 

 

 

 

‘s. .3... 3.... .
w .

up“.

u.

. €1.73.
lean 3......
.. . may“
u w . n.
5‘ not
an...»

”may“

10!!

' 3 g,
axx-nnra ‘

‘ II.

9’.
21.1.?
05".
. .l‘t

 

 

 

2 Carl

This is to certify that the
dissertation entitled

SUBCELLULAR LOCALIZATION OF AFLATOXIN ENZYMES AND
AFLATOXIN IN ASPERGILLUS PARASITICUS

presented by

ANINDYA CHANDA

has been accepted towards fulﬁllment
of the requirements for the

Doctoral degree in Food Science and

 

 

Environmental Toxicology

Major Professor’ s Signature

47.9 0‘;

 

Date

MSU is an Afﬁrmative Action/Equal Opportunity Employer

SUBCELLULAR LOCALIZATION OF AFLATOXIN ENZYMES AND AFLATOXIN
IN ASPER GILL US PA RASITIC US
By

Anindya Chanda

A DISSERTATION
Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of
DOCTOR OF PHILOSOPHY
FOOD SCIENCE AND ENVIRONMENTAL TOXICOLOGY

2009

ABSTRACT

SUBCELLULAR LOCALIZATION OF AFLATOXIN ENZYMES AND AF LATOXIN
IN ASPERGILL US PARASIT 1C US

By

Anindya Chanda

Aﬂatoxin biosynthesis initiates as a response to environmental changes, involves a tightly
regulated expression of a 75kb gene cluster resulting at least 17 enzyme activities and
ﬁnally ends with the secretion of end products outside the cell. It is one of the most
characterized eukaryotic secondary metabolic pathways and hence serves as a useful
model to understand secondary metabolism in fungi and plants. Understanding the spatial
distribution of proteins and biosynthetic products in Aspergillus parasiticus during
aﬂatoxin synthesis helps us to understand fungal and plant secondary metabolism in
general at a cellular level. Prior to our current work, the intracellular site of aﬂatoxin
synthesis was unknown although our previous subcellular studies demonstrated
localization of early, middle and late aﬂatoxin enzymes in vesicles and vacuoles during
aﬂatoxin synthesis at peak levels.

Under aﬂatoxin inducing conditions in liquid yeast-extract sucrose medium, A.
parasiticus generates vesicles and vacuoles which exhibit signiﬁcant heterogeneity in
size (20nm to 5pm) and density. The hypothesis tested in this study is vesicles and

vacuoles are the intracellular site(s) for aﬂatoxin biosynthesis. Two independent

approaches were used to test the hypothesis.

As a ﬁrst step in conducting a detailed analysis of the role of these organelles in
aﬂatoxin synthesis, a novel “high density sucrose cushion” method was developed to
purify a vesicle-vacuole fraction using protoplasts prepared from cells harvested during
aﬂatoxin synthesis. Western blot analysis demonstrated the presence of three aﬂatoxin
enzymes (Ver-l, Vbs and OmtA) in this fraction. Vesicles and vacuoles also were
observed to represent a primary site to sequester aﬂatoxin. This puriﬁed fraction
converted sterigmatocystin, a late intermediate in aﬂatoxin biosynthesis, to aﬂatoxin B1
showing that the last two steps of aﬂatoxin biosynthesis occur in or on vesicles and
vacuoles.

Second, to clarify which compartments (vesicles or vacuoles) were functionally
involved aﬂatoxin biosynthesis vesicle-vacuole fusion (a late step in vacuole biogenesis
in eukaryotes) was interrupted by application of Sortin3 (a low mass bioactive compound
that interferes with protein trafﬁcking to the vacuole and produces a vpsl6 phenotype in
yeast) and by disruption of the Rab7/th7 GTPase homologue, vb]. Both treatments
resulted in accumulation of vesicles and signiﬁcantly higher levels of aﬂatoxins in the
medium compared to wild-type (ELISA). This increase in aﬂatoxin was not due to up-
regulation in aﬂatoxin gene expression (RT-PCR) but was due to signiﬁcantly higher
accumulation of functional enzymes (Western blot analysis) caused by elevated
accumulation of vesicles. These data provide the ﬁrst evidence that manipulation of the
vesicle transport machinery in Aspergillus affects secondary metabolism. We hypothesize
that vesicles represent the intracellular site for the late steps of aﬂatoxin biosynthesis and

aﬂatoxin export, whereas the vacuole is primarily responsible for aﬂatoxin storage and

aﬂatoxin enzyme turnover.

To my parents, who worked so hard to provide me with a good education

iv

ACKNOWLEDGEMENTS

First I like to thank Dr. John Linz, my major advisor. Without him, completion of
this work would be impossible. He is a great scientist, a great mentor and a very good
man. I feel very fortunate and proud to have worked in his laboratory.

I am also grateful to all my guidance committee members, Dr. Gregory Zeikus,
Dr. James Pestka and Dr. Leslie Bourquin who increased the value of this dissertation
with their useful comments and suggestions.

I would like to speciﬁcally thank Dr. Ludmila Roze for her constant
encouragement, unconditional support and help in almost every aspect of this
dissertation. I thank several other Linz laboratory members including Dr. Suil Kang, Dr.
Mike Miller, Dr. Li-Wei Lee, Dr. Ching-Hsun Chiou, Dr. Joo-Won Lee, Dr. Sung-Yong
Hong, Eric Harper, Anna Arthur and Katherine Artymovich for their help that I received
during my work.

Last, but not least, I thank Paramita, my lovely wife, for her constant support

during my Ph D program.

TABLE OF CONTENTS

LIST OF TABLES ........................................................................ ix
LIST OF FIGURES ........................................................................ x
LIST OF ABBREVIATIONS ............................................................ xii
CHAPTER 1
LITERATURE REVIEW... .......................................................................... l
Aﬂatoxins: background, toxicity and economic signiﬁcance ................ 1
The discovery ............................................................... 1
Toxicity ....................................................................... 3
Mechanism of carcinogenicity .......................................... 4
Economic signiﬁcance of aﬂatoxin contamination ..................... 5
Environmental signiﬁcance ............................................... 6
Aﬂatoxin biosynthesis ............................................................... 7
Our previous work ........................................................... 7
The discovery of the aﬂatoxin biosynthetic genes and
aﬂatoxin gene cluster ............................................. 7

Regulatory factors involved in aﬂatoxin gene expression. . ..9
Association between fungal development and aﬂatoxin

synthesis ............................................................. 10
Studies on signal transduction pathways and molecular
mechanisms that mediate aﬂatoxin gene expression .......... 11

Studies on compounds that inhibit aﬂatoxin production. 13
Studies on the subcellular localization of aﬂatoxin enzymes

and aﬁatoxins ....................................................... 14
Compartmentalization in secondary metabolism ................................. 15
Plants ................................................................. 15
Fungi ................................................................. 17
Signiﬁcance of this study ............................................................ 21
REFERENCES ...................................................................... 22
CHAPTER 2 ............................................................................................................ 3O
Vacuoles and vesicles are one primary site for the late steps in
aﬂatoxin biosynthesis and storage in Aspergillus ................................ 30
ABSTRACT ........................................................................... 30
INTRODUCTION ................................................................... 3 1

vi

MATERIALS AND METHODS .................................................. 35

Fungal strains and growth media .................................................. 35
Preparation of protoplasts from mycelia ................................. 35
Puriﬁcation of a vesicles-vacuoles fraction .............................. 36
Purity assessment of the vesicles-vacuoles fraction .................... 36

a. Confocal laser scanning microscopy (CLSM) .................. 37
b. Transmission Electron Microscopy (TEM) ..................... 37
0. Enzyme assays ...................................................... 38
Protein determination ....................................................... 39
Enzyme-linked immunosorbent assay (ELISA) for measuring
aﬂatoxin ....................................................................... 39
Western blot analysis ....................................................... 39
Feeding experiments ...................................................... 40
a. Feeding pure protoplasts. ......................................... 40
b. Feeding vesicles-vacuoles and non-vesicles-vacuoles
fractions ............................................................. 41
RESULTS AND DISCUSSION ................................................... 41
Protoplast isolation .......................................................... 41
Puriﬁcation of a vesicles-vacuoles fraction .............................. 42
Fraction purity ............................................................... 49
The vesicles-vacuoles fraction carries the aﬂatoxin enzymes,
Ver-l, Vbs and OmtA ...................................................... 54

Protoplasts and vesicles-vacuoles convert exogenously added
sterigrnatocystin to aﬂatoxin ............................................... 57
Intracellular site of aﬂatoxin biosynthesis in A. parasiticus. . . . . . . . ....62
REFERENCES ....................................................................... 67
CHAPTER 3 ................................................................................. 71

Aﬂatoxin biosynthesis is functionally related to vacuolar biogenesis ........ 71

ABSTRACT .......................................................................... 71

INTRODUCTION ................................................................... 72

MATERIALS AND METHODS ................................................... 75
Strains and culture conditions ............................................................ 75
Microscopy ................................................................... 76
Sortin treatment of A. parasiticus .......................................... 76
Identiﬁcation and Cloning of A. parasiticus vb] ........................ 76
Disruption of A. parasiticus vb] . ....................................... 78
Isolation of crude genomic DNA from transformants. ................ 79
Southern hybridization analysis ........................................... 79
RT-PCR analysis of gene expression. ................................. 80
Western blot analysis. ................................................... 80
Protein Determination. ................................................ 81
Aﬂatoxin estimation. ....................................................... 81
Dry weight measurements ................................................ 81

vii

RESULTS ........................................................................... 81
Effect of growth medium on vesicles-vacuoles morphology in

A. parasiticus. ............................................................ 81
Treatment of A. parasiticus with Sortin 3. .............................. 85
Sequence analysis of vb] in A. parasiticus. ............................ 86
Role of vb] in A. parasiticus vacuole biogenesis and

aﬂatoxin synthesis ........................................................... 89

Comparison of the expression (RT-PCR) of A. parasiticus
vb] and the vps] 6 homologue under aﬂatoxin inducing and

non-inducing conditions ................................................... 99
DISCUSSION ........................................................................ 102
REFERENCES ....................................................................... 111

APPENDIX I ................................................................................. 117
APPENDIX 11 .............................................................................. 121
APPENDIX III .............................................................................. 128
APPENDIX IV .............................................................................. 135

viii

LIST OF TABLES

Table 3.1. List of primers used for RT-PCR (Figure 3.6) ............................ 98
Table 3.2. List of primers used for RT-PCR (Figure 3.7) ............................ 101

Table A1. Aﬂatoxin accumulated in mycelium and medium
at various time points ......................................................... 119

ix

LIST OF FIGURES

Images in this dissertation are presented in color

Figure 1.1. Molecular structure of the four major types of aﬂatoxins ...................... 2
Figure 1.2. The 75kb aﬂatoxin gene cluster in A. parasiticus ............................. 8

Figure 1.3. Model: GPCR mediated sensing of declining glucose/sucrose
concentration in the growth medium by 24 h results in a decrease of
cAMP/PKA pathway activity. CRElbp bound to 15 CRE-like sites in the
pksA/nor-l intergenic region, is activated by dephosphorylation and forms a
complex with HAT (histone acetyltransferase) ; this initiates bidirectional
acetylation of histone H4 followed by activation of gene

transcription ................................................................................. 12
Figure 2.1. A differential interference contrast [DIC] image of

A. parasiticus (whole cell) ...................................................................... 34
Figure 2.2A-E. Microscopic analysis of puriﬁed protoplasts .............................. 44

Figure 2.3 Release of vesicles and vacuoles from protoplasts after addition of
triton-X 100 (lysis) solution. .................................................................. 48

Figure 2.4 Measurement of marker enzyme speciﬁc activities during
puriﬁcation of vesicles-vacuoles; protein extracts from whole cells, protoplasts
and vesicles-vacuoles ........................................................................... 50

Figure 2.5. Microscopic analysis of a vesicles-vacuoles fraction ........................ 51

Figure 2.6. Western blot analysis of aﬂatoxin proteins present in a vesicles-

vacuoles fraction puriﬁed from A. parasiticus during aﬂatoxin biosynthesis ........... 55
Figure 2.7 Feeding experiments ............................................................... 58
Figure 2.8. Model depicting vesicles-vacuoles as the primary intracellular site for

aflatoxin synthesis and storage ............................................................... .63
Figure 3.1. Effect of growth medium on vesicles-vacuoles morphology ............... 83
Figure 3.2 Effect of Sortin3 on SU-l ........................................................ 87
Figure 3.3 Disruption of A. parasiticus vbI gene ............................................ 90

Figure 3.4 Effect of A. parasiticus vb] on vesicles-vacuoles morphology ............... 92
Figure 3.5 Effect of vb] disruption on aﬂatoxin and aﬂatoxin proteins ................ 94
Figure 3.6 Comparison of transcript levels by RT-PCR .................................. 97
Figure 3.7. Comparison of time course transcript levels between SUI grown

in aﬂatoxin inducing conditions (YES grth medium) and non-inducing

medium (YEP growth medium) by RT-PCR .............................................. 100

Figure 3.8. Bright ﬁeld microscopy representing vacuole biogenesis
inA.parasiticus ................................................................................ . 103

Figure 3.9A-B. Model depicting the role of vacuolar biogenesis in aﬂatoxin

biosynthesis .................................................................................... 1 04
Figure AI. Western blot analysis of aﬂatoxin proteins in A. parasiticus SU-l

during a transition from exponential growth to stationary phase ....................... 119
Figure AII-a. Native gel and Western Blot analysis ..................................... 124
Figure AII b : Immunoprecipitation (IP) with anti-OmtA .............................. 125

Figure A111. 1. Protrusions and secretory vesicles observed in TEM images of pure
protoplasts ..................................................................................... 1 29

Figure AIII-2. Anti-aﬂatoxin B.(AFB1) binds on cell surface of A. parasiticus
in a speciﬁc pattern in aﬂatoxin producing conditions .................................. 132

xi

YES:

YEP:

AFBI:

TEM:

ELISA:

CLSM:

SAM:

ST:

OMST:

PCR:

RT-PCR:

EGFP:

NA:

PKS:

LIST OF ABBREVIATIONS

Yeast-extract sucrose growth medium
Yeast-extract peptone growth medium
Aﬂatoxin Bl

Transmission electron microscopy
Enzyme-linked immunosorbent assay
Confocal laser scanning microscopy
S-adenosyl methionine
Sterigmatocystin
o-Methylsterigmatocystin

Polymerase chain reaction

Reverse transcriptase polymerase chain reaction
Enhanced green ﬂuorescence protein
Norsorolinic acid

Polyketide synthase

xii

CHAPTER 1

LITERATURE REVIEW

Aﬂatoxins: Background, toxicity and economic significance
The discovery

In 1960, London witnessed a huge loss in the poultry industry. More than 100,000
turkeys died as a result of an illness named “Turkey X disease” (N esbitt et al., 1962; WP,
1961). The causative agents of this illness were contaminants in feed that were later
characterized as “aﬂatoxins” by thin layer chromatography on the suspect feed (Diener,
1969)

Aﬂatoxins are a group of biologically active secondary metabolites (mycotoxins)
produced by certain strains of imperfect fungi (Bennett & Klich, 2003). They are
polyketide-derived furanocoumarins and consist of four major structural groups (Figure
1.1) - B1, B2, G; and G2. These groups are named on the basis of their Rf values and
ﬂuorescent color under ultraviolet light (Camaghan et al., 1963). Aspergillus ﬂavus,
Aspergillus pseudotamarii, and Aspergillus ochraceoroseus produce only the B
aﬂatoxins, and Aspergillus nomius, Aspergillus bombycis, and Aspergillus parasiticus
produce both B and G aﬂatoxins (Bennett & Klich, 2003; Yu et al., 2002). Aﬂatoxins are
the most toxic and carcinogenic compounds among the known mycotoxins (Squire, 1981)
and, therefore, they have been extensively studied. Aﬂatoxins derived their name from
A. ﬂavus from which they were originally isolated. Other signiﬁcant members of the

aﬂatoxin family are M] and M2, that are oxidative forms of aﬂatoxin B1 modiﬁed in the

 

 

 

 

 

Figure 1.1. Molecular structure of the four major types of aﬂatoxins

digestive tract of some animals and isolated from milk, urine and feces (Allcroft et al.,

1966; Allcroft et al. , 1967; Yu et al., 2002).

Toxicity

Mycotoxins (low molecular weight secondary metabolites, produced by
ﬁlamentous ﬁmgi, including Aspergillus, Penicillium and F usarium), are known to cause
a toxic response, called mycotoxicosis, if ingested by higher vertebrates and other
animals (Bennett & Klich, 2003; Yabe & Nakajima, 2004; Yu et al., 2004b). Since the
discovery of Turkey X disease in 1960, aﬂatoxins are recognized as the most harmful
mycotoxins and are of greatest signiﬁcance in agriculture and human health. The diseases
caused by aﬂatoxin consumption are collectively called ‘aﬂatoxicoses’. According to the
studies done on laboratory animals and domestic animal species, the major target organ
for aﬂatoxin toxicity is the liver (Busby, 1984). Aﬂatoxins are immunosuppressive,
mutagenic, teratogenic and hepatocarcinogenic in experimental animals (Yu et al., 2002).
The effects of aﬂatoxin ingestion are dependent on close, time of exposure and nutritional
status of patients (CAST, 2003). Acute effects may involve lack of appetite, loss of
weight, gastrointestinal infection coupled with abnormal liver function tests, liver
centrilobular necrosis, bile duct proliferation, acute hepatitis, and even death (Edds, 1973;
Mwanda et al., 2005; Probst et al., 2007; Robens & Richard, 1992). Chronic aﬂatoxicosis
results in cancer and immune suppression (Bennett & Klich, 2003; Busby, 1984). The
liver is the primary target organ for these potent naturally occurring carcinogens, which
cause liver damage, liver cirrhosis, tumor induction, teratogenesis and hepato-cellular

carcinoma(Bennett & Klich, 2003). Aﬂatoxin Bl (AFBI), B2 (AFB2), G1 (AFGI) and G2

(AF G2) are the major aﬂatoxins (where B and G refer to the blue and green ﬂuorescence
observed upon UV exposure) produced by the ﬁlamentous fungi with AFB] being the
most toxic and most abundant (McLean & Dutton, 1995; Yu et al., 2004b) (the order of
toxicity is B1>G1>B2>G2).

Epidemiological studies have shown that aﬂatoxins, together with Hepatitis B
virus, cause 250,000 deaths annually in certain parts of China and sub-Saharan Africa
from hepatocellular carcinoma (Yabe & Nakajima, 2004). Aﬂatoxins are a major concern
in areas where climates are warm and humid, and grains are stored with poor drying.
Although humans and animals are susceptible to the effects of acute aﬂatoxicosis, the
likelihood of human exposure to acute levels of aﬂatoxin is more remote in well-
developed countries. In undeveloped countries, human susceptibility can vary with age,
health, and level and duration of exposure. Some notable outbreaks include the deaths of
3 Taiwanese in 1967, the deaths of more than 100 people in Northwest India in 1974 and
12 deaths in Kenya in 1982 (Agag, 2004). Aﬂatoxins also can be detected in meat, milk,
and eggs from animals that have consumed feed ingredients containing aﬂatoxins. Hence,
apart from direct risks to humans from consumption of aﬂatoxin-contaminated grains,
there also are indirect health risks to those who consume animal products containing

residues of the toxin.

Mechanism of carcinogenicity
AFBl is metabolized by the liver through the cytochrome p450 enzyme system to
the major carcinogenic metabolite AFBl-8,9 epoxide (AF B0), or to less mutagenic

forms such as AFMI, Q1 or P]. There are several pathways that AFBO can take,

resulting in cancer, toxicity or excretion through the urine. This highly reactive molecule
readily binds DNA and protein to form adducts; for example N7-guanine adducts lead to
gene mutations and cancer. One such mutation occurs in the human p53 tumour
suppressor gene at codon 249. Studies have shown that AFBO induces G>T or G>C
transversions in this codon, making it a mutational ‘hotspot’ (McLean & Dutton, 1995;
Newberne, 1973; Rundle, 2006; Staib et al., 2003). Inhibition of AFBO formation
(through disruption of the cytochrome p450 system) and/or adduct formation are
important strategies for prevention of these damaging mutations. In animal models,
metabolic detoxiﬁcation of AF BO is facilitated by induction of glutathione S-transferase
(GST), which catalyzes the reaction that binds glutathione to AFBO and renders it non-

carcinogenic.

Economic significance of aﬂatoxin contamination

Because of the serious health concerns that result from aﬂatoxin contamination of
foods and feeds worldwide, regulatory guidelines have been imposed by the US. Food
and Drug Administration for consumption and for interstate shipment of foods and feeds.
A maximum of 20 parts total aﬂatoxin per billion parts of food or feed substrate (ppb) is
the maximum allowable limit (action level) imposed according to FDA(CAST, 2003). In
some European countries total aﬂatoxin levels are regulated below 5 ppb. The stringency
in allowable limits of aﬂatoxin results in an enormous wastage of agricultural
commodities because they must be destroyed or decontaminated. One report says that the
yearly loss due to aﬂatoxin contamination in peanut and corn has been estimated to be

about $47 million (CAST, 2003). Another report says that the average aﬂatoxin

management costs in United States alone is at least $100 million per year (Robens, 2001).
The problem is further complicated because these toxins are resistant to milling,
processing and cooking (CAST, 2003) and the presence of other mycotoxins might result
in synergistic effects (Casado J.M, 2001). Aﬂatoxins along with other mycotoxins
(fumonisins, etc.) also might have serious impacts on the recently booming biofuel
industry. Their presence may affect negatively the biological conversion of
lignocellulosic materials to liquid fuel (Kyung-Hwan Han, 2007); an old study suggests
that aﬂatoxin contamination may affect biological conversion of carbohydrates to ethanol
by affecting the activity of alcohol dehydrogenase (Reiss, 1973). There are also concerns
with regard to occupational hazard associated with production of biofuels from biomass

contaminated with aﬂatoxins (A. M. Madsen, 2003).

Environmental significance

The increasing concern over global warming and a constant depletion of stratospheric
ozone layer of approximately 6% per decade (Bjdm, 2007), raise concerns regarding a
possible trend to increased accumulation of aﬂatoxins in the environment. In a previous
study, near UV light exposure enhanced accumulation of aﬂatoxin B1 in A. ﬂavus culture,
caused a mutagenic effect and induced production of aﬂatoxin by non-toxigenic strains A.
ﬂavus P-63, A. niger EN-200 and A. ochraceus P-157 (Nagy H. Aziz, 2002; Nagy H.

Aziz, 1997).

Therefore, elimination of aﬂatoxins is a critical economical, environmental and health

concern worldwide.

Aflatoxin biosynthesis

Our previous work

1.

The discovery of the aﬂatoxin biosynthetic genes and aﬂatoxin gene cluster

Our laboratory ﬁrst cloned the aﬂatoxin structural genes nor-1 and ver-I by genetic
complementation of the recipient strains B-62 (Chang et al., 1992) and CS-10 (Skory
et al., 1992). A year later genetic linkage between nor-I and ver- 1 (Skory et al.,
1993) was demonstrated and by 1995, a physical and transcript map of the aﬂatoxin
gene cluster was generated and the gene cluster was characterized (Trail et al., 1995;
Yu et al., 1995). By the early 20005 through the collaborative efforts of different
laboratories working on the aﬂatoxin biosynthetic pathway the complete nucleotide
sequence and the gene function for the entire aﬂatoxin cluster was delineated (Yu et
al., 2004a; Yu et al., 2004b). Brieﬂy the pathway (Figure 1.2.) is: acetate -)
polyketide (decaketide) 9 anthraquinones -) xanthones 9 aﬂatoxins (Yabe &
Nakajima, 2004; Yu et al., 2004b). Initially, acetate and malonyl CoA are converted
to a hexanoyl starter unit by a specialized fatty acid synthase, which is then extended
by a polyketide synthase to the early intermediate norsolorinic acid, the ﬁrst stable
precursor in the pathway. The polyketide then undergoes several enzymatic
conversions, through a series of pathway intermediates. Following the formation of
the middle pathway intermediate versicolorin B, the pathway branches to form AF B1,
and AF G1, which contain dihydrobisfuran rings and are produced from
demethylsterigmatocystin (DMST); the other branch forms AF B2, AFG2, which

contain tetrabisfuran rings and are produced from dihydrodemethylsterigmatocystin

norB
cypA
of] T

pksA
nor-1

fas-Z

fas—I
aflR
aflJ
adhA
estA
norA
ver-I
verA
avnA
verB
ava
omtB
omtA

ordA
vbs

cpr
moxY

 

li- d FF ﬂﬂiﬂﬂhhhﬁi t-t- -N——N->4-l-b

Figure 1.2. The 75kb aﬂatoxin gene cluster in A. parasiticus. Arrowheads represent

direction of transcription.

