la :2 it. fit: .33 39%....” u "1.5%le Plan u . . I x‘l‘m! . :- luau." h? ){r-F.” ti! .! deg... .92. L... thAmu .3. Fara“. “luv-:5... .2... ‘ .MMV K . I‘ll. “Eula-s- “ . m IL. vain... Awe 1!. ”$3.7!!Yil... .5 .315359 It..tét|tfi “Running . . til-5!: .. 9L}! ,i . ..uu¢¥.l.n.)3!.€ LN). kigrflitai? .35. .\!..!:1.:..Kuni. 21. . Mfr-n ‘I I'vo’. l 0051 LIBRARY Michigan State University This is to certify that the thesis entitled PHYLOGENETIC RELATIONSHIPS IN POLIOMINTHA AND RELATED GENERA IN THE MENTHEAE (LAMIACEAE) presented by GRANT THOMAS GODDEN has been accepted towards fulfillment of the requirements for the M. S. degree in Plant Biology Méjor Professor’s Signature 6 fi/(WZL ZOO? Date MSU is an Afiinnative Action/Equal Opportunity Employer PLACE IN RETURN BOX to remove this checkout from your record. TO AVOID FINES return on or before date due. MAY BE RECALLED with earlier due date if requested. DATE DUE DATE DUE DATE DUE 5/08 K.IPrQ/Achres/CIRCIDaIeDue.indd PHYLOGENETIC RELATIONSHIPS IN POLIOMINTHA AND RELATED GENERA IN THE MENTHEAE (LAMIACEAE) By Grant Thomas Godden A THESIS Submitted to Michigan State University In partial fulfillment of the requirements for the degree of MASTERS OF SCIENCE Plant Biology 2009 ABSTRACT PHYLOGENETIC RELATIONSHIPS IN POLIOMINTHA AND RELATED GENERA IN THE MENTHEAE (LAMIACEAE) By Grant Thomas Godden Poliomintha (Lamiaceae; subfamily Nepetoideae; tribe Mentheae) is a genus of aromatic shrubs from the southwestern United States and northem Mexico. For over 100 years, the circumscription of Poliomintha has remained uncertain and taxa have been transferred to and from Poliomintha and related genera on the basis of various morphological characters. For my thesis research, sequence data from the nuclear ribosomal ITS and two plastid regions, tmL-tmL-trnF and mL32-tmL, were used to objectively test morphologically-based hypotheses of relationship within Poliomintha and among genera in tribe Mentheae. Poliomintha is not monophyletic as currently circumscribed and represents at least two distinct lineages: a lineage that includes the type species, P. incana, and either (or both) Rhododon or Clinopodium; and a second lineage that includes the remaining species of Poliomintha and species of the allied genus, Hedeoma. Shimodaira-Hasegawa tests confirm that P. incana is not related to the remaining Poliomintha species. Therefore, the genus Poliomintha may be best limited to the type species, P. incana, pending phylogenetic evidence that determines the relationships of Poliomintha species to the other genera with confidence. ACKNOWLEDGEMENTS This study was made possible through financial support from both the Paul Taylor Academic Achievement Fund administered by the Department of Plant Biology as well as the Graduate School, College of Natural Sciences, and the International Studies Program of Michigan State University (MSU). I wish to extend my sincerest thanks to my major professor and friend, Alan Prather, whose encouragement and expert guidance enhanced my research and graduate school experiences. Additional thanks belong to members of my guidance committee, Richard Triemer and Andrew Jarosz, who always made time for me and offered helpful guidance. To my labmate and friend, Orlando Alvarez-Fuentes, thank you for providing my initial training experiences, for assisting me in the laboratory, and for your support and advice during challenging times. Additional thanks belong to my fellow graduate students, thank you for your friendship and support throughout my MSU experience. To my family, thank you for your patience and encouragement. Lastly, I wish to express my eternal gratitude for the support of my dearest friends. To Jannes Szyren, Natalia Ruiz Rubio, Eleni Beli, Abe Pollister, Nidal Karim, Isabel Alvarez Sancho, Julian Taurozzi, and Marisa Rinkus, thank you for believing in me when I couldn't believe in myself. You are my family and I wouldn’t have made it without your support, encouragement, and love. TABLE OF CONTENTS LIST OF TABLES ................................................................................... v LIST OF FIGURES ................................................................................ vi CHAPTER 1: INTRODUCTION ................................................................. 1 Taxonomic History ........................................................................ 2 Morphology ................................................................................. 5 Phylogenetic Relationships ............................................................. 6 CHAPTER 2: MATERIALS AND METHODS Plant Material and Sampling ............................................................ 9 DNA Extraction ........................................................................... 10 Marker Choice ............................................................................ 11 Amplification and Visualization ....................................................... 12 Purification and Sequencing .......................................................... 15 Sequence Alignment and Data Analyses .......................................... 16 Congruence and Hypothesis Testing ............................................... 18 CHAPTER 3: RESULTS Marker Choice ............................................................................ 20 Phylogenetic Analyses .............................................................................. 20 ITS Analyses of Poliomintha and Related Genera .............................. 21 Plastid Analyses of Poliomintha and Related Genera .......................... 28 Combined Analyses of Poliomintha and Related Genera ..................... 34 Tests of Alternative Phylogeny ....................................................... 41 CHAPTER 4: DISCUSSION .................................................................... 43 Phylogenetic Relationships among Poliomintha and Related Genera ...... 43 Importance of Morphological Characters in Delineating Genera ............ 46 The Taxonomy of Poliomintha ........................................................ 48 APPENDICES ..................................................................................... 50 APPENDIX A ............................................................................................. 51 Voucher lnforrnation for Material Used in the Phylogenetic Study .......... 52 APPENDIX B ............................................................................................. 61 Aligned Sequence Matrix 1: Nuclear Ribosomal lntemal Transcribed Spacer (lTSl, 5. BS, ITSZ) ............................................................. 62 Aligned Sequence Matrix 2. trnL lntron and tmL- th Spacer of the Chloroplast Genome ............................................................................... 101 Aligned Sequence Matrix 3: rpL32 - tmL Spacer of the Chloroplast Genome ............................................................................... 137 LITERATURE CITED ........................................................................................ 173 LIST OF TABLES Table 1-1: Recognized taxa and nomenclature in preVious taxonomic treatments of Poliomintha ....................................................................................... 4 Table 1-2: Characteristics distinguishing Poliomintha from the closely allied genera Hedeoma and Hesperozygis. Characters adapted from R. S. Irving (1972, 1980) .................................................................................................. 6 Table 2-1. Primer sequences used for PCR amplification and sequencing. Forward (F :) and reverse (R:) designates are indicated before each primer name ................................................................................................ 1 3 Table 2-2. Components of polymerase chain reactions. Amplification was carried out using AmpliTaq Gold® DNA Polymerase with Buffer II and MgCl2 reagents (Applied Biosystems, Foster City, CA). All plastid regions (trnL—th, tmD-tmT, th-tme, rpl32-tmL, and nth-rpl32) were amplified using the same quantities of reaction components ........................................................................ 14 Table 2-3. PCR profiles for amplification of nuclear and plastid markers ......... 14 Table 2-4. Aligned characters excluded from the phylogenetic analyses ......... 16 Table 2-5. Models of sequence evolution and parameters for three datasets analyzed using the maximum likelihood method. Models were determined by a hierarchical likelihood ratio test (Goldman 1993; Huelsenbeck and Crandall 1997) as implemented in ModelTest 3.7 (Posada and Crandall 1998). Parameters estimated by ModelTest are indicated for each model ................................. 18 Table 3-1. Characteristics and phylogenetic utility of sequences from two plastid regions acquired from ten taxa in the Mentheae ........................................ 20 Table 3-2. Sequence characteristics of regions used in phylogenetic analyses ........................................................................................... 22 Table 3-3: Results of SH tests. Numbers indicate P value / difference in negative log likelihood (-In L) score. Significance at the a = 0.05 level is indicated with an asterisk ............................................................................................ 43 LIST OF FIGURES Figures 3-1 A and B: One of 97,217 most parsimonious (MP) trees recovered from an analysis of ITS sequence data (treelength = 485 steps; CI = 0.518, Rl = 0.722, and RC = 0.374, excluding uninformative characters). The randomly selected MP tree is shown as a rectangular cladogram with branch lengths (above) and bootstrap support values (bold, below) indicated. Branches that collapse in the strict consensus tree are indicated with arrows .................. 24-25 Figures 3-2 A and B: Most likely tree recovered from a maximum likelihood (ML) analysis of ITS sequence data from 71 accessions in the tribe Mentheae. Shown here is a phylogram (-In L = 352426454) with branch lengths drawn to scale and bootstrap support (>50%) indicated above the branches .......................... 26-27 Figures 3-3 A and B: One of 88,000 most parsimonious (MP) trees recovered from an analysis of combined plastid (tmL-F and rpl32-tmL) sequence data (treelength = 248 steps; CI = 0.887, RI = 0.841, and RC = 0.746, excluding uninfonnative characters). The randomly selected MP tree is shown as a rectangular cladogram with branch lengths (above) and bootstrap support values _ (bold, below) indicated. Branches that collapse in the strict consensus tree are indicated with'arrows. Accessions used to represent identical groups of sequences are indicated with an asterisk ............................................. 30-31 Figures 3-4 A and B: Maximum likelihood tree (-In L = 4086.57963) recovered from an analysis of combined plastid (tmL-F and rpl32-trnL) sequence data for 83 accessions in the tribe Mentheae. Branch lengths are drawn to scale and bootstrap support (>50%) is indicated above the branches. Accessions used to represent identical groups of sequences are indicated with an asterisk ...... 32-33 Figures 3-5 A and B: One of 43,966 most parsimonious (MP) trees recovered from a combined analysis of ITS, trnL-F, and rpl32-tmL sequence data (treelength = 735 steps; CI = 0.553, RI = 0.749, and RC = 0.414, excluding uninfonnative characters). The randomly selected MP tree is shown as a rectangular cladogram with branch lengths (above) and bootstrap support values (bold, below) indicated. Branches that collapse in the strict consensus tree are indicated with arrows ........................................... . .......................... 37-38 Figures 3-6 A and B: Maximum likelihood tree (-In L = 7951.01811) recovered from the combined analysis of nuclear (ITS) and plastid (tmL-F and rpl32-trnL) sequence data for 71 accessions in the tribe Mentheae. Branch lengths are drawn to scale and bootstrap support (>50%) is indicated above the branches ..................................................................................... 39-40 vi Chapter 1 INTRODUCTION Poliomintha A. Gray (Lamiaceae) is a small genus comprising seven species with distributions in the deserts and arid regions of northeastern Mexico and the southwestern United States. Poliomintha species are characterized by a shrubby habit, tubular and symmetrical calyces, large tubular corollas with two stamens, and oblong nutlets (Epling and Stewart 1939; Irving 1972). None of these characters are unique to Poliomintha; rather the combination of characters can be used to distinguish Poliomintha from other closely allied genera in family Lamiaceae. Poliomintha is a member of subfamily Nepetoideae, which is divided into four tribes: Escholtzieae, Lavanduleae, Mentheae, and Ocimeae (Cantino et al. 1992). The genus belongs to a clade of New World Mentheae (Wagstaff et al. 1995; Williams, unpublished data), a group historically viewed as taxonomically difficult because of complex morphological interpretation. Systematists such as Bentham (1834), Briquet (1897), Epling and Stewart (1939), and Irving (1972, 1980) and others circumscribed groups in the tribe based on habit and other morphological characters, but discussed difficulty in assigning characters sufficiently important to distinguish genera. Recognition of some genera in the Mentheae, including Poliomintha, has been controversial and an ongoing subject 'of taxonomic debate. Consequently, the generic status of Poliomintha has been questioned multiple times throughout history and its species have been transferred to and from genera such as Hedeoma Pers. and Hesperozygis Epling. Taxonomic History The genus Poliomintha was first proposed by Asa Gray (1870) to accommodate two species, P. Iongiflora A. Gray and P. incana (Torr.) A. Gray. However, suggestion of the group came eleven years earlier with Torrey’s description of Hedeoma incanum (1859). Regarding the classification of his new species, Torrey noted, “It may remain in Hedeoma for the present, but, if other species like it should be found, it may be the type of a new genus.” During the twenty years after Gray’s formation of Poliomintha, two species (Hedeoma moi/e Torr. and Keithia [Hesperozygis] man'folia S. Shauer) were transferred by Gray (1872) to Poliomintha and two additional species, P. glabrescens A. Gray ex. Hemsley (1882) and P. bicolor Watson (1890), were described. A fifth name, P. greggii, was referenced in Watson’s publication, but was not formally described (nomen nudum). Briquet (1897) recognized the inherent difficulties in the taxonomic disposition of the taxa and subsumed Poliomintha into Hedeoma in his treatment of. the Labiateae in Die Naturlichen Pflanzenfamilien. However, the work of Epling and Stewart (1939) restored the generic status of Poliomintha and informally established two new sections, section Incanae to accommodate P. incana and section Saturejoides to accommodate P. glabrescens and P. Iongr'flora. As for the other species, Epling and Stewart (1939) placed P. bicolor in synonymy with P. longiflora and transferred P. molle and P. marifolr’a into Hedeoma and Hesperozygis respectively. Poliomintha conjunctrix was described by Epling and Wiggins in 1940, bringing the genus to a total of four species. In the most recent revision (Irving 1972) four species of Poliomintha were recognized: P. Iongiflora and P. glabrescens belonging to section Saturejoides R. S. Irving; and P. conjuntn'x and P. incana belonging to section Poliomintha. Poliomintha longiflora var. congesta also was described by Irving, but more recently has been reduced to synonymy with Clinopodium dominguense Urb. and Ekman. Since Irving’s revision, three additional species were described; P. madrensis by Henrickson (1982) and P. dendritica and P. bustamanta by Turner (1993). With the latest additions, a total of seven species were recognized for this study (Table 1-1). Table 1-1: Recognized taxa and nomenclature in previous taxonomic treatments of Poliomintha. Taxonomist Recognized Taxa Standley (1923) Poliomintha A Gray P. bicolor P. glabrescens P. incana P. longiflora P. marifolia P. moi/is Epling and Stewart (1939) Poliomintha A Gray Poliomintha sect. Incanae (bold text below) Poliomintha sect. Saturejoides P. glabrescens P. incana P. Iongiflora P. bicolor =syn. Poliomintha longiflora P. man'folia = syn. Hesperozygis marifolia P. mollis = syn. Hedeoma molle Irving (1972) Poliomintha A Gray Poliomintha sect. Poliomintha (bold text below) Poliomintha sect. Saturejoides R. S. Irving P. conjunctrix P. glabrescens P. incana P. Iongiflora var. congesta P. Iongiflora var. Iongr‘flora P. manfolra= syn Hesperozygis marifolia P. moi/is = syn. Hedeoma molle Proposed Poliomintha A Gray Poliomintha sect. Poliomintha (bold text below) Poliomintha sect. Saturejoides R. 8. Irving P. bustamanta P. conjunctrix P. dendritica P. glabrescens P. incana P. Iongiflora P. maderensr's P. Iongiflora var. congesta = syn. Clinopodium dominguense P. marifolia = syn. Hesperozygis marifolia P. moi/is =gyn. Hedeoma molle Morphology Poliomintha are small aromatic shrubs with slender, moderately branched, and ascending-erect four-angled stems with minute and usually appressed pubescence. The species have small leaves that are oval, elliptiwl, or linear in shape and with entire margins. The leaves are opposite and attached to the stem at the base (sessile) or on short petioles. The flowers are solitary or grouped into two-, three-, or five-seven-flowered cymules in the leaf axils of the upper one-half to one-third of the plant. The calyces are characteristically tubular and more or less symmetrical, 13-15-nerved, sometimes hirsute-annulate within, softly pubescent on the margins and inner surfaces, and with subequal teeth that are narrowly deltoid, acute, and connivent to close the orifice. The red, orange-red, purplish, pale lavender, pink, or white corollas of Poliomintha are tubular and zygomorphic, with a conspicuous emarginated upper lip and a spreading, three- Iobed lower lip. The corollas are pubescent on the outer surface and have a dense ring of pubescence (annulus) within, below the middle of the tube. The flowers have two, slightly exserted fertile stamens that are seated well above the middle of the tubular corolla with glabrous filaments and widely divergent anther sacs on well-developed connectives. The gynobasic style is long exserted and bifid. The fruit is a schizocarp of four oblong nutlets. Previous taxonomic treatments by Epling and Stewart (1939) and Irving (1972, 1980) distinguished Poliomintha from the closely allied genera Hedeoma and Hesperozygis on the basis of a combination of habit, calyx, and nutlet characters and chromosome counts (Table 1-2). Table 1-2: Characteristics distinguishing Poliomintha from the closely allied genera Hedeoma and Hesperozygis. Characters adapted from R. 8. Irving (1972, 1976,1980) Hedeoma Poliomintha Hesperozygis Habit: Herbaceous, Habit: Shrubs Habit: Shrubs occasionally semishrubs Cam sham: Gibbous or saccate, but never funnelforrn Cain smmetm: Zygomorphic Cam teeth: Differentiated into upper and lower sets; usually upper deltoid, lower lanceolate Calyx annulus: Well-defined ring at juncture of upper and lower teeth Fruit: Nutlets oblong, mucilaginous when moistened Chromosome counts’: 2n = 34, 36, 44, 72, 144 Calyx shag: Tubular Calfl symmetm: Actinomorphic Calyx teeth: Not differentiated into upper and lower sets; deltoid Calfl annulus: Absent or in an irregular ring Fruit: Nutlets oblong, not mucilaginous when moistened Chromosome counts‘: 2n=36 Calfl shag: Funnelforrn, campanulate W: Actinomorphic Calfl teeth: Not differentiated into upper and lower sets; deltoid or lanceolate Calyx annulus: Well-defined ring near middle of tube Fruit: No comparison provided WI: 2n=44 1. Chromosome counts based on cytological studies of 24 species of Hedeoma and one species each of Poliomintha and Hesperozygis, respectively (Irving 1976). Phylogenetic Relationships The relationships of Poliomintha to other New World genera in the Mentheae are uncertain. The only phylogenetic study that included Poliomintha is the molecular study of Wagstaff et al. (1995), who used a phylogenetic analysis of chNA restriction site variation to infer relationships among several relevant genera in subfamily Nepetoideae and tribe Mentheae. They included only one species each of Poliomintha and Hedeoma; Poliomintha longiflora was placed as sister to Hedeoma drummondii Benth. in an unresolved clade of species from genera that included Acinos Mill., Blephilia Raf, Calamintha L., Conradina A. Gray, Minthostachys (Benth.) Spach, Monardella Benth., Piloblephis Raf., and Satureja L. (of which the sampled species have since been transferred to Clinopodium L.). Previous morphologically-based studies have closely examined the relationships among Poliomintha and related genera (Epling and Stewart 1939; Irving 1972; and Irving 1980), but not in a modern phylogenetic context. The most recent revision of Poliomintha by Irving (1972) suggested that Poliomintha is monophyletic and closely allied to the genus Hedeoma and some species of Hesperozygis. However, it is important to recognize that the definitions of monophyly and phylogeny have evolved with more recent advances in molecular biology (Judd et al. 2002) and a rigorous phylogenetic analysis for Poliomintha and related genera has never been performed. Many contemporary studies of the Lamiaceae have employed DNA sequence data and phylogenetic methods to infer relationships among mints at lower taxonomic levels (Wagstaff and Olmstead 1997; Steane et al. 1999; Prather et al. 2002; Jamzad et al. 2003; Trusty et al. 2004; Walker et al. 2004; Braiichler et al. 2005; Trusty et al. 2005; Edwards et al. 2006; Rosello et al. 2006; Walker and Systma 2007; Edwards et al. 2008; and Schmidt-Lebuhn 2008), facilitating the testing of monophyly for several genera and allowing for much-needed revision of existing circumscriptions. The studies have demonstrated that some genera in the Mentheae are not monophyletic—e.g., Micromen'a Benth. (Brailchler et al. 2005), Salvr'a L. (Walker et al. 2004), and Satureja (Wagstaff et al. 1995)—and, in some cases, the discovery of paraphyletic or polyphyletic groups has initiated taxonomic revisions at the generic level (Cantino and Wagstaff 1998; Steane et al. 1999; Harley and Granda Paucer 2000; Steane et al. 2004; BraiJchler et al. 2006; Ryding 2006; and Pool 2008). For my thesis research, a molecular phylogenetic study was conducted to examine closely the generic status of Poliomintha. The goals of the study were to test the monophyly of the genus, to elucidate interspecific relationships within Poliomintha and among taxa from closely related genera in the Mentheae, and to clarify the taxonomy (of Poliomintha and closely related or ambiguously placed species using phylogenetic data. Chapter 2 MATERIALS AND METHODS Plant Material and Taxonomic Sampling Herbarium specimens from subfamily Nepetoideae and tribe Mentheae (Lamiaceae) were selected for morphological review from the following herbaria: CAS, Ml, MO, MSC, NY, US, and TEX/LL. Specimens were evaluated and selected for the phylogenetic analyses to represent morphological and geographical variation