LIBRARY
Michigan State
University

 

 

 

This is to certify that the
thesis entitled

DEVELOPING A HIGH-THROUGHPUT, SNP-BASED
POPULATION SCREENING METHOD FOR
PSEUDOPERONOSPORA CUBENSIS

presented by

CATHERINE J. ERHARDT

has been accepted towards fulfillment
of the requirements for the

Master of degree in Plant Pathology
Science

 

 

mm, era/W

valor Professor’s Signature

3-5793 6700‘?

 

Date

MSU is an Affirmative Action/Equal Opportunity Employer

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5i08 K'lProjIAccaPres/CIRCIDateDue indd

DEVELOPING A HIGH-THROUGHPUT, SNP-BASED POPULATION
SCREENING METHOD FOR PSEUDOPERONOSPORA CUBENSIS

By

Catherine J. Erhardt

A THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTERS OF SCIENCE
Plant Pathology

2009

ABSTRACT

DEVELOPING A HIGH-THROUGHPUT, SNP-BASED POPULATION
SCREENING METHOD FOR PSEUDOPERONOSPORA CUBENSIS
By
Catherine J. Erhardt

Pseudoperonospora cubensis, the causal agent of cucurbit downy mildew, is
responsible for increasingly severe economic losses for cucurbit growers over the last
four years in the United States. Due to breeding efforts in the 19405 and 19505 and
successive plantings of the resulting resistant cultivars, little to no management was
necessary to control this disease until recently. In North America, it is believed that this
pathogen follows successive warm weather plantings of susceptible cucurbit crops north
along the eastern seaboard from over-wintering sites in southern States by means of long-
range transport of airborne sporangia. No studies have been conducted to date that
support this hypothesis either by looking at how the populations of P. cubensis found in
the Midwest compare with the early season strains in the South, or by accurately
predicting new outbreaks with forecasting models. To analyze the nature and structure of
P. cubensis populations, a high-throughput method for the screening of a large number of
isolates for identifying polymorphisms was devised. Due to the obligate biotrophy of P.
cubensis a method that is highly pathogen specific was needed. A single nucleotide
polymorphism (SNP)-based genotyping assay utilizing TaqMan® chemistry was
designed and tested in a trial population of 213 mixed Pseudoperonospora cubensis
isolates gathered over 2 years. Epidemic history, biotrophy, SNP characterization and

assay performance is discussed.

ACKNOWLEDGEMENTS

To all those that helped with insight and ideas, sampling both near and far, technical help

or answering the occasional ‘stupid question’, I thank you.

To all those that challenged my viewpoints, questioned my reasoning, or argued what ifs

with me, I thank you.

To all those that made me laugh, baked cookies, put up with me on long car rides, waxed
endlessly with me about videogames or shared my sometimes incessant need to go to the

dairy store, I thank you.

Special thanks goes out to the members of my advisory committee; Dr. Mary Hausbeck,
Dr. Brad Day and Dr. Ray Hammerschmidt, for their support and guidance, and to the
members of ‘team downy’ for being as enthusiastic about downy mildew as I was. I know
that when I look back at my time at MSU, I will do so with fondness and will take with

me more than just knowledge.

iii

TABLE OF CONTENTS

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

iv

LIST OF TABLES ...............................

LIST OF FIGURES .......................

CHAPTER 1

Literature Review ____________ 1
Introduction __________ 2
Pseudoperonospora cubensis ____________________ 3
Plant defenses and biotrophy _________________________ 8
Cucurbit breeding and disease resistance _ 10
Downy mildew epidemics and management __________________ 11
Molecular markers __ _____________ 17
Population assessment ______________ 21
Downy mildew phylogenetics __________________ 22
Genomic and bioinformatic resources 25
References ............................................. 27

CHAPTER 2

Developing a High-Throughput, SNP-Based Population Screening Method

for Pseudoperonospora cubensis 3 8
Introduction ................................ 39
Materials and methods ..................................................................................... 41
Results ........................................................ 55
Discussion ....................................................................................................... 62
Future directions ........................................................................ 65
References ............................................................................... 69

APPENDICES .......................................................................... 71
Appendix 1 ...................................................... 72
Appendix 2 ......................................................................... .. 78

LIST OF TABLES

Table 1: Summary of samples collected ...................................

