paternal genome
(AgE). In mammals, Parthenogenetic (PgE) and Androgenetic (AgE) embryos are not
compatible with life and fail to thrive during the post-implantation stages [1].
Parthenogenetic fetuses exhibit severe growth and differentiation defects, failure to
establish proper placental growth and die early in gestation. One of the major reasons
for this phenomenon has been attributed to deregulation of imprinted genes [2],[3]
(Figure1.1).

Morphologically PgEs develop into normal embryo but fail to establish a functional
placenta able to support embryo growth. In contrast AgEs extensively develop the extra
embryonic membranes but lack proper formation of the embryo. These two phenomena
reveal that genetic material derived from the opposite sexes exhibit differential effects
on the offspring development and growth. In humans a subset of gestational
trophoblastic diseases, found in women have been attributed to spontaneous
parthenogenetic or androgenetic activation of the oocyte. For example it has been found
that complete moles are androgenetic by origin. The tumor mass of such a mole
represents a mixture of extra-embryonic membranes-like structures and the cytogenetic
analysis confirmed that the cells in these lesions have only the paternal genomic

3

complement. In contrast to the complete moles, a specific subclass of benign ovarian
teratomas, have been found to consist of parts of an embryo- hair, teeth, cartilage etc.
Data showed that the genetic material of these teratomas is exclusively of maternal
origin. How the complete moles and ovarian teratomas arise has been extensively
studied. It has been suggested that activation of an enucleated oocyte by sperm entry
may trigger the formation of these types of moles. Ovarian teratomas, on the other
hand, may arise from activation of the oocyte by an enucleated sperm or by other
environmental or age related stimuli. Regardless of the mechanism involved in the
development of these two types of gestational trophoblastic diseases, these pathologies
once again demonstrate the influence that the two parental genomes exert on embryo
development and differentiation – the paternal genome driving placentation and the
maternal genome-supporting the formation of the embryo proper [4].
Although parthenogenetic embryos are not viable, in mouse, P-ESCs derived from the
ICM of parthenogenetically activated oocytes were able to give rise to viable animals,
called chimeric animals, when inserted into a fertilized mouse blastocyst. The tissues
and organs of such chimeric animals consist of mixture of cells derived from the injected
P-ESCs and the cells of the host embryo. In primates, parthenogenetic stem cells (PESCs) have been derived from Macaca Fascicularis (called Cyno1 P-ESCs) and from
Rhesus Monkey. However, their contribution to a chimeric embryo in non-human
primates has not been tested due to ethical concerns.
In humans, parthenogenetic ES cells have also been successfully derived in vitro from
human parthenogenetic blastocysts [5], [6-8]. Moreover, a child whose peripheral blood
leukocytes were entirely parthenogenetic by origin has been reported [9]. This

4

phenomenon indicates that although parthenogenetic development in utero is aborted
and rarely detected, a chimeric individual can develop from a single zygote [9-10].

PgEs can be artificially derived by chemical activation of the oocyte using different
compounds which allow the oocyte to exit from Metaphase II (MII) arrest. The role of
these compounds is to activate the oocyte by inactivating the activity of the maturation
promoting factor (MPF) and cytostatic factor (CSF) directly or indirectly, by reducing
protein synthesis and/or protein phosphorylation [11]. Depending on the protocol used,
the extrusion of the second polar body can be prevented, rendering the embryonic
genome diploid [12]. Since the parthenogenetic embryos are created without sperm
contribution they only contain a duplication of the maternal genome. This is possible by
preventing the extrusion of the second polar body using nontoxic microfilament
inhibitors such as cytochalasin B and Dimethylaminopurine (DMAP) [13].

Parthenogenetic Embryonic Stem Cells (P-ESCs) are prone to chromosomal
aberrations such as loss of one of the X-chromosomes which renders the cells
aneuploid. This phenomenon is mostly due to the presence of two active XX
chromosomes which is associated with global reduction of DNA methylation. In the PESCs as well as in normal fertilized female Biparental Embryonic Stem Cells (B-ESCs)
there is a selective mechanism against loss of methylation which may provide the
tendency of X-chromosome instability [14].

5

PARTHENOGENETIC EMBRYONIC STEM CELLS IN HUMAN AND NON-HUMAN
PRIMATES

Derivation of human and primate PgEs and P-ESCs cells
Non-human primates are the closest species to Homo sapiens in the tree of evolution
and therefore are excellent model for studying human development and diseases. PESCs from non-human primate and human parthenogenetically activated oocytes have
recently been derived [6-8]. These cells offer a valuable tool for studying the
developmental, differentiation and functional potential of the P-ESCs in the context of
their clinical application in organ and tissue transplantation in humans.
Primate P-ESCs have been derived for the first time by Cibelli et al in 2002 from
Macaca fascicularis PG embryos and are called Cyno-1 P-ESCs [15] (Figure1.3).The
protocol for derivation of primate PG embryos calls for the use of ionomycin for
parthenogenetic activation of the oocyte followed by DMAP which prevents the
extrusion of the second polar body. Primate P-ESCs are derived from the ICM of PG
embryos at blastocyst stage. These cells exhibit normal ESC morphology i.e. small
cytoplasmic/nuclear ratio, numerous nucleoli and cytoplasmic lipid bodies. They stain
positive for markers for primate ESCs and express pluripotency markers such as OCT4.
They exhibit high telomerase activity and are karyotypically normal (42XX) [16]. The
capacity of the Cyno-1 P-ESCs to differentiate was tested in vivo by teratoma formation.
Teratoma derived from Cyno-1 P-ESCs demonstrated these cells can give rise to cell
derivatives from all three germ layers meso-, ecto- and endoderm. These include
6

cartilage, muscle and bone (mesoderm), neurons, melanocytes and hair follicles
(ectoderm), and intestinal and respiratory epithelial (endoderm) with a preference
towards ecto- and endoderm derivatives [15]. Teratomas derived from Cyno-1 P-ESCs
consisted of mature differentiated tissues with a little contribution of mitotically dividing
cells which indicates their benign origin (Figure1.4). Cyno-1 P-ESCs were successfully
differentiated in vitro into neurons and were capable of producing neural specific
mediators such as dopamine and serotonin. Further characterization of Cyno-1 cells
derived neurons demonstrate that these cells express tyrosine hydroxylase and are
electrophysiologically active [16-17]. When dopamine neurons derived from Cyno-1
cells were transplanted in vivo in rodents and in primate models of Parkinson disease,
they were able to maintain stable phenotype, express dopaminergic markers and show
long term survival [17-18] (Figure1.5).
Primate Parthenogenetic Stem cells have been also derived from Rhesus Monkey using
the similar protocols. Briefly, these are protocols using electroporation as a method for
oocyte activation and Cytochalasin B or Roscovitine for prevention of the second polar
body extrusion [11, 19]. Similar to Cyno-1 cells, when injected into immunocompromised mice, Rhesus P-ESCs were able to form teratomas also consisting of cell
derivatives of all tree germ layers. The Rhesus monkey P-ESCs were morphologically
similar to normal biparental stem cells derived from the same species. They expressed
the key-pluripotency markers such as OCT4, SSEA-3 and -4, TRA-1-60, NANOG, SOX2, TDGF, LEFTYA and TERT and were karyotypically normal [19].

7

Genetic homozygosity is potentially one of the obstacles to potential implication of the
P-ESCs for cell replacement therapy due to the possibility of immune rejection.
However, Dighe et al. have demonstrated that diploid Rhesus Monkey P-ESCs restored
heterozygosity at 64% of the examined loci on average in the five P-ESC cell lines
analyzed by using a microsatellite analysis, also called Short Tandem Repeat analysis
(STR) [19]. Moreover, the Rhesus Monkey P-ESCs demonstrated re-establishment of
heterozygosity within 15 analyzed microsatellite markers of the Major Histocompatability
Region (MHC) in three of the five Rhesus Monkey P-ESCs tested. This rendered the
genotype of the MHC region of these three cell lines identical to the egg donors. The
ability to generate isogenic MHC Rhesus Monkey P-ESCs suggests the potential
application of these cells as a source of a patient’s own MHC-matched cells for
therapeutic cell replacement therapy. Dighe et al. have also genotyped one Cyno-1 PESC cell line for the 15 microsatellite markers of the MHC region. This Cyno-1 P-ESC
cell line was homozygous for the MHC region STR markers [19].
Human parthenogenetic embryonic stem cells have been derived only recently in 2007
by International Stem Cell Corporation (ISCC) [6, 8]. The induction of PG development
of human oocytes calls for 5 µM Calcium Ionophore-A23187 (Sigma, St. Louis, MO) for
5 min followed by 10 µg/mL puromycin (Sigma) or 1mM 6-DMAP (Sigma, St. Louis, MO)
for 4 hours [6]. The human P-ESCs are then derived by mechanical slicing of the ICM
and plating onto fresh feeder layers. The human P-ESCs stained positive for the major
pluripotency markers such as SSEA-3, SSEA-4, TRA1-60, TRA1-81, and OCT4 similar
to non-human primate P-ESCs and also exhibit similar morphology characterized by
tightly packed colony with prominent nucleoli, and a small cytoplasm to nucleus ratio

8

(Figure1.6). Upon induction of differentiation in vitro, the human P-ESCs give rise to
derivatives of all three germ layers – ecto-, endo- and mesoderm [6]. DNA profiling of
the human P-ESCs revealed that these cells can also give rise to MHC matched PESCs, isogenic to the oocyte donor [6]. Recently a derivation of new lines of human PESCs have been reported [20].
Despite the ability to produce karyotypically normal and donor-matched at the MHC loci,
in human and non human P-ESCs, a major obstacle to a potential successful
application of parthenogenetic stem cells in clinical trials is the deregulation of imprinted
genes, which may render these cells prone to tumorogenesis and other abnormalities
upon engraftment/transplantation.

Imprinting in Human and Primate Parthenogenetic Stem Cells
The phenomenon of imprinting refers to the differential expression of the maternally or
paternally inherited alleles of specific genes (named imprinted genes) [21]. Thus a
paternally imprinted gene is silenced when inherited from the paternal chromosome and
expressed when inherited from the maternal chromosome and vice versa. The
expression pattern changes do not occur as a result of changes of the underlying DNA
sequence but as a result of different epigenetic modifications such as DNA methylation,
histone modification, spreading of non-coding RNA molecules, small interfering RNAs,
and other yet unidentified, factors [22]. The imprinting pattern of the genes is initially
erased and then re-established during germ cell development in a parent-specific
manner and is later maintained in all tissues and organs. The expression of the
imprinted genes in most cases is under the control of an imprinting control region (ICR),

9

known also as the differentially methylated region (DMR), which is differentially
methylated at Cytosin-5 in CpG dinucleotide repeats. Imprinted genes are usually found
in clusters. In most cases, the differential methylation of the ICR can regulate the
expression of an imprinted gene cluster both positively and negatively [23]. In humans,
loss of imprinting of certain genes such as IGF2, H19, SNURF/SNRPN (small nuclear
ribonucleoprotein polypeptide N/ SNRPN upstream reading frame), NDN (Necdin
homolog) and others, can lead to the development of several congenital disorders and
cancer (Table1.1). Parthenogenetic embryos and embryonic stem cells exhibit
deregulation of imprinted genes due to their uni-parental origin, i.e. they lack the
paternal set of the imprinted genes [24-26]. Loss of imprinting is one of the major
causes for developmental failure in parthenogenetic embryos and for the limited
differentiation potential of the parthenogenetic stem cell [3] ,[24-28]. Additional changes
in imprinting can arise in the process of derivation of parthenogenetic embryos due to
reasons that are yet to be determined. Loss of imprinting of the parthenogenetic stem
cells can occur during culturing or manipulation of these cells in vitro. This holds true
and is extensively investigated in primate P-ESCs and in normal primate biparental
embryonic stem cells which are generated from a normally fertilized embryos [29]. The
expression pattern and methylation status of two of the most extensively studied gene
clusters –one on chromosome 11p15 and the other on chromosome 15p11 in primates
and humans have been extensively investigated [29]. Chromosome 11p15.5 harbors
IGF2 and H19 imprinted genes which expression is regulated by a common ICR, also
called DMR that lies between the two genes. In the maternal allele the DMR is not
methylated which allows an insulator protein to bind and prevent action of an enhancer

10

downstream of H19 to stimulate IGF2 expression and thus H19 is expressed and IGF2
is silenced. On the paternal allele DMR is methylated on the CpG dinucleotides, and the
enhancer stimulates IGF2 expression while H19 is silenced.
The region on chromosomes 15q11-q13 is characterized with a set of oppositely
imprinted genes the most studied of which are SNURF/SNRPN, UBE3A (Ubiquitin
protein ligase E3A) and NDN. NDN is paternally expressed gene i.e. maternally
imprinted. SNURF/SNURPN region is controlled by an imprinted center located at the 5’
end of the SURF/SNURPN gene [30]. The SNURF/SNURPN gene is expressed from
the paternal allele. UBE3A is maternally expressed gene i.e paternally imprinted in the
opposite direction of SNURF/SNURPN gene and its imprinted expression is restricted to
certain tissues [30].
Loss of Imprinting of IGF2 and H19 and other imprinted genes has been associated with
multiple congenital disorders in humans such as Beckwith-Wiedemann syndrome [31]
(IGF2 and H19), Prader-Willi and Angelman syndromes [32]
(SNURF/SNRPN,UBE3Aand NDN ) and many others [33]. In parthenogenetic (PgEs)
embryos and P-ESCs there is a severe deregulation of the imprinted genes with H19
being expressed bi-allelically and therefore upregulated while IGF2 is barely detectable
[3, 34]. H19 is a paternally imprinted gene (i.e. expressed form the maternal allele) and
IGF2 is maternally imprinted (i.e. expressed from the paternal allele) gene. The H19
gene codes for an untranslated mRNA molecule. During embryogenesis H19 mRNA
transcription is activated in tissue specific manner at certain developmental periods
such as in the extra-embryonic cell types at the time of implantation. Later in
development, during mid-gestation, H19 expression is observed in certain tissues and

11

cells most of which are derived from the endoderm and mesoderm germ layer such as
the developing liver, gut, muscle, and kidney. In adult tissues, H19 expression becomes
predominantly restricted to the skeletal muscles, thymus, heart and lungs [35].
Recently, H19 has been implicated to be a part of the “Imprinted Genes Network (ING)”
where any change of the expression levels of an imprinted gene in the network leads to
changes in the expression levels of the connected genes [36-38]. It has been reported
that H19 can function as a long antisense RNA and as a micro RNA (miRNA) [39-40].
The miRNA originates from exon1 of the H19 mRNA precursor and is referred to as
mir675 [41-43].
The IGF2 (insulin-like growth factor 2) gene encodes a member of the insulin family of
polypeptide growth factors that is involved in development and growth. IGF2 promotes
differentiation and migration, inhibits apoptosis and is essential for proper embryo and
placental growth [44]. IGF2 is expressed by the embryo during early pregnancy and
later becomes localized to the cytoplasm of the trophoblast cells, the cells that are
going to contribute to the formation of the placenta and other extra-embryonic organs
[45]. IGF2 is also a potent mitogenic factor. IGF2 is not only over expressed in a
number of human neoplasms [46],[47],[48] but also, leads to malignant
transformations, tumor development and hyperplasia when over expressed in mouse
models [49-51].
Due to deregulation of imprinted genes and IGF2 and H19 in particular, PG embryos
are defective in ICM population maintenance and differentiation and in generation of
multinucleated trophoblastic cells (syncitiotrophoblasts) leading to defective
placentation and embryonic lethality [25, 52].

12

It has been reported that biparental Rhesus monkey embryonic stem cells exhibit loss
of imprinting of H19 and IGF2 due to aberrant methylation of the DMR region [53].
Mitalipov et al. took advantage of the availability of single nucleotide polymorphisms
(SNPs) in the monkey to study the parental-specific methylation pattern of the
H19/IGF2 and SNURF/SNRPN imprinted genes in biparental Rhesus monkey ESCs
[53]. They performed methylation analysis on 17 Rhesus Monkey ESC lines for the
methylation status of the DMR region by bisulfate sequencing and Southern blot using
SNPs genotyping for defining the parent-of origin region. Mitalipov et al. found severe
deregulation of the methylation of the DMR region which leads to bi-allelic expression
of IGF2 and H19 [53]. The methylation status and imprinting expression of
SNURF/SNRPN Imprinting Center (IC) was not affected. These results suggest that
the imprinting status of genes is influenced and can be changed during in vitro
culturing and that different genes have different degree of susceptibility to the
epigenetic changes induced in culture. This is specifically critical and of great concern
for the application and use of primate parthenogenetic - and all parthenogenetic stem
cells in general - in clinics since, as stated, these cells lack the paternal imprints and
additional imprinting defects can accumulate during cell culture. In a later report, the
same group analyzed the imprinted pattern of Rhesus Monkey P-ESCS cell lines [19].
Expression levels of maternally expressed genes such as UBE3A and H19 and
paternally expressed genes such as IGF2, PEG10, DIRAS3, SGCE, PEG3, MEST,
ZIM2, PLAGL1, MAGEL2, MKRN3 and SNRPN were analyzed by reverse
transcription-polymerase chain reaction (RT-PCR) and by Real Time PCR analyses. A
significant expression of paternally expressed genes IGF2, SGCE and DIRAS3 were

13

detected in Rhesus monkey P-ESCS cells which normally are expected to be silenced.
Moreover transcription from some of the other paternally expressed genes i.e.
maternally imprinted was detected. To confirm the gene expression data, the
methylation status of the H19/IGF2 and SNURF/SNURPN Imprinted Control (IC)
regions was evaluated using a methylation-sensitive Southern Blot and Bisulfate
Sequencing Analysis [19]. The methylation profiling of these two well defined
imprinted centers demonstrated sporadic hypermethylation of the H19/IGF2 IC region
which normally is expected to be hypomethylated on both maternal alleles and can
explain the significant upregulation of IGF2 gene expression in Rhesus Monkey PESCS cells reported in this study. The methylation status of SNURF/SNURPN IC
region was, as expected; both maternal alleles were completely methylated [19]. This
data reinforces the notion that that multiple factors such as stem cell derivation, culture
conditions and manipulation, combined with the intrinsic genetic instability that PESCS cells possess, may cause changes in the methylation status and inappropriate
expression of imprinted genes.
The expression pattern of several of the imprinted genes such as H19, IGF2, SNRPN,
NDN, PEG10 and P57 was analyzed in Cyno-1 cells as well by the means of
Quantitative Real Time Polymerase Chain Reaction (qRT-PCR) on cDNA derived from
total RNA (Cibelli, unpublished). As in Rhesus Monkey P-ESCS cells, H19 mRNA
expression levels were significantly higher in the Cyno-1 P-ESCS cells when
compared to that of normal biparental Macaca Fascicularis embryonic stem cells. The
expression of the paternally expressed gene PEG10 was low but detectable while the
expression of another set of paternally expressed genes –SNRPN and NDN was

14

undetectable, as expected according to their parent-of origin imprinting status. P57 is
maternally expressed gene i.e. paternally imprinted and therefore high levels of P57
mRNA expression in Cyno-1 P-ESCS cells were detected compared to a normal
biparental cell line (Cibelli, unpublished). Significant upregulation of IGF2 gene
expression, normally imprinted on the maternal allele, was detected in Cyno-1 PESCS cells, similar to that observed in Rhesus monkey P-ESCS cells. An interesting
observation was that upon downregulation of H19 in Cyno-1 P-ESCS cells by using a
short hairpin RNA (shRNA), the mRNA levels of IGF2 dropped significantly as well.
The same phenomenon was observed upon downregulation of H19 in mouse P-ESCS
cells. The causes of this unexpected observation are yet to be investigated.
The expression patterns of H19, TSSC5, PEG1 and SNURPN have been analyzed in
human P-ESCS cells [6]. The expression of PEG1 and SNRPN, two paternally
expressed genes, was lower but detectable in human P-ESCS cells compared to the
expression levels in normal biparental human embryonic stem cells. This data
indicates that human P-ESCS cells also exhibit deregulation of some of the imprinted
genes analyzed, similar to that observed in non-human primate P-ESCS cell. Another
set of imprinted genes suggested of being important for development of
parthenogenetically derived (PG) embryos and for proper differentiation of P-ESCS
cells are the oppositely imprinted genes DLK-DIO3 located on chromosome 14 in
human and non-human primates. It was recently reported that parthenogenetic mice
can develop to term when the H19 differentially methylated region (DMR) and Dlk1Dio3 intergenic germline -derived DMR region are deleted [54].

15

Thus P-ESCS and ESCs derived from normally fertilized embryos exhibit aberrant
expression of imprinted genes when cultured in vitro. This phenomenon raises a
concerns and put into question the use of these cells in therapy since the majority of
the imprinted genes control cell growth, division and proliferation and may be part of
the development of tumors or disease phenotypes [46],[47],[48], [49-51].
Nevertheless, In mouse models when P-ESCs were induced to differentiate or after
manipulation of the ICR regions of key imprinted genes such as H19, IGF2, DLKDIO3, these cells were able, by yet unknown mechanism, to give rise to terminally
differentiated tissues or to viable animals capable of producing offspring (See below)
[27-28, 54-55].
Despite being important for the embryo development and differentiation, the role of H19
and Igf2 has been strongly implicated in the ethiology of tumor development. As
mentioned above, IGF2 is viewed as a potent mitogen and tumor promoter gene. The
role of H19 in malignant transformation has been controversial. It has been long
believed that H19 is a tumor suppressor and have negative effect on tumor growth [46,
50-51, 56-57]. The tumor suppressor role of H19 comes mostly from mouse studies
(see next chapter) and from clinical studies in patients with Beckwith-Wiedemann
syndrome which is characterized by bi-allelic expression of IGF2 and silencing of H19
expression from the maternal allele. In these patients there is a high incidence of
development of Willms tumors. These tumors have been also found to result from a
mutation in the Wilms tumor gene 1 (WT1), another imprinted gene located in the same
chromosome 11 where H19 and IGF2 genes reside. However, in a 1995 paper
published by Dugimon et al. and in recent studies, it was reported that H19 and/or its

16

product mir675, are over expressed in different types of cancers and they have been
put forward as useful prognostic markers for tumor progression and metastasis [58-64].
In this context, a direct interaction between mir675, Rb and C-Myc in tumor
development, growth and metastasis has been reported [59, 65].

Primate and Human Parthenogenetic Stem Cells – Future Applications and
Concerns;
The rate of the organ transplantations performed in the United States is increasing
[66]. In 2009 a record total of 28,465 organ transplant operations have been
performed compared to 27,965 in year 2008 (New York Organ Donor Network).
Despite the increasing number of organ transplantations, the pool of patients waiting
for organ donations exceeds the supply [67]. There is a lack of awareness in the
American population to the need to donate organs that must be addressed if this gap
between supply and demand wants to be closed.
Even when the donors are available, a major issue in organ and tissue transplantation
continues to be tissue matching. Engraftment of solid organs, tissues, and cells from
unrelated donors carries a high risk of rejection due to lack of compatibility between
the major histocompatible- complex (MHC) alleles of the recipient and donor. This
obstacle can be surpassed by deriving tissues and organs from a cell pool that
contains the patient’s own genome. P-ESCS cells can be an alternative source of
matched cells for women in reproductive age.
In the context of tissue transplantation, primate and human P-ESCS cells have not
been extensively studied yet. More experiments are needed to determine the extent to

17

which these cells can differentiate. Ideally chimeric primate and human P-ESCS
embryos could be generated by injecting P-ESCS cells into a blastocyst of a fertilized
embryo or more stringent yet, by aggregation of P-ESCS cells with tetraploid embryo
(tetraploid complementation experiment)[68-69]. Due to their close relationship to
human, non-human primate P-ESCS offer a valuable tool not only as a model to study
human disease and epigenetic, but also as a model to study their potential to serve as
a future source for cell replacement therapy.
There are two questions still to be answered regarding the plasticity of P-ESCS cells. If
parthenogenesis does not lead to full-term development, due to failure to produce all
organs and tissues of the embryo and the extra-embryonic membranes, how is it
possible that ES cells derived from a parthenogenetic blastocyst can give rise to all
embryonic germ layers? Recent data shows that one of the leading factors is
epigenetic changes in the stem cell genome that occur during in vitro culture
conditions [70]. Some of these culture–induced epigenetic changes may affect a subpopulation of the P-ESCS cells and confer them with growth and/or differentiation
advantages that are preferentially selected for in culture. Therefore, it is of great
importance that terminal differentiation of these cells can be achieved before
transplanting P-ESCS cells derivatives in order to ensure that no pluripotent,
epigenetically abnormal P-ESCS cells exist in the graft that may lead to tumors and/or
may have yet unknown consequences for the recipient.
Current efforts focus on optimizing the non-human primate and human P-ESCS
growth conditions as to minimize the presence of animal proteins and other

18

contaminants in the growth media that have the potential to induce a severe immune
response upon transplantation.
The use of feeder–free system for manipulation and propagation of the non-human
primates and human P-ESCS cells will prevent contamination of the P-ESCS cells
intended for clinical application with feeder layer cells or their metabolite products. This
is another way to ensure the P-ESCS cell purity and thus ameliorate the risk of
rejection upon engraftment into the recipient.

MOUSE PARTHENOGENETIC EMBRYONIC STEM CELLS
Derivation of mouse P-ESCS cells
The first mouse P-ESCS line was described by Kaufman and Robertson in
1983.
Initially, ethanol was used for parthenogenetic activation of the oocyte. This approach
however led to derivation of haploid P-ESCs due to extrusion of the second polar body
[11]. Currently the most efficient method for derivation of P-ESCs is a combination of
strontium to activate the egg followed by treatment with cytochalasin B to prevent the
extrusion of the second polar body. P-ESCS cells are later isolated from the ICM of the
P-ESCs at blastocyst stage, and plated on mitotically inactivated feeder cells. Mouse
P-ESCS cells and mouse P-ESCs represent a unique model for studying imprinting,
embryo development and differentiation.

Mouse Parthenogenetic Embryo Development

19

The influence of the paternal genomes on the formation of the embryo studied using
mouse P-ESCS cells and mouse P-ESCs. It was found that mouse P-ESCs cannot
survive pass 10.5 days post activation (DPA). Surprisingly, Kono and colleagues
succeeded, through series of modifications of the PgE genome, in generating a viable
parthenogenetic offspring.
These modifications were done in the H19/IGF2 DMR regions, and later combined
with modifications of Dlk1/Gtl2 imprinted region. That the imprinted genes are crucial
for PgE development became clear after Kono’s group observed an increase in the
PgE survival after combining two maternal genomes, one coming from fully grown(fg)
oocyte, where the maternal imprint was already established, with a genome from nongrowing (ng) oocyte, where the imprinting pattern was still not set up. These P-ESCs
containing two maternal genomes one from fg and one from ng occyte, were able to
develop until 13.5DPA. The development of PgE to term was allowed after 13kb
deletion of the H19 coding region and the upstream differentially methylated region
(DMR) which controls the coordinate expression of H19 and Igf2 by controlling the
access of these two genes to a downstream enhancer element. Live-born offspring
were obtained after the 13kb H19 and DMR deletion was combined with a deletion of
Dlk1/Gtl2 imprinted control region. These results clearly demonstrated that the
presence of the paternal genome complement is indispensable for proper embryo
development in mammals and the mechanism by which the paternal genome
influences the embryo development lies at the bases of the imprinted genes function,
H19/Igf2 and Dlk1/Gtl2 genes in particular. Due to the use of mouse P-ESCs we know
that the paternally expressed genes are critical for the proper embryo growth and

20

development of the extra-embryonic membranes, placenta in particular and muscle
development. On the other hand the maternally expressed genes control for the proper
development of the embryo proper. That the paternal genome is required for proper
development of the extra-embryonic membranes is revealed by the inability of the PESCs to form functional placenta. It has been found [52] that P-ESCs exhibit a primary
trophoblast formation which cannot be further developed due to defects in the
proliferation and maintenance of trophoblast cells. The placental formation in mouse
P-ESCs can be improved by addition of Igf2 or by serial nuclear transfers [71-72]. Both
of these methods act trough supplementing the embryo with the missing paternally
expressed gene (Igf2) [71] which is crucial for embryo growth or by down regulation of
the maternally expressed genes, H19 and Peg10 in particular, which can occur
through serial nuclear transfers [72]. Although in P-ESCs there is a silencing of the
paternally expressed genes, in a study by Chao Li et al was reported that Igf2
transcript can be detected at 3.5DPA of development and later ceased by 9.5DPA
[73]. In the same study it was revealed that at H19 was the most highly overexpressed
maternal gene in all time points of PgE development. Also Le et al. found that from
3.5DPA to 9.5DPA the PgE genome is subjected to hypermethylation event which may
explain the progressive loss of Igf2 expression in P-ESCs at 9.5DPA [73].
Another evidence that the paternal genome is required for embryo growth comes from
findings that P-ESCs exhibit lower weight compare to wild type (wt) embryos and that
when introduced to form chimers with wt embryos, the weight of resulting offspring is
inversely proportional to the P-ESCs that were introduced i.e. the greater the number
of P-ESCs, the less is the weight of the newborn mice [74-75].

21

That the maternal genome is critical for embryo proper formation has been observed in
androgenetic mouse embryos (AgE) – embryos that consist only of the paternal
genome complement. In these embryos there is a proper formation of the extraembryonic membranes but failure in the embryo proper formation[76] . Another
support of the aforementioned effect that the two opposite sexes confer on the
offspring has been observed in ovarian malformations found in women known as
gestational trophoblastic diseases and mentioned in the previous section.

Differentiation potential of mouse P-ESC cells
Mouse P-ESCs are an excellent model to study the differentiation potential of monoparental ESCs. There are five main approaches to study differentiation potential of
embryonic stem cells and therefore their pluripotency; teratoma formation, embryo
body formation, direct differentiation in culture dishes, chimera formation and tetraploid
embryo complementation. The last two approaches, which also represent a test for
ESCs pluripotency , are possible exclusively with mouse P-ESCs due to ethical issues
associated with creating a chimera consisting of human or primate ESCs or P-ESCs.
The generation of chimeric embryos calls for injection of the ESCs of interest into a
host blastocyst or aggregation of the ES cells with host embryo [77]. If the ESCs of
interest are pluripotent, they can be traced to all tissues and organs of the resulting
offspring and if totipotent will be also passed through the germ line (Figure1.2). The
derivation of tetraploid embryos calls for aggregation of the ESCs of interest with a
four-cell-stage tetraploid embyo. The last one generated by electro fusion of two-cellstage (1.5DPF) embryos which were then left to cleave till four-cell-stage before

22

aggregation with host ESCs. In tetraploid embryo complementation experiment, the
ESCs of interest, if totipotent, will give rise to all tissues and organs of the embryos
including the germ line. The host cells, on the other hand, will give rise to the extra
embryonic membranes [77].
The first report of P-ESCS-wt chimera was published in 1978 in Nature by Stevens
[78]. Data from this first study clearly demonstrated that although complete PgE
cannot develop to term, live chimeric animals can be produced when P-ESCS cells are
aggregated with normal wt embryo. The ability of the P-ESCs to give rise to the
embryo proper revealed that P-ESCs are viable and are capable to differentiate and
give rise to all three germ layers- ecto, meso and endoderm and germ cells, in a
chimeric animal. However, the P-ESCs-wt chimeras had significantly lower size than
normal wt embryos and chimeras. Anderegg et al and Paldi et al. also found a
negative correlation between embryo size and P-ESCs contribution into P-ESCs-wt
chimeras [74-75]. Together with lower embryo size, Anderegg et al reported an
increase in the number of the resorbing P-ESCs-wt embryos in the uterine horns of the
recipient mice. Paldi et al attempted to quantify the percentage contribution of P-ESCs
in the chimeric animals by quantifying the GPI isoenzyme intensity of staining in
organs and tissues derived from P-ESCs-wt chimeras and normal fertilized embryos
(fEs) [75]. They found that not only the P-ESCs –wt chimeric animals had lower weight
but that there was a negative correlation between the weight of the chimeras and the
P-ESC cell contribution (P-ESCs contribution to chimeric embryos ranged from 1040%) i.e. the smaller the body size the more the P-ESCs were found to contribute to
the embryo proper. The chimeric embryos that died soon after birth had the highest P-

23

ESCs cell contribution. It was also noticed that the P-ESCs-wt chimeras were only
females. The surviving P-ESCs-wt female chimeric embryos were able to mate and
passed the P-ESCs genotype through the germline and into the offspring as judged by
their pigmented coat color [75].That mouse P-ESCs are totipotent and that its genome
can be transmitted through the germ line was also reported by Allen and Surani. They
found that P-ESCs in P-ESCs-wt chimeras can contribute to the germ lineage and that
this contribution did not depend on the passage number or the strain from which the PESCs were derived [76]. More striking was the observation that regardless of the
strain, in chimeras with normal host cells, the P-ESCs exhibited restricted
differentiation capacity consistent with that observed in PgEs i.e the P-ESCs were
completely excluded or very low represented in the skeletal muscle tissues and testis.
The chimerism varied from 40-80% in other organs tested such as brain, liver, and
blood. Growth retardation was observed only in chimeric embryos derived by
aggregation of PgE and wt embryo but not in P-ESCs-wt chimeras.
Fundele and colleagues published in two separate studies a controversial data
regarding the capacity of mouse P-ESCs to differentiate into all tissues and organs of
the body when introduced into chimeric embryos. In the earlier publications the
authors looked at adult and fetal chimeras [79-80]. It was found that by 13 DPA and
15DPA, the P-ESCs were progressively excluded from the skeletal muscle, pancreas
and the liver and that they were completely excluded from the tongue right before the
myoblast fusion occurs. Later study by Fundale et al reported that P-ESCs can
contribute to all tissues of the chimeric animals with lower affinity to the colon, uterus,
duodenum and stomach with chimerism ranging from 0-21% [81]. They found that P-

24

ESCs contribute to the tongue tissue up to 23%. In 24 days old chimeras, it was found
that the proliferation capacity of the P-ESCs in mesoderm derived mesenchymal cells
of the colon and uterus and the endoderm derived duodenum is significantly lower
than in wt control cells. Therefore the studies by Fundale and colleagues
demonstrated again that P-ESCs are viable and pluripotent, they can give rise to
derivatives of all germ layers and can be passed to the progeny through the germ cells
but their differentiation potential may vary between chimeras and P-ESCs derived from
different laboratories.
An exclusion of the P-ESCs from the endoderm germ lineage and stomach, in
particular, has been reported by Sturm et al [82]. Sturm et al also analyzed the
capability of P-ESCs to contribute to the hematopoietic stem cell lineage. They found,
using FACS analysis, that in chimeras the P-ESCs contributed to the same extent to
bone marrow and thymus hematopoietic cells as wt cells used to generate control
chimeras. An interesting finding by Sturm et al. was that the chimeras with highest PESCs contribution, regardless of P-ESC cell line tested, were females [82]. However,
the correlation between the P-ESCs contribution to P-ESCs –wt chimeras and the sex
of the resulting offspring has been controversial since other groups have not reported
such a gender preference [76, 83].
One possible explanation for the different contribution of the P-ESCs to the embryo
proper of P-ESCs-wt chimers, as reported by the different scientific groups mentioned
above, may be due to differences in P-ESCs culture conditions and propagation in vitro.
For example it has been reported that in vitro culture conditions and passage number can
alter the expression of the imprinted genes [73]. In this context, Li et al published data

25

on how passage number affects the differentiation potential of mouse P-ESCs when
introduced into chimeras with wt embryos [73]. They found that the passage number of
the P-ESCs used may have an effect on the contribution of these cells to tissues and
organs of chimeric embryos. By using polymorphism markers to distinguish between the
wt host cells and the P-ESCs, they found that when P-ESCs at early passage number
five (p5) are introduced in chimeras, the P-ESCs are excluded from brain, lung, muscle,
liver and kidney. The differentiation potential of the P-ESCs at later passage (p54) in
chimeras was similar to that of the early passage P-ESCs (p5) with the exception of skin,
heart and intestines where the P-ESCs contribution was very low. The highest
contribution to chimeras was reported for P-ESCs at p21. The authors of this study tried
to justify these findings by analyzing the methylation profile of a set of differentially
methylated resgions (DMRs) controlling the expression of key imprinted genes;
H19/Igf2DMR, Dlk1/Gtl2 DMR, Snrpn DMR, U2af1-rs1 and Peg1 promoter and exon1
region, in P-ESCs at the passages 5, 21 and 54. Li et al reported that there was no
difference of the methylation profiles of the Snrpn DMR, U2af1-rs1 and Peg1 promoter
and exon1 regions between P-ESCs at p5 and p54. The methylation of Snrpn DMR,
U2af1-rs1 and Peg1 promoter and exon1 region at p21 was significantly decreased and
correlated with over expression of the paternally expressed genes Snrpn, U2af1-rs1 and
Peg1. Overexpression of the Snrpn, U2af1-rs1 and Peg1 genes was associated with the
higher contribution of the P-ESCs to the embryo proper of chimeric animals. The
expression of the maternally expressed gene Dlk1 was also overexpressed in P-ESCs at
p21. However the mRNA levels of Dlk1 did not correlate with the methylation status of the
Dlk1/Gtl2 DMR. This data demonstrated that the methylation of the imprinted genes DMR

26

regions is dynamic and may affect the expression of the imprinted genes. However,
further studies are necessary to elucidate the exact mechanism through which the
imprinted genes expression influence the differentiation potential of the P-ESCs [73].
In an attempt to improve the differentiation potential of mouse P-ESCs, Hikichi and
colleagues used nuclear transfer method [84]. The original P-ESC cell nuclei were
transferred into enucleated oocytes, and the resulting nuclear transfer (NT) embryos
were used for establishment of a new NT-P-ESC cell line For this study they used two
innovative strategies; instead of ethanol they activated the oocytes by using SrCl2, a
method that now is considered the most efficient in generating P-ESCs from mouse
models. Second, instead of producing P-ESCs containing a duplication of only the
oocyte genome, they combined the genomes of two oocytes. Third but not least, they
introduced a green fluorescent protein (GFP) in the hybrid oocytes which allows them to
follow the P-ESCs allocation into the chimeric animals. They found that the P-ESCs
contribution to chimeric animals was very low-2-8% and especially low in mesoderm
(heart and kidney) and endoderm (liver) derivatives and there was no germ line
transmission. The low contribution to heart muscle and germ line was somehow
controversial to the findings of the groups mentioned above [76, 78] . During three
consecutive NT experiments the contribution of the P-ESCs was increased in the brain
and intestines up to five fold compare to the initial P-ESC cell line. However, three
consecutive rounds of NT were not able to reprogram the P-ESC genome in manner
that will increase the P-ESCs propensity to contribute to heart and liver in P-ESCs-wt
chimeras.