within species and major taxonomic groupings within the genera Poliomintha, Hedeoma, and Hesperozygis and tribe Mentheae. Permission for destructive sampling was requested and granted from each herbarium prior to DNA extraction (see Appendix A for voucher information). Individuals sampled for phylogenetic analyses included six taxa from Poliomintha; 23 taxa from Hedeoma representing the subgenera Cilata, Poliominthoides, Saturejoides, and Hedeoma; and four taxa from Hesperozygis. The seventh Poliomintha species, P. maderensis J. Henrickson, was unavailable for sampling due to its rarity in collections. Previous revisions of Hedeoma by Epling and Stewart (1939) and of Poliomintha and Hedeoma by Irving (1972 and 1980 respectively) suggested that Poliomintha is not only closely allied to genera such as Hedeoma and Hesperozygis, but also related to several genera in tribe Mentheae and subtribe Melissinae, including two- and four-stamened genera such as Satureja section Gardoquia (R. and P.) Briq. (now Clinopodium), Cunila L., Glechon Spreng., Rhabdocaulon (Benth.) Epling, and Rhododon Epling, etc. Therefore, in order to infer phylogenetic relationships among Poliomintha and closely allied genera within the Mentheae, 21 additional taxa were sampled (see Appendix A). Mentha and Thymus were chosen as outgroup genera based on the phylogenetic results of Wagstaff et al. (1995) and Walker and Systma (2007). Mentha rotundifolia Huds. and Thymus mastichina L., were selected as representatives of the two genera to facilitate use of ITS sequence data previously published by Prather et al. (2002) and plant tissue available at MSC for re-extraction and amplification of selected plastid genomic regions. DNA Exu’action Genomic DNA was extracted from herbarium tissue using the method of Doyle and Doyle (1987) and the small-scale extraction techniques of Loockerrnan and Jansen (1996). Approximately 10-20 mg plant tissue from each herbarium specimen was sampled. Tissue was homogenized in 1.7 mL tubes with 400 uL extraction buffer comprised of 100 mM Tris-HCI at pH 8.0, 1.3 M NaCl, 20 mM ethylenediaminetetraacetic acid (EDTA), 2% hexadeclytrimethyl-ammonium bromide (CTAB) at pH 8.0, 0.5% 2-mercaptoethanol and 4% polyvinyl- pyrrolidone (PVP). An additional 400 pL extraction buffer was added to each homogenate, incubated at 60°C for 30 minutes and inverted six times at five- minute intervals. DNA was extracted from each homogenate with the addition of 550 uL chloroformzoctanol (24:1) followed by centrifugation at 14,000 rpm for three minutes. The supernatant from each sample was transferred to a new 1.7 mL tube and DNA was precipitated with tvvo-thirds volume ice-cold isopropanol 10 and overnight storage at -20°C. Precipitated DNA was centrifuged into a pellet at 14,000 rpm for 6 minutes, washed with a layer of 800 pl 76% EtOH/0.01M Nl-l40Ac for ten minutes, and resuspended in 30-40 pL water. DNA samples that failed to amplify using PCR were suspected of having impurities that inhibited amplification and subsequently purified using the Qiagen DNeasy Plant Mini Kit (Qiagen, Ltd) following the manufacturer protocol. Marker Choice Two markers, the nuclear ribosomal lntemal transcribed spacer (including ITS1, 5.88, and ITSZ regions) and the combined tmL intron and tmL-th intergenic spacer (referred to hereafter as trnL-trnF) from the plastid genome, were selected because they have been used successfully in previous systematic studies of the Mentheae (Trusty et al. 2004; Trusty et al. 2005; Edwards et al. 2006; and Walker and Systma 2007). Four additional plastid regions, trnDGUC- tmTGGU, tmsUGA-tmeCAU, rpl32-tmL, and nth-rpl32, recommended by Shaw et al. 2005 and Shaw et al. 2007 were surveyed to identify one additional phylogenetically informative plastid region for the analysis. The regions were compared for their efficient amplification across in-group taxa and the phylogenetic utility of their sequence content as measured by average sequence variability and number of potentially phylogenetically informative characters. The following subset of in-group taxa were used to evaluate and select a region: Clinopodium mexicanum, Hedeoma costata, Hedeoma drummondii, Hedeoma 11 hispida, Hedeoma molle, Hedeoma palmeri, Hedeoma patrina, Hedeoma pusilla, Poliomintha incana, and Poliomintha Iongiflora. For reasons identified in the results, rpl32-tmL was selected as the second plastid marker for the phylogenetic analyses. Amplification and Visualization Polymerase chain reaction (PCR) was carried out using an MJ Research PTC- 100 then'nalcycler and 25 pL reactions containing standard PCR components (Table 2-2), 1 pl DNA template from one of three prepared 1:1, 1:9, or 1:99 dilutions, and universal primers (Table 2-1). Three PCR profiles were used to amplify nuclear and plastid regions (Table 2-3). Bands were resolved by electrophoresis on a 2% agarose gel in 1X Tris-acetate-EDTA (T AE) buffer, stained with ethidium bromide, and visualized with UV illumination. For samples that successfully amplified, PCR was repeated two additional times using a 50 pL reaction to amplify sufficient quantities of DNA for purification. 12 Table 2-1. Primer sequences used for PCR amplification and sequencing. Forward (F:) and reverse (R:) designates are indicated before each primer name. Marker 1: ITS (ITS1, 5.88, ITSZ) Primer Primer sequence (5’-3') F: ITS4 (White et al. 1990) TCCTCCGC‘I‘I‘ATTGATATGC R: ITSS (White et al. 1990) GGAAGTAAAAGTCGTAACAAGG R: ITSSM (Sang et al. 1996) GGAAGGAGAAGTCGTAACAAGG Marker 2: tmL-trnF (trnL intron, trnL-trnF intergenic spacer) Primer Primer sequence (5’-3') F: TabC (T aberlet et al. 1991) CGAAATCGGTAGACGCTACG R: TabF(Taber1etetal. 1991) ATI’TGAACTGGTGACACGAG Marker 3: trnDGUc-tmTGGU (intergenic spacer, embedded trnY and trnE genes) Primer Primer sequence (5’-3’) F: tmDGUCF (Demesure et al. 1995) ACCAATTGAACTACAATCCC R: trnTGGU (Demesure et al. 1995) CACCACTGAGTTAAAAGGG Marker 4: trnSUGA-tmeCAU (intergenic spacer, embedded trnG, ycf9, and pst genes) Primer Primer sequence (5’-3’) F: trnSUGA (Demesure et al. 1995) CGAAATCGGTAGACGCTACG R: trnfMC’“U (Demesure et al. 1995) ATTTGAACTGGTGACACGAG Marker 5: rpl32-tmL (intergenic spacer) . Primer Primer sequence (5’-3’) F: rpL32-F (Shaw et al. 2007) CAGTTCCAAAAAAACGTACTTC R: trnL‘UAG’ (Shaw et al. 2007) CTGCTI’CCTAAGAGCAGCGT Marker 6: nth-rpl32 (intergenic spacer) Primer Primer sequence (5’-3’) F: nth (Shaw et al. 2007) GAAAGGTATKATCCAYGGMATATT R: rpL32-R (Shaw et al. 2007) CCAATATCCCI WW I I ICCAA 13 Table 2-2. Components of polymerase chain reactions. Amplification was carried out using AmpliTaq Gold® DNA Polymerase with Buffer II and MgCl2 reagents (Applied Biosystems, Foster City, CA). All plastid regions (tmL-trnF, tmD-tmT, th-tme, rpl32—tmL, and nth-rpl32) were amplified using the same quantities of reaction components. Components ITS Plastid Purified distilled H20 14.75-16.00 pl 16.50 pl 10X PCR buffer 2.50 pl 2.50 pl MgCl2 2.50 pl 2.00 pl 0.2 mM dNTPs (lnvitrogenTM Life Technologies) 2'00 “I 2'00 “I 20 pM forward primer 0.25 pl 0.25 pl 20 pM reverse primer 0.25 pl 0.25 pl Dimethyl sulfoxide (DMSO) 1.25-2.50 pl 1.25 pl Taq DNA polymerase 0.25 pl 0.25 pl DNA Template 1.00 pl 1.00 pl TOTAL 25.00 pl 25.00 pl Table 2-3. PCR profiles for amplification of nuclear and plastid markers. ITS — following the parameters of Prather and Jansen (1998) Step Temperature Time Notes (00) (minutes) 1 94 5 2 72 2 3 94 1 4 43 1 Cycle to Step 3 for 30 cycles 5 72 7 6 15 - Indefinite hold 14 Table 2-3. Continued tmL-th, trnD-tm T, and th-trn f M Step Temperature Time Notes (°C) (minutes) 1 80 5 2 94 1 3 50 1 4 72 2 Cycle to Step 3 for 36 cycles 5 72 5 6 4 - Indefinite hold rpl32-trnL and nth-rpl32 — following the parameters of Shaw et al. (2007) Step Temperature Time Notes (°C) (minutes) 1 80 5 2 95 1 3 50 1 4 65 4 Cycle to Step 3 for 31 cycles 5 65 5 6 4 - Indefinite hold Purification and Sequencing PCR products were purified using the Qiagen PCR Purification Kit (Qiagen, Ltd) according to the manufacturer’s recommendations and sequenced in both directions at the Michigan State University Genomics Technology Support Facility using either the ABI 3730 Genetic Analyzer or ABI Prism 3700 DNA Analyzer (Applied Biosystems, Foster City, CA). 15 Sequence Alignment and Data Analyses DNA sequence data were assembled and edited using MEGA4 (T amura et al. 2007). Sequences were initially aligned using Clustal W and were refined by eye in MEGA4. End regions from each of the three aligned data matrices were excluded from consideration in the phylogenetic analyses, as were regions where sequence homology could not be easily determined (Table 2-4). Table 2-4. Aligned characters excluded from the phylogenetic analyses. Aligned Characters Regions of Total Marker Excluded end regions ammuous alignment excluded ITS 1-73; 712-779 474-504 172 trnL-th 1 - 63; 944 - 1010 n/a 130 rpl32-trnL 1 - 14; 946 - 953 691-702 34 To maximize computational efficiency by eliminating sequence redundancy in the data matrices, analyses of pairwise genetic distance were conducted using the combined plastid and ITS datasets. Multiple accessions with identical plastid sequences were identified within each of the following nine taxa (two accessions each, except where noted): Acinos arvensis, Clinopodium brownei, Clinopodium chandlen', Hedeoma mandoniana, Hedeoma media, Hedeoma pulegioides (four accessions), Hesperozygis marifolia, Poliomintha incana, and Rhododon angulatus. Twenty-two other accessions with identical 16 plastid sequences were classified into one of two groups (see Results: groups defined in Figures 3-3 A and B). In total, 33 accessions were removed from consideration and a single accession was used in the phylogenetic analysis to represent each of ten groups of identical sequences. No sequences were removed from the ITS matrix. Analyses of the ITS, combined plastid, and combined ITS plus plastid datasets were conducted in PAUP*4.0.b10 (Swofford 2002) using maximum parsimony (MP) and maximum likelihood (ML) optimality criteria. Branch support for the resulting trees from each analysis was evaluated using bootstrap analyses (Felsenstein, 1985). Gaps and missing data were ignored. For the MP analysis, a heuristic search was conducted using 1000 random addition replicates with tree bisection and reconnection (TBR) branch swapping, holding one tree during each stepwise addition and saving only the best trees. Bootstrap (BS) support values were obtained for the resulting trees using a heuristic search with TBR branch swapping, 1000 replicates and ten random addition sequences, saving no more than 100 trees per replicate. For the ML analyses, a hierarchical likelihood ratio test (Goldman 1993; Huelsenbeck and Crandall 1997) as implemented in ModelTest 3.7 (Posada and Crandall 1998) was used to determine the best model of sequence evolution for the ITS, combined plastid, and combined ITS plus plastid datasets (Table 2-5). Model parameter values generated by ModelTest were used in the ML analyses conducted in PAUP and a heuristic search with 100 random replicates and TBR branch swapping was used, saving no more than 100 trees per replicate. 17 Bootstrap analyses were conducted in PAUP using TBR branch swapping, 100 replicates with ten random additions per replicate, saving no more than 100 trees per replicate. Table 2-5. Models of sequence evolution and parameters for three datasets analyzed using the maximum likelihood method. Models were determined by a hierarchical likelihood ratio test (Goldman 1993; Huelsenbeck and Crandall 1997) as implemented in ModelTest 3.7 (Posada and Crandall 1998). Parameters estimated by ModelTest are indicated for each model. Dataset Model of sequence evolution Estimated parameters ITS Combined tmL-th + rpl32-tmL Combined tmL-trnF + rpl32-trnL + ITS TrN + l + I" (T amura and Nei 1993; Yang 1994) K81 uf + I‘ (Kimura 1981; Yang 1994) TrN + l + I' (Tamura and Nei 1993; Yang 1994) Base= (0.2187 0.3121 0.2833) Nst=6 Rmat= (1.0000 2.6190 1.0000 1.0000 5.4251) Rates=gamma Shape=0.6195 Pinvar=0.3664 Base=(0.3771 0.1605 0.1354) Nst=6 Rmat=(1.0000 1.6402 0.6516 0.6516 1.6402) Rates=gamma Shape=0.5858 Pinvar=0 Base=(0.3267 0.2085 0.1800) Nst=6 Rmat=(1.0000 2.1232 1.0000 1.0000 3.2821) Rates=gamma Shape=0.7141 Pinvar=0.6149 Congruence and Hypothesis Testing To test for congruence between ITS and combined plastid data partitions, an ' hoongruence Length Difference (ILD) Test of Farris et al. (1994) was conducted a s implemented in PAUP as the Partition Homogeneity Test (Swofford 2002). For 18 the lLD analysis, a null hypothesis of congruence was used and the nuclear and plastid datasets were compared using only parsimony informative characters and 1000 replicates (q = 0.05). A heuristic search was used with TBR branch swapping, gaps coded as missing data, ten random additions per replicate, saving no more than 100 trees per replicate. To test alternative hypotheses of phylogeny, the combined ITS and plastid dataset was analyzed in PAUP with an enforced constraint using the MP search strategy outlined above. Trees constrained to one of two topologies (i.e., a monophyletic Poliomintha [Constraint 1] and a monophyletic Poliomintha that excluded P. conjunctrix [Constraint 2]), were prepared in MacClade 4.1 (Maddison and Maddison 2001 ). The most likely tree topologies recovered by the unconstrained MP and ML analyses and the constrained MP analyses of the combined dataset were compared using a Shimodaira-Hasegawa (SH) test (Shimodaira and Hasegawa 1999; Shimodaira 2002), as implemented in PAUP with RELL optimization and 1000 bootstrap replicates. A null hypothesis of no difference was used and assessed at c = 0.05. 19 Chapter 3 RESULTS Marker Choice Two plastid regions, thUGA-trnfMCAU and nth-rpl32, failed to amplify consistently for the surveyed taxa and were not used in the study. Of the remaining regions surveyed, analyses of painrvise genetic distances among sampled taxa suggested that rpl32-tmL was neariy twice as variable as tmD-tmT and more phylogenetically informative (Table 3-1). Therefore, rpl32-tmL was identified as the best additional plastid marker for the study. Table 3-1. Characteristics and phylogenetic utility of sequences from two plastid regions acquired from ten taxa in the Mentheae. All accessions Variable, Parsimony parsimony Average pairwise Total informative uninformative uncorrected genetic Region Characters characters characters (p) distance tmD-tmT 934 0 7 0.00157 [pl32-tmL 857 2 1 1 0.00364 Phylogenetic Analyses Sequences from 83 accessions representing 57 taxa were included in the phylogenetic analyses (Appendix A). Of the total, 71 accessions amplified and sequenced successfully for all three regions. The remaining twelve accessions 20 successfully sequenced for both tmL-th and rp132-tmL regions of the plastid genome, but failed to yield quality ITS sequences. ITS Analyses of Poliomintha and Related Genera The data matrix of aligned ITS sequences from 71 accessions included a total of 607 characters, of which 140 were parsimony-informative, 62 were variable but parsimony-uninforrnative, and 405 were constant (Appendix B; Table 3-2). Parsimony analysis of the ITS data resulted in 97,217 most parsimonious (MP) trees of a length of 485 steps, consistency index (CI) of 0.518, retention index (RI) of 0.722, and rescaled consistency index (RC) of 0.374. In the MP topologies, the ingroup taxa were weakly supported by the bootstrap analysis as a monophyletic clade (BS = 75%), with Acinos arvensis weakly supported as sister to the remaining taxa (BS = 74 %; Figures 3-1 A and B). The monophyly of Poliomintha was not supported by the ITS data. The type species, P. incana, was positioned in the MP topologies as sister to the genus Rhododon, as part of a weakly supported Poliomintha incana / Rhododon clade (BS = 76%). The remaining Poliomintha species did not form a monophyletic clade in any of the MP topologies recovered by the heuristic search. The species were distributed among two clades in the strict consensus of MP trees: an unresolved clade with P. conjunctn’x and three Hedeoma species (H. apiculata, H. drummondii, and H. reverchonir); and an unresolved clade with P. Iongiflora as sister to a group that il'1cluded P. bustamanta and P. dendritica. In the randomly selected MP tree, the Mo clades were part of a polytomy with H. acinoides that was positioned in a 21 large clade referred to here as the “Hedeomintha” clade (for communication purposes) that included most species from Hedeoma, but excluded the Poliomintha incana / Rhododon clade (Figures 3-1 A and B). Table 3—2. Sequence characteristics of regions used in phylogenetic analyses. All accessions Variable, Parsimony parsimony Included informative uninformative Region characters characters characters ITS 607 140 62 tmL-th 880 25 45 rpl32-tmL 91 9 45 94 Combined trnL-trnF + rpl32-tmL 1799 70 139 Combined trnL-trnF + rpl32-tmL + ITS 2406 2271 169 For nrne specres, where multiple accessrons had identical sequences, each specres was represented by a single sequence in the phylogenetic analyses of plastid data matrix (see Chapter 2). However, they were not combined in phylogenetic analyses of the combined plastid + ITS data matrix. The increased number of phylogenetically informative characters reported here for the combined plastid + ITS data is the result of pseudosynapomorphic characters that were autapomorphic within each species in the analyses of plastid data. Maximum likelihood (ML) analysis of ITS sequence data recovered one tree with a negative log likelihood (-In L) of 3524.26454 (Figures 3-2 A and B). The ingroup taxa were monophyletic, but poorly supported by the bootstrap analysis (BS = 63%). The ingroup formed a large polytomy that included Hedeoma pulegioides and two unsupported clades comprised of the remaining taxa (Figures 3-1 and 3-2). The monophyly of Poliomintha was not supported in the ML topology. Poliomintha species were distributed among the 22 “Hedeomintha” and Poliomintha incana / Rhododon clades with the same membership described for the MP topologies. However, bootstrap support (BS = 73%) decreased slightly for the Poliomintha incana / Rhododon clade. While its position was unresolved in the strict consensus of MP topologies, the Poliomintha incana / Rhododon clade recovered by the ML analysis was positioned within a polytomy that included taxa from genera such as Blephilia, Conradina, Monarda, Pycnanthemum, and some taxa from Hedeoma and Hesperozygis from eastern South America. This polytomy with the Poliomintha incana / Rhododon clade was positioned as sister to the “Hedeomintha” clade, but without bootstrap support (>50%). 23 223 m S bu::.a:ou «to Tn 059”. 28.0 ..2.=.Eoooo_._.. . I 8v :mEEm oEomumI IFJ aa 2; :25: 6&8me IqL m 3.53 2:8me — SH 8830 SE88: _ g 2880 SE83: _ 28:: 9:83: €23.34 oEomnoI 38:63.0 9:8me g 2:3: 52538: a“ £23: 9:8me 3 3:3: 9:83: 220.50 9:8me av 5959:: 235.559.. as 22:82 2:55.52. 3.53353 ufisfiozom Q SeuEEnao 955.550.: av 8:25:23 ass—5:31 Ecocsgm: 9:83: AM: mucoEEE: 2:83: AS SCEEEE: 9:83: 223.56 3633: I 33050: 85831 5:28.: “SEEKS: SSE: 33:96:33.: 8V SEE 62:83: 9: 5..me 5:83: A 2 E: S can £986:me 3:on 659058 N £8.32: 3.62:0 9 N 53.25038 E:Em£:o:o n. $3855.: SEES: 2: F F 3033: 636:2: — 2:23 £333 24 .9528 5:5 889:9 2m 8: 388:8 69m 9: :_ 88:8 85 88:9: 628:9 A398 .908 mw:_m> 8:98 8:98: :8 85an 26:9 585 5:5 E9888 85898: m mm 9508 9 we: :5. 8898 380:8: 0:... .Aflofifimzo 028E595. 96298 .300 u om :cm .mwud n E .med n .0 ”3on mm: u 5:869: :8: 88:98 9.. :0 99:8 8 E0: 8858: wow: Es: mzoEoEEm: fioE CNS :0 m:O ”m :8 < Tn 859: SENESE 8E9: “50:02.0 _ 9:0 ESE: :585 AF 8.“ 989:: 399x cm 89:: E9:o:o:.5 Fe , mm 89:9: SE88: w mF 889 888: J] I av .588 528850 F _ 9 a: 8:8 E E388 :6 5 g 99:88 E98896 m: 8:983: :E88: 0 v R: 8:983: :988: g 8:983: :E88: o a: 8:983: 9:88: o 9: V v O O .— III 18:98:: :Eom8: o m 8 9:98:59: :E88: IoI. 2 ::9:o:::E :E88: Idl. 9.89: :E88: .Imlt. EaEEmEouE E98890 ImI. E90929: E98890 NN‘g :::8:F:E8 8: 9 k Ev 9:989 9898 8: N _F F :5 93:8E 99868:»: F F F m E::8.8E E98896 99388:: :9. 8:39: E98896 8F 2: 8:905 E9:o:o:.:u mm a: «993:: :o:o:o:: o 8: 39.9: 888:: 2: 999396 8:08 5: on Q 9:89 3.9593: F e :JI 8: 3585 355.550: no :5 3:85 BEE—55¢: F NF u:n_u =o:o:o:: \ 3:39 BEEF—:23: m 96:: < S 8:9Eou out 25 285 3.2.283? «EU 583.: 9.88.. 888:8: . \‘ 9 98:98 88: \v \ 398: m S 8:988 \ Q 9:3: :E88: 9 9:3 EBB: 3 9:8: :E88: 5 990:: :988: E 29:29 85:98 E 8:89 858:8 3:85.. 8:598 0: 35.8823 235.88: a: 38:88:: 95:80.3: 2: 5:28.23 2: 5.550: 5:85.83 235.:23: 80:99:: 5988: m 8:398 :E8.8: 8: 88388 888:: F9 88:: 888:: 3 8838: 888:: 8V 885 359523: as :39 3882.0: 8.9: 88288: 888:: “38988: 9988:“ 88988: 9:98 8.89:8 9:988 8.89:8 E:.:.E:Cm=tk 93:89:89 8889 S998 8889 8: 98E .888: 3 98E .888: 28.: 9:3: \ ‘\ 35208583 mood Na 2:9: 26 00:00.80 05 0500 uofiofiE onaomAv 20095 0003000 0:0 0.00m 2 0390 05000. 50:05 53> $mvmm.vmmm n ._ :3 E05230 0 w_ 0.0: 0305 0005005. 003 05 E $230000 E. E0: 900 0000003 9.. :0 07.2000 35: 0005.3: E2552 m 60: 090500.. 00: 295 602 um 000 < Na meant R: 00520 8:th E38333 00> .aEsos E50385 J AS .5533 EPfioQoEU IL 25.0 amp—«58003:: 8V SEES: 0550:0301 As 0:0...t0E 0.532003: wtflmcorztumnzm mood I. 0:30.502: SEE.” 0:83:20: 05:2: 5.500 E58355 005:: 026000: 830:: 0:000:02 Re 50:00 E20885 3:00:20 53.000050 2.. 2:00:05 53.0886 m m: 80.6.6030 0E00001 R: 305M030 0E0000: . 00 .§ 0 0: 0:60 0: “WW “ups?“a: 0EO0W01 oo _. 95 “00.5.5qu 0&8me 8V 0:0.E00:0E 0E00001 me As 0:0..000:0E 0E800I I'llT. E0E28C0E E20385 m 2:32:25: E20385 ll 00:00.5 E0000: mo 25:00.:me Epfioqoficu 00:000NOE800I an, Ev .szBQ 026000: 20 .tmEEq 0E0~0~I a .::0u::0.\ 0E00001 BV 2038 0E00001 3 00030... 0E0000I av 0:0: 0E00001 00 0:00:0E 0E80~I 20:3: 0E0000I \ to \ ‘0 96:0 <2 000530..» 27 Plastid Analyses of Poliomintha and Related Genera Plastid sequences (tmL-th and rpl32-tmL) from 50 accessions were aligned for the combined plastid analyses, representing a total of 83 accessions from 57 taxa. The plastid data matrix included 1799 aligned characters, of which 70 were parsimony-informative, 139 were variable but parsimony—uninfonnative, and 1590 were constant (Appendix B; Table 3-2). Parsimony analyses of the combined plastid datasets recovered 88,000 trees with a length of 248, CI of 0.720, RI of 0.841, and RC of 0.605. In the strict consensus of MP trees (Figures 3-3 A and B), a sister relationship between Acinos arvensis and a polytomy that included all remaining ingroup taxa was strongly supported by the bootstrap analysis (BS = 98%). Poliomintha species were distributed among two clades. The first clade (Clade l) was marginally supported (88 = 69%) and included P. incana and two Clinopodium species from Baja California (i.e., C..chandlen’ and C. ganden). The second clade (Clade II) was a weakly supported polytomy (38 = 61%) comprised of P. bustamanta, P. conjunctrix, P. dendritica, P. glabrescens, P. Iongiflora, Clinopodium hintoniorum, and eighteen Hedeoma species. While the relationship between Clade l and Clade II and their position relative to other ingroup taxa was unresolved in the strict consensus, the topology suggests that Poliomintha is not monophyletic. However, poor bootstrap support in the topology limits confidence in a formal rejection of monophyly. Maximum likelihood (ML) analysis of the combined plastid datasets recovered one tree with a negative log likelihood (-In L) of 4086.57963 (Figures 3-4 A and B). The ingroup taxa were strongly supported (BS = 97%) as a 28 monophyletic group, with Acinos arvensis positioned basally and strongly supported (BS = 99%) as sister to the remaining taxa. The monophyly of Poliomintha was not supported in the ML topology. As described above for the parsimony results, Poliomintha species were distributed among the same two clades (Clade I and Clade II) in the ML topology. Bootstrap support increased for Clade l (BS = 74%), but slightly decreased for Clade ll (BS = 59 %). While unresolved in the MP topologies, Clade II was positioned here as part of a larger, unsupported (BS < 50%) polytomy that included Hedeoma hispida, a Rhododon clade, and an unsupported (BS < 50%) polytomy that included species of Blephilia, Clinopodium, Conradina, Dicerandra, Monarda, and Pycnanthemum. The relationship of the above polytomy was unresolved relative to the remaining ingroup taxa, which included Clade I, two Clinopodium species, two Hedeoma species and four other clades of ingroup taxa. 29 a: 30:0 8000:: ~ 2: “20:00 .0 :m .2: 0003000 00000:: lolITPM—IF 20:00 0 0. 