Table 2: Summary of genes and primers _____

 

 

Table 3: Taqman® primers and probes ________________________

42

49

54

LIST OF FIGURES

 

 

 

 

 

 

Figure 1: Signs and symptoms of Pseudoperonospora cubensis infection ____________ 4
Figure 2: Pseudoperonospora cubensis life cycle _____________________________ 7
Figure 3: DNA extraction results _ ______ _ _ 46
Figure 4: Fluorescent reporter dye reads for homozygous and

heterozygous individuals ............................................. 59
Figure 5: Allelic discrimination for BTUB E ________________________________ . 60
Figure 6: Allelic discrimination for BTUBG _____ .. _________________ 61
Figure 7: FTA Card® comparison _____________________ __ 67

 

Images in this thesis are presented in color.

vi

CHAPTER 1

Literature Review

Introduction

Downy mildews, obligate pathogenic water molds (Oomycetes, Peronosporales,
Peronosporaceae), infect a wide variety of economically important crops the world over.
Pseudoperonospora cubensis (Berk. & M. A. Curtis) Rostovzev 1903, the causal agent of
cucurbit downy mildew, is responsible for severe economic losses for cucurbit growers
over the last four years in the United States (Holmes et a1. 2006). The recently observed
increase in virulence raises the question of how this pathogen, once controlled by the use
of resistant cultivars developed in the middle of last century (Barnes 1948; Barnes and
Epps 1950; Cochran 1937), has changed. In North America, where no overwintering
sexual structures have been found to date, this pathogen is thought to follow successive
warm weather plantings of susceptible cucurbit crops north along the Eastern Seaboard
from temperate sites in Florida or Texas by means of long-range transport of airborne
(asexual) sporangia (Wehner and Shetty 1997). Although there have been no studies to
date that support this hypothesis, either by looking at how the populations of P. cubensis
found in the Midwest compare with the early season strains in the South, or by accurately
predicting new outbreaks with forecasting models (Holmes et a1. 2008), the use of
molecular markers to genotype the North American population would yield needed

insight.

To achieve the level of analysis necessary for answering questions regarding the
nature and structure of P. cubensis populations, a high-throughput method for isolate

screening is needed. While a number of methods, including RFLPs, AFLPs and

microsatellites, have traditionally been used to classify populations of microorganisms
(Dracatos et al. 2006; Garnica et a1. 2006; Goodwin et a1. 1998; Grandon and Michalakis
2002; Hall 1996; Ivors et a1. 2006; Karaoglu, Lee, and Meyer .2004; McDonald and Linde
2002; Prospero et al. 2004; Roeckel-Drevet et a1. 2003; Schlotterer 2004), newer
technology has the potential to reduce the amount of time needed for screening, make
real-time population monitoring a reality, and answer questions of pathogen virulence or
origin. Through a review of the literature published to date, the P. cubensis-cucurbit
pathosystem, population genetics and current methods for the development and use of

molecular markers for genotyping assays are discussed.
Pseudoperonospora cubensis

Pseudoperonospora cubensis (Berk. & M. A. Curtis) Rostovzev, the causal agent
of cucurbit downy mildew, a destructive foliar disease, was initially characterized in
Cuba in 1868 and Japan in 1888 (Spencer 1981). Since then, it has been reported in more
than 70 countries and accounts for cucurbit crop losses the world over (Spencer 1981).
Cucurbit downy mildew symptoms first appear as green mottling, or small water-soaked
lesions, which then develop into characteristic angular yellow spots. The initial disease
symptoms can resemble frost damage (Babadoost 2001). Leaf blight and subsequent
death progresses quickly under warm, wet conditions. Disease symptoms are typically
observed first on older leaves in the center of the hill before moving towards the younger
leaves. The various disease symptoms associated with cucurbit downy mildew are shown

in Figure l.

 

 

Figure 1: Characteristic signs and symptoms of downy
mildew infection. The top pane shows a cantaloupe
(Cucumis melo cv. Hale’s Best Jumbo) hill decimated by
downy mildew in Clinton County, Michgan, July 2007.
Infection has started in the older part of the hill, with
some green foliage still visible on the growing tips.
Center left and right images show the characteristic
angular lesions present on cucumber (Cucumis star'vus cv.
Straight 8) and the grayish ‘downy’ sporulation present on
the underside of the same leaf, respectively. In both cases,
infection is between the leaf vein margins. Bottom left
image shows an antler-like sporangiophore of P. cubensis.