27

Another study on P-ESCs pluripotency by Onodega et al. reported significant
differences in the potential of the P-ESC cell lines derived in his laboratory to contribute
to the embryo proper in chimeras. Onodega et al. found high contribution of the P-ESCs
to heart muscle and more than 30% P-ESCs contribution to liver of chimeric mice than
Hikichi et al have reported before. The contribution of the P-ESCs to intestines, bone
marrow, skeletal muscle and germ cells was from low to none. These discrepancies that
arise between the different scientific groups in the ability to obtain germ line
transmission of the parthenogenetic genome in P-ESCs –wt chimeras, Onodera and
colleagues attributed to the instability of the P-ESC genome. That the P-ESCs exhibit
unstable karyotype was reported in studies by multiple groups [84-87].
Tetraploid Embryo Complement (TEC) is considered to be the highest standard for
totipotency [88-89]. None of the mouse P-ESCs studied so far has been able to
generate TEC embryos. In a study by Allen and Surani, two P-ESCs were tested in PESCs-wt TEC experiment. One of the cells line used had the highest contribution to all
tissues and organs of P-ESCs-WT chimeric embryos with no germ line transmission,
and the second one had less potential of contributing to chimeras but allowed for gem
line transmission and therefore was considered totipotent. However, when used in TEC
experiment none of the two P-ESC cell lines was able to yield a viable embryo. The PESC cell line with the highest differentiation capability as judged by chimeric
contribution, allowed for the embryos to develop passed day 13 of gestation. Despite
the prolonged development, this embryo suffered an increase of the parts of the brain
and was not compatible with life. TEC method was also not able to rescue PgE – wt
aggregates. Moreover the phenotype of embryos derived by TEC with PgEs and P-

28

ESCs was indistinguishable. Therefore, this data suggested that whatever changes in
the gene expression arise in the P-ESCs due to their manipulation and expansion in
vitro, they have no effect on the capacity of the P-ESCs to differentiate in vivo at least
as seen from the TEC experiments.[76]
Recently, a study by a Chinese group led by Chen et al, reported the first PgE embryo
derived by TEC [90]. They injected 10-20 P-ESCs in tetraploid embryo at blastocyst
stage. The tetraploid embryos were produced by electrical fusion of fertilized embryos
at two cell stage. Only one PgE developed to term but died shortly after birth. The
authors of the paper were not able to produce life parthenogenetic offspring and so far
other groups have not been able to reproduce their results.
An alternative and more simplistic way to evaluate the differentiation potential of
mouse P-ESCs in vivo is to inject the cells into immune compromised nude SCID
mice. If the cells are pluripotent, after 4-8 weeks post injection they will develop
teratomas consisting of derivatives of all three germ layers- ectoderm, mesoderm and
endoderm.
Indeed it was found that teratomas derived from mouse P-ESCs comprise of tissues of
all three germ layer [82-83, 86]. Allen et al studied differentiation potential of P-ESCs
derived from two different strains of mice -CFLP and Rosa26, in teratomas. The
teratomas were derived by injection of the P-ESCs into the kidney capsule of immune
compromised NUDE-SCID mouse. Strikingly, they found that although the teratomas
were composed of heterogeneous tissues and they were almost completely devoid of
muscle tissue. The muscle was present only in few of the teratoma sections analyzed
and was ranging from 5% of all tissue derivatives; compare to 20% in normal wild type

29

cells derived teratomas. In contrast teratomas derived from A-ESCs which possess a
duplication of the paternal genomic complement without any maternal influence,
consisted of predominantly muscle tissue [76]. In another study by Sturn et al it was
reported that most of the P-ESCs derived teratomas (five out of seven) consist
predominantly of neuro -ectoderm derived tissues and less mesoderm derived muscle
tissue [82].
An alternative way to analyze the differentiation potential of ESCs and P-ESCs, in
particular, is to induce them to differentiate, in vitro, into embryonic bodies (EB) upon
withdrawal of Leukemia Inhibitory factor (LIF) and in the absence of mitotically
inactivated feeder cells [91]. In vitro differentiation of mouse P-ESCs into Embryo
bodies has revealed that, as in teratomas, multiple tissue derivatives can be observed.
Park et al reported that in EBs derived from, P-ESCs, there is a restriction in the
ability of the P-ESCs to give rise to endodermal derivatives [91].
Despite their restricted developmental potential mostly towards mesoderm muscle and
endoderm tissues, P-ESCs can be successfully induced in vitro to give rise to
mesoderm and muscle derivatives and to endoderm derived hepatocytes by using
different combinations of growth factors and stimuli [84, 86].

Imprinting in Mouse Parthenogenetic Embryonic Stem Cells
Mouse PgEs and mouse P-ESCs have been invaluable model for studying imprinting
and the role of H19 and Igf2, in particular, in embryo development and cancerogenesis.
In mouse, H19 and Igf2 are located on chromosome 7 and are coordinately regulated
mainly by differentiation methylation of the DMR region located between the two genes.

30

H19 gene codes for an untranslated mRNA molecule. It has been reported that H19 can
function as a long antisense RNA and as a micro RNA (miRNA 675) in humans and
non-human primates [39-40]. Unlike humans, however, the mouse mir675 is presented
by two isoforms: mmu-miR-675-3p and mmu-miR-675-5p. It was in mouse models
where for the first time it was demonstrated that H19 may function as a tumor
suppressor gene [56]. In this study the authors used H19Δ3 mice in which the maternal
H19 allele and the upstream coding sequence was deleted and H19ΔEnh mice where
the enhancer sequence downstream of H19 gene was deleted. It was found that upon
grafting H19Δ3 and wild type control embryos at 6.5DPF and 6.5DPA, respectively,
under the kidney capsule of syngenic mice, the resulted teratocarcinomas varied in
weight between the two groups. The tumors derived from H19Δ3 grafted embryos
exhibit smaller weight compare to controls regardless if the IGF2 expression was
paracrine or autocrine. When H19Δ3 mice were crossed with Apc mutant mice, the
number of adenomas and the incidence of development of smaller polyps were
significantly higher than in control mice with normal H19 expression [56] . However, as
mentioned in the previous section, there is currently strong evidence that H19 and /or its
product mir675 might be involved in the progression and pathogenesis of tumor
development rather than tumor suppression [62-65].

The major reason for failure of the mouse PG embryos to develop to term, and the
limited differentiation potential of P-ESCs, as in human and primate PgEs and P-ESCs,
has been attributed to defects in establishing correct imprinting patterns of the imprinted
genes (Allen, Barton et al. 1994; Park, Yoshida et al. 1998; Kono, Sotomaru et al. 2002;

31

Kono, Obata et al. 2004; Kono, Kawahara et al. 2006). Like primates, mouse PgEs and
P-ESCs have a severe deregulation of the imprinted genes with H19 being expressed
bi-allelically and therefore upregulated while Igf2 is barely detectable (Sotomaru,
Kawase et al. 2001; Ogawa, Wu et al. 2006). Another study in uniparental mouse
fetuses suggests that H19 is over-expressed up to 400 times compared to mouse
conceptuses that are normally fertilized (Sotomaru, Katsuzawa et al. 2002). Treatment
of mouse parthenogenetic embryos with Igf2 at pre- and post-implantation
developmental stages could extend embryonic development up to the 50 somite stage
(Platonov, Penkov et al. 2002).
Several studies analyzed the expression pattern and methylation status of imprinted
genes in mouse P-ESCs upon differentiation in vitro and in vivo (Allen, Barton et al.
1994; Szabo and Mann 1994; McKarney, Overall et al. 1996; Barton, Arney et al. 2001;
Sotomaru, Katsuzawa et al. 2002; Hernandez, Kozlov et al. 2003; Ogawa, Wu et al.
2006; Horii, Kimura et al. 2008; Li, Chen et al. 2009).
Most data suggests that the expression profile of the imprinted genes in P-ESCs
changes during cell culture propagation and expansion [83]. Regardless of the method
used for parthenogenetic oocyte activation, P-ESCs exhibit loss of imprinting of
paternally and maternally imprinted genes such as Igf2, Snrpn, Igf2r, peg1 and U2af1rs1 which may or may not coincide with the methylation status of their promoters or
differentially methylated regions (DMR) known also as an imprinted control
regions(ICR). In a study by Li et al it was reported that the expression of a set of
paternally expressed genes; Peg1, Peg3, Peg5, Peg10, Sgce, Snrpn, Zfp127, Lit1, Igf2,
Zac1, U2af1-rs1, Dlk1, Ata3, Air and Impact was detected in P-ESCs but not in the

32

PgEs from which the cells were derived [73]. Moreover the expression of the paternally
expressed genes persisted in PgEs derived by tetraploid embryo complementation
(TEC) between fertilized 4N embryo and P-ESCs with the exception of Igf2 and Dlk1
which expression was suppressed [73]. Another study by Jiang et al, also reported that
a set of paternally imprinted genes tested, were detected in P-ESCs from earlier p10
and at later p20. These genes were Snrpn, U2af1-rs1, Peg3 Zfp127, Ndn, Impact and
Mest. The most overexpressed maternally expressed gene was H19 and the most
highly overexpressed paternally expressed gene was Peg3 at levels even higher than
those of H19. The authors of this study surprisingly discovered that the re-activation of
the maternally imprinted genes Peg3, Snrpn and Mest occurs in parthenogenetic
blastocysts where the expression of these genes can be detected and then maintained
into the P-ESCs derived [83]. It is worth mentioning an earlier study by Allen and Surani
which observed a stable silencing of the paternally imprinted gene Igf2 and over
expression of the maternally expressed genes H19 and Igf2R in PgEs and P-ESCs from
p2 to p8 derived from two different stain of mice CFLP and Rosa26 by using Northern
analysis. However in this study the expression pattern of other paternally expressed
genes, besides Igf2 was not analyzed. It would have been useful to look at the
expression of imprinted genes at later passages in both, P-ESCs and PgEs.
Analysis of the expression of imprinted genes in EBs has been also published by Szabo
et al [92]. This group focused on analyzing the expression pattern of the maternally
(H19, Igf2R) and paternally(Igf2 and Snrpn) expressed genes in EBs derived from
mouse P-ESCs at different - late and early - passage and compare them to the

33

expression levels of the same genes in wild type biparental ES cells (B-ESCs) and in AESCs by Northern blot analysis.
P-ESCS cells from p8 and p12 were considered an early passage. P-ESCs at p27 and
p32 were considered as old passage. Unfortunately, Szabo et al did not evaluate the
expression pattern of these genes in P-ESCs, B-ESCs and A-ESCs prior to induction of
EB differentiation. Szabo et al did show that P-ESCs give rise to, when differentiated in
vitro for 14 days as EBs, tissues of all three germ layers. In P-ESCs from early
passages, Igf2R was expressed later in EB differentiation around day 9 while in wild
type derived EBs it was expressed at all time points peaking at days 9-14 of EB
differentiation. Igf2R was expressed also in AG EBs but at low levels. Surprisingly, H19
was found to be expressed around day 9 in AG EBs and by day14 the H19 expression
in AG EBs was significantly increased. The highest expression of H19 was however
detected in P-ESCs derived EBs from day 9 to day 14 of EB formation. Igf2 expression
was detected in EBs derived from all three cell lines- B-ESCs, P-ESCs and A-ESCs,
and its expression became evident at day 9 and peaked at day 14 post fertilization for
the B-ESCs and post activation for the P-ESCs and A-ESCs cell lines. Snrpn
expression was detected in all three types of EBs; however its expression was highest
at days 1-4 of AG EB formation. Analysis of the methylation status of the Igf 2 5’ region,
Igf2R intron II region and H19 promoter region were found to correlates with the mRNA
expression of the imprinted genes Igf2, Igf2R and H19 respectively. Therefore, this data
suggested that the expression of the imprinted genes in P-ESCs, B-ESCs and A-ESCs
changes during different stages of EB differentiation and coincides with changes in the
methylation status of their imprinted control regions.

34

Northern blot analysis on teratoma sections revealed that H19 was highly expressed in
P-ESCs and B-ESCs derived teratomas compare to A-ESCs derived ones. Igf2
expression, on the other hand, was high in A-ESCs derived teratomas. Igf2 expression
was also detected in P-ESCs teratomas. No Igf2 expression was found in B-ESCs
teratomas.
The localization of H19 and Igf2 transcripts was detected by in situ hybridization. It was
found that both H19 and Igf2 transcripts were co-expressed in striated muscle in PESCs, A-ESCs and B-ESCs derived teratomas and in cartilage from B-ESCs derived
teratomas. In A-ESCs derived teratomas, Igf2 was expressed in mature cartilage while
H19 transcript was detected in less differentiated cartilage regions. The expression of
H19 and Igf2 in cartilage from P-ESCs cells derived teratomas has not been analyzed.
In epithelial structures derived from B-ESCs and A-ESCs derived teratomas either H19
or Igf2 were expressed. There was a very low co-expression detected of H19 and Igf2 in
the epithelium from B-ESCs and A-ESCs derived teratomas. In P-ESCs derived
teratomas, H19 was most highly expressed in epithelial layers and sub-epithelial
stroma, while Igf2 mRNA was more abundant in sub-epithelial stroma and smooth
muscle[93]. These results revealed that both H19 and Igf2 were highly expressed in PESCs, A-ESCs and B-ESCs derived teratomas and in most instances their expression
was co-localized to the same tissue derivatives analyzed.

CONCLUSION
P-ESCs cells are an invaluable tool for studying the effect of imprinting on
development and disease as well as to study the potential application of P-ESCs for

35

cell replacement therapy in humans. Moreover, this source of cells is mitochondria and
MHC- matched to the recipient which makes them valuable for transplantation therapy
[5, 94-100]. Similar to the embryonic stem cells derived from fertilized embryos, PESCs stain positive for the major pluripotency markers such as SSEA-3, SSEA-4,
TRA1-60, TRA1-81, and OCT4. P-ESCs morphology is indistinguishable from that of
normal biparental ES cells. Unlike ES cells derived from normal biparental embryos, PESCs derivation does not require a destruction of a viable embryo and therefore
bypass the ethical concerns that some members of the society possess.
Unlike human and primate P-ESCs, whose in vivo differentiation potential can be
tested only by teratoma formation, mouse P-ESCs are an excellent model to test the
developmental behavior of the P-ESCs in vivo, directly, by introducing the P-ESCs into
chimeras and TEC. These experimental in vivo studies indicated that although
epigenetically instable, when injected into chimeras, mouse P-ESCs have been able to
contribute to all tissues and organs of the embryo, to the germ line lineage and into the
offspring. Moreover teratomas derived from mouse, primate and human P-ESCs
revealed that these cells can differentiate into derivatives of all three germ layer and
do not lead to any secondary teratomas besides the ones obtained at the site of
injection. The results of the aforementioned studies indicate that P-ESCs are totipotent
and are able to correct for the imprinting mis-expression upon induction of
differentiation and generate terminally differentiated derivatives of ecto-, endo- and
mesoderm origin.
Thus mouse, human and primate P-ESCs not only offer an unlimited source of
pluripotent stem cells with a potential for cell replacement therapy but also represent a

36

valuable avenue for studying the molecular basis of human congenital disorders
caused by deregulation of imprinting.

37

FIGURES AND TABLES
Table 1.1 Diseases and syndromes resulting from abnormal imprinting mechanisms
[101] Swales and N.Spears; Reproduction (2005) 130 389 399,
http://www.reproduction-online.org

38

Table 1.1 (cont’d)

39

Figure 1.1 Construction of diploid embryos with genomes derived from a single sex. In
a fertilized egg, the male and female pronuclei can be removed before they fuse, and a
diploid egg recreated by injection of another pronucleus. The development of these
diploid eggs can then be followed in vitro by culturing or in vivo by transplantation to
pseudopregnant mice. Parthenogenetic embryos can be created by the chemical
activation of an unfertilized egg [102].
Lyle, R. Gametic imprinting in development and disease. J Endocrinol 155, 1-12
(1997), http://www.endocrinology-journals.org/
For interpretation of the references in color in this and all other figures, the reader is
referred to the electronic version of the dissertation.

40

Figure 1.1 (cont’d)

egg
sperm

haploid gametes
inject male
nucleus

nucleus
nucleus
remove
female
nucleus

ANDROGENOTE

diploid zygote
FERTILIZATION

remove
male
nucleus

GYNOGENOTE

inject female
nucleus

activation

PARTHENOGENOTE

41

Figure 1.2 Stem cell hierarchy. Zygote and early cell division stages (blastomeres) to
the morula stage are defined as totipotent, because they can generate a complex
organism. At the blastocyst stage, only the cells of the inner cell mass (ICM) retain the
capacity to derive all three primary germ layers, the endoderm, mesoderm, and
ectoderm as well as the primordial germ cells (PGC), the founder cells of male and
female gametes. In adult tissues, multipotent stem and progenitor cells exist in tissues
and organs to replace lost or injured cells. At present, it is not known to what extent
adult stem cells may also develop (transdifferentiate) into cells of other lineages or what
factors could enhance their differentiation capability (dashed lines). Embryonic stem
(ES) cells, derived from the ICM, have the developmental capacity to differentiate in
vitro into cells of all somatic cell lineages as well as into male and female germ
cells.[103].
Wobus, et al, Physiol Rev 85:635-678, 2005, www.endocrinology.org &
www.bioscientifica.com

42

Figure 1.2 Stem cell hierarchy (cont’d)

TOTIPOTENT
EN

ZYGOTE
MORULA
BLASTOCYST

PLURIPOTE
NT

ICM--ESC

ECTODERM
GERM CELLS
MESODERM
ENDODERM

PGC--EGC
IN VITRO
ECTODERM MESODERM ENDOODERM
MULTIPOTENTN MULTIPOTENTN MULTIPOTENTN
T
T

MULTIPOTENT
T
NT
NT

NT

NT

PROGENITOR
MULTIPOTENTN
T

NT
ORGANS

MULTIPOTENTN
T

NT

IN VIVO
MULTIPOTENTN
T

NT

43

Figure 1.3 Characterization of parthenogenetic Cyno-1 embryos and derived cell lines.
(A) Parthenogenetically activated eggs at day 8 of development before ICM isolation.
(B) Phase contrast of Cyno-1 stem cells growing on top of mitotically inactivated mouse
feeder layer (mef). (C) Alkaline phosphatase staining. (D) Stage-specific embryonic
antigen 4. (E) Tumor rejection antigen 1-60. (F) Tumor rejection antigen 1-81 staining.
(G) RT-PCR octamer-binding transcription factor 4 expression in undifferentiated Cyno1 cells. (Scale bars = 50 µm in A, 10 µm in B and D–F, and 4 mm in C.) [16].
Vrana et al, Proc.Natl.Acad.Sci USA., 2003 Sep 30; 100, http://www.pnas.org/

A

B
MEF

Cyno-1

C

D

E

F

Undiif.

G
rt

+

Diff.
-

+

OCT4
44

-

Figure 1.4 In vivo differentiation of Cyno-1 cells. Cells were injected i.p.
(IntraPeritoneal) in severe combined immunodeficient mice. Eight and 15 weeks after
injection, teratomas 12 and 30 mm in diameter, respectively, were isolated, fixed with
10% paraformaldehyde, and paraffin–embedded. Sections were stained with
hematoxylin-eosin. The following complex structures were observed: gut (A), intestinal
epithelium with typical goblet cells (gc) and smooth muscle (sm) (B), neuronal tissue
with melanocytes (C), hair follicle complex with evident hair (h) and sebaceous gland
(sg) (D), skin (E), cartilage (F), ganglion cells (G), and bone (H). (Scale bars = 40 µm in
A, 10 µm in B and D–H, and 20 µm in C.) [16].
Vrana et al, Proc.Natl.Acad.Sci USA., 2003 Sep 30; 100, http://www.pnas.org/

sm

A

B

gc

h

C

D

E

F

G

H
45

sg

Figure 1.5 In vitro differentiation of primate Cyno-1 P-ESCs. (A): Schematic
representation of the sequential steps designed to induce a dopamine neuronal
phenotype from undifferentiated primate ES cells. ES cells are first grown in a
coculture system on stromal feeders. At the rosette stage, these neuroepithelial
structures are replated on coated dishes in a feeder-free system for differentiation. (B–
D) Microscopic images illustrating the aspect of the colonies at each passage.
Undifferentiated stage Cyno-1 cells grow in colonies and all cells (B) express the
transcription factor Oct-4. (C) Soon after the first passage, cells are organized into
typical neuroepithelial structures (rosettes, r); (D): At the differentiation stage neurons
grow in clusters and extend out neurites and (E) express midbrain genes like
Engrailed-1 (En1), which is colocalized in some neurons with TH. (F) TH neurons
coexpressed the neuronal marker β-tubulin III (clone TuJ1) and (G) some coexpressed
VMAT-2 (yellow coexpression). Scale bars = 100 μm (B–C), 150 μm (D), 75 μm (E),
50 μm (F), 35 μm (G) and inset in (E). Abbreviations: BDNF, brain-derived neurotropic
factor; ES, embryonic stem; FGF8, fibroblast growth factor 8; GDNF, glial-derived
neurotropic factor; TH, tyrosine hydroxylase; SHH, sonic hedgehog; TGFβ3,
transforming growth factor β3; TH, tyrosine hydroxylase; VMAT, vesicular monoamine
transporter; [17].
Sánchez-Pernaute, Studer, Ferrari et al; Stem Cells 2005 Aug; 23(7):914-22. Epub
2005 Jun; http://stemcells.alphamedpress.org

46

Figure 1.5 (cont’d)

Cyno1 cells
on stromal
cells

Serum
replacement

N2
medi
um

Rosete
neural
precursors
and
differentiated
neurons

Mito C

Grafting

SHH + FGF8
N2 medium + BDNF + Ascorbic acid

SHH + FGF8

Day

0

B

9

12

C

15

D

21

GDNF + dbcAMP+ TGFβ
28

35

F

E

TH/TUJ1

41-44

G

r
r

OCT4

En1/TH
47

TH/VMAT-2

Figure 1.6 Morphology, AP and Immonustaining of stem cell markers for human
Parthenogenetic Embryonic Stem -1 (hPES -1) cell line. (A) Morphology of hPES-1
colony under invert microscope; (B) AP staining of hPES-1; (C) SSEA4; (D) SSEA3; (E)
TRA-1-60; (F) TRA-1-81; (G) SSEA1. (C-G) Listed are optical, confocal images and the
corresponding Hoechst staining for the hPES-1 cells [8]. Qingyun Mai et al; Cell
Research (2007) 17:1008-1019. http://www.nature.com/cr/index.html

48

Figure 1.6 Morphology, AP and Immonustaining of stem cell markers for human
Parthenogenetic Embryonic Stem -1 (hPES -1) cell line.

A

B

Optical

Hoecst

Confocal

SSEA-4

SSEA-3

TRA-1-60

SSEA-1-81

SSEA-1

49

REFERENCES

50

REFERENCES
1.
Mutter, G.L., Role of imprinting in abnormal human development. Mutation
Research/Fundamental and Molecular Mechanisms of Mutagenesis, 1997. 396(1-2): p.
141-147.
2.

Sotomaru, Y., et al., Unregulated Expression of the Imprinted Genes H19 and
Igf2r in Mouse Uniparental Fetuses J. Biol. Chem., 2002. 277(14): p. 1247412478.

3.

Ogawa, H., et al., Disruption of parental-specific expression of imprinted genes in
uniparental fetuses. FEBS Letters, 2006. 580(22): p. 5377-5384.

4.

Surti, U., et al., Genetics and biology of human ovarian teratomas. I. Cytogenetic
analysis and mechanism of origin. Am J Hum Genet, 1990. 47(4): p. 635-43.

5.

Revazova, E.S., et al., Patient-Specific Stem Cell Lines Derived from Human
Parthenogenetic Blastocysts. Cloning Stem Cells, 2007. 9(3): p. 432-49.

6.

Revazova, E.S., et al., Patient-Specific Stem Cell Lines Derived from Human
Parthenogenetic Blastocysts. Cloning and Stem Cells, 2007. 9(3): p. 432.

7.

Revazova, E.S., et al., HLA Homozygous Stem Cell Lines Derived from Human
Parthenogenetic Blastocysts. p. 1-14.

8.

Mai, Q., et al., Derivation of human embryonic stem cell lines from
parthenogenetic blastocysts. Cell Res. 17(12): p. 1008-1019.

9.

Strain, L., et al., A human parthenogenetic chimaera. Nat Genet, 1995. 11(2): p.
164-9.

10.

Surani, M.A., Parthenogenesis in man. Nat Genet, 1995. 11(2): p. 111-3.

11.

Cibelli, J.B., K. Cunniff, and K.E. Vrana, Embryonic stem cells from parthenotes.
Methods Enzymol, 2006. 418: p. 117-35.
51

12.

Mitalipov, S.M., K.D. Nusser, and D.P. Wolf, Parthenogenetic Activation of
Rhesus Monkey Oocytes and Reconstructed Embryos. 2001. p. 253-259.

13.

Cibelli, J.B., K. Cunniff, and K.E. Vrana, Embryonic Stem Cells from Parthenotes,
in Methods in Enzymology, K. Irina and L. Robert, Editors. 2006, Academic
Press. p. 117-135.

14.

Zvetkova, I., et al., Global hypomethylation of the genome in XX embryonic stem
cells. Nat Genet, 2005. 37(11): p. 1274-9.

15.

Cibelli, J.B., et al., Parthenogenetic stem cells in nonhuman primates. Science,
2002. 295(5556): p. 819.

16.

Vrana, K.E., et al., Nonhuman primate parthenogenetic stem cells. Proc Natl
Acad Sci U S A, 2003. 100 Suppl 1: p. 11911-6.

17.

Sanchez-Pernaute, R., et al., Long-Term Survival of Dopamine Neurons Derived
from Parthenogenetic Primate Embryonic Stem Cells (Cyno-1) After
Transplantation. 2005. p. 914-922.

18.

Ferrari, D., et al., Transplanted dopamine neurons derived from primate ES cells
preferentially innervate DARPP-32 striatal progenitors within the graft. 2006. p.
1885-1896.

19.

Dighe, V., et al., Heterozygous Embryonic Stem Cell Lines Derived from
Nonhuman Primate Parthenotes. 2008. p. 2007-0869.

20.

Cheng, L., More new lines of human parthenogenetic embryonic stem cells. Cell
Res. 18(2): p. 215-217.

21.

Sapienza, C., Parental imprinting of genes. Sci Am, 1990. 263(4): p. 52-60.

22.

Tang, W.-y. and S.-m. Ho, Epigenetic reprogramming and imprinting in origins of
disease. Reviews in Endocrine & Metabolic Disorders.
52

23.

Swales, A.K.E. and N. Spears, Genomic imprinting and reproduction. 2005. p.
389-399.

24.

Fujimoto, A., et al., Aberrant genomic imprinting in rhesus monkey embryonic
stem cells. Stem Cells, 2006. 24(3): p. 595-603.

25.

Newman-Smith, E.D. and Z. Werb, Stem cell defects in parthenogenetic periimplantation embryos. Development, 1995. 121(7): p. 2069-77.

26.

Horii, T., et al., Loss of Genomic Imprinting in Mouse Parthenogenetic Embryonic
Stem Cells. 2008. p. 79-88.

27.

Kono, T., et al., Birth of parthenogenetic mice that can develop to adulthood.
Nature, 2004. 428(6985): p. 860-4.

28.

Kono, T., et al., Mouse parthenogenetic embryos with monoallelic H19
expression can develop to day 17.5 of gestation. Dev Biol, 2002. 243(2): p. 294300.

29.

Mitalipov, S., et al., Methylation status of imprinting centers for H19/IGF2 and
SNURF/SNRPN in primate embryonic stem cells. Stem Cells, 2007. 25(3): p.
581-8.

30.

Runte, M., et al., SNURF-SNRPN and UBE3A transcript levels in patients with
Angelman syndrome. Human Genetics, 2004. 114(6): p. 553-561.

31.

Reik, W. and E.R. Maher, Imprinting in clusters: lessons from BeckwithWiedemann syndrome. Trends Genet, 1997. 13(8): p. 330-4.

32.

Nicholls, R.D., S. Saitoh, and B. Horsthemke, Imprinting in Prader-Willi and
Angelman syndromes. Trends in Genetics, 1998. 14(5): p. 194-200.

33.

Hurst, L.D. and G.T. McVean, Growth effects of uniparental disomies and the
conflict theory of genomic imprinting. Trends Genet, 1997. 13(11): p. 436-43.
53

34.

Sotomaru, Y., et al., Disruption of imprinted expression of U2afbp-rs/U2af1-rs1
gene in mouse parthenogenetic fetuses. J Biol Chem, 2001. 276(28): p. 26694-8.

35.

Poirier, F., et al., The murine H19 gene is activated during embryonic stem cell
differentiation in vitro and at the time of implantation in the developing embryo.
1991. p. 1105-1114.
Varrault, A., et al., Zac1 Regulates an Imprinted Gene Network Critically Involved
in the Control of Embryonic Growth. Developmental Cell, 2006. 11(5): p. 711722.

36.

37.

Gabory, A., et al., H19 acts as a trans regulator of the imprinted gene network
controlling growth in mice. Development, 2009. 136(20): p. 3413-21.

38.

Matsuda T, W.N., Genetics and molecular markers in gestational trophoblastic
disease with special reference to their clinical application. Best Pract Res Clin
Obstet Gynaecol, 2003. 17.(6): p. 827-36.

39.

Schoenfelder, S., et al., Non-coding transcripts in the H19 imprinting control
region mediate gene silencing in transgenic Drosophila. EMBO Rep, 2007. 8(11):
p. 1068-73.

40.

Berteaux, N., et al., A novel H19 antisense RNA overexpressed in breast cancer
contributes to paternal IGF2 expression. Mol Cell Biol, 2008. 28(22): p. 6731-45.

41.

Gabory, A., H. Jammes, and L. Dandolo, The H19 locus: role of an imprinted
non-coding RNA in growth and development. Bioessays, 2010. 32(6): p. 473-80.

42.

Gabory, A., et al., The H19 gene: regulation and function of a non-coding RNA.
Cytogenet Genome Res, 2006. 113(1-4): p. 188-93.

43.

Cullen, X.C.a.B.R., The imprinted H19 noncoding RNA is a primary microRNA
precursor. RNA, 2007. 13: p. 313–316.

54

44.