000:0:8 «5 0000:: 0E0000I ||ml|7 P m. .0 .0 £0 {10000000000000.0001 000.0000 20.000030 0.00000 0E0000I 00000:: “00000000: '0': 8 VS 0.00E 08000: i 8 rs 0:00:00:0E 0E0000I j 0.080 .1 u 0 00000800.: 00.00085 l|_~ E0:00..x0E EE0000::U 0000:: 0:00:03: 00:00 E0.0000:.:u E: 0:35 055E230 O 5: 0:005 2:550:00 8: 00000 E00335 9: 00000 E30336 rm .5 00:20 5208050 AB .4: 0:0:0E 0009000000: 0000000 00000000: 00.0.0 0000:0000: E030300:0 00> 00:30:: EJ000050 em a ...s 0:205 52088.0 0 E0000:00 E0E0£:0:0>.0 0:0000£:0E 00:02 0000:“: 000:2: 00300EE: 00:00.85 0:00.300 0500: :8 o a: 0:8 5300080 F E 0:8 E0380 _ _ 0.3.0 v—Oov—‘o 2:22 0:300 Wm 9:90 30 O .9 0.005003: 0:050:00 O: 0:000 050000: 0.00:0 050000: 05: 00 050000: 2. 00:00: 0:050:00 8 5 00000000 0:050:00 5:00.000 0:550:00 a: 00500 050000: 0:500:00 050000: a: 0:0: 050000: 0:05 050000: 00:00:05 050000: .8 :0005500 050000: a .5 0000000 050000: 500.085: 55000050 0: 0:05 8: 000.000: 05:50:00 ::0:000>00 050000: .3 :0:0EEE0 050000... *0. 000.00 050000: 0. 000.5 0.0.0.00 :0 5.3 02020:. 000 0005300 00 00:00 00:00. 50000000 0. 000: 20.0.0002 030:0 5.3 00.00.05 00 00: 90:00:00 .050 0:0 :. 0000.60 .05 85:05 0000.05 050.00 0.09 000.? 000000 0003000 0:0 .0500: 050:0. 5:05 5.2, 50000008 0.090.000 0 mm 550:0 m. 00: 0.2 00000.00 2:000:00 0:... 000000005 02.050055. 0:00.000 .03.: H Um. 0:0 .30.: u E wad u .0 ”00000 mew u 50:000.: 0000 00000000 357N900 0:0 05.55 0.60.0 0050500 00 0.30:0 :0 50: 0000500.. 000.: Es: 32:05.00: 0005 000.00 .0 0:0 mm 0:0 < m-..” 0050.“. 05:000.: 0050:: 0:000:00: 0:0 :05: rm .3 50:00.0 00500. 00:00:00 05550.00 a: 0:000 050000: .5 5:30 050000: .3 00500 050000: 2: 0:0: 050000: 00005 050000: .. 0:05 = ova—U 0050000050000: 000.050.0583: .055 050000: 0:00.033: 0500001 0.0.0:..0 050000: .5 00050000: 05:50:00 _ 0005 «00.0500 050000: 0235.540 _ N— mm ,— O: 00:0 < 00 00:50:00 «.0 0.0L \ \ \ \\ \\ 31 30.0: m 0. 000008 mu. .0. 0:00.00 0.9.0.0000... 000000.000 00> .0059: 00.000000 .0 .2. .0550... 2.200080 .8 000:.0 00000:: I|.I .s 3.00 .0 .8 as 3.000% 5.802... _ 8. 00.00.: 0000.00... 00.0.0000: 0:0:—0:00 I .0. 0:00 000000... I .3 0....000 000000.. I .3 000.00 000000... I .3 0:0: 000000... I 000000 000000... I = 0095 = ova—U 000000000000... 00.000.000.000... I I .000. 000000... I 0.00.0000: 000000... I 0.0.0:..0 000000... I .3 50000.00: 0:05—00:00 I.I . 009.0 :0 0000000 000000: 000.00.:00 0000000500 0:800:00... 000:2: 00.0.0: 0.00:0... mm 00.00000. 00:08.5 0:00.300 000008 a. .000 83.00080 0: 2. .000 52.80000 050.... 0......00.0 no .10 050.“. 00.000.00.033 Sod I 2. 200.000. 05552.00 .0 .3 0:802:20 0:0:-00:00 0000:0000 05002.00 0 .0. 00000.00: 05500.00 0. 0....000 000000... 0.00:0 000000: 0:000 000000... .0. 000.00 000000... 0:00.030 000000... .0. 0:0: 000000... g0:00 000000... 00:00:00 000000... .9 :000000 000000... .0 .3 00.00 000000... 00000.. 0.: 00.0005 .= 009.0 .0. 005000: 05000.00 00:000. 000000... .3 :0000000 000000.. 00.00.00 000000... 0. 0005 32 .xmtoumm cm 5:; 8.865 9m m8coacwm :o 3:05 $352 E3052 2 :3: 22382 .3289: m5 m>onm 8829: m_ 308$ «5:95 3:508 95 28m 2 :39: Ba 25:9 5965 .mmmécms. BE 9: E mcofimooom no :8 Emu mucoscmm SEEQE vcm “IE: 28.: 8:388 :0 $395 an E9: 8:982 885.89. u ._ :3 $3 805.3: E:E_xm_2 nm 26 < Ym $59“. Saucozsuzmnam Sod I. 3.52:2: 3:5: 2:056:59 3:305 rm 2: Magic 8:.G< m. d 0 cm .5 3E293u qumme 3:33 2:8me 223:3: nmfioaqmmt 22:53“ fluxnoquml ‘ ubFE £99938: 8 .2: ESE quwme mm: EmcEauoE E38356 on 328.: 23:58: m ESE: E96385 LI 3 $.38:me EEboquU 8 rs u:u.Eou:cE 2:83: I'll— Efizu a L EaEamobcE E53356 |_ ~h Q 2.32: 235.550: 0 ...$ 2.3.: u££Eo=om _ Uta—U a: 33% E38325 g .533 2:38:85 5. .s 5265 E28356 ma 96:: < 8 33:25.6 ou‘ 33 Combined Analyses of Poliomintha and Related Genera The partition homogeneity test (PHT) of the combined ITS and plastid (trnL-th and rpl32-tmL) datasets recovered a highly significant level of incongruence (P = 0.005). Visual comparison of trees recovered by parsimony and maximum likelihood analyses of the individual ITS and plastid datasets revealed supported topological differences for two taxa. The most important incongruence was observed for the focal taxon, Poliomintha incana, which is the type of the genus. Poliomintha incana was supported as sister to the genus Rhododon in the ITS topologies (Poliomintha incana / Rhododon Clade; MP BS = 76%; ML BS = 73%), but was supported as sister to a clade that includes the two Clinopodium species, C. chandlen' and C. ganden', in the plastid topologies (Clade l; MP BS = 69%; ML BS = 74%). The second topological difference was observed for Conradina etonia, which was well supported as sister to Conradina brevifolia in the ITS topologies (MP BS = 99%; ML BS = 95), but within a weakly supported polytomy that included Clinopodium macrostemum and Hedeoma mandoniana in the plastid topologies (MP BS = 71%; ML BS = 74%). The combined nuclear (ITS) and plastid (tmL—th and rpl32-trnL) data matrix for 71 accessions included 2406 characters, of which 227 were . parsimony-informative, 169 were variable but parsimony-uninformative, and 2010 were constant (Appendix B; Table 3-2). Parsimony analyses of the combined datasets recovered 43,966 trees with a length of 735 steps, CI of 0.553, Rl of 0.749, and RC of 0.414. The topology in the strict consensus of MP trees strongly resembled that reported from the ITS data (Figures 3—5 A and B; Figures 3-1 A and B). The monophyly of the ingroup was strongly supported in the MP trees (BS = 96%), with Acinos arvensis positioned basally as sister to the remaining ingroup taxa (BS = 98%). Poliomintha was not supported as a monophyletic group. Species of Poliomintha were distributed among the “Hedeomintha” and Poliomintha incana / Rhododon clades described for the ITS topologies. However, bootstrap support for the Poliomintha incana / Rhododon clade was higher for the combined data (BS = 83%) than it was for the ITS data alone. The remaining Poliomintha species did not form a monophyletic group within the “Hedeomintha” clade, but were present as part of two subclades within all MP topologies. However, increased resolution and bootstrap support (>50%) among clades with Poliomintha in the “Hedeomintha” clade was not improved with the addition of plastid data. The ML analysis of the combined nuclear and plastid data recovered one tree with a negative log likelihood (-In L) of 7951.01811 (Figures 3-6 A and B). As described above, the ingroup taxa were supported as a monophyletic group, but bootstrap values decreased slightly in comparison .to the MP results (ML BS = 91%; MP BS = 96%). Acinos arvensis was positioned basally and strongly supported as sister to the remaining ingroup taxa (BS = 91%). Consistent with previous results, the monophyly of Poliomintha was not supported in the ML topology. Poliomintha species were distributed among the Poliomintha incana / Rhododon and “Hedeomintha” clades as previously described. However, support for the Poliomintha incana / Rhododon clade decreased in the ML topology (ML BS = 75%; MP BS = 83%). The position of the Poliomintha incana / Rhododon 35 clade was resolved as sister to another clade that included taxa from genera such as Blephilia, Conradina, Monarda, Pycnanthemum, and some taxa from Hedeoma and Hesperozygis from eastern South America. As for the “Hedeomintha” clade, it was positioned within a polytomy that included Clinopodium hintoniorum and Hedeoma jucunda. The addition of the two taxa as part of a larger group that included the “Hedeomintha” clade was consistent with relationships observed in ML plastid topology. 36 soap sseésoooozs AS .822: 6E88: 62:2: 6288: N g 2230 6888: l. F 8: 2230 2:88: 8 mo 2: 8 I 8:82 2: 8:]1 $‘ 28.2: 6:288: o ::o:::o.€E88: 6:2 :2: 8:88: .322 6E88: a: 6:6: 8:88: :5 ecu: 2:88: 2:2: 2:88: 22:28 3:88: 222% 2:88: he EoEuE: 2355025 9: 9359:: uS—eEoEE 252:5! 2: =~Eo=em 0v StuEEuao o52Eo~3m 8: 5:25:23 ossfio=om 9: 8:25:25 955.550.: 5.85%...» ecu-2:23.: 2:08:28: 2:88: 8: 2:82:28 8:88: 2: 8:08:53 2:88: 22:22. 2:88: 328: m 2 83:88 «5 mtm 959...: _ l 82:20: 2:88: 22282 233838: 588:: 233838: op 62:: 2930838: 9 F a: 28:: 2:88: :5 288 6588: o 2:08 3.62:8 2 cm 23:85 8.22:0 3 E325028 52:85:65 a 2282: :2: 2:802 2: 222“: 2:32: 2:2,: :29: 830:: 5:5 882:5 2m 8: 28:88: 20:8 :5 :_ 88:8 8.5 8:085 020065 36.8 .202 83.8 8:25 8:900: 3:: 35:2 2:38. 5:2: 5:5 22:08.0 8.33862 m 8 250:...” w_ 8: :5. 328.8 >_Eo::2 2:. 22288:: 88225:: 5:53.98 .33.: u 0: 3:0 .332: n E .mmmd u .0 M88 mm» H £38.85 2:: 883:8 ._::-Nm_e 3:: .u.-._:: .9: :0 296:: 8:328 m E0: 8858: 8:: Es: 828288: 52: 25.9. .6 20 ”m 3:: < mtm 8:39: :2 020E SEA 2 1:95.50 _ 2222:2820: 35:82.»: Am: 23:02: “020:: N 8E5: E28825 Fm ea mm 02:2: 0E88: N F ON 820:: 2:020:03: j E 8: 86:05 E35032“: 2:. N o F 8: 85:08 E28825 e um F E 5:26 82388.6 e r 0:2:0 ::E :E8 8 2:. Max ::2:0W:0E :Eowmmu flj mm m E3E2880E E3: 0:025 IL 8: 0.22::E :5 88:8: 0 2 oo— 9: 22:2: «5:008:82: m F 2 E3::0.:8E E28825 2.82: :E88: E: 820523: 2:88: EV 820.523: :E88: g 8.20523: :E88: 8: 820523: :E88: 9: 820.523: :E88: E238232: :2. 28:30:: E28820 “It m 2: 28:20:: E33082“: : N 20:33.2:E88: filly E3282: E28825 |L Am: “2235:: 83200:: 2: 8: W22:0 888:: MUthfil— :5 32235:: 8830:: F m: Q 262... 3.5528 r w. a: 0:02: 05::E0=0: o 8 F :3 28225528 F 2 ._,._._. F ova—u E20235: \ 3:305 05250.20: 2.0:: < 2 832:8 out 38 03030382832: | : v 8.20: 02830:: c: 002:0: 020030: 0:20: 020032: 0:02: 02830:: 3. 2: 0:0: 020032: 2:02 02832: n: 0:0 :02 020032: .2 22 0200301 no 0: 0 .0030 02832: WA 253: 020030: 8: 0: :03: 02830:: :3 2:3: 05800: 0:20:30 020030: a: 0350.6: 205520: 2: 0:05:00: 05000050: 05:03:03 050:0:0::0: O: 0:00—00:00: 055.050: 8: 200.0080: 055.005.: €300.05»... 052.0050: 0:800 000 052.0050: 28:22.0: 02830:: Am: 2382223 02830:: 9:: 2382233 02830:: 0: 22328 02830:: 820200 02830:: 238282: 2230825 020:2: 020032: e 03:23:00 83030:: 8 03.0.20 83030:: 9:: 03.2358 83030:: G: 00000: 0500.050: Mm 00000: 0522050: < 00000: 05220::0: 83030:: “5:008:81 0:23:23 “5:88:81 03.2: “5:208:02: a: 2302 020032: :3 2302 02830:: F 23220200 2320:2052: 2200582 03:08:: WES“: 03:08:: 2:23.08 023028 2.20 02.5583? 0305 0030305: \ 0000:: 05220.8: 288 2:23 2:20 \o \ 0-0 059”. 0228003083 mood 20:03 m 9 30:53:00 39 .wwcocmfi 2: 9on 8:865 m_ @ooma toaazw 22568 new 28m 2 E56 2m 26:2 555 .omoficoz SE 2: E mcofimmoom E .2 Emu wocmacom 3.5-85. ucm “3:5 Emma new 3k: 820:: ho mfizmcm umcEEoo 9: :5: 8.982 :33. Em» n .. :3 mm: 8959.: E:E_xm_2 Hm ucm < o-m $59... Buhcozazmnsm mood cEEEcE 325:. 9:86:28 ucEmE Am: $226 852‘ tn 8.. 3F] 00.. no 3 gates Fa 53:ch $338233 :9. .6583 EEBQOEU 9:22:3me |J A5 .BEsoS E28325 L ddp 869» < S 332:8 ‘\ ‘5 no 40 Tests of Alternative Phylogeny Results from the SH tests supported the conclusion that Poliomintha is not monophyletic, regardless of whether or not P. conjunctn'x was included. Parsimony searches of the combined nuclear and plastid datasets constrained to one of two topologies recovered a total of 232 trees with a monophyletic Poliomintha (Constraint 1) and 72 trees with a monophyletic Poliomintha that excluded P. conjunctrix (Constraint 2). Based on the TrN + l + l' model of sequence evolution for the combined data, the most likely tree recovered under Constraint 1 had a negative log likelihood (-In L) of 7997.70634, length of 745 steps, CI of 0.543, RI of 0.739, and RC of 0.401. The most likely tree recovered under Constraint 2 had a -In L of 7991 .02576, length of 743 steps, CI of 0.545, Rl of 0.741, and RC of 0.404. The SH tests comparing the mostly likely constraint trees with the most likely unconstrained MP tree (-ln L = 795602084) and the ML tree (-In L = 795101811) detected highly significant differences in likelihoods for all pairwise comparisons (Table 3-2). Not reported in Table 3-3 are the results of an SH test comparing the most likely MP tree and the ML tree, of which significant likelihood differences were not detected among the two topologies at the a = 0.05 level (P = 0.382; difference in —In L = 5.00273). 41 Table 3-3: Results of SH tests. Numbers indicate P value / difference in negative log likelihood (-In L) score. Significance at the a = 0.05 level is indicated with an asterisk. MP no constraint: Most likely tree (-In L = 7956.02084) ML no constraint: Most likely tree (-In L = 7951.01811) MP: Constraint 1 Poliomintha monophyly Most likely tree (-In L = 7991 .02576) . 0009* / 41.68551 0004* / 46.68824 Most lrkely tree (-In L = 7997.70634) MP: Constraint 2 Poliomintha monophyly exc'“d'"9 P‘ °°”’“"°t”x 0018* / 35.00492 0012* /40.00765 42 Chapter 4 DISCUSSION The phylogenetic hypotheses presented herein, inferred from over 2,400 base pairs of nuclear and chloroplast DNA sequence data, resurrect a number of systematic issues pertinent to Poliomintha previously discussed by some researchers and offer much needed insight into long-standing taxonomic questions and debate over the generic boundaries among Poliomintha and closely related genera in the tribe Mentheae. Several important findings from the study and their implications are discussed here, including: (1) phylogenetic relationships among Poliomintha and related genera; (2) the importance of morphological characters in delineating genera; and (3) the taxonomy of Poliomintha. Phylogenetic Relationships among Poliomintha and Related Genera The phylogenetic hypotheses consistently suggest that Poliomintha is not monophyletic. As currently circumscribed, Poliomintha represents at least two distinct lineages; a lineage that includes the type species, P. incana, and either (or both) Rhododon or two species of the polyphyletic genus Clinopodium; and a second lineage that includes the remaining species of Poliomintha and most species of Hedeoma (e.g., the “Hedeomintha” clade). These results are, in part, consistent with the findings of Wagstaff et al. (1995), who first reported a sister relationship between Poliomintha (P. Iongiflora) and Hedeoma (H. drummondii) 43 based on a parsimony analysis of chNA restriction site variation in subfamily Nepetoideae. The results of my study consistently reveal a close relationship between most species of Poliomintha and Hedeoma. However, no evidence is available to suggest that the type species of either genus (P. incana and H. pulegioides) is included in the same clade as the majority of the species from the two genera. In fact, the results of the constraint analyses and SH tests suggest that P. incana is not related to the remaining Poliomintha species, representing a new and important finding that has taxonomic implications. Phylogenetic relationships among genera in the Mentheae are difficult to interpret with confidence from the results presented here for several reasons. First, insufficient resolution and low bootstrap support within and among most clades imposes substantial limits on inference of evolutionary relationships among sampled taxa, especially at the generic level. It is possible that the lack of resolution and support is a consequence of either incomplete sampling of taxa or insufficient sequence data, or both (Graybeal 1998). As suggested by my results, several genera included the study may be polyphyletic (Figures 3-1 to 3—6)——e.g., Clinopodium, Hedeoma, Hesperozygis, and Poliomintha—and more extensive sampling of taxa within these genera as well as from other genera in the Mentheae such as Acanthomintha, Bystropogon, Cunila, Dicerandra, Eriothymus, Glechon, Minthostachys, Piloblephis, Pogogyne, Rhabdocaulon, and Stachydeoma may help to better resolve relationships. As for character sampling, additional work is needed to identify informative nuclear and plastid markers. The plastid regions used in this study exhibit low levels of sequence divergence and contribute less than one-third of the total phylogenetically informative characters to the analyses (Table 3-1). As a result, insufficient resolution is obtained for many groups from analyses of plastid data alone (Figures 3-3 A and B; Figures 3—4 A and B) or in combination with lTS data (Figures 3-5 A and B; Figures 3-6 A and B). The incongruence among the ITS and plastid datasets represents another challenge to phylogenetic inference of relationships in the Mentheae. The PHT has been demonstrated to be overly sensitive in large datasets such as that used here (Hipp et al. 2004). Therefore, it is possible that the incongruence suggested by the PHT does not represent phylogenetic differences, but instead is an artifact of the overly sensitive nature of the test. In this case, it appears that the incongruence is widespread and involves more than one taxon. The topological differences observed among individual analyses diminish confidence in some relationships, particularly for those involving the focal taxon (P. incana). For example, relationships between P. incana and either Rhododon or species of Clinopodium are weakly supported in the phylogenetic analyses of ITS and plastid datasets, as well as in those using total evidence. Casesof widespread incongruence among ITS and plastid datasets have been documented for other groups in the Mentheae such as Conradina, Clinopodium, and related scrub mints from the southeastern United States (Edwards et al. 2006; Edwards et al. 2008). In fact, incongruence among different gene trees is a commonly encountered problem in phylogenetic studies, particularly in those involving recently derived and rapidly radiating species 45 (Buckley et al. 2006). In examples of incongruence between nuclear and plastid data, the patterns of plastid sequence variation may be explained by processes such as introgression or shared ancestral polymorphism lineage sorting (Wendel and Doyle 1998; Schaal and Olsen 2000). However, distinguishing between processes responsible for the patterns is often difficult because of the large variance associated with the coalescent process and the fact that the processes can produce similar phylogenetic patterns (Holder et al. 2001). For some groups in the Mentheae, it may be difficult to reconstruct phylogenetic relationships using DNA sequence data, particularly in cases where taxa are recently derived, hybridization is widespread, or where there is a lack of coalescence (Edwards et al. 2008). Importance of Morphological Characters in Delineating Genera For over 100 years systematists have been uncertain about the generic circumscription of Poliomintha. lts similar morphology and close relationship to genera such as Hedeoma and Hesperozygis have been discussed by several researchers, some of whom have questioned its distinction at the generic level. Briquet (1897) first discussed in-depth the inherent complexity of morphological interpretation for these genera, emphasizing the fact that some taxa exhibit character states that appear “intermediate” between those traditionally used to delineate generic boundaries. It seems that Briquet’s decision to subsume Poliomintha into Hedeoma on the basis of insufficient clear-cut differences was, as Epling and Stewart (1939) effectively point out, inappropriate within the 46 context of a larger Mentheae and would necessitate the inclusion of other genera beyond the scope of those discussed here. Epling & Stewart (1939) argued that “the fact that no single constant point of difference may be brought forward wherewith to distinguish Hedeoma and Poliomintha is not presumptive of their unity.” Characters such as stamen number (two versus four), habit (herbaceous versus woody), calyx morphology (gibbous, saccate, campanulate, or bilabiate versus tubular and symmetrical), and the presence or absence of a well-defined or irregular calyx annulus were defined by Epling and Stewart (1939) and Irving (1972, 1980) for the purposes of delineating boundaries among Hedeoma, Hesperozygis, and Poliomintha. However, in light of my phylogenetic results, it appears that the taxonomic importance of at least some of the characters used by these researchers has been overestimated. Characters such as habit and calyx morphology do not represent synapomorphies that characterize monophyletic groupings of taxa, but instead are homoplasious within the phylogenetic context presented here. The habit, in particular, is not an ideal diagnostic character by which to distinguish Poliomintha from Hedeoma. Within the monophyletic “Hedeomintha” clade, one can find numerous examples of Hedeoma species that exhibit woody or semi-woody habits. Moreover, species with annual and perennial herbaceous habits as well as species with woody or semi-woody habits can be found in other monophyletic genera in the Mentheae—for example, in Monarda (Prather et al. 2002). Without sufficient resolution and bootstrap support within and among most clades, it seems premature to undertake a comprehensive morphological study to uncover 47 synapomorphies. However, character analyses may be helpful in determining what characters best distinguish monophyletic clades, pending the acquisition of more conclusive phylogenetic evidence. The Taxonomy of Poliomintha The phylogenetic evidence from this study consistently suggests that Poliomintha is not monophyletic as currently circumscribed. In consideration of these results, the genus Poliomintha may be best limited to the type species, P. incana, pending future phylogenetic and morphological studies that determine the relationships of P. incana with confidence. As for the remaining Poliomintha species, their taxonomic disposition depends on the relationships among the species of Hedeoma. Based on my results, Hedeoma is polyphyletic and the type of Hedeoma, H. pulegioides, is most likely unrelated to the remainder of the genus. However, more evidence is needed to confirm this result. If further phylogenetic evidence suggests that H. pulegioides is a member of the “Hedeomintha” clade, the Poliomintha species that comprise the clade are best subsumed into the genus Hedeoma to reflect their common ancestry. Altematively, if H. pulegioides is excluded from the “Hedeomintha” clade, the Poliomintha and Hedeoma species comprising the clade should be reclassified into a new genus. Many genera in family Lamiaceae are not monophyletic as currently circumscribed. In consideration of molecular synapomorphies, many genera are polyphyletic or paraphyletic relative to other genera, including: Satureja L. 48 (Wagstaff et al. 1995); Clerodendrum (Steane et al. 1999); Salvia L. (Walker and Systma 2004); Huxleya (Steane et al. 2004); Basilicum Moench, Endostemon N. E. Br., Fuerstia T. C. E. Fr., Haumaniastrum P. A. Duvign and Plancke, Hemizygia Briq., Hos/undia Vahl, Hyptis Jacq., Platostoma P. Beauv., Plectranthus L. Hér., Puntia Hedge, Ocimum L., Orthosiphon Benth., and Syncolostemon E. Mey. (Paton et al. 2004); and Micromeria Benth. (Brauchler et al. 2005). Many of these genera, including Poliomintha, Hedeoma, and Clinopodium, will likely necessitate (or have been subject to) taxonomic and nomenclatural revision. Although no nomenclatural changes are recommended based on my results, any future taxonomic revisions that involve nomenclatural changes for Poliomintha or other genera should carefully consider the possibility of broader societal impacts. 