M

1l

      
     
    

‘l

w
1
\

i‘flHHUW

”WW

1“

 

§§E “WWW!“

 

 

was“ LIBRARY
, ( Michigan :"'?.a'te
20M Unwersfiy

 

 

 

This is to certify that the
thesis entitled

LEECHES IN THE LAKE ERIE WATERSHED: THE
IDENTIFICATION AND POTENTIAL ROLE IN DISEASE
TRANSMISSION

presented by

Carolyn A. Schulz

has been accepted towards fulfillment
of the requirements for the

MS. degree in Fisheries and Wildlife

 

 

New ¥QIS¢Q_

Major Professor’s Signature

#3va

Date

 

MSU is an Affirmative Action/Equal Opportunity Employer

_,_-.-.—.—--I—.-n-----—.—-o-—.—o—.—-----—u—.-.-.-.--.—.-— _ - _

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 KV/ProglAcc8Pres/CIRC/Date0ue indd

LEECHES IN THE LAKE ERIE WATERSHED: THE IDENTIFICATION AND
POTENTIAL ROLE IN DISEASE TRANSMISSION

By

Carolyn A. Schulz

A THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE
Fisheries and Wildlife

2009

ABSTRACT

LEECHES IN THE LAKE ERIE WATERSHED: THE IDENTIFICATION AND
POTENTIAL ROLE IN DISEASE TRANSMISSION

By

Carolyn A. Schulz

Three species of leeches (Actinobdella pediculata, Myzobdella lugubris, and
Placobdella montifera) were found parasitizing fish species from Lake St. Clair,
Michigan, within the Lake Erie Watershed in the Great Lakes Basin (GLB). Leeches
were found attached to a variety of sites on the host species. Gross and histological
examination of attachment sites revealed necrotic and hemorrhagic tissue, severe
swelling, expansion of muscle and dermal layers, and infiltration of macrophages,
lymphocytes, and heterophils. The predominant leech in the watershed, Myzobdella
lugubris, was further investigated for its role in disease transmission. An emerging
disease in the GLB, the Viral Hemorrhagic Septicemia virus (V HSV), has been
associated with several mass fish mortalities, including fish species that are susceptible to
leech parasitism. Cell culture and PCR results showed that this is the first report of
VHSV detected within leeches. In addition to the detection of viral pathogens, the
bacterial community of M. lugubris was also examined. Sequences of amplified
community bacterial DNA was checked for similarity to existing 168 sequences in the
Ribosomal Database Project and BLAST. The phyla Bacteroidetes, Beta-proteobacteria,

and Verrucomicrobia were detected in leech homogenates.

ACKNOWLEDGEMENTS

I would first like to thank my advisor, Dr. Mohamed Faisal, for all of the guidance
and wisdom that he shared with me throughout the completion of this thesis. Without his
careful direction during my research and writing, I would not have been able to be as
successful in my research as I was. I thank him for his belief in me, encouragement,

friendship, and guidance, and will always consider him my mentor.

In addition, I would like to thank my committee member Dr. Don Garling for his
input and assistance with the details in my research and writing. I would also like to
thank my committee member Dr. Scott Fitzgerald for sharing his expertise in

histopathology and his overall contribution to my thesis.

I am also grateful to the members of the Aquatic Animal Health Laboratory for
their invaluable assistance throughout my research. Specifically, I would like to thank
Michelle Gunn, Thomas Loch, Wei Xu, Andrew Winters, Robert Kim, and Elena

Millard.

My research efforts would not have been possible without the funding and support
of the Michigan Department of Natural Resources (MDNR). I would specifically like to
thank Michael Thomas and the crew of the Lake St. Clair Fisheries Research Station, as

well as David Blair Commercial Fisheries, for their assistance in my sampling.

Lastly, I would like to thank my friends and family for their steadfast support

throughout my master’s research.

iii

TABLE OF CONTENTS

LIST OF TABLES .................................................................................... vi
LIST OF FIGURES ................................................................................. vii
GENERAL INTRODUCTION AND OVERVIEW ............................................... 1
STUDY OBJECTIVES .............................................................................. 3
CHAPTER 1
REVIEW OF LITERATURE ......................................................................... 4
Leech background information and distribution .......................................... 4
Description of the leeches of interest in this study ...................................... 8
Role of leeches in disease and pathogen transmission ................................. 11
The Great Lakes Basin and Lake Erie Watershed background information. . ......15
Diseases of Great Lakes fish species ..................................................... 17
CHAPTER 2
LEECHES PARASITIZING FISH SPECIES IN LAKE ST. CLAIR, MICHIGAN AND
THE POTENTIAL IMPACT ON THE FISH HOSTS ......................................... 26
Abstract ...................................................................................... 26
Introduction ................................................................................. 28
Materials and methods ..................................................................... 30
Study area description ............................................................ 30
Fish and leech sampling .......................................................... 30
Leech identification ............................................................... 32
Assessment of fish damage caused by leeches ................................ 33
Statistical analyses ................................................................ 34
Results ....................................................................................... 35
Leech identification ............................................................... 35
Leech prevalence, intensity, and abundance ................................... 36
Leech site of attachment ......................................................... 38
Gross and histopathological damage ........................................... 39
Discussion ................................................................................... 42
Leech identification ............................................................... 42
Leech prevalence, intensity, and abundance ................................... 44
Leech site of attachment ......................................................... 45
Gross and histopathological damage ........................................... 46
CHAPTER 3

THE POTENTIAL ROLE OF LEECHES IN THE TRANSMISSION OF VIRAL

HEMORRHAGIC SEPTICEMIA VIRUS (VHSV) IN THE LAKE ERIE

WATERSHED, MICHIGAN ..................................................................... 62
Abstract ...................................................................................... 62

iv

Introduction ................................................................................. 63

Materials and methods ..................................................................... 66
Study area description ............................................................ 66
Leech collection ................................................................... 67
Sample processing ................................................................ 68
Cell culture ......................................................................... 68
Reverse transcriptase polymerase chain reaction (RT-PCR) procedure. . .69
Sequence analysis ................................................................. 70
Results ....................................................................................... 71
Virus isolation ..................................................................... 71
RT-PCR results .................................................................... 71
Sequence analysis ................................................................. 72
Discussion ................................................................................... 73
Virus isolation ..................................................................... 73
RT-PCR results and sequence analysis ......................................... 73
CHAPTER 4
BACTERIAL COMMUNITY ASSOCIATED WITH THE LEECH MYZOBDELLA
LUGUBRIS FROM THE LAKE ERIE WATERSHED, MICHIGAN ....................... 81
Abstract ...................................................................................... 81
Introduction ................................................................................. 83
Materials and methods ..................................................................... 85
Study area description ............................................................ 85
Leech collection ............................... . .................................... 85
Leech preparation ................................................................. 86
Sequence analysis ................................................................. 86
Results ....................................................................................... 89
Discussion ................................................................................... 91
CHAPTER 5
CONCLUSIONS AND FUTURE RESEARCH ................................................ 96
REFERENCES .................................................................................... 100

LIST OF TABLES

Table 1. Prevalence, intensity, and abundance of leeches parasitizing fish caught from
Lake St. Clair, Lake Erie Watershed, Michigan ................................................ 50

Table 2. Prevalence, intensity, and abundance for Actinobdella pediculata attached to fish
collected from Lake St. Clair, Lake Erie Watershed, Michigan ............................... 51

Table 3. Prevalence, intensity, and abundance for Myzobdella lugubris attached to fish
collected from Lake St. Clair, Lake Erie Watershed, Michigan .............................. 52

Table 4. Prevalence, intensity, and abundance for Placobdella montifera attached to fish
collected from Lake St. Clair, Lake Erie Watershed, Michigan .............................. 53

Table 5. Proportion of leeches attached to a specific external attachment site based on the
total number of leeches collected in this study, as well as the individual number of
leeches collected from Actinobdella pediculata, Myzobdella lugubris, and Placobdella
montifera .............................................................................................. 54

Table 6. Pooled leech sample results for the first (Pl), second (P2), and third (P3) cell
culture passages, as well as PCR (~five leeches/pool) ......................................... 76

Table 7. The presence of bacteria from the Bacteroidetes phyla (F lavobacterium sp., F.
johnsoniae, and F. psychrophilum), Beta-proteobacteria phyla (Chromobacterz’um
violaceum, Thiobacillus denitrificans, and Vogesella sp.), and Verrucomicrobia phyla
(Verrucomicrobium genera incertae sedis) detected within viscera from leeches collected
to the channel catfish and freshwater drum ....................................................... 94

vi

 

i.

 

LIST OF FIGURES

Figure 1. Actinobdella pediculata (Rhynchobdellida: Glossiphonida) has a flat, wide
body, with a ventral oral sucker, more or less fused or continuous with the body, not
distinctly expanded or set off from the body by a narrow neck (a); a caudal sucker
separated from the body on a distinct pedicel with the rim of the caudal sucker thick and
bulbous, without digitate processes (b); and one pair of eyes (c) ............................. 22

Figure 2. Myzobdella lugubris (Rhynchobdellida: Piscicolida) has a cylindrical body,
often divided into a narrow anterior (a) and wider posterior region (b), with an oral sucker
that is clearly set off from the body (c) ........................................................... 23

Figure 3. Placobdella montifera (Rhynchobdellida: Glossiphonida) has a flat body much
wider than the head region; a ventral oral sucker distinctly expanded to form a discoid
head, set off from the body by a narrow neck constriction (a); one pair of eyes (b); and a
dorsum with 3 prominent tuberculate keels or ridges (c) ...................................... 24

Figure 4. The Lake Erie Watershed, surrounded by the states Michigan, New York, Ohio,
and Pennsylvania, and the Canadian province of Ontario, is connected in the east to Lake
Ontario by the Welland canal and in the west to Lake Huron via the Detroit River, Lake
St. Clair, and the St. Clair River. The four-pointed black star denotes the sampling
location of the Michigan Department of Natural Resources trap nets (42°37'54.60"N,
82°45'54.60"W) in Anchor Bay, Lake St. Clair. The five-pointed black star denotes the
commercial fishing trap nets (41°46'OO.74"N, 83°24'58.09"W) in Lake Erie from which
leeches were collected during this study .......................................................... 25

Figure 5. Proportion of each leech species (Actinobdella pediculata, Myzobdella lugubris,
and Placobdella montifera) identified in the study, expressed as a percent ................. 55

Figure 6. Gross attachment of Myzobdella lugubris attached to various locations on hosts:
(a) the isthmus of a freshwater drum demonstrating the variation in size of M. lugubris
(arrows); (b) M. lugubris attached to the pectoral fin of a channel catfish, surrounded by
necrotic and hemorrhagic patches (arrows), which are former feeding sites; (c) the caudal
sucker of M. lugubris (arrows) embedded into the anal fin of a northern pike, surrounded
by a hemorrhagic ring; and (d) the caudal fin of channel catfish demonstrating the a
heavy infection of M lugubris ..................................................................... 56

Figure 7. A juvenile specimen of Actinobdella pediculata attached to the interior of the
operculum of two freshwater drum, (a) the caudal sucker of A. pediculata is embedded
into the opercular tissue (black arrow), while the oral sucker left behind multiple
hemorrhagic sites of previous feeding (white arrow); and (b) the attachment sites left
behind by juvenile A. pediculata caused severe swelling (arrows), but had no hemorrhage
associated with it ..................................................................................... 57

Figure 8. As Actinobdella pediculata increases in size, the location of attachment changes
in the gill chamber of the freshwater drum, (a) the caudal sucker of A. pediculata

vii

embedded into the musculature of the gill chamber, while the oral sucker (arrow)
searched for a suitable feeding site; and (b) the hemorrhagic feeding sites of A. pediculata
(arrow) ................................................................................................. 58

Figure 9. Adult Actinobdella pediculata were attached to the gill chamber of freshwater
drum in groups of 1-3 leeches, (a) two adult A. pediculata attached to the gill chamber
(arrows); and (b) whereas, if A. pediculata was large enough, only one was attached to
the gill chamber (arrow) ............................................................................ 59

Figure 10. The gill chamber of the freshwater drum, where Actinobdella pediculata was
attached and resulted in lesions, (a) the lesions varied in size, dependent upon the size of
A. pediculata, and were frequently surrounded by a hemorrhagic ring (arrows); and (b)
the attachment site of larger specimens of A. pediculata resulted in more severe lesions,
with a hemorrhagic margin and central depression where the caudal sucker was

attached ............................................................................................... 60

Figure 11. Histopathological damage caused by Actinobdella pediculata to the freshwater
drum. Figure (a) demonstrates healthy (H) muscle tissue with prominent nuclei (arrows)
(x200, H&E), whereas (b) shows necrotic (N) muscle tissue with less pronounced nuclei
(arrow) (x200, H&E); (c) demonstrates healthy and necrotic muscle tissue, being
surrounded by lymphocytes and macrophages (arrows), in order to engulf the dying tissue
and cells (x100, H&E); and (d) shows epidermis (E) and dermis (D) where massive
expansion (arrows) has occurred due to edema (x100, H&E) ................................. 61

Figure 12. The comparison of (a) the cell monolayer of normal EPC growth in 96-well
plates, and (b) the cell monolayer exhibiting cytopathic effect in the form of focal areas
of rounded, refractile cells .......................................................................... 77

Figure 13. Agarose gel showing the bands from RT-PCR, used for the detection of VHSV
(811 base pair). Pooled leech samples (#66, 69, 71, 75, 79, 80, 83-86, and 90) are
representative VHSV-positive samples. The marker (M) used was 1.0 kb plus
(Invitrogen) .......................................................................................... 78

Figure 14. Multiple alignments of VHSV sequences, showing 100% match of the VHSV
Leech sequence to the DQ427105 VHSV IVb sequence, as well as homology to other
VHSV genotypes ..................................................................................... 79

Figure 15. Phylogenetic distance tree generated by neighbor-joining analysis of 20
complete nucleoprotein gene open-reading frame sequences representing the
Rhabdoviridae group, with special interest going to the VHSV genotypes. Bootstrap
confidence values are shown at branch nodes. Notice the VHSV leech is homologous to
the MIO3GL strain (type IVb) ....................................................................... 80

Figure 16. The occurrence of bacteria phyla (expressed as frequency) within the two
leech samples; based on the RDP Classifier, using a 95% confidence threshold ........... 95

viii

GENERAL INTRODUCTION AND OVERVIEW

Leeches (Annelida: Hirudinea) are known to occur in a diversity of habitats,
including aquatic (freshwater and marine) and terrestrial environments (Burreson 2006).
They parasitize a variety of hosts, such as annelids, crabs, crayfish, fish, frogs, reptiles,
aquatic birds, cows, monkeys, horses, elephants, as well as humans (Klemm 1972;
Sawyer 1986; Mulcahy et al 1990; Greenblatt et al 2004; Hemmingsen et al 2005);
however, this research focuses on leeches that attach to fish. Fish leeches can attach to
various sites on the body of the host, including the pectoral, pelvic, dorsal, and caudal
fins, the eyes, the gill chamber, the mouth cavity, and directly to the main body of the
fish (Daniels and Sawyer 1975; Appy and Cone 1982; Noga et a1 1990; Morrison et al
1993; Font and Tate 1994). Leeches attached to fish hosts can also cause a variety of
damage, such as ulcerations, hemorrhagic or necrotic tissue, hyperplasia, thickened
hypodermis, severe inflammation, and erosion of the dermis (Papema and Zwemer 1974;
Appy and Cone 1982; Noga et a1 1990). In other studies, leeches have been found
associated with bacteria (Kikuchi and F ukatsu 2002, 2005) and viruses (Ahne 1985;
Mulcahy et al 1990; Greenblatt et al 2004). These studies demonstrate the ability of
leeches to aid in the transmission of pathogenic bacteria and viruses.

Although much research has been conducted regarding the distribution and
taxonomy of leeches in North America, the distribution record for the Great Lakes and its
connecting waters is still incomplete, especially for the Lake Erie Watershed. The Lake
Erie Watershed is of particular interest because it is a heavily utilized commercial and

recreational fishery. Additionally, several mass fish mortalities associated with the

emerging Viral Hemorrhagic Septicemia virus (V HSV) have recently occurred in the
Lake Erie Watershed. The following study was designed to better understand the role

leeches may play in disease transmission in the Lake Erie Watershed.

STUDY OBJECTIVES

The overall hypothesis of this research was that fish in the Lake Erie Watershed
harbor both intermittent and semi-pennanent leeches, and the leech population would
most likely be dominated by a generalist leech species. It was also hypothesized that
leeches in the Lake Erie Watershed could harbor microbes of potential pathogenicity to
fish. To test these hypotheses, a number of tasks were performed with the following .—
objectives:

(1) To determine the species of leeches prevalent in the Lake Erie Watershed,
specifically Lake St. Clair. Since Lake St. Clair is the shallowest major lake within the
Lake Erie Watershed, it is considered an optimal collection site for parasitic leeches. In
specific, fish were collected to evaluate the occurrence, prevalence, intensity and
abundance of leeches per each fish species of host. The prevalence and intensity of
leeches at specific attachment sites on the host were also determined;

(2) To describe gross damage caused by the intermittent leeches and the
histopathological damage at the attachment site of Actinobdella pediculata to its host, the
freshwater drum (Aplodinotus grunniens), where A. pediculata spends most of its life
cycle (Sawyer 1986);

(3) To determine if leeches with intermittent feeding habits, such as Myzobdella
lugubris, harbor the emerging fish-pathogenic rhabdovirus, Viral Hemorrhagic
Septicemia virus (VHSV); and

(4) To describe the bacterial pathogens that the intermittent leech M lugubris

harbors within its internal organs.

CHAPTER ONE

REVIEW OF LITERATURE

Leech background information and distribution. Leeches (Annelida: Hirudinea) are
parasites that have a worldwide distribution and occur in a diversity of habitats (Burreson
2006). They live in both aquatic (freshwater and marine) and terrestrial environments
where they parasitize a variety of hosts, such as annelids, crabs, crayfish, fish, frogs,
reptiles, aquatic birds, cows, monkeys, horses, elephants, as well as humans (Klemm
1972; Sawyer 1986; Mulcahy et a1 1990; Greenblatt et a1 2004; Hemmingsen et al 2005).
Leeches periodically attach themselves to a host and gain their nourishment from feeding
on blood and body fluids. With the assistance of an oral and caudal sucker, leeches
attach themselves to a host and secrete an anticoagulant, which allows the blood to flow
more freely (Sawyer 1986).

Leeches can be temporary parasites, detaching from a host and reattaching to
another host, or permanent parasites, staying attached to the host for the lifetime of the
leech (Sawyer 1986). Leeches with intermittent parasitism can act as a vector for
pathogens and inflict damage in their host due to their movement and nature of feeding,
thereby facilitating the entry of opportunistic pathogens (Burreson 1982; Ahne 1985;
Kruse et a1 1989; Mulcahy et al 1990; Greenblatt et al 2004; Burreson 2006; Raffel et al
2006)

By acting as prey and predator, leeches play an important role in the food chain

and can alter its dynamics. Also, due to their abundance and distribution, leeches have

1

been used as bioindicators for the presence of pollutants, such as polychlorinated
biphenyls (PCBs) (Scrimgeour et al 1998; McCreanor et a1 2008). It has also been shown
that they can have similar, if not higher, levels of contaminants compared to the more
often used sentinel fish species.

In a freshwater habitat, there are different physical, chemical, and biological
parameters that determine if leeches will be present, such as the availability of susceptible
hosts, type of substrate, depth and size of water body, water hardness, pH, and
temperature, dissolved oxygen levels, turbidity and salinity (Sawyer 1986; Klemm 1991).
Leeches are typically found in shallower, lentic waters with submerged vegetation; a
solid substrate is preferred, as a muddy or sandy substrate will restrict their movement
(Sawyer 1986; Klemm 1991). Leeches can have a wide range of tolerance for factors
such as pH, water temperature, dissolved oxygen levels, and salinity; therefore these
factors do not have as great of an impact on the biology of the leech as the other factors.
However, the factors stated above can affect the distribution of susceptible hosts, which
will in turn affect the leeches.

Leeches can exhibit several types of elementary behavior while they are searching
for food, specifically relying on chemoreception to detect when a prey item is present.
Once they are aware of the host, the leech will crawl or swim to attach themselves. The
leech may attach itself immediately, or could explore with its oral sucker, and then may
or may not attach to the host (Sawyer 1986).

Once a leech has attached itself to a host, it then must determine if it is a suitable
host. Some species of leech are extremely host-specific, such as Actinobdella pediculata

on the freshwater drum, Aplodinotus grunm'ens (Hemingway 1908; Bur 1994), and

T heromyzon tessulatum on waterfowl (Sawyer 1986), while other species are generalists
and have a wider host range, such as Myzobdella Iugubris (Sawyer et a1 1975; Miller et al
1973; Becker and Dauble 1979; Appy and Cone 1982; Font and Tate 1994).

While leeches are similar to other annelids, they differ by having and using both
anterior (oral) and posterior (caudal) suckers, which aid in attachment, feeding, and
locomotion (Klemm 1972; Sawyer 1986). Adhesion occurs when the caudal sucker
sticks to the substrate (or host) with the aid of a mucoid secretion, typically as a holdfast
structure; suction also aids in rapid locomotion and allows for flexibility (Sawyer 1986).
When a leech is feeding, the caudal sucker acts as an anchor, sometimes embedding itself
into the tissue of the host, while permitting the oral sucker to search for a suitable feeding
site (Sawyer 1986).