Han, V.K.M. and A.M. Carter, Spatial and Temporal Patterns of Expression of
Messenger RNA for Insulin-Like Growth Factors and their Binding Proteins in the
Placenta of Man and Laboratory Animals. Placenta, 2000. 21(4): p. 289-305.

45.

Pringle, K.G. and C.T. Roberts, New Light on Early Post-Implantation Pregnancy
in the Mouse: Roles for Insulin-Like Growth Factor-II (IGF-II)? Placenta, 2007.
28(4): p. 286-297.

46.

Minniti, C.P., et al., Insulin-like growth factor II overexpression in myoblasts
induces phenotypic changes typical of the malignant phenotype. 1995. p. 263269.

47.

Pacher, M., et al., Impact of constitutive IGF1/IGF2 stimulation on the
transcriptional program of human breast cancer cells. 2007. p. 49-59.

48.

Prelle, K., et al., Overexpression of insulin-like growth factor-II in mouse
embryonic stem cells promotes myogenic differentiation. Biochem Biophys Res
Commun, 2000. 277(3): p. 631-8.

49.

Weber, M.M., et al., Postnatal Overexpression of Insulin-Like Growth Factor II in
Transgenic Mice Is Associated with Adrenocortical Hyperplasia and Enhanced
Steroidogenesis. 1999. p. 1537-1543.

50.

Moorehead, R.A., et al., Transgenic overexpression of IGF-II induces
spontaneous lung tumors: a model for human lung adenocarcinoma. Oncogene,
2003. 22(6): p. 853-7.

51.

Petrik, J., et al., Overexpression of Insulin-Like Growth Factor-II in Transgenic
Mice Is Associated with Pancreatic Islet Cell Hyperplasia. 1999. p. 2353-2363.

52.

Newman-Smith, E. and Z. Werb, Functional analysis of trophoblast giant cells in
parthenogenetic mouse embryos. Dev Genet, 1997. 20(1): p. 1-10.

53.

Mitalipov, S., et al., Methylation Status of Imprinting Centers for H19/IGF2 and
SNURF/SNRPN in Primate Embryonic Stem Cells
10.1634/stemcells.2006-0120. Stem Cells, 2006: p. 2006-0120.

55

54.

Kawahara, M., et al., High-frequency generation of viable mice from engineered
bi-maternal embryos. Nat Biotechnol, 2007. 25(9): p. 1045-50.

55.

Kono, T., et al., Paternal dual barrier by Ifg2-H19 and Dlk1-Gtl2 to
parthenogenesis in mice. Ernst Schering Res Found Workshop, 2006(60): p. 2333.

56.

Yoshimizu, T., et al., The H19 locus acts in vivo as a tumor suppressor. Proc Natl
Acad Sci U S A, 2008. 105(34): p. 12417-22.

57.

Liou, J.-M., et al., Loss of imprinting of insulin-like growth factor II is associated
with increased risk of proximal colon cancer. European Journal of Cancer. In
Press, Corrected Proof.

58.

Adriaenssens, E., et al., H19 Overexpression in Breast Adenocarcinoma Stromal
Cells Is Associated with Tumor Values and Steroid Receptor Status but
Independent of p53 and Ki-67 Expression. Am J Pathol, 1998. 153(5): p. 15971607.

59.

Barsyte-Lovejoy, D., et al., The c-Myc Oncogene Directly Induces the H19
Noncoding RNA by Allele-Specific Binding to Potentiate Tumorigenesis. Cancer
Research, 2006. 66(10): p. 5330-5337.

60.

Berteaux, N., et al., H19 mRNA-like Noncoding RNA Promotes Breast Cancer
Cell Proliferation through Positive Control by E2F1. Journal of Biological
Chemistry, 2005. 280(33): p. 29625-29636.

61.

Dugimont, T., et al., The H19 gene is expressed within both epithelial and
stromal components of human invasive adenocarcinomas. Biology of the Cell,
1995. 85(2-3): p. 117-124.

62.

Lottin, S., et al., Overexpression of an ectopic H19 gene enhances the
tumorigenic properties of breast cancer cells. Carcinogenesis, 2002. 23(11): p.
1885-1895.

56

63.

Lottin, S., et al., Thioredoxin post-transcriptional regulation by H19 provides a
new function to mRNA-like non-coding RNA. Oncogene, 2002. 21(10): p. 162531.

64.

Matouk, I.J., et al., The oncofetal H19 RNA connection: Hypoxia, p53 and
cancer. Biochimica Et Biophysica Acta-Molecular Cell Research, 2010. 1803(4):
p. 443-451.

65.

Tsang, W.P., et al., Oncofetal H19-derived miR-675 regulates tumor suppressor
RB in human colorectal cancer. Carcinogenesis, 2010. 31(3): p. 350-358.

66.

Sheehy, E., et al., Estimating the number of potential organ donors in the United
States. N Engl J Med, 2003. 349(7): p. 667-74.

67.

Coombes, J.M. and J.F. Trotter, Development of the allocation system for
deceased donor liver transplantation. Clin Med Res, 2005. 3(2): p. 87-92.

68.
Nagy, A., et al., Embryonic stem cells alone are able to support fetal
development in the mouse. 1990. p. 815-821.
69.

Nagy, A., et al., Derivation of Completely Cell Culture-Derived Mice from EarlyPassage Embryonic Stem Cells. 1993. p. 8424-8428.

70.

Horii, T., et al., Loss of Genomic Imprinting in Mouse Parthenogenetic Embryonic
Stem Cells. 2007. p. 2006-0635.

71.

Platonov, E.S., L.I. Penkov, and D.A. New, [Effects of growth factors FGF2 and
IGF2 on the development of parthenogenetic mouse embryos in utero and in
vitro]. Ontogenez, 2002. 33(1): p. 60-7.

72.

Hikichi, T., et al., Functional full-term placentas formed from parthenogenetic
embryos using serial nuclear transfer. Development, 2010.

73.

Li, C., et al., Correlation of expression and methylation of imprinted genes with
pluripotency of parthenogenetic embryonic stem cells. Hum. Mol. Genet., 2009.
18(12): p. 2177-2187.
57

74.

Anderegg, C. and C.L. Markert, Successful rescue of microsurgically produced
homozygous uniparental mouse embryos via production of aggregation
chimeras. Proc Natl Acad Sci U S A, 1986. 83(17): p. 6509-13.

75.

Paldi, A., et al., Postnatal development of parthenogenetic in equilibrium with
fertilized mouse aggregation chimeras. Development, 1989. 105(1): p. 115-8.

76.

Allen, N., et al., A functional analysis of imprinting in parthenogenetic embryonic
stem cells. Development, 1994. 120(6): p. 1473-1482.

77.

Nagy A, G.M., Vintersten K, Behringer R, Manipulating the Mouse Embryo, A
Laboratory Manual. Vol. Third Edition. 2003: Cold Spring Harbor Laboratory
Press.

78.

Stevens, L.C., Totipotent cells of parthenogenetic origin in a chimaeric mouse.
Nature, 1978. 276(5685): p. 266-7.

79.

Fundele, R.H., et al., Temporal and spatial selection against parthenogenetic
cells during development of fetal chimeras. Development, 1990. 108(1): p. 203211.

80.

Fundele, R., et al., Systematic elimination of parthenogenetic cells in mouse
chimeras. Development, 1989. 106(1): p. 29-35.

81.

Jagerbauer, E.M., et al., Parthenogenetic stem cells in postnatal mouse
chimeras. Development, 1992. 116(1): p. 95-102.

82.

Sturm, K.S., et al., Unrestricted lineage differentiation of parthenogenetic ES
cells. Development Genes and Evolution, 1997. 206(6): p. 377-388.

83.

Jiang, H., et al., Activation of paternally expressed imprinted genes in newly
derived germline-competent mouse parthenogenetic embryonic stem cell lines.
Cell Res. 17(9): p. 792-803.

84.

Hikichi, T., et al., Differentiation Potential of Parthenogenetic Embryonic Stem
Cells Is Improved by Nuclear Transfer. Stem Cells, 2007. 25(1): p. 46-53.
58

85.

Zvetkova, I., et al., Global hypomethylation of the genome in XX embryonic stem
cells. Nat Genet, 2005. 37(11): p. 1274-1279.

86.

Onodera, Y., et al., Differentiation diversity of mouse parthenogenetic embryonic
stem cells in chimeric mice. Theriogenology, 2010. 74(1): p. 135-45.

87.

Horii, T., et al., Loss of genomic imprinting in mouse parthenogenetic embryonic
stem cells. Stem Cells, 2008. 26(1): p. 79-88.

88.

Eggan, K., et al., Hybrid vigor, fetal overgrowth, and viability of mice derived by
nuclear cloning and tetraploid embryo complementation. Proceedings of the
National Academy of Sciences of the United States of America, 2001. 98(11): p.
6209-6214.

89.

Eggan, K., et al., Male and female mice derived from the same embryonic stem
cell clone by tetraploid embryo complementation. Nat Biotech, 2002. 20(5): p.
455-459.

90.

Chen, Z., et al., Birth of parthenote mice directly from parthenogenetic embryonic
stem cells. Stem Cells, 2009. 27(9): p. 2136-45.

91.

Park, J.I., et al., Differentiative potential of a mouse parthenogenetic embryonic
stem cell line revealed by embryoid body formation in vitro. Jpn J Vet Res, 1998.
46(1): p. 19-28.

92.

Szabo, P. and J. Mann, Expression and methylation of imprinted genes during in
vitro differentiation of mouse parthenogenetic and androgenetic embryonic stem
cell lines. Development, 1994. 120(6): p. 1651-1660.

93.

McKarney, L.A., M.L. Overall, and M. Dziadek, Expression of H19 and Igf2 genes
in uniparental mouse ES cells during in vitro and in vivo differentiation
doi:10.1046/j.1432-0436.1996.6020075.x. Differentiation, 1996. 60(2): p. 75-86.
94.

Dighe, V., et al., Heterozygous embryonic stem cell lines derived from nonhuman
primate parthenotes. Stem Cells, 2008. 26(3): p. 756-66.

59

95.

Ferrari, D., et al., Transplanted dopamine neurons derived from primate ES cells
preferentially innervate DARPP-32 striatal progenitors within the graft. Eur J
Neurosci, 2006. 24(7): p. 1885-96.

96.

Sanchez-Pernaute, R., et al., Parthenogenetic dopamine neurons from primate
embryonic stem cells restore function in experimental Parkinson's disease. Brain,
2008. 131(Pt 8): p. 2127-39.

97.

Sanchez-Pernaute, R., et al., Long-term survival of dopamine neurons derived
from parthenogenetic primate embryonic stem cells (cyno-1) after
transplantation. Stem Cells, 2005. 23(7): p. 914-22.

98.

Kim, K., et al., Histocompatible embryonic stem cells by parthenogenesis.
Science, 2007. 315(5811): p. 482-6.

99.

Lengerke, C., et al., Differentiation Potential of Histocompatible Parthenogenetic
Embryonic Stem Cells. Annals of the New York Academy of Sciences, 2007.
1106(1): p. 209-218.

100.

Eckardt, S., et al., Hematopoietic reconstitution with androgenetic and
gynogenetic stem cells. Genes Dev, 2007. 21(4): p. 409-19.

101.

Swales, A.K.E. and N. Spears, Genomic imprinting and reproduction. 2005. p.
389-399.

102.

Lyle, R., Gametic imprinting in development and disease. 1997. p. 1-12.

103.

Wobus, A.M. and K.R. Boheler, Embryonic Stem Cells: Prospects for
Developmental Biology and Cell Therapy. 2005. p. 635-678.

60

DISSERTATION CHAPTER 2

TITLE
MODULATION OF H19 EXPRESSION IN PRIMATE
(Cynomolgus macaque) PARTHENOGENETIC
EMBRYONIC STEM CELLS (Cyno1 P-ESCs) USING
H19ShRNA

61

ABSTRACT
The non-human primate parthenogenetic embryonic stem cell line (Cyno1 P-ESC) was
previously derived from a Macaca fasciculatis (also called Cynomolgus macaque)
blastocyst created via artificial oocyte activation. A maternally derived parthenogenetic
stem cell line does not require formation or destruction of a viable embryo, and
therefore offers a valid alternative to the ethical and scientific challenges that bi-parental
embryonic stem cells isolated from fertilized embryos pose to some members of society.
However, the relative abundance of ectoderm tissues over mesoderm and endoderm in
teratomas derived from parthenogenetically derived embryonic stem cells may limit their
potential therapeutic applications. H19 is a paternally imprinted gene (i.e. maternally
expressed) that encodes for an untranslated RNA linked to normal development whose
expression in Cyno1 cells is upregulated. In addition, loss of H19 imprinting has been
associated with several human diseases [104]. Thus, the objective of the present
studies was to generate a transgenic Cyno1 cell line with suppressed H19 expression
(Cyno1 H19shRNA), using the vector based shRNA system and use this cell line for
comparisons of mRNA abundance of several known imprinted genes (H19, p57, IGF2,
Peg10, and SNRPN) between transgenic Cyno1 H19shRNA cells, Cyno1 P-ESCs
transfected with empty vector (Cyno1 Con.vector) and bi-parental Cyno1 cells (CMK6).
We also aimed to determine the ability of the Cyno1 shRNA cells and control ones to
differentiate in vivo, in teratomas, into derivatives of the three germ layers.

As

expected, H19 mRNA levels in Cyno1 Con.vector cells were higher than in the
biparental CMK6 cells. Knockdown of H19 mRNA in the Cyno1 H19shRNA cell line
resulted in H19 mRNA expression similar to that observed in the biparental (CMK6) cell
62

line. A loss of imprinting of IGF2 and PEG10 in Cyno1 and Cyno1 H19shRNA cell lines
was also observed. Future experiments are aimed towards investigating the
differentiation potential of Cyno1 H19shRNA cells by teratoma formation. These
experiments should help us elucidate the role of H19 in differentiation of non-human
primate parthenogenetic ES cells.

63

INTRODUCTION
A maternally derived primate parthenogenetic embryonic stem cell line (P-ESCs) does
not require formation or destruction of a viable embryo, and therefore in the context of
human embryonic stem (HES) cells, may offer a valid alternative to the ethical and
scientific challenges that biparental embryonic stem cells (B-ESCs) isolated from
fertilized embryos pose. Non-human primate P-ESCs have been derived from Macaca
fascicularis (called Cyno1 P-ESCs) and from Rhesus Monkey- Rhesus P-ESCs [12, 1516, 29, 94, 105]. When these cells are induced to differentiate they form cell derivatives
from the three germ layers with a preference towards ectoderm and endoderm at the
expense of mesoderm derivatives. This phenomenon is in part attributed to the
monoparental origin of the cells. The lack of a paternal genome can contribute to a
deregulation of imprinted genes. Deregulation of imprinted genes in mouse PgEs is
viewed as the major barrier to parthenogenetic development to term and for the
restricted developmental potential of the P-ESCs to mesoderm and endoderm
derivatives. There are two major clusters of imprinted genes that have been extensively
studied and primate P-ESCs. The first cluster is located on chromosome 11p15 and the
other on chromosome 15p11-q13. H19 and IGF2, one of the most important genes for
parthenogenetic development, are located on chromosome 11p15. As in mouse, in
primates, H19 is a paternally imprinted gene (i.e. maternally expressed) that encodes
for an untranslated mRNA linked to normal development and IGF2 is a paternally
expressed (maternally imprinted gene).

64

SNURF/SNRPN, UBE3A and NDN are imprinted genes located on chromosome 15q11q13 in primates and humans. SNURF/SNRPN and NDN are paternally expressed
genes and UBE3A is a maternally expressed gene.
Mitalipov et al. and Dighe et al. have analyzed the expression patterns of H19 and IGF2
and SNURF/SNRPN genes and the methylation status of their imprinted control (ICR)
regions in Rhesus monkey P-ESCs [29, 94]. Both groups reported significant
upregulation of H19 gene in non-human primate P-ESCs tested. Moreover, IGF2 was
also expressed in Rhesus Monkey P-ESCs which coincided with sporadic methylation
pattern of the IGF2/H19 ICR region. The imprinting of SNURF/SNRPN gene was stably
maintained and no expression was detected as expected for paternally expressed gene
in bi-maternal genetic background. These results demonstrated that in vitro culture
conditions and passaging can influence the epigenetic status of some of the imprinted
genes such as H19 and IGF2. Nevertheless, despite their epigenetic instability, primate
P-ESCs have been successfully differentiated into neuronal lineage in vitro, and upon
transplantation into animal models, have exhibited lineage specific function and long
term survival [17-18, 106]. Studies in mouse P-ESCs have revealed that in PGES cells
both X-cromosomes are active which leads to genome wide hypomethylation. The
genome wide hypomethylation can affect not only the imprinted genes expression but
also can lead to aneuploidy due to extrusion of one of the X-chromosome. The loss of
one of the X-cromosomes was reported as a natural attempt for dosage compensation
[85].The extent to which the imprinted genes and H19, in particular, can influence the
differentiation potential of primate P-ESCs in embryo development in vivo, however, has
not been extensively studied for several reasons. First the description of non human

65

primate P-ESCs has been relatively recent (Cibelli et al in 2001[15] and second, since
the monkeys are the closest species to human, chimera experiments where primate PESCs are introduced into a primate embryo at early stage of development or chimeras
between primate P-ESCs and embryo from other species have yet to be reported.
Hence, teratoma formation is the readily available test, so far, to analyze the
developmental potential of primate P-ESCs in vivo.
The main body of literature on the effect of imprinting on embryo development and
parthenogenesis, in particular, come from studies of mouse uniparental fetuses. It was
found that in mouse PgEs, the H19 gene was over-expressed up to 400 times
compared to biparental concepti [2, 71]. Moreover, deregulation of H19 acts as a
major barrier towards proper development of parthenogenetic embryos [2],[107],[108],
[55]. Kono and co-workers showed that a 13 kb deletion encompassing the H19
coding region and the upstream differentially methylated region (DMR) allows
parthenogenetic embryos to develop to term [107]. The efficiency of full-term
development significantly increases when the H19/Igf2 DMR region together with the
DMR region found within a second imprinted gene cluster Dlk1/Dio3 on chromosome
12 are deleted [54, 109]. Most recently Hikichi et al. showed that the development of
PG embryos can be extended following serial nuclear transfer and is associated with a
decrease in H19 expression [110].
Based on these findings in relation to the role of H19 in PgE development and in
mesoderm muscle differentiation, in particular, coming from mouse in vivo and in vitro
studies [76, 79-80, 91, 111], we hypothesized that by modulating H19 gene expression
we could achieve a more homogeneous cell differentiation of Cyno1 P-ESCs into all 3

66

germ layers – ectoderm, mesoderm and endoderm, and muscle in particular, in a
manner similar to their biparental counterparts.
To fulfill our goal, we developed a non-human primate parthenogenetic cell line from a
Cynomolgus macaque blastocyst (Cyno1 P-ESCs). We sought to analyze the
imprinted gene expression profile and the differentiation potential, in vivo, in
teratomas, of wild type Cyno1 and in Cyno1 cells with suppressed H19 gene
expression cells (Figure2.6). Our data revealed re-activation of the paternally
expressed gene PEG10 and IGF2. Consistent with previous reports in Rhesus PESCs, SNRPN expression in Cyno1 P-ESCs was not detected. The same was true for
NDN gene expression, another paternally expressed gene. NDN was highly expressed
in control CMK6 cells but not in Cyno1 cells. We also observed H19 to be overexpressed in Cyno1 P-ESCs. Teratomas from Cyno1 cells revealed high abundance of
ectoderm germ layer followed by endoderm and mesoderm cartilage derivatives.
However, no skeletal muscle development was observed (Figure 2.4).
After downregulation of H19 gene expression using a H19 small hairpin (sh) RNA
expressing vector system, we were able to achieve H19 mRNA expression levels, as
measured by qRT-PCR, similar to that observed in control biparental (CMK6) cell line.
Unfortunately, we were not able to proceed with using the Cyno1 cells with
suppressed H19 expression for further studies in vivo, in teratomas, due to high
incidence of chromosomal aberration which rendered the cells karyotypically abnormal
(Table2.2). Nevertheless, the data provided here revealed that transgenic Cyno1 PESCs with stable down regulation of H19 can be generated in vitro. New lines of
primate P-ESC Cyno1 or Rhesus monkey P-ESCs (Mitalipov[29, 94]) at lower passage

67

number will be used to test the effect of H19 on the differentiation plasticity of primate
P-ESCs in vivo.

MATERIALS AND METHODS
Cyno1 P-ESCs derivation and culturing
Monkey Parthenogenetic ES cells were derived from the inner cell mass (ICM) of a
parthenogenetically activated embryos (PgEs) at blastocyst stage (Figure2.2).The
monkey oocyte donor was from Macaca fascicularis monkey also known as
Cynomolgus monkey and therefore the P-ESCs derived were called Cyno1 P-ESCs.
The protocol used for parthenogenetic oocyte activation and Cyno1 P-ESCs derivation
was previously published by Cibelli et al in 2002 [15-16]. Briefly, the protocol for calls
for the use of ionomycin for parthenogenetic activation of the oocyte followed by 6DMAP which prevents the extrusion of the second polar body by inhibiting DNA
synthesis and mitosis[112]. After removal of zona pellucida by brief pronase exposure,
the PG blastocysts were cultured over mitotically inactivated mouse embryonic
fibroblast (MEF) cells with DMEM F12 (Invitrogen) medium supplemented with 20%
FBS-HI (Invitrogen, Carlsbad, CA), 2mM L-Glutamine (Invitrogen, Carlsbad, CA), 1%
Non-essential Amino Acids (Invitrogen, Carlsbad, CA), 2-Mercaptoethanol (Sigma,
St.Louis, MO), and 1x final volume of Penicillin-Streptomycin. After colonies appear
(approximately after 2 weeks), they were mechanically removed and passed onto new
MEF cells.

Human Embryonic Stem (HES) cells derivation and culture

68

HES were purchased from WiCell Research Institute (Madison, WI). HES cells were
cultured over mitotically inactivated mouse embryonic fibroblast (MEF) cells with DMEM
F12 (Invitrogen, Carlsbad, CA) medium supplemented with 20% Knock out Serum
(Invitrogen, Carlsbad, CA), 2mM L-Glutamine (Invitrogen, Carlsbad, CA), 1%, Nonessential Amino Acids (Invitrogen, Carlsbad, CA), 4ng/ml FGF2 (Invitrogen, Carlsbad,
CA), 2-Mercaptoethanol (Sigma, St.Louis, MO), Penicillin-Streptomycin, 1x final volume
and cultured according to the manufacturer’s recommendations. The human ES cells
were mechanically passed onto new MEF cells during each passaging.

RNA isolation and cDNA synthesis
Total RNA from three biological replicates of wild type Cyno1, Cyno1 transfected with
the H19shRNA expressing plasmid vector (Cyno1 H19shRNA) and Cyno1 cells
transfected with the empty control plasmid vector (Cyno1 Con.vector) was extracted
using Rneasy Kit (Qiagen, Valenica, CA) and residual genomic DNA was removed by
DNAse I digestion, using the RNAse –Free DNAse Set (Qiagen, Valencia, CA)
according to the manufacturer’s instructions and observing strict RNAse and DNAse
free procedures. Biparental Cyno1 (CMK6) cell lysed in Rneasy cell lysis buffer
(Qiagen, Valencia, CA) were provided generously from Dr. Norio Nakatsuji (Institute for
Frontier Medical Sciences, Kyoto University, Japan) and the RNA extraction was done
following the manufacturer’s recommendations. Additionally, following the same method
as described above, we isolated total RNA from Cynomolgus monkey skin and testis
and from teratoma derived from Cyno1 P-ESCs. Total RNA from all samples used was
eluted from the purification column using 25 µl volume of nuclease free water (Ambion,
69

Austin, TX). Total mRNA amount was measured using Nanodrop. One ug of total RNA
with OD260/280 > 2.1 was spiked with 1µl of 250fg/ µl of HcRed1 synthetic RNA as an
exogenous control and then used for first strand cDNA synthesis. For first strand cDNA
synthesis, Superscript II (Invitrogen, Carlsbad, CA) and anchored Oligo (dT12-18) primers
(Invitrogen, Carlsbad, CA) were used following the manufacturer’s instructions in a final
total volume of 20µl. For quantitative Real Time PCR (qRT-PCR), each Reverse
Transcription (RT) reaction was then diluted with nuclease free water (Ambion, Austin,
TX) to a final volume of 100µl.

In Vitro Transcription and RNA quantification
For synthesis of far-red fluorescent protein (HcRed1) cRNA, linear DNA templates
having a SP6 promoter sequence at the 5’end and poly(T18) tail on the 3’end were
generated by polymerase chain reaction (PCR) from plasmid vector pHc-Red-Nuc (BD
Bioscience, San Jose, CA). The conditions for cRNA synthesis are described elsewhere
(Bettegowda et al, 2006, Molecular Reproduction and development). The RNA quality
and quantity were estimated using an Agilent Bioanalyzer 2100 RNA 6000 nanochip
(Agilent Technologies, Palo Alto, CA).

Absolute Quantitative Real –Time PCR
The quantification of all gene transcripts was performed by absolute real-time
quantitative RT-PCR using SYBR Green PCR Master Mix (Applied Biosystems, Foster
City, CA). Absolute quantification using this method is described elsewhere (Li and
Wang, 2000; Whelan et al., 2003). Primers for absolute real time PCR were designed

70

using Primer Express program (Applied Biosystems, Foster City, CA) and derived from
mouse sequences found in GeneBank. A primer matrix was performed for each gene
tested to determine optimal concentrations. Each reaction mixture consisted of 2 µl of
cDNA, optimum concentration of each forward and reverse primer, nuclease free water,
and 12.5 µl of SYBR Green PCR Master Mix in a total reaction volume of 25 µl (96well
plates). Reactions were performed in duplicate for each sample using an ABI Prism
7000 Sequence Detection System (Applied Biosystems, Foster City, CA). The thermal
cycle consisted of 40 cycles of 95ºC for 15sec and 60 ºC for 1min. Standard curves for
each gene and controls were constructed using tenfold serial dilutions of corresponding
plasmids and run on sample plates as standards. For gene expression, normalization
the expression levels of beta actin (β-actin) were used. To monitor for the technical
accuracy and reproducibility of our RNA extraction and qRT-PCR efficiency, HcRed
expression levels were monitored.
Copies of HcRed 1 and b-actin RNA in each pool were determined using standard
curves constructed from the plasmid pHc-Red1-Nuc and PCR2.1 plasmid (Invitrogen
Life Technologies, Carlsbad, CA), containing the β-actin sequenced product. Real-time
primer sequences for HcRed1 were designed elsewhere (Bettegowda et al, 2006).
Partial cDNA sequences for H19, β-actin and other genes tested (Table2.1), were
amplified from mouse Cyno1 ES cells cloned into pCR2.1 Topo vector (Invitrogen Life
Technologies, Carlsbad, CA), and subjected to fluorescent dye primer sequencing to
confirm identity. From the resulting plasmids were construct standard curves.
Representative R2 for HcRed1, H19 and the rest of the genes will be estimated and only
the one ≥ 0.98 will be used. For each measurement, threshold lines will be adjusted to

71

intersect amplification lines in exponential portion of amplification curve (Bettegowda et
al). For each sample amounts of mRNA (copies) for β-actin and HcRed1 were
determined from their respective standard curves.

Plasmid shRNA delivery system
For the plasmid shRNA delivery, pRNAT- U6.1/Neo vector was used (GenScript,
Piscataway, NJ). In this vector system the H19 shRNA was expressed from U6
promoter and GFP and Neomycin expression were driven by CMV promoter. The
pRNAT- U6.1/Neo H19 shRNA vector was linearized by using a unique ScaI (NEB,
Ipswich, MA) restriction site and transformed into Cyno1 cell line by using Fugene6
transfection reagent (Roche, Basel Switzerland) according to the manufacturers’
recommendations. Stable transgenic cell line was selected by using 100ug/ml of
Neomycin for 14 days.

Teratoma formation
A suspension of approximately 2x106 Cyno1 P-ESCs was injected subcutaneously into
immune-deficient Nude mice, CD-1 (Charles River Laboratories, Wilmington, MA).
Euthanasia was done following AAALAC's guidelines. One tumor was isolated and
examined macroscopically. Diameter was recorder to be 0.8 cm. Subsequently, the
tumor was fixed in paraformaldehyde, embedded in paraffin and stained with
hematoxylin eosin. Contribution of the different tissue types in the tumor was
determined under the microscope in 100 different fields.

72

We did not proceed to inject the Cyno1 H19shRNA or Cyno1 Con.vector cells due to
their cytogenetic abnormalities which identified the cells as karyotypically unstable with
multiple chromosomal aberrations (see Table2.2).
We also did not injected CMK6 cells since the lab that has established the CMK6 cell
line, led by Dr. Norio Nakatsuji, agreed upon sending only lysed cells for RNA isolation
and transcription analysis.

Immunocytochemistry
Cells were washed 3 times, each time 5 minutes with washing buffer (DPBS, 0.1%
TX100 (Triton 100X) and incubated with Permeabilization Buffer (DPBS, 1% TX100) for
10 min. Subsequently, the cells were washed once more with washing buffer, then
blocked with blocking buffer (DBPS + 0.1%TX100 + 1%BSA + 10%NGS) for 1-2 hours.
Oct4 antibody (Santa Cruz Biotechnology, inc Santa, Cruz, CA.) in dilution 1:300,
SSEA4 (R@D Systems, Minneapolis, MN) in dilution 1:500 and HuNu (Millipore,
Billerica, MA) in 1:500 was added to the cells and incubated for 3 hours to overnight at
4C. Cells were washed 6 times each time 10minutes. Then secondary Ab (Abcam,
Cambridge, MA) was added in 1:500 dilutions following the manufacturer’s
recommendations.

Immunohystochemical analysis of formalin fixed, paraffin embedded tumor
sections
Hematoxylin-Eosin staining

73

Tissue samples previously fixed in 10% Neutral Buffered Formalin were processed
embedded with the ThermoFisher HistoCentre III embedding station. The blocks were
sectioned at 4-5 microns. Sections were stained with Hematoxylin and Eosin (H and E).

Statistics
qRT-PCR experimental data and teratoma quantification data were analyzed by
analysis of variance (ANOVA) procedure using the mixed procedure of SAS (Cary, NC,
USA). Differences of p < 0.05 were considered statistically significant

RESULTS AND DISCUSSION
Alteration of key imprinted genes in P-ESCs
For our initial experiments looking at H19 and IGF2 gene expression levels in Cyno1
PGES cells, we used HES cells as biparental control cell line. The reason was that at
that time we did not have Cynomolgus macaque derived biparental cell line in our
laboratory. The evolutionary proximity of the two species justified the use of human
ESCs.
It has been reported that in mouse and Rhesus P-ESCs, H19 is highly overexpressed.
Consistent with these findings, our qPCR expression data revealed that in Cyno1 PESCs, H19 mRNA levels were higher than that in the biparental HES cells (Figure2.3).
Our qPCR data also revealed IGF2 to be also highly expressed in Cyno1 P-ESCs
(Figure2.3). We did not analyze further the mechanism of IGF2 loss of imprinting, but
data coming from the literature suggest that cell culture conditions and prolong
passaging can alter the epigenetic status of the cells and lead to loss of imprinting [113].

74

We also looked at the expression pattern of H19 and IGF2 in cells derived from Cyno1
P-ESCs teratomas (Figure2.3), Cyno1 skin and Cyno1 testis. We found that H19 and
IGF2 were the most highly overexpressed in teratomas derived from Cyno1 P-ESCs.
IGF2 and H19 expression was also detected in Cyno1 testis; however IGF2 expression
in testis was significantly higher than the expression of H19 gene. Upon terminal
differentiation into skin fibroblast, both mRNA abundance of H19 and IGF2 was very low
but detectable.
The data presented above revealed H19 to be highly overexpressed in Cyno1 P-ESCs
and in cells derived from Cyno1 P-ESCs teratomas compare to control biparental HES
cells, Cyno1 testis, and Cyno1 skin fibroblast cells (Figure2.3). IGF2 was also highly
expressed in Cyno1 P-ESCs, and Cyno1 derived teratomas followed by Cyno1 testis.
As the cells proceed to terminal differentiation into skin, the expression levels of both
H19 and IGF2 become barely detectable. The high expression levels of H19 and IGF2
in Cyno1 P-ESCs derived teratomas indicate that during differentiation in vivo, into
teratomas, the expression pattern of H19 and IGF2 remain high as in the P-ESCs from
which the teratomas were derived (see Figure2.3C-E)

Teratomas derived from P-ESCs give rise to a lower proportion of mesoderm
derived muscle compared to tumors derived from B-ESCs
Cyno1 P-ESCs are pluripotent in that they stain positive for the pluripotency markers
Oct4 and SSEA4 (Figure2.2C-D). Staining of the cells with HuNu antibody to confirmed
the primate identity of the cells upon their derivation (Figure2.2E). Next we perform an
in vivo pluripotency assay by testing the ability of Cyno1 P-ESCs, upon teratoma

75

formation, to give rise to derivatives of all three germ layers –ectoderm, endoderm and
mesoderm. We injected Cyno1 P-ESCs subcutaneously into immunodeficient Nude
mice-CD-1 (see Materials and Methods). A teratoma was recovered, formalin fixed and
paraffin embedded. The teratoma was then sectioned into 4-5 microns sections and
H&E stained. Macroscopic examination of the teratoma sections revealed that
morphologically it consisted of terminally differentiated tissues with very little
contribution of mitotically dividing cells. There was a high abundance of ectoderm
derived neural epithelium, followed by mesoderm derived cartilage and endoderm
derived primitive glandular structures (Figure2.4). No mesoderm derived skeletal
muscle was identified. Therefore, we concluded that Cyno1 P-ESCs are pluripotent and
have the potential, when differentiated in vivo, into teratomas, to give rise to derivatives
of all three germ layers ectoderm, endoderm and mesoderm. However, Cyno1 P-ESCs
exhibit limited differentiation potential into mesoderm muscle derivatives.