(DHDMST). A. parasiticus generally produces all four kinds of major aﬂatoxins,
whereas A. ﬂavus produces only AF B1 and AFB2 (Yabe & Nakajima, 2004). More
than 20 Aspergillus species produce sterigmatocystin (ST) as their ﬁnal product,
which is a potent mycotoxin as well. At least 17 different enzymatic steps are
involved in aﬂatoxin biosynthetic pathway. The genes for this biosynthetic pathway
are well conserved between Aspergilli and are located within a 75kb gene cluster in
the genomes of A. parasiticus and A. ﬂavus (Yabe & Nakajima, 2004; Yu et al.,

2004b).

. Regulatory factors involved in aﬂatoxin gene expression

A very important event in aﬂatoxin research was the discovery of a key positive
regulator in the pathway called AﬂR (Chang et al., 1993; Payne et al., 1993). AﬂR
belongs to a family of fungal transcriptional activators (zinc binuclear cluster), and
positively regulates the expression of most genes involved in the AF/ST biosynthesis
pathway. Gene disruption of (knocking out) aﬂR completely blocks the expression of
(most) genes in this biosynthetic pathway and eliminates aﬂatoxin or sterigmatocystin
production (Chang PK, 1999; Woloshuk GP, 1994). Our studies show that AﬂR
requires other regulatory factors to carry out its regulatory activities. Novel
transcription factors (Norpr and CRElbp), TATA binding protein and their
associated cis-acting binding sites have been identiﬁed that participate in regulation
of aﬂatoxin biosynthesis at the level of the individual gene (nor-1) and the entire
aﬂatoxin gene cluster possibly through their association with AﬂR regulation (Miller

et al., 2005; Roze et al., 2004c).

3. Association between fungal development and aflatoxin synthesis

Studies by us and others suggested that aﬂatoxin biosynthesis and fungal
development are associated. Strains that accumulate intermediates between
norsorolinic acid and versicolorin A have reduced sclerotial (asexual survival
structure) development (Skory et' al., 1992; Trail et al., 1995). On the other hand, a
gene knock-out of fas-I A or pksA that affect the pathway upstream to nor-1 increased
sclerotia production (Mahanti et al., 1996). Another gene encoding a polyketide
synthase (ﬂuP), was studied by our laboratory; disruption of ﬂuP reduced sclerotial
development (Zhou et al., 2000). Sclerotial development also is affected in the o-
methylsterigrnatocystin accumulating strain SRRC2043 (Yu et al., 1998). Various
conidiation mutants showed reduction in aﬂatoxin production (Kale et al., 2003). A
recent study showed that disruption of veA gene in A. parasiticus resulted in the
blockage of sclerotial formation as well as a blockage in the production of aﬂatoxin
intermediates (Calvo et al., 2004). According to a recent ﬁnding, the VeA protein in
A. nidulans participates in a complex that connects light-dependant developmental
regulation and control of secondary metabolism (Bayram et al., 2008). These data
strongly support a regulatory link between fungal development and secondary

metabolism in A. parasiticus.

10

4. Studies on signal transduction pathways and molecular mechanisms that
mediate aflatoxin gene expression
Aﬂatoxin gene expression is affected by many environmental factors [carbon,
nitrogen, trace elements, pH and temperature] (Miller MJ, 2006). These studies
provided the rationale for our research on signal transduction mechanisms in A.
parasiticus. One identiﬁed signaling pathway associated with aﬂatoxin biosynthesis
is a G-protein mediated signaling pathway. A. parasiticus makes aﬂatoxin in yeast
_e_xtract sucrose [YES] medium but not in yeast-gxtract-peptone (YEP) medium (when
peptone replaces sucrose) (Cary et al., 2000). In a 100mL YES liquid shake culture
(standard growth conditions, batch fermentation) A. parasiticus starts aﬂatoxin
production from 24h and the production increases exponentially until 48h. After 48h
the production slows down (Liang, 1996). Aﬂatoxin proteins and transcripts are ﬁrst
detected in the same system between 24h to 40h (Roze et al., 20073). We think that
the transition from high to low glucose/sucrose is what activates a signal transduction
pathway that is ﬁnally transduced into aﬂatoxin gene expression. A regulatory model
was ﬁrst proposed in A. nidulans where it was shown that FadA, an a-subunit of the
heterotrimeric G protein, binds GTP, the result of which promotes growth and inhibits
conidiation and sterigmatocystin production (Hicks et al., 1997). The involvement of
G protein, cAMP and PKA in regulation of aﬂatoxin biosynthesis and conidiation
was later established in the Keller laboratory (Shimizu & Keller, 2001) and in our
laboratory in A. parasiticus (Roze et al., 2004a). It was proposed that FadA/PKA
regulation mechanisms are similar in A. parasiticus and A. nidulans and cAMP levels

are involved in mediating the PKA-dependent regulatory inﬂuence on conidiation and

11

lGlucose (Sucrose)

   
 
 

Medium

‘/Membrane/
CAMPi Wall
0‘.
’ ’lP-IZA‘. ‘ \ KCytoplasm
’ m NucleIB"
/ \
CREl-bp CRElbp-P \

 

Figure 1.3. Model: GPCR mediated sensing of declining glucose/sucrose concentration
in the growth medium by 24 h results in a decrease of cAMP/PKA pathway activity.
CRElbp bound to 15 CRE-like sites in the pksA/nor-l intergenic region, is activated by
dephosphorylation and forms a complex with HAT (histone acetyltransferase) ; this
initiates bidirectional acetylation of histone H4 followed by activation of gene

transcription (Roze et al., 2007a).

aﬂatoxin biosynthesis in A. parasiticus. Recently we have also found a positive
correlation between the initiation and spread of histone H4 acetylation in aﬂatoxin
promoters and the onset of accumulation of aﬂatoxin proteins and aﬂatoxin (Roze et
al., 2007a). We proposed that the declining glucose/sucrose levels in the growth
medium is sensed by a G-protein coupled receptor, which turns on a signaling
cascade through a cAMP/PKA signaling pathway. This results in activation of a
cyclic AMP response element binding protein, called CRElbp (Roze et al., 2004c),
which then recruits histone acetyltransferase (HAT) to initiate a wave of histone H4
acetylation at or near the pksA/nor-l intergenic region. The wave then spreads
bidirectionally from this point. The CREl-like sites present in the promoters
throughout the cluster reinforce spreading of the wave by recruiting new
CRElbp/AﬂR/HAT complexes to the aﬂatoxin promoters as they are made accessible

in the conversion of heterochromatin to euchromatin (Figure 1.3.)

. Studies on compounds that inhibit aﬂatoxin production

As mentioned earlier, aﬂatoxins have received greater attention than other
mycotoxins because of their acute health and economic impacts worldwide. The long-
terrn goal of gaining knowledge about the aﬂatoxin biosynthetic pathway aims at
eliminating aﬂatoxin contamination from foodstuffs. Extensive research has been
focused on identifying compounds that inhibit aﬂatoxin biosynthesis. Our
laboratory’s contributions in this area include the ﬁndings of inhibitory effects of
ethylene and carbon dioxide (Gunterus et al., 2007; Roze er al., 2004b), wortmannin

(Lee et al., 2007) and volatiles (Roze et al., 2007b) on aﬂatoxin biosynthesis. An

13

excellent detailed review on this area of research has recently been published

(Holmes et al., 2008).

6. Studies on the subcellular localization of aﬂatoxin enzymes and aﬂatoxins

In order to design efﬁcient ways to block aﬂatoxin production (our long term
goal) sufﬁcient information (apart from understanding the genes and enzymes involved in
aﬂatoxin biosynthesis) is necessary to understand how the aﬂatoxin enzymes localize and
interact within the fungal cell to complete the biosynthetic pathway. So apart from
studying aﬂatoxin biosynthesis at the molecular level we also focused on studying
aﬂatoxin biosynthesis at the cellular and colony levels. My research was aimed at
contributing to this area. Our initial incentive for this study was to block aﬂatoxin
biosynthesis by blocking the destined localization of aﬂatoxin enzymes. But along the
way we found that secondary metabolic pathway in plants and fungi share striking
similarities in their use of the endomembrane system to effectively compartrnentalize
proteins, substrates, intermediates and products for completion of the orderly biosynthetic
process. The knowledge of orchestration and regulation of secondary metabolism at a
cellular level in an Aspergillus model could therefore be useful to discover novel
methods to control and manipulate secondary metabolism in nature.

Presented in the following section is a brief review on what is known about
compartmentalization of secondary metabolism in plants and fungi. The review ends with
a summary of our previous subcellular localization studies of aﬂatoxin proteins in A.

parasiticus.

14

Compartmentalization in secondary metabolism
Plants

Plant secondary metabolites are broadly classiﬁed on the basis of their
biosynthetic origin into alkaloids and other nitrogen compounds, phenolics and
terpenoids (Harbome, 1999.). Based on a thorough search of the literature, most sub-
cellular work has been done on alkaloid and ﬂavonoid (phenolic compounds)
metabolism.

Alkaloids are secondary metabolites derived from amino acids. Approximately
12000 alkaloids are produced by plants (F acchini & St-Pierre, 2005). Their source can be
traced to the aliphatic amino acids ornithine and lysine and the aromatic amino acids
phenylalanine, tyrosine and tryptophan (Mann, 1987). Different specialized cell types
[endodermis, laticifers, idioblasts, pericycle and cortex] have been associated with
alkaloid biosynthesis and accumulation in plants. Recent studies on trafﬁcking and
metabolic channeling in alkaloid metabolism suggest that alkaloid biosynthetic enzymes
can effectively form complexes in sub-cellular compartments. The compartmentalization
of enzyme complexes helps in sequestration of the toxic endproducts in those
compartments and protects the cell from self-toxicty. Studies done on Catharanthus
roseus have associated vacuoles with the sequestration of endogeneous alkaloids (Deus-
Neumann B, 1984; Deus-Neumann B, 1986; McCaskill et al., 1988; Roytrakul S, 2007).
For example, berberine has been shown to accumulate in vacuoles mediated by two
different transporters — an ABC transporter and a H+/berberine antiporter (Otani et al.,
2005). Nicotine, that is toxic to the cells, also accumulates in vacuoles (Saunders, 1979).

Sanguinarine, a toxic benzophenanthridine alkaloid made in opium poppy cells is made

15

in vesicles originating from the ER and which are thought to fuse with the central vacuole
(Alcantara et al., 2005). A similar vesicle-mediated-vacuolar accumulation has also been
suggested for camptothecin, a terpenoid indole alkaloid (Sirikantaramas et al., 2007).
Three excellent reviews are available on alkaloid metabolism- one on biosynthesis
(Facchini, 2001), another on synthesis and trafﬁcking (Facchini & St-Pierre, 2005) and
the most recent one on trafficking and metabolic channeling (Ziegler & Facchini, 2008).
Flavonoids, the most common among the phenolics, belong to the class of
phenylpropanoids. These are a diverse group of secondary metabolites that result from
different branches of a general biosynthetic pathway. Because of the multiple levels of
regulation involved in production of these structurally similar but functionally different
compounds, ﬂavonoid biosynthesis has been studied extensively. The pathway has been
recently reviewed in detail (Tanaka et al., 2008). Biosynthesis starts from a compound
called coumaryl CoA. Chalcone synthase, a polyketide synthase, catalyzes the reaction
of one molecule of 4-coumaryl CoA and three molecules of malonyl CoA to form a
chalcone [tetrahydroxychalcone]. From here the pathway can branch in different
directions forming different products [anthocyanins, apigenin (ﬂavone), naringenin
(ﬂavanone), kaemferol (ﬂavonol), aureusidin 6-glucoside and isosalipurposide
(chalcone)] depending on the enzyme[s] in play. From interaction studies it was proposed
that multiple ﬂavonoid biosynthetic enzymes interact to form macromolecular complexes
(Burbulis & Winkel-Shirley, 1999) at the cytoplasmic face of the endoplasmic reticulum
[ER] membrane (Hrazdina et al., 1987). It has been suggested from many studies that
ﬂavonoids, after being synthesized in the cytosol, are transported to vacuoles for storage.

A study on lisianthus (Eustoma grandiﬂorum) petals shows the involvement of pre-

16

vacuolar compartments [PVCs] derived from endoplasmic reticulum [ER] for transport
of anthocyanins to vacuoles (Zhang et al., 2006). Involvement of glutathione s-
transferase (Alfenito et al., 1998; Kitamura et al., 2004; Marrs et al., 1995), a multidrug
resistance-associated protein (MRP), ZmMrp3 (Goodman et al., 2004) and a membrane
protein [TT12] of the multidrug and toxic efﬂux [MATE] transporter family (Marinova et
al., 2007) also have been demonstrated in the mediation of anthocyanin transport to
vacuoles.

Marijuana (Cannabis sativa) is a herb that synthesizes a group of
terpenophenolics called cannabinoids. Delta (1)-tetrahydrocannabinol (THC) is one such
compound, the biosynthetic pathway of which has been characterized. Sub-cellular
localization studies in C. sativa have shown that THCA synthase that synthesizes
tetrahydrocannabinolic acid (THCA) is sorted from secretory cells into a storage cavity in
glandular trichomes (Sirikantaramas et al., 2005). In the storage cavity THCA was
functional and both the substrate [CBGA] and the product [THCA] were present. Hence
it was suggested that the storage cavity is not only the site for the accumulation of

cannabinoids but also the site for THCA biosynthesis.

Fungi
Fungal secondary metabolites occurring in nature can be broadly divided into two major
categories (Hoffmeister & Keller, 2007):

l. Polyketides and fatty acid-derived compounds, and

2. Non-ribosomal peptides and aminoacid-derived compounds

17

The ﬁrst group includes aﬂatoxin/sterigmatocystin/dothistromin, ochratoxin, aurofusarin,
aromatic polyketides, lovastatin/compactin, squalestatin, fumonisin, fusarin, equisetin,
methylsalicylic acid and related compounds, oxylipins and spore and hyphal pigments.
The second group includes penicillin and cephalosporin, cyclosporin, ergot alkaloids,
tricothecenes, diketopiperazines, asterriquinones, siderophores, HC-toxin and victorin,
AM-, AK—,AF- and ACT-toxins, destruxin, enniatins, peptaibols, peramine, loline
alkaloids, terpenes, gibberellin, indole diterpenes, botrydial, aphidicolin and carotenoids.
Unlike plants, little is known about sub-cellular organization of secondary metabolism in
fungi.

Two B-lactam antibiotics, penicillin and cephalosporin (amino acid—derived
metabolites) have been studied extensively at the sub-cellular level. Penicillin
biosynthesis involves three enzymes — ACVS ((L-aminodipyl)-L-cysteiyl-D-valine
synthetase), IPNS (isopenicillin N synthetase) and IAT (acyl-coenzyme Azisopenicillin N
acyltransferase isopenicillin N acyltransferrase). In Penicillium chrysogenum and A.
nidulans, ACVS and IPNS are located in cytosol (van de Kamp et al., 1999; van der
Lende et al., 2002) whereas IAT is located in peroxisomes (Muller et al., 1991; van de
Kamp et al., 1999; van der Lende et al., 2002). So, it is thought that penicillin
biosynthesis and storage occurs in peroxisomes. Precursors for this biosynthetic pathway
are proposed to be withdrawn from the vacuolar amino acid pool with the help of a
fraction of ACVS that is loosely bound to the vacuolar membrane (Lendenfeld et al.,
1993). Cephalosporin (a structural relative of penicillin) biosynthesis probably occurs in
the cytosol because all enzymes of cephalosporin biosynthesis pathway in

Cephalosporium acremonium have a cytosolic location (van de Kamp et al., 1999);

18

however, a recent study demonstrates the involvement of peroxisomes in cephalosporin
synthesis in Acremonium chrysogenum (Teijeira et al., 2008) but the nature of this
involvement is not clear.

Cyclosporin is a non-ribosomal peptide whose synthesis is catalyzed by a large
enzyme complex, cyclosporin synthetase. The enzyme activates the substrate amino acids
(L-valine, L-leucine, L-alanine, glycine, 2-aminobutyric acid, (4R)-4-[(E)-2-butenyl]-4-
methyl-threonineaautenyl-methyl-Thr), and D-alanine) to amino acyl adenylates and
binds them covalently via thioester linkages at prosthetic phosphopantetheine groups.
Recent studies in T olypocladium inﬂatum indicate that cyclosporine synthetase and
another enzyme alanine racemase (that synthesizes D-alanine for cyclosporine synthesis
from L-alanine) are attached loosely to the vacuolar membrane (Hoppert et al., 2001).
According to the model of Hoppert (Hoppert et al., 2001) the metabolic ﬂux in
cyclosporine synthesis is directed from the cytosol towards the vacuolar lumen in contrast
to penicillin where the metabolic ﬂux is directed from vacuoles-)cytosol-)peroxisomes.
Cyclosporin synthesis presumably occurs at the vacuolar membrane at cyclosporine
synthetase locus and is stored in vacuoles.

Aﬂatoxin biosynthesis has been studied extensively by us at the cellular level (the
only sub-cellular studies known for fungal polyketide biosynthesis). Speciﬁc rabbit
polyclonal antibodies were developed through our previous work for an early pathway
enzyme Nor-1 (Zhou, 1997), middle enzymes Ver-l (Liang, 1996) and Vbs (Chiou,
2003) and a late enzyme called OmtA (Lee, 2003). Lee and Chiou developed a
“concentric circle colony fractionation” procedure (Chiou, 2003; Lee, 2003) to determine

the sub-cellular localization of Nor-l, Ver-l, Vbs and OmtA in speciﬁc fractions of A.

19

parasiticus grown on solid aﬂatoxin inducing media. Transmission electron microscopy
(TEM) performed after immunogold labeling with antibodies against Nor-1. Ver-l, Vbs
and OmtA suggested that at a relatively early time in colony grth [24- 48h], all four
enzymes localize in the cytoplasm. However, in the cells on the substrate surface of
colonies of the same age [24-48h old], OmtA predominately localized in vesicles and
vacuoles. In a recent study, sub-cellular localization of Nor-1 and Ver-l in A. parasiticus
was monitored in real time (Hong, 2008). Hong developed an EGF P reporter system in
which expression of Nor-l and Ver-l fused to EGFP reporter were driven by wild-type
nor-1 and ver-I promoters respectively. Confocal laser scanning microscopy (CLSM)
demonstrated that these fusion proteins were synthesized in the cytoplasm but later
localized in vesicles and vacuoles. Based on these data, two possible models to explain
the intracellular site of aﬂatoxin synthesis were proposed. In the ﬁrst model, aﬂatoxin is
synthesized in the cytoplasm by aﬂatoxin enzymes that are present in that location. After
synthesis is complete, the toxin is secreted outside the cell by an unknown mechanism
[previous data demonstrated that 99% of the aﬂatoxin made by the cell was found in the
growth medium (Roze et al., 2007a)]. Aﬂatoxin enzymes are then transported to
vacuoles for proteolytic cleavage by peptidases that also localize there. According to the
second model, aﬂatoxin enzymes are made in the cytoplasm and transported to vesicles
and vacuoles. These proteins are enzymatically functional in vesicles and vacuoles and
hence, part or all of aﬂatoxin biosynthesis occurs in these organelles; the enzymes are
eventually degraded (Chiou, 2003; Lee, 2003; Skory, 1992), likely by peptidases that are

transported to these organelles. According to this model, aﬂatoxin is sequestered within

20

the vesicles and vacuoles and ﬁnally is transported outside the cell by an unknown
mechanism.

My research was aimed at determining the functional signiﬁcance of vesicles and
vacuoles in aﬂatoxin biosynthesis. The hypothesis tested in this study is that vesicles and
vacuoles are the intracellular site(s) for aﬂatoxin biosynthesis. Two approaches were
adopted to test this hypothesis. In the ﬁrst approach (as discussed in Chapter 2), I
developed a method to purify a vesicles-vacuoles fraction from A. parasiticus during
aﬂatoxin synthesis to conduct a functional analysis of this fraction. In the second
approach (as discussed in Chapter 3), I interrupted vacuole biogenesis genetically and
chemically to determine the individual roles of vesicles and vacuoles in aﬂatoxin

biosynthesis.

Significance of this study

The current study has increased our understanding about the role of vesicles and vacuoles
in aﬂatoxin biosynthesis and the organization of this polyketide biosynthetic pathway
within the cell. Follow up studies will characterize the composition of these organelles in
detail. The knowledge gained from these studies can be applied directly to solving the
aﬂatoxin contamination problem by providing novel targets to block aﬂatoxin
contamination. This will have positive outcomes on human and animal health and the
global economy and will also help in development of new strategies to manipulate

secondary metabolism in nature for the beneﬁt of human kind.

21

REFERENCES

A. M. Madsen, W. E., G. Blomquist, U. Midtgard (2003).Biofuels and Occupational
Health - with Special Focus on Microbial factors: Ekspressen Tryk & Kopicenter.

Agag, B. I. (2004). Mycotoxins in foods and feeds 1 - Aﬂatoxins. Ass Univ Bull Environ
Res 7.

Alcantara, J., Bird, D. A., F ranceschi, V. R. & Facchini, P. J. (2005). Sanguinarine
biosynthesis is associated with the endoplasmic reticulum in cultured opium poppy cells
after elicitor treatment. Plant Physiol 138, 173-183.

Alfenito, M. R., Souer, E., Goodman, C. D., Buell, R., Mol, J., Koes, R. & Walbot, V.
(1998). Functional complementation of anthocyanin sequestration in the vacuole by
widely divergent glutathione S-transferases. Plant Cell 10, 1135-1149.

Allcroft, R., Rogers, 11., Lewis, G., Nabney, J. & Best, P. E. (1966). Metabolism of
aﬂatoxin in sheep: excretion of the "milk toxin". Nature 209, 154-155.

Allcroft, R., Roberts, B. A. & Butler, W. H. (196”. Aﬂatoxin in milk. Food Cosmet
T oxicol 5, 597.

Bayram, 0., Krappmann, 8., Ni, M. & other authors (2008). VelBNeA/LaeA
complex coordinates light signal with fungal development and secondary metabolism.
Science 320, 1504-1506.

Bennett, J. W. & Klich, M. (2003). Mycotoxins. Clin Microbiol Rev 16, 497-516.

Bjiirn, L. O. (2007). Stratospheric ozone, ultraviolet radiation, and cryptogams.
Biological Conservation 135, 326.

Burbulis, I. E. & WinkeI-Shirley, B. (1999). Interactions among enzymes of the
Arabidopsis ﬂavonoid biosynthetic pathway. Proc Natl Acad Sci U S A 96, 12929-12934.

Busby, W. F. J. a. G. N. W. (1984).Aﬂatoxins in "Chemical carcinogens", pp. 945-1136.
Edited by C. E. Searle. Washington DC: American Chemical Society.

Calvo, A. M., Bok, J., Brooks, W. & Keller, N. P. (2004). veA is required for toxin and
sclerotial production in Aspergillus parasiticus. Appl Environ Microbiol 70, 4733-4739.

Camaghan, R. B., Hartley, R. D. & O'Kelly, J. (1963). Toxicity And Fluorescence
Properties Of The Aﬂatoxins. Nature 200, 1101.

22

Cary, J. W., Montalbano, B. G. & Ehrlich, K. C. (2000). Promoter elements involved
in the expression of the Aspergillus parasiticus aﬂatoxin biosynthesis pathway gene
avnA. Biochim Biophys Acta 1491, 7-12.

Casado J.M, T. M., Masih D.T, Chulze S, Rubinstein HR. (2001). Experimental
subchronic mycotoxicoses in mice: individual and combined effects of dietary exposure
to fumonisins and aﬂatoxin Bl. Food Chem T axical 39, 579-586.

CAST (2003).Mycotoxins: risks in plant, animal, and human systems. Ames, Iowa:
Council for Agricultural Science and Technology.

Chang P.K, Y. J., Bhatnagar D, Cleveland TE 1999; Mycopathologia.l47(2):105-12.
(1999). Repressor-AF LR interaction modulates aﬂatoxin biosynthesis in Aspergillus
parasiticus. Mycapathalagia 147, 105-112.

Chang, P. K., Skory, C. D. & Linz, J. E. (1992). Cloning of a gene associated with
aﬂatoxin B1 biosynthesis in Aspergillus parasiticus. Curr Genet 21, 231-233.

Chang, P. K., Cary, J. W., Bhatnagar, D., Cleveland, T. E., Bennett, J. W., Linz, J.
E., Woloshuk, C. P. & Payne, G. A. (1993). Cloning of the Aspergillus parasiticus apa-
2 gene associated with the regulation of aﬂatoxin biosynthesis. Appl Environ Microbial
59, 3273-3279.

Chiou, C.-H. (2003).Position-dependent regulation of the nor-1 promoter in the aﬂatoxin

gene cluster and immuno-localization of proteins involved in aﬂatoxin biosynthesis, pp.
xi, 141 leaves: Michigan State University. Dept. of Food Science and Human Nutrition.

Deus-Neumann B, Z. M. (1984). A highly selective alkaloid uptake system in vacuoles
of higher plants. Planta 162, 250-260.