Leeches are classified depending upon how their mouthparts are structured, and
are either predaceous (such as those preying on invertebrates) or haematophagous
(bloodsucking). Predaceous leeches (order Pharyngobdellida) are worm-like, lack jaws
and teeth, and swallow their prey whole (Sawyer 1986). Haematophagous leeches either
have jaws with teeth to bite the host (order Gnatbobdellida), or they have a muscular
proboscis which is inserted into the host (order Rhyncobdellida) for feeding (Sawyer
1986). Also, predaceous species are nocturnal, while haematophagous are active when
hosts are active, whether it is day or night (Klemm 1972).

Some leech species stay attached to the host for the duration of their lifetime,
while others detach and reattach to other hosts (Sawyer 1986). Temporary leeches
usually leave the host soon after taking a blood meal, while semi-permanent leeches

remain on the fish and take successive blood meals, leaving only to deposit their egg eggs

on a hard substrate, such as vegetation, rocks, or even the carapace of crustaceans
(Burreson 2006).

While there are several types of aquatic leeches that attach to a variety of aquatic
hosts, in this review of literature, I will focus on the fish leeches. Fish leeches are in the
families Glossiphonidae and Piscicolidae (Klemm 1972). They have the same general
feeding and locomotion methods as stated above. Fish leeches commonly attach to
various sites on the body of the host, including the pectoral, pelvic, dorsal, and caudal
fins, the eyes, the interior of the gill chamber, the inside of the mouth cavity, and directly
to the main body of the fish (Daniels and Sawyer 1975; Appy and Cone 1982; Noga et
al 1990; Morrison et a1 1993; Font and Tate 1994). Predators of piscicolid and
glossiphoniid leeches consist of mainly fish, birds, aquatic insects, crayfish, and other
leeches (Sawyer 1986; Young and Spelling 1986).

The distribution and taxonomy of leeches have been well documented in North
America throughout the past century (Hemingway 1908; Meyer 1940; Meyer 1946;
Branson 1961; White and Crisp 1973; Overstreet 1973; Miller et a1 1973; Paperna and
Zwemer 1974; Sawyer et a1 1975; Daniels and Sawyer 1975; Becker and Dauble 1979;
Smith and Taubert 1980; Schramm et a1 1981; Appy and Dadswell 1981; Appy and Cone
1982; Tartar and Sheridan 1984; Muzzall et al 1987; Noga et a1 1990; Woods et a1 1990;
Morrison et a1 1993; Bur 1994; Font and Tate 1994; Klemm et al 2003; Choudhury et al
2004; Ruiz-Carus et a1 2006; Wolf et al 2008). For Michigan, extensive distribution
records have been published by Klemm (1972, 1977, 1991). Klemm (1972) identified 45
leech species distributed throughout the Upper and Lower peninsulas of Michigan,

including two species of interest for this study, Myzobdella lugubris and Placobdella

montifera. The third leech species of interest for this study, Actinobdella pediculata, was
not recorded. Klemm (1972) also noted that too few specimens of fish leeches were
collected to be able to make conclusions regarding their distribution.

Later, Klemm (1977) expanded the survey of leeches to include those in the entire
Great Lakes (GL) region (defined as including the states of Illinois, Indiana, Michigan,
Minnesota, New York, Ohio, Pennsylvania, and Wisconsin, and the Canadian province,
Ontario). Placobdella montifera and M. lugubris were once again collected in Michigan
and the GL region, however A. pediculata, while collected in the GL region, was still not
found in Michigan (Klemm 1977). In his final GL comprehensive study, Klemm (1991)
discussed the current status in taxonomy and distribution of leeches in the GL region,
with the highest number of leech species recorded (40) in Michigan.

While the leeches of Michigan and the GL region have been extensively studied,
relatively few leech species have been collected from Lake St. Clair (Appy and Cone
1982). Lake St. Clair is an ecologically and economically important part of the GL
system. The economic impact due to leeches and their potential to cause damage and
transmit pathogens has not been and would be difficult to quantify, yet it is still critical to

review. This will be explored further later in the chapter.

Description of the leeches of interest in this study. Of the freshwater fish leeches
found in Michigan, a special emphasis was given to three species of leeches; namely
Actinobdella pediculata, Myzobdella lugubris, and Placobdella montifera. Described
below is general information regarding the physical description, distribution, and life

cycle for each leech. It should be noted that the annual life cycles of leeches are

extremely variable, depending on habitat, geographical location, and host biology
(Burreson 2006).

Actinobdella pediculata Hemingway, 1908 (Rhynchobdellida: Glossiphonida)
(Figure 1) has a flat, wide body, with a ventral oral sucker that is more or less fused with
the body, and is a poor swimmer (Hoffman 1999). Actinobdella pediculata is not
commonly found nationwide, occurring mainly in the Midwestern states, and mostly
inhabiting areas where its preferred host is present (Klemm 1982). As mentioned
previously, A. pediculata is host-specific for the freshwater drum, Aplodinotus grunniens,
where it usually attaches itself to the isthmus below the gill chamber, or to the inside of
the operculum (Sawyer 1986; Bur 1994). On one occasion, it was also reported attached
to the white sucker, Catostomus commersonii, in Maine (DeRoth 195 3), but has not been
recorded attached to any other species other than the freshwater drum. While not much is
known about its life history, it is believed by Sawyer (1986) to be similar to that of A.
inequiannulata. Actinobdella inequiannulata is a semi-permanent parasite of freshwater
fish, specifically catostomids, where it is commonly found feeding in the gill chamber of
its hosts (Sawyer 1986). Juvenile A. inequiannulata attach themselves to their fish host
where they fed for several months and then detach themselves to mature into adults for
reproduction (Sawyer 1986). Due to A. pediculata being a semi-permanent parasite with
specialized host specificity and attachment site, a similar life cycle to A. inequiannulata
was assumed (Sawyer 1986).

Myzobdella lugubris Leidy, 1851 (Rhynchobdellida: Piscicolida) (Figure 2) has a
cylindrical body, often divided into a narrow anterior and wider posterior region, with an

oral sucker that is clearly set off from the body, and are described as true fish leeches, as

they are almost always found attached to fish, rarely attaching to other organisms
(Hoffman 1999). Myzobdella lugubris has a very widespread distribution, as it is found
throughout freshwater and marine waters throughout North America and has a very wide
host range (Klemm 1972, 1977, 1991; Davies 1973; White and Crisp 1973; Papema and
Zwemer 1974; Daniels and Sawyer 197 5; Sawyer et a1 1975; Becker and Dauble 1979;
Appy and Dadswell 1981; Schramm et al 1981; Appy and Cone 1982; Tartar and
Sheridan 1984; Muzzall et al 1987; Woods et al 1990).

Myzobdella lugubris, also found in the marine environment, is one of the few
leech species that shares its life cycle with a fish host and a crustacean host, specifically
the blue crab, Callinectes sapidus (Daniels and Sawyer 1975). The leech is parasitic on
its fish host for most of the year, and then leaves the host to deposit its eggs on the crab
carapace (Daniels and Sawyer 1975). In freshwater habitats lacking C. sapidus, or
without other suitable crustaceans available, it is assumed that stones or other hard
substrates are used by M. Iugubris in the place of the blue crab’s carapace (Becker and
Dauble 1979). It is of interest that M. platensis also utilizes a crustacean for egg
deposition, the Bocourt swimming crab (C. bocourti) (Zara et a1 2008).

Placobdella montifera Moore, 1906 (Rhynchobdellida: Glossiphonida) (Figure 3)
is also a member of the Glossiphonidae family, but has different physical characteristics
than A. pediculata: the oral sucker is distinctly expanded, forming a discoid head, and the
dorsum has three prominent tuberculate ridges (Hoffman 1999). Placobdella montz’fera is
distributed throughout the eastern and Midwestern United States, including Arkansas,
Illinois, Indiana, Louisiana, Michigan, Minnesota, Missouri, New York, Ohio,

Pennsylvania, Texas, Wisconsin, and Ontario, where it parasitizes a variety of salmonids,

10

sunfish, catfish, and bass (Klemm 1982, 1991; Hoffman 1999; Moser et al 2006). All
Placobdella spp. are considered semi-permanent parasites, which are either parasitic to
fish, turtles, or birds (Davies and Wilkialis 1982). Little is known about the general
biology and ecology of Placobdella spp., primarily due to the fact that while they are
widespread in range, they are also relatively rare in occurrence (Davies and Wilkialis
1982). However, P. montifera has been found attached to fish that prefer deeper, cooler
water, which may reflect the ecology of this species (Szalai and Dick 1991). This leech
has also been found in the mantle cavity of freshwater clams, but it is unknown if the

leech feeds on the clam or if the leech utilizes the clam as protection (Curry 1977; Curry

and Vidrine 1976).

Role of leeches in disease and pathogen transmission. As integral parts of the food
chain, it is important to understand how leeches affect their hosts. Histological studies of
leech attachment sites on fish have shown that their invasive method of attachment
causes an extensive inflammatory response; displacement, erosion, and thickening of the
dermis; hyperplasia and erosion of the epithelium; focal and widespread hemorrhages
with clot formations; edema with mononuclear cells; and necrotic tissue (Papema and
Zwemer 1974; Appy and Cone 1982; Roubal 1986; Volonterio et a1 2004). Recorded
gross signs of damage caused to fish hosts have included: emaciation, bleeding ulcers,
necrotic patches, inflammation, erosion of the epithelium, hemorrhage, and swelling
(Papema and Zwemer 1974; Appy and Cone 1982; Roubal 1986; Noga et al 1990). Due
to the energy requirements of some leeches, it has also been shown that they are capable

of stunting the growth of fish as well (Mace and Davis 1972).

11

Noga et a1. (1990) found the leech Myzobdella lugubris associated with large
ulcerations on the tongue and in the buccal cavity of largemouth bass, Micropterus
salmoides, as well as small focal erosions and large, light-red ulcerations extending into
the underlying musculature. Bacteria were also isolated from these lesions (Bacillus sp.,
Pseudomonasfluorescens, P. putrefaciens, and Staphylococcus hemolyticus), but there
was not a predominant species (Noga et a1 1990). This shows that not only do leeches
cause damage to their hosts, but also their presence is associated with bacterial
colonization.

In addition to the damage to the underlying musculature caused by leeches, they
are also known as vectors for several pathogens and have been found associated with
bacteria, trypanosome blood parasites, and viruses. For example, Kikuchi and Fukatsu
(2005) found a Rickettsia spp. infection in the leeches Torix tagoi, T. tukubana, and
Hemiclepsis marginata. Rickettsia sp. is a known pathogen that seriously affects many
fish species (Cusack et al 2002). It has also been found that leeches which fed on
infected fish contained Aeromonas spp. and Pseudomonas spp. in their digestive tracks
(Snieszko and Bullock 1968). Additionally, leeches are known to disperse A. hydrophila
from host to host (Negele 1975). The earlier studies of Dombrowski (1952)
demonstrated that Piscicola geometra can transmit Pseudomonas punctata to carp. As
well as potentially transmitting bacterial pathogens from fish to fish, leeches can cause
bacterial infections in immuno-comprised human patients when utilizing medicinal

leeches to assist with venous congestion after surgeries (Silver et a1 2007; Laufer et a1

2008)

12

In addition to bacteria, leeches are well known to transmit haematozoans among
hosts. T rypanoplasma atraria was found in the gut of the leech Piscicola salmositica, as
well as in the Utah chub, Gila atraria, redside Shiner, Richardsonius balteatus, and
speckled dace, Rhinichthys osculus (Cranney and Heckmann 1996). Burreson (1982)
found T. bullocki present in the proboscis sheath of the leech Calliobdella vivida, which,
in a laboratory experiment, then infected the hogchoker, Trinectes maculatus. Also,
Trypanosoma punctati was recovered from the green snakehead, Channa punctatus, as
well as its leech vector, Hemiclepsis marginata (Shanavas 1991). The leech Johanssonia
arctica is a known vector for T rypanosoma murmanensis, which was found in Atlantic
cod, Gadus morhua (Hemmingsen et a1 2005).

Furthermore, leeches are vectors for viral pathogens. Greenblatt et a1. (2004)
reported that the fibropapilloma-associated turtle herpesvirus (FPTHV) was found within
the marine turtle leech Ozobranchus spp. at high viral DNA loads. In the same context,
the fish leech Piscicola geometra is known as a vector for the Spring Viraemia of Carp
virus (SVCV) and was experimentally shown to transmit the pathogen mechanically from
infected to non-infected carp (Ahne 1985). Also, the fish leech P. salmositica was found
to be a vector for the Infectious Hematopoietic Necrosis virus (IHNV) in the sockeye
salmon, Oncorhynchus nerka, where it was also suggested that the virus could be
replicating within the leech itself (Mulcahy et a1 1990).

Many animals that gain nourishment primarily through feeding on the blood of
vertebrates possess symbiotic microorganisms, such as bacteria. Their roles are not
clearly defined, but it is speculated that the symbionts can provide essential nutrients, aid

in energy balance and digestion, or produce antibiotics to prevent the growth of

13

contaminant bacteria (Kikuchi and Fukatsu 2002; Kikuchi and Graf 2007). It is critically
important to understand the structure of bacterial communities within blood-sucking
leeches in order to recognize the relationship between leeches and their symbionts, as
well as the potential role of leeches in transmitting bacterial pathogens.

Studies regarding leeches and their endosymbiotic bacteria have mainly pertained
to the aquatic European medicinal leeches, Hirudo spp, and less often, the North
American medicinal leech, Macrobdella decora. Hirudo spp. are of particular interest
due to their ability to secrete anticoagulants, and therefore has been widely used to treat
venous congestion complications following surgical procedures in humans (Sawyer 1986;
Silver et al 2007).

European medicinal leeches are comprised of three species: H. medicinalis, H.
orientalis, and H. verbana (Siddall et a1 2007). It has been documented that H
medicinalis contains Aeromonas veronii Biovar sobria and A. hydrophr'lia within its
digestive tract, although A. veronii was the dominant culturable bacteria (Graf 1999), H.
orientalis harbors two Aeromonas spp., A. veronii and A. jandaer' within the digestive
tract (Laufer et a1 2008), and similarly, H. verbana contains A. veronii and a Rikenella-
like bacterium in the crop (Silver et a1 2007). All of these bacteria are facultative
pathogens. In addition, the North American medicinal leech, M. decora, harbors A.
jandaei within its crop, suggesting there is a consistency among leech species in
harboring motile Aeromonas spp., regardless of their geographical distribution (Siddall et
al 2007). It has been reported that in human post-operative patients treated with Hirudo
spp., infection with Aeromonas spp. can occur (Silver et a1 2007; Laufer et al 2008).

Aeromonas spp. has also been implicated in causing septicemia, wound infections, and

14

diarrhea in humans (Janda and Abbott 1998). In addition, A. hydrophilia is a common
and dangerous pathogen involved in heavy mortalities in farmed and wild fish
(Harikrishnan and Balasundaram 2005).

While there has been significant research regarding the bacterial community
structure of medicinal leeches, there is still much to learn regarding glossiphoniid and
piscicolid leeches. As of present, there is one report of endosymbiotic bacteria within the
esophageal organ of two glossiphoniid leeches, Placobdelloides siamensis and
Parabdella sp. (Kikuchi and Fukatsu 2002), which are parasitic on turtles and crocodiles
(Hoffman 1999). After molecular analysis, a single dominant bacterial species, which
showed an 89% similarity to Buchnera aphidicola, the primary endosymbiont of aphids,
was detected (Kikuchi and Fukatsu 2002). The biological function of the B. aphidicola is
currently unknown; however it is possible that they provide the leech host with vitamins,
as they do in their arthropod counterparts (Kikuchi and Fukatsu 2002). Piscicolid leeches
are more widespread than glossiphoniid leeches; however, their bacterial communities

are currently unknown.

The Great Lakes basin and Lake Erie Watershed background information. The
Great Lakes comprises approximately 18% of all the freshwater in the world and
provides an ecosystem for a variety of aquatic organisms, including 179 species of fish,
several species of waterfowl, and aquatic mammals (United States Environmental
Protection Agency 2006; Coon 1999). The GL are also heavily used in shipping,
recreational and commercial fishing, and recreational boating. In the Great Lakes,

Canadian, US, and tribal commercial and recreational fishermen compete for popular

15

yellow perch, walleye, lake trout, and salmonid fisheries (Brown et al 1999). In 2006,
recreational fishermen spent $US 1.5 billion on their total hip and equipment
expenditures for fishing on the GL, including food, lodging, guides, bait, and special
equipment (United States Department of the Interior 2006). Commercial shipping vessels
regularly transport iron ore, coal, and grain throughout the GL and into the Atlantic
Ocean (United States Environmental Protection Agency 2006).

Within the GL system, the Lake Erie watershed contains Lake Erie (LE) and Lake
St. Clair (LSC). Both lakes are greatly utilized, particularly in recreational activities.
Lake Erie (Figure 4), the shallowest of the GL, is surrounded by the states Michigan,
New York, Ohio, Pennsylvania, and the province of Ontario (United States
Environmental Protection Agency 2006). The western portion of LE is connected to
Lake Huron, via LSC and the Detroit and St. Clair rivers, and is connected to Lake
Ontario by way of the Welland Canal and Niagra Falls (United States Environmental
Protection Agency 2006). It also has an active commercial and recreational fishery.

Lake St. Clair is located between southeastern Michigan and southwestern
Ontario and connects Lake Huron to Lake Erie via the St. Clair and Detroit Rivers
(Figure 4). The lake is critical to the GL shipping industry and is also a very popular
recreational lake (Michigan Department of Environmental Quality 1999). Currently, the
most commonly exploited species include the muskellunge (Esox masquinongy),
smallmouth bass (Micropterus dolomieu), yellow perch (Percaflavescens), and walleye
(Sander vitreus) (MacLennan et al 2003; Thomas and Haas 2004). According to the
Michigan Department of Environmental Quality (1999), the annual value of the sport

fishery of the Michigan section of LSC was US $ 30 million and is expected to have

16

increased over the decade. In brief, recreation in LSC has significant socioeconomic
benefits, therefore there is an increasing concern of any factor that may negatively affect

the fishing industry or disturb the health of its fragile ecosystem.

Diseases of Great Lakes fish species. Over the last five decades, a number of diseases
have been incriminated of devastating a number of native and introduced GL fish species
(Faisal et al 2007; Faisal and Hnath 2005). Infectious agents, such as bacteria and
viruses, cause many of these diseases. Among these, bacteria such as Renibacterium
salmonarium, the causative agent of Bacterial Kidney Disease, is widespread in GL free
ranging, and confined, salmonid stocks (Beyerle and Hnath 2002; Faisal and Hnath
2005). Furunculosis, which is caused by Aeromonas salmonicida, is another disease that
also ravages salmonids in the GL basin (Cipriano et al 1996; Faisal and Hnath 2005).
The bacteria F lavobacterium spp. is known to cause Bacterial Coldwater Disease,
Bacterial Gill Disease, and Columnaris, which can cause mortalities in a wide range of
fish species (Faisal and Hnath 2005). Piscirickettsia-like infections have caused raised
ulcers, edema, and degenerative kidneys in muskellunge, Esox masquinongy, in the GL as
well (Faisal and Hnath 2005).

In addition to the bacterial diseases that distress the fish populations of the GL,
many viral pathogens also cause harm. The Largemouth Bass virus has caused massive
mortalities among fish from several inland lakes in southern Michigan (Faisal and Hnath
2005). The Infectious Pancreatic Necrosis virus has been isolated from within hatchery-
raised trout and salmon, specifically the Coho salmon, Oncorhynchus kisutch, which can

cause up to 90% mortality rates in hatchery-raised fish, as well as melanosis and

17

distended abdomens (Beyerle and Hnath 2002; OIE 2006). Garver et al. (2007) reported
the presence of the Spring Viraemia of Carp virus in wild common carp in Lake Ontario,
which can cause acute hemorrhages and death and is a highly contagious disease. The
Lymphocystis Disease virus causes hypertrophy of connective tissue cells and is
commonly found in walleye populations in the GL (Schneeberger 2000; Muzzall and
Haas 1998). Recently, the lethal Viral Hemorrhagic Septicemia virus has invaded the GL
and caused widespread mortalities in several fish species, including the recreationally
important muskellunge (Elsayed et al 2006b).

Along with bacterial and viral pathogens, various parasites are known to
negatively affect fish health and in some extreme cases, can result in death. A protozoan,
such as Myxobolus cerebralz’s, the causative agent of Whirling Disease, has been found in
several trout and salmon species in Michigan hatcheries (Beyerle and Hnath 2002).
Larval cysts and adult parasitic worms of common cestodes, trematodes, and nematodes
in the GL can be found to parasitize various organs, such as the intestine, stomach, or
swim bladder, and are also found throughout the musculature of the fish (Hoffman 1999),
causing erratic behavior that can result in predation, or in mortalities (Muzzall et a1 2003;
Torres et al 2002; Lafferty and Morris 1996).

Despite the increasing number of emerging and resurging fish diseases in the
Great Lakes, very little is known about their ecology, including their mode of
transmission, disease dynamics, subclinical carrier status, and pathogen reservoir. In
general, pathogens can be transmitted vertically, from parent to offspring, or horizontally,
from one organism to the other, either directly or indirectly via a vector (McCallum et a1

2001; Begon et al 2002). Pathogens can be transmitted through the medium in which the

18

organism lives, such as water or air, or they can be transmitted by a vector (McCallum et
al 2001). Commonly known vectors for disease include the mosquito, Anopheles spp.,
the vector for malaria, and the blacklegged tick, Ixodes dammim', the vector for Lyme _
disease (Phillips 2001; Magnarelli and Anderson 1988). Other parasites, such as Argulus
foliaceus, are intermittent and can act as vectors for fish pathogenic viruses (Ahne 1985).