Downregulation of H19 expression in Cyno1 ES cells
We designed an H19shRNA expressing vector system. The H19shRNA was expressed
under the control of U6 promoter of pRNAT-U6.1 vector (GenScript Corporation). The
pRNAT-U6.1 also encoded a green fluorescent protein (GFP) under the control of CMV
promoter. This feature allowed us to monitor the transfection efficiency of the
H19shRNA vector during the Neomycin selection for stable H19shRNA expressing cell
line (Figure2.5).
PCR and qRT-PCR data revealed that H19 was stably downregulated in Cyno1 PGES
cells transfected with the H19shRNA expressing vector (Cyno1 H19shRNA) compare to

76

Cyno1 PGES cells transfected with control empty vector (Cyno1 Con.vector)
(Figure2.5C and Figure2.6A). H19 mRNA abundance in Cyno1 H19shRNA cells was
similar to that of control biparental CMK6 cells (Figure2.6A). IGF2 mRNA expression in
Cyno1 H19shRNA cells was lower than in Cyno1 and CMK6 cells, but the level of IGF2
mRNA in Cyno1 cells was significantly higher than that in the CMK6 cells. PEG10
mRNA abundance in Cyno1 and Cyno1 H19shRNA cells was low but detectable
compared to robust expression in CMK6 cells. P57 mRNA abundance in Cyno1
H19shRNA cells was lower compared to Cyno1 and CMK6 cells, but the expression
level of P57 in Cyno1 cells was higher than that in the biparental CMK6 cells. SNRPN
and NDN mRNA expression in Cyno1 Con.vector and Cyno1 H19shRNA cells was
undetectable.
In conclusion, we were able to downregulate the H19 levels in Cyno1 P-ESCs to levels
similar to control biparental CMK6 Cyno1 cells.
Our data also indicated that with the exception of IGF2, the expression levels of the
paternally expressed gene SNRPN were barely detectable while PEG10 and NDN
expression was not detected as expected according to their maternal imprinting status.
The mRNA abundance of P57, a maternally expressed gene, was overexpressed in
Cyno1 P-ESCs compare to that in biparental CMK6 cells, as expected, with or without
suppressed H19 gene expression.

77

CONCLUSION
Non-human primates are evolutionary the closest species to human and therefore,
primate PGES cells offer an invaluable tool for studying the effect of imprinting on
development and differentiation and the efficiency of engraftment and survival of P-ESC
derived tissues.
In our study we aimed to analyze the imprinted gene expression profile of IGF2 before
and after suppression of H19 gene expression as well as the expression of P57, NDN,
PEG10 and SNRPN in H19shRNA Cyno1 and Cyno1 Con.vector P-ESCs. H19 and P57
are maternally expressed (i.e paternally imprinted) genes and IGF2, NDN, PEG10 and
SNRPN are paternally expressed (maternally imprinted) genes. Interestingly qRT-PCR
data from Cyno1 PGES cells derived teratomas indicated that the expression of the
imprinted genes is maintained during the differentiation of these cells in vivo. This data
suggest that once established in the ES cell line, the imprinting status of some genes
remains stable during differentiation, at least under the teratoma assay conditions. We
also found that Cyno1 P-ESCs are pluripotent. They stained for the pluripotency
markers OCT4, SSEA4 and upon differentiation in vivo, in teratomas, they give rise
most exclusively to terminally differentiated tissues from all three germ layers –
ectoderm, endoderm and mesoderm. These findings indicate their benign origin which
emphasize on the feasibility of using Cyno1 P-ESCs for generation of terminally
differentiated tissues for transplantation. Indeed, Cyno1 P-ESCs derived neurons were
able, upon transplantation in vivo, to express dopamine and serotonin. They were also
electrophysiologically active and exhibited long term survival upon transplantation into
primate models of Parkinson disease [17-18, 106].

78

Scientific reports coming from mouse P-ESCs studies in vitro and in vivo have revealed
that H19 is the most over expressed gene in mouse PGES cells and PgEs. It has been
also demonstrated that H19 is critical for PgE development to term since 13 kb deletion
encompassing H19 coding and upstream DMR region allowed for parthenogenetic
embryo to develop to term. When mouse P-ESCs are injected into wild type chimeras,
their contribution to muscle tissue is restricted[79]. Moreover we and others have shown
that teratomas derived from P-ESCs consist of predominantly ectoderm derivatives with
very little muscle contribution around 5%, (Cibelli unpublished) compare to teratomas
derived from biparental mouse P-ESCs -20% (Cibelli unpublished). We also showed
that upon suppression of H19 gene expression, mouse PGES cells exhibit increased
differentiation potential to mesoderm muscle compare to wild type P-ESCs and more
similar to normal biparental mouse P-ESCs controls (Cibelli unpublished). Consistent
with these findings in mouse models, teratomas derived from our Cyno1 PGES cells did
not exhibit muscle derivatives. In order to study the effect of the imprinted genes, and
H19 in particular, on the mesoderm muscle development in primate Cyno1 P-ESCs, we
derived a transgenic Cyno1 H19shRNA cell line with stable suppression of the H19
gene expression by using a shRNA expressing vector. Knockdown of H19 mRNA in the
Cyno1 H19shRNA cell line resulted in H19 mRNA expression similar to that observed in
the biparental CMK6 cell line. Unfortunately due to the multiple cytogenetic
abnormalities of the Cyno1 P-ESCs we were unable to test the differentiation potential
of the transgenic Cyno1 H19shRNA cell line in vivo. New Cyno1 cell lines, at lower
passage number will be utilized in the future to fulfill this goal. We expect that
downregulation of H19 will reverse the dearth of mesoderm derived muscle and will

79

allow for more complete differentiation potential of the Cyno1 P-ESCs similar to that of
their normal biparental counterparts. This study will help elucidate the effect of
imprinting on cellular differentiation in general and will increase the efficiency of primate
Cyno1 P-ESCs for future application in the transplantation medicine.

80

FIGURES AND TABLES

Figure 2.1 Experimental Outline (part of the figure was adopted from “Stem Cells:
Scientific Progress http://stemcells.nih).
Chemical Activation

Gastrula

Blastocyst

Isolation of ICM

Gene Expression Profile

PGES cell cultivation

Immunocytochemistry

H19shRNA vector design

Stable Cell Line

pRNAT-U6.1
(9.4kb)
Vector was used
(Corporation)

Ectoderm

Mesoderm

Endoderm

Germ cells

Teratoma Formation
Stem Cells: Scientific Progress http://stemcells.nih.gov
Germ Layers Derivation

81

Figure 2.2 Derivation (A-B) and Immunocytochemical staining (C-E) of Cyno1 P-ESCs;
Parthenogenetically activated Cyno1 oocytes (A), Cyno1 P-ESCs morphology (B),
OCT4 (C), SSEA4(D) and HuNu (E) Immunocytochemical staining.

A

B
mef

Cyno-1

C

D

E

82

Figure 2.3 qRT-PCR Analysis of the expression levels of HcRed (A) and beta actin (B)
and the maternally expressed H19 (C) and paternally expressed IGF2 (D,E) genes. The
mRNA abundance of all the genes was normalized to beta actin control, n=3 (P<0.05).
HcRed was used to assay for technical efficiency only. The bars represent stand error
bars. All the letters above the error bars represent the difference between samples on
the basis of standard error values (P<0.05).

HcRed mRNA abundance

A

83

Beta-actin mRNA abundance

Figure 2.3 (cont’d)

B

84

Figure 2.3 (cont’d)

C

D

85

Figure 2.3 (cont’d)

E

86

Figure 2.4 Teratomas from Cyno1 P-ESCs give rise to derivatives of all three germ
layers- ectoderm, endoderm, and mesoderm (A-K); C -10X, A,B, D, E, F, G, J -20X, H,
I, K-40X, ctr- cartilage, sm- smooth muscle, nt- neural tissue, gl- glandular structures,
eps- ependymal papillary structures (ciliated epithelia).

eps
crt

A

gl

sm

crt
crt

nt
nt

B

eps

C
eps

nt

crt

E

F

sm

sq

G

sm

H

gl

J

nt

nt

crt

D

gl

I

gl

K

87

Figure 2.5 Downregulation of H19 in Cyno1 P-ESCs. Cyno1 P-ESC colony stably
transfected with H19shRNA expressing vector, 14days post Neomycin selection (A-B).
A. Bright Field, B. Green Fulorescence expression from H19shRNA trasnfected plasmid
vector. C. PCR gel electrophoresis for detection of H19 expression (Lanes 1 and 4)
using beat actin as control (Lanes 2 and 5). Lane 1 and 2- Cyno1 P-ESC Con.vector,
Lane 4 and 5- H19shRNA Cyno1, Lane 7 Marker (M) -1 kb Plus DNA ladder.

A

B

2000bp

500bp

C

88

Figure 2.6 qRT-PCR Analysis of the expression levels of the maternally expressed H19
and P57 (Figure2.5A and E respectively) and paternally expressed IGF2, NDN, PEG10
and SNRPN (Figure2.5B, C, D and F respectively) genes. The mRNA abundance of all
the genes was normalized to beta actin control; for all runs n=3 (P<0.05). The bars
represent stand error bars. All the letters above the error bars represent the difference
between samples on the basis of standard error values (P<0.05).

A

89

Figure 2.6 (cont’d)

B

90

Figure 2.6 (cont’d)

C

91

Figure 2.6 (cont’d)

D

92

Figure 2.6 (cont’d)

E

93

Figure 2.6 (cont’d)

F

94

Table 2.1 qRT-PCR Primers Table
qRT-PCR primer
name

Primer sequence

Accession number

H19 Forward

5'-CCCGTCCCTTCTGAATTTAATTT-3'

NR_002196.1

H19 Reverse

5'-CACTCGCACCGAGACTCAAG-3'

NR_002196.1

p57 Forward

GCGCGGCGATCAAGAA

NG_008022.1

p57 Reverse

ACATCGCCCGACGACTTC

NG_008022.1

IGF2 Forward

5'-CCGTGCTTCCGGACAACTT-3'

NM_000612.4

IGF2 Reverse

5'-TGGACTGCTTCCAGGTGTCA-3'

NM_000612.4

NDN Forward

CCGGCCTAACCAAGAAAAGTC

NM_001172102.1

NDN Reverse

ACTCCACGAGGGTGTTTTCTGT

NM_001172102.1

PEG10 Forward

TTGTCTGTAGCCCTGGCATGT

NM_001172427.1

PEG10 Reverse

GGGAACTTTTCCAGACTTTTGCT

NM_001172427.1

SNRPN Forward

GCAGAAGGACTGCCTCACTGA

XM_001106970.2

SNRPN Reverse

CAGGTACTTGCTGCTGCTGAGA

XM_001106970.2

b-actin Forward
b-actin Reverse

CATACTCCTGCTTGCTGATCCA
GGATCGGCGGCTCCAT

NM_001101.3
NM_001101.3

95

Table 2.2 Summary of the Cyno1 oocyte donor (Buttercup) derived fibroblast cells at
p4, Cyno1p47 and Cyno1p60 P-ESCs (Cell Line Genetics, WI, USA).
Cell Line ID

Passage #

Specimen Type

Results

Cyno1-Butter cup
(Oocyte donor)

4

Monkey Fibroblast
Culture

42,XX, inv(6) X2(20)
Apparently normal
monkey female
karyotype

Cyno1 P-ESCs

47

Live ES culture

Cyno1 P-ESCs

60

Live ES culture

42,XX,
inv(6q),inv.dup(6q),
del(7p),del(18p)
Abnormal female
karyotype
42,XX,
inv(6q),inv.dup(6q),
del(7p),del(18p)
Abnormal female
karyotype

96

REFERENCES

97

REFERENCES
1.

Mutter, G.L., Role of imprinting in abnormal human development. Mutation
Research/Fundamental and Molecular Mechanisms of Mutagenesis, 1997.
396(1-2): p. 141-147.

2.

Sotomaru, Y., et al., Unregulated Expression of the Imprinted Genes H19 and
Igf2r in Mouse Uniparental Fetuses J. Biol. Chem., 2002. 277(14): p. 1247412478.

3.

Ogawa, H., et al., Disruption of parental-specific expression of imprinted genes in
uniparental fetuses. FEBS Letters, 2006. 580(22): p. 5377-5384.

4.

Surti, U., et al., Genetics and biology of human ovarian teratomas. I. Cytogenetic
analysis and mechanism of origin. Am J Hum Genet, 1990. 47(4): p. 635-43.

5.

Revazova, E.S., et al., Patient-specific stem cell lines derived from human
parthenogenetic blastocysts. Cloning Stem Cells, 2007. 9(3): p. 432-49.

6.

Revazova, E.S., et al., Patient-Specific Stem Cell Lines Derived from Human
Parthenogenetic Blastocysts. Cloning and Stem Cells, 2007. 9(3): p. 432.

7.

Revazova, E.S., et al., HLA Homozygous Stem Cell Lines Derived from Human
Parthenogenetic Blastocysts. p. 1-14.

8.

Mai, Q., et al., Derivation of human embryonic stem cell lines from
parthenogenetic blastocysts. Cell Res. 17(12): p. 1008-1019.

9.

Strain, L., et al., A human parthenogenetic chimaera. Nat Genet, 1995. 11(2): p.
164-9.

10.

Surani, M.A., Parthenogenesis in man. Nat Genet, 1995. 11(2): p. 111-3.

11.

Cibelli, J.B., K. Cunniff, and K.E. Vrana, Embryonic stem cells from parthenotes.
Methods Enzymol, 2006. 418: p. 117-35.
98

12.

Mitalipov, S.M., K.D. Nusser, and D.P. Wolf, Parthenogenetic Activation of
Rhesus Monkey Oocytes and Reconstructed Embryos. 2001. p. 253-259.

13.

Cibelli, J.B., K. Cunniff, and K.E. Vrana, Embryonic Stem Cells from Parthenotes,
in Methods in Enzymology, K. Irina and L. Robert, Editors. 2006, Academic
Press. p. 117-135.

14.

Zvetkova, I., et al., Global hypomethylation of the genome in XX embryonic stem
cells. Nat Genet, 2005. 37(11): p. 1274-9.

15.

Cibelli, J.B., et al., Parthenogenetic stem cells in nonhuman primates. Science,
2002. 295(5556): p. 819.

16.

Vrana, K.E., et al., Nonhuman primate parthenogenetic stem cells. Proc Natl
Acad Sci U S A, 2003. 100 Suppl 1: p. 11911-6.

17.

Sanchez-Pernaute, R., et al., Long-Term Survival of Dopamine Neurons Derived
from Parthenogenetic Primate Embryonic Stem Cells (Cyno-1) After
Transplantation. 2005. p. 914-922.

18.

Ferrari, D., et al., Transplanted dopamine neurons derived from primate ES cells
preferentially innervate DARPP-32 striatal progenitors within the graft. 2006. p.
1885-1896.

19.

Dighe, V., et al., Heterozygous Embryonic Stem Cell Lines Derived from
Nonhuman Primate Parthenotes. 2008. p. 2007-0869.

20.

Cheng, L., More new lines of human parthenogenetic embryonic stem cells. Cell
Res. 18(2): p. 215-217.

21.

Sapienza, C., Parental imprinting of genes. Sci Am, 1990. 263(4): p. 52-60.

22.

Tang, W.-y. and S.-m. Ho, Epigenetic reprogramming and imprinting in origins of
disease. Reviews in Endocrine & Metabolic Disorders.
99

23.

Swales, A.K.E. and N. Spears, Genomic imprinting and reproduction. 2005. p.
389-399.

24.

Fujimoto, A., et al., Aberrant genomic imprinting in rhesus monkey embryonic
stem cells. Stem Cells, 2006. 24(3): p. 595-603.

25.

Newman-Smith, E.D. and Z. Werb, Stem cell defects in parthenogenetic periimplantation embryos. Development, 1995. 121(7): p. 2069-77.

26.

Horii, T., et al., Loss of Genomic Imprinting in Mouse Parthenogenetic Embryonic
Stem Cells. 2008. p. 79-88.

27.

Kono, T., et al., Birth of parthenogenetic mice that can develop to adulthood.
Nature, 2004. 428(6985): p. 860-4.

28.

Kono, T., et al., Mouse parthenogenetic embryos with monoallelic H19
expression can develop to day 17.5 of gestation. Dev Biol, 2002. 243(2): p. 294300.

29.

Mitalipov, S., et al., Methylation status of imprinting centers for H19/IGF2 and
SNURF/SNRPN in primate embryonic stem cells. Stem Cells, 2007. 25(3): p.
581-8.

30.

Runte, M., et al., SNURF-SNRPN and UBE3A transcript levels in patients with
Angelman syndrome. Human Genetics, 2004. 114(6): p. 553-561.

31.

Reik, W. and E.R. Maher, Imprinting in clusters: lessons from BeckwithWiedemann syndrome. Trends Genet, 1997. 13(8): p. 330-4.

32.

Nicholls, R.D., S. Saitoh, and B. Horsthemke, Imprinting in Prader-Willi and
Angelman syndromes. Trends in Genetics, 1998. 14(5): p. 194-200.

33.

Hurst, L.D. and G.T. McVean, Growth effects of uniparental disomies and the
conflict theory of genomic imprinting. Trends Genet, 1997. 13(11): p. 436-43.
100

34.

Sotomaru, Y., et al., Disruption of imprinted expression of U2afbp-rs/U2af1-rs1
gene in mouse parthenogenetic fetuses. J Biol Chem, 2001. 276(28): p. 26694-8.

35.

Poirier, F., et al., The murine H19 gene is activated during embryonic stem cell
differentiation in vitro and at the time of implantation in the developing embryo.
1991. p. 1105-1114.

36.

Varrault, A., et al., Zac1 Regulates an Imprinted Gene Network Critically Involved
in the Control of Embryonic Growth. Developmental Cell, 2006. 11(5): p. 711722.

37.

Gabory, A., et al., H19 acts as a trans regulator of the imprinted gene network
controlling growth in mice. Development, 2009. 136(20): p. 3413-21.

38.

Matsuda T, W.N., Genetics and molecular markers in gestational trophoblastic
disease with special reference to their clinical application. Best Pract Res Clin
Obstet Gynaecol, 2003. 17.(6): p. 827-36.

39.

Schoenfelder, S., et al., Non-coding transcripts in the H19 imprinting control
region mediate gene silencing in transgenic Drosophila. EMBO Rep, 2007. 8(11):
p. 1068-73.

40.

Berteaux, N., et al., A novel H19 antisense RNA overexpressed in breast cancer
contributes to paternal IGF2 expression. Mol Cell Biol, 2008. 28(22): p. 6731-45.

41.

Gabory, A., H. Jammes, and L. Dandolo, The H19 locus: role of an imprinted
non-coding RNA in growth and development. Bioessays, 2010. 32(6): p. 473-80.

42.

Gabory, A., et al., The H19 gene: regulation and function of a non-coding RNA.
Cytogenet Genome Res, 2006. 113(1-4): p. 188-93.

43.

Cullen, X.C.a.B.R., The imprinted H19 noncoding RNA is a primary microRNA
precursor. RNA, 2007. 13: p. 313–316.

101

44.

Han, V.K.M. and A.M. Carter, Spatial and Temporal Patterns of Expression of
Messenger RNA for Insulin-Like Growth Factors and their Binding Proteins in the
Placenta of Man and Laboratory Animals. Placenta, 2000. 21(4): p. 289-305.

45.

Pringle, K.G. and C.T. Roberts, New Light on Early Post-Implantation Pregnancy
in the Mouse: Roles for Insulin-Like Growth Factor-II (IGF-II)? Placenta, 2007.
28(4): p. 286-297.

46.

Minniti, C.P., et al., Insulin-like growth factor II overexpression in myoblasts
induces phenotypic changes typical of the malignant phenotype. 1995. p. 263269.

47.

Pacher, M., et al., Impact of constitutive IGF1/IGF2 stimulation on the
transcriptional program of human breast cancer cells. 2007. p. 49-59.

48.

Prelle, K., et al., Overexpression of insulin-like growth factor-II in mouse
embryonic stem cells promotes myogenic differentiation. Biochem Biophys Res
Commun, 2000. 277(3): p. 631-8.

49.

Weber, M.M., et al., Postnatal Overexpression of Insulin-Like Growth Factor II in
Transgenic Mice Is Associated with Adrenocortical Hyperplasia and Enhanced
Steroidogenesis. 1999. p. 1537-1543.

50.

Moorehead, R.A., et al., Transgenic overexpression of IGF-II induces
spontaneous lung tumors: a model for human lung adenocarcinoma. Oncogene,
2003. 22(6): p. 853-7.

51.

Petrik, J., et al., Overexpression of Insulin-Like Growth Factor-II in Transgenic
Mice Is Associated with Pancreatic Islet Cell Hyperplasia. 1999. p. 2353-2363.

52.

Newman-Smith, E. and Z. Werb, Functional analysis of trophoblast giant cells in
parthenogenetic mouse embryos. Dev Genet, 1997. 20(1): p. 1-10.

53.

Mitalipov, S., et al., Methylation Status of Imprinting Centers for H19/IGF2 and
SNURF/SNRPN in Primate Embryonic Stem Cells
10.1634/stemcells.2006-0120. Stem Cells, 2006: p. 2006-0120.

102

54.

Kawahara, M., et al., High-frequency generation of viable mice from engineered
bi-maternal embryos. Nat Biotechnol, 2007. 25(9): p. 1045-50.

55.

Kono, T., et al., Paternal dual barrier by Ifg2-H19 and Dlk1-Gtl2 to
parthenogenesis in mice. Ernst Schering Res Found Workshop, 2006(60): p. 2333.

56.

Yoshimizu, T., et al., The H19 locus acts in vivo as a tumor suppressor. Proc Natl
Acad Sci U S A, 2008. 105(34): p. 12417-22.

57.

Liou, J.-M., et al., Loss of imprinting of insulin-like growth factor II is associated
with increased risk of proximal colon cancer. European Journal of Cancer. In
Press, Corrected Proof.

58.

Adriaenssens, E., et al., H19 Overexpression in Breast Adenocarcinoma Stromal
Cells Is Associated with Tumor Values and Steroid Receptor Status but
Independent of p53 and Ki-67 Expression. Am J Pathol, 1998. 153(5): p. 15971607.

59.

Barsyte-Lovejoy, D., et al., The c-Myc Oncogene Directly Induces the H19
Noncoding RNA by Allele-Specific Binding to Potentiate Tumorigenesis. Cancer
Research, 2006. 66(10): p. 5330-5337.

60.

Berteaux, N., et al., H19 mRNA-like Noncoding RNA Promotes Breast Cancer
Cell Proliferation through Positive Control by E2F1. Journal of Biological
Chemistry, 2005. 280(33): p. 29625-29636.

61.

Dugimont, T., et al., The H19 gene is expressed within both epithelial and
stromal components of human invasive adenocarcinomas. Biology of the Cell,
1995. 85(2-3): p. 117-124.

62.

Lottin, S., et al., Overexpression of an ectopic H19 gene enhances the
tumorigenic properties of breast cancer cells. Carcinogenesis, 2002. 23(11): p.
1885-1895.

103

63.

Lottin, S., et al., Thioredoxin post-transcriptional regulation by H19 provides a
new function to mRNA-like non-coding RNA. Oncogene, 2002. 21(10): p. 162531.

64.

Matouk, I.J., et al., The oncofetal H19 RNA connection: Hypoxia, p53 and
cancer. Biochimica Et Biophysica Acta-Molecular Cell Research, 2010. 1803(4):
p. 443-451.

65.

Tsang, W.P., et al., Oncofetal H19-derived miR-675 regulates tumor suppressor
RB in human colorectal cancer. Carcinogenesis, 2010. 31(3): p. 350-358.

66.

Sheehy, E., et al., Estimating the number of potential organ donors in the United
States. N Engl J Med, 2003. 349(7): p. 667-74.

67.

Coombes, J.M. and J.F. Trotter, Development of the allocation system for
deceased donor liver transplantation. Clin Med Res, 2005. 3(2): p. 87-92.

68.

Nagy, A., et al., Embryonic stem cells alone are able to support fetal
development in the mouse. 1990. p. 815-821.

69.

Nagy, A., et al., Derivation of Completely Cell Culture-Derived Mice from EarlyPassage Embryonic Stem Cells. 1993. p. 8424-8428.

70.

Horii, T., et al., Loss of Genomic Imprinting in Mouse Parthenogenetic Embryonic
Stem Cells. 2007. p. 2006-0635.

71.

Platonov, E.S., L.I. Penkov, and D.A. New, [Effects of growth factors FGF2 and
IGF2 on the development of parthenogenetic mouse embryos in utero and in
vitro]. Ontogenez, 2002. 33(1): p. 60-7.

72.

Hikichi, T., et al., Functional full-term placentas formed from parthenogenetic
embryos using serial nuclear transfer. Development, 2010.

73.

Li, C., et al., Correlation of expression and methylation of imprinted genes with
pluripotency of parthenogenetic embryonic stem cells. Hum. Mol. Genet., 2009.
18(12): p. 2177-2187.
104

74.

Anderegg, C. and C.L. Markert, Successful rescue of microsurgically produced
homozygous uniparental mouse embryos via production of aggregation
chimeras. Proc Natl Acad Sci U S A, 1986. 83(17): p. 6509-13.

75.

Paldi, A., et al., Postnatal development of parthenogenetic in equilibrium with
fertilized mouse aggregation chimeras. Development, 1989. 105(1): p. 115-8.

76.

Allen, N., et al., A functional analysis of imprinting in parthenogenetic embryonic
stem cells. Development, 1994. 120(6): p. 1473-1482.

77.

Nagy A, G.M., Vintersten K, Behringer R, Manipulating the Mouse Embryo, A
Laboratory Manual. Vol. Third Edition. 2003: Cold Spring Harbor Laboratory
Press.

78.

Stevens, L.C., Totipotent cells of parthenogenetic origin in a chimaeric mouse.
Nature, 1978. 276(5685): p. 266-7.

79.

Fundele, R.H., et al., Temporal and spatial selection against parthenogenetic
cells during development of fetal chimeras. Development, 1990. 108(1): p. 203211.

80.

Fundele, R., et al., Systematic elimination of parthenogenetic cells in mouse
chimeras. Development, 1989. 106(1): p. 29-35.

81.

Jagerbauer, E.M., et al., Parthenogenetic stem cells in postnatal mouse
chimeras. Development, 1992. 116(1): p. 95-102.

82.

Sturm, K.S., et al., Unrestricted lineage differentiation of parthenogenetic ES
cells. Development Genes and Evolution, 1997. 206(6): p. 377-388.

83.

Jiang, H., et al., Activation of paternally expressed imprinted genes in newly
derived germline-competent mouse parthenogenetic embryonic stem cell lines.
Cell Res. 17(9): p. 792-803.

84.

Hikichi, T., et al., Differentiation Potential of Parthenogenetic Embryonic Stem
Cells Is Improved by Nuclear Transfer. Stem Cells, 2007. 25(1): p. 46-53.
105

85.

Zvetkova, I., et al., Global hypomethylation of the genome in XX embryonic stem
cells. Nat Genet, 2005. 37(11): p. 1274-1279.

86.

Onodera, Y., et al., Differentiation diversity of mouse parthenogenetic embryonic
stem cells in chimeric mice. Theriogenology, 2010. 74(1): p. 135-45.

87.

Horii, T., et al., Loss of genomic imprinting in mouse parthenogenetic embryonic
stem cells. Stem Cells, 2008. 26(1): p. 79-88.

88.

Eggan, K., et al., Hybrid vigor, fetal overgrowth, and viability of mice derived by
nuclear cloning and tetraploid embryo complementation. Proceedings of the
National Academy of Sciences of the United States of America, 2001. 98(11): p.
6209-6214.

89.

Eggan, K., et al., Male and female mice derived from the same embryonic stem
cell clone by tetraploid embryo complementation. Nat Biotech, 2002. 20(5): p.
455-459.

90.

Chen, Z., et al., Birth of parthenote mice directly from parthenogenetic embryonic
stem cells. Stem Cells, 2009. 27(9): p. 2136-45.

91.

Park, J.I., et al., Differentiative potential of a mouse parthenogenetic embryonic
stem cell line revealed by embryoid body formation in vitro. Jpn J Vet Res, 1998.
46(1): p. 19-28.

92.

Szabo, P. and J. Mann, Expression and methylation of imprinted genes during in
vitro differentiation of mouse parthenogenetic and androgenetic embryonic stem
cell lines. Development, 1994. 120(6): p. 1651-1660.

93.

McKarney, L.A., M.L. Overall, and M. Dziadek, Expression of H19 and Igf2 genes
in uniparental mouse ES cells during in vitro and in vivo differentiation
doi:10.1046/j.1432-0436.1996.6020075.x. Differentiation, 1996. 60(2): p. 75-86.
94.

Dighe, V., et al., Heterozygous embryonic stem cell lines derived from nonhuman
primate parthenotes. Stem Cells, 2008. 26(3): p. 756-66.

106

95.

Ferrari, D., et al., Transplanted dopamine neurons derived from primate ES cells
preferentially innervate DARPP-32 striatal progenitors within the graft. Eur J
Neurosci, 2006. 24(7): p. 1885-96.

96.

Sanchez-Pernaute, R., et al., Parthenogenetic dopamine neurons from primate
embryonic stem cells restore function in experimental Parkinson's disease. Brain,
2008. 131(Pt 8): p. 2127-39.

97.

Sanchez-Pernaute, R., et al., Long-term survival of dopamine neurons derived
from parthenogenetic primate embryonic stem cells (cyno-1) after
transplantation. Stem Cells, 2005. 23(7): p. 914-22.

98.

Kim, K., et al., Histocompatible embryonic stem cells by parthenogenesis.
Science, 2007. 315(5811): p. 482-6.

99.

Lengerke, C., et al., Differentiation Potential of Histocompatible Parthenogenetic
Embryonic Stem Cells. Annals of the New York Academy of Sciences, 2007.
1106(1): p. 209-218.

100.

Eckardt, S., et al., Hematopoietic reconstitution with androgenetic and
gynogenetic stem cells. Genes Dev, 2007. 21(4): p. 409-19.

101.

Swales, A.K.E. and N. Spears, Genomic imprinting and reproduction. 2005. p.
389-399.

102.

Lyle, R., Gametic imprinting in development and disease. 1997. p. 1-12.

103.

Wobus, A.M. and K.R. Boheler, Embryonic Stem Cells: Prospects for
Developmental Biology and Cell Therapy. 2005. p. 635-678.

104.

Lyle, R., Gametic imprinting in development and disease. J Endocrinol, 1997.
155(1): p. 1-12.

105.

Mitalipov, S.M., Genomic imprinting in primate embryos and embryonic stem
cells. Reprod Fertil Dev, 2006. 18(8): p. 817-21.

107

106.

Sanchez-Pernaute, R., et al., Parthenogenetic dopamine neurons from primate
embryonic stem cells restore function in experimental Parkinson's disease. 2008.
p. 2127-2139.

107.

Kono, T., et al., Birth of parthenogenetic mice that can develop to adulthood.
Nature, 2004. 428(6985): p. 860-864.

108.

Kono, T., Genomic imprinting is a barrier to parthenogenesis in mammals.
Cytogenet Genome Res, 2006. 113(1-4): p. 31-5.

109.

Wu, Q., et al., Regulated expression of two sets of paternally imprinted genes is
necessary for mouse parthenogenetic development to term. Reproduction, 2006.
131(3): p. 481-488.

110.

Hikichi, T., et al., Functional full-term placentas formed from parthenogenetic
embryos using serial nuclear transfer. Development, 2010. 137(17): p. 2841-7.

111.

Lengerke, C., et al., Differentiation potential of histocompatible parthenogenetic
embryonic stem cells. Annals of the New York Academy of Sciences, 2007.
1106(1): p. 209-18.

112.

Simili, M., et al., 6DMAP inhibition of early cell cycle events and induction of
mitotic abnormalities. Mutagenesis, 1997. 12(5): p. 313-319.

113.

Frost, J., et al., The effects of culture on genomic imprinting profiles in human
embryonic and fetal mesenchymal stem cells. Epigenetics, 2011. 6(1): p. 52-62.

114.

Network, N.Y.O.D., http://www.donatelifeny.org/index.asp, 2010.

115.

Sasazuki, T., et al., Effect of Matching of Class I HLA Alleles on Clinical Outcome
after Transplantation of Hematopoietic Stem Cells from an Unrelated Donor. New
England Journal of Medicine, 1998. 339(17): p. 1177-1185.

116.

Flomenberg, N., et al., Impact of HLA class I and class II high-resolution
matching on outcomes of unrelated donor bone marrow transplantation: HLA-C

108

mismatching is associated with a strong adverse effect on transplantation
outcome. Blood, 2004. 104(7): p. 1923-1930.
117.

Petersdorf, E.W., et al., Major-Histocompatibility-Complex Class I Alleles and
Antigens in Hematopoietic-Cell Transplantation. New England Journal of
Medicine, 2001. 345(25): p. 1794-1800.

118.

Ishikawa, K., et al., The innate immune system in host mice targets cells with
allogenic mitochondrial DNA. J Exp Med, 2010.

119.

Petersdorf, E.W., et al., Major-Histocompatibility-Complex Class I Alleles and
Antigens in Hematopoietic-Cell Transplantation. 2001. p. 1794-1800.

120.

Hipp, J. and A. Atala, Tissue engineering, stem cells, cloning, and
parthenogenesis: new paradigms for therapy. J Exp Clin Assist Reprod, 2004.
1(1): p. 3.

121.

Kaufman, M.H., et al., Establishment of pluripotential cell lines from haploid
mouse embryos. J Embryol Exp Morphol, 1983. 73(1): p. 249-261.

122.

Robertson, E.J., M.J. Evans, and M.H. Kaufman, X-chromosome instability in
pluripotential stem cell lines derived from parthenogenetic embryos. J Embryol
Exp Morphol, 1983. 74: p. 297-309.

123.

Mitalipov, S.M., K.D. Nusser, and D.P. Wolf, Parthenogenetic Activation of
Rhesus Monkey Oocytes and Reconstructed Embryos. Biology of Reproduction,
2001. 65(1): p. 253-259.

124.

Fang, Z.F., et al., Rabbit embryonic stem cell lines derived from fertilized,
parthenogenetic or somatic cell nuclear transfer embryos. Exp Cell Res, 2006.
312(18): p. 3669-82.

125.

Kono, T., et al., Epigenetic modifications during oocyte growth correlates with
extended parthenogenetic development in the mouse. Nat Genet, 1996. 13(1): p.
91-4.

109

126.

Barton, S.C., M.A.H. Surani, and M.L. Norris, Role of paternal and maternal
genomes in mouse development. Nature, 1984. 311(5984): p. 374-376.

127.

Karin S. Sturm, M.L.F.R.A.P., Abnormal development of embryonic and
extraembryonic cell lineages in parthenogenetic mouse embryos. Developmental
Dynamics, 1994. 201(1): p. 11-28.

128.

