.84

a?

a!
I

 

3:223)
aria?!“
x 3.54%..
h. “2.13. find.
an»: gunmamfihfi.
.nxtahinn)
.3... 1...!

 

..

.0155)! {III it
u..Iul.l$iOI-.¢$50\(«x
41...? 32.5...

.. Ii . 31.!!!

)1... .71.. £5.52}!- ... $.t‘inn

1;... .3». ;: 51.13.11.133,
v.31. 2... {£012.},

, .4!
.‘lbiz‘blll
$9 .3}! 1.;

:Ig;~..au'.~

g ym3w

 

 

"ES" ‘ LIBRARY
00? Michigan State
' University

 

This is to certify that the
dissertation entitled

TOWARDS RENEWABLE COMMODITY CHEMICALS:
BIOSYNTHESIS OF PHLOROGLUCINOL AND
CHEMOENZYMATIC SYNTHESIS OF CAPROLACTAM

presented by

Brad M Cox

has been accepted towards fulfillment
of the requirements for the

Doctoral degree in Chemistry

 

 

QL fiҤz:.4

 

7 Major Professor’s Signature
Y/ 15/08

Date

 

MSU Is an aflnnafiw—action, equal-opportunity employer

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K'lProlechreleIRC/DateDue.indd

TOWARDS RENEWABLE COMMODITY CHEMICALS: BIOSYNTHESIS OF
PHLOROGLUCINOL AND CHEMOENZY MATIC SYNTHESIS OF CAPROLACT AM

By

Brad M. Cox

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
DOCTOR OF PHILOSPOHY
Department of Chemistry

2008

ABSTRACT

TOWARDS RENEWABLE COMMODITY CHEMICALS: BIOSY NTHESIS OF
PHLOROGLUCINOL AND CHEMOENZY MATIC SYNTHESIS OF CAPROLACT AM

By
Brad M. Cox

In rise of the uncertainty associated with the chemical industries reliance on non-
renewable resources for virtually all commodity chemical manufacture, the research for
sources with renewable feedstocks are of importance. The following research comprises
of chemistry which progresses towards the deviation from a petroleum-based chemical
economy, to one that thrives on starting materials from renewable sources through
utilization of rapid and efficient syntheses dependent upon microbial biocatalysts. Efforts
aimed to biocatalytically produce 1,3 ,5-trihydroxybenzene and an e-caprolactam precursor
from renewable resources at a level with commercial importance. To enhance the viability
of commercial manufacture, following a successful biocatalytic production, efforts
focused on delivering chemicals with the same level and purity to compete with non-
renewable routes.

s-Caprolactam, the monomer for nylon 6, was synthesized from L-B-lysine. As a
renewable feedstock, D-glucose derived L-lysine had been shown to cyclize and deaminate
to form e-caprolactam in previous works. Alternatively, L-fi-lysine was researched for
applicability in an analogous synthesis of e-caprolactam. Under anaerobic conditions,
Clostridium subterminale SB4 degrades L-lysine as a carbon source with two initial
metabolic, amino group isomerizations, to L-B-lysine and then 3,5-diaminohexanoate.
Successful, selective inhibition of the second aminomutase enzyme was achieved through

intense irradiation with light, providing an in viva microbial synthesis of L-B-lysine. The

resulting biosynthetic L—[3-lysine product, ultimately from renewable D-glucose, was
cyclized to B—aminocaprolactam in near quantitative yields by reflux in high temperature
alcohols. Hydrodenitrogenation of B-aminocaprolactam to e-caprolactam was achieved
only in trace amounts.

Phloroglucinol’s vast synthetic utility is overshadowed by the problematic
synthesis, which precludes its use in commodity chemical markets. Phloroglucinol in vivo
biocatalysis, from D-glucose, had been shown previously by heterologous expression of
phloroglucinol synthase (Type III polyketide synthase, pth) from Psuedomonas
fluorescens Pf—S in Escherichia coli. Microbial synthesis of phloroglucinol in a controlled
fermentation vessel was increased to concentrations approaching 5 g/L at 6% yield (mol
phloroglucinol/mo] D-glucose) in fed-batch mode with a l L working volume scale.
Phloroglucinol toxicity is contributive to limited production, leading to an engineered
continuous-extractive, two stage microbial synthesis that afforded concentrations up to 38
g/L at 12% yield (mol phloroglucinol/moi D-glucose). Besides continuous extraction to
alleviate toxicity issues, transcriptome analysis was another avenue of research.
Upregulated genes by transcriptome analysis, along side probable E. coli export
machinery, were researched and manipulated in hopes of generating a phloroglucinol
tolerant host, to no avail. Genetic advancement of the Psuedomonas fluorescens Pf-S
pth gene through codon optimization increased the crude lysate specific activity, from
malonyl CoA to phloroglucinol, two-fold to 0.045 umol phloroglucinol/min/mg protein.
Downstream purification of biocatalytically produced, phloroglucinol had recovery rates
of 91% from production to bottled chemical, that was independently certified to be 99.6%

pure.

 

Copyright by
Brad M. Cox

2008

ACKNOWLEDGMENTS

The research and preparation leading to this dissertation was contributed upon by
many individuals throughout my career at Michigan State University. First and foremost
my appreciation is given to Professor John W. Frost for his unwaivering support of the
research, his criticism and breadth in knowledge of science, and the way he provokes
excitement about experimentation. Another intergral scientist that has helped pave the
way for success has been Dr. Karen M. Draths who offered invaluable suggestions and
given treasured time and effort in my development as a scientist. I would like to share my
thanks with Professors Babak Borhan, Milton R. Smith III, and Gregory L. Baker who
have been my graduate committee advisors throughout my term and have shown interest
and dedication to not only my dissertation, but what it represents. The members and
colleagues within the science confines have been pivotable in learning and coexisting in a
research environment. Thanks to Dr. Jihane Achkar, Diane Alessi, Craig Banotai, Dr. Vu
Bui, Dr. Jiantao Guo, Dr. Chad Hansen, Dr. Wei Nui, Dr. Mapitso Molefe, Dr. Ningqing
Ran, Dr. Heather Steuben, Dr. Dongming Xie, Dr. Jinsong Yang, Dr. William Yang and
other past members whose research or experiences have laid the path for the opportunities
I received and whose direct interactions expanded my knowledge. Dr. Man Kit Lau and
Dr. Justas Jancauskas I would like to thank individually because without their constant
support and friendship this experience would not have been as cherished as it was.
Jennifer Froelich has been an irreplaceable asset in my career and life to which I owe a
lifetime worth of gratitude. Last, but not at all least, are understatedly appreciated John,
Dr. Cheryl and Bryan Cox along with my family and friends who have supported me with

any means DCCCSSEII')’ .

TABLE OF CONTENTS

Chapter ONE ............................................................................................................. 1
Introduction ........................................................................................................... l
Bioeconomy ...................................................................................................... 1
Biocatalysis ..................................................................................................... 23
Chemical manufacture .................................................................................... 28
Hydroxy aromatics .......................................................................................... 32
CHAPTER ONE REFERENCE ......................................................................... 43
Chapter TWO .......................................................................................................... 50
L—lysine Derived s-Caprolactam ......................................................................... 50
Introduction ..................................................................................................... 50
Results ............................................................................................................. 61
Discussion ....................................................................................................... 74
CHAPTER TWO REFERENCE ........................................................................ 76
Chapter THREE ...................................................................................................... 78
D-Glucose Derived Phloroglucinol ..................................................................... 78
Introduction ..................................................................................................... 78
Results ............................................................................................................. 94
Discussion ..................................................................................................... 133
CHAPTER THREE REFERENCE .................................................................. 137
Chapter FOUR ...................................................................................................... 139
Downstream Processing and Chemistry of Phloroglucinol .............................. 139
Results ........................................................................................................... 145
Discussion ..................................................................................................... 160
CHAPTER FOUR REFERENCE ..................................................................... 162
Chapter FIVE ........................................................................................................ 163
Experimental ..................................................................................................... 163
Reagents and solvents ................................................................................... 163
Chromatography ........................................................................................... 164
Spectroscopic and analytical measurements ................................................. I64
Bacterial strains, plasmids, primers and gene synthesis ............................... 166
Storage of microbial strains and plasmids .................................................... 167
Culturing of Clostridium subterminale ......................................................... 167
Intact cell bioconversion of L-lysine ............................................................ 168
Purification of L-B-lysine ............................................................................. I69
Deamination of L-B-lysine ............................................................................ 169

vi

Cyclization of L-lysine to a-Amino-caprolactam. ....................................... 170

Chemical L-[S-Lysine synthesis. ................................................................... 171
In vitro enzyme assays preparation ............................................................... 172
Plasmids ........................................................................................................ 172
Comprehensive reference list of strains and plasmids .................................. 179
In house optimized pth sequence ............................................................... 180
DNA2.0 gene designer optimized pth sequence ........................................ 181
Culture mediums ........................................................................................... 182
Fed-batch microbial synthesis ....................................................................... 183
Process description of the biosynthesis of phloroglucinol ............................ 185
Phloroglucinol strain prior to microbial synthesis supplemental .................. 186
Phloroglucinol Extraction for phloroglucinol biosynthesis .......................... 189
Overall Phloroglucinol Process Schematic ................................................... 195
Multiple-stage Fed-batch Extractive Microbial synthesis ............................ 198
Analysis of microbial synthesis broth ........................................................... 199
Genetic manipulations .................................................................................. 200
Wanner type gene inactivation technique ..................................................... 211
Transcriptome analysis ................................................................................. 215
Phloroglucinol reduction methodology ......................................................... 251
CHAPTER FIVE REFERENCE ...................................................................... 252

vii

Table 1.
Table 2.
Table 3.
Table 4.

Table 5.

strain ......

LIST OF TABLES

Clostridium subterminale SB4 bioconversion of L—lysine to L-[3-lysine. .......... 63
Procedural outline with time allotments for bioconversion to L-B-lysine. .......... 66
Procedural outline with time allotments for purification of L-B-lysine ............... 67
Hydrodenitrogenation of acyclic L-B-lysine and B-aminocaprolactam ............... 71

Upregulated genes found by transcriptome analysis in phloroglucinol producing
............................................................................................................................ 105

Table 6. Corresponding up-regulation twofold and greater in phloroglucinol producing and
phloroglucinol added transcriptome analyses. .................................................................. 106

Table 7. Corresponding up-regulation of transport or membrane protein encoding genes
fourfold in phloroglucinol producing and phloroglucinol added transcriptome analyses.109

Table 8.

Table 9.

Table 10.
Table 11.
Table 12.
Table 13.
Table 14.
Table 15.
Table 16.

Table 17.

ooooooooooooooo

Table 18.
Table 19.
Table 20.

Table 21.

Phosphate elution of phloroglucinol from anion exchange resin. ..................... 147
Relative counterion selectivity for AG 1 anion exchange resin. ....................... 149
Binding efficiency comparison of Dowex 1. ................................................... 150
Elution effects of temperature and ionic strength ............................................ 151
Cooperative ionic strength and free proton dependence elution ...................... 154
Recrystallization of Authentic phloroglucinol ................................................. 155
Phloroglucinol producing transcriptome analysis: Upregulated at least 4x. ...219
Phloroglucinol producing transcriptome analysis: Upregulated 2-4x. ............ 220
Phloroglucinol producing transcriptome analysis: Downregulated 2-4x. ....... 221

Phloroglucinol producing transcriptome analysis: Downregulated at least 4x.

............................................................................................................................ 222
Membrane or transport transcriptome gene list: Upregulated at least 4x. ....... 223
Membrane or transport transcriptome gene list: Upregulated 2-4x. ................ 224

Membrane or transport transcriptome gene list: Downregulated at least 4x. ..225

Membrane or transport transcriptome gene list: Downregulated 2-4x. ........... 226

viii

 

 

Table 22.
Table 23.
Table 24.
Table 25.
Table 26.
Table 27.

Table 28.

Total transcriptome gene list: Downregulated at least 4x ................................ 227
Total transcriptome gene list: Downregulated 2-4x. ....................................... 229
Total transcriptome gene list: Upregulated 2—4x. ............................................ 236
Total transcriptome gene list: Upregulated at least 4x. ................................... 241

Comparitive transcriptome membrane or transport gene list: Upregulated ..... 245
Comparitive transcriptome cellular gene list: Upregulated ............................. 246

Comparitive transcriptome total gene list: Downregulated ............................. 249

Figure 1.
Figure 2.
Figure 3.
Figure 4.
Figure 5.
Figure 6.
Figure 7.
Figure 8.
Figure 9.

Figure 10

Figure 11.
Figure 12.
Figure 13.
Figure 14.
Figure 15.
Figure 16.
Figure 17.
Figure 18.
Figure 19.

Figure 20.

Figure 21
Figure 22

Figure 23

LIST OF FIGURES

Worldwide energy consumption sources .............................................................. 2
Global carbon emissions from fossil fuels. .......................................................... 3
Miscanthus growth after 1 year. ......................................................................... 10
Reduction in cost for various technological advances. ...................................... 16
Current capabilities of the biofuel production process ....................................... 18
Future capabilities of the biofuel production process ......................................... 19
Major products of aromatic feedstocks. ............................................................. 31
Shikimate pathway for aromatic amino acid synthesis ...................................... 33
Hydroxy aromatics. ............................................................................................ 34
. Phenol and catechol current and microbial manufacture ................................. 35
Hydroquinone current and microbial manufacture ........................................... 36
Pyrogallol current and microbial manufacture ................................................. 38
Phloroglucinol and resorcinol current and microbial manufacture .................. 39
Proposed polyhydroxyaromatic synthesis from a renewable source ................ 41
Syntheses of s-caprolactam from 1,3-butadiene .............................................. 52
Current and biobased method of manufacture of e-caprolactam ...................... 53
e-Caprolactam from L-lysine. .......................................................................... 54
Potential mechanisms for hydrodenitrogenation of a—aminocaprolactam. ...... 55
Relative cyclizations of amino acid precursors. ............................................... 56
Degradation of L-lysine in Clostridium subterminale ...................................... 57
. L-lysine—2,3-aminomutase active site AdoMet generation mechanism. ........... 58
. L-lysine—2,3-aminomutase reaction mechanism ................................................ 59
. Arndt-Eistert homologation of L-ornithine yielding L—B—lysine. ..................... 61

Figure 24.
Figure 25.
Figure 26.
Figure 27.
Figure 28.
Figure 29.
Figure 30.
Figure 31.
Figure 32.
Figure 33.
Figure 34.
Figure 35.
Figure 36.

Figure 37.
synthesis.

Figure 38.
synthesis.

Figure 39.
Figure 40.
Figure 41.

Figure 42.
profile. .....

Figure 43.
profile. .....

Figure 44.
profile. .....

Figure 45.

Cyclodehydration of L-B-lysine. ...................................................................... 69
L-B-lysine to pyrollidine adaptation from L-lysine to pipecolinic acid. .......... 73
Current manufacture of TATB ......................................................................... 78
Current manufacture of phloroglucinol ............................................................ 79
Synthesis of trimethoxybenzene from glucose. ................................................ 80
Potential polymer applications of phloroglucinol. ........................................... 81
Phloroglucinol from TAL, TNT and glucose. .................................................. 82
Derivatized phloroglucinol biomolecules with reported biological activity. ...83
Biosyntheses of TAL, phloroglucinol and diacetylphloroglucinol. ................. 84
Type I polyketide synthase depiction. .............................................................. 86
Catalytic triad and priming Pth mechanism. ................................................. 88
Polyketide ring closing mechanism. ................................................................. 89
Comparative fed-batch phloroglucinol microbial synthesis of E. coli. ............ 90
Schematic diagram of fed-batch, in situ resin based extractive microbial
............................................................................................................................ 91
Schematic diagram of two-stage, fed-batch, in situ extractive microbial
............................................................................................................................ 93
Phloroglucinol toxicity screening of W31 lOserA(DE3)/pJA3.131A ............... 95
E. coli phloroglucinol production from microbial synthesis. ........................... 96
E. coli phloroglucinol fed-batch extractive microbial synthesis profile ........... 96
E. coli phloroglucinol single stage fed-batch extractive microbial synthesis
............................................................................................................................ 97
E. coli phloroglucinol two stage fed-batch extractive microbial synthesis
............................................................................................................................ 97
E. coli phloroglucinol five stage fed-batch extractive microbial synthesis
............................................................................................................................ 98
Ideology behind use of transcriptome analysis ................................................ 99

xi

 

Figure 46. Affymetrix genechip microarray technology ................................................. 100
Figure 47. Transcriptome analysis of E. coli after addition of phloroglucinol ................ 101
Figure 48. Plasmids pJA3.l31A and pBC1.146. ............................................................. 102
Figure 49. Transcriptome analysis of induced phloroglucinol producing E. coli ............ 103
Figure 50. Corresponding up-regulation twofold and greater in phloroglucinol producing

and phloroglucinol added transcriptome analyses. ........................................................... 106
Figure 51. Corresponding up-regulation of transport or membrane protein encoding genes

fourfold in phloroglucinol producing and phloroglucinol added transcriptome analyses.109

Figure 52. Sensitivity experiments of gene deletion, phloroglucinol producing strains .111
Figure 53. Controlled insertion of the T7 pth genetic region into pKD3 ...................... l 13
Figure 54. Wanner—type insertion of T7 pth into the lacZ orf on the chromosome of E.
coli W3110(DE3). ............................................................................................................. 114
Figure 55. Construction of plasmid pBC2.179 en route to pBC2.187 ............................. 117
Figure 56. Construction of plasmid pBC2.187 ................................................................ l 18
Figure 57. SDS-PAGE analysis of BL215erA(DE3)/pBC2.187 ...................................... 120
Figure 58. SDS-PAGE protein solubility analysis of BLZISerA(DE3)/pBC2.187 ......... 121
Figure 59. Codon optimization for expression of P. fluoroscens Pf-5 pth in E. coli.... 123
Figure 60. Construction of plasmid pBC2.212 en route to pBC2.219 ............................. 124
Figure 61. Construction of plasmid pBC2.219. ............................................................... 125
Figure 62. Specific activity comparison for induction time and temperature .................. 126
Figure 63. Construction of plasmid pBC2.252 en route to pBC2.257 ............................. 127
Figure 64. Construction of plasmid pBC2.257. ............................................................... 128
Figure 65. Construction of plasmid pBC2.271 en route to pBC2.274 ............................. 130
Figure 66. Construction of plasmid pBC2.274. ............................................................... 131
Figure 67. Yeast extract supplementation effect on microbial synthesis ......................... 132
Figure 68. Crude lysate specific activity comparison of wild-type, in house optimized,
and DNA2.0 optimized pth with and without supplementation ..................................... I33

xii

Figure 69. Keto—enol chemistry of phloroglucinol. ......................................................... 140
Figure 70. pH dependent equilibration of tautomers. ...................................................... 141
Figure 71. Phloroglucinol reduction to resorcinol. .......................................................... 141
Figure 72. Catalytic deoxygenation reactions of polyhydroxyarimatics. ........................ 142
Figure 73. Schematic diagram of in situ resin based extraction. ..................................... 144
Figure 74. Density effect on elution. ............................................................................... 153
Figure 75. Downstream processing for phloroglucinol production. ................................ 156
Figure 76. Phloroglucinol process from biosynthesis to product isolation ...................... 157
Figure 77. Pretreatments and hydrogenations of phloroglucinol. .................................... 159
Figure 78. Schematic diagram of a two-stage continuous extractive microbial synthesis.

........................................................................................................................................... 198
Figure 79. Gene knock-out strategy. ................................................................................ 212

xiii

AFEX
AP

AP
ATP
bp
BSTFA
CIAP

Cm

Cm

D.O.
DTT
Flp

FRT

GC

HPLC
IPTG

Km
KanR

kb

kg

LIST OF ABBREVIATIONS

Ammonia fiber expansion
ampicillin
ampicillin resistance gene

adenosine triphosphate

base pair

N ,0-bis(trimethylsilyl)trifluor0acetamide
calf intestinal alkaline phosphatase

chloramphenicol

chloramphenicol resistance gene

dissolved oxygen

dithiothreitol

flipase

flipase recognition target sequence

gas chromatography

hour

high performance liquid chromatography
isopropyl B-D-thiogalactopyranoside

kanamycin

kanamycin resistance gene

kilobase

kilogram

xiv

LB

mg
mL

uL
mM
14M
min
mRNA
NMR
OD
OOMT
ORF
PCR
pfu

PG
PID
POMT
PPm
psi
RBS

Luria-Bertani medium
molar

milligram

milliliter

microliter

millimolar

micromolar

minute

messenger RNA

nuclear magnetic resonance
opficaldenshy

orcinol o-methyl transferase
open reading frame
polymerase chain reaction
plaque forming units
phloroglucinol
proportional-integral-derivative
phloroglucinol o-methyl transferase
parts per million

pounds per square inch
ribosome binding site
revolutions per minute

room temperature

XV

SAM

SDS
SDS-PAGE
tRNA

TMS

TSP

UV

Vmax

yr

S-adenosylmethionine

sodium dodecyl sulfate

SDS polyacrylamide gel electrophoresis
transfer RNA

trimethylsilyl

sodium 3-(trimethylsilyl)pr0pionic-2,2,3,3-d4
ultraviolet

maximal velocity

year

xvi

WE

Introduction

Bioeconomy

Eyes have been widened and minds are realizing the detriment humans have
caused to this Earth. In a closed system in which epitomizes the Earth, resources are
limited and wastes are accumulated. Education, awareness and action will determine not
only the lives of 6.7 billion, but the livelihood of one planet. Even though population and
greenhouse gases are on the rise with average temperatures and sea levels following suit,
there is some light in renewable trends and investment that will allow for a more

sustainable future. In 2006 renewable sources accounted for 18% of the energy

consumption worldwide and is broken down into the sectors outlined in (Figure 1).1 More

than $100 billion were devoted to renewable energy assets, manufacturing, research and

development with growth in renewable technologies and industries of 20-60% yearly. 65

countries have goals for a sustainable future and are Iegislating towards these goals.l
Sources of carbon for manufacturing feedstocks and their uses in chemical

production spawn emissions that contribute to global warming. The greenhouse gases role

are commonly misunderstood because of the misnomering analogy of what happens

realistically in greenhouses.

RENEWABLE
ENERGY 18%

LARGE

7 V. HYDROPOWER
NUCLEAR 3 , < 17%

7%

 

POWER

\ GENERATION 4%

\ BIOFUEI. 1%

Figure 1. Worldwide energy consumption sources.

fossil fuels = petroleum and coal based: nuclear energy = splitting or fission of atoms:
biomass traditionally = unprocessed agricultural waste, forestry product waste, collected
fuel wood and animal dung that is burned: modern biomass = biomass co—generation,
gasification, anaerobic digestion and liquid biofuels: hydropower uses gravity driven
water flow to generate electricity: hot water = solar heated water from rooftop panels or
geothermal avenues: power generation = electricity primarily used from wind turbines.
The higher energy rays emitted from the sun are absorbed by the surface, dampened and
irradiated back where molecules that can absorb the energy, mostly in the form of infrared
light, that keeps the energy in our atmosphere. Fortunately nitrogen and oxygen do not

readily absorb infrared light whereas water vapor, methane, carbon dioxide, ozone and

nitrous oxide do, contributing to global warming. Humans are directly involved in the
spike of atmospheric C02 through burning of fossil fuels and deforestation. The carbon

emission forms are outlined in (Figure 2).

1 Global Fossil Carbon Emissions

 
 
  
   

r. ........................................................................... 6000
l — Total
i. —— Petroleum ................... - .................. 5000
—— Coal
—— Natural Gas

—-- — Cement Production

Million Metric Tons of Carbon /Year

 

Figure 2. Global carbon emissions from fossil fuels.2

Commonly illustrated C02 emissions graphs indicative from the times of the pre-
industrial era depict drastic trends in C02 production as in (Figure 2), and sometimes
conveniently or not, leave out graphs that perceive a shift in C02 emissions that seem to

peak every 100,000 years .3

Nature has had to attend with volcanic eruptions that have sent many greenhouse
gases into the atmosphere, but until the last 150 years have unnatural sources been
partially to blame. If as a society we can become closer to a carbon neutral lifestyle the

Earth may reduce atmospheric greenhouse gases like it has for the last few hundred

thousand years .3

Nevertheless, West Antarctica and the Antarctic Peninsula lost approximately 200

billion metric tons of ice to the sea in 2006 alone.4 That is enough drinking water for the
UK for 50 years or enough to raise the entire ocean 0.5 mm. The temperature of the

Earth’s surface, at current rate, will rise 3.2 °F every century supported by the fact that the

top ten warmest years have occurred since 1990.5 The answer to decrease global warming
trends in the immediate future is to stop producing as much greenhouse gases and try to
sequester what is already out there.

A lesson on efficiency can be taken from Brazil’s bio-fuel market that uses
streamlined processes that utilize every aspect of production wastes, offering an insight to
how near perfect a process can be. Bioethanol, a product in the US currently produced by
fermenting the sugars found in corn, drastically wastes product considering only about

30% of the kernel’s mass is used of the entire plant, besides some of the stover dried for

animal feed, where Brazil grows sugarcane and wastes almost none.6 Trucks, fueled by
biodiesel from neighboring plants, bring in sugarcane that is stripped of any leaves and
washed. The residual and treated process water from the plant are collected and used for
irrigation. Five steam-powered crushers will then shred the cane to access the syrup. The
syrup is concentrated, crystallized and centrifugated leaving behind pure white granular
sugar. The Santa Elisa plant in Brazil produces 475,000 metric tons of sugar per year,
which leaves in l-metric-ton sacks.

To make ethanol, a crude stream of the cane syrup from the crushers is diluted to
a 20% sugar solution and pumped into large fermentation vats directly without the use of
enzymes. Over 8 hours, yeasts ferment the sugar to a 6 to 10% ethanolic, aqueous

solution. The yeasts are then removed and either recycled to ferment more sugar or dried

4

and sold as animal feed. The ethanol is distilled and dehydrated in stages to greater than
99% purity, denatured, loaded into biodiesel driven tanker trucks and delivered to fuel

distributors.

The fibrous, grass—like fluff left over from the sugarcane crusher is sent along on

conveyers to furnaces where it is burned to produce steam (which may have a particulate

inhalation health risk7). The steam, in turn, powers the crushers and other equipment at
the facility and turns a set of generators to make electricity. While bioethanol plants in the
US typically only consume electricity, the Santa Elisa plant in Brazil generates 60 MW of
electricity. About 19 MW is used to power the plant while the remainder is sold to power

local towns. The residual ash from the furnaces is spent on sugarcane fields supplying the

sole fertilizer. Although burning and fermentation exhausts C02, given that all machinery

run on the biomass derived fuels and the plant runs on and diverts electricity, the entire

process must have no net C02 production because the sugars fermented are in essence

sequestered C02. Plant matter is composed of more than 1/3 cellulose, which is the

largest organic matter on the planet and some plants (i.e. cotton) contain over 90%

cellulose. Cellulose is a biopolymer made from the monomer D—glucose, which is

constructed during photosynthesis in plants. The overall reaction of C02 sequestration in
the Calvin cycle is 6COZ + 12HZO + light —-> D-glucose + 602 + 6HZO. If the Brazilian
plant is completely run on the products of their crop, all the C02 that is released during

ethanol production with inclusion of C02 production from the burning of the ethanol fuel

in vehicles, the net C02 production is at worst a fraction of what was sustainably captured

in the short time-frame allowed for the growth of the plant.

The shift from fossil fuels to renewables is not a one-man show. A diversity of
sources will need development to steer society away from petroleum, curb greenhouse gas
production and not derail into a struggle for survival on a desolate planet. Building 1.5
million wind turbines could satisfy 40% of the Earth’s energy needs, 250,000 acres of US
land in the southwest could be used for solar panels harnessing as little as 2.5% of the

Btu’s that are received in that area to satisfy our electricity needs and biomass could

. 8 . . . .
drastically cut our need for fuels. With the boom in renewable energies, caution must be

constant as recently green marketing processes offer carbon off-sets that can be somewhat

deceptive.9
When government gets involved in renewable energy bills, linking energies and

climate change with mandated reductions in emissions or fuel usage etc. the US is at much

debate.10 With expectations for drastic change in limited time the US inevitably looks at
high costs for change through many avenues. High costs to corporate America can lead to
even more jobs leaving the US for countries whose regulation are not as strict. For
example, energy legislature enacted towards the end of 2007 requires the production of 36
billion gallons of fuel ethanol by the US in 2022 with 15 billion from corn and 21 billion
from cellulosic feedstock. The US burns about 140 billion gallons of gasoline a year and

about 7 billion gallons of ethanol are produced from corn with no commercial processes in

Q

cellulosic ethanol.ll This initial deadline, though needed, may have the ethical issue of

diverting a food source towards fuels. The cost of corn has almost tripled in the last five

years to just less than $6/bushel due to ethanol fermentation and the prices of some foods
related to this animal feedstock have already shown reflection. The immediate threat is
realized, but may be curbed by the decrease of shipping costs that are eminent from the
use of ethanol, that can drop the price of a gallon of bioethanol to a projected $1 .50/ gallon.
In many of the following arguments it is important to note that it is not fair to equate one
gallon of ethanol to one gallon of gasoline though in today’s engines, because on average
ethanol only possesses that energy output equivalent of 60-70% that gasoline does. This
offset in price of corn to ethanol, instead of as a source for food and the evolution of
engines tuned for ethanol burning will only be determined in the future.

Ethanol is not only envisioned from fermentation from sugars, but also syngas.
Syngas is a hydrogen and carbon monoxide mixture currently produced from steam

reforming natural gas or the gasification of coal. Researchers are now looking towards

pyrolysis of biomass to make syngas.12 Coskata, a start up biofuels company funded
partially by Khosla ventures, announced at the Detroit Auto Show that their ethanol

production from syngas, with a delivery cost of $1.00 per gallon, would be cheaper
compared to the $2.00 per gallon selling price at wholesale.13 Coskata claims a
production method that uses syngas for a fermentation feed that could be derived from
burning tires and municiple or agricultural wastes.

At the forefront of biofuels debates and discussions are our own Michigan State
University’s Bruce E. Dale alongside David Pimentel from Cornell respectively as the pro
and con.14 Dale points out that two ideas are crucial in any talk concerning petroleum

replacement, deviation from dependence on resources from mostly third world countries

and climate security. He continues to show decreases of greenhouse gases and energy

inputs to produce 1 MJ of ethanol even now from corn, let alone cellulosic sources,
compared to production of 1 MJ gasoline. The processes for capture of D-glucose are
rapidly improving which would even further detract people from use of gasoline.
Pimentel exhaustively talks about the point that with all the available resources that only a
fraction of US consumption is possible when we would be at maximum ethanol
production from corn and that food prices will increase while other resources such as
fertilizers and irrigation water will be problematic. Pimentel argues that the energy input
to make ethanol is 40% more than what it supplies when you factor in farm labor,
machinery, genetically engineered seed, irrigation and processing equipment. There is
also debate on how much by-product 10-60% can be used for cattle feed. Pimentel then

states about the increase in the prices of meats, eggs and milk from food diversion and the

extra C02 produced during fermentation. Dale fires back refuting Pimentels flawed

approach which relies on energy equalities of coal, gasoline and ethanol and that another
overlooked view of resources would be the cessation of military assets guarding our oil
pipelines and reserves. Dale mentions that Pimentel’s views on how labor intensive
cellulosic ethanol production is shared only by few and that leftover biomass could be
used to steam power electricity production cutting costs further, while significant
increases in switch-grass yields per acre are probable for land usage. In a last point by
Dale, he mentions how wealth could be brought to rural communities because cellulosic
material would be bulky enough to entice factories to be set-up close to the growth source.

Fact is, renewable energy sources are becoming more attractive, evident from

. . 15 . . . . . .
Increases in renewables research funds , the decline of crude Oil in VISCOSIIy, (which

limits the quantity of unreformed lighter fractions) and higher levels of sulfur that need to

be removed. The desulfurization process may have some new insights that help with the

discovery that large aromatics may be blocking catalyst active sites in which chemists

could design better catalysts.16 The heavier fractions will take in even more energy to
produce than what the finished product will give (gasoline production even now is slightly
energy negative).

Perennial grasses are one of the frontrunners for cellulosic energy sources (Figure

3). A recent study indicates that more than enough cellulosic ethanol could be produced

. 7
on a per-acre basrs to offset the energy needed to grow and convert the grass to fuels.l
Advantages for grasses include that they are fast-growing, hearty, tall, pest resistant and
can grow on marginal land or cooler climates with extremely limited fertilizers. Over a

period of five years Vogel from the University of Nebraska has harvested 10 farm sites in

fields up to 23 acres in size keeping track of all costs associated.18 On average 320
gallons of fuel ethanol would have been produced per acre. Vogel states an energy gain of
540% energy compared to the fossil energy required to produce ethanol. The current
switchgrass crop yields were achieved in the same years, in the same states, as corn
devoted to biofuels. With further increases in switchgrass genetics and growth conditions
they will drastically overtake current corn practices in usable plant mass. Critics are only
concerned with some of the calculations used, based upon theory and not actual data in the

conversion of cellulosic material to glucose.

 

Figure 3. Miscanthus growth after 1 year.19

Another sought after source to cellulosic ethanol are softwood trees and by-product
waste from forestation. These feedstocks can be used similarly to the plans for
switchgrass with the enzymatic breakdown to sugars to be used in fermentation. Trees do
have the added advantage of cellulose density that would aid in transportation and
presumably in total acreage devoted to biofuels. The downfall to use of varying
feedstocks can be the ideology that optimal enzymes can mostly be efficient on one type
of feedstock. Converting biomass into syngas could be beneficial because one production
plant could take in limitless types of feedstock wastes of not only trees, but vegetation and
other wastes as well. Range Fuels, another Khosla Ventures investment, is breaking

ground on a cellulosic ethanol production plant in Soperton, Georgia.20 Range Fuels is

10

invested in thermochemical breakdown of biomass that uses gasification wherein heat and
oxygen or steam is used to break down biomass to syngas. Use of established Fischer-
Tropsch type chemistries would then be conducted for fuel production. ConocoPhillips,
mostly recognized as working on the biochemical conversion to sugars, recently has
dumped some money into thermochemical processing and are on the verge of
commercializing thermal processes to convert soybean oil or animal fats into bio-diesel
and propane. Thermochemical processes are not a complete answer though, because it
was estimated that all of forestry in Georgia could supply 2 billion gallons of ethanol per
year, a far cry from the 140 billion gallons of gasoline consumed every year. It is facile to
think that both fermentative and thermochemical processes could be synergistic.

Other renewable sources of energy exist that have followers. The current US

consumption of hydrogen gas is about 50 million metric tons, mostly used for the

production of ammonia fertilizers and chemical refining?! Most hydrogen is produced by
steam reforming methane or lighter hydrocarbons, with smaller fractions made from coal
and even less from electrolysis. Hydrogen can be produced biologically by algal and

cyanobacterial photolysis of water, fermentation of acidogenic bacteria and thermophilic

organisms.22 At current technology hydrogen can be produced at about four times the cost

of gasoline23 and when compressed to 10,000 psi hydrogen occupies 8 x the equivalent

volume of a gallon of gasoline (it is disregarded that the energy given from one gallon of

gas would not equal one gallon of compressed hydrogen at 10,000 psi).24 Liquification is

too energy intensive to maintain at -253 °C. Owing primarily to liquifaction difficulties

. . . . . 25 . . .
and storage, most hydrogen 1S produced on Slte for consumption wrth options , feasrbility

ll

and delivery discussed elsewhere.26 Solid supports for hydrogen storage seem to be a

plausible answer to shipping and compression issues if cost and safety can be shown.27
Research for the hydrogen economy is strong owing to the benefit of use in every sector
where energy is required, that it can be produced from multiple sources, that it could be
stored almost indefinitely (ethanol etc. absorb water) and has the sole by—product of water
upon burning for energy.

George Olah is one of the leaders in a methanol economy.28 Methanol has
chemistries to syngas, formaldehyde, acetic acid, olefins and dimethyl ether (possibly a
cleaner burning diesel). Two of the largest chemical building blocks in propylene and
ethylene can be derived from methanol. Coal-gasification is currently being investigated

for large-scale production of methanol in the US, China and India which house more than
half of the world’s recoverable coal .29 Biobased methanol was used as a fuel in Germany

during World War II found by the thermochemical breakdown of wood (to harvest wood

alcohol).22 A biomass to biomethanol process using bacteria with sugar beet pulp as

substrate was researched as well.30 Dry sugar beet pulp contains about 60% (w/w) pectin
of which contains methyl esters. Overexpressing pectin methylesterase from Erwinia
chrysanthemi in E. coli produced methanol. Methanol can be used similarly to ethanol

and has been used in Indy Racing League cars, which just recently moved to ethanol for

promotion (and that the fuel is given at no cost).31 Methanol has the added benefit to be
used in fuel cells generating hydrogen, a concept tested in a cross-country drive by

Daimler Chrysler’s NECAR 5. A promising thought related to the methanol economy is

12

the recycling of C02 or oxidation of methane, especially what is burned off of oil wells or
chemical flue gases, into methanol for use in fuels.
Often wrongly described as a “new fuel”, biobutanol has been around since

2 . . .
1916.2 Butanol is looked to have value as diesel and kerosene replacements, a Silage

preserver, biocides and a C4 chemical building block. Butanol has potential to be a fuel
with advantages over ethanol in energy and blending with gasoline owing to ethanols
enhanced ability to increase partitioning when wet. It was demonstrated in 2006 that

butanol can be used in 100% to power unmodified 4-cycle ignition engines, blended at

3233

30% in diesel engines and 20% (with kerosene) in a jet turbine engine.‘ Clostridium

acetobutylicum was the first identified butanol producing strain, which was a no value by-

product, along side ethanol, in the intended manufacture of acetone in World War I.

Acetone was used in the production of cordite, a cartridge and shell propellant.22 A

modern biobutanol, fermentation facility is being built by BP and DuPont that will likely

heterologously express the clostridial genes responsible for butanol production in a more
. 34 . . . .
tolerant host organism. Initially the renewable feedstock Will be the preViously

. 33 . . . .
mentioned sugar beets. The economic aspects of butanol and other options for microbial

. 35
hosts are discussed elsewhere.

Bioethano/ process

The bioethanol process will ultimately be the driving force for other microbial

syntheses as technology for D-glucose capture from biomass is greatly improved. In the

13

long run, biofuels research should further decrease the already low price of D-glucose.

The largest production cost reductions of ethanol in the immediate future will rely on

technological advances in the realm of converting biomass into fermentable sugars.36
According to the cited literature corn ethanol, in terms of equivalent energy output, is
already produced cheaper than petroleum feedstock gasoline and cellulosic ethanol could
more than halve the corn ethanol price with added benefits of land used for growth,
fertilizers and other benefits discussed previously. Feasible land usage for biomass
cultivation is reasonable and fermentation by ethanologenic yeast strains, Zymomonas
mobilis, Klebsiella oxytoca, and E. coli are mainstream.

Biomass processing in microbial organisms involves four key steps: the production
of saccharolytic enzymes (cellulases and hemicelluases), hydrolysis of pretreated biomass
to sugars, fermentation of hexose sugars and the fermentation of pentose sugars. Some

envision, and would make a stone-clad case for a sustainable and highly lucrative process,

. . . . . . 37
a Single microbe that is capable of all four steps termed consolidated bioprocessmg.
Cellulase, an enzyme concoction required for the hydrolysis of cellulose, is a

target of the US Department of Energy. The cost estimate for cellulase is about 30 to 50
cents per gallon of the ethanol cost.38 Currently most cellulases are produced by

Trichoderma and Aspergillus species.39 Cellulases are already used in the cotton industry
as a softening agent and in denim finishing; in detergents for color care; cleaning; mashing
in the food industry; and in the pulp and paper industries for de—inking, drainage
improvement and fiber modification.40 The widely accepted mechanism involves the

synergistic degradation of cellulose by endogluconase, exogluconase or cellobiohydrolase

and B-glucosidase. Endogluconases hydrolyze accessible intramolecular B-l,4-glucosidic

I4

bonds to free chain ends, exoglucanases cleave cellulose chains at the end to produce
cellobiose and B-glucosidases break down cellobiose to glucose. It is dangerous to
compare activity correlation due to heterogeneity of biomass, even from the same source
with the same pretreatment, the complex dynamic interaction between the three separable
enzymes required and the insoluble biomass. Two basic results are being followed for
improvement through rational design and directed evolution with additional comments on
assay conditions in reference 40.

A percentage of influence of biological improvements on the ethanol process is
presented in (Figure 4). It is important to note that ease of percentage gain is not
correlated to ease of success. It is most likely easier to get two-fold improvement in
cellulase activity and gain the 13% reduction in cost than to have a consolidated
bioprocess that would likely take much more effort to achieve with the 41% reduction in

process COSt .

15

 

Increase hydrolysis yield

Halve cellulase loading

Eliminate pretreatment
Consolidated Bioprocessing (CBP)
Simultaneous C5 and C6 use
Increased fermentation titer
Increased ethanol titer

Increased ethanol titer after CBP

 

 

l I I I F

O 1 0 20 30 40 50

Processing cost reduction (%)

Figure 4. Reduction in cost for various technological advances?6

(Reproduced) Values represent the average for the indicated advance relative to two-base
configurations (Figure 5 and Figure 6) scenario 1 at 2,205 dry tons feedstock/day; scenario
2 at 5,000 dry tons feedstock/day. Error bars denote the range of processing costs
reductions for each scenario. (for a more detailed description see ref. 36)

Bruce E. Dale is one of the leaders in many bioeconomy references, the associate
director of the Office of Biobased Technologies at Michigan State University and the
editor-in-chief of Biofuels, Bioproducts and Biorefineries, a new Wiley journal. Dale in
many works attempts to work hand-in-hand, thermochemical breakdown of biomass and
enzymatic hydrolysis of cellulose to fermentable sugars. Corn stover, switchgrass

(Panicum vergatum) and giant Chinese silver grass (Miscanthus gigateus) were

investigated in the thermochemical breakdown and subsequent enzymatic

. . 414243
saccharization. ' ’

100 million dry tonnes of corn stover is achieved yearly. Various current
pretreatments to clarify cellulose depletes nutrients and before introduction to microbial

organisms, must then be supplemented with rich laboratory media for saccharification.

16

The leftover dried grains and solubles are shipped off as animal feed. If the cellulose is
more accessible than in unprocessed biomass, supplementation would not be necessary
because the dried grains and solubles in the hydrosylate have more than enough nutrients

for the cellulase enzymes. Ammonia fiber expansion is one of the leading technologies

for blowing apart biomass.“46 Leaving the nutrient rich dried grains in the unclarified,
masticated biomass allows enzymatic access to the cellulose without addition of nutrients.
After treatment with cellulase, fermentation with an a evolved, ethanologenic E. coli strain
(which may not be the optimal choice for ethanol production) did ferment ethanol near the

theoretical limit of 0.51 g ethanol/g consumed sugar from cellulosic hydrosylates at 36-51

g/L glucose at a rate of I .2 g/L/h from corn stover.43

The ammonia fiber expansion occurred in a 300 mL Parr apparatus with optimized
conditions for switchgrass being 100 °C, an ammonia loading of 1 kg ammonia : 1 kg
biomass with an 80% moisture content for 5 min. Rapid release of pressure explodes the
biomass apart. Glucose and xylose conversion was 93% and 70% compared to untreated
conversions of 16% and 3% with a total ethanol production after treatment with cellulase

of 0.2 g ethanol/1 g dry biomass. From the same lab a slightly modified approach allows

some of the protein to be extracted for animal feed.47

The ammonia fiber expansion occurred in a 300 mL Parr apparatus with optimized
conditions for Miscanthus being 160 °C, an ammonia loading of 2 kg ammonia : 1 kg
biomass with an 233% moisture content for 5 min. Glucose and xylose conversion was
96% and 81%. The total ethanol production was not reported and there were some

additional additives compared with switchgrass.

l7

A process outlook schematic would look something along the lines of (Figure 5).
Scenario 1 is based on current technology and could be implemented within a year.

Scenario 2 uses incorporation of advanced, non—biological technologies into the scope of

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Scenario 1.

Biomass Ethanol
Pretreatment _IDetoxification g . . Staget _ Stage 2
(dilute acid) it (lime) i7 B'Oconvers'on —’ distillation ' distillation

Recycled ll
Water V

. Solids

[—— Evaporatlon < Separation
I l Concentrated lngnins
Treated Waste Water Syrup Rankine
Water <—— Treatment Power —> Power

(recycled) Generation

 

 

 

 

 

 

I l

Biogas and sludge

Figure 5. Current capabilities of the biofuel production process36

(Reproduced) Schematic diagram of scenario 1: feedstock biomass is pretreated with
dilute sulfuric acid; pretreated material is mixed with lime to adjust pH and remove
inhibitory compounds for downstream biconversion; ethanol is purified by two-column
distillation and molecular sieve adsorption; residual solids are removed from the
distillation bottoms liquid and fed to a power plant boiler; distillation bottoms liquid is
concentrated by evaporation with the resulting syrup also being fed to the boiler;
remaining wastewater is treated on-site by anaerobic digestion and recycled to the process.