49 APPENDICES 50 APPENDIX A 51 85.95 9.295 62383 m. Econ? 85 90...; 83:88; 85 E 5:80. 55:? ”.883: 882.8 new 882.8 3 89m: 9m wcocozo> i=5.NQE u m ucm .lEfiqET42b n ._. .wt .1. _ U25.05 ._. m H ._ 69% 88mm 8:2. 8:2“. 26: gm 380 .28 25383325 ems 8:395 2588056 a F 65v 8 83 w memco 8820 8:62 m 68:3. 2.ng 28263 538856 m .e ._ 65v one 88.. 8830 “Sims. < muse. 36v Lessee 538855 m H 695 988 ___;osco 8:2“. “<8 m =me 2.583 .828 53.6885 m .» 6mg 88» .2220 9980 ” :oznoou :oEBon coxmh 35.9.2 mambo—3 ozocomogca 3.30222 2: 5 com: 33:22 .2 cozchoE. Lozozo> < x.ozmmn_< 52 .25..NQB u m new (22-422.-qu u ._. .m... u _ H00.0.02. 022.8220 2.0.001 82.00000 2 2020:? 2.: 0.023 25.80.02 05 2 202000. .0203? 200.8: 2082.8 020 2082.00 >0 008.. 0.0 202020> .. m H ._ .002. 850 .....0.2.0 00.5.... ”<0: 505.50 5.5250 05.00500 m .H .920. 0mm 288 008.20 ”00.0.22 .28: .0820. 0200280020 23.008220 2 H ._ .022. 002.0 0.0.50 8.0.0.0000 0.0. 50.05.). 05:3. 2.50 .<. 505.02 58805.0 m. .H ._ .>z. 803 8.8.8.0 000me ”00.0.22 020900 .283. 23202.82. 22.008220 2 H .. .>z. «N0 .5 .0 0.0500 0000000.... 50.50.... 0503. .5500 .5 00000 .0 .002. 23.220282. 25.00825 2 H ._ .w<0. 0000a .0 .0 .55.... 000.. 90:2 50.5.2 0:02.00 .553 .. .m. 2220.20.23 53.008220 2 H ._ .m<0. 00000 550.2 0.55.50 0.00 ”8.0.0.2 m 0:05.00 .058. 20.0500 50.502058 2 H .08.: ~83. 5.0002. 0.55.50 0.50 50.05.). < 5.0560 .0550. 50.0500 50.502058 2 H .. .002. 002.: 00.0.). 0.55.50 0.50 50.0.0.2 0 20.000310 .0 00.50005 50500050. 20.02020 28.008220 2 H ._ 3.20m: 02: 0505. 0.55.50 0.0m. 5005.2 < 25503.10 .0 00.50002 .00000050. 22.02020 258082.20 Hmcofluwm 5.20.800.— 2020.52 .020=0> 20:000.. 205.00dw 20.8... 005.55... 53 85.95 223m .uEanwa m_ 55:? 05 9.23 E2892 «.5 m_ 8:80. .6539 52:5: 862.8 95 58:8 >2 omfi: 2m szozo> JE~.NQE u m ucm (HEJEVQEg u ._. .w.... u _ H2:32.: H m H ._ 92v 38m ___: was... aw: 55m 5%.: $88: m H ._ CE 3: ozocmH a ~855me 99980 “85.2 m .598 %SEEEn «.588: m H ._ 92V 88 .95: @5523 am: < Scam %zosseu $88: m H ._ 92V «flew .a .m :25: :03 9,82 62me m 220 .< $880 $88: m H ._ 92v 9.3 .E a 32.9.5 25580 ”852 < 50 .< .2380 388: m H ._ 92v ~32 :8onva .53 96:2 52me Ea. .m .m 653.”: $33.5 38%: m H ._ crzv H8: 259: $on am: :95me .w .2, masoam $88: m H ._ om: «E 5E3 .2, ._2 .8me am: 285m 82058 $88: a H 6mg 25%. :3. 8:2”. ”<9 «.23 $3858.. @8985 m H ._ 693 83a __Eosco mast am: 3:582 .m .m a .92 £58 8.5880 macaw. 30:30.. 3:252 .852; 5:30.. 59.8QO 5.8... ._. 605.95 ._. uoEaEm 22061 63383 m_ 55:? on. 9ch E2558: 9: E 8:80. .9539 235.3: 58:8 ucm 562.8 3 8%.: 9m chozo> .4E~.NQB u 1 new .lEJEhJHE u ._. .w._._ u _ ”25.05 H m H ._ cm: 88 .B E :3 $on aw: .EH 9on «.588: m H 3.:me 94m. 58.2 m_Ee__mo %m 3me :92). anagrams 588: m H ._ cat 91: 9E. .o a .m 08328.2 8 .38 m 8:8 $8.: $88: $962: a H ._ cm: 7: as; .o a .m 82, :3 2. .58 ”$395 < 8:8 $88 $881 1 .._. ._ 92v mmop Eom>mamH 283:5 ”Ema m 683 mcwEobcmE mEomme m H ._ crzv 3m: $528 0:235. 53:8 < 68>) mzmsoncme @588: m .._. ._ Ame SH 9.3.. 09230 ”8_st_ 9.8.0 .8563 9:8me m H ._ cab 88 92:2.QO 95:80 52wa 9.3.. .m .m €285 «588: m H ._ om: Emmm .a s :25: 25:80 52me $53 .._ .m 35$ $88: m H om: Rom emucmm 02x22 202 ”<3 >90 .< £2382: «E88: 32am unozauo; 5:253 .852; 5330.. 58825 coxmh H 35.95 55 BEBE: mcoamm 62.83: m. Enos? :5 29.3 83.699. 05 m. 8:80. 85:? quEac 582.8 95 589.8 :3 52m: 9: Emcozo> JETNQB u m new (5845745: u ._. .w._._ u _ H256:. H m H ._ 92. 832 .8 8 8&2: 8.883 ”<2. < .28: 3: 8:383: 8:88: m H ._ cat 8: 8:2 .288: 2:85 “8.8.2 .58: 282: 8:88: m H ._ cm: 88 2:88.. 8825 ”8:85. :8 28:: 2:88: m H ._ cm: 82. .882 882:0 52x85. 886 .22. 8:8: 2:88: m H ._ £2. 32. 88:5 :8._ 92.2 8.8.2 m .88: 8:8: 2:88: m H ._ 92. 83: 8 8 :25: 83 92.2 88.2 < ._mem: 8:8: 8:88: m H ._ cm: 88 88:5 95:80 52me 88:5 8:288 2:88: m H ._ cat 83.: 853 .._ .m 8me “<3 m gm ..:8: :8: 2:88: m H ._ cab 38 8 8 8.. 8me am: < Sm tab :8: 8:88: m .... .. Crz. mmHNH 89.2.5... 2.2.80 60.me mmmmucmfi «:sz2: mEomme 305011 20:30.. .2263 ._ocoso> 5:30.. :2:ng :93... H 8535.: ._. 56 8.2.9:: 8053.. 6.2.8qu 2 88:9 9.. 92.3 E2892. 2.. 2 2.2.80. .582? ”.0922: 5.02.8 0:: 5.02.8 .3 8.2. 08 Emcozo> 452N322 n 1 new .lE~-qE.-4E. u ._. .w._._ u . H203.9... ._. m H .. $5. .88 8282: .220: 53 :8 ”8.55.2 m :58. 88:8 .m. 2.28:: 2:89.88: 2 H ._ cm... :8. 88H 82:: 53 8w 8.6.2 < :58. 88:8 .2 228: 2:88:88: 2 H .. cm... :82 8:22. 8me ”<8 8.0 .< 8888: 8:88: m H __ 92. ~82 588: a 8.5m :8. 282 8.82 o :52. .w .m 652. .m .m. 2.8: 2:88: m H ._ £2. 82: .8 8 :25... :8._ 92.2 8.8.2 m :52. .m .m 35>: .w .m. 2.8: 8288: m H ._ .me. 8.8 882 :8. 282 8.8.2 < :52. .m .m 352. .m .m. 5.8: 8:88: m H ._ .82. 58.2.8.5: 8:2. 2:0 ”<8 m .8: 3. 8528.2: 2:88: m H ._ 92. H 22.85 58288: ”<2. 0 .8: 3. 8228.2: 8:88: m H ._ 92. m8 .225 a .888 5.02:9. ”<8 0 .8: 3. 82283: 2:88: m H ._ 92. :8: 88.2 88.2 8m: m .8: 3. 82283: 8:88: wee—woe H2858.— .ocosoa 8:03.; :03qu.— =mEBoqm :98... H 8.23:2 57 005.58: 2553: 59.8.50 2 5..0:0> 9.. 0.2.2. 5250.2. 2.. m. 8.800. 550:? .5582: 5.02.8 0.5 5.02.8 .3 8.2. m5 Emc0zo> Josuwmun: u m tam (574E745. u ._. .w... u _ 6020:. : H ._ .85 82 89:0 :8. 8.85: :83 08:2 8.8.2 0 853 3 .m 888.8: 858.8“ m H ._ .85 E: 3 858.2 85.883 8.8.2 m 853 3 .m 2888: 858.3: m H ._ .xm: 8:8: 8.8.... 8.82.30. :9... ”<0: < 85.: .. .m 288.8: 858.3: m H ._ .022. :8 882. 5:580 ”<8 220 .< 88:... 5.888... m H ._ .022. 8:. 25.8520 88...: ”<8 58.88:... 288.2 m H ._ .022. $2 859: 8me am... 3 88.8 88:22 : H ._ .08. 9:2 888.: 552.80 “<0: .83.. 5.08:3... 2.82. m H ._ .002. :82 880 :88: 2.8.: :53: 588:: 888:8: m H ._ .>2. 8%: 88:86... «:8: 28.: :53: 88.8.: 888:8: : H ._ .>2. :3. .8356: 88: ”.58 :53: .28.... 8...: 888:8: 80.9.”. +£2.30. 550302 .0..0:0> 5.800.. :0E_00@m :98... ._. U¢EEE< 58 JETNQB u m 95 (HEJETQHE u ._. .w._._ u _ ”mUEQE umEaEm 955mm 69383 2 85:9 05 26:3 E2590; 9: 2 5:80. 55:9 ”89:2: 582.8 95 58260 E 8%: 9m Emcozo> 2 m H ._ 62): m E .3 E 9228 222:8 ”<2. 25-25 .6 .toH EsoNthEo E:Em£:m:§l m H ._ omE 2.8m .3. 2m :22: 25:80 5222 m 922 .< 2222922228231 m H ._ cab 828 82.2.5: .50.. 92.2 52me < 92o .< 22282 msssgom m H ._ £22 £3 22m 2022 ”$2 0 920 .< 9225 .882 $220.28 m H ._ 2>zv ~83 852.225 25820 52me m 920 ..< 925: mass $55262 m H ._ Ems: 2% .82250 $on am: < 92o .< 9225 $85 $5828 m H cab «Emu 82.2.5: 25:80 52me m 923m: .6 92w .< 383me mSEEo.:oQ m H cat 8.8 2.22m 25:80 526.2 < 9230: .6 920 .< wEommSmB 325220.201 m H ._ cab 22; 8225; a 552a :2: 02.52 52me 553 .4 .m Setucmn «£55228 m H ._ 65v 52 25., on .3 9822.. 252:8 28 526.2 8523 a 925m €83.38 $22262 #2653. +9.26qu .ucoaoa .m:u:o> 20:30... :o—Euuam :98... 853:2 59 umEaEm 256mm .oozmoamo 2 85:? m5 9ch 62.3.3 «5 2 5:80. 55:9, 28:5: 58260 new 58260 B 86: 2m m.m:o:o> 25.32 n m can (52-28325 u H .m: u _ ”8202 ._. m .H ._ Gas; mo? 992 or .:.m 22:3 3202.5 $4.85., a.- J mch.=mmE 3:3: ”5me m H ._ omE 8-8 553 .2, .2 w .._ .m 8on ”<24 m 9.3m 2:59 323 28882 m .H om: Show mtonomoms. ._2 w .m $me H{m3 < 923m 2:59 mamas notebocm m .H ._ Ame 3 .E E 853. .>> ._2 22$... H{ms m 5:5... z. .m 3.2.: 9:2:an 338% m .2. ._ 3.:wa «NS; :8 3me ”(m: < 5&3 i. .m East wSmSuzm :ononocm 2853. 5595555.. 3525. 3525 5:30.. 5:23qu :98... H 3.23:2 60 APPENDIX B 61 mom mom Hom Hom flow mom mom mom flom mom mom mom 2 mom a how H mom H mom 2 mom H mom H H _ Hu—JL—lh—lh—JL—Jl—Jh—ll—lL—l l—J fiom mom ¢wwuweou<¢oawmImHQ HMmEHmQ Ezcmowxmfi Ezsmumonumfi Ezuofl9022w£ m flhmbcmm m Humwbcmzu 4 Humwbemco Ezwbomocwwb Ezwbomocwwo EDHUOQOQHNU ESHUOQOCHfiu EzflthOcflHU EzHUOQOQHHU Ezwnomocwwo Ezwwomozflwu ESHUQQOQHaU EzfisomzwmoHHQ .nm> HmCROMQ m HmCBOMQ Ezwbouocflwb Ezwbomocflwb muzmnflc mflqwcmmam mwmcm>um mocwum wwwomflbczuOM mcucmz mcwcuwumms mzsxxh aflmhh USN .mw.m ._‘MF: hwuuflam flwntomCNuP _fl:._0u=_ _NEOmOn_N_ bflfi-O-az "P 556: ”0:0:—aw” U¢6U=< m X_Dzmn_m< 62 2cm 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 2 20m 20m 20m 20m 20m 20m 20m 20m 20m 20m 2 mh U m 4 mfiwwsz mwawsz mwwwmzm mmUHOHmmwzQ mmmHONGmHSQ mmmwowommsq mmmflowbmwzm mmmfloflmmwzm m < mumeQHQ mewuqu mumUHHQ HHmENmQ HHmENmQ mflaoeflumano m meme m meme memueoE mwaoE m menoa c mwbms mwmxmoqummm mHUANOMQOmm mwuxmoqummm mwoxmoqummm mfluxmoqummm mEomUmm mEomUmm mEomUmm mEomUmm mEommmm mEomUmm mEomUmm mEombmm mEommmm mEomUmm mEommmm mEommmm mEommmm mEommmm mEommmm mEommmm mEomUmm mEommmm mEombmm 22222222222 msombmm 282022 2 mcmweobcms mssmbmm mbesuzm mEowUmm 63 O O L0 L0 |—lL-_lL—-II.—l C) LO I—lt—dL—Jl—J ....u<¢................wuu...ow..... Hmezoun 4 Hmezoua ESHUOQoeHHU EzwmoQoeHHU muzmuflc mflaflcemflm mflmem>nm moewo< mHaOMwmezuou meuemE meHeUHummE m:E%e& m mzumwawo eom0boem m mzumfizbem e0momoem < msumwzmem eonomoem U memoew m memuew < memuew mowuwumemb xfluuoesfleoo Ezoweuowwwmo EzEmeuemeuxm m mMOHMHUeOH d mMONMHUeOH meueHEOHHOQ meueHEOHNOQ meueHEOHwom meueHEoflfiom meueflEOHNom meuefiEOHaom 2222222222222 meueHEowwom w£uCWEONNS% mCucwEowwpm mmmwocflw wwwmnumcoz ”0042 20022 Hooa2 Hooa2 mooa2 Hooa2 mooa2 Hoofi2 Hooa2 Hooa2 20042 HooH2 20022 Hooa2 Hooa2 20022 20042 moofi2 H0042 20022 Hooa2 HOOH2 HooH2 Hooa2 20022 Hooa2 20022 _ooH2 Hooa2 H0022 Hooa2 .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .HH...... .BH...... .......B. .......B. .......H. .044..H....... .00.. .040UH0BH4UB4III .040050BE4UB4III .0400HOHH4094004 ..400BOHB4094004 .040090HH40H4004 .040080994084004 .0400 IIIIIIIIIII .0400 IIIIIIIIIII .040090EH4094004 .040090HB40H4004 .040080994094004 .040080984084004 .0400HOBH4094004 .040080994094004 .040080894094004 ..400&0BH4094004 ..400HOBB40B4004 I.400B0HH40H40II .H400BOHB40H4004 .040050984094004 ..400HOHB40&4004 .040080994094004 .040080984094004 .0400BOHB40H4004 .040080594094004 .040090994084004 .040080984094004 .040080HH4094004 .04 IIIIIIIIIIIII .040020224294004 4 m 0:2 muHHmQHQ mefluqu mumUflNQ m HMmENmQ 4 HumEHmQ mfiaomfiumHQO m meme 4 meme memueos maon m mwme 4 mHUmE m memweobemE 4 memHeOUemE mbezuzm flweOumeeOh Hflocfl>ufl mnfiemfic m wwbeoEEzhb 4 meeoEEsub 22 WNNDW m mumumoo 4 mumumoo mumwoflwwo mumasome mmbwoewbm .2222 Nb mmmfiowumazm mEomUmm mmmfioflumazQ mmmwowomwzm mmUHOwumwzQ mEommmm mEombmm mEomUmm mEomUmm mEommmm mEomUmm mEommmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEommmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEommmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm 222222222 D Ebwuomwcwqo mac Ezwb0Qoew40 65 Homfi2 Homa2 20042 Hooa2 Hooa2 Hooa2 Hooa2 Hooa2 HOOH2 Hooa2 Hooa2 HQOH2 Hooa2 Hooa2 HooH2 HooH2 20022 Hooa2 Hooa2 HQOH2 ”0042 Hooa2 20042 20042 HQOH2 Hooa2 20022 Hooa2 40042 0..0..0H..........90....00.....4I40....00..00...IB 90090H4000H0H0000H0800044800000000B00040000BB000I4 .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. ...0444. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .044. .66.. .uw.. .uw.. .00.. .06.. .66.. .00.. .00.. .00.. .00.. .00.. .um.. .ow.. .09.. .oo.. .ow.. .00.. .06.. .00.. ..400HOBH40H4004 ..400HOHH4UH4004 ..40090994084004 .04 IIIIIIIIIIIII .040UBOHH4UH4004 .0400BOBH40H4004 ..H0090HB4084004 ..HO0HOHH4084004 ..B00 IIIIIIIIIII .040090984054004 .040UBOHH4UH4004 .040090994084004 .040090994094004 .040090984094004 ..4 IIIIIIIIIIIII .940080994084004 .94 lllllllllllll oo.< lllllllllllll .040080994094004 amumw lllllllllllll ..40090884084004 ..40090994094004 .040080984094004 .0400809 IIIIIIII .040090BH4UH4004 .040050954094004 .mmwuawea4ueauw4 mflwowwm mefleu m mzumw e5202 meuemz HummE mzsxeh 440 cononoam m mzumwzbem eomomoem 4 mammazmem eonomoem ESUHeMOwHHmU EzEmeuemeuxm m mHOHMHDeOH 4 mHOHMHmeOH 0 memoew m memoefl 4 memuew muwufiamemb xfluuoezmeou 0 muemEmumzfl m muemEmumzn 4 muemEmumzfl mmmwoefl mwwommme mmOH: mumaseummm eOUOUOCM mbwuwe m mwmowflhmfi 4 mHHOMHHmE wweoeoh 0 mNH m mNN meueHEowHom meueHEowwom meueHEOfiwom meueHEoHNOQ meueHEOHNOQ meueHEoflaom mepeHEoHHom meueHEowwom meuewEOwaom meueHEOHwom N mwwmmumeoz uemE mUMmeoz umflm mmumeoz mHOxNOMQOmm mwmxmoummmmm mwmxmommummm mHU%N0HQOmm mHUANOHQOmm m>mu mEombmm Hmzm mEombmm Hmze m3©$g3¢ m ..mwmzsi 22222222222 ND mwzQ mEommmm 66 Hom22 Homa2 Homfl2 momfi2 Homa2 Homa2 Homa2 fioma2 Homa2 Homfi2 Homa2 Homa2 Homa2 Homa2 Homa2 Homa2 Homfi2 Homa2 Homfi2 Homa2 Homa2 HomH2 Homfi2 Homa2 Homfi2 HomH2 Homfi2 Homa2 Homfi2 Homfi2 00 00000 0000000000 0 0000000000 0 I O O I O U 0 0 000000000 000 .wo:. .wo:. .o... .0... .oo:. .wuu. .oou. .601. .06.. .wuu. .wou. .wun. .ouu. .oun. .won. .ouu. .wuu. .wwu. .001. .661. .wuu. .wou. .ouu. ..uu. ..01. ..UI. .wos. .00I. .0.I. .00.. .I000.0090..00.4.I. .I000.00H0..00...I. .1000.00.0..00...I. .I000.00.0..00...I. .1000.00.0..00...I. .I000.00.0..00...I. .I000.00.0..0....I. .1000.00.0..00...I. .I000.0090..00.4.I. .I000.00.0..00.0.I0 .I000.00.0..00...IB .1000.00.0..00...IB .I000.00.0..00...I. .I000.00.0..00...I. .I000.00B0..00...I. .I000.00.0..00...IB .I000.00.0..00...IB .I040.00.0..00...I0 .1000.00.4..00...I0 .I000.00.0..00...I. .IH00.00.0..00...I. .1000.00.0..004..I. .1000.00.0..00..4I. .1000.00.0..00.4.I. .I000.00.0..00.4.I. .I000.00.0..00.4.I. .I040.00.B..00.4.I. .-ooo.wo.<..oo.<.u. .uoou.wu.u..wu...ufl mmflemfla m meeoEEshm 4 HwbeoEszum .m mumumou 4 mumumoo mumwoflwwo mumaonQm mmmwoewum mweOHm mHNOMHmeQ HumfiamQ Ezemowme EsEmumouumE Ezuofle02ewe m Humbemo m flumwbemeu 4 wumabemeo mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEommmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm SawmomoeHNU EzwmomoefiNU EswUOQoeHHU EsfiUoQoewflb EnwmoQoeHHU Ezflbomoewab Ezwonoewwo EzwboaoeHHU Sawmomoeflw0 Ezwzumsflmowa .Hm> wmeaoun 4 wmeEOMQ Ezwmomoewab 222 EQQQQNE ©23m222 newecmuem m. wmemsmm moewu4 67 Homa2 Homa2 Homa2 HomH2 Homa2 Homfi2 Homa2 HomH2 HomH2 Homa2 Homfi2 Homfi2 Homfi2 Homa2 Homa2 Homa2 Homa2 Homfi2 Homa2 homa2 Homa2 Homa2 Homfi2 Homfi2 Homfi2 HomH2 Homa2 Homa2 HomH2 Homa2 Homa2 ° 0 '00 '00000 0000000000000000000000000000000 ........u..2.wu|.....uuwu.ou.u..wu...n. ......u.4....ouu.....uuou.ou.o..wu...ue ........u....wou.....uuou.wu.u..wu4..ue ......u.4....won.....uowu.wu.u..uu...ue ....... ..u.4....wou.....uooo.ou.o..wu...ue ......u.4....wu-....Ha.wo.ou.o..wu...ue .o......u.....z:.....nuw9.uo.o..ou...4. .o....ouu....wunn....:4wu.wu.u..wo...u. .u....uuo....oouu....umn mEommmm o mwwwmzm mEommmm m mNHHmzm mEommmm 4 mfiafisz mEommmm m mmUHOHumwzQ mEommmm Q mmmwowomwsm mEomUmm 0 mmmwoflumwzm mEombmm m mmmwofiomazm mEomUmm 4 mmUNOHOmwzQ mEomUmm muHMmQHQ mEomUmm meflhqu mEommmm mumUHHQ mEomUmm m HMmemQ mEomUmm 4 wumEHmQ mEomUmm «HeomflumNQo 2282qu D 22222 2222282222 4 meme mEombmm 68 Homfi2 Homa2 Homa2 Homfi2 Homa2 Homfi2 HomH2 Homfi2 000000000000 °4v4 1.0. .I.0B4. .I.........I0.0B... .no.oeu.. .no.ueo.. .u4.uau.. .uu.ueu.. .I0.090.0.... II0.000.. II0.000.. .I0.0H0.. .10.090.. .I0.090.. .10.090.. .I0.090.. .I0.050.. .10.090.. .10.0H0.. .I..090.. .I0.090.. .I0.0HU.0.H.. 00000004400449000000H0090I040900009190948080000000 00 00000000 .I040.0090..00.%.I. .I040.00H0..00...I. .I040.00HU..00...I. .I000.00.0..00...I. .I000.00.0..0044.IH .I000.00.0..00...IB .I000.00.0..00...I. .I000.00.0..00...I. m mumumou mEommmm 4 mumumou mEommmm mumwoflwwu mEomUmm mumHSUHQm mEommmm mmmwoewum mEomUmm mHeOum Ezflmomoewwo mHHOMH>mHQ Ezflboeoewwb HHmEHmQ Eswbomoeflwb EzemUmeE EzwmoQoeHHU EzEmumouomE Ezwboqoewwb EzuoweOuewe EswmoQoeHNU m Humbemu EzwmoQoefiwb m flumwmemeu Ezwboqoeflwo 4 Numwbemeu EzwmomoeHHD Ezwzomzflm04HQ .Hm> Hmezoan EzwmoQoeHHU 4 wmezoun EnwmoQoeflwb muzmufle mflqflcemNm mflmem>um moewu4 mHHomeezqu meuemz meweowummE msexeg m msumflflwu eonomoem m msumwzmem eOUOerm 4 msumwzoem eonomoem m @CvaCN.‘ EnuHeHomHHmu EzEmeuemeuxm m m20424u204 m2224202402 4 mHonHerw mauewEQwNSQ 2 222222222 2 22222222222222 mCuewEOHNOm 69 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 moom2 Hoom2 Hoom2 Hoom2 Hoom2 moom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 moom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 00 00044000 '4444000000 '414 4'4 .I..0H0. .I..0H0. .0I0.080. .I4.090. .I4.090. .I4.080. .I0.000. .I0.000. .I0.000. .I0.000. .00.000. .I0.090. .I0.0HU. .I0.090. .I0.080. .I0.080. .I0.0H0. .I0.0HU. .I0.080. .10.050. .I0.050. .10.0H0. .10.090. .I0.080. .I0.0H0. .10.UB0. .I0.080. .I0.090. .I0.0B0. .0I0.050. .010.090. .4. .4. mHHOMHHmE mwm%NOHQOm4 mHHoMNMmE mfluxmoummmmm Hweoeoum>mn u mHNHmze m mHHHmse 4 m444mze mmUHonmazQ mmUHmemwzQ mmUHOflumsz mmmwowomst mmUflOHmmwzQ muwquHQ meflhqu mumuflHQ m HMmENmQ 4CDUQLIJ 4 HHmEHmQ. mwwowwumano m meme 4 meme memueoE @440E m mflmmE 4 mHUmE m memweomemE 4 memweomemE mmesuzw 44:02mccoh meew>nw m MN mnHQmwa 4 Hwbeosszhm mEomUmm mEomUmm mEomUmm mEommmm mEomUm4 mEommmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEombmm mEommmm mEomUmm mEombmm mEommmm mEomUmm mEomUmm mEommmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomWflm 222222222222 mEomUm4 70 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 HomN2 Homm2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 moom2 Hoom2 Hoom2 Hoom2 ..0.. ..00. ..0....I0. .0I0... .010... .BU00.. .9000.. .0I00.. .0I000. .09. ..0I00...........0. 00H4000I500000IHHB0004400444404444004400000H440000 0 '00000000000 E4 0 E-4 000 0 00000000000000000000 ..0. ..0. ....:o.oeo.. ....uo.uam.. ....|o.ueo.. ....|o.oeo.. ....uu.oeu.. ....uo.ueu.. ....nu.oeu.. ....uo.oeo.. ....uu.oeo.. .I0.0B0.. ..H.10.0H0.. ....|u.ueu.. ....uu.ueu.. ....uo.ueo.. ....uo.ouo.. ....:u.ueo.. ....uu.ueo.. ....:u.uou.. ....so.ueu.. .I0.080.. .0.. m flamwmemeu EzwbomoeHHD 4 Hnmwmemeo EsonQOeHNU E:~zum:HmOHwQ .um> Hmezoun Ezflbomoewao 4 flmezoun Ezflonoewwb muzmuwa mflaflcemNm mwmem>um moewo4 mwwowwmezuoh meuemE mefleowummE mzsxeh m mzumwaflo eomomoem m mzumflzoem eOUOboem 4 mnumfizmem eOUOerm EzuHeMOMHNmU Ezsmeuemeoxm m muoaeflmQOH mcucwsoHNOm 2 m20424o204 «2224204404 0 memoefl meueHEOHHOQ m memoefl meueflEoHfiom 4 memuefl meueHEOwwom mufluwumemm meueHEOHwom xfluuoesneoo meueflEOHHom 0 muemEmumzn meueHEofiwom m muemEmusz meueHEoflwom 4 muemEmumzn meueHEonom mmbfloeww m-mbhme02 mwwowmmeuems mUMmeoE mmowzumww mbumeoz mumwzaumem mwosmoaqugq 2: mbwuwe 2 2222222222 mwoxwonmammm 71 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 momm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 momm2 Homm2 HomN2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 ..0.. .00.. .00.. ..0.. mewhqu mumoHHQ m HumEHmQ 4 HHmEHmQ mwwowwumwno m meme 4 meme memueoE maon m mHUmE 4 mwmmE m memfieomemE 4 memweomemE mbezuzh 22:02mcaom Hflocfl>afl mnwemfls m meeoEE:MU 4 HabeoEssum m mumumoo 4 mumumou mumaoflwflu. mummzuwmm mmmfloewom mEommmm mEomUmm mEommmm mEommmm mEommmm mEomUmm mEommmm mEomUmm mEommmm mEomUmm mEomUmm mEommmm mEomUmm mEommmm mEommmm mEomUmm mEomUmm mEomUmm mEommmm mEommmm mEombmm mEommmm mEomUmm mEomUmm mHeOHm Ezflmomoeflwb mHHOMH>mHQ Eswboaoewwo HMmEHmQ Ezwmouoeflao Ezemoflxmfi EzwonoeHHU EzfimumOMomE Enabouoeawb EzhoweOMQNQS m Hawucmo czfiboqocg 72 momm2 Homm2 Homm2 Homm2 Homm2 Homm2 HomN2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 momm2 Homm2 Homm2 Homm2 20mm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 flomN2 Homm2 flomm2 fiomm2 momm2 Homm2 .m..l0....0l00..m. ..I0....0I00.... ..I0....0I00.... ..I0....0I00..4. ..uu....euou. ..uo....wnoo. ..no....ouuu. ..uu....wu.u. ..I0....0I000. ..I0....0I0.. ..uu....wuouu. ..uu....wuuou. ..uo....onouo. ..uu....wuuuu. ..ou....wuou. ..00....wuuu. ..uu....wluu. ..uo....wuuu. ..uo....4uuo. ..uu..4.wuuu. ..uo..4.ouou. ..uu....wuou. ..uu....wuou. ..Iue....uou. ..uu....wuuu. ..uu....wuou. ..uo....ouuo. ..uu....ouuu. ..Io....wuuu. ..uu....mnuu. ..u.....wnoo. .00. B00. .00. m msumfizmem eomomoem 4 magmazuem eonomoem Ezufleuowwwmu Ezsmeuemeuxm m m20422o204 maucfisoflaoe m m20424u204 maucflsoHaom 0 memuefl meueHEoH404 m memuew meueHEoflwom 4 memoew meueHEowwom mowufiumcmm maucflsoflwom xfluuoesmeoo mepeHEOHHom 0 muemEmumzn meueHEOHHom m muemEmusz meueHEoHfiom 4 muemEmumsa meueHEowwom mmbfloeflw mwfimbumeoE mHNOMmmeuemE mmumeoz mmofizumflm mUHmeoZ mumwzequm mwmxmoqummm eomomoeu mHGXNOMQOmm mbwuwe mwdkmoummmmm m mHHOMHHmE mHQXNOHQOmm 4 mHHOMNHmE mwo%NOHQOm4 Hweoewum>mu mEomUmm U mwwwmzq mEommmm m mawwmzm mEommmm 4 maqwsz mEomUmm m mmbwowmmst mEombmm Q mmbfloflomwzQ mEommmm 0 mmbwowmmwzm mEombmm m mmUHOHDmHSQ mEowUmm 4 wmb .~.O Nam ng m2HHwQHQ 73 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 floom2 moom2 floom2 Hoom2 Hoom2 Hoom2 Hoom2 floom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Homm2 ....uuu|.....uuw..... . . .I... . .... ........... ....uuuu.....nu..4... . . .u... . .... ....z...... ...4nuun.....uu...... . . .u... . .... ........... ...4nuuu.....nu...... . . .u... . ...e ........... ...4uunn.....ul...... . . .u... . .... ........... ...ufl _ mmflemwe m HHerEEzMU 4 HwbeoEEzum m mumumoo 4 mumumou mumwoflwflo mum430HQm mmmwoeflum mEombmm mEommmm mEommmm mEommmm mEombmm mEommmm mEomUmm mEombmm mEombmm mEomUmm mEommmm mEommmm mweOum EzwmomoeHNU mflwoww>mun EzwonoeHNU HHmEHmQ EzwmoQoeflwo EzemwamE Eswmomoewwb EzEmumOMomE EnwmoQoeHNU 5:20He02ewe Ezwbomoewwb m flammemm Eswmomoeflmb m Humwmemeu Ezflmomoewwo 4 Humamemeu ESHUQQoeHNU EswsomzwmonQ .Hm> flmezong ESflmomoewwb 4 HmeEOHQ EzwmoQoeHHU munmuwe mHHHeQmNm mwmem>um moewo4 mflwowflmezuou meuemz meweUflummE mzfixeh mm: #wflfiwu eoboboee 74 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 moom2 Hoom2 Hoom2 Hoom2 Hoomu Hoom2 Hoom2 Hoom2 moom2 moom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 ow<3(Dcfinpnoc)c>wt3c3L9L923¢>0<3<3L9L9L929¢>o otwto<5c5<5c5(5L5L5L52§25u)olazyL5L92323c>wtacacpnouauac>d ooooE—IooooooE—IE‘E—IHE—d E—‘E‘E—IE—‘IE—IE'IE'IE‘IE—IE—IBHHHE—IBHE—IE—IHHHBHE—IBE—IBBHE—I I U) 0E-*E|000000000000000000000H000000 0000000000000000000000000000000 4 E—4 0000000000000000000000000000000 00. 4 muemEmumsn meueHEOHHOQ mmbwoeww mwwmmumeoz mflaowmmeuemE mmumeoz mmo~zumflm mbumeoz mumazaqum eomomoeu mmwuwe m mNHOMHMmE 4 mHNOMflMmE 4410th Hfleoaohmbmh 0 mwfiwmzm m m44wmze 4 m44flmze mmmwoflmmst mmbwoflumwsm mmnonumwzQ mmUHOHUmNSQ mmmwowomwzQ, muwanwQ m 4 meflhqu mumoflHQ HHmEHmQ HHmEHmQ mHHOMHHmHQO 4 meme 4 meme memueoE mflaofi m mHUmE 2 .222 m acmflCOUcmS mHUANOMQOmm mwmxmoquWmm mfloxmoummmwm mwoxmoummmmm mfloxNOMQOmm mEommmm mEomUmm mEommmm mEomUmm mEombmm mEomUmm mEomUmm mEommmm mEommmm mEommmm mEomUmm mEomUmm mEommmm mEommmm mEommmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm 222222 75 Homm2 momm2 Homm2 Homm2 Homm2 momm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 O 004404408400540008080000H09484000440000H0904004444 .4I444. .4I444. .41444. 