Ogawa, H., et al., Disruption of parental-specific expression of imprinted genes in
uniparental fetuses. FEBS Lett, 2006. 580(22): p. 5377-84.

129.

Liu, J.-H., et al., Diploid parthenogenetic embryos adopt a maternal-type
methylation pattern on both sets of maternal chromosomes. Genomics, 2008.
91(2): p. 121-8.

130.

Zambrowicz, B.P., et al., Disruption of overlapping transcripts in the ROSA beta
geo 26 gene trap strain leads to widespread expression of beta-galactosidase in
mouse embryos and hematopoietic cells. Proc Natl Acad Sci U S A, 1997. 94(8):
p. 3789-94.

131.

Kono, T., et al., A cell cycle-associated change in Ca2+ releasing activity leads to
the generation of Ca2+ transients in mouse embryos during the first mitotic
division. J Cell Biol, 1996. 132(5): p. 915-23.

132.

Abbondanzo, S.J., I. Gadi, and C.L. Stewart, Derivation of embryonic stem cell
lines. Methods Enzymol, 1993. 225: p. 803-23.

133.

Bettegowda, A., et al., Quantitative analysis of messenger RNA abundance for
ribosomal protein L-15, cyclophilin-A, phosphoglycerokinase, beta-glucuronidase,
glyceraldehyde 3-phosphate dehydrogenase, beta-actin, and histone H2A during
bovine oocyte maturation and early embryogenesis in vitro. Mol Reprod Dev,
2006. 73(3): p. 267-78.

134.

Whelan, J.A., N.B. Russell, and M.A. Whelan, A method for the absolute
quantification of cDNA using real-time PCR. Journal of Immunological Methods,
2003. 278(1-2): p. 261-269.

110

135.

Li, X. and X. Wang, Application of real-time polymerase chain reaction for the
quantitation of interleukin-1[beta] mRNA upregulation in brain ischemic tolerance.
Brain Research Protocols, 2000. 5(2): p. 211-217.

136.

Norris, H.J., H.J. Zirkin, and W.L. Benson, Immature (malignant) teratoma of the
ovary: a clinical and pathologic study of 58 cases. Cancer, 1976. 37(5): p. 235972.

137.

O'Connor, D.M. and H.J. Norris, The influence of grade on the outcome of stage I
ovarian immature (malignant) teratomas and the reproducibility of grading. Int J
Gynecol Pathol, 1994. 13(4): p. 283-9.

138.

Steeper, T.A. and K. Mukai, Solid ovarian teratomas: an immunocytochemical
study of thirteen cases with clinicopathologic correlation. Pathol Annu, 1984. 19
Pt 1: p. 81-92.

139.

Lucifero, D., et al., Methylation dynamics of imprinted genes in mouse germ cells.
Genomics, 2002. 79(4): p. 530-8.

140.

Friedman, R.C., et al., Most mammalian mRNAs are conserved targets of
microRNAs. Genome Res, 2009. 19(1): p. 92-105.

141.

Yuasa, S., et al., Transient inhibition of BMP signaling by Noggin induces
cardiomyocyte differentiation of mouse embryonic stem cells. Nat Biotechnol,
2005. 23(5): p. 607-11.

142.

Dean, W., et al., Altered imprinted gene methylation and expression in
completely ES cell-derived mouse fetuses: association with aberrant phenotypes.
Development, 1998. 125(12): p. 2273-2282.

143.

Bibikova, M., et al., Human embryonic stem cells have a unique epigenetic
signature. Genome Res, 2006. 16(9): p. 1075-83.

144.

Sasaki, H., K. Ishihara, and R. Kato, Mechanisms of Igf2/H19 imprinting: DNA
methylation, chromatin and long-distance gene regulation. J Biochem, 2000.
127(5): p. 711-5.

111

145.

Tsang, W.P., et al., Oncofetal H19-derived miR-675 regulates tumor suppressor
RB in human colorectal cancer. Carcinogenesis, 2010. 31(3): p. 350-358.

146.

Onodera, Y., et al., Differentiation diversity of mouse parthenogenetic embryonic
stem cells in chimeric mice. Theriogenology. In Press, Corrected Proof.

147.

Milligan, L., et al., H19 gene expression is up-regulated exclusively by
stabilization of the RNA during muscle cell differentiation. Oncogene, 2000.
19(50): p. 5810-6.

148.

Chung, S., et al., Analysis of different promoter systems for efficient transgene
expression in mouse embryonic stem cell lines. Stem Cells, 2002. 20(2): p. 13945.

149.

Thuan, N.V., S. Kishigami, and T. Wakayama, How to improve the success rate
of mouse cloning technology. J Reprod Dev, 2010. 56(1): p. 20-30.

150.

Hao, J., et al., Human parthenogenetic embryonic stem cells: one potential
resource for cell therapy. Sci China C Life Sci, 2009. 52(7): p. 599-602.

151.

Honeycutt, K.A., M.I. Koster, and D.R. Roop, Genes involved in stem cell fate
decisions and commitment to differentiation play a role in skin disease. J Investig
Dermatol Symp Proc, 2004. 9(3): p. 261-8.

152.

Senoo, M., et al., p63 Is Essential for the Proliferative Potential of Stem Cells in
Stratified Epithelia. Cell, 2007. 129(3): p. 523-536.

153.

Yang, A., et al., p63 is essential for regenerative proliferation in limb, craniofacial
and epithelial development. Nature, 1999. 398(6729): p. 714-8.

154.

Barrandon, C., B. Spiluttini, and O. Bensaude, Non-coding RNAs regulating the
transcriptional machinery. Biol Cell, 2008. 100(2): p. 83-95.

155.

Koster MI, K.S., Mills AA, DeMayo FJ, Roop DR, p63 is the molecular switch for
initiation of an epithelial stratification program. Genes Dev. , 2004 18(2): p. 12631.
112

156.

Roop, M.I.K.a.D.R., Transgenic Mouse Models Provide New Insights into the
Role of p63 in Epidermal Development. CellCycle, 2004. 3(4): p. 409 - 411.

157.

Gaudet, F., et al., Induction of tumors in mice by genomic hypomethylation.
Science, 2003. 300(5618): p. 489-92.

158.

Izadpanah, R., et al., Long-term in vitro expansion alters the biology of adult
mesenchymal stem cells. Cancer Res, 2008. 68(11): p. 4229-38.

159.

Cimini, D. and F. Degrassi, Aneuploidy: a matter of bad connections. Trends Cell
Biol, 2005. 15(8): p. 442-51.

160.

Cheng, L., More new lines of human parthenogenetic embryonic stem cells. Cell
Res, 0000. 18(2): p. 215-217.

161.

Sun, X., et al., Two active X Chromosomes and methylation of the imprinted
gene in human parthenogenetic embryonic stem cell line. Cell Res, 0000. 18(S1):
p. S35-S35.

162.

Park JI, Y.I., Tada T, Takagi N, Takahashi Y, Kanagawa H., Trisomy 8 does not
affect differentiative potential in a murine parthenogenetic embryonic stem cell
line. Jpn J Vet Res. , 1998 46(1): p. 29-35.

163.

Epstein, C.J., Mouse monosomies and trisomies as experimental systems for
studying mammalian aneuploidy. Trends in Genetics, 1985. 1: p. 129-134.

164.

Gropp, A., U. Kolbus, and D. Giers, Systematic approach to the study of trisomy
in the mouse. II. Cytogenet Cell Genet, 1975. 14(1): p. 42-62.

165.

Gropp, A., et al., Murine trisomy: developmental profiles of the embryo, and
isolation of trisomic cellular systems. J Exp Zool, 1983. 228(2): p. 253-69.

166.

Gropp, A., D. Giers, and U. Kolbus, Trisomy in the fetal backcross progeny of
male and female metacentric heterozygotes of the mouse. i. Cytogenet Cell
Genet, 1974. 13(6): p. 511-35.

113

167.

Longo, L., et al., The chromosome make-up of mouse embryonic stem cells is
predictive of somatic and germ cell chimaerism. Transgenic Research, 1997.
6(5): p. 321-328.

168. Inoue, K., et al., Sex-Reversed Somatic Cell Cloning in the Mouse. The Journal
of Reproduction and Development, 2009. 55(5): p. 566-569.
169.

Fauque, P., et al., Modulation of imprinted gene network in placenta results in
normal development of in vitro manipulated mouse embryos. Hum Mol Genet,
2010. 19(9): p. 1779-90.

170.

Marina Bibikova, E.C., 1 Bonnie Wu,1 Lixin Zhou,1 Eliza Wickham Garcia,1 Ying
Liu,2,12 Soojung Shin,2,12 Todd W. Plaia,3 Jonathan M. Auerbach,3 Dan E.
Arking,4 Rodolfo Gonzalez,5 Jeremy Crook,6 Bruce Davidson,6 Thomas C.
Schulz,7 Allan Robins,7 Aparna Khanna,8 Peter Sartipy,9 Johan Hyllner,9
Padmavathy Vanguri,10 Smita Savant-Bhonsale,10 Alan K. Smith,11 Aravinda
Chakravarti,4 Anirban Maitra,4 Mahendra Rao,2,12 David L. Barker,1 Jeanne F.
Loring,5 and Jian-Bing Fan1,13, Human embryonic stem cells have a unique
epigenetic signature. Genome Research, 2006. 16(9): p. 1075–1083.

171.

Kim, K., et al., Recombination signatures distinguish embryonic stem cells
derived by parthenogenesis and somatic cell nuclear transfer. Cell Stem Cell,
2007. 1(3): p. 346-52.

172.

Durbin, R.M., et al., A map of human genome variation from population-scale
sequencing. Nature, 2010. 467(7319): p. 1061-73.

173.

Crespo, F.L., et al., Mitochondrial reactive oxygen species mediate
cardiomyocyte formation from embryonic stem cells in high glucose. Stem Cells,
2010. 28(7): p. 1132-42.

174.

Zhu, D.Y., et al., PPAR-beta facilitating maturation of hepatic-like tissue derived
from mouse embryonic stem cells accompanied by mitochondriogenesis and
membrane potential retention. J Cell Biochem, 2010. 109(3): p. 498-508.

114

DISSERTATION CHAPTER 3

TITLE
H19 CONTROLS THE DIFFERENTIATION
POTENTIAL OF MOUSE P-ESCs UPON
DIFFERENTIATION IN VIVO

115

ABSTRACT

Parthenogenetic embryonic stem cells (P-ESCs) cells offer an alternative source of
pluripotent cells, which hold great promise for autologous transplantation and
regenerative medicine. P-ESCs have been successfully derived from blastocysts of
several mammalian species. However, compared to biparental embryonic stem cells (BESCs), P-ESCs are limited in their ability to fully differentiate into all of the three germ
layers. For example, it has been observed that there is a differentiation bias towards
ectoderm derivatives at the expense of endoderm and mesoderm derivatives and
muscle, in particular, in chimeric embryos, teratomas and embryoid bodies. The lack of
paternal genome and inappropriate imprinting are thought to be major contributors to
this limitation. In the present study we found that H19 was the most deregulated
imprinted gene in P-ESCs with more than 6-fold over-expression compared to B-ESCs.
Thus, we hypothesized that manipulation of the H19 gene in P-ESCs would alleviate
their limitations and allow them to function like B-ESCs. To test this we employed a
small hairpin RNA (shRNA) approach to reduce the amount of H19 transcripts in mouse
P-ESCs. We found, for the first time, that down-regulation of H19 led to an increase of
mesoderm derived muscle and endoderm in P-ESCs teratomas similar to that observed
in B-ESCs teratomas. This phenomenon coincided with upregulation of mesoderm
specific genes such as Myf5, Myf6 and MyoD. Moreover, H19 down-regulated P-ESCs
differentiated into a higher percentage of beating cardiomyocytes compared to control
P-ESCs. Collectively, these results suggest that P-ESCs are amenable to molecular
modifications that bring them functionally closer to true ES cells. In the future, such a

116

supply of cells may be useful as an alternative source of MHC matched stem cells for
generation of organs and tissues from a female patients’ own genome.

INTRODUCTION
The rate of organ transplantations performed in the United States is increasing [66]. In
2009 a record total of 28,465 organ transplant operations were performed compared to
27,965 in 2008 [114]. Despite the increasing number of organ transplantations, the pool
of patients waiting for organ donations far exceeds the supply [67]. Another negative
aspect of organ and tissue transplantation, even when a donor is available, is the failure
of engraftment due to immune rejection. Engraftment of solid organs, tissues, and cells
from unrelated donors has a very high risk of rejection due to lack of compatibility to the
major histocompatible- complex (MHC) alleles and to the mitochondria of the recipient
[115-118]. The risk of graft failure is increased even more when the donor is
heterozygous and the patient is homozygous at the HLA locus [119]. The best
alternative is the generation of autologous tissues and organs derived from a patient’s
own cells that express the same HLA antigens (MHC- matched cells).
Parthenogenesis results when an oocyte is artificially activated and develops in the
absence of a sperm [120]. ESCs derived from such embryos (P-ESCs) have been
successfully derived from mouse [121-122], monkey [15, 123], rabbit [124], and human
[5, 94]. Notably, P-ESCs are capable of giving rise to chimeric animals when injected
into normal blastocysts [79, 81, 86]. However, mammalian parthenogenetic embryos
per-se fail to develop past the early to mid stages of gestation [125-127], and are

117

deemed non-viable, alleviating many of the ethical concerns associated with destroying
a fertilized embryo for ES cell derivation.
P-ESCs, like ES cells derived from fertilized embryos, can differentiate - in vitro as
embryoid bodies and in vivo as teratomas – into cells from the three major germ layers
– ecto-, meso- and endoderm [82, 91]. Although these cells have the potential to
differentiate in a manner similar to their biparental counterparts, a differentiation bias
towards ectoderm derivatives at the expense of endoderm and mesoderm derivatives
and muscle, in particular, has been observed in chimeric embryos, teratomas and
embryonic bodies [76, 86, 127]. The major reason for failure of the PG embryos to
develop to term, and the limited differentiation potential of P-ESCs in teratomas and
embryo bodies, has been attributed to defects in establishing correct expression
patterns of the imprinted genes [76],[91] [2, 107] [54, 128]. For example, the H19 gene
has been reported to be highly deregulated in PG embryos and P-ESCs [3, 128-129].
H19 is a maternally expressed (paternally imprinted) gene and codes for an
untranslated mRNA. It has been reported that H19 can function as a long antisense
RNA and as a micro RNA (mir675) [39-40]. In uniparental mouse fetuses the H19 gene
was found to be over-expressed up to 400 times compared to biparental concepti [2,
71]. Moreover, deregulation of H19 acts as a major barrier towards proper development
of parthenogenetic embryos [2],[107],[108], [55]. Kono and co-workers showed that a 13
kb deletion encompassing the H19 coding region and the upstream differentially
methylated region (DMR) allows parthenogenetic embryos to develop to term [107]. The
efficiency of full-term development significantly increases when the H19/Igf2 DMR
region together with the DMR region found within a second imprinted gene cluster

118

Dlk1/Dio3 on chromosome 12 are deleted [54, 109]. Most recently Hikichi et al showed
that the development of PG embryos can be extended following serial nuclear transfer
and is associated with a decrease in H19 expression [110]. Altogether, these results
suggest that the correct expression of H19 is critical for normal embryonic development.
The results of the aforementioned studies led us to hypothesize that correct expression
of H19 is required for proper differentiation of mouse P-ESCs into the three germ layers.
To test this we utilized a retroviral-mediated shRNA approach to silence H19 gene
expression in mouse P-ESCs. Furthermore, we developed a method to quantify the
abundance of the tissue derivatives of the three main germ layers in teratomas. We
found that down-regulation of H19 led to an increase of mesoderm derived muscle and
endoderm in P-ESCs teratomas similar to that observed in B-ESCs teratomas. This
phenomenon coincides with up regulation of the mesoderm specific genes such as
Myf5, Myf6 and MyoD. These results suggest that P-ESCs are amenable to molecular
modifications that bring them functionally closer to true ES cells.

MATERIALS AND METHODS
Mouse ES cells derivation and culture
Mouse Parthenogenetic embryonic stem cells (P-ESCs) and biparental embryonic stem
cells (B-ESCs) were derived from parthenogenetically activated and fertilized oocytes,
respectively. P-ESCs and B-ESCs were derived from Rosa 26 (R26) strain of mice [130]
expressing the β-galactosidase gene. Mouse R26 P-ESCs were produced by artificial
activation of metaphase II (MII) eggs preventing the extrusion of second polar body
[123, 131]. Briefly for P-ESCs derivation matured MII oocytes, were collected around

119

16hrs post hCG injection. The matured oocytes were activated by 5mM SrCl 2 in 2mM
Ca2+ free mCZB medium in the presence of 5ug/ml cytochalasin B for 6hrs and cultured
at 37 C in 5% CO2 balance air up to 4 days in Ca2+ included mCZB medium [123] .
Blastocysts were then treated with Tyrode’s solution to remove the zona pellucida and
placed in 96-multi well dishes coated with 90% confluent Mytomycin C inactivated MEFs
until attachment [84]. From the plated embryos that exhibited sufficient ICM out-growth
and colony formation, the colonies were manually cut, pipetted gently and replated onto
fresh mytomycin C inactivated MEFs. The cells were sent for karyotyping at passage 4
to Cell Line Genetics (Madison, WI). All P-ESC and one B-ESC cell lines used in this
study have been karyotyped, and found to have normal chromosome number 40XX and
40XY respectively. The cells were grown with complete medium consisting of KO
DMEM (Invitrogen, Carlsbad, CA), Knockout Serum, 10% (Invitrogen, Carlsbad, CA), LGlutamine 2mM (Invitrogen, Carlsbad, CA), Non Essential Amino Acids 1x solution
(Invitrogen, Carlsbad, CA), FGF2, 4ng/ml, 2-Mercaptoethanol (Sigma, St. Louis, MO),
Penicillin-Streptomycin, 1x final volume and 103 Units of LIF(Millipore, Billerica, MA).
Normal fertilized B-ESCs controls were derived from fertilized blastocysts at 3.5 dpc
[132] and cultured under the same conditions as the mouse P-ESCs described above.

RNA isolation and cDNA synthesis from ES cells
A total mRNA form mouse P-ESCs and B-ESCs was isolated using the RNeasy
Isolation Mini Kit (Qiagen, Valencia, CA) following the manufacturer's instructions and
strict RNAse and DNAse free procedures. Total mRNA amount was measured using
Nanodrop. One ug of total RNA with OD260/280 > 2.1 was used for first strand cDNA

120

synthesis. cDNA was synthesized with Superscript II (Invitrogen, Carlsbad, CA) using
anchored Oligo (dT12-18) primers (Invitrogen, Carlsbad, CA) and following the
manufacturer’s instructions.

RNA isolation and cDNA synthesis from formalin fixed paraffin embedded
teratomas
RNA was isolated from ectoderm and endoderm derivatives and from whole teratoma
sections following strict RNAse and DNAse free techniques. Ectoderm and endoderm
derivatives were isolated by using Laser Capture Microdissection System (LCM)
(Supplem. Figure3.5A and B). Total mRNA was extracted by using High Pure RNA
paraffin Kit (Roche, Basel, Switzerland) following manufacturer’s recommendations with
the following modifications: after each RNA extraction procedure, the RNA was further
purified by using NucleoSpin RNA II protocol for RNA purification (Machinery-Nagel,
Bethlehem, PA) following the manufacturer instructions. Total RNA (tRNA) was
measured by RNA picochip on Agilent 2100 Bioanalyzer. For the LCM obtained
samples, one ng of total RNA (tRNA) was converted to cDNA using SuperScript II first
strand cDNA kit (Invitrogen, Carlsbad, CA) using random oligo primers. For the tRNA
extracted from whole sections, one µg was used for cDNA synthesis following the same
protocol as mentioned above. A validation of this method has been published elsewhere
[133].

Quantitative real time RT-PCR

121

The quantification of all gene transcripts was performed by reverse transcription of total
RNA followed by absolute real-time quantitative RT-PCR using SYBR Green PCR
Master Mix (Applied Biosystems, Foster City, CA). Absolute quantification using this
method is described elsewhere [134-135]. Primers for PCR and absolute real time PCR
were designed using Primer Express program (Applied Biosystems, Foster City, CA)
and derived from mouse sequences found in GeneBank (Supplem. Table 3.2 and 3.3).
A primer matrix was performed for each gene tested to determine optimal
concentrations. Each reaction mixture consisted of 2 µl of cDNA, optimum concentration
of each forward and reverse primer, nuclease free water, and 12.5 µl of SYBR Green
PCR Master Mix in a total reaction volume of 25 µl (96well plates). Reactions were
performed in triplicate for each sample using an ABI Prism 7000 Sequence Detection
System (Applied Biosystems, Foster City, CA). The thermal cycle consisted of 40 cycles
of 95ºC for 15sec and 60 ºC for 1min. Standard curves for each gene and controls were
constructed using tenfold serial dilution and run on sample plates as standards. For
gene expression normalization (except for the expression analysis done on the LCM
obtained endoderm and ectoderm derivatives from fixed tumors) expression levels of βactin mRNA was used. For the normalization of gene expression in the LCM obtained
endoderm and ectoderm derivatives from fixed tumors, Gapdh expression levels were
used. Copies of β-actin and Gapdh RNA in each pool were determined using standard
curves constructed from the plasmid PCR2.1 Topo containing partial β-actin and Gapdh
cDNA sequences [133]. Partial cDNA sequences for β-actin , Gapdh H19, IGF2 and
other genes tested, were amplified from mouse R26 P-ESCs, cloned into pCR2.1 Topo
vector (Invitrogen, Carlsbad, CA), and subjected to fluorescent dye primer sequencing

122

to confirm identity. Resulting plasmids were used to construct standard curves.
Representative R2 for β-actin, Gapdh, H19 and the rest of the genes were estimated
and only the one ≥ 0.98 used. For each measurement, threshold lines were adjusted to
intersect amplification lines in exponential portion of amplification curve [133].

Quantification of Endoderm, Ectoderm and Mesoderm derivatives in teratomas
Teratomas from B-ESCs (BP), P-ESCs (PG1 and PG2), H19shRNA cells and P-ESCs
infected with the control viral vector-Control (C), were derived by subcutaneous injection
into immune-deficient Nude mice, CD-1 (Charles River Laboratories, Wilmington, MA).
The teratomas were formalin fixed sectioned and embedded in paraffin blocks; each
was entirely submitted for histological analysis. Initially one to three gross tissue
samples per tumor was obtained for this study. The College of American Pathologists
(CAP) guidelines for gross sampling of solid tumors state that one sample for each
centimeter of tumor or three samples, whichever is greater, should be used for tumor
grading. Histological grading was performed utilizing the modified Thurlbeck-Scully
histological grading system for solid ovarian teratomas proposed by Norris et al. [136]
and successfully implemented by O’Conner et al. [137] and Steeper and Mukai [138].
This system which is widely employed clinically, estimates percentage of neuro
epithelium in the total tumor mass by counting the number of microscopic 10x Low
Power Fields (LPFs) to differentiate between tumors grades I, II, and III. We estimated
that from our teratoma samples about 12-16 LPFs could be evaluated per full tissue
section on one glass microscopic slide and that 3 tissue sections would yield
approximately 36-48 LPFs for examination, and thus comply with the modified

123

Thurlbeck-Scully histological grading system. However, in order to increase our
quantification precision in an inherently heterogeneous tumor and adjust for variability in
tumor size (0.8cm-1.2cm in diameter), we obtained consecutive additional deep level
sections 15, 30 and 45µms apart from each tumor sample paraffin block. Thus the
number of sections was increased to 10 -18 per tumor, the number of LPFs evaluated
was increased to 120-288, and sections reflected whole tumor. The sections identity
was hidden and the sections were also given to an independent histopathologist for
evaluation.

Plasmid shRNA delivery system
For the plasmid shRNA delivery, pRNAT- U6.1/Neo vector was used (GenScript,
Piscataway, NJ). In this vector system the H19 shRNA was expressed from U6
promoter and GFP and Neomycin expression driven by CMV promoter. The pRNATU6.1/Neo H19 shRNA vector was linearized by using a unique ScaI (NEB, Ipswich, MA)
restriction site and transformed into mouse R26 P-ESCs cell line by using Fugene6
transfection reagent (Roche, Basel, Switzerland) according to the manufacturers’
recommendations. A stable transgenic cell line was selected using 100ug/ml of
Neomycin for 14 days.

Lentiviral shRNA delivery system
For Lentiviral shRNA delivery pLenti-DEST-Block it TM lentiviral vector system was used
(Invitrogen, Carlsbad, CA). In this system H1/TO promoter drives H19 shRNA
expression. The zeocin selectable marker is under the control of SV40 promoter. Due to
124

possible silencing of the SV40 promoter in mouse embryonic stem (MES) cells, pLentiDEST-Block it TM vector was modified. The SV40 zeocin cassette was released by
restriction digestion with Kpn1 and Xho1 (NEB, Ipswich, MA) and replaced with PGK
promoter driving Hygromycin selectable marker cassette derived from plasmid pMSCVHygro (Clontech Laboratories, Inc. Mountain View, CA) by digesting with ClaI and XhoI.
This first construct was called pLenti-DEST-Block it/Hygro-H19 shRNA vector. For
expression of fluorescent protein, chicken b- actin promoter driving EGFP expression
was introduced downstream of the PGK-Hygromycine cassette by releasing it first from
PCX-EGFP vector and subcloning it into pLenti-DEST-Block it/Hygro-H19 shRNA. The
modified plasmid carrying both PGK-promoter driving Hygromycin selectable marker
and EGFP expression cassette was called pLenti-DEST-Block it TM-CRL-H19 shRNA
expression vector. The packaging and transduction of pLenti-DEST-Block it TM-CRLH19 shRNA vector was done following the manufacturer’s recommendations
(Invitrogen, Carlsbad, CA) in mouse Rosa 26 P-ESC line. As a negative control, pLentiDEST-Block it TM – CRL without the H19shRNA insert, was transduced into mouse Rosa
26 P-ESCs. The cells underwent Hygromycine selection two days post-viral infection.
The Levels of H19 downregulation was evaluated 10 to 14 days post infection with the
H19shRNA lentiviral vector by Quantitative Real Time PCR as described above.

Retroviral shRNA delivery system
pMSCV-Hygro vector (Clontech Laboratories, Inc. Mountain View, CA) was used for
H19 shRNA delivery into a mouse P-ESCs with the following modifications: Chicken bpromoter CMV-IE Enhancer fragment was derived from plasmid pCX-EGFP without

125

PolyA signal by digestion with Sal-I and Bgl-II. The pMSCV-Hygro retroviral vector was
digested with Sal1 and the Chicken b-promoter CMV-IE Enhancer-Intron-EGFP and
introduced by T4 DNA ligation reaction into the Sal1 site. The cassette H1/TO promoter
-H19 shRNA –Pol III termination site was released from plasmid pENTR/H1/TO plasmid
(Invitrogen) by digestion with BamHI (NEB, Ipswich, MA) and cloned into unique Xho1
site of the pMSCV-Hygro retroviral vector. The so modified pMSCV-Hygro retroviral
vector was called pMSCV-Hygro-EGFP-H19 shRNA retroviral vector.
The packaging and transduction of pMSCV-Hygro-EGFP-H19shRNA vector was done
following the manufacturer’s recommendations (Clontech, Mountain View, CA) in mouse
R26 P-ESC cell line. For negative control, pMSCV-Hygro-EGFP-H19shRNA without the
H19shRNA insert was transduced into mouse R26-P-ESCs. The cells were subjected to
Hygromycin selection two days post-viral infection. The Levels of H19 downregulation
was evaluated 10 to 14 days post infection with the H19shRNA Lentiviral vector by
Quantitative Real Time PCR as described above.

Bisulfate sequencing analysis
Genomic DNA was isolated from mouse P-ESCs and B-ESCs using Dneasy Blood and
Tissue Kit (Qiagen, Valencia, CA). Bisulfate conversion of genomic DNA (gDNA) from
mouse P-ESCs and B-ESCs was performed by using EZ DNA Methylation -DirectTM kit
(ZymoResearch, Irvine, CA) and following the manufacturer’s instructions. Bisulfate
treated gDNA was then subjected to two rounds of PCR reaction. The primers for
amplification of H19/Igf2 DMR region and the amplification conditions are as described
elsewhere (Supplem. Table3.4) [139].

126

Immunocytochemical analysis
A. β-galactosidase staining
Cells in a six-well plate were fixed with 1.5ml/well of 1% glutaraldehyde solution in PBS
for 10min. The fixed cells were washed three times with PBS after which 1.5m/well of
color substrate was added. The color substrate contains water, 10xPBS, 100X Ca2+
Mg2+, 0.5M K3Fe (CN) 6, 0.5M K4Fe (CN) 6, 1M MgCl2 and X-gal. The cells were
incubated with color substrate for 3 hours and washed three times with PBS
B. Oct4 and SSEA1 immunostaining
Cells were washed 3 times, each time 5minutes with washing buffer (DPBS, 0.1%
TX100 (Triton 100X) and incubated with Permeabilization Buffer (DPBS, 1% TX100) for
10min. Subsequently, the cells were washed once more with washing buffer, then
blocked with blocking buffer (DBPS + 0.1%TX100 + 1%BSA + 10%NGS) for 1-2 hours.
Oct4 antibody (Abcam, Cambridge, MA) in dilution 1:75 and SSEA1 antibody (Santa
Cruz biotechnology, Inc. Santa Cruz, CA) in 1:200 dilution was added to the cells and
incubated for 3 hours to overnight at 4C. Cells were washed 6 times each time
10minutes. Then secondary Ab (Abcam, Cambridge, MA) was added in 1:500 dilutions
following the manufacturer’s recommendations.
C. Immunocytochemistry for muscle specific markers
Beating EBs were trypsinized and plated on day 10 of EB formation. The plated EB
were immono-stained for muscle specific markers – Myf5 (Abcam, Cambridge, MA)
1:250 dilution, Sarcomeric α- actin (Abcam, Cambridge, MA) 1:100 dilution, and
sarcomeric Myosin (Abcam, Cambridge, MA) 1:250 dilution and following the
manufacturer’s recommendations.

127

Immunohystochemical analysis of formalin fixed, paraffin embedded tumor
sections
A. Hematoxylin-Eosin staining
Tissue samples previously fixed in 10% Neutral Buffered Formalin were processed
embedded with the ThermoFisher HistoCentre III embedding station. The blocks were
sectioned at 4-5 microns. Sections were stained with Hematoxylin and Eosin (H and E).
B. Beta Galactosidase, Alpha Fetoprotein, Beta Tubulin, and α- Smooth Muscle
Actin staining.
Specimens were processed, embedded in paraffin and sectioned on a rotary microtome
at 4 -5 µs. Sections were placed on slides coated with 3-Aminopropyltriethoxysilane
and dried at 56°C overnight. The slides were subsequently deparafinized in Xylene.
Following pretreatment standard avidin-biotin complex staining steps were performed at
room temperature on the DAKO Autostainer. Slides were inset for two minutes between
each staining step; after blocking for non-specific protein with Normal Horse Serum or
Normal Goat Serum (Vector Labs, Burlingame, CA) for 30 minutes; sections were
incubated with Avidin / Biotin blocking system for 15 minutes (Sigma, St. Louis, MO).
Following subsequent rinsing in Tris Buffered Saline + Tween 20 (Scytek, Logan, UT)
slides were incubated in the following primary antibodies: Polyclonal Rabbit anti-beta
Galactosidase diluted (Abcam, Cambridge, MA); Polyclonal Rabbit anti-Alpha
Fetoprotien (ThermoFisher Labvision, Hampton, NH); Monoclonal Mouse anti-beta
Tubulin Isotype III Clone SDL (Sigma, St.Louis, MO); Monoclonal Mouse anti-Alpha
Smooth Muscle Actin Clone (Dako North America). Upon completion of primary
incubations, slides were incubated for 30 minutes with the corresponding biotinylated

128

secondary IgG (H+L) either Goat anti-Rabbit or Horse anti-Mouse (Vector) at a
concentration of 11µg/ml. Samples were counterstained with Gill 2 Hematoxylin
(ThermoFisher, Hampton, NH).
C. DeltaNp63 staining
Slides were stained using deltaNp63 primarily Antibody (Santa Cruz Biotechnology,
Santa Cruz, CA) in 1:100 dilution and following the manufacturer’s recommendations.
Upon completion of primary incubations, slides were incubated for 40 minutes with the
corresponding biotinylated secondary Goat anti-Rabbit at 1:136 dilutions. For
visualization of the staining, Phospohatase labeled streptavidin (Kirkegaard & Perry
Laboratories, Inc. Gaithersburg, Maryland) was used which upon addition of a vector
red substrate (Kirkegaard & Perry Laboratories, Inc. Gaithersburg, Maryland) gave the
brick red staining of the specimen.

Teratoma formation
For all teratoma experiments, a suspension of 5x105 P-ESCs(PG1 and PG2) cells and
control B-ESCs(BP) cells were injected subcutaneously (s.c.) into immunodeficient
Nude mice-CD-1 (Charles River Laboratories, Wilmington, MA). Mice were euthanized
around eight weeks after injection or when tumors had grown to about 1cm in diameter
whichever came first. Tumors were then isolated, fixed in paraformaldehyde, embedded
in paraffin and stained with hematoxilin eosin. Tumors were stained for βgalactosidase, to confirm their origin. The tumor sections were also stained for αfetoprotein, α-smooth muscle and β-tubulin, markers of endoderm, mesoderm and
ectoderm derivatives respectively.
129

Identification of Mier2 as a potential target of mir675
miRNA targets were found using TargetScan (Supplem. Figure 3.10) [140].

Derivation of beating embryo bodies (EB)
Beating EBs were derived from mouse ES cells as described by Yuasa et al. [141].
Briefly, mouse ES cells were cultured on gelatin-coated dishes for 3 days in α-MEM
supplemented with 10% FBS (Invitrogen,Carlsbad, CA), 2mM L-glutamine (Invitrogen),
0.1mM nonessential amino acids (Invitrogen, Carlsbad, CA),1mM sodium pyruvate
(Invitrogen, Carlsbad, CA), 0.1mM 2-mercaptoethanol, 2,000U/ml LIF (Chemicon,
Billerica, MA ) and 0.15µg/ml Noggin (R @D System Inc., Minneapolis, MN) for 3 days.
The cell were then trypsinized and cultured to form spherical embryo bodies from 1,000
cells using tri-dimensional culture system in the same medium as above minus LIF and
using 0.1µg/ml Noggin and round bottom low cell binding 96 well plates (Nunc,
Roskilde, Denmark). The EBs were cultured until day 10 of EB formation. The incidence
of EB beatings was recorded on days 8, 10 and 12 post EBs formation by us and by an
independent researcher.