18

Biomass Ethanol

l l

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Pretreatment . . IHOSR
(AFEX) = B'°C°”Ve'3'°" ‘—* distillation
Solids
Separation
lLignins
Treated .
Waste Water 4 TC
“£53; d) ‘—' Treatment ‘ Processing ' Power

 

 

 

 

 

 

 

 

 

Biogas and sludge

Figure 6. Future capabilities of the biofuel production process.36

(Reproduced) Schematic diagram of scenario 2: feedstock biomass is pretreated with
ammonia fiber expansion and delivered directly to bioconversion with no detoxification;
ethanol is purified using a single-stage intermediate via heat pump and optimal sidestream
return (IHOSR) and molecular sieves adsorption; residual solids are removed from the
distillation bottoms liquid and fed into a thermochemical processing operation; distillation
bottoms liquid is treated on-site by anaerobic digestion and recycled to the process.

002 Sequestration

C02 sequestration is a daunting task in which initial responses looked towards
pumping it beneath the ground. Burning of coal for electricity is responsible for one third
of 26 billion metric tons, globally, of anthropogenic C02 that is released into our
atmosphere yearly.48 Experts look at 550 ppm of C02 in our atmosphere to be the

threshold of no return. Currently hovering around 380 ppm, up 100 ppm from the

19

preindustrial era, experts expect that emissions need to decline before 2020 or 2030.
Deviation from coal burning should be helped by production of wind turbines and solar

cells, all of which in the meantime will take much coal-derived electricity to make.

Pumping C02 underground is a trick that has already been used by oil companies to

harvest residual oil in depleting oil reserves and North America already has some 3000

miles of C02 pipeline in existence. Initial studies indicate the 9.5 trillion metric tons

could be sequestered in depleted wells and offer more compressed C02 for oil companies

to use for financial gain in enhanced oil recovery. The authors unfortunately continue to
make the remark that instead of dealing with the problem now that sequestration could

warrant the continued use of coal burning. According to calculations made, the US has
capacity for only about 3 years worth of global C02 production in unminable coal seams
and depleted oil and natural gas reserves. The largest area, and therefore potential for C02
sequestration, is in deep saline aquifers in sandstone. The US could house about 150 years
worth of global C02 production and seems the only option that is worth a breath of
exhausted C02 to even talk about.

The Intergovernmental Panel on Climate Change report explains how C02

storage would be achieved in a saline aquifer.48 Supercritical C02 would be injected

through concrete-lined wells, past multiple geologic strata and below drinking water

aquifers. There, deep in a sandstone saline aquifer, C02 is relatively buoyant compared

with sandstone and formation brine. It would rise to the capstone, an impermeable rock

20

layer at the top of the reservoir. The C02 would dissolve into the aquifer's fluids, and

over hundreds to thousands of years, the COz-laden water would become dense, sinking

into the formation and precipitating to a solid carbonate mineral.

The largest scale sequestration projects are injecting C02 at two natural gas

facilities: Statoil's Sleipner facility in the North Sea off the coast of Norway and BP's In

Salah gas field in Algeria. At both sites, C02 is being stripped from natural gas and

injected into saline aquifers at a rate of about 1 million tons per year. BP and Statoil are

collecting some data on the behavior of the C02 in the aquifers, but the commercial

operations are not designed for research. Starting in 2008, DOE researchers in

partnership with universities and industry will inject some 1 million tons of C02 annually

into saline aquifers at as many as a half-dozen sites. They hope to determine how

quickly C02 dissolves in brine, where it circulates within the aquifer, and how much an

aquifer can hold. They also hope to determine monitoring needs and whether large

plumes of supercritical C02 can trigger earthquakes.

Ammonium bicarbonate has been used to scrub C02 from flue gas streams in a

Wisconsm utility. 9 Flue gas containing less than 1% C02 IS cooled and ammonium

carbonate/bicarbonate equilibriums form allowing bicarbonates to crystallize out. The

crystals are heated to regenerate the ammonium carbonate to recycle back into the flue

gas stream and the C02 is compressed at more than 90% pure. This C02 capture,

21

however, the investors say is energy intensive enough that at mainstream this technology

would use 25% of the plant’s energy consumption. Unless this is energy from turbines or
solar panels, is this not producing more C02 despite the fact that they still have
compressed tanks of C02 to deal with? The investors also comment that if plants

employed this technology it would likely double the price of electricity in the US.

If C02 was sequestered and made into a stable species chemically, that would be

a solid at conditions in the aquifers that scientists plan on injecting gaseous C02, then

focus should be diverted towards this goal. This landfill idea would satisfy C02

sequestration with a faint possibility of added costs, but bearing the assurance that in the

event of a geological mishap would not release all of the C02 that’s sequestration caused

production of more C02 (in the energy required to pump it below the surface). Nature

already made a way to chemically sequester C02 in plants. Burying plants underground

should not be ruled out if degradation could be avoided. The temperatures of these
aquifers are not optimal for most bacterial growth, and humidity is low which diverts
thoughts of giant compost heaps. Planting trees instead of rapid deforestation and
helping overpopulation here and abroad is where efforts need to be focused, but this does
not garnish much attention presumably for the reason that it will not increase anyone’s

bottom line!

22

Biocatalysis

Catalysts either lower the activation barrier or raise the energies of the reactants to
allow the realization of product with a minimum input of energy without a net loss or gain.
Biocatalysis relies upon catalysts predominantly in the form of proteins, referred to as
enzymes, for organic manipulations of substrates into compounds of greater value or
importance. Whether catalysts used in vitro utilizing some level of clarified enzyme or in
vivo enzymatic use in intact microbial organisms, biocatalysis can be a powerful
alternative or complementary to classical organic synthesis.

Enzymes can seemingly without limits transform relatively un-reactive species
with the right combination of energetic gains excluding major temperature fluctuations.
Organisms are designed to optimally thrive in a limited temperature range and although
temperature can drastically alter the outcome of the free energy, and thus the likelihood of
whether a process will happen or not, it can only have minimal variance in vivo.

Some of the ideas that allow enzymes to convert un-reactive species cross the
gamut, including orbital steering, orientation, solvation, transition state complimentarity,

acid/base/nucleophilic catalysis, electronic stabilization, intrinsic binding energies, strain,

”5'52 With all of the added

hydrophobicity, proximity and entropy among others.
advantages that nature employs to lower the energy required to make a transformation

possible, substrates still must contain that minimized amount of energy to commence

reaction. Entropy is widely accepted as a major factor in enzyme catalysis first discovered

by Linus Pauling.53 In 1865 Clausius introduced the concept of entropy based on the

claim that a cold body could not transfer warmth to a warm body. In the coming decades

23

Thomson, Gibbs, and Boltzmann also weighed in. Boltzmann helped define the second
law of thermodynamics substantiated in the kinetic theory of gases with his H theorem
coming from the mean logarithm of the particle distribution function. The Boltzmann H
function is proportional to the entropy of a perfect gas. Boltzmann demonstrated that the
entropy is related to the logarithm of thermodynamic probability. When exponentially
compounded by electrostatic forces of molecules these simple logarithms become
somewhat useless. It is well established that molecules occupy many vibrational,
translational and rotational energies that give vastly different total energies that lead to
energy patterns to exhibit a Boltzmann distribution. If the majority of this distribution of
molecules has enough energy to react they need to be in proximity of the other reactant.
When enzymes bind substrate the binding energy released compensates for the entropic
loss associated and almost no entropy is lost during reaction, because the effective
concentrations of reactants are extremely high.

The awe and diversity of enzymatic reaction are only trumped by the idea that their
composition is solely based upon a limited amino acid makeup. Intermediates of reactants
and products formed during enzymatic catalysis are orientations of molecules in definable
states of higher energies that can be lowered by providing static or electronic stabilization
or even bonding motifs. By increasing the ratio of the transition state to the ground state
the enzyme effectively exhibits catalysis. Enzymes can also rule out much of the chance
of reactants proximity. By lining up two molecules in proper orientation they are more
likely to react in structurally engineered pockets elicited by a simplistic set of 20 naturally

occurring building blocks. Nature also utilizes one of the most intriguing, universally

reactive and abundant chemicals that conveniently acts in multiple modes of catalysis.

24

Water can act as an acid or a base, both of which are effective in catalysis, with the added
ability of enhancing solubility of charged intermediates due to its polar nature. All of the
simplicity that nature ingeniously utilizes combines it in a collage of complexity that are
intrinsically difficult to probe. Enzymatic assays are often taken in dilute, homogeneous
solutions where substrate binding constants are measured, selectivities are determined and
inhibition properties are found. Within a cell the opposite scenario is true. Cells are
densely packed with protein and exhibit massively diverse transcriptomes often shuffling
substrates to other domains in intimate, heterogeneous protein-protein interactions.
Notwithstanding is the fact that even though enzymes are tailored to accommodate
preferentially a limited subset of potential substrates, often many substrates will compete
for binding and have strong influences on overall states of enzymatic processes. Substrates
may also have multiple proteins to which they can bind. If a weaker binding substrate is
much higher in concentration it may readily compete for active site occupation. The
overall balance of everything mentioned thus far is constantly changing at different rates
with or without relation and gives rise to the reason that a thorough understanding of exact
energy definitions are rather elusive, if not unattainable.

The potential energy surface diagrams of static proteins often depict ingeniously
engineered pockets and binding motifs to accommodate rather specific substrates in some
cases. The intimate relationship of an enzyme and substrate is usually one in which all of
the combined binding motifs of ground states, transition states and products need be
summed to allow the enormous task of surpassing an energy barrier eliciting reaction.

Even with an enzyme’s intrinsic use of a multiple-headed energy lowering plan, with the

25

battle of catalysis being an uphill fight in which energy is never in excess, one minor
deviation in gained energy can cause enzyme deficiency.

Well understood enzymatic reactions composed of such limited makeup of
primarily L-amino acids and sequences delivering secondary, tertiary and quaternary
structures offer many advantages over classical synthesis in the form of selectivities. With

three-dimensional binding pockets diastereomers can oftentimes be differentiated, while

regioselection can be attained as well.54 Reaction by—products can be rather limited in
cases leading to enhanced efficiency of reaction recovery by selective organic
transformation to a specific functional group when classical conditions may not selectively
transform one group leaving another susceptible group unreacted. Enantioselectivity can

be understatedly important especially in pharma where one purifed enantiomer is the
active molecule in nine of the top ten drugs.55 Asymmetric catalysis can be achieved in
many cases and have influenced mimicry by classic syntheses56 alongside kinetic
resolution.57 While making enantiopure chemicals is powerful in a few instances,

racemizing chemicals achievable by some enzymes, can have benefits in certain areas.58
The enzymes utilized in in vitro biocatalysis can be crude, partially purified or
what is to be considered homogeneity by a defined purification level. Solubility in media

and finding purification, that in the end must retain activity are oftentimes energy and cost

intensive which can be the downfall to industrial use.59 Recombinant methods, such as
introduction of plasmid bearing genes, can drastically increase levels of protein over
genomic expression that aids in the ratio of protein sought after versus the level of crude

background protein. Proteins themselves oftentimes require expensive and usually labile

26

cofactors, endogenously supplied from a host organism in nature, which must be
externally added for a proper protein environment or catalytic state that can preclude their
widespread use for many chemical productions. Whole-cell biocatalysis can express
multiple protein encoding genes without the addition of expensive co-factors. The
downfalls of microorganism chemical production can be the time and resource
involvement in research and development compared to classical synthesis. Thorough
understanding of many experimental observations can lead one down tedious paths of
investigation. Magnitudes more variables exist when working with viable organisms
when it comes to finding out why something was perceived. Is it because the molecule is
not stabile in cellular environments, is the molecule toxic, is a precursor limiting, is
transport a problem, is gene expression or protein translation inhibitory, is the gene
expressed at the correct level, is the cell limited by co-factors or minerals, are the cells
induced at the correct phase in their life cycle, are the cells production at the correct
temperature, is the right host organism being utilized, are metabolic paths competing for
substrate and are there precedent tools for host manipulation are just of the few of the
questions asked in every biocatalytic production. Research using biological systems can
pay off in big ways because of what the results can reap in process costs reduction. The
benefits of using live machinery for chemical production are the mostly innocuous and
oftentimes biodegradable waste streams, utilization of aqueous low-salt solutions for
solvent with reactions at ambient temperatures and pressures. The viability of whole-cell
biocatalysis hinges upon the metabolic effects of small molecule production, the chemical
tolerance of the host organism and the transport machinery to extrude the molecule

without osmotic stress. Biocatalysis often utilizes sugar or metabolic sugar derivatives as

27

building blocks that garner immediate attention in light of the current hike in non-

renewable building block feedstock.

Chemical manufacture

About 13% of crude oil, that just topped the feared 8100/be mark recently, is used

. 60 . . . .
for non-fuel chemical manufacture. With most of the biomass attention looking towards

replacement of transportation fuels6| it is also important to cover this other 13% that has
potential to be a more rapidly transformed area with a modest impact. As a starting point
for potentials to chemicals, building blocks or intermediates, in 2004 the staffs at the
Pacific Northwest National Lab (PNNL) and the National Renewable Energy Laboratory

(NREL) put together a list of the top value added chemicals that could be produced from

. . . . . . 62
biomass through utilization of sugars or syngas derived from pyroly5ls.

Current commodity chemicals produced from microbial synthesis include glutamic

acid, citric acid, and lysine all consumed at quantities close to or above 1 billion kg/year.63

At 16,000 ton per year production indigo is used to dye denim. Chemically,

phenylglycine is reacted in KOH-NaOH with NaNH2 at 900 °C making indoxyl, which

spontaneously oxidizes to indigo.64 With heterologously expressed naphthalene
dioxygenase from Psuedomonas putida in E. coli, Genencor developed the route from D-
glucose. Siphoning off of indole in the tryptophan biosynthetic pathway was achieved by
naphthalene dioxygenase for conversion to indoxyl, which just as in the chemical

manufacture, oxidizes to indigo. 1,3-propanediol, the building block of

28

polypropyleneterephthalate (PPT) out of Genencor and DuPont is produced from

biomass.65 In the final construct, four genes required for 1,3—propanediol microbial
synthesis were heterologously expressed in E. coli to currently produce product in titers of
129 g/L at 34% yield (g 1,3-propanediol / g D-glucose). Other polymers could be formed

by methyl lactate, lactide or polylactic acid which can be chemically derived from

microbially synthesized lactic acid.66 Polylactic acid is a potential replacement for
polyethyleneterephthalate (PET) that also has the benefit of being biodegradable. Maleic

anhydride, used in solvents and polymers, could be replaced with succinic acid derived
from renewables.67 Adipic acid in Nylon 6,6 could be chemically derived from cis-cis

muconic acid in technology developed in the Frost lab.68
One of the most important raw materials for chemical manufacture comes to the
US in the form of petroleum based aromatics that lead to the production of many of

America’s commodity chemicals including plastics, fibers, rubbers and biologically active

drugs.69 Benzene, toluene and xylenes are the lightest aromatics and were originally
produced with the pyrolysis of coal. During WWII, with the onset of gasoline production,
the aromatics were siphoned off reformate streams. Aromatics are a large component of
gasoline having high “octane ratings” and although there are specific sequestrations of

aromatics from crude oil, they are largely produced as a gasoline additive. Reforming of

the naphtha layer (bp of 70-190 °C) of crude oil, hydrocarbons of primarily C6-C12 are

vaporized, with temperatures and pressure ranges from 450-550 kPa and 470-530 °C, and
passed through a 1% platinum catalyst on a high surface area acidic support such as

alumina. A typical reformate contains a 20:50:30 mixture of benzene:toluene:xylene.

29

. . . . 7
Toluene, which makes up the majority 18 dealkylated to form larger amounts of benzene. O

The uses of major aromatic feedstocks are outlined in (Figure 7). In 2005, the US.

produced 1,828 x 106 gal of toluene.71 Of this total, 76% was used in the production of

benzene and xylenes. In 2006, world capacity of benzene reached 48 x 106 ton.

Production of ethylbenzene, cumene, and cyclohexane accounted for 85% of the benzene

produced.72 In 2004, 9,745 x 106 pounds of p-xylene were produced in the United States.

Of this, 77% was used to produce dimethyl terephthalate.73 Benzene is a known

carcinogen and exposure has been evident to lead to both acute leukemia and non-
Hodgkins lymphoma.74 A mandate by the Environmental Protection Agency has outlined

. . . . . 75
the limitations for future benzene emlSSlons.

30

/ Polystyrene
/ Styrene \ ABS Resins
SBR elastomers

Ethylbenzene

 

 

 

Phenol Phenolic Resins
Benzene Cumene "'< Methacrylates
Acetone <
d d Solvents
Cyclohexane A ipic aci
l n
\< Caprolactam NY 0 S

Benzene
Toluene ———<

Dinitrotoluene — Toluene Diisocyanate '— Polyurethanes

o-Xylene -— Styrene \_< Plasticizers
Xylenes Polyesters

m-Xylene —— lsophthalic acid

Dimethyl

-X l
p Y ene < terephthalate >—- Polyesters
T d

erephthalic aci

Figure 7. Major products of aromatic feedstocks.

An alternative to aromatic feedstocks could take advantage of the largest

biopolymer on Earth. Cellulose gives a densely packaged substrate in D-glucose that is
currently made from the depolymerization of starch76 and hydrolysis of hemicellulose

offers D-xylose?7 and L-arabinose.78 Another important feedstock, especially in light of
the fact that D-glucose prices will probably increase in the immediate future owing to the
siphoning of ethanol to biofuels, is glycerol whose prices are decreasing rapidly. Glycerol
is a direct by—product in the manufacture of another biofuel, biodiesel. Biodiesel is a

sustainable and renewable alternative to conventional petrodiesel that upon combustion

comparatively releases less C02. Different plant oils and animal fats are transesterified to

31

use short chain alkyl esters in unmodified diesel engines as a blend or even straight. The
transesterification by-product is glycerol that is dubbed a limited value by-product.

Glycerol may play an immediate role in production of epichlorohydrin, propylene glycol

63
and polyurethanes. Glycerol could however, be a sole-carbon source for many

microbial organisms. All the mentioned substrates have been used in microbial synthesis,
some of which in the Frost lab, en route to a multitude of valuable chemicals normally

derived from petroleum.

Hydroxy aromatics

Many of the less densely hydroxylated benzenes are currently known to be derived
from microbial synthesis either from a direct biocatalysis, catabolism of a precursor or
chemical manipulation of biosynthesized substrate. Outlined in (Figure 9) the boxed
aromatics offer syntheses from renewables from the Frost lab. Manipulation of the

Shikimate pathway (Figure 8), used for aromatic biosynthesis in E. coli, yields access to

catechol79, hydroquinone80 and pyrogallol.81

32

OH 0

HO
0- -erythrose 4- phosphate 0’. CO2H 002H
AFOFFBR AroB AroE

H9 CO2H
T—Ho“ : ‘OH

OPOaHz H203PO oHO 5H
COZH . . 3- -d§hydroquinic quinic
3-deoxy-o-arabino-heptulosonlc aC|d acid
phosphoenolpyruvic acid acid 7-phosphate
lAmD
COQH C02H CO2H CO2“
AI'OK ATOE
‘——_
HanPO‘ OH A'OL H0" ; 0H OH:
OH OH
Shikimate 3 PhOSphate shikimic 3-dehyfro:hikimic gallic
acid acid acid
lAmA
C02H C02H
L-phenylalanine
AroC ' L-tryptophan
\' OZ’lL JL L-tyrosine
OH OH

5-enolpyruvylshikimate
3-phosphate

chorismic acid

Figure 8. Shikimate pathway for aromatic amino acid synthesis

Microbial routes to catechol and pyrogallol are plagued with toxicity of the

product towards the organism. Routes can be employed to circumvent sensitivity by

indirect biocatalysis of a precursor to an aromatic such as in the syntheses of

hydroquinone and phenol .82 A quick look at all the hydroxy aromatics follows.

33

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

F 1 F D r r
OH OH OH OH
O O ”CO
HO
OH
Phenol Resorcinol Catechol Hydroquinone
L P L L
r 1 f r r
OH OH OH OH 1
HOUOH 0 OH
OH HO OH OH
OH OH
Hydroxy . .
- P ro allol Phl I I A lonol
khydroqumone L y 9 L 0’09 ucmo L p
OH OH OH OH
HO HO OH HO OH HO OH
OH OH HO OH
OH OH OH OH
1 ,2,4,5-tetra 1 ,2,3,5-tetra Pentahydroxy Hexahydroxy
hydroxybenzene hydroxybenzene Benzene Benzene

Figure 9. Hydroxy aromatics.

Boxed molecules have current or precursor renewable, biocatalytic syntheses.

Virtually all 7 million metric tons per year of phenol is chemically manufactured

from benzene.83 The uses primarily are for manufacture of bisphenol A, phenolic resins,
s-caprolactam, aniline and alkylated phenols. Friedel-Crafts alkylation of benzene with

propylene yields cumene, which upon oxidation and cleavage, produces phenol and

acetone (Figure 10). Phenol undergoes 0-, p-hydroxylation with peroxide to afford

hydroquinone and catechol that are differentially distilled. More direct routes to

hydroquinone exist, without the separation from catechol. Phenol can instead be produced

34

from renewables after reaction of shikimic acid (biocatalytically produced in over 100 g/L

concentrations) in near-critical water to an isolated yield of 51% (Figure 10).82

With an annual production of over 22,000 metric tons, catechol finds use as a
starting material in the manufacture of pharmaceuticals (L-DOPA, adrenaline), flavors

(vanillin, eugenol, isoeugenol), agrochemicals (carbofuran, propoxur), polymerization

inhibitors and antioxidants (4-tert-butylcatechol, veratrol).84 Hydroxylation of phenol is
the current production method of catechol with hydroquinone as a recovered by-product.

Catechol can be microbially synthesized, directly from glucose, albeit in limited quantities

of 2 g/L due to product sensitivity to the organism.79

3-dehydroshikimic

acid
shikimic
acid C02H C02H OH 0H
(1 4 .:- 0 "
n +—-
HO‘ ; OH O _._ OH ; OH
OH OH HO OH
id is
OH OH
© 3 b o ° “’6
—_> —> T’
OH
OH

Figure 10. Phenol and catechol current and microbial manufacture

(a) Propylene, AlCl3. (b) i) 02, 100 °C, ii) A, H2804. (c) 70% H202 EDTA, Fee or C0“,
80 °C. ((1) H20, 350 °C. (e) E. coli A82834/pKD136/pKD9D69A, 37 °C.

35

Hydroquinone is produced globally at approximately 45,000 metric tons per year

and utilized in antioxidants and polymerization inhibitors.85 Similarly to phenol
production, benzene is alkylated with propylene and reacted in a Hock oxidation to
hydroquinone or produced as a by—product shown in catechol manufacture. Alternatively,
nitrobenzene can be reduced to aniline, treated with stoichiometric amounts of manganese
oxide in the presence of acid to benzoquinone, that upon the addition of iron aromatizes to
hydroquinone. Quinic acid can be synthesized microbially from D-glucose at
concentrations approaching 70 g/L and can be converted to hydroquinone with

stoichiometric amounts of bleach to 87% isolated yield after extraction with t-

butylmethylether followed by sublimation.80 In the same study, catalytic Ag3PO4 at 2

mol% was used with K25208 as a co-oxidant offering isolated yields of 74%. The toxicity

of hydroquinone toward ethanologenic E. coli cultured on xylose under fermentative

conditions has been analyzed from the perspective of hydroquinone’s inhibition of sugar
catabolism and damage to the plasma membrane.86
OH HO C02H 0H
o f " 0 -‘OH
«—
. <—
3 HO‘ _._ OH ; OH
/ OH OH HO OH
1 quinic

9 acid
0
c\. d
I o’j

NH2

O

Figure 11. Hydroquinone current and microbial manufacture

(a) propylene, HZSM-12. (b) i) 02, NaOH, ii) A, H2504. (c) i) HNO3, st04 ii) Cu/SiOz,
H2. (d) MHOZ, H2504. (8) F60. (f) HOCI 01' Ag3PO4/K25208.

36

Gallic acid first and foremost is used as a veterinary urinary astrigent and

antihemorrhageant, but also has applications as a plant growth regulator, besides being the

precursor to pyrogallol.87 Pyrogallol is a pharmaceutical (Trimethoprim,
gallaminetriethiodide) and pesticide (Bendiocarb) precursor providing the hydroxylated
benzene ring. Pyrogallol happens to be the oldest and one of the most versatile
photographic developing agents. Gallic acid availability is directly related to the natural
sources of insect carapices (gall nuts) and the seed pods of a Peruvian tree (Coulteria
tinctoria tara powder) which are neither a controlled cultivation. Some syntheses have
been brought to industrial applications from benzene. Conversion to
tetrachlorocyclohexanone from cyclohexanone with subsequent base catalyzed hydrolysis
affords gallic acid. Either source of gallic acid is treated in a copper lined autoclave at
high pressures and decarboxylated to pyrogallol (Figure 12). E. coli KL7/pSK6.161 can
convert D-glucose to gallic acid in over 20 g/L titer in 12% yield. E. coli

RB79lserAzzaroB/pSK6.234 can convert gallic acid to pyrogallol in near quantitative

yields either through 3-dehydroshikimic acid or protocatechuic acid.81

37

PCA 3-dehydroshikimic acid
OH COQH OH

HO 9 O .\OH
‘— +—
0 ; OH ; OH
COzH OH HO OH
h
\ 1*

OH OH
gall nuts a HO OH b,i HOG/OH
-—> ——>
tara powder .
COQH

V gallic acid
0 Cl 0 Cl
0 L, b _d_, of}...
Figure 12. Pyrogallol current and microbial manufacture

(a) Natural product isolation. (b) CuO, 12 atm, 175 °C. (c) i) H2/Pt ii) Oz/Co, iii) Cu/Zn.

((1) C12. (e) NaOAc. (f) 3-dehydroshikimic acid dehydrogenase. (g) 3-dehydroshikimic
acid dehydratase (AroZ). (h) p-hydroxybenzoate hydroxylase (PobA). (i) PCA
decarboxylase (AroY).

Phloroglucinols use in industry and production is discussed in depth in Chapter
three. Resorcinol has a worldwide production of 45 ,000 metric tons per year88 and finds

. . . . . 85 . . .
most of it use in tires and wood adheSives as a tacklfier. Resorcmol also has application

in UV protective coatings, throat lozenges and molecules with biological activity. Both
industrial productions of resorcinol use benzene as starting material (Figure 13). In one
synthesis, conversion of diisopropyl benzene, by propylene addition to benzene, takes an
analogous path as the cumene/phenol synthesis. In other efforts oleum/sodium sulfite is
used to sulfonate benzene, followed by alkali fusion, that generates large sulfate salt

streams. Resorcinol can be derived in 82% isolated yield from phloroglucinol using a

38

base-catalyzed hydrogenation with Rhodium on alumina after Kugel-Rohr distillation.89

Phloroglucinol is microbially synthesized from D-glucose in varying titers with use of

external extractive techniques (discussed in Chapter three).90

COQH
I; O2NT:CT)2__’ N02b OZN. :02 NO: H2N : .NH2

NH2

7 A Ho
(2 0
g\\ SOaH/hv OH

H038

Figure 13. Phloroglucinol and resorcinol current and microbial manufacture

(a) HNO3, H2804. (b) NazCrzO—7, H2804. (c) Feo, HCl. (d) H2504, 108 °C. (e) propylene,
HZSM-12. (f) 02, NaOH, 90-100 °C. (g) 503, NaZSO4, 150 °C. (h) NaOH, 350 °C. (i)

W31108erA(DE3)/pBC2.274. (j) i) Rh/A1203, H2, NaOH; ii) H2304, reflux.

Other hydroaromatics are not in mainstream industrial applications and their
difficulty in production precludes use as commodity chemicals. Some proposed syntheses

have been shown at bench-scale (Figure 14). Hydroxyhydroquinone is not produced

industrially, but IS found in several insectiCldes.8 D-glucose derived 2-deoxy-scyllo-

inosose9| can be converted to hydroxyhydroquinone with reflux in 0.5 M phosphoric
acid.89 Functionalized apionol molecules include antioxidant coenzyme Q10, Which

39

. . . . . . . . 92 . . . .
inhibits ox1dative stress to low-denSlty lipoprotelns , fumagatln and aurontlogliocladln,

which have antibiotic acthlty.9 Aplonol comes from D-glucose Via an aCld catalyzed
aromatization of selectively oxidized myo-inositol. 1,2,3,5-tetrahydroxybenzene is the
first product in the proposed phloroglucinol degradative pathway in Rhodococcus sp BPG-

8 and with identification and inhibition of subsequent enzyme(s) this hydroxy-aromatic

could be achieved.94 1,2,3,5-tetrahydroxybenzene can be made by acid hydrolysis of
2,4,6-triaminophenol. 1,2,4,5—tetrahydroxybenzene is produced by the reduction of 2,5-
dihydroxyl-l,4-benzoquinone and would most likely have to be derived from a higher
order hydroxybenzene or unsaturated polyol with a reactive end functionality for ring
closure. Tetrahydroxybenzoquinone is reduced with stannous chloride under acidic
conditions to yield hexahydroxybenzene. D-glucose derived, cellular inositols are the
most densely chiral molecules known and, although unlikely, there is a possibility of
dehydrogenating to aromatize to hexahydroxybenzene which maybe selectively

deoxygenated to pentahydroxybenzene has been synthesized previously by boiling 2,4,6-

. . . . . 7
triaminoresorcmoldlethylether in water followed by ether cleavage .8

Hydroxy _ .
hydroquinone mJ’O'mOS'IO' Aplonol

OH OH
0' ‘--_-'_'l.:j.: H'OH o\' '/O
OH

\N‘O/ \o.

 

HO OH HO OH Hydroxy
hydroquinone
HO OH OH
OH OH
b Hexahydroxy
Benzene OH
OH
HO OH
OH OH
HO OH
OH OH
1,2,3,5-tetra OH OH
hydroxybenzene
Pentahydroxy 1 ,2,4,5-tetra
Benzene hydroxybenzene

Figure 14. Proposed polyhydroxyaromatic synthesis from a renewable source.

(a) W3110serA(DE3)/pBC2.274. (b) Recombinant Rhodococcus sp BPG-8. (c) i)
hexokinase, ii) 2-deoxy-scyllo—inosose synthase 38%. (d) 0.5 M H3PO4 reflux, 39%. (e) E.

coli JWFI/pAD1.88A, 11%”. (f) G. oxydans, 95%”. (g) H20, H2504, reflux, 66%95

In rise of the uncertainty associated with the chemical industries reliance on non-

renewable resources for virtually all commodity chemical manufacture the research for

sources with renewable feedstocks are of importance. The following research comprises

of chemistry that progresses towards the deviation from a petroleum—based chemical

economy to one that thrives on starting materials from renewable sources through

utilization of rapid and efficient syntheses dependent upon microbial biocatalysts. Efforts

aimed to biocatalytically produce 1,3 ,5—trihydroxybenzene and an e-caprolactam precursor

41

from renewable resources at a level with commercial importance. To enhance the viability
of commercial manufacture following a successful biocatalytic production, focused on
delivering molecules with the same purity and level to compete with non-renewable

routes .

42

CHAPTER ONE REFERENCE

1 El-Ashry, M. “Renewables 2007 Global Status Report”. 2007. www.ren21.net

2 c n . - ' '
‘Greenhouse gas , litip:/.«'eli.lvlklpetllaorg, (accessed March 5, 2008).

 

3 u ' n I -
Past climate change , WWW .cpil.gmw'cllinatcclitlllgc, (accessed March 5, 2008).

 

4 Schulz, W.G.; Chambers, A.J. Chem. Eng. News. 2008. January 2], 9.

5 £6 ' 9) '
Recent climate change , w w w .6130.gOV'I’CIIIIIIIICCIIZIII ge, (accessed March 5, 2008).

 

6 Ritter S.K. Chem. Eng. News. 2007. June 25, 15.

7 dos Santos, C.Y .M.; Azevedo, D.D.; Neto, F.R.D. Atmos. Environ. 2002, 36, 3009.
8 Hileman, B. Chem. Eng. News. 2008. February 18, 35.

9 Hogue, C. Chem. Eng. News. 2008. February 4, 24.

10 Hess, G. Chem. Eng. News. 2008. March 10, 42.

H Erickson, B. Chem. Eng. News. 2008. January 7, 10.

1’2 (a) Asadullah, M.; Ito, S.I.; Kunimori, K.; Yamada, M.; Tomishige, K. Environ. Sci.
Technol. 2002,36, 4476. (b) Tomishige, K.; Asadullah, M.; Kunimori, K. Catalysis
Today. 2004, 89, 389. (c) Rohde, M.; Unruh, D.; Piap, R; Lee, K.W.; Shaub, G. Studies in
Surface Science and Catalysis. 2004, 153,97. Among many conference abstracts of
papers.

'3 Mccoy, M. Chem. Eng. News. 2008. January 2], ll.
'4 Chem. Eng. News. 2008. December 17, 12.
15 Voith, M. Chem. Eng. News. 2008. February 11,34.

16 Jacoby, M. Chem. Eng. News. 2008. February 27, 7.

43

l7 Schmer, M.R.; Vogel, K.P.; Mitchell, R.B.; Perrin, R.K. Proc. Nat. Acad. Sci. 2008,
[05, 464.

18 Ritter, S. Chem. Eng. News. 2008. January 21, 45.

19 “Miscanthus”, www.bical .net.

20 Tullo, A. Chem. Eng. News. 2007. November 26, 28.

21 Crabtree, G.; Dresselhaus, M.; Buchanan, M. Physics Today. 2004, 57, 39.

22 Antoni, D.; Zverlov, V.V.; Schwarz, W.H. Appl. Microbiol. Biotechnol. 2007, 77,23.

23 US Department of Energy. Todays Hydrogen Production Industry. 2006.

http://www .fossi 1 .energy .gov/programslfuel s/liydrogen/currelittechnolonghtml. (Accessed
March 7, 2008).

24 Lattin, W.C.; Utgikar, V .P. International Journal of Hydrogen Energy. 2007, 32, 3230.

25 Mueller-Langer, F .; Tzimas, E.; Kaltschmitt, M.; Peteves, S. International Journal of
Hydrogen Energy. 2007, 32, 3797.

26 McDowall , W.; Eames, M. International Journal of Hydrogen Energy. 2007, 32, 461 1.
27 Jacoby, M. Chem. Eng. News. 2008. January 28, 67.

28 Olah, G.A.; Goeppert, A.; Prakash, G.K.S. Beyond Oil and Gas: The Methanol
Economy. 1“ ed.; Wiley—VCH: 2006.

29 Tullo, A. Chem. Eng. News. 2008. March 17, 15.

30 Wang, Q. Masters Thesis. University of Maryland, 2006.
https://drum.umd.edu/dspace/bitstream/1903/3833/1/umi-umd-3678.pdf

31 Kemsley, J. Chem. Eng. News. 2007. December 3, 55.

32 (a) Schwarz, W.H.; Gapes, JR. BioWorld Europe. 2006, 01-2006, 16. (b) Schwarz,
W.H.; Gapes, J .R.; Zverlov, V.V.; Antoni, D.; Erhard, W.; Slattery, M. Demonstration at
the TU Muenchen. June 2006.

33 Durre, P. Biotechnol. J. 2007, 2, 1525.

34 . ,,. . . , ,,.
Blobutanol. http:/rwww2.dllpont.com/BioflleIS/eli USIIIKIE‘XJIIITII. Accessed March 16,
2008.

 

35 Ezeji, T.C.; Qureshi, N.; Blaschek, H.P. Curr. Opin. Biotechnol. 2007, 18,220.

36 Lynd, L.R.; Laser, M.S.; Bransby, D.; Dale, B.E.; Davison, 8.; Hamilton, R.; Himmel,
M.; Keller, M.; McMillian, J.D.; Sheehan, J.; Wyman, C.E. Nat. Biotechnol. 2008, 26,
169.

37 (a)Lynd, L.R.; Weimer, PJ; van Zyl, W.H.; Pretorius, I.s. Microbial. Mol. Biol. Rev.
2002, 66, 506. (b) Lynd, L.R.; van Zyl, W.H.; McBride, J.E.; Laser, M. Curr. Opin.
Biotechnol. 2005, I6, 577.

38 wwwl .eere.energy.gov/biomass/cellulase_enzyme.html. (Accessed March 9,2008).

39 (a) Cherry, J .R.; Fidantsef, A.L. Curr. Opin. Biotechnol. 2003, I4, 438. (b) Esterbauer,
H.; Steiner, W.; Labudova, I.; Hermann, A.; Hayn, M. Bioresour. Technol. 1991 , 36, 51.
(c) Kirk, 0.; Borchert, T.V .; Fugslang, C.C. Curr. Opin. Biotechnol. 2002, 13, 345.

40 Percival-Zhang, Y .H.; Himmel, M.E.; Mielenz, J.R. Biotechnol. Adv. 2006, 24,452.

4‘ Alizadeh, 11.; Teymouri, F; Gilbert, T.l.; Dale, lB. Appl. Biochem. Biotechnol. 2005,
121,1133.

42 Murnen, H.K.; Balan, V.; Chundawat, S.P.S.; Bals, 8.; da Costa Sousa, L.; Dale, B.E.
Biotechnol. Prog. 2007, 23, 846.

43 Lau, M.W.; Dale, B.E.; Balan, V. Biotechnol. Bioengin. 2007, 99, 529.
44 Kadam, K.L.; McMillan, J.D. Bioresour. Technol. 2003, 88, I7.

45 Lynd, L.R. Annu. Rev. Energy Environ. 1996, 21,403.

45

46 Holtzapple, M.T.; Jun, J.; Ashok, G.; Patibanadala, S.L.; Dale, B.E. Appl. Biochem.
Bioethanol. 1991 , 28/29, 59.

47 Bals, 13.; Teachworth, L.; Dale, 8.; Balan, v. Appl. Biochem. Biotechnol. 2007, 143,
187.

48 Hileman, B.; Johnson, J. Chem. Eng. News. 2007. September 24,74.
49 Johnson, J. Chem. Eng. News. 2008. March 3, 7.
5” Menger, F.M. Pure Appl. Chem. 2005, 77, 1873.

51 Villa, J.; Strajbl, M.; Glennon T.M.; Sham Y .Y.; Chu, Z.T.; Warshel, A. Proc. Nat.
Acad. Sci. 2000, 97, 11899.

52 Udgaonkar, J .B. Resonance. 2001. Sept. 61 .
53 Pauling, L. Nature. 1948. 16,707.

54 Muller, M.; Wolberg, M.; Schubert, T.; Hummel, W. Adv. Biochem. Engin. Biotechnol.
2005, 92, 261.

55 Rouhi AM. Chem. Eng. News. 2004, 82,47.

56 Ikunaka, M. Organic Process Research and Development. 2007, I] , 495.
57 Martin-Matute, 13.; Backvall , J.E. Curr., Opin. Chem. Biol. 2007, 11,226.
58 Scnell, B.; Faber, K.; Kroutil, W. Adv. Synth. Catal. 2003, 345, 653.

59 Jenkins, R. O. In Biotechnological Innovations in Chemical Synthesis; van Dam-
Mieras, M. C. E., de Jeu, W. H., de Vries, J., Currell, B. R., James, J. W., Leach, C. K.,
Patmare, R. A., Eds.; Butterworth Heinemann: Oxford 1997: pp. 9-34.

60 www.ciaxloegov (Mar 4, 2008).

6‘ Lewis, N.S. Science. 2007, 315, 798.

62 Werpy, T.; Peterson, P. “Top Value Added Chemicals From Biomass: Volume 1”.
www l .eere.energy.gov/biomass/pde/35523 .pdf

63 Dodds, 0.12.; Gross, R.A. Science. 2007, 318, 1250.

64 (a) Ferreira, E. S. B.; Hulme, A. N.; McNab, H.; Quye, A. Chem. Soc. Rev. 2004, 33,
329. (b) Bommarius, A. S.; Riebel, B. R. Biocatalysis; Wiley-VCH: Weinheim, 2004.

65 Emptage, M; Haynie, S.; Laffend, L.; Pucci, J.; Whited, G. European Patent
Application 1586647A l , Published October 19, 2005.

66 Carlson, T.L.; Peters, E.M. US Patent Application US2006/094093 A1. Published May
4, 2006.

‘57 Donnelly, M.; Millard, C.S.; Stols, L. us Patent Application 5770435. Published 1998.
68 Niu, W.; Draths, K.M.; Frost, 1w. Biotechnol. Prog. 2002, 18, 201.

69 Weissermel, K.; Arpe, H.J. Industrial Organic Chemistry, 3rd ed.; VCH: New York,
l997:p.310.

7" Sweeney, W.A.; Bryan, P.F. “BTX Processing”, Kirk-Othmer Encyclopedia of
Chemical Technology. 2007.

7‘ “Toluene, Chemical Profile” Chem. Market Rep. 2006,30, (April 3-9).

7" Davis, S. “Benzene”, Chemical Economics Handbook. 2007, SR1 Consulting, Menlo
Park, Calif. (Jan).

73 “Paraxylene, Chemical Profile” Chem. Market Rep. 2004’ 31’ (Aug 9'16)

74 (a) O’ Connor, S. R.; Farmer, P. B.; Lauder, I. J. Pathol. 1999, I89, 448. (b) Farris, G.

M.; Everitt, J. I.; Irons, R.; Popp, J. A. Fundam. Appl. Toxicol. 1993, 20, 503. (c) Huff, J.
E.; Haseman, J. K.; DeMarini, D. M. Environ. Health Perspect. 1989, 82, 125.

47

75 (a) Noah, T. Wall Street J. 1994, B2 (March 2); (b) Washington Post 1994, A3 (March
2); (c) Ember, L. Chem. Eng. News 1994, 72, 4 (March 7).

76 Corn: Chemistry and Technology; Watson, S. A.; Ramstad, P. E., Eds.; American
Association of Cereal Chemists: St. Paul, MN, 1987.

77 Swiss Pat. 514,675 (Dec. 15, 1971), H. J. Schultze and R. Mondry (to Inventa AG fuer
Forschung and Patentverwer-tung).

78 Belozerova L.A. Tr. Leningrad. Lesotekh. Akad. 1966, 105,89.

79 Draths, K.M.; Frost, J.W. J. Amer. Chem. Soc. 1995, 117, 2395.

80 Ran, N.; Knop, D. R.; Draths, K. M.; Frost, J.W. J. Am. Chem. Soc. 2001, 123, 10927.
8] Kambourakis, S.; Draths, K. M.; Frost, J. W. J. Am. Chem. Soc. 2000, 122, 9042.

82 Gibson, J. M.; Thomas, P. S.; Thomas, J. D.; Barker, J. L.; Chandran, S. S.; Harrup, M.
K.; Frost, J. W. Angew. Chem, Int. Ed. 2001, 40, 1945.

83 Wallace, J. Kirk-Othmer Encyclopedia of Chemical Technology; Wiley: New York,
2001. “Phenol”, updated online May 13,2005.

84 (a) Franck, H.-G.; Stadelhofer, J. W. Industrial Aromatic Chemistry; Springer-Verlag:
New York, 1988; pp. 183-190. (b) Varagnat, J. In Kirk-Othmer Encyclopedia of Chemical
Technology, 3rd ed.; Grayson, M. Ed.; Wiley: New York, 1981; Vol. 13, pp. 39—69. (c)
Szmant, H. H. Organic Building Blocks of the Chemical Industry; Wiley: New York,
1989; PP. 512—519.

85 Krumenacker, L.; Constantini, M.; Pontal , P.; Sentnac, J. K irk-Othmer Encyclopedia of
Chemical Technology; Wiley: New York, 2001.

86 Zaldivar, 1.; Martinez, A.; lngram, L.o. Biotechnol. Bioeng. 2000, 68, 524.

87 Leston, G. “Polyhydroxybenzenes”. K irk-Othmer Encyclopedia of Chemical
Technology; Wiley: New York, 2001.

48

88 INDSPEC Chemical producer. http://www.iiitlSjiet‘—t‘lielil.com/ABOUT/AbolitUs.asp.
Accessed March 8,2008.

89 Hansen, C.A.; Frost, 1w. J. Amer. Chem. Soc. 2002, 124, 5926.
90 This thesis and results from Dr. Dongmig Xie.

91 Kakinuma, K.; Nango, E.; Kudo, F.; Matsushima, Y.; Eguchi, T. Tetrahedron Lett.
2000,41, 1935.

92 (a) Ingold, K. 11.; Bowry, v. w.; Stacker, R.; Walling, c. Proc. Natl. Acad. Sci. USA.
1993, 90,45. (b) Stocker, R.; Bowry, V. W.; Frei, B. Proc. Natl. Acad. Sci. U.SA.1991,
88, 1646. (c) Steinberg, D. Circulation 1991,84, 1420.