It has long been known that many organisms, such as fish, shorebirds, and
mollusks, are integral in the life cycles of parasites (Roberts and Janovy 2005). For
example, the tapeworm Diphyllobothrium latum utilizes a copepod and fish intermediate
host in its life cycle to find its way to the final host, fish-eating mammals (Roberts and
Janovy 2005). The bacteria Vibrio vulnificus, the causative agent of deadly
gastroenteritis in immuno-compromised humans, employs the oyster in its dissemination
(Wright et a1 1996). Other recent studies on GL fish pathogens demonstrated that macro-
parasites, such as the sea lamprey (Petromyzon marinas), can harbor salmonid pathogens
in their bodies, such as Renibacterium salmonarium, which is the causative agent of
Bacterial Kidney disease, as discussed previously (Eissa et a1 2006), F lavobacterium
psychrophilium (Elsayed et al 2006b), and Aeromonas salmonicida (Faisal et al 2007),
which are the causative agents of Coldwater disease and F urunculosis, respectively.

While it has not been shown that leeches are vectors for viral pathogens in the
GL, they could become vectors for new viruses introduced to the LSC system. There are
numerous ways that exotic organisms are introduced to the Great Lakes ecosystem. Mills
et al. (1993) outlines several methods, including unintentional releases, ship-related

introductions, deliberate releases, entry through or along canals, and movement along

19

railroads and highways. It is still unknown as to how a new virus, the Viral
Hemorrhagic Septicemia virus (V HSV), has arrived into the Great Lakes.

Viral Hemorrhagic Septicemia is a viral fish disease that has caused large-scale
mortalities in Europe and the North American Pacific Coast (Meyers and Winton 1995;
Skall et a1 2005; Raja—Halli et al 2006). It made its first appearance in the Great Lakes in
muskellunge in LSC in 2003 (Elsayed et al 2006b). Viral Hemorrhagic Septicemia has
been implicated in several Great Lakes mass fish kills, including freshwater drum
(Lumsden et a1 2007) and round gobies (Groocock et a1 2007) in Lake Ontario. Fish
infected with the virus can exhibit no external signs, or can exhibit signs of petechiae or
large patches of hemorrhaging on the skin (Elsayed et al 2006b). Infected organs are
often congested with multiple hemorrhages in the kidney, liver, spleen, and intestines
with fluid-filled vesicles attached to the internal membrane of the swim bladder (Elsayed
et al 2006b).

The virus has been isolated from LSC muskellunge and Lake Ontario freshwater
drum, as well as mummichog (F undulus heteroclitus), three-spine stickleback
(Gasterosteus aculeatus aculeatus), striped bass (Morone saxatilis), and brown trout
(Salmo trutta) in eastern Canada (Elsayed et al 2006b; Gagné et a1 2007; Groocock et al
2007; Lumsden et al 2007). Leeches have been found attached to muskellunge,
freshwater drum, and walleye in LSC (Schulz 2008, unpublished data). Therefore, it is
possible that leeches could transmit the VHSV from fish to fish, as previously reported

by Ahne with the SVCV (1985).

20

 

 

 

 

Figure l. Actinobdella pediculata (Rhynchobdellida: Glossiphonida) has a flat, wide

body, with a ventral oral sucker, more or less fused or continuous with the body, not
distinctly expanded or set off from the body by a narrow neck (a); a caudal sucker
separated from the body on a distinct pedicel with the rim of the caudal sucker thick

and bulbous, without digitate processes (b); and one pair of eyes (c).

21

 

 

 

Figure 2. Myzobdella lugubris (Rhynchobdellida: Piscicolida) has a cylindrical body,

often divided into a narrow anterior (a) and wider posterior region (b), with an oral

sucker that is clearly set off from the body (c).

22

 

 

 

 

Figure 3. Placobdella montr'fera (Rhynchobdellida: Glossiphonida) has a flat body
much wider than the head region; a ventral oral sucker distinctly expanded to form
a discoid head, set off from the body by a narrow neck constriction (a); one pair of

eyes (b); and a dorsum with 3 prominent tuberculate keels or ridges (c).

23

 

   
 
 
    
 
  

Lake t;
. uro ' Welland Canal 27 v . Buffalo
ONTARIO
~ K St. Clair
MICHIGAN ’ River
Detroit . A NEW YORK
Detroit /
River '-
I
Toledo ' PENNSYLVANIA N
A
. Cleveland I
OHIO I

 

 

 

Figure 4. The Lake Erie Watershed, surrounded by the states Michigan, New York,
Ohio, and Pennsylvania, and the Canadian province of Ontario, is connected in the
east to Lake Ontario by the Welland canal and in the west to Lake Huron via the
Detroit River, Lake St. Clair, and the St. Clair River. The four-pointed black star
denotes the sampling location of the Michigan Department of Natural Resources
trap nets (42°37 '54.60"N, 82°45'54.60l'W) in Anchor Bay, Lake St. Clair. The five-
pointed black star denotes the commercial fishing trap nets (41°46'00.74"N,

83°24'58.09"W) in Lake Erie from which leeches were collected during this study.

24

CHAPTER TWO

LEECHES PARASITIZING FISH SPECIES IN LAKE ST. CLAIR, MICHIGAN AND

THE POTENTIAL IMPACT ON THE FISH HOSTS

ABSTRACT

Three species of leeches were found parasitizing fish species from Lake St. Clair,
Michigan, within the Lake Erie Watershed in the Great Lakes Basin. Actinobdella
pediculata, Myzobdella lugubris, and Placobdella montifera, identified based on
morphological keys, were attached to channel catfish, freshwater drum, northern pike,
northern shorthead redhorse sucker, quillback sucker, rock bass, smallmouth bass,
walleye, and yellow perch. This is the first report of the northern shorthead redhorse
sucker as a host for A. pediculata, which is highly host-specific for the freshwater drum.
The freshwater drum had the highest prevalence (36.21%), mean intensity (12.70
leeches/fish), and abundance (4.60 leeches/fish) compared to the other host species.
Leeches were found attached to the pectoral fin, pelvic fin, caudal fin, anal fin, adipose
fin, barbel cavity, body of the fish, dorsal fin, eye, gill cavity, and isthmus region. The
preferred attachment site of all leeches was the pectoral fins at 38.16%; however,
variation occurred among A. pediculata (gill chamber, 90.0%), P. montzfera (body of the
fish, 60.0%), and M. lugubris (pectoral fins, 41.37%). Gross examination of attachment
sites revealed necrotic and hemorrhagic patches near the attachment site, severe nodular

swelling of the tissue, and a heavy infestation of leeches. Lesions associated with leech

25

attachment varied in size displayed hemorrhagic margins. Histological examination
revealed necrosis and expansion of muscle and dermal layers, infiltration of

macrophages, lymphocytes, and heterophils, hemorrhaging and subcutaneous edema.

26

INTRODUCTION

Leeches (Annelida: Hirudinea) are parasites known to cause physical damage to
their hosts (Appy and Cone 1982; Roubal 1986; Kruse et al 1989; Noga et a1 1990;
Volonterio et al 2004). Leeches feed on blood and body fluids, thereby depriving their
hosts of important nutrients (Sawyer 1986), while also transmitting trypanosomes (Lewis
and Ball 1980; Kruse et a1 1989) bacteria (Kikuchi and F ukatsu 2005), fungi (Raffel et al
2006), and viruses (Greenblatt et al 2004; Mulcahy et al 1990; Ahne 1985).

Leeches exhibit a marked diversity and host range as they parasitize on hosts such
as annelids, crabs, crayfish, fish, frogs, reptiles, aquatic birds, cows, monkeys, horses,
and elephants, as well as humans (Klemm 1972; Sawyer 1986; Mulcahy et a1 1990;
Greenblatt et al 2004; Hemmingsen et al 2005). Due to their abundance and distribution,
leeches have also been used as bioindicators for pollution (Scrimgeour et a1 1998;
McCreanor et al 2008). Their ability to have similar, if not higher, levels of contaminants
compared to the more often used bioindicators, such as fish, makes them a valuable
resource for determining the ecological health of an ecosystem (Scrimgeour et a1 1998;
McCreanor et a1 2008). Despite their widespread distribution in North America, little is
known about leech biology and their impact on fisheries in the Great Lakes Basin (GLB).

The GLB is one of the most important waterbodies of the world and is home for
159 species of fish (Coon 1999). Lake St. Clair (LSC), which is a major lake within the
Lake Erie Watershed and GLB, is a popular recreational lake that also has a diverse fish
community. Lake St. Clair is the shallowest lake of the GL system, with a maximum

natural depth of 6.4 m and shallow sandbars offshore of the littoral zone, which can

27

increase the density of macrophytes, thereby influencing the abundance of fish
congregating in the shallowest portions of the lake (MacLennan et a1 2003).

Leeches are typically found in shallower, lentic waters with submerged vegetation
(Sawyer 1986; Klemm 1991), thus the abundance of fish in LSC is ideal for supporting
leeches. Lake St. Clair is greatly utilized, particularly in recreational activities; therefore
there is an increasing concern of factors that may disturb the health of its fragile
ecosystem. Existing reports on leeches parasitizing fish of the GL (Klemm 1972, 1977,
1982, 1991) primarily focus on the anatomy and spatial distribution of leeches, and not
their preference for host species and attachment site. The only record of leeches
collected from LSC was Myzobdella lugubris and Piscicola reducta attached to logperch,
Percina caproa'es, and brown bullhead, Ictalurus nebulosus (Appy and Cone 1982).

Herein I report on the leeches parasitizing important LSC fish species; the
preference of the leeches for different fish species and for different attachment sites on

the fish; and the impact of the damage caused to the hosts.

28

MATERIALS AND METHODS

Study area description. Lake St. Clair is located in southeastern Michigan, and
connects Lakes Huron and Eric via the St. Clair River and Detroit River (Figure 4). It is
38.6 km wide and 41.8 km long with a surface area of 1,100 km2 (MacLennan et al
2003). As stated above, LSC is shallow compared to the GL with an average depth of 3.0
m, a maximum natural depth of 6.4 m, except for the shipping lanes, which have a
maximum dredged depth of 8.0 m (MacLennan et a1 2003). The fish community consists
of a diverse mixture of wannwater and coolwater species (MacLennan et a1 2003;

Thomas and Haas 2004).

Fish and leech sampling. Fish were collected during May of 2006 and 2007 in five
adjacent trap nets located in Anchor Bay, Lake St. Clair by the Michigan Department of
Natural Resources (42°37'54.60"N, 82°45'54.60"W) (Figure 4). While there can be
variation in the occurrence of size and number of leeches depending on the time of year,
this study was conducted during May due to sampling constraints. The fish species
caught in this study, as well as the specific location in Anchor Bay, are considered to be
representative of the entire fish population in LSC. These locations were selected for this
study due to the abundance and variety of fish species present, as well as their
accessibility by the research vessel Channel Cat of the Mt. Clemens Fisheries Research
Station, Michigan, which was made available by the Michigan Department of Natural
Resources for this study. The trap nets had 1.8 m deep pots of 5.1 cm stretch mesh, 7.6

cm stretch mesh hearts and wings, and 91.4 m long leads of 10.2 cm stretch mesh.

29

Fish were removed from the nets at 48-72 h intervals and examined for the
presence of leeches. The attachment sites were recorded for each fish and leeches were
separated into vials containing lake water according to the fish number and attachment
site. Fish length, weight, species, and capture location were also recorded for each fish
from which leeches were collected. Afier collecting the leeches, the fish was released
into the lake, unless needed for other investigations.

Twenty-one species of fish were examined for leeches, including the bluegill
(Lepomis macrochirus), carp (Cyprinus carpio), channel catfish (Ictalurus punctatus),
common white sucker (Catostomus commersonii), freshwater drum (Aplodinotus
grunniens), gizzard shad (Dorosoma cepedianum), golden redhorse sucker (Moxostoma
erythrurum), lake sturgeon (Acipenserfirlvescens), largemouth bass (Micropterus
salmoides), muskellunge (Esox masquinongy), northern pike (E. lucius), northern
shorthead redhorse sucker (Moxostoma macrolepidotum), pumpkinseed sunfish (Lepomis
gibbosus), quillback sucker (Carpiodes cyprinus), rock bass (Ambloplites rupestris),
smallmouth bass (Micropterus dolomieu), silver redhorse sucker (Moxostoma anisurum),
walleye (Sander vitreus), white bass (Morone chrysops), white perch (M. americana),
and yellow perch (Percaflavescens). The species and number of fish collected, as well
as the number of infected fish, number of leeches, and mean weight and length for each
fish species are listed in Table 1.

Data for this study is expressed as prevalence, mean intensity, and abundance.
Prevalence is calculated by dividing the number of infected fish by the number of all fish
examined and is reported as a percent. Mean intensity is calculated by dividing the total

number of leeches in one species of fish by the number of infected fish of the same

30

species. Abundance is calculated by dividing the total number of leeches from one
species of fish by the total number of fish examined (Bush et a1 1997). The proportion of
leeches is used to determine leech preference for different attachment sites, where
proportion is calculated by dividing the number of leeches present at an attachment site
by the total number of leeches collected in the study. Proportion is also used to calculate
the leech preference for attachment sites based on the three specific leech species in this
study. It is noteworthy that prevalence, mean intensity, and abundance located in Table 1

pertain only to the fish species from which the leeches were obtained.

Leech identification. Leeches are very muscular; therefore they were relaxed before
preservation as recommended by Klemm (1982). Initially, two methods were compared
for leech relaxation and fixation. In the first method, live leeches were placed in a Petri
dish with 95% ethanol added dropwise until movement stopped. If the leech did not
respond to physical stimuli, it was then fixed in 5% buffered formalin (J .T. Baker,
Phillipsburg, NJ) for 24 hours, and then preserved indefinitely in 70% ethanol (Madill
1983). The second method was that described by Pritchard and Kruse (1982), which
uses menthol crystals for relaxation. A Petri dish was partially filled 50% with lake
water, to which menthol crystals (5-methyl-2-[1-methyl-ethyl] cyclohexanol, Sigma-
Aldrich, St. Louis, M0) were added until the surface of the water was covered with the
crystals. Alive leeches were then placed in the dish for 24 hours, after which the mucous
was removed with paper towel, and then preserved in 70% EtOH (Pritchard and Kruse
1982). The first 100 leeches collected in this study were used in the relaxation method

comparison above, with 50 leeches used for the first method and 50 leeches used for the

31

second method. The method of Pritchard and Kruse (1982) was found to be more
effective, therefore it was used to relax the remaining leeches of the study reported here.
Taxonomic identification of leeches followed primarily the dichotomous keys of
Peckarsky et al (1990), while the original publications of Hoffman (1999) and Pennak
(1989) were also used for validation to ensure accuracy of identification.

A representative specimen of each leech species was stained for further
identification. Relaxed leeches passed through descending strengths of ethanol (70%,
50%, and 35%), a single stage of distilled water, and then stained with Mayer’s
hematoxylin stain (Sigma), each immersion lasting 15-30 min, depending on the size of
the leech. Once the leech was stained, it was dehydrated through ascending stages of
ethanol immersion (85%, 95%, and 100%), once again lasting 15-30 min depending on
the size of the leech, and lastly, cleared by xylene (J .T. Baker). Cleared leeches were
mounted on slides in Canada balsam (Sigma) for microscopic examination (Pritchard and

Kruse 1982).

Assessment of fish damage caused by leeches. Lesions on fish caused by leech
attachment were described and recorded. In the case of freshwater drum parasitized by
Actinobdella pediculata, samples were taken from the gill musculature attachment sites
and were preserved in 10% buffered formalin (J .T. Baker). The fixed samples were then
embedded within paraffin, sectioned at 5 pm, and stained with hematoxylin and eosin

according to the methods detailed in Prophet (1992).

32

Statistical analyses. Data on prevalence, intensity and abundance was tested for
normality. If not normally distributed, the Kruskal-Wallis one way analysis of variance
(ANOVA) on Ranks was performed. All pairwise multiple comparisons were performed
according to Dunn’s Method. In the instance where only two groups were compared, the
Mann-Whitney Rank Sum Test was performed. All calculations were performed with the
help of SigmaStat 3.0® (San Jose, CA). Analyses also included comparisons among the

sites of leech attachment.

33

RESULTS

Leech identification. Along the course of this study, three leech species were found
attached to the examined fish. The leeches were identified as Actinobdella pediculata
Hemingway, 1908 (Rhynchobdellidae: Glossiphonidae), Myzobdella lugubris Leidy,
1851 (Rhynchobdellidae: Piscicolidae), and Placobdella montifera Moore, 1906
(Rhynchobdellidae: Glossiphonidae) with the help of taxonomic criteria outlined in
Peckarsky et a1 (1990) and Hoffman (1999). The proportion of the leech population in
Lake St. Clair was not equally distributed, with M. lugubris occurring at 92.01%,
followed by A. pediculata at 7.52% and P. montifera at 0.47% (Figure 5).

Leeches identified as Actinobdella pediculata had a mouth with a small pore in
the oral sucker through which a muscular proboscis was protruded; a flat body much
wider than the head region; an oral sucker ventral and more or less fused or continuous
with the body, not distinctly expanded or set off from the body by a narrow neck; a
caudal sucker separated from the body on a distinct pedicel with the rim of the caudal
sucker thick and bulbous, without digitate processes; one pair of eyes separated by less
than the diameter of one eye, without accessory eyes; a dorsum without white patches
and a white ring in neck region. These morphological criteria coincide with those
described by Peckarsky et al (1990). The leech was found parasitizing on the freshwater
drum; however, it was also found on two northern shorthead redhorse suckers.

Myzobdella lugubris had a mouth with a small pore in the oral sucker through
which a muscular proboscis was protruded; a cylindrical and narrow body often divided

into a narrow anterior region and a wider posterior region; and a concave, weakly

34

developed caudal sucker, which was narrower than the widest part of the body. All
leeches identified as Placobdella montifera had a mouth with a small pore in the oral
sucker through which a muscular proboscis was protruded; a flat body much wider than
the head region; an oral sucker ventral and distinctly expanded to form a discoid head, set
off from the body by a narrow neck constriction; one pair of eyes; a dorsum with 3
prominent tuberculate keels or ridges; and parasitic on fish. These morphological criteria

also corresponded with the descriptions in Peckarsky et al (1990).

Leech prevalence, intensity, and abundance. Of the 2,117 fish examined, 165
individual fish were found with leeches attached, with a prevalence of 7.79% of
examined fish being infected with leeches. The leeches were attached to nine of the 21
fish species examined (Table 1). The infected fish species were channel catfish,
freshwater drum, northern pike, northern shorthead redhorse Sucker, quillback sucker,
rock bass, smallmouth bass, walleye, and yellow perch. The prevalence of leeches,
however, varied greatly among fish species (P<0.001). The freshwater drum exhibited
the highest prevalence (36.21%) of attached leeches, followed by the channel catfish
(24.44%), yellow perch (13.89%), and walleye (12.24%, Table 1).

Statistical analysis indicated that, while there were no significant differences
between the freshwater drum and channel catfish in terms of leech prevalence, both
species had a higher prevalence than all other fish species examined (P3005). No
significant differences were observed among the Northern pike, quillback sucker, rock
bass, smallmouth bass, and Northern shorthead redhorse in leech prevalence, which

ranged between 2.68-4.84%. Myzobdella lugubris preferred the freshwater drum as a

35

host, with a prevalence of 32.76% (Table 3); however, this was not significantly different
from the channel catfish or yellow perch. There were significant differences in M
Iugubris prevalence between freshwater drum and walleye, quillback sucker, rock bass,
northern pike, and smallmouth bass (PS0.023). Additionally, the channel catfish was
statistically different than the northern pike, rock bass, and smalhnouth bass as a host for
M lugubris (PS0.017).

A total of 1,064 leeches were collected from 165 fish, with a mean intensity of
6.45 leeches/infected fish. The freshwater drum accounted for the highest mean intensity
(12.70 leeches/fish) and was significantly different than the other fish species (P<0.05).
The mean intensity of the walleye (5.50 leeches/fish, Table 1) and channel catfish (2.85
leeches/fish, Table l) were also statistically significant compared to other species
(P<0.05). Differences among the northern pike, quillback sucker, smallmouth bass, and
northern shorthead redhorse sucker were not statistically significant. The freshwater
drum had the highest mean intensity of Actinobdella pediculata (2.26 leeches/fish, Table
2) compared to the northern shorthead redhorse sucker (1.50 leeches/fish, Table 2), which
was significantly different (P=0.011). However, the host preference of Placobdella
montifera was not statistically significant among its host species (Table 4). The
freshwater drum also had the highest mean intensity of M lugubris (12.65 leeches/fish,
Table 3) and was statistically different than all other fish species (PS0.023), with the
exception of the channel catfish.