Pathogen testing
The mouse B-ESCs, wild type P-ESCs and P-ESCs infected with the retroviral
H19shRNA expressing viral vector and the control ones were sent for IMPACT Profile I
pathogen testing (www.radil.missouri.edu). The cells were identified as negative for all
22 pathogens tested such as: Mycoplasma spp., Sendai virus, Mouse hepatitis virus,
Pneumonia virus of mice, Minute virus of mice, Mouse parvovirus (MPV1, MPV2,

130

MPV3), Theiler's murine encephalomyelitis virus, Murine norovirus, Reovirus 3, Mouse
rotavirus, Ectromelia virus, Lymphocytic choriomeningitis virus, Polyoma virus, Lactate
dehydrogenase-elevating virus, Mouse adenovirus (MAD1, MAD2), Mouse
cytomegalovirus, K virus, Mouse thymic virus, Hantaan virus.

Statistics
qRT-PCR experimental data and teratoma quantification data were analyzed by
analysis of variance (ANOVA) procedure using the mixed procedure of SAS (Cary, NC,
USA). Differences of p < 0.05 were considered statistically significant.

RESULTS AND DISCUSSION
Generation of mouse P-ESCs and B-ESCs
Two mouse P-ESC lines (PG1 and PG2) and one B-ESC line were derived from
parthenogenetic and biparental blastocysts of Rosa 26 strain of mice (see materials and
methods). All three lines were found to possess a normal karyotype - 40XX and 40XY
respectively when cultured under normal growth conditions (Supplem. Table3.1).
Morphologically the P-ESCs and B-ESCs displayed small cytoplasmic/nuclear ratio and
grew as small compact colonies with prominent nucleoli (Supplem. Figure 3.1A, B).
These cells were extensively propagated in vitro while maintaining their ES cell
morphology. The PG1, PG2 and B-ESCs stained positive for β-galactosidase (Supplem.
Figure3.1C, D) and the pluripotency markers OCT4 and SSEA1 (Supplem. Figure3.2).
Moreover, following injection into immunodeficient Nude mice-CD-1 both P-ESC lines
were capable of forming teratomas (Supplem. Figure3.3).
131

Alteration of key imprinted genes in P-ESCs
It has been shown that in vitro culture of B-ESCs and P-ESCs can lead to alterations in
DNA methylation and covalent modifications on histones such as histone acetylation
and methylation [76, 83, 87, 110, 142-143]. Moreover, it has been reported that in PESCs the expression of several imprinted genes is altered due to absence of a paternal
chromosomal complement [76, 83, 87]. We analyzed the expression profile of the
paternally imprinted gene H19 and the maternally imprinted gene Igf2. Both H19 and
Igf2 share the same differentially methylated region (DMR) as the main regulator of their
expression (55). We found that expression levels of the paternally imprinted gene (i.e.
maternally expressed gene) H19 was upregulated greater than 6-fold in P-ESCs
compared to control B-ESCs (P<0.05; Figure3.1A). Contrary to its maternal imprinted
status there were significantly higher levels of Igf2 in P-ESCs compared to B-ESCs
(P<0.05; Figure3.1A). We also evaluated the expression levels of other maternally (P57,
Igf2R) paternally (Mest1, Mkrn) expressed genes (P<0.05; Figure3.1D), and the
pluripotency marker Nanog (P<0.05; Figure3.1E). The expression pattern of P57, Igf2R
and Mkrn was also unexpected according to their imprinting status i.e. there was no
statistical significant difference in the P57 and Igf2R expression between P-ESCs and
B-ESCs and the expression of the paternally expressed gene Mkrn was low but
detectable. The Mest1 gene expression, however, remained faithful to the parent of
origin expression, and was over-expressed in B-ESCs compare to P-ESCs (P<0.05;
Figure3.1D). We also analyzed the mRNA levels of Nanog, a key pluripotency gene
(Figure3.1E). We observed more than eight folds over-expression of Nanog in B-ESCs
compare to P-ESCs (P<0.05; Figure3.1E).

132

These results demonstrate that the expression of key imprinted genes such as H19,
Igf2, P57, Igf2R and Mkrn is deregulated in P-ESCs.

Partial CpG methylation of the H19/Igf2 DMR region in P-ESCs
The methylation status of the H19/Igf2 DMR has been viewed as the main regulator of
H19 and Igf2 gene expression (Figure3.1B). On the maternal allele the CpG
dinucleotides are not methylated which allows for a CTCF insulator protein to bind,
preventing the enhancer downstream of H19 to reach Igf2 gene [144]. This leads to H19
being expressed on the maternal allele and Igf2 silenced. On the paternal allele the
DMR region is methylated which inhibits binding of the CTCF insulator protein and
allows for the expression of Igf2 from the paternal allele while H19 remains silenced.
Since we were able to detect expression of Igf2 in our P-ESCs, and the expression of
H19 and Igf2 is coordinately regulated, we decided to analyze the methylation status of
the H19/IGF2 DMR region. It has been previously reported that this region in CD-1 mice
contains 16 critical CpGs sites important for CTCF binding [139]. After bisulfite
sequencing analysis we found that in the Rosa26 strain of mice there are 15 CpG sites,
the fourth of which seems not to be methylated in normal fertilized B-ESCs
(Figure3.1C). The DMR methylation status in the two P-ESC lines (PG1 and PG2)
revealed a partial methylation of the CpG sites analyzed with PG1 and PG2 having
7.3% and 19.3% methylation, respectively (Figure3.1C). These results demonstrate that
the DMR of the H19/Igf2 genes is not completely demethylated and that this may
account for the elevated levels of Igf2 expression in mouse P-ESCs.

133

Elevated levels of H19 persist throughout P-ESCs differentiation in vivo
Next we wanted to determine the expression status of the H19 gene throughout
differentiation in vivo. We hypothesized that expression levels of H19 remained higher
in teratomas derived from P-ESCs compared to B-ESCs. To test this we injected PESCs and B-ESCs subcutaneously into immune-deficient Nude mice-CD1. Teratomas
were recovered and stained for β-galactosidase expression confirming that the
teratomas originated from the injected cells (Supplem. Figure3.4A). The ectoderm,
endoderm and mesoderm derivatives were also stained for α- fetoprotein, β- tubulin and
α-smooth muscle actin indicating the identity of the morphologically observed structures
(Supplem. Figure3.4B). qRT-PCR data indicated that the expression levels of H19 in
ectoderm and endoderm derivatives and in whole teratoma sections from P-ESCs
teratomas was significantly higher than in controls (P<0.05; Figure3.2A-C). We also
evaluated the expression levels of Igf2 in teratomas. Igf2 expression in ectoderm and
endoderm derivatives did not differ between P-ESCs and B-ESCs derived structures
(Figure3.2B). The same expression pattern (no difference) was observed for Igf2 mRNA
expression between B-ESCs and P-ESCs from which the teratomas were derived
(P<0.05; Figure 3.1A). However, when total RNA from whole teratoma sections was
analyzed for Igf2 mRNA transcript abundance, there was a significant downregulation of
Igf2 expression in P-ESCs teratomas compare to B-ESCs teratomas
(P<0.05;Figure3.2C). We also analyzed the Retinoblastoma gene (Rb) mRNA
abundance in whole teratoma sections. It has been reported that mir675, a product of
H19 gene, targets the 3’UTR region of the Rb mRNA and therefore affects the Rb
mRNA levels [145]. Rb mRNA abundance in the P-ESCs derived teratomas was lower

134

than in B-ESCs derived ones; however, this difference was not statistically significant
(P<0.05; Figure3.2D).
Therefore, upon in vivo differentiation, the expression pattern of the imprinted gene H19
and Igf2 remains faithful to the origin of the P-ESCs from which the teratomas were
derived.

Teratomas derived from P-ESCs give rise to a lower proportion of mesoderm
derived muscle compared to tumors derived from B-ESCs
Results of previous studies suggest that there is a differentiation bias of P-ESCs
towards ectoderm derivatives at the expense of endoderm and mesoderm derivatives
and muscle in chimeric embryos, teratomas and embryonic bodies [76, 81, 146]. We
hypothesized that correct expression of H19 is required for normal germ layer formation
in vivo. We quantified the percentage of ecto-, endo- and mesoderm derivatives in
teratomas derived from our P-ESCs (PG1 and PG2) and B-ESCs (BP) by using our
modified Thurlbeck-Scully grading system (see materials and Methods). We found that
in teratomas derived from P-ESCs consisted of predominantly ectoderm derivatives
(70%) (Figure3.3A) compared to B-ESCs ones (50%). There was less endoderm (20%)
in P-ESC derived teratomas compared to B-ESC ones (30%). Interestingly, we found
that P-ESCs give rise to less mesoderm derived muscle (5%) compared to B-ESC
teratomas (20%) (Figure3.3A).

We also performed qRT-PCR to analyze the expression pattern of genes specific to
ectoderm (Vimentin and Nestin), endoderm (α- feto protein (Afp) and Gata4) and

135

mesoderm (Myf5, Myf6, MyoD) germ layers in these teratomas (Figure3.3B). In
addition, we analyzed the expression pattern of Mier2 gene. Mier2 is an early
mesoderm promoting gene that we identified as a target of mir675 by performing
miRNA targets were found using TargetScan (see Materials and Methods). qRT-PCR
data indicated that there was no difference in expression of ectoderm and endoderm
specific transcript in P-ESCs and B-ESCs derived teratomas. In contrast there was a
significant decrease in the expression of Myf5, Myf6 and MyoD in P-ESCs teratomas
compared to B-ESCs ones (P<0.05; Figure3.3B). The expression of Mier2 was also
lower in P-ESCs compared to B-ESCs teratomas (Figure3.3B) and coincided with high
levels of H19 gene expression (P<0.05; see Figure3.2A and B). These results suggest
that upon differentiation in vivo P-ESCs exhibit limited developmental potential towards
endoderm and mesoderm germ layer, muscle in particular. This phenotype coincides
with overexpression of H19 and downregulation of the muscle and mesoderm promoting
genes - Myf5, Myf6, MyoD, and Mier2 in P-ESCs derived teratomas compare to B-ESC
controls.

Downregulation of H19 expression in P-ESCs promotes normal mesoderm
differentiation in vivo
Proper H19 regulation is central to normal development of PG embryos [27-28].
Moreover, H19 may be important for proper muscle cell differentiation [79, 147]. For
example chimeras between wild type and P-ESCs result in restricted contribution of PESCs to muscle tissues in chimeric embryos [79]. Another study by Milligan et al. found
a connection between H19 and muscle differentiation in vitro [147]. In this study it was

136

elegantly shown that H19 ncRNA is stabilized in C2C12 myoblastic cells during muscle
differentiation and inhibition of protein synthesis leads to H19 ncRNA destabilization
[147]. Because we found that teratomas derived from P-ESCs are composed of a very
limited amount of muscle tissue (Figure3.3A), we hypothesized that deregulation of H19
expression in P-ESCs is responsible for the decreased differentiation potential of these
cells into muscle. To test this hypothesis we employed an H19 shRNA expressing
plasmid, lentiviral and retroviral vector systems to chronically suppress H19 gene
expression in P-ESCs. The lentiviral and retroviral shRNA delivery vectors were
modified to express fluorescent protein (EGFP) under the control of strong mouse ES
cells promoter, such as CAG promoter [148]. The plasmid vector pRNAT-U6.1/Neo was
used for preliminary study to test two different H19 shRNA oligos (Supplem. Table3.5).
The pRNAT-U6.1/Neo expressing two H19shRNAs (Supplem. Table3.5) was
transfected into mouse embryonic fibroblast (MEF) cells (Supplem. Figure3.8). In this
preliminary study we identified that H19shRNA#2 was more efficient in suppressing H19
gene expression (almost 4 fold downregulation of H19 levels) compare to H19shRNA#1
(two fold downregulation of H19 expression) (P<0.05; Supplem. Figure3.8). Therefore,
we used H19shRNA#2 for all our further experiments. The H19shRNA#2 was
introduced into the modified lentiviral and retroviral vectors. P-ESCs infected with the
H19shRNA viral vectors exhibit reduced expression of H19 mRNA (P<0.05; Supplem.
Figure3.9).
Because the retroviral H19shRNA vector had a better expression of the introduced
EGFP fluorescent protein, we have proceeded using the retroviral H19shRNA vector for
all our experiments (Supplem. Figure3.11).

137

We infected P-ESCs with an H19 shRNA retroviral vector or control vector and selected
with Hygromycin for 14 days and selected for clonal cell lines (Figure3.4A). qRT-PCR
analysis revealed that H19 was stably and efficiently down-regulated in the H19shRNA
cell line compare to the control P-ESC lines (P<0.05; Figure3.4A). Moreover, low levels
of H19 transcripts were faithfully maintained in teratomas derived from H19shRNA PESCs (P<0.05; Figure3.5A). We also analyzed the maternally (P57, Igf2R, Grb10) and
the paternally (Igf2, Mest1 and Mkrn) expressed genes between cells infected with the
H19shRNA and the control retroviral vector (Figure3.4B). Mkrn mRNA expression was
very low but detectable. Igf2 expression was upregulated in P-ESCs with suppressed
H19 (P<0.05; Figure3.4B) and this expression pattern was maintained in the teratomas
(P<0.05; Figure3. 5D). Mest1 mRNA levels were six folds upregulated in H19
downregulated P-ESCs (P<0.05; Figure 3.4B). This can phenomenon can be explained
by the recently reported Imprinted Gene Network (IGN) [36]. In the IGN any change of
imprinted genes directly connected in the hub lead to alteration of the neighboring gene.
In this context H19 may influence the expression of Igf2 and Mest1 probably trough it
antisense mRNA gene product.
We also analyzed the expression pattern of Mier2 and Rb genes and found no
statistically significant differences in Mier2 gene expression between H19
downregulated P-ESCs and Control ones (P<0.05; Figure3.4D). However,
downregulation of H19 coincided with significant upregulation of the Rb mRNA
abundance in P-ESCs (P<0.05; Figure3.4C) and this tendency persisted in the P-ESCs
derived teratomas (P<0.05; Figure3.5E).

138

To determine whether down-regulation of H19 expression improved the differentiation
potential of P-ESCs in vivo, we used our modified Thurlbeck-Scully grading system to
quantify the percentage of ecto-, endo- and mesoderm derivatives in teratomas. We
found that there was a significant increase in endoderm (15%) and mesoderm-muscle
derivatives (11%) in H19shRNA derived teratomas compared to control P-ESCs
(P<0.05; Figure3.5B). This increase was similar to the percentage of endoderm and
muscle derivatives in teratomas derived from B-ESCs (P<0.05).

To further confirm our findings, we performed qRT-PCR analysis of mesoderm specific
transcripts – MyoD, Myf6 and Mier2 whose transcription levels were significantly altered
in teratomas derived from wild type P-ESCs (see Figure3.3B). We found that upon
downregulation of H19, the levels of MyoD, Myf6 and Mier2 were significantly
upregulated in H19shRNA derived teratomas compared to control ones (P<0.05; Figure
3.5C). Such results suggest that the increased propensity of the H19shRNA cells to
differentiate into the mesoderm lineage is dependent upon the downregulation of H19
expression and the upregulation of the mesoderm specific markers (MyoD, Myf6 and
Mier2) (P<0.05; Figure 3.5A-C).

Induction of beating Embryoid Bodies (EBs) from H19 down-regulated P-ESCs
In order to further compare and analyze the differential potential of PG1, PG2 and H19
shRNA cell lines, we employed an embryoid body (EB) assay to examine
cardiomyocyte formation. We adopted a protocol for derivation of beating
cardiomyocytes by Shinsuke Yuasa et al. [141] . The incidence of beating EBs was

139

recorded at days 8, 10 and 12 of EB formation. Then the beating EBs were dissociated
and plated on gelatin coated dishes and stained for cardiomyocyte specific markers. All
the cardiomyocyte cells stained positive for α-sarcomeric actin, α-sarcomeric myosin
and Myf5 (Figure3.6A) and express the cardiomyocyte specific marker; α-cardiac actin
(Figure3.6C). The cardyomyocyte contractions were inhibited upon addition of 10µM
Verapamil which acts by specifically blocking L-type Ca2+ channels in smooth and
cardiac muscle (Supplem. movie 1). Our data indicated that P-ESCs and control vector
P-ESCs have a lower potential to give rise to beating EBs compared to control B-ESCs.
Remarkably, upon downregulation of H19, this phenotype was completely reversed
(Figure3.6B). The incidence of beating cardiomyocytes was similar between EBs
derived from H19shRNA P-ESCs and B-ESCs (p>0.05). In summary, downregulation of
H19 gene expression increases the differentiation potential of P-ESCs into
cardiomyocytes and beating EBs in a manner similar to that of normal B-ESCs.

CONCLUSION
P-ESCs: an alternative source of pluripotent stem cells in regenerative medicine
In light of an increased need for cell and tissue replacement therapy, a number of
different strategies have been implemented to obtain a pluripotent source of stem cells.
P-ESCs represent a unique source of pluripotent cells that can potentially overcome the
current limitations that destruction of viable embryos (during the derivation of stem cells
from fertilized and nuclear transfer derived embryos) or the viral integration of
oncogenes expressing vectors (used in iPS cell production) represent. The efficiency of
derivation of P-ESCs is higher than the efficiency for derivation of ES cells from Nuclear

140

Transfer (NT) [98, 111, 149-150]. Moreover, MHC matched to the major histocompatible
complex human P-ESCs have been derived with high efficiency. Such cells can be used
to treat not only the oocyte donor’s but also her siblings and perhaps, other individuals
that share their HLA types [94, 98, 111, 150].

The results reported in this study strongly suggest that H19 plays an important role for
the parthenogenetic ES cell development towards mesoderm germ layer, muscle in
particular. We used teratomas as an experimental model for evaluating the
differentiation potential of the P-ESCs instead of chimeras. In a chimeric embryo the PESCs form aggregates with the wild type host cells and are under the influence of host
cell’s environment. Therefore, during embryo development the P-ESCs, in P-ESCs-WT
cells chimeras, are in constant cross-talk and can exchange biochemical and protein
signaling with the host cells that may influence their developmental potential. Thus, in
order to evaluate the intrinsic differentiation potential of our mouse P-ESCs we used
teratoma formation and cardiomyocyte differentiation assays to analyze the sole ability
of these cells to give rise to derivatives of all three germ layers- ectoderm, endoderm
and mesoderm and to beating embryo bodies. Our results demonstrated for the first
time, that downregulation of a single imprinted gene can increase the differentiation
potential of P-ESCs towards mesoderm development and beating EBs and that this
phenotype coincides with an up –regulation of the expression of mesoderm specific
genes –MyoD, Myf6 and Mier2. These findings are consistent with reported studies by
Surani and Kono’s groups revealing the significance of H19 in development and
differentiation of parthenogenetic embryos and P-ESCs [55, 79, 108]. Future studies are

141

necessary in order to reveal the exact mechanism through which H19 exerts its role in
the P-ESCs differentiation potential. One suggestive mechanism could be that H19
through its product mir675 regulates the expression of MyoD, Myf6 and Mier2. We
already have identified Mier2 as potential targets of mir675 based on miRNA
TargetScan [140].

We also found the expression of deltaNp63 to be 250 fold overexpressed in P-ESCs
compared to control B-ESCs (P<0.05; Supplem. Figure 3.6A). DeltaNp63 is a product of
the Tumor Protein 63 gene (TP63) and is involved in stem cell maintenance and
commitment to ectoderm lineages [151-152]. TP63 mRNA is transcribed from two
alternative promoters which give rise to two different TP63 isoforms – deltaNp63 and
TAp63. Disruption of deltaNp63 in mice results in failure of proper ectoderm
development [153]. Overexpression of deltaNp63 may induce the P-ESCs, when
differentiated in vivo, to give rise to mostly ectodermal derivatives. Moreover, we found
that suppression of H19 gene expression in P-ESCs results in significant
downregulation of the deltaNp63 which coincides with less propensity of these cells to
differentiate to ectoderm lineage (P<0.05;Supplem. Figure 3.6D). The aforementioned
findings may explain the high prevalence of ectoderm derivatives in teratomas derived
from P-ESCs (see Figure3.3A) and the decrease of ectoderm contribution to teratomas
derived from P-ESCs with downregulated H19 expression. Unlike the expression in ES
cells, the expression of deltaNp63 in teratomas was inconclusive (Supplem. Figure
3.6C, D). However, since teratomas consist of heterogenous population of germ layer

142

derivatives, it is logical to conclude that the detection of the deltaNp63 in teratomas will
vary depending on the prevalence of structures that express it (Supplem. Figure 3.7).
We have also analyzed the mRNA abundance of the second major isoform of TP63
gene -TAp63. TAp63 expression is negatively regulated by deltaNp63 during ectoderm
development. For a proper ectoderm differentiation, TAp63 expression is downregulated
which coincides with upregulation of deltaNp63. We found that TAp63 was significantly
downregulated in P-ESCs compare to B-ESCs which coincided with high levels of
deltaNp63 (P<0.05; Figure3.6A). Upon downregulation of H19 the TAp63 expression
was increased. Interestingly this expression pattern was maintained upon in vivo
differentiation of the P-ESCs and B-ESCs into teratomas (Supplem. Figure 3.6A-C).
qRT-PCR for TAp63 expression in teratomas derived from P-ESCs with suppressed
H19 expression indicated that the TAp63 mRNA abundance was significantly increased
(Supplem. Figure 3.6D). It is well known that long non coding RNAs (ncRNA), such as
H19, are involved in transcriptional regulation of multiple gene targets [154]. Therefore,
one possible mechanism for the high overexpression of deltaNp63 in P-ESCs may
involve the H19ncRNA. H19ncRNA may act as transcriptional activator of deltaNp63
expression and therefore suppression of H19 may result in decrease of deltaNp63
transcript. TAp63 expression pattern observed in P-ESCs and B-ESCs as well as in
cells with downregulated H19 might be a result of transcriptional repression by
deltaNp63 as, a mechanism reported by many scientific groups [155-156]. Interestingly
we found that mir675 has 11bp perfect match to the trans-activating (TA) domain of
TP63 mRNA (Supplem. Figure 3.10) and may account for upregulation of TAp63 in ES
cells and teratomas observed (P<0.05; Supplem. Figure3.6A-D) upon down regulation

143

of H19. Another possible mechanism for regulation of deltaNp63 and TAp63 expression
in P-ESCs and B-ESCs might be through other, yet unknown factors.
Parthenogenetic stem cells represent a unique source of stem cells. They are
indistinguishable by morphology from normal B-ESCs and can be propagated in vitro for
a long period of time while still keeping their pluripotency. Moreover, our study revealed
that P-ESCs differentiation potential towards mesoderm and endoderm germ layers can
be enhanced by modulating H19 gene expression. The major obstacles of using mouse
P-ESCs as a model is that longer culture propagation, evokes high frequency of
aneuploidy 39XO and other chromosomal aberrations. This phenomenon has been very
well studied and described in parthenogenetic and normal fertilized B-ESC lines by
various groups [85, 122, 157-161]. Some of the chromosomal abnormalities can be
affecting the stem cells properties of the ES cell and some may not. For example
trisomy eight has been found to be a problem during prolong passaging of mouse BESCs, however it has no effect on differentiation potential of the mouse B-ESCs [162] .
The same holds true also for trisomies 1, 2, 6, 7, 10, 12-14, 16, 18 and 19. Complete
trisomic mice for aforementioned chromosomes can complete gastrulation stage (6.513.5 dpc) giving rise to all three main germ layers – ecto-, meso- and endo-derm [163166]. We also found that P-ESCs at passage 9 already show aneuploidy for the X
chromosome (Supplem. Table3.1). This tendency escalates pass passage12 when
other chromosome abnormalities may occur. It has been also reported that aneuploid
cells are indistinguishable from normal cells in that they can contribute to all tissues and
organs of a chimeric animal [167-168]. Therefore, due to high frequency of cytogenetic
abnormalities in mouse B-ESCs and P-ESCs in culture, the number of clones without

144

chromosomal aberrations that can be derived after prolonged passaging, may be very
limited. Despite the obstacles mentioned above, the embryonic stem cells properties do
not change at least in term of their differentiation potential, even in the presence of
certain trisomies.

In conclusion, these data demonstrate that suppression of H19 in P-ESCs has a
profound effect on the ability of these cells to give rise to mesoderm muscle derivatives.
Our data together with others strongly enforce the rationale of using P-ESCs in the
clinic. Studies in primate P-ESCs, the closest species to human, have already shown
the differentiation plasticity of these cells to give rise to all three germ layers in
teratomas and to functional neurons when differentiated in vitro and transplanted into
animal models [17, 95, 106] Further studies of the role of the imprinted genes in
modulating the developmental potential of human P-ESCs are needed to assess the
safety and the efficiency of these cells to replace or regenerate the needed tissue in
vivo.

145

FIGURES AND TABLES

146

Figure 3.1 Alterations in H19/Igf2 expression and DMR methylation in P-ESCs. (A)
Quantification of mRNA abundance of H19 and Igf2 imprinted gene expression in
mouse B-ESCs and P-ESCs by qRT-PCR. (B) Schematic representation of the H19/Igf2
DMR region. (C) Methylation profile of H19/Igf2 DMR region in Rosa 26 strain of mice,
on the bottom are indicated the CpG sites in nucleotides (nt), on the top is indicated the
number of the CpG site. (D) Percent (%) methylation of the 15th CpG islands of the
DMR region in Rosa26 strain of mice. (E) Quantification of mRNA abundance of the
P57, Igf2R, Igf2, Mest1 and Mkrn imprinted genes expression in mouse B-ESCs and PESCs by qRT-PCR. (F) Quantification of mRNA abundance of the pluripotency gene
Nanog gene expression in mouse B-ESCs and P-ESCs by qRT-PCR. For all qRT-PCR
experiments three biological replicates (n=3) in three technical replicates were used in
each run and a P<0.05 has been considered as statistical significant, unless stated
otherwise. The bars represent stand error bars. All the letters above the error bars
represent the difference between samples on the basis of standard error values
(P<0.05).

A

147

Figure 3.1 (cont’d)

B

STOP
IGF2

~100kb
~2-4kb
CTCF

H19
Enhancer

CH3CH3CH3
IGF2

~7-9kb
H19

DMR

148

Enhancer

Figure 3.1 (cont’d)

62

76

91

97

238

9 10 11 12 13 14 15

358

60

149

8

345

7

338

6

324

5

321

4

317

3

268

2

246

1

30

C

150

358

345

338

324

9 10 11 12 13 14 15

321

8

317

7

268

6

246

62

5

238

60

4

97

3

91

2

76

1

30

Figure 3.1 C (cont’d)

91

97

358

76

9 10 11 12 13 14 15

345

62

8

338

60

151

7

324

6

321

5

317

4

268

3

246

2

238

1

30

Figure 3.1 C (cont’d)

Figure 3.1 (cont’d)

D

5
4.5

Fold Change mRNA
(Relative to control)

4

3.5
3
2.5
2
1.5
1
0.5
0
P 57

Igf2

Igf2 Receptor

152

Mest1

Mkrn

Figure 3.1 (cont’d)

E

153

Figure 3.2 Elevated levels of H19 expression persist during P-ESCs differentiation in
vivo. Quantification of H19 (A) and Igf2 (B) from LCM obtained primitive glandular
structures (Endoderm) and neural rosettes (Ectoderm) by qRT-PCR. (C-D)
Quantification of H19 and Igf2(C) and Rb (D) mRNA abundance in whole teratoma
sections by qRT-PCR (P<0.05). For all qRT-PCR experiments three biological replicates
(n=3) in three technical replicates were used in each run and a P<0.05 has been
considered as statistical significant, unless stated otherwise. The bars represent
standard error bars. All the letters above the error bars represent the difference
between samples on the basis of standard error values (P<0.05).

A

154

Figure 3.2 (cont’d)

B

155

Figure 3.2 (cont’d)

C

156

Figure 3.2 (cont’d)

D

157

Figure 3.3 Lack of mesoderm muscle derivatives and downregulation of mesoderm
specific transcripts in P-ESCs upon differentiation in vivo. (A) Quantification (%) of germ
layer derivatives: ectoderm, endoderm and mesoderm; Three teratomas per sample
have been evaluated (n=3). The bars represent stand error bars. All the letters above
the error bars represent the difference between samples on the basis of standard error
values (P<0.05). (B) qRT-PCR measuring the mRNA abundance of germ layer specific
transcripts in P-ESCs and B-ESCs derived teratomas (P<0.05). For all qRT-PCR
experiments three biological replicates (n=3) in three technical replicates were used in
each run and a P<0.05 has been considered as statistical significant, unless stated
otherwise. The bars represent stand error bars. All the letters above the error bars
represent the difference between samples on the basis of standard error values
(P<0.05).

158

Figure 3.3 (cont’d)

A

159

Vimentin
Nestin

Ectoderm
Afp
Gata4

Endoderm

160
Myf5

0.5

b

Myf6
MyoD

Mesoderm

P-ESCs

a

B-ESCs

a

P-ESCs

a

B-ESCs

a

P-ESCs

a

B-ESCs

a

P-ESCs

a

B-ESCs

P-ESCs

a

B-ESCs

P-ESCs

1

B-ESCs

a

P-ESCs

1.5

B-ESCs

a

P-ESCs

B-ESCs

Fold Change mRNA
(Relative to control)
Figure 3.3 (cont’d)

B
2.5

a

2

a
a
a

b

0

Mier2

Figure 3.4 Stable and efficient down-regulation of H19 mRNA levels in mouse P-ESCs;
Quantification of the imprinted genes H19 mRNA(A), P57, Igf2R,Grb10, Igf2, Mest1and
Mkrn (B), Rb (C) and the early mesoderm promoter gene Mier2 (D)abundance by qRTPCR in H19 down-regulated P-ESCs (shRNA) and in P-ESCs infected with the control
retroviral vector (Con.vector) (P<0.05). For all qRT-PCR experiments three biological
replicates (n=3) in three technical replicates were used in each run and a P<0.05 has
been considered as statistical significant, unless stated otherwise. The bars represent
stand error bars. All the letters above the error bars represent the difference between
samples on the basis of standard error values (P<0.05).

161

Figure 3.4 (cont’d)

A
b

b
b

a

a

a

a

a

a

a

Clone
1

Clone
2

Clone Clone4
Clone
3
4

Clone
5

H19shRNA
162

Clone
6

Clone
7

Clone Clone
1
2

Clone
3

Con.Vector

Figure 3.4 (cont’d)

B

Fold Change mRNA
(Relative to control)

7
6
5
4
3
2
1
0

Con.
vector

H19 Con.
shRNA vector

P57

H19
shRNA

Igf2
Receptor

Con.
vector

H19
Con.
shRNA vector

Grb10

Maternally expressed
163

H19
shRNA

Igf2

Con.
vector

H19
shRNA

Mest1

Con.
vector

Mkrn

Paternally expressed

H19
shRNA

Figure 3.4 (cont’d)

C

164

Figure 3.4 (cont’d)

D

165

Figure 3.5 Downregulation of H19 expression in P-ESCs promotes normal endoderm
and mesoderm differentiation in vivo. (A) Quantification of H19 by qRT-PCR in samples
derived from whole teratoma sections (P<0.05). For all qRT-PCR experiments three
biological replicates (n=3) in three technical replicates were used in each run and a
P<0.05 has been considered as statistical significant, unless stated otherwise. The bars
represent stand error bars. All the letters above the error bars represent the difference
between samples on the basis of standard error values (P<0.05). (B) Quantification (%)
of germ layer derivatives: ectoderm, endoderm and mesoderm in teratomas derived
from B-ESCs, H19 down-regulated P-ESCs (shRNA) and in P-ESCs infected with the
control retroviral vector (Con.vector). Three teratomas per sample have been evaluated
(n=3). The bars represent stand error bars. All the letters above the error bars represent
the difference between samples on the basis of standard error values (P<0.05). (C)
Quantification of mesoderm specific transcripts: MyoD, Myf6, Mier2 the paternally
expressed gene Igf2 (D) and Rb (E) by qRT-PCR in samples derived from whole
teratoma sections (P<0.05), n=3. The bars represent standard error bars. All the letters
above the error bars represent the difference between samples on the basis of standard
error values (P<0.05).

166

Figure 3.5 (cont’d)

A

167

Figure 3.5 (cont’d)

B

168

Figure 3.5 (cont’d)

C

169

Figure 3.5 (cont’d)

D

170

Figure 3.5 (cont’d)

E

171

Figure 3.6 Derivation of beating embryo bodies (EBs) from B-ESCs, Control P-ESCs,
and Control vector (Con.vector) and H19shRNA P-ESCs. (A) Immunostaining for
cardiomyocyte specific markers: α-sarcomeric actin (αSM), α-sarcomeric myosin (αSM),
and Myf5. (B). Incidence of derivation of beating EBs in percentage (%) on y-axis vs.
days in culture on the x-axes. These experiments were repeated three times and total of
100 BPES, 176 Control P-ESCs, 140 H19shRNA P-ESCs and 224 Control vector
(Con.vector) P-ESC derived embryo bodies (EB) were analyzed per experiment. (C)
PCR for detection of alpha –cardiac actin in beating embryo bodies (EB). The bars
represent stand error bars (P<0.05).

A
αSA/ Hoechst

Myf5/ Hoechst

αSA/ Hoechst

αSA/ Myf5/Hoechst

172

αSM/ Hoechst

αSM/ Myf5/Hoechst

αSM/ Hoechst

Figure 3.6 (cont’d)

B

173

Figure 3.6 (cont’d)

C

174

SUPPLEMENTAL FIGURES AND TABLES

Supplemental Figure 3.1 Mouse Rosa 26 P-ESCs are morphologically
indistinguishable from mouse Rosa 26 biparental ES (B-ESCs) cells (A and B) and stain
positive for β-galactosidase expression (C and D).

10X

10X

100um

100um

A

10X

100um

B

C

20X

100um

D

175

Supplemental Figure 3.2 Mouse Rosa 26 P-ESCs and Rosa 26 B-ESCs express Oct4
and SSEA1 in mouse as shown by immunocytochemical analysis.

176

Supplemental Figure 3.3 Hematoxylin-Eosin (H&E) staining of mouse B-ESCs and PESCs (P-ESCs 1 and P-ESCs 2) derived teratomas indicating the ability of these cells
to give rise to all three germ layers when differentiated in vivo.