93 (a) Vischer, E. B. J. Chem. Soc. 1953, 815. (b) Baker, w.; McOmie, J. F. W.; Miles, 1).
J. Chem. Soc. 1953, 820. (c) Baker, W.; Raistrick, H. J. Chem. Soc. 1941, 670.

94 Armstrong, S.M.; Patel, T.R. J. Basic Microbiol. 1994, 2, 123.

95 Hansen, C.A.; Dean, A.B.; DrathS. KM; FFOSt.J-W-J.Amer. Chem.Soc. 1999,12],
3799.

49

CHAPTER TWQ

L-lysine Derived s-Caprolactam

Introduction
Nylon 6 and Nylon 6,6 account for 98% of the total Nylon manufacture

. l . .
worldw1de. Nylon 6 fibers are composed of the monomer unit e-caprolactam. Forecasts

have projected an annual growth of almost 3% reaching 4.5 million metric tons per year

by 2010.2 As with any commodity chemical manufacture the processes are highly cost
and resource dependent. Petroleum, defined as a non-renewable resource, is the origin for
starting materials used in the production of e-caprolactam. Current routes to e-
caprolactam include the use of benzene, toluene or butadiene as starting materials (Figure

15 and Figure 16) and although demand, competition and environmental impact have

contributed heavily to process improvements3 there iS still the fundamental flaw that the
sources are not renewable.

Benzene, the starting material for e-caprolactam manufacture, and other alkylated
benzenes make up to 20% of the lighter fractions of crude oil and are also made as a

gasoline additive as discussed in Chapter one. Various routes to phenol from benzene

exist and hydrogenation with another petrochemical Hz to cyclohexanone iS fairly
fundamental (Figure 16). Most of the improvements exist in the massive waste
accumulations of the subsequent steps. Stoichiometric hydroxylamine sulfate is used to

convert cyclohexanone to the oxime, generating massive amounts of ammonium sulfate in

the process which can only be slightly discounted because some of the salts can be used as

50

fertilizers. DSM has helped this Situation by using a nitrous oxide reduction and a
. 4 . . .
phosphate ox1me process. Sumlmoto completely eliminates the salt stream through use

of an NH; and H202 ammoxidation using a titanosilicate catalyst.5 Alternatively,

cyclohexane iS converted into cyclohexanone oxime in the presence of nitrous oxide and

HCl. Both cyclohexanone and hydroxylamine are eliminated in this process.6 The

Beckmann rearrangment often uses oleum as the electrophile and converts the oxime to

7 . . . .
the lactam. Another waste stream production step IS neutralization of the oleum.
Thomas has devised use of bifunctional, heterogeneous, nanoporous catalysts containing

isolated acidic and ‘redox Sites to seamlessly convert cyclohexanone to c-caprolactam

using air and ammonia at 80 °C.8 Some of the processes mentioned have only been

proven on laboratory scale and are not practiced on an industrial scale. In the end up to

. . 9
4.3 tons of ammonium sulfate alone is produced per ton of e-caprolactam.

51

petroleum

l

mOCHQ, I a N __e_. NC/WCN
O
methyl-3-pentenoate 1 ,3-butadiene adiponitrile
lb 1‘

, OCH 0
CW 3 OH NCWNHZ

 

O

5-formyl valerate 6-aminocapronitrile

 

 

 

1 c e-caprolactam

d
H2N /\/\/\erCH3 /
O

6-aminocaproate

Figure 15. Syntheses of e-caprolactam from 1,3-butadiene. (a) CO, MeOH, Ni-
zeolites. (b) CO, H2, Co, Rh. (c) NH3/H2, Ru. (d) 250 °C. (e) HCN. (f) Ni/Co, H2. (g)
T102, H20.

In addition to being carcinogenic, the price and availability of benzene has shown
recent instability and this demands experimentation that looks elsewhere for starting
materials. More efficient and environmentally sound production methods have been
investigated. In efforts to derive a renewable route to e—caprolactam, L-lySine, a source

readily produced from glucose, was investigated through research conducted by Dr.

Mapitso Molefe10 and Dr. Jinsong Yangll in the Frost lab (Figure 16). L-lysine has all the

functional groups necessary to supply the e-caprolactam backbone.

52

+ -
H3N CI
NaCl N2, K2304

D-glucose —> -‘NH3 4 Q6 "NHZ 1:21» Q0“ QC”) "NH2
a - b 02
H

co2

0 \ (1.3. l
benzened:: Q? R
e, l OOH

Figure 16. Current and biobased method of manufacture of e-caprolactam.

 

(a) Corynebacterl'um glutanicum.l4 (b) refluxing hexanol. (c1) NHZOSO3H, KOH. (c2)
Pt-S/C ,250 °C, 150 psi HzS/HZ. (d) Hz/Pt. (e) propylene, HZSM-12. (f) i) 02 ii) H2804.
(g) i) Oz/Co, ii) Cu/Zn. (h) Hz/Pd. (i) i)(NHzOH)2HZSO4 ii) NH3. 0) 1) H2504 503, ii)
NH3. (k)TS-1.

L-Lysine as starting material also benefits from being the second most abundant

amino acid produced12 because of its importance in agriculture. Farmers, in essence, are
in the business of protein turnover. When a marketable protein, in the form of poultry,
swine or bovine type, needs to build mass through protein, feed is administered containing
supplemented limiting amino acids. It is more cost effective to supplement the limiting
amino acids from a purified stock than to use twice as much bulk feed resulting in the
same amount of overall useful protein mass accumulation. The same idea drives why L-
lysine has become a major revenue stream for producers because of the utilization in food

additives, feed supplements, therapeutic agents and precursors for the syntheses of

. . 3 . . .
peptides or agrochemicals.l Introduced in 1957, the current manufacture of L-lysme IS

from microbial fermentation of Corynebacterium glutamicum and has Since been

improved to afford a titer of 170 g/L from D-glucose.”

53

Drs. Yang and Molefe looked at three different potential routes to e-caprolactam
using glucose derived L-lysine (Figure 17). Direct deamination to 6-aminocaproic acid
was not fruitful giving many undesired products with lack of separable distinction of
amino groups. A one-step direct deaminition and lactamization did not elicit desired
product selectivity and was unfit for industrial processes. The most promising results
came from first cyclizing the lactam to mask the terminal amine as an amide, and
deaminating the a-amino group. Cyclizations were quantitative in high boiling alcohols

and ethanol in a sealed Parr hydrogenation apparatus at 200 °C.
Catalytic deamination over Pt on Si02 and Mo-Ni-S on A1203 catalysts were

attempted to deaminate a-aminocaprolactam. Partial deamination was observed when a-

aminocaprolactam was subjected to reduction with sodium metal in 2-propanol (20%).10

Hydroxylamine-O-sulfonic acid was used to stoichiometrically deaminate a—

aminocaprolactam in 75% overall yield. Catalytic deamination with various transition
metals with or without sulfidation led to a maximum 60% yield of product by NMR.“

a-aminocaprolactam
”2'! 0

NH

D-glucose —> —> l NH
AN H3

e—caprolactam

CO-
2 \ - /
002
C\ +
NH3

6-aminocaproic acid

Figure 17. e-Caprolactam from L-Iysine.

S4

With intimate knowledge in the research of the utilization of L-lysine as a
precursor to e-caprolactam another source was looked upon in L-B-lysine. L-lysine

cyclized yields a-aminocaprolactam that upon hydrodenitrogenation gives our desired 8-

caprolactam. The three proposed mechanisms for deamination include two 8N2 type

mechanisms based on what looks like a hydride or thiol nucleophile or an El elimination15

(Figure 18).
HydrideO 8N2
H H
N OH H N O
uINHz -—> IIN.-—>H2 ...I'IMuNH2_> O _.2.. G
M'NH2
Tthl HSN2
00
M ,:28
"""NH2 —> HL‘HSH HZ-
H MNHz

O HO Ho

EZH
.IIIIINH2 /
M H2
H

C

'SH

Figure 18. Potential mechanisms for hydrodenitrogenation of a-aminocaprolactam.

lf the mechanism indeed goes through an E2 mechanism the denitrogenation may

be better facilitated if the amino group was on the carbon in the B-position. The
corresponding cyclized product would have a more labile proton which may enhance the
possibility of increasing the yield of the hydrodenitrogenation reaction (Figure 19). This

hypothesis could be easily satisfied by a migration of the amino group prior to cyclization.

55

H
NHg NH2
WW 9 ca
0 NH

th H
HeN’VWO” —> 0°
NHZO NH

Figure 19. Relative cyclizations of amino acid precursors.

Efforts proceeded towards the chemical, in vitro and in viva microbial synthesis of
L-[3-lysine. Under anaerobic conditions some C lostridium species utilize L-lysine as a sole
carbon source in which the first biodegradation step is an aminomutase reaction that
migrates the amino group to the B-position catalyzed by L-lysine-2,3-aminomutase (Figure
20). If L—B-lysine-S,6-aminomutase can be selectively inhibited and accumulation of L-B-
lysine is achieved, a suitable substrate for B-aminocaprolactam is just a cyclization away.
Dr. Molefe found that approximately 100 mg of protein from crude lysate was required to
convert 100 mg L-lysine to 77 mg of L-B-lysine under optimal conditions. This much

protein was obtained from 12 L of cultures incubated for 5 h.

56

O §1H3 O §1H3 §1H3 O §1H3 O O
L-Lysine L-lfi-Lysine 3,5-diamino 5-amino-3-keto
hexanoate hexanoate
d WSCOA e WSCOA _‘__ WSCOA _9__ WO—
NH3 0 O O
3-aminobutyryl CoA crotonyl CoA butyryl CoA butyrate

Figure 20. Degradation of L-lysine in Clostridium subterminale.

(a) L-lysine-Z,3-aminomutase. (b) L-B-lysine-S,6-aminomutase. (c) oxidative deamination.
(d) 3-keto-5-aminohexanoate cleavage enzyme. (e) 3-aminobutyrl CoA deaminase. (0
reductase. (g) hydrolysis.

In addition, additives are necessary for the bioconversion in crude cell lysates. a—
Ketoglutarate and pyridoxal phosphate are required to make the imine with L-lysine
whereas S-adenosylmethionine is required to generate the 5’-deoxyadenosyl radical

necessary to initiate the l,2-migration reaction of the amino group (Figure 22). L-lysine-

2,3-aminomutase is a 285 kDa protein, with Km: 2.8 x 10'8 M and 6.6 mM for S-

adenosylmethionine and L-lysine respectively. The enzyme catalyzes a reversible reaction

that has an equilibrium constant in favor of L-B-lysine over L-lysine of 6.7 at 37 °C and

. . 16
shows no IncorporatIon of solvent hydrogen atoms to substrates.

57

Cs-S
+ | y \ + CyS-S\
.. / / ‘CYS / /' S'Cs
CO2 HO/&f + S—SEe-Fq v_—‘ S—é-Eeé y
Ad l/ l/ 3 l/ l/ ‘3
HO Fe—S cyS fe—S Cys
S-adenosylmethionine + |
H3N +3 (3
co; 0
HO
HO Ad
CYS'S 2+
Fe—S —l
/l /l/S‘Cys
8—3 Fe\

\ l/ |/ $ °

S’Fe—S Cys i0
+ H0

+26 HO Ad

H3N 002—
AdoMet

Figure 21. L-lysine-2,3-aminomutase active site AdoMet generation mechanism.

58

O_ O
, H W M
Ado_CH2 H C H2N H2N o

 

 

2—O3PO I \

l

H
Ado-CH3 RAYco;
/ N

_ R H
2 03% l \ OH lg—CO‘
2

I

N ' N

l

Figure 22. L-lysine-2,3-aminomutase reaction mechanism.

59

l

Glutathione or mercaptoethanol is required to reduce the iron-sulfur cluster. This
implies that scaling up the isomerization in crude cell lysate would also require scaling-up

of these expensive additives in pyridoxal phosphate, S-adenosylmethionine and a reducing

agent regardless of the amount of time and effort required to harvest active lysate.10

The aminomutases in the biodegradation pathway can be differentiated. L-lysine-
2,3-aminomutase is an S-adenosylmethionine dependent iron-sulfur [4Fe4SJ cluster active
site enzyme whereas L—B-lysine—S,6-aminomutase has a adenosylcobalamine active site
reaction. The only difference in reaction is in the source of the adenosylmethionine
(AdoMet) radical. Both are also pyridoxal phosphate dependent (Figure 21).

In L-B-lysine-S,6-aminomutase it has been documented that intense light (550

nm)1 can presumably Inactivate the actIve SIte IrreverSIbly18 by SClSSlon of the weak Co-

C (2540 kcal/mol) bond of the adenosylcobalamine in vitro.

60

Results

Bioconversion of L-Iysine to L-fi-Iysine

Since L-B-lysine is not commercially available authentic material was synthesized

concurrently according to work in the Seebach lab!9 and achieved as in literature

description (Figure 23).

O a O b O O
NH2 082 NH CBz NH
CB2 082
O
—C—> N —C-l-——b- OH
HN 2 HN
CB2 NH CBz NH O
082 082

e
——> H2N/\/Y\n,OH
NH2 0

Figure 23. Arndt-Eistert homologation of L-ornithine yielding L-B-lysine.

(a) NaOH, CBzCl, CHZCIZ, O 0C. (b) i-BuOCOCl, N-methyl-morpholine, THF, -5 0C. (c)
CHZNZ, Ether. (d) PhCOZAg, N-methyl-morpholine, THF, H20, O 0C. (e) Pd/C, HCOZH,

MeOH.

C lostridium subterminale SB4 from ATCC (29748) is grown on L—lysine and yeast
extract rich agar plates. C. subterminale is an anaerobic bacterium isolated from sludge in
a L-lysine rich medium. L-lysine-2,3-aminomutase is itself an enzyme that needs to be
stored in an anaerobic environment. All manipulations were carried out in an anaerobic

Coy chamber (with an atmosphere consisting of 5:15:80 mixture of

61

hydrogen:C02:nitrogen) in sealed Hungate tubes, Pyrex bottles or bags. After incubation

a single colony inoculates 5 mL of semisolid (soft agar) L-lysine and yeast extract

medium. The 5 mL culture tube is placed on a 37 °C bench-top shaker until OD600 ~ 2.

400 mL of a 4 L L—lysine and yeast extract rich medium is inoculated with the 5 mL

growth medium and incubated at 37 °C and 200 rpm. Once the OD600 reaches 2-2.5 the

400 mL growth medium inoculates the remaining 4 L medium. Once the aforementioned
optical density is achieved, about 24 h, the cells are centrifugated at 7000 g for 15 min and
the cells are collected yielding about 1.5-2.5 g of an off-white pellet of cells per liter. The
cells are directly placed in the —20 °C freezer unless noted. Prior to use, the cells are

thawed in ice and then resuspended in a L-lysine rich medium, with sodium dithionite or

dithiothreitol and FeSO4 (3 mM) and allowed to shake at 37 °C, 200 rpm and irradiated

with a common, tungsten based, flood lamp to inhibit 5,6-aminomutase.18 Without

irradiation or with partial irradiation, isomerizations resulted in trace amounts of L—B-
lysine, if detected, and all carbon flow led to acetate and butyrate as evidenced by NMR
and resulting pH that was detrimental to the cultures. The resulting medium is acidified
and the supernatant is decanted after centrifugation. The supernatant is then passed
through an Amicon Ultrafiltration apparatus (10 kDa filter) to remove any remaining cell
debris and protein. All the following experiments were at least averages of duplicate

experiments (Table 1).

62

Entry Suspension L-lysine Buffer Days °/o Conversion

 

Volume (mL) Concentration (80mM) Frozen
(mML

1 250 50 Tris 0 14
2 250 50 Tris 1 56
3 250 a 50 Tris 1 53 (56)b
4 250 50 Phosphate 1 54
5 250 50 Phosphate(10mM) 1 11
6 250 100 Phosphate 1 18
7 500 50 Phosphate 1 28
8 250 25 Phosphate 1 100
9 250 50 Phosphate 1 73
10 250 100 Phosphate 1 55
1 1 500 50 Phosphate 13 100
12 250 100 Phosphate 13 100

 

Table 1. Clostridium subterminale SB4 bioconversion of L-lysine to L-B-lysine.

(a) Entry 3 is an additional experiment using a resuspension of cells used in entry 2 for a
second isomerization fermentation. (b) % conversion of prior run with identical cell
resuspenSIon.

Initial bioconversions using fresh cell pellets did not yield good results. It was
serendipitous that cells frozen for a particular experiment resulted in a higher conversion
rate (Table 1 entries 1 vs 2). Turnover seems apparent when comparable results were
obtained from two sequential bioconversions. After bioconversion cells were
centrifugated and resuspended in a fresh L—lysine rich medium yielding the same result
(Table 1 entries 2 vs 3). Using phosphate as a buffer is more cost efficient and widely
accepted industrially leading to a switch in buffers that did not affect the conversion
(Table 1 entries 2 vs 4) while lowering the concentration, ie buffering capacity, had a
negative effect (Table 1 entries 4 vs 5). To verify the limits of the bioconversion,

substrate concentrations and volumes were doubled (Table 1 entries 6 vs 7) with little

promise for further throughput. As seen in (Table 1 entries 4 vs 9) variability in

63

conversion capabilities did exist and further experimentation used colonies grown from
the same glycerol stock. Lowering of the L-lysine starting concentration did lead to
complete isomerization of L-lysine to L-B-lysine (Table lentries 8 vs 9 and 10). Stemming
from the observation that freezing the cells led to better conversion of substrate, cells were
kept in the freezer for 2 weeks and surprisingly the isomerization amounts went two-fold
higher either in terms of concentration or volume (Table 1 entries 10 vs 12 and 9 vs 11).
Past experience shows that running crude lysate enzyme activities are usually two-fold
less when cells are frozen prior to the assay than when run fresh. Experimental reasoning
was not sought to determine what affect the frozen cell pellet had on the bioconversion.
Possibly low temperature affects L-B-lysine-S,6-aminomutase moreso than other proteins
or more likely the thawing process may be detrimental to the active site. Lysing of cells
and, in essence, posing an in vitro synthesis of L-B-lysine as a whole is unlikely because
much larger quantities of L-lysine were isomerized than in traditional in vitro experiments

and resuspensions showed that the subsequent syntheses were reproducible.

Purification of L-fi-Iysine

In incomplete conversion experiments L-B—lysine was differentially eluted from L-
lysine based upon slight basicity differences. The L-lysine carboxyl group pKa is about
2.2 while L-B-lysine is closer to 3. When the buffered eluent is at a pH of 2.75 with a
mixture of L-lysine and L-B-lysine there are differently charged substrates allowing a

means of separation of two similar compounds. The isolation of L-B-lysine is carried out

on strong cation exchange resin Dowex-50Wx4 (H") 200-400 mesh.l6 Supernatant of the

C. subterminale bioconversions is brought to pH 2 with HCl and run into 500 mL of resin.
The samples are thoroughly washed and L-B-lysine and L—lysine are then differentially

eluted with a 0.2 M sodium formate, 0.35 M sodium chloride system at pH 2.75. The

pooled L—B—lysine fractions, determined by lHNMR, are diluted two-fold and run into a

separate 75 mL of cation exchange resin and desalted by washing with water. Dilution
may or may not be necessary, the reasoning for this step is to ensure that there is ample
contact time so the amino acids can bind to the resin. The amino acid retained on the resin
is then eluted with 1 N ammonium hydroxide. The resulting solution is concentrated in
vacuo to yield L-fi-lysine. An ethyl acetate extraction may be necessary to remove an
unidentified organic impurity after elution from the column. Acetic acid accumulates due
to hydrolysis of ethyl acetate and is removed by acidifying with HCl and concentrating the
product to dryness.

In complete conversions where all L-lysine is consumed the purification of L-B-

lysine follows the preceding paragraph with the exception of the first Dowex column.

Abbreviated process for bioconversion of L-lysine to L-fi-Iysine

A look into (Table 2 and Table 3) gives insight to the compiled steps and time

allotments in order to isomerizes L-lysine to L—B—lysine and purify the product.

65

 

 

Step Procedure for Bioconversion Time (h)

Clostridium subtermina/e from ATCC is grown anaerobically on

1 . . 24
yeast extract, L-Iysme, buttered agar plates and Incubated.

2 Individual colonies are grown anaerobically in 5 mL yeast 24
extract, L-Iysine, buttered, semisolid media and incubated.

3 The 5 mL growth culture inoculates 400 mL yeast extract, L- 12
lysine, buffered media and is incubated.

4 The 400 mL growth culture inoculates 4 L yeast extract, L- 12
lysine, buffered media and is incubated.

5 C. sub cells are harvested by centrifugation. 2

6 C. sub cells are quick-frozen and stored at —20 °C. 12

7 C. sub cells are thawed in ice. 3
C. sub cells are resuspended in L-Iysine, buttered media and

8 . . . . . . 24
Incubated under Irradiative condItIons.
Alotted time for complete bioconversion 113

 

Table 2. Procedural outline with time allotments for bioconversion to L-B ~1ysine.

66

 

Step Procedure for Purification Time (h)
1 Centrifugation to remove cell debris 0.5
2 Acidity to precipitate protein and centrifugation 0.5
3 Ultrafiltration to remove any residual protein 4
4 Bring sample to pH 2.0 and load onto 500 mL of Dowex 0 5
50Wx4 ‘

5 Wash column 8

6 Differentially elute fi-Iysine with 0.2M formic acid, .35M 8
sodium chloride solution

7 Dilute like fractions (2x) (pH 2) and load onto 75 mL of Dowex 6
50Wx4

8 Wash column 2

9 Elute product with 5 bed volumes of 1M ammonium 1
hydroxide

10 Concentrate sample to dryness 1

11 Continuous extraction with ethyl acetate 4

12 Acidity aqueous layer with hydrochloric acid (pH 1) and O 5
concentrate '
Alotted time for complete purification 36

 

B-Amino acids have interest pharmacologically and to a lesser extent industrially.

. . . 20
have been shown to fold secondary structures In a predictable fashIon.

Table 3. Procedural outline with time allotments for purification of L-B -lysine.

Attempts towards a convergent route to fl-amino acids

Drug targets that use B-amino acids have a distinct advantage over their common

counterpart. Proteases do not generally destroy B-amino acids leading to the possibility of

longer half-lives in the body. B-amino acid drug targets at peptide levels and higher also

67

Production by

traditional chemical synthesis is a possibility with expensive reagents in multiple steps
that in the end produce racemized enatiomers that require purification. If a whole cell
biocatalysis is possible and L-lysine-2,3-aminomutase has promiscuity, this could be a

plausible alternative synthesis of B-amino acids. Isomerizations using L—lysine-2,3-

aminomutase have patented promiscuity and isomerizes an array of amino acids in vitro.21

Just as conducted for the L-lysine to L-B-lysine bioconversion, the in vivo
experiments were conducted on ten buffered amino acids solutions: ornithine, glutamine,
cysteine, threonine, arginine, methionine, glutamic acid, aspartic acid, asparagine and

serine. Basis for conversion was visualized by the resonance of newly formed methylene

during isomerization by lHNMR. At first glance a feeling of gratitude was achieved when

finding the diagnostic methylene resonance for the isomerization of aspartic acid. After a
quick deliberation it was realized that this experiment was not definitive in this case
because the isomerization yields the starting material! The amino isomerization to the
beta position was not observed in any case. Interestingly some metabolites from different
amino acids were identical and cysteine was toxic to the cells evidenced by a precipitation

of the cells. Further promiscuity experimentation was not conducted.

Cyclodehydration to wards lactams

Lactamization differentiates the amino groups for deamination. Conditions for this

. . . . . ll
cyclodehydratIon forming 7-membered lactams were InvestIgated preVIously.

Essentially quantitative cyclodehydration was observed in 2-4 h when refluxed with high

boiling point alcohols such as 1,2 propanediol, hexanol, among others and also worked

68

well with ethanol in a Parr apparatus that could be pressurized sufficiently to ramp the

temperatures to 200 °C (Figure 24).

Ian

alcohol

OH > O
Hsz 150-2000 C, 2 h 0

NHQO NH

 

Figure 24. Cyclodehydration of L-B-lysine.

Interestingly, the highest yield (98%) and shortest time (2 h) for the conversion of
L-lysine to a-amino-e—caprolactam were observed in refluxing 1,2-propanediol. 1,2—
propanediol is obtained from the hydrogenation of lactic acid, which is obtained from
fermentation on large scale for food and polymer applications. As observed before, the
reaction yield in the cyclization of L-lysine decreased when the reaction temperature is
above a certain temperature. In fact, all L-lysine was consumed after refluxing in glycerol
(290 °C) for less than 10 min and no desired product was observed.

Different size lactams play an important role even outside of Nylons and can be
beneficial in natural product syntheses, pharmaceuticals among other potential uses. The
cyclodehydration methodology was further subject to the formation of 8-membered ring

lactams. 7-aminoheptanoic acid was purchased and D,L-homolysine was synthesized

according to literature precedent.22 Lactamization was detected in refluxing hexanol,
propanediol and ethanol at 200 °C, however the yields all failed to rise above 10%. Eight
membered rings are implicitly difficult in formation. The torsional strain and
conformations of eclipsing hydrogens in the product help explain the limitations. L-lysine

and L-B-lysine were lactamized under these conditions in > 95% yield.

69

Hydrodenitrogenation of ,B-aminocaprolactam

With successful quantitative, multi-gram scale, in vivo isomerization of L-lysine
to and purification of L-B-lysine, the substrate was probed as a hopeful precursor to e-
caprolactam. After purification, cyclization of L-B-lysine yields B—amino-e-caprolactam in

yields above 95%. The hydrodenitrogenation conditions of both the cyclic and acyclic
forms of the molecule were to be investigated based upon previous work by Dr. Yang.11
Hydrodenitrogenation of a-amino-e—caprolactam was researched in the group and
optimized conditions on this substrate were instituted on B-amino-e-caprolactam in hopes

for a more dominant production yield with milder conditions (Table 4). Time-points

within reaction completion were analyzed by NMR.

70

 

Substrate Catalyst Temp Time Atmosphere Solvent Result

 

(1 mol %) ( °C) (h) (gas, psi) (compound, yield)
L-B-lysine Pt/C 300 6 H2, 50 H20 pyrrolidine, 60
L-B-lysine Pt/C 250 6 H2, 50 H20 pyrrolidine, 61
L-B-lysine-HCI Pt/C 300 6 H2, 50 H20 pyrrolidine, 59
L-B-lysine-HCI Pt/C 300 6 D2, 50 H20 D incorporation
L-B-lysine-HCI Pt/C 300 6 H2, 50 020 No D incorporation
B-amino-
s-caprolactam Pd/C 300 8 H2, 50 THF decomposition
[BI-amino-
s-caprolactam Pd/C 200 8 H2, 50 THF decomposition
8-amino-
e-caprolactam Pd/C 100 8 H2, 50 THF decomposition
B-amino-
e-caprolactam Pt-S/C 300 8 H22H28, 50 THF decomposition
B-amino-
e-caprolactam Pt-S/C 200 8 Hgil'lgs, 50 THF decomposition
B-amino-
c-caprolactam Pt-S/C 100 3 H22H28, 50 THF e-caprolactam, trace

 

Table 4. Hydrodenitrogenation of acyclic L-B-Iysine and B-aminocaprolactam

The reaction conditions applied to B-aminocaprolactam lead to unwanted results of

mostly decomposition products when conditions reached levels that starting material was

converted. e-Caprolactam was produced in < 1% yield based on lHNMR in the case of

(Table 4 last entry). Interestingly, pyrrolidine was the final product of the aqueous

hydrodenitrogenation reactions of L-B-lysine with little impurity present directly from the

71

Parr apparatus. Authentic pyrrolidine was characterized against the hydrodenitrogenation

product by lH and l3CNMR.

Pyrrolidine is used as a building block within several industries. Pharmaceuticals
use pyrrolidine in the manufature of Buflomedil (vasodilator, spasmolyticum), Bepridil
(Calcium antagonist), Simvastatin (Cholesterol-lowering drug) and Cefepime
(Cephalosporin antibiotic). Agrochemicals include pesticides and agents for crop
protection. Material uses of pyrrolidine include: polyurethane catalysts, plasticizers,
photographic chemicals, curing agents in epoxy resins, dyes, water treatment related

polymers, catalysts for aldol—condensations, emulsifiers, corrosion inhibitors and rubber

.. . 23
aUXlllal’leS.

This ring closure type of rearrangement was observed in the hydrodenitrogenation

. . ll . . .
reactions of a-aminocaprolactam. Usmg L-lysme as substrate the mechanism proposed

by Pal24 to pipecolinic acid went through an oxidation of the amine group forming an
imine, followed by hydrolysis of the imine to yield an a-keto acid or an aldehyde with the
by—product release of ammonia, allowing for an intramolecular condensation of the
remaining amino group with the carbonyl forming two cyclic Schiff base intermediates
which are just a reduction away from pipecolinic acid. An example of this reaction
mechanism is given with L-B-lysine as substrate (Figure 25).

Deuteration in both the alpha and possibly the beta positions (purification of

pyrollidine is necessary because of overlapping resonances in the 2DNMR spectrum) to

the nitrogen in the pyrrolidine ring was demonstrated using D2 as the hydrogenation gas.

Incorporation of deuterium was not evident using deuterated solvent.

72

 

H3N
NH20
H2
H2NNW° H2N’VWO
NH2 0 5H 0
H20 H20
NH3 NHa
_ + _

Figure 25 . L-fi-lysine to pyrollidine adaptation from L-lysine to pipecolinic acid.

73

Discussion

Chemoenzymatic synthesis of e-caprolactam from glucose was marginally
achieved albeit only in a demonstrative way. Whole cell biocatalysis of industrially,
glucose derived L-lysine to L-B-lysine was demonstrated with use of anaerobic
fermentation of Clostridum subterminale SB4 recruiting natural enzyme, expressed at
genomic levels, lysine-2,3-aminomutase and selectively inhibiting lysine-5,6-
aminomutase in the biodegradation pathway of L-lysine to acetate and butyrate. Inhibition
was successful with light irradiation from a tungsten-based flood-lamp presumably
assisting in the suicide inactivation of the weak Co-C bond in the adenosylcobalamin
active site yielding gram-scale, in vivo and complete isomerization conditions of L-lysine
to L-B-lysine.

Subsequent cyclization methodology developed in the Frost lab was applied to L-
B—lysine, homolysine and 7-aminocaproic acid further demonstrating lactam forming
cyclodehydration reactions with use of high boiling point alcohols or of pressurized low
boiling point alcohols. The formation of 7-membered lactams was successful in near
quantitative yields, while the formation of 8-membered lactams resulted in less than 10%
conversion, which was not surprising with the inherent problems associated with ring
structures of that size.

Hydrodenitrogenation of B-aminocaprolactam led to unwanted decomposition
products where only trace amounts of e-caprolactam was detected by NMR.
Decomposition of substrate even at much milder conditions than the deaminations of a-

aminocaprolactam is unfortunate stemming from the fact that the selective C-N bond

74

cleavages are not trivial with comparably or less energetic bonds elsewhere in the
molecule.

Hydrodenitrogenation conditions for acyclic L-B-lysine in aqueous conditions were
interesting in the serendipitous reactions yielding another petroleum—derived chemical in
pyrollidine. Optimization and further mechanistic studies towards the generation of
pyrollidine was not pursued being tangential to the project of focus.

In order for e-caprolactam produced chemoenzymatically to compete with
petroleum derived manufacture at aroundv$2.50/kg would require high yielding, cost
effective routes. It is becoming more attractive as societies awareness of renewable
resources surfaces and petroleum prices go up as predicted. Yet a facility, assuming the
improbable hydrodenitrogenation reaction gave a moderate to high yield of e-caprolactam
from L—B-lysine and had more cost effective purifications associated with it, would have to
supply both aerobic and anaerobic fermentation knowledge and specialized equipment.
The number of unit operations, compounded by the low yielding reactions make this route

to a commodity chemical unrealistic.

75

CHAPTER TWO REFERENCE

' Chemical Week 2003, 165(29), 26.
2 Dahlhoff, G.; Niederer, J.P. M.; Hoelderich, W. F. Cat. Rev. 2001, 43, 381.

3 a) Hoffman, J. Chemical Market Report, 2000, 258 (9), 3. b) O’Driscoll, C. Eur. Chem.
News 2005, 82, 2152. c) Ichihashi, H.; Sato, H. Appl.Catal. A: General 2001, 221, 359. (1)
Thomas, J. M.; Raja, R. Proc. Nat. Acad. Sci. 2005, 102, 13732.

4 (a) Dahlhoff, G.; Niederer, J. P. M.; Hoelderich, W. F. Catal. Rev. 2001, 43, 381;
(b)Morgan, M. European Chem. News 2005, 81, 2128.

5 Eul, W.; Moeller, A.; Steiner, N. Kirk-OIhmer Encyclopedia of Chemical Technology;

Wiley: New York,
http://www.mrw.interscience.wiley.com/kirk/articles/hydrhess.a01/sect1 1-fs.html

6 Funken, K. H.; Muller, F. J.; Ortner, J.; Riffelmann, K. J.; Sattler, C. Energy, 1999,24,
681.

7 (a) Beckmann, E. Ber. 1886, I9, 988; (b) L. De Luca, G. Giacomelli, A. Porcheddu, J.

Org. Chem, 2002, 67, 6272-6274; (c) S. Chandrasekhar, K. Gopalaiah, Tetrahedron Lett.,
2003, 44, 755-756.

8 Thomas, J. M.; Raja, R. Proc. Nat. Acad. Sci. 2005, 102, 13732.

9 Fisher, W. B.; Crescentini, L. Kirk-OIhmer Encyclopedia of Chemical Technology;
Wiley: New York, 2004.

‘0 Molefe, M. PhD Dissertation, Michigan State University, 2005.
H Yang, J. PhD Dissertation, Michigan State University, 2007.

'2 Comara Greiner, E. O.; Gubler, R.; Yokose, K. CEH Marketing Research Report:
Amino Acids; SRI Consulting: Menlo Park, CA, 2003.

'3 a) Tryfona, T.; Bustard, M. T. ProcessBiochem. 2005, 40, 499.

76

b) Weuster-Botz, D.; Kelle, R.; Frantzen, M.; Wandrey, C. Biotechnol. Prog. 1997, 13,
387.

‘4 Kinoshita, S.; Udaka, 5.; Shomono, M. J. Gen. Microbiol. 1957, 3, 193.
‘5 Hadjiloizou G.C.; Butt J.B.; Dranoff J.S., Ind. Eng. Chem. Res. 1992, 31, 2503.

‘6 Chirpich, T.P.; Zappia, V .; Costilow, R.N.; Barker, H.A. J. Biol. Chem. 1970, 245,
1778.

‘7 Andrunion,T.; Zgierski, M. 2.1. Am. Chem. Soc. 2001, 123, 2679.

'8 Tang, K.H.; Chang, C.H.; Frey, P.A. Biochemistry. 2001,40, 5190.

'9 Abele, s.; Guichard, G.; Seebach, D. Helv. Chim. Acta. 1998, 81, 2141.

20 Lil jeblad, A.; Kanerva, L.T. Tetrahedron. 2006,62, 5831.

21 Frey, P.A.; Ruzicka E]. US. Patent Application 20030113882. September
22 Payne, L.S.; Boger, J.J.Syn.Commun. 1985,15, 1277.

23 DSM.com, “Exclusive Synthesis/Intermediates”

http://www.dsm.com/en US/html/(lfc/products actis pyrrolidinelitm (accessed February,
08)

24 Pal, B.; lkeda, S.; Kominami, H.; Kera, Y.; Ohtani, B. J. Catal. 2003, 217,152.

77

CHAPTER THREE
D-Glucose Derived Phloroglucinol

Introduction
Phloroglucinol is currently most utilized in diazodyes, polymer crosslinking,

. . . 1 . .
pharmaceutical agent bu1ld1ng blocks , and as a precursor to stable energeucs, pamcularly

1,3 ,5-triamino-2,4,6-trinitrobenzene (TATB) (Figure 26).23

N02 N02 N02
HO OH HO OH 1310 OEt H2N NH2
$ OQN No2 02N no2 OZN N02

OH OH OEt NH2
pG TATB

Figure 26. Current manufacture of TATB

(a) i) NaN02,NaOH, ii) dilute HNO3, iii) 70% HNO3. (b) (C2H503)3CH. (c)NH3,
CZHSOH.

The synthetic utility of phloroglucinol is vastly overshadowed by the pitfalls of its

current manufacture (Figure 27). Petroleum-derived trinitrotoluene (TNT) is the precursor

to phloroglucinol and ultimately TATB synthesis.l4 TATB has a higher detonation

velocity relative to TNT and comparable to RDX and HDX, two of the highest explosive
materials used in the military, with greater thermal stability. TATB is used in
formulations of PBXN-7 a fuse booster associated in the FMU-l39 series bomb fuses that
are part of the MK80 general purpose bombs. The MK80 series account for a majority of

bombs used in aerial assaults.

78

COZH

OzN. : ,NOQ OZN. : ,N02 H2N NH2 HO OH
E: a b c I I d I :I
———-> ——> —> —>
N02
TNT

N02 NH2 OH

Figure 27 . Current manufacture of phloroglucinol

(a) HNO3, H2804. (b) N32Cl'207, H2804. (C) F60, HCl. (d)stO4, 108 0C.

Aside from the fact that TNT has obvious explosion risks, it is flawed by necessary
separation from incomplete nitration by—products that have had treatment with sodium
sulfite. These treated by-products are the culprits of large “red water” environmentally
detrimental waste streams. Large quantities of metal salts, one being carcinogenic
hexavalent chromium, are produced in the chemical reactions from TNT to phloroglucinol
as well. The aforementioned downfalls of phloroglucinol manufacture have precluded the
production in the states and Europe.

Phloroglucinol could have applications in the cosmetic industry through
manufacture of trimethoxybenzene that is one of the three compounds in the essence of
rose. Use of a phloroglucinol o-methyltransferase and orcinol o-methyltransferases a
biocatalytic approach can be envisioned for in vivo methylation of phloroglucinol. There
is also possibility of a chemoezymatic synthesis of trimethoxy benzene taking
biocatalytically derived phloroglucinol and finding conditions for chemical methylation

(Figure 28).

79

0“ 001+, OCH3

,‘CL‘: g? Q O
—>
- HO OH HO OH H 3C0 OCH3

HO OH

Figure 28. Synthesis of trimethoxybenzene from glucose.
(3) W3110serA(DE3)/pBC2.274 (b) phloroglucinol o-methyltransferase (c) orcinol o-

methyltransferases.

Phloroglucinol may have a profound impact in the near future with introduction
into the phenol-formaldehyde resins. So-called novolak and resole—type resins account for
almost a $4 billion per year industry. Phenolic resins uses are found in a wide array of

adhesives, coatings, glues and paints. In 2000, 4 million tons of phenolic resins were

consumed worldwide with roughly half produced in the US.5 About 50% of the US
consumption is in the adhesives used in plywoods that add structural integrity and weather
resistance. Another large consumer product containing phenolic resins include the
binding material that keeps the glass strings of insulation together. The reason that
phloroglucinol may be important stems oddly enough from the ties of formaldehyde
making the list as a known carcinogen in 2004 by the World Health Organization. Out-
gas of formaldehyde, the root cause of “sick building syndrome”, from these common
construction materials has made developers look elsewhere for a nontoxic aldehyde. To
balance out the lower reactivity of possible replacement aldehydes the co-monomer must
be more reactive to yield similar polymers. Phloroglucinol and resorcinol have
magnitudes higher polymerization reactivity compared to phenol that could also benefit
the use of a variety of renewable source aldehydes. Resorcinol (1,3-dihydroxybenzene),
which can be derived from phloroglucinol as discussed later, and phloroglucinol have that

potential with added benefits of tunability with derivatization of the hydroxy groups

80

and/or aromatic ring (Figure 29). Derivitization and tunability lead to more control over
what characteristics the final polymer yields. Resorcinol and phloroglucinol, being

polyols could react with diacids and form aromatic bearing polyesters (Figure 29).

 

O O O O
HOMOK o’ulvllLIPG

11
(”CL
PG 0 O

O

 

 

 

 

Figure 29. Potential polymer applications of phloroglucinol.
(PG = unmodified phloroglucinol, PG’=modified phloroglucinol).

81

If within a single microbe catalyzed reaction from nontoxic glucose
phloroglucinol can be produced, then all of the aforementioned faults are avoided. The
first microbial biocatalysts giving a bio-based approach to phloroglucinol synthesis

converted glucose to triacetic acid lactone by design of a fatty acid biosynthetic pathway,

. . . . . 6 . . .
usmg Brevzbacterlum ammonlagenes fatty and synthase B. Trlacetlc aCId lactone can be

chemically manipulated to phloroglucinol (Figure 30). The highest titer (1.8 g/L) and

yield (6%, mol/mol) of triacetic acid lactone was synthesized from glucose by S.
cerevisiae lNVSCI .6

TNT

02N N02

a,b,c
0” N02 on

O AOH

———_>

h

OH
HO PG OH
d

OR _
\ n t/’ $ng 9
o o

TAL
R=H
R=CH3

HO OH

Figure 30. Phloroglucinol from TAL, TNT and glucose.6

(a) NazCrZO7, H2804. (b) Fe, HCl. (c) H2504, 108 °C. ((1) ref. 6 (e) Dowex 50 H*,
MeOH. (f) Na, MeOH, 185 °C. (g) 12 N HCl. (h) pth-expressing microbe.

Phloroglucinol exists in some derivitization in countless biomolecules, with 700

. 7 . . . .
c1ted by Bharate , a more succmct set of examples are given in (F1gure 31). The
biological activities of phloroglucinol containing molecules are widespread leading to

possibilities for massive amounts of pharmaceuticals and agro chemicals. 2,4—

82

diacetylphloroglucinol is a fungicide while thouvenol A has cytotoxic affects towards
ovarian cancer cells (Figure 31). Macrocarpals A,B inhibit HIV reverse transcriptase and
lysiside A reversed phenylephrine-induced vasoconstriction in rats. Chinensins have
inhibitory effects upon vesicular stomatitis virus and herpes simplex virus I and 11.

Oligomeric phloroglucinol make up phlorotannin molecules that are abundant in nature.

 

O OH O OH O
\
11
HO OH HO OH 3
2,4-diacetylphloroglucinol thouvenol A Macrocarpals A.B

OH
O O OH ._. ;
Homo/Y ’ OH
OH 0

Lysiside A

   

chinensin I

Figure 31. Derivatized phloroglucinol biomolecules with reported biological activity.

It was not until 2005 that a single gene responsible for the synthesis of unaltered
phloroglucinol was discovered.8 The biosynthetic gene cluster phlACBDE in

Pseudomonas fluorescens Pf-S produces diacetylphloroglucinol.9 Pseudomonas
fluorescens Pf-S was isolated in the plant rhizosphere of disease resistant plants and was

found to be directly involved in the prevention of black root rot in tobacco and take-all
disease in wheat.10 The appropriate heterologously, plasmid expressed, individual genes

led to the accumulation of phloroglucinol by Pth alone.8 Acetylphloroglucinols are

83

synthesized first by cyclization of three malonyl CoA precursors by Pth and is

presumably acylated sequentially by PhlACB (Figure 32). A protein PhlE is involved in

product export with a divergently transcribed pth-encoded regulator.” The

differentiation of triacetic acid lactone and phloroglucinol may be in the orientation of

decarboxylation (Figure 32).

OH
O _\OH

OH

\

O O

HOMSCOA
;/( 3002 )\

3CoASH
000 0000

I 0027

OH OH O OH O OH 0
f1 <1 —* ”not —* figs

0 O HO OH HO OH HO

TAL PG

HO 5”

OH

Figure 32. Biosyntheses of TAL, phloroglucinol and diacetylphloroglucinol.

The class of proteins that catalyze synthesis and closure to these aromatic
molecules are polyketide synthases (PKS). Three distinct types of PKS exist to date.
PKS’s all exhibit a B-keto-synthase (KS) unit that, in a head-to-tail fashion, incorporate
sequentially the addition of acetate units linking together a polyketide of various lengths.
Unlike their most commonly accepted ancestor, fatty acid synthases, PKS do not share, to

the same extent, the systems causing reduction or dehydrations to occur, therefore leaving

84

in tact the more reactive, polarized ketones. Configuration and proximity of these reactive
groups yield multitudes of substituted mono- and polycyclic products. With a varied
number of incorporated acetate units, derived from decarboxylations of malonyl CoA, and
the added number of ring closure conditions, the types of polyketide products elicited
range the entire spectrum of size, biological activity, and uses all from one simple acetate
building block. Some of the forefront uses for polyketide natural products include
treatments for physiological disorders, antibiotics, fungicides and pesticides, among
others.