Dans-Neumann B, Z. M. (1986). Accumulation of alkaloids in plant vacuoles does not
involve an ion-trap mechanism. Planta 167, 44-53.

Diener, U. L., and N. D. Davis (1969). Aﬂataxinformatian by Aspergillusﬂavus: In L.
A. Goldblatt (ed.),Aﬂatoxin. Academic Press Inc., New York and London.

Edds, G. T. (1973). Acute aﬂatoxicosis: a review. J Am Vet Med Assoc 162, 304-309.
Facchini, P. J. (2001). Alkaloid biosynthesis in plants: Biochemistry, Cell Biology,
Molecular Regulation, and Metabolic Engineering Applications. Annu Rev Plant Physiol
Plant Mol Biol 52, 29-66.

Facchini, P. J. & St-Pierre, B. (2005). Synthesis and trafﬁcking of alkaloid biosynthetic
enzymes. Curr Opin Plant Biol 8, 657-666.

23

Goodman, C. D., Casati, P. & Walbot, V. (2004). A multidrug resistance-associated
protein involved in anthocyanin transport in Zea mays. Plant Cell 16, 1812-1826.

Gunterus, A., Roze, L. V., Beaudry, R. & Linz, J. E. (2007). Ethylene inhibits
aﬂatoxin biosynthesis in Aspergillus parasiticus grown on peanuts. Faad Microbial 24,
658-663.

Harborne, J. B. (1999.). Chemicals From Plants. London: ICP.

Hicks, J. K., Yu, J. H., Keller, N. P. & Adams, T. H. (1997). Aspergillus sporulation
and mycotoxin production both require inactivation of the FadA G alpha protein-
dependent signaling pathway. Emba J 16, 4916-4923.

Hoffmeister, D. & Keller, N. P. (2007). Natural products of ﬁlamentous fungi: enzymes,
genes, and their regulation. Nat Prod Rep 24, 393-416.

Holmes, R. A., Boston, R. S. & Payne, G. A. (2008). Diverse inhibitors of aﬂatoxin
biosynthesis. Appl Microbial Biatechnal 78, 559-572.

Hong, S.-Y. (2008).Analysis of transport and sub-cellular localization of aﬂatoxin
biosynthetic enzymes, Ver-l and Nor-1, using EGF P fusions in Aspergillus parasiticus.,
pp. 311: Michigan State University. Dept. of Food Science and Human Nutrition, 2008.

Hoppert, M., Gentzsch, C. & Schorgendorfer, K. (2001). Structure and localization of
cyclosporin synthetase, the key enzyme of cyclosporin biosynthesis in Tolypocladium
inﬂatum. Arch Microbiol 176, 285-293.

Hrazdina, G., Zobel, A. M. & Hoch, H. C. (1987). Biochemical, immunological, and
immunocytochemical evidence for the association of chalcone synthase with endoplasmic
reticulum membranes. Prac Natl Acad Sci U S A 84, 8966-8970.

Kale, S. P., Cary, J. W., Baker, C., Walker, D., Bhatnagar, D. & Bennett, J. W.
(2003). Genetic analysis of morphological variants of Aspergillus parasiticus deﬁcient in
secondary metabolite production. Mycal Res 107, 831-840.

Kitamura, S., Shikazono, N. & Tanaka, A. (2004). TRANSPARENT TESTA 19 is
involved in the accumulation of both anthocyanins and proanthocyanidins in Arabidopsis.
Plant J37, 104-114.

Kyung-Hwan Han, J.-H. K. a. S. H. Y. (2007). Optimizing lignocellulosic feedstock for
improved biofuel productivity and processing. Biaﬁtels, Biaprad Biaref 1, 135-146.

Lee, J. W., Roze, L. V. & Linz, J. E. (2007). Evidence that a wortmannin-sensitive
signal transduction pathway regulates aﬂatoxin biosynthesis. Mycalagia 99, 562-568.

24

Lee, L.-W. (2003).Functional analysis of OmtA and subcellular localization of aﬂatoxin
enzymes in Aspergillus parasiticus, pp. xi, 141 leaves: Michigan State University. Dept.
of Food Science and Human Nutrition, 2003.

Lendenfeld, T., Ghali, D., Wolschek, M., Kubicek-Pranz, E. M. & Kubicek, C. P.
(1993). Subcellular compartrnentation of penicillin biosynthesis in Penicillium
chrysogenum. The amino acid precursors are derived from the vacuole. J Biol Chem 268,
665-671.

Liang, S.-H. (1996).The function and expression of the ver-l gene and localization of the
ver-l protein involved in aﬂatoxin B b1 5 biosynthesis in Aspergillus parasiticus, pp. xi,
135 leaves: Michigan State University. Dept. of Food Science and Human Nutrition,
1996.

Mahanti, N., Bhatnagar, D., Cary, J. W., Joubran, J. & Linz, J. E. (1996). Structure
and function of fas-lA, a gene encoding a putative fatty acid synthetase directly involved
in aﬂatoxin biosynthesis in Aspergillus parasiticus. Appl Environ Microbial 62, 191-195.

Mann, J. (1987). Secondary metabolism, 2 edn: Oxford University Press.

Marinova, K., Pourcel, L., Weder, B., Schwarz, M., Barron, D., Routaboul, J. M.,
Debeaujon, I. & Klein, M. (2007). The Arabidopsis MATE transporter TT12 acts as a
vacuolar ﬂavonoid/H+ -antiporter active in proanthocyanidin-accurnulating cells of the
seed coat. Plant Cell 19, 2023-2038.

Marrs, K. A., Alfenito, M. R., Lloyd, A. M. & Walbot, V. (1995). A glutathione S-
transferase involved in vacuolar transfer encoded by the maize gene Bronze-2. Nature
375, 397-400.

McCaskill, D. G., Martin, D. L. & Scott, A. I. (1988). Characterization of Alkaloid
Uptake by Catharanthus roseus (L.) G. Don Protoplasts. Plant Physiol 87, 402-408.

McLean, M. & Dutton, M. F. (1995). Cellular interactions and metabolism of aﬂatoxin:
an update. Pharmacol Ther 65, 163-192.

Miller, M. J., Roze, L. V., Trail, F. & Linz, J. E. (2005). Role of cis-acting sites NorL,
a TATA box, and AﬂRl in nor-1 transcriptional activation in Aspergillus parasiticus.
Appl Environ Microbial 71, 1539-1545.

Miller MJ, L. J. (2006). Genetic mechanisms involved in regulation of mycotoxin
biosynthesis. Food Biotechnology.

Muller, W. H., van der Krift, T. P., Krouwer, A. J., Wosten, H. A., van der Voort, L.

H., Smaal, E. B. & Verkleij, A. J. (1991). Localization of the pathway of the penicillin
biosynthesis in Penicillium chrysogenum. Emba J 10, 489-495.

25

Mwanda, O. W., Otieno, C. F. & Omonge, E. (2005). Acute aﬂatoxicosis: case report.
East Afr Med J 82, 320-324.

Nagy H. Aziz, B. S. (2002). Inﬂuence of UV radiation and nitrosamines on the induction
of mycotoxins synthesis by nontoxigenic moulds isolated from feed samples.

Nahrung/Faad 46, 118-121.

Nagy H. Aziz, M., L.A.E. (1997). Inﬂuence of white light, near-UV irradiation and other
environmental conditions on production of aﬂatoxin B1 by Aspergillus ﬂavus and
ochratoxin A by Aspergillus ochraceus. Nahrung.

Nesbitt, B. F., O'Kelly, J., Sargeant, K. & Sheridan, A. (1962). Aspergillus ﬂavus and
turkey X disease. Toxic metabolites of Aspergillus ﬂavus. Nature 195, 1062-1063.

Newberne, P. M. (1973). Chronic aﬂatoxicosis. J Am Vet Med Assoc 163, 1262-1267.

Otani, M., Shitan, N., Sakai, K., Martinoia, E., Sato, F. & Yazaki, K. (2005).
Characterization of vacuolar transport of the endogenous alkaloid berberine in Coptis
japonica. Plant Physiol 138, 1939-1946.

Payne, G. A., Nystrom, G. J., Bhatnagar, D., Cleveland, T. E. & Woloshuk, C. P.
(1993). Cloning of the aﬂ-2 gene involved in aﬂatoxin biosynthesis from Aspergillus
ﬂavus. Appl Environ Microbial 59, 156-162.

Probst, C., N japan, H. & Cotty, P. J. (2007). Outbreak of an acute aﬂatoxicosis in
Kenya in 2004: identiﬁcation of the causal agent. Appl Environ Microbial 73, 2762-2764.

Reiss, J. (1973). Inﬂuence of the mycotoxins aﬂatoxin B1, rubratoxin B, patulin and
diacetoxyscirpenol on the fermentation activity of baker's yeast. Mycapathal Mycal Appl
51, 337-345.

Robens, J. (2001). The costs of mycotoxin management to the USA: management of
aﬂatoxins in the United States, 2-8.

Robens, J. F. & Richard, J. L. (1992). Aﬂatoxins in animal and human health. Rev
Environ Contam T axical 127, 69-94.

Roytrakul S, V. R. (2007). Role of vacuolar transporter proteins in plant secondary
metabolism: Catharanthusroseus cell culture. Phytachem Rev 6, 383—396.

Roze, L. V., Beaudry, R. M., Keller, N. P. & Linz, J. E. (2004a). Regulation of

aﬂatoxin synthesis by FadA/cAMP/protein kinase A signaling in Aspergillus parasiticus.
Mycapathalogia 158, 219-232.

26

Roze, L. V., Calvo, A. M., Gunterus, A., Beaudry, R., Kall, M. & Linz, J. E. (2004b).
Ethylene modulates development and toxin biosynthesis in aspergillus possibly via an
ethylene sensor-mediated signaling pathway. J F aad Prat 67, 438-447.

Roze, L. V., Miller, M. J., Rarick, M., Mahanti, N. & Linz, J. E. (2004c). A novel
cAMP-response element, CREl , modulates expression of nor-1 in Aspergillus
parasiticus. J Biol Chem 279, 27428-27439.

Roze, L. V., Arthur, A. E., Hong, S. Y., Chanda, A. & Linz, J. E. (2007a). The
initiation and pattern of spread of histone H4 acetylation parallel the order of
transcriptional activation of genes in the aﬂatoxin cluster. Mal Microbial 66, 713-726.

Roze, L. V., Beaudry, R. M., Arthur, A. E., Calvo, A. M. & Linz, J. E. (2007b).
Aspergillus volatiles regulate aﬂatoxin synthesis and asexual sporulation in Aspergillus
parasiticus. Appl Environ Microbial 73, 7268-7276.

Rundle, A. (2006). Carcinogen-DNA adducts as a biomarker for cancer risk. Mutat Res
600, 23-36.

Saunders, J. A. (1979). Investigations of Vacuoles Isolated from Tobacco: I.
Quantitation of Nicotine. Plant Physiol 64, 74-78.

Shimizu, K. & Keller, N. P. (2001). Genetic involvement of a cAMP-dependent protein
kinase in a G protein signaling pathway regulating morphological and chemical
transitions in Aspergillus nidulans. Genetics 157, 591-600.

Sirikantaramas, S., Taura, F., Tanaka, Y., lshikawa, Y., Morimoto, S. & Shoyama,
Y. (2005). Tetrahydrocannabinolic acid synthase, the enzyme controlling marijuana
psychoactivity, is secreted into the storage cavity of the glandular trichomes. Plant Cell
Physiol 46, 1578-1582.

Sirikantaramas, S., Sudo, H., Asano, T., Yamazaki, M. & Saito, K. (2007). Transport
of camptothecin in hairy roots of Ophiorrhiza pumila. Phytochemistry 68, 2881-2886.

Skory, C. D. (1992).Isolation and characterization of a gene from Aspergillus parasiticus
associated with the conversion of versicolorin A to sterigmatocystin in aﬂatoxin
biosynthesis, pp. x, 135 leaves: Michigan State University. Dept. of Food Science and
Human Nutrition, 1992.

Skory, C. D., Chang, P. K., Cary, J. & Linz, J. E. (1992). Isolation and
characterization of a gene from Aspergillus parasiticus associated with the conversion of
versicolorin A to sterigmatocystin in aﬂatoxin biosynthesis. Appl Environ Microbial 58,
3527-3 537.

27

Skory, C. D., Chang, P. K. & Linz, J. E. (1993). Regulated expression of the nor-1 and
ver-l genes associated with aﬂatoxin biosynthesis. Appl Environ Microbial 59, 1642-
1646.

Squire, R. A. (1981). Ranking animal carcinogens: a proposed regulatory approach.
Science 214, 877-880.

Staib, F., Hussain, S. P., Hofseth, L. J., Wang, X. W. & Harris, C. C. (2003). TP53
and liver carcinogenesis. Hum Mutat 21, 201-216.

Tanaka, Y., Sasaki, N. & Ohmiya, A. (2008). Biosynthesis of plant pigments:
anthocyanins, betalains and carotenoids. Plant J54, 733-749.

Teijeira, F., Ullan, R. V., Guerra, S. M., Garcia-Estrada, C., Vaca, I. & Martin, J. F.
(2008). The transporter CefM involved in translocation of biosynthetic intermediates is
essential for cephalosporin production. Biochem J.

Trail, F., Mahanti, N., Rarick, M., Mehigh, R., Liang, S. H., Zhou, R. & Linz, J. E.
(1995). Physical and transcriptional map of an aﬂatoxin gene cluster in Aspergillus
parasiticus and functional disruption of a gene involved early in the aﬂatoxin pathway.
Appl Environ Microbial 61, 2665-2673.

van de Kamp, M., Driessen, A. J. & Konings, W. N. (1999). Compartmentalization and
transport in beta-lactam antibiotic biosynthesis by ﬁlamentous fungi. Antonie Van
Leeuwenhoek 75, 41-78.

van der Lende, T. R., van de Kamp, M., Berg, M., Sjollema, K., Bovenberg, R. A.,
Veenhuis, M., Konings, W. N. & Driessen, A. J. (2002). delta-(L-alpha-Aminoadipyl)-
L-cysteinyl-D-valine synthetase, that mediates the ﬁrst committed step in penicillin
biosynthesis, is a cytosolic enzyme. Fungal Genet Biol 37, 49-55.

Woloshuk C.P, F. K. R., Brewer J.F, Bhatnagar D, Cleveland T.E, Payne G.A.
(1994). Molecular characterization of aﬂR, a regulatory locus for aﬂatoxin biosynthesis.
Appl Environ Microbial 60, 2408-2414.

WP, B. (1961). Turkey “X” disease. Turkeys 9, 52, 55—58, 61—71, 77.

Yabe, K. & Nakajima, H. (2004). Enzyme reactions and genes in aﬂatoxin biosynthesis.
Appl Microbial Biatechnal 64, 745-755.

Yu, J., Chang, P. K., Cary, J. W., Wright, M., Bhatnagar, D., Cleveland, T. E.,
Payne, G. A. & Linz, J. E. (1995). Comparative mapping of aﬂatoxin pathway gene
clusters in Aspergillus parasiticus and Aspergillus ﬂavus. Appl Environ Microbial 61,
2365-2371.

28

Yu, J., Chang, P. K., Ehrlich, K. C., Cary, J. W., Montalbano, B., Dyer, J. M.,
Bhatnagar, D. & Cleveland, T. E. (1998). Characterization of the critical amino acids of
an Aspergillus parasiticus cytochrome P-450 monooxygenase encoded by ordA that is
involved in the biosynthesis of aﬂatoxins B1, G1, B2, and G2. Appl Environ Microbial 64,
4834-4841.

Yu, J., Bhatnagar, D. & Ehrlich, K. C. (2002). Aﬂatoxin biosynthesis. Rev Iberaam
Mica] 19, 191-200.

Yu, J., Bhatnagar, D. & Cleveland, T. E. (2004a). Completed sequence of aﬂatoxin
pathway gene cluster in Aspergillus parasiticus. FEBS Lett 564, 126-130.

Yu, J., Chang, P. K., Ehrlich, K. C. & other authors (2004b). Clustered pathway
genes in aﬂatoxin biosynthesis. Appl Environ Microbial 70, 1253-1262.

Zhang, H., Wang, L., Deroles, S., Bennett, R. & Davies, K. (2006). New insight into
the structures and formation of anthocyanic vacuolar inclusions in ﬂower petals. BMC
Plant Biol 6, 29.

Zhou, R. (1997).The function, accumulation and localization of the Nor-1 protein
involved in aﬂatoxin biosynthesisthe function of the ﬂngene associated with sporulation
in Aspergillus parasiticus, pp. xiii, 224 leaves: Michigan State University. Dept. of Food
Science and Human Nutrition and Multidisciplinary Graduate Program in Environmental
Toxicology, 1997.

Zhou, R., Rasooly, R. & Linz, J. E. (2000). Isolation and analysis of ﬂuP, a gene
associated with hyphal growth and sporulation in Aspergillus parasiticus. Mal Gen Genet
264, 514-520.

Ziegler, J. & Facchini, P. J. (2008). Alkaloid biosynthesis: metabolism and trafﬁcking.
Annu Rev Plant Biol 59, 735-769.

29

CHAPTER 2

VESICLES AND VACUOLES ARE ONE PRIMARY SITE FOR THE LATE

STEPS IN AF LATOXIN BIOSYNTHESIS AND STORAGE IN ASPERGILLUS

ABSTRACT

Aﬂatoxin biosynthesis initiates in response to environmental signals, involves the tightly
regulated expression of a 75kb gene cluster resulting in the coordinated activity of at least
17 enzymes, and ends with secretion of the end product(s) outside the cell. Aﬂatoxin
synthesis is one of the most highly characterized eukaryotic secondary metabolic
pathways and serves as a useful model to understand secondary metabolism in fungi and
plants. Our previous studies demonstrated localization of early, middle and late aﬂatoxin
enzymes in vesicles and vacuoles during aﬂatoxin synthesis; these organelles exhibited
signiﬁcant heterogeneity in size (20nm to 5pm) and density. In the current study, we
developed methods to purify and conduct functional analyses of vesicles and vacuoles
from Aspergillus parasiticus protoplasts generated during aﬂatoxin synthesis using a
‘high density sucrose cushion’ method. Western blot analysis demonstrated the presence
of three aﬂatoxin enzymes (V er-l, Vbs and OmtA) in this puriﬁed organelle fraction.
Vesicles and vacuoles also were observed to represent a primary site to sequester
aﬂatoxin. The conversion of sterigmatocystin, a late intermediate in aﬂatoxin

biosynthesis, to aﬂatoxin B. was demonstrated in this puriﬁed fraction showing that the

30

last two steps of aﬂatoxin biosynthesis occur in or on vesicles and vacuoles. These data
demonstrate a strong functional link between aﬂatoxin synthesis and storage, and vesicles

and vacuoles in A. parasiticus.

INTRODUCTION

Secondary metabolites, natural products generated by ﬁlamentous fungi, plants,
bacteria, and animals, have an enormous impact on humans due to their application in
health, medicine and agriculture. Many secondary metabolites are beneﬁcial (antibiotics,
statins, morphine, etc.), while phytotoxins (e.g. ricin, crotin, amygdalin) and fungal
poisons called mycotoxins (e.g. aﬂatoxin, sterigmatocystin, ﬁrmonisin) are detrimental to
humans. To control or customize biosynthesis of these natural products we must
understand how and where secondary metabolism is orchestrated within the cell.

Aﬂatoxins are polyketide-derived furanocoumarins synthesized primarily by the
ﬁlamentous fungi A. parasiticus and Aspergillus ﬂavus (Bennett & Klich, 2003; Miller
MJ, 2006). Aﬂatoxin biosynthesis is one of the most highly characterized secondary
metabolic pathways and serves as a model to understand secondary metabolism in
eukaryotes. Aﬂatoxin B1 (AFBI) is the most potent naturally occurring carcinogen
known (Miller MJ, 2006) and has signiﬁcant health and economic impacts worldwide
(Miller MJ, 2006; Yabe & Nakajima, 2004). Aﬂatoxin biosynthesis involves at least 17
enzyme activities encoded by 25 or more genes that are clustered in a 75-Kb region on
one chromosome (Miller MJ, 2006; Yabe & Nakajima, 2004; Yu et al., 2002). The

molecular mechanisms that regulate aﬂatoxin biosynthesis have been studied extensively

31

by us and others [reviewed in (Keller et al., 2005 ; Miller MJ, 2006)]. We are currently
studying the spatial distribution of aﬂatoxin enzymes and pathway intermediates at the
sub-cellular level to identify targets to control aﬂatoxin synthesis.

In plants, vesicles and vacuoles sequester secondary metabolites to protect host
cells from self-toxicty (Facchini & St-Pierre, 2005; Tanaka et al., 2008). Multi-enzyme
complexes involved in synthesis of these metabolites localize either in sub-cellular
compartments [alkaloid biosynthesis (Facchini & St-Pierre, 2005)] or in the cytosol
[ﬂavonoid biosynthesis (Tanaka et al., 2008)]. Less is known about intracellular sites of
secondary metabolism in fungi. Penicillin, a B-lactam antibiotic (amino-acid-derived
fungal secondary metabolite) is thought to be synthesized in peroxisomes, where the ﬁnal
two enzymes in the biosynthetic pathway localize in Penicillium chrysogenum (van de
Kamp et al., 1999). Cephalosporin, a structural relative of penicillin, is thought to be
made in the cytosol in Cephalosporium acremonium where most of the biosynthetic
enzymes localize (van de Kamp et al., 1999). However, a recent study in Acremonium
chrysogenum demonstrated involvement of peroxisomes in cephalosporin synthesis
(Teijeira et al., 2008). In Tolypocladium inﬂatum, cyclosporin (a non-ribosomal peptide
derived fungal secondary metabolite), and a key pathway enzyme (cyclosporin
synthetase) were detected in vacuoles (Hoppert et al., 2001); the functional signiﬁcance
of this location is not yet clear.

Unlike for amino acid and non-ribosomal peptide-derived secondary metabolites,
the intracellular site of fungal polyketide-derived secondary metabolites was not known
prior to our current work. We previously used transmission electron microscopy (TEM)

and immunogold-labeled antibodies to detect OmtA (a late enzyme in aﬂatoxin

32

biosynthesis) primarily in the cytoplasm in cells grown for 24 to 48 h under aﬂatoxin
inducing conditions. However, OmtA localized primarily to vacuole-like organelles (Lee
et al., 2004) in cells on the substrate surface of colonies (also at 24 h-48 h), while Nor-1
(an early enzyme in the pathway), Ver-l and Vbs (middle enzymes) were detected
primarin in the cytoplasm (Chiou et al., 2004; Lee et al., 2004). More recently, we
demonstrated that Nor-1 or Ver-l fused to EGFP localized to vesicles and vacuoles
(Hong, 2008). Despite compelling evidence supporting the localization of multiple
aﬂatoxin enzymes in vesicles and vacuoles, it was not clear whether aﬂatoxin
biosynthesis occurred in these organelles or if the aﬂatoxin enzymes localized to the
vacuole for turnover.

As a ﬁrst step to detennine the functional role of these organelles in Aspergillus
secondary metabolism, we developed a novel ‘high density sucrose cushion’ method for
puriﬁcation of a vesicles-vacuoles fraction from A. parasiticus during aﬂatoxin synthesis
(Figure 2.1). Western blot analysis showed the presence of three aﬂatoxin enzymes (Ver-
1, Vbs and OmtA) in this fraction. This fraction also was the predominate site for
sequestering aﬂatoxin. Signiﬁcantly, the fraction converted exogenously added
sterigmatocystin to aﬂatoxin in vitra, demonstrating that the ﬁnal two steps in aﬂatoxin
biosynthesis can be carried out by vesicles and vacuoles. This current work is the ﬁrst to

demonstrate the primary sub-cellular site(s) for the late steps in aﬂatoxin biosynthesis.

33

 

Figure 2.1. A differential interference contrast [DIC] image of A. parasiticus (whole
cell): A. parasiticus was grown for 36 h under aﬂatoxin inducing conditions and observed
by CLSM. Organelles in whole cells were divided into two subsets; organelles Z 2.5um
were designated ‘vacuoles’ (black arrows) and those <2.5um were designated as

‘vesicles’ (white arrows).

34

MATERIALS AND METHODS
Fungal strains and growth media

A. parasiticus strain SU-l (ATCC 56775), a wild-type aﬂatoxin producer, was used
in this study. A. parasiticus SU-l conidiospores (spores) from a frozen spore stock were
inoculated into YES liquid medium [contains 2% yeast extract and 6% sucrose; pH 5.8]
at 104 spores per ml and incubated at 30°C with shaking at 150 rpm for 36h (standard
growth conditions). Western blot analysis demonstrated accumulation of aﬂatoxin

enzymes beginning at 30 h under these growth conditions (Roze et al. , 2007).