Ectoderm/
mesenchyme

Glandularlike structures

P-ESCs line2

P-ESCs line1

B-ESCs

Primitive neural
rosettes

177

Muscle

Supplemental Figure 3.4 Immunohistochemical staining of teratoma sections derived
from mouse Rosa 26 B-ESC and P-ESC lines confirming the identity of the germ layer
derivatives. (A) β-galactosidase, (B) α-fetoprotein, α-SMA, β-tubulin III.

A
P-ESCs line1

β-tubulin III

α-fetoprotein

P-ESCs line2

β-galactosidase

B-ESCs

P-ESCs

B

178

α-SMA

Supplemental Figure 3.5 Laser Capture Microdisection (LCM). (A) LCM experimental
outline. (B) Ectoderm (primitive neural rosettes) and endoderm (glandular structures)
derivatives obtained from mouse B-ESCs and P-ESCs derived teratomas before and
after LCM sample acquisition.

A

Endodermal Derivatives

Ectodermal Derivatives
Extract RNA

Purify the RNA

qRT-PCR w/ random primers

179

Detached Sample
After Capture

Before Capture

Supplemental Figure 3.5 (cont’d)

B

180

Supplemental Figure 3.6 Delta Np63 and TAp63 expression is indicative of germ layer
commitment. Relative mRNA expression levels of Delta Np63 and TAp63 in ES cells (AB) and teratomas(C-D) measured by qRT-PCR (P<0.05). For all qRT-PCR experiments
three biological replicates (n=3) in three technical replicates were used in each run and
a P<0.05 has been considered as statistical significant, unless stated otherwise. The
bars represent standard error bars. All the letters above the error bars represent the
difference between samples on the basis of standard error values (P<0.05).

181

Supplemental Figure 3.6 (cont’d)

A

182

Supplemental Figure 3.6 (cont’d)

B

183

Supplemental Figure 3.6 (cont’d)

C

184

Supplemental Figure 3.6 (cont’d)

D

185

Supplemental Figure 3.7 Immunohistochemical staining for delta Np63 of mouse BESCs derived teratomas using conjugated Alkaline Phosphates secondary antibody
(red color) (A-C). Intense nuclear staining (red) was identified in the basal cells of the
epithelial structures with glandular (black arrow head) and squamous (black asterix)
differentiation. There was no clear evidence of positive staining for delta Np63 seen in
mesenchyme or neural tissues. The squamous epithelium structures, however, were
more abundant than the glandular ones.

A

B

C

186

Supplemental Figure 3.8 Down-regulation of H19 expression in Mouse Embryonic Fibroblasts (MEFs) infected with two
different H19shRNA oligos (H19shRNA#1 and H19shRNA#2) by qRT-PCR, (P<0.05). For all qRT-PCR experiments three
biological replicates (n=3) in three technical replicates were used in each run and a P<0.05 has been considered as
statistical significant, unless stated otherwise. The bars represent standard error bars. All the letters above the error bars
represent the difference between samples on the basis of standard error values (P<0.05). For all qRT-PCR experiments
three biological replicates (n=3) in three technical replicates were used in each run and a P<0.05 has been considered as
statistical significant, unless stated otherwise. The bars represent standard error bars. All the letters above the error bars
represent the difference between samples on the basis of standard error values (P<0.05)

187

Supplemental Figure 3.9 Down-regulation of H19 expression in mouse P-ESCs
infected with two different H19 shRNA expressing pLenti-DEST/Hygro -EGFP shRNA
expressing lentiviral and pMSCV-Hygro-EGFP shRNA expressing retroviral vectors
(P<0.05). For all qRT-PCR experiments three biological replicates (n=3) in three
technical replicates were used in each run and a P<0.05 has been considered as
statistical significant, unless stated otherwise. The bars represent standard error bars.
All the letters above the error bars represent the difference between samples on the
basis of standard error values (P<0.05).

188

Supplemental Figure 3.10 Schematic representation of the mir675 region that is a perfect 11bp match to the TP63 Trans
Activating (TA) domain and therefore may affect the transcription or regulate the translation of TP63 mRNA.

P63 Target Region

189

Supplemental Figure3.11 EGFP fluorescence (B) and bright field (A) of mouse PGES
cells infected with pMSCV-Hygro-EGFP - H19 shRNA retroviral vector.

10X

A

10X

190

B

Supplemental Table 3.1 Cytogenetic analysis of B-ESC, P-ESC, and transgenic PESC cell lines

191

Supplemental Table 3.1 (cont’d)

192

Supplemental Table 3.2 Mouse PCR Primer Sequences
PCR Primer
Name

Forward

Reverse

Gene
bank
Acsessio
n
number
Mouse
CTCCTCCCCCTACCTTGA AATGGGGAAACAGAGTC NR_0015
H19.2
AC
ACG
92.1
Mouse Igf2
ATTCGGCCTCTGCGACT GGAAGTACGGCCTGAGA NM_0105
C
GGT
14
Mouse Igf2R CCACTGGTCAAGTCCAG CATGCAGGGTAAGAAGA NM_0105
GTT
GC
15
Mouse P57
CTGGGACCTTTCGTTCAT GTGGGGGCTTTTACTCA NM_0098
GT
ACA
76
Mouse Mkrn GCTTTGGCATTCTTTTCA ACCACCATCTGGTCTTG
NM_0117
GC
GAG
46
Mouse
AGGTTTGAAGACGCAGA TTCGAGAGATTCGAGGG NM_0167
Nestin
GGA
AGA
01
Mouse
TGGTTGACACCCACTCA
GCTTTTGGGGTGTCAGT NM_0117
Vimentin
AAA
TGT
01
Mouse Myf6 AGATCGTCGGAAAGCAG TTGCTCCTCCTTCCTTAG NM_0086
CTA
CA
57
Mouse Myf5 AGACGCCTGAAGAAGGT TGGAGAGAGGGAAGCTG NM_0086
CAA
TGT
56
Mouse
CACGACTGCTTTCTTCAC TGCTGTCTCAAAGGAGC NM_0108
MyoD
CA
AGA
66
Mouse AFP
GAAGCAAGCCCTGTGAA CCGAGAAATCTGCAGTG NM_0074
CTC
ACA
23
Mouse
CTGTGCCAACTGCCAGA CTGCTGTGCCCATAGTG NM_0080
GATA4
CTA
AGA
92
Mouse Mier2 ACACAGACAGACCCCAG CGGCTTTTCCTGAAGTG NM_0274
ACC
AAG
22
Mouse αCTGAGATGTCTCTCTCTC ACAATGACTGATGAGAG NM_0096
cardiac actin TCTTAG
ATG
08.2
Mouse
TTCAACGGCACAGTCAA
CATGGACTGTGGTCATG NM_0080
GAPDH
GG
AG
84
Mouse Rb
GCAAGTGATCAGCCATC CCAGAATCAAGATGCTG NM_0090
AGA
CAA
29
Mouse
CCAAAAGCTCCTCAAAG
AAAATGAATGGGGATGG NM_0085
Mest1
ACG
ACA
90

193

Supplemental Table 3.3 Mouse qRT-PCR Primer Sequences

194

Supplemental Table 3.3 (cont’d)

195

Supplemental Table 3.4 Bisulfate Sequencing Primers
H19 ICR region

Bisulfate sequencing primers

Outside forward

GAGTATTTAGGAGGTATAAGAATT

Inside forward

GTAAGGAGATTATGTTTATTTTTGG

Inside reverse

CCTCATTAATCCCATAACTAT

Outside reverse

ATCAAAAACTAACATAAACCCCT

*The primers are after Lucifero et al., Methylation Dynamics of Imprinted Genes in
mouse germ cells, Genomics, April 2002.

Supplemental Table 3.5 H19 small hairpin RNA (shRNA) sequence information
H19shRN
A

Accessio
n
number
H19shRNA NR_0015
,1
92

H19shRNA NR_0015
,2
92

Top strand
5'CACCGCAGGTGAGTCTCCT
TCTTCTCGAAAGAAGAAGGA
GACTCACCTGC-3'

Bottom strand

5'AAAAGCAGGTGAGTC
TCCTTCTTCTTTCGAG
AAGAAGGAGACTCAC
CTGC-3'
5’5’CACCGCAGAATGGCACATA AAAAGCAGAATGGCA
GAAAGGCGAACCTTTCTATG CATAGAAAGGTTCGC
TGCCATTCTGC-3’
CTTTCTATGTGCCATT
CTGC-3’

196

REFERENCES

197

REFERENCES
1.

Sheehy, E., et al., Estimating the number of potential organ donors in the United
States. N Engl J Med, 2003. 349(7): p. 667-74.

2.

Network, N.Y.O.D., http://www.donatelifeny.org/index.asp, 2010.

3.

Coombes, J.M. and J.F. Trotter, Development of the allocation system for
deceased donor liver transplantation. Clin Med Res, 2005. 3(2): p. 87-92.

4.

Sasazuki, T., et al., Effect of Matching of Class I HLA Alleles on Clinical Outcome
after Transplantation of Hematopoietic Stem Cells from an Unrelated Donor. New
England Journal of Medicine, 1998. 339(17): p. 1177-1185.

5.

Flomenberg, N., et al., Impact of HLA class I and class II high-resolution
matching on outcomes of unrelated donor bone marrow transplantation: HLA-C
mismatching is associated with a strong adverse effect on transplantation
outcome. Blood, 2004. 104(7): p. 1923-1930.

6.

Petersdorf, E.W., et al., Major-Histocompatibility-Complex Class I Alleles and
Antigens in Hematopoietic-Cell Transplantation. New England Journal of
Medicine, 2001. 345(25): p. 1794-1800.

7.

Ishikawa, K., et al., The innate immune system in host mice targets cells with
allogenic mitochondrial DNA. J Exp Med, 2010.

8.

Petersdorf, E.W., et al., Major-Histocompatibility-Complex Class I Alleles and
Antigens in Hematopoietic-Cell Transplantation. 2001. p. 1794-1800.

9.

Hipp, J. and A. Atala, Tissue engineering, stem cells, cloning, and
parthenogenesis: new paradigms for therapy. J Exp Clin Assist Reprod, 2004.
1(1): p. 3.

10.

Kaufman, M.H., et al., Establishment of pluripotential cell lines from haploid
mouse embryos. J Embryol Exp Morphol, 1983. 73(1): p. 249-261.

198

11.

Robertson, E.J., M.J. Evans, and M.H. Kaufman, X-chromosome instability in
pluripotential stem cell lines derived from parthenogenetic embryos. J Embryol
Exp Morphol, 1983. 74: p. 297-309.

12.

Cibelli, J.B., et al., Parthenogenetic stem cells in nonhuman primates. Science,
2002. 295(5556): p. 819.

13.

Mitalipov, S.M., K.D. Nusser, and D.P. Wolf, Parthenogenetic Activation of
Rhesus Monkey Oocytes and Reconstructed Embryos. Biology of Reproduction,
2001. 65(1): p. 253-259.

14.

Fang, Z.F., et al., Rabbit embryonic stem cell lines derived from fertilized,
parthenogenetic or somatic cell nuclear transfer embryos. Exp Cell Res, 2006.
312(18): p. 3669-82.

15.

Dighe, V., et al., Heterozygous embryonic stem cell lines derived from nonhuman
primate parthenotes. Stem Cells, 2008. 26(3): p. 756-66.

16.

Revazova, E.S., et al., Patient-Specific Stem Cell Lines Derived from Human
Parthenogenetic Blastocysts. Cloning Stem Cells, 2007. 9(3): p. 432-49.

17.

Onodera, Y., et al., Differentiation diversity of mouse parthenogenetic embryonic
stem cells in chimeric mice. Theriogenology, 2010. 74(1): p. 135-45.

18.

Jagerbauer, E.M., et al., Parthenogenetic stem cells in postnatal mouse
chimeras. Development, 1992. 116(1): p. 95-102.

19.

Fundele, R.H., et al., Temporal and spatial selection against parthenogenetic
cells during development of fetal chimeras. Development, 1990. 108(1): p. 203211.

20.

Kono, T., et al., Epigenetic modifications during oocyte growth correlates with
extended parthenogenetic development in the mouse. Nat Genet, 1996. 13(1): p.
91-4.

199

21.

Barton, S.C., M.A.H. Surani, and M.L. Norris, Role of paternal and maternal
genomes in mouse development. Nature, 1984. 311(5984): p. 374-376.

22.

Karin S. Sturm, M.L.F.R.A.P., Abnormal development of embryonic and
extraembryonic cell lineages in parthenogenetic mouse embryos. Developmental
Dynamics, 1994. 201(1): p. 11-28.

23.

Park, J.I., et al., Differentiative potential of a mouse parthenogenetic embryonic
stem cell line revealed by embryoid body formation in vitro. Jpn J Vet Res, 1998.
46(1): p. 19-28.

24.

Sturm, K.S., et al., Unrestricted lineage differentiation of parthenogenetic ES
cells. Development Genes and Evolution, 1997. 206(6): p. 377-388.

25.

Allen, N., et al., A functional analysis of imprinting in parthenogenetic embryonic
stem cells. Development, 1994. 120(6): p. 1473-1482.

26.

Sotomaru, Y., et al., Unregulated Expression of the Imprinted Genes H19 and
Igf2r in Mouse Uniparental Fetuses
J. Biol. Chem., 2002. 277(14): p. 12474-12478.
27.

Kono, T., et al., Birth of parthenogenetic mice that can develop to adulthood.
Nature, 2004. 428(6985): p. 860-864.

28.

Kawahara, M., et al., High-frequency generation of viable mice from engineered
bi-maternal embryos. Nat Biotechnol, 2007. 25(9): p. 1045-50.

29.

Ogawa, H., et al., Disruption of parental-specific expression of imprinted genes in
uniparental fetuses. FEBS Lett, 2006. 580(22): p. 5377-84.

30.

Ogawa, H., et al., Disruption of parental-specific expression of imprinted genes in
uniparental fetuses. FEBS Letters, 2006. 580(22): p. 5377-5384.

31.

Liu, J.-H., et al., Diploid parthenogenetic embryos adopt a maternal-type
methylation pattern on both sets of maternal chromosomes. Genomics, 2008.
91(2): p. 121-8.
200

32.

Schoenfelder, S., et al., Non-coding transcripts in the H19 imprinting control
region mediate gene silencing in transgenic Drosophila. EMBO Rep, 2007. 8(11):
p. 1068-73.

33.

Berteaux, N., et al., A novel H19 antisense RNA overexpressed in breast cancer
contributes to paternal IGF2 expression. Mol Cell Biol, 2008. 28(22): p. 6731-45.

34.

Platonov, E.S., L.I. Penkov, and D.A. New, [Effects of growth factors FGF2 and
IGF2 on the development of parthenogenetic mouse embryos in utero and in
vitro]. Ontogenez, 2002. 33(1): p. 60-7.

35.

Kono, T., Genomic imprinting is a barrier to parthenogenesis in mammals.
Cytogenet Genome Res, 2006. 113(1-4): p. 31-5.

36.

Kono, T., et al., Paternal dual barrier by Ifg2-H19 and Dlk1-Gtl2 to
parthenogenesis in mice. Ernst Schering Res Found Workshop, 2006(60): p. 2333.

37.

Wu, Q., et al., Regulated expression of two sets of paternally imprinted genes is
necessary for mouse parthenogenetic development to term. Reproduction, 2006.
131(3): p. 481-488.

38.

Hikichi, T., et al., Functional full-term placentas formed from parthenogenetic
embryos using serial nuclear transfer. Development, 2010. 137(17): p. 2841-7.

39.

Zambrowicz, B.P., et al., Disruption of overlapping transcripts in the ROSA beta
geo 26 gene trap strain leads to widespread expression of beta-galactosidase in
mouse embryos and hematopoietic cells. Proc Natl Acad Sci U S A, 1997. 94(8):
p. 3789-94.

40.

Kono, T., et al., A cell cycle-associated change in Ca2+ releasing activity leads to
the generation of Ca2+ transients in mouse embryos during the first mitotic
division. J Cell Biol, 1996. 132(5): p. 915-23.

41.

Hikichi, T., et al., Differentiation Potential of Parthenogenetic Embryonic Stem
Cells Is Improved by Nuclear Transfer. Stem Cells, 2007. 25(1): p. 46-53.

201

42.

Abbondanzo, S.J., I. Gadi, and C.L. Stewart, Derivation of embryonic stem cell
lines. Methods Enzymol, 1993. 225: p. 803-23.

43.

Bettegowda, A., et al., Quantitative analysis of messenger RNA abundance for
ribosomal protein L-15, cyclophilin-A, phosphoglycerokinase, beta-glucuronidase,
glyceraldehyde 3-phosphate dehydrogenase, beta-actin, and histone H2A during
bovine oocyte maturation and early embryogenesis in vitro. Mol Reprod Dev,
2006. 73(3): p. 267-78.

44.

Whelan, J.A., N.B. Russell, and M.A. Whelan, A method for the absolute
quantification of cDNA using real-time PCR. Journal of Immunological Methods,
2003. 278(1-2): p. 261-269.

45.

Li, X. and X. Wang, Application of real-time polymerase chain reaction for the
quantitation of interleukin-1[beta] mRNA upregulation in brain ischemic tolerance.
Brain Research Protocols, 2000. 5(2): p. 211-217.

46.

Norris, H.J., H.J. Zirkin, and W.L. Benson, Immature (malignant) teratoma of the
ovary: a clinical and pathologic study of 58 cases. Cancer, 1976. 37(5): p. 235972.

47.

O'Connor, D.M. and H.J. Norris, The influence of grade on the outcome of stage I
ovarian immature (malignant) teratomas and the reproducibility of grading. Int J
Gynecol Pathol, 1994. 13(4): p. 283-9.

48.

Steeper, T.A. and K. Mukai, Solid ovarian teratomas: an immunocytochemical
study of thirteen cases with clinicopathologic correlation. Pathol Annu, 1984. 19
Pt 1: p. 81-92.

49.

Lucifero, D., et al., Methylation dynamics of imprinted genes in mouse germ cells.
Genomics, 2002. 79(4): p. 530-8.

50.

Friedman, R.C., et al., Most mammalian mRNAs are conserved targets of
microRNAs. Genome Res, 2009. 19(1): p. 92-105.

202

51.

Yuasa, S., et al., Transient inhibition of BMP signaling by Noggin induces
cardiomyocyte differentiation of mouse embryonic stem cells. Nat Biotechnol,
2005. 23(5): p. 607-11.

52.

Dean, W., et al., Altered imprinted gene methylation and expression in
completely ES cell-derived mouse fetuses: association with aberrant phenotypes.
Development, 1998. 125(12): p. 2273-2282.

53.

Horii, T., et al., Loss of genomic imprinting in mouse parthenogenetic embryonic
stem cells. Stem Cells, 2008. 26(1): p. 79-88.

54.

Jiang, H., et al., Activation of paternally expressed imprinted genes in newly
derived germline-competent mouse parthenogenetic embryonic stem cell lines.
Cell Res. 17(9): p. 792-803.

55.

Bibikova, M., et al., Human embryonic stem cells have a unique epigenetic
signature. Genome Res, 2006. 16(9): p. 1075-83.

56.

Sasaki, H., K. Ishihara, and R. Kato, Mechanisms of Igf2/H19 imprinting: DNA
methylation, chromatin and long-distance gene regulation. J Biochem, 2000.
127(5): p. 711-5.

57.

Tsang, W.P., et al., Oncofetal H19-derived miR-675 regulates tumor suppressor
RB in human colorectal cancer. Carcinogenesis, 2010. 31(3): p. 350-358.

58.

Onodera, Y., et al., Differentiation diversity of mouse parthenogenetic embryonic
stem cells in chimeric mice. Theriogenology. In Press, Corrected Proof.

59.

Kono, T., et al., Birth of parthenogenetic mice that can develop to adulthood.
Nature, 2004. 428(6985): p. 860-4.

60.

Kono, T., et al., Mouse parthenogenetic embryos with monoallelic H19
expression can develop to day 17.5 of gestation. Dev Biol, 2002. 243(2): p. 294300.

203

61.

Milligan, L., et al., H19 gene expression is up-regulated exclusively by
stabilization of the RNA during muscle cell differentiation. Oncogene, 2000.
19(50): p. 5810-6.

62.

Chung, S., et al., Analysis of different promoter systems for efficient transgene
expression in mouse embryonic stem cell lines. Stem Cells, 2002. 20(2): p. 13945.

63.

Varrault, A., et al., Zac1 Regulates an Imprinted Gene Network Critically Involved
in the Control of Embryonic Growth. Developmental Cell, 2006. 11(5): p. 711722.

64.

Lengerke, C., et al., Differentiation potential of histocompatible parthenogenetic
embryonic stem cells. Annals of the New York Academy of Sciences, 2007.
1106(1): p. 209-18.

65.

Thuan, N.V., S. Kishigami, and T. Wakayama, How to improve the success rate
of mouse cloning technology. J Reprod Dev, 2010. 56(1): p. 20-30.

66.

Kim, K., et al., Histocompatible embryonic stem cells by parthenogenesis.
Science, 2007. 315(5811): p. 482-6.

67.

Hao, J., et al., Human parthenogenetic embryonic stem cells: one potential
resource for cell therapy. Sci China C Life Sci, 2009. 52(7): p. 599-602.

68.

Honeycutt, K.A., M.I. Koster, and D.R. Roop, Genes involved in stem cell fate
decisions and commitment to differentiation play a role in skin disease. J Investig
Dermatol Symp Proc, 2004. 9(3): p. 261-8.

69.

Senoo, M., et al., p63 Is Essential for the Proliferative Potential of Stem Cells in
Stratified Epithelia. Cell, 2007. 129(3): p. 523-536.

70.

Yang, A., et al., p63 is essential for regenerative proliferation in limb, craniofacial
and epithelial development. Nature, 1999. 398(6729): p. 714-8.

204

71.

Barrandon, C., B. Spiluttini, and O. Bensaude, Non-coding RNAs regulating the
transcriptional machinery. Biol Cell, 2008. 100(2): p. 83-95.

72.

Koster MI, K.S., Mills AA, DeMayo FJ, Roop DR, p63 is the molecular switch for
initiation of an epithelial stratification program. Genes Dev. , 2004 18(2): p. 12631.

73.

Roop, M.I.K.a.D.R., Transgenic Mouse Models Provide New Insights into the
Role of p63 in Epidermal Development. CellCycle, 2004. 3(4): p. 409 - 411.

74.

Gaudet, F., et al., Induction of tumors in mice by genomic hypomethylation.
Science, 2003. 300(5618): p. 489-92.

75.

Zvetkova, I., et al., Global hypomethylation of the genome in XX embryonic stem
cells. Nat Genet, 2005. 37(11): p. 1274-1279.

76.

Izadpanah, R., et al., Long-term in vitro expansion alters the biology of adult
mesenchymal stem cells. Cancer Res, 2008. 68(11): p. 4229-38.

77.

Cimini, D. and F. Degrassi, Aneuploidy: a matter of bad connections. Trends Cell
Biol, 2005. 15(8): p. 442-51.

78.

Cheng, L., More new lines of human parthenogenetic embryonic stem cells. Cell
Res, 0000. 18(2): p. 215-217.

79.

Sun, X., et al., Two active X Chromosomes and methylation of the imprinted
gene in human parthenogenetic embryonic stem cell line. Cell Res, 0000. 18(S1):
p. S35-S35.

80.

Park JI, Y.I., Tada T, Takagi N, Takahashi Y, Kanagawa H., Trisomy 8 does not
affect differentiative potential in a murine parthenogenetic embryonic stem cell
line. Jpn J Vet Res. , 1998 46(1): p. 29-35.

81.

Epstein, C.J., Mouse monosomies and trisomies as experimental systems for
studying mammalian aneuploidy. Trends in Genetics, 1985. 1: p. 129-134.

205

82.

Gropp, A., U. Kolbus, and D. Giers, Systematic approach to the study of trisomy
in the mouse. II. Cytogenet Cell Genet, 1975. 14(1): p. 42-62.

83.

Gropp, A., et al., Murine trisomy: developmental profiles of the embryo, and
isolation of trisomic cellular systems. J Exp Zool, 1983. 228(2): p. 253-69.

84.

Gropp, A., D. Giers, and U. Kolbus, Trisomy in the fetal backcross progeny of
male and female metacentric heterozygotes of the mouse. i. Cytogenet Cell
Genet, 1974. 13(6): p. 511-35.

85.

Longo, L., et al., The chromosome make-up of mouse embryonic stem cells is
predictive of somatic and germ cell chimaerism. Transgenic Research, 1997.
6(5): p. 321-328.

86.

Inoue, K., et al., Sex-Reversed Somatic Cell Cloning in the Mouse. The Journal
of Reproduction and Development, 2009. 55(5): p. 566-569.

87.

Sanchez-Pernaute, R., et al., Parthenogenetic dopamine neurons from primate
embryonic stem cells restore function in experimental Parkinson's disease. 2008.
p. 2127-2139.

88.

Sanchez-Pernaute, R., et al., Long-Term Survival of Dopamine Neurons Derived
from Parthenogenetic Primate Embryonic Stem Cells (Cyno-1) After
Transplantation. 2005. p. 914-922.

89.

Ferrari, D., et al., Transplanted dopamine neurons derived from primate ES cells
preferentially innervate DARPP-32 striatal progenitors within the graft. Eur J
Neurosci, 2006. 24(7): p. 1885-96.

206

DISSERTATION CHAPTER 4

TITLE
CONCLUSIONS, FUTURE DIRECTIONS AND
PRELIMINARY RESULTS

207

DISSERTATION CONCLUSIONS

The study of P-ESCs and PgEs has been of high interest in the area of stem cells and
developmental biology primarily for three reasons: the potential application of P-ESCs in
transplantation medicine, the role of imprinted genes in stem cell differentiation and
embryo development, and third, their homozygosity, as it relates to fetal and stem cell
viability and tumor formation.
P-ESCs used in our studies were derived from three different species –human (LLC6p), primate (Cyno1) and mouse. We focused primarily on the deregulation of a specific
set of imprinted genes, their impact on cell differentiation and potential regulation.
Morphologically all the P-ESCs were indistinguishable from their respective biparental
ES cells. The P-ESCs were propagated for long period of time while maintaining their
undifferentiated ES cell morphology. Mouse, primate and human P-ESCs stain positive
for the pluripotency markers OCT4, SOX2, SSEA1, and SSEA4 similar to their
biparental counterparts. That the P-ESCs were pluripotent was revealed by an in vivo
assay where the cells were injected subcutaneously into immune compromised NudeSCID mice and were able to give rise to teratomas consisting of derivatives of all three
germ layers- ectoderm, endoderm and mesoderm. Moreover, the teratomas formed on
the site of injection, and no metastatsis were discovered. In this study we developed a
method for quantification of germ layer derivatives based on morphological evaluation of
consecutive sections of paraffin fixed formalin embedded teratoma sample. We
modified the well established Tumberlek-Skully grading system, which is approved by
the College of American pathologists (CAP) and highly used in clinics for determining

208

the tumor grade of solid ovarian teratomas, in order to account for the heterogeneous
nature of our teratomas [136-138]. By using this method we determined that P-ESCs
teratomas consisted of mostly terminally differentiated tissues of ectoderm, endoderm
and mesoderm origin. These studies indicated that the P-ESCs are indistinguishable
from normal biparental ES cells in terms of pluripotency and morphology, and can be
induced to give rise to derivatives of all three germ layers –ectoderm, mesoderm and
endoderm when differentiated in vivo but unlike teratomas derived from fertilized BESCs, mouse, primate and human P-ESCs derived teratomas showed restricted
developmental potential towards endoderm derivatives. Mouse and primate P-ESCs
also exhibited less potential to give rise to mesoderm muscle derivatives.

Numerous reports have identified H19 gene as critical for proper PgE development [2,
55, 72, 107-108]. H19 is an imprinted gene that codes for an untranlsated mRNA
molecule. H19 is maternally expressed i.e. paternally imprinted gene. Recently it was
found that H19 and other imprinted genes form an imprinted gene network whereby
even a slow alteration of an imprinted gene of the hub effects the expression of the
imprinted genes in the network [36, 169]. Therefore one can assume that modulating
H19 gene expression may affect the expression of other imprinted genes and ultimately
can change the differentiation potential of the cells since one of the main function of
H19 and other imprinted genes in the network such as IGF2, DIO3, DLK1, IGF2R is to
control embryo and cell growth and differentiation.
H19 expression in the cell is coordinately regulated with the expression of the paternally
expressed gene Insulin Growth Factor 2(IGF2) which resides around 70kb upstream of

209

H19 [144]. The coordinate expression of H19 and IGF2 is mainly under the control of a
DMR region located upstream of H19. Our data revealed that H19 was highly
overexpressed in P-ESC cell lines derived from mouse, primate and human
parthenogenetic blastocysts. We were also able to detect expression of paternally
expressed genes which normally are expected to be silent in P-ESCs. These findings
were consistent with reports coming from other groups, pointing out that the imprinting
maintenance is unstable in P-ESCs during passaging [72, 76, 83, 87]. The same
phenomenon has been found to be the case in normal fertilized B-ESCs revealing that
the expression pattern of the imprinted genes changes upon in vitro culturing and
propagation [24, 142, 170]. For example gene expression data from our P-ESC lines
indicated that Igf2 was expressed in all mouse, primate and human P-ESCs. The
expression of Igf2 in mouse P-ESCs did not correlate with the methylation of the DMR
region which remained partially methylated in the two mouse P-ESC lines; P-ESC-1 and
P-ESC-2 tested. Other paternally expressed genes whose expression was detected in
P-ESCs were PEG10 and SNRPN in primate P-ESCs, DIO3 in human P-ESCs and
Mest1 and Mkrn in mouse P-ESCs.
We focused our study on evaluating the effect of H19 on P-ESCs differentiation
plasticity because H19 was highly overexpressed in all P-ESC cell lines tested and
second because a huge body of literature has revealed that H19 is critical for PgE
development to term. We and other groups have also observed that P-ESCs with H19
overexpression give rise to mostly ectodermal derivatives when introduced into chimeric
animals in vivo [79-81, 146].

210

We used small hairpin RNA (shRNA) plasmid and retroviral vector system to chronically
suppress the H19 expression in mouse, primate and human P-ESCs. We followed the
developmental potential of mouse P-ESCs with suppressed H19 expression and found
that these cells were more prone to give rise to endoderm and mesoderm derived
muscle compare to P-ESC control cells (there was a 15% increase in endoderm and
11% increase in mesoderm derived muscle in mouse P-ESCs with suppressed H19
compare to control P-ESCs). By using our modified Tumberleck –Skully method for
quantification of germ layer derivatives, we estimated the percentage of endoderm and
mesoderm muscle tissues in H19 downregulated P-ESCs derived teratomas to be
similar to that observed in B-ESC control cells. The increase of mesoderm derived
muscle correlated with a statistical significant increase (P<0.05) in the expression of the
muscle specific genes Myf5, Myf6, MyoD and an increase in the early mesoderm
promoting marker Mier2. Moreover, we found that the expression of the ectoderm
promoting gene ΔNp63 was significantly down regulated in the mouse P-ESCs with
suppressed H19 expression which may account for the decrease of the ectoderm
derived tissues in teratomas. We also performed a functional study where we induced
the mouse P-ESCs with downregulated H19 to differentiate into beating EBs following a
very well established protocol [141]. Our data revealed that P-ESCs with suppressed
H19 give rise to more beating EBs compare to P-ESC control cells and more similar to
normal B-ESCs.

All together these results suggest that P-ESCs are amenable to genetic modification
and that downregulation of H19 can bring them functionally closer to normal B-ESCs.

211

Improving the differentiation plasticity of P-ESCs towards endoderm and mesoderm
muscle derivatives will aid towards a potential application of these cells for stem cell
therapy. Another advantage of the P-ESCs for transplantation application is that these
cells are isogenic with the oocyte donor i.e. a perfect match for the tissue rejection
antigens of the major histocompatible complex loci [98, 171].
Unfortunately we found that P-ESCs are very prone, probably due to their monoparental
genomic complement, to accumulate cytogenetic abnormalities. This may be avoided if
an early passage (not later than passage 6) P-ESCs are used. The maternal-only
genomic complement also carries some risk for failure of the P-ESCs derived tissues
and organs due to genetic homozygosity for deleterious mutations. The “1000 genomes
project” estimated that on average, in a heterozygous genome, there are 50-100
variants classified by the Human Gene Mutation Database (HGMD) as causing inherited
disorders in humans [172]. Assuming random recombination among the chromatids
prior to meiotic reduction and division as demonstrated by Kim et al., we can presume
that a human parthenote would, on average, be homozygous for half the number of the
deleterious alleles annotated by The “1000 genomes project” mentioned above [172].
However, it is not known if these deleterious alleles are disadvantageous for specific
tissues and organs or only for the whole individual. Therefore, more data is needed to
reveal the impact these allele variants may have on the use of P-ESCs for tissue
replacement.

In conclusion, despite the pitfalls outlined above, P-ESCs can give rise to functional
tissues such as those already reported and exhibited long term survival and function

212

upon grafting into animal models [17-18, 106]. Also P-ESCs bypass the ethical issues
associated with destruction of viable embryos which the fertilized B-ESCs face. Future
pre-clinical studies on the safety and efficiency of P-ESCs during engraftment and
tissue regeneration will help us determine the real potential of these cells for clinical
application.

FUTURE DIRECTIONS
The data presented here suggests that H19 expression affects the differentiation
potential of mouse P-ESCs towards endoderm and mesoderm germ layers.
Future studies would need to focus on the mechanism through which H19 exerts its
action. We now know that H19 codes for an antisense (AS) RNA molecule as well as for
a microRNA (mir675). We also identified through Target Scan software that Mier2 is a
potential target of mir675. Therefore a possible way for H19 mode of action can be
affecting the mesoderm and/or the endoderm differentiation by using the miRNA
pathways. It has been already reported that mir675 targets the 3’UTR region of the
Retinoblastoma (RB) transcript and suppresses RB expression in different carcinoma
cell lines [145]. Another mechanism can be that the H19asRNA is the molecule that
targets transcriptional or post transcriptional silencing of candidate genes and thus
modulates the developmental program. This can be tested in vitro by over expressing
the H19AS RNA followed by a microarray experiment looking for global changes in
gene expression.

It has been reported that suppression of H19 is critical for PgEs development to term.

213

These studies were based on genetically modifying the PgE genome so that the H19
coding and upstream DMR region is deleted from one of the maternal chromosomes
[55, 107]. An elegant experiment to look at the role of H19 in PgE development to term
would be to incubate a PgE at 2-cells or blastocyst stage in the supernatant of our
packaged shRNA expressing retroviral vector. Then the PgE can be transferred to a
pseudopregnanat surrogate mother and the development of the embryo can be followed
and analyzed to term.