0000 '000000 0000000000000 HE—iE-‘IE-dEIE-‘E-‘EHE—I FIE-+54 0 00000000090 00000000000 0000000000000 0 mHeOHm mwwokwbmufl HHmEHmQ EzemUHXmE EzEmumOMUmE E320He02ewe m Humbemu m flhmwbemeu 4 Hnmflbemeo EzwonoewH0 Ezflmomoewwu EswonoeHHU Ezflmomoewwo Ezwmomoewwb Ezflmoqoewab EzwonoeH~0 EswmoQoeHHU Ezwboqoewab EzwsumzmeHflQ .Mmb Hmeaoun 4 Hmekoun EzfimoQoeHNU Ezwmomoewwb musmuwc mfl4wcem44 mwmem>um moewo4 mHHOMHUeSuOM meuemz mewnowumms szxfih m mzumwwflo eomomoem m mzumwzbem eonomoem 4 mzumazoem eonomoem EzUHeMOMHHmU EzEmeuemeoxm m mHOHMHOeOH 4 mMOHMHOeoH 0 memoew m memoefl 4 memuefl mowuwumemb xflegoesneoo 0 muemEmume . £23222 mcucflsoflwom «2524204404 meueHEOHwom meueflEowwom maucflsoflaom maucflsoflaom meueHEoflHom mauc~E©~ o4 GCHCHEOWNOQ 76 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 400on m 4 mHNHm3Q mmmwowomwsm mmUflOHomst mmUHOHomwzm mmmwoflmmwzQ mmUHonmwzm m 4 muwquHQ mewnumu mumUHwQ HHmEHmQ HMmEHmQ mflHOMHumaao m meme 4 meme memueoE mHHoE m mHUmE 4 mHUmE memHeOUemE 4 memweomemE mmezosh HweOUmeeON Hflmcfl>ufl mnflemflc meeoEEDHU HHUeOEEzuU m 4 mumumou mumumou mumaoflawo mumNSQNQQ meHOCflUm mEomUmm mEommmm mEombmm mEomUmm mEommmm mEommmm mEommmm mEommmm mEombmm mEomUmm mEomUmm mEommmm mEommmm mEombmm mEommmm mEomUmm mEommmm mEommmm mEommmm mEommmm mEommmm mEomUmm mEommmm mEommmm mEommmm mEommmm mEommmm mEomUmm mEomhmm 22222 222 UEOWUQNN 77 40042 40042 40042 O O O O O I O O O O C O O O O O O O C C C O I O O O O O C O O O C O C O C 0 C C C O C O C O 0 O C C 40042 4009400440H0000B440400HH440HOBO0BBU4B4000B4440004H Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 40mm2 Homm2 MommH Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 Homm2 muzmafla m44flaem44 mHmem>Mm moeflo4 mHHOMwmezuou meuemz meweoflummE szxag m mzumwwwo eouomoem m mnumwzuem eomonoem 4 mzumflzoem echonoem Ezofleuomflwmu EzEmeuemeUAN m 4204245204 44224204404 4 mHQHMHu:04 mcucfisoHHOm U memoew meuewfiowaom m memoew meueflEowwom 4 memoew meueHEOfiwom mUHuHHUemU meueHEOHHom xfluuoesneoo m£ueHEOHHom U muemEmumSQ meueHEowaom m muemEmumzn meuewEowwom 4 muemEmumzn meuewEOH~04 mmmwoeflw mHHmUMmeoZ mflwowmmeuemE mmumeoz mmowzumflm mbumeoz m2m~zequm mHOANOMQOmm eonomoeu mwbkw0~¢Qmmm mmfluwe mHUXNOHQOmm m mHHOMHMmE mHQXNOMQOmm 4 mHHOMHHmE mwmxmoqummm wfleoemum>mh mEomnmm D 22224 £8 D: m mHmezQ ME 78 40042 40042 40042 40042 40042 H0042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 ”0042 H0042 40042 40042 m meme 4 meme memueoE mNHoE m mHUmE 4 mHUmE mEomUmm mEomUmm mEommmm mEomUmm mEomUmm mEomUmm m memfleonemE mEombmm 4 memweomemE mEomUmm mnezuzh mEommmm flHeOHmeaoh mEombmm wflmew>ufl mEomUmm mwamfle mEombmm m HflmeoEEzub mEombmm 4 meeOEEzum mEommmm m mumumou mEommmm 4 mumumoo mEomUmm mumHOHHHU mEommmm mumwsuflmm mEomUmm mmmwoeflom mEomUmm mHeOHm mwfiowfl>mha meEHmQ Ezemowme EzEmumOMUmE 5:20He02ewe m Humbemm m wumwbemeo 4 flumwbemeo EzwmoQoeH40 EzwmomoeNND Ezflmouoefifib EzwbouoeHNU Sawmoaoewfi0 Ezflbomoeflwb Eswmomoeflab ESHUOQOewwb EzwonoeHHD Ezwzomssmoaam .Mm> Hmeaoke 2 emcgoep 2222222322222 225 E: HUOQOCH N0 79 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042. 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 40042 Hoovg 40042 40042 40042 40042 H0042 40042 40042 20042 0 memuew meueHEOHHOm m memuew meueHEOHwom 4 memuefl meueHEOHHOQ mowuwubemb maueHEOwHom xfluuoesfleoo mnueHEoHHom 0 muemEmumsQ maueHEOHfiom m muemEmumzfl meueflEowwom 4 muemEmumsn meueHEOHHOQ mumwzemem eomomoen m mwa©MmeE 4 mHNOMHHmE 4 mIOIDEfl mmmwoeww mwfimmhmeoz QWOflSUWHN mHHOMmmeuemE mbumeoz mUHmeOE mNDXNOHQOmm mHOANOHQOmm mbwuwe mHOXNOMQOmm Hweoeuumbmh u m444mze m ma4flmze 4 m444mse mmnwoflmmwzQ mmUwOHomHDQ mmbwowumazm mmUHOHomsz mmUHONomwzQ muHMmQHQ mewuqu mumoHHQ m HMmEHmQ . .22 m440442m4ao mHOxNOMQOmm mfloxNoqummm mEomUmm mEomUmm mEomUmm mEommmm mEomUmm mEomUmm mEommmm mEomUmm mEomUmm mEommmm mEommmm mEomUmm mEomwmm 2222222 222 80 Hom42 Hom42 Hom42 Homv2 Homv2 Homv2 Homv2 Homv2 aom42 Homv2 Homv2 flomv2 Homv2 Hom42 Homv2 Homv2 Homv2 fiom42 Hom42 Homv2 fiomv2 Hom42 40042 40042 40042 40042 40042 40042 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I ...0.........H.....0.............................. 090900400004000004HH400044000000089044000440899090 m HflmeoEEzum mEombmm 4 wwbeoEEzub mEommmm m mumumou mEommmm 4 mumumoo mEomUmm mumaoHku mEomUmm mummsume mEombmm mmmwoeflum mEomUmm mHeOHm Ezwbomoewab mwaomflbmun Ezwmouoewflb HHmEHmQ EzwonoeHHU Ezemowme Sawmoqoewwu EzEmumOMomE Ezflboqoewwb EzuoweOHewc Eswbomoewab m flHmUemu EzwmoQoewao m wumwmemeo EzwnoQoewwb 4 Hnmwbemeo Ezwbouoewwb Ezasumzwmowa .Mmb “meEOMQ Ezwbomoewab 4 Hmezoufl SawmoQoeHHU muzmeflc mflaflaemHm mwmembum moeflu4 mHHOMerzuou meuemz meweowummE msEAeE m mzumwaflo eomomoem m mzumwzmem eononoem 4 mzumwzmem eonouoem EnuHeuowwwmo Ezsmeuemeuxm m muoflmHonN meuewEofifiom 4 m20~wwo20~ maucflsowwom 81 Homv2 Homv2 mom42 Homv2 mom42 Homv2 Hom42 Homv2 Homv2 Homv2 Homv2 Hom42 Homv2 Homv2 Homv2 Homv2 Homv2 Homv2 Homv2 Homv2 Homv2 Hom42 Hom42 Homv2 Hom42 Hom42 Hom42 Homv2 Homv2 Hom42 Hom42 C m 44 4 mw 4CQUQLIJ Oboeoee mHQXNoeQOmm mbwufle mwmxmoemmmmm HOMHHmE mfluxwoeQOmm HOMHMmE mfloxmoqummm Hweoeuum>mh u mHNHmze m m-wmze 4 4444mse mmmwowmmwzm mmUflOflomazm mmUHoHomwzm mmUHoHomHzQ mmbwowomwzm muHMmQflQ mewuqu mumuH4Q m HHmEHmQ 4 HumEHmQ mflwowwumano m meme 4 meme memueos mNHoE m mwmmE 4 mwmmE m memHeOUemE 4 memfleomemE mbezozh HHeOHmee0h Hwbew>ew manmwn mEomUmm mEommmm mEommmm mEombmm mEommmm mEombmm mEomUmm mEommmm mEommmm mEombmm mEomUmm mEommmm mEomUmm mEomUmm mEommmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEommmm mEommmm mEomUmm mEomUmm msombmm Meowbwm 82 Hoom2 ”oom2 Hoom2 Hoom2 Hoom2 Hoom2 moom2 Hoom2 Hoom2 Hoom2 Hom42 Hom42 Hom42 Hom42 Hom42 Hom42 Hom42 Hom42 fiom42 Homv2 Hom42 Homv2 Hom42 Hom42 Hom42 Hom42 Hom42 mom42 nune.oo.. Inue.uw.. nune.uo.. :uue.uw.. nun..u4.. unlwwuw.. uuueuew.. uluo.om.. .04.. .04.. .049. .049. .044. .044. .4... ..4.. III0.04.....II....4......II.. III440900000II00UHH000000II0080000H400040H00000H00 ...0. ...0. ...0. Ezwonoeflwb Ezwonoewwb m Humwbemeu EswmoQoeHHU 4 Hemamemeo Euflboeoewwo Sufisomzflmoaflq .em> wmezoen Ezwmoeoefiww 4 Hmezoen Ezweoedewab muameflc m444cemfim mwmembhm moewo4 mfiaowflmesuou meuemz meweoflummE szer E5204e02ewe m flemnemo m mzumwwflu eonomoem m mzumazmem eoUOerm 4 mzumaaoem eOUOerm Esoweeomflfimo EDEmeuemeoxm m meoaeflo204 maucflsoflaom 4 muoweflo:04 44524504404 0 memuew meuewE04404 m memoew meueHEOHaom 4 memuew meue4E04404 mofluflumemm meueflEOwfiom xfleuoesmeoo meueHEoHHom u muemEmusz meueHEOHwom m muemEmumse meuewEowaom 4 muemEmumse meueHEOHHOm mmmwoeww mmfimmemeOE mHNOMmmeuemE mnemeoz mmOHsumHMmUHmCO 333224 32482282“ 83 200m2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 moom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 moom2 200m2 Hoom2 Hoom2 Hoom2 Hoom2 Hoom2 .oom2 111909... 1119.00.. 1119900.. 1119900.. 1119900.. 1119900.. 1119900.. 111994... 1119940.. 11199004. 1119940.. 1110000.. 1110000.. 1119.00.. 1110.00.. 1119.00.. 1119900.. 11199004. 1119.00.. 111900... 111900... 1119900.. 1119900.., 1119900.. 111900... 111900... 9009900.. 9009000.. 1119.00.. 1119.00.. 1119.00.. 4 mmUHOHumwzQ m 4 muHHmQHQ meflmqu mumuHHQ HHmEHmQ HemEHmQ 44444444444 m meme 4 meme memueoE m-oE m mHUmE 4 44442 m memfleOUemE 4 memfleOUemE mbesozh HHeOumeQON 44444224 4444444 m HwbeosEzhb 4 HwneoEEzeU m 4 mumumoo mumumoo mumNOwHwo mumwzome mmnwoewom mweOum EswonoeHHU mwwomfl>mee EzHUoQoewwu fingHmQ Ezflbomoeflab EzemUHXmE Ezflhoqocfiwp 43442404442 22240404. mEomUmm mEomUmm mEomUmm mEomUmm mEomBmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm mEomme mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEombmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm ~44 ...00.. 9049. ...11..90<9. ...11..90<9. ...11...0... .0... .0... .0... m mzumw 44U comomocm m mzumwzuem eomonoem 4 msumasoem eOU0boe4 m meowmfloeow 4 meoHMwmeofl 0 memuefl m memoew 4 memoew mofluwebemb xfleuocsmeoo 0 muemEmumSQ m muemEmumse 4 muemEmume mmbwoefi mHNOMmme mmOH: mumasequm eOUOBoee mbwufle m mHNOMHMmE 4 mNHOMHHmE flweoeue 0 mNH m mHN 4 mHH mmbfiowu mmbwoflu mmn4040 EQUQLIJ 4.44044443Q EzufleMOMHNmU EsEmeuemeoxm meue4E04404 meue4E04~om meueHEonom meueHEofiwom meuewEOHHom meueHEOHHOQ meu24E04aom meueHEoflwom meue4504404 meueflsowwom 4 mwwmnemeoz uemE mnemeoz umwm mnemeoz mHUENOHQOmm mwuxmoemmmmm m4UXNoeQOmm mHDXNOMQOmm mwoxmoeQOmm m>m4 msombmm Hsz mEomUmm 4msQ mEomUmm Hmsq mEomUmm mHzQ mEomUmm maze mEomUmm mHQQ mEowbmm 85 momma momma Homm_ momma momma momma HommH momma 40mm0 40mmg Homma momma momma Homma HommH momma Hommfi momma HommH momma momma fiommg momma HommH Homma 40mm0 momma Hommg momma Hommg 'UUUUUUUUUUUUUUUUUUUUU '00 I U 0 O O O O O O I O O O O I O O O O O O I O O O O O O O 0 ~44 I O O O O C O O O O O O O O O O O O O O C O O O O O I O O O O O O O O O I O 'BHHHE-‘E-‘HEJE-‘BHHHBE «34444444 I ‘2' 45 °HE-*E-4BHBBE—‘BBBE—‘BE—‘E—‘BHHBBBHHB 0000000000000000000000000 0000000000000000000000000 E—4 4 00000000000000000000000E—1E1 E-1000009000000000000000000 00000000440000000‘300000‘3‘2 000 E-1 4..... ....0......1...9.0....... 00009000900400900009000099404000001000094000000009 «So 4400 .9. ........ ...4. 0000 '00 00012—1 L) m m4UmE mEombmm 4 mflme mEombmm m memHeOUemE mEomUmm 4 memfleonemE mEomUmm mbezozh mEomUmm 44e0umeeow mEomUmm 4H0e4>HH mEombmm mUHQmfle mEombmm m HwbeoEESHU mEombmm 4 HHUeOEEzen mEomUmm m mumumou mEomUmm 4 mumumoo mEomUmm mumwowwwo mEombmm mumwzuflmm mEomUmm mmbwoeflum mEomUmm mHeOQm m44044>men wemENmQ EzemUmeE EzEmumoeumE EzeoweoMeHe m Humbemo m Hemwbemeu 4 Humanemeo EzwnoQoeHHU EzfieoQOeHHU Ezwnomoewao ESHUOQOeHH0 5:4U0Q0e440 Eswnomoeflwb Sawbomoewwb E24U0Q0e440 EzflboaoeHNU EzazumszOHflQ .Mm> Hmezoee 4 Hmeaoee Ezwbomoewwo EswonOeHHU muzm44c m444aem4m mflmem>em moeflo4 m.4404 44:38.4 2: 52 4444040444 434444 86 momma Homma Hommg momma HommH Homma momma HommH Homma momma Hommg mommH Hommg Homma momma momma momma momma Hommg HommH Hommg Hommg momma Homma Homma Homma momma momma momma HommH HommH BEBE-1919451519154 <2 BHHBBBHE—‘HE—‘BBEHHHE—‘BBHE—I 000000000000000000000 000000000 0009' 0000000000000000000000000000000 0000000000000000000000000000000 E1 O O O O O O O I O O O O O O I O O I O O O C O E-‘ 0%0000000000000000000 'KCKC0000000 fl fl. d. «0 <0 «0 ¢. 4. <0 0 O O O O O O O O I 0 O O O 0 O O : d. £0 d. <0 °m4 u m444mze m m444mze < m444mze mmUHOHGmHsQ mmbflowumwzm meHOHmmwzm mmbflowom43Q mmmfloHUmasQ muHMmQHQ mewequ mumUHNQ m HemEHmQ 4 HMmEHmQ mwaomflumweo 4 meme 4 meme memueoE 0:24 mwwowmmeuemE mnemeoz mUemeoz mwmxmoeQOmm mflmxwoeQOmm mwoxmoeQOmm mfloxwoqummm mwoxmoeQOmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEombmm mEomUmm mEomUmm mEombwm mEomUmm mEomUmm mEomUmm mEomUmm msowbmm 87 40000 40000 HOOQH HoooH Hoomg ”coma HOO®H 40000 40000 400mg 40000 40000 40000 Hoomg ”com. Hooma ”coma Hooog mommH momma mommg momma momma Hommg momma momma HommH HommH 0 ...OOOOOUOOCOOOOOOO ...OOOOOOOOOUOIOOOOOOO ' Emil?-1 0000000000000 000 .0.. 09009044040040900009040000000009400109444000009000 E—4 0 44931-1 -4:414 °HHH 0000000000 0000000000 0000000000 0000000000 45 B‘C‘CflHE—‘BBBB 0000000000 E-1 °flimun meEHmQ EzemUmeE EzEmumoeumE EzHOHeOUeHe m flembemo m Humanemeo 4 Hemwbemeo E54U0Q0e440 EzwonoeHNU Ezflnomoewwo Ezflbomoewwb Esflbomoewwb EswnoQoewwb EzflonoeHNU EswonoeHHU Ezwbomoewww Ezwzomswmowa .4m> wmezoee 4 Hmezoee EsflonOeHNU EzwonoeHHU muzm44c m444cem4m mwmem>em moewu4 mHHOMHUesuoe meuemz mewerummE szAeE m mszHNHU eOBOerm m msumazuem eomonoem 4 mzumflzoem eononoem 5:94eeom44m0 EeEmeuemeuxm m mMONMNUeOH 4 meowwwonH U memoew m memuefl 4 memoefl mo4u4encmn meuewEOHHOQ meuewEOHHOm meueHE04Hom meuewEOHaom .4..4E.4494 88 40000 40000 40000 40000 ”coma HoooH 40000 40000 40000 ”coma 40000 40000 40000 Hooou meow. H0000 H0000 Hoooa Hooma 40000 40000 40000 40000 40000 40000 40000 40000 ”coma 40000 40000 40000 '000000000 000000000000000000000 4111301331311 44e0e84m>m4 u m444mse m m444mse m m444mse mmbwowomanm mmUHOHOmwsm mmb404omwze mmbwowumwzQ, mmbfiowmmwzQ muflemQHQ meHMqu mumUHHQ m meENmQ 4 HemENmQ mHHOMHHmNQO m meme 4 meme memueoE @440E m mHUmE 4 mwme memweoeemE memHeOUemE mbezozm 44e0umeeom 44me4>44 mm4em4a HwbeoEEzeb HwbeoEEzeb m mumumou 4 mumumoo mEombmm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEomme mEombmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEombmm mEomUmm mEomnmm mEomUmm mEombmm mEomUmm mEombmm mEomUmm mEombmm mEomUmm mEowbwm 89 momma 00.0..ll...0.0..l..0..0.<0.H.I0................... ESHSUWSHWONHQ .Mm> Hmezoee E24U0Q0e440 momwu 00.0..II...U.U..I..U..U.¢U.H.IO....o.............. < NQCRONQ ESHUOQOCHNU HOmOH UU....Il...H.U..I.......UUm..I.................... MUSWHHC QNHWQQQHQ momma 00....IIU..0.U..I............I.................... WHWQ®>HM WOCHU< HODQH UU....|I...U.U..I.....U.mee HememQ EzemUmeE EmEmumoeumE E3404e00efle m Hemnemo m Hemwbemeu mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm mEomnmm mEomnmm mEombmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEombmm 5:400Q0e440 EzflonoeHHU 5:400Q0e440 8:400Q0e440 EzwonOeHHU Eswbomoeflwb Ezwonoewab E3400Q0e440 4 whmwhemQQ ESEQQQQQNFV 91 Home. HomoH Homog momma 8mm: momma HommH momma Home. Homog 40mm. Home“ Homoa momma Homow HomoH Homwg Home HomoH momma momma HomoH Homwg momwa Homog momma momma momma momwa momma momma 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 00. 0 00000000000000000000 0000000000000000000000000 0 O O O O U 00000000000 4 meofiwwme04 4 mMONMHDeOH 0 memuefl m memUeH 4 memuefl muwuwebeme x4400e39e00 0 muemEmumze m muemEmusz 4 muemEmusz Es0weeowwam0 EzEmeuemeuxm meueHEOHHOQ meue4sowwom meueHEOHHOm meueHEOHHom meueHEOHwom meuewEOHHom meHCHEOHHOm meueHEowwom meueHEOHHom meueHEONHom mmbwoeww mwwmnemeOE mwaowmmeuemE mnemeoz mmowzumww mnemeoz m0m45e0QO mwoxmoeQOmm eOUOere mwoxmoememmm m0404e mHOANOMQOmm m m4~0444m5 mwbkwoeQOmm 4 mflwowHMmE mfloxmoemmmmm 44eoeoem>me mEomUmm 0 m444m3Q mEomUmm m mwwwmsQ mEomUmm 4 mawwsz mEomUmm m 0004040045Q mEomUmm Q mmbflowomazQ mEomUmm 0 0004040043Q mEombmm m mmbwowmmwsq mEombmm 4 mmbflowmmwma mEomUmm muwemQHQ mEomUmm mefluqu mEomUmm 38444 443444 92 40090 40090 40090 40090 HOOPH 4009. ”0090 40090 40090 40090 40090 40090 4009_ ”con. 40090 HOOPH 40090 40090 40090 40090 40090 HOOBH 40090 40090 40090 momma Hommg momma .90..4...00000.04.............H...4111.0.......0.0 .50..4...00000.04.............e...4111.0.......0.0 .90..4.0.00000904......0......B...4111.0.........0 ..0..4...00000.04.................4.11.0.......0.0 ..0..4...00000.04.................4.11.0.......0.0 .90..44..00000.04.............B...4111.0.......0.0 .90..4...00000.04.............e...4111.0.......0.0 .40..4...00000.04.............H...4111.0.......0.0 .90..4...00000.04.................4.11.0.......0.0 ..0..4...00000.44.............B...4111.0.......0.0 .90..4...40000.04.....e...........4111.e.......0.0 ..0..4...00000.04................e4.11.0.......0.. 450..0.0.00000.04.....0.B.........4111.0.........0 .00..4...00000.04.............90..4111.0.........0 .90..4...00000.04.............H...4111.0.........0 .90..4.B.00000.044......0.....e...4111.0.......... .90..4...00000.04.............e...4111.0.........0 .90..4...00000.04.................4111.0.........0 .90..4...00000.04.................4111.0.........0 ..0..4...00000.04.....90......90..411100.0......00 11111111111111111111 ..90......90..411140.0......00 .90..4...0.000.04................94111.0.......0.0 «BOooUoDooU—mvuwofiwfioococo-o.oooooooéllh'ooooooooooomv .90..49..0000..04.................0.1100.........0 00400904499009000009000440004004449409049440000499 00....11...0 0..1.......00...1............0....... 00....11...0.0..1.......00...1............0....... 00....11...0 0..1.......00...1............0....... 44e00mee09 mEomUmm 440e4>44 mEomUmm mbflmmwe mEombmm m wflbeoEEsen mEomUmm 4 HflbeOEEzHU mEomUmm m mumumoo mEomUmm 4 mumumou mEomUmm mumwowfiwo mEomUmm mumfizume mEombmm mmbfloewom mEomUmm m4e00m m4~044>mee HemEHmQ EzemUNXmE EzEmumOHUmE E2404e00ewe m Humbemo m Hemwbemeu 4 Hemweemeu EzwonoeHHU EzwonoeHNU E3400Q0e440 Eswbomoewwb Ezweomoewwb EzHUOQoeHHU E:HUOQOeH~0 Ezwhoqoewfiw Ezwnomoeflwb 824:0m340044Q .em> Hmekoee 4 Hmezoee E3400Q0e440 EBHUoQoewab muzmewe mwsweQmNm mfimem>em woe404 mwaowwbezuoe meuemz me4e040mmE szXeH m m30m4440 embonoem m msumwzuem echoeoem 4 304.20% 200800ch 93 4009_ 4005. 40090 4005. 40000 40050 40090 40050 40050 40050 H009H 40090 ”0090 40090 ~009H 40050 40050 40090 40050 40050 40090 40090 40090 40090 40050 40090 40090 40050 mocha 40050 40090 ..0. ..0. .50. .50. .50. .50. .50. ..0. .50. .50. .50. .50. .50. .50. .50. .50. .50. .90.. .50. .50. .50. .50. .50. .50. .50. .50. .50. .50. .50. .50. .50. .49..00000.04. .49..00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .4. .4. .4. .4. .4. .49..00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .4...00000.04. .49..00000.04. .49..00000.94. .4...00000.04. .49..00000.94. .4...00000.04. .4...00000.04. .4...00000.04. .4 ...00000.04. .4.m.00000.04. ..00000.044. ..00000.044. ..00000.044. ..00000.044. ..00000.044. 'BBBHBHBEHBBBBBBBBE E-IE-iE"1 .4.1100. .4.1100. .411.40. .4111.0. .4111.0. .4111.0. .4111.0. .4.11.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4---.0. .411140. .4111.0.. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .4111.0. .411140. '00000 '000000000 '00000000000 010<3L9L9030>010to(9L9030101013(3L505030>0151315L50501015 mumwzequm echoeoee m mHHOMHHmE 4 meOMHHmE 41111000 mmofiz0mwm mm404e Hweoeoem>me 0 mwwwmzm m m444mze 4 m444mze 0004040043Q mmUHOHomwzQ mmUNOHumwzQ mmbwowomazm mmbwoflomwzm muwemQHQ me440mQ m0m04~Q m HememQ 4 wemEHmQ m440440m~e0 4 meme 4 meme memueoE mwaoE m mHUmE 4 mHUmE m memweonemE 4 memHeOUemE mhcsosn mwaommmeuemE.mUeme02 mnemeoz 040%N040Q004 mwoxmoeQOmm mwmxmoemamwm mwuxwoeQOmm mfloxmoemqmmm mEomUmm mEomUmm mEomUmm mEombmm mEomme mEomUmm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEombmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEQ&Q&q 94 Homwa 190000049940000004090040000400 1111111 00.... ....... HememQ EswnoQOewHU Homba 190000049940000004090040000400 1111111 00........... Ezemofiwa ESHUOQOewHU Homha 190000049940000004090040000400 1111111 00........... EsEmumOHUmE ESHUOQOCNHD _om40 150000045540000004050040000400 1111111 00........... 50404200240 5:400e02440 Homna 11111111111111111 4050040000400 1111111 00........... m wembemo E0400Q0e440 Hombg 190000049940000004090040000400 1111111 00........... m flHmHUemeU EefibOQoeHHO Homba 1111111111111 00004050040000400 1111111 00........... 4 wemmnemeu Ezflnomoe440 Hombfl 190000049940000004090040000400 1111111 00........... EswzumszOHHQ .Hm> Hmeaoee Ezwbouoe4~0 Hom50 11111111111111111111111111111111111111111111111111 4 40e304e 5:400Qoe440 Hom50 111111111111111111111111111111111111111 ........... muzmMHe m444eQmam HombH 190000049940000004090040000400 1111111 00........... mwmem>5m woeH04 Hom50 111111w 11111111111111111111111111111111 ........... m44054ne0004 meuemE 40050 111111111111111111111111111111111111111 04005500405 mc4e04umme 005445 HOOPH .HU..¢...UUUUU.<¢...........0..H....¢III.U.........U m WSUWHNHU COUOUOQWN HOOK; ..HU..<...UUUUU.¢¢.............H...4|ll.U.......o.m0 m WDUQNSUQQ COUOUOCM HOOFH— .HU..¢H..UUUUU.<¢.. ...... ......H...<||I.U.........m0 < WDMQNDUCW COUOUOQm HOOPH .BU...<...UUUUU.U¢.................44 0040040 0 44erEEzen 4 HwbeoEEzeb m mumumoo 4 m0m0000 mumaoflwwo m0m4304Qm mmUHOeHUm 411300 mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomnmm mEombwm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomnmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm m4e00m E3400Q0e440 m440440044 E2540QQQ~FM 96 momma HomNH momha Momba flom90 flomPH Hom0_ momma Hommg Homha Hemp“ Hom5_ momma Hommg Hombu mom9H Hom9H Homhg momma Hom50 fiomba Homba 40050 homba momma Hom50 Homnw 3E ............................. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII DU. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000040940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00 ..... 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 190000049940000004090040000400 1111111 00. 0440440 mefleu m 0:0m4 e00oe me0e02 HummE szxe5 440 00000004 0 mzumwsoem eouonoem 4 mzumwzoem eOUOerm EzoweeomHamo EzEmeuemeUAM m mHOHMHDeOH 4 mHONMHQeO~ 0 memuefl m memoew 4 memoew m0fluflenemb x4400e59000 0 muemEmumse m muemEmusz 4 muemEmumBQ mmbwoefl mwaowmme mmOHD m0m40e0QO eononoee mnwuwe m mwwomflemfi 4 mNHOMHHmE HHeoeoe 0 mHN m mNH 4 mam 0 0004040 meuewEOHHom meueHEowwom me0e4804404 me0e4E04404 me0e4E04404 meue4E04404 mnuC4EO4aom me0e4504404 meue4E04404 me0e4E04404 4 mfiwmwemeoz 0emE mnemeoz 0044 mnemeoz mwuxmoeQOmm mfluxmoemammm mwuxwoeQOmm mfloxmoememm 040%N040Q004 m>04 mEomUmm Hmsm mEombmm wmnm mEombmm Hmzm mEomUmm 0440. 2003 97 ”@550 11111111111111111111111111111 .0550 1111111111 4544054540044555040 40550 11111111111111111111111111111 40550 11111111111111 054540044555040 40550 11111111111111 054540044555040 40550 1111111111111111 4540044555040 40550 11111111111111 054540044555040 40550 111111111111111 54540044555040 40550 1111111111 4544054540044555040 40550 1111111111 4544054540044555040 .0550 40040000144544054540044555040 40550 11111111111111 054540044555040 40550 111111 00144544054540044555040 40550 11111111111 544054540044555040 40550 11111111111111 054540044555040 40550 1111111111111 4054540044555040 40550 11111111111111 054540044555040 40550 11111111111111111111111111111 40550 1111111111111 4054540044555040 _m550 11111111111111 054540044555040 40550 11111111111111 054540044555040 _m550 1111111111111 4054540044555040 00550 11111111111111 054540044555040 .0550 11111111111111111111111111111 00550 11111111111 544054540044555040 40550 11111111111111111111111111111 40550 11111111111 544054540044555040 40550 11111111111111111111111111111 .0550 11111111111111111111111111111 40550 111111 00444544054540044555040 mem0e0E 0440E m mHUmE 4 m4me 0 memweOUemE 4 memHeOUemE mbezuzm 44e00mee0h 44004044 004e044 m 440eoEEzeU 4 wwbeoEEseb m mumumoo 4 m0m0000 m0m404440 mumazoflQm mmbwoeHUm mEomUmm mEombmm mEombmm mEomUmm mEombmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEombmm mEomwmm mEombwm mEomUmm mEombmm mEombmm mEomUmm m4e00m E0400Q0e4~0 m44054>0ee E0400Q0e440 440E4mQ E0400Q0e440 Esemuwme E0400Q0e440 E0E000040mE E3400Q0e4~0 Ezeofle00e4e E0400Q0e440 m 4embem0 E0400Q0e440 m Hemabemeu E0400Q0e4~0 4 440~Ueme0 E0400Q0e440 E0~000040044Q .4m> wmezoee E0400Q0e440 4 40:304Q EszoQ0e440 0000444 044400044 04020044 002404 4 98 ”mung 2055a Horne Hm55_ morn“ fimhba hombw 20550 Hm55~ Hanna 20550 Hanna 40550 50550 Hanna ”mph“ 2055_ ”@550 20550 ”mung Hanna .0550 2055a mmbha Hmbna 20550 ambba fimbha Hanna 20550 4055_ Iu140000:44544054540044555040 lllllll 0:44544054540044555040 IIIIIIIIII 4544054540044555040 uuuuuuuuuu 4544054540044555040 uuuuuuuuuuuuuuuuu 5400:4555040 nnnnnnnnnnnnnn 054540044555040 uuuuuuuuuuuu 44054540044555040 IIIIIIIIII 45:4094540044555040 nnnnnnnnnnnnn 4054540044555040 uuuuuuuuuuuuuuuuuuu 0044555040 uuuuuuuuuuuuuu 054540044555040 uuuuuuuuuuuuuu 054540044555040 ......... 44544054540044555040 IIIIIIIIIII 5:4054540044555040 III4UOUUI44H44UH4B4UQ404 0 04440:2 m 0444022 4 0444032 0004040043Q 0004040040Q 0004040040Q 0004040040Q 00040400402 00440Q4Q 024400Q 0000445 2 440540Q 4 440540Q 04404400420 2 0202 4 0202 040240402002 04024040Q002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 0500002 99 0m440 uuuuuuuuuuuuuu 054540044555040 00550 -0040000-44514054540044555040 00540 ............. 4054540044555040 04450 uuuuuuuuuuuuuuuuuuuuuuuuuuuuu 04450 uuuuuuuuuuuuuu 054540044555040 04540 ............ 44054540044555040 04550 ............... 