Preparation of protoplasts from mycelia

Protoplasts were prepared by a published method (Birch et al. , 2001). Mycelia grown
for 36h in YES media were harvested by ﬁltration through miracloth [Calbiochem]. The
miracloth carrying the mycelia was placed on paper-towels for 30 min to absorb the
remaining medium. The mycelia were resuspended [40mg of mycelia per mL] in lysis
buffer [10 mM potassium phosphate, pH 5.8] containing 1.2 M MgSO4 as osmotic
stabilizer and 50 mg/mL of driselase and lysing enzymes [both from Sigma, St.Louis, St.
Louis, MO]. The suspension was incubated for 7 h 30 min at 30°C with shaking at 100
rpm. The protoplasts were separated from debris by ﬁltration through a double layer of
cheese cloth and then nylon mesh (30 um mesh, 64 um thickness) [Spectrum Labs,
Rancho Dominguez, CA]. 25 mL of ﬁltrate was overlaid with 25 mL of separation buffer
[0.6 M sorbitol, 100 mM Tris-Cl, pH 7.0] in a 50 mL conical tube and centrifuged at
1500 x g at room temperature (RT) for 15 min. Protoplasts (106 obtained per gram of

mycelia) were collected from the interface in a total volume of 5 mL, mixed with an

35

equal volume of protobuffer [1.2 M sorbitol, 10 mM Tris-Cl, pH 7.5], and centrifuged at
1000 x g for 10 min (at RT) to obtain a protoplast pellet. This pellet was washed with
protobuffer and centrifuged at 1000 x g for 10 min at 4°C. The protoplast pellet was
ﬁnally resuspended in 0.5mL of protobuffer. The purity of the protoplast fraction was
analyzed by bright ﬁeld microscopy using a Nikon Eclipse E600 microscope [Nikon Inc.,

Melville, NY].

Puriﬁcation of a vesicles-vacuoles fraction

The protoplast suspension (0.5 mL) was added to 1.5 mL of protoplast lysis solution
[0.6M sorbitol, 10mM Tris-Cl, 0.025% Triton-X 100 pH 7.5]. Release of vesicles and
vacuoles was observed by the use of MDY-64 (Molecular Probes, Invitrogen, Carlsbad.
CA) that stains yeast vacuolar membranes green; cells were viewed under a Nikon
Eclipse E600 or Labophot ﬂuorescence microscope (Nikon Inc., Melville, NY). After
approximately 15 min, when 90-95% of the protoplast lysed, 1 ml of lysis mixture was
carefully overlaid on a lmL high density sucrose cushion [60% (w/v) sucrose, 1.2 M
sorbitol, 10 mM Tris-Cl, pH 7.5] and then centrifuged at 3000 x g at RT for 45 minutes.
The vesicles-vacuoles fraction was collected from the interface in a volume of 100 uL

and stored on ice for further analysis.

Purity assessment of the vesicles-vacuoles fraction

Three parallel approaches were utilized to conﬁrm purity of the vesicles-vacuoles

fraction.

36

a. Confocal laser scanning microscopy (CLSM)

MDY-64 and CellTracker Blue CMAC (vacuolar peptidase marker) [Molecular
Probes, Invitrogen, Carlsbad, CA] were used to visualize vesicles and vacuoles and to
assess their purity. These dyes were utilized according to manufacturer’s protocols with
modiﬁcations. 2 pL of a 10 mM MDY-64 stock solution in DMSO was added to the
protoplast lysis mixture (2 mL total volume) 5 min before loading on the density
gradient. 1 [IL of 10 mM CMAC in DMSO was added to the puriﬁed vesicles-vacuoles
fraction and incubated at RT for 15 min before microscopy. Images were acquired using
an Olympus Flroiew 1000 confocal laser scanning microscope (CLSM) (Olympus,
Center Valley, PA) using a 60x/ 1.42 oil objective and BP 430-470 emission ﬁlter set
under excitation with the 405 nm diode laser line for CMAC ﬂuorescence (353 nm
excitation/466 nm emission) and BP 505-525 emission ﬁlter set under excitation with the

488 nm diode laser line for MDY-64 ﬂuorescence (451 nm excitation/497 nm emission).

b. T ransmissian Electron Microscopy (T EM)

The purity of protoplasts and the vesicles-vacuoles fraction also was assessed by
TEM. Protoplast samples were ﬁxed with 2.5% glutaraldehyde overnight at 4°C on a
rotating platform shaker. Samples were post-ﬁxed in 1% buffered osmium tetroxide
overnight at 4°C, dehydrated in an acetone series (30—100%), and then inﬁltrated and
polymerized in Poly/Bed 812 resin for 24 h at 60°C. Resin blocks were sectioned using a
Power Tome-XL ultramicrotome (Boeckeler Instruments, Tucson, AZ). Protoplast
sections (70 nm thick) were mounted on formvar coated copper grids and stained with

1% uranyl acetate and lead citrate. Vesicles-vacuoles samples were prepared by ﬁxing

37

with 1% osmium tetroxide for 1 h at RT. A drop of the solution was then placed on a
copper grid and the excess solution was removed by ﬁlter paper. The grid was air-dried
and stained with 1% uranyl acetate (negative stain). Images were generated with a JEOL

100CX transmission electron microscope.

c. Enzyme assays

The activities of speciﬁc marker enzymes were examined in the vesicles-vacuoles
fraction. The a-mannosidase (a marker tightly associated with vesicles and vacuoles)
activity was measured by a method adopted from a published protocol (Boller & Kende,
1979). 10 pL of the sample [total protein range from 3 pg to 10 pg] was added to a
reaction mix containing 0.5 mL of sodium succinate buffer [50 pM Na-succinate, pH
5.0]; then, 3 pL of 0.1 M p-nitrophenyl substrate [Sigma, St.Louis, MO] was added. The
reaction was stopped by addition of 0.8 mL of 1M sodium carbonate. The absorbance
was determined at 405 nm. The speciﬁc activity was expressed as nmoles of p-
nitrophenol produced per min per pg total protein. Succinate dehydrogenase activity
(mitochondrial marker) was assessed according to a standard protocol (Berg, 1995). 10
pL of the sample solution [total protein range from 3 pg to 10 pg] was added to a
reaction mixture consisting of 0.3 M potassium phosphate, 8. mM potassium cyanide and
50 pg of DCPIP [dichlorophenolindophenol, Na salt]. 0.1 mL of sodium succinate was
then added to this reaction mixture and the absorbance was recorded at 600 nm. Speciﬁc
activity was expressed as pmoles DCPIP reduced per minute per pg total protein.
Lactate dehydrogenase activity (cytoplasmic marker) was measured according to a

Standard protocol (Kuznetsov, 2006). 10 pL of the sample was added to 1 mL of pre-

38

incubated reaction medium (at 30°C) containing 100 mM Tris—HCl buffer, 10 mM of
pyruvate and 0.3 mM NADH and the absorbance was measured at 340 nm. Enzyme

speciﬁc activity was expressed as pmoles of lactate formed per min per pg total protein.

Protein Determination
The protein concentration was determined using Bio-Rad protein dye reagent

(Invitrogen, Carlsbad, CA).

Enzyme-linked immunosorbent assay (ELISA) for measuring aﬂatoxin
Aﬂatoxin in feeding experiments was measured with an enzyme-linked
immunosorbent assay as described previously (Roze et al., 2007) using polyclonal

antibodies against aﬂatoxin B1 (Sigma).

Western blot analysis

Whole cell (CE) proteins were prepared from 36 h old frozen mycelium using a
method similar to a procedure described by Roze (Roze et al., 2007). Protoplast proteins
were extracted by adding 1:1 TSA buffer (Roze et al., 2007) directly to the protoplast
pellet and then homogenizing the solution in a Potter homogenizer placed in ice. Proteins
from the vesicles-vacuoles fraction were extracted by adding 700 pL of 1:1 TSA solution
to every 500 pL of vesicles-vacuoles fraction to enable osmotic lysis. Total protein (20
mg) was separated by electrophoresis on 12% SDS polyacrylamide gels, transferred to
PVDF membrane, exposed to antibody speciﬁc to OmtA, Ver-l,Vbs and Nor-1 [all

generated in our laboratory (Lee et al., 2004)]. Then the ﬁlter was incubated with goat

39

anti-rabbit secondary antibody conjugated to IRDye 800 (Invitrogen Corporation,
Carlsbad, CA). Infrared ﬂuorescence was directly detected by using an Odyssey Infrared

Imaging System (Li-Cor Biosciences, Lincoln, NE, USA).

Feeding experiments

Each feeding experiment was repeated a total of three times with similar trends.
Representative data from a single experiment are presented in each panel to illustrate the
results. A schematic that illustrates the experimental design is presented to the left of

each panel (Figure 2.7).

a. Feeding pure protoplasts.

Sterigmatocystin (ST) (Sigma, St Louis, MO) [20 pg/mL] was added (fed) to 1
mL of a pure protoplast fraction containing approximately 10° protoplasts and this
mixture was incubated overnight at 30°C. The aﬂatoxin content as determined by ELISA
(see below) was measured before and after incubation and normalized to total protein in
the protoplast fraction. A no-ST control was conducted; protoplasts were incubated
under the same conditions without added ST. Protoplasts prepared from A. parasiticus
AF SlO [derived from SU-l, aflR disruption, no aﬂatoxin enzymes or aﬂatoxin
accumulate] and LW1432 [amtA disruption] were also included as controls.

To measure aﬂatoxin content, protoplasts were pelleted at 1000 g, the supernatant
was discarded and the pellet was suspended with 500 pL of chloroform and shaken 20
times to extract aﬂatoxins. The suspension was centrifuged at 10000 x g, the lower

organic layer was removed, dried to evaporate chloroform and the aﬂatoxin residue was

40

dissolved in 70% methanol. Aﬂatoxin was measured by ELISA (Roze et al., 2007) using
standard methods and the values were normalized to total protein in the fraction.

To determine if aﬂatoxins are stored in the vesicles-vacuoles fraction, protoplasts
prepared from strain SU-l were incubated with and without added ST as described
above; the vesicles-vacuoles fraction was puriﬁed from the protoplasts as described
above. Once the vesicles-vacuoles fraction was removed from the gradient, we combined
the remaining contents of the gradient and designated it as the non-vesicles-vacuoles
fraction. Aﬂatoxins from both the vesicles-vacuoles and the non-vesicles-vacuoles
fractions were extracted with chloroform (500pL chloroform per 100pL of volume
fraction) after which the chloroform was evaporated. Aﬂatoxin was dissolved in 70%
methanol, measured by ELISA, and the data normalized to the total protein in the

appropriate fraction.

b. Feeding vesicles-vacuoles and nan-vesicles-vacualesﬁactions
The vesicles-vacuoles and the non— vesicles-vacuoles fractions prepared from lmL of
pure protoplasts (containing approximately 10° protoplasts) were incubated in parallel,

with or without added ST (20pg/mL) at 30°C overnight. Aﬂatoxin (measured by ELISA)

in each fraction was normalized to the total protein in the appropriate fraction.

RESULTS AND DISCUSSION
Protoplast isolation
Protoplast preparation from mycelia harvested during aﬂatoxin synthesis (during

a transition from exponential growth to stationary phase) is challenging as aging

41

negatively affects cell wall digestion. Our previous studies showed that aﬂatoxin gene
transcripts and enzymes (Nor-1, Ver-1,VbsA and OmtA) were ﬁrst detected between 24
and 40 h of growth (Roze et al. , 2007). Aﬂatoxin enzymes and transcripts reached peak
levels at 48 h and then declined. We determined that 36h was an optimum time point
because we could detect aﬂatoxin enzymes and aﬂatoxin in the mycelia and still digest
the cell wall to produce protoplasts. ’ Protoplasts were isolated and their purity assessed
by bright ﬁeld microscopy; this analysis showed no detectable contamination by mycelial
debris (Figure 2.2A). The presence of the vesicles-vacuoles population in protoplasts was
observed by CLSM (Figure 2.2B-D) and TEM (Figure 2.2E.). Throughout this current
work we deﬁne the size range of vesicles and vacuoles as 2 2.5 pm and < 2.5 pm
respectively. Vesicles and vacuoles with similar size range were observed in puriﬁed

protoplasts and whole cells.

Purification of a vesicles-vacuoles fraction
Vesicles and vacuoles were released from protoplasts (see Methods). Within 15
minutes after addition of Triton X 100, most protoplasts (> 90%) released vesicles and
vacuoles (Figure 2.3). Storing the released vesicles and vacuoles in the presence of
Triton X-100 for longer periods of time negatively affected the stability of the vesicles
and vacuoles; after 30 min few intact vesicles and vacuoles could be observed in the lysis

mixture.

Isolation of a vacuolar fraction has been reported for ﬁlamentous fungi (Martinoia et
al., 1979), yeast (Rieder & Emr, 2001), and plants (Robert et al., 2007). However, the

high degree of size and density heterogeneity in the vesicles and vacuoles population of

42

A. parasiticus during aﬂatoxin synthesis prevented us from directly applying published
procedures to obtain a puriﬁed vesicles and vacuoles fraction. The ‘high density sucrose
cushion’ method to fractionate vesicles and vacuoles developed in this study (see
methods) caused the vesicles-vacuoles population to migrate downward to the sucrose
cushion forming a thin but distinct band at the interface; the remaining cell debris banded
either within the cushion (small protoplast fragments) or pelleted at the bottom of the
cushion (large protoplast fragments). Experimental conditions were optimized
empirically. This procedure routinely yielded sufﬁcient vesicles and vacuoles to generate

30 pg of protein from 4 g of mycelia (wet weight).

43

Figure 2.2. Microscopic analysis of puriﬁed protoplasts.
A. parasiticus was grown for 36 h under aﬂatoxin inducing conditions and protoplasts

were prepared and puriﬁed as described in Methods.

44

 

Figure 2.2 A. Bright ﬁeld microscopy image of a pure protoplast fraction.

45

5pm 5pm
—

 

Figure 2.2 B. Protoplast stained with CMAC stain. Figure 2.2 C. Protoplast stained with
MDY-64. Figure 2.2 D. Digital overlay of B and C. B and C were acquired with CLSM
under dark ﬁeld. The white arrows in C illustrate the various sized organelles in the

vesicles -vacuoles population in the protoplast.

46

 

Figure 2.2 E. Protoplast observed under TEM as described in Methods. Image was
acquired on the JEOL 100CX transmission electron microscope. White arrows illustrate

the various sized organelles in the vesicles-vacuoles population in the protoplast

47

 

Figure 2.3. Release of vesicles and vacuoles from protoplasts after addition of Triton—X
100 (lysis) solution. Red arrows illustrate vesicles and vacuoles of various sizes released

from protoplast. White arrows illustrate the protoplasts undergoing lysis.

48

Fraction purity

Three methods were employed to test the purity of the vesicles and vacuoles
fraction. Alpha(a)-mannosidase has been used frequently as a vacuolar marker enzyme
in plants (Boller & Kende, 1979), ﬁlamentous fungi (Hoppert et al., 2001), and yeast
(Yoshihisa et al., 1988); the enzyme also localizes to vesicles of yeast (Campbell &
Rome, 1983) and ﬁlamentous fungi (Akao et al., 2006). We therefore measured a-
mannosidase speciﬁc activity in the vesicles-vacuoles fraction and compared it with
speciﬁc activity in protoplasts and in whole-cells. Succinate dehydrogenase activity, a
mitochondrial marker enzyme (Pycock & Nahorski, 1971), allowed us to detect the
presence of mitochondria in the vesicles-vacuoles fraction. We also measured activity of
lactate dehydrogenase, a cytosolic marker enzyme (Kobayashi et al., 2006), to track the
successful elimination of this potential contaminant during the puriﬁcation process. We
observed that a-mannosidase speciﬁc activity increased markedly at each successive
puriﬁcation step (whole cells, protoplasts, vesicles and vacuoles) accompanied by
elimination of detectable succinate dehydrogenase and lactate dehydrogenase activities
(Figure 2.4).

Peroxisomes have been shown previously to sediment at centrifugal forces
>50000xg with maximum quantities in 140000xg supernatant, that is signiﬁcantly higher
than that required to sediment mitochondria (20000xg) (Liang, 1996; Zhou, 1997) and
vesicles-vacuoles (3000xg) (current work). We reasoned that like mitochondria,
peroxisomes do not co-purify with vesicles-vacuoles fraction.

An independent assessment of purity of the vesicles and vacuoles fraction by

CLSM showed no protoplast debris (Figures 2.4A-C).The vacuolar membrane stain

49

 

 

 

  

    

 

 

 

 

 

 

 

 

   

 

 

3 30 i f

200 3 ;

'5 ;

,‘E‘ 15" 7 [I— 3 2 - '5 20 ::.;

3.. '5 U .;:; j

a {L s “ a

a: 100 - 1.3: g E l

-::-: I-I . 3;. l

a 95 1— a 10 I

'8 50 - .Igsg-i. o _ a 5253 l

O ;;-;-:: Q. :;:;:;:;:.-.-_. :2: l
D. :33151: (0 3::13513“".m 45:3:
‘0 o 22:21 0 ND" 0

0&4 cs4 014

Figure 2.4. Measurement of marker enzyme speciﬁc activities during puriﬁcation of
vesicles-vacuoles; protein extracts from whole cells, protoplasts and vesicles-vacuoles.
Protein extracts were prepared from whole cells (CE), pure protoplasts (P), and pure
vesicles-vacuoles (V). The speciﬁc activities of a-mannosidase (A) (vacuole marker;
speciﬁc activity is expressed as nmoles of p-nitrophenol produced per min per pg of total
protein), succinate dehydrogenase (B) (mitochondrial marker; speciﬁc activity is
expressed as pmoles of DCPIP reduced per minute per pg of total protein) and lactate
dehydrogenase (C) (cytoplasmic marker; speciﬁc activity is expressed as pmoles of
lactate formed in the reaction per min per pg of total protein) were measured. Data
summarize three independent experiments. Speciﬁc activities are reported as the mean i

standard error. ND = not detectable.

50

Figure 2.5. Microscopic analysis of a vesicles-vacuoles fraction
The vesicles-vacuoles fraction was puriﬁed and prepared for microscopic analyses as

described in Methods.

51

3 Clip m

 

Figure 2.5 A — C. CLSM images of a vesicles-vacuoles fraction. Panel A. Vesicles-
vacuoles stained with CMAC. Panel B. Vesicles-vacuoles stained with MDY-64 stain.

Panel C. Digital overlay of A and B.

52

200 nm

 

Figure 2.5 D-E. TEM images of a vesicles-vacuoles fraction, two different

magniﬁcations

53

MDY-64 and the vacuolar peptidase stain CMAC demonstrated great affinity for all
organelles in the vesicles-vacuoles preparation. These organelles were spherical in shape
and were highly diverse in size (range approximately 20mm to 5pm). We observed ten
different ﬁelds under CLSM with at least 50 vesicles-vacuoles in each ﬁeld and found no
protoplast debris or unbroken protoplasts associated with that fraction.

TEM images (Figure 2.5D-E) supported the CLSM data showing no
contamination of the vesicles-vacuoles fraction with mitochondria or other organelles.
As in protoplasts, CLSM and TEM images of the organelles in the fraction demonstrated

signiﬁcant size heterogeneity

The vesicles-vacuoles fraction carries the aﬂatoxin enzymes, Ver-l, Vbs and OmtA
The aﬂatoxin enzymes Ver-l, Vbs and OmtA were detected in the vesicles-
vacuoles fraction by Western Blot (Figure 2.6). The presence of Ver-l conﬁrms data
from recent studies (Hong, 2008; Hong & Linz, 2008; Hong & Linz, 2009) that suggest
that Ver-l and Nor-1 localize to vesicles and vacuoles. No evidence of aﬂatoxin enzyme
turnover was observed in any fraction tested. Surprisingly, Nor-1 could not be detected
(Western Blot) in protoplasts or the vesicles-vacuoles fraction. This could mean either
that Nor-1 is not stable in isolated protoplasts or the vesicles-vacuoles fraction or that the

signal from antibody bound to Nor-1 was below the detection limit.

54

Figure 2.6. Western blot analysis of aﬂatoxin enzymes present in a vesicles-vacuoles
fraction puriﬁed from A. parasiticus during aﬂatoxin biosynthesis. A total of 10° spores
were inoculated into 100 ml YES liquid medium and incubated at 30°C with shaking for
36h. Vesicles-vacuoles fraction was puriﬁed from protoplasts generated from whole cells
as described in methods. Protein extracts were prepared from whole cells (CE), pure

protoplasts (P), and pure vesicles-vacuoles (V) as described in methods.

55

OmtA

Nor-1 —>

 

Figure 2.6.

56

Protoplasts and vesicles-vacuoles convert exogenously added sterigmatocystin to
aﬂatoxin

In the ﬁnal two steps of aﬂatoxin biosynthesis (Yabe & Nakajima, 2004; Yu et
al., 2002) sterigmatocystin (ST) is converted to o-methylsterigmatocystin (OMST) which
is then converted to aﬂatoxin Bl (AF B1). OmtA catalyzes the methylation of ST by
transfer of a methyl group from S-adenosylmethionine (SAM) (Bhatnagar et al., 1987;
Cleveland et al., 1987). OrdA, an oxido-reductase, catalyzes the ﬁnal reaction step in the
presence of NADPH (Yu et‘ al., 1998). We previously fed ST (20pg/mL) to whole cells
to conﬁrm the catalytic function of OmtA (Lee et al., 2002) in viva. In the current work,
we performed analogous feeding experiments on protoplasts and a puriﬁed vesicles-
vacuoles fraction in vitra to test whether OmtA and OrdA are enzymatically active in
these sub-cellular locations (Figure 2.7).

In protoplasts fed ST, aﬂatoxin increased 6 fold; without added ST, aﬂatoxin
increased only 2-fold (Figure 2.7A). When the vesicles-vacuoles fraction was puriﬁed
from protoplasts fed with ST, this fraction carried the vast majority of the aﬂatoxin when
compared to the non-vesicles-vacuoles fraction (contains all remaining cell materials
besides vesicles-vacuoles) (Figure 2.78). These data strongly suggest that aﬂatoxin was
synthesized and accumulated in the vesicles-vacuoles fraction and that vesicles-vacuoles
are the major site for AF B1 accumulation in the cell. Secondary metabolites including
anthocyanins (Marrs et al., 1995), berberine (Otani et al., 2005), nicotine (Saunders,
1979) sanguinarine (Alcantara et al., 2005), camptothecin (Sirikantaramas et al., 2007)
and many alkaloids in Catharanthus roseus (Roytrakul S, 2007) are commonly

sequestered in vacuoles or vesicles in plants. To date, the sole example of vacuolar

57

Figure 2.7 Feeding experiments: Each feeding experiment was conducted three times
with similar trends. A schematic illustrating the experimental design for feeding
experiments is included at the left of each panel. Representative results from one
experiment are presented in the graph at the right in each panel. Panel A. Feeding
experiment with protoplast (P) fraction. +ST represents addition of sterigmatocystin and
—ST represents a control experiment with no sterigamtocystin. P+ST = protoplasts fed
with ST; P-ST = protoplasts not fed with ST. Panel B. Feeding experiment to test
whether vesicles-vacuole fraction (V) can sequester aﬂatoxin made in protoplasts. NV
represents non-vesicle-vacuole fraction. V(P+ST) and NV(P+ST) represent the vesicle-
vacuole fraction and non-vesicle-vacuole fraction obtained from protoplasts fed with ST,
respectively. V(P-ST) and NV(P-ST) represent the same fractions obtained from
protoplasts not fed with ST. Panel C Feeding experiments with fraction V and NV.
V+ST and V-ST represent the vesicle-vacuole fraction fed and not fed with ST,
respectively; NV+ST and NV-ST represent non-vesicle-vacuole fraction fed and not fed
with ST. Aﬂatoxin is expressed as pg per pg of total protein. The two-tailed p-values
used to determine statistical signiﬁcance were calculated using an unpaired t-test with
sample size = 3 (aﬂatoxin measurements in each experiment were conducted in

triplicate).

58

35’
U2
l-I
«'5
'4:
’e
'1’

+
U)
'-i

Aflatoxin (pg)
N
f
+

I

 

@ P mo :2?
‘ f]
—ST 0 F1 -
q. ,2 a}
P-ST s ‘1"
(linear) 1200-
.0001*
@(P+ST) ”fl...
V A
g 800' l
.s
.5
212-3 400-
<
.006“
1‘ °§§$$

 

 

 

 

 

 

 

 

Figure 2.7 A-B

59

C.

 

 

 

 

Ls
SAWS
. as.
.3. 5x
W. w H cam
n A A
a a 0..
33 5x82:

M T
T®V m. P W.,!
®Rt® :@ Qth

6 _

C:FNV-ST

Figure 2.7 (continued)

60

sequestration of fungal secondary metabolites (to our knowledge) is cyclosporin in
Tolypocladium inﬂatum (Hoppert et al. , 2001).