Type I PKS are large, modular in order and consist of sequential domains that
catalyze desired reactions (Figure 33). Type II PKS rely on separable proteins, oftentimes
with distant positioning on the chromosome, that must come together independently and
form complexes that behave similarly to the Type I PKS subset mentioned earlier. Type
III, the smallest and simplest PKS, only utilize a KS domain with an active site cysteine as
the catalytic unit. Type III PKS usually exist as homodimers around 50 kDa in size and
consisted of primarily plant genes of the Chalcone synthase (CH5) and Stilbene synthase
(STS) likeness until about a decade ago when bacterial type III PKS were identified,

mostly due to bioinformatics searches of sequence similarity spawning from the

. . . . 12
Informatlonally rlch genomic era.

85

 

 

[ ell/AIL I) erAll >1 arming >

 

 

 

 

 

 

1. Transcription 1. Transcription 1. Transcription
2. Translation 2. Translation 2. Translation
( DEBS 1 X DEBS 2 I DEBS 3 j
Ioadin
9 Module 1 Module 2 Module 3 Module 4 Module 5 Module 6 end

 

 

 

”Ks Woe es in rec: in
3 i
S s

a
f0 o S S

Polyketide product

 

 
   

 

 

6-Deoxyerythronolide B

 

Figure 33. Type I polyketide synthase depiction.l3

AT=Acyltransferase; ACP=Acyl carrier protein; KS=Ketosynthase; KR=Ketoreductase;
ER=Enoyl reductase; DH=Dehydratase; TE=Thioesterase.

Pth was assigned as a 38 kDa protein that exists as a homodimer in solution.
Pth utilizes malonyl CoA as the primary substrate albeit with the poSsibility of
incorporation of one varied CoA substrate. The broad substrate specificity is

demonstrated accepting C4-C 12 aliphatic acyl-CoAs along with phenylacetyl-CoAs to
form C6-polyoxoalkylated a-pyrones mediated by a tunnel exiting the active site.14 Zha

also reports the kinetics and stability of Pth showing the kcat = 24+/-4 min.l ,K,,, = 13+/-1

1.1M, kcat/sz 1883 mM-lmin-l, all similar to the results found in the Frost lab along with

the feedback insensitivity data, which are substantially higher than other Chalcone

86

synthases. Pth is a relatively unstable protein losing 50% activity in 128, 74 and 7.2 min

at 25, 30 and 37 °C, respectively.”

Chalcone synthases and other Type III PKS have a highly conserved cysteine

. . . . . 12 . .
reSIdue w1th1n the active s1te. As a model the Pth was ahgned W1th a more

characterized protein in 1,3 ,6,8-Tetrahydroxynapthalene Synthase (THNS) isolated from
Streptomyces coelicolor, a known type 111 PKS. When the catalytic cysteines were
overlaid the known cys-his-asn catalytic triad of THNS was conserved in the input Pth
sequence along with the “gatekeeper” phenylalanines that either aid in decarboxylation
and/or detouring water that may hydrolyze the thioesters formed during the reaction.
Using known comparison to the mechanisms of the Chalcone family a mechanism
for Pth can be proposed (Figure 34). The active site cysteine, ionically supported by the
charged histidine residue, is primed with an acyl CoA through a thioester linkage and

releases the CoA thiol.

87

 

 

Loading Extension
C s C 8
His Sfi y 0 His —\_\ Sr y
T “““\\‘\“‘“ T
HNVN‘H‘ x RiSCoA HNvN~H O=<R
R \

o ”‘61 = o _

AanNJ'l’ Ufa \‘ Asn N,H---O? (6
H COA HSCOA H COA‘ S O 69

 

 

Figure 34. Catalytic triad and priming Pth mechanism.

The subsequent decarboxylation of another acyl-CoA undergoes a Claisen
condensation with the acylated cysteine residue and chemically breaks the thioester,
releasing the active cysteine for further extension of the polyketide. Pth has. only been
seen to utilize up to three malonyl-CoA, or one additive acyl-CoA and two malonyl-CoA
starter units, so it is postulated that in a final self-condensation of a decarboxylated

polyketide phloroglucinol is produced (Figure 35).

88

f
n S Cys
o J r
u \s _
His 0 His
HNvN. H O _. HN N. 0

Figure 35. Polyketide ring closing mechanism.

Drs. Jihane Achkar, Dongming Xie, and Mo Xain in the Frost lab collaborated on
the initial screenings of host and promoters for heterologous expression. The E. coli K-12
strains JWF1(DE3), KL3(DE3), and W31108erA(DE3) and E. coli B strain
BL218erA(DE3) were chosen to investigate the effect of host strains on phloroglucinol
production. The phloroglucinol productions, in M9 minimal salts culture medium with

glucose as the sole-carbon source, for E. coli BL21serA(DE3) or BL218erA expressing

pth under P77, P75, and PW promoters were also compared. All the experiments were

performed under glucose-limited fed-batch fermentor conditions and the temperature was

controlled at 36 °C. The E. coli BL218erA(DE3) expressing pth under P77 promoter

synthesized 3.5 g/L phloroglucinol while BL215erA expressing pth under P15 or Pm

89

promoter synthesized 2.3 g/L. Among all the strains investigated the E. coli
BL218erA(DE3)/pJA3.13lA (Figure 48) synthesized the highest titer and yield of
phloroglucinol, but the concentrations reached the maximum at 18 h, which is only 6 h
after the first IPTG induction (Figure 36). W3110serA(DE3)/pJA3.131A was the highest
titer and yield producing E. coli K-12 strain and synthesized the second highest titer of
phloroglucinol, which appeared at 24 h, i.e. 12 h after the first IPT G induction. Both

BL2lserA(DE3)/ pJA3.l3lA and W3110serA(DE3)/pJA3.131A were chosen for further

investigation.

 

A30 6
32% we 0 0 5g,
€20 “ Induction O O O ‘ 4 E
'03159 «3'9
310" ~23
0 o
b 5'“ - 1E
“O Q.
04 0

 

 

 

0121518 24 3O 36 42
time(h)

Figure 36. Comparative fed-batch phloroglucinol microbial synthesis of E. coli.

Phloroglucinol synthesized by W31 10serA(DE3)/pJA3.l31A (open circles, dry cell
weight; open bars, phloroglucinol) and BL218erA(DE3)/pJA3.13 1A (black circles, dry
cell weight; black bars, phloroglucinol) under glucose-limited culture conditions.

Optimized fed-batch microbial syntheses of W31108erA(DE3)/pJA3.131A and
BL21serA(DE3)/ pJA3.l3lA, which are K-12 and B-type E. coli strains respectively, with
plasmid harboring the pth gene isolated from P. fluorescens Pf-5 behind a T7 promoter
and a serA nutritional marker for plasmid maintenance was used for the process

optimization.

90

It was soon realized that there was a ceiling on phloroglucinol production of about

4—5 g/L, and that cells began to show stress when titers achieved 2 g/L indicated by
observance of culture characteristics and glutamic acid later identifed.15 The sensitivity to

phloroglucinol was verified on liquid and solid medium with added authentic

phloroglucinol and determined with lPTG induced production strains. Based on the

. . . . . . l6 . . .
prewous experience in the m1crob1al synthes1s of catechol the in situ, resm-based
extractive microbial synthesis was employed to eliminate sensitivity to phloroglucinol by

binding the produced phloroglucinol on resin (Figure 37).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

@D

 

 

 

 

 

 

 

 

Figure 37. Schematic diagram of fed-batch, in situ resin based extractive microbial
synthesis. (1) 1L working volume fermentation vessel; (2) PID controlled glucose
addition; (3) Externally IOOped, peristaltic pump driven, fluidized resin bed extractive unit.

Using the in situ, multi-column (columns were typically changed every 8-12 h
following induction while flowing at 8-12 mL/min), resin—based extraction, the
phloroglucinol concentrations in the culture medium were maintained below 1.5 g/L.

Compared with the fed—batch microbial synthesis without using resin-based extraction, the

91

extractive microbial synthesis improved the titers of phloroglucinol threefold and the yield
by twofold to 15 g/L and 11% mol phloroglucinol/mol glucose, respectively. To establish
whether or not phloroglucinol production could be a continuous process along side the
addition of young cells that can have more robust cellular function that have not been
subject to a sensitizer, a 2-stage, fed-batch continuous extractive microbial synthesis was
investigated (Figure 38). In many microbial synthesis processes, particularly for
secondary metabolite production, cell growth and product formation steps should be
separately operated owing to the fact that optimal conditions for each step are different.

Therefore, a two-stage continuous culture system may be more efficient than the single-

' . . . 7
stage mode by controllmg cell growth and product formation In different stages.1 °l8'19

For example temperature optimization at 36 °C for E. coli growth was found not to be the
optimal temperature for phloroglucinol production at 33 °C. This may be because of pth
genes host Pseudomonas has an optimal growth temperature of 30 °C, or that expression
of toxic protein have been shown to occur optimally at lower temperatures than ideal for a

given host.

92

 

 

Figure 38. Schematic diagram of two-stage, fed-batch, in situ extractive microbial
synthesis.

(1) 1L working volume production microbial synthesis vessel. (2) PlD controlled glucose
addition. (3) Externally looped, peristaltic pump driven, fluidized resin bed extractive unit.
(4) 1L working volume seed microbial synthesis vessel. (5) PID controlled diluted glucose
addition. (6) overflow collection.

Phloroglucinol production was doubled to 35 g/L (without inclusion of the volume
associated with the uninduced vessel), while the yield remained around 10% due to the
glucose consumption of the extra, uninduced, seed vessel. During the time of the two—
stage phloroglucinol production experiment evolution of the E. coli production strain was
attempted.

The sensitivity of the producing strains to phloroglucinol in the medium was
targeted for further improvement of in vivo phloroglucinol synthesis. Although the
sensitivity was alleviated by maintaining the phloroglucinol at low concentration using in
situ resin-based extraction, a phloroglucinol resistant producer would lower costs if an
external loop was discarded. The strategy used was to get cells from the microbial

synthesis of W31103erA(DE3) and BL215erA(DE3) when phloroglucinol concentrations

93

in the medium were above 3 g/L, streak out the strain onto LB plates containing
phloroglucinol (LB with 1-5 g/L phloroglucinol), and then incubate at 37 °C for a
selection of a colony that could grow on plates containing consistently higher
phloroglucinol concentrations. The single colonies were streaked out again onto LB plates
containing phloroglucinol for further cycles of evolution and excision of plasmid DNA.
Two strains, W31 103erA(DE3)* and BL21serA(DE3)*, which could stably survive on LB
plates containing phloroglucinol were evolved from their parent strains, W31108erA(DE3)

and BLZISerA(DE3).

Results

Sensitivity Screening

Growth curves of W31108erA(DE3)/pJA3.131A were established along side
sensitivity assays to phloroglucinol. Toxicity assays were developed in both liquid and
solid medium. Minimal salts plates were poured with glucose and authentic
phloroglucinol was added. W31105erA(DE3)/pJA3.l31A was grown on 0, 0.01, 0.05,
0.1, 0.2, and 0.4 g/L phloroglucinol on M9 minimal salts medium containing glucose
plates and allowed to grow at 37 °C for 24 h with signs of inhibition at 0.2 g/L and no
growth on plates containing 0.4 g/L phloroglucinol. In liquid M9 minimal salts medium
containing glucose, a 125 mL culture was aliquoted into tubes with appropriate amount of
phloroglucinol and blank medium added to consistently dilute the cultures and absorbance
at 600 nm was recorded with up to 10 g/L phloroglucinol concentration added. The

sensitivity is lower in liquid medium as only 5 g/L phloroglucinol (Figure 39) started to

94

have a profound negative impact on growth while lower concentrations of phloroglucinol

increase growth rate.

 

3.5

 

 

 

 

 

 

 

 

. e
X g 5 I I I
\'( X Y
n . l . .4
2.5 ' ‘—
51- o
o .
8 2 9M9 control
0 ’ IM9 +0.5 (g/L) PG
0 1-5 e ‘M9+1(g/L) PG
,.;..o°'eae,_, o 2‘ L XM9+2(g/L)PG
1 “ ' rM9+5(g/L) PG
0M9 + 10 (g/L) PG
0.5 ‘PG control 10(g/L)
0 ' 7 “‘ T J“ r 7‘ ifi
0 S 10 15 20 25
Time (h)

Figure 39. Phloroglucinol toxicity screening of W31105erA(DE3)/pJA3.131A

Phloroglucinol Microbial Synthesis

Microbial synthesis of W31lOserA(DE3)/pJA3.131A, W31108erA(DE3)*/
pJA3.l3lA, BL2lserA(DE3)/pJA3.13lA and BL218erA(DE3)*/pJA3.131A commenced
in fed-batch, single stage fed-batch extractive, two stage fed-batch extractive and five-
stage fed batch modes with phloroglucinol titers and yields depicted in (Figure 40), with a
representative profile in (Figure 41), (Figure 42), (Figure 43) and (Figure 44) and

quantified by gas chromatography according to response factor and isolated yields (as

95

discussed later). As a proof of concept towards reproducibility of the process, close to 300

g of phloroglucinol was isolated using the two-stage extractive microbial synthesis of

BL21serA(DE3)*/pJA3.l31A.

 

Fed-Batch Fed-Batch Extr. 2-Stg Contn Extr.

 

 

Titer(g/L) : Titer(g/L) : Titer(g/L) :
Entry Strain Yieldiolomol/mol) Yield(%mol/mol) Yield(%mol/mol)
l BL21serA(DE3)/pJA3.l3lA 3.8: 3 16.8: 12 35.0: 6
2 BL2|serA(DE3)*/pJA3.131A 4-3 = 5 172: 12 37-6 = 6
3 W31 IOserA(DE3)/pJA3.l3lA 36: 3 150: 11 N/A
4 W31 lOserA(DE3)*/pJA3.l3lA 4-0 : 5 17-0: 12 36-6 = 6

 

Figure 40. E. coli phloroglucinol production from microbial synthesis.

 

  

 

A30 6A
<‘ 5:,
9 b - 0 ’ . 9
3320 ....lnductl_0r1‘_-_! _____________ 0-24?
3. L 3g
B 10' ------------ 2 3
s » .1 g
D 0"”. 0 D.

 

0121518 24 30 36
time(h)

Figure 41. E. coli phloroglucinol fed-batch extractive microbial synthesis profile.

(black circles=dry cell weight, black bars=phloroglucinol in culture medium)

96

 

O)
O
N
01

lnducfion

45 k—bk—DHe—piflfljezo
, 5

j
\
93
E
Q)
3
75
O
E‘
'0

phloroglucinol (g/L)

 

 

 

O 1215 2128 36 48 60 72
time(h)

Figure 42. E. coli phloroglucinol single stage fed-batch extractive microbial synthesis
profile. (white circles=dry cell weight, grey bars=phloroglucinol in culture medium,
black bars=phloroglucinol total, number and arrows indicate a change in extractive
column and duration of time used respectively)

 

75 60
:t‘ 1 2 3 4 5 6 -- :t‘
E Id 1' o o o 406
9 451 n ucron .S
8 308
a 20 8’
° .9
% ~1°a

~0

 

 

 

01215 24 36 48 50 72 84 96
time (h)

Figure 43. E. coli phloroglucinol two stage fed-batch extractive microbial synthesis
profile. (white circles=dry cell weight, grey bars=phloroglucinol in culture medium,
black bars=phloroglucinol total, number and arrows indicate a change in extractive
column and duration of time used respectively)

97

 

V

UT
CD
0

 
      
     
   

j A
4—- #40—
.t: o
4 ........
g) 5 Ind ction O O O O 30 f3
3 2
_ 30 O o,
E 1 O 209
Q
15 O _- .9
s .108.
0 —* 0

 

 

0 12 15 24 36 48 60 72 84 96108120132144
time(h)

Figure 44. E. coli phloroglucinol five stage fed-batch extractive microbial synthesis
profile. (white circles=dry cell weight, grey bars=phloroglucinol in culture medium,
black bars=phloroglucinol total, number and arrows indicate a change in extractive
column and duration of time used respectively)

98

Transcriptome analysis of W3110serA(DE3)/pJA3. 131A

An approach to combat proposed phloroglucinol sensitivity to E. coli strains is to
determine what and if phloroglucinol targets to cause cell-death and bioengineer a new
microbial biocatalyst that is phloroglucinol resistant. Microbial organisms will oftentimes
induce expression of defense and export proteins when subjected to toxic chemicals. The
panic mode of the cell may induce efflux or transport systems along with membrane
channel protein expression (Figure 45). Transcriptome analysis can be a powerful tool to

indirectly analyze protein regulation.

phloroglucinol
binding receptor phloroglucinol

 

phloroglucinol v exiting cells
entering cells v 2
3 Increase efflux or other Q‘
‘ —’ protein expression
V // l \\ I
// j \

 

\ / m FiNA altered gene expression

induced response

\MWDNA

Transcriptome Analysis

Figure 45. Ideology behind use of transcriptome analysis

Affymetrix genechip microarray technology was utilized in the transcriptome
analysis. These genechips monitor RNA expression levels through fluorescence
measurements. Distinctive fragmented sequences of gene compliments are embedded as
“probes” to seek out subjected sequences. Sample cDNA with a fluorescent tag is placed

99

on the genechip. Complimentary strands will bind, the genechip will then be stained and
washed, and fluorescence will be monitored (Figure 46). Once analyzed, gene expression
levels are obtained and the information must be sorted with the utmost scrutiny. It is
important to note that regulation values do not necessarily correlate with increased
expression of proteins and even if that were true, upregulation of protein levels vary with
increased function of that protein, all disregarding the possibility of post-translational

modification deficiencies towards an unrelated over—expressed gene.

GeneChip9 Array

      

Figure 46. Affymetrix genechip microarray technology

E. coli 2.0 genechip array contains 10,000 probes for all 20,366 genes in four E. coli
strains: K-12, two 0157 strains, and CFT073.

Since it is not known how and if phloroglucinol is directly toxic to cells, two

different experiments were conducted. Dr. Ningqing Ran of the Frost lab was a coworker

100

on this project who looked at an approach subjecting outside additions of authentic
phloroglucinol (2 g/L) to healthy, non-phloroglucinol producing cells and analyzed gene

expressions 1 h after subjection (Figure 47).

E. ('(1/i grown in minimal salts medium

1 l

 

Control Experiment
W31 |(lscrA(DlZ3) W31|OserA(DE3)
i 37"C.lh 37°C!“ . l

(+ 2 g/L phloroglucmol)

Transcriptome analysis: Affymetrix Gcncchip E. coli 2.0

Figure 47. Transcriptome analysis of E. coli after addition of phloroglucinol

In other efforts, RNA levels are analyzed looking at phloroglucinol producing
strains. Knowing what genes are over-expressed may lead to delineating a phloroglucinol
export system, and it is possible that if phloroglucinol is toxic to the inside of the cell
over-expressing this export system may result in a more phloroglucinol resistant host
strain. Transcriptome analysis was conducted to determine up-regulated genes of a

phloroglucinol producing E. coli strain W3110 serA(DE3)/pJA3.13lA. In order to

101

substantially limit the number of up-regulated genes that are possibly unimportant in
phloroglucinol export, a non-phloroglucinol producing E. coli strain W3110
serA(DE3)/pBC1.l46 was constructed. pBC1.164 is a plasmid identical to pJA3.l31A

except that the region of the plasmid encoding the pth gene is missing (Figure 48).

-- -"'"' “"‘rv-E
//‘I w‘.H—g.._g_‘ ""m.‘

 

l/j/“V \-\::::\
//’ I‘;\
./ / Pf-5 th M
< . p KmR
~ -.\
PT7 \‘-‘I‘-
J 1,1 .
i i‘ pJA3.131A H ' [0801.146
" 1 1' II
aserA t/i '.
1 r“ /;e') A, 1
€9.34 iii-I}
[122’ \\§\ //’>
c laolQ / \‘tx 'aC'Q 9]

Figure 48. Plasmids pJA3.131A and pBC1.l46.

Comparison of the control and the phloroglucinol producing strain eliminates up-
regulation associated with other cellular functions and the burden of carrying a plasmid of

comparble size.

102

E. coli grown in minimal salts medium

Control: induced Experiment: induced
W3 I 10serA(DE3)/pBC l - 146 W31 10serA(DE3)/pJA3.l3 1A

 

 

l 36*‘C.18h 36"C,l8h(2g/L) l

Transcriptome analysis: Affymetrix Genechip E. coli 2.0

Figure 49. Transcriptome analysis of induced phloroglucinol producing E. coli

Once target protein inducing genes are found to be upregulated by transcriptome
analysis two strategies can help determine possible phloroglucinol efflux mechanisms.
One tactic employs chromosomal deletions of the critical nucleotide bases that encode the
protein. This deletion methodology is often called a “gene knock-out”. Once the knock-
out is successful the new host will undergo a series of toxicity screenings in both
suspension and solid medium. If the strain is hypersensitive to phloroglucinol then the
deleted gene will be over-expressed and the new host will then be subject to a microbial
synthesis process and phloroglucinol production will be monitored by established gas
chromatography methods. Should the host with over-expression of the gene, in which the

deletion caused hypersensitivity, increase phloroglucinol accumulation then the targeted

103

gene may be involved in phloroglucinol export. However showing a knocked-out gene is
hypersensitive does not explicitly give data that supports it is involved in phloroglucinol
export. The knock-out could be affecting another crucial export or encode for other
downstream expressions that are important in cell viability. If over-expression of the
knocked-out gene that lead to no phloroglucinol production leads to a more resistant host
and produces elevated levels of phloroglucinol there is reason to believe that the protein
that gene encodes for may have a role in phloroglucinol transport. The other strategy is
the reverse approach where you over-express the up-regulated genes and look for a
resistant host. There are chances for inherent problems to arise using this reverse
approach such as verification of actively expressed protein.

The following charts indicate some of the resulting cross referencing of
experiments that were found to have interesting gene expressions in comparison with the
aforementioned control, along with the extent of regulation indicated by fold cutoffs
determined post experiment where applicable. For complete transcriptome analyses and
graphical comparisons see experimental. Since up-regulated genes is the obvious starting
point, the genes found to be upregulated compared to the control of the phloroglucinol

producing experiment are listed in (Table 5).

104

 

Genes Upregulated (4x)

 

ach bioAD moaBC wecB yegN
ach cchB mopAB xerC yfaE
apaH celF nagABC yabN yfoN
argABCDFGHI clpB nrdABCDEFGHI yacH yfiA
aroH cspl nth yaeC yng
artJMPQ cysACDHIJMNW plsB yagDL ych
aan dnaJK ppx ybbN ygiAC
b0830, b0832.b0833 elaD pku YbCK yth
D1436 eno rfaC ybeFZ yibG
..
b1551 fimE rffGH ythS yjcV
b1632 glnD rygAB ybiJM yij
b2074 9118 5918 ych ythC
b2085 hisP sgcQ ycel yjiD
b2385 Hpr sodA ycfS yij
b2460 hthX spy yciW ykgH
b2758 iprB sseB ychX ymeE
b3400, D3401 manXYZ trpA ydeH yqelJ
b3913,b3914 mch udhA yde thD
betA metJK uvrC yeaD yqul
bglA micF uqu yebE yrfl-ll

 

Table 5. Upregulated genes found by transcriptome analysis in phloroglucinol
producing strain. (a) genes are at least upregulated fourfold while the bolded genes are
at least eightfold upregulated.

Narrowing down the roughly 4,400 genes of E. coli by transcriptome analysis was
a starting point for elucidation of a possible phloroglucinol export system. The
corresponding genes were carefully analyzed across phloroglucinol produced and
phloroglucinol added analyses (Figure 50 and Table 6) with emphasis towards overlapping
known export and membrane proteins (Figure 51 and Table 7). Further experimentation
was orchestrated by coupling the transcriptome results with both the 37 known E. coli
transport proteins and intuition of probable targets theorized prior to transcriptome

analysis from established literature.

105

109 171

Strain with phloroglucinol Phloroglucinol producing
added strain

Figure 50. Corresponding up-regulation twofold and greater in phloroglucinol
producing and phloroglucinol added transcriptome analyses.

 

Genes Up—regulated in both transcriptome analyses W3110
Definition

 

ach acyl carrier protein phosphodiesterase

ach possible efflux pump

apaH diadenosine tetraphosphatase

argA N-acetylglutamate synthase; amino acid acetyltransferase
argB acetylglutamate kinase

argC N-acetyl-gamma-glutamylphosphate reductase

argD acetylornithine delta-aminotransferase

argF ornithine carbamoyltransferase 2

argG argininosuccinate synthetase

aroH 3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (DAHP synthetase
artJ arginine 3rd transport system periplasmic binding protein
b0261 yagD

b0309

b0476 putative lipase

b0833

b0834 hypothetical protein

b0851 modulator of drug activity A

b1057 putative cytochrome

b1451 putative outer membrane receptor for iron transport
b1498 putative sulfatase

b1499 putative ARAC-type regulatory protein

b1500

b1501 putative oxidoreductase, major subunit

b1502 putative adhesin; similar to FimH protein

b1504 putative fimbrial-like protein

Table 6. Corresponding up-regulation twofold and greater in phloroglucinol
producing and phloroglucinol added transcriptome analyses.

106

Table 6. cont

D1 679
D1 688
D1 684
b1 730
b2074
b2085
b2385
b2680
b3050
b3051
b3840
b391 3
b391 4
baeS
bcr
bioA
bioD
celF
elaD
fimZ
fpr
garD
gidB
hscA
manX
manY
manZ
metJ
metK

micF
nagA
nagB
nrdE
nrdF
nrdH
nrdl
pka
rffH
rhsB
rygA
rygB
SPY
sseB
sufS
tch
trkA
uqu
wecB

wecD

hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
putative membrane protein

putative peptidase
hypothetical protein
putative oxidoreductase
putative membrane protein
Mg-dependent DNase

sensor protein (for BaeR)

bicyclomycin resistance protein; transmembrane protein
8-diaminopelargonic acid synthetase

dethiobiotin synthetase

phospho-beta-glucosidase; cryptic

putative sulfatase / phosphatase

fimbrial 2 protein; probable signal transducer
ferredoxin-NADP reductase

(D)-ga|actarate dehydrogenase

glucose-inhibited division; chromosome replication?
DnaK-homologue chaperone Hsc66

PTS enzyme IIAB

PTS enzyme IIC mannose-specific

PTS enzyme IID mannose-specific

repressor of all met genes but metF

methionine adenosyltransferase 1 (AdoMet synthetase); methyl and propylamine donor

regulatory antisense RNA affecting ompF expression
N-acetylgIucosamine-B-phosphate deacetylase
glucosamine-G-phosphate deaminase
ribonucleoside-diphosphate reductase 2
ribonucleoside-diphosphate reductase 2
glutaredoxin-like protein; hydrogen donor

6-phosphofructokinase ll; suppressor of pka
glucose-1-phosphate thymidylyltransferase
rhsB protein in rhs element

enhanced serine sensitivity

selenocysteine Iyase, PLP-dependent

putative kinase

transport of potassium

D-mannonate oxidoreductase

UDP-N-acetyl glucosamine -2-epimerase; synthesis of enterobacterial common antigen
(ECA)

107

Table 6. cont

yacH
yagL
ych
11990
yth
ybU
ych
ydeH
yebE
yecP
YegN
)flbN
yfiA
ych
ygiB
ygiC
yhaK
ythV
yth
ykKS
wa
weF
wgB
ng
ngi
yhX
yifN
yiel-
yjiD
viiM
ykgH
ynnD
ynfiE
thD

1191'

putative membrane protein
DNA-binding protein

putative fimbrial-like protein
hypothetical protein

putative amidase

putative enzyme
multidrug transporter

putative yhbH sigma 54 modulator
hypothetical protein

hypothetical protein

putative synthetase/amidase
hypothetical protein

putative enzyme

putative phosphatase

putative oxidoreductase

108

30 o 30

Strain with phloroglucinol Phloroglucinol producing
added strain

Figure 51. Corresponding up-regulation of transport or membrane protein encoding
genes fourfold in phloroglucinol producing and phloroglucinol added transcriptome
analyses.

 

Genes Up-re4gulated in both transcriptome Analysis W3110
flown genes encoding transport or

 

 

membrane proteins Description

ach RND multidrug efflux pump (typical substrate: aminoglycosides)
b1451 putative outer membrane receptor for iron transport
b3051 putative membrane protein

bcr bicyclomycin resistance protein; transmembrane protein

trkA transport of potassium

yacH putative membrane protein

YegN— (mdtB) RND multidrug transporter

 

Table 7. Corresponding up-regulation of transport or membrane protein encoding
genes fourfold in phloroglucinol producing and phloroglucinol added transcriptome
analyses.

Two known multi-drug export proteins with high transcriptional levels and
regulation were identified in Ach and YegN (MtdB). These two genes are prime targets
for a phloroglucinol export system. Some of the unknown proteins were not over-looked.
Many other known drug and toxic molecule transporters were also found to be up-
regulated in differing amounts by the two transcriptional analysis strategies. Down-
regulation of RNA expression is another target of interest. Import proteins may be shut

down to stop phloroglucinol from entering the cell.

109

ERGO BLAST bioinformatics searches gave rise to two E. coli proteins that had
greater than 50% homology with PhlE, the known diacetlyphloroglucinol export protein in
P.fluorescens. ijL and thB were hits in W3110 strains with yth upregulated in both
transcriptome analyses and Y ij, the putative regulator of ijL, was overexpressed
during the phloroglucinol producing analysis.

Several resources were utilized to target potential gene disruptions. ach, acrAB,
yegMN, bcr, trkA and yacH were targeted from the transcriptome analysis, yth was
targeted from homology with phlE and yieO, yicM, yth, yth, and yqu were looked at
because of literature precedent of the gene encoding for proteins with multi component

transport.

All knock—outs were conducted using the Wanner20 methodology with the
exception of yegMN which failed three times and was not completed. Confirmation of
each knock-out was verified by PCR amplification of genomic DNA outside of the target
sequence and observing a lower band shift indicating a loss of the gene on the
chromosome. Of the knock-out mutants not one showed significant deviation from the

control in the sensitivity assays in solid or liquid medium (Figure 52).

110

 

00600
0.09
vab

 

 

 

 

0 0.5 1 2 4 8
PG concentration (g/L)
-l- W3110serA(DE3)/pJA3.131A
+ W31 1OSerA(DE3)yth/pJA3. 131 A
W31105erA(DE3)yacH/pJA3.131A
+ W31toserA(DE3)yqu/pJA3.131A
+W31toserA(DE3)trkA/pJA3.131A
0.7 ~ ~ - - - ——~ ~77
0.61 ’7‘. a“. =:.x\' J
8 0,5 2--.---22 -9- -.
8 3'3
0 0.2
0.1 y _, .
0 2-2-2,- .. . I . Y. ’23.“;l .1
0 0.5 1 2 4 8
PG concentration (g/L)

+W31ioserA(DE3)/pJA3.131A
+ W3110serA(DE3)Yicm/pJA3.131A
6+ » W3110serA(DE3)YieO/pJA3.131A

00600

 

 

 

0 0.5 1 2 4 8
PG concentration (g/L)

+ W3110serA(DE3)/pJA3.131 A

-+ w311OSerA(DE3)ach/pJA3.131A
W3110serA(DE3)bcr/pJA3.131A

—-— W311 OserA(DEB)acrAB/pJA3.131 A

0.8
o 7 A

0.6 45% --__.__-Lss_
0.5

0.4
0.3
0.2
0.1
0 e
0 0.5 1 2 4 8

PG concentration (g/L)

 

 

 

 

 

 

 

 

 

 

+ W31105erA(DE3)pJA3.131 A

—-— W31 1 OserA(DE3)yth/pJA3. 131 A
- -W31105erA(DE3)ythpJA3.131A

-— W3110$erA(DE3)yth/pJA3.131A

Figure 52. Sensitivity experiments of gene deletion, phloroglucinol producing strains

111

Genomic insertion of T7 phID

Up to this point microbial synthesis of E. coli uses expression of the pth gene
from a plasmid. After a period of productivity the host construct yields a drastic decline in
rate of production. Many reasons for decline can exist, but plasmid loss has been shown
to be concurrent late into the microbial synthesis with the drop in productivity. Placing
the pth gene onto the chromosome of E. coli may aid in delineating the cause of the
experimentally observed loss of phloroglucinol production if it is in fact due to loss of the
pth encoding plasmid, or may provide additional information that could be pivotal
towards generating a biocatalyst that is more resistant to phloroglucinol .

The insertion of pth utilizes slightly modified methodology outlined by Wanner.
The following genomic insertion strategy up to this point has not been reported in the
literature. Instead of pKD3 being used as the template plasmid for amplification of the
FRT flanked DNA fragment to be recombined into a genetic region of choice, a plasmid
was constructed by first inserting pth into pKD3. This modification allows for a gene
replacement to be conducted instead of deletion of genetic material as intended. The

central idea is to insert pth into lacZ with the outlined procedures in (Figure 53).

112

1) PCR phID installing Sphl and BmgBl sites

 

 

 

 

 

 

 

 

S hl
pJA3.242 [ L |
" ph/D —\
T7 BmgBl
2) Digest pKD3 with Sphl and BmgBl
Sphl BmgBl
pKD3 L H l FRT Hi" I
‘
Cm”
3) Treat purified ph/D insert w/Klenow
4) Digest insert with Sphl
:1 T7 pth J
5) Selective Ligation
Sphl BmgBl
pBC2.0551 H IFTT Fl,“ 1
> 4 R
T7 pth 0'"

Figure 53. Controlled insertion of the T7 pth genetic region into pKD3.

With a newly formed, verified plasmid in hand the Wanner methodology can be
followed to insert pth onto the chromosome of E. coli. The insertion is outlined in

(Figure 54).

113

1) PCR amplify insert with FRT-flanked resistance gene

"/7
pBC2.055 L X ”P FF," 1

T7 phlo CmR x2”

2) Transform fragment into W3110(DE3) expressing ). red recombinase and select for em resistance

 

 

ll

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

H1 FRT FRT
L_ [act 11 _ '4 ' _1L IacY J
' 17an Cm” W '
3) Eliminate resistance using FLP
FRT
[ Iacl 11 _ ' 11 leer 1
r T7pth

Figure 54. Wanner-type insertion of T7 pth into the lacZ orf on the chromosome of
E. coli W3110(DE3).

A blue-white selection on LB plates containing chloramphenicol was used as a
first wave screening of mutants. When a functional B-galactosidase, a protein transcribed
from the lacZ orf, is cultured with selective solid medium containing 5-bromo-4—chloro-3-
indolyl-beta—D-galactopyranoside (x-gal) hydrolysis of the sugar from the indolyl
functionality results in a dimerized chromophore. Those mutants who did not give
evidence for a functional lacZ orf were cultured for extraction of DNA. PCR primers
were chosen outside the lacZ orf, and the resulting bands did indicate a loss from the
native 3.3 kb (200 bp addition of molecular weight with chosen primers over the 3.1 kb
unit weight of lacZ) to a successful insertion of the T7 pth FRT-CmR-FRT DNA
fragment corresponding to a 2.4 kb band. Experimental results have indicated that

abilities of E. coli to produce target molecules are lessened when the unnecessary Cm

114

resistance gene is kept in the chromosome. Two FRT (Flipase Recognition Target) sites
flank the genetic region encoding the resistance protein.

In order to abolish resistance pCP20 is the necessary plasmid to encode the flipase
to “flip-out” genetic regions between FRT sites. Electrocompetent W3110(DE3)
lacZ::T7pth FRT CmR FRT was transformed with pCP20 and the procedure followed the
Wanner protocol. A total of 16 colonies were picked and plated on LB, LB containing
chloramphenicol, and LB containing ampicillin. Correct mutants shall exhibit growth
only on LB plates.

The colonies that passed the selective plate screenings were cultured and DNA was
extracted. The DNA solution was the template for PCR amplification with the primers
used to establish the size of the lacZ orf. The majority (75%) of the original 16 colonies
were correct as indicated from a loss from 2.4 kb (lacZ::T7pth FRT CmR FRT) to 1.4 kb
(lacZ::T7pth FRT). In summary, evidence of the W3110(DE3) lacZ::T7pth FRT
successful cloning includes PCR amplification of the lacZ orf indicating stepwise insertion
of T7pth FRT CmR FRT and then loss of the cat resistance gene as indicated by a
decrease in band sizes. Besides PCR, selective plates and x-gal treated plates verified
disruption of lacZ and drug resistance where appropriate.

Unfortunately, despite many efforts, the T7 pth mutant did not grow in minimal
salts medium on multiple attempts. Efforts for growth included culturing in LB medium
and centrifugating, washing, and resuspending in M9 minimal salts medium with glucose.
Centrifugation after 24 h would not pellet indicating cell lysis. It has been found that
expression prior to stationary phase is detrimental to the cell. In the case that the genomic

copy of lacl did not produce enough protein to regulate expression of the T7 RNA

115

polymerase, pJF 118EH was transformed into the mutant and grown on LB containing
ampicillin. pJFl 18EH has a copy of lacl. Colonies were picked and streaked on M9
minimal salts medium with glucose supplemented with ampicillin leading to a result of no

growth after rather extended periods of time.

Enhancing pth genetic expression

Specific activities of Pf—5 pth, behind a T7 promoter expressed from the pET-
based expression vector pJA3.l3lA, has repeatedly been shown to peak at .02 U/mg/min
and lose activity sharply past a 6-12 h post-induction time period. Surpassing this barrier
was looked at in the following ways. pJA3.l31A has been utilized heavily in
phloroglucinol biosyntheses to date, and contains excess DNA before the front terminus of
the expression gene. The excess DNA could have a beneficial effect if the Pth protein is
toxic by hindering proper expression. Since it has not been ruled out though that proper
gene expression could be increased with an optimally positioned promoter and ribosomal
binding site, this task is important. Using pET-27b+ (Novagen cat no. 69863-3), also a
pET-based plasmid, with pth and serA genes from laboratory sources, pJA3.l31A was
reformed with minimal differences and optimal pth gene positioning as pBC2.187

(Figure 55 and Figure 56).

116

PCR amplification of Pf-5
pth from pJA3.131A

 

 

 

 

1) Ndel
2) BamHI
Ndel BamHl
iii if") """ T 9
Pf-5 pth
1) BamHl
2) Ndel

3) CIAP treatment

1) Ligation

 

Figure 55. Construction of plasmid pBC2.179 en route to pBC2.187

117

BamHl

-..w,
3“ .-_ , _. 1.!“ ...

 

 

’I-J/r/“A' '~- ftp-.5
,/;./ .

Ndel /’/ P15 9th . Plasmid pRC1.558
1?
PW p602.179 i

Sphl 6.4 kb 1} 1) Smal

Smal Smal
sagas _

1) Sphl
2) Klenow treatment
3) CIAP treatment

 

1) Ligation
2) Orientation verification

/"'§’//fl V II“ ‘
grief-5 pth

    

Figure 56. Construction of plasmid pBC2.187

118

Enzymology and phloroglucinol titers and yields comparing biosyntheses of
BLZISerA(DE3) transformed with pJA3.l3lA or pBC2.187 were not statistically different
leading to the idea that optimal positioning did not alter the gene expression to an
appreciable amount to change any biocatalytic production numbers. A representative
SDS-PAGE gel analysis is depicted in (Figure 57 and Figure 58). In (Figure 57) time is
equal to the hours after induction and See-Blue Plus 2 are molecular weight markers with
bands indicated along the y-axis. Lanes 2-6 are samples taken from unmodified culture,
while lanes 8-13 are culture supernatant diluted with water 5:1, waterzculture supernatant.
Protein depictions are based upon N-terminal protein sequencing conducted by the
Michigan State University Mass Spectrometry Facility.

(Figure 58) is an SDS-PAGE analysis of soluble vs. insoluble protein (see
experimental for details). The time is equal to the hours after induction and See-Blue Plus
2 are molecular weight markers with bands indicated along the y-axis. SN is equivalent to
the lysate supernatant, and thus soluble protein, whereas the lysate pellet indicates what
protein was not soluble in the culture supernatant and resuspended in a detergent solution.
Pth is found predominately in the insoluble fraction leading to evidence of support that
most of the protein translation is used for the formation of non-phloroglucinol producing
inclusion bodies. It is important to note that Pth is the lower band of the doublet that

looks as if it were one band.

119

210 kD —

  

{Mn

. rum oEEcm Stop: ..E 3‘"...
- um 038$ «:68 .E can...
- rum oEEmw £605 ..E «Nu...
. in 0.953 £92.: .5 up"...
- 2m 2953 SEE ..E «H...

- :m 29:8 «52.: .5 cu...

.m .v
m . m an n ~ - N man. 03598
M - .5 Sup
e - .E can»
a . I
.m .m - E «are
m 3 % ..2 ~an
M
M... . .5 «up
Willi - cozoauséi
. .. - m we“. 2.58m
_ _ _ _ _ _ _ _
D D D D DD D D
k k k .K kk k k
8 5 5 4 76 7 4
7 5 4 3 11

105 kD —

Figure 57. SDS-PAGE analysis of BL21serA(DE3)/pBC2.187

All lanes are normalized to OD600 = 1.

120

210 kD —

- 8; 8:8 233 .5 8n»
- 2; 2m 233 .5 Sup
- on; 5:8 33.: .E 83.
- 2; zm 233 .2 Sue

- 8: 3:9". 233 .E can»

v
A
Pth...

- 2; zm 883 .2 fine

- 8: 8:8 283 .5 Sn»

Outer Membrane Protein

- S; zm 23.3 .2 fine

- om; 3:0“. 233 .2 an»
- S; zm 283 .5 ”up

- N ms: 3.38

DD
kk

76

11

78kD—
55kD—
45kD—
34kD—
7kD—
4kD—

105 kD —

121

Figure 58. SDS-PAGE protein solubility analysis of BL215erA(DE3)/pBC2.187

All lanes are normalized to OD6OO = l.

Codon usage is the single most important variable when expressing genes in hosts
other than the source of the gene. Codon usage is directly based upon the t-RNA pool
percentages in a particular organism and disrupting t-RNA concentrations can lead to poor
expression. Codon optimization was done manually and changes in codons were made
accordingly with attention to keeping regions from overlapping codons and highly
localized GC content (Figure 59).

The final hand sorted, gene construct was given to DNA2.0 for synthesis. Once
received the optimized gene was cloned into the same pET27-b+ vector along with serA
(Figure 60 and Figure 61) and biosynthesis commenced with W31103erA(DE3) and

BL215erA(DE3)* after establishing a growth curve. With the new construct microbial

synthesis were conducted at 33 and 36 °C and induced at late log phase (OD600 = 30),

early stationary phase (OD600 = 50) and well into stationary phase (OD600 = 80). The

maximum titer and yield were observed as 4.1 g/L and 3% with the biosynthesis
conducted at 36 °C and stationary induction while the greatest specific activity of 0.038
and 0.042 U/mg/min was found to be at early stationary induction at 33 or 36 °C (Figure

62). Similar data was found with BLZISerA(DE3)*/pBC2.219.

122

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

N N 00.0 0 0w.0 <03
0 0 00.0 0 00.0 0¢3 F 0 p 00.— r 00... 003 n. v 00.0 0 3.0 003
—. 0 00.— p NN.0 ¢03fo. 0 0 N30 0 3.0 ¢30 p N 00.0 p N30 ¢0¢ n 0 00.0 p 3.0 303
p p 00.0 0 00.0 ¢¢3 N. m 0N.0 N 2.0 030 p N 00.0 F 3.0 30¢ v v 00.0 0 3.0 30¢
v. N 00.— 0 3.0 0¢3 0 0 00.0 0 0N0 330 m m 00.0 0 NN.0 00¢ n. m N00 0 0N.0 003
v v 00.0 0 00.0 3¢3 > v. 5 00.0 3 00.0 030 N. 0 00.0 mp N10 00¢ —. 0 0N0 N mN.0 00¢
N m pN.0 n 00.0 ¢¢0
N. o 0N.0 —— 00.0 0¢0 0 up 004 n— 00.— 03¢ 07 n 00.— n— 0N0 0¢¢
_ _. p 00.0 0 3.0 00¢ 7 0 00.0 r N00 000 p P 00.0 0 no.0 <30 0— 0— 00.0 0 NN.0 ¢¢¢
. p p 00.0 0 00.0 ¢0¢ N N 00.0 0 3.0 300 N v 00.0 N 5.0 330 — — 00.0 0 00.0 ¢3¢
p p 00.0 0 00.0 <00 —. N NN.0 n 030 ¢00 N. v 3.0 0 N30 030 0. 0 00.0 0— 3.0 03¢
.n. N 0N.0 m 3.0 000 m 0 N 3.0 N 5.0 000 m m 00.0 0 3.0 <33 0 0— 3.0 N 3.0 33¢
“ m 0 00.0 p 00.0 300 N- N 00.0 v— 3.0 0¢¢ n m 00.0 N 3.0 033 0. N 3.0 mp 3.0 0¢0
.m. N No.0 N— 000 000 N o 030 N 3.0 3¢¢ 0. 0w pN.0 N 00.0 030 0 0 00.0 — 00.0 3¢0
_ N N 00.0 0 030 <00 0—. N 00.0 NF 0nd 033 07 N NN.0 N— 3.0 0¢0 0 0 00.0 0 0.30 300
p n N—.0 N 9.0 000 o— N— 3.0 N 5.0 333 0' mp 0N.0 m 00.0 3¢0 v 0 3.0 v —N.0 (00
V p m vN.0 v 00.0 300 0 n. 0 nmd 0 0nd 0¢0 N n N—.0 — N10 303 mp. 5 N00 0N 0N.0 000
v. N 00.0 3 3.0 000 n 5 N10 0 N00 ¢¢0 N. n 00.0 m 00.0 003 n v— 0N.0 : 00.0 .000
M > >_ =. __ _ > >_ =. __ _ > >_ =. __ _ > >. _= = _

 

 

 

m :8 mEotmcomm E 250 QEQ max. $88830 32625.3me 9:

..o cofimmaxm Lou. momma conou u6 cosmuEzqo

 

 

1'.

col

E.