54540044555040 0m440 uuuuuuuuu 544054540044555040 2 00004440 20000022 0 000040020 20000022 4 000040020 20000022 500424054400 505020202022 2 0404540204 4 0404240204 0 020024 2 020024 02024504402 02024504402 02024504402 02024504402 100 Homg 2000 HomH 2000 2000 HomH HomH HomH HomH Homg 2000 Hom_ 2000 2000 00mg 2000 HomH HomH Hom_ Homa 20mg 0000 20mg 20mg 20mg HomH .oooooBo llllllllllllllllllllllllllllllllllllllllll . . . . . .H.4H_HU44400 IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII oooooorfio< IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ooooooBoag lllllllllllllllllllllllllllllllllllllll ......H.4890444008480088UUU4UHB4UOIH44BHU4OUU4BUOU ooooooHo40 002404 044044020004 020202 0242040005 005225 0:50:69 “mm—QOhO—P—U 9.: *0 ..00an “Chum-4:5 USN €0.59: 125% "N 5.50: ¢0C¢300w U¢=D=< 101 HOOHH 20040 20040 20040 20040 20040 2000 2000 2000 20mg 2000 2000 2000 20mg 20m“ 20mg 20mg Home How“ 20mg Homa 20mg 20mg 20mg 20mg HomH 2002 20mg HomH 0544000UH44444H44HH44OOUUUU444U4U4UHHI444UBHHUI44H O 0 40200 50400002440 4 40200 50400002440 .0044442 044442040 04020040 002404 044044020004 020202 0242040005 005225 2 00004440 20000022 4 000040020 20000022 500424044400 505020202022 2 020024 02024504402 4 020024 02024504402 0040440200 02024504402 4 0020500002 02024504402 00040244 0440040202 044040020205 000400044 0040202 0040202 0004020020 040200402002 20000024 040200402002 004042 040240402002 2 044044405 040240402002 2 0444002 4 0444002 2 00040400402 00440242 4 4405402 4 0202 0200205 4 04005 0500002 0500002 0500002 0500002 0500002 0500002 0500002 44 00040 0500002 102 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 2 0444002 0500002 4 0444002 0500002 0 00040400402 0500002 00440242 0500002 4 4405402 0500002 4 0202 0500002 0200205 0500002 44 00040 4 04005 0500002 4 0204200205 0500002 0020000 0500002 4420002204 0500002 44024044 0500002 044044200022 0500002 0042042 0500002 000404440 0500002 4 00040 000402400 0500002 0004000554 0402040042 042000 0440440042 0202500040 4405402 502004405 50500004005 2 4400200 4 4400200 0 440402020 50400202440 50400202440 50400002440 50400202440 50400202440 50400202440 50400202440 50400202440 50400202440 5040000400442 .40> 4020042 4 4022042 50400202440 50400202449 103 HomHH 20040 HomHH Hom4_ 20020 20040 HomHH Homaa HomHH 20040 Hom4_ HomHH HomHH HomHH HOOHH 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 20040 HOOHH 4440999.. 4440999.. 4440999.. 4440999.. 4440999.. 4440999.. 4440999.. 4440999.. 4440999.. 4440099.. 4440999.. 4440999.. 4440999..... IIIIIII 004440:InInIII:II44440909999090094440004090 E—‘HBE—‘HHB °HBEB ....0............... 4405402 502004205 50500004005 2 4400200 50400202440 50400202440 50400202440 50400202440 4 4400200 50400202440 2 440402020 50400202440 5040000400442 .40> 4022042 50400202440 4 4022042 50400202440 2 40200 50400002440 4 40200 50400002440 0020242 044222040 04020040 002404 044044020004 020202 0242040005 005224 2 00004440 20000022 4 000040020 20000022 500424024400 505020202020 2 020024 02024504400 4 020024 02024504402 0040440200 02024504402 4 0020500002 02024504402 00040244 0440040202 044020020205 0040202 000400044 0040202 0004020020 040200402002 20000024 040200402002 004042 040200402002 2 044024405 040200402002 104 105 Hom40 4440999...... IIIIIIIIIII ....9..................... 0040440200 02024504402 HOMHH— «gUHHn—u.....o llllll igH....B........o............ 4 QHCQEMUWSQ QCHCHEOflNOQ HomHH 4440999...... IIIIIIIIIII ....9..................... 00240244 2440242202 HomHH 4440999...... IIIIIIIIIII ....9..................... 244042220225 2242202 HomHH 4440999...... IIIIIIIIIII ....9..................... 200400244 2242202 Hom40 4440999...... IIIIIIIIIII ....9..................... 0004020020 040200402002 Hom4_ 4440999...... IIIIIIIIIII ....9..................... 20000024 040200402002 momHH— «@EUHHH...... IIIIIIIIIII ...orH...................... QUHUH: WmefiNOngmwm Hom40 4440999...... IIIIIIIIIII ....9..................... 2 044044405 040200402002 Hom4. 4440499...... lllllllllll .. IIIIIIIII ............... 0 0444002 0500002 HODHH EUHHH...... lllllllllll ...oH...................... flmflHHWDQMEOQUQm HomHH gfiUHHB...... lllllllllll .....H..................... mmmnflOflmmfifiQ QEO®U®44 HODHH— g4UBHB...... lllllllllll .....H..................... MMHHmfiwfiQmEOQUmm HomHH 44 2500222 HODHH <¢¢UHHH...... lllllllllll ...ofi..........L.......... WHNONHQOmeg QEOQUmm HomHH <44U999...... IIIIIIIIIII ....9..................... 224Q242 2500222 HomHH 4440999...... IIIIIIIIIII ....9..................... 202404440 2502202 HomHH <440999...... IIIIIIIIIII ....9..................... H 22040 HomHH 4440999...... IIIIIIIIIII ....9..................... 202402402 2500222 HomHH 4440999...... IIIIIIIIIII ....9..................... 2024502554 242224204Q HOWHH— EUBfifiooo... lllllllllll .....H..................... mflqoumfisflboqocufiflb Hom40 4440999...... IIIIIIIIIII ....9..................... 0440440042 50400202440 Hom40 4440999...... IIIIIIIIIII ....9..................... 0202500042 50400002440 HQONH ”coma Hooma floomg ”coma HOONH HOONH Hoomg 200mg HOONH moomg HOONH HOONH Hooma HoomH 200mg ”coma HOONH HOONH 200mg ”CONE Hooma 200mg HomHH 20042 Hom42 Hom4H HomHH o ooooooooooooooooooooooooooooooo wD/NIIIMNggmmUUIfimN .004III44444400I444 .004III44444400I444 .004III444444001444 .004III44444400I444 .004III44444400I444 .004III44444400I444 .004III44444400I444. .004III44444400I444 .004III44444400I444 .00411144444400I244 .004III44444400I444 .00444444444400I444 .00444444444400I444 .004III444444001444 .004III444444001444 .004III44444400I444 .004III42444400I444 ..004III444444001444 .004III44444400I444 oooooooooooooooooooooooooooooooo DO¢I lggwolg .004II444444400I444 49099090044004440904040400400444 uuuuuuuuuuuuuuuuuu ”NEUBBB...... lllllllllll .. ¢§UHHH...... lllllllllll . gUHBH...... lllllllllll . §042 53400202440 0202830042 83400202440 4405402 53400202440 532004205 53400202440 53504004005 53400202440 0 4400200 53400202440 4 4400200 53400202440 0 440402020 53400202440 5343003400442 .40> 4022042 53400202440 4 4023042 53400202440 0 40200 53400202440 4 40200 23400202440 0030440 «44402040 04020>40 002404 044044023404 024202 0242044005 035424 0 03004440 20000022 4 034043020 20000022 530424044400 535024202042 0 020024 02424504402 4 020024 02424504402 106 HomNH Hommg Hooma Hoomg MOON“ ”coma HOONH HOONH HOONH HQONH meow“ HOONH HQONH HOQNH HOONH 80$ HOONH 803 303 HQONH Hooma Hooma Hooma 80m. HOONH HOONH ”coma HOONH Hoomw .........D...................U.................... MN mEowbmm 107 HomNH momma HomNH Hommg Hommg momma momma momma HomNH momma momma HomNH Hommg momma momma momma momma momma momma momma Hommg fiomNH momma momNH Hommg Hommg HomNH Hommg Hommg Homma DUOUOOOUQOOOUUUOU(30000000 000L190 UUUUUUUUUUUUUUUUUUUUU UUUUU .d flMmEHmQ mEombmm d meme mEomUmm mcmuCOE mEomUmm HH msouo m mflUmE mEombmm < mcmHQOUcmE mEomUmm mbczuzh HHCOumccoh HHQQH>MH MHHOMHQOmmx£ mnHQch mum~oH~wU mmbwocwum mEomUmm mEombmm mEomUmm mEombmm mEombmm mEomUmm H msouw mEomUmm mumwzumfifiw muncmnmbflq MHQOum meOMw>mMQ mcwnasooum HNmemQ EzemumeE EzEmumOMumE m Humbcmo 4 Humbcmu m wumwbcmcu ESHUOQOCHNU E2HU0QOCH~U ESHUOQOCHHU EzfiUoroflwb ESHUOQOCHHU EzflonQCflab ESHUOQOCHHU EzflonOCHHU EszOQOCHNU EzazumSHmoHHQ .Mm> Hmczoun < Hmczoha m Hmcmm < ngmm Ezflbomocfiab Eswbomocflwb EsflUOQOCHHU Esflnoaocaau musmuflc mflHHchNm mwmcm>um mocwom 108 Hoomg Hooma ”coma Hoomu Hoomg Hoomg ”coma Hoomg Hoomu HoomH momma momma fiomNH Homma HomNH Hommg momma Hommg Hommu momma aomNH Homma HomNH Homma momma momma momma HomNH B¢B0.. ... ......0. ... .. IIIIIIIIIII H Hmcgoun annouocwwo ¢ quzohfl Eswonocwab m Hmnmm ESHUOQOCHHU m Hmnmm EDHUOQOCHHU musmuflc mfiaflcmmfim mwmcm>nm mocflom MNNOMwbczuou M£ucw2 mcwaowumms msExch m msumwwflo COUOUocm d msumqsocm sononoam ESUHQHOMHNMU EzEmcucmzoxm m mcmocw maucwsoflwom a mzmucw maucflEoflwom wwwuwubcmb maucwEowNom 4 mucmEmumza MSHCHEOHHOm mmUHOCHH wwwmbumcoz mwaowmmcucme mbumeox mmo~sumflw mbumcofi mumwscummm mflmxmoqummm COUOUOQH mwbxwoummmmm Mbwuwc mwoxmoummmmm m mflwowHHmE mfluxmonmmmmm .m mawwmzm mEomUmm « mwawmzm mEomUmm m mmbonmmH3Q mEomUmm MUflMmQHQ mEomUmm 109 Hoomg Hooma ”coma HOOMH ”coma Hooma moomg Hooma Hooma Hoomg ”coma Hoomg Hoomg HoomH Hoomg Hoomg Hoomg _oomH HoomH Hooma Hooma Hoomg Hoomg Hoomg Hoomg ”coma Hooma ”coma Hooma Hooma Hoomg HmeQ mchESUOHQ HemEflmQ Enembflme EzEmumoeomE m Humbemm < meme memueoE ¢ menms m memweOUemE mmesozh HHCOHmccom Hamefl>uw mflHOMHQOmmxe mneemflc mumHOwNHU mWOHnumHm mnemeoz mwoxwoeQOmm mfioxmoemmmmm mHoANOMQOmm mfluxNoeQOmm m mawwsz mEommmm d mmawmzfl mEomUmm m mmbfloflmmwzq muHHmQfiQ 4 HemENmQ mEombmm mEomUmm mEomUmm mEomUmm mEomUmm HH asoeo mEombmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEommmm mEombmm H asouw mmbwoewom mEomUmm mumwsomEEH mebememofle Ezwmomoeflab Ezwbomoewau Esflboaoeflau Ezwbomoewwb Ezwboeoeflab Eswmoeoeflwo Ezflboeoewwb 110 HommH .................... llllllllllllllllllllllllllllll mmbfloewum mEombmm momma .................... IIIIIIIIIIIIIIIII HomemdeHmBUH mumwsomEEH mebememowe momma .................... IIIIIIIIIIIIIIIIIIIIIIIIIIIIII mHeOum EDHUOQoefiHU Hommg ....................H0¢E<¢0BBdEUBBmHQ ESHUOQOCHHU momma .................... IIIIIIIIIIIIIIIIIIIIIIIIIIIIII mewnfieooea Esflbomoeaau Hommg .................... IIIIIIIIIIIIIIIIIIIIIIIIIIIIII HHmENmQ EzwonOeHHU momma .................... IIIIIIIIIIIIIIIIIIIIIIIIIIIIII EzemoHXmE Ezwbomoeflwo momma .................... IIIIIIIIIIIIIIIIIIIIIIIIIIIIII EzEmumoeumE Sufibomoewwo momma .................... IIIIIIIIIIIIIIIIIIIIIIIIIIIIII m Hemmemo Ezwbouoewwb HomMH .................... IIIIIIIIIIIIIIIIIIIIIIIIIIIIII m Hemmemm EswonoeHHU momma .................... IIIIIIIIIIIIIIIIIIIIIIIIIIIIII m HHmHUemeU ESHUOQOeHHD 90mm”— .................... llllllllllllllllllllllllllllll EDHBUWSNWOHHQ ..NMb Hmeaoee EzwonoeHNU Hommg .... . .. llllllllllllllllllllllllllllll < wmeaoee ESflUoQOefiHU Homm_ .... . ..aU¢B<em moeflue HommH .... . .. llllllllllllllllllllllllllllll mwwowflmesuou meuemz momma 09909<ee mHHOMHQOmmxe mneemea mumwowfiflu mEommmm mEomUmm mEomUmm mEommmm mEomUmm mEQmmmm mEomUmm HH asouw mEommmm mEomUmm mEommmm mEommmm mEommmm mEommmm mEommmm mEommm4 H msoeo 112 meow“ Hoova Hoova Hoova Hoovg Hoova Hoova Hooqa Hoova Hoova Hoova Hoova Hoovg Hoovg HoovH HoovH Hoovg Hooqa Hooqa Hoowa meow. Hoovg Hoova Hoovg Hoova Hoova Hoova Hoovg Hoova lllllllll ......... ...........IIIII..............U ......... .....................-I---..............w uuuuuuuuu .....................----u..............o ......... .....................--u-|..............w ......... .....................uuuun..............w uuuuuuuuu .....................uuuuu..............w ......... .....................uuunu..............o uuuuuuuuu .....................:---:..............u ......... .....................n-uln..............w uuuuuuuuu .....................:I---..............o IIIIIIIII ......... ...........|||||.......o......0 uuuuuuuuu .....................-Iluu..............o lllllllll .....................l|l|l..............w lllllllll .....................||||l..............U uuuuuuuuu .....................-uun-..............w uuuuuuuuu .....................----u..............w ......... .....................n----..............w lllllllll ........o............lllll....o.........0 uuuuuuuuu .....................-u-uu..............o ......... .....................--u--..............o uuuuuuuuu .....................u--un...... ..... .m uuuuuuuuu .....................----u..............w lllllllll ....................lllll..............w lllllllll ..........o..........|||l|..............U uuuuuuuuu .....................-----..............w lllllllll .....................|I|Il...........o..w nnnnnnnnn .....................--uuu..............w ......... .....................uuuun..............w uuuuuuuuu 444444w94444w94944eeeuuIIIBHHH4BUB44wouvH HH msouw 4 mHUmE mEommmm 4 memHeOUemE mEombmm mnezozh mEombmm HHeOumeeOM mEomUmm HHueH>HH mEommmm mHHOHHQOmmHe mEommmm mUHQmHe mEomUmm mumHOHHHU mEomUmm H asouw mmUHoeHUm mEomUmm mumHzomEEH munememoHe mHeOMm mHHomwbmeQ memQESUOMQ HemEHmQ EzemonmE EzEmumoeumE m Hemeemu 4 Humbemm m Hemeemeu EszomoeHHo EsHmoQoeHHo ESHUOQOCHHU EszoeoeHHb EszomoeHHb EzwboeoeHHU EzwboqoeHHU ESHUoQoeHHU EzHUoQoeHHU EszUmszoHHQ .Mm> Hmexoee 4 Hmezoue m Hwemm 4 ngmm EszoQOeHHU EszoQoeHHU EDHUOroHHU EDHUOQoeHHU muameec meewcemHm mHmem>um moeflo4 mHHOHHUezuOM meuemE meHeUHummE szAeH 113 Homqw Homvg Homva Hom4_ Homvg Homvg Homva Hoovg HOOVH Hoovg Hooqg Hoovg moova ”0040 ”Dove Hoov_ Hoova HoovH Hoovg Hoovu H0046 Hoova H004“ Hoovw Hoov_ Hoova Hoova Hoovu {—1 LDLDLDLDULDLDLDLDLDLDCDLDLDCDLDLDUULDLD 44044099wo4ueae4eee44wfiweww:0944444009 uuuuuuuuuuuu Hmeaoee 4 Hmezoee m Hmemm 4 404mm muzme mHm mHHOHHU meHeu m mzumH EzHUoQOeHHu ESHUoQoeHHU EsflbomoeHHu ESHUOQoeHHU 44 mNNHaem4m em>em moewm4 ezuoe meuemz HummE szer 440 cononoam 4 mzumHsmem eonouoem EoneMOHHHmU EDEmeuemeuxm m memoeH 4 memuefl mUHuHMUemU 4 muemEmusz mmUHoeH mHHOHmme mmoH: mumHzequm eomomoee mbHuHe m mHHOHHMmE m mHH 4 mHH m mmmfloflm muHe 4 HemEHmQ 4 mem meueHEoHHom meueHEoHHom meueHEoHHom meueHEOHHom H mHHmUemeoz uemE mnemeoz umHH mnemeoz mHDHNOHQOmm mwmxmoemmmmm mHUHNOMQOmm mHQHNOMQOmm Hmzq mEomUmm Hsz mEomUmm mwsq mEOmUmm mQHQ mEomUmm mEomUmm mEomUmm mEommmm meme ueOE 114 Homqg Homvu Hom4_ Homva HomVH Homva HomvH Homva Homvg HomQH Homva Homvg Homvg Homvg Homvg Homva Homva Homvg Homva Homva HomVH HomvH HomvH Homva Homvy Homvg Homvg Homvg Homvg Homva HomvH mUHuHe mHmHNoeQOmm m mHHowHHmE mHuxmoeQOmm m mHHHm3Q mEomUmm 4 mHHHm2Q mEomUmm m mmUHoHumHzQ mEomUmm muHemQHQ mEombwm 4 HMmEHmQ mEomUmm 4 meme mEomUmm memueoE mEombmm HH asouw 4 mHUmE mEommmm 4 memHeOUemE mEommmm mbezuzh mEombmm HHeOumeeOM mEombmm HHDeH>MH mEombmm mHHOHHQOmmAe mEomUmm mbHQmHe mEombmm mumHoHHHo mEommmm H Quouw mmUHoeHum mEombmm mHeOMm mHHOHH>meQ memQEsuouQ HMmEHmQ EzemonmE EzEmumoeomE m Hemmemu 4 Humbemm m HMmHUemeo MMMNDUQEEH MHUQmHmUHQ EanoQoeHHU EzflonoeHHU ESHUOQOCHHU EzHUoQOeHHU ESHUOQOeHHQ EswnoQoeHHU ESHUOQoeHHU EzwonoeHHb EzHquoeHHb EszomzwmoHHQ .em> 115 hf. i5 Hoomg ”coma Hoomu Hoom_ Hoomg Hooma Hooma Hoomg Hooma Hooma ”coma Hooma ”coma HoomH Hooma ”coma HomvH Homvg Homvw Homvg Homqa Homva Homqa HomvH Homva HomvH momva Homvg ..40........ ..40.. ..... . ..404....... ..4w4....... ..404....... ..40........ ..40........ ..40........ ..40........ ..40........ LDLDLDLDLDLDLDLDLD UUUUUUUUU LDLDLDLDLD °UUUU .0..0. UUUUUUUUU UUUUUU HHHHUH404B40UUB44H4UUH0448940?04408409849440494444 mHHOHH>meQ EsHUOQoeHHb memessooem EDHUOQoeHHU HemEHmQ EszoQoeHHo EzemumeE EsHmoQoeHHb EzfimumoeomE EszomoeHHb m Humbemo EszomoeHHU 4 Humbemo EzHUOQOeHHU m HemHUemeQ EzHUOQOeHHw EszomszoHHQ .em> Hmeaoee EszoQoeHHU 4 Hmezoue EsflonoeHHb m Hmewm ESHUOQoeHHU 4 Hmnmm EDHUOQoeHHU musmufla mflaflcemam mHmem>em moeHu4 mHHOHHUezuoe meuemz meHeUHummE szHeH m msumHHHo eOBOUQem 4 mzumHzmem eomomoem EsmHeHOHHHmU Ezsmeuemeuxm m memoefl meueHEoHHom 4 memoew meueHEOHfiom moHuHeUemb meueHEOHHom 4 muemEmumze meueHEOHHom mmbHoeHH mHHwUMmeOE mHHOHmmeuemE mnemeoz mmoHsumHH mnemeoz mumHzequm mflmxmoemammm eomomoee mHDXNOMQOmm 116 HoomH— ..do ..... ...0. Hooma 0o¢w.o0....... ”Dom“ .0MH mEomUmm mHHOHHQOmmHe mEommmm mUHQmHe mEombmm mumHoHHHu mEombmm H asouw mmUHOeHUm mEomUmm mumqumEEH mememembwe mHeOum EszoQoeHHU LDL'JLDLDEDCDUUUUOUUUUOUUUUUUOOUOUULDLDLD UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU O O I O O O I O O O C O C O C O O O O C O C O O O O O O C O O O O 117 HommH Hommu Hommg Homma Homfl Homfl momma 8mm: momma 8mm: 3mm: HommH Homfl momma Homm: Homfl momma 8mm; momma momma momma Homma Homma momma momma Hoomg 802 302 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 4444444444444444 444344444444 ........<......... ........<......... 0H404HUHH400090404840444H4404000000H44HHHHH0440444 ..40 ........... 0.0 ...... 0 ......... .... ............ ..40...........0.0......0......................... ..40...........0.0......0........... .............. HHeOume40h mEomUmm HHOeH>HH mEomemm mHHOHHQommHe mEomUmm mUHQmHe mEomUmm mumHoHHHo mEommmm H Q5040 mmUHoeHum mEomUmm mumHsomEEH mebemMmUHQ mHeoMm EszoQoeHHb mHHOHH>mMQ EzwonoeHHU memeasuoem EDHUOQoeHHU HMmEHmQ EzwmoqoeHHU EzemumeE EzwbomoeHHU EzEmumoeumE ESHUoQoeHHU m Hemmemo EzHUOQoeHHU 4 Hemmemo EszoQOeHHU m HemHUemeu ESHUOQoeHHU EszomszoHHQ .Mmb Hmeaoee EzHUoQoeHHU 4 HmeaoHQ EzwbomoeHHU m Hmewm ESHUOQOCHHU 4 Hmemm ESHUOQOCHHU muzmeHe mHHHeQmHm mwmem>em moewo4 mHHOHHUezuoe meuemz meHeUHummE szer m mzumHHHU e0b0boe4 4 msumquem eononoem EoneMOHHHmU Ezfimeuemeoxm 118 Hoooa HOO©H Hoowa Hoowg momma HommH momma momma Hommg Hommg momma Homma Hommg HommH momma Hommg HommH momma Hommg Homma Hommg momma Homma Momma momma momma momma momma momma 00054444004044904H4HBH4440H44044000004H44084H404H0 muzmefle mHHflcemem mwmem>em moeHu4 mHHOHHUezuoe meuemz meHeoHummE mzsxes m maumHHHU eononoem 4 mzumHzoem eomoeoem EmuHeMOHHHmU E3Emeeemeoxm m memoeH meueHEOHHom 4 memoeH meueHEOHHom mUHuHebemm meueHEOHHom 4 muemEmumze meueHEoHHom mmbfloeHH mHHmUMmeOE mHHOHmmeuemE1mUHme02 mmOHzemHH mmeeoz mumHzequm mwuxwoemammm eomomoee mHoHNoeQOmm mUHuHe WHOANOHQOmm m mHHOHHHmE mHuHNOMQOmm m mHHHsz mEomUmm 4 mHHHmsQ mEomemm m mmUHonmHzQ mEomUmm meHemQHQ mEomUmm 4 HHmEHmQ mEommmm 4 meme mEomUmm memueoE mEommmm HH asoew 4 mHUmE mEomUmm 4 memHeOUemE mEomUmm mnezuzh mEommmm 119 Hoowa Hooma 82:. Hooma Hoooa flooma HoomH Hoooa Hoowa H0006 Hooog Hoowa HoowH moomg ”coma mooog moowg Hoowg Hoomg HOOQH Hooog meow“ ”coma HQO©H Hoowg ”coma Hoooa moowa ”coma Hooma m mmbHoHQmHsQ mEomme muHHmQHQ mEombmm 4 HemEHmQ mEombmm 4 meme mEomUmm memueoE mEomUmm HH asoew 4 mHUmE mEommmm 4 memHeomemE mEommmm mbezuzh mEomUmm HHeOHmee0h mEombmm HHUeH>MH mEomUmm mHHOHHQOWmHe_mEomUmm mUHQmHe mEomUmm mumHOHHHU mEommmm H meoew mmmHoeHUm mEomUmm mumHsumEEH mebememowe mHeOum mHHOHH>mMQ memQESerm HHmEHmQ EzemonmE EzEmumouomE m Humbemu 4 Hembemu m HemHUemeu EswbomoeHHb EzwmoeoeHHb EDHUOQOCHHU EsHUomoeHHb EszoQoeHHu EzflmomoeHHb EanoqoeHHb EzHeroeHHU EswnomoeHHD 53Hzom2HmOHHQ .em> Hmeaoee 4 Hmeaoee m Hwemm 4 Hmemm ESHUOQoeHHU EszouoeHHb EsHanoeHHo EDHUOQoeHHU 120 Hommg Homwg Home“ momma Homog Home“ momma Homwg Home“ Homog Homou Homog Hooo_ Hooog ”coma HoowH Hoowg Hooma Hooma Hoooa Hoooa ”coma Hooou Hoomg HOO®H Hooog Hooog Hoomu 9000444440000H4H0800050440HB00040H00844444HHH04009 EzEmumoeomE m Hemmemm EzHUOQoeHHD EswmomoeHHU 4 Hemnema EszoQOeHHU m Hemeemeo EsHboeoeHHU EszumsHmoHHQ .Mm> Hmeaoee EzHUOQoeHHQ 4 Hmeaer EzHUomoeHHo m Hmemm EDHUOQoeHHU 4 Hmemm EDHUOQOCHHU augmeee 44444Qm4m mHmem>em moeHo4 mHHOHHUezuoe meeemE meHeUHummE mzexeh m maumHHHo eomomoem 4 mzumquem eOU0boe4 EoneMOHHHmu EzEmeuemeuxm m memueH meueHEOHHOm 4 memueH meueHEOHHom mUHuHeUemn meueHEoHHom 4 meemEmusz meueHEOHHom mmUHoeHH mHHmmemeoE mHHOHmmeeemE mbnmeoz mmoHsumHH mnemeoz mumHzequm mHDHNOMQOmm echoeoee mHmHNoeQOwm mUHuHe mHoxmoeQOmm m mHHoHHMmE mflmHNOMQOmm m mHHHsz mEomUmm 4 mHHHsz mEommmm 121 momma Hommw Homwfl momma momma Homwa momma Homog Homma Homwg Home“ HommH momma momma momma momma Homwg momma Hommg Homog Homma Hommg Hom©H Home momma Homog HomoH Homma momma Homwa Homo_ mmUHoeHH mHHmUMmeoz mHHOHmmeuemE mbumeoz mmOHSumHH mUHmeoE mumHsequm eomomoen mHuxmoeQOmm mHUANOMQOmm mUHeHe mHmHNoememm m mHHOHHHmE mHUHNOMQOmm m mHHHsz mEombmm 4 mHHHmSQ mEomUmm m mmUHOHmmHzm mEommmm muHemQHQ mEommmm 4 HMmEHmQ mEommmm 4 meme mEombmm memueoE mEomUmm HH meoew 4 mHUmE mEombmm 4 memHeOUemE mEomUmm mmezozh mEomUmm HHeOemeeow mEommmm HHUeH>HH mEomUmm mHHOHHQOmmHe mEombmm mUHQmHe mEommmm mumHoHHHU mEommmm H msoew mmmfloeHom mEOmUmm mHeOum mHHOHH>meQ memessooem HemEHmQ EzemUHXmE mumHsumEEH memememuHQ EzHeoQOeHHU EsHmoQOeHHU EsHUomoeHHU EsflmomoeHHo EzHeroeHHU 122 Hoong HOOFH HOOPH Hoong floor“ HOOFH ”coma Hoona meowa Hoora ”Dong moona Hoong Hoonw HOOPH HOOFH Hoo>_ moona Hoona HoowH ”GONE momma momma HommH Homww Homwa momma Homo_ {90000000000000 4 KC E-iE-*E-1 -4 4 4 4 BHHHBHE‘BE—iE-ifi 4 °BBBBH H00044HH0098HBBUHB0000094B0004HHH4B44449000040B894 LDCDLDULDLD °ImHQ EzwnomoeHHb memefisooea ESHUOQoeHHU HemEHmQ EsHonoeHHo EzemonmENESHmouoeHHU EsEmemouomE ESHUOQoeHHU m Hemnemm ESHUOQoeHHU 4 Hembemm EszoeoeHHb m HMmHUemeo E:HU0QOeHHU EszomszoHHQ .em> Hmezoee EzHUOQOeHHU 4 Hmezoee EszomoeHHb m Hmewm EDHUOQoeHHU 4 Hmemm EDHUOQOCHHU musmeflc mflflflcemNm mHmem>em moeHU4 mHHOHHUezuOM meuemz meHeuHummE szer m mzumHHHo eonomoem 4 mzumHzoem eononoem EzmHeeowHHmo EnEmeuemeuxm m memuew meueHEoHHom 4 memoeH meueHEoHHom mUHeHMUemU meueHEOHHom 4 muemEmumze meueHEoHHom 123 mocha mocha Hoona ”Gong HOOFH Hoop. Hoop“ HoonH HOOPH moon“ HOOFH Hoona ”COPE Hoona mocha HOOPH mocha Hoomg Hoona HOONH Hoona moose HOQPH Hoop. Hoop“ HOOPH mocha H0050 Hoong 0000000000000 '00000000000 ~424:4:454:4 4 HE—‘E—‘HHE—iE-‘E-IE—IE-iE-IE-‘I BHHHHBBHBHHHHHHB m mzumHHHU eomomoem 4 mzumHzmem eomomoem EoneMOHHHmU EzEweuemeoxm m memoeH meueHEOHHom 4 memuefl meueHEOHHOQ mowuwubemb meueHEoHHom 4 muemEmumze meueHEOHHom mmewoeHH mHHmUMmeOE mHHOHmmeuemE mmonumHH mnemeoz mnemeoz mumHzequm mflmxmoememmm embomoee mHOHNOMQOmm mUHUHe mwmxmoeQOmm m mHHOHHHmE mHOANOHQOmm m mHmeze 4 maawmze m mmUHOHmmHzQ muHMmQHQ 4 HHmEHmQ 4 meme memueoE 4 mHUmE 4 memHeomemE mUe305h HHeOHmeeOh HHmeH>MH mHHOHHQmeAe mneemwa mEomUmm mEomUmm mEommmm mEommmm mEombmm mEomUmm mEommmm HH Qsoew mEomUmm mEomUmm mEombmm mEombmm mEomUmm mEomUmm mEommmm 124 Homba Hombw HombH Homna Homwg Homha Homha Homba Homwa momma Hombg Hemp; momma Hombg HomnH Homba Homba momma momma moms; Hombg Home Homba HomFH Homhg Homng Homba momma Hombg ° E4 00000000000000000000000 '00000 I HBE—‘BHHBBBHE—‘HEBBBHBBHBBH BEBE-+88 Homng 44ew00003994900444040959099409099uoe4eeuouee444uuo memueoE mEombmm 4 mHUmE 4 memHeOUemE mbezozh HHeOumeeoh 44u24>e4 mHHoHHQommxe mnflemwa mumHoHHHU mmUHoeHom HH aeoew mEomUmm mEomUmm mEomUmm mEommmm mEomUmm mEombmm mEomUmm mEombmm H asoew mEomUmm Mu QNSUMEEH MHUCMHmb “HQ mHeOUm mHHOHH>meQ meweEsoer HMmEHmQ EzemoHXmE EzsmumoeumE m Humbemm 4 Humbemu m HHmHUemeo EzfleoQoeHHU EszouoeHHb ESHUOQoeHHU EzwonoeHHU EzwonoeHHb EzHUoQOeHHU EzwonoeHHU EzwnoQOeHHU ESHUOQOeHHU EszumszoHHQ .em> HmeEOMQ 4 Hmezoee m.Hmemm 4 Hmemm EszoQOeHHU EszomoeHHU EDHUOQoeHHU EDHUOQoeHHU muzmeflc 444444444 mHmem>em moeHU4 mHHOHHUeSHOH meuemz meHeowummE msEer 125 Hoomg 80m: 302 ”coma Hoomg ”coma meow; Hoom: Sm: Sm: gonna mom: mom: HomPH flown; momma Home; 8m: Homh_ Homng Hombg HomNH Homng Sm: Homwa Rom: Hom>_ momma '00000 0000000000000 000000 0 HBHBHBBE—‘BBHBHBHBBE—‘HH EszomszoHHQ .em> Hmeaoee EzHUoQoeHHU 4 Hmeaoee ESHUOQoeHHU m Hmemm ESHUOQOQHHU 4 Hmemm ESHUOQoeHHU muzmefle mflawcemmm mHmem>em moeHo4 mHHOHHUezuoe meuemz meHeoHummE szHeh m mzumHHHu eomomoem 4 mzumquem eonomoem EzuHeMOHHHmU EzEmeuemeoxm m memoeH meeeHEOHHom 4 memoeH meueHEoHHom muHuHeUemU meueHEoHHom 4 muemEmumze meueHEoHHom mmmwoeHH mHHmbemeoz mHHOHmmeuemE mbumeoz mmonumHH mmemeoE mumHzequm mHoANoeQOmm eomomoee mHmHNoeQOmm mUHUHe mHOANOMQOmm m mHHOHHemE mHUHNOMQOmm m mHHHm3Q mEomUmm 4 mHHHmsQ mEomUmm m mmUHoHumHzm mEombmm muHMmQHQ mEomUmm 4 HMmEHmQ mEommmm 4 meme mEommmm 126 Hooma HoomH HoomH Hooma Hoomg ”coma ”coma Hoomfi Hoomg Hoomfl Hoomg ”com“ HoomH ”coma Hoom_ ”coma ”coma Hoomw ”coma Hoomg Hoomg HoomH Hoomg Hooma ”coma Hooma Hoom. Hoomg HoomH Hooma Hoomw 0000000000000000000000000000000 0000000000000000000000000 echoeoee mHuxNoeQOmm mUHuHe mHORNOMQOmm m mHHOHHMmE mmeNOHQOmm m mHHHan mEomUmm 4 mHHHsz mEomUmm m mmUHoHomHzm mEomUmm muHemQHQ mEomUmm 4 HHmEHmQ mEombmm 4 meme mEomUmm memueoE mEombmm HH asoem 4 mHUmE mEomUmm 4 memHeOUemE mEomUmm mbesuzh mEomUmm HHeOumeeON mEombmm HHmeH>eH mEombmm mHHOHHQOmmAe mEomUmm mUHQmHe mEomemm mumHOHHHU mEomUmm H meoew mmbHoeHom mEombmm mumHzomEEH memememuHQ mHeOHm mHHOHH>meQ memefieooea HemEHmQ EzemumeE Essmumoeums m Humbemm 4 Humbemo m HMmHmemeu EDHUOQoeHHU EszoQoeHHb EDHUOQOCHHU EsHUoQOeHHU EzwbomoeHHU EszoeoeHHb EszoeoeHHU EszoQOeHHU EzHUoQOeHHO 127 Homma HommH momma Homma Homma momma HommH Hommg Homwu Homwg momma Homma momma HommH Home Homwg momma meowH HoomH Hoowa Hooma HoomH Hoowa ”coma Hoomfi ”coma Hooma HoomH .....4.. 