The overall abundance of leeches was 0.50 leeches/examined fish, regardless if it
was parasitized by leeches or not. The freshwater drum had the highest abundance of

leeches (4.60 leeches/fish) and was statistically different than all other fish species

36

(PS0.021). The abundance of leeches attached to the channel catfish (0.70 leeches/fish)
differed significantly from the northern pike, quillback sucker, rock bass, smallmouth
bass, and northern shorthead redhorse sucker (0.03-0.05 leeches/fish, Table 1, PS0.022).
As a host for A. pediculata, the freshwater drum had a higher abundance (0.44
leeches/fish) than the northern shorthead redhorse sucker (0.03 leeches/fish) and was
statistically significant as well (P=0.011). However, the difference in abundance of
leeches among the host species for P. montifera did not differ significantly (Table 4).
The freshwater drum had the highest abundance of M lugubris (4.14 leeches/fish, Table
3) and was statistically different than the other host species (0.03-0.67 leeches/fish, Table
3, PS0.024), with the exception of the channel catfish (0.70 leeches/fish, Table 3). The
channel catfish did differ significantly from the northern pike, rock bass, and smallmouth

bass (0.03-0.04 leeches, Table 3, PS0.015) as a host for M lugubris.

Leech site of attachment. Leeches were attached at various external sites of the host
(Table 5). The proportion of leeches showed that the pectoral fins were the most
common attachment sites for leeches (38.16%), followed by the pelvic (19.92%), caudal
(12.88%), and anal fins (10.43%, Table 5). Additionally, the attachment of leeches to the
pectoral fins were statistically different than all other attachments sites (PS0.043). The
proportion of leeches attached to the pelvic fins (PS0.004), anal fin (PS0.004), and caudal
fin (PS0.002) all differed significantly from the leeches attached to the less common

attachment sites, such as the barbel, body, dorsal fin, eye, gill chamber, and isthmus

(Table 5).

37

The leech Myzobdella lugubris was the most abundant leech found in this study;
therefore the specific attachment sites of M lugubris were further scrutinized. The
pectoral fins had the highest proportion of Myzobdella lugubris attached (41.37%, Table
5) and were statistically different than all other attachment sites (PS0.004), with the
exception of the caudal fin. The pelvic fins accounted for 21.45% of the proportion of M
lugubris and differed significantly from leeches attached to the barbel, body, dorsal fin,
eye, gills, and isthmus (PS0.004, Table 5). The proportion of M lugubris attached to the
caudal fin (13.79%, Table 5) also differed significantly from the aforementioned sites,
including the anal fin (PS0.001). In addition, the anal fin (11.24%, Table 5) was
statistically different than the eye, gills, and isthmus (PS0.004).

Actinobdella pediculata was predominantly attached to the gill chamber (90.0%),
and to a much lesser extent, it was attached to the trunk of the fish (3.75%), and pelvic
(2.5%), caudal (2.5%), and anal (1.25%) fins (Table 5). On the other hand, P. montifera
was primarily found on the trunk of the fish (60.0%) and to a lesser degree on the isthmus

and pectoral fins (20.0%, Table 5).

Gross and histopathological damage. Attachment of Myzobdella lugubris and
Placobdella montifera to the fins and musculature of the fish were similar, therefore M
lugubris was used as a representative leech. The size of M lugubris varied from host to
host, however there was also variation of size at individual attachment sites (Figure 6a).
Attachment of M lugubris was also associated with pathological changes in the form of
necrotic and hemorrhagic patches on fin tissue (Figure 6b). The invasive attachment of

the caudal sucker caused hemorrhages surrounding the attachment site (Figure 6c).

38

Additionally, while the intensity of leeches attached to a particular site varied from host
to host, there were a few instances that exhibited a severe infestation (Figure 6d).

Actinobdella pediculata is a semi-permanent leech, therefore it attaches as a
young leech to the gill chamber of its host, remains for the duration of its lifetime, and
then detaches itself to deposit its eggs (Sawyer 1986). The caudal sucker of the juvenile
leech was embedded into the opercular tissue as a holdfast structure to allow the oral
sucker to search for suitable feeding sites; however, the feeding behavior of A. pediculata
resulted in hemorrhagic areas surrounding the leech (Figure 7a). The attachment of A.
pediculata resulted in severe nodular swelling of the tissue; however, there was no
hemorrhage associated with it (Figure 7b).

As A. pediculata grew in size, it was more commonly found attached to the
musculature in the gill chamber, as opposed to the opercular tissue (Figure 8a). In
addition to juvenile A. pediculata, medium-sized leeches were also found associated with
hemorrhagic areas surrounding the attachment site (Figure 8b). Larger specimens of A.
pediculata were frequently attached to the gill chamber in groups of one to three leeches
(Figure 9a); however, in a few instances, if A. pediculata was extremely large, only one
specimen was found (Figure 9b). Additionally, as the size of the leech continues to grow,
it can prevent the operculum from closing entirely, making it difficult for the host to
breathe.

Once A. pediculata was removed from the gill chamber, lesions at the site of
attachment remained. The lesions varied in size, mostly dependent upon the size of A.

pediculata, and frequently had hemorrhagic margins (Figure 10a). The larger, more

39

severe sites of attachment displayed a relatively large, circular, one to two cm in
diameter, raised lesion with a hemorrhagic margin and central depression (Figure 10b).
In hematoxylin and eosin stained sections of the attachment sites, severe focal
muscle necrosis, massive expansion of the subcutis by macrophages and lymphocytes,
and infiltrates of macrophages, lymphocytes, and heterophils were observed. Healthy
muscle tissue is usually more developed and lighter in color with more defined nuclei
(Figure 11a), whereas necrotic muscle tissue is shrunken and darker in color and has less
pronounced nuclei (Figure 11b). It was also found that the necrotic areas were
surrounded by lymphocytes and macrophages, which are part of the inflammatory
response to close off and isolate the dying tissue and cells (Figure 11c). Less common
findings at the attachment sites were hemorrhaging and subcutaneous edema. Edema can
cause marked expansion to occur, as seen in the dermis layer of a leech attachment site

from a freshwater drum (Figure 11d).

40

DISCUSSION

Leech identification. The findings of this study demonstrated that the diversity of the
leech community in Lake St. Clair is very low, as it was composed of only three species.
As stated previously, there can be variation in the occurrence of size and number of
leeches depending on the time of year; however, this study was conducted during May
due to sampling constraints. One species of leech in particular, Myzobdella lugubris, was
quite dominant (92.1%) throughout this study (Figure 5). Myzobdella lugubris has a very
general distribution throughout freshwater and marine waters in North America and has a
widespread host range as well (Klemm 1972; Davies 1973; White and Crisp 1973;
Papema and Zwemer 1974; Daniels and Sawyer 1975; Sawyer et a1 1975; Klemm 1977;
Becker and Dauble 1979; Appy and Dadswell 1981; Schramm et a1 1981; Appy and Cone
1982; Tartar and Sheridan 1984; Muzzall et a1 1987; Woods et al 1990; Klemm 1991).
Due to its ability to exist in a wide range of environments, it was not unexpected for M
lugubris to be so abundant in this study.

Actinobdella pediculata is commonly found in the Midwestern states, mostly
inhabiting areas where its preferred host, the freshwater drum, is present (Klemm 1982).
It is known for having a very high host specificity for the freshwater drum (Hemingway
1908; Branson 1961; Sawyer 1972; Klemm 1982; Sawyer 1986; Bur 1994; Wolf et a1
2008); although it has also been found free-living, under a rock (Bere 1931), and on one
occasion, attached to a white sucker, Catostomus commersonii (DeRoth 1953).
Therefore, the northern shorthead redhorse sucker (n=2) is a new host record for A.

pediculata. The northern shorthead redhorse sucker has similar habitat requirements and

41

physical characteristics to the freshwater drum (Trautman 1981) and could explain the

attachment of A. pediculata.

Actinobdella pediculata (Hemingway, 1908) (Placobdella pediculata, Hemingway, 1908)
Prevalence, mean intensity, and abundance (Table 2)

Site of infection: Anal fin, body of fish posterior to anal fin

Location: Lake St. Clair, Michigan, USA.

New Host: Northern shorthead redhorse sucker (Moxostoma macrolepidotum)

Other reported hosts: Freshwater drum (Aplodinotus grunniens, Hemingway 1908;
Branson 1961; Sawyer 1972; Klemm 1982; Sawyer 1986; Bur 1994; Wolf et a1 2008),
white sucker (Catostomus commersonii, DeRoth 1953)

Other reported localities: Lake Ontario, Lake Erie, Lake St. Clair, Mississippi River
(Illinois), Kentucky Lake (Kentucky), North America (Illinois, Iowa, Maine, Minnesota,
Missouri, Oklahoma, Wisconsin), Lake Texoma (Oklahoma), Lake Pepin (Minnesota)

Specimen deposited: USNPC, in submittal process

Placobdella montifera was found attached to only a few individual fish and was
the least dominant leech species in this study (0.47%, Figure 5). Other studies have
indicated that P. montifera is rare in occurrence despite its generalist nature. It is found
throughout the eastern and Midwestern US, where it parasitizes a variety of salmonids,
sunfish, catfish, and bass (Harms 1960; Klemm 1982, 1991; Hoffman 1999; Moser et a1
2006). Little is known about the biology and ecology of the Placobdella spp.; however,

P. montifera has been found attached to fish that prefer deeper, cooler water (Szalai and

42

Dick 1991). In this study, P. montifera was found attached to the freshwater drum,
northern pike, northern shorthead redhorse suckers, and walleye; indicating that they

might not be restricted to only deep, cool water fish species as hosts.

Leech prevalence, intensity, and abundance. The generalist M lugubris was very
dominant in LSC fish. Despite the wide host range and high abundance, the leech was
not found on a number on species. For example, the rock bass was the most commonly
examined fish, yet it accounted for one of the lowest prevalence of attached M lugubris.
The freshwater drum was the most common host species for leeches in this study. The
feeding habits of freshwater drum consist of searching through sediment and vegetation
for aquatic invertebrates and mollusks (Moyle and Cech 2003), which is also suitable
habitat for leeches (Sawyer 1986). It is possible that, due to their habitat and feeding
behavior, bottom-feeding fish are more susceptible to leech attachment, but more
research is needed to support this.

Regarding leech prevalence, the northern pike, quillback sucker, and northern
shorthead redhorse sucker were not significantly different compared to the freshwater
drum. While the quillback sucker and northern shorthead redhorse sucker are similar in
feeding behavior and habitat requirements to the freshwater drum, fewer specimens of
northern pike, quillback sucker, and northern shorthead redhorse sucker were examined
for leeches during the study, and could explain the low prevalence of each one.

The freshwater drum had the highest prevalence of Myzobdella lugubris and it
differed significantly compared to the walleye, quillback sucker, rock bass, northern pike,

and smallmouth bass. While M lugubris is a commonly occurring leech (Davies 1973;

43

White and Crisp 1973; Papema and Zwemer 1974; Daniels and Sawyer 1975; Sawyer et
a1 1975; Becker and Dauble 1979; Tartar and Sheridan 1984; Woods et al 1990; Klemm
1991), the freshwater drum has shown in this study that it is a preferred host for leech
attachment, regardless of leech species. Therefore, it is not unexpected for the freshwater
drum to have a high prevalence of M lugubris. In addition to the freshwater drum, the
channel catfish was also preferred as a host for M lugubris, compared to the northern
pike, rock bass, and smallmouth bass. As stated previously, the channel catfish also
exists in suitable habitats for leeches, and it is not unexpected to have a high prevalence

for leech attachment.

Leech site of attachment. The distribution of leeches differed greatly by attachment
sites. The most common attachment sites were the pectoral fins, which were significantly
different than all other attachment sites. The pectoral fins are a suitable site for leech
reproduction, simple adhesion, and feeding (Sawyer 1986). They are also an area of least
water resistance, particularly the interior portion, and could provide protection and
prevent the leech from dislodging from the fish. The pectoral fins are also located near
the gills and heart, which is a site of increased blood flow, thereby possibly making it an
appealing site for feeding. Additionally, the pelvic fins, anal fin, and caudal fin were
significantly different than the less common attachment sites, the barbel, body of the fish,
dorsal fin, eye, gills, and isthmus region. The isthmus region is an eXposed surface where
leeches could easily be dislodged by the host (Rupp and Meyer 1954). The barbel, body
of the fish, dorsal fin and eye are also more exposed than the other sites, making it

possible for leeches to be easily dislodged fi‘om these sites as well.

44

The gills had a low distribution of leeches attached (7.52%, Table 5), which is
most likely because the gills are the preferred attachment site for Actinobdella pediculata,
and not the other two leech species (Sawyer 1986; Bur 1994). Therefore, while its
distribution was low among all leech species, it was the most common site of attachment
for A. pediculata (Table 5).

Due to its common occurrence in North America and this study, the attachment
sites of M lugubris were finther investigated. The pectoral fins had the highest
distribution of M lugubris and were significantly different than all other attachment sites,
with the exception of the caudal fin. As previously described, the pectoral fins are a
suitable site for reproduction, simple adhesion, and feeding and could provide protection

and prevent the leech from dislodging.

Gross and histopathological damage. Observation of gross and histopathological
damage caused to the fish hosts at attachment sites were similar to earlier findings
(Papema and Zwemer 1974; Appy and Cone 1982; Roubal 1986; Noga et a1 1990;
Woods et al 1990). Myzobdella lugubris was found attached to the freshwater drum in
high intensities (Table 1, Figure 6a). Previous studies have documented severe
infestations of M lugubris attached to the white bass, Morone saxatilis (Woods et a1
1990) and Cystobranchus virginicus attached to the white catfish, Ictalurus catus
(Papema and Zwemer 1974). In addition to these findings, circular, necrotic areas were
noted surrounding attached leech specimens (Figure 6b). Due to the consistency in size
and shape of the circular areas, it is most likely that these were previous attachment sites.

Inflammation and swelling were also associated with leech attachment (Figure 6b, 6d).

45

The location of attachment for Actinobdella pediculata seemed to vary based on
thesize of the leech. Juvenile A. pediculata were mainly found attached to the inside of
the operculum, embedded in tissue (Figure 7), where as the medium and larger adult A.
pediculata were mostly found attached to the musculature in the gill chamber (Figures 10
and 11). Juvenile A. inequiannulata, a species with a similar life history to A. pediculata,
are known to initially infest the gills, and then move on to the inside of the operculum
(Sawyer 1986). Swollen, nodular lesions were also noted in this study (Figure 7b), along
with hemorrhagic feeding sites (Figure 7a and 8b, Figure 10). Large, reddened lesions,
swelling, and hemorrhagic areas have also been associated with the attachment of leeches
in other studies (Appy and Cone 1982; Roubal 1986; Noga et al 1990). Lesions may
allow the introduction of pathogenic microorganisms into the fish, especially where the
dermal layer is missing (Appy and Cone 1982); however, more research is needed to
support this.

The histopathological results reported here are also consistent with previous
records of damage caused to fish, such as an extensive inflammatory response, focal and
widespread hemorrhages, necrotic muscle tissue, and edema, which led to expansion
(Figure 10; Papema and Zwemer 1974; Appy and Cone 1982; Roubal 1986; Volonterio
et a1 2004). Sections from the freshwater drum revealed necrotic muscle tissue, which
was surrounded by lymphocytes and macrophages (Figure 11b and c). The yellowfin
bream, Acanthopagrus australis, showed an extensive inflammatory response in the
upper palate, associated with the attachment of the marine fish leech, Austrobdella

bilobata (Roubal 1986). While the histopathological findings do not show that the

46

damage caused by the leeches is fatal, there is the potential for secondary pathogens to
gain entry to the fish host (Burreson 2006).

It is evident that three specific leech species are parasitizing fish species in the
Lake Erie Watershed, specifically Lake St. Clair, Michigan. While they were found on a
variety of hosts, the leeches showed a high prevalence for the freshwater drum as a
suitable host. The leeches also showed a high prevalence for attaching themselves to the
fins of the fish in general, specifically the pectoral fins. In addition, gross and
histopathological damage were noted, however the implications of long-term damage are

still unknown and require further research.

47

Table 1. Prevalence, intensity, and abundance of leeches parasitizing fish caught

from Lake St. Clair, Lake Erie Watershed, Michigan. (N/R = Not Recorded)

aThe freshwater drum had the highest prevalence, mean intensity, and abundance,

despite not having the greatest number of fish collected, such as the rock bassb.

48

 

 

 

2: a :5 SN am a 252
a 2...

one 31.. $2 a: a: t a 45.2
o o o o o 8 Z a 4.8 on. a o: Ea £23

0 o o o o a. 2 a a: an a o8 as 223

o c c o c on an a 2% 2.2 a 8mm 303 sconce 82%

o o c o o M: 2 a a: 8 4 2: eoasxaeé

o o o o o R 2: a 22: 2mm a 25 ow§=a§2

o o o o o m as a 3m éz map 58883

c o o o o _ 32 26mm 8&5: 83

o o o o o N am a an. o: a 22: Ease 882.2 828

o o o o o _ 2m 2: Ba cage

o o o o o 2 mm a as. 22. « o8 is; as; .5858

o o o o o om ”<2 «\z .50

o o o o o N am a Na. 2 a 2: 282m
23 m2 4 SN m 2 _ 2.2 a a2. o8 4 o; scones nuances. Eoeaz
2:. 2: w 23 w 8m «.2 a a? o: a E. was 5.5.53.5
23 m2 2. an .m 242., T... a 3:. 8 a on was v.82
Ed 2: _ e _ .4 _ «N 3. a 34 8a a 8: 3203 83:30
8.0 2: m 3:. m S _.: a 2% 2K a 8% 3a .5552
$6 can 8 Ed M: E as a 3m own a on» .2233
one 8.~ 2 an m 3 2a a 2:. 8 a 2K :22. 30:;
o; 22 2.. 3% mm 22 22 a as. 8: 4 Sam 598 3:55
so: «2.2 o8 “Sam 8 E 2: a 22. on. 4 2E 85 3328;

852:? £2.85 858. A2; 8%“.— memoo Ase Em a .325 E 8m 4 .325 8.8% a...—
522 a a 8532.— .....E a a S a 52.3 .2..— 2293 .3...

 

49

Table 2. Prevalence, intensity, and abundance for Actinobdella pediculata attached

to fish collected from Lake St. Clair, Lake Erie Watershed, Michigan.

 

 

 

Fish 5 ecies # of Fish #‘thth # of A. Prevalence Mean Abundance
p Collected P3 dicu 10' to pediculata (%) Intensity
Fresihwate' 174 34 77 19.54a 2.26a 0.44a
Northern
shorthead 112 2 3 1.79 1.50 0.03
redhorse
TOTAL 286 36 80 12.59 2.22 0.28
MEAN :1: SD 1.88 d: 0.54 0.23 d: 0.29

 

aThe prevalence, mean intensity, and abundance of leeches attached to the

freshwater drum differed significantly (P=0.011) from the northern shorthead

redhorse sucker.

50

Table 3. Prevalence, intensity, and abundance for Myzobdella lugubris attached to

fish collected from Lake St. Clair, Lake Erie Watershed, Michigan.

 

# of Fish

# of Fish with

# of M. Prevalence

Mean

 

 

FlSh specres Collected M lugubris lugubris (%) Intensity Abundance
Freshwater drum 174 57 721 32,76" 12,6531 41421
Channel catfish 135 33 94 24.44 2.85 0.70
Yellow perch 36 5 13 13.89 2.60 0.36
Walleye 147 17 98 11.56 5.76 0.67
Quillback sucker 24 1 1 4.17 1.00 0.04
Rock bass 954 31 42 3.25 1.35 0.04
Northern pike 62 2 2 3.23 1.00 0.03
Smallmouth bass 262 8 8 3.05 1.00 0.03
TOTAL 1794 154 979 8.58 6.36 0.55

MEAN 2 SD 3.53 :1: 4.03 0.75 :1: 1.40

 

aThe freshwater drum had the highest prevalence, mean intensity, and abundance

of leeches attached to it and was significantly different (P<0.005) than all other

species.

51

Table 4. Prevalence, intensity, and abundance for Placobdella montifera attached to

fish collected from Lake St. Clair, Lake Erie Watershed, Michigan.

 

 

 

Fish species # 0f FiSh #vriithiih # 0f. P' Prevalence Mean Abundance
Collected . montifera (%) lntensrty
montifera
Northern pike 62 1 l 1.61 1.00 0.02
Freshwater drum 174 2 2 1.15 1.00 0.01
Northern
shorthead 1 12 1 1 0.89 1.00 0.01
redhorse
Walleye 147 1 l 0.68 1.00 0.01
TOTAL 495 5 5 1.01 1.00 0.01
MEAN 3: SD 1.00 i 0.00 0.01 :t 0.004

 

52

Table 5. Proportion of leeches attached to a specific external attachment site based
on the total number of leeches collected in this study, as well as the individual

number of leeches collected from Actinobdella pediculata, Myzobdella lugubris, and

Placobdella montifera.

 

 

Attachment site Total A. pediculata M lugubris P. montifera
Pectoral fins 38.16%21 0% 41 .37%° 20.00%
Pelvic fins 19.92% 2.50% 21.45% 0%
Caudal fin 12.88% 2.50% 13.79% 0%
Anal fin 10.43% 1.25% 11.24% 0%
Gills 7.52% 90.00%b 0.72% 0%
Isthmus 3.76% 0% 3.98% 20.00%
Dorsal fin 3.48% 0% 3.78% 0%
Barbe] 1 .79% 0% 1 .94% 0%
Body 1.79% 3.75% 1.43% 60.00%d
Eye 0. 19% 0% 0.20% 0%
Adipose fin 0.09% 0% 0.10% 0%

 

aBased on the total number of leeches, as well as cM. lugubris, the pectoral fins had
b
the most leeches attached, whereas A. pediculata mostly attached to the gill

chamber and ('1’. montifera was mostly attached to the body of the fish.