(I) = E. coli B codon frequency. (11) = Native phID codon usage. (Ill) Native pth codon

In
frequency. (IV) Optimized pth codon frequency. (V) Relative change in codon usage.

for expression of P. fluoroscens Pf-S pth '

ion

1mizat

Figure 59. Codon opt

123

pJ201z13176
codon optimized Pf—5 pth

 

 

 

 

1) Ndel
2) BamHl
Ndel BamHl
pt phID
1) BamHl
2) Ndel
3) CIAP treatment

1) Ligation

 

Figure 60. Construction of plasmid pBC2.212 en route to pBC2.219.

124

 

ggfr/CSpt pth Plasmid pRC1.558
z" ’

Ndel

   
 

 

 

 

PT7 8C2 212 ii
Smal Smal
L serA” A

1) Sphl
2) Klenow treatment
3) CIAP treatment

 

1) Ligation
2) Orientation verification

,- ff"..-
7" 1’91; 1 1%
..li'. -,_.‘-—-—-.... l ,. I
A . ' ‘
‘1

xii: t th

3,} Op p KmR
tPW

[7 p802 219

 

Figure 61. Construction of plasmid pBC2.219.

125

0.05
0.045
0.04
0.035
0.03
0.025
0.02
0.015

Activity (umol/min/mg)

0.01 -
0.005 -

 

 

+36 C 0050
+33 C 0050
—-..— 36 C 0080
+36 C 0030

 

 

 

 

 

 

/ /\\ 1
\-
2 l. é {3 1'0

Post Induction Time (h)

Figure 62. Specific activity comparison for induction time and temperature.

In different efforts in increasing active protein expression the in-house, visually
optimized pth was cloned into pJFl 18EH which is a lower copy plasmid of about 30
copies per cell compared to the pET-based plasmid which can have up to 300 copies per
cell. Besides the burden inherent with plasmid bearing cells, lower amounts of transcribed
DNA can possibly lead to better RNA that can be properly translated yielding more active
protein instead of the host packaging them all to inclusion bodies. The same idea is

apparent in the use of a less strong promoter, replacing T7 with Tac (Figure 63 and Figure

64).

126

PCR amplification of opt
pth from pBCZ.219

1) BamHl
2) Hindlll

BamHl Hindlll

 

 

1) BamHI

2) Hindlll
3) CIAP treatment

1) Ligation

BamHl

"”352” .

,(T'
H . : ‘“ ‘ .-__\
- NA

:- :1..." - P Tac“(';-:~‘T;~ 3‘
la IQ t hllj“? .

/ C Op p \ Hindlll
l‘-l ,;
chz.252 if

  

 

i i
1
if. 6.4 kb I?
\ [Li]
\ A R /,
\ .k p "'2'"
ul‘:: ’4 ‘7 7‘1,
,\:\ \\ 1"4’4') .
/ ‘31:“..‘313’
Ndel

Figure 63. Construction of plasmid pBC2.252 en route to pBC2.257.

127

 
 

Plasmid pRC1.558

’53.; I Q V{%?i\

[i/ Iacl Opt pthxEEg/ Hindlll

1 pBC2.252 )7) 1) Smal
i "1‘

6.4 kb

“it A R I
X p Smal Smal

 

 

1) Ndel
2) Klenow treatment
3) CIAP treatment

 

1) Ligation
2) Orientation verification

\

   

fl?! PTac x»
{nit/l Q 3?.
f7," '80' Opt ph|D¢g§

ii chz.257
{'53}. 8.1 kb ADR/

K ‘x If";
‘ 3. J»
‘ , serA {4/
..."w
. ‘ —— ' .44,“

Figure 64. Construction of plasmid pBC2.257.

128

The Tac promoter in the medium copy plasmid expression system produced 0.5
g/L phloroglucinol and specific activites were not acquired.
Several programs and software exist for codon optimization. DNA2.0, a

California based company, provides gene synthesis services with codon optimization

software from any amino acid sequencem‘22 The added benefits of using Gene Designer,
the free software available from DNA2.0, is that not only can codon usage be optimized
for an amino acid sequence in a multitude of given hosts, but there are also many features
that can add purification tags, restriction enzymes inclusions or exclusions, alignments of
promoters and ribosomal binding sites, among others. These services and tools can
expedite many researchers ability to obtain genetic materials to answer their scientific
questions for less cost and time than an individual would take to construct. The Pf-S pth
gene was submitted for sequencing and once received was cloned into pET27-b+ just as
described for all of the pBC pth containing plasmids (Figure 65 and Figure 66). Once

constructed the plasmid was subject to microbial synthesis using W31103erA(DE3) as the

host. With induction at early stationary (OD600 = 50) the consistent titer of 3.7 g/L was

achieved, although the yield was over 6% which is almost double that of historical yields
(Figure 40) and the crude lysate specific activity again doubled the benchmark wild-type

pth.

129

pJ201 215277

 

DNA2.0 optimized pth
1) Ndel
2) BamHl
Ndel BamHl
[—lbl
2.0 Opt pth
1) BamHl
2) Ndel
3) CIAP treatment

1) Ligation

IamHl
that:
mll‘mfll \ -. ..

 

111111.120 Opt phID
Ndel 1111 K

P17 p802.271 it
6.4 kb i!)

 

 

Figure 65. Construction of plasmid pBC2.271 en route to pBC2.274.

130

Plasmid pRC1.558

1) Smal

Smal Smal

 

 

1) Sphl
2) Klenow treatment
3) CIAP treatment

 

1) Ligation
2) Orientation verification

~r-—

 

pBCZ.274
8.1 kb

 

- ,serA

 

Figure 66. Construction of plasmid pBC2.274.

131

To ensure that phloroglucinol production was not limited by lack of a mineral or
nutrient source, a biosynthesis was conducted similarly to the minimal salts medum
usually employed with the addition of a sterilized and concentrated stock of yeast extract

solution added just prior to induction. A similar method was applied in the biosynthesis of

shikimic acid that helped improve fermentative results.23 With comparison to the
experiment of the same construct using W31105erA(DE3) as the host without
supplementation of 15 g/L yeast extract, the titer (Figure 67), yield from glucose and
specific activity of crude lysate was similar with the only difference showing a slightly

slower drOp in activity over time (Figure 68).

 

   

 

 

 

 

 

 

40 5
A Induction O A
3 ’ l O 0 9 4 3,
I: 30 ~ ---------------- .i ------------ 4 1’
a - 3 + 3 .8
Q) 20 . ......... . ............. , .. o
3 .. 2 2
= ’ 8’
8 1O "" 1 5
s . . a

0 - O

O 23 26 29 2

time (h)

Figure 67. Yeast extract supplementation effect on microbial synthesis.

I32

 

0.045

 

0.04 —

O 035 A + in-house opt

N Tomzo gpt+YE _
.222 // \\ +333?
”/1 \\
0.0.5 / /\ \ \

0:2; // N \g
o/ . . \—

Post Induction Time (h)

 

Activity (umoI/min/mg)

 

 

Figure 68. Crude lysate specific activity comparison of wild-type, in house
optimized, and DNA2.0 optimized pth with and without supplementation.

Discussion

In combined efforts, the parameters for the whole-cell biocatalysis of
phloroglucinol from renewable glucose by microbial synthesis using two sources of E. coli
as host organisms in minimal salts medium were established. pth from P. fluorescens
Pf-S was heterologously expressed behind a T7 promoter in a pET based plasmid
encoding a type III polyketide synthase responsible for condensation of three malonyl
CoA subunits to afford phloroglucinol. Successful production was achieved in

sequentially increasing titers from 4 g/L in a fed-batch microbial synthesis to a single

133

stage fed-batch extractive microbial synthesis that produced 17 g/L and doubled the yield
to about 10%. Introduction of younger cells lacking sensitivity from phloroglucinol
exposure via a second stage fermenter vessel resulted in a doubling of titer to 37 g/L albeit
maintaining the same yield due to the non-production stage glucose feeding. An
exhaustive five stage, staggered introduction spawning from the same idea as the two-
stage microbial synthesis setup, with the added benefit of learning if this process could
have a continuous production vessel, did not bear fruit only producing a slightly higher
titer than the two-stage with a drop in yield consistent with the extra number of
preparatory cell feed vessels. As an aside, an increase in titer of about 10% was found
when the initial minerals of the batch feed were supplemented throughout the microbial
synthesis by slow addition from solvation in the glucose addition stock (see experimental).
Close to 300 g of phloroglucinol was collected from two-stage microbial synthesis of
BLZISerA(DE3)*/pJA3.13 1A for production of resorcinol (Chapter four).

Transcriptome analysis, although informative, may be looked at in the future as a
secondary line of evidence for a hypothesis of what regulatory paths changed or need to be
changed for a perceived finding. Focusing on all the conjectured leads was impractical
and this information will be used to decipher a finding rather than lead to experimental
paths.

The isolated P. fluoroscens Pf-S pth was codon Optimized by relative amount of
charged t-RNA concentration pools towards E. coli. A two-fold improvement in crude
lysate specific activity was observed whether use of visual codon optimization or
algorithims used by Gene Designer software from DNA2.0. Crude lysate specific activity

is in essence a measure of the concentration of expressed and active pth relative to

134

endogenous protein that has been normalized. Mineral deficiency could be at most a
minor cause in the observed ceiling of less than 5 g/L of phloroglucinol to be produced
evident through a miniscule increase of titer when 15 g/L of yeast extract was added to the
minimal salts medium just prior to induction.

Three main obstacles in limited phloroglucinol accumulation are Pth activity,
substrate availability (malonyl CoA) and/or phloroglucinol or protein toxicity. These
targets are what can be improved upon yielding a biocatalyst that provides high enough
titers and yields to move to the forefront of a commodity chemical production.

What was not noted thus far was the perceived drop in titer and viability of
especially the evolved “*” strain. Upon the introduction of the extractive biosyntheses it
was not four months when the maximum titers were not achieved by Dr. Xie. In the two-
stage extractive microbial synthesis a small difference of 2-3 g/L was looked upon as just
statistical deviation. A total of six months when reproduction of Dr. Xie’s results were
attempted another drop of about 10% was achieved. Once the 300 g of phloroglucinol
was collected, the microbial synthesis ceased for optimization of the downstream
processing with limited immediumte concern over the small decreases in titers.

It was not until almost one year from the highest titers of phloroglucinol recorded
that in the extractive microbial synthesis the titer was out almost to 33% of the original
numbers obtained. The obvious issues were immediately addressed: phloroglucinol was
monitored carefully for proper extraction without detrimental accumulation, the resin was
conditioned properly with subsequent ordering of different batches and different sources,
bottled air tanks were used as an air source instead of house air, extensive cleaning,

filtration changes, and temperature characterization of the autoclave used for sterilization,

135

water changes from completely different purification sources, complete swapping out for
new additive salts and minerals, retransforming of cells streaked out from untouched
glycerol freezes, recalibration of the DCU control units for the fermenters, elution
conditions for collection of phloroglucinol off the resin. With no other explanations it
seemed the microbe had somehow changed. With careful examination of growth
characteristics and profiles some ideas were gained. The growth curve has slowly

66*,9

changed over time. It was repeatedly shown that the evolved strains indeed amassed

about 20% more cell mass and reached peak densities hours quicker. Cryptic mutations

may be a culprit of explaining why these microorganisms changed.24 After establishing
and testing optimal induction times it seems the majority of the perceived low titers was
due to an early induction because of the difference in cell mass production. The fed-batch
titers and yields returned to normal. A similar situation was perceived in the literature
citing that cells screened for resistance to phlorizin, a glycosylated and acylated
phloroglucinol, lost resistance and became sensitive over time if not pressured by the
toxicant, even in the glycerol freeze. It is probable that the titers for the extractive

biosynthesis would be at least marginally returned, but efforts were focused elsewhere.

136

CHAPTER THREE REFERENCE

1 Leston, G. In Kirk-Othmer Encyclopedia of Chemical Technology; Kroschwitz, J. I.;
Howe-Grant, M., Eds.; Wiley: New York, 1996; Vol. 19, p. 778.

2 Agarwal, J.P. Prog. Energy Combust. Sci. 1998, 24, 1-30.

3 Mitchell, A. Amination of Electrophilic Aromatic Compounds by Various Nucleophilic
Substitution. International Patent Application WO 96/35659, 1996.

4 McKillop, A.; Howarth, B. 1).; Kobylecki, R. 1. Syn. Commun. 1974, 4, 35.

5 Kopf, P.W. Kirk-Othmer Encyclopedia of Chemical Technology; “Phenolic Resins”,
John Wiley & Sons Inc: New York, 2001.

6 Zha, W.; Shao, 2.; Frost, 1.w.; Zhao, Hi. J. Am. Chem. Soc. 2004, 126, 4534.

7 Singh, 1.1).; Bharate, S.B. Nat. Prod. Rep. 2006,23, 558.
8 Achkar 1.; Xian M.; Zhao 11.; Frost 1w. 2005, 127, 5332.

9 Novak-Thompson, B.; Gould, S. J.; Kraus, J.; Loper, J. E. Can. J. Microbiol. 1994, 40,
1064.

10 Weller, D.M.; Landa, B.B.; Mavrodi, O.V.; Schroeder, K.L.; De La Fuente, L.; Blouin
Bankhead, S.; Allende Molar, R.; Bonsall, R.F.; Mavrodi, D.V.; Thomashow, L. Plant
Biol. 2006, 9, 4.

” Bangera, M.G.; Thomashow, L.S. J. Bacteriol. 1999, 181, 3155.
12 Austin, M.B.; Noel, JP. Nat. Prod. Rev. 2003, 20, 79.
13 Adapted from Staunton, J.; Weissman, KJ. Nat. Prod. Rep. 2001, 4, 380.

'4 Zha, W.; Rubin-Pitel, 5.13.; Zhao, H. J. Biol. Chem. 2006, 281, 32036.

137

15 McLaggan, D.; Naprstek, J.; Buurman, E.T.; Epstein, W. J. Biol. Chem. 1994, 269,
1911.

‘6 Li W.; Xie D.; Frost 1w. J Am Chem Soc, 2005, 127, 2874.
‘7 Park, S.; Ryu, D.D.Y.; Kim, J.Y. Biotechnol. Bioeng. 1990, 36,493.
'8 Fu, 1.; Wilson, D.B.; Shuler, M.L. Biotechnol. Bioeng. 1993, 41, 937.

'9 Bruno-Barcena, J.M.; Ragout, A.L.; Cordoba, P.R.; Sineriz, F. Appl. Microbial.
Biotechnol. 1999, 51, 316.

2° Datsenko, K.A.; Wanner B.L. Proc. Natl. Acad. Sci. USA. 2000, 97, 6640-6645.

21 Villalobos, A.; Ness, J.E.; Gustafsson, C.; Minshull, J.; Govindarajan, S. BMC
Biainfarmatics. 2006, 7, 285.

22 Gustafsson, C.; Minshull, J .; Govindarajan, S. TRENDS in Biotechnology. 2004,22,
346.

23 Chandran, S.S.; Yi, J.; Draths, K.M.; von Daeniken, R.; Weber, W.; Frost, J-W-
Biotechnol. Prag. 2003, 19, 808.

24 (a) Parker, L.L.; Betts, P.W.; Hall, B.G. J. Bacterial. 1988, I70, 218. (b) Hall, B.G.
Genetica. 1999, 107, 181.

138

MEI—RM

Downstream Processing and Chemistry of Phloroglucinol

Current efforts aim to produce 1,3 ,5-trihydroxybenzene, known as phloroglucinol,
biocatalytically from D-glucose at a level with commercial importance. To enhance the
viability of commercial manufacture following a successful biocatalytic production the
downstream purification must be crisp and concise delivering phloroglucinol with the
same purity and level to compete with non-renewable routes. Chemical methods or
treatment to other target compounds will aid in developing markets and interest in
phloroglucinol.

Varied physical properties spawned by unique chemical properties add to the
intrigue of phloroglucinol. The solubility in water at room temperature is about 10 g/L,

but if the temperature is increased to 37 °C the solubility raises to more than 30 g/L. An

appreciable keto—enol tautomerism sets this molecule apart from many others.1 With
hydroxylamine the trioxime is produced through what seems like an addition to a ketone,

and excess methyl iodide or halogen in base leads to hexamethylated or hexahalogenated

tricyclohexanone products (Figure 69).2 When in the presence of diazomethane or acetyl

chloride the enolic products are formed in the trimethyl ether or acetylated versions.

139

Figure 69. Keto-enol chemistry of phloroglucinol.
(a) hydroxylamine; (b) CH3I, KOH; (c) C12 or Brz; (d) CH2N2; (e) AcCl

Phloroglucinol in the solid state or solution at neutral pH has failed to yield any

evidence by Raman, ultraviolet and infrared spectroscopies of the keto tautomer. The

l
commonality of the keto reactions are the use of base. The HNMR of phloroglucinol at

neutral pH shows a single peak in the aromatic region in DZO.3 The aromatic peak shifts
upfield into the alkene region with an addition of a second peak indicative of a methylene
- a 13 o

in 2 mole equ1valence of base. CNMR and UV spectroscopy give further support of the
complex equilibrium that exists when phloroglucinol is dissolved in an aqueous solution

of base.4 With data gathered across the representative literature the pH dependent

isomerization is as depicted in (Figure 70).

I40

OH O
O 9K81 =80 QC pKa2=9.2 pKa3= 14 G
——->
HO OH HO —O O" —O O—

O O
HO iii 0— "000—

Figure 70. pH dependent equilibration of tautomers.

Fray reported the stoichiometric sodium borohydride reduction of phloroglucinol

to resorcinol in 90% yield presumably going through a dihydrophloroglucinol salt
intermediate (Figure 71).5 Base was necessary for the reaction to take place, at neutral pH
either phloroglucinol was recovered or 1,3 ,5-cyclohexanetriol was produced.6 An adapted
synthesis of dihydrokavain by Smissman7 was used to make the dihydrophloroglucinol

salt that upon reflux in dilute acid afforded resorcinol.8

OH OH
——>
HO OH HO
PG b
C
\ HO A

H
i H H20
0 0

Figure 71. Phloroglucinol reduction to resorcinol.
(a) NaBH4. (b) 50 psi H2, 5% Rh/AIZO3, 1N NaOH. (c) 0.5 M HZSOa, A.

141

A l M solution of phloroglucinol in 1 N NaOH was shaken under 50 psi H2 in the
presence of a 1.2 mol% loading of 5% Rh/Ale3. After filtering off the catalyst through a

plug of Celite, the aqueous solution was acidified to pH 6.0 with 10% HCl followed by

concentration to a yellow oil. Heating the oil at reflux in a solution of 0.5 M H2504

afforded resorcinol in 82% yield after Kugelrohr distillation. A series of catalysts were

applied to phloroglucinol, 1,2,3 ,4—tetrahydroxybenzene and hydroxyhydroquinone to yield

successful deoxygenation reactions (Figure 72).8 Evidence led to mechanistic insight that

hydrogenation occurred through the dianionic species at the neutral oxygen evident from

resorcinol production using a-methylated phloroglucinol, with loss of methanol, among

other supports .6

 

 

Praia/2:21am Catalyst Product Yield
OH OH
Rh/A1203 82
<1 o 74
HO OH Pt/C H0 33
Pd/
Phloroglucinol C Resorcinol
0“ OH Rh/AI203 0” 0H 44
:1 ENG (j 43
Pt/C
OH
OH Pd/C OH 4‘
Apionol Pyrogallol
OH OH
Rh/Al203 53
ENG 47
OH Pt/C 43
OH Pd/C OH
Hygqu‘gtri‘yédro Hydroquinone

 

Figure 72. Catalytic deoxygenation reactions of polyhydroxyarimatics.8

To this point phloroglucinol has been produced from glucose in titers and yields
that warrant efforts towards efficient downstream processing techniques for recapture of
purified product. Phloroglucinol had been trapped on AG 1x8 or Dowex 1x8 strong anion
exchange resin thusfar. AG 1 resins have styrene, divinyl benzene polymer gel matrices
with quaternary amines as the cationic species that can bind anionic analytes. Dowex 1 is
a lesser grade of a strikingly similar product to AG 1 at a more reasonable price. For
practical purposes once washed, clarified and generated the resins behave as equivalents.
Anion exchange resins come in vast arrays of sizes and effective cross—linkings. The mesh
size given is proportionate to the size mesh that particles are allowed to pass. Usually
mesh sizes are reported as ranges. For example ZOO-400 mesh resin bead sizes are small
enough to pass through 200 mesh and are large enough not to pass through 400 mesh. The
smaller the mesh size range the larger the particle size. The number after the x, as in
Dowex 1x8, is the effective percentages of cross-linkings that bind adjacent linear strands
together. As one could imagine theses numbers have a drastic effect on the flow
characteristics through the resin. The larger the beads (and lower the mesh size), the less
the flow is perturbed. On the other hand, the less the cross-linking percentage, the less the
flow is perturbed. The optimization though, is not solely dependent upon flow. The
ability to capture an analyte is increased when particle sizes are smaller and cross-linking
is maximized. A balance was sought between efficient capture of phloroglucinol and the
ability to flow the unfiltered, viscous and live cell culture through the resin. Flow needs to
be high enough such that the cells can be funneled back into the fermenter, because
outside the precisely controlled fermenter environment the cells are surviving in a strongly

organic medium likely devoid of air, nutrients and pH control (Figure 73).

143

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

@D

 

 

 

 

 

 

 

 

Figure 73. Schematic diagram of in situ resin based extraction.

(1) 1L working volume fermentation vessel. (2) PID controlled glucose addition. (3)
Externally looped, peristaltic pump driven, fluidized resin bed extractive unit.

Dr. Dongmig Xie optimized the resin usage for AG 1x8, 50-100 mesh. To recover
the phloroglucinol bound on the AG 1x8 resin, the column was initially washed in a
fluidized-bed mode with 10 bed volumes of distilled, deionized water to remove the
residual cells and recover part of phloroglucinol on the resin. Then, the column was

rinsed with 15 bed volumes of acidic aqueous ethanol (acetic acid, 10% (v/v); ethanol,
75% (v/v); H20, 15% (v/v)) in a gravity-flow mode to recover the remaining
phloroglucinol on the resin. The resin after phloroglucinol recovery was regenerated by a

rinse with 15 bed volumes of KHZPO4 (0.5 M). To purify the recovered phloroglucinol,

the cells in the resulting water solution were removed by centrifugation and the cell-free
water solution was concentrated to about 1/10 of the original volume. The resulting acidic

ethanol solution was concentrated to dryness and combined with the concentrated water

144

solution. The resulting aqueous solution was extracted three times with equal volumes of

ethyl acetate. The organic phases were combined, concentrated to dryness and redissolved

in H20. Phloroglucinol was recrystallized from H20 at about 50% recovery, affording

pale yellow crystals.

Results

Resin optimization for phloroglucinol capture

The binding phenomena of phloroglucinol to Dowex 1x8 resin has been optimized
for mesh size, counter—ion, eluent, elution rate and temperature for a delicate balance
between binding capacity, elution efficiency and practicality. As eluded to before,
conditions are desired in which phloroglucinol is extracted efficiently to detour its toxicity
effects while allowing efficient recapture post microbial synthesis, all keeping in constant
cognition that the producing cells be allowed to flow and spend minimal time in the
extraction column.

Efforts were first applied towards simplifying the elution conditions of
phloroglucinol from Dowex 1x8 anion exchange resin. The current protocol has inherent
problems and can be optimized. Monobasic phosphates are used to regenerate the resin
initially and elution with a solution of phosphates has the important advantage of
minimizing concentration of time, materials, and money associated with resin preparation.
Eluting and regenerating in the same step will constitute a major benefit of this protocol
phasing out excess washes, equilibrations, and unnecessary resource use. After extraction

of phloroglucinol, consistently shown to be the only major product with organic solvent

145

solubility, the eluent should be recycled at least marginally. Monobasic phosphates have
the added advantage of an acidic proton to neutralize any loosely bound anions contrary of
reliance on simply replacing the counter-ion on the resin, assuming the pKa of the
protonated conjugate base is greater than the phosphate species.

The eluent screening experiment used a large batch generation of the phosphate
form Dowex 1x8. A uniformly massed resin amount was slurried in minimal salts
medium to 25 mL of resin into fritted bio—rad, econo columns. In order to saturate the
resin, which has a capacity rating of 1.4 milliequivalence/mL of slurried resin, 5 g of
phloroglucinol was dissolved in 500 mL of minimal salts medium, adjusted to pH 7 and
passed at a experimentally practiced elution flow rate of 8-12 mL/min in a fixed-bed
mode. Typically eight experiments were done at a time leading to the infamous column
Christmas tree in the lab that was festive towards the holidays. Binding of phloroglucinol
was determined by subtracting the amount quantified from the flowthrough by gas
chromatography. Phloroglucinol eluted was quantified in terms of how many bed
volumes (25 mL fractions) were necessary to elute off the indicated percentage of the
phloroglucinol that bound to the resin (1 BV, 2 BV and 5 BV) as depicted (Table 8).
Preliminary results of using phosphates in different forms have benefits over current

elution routes.

146

 

entry PG Bound eluent temperature elution rate PG eluted (%)

 

(%) (°C) (mL/min 4+3 1 EV 2 8V 5 BV
1 40 1M NaH2P04 23 10 18 25 50
2 36 0.5M NaH2P04 23 10 20 28 53
3 37 0.1M NaH2P04 23 10 20 30 67
4 45 1M H3PO4 23 10 21 32 52
5 33 1M NaH2P04 23 4 22 32 73
6 32 1M H3PO4/1 M NaH2PO4 23 10 37 52 100
7 34 1M NaH2P04 95 10 42 67 103

 

resins are approx 3 yrs old with frequent use.

Table 8. Phosphate elution of phloroglucinol from anion exchange resin.

Initial responses showed a slight indication that lower ionic strength can have a
positive effect on elution (Table 8 entries 1-3). Lowering of the concentration of reagents
can have drastic effects on work-up costs. Use of the fully protonated phosphoric acid
compared with the monobasic salt had virtually no effect indicating that excess protons are
not necessary (Table 8 entries 1 vs 4). The combined efforts of essentially a 2 M acidic
phophate seems contradictory to the observations just discussed (Table 8 entry 6). The
fact that this experiment did have the lowest phloroglucinol binding capacity observed
may lead to the need for reproduction. Temperature looks as if it will elute of
phloroglucinol more rapidly at 95 °C than at rt (Table 8 entries 1 vs 7). The cost reflection
of boiling an eluent compared to storage and use of more bed volumes would have to be

considered.

147

The phloroglucinol binding efficiency was considered to be a point of interest,
because increased binding could lower the amount of resin used for extraction. The resin
used in the scout experiment (Table 8) was approximately 3 years old with frequent use
and this was a concern if extraction ability was lost. Another thought was that if the
affinity of phosphate was low compared to other counter-ions (Table 9) then how would
phloroglucinol bind if a more tightly bound counter-ion needed displacement. Phosphate
is the prime candidate to use keeping in mind that the biosynthesis schematic diverts
column flow through to be recycled back into the fermenter (Figure 73). Bumping off a
counter-ion will subject the cells to enrichment of that corresponding product back into the
fermenter vessel. This limits the choice of the resin form drastically. Many of the
counter-ions will have a negative effect if dumped back into the fermenter. Phosphates
are the major salt in the microbial synthesis medium and so this choice was obvious.
Sulfate, another batched additive required as a sulfur source for amino acid production,
could give us some insight into how a more tightly bound ion (Table 9) affects
phloroglucinol binding.

If the binding is not much lower than the case in the phosphate form resin then
phloroglucinol may be eluted more efficiently, cutting costs related to salts. Not only is
sulfuric acid relatively a cheaper feedstock for industrial consumption, it also does not

have eutrophication properties when compared to phosphates (Table 10).

148

 

Relative
Counterion (-) Selectivity

 

OH 1
benzene sulfonate 500
salicylate 450
citrate 220
I 175
phenate 1 10
. HSO4 85
C103 74
NO3 65
Br 50
CN 28
HSO3 27
BrO3 37
N02 24
Cl 22
HCO3 6.0
103 5.5
HPO4 5.0
formate 4.6
acetate 3 .2
Propionate 2.6
F 1 .6

 

Table 9. Relative counterion selectivity for AG 1 anion exchange resin.

149

 

entry PG bound condition crosslinking mesh resin

 

(ave %) (%) size form
1 37 used 8 50-100 phosphate
2 44 new 8 50-100 phosphate
3 1 4 new 2 50-100 phosphate
4 98 new 8 200-400 phosphate
5 60 new 8 50-100 sulfate
6 28 new 2 50—100 sulfate

 

Table 10. Binding efficiency comparison of Dowex 1.

As expected, many variables play a role in the phloroglucinol binding efficiency.
Used vs new resin (Table 10 entries 1 vs 2) indicate that even though resin has been
thoroughly used in excess of 30, 60+ h biosyntheses that the longevity of the resin in our
biocatalysis conditions are stable for frequent use over time as only a slight fall-off in
binding capacity was observed. The mesh size difference from larger beads to smaller
ones (Table 10 entries 2 vs 4) is noticeable, but despite the binding advantage there is also
an elution disadvantage observing only half the amount of phloroglucinol was eluted
comparatively. Also noticed, in regard to practicality, the flow rates were slow. On these
criteria the mesh size was optimized for 50-100. It is harder to predict biomass flow
through varied cross-linking effects, but binding is drastically affected (Table 10 entries 2
vs 3 and 5 vs 6) so the optimized resin cross-linking was chosen as 8%. Sulfates also have
a much tighter binding coefficient to the resin’s quaternary amine ionic binding group.
Therefore, phosphates in the vessel would be less likely to deplete first off because of
overall affinity, but also the fact that if phosphates are indeed bound the expelled sulfate

will soon pass through the resin bed again and preferentially displace the phosphate. With

150

the added benefits, the sulfate form of the resin and the surprisingly increased
phloroglucinol binding (Table 10 entries 2 vs 5) will be looked at in more detail.
Temperature was an important boundary detected earlier (Table 8) and a closer
look was warranted. An increase of elution rate is observed with increases in the
temperature (T able 11 entries 1-4) with a maximum effect observed between 37 and 60
°C. Higher temperatures increase the solubility of phloroglucinol in aqueous medium,
while a slower elution rate also increases extraction efficiency (Table 8 entries 1 vs 5).
Again it was observed that when a decrease in the concentration of phosphate was used

the number of bed volumes was less for product elution (Table 11 entries 2 vs 6).

 

 

 

entry PG bound eluent temperature elution rate PG eluted (%)
(%) (°C) (mUmin +/-2) 1 EV 2 EV 5 EV
1 40 1 M NaHzPO, 23 1O 18 25 50
2 45 1 M NaHzPO4 37 1O 24 36 65
3 46 1 M NaHzPO, 60 1O 21 49 81
4 44 1 M NaHzPO, 95 1O 21 41 80
5 4O 1 M NaHzPO4 23 4 22 32 73
6 39 0.1 M NaH2P04 37 10 25 43 74

 

Table 11. Elution effects of temperature and ionic strength

Thought of how the resin was binding phloroglucinol is likely more of a mixture of
anionic binding and an adsorption phenomena than just anionic binding which would
account for all of the perceived differences in theory vs experimental results. If
phloroglucinol was interacting with the polystyrene, divinylbenzene backbone, then the

smaller sulfate anion would increase the ratio of organic phase (i.e. the backbone) to ionic

151

phase (quaternary amine with counter-ion and aqueous mobile phase) to increase the
binding capacity in favor of the larger phosphate ions per amount of resin. This idea
would also help explain how lowering of the ionic strength (i.e. lowering the concentration
of phosphates in elution Table 8) increases phloroglucinol elution. Another support would
be the unmentioned observance of the decrease of the effective density of the resin when
higher salt concentrations were introduced. Disregarding the chance of bead swelling,
which would ultimately lead to the same argument, a pictoral representation will help
explain in another way (Figure 74). The bead to bead distance in a low ionic strength
mobile phase is much lower than in a mobile phase of higher ionic strength.
Phloroglucinol would be more efficiently eluted with closer bead to bead distances
considering the enhanced adsorption to the beads compared to solubility in the aqueous
mobile phase. Yet more evidence supporting the adsorption of phloroglucinol to the resin
is the fact that the controlled pH in the fermentation vessel is 7.0 +/- 0.05 and that at this
pH (and that if there is deviation of pH in the uncontrolled extraction column loop, normal
metabolism makes organic acids and would lower the pH, keeping phloroglucinol fully
protonated) phloroglucinol should be fully protonated thus passing through the resin bed
unperturbed. It should not be ruled out that a percentage of the phloroglucinol is attached
ionically, because addition of acid that would start to show the effects of the decreased
density does aid in phloroglucinol elution against the control use of water slowly eluting

phloroglucinol.

152

(
ll

00 O 000 O
o
0000 o o

 

 

 

 

 

 

Low ionic strength High ionic strength

Figure 74. Density effect on elution.

In a last supportive effort different concentrations of sulfuric acid and monobasic
phosphates were used to elute phloroglucinol from their respectively formed resins (Table
12). The idea of increases in ionic strength were apparent in the effective density by
visualization of the rise in the resin bed volume. The trend is obvious with indication of
the lower concentrations of phosphates that elute off phloroglucinol more efficiently
(Table 12 entries 5 vs 6 vs 7). The concentration of sulfuric acid is not as noticeable at
small concentrations (Table 12 entries 2 vs 3 vs 4) presumably due to the relative size and
charge densities of a proton vs a sodium ion and a phosphate vs a sulfate ion. An acid

source is also important with comparison to a water elution (Table 12 entry 1).

153

 

entry PG bound resin eluent temp PG eluted (%)

 

 

(%) form (°C) 1 EV 2 BV 5 EV
1 67 sulfate H20 37 14 26 48
2 59 sulfate 0.05 M H280, 37 28 50 68
3 52 sulfate 0.5 M H2804 37 34 66 103
4 65 sulfate 2 M H2804 37 29 45 74
5 50 phosphate 5 M NaHgPO4 95 7 14 22
6 44 phosphate 1 M NaHzPO, 95 21 41 8O
7 4O phosphate 0.1 M NaH2PO4 95 42 62 102

 

Table 12. Cooperative ionic strength and free proton dependence elution.

Phloroglucinol Recovery Optimization

Recrystallization studies commenced on authentic phloroglucinol trying various
eluents from the resin survey as to have a stream-lined downstream processing with as few
process steps as possible. Phloroglucinol does recrystallize nicely in aqueous solvents and
ethyl acetate and hexanes (Table 13). It should be noted that the phloroglucinol
recrystallizes as the dihydrate as white crystals noticed within 1 h and complete within 12

h.

154

 

recrystallization

 

solvent treatment r e cove “((%)
0.1 M NaHzPO, 2% by weight, gentle heating to dissolve, place in 4 °C 96
0.5 M NaHzPO, 2% by weight, gentle heating to dissolve, place in 4 °C 90
1 M NaHZPO, 2% by weight, gentle heating to dissolve, place in 4 °C 93
2 M NaHzPO, 2% by weight, gentle heating to dissolve, place in 4 °C 92
0.5 M H280, 2% by weight, gentle heating to dissolve, place in 4 °C 84
2 M H280, 2% by weight, gentle heating to dissolve, place in 4 °C 80
conc H280, 2% by weight, gentle heating to dissolve, place in 4 °C 0
EtOAc 12% by weight, gentle heating to dissolve, place in 4 °C 0
EtOAc/hexanes 9% by weight, add hexanes until cloudiness 87

appears and dissipates slowly, place in 4 °C

Table 13. Recrystallization of Authentic phloroglucinol.
(Recrystallizes as the dihydrate form of phloroglucinol)

When recrystallization procedures were applied to eluted phloroglucinol from a

microbial synthesis, an orange color of the elution mixture co-crystallizes in the
phloroglucinol that is clean by GC, IH and l3CNMR, but as stated has a bright orange
hue. Initial intuition led to the possible formation of oligomers, but contrary to thought,
upon extraction with ethyl acetate, phloroglucinol was selectively extracted leaving most
of the rather intense coloration behind in the aqueous layer. Decolorization with activated
charcoal (2 x 5% phloroglucinol by weight) offered a colorless solution of phloroglucinol

in ethyl acetate. At this point half of the phloroglucinol was recrystallized in hexanes as

mentioned above (Table 13) while the other half was added to 5 V of hexanes and allowed

to precipitate. Both experiments yielded phloroglucinol that is clean by GC, lH and
l3CNMR as a colorless powder.

155

As mentioned above, phloroglucinol at this stage is in the dihydrate form. The
water is released upon heating at 110 °C or in vacuo. The following downstream
processing procedures are highlighted in (Figure 75) along with the yield remaining after

each subsequent step.

 

 

 

   

 

 

I 1:21
A U
:> 3 => Z)
r:-'.'
@V
7 8

9 10
98% 97% 91%

Figure 75 . Downstream processing for phloroglucinol production.
* percentages are a running tally of phloroglucinol remaining.

(5) Removal of cellular debris; 3-5 BV water at 4 °C, batch-mode. (6) Elution of
phloroglucinol; 5 BV of 0.1M NaHzPO4 at 60 °C. (7) Extraction; 3 x V with ethyl acetate.

(8) Decolorization and filtration; 2 x 5% charcoal to phloroglucinol by weight. (9)
Precipitation and filtration; hexanes 22 °C. (10) Remove hydration; 110°C.

From microbial synthesis to purified product in hand 91% recovery was obtained.
Optimization of the decolorization technique, and a column prefiltration to limit the
amount of cells and debris entering the column (work with hollow fibers and separation
cassettes were troubled by lack of flow-rate because of the high density culture) could

result in recoveries upwards of 95%. Combining the downstream processing procedural

operations an outline of the entire procedure would follow in (Figure 76).

156

 

 

 

 

 

 

 

 

 

 

 

i}

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1O

 

Figure 76. Phloroglucinol process from biosynthesis to product isolation.

(1) Generate phosphate resin form; 15 BV of 1M NaHZPO4. (2) Sterilize resin bed; 1 EV
of 70% EtOH. (3) Sterile wash; 3 BV of autoclaved water. (4) Extraction; phloroglucinol
bound to resin. (5) Removal of cellular debris; 3—5 BV water at 4 °C, batch-mode. (6)

Elution of phloroglucinol; 5 EV of 0.1M NaH2P04 at 60 °C. (7) Extraction; 3 x V with
ethyl acetate. (8) Decolorization and filtration; 2 x 5% charcoal to phloroglucinol by
weight. (9) Precipitation and filtration; hexanes 22 °C. (10) Remove hydration; 110°C.

157

Resorcinol from hydrogenation of biobased phloroglucinol

Hydrogenation of authentic phloroglucinol was reproduced from the work of Dr.

8 . . . .
Hansen. Early hydrogenation results indicated there was some sort of catalyst porson

contaminating the biobased phloroglucinol without indication by NMR and GC (Figure
77). This poison is yet to be identified. Purification was best achieved with treatment of
activated charcoal.

Sublimation gave a 54% recovery rate with decomposition of starting material
consistent with the literature. Charcoal treatment as indicated gave a recovery of 92%
upon two treatments and 85% with five treatments. After the hydrogenation and prior to

aromatization, the reaction goes through the salt of dihydrophloroglucinol.

158

OH HO H OH

Q Catalyst £1” XM H2804 Q
HO OH rt, 1M NaOH 0 O Y h, 2 OC HO

1 12 n, 50 psi H2 2 3

 

 

 

Hydrogenation Results

 

 

Phloroglucinol Scale Purification, Catalyst Products (%)
(g) 1088 (0/0) (mol%) 1 3
Authentic 5 1,2 Rh/A1203 83
5 1.2 Rh/C 78
5 1.2 Pt/C 63
20 1.2 Rh/Ale3 84
Biobased 5 12 Rh/AI203 94
5 1.2 Rh/C 90
5 1.2 Pt/C 62
5 A(46)* 1.2 Pt/C 62
20 1.2 PVC 92 5
20 8(8)* 1.2 Pt/C 82 15
20 C(15)* 1.2 Pt/C 63
20 5.0 Pt/C 64
20 8(8)* 1.2 Bh/A1203 91
20 C(15)‘ 1.2 Rh/AI203 81
20 5.0 Rh/Al203 79
20 B(8)' 1.2 Rh/C 86 10

 

*A = sublimation
B = 2 x Treatment
C = 5 x Treatment

Treatment: 5% by weight Darco KB 100 mesh wet powder activated
charcoal was added to a corresponding 20 g/L PG solution in water.

 

 

 

Rearomatlzation
Concentration Conversion of
PG (g/L) X Y Z 2 to 3 (%)

20 0.5 8 1 10 100
20 0.5 1 1 10 100

20 0.5 24 23 43
10 0.5 1 1 10 100
10 0.08 1 1 10 100

1'5 1 n/a 8 23 30 2
0.151 “/8 8 23 87 2

 

l = g Dowex-50Wx4 (H‘) / g PG in SmL ddeO

2 = Conversion 2 to 1

Figure 77. Pretreatments and hydrogenations of phloroglucinol.

159

Discussion

Conditions for Dowex 1 strong anion exchange resin were optimized for practical
cycling of culture through the fluidized resin bed, phloroglucinol capture and elution. A
low mesh size was utilized for ease of flow of a high-density microbial synthesis culture
through a Bio-rad econo column in a fluidized bed mode. Cross-linking of the beads was
maximized for phloroglucinol capture at 8%. The phosphate form of the resin was
optimal, because of the need of phosphates in the fermenter as a nutrient and the lability to
optimize anionic phloroglucinol capture. The sulfate form should be thoroughly tested by
experimentation because of the similar need for nutrition along side the cost benefits over
phosphate and the lack of eutrophication properties. In order to have a streamlined elution
and regeneration, monobasic phophates were used supplying a form of acid and phosphate
counter-ion. Acids are used to first protonate any anionically bound molecule and allow it
to wash away, but then the conjugate base can take the place of the released neutral
molecule. The number of protons or other ions changes the effective density of the resin,
as seen by a rise in bed volume with increasing salt concentrations, and phloroglucinol
cannot be efficiently pushed through the resin beds presumably because of gaps between
the highly “solublizing” stationary phase. With the resin compacted the phloroglucinol
does not have to escape the binding affinity to the backbone of the resin and can be
effectively pushed by slight interaction with mobile phase until it comes off the column.
These ideas also give a peace of mind in phloroglucinol extraction because if water elutes
phloroglucinol then one might ask why phloroglucinol will not elute in 36 °C microbial
synthesis culture? During extractive microbial synthesis the resin is operated in a

fluidized bed mode, drastically decreasing the “effective density” of the resin. Extraction

160

was successful in ethyl acetate, followed by discoloration with charcoal and precipitation
with hexanes to afford the dihydrate version of phloroglucinol, that when heated to 110
°C, dehydrated to yield phloroglucinol in 91% recovery from column to phloroglucinol in

a bottle that has been independently characterized to be a white solid with 99.6% purity.

Resorcinol was produced from hydrogenation of phloroglucinol with Rh/AIZO3 in

basic solution with comparable yields to the literature going through the
dihydrophlorogluinol salt that upon reflux in acid gives resorcinol. When Dowex cation
exchange resin was used as a potential acid source the dihydrophloroglucinol salt was
retransformed into phloroglucinol. After distillation in a Kugel-Rohr apparatus resorcinol
was produced in over 100 g quantity from biobased phloroglucinol as a result of
heterologous expression of pth in W31108erA(DE3) giving white crystals independently
certified to be 99.9% pure with only contaminates observed was phloroglucinol in 0.01%

which is on target with industrially used resorcinol.

161

CHAPTER FOUR REFERENCE

‘ Lohrie, M.; Knoche, w. J. Am. Chem. Soc. 1993, 115,919.

2 Baeyer, A. Ber. Dtsch. Chem. Ges. 1886, I 9, 159. For a review on various reactions with
phloroglucinol: Ershov, V .V .; Nikiforov, G.A. Russ. Chem. Rev. 1966, 35, 817.

3 Highet, R.; Batterharn, T. J. Org. Chem. 1964, 29, 475.

4 Wang, D.; Hildenbrand, K.; Leitich, J.; Schuchmann, H.P.; Sonntag, C. v. Zeits. Fur
Natur. B. 1993, 48, 478.

5 Fray, (3.1. Tetrahedron. 1958, 3, 316.
6 Hansen, C. PhD Dissertation, Michigan State University, 2002.
7 Smissman, E. E.; Voldeng, A. N.; McCarthy, J. F. J. Pharm. Sci. 1966, 55,1101.