440980004H<40H440Hem moeHo4 mHHOHHUeseOM meeemz meHeuHummE mzfier m mzumHHHo eomomoem 4 mzumHzmem embomoem EsoHeMOHHHmU Ezfimeuemeuxm m memueH meueHEoHHom 4 memoeH meueHEoHHom mUHuHeUemU meueHEOHHom 4 muemEmumze meueHEOHHom mmbfloeHH mHHmUemeOE mHHOHmmeuemE mnemeoz mmoHsumHH mbemeoz mumHsequm mHm4NOHQOm4 128 EzuHeHOHHHmU EzEmeuemeoxm m memueH meueHEOHHom 4 memuew meueHEOHHom mUHuHememU meueHEOHHom 4 muemEmumze meueHEoHHom mmmHoeHH mHHmbemeoz mHHOHmmeuemE mmOqumHH mnemeoz mmemeox mumHzequm mHUHNOMQOmm eonomoee mHUANoeQOmm mbHuHe mHDHNOMQOmm m mHHoHHMmE mwoxmoeQOmm m mNNHmze 4 «4444.4 m mmUHoHomHzQ muHMmQHQ 4 HemEHmQ 4 meme memueoE 4 mHUmE 4 memHeomemE mUe305h HHeOHmeeOh HHueH>MH mHHOHHQOmmAe mUHQmHe mumHOHHHu mmmwoeHum mEombmm mEombmm mEomUmm mEommmm mEomUmm mEommmm mEommmm HH msoew mEombmm mEomUmm mEomUmm mEommmm mEommmm mEomUmm mEombmm mEomUmm H Qsoew mEombmm mumHzUmEEH memememowe 129 HoomH— ..0.l.|lll.l.0....< fl HOOQH ...III'I......A& < Hoomu .0.II'II-oo....«.....0....0¢....0......0.....0..Illl|| 4 4 4 4 ”com“ ...llIl-ooooo HOOQH ...Illul|...... HoomH ...:uul ...... HoomH— ...IIIIII- ...... HOOQH ...IIIII...-. ”coma ...-uu-..... 400mg ...-nlu..... Hooma .. I--- HOOGH ...l'lnl..... Hoomg ...Illlulooo. HoomH ...:uuu..e. 40040 ...:n....... HoomH ...11'1..... _oom0 ...-u--..... ”com“ ...---l..... HOOQH ....lllalooooo ~4 4:4:4:4:4 4 4.4 4 4 4 4 4 4 d . I . 414141424 4 4 4 4 4'4 4 4 4 ..........04.................... moom_ ...IIII......4 HoomH ...IIII ...... 4 ..... ......4 HoomH ...IIII ...... 4 ...... .....4.................... 4 HoomH— ...Illloonoo.uw mEombmm mwwomflQommxe mEomUmm mUHQmHe mEomUmm mumHoHNHo mEomUmm H @5040 meHoeHUm mEomUmm mumasomEEH mHUemMmUflQ mHeOMm mflwoww>mun memQESUOeQ HMmEHmQ Esemowme EzfimumoeomE m Hemmemm 4 whmbemm m flemwmemeo ESHUOQoeHHU EzwonoeHNU ESHUOQoeHHU Ezwbomoewwo EsweoQoeHHU EzwonoeHHU Ezwmomoeflwo EswUOQoeHHU EzwnoqoeHHo EszomzwmoHHQ .Mm> wmeEOMQ 4 Hmeaoufl m Hwemm 4 Hmcmm Ezwboaoeflmo EzflmomoeHHb EefiboaoeHHo EsflvomoeHHU muzmewe mHHHeQmHm mwmem>em moewo4 mflflowflmezuoe meuemz meweuwummE mzfixeh m msumwwflo eOU0boem 4 mzumwzoem eOUOerm 130 Hommg Hommw HommH momma HommH HoomH Hoomg HoomH Room“ Hoomg ”coma ”coma Hooma HoomH moomH Hoomw moomg Hoomg ”coma Hooma ”coma Hooma Hoomg HoomH ”coma ”coma Hooma Hooma ”coma ...........0...... 994045!U094000B00040H4444H44B094080400H040094040HB 444444444444444444444444 I I I (D I I 4 4 4’4 4'4 4 4'4 4 4.4 414 4 4.4 4 4 4 4 4 4 4 4 Hmemm EDHUOQoeflHU mumm444 m44444044 mwmem>em moeflo4 mwwowflbesuon meuemz mefleowummE msExeh m msumewo eomomoem 4 mzumwzmem eomomoem EsofleHOMHamo EzEmeuemeoxm m memoew maueHEONaom 4 memoew meuewEOHHom mowuwebemm meuewfiowfiom 4 muemEmumBQ meueHEowHom mmbwoeflw mwammumeoz mwwommmeuems mUHmeoz mm0~zumflw mnemeoz mumwzeummw mfluxmoeQOmm eomomoeu mflUXNOHQOmm mbfluwe mwoxmoummmmm m mHHOMHHmE mfloxwoeQOmm m mawflmzm mEombmm 4 mHmezQ mEomUmm m mmUHoHumazm mEomUmm muwemQHQ mEommmm 4 NemENmQ mEombmm 4 meme mEombmm memueoE mEommmm HH Q2040 4 mHUmE mEomUmm 4 memHeOUemE mEomUmm 131 HommH momma momma momma momma Homma momma Hommg momma Homma momma Homma momma Homma Hommw 40mma momma Hommg mommg HommH Homma 40mm_ 40mm“ momma Homo. momma momma flommg Hommg HommH .0. 4 mwwwmzq mEomUmm m mmnwowmmwsm mEombmm mumeQfiQ mEomUmm 4 flumEHmQ mEommmm 4 meme mEomUmm memueoE mEommmm HH @5040 4 mHUmE mEomnmm 4 memHeOUemE mEomUmm mmezuzh mEomUmm wweOHmeeom mEomUmm Hfibew>ew mEomUmm mflwomfiqommxe mEombmm mUHQch mEombmm mumaowwflo mEomUmm H Qsoew mmbwoewom mEombmm mumwzumEEw mebemumowQ mHeOHm mwwoww>mefl mcmnesooem HemEHmQ EzemUmeE EzEwumogumE m Hemmemo 4 Hemmemo m Hhmweemeo EzflUOQOeHHU ESHUOQOeHNU EDHUOQoeHHU EszoQoeHHU Ezwboqoeflwo Ezwbomoeflqb Ezwnomoewwb EszoQoeHHU EswmomoeHHD EszumzwmonQ .em> Hmezoun 4 HmeROMQ m Hmnmm EzwmoQoewwb EzwonoeHHb EDHUOQOCHHU 132 HoooHH IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ............HH4440 Ezemowme Ezflmoqoewwu HOOOHH 4440BU40040400404H0090040900484. . . . . . . . . . . . . IIIIII EzEmumOnHumE E: HUOQOCHHD HOQOHH nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn ............. llllll m Hemmemb Ezwmoaoewwo HOOOHH uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu ............ IIIIII 4 Hemmemu Ezflbouoeflwb MOOOHH IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ............ IIIIII m Humwmemeo E24U0Q0ewwu floooHH IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ............ IIIIII EzfizomzwmoHHQ .em> Hmezer SufionoewNU flOOOHH IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ............ IIIIII 4 wmezoen EsonQOeHHU HOOOHH IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ....U nnnnnn m stmm EsfivomoeflHo HOQOHH uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu ..... uuuuuu 4 Hwnmm EsflnoaoeHHu HoooHH llllllllllllllllllllllllllllllll ............ IIIIII muzmuwz mwwwszHm HOOOHH lllllllllllllllllllllllllllllll ............. IIIIII mwmem>em moeflu4 HoooHH uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu ............ 111111 mwfiomHmezuon meuemz 400040 uuuuuuuuuuuuuuuuuuuuuuuuuuuuuuu wwwugwwe444wo nnnnnn meHeUHummE 425445 mommH ...... .................. m WBMMflNHU COUOUOCm mOmmH ...... ......o........... « WDUQNBUCQ COUOUOSK momma ...... .................. ESUHCNONHHQU EDEmfiuCMCUNW HOmmH ...... .................. m QCQUCN MQHCHEOHHOQ mommH ...... .................. 4 MCQUQH QCuQfiEOflHOm momma ...... .................. QUHHHHUCQU MQHCHEOHNOQ momma ...... .................. < MMQQEMHWSQ MQHCHEOHNOW Hommg ...... .................. WQUHOQHN MHNWUHMQOE HODQH ...... .......... ........ QflfiowmmfiucmE mUHMCQz momma ...... .................. MWOHDHWHM MUMMCOE mommg ...... .................. MMQHDCUMQW WHOXNOHQQQQW mommg ...... .................. COUOUOCH WHORNOHQQMQE momma ...... .................. MUHUHQ WfluxNOqummm HOmmH ...... .................. m QHHONWHWE mflmeOHmmmmm mommg ...... .................. m QHflHWSQ meombmm 133 HOQOHH HQOOHH HOQOHH HOQOHH HOOOHH floooHH moooHH fiOOOHH HOOOHH HOQOHH HoooHH HoooHH floooHH HOOOHH HQOOHH HoooHH HOQOHH floooHH floooHH HQOOHH HoooHH HoooHH HOOOHH HOQOHH floooHH HoooHH HOOOHH HOQOHH HOOOHH HOOOHH HoooHH 4440H040040400404BO0HU040H004H4......... uuuuuuuuuuuuuuuuuuuuuu woue444woa-...... uuuuuuuuuuuuuuuuu waeuo4ueou4e4........ IllIHU40040400404H00H0040900494........ lllllllllllllllllllllll UHg<®UBI . . o a . . 444mgo4ow4w4oo4w4eooa0040500494........ ................. aoweuu4ueuw4e4........ 444ueu4mw4w4uo4o4ewoaow4oeoo4e4........ Iuuueu4oo4w4uo4u4emmeou4ue00494........ lllllllllllllllllllllllllll Dew mEomUmm . IIIIII mw~OMHQommxe mEomUmm . IIIIII mUHQmHe mEomUmm . llllll mumHoHHHu mEomUmm . IIIIII H asoeo . uuuu mmmfloeflom mEomnmm . IIIIII mumwzomEEH mebememowq . nnnnnn mweOum EzwmoQoeHHU . IIIIII mfiaomH>meQ EzfionoeHHD memQEeoer EDHUOQOCHHQ HHmENmQ E . D HUOQOCHND 134 _oHOHH IIIIIIIIII mUmeHe mEomUmm HOHOHH IIIIIIIIII mumHoHHwU mEomUmm ”OHOHH IUHGUHUUH4 . H asoeo HQHQHH uuuuuuuuuu mmbwoeflom mEomUmm HOHQHH 1111111111 mumwsumEEH mebememUwQ HOHOHH_ IIIIIIIIII mweOMm Sawmomoeflao HOHOHH uuuuuuuuuu mflwowfl>mea Ezwnouoewao HOHOH_ IIIIIIIIII memeESUOHQ ESHUOQoeHHU HOHOHH IIIIIIIIII HHmEHmQ ESwUOQoeHHU HOHOHH llllllllll Enemowme EzflmoQoewfib HoHOHH IIIIIII 0H4 EzEmumouomE Ezwboaoeflwb HoHoHH IIIIIIIIII m Humbemm ESHUOQOeHNU moHoHH uuuuuuuuuu 4 wembemo EnHmOQoeHHU HOHOHH llllllllll m Hemwbemeu Eswmoaoeflwb HQHOHH IIIIIIIIII EzwzomswmonQ .em> flmezoen EzwmoQoeHHb HOHQHH IIIIIIIIII 4 HmeEOMQ ESHUOQOCNND flQHOHH uuuuuuuuuu 4 chmm EDHUOQOCHHU HOHOHH IIIIIIIIII 4 Hmnmm EzflvoaoeHHo hoHOHH IIIIIIIIII musmewe mwwflszNm HQHOHH IIIIIIIIII mflmem>em moewu4 HOHQHH IIIIIIIIII mHHowwbezuou meuemz fioHoHH IIIIIIIIII meweoHummE m:E%e& HOOOHH IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ............ llllll m MDMMflHHU COUOUOCK HOOOHH llllllllllllllllllllllllllllllll ............ llllll fl WSMQHSOQM COUOUOCK HOOOHH IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ............ IIIIII Ezoweeowflwmu EzEmfiuemeoxm HoooS IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII ........... IIIIII m memuew meueHEOHwom H000.: IIIIIIIIIIIIIIIIIIIIIIIIIIII 4B4............. IIIIII 4 memoefl mfiuQHEOHMOm HQQOHH uuuuuuuuuuuuuuuuuuuuuuuuuuuuuu oe............ nnnnnn muHuHeUemm meuefiEonom 135 HQHOHH IIIIIIIIII m msumwwflo embobocm HQHOH_ IIIIIIIIII 4 mzumazuem eonomoem HOHOHH IIIIIIIIII EzofleeomHHmo E3Eme0emeoxm HoHoHH IIIIIIIIII m memuefl meueHEowflom HQHOHH IIIIIIIIII 4 memuefl meueHEOHHOm HOHOHH uuuuuuuuuu muwuwememb meueHEowaom 404040 uuuuuuuuuu 4 muemEmumsn m40e4504404 HoHoHH nnnnnnnnnn mmmwoeflw mwwmmemeoz HoHoHH IIIIIIIIII meowmmeuemE muemeoz HOHQHH IIIIIIIIII mmowzumwm mbumeoz HQHOHH 1111111111 mumwzequm mwoxwoemnmmm HOHOHH_ IIIIIIIIII eonomoeh mwoxmoeQOmm HOHOHH IIIIIIIIII mbfiuwe mwuxmoqummm HQHQHH IIIIIIIIII m mflHOMHMmE mflmxmoqummm HOHOHH 9090090094 m mHHHsz mEomUmm HOHOHH IIIIIIIIII 4 mHflfisz mEomUmm HoHoHH IIIIIIIIII m mmbwowmmwsm mEombmm HOHOHH llllllllll mumeQwQ mEomUmm HOHOHH IIIIIIIIII 4 HemEHmQ mEomUmm HOHQHH IIIIIIIIII 4 meme mEomUmm HOHOHH nnnnnnnnnn memueoE mEommmm HOHOHH IIIIIIIIII HH msoe0 HOHOHH IIIIIIIIII 4 mHUmE mEombmm HOHOHH llllllllll 4 memweobemE mEmemm HQHOHH uuuuuuuuuu mmezusm mEommmm HoHoHH 9090090094 “weepmeeom meombmm HoHoH. uuuuuuuuuu kuew>ew mEomUmm HOHOHH nnnnnnnnnn mHHomNQOmmAe mEombmm 136 Hm40 4440 Hmvg 4440 4440 Hm4_ 4440 4440 4040 4440 mmvg Hmva Hmvg Hmv_ H440 Hmwa HmvH HmvH 4440 4440 4440 4440 fimva Hmvg 4440 I I I I I I I I 000000000 00000000 I I I I 9400444499000000009949900444004440099999444 ..... mbezuzh 44e00mee0h 44m44>44 mwfiowfiuommxe 4444444 mumNOHHHU mmbfloewom mEommmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm H @5040 mEombmm mumwzumEEH mubememowe mwe00m mwwowflbmen memeeeuoea HMmEHmQ Ezemowxms EzEmumoeomE m Humbemm 4 Nemeemm m flHmeemeo 4440 Esflbomoeflw0 EszoQoeH~0 ESHUOQoeHHO Ezflbouoefl~0 Ezwbomoewa0 EswmoQOeH~0 5:400Q0e440 EzwbomoeHH0 EzfionoeHH0 EzwzumsflmonQ .em> Hmeaoen 4 wmezoufl m Hmemm 4 Hmemm 5:400Q0e440 EsflbouoeH~0 ESHUOQOCHH0 EsflvomoeHH0 4454444 44444Qm4m mwmem>um m0e404 meomHUezuoH meuemz meweoflummE maske9 0:50:00 $0320.30 05 no Scam 4.54423 "n 5..qu mucmzaom 02.9.4 137 meH 40mg Home ~0m_ _0m0 Hmvg 4440 4440 4440 Hmva 4440 Hmva 4440 4440 Hmvg Hmva 4440 4440 qua waa 4440 4440 4440 Hmvg fimva Hmvg ”avg 4440 Hmv_ .0. .0. .9. .0. 099999990444440990400000490999090944490049990999 000000000000000000000000 4 405mm EDHUOQoeHHO muzme4c 44444em44 mflmem>em moewo4 mHHOMNUezuok mguemE mefleowummE szAe9 m mzumeHu eOUOUQem 4 mzumwzmem eonouoem E304eeOMHHmU EDEmnuemeoxm m memoew meueHEoHflom 4 memoew meuewEOHflom mowuwebemb maueHEowflom 4 muemEmumze maueHEOHHOm mmbwoeww mwwmbemeoz mwaowmmeuemE mUHmeOZ mmo~zumww mbnmeoz mumwzeumum mHDXNOMQOmm eOUOerH mfloxmoummmmm mmwuwe mfloxmoemmmmm m mHHOMHHmE mwmxmoeQOmm m mwwflmzm mEomUmm 4 mwwwmzm mEomUmm m mmmwoNomwzm mEomUmm muwemQHQ mEommmm 4 HHmENmQ mEomUmm 4 meme mEomUmm memueoE mEomUmm HH Q5040 4 memE mEomUmm 4 memHeOUemE mEombmm 138 40mg 40mg 90mg 40mg 40mg 40mg 40mg 40mg 40mg 40mg 40mg 40mg Roma Homa HomH 40mg 40mg 40mg 40mg 40mg momH 40m. 40mg ~0m_ .mmu 4000 Home 40mg HomH 40m0 00000000000000 .0. 4 4444mze m mmbwowomwsq mumeQflQ .4 HHmEHmQ 4 meme memueoE mEomUmm mEombmm mEombmm mEombmm mEomUmm mEomUmm HH msoe0 4 mfime 4 memHeomemE mnezozh Hwe00mee09 44o44>44 mfiwomflaommxe 4444444 mumHOwHwo mmbwoewum mEombmm mEomUmm mEombmm mEommmm mEomUmm mEombmm mEombmm mEomUmm H asoe0 mEomUmm mumHzomEEH mebememoHQ mHe00m Eswbomoeww0 mflwomfl>mefl memeESUOHQ fiemEHmQ Enemowme EzEmumouomE m Humbemb 4 Humbemu m Hemwbemeu EswboaoeHHO Esflvomoefla0 SufimoQoeH~0 Ezwvomoeww0 Ezwbomoewa0 EzHUOQOeH~0 Eswmomoeww0 EswnoQoeflH0 EzwsumzmeHwQ .emb Hmezonn 4 Hmeaohn m chmm Ezwbomoefl~0 EzflonoeH~0 EsavomoeHH0 139 ! vaH0 vaH0 mvaH vaHH fivaH 444H0 quHH vaHH flwvHH mvaH vaHH vaHH vaHH 40mg 40mg 40mg Hmmw .0m. Home 40mg me0 40m“ 40mg 40m_ 40m“ Hmmg Homa _0m_ '00000 444444 0 I 00000 4141414 4 004449444044994990449I44444449444494440444040009 000000000000000 Ezemowme ESHUOQoeflH0 EzEmumOMumE Ezflbomoeww0 m Humbemm Ezflmoqoewq0 4 HMmUemu Ezwbouoeww0 m Hemwbemeu Ezwbomoew~0 EzwzumzmeHHQ .em> wmezoun Ezflnomoeww0 4 Hmezoen EswnoQoewH0 m 405mm ESHUOQoeHH0 4 Hmemm EDHUOQOCHH0 muzmefle mHNHeQmNm mwmem>em moeH04 mwwomHUezqu meuemE mefleuwummE szAe9 m mzumwwflo eOUOerm 4 mzumwzoem eomonoem EzufleMOMmeu EzEmeuemeuxm m memoefl meuewEOwwom 4 memuefl meueHEOHHOm mowuflebemn meueHEoflHom 4 muemEmumzn meueHEONHom mmbwoewa mNHmmeeoz meommmeuemE mnemeoz mmowzumwm mbnmeoz mumwzequm mwbkmoeQOmm eononoee mHDXNoeQOmm mbwuwe mwomwoeQOmm m mHNOMmeE mflOANOMQOmm m mwwwmzm mEomUmm 140 viH_ vaH_ vaH0 viH0 vaHa vaHa quH_ vaH. vaH0 viH0 44440 vaHH HvVHH vaHa vaH0 vaH0 _44HH fivaH HQVHH fivaH mvaH HVVHH 44440 HQVHH HvVHH vaHH viHH mvaH vaHH vaHH fivaH 00000000000000000000000 I I 44444444444444444444 4 meme memueOE 4 44404 4 memHeOUemE mnezozh 44e00me40h 44un4>44 mHNOMHQ04094 4044444 m0m404440 4 muemEmumsa me0e4E04404 00040e44 m44004me02 m44040m40e0E m04me02 mmo450044 m04me02 m0m4se0QO 04044040Qm04 e00000£4 04044040Q004 m0404e 44044040Q004 m m440444mE m404404mmmmm m 4444mse 4 4.444434 m m004040040Q m0440Q4Q .4 H4®EHmQ mE00004 mEomUmm mEombwm mEombmm mEomUmm m500004 mE00004 HH Q5040 mEomUmm mEombmm mEombmm msombmm mEomUmm mEombmm msombmm mE00004 H Q5040 00040e40m mEombmm mumwnumEEH m40em4004Q m4e00m 82400Q0e440 m44044>m44 E0400Q0e440 wemQEDUO4Q 8:400Q00440 44mE4mQ E2400Q0e440 141 HNmHH HNmHH HNmHH HNmHH 4N0: HNmHH ”NmHH HNmHH 4mm: HNmHH ”NmHH 4mm: HNmHH HNmHH HNmHH HNmHH HNmHH HNmHH ”NmHH HNmHH ammHH ”NmHH quHH fivaH quHH fivaH fivaH avaH 000000000000000 00000 0 ° 0 HBHBHHBHBBHE—‘BE—‘B 'E-*E-+E-|E-1 I - I I I I I I I I I I I I I .9. .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 II1440994444409040900400944490944044049900444440 000000 4141414 4'4 m04Q044 mEombmm m0m404440 mEomUmm H Q5040 mmbwoewom mEombmm m0m450mEE4 m40em4004Q m4e000 E5400Q0e440 m44044>044 E5400Q0e440 mchE5004Q E5400QOCH40 H4054mQ E5400Q0e440 Ezem04me 55400Q0e440 E5Emumo40mE E5400Q0e440 m 4400em0 5:400Q0e440 4 4400em0 85400Q0e440 m 44040eme0 85400Q0e440 554500540044Q .4m> 40e3044 E5400Q0e440 4 40e2044 E5400Q0e440 m Hwnmm E5400Q0e440 4 Hmzmm E5400Qoe440 m05m44£ mHNHeQ04m mHmem>4m moe404 m440440e5004 mauemz mewaowumms 03E>£9 m mzum4440 e0000044 4 m50m450em e00000e4 E504e40444m0 EzEmauemeokm m memoeH maueHEOHHOQ 4 memUeH m£0e4E04~0Q m040440e00 mauewEOHHOQ 142 HOVNH ”mmHH HNmHH HNmHH ”mafia Qmm40 HNmHH HNmHH HNmHH HNmHH HNmHH QNmHH ”NmHH HNmHH ”mafia HNmH. HNQHH HNmHH HNmHH Hmmag HNmHH HNmHH ”NmHH HNmHH HNmHH ”NmHH QNmHH QNmH. HNmHH 4009944000099444404444 IIIIIII 40III1999990099000I 990.......... BHHHBBEHE—‘HBHBHH .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 .04 me4£040mmE 05E4e9 m m50m4440 e0000044 4 050m450em e00000£4 E304e40444m0 Ezsmeuemeuxm m mem0e4 4 mem0e4 m040440e00 4 muemEmumza meueHEOHHOm me0e4E04404 maueflsoflwom me0e4E04404 00040e44 m44004me02 mflwowmmeuemE m40450444 m0m45e0QO e0000044 mbwufle m 44404. 4444 m 4.4440:4 4 4444424 m 0004040045Q m0440QHQ 4 H40ENmQ 4 meme memueoE 4 m400E 4 mem4e00emE m0e2059 4440544404 44uc4>44 mflwomHQOmme m04me02 m04me02 44044040Qmm4 04044040Qmmm m4044040Qm04 04044040Qm04 mEomUmm mEomUmm mEombmm mEombmm mEombmm mEomUmm mEombmm HH Q5040 mEomUmm mE00004 mEombmm mE00004 mE00004 msombwm 143 Hovm_ Hovmg Hovmg Hova mova HOVNH HOVNH HovNH movmg 404N0 Hovma 404m0 404mg Hovma Hovmg Hovmg Hovma Hovm_ Hovmg Hovm0 Hovma movma Hovmg HOQNH Hovmg Hova Hovma Hova 404mg HOVNH 4 meme mEombmm mem0e0E mEombmm HH Q5040 4 m4005 mEombmm 4 mem4e00emE mEomUmm mbezozh mEomUmm 44e00mee0h mEomnmm 440ew>44 mEomUmm m44044Qommka mEomUmm m04Q444 mEomUmm m0m404440 mEomUmm H Q5040 mmnwoewom mEomUmm m0m450mEEH m40em4004Q m4e000 m44044>m4Q mchE5UO4Q H4mE4mQ Ezem04me EsEmumO4UmE m 4400em0 4 4400em0 m 44040em40 E3400Q0e440 4:400Q0e440 E5400Q024H0 E5400Q0e440 4:400Q0e440 E2400Q0e440 4:400Q0e440 E5400Q0e440 E3400Q0e440 E54204544044Q .4m> 40e2044 4 40e204n m Hmcmm 4 flmcmm E5400Q0e440 E2400Q0e440 E5400Q0¢440 E5400Q0C4H0 4444444 444444444 mHmCm>Hm 0093.044 444444444404 444444 144 HmmNH wamg 4IIIIHHHOHUHHUHB< Hmcaoun Ezwonocwab 4 wmczoun EzflonOCHHQ m Hmnmm ESHUOQOCHHU 4 Hmcmm ESHUOQOCflHU muzmuflc mflaflaqmam mwmcm>um mocflo4 wwwomfibczuOH mnucmz .mcflgowummE mzsxzh m mzumwwwo zebonozm 4 mzumwzocm comebozm Ezoflcuowwamo EzEmcucmcuxm m mcmuzfl maucwEOHwom 4 mcmocw mzuCHEOHHOm mowuflubcmb mcucwEowwom 4 wucmEmumzfl mxucwsoflaom mmbflozflw mwambhmcoz mwaowmmcucwE mbumcoz mmo~zumwm mbumcoz wumazaummm mwuxmoqummm COUOUocM mfibxmoanmmm mbwUH: mfluxmonmmwmm m wwwowwums mwmxmoummmmm m mwwfisz mEombmm 4 mwawmzq mEombmm m meHOHomst mEomUmm muHMwaQ mEomUmm 4 meEflmQ mEowUmm 145 Hmmmg wamu Hmmma ammmg Hmwmg Hmmma Hmwmu mema Hmmmg meNH Hmmmg HmwNH HmwNH Hmmmg ammma Hmmmg HmmNH Hmwma ammmg Hmmmg ”mama mmwNH Hmmm_ Hmwmg ammmu Hmmmg fimmmg Hmmmg ammma mmmmu Hamm_ wumwzzummm EOUOUO£H mnfiuw: m mwflomHHmE m mHH .4 mNH mHOANOMQOmm mflmxmoummmmm mwbxmoqummm mHoANOMQOmm Hsz mEomUmm HmsQ mEomUmm m mmbHoHomfizQ mEomUmm muHMmQHQ mEombmm 4 HHmEHmQ mEombmm 4 mum 4 m mam: mEombmm “EOE mEombmm HH msouw HUmE mEombmm 4 memHCOU:mE mEomUmm mbcsozh mEomUmm HHEOHm ku: Econ mEomUmm H>HH mEomUmm mHHOMwQOmmxn mEomUmm mUHQmwc mEomUmm mumwo mmbflo MHQOum mHHOMH>mMQ mchESDOMQ HHmEHmQ Ezcmowxms EzEmumOMumE m Humbcmo 4 Hhmbcmm Hawu mEomUmm H abouw :wom mEomUmm QMQNSUQEN whbcmhmnu HQ Ezfionocwwb EszOQOCNHU Esflvoaocflau Ezflboaocflfiw EsflonOQHHU Ezwbomocwwo Ezwbomocfiab E:HU0QOCNHU 146 mmmma momma flmmmg mwmma ammma momma momma Homma HommH mwmmg H©MMH Hommg HmmmH momma Hommg momma HommH Homma Hmmmu Hmmmg Hmwma ...I..II......U<<............................... ...I..II......U<¢............................... ...B..I..........I.............................. ..................................H..... <40I40I<<<<¢448908HHBBBH0804¢4U<¢4UHH<mna Ezwbomocwfib mcmflssooua ESHUOQOCHHU HHmEHmQ EzHUorowqo Ezcmowme EzwonocflHb EzEmumOHumE EzwonocHHU m whencmm Esflnoaocfiwb 4 Humbcmu E3HU0Q02H~U m Humancmnu EzHUoroflwb Ezwzumzwmowa .Mm> chzoaa E:HU0Q0:HHU 4 HmcaoaQ EzwonocHHU m Hmcmm EDHUOQOCHHU 4 Hmcmm ESHUOQOCHHU wuzmuwc wwwwcmmwm mwmcm>um mocwu< MHHOMHUCDHOM mxucmz mcflauflummE WBEXCH m mzuMfiHHo COUOUocm 4 msumwzucm :0U0b044 Ezowcuomflwmo EzEmCucmcoxm m memocfl mzucwEoflwom 4 mcmucfl maucwEofiwom mUHuflubch maucflfiofiwom 4 wucmEMHmzn mzuCflEOHHOQ mmbflocwa mHHmUMmcoz wwwommmzucmE mbumcoz mm0~zumww mnumcoz 147 HommH momma momma mema Hommg Hmmmg HomMH 3mm; ammmu memH HmmMH 3mm; Hommg Hommg Hmmma memH Hmmma Hommg Hmmmg momma HommH HommH memH Homfl Hmmmg Hommg mema HommH Smfl momma Hmmma 4 mzumwzmcm :0U0boam Esoflcuowwflmw EzEmcucmcuxm m memocw mzu2HEoHHom 4 mzmocfl mauCHEOHHom mowuflnbcmb mnucwsoHHom 4 mnemEmusz maucHEOHHom mmBHOCHH mHHmbumcoE mHHoMmmzucmE mUMmQOE mmOqumwm mbnmcoz wumH34qum mwuxmommmmmm COUOUOQM mwmxmomemmm mbwuw: mwuxwoammwmm m mHHOMHMmE mfloxmoummmwm m MHHHmSQ mEomUmm 4 mHHHsz mEombmm m mmbwowomHzm mEomUmm muHHmQHQ mEomUmm 4 HumEHmQ mEomUmm 4 mem: mEombmm m:m~:oE mEomUmm HH QSOHD 4 mHUmE mEomUmm 4 mcmHCOUCmE mEomUmm mbcsuzh mEomUmm Hflcoumcaow mEomUmm HH02H>HH mEomUmm mHHowHQOmmxc mEombmm MUHQWH4 mEomUmm wumHOHHHU mEomUmm H msomw mmbflocflum mEomUmm 148 vamH qum_ vamg vama vamH vamH vamH mema vamH vama vamH vamH vamg vama vamH Hammu vamg vamw vamH vaMH vamg vamg vamw vaMH vamg vamH vama vamg vamg Hmmmw 4 mHUmE 4 mcmwzoncms mbcsuah HHQOuWC£Oh HHo2H>nH mHHOHHQOmmxn mnfimmflc .mumHOHHHU mmnflocwom HH msouw mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm H msouw mEomUmm wumHzUmEEH mHUCmHmUHQ mHQOHm meOHH>mMQ mchEDUOHQ flHwEHmQ EnchmeE EzEmumOMUmE m Humnzmo 4 Humbcmu m Hummbcmco ESHUOQOCHHU ESHUOQOQHHD EDHUOroHHU EDHUOQOQHHQ ESHUOQOEHHU EzwbomocHHb EzflonOCHHU ESHUOQOCHHQ EzwonOCHHU EzHuomSHmoHHQ .Hm> Hmczoun E3HU0QOCHHU 4 Hmcaoun EzwbomocHHb m ngmm ESHUOQOCHHU 4 Hmnmm EDHUOroHHU muzmgfla mHHHanHm mwmcm>um mocwom mHHOHanzuou mcucmz ..........4O@40....UU...UH.H IIIIIII .......... ..........4ww40....UU...UB.H IIIIIII U..UU..... ..........40040....UU...UI.H IIIIIII .......... ..........4004U....UU...UB.H IIIIIII .......... ..........46040....UU...UB.B IIIIIII .......... ..........40040....UU...UH.H IIIIIII .......... .......... Hmczoun EzHUoQOQHHD 4 Hmcaomn EuflonOCHHU m Hmnmm ESHUOQOCHHU 4 Hmnmm ESHUOQOCHHU wusmuwc mHHwnmmHm mwmcmbum mocwum mHHOHHbczuon maucmz QQHSUHummE szx£H m msumHHHu cononocm 4 mSHMHsbcm GOUOUOQm EsuHCHOMHHmo Esfimaucmcomm m MCMUQH MQHCHEOHHOH 4 mamUCH maucwEOHHom wwwuwubcmb mcucHEOHHom 4 mucmEmwmzn mnucflEoHHom mwnwocfla mHHmbumcoz mHHommmaucmE‘mbumcoz wumH34qum mwuxwoummmmm :0U0b04h mwoxwoqummm mbfluw: mwuxmoummmmm m meOHHMmE mwuxmoumummm m mHHHsz mEomUmm 4 mHHHsz mEombwm m mmbwowbmHzQ mEombmm wuHMmQHQ mEombmm 4 HHmEHmQ mEomUmm 4 mam: mfiomnmm mcmucoE mEombmm 150 Hmmva Hmmv. Hmmva Hmmva HvaH Hmmva Hmmva Hmmv_ Hmmvg mmmvH Hmmva HmmvH Hmmva Hmmva HmmvH Hmmva Hmmva Hmmva HNMVH Hmme Hmmva Hmmva ”va. Hmmvu ”vaH mmmva Hmmva Hmmva Hmmva HvaH HwaH .IIII44449490490. IIIII 44449490490. ...4044449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. . IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. ...40IIII9490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. .IIII44449490490. .IIII44449490490. IIIII 44449490490. IIIII 44449490490. . IIIII 44449490490. IIIII 44449490490. IIIII 44449490490. COUOUOSM mHoANoqummm mnwuflc mwu9N0HQOmm m mflHOMmeE mwoxmoqummm m wwwwmzm mEomUmm 4 mwaflmnm m mmUHOHOmHBQ muHMwQHQ 4 HHmEHmQ 4 meme QCMquE 4 mHUmE 4 mcmwconcmE mUCzUSh HHCOquSOW HHQQH>HH mHNOMHQomm94 mnflumflc mumaoHku mmbwozwom mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm HH msouo mEomUmm mEomUmm mEombmm mEomUm4 mEomUmm mEomUmm mEomUmm mEomUmm H anonw mEomUmm wumwzomEEw muncmnmowm mHCOum mHHOMH>mHQ mchEDUOHQ HMmENmQ Escm0meE EzEmumonomE m Humbzmm 4 Humbcmb m Hnmwncmno Esflbomocwwo Ezwnomozflab EDHUOQOCHHU EszoQOQHHU Ezwbomocflao Ezwwoqocwwu ESHUOQOQHNU Ezflboaocwwu Ezwboaocwab 151 HOWVH lllll ...........o.....o.......o................. QHQOUQ ESHUOQOCHHU Homva lllll ........................................... MflNONH>mNQ ESHUOQOCNNU How?“ lllll ........................................... WC®QESUOHQ EDHUOQOCHHU mowVH lllll ...........................o............... HHmsfimQ EDWUOQQQHNU momvH lllll ........................................... ESCQUHX®E ESHUOQQCHNU H0m¢g lllll ........................................... ESEGuWOHUQE EZflUOQOQHHU HOQVH lllll ......o.................................... m flHQUQQU ESHUOQOCHHU momva lllll ........................................... m flHmUCWU ESHUOQOCHHU momvH lllll .................o....................o.... m flHmHUQWCU EDHUOQOCHNU HOmvH lllll ........................................... ESNDUWBHWONHQ .HQ> flmczonn Ezwnomocwfib HOQVH lllll ................o.......................... fl N®Q§OHQ ESNUOQOQNNU HowvH lllll ........................................... m Hmnmm EsflnoaocflHu HomvH IIIII ........................................... é Hmflmm ESHUOQQCHHU HOmVH lllll .........o...............o................. QUSWHHQ WHNHCQmNm momva NQ WOCHUQ Howvg IIIII ..HUH...................................... “HHONHUQSUON mfiucwz _owvg ..... 