53

 

Placobdella Actinobdella

montifera pediculata
0. 4 7% 7. 52 %

  

Myzobdella
lugubris
92. 01 %

 

 

 

Figure 5. Proportion of each leech species (Actinobdella pediculata, Myzobdella

lugubris, and Placobdella montifera) identified in the study, expressed as a percent.

54

 

 

 

 

Figure 6. Gross attachment of Myzobdella lugubris attached to various locations on

hosts: (a) the isthmus of a freshwater drum demonstrating the variation in size of M.
lugubris (arrows); (b) M. lugubris attached to the pectoral fin of a channel catfish,
surrounded by necrotic and hemorrhagic patches (arrows), which are former
feeding sites; (c) the caudal sucker of M. lugubris (arrows) embedded into the anal
fin of a northern pike, surrounded by a hemorrhagic ring; and (d) the caudal fin of

channel catfish demonstrating the a heavy infection of M. lugubris.

55

 

 

 

Figure 7. A juvenile specimen of Actinobdella pediculata attached to the interior of

the operculum of two freshwater drum, (a) the caudal sucker of A. pediculata is
embedded into the opercular tissue (black arrow), while the oral sucker left behind
multiple hemorrhagic sites of previous feeding (white arrow); and (b) the
attachment sites left behind by juvenile A. pediculata caused severe swelling

(arrows), but had no hemorrhage associated with it.

56

..Iq. A, "

' 0.. " 0..

 

 

 

 

Figure 8. As Actinobdella pediculata increases in size, the location of attachment

changes in the gill chamber of the freshwater drum, (a) the caudal sucker of A.
pediculata embedded into the musculature of the gill chamber, while the oral sucker
(arrow) searched for a suitable feeding site; and (b) the hemorrhagic feeding sites of

A. pediculata (arrow).

57

 

 

 

Figure 9. Adult Actinobdella pediculata were attached to the gill chamber of

freshwater drum in groups of 1-3 leeches, (a) two adult A. pediculata attached to the
gill chamber (arrows); and (b) whereas, if A. pediculata was large enough, only one

was attached to the gill chamber (arrow).

58

 

 

Figure 10. The gill chamber of the freshwater drum, where Actinobdella pediculata
was attached and resulted in lesions, (a) the lesions varied in size, dependent upon
the size of A. pediculata, and were frequently surrounded by a hemorrhagic ring
(arrows); and (b) the attachment site of larger specimens of A. pediculata resulted in
more severe lesions, with a hemorrhagic margin and central depression where the

caudal sucker was attached.

59

 

 

H _,.
'\
r"
t.
"“‘N’; ‘
I -... '“i‘
- - H

 

 

 

 

In."

 

Figure 11. Histopathological damage caused by Actinobdella pediculata to the
freshwater drum. Figure (a) demonstrates healthy (H) muscle tissue with
prominent nuclei (arrows) (x200, H&E), whereas (b) shows necrotic (N) muscle
tissue with less pronounced nuclei (arrow) (x200, H&E); (c) demonstrates healthy
and necrotic muscle tissue, being surrounded by lymphocytes and macrophages
(arrows), in order to engulf the dying tissue and cells (x100, H&E); and (d) shows
epidermis (E) and dermis (D) where massive expansion (arrows) has occurred due

to edema (x100, H&E).

60

CHAPTER THREE

THE POTENTIAL ROLE OF LEECHES IN THE TRANSMISSION OF VIRAL
HEMORRHAGIC SEPTICEMIA VIRUS WHSV) IN THE LAKE ERIE

WATERSHED, MICHIGAN

ABSTRACT

The leech Myzobdella lugubris is widespread in the Lake Erie Watershed,
especially Lake St. Clair, its role in pathogen transmission, is however, not fully
understood. In this same watershed, several widespread fish mortalities associated with
the Viral Hemorrhagic Septicemia virus (V HSV) were recorded. VHSV is an emerging
disease in the Great Lakes Basin that is deadly to the fish population, yet little is known
about its mode of transmission. To assess the potential role of M lugubris in VHSV
transmission, leeches were collected from Lake St. Clair and Lake Erie and pooled into
samples of five. Cell culture and polymerase chain reaction (PCR) were used for virus
isolation. Results showed that 57 of the 91 pooled leech samples were positive by cell
culture for VHSV and 66 of the 91 pooled leech samples were positive by PCR for the
VHSV. Two representative samples were sequenced for further genetic confirmation and
genotype classification. VHSV detected within M lugubris was homologous to the Great
Lakes strain of VHSV, Type IV. This is the first record of the VHSV being detected
from within a leech, specifically M lugubris, and demonstrates the potential of M.

lugubris being involved in VHSV transmission.

61

INTRODUCTION

The Viral Hemorrhagic Septicemia virus (V HSV) is a recent invader to the Great
Lakes Basin (GLB) and has been associated with mortalities in a number of fish species,
such as mummichog (F undulus heteroclitus), three-spine stickleback (Gasterosteus
aculeatus aculeatus), striped bass (Morone saxatilis), brown trout (Salmo trutta), round
goby (Neogobius melanostomus), freshwater drum (Aplodinotus grunniens), and
muskellunge (Esox masquinongy) (Elsayed et al 2006; Gagné et a1 2007; Groocock et al
2007; Lumsden et a1 2007). It has spread to four of the Great Lakes (not including Lake
Superior), as well as several inland lakes in the states surrounding the GL. Viral
hemorrhagic septicemia has been responsible for fish mortalities since 2003 in the GLB
(Elsayed et al 2006b). It has also been associated with large-scale mortalities in Europe
and the North American Pacific Coast (Meyers and Winton 1995; Raja-Halli et a1 2006;
Skall et al 2005).

While there are four known genotypes of VHSV (Types I-IV), the GL strain is a
new sub-lineage, Type IVb, and little is known about its biology and epidemiology
(Elsayed et al 2006b). Kim and Faisal (in press) have shown that the virus has a wide
host range infecting many freshwater species, although some species (e.g., muskellunge
and largemouth bass, Micropterus salmoides) are more susceptible than others. Despite
its relative rapid spread within the GLB, little is known about the modes of its
transmission.

Leeches (Annelida: Hirudinea) have a widespread distribution in the GLB

(Klemm 1972, 1977, 1991; Muzzall et al 1987; Klemm et a1 2003). In a previous study

62

(Schulz Chapter 2), leeches were found to parasitize nine out of the 21 fish species
examined from Lake St. Clair, with the highest prevalence found on the freshwater drum,
channel catfish (Ictalurus punctatus), rock bass (A mbloplites rupestris), and walleye
(Sander vitreus). The leech population in Lake St. Clair was found to be dominated by
Myzobdella lugubris, an intermittent, haematophagous feeder that is capable of causing
hemorrhagic ulcerations to underlying musculature, as well as allowing opportunistic
pathogens to gain entry (N oga et al 1990; Faisal in preparation; Schulz Chapter 2). In the
study conducted on LSC, M lugubris was especially abundant on the freshwater drum
(Chapter 2), a species that has experienced extensive VHSV-related mortalities in Lake
Ontario (Lumsden et a1 2007). This raises the concern that leeches may be playing a role
in its transmission.

There are other leech species that are known to contribute to the transmission of
fish pathogenic viruses. For example, the marine turtle leech Ozobranchus sp. has been
incriminated as a mechanical vector for fibropapilloma—associated turtle herpesvirus
(FPTHV), based on molecular diagnostic assays (Greenblatt et al 2004). The fish leech
Piscicola salmositica is a mechanical, and possibly biological, vector for the Infectious
Hematopoietic Necrosis virus in sockeye salmon, Oncorhynchus nerka (Mulcahy et al
1990). In the same context, the fish leech P. geometra has been shown to be a
mechanical vector for the Spring Viraemia of Carp virus (Ahne 1985).

In addition to being an intermittent feeder, M lugubris is a good candidate leech
to act as a vector because of its widespread distribution in North America, its wide host
range, and it has been shown to heavily infest its host (Klemm 1972; Davies 1973;

Papema and Zwemer 1974; Daniels and Sawyer 1975; Sawyer et al 1975; Klemm 1977;

63

Appy and Dadswell 1981; Appy and Cone 1982; Muzzall et al 1987; Woods et a1 1990;

Klemm 1991). Therefore, M lugubris is an ideal leech species to determine if leeches

can contribute to the spread of VHSV.

64

MATERIALS AND METHODS

Study area description. Leeches were collected from the Lake Erie Watershed, which
encompasses two major lakes in the GLB, Lake Erie (LE) and Lake St. Clair (Figure 4).
These locations were chosen because of the VHSV-associated fish mortalities that have
occurred in both lakes and the abundance of suitable leech hosts present. Lake Erie is the
smallest and shallowest of all the GL, and is located near the southeastern portion of
Michigan. It is 92 km wide and 388 km long with a surface area of 25,700 kmz. Lake
Erie has an average depth of 19 m, but can be as deep as 64 m in some areas (U SEPA
2006). Although it has declined over the past several years in Michigan, LE supports a
commercial fishery for a wide variety of fish, including, but not limited to, the channel
catfish, freshwater drum, bigmouth buffalo (Ictiobus cyprinellus), and white perch
(Morone americana) (Baldwin et al 2002). Lake Eric is the Warmest of the GL and also
very biologically active, making it a suitable environment for leeches (U SEPA 2006).
Lake St. Clair is also located in southeastern Michigan, and connects Lakes Huron
and Erie via the St. Clair and Detroit River. It is 38.6 km wide and 41.8 km long with a
surface area of 1,100 km2 (MacLennan et al 2003). Lake St. Clair is shallow compared to
the GL with an average depth of 3.0 m and a maximum natural depth of 6.4 m
(MacLennan et al 2003). The fish community consists of a diverse mixture of
warmwater and coolwater species (MacLennan et al 2003; Thomas and Haas 2004). In a

previous study, LSC was determined to have an abundant population of leeches present

(Schulz Chapter 2).

65

Leech collection. Leeches were collected on five separate dates, within the months of
May and June 2008, from trapnets in Anchor Bay, LSC (42°37'54.60"N, 82°45'54.60"W)
and the western basin of LB (41°46'00.74"N, 83°24'58.09"W) (Figure 4). While there
can be variation in the occurrence of size and number of leeches depending on the time of
year, this study was conducted during May and June due to sampling constraints. Fish
species inspected for leeches include bluegill (Lepomis macrochirus), carp (Cyprinus
carpio), channel catfish, common white sucker (Catostomus commersonii), freshwater
drum, gizzard shad (Dorosoma cepedianum), golden redhorse sucker (Moxostoma
erythrurum), lake sturgeon (Acipenserfulvescens), largemouth bass, muskellunge,
northern pike (Esox lucius), northern shorthead redhorse sucker (Moxostoma
macrolepidotum), pumpkinseed sunfish (Lepomis gibbosus), quillback sucker (Carpiodes
cyprinus), rock bass, smallmouth bass (Micropterus dolomieu), silver redhorse sucker
(Moxostoma anisurum), walleye, white bass (Morone chrysOps), white perch (M
americana), and yellow perch (Percaflavescens). Fish species that had leeches attached
include channel catfish, freshwater drum, rock bass, yellow perch, and walleye caught in
trapnets. Due to the intermittent feeding nature of Myzobdella lugubris, samples
collected during this study were not separated according to fish species or location.

Fish were removed from the nets after 24-48 hrs and inspected visually for
attached leeches. Suspected M lugubris specimens were detached from the hosts and
deposited into large, one liter bottles of lake water. Overall, 456 leeches were removed
and divided in 91 pools of ~five leeches. Leeches remained alive until returned to the
laboratory, where they were identified as M lugubris based on the morphological key of

Peckarsky et a1 (1990).

66

Sample processing. All leech samples were briefly immersed into 100% ethanol (EtOH)
(Thermo Fisher Scientific, Pittsburgh, PA) to eliminate any superficial bacteria that might
have been present. Bacteria-free leech samples were then sectioned into smaller pieces
with sterile scissors and scalpels in sterile Petri dishes. The purpose of sectioning the
leech samples was to maximize extraction of leech viscera due to the thick cuticle of the
leech, which cannot be easily homogenized. The sectioned tissue of pooled samples was
placed into labeled whirlpak bags.

‘ Leech samples were homogenized using a Biomaster Stomacher (Wolf
Laboratories Ltd, Pocklington, York, UK) at the high speed setting for 2 min.
Homogenates were diluted with Earle’s salt-based minimal essential medium (MEM,
Invitrogen, Carlsbad, CA) supplemented with 12 mM tris buffer (Sigma-Aldrich, St.
Louis, MO), Penicillin (300 pg mL'l), Streptomycin (300 pg mL'l) (Invitrogen), and
Amphotericin B (750 pg mL", Invitrogen) to produce 1:4 dilution (w/v) of original
tissues. Homogenized leech contents were removed with a sterile transfer pipette and
dispensed into a sterile 15 ml centrifuge tube (Denville Scientific, Inc., Metuchen, NJ).
Samples were then centrifuged at 5300 rpm for 20 min in the IEC Multi RF Centrifuge

(Thermo Scientific).

Cell culture. Virus isolation was performed according to the standard protocols
published by the American Fisheries Society Blue Book (2007). The Epithelioma
papulosum cyprinii (EPC) (F ijan et a1 1983) cell line was used for virus isolation. EPC
was maintained and sub-cultured in 150 cm2 tissue culture flasks (Corning, Lowell, MA)

at 25°C using a grth formulation of Earle’s salt-based Minimal Essential Media

67

(MEM) (Invitrogen) supplemented with 29.2 mg mL'1 L-glutamine (Invitrogen),
Penicillin (100 IU mL") and Streptomycin (0.1 mg mL") (Invitrogen), 10% fetal bovine
serum (Hyclone, Logan, UT), and sodium bicarbonate (7.5% w/v; Sigma-Aldrich).

After centrifugation, the supematants were removed and inoculated into
individual wells of a 96-well plate containing EPC cells grown with MEM (5% fetal
bovine serum). Plates were incubated at 15°C for 7 days, and were observed for the
formation of cytopathic effects (CPE) periodically. Second and third blind passages were

performed and assessed for the presence of the VHSV.

Reverse-transcriptase polymerase chain reaction (RT-PCR) procedure. Total RNA
was extracted from inoculated cells from all samples, regardless if CPE was noticed or
not, using a QIAamp® Viral RNA Mini Kit (Qiagen, Valencia, CA), according to the
manufacturer’s instructions. Reverse transcription was accomplished by a two-step
protocol using the Affinity Script Multiple Temperature Reverse Transcriptase RT-
PCRTM (Stratagene, La Jolla, CA) following the manufacturer’s instruction. The primer
set used in this assay was recommended by the Office of International Epizootics (OIE
2006) for detection of a 811 base pair sequence of the VHSV nucleocapsid (N) gene: 5’-
GGG GAC CCC AGA CTG T-3’ (forward primer) and 5’-TCT CTG TCA CCT TGA
TCC-3’ (reverse primer). Polymerase chain reaction (PCR) was achieved by adding 2.5
pl of complimentary DNA, 1.5 pl of each primer, 12.5 p1 of 2X GoTaq Green Masterrnix
(Promega, Madison, WI), and nuclease free water (Promega), to create a final volume of
25 pl, into each reaction tube. The reverse transcriptase was inactivated by subjecting the

mixture to a 94°C for 2 min, and 30 cycles of PCR (denaturation for 30 s at 94°C,

68

annealing for 30 s at 52°C, and polymerization at 68°C for 1 min) in a Mastercycler
Personal Thermal Cycler (Eppendorf, Hamburg, Germany). The polymerization was
finalized by maintaining the mixture for a period of 7 min at 68°C. The product was

visualized by gel electrophoresis in 1.5% agarose gels.

Sequence analysis. Two representative VHSV-positive samples were chosen for further
confirmation of the VHSV by sequencing. The PCR products were purified with the
Promega Wizard® SV Gel and PCR Clean-up System. The concentration of the PCR
product was determined with the Quant-iTT'“ dsDNA BR Assay Kit (Invitrogen) and the
Qubit F luorometer. The concentration of the PCR product was used to develop the 30 ng
DNA sample required for cycle sequencing. The final reaction for sequencing consisted
of 30 pM VHSV forward (or reverse) primer, 30 ng of viral DNA. Samples were
submitted to the MSU Research Technology Support Facility. After quality trimmed, the
two sequences were aligned by BL2SEQ (Tatusova and Madden 1999). The aligned
contig was used for multiple alignments performed by ClustalW (Thompson et al 1994)
with seven other VHSV genotypes, namely type I, la, lb, 11, III, Iva and Nb. The
phylogenetic analysis of the VHSV leech strain with 19 nucleoprotein encoding genes
from other species of rhabdovirus was done by using bootstrap test of phylogeny in
MEGA 4 (Tamura et al 2007). The Neighbor-Joining algorithm was chosen to create the
phylogenetic dendrogram containing 1000 bootstrap samplings. The VHSV leech

sequence was submitted to GenBank nucleotides database (Accession no. pending).

69

 

RESULTS

Virus isolation. Thirteen out of the 91 samples of leech homogenates caused CPE on
EPC cell lines. Cytopathic effect was in the form of focal areas of rounded, refractile
cells that progressed to full lysis of the cell monolayer within two to four days post-
inoculation (Figure 12). Since tissue homogenates can be toxic to cultured cells, a second
passage was performed. Results indicated that nine out of the original 13 positive
samples from the first passage caused CPE, while samples #19, 52, 57, and 73 did not
(Table 6). Moreover, pooled samples #51, 56, 77, and 87, which were negative in the
first passage, caused CPE in the second passage (Table 6). A third passage was then
performed during which the original 13 positive samples, three of the four second
passage positive samples, and an additional 41 homogenate samples exhibited CPE

(Table 6).

RT-PCR results. This assay was performed on third passage EPC cells, which had been
incubated for 14 days. The primers 5’-GGG GAC CCC AGA CTG T-3’ (forward) and
5’-TCT CTG TCA CCT TGA TCC-3’ (reverse) produced an approximately 811 base pair
product, which is characteristic of VHSV (Figure 13). A positive PCR result for the
VHSV was obtained in 66 out of 91 samples (Table 6). Results from 80 out of the 91
samples were consistently positive or negative with both the third passage of cell culture
and PCR (Table 6). However, 11 out of the 91 samples were not consistent with cell

culture and PCR testing (Table 6).

70

Sequence analysis. Sequencing of the VHSV leech sample produced a 780 base pair
sequence that was identical to Great Lakes strain of VHSV IVb (Accession No.
DQ427105). Multiple alignment of the VHSV leech sequence was a 100% match to
VHSV Type IVb (Figure 14). The phylogenetic analysis indicated that within the
rhabdovirus family, the VHSV leech strain was grouped into a big clade with the seven
known strains of VHSVs (Figure 15). It showed a fairly short distance between the
VHSV leech strain and the VHSV strain type IVb. The closest clade to VHSV contained
a strain of rabies virus and two bat lyssus virus from Europe and Australia, respectively
(Figure 15). However, the BLASTn results suggested that the VHSV as a independent

species was much different than the other species of rhabdovirus in nucleoprotein genes.

71

DISCUSSION

Virus isolation. This is the first time that VHSV (of any genotype) has been isolated
from leeches, or other invertebrates. Myzobdella lugubris is an intermittent, generalist
species; therefore the detection of VHSV within M lugubris poses a threat to VHSV-
susceptible host species. In addition to residing in the same family, P. geometra and M
lugubris share similar distribution and host specificity (Meyer 1940; Davies 1973; ,
Klemm 1972, 1991; Kvach and Skroa 2007; Oktener et a1 2007). Also, similar to VHSV, i
the Spring Viraemia of Carp virus is an acute hemorrhagic and contagious disease among
fish and is also a rhabdovirus (Garver et a1 2007). As VHSV has been associated with
mass fish mortalities in the GLB, the potential for M lugubris to play a role in VHSV
transmission is eminent.

While quantification was not performed in this study, the titer levels of the virus
were most likely very low due to the lack of CPE in most samples until the third passage.
This is common in many viruses; therefore, typically two blind passages are required for

virus detection.

RT-PCR results and sequence analysis. Polymerase chain reaction is widely
considered to be more sensitive and accurate than cell culture (Devold et a1 2000; van
Elden et a1 2002; Kniisel et al 2007); therefore PCR was used as a preliminary
confirmation of the VHSV. Due to the sensitivity of PCR, the ten samples that were cell
culture negative, but PCR positive, were considered to be positive for the VHSV. It is

most likely that the concentration of the virus was so low that it went undetected in cell

72

culture, but was detected by PCR. Also due to the sensitivity of PCR, the one sample that
was cell culture positive and PCR negative was considered to be negative for VHSV.
There is the potential that a virus other than the VHSV was present or that there might
have been intracellular bacteria causing the CPE to occur. After initial detection of
VHSV via PCR, the USDA APHIS National Veterinary Services Laboratory in Ames,
Iowa also confirmed representative samples to be VHSV positive.

This is the first study documenting the presence of VHSV within Myzobdella
lugubris. Due to the intermittent feeding behavior of M lugubris and the still unknown
mode of transmission of VHSV, it is imperative to determine if M lugubris is a vector for
VHSV or not. Additionally, because the VHSV leech genotype is the same that has been
associated with mass mortalities of muskellunge and freshwater drum, there is an
increased chance that M lugubris might be spreading the virus. To fully determine if M
lugubris is a vector for VHSV, experimental infections and transmissions of the virus

need to be conducted.