The hypotheses stated above were tested in independent feeding experiments
using a modiﬁcation of the original protocol. Here, ST was fed directly to vesicles and
vacuoles in the puriﬁed fraction. Addition of ST to the puriﬁed vesicles-vacuoles
fraction increased aﬂatoxin > 5 fold (Figure 2.7C). The increase in aﬂatoxin in the
vesicles-vacuoles fraction without added ST was much smaller and not signiﬁcant. In
contrast, feeding of ST to the non-vacuolar fraction resulted in nearly undetectable levels
of aﬂatoxin. These data combined with data obtained by Western blot analysis on the
puriﬁed vesicles-vacuoles fraction, conﬁrm that OmtA is present and enzymatically
functional in this sub-cellular location. The data also strongly suggest that OrdA is
present and functional at this location. We do not currently possess anti-OrdA antibodies
that could be used to help conﬁrm this hypothesis. However, since OrdA is the only
enzyme in A. parasiticus reported to catalyze the NADPH-dependent reduction of OMST
to AFB1 (Yu et al., 1998), accumulation of AFB; in the vesicles-vacuoles fraction
strongly suggests that both OmtA and OrdA are functional in that sub-cellular location.

The data also suggest that SAM and NADP are contained in the vesicles-vacuoles
fraction since these compounds were not added during the feeding studies but are
required for these reactions to occur. It is possible that even higher levels of AF B1 could
be obtained by feeding ST, SAM, and NADP to the vesicles-vacuoles fraction if these

compounds normally are present in rate-limiting quantities.

61

Intracellular site of aﬂatoxin biosynthesis in A.parasiticus

We initiated these studies to test two possible models for the sub-cellular location
of aﬂatoxin synthesis. According to the ﬁrst model, aﬂatoxin is synthesized in the
cytoplasm by aﬂatoxin enzymes that are present in that location. Aﬁer synthesis is
complete, the toxin is secreted outside the cell by an unknown mechanism [previous data
demonstrated that 99% of aﬂatoxin made by the cell was found in the growth medium
(Roze et al., 2007)]. Aﬂatoxin enzymes are then transported to vacuoles for proteolytic
cleavage by peptidases that also localize there.

The second model proposes that aﬂatoxin enzymes are made in the cytoplasm
and transported to vesicles-vacuoles. These proteins are enzymatically functional in
vesicles-vacuoles and hence, part or all of aﬂatoxin biosynthesis occurs in these
organelles; the enzymes are eventually degraded (Chiou, 2003; Lee, 2003; Skory, 1992),
likely by peptidases that are transported to these organelles. According to this model,
aﬂatoxin is sequestered within the vesicles-vacuoles and ﬁnally is transported outside the
cell by an unknown mechanism.

The observation that the vesicles-vacuoles fraction efﬁciently converts ST to
AFB1 while the non-vacuolar fraction does not carry out this conversion at detectable
levels strongly supports model 2 (see Figure 2.8). Our data demonstrate that OmtA and
likely OrdA are active predominantly in the vesicles-vacuoles fraction. Direct
comparison of the size range of vesicles and vacuoles in whole cells, protoplasts and in
the puriﬁed vesicles-vacuoles fraction allow us to conclude that organelles in the puriﬁed
fraction are representative of the organelles existing in whole cells. Further

characterization of these organelles is a subject for future research.

62

Figure 2.8. Model depicting vesicles-vacuoles as the primary intracellular site for
aﬂatoxin synthesis and storage. Several studies suggest that early, middle and late
enzymes in aﬂatoxin biosynthesis are synthesized initially in the cytoplasm. During peak
levels of aﬂatoxin synthesis, some or all of the aﬂatoxin enzymes are transported to
vacuoles via a direct route (a) or a vesicle-mediated route (b). Recent data obtained with
Nor-1 or Ver-l EGF P fusions combined with Western blot analysis in the current study
support transport via route (b). Transport via route (a): the model proposes that early and
middle aﬂatoxin enzymes are functional in the cytoplasm and transported to vacuoles for
turnover; this model predicts that ST is present initially in the cytosol and then
transported to vesicles by an unknown mechanism — here, only the late pathway steps
occur in vesicles-vacuoles. Transport via route (b). If most or all aﬂatoxin enzymes
localize to vesicles-vacuoles and are functional in that location, the model predicts that
most or all of aﬂatoxin synthesis occurs in vesicles-vacuoles. ST = sterigmatocystin,

OMST = a-methylsterigmatocystin, AF = aﬂatoxin

63

 

 

    
 
 
   
   
    
 

Vacuole

Cytoplasm
\ a
\
’ ’ Early and middle enzymes
/ ' ' ‘
Acctyl Co-A I

I
III-III.
" I I I I I I ' '
Vesicles carrying
functional OmtA OmtA and OrdA ‘- ~
and OrdA (or all
aﬂatoxin enzymes)

 
     

AF gene cluster

 

Figure 2.8.

64

 

In related work, norsorolinic acid (NA, an early intermediate in the pathway) was
detected in peroxisomes of Aspergillus strains carrying a genetic block in nor-1
(Maggio-Hall et al. , 2005). We subsequently showed that the enzyme responsible for NA
synthesis (Nor-1) is part of a large protein complex that is different from the complex that
includes Ver-l, Vbs and OmtA (Appendix 11). Together, these data may suggest that
peroxisomes carry a protein complex that contains enzymes (FAS, PKS, and Nor-1)
required to conduct the early steps in aﬂatoxin biosynthesis; we propose that vesicles and
vacuoles, responsible for the late steps in aﬂatoxin biosynthesis, carry a separate complex
that includes Ver-l,Vbs, and OmtA. Details of this model and the proposed interaction
between peroxisomes and vesicles-vacuoles in Aspergillus remain to be elucidated.

In summary, our studies prompt us modify our existing model (Roze et al. , 2007)
of the genetic switch that controls the shift from primary to secondary metabolism in A.
parasiticus. During active growth vacuoles participate in primary metabolism; they store
required substrates and ions and maintain pH balance and cell homoeostasis; these
vacuolar functions have been characterized in detail (Klionsky et al., 1990). The
modiﬁed model proposes that vacuoles undergo morphological, chemical and functional
development during this transition. In support of this model, our data demonstrate that as
cells switch to secondary metabolism, vacuoles gain additional functions which include
synthesis, storage and secretion of secondary metabolites. The model further proposes
that late in this developmental process vacuoles predominantly engage in protein tum-
over and eventually cell death occurs. Future studies will focus on understanding how
vacuolar function correlates with the population of proteins that are present in vacuoles at

different phases during development of this organelle.

65

Compartmentalization of enzymes, intermediates and end products appears to be a
common feature of secondary metabolism in plants and fungi. In a recent study, we
demonstrated that interfering with vacuolar biogenesis or protein trafﬁcking to the
vacuole strongly affected aﬂatoxin biosynthesis in A. parasiticus (Chapter 3 of the
current study). Therefore, regulating protein traffic into vacuoles or between vesicles and
vacuoles presents one promising mechanism to manipulate secondary metabolism. In
just one potential application, we are hopeful that this general strategy will enable

effective control of aﬂatoxin contamination on susceptible plant materials.

66

REFERENCES

Akao, T., Yamaguchi, M., Yahara, A. & other authors (2006). Cloning and expression
of 1,2-alpha-mannosidase gene (ﬁnanIB) from ﬁlamentous fungus Aspergillus oryzae: in
vivo visualization of the FmanIBp-GFP fusion protein. Biasci Biatechnal Biochem 70,

471-479.

Alcantara, J., Bird, D. A., Franceschi, V. R. & F acchini, P. J. (2005). Sanguinarine
biosynthesis is associated with the endoplasmic reticulum in cultured opium poppy cells
after elicitor treatment. Plant Physiol 138, 173-183.

Bennett, J. W. & Klich, M. (2003). Mycotoxins. Clin Microbial Rev 16, 497-516.
Berg, V. (1995). Plant Physiology Manual.

Bhatnagar, D., McCormick, S. P., Lee, L. S. & Hill, R. A. (1987). Identiﬁcation of a-
methylsterigrnatocystin as an aﬂatoxin BI and G1 precursor in Aspergillus parasiticus.
Appl Environ Microbial 53, 1028-1033.

Birch, M., Prebble, E., Mosquera, J. & Anderson, M. (2001).Protoplast preparation.

Boller, T. & Kende, H. (1979). Hydrolytic Enzymes in the Central Vacuole of Plant
Cells. Plant Physiol 63, 1 123-1 132.

Campbell, C. H. & Rome, L. H. (1983). Coated vesicles from rat liver and calf brain
contain lysosomal enzymes bound to mannose 6-phosphate receptors. J Biol Chem 258,
13347-13352.

Chiou, C.-H. (2003).Position-dependent regulation of the nor-1 promoter in the aﬂatoxin
gene cluster and immuno-localization of proteins involved in aﬂatoxin biosynthesis, pp.
xi, 141 leaves: Michigan State University. Dept. of Food Science and Human Nutrition.

Chiou, C. H., Lee, L. W., Owens, S. A., Whallon, J. H., Klomparens, K. L.,
Townsend, C. A. & Linz, J. E. (2004). Distribution and sub-cellular localization of the
aﬂatoxin enzyme versicolorin B synthase in time-fractionated colonies of Aspergillus
parasiticus. Arch Microbial 182, 67-79.

Cleveland, T. E., Lax, A. R., Lee, L. S. & Bhatnagar, D. (1987). Appearance of
enzyme activities catalyzing conversion of sterigmatocystin to aﬂatoxin B1 in late-
growth-phase Aspergillus parasiticus cultures. Appl Environ Microbiol 53, 1711-1713.

Facchini, P. J. & St-Pierre, B. (2005). Synthesis and trafﬁcking of alkaloid biosynthetic
enzymes. Curr Opin Plant Biol 8, 657-666.

67

Hong, S.-Y. (2008).Analysis of transport and sub-cellular localization of aﬂatoxin
biosynthetic enzymes, Ver-l and Nor-l, using EGF P fusions in Aspergillus parasiticus.,
pp. 311: Michigan State University. Dept. of Food Science and Human Nutrition, 2008.

Hong, S. Y. & Linz, J. E. (2008). Functional expression and subcellular localization of
the aﬂatoxin pathway enzyme Ver-l fused to enhanced green ﬂuorescent protein. Appl
Environ Microbial 74, 6385—6396.

Hong, S. Y. & Linz, J. E. (2009). Functional expression and sub-cellular localization of
the early aﬂatoxin pathway enzyme Nor-1 in Aspergillus parasiticus. Mycal Res.

Hoppert, M., Gentzsch, C. & Schorgendorfer, K. (2001). Structure and localization of
cyclosporin synthetase, the key enzyme of cyclosporin biosynthesis in Tolypocladium
inﬂatum. Arch Microbial 176, 285-293.

Keller, N. P., Turner, G. & Bennett, J. W. (2005). Fungal secondary metabolism - from
biochemistry to genomics. Nat Rev Microbial 3, 93 7-947.

Klionsky, D. J., Herman, P. K. & Emr, S. D. (1990). The fungal vacuole: composition,
function, and biogenesis. Microbial Rev 54, 266-292.

Kobayashi, N., Nishi, T., Hirata, T., Kihara, A., Sano, T., Igarashi, Y. & Yamaguchi,
A. (2006). Sphingosine l-phosphate is released from the cytosol of rat platelets in a
carrier-mediated manner. J Lipid Res 47, 614-621.

Kuznetsov, A. V. a. G., E (2006). Laboratory Protocol- Lactate Dehydrogenase. In
Mitochondrial Physiology Network. Edited by Orobos.

Lee, L.-W. (2003). Functional analysis of OmtA and subcellular localization of aﬂatoxin
enzymes in Aspergillus parasiticus, pp. xi, 141 leaves: Michigan State University. Dept.
of Food Science and Hmnan Nutrition, 2003.

Lee, L. W., Chiou, C. H. & Linz, J. E. (2002). Function of native OmtA in vivo and
expression and distribution of this protein in colonies of Aspergillus parasiticus. Appl
Environ Microbial 68, 5718-5727.

Lee, L. W., Chiou, C. H., Klomparens, K. L., Cary, J. W. & Linz, J. E. (2004).
Subcellular localization of aﬂatoxin biosynthetic enzymes Nor-1, Ver-l , and OmtA in
time-dependent fractionated colonies of Aspergillus parasiticus. Arch Microbial 181,
204-214.

Liang, S.-H. (1996).The function and expression of the ver-l gene and localization of the
ver-l protein involved in aﬂatoxin B1 biosynthesis in Aspergillus parasiticus, pp. xi, 135
leaves: Michigan State University. Dept. of Food Science and Human Nutrition, 1996.

68

Maggio-Hall, L. A., Wilson, R. A. & Keller, N. P. (2005). Fundamental contribution of
beta-oxidation to polyketide mycotoxin production in planta. Ma] Plant Microbe Interact
18, 783-793.

Marrs, K. A., Alfenito, M. R., Lloyd, A. M. & Walbot, V. (1995). A glutathione S-
transferase involved in vacuolar transfer encoded by the maize gene Bronze-2. Nature
375, 397-400.

Martinoia, E., Heck, U., Boller, T., Wiemken, A. & Matile, P. (1979). Some properties
of vacuoles isolated from Neurospora crassa slime variant. Arch Microbial 120, 31-34.

Miller MJ, L. J. (2006). Genetic mechanisms involved in regulation of mycotoxin
biosynthesis. Food Biotechnology.

Otani, M., Shitan, N., Sakai, K., Martinoia, E., Sato, F. & Yazaki, K. (2005).
Characterization of vacuolar transport of the endogenous alkaloid berberine in Coptis
japonica. Plant Physio] 138, 1939-1946.

Pycock, C. J. & Nahorski, S. R. (1971). The validity of mitochondrial marker enzymes
in rat heart. J Ma] Cell Cordial 3, 229-241.

Rieder, S. E. & Emr, S. D. (2001). Isolation of subcellular fractions from the yeast
Saccharomyces cerevisiae. Curr Pratac Cell Biol Chapter 3, Unit 3 8.

Robert, S., Zouhar, J., Carter, C. & Raikhel, N. (2007). Isolation of intact vacuoles
from Arabidopsis rosette leaf-derived protoplasts. Nat Pratac 2, 259-262.

Roytrakul S, V. R. (2007). Role of vacuolar transporter proteins in plant secondary
metabolism: Catharanthusroseus cell culture. Phytachem Rev 6, 383—3 96.

Roze, L. V., Arthur, A. E., Hong, S. Y., Chanda, A. & Linz, J. E. (2007). The
initiation and pattern of spread of histone H4 acetylation parallel the order of
transcriptional activation of genes in the aﬂatoxin cluster. Ma] Microbial 66, 713-726.

Saunders, J. A. (1979). Investigations of Vacuoles Isolated from Tobacco: 1.
Quantitation of Nicotine. Plant Physiol 64, 74-78.

Sirikantaramas, S., Sudo, H., Asano, T., Yamazaki, M. & Saito, K. (2007). Transport
of camptothecin in hairy roots of Ophiorrhiza pumila. Phytochemistry 68, 2881-2886.

Skory, C. D. (1992).Isolation and characterization of a gene from Aspergillus parasiticus
associated with the conversion of versicolorin A to sterigmatocystin in aﬂatoxin
biosynthesis, pp. x, 135 leaves: Michigan State University. Dept. of Food Science and
Human Nutrition, 1992.

69

Tanaka, Y., Sasaki, N. & Ohmiya, A. (2008). Biosynthesis of plant pigments:
anthocyanins, betalains and carotenoids. Plant J 54, 733-749.

Teijeira, F., Ullan, R. V., Guerra, S. M., Garcia-Estrada, C., Vaca, I. & Martin, J. F.
(2008). The transporter CefM involved in translocation of biosynthetic intermediates is
essential for cephalosporin production. Biochem J.

van de Kamp, M., Driessen, A. J. & Konings, W. N. (1999). Compartmentalization and
transport in beta-lactam antibiotic biosynthesis by ﬁlamentous fungi. Antonie Van
Leeuwenhoek 75, 41-78.

Yabe, K. & Nakajima, H. (2004). Enzyme reactions and genes in aﬂatoxin biosynthesis.
Appl Microbial Biotechnol 64, 745-755.

Yoshihisa, T., Ohsumi, Y. & Anraku, Y. (1988). Solubilization and puriﬁcation of
alpha-mannosidase, a marker enzyme of vacuolar membranes in Saccharomyces
cerevisiae. J Biol Chem 263, 5158-5163.

Yu, J., Chang, P. K., Ehrlich, K. C., Cary, J. W., Montalbano, B., Dyer, J. M.,
Bhatnagar, D. & Cleveland, T. E. (1998). Characterization of the critical amino acids of
an Aspergillus parasiticus cytochrome P-450 monooxygenase encoded by ordA that is
involved in the biosynthesis of aﬂatoxins Bl, G1, B2, and G2. Appl Environ Microbial
64, 4834-4841.

Yu, J., Bhatnagar, D. & Ehrlich, K. C. (2002). Aﬂatoxin biosynthesis. Rev Iberaam
Mica] 19, 191-200.

Zhou, R. (1997).The function, accumulation and localization of the Nor-l protein
involved in aﬂatoxin biosynthesis the function of the ﬂngene associated with
sporulation in Aspergillus parasiticus, pp. xiii, 224 leaves: Michigan State University.
Dept. of Food Science and Human Nutrition and Multidisciplinary Graduate Program in
Environmental Toxicology, 1997.

70

CHAPTER 3

AF LATOXIN BIOSYNTHESIS IS F UNCTIONALLY RELATED TO

VACUOLE BIOGENESIS

ABSTRACT

Aﬂatoxin biosynthesis is a multi-step secondary metabolic pathway involving at
least 17 enzyme activities encoded by 25 or more genes clustered in a 75-Kb region on
one chromosome; this highly characterized pathway serves as a model to understand
secondary metabolism in eukaryotes. Recent sub-cellular studies provided a functional tie
between vesicles and vacuoles and aﬂatoxin synthesis. Despite increasing evidence that
demonstrates the importance of vesicles and vacuoles in secondary metabolism, the role
of vacuole biogenesis in eukaryotic secondary metabolism was previously unclear. In the
current study, we demonstrate that, vesicles (and not vacuoles) are the primary sites for
aﬂatoxin synthesis. We interrupted vesicle-vacuole fusion (a late event in vacuole
biogenesis) in Aspergillus parasiticus by disruption of the Rab7/th7 GTPase
homologue, vb] and by application of Sortin3 (that produces a Vpsl6 phenotype in yeast)
during aﬂatoxin synthesis. Both treatments resulted in accumulation of vesicles and
signiﬁcantly higher levels of aﬂatoxins compared to wild-type. This increase in aﬂatoxin
was not due to up-regulation in aﬂatoxin gene expression but due to signiﬁcantly higher
accumulation of functional enzymes caused by elevated vesicles accumulation. An
increase in vesicles number was functionally linked to down-regulation of A. parasiticus

vb] and vps16 expression and to up-regulation of aﬂatoxin synthesis. These data provide

71

the ﬁrst evidence that manipulation of the vesicle transport machinery in Aspergillus

affects secondary metabolism.

INTRODUCTION

Proteins involved in secondary metabolism are often found in vesicles and
vacuoles. Multiple studies indicated the importance of vacuoles in sequestration, and
storage of plant secondary metabolites (e.g. anthocyanins (Tanaka et al., 2008),
sanguinarine (Alcantara et' al., 2005)). Signiﬁcantly, localization studies suggest that
vacuoles are also involved in biosynthesis of secondary metabolites (Costa et al. (Costa et
al., 2008), Ono et. al. (Ono et al., 2006), Saslowsky et. al. (Saslowsky & Winkel-Shirley,
2001)). The few sub-cellular studies conducted on fungi, primarily on penicillin and
cephalosporin biosynthesis (amino acid derived secondary metabolites), suggest that the
precursors for their biosyntheses are withdrawn from vacuolar amino acid pools
(Lendenfeld et al., 1993; Muller et al., 1991; Teijeira et al., 2008; van de Kamp et al.,
1999; van der Lende et al., 2002). In T aIypacladium inﬂatum the synthesis of
cyclosporin (a non-ribosomal peptide) is associated with vacuoles. Cyclosporin synthesis
presumably occurs at the vacuolar membrane catalyzed by cyclosporin synthetase and the
ﬁnal product is stored in vacuoles (Hoppert et al., 2001).

Eukaryotes employ highly conserved vesicle transport machinery to deliver
proteins to vacuoles (plants and fungi) and lysosomes (mammals) (Conibear & Stevens,
1995; Ferro-Novick & Jahn, 1994); separate reviews are available for yeast (Bowers &
Stevens, 2005; Bryant & Stevens, 1998; Conibear & Stevens, 1998; Klionsky, 1997;

Klionsky & Ohsumi, 1999; Teter & Klionsky, 2000; Wickner, 2002), plants (Mo et al.,

72

2006; Ueda & Nakano, 2002), ﬁlamentous fungi (Shoji et al., 2008) and mammals
(Mullins & Bonifacino, 2001). A small GTPase, called Rab7 in mammals and th7 in
yeast(Bucci et al., 2000; Cantalupo et al., 2001; Vitelli et al., 1997) (Haas et al., 1995;
Ostrowicz et al., 2008; Schimmoller & Riezman, 1993; Wichmann et al., 1992) (Agarwal
et al., 2008; Nahm et al., 2003), has been shown to interact with a tethering protein
complex (HOPS) to mediate the physical contact of late endosomes to vacuoles
eventually leading to membrane fusion with the assistance of SNARE proteins
(Ostrowicz et al., 2008; Whyte & Munro, 2002). The involvement of Rab7/th7 in
vacuolar biogenesis in ﬁlamentous fungi has been recently demonstrated in Aspergillus
nidulans; the disruption of avaA, a homologue of Rab7/th7, resulted in a fragmented
vacuolar morphology (Ohsumi et al., 2002).

Aﬂatoxin biosynthesis (a pathway involving at least 17 enzyme activities encoded,
by 25 or more genes clustered in a 75-Kb region on a chromosome (Miller M], 2006;
Yabe & Nakajima, 2004; Yu et al., 2002)), is one of the most highly characterized
secondary metabolic pathways and serves as a model to understand secondary
metabolism in eukaryotes. A. parasiticus initiates aﬂatoxin synthesis between 24h and
30h of growth on sucrose (YES medium) (Roze et al., 2007). Aﬂatoxin accumulation
increases exponentially until 48h and then declines(Liang, 1996). Aﬂatoxin enzymes and
transcripts appear between 24h and 40h in roughly the same order as the genes in the
cluster(Roze et al., 2007). As aﬂatoxin synthesis increases, early (N or-l), middle (V er-l)
and late (OmtA) pathway enzymes localize to two primary sub-cellular locations: i)

cytoplasm; and ii) vesicles and vacuoles (Chiou et al., 2004; Hong & Linz, 2008).

73

As discussed in chapter 2 of this dissertation, we ﬁrst obtained a highly pure
vesicle-vacuole fraction and demonstrated the presence of late aﬂatoxin enzymes in this
fraction by Western blot consistent with our previous TEM and CLSM data(Hong &
Linz, 2008; Lee et al., 2004). Next, we performed feeding experiments with protoplasts,
the vesicles-vacuole fraction, and the non-vacuole fraction (contains the remaining cell
materials) in vitra with a late pathway intermediate sterigmatocystin (ST) to test whether
these could convert ST to aﬂatoxin B1 (AF Bl) as described in a previous study(Lee et al.,
2002). In protoplasts fed ST, aﬂatoxin increased 6 fold; without added ST, aﬂatoxin
increased 2-fold. The vesicles—vacuole fraction (puriﬁed from protoplasts which had
been fed ST) carried the vast majority of the aﬂatoxin as compared to the non-vacuolar
fraction. ST fed directly to the vesicles-vacuole fraction increased aﬂatoxin more than 5
fold. In contrast, ST fed to the non-vacuole fraction resulted in nearly undetectable levels
of aﬂatoxin. These data demonstrated that the vesicles-vacuole fraction carry functional
aﬂatoxin enzymes and compartmentalize aﬂatoxin.

This work was initiated to clarify which compartments (vesicles or vacuoles)
associate functionally with aﬂatoxin synthesis. We targeted the Class C Vps tethering
complex that mediates fusion of vesicles and other pre-vacuolar compartments to
vacuoles (Whyte & Munro, 2002). We disrupted A. parasiticus vb] that encodes a
homolog of ypt7 in yeast (th7 is one member of Class C Vps complex) and avaA
(vacuole biogenesis gene) in A. nidulans ; ypt7 and avaA disruption results in
“fragmented vacuoles” (Ohsumi et al., 2002; Wichmann et al., 1992). Vbl contains 205
amino acids and is 70% identical to yeast th7, 74% identical to mammalian Rab7

GTPases, and 94% identical to A. nidulans AvaA. In addition we treated A. parasiticus,

74

SU-l (wild type) with Sortin3, a low-mass compound, that inhibits Vpsl6, another
protein in the Class C Vps tethering complex in yeast (Zouhar et al., 2004). Our data
demonstrate that vb] - and Sortin3- dependent defects in trafficking to the vacuole affect
aﬂatoxin biosynthesis. We hypothesize that vesicles represent the primary intracellular
site for the late steps of aﬂatoxin biosynthesis, whereas the vacuole is primarily

responsible for aﬂatoxin storage and aﬂatoxin enzyme turnover.