8 Hansen, C.A.; Frost, J.W. J. Amer. Chem. Soc. 2002, 124, 5926.

162

CHAPTER FIVE

Experimental

All reactions sensitive to air and moisture were carried out in oven and/or flame
dried glassware under positive argon or nitrogen pressure. Air or moisture sensitive
reagents and solvents were transferred to reaction flasks fitted with rubber septa via
syringes or cannula. Solvents were removed using either a Biichi rotary evaporator at
water aspirator pressure or under high vacuum. Hydrodenitrogenations were performed in
the Parr 4575 stainless steel high temperature-high pressure reactor equipped with the Parr
4842 temperature controller, which controlled the temperature and stirring rate.
Hydrogenations were performed on a Parr hydrogenation apparatus under 50 psi of

hydrogen at rt unless otherwise specified.

Reagents and solvents

THF and diethyl ether were distilled under nitrogen from sodium benzophenone
ketyl. DMF, DMSO, hexanes and acetone were dried over activated Linde 4 A molecular
sieves under nitrogen. Water was glass distilled and deionized. All reagents and solvents
were used as available from commercial sources or purified according to published
procedures. If applicable organic solutions of products were dried over anhydrous

MgSO4. Charcoal (Darco® G-60 ~ 100 mesh) was used for discoloration of solutions.

Sodium salt of 3-(trimethylsilyl)-propionic2,2,3,3-d4 acid (TSP) was purchased from

163

Lancaster Synthesis lnc. Diazomethane was generated from Diazald® following a

literature procedure.

Chromatography

AG 1x8 Cl' was converted to the hydroxide form by washing with twenty column
volumes of 1N NaOH. The column was then washed with distilled deionized water until
all the chloride was displaced as determined by silver nitrate test.

Dowex 50Wx8 100-200 (H‘) and Dowex 1x8 200-400 (Cl') were purchased from
Sigma- Aldrich. Previously used Dowex 50 (H‘) was cleaned by treatment with bromine.
An aqueous suspension of resin was adjusted to pH 14 by addition of solid KOH.
Bromine was added to the solution until the suspension turned a golden yellow color.
Additional bromine was added (l-2 mL) to obtain a saturated solution. The mixture stood
at room temperature overnight, and the Dowex 50 resin was collected by filtration and
washed exhaustively with water followed by 6 N HCl. Dowex 50 (11*) was stored at 4 °C.
AG 1x8 (acetate form and chloride form) and hydroxyapatite Bio-Gel HTP gel were

purchased from Bio-Rad.

Spectroscopic and analytical measurements

'H NMR and '3C NMR spectra were recorded on a Varian VX-300 FT-NMR
spectrometer or a Varian VXR—SOO FT-NMR spectrometer. Chemical shifts for ‘H NMR

spectra are reported in parts per million (ppm) relative to internal tetramethylsilane

164

(Me4Si, 6 = 0.0 ppm) with CDCI3 as the solvent and to internal sodium 3-(trimethylsilyl)

propionate-2,2,3,3-d4 (TSP, a = 0.0 ppm) when D20 was the solvent. 13C NMR spectra

were recorded at 75 MHz on a Varian VX—300 FT-NMR spectrometer or at 125 MHz on a

Varian VXR-SOO FT—NMR spectrometer. Chemical shifts for 13C NMR spectra were

reported in parts per million (ppm) relative to CDCI3 (6 = 77.0 ppm) or CD3OD (6 = 49.0

ppm) in D20. 1 mL of the bioconversion mixture was taken every h and the protein was

precipitated with 10% HCI and spun down in a microfuge. The supernatant was

concentrated to dryness, the residue redissolved in 1 mL D20, concentrated again to

dryness and the residue redissolved in 1 mL D20 containing 10 mM TSP. The molar

concentration during the bioconversion of L-lysine to B-L-lysine was determined as
mentioned above. The concentration of B-L-lysine and L-lysine were determined by the
ratios of the integrated 1H NMR resonances at 6 2.8 and a 2.0, respectively, with the
integrated resonance corresponding to TSP at a 0.00.

Gas chromatography was used to determine the product yields obtained during the
bioconversions. Chromatograms were obtained using an Agilent 6890N equipped with an
HP-S column (30 m x 0.25 mm x 0.25 pm) after samples were derivatized with
bis(trimethylsilyl) trifluoroacetamide (BSTFA). Analysis was optimized by using a
temperature program in the range from 120 °C to 210 °C at 15 °C/min. GC derivatization
was initiated by dissolving the extracted or dried material in pyridine (1 mL) followed by
the addition of dodecane (0.001 mL) and bis(trimethylsilyl)fluoroacetamide BSTFA (1

mL) per sample. A stock of the derivatization components is generally prepared and used

165

promptly within 3 h. Derivatization reactions are stirred at room temperature in darkness
for a minimum of 2 h. No change in yield was observed when reaction times were
increased up to 12 h. Yield was determined using response factors obtained when
authentic phloroglucinol (Fluka, catalog number 79330) was extracted or dried and
derivitized using the same protocol. Halving the derivitization mixture showed no
deviance from the calibration curve. Samples were injected (2-5 uL) using an Agilent
7683 series injector. Yields were determined with response factors obtained from

authentic samples that were quantified relative to dodecane internal standard.

Bacterial strains, plasmids, primers and gene synthesis

Clostridium subterminale SB4, Escherichia coli W3110 and Pseudomonas
fluorescens Pf-S were obtained from ATCC. Escherichia coli BL21 was obtained from
Novagen. Escherichia coli DHSa was purchased from lnvitrogen. Primers were
synthesized by the Research Technology Support Facility at Michigan State University.
Plasmid sequencing was completed at the Research Technology Support Facility at
Michigan State University. Genes submitted for synthesis were constructed by DNA2.0

(Menlo Park, CA).

166

Storage of microbial strains and plasmids

All bacterial strains were stored at -78 °C in glycerol. Plasmids were transformed
into DHSa for long-term storage. Glycerol samples were prepared by adding 0.75 mL of

an overnight culture to a sterile vial containing 0.25 mL of 80% (v/v) glycerol. The

solution was mixed, flash frozen in liquid N2 and then stored at —78 °C.

C ulturing of Clostridium subterminale

Clostridium subterminale SB4 was obtained from the American Type Culture

Collection (ATCC 29748). Cells were grown in a medium (1 L) containing yeast extract
(6 g), L-lysine-HCI (6 g), 1 M phosphate buffer (45 mL), and l M K2C03 (7.5 mL) at pH

7.5 (Clostridium medium). After the medium was autoclaved in a Pyrex bottle, it was

purged with N2 while it was allowed to cool to rt. All subsequent manipulations were

performed in a Coy anaerobic chamber. Sodium dithionite (30 mg) was added to the
medium inside a Coy anaerobic chamber. Cultures were initiated by inoculating a single
colony into 5 mL of semisolid (0.2% agar) Clostridium medium. The test tubes were
sealed tightly with septa and the inoculants were cultured at 37 °C with agitation at 250
rpm for 12 h outside of the Coy chamber. The 5 mL semisolid aliquot was subsequently
transferred (inside a Coy chamber) to a 100 mL containing clostridium medium. The cells

were grown at 37 °C with agitation at 150 rpm for 12 h and subsequently transferred to l

167

L of growth medium, which was cultured for 12-18 h at 37 °C to OD600 ~2-3.2.

Following centrifugation at 9,000g for 10 min, approximately 2-4 g of wet cells were
obtained. Precaution was taken not to expose cells to air by conducting all transfers inside

the Coy chamber.

Intact cell bioconversion of L-lysine

All manipulations are carried out in a Coy anaerobic chamber unless otherwise

noted. Clostridium subterminale SB4 cells harvested after 18 h (OD600 ~ 2) from a 4 L

medium, either thawed from -80 °C freezer or freshly cultured, were resuspended in a

reaction mixture, previously purged with N2, containing 150 mM L-lysine, 80 mM Tris-

HCl (pH 7.5), 5 mM potassium phosphate (pH 7.5), and FeSO4 (3 mM). The reaction

mixture contained ~20 g of cells/250 mL Pyrex bottle, which was sealed with a screw-cap.
The reaction mixture was incubated outside of the Coy chamber, in a 37 °C shaker (150
rpm) with a tungsten lamp (75 watt, 120 V) directly shone at the Pyrex bottles for 24 h.
Outside of the coy chamber the reaction mixture was centrifuged at 9000g to remove
intact cells and the resulting supernatant was concentrated to 20 mL, which was then

acidified to pH 2.5 with HCI. A mL of the product mixture was concentrated to dryness

and the residue was redissolved in D20 (1 mL) and concentrated three times. L-B-Lysine

was quantified by integration of its 2.8 ppm peak relative to TSP internal standard.

168

Purification of L-B-lysine

The main reaction mixture was acidified to pH 2.5, centrifuged to remove protein,
and then loaded on the Dowex 50 (H*) column (3 x 40 cm) previously washed with 10
mM HCl. The L-lysine and L-B-lysine were differentially eluted with 0.2 M sodium
formate buffer, pH 2.75, containing 0.35 M NaCl. Fractions of 10 mL were collected after
~200 mL of eluent was discarded. L-Lysine eluted first in the fractions 22-56 and L—B-
lysine in fractions 78-115. The L-B-lysine fraction were pooled and concentrated to 50
mL and loaded on a fresh Dowex 50-column and washed with water. The amino acid was
retained on the column and then was eluted with l N ammonium hydroxide, which came
out as a single 40-mL fraction. The L—B-lysine solution was evaporated under reduced
pressure to remove excess ammonia and the resulting yellow solid was redissolved in
ethanoi and concentrated several times to a to afford a yellow solid in 43% isolated yield
based on starting L-lysine. L-B-Lysine obtained was very hygrosc0pic and was used in the

next step.

Deamination of L-B-lysine

A solution of L—B-lysine (0.4 g, 2.8 mmol) was dissolved in ethanol (80 mL) in a

glass reaction vessel. 5 mol % of Ru/Al203 (0.28 g, 0.14 mmol) was suspended in the

reaction solution. The glass reaction vessel was inserted into the 500 mL Parr 4575

stainless steel high temperature-high pressure reactor and the vessel sealed. The

169

temperature and the stirring rate were controlled by a Parr 4842 temperature controller.
Hydrogen was bubbled through the reaction mixture for 10-15 min to remove air while

stirring at 100 rpm. The vessel was heated to 200 °C and stirred for 2 h. After 2 h, the

reaction vessel was pressurized to 1,000 psi H2 pressure. The reaction was stirred at 400

rpm for another 2 h. After removal of the catalyst by filtration, the reaction mixture was
concentrated to dryness under vacuum to afford a brown residue. Quantification was
conducted by integration of the caprolactam peak centered at 2.5 ppm relative to TSP as

an internal standard.

. . . . l
Cyclization of L-lysme to a-Ammo-caprolactam.

A stirrer mixture of L-lysine-HCI (55 g, 0.3 mol) and NaOH (12 g, 0.3 mol) in 1,2,-
propanediol (1.2 L) was heated to reflux for 2 h in the presence of Dean-Stark trap. The
solution was then cooled and concentrated under vacuum to afford to a-aminocaprolactam
along with byproduct NaCl, which was removed by filtration.

In an alternative method, a-aminocaprolactam was obtained from heating a
mixture of L-lysine in EtOH to 200 °C for 2 h inside a 4575 Parr reaction vessel. After

removal of ethanol, a-aminocaprolactam was obtained as the only product as confirmed

by ‘HNMR.

170

Chemical L-B-Lysine synthesis.2

A solution of L-ornithine-HCI (30.0 g, 0.178 mol) in 5 M NaOH (450 mL) was
stirred with icebath cooling while benzyl chloroformate (63.5 mL, 0.440 mol) was added

dropwise over 15 min. The resulting mixture was stirred for an additional 6 h in an

icebath before it was diluted with H20 (400 mL) and acidified to pH 5 with concentrated

HCI. The solution was extracted 5x with ethyl acetate (200 mL) and the combined

extracts were washed with brine, dried over NaZSO4, and concentrated in vacuo to afford a

white wax, which was suspended in boiling petroleum ether and filtered to afford N,N’-
dibenzyloxycarbonyl L—omithine (52 g, 80%). To a solution of N,N’-dibenzyloxy-
carbonyl L-ornithine (9.15 g, 0.0250 mol) in ethyl acetate (250 mL) was added N-
methylmorpholine (3.0 mL, 0.0275 mol). The solution was stirred at —10 °C while
ethylchloroformate (4.75 mL, 0.050 mol) was introduced dropwise over 20 min. The
resulting milky mixture was stirred for an addition 3 h at —-10 °C before it was filtered
through Celite. The resulting filtrate was combined with a 0.8 M diazomethane in diethyl
ether (400 mL) and stirred at 0 °C for 6 h. Excess diazomethane was destroyed by
addition of acetic acid before the reaction mixture was concentrated under reduced
pressure to afford a diazoketone as a yellow solid (6.25 g, 85%).

The diazoketone (6.25 g, 0.0214 mol) was dissolved in methanol (100 mL) and the
reaction flask was wrapped with aluminium foil. All subsequent reactions were performed
in the dark room. A solution of silver benzoate (1.25 g, 6.55 mmol) in triethylamine (20

mL) was introduced dropwise into the diazoketone solution held at 0 °C. The reaction

171

mixture was stirred for l h before an additional solution of silver benzoate was introduced.

The resulting muddy mixture was concentrated to dryness and the resulting residue was
redissolved in ethyl acetate (20 mL) and subsequently washed with NaHCO3 (10 mL),
brine (2 x 10 mL) and 5% HCI (10 mL). After the organic layer was dried and

concentrated under reduced pressure, L-B-lysine ester was obtained as an orange solid

(4.11 g,65%).

In vitro enzyme assays preparation

After collected and resuspended in the proper resuspension buffer, the cells were
disrupted by two passages through a French pressure cell (SLM Aminco) at 16,000 psi.
Cellular debris was removed from the lysate by centrifugation (48,000g, 20 min, 4 °C).
Protein was quantified using the Bradford dye-binding procedure.3 A standard curve was

prepared using bovine serum albumin. Protein assay solution was purchased from Bio-

Rad and used as described by the manufacture.

Plasmids

Unless otherwise noted all plasmid construction was completed in DHSa or XLl
Blue on appropriate antibiotics and was verified by both enzymatic digestion and

sequencing in both directions.

172

Plasmid pJA3. 131A

Plasmid pJA3.l31A is a 8.2 kb plasmid derived from pJA2.042. Plasmid
pJA2.042 was created by insertion of pth behind the T7 promoter of pHIS-8, a
pET28a(+) derivative (Novagen). Insertion of a 1.6 kb fragment encoding serA from
Smal digested pRCl .558 into the Bglll site of pJA2.042 afforded pJA3.l31A in which the

pth gene and serA gene are transcribed in opposite directions.

Plasmid pBC1. 146

Plasmid pBC1 .146 is a 7.0 kb plasmid. As a negative pth control of pJA3.l3lA,
pBCl.146 is derived from leS-8. Smal digested pRCl.55B excising a 1.6kb serA gene
fragment was cloned into the Bglli site after blunting with Klenow large fragment. The

serA gene is transcribed in the opposite direction of the T7 promoter.

Plasmid pBCZ.055

Plasmid pBC2.055 is a 3.9 kb plasmid. Pf-S pth was cloned into the pKD3 host
vector. The T7 promoter region with the Pf-5 pth gene was PCR amplified from
pJA3.242 with engineered Sphl and BmgBI cutting sites. JWF 1637 5’—
GTACCT GCATGCT CT CGATCCCGCGAAA'ITA-3’ was used as the forward primer
and JWF 1610 was the reverse primer 5’-AATTTAACACGTCAGGCACAGGCAGTC
ACATCA-3’. PKD3 and the column purified PCR product was digested with Sphl and

BmgBl, purified and ligated with the Fast-link Ligation kit. Along the lines with

173

experimental design the PF—S pth fragment is in the opposite orientation as the cmR gene.

Verification was observed by digestion with Hindlll.

Plasmid p802. 179

Plasmid pBC2.179 is a 6.4 kb plasmid. pJA3.l31A has DNA followed by a stop
codon between the T7 promoter and the transcribed pth sequence. pBC2.179 chose the
same pET-based expression system in attempts to give the pth gene optimal positioning
for unperturbed transcription. pET-27b(+) was purchased from Novagen. pth was PCR
amplified with primers installing Ndel and BamHI sites from pJA3.131A. The forward
primer being JWF1668 5’-GGAATTCCATATGTCTACACTTTGCCTTCCJ’ and the
reverse primer used was JWF1669 5’-CGCGGATCCTCAGGCGGTCCACTCGC-3’.
The gel purified PCR product and pET-27b(+) were independently digested sequentially
with BamHI and Ndel. The digested vector was treated with CIAP prior to ligation with

the Fast-link ligation kit. Verification was observed by digestion with Smal.

Plasmid p802. 187

Plasmid pBC2.187 is a 8.1 kb plasmid. Insertion of the serA gene locus involved
in the production of serine into pBC2.179 was achieved to provide a nutritional marker for
a host with a serA deletion offering an alternative to antibiotic pressure that is not practical
in an industrial setting. The serA fragment origin is pRC 1.55b which was cloned into
pSU18. pRC1.55b is a plasmid produced by Rachel Christ of our lab. Digestion of
pRC1.55b with Smal afforded a 1.6 kb serA encoding fragment. pBC2.179 was digested

with Sphl, blunted with Klenow, dephosphorylated with CIAP and ligated with the serA

174

fragment. serA and pth are transcribed in opposite directions. Orientation was verified

by digestion with Pstl.

Plasmid pBCZ.212

Plasmid pBC2.212 is a 6.4 kb plasmid. The Pf-S pth sequence was visually
optimized for transcription of the proper statistical alignment of E. coli compared to the
Pseudomonas host (See “in-house optimized pth sequence”). Attention was focused
with preference of common codon usage towards the leading end of pth. pJ201:13176
encoded the optimized pth sequence and was synthesized by DNA2.0 with engineered
with BamHI and Ndel cutting sites. p1201:13l76 and pET-27b(+) were independently
digested sequentially with BamHI and Ndel. The digestion mixtures were independently
gel purified using the Zymo kit. The digested vector was treated with CIAP prior to

ligation with the Fast-link ligation kit. Verification was observed by digestion with Eagl.

Plasmid pBCZ.219

Plasmid pBC2.219 is a 8.1 kb plasmid. Insertion of the serA gene locus involved
in the production of serine into pBC2.212 was achieved to provide a nutritional marker for
a host with a serA deletion offering an alternative to antibiotic pressure that is not practical
in an industrial setting. The serA fragment origin is pRCl.55b which was cloned into
pSU18. pRCl.55b is a plasmid produced by Rachel Christ of our lab. Digestion of
pRCl .55b with Smal afforded a 1.6 kb serA encoding fragment. pBC2.212 was digested

with Sphl, blunted with Klenow, dephosphorylated with CIAP and ligated with the serA

175

fragment. serA and pth are transcribed in opposite directions. Orientation was verified

by with a Pstl and Xhol double enzyme digestion.

Plasmid p802. 252

Plasmid pBC2.252 is a 6.4 kb plasmid. The Pf-S pth sequence was visually
optimized for transcription of the proper statistical alignment of E. coli compared to the

6

Pseudomonas host (See ‘in-house optimized pth sequence”). Attention was focused
with preference of common codon usage towards the leading end of pth. pJ201:13176
encoded the optimized pth sequence and was synthesized by DNA2.0. The optimized
pth was PCR amplified from pBC2.219 using JWF1695 S’-AACGCGGATCCATGTC
TACACITTGCCITCCA-3’ and JWF1696 5’-AATCCCAAGC’1TTTAAGCCGTCCA
CT CT CCAA-3’ inserting BamHI and Hindlll sites respectively. The purified PCR
product and pJF118EH were independently digested sequentially with BamHI and
Hindlll. The vector was dephophorylated with CIAP before ligation with the Fast-link kit.

Verification was observed with digestion by Ndel.

Plasmid p802.25 7

Plasmid pBC2.257 is a 8.1 kb plasmid. Insertion of the serA gene locus involved
in the production of serine into pBC2.252 was achieved to provide a nutritional marker for
a host with a serA deletion offering an alternative to antibiotic pressure that is not practical
in an industrial setting. The serA fragment origin is pRCl.55b which was cloned into

pSU18. pRCl.55b is a plasmid produced by Rachel Christ of our lab. Digestion of

176

pRCl .55b with Smal afforded a 1.6 kb serA encoding fragment. pBC2.252 was digested
with Ndel, blunted with Klenow, dephosphorylated with CIAP and ligated with the serA
fragment. serA and pth are transcribed in the same direction. Orientation was verified

by with a Pstl and ScaI double enzyme digestion.

Plasmid pBCZ.264

Plasmid pBC2.264 is a 8.1 kb plasmid. Insertion of the serA gene locus involved
in the production of serine into pBC2.252 was achieved to provide a nutritional marker for
a host with a serA deletion offering an alternative to antibiotic pressure that is not practical
in an industrial setting. The serA fragment origin is pRCl.55b which was cloned into
pSU18. pRCl.55b is a plasmid produced by Rachel Christ of our lab. Digestion of
pRCl .55b with Smal afforded a 1.6 kb serA encoding fragment. pBC2.252 was digested
with ScaI, blunted with Klenow, dephosphorylated with CIAP and ligated with the serA
fragment. pBC2.264 was a back-up strategy cloned concurrently with pBC2.257 and was

not characterized by microbial synthesis.

Plasmid pBCZ.271

Plasmid pBC2.271 is a 6.4 kb plasmid. The Pf-S pth sequence was optimized for
transcription of the proper statistical alignment of E. coli compared to the Pseudomonas
host (See “DNA2.0 optimized pth sequence”) using the gene designer software offered
by DNA2.0. p.1201215277 encoded the optimized pth sequence and was synthesized by

DNA2.0 with engineered with BamHI and Ndel cutting sites. pJ201:15277 and pET-

I77

27b(+) were independently digested sequentially with BamHI and Ndel. The digestion
mixtures were independently gel purified using the Zymo kit. The digested vector was
treated with CIAP prior to ligation with the Fast-link ligation kit. Orientation was verified

by with a Pstl and Eagl double enzyme digestion.

Plasmid pBCZ.274

Plasmid pBC2.274 is a 8.1 kb plasmid. Insertion of the serA gene locus involved
in the production of serine into pBC2.271 was achieved to provide a nutritional marker for
a host with a serA deletion offering an alternative to antibiotic pressure that is not practical
in an industrial setting. The serA fragment origin is pRCl.55b which was cloned into
pSU18. pRCl.55b is a plasmid produced by Rachel Christ of our lab. Digestion of
pRCl .55b with Smal afforded a 1.6 kb serA encoding fragment. pBC2.271 was digested
with Sphl, blunted with Klenow, dephosphorylated with CIAP and ligated with the serA
fragment. serA and pth are transcribed in opposite directions. Orientation was verified

by digestion with Pstl.

178

Comprehensive reference list of strains and plasmids

 

 

 

 

 

strain relavant characteristics source
DHSa F’ ¢801acZAM/5 A(lacZYA-argF)U169 deoR Invitrogen
recAI endAI hst17(rk',mk*)ph0A 11' supE44 thi-
l gyrA96 relAl
31210353) E. coli B F dcm ompT hst(rB- m B- ) gal A (0153) Novagen
XLl-Blue recAI endAI gyrA96 thi-I hst17 supE44 relAI Stratagene
lac [F’ proAB lachZAMl5 TnlO (Tet)].
BW251 13 DE(araD-araB)567lacZ47879del)(: :rrnB-3)LAM- CGSC
rph- 1 DE(rhaD-rhaB)568hstS 14
W31 10 wild-type K12 ATCC
Pseudomonas wild-type ATCC
F luorescens Pf-5
plasmid relavant characteristics source
pUCl8 APR, Plac ref
pKD3 ApR, FRT-flanked CmR ref
pKD4 ApR, FRT-flanked KmR ref
PKD46 ApR, araC, PamBy, fl, exo,ts-pA101 replicon CGSC
pCP20 ApR, Cm“, Flp“, A. cI857+ ref
pRCl .55B serA in pSUl8 lab
pJF118EH ApR, laclQ in pKK223-3 lab4
pET27b(+) KmR, lale, p77 Novagen
pBCl .146 Km“, lac/Q, p77 This study
pBC2.055 ApR, pth FRT-flanked CmR This study
pBC2.179 Km“, lac/Q, p77, ,9th This study
pBC2.187 Km“, lac/Q, 1977,],th, serA This study
PBCZ-ZIZ KmR, lac/Q, P77, in house opt pth This study
PBC2-219 KmR, lale, P77, in house opt pth, serA This study
pBC2.252 ApR, laclQ in pKK223-3, in house opt pth This study
pBC2.257 ApR, lac]Q in pKK223-3, in house opt pth, serA This study
PBC2-271 KmR, lac/Q, P77, 2.0 opt pth This study
PBC2-274 Km“, lac/Q, P77, 2.0 opt pth, serA This study

 

179

In house optimized pth sequence

The Pf—Spth sequence was visually optimized for transcription of the proper
statistical alignment of E. coli compared to the Pseudomonas host (see text for comparison
and statistical aligments). The optimized sequence is as follows with changes from PF-S
wild type pth in light grey:

ATGTCTACACTTTGCCI‘TCCAC'AT(iTTATGTTTCCGCAACACA A A ATTACCCAG
CAACAGATGCiTTGATCACCTGGAAAACTTGCA CGCG G ATCATCCACGTATGGC
CCT G G C G A A .~\ CGCATGATCGCCA ATACCGAAGTCAACG A A CG TC ATCT GGTGT
TGCCGATTC 1 ATGAATTGGCAGTGCACACCGGTTTTA C G CATCGCAGCATCGTC
TATG A ACGTGAAGCGCGTCAGATGAGTTCGGCCGCGGCG( ‘GTCAAGCAATCG
A A AATGCCGG GTTA CAGATTAGCG ATATTCGCATGGTGATTGTCACI‘ TCT TGC
ACCGGGTTTATGATGCCGTCGTTAAC G GCGCACCT GATCA ATG ATTTAGC ACT
GCCAACCT CCACCGTGCAGTTGCCGAT'IT } CTCAGCT GGGC TGTGTGG C A GGTG
CCGCGGCCATCA ATC G TGCCAACGACT'FI'GCA CGTCT CGATG CTCGCA ATC AT
GTATTAATTGTG']'(T'I‘CTGGAATTCTCCAGTCTGTGCTATCAGCCGGACG ATA C G
AAGCTGCACG CT'I‘I’1‘ATCTCCGCGGCGCTGTTCGGCGATGCGGTATCTGCCTGT
GTTCFGCGTGCTGATG ATC‘A AGCCGGTGGCTTTAAAATCAAAAAGACGGAGA
GTTACTTCI‘TK } (“CG .~\ A A AGCGAGCACT A'I'ATCA A ATACGACGTGA A A G ATACC
GGCITTCAT'ITTACCCT'I‘G ATA A A GCGGTGATGA ATTCCATTAA AGACGTTGC
ACCGGTCATGGAGCGGCTCAACTATGAGAGCTTTGAACAGAATTGTGCGCATA
ACG ATTTCI"l"l‘ATCTTCCAC.-\ CAGGTGGTCGCAAGAT'I'CTTGACGAGCI‘GGTG
ATGCATT'I'AGACCI‘GGCATCCAATCGGGTCTCA CAAAGTCGCAGCAGCC’I‘GTC
GGAAG CTGGCAACATTGCCTC A GTGGTTGTGTTCGACGTACT CA A ACGGCAGT
TTGATTCCAACCT CAATCGCGGCGACATCG( ‘1 ACT GCT GGCAGCCTT CGGCC‘C "1‘
GGG’I"l‘TA("I‘GCGGAAATGGCGGTTG G AGAGTGGA CG G CTTA A

180

DNA2.0 gene designer optimized pth sequence

The PF—S pth sequence was optimized for transcription of the proper statistical
alignment of E. coli compared to the Pseudomonas host (see text for detail). The
optimized sequence is as follows:

ATGTCT ACT CT GTGCCT GCCACACGTAATGTTCCCACAACACAAAATCACT CA
GCAGCAAATGGTTGACCACCTGGAAAACCTGCACGCCGATCACCCACGTATG
GCT CT GGCT AAACGTATGATCGCT AACACCGAGGTTAACGAGCGTCATCT GGT
ACT GCCGATTGACGAGCT GGCAGTTCATACCGGCTTT ACCCACCGCT CT ATCG
TGTACGAACGCGAAGCGCGCCAGATGTCTTCTGCAGCGGCTCGTCAGGCGATT
GAGAACGCAGGTCT GCAAATCAGCGACATCCGTATGGTGATCGTTACCAGCT G
TACT GGTTTTATGATGCCT TCT CT GACT GCCCATCT GATTAATGATCT GGCCCT
GCCAACTAGCACCGTACAACTGCCGATTGCGCAGC'TGGGCFGTGTTGCFGGTG
CGGCAGCTATTAATCGCGCTAACGATTTTGCACGCCTGGATGCTCGTAATCAT
GTTCT GATTGTGTCT CT GGAATTCT CT AGCCT GTGCT ACCAACCGGATGACACG
AAACTGCACGCGTTTATCTCCGCTGCTCFG'ITCGGTGATGCGG'I‘TTCCGCATGT
GTACTGCGCGCGGATGACCAAGCTGGCGGTTTCAAAATTAAAAAGACCGAAT
CT TACTT CCT GCCAAAAAGCGAACATTACATTAAATATGATGTTAAGGATACC
GGTTTCCATTTTACGCI GGATAAAGCF GTTATGAACT CT ATCAAAGACGTTGCT
CCGGTCATGGAACGTCTGAACI‘ATGAATCTTTTGAGCAGAACTGCGCICATAA
CGACTTCTTTATCI‘TCCATACCGGCGGTCGTAAAATCCTGGATGAACTGGTTAT
GCACCT GGACCT GGCGTCT AACCGTGTAAGCCAGTCT CGCAGCT CT CT GTCCG
AAGCFGGCAACATCGCGTCFGTGGTGGTCI‘TTGATGTGCTGAAACGTCAGTTC
GATAGCAATCTGAACCGTGGCGATATCGGTCTGCFGGCCGCCITCGGTCCTGG
CTTCACTGCTGAAATGGCGGTGGGTGAGTGGACCGCATAATGAGGATCCTAAT
GA

181

Culture mediums

All solutions were prepared in distilled, deionized water. LB medium (1 L)
contained Bacto tryptone (10 g), Bacto yeast extract (5 g), and NaCl (10 g). YT medium
(1 L) contained Bacto-tryptone (16 g), Bacto-yeast extracts (10 g) and NaCl (5 g) in
distilled, deionized water. TB medium (1 L) contained tryptone (10 g) and NaCl (5 g).

After autoclaving and directly before use, MgSO4 (10 mL of 1 M stock) was added to the
TB medium. M9 salts (1 L) contained NaZHPO4 (6 g). KH2P04 (3 g), NH4CI (1 g) and
NaCl (0.5 g). M9 medium contained D-glucose (10 g), MgSO4 (0.12 g) and thiamine

(0.001 g) in l L of M9 salts. CAYE medium (100 mL) contained casamino acids (2 g)

and yeast extract (10 g). Minimum salts (1 L) contained (NH4)2SO4 (0.2 g), KHZPO4 (0.6

g), KZHPO4 (1.4 g), sodium citrate (0.1 g) and magnesium sulphate (0.02 g). SOC

medium (1 L) contained Bacto tryptone (20 g), Bacto yeast extract (5 g), NaCl (10 mL, 1
M), KCl (2.5 mL, 1 M), MgC12 (10 mL, 1 M), MgSO4 (10 mL, 1 M) and glucose (10 mL,
2 M). 2xYT medium (1 L) contained Bacto tryptone (16 g), yeast extract (10 g) and NaCl

(5 g). Solutions of inorganic salts, magnesium salts and X-Gal indicator plates5 contained

glucose (4 g), lactose (4 g), X—gal (5-bromo-4—chloro-3-indolyl-,B-D-galactopyranoside) (1

mL, 3 mg/mL in EtOH:HzO, 1:1,v/v) in medium E (1 L) with 1.5% (w/v) Difco agar.
Antibiotics were added where appropriate to the following final concentrations

unless noted otherwise: ampicillin, 50 ug/mL; kanamycin, 50 ug/mL. Stock solutions of

antibiotics were prepared in water with the exceptions of tetracycline, which was prepared

182

in 50% aqueous ethanol. Antibiotics, isopropyl B-D-thioglucopyranoside (IPTG),
thiamine, and amino acid supplementations were sterilized through 0.22pm membranes
prior to addition to M9 medium. Solid medium was prepared by addition of 1.5% (w/v)
Difco agar to the medium.

Microbial synthesis medium (1 L) contained KzHPO4 (7 .5 g), ammonium iron (III)
citrate (0.3 g), citric acid monohydrate (2.1 g and concentrated HZSO4 (1.2 mL). The
culture medium was adjusted to pH 7.0 by addition of concentrated NH4OH before
autoclaving. The following supplements were added immediumtely prior to initiation of
the microbial synthesis: glucose (19 to 22 g) MgSO4 (0.24 g) and trace minerals
(NH4)6(Mo7OZ4).4 H20 (0.0037 g), ZnSO4.7 H20 (0.0029 g), H3BO3 (0.0247 g),
CuSO4.5 H20 (0.0025 g), and MnClz.4 H20 (0.0158 g). Solutions of D-glucose and
MgSO4 were autoclaved separately. Trace minerals were sterilized through 0.22-ym

membranes prior to addition to the medium.

Fed-batch microbial synthesis

Microbial syntheses were conducted in a B. Braun M2 culture vessel with a 2 L
working capacity. Environmental conditions were supplied by a B. Braun Biostat MD
controlled by a DCU-1. Data was acquired on a Dell Optiplex Gs+ 5166M personal
computer using B. Braun MFCS/Win software. PID control loops were used to control
temperature, pH, and glucose addition. The temperature was maintained at 33 °C or 36 °C

as indicated and the pH was maintained at 7.0 by addition of NH4OH and 2 N H2504.

183

Glucose was added as a 60% (w/v) solution. Dissolved oxygen (D.O.) was monitored

using a Mettler-Toledo 12 mm sterilizable Oz sensor fitted with an Ingold A-type Oz

permeable membrane. D.O. was maintained at 20% air saturation throughout the course
of the microbial synthesis unless otherwise specified. Antifoam (Sigma 204) was
manually pumped into the vessel as needed.

Inoculants were prepared by introduction of a single colony from a freshly
transformed plate onto M9 minimal medium with glucose into 20 mL of M9 minimal

medium with glucose. The culture was grown at 37 °C with agitation at 250 rpm until an

OD600 ~ 0.5—1.0 (~18 h) and subsequently 0.5 - 1.0 mL, depending on previous optical

density, was transferred to another 20 mL of M9 glucose medium. Cultures were grown at

37 °C for an additional ~ 68 h. The inoculant (OD600 = 0.5 - 1.0) was then transferred

into the fermenter vessel and the batch microbial synthesis was initiated.

Three staged methods were used to maintain D.O. concentrations at desired air saturation
during the microbial synthesis. With the airflow at an initial setting of 0.06 LIL/min, the
DO. concentration, was maintained by increasing the impeller speed from its initial set
point of 50 rpm to its preset maximum rate. With the impeller speed constant, the mass
flow controller then maintained the DO. concentration by increasing the airflow rate from
0.06 L/L/min to a preset maximum of 1.0 L/L/min. At constant impeller speed and
constant airflow rate, the DO. concentration was finally maintained at the desired air
saturation for the remainder of the microbial synthesis by oxygen sensor-controlled carbon
source feeding. At the beginning of this stage, the DO. concentration fell below the

desired air saturation due to residual initial carbon source in the medium. This lasted for

184

approximately 10 min to 30 min before carbon source feeding commenced. The carbon

source feed PID control parameters were set to 0.0 3 (off) for the derivative control (131))

and 999.9 3 (minimum control action) for the integral control (1:1). XP was set to 950% to

achieve a KC of 0.1.

Process description of the biosynthesis of phloroglucinol

Fed-batch single stage continuous extractive microbial synthesis protocol
PhloroglucinoI is produced directly from glucose by a transformed strain of E. coli
K-12. The host strain and plasmid contain the necessary genes to provide efficient
metabolism of glucose to phloroglucinol. During the course of the microbial synthesis,
phloroglucinol is continuously extracted from the microbial synthesis medium by passage
through Dowex 1 strong anion exchange resin. Maintaining low glucose concentrations in
the microbial synthesis medium (< 0.1mM) results in optimal synthesis of phloroglucinol.
Host strain W31105erA(DE3) was constructed from E. coli K-12 strain W3110 (ATCC).
W31103erA(DE3) was created by inactivating the serA gene of W3110 to create
W31103erA followed by insertion of the T7 gene 1 onto the chromosome to obtain
W31105erA(DE3). The T7 gene 1 encodes for T7 RNA polymerase, which is needed to
overexpress genes cloned behind the T7 promoter. Phloroglucinol production occurs
when W3110$erA(DE3) is transformed with plasmid pBC2.274, an 8.1 kb plasmid that
includes a 1.1 kb fragment expressing the pth gene of Pseudomonas fluorescens Pf-S
optimized for E. coli cloned behind a T7 promoter. Plasmid pBC2.274 also contains the

E. coli serA gene. In the absence of serine supplementation W31105erA(DE3) does not

185

grow in minimal salts medium. The functional serA gene of pBC2.274 allows the
transformed host W31 lOserA(DE3)/pJA3.l31A to grow in minimal salts medium without

the addition of serine.

Phloroglucinol strain prior to microbial synthesis supplemental

Seedtrain for phloroglucinol bios ynthesis

The complete microbial synthesis process consists of a fed-batch production phase
inoculated from a two-stage seedtrain that has been grown from a single colony from a
freshly transformed plate. A 1% inoculum is used to inoculate the microbial synthesis at
bench—scale, but only for operational convenience. There has been no investigation of

inoculum volume at this time. The first inoculum seedtrain from F1 to F2 is a volume of

5% with a cell density (OD600) of approximately 1 (between 0.2 and 1.3 OD is sufficient).

There are differences between the seedtrain medium and the production medium.
Following 1% inoculation from F2 to the fermenter, the production phase runs for

approximately 60 hours as a fed-batch (glucose feed) microbial synthesis.

Control of fermentation vessel for phloroglucinol biosynthesis

Active pH control is required and the pH set-point is 7.0 i 0.1. Concentrated
ammonium hydroxide and 2 N sulfuric acid are used. Typically, only the ammonium
hydroxide is required. Antifoam 204 (Sigma—Aldrich) is also in place during the microbial
synthesis but is used only on an as-needed basis under manual control. No automated

antifoam control is used. The production vessel is batched with all the medium

186

components listed except the glucose feed solution. The medium pH is adjusted to 7 with

concentrated NH4OH prior to sterilization. The glucose for the initial batch is sterilized

separately as a 50% w/v solution. Following sterilization the temperature is brought to 36
°C, the glucose solution is added to the production vessel to give a final concentration of
25 g/L, the pH is adjusted to 7.0 and the inoculum is added. DO levels are maintained at
20% during initial growth of the microbial synthesis using the following cascade control.
With the airflow at an initial setting of 0.06 vvm, the dissolved oxygen is maintained by
increasing the impeller speed from an initial set point of 50 rpm (0.14 m/sec) to a preset
maximum of 1000 rpm (2.8 m/sec). Then with the impeller rate constant at 1000 rpm, the
mass flow controller maintains the dissolved oxygen concentration by increasing the
airflow rate from 0.06 vvm to a preset maximum of 1.0 vvm. During this part of the

microbial synthesis, glucose feeding does not occur while the cells consume the glucose

initially added to the medium. Typically, the cell density (OD600) of the microbial

synthesis will reach a value of 30—40 by the time agitation and airflow reach the maximum
set-points.

After reaching maximum agitation and airflow, DO levels are controlled by
glucose addition; glucose is added based on DO sensor readings to maintain a DO level of
20%. This event is referred to as the phase change and is defined by manual manipulation
from DO control by agitation and airflow to DO control by nutrient addition of glucose.
Airflow is set at l. .0 vvm and impeller speed is set at 1000 rpm (2.8 m/sec). After phase
change the DO level typically drops to 1-5% as glucose is consumed rapidly. Usually 0.5
to 1.0 h after the phase change is executed, all the initial glucose is consumed and glucose
addition begins when the DO level rises above 20%. The glucose feed PID control

187

parameters are set to 0.0 5 (off) for the derivative control (11D) and 999.9 3 (minimum

control action) for the integral control (1:1). Xp was set to 200%.

At the outset of the run and throughout the exponential phase of cell growth, the
temperature is set at 36 °C. Once the maximum agitation and airflow set-points are
reached the phase change is executed and the temperature is decreased linearly from 36 °C
to 33 °C over a 30 min period.

Phloroglucinol production by the cells requires addition of isopropyl-B-D-
thiogalactopyranoside (IPTG) to the culture medium. IPTG induces production of T7
RNA polymerase which in turn recognizes the T7 promoter situated upstream of the pth
gene. IPTG (0.075 g/L) delivered as 3 mL of a 0.025 g/mL sterile-filtered solution) is
added to the medium as soon as the temperature ramp from 36 °C to 33 °C is complete.
IPTG (3 mL of 0.025 g/mL stock solution) is added to the medium 24, 36, and 48 h after
initiation of the run. It should not be metabolized, but experimental evidence shows
increased production with further additions of IPTG. If the run extends beyond 60 h, an
equal amount of IPTG is added to the medium 60 h after initiation of the run. The IPTG
added sequentially is most likely not necessary.

A 65% w/v glucose solution is used as the feed—stock. Over the course of the
production phase, the addition of glucose feed solution increases the microbial synthesis

volume by approximately 25-35%.

188

Phloroglucinol Extraction for phloroglucinol biosynthesis

Dowex 1x8-100 resin in the phosphate form is rinsed with 1 bed volume of ethanol
(70%) for sterilization followed by 3 bed volumes of sterilized, deionized, distilled water.
The in situ resin based extraction is performed as an external fluidized bed extraction
cycle. The circulation flow is driven by a Manostat peristaltic pump (Cole-Parmer cat no
EW-78210-00) that is positioned downstream from the extraction column. Effluent from
the extraction column is then pumped directly back into the fermenter. 4 Bio-Rad econo
columns (2.5 x 20 cm) each packed with 80 mL of resin were individually used for a
single 12 h increment. Circulation of culture through the resin column is started 3 h after
induction with IPTG (typically at 15 h). The column is replaced at 24 h, 36 h, and 48 h. If
the microbial synthesis is run beyond 60 h, a new column is put in place at 60 h. The
typical flowrate is between 8-12 mL/min. Because most of the phloroglucinol is bound to
the resin, it is difficult to determine in real time when phloroglucinol production has
ceased. Historically, the amount of phloroglucinol produced after 60 h is minimal, and

microbial syntheses are generally stopped at this time.

189

 

Step

Parameters

Time

0‘)

Volume
(as V.)

 

Seed train

One transformed colony plated on minimal
media inoculates F1 culture tube containing 20
mL M9 seedtrain medium. 5% inoculum into F2
shake flask containing 20 mL M9 seedtrain
medium.

1% inoculation into F3 at 0.3-1.3 00

F1-16h
F2-6h

F1 - fixed 20 mL
F2 — fixed 20 mL
F3 - fermentor

 

Production
Phase
Fermentation

Initial batch of Production medium
Production medium without glucose
65% wlv glucose batching solution
trace inorganic nutrients stock solution
magnesium stock solution
10% inoculum
rocess feed tanks
antifoam
pH control (acid AND base)
65% w/v glucose feed stock solution
rocess Control
Temperature:
DO control:
- Agitation:
m/s)
- Air Flow: 0.06 - 1.0 vvm
- Backpressure 3 psi
0 pH control: 7.0
- conc. NH,OH (max rate 0.1%
Vi/min)
0 glucose feed (max rate 0.2 mL/min)
Glucose-minimal feed strategy
0 Glucose permitted: < 0.1 mM
0 Sampling every 12 h (OD,500 and titer)
ln-process titer determination
GC method; 4 h turnaround

"000000

13000

36e33 °C
20%
(max tip-speed 2.8

00

48h

1.00
0.85
0.05
0.001
0.002
0.1
0.45
<0.01
0.10
0.35

 

Final volume

1 .45

 

Continuous
Extraction

 

 

Dowex 1x8 100 mesh
Phosphate form
Fluidized bed

Extraction rate 8-12 mL/min

 

 

008x4

 

Seedtrain Medium for phloroglucinol bios ynthesis

The seed stage is grown using glucose in M9 salts supplemented with magnesium
sulfate and thiamine hydrochloride. Trace minerals are not added to the seed medium.
M9 salts medium is made up in de—ionized water and autoclaved separately. Magnesium
sulfate is prepared as a 1M solution and autoclaved separately. Glucose is prepared as a

50% solution and autoclaved separately. Thiamine hydrochloride is prepared as a l

190

 

mg/mL stock in water and sterilized by filtration through a .22 um membrane. The
separate solutions are combined immediumtely before inoculation to give a complete seed

medium with the following final concentrations in the seedtrain medium.