73

Table 6. Pooled leech sample results for the first (Pl), second (P2), and third (P3)

cell culture passages, as well as PCR (~five leeches/pool).

aSamples which initially tested negative via cell culture, but were PCR-positive for

VHSV, and bsamples which initially tested positive via cell culture, but were PCR-

negative for VHSV.

74

"AI‘A a .‘A—l’v

 

 

Sample #

PCR

 

LAN-—

&
a)

OO\)O\UI

b)

t—II—Iu—I—I—l
Amid—Co

fl—flfl
“Nam

\0

MN
t-‘O

NNNNN
Chm-AWN

MN
O°\)

N
‘30

93

we)
N—

wwww
O‘UIAUJ

b.)
”\J

AAAAAAAcJW
QmAuN—oom

++-

++++

++++++++++++++..

+++:

+

++++++++-

++++++++++++++-

+++++++

 

+

 

Total

46

 

Sample #

PCR

 

47
48
49

50

51
52
53
54

55

56
57
58
59
60

61°
62

63

64

65b

66
67
6331
69

70a

71

72al

73
74

75
76

77
a

78
79
80
81
82
83

84

85
86
87
88
89
90
91

+++

++-+ +

++++++++-

+

+++++..++++.

 

+

40

25
20

29
16

 

Total

45

45

45

 

75

 

 

 

 

 

. '.
() ) ~ . '-.<i 1". .<~.' ' e
,vs ‘~ I . V l‘ e D
.1' ‘ ‘ I
. . .. . l . r
.’ . .,.

 

Figure 12. The comparison of (a) the cell monolayer of normal EPC growth in 96-

 

well plates, and (b) the cell monolayer exhibiting cytopathic effect in the form of

focal areas of rounded, refractile cells.

76

/ 850 hp

cont cont

 

Figure 13. Agarose gel showing the bands from RT-PCR, used for the detection of
VHSV (811 base pair). Pooled leech samples (#66, 69, 71, 75, 79, 80, 83-86, and 90)

are representative VHSV-positive samples. The marker (M) used was 1.0 kb plus

 

(Invitrogen).

77

               

 

 

vasvr TTCTCTCCTATGTACTCCAAGGGAATACACAGGAGG
VHSVIa TTCTCTCCTATGTACTCCAAGGGA CACAcAGGAGG
VHSVIVa G .TTCTCTCCTATGTAC’TCCAAGGIA ccACAI-GG
VHSVIII GGc TGTCCG .rrcrcrccrATGTAcrICCAAGGGAAAcACAGGAG
VHSVIb sec rcrccc TTCTCTCCTATGTACTCC ACACA'GGAG
VHSVII sci: TGTCIG TTCTCTC'TATGTACTCC GCACA'GGAG
VHSVIVb AGc TGTCCGT crrcrcrccrArGTAc : GCACAAAGA‘
LZZZX A c TTCTCTCCTATGTAC G
vnsvr ' .. TGCAAGGTCCTCACAGACATGGG CAAGGTGAC
vasvra . CAAAGTGCAAGGTCCTCACAGACATGGG TCAAGGTGAC
vrrsv IVa . CAAAGTGCAAGIITCCTCACGACATGGG TCAAGG'TGAC
VHSVIII CAAAGTGCAAGGTICTCACAGACATGGG TCAIGGTGA'C
VHSVIb . GCAAGGTCCTCACAGACATGG‘G TC'AAGG'TGAC
VHSVII : .. GCAIIGGTCTCACAGAcATGGG TCAAG'GTGAC
vasvrvn , . CAc AcATGGG TCAAGGTGAc
£23: 1 . ACATG TGAc
VHSVI v. " ~ '0 GCATCGAGG: " : "GATGCC
VHSVIa " ' g" GCATCGAGG‘ ‘ GATGcc
VHSV IVa . G'ATCGAGG‘i ATGcc
VHSVIII ' . 'sGCATCGAIG GATGCC
VHSVIb ' .. GCATCGAGG . GATGcc
VHSVII ~ GCATTGAGG. GATGcc
VHSV IVb . , - GCATCGAGG.
VHSV GGCATCGAGG:
Leech
VHSVI * ‘ l '- " AACCTCA
VHSVIa . sAccACAACCTCA GGAAATCGT
VHSV IVa ACGACAACCTCA GGACATCGT
VHSV III GACGACAACCTCA GGACATCGT
vnsvrb GACGACAACCTCA GGAIATCGT
VHSVII ACGACAACITCA GGACAT'GT
vasv IVb ‘ A GGACATCGT
ngiil .5 GGACATCGT
VHSVI 'CCCTTCTGACCAAGTAC CGGrGGACAAGATG
vnsvra r cccrrcrIACCAAGrAc CGGTGGACAAGATG

VHSVIVa LJGIIICCCTGATGACTGTTCCCTTTGACCAAGTAC CGGTGGACAA'ATG
VHSVIII “GACCCTGATGACATGTTCCCTTCTGACCAAGTAC CGGTGGACAAGATG
VHSVIb 'GACC TGATGACATGITCCCTTCTGACCAAGTAC CGGTGGACAAGATG
VHSVII GAC CTGATGACATGTTCCCTTCTGACCAAGTAC C'GTGGACAAGATG

VHSVIVb _ GCCCTGATGACGT‘GTTCCCTTCTGACCAAGTAC CGGTGGACAAAATG
LZSZX G‘CCCTGATGACGTGTTCCCTTCTGACCAAGTACTCGGTGGACAAAATG

 

Figure 14. Multiple alignments of VHSV sequences, showing 100% match of the VHSV Leech
sequence to the DQ427105 VHSV [Vb sequence, as well as homology to other VHSV genotypes,
VHSV l (Accession No. 293412), VHSV [a (Accession No. AJ233396), VHSV lb (Accession No.
AY356632), VHSV ll (Accession No. AY356743), VHSV III (Accession No. AY356720), VHSV lVa

(Accession No. AJ 130926), VHSV lVb (Accession No. DQ427105).

78

 

M12 VHSV Type I
18 AY356632 VHSV Type lb
M414VHSV Cod Ulcua

M23396V HSV Typo Ia
- AY356720 VHSV Type III
DQ427105 VHSV m in W39.

A3179621 vusv min-KRRvsazz
18 AJ1SIB26 Vl-BV Type IV
AY356743 VHSV Type II

 
 
   
   

 

22

 

— $32503 alropea n bat Iyaeavirua
— AY573$5 Australian bat lysavirus

 

20

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

73 50 —— ELBS$55 Rabies virus
34610114 Hiame rha bdovirue
.6 9633477 Snakehea d rhabdovirus
L—— ABZ31658 lnfictiomhematopoietic necroda
DQ491013 Mount Egon bat virus
59 AY383716 Vesicular abmaltiavlrua
4 I U10$3 Adela ide River virus
29 W166 Bovine ephemeral five rvirua

0.2

 

 

 

Figure 15. Phylogenetic distance tree generated by neighbor-joining analysis of 20
complete nucleoprotein gene open-reading frame sequences representing the
Rhabdoviridae group, with special interest going to the VHSV genotypes. Bootstrap
confidence values are shown at branch nodes. Notice the VHSV leech is homologous

to the MIO3GL strain (type IVb).

79

CHAPTER FOUR

BACTERIAL COMMUNITY ASSOCIATED WITH THE LEECH A/IYZOBDELLA

LUGUBRIS FROM THE LAKE ERIE WATERSHED, MICHIGAN

ABSTRACT

Leeches are widespread in the Great Lakes basin, yet their potential to harbor
disease-causing agents has not been investigated. The purpose of this study was to
identify the bacterial community of the commonly occurring leech, Myzobdella lugubris,
within the Lake Erie Watershed. Leech samples were collected from the pectoral fins of
channel catfish and freshwater drum from Lake Erie in commercial trap nets and pooled
into two samples based on host attachment. Bacteria from within the viscera of the leech
were identified by sequencing the 16S rRNA (rDNA) gene of amplified community
bacterial DNA extracted from pooled leech homogenate samples. One-hundred thirteen
16S gene sequences were checked for similarity to existing 168 sequences contained in
two public databases: the Ribosomal Database Project and BLAST. A total of five
genera belonging to three bacterial subdivisions were detected in leech homogenates.
Bacteria belonging to the phyla Bacteroidetes, Beta-proteobacteria, and Verrucomicrobia
were present in the leech samples. Samples also contained sequences from bacteria that
are currently unclassified. The majority of bacteria found within leeches attached to
channel catfish consisted of a number of sequences that could not be classified beyond

the Domain Bacteria (63.64%). However, many of these sequences were homologous

80

.h‘

(<45 %) to the phyla Bacteroidetes. Beta-proteobacteria was the most abundant phyla
within leeches attached to freshwater drum (86.21%), while Verrucomicrobia was the
least abundant (1.72%). One of the five genera detected in the leech homogenates,
F lavobacterium psychrophilum, is the causative agent of Bacterial Cold Water Disease.
While the frequency of genera varies, bacteria associated with the two samples in this
study are comparatively similar. This study represents the first report of microbial

communities within the leech Myzobdella lugubris in the Lake Erie Watershed.

81

INTRODUCTION

Leeches (Annelida: Hirudinea) have been shown to be widespread throughout
North America, and recently, Lake St. Clair and the Lake Erie Watershed (Klemm 1972,
1977, 1991; Muzzall et a1 1987; Klemm et a1 2003; Schulz Chapter 2). In a previous
study in the Lake Erie Watershed, leeches were attached to nine out of 21 fish species
examined, with a prevalence of 7.79% (Schulz Chapter 2). In addition, 1,064 leeches
were found parasitizing 165 individual fish, with a mean intensity of 6.45 leeches/fish
and an abundance of 0.50 leeches/fish (Schulz Chapter 2). Myzobdella lugubris, an
intermittent, haematophagous feeder, was found to dominate the leech population.

Leeches can harbor potentially harmful bacteria and transmit it from host to host
(Graf 1999; Kikuchi and Fukatsu 2005; Silver et al 2007; Laufer et a1 2008). While there
have been many studies regarding bacteria within leeches, no studies have been
conducted concerning the bacterial communities within leeches from the Great Lakes
Basin, specifically the Lake Erie Watershed.

The European medicinal leech, Hirudo spp., is of particular interest due its use in
aiding venous congestion complications that occur following surgical procedures in
humans and its unique relationship with Aeromonas spp. (Sawyer 1986; Silver ct al
2007). It has been documented that Hirudo spp. can contain multiple Aeromonas spp.,
such as A. veronii Biovar sobria, A. hydrophilia, and A. jandaei (Graf 1999; Silver et al
2007; Laufer et al 2008). Infections have been known to occur in hlunan post-operative
patients, for which Hirudo spp. have been used for bloodletting (Silver et a1 2007; Laufer

et al 2008).

82

Pathogenic bacteria have also been found within the digestive organs of leeches.
Kikuchi and Fukatsu (2005) found a Rickettsia spp. infection in the leeches T orix tagoi,
T. tukubana, and Hemiclepsis marginata. Rickettsia is a known pathOgen that seriously
affects many fish species (Cusack et al 2002). Also, leeches that fed on infected fish
contained pathogenic strains of Aeromonas spp. and Pseudomonas spp. in their digestive
tracks (Snieszko and Bullock 1968). Additionally, Dombrowski (1952) demonstrated
that Piscicola geometra transmits Pseudomonas punctata to carp. Pseudomonas species,
such as P. putida, have been implicated as the cause of fish mortalities in aquaculture
(Altinok et al 2006). Leeches are also known to disperse A. hydrophila from host to host
(Negele 1975). Aeromonas spp. cause F urunculosis and mortalities in farmed and wild
fish (Harikrishnan and Balasundaram 2005), as well as septicemia and diarrhea in
humans (Janda and Abbott 1998).

The purpose of this study was to identify the bacterial community of Myzobdella
lugubris within the Lake Erie Watershed. Due to its ability to provide a more detailed
description of the bacterial communities within the leeches, the molecular method of 16S

rRNA (rDNA) gene sequencing was preferred over traditional culture methods.

83

MATERIAL AND METHODS

Study area description. Leeches were collected from the western portion of Lake Erie,
where Myzobdella lugubris and fish hosts were abundant. Lake Eric is the smallest and
shallowest of all the Great Lakes (GL), and is located near the southeastern portion of
Michigan (Figure 4). It is 92 km wide and 388 km long with a surface area of 25,700
kmz. Lake Erie has an average depth of 19 m, but can be as deep as 64 m in some areas a
(U SEPA 2006). Although it has declined over the past several years in Michigan, Lake '

Erie supports a commercial fishery for a wide variety of fish, including the channel l} 4

 

catfish (Ictalurus punctatus), freshwater drum (Aplodinotus grunniens), bigmouth buffalo
(Ictiobus cyprinellus), and white perch (Morone americana), to name a few (Baldwin et
al 2002). Lake Erie is the warmest of the GL and also very biologically active, making it

a suitable environment for leeches (U SEPA 2006).

Leech collection. Leech samples were collected during October of 2008 from Lake Erie
in commercial trap nets (41°46'00.74"N, 83°24'58.09"W) (Figure 4). While there can be
variation in the occurrence of size and number of leeches depending on the time of year,
this study was conducted during October due to sampling constraints. In addition to the
abundance of fish hosts and leeches, this specific location was chosen due to the
accessibility by commercial fishermen. The trap nets had 1.8 m deep pots of 5.1 cm
stretch mesh, 7.6 cm stretch mesh hearts and wings, and 91.4 m long leads of 10.2 cm

stretch mesh.

84

Fish were removed from the nets after 48 hrs and examined for the presence of
leeches. The attachment sites were recorded for each fish and leeches were separated
into whirlpaks containing lake water according to the fish number and attachment site.
Myzobdella lugubris heavily parasitized the channel catfish and freshwater drum in Lake
St. Clair (Lake Erie Watershed) and were therefore chosen as hosts of interest for this
study and examined for leeches. Leeches remained alive until returned to the laboratory,
where they were identified as Myzobdella lugubris based on the morphological key of

Peckarsky et al (1990).

Leech preparation. Leeches ranged in size from 7.5 mm to 20 mm. Leeches were
dipped in 100% ethanol baths prior to dissection, in order to remove any contaminants
and limit the presence of external bacteria. Leech viscera were aseptically removed, with
the assistance of a dissecting microscope, and placed in a microcentrifuge tube containing
80% ethanol (Thermo Fisher Scientific, Pittsburgh, PA). Due to the small size of the
leeches, intestinal contents were pooled into two samples and are referred to hereafter as
leech guts. Eight leeches were collected fiom the pectoral fins of channel catfish and

four leeches were collected from the pectoral fins of freshwater drum.

Sequence analysis. Genomic bacterial community DNA was harvested from the leech
gut homogenates (30-50 mg) using the PowerSoilTM DNA Isolation Kit (MO BIO
Laboratories Inc., Carlsbad, CA) following the manufacturer’s protocol. The PCR

amplification of the bacterial 16S gene were performed using the universal eubacterial

primer set 27f—1387r (27f: 5'-AGAGTTTGATC(AC)TGGCTCAG-3' and l387r (5’-GGG

85

CGG WGT GTA CAA GGC-3’) (Marchesi et al 1998). The PCR mixtures

(25 pl/reaction) contained 20 pmol 27F and 1387R primers, 22mM Tris-HCL (pH 8.4),
55mM KCL, 1.65 mM MgC12, 220 pM dNTP’s, 0.55 units recombinant Taq DNA
Polymerase, and 50 ng template DNA (all reagents from Invitrogen Life Technologies,
Carlsbad, CA, USA unless otherwise stated). The PCR amplification was carried out for

30 cycles of 94°C for 4 min., 56°C for 30 sec. and 72°C for 1.5 min. and final 7 min.

incubation at 72°C (modified after Sambrook and Russell 2001).

The expected size of PCR products was 1.36 kb. The PCR products were used to
construct 16S gene clone libraries using a TOPO TA Cloning Kit® (with pCR®2.1-
TOPO® vector and One Shot® TOP10 Chemically Competent E. coli, Invitrogen)
following the manufacturer’s protocol. All clones were cultured on Luria-Bertani agar
plates (Fisher Scientific Inc., Pittsburgh, PA) containing 50 pg/ml Kanamycin, as
directed by the protocol supplied in the TOPO TA Cloning Kit®. Clones were screened
for positive transformation with PCR using the primer set M13 forward (5’-GTT TTC
CCA GTC ACG AC-3’) and M13 reverse (5’-CAG GAA ACA GCT ATG ACC-3’).

A total of 190 screened clones were submitted to the Michigan State University
Genomic Technology Support Facility (GTSF) for cell preparation and sequencing on a
3730 Genetic Analyzer (Applied Biosystems Inc., Foster City, CA). Sequences were
aligned and classified using the Ribosomal Database Project II (RDP 11) Release 9.47
produced by Wang et al (2007). The RDP-II provides aligned and annotated rRNA
sequences and uses a naive Bayesian classifier to assign sequences to the RDP
Taxonomy. It provides taxonomic assignments from domain to genus, with confidence

estimates for each assignment. Fifty-five clones from the channel catfish leech sample

86

and 58 clones from the freshwater drum leech sample were successfully aligned. The
RDP “Seq Match” was used to identify bacteria, while the RDP “Classifier” (95%
confidence interval) was used to compare relative abundance of sequences. Multiple
sequences were rechecked with the Basic Local Alignment Search Tool (BLAST) of the

National Center for Biotechnology Information of the National Institute of Health.

 

87

RESULTS

Sequence analysis revealed the presence of four bacterial groups within the leech
viscera (Beta-proteobacteria, Bacteroidetes, Verrucomicrobia, and RDP-unclassified
Bacteria), although the frequency at which each group was found in the two samples
differed (Figure 16). With the exception of Verrucomicrobia, which only occurred in the
freshwater drum leech sample, all phyla were detected both leech samples. In the
channel catfish leech sample, RDP-unclassified Bacteria had the highest occurrence at
63.64% (Figure 16). While these were determined to be unclassified Bacteria, the RDP
library produced homologous match scores (<45 %) to the Sphingobacteriales order
(Bacteroidetes). Interestingly, the group with the least amount of clones present in the
freshwater drum leech sample was RDP-classified as Bacteroidetes (16.36%). In the
channel catfish leech sample, Beta-proteobacteria were the most abundant bacterial group
detected (86.21%, Figure 16). The least abundant bacterial group in the channel catfish
leech sample was the Verrucomicrobia (1.72%, Figure 16).

A number of sequences within the Bacteroidetes phylum showed high homology
to F lavobacterium spp. (F. johnsoniae and F. psychrophilium) (Bacteroidetes) according
to RDP and BLAST (Table 7). In the freshwater drum leech sample, six of the nine
Bacteroidetes sequences were similar to Flavobacterium sp. (AAXX01000001.11), with
the highest match at 94% (BLAST) and three of the nine sequences were similar to F.
psychrophilium (NC_009613.11), with the highest match at 98% (BLAST, Table 7). In

the channel catfish leech sample, the only two sequences homologous to the phylum

88

 

Bacteroidetes were similar to F lavobacterium sp. (AAXXOlOOOOOl .11) with the match at
95% and F. johnsoniae (NC_009441.11) with the match at 92% (Table 7).

The class beta-proteobacteria was the most abundant group of bacteria detected,
with RDP and BLAST searches producing matches for the genera Chromobacterium,
T hiobacillus, and Vogesellal In the freshwater drum leech sample, three of the 11 beta-
proteobacteria sequences closely resembled T. denitrificans (N C_007404.11), with the
highest match at 92% (BLAST); however RDP matched the same three samples as
unclassified members of the Neisseriaceae family of bacteria (Table 7). The remaining
eight sequences of beta-proteobacteria were similar to Vogesella sp., with the highest
match at 100% (RDP, Table 7). In the channel catfish leech sample, 48 of the 50 beta-
proteobacteria sequences were also closely related to Vogesella sp., with the highest
match at 100% (RDP). The last two sequences from the channel catfish leech sample in
the Beta-proteobacteria were determined to be unclassified members of the Neisseriaceae
family of bacteria according to RDP, but according to BLAST, they were similar to
Chromobacterium violaceum, with the highest match at 96% (Table 7).

One sequence from the freshwater drum leech sample was determined to belong
to the phylum Verrucomicrobia. This sequence showed high homology to

Verrucomicrobium genera incertae sedis, with a match of 86% (RDP, Table 7).

89

DISCUSSION

This is the first report addressing the microbial community of Myzobdella
lugubris. Results indicated that there are multiple bacterial groups within the viscera of
M lugubris. Bacterial communities have been documented in other species of leech,
either as intestinal symbionts or as an infection within the leech. Aeromonas spp. such as
A. jandaei and A. veronii have a symbiotic relationship with the European medicinal
leeches Hirudinea orientalis, H. verbana, and H. medicinalis (Graf 1999; Kikuchi and
Graf 2007; Laufer et a1 2008). Infectious bacteria, such as Rickettsia sp., have been
found within Torix spp. and Hemiclepsis spp. (Kikuchi and Fukatsu 2005).