MATERIALS AND METHODS
Strains and culture conditions

A. parasiticus NRRL 5862 (SU-l) served as the aﬂatoxin-producing wild-type
strain. A. parasiticus NR-l (niaD, encodes nitrate reductase), derived from A. parasiticus

NRRL 5862 (SU-l; ATCC 56775) served as the recipient for fungal transformation.

e k-
Escherichia cali DH5<1 F' [F'/endA1 hst17 (rk' m ) supE44 thi-I recAI gyrA (Nal'))

relA] (lacZYA argF) lJl1692(m80)lacZ M15) (Invitrogen, Carlsbad, CA) was used to
amplify plasmid DNA using standard procedures (Ausubel & Struhl., 2003). Fungal
strains SU-l and NR-l were maintained on potato dextrose agar (PDA) and the vb]
disrupted strains, AC5, AC7 and AC1 l, constructed as part of this study, were
maintained on Czapek-Dox agar (CZA), a selective growth medium. A. parasiticus was
cultured in YES liquid medium (2 % yeast extract, 6 % sucrose, pH 5.8), a rich aﬂatoxin
inducing media, at 30°C in the dark with shaking at 150 rpm (batch fermentation) for
RNA isolation, for total protein extraction, to measure mycelial dry weight and aﬂatoxin
produced in the growth medium, and for microscopy. For DNA isolation from AC5 , AC7

and AC1] and for Southern hybridization analysis, CZ, a deﬁned growth medium was

75

used instead of YES. YEP liquid medium (2% yeast extract, 6% peptone, pH 5.8), a rich
aﬂatoxin non-inducing medium, was used for comparisons of vacuole-vesicle
morphology of SU-l in aﬂatoxin inducing and non-inducing conditions and also for

analyzing gene expression at the RNA level.

Microscopy

Forceps were used to remove hyphal ﬁlaments from a mycelial pellet harvested
from the grth medium. These ﬁlaments were placed on a microscope slide and bright
ﬁeld images were obtained using a Nikon Eclipse E600 microscope [Nikon Inc.,

Melville, NY].

Sortin treatment of A. parasiticus

Sortins were added (DMSO stock solutions) to 50ml growth medium at
concentrations (25pg/mL for Sortinl, 10pg/mL for Sortin2 and 10pg/mL for Sortin3)
optimized in yeast (Zouhar et al., 2004). SU-l spores were inoculated (10° spores/mL)
after addition of Sortins and incubated at 30°C in a rotary shaker (150rpm). SU-l grown

in untreated growth medium and DMSO treated medium were used as controls.

Identification and Cloning of A. parasiticus vb]
We performed a database search for homologues of avaA of A. nidulans (Ohsumi
et al., 2002)) using the A. ﬂavus genome sequence (Yu et al., 2008). Gene 92.m03481

was identiﬁed in this blast search. Using the sequence of 92.m03481, forward (5’-

76

TCGGCGCGGATTTCCTTAC-3’) and reverse ((5’- GGCTTCCTTGGCAC TGGTTTC-
3’) primers were designed to amplify a 0.5 Kb PCR product in the avaA open reading
frame (ORF) using A. parasiticus genomic DNA as template. This PCR product was used
as a probe to screen an A. parasiticus cosmid library. Cosmid C31 was isolated in this
screen and it harbored 92.m03481, the avaA homologue. We named this homologue vb]
(“vb” stands for vacuolar biogenesis).

On the basis of A. flavus genome sequence, we designed forward (5’- AGTTAAC
CTTAGGAAATCAGATG-3’) and reverse (5’-AAGCAGAGGGAATATTGGTC-3’)
primers to amplify a 5Kb fragment using cosmid C31 as template. This fragment
contained vb] with approximately 2Kb ﬂanking sequence on either side of the gene. A
4.4Kb XbaI/Xmal ﬁ'agment was excised from this 5Kb PCR fragment and sub-cloned
into the XbaI/Xma] sites of pUC19 (New England Biolabs, Beverly, MA) resulting in
plasmid pC4k. This plasmid was used for construction of the disruption plasmid
(discussed below).

For nucleotide sequence analysis, we ampliﬁed a 1.1Kb fragment (forward primer
5’-ATCTCCCACCGCGCATACCGCC-3’ and reverse primer 3’-AAACAACCCGTTC
CCCAAGCCCG-3’; based on the A. ﬂavus genome sequence) from A. parasiticus
genomic DNA containing the vb] gene and subcloned this PCR product into a
pGTEMeasy vector. Nucleotide sequence analysis was conducted on the 1.1 Kb fragment
using an automated nucleotide sequencer (ABI robotic catalyst and 373A DNA
sequencer) at the Plant Research Laboratory at Michigan State University. A
complementary DNA sequence was analyzed using a SMART RACE cDNA

Ampliﬁcation Kit (Clonetech) following the manufacturer’s instructions. The nucleotide

77

sequence accession number for vb] is AY520458. Comparison of the amino acid
sequence of Vbl (deduced from the cDNA sequence) with mammalian Rab7, yeast th7

and A. nidulans AvaA was performed using the EMBL database.

Disruption of A. parasiticus vb1

The vb] disruption plasmid pVB was constructed (shown in Figure 3A) by
inserting a 6.3Kb HindIII fragment from plasmid pSL82 (Homg et al., 1990) (blunt
ended with Klenow fragment of DNA Poll) into a ClaI site of pC4K (also blunt ended by
Klenow enzyme) using standard methods (Ausubel, 1998). The blunt ended HindIII
fragment carried the niaD selectable marker. In pVB, this marker was inserted into the
middle of vb].

Transformation of A. parasiticus protoplasts was performed as described by
Homg et al. (Skory et al., 1990). Two to four micrograms of DNA (SphI/Nde] fragment
from pVB carrying the disruption construct (Figure 3.3B)) and approximately 107
protoplasts resulted in approximately 100 transformants. Transforrnants were screened for
the vb] disruption by a PCR-based screening method using forward (5’-
ATCTCCCACCGCGCATACCGCC-3’) and reverse (5 ”-GGAGGGACAGGGATG
GTACC-3’) primers and crude genomic DNA (as described below) obtained from the
transformants as template. Strains carrying the vb] gene disruption were conﬁrmed by

Southern blot analysis.

78

Isolation of crude genomic DNA from transformants

Spores (from a 10° spores/mL spore stock) were inoculated in 100mL of YES
grth medium for 48h. The mycelium was harvested and ground in liquid nitrogen. lgm
of ground mycelium was mixed with lOmL of DNA extraction buffer (100 mM Tris-.
HCl, 150 mM NaCl, 100 mM EDTA, pH 8.0) containing 300pL of 20% SDS and 60pL
of proteinase-K(20mg/mL) and incubated for 16h at 50°C. The lysate was extracted with
lOmL of 1:1 phenolzchloroform and the crude genomic DNA precipitated from the
aqueous phase with 5M sodium acetate and two volumes ice-cold 100% ethanol. The
precipitate was collected by centrifugation (13000xg for 10min) and the pellet was

dissolved in TE buffer to be used as template for PCR screening.

Southern hybridization analysis

Spores (10°) of individual fungal isolates (obtained by two rounds of single spore
isolation (Skory et al., 1992)) were inoculated in 100mL of YES liquid medium and
incubated on a rotary shaker (150 rpm) at 30°C for 48h. Genomic DNA was then isolated
from the harvested mycelia according to our standard protocol (Skory et al., 1990).
Restriction enzyme Sal] was purchased from New England Biolabs ( Beverly, MA) and
used according to the manufacturer’s instructions. Enzyme digestion, agarose gel
electrophoresis, and Southern hybridization analyses were performed according to
standard procedures (2). A radiolabeled vb] probe was generated with a random-primed
DNA labeling kit (Roche, Indianapolis, IN) by incorporation of [a-32P]dCTP (DuPont)
into a 0.5kb PCR fragment obtained using pAVD as template and primers described

above.

79

RT-PCR analysis of gene expression

Total RNA was isolated from mycelia in duplicate samples by the Trizol method
(Trizol Reagent; Invitrogen, Carlsbad, CA) as described previously (Roze et al., 2007). 2
pL of cDNA was used as a template in the subsequent PCR using the following
robocycler (Stratagene, La Jolla, CA) parameters: initial denaturation at 94°C for 5 min;
25 cycles of 94°C for l min, 60°C for 1 min, and 72°C for 2 min; ﬁnal extension at 72°C
for 10 min. Primer pairs for PCRs are shown in Tables 3.1 and 3.2. The PCR products

were separated by electrophoresis on a 0.8% agarose gel.

Western blot analysis

Fungal cells were cultured for 40 h in appropriate grth media and proteins for
Western blot were prepared by grinding the mycelial samples in liquid N2 in a mortar
with a pestle, and the powdered mycelium was re-suspended 1:1 (w/v) in TSA buffer
(0.01 M Tris, 0.15 M NaCl, 0.05% NaN3, pH 8.0) containing 1 tablet of Complete Mini
Protease Inhibitor cocktail (Roche Diagnostics, Mannheim, Germany), 50 ml Proteinase
Inhibitors mix (Sigma, St Louis, MO) and 0.125 mM phenylmethylsulphonyl ﬂuoride per
10 ml. Total protein (20mg) was separated by electrophoresis on 12%SDS
polyacrylarnide gels, transferred to PVDF membrane, exposed to antibody speciﬁc to
OmtA, Ver-1,Vbs and Nor-1 (all generated in our laboratory (Lee et a]. , 2004)). Then the
ﬁlter was incubated with goat anti-rabbit secondary antibody conjugated to IRDye 800
(Invitrogen Corporation, Carlsbad, CA). Infrared ﬂuorescence was directly detected by

using an Odyssey Infrared Imaging System (Li-Cor Biosciences, Lincoln, NE, USA). For

80

comparison of protein levels, we measured the band intensities in Western blot using

Odyssey software (Li-Cor Biosciences, Lincoln, NE).

Protein Determination
The protein concentration was determined using Bio-Rad protein dye reagent

(Invitrogen, Carlsbad, CA)(Roze et al., 2007).

Aﬂatoxin estimation
Aﬂatoxin accumulated in the grth medium was estimated by ELISA (Pestka,
1988) using polyclonal antibodies against aﬂatoxin B1 (Sigma) as described previously

(Liang, 1996).

Dry weight measurements

Mycelia] dry weight was estimated according to our standard protocol (Liang, 1996).

RESULTS

Effect of growth medium on vesicles-vacuoles morphology in A. parasiticus
Yeast-extract sucrose (YES) is an aﬂatoxin inducing growth medium and yeast

extract peptone (YEP) is a non-inducing medium (Cary et al., 2000). Under standard

growth conditions (100mL YES liquid shake culture) A. parasiticus initiates aﬂatoxin

synthesis between 24 and 30 h. Synthesis increases exponentially until 48h and then

slows (Liang, 1996). Aﬂatoxin enzymes and transcripts are ﬁrst detected under the same

81

conditions between 24h to 40h (Roze et al., 2007). We compared the morphology of
vesicles-vacuoles in SU-l (a wild type aﬂatoxin producing strain) grown in YES at 24h
(when aﬂatoxin synthesis initiates) and 40h (when the cells are actively making
aﬂatoxin). A similar comparison was conducted with SU-l grown in YEP medium. At
40h in YES, we observed a signiﬁcant increase in vesicles as compared to 24h. An
increase in vesicles was not observed in YEP (Figure 3.1). We also conducted a
nutritional shift experiment. SU-l was grown in YES or YEP for 40b and transferred to
the opposite medium. Within 6h after transfer we observed a signiﬁcant increase in
vesicles when shifted from YEP to YES but not from YES to YEP.

To examine whether changes in vesicles depended on aﬂatoxin biosynthesis, we
conducted a similar experiment with strain AF S10 [disruption of a pathway regulator aﬂR
in this SU-lderivative eliminates aﬂatoxin biosynthesis]. AF 810 also demonstrated an
increase in vesicles in YES at 40h similar to that in SU-l. Based on these data, we
conclude that changes in vesicles number resulted from changes in the growth

environment (growth medium) and were not dependent on aﬂatoxin biosynthesis.

82

Figure 3.1. Effect of growth medium on vesicles-vacuoles morphology: A total of 10°
spores of wild type A. parasiticus SU-l were inoculated separately into 100 ml YES
liquid medium (aﬂatoxin inducing medium) and 100mL YEP liquid medium (aﬂatoxin
non-inducing medium) and incubated at 30°C with shaking (150 rpm) for 40h. A
proportion of vacuoles (compartments 2 2.5pm) and vesicles (compartments < 2.5pm)
was estimated at 24h and 40h time points. Panel A: Vesicles-vacuoles morphology was
compared between SU-l growing in YEP and YES growth media, using bright ﬁeld
microscopy. Black arrowheads show examples of vacuoles and white arrows point to
vesicles. The reversibility of the morphologies as demonstrated by nutritional shift
experiments is represented by forward and backward arrows. Size Bar = 5pm. Panel B:
Vacuole (VAC) and vesicles numbers (VES) of SU-l grown in YES medium at 24h and
40h. Panel C: Vacuole and vesicles numbers of SU-l grown in YEP medium at 24h and
40h. Panel D: Nutritional shiﬁ of SU-l from YES at 40h to YEP medium. B (for panels
D and E) represents “before shift” i.e. 40h time point and A (for panels D and E)
represents “after shift” which is 6h after the shift was made. Panel E: Nutritional shift of
SU-l from YEP at 40h to YES medium.

N (for panels B-E) equals the average number of vacuoles (VAC) or vesicles
(VES) observed per mycelium in focus per ﬁeld observed under bright ﬁeld microscopy

(from 10 different ﬁelds per biological replicate. Two biological replicates were used.

83

 

 

 

Figure 3.1

84

Treatment of A. parasiticus with Sortin3

In a recent study, three chemicals were identiﬁed as protein sorting inhibitors
(Sortins) in yeast (Zouhar et al., 2004). Sortinl, Sortin2 and Sortin3 caused carboxy
peptidase Y (CPY) secretion to the growth medium; normally CPY is transported to
vacuoles. Sortin3 showed a weaker effect on CPY secretion, but, unlike Sortinsl and 2,
showed an altered vacuolar morphology (vam) phenotype that was similar to a yeast
strain carrying a mutation in vpsI6 (vps16A). The mechanisms underlying the effects of
Sortins are not understood. To detect a possible link between vacuole biogenesis and
aﬂatoxin synthesis, we treated A. parasiticus with Sortinsl , 2 and 3 with doses optimized
by Zouhar in yeast (Zouhar et al., 2004).

Growth rate of SU-l was severely reduced with Sortinsl and 2 treatments. In
contrast, Sortin3, did not show any signiﬁcant effect on growth rate of SU-l as
compared to untreated SU-l (YES only) in the vehicle control (YES plus DMSO)
(Figure 3.2 C). Due to severe effects of Sortinl and 2 treatments on growth, their effects
on vacuolar morphology and aﬂatoxin production were not studied further.

To determine the effect of Sortin3 treatment on aﬂatoxin synthesis, SU-l was
grown in YES medium for 40h. At this time, SU-l synthesizes aﬂatoxin at peak levels
and exports 99% of the toxin into the grth medium (Roze et al., 2007). To measure
the effect of Sortin3 treatment on vesicles-vacuole morphology, SU-l was grown in YEP
medium for 40h (at this time, SU-l showed signiﬁcantly lower numbers of vesicles
(<2.5pm) than in YES. We reasoned, if Sortin3 treatment inhibited vacuole biogenesis to
produce increased vesicles numbers, this effect could be better observed if SU-l is grown

in YEP medium.

85

Bright ﬁeld microscopy demonstrated that Sortin3 treated SU-l carried a
signiﬁcantly higher number of vesicles in YEP as compared to untreated SU-l (Figure
3.2A-B). Sortin3 treatment also resulted in aﬂatoxin accumulation (ELISA) in YES
growth medium that was approximately 5 fold higher as compared to untreated or vehicle
controls (Figure 3.2 D). To determine whether the increase in aﬂatoxin was associated
with an increase in aﬂatoxin enzymes, we compared the levels of three enzymes, Ver-l,
Vbs and OmtA, in SU-l grown in YES with or without Sortin3 treatment using Western
blot analysis (Figure 3.2E). Sortin3 increased Ver-l, OmtA, and Vbs levels signiﬁcantly
but not to the extent that aﬂatoxin accumulation increased. These data demonstrate that
interruption of vesicle-vacuole fusion increases vesicles accumulation that results in

accumulation of functional aﬂatoxin enzymes and hence increases aﬂatoxin production.

Sequence analysis of vb] in A. parasiticus

A. parasiticus vb] encodes a protein containing 205 amino acids. The Vbl amino
acid sequence is 74% identical to mammalian Rab7, 70% identical to yeast th7 and
94% identical to AvaA in A.nidulans. All ﬁve regions involved in GTP-binding and
hydrolysis in th7/Rab7 GTPases along with a isoprenoid binding motif with two
characteristic cysteine residues at the c-terminus (Lazar et al., 1997; Ohsumi et al., 2002)
are conserved. These similarities in amino acid sequence suggest functional similarity

(homology) of Vbl with th7/Rab7 GTPases.

86

Figure 3.2 Effect of Sortin3 on SU-l

Panel A-B: Comparison of vesicle-vacuole morphology in presence (panel B) and
absence (panel A) of Sortin3. Size Bars = 5pm. Panel C: Dry weight comparisons
between SU-l grown in YES medium in presence (+) and absence (-) of Sortin3. Panel
D: Comparison of aﬂatoxin accumulated in the media in presence (+) and absence (-) of
Sortin3. Panel E: Comparison of aﬂatoxin enzymes Ver-l, Vbs and OmtA accumulated

in SU-l at 40h grown in presence (+) and absence (-) of Sortin3.

87

 

 

 

 

55

Aflatoxin
(pg/mg dry Wt)

 

 

 

E- SU—1(40h)

Vbs

OmtA

Ver-l

 

Figure 3.2.

Role of vb] in A. parasiticus vacuole biogenesis and aﬂatoxin synthesis

Transformants AC5, AC7 and ACll were identiﬁed as vb] disruptant strains
based on Southern hybridization analysis (Figure 3.3C). NR-l (the host strain) and
transformant AC34 (the mutant niaD allele in the host strain was replaced by wild type
niaD in plasmid pVBD generating a niaD+ phenotype) carried the wild type 5.8Kb Sal]
fragment that hybridized to the vb] probe; transformants AC5, AC7 and AC1 1, carried a
12.8Kb Sal] fragment conﬁrming the presence of a 6Kb niaD selectable marker inserted
into vb]. These data provide direct evidence of vbl gene disruption in AC5, 7, and 11.

To determine whether disruption of vb] affects vacuole biogenesis, vesicles-
vacuole morphology in the vb] disruptants was compared with wild-type SU-l at 40h in
YEP medium. vb] disruption resulted in a large increase in vesicles number in YEP in the
transformants. Figure 3.4 shows the comparison of one of the transformants (AC1 l) with
SU-l and NR-l.

To determine whether disruption of vb] affects aﬂatoxin synthesis, we measured
aﬂatoxin synthesized in the medium per gram (dry weight) of AC11 and SU-l (ELISA).
ACll accumulated approximately 15 fold more aﬂatoxin as compared to SU-l at 40h
(Figure 3.5A b). To determine whether the increased aﬂatoxin accumulation in the
growth medium by AC1 1 was due to higher aﬂatoxin enzyme levels in the mycelium, we
performed Western blot analysis with antibodies against Nor-1, Ver-l, Vbs and OmtA.
The data (Figure 3.5B) show that all four aﬂatoxin enzymes were detected at signiﬁcantly
higher levels (Vbs and OmtA by approximately 2 fold, Ver-l by approximately 3 fold
and Nor-1 approximately 2.5 fold) in ACll as compared to wild-type SU-l. Using

Oddesey software, the approximate mean intensities of the bands representing aﬂatoxin

89

Figure 3.3 Disruption of A. parasiticus vb] gene

Panel A. Plasmid map of pVB used for disruption of vb] gene Panel B. Scheme of
integration of the SphI/Nde] linear fragment (lOkB) leading to replacement of wild type
vb] with the disruption construct carrying Avb] ::niaD. Panel C. Southern blot analysis
for conﬁrmation of the disruption of A. parasiticus vb] in strains AC5, AC7 and AC1 1. P
represents a 0.3Kb probe for vb]. Disruption of vb] was demonstrated by a 11.8 Kb Sal I

fragment; 5.8 Kb Sal I fragment represents wild type vb].

90

Sph l 244
Xba I 258

   
  
 

Nde I 10611
amp

pVB
12798 bp

  
  

Xma I 10381

  
   
   

niaD

 

 

 

 

 

 

 

 

B.
; 7Kb ﬂ
Ndel niaD .I’. Sphl
l ___J
\
Sal l\ _g SalI
1K
#5.8Kb#l
C.
AC5 AC7 AC1] AC34 NR-l
L scheme of 11.8Kb
10f Wildly]:
. 5.8Kb
blot anal)?“
and AC1” Figure 3.3

11.8Kbsall

91

SU-l NR-l AC11

 

Figure 3.4 Effect of A.parasiticus vb] on vacuole-vesicles morphology

Vacuole-vesicuar morphology was compared between SU-l (wild type strain), NR-l
(host strain for fungal transformation) and a vb] mutant AC11 under bright ﬁeld
microscopy. A total of 10° spores were inoculated into 100 ml YEP liquid medium and
incubated at 30°C with shaking for 40h. SU-l and NR-l represented a similar
morphology (predominance of vacuoles compared to vesicles). AC11 showed less than
5% vacuoles at this time point grown under similar conditions demonstrating a “high

vesicles number” phenotype. Size Bars = 5 pm.

92

proteins were compared between SU-l grown in presence (+) and absence (-) of Sortin3.
A 10 fold higher mean intensity was observed for Ver-l protein in (+) than (-). A 25%
higher mean intensity was observed for Vbs and 20% higher mean intensity was observed
for OmtA protein in (+) compared to (-).

There are at least two possible explanations for the observed increase in aﬂatoxin
enzymes in AC11. First, disruption of vb] increases .aﬂatoxin gene expression by an
unknown mechanism. Second, increased vesicles accumulation resulting from disruption
of vb] leads to an accumulation of functional proteins in vesicles. To help determine if
either or both of these explanations contribute to increased aﬂatoxin accumulation, we
performed RT-PCR to measure the level of gene expression at the RNA level for the
aﬂatoxin gene, ver-I (Figure 3.6). No signiﬁcant difference in the expression of this

gene was observed

93

Figure 3.5 Effect of vb] disruption on aﬂatoxin and aﬂatoxin enzymes

94

 

 

NU)

Dry Wt.,g

 

 

 

 

 

 

SU-l AC11

 

 

 

 

b 150
E' _
.5 e 100
3 '5
a 0.0
S". in so —
0 ["7 _
SU-l AC11

Figure 3.5 A. a. Dry weight comparisons between SU-l and AC11 ( a vb] disruptant )
grown in YES medium for 40h. b: Comparison of aﬂatoxin accumulated in the media by
AC11 and SU-l. Aﬂatoxins in the media was estimated by ELISA and normalized to the

dry weight of the mycelium.

95

JACll SU-l

    
 

Vbs

OmtA '

Ver-l

No.1»: .

Figure 3.5B: Comparison of aﬂatoxin enzymes Nor-1, Ver-l, Vbs and OmtA

accumulated in AC11 and SU-l at 40h.

96

Figure 3.6 Comparison of transcript levels by RT-PCR. 10° conidiospores of each strain
were inoculated into 100 ml YES liquid medium and incubated at 30°C with shaking for
40h. Total RNA was extracted. RT-PCR was performed on total RNA treated with
RNAse-free DNAse I with primers speciﬁc for the coding region of each gene. PCR

products were separated by electrophoresis on a 0.8% agarose gel.

97

Table 3.1. List of primers used for RT-PCR (Figure 3.6)

«(9.8 5 “PO ’\
§e°e$v9v~° :9

vb]
(463bp)

B-tubulin
(61 Obp)

 

 

 

 

 

 

 

 

 

Gene Primers PCR product Introns
gDNA cDNA

vb] F-5’ CAACAAGTTCAGCGCCAGCTAC 3’ 689bp 463bp 3
R-5’ AAACTCTTCGGCCTCTTCTTGC 3’

B-tubulin F-5’ TTCCGTCCCGACAACTTC 3’ 610bp 610bp 0
R-5’ TCAGGAACGGAGACGGC 3’

ver-I F-5’ AACAGATCAAGGCCAATGGT 3’ 628bp 518bp 2
R- 5’ AGGAGAGAGCCAAGCGG 3’

 

98

 

between the vb] disruption strains AC7 and AC11 and wild-type SU-l. The RT-PCR

data tend to support the second explanation.