4349454590994449490999B4HBHHHHU4HHoaeeo44o4 mcflaowumms mzsan mvaH ......o........ lllll <<<afl mHNOMHQOmmxa mnHQmHs mumwowwflo mmbwocflum mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm mEomUmm HH onuo mEombmm mEomUmm mEomUmm mEomme mEomUmm mEombmm mEombmm mEomUmm H msouo mEomUmm wumazumEEH mubcmumoflm 153 HmNm. Hmmma Hmmm_ HmNmH Hmmma Hmmma HwNmH HmNmH Hmmm. Hmmma Hmmmg Hmmmg Hmmma Hmmma mema mmNmH Hmmm_ HmNmH mwmma Hmmm_ Hmmma Hmmm_ HmNmH Hmmma Hmmma Hmmmg _omvH Homvg UUUUUUU‘EUUUUUUUUUUU .0..... -4444 .444 L9 " 4444444444444444444 -44444 .49494949 .494949II 9904944444000409944094000090909494940000 IIIIIIII mbczozh NHQOHmC£Oh mecfl>ufl mwwowflmommxa mbHQch muMHOHNHU mwbwocwom mEombmm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm H asouw mEombmm mumwsomEEw MHUCMMmUflQ meOum wwwowflbmufl mquEDUOHQ meEHmQ Ezmmowxmfi EsEmumouumE m meUQmO 4 Hambcmu m Hamfibcm40 ESHUOQOCHHU Ezwboqocwwb EDHUOQOCHHU EzflonOQHHU ESHUOQOCHHU EzwonOCHHU EzflonOCHHU EzwonOCHNU Ezwboqocflwb Ezazomzwmowflm .Hm> Hmmzoufl 4 HmQROMQ m Hmcmm 4 Hmnmm Ezwbomocflwo Eswonocwau ESHUOQOCHHU EDHUOQOCHHU musmuwa wwfiwszam mwmcm>um mocHU4 MHHOMHUQDuOM mcucmz mCHSUHummE sz449 m mzumflwflu comebocm 4 mzumwsmzm cowonozm 154 HohmH Honma Hmnmw Honmg Honma ”mmmg Hmmmw ”mmma Hmmmu mwmmg HmNmH Hmmm_ flmNmH flmNmH Hmmmu Hmmmg Hmmmu ”mmmg Hmmma flmNmH Hmmma Hmmm_ Hmmmg memu fiwmmg mema Hmmmg Hmmma HmNmH 4409090949444940490 IIIIIIIIIIIIIIII 994944440944I UUUUUUU UUUUUUUUUUUUUUUUU O O O O O O O O O O O I O O O (D .9. 444444444444444444444444 H O O O I I O O O O O I I 0 EH 4 Hmcmm EDHUOQOCHHU muzmufia m44444444 mwmcm>um mOCHU4 mwmowwbcsuOM mcucmz mCHaowummE sz445 m msumwwflo comebocm 4 mammazocm :0U0U044 E304240444m0 EzEmaucmcoxm m mCMUCH 4 mcmucw mufluwubcmb 4 MpcmEMumza maucwEOHHOQ maucflEoHaom mcucwEOflfiom mauCHEOHaom mmnwocww mawmbumcoz mwaommmaucmE mmowzume m~m~saqum COUOanu mbwuwc m MHHOMHHmE m 4444424 4 mHHHmzm m mmnwowumazQ muHHwQHQ 4 HumEHmQ 4 mcmc mcmucoE 4 mHUmE 4 mcmflCOUcmE mUMMCOE mbnmcoz mHOXNOHQOmm mwmxmoqummm mwmxmoqummm WHGXNOHQOmm mEombmm mEomUmm mEomUmm mEomUmm mEombmm mEomUmm mEomUmm HH Q5040 mEomUmm mEomUmm 155 445mg Honmw $92 Hobmg $5: Honma $92 409mg Hobmg Hmbm_ Hmbma Hmnmg Hwhmg Hobmg 409mg Home fimbmg Hohmg Hobma Hwbm 409m 409m Hobm Hmbm Hobmg HobmH Honmw Honma L—JL—lt—dl—Ot—l Hoan Honmg ..444940490 IIIIIII ..444940490 IIIIIII ..444940490 IIIIIII 4 wwwwsz mEomUmm m mmUHOHGmNSQ mEomUmm mufiMmQflQ mEomUmm 4 HMmEHmQ mEomUmm 4 mem: mEomUmm mcmuCOE mEomUmm HH asouo 4 mHUmE mEomUmm 4 mcmHQOUEmE mEombmm mU23039 mEomUmm HHCOumccom mEomUmm HfiUCw>Mw mEomUmm MHNOMwQOmmxa mEowUmm MUHQmwx mEomUmm wumaowwwv mEomUmm H Q5040 mmUHOCwUm mEombmm wumwzomEEH muficmumowQ mHQOum mHHOMH>mMQ mcwnssuoua HHmEHmQ ESCMUmeE EzEmumouomE m Humbcmb 4 flambcmo m Humwbcmam Eswbomocwab ESHUOQOQHHU EDHUOQOCHHU EDHUOQOCHNU Ezwbouocwwb Ezwnomocflaw Ezwbomocwaw Esflbomocflwb Ezwnoaocwwb EswzumzflmOHNQ .nm> HmQEOMQ 4 Hmczoufl m Hmnmm EzflonOCHHU Ezflb0QOCH40 EsavoaocfiHo 156 vaoH HvNoH vaow vao_ vama fivmwg vaww vama HvNoH vaoa vaoH mvmwa quma Honmg Hmbmg mmbmg HohmH Hohma 409mg Hobma fiwhmg Howmg 449mg Honma Honma 449mg 409mg Hmnmu 4 E-iE-iE-iE-‘IE'B E-IEIE-IE-‘IE-‘H O O O O O O C O I .l O O O O O O O O 0 0| 0 O O O O O O O O .I O O O C O I O O O .' ESQMUHXmE Ezwnomocflwo EzsmumouumE Eswboqocwflb m Humbcmm ESHUOQOCHHU 4 Humbcmo EzHUOQOQHHU m Humwbcmco Ezflbouocwab EzwzumswmofiflQ .Hm> flmczoun ESHUOQOCHHU 4 Mmckoufl ESHUoQOQHHU m chmm EDHUOQOCHHU 4 Hmcmm Esfivomocflau musmuflc m44444m44 mwmcm>nm mocwo4 mHHowHU2340M maucmz mcwauflummE szkcg m mzumwwflu mononoam 4 msumwzbzm mononoam E2UHCHOMHHMU EzEmaucmcomm m memocfl maucflsowfiom 4 mcmucw maucHEOHHom muwuwuqun QCHCHEONHOK 4 wucmfimumza mcucwfioflwom mwbwocflw mawmbhmcoz mwaowmmaucmE MUMmQOE mmownumfim mbhmcoz mumazsqum mflmxmohmuwmm EOUOUOQH mflOANOHQOmm mbwqu mwoxmoqummm m mHHOMmeE mwoxmoqummm m mwwwmzm mEomUmm 157 vaoa fivmoH fivmma vamH Hemoa vaoH _4N©H vamg fivmma vamH vama memH vawH mema vamH memH vamg HvaH vawa quoH avmma HvN©H vawa vaoa vawa vaoa HvN©H vao_ vaog fivmwg meoa BEBE-40999999999999E—iE-ifiiBE-iE-‘BB wumazcqum EOUOUOCH mbwufl: m mwfiowmeE 4 mum: mzmucoE 4 mflnms 4 mcmHQOUEmE mucsuzm HflcoUmcaon 44024544 MNwomflmommXG mnflqmfls mumHOHHHU mmBHOCwUm mumwzumEEw mancmMmUHQ MNCOUm ESHUOQOQHHU wwwowwbmun Ezwnouocwflb mamQE:oouQ EDHU04044HU HMmEamQ Esflbomocwwb 4 mucmEMNmsQ mCucwEoH~04 mmbwocww mwambumcpE mwwowmmzucmE mbnmcoz mmONBumww mbhmcoz mflbxmoqummm mwoxmommmmmm mwmxwoummwmm mH®%NOMmem4 m maaflmzm 4 mfiaflmza m mmbwoflomazQ muwanHQ 4 flMmEHmQ mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEomUmm mEombmm HH @5040 mEomUmm mEombmm mEomUmm msombmm mEomUmm mEomUmm mEomUmm mEomUmm H Q3040 mEomUmm 158 54.8 H30. H300 at: 3.43 343 5440 fimho_ ”mi: HNSH Hmbmg at: 343 ”N900 Hmbmg HmeH Hmhog HmbmH ”N900 H23 Hmhwa H33 vaog vaoa fivmma vamg 3N3 HVNQH 44 44 44 44.. 44 44 ULDLDLDLDLDLDLDLDLDLDLDLDLDLD °LDLDLDLD BEBE—'98 404Q044 4E00004 404404440 4E00004 H @5040 400402404 4E00004 4044:04EE4 440244004Q 442000 E5400Q02440 444044>04Q E0400Q02440 4200520044 50400002440 440E444 E0400402440 E32404X0E E2400Q02440 E3E0040404E E440oQO2440 m 4400240 E0400Q02440 4 4400240 E3400Q02440 m 440402440 E3400Q02440 E24300340044Q .44> 4023044 E0400Q02440 4 4023044 84400402440 m 40004 59400002440 4 40:04 E240OQOC440 4030444 444444044 04020>44 402404 444044024004 440202 4244040048 msExag 4 44044440 20000044 4 000443024 20000044 E00424044440 545040242044 m 424024 40024E04404 4 424024 44024E04404 4040440200 44024E04404 159 HONPH Hmnwa Hmbog ”N004 ”whoa mmhoa ”N004 ”N004 ”whoa HN>4H Hmnwa Hmnou ”N004 Hmnoa Hmnog Hmnoa .N440 Hmhwa ”N504 ”whoa ”N004 Hmnwg Hmhoa Hmbwa Hmnmg Hmhma .mnog Hmhwa Hmnwg IIIIIIIIIII HUUDUD4OOBEHHHHHHBHHHBHHBDHH44444UIII éifiiz‘é‘ifiifi§§§§$§§§§§E§§§§§§§iééfi «£4 (DDQDLDLDDLDULDLDLDLDLDLDLDLD 000.00.040.00.- 00000000000000. ..B..... LDLDLDULDLDO '00000000000000 (3000 0 4244040445 445444 4.44044440 20000044 4 440444024 20000044 540424044440 545040242044 4 424024 4 424024 4040440200 4 4024540444 44024504404 44024504404 44024504404 44024504404 40040244 4440044202 444040440205 440440444 4044440444 20000044 404042 4 444044445 4 4444440 4 4444444 4 40040400444 40440444 4 4405444 4 4242 4240205 4 44005 4 4244200245 4024040 4420042400 44054>44 444044404444 4044202 4044202 440240404404 440240404404 440240404404 440440404404 4500004 4500004 4500004 4500004 4500004 4500004 4500004 44 Q4040 4500004 4500004 4500004 4500004 4500004 4500004 160 Homng Homnw HONPH Hombg HONPH Hombg HONPH Homng HONFH Homba Homng Hombg Homha HombH HONDH HONPH Homng Hombg Hombg HONFH Hoth momma Hombg HomnH HONFH Homng HONPH fiomnw HONBH Hombg uuuuuu HB¢uw mEomUmm mNNOMHQomm%c mEomUmm mUHQmfla mEombmm mumNOHHfiu mEomUmm H msouo mmnflocflum mEomUmm wumfizomEEfl mubcmumufla MHQOum ESHUoQOCHNU mflwoww>mun EzwonOQHaU mchEDUOHQ ESHUOQOCHHU meEHmQ ESHUOQOQHNU Ezcmoflme EszOQOCH~U EzEmumOHumE Eswnomocflau m wumbcmu EzflonOCNHD ¢ Humncmo Ezwbomocflwu m Hamwbcmau Esflboaocflwb Emanumswmowa .Mm> wmczoaa Ezflboaocflwo < wmczoun EzwnoQOCHHU m Hmnmm EDHUOQOCHHU 4 flmnmm EDHUOQOCHHU musmuflc mHHHchNm mflmcm>um mocwom mfifiowfluczuou maucmz 161 Hmong Hmmba HwQPH HmonH Hmong Hmong ”wobH Hmowa HmmnH Homhg HONBH HONNH HomnH momma HONPH Homng HomnH Homng HONPH Hom>_ Homwa HONPH Homba HONNH momma mONFH Homhg HONNH U 'UUUUU .U.w.... (DO @0000 I .0....I UHD¢O< Hmcaoun EDHUOQOQHHU d Hmczoun EszoQOCHHU m Hmnmm ESHUOQOCHHU 4 Hmzmm EDflUOroHHU musmuflc mHNH:Qm~m mwmcm>um mocwum mflwowwbczuou maucmz mcflzuflummE szxah m mzumwmwo concuogm < mzumwzmcm mononoxm ESUHCHOMNHmo EzEmcMzmcuxm m mcmucw mCuCHEOHHOQ < mcmocfl maucwEOHwom mofluwubzmb mquflEonom 4 wucmEmumzfl maucflEOHHom mmUHOCHH mNHmUMmCOE wwwommmcucmE mmecoE mmonumfim mbumcoz mumwzaqum mfluxNOMQOmm COUOUO£H mwoxmoqummm mbfluw: mHoANOMQOmm m mHHOMHHmE mwmeoqummm m mawwmsq mEomUmm < mHmezQ mEomUmm m mmbwoflomazm mEomUmm muHMmeQ mEomUmm fl HHmENmQ mEomUmm 162 Hmong Hmwba Mamba Hmong ”mobg Hmmba Hmong Hmwha HwoPH ”mama Hmwna Hmong Hmmhg Hmong Hw©h_ flwmng Hmong Hmong HmmnH ”mama Hmong waha Hmong Hmmba Hamba Hmong Hmong Hmmba Hmwbg "mobfi Hmong UUUUUUU UUUUUUUUUUUUUUUUUUUU & U U KI} UUUUUUUUUUOUU UUUUUUUUUUUUUUUUUU 4 w<5t3Lptnuau>6:3(BLDLDcac>wtac3L954u>c»wr3c3c3n9n9uauau>o O O I O O O O O O O I I I O O O O O O O O O O 4 O I I 0 O O criticicicinfiLficau>u>wI3w DIO(D(DLDLDLDUDU)U)O wumHSCqum COUOUOQM mnHUHc m MflNOMflMmE m mam d mHH muwu mwuxmoanmmE mwoxmoummmmm mwoxmoummmmm mwd%N0MQOmm Nsz mEomUmm Hsz.mEombmm m mmbwoflmmwzQ mEowUmm mQfiQ mEombmm m flHmEHmQ mEombmm d mum ”mm mu: HflCOHW Hflo: mem: mEombmm uses mEomme HH msouw HUmE mEombmm m mumHCOUQmE mEombmm 303% mEomUmm Each mEombmm H>Mw mEomUmm mwmowwmommxs mEomUmm mUmewc mEomUmm mumao mmbflo mHCOum mflwomfl>mnm m:mQE:oouQ HHmENmQ Emchwme EzEmumOMomE m Hhmncmo ¢ flambcmo wau mEombmm H abouw cwum mEombmm QHMflsomEEH muncmhmoflq EnflU0QOCHHU E:HU0Q0:H~U EDHUOQOCHHU Eswwoaocwab ESHUOQOCHHD EzwaQOCHNU ESHUOQOCHHU Esflnoaocflwo 163 O O O O O O O O O O O O O O O O O O O O O O C O O O O O O O O O O I O O O Hmfima ..... HonH ..... Hoflmg ..... HonH ..... HonH ..... Hoama ..... HmHmH ..... Hwama ..... Hmamg ..... ”mama ..... ”mama ..... IIIII mumazumEEw mnbcmumuHQ lllll mwQOHm Esflbouocwfib uuuuu mwwoww>mun EzwnoQQCHNU lllll mcwnasooum ESHUOQOCAHU lllll HHmEHmQ Ezwonocwab uuuuu EzcmuwaE E:HU0QOCHHU uuuuu EzEmumOMumE EszOQOQHHD lllll m “umbcmu EzflUoroHHU 4 Hambcmo E3HUOQOCNNU lllll m Humwbcmno Eswonocwab IIIII EzwzomzfimOHHQ .Mm> Hmcaoufl Esflbouocwwo lllll d wmczoha EzflhOQOCHHU uuuuu m Hmcmm EDHUOQOCHHU lllll < Hwnmm ESHUOQOCHHU ”mama ..... lllll wuzmuwc wwfiflammam H©H®H ..... ...U.............. lllll ................. mflmcmbhm WOQHUQ Hwfima ......H................... ||||| ................. QHflOMHUCDUOH maucmg .mfimH 4ufl mwaowHQommxc mnflumflz wumaoflwflo mmnwocflum mEomUmm msombmm mEombmm mEomUmm mEomUmm mEomUmm mEomUmm HH msouw mEomUmm mEomUmm mEomUmm mEomUmm mEombmm mEombmm mEomUmm mEomUmm H asouw mEomUmm 165 J ‘ I. it ' vamH Hvomu vam. vama vamH vamH vamH vamH avowa avowa ”wwwg ”vomH vamH avowH avowa ”vomg vamH vamg avomg Hwomg avowH nvomg vamH avowg vawg Hvomg vamg ”voma vamg HonH OOOOOHH mEombmm MHHOHHQOmmHC mEomUmm mbHQmHa mEomUmm mumHoHHHU mEomUmm H gnome mmUHOCHum mEomUmm mMMHsumEEH mubcmuwufla MHCOum mHHOHHbmHQ mamQEDUOHQ HHmEHmQ E32m0meE EzEmquMomE m Humncmm 4 Humbcmm m HHmecmcU EzHUOQOQHHD EsHUoQOCHHU EDHUOQOCHHU EszoQOCHHU Ezwbonocwa EzwonOCHHU Ezwbomocflww EszomocwHU EsHUoQOQHHU EszUmSHWOHHQ .Hm> Hmczoun 4 Hmcaoun m Hmcmm 4 Hmcmm EDHUOQOQHHU EzHU0QOCHHU EDHUOQOCHHU ESHUOQOCHHU musmuflc mflHwanHm mflmcm>um mocHu4 mHHomwbczuOH maucmz mCH£UHummE szxzs m mzumflHHU :0U0U044 166 HNHmH HNHS HmHmH HmHmH HNHmH HmHmH HmHmH Hvomg gem: 21X: ”voma fivwwa vawa qumH avoma avowg wamH avowg vamH "vomg HvomH fivmmw 3mm: :3: 3mm: Hvoma vamH avowg D ....0........... O ....0........... 000000 .....H...... HBHum mOCHU4 mHHOHanzuou mxucmz mcHavHummE szxcH m msumHHHo COUOUOSm 4 mzumHsucm cononoam Ezuwcuowmeo Ezfimcucmcoxm m mcmmcfl mQQCHEOHHom 4 mcmucfl maucHEOHHOQ muHuHMbch mguCHEOHHom 4 mucmfimumzn maucflEOHHom mmUHocHH mHHmbumcoz mHHowmmzucmE mbumcoz mmonumHH mbumcoz mumHznqum mHUHNOHQOmm GOUOUOCM mHUHNOHQOmm mUHuH: mHUHNOHQOmm m mHHOHHHmE meHNOHQOmm m mHHHsz mEomUmm 4 MHHHmsm mEomUmm m mmbHoHUmHsQ mEomUmm wuHMmQHQ mEomUmm 4 HumEHmQ mEomUmm 4 mum: mEomUmm mcmucoE mEomUmm 167 HNHmH mmHmH HNHmH HNHmH HNHmH HNHmH HNHmH ”NHmH HNHmH HNHmH HNHmH HmHmH HNHmH HNHmH HmHmH HNHmH HNHmH HNHm_ HmHmH HNHmH HNHmH HNHmH HNHmH HmHmH ”NHmH HNHmH HmHmH HNHmH HmHmH HmHmH HNHmH KIILDLDLDLDLDLDCDOLDLDLDULDLDLDUUODLDD 00000000 4' I I I I& I I I II I I I I UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU MUHuH: mHQHNOHQOmm m mHHOHHHmE mHmHNOHQOmm m mHHHmsQ mEomUmm 4 mHHHsz mEomUmm m mmUHOHomH2Q mEomUmm muHMmQHQ mEomUmm 4 HMmEHmQ mEombmm 4 mem: mEomUmm mcmuqu mEombmm HH msouw 4% mu HUGE mEomUmm 4 mcmwconcmE mEomUmm mbczonh mEomUmm HHCOumC£OH mEomUmm HHQCH>HH mEomUmm mHHOHHQOmmAQ mEombmm mUHQmHQ mEombmm mumHOHHHU mEomUmm H msouw mmUHocwum mEomUmm mHQOUm MHHowwmeQ mchEsoouQ HHmEHmQ EzcmumeE EsEmumonomE m Humbcmm 4 Humbcmm m HHwacmao mumqumEEH mHUCmHmUHQ ESHUoQOCHHU EzwonocHHb ESHUOQOCHHU EzwbomocflHb EzHUoQOQHHb ESHUOQOCHHU EDHUOQOCHHU ESHUOQOQHHU EszoqocHHb EszomzwmoHHQ .Mm> 168 HNHmH HNHmH HNHmH HNHmH HNHmH HNHmH HNHm_ HNHmH HmHmH HNHmH HmHmH HmHmH 4.4 ......«a (90000000thth Hmmm. Hmmma HmmmH mmmma Hmmma Hmmmw Hmmma Hmmm_ Hmmmg Hmmmg Hmmma Hmmma Hmmmg HmmaH Hmmma Hmmmg I l I I BEBE-4995094 E-‘E-‘E-«En‘HEflHE-4 UUUUUUUUUUUU III....H.H..H III4H¢<¢4mMQ mchEsuouQ HHmEHmQ EnemUmeE EzEmumouomE m Humbzmu 4 Numbcmm m HHmanmco EzHUOQOCHHU EDHUOQOCHHU EzwonOCHHU Ezwb0QOCHHU EDHUOQOQHHU E:HU0Q0:HHU ESHUOQOCHHU ESHUOQOQHHQ EstomzwmoHHQ .Hm> Hmczonn 4 HmCROMQ m Hmnwm 4 Hmcmm EzwnoQOCHHU EswonOCHHU ESHUOQOCHHU EDHUOQOCHHU muzmuwa mflHHanHm . mHmcm>Mm mOCHU4 mHHOHanzuou m£ucm2 MCH£UHummE msEACB m mzumHHHo mononoxm 4 mzumHzocm COUOUocm EsoHQHOHHHmU EzEmaucmcoxm m MEMUQH 4 MCMUCH muflufluncmu 4 mucmEMumzn maucHEOHHom maucHEOHHOm mfiucHEOHHom maucHEOHHom mmbHOQHH mHHmUHmCOE mHHommmaucmE muumcoz mmonumHH mbumcoz mumszqum mwoxmoummmmm COUOUOCH mHuxmoqummm 169 BHBHBBEHHBHBBHBHBE—IBBHBHBBBBBBEE—I .oEIE—q -EIBE-IE-IE-4E-4&4 m mzmucH 4 mchCH moHuflubcmn 4 mucmEmumzn m mHHOHHMmE mCuCHEOHHom mauCHEOHHom mCHCHEOHHom maucHEOHHom meHOCHH mHHmUMmcoz mHHOHmmaucmE mbumcoz mmoHsuMHH mbhmcoz MHMHzcqum mwmxmonmmmmm covenocu mwmkmonmummm mUHuH: mHDHNOMQOmm mHmHNOMQOmm m mHHHsz mEomUmm 4 mHHHsz mEomUmm m mmUHoHUmHzQ msombmm muHHmQHQ mEombmm 4 HHmEHmQ mEomUmm 4 mcm: mEomUmm mumwcoE mEomUmm HH msouo 4 mHUmE mEomUmm 4 mcmHCOUcmE mEombwm mUCSUSW mEombmm HHCOumCQOh mEomUmm HHUCH>MH mEomUmm mHHOHHQOmmxc mEombmm mUHQmwa mEombmm wumHoHHHU mEombmm H asouw mmUHocHom mEomnmm mumqumEEH muncmumqu mHCOum EzwonOQHHb 170 HmmmH Hmmmg Hmmm: .............I..4..........IIII....B....B II...........I..4..........IIII....H....B IIIIIIIIIIIIIIIIIIIIIIII ...IIII....B....H m mzumHHHu :0b0b044 4 msumHzocm mononoam EzuHcHOMHHmo EzEmCQCQCUHQ 171 REFERENCES 172 LITERATURE CITED Bentham, G. 1834. Labiatarum Genera et Species. James Ridgway, London, UK. Pp. 1-783. Brauchler, C., Meimberg, H., Abele, T., and Heubl, G. 2005. Polyphyly of the genus Micromeria (Lamiaceae) — evidence from chNA sequence data. Taxon 54: 639-650. Brauchler, C., Meimberg, H., and Heubl, G. 2006. New names in Old World Clinopodium—the transfer of the species of Micromeria sect. Pseudomelissa to Clinopodium. Taxon 55: 977-981. Bremer, K. 1988. The limits of amino acid sequence data in angiosperrn phylogenetic reconstruction. Evolution 42: 795—803. Briquet, J. 1897. Labiatae. In A. Engler and E. K. Prantl, Die Natiirlichen Pflanzenfamilien 4(3a): 183-375. Buckley, T. R., Cordeiro, M., Marshall, D. C., and Simon, C. 2006. Differentiating between hypotheses of lineage sorting and introgression in New Zealand alpine cicadas (Maoricicada Dugdale). Systematic Biology 55(3): 411-425. Cantino, P.D., Harley, R. M., and Wagstaff, S. J. 1992. Genera of Labiatae: status and classification. Pp. 551-552 in Advances in Labiatae Science, ed. R. M. Harley and T. Reynolds. Kew: Royal Botanical Gardens Press. Cantino, PD, and Wagstaff, S. J. 1998. A reexamination of North American Satureja s.l. (Lamiaceae) in light of molecular evidence. Brittonia 50: 63- 70. Demesure, B., Sodzi, N., and Petit, R. J. 1995. A set of universal primers for amplification of polymorphic non-coding regions of mitochondrial and chloroplast DNA in plants. Molecular Ecology 4: 129-131 . Donoghue, M. J., and Sanderson, M. J. 1992. The suitability of molecular and morphological evidence in reconstructing plant phylogeny. Pp. 340-368 in Molecular Systematics of Plants, eds. Soltis, P. S., Soltis, D. E., and Doyle, J. J.. Chapman and Hall, New York, USA. Doyle, J. J. and Doyle, J.A. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11-15. Edwards, C. E., Soltis, D. E., and Soltis, P. S. 2006. Molecular phylogeny of Conradina and other scrub mints (Lamiaceae) from the southeastern USA: 173 evidence for hybridization in Pleistocene refugia? Systematic Botany 31: 183-207. El Oualidi, J., Vemeau, 0., Puech, S., and Dubuisson, J. 1999. Utility of rDNA ITS sequences in the systematics of Teucrium section Polium (Lamiaceae). Plant Systematics and Evolution 215: 49-70. Epling, C. and Stewart, W. S. 1939. A revision of Hedeoma with a review of allied genera. Reperton'um Specierum Novarum Regni Vegetabilis Beihefte 115: 1-49. Epling, C., and Wiggins, L. 1940. A new Poliomintha from Baja California. Contributions from the Dudley Herban'um 3: 85-86. Felsenstein, J. 1985. Phylogenies and the comparative method. American Naturalist 125: 1-15. Gray, A. 1870. Proceedings of the American Academy 8: 295-296. Gray, A. 1872. Proceedings of the American Academy 8: 365. Hemsley, W. B. 1882. Labiatae. Pp. 541-574 in Biologia Centrali-Amen'cana, eds. Godman, F. D. and Salvin, O. R. H. Porter and Dulau and Company, London, UK. Graybeal, A. 1998. Is it better to add taxa or characters to a difficult phylogenetic problem? Systematic Biology 47: 9-17. Harley, R. M., and Granda Paucar, A. 2000. List of species of tropical American Clinopodium (Labiatae), with new combinations. Kew Bulletin 55: 917-927. Henrickson, J. 1982. A new species of Poliomintha (Lamiaceae) from the Chihuahuan Desert Region. Sida 9: 290-292. Hipp, A. L., Hall, J. C., and Systma, K. J. 2004. Phylogenetic accuracy, oongruence between data partitions, and performance of the lLD. Systematic Biology 53: 81-89. Holder, M. T., Anderson, J. A., and Holloway, A. K. 2001. Difficulties in detecting hybridization. Systematic Biology 50: 978-982. Irving, R. S. 1972. A revision of the genus Poliomintha (Labiatae). Sida 528-22. Irving, R. S. 1976. Chromosome numbers of Hedeoma (Labiatae) and related genera. Systematic Botany 1: 46-56. 174 Irving, R. S. 1980. The systematics of Hedeoma (Labiatae). Sida 8: 218-295. Jamzad, Z. M., Chase, M. W., lngrouille, M., Simmonds, M. S. J., and Jalili, A. 2003. Phylogenetic relationships in Nepeta L. (Lamiaceae) and related genera based on ITS sequence data. Taxon 52: 21-32. Judd, W.S., Campbell, C.S., Kellogg, E.A., Stevens, RP, and Donoghue, M.J. 2002. Plant Systematics: A Phylogenetic Approach. Sunderland: Sinauer Associates, Inc. Kimura, M. 1981. Estimation of evolutionary distances between homologous nucleotide sequences. Proceedings of the National Academy of Sciences 78: 454-458. Loockerman, D. J. and Jansen, R. K. 1996. The use of herbarium material for DNA studies. Pp. 205-220 in Sampling the green world, eds. Stuessy, T. F. and Sohmer, S. H. New York: Columbia University Press. Pool, A. 2008. A new combination in Clinopodium (Lamiaceae) from Mesoamerica and Cuba. Novon 18(4): 508-510. Paton, A. J., Springate, D., Suddee, S., Otieno, D., Grayer, R. J., Harley, M. M., Willis, F ., Simmonds, M. S. J., Powell, M. P., and Savolainen, V. 2004. Phylogeny and evolution of basils and allies (Ocimeae, Labiatae) based on three plastid DNA regions. Molecular Phylogenetics and Evolution 31: 277-299. Prather, L. A., Monfils, A. K., Posto, A. L., and Williams, R. A. 2002. Monophyly and phylogeny of Monarda (Lamiaceae): evidence from the internal transcribed spacer (ITS) region of nuclear ribosomal DNA. Systematic Botany 27: 127-137. Ramamoorthy, T. P. and Elliott, M. 1993. Mexican Lamiaceae: Diversity, distribution, endemism, and evolution. Pp. 513-539 in Biological Diversity of Mexico: Origins and Distribution, eds. Ramamoorthy, T. P., Bye, R., Lot, A., and Fa, J. New York: Oxford University Press. Rossello, J. A., Cesin, R., Boscaiu, M., Vicente, 0., Martinez, l., and Soriano, P. 2006. lntragenomic diversity and phylogenetic systematics of wild rosemaries (Rosmarinus oflicinalis L. s.l., Lamiaceae) assessed by nuclear ribosomal DNA sequences (ITS). Plant Systematics and Evolution 262: 1-12. Ryding, O. 2006. Revision of the Clinopodium abyssinicum group (Labiateae). Botanical Journal of the Linnean Society 150: 391-408. 175 Sang, T., Crawford, D. J., and Stuessy, T. F. 1995. Documentation of reticulate evolution in peonies (Paeonia) using internal transcribed spacer sequences of nuclear ribosomal DNA: Implications for biogeography and concerted evolution. Proceedings of the National Academy of Sciences 92: 6813-6817. Schaal, B. A. and Olsen, K. M. 2000. Gene genealogies and population variation in plants. Proceedings of the National Academy of Sciences 97: 7024- 7029. Schmidt—Lehbun, A. N. 2008. Monophyly and phylogenetic relationships of Minthostachys (Labiatae, Nepetoideae) examined using morphological and nrlTS data. Plant Systematics and Evolution 270: 25-38. Shaw, J., Lickey, E. B., Schilling, E. E., and Small, R. L. 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperrns: The tortoise and the hare lll. American Jounral of Botany 94: 275-288. Standley, PC. 1923. Trees and Shmbs of Mexico. Contributions from the United States National Herbarium 23: 1270-1271. Steane, D. A., Scotland, R. W., Mabberley, D. J., and Olmstead, R. G. 1999. Molecular systematics of Clerodendrum (Lamiaceae): ITS sequences and total evidence. American Journal of Botany 86: 98-107. Steane, D. A., de Kok, R. P. J., and Olmstead, R. G. 2004. Phylogenetic relationships between Clerodendrum (Lamiaceae) and other Ajugoid genera inferred from nuclear and chloroplast DNA sequence data. Molecular Phylogenetics and Evolution 32: 39-45. Taberlet, P., Gielly, L., Pautou, G., and Bouvet, J.. 1991. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Molecular Biology 17: 1 105-1 109. Tamura, K. and Nei, M. 1993. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Molecular Biology and Evolution 10: 512-526. Torrey, J. 1859. Botany of the Boundary. Vol. 2, Part 1 in Report on the United States and Mexican boundary survey, made under the direction of the secretary of the Interior ed. Emory, W.H., Washington DC, USA. Trusty, J. L., Olmstead, R. G., Bogler, D. J., Santos-Guerra, A., and Francisco- Ortega, J. 2004. Using molecular data to test a biogeographic connection 176 of the Macronesian genus Bystropogon (Lamiaceae) to the new world: a case of conflicting phylogenies. Systematic Botany 29: 702-715. Turner, B. L. 1993. Two new species of Poliomintha (Lamiaceae) from northeastem Mexico. Phytologia 74: 164-167. Watson, S. 1890. Proceedings of the American Academy 25: 160. Wagstaff, S. J., Olmstead, R.G., and Cantino, PD. 1995. Parsimony analysis of chNA restriction site variation in subfamily Nepetoideae (Labiatae). American Journal of Botany 87: 886-892. Wagstaff, S. J. and Olmstead, R.G. 1997. Phylogeny of Labiatae and Verbenaceae inferred from rbcL sequences. Systematic Botany 22: 265- 274. Walker, J. B., Systma, K. J., Treutlein, J., and Wink, M. 2004. Salvia (Lamiaceae) is not monophyletic: implications for the systematics, radiation, and ecological specializations of Salvia and tribe Mentheae. American Journal ofBotany 91: 1115-1125. Wendel, J. F. and Doyle, J. J. 1998. Phylogenetic incongruence: window into genome history and molecular evolution. Pp. 265-296 in Molecular Systematics of Plants ll: DNA sequencing, eds. D. E. Soltis, P. S. Soltis, and J. J. Doyle. Boston: Kluwer Academic Publishers. White, T. J., Bruns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315- 322 in PCR Protocols: A guide to methods and applications, eds. Innis, M., Gelfrand, D., Sinsky, J. and White, T. Academic, San Diego, USA. Yang, Z. 1994. Maximum-likelihood phylogenetic estimation from DNA sequences with variable rates over sites: approximate methods. Joumal of Molecular Evolution 39: 306-314. 177 2 3 03062 8188 l llllllllfllllllllll