With the exception of Verrucomicrobia, the bacterial communities within the
freshwater drum sample and the channel catfish sample consisted of mostly similar phyla.
Although the group that had the highest occurrence in the channel catfish leech sample
was unclassified bacteria, they were similar to the order Sphingobacteriales
(Bacteroidetes). The order Sphingobacteriales includes several species, such as
Sphingobacterium composti, S. antarcticus, and S. anhuiense, which are bacteria
commonly found in forest soil, composts, and aquatic environments (Shivaji et a1 1992;
Yoo et a1 2007; Leon-Galvan et a1 2008; Wei et a1 2008). However, a bacterium from
Sphingobacteriales was recently isolated from diseased fish (Loch and Faisal, personal
communication). It is not unexpected since M lugubris feeds exclusively on blood and
tissue fluids; however, it is unknown as to how bacteria from Sphingobacteriales found

its way to the interior of M lugubris.

90

Bacteria from the Bacteroidetes phylum were found to be the least abundant
group in the channel catfish leech sample. A number of these sequences were similar to
F lavobacterium spp., including F. psychrophilum. F lavobacterium psychrophilurn is the
causative agent of Bacterial Cold-Water Disease and Rainbow Trout Fry Syndrome,
which are known to cause high mortalities in salmonids and can increase their
susceptibility to other diseases (Nematollahi et a1 2003). This finding underscores the
potential role of M lugubris in F lavobacterium spp. transmission among susceptible fish.

The most abundant group present in the freshwater drum sample was unclassified
members of Neisseriaceae (beta-proteobacteria). Most of the sequences were similar to a
Vogesella sp. (SS-100%, RDP), of which there are only two known species, V. indigofera
and V. perlucida (Grimes et al 1997; Chou et al 2008). Vogesella indigofera and V.
perlucida have both been found in groundwater (Grimes et al 1997; Gu and Cheung
2001; Whiteley et al 2001; Chou et a1 2008). However, V. indigofera has been found
within the pyloric cecae of wild fish which had leeches, specifically Piscicola geometra,
attached to them (Goldschmidt-Clerrnont et a1 2008). The bacterial community from
within P. geometra was not investigated; therefore, it is unknown if the leeches contained
V. indigofera or not (Goldschmidt-Clerrnont et al 2008). While the sequences in this
study were similar to a Vogesella sp., further research is needed to determine the potential
symbiotic, or pathogenic, relationship there might be between M lugubris and Vogesella
sp.

The least abundant bacteria group in the freshwater drum sample was
Verrucomicrobia, which only had one sequence similar to a Verrucomicrobium species.

Verrucomicrobium spp. are found in soil and aquatic environments and are significant for

91

understanding the evolution of bacteria (Paissé et al 2008; Lee et al 2009).
Verrucomicrobia bacteria have also been detected in toxic cyanobacterial blooms,
although their role in the toxic bloom is unknown (Pope and Patel 2008). Bacteria from
the Verrucomicrobia phylum have recently been found to oxidize methane, which enables
the bacteria to reduce methane emissions to the atmosphere (Dunfield et a1 2007). This is
also the first report of a Verrucomicrobium-like species detected within the leech viscera,
however the phylum Verrucomicrobia is still relatively new and it is unknown as to what
kind of relationship the bacteria and leeches might have.

There is little variation in bacterial community composition in Myzobdella
lugubris collected from channel catfish and freshwater drum. As expected, most of the
bacteria detected from within the leeches were environmental bacteria typically found in
soil and the aquatic environment; however, a further investigation is warranted to
determine if there is a pathogenic relationship between M lugubris and F lavobacterium
psychrophilum.

This is the first study ever conducted on bacterial communities in leeches that are
parasitic on fish. These types of studies are needed to better understand the role played
by leeches in shaping the bacterial community structure of an ecosystem and in disease
transmission. In general, the M lugubris bacterial community seemed to be of extreme
low diversity, especially when compared to other invertebrates collected from the same
environment, such as the zebra mussel, Dreissena polymorpha (Winters 2008). This may

be attributed to the haematophagous nature of leech feeding.

92

Table 7. The presence of bacteria from the Bacteroidetes phyla (Flavobacterium sp.,
F. johnsoniae, and E psychrophilum), Beta-proteobacteria phyla (Chromobacterium
violaceum, T hiobacillus denitriflcans, and Vogesella sp.), and Verrucomicrobia phyla
(Verrucomicrobium genera incertae sedis) detected within viscera from leeches

collected to the channel catfish and freshwater drum.

 

Channel catfish Freshwater drum

 

Genus species leech samples leech samples
Chromobacterium violaceum x
F lavobacterium johnsoniae I x
F lavobacterium psychrophilum x
F lavobacterium sp.a x x
Thiobacillus denitriflcans x
Verrucomicrobium genera incertae sedis x
Vogesella spa x x

 

aOnly Flavobacterium sp. and Vogesella sp. were present in both the channel catfish

and freshwater drum samples.

93

 

 

I 100

 

 

 

 

 

 

 

 

: s g
.9 V - e— - I
l E _ IChannel l I
’ 3 catfish leech . .
. 5 sample l

l I" IFreshwater i l
I I e _ ,_ drum leech .
I \\\\\\\\\‘ samle i I

 

Figure 16. The occurrence of bacteria phyla (expressed as frequency) within the two

leech samples; based on the RDP Classifier, using a 95% confidence threshold.

94

 

CHAPTER 5

CONCLUSIONS AND FUTURE RESEARCH

Although there have been studies regarding the distribution and ecology of
leeches in the Great Lakes, there is still a lack of knowledge pertaining to leeches of the
Lake Erie Watershed. This study has shown that leeches have the potential to cause
damage to fish hosts as well as possibly spread disease, which may have negative effects
on the fish population in the Lake Erie Watershed. Three species of leech, Actinobdella
pediculata, Myzobdella lugubris, and Placobdella montifera, were found attached to fish
hosts.

The leech A. pediculata was thought to be highly host-specific to the freshwater
drum. This study is the first report of A. pediculata attached to two northern shorthead
redhorse suckers. The A. pediculata that were attached to the northern shorthead
redhorse sucker were smaller in size and were found attached to the anal fin and the
musculature just posterior to the anal fin. As an adult, A. pediculata detaches from its
host to deposit its eggs; then as a juvenile, it searches for its preferred host, attaches
anywhere on the body, and then gravitates towards its preferred attachment site, the gill
chamber. Due to the size and attachment site of A. pediculata on the northern shorthead
redhorse sucker, the leeches were most likely juveniles that had not gravitated to the gill
chamber yet. It is unknown if larger A. pediculata will attach to the northern shorthead

redhorse sucker in the gill chamber, or only juveniles.

95

Leeches have an annual life cycle and different life stages can be found during
different periods. This study was conducted over only one month; therefore, it would be
of interest to sample for leeches intermittently throughout the year, specifically during
winter, spring, summer, and fall months. It would also be helpful to conduct this study
over at least two years, in order to better compare prevalence, intensity, and abundance
data and statistical analyses.

In addition to determining the leech species present in the portion of the Lake Erie
Watershed that was sampled, one species in particular, Myzobdella lugubris, was further
examined in Chapters 3 and 4. Myzobdella lugubris is a wide-ranging leech in regards to
distribution in North America, as well as preferred host species. There are few studies
which have shown leeches to act as vectors for viral diseases. While this study was not
able to confirm that M lugubris is a vector for VHSV, it is the first report of VHSV being
detected within M lugubris. Due to the still unknown mode of transmission, the
implication of M lugubris acting as a vector for VHSV could have severe effects on the
fish population. Further research is required in order to determine if M lugubris is a
vector for VHSV or not. Experimental infections of susceptible host species, particularly
the freshwater drum, should be conducted with M lugubris. Freshwater drum in replicate
tanks would be injected with the VHSV, and would then be exposed to VHSV-free
leeches over a period of time. Leeches, now infected with VHSV, would be detached
from infected hosts, and reattached to VHSV-free fish hosts. After a period of time, both
leeches and fish hosts would be tested for VHSV, which will determine whether leeches

can transmit the disease.

96

It would also be of value to determine if they are mechanical vectors, passing the
virus from one host to another, or biological vectors, having the virus replicate within the
leech while the virus is transmitted. While A. pediculata and P. montifera are semi-
permanent hosts, it would also be of interest to discover if they too harbor VHSV. Since
they are not intermittent feeders, the presence of VHSV from within both leeches would
imply that leeches can acquire the virus through the water and not just through blood
feeding.

Myzobdella lugubris was found to not only contain the VHSV, but different
groups of bacteria as well. The bacterial communities within leeches have been studied
extensively regarding medicinal leeches, but this is the first report of bacterial
communities within leeches that are parasitic on fish, specifically M lugubris. While the
bacterial community of M lugubris was not very diverse, the pathogenic F lavobacterium
psychrophilum was detected, which could have implications regarding the spread of F.
psychrophilum in the fish population. Due to the size of leeches collected for this study,
the entire viscera was removed and examined for bacteria. It would be beneficial to focus
on specific internal organs of the leeches, because the different locations of the bacteria
within the leech could have different implications as to their purpose.

Overall, it would be valuable to compare the data in all three studies on both Lake
St. Clair and Lake Erie. Due to sampling constraints (i.e., suitable access to sites), the
Chapter 2 study was conducted on only Lake St. Clair, the Chapter 3 study was
conducted on both lakes, and the Chapter 4 study was conducted on only Lake Erie.
Since both of these lakes are similar to each other in fish distribution, and they share

waterways, it would be of interest to determine how the leech distribution and the

97

presence of bacterial communities compare. The three studies mentioned above have
implications regarding the health of the fish population of the Lake Erie Watershed, and
therefore should be continued in order to determine the role leeches have in the spreading

of diseases in the Great Lakes.

98

ff; e:-¢q3.j’r’77‘ _ l5

REFERENCES

Ahne W. 1985. Argulusfoliaceus L. and Piscicola geometra L. as mechanical vectors of
spring viremia of carp virus (SVCV). Journal of Fish Diseases 8:241-242.

Altinok,l, Kayis S, Capkin E. 2006. Pseudomonas putida infection in rainbow trout.
Aquaculture 261:850—855.

Appy RG, Cone DK. 1982. Attachment of Myzobdella lugubris (Hirudinea: Piscicolidae)
to Logperch, Percina caprodes, and Brown Bullhead, Ictalurus nebulosus. Transactions
of the American Microscopical Society 101(2):135-141.

r1-
Appy RG, Dadswell MJ. 1981. Marine and estuarine piscicolid leeches (Hirudinea) of the
Bay of Fundy and adjacent waters with a key to species. Canadian Journal of Zoology ..
59:183-192. If»

American Fisheries Society-Fish Health Section. 2007. Suggested procedures for the
detection and identification of certain finfish and shellfish pathogens. American Fisheries
Society, Bethesda, MD.

Baldwin NA, Saalfeld RW, Dochoda MR, Buchner HJ, Eshenroder RL. 2002.
Commercial fish production in the Great Lakes 1867-2000.
http://www.glfc.org/databases/commercial/commerc.php

Becker CD, Dauble DD. 1979. Records of piscivorus leeches (Hirudinea) from the
central Columbia River, Washington state. Fishery Bulletin 76(4):926-931.

Begon M, Bennett M, Bowers RG, French NP, Hazel SM, Turner J. 2002. A clarification
of transmission terms in host-microparasite models: numbers, densities, and areas.
Epidemiology and Infection 129(1): 147-153.

Bere R. 1931. Leeches from the lakes of northeastern Wisconsin. Transactions of the
Wisconsin Academy of Science, Arts, and Letters 26:437-440.

Beyerle J, Hnath JG. 2002. History of Fish Health Inspections State of Michigan 1970-
1999. Michigan Department of Natural Resources, Fisheries Technical Report 2002-2,
Ann Arbor.

Branson BA. 1961. The Leech Placobdella pediculata Hemingway Parasitizing
Aplodinotus grunniens in Oklahoma. The Southwestern Naturalist 6(1):53.

Brown RW, Ebener M, Gorenflo T. Chapter 11: Great Lakes Commercial Fisheries:
Historical Overview and Prognosis for the Future. 1999. In: Great Lakes Fisheries Policy

99

and Management: A Binational Perspective, eds. W.W. Taylor and C. P. F erreri.
Michigan State University Press, East Lansing, MI, pgs. 307-354.

Bur MT. 1994. Incidence of the Leech Actinobdella pediculata on Freshwater Drum in
Lake Erie. Journal of Great Lakes Research 20(4):768-770. ,

Burreson EM. 1982. The life cycle of Trypanoplasma bullocki (Zoomastigophorea:
Kinetoplastida). Journal of Protozoolgy 29(1):72-77.

Burreson EM. 2006. Phylum Annelida: Hirudinea as vectors and disease agents. In: Fish
Diseases and Disorders, Vol. 1. Protozoan and Metazoan Infections, Second Edition (ed.
by P.T.K. Woo), CAB lntemational, Oxon, p. 566-591.

Bush AO, Lafferty KD, Lotz J M, Shostak AW. 1997. Parasitology meets ecology on its
own terms: Margolis et al. revisited. Journal of Parasitology 83(4):575-583.

Chou Y, Chou J, Lin M, Arun AB, Young C, Chen W. 2008. Vogesella perlucida sp.
nov., a non-pigmented bacterium isolated from spring water. International Journal of
Systematic and Evolutionary Microbiology 58:2677-2681.

Choudhury A, Hoffnagle TL, Cole RA. 2004. Parasites of native and normative fishes of
the Little Colorado River, Grand Canyon, Arizona. Journal of Parasitology 90(5):1042-
1053.

Cipriano RC, Bullock GL, Schill WB, Kretschmann R. 1996. Enhanced culture of
A eromonas salmonicida from covertly-infected rainbow trout following administration of
the stress induced Furunculosis test. Biomedical Letters 54:105-112.

Coon TG. 1999. Ichthyofauna of the Great Lakes Basin. In: Great Lakes Fisheries Policy
and Management: A Binational Perspective, eds. W.W. Taylor and C. P. F erreri.
Michigan State University Press, East Lansing, MI, pgs. 55-71.

Cranny S, Heckmann RA. 1996. Trypanoplasma atraria sp. nov. (Kinetoplastida,
Bodonidae) in fishes from the Sevier River drainage, Utah. Great Basin Naturalist
56(2):l42-149.

Curry MG. 1977. Delaware leeches (Annelida: Hirudinea: Glossiphoniidae): new state
records and new molluscan host record for Placobdella montifera Moore. Wasmann
Journal of Biology 35:65-67.

Curry MG, Vidrine MF. 1976. New fresh-water mussel host records for the leech
Placobdella montifera, with distributional notes. Nautilus 90: 141-144.

Cusack R, Cone DK. 1986. A review of parasites as vectors for viral and bacterial
diseases of fish. Journal of Fish Diseases 9:169-171.

100

Cusack RR, Groman DB, Jones SRM. 2002. Rickettsia] infection in farmed Atlantic
salmon in eastern Canada. Canadian Veterinary Journal 43(6):435-440.

Daniels BA, Sawyer, RT. 1975. The biology of the leech Myzobdella lugubris infesting
blue crabs and catfish. Biological Bulletin 148:193-198.

Davies RW. 1973. The geographic distribution of freshwater Hirudinoidea in Canada.
Canadian Journal of Zoology 51:531-545.

Davies RW, Wilkialis J. 1982. Observations on the Ecology and Morphology of
Placobdella papillifera (Verrill) (Hirudinoidea: Glossiphoniidae) in Alberta, Canada.
American Midland Naturalist 107(2):316-324.

DeRoth GC. 1953. Some parasites from Maine fresh-water fishes. Transactions of the
American Microscopical Society 72(1):49-50.

Devold M, Krossoy B, Aspehaug V, Nylund A. 2000. Use of RT-PCR for diagnosis of
infectious salmon anaemia virus (ISAV) in carrier sea trout Salmo trutta after
experimental infection. Diseases of Aquatic Organisms 4029-18.

Dombrowski. 1952. Die Karpfenlause, Argulusfoliaceus. Fischblatter 2:145-146.

Dunfield PF, Yuryev A, Senin P, Smimova AV, Stott MB, Hou S, Ly B, Saw JH. 2007.
Methane oxidation by an extremely acidophilic bacterium of the phylum
Verrucomicrobia. Nature 450:879—882.

Eissa AE, Elsayed EE, McDonald R, Faisal M. 2006. First record of Renibacterium
salmoninarum in the sea lamprey (Petromyzon marinas). Journal of Wildlife Diseases
42(3):556-560.

Elsayed EE, Eissa AE, Faisal M. 2006a. Isolation of F lavobacterium psychrophilum from
sea lamprey, Petromyzon marinus L., with skin lesions in Lake Ontario. Journal of Fish
Diseases 29(10):629-632.

Elsayed E, Faisal M, Thomas M, Whelan G, Batts W, Winton J. 2006b. Isolation of viral
haemorrhagic septicaemia virus from muskellunge, Esox masquinongy (Mitchill), in Lake
St. Clair, Michigan, USA reveals a new sublineage of the North American genotype.
Journal of Fish Diseases 29:611-619.

Faisal M, Eissa AE, Elsayed EE. 2007. Isolation of Aeromonas salmonicida from sea
lamprey (Petromyzon marinus) with furuncle-like lesions in Lake Ontario. Journal of
Wildlife Diseases 43(4):618-622.

Faisal M, Hnath JG. 2005. Fish Health and Disease Issues in the Laurentian Great Lakes.

Pages 331-349, in Cipriano RC, Shchelkunov IS, and Faisal M, editors. Health and
Diseases of Aquatic Organisms: Bilateral Perspectives. Proceedings of the Second

101

Bilateral Conference between Russia and the United States. 21-28 September 2003.
Shepherdstown, West Virginia. Michigan State University, East Lansing, Michigan.

Fijan N, Sulimanovié El, Bearzotti M, Muiinié D, Zwillenberg LO, Chilmonczyk S,
Vautherot J F , de Kinkelin P. 1983. Some properties of the epithelioma papulosum cyprini
(EPC) cell line from carp Cyprinus carpio. Annales de l’Institute Pasteur Virology
134E:207—220.

Font WF, Tate DC. 1994. Helminth parasites of native Hawaiian freshwater fishes: an
example of extreme ecological isolation. Journal of Parasitology 80(5):682-688.

Fremling CR. 1980. Aplodinotus grunniens Rafinesque Freshwater Drum. page 756, in
Atlas of North American Freshwater Fishes. Edited by OS. Lee, C.R. Gilbert, C.H.
Hocutt, R.E. Jenkins, D.E. McAllister, and J .R. Stanffer, Jr. North Carolina State
Museum of Natural History, Raleigh. 854 pages.

Gagné N, MacKinnon AM, Boston L, Souter B, Cook-Versloot M, Griffiths S, Olivier G.
2007. Isolation of viral hemorrhagic septicemia virus from mummichog, stickleback,
striped bass and brown trout in eastern Canada. Journal of Fish Diseases 30:213—223.

Garver KA, vailow AG, Richard J, Booth TF, Beniac DR, Souter BW. 2007. First
detection and confirmation of spring Viraemia of carp virus in common carp, Cyprinus
carpio L., from Hamilton Harbour, Lake Ontario, Canada. Journal of Fish Diseases
30:665-671.

Goldschmidt-Clerrnont E, Wahli T, Frey J, Burr SE. 2008. Identification of bacteria from
the normal flora of perch, Percafluviatilis L., and evaluation of their inhibitory potential
towards Aeromonas species. Journal of Fish Diseases 31(5):353-359.

Graf J. 1999. Symbiosis of Aeromonas veronii Biovar sobria and Hirudo medicinalis, the
medicinal leech: a novel model for digestive tract associations. Infection and Immunity
67(1):1-7.

Greenblatt RJ, Work TM, Balazs GH, Sutton CA, Casey RN, Casey J W. 2004. The
Ozobranchus leech is a candidate mechanical vector for the fibropapilloma—associated
turtle herpesvirus found latently infecting skin tumors on Hawaiian green tlu'tles
(Chelonia mydas). Virology 321 :101-1 10.

Grimes DJ, Woese CR, MacDonell MT, Colwell RR. 1997. Systematic Study of the
Genus Vogesella gen. nov. and Its Type Species, Vogesella indigofera comb. nov.
International Journal of Systematic Bacteriology 47(1):]9-27.

Groocock GH, Getchell RG, Wooster GA, Britt KL, Batts WN, Winton JR, Casey RN,
Casey J W, Bowser PR. 2007. Detection of viral hemorrhagic septicemia in round gobies
in New York State (USA) waters of Lake Ontario and the St. Lawrence River. Diseases
of Aquatic Organisms 76(3):]87—192.

102

Gu J, Cheung KH. 2001. Phenotypic expression of Vogesella indigofera upon exposure
to hexavalent chromium, Cr6+. World Journal of Microbiology and Biotechnology
17(5):475-480.

Harikrishnan R, Balasundaram C. 2005. Modern trends in Aeromonad hydrophila disease
management with fish. Reviews in Fisheries Science 13:281-320.

Harms CE. 1960. Some parasites of catfishes from Kansas. Journal of Parasitology
46(6):695-70l .

Hemingway EE. 1908. Placobdella pediculata. American Naturalist 42(500):527-532.

Hemmingsen W, Jansen PA, MacKenzie K. 2005. Crabs, leeches, and trypanosomes: an
unholy trinity? Marine Pollution Bulletin 50:336-339.

Hoffman G. 1999. Parasites of North American Freshwater Fishes. Cornell University
Press, Ithaca, NY.