Comparison of the expression (RT-PCR) of A. parasiticus vb] and the vpsl6
homologue under aﬂatoxin inducing and non-inducing conditions

To better understand the role of the vacuole biogenesis gene vb] in aﬂatoxin
synthesis, we compared expression of vb] at the level of RNA by RT-PCR in A.
parasiticus grown for 24, 30 and 40h in aﬂatoxin inducing medium (YES) and aﬂatoxin
non-inducing medium (YEP). Because Sortin3 treatment results in a Vpsl6 phenotype in
yeast and because vesicle transport machinery is conserved in eukaryotes (Bennett &
Scheller, 1993), we also measured expression of the A. parasiticus vps] 6 homologue. The
data demonstrate that the expression of vb] and the vpsl6 homologue remained the same
at all time points in YEP. However, in YES, expression of both genes declined as
aﬂatoxin synthesis increased from 24 to 40h (Figure 3.7). This decline in expression
correlates with a signiﬁcant rise in vesicles in SU-l observed between 24 and 40h in YES

medium.

99

Figure 3.7. Comparison of time course transcript levels between SU-l grown in aﬂatoxin
inducing conditions (YES growth medium) and non-inducing medium (YEP growth
medium) by RT-PCR. 10° conidiospores of SU-l wild type strain was inoculated into 100
ml YES and YEP liquid medium and incubated at 30°C with shaking for three different
time points (24h, 30h and 40h). Total RNA was extracted. RT-PCR was performed on
total RNA treated with RNAse-free DNAse I with primers speciﬁc for the coding region

of each gene. PCR products were separated by electrophoresis on a 0.8% agarose gel.

100

YES YEP

(518bp) . , .. -

 

vpsl6
(400bp) I ~ .11. _

vb]
(463 l)p)

 

 

 

Figure 3.7

Table 3.2. List of primers used for RT-PCR (Figure 3.7)

 

 

 

 

Gene Primers PCR product Introns
gDNA cDNA
vb] F-5’ CAACAAGTTCAGCGCCAGCTAC 3’ 689bp 463bp 3
R-5’ AAACTCTTCGGCCTCTTCTTGC 3’
vps16 F-5’ TGAAGATGTTGAACTAGAGAAC 3’ 500bp 400bp 3
R-S’ GGGCTCGCTATAGTTAGAC 3’
ver-I F-5’ AACAGATCAAGGCCAATGGT 3’ 628bp 518bp 2

R- 5’ AGGAGAGAGCCAAGCGG 3’

 

 

 

 

 

101

 

DISCUSSION

Fusion of vesicles with vacuoles is a frequent occurrence in A. parasiticus
(Figure 3.8). As discussed in Chapter 2 of this dissertation, we ﬁrnctionally linked
aﬂatoxin synthesis to a pure vesicles-vacuoles fraction. Analysis of the organelles in this
fraction demonstrated the presence of Ver-l, Vbs and OmtA. Another recent study
demonstrated the presence of Nor-1 in these same organelles (Hong, 2008). These
organelle fraction also could convert the late pathway intermediate sterigmatocystin
(exogenously added) to aﬂatoxin, demonstrating directly that vesicles-vacuoles serve as
the primary sub-cellular site(s) for the late steps in aﬂatoxin synthesis. The current study
demonstrates that one can increase aﬂatoxin accumulation by interfering with fusion of
vesicles with vacuoles.

The data strongly support a model which proposes that aﬂatoxin enzymes are
made in the cytoplasm and transported in vesicles to vacuoles. At least the last two
enzymatic steps in aﬂatoxin biosynthesis are completed in vesicles and these organelles
also participate in compartmentalization and probably in export of the end-product,
aﬂatoxin, into the growth medium. Characterization of these aﬂatoxin synthesizing
vesicles (“aﬂatoxisomes”) will be addressed in our future studies. We hypothesize that
aﬂatoxin enzymes likely continue to make aﬂatoxin until they are eventually turned over
in vacuoles by peptidases that are also transported there. We also propose that during
aﬂatoxin synthesis, signals from the grth environment not only turn on gene
expression ( a model described by us previously (Roze et al., 2007)) but also result in a

decrease in vacuole biogenesis resulting in accumulation of aﬂatoxisomes that carry

102

 

Figure 3.8. Bright ﬁeld microscopy representing vacuole biogenesis in A.parasiticus. A
mycelium of SU-l grown on solid culture for 3 days was observed in an independent
study. A series of images of a mycelium was acquired with 2 to 5 min intervals. The
series of red arrows on the top shows the fusion of a vesicle into a vacuole. The lower

series of red arrows show the fusion of two vesicles to form single vesicles.

103

Figure 3.9A-B. Model depicting the role of vacuole biogenesis in aﬂatoxin biosynthesis

3.9 A: Several studies suggest that early, middle and late enzymes in aﬂatoxin
biosynthesis are synthesized initially in the cytoplasm. During peak levels of aﬂatoxin
synthesis, some or all of the aﬂatoxin enzymes are transported to vacuoles via a direct
route (a) or a vesicles-mediated route (b). Transport via route (Q: the model proposes
that early and middle aﬂatoxin enzymes are functional in the cytoplasm and transported
to vacuoles for turnover; this model predicts that ST is present initially in the cytosol and
then transported to vesicles by an unknown mechanism — here, only the late pathway
steps occur in vesicles-vacuoles. Transport via route (b). If most or all aﬂatoxin enzymes
localize to vesicles-vacuoles and are functional in that location, the model predicts that
most or all of aﬂatoxin synthesis occurs in vesicles-vacuoles. ST = sterigmatocystin,
OMST = a-methylsterigmatocystin, AF = aﬂatoxin. The green dashed arrow proposes
site of action of Vbl and Sortin3. The increased aﬂatoxin accumulation on interruption of

vacuolar biogenesis support transport via route (b).

104

 

 
  
  

 
    
   

  

     
  
  
     

 

 

 

Fusion enabled by a tethering complex

analogous to Class C Vps complex in

yeast (vbI and vpsl6 homogue

components of this comp ex)

‘ AF V l
acuo e
‘ \ /ST Cytoplasm
[thess O MST
ﬂaioxin
a
llatoxin S'I‘
/ \
. I .
adireci ’ I Early and middle enzymes
0
_ ’ Acctvl Co—A : ‘
r0p0533 ’ .0
. .~ ‘
spoiled ‘IIIIIII"II-Il-
<01 and Vesicles carrying
- functional OmtA and OmtA and OrdA <I _
3mm OrdA or all aﬂatoxin
4 enzymes
mmes
:15 {I131
_ Figure 3.9 A

.c}'511ﬂ-
OPOS°°
i110“ of

105

3.9 B. Panel a. At the start of aﬂatoxin synthesis vacuole biogenesis enables functionally
active aﬂatoxin enzymes to reach vacuoles. Vacuolar peptidases also transported to
vacuoles probably lead to degradation of aﬂatoxin enzymes keeping the aﬂatoxin
synthesis at low level. Panel b. Between 24 to 48h vacuole biogenesis is downregulated
(suggested by time course gene expression levels for vb] and vpsl6 homologue in A.
parasiticus) vesicles containing functional aﬂatoxin enzymes accumulate leading to
accumulation of aﬂatoxins at maximum levels. We designate these aﬂatoxin synthesizing

vesicles as aﬂatoxisomes (see discussion).

106

a. At initiation stages of
aflatoxin production

Active aflatoxin
enzyme trafﬁc from
aﬂatoxisomes to
vacuoles

Vesicle

Vacuole

During peak levels of
aﬂatoxin s thesis

Vesicles #I ””0"“ enzyme trafﬁc

slows down

‘00-.-

Vacuole ‘

#1

Figure 3.9 B

107

active aﬂatoxin enzymes. Blocking vacuole biogenesis by genetic or chemical means
therefore results in further accumulation of aﬂatoxisomes leading to an even larger
increase in aﬂatoxin accumulation. Fusion of vesicles to vacuoles therefore appears to be
one important mechanism by which the fungus regulates the level of accumulation of
aﬂatoxin enzymes and aﬂatoxin in the cell. For a schematic of our model (the role of
vesicle-vacuole fusion in aﬂatoxin synthesis) see Figure 3.9. The observation that early
(Nor-1), middle (V er-l and Vbs) and late (OmtA) aﬂatoxin enzymes all increase with
increased accumulation of vesicles in vb] disruption mutants suggests that most of, or the
entire aﬂatoxin biosynthetic pathway is carried in or on vesicles and vacuoles.

The N-glycosylation motif in Vbs combined with TEM and immunoﬂuoresence
data demonstrate the localization of Vbs in ring-like structures around nuclei as well as in
the cytoplasm (Chiou, 2003). The current data (Western blot analysis suggests the
presence of Vbs in vesicles-vacuoles fraction and interruption of vesicle-vacuole fusion
increases Vbs accumulation in the cell) suggest strongly that Vbs is transported to
vacuoles through a secretory pathway (ER-)Golgi-)vesicles-)vacuoles). Recent studies
(Hong & Linz, 2008; Lee, 2003) demonstrate that Nor-1, Ver-l, and OmtA (proteins that
do not have N-glycosylation motif) are localized in cytoplasm when aﬂatoxin synthesis
initiates; then localizes in the cytoplasm, vesicles and vacuoles when aﬂatoxin synthesis
occurs at peak levels. We propose based on these observations that these proteins also
reach vacuoles through vesicles; but they probably take a different route (gytoplasm-to-
yacuoles-targeting pathway or Cvt) to reach vacuoles. Why should the fungus employ a
different route for Vbs trafﬁcking? Vbs catalyzes the bisfuran ring closure in versiconal

hemiacetal (a reaction near the middle of the pathway) to form versicolorin B (the ﬁrst

108

toxic intermediate in aﬂatoxin biosynthetic pathway) (Chiou et al., 2004). We propose
that a different route for Vbs protein trafﬁc is a mechanism by which the fungus ensures
prevention of any aﬂatoxin synthesis in the cytoplasm, thus avoiding self-toxicity. Our
preliminary data suggest that Vbs forms a complex with Ver-l and OmtA. We
hypothesize that vesicles form aﬂatoxisomes only when functional enzymes involved in
aﬂatoxin biosynthesis co-localize to a form complex that can complete the pathway.
When and how the enzymes co-localize to aﬂatoxisomes to carry out their functions
remain to be elucidated. Most aﬂatoxin that accumulates in the vb] disruption strain
can be transported outside the cell; this observation demonstrates that the aﬂatoxin
secretion machinery is not vacuole dependent. This may suggest then that aﬂatoxin
synthesis and export may both be primary functions of aﬂatoxisomes, while aﬂatoxin
storage and aﬂatoxin enzyme turnover may take place primarily in vacuoles. Whether or
not aﬂatoxisomes mediate this export (exocytosis) needs to be elucidated in our future
studies.

In yeast, at least six different pathways can be used to transport proteins to
vacuoles; many of these pathways are mediated by vesicles (Bowers & Stevens, 2005;
Bryant & Stevens, 1998; Kucharczyk & Rytka, 2001; Martin et al., 2005; Ostrowicz et
al., 2008; Takegawa et al., 2003; Teter & Klionsky, 2000; Weisman, 2003; Weisman,
2006; Wickner, 2002). One observation during our work with Sortinl suggests the
importance of a CPY trans-golgi to vacuole route in mediating aﬂatoxin enzyme delivery
to vacuoles. Sortinl treatment results in missorting of CPY outside the yeast cell
instead of sorting to vacuoles (Zouhar et al., 2004). Sortinl treatment severely inhibited

grth in A. parasiticus However, in a preliminary study using strain V-86 (expresses

109

Ver-l protein fused to EGF P), we observed that Sortinl treatment caused Ver-l fused to
EGFP (contained in vesicles) to be secreted outside the cells into the medium. Follow up
studies will try to understand why Sortinl affects growth in A. parasiticus and why it
stimulates the export of aﬂatoxin enzymes into the medium.

The enormous impact of vacuole biogenesis on growth in ﬁlamentous fungi
makes it difﬁcult to obtain vacuolar sorting mutants (Shoji et a]. , 2008). In support of this
we observed that when vb] disruption mutants were grown in non-selective conditions,
15-20% of nuclei appeared to revert to wild type by elimination of the disruption
construct (data not shown). Our work demonstrates that A. parasiticus Vbl and A.
nidulans AvaA share a high similarity not only in protein sequence (94% identity) but
also in their function (both affect vacuole biogenesis). Based on these data, we decided to
re-designate A. parasiticus vb] gene as A. parasiticus avaA in our future studies to avoid
any unnecessary confusion in gene designation.

Of primary importance, our studies support the idea that Aspergilli, like other
organisms with small genomes, utilize existing conserved cellular machinery (vesicle
trafﬁcking) to conduct new cellular functions (aﬂatoxin synthesis). Understanding the
mechanisms that co-regulate the activation of aﬂatoxin synthesis and the shift to form
aﬂatoxisomes is a key to development of efﬁcient strategies to manipulate secondary

metabolism in general and aﬂatoxin synthesis speciﬁcally.

110

REFERENCES

Agarwal, P. K., Agarwal, P., Jain, P., Jha, B., Reddy, M. K. & Sopory, S. K. (2008).
Constitutive overexpression of a stress-inducible small GTP-binding protein PgRab7
from Pennisetum glaucum enhances abiotic stress tolerance in transgenic tobacco. Plant
Cell Rep 27, 105-115.

Alcantara, J., Bird, D. A., Franceschi, V. R. & Facchini, P. J. (2005). Sanguinarine
biosynthesis is associated with the endoplasmic reticulum in cultured opium poppy cells
after elicitor treatment. Plant Physio] 138, 173-183.

Ausubel, F. M. (1998). Current protocols in molecular biology. New York: John Wiley
& Sons.

Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. A. Seidman, J. A. Smith,
& Struhl., a. K. (2003). Current Protocols in Molecular Biology. New York: John Wiley
& Sons.

Bennett, M. K. & Scheller, R. H. (1993). The molecular machinery for secretion is
conserved from yeast to neurons. Prac Nat] Acad Sci U S A 90, 2559-2563.

Bowers, K. & Stevens, T. H. (2005). Protein transport from the late Golgi to the vacuole
in the yeast Saccharomyces cerevisiae. Biochim Biophys Acta 1744, 43 8-454.

Bryant, N. J. & Stevens, T. H. (1998). Vacuole biogenesis in Saccharomyces cerevisiae:
protein transport pathways to the yeast vacuole. Microbial Mal Biol Rev 62, 23 0-247.

Bucci, C., Thomsen, P., Nicoziani, P., McCarthy, J. & van Deurs, B. (2000). Rab7: a
key to lysosome biogenesis. Ma] Biol Cell 11, 467-480.

Cantalupo, G., Alifano, P., Roberti, V., Bruni, C. B. & Bucci, C. (2001). Rab-
interacting lysosomal protein (RILP): the Rab7 effector required for transport to
lysosomes. Emba J 20, 683-693.

Cary, J. W., Montalbano, B. G. & Ehrlich, K. C. (2000). Promoter elements involved
in the expression of the Aspergillus parasiticus aﬂatoxin biosynthesis pathway gene
avnA. Biochim Biophys Acta 1491, 7-12.

Chiou, C.-H. (2003).Position-dependent regulation of the nor-1 promoter in the aﬂatoxin

gene cluster and immuno-localization of proteins involved in aﬂatoxin biosynthesis, pp.
xi, 141 leaves: Michigan State University. Dept. of Food Science and Human Nutrition.

Chiou, C. H., Lee, L. W., Owens, S. A., Whallon, J. H., Klomparens, K. L.,
Townsend, C. A. & Linz, J. E. (2004). Distribution and sub-cellular localization of the

111

aﬂatoxin enzyme versicolorin B synthase in time-fractionated colonies of Aspergillus
parasiticus. Arch Microbial 182, 67-79.

Conibear, E. & Stevens, T. H. (1995). Vacuolar biogenesis in yeast: sorting out the
sorting proteins. Cell 83, 513-516.

Conibear, E. & Stevens, T. H. (1998). Multiple sorting pathways between the late Golgi
and the vacuole in yeast. Biochim Biophys Acta 1404, 211-230.

Costa, M. M., Hilliou, F., Duarte, P., Pereira, L. G., Almeida, 1., Leech, M.,
Memelink, J., Barcelo, A. R. & Sottomayor, M. (2008). Molecular cloning and
characterization of a vacuolar class III peroxidase involved in the metabolism of
anticancer alkaloids in Catharanthus roseus. Plant Physio] 146, 403-417.

Ferro-Novick, S. & Jahn, R. (1994). Vesicle fusion from yeast to man. Nature 370,
191-193.

Haas, A., Scheglmann, D., Lazar, T., Gallwitz, D. & Wickner, W. (1995). The
GTPase th7p of Saccharomyces cerevisiae is required on both partner vacuoles for the
homotypic fusion step of vacuole inheritance. Emba J 14, 525 8-5270.

Hong, S.-Y. (2008). Analysis of transport and sub-cellular localization of aﬂatoxin
biosynthetic enzymes, Ver-l and Nor-1, using EGF P fusions in Aspergillus parasiticus.,
pp. 311: Michigan State University. Dept. of Food Science and Human Nutrition, 2008.

Hong, S. Y. & Linz, J. E. (2008). Functional expression and subcellular localization of
the aﬂatoxin pathway enzyme Ver-l fused to enhanced green ﬂuorescent protein. Appl
Environ Microbial 74, 63 85-6396.

Hoppert, M., Gentzsch, C. & Schorgendorfer, K. (2001). Structure and localization of
cyclosporin synthetase, the key enzyme of cyclosporin biosynthesis in Tolypocladium
inﬂatum. Arch Microbial 176, 285-293.

Horng, J. 8., Chang, P. K., Pestka, J. J. & Linz, J. E. (1990). Development of a
homologous transformation system for Aspergillus parasiticus with the gene encoding

nitrate reductase. Ma] Gen Genet 224, 294-296.

Klionsky, D. J. (1997). Protein transport from the cytoplasm into the vacuole. J Membr
Biol 157, 105-115.

Klionsky, D. J. & Ohsumi, Y. (1999). Vacuolar import of proteins and organelles from
the cytoplasm. Annu Rev Cell Dev Biol 15, 1-32.

Kucharczyk, R. & Rytka, J. (2001). Saccharomyces cerevisiae--a model organism for
the studies on vacuolar transport. Acta Biochim Pa] 48, 1025-1 042.

112

 

 

 

Lazar, T., Gotte, M. & Gallwitz, D. (1997). Vesicular transport: how many th/Rab-
GTPases make a eukaryotic cell? Trends Biochem Sci 22, 468-472.

Lee, L.-W. (2003).Punctional analysis of OmtA and subcellular localization of aﬂatoxin
enzymes in Aspergillus parasiticus, pp. xi, 141 leaves: Michigan State University. Dept.
of Food Science and Human Nutrition, 2003.

Lee, L. W., Chiou, C. H. & Linz, J. E. (2002). Function of native OmtA in vivo and
expression and distribution of this protein in colonies of Aspergillus parasiticus. Appl
Environ Microbial 68, 5718-5727.

Lee, L. W., Chiou, C. H., Klomparens, K. L., Cary, J. W. & Linz, J. E. (2004).
Subcellular localization of aﬂatoxin biosynthetic enzymes Nor-1, Ver-l , and OmtA in
time-dependent fractionated colonies of Aspergillus parasiticus. Arch Microbial 181,
204-214.

Lendenfeld, T., Ghali, D., Wolschek, M., Kubicek—Pranz, E. M. & Kubicek, C. P.
(1993). Subcellular compartmentation of penicillin biosynthesis in Penicillium
chrysogenum. The amino acid precursors are derived from the vacuole. J Biol Chem 268,
665-671.

Liang, S.-H. (1996).The ﬁrnction and expression of the ver-l gene and localization of the
ver-l protein involved in aﬂatoxin B1 biosynthesis in Aspergillus parasiticus, pp. xi, 135
leaves: Michigan State University. Dept. of Food Science and Human Nutrition, 1996.

Martin, J. F., Casqueiro, J. & Liras, P. (2005). Secretion systems for secondary
metabolites: how producer cells send out messages of intercellular communication. Curr
Opin Microbial 8, 282-293.

Miller MJ, L. J. (2006). Genetic mechanisms involved in regulation of mycotoxin
biosynthesis. Food Biotechnology.

Mo, B., Tse, Y. C. & Jiang, L. (2006). Plant prevacuolar/endosomal compartments. Int
Rev Cytal 253, 95-129.

Muller, W. H., van der Krift, T. P., Krouwer, A. J., Wosten, H. A., van der Voort, L.
H., Smaal, E. B. & Verkleij, A. J. (1991). Localization of the pathway of the penicillin
biosynthesis in Penicillium chrysogenum. Emba J 10, 489-495.

Mullins, C. & Bonifacino, J. S. (2001). The molecular machinery for lysosome
biogenesis. Biaessays 23, 333-343.

Nahm, M. Y., Kim, S. W., Yun, D., Lee, S. Y., Cho, M. J. & Bahk, J. D. (2003).

Molecular and biochemical analyses of OsRab7, a rice Rab7 homolog. Plant Cell Physiol
44, 1341-1349.

113

Ohsumi, K., Arioka, M., Nakajima, H. & Kitamoto, K. (2002). Cloning and
characterization of a gene (avaA) from Aspergillus nidulans encoding a small GTPase
involved in vacuolar biogenesis. Gene 291, 77-84.

Ono, E., Hatayama, M., Isono, Y. & other authors (2006). Localization of a ﬂavonoid
biosynthetic polyphenol oxidase in vacuoles. Plant J 45, 133-143.

Ostrowicz, C. W., Meiringer, C. T. & Ungermann, C. (2008). Yeast vacuole fusion: a
model system for eukaryotic endomembrane dynamics. Autophagy 4, 5-19.

Pestka, J. J. (1988). J Assoc Anal Chem 71, 1075-1081.

Roze, L. V., Arthur, A. E., Hong, S. Y., Chanda, A. & Linz, J. E. (2007). The
initiation and pattern of spread of histone H4 acetylation parallel the order of
transcriptional activation of genes in the aﬂatoxin cluster. Ma] Microbial 66, 713-726.

Saslowsky, D. & Winkel-Shirley, B. (2001). Localization of ﬂavonoid enzymes in
Arabidopsis roots. Plant J27, 37-48.

Schimmoller, F. & Riezman, H. (1993). Involvement of th7p, a small GTPase, in
trafﬁc from late endosome to the vacuole in yeast. J Cell Sci 106 (Pt 3), 823-830.

Shoji, J. Y., Arioka, M. & Kitamoto, K. (2008). Dissecting cellular components of the
secretory pathway in ﬁlamentous ﬁmgi: insights into their application for protein
production. Biatechnal Lett 30, 7-14.

Skory, C. D., Homg, J. S., Pestka, J. J. & Linz, J. E. (1990). Transformation of
Aspergillus parasiticus with a homologous gene (pyrG) involved in pyrimidine
biosynthesis. Appl Environ Microbial 56, 3315-3320.

Skory, C. D., Chang, P. K., Cary, J. & Linz, J. E. (1992). Isolation and
characterization of a gene from Aspergillus parasiticus associated with the conversion of

versicolorin A to sterigmatocystin in aﬂatoxin biosynthesis. Appl Environ Microbial 58,
3527-3537.

Takegawa, K., Iwaki, T., F ujita, Y., Morita, T., Hosomi, A. & Tanaka, N. (2003).
Vesicle-mediated protein transport pathways to the vacuole in Schizosaccharomyces
pombe. Cell Struct F unct 28, 399-417.

Tanaka, Y., Sasaki, N. & Ohmiya, A. (2008). Biosynthesis of plant pigments:
anthocyanins, betalains and carotenoids. Plant J54, 733-749.

Teijeira, F., Ullan, R. V., Guerra, S. M., Garcia-Estrada, C., Vaca, I. & Martin, J. F.

(2008). The transporter CefM involved in translocation of biosynthetic intermediates is
essential for cephalosporin production. Biochem J.

114

 

 

Teter, S. A. & Klionsky, D. J. (2000). Transport of proteins to the yeast vacuole:
autophagy, cytoplasm-to-vacuole targeting, and role of the vacuole in degradation. Semin
Cell Dev Bio] 11, 173-179.

Ueda, T. & Nakano, A. (2002). Vesicular trafﬁc: an integral part of plant life. Curr Opin
Plant Biol 5, 513-517.

van de Kamp, M., Driessen, A. J. & Konings, W. N. (1999). Compartmentalization and
transport in beta-lactam antibiotic biosynthesis by ﬁlamentous fungi. Antonie Van
Leeuwenhoek 75, 41-78.

van der Lende, T. R., van de Kamp, M., Berg, M., Sjollema, K., Bovenberg, R. A.,
Veenhuis, M., Konings, W. N. & Driessen, A. J. (2002). delta-(L-alpha-Aminoadipyl)-
L-cysteinyl-D-valine synthetase, that mediates the ﬁrst committed step in penicillin
biosynthesis, is a cytosolic enzyme. F unga] Genet Bio] 37, 49-55.