 

 

 

 

 

 

 

 

 

 

 

Concentration
Component

(g/L)
N32HPO4 6
KH21304 3
NaCl 0.5
MgSO4°7H20 0.24
Glucose 10
Thiamine HCI 0.001

 

 

 

 

Production Medium for phloroglucinol biosynthesis

The production microbial synthesis medium contains KZHPO4 ammonium iron

(Ill) citrate and citric acid monohydrate. Concentrated H2804 is added to the aqueous
solution and after the salts have been dissolved, the microbial synthesis medium is
adjusted to pH 7.0 by addition of concentrated NH4OH before autoclaving. Magnesium

sulfate is prepared as a 1M solution and autoclaved separately. Immediumtely prior to

inoculation it is added to give a final concentration of 0.24 g/L.

191

 

 

 

 

 

 

 

 

Component Concentration in
Initial Batch (g/L)

KZHPO4 7 .50
Citric Acid H20 2.10
Ammonium Iron (Ill) Citrate 0.30
Conc. H2804 1.20 mL
NH4OH qs. to pH 7.0
MgSO4-7H20 0.24

trace inorganic nutrients stock solution 1. mL

 

 

 

 

Trace Inorganic Nutrients Stock Solution for phloroglucinol bios ynthesis

The trace inorganic nutrients are prepared as a 1000x stock solution and sterilized
by filtration. This supplement is added to the production microbial synthesis medium
immediumtely prior to inoculation of the microbial synthesis to give final concentrations

of 0.1% of the stock concentrations.

 

 

 

 

 

 

 

 

 

Component Concentration in
Stock Solution (g/L)

H3303 24.7
MnC12,4H20 15.8
(NH4)6(M07024)°4H20 3 .7
ZnSO4-7H20 2.9
CuSO4°5H20 2.5

qs to 0.001 initial batch volume

 

 

I92

Glucose Solution for Initial Batching for phloroglucinol biosynthesis

Anhydrous glucose (25 g) is dissolved in water (50 mL), and the solution is
sterilized separately. The entire solution is added to the production medium prior to
initiation of the microbial synthesis to give an initial concentration of 25 g/L. The
supplement was added immediumtely prior to inoculation of the production microbial

synthesis.

 

 

Concentration in
Component
Stock Solution (g/L)
Glucose (anhyd.) 500

 

 

qs. To 0.05 initial batch volume

 

 

 

Glucose Feed Solution for phloroglucinol biosynthesis

A 65% w/v solution of glucose is prepared for feeding. To prepare a 65% solution
of glucose, 300 g of anhydrous glucose is added to 280 mL of deionized water. The

mixture is autoclaved separately and stirred continuously following sterilization.

 

 

Concentration in
Component
Feed Solution (gfL)
Glucose (anhyd.) 650.0

 

 

qs to 0.25-0.35 initial batch volume

 

 

 

193

Antifoam

A solution of antifoam 204 (Sigma-Aldrich) is present during the microbial
synthesis although foaming generally does not occur. Antifoam is added by manual
control if foaming is observed; a foam probe is not used. Excess antifoam has a

deleterious effect on the microbial synthesis.

Nutrient Addition during phloroglucinol biosynthesis

Nutrients are also consumed during the course of the microbial synthesis and
supplementation has shown to be beneficial. 1 mL of 1 M magnesium sulfate, 0.5 mL
trace mineral stock solution (outlined above), 0.15 g ammonium iron(III)citrate, 2.5 g
dibasic sodium phosphate and 2.0 g monobasic potassium phosphate are added to the
microbial synthesis medium through an external port outside of a sterile hood at 24 h and
12 h intervals thereafter.

In a two-stage microbial synthesis scheme nutrients were added to the auto-claved
glucose feed and were allowed to supplement the microbial synthesis medium continually
as glucose consumption occurred. (A modest 10% PG titer increase was observed). The
amounts of nutrients added externally at 24, 36, and 48 h were summed for 3 additions
(running a 60 h microbial synthesis); giving additive totals of 3 mL of l M magnesium
sulfate, 1.5 mL trace mineral stock solution, 0.45 g ammonium iron(III)citrate, 7.5 g
dibasic sodium phosphate and 6 g monobasic potassium phosphate that were dissolved in

the glucose feed.

194

Overall Phloroglucinol Process Schematic

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

:>[]11111111111111111111:1]~
t}

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

”11111111111lillliillilliiiillllll

 

 

   

Fiesin Preparation for phloroglucinol biosynthesis

1) Dowex 1x8 100 mesh (chloride form) (Sigma Aldrich) was exchanged to the
phosphate form. Following the manufacturers protocol, a total of 17 bed volumes (BV) of
1 M monobasic sodium phosphate passed through resin beds at 10-15 mL/min in a fixed

bed mode.

195

2) The resin bed was sterilized by l BV of 70% ethanol at 10-15 mL/min in a fixed bed

mode.

3) The resin bed was then washed with 3 BV of distilled, deionized, sterile water in a

fixed bed mode at 10-15 mL/min to prepare the resin for extraction.

4) Beginning 3 h after induction with IPT G, microbial synthesis medium was passed
through a single column of resin in a fluidized bed mode at a rate of 8-12 mL/min. Resin
columns were exchanged for fresh resin columns 24 h, 36 h, 48 h, and 60 h after initiation

of the microbial synthesis batch.

Downstream Processing Description for phloroglucinol biosynthesis

5) Phloroglucinol-containing resin was transferred from the columns and combined in an
Erlenmeyer flask. After brief agitation in 1 EV of water (4 °C), the resin was allowed to
settle and the cloudy liquid decanted. This process was repeated several times until the
water was no longer cloudy (typically 3-5 BV water total). Approximately 2-3% of
phloroglucinol is lost in this washing step. If water is at room temperature, phloroglucinol

loss increases to 15%.

6) Phloroglucinol-containing resin was transferred to a column and eluted in a fixed bed

mode with 5 BV of 0.1 M monobasic sodium phosphate initially at 95 °C. The elution

rate was 10 mL/min and the temperature at the conclusion of the elution was typically 65

196

°C. In this step, phloroglucinol was eluted from the resin and the resin was

simultaneously regenerated for the subsequent microbial synthesis.

7) The eluent was extracted with an equal volume of ethyl acetate. The extraction was
repeated two additional times and the organic layers were combined. Most of the intense

coloration remains in the aqueous layer while the phloroglucinol is in the organic layer.

8 i) Decolorization with 2 x 5% by weight Darco KB (100 mesh) wet powder activated

charcoal commenced in an Erlenmeyer flask. The mixture was stirred vigorously for 1 h.

8 ii) Vacuum filtration of charcoal was conducted in a Buchner funnel through a small

pad of celite. On average, 5—7% of the phloroglucinol is lost at this step.

9 i) Hexanes were added to the colorless ethyl acetate layer to precipitate the
phloroglucinol. The amount of hexanes added varies with concentration of phloroglucinol
in the ethyl acetate, up to an approximate ratio of 3:1 (hexaneszethyl acetate) to precipitate
the vast majority of phloroglucinol. To reduce the amount of hexanes added, the

phloroglucinol-containing ethyl acetate solution can be concentrated prior to precipitation.

9 ii) Phloroglucinol was collected by vacuum filtration in a Buchner funnel through

Whatman filter paper.

197

10) The white precipitate has been characterized by 1H NMR, 13C NMR, and GC. The
isolated material was the dihydrate of phloroglucinol and no impurities were detected.
Hydration was removed upon heating at 1 10 °C or at lower temperatures in vacuo to yield

phloroglucinol in > 90% from Step 4.

Multiple-stage Fed-batch Extractive Microbial synthesis

2a

 

I 2b
1-1

 

2c

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

_ ' 1b
I] 3a . .

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 78. Schematic diagram of a two-stage continuous extractive microbial
synthesis (1) feed tank; (2) peristaltic pump; (3) fermenters, [3a uninduced]; (4) resin
column; (5) broth collector.

In a two-stage, fed batch extractive microbial synthesis, the production vessel
(fermenter 3b) has the analogous characteristics as the single stage fed batch extractive
microbial synthesis. The feed vessel (fermenter 3a) contains the identical construct as the
production vessel without ever being induced with IPTG. The glucose addition feed (la)
for the feed vessel (3a) is diluted compared with the glucose addition feed (lb) for the
production vessel (3b). Preparation of the glucose feed preparations are identical except

that (1a) is at a 200 g/L concentration instead of 650 g/L as feed (1b). This dilution is

198

necessary for replenishing volume to the feed fermenter (3a) as it is drained into the
production vessel (3b). Flow from the feed tank (3b) started 12 h after induction of the
production tank (3a) at a rate of about 1-3 mL/min. Collection tank (5) is 5 L in volume
and is used to capture the overflow of the production vessel as the contents of the feed
vessel. The flow to the collector tank is orchestrated from the top of the vessel with a steel
tube at a maximum level and may be run without a pump. The distance between each
microbial synthesis vessel was kept at a minimum.

The five-stage, fed batch extractive microbial synthesis was analogous to the two-
stage swapping in new feed vessels (3a) that’s initial growth was staggered every 24 h.
Only three vessels were used, a production vessel and two feed vessels. As the first vessel
started feeding (12 h post-induction) the second feed vessel was inoculated and did not

start feeding the production vessel until 36 h post-induction, etc.

Analysis of microbial synthesis broth

Samples (10-20 mL) of microbial synthesis supernatant were removed at the
indicated timed intervals. Cell densities were determined by dilution of microbial

synthesis broth with water (1:100) followed by measurement of absorption at 600 nm
(OD600). Dry cell weight of E. coli cells (g/L) was calculated using a conversion
coefficient of 0.43 g/L/OD600. 20 mL of microbial synthesis broth was centrifuged to
obtain cell pellets for enzymatic assays and either used immediumtely whenever possible,

but flash frozen in liquid N2 when timing could not be accommodated.

199

Glucose concentrations in cell-free broth were measured using the Glucose
Diagnostic Kit purchased from Sigma. For the biosynthesis of phloroglucinol the
concentration was quantified by GC analysis. A portion of the microbial synthesis broth
(0.5-1.0 mL) was concentrated to dryness under reduced pressure. Derivatization of the
product mixture was initiated by dissolving the material in pyridine (1 mL) followed by
the addition of dodecane (0.001 mL) and bis(trimethylsily1)fluoroacetamide BSTFA (1
mL). A stock of the derivatization components is generally prepared and used promptly
within 3 h. Derivatization reactions are stirred at room temperature in darkness for a
minimum of 2 h. No change in yield was observed when reaction times were increased up
to 12 h. Yield was determined using response factors obtained when authentic
phloroglucinol (Fluka, catalog number 79330) derivitized using the same protocol.
Reaction samples were analyzed on an Agilent 6890N gas chromatograph equipped with
an HP—S phenyl methyl siloxane column (30 m length, 0.25 mm ID). The temperature
profile is as follows: hold at 120 °C for 3 minutes, ramp linearly to 210 °C over 6
minutes, hold at 210 °C for 5 minutes. Retention times: dodecane (3.74 min),

phloroglucinol (8.68 min).

Genetic manipulations

Recombinant DNA manipulations generally followed methods described by

Sambrook et al.6 Restriction enzymes were purchased from Invitrogen or New England
Biolabs. T4 DNA ligase was obtained from Invitrogen. Fast-LinkTM DNA Ligation Kit

was obtained from Epicentre. Zymoclean Gel DNA Recovery Kit and DNA Clean &

200

Concentrator Kit was obtained from Zymo Research Company. Maxi and Midi Plasmid
Purification Kits were obtained from Qiagen. Calf intestinal alkaline phosphatase was
obtained from Invitrogen. Agarose (electrophoresis grade) was obtained from Invitrogen.
SEVAG was a mixture of chloroform and isoamyl alcohol (24:1, v/v). TE buffer
contained 10 mM Tris-HCI (pH 8.0) and 1 mM NazEDTA (pH 8.0). TAE buffer
contained 40 mM Tris-acetate (pH 8.0) and 2 mM NazEDTA. Endostop solution (10x
concentration) contained 50% glycerol (v/v), 0.1 M NazEDTA pH 7.5, 1% sodium
dodecyl sulfate (SDS) (w/v), 0.1% bromophenol blue (w/v), and 0.1% xylene cyanole FF
(w/v) and was stored at 4 °C. Prior to use, 0.12 mL of DNase-free RNase was added to 1
mL of 10X Endostop solution. DNase-free RNase (10 mg mL'l) was prepared by
dissolving RNase in 10 mM Tris—HCI (pH 7.5) and 15 mM NaCl. DNase activity was
inactivated by heating the solution at 100 °C for 15 min. Aliquots were stored at -20 °C.

PCR amplifications were carried out as described by Sambrook et al.

Small scale purification of plasmid DNA

An overnight culture (10 mL) of the plasmid-containing strain was grown in LB
containing the appropriate antibiotics. Cells from 10 mL of the culture were collected in a
14 mL falcon tube by centrifugation. The resulting cell pellet was liquefied by vortexing

and then resuspended

201

Restriction enzyme digestion of DNA

Restriction enzyme digests were performed in buffers provided by Invitrogen or
New England Biolabs. A typical restriction enzyme digest contained 0.8 pg of DNA, 2
11L of restriction enzyme buffer (10x concentration), 1 pL of bovine serum albumin (0.1
mg/mL), 1 11L of restriction enzyme and 8 uL TE. Reactions were incubated at 37 °C for
1 h, terminated by addition of 2.2 11L of 10X Endostop solution and analyzed by agarose
gel electrophoresis. When DNA was required for cloning experiments, the digest was

terminated by addition of l uL of 0.5 M NazEDTA (pH 8.0) or by heating at 70 °C for 15

min followed by extraction of the DNA using Zymoclean gel DNA recovery kit.

Determination of DNA concentration

The concentration of DNA in the sample was determined as follows. An aliquot
(10 uL) of the DNA was diluted to 1 mL in TE and the absorbance at 260 nm was
measured relative to the absorbance of TE. The DNA concentration was calculated based

on the fact that the absorbance at 260 nm of 50 ug/mL of double stranded DNA is 1.0.

Small scale cell lysis

Lysis began with 10 ml of 10 OD600 culture. To calculate the volume of culture

needed, divide the OD of the culture into 100. For example, for a culture of 25 OD, 4 ml

of culture would be needed. The lysis buffer contains 50 mM Tris pH 8.0, 5 mM CHAPS

and 10 mM MgC12. Collect the cell pellet by centrifugation at 3220g for 10 min at 4 °C.

202

Decant the supernatant and resuspend the pellet in 5 mL lysis buffer. Add 2.5 mg of
lysozyme as a solution and 2 uL Benzonase (500,000 units; invitrogen) and vortex. The
sample should be allowed to freeze at ~80 °C for at least 1 h. Allow the sample to thaw
and save 1 mL for analysis before centrifugating for 5 min at 20,817g and 4 °C. Save the
lysate for analysis. Resuspend the lysate pellet in water and centrifugate for 5 min at
20,817g and 4 °C to wash. Remove water and resuspend in 1 mL 1% SDS and save for

analysis by protein SDS-PAGE.

Protein SDS-PAGE analysis

Protein SDS-PAGE analysis followed the procedure described by Harris.7
Preparation of a 10% separating gel started from mixing 3.33 mL of 30% (w/v) aqueous
acrylamide stock solution containing N, N’-methylene-bisacrylamide (0.8% (w/v)), 2.5
mL of 1.5 M Tris—HCI (pH 8.8), and 4 mL of distilled deionized water. After degassing
the solution using a water aspirator for 30 min, 0.1 mL of 10% (w/v) aqueous ammonium
persulfate solution, 0.1 mL 10% (w/v) aqueous SDS solution, and 0.005 mL of N, N, N’,
N’-tetramethylethylenediamine (T EMED) were added. The solution was mixed
thoroughly and poured into a 0.1 cm-width gel cassette to about 1.5 cm below the top of
the gel cassette. t-Amyl alcohol was overlaid on top of the solution and the gel was
allowed to polymerize for 1 h at rt. The stacking gel was prepared by mixing 1.7 mL 30%
acrylamide stock solution containing N,N’-methylene-bisacrylamide (0.8% (w/v)), 2.5 mL
Tris-HCI solution (0.5 M, pH 6.8), and 5.55 mL of distilled, deionized water. After
degassing for 30 min, 0.1 mL of 10% ammonium persulfate, 0.1 mL 10% SDS, and 0.01

mL of TEMED was added, and the solution was mixed thoroughly. t—Amyl alcohol was

203

removed from the top of the gel cassette, which was subsequently rinsed with water and
wiped dry. After insertion of the comb, the gel cassette was filled with stacking gel
solution, and the stacking gel was allowed to polymerize for 1 h at rt. After removal of
the comb, the gel cassette was installed into the electrophoresis apparatus. The electrode
chamber was then filled with electrophoresis buffer containing glycine (192 mM), Tris
base (25 mM), and 0.1% SDS (w/v). Following dilution with Laemmli sample buffer (10
pL, Sigma S—3401) consisting of 4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004%
bromophenol blue, and Tris-HCI (125 mM, pH 6.8), each protein sample (10 11L) was
heated at 100 °C for 10 min. Samples and markers (MW-SDS-200, Sigma) were then
loaded into the sample wells and the gel was run under constant current at 30 mA until the
blue tracking dye (bromophenol blue) reached the interface of stacking gel and separating
gel. The protein gel was then run at a higher current (50 mA). When the blue tracking
dye reached the bottom of the gel, electrophoresis was terminated. The protein gel was
subsequently removed from the cassette and submerged in 10% (w/v) aqueous
trichloroacetic acid solution with constant shaking for 30 min. The protein gel was then

transferred into a solution containing 0.1% (w/v) Comassie Brilliant Blue R, 45% (v/v)

MeOH, 10% (v/v) HOAc in H20 and stained with constant shaking for 4 h. Destaining of

the protein gel was carried out in a solution containing 45% (v/v) MeOH, 10% (v/v)

HOAc in H20 for 2-3 h. For long—term storage, SDS-PAGE gels were sealed in plastic

bags containing 10% glycerol.
Alternatively acrylamide gels were purchased from lnvitrogen with a 10—20%
Tricene gradient (cat. no. EC6625 or EC66255). A 5x stock resolving diluent was made

consisting of 5% SDS, 50% glycerol, 0.01% bromophenol blue, and Tris-HCI (250 mM,

204

pH 6.8). In the sample preparation of 100 11L, 20 uL of the 5x diluent was added to a

culture sample normalized to an of OD600 = 1 (use equation 100 uL/OD6OO of sample =

amount culture added), then diluted up to 100 uL. Prior to separation each sample was
heated at 90 °C for 10 min. The cathode buffer contained 0.1 M Trizma/0.1 M Tricine pH

8.25 with 0.1 % SDS while at the anode the buffer contained 0.2 M Tris(Cl-) pH 8.9.

Agarose gel electrophoresis

Agarose gel typically contained 0.7% agarose (w/v) in TAE buffer. Ethidium
bromide (0.5 rig/ml) was added to the agarose to allow visualization of DNA fragments
under a UV lamp. Agarose gel was run in the TAB buffer. The size of the DNA
fragments were determined using two sets of DNA molecular weight standards: Lambda
DNA digested with Hindlll (23.1-kb, 9.4-kb, 6.6-kb, 4.4-kb, 2.3-kb, 2.0-kb and 0.6-kb)
and Lambda DNA digested with EcoRI and Hindlll (21 .2-kb, 5.1-kb, 5.0-kb, 4.3-kb, 3.5-

kb, 2.0-kb, 1.9-kb, 1.6-kb, 1.4-kb, 0.9-kb, 0.8-kb and 0.6-kb).

Isolation of DNA from agarose

The band of agarose containing DNA of interest was excised from the gel while
visualized with long wavelength UV light. Two methods were used for isolating DNA
from agarose gels. The first method used Zymoclean gel DNA recovery kit to isolate

DNA from the agarose gel according to the procedure provided by Zymo Research.

205

Treatment of DNA with Klenow fragment

DNA fragments with recessed 3’ termini were modified to DNA fragments with blunt
ends by treatment with the Klenow fragment of E. coli DNA polymerase 1. After
restriction digestion (20 uL) of the DNA (0.8-2 pg) was complete, a solution (1 uL)
containing each of the four dNTPs was added to a final concentration of 1 mM for each
dNTP. Addition of 1-2 units of Klenow fragment was followed by incubation at room
temperature for 20-30 min. Since the Klenow fragment works well in the common
restriction enzyme buffers, there was generally no need to purify the DNA after restriction
digestion and prior to filling recessed 3’ termini. DNA was recovered using the
Zymoclean gel DNA recovery kit or by precipitation as described previously and

subsequently dissolved in TE.

Treatment of vector DNA with calf intestinal alkaline phosphatase

Following restriction enzyme digestion, plasmid vectors were dephosphorylated to
prevent self-ligation. Digested vector DNA was dissolved in TE (88 11L). To this sample
was added 10 11L of dephosphorylation buffer (10x concentration) and 2 [AL of calf
intestinal alkaline phosphatase (2 units). The reaction was incubated at 37 °C for 1-2 h.
The phosphatase was inactivated by heat treatment (70 °C, 15 min) and the DNA was

purified as previously described.

206

Ligation of DNA

Molar ratios of insert to vector were typically maintained at 2 to l for DNA
ligations with compatible ends, while for blunt-end ligations a ratio of 4 to 1 was used. A
typical reaction contained 0.1 pg of vector DNA and 0.05 to 2.0 p g of insert DNA in a
total volume of 7 pL. To this was added 2 yL of T4 ligation buffer (5x concentrations)
and 1 pL of T4 DNA ligase (2 units). The reaction was incubated at 16 °C for at least 4 h
and then used to transform competent cells. Alternatively, Fast-Link" DNA Ligation Kit
(Epicentre, Madison, WI) was used for ligation of insert DNA with cohesive or blunt ends
into predigested vectors with compatible ends according to the protocol provided by

Epicentre.

Preparation and transformation of competent E. coli cells

Competent cells were prepared according to a procedure modified from Sambrook
et a1. LB medium (5 mL) containing antibiotics where appropriate, was inoculated with a
single colony from a LB plate containing antibiotics where appropriate. The culture was
grown at 37 °C with shaking at 250 rpm for 10-12 h. An aliquot (1 mL) from the culture
(5 mL) was used to inoculate LB (100 mL) containing the appropriate antibiotics. The
culture was grown at 37 °C with shaking at 250 rpm in a NBS series 25 incubator shaker
until the optical density at 600 nm was between 0.4 and 0.6. The culture was transferred
to a centrifuge bottle that had been sterilized with a 25% (v/v) bleach solution and rinsed
four times with sterile, deionized water. The cells were harvested by centrifugation

(40003, 5 min, 4 °C) and the culture medium was decanted. All subsequent manipulations

207

were carried out on ice. The harvested cells were resuspended in ice-cold 0.9% NaCl (100

mL), and the cells were collected by centrifugation (4000 g, 5 min, 4 °C). The 0.9% NaCl

solution was decanted, the cells were resuspended in ice-cold 100 mM CaClz (50 mL) and

stored on ice for 30 min. After centrifugation (4000 g, 5 min, 4 °C), the cells were

resuspended in 4 mL of ice-cold 100 mM CaC12 containing 15% glycerol (v/v). Aliquots

(0.25 mL) of competent cells were added to 1.5 mL microfuge tubes, immediumtely
frozen in liquid nitrogen, and stored at -78 °C.

Frozen competent cells were thawed on ice for 5 min before transformation. A
small aliquot (l to 10 ,uL) of plasmid DNA or a ligation reaction was added to the thawed
competent cells (0.1 mL). The solution was gently mixed by tapping and stored on ice for
30 min. The cells were then heat shocked at 42 °C for 30 seconds and returned to ice
briefly (1 min). LB (0.5 mL, no antibiotics) was added to the cells, and the sample was
incubated at 37 °C (no agitation) for 1 h. Cells were collected by centrifugation (30 s) in a
microcentrifuge. If the transformation was to be plated onto LB plates, 0.5 mL of the
culture supernatant was removed, and the cells were resuspended in the remaining 0.1 mL
of LB and subsequently spread onto plates containing the appropriate antibiotics. If the
transformation was to be plated onto minimal medium plates, the cells were washed twice
with a solution of M9 inorganic salts (0.5 mL). After resuspension in a fresh aliquot of
M9 salts (0.1 mL), the cells were spread onto a plate. An aliquot of competent cells with
no DNA added was also carried through the transformation protocol as a control. These
cells were used to check the viability of the competent cells and to verify the absence of

growth on selective medium.

208

Transformations were also performed by electroporation using electrocompetent cells. An
aliquot (1 mL) from an overnight culture (5 mL) was used to inoculate 500 mL of 2xYT
containing the appropriate antibiotics. The cells were cultured at 37 °C with shaking at
250 rpm. Once an absorbance of 06-08 at 600 nm was observed, the cells were kept on
ice for 10 min and harvested (3 000g, 5 min, 4 °C). The cells were gently washed three
times with sterile, cold water (450 mL once and 250 mL twice) and then resuspended in
100 mL sterile, ice-cold aqueous 10% glycerol (v/v). After centrifugation (3000g, 5 min,
4 °C), the cells were resuspended in 1.5 mL sterile ice-cold aqueous 10% glycerol (v/v).
Aliquots (0.1 mL) of electrocompetent cells were dispensed into 1.5 mL microfuge tubes,
and immediumtely frozen in liquid nitrogen and stored at —78 °C.

The electroporation was performed in Bio-Rad Gene Pulser cuvettes with an
electrode gap of 0.2 cm. The cuvettes were chilled on ice for 5 min prior to use.
Electrocompetent cells were thawed in ice for 5 min, and 40 14L of thawed cells was added
to the chilled cuvette. To this was added 1-10 14L of plasmid DNA (1 pg mL"), and the
mixture was gently shaken. The Bio-Rad Gene Pulser was set at 2.5 kvolts, 25 FF and
200 Ohms. The outside surface of the cuvette was wiped clean and it was placed in the
sample chamber. A single pulse was applied, the cuvette was removed, and 1 mL of
freshly prepared SOC was added into it. The contents of the cuvette were transferred to a
15 mL sterile centrifugation tube. The cells were incubated at 37 °C for l h with shaking
at 250 rpm. The transformed cells were plated in the same manner as in the

transformation with chemically competent cells.

209

ADE3 L ysogeny

The }.DE3 lysogeny was performed according to the protocol provided by
Novagen. The ADE3 lysate (2.5 x 1010 pfu/mL), Helper phage lysate (3.6 x1010 pfu/mL),
and Selection phage lysate (5.6 x 1010 pfu/mL) were stored at -78 °C and thawed on ice
immediumtely before use. A colony of the strain to be lysogenized was inoculated into 5

mL of LB containing the appropriate antibiotics, 0.2% maltose and 10 mM MgSO4. The

maltose stock solution was sterilized by passage through 0.22—um membranes and the
MgSO4 solution was separately autoclaved. The culture was grown at 37 °C with
agitation until the OD600 reached 0.5. Various amounts (1, 3, 5, 7, 10 uL) of the culture
were transferred to individual microfuge tubes. kDE3 lysate (4 uL), Helper phage lysate
(2.78 11L), and Selection phage lysate (1.79 11L) were added to each tube and mixed gently.
The host/phage mixture was incubated at 37 °C for 20 min. The mixture was plated onto
LB plates with appropriate antibiotics and incubated overnight at 37 °C. Several of the
resulting colonies were selected, transformed with a plasmid containing an assayable gene
under a T7 promoter, and the specific activity of the enzyme expressed from the T7
promoter was measured. The host strain providing the highest specific activity was

chosen and named as the (DE3) strain.

210

Wanner type gene inactivation technique

PCR step

Design primers for PCR amplification of an antibiotic (kanamycin PKD4 or
chloraphenicol PKD3) gene flanked by two FRT (Elipase Recognition Iarget) sequences.
Designed primer has 40 nt homologous sequence (H1) to the genetic region to be deleted
and 20 nt homologous sequence (P1) to the priming site that is located just before FRT
sequence (Figure 79). To reduce background colonies on rich selection plates the PCR
product should be digested with Dpnl and purified by gel electrophoresis. Dpnl digests
only methylated DNA which is not a modification in PCR amplified DNA therefore only
template DNA will be digested and will minimize false positive clones from

transformation of template pKD3 or 4.

211

PCR amplify FRT-flanked resistance gene
FRT FRT

P1 F1 Antibiotic resistance F

" P2 ‘3

 

 

 

 

 

 

Transform strain expressing A Red recombinase

GeneA w. GeneB flg GeneC
1 1 1 1

 

Select antibiotic-resistant transformants

FRT .. . . FRT
Gene A "1 Antlblotlc reelstance Gene C

 

 

 

 

 

 

Eliminate resistance cassette using FLP expression plasmid

FRT
Gene A 7 Gene C

1 Ex?“ ' .4592! ]

 

 

 

 

.1

Figure 79. Gene knock-out strategy.

Host preparation step

Transform any E. coli host (K-12 derived strains are much easier to work with and
although B-type E. coli have had minimal success, the deletion can be made in a K-12
strain and Pl-phage transduced into a B-type strain) with pKD46 on LB/Ap plates.
Incubate at 37 °C overnight. Plasmid pKD46 encodes A Red (y, [3, exo) recombinase
under the arabinose promoter. Inoculate a single colony of E. coli/pKD46 in 10 mL of
2xYT/Ap. Grow the culture at 30 °C (not 37 °C) for approximately 5-6 h (slightly turbid

culture). Add 100 pL of l M arabinose solution (10 mM final concentration) and grow it

for additional 1 h. The final OD600 of the culture should be approximately 06-07. The

212

arabinose solution can be introduced before turbidity is observed, but the growth curve is
slowed by 2-3 h. Harvest the culture by centrifugation at 1,900g at 4 °C for 5 min. Re-
suspend cell pellet in 1 mL of sterile ice—chilled water. Centrifuge at 1,500g at 4 °C for 2
min. Repeat this wash step three times. (Total 4 washes). Resuspend cell pellet in 80 uL

of sterile, ice-chilled water or 10% glycerol.

Gene knock-out

Transform freshly prepared E. coli/pKD46 with the PCR amplified FRT flanked
antibiotic resistance cassette product by electroporation. Mix 40 ML competent E.
coli/pKD46 with 400-1000 ng of PCR product (no more than 10 [LL volume),
electroporate using standard E. coli protocol, add 1 mL of SOC and cure for l h in 37 °C.
Plate 0.5 mL on LB/antibiotic (Cm or Kan) plate to incubate overnight at 37 °C while
incubating the other half of the culture overnight at rt and plating if colonies are not

observed.

Verification of the mutant

Verify gene knock out by replicating on selective plates. Colonies should be
sensitive for Ap (indicates loss of pKD46 plasmid) but should grow on Cm or Kan plate
(depending which marker was used) keeping in mind that the deleted gene may be needed
for survival. Once the desired phenotype is observed verify the gene interruption by using
PCR to amplify regions outside the targeted deletion site and look for shifts in the

corresponding band sizes. Design primers, which are outside of knock-out region and run

213

PCR using genomic DNA from mutants alongside the host as a control. Mutant
possessing the FTR-antibiotic-FRT insert in the desired gene will have different size PCR

product than the control.

P1 phage mediumted transduction

P1 phage transduction was used to transfer a gene deletion from a donor E. coli
strain to a recipient strain. P1 phage lysate was prepared by propagation of phage in the
donor strain to generate the P1 phage library used to infect recipient strain. The recipient
strain was plated on LB/kan plates after phage infection and incubated at 37 °C overnight.
The recipient strain was verified by growth phenotype and PCR amplification of genomic
DNA as described above. Use of P1 phage transduction was the preferred way to

inactivate E. coli B strains.

Recombination and excision of antibiotic resistance

In some instances leaving in the resistance gene can have hindered effects on
growth and subsequent molecular production and is usually common practice to relieve
the targeted gene deficient host of the antibiotic marker. A properly verified mutant was
transformed with pCP20, carrying the flipase gene. Electroporation was performed using
standard E. coli protocol. The curing step was performed at 30 °C (not at 37 °C).
Transformation of the mixture was plated on LB/Ap plates and incubated overnight at 30
°C (not 37 °C). Plasmid pCP20 has temperature sensitive replicon, therefore it cannot

replicate at 37 or 43 °C. Several colonies from overnight plates were inoculated in liquid

214

LB or 2xYT culture medium and grown at 43 °C. Cells were streaked on LB plates and
grown up at 37 °C to obtain single colonies. Single colonies from LB plate were used to
verify deletion by selective plates and PCR amplification of flanking genomic DNA as

described above.

Transcriptome analysis

RNA isolation

Total RNA was isolated through extraction with hot phenol to remove protein and
used to prepare cDNA as described. E. coli cell pellets were resuspended in 1 mL of TE
and rapidly transferred to a 17 x 100 mm sterilized test tube containing 4 mL of hot lysis
buffer (1% sodium dodecyl sulfate, 30 mM sodium acetate, 3 mM EDTA, pH 5.0) in a
boiling water bath. The tubes were held for 5 min with intermittent mixing. Cell lysates
were extracted with 3 mL acidic phenol (warmed to 65 °C) with vigorous intermittent
mixing for 3 min. The sample was centrifuged (12000g, 4 °C) for 10 min. The aqueous
layer was extracted a second time with 3 mL acidic phenol (warmed to 65 °C) followed by
extraction with equal volumes (1.5 mL) of phenol and SEVAG (chloroformzisoamyl
alcohol, 24:1, v/v) at room temperature. After the final extraction with 3 mL of SEVAG at
room temperature, the aqueous layer was transferred to a fresh tube. One-tenth volume of
3 M sodium acetate (pH 5.2, ice cold) was added to the aqueous phase followed by 2.5

volumes of 100% ethanol (-20 °C). The sample was kept at —20 °C for at least 2 h.

215

Total RNA was pelleted by centrifugation (12 000g, 4 °C) for 20 min, washed
carefully by addition of 70% ethanol (ice cold), and then pelleted again by centrifugation
(12 000g, 4 °C) for 20 min. The RNA pellet was washed again by addition of 70%
ethanol (ice cold) followed by centrifugation (12 000g, 4 °C) for 20 min. The RNA pellet
at the bottom of the tube was marked outside the tube with a pen and then dried at room
temperature under air for 2-3 h. When the RNA pellet appeared clear or translucent, RNA
was dissolved in 80 pL of sterile RNase-free water. Contaminating DNA was removed
from RNA by hydrolysis with DNaseI. RNA solution (80 pL), 10 pL DNaseI reaction
buffer (10x, Ambion), DNasel (8 pL, Ambion, 200 U) and RNase inhibitor (2 pL, 80 U)
were incubated at room temperature for 25 min. After the reaction, a Qiagen RNeasy
Mini Kit was used to purify the RNA according to the procedure provided by the
manufacturer. The purified RNA sample (approximately 30 pL) was quantified by
measuring the absorbance at 260 nm (usually 5 pL of RNA in 795 pL water). The RNA
concentration was calculated based on the fact that the absorbance at 260 nm of a 40 pg
mL" of RNA is 1.0. The integrity of the RNA and the amount of genomic DNA

contamination was checked with a RNAPico Labchip on an Agilent Bioanalyzer 2100.

cDNA synthesis

10 pg of total RNA was mixed with 10 pL of random primers (lnvitrogen), 2 pL of
diluted poly-A RNA controls and appropriate amount of water to 30 pL. The RNA/Primer
mixture was incubated on a PCR apparatus at 70 °C for 10 min followed by 25 °C for 10
min. The reaction mixture was briefly centrifuged and added to the cDNA synthesis mix.

The 30 pL cDNA synthesis mix contains 12 pL 5x1"l strand buffer, 6 pL 100 mM DTT, 3

216

pL 10 mM dNTPs, 1.5 pL SUPERase°In and 7.5 pL SuperScript II. The mixture was
incubated at 25 °C for 10 min, followed by 37 °C for 60 min, and finally 42 °C for 60 min,
then the SuperScript II was inactivated by heating at 70 °C for 10 min. The RNA template
was removed by adding 20 pL 1 N NaOH and incubated at 65 °C for 10 min. The
solution was then neutralized with 20 pL 1 N HCI. The synthesized cDNA was purified
using MiniElute PCR purification columns following the manufacturer’s protocol. The
cDNA was quantified by measuring the absorbance at 260 nm (usually 1-2 pL of cDNA in
795 pL water). The RNA concentration was calculated based on the fact that the

absorbance at 260 nm of a 33 pg mL" of single-stranded DNA is 1.0.

cDNA fragmentation

The cDNA purified from the previous step (10 pL) was mixed with 2 pL 10 One-
Phor-All buffer, about 3 pL DNase I (Ambion) and appropriate Nuclease-free water to 20
pL. The dosage (unit of DNase I per pg of cDNA) of DNase I to be used is critical for
obtaining DNA fragments with suitable size. A titration assay is carried out prior to
determine the suitable dosage. DNase I from Ambion was determined to be 0.35 U per pg
cDNA. The reaction mixture was incubated at 37 °C for 10 min, the DNase I was
inactivated by incubating at 98 °C for 10 min, and the fragmented cDNA was directly

applied to the terminal labeling reagents.

217

Terminal labeling, hybridization and data analysis

The fragmented cDNA was labeled with Genechip labeling reagents (Affymetrix)
in a 60 pL solution containing 10 pL cDNA fragmentation products, 10 pL 5x reaction
buffer, and 2 pL terminal deoxynucleotidyl transferase. The solution was incubated at 37
°C for 60 min. The reaction was stopped by addition of 2 pL 0.5 M EDTA. A gel shift
assay was performed to estimate the efficiency of labeling. Hybridization was performed
in the Genomic Technology Support Facility at Michigan State University. Data analysis
was performed with Arrayassist software (Stratagene). Gene annotations were retrieved

from NetAffx analysis center (Affymetrix), Ecocyc and ERGO servers.

218

Transcriptome supplemental

 

Genes upregulated in producing transcriptome analysis fix) W3110serA(DE3)IpJA3.131A

 

ach bioAD moaBC wecB yegN

ach cchB mopAB xerC yfaE

apaH celF nagABC yabN yle
argABCDFGHI clpB nrdABCDEFGHl yacH yfiA
aroH cspl nth yaeC yng
artJMPQ cysACDHIJMNW plsB yagDL ych
aan dnaJK ppx ybbN ygiAC
b0830, b0832,b0833 elaD pku ych yth
b1436 eno rfaC ybeFZ yibG

D1498, b1499, b1500,

b1501, b1502, 131503, b1504 eng ”3" ybgDH “93
b1551 fimE rffGH ythS yjcV

b1632 glnD rygAB ybiJM yij
b2074 gItB selB ych ythC

b2085 hisP sgcQ ycel yjiD
b2385 Hpr sodA ycfS yij
b2460 hthX spy yciW ykgH
b2758 iprB sseB ychX ymeE
b3400, b3401 manXYZ trpA ydeH yqelJ
b3913,b3914 mch udhA yde thD
betA metJK uvrC yeaD yqul

bglA micF uqu yebE yerl

 

Table 14. Phloroglucinol producing transcriptome analysis: Upregulated at least 4x.

(Bold indicates an 8x upregulation)

219

 

Genes up-regulated in fermentative analysis (2-4x) W311 OserA(DE3)IpJA3.131A

 

acrA b3112 murF ythL
adhE b3553 nan ybjC
alpA b3706 nfo ych
amn b3835 nlpA yceF
ampG b3839,b3940 ong ycfHQ
apaG b4085 ompC ych
argE baeS parE ydbL
asmA bcr ppr ychEH
ath caiD pdxA ydiD
b0476 cchA pkaB yecE
b0631 crcA pflA yecP
b0655 cutA pgsA yehA
b0829 cbeC prlC yeiG
b0831 degQ prmA yfbM
b0834 dsz ptsGN ych
b0836 elaC recR yffB
b0851 eutG rfaDFS ych
b0936 fabB rho yij
b1057 fdx rhsB ych
b1 134 fimZ rpe ygeF
b1 163 fpr rpoN YQQVW
b1451 fumC sapABDF ygiB
b1459 galEKT sbcC yhaK
b1520 gapA selA yhbHW
b1541 garD sgcAER ythR
131583 gidB speG yheTU
b1601 glk spoT yth
b1630,b1631 gloB sufS yhhH
b1679 gltFL talB yhiJS
b1683,b1684 egS tch yibAJ
b1706 gor tdh yicM
b1730 gph tdk yidA
b1768 gyrB thiL yieEFO
b1843 hemL tpx yigAFG
b1936 hflK trkA yiiX
b2254 hscA trpBRS yjePS
b2324 imp trxA YJQDGL
b2351 intF tus yojN
b2363 iscR wecCD yqu
b2438,b2439 kde wzzE yquG
b2461 kefB yacFG yrfE
b2504 ksgA yadCT yth
b2680 lipB yaeB

b2760 Int yagN

b2858 Ion yaiW

b2925 mch ybaBNP

b3012 metJL ybcL

b3050,b3051 man ybeXY

 

Table 15 . Phloroglucinol producing transcriptome analysis: Upregulated 2-4x.

220

 

Genes down-regulated in fermentative analysis (2-4x) W3110serA(DE3)IpJA3.131A

 

ach b2740 hisL ryfA yeiHL
adk b2832 hmpA rng yfaL
afuC b3322 hokC secDF ych
amiA b3325 hrpB serB yde
amtB b3335 hybE smf yfeN
aqu b3419,b3420 ilvG smpA ythK
aroF b3470 intD speD yfiF
ascB b3475 kdgKT sraB yij
aslB D3996 kgtP sulA ygaE
b0070 b4003 lexA tehA ych
b0123 bfr malK tesB yngL
b0189 bglF melA tolABQR yggH
b0263 bioH mglC tonB ygiEP
b0441 blr mlc torDRT yng
b0484 celA mltE tyrA yhaJ
b0505,b0506 chpAB mrr ucpA yth
b0539 cmk msbA uhpA yhdAG
b0847 cobSU mukF wzzB ythOR
b0964 cch nadA xapR yi91b
b1339 cutC napBDF xylE yidI
b1447 cyoA narQX yaeJ yigN
b1483 dpr nhaA yafKNP yihVW
b1485 dcuC nipC yagF yiiR
b1509 dgkA nrfF yaiU yijP
b1522 dicC nqu yajC ych
b1533 dinB oraA ybaQZ yjeAM
b1543 dnaAB pan ybcR ngAPQ
b156S dsbB pde ybeBH ythER
131582 entD perM ybe yjiK
b1625,b1626,b1627 ebeD prC yth yka
b1627 fadR phnA ybiA ymjA
b1663 fth phrB ybjFM ynel-l
b1741 fan pnuC ychOWY yohDLM
b1758,b1759,b1760 fdoHI potAEI yceGLP yphAEF
b1810 fecB priC ychLP ngA
b1822 fepA proY ycg LR zipA
b1998 fhuE pssAR ychEM

b2070 fimC rdIC yciLS

b2191 flgN reIE ydaL

b2340 frdAD rfaH ydbAC

b2343 fruR rhlE ych

b2354 ftsY ribBF ydgC

b2538 gch rpiBSY yth

b2608 glpEG rpmA yecF

b2638 gntT rpoES yedI

b2639 gme rpsI yeeP

b2640 gsk rtT yegD

b2710 hemF ruvAB yehZ

 

Table 16. Phloroglucinol producing transcriptome analysis: Downregulated 2-4x.

221

 

Genes down-regulated in fermentative analysis (4x) W31103erA(DE3)/pJA3.131A

 

araE fis ter yjaA
aroG flgM umuCD yjcB
b0174 hokDE yaeL yme
b0627 hupB yagEU yohI
b1016, b1017 hybAB yahA

b1146 15102 yaiB

b1445 motA ybeM

b1657 narP ybgC

b1722 ndk ybiN

b1728 ppsA ybjO

b1748 psiF ycaD

b1858, b1859 purR ychGZ

b2997 putP yciA

b3020, b3021, b3022 per yeaS

b3776 rem yebFGK

cdsA rph yeeW

cspBFGH rpsT yegQ

dinG sfa yth

fdnH smtA YQJN

fhuB tkel ythZ

 

Table 17. Phloroglucinol producing transcriptome analysis: Downregulated at least

4x.

222

 

Genes Uj-rejgulated in producing transcriptome Analysis (4x) W3110serA(DE3)IpJA3.131A

Genes encoding transport or
membrane proteins

Description

 

artQ arginine 3rd transport system permease protein

hth Zn metalloprotease participates in proteolytic quality control of
membrane proteins

yjcV putative transport system permease protein

ybgH (glnT) Glutamine transporter

ach RND multidrug efflux pump (typical substrate: aminoglycosides)

yth putative transport protein involved in sialic acid metabolism

hisP ATP-binding component of histidine transport

yacH putative membrane protein

yabN putative transport protein activates SgrS leads to ptsG mRNA
degradation which leads to decreased production of glucose transport
machinery

YggN (mdtB) RND multidrug transporter

 

Table 18. Membrane or transport transcriptome gene list: Upregulated at least 4x.