Janda J M, Abbott SL. 1998. Evolving concepts regarding the genus Aeromonas: an
expanding panorama of species, disease presentations, and unanswered questions.
Clinical Infectious Diseases 27:332-344.

Johnsen BO, Jensen AJ. 2003. Gyrodactylus salaris in Norwegian rivers. Russian
Academy of Sciences, Karelian Research Center, Institute of Biology, 38-44.

Kikuchi Y, Fukatsu T. 2002. Endosymbiotic bacteria in the esophageal organ of
glossiphoniid leeches. Applied and Environmental Microbiology 68(9):463 7-4641.

Kikuchi Y, Fukatsu T. 2005. Rickettsia infection in natural leech populations. Microbial
Ecology 49:265-271.

Kikuchi Y, Graf J. 2007. Spatial and temporal population dynamics of a naturally
occurring two-species microbial community inside the digestive tract of the medicinal
leech. Applied and Environmental Microbiology 73(6):1984-1991.

Kim, RA, Faisal M. Experimental studies confirm the wide host range of the Great Lakes
Viral Hemorrhagic Septicemia Virus Genotype IVb. Journal of Fish Diseases, in press.

Klemm DJ. 1972. The leeches (Annelida: Hirudinea) of Michigan. The Michigan
Academician 4(4):405-444.

Klemm DJ. 1977. A Review of the Leeches (Annelida: Hirudinea) in the Great Lakes
Region. The Michigan Academician 9(4):397-418.

103

Klemm DJ. 1982. Leeches (Annelida: Hirudinea) of North America. Cincinnati, Ohio:
US. Environmental Protection Agency, Environmental and Monitoring Support
Laboratory. EPA-600/3-82-025.

Klemm DJ. 1991. Taxonomy and Pollution Ecology of the Great Lakes Region Leeches
(Annelida: Hirudinea). The Michigan Academician 24:37-103.

Klemm DJ, Daniels BA, Moser WE, Lester RJ G. 2003. Biology of the Leech
Actinobdella inequiannulata Moore, 1901 (Annelida: Hirudinea: Rhynchobdellida:
Glossiphoniidae), Parasitic on the White Sucker, Catostomus commersoni Lacepéde,
1803, and the Longnose Sucker, Catostomus catostomus Forster, 1773, in Algonquin
Provincial Park, Ontario, Canada. Comparative Parasitology 70(2):]20-127.

Kniisel R, Bergmann SM, Einer-Jensen K, Casey J, Segner H, Wahli T. 2007. Virus
isolation vs. RT-PCR: which method is more successful in detecting VHSV and IHNV in
fish tissue sampled under field conditions? Journal of Fish Diseases 30:559-568.

Kruse P, Steinhagen D, Korting W. 1989. Development of Trypanoplasma borreli
(Mastigophora: Kinetoplastida) in the leech vector Piscicola geometra and its infectivity
for the common carp, Cyprinus carpio. Journal of Parasitology 75(4):527-530.

Kvach Y, Skréa KE. 2007. Metazoa parasites of the invasive round goby Apollonia
melanostoma (Neogobius melanostomus) (Pallas) (Gobiidae: Osteichthyes) in the Gulf of
Gdansk, Baltic Sea, Poland: a comparison with the Black Sea. Parasitology Research
100:767-774.

Lafferty KD, Morris AK. 1996. Altered behavior of parasitized killifish increases
susceptibility to predation by bird final hosts. Ecology 77(5):1390-1397.

Laufer AS, Siddall ME, Graf J. 2008. Characterization of the digestive-tract microbiota
of Hirudo orientalis, a European medicinal leech. Applied and Environmental
Microbiology 74(19):6151-6154.

Lee K, Webb RI, Janssen PH, Sangwan P, Romeo T, Staley JT, Fuerst JA. 2009. Phylum
Verrucomicrobia representatives share a compartmentalized cell plan with members of
bacterial phylum Planctomycetes. Microbiology 9:5-14.

Leon-Galvan MF, Carbajal N, Frickey T, Santos L. 2009. Microbial identification of the
Nichupte-Bojorquez coastal lagoon in Cancun, Mexico. Aquatic Ecology 43:197-205.

Lewis J W, Ball SJ. 1980. Ultrastructure of the epimastigotes of the fish trypanosome
Trypanosoma cobitis Mitrophanow 1883, in the crop of the leech vector, Hemiclepsis
marginata. Journal of Parasitology 66(6):948-953.

Lumsden J S, Morrison B, Yason C, Russell S, Young K, Yazdanpanah A, Huber P, Al-
Hussinee L, Stone D, Way K. 2007. Mortality event in freshwater drum Aplodinotus

104

 

grunniens from Lake Ontario, Canada, associated with viral haemorrhagic septicemia
virus, Type IV. Diseases of Aquatic Organisms 76(2):99-111.

Mace TF, Davis CC. 1972. Energetics of a host-parasite relationship as illustrated by the
leech Malmiana nuda, and the shorthom sculpin Myoxocephalus scorpius. Oikos
23(3):336-343.

MacLennan DS, Haas RC, Towns G, Thomas MV, Roseman E, Francis J, Brauncheidel
J, Halyk L, Hector D, Locke B, McGregor R, Morencie M, Murray A. 2003. Fish-
community goal and objectives for Lake St. Clair, St. Clair River, and Detroit River (St.
Clair System). Great Lakes Fishery Commission Special Publication 40 p.

Madill J. 1983. The preparation of leech specimens: relaxation, the key to preservation.
In: Proc. of 1981 Workshop on the Care and Maintenance of Natural History Collections,
edited by DJ. Faber, Syllogeus 44:37-41.

Magnarelli LA, Anderson J F . 1988. Ticks and biting insects infected with the etiologic
agent of Lyme disease, Borrelia burgdorferi. Journal of Clinical Microbiology
26(8): 1482-1486.

Marchesi JR, Sato T, Weightman AJ, Martin TA, Fry JC, Hiom SJ, Dymock D, Wade
WG. 1998. Design and evaluation of useful bacterium-specific PCR primers that amplify
genes coding for bacterial l6S rRNA. Applied and Environmental Microbiology 64:795-
99.

McCallum H, Barlow N, Hone J. 2001. How should pathogen transmission be modeled?
Trends in Ecology and Evolution 16(6):295-300.

McCreanor L, Tsuji LJ S, Wainman BC, Martin ID, Weber JP. 2008. The use of leeches
and logit log-linear contingency models to assess and monitor aquatic PCB
contamination originating from mid-Canada radar line site 050. Environmental
Monitoring Assessment 140:21 1-222.

Meyer MC. 1940. A revision of the leeches (Piscicolidae) living on fresh-water fishes of
North America. Transactions of the American Microscopical Society 59(3):354-3 76.

Meyer MC. 1946. Further notes on the leeches (Piscicolidae) living on fresh-water fishes
of North America. Transactions of the American Microscopical Society 65(3):237-249.

Meyers TR, Winton JR. 1995. Viral hemorrhagic septicemia virus in North America.
Annual Review of Fish Diseases 523-24.

Michigan Department of Environmental Quality. 1999. Lake St. Clair: Its Current State
and Future Prospects. Conference Summary Report; 1999 Nov 30-Dec 1; Port Huron,
Michigan.

105

Mills EL, Leach JH, Carlton JT, Secor CL. 1993. Exotic species in the Great Lakes: A
history of biotic crises and anthropogenic introductions. Journal of Great Lakes Research
19(1):l-54.

Miller RL, Olson Jr. AC, Miller LW. 1973. Fish parasites occurring in thirteen southern
California reservoirs. California Fish and Game 59(3):]96-206.

Morrison JR, Fox SR, Rogers WA. 1993. Control of an Infestation of a Fish Leech
(Myzobdella lugubris) on Catfishes in Tanks and Earthen Ponds. Journal of Aquatic
Animal Health 5:110-114.

Moser WE, Klemm DJ, Richardson DJ, Wheeler BA, Trauth SE, Daniels BA. 2006.
Leeches (Annelida: Hirudinida) of northern Arkansas. Journal of the Arkansas Academy
of Science 60:84-95.

Moyle PB, Cech Jr. JJ. 2003. Fishes: An Introduction to Ichthyology. Prentice-Hall,
Englewood Cliffs, NJ.

Mulcahy D, Klaybor D, Batts WN. 1990. Isolation of infectious hematopoietic necrosis
virus from a leech (Piscicola salmositica) and a copepod (Salmincola sp.), ectoparasites
of sockeye salmon Oncorhynchus nerka. Diseases of Aquatic Organisms 8:29-34.

Muzzall PM, Whelan GE, Peebles CR. 1987. Parasites of burbot, Lota Iota (family
Gadidae), from the Ford River in the Upper Peninsula of Michigan. Canadian Journal of
Zoology 65:2825-2827. ‘

Muzzall PM, Haas RC. 1998. Parasites of Walleyes, Stizostedion vitreum, from Saginaw
Bay, Lake Huron, and the Other Great Lakes. Journal of Great Lakes Research
24(1):]52-158.

Muzzall PM, Merritt GG, Bowen CA. 2003. Parasites of Burbot, Lota Iota, from Lake
Huron, Michigan, USA, with a checklist of the North American Parasites of Burbot.
Comparative Parasitology 70(2): 182-195.

Nematollahi A, Decostere A, Pasmans F, Haesebrouck F. 2003. Flavobacterium
psychrophilum infections in salmonid fish. Journal of Fish Diseases 26:563-574.

Noga EJ, Bullis RA, Miller GC. 1990. Epidemic Oral Ulceration in Largemouth Bass
(Micropterus salmoides) Associated with the Leech Myzobdella lugubris. Journal of
Wildlife Diseases 26(1):132-134.

Negele RTD. 1975. Fischegel als Schadlinge und Krankheitsubertrager. Fish und Umwelt
12123-126.

Office International des Epizootics (OIE) 2006. Infectious Pancreatic Necrosis. In:
Manual of Diagnostic Tests for Aquatic Animals, 4th edition. Chapter 2.1.8., World
Animal Health Organization, Paris.

106

Oktener A, Trilles JP, Leonardos I. 2007. Five ectoparasites from Turkish fish. Tiirkiye
Parazitoloji Demegi 31(2): 154-157.

Overstreet RM. 1973. Parasites of some penaeid shrimps with emphasis on reared hosts.
Aquaculture 2:105-140.

Paissé S, Coulon F, Goni-Urriza M, Peperzak L, McGenity TJ, Duran R. 2008. Structure
of bacterial communities along a hydrocarbon contamination gradient in a coastal
sediment. Microbiology Ecology 66:295-305.

Papema I, Zwemer DE. 1974. Massive Leech Infestation on a White Catfish (Ictalurus
catus): A Histopathological Consideration. Proceedings of the Helminthological Society
of Washington 41 (1 ):64-67.

Peckarsky BL, Fraissinet PR, Penton MA, Conklin Jr. DJ. 1990. Freshwater
Macroinvertebrates of Northeastern North America. Cornell University Publishing,
Ithaca, New York.

Pennak RW. 1989. Freshwater Invertebrates of the United States. John Wiley and Sons,
Inc., New York, New York.

Phillips RS. 2001. Current status of malaria and potential for control. Clinical
Microbiology Reviews 14(1):208-226.

Pope PB, Patel BKC. 2008. Metagenomic analysis of a freshwater toxic cyanobacteria
bloom. Microbiology Ecology 64:9-27.

Pritchard MH, Kruse GOW. 1982. The collection and preservation of animal parasites.
Lincoln: University of Nebraska press. p 1-141.

Prophet EB, Mills B, Arrington J. 1992. Laboratory methods in histotechnology. Armed
Forces Institute of Pathology, Washington, DC.

Raffel TR, Dillard JR, Hudson PJ. 2006. Field evidence for leech-bome transmission of
amphibian Ichthyophonus sp. Journal of Parasitology 92(6): 1256-1264.

Raja-Halli M, Vehmas TK, Rimaila-Parnanen E, Sainmaa S, Skall HF, Olesen NJ,
Tapiovaara H. 2006. Viral haemorrhagic septicaemia (VHS) outbreaks in Finnish
rainbow trout farms. Diseases of Aquatic Organisms 72:201-211.

Roberts LS, Janovy Jr. J. 2005. Foundations of Parasitology. McGraw-Hill Higher
Education, Madison, WI.

107

Roubal FR. 1986. Histopathology of leech, Austrobdella bilobata Ingram, infestation on
the yellowfin bream, Acanthopagrus australis (Gunther), in northern New South Wales.
Journal of Fish Diseases 9:213-223.

Ruiz-Carus R, Matheson Jr. RE, Roberts Jr. DE, Whitfield PE. 2006. The western Pacific
red lionfish, Pterois volitans (Scorpaenidae), in Florida: Evidence for reproduction and
parasitism in the first exotic marine fish established in state waters. Biological
Conservation 128:384-390.

Rupp RS, Meyer MC. 1954. Mortality among brook trout, Salvelinusfontinalis, resulting
from attacks of freshwater leeches. Copeia 1954(4):294-295.

Sambrook J, Russell DW. 2001. Molecular cloning: A laboratory manual, third edition.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Sawyer RT. 1986. Leech Biology and Behaviour, Vols l-lII. Oxford University Press,
Oxford.

Sawyer RT. 1972. North American Freshwater Leeches, Exclusive of the Piscicolidae:
with a Key to all Species. Illinois Biological Monographs 46:1-154.

Sawyer RT, Lawler AR, Overstreet RM. 1975. Marine leeches of the eastern United
States and Gulf of Mexico with a key to the species. Journal of Natural History 9:633-
667.

Schneeberger. 2000. Population Dynamics of Contemporary Yellow Perch and Walleye
Stocks in Michigan Waters of Green Bay, Lake Michigan, 1988-96. Michigan
Department of Natural Resources, Fisheries Research Report 2055, Ann Arbor.

Schramm J C, Hardman CH, Tarter DC. 1981. The Occurrence of Myzobdella lugubris
and Piscicolaria reducta (Hirudinea: Piscicolidae) on Fishes from West Virginia.
Transactions of the American Microscopical Society 100(4):427-428.

Scrimgeour GJ, Wicklurn D, Pruss SD. 1998. Selection of an aquatic indicator species to
monitor organic contaminants in trophically simple lotic food webs. Archives of
Environmental Contamination and Toxicology 35:565-572.

Shanavas KR. 1991. T rypanosoma punctati Hasan and Qasim, 1962 from Channa
punctatus Bloch in Kerala, India, with observations on its vector-phase development and
transmission. Arch. Protistenkd. 140:201-208.

Shivaji S, Ray MK, Shyamala R, Saisree L, Jagannadham MV, Kumar GS, Reddy GSN,
Bhargava PM. 1992. Sphingobacterium antarcticus sp. nov., a psychrotrophic bacterium
from the soils of Schirrnacher Oasis, Antarctica. International Journal of Systematic
Bacteriology 42(1): 102-1 06.

108

Siddall ME, Worthen PL, Johnson M, Graf J. 2007. Novel role for Aeromonasjandaei as
a digestive tract symbiont of the North American medicinal leech. Applied and
Environmental Microbiology 73(2):655-658.

Silver AC, Rabinowitz NM, Kuffer S, Graf J. 2007. Identification of Aeromonas veronii
genes required for colonization of the medicinal leech, Hirudo verbana. Journal of
Bacteriology 189(19):6763-6772.

Skall HF, Olesen NJ, Mellergaard S. 2005. Viral Hemorrhagic Septicaemia Virus in
marine fish and its implications for fish farming — a review. Journal of Fish Diseases
28:509—529.

Smith DG, Taubert BD. 1980. New records of leeches (Annelida: Hirudinea) from the
Shortnose Sturgeon (Acipenser brevirostrum) in the Connecticut River. Proceedings of
the Helminthological Society of Washington 47(1): 147-148.

Snieszko SF, Bullock GL. 1968. Freshwater fish diseases caused by bacteria of the
genera Aeromonas and Pseudomonas. United States Department of the Interior, Fish and
Wildlife Service, Fish Disease Leaflet 11.

Szalai AJ, Dick TA. 1991. Evaluation of Gill Nets, F yke Nets, and Mark-Recapture
Methods to Estimate the Number of Hirudinea and Crustacea on Fish. The Journal of
Parasitology 77(6):914-922.

Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: Molecular Evolutionary Genetics
Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24: 1 596-1599.

Tatusova TA, Madden TL. 1999. Blast 2 sequences - a new tool for comparing protein
and nucleotide sequences. Microbiology Letters 174(2):247-250.

Tartar DC, Sheridan MF. 1984. The Occurrence of the Leech Myzobdella lugubris Leidy
on Notropis atherinoides Rafinesque from Little Hurricane Creek, Putnam County, West
Virginia. Proceedings of the West Virginia Academy of Science 56(1):8.

Thomas MV, Haas RC. 2004. Status of the Lake St. Clair Fish Community and Sport
Fishery, 1996-2001. Michigan Department of Natural Resources, Fisheries Research
Report 2067, Ann Arbor.

Thompson JD, Higgins DG, Gibson TJ. 1994. CLUSTAL W: improving the sensitivity of
progressive multiple sequence alignments through sequence weighting, position specific
gap penalties and weight matrix choice. Nucleic Acids Research 22:4673-4680.

Torres P, Lopez JC, Cubillos V, Lobos C, Silva R. 2002. Visceral diphyllobothriosis in a
cultured rainbow trout, Oncorhynchus mykiss (Walbaum), in Chile. Journal of Fish
Diseases 25:375-379.

109

Trautman. 1981. The Fishes of Ohio: with illustrated keys. Ohio State University Press:
Columbus, OH.

United States Department of the Interior, Fish and Wildlife Service, and US. Department
of Commerce, US. Census Bureau. 2006 National Survey of Fishing, Hunting, and
Wildlife-Associated Recreation.

United States Environmental Protection Agency (USEPA). The Great Lakes: An
Environmental Atlas and Resource Book. Chicago, IL: USEPA, 2006.

van Elden LJR, van Kraaij MGJ, Nijhuis M, Hendriksen KAW, Dekker AW, Rozenberg-
Arska M, van Loon AM. 2002. Polymerase chain reaction is more sensitive than viral
culture and antigen testing for the detection of respiratory viruses in adults with
hematological cancer and pneumonia. Clinical Infectious Diseases 34(2):177-183.

Volonterio O, Lopez-de Leon E, Ponce de Leon R. 2004. Infestation dynamics and
histopathology of two species of freshwater leeches (Hirudinea: Piscicolidae) on teleost
fish from Uruguay. Comparative Parasitology 71(1):21-28.

Wallace IS, Gregory A, Murray AG, Munro ES, Raynard RS. 2008. Distribution of
infectious pancreatic necrosis virus (IPNV) in wild marine fish from Scottish waters with
respect to clinically infected aquaculture sites producing Atlantic salmon, Salmo salar L.

Journal of Fish Diseases 31:177-186.

Wang Q, Garrity GM, Tiedje J M, Cole JR. 2007. Na'l've Bayesian classifier for rapid
assignment of rRN A sequences into the new bacterial taxonomy. Applied and
Environmental Microbiology 73(16):5261-5267.

Wei W, Zhou Y, Wang X, Huang X, Lai R. 2008. Sphingobacterium anhuiense sp. nov.,
isolated from forest soil. International Journal of Systematic and Evolutionary
Microbiology 58:2098-2101.

White GE, Crisp NH. 1973. The occurrence of four leeches (Hirudinea: Rhynchobdellida:
Piscicolidae) on Kentucky River drainage fishes. Transactions of Kentucky Academy of
Science 34:47-48.

Whiteley M, Ott JR, Weaver EA, McLean RJC. 2001. Effects of community composition
and growth rate on aquifer biofilm bacteria and their susceptibility to betadine
disinfection. Environmental Microbiology 3(1):43-52.

Winters A. 2008. Microbial communities associated with the zebra mussel (Dreissena

polymorpha) in the Laurentian Great Lakes Basin (USA) [thesis]. East Lansing (MI):
Michigan State University. 94 p.

110

 

Wolf DP, Cone DK, Burt MDB. 2008. Recent appearance and pathology of Actinobdella
pediculata (Hirudinea) on freshwater drum, Aplodinotus grunniens Rafinesque, in Hay
Bay, Lake Ontario. Journal of Fish Diseases 31 :229-233.

Woods LC III, McCarthy MA, Kraeuter JN, Sager DR. 1990. Infestation of striped bass,
Morone saxatilis, by the leech Myzobdella lugubris. From: Pathology in marine science :
[proceedings of the Third International Colloquium on Pathology in Marine Aquaculture
held in Gloucester Point, Virginia (USA), 2-6 October 1988] / edited by Frank O.
Perkins, Thomas C. Cheng.

wright AC, Hill RT, Johnson JA, Roghman M, Colwell RR, Morris Jr. JG. 1996.
Distribution of Vibrio vulnificus in the Chesapeake Bay. Applied and Environmental
Microbiology 62(2):717-724.

Yoo S, Weon H, Jang H, Kim B, Kwon S, Go S, Stackebrandt E. 2007.
Sphingobacterium composti sp. nov., isolated from cotton-waste composts. International
Journal of Systematic and Evolutionary Microbiology 57:1590-1593.

Young JO, Spelling SM. 1986. The incidence of predation on lake-dwelling leeches.
Freshwater Biology 16:465-477.

Zara FJ, Reigada AL, Passero LF, Toyama MH. 2008. Myzobdella platensis (Hirudinida:

Piscicolidae) is true parasite of blue crabs (Crustacea: Portunidae). Journal of
Parasitology Jul 5:] [Epub ahead of print]

111