Vitelli, R., Santillo, M., Lattero, D., Chiariello, M., Bifulco, M., Bruni, C. B. &
Bucci, C. (1997). Role of the small GTPase Rab7 in the late endocytic pathway. J Biol
Chem 272, 4391-4397.

Weisman, L. S. (2003). Yeast vacuole inheritance and dynamics. Annu Rev Genet 37,
435-460.

Weisman, L. S. (2006). Organelles on the move: insights from yeast vacuole inheritance.
Nat Rev Mal Cell Biol 7, 243-252.

Whyte, J. R. & Munro, S. (2002). Vesicle tethering complexes in membrane trafﬁc. J
Cell Sci 115, 2627-2637.

Wichmann, H., Hengst, L. & Gallwitz, D. (1992). Endocytosis in yeast: evidence for
the involvement of a small GTP-binding protein (th7p). Cell 71, 1131-1142.

Wickner, W. (2002). Yeast vacuoles and membrane fusion pathways. Emba J21, 1241-
1 247.

Yabe, K. & Nakajima, H. (2004). Enzyme reactions and genes in aﬂatoxin biosynthesis.
Appl Microbial Biatechnal 64, 745-755.

Yu, J., Bhatnagar, D. & Ehrlich, K. C. (2002). Aﬂatoxin biosynthesis. Rev Iberaam
Mica] 19, 191-200.

Yu, J., Payne, G. A., Nierman, W. C. & other authors (2008). Aspergillus ﬂavus

genomics as a tool for studying the mechanism of aﬂatoxin formation. Food Addit
Contam, 1-6.

115

 

 

 

 

Zouhar, J., Hicks, G. R. & Raikhel, N. V. (2004). Sorting inhibitors (Sortins):
Chemical compounds to study vacuolar sorting in Arabidopsis. Prac Natl Acad Sci U S A
101, 9497-9501.

 

116

APPENDIX I

TIME-COURSE OF AF LATOXIN PROTEIN AND AF LATOXIN
ACCUMULATION IN ASPERGILL US PARASI T ICUS
INCLUDED AS A PART OF:
Roze, L. V., Arthur, A. E., Hong, S. Y., Chanda, A. & Linz, J. E. (2007a). The
initiation and pattern of spread of histone H4 acetylation parallel the order of

transcriptional activation of genes in the aﬂatoxin cluster. Ma] Microbial 66, 713-726.

MATERIALS AND METHODS

Western blot analysis

Mycelial samples for Western blot analysis were collected and frozen in liquid N2.
Frozen mycelium was ground in liquid N2 in a mortar with a pestle, and the powdered
mycelium was re-suspended 1:1(w/v) in TSA buffer (0.01 M Tris, 0.15 M NaCl, 0.05%
NaN3,pH 8.0) containing 1 tablet of Complete Mini Protease Inhibitor cocktail (Roche
Diagnostics, Mannheim, Germany), 50 ml Proteinase Inhibitors mix (Sigma, St Louis,
MO) and 0.125 mM phenylmethylsulphonyl ﬂuoride per 10 ml. Total protein (30—60 mg)
was separated by electrophoresis on 12% or 4—20% SDS polyacrylamide gels, transferred
to PVDF membrane, exposed to antibody speciﬁc to OmtA, Ver-l, Nor-l (all generated
in our laboratory; Lee, 2003). Then the ﬁlter was incubated with goat anti-rabbit
secondary antibody conjugated to alkaline phosphatase (Sigma, St Louis, MO), and

developed in the presence of NBT/BCIP (Roche, Penzberg, Germany).

117

 

 

 

Detection of aﬂatoxin B1
Aliquots of growth medium (10 ml) for aﬂatoxin analysis were collected and extracted
three times with 10 ml chloroform each. Aﬂatoxins were detected by ELISA (Liang,

1996) using polyclonal antibodies against aﬂatoxin B1 (Sigma).

RESULTS

Aﬂatoxin proteins were not detected at 24h of growth but were detected at 30h; Vbs was
barely detected at 24 and 30h. Then, the accumulated levels of the proteins increased in
the 40h mycelial samples (Figure AI). Accumulation of aﬂatoxin in the medium
(TableAI) correlated well with the appearance of the aﬂatoxin proteins. No aﬂatoxins
were detected at 24 or 30h, but clearly were detected at 40h. In liquid shake culture, we
observed that approximately 99% of the synthesized toxin was detected in the growth
medium, while only 1% was found in the mycelium. A similar observation was made

previously for fungal colonies grown on YES agar medium (Lee, 2003).

118

 

 

 

OmtA

17er1
VbsA

Norl

NC

Figure AI. Western blot analysis of aﬂatoxin proteins in A. parasiticus SU-l during a

transition from exponential growth to stationary phase.

Table AI. Aﬂatoxin levels in A. parasiticus SU-l grown in YES liquid medium.

 

 

 

Time Mycelium Medium
24h Undetected 0.55
30h Undetected 0.78
40h 0.01 8 6.0
68h 2.83 550

 

 

 

119

 

 

 

 

 

REFERENCES

Lee, L.-W. (2003).Functional analysis of OmtA and subcellular localization of aﬂatoxin
enzymes in Aspergillus parasiticus, pp. xi, 141 leaves: Michigan State University. Dept.
of Food Science and Human Nutrition, 2003.

Liang, S.-H. (1996).The function and expression of the ver-l gene and localization of the
ver-l protein involved in aﬂatoxin B1 biosynthesis in Aspergillus parasiticus, pp. xi, 135
leaves: Michigan State University. Dept. of Food Science and Human Nutrition, 1996.

 

 

120

APPENDIX 11

INTERACTION OF AFLATOXIN PROTEINS (A PRELIMINARY STUDY)

INTRODUCTION

The organization of enzymes into macromolecular complexes localized to speciﬁc
subcellular sites is a central feature of cellular metabolism. Recent studies in plant
secondary metabolism suggest that enzymes involved in biosynthesis of secondary
metabolites co-localize in cellular compartments to form multi-enzyme complexes e.g.
polyamine metabolism (Panicot et al., 2002) and ﬂavoinoid metbaolism (Burbulis &
Winkel-Shirley, 1999). Such metabolic complexes/channels (also called ‘metabolons’)
enable direct transfer of a pathway-intennediate from one enzyme to another thereby
maintaining a high local substrate concentration (Facchini & St-Pierre, 2005)

Our previous and current studies show that more than one aﬂatoxin proteins are
expressed at the same time range (Roze et a]. , 2007) and they localize at the same cellular
location (vesicles and vacuoles) (Hong, 2008; Hong & Linz, 2008; Lee et al., 2004). We
hypothesized that since these proteins are expressed almost at the same time range and at
the same cellular location, there is a strong possibility that the proteins physically interact
with each other to from a complex which helps the proteins to complete the biosynthetic

pathway.

121

 

 

 

MATERIALS AND METHODS
Strains, media and growth conditions

A. parasiticus strain SU-l (ATCC 56775), a wild-type aﬂatoxin producer, was
used in this study. A. parasiticus SU-l conidiospores (spores) from a frozen stock were
inoculated into YES liquid medium [contains 2% yeast extract and 6% sucrose; pH 5.8]

at 104 spores per ml and incubated at 30°C with shaking at 150 rpm for 40h.

Native gel electrophoresis and Western blot analysis

Proteins for native gel analysis were extracted from 36h old frozen mycelium by
grinding in liquid N2 in a mortar with a pestle, and the powdered mycelium was re-
suspended 1:1(w/v) in native gel solubilization buffer (5% (w/v) sucrose containing 1
tablet of Complete Mini Protease Inhibitor cocktail (Roche Diagnostics, Mannheim,
Germany), 50p] Proteinase Inhibitors mix (Sigma, St Louis, MO), 0.125mM
phenylmethylsulphonyl ﬂuoride and 0.1mg of bromophenol blue per 10 ml of the buffer).
Four different lanes were loaded with total protein 40pg (each), separated on a 12.5%
non denaturing gel (Ausubel, 2003) and transferred to PVDF membrane. The lanes were
separately exposed to antibody speciﬁc to Nor-l, Ver-l, Vbs and OmtA respectively (all
generated in our laboratory; Chiou, 2003; Lee, 2003). The ﬁlters were ﬁnally incubated
with goat anti-rabbit secondary antibody conjugated to alkaline phosphatase (Sigma, St

Louis, MO), and developed in the presence of NBT/BCIP (Roche, Penzberg, Germany).

122

 

 

 

Coimmunoprecipitation studies

Proteins from whole cells were prepared from 36 h old frozen mycelium similar
to a procedure described in Appendix I. To 1 mL of this protein solution (containing 2mg
of total proteins), 15pL of anti-rabbit IgG/protein-A agarose complex ( Oncogenic
science, Uniondale, NY) and 10pL of rabbit IgG ( 0.4 pg/pL) were added. The solution
was incubated on a platform shaker (100 rpm) at 4°C overnight followed by
centrifugation at 2500xg for 15min to precipitate the proteins that bind non-speciﬁcally to
the rabbit IgG (a preabsorption procedure). The precipitate was discarded. The
supernatant was divided into two equal volumes. To the ﬁrst volume 4pg of anti-OmtA
was added along with 15pL of anti-rabbit IgG/protein-A agarose complex (Oncogenic
Science, Uniondale, NY) to immunoprecipitate the complex involving OmtA. To the
other volume, 4pg of rabbit IgG was added as a negative control. The solutions were
incubated overnight at 4°C with shaking followed by centrifugation as described above.
The precipitates and supematants were analyzed for the presence of middle and late

aﬂatoxin proteins OmtA, Ver-l and Vbs by Western blot analysis as described above.

RESULTS
Native gel

Native gel analysis (Figure AII-a) showed that protein complexes recognized by
antibodies against Vbs, Ver-l and OmtA aligned at the same level relative to the loading
point suggesting that these three proteins might participate in a multi-protein complex.
Nor-1 antibody recognized a protein complex that was larger in size compared to the

Ver-1,Vbs, OmtA complex.

123

 

 

 

OmtA Vbs Ver Nor-1

 

Loading pain?) “3 i :1”, a... I... , _
1‘
{-Nor-l complex
OmtA,Vbs,
Ver-l -)
complex

Figure AII-a. Native gel and Western blot analysis. Proteins were extracted from 36h old
frozen mycelium as described in methods. Four different lanes were loaded with total
protein 40pg (each), separated on a 12.5% non denaturing gel and then transferred to
PVDF membrane. The membrane was cut to separate the lanes which were then
separately exposed to antibody speciﬁc to Nor-1, Ver-l, Vbs and OmtA respectively for

Western blot analysis

124

 

IP with
pre-immune
rabbit IgG

P S S P

[P with rabbit
anti-OmtA IgG

 

 

  
 

‘25-;11Ior :J‘it‘ifr $2114. “5‘57.- 5.593;; '-~“ 3.1“; 3:221; 1' ‘i—‘fifr .E‘l- _=;.wm_

 

 

   

n'.‘ 1". ."'.',',4;~, -'
.. .,.._ ..
' 11%.353‘35'3’8""-‘-'A‘.~.'-‘-_«.‘..'..". «1W mass:553.1...:«.-.+..:'.-.-.-.-.4;-'-. ~ .- .- _-:_:.. “ - . _, ,
a
'. .
I ' I er-
'% ' I” ‘- '. a ’ r“. ' i3:133:553'1':S°F:l":.‘.’:";‘.§-i~'r‘r‘3:.i‘ ' ~‘.~.€.‘5'.~v‘-v. ..53.“: “Ir-W -'3?¥‘:&‘%éﬁmsﬁr ‘

3. .. ”*WM‘WS

l
l
LE3-ifi‘7'frfx-“Q.".. {iii-3 T. is?“ -.-:-'-‘ ("1,333 ,-i-,'- ' 52 +5.13? .. ‘- """ :-_L,_L :f.:.‘ull.sL'“i-'r: M

 

 

 

Figure AII b : Immunoprecipitation (IP) with anti-OmtA. Proteins from whole cells
were prepared from 36 h old frozen mycelia as described. After a preabsorption step as
described in the methods, the protein solution was divided into two equal volumes. The
ﬁrst volume was precipitated with anti-OmtA (made in rabbit(Lee et al., 2002)). The
second volume was precipitated with rabbit IgG (Sigma, St Louis, MO)
(immunoprecipitation described in methods). Precipitates (P) and supematants(S) were
analyzed for the presence of aﬂatoxin proteins Nor-l, Ver-l, Vbs and OmtA by Western

blot analysis as described above. CE= whole cell protein extract used a positive control.

125

 

 

Coimmunoprecipitation

Native gel analysis suggested possible of complex formation between three
aﬂatoxin enzymes (V er-l, Vbs and OmtA). As a ﬁrst step to determine whether such a
protein interaction occurs between middle (Vbs) and late (V er-l and OmtA) aﬂatoxin
enzymes, an immunoprecipitation experiment was done with antibody against one of the
proteins (OmtA). A similar “pull down” was done with rabbit IgG (negative control). As
shown in ﬁgure AII b, a-OmtA was able to pull down Ver-l and some Vbs proteins along
with OmtA. Nor-1 as expected (from native gel results) was not obtained as

immunoprecipitate.

Discussion

The results suggest strongly that during aﬂatoxin biosynthesis middle and late
aﬂatoxin proteins participate in a multi-protein complex. The exact location and
signiﬁcance of this complex is yet unknown and could be a possible area to explore in

future.

126

REFERENCES

Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. A. Seidman, J. A.
Smith,and K. Struhl. (2003). Current Protocols in Molecular Biology: John Wiley &
Sons, NewYork.

Burbulis, I. E. & Winkel-Shirley, B. (1999). Interactions among enzymes of the
Arabidopsis ﬂavonoid biosynthetic pathway. Prac Natl Acad Sci U S A 96, 12929-12934.

Chiou, C.-H. (2003).Position-dependent regulation of the nor-1 promoter in the aﬂatoxin
gene cluster and immuno-localization of proteins involved in aﬂatoxin biosynthesis, pp.
xi, 141 leaves: Michigan State University. Dept. of Food Science and Human Nutrition.

Facchini, P. J. & St-Pierre, B. (2005). Synthesis and trafﬁcking of alkaloid biosynthetic
enzymes. Curr Opin Plant Biol 8, 657-666.

Hong, S.-Y. (2008).Analysis of transport and sub-cellular localization of aﬂatoxin
biosynthetic enzymes, Ver-l and Nor-1, using EGF P fusions in Aspergillus parasiticus.,
pp. 311: Michigan State University. Dept. of Food Science and Human Nutrition, 2008.

Hong, S. Y. & Linz, J. E. (2008). Functional expression and subcellular localization of
the aﬂatoxin pathway enzyme Ver-l fused to enhanced green ﬂuorescent protein. Appl
Environ Microbial 74, 6385-6396.

Lee, L.-W. (2003).Functional analysis of OmtA and subcellular localization of aﬂatoxin
enzymes in Aspergillus parasiticus, pp. xi, 141 leaves: Michigan State University. Dept.
of Food Science and Human Nutrition, 2003.

Lee, L. W., Chiou, C. H. & Linz, J. E. (2002). Function of native OmtA in vivo and
expression and distribution of this protein in colonies of Aspergillus parasiticus. Appl
Environ Microbiol 68, 5718-5727.

Lee, L. W., Chiou, C. H., Klomparens, K. L., Cary, J. W. & Linz, J. E. (2004).
Subcellular localization of aﬂatoxin biosynthetic enzymes Nor-1, Ver-l , and OmtA in
time-dependent fractionated colonies of Aspergillus parasiticus. Arch Microbial 181,
204-214.

Panicot, M., Minguet, E. G., Ferrando, A., Alcazar, R., Blazquez, M. A., Carbonell,
J., Altabella, T., Koncz, C. & Tiburcio, A. F. (2002). A polyamine metabolon
involving aminopropyl transferase complexes in Arabidopsis. Plant Cell 14, 2539-2551.

Roze, L. V., Arthur, A. E., Hong, S. Y., Chanda, A. & Linz, J. E. (2007). The

initiation and pattern of spread of histone H4 acetylation parallel the order of
transcriptional activation of genes in the aﬂatoxin cluster. Mal Microbial 66, 713-726.

127

 

APPENDIX III

AF LATOXIN SECRETION: PRELIMINARY EVIDENCE FOR INVOLVEMENT

OF SECRETORY VESICLES

INTRODUCTION

Secondary metabolites are often toxic to the microorganisms that produce them.
To protect the host strain from self-toxicity, the producer strains have developed means to
export the end-products of secondary metabolism into the environment. Along with using
transporter proteins (ATP-binding cassette(ABC) and major facilitator superfamily
(MF S) transporters) (Del Sorbo et al., 2000; Martin et al., 2005) recent studies revealed
the use of vesicle transport mechanisms that help to secrete the toxic compounds out of
the cell (e. g. exudation of secondary metabolites in the marine red alga Laurencia abtusa
(Salgado et al., 2008).

Our studies have shown that A. parasiticus exports 80% (solid culture studies;
Lee, 2003) to 99% (liquid culture studies; Roze et al., 2007) of total aﬂatoxins made by
the cell to the growth medium. The model of Roze for aﬂatoxin secretion proposes the
use of protrusions from the cell surface (Roze et al., 2007). It was proposed that
aﬂatoxins are exocytosed into the environment by vesicles containing aﬂatoxins that fuse
with the membrane surface (observed as protrusions under a microscope). Recent
transmission electron microscopy with protoplasts from aﬂatoxin producing A.

parasiticus (methods described in chapter 2) shows similar protrusions from the

128

 

 

Figure All]. 1. Protrusions and secretory vesicles observed in TEM images of pure
protoplasts. Panel a. Two protrusions seen on plasma membrane Panel b. A secretory
vesicle-like-structure budding out of a plasma membrane. Panel c. A secretory vesicle
like structure observed outside the cell near the plasma membrane. Panel a, b and c

represent three different locations in the same protoplast.

129

 

membrane surface and also shows vesicles budding out of the membranes of protoplasts
(Figure A111. 1).

As a preliminary study to test whether secretory vesicles might be involved in
aﬂatoxin export we developed a novel surface immunoﬂuoresence assay to compare the
pattern of immunoﬂuorescence imparted by anti-aﬂatoxin B1 on the A. parasiticus cell

surface during aﬂatoxin producing and non-producing conditions.

Materials and methods
Strains, growth media and antibodies

A. parasiticus strain SU-l (ATCC 56775), a wild-type aﬂatoxin producer, was
used in this study. A. parasiticus SU-l conidiospores (spores) from a frozen stock were
inoculated into the growth medium at 104 spores per ml and incubated at 30°C with
shaking at 150 rpm for 40h. YES liquid medium [contains 2% yeast extract and 6%
sucrose; pH 5.8] was used as aﬂatoxin inducing medium and YEP liquid medium
[contains 2% yeast extract and 6% peptone; pH 5.8] was used as aﬂatoxin non-inducing
medium. Antibodies against aﬂatoxin B1 made in rabbit (Sigma, St.Louis ,M0) were
used for recognition of aﬂatoxin on the surface being exocytosed. Anti-IgG labeled with
FITC (Sigma, St.Louis ,MO) was used as secondary antibody for detection of the binding
pattern. A. parasiticus AF SlO [derived from SU-l, aﬂR disruption, no aﬂatoxin enzymes
or aﬂatoxin accumulation] was used a control strain. An antibody against satratoxin
(kindly provided by Pestka lab) was used in one control experiment for determining the

speciﬁcity of this immunoassay.

130

 

Surface immunoﬂuoresence assay

A pellet of mycelia harvested ﬁ'om liquid growth medium was untangled with
sterile forceps until a visible thread was obtained. The threads of mycelia were added to
50uL of fresh YES with a-AF B1 antibodies (Sigma, St.Louis ,MO) [dilution 1:10] and
incubated for 30min at 30deg The mycelia were centrifuged at 13,000 rpm and washed
three times with fresh YES medium before a 15min treatment with a-Ig-rabbit with FITC
label [dilution 1:50 in fresh YES]. Finally the mycelia were centriﬁrged and washed three
times with fresh YES media before observing under Labophot ﬂuorescence microscope

(Nikon Inc., Melville, NY).

Results
Antibodies against aflatoxin B1 binds in a speciﬁc pattern on cell surface in aﬂatoxin
producing conditions

As shown in Figure AIII-2 a, anti-AF B1 (recognized by FITC labeled secondary
antibody) binds to the surface of the A. parasiticus cell grown in aﬂatoxin inducing
medium (YES) for 48h. To check for the speciﬁcity of this binding pattern we employed
a series of control experiments. First, we compared the binding pattern of the wild type
strain SU-l in YES (aﬂatoxin inducing medium) and YEP (aﬂatoxin non-inducing
medium). Second we compared the binding pattern between wild type SU-l and a mutant
strain AF S 1 0 (genetically blocked for aﬂatoxin biosynthesis). Third we conducted two

experiments two check the speciﬁcity of the antibody binding to the cell surface. In the

131

 
 

-

- -

Figure AIII-2. Anti-aﬂatoxin Bl (AFBl) binds on cell surface of A.parasiticus in a
speciﬁc pattern in aﬂatoxin producing conditions. Panel a. A pellet of 48h old SU-l
mycelia harvested ﬁ'om liquid YES medium was untangled with sterile forceps until a
visible thread was obtained. The threads of mycelia were used for surface immunoassay
(desribed in methods). Panel b. Similar treatment was done with SU-l grown in YEP.
Panel c. Surface immunoassay using mycelial fragments obtained from AFSIO strain
grown for 48h in YES. Panel d. Surface immunoassay using mycelial fragments obtained
from SU-l grown for 48h in YES using anti-FITC only. Panel e. Surface immunoassay
using mycelial fragments obtained from SU-l grown for 48h in YES using anti-satratoxin

instead of anti-AFB]. Panel f. Surface immunoassay using mycelial fragments obtained

from SU-l grown for 48h in YES using neutralized anti-AFB]. Size bars = 5 pm.

132

ﬁrst experiment we compared the binding pattern of anti-AF B1 with anti-satratoxin and
second we neutralized anti-AF B1 with aﬂatoxin B1 and then applied netralized antibodies
to see whether the binding pattern is affected.

Our results demonstrate that antibodies bind to the surface only during conditions
when aﬂatoxin is produced actively by the cell (Figure AIII-2). On the basis of the
characteristic ﬂuorescence pattern observed we propose that anti-AFB] binds to aﬂatoxin

in the vesicles that participate in transport of aﬂatoxin outside the cell during exocytosis.

133

REFERENCES

Del Sorbo, G., Schoonbeek, H. & De Waard, M. A. (2000). Fungal transporters
involved in efflux of natural toxic compounds and fungicides. F unga] Genet Bio] 30, l-
15.

Lee, L.-W. (2003).Punctional analysis of OmtA and subcellular localization of aﬂatoxin
enzymes in Aspergillus parasiticus, pp. xi, 141 leaves: Michigan State University. Dept.
of Food Science and Human Nutrition, 2003.

Martin, J. F., Casqueiro, J. & Liras, P. (2005). Secretion systems for secondary
metabolites: how producer cells send out messages of intercellular communication. Curr
Opin Microbial 8, 282-293.

Roze, L. V., Arthur, A. E., Hong, S. Y., Chanda, A. & Linz, J. E. (2007). The
initiation and pattern of spread of histone H4 acetylation parallel the order of
transcriptional activation of genes in the aﬂatoxin cluster. Ma] Microbial 66, 713-726.

Salgado, L. T., Viana, N. B., Andrade, L. R., Leal, R. N., da Gama, B. A., Attias, M.,
Pereira, R. C. & Amado Filho, G. M. (2008). Intra-cellular storage, transport and
exocytosis of halogenated compounds in marine red alga Laurencia obtusa. J Struct Biol
162, 345-355.

134

APPENDIX IV

FUTURE STUDIES

A. Studies to understand vacuolar development in detail

The studies included in this dissertation demonstrated that vesicles and vacuoles
are functionally linked with aﬂatoxin biosynthesis. We propose that vacuoles undergo
morphological, chemical and functional development as fungal cells switch to secondary
metabolism. As a result vacuoles gain additional functions which include synthesis,
storage and secretion of secondary metabolites. The model further proposes that late in
this developmental process vacuoles predominantly engage in protein turn-over and
eventually cell death occurs. To understand how vacuolar function correlates with
population of proteins present in vacuoles at different phases during development of this
organelle it is essential to characterize the biochemical composition of vacuoles over
time. A time course vacuole proteome analysis could be very helpful to understand this

correlation.

B. Studies to understand details of the involvement of vesicle transport machinery in
aﬂatoxin biosynthesis

Our studies linked aﬂatoxin biosynthesis to vacuolar biogenesis. We propose that
blocking vesicle to vacuole fusion facilitates accumulation of aﬂatoxisomes carrying
functional aﬂatoxin enzymes resulting in increased aﬂatoxin accumulation. Studies

involving interruption of aﬂatoxin protein trafﬁc (either chemically or genetically) at

135

various points in the vesicular transport machinery could provide novel targets to

manipulate secondary metabolism at the cellular level

136