A more sophisticated modification of the experiment proposed above is to use our
H19shRNA viral vector construct which is also Tetracycline off vector i.e. the H19 is
expressed unless tetracycline is added. After infection of the PgE at blastocyst stage
and transfer to surrogate mother, the mother can be fed tetracycline and the H19
shRNA expression can be regulated on timely manner at different stages of embryo
development – implantation, gastrulation, and organogenesis.

Recent studies in PgE development revealed that when passed through serial nuclear
transfers, the parthenogenetic genome can be partially reprogrammed so that the PgE
development can be prolonged as a result of improvement in placental development
[84, 110]. This study showed that as the placental formation and embryo development
improved the levels of H19 expression decreased. Therefore, it would be of great
scientific value if we use our transgenic P-ESC lines with suppressed H19 gene
expression for nuclear transfer experiment. We would expect that the nuclear transfer

214

PgEs would exhibit prolong embryo development, placental formation even after the first
round of nuclear transfer.

Finally, we are currently applying the knowledge on H19 down regulation gained from in
mouse P-ESCs studies on modulating the differentiation potential of human P-ESCs –
LLC-6p. Primates and rodents are far in the tree of evolution; however the imprinting
pattern of most of the imprinted genes such as H19 has been conferred. We have
constructed an H19shRNA and H19asRNA expressing vectors to study the effect of
downregulation of H19 on the differentiation plasticity of the human P-ESCs. The
preliminary results are outlined below.

215

HUMAN PARTHENOGENETIC EMBRYONIC STEM CELLS (P-ESCS)
PRELIMINARY RESULTS

AIMS

A. To study the differentiation potential of human B-ESCS and P-ESCs in vivo, by
teratoma formation
B. To analyze the expression of set of maternally and paternally imprinted genes as
well as the expression pattern of DNA Methyl transferase enzymes (DNMTs) in
different passages of human B-ESCs and P-ESCs.
C. To design expression vectors for stable downregulation of H19 gene expression
in human B-ESCs and P-ESCs

MATERIALS AND METHODS

Embryonic Stem Cell Culturing and Propagation
Human Biparental Embryonic Stem cells(H1) (WiCell Institute, Wisconsin, USA) and
Human Parthenogenetic Embryonic Stem (LLC-6p) (International Stem Cells
Corporation, California, USA) cells with a stable, normal (46, XX) karyotype, were
cultured on mitotically inactivated feeder layer of mouse embryonic fibroblast cells as
described by Zhang et al., 2001. The culture media consisted of Dulbecco’s Modified
Eagle’s Medium (DMEM/F12; Invitrogen), 20% knock out serum replacement
216

(Invitrogen), 0.1mM β-mercaptoethanol, 4ng/ml FGF-2 (Invitrogen), 1% nonessential
amino acids (Invitrogen), and 2mM L-glutamine (Invitrogen). The embryonic stem (ES)
cells were cultured and maintained in humidified incubator with 5% CO2 at 37oC.

Immunocytochemistry
Cells were washed 3 times, each time 5 minutes with washing buffer (DPBS, 0.1%
TX100 (Triton 100X) and incubated with Permeabilization Buffer (DPBS, 1% TX100) for
10min. Subsequently, the cells were washed once more with washing buffer, then
blocked with blocking buffer (DBPS + 0.1%TX100 + 1%BSA + 10%NGS) for 1-2 hours.
OCT4 antibody (sc8628, Santa Cruz Biotechnology, Inc.) in dilution 1:300 and SSEA4
antibody (DSHB at the University of Iowa, mc813-70), in 1:500 dilution, NANOG
(sc33759, Santa Cruz Biotechnology, Inc.), LIN28 (sc67266, Santa Cruz Biotechnology,
Inc.), and SOX2 (ab5603, Abcam) was added to the cells and incubated for 3 hours to
overnight at 4oC. Cells were washed 6 times each time 10 minutes. Then secondary Ab
(Abcam) was added in 1:500 dilutions following the manufacturer’s recommendations.

RNA isolation and cDNA synthesis from ES cells
Total mRNA from human H1 and LLC-6p embryonic stem (ES) cells was isolated using
the RNeasy Isolation Mini Kit (Qiagen) following the manufacturer's instructions and
strict RNAse and DNAse free procedures. Total mRNA amount was measured using
Nanodrop. One ug of total RNA with OD260/280 > 2.1 was used for first strand cDNA
synthesis. cDNA was synthesized with Superscript II (Invitrogen) using anchored Oligo
(dT12-18) primers (Invitrogen) and following the manufacturer’s instructions.

217

Quantitative real time RT-PCR
The quantification of all gene transcripts was performed by reverse transcription of total
RNA followed by absolute real-time quantitative RT-PCR using SYBR Green PCR
Master Mix (Applied Biosystems). Absolute quantification using this method is described
elsewhere (Li and Wang, 2000; Whelan et al., 2003). Primers for absolute real time
PCR were designed using Primer Express program (Applied Biosystems) and derived
from human sequences found in GeneBank (Table4.1). A primer matrix was performed
for each gene tested to determine optimal concentrations. Each reaction mixture
consisted of 2 µl of cDNA, optimum concentration of each forward and reverse primer,
nuclease free water, and 12.5 µl of SYBR Green PCR Master Mix in a total reaction
volume of 25 µl (96well plates). Reactions were performed in triplicate for each sample
using an ABI Prism 7000 Sequence Detection System (Applied Biosystems). The
thermal cycle consisted of 40 cycles of 95ºC for 15sec and 60 ºC for 1min. Standard
curves for each gene and controls were constructed using tenfold serial dilution and run
on sample plates as standards. For gene expression normalization expression levels of
β-actin mRNA was used. Copies of β-actin RNA in each pool were determined using
standard curves constructed from the plasmid PCR2.1 Topo containing partial β-actin
cDNA sequence (Bettegowda et al, 2006). Partial cDNA sequences for β-actin , H19,
IGF2 and the other genes tested, were amplified from human H1 ES cells, cloned into
pCR2.1 Topo vector (Invitrogen), and subjected to fluorescent dye primer sequencing to
confirm identity. Resulting plasmids were used to construct standard curves.
Representative R2 for β-actin, H19 and the rest of the genes were estimated and only

218

the one ≥ 0.98 used. For each measurement, threshold lines were adjusted to intersect
amplification lines in exponential portion of amplification curve (Bettegowda et al).

Teratoma formation
For all teratoma experiments, a suspension of around 1x106 H1 HES cells and LLC-6p
ES cells were injected subcutaneously (s.c.) into immunodeficient Nude mice-CD-1
(Charles River Laboratories). Mice were euthanized around eight weeks after injection
or when tumors had grown to about 1cm in diameter, whichever came first. Teratomas
were then isolated, fixed in paraformaldehyde, embedded in paraffin and stained with
hematoxilin eosin.

Quantification of Endoderm, Ectoderm and Mesoderm derivatives in teratomas
Teratomas from H1 HES cells and LLC-6p ES cells were derived by subcutaneous
injection into immune-deficient Nude mice, CD-1 (Charles River Laboratories). The
teratomas were formalin fixed sectioned and embedded in paraffin blocks; each was
entirely submitted for histological analysis. One to three gross tissue samples per tumor
were obtained for this study. The College of American Pathologists (CAP) guidelines for
gross sampling of solid tumors state that one sample for each centimeter of tumor or
three samples, whichever is greater, should be used for tumor grading. Histological
grading was performed utilizing the modified Thurlbeck-Scully histological grading
system for solid ovarian teratomas proposed by Norris et al [136] and successfully
implemented by O’Conner et al[137] and Steeper and Mukai [138]. This system which is
widely employed clinically, estimates percentage of neuro epithelium in the total tumor
mass by counting the number of microscopic 10x Low Power Fields (LPFs) to
219

differentiate between tumors grades I, II, and III. We estimated that from our teratoma
samples about 12-16 LPFs could be evaluated per full tissue section on one glass
microscopic slide and that 3 tissue sections would yield approximately 36-48 LPFs for
examination, and thus comply with the modified Thurlbeck-Scully histological grading
system.

H19 shRNA and H19asRNA expressing vectors
For downregulation of H19 in human P-ESCs (LLC-6p) we used shRNA and asRNA
approach. For expression of H19shRNA we used pRNAT-U6.1 plasmid (GenScript,
cat#SD1211) and a pMSCV-Hygro retroviral vector (Clontech Laboratories, Inc.). The
pMSCV-Hygro vector (Clontech Laboratories, Inc.) was used for H19 shRNA delivery
into humanLLC-6p cells with the following modifications: Chicken b-promoter CMV-IE
Enhancer fragment was derived from plasmid pCX-EGFP without PolyA signal by
digestion with Sal-I and Bgl-II. The pMSCV-Hygro retroviral vector was digested with
Sal1 and the Chicken b-promoter CMV-IE Enhancer-Intron-EGFP and introduced by T4
DNA ligation reaction into the Sal1 site. The cassette H1/TO promoter -H19 shRNA –
Pol III termination site was released from plasmid pENTR/H1/TO plasmid (Invitrogen) by
digestion with BamHI (NEB) and cloned into unique Xho1 site of the pMSCV-Hygro
retroviral vector. The so modified pMSCV-Hygro retroviral vector was called pMSCVHygro-EGFP-H19 shRNA retroviral vector (Figure4.8).

The packaging and transduction of pMSCV-Hygro-EGFP-H19shRNA vector was done
following the manufacturer’s recommendations (Clontech, Cat# 634401) in human LLC6p. For negative control, non specific shRNA sequence derived from plant genome and
220

called NDR1 was used. The NDR1shRNA was plant specific (Arabidopsis Thaliana) and
did not match to any human coding region. The cells were subjected to Hygromyocin
selection two days post-viral infection.

For the plasmid shRNA delivery, pRNAT- U6.1/Neo vector was used (GenScript,
cat#SD1211). In this vector system the H19 shRNA was expressed from U6 promoter
and GFP and Neomycin expression are driven by CMV promoter. The pRNATU6.1/Neo H19 shRNA vector was linearized by using a unique ScaI (NEB) restriction
site and transformed into human Hela cell line by using Amaxa™ Nucleofector™machine
(Lonza, USA), Amaxa Cell Nucleofector Kit V (Lonza, USA), program A-030 and
following the manufacturer’s recommendation (Figure4.9).
H19 antisense RNA (asRNA) was amplified from human LLC-6p and sublconed into
SCNT-ES Competent –Tet Regulated retroviral vector. Yellow fluorescent protein (YFP)
sequence was subcloned into the SCNT-ES Competent –Tet Regulated vector
(Figure4.8). The H19shRNA and H19as sequences are based on sequence accession
number NR_002196.1 derived from GenBank. The sequences are provided below:

H19homo, shRNA#1
5’-GGCAGGAGAGTTAGCAAAGGT-3’
H19homo, shRNA#2
5-GAAGCGGGTCTGTTTCTTTAC-3’
H19homa Anti Sense RNA
5’GGCCCGTTCCAGGCAGAAAGAGCAAGAGGGCAGGGAGGGAGCACAGGGGTGGC
221

CAGCGTAGGGTCCAGCACGTGGGGTGGTACCCCAGGCCTGGGTCAGACAGGGAC
ATGGCAGGGGACACAGGACAGAGGGGTCCCCAGCTGCCACCTCACCCACCGCAA
TTCATTTAGTAGCAGGCACAGGGGCAGCTCCGGCACGGCTTTCTCAGGCCTATGC
CGGAGCCTCGAGGGCTGGAGAGCGGGAAGACAGGCAGTGCTCGGGGAGTTGCA
GCAGGACGTCACCAGGAGGGCGAAGCGGCCACGGGAGGGGGGCCCCGGGACAT
TGCGCAGCAAGGAGGCTGCAGGGGCTCGGCCTGCGGGCGCCGGTCCCACGAGG
CACTGCGGCCCAGGGTCTGGTGCGGAGAGGGCCCACAGTGGACTTGGTGACGCT
GTATGCCCTCACCGCTCAGCCCCTGGGGCTGGCTTGGCAGACAGTACAGCATCCA
GGGGAGTCAAGGGCATGGGGCGAGACCAGACTAGGCGAGGCGGGCGGGGCGGA
GTGAATGAGCTCTCAGGAGGGAGGATGGTGCAGGCAGGGGTGAGGAGCGCAGC
GGGCGGCGAGCGGGAGGCACTGGCCTCCAGAGCCCGTGGCCAAGGCGGGCCTC
GCGGGCGGCGACGGAGCCGGGATCGGTGCCTCAGCGTTCGGGCTGGAGACGAG
GCCAGGTCTCCAGCTGGGGTGGACGTGCCCACCAGCTGCCGAAGGCCAAGACGC
CAGGTCCGGTGGACG-3’

Statistics
qRT-PCR experimental data and teratoma quantification data were analyzed by
analysis of variance (ANOVA). Differences of p < 0.05 were considered statistically
significant.
RESULTS AND DISCUSSION

Human parthenogenetic cell line LLC-6p was obtained from International Stem Cells
Corporation, California, USA. LLC-6p cell line was morphologically indistinguishable
222

from normal biparental human ES cell line H1 and also expressed the pluripotency
markers OCT4, SOX2, NANOG, LIN28, and SSEA4(Figure4.1). Both LLC-6p and H1
ES cell lines were able to expand in vitro for prolong period of time without changing
their ES cell morphology. Both H1 and LLC-6p cell line were able to give rise to
teratomas when injected subcutaneously into immune deficient Nude-SCID mice which
consisted of derivatives of all three germ layer – endoderm, ectoderm and mesoderm
(Figure 4.2 and Figure4.3). There was a difference in the endoderm derivatives between
LLC-6p and H1 HES cells teratomas (Figure4.4). Teratomas derived from human H1 ES
cells gave rise to 39% endoderm derivatives compared to only 9% in LLC-6p derived
ones. We did not find skeletal or smooth muscle tissue neither in the H1 ES cells nor in
the LLC-6p ES cells derived teratomas. There was however, a significant amount of
mesoderm-derived connective tissue in the LLC-6p teratomas (58%) compare to the
connective tissue abundance in H1 HES teratomas (3%). There was less cartilage and
adipose tissue, a mesoderm derived lineages, and in the LLC-6p teratomas compare to
H1 HES cells derived teratomas (Figure4.4). It has been reported that mitochondrial
function is essential for proper differentiation of ES cells [173-174]. An increase of
apoptosis in the ES cell culture due to impaired mitochondria function may alter the
developmental potential of the ES cells. We measured apoptosis in H1 and LLC-6p ES
cells by analyzing the Annexin V expression on the cell surface using FACs analysis.
Annexin V is an apoptotic marker for cells in early and late apoptosis. Our results
revealed that there was no statistical significant difference in apoptotic cells expressing
Annexin V between H1 and LLC-6p cells (Figure4.5). Therefore the difference in germ

223

layer derivatives may not be due to differences in apoptotic cells between H1 and LLC6p ES cells during in vivo differentiation.
We also analyzed the expression levels of a set of imprinted genes, paternally imprinted
i.e. maternally expressed genes H19 and UBE3A (Ubiquitin protein ligase E3A) and the
maternally imprinted genes IGF2 (insulin-like growth factor 2 (somatomedin A), DIO3
(deiodinase, iodothyronine, type III) and NDN (Necdin homolog), in human H1 and LLC6p ES cells by qRT-PCR (Figure4.6). Multiple studies as well as data coming from
studies of mouse P-ESCs in our laboratory have revealed that the levels of H19 gene
can influence the differentiation potential of mouse P-ESCs towards endoderm and
mesoderm derivatives. As expected, the expression level of H19 gene was significantly
upregulated in LLC-6p cells (p<0.05) compare to biparental H1 ES cells (Figure4.6). We
also found that IGF2 and DIO3, maternally imprinted genes, were expressed in LLC-6p
ES cells at levels similar (Figure4.6C) or even higher (Figure4.6B) than that of
biparental H1 human ES cells. NDN, another paternally expressed gene, was not
expressed in LLC-6p ES cells at least by the qRT-PCR method used (Figure4.6E).
UBE3A, another maternally expressed genes, known to be imprinted specifically in the
brain, was expressed at similar levels between biparental H1 and parthenogenetic LLC6p ES cells, suggesting that this gene may not be imprinted in ES cells (Figure4.6D).

We next looked at the expression of the imprinted genes tested above in two different
passages of human H1 and LLC-6p ES cells. We did not found a significant difference,
between two different passages of H1 and LLC-6p cell lines, in the expression of the
imprinted genes tested except DIO3 gene whose expression varied statistically between

224

earlier and later passage of human H1 ES cells (Figure 4.7A-D, K-N). We also found
that after five passages the expression of H19 also changes a finding that is in
agreement with reports coming from other groups in which gene expression of imprinted
genes can change during prolonged culture in vitro. We did find alterations in the genes;
DIO3 and H19, in particular. We also looked at the gene expression of the major DNA
methyltransferase enzymes – DNMT1, DNMT3A and DNMT3B in H1 and LLC-6p Es
cells during passaging. There was no difference in the expression of the de novo
DNMT3A and DNMT3B methyl transferase enzymes in H1 human ES cells of different
passages (Figure4.7G, I). However the levels of DNMT1 in H1 ES cells were increasing
with the increase in passage number (Figure4.7E). On the contrary, in two different
passages of LLC-6p ES cells, we observed that the levels of DNMT1 did not differ,
however the expression of the de-novo methyl transferases DNMT3A and DNMT3B had
a statistical significant decrease in later passage compare to early passage (Figure4.7
F, H, J).

In conclusion, we found, H19 gene to be highly over expressed in human LLC-6p cells
compare to normal biparental H1 ES control cells. Our data also suggest that gene
expression profile should be evaluated between cell lines of the same type with no more
than five passages difference. We found that the levels of DNA methyltransferases
change during passage, with DNMT1 levels were increasing in H1 HES cells and
DNMT3A and 3B levels decreasing with increase of the LLC-6p passage number.
Further studies are needed to correlate the changes of expression of DNMT enzymes
with the expression of the imprinted genes in HES and LLC-6p cells.

225

Bisulfate sequencing analysis of the H19 and DIO3 is necessary to evaluate if the
changes in the methylation of the imprinted domains underlies the changes of gene
expression observed in our study and suggested by reports coming from other groups.

Next we wanted to examine if downregulation of H19 can alter the in vivo differentiation
phenotype of human LLC-6p ES cells. We previously found that downregulation of H19
in mouse P-ESCs increase the developmental plasticity of the cells towards mesoderm
and endoderm germ layer derivatives. In order to test that, we employed a small hairpin
(sh) and an anti sense (as) RNA expressing vector system to stably downregulate H19
in LLC-6p ES cells (Figure4.8). We designed a plasmid and a retroviral (pMSCV-Hygro
–EGFP) H19 shRNA expressing retroviral vector system to suppress H19 gene
expression. We also designed an H19 antisense overexpressing retroviral vector
system (SCNT-ES competent Tetracyclin off) which is an alternative way to suppress
H19 gene expression using a long non coding H19 anti sense RNA instead of shRNA
(Figure4.8).
In our preliminary study we utilized the pRNAT-U6.1 H19shRNA expressing vector. The
vector was linearized and transfected into Hela cells by electroporation. We used Hela
cells for our preliminary study because this cell line is very easy to transfect, grow and
propagate (Figure4.9 A, B).
We used NRD1 (Arabidopsis thaliana Non Race-specific Disease resistance 1) cDNA
sequence as a non specific RNA control that was also transfected into Hela cells. Hela
cells transfected with the H19shRNA or Control vector were subjected to 500ug/ml
G418 for 14 days. Total RNA was extracted from the H19shRNA and Control vector cell

226

lines and subjected to polymerase chain reaction to test for suppression of H19 gene
expression. The PCR results clearly revealed that H19 was efficiently down regulated in
the Hela cells transfected with the H19shRNA expressing vector (Figure4.10). Next we
attempted to transfect by electroporation the H19shRNA expressing pRNAT-U6.1
expressing viral vector into LLC-6p ES cells (Figure4.9 C-E). Figure4.9E represents a
green fluorescent expression in LLC-6p cells infected with H19shRNA expressing
vector. Unfortunately after selection with 300-400ug/ml Neomycin we lost all GFP
fluorescent expressing cells i.e. we were not able to get a transgenic cell line stably
expressing H19shRNA. We were also not able to get stable transgenic cell line from the
LLC-6p infected with the H19asRNA expressing retroviral vectors as well. We are
currently optimizing the infection conditions in order to obtain stable transgenic cell lines
and evaluate the developmental potential of LLC-6p cell lines with suppressed H19
expression either using H19shRNA or H19AS RNA expressing vector systems.
Once stable transgenic LLC-6p cell lines are selected, we will proceed evaluating their
differentiation potential by teratoma formation into immune compromised Nude SCID
mice. We hope to observe a change in the in vivo differentiation potential of LLC-6p ES
cells. Furthermore, a microarray analysis will reveal the gene expression changes that
underlie any change in the developmental plasticity of LLC-6p ES cells upon
downregulation of H19 gene.

227

FIGURES AND TABLES

Figure 4.1 Immunocytohemistry for the pluripotency markers NANOG (NAN), LIN28,
SSEA4, SOX2, and OCT4 in human ES cells H1 and in human P-ESCS (LLC-6P). RRed, G-Green.

CONTROL
NAN(R)
LIN28(R)
SSEA4(G)
SOX2(R)
OCT4(G)
BRIGHTFIELD

HUMAN ES CELL (H1)

228

HUMAN PARTHENOTE
ES CELL (H1)

Figure 4.2 Hematoxylin-Eosin (H&E) staining of human HES H1 derived teratomas
indicating the ability of these cells to give rise to all three germ layers when
differentiated in vivo. A and D – squamos epithelium (10X and 40X respectively), B.
Neuroepithelium (10X), E. Primitve neural rosette (40X), C and F- glandular structures
(endoderm) (10X and 40X respectively) G and H- connective tissue (10X and 40X
respectively.

A

B

C

D

E

F

G

H

229

Figure 4.3 Hematoxylin-Eosin (H&E) staining of human LLC-6p cells derived teratomas
indicating the ability of these cells to give rise to all three germ layers when
differentiated in vivo. A Neural Ectoderm (10X), B. Connective tissue (40X), C.
Glandular structure (10X) D. Neural ectoderm (40X).

A

B

C

D

230

Figure 4.4 Quantification (%) of germ layer derivatives: ectoderm, endoderm and
mesoderm in teratomas derived from wild type HES, H1 cells and in human P-ESCs
(LLC-6p). Two LLC-6p and three H1 HES cells derived teratomas were used for
quantification (See Materials and Methods section).

A

Connective
Tissue/Stroma 3%

B

Cartilage13%
Ectoderm
35%

Adipose
10%

Ectoderm
27%
Connective
Tissue/Stroma
58%

Endoderm
9%

Endoderm
39%

Adipose3%
Cartilage- 3%

LLC-6p

HES, H1

231

Figure 4.5 Fluorescent Activated Cell Sorting analysis (FACS) on the apoptotic rate of
HES H1 and human LLC-6p cells measured by Annexin V expression. Three six well
plates from each cell line have been used. The bars represent standard error bars
(P<0.05).

232

Figure 4.6 Quantification of mRNA abundance of the maternally expressed H19 and
UBE3A and the paternally expressed IGF2, DIO3 and NDN in HES H1 and LLC-6p cells
by qRT-PCR. For all qRT-PCR experiments three biological replicates (n=3) in three
technical replicates were used in each run and a P<0.05 has been considered as
statistical significant, unless stated otherwise. The bars represent standard error bars.
All the letters above the error bars represent the difference between samples on the
basis of standard error values (P<0.05).
6
5
4
3
2
1
0

A

B
233

Figure 4.6 (cont’d)

C

D
234

Figure 4.6 (cont’d)

E

235

Figure 4.7 Quantification of mRNA abundance of the maternally expressed H19 (A, B),
UBE3A (K, L) and the paternally expressed IGF2 (C, D), DIO3 (M, N), DNA
Methyltransferase1 (DNMT1) (E, F), DNA Methyltransferase3A (DNMT3A) (G, H) and
DNA Methyltransferase3B (DNMT3B) (I, J) in HES H1 and LLC-6p cells from different
passages by qRT-PCR. The qRT-PCR expression data was normalized towards beta
actin housekeeping gene expression (O). For all qRT-PCR experiments three biological
replicates (n=3) in three technical replicates were used in each run and a P<0.05 has
been considered as statistical significant, unless stated otherwise. The bars represent
standard error bars. All the letters above the error bars represent the difference
between samples on the basis of standard error values (P<0.05).

236

Figure 4.7 (cont’d)

237

Figure 4.7 (cont’d)

238

Figure 4.7 (cont’d)

239

Figure 4.7 (cont’d)

240

Figure 4.7 (cont’d)

241

Figure 4.7 (cont’d)

242

Figure 4.7 (cont’d)

243

Figure 4.7 (cont’d)

Relative mRNA abundance

Beta actin

244

Figure 4.8 Schematic representation of H19shRNA and H19asRNA expressing plasmid
(A) and Retroviral (B-E) vector constructs.

245

Figure 4.9 H19shRNA delivery in Hela cells. A, B, Hela cells transfected with
H19shRNA pRNAT-U6.1, A-bright field, B-GFP Fluorescence. C-E, LLC-6p transfected
with H19shRNA pRNAT-U6.1 vector, C-bright field, D-bright field fluorescence, E-EGFP
fluorescence.

A

B

C

D

E

246

Figure 4.10 PCR-Agarose Gel Electrophoresis on H19 expression in Hela cells
transfected with two different H19shRNAs (human H19shRNA1 and human
H19shRNA2) –Lanes 2-5, and Hela cells transfected with control unspecific shRNA
(lanes 6-9). Lane1, 1kb marker, Lane 10, RT- ; Two biological replicates for each
treatment have been used for detection of H19 expression.

390bp
245bp

RT-

Hela NDR1shRNA,2

Hela NDR1shRNA,2

Hela NDR1shRNA,1

Hela NDR1shRNA,1

Hela H19shRNA,2

Hela H19shRNA,2

Hela H19shRNA,1

Hela H19shRNA,1

247

Table 4.1 Human qPCR Primers
Primer
Name
H19

IGF2
NDN
UBE3A
DIO3
DNMT1
DNMT3A
DNMT3B
β- Actin

Forward

Reverse

CTCGAGGCTCCGGCA
TAG
CCTCACTCCCTTTTCC
ATCACT

Gene bank
Accession
number
CCACCGCAATTCATTTAGT NR_002196.
AGCA
1
TGTCCTCCCCTCCTTTGG NM_000612.
TT
4

TGCACTGTAAATCCTG
AATACTATAATGAC
CACATTCCACGTTAGG
TGACAAA
TCCCCCCACCTCTCTT
TCC
GGCCGCTGCACCGTG
GAGTATGG
CAAGTCCCCATTGGG
TAATAGC
CCAAGCGCCTCAAGA
CAAA
ATGATGGAGTTGAAG
GTAGTT TCGT

GGAGGCAGATGAATGGTT
TCTG
GGGTCTACACCAGATTGC
TCTCTAAT
GCCCCAGGGAGAGAGAA
AAA
CTGGCCGCGGGAGTTGG
TGGTC
GATCTCCAAGTCCCCATC
CA
TTGTTCTCGGCTCTGATCT
TCA
GGCACTCTTCCAGCCTTC
CT

248

NM_002487.
2
NM_130838.
1
NM_001362.
3
NM_001130
823.1
NM_175630.
1
NM_175850.
1
NM_001101.
3

REFERENCES

249

REFERENCES
1.

Norris, H.J., H.J. Zirkin, and W.L. Benson, Immature (malignant) teratoma of the
ovary: a clinical and pathologic study of 58 cases. Cancer, 1976. 37(5): p. 235972.

2.

O'Connor, D.M. and H.J. Norris, The influence of grade on the outcome of stage I
ovarian immature (malignant) teratomas and the reproducibility of grading. Int J
Gynecol Pathol, 1994. 13(4): p. 283-9.

3.

Steeper, T.A. and K. Mukai, Solid ovarian teratomas: an immunocytochemical
study of thirteen cases with clinicopathologic correlation. Pathol Annu, 1984. 19
Pt 1: p. 81-92.

4.

Kono, T., et al., Birth of parthenogenetic mice that can develop to adulthood.
Nature, 2004. 428(6985): p. 860-864.

5.

Sotomaru, Y., et al., Unregulated Expression of the Imprinted Genes H19 and
Igf2r in Mouse Uniparental Fetuses
J. Biol. Chem., 2002. 277(14): p. 12474-12478.
6.

Kono, T., Genomic imprinting is a barrier to parthenogenesis in mammals.
Cytogenet Genome Res, 2006. 113(1-4): p. 31-5.

7.

Kono, T., et al., Paternal dual barrier by Ifg2-H19 and Dlk1-Gtl2 to
parthenogenesis in mice. Ernst Schering Res Found Workshop, 2006(60): p. 2333.

8.

Hikichi, T., et al., Functional full-term placentas formed from parthenogenetic
embryos using serial nuclear transfer. Development, 2010.

9.

Varrault, A., et al., Zac1 Regulates an Imprinted Gene Network Critically Involved
in the Control of Embryonic Growth. Developmental Cell, 2006. 11(5): p. 711722.

250

10.

Fauque, P., et al., Modulation of imprinted gene network in placenta results in
normal development of in vitro manipulated mouse embryos. Hum Mol Genet,
2010. 19(9): p. 1779-90.

11.

Sasaki, H., K. Ishihara, and R. Kato, Mechanisms of Igf2/H19 imprinting: DNA
methylation, chromatin and long-distance gene regulation. J Biochem, 2000.
127(5): p. 711-5.

12.

Allen, N., et al., A functional analysis of imprinting in parthenogenetic embryonic
stem cells. Development, 1994. 120(6): p. 1473-1482.

13.

Horii, T., et al., Loss of genomic imprinting in mouse parthenogenetic embryonic
stem cells. Stem Cells, 2008. 26(1): p. 79-88.

14.

Jiang, H., et al., Activation of paternally expressed imprinted genes in newly
derived germline-competent mouse parthenogenetic embryonic stem cell lines.
Cell Res. 17(9): p. 792-803.

15.

Dean, W., et al., Altered imprinted gene methylation and expression in
completely ES cell-derived mouse fetuses: association with aberrant phenotypes.
Development, 1998. 125(12): p. 2273-2282.

16.

Marina Bibikova, E.C., 1 Bonnie Wu,1 Lixin Zhou,1 Eliza Wickham Garcia,1 Ying
Liu,2,12 Soojung Shin,2,12 Todd W. Plaia,3 Jonathan M. Auerbach,3 Dan E.
Arking,4 Rodolfo Gonzalez,5 Jeremy Crook,6 Bruce Davidson,6 Thomas C.
Schulz,7 Allan Robins,7 Aparna Khanna,8 Peter Sartipy,9 Johan Hyllner,9
Padmavathy Vanguri,10 Smita Savant-Bhonsale,10 Alan K. Smith,11 Aravinda
Chakravarti,4 Anirban Maitra,4 Mahendra Rao,2,12 David L. Barker,1 Jeanne F.
Loring,5 and Jian-Bing Fan1,13, Human embryonic stem cells have a unique
epigenetic signature. Genome Research, 2006. 16(9): p. 1075–1083.

17.

Fujimoto, A., et al., Aberrant genomic imprinting in rhesus monkey embryonic
stem cells. Stem Cells, 2006. 24(3): p. 595-603.

18.

Jagerbauer, E.M., et al., Parthenogenetic stem cells in postnatal mouse
chimeras. Development, 1992. 116(1): p. 95-102.

251

19.

Fundele, R.H., et al., Temporal and spatial selection against parthenogenetic
cells during development of fetal chimeras. Development, 1990. 108(1): p. 203211.

20.

Fundele, R., et al., Systematic elimination of parthenogenetic cells in mouse
chimeras. Development, 1989. 106(1): p. 29-35.

21.

Onodera, Y., et al., Differentiation diversity of mouse parthenogenetic embryonic
stem cells in chimeric mice. Theriogenology.

22.

Yuasa, S., et al., Transient inhibition of BMP signaling by Noggin induces
cardiomyocyte differentiation of mouse embryonic stem cells. Nat Biotechnol,
2005. 23(5): p. 607-11.

23.

Kim, K., et al., Histocompatible embryonic stem cells by parthenogenesis.
Science, 2007. 315(5811): p. 482-6.

24.

Kim, K., et al., Recombination signatures distinguish embryonic stem cells
derived by parthenogenesis and somatic cell nuclear transfer. Cell Stem Cell,
2007. 1(3): p. 346-52.

25.

Durbin, R.M., et al., A map of human genome variation from population-scale
sequencing. Nature, 2010. 467(7319): p. 1061-73.

26.

Sanchez-Pernaute, R., et al., Parthenogenetic dopamine neurons from primate
embryonic stem cells restore function in experimental Parkinson's disease. 2008.
p. 2127-2139.

27.

Sanchez-Pernaute, R., et al., Long-Term Survival of Dopamine Neurons Derived
from Parthenogenetic Primate Embryonic Stem Cells (Cyno-1) After
Transplantation. 2005. p. 914-922.

28.

Ferrari, D., et al., Transplanted dopamine neurons derived from primate ES cells
preferentially innervate DARPP-32 striatal progenitors within the graft. 2006. p.
1885-1896.

252

29.

Tsang, W.P., et al., Oncofetal H19-derived miR-675 regulates tumor suppressor
RB in human colorectal cancer. Carcinogenesis, 2010. 31(3): p. 350-358.

30.

Hikichi, T., et al., Functional full-term placentas formed from parthenogenetic
embryos using serial nuclear transfer. Development, 2010. 137(17): p. 2841-7.

31.

Hikichi, T., et al., Differentiation Potential of Parthenogenetic Embryonic Stem
Cells Is Improved by Nuclear Transfer. Stem Cells, 2007. 25(1): p. 46-53.

32.

Crespo, F.L., et al., Mitochondrial reactive oxygen species mediate
cardiomyocyte formation from embryonic stem cells in high glucose. Stem Cells,
2010. 28(7): p. 1132-42.

33.

Zhu, D.Y., et al., PPAR-beta facilitating maturation of hepatic-like tissue derived
from mouse embryonic stem cells accompanied by mitochondriogenesis and
membrane potential retention. J Cell Biochem, 2010. 109(3): p. 498-508.

253