223

 

Genes Up-regulated in producing transcriptome Analysis (2-4x) W311OSerA(DE3)IpJA3.131A

 

Genes encoding transport or Description
membrane proteins

acrA

acridine efflux pump

ath membrane-bound ATP synthase, F1 sector, gamma-subunit
b0655 putative periplasmic binding transport protein
b0829 putative ATP-binding component of a transport system
b0831 putative transport system permease protein
b1451 putative outer membrane receptor for iron transport
b1601 putative transport protein
b1630 electron transport complex protein
b3051 putative membrane protein
bcr bicyclomycin resistance protein; transmembrane protein
cydC ATP-binding component of cytochrome-related transport
gltL ATP-binding protein of glutamateaspartate transport system
kde ATPase of high-affinity potassium transport system, B chain
kefB K+ efflux; NEM-activable K+H+ antiporter
Int apolipoprotein N-acyltransferase, copper homeostasis protein,
inner membrane
ompC outer membrane protein 1b
sapA homolog of Salmonella peptide transport periplasmic protein
sapB homolog of Salmonella peptide transport permease protein
sapD putative ATP-binding protein of peptide transport system
sapF putative ATP-binding protein of peptide transport system
trkA transport of potassium
wzzE putative transport protein
ybeX putative transport protein
yth putative outer membrane protein
yicM putative transport protein
yieO putative transport protein (MFS family)
yttL putative transport protein

 

Table 19. Membrane or transport transcriptome gene list: Upregulated 2-4x.

224

 

Genes Down-regulated In producm transcriptome Analysis (4x) W31103erA(DE3)/pJA3.131A

Genes encoding transport or
membrane proteins

Description

 

fhuB hydroxamate-dependent iron uptake, cytoplasmic membrane component
hokE small toxic membrane polypeptide

ycaD putative transport

hokD polypeptide destructive to membrane potential
D1657 putative transport protein
D1858 putative ATP-binding component of a transport system _

ter tyrosine-specific transport system

araE low-affinity L-arabinose transport system proton symport protein
b3020 putative transport periplasmic protein

 

Table 20. Membrane or transport transcriptome gene list: Downregulated at least

4x.

225

 

Genes Down-regulated in producing transcriptome Analysis (24x) W3110serA(DE3)/pJA3.131A

 

Known genes encoding

ri 1
transport or membrane proteins DBSC pt on

 

atuC putative ATP-binding component of a transport system
amtB probable ammonium transporter
aqu transmembrane water channel; aquaporin Z
b0070 putative transport protein
b0263 putative transport system permease protein
b0847 putative transport protein
b1483 putative ATP-binding component of a transport system
b1485 putative transport protein
D1509 putative ATP-binding component of a transport system and adhesin protein
b1533 amino acid metabolite efflux pump
b1543 putative transport protein
b1663 multidrug resistance protein norM (Na(+)drug antiporter) (Multidrug-eitlux transporter)
b2740 putative transport protein
b2832 putative transport protein
dcuC transport of dicarboxylates
fecB citrate-dependent iron transport, periplasmic protein
fepA outer membrane receptor for ferric enterobactin (enterochelin) and colicins B and D
fhuE outer membrane receptor for ferric iron uptake
frdD iumarate reductase, anaerobic, membrane anchor polypeptide
ttsY cell division membrane protein
gntT higheaitinity transport of gluconate gluconate permease
hokC small toxic membrane polypeptide
kdgT 2-keto-3deoxy-D-gIuconate transport system
malK ATP-binding component of transport system for maltose
mglC methyl-galactoside transport and galactose taxis
msbA ATP-binding transport protein; multicopy suppressor of htrB
pnuC required for NMN transport
potA ATP-binding component of spermidineputrescine transport
potE putrescine transport protein
potl putrescine transport protein; permease
proY proline permease transport protein
secD protein secretion; membrane protein, part of the channel
secF protein secretion, membrane protein
smpA small membrane protein A
tolA membrane spanning protein, required for outer membrane integrity
tol Q inner membrane protein, membrane-spanning, maintains integrity of cell envelope;
tolerance to group A colicins
toIR putative inner membrane protein, involved in the tonB-independent uptake of group A
colicins
ychM putative sulfate transporter
yehZ putative transport system permease protein
ytaL putative ATP-binding component of a transport system
ych putative transport protein
yjeM putative transport protein
yphE putative ATP-binding component of a transport system
ngA putative transport protein

 

Table 21. Membrane or transport transcriptome gene list: Downregulated 2-4x.

226

 

Genes Down-regulated In Fermentatlve Transcriptome Analysis (4x)

araE
aroG

b0174
b0627
D1016
D1017
D1146
D1445
D1657
D1722
D1728
D1748
D1858
D1859
D2997
D3020
D3021
b3022
b3776
cdsA
cspB
cspF
cspG
cspH
duKB
fdnH
fhuB
fis

flgNl
hokD
hokE
hupB
hyDA
hbe
18102
motA
narP
ndk

W31 10serA(DE3)/pJA3.131A
Description
low-affinity L-arabinose transport system proton symport protein
3-deoxy—D-arabinoheptuIosonate-7-phosphate synthase (DAHP synthetase,
phenylalanine repressible)
hypothetical protein
hypothetical protein
hypothetical protein
high-affinity iron permease
hypothetical protein
hypothetical protein
putative transport protein
hypothetical protein
hypothetical protein
acetylornithine delta-aminotransferase
putative ATP-binding component of a transport system
hypothetical protein
putative hydrogenase subunit
putative transport periplasmic protein
hypothetical protein
hypothetical protein
hypothetical protein
CDP-diglyceride synthetase

homolog of Salmonella cold shock protein

cold shock-like protein

ATP-dependent heiicase

formate dehydrogenase-N, nitrate-inducible, iron-sulfur beta subunit
hydroxamate-dependent iron uptake, cytoplasmic membrane component
site-specific DNA inversion stimulation factor; DNA-binding protein; a trans activator
for transcription

anti-FIiA (anti-sigma) factor; also known as Rle protein

polypeptide destructive to membrane potential

small toxic membrane polypeptide

DNA-binding protein HU-Deta, N81 (HU-1)

hydrogenase-2 small subunit

probable cytochrome NiFe component of hydrogenase-2

proton conductor component of motor; no effect on switching
nitratenitrite response regulator (sensor NarQ)
nucleoside diphosphate kinase

Table 22. Total transcriptome gene list: Downregulated at least 4x.

227

Table 22. continued
ppsA phosphoenolpyruvate synthase
psiF induced by phosphate starvation
purR transcriptional repressor for pur regulon, glyA, glnB, prsA, speA
putP major sodiumproline symporter
per pyrBl operon leader peptide
rem hypothetical protein
rph RNase PH
rpsT ribosomal subunit protein S20
sfa suppresses fabA and is growth mutation
smtA S-adenosylmethionine-dependent methyltransferase
tke1
ter tyrosine-specific transport system
umuC SOS mutagenesis and repair
umuD SOS mutagenesis; error-prone repair; processed to UmuD; complex with UmuC
yaeL hypothetical protein
yagE putative lyasesynthase
yagU hypothetical protein
yahA hypothetical protein
yaiB hypothetical protein
ybeM putative amidase
ybgC hypothetical protein
yDiN hypothetical protein
yDjO hypothetical protein
ycaD putative transport
chC hypothetical protein
ych putative dehydrogenase
ych hypothetical protein
yciA hypothetical protein
yeaS hypothetical protein
yebF hypothetical protein
yeDG hypothetical protein
yebK hypothetical protein
yeeW hypothetical protein
yegQ hypothetical protein
yth hypothetical protein
yng hypothetical protein
thE hypothetical protein
th2 putative GTP-binding factor
yjaA hypothetical protein
yjcB hypothetical protein
yme hypothetical protein
johl putative regulator protein

 

228

 

ach
adk
atu(3
annA
amtB
aqu
aroF
ascB
asHB
D0070
D0123
D0189
D0263
D0441
D0484
D0505
D0506
D0539
D0847
D0964
D1339
D1447
D1483
D1485
D1509
D1522
D1533
D1543
D1565
D1582
D1625
D1626
D1627
D1663
D1741
D1758
D1759
D1760
D1810
D1822
D1998
D2070
D2191
D2340

Genes Down-regulated in fermentative transcriptome Analysis (2-4x)

W3110serA(DE3)/pJA3.131A
Descrfigtion
acetleoA carboxylase, carboxytransferase component, beta subunit
adenylate kinase activity; pleiotropic effects on glycerol-3-phosphate acyltransferase activity
putative ATP-binding component of a transport system
N-acetylmuramoyl-l-alanine amidase I
probable ammonium transporter
transmembrane water channel; aquaporin Z
3-deoxy-D-arabinoheptulosonate-7-phosphate synthase (DAHP synthetase, tyrosine repressibl
6-phospho-Deta-glucosidase; cryptic
putative arylsulfatase regulator
putative transport protein
hypothetical protein
hypothetical protein
putative transport system permease protein
putative protease maturation protein
putative ATPase
hypothetical protein
putative regulator
putative exonuclease
putative transport protein
hypothetical protein
putative transcriptional regulator LYSFi-type
hypothetical protein
putative ATP-binding component of a transport system
putative transport protein
putative ATP-binding component of a transport system and adhesin protein
hypothetical protein
amino acid metabolite efflux pump
putative transport protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
multidrug resistance protein norM (Na(+)drug antiporter) (Multidrug-efflux transporter)
putative excinuclease subunit
putative cytochrome oxidase
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
putative chaperonin
hypothetical protein
hypothetical protein

Table 23. Total transcriptome gene list: Downregulated 2-4x.

229

Table 23.

D2343
D2354
D2538
D2608
D2638
D2639
D2640
D2710
D2740
b2832
D3322
D3325
D3335
D3419
D3420
D3470
D3475
D3996
D4003
Dh
DgFi
Dkni
bk
ceU\
chpA
chpB
cnm
coDS
coDU
cch
cutC
cyoA
dpr
dcuC
dgkA
(ficC
rflnB
dnaA
dnaB
dsbB
entD
ebe
ebe
fadR

confinued

hypothetical protein

hypothetical protein

large terminal subunit of phenylpropionate dioxygenase

hypothetical protein

hypothetical protein

putative pump protein

hypothetical protein

putative ilavodoxin

putative transport protein

putative transport protein

calcium-binding protein required for initiation of chromosome replication
YheF

leaderpepfidase

RNA phosphage cyclase

RNA 3-terminal phosphate cyclase

hypothetical protein

hypothetical protein

NADH pyrophosphatase

Hde

Dacterioferrin, an iron storage homoprotein

PTS system beta-glucosides, enzyme 11, cryptic

biotin biosynthesis; reaction prior to pimeloyl CoA

beta-lactam resistance protein

PEP-dependent phosphotransferase enzyme IV for cellobiose, arDutin, and salicin
probable growth inhibitor, PemK-Iike, autoregulated

probable growth inhibitor, PemK-like, autoregulated

cytidylate kinase

cobalamin 5-phosphate synthase

cobinamide kinasecobinamide phosphate guanylyltransferase
hypothetical protein

copper homeostasis protein

cytochrome b ubiquinol oxidase subunit II

ATP-dependent RNA helicase

transport of dicarboxylates

diacylglycerol kinase

regulator of dicB

DNA polymerase IV -1- DNA polymerase IV, devoid of proofreading, damage-inducible protein P
DNA biosynthesis; initiation of chromosome replication; can be transcription regulator
replicative DNA heiicase; part of primosome

reoxidizes DsbA protein following formation of disulfide bond in P-ring of flagella.
enterochelin synthetase, component 0

uptake of enterochelin; tonB-dependent uptake of B colicins

uptake of enterochelin; tonB-dependent uptake of B colicins

negative regulator for fad regulon, and positive activator of faDA

230

Table 23.

fth
fdnl
fdoH
tdol
fecB
fepA
fhuE
fimC
flgN
frdA
frdD
fruR
ttsY
gch
glpE
glpG
gntT
gme
gsk
hemF
hisL
hmpA
hokC
hrpB
hybE
ilvG
intD
kdgK
kdgT
kgtP
lexA
malK
melA
mglC
mlc
mltE
mrr
msbA
mukF
nadA
napB
napD
napF
narQ

confinued

selenopolypeptide subunit of formate dehydrogenase H
formate dehydrogenase-N, nitrate-inducible, cytochrome 8556(Fdn) gamma subunit
formate dehydrogenase-O. iron-sulfur subunit

formate dehydrogenase, cytochrome 8556 (FDO) subunit
citrate-dependent iron transport, periplasmic protein

outer membrane receptor for ferric enterobactin (enterochelin) and colicins B and D
outer membrane receptor for ferric iron uptake

periplasmic chaperone, required for type 1 fimbriae

protein of flagellar biosynthesis

iumarate reductase, anaerobic, flavoprotein subunit

iumarate reductase, anaerobic, membrane anchor polypeptide
transcriptional repressor of fru operon and others

cell division membrane protein

hypothetical protein

rhodanese (thiosulfatezcyanide sulfertransferase)

protein of glp regulon

high-affinity transport of gluconate gluconate permease
phosphoglyceromutase 2

inosine-guanosine kinase

coproporphyrinogen Ill oxidase

his operon leader peptide

dihydropteridine reductase, ferrisiderophore reductase activity
small toxic membrane polypeptide

heiicase, ATP-dependent

hypothetical protein

acetolactate synthase ll, large subunit, cryptic, interrupted
prophage DLP12 integrase

ketodeoxygluconokinase

2-keto-3-deoxy-D-gluconate transport system
alpha-ketoglutarate permease

regulator for SOS(lexA) regulon

ATP-binding component of transport system for maltose
alpha-galactosidase

methyl-galactoside transport and galactose taxis

putative NAGC-like transcriptional regulator

murein transglycosylase E

restriction of methylated adenine

ATP-binding transport protein; multicopy suppressor of htrB
mukF protein (killing factor KICB)

quinolinate synthetase, A protein

cytochrome c-type protein

hypothetical protein

ferredoxin-type protein: electron transfer

sensor for nitrate reductase system, protein histidine kinase (acts on NarP and narL)

231

Table 23.

narX
nhaA
nlpC
nrfF
nqu
oraA
pan
pde
perM
pflC
phnA
phrB
pnuC
potA
potE
potl
priC
proY
pssA
pssR
rdIC
relE
rfaH
rhlE
riDB
ribF
rpiB
rplS
rplY
rpmA
rpoE
rpoS
rpsl
rtT
ruvA
ruvB
ryfA
W90
secD
secF
serB
smf
smp
smpA
speD
sraB
sulA
tehA
tesB

confinued

nitratenitrate sensor, histidine protein kinase acts on NarL regulator
Na+H antiporter, pH dependent

Iipoprotein

part of formate-dependent nitrite reductase complex

NADH dehydrogenase I chain A

regulator, OraA protein

poly(A) polymerase I

pyridoxalpyridoxinepyridoxamine kinase

putative permease

probable pyruvate formate lyase activating enzyme 2

deoxyribodipyrimidine photolyase (photoreactivation)
required for NMN transport

ATP-binding component of spermidineputrescine transport
putrescine transport protein

putrescine transport protein; permease

primosomal replication protein N

proline permease transport protein

phosphatidylserine synthase; phospholipid synthesis
regulator of pssA

antisense RNA, trans-acting regulator of ldrC translation
hypothetical protein

transcriptional activator affecting biosynthesis of Iipopolysaccharide core, F pilin, and haemolysin
putative ATP-dependent RNA helicase

3,4 dihydroxy-2-butanone-4-phosphate synthase

putative regulator

ribose 5-phosphate isomerase B

50S ribosomal subunit protein L19

50$ ribosomal subunit protein L25

508 ribosomal subunit protein L27

RNA polymerase, sigma-E factor; heat shock and oxidative stress
RNA polymerase, sigma S (sigma38) factor; synthesis of many growth phase related proteins
303 ribosomal subunit protein 89

rtT RNA; may modulate the stringent response

Holliday junction heiicase subunit B; branch migration; repair
Holliday junction heiicase subunit A; branch migration; repair
hypothetical protein

hypothetical protein

protein secretion; membrane protein, part of the channel
protein secretion, membrane protein

3-phosphoserine phosphatase

hypothetical protein

small membrane protein A

S-adenosylmethionine decarboxylase

hypothetical protein

suppressor of Ion; inhibits cell division and 1152 ring formation
hypothetical protein

acyl-CoA thioesterase II

232

Ta

tne223.
tolA
tolB
tolQ

tolR
tonB
torD
torR
torT
tyrA
ucpA
uhpA
wzzB
xapR
xylE
yaeJ
yafK
yafN
yafP
yagF
yaiU
yajC
yDaQ
ybaZ
ybcR
ybeB
yDeH
nyE
thC
ybiA
qu
ybjM
chW
ych
ych
ych
yceG
yceL
yceP
ych
ych
ycfP
ych
ych
ychE
ychM
yciL
yciS
ydaL
ydDA
ydbC
ych

continued

membrane spanning protein, required for outer membrane integrity
periplasmic protein involved in the tonD-independent uptake of group A colicins
inner membrane protein, membrane-spanning, maintains integrity of cell envelope; tolerance to
group A colicins

putative inner membrane protein, involved in the tonB-independent uptake of group A colicins
energy transducer; uptake of iron, cyanocobalimin; sensitivity to phages, colicins
part of trimethylamine-N-oxide oxidoreductase

response transcriptional regulator for torA (sensor TorS)

part of regulation of tor operon, periplasmic

chorismate mutase-T and prephenate dehydrogenase

putative oxidoreductase

response regulator, positive activator of uhpT transcription (sensor. uhpB)
regulator of length of O-antigen component of lipopolysaccharide chains
regulator for xapA

xylose-proton symport

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative dehydratase

putative flagellin structural protein

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative pectinesterase

hypothetical protein

putative enzyme

hypothetical protein

hypothetical protein

putative oxidoreductase

hypothetical protein

hypothetical protein

putative thymidylate kinase (EC 2.7.4.9)

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative channel protein

putative sulfate transporter

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative dehydrogenase

putative protease

233

Table 23.

ydgC
yth
yecF
yedl
yeeP
yegD
yehZ
yeht
yen.
ydaL
yncF
)ndL
)neN
yhhH
yth
yfiF
yfiN
ygaE

ych
yng

ygdL

yggH
ygiE
ygiP
YQAA
yhaJ
yth
yhdA
yth
W16
vhf)
vhf?
yi91b
yidl
WQN
yihV
yth
yiiR
YUP
ych
yjeA
yjeM
ng
ngP
wgC!
yth

confinued

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative histone

putative heat shock protein

putative transport system permease protein
hypothetical protein

stationary phase nitrogen starvation regulator
putative ATP-binding component of a transport system
hypothetical protein

putative RNA polymerase beta

putative sugar hydrolase

hypothetical protein

putative 2-component sensor protein
hypothetical protein

putative cell division protein

putative transcriptional regulator

putative transport protein

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative transcriptional regulator LYSR-type
hypothetical protein

putative transcriptional regulator LYSR-type
hypothetical protein

hypothetical protein

putative dehydrogenase

hypothetical protein

putative cellulose synthase

hypothetical protein

l8911

hypothetical protein

putative alpha helix chain

putative kinase

putative DEOR-type transcriptional regulator
hypothetical protein

hypothetical protein

hypothetical protein

putative Iysyl-tR NA synthetase

putative transport

putative alpha helix protein

hypothetical protein

hypothetical protein

hypothetical protein

234

Table 23. continued
yjhE hypothetical protein
yth putative frameshift suppressor
yjiK hypothetical protein
yka putative GTP-Dinding protein
ymjA hypothetical protein
yneH putative glutaminase
yohD hypothetical protein
yth hypothetical protein
yohM hypothetical protein
yphA hypothetical protein
yphE putative ATP-binding component of a transport system
yphF putative LACl-type transcriptional regulator
ngA putative transport protein
zipA cell division protein involved in F152 ring

 

235

 

GeneWp-regulated in fermentative transcriptome Analysis (2-4x)

W31103erA(DE3)/pJA3.131A

 

 

Definition
acrA acridine efflux pump
adhE CoA-linked acetaldehyde dehydrogenase and iron-dependent alcohol dehydrogenase;
pyruvate-formate-lyase deactivase
alpA prophage CP4-57 regulatory protein alpA
amn AMP nucleosidase
ampG regulates Deta-Iactamase synthesis
apaG hypothetical protein
argE acetylornithine deacetylase
asmA suppressor of ompF assembly mutants
ath membrane-bound ATP synthase, F1 sector, gamma-subunit
b0476 putative lipase
D0631 hypothetical protein
b0655 putative periplasmic binding transport protein
D0829 putative ATP-binding component of a transport system
D0831 putative transport system permease protein
D0834 hypothetical protein
b0836 putative receptor
D0851 modulator of drug activity A
D0936 hypothetical protein
D1057 putative cytochrome
D1134 putative phosphohydrolase
D1 163 hypothetical protein
b1451 putative outer membrane receptor for iron transport
D1459 hypothetical protein
b1520 hypothetical protein
D1541 hypothetical protein
D1583 hypothetical protein
b1601 putative transport protein
D1630 electron transport complex protein
D1631 hypothetical protein
b1679 hypothetical protein
D1683 hypothetical protein
D1684 hypothetical protein
D1706 hypothetical protein
D1730 hypothetical protein
b1768 hypothetical protein
b1843 hypothetical protein
b1936 hypothetical protein
D2254 putative sugar transferase
D2324 putative peptidase
D2351 putative glycan biosynthesis enzyme
b2363 hypothetical protein
D2438 hypothetical protein
D2439 hypothetical protein
b2461 hypothetical protein
D2504 hypothetical protein
D2680 hypothetical protein

Table 24. Total transcriptome gene list: Upregulated 2-4x.

236

Table 24. continued

D2760
D2858
D2925
D301 2
D3050
D3051
D31 12
D3553
D3706
D3835
b3839
b3840
D4085
DaeS
Dcr
caiD
cchA
crcA
cutA
cbe
cydC
degQ
dsDD
elaC
eutG

fabB
fdx
fimZ
fpr
fumC
galE
galK
galT
gapA
garD
gidB
glk
gloB
gltF
gltL
glyS
gor
gph
QYVB
hemL

hflK
hscA
imp

hypothetical protein

hypothetical protein

fructose-Disphosphate aldolase, class II

hypothetical protein

putative oxidoreductase

putative membrane protein

putative L-serine dehydratase

putative dehydrogenase

GTP-binding protein in thiophene and furan oxidation

Mg-dependent DNase

putative epimerase

sensor protein (for BaeR)

bicyclomycin resistance protein; transmembrane protein
carnitine racemase

detox protein

hypothetical protein

divalent cation tolerance protein; cytochrome c biogenesis
cytochrome D(561)

ATP-binding component of cytochrome-related transport
serine endoprotease

thiolzdisulfide interchange protein; copper tolerance
hypothetical protein

ethanolamine utilization; homolog of Salmonella enzyme, similar to iron-containing alcohol
dehydrogenase

3-oxoacyl-(acyl-carrier-protein) synthase 1

(2FE-28) ferredoxin, electron carrer protein

fimbrial Z protein; probable signal transducer
ferredoxin-NADP reductase

iumarate hydratase Class II; isozyme
UDP-galactose-4-epimerase

galactokinase

galactose-1-phosphate uridylyltransferase
gcheraldehyde-3-phosphate dehydrogenase A
(D)-galactarate dehydrogenase

glucose-inhibited division; chromosome replication?
glucokinase

probable hydroxyacylglutathione hydrolase

regulator of gltBDF operon, induction of Ntr enzymes
ATP-binding protein of glutamateaspartate transport system
glycine tRNA synthetase, beta subunit

glutathione oxidoreductase

phosphoglycolate phosphatase

DNA gyrase subunit B, type II topoisomerase, ATPase activity
glutamate-1-semialdehyde aminotransferase (aminomutase)
protease specific for phage lambda cll repressor
DnaK-homologue chaperone H5066

organic solvent tolerance

237

Table 24. continued

intF
iscR
kde
kefB
ksgA
lipB
Int
Ion
mch
metJ
metL
man
murF
nan
nfo
nlpA
ong .
ompC
parE
prG
pdxA
pka
pka
prA
pgsA

prlC
prmA
ptsG
ptsN
recR
rfaD
rfaF
rfaS
rho
rhsB
rpe
rpoN
sapA
sapB
sapD
sapF
sbcC
selA
sgcA
sch
sgcR
speG
spoT
sufS

putative phage integrase

Fe-S cluster-containing transcription factor -1- transcriptional repressor of iscRSUA operon
ATPase of high-affinity potassium transport system, 8 chain

K+ efflux; NEM-activable K+H+ antiporter
S-adenosylmethionine-G-N,N-adenosyl (rRNA) dimethyltransferase

protein of lipoate biosynthesis

apolipoprotein N-acyltransferase, copper homeostasis protein, inner membrane
DNA-binding, ATP-dependent protease La; heat shock K-protein

component of MchC 5—methylcytosine restriction system

repressor of all met genes but metF

aspartokinase II and homoserine dehydrogenase ll

molybdopterin converting factor, subunit 2

D-alanine:D-alanine-adding enzyme

oxygen-insensitive NAD(P)H nitroreductase

endonuclease IV

lipoprotein-28

prophage P2 ogr protein

outer membrane protein 1D

DNA topoisomerase IV subunit 8

penicillin-binding protein 7

pyridoxine biosynthesis

6-phosphofructokinase I

6-phosphofructokinase ll; suppressor of pka

pyruvate formate lyase activating enzyme 1

phosphatidylglycerophosphate synthetase = GDP-1,2-diacyl-sn-glycero-3-phosphate
phosphatidyl transferase

oligopeptidase A

methylase for 508 ribosomal subunit protein L11

PTS system, glucose-specific llBC component

phosphotransferase system enzyme IIA, regulates N metabolism
recombination and repair

ADP-L-gchero-D-mannoheptose-S-epimerase

ADP-heptose--lps heptosyltransferase ll; Iipopolysaccharide core biosynthesis
Iipopolysaccharide core biosynthesis

transcription termination factor Rho; polarity suppressor

rhsB protein in rhs element

D-ribulose-S-phosphate 3-epimerase

RNA polymerase, sigma(54 or 60) factor; nitrogen and fermentation regulation
homolog of Salmonella peptide transport periplasmic protein

homolog of Salmonella peptide transport permease protein

putative ATP-binding protein of peptide transport system

putative ATP-binding protein of peptide transport system

ATP-dependent dsDNA exonuclease

selenocysteine synthase: L-seryI-tRNA (Ser) selenium transferase

putative PTS system enzyme II A component

putative epimerase

putative DEOR-type transcriptional regulator

spermidine N1 -acetyltransferase

(p)ppGpp synthetase II; also guanosine-3,5-Dis pyrophosphate 3-pyrophosphohydrolase
selenocysteine lyase, PLP-dependent

238

Table 24. continued

talB transaldolase B

tch putative kinase

tdh threonine dehydrogenase

tdk thymidine kinase

thiL thiamin-monophosphate kinase

tpx thiol peroxidase

trkA transport of potassium

trpB tryptophan synthase, beta protein

trpR regulator for trp operon and aroH; trp aporepressor

trpS tryptophan tRNA synthetase

trxA thioredoxin 1

tus DNA-binding protein; inhibition of replication at Ter sites

wecC UDP-N-acetyl-D-mannosaminuronic acid dehydrogenase; synthesis of enterobacterial
common antigen (ECA)

wecD

wzzE putative transport protein

yacF hypothetical protein

yacG hypothetical protein

yadC putative fimbrial-like protein

yadT hypothetical protein

yaeB hypothetical protein

yagN hypothetical protein

yaiW hypothetical protein

yDaB hypothetical protein

yDaN putative gene 58

yDaP putative ligase

ybcL hypothetical protein

yDeX putative transport protein

ybeY hypothetical protein

yth hypothetical protein

yth hypothetical protein

ybjC hypothetical protein

ych putative dehydrogenase

yceF hypothetical protein

ycfH hypothetical protein

ycfQ hypothetical protein

ych hypothetical protein

ydbL hypothetical protein

ych hypothetical protein

ych hypothetical protein

ych hypothetical protein

ydiD putative Iigasesynthetase

yecE hypothetical protein

yecP putative enzyme

yehA putative type-1 fimbrial protein

yeiG putative esterase (EC 311-).

yfbM hypothetical protein

ytcA putative structural protein

yffB hypothetical protein

nyJ hypothetical protein

yij hypothetical protein

239

Table 24. continued

ych hypothetical protein

ygeF hypothetical protein

yggV putative ribosomal protein

yggW putative oxidase

ygiB hypothetical protein

yhaK hypothetical protein

yhbH probable sigma-54 modulation protein
yhbW putative enzyme

yth putative outer membrane protein
yth hypothetical protein

yheT hypothetical protein

yheU

yth

yhhH

yhiJ

yhiS

yiDA

yiDJ

yicM putative transport protein

yidA

yieE

yieF

yieO putative transport protein (M FS family)
yigA

yigF

yigG

yiiX

yjeP putative periplasmic binding protein
yjeS

yigD

yigG

yigL

yojN putative 2-component sensor protein
yqu hypothetical protein

yqu hypothetical protein

yqu putative transferase

yrfE

yth putative transport protein

 

240

 

Genes Up-regulated in fermentative transcriptome analysis (4x)

W3110serA(DE3)IpJA3.131A

 

 

 

 

'l‘r'zinsport Definition

artQ arginine 3rd transport system permease protein

hth integral membrane protein

yjcV putative transport system permease protein

ybgH Hypothetical transporter

ach possible efflux pump

yth putative transport protein

hisP ATP-binding component of histidine transport

yacH putative membrane protein

yabN putative transport protein

YegN multidrug transporter

('cllulzlr Definition

ach acyl carrier protein phosphodiesterase

apaH diadenosine tetraphosphatase

argA N-acetylglutamate synthase; amino acid acetyltransferase
argB acetylglutamate kinase

argC N-acetyl-gamma-glutamylphosphate reductase

argD acetylornithine delta-aminotransferase

argF ornithine carbamoyltransferase 2

argG argininosuccinate synthetase

argH argininosuccinate lyase

argl ornithine carbamoyltransferase 1

aroH 3-deoxy-D-arabinoheptulosonate-7—phosphate synthase (DAHP synthetase)
artJ arginine 3rd transport system periplasmic binding protein
artM arginine 3rd transport system permease protein

artP ATP-binding component of 3rd arginine transport system
aan regulator for asnA

betA choline dehydrogenase

bglA 6-phospho-beta-gIucosidase A; cryptic

bioA 8—diaminopelargonic acid synthetase

bioD dethiobiotin synthetase

cchB detox protein

celF phospho-beta-glucosidase; cryptic

clpB heat shock protein

cspl cold shock-like protein

cysA ATP-binding component of sulfate permease A protein; chromate resistance
cysC adenosine 5-phosphosulfate kinase

cysD ATstulfurylase (ATP:sulfate adenylyltransferase)

cysH 3-phosphoadenosine 5-phosphosulfate reductase

cysl sulfite reductase

cst sulfite reductase (NADPH) flavoprotein beta subunit
cysM cysteine synthase B

cysN ATP-sulfurylase (ATP:sulfate adenylyltransferase)

cysW sulfate transport system permease W protein

dnaJ chaperone with DnaK; heat shock protein

dnaK chaperone Hsp70; DNA biosynthesis; autoregulated heat shock proteins
elaD putative sulfatase I phosphatase

eno enolase

eng putative sensor for regulator Eng

fimE recombinase involved in phase variation; regulator for flmA
glnD protein Pll; uridylyltransferase acts on regulator of glnA
gltB glutamate synthase

Hpr phosphocarrier protein HPr-like NPr

Table 25. Total transcriptome gene list: Upregulated at least 4x.

241

Table 25. continued

hth
hth
ipr
ipr
manX
manY
manZ
mch
metJ
metK

moaB
moaC
mopA
mopB
nagA
nagB
nagC
nrdA
nrdB
nrdB
nrdD
nrdE
nrdF
nrdG
nrdH
nrdl
nth
plsB
PPX
pku
rfaC
rfaL
rffG
rffH
selB
sgcQ
sodA
SPY
sseB
trpA
udhA
uvrC
uqu
wecB

xerC

chaperone Hsp90

integral membrane protein

heat shock protein

heat shock protein

PTS enzyme IIAB

PTS enzyme llC mannose-specific

PTS enzyme IID mannose-specific

component of MchC 5-methylcytosine restriction system
Met repressor

methionine adenosyltransferase 1 (AdoMet synthetase); methyl and
propylamine donor

molybdopterin biosynthesis

molybdopterin biosynthesis

chaperone Hsp60

suppressing its ATPase activity
N-acetylgIucosamine-6-phosphate deacetylase
glucosamine-G-phosphate deaminase

transcriptional repressor of nag (N-acetylglucosamine) operon
alpha subunit ribonucleoside diphosphate reductase 1
ribonucleoside-diphosphate reductase 1
RiDonucleoside-diphosphate reductase 1 beta chain
anaerobic ribonucleoside—triphosphate reductase
ribonucleoside-diphosphate reductase 2
ribonucleoside-diphosphate reductase 2

anaerobic ribonucleotide reductase activating protein
glutaredoxin-like protein; hydrogen donor

endonuclease Ill; specific for apurinic and/or apyrimidinic sites
glycerol-3-phosphate acyltransferase

exopolyphosphatase

pyruvate kinase 1 (formerly F)

heptosyl transferase l; Iipopolysaccharide core biosynthesis
O-antigen ligase; Iipopolysaccharide core biosynthesis
dTDP-glucose 4

glucose-1-phosphate thymidylyltransferase
selenocysteinyl-tRNA-specific translation factor

putative nucleoside triphosphatase

superoxide dismutase manganese

enhanced serine sensitivity

tryptophan synthase

putative oxidoreductase

excinuclease ABC

D-mannonate oxidoreductase

UDP-N-acetyl glucosamine -2-epimerase; synthesis of enterobacterial
common antigen (ECA)

site-specific recombinase acts on cer sequence of Co|E1

242

 

Table 25. continued

yabN
yacH
yaeC
yagD
yagL
ybbN
yDcK
ybeF
yDeZ
ybgD
ybgH
yth
yth
ybU
ybmfl
chB
ycel
ycflS
deV
de
wjx
ydeH
yde
yeaD
yebE
YegN
yegN
yfaE
yflflu
yfiA
yng
ych
ysV\
ng3
yth
WDGB
W98
wcv
wflv
th
WhC

putative transport protein
putative membrane protein
putative Iipoprotein

DNA-binding protein
putative thioredoxin-like protein

putative transcriptional regulator LYSR-type
putative ATP-binding protein in pho regulon

putative fimbrial-like protein
Hypothetical transporter

putative amidase

putative oxidoreductase

putative EC 2.1 enzymes

multidrug transporter

putative yhbH sigma 54 modulator
putative cytochrome oxidase subunit

putative synthetase/amidase
putative phosphatase

putative transport system permease protein

putative transport protein
putative dehydrogenase

243

Table 25. continued

yjiD
111M
ykgH
yme
yme
yqel

yqu
thD

YQIB
yqjl
yer
yrfl

putative sensory transducer

putative oxidoreductase

244

When compared, the experiments adding authentic phloroglucinol in non-
phloroglucinol producing strain W3110 and inducing a phloroglucinol producer
W31103erA(DE3)/pJA3.131A there were 109 total and seven membrane or transport
proteins encoded by its respective genes that were up-regulated at least twofold. An

identification and brief description of the common genes are supplied.

 

Genes Up-regulated in both transcriptome Analysis W3110
Khown genes encoding transport or

 

 

membrane proteins Description

ach RND multidrug efflux pump (typical substrate: aminoglycosides)
D1451 putative outer membrane receptor for iron transport
D3051 putative membrane protein

Dcr bicyclomycin resistance protein; transmembrane protein

trkA transport of potassium

yacH putative membrane protein

YegL (mdtB) RND multidrug transporter

 

Table 26. Comparitive transcriptome membrane or transport gene list: Upregulated

245

 

ach
ach
apaH
argA
argB
argC
argD
argF
argG
aroH
artJ
D0261
b0309
D0476
b0833
D0834
D0851
D1 057
D1 451
D1 498
D1 499
D1 500
D1 501
D1 502
D1 504

Genes Up-regulated in both transcriptome analyses W3110
Definition
acyl carrier protein phosphodiesterase
possible efflux pump
diadenosine tetraphosphatase
N-acetylglutamate synthase; amino acid acetyltransferase
acetylglutamate kinase
N-acetyl-gamma-gIutamylphosphate reductase
acetylornithine delta-aminotransferase
ornithine carbamoyltransferase 2
argininosuccinate synthetase
3-deoxy-D-arabinoheptulosonate-T-phosphate synthase (DAHP synthetase
arginine 3rd transport system periplasmic binding protein
yagD

putative lipase

hypothetical protein

modulator of drug activity A

putative cytochrome

putative outer membrane receptor for iron transport
putative sulfatase

putative ARAC-type regulatory protein

putative oxidoreductase, major subunit
putative adhesin; similar to FimH protein
putative fimbrial-like protein

Table 27. Comparitive transcriptome cellular gene list: Upregulated

246

Table 27. continued

D1679
D1683
D1684
D1730
b2074
b2085
b2385
D2680
D3050
b3051
D3840
D3913
b3914
baeS
bcr
inoA
lfioD
0e”:
eflaD

fimZ ‘

fpr
garD
gidB
hscA
manX
manY
manZ
metJ
metK

micF
nagA
nagB
nrdE
nrdF
nrdH
nrdl
pka
rffH
rhsB
rygA
rygB
SPY
sseB
sufS
tch
trkA
uqu
wecB

wecD

hypothetical protein
hypothetical protein
hypothetical protein
hypothetical protein
putative membrane protein

putative peptidase
hypothetical protein
putative oxidoreductase
putative membrane protein
Mg-dependent DNase

sensor protein (for BaeR)

bicyclomycin resistance protein; transmembrane protein
8-diaminopelargonic acid synthetase

dethiobiotin synthetase

phospho-beta-glucosidase; cryptic

putative sulfatase / phosphatase

fimbrial 2 protein; probable signal transducer
ferredoxin-NADP reductase

(D)-ga|actarate dehydrogenase

glucose-inhibited division; chromosome replication?
DnaK-homologue chaperone Hsc66

PTS enzyme llAB

PTS enzyme IIC mannose-specific

PTS enzyme IID mannose—specific

repressor of all met genes but metF

methionine adenosyltransferase 1 (AdoMet synthetase); methyl and propylamine donor

regulatory antisense RNA affecting ompF expression
N-acetylglucosamine-G-phosphate deacetylase
glucosamine-B-phosphate deaminase
ribonucleoside-diphosphate reductase 2
ribonucleoside-diphosphate reductase 2
glutaredoxin-like protein; hydrogen donor

6-phosphofructokinase ll; suppressor of pka
glucose-1-phosphate thymidylyltransferase
rhsB protein in rhs element

enhanced serine sensitivity

selenocysteine lyase, FLP-dependent

putative kinase

transport of potassium

D-mannonate oxidoreductase

UDP-N-acetyl glucosamine -2-epimerase; synthesis of enterobacterial common antigen
(ECA)

247

Table 27. continued

yacH
yagL
ych
ybgD
thB
yDU
chB
ydeH
yebE
yecP
YegN
yde
yflA.
ych
ygfi3
ng3
yhaK
ythV
yth
ykKS
wDJ
weF
WQB
ng
ngi
yfiX
was
ngL
yfiD
yfiNI
ykgH
ynnD
anE
thD
yqfl

putative membrane protein
DNA-binding protein

putative fimbrial-like protein
hypothetical protein

putative amidase

putative enzyme
multidrug transporter

putative yhbH sigma 54 modulator
hypothetical protein

hypothetical protein

putative synthetase/amidase
hypothetical protein

putative enzyme

putative phosphatase

putative oxidoreductase

248

When compared, the experiments adding authentic phloroglucinol in non-
phloroglucinol producing strain W3110 and inducing a phloroglucinol producer
W31103erA(DE3)/pJA3.13lA there were 58 proteins encoded by its respective genes that
were down-regulated. An identification and brief description of the common genes are
supplied. Down regulated genes were not discounted in transcriptome interpretation and

are presented below.

 

Genes Down-regulated in both transcriptome analyses W3110
Definition

speD S-adenosylmethionine decarboxylase

b0123 hypothetical protein

dinB DNA polymerase lV

yagU hypothetical protein

psiF induced by phosphate starvation

proY proline permease transport protein

hupB DNA-binding protein HU-beta

b0484 putative ATPase

b0627 hypothetical protein

phrB deoxyribodipyrimidine photolyase (photoreactivation)
aroG DAHP synthetase, phenylalanine repressible
rhlE putative ATP-dependent RNA helicase
ybiA hypothetical protein

Table 28. Comparitive transcriptome total gene list: Downregulated

249

Table 28. continued

dinG probably ATP-dependent heiicase

ybiN hypothetical protein

sulA suppressor of Ion, inhibits cell division and f tsZ ring formation
putP major sodium proline symporter

D1016 hypothetical protein

b1017 hi gh-affinity iron permease

ych hypothetical protein

ych hypothetical protein

fl gN protein of flagellar biosynthesis

potA ATP-binding component of spermidineputrescine transport
yme hypothetical protein

umuD SOS mutagenesis; error-prone repair

yciL hypothetical protein

b1339 putative transcriptional regulator LysR-type
bl445 hypothetical protein

b1533 amino acid metabolite efflux pump

cspB cold shock protein

bl625 hypothetical protein

ppsA phosphoenolpyruvate synthase

b174l putative excinuclease subunit

b1748 acetylornithine delta-aminotransferase

yebG hypothetical protein

yebK hypothetical protein

bl858 putative ATP-binding component of a transport system
bl859 hypothetical protein

cutC copper homeostasis protein

ter tyrosine-specific transport system

yegD putative heat shock protein

yegQ hypothetical protein

yehZ putative transport system permease protein
narP nitratenitrite response regulator (sensor NarQ)
b2340 hypothetical protein

yth hypothetical protein

tyrA chorismate mutase-T and prephenate dehydrogenase
aroF DAHP synthetase, tyrosine repressible

yij putative cell division protein

b2997 putative hydrogenase subunit

D3020 putative transport periplasmic protein

yth hypothetical protein

pssR regulator of pssA

lexA regulator for SOS(lexA) regulon

yjcB hypothetical protein

ych hypothetical protein

rpiB ribose 5-phosphate isomerase B

phnA hypothetical protein

 

250

Phloroglucinol reduction methodology

Resorcinol Phloroglucinol (1.0 g, 8.0 mmol) was dissolved in degassed 1.0 N
aqueous NaOH (8 mL). To the solution was 1.2 mol% of 5% Rh on alumina catalyst. The
suspension was shaken 12 h under 50 psi. H2. After filtering the catalyst through Celite,
pH was adjusted to 6.0 with 10% HCI. The solution was concentrated in vacuo to a
yellow oil which was subsequently dissolved in 0.5 M H2304 (20 mL) then refluxed under
argon for 9 hours. The cooled solution was extracted with 5 x 20 mL ether, then dried
over MgSO4,filtered, then concentrated in vacuo. The resulting brown oil was purified by
Kugel-Rohr distillation in vacuo at 120 °C affording resorcinol as white crystals. lHNMR
(d-6-acetone): 6 6.97 (dd, J = 8.0, 8.0 Hz, 1H), 6.35 — 6.30 (m, 3H) ; 13C NMR (d-6—

acetone): 6 159.4, 130.7, 107.4, 103.4.

251

CHAPTER FIVE REFERENCE

1 Yang, 1.; Frost, J. W. unpublished results.

2 (a)Katrizky, A. R.; Zhang, S.; Hussein, A. H. M.; Fang, Y. J. Org. Chem. 2001, 66,

5606; (b) Hudlicky, M. J. Org. Chem. 1980,45, 5377; (c) Marti, R. E.; Bleicher, K. H.;
Bair, K. W. Tetrahedron Lett. 1997, 38, 6145.

3 Bradford, M. M. A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976,
72, 248-254.

4 Tabor, 5.; Richardson, C. C. Proc. Natl. Acad. Sci. USA, 1987, 84,4767.

5 Donnelly, M. 1.; Sanville-Millard, C .; Chatterjee; R. Method for construction of
bacterial strains with increased succinic acid production. US. Patent 6,159,738, 2000.

6 Sambrook, J .; Russell, D. W. Molecular Cloning: A Laboratory Manual; Cold Spring
Harbor Laboratory Press: Cold Spring Harbor, NY, 2001.

7 Harris, E. L. V.; An gal, S. In Protein Purification Methods: A Practical Approach;
Oxford University Express: Oxford, New York, Tokyo, 1989.

252