 

Oomycetes produce multiple types of propagules: sporangia (which either
produce zoospores or direct germination), zoospores (motile, biflagellate spores capable
of swimming in free water), and oospores (thick-walled resting structures produced
through sex). When P. cubensis sporangia land on plant tissue, zoosporangia are released
from sporangia in the presence of leaf moisture. The zoospores swim on the leaf surface
water, target stomatal openings and encyst in their vicinity. Penetration pegs emerge
from encysted zoospores and grow into the stomata, producing intercellular hyphae and
haustoria. Sporangiophores emerge from stomatal openings on the abaxial surface of
host leaves between 3 and 7 days post infection (Cohen et a1. 1971). Both homo- and
heterothallism are present in oomycetes. Some downy mildews, like Bremia lactucae
(Lebeda and Blok 1990) and Peronosporafarinosa (Danielsen 2001), have been shown
to reproduce sexually, while others not (Spring and Zipper 2006). Amongst the downy
mildews, both conditions may even occur within the same species, as is the case with
Hyaloperonospora parasitica (Danielsen 2001). All propagule types have been observed
in the P. cubensis (Bedlan 1989; Cohen et a1. 1989; Cohen et al. 2003), and Figure 2
illustrates the complete life cycle of Pseudoperonospora cubensis (though the role of
sexual reproduction has yet to be defined for the North American population). With the
lack of observed sexual structures, it may be possible for the North American population
of Pseudoperonospora cubensis to be asexual. The ability to reproduce sexually has
broad implications for an organism’s genetic diversity (Goodwin et al. 1998) and the
observed lack of sexual reproduction in the North American populations of P. cubensis

may have accounted for the initial durability of host resistance. It is possible to gain

 

genetic variation in primarily asexual lineages through mutation, mitotic recombination

and, to a lesser degree, parasexual recombination (Goodwin 1997).

In order to achieve their distinctive “downy” sporulation, most downy mildews
require very high humidity (95-99%), diurnal cycling (including a dark period of 6-10
hours per day) and a temperature range between 18 and 25°C (Heist 2001; Spencer 1981).
The Sporangiophores are antler-shaped and topped with large, lemon-shaped sporangia.
A minimum dew period of 6 hours has been reported to be necessary for sporangial
formation in the field (Spencer 1981), with an optimal temperature range between 16°C
and 22°C. Although Pseudoperonospora cubensis has been known to sporulate at
temperatures up to 38°C (Spencer 1981), pathogenesis is reported to be limited by
temperatures greater than 35°C (Shi et al. 2005). Temperatures above 25°C are not ideal
for cucurbit downy mildew, causing tissue necrosis to form within the lesion margins.
Necrotic lesions often have less sporulation than either chlorotic or green, water-soaked
lesions (Cohen and Rotem 1971; Cohen et a1. 1971; Spencer 1981). In the southern
United States, P. cubensis overwinters as mycelia in infected tissue (Holmes et al. 2008),
though propagation cycles can occur in areas where temperatures are suitable year round,
such as in a continuous production greenhouse (MGS Horticultural Inc. 2006). Unlike the
other oomycetes that attack cucurbits, P. cubensis does not affect the fruit directly, but
rather the fruit become dwarfed and flavorless as photosynthate is diverted away from

them (Jensen et a1. 1999).

 

dotoE< 5.82

E cor—03o Ho: swzofi 68582: mm cognac.“ econ—moo Sewn «Ewen 0—96 05 use vow—25v 0.8 fiwfitoam due. 05 .«o 36 inane 05 .8 83:53 Set 0325
mucosaofieflonm can 32:3 838. 5&5 caucuses—O 96:8 333328 use :otebocoa “we: $.85 98 83:53 8 53m manages of. 6:865

Mao. no 3:08.:— ofi E «Samoan oEoE omen—o.— Ea “no: 03:38.5 a :0 use. flwcfioam non—Ease :o 298 cm: $333 exomnoaoxemehamnm .8260 "N 9. =9..—

        

Eanwoo

moans—3m Eoc
omcoEo 88:33:8on

 

       

toamaeb omen—meo— mo 0333
«$52on ceases—ma

28.3. 5sz
. fine:

5:83 .8.

Eon—moon ©8985

Plant Defenses and Biotrophy

Due to their biotrophic nature, the downy mildews, which include the genera
Peronospora, Bremia, Plasmopara, Pseudoperonospora and Hyaloperonospora, have a
narrow host range when compared with other oomycetes (Choi et a]. 2003). To date,
none of the downy mildews have been known to cause disease on the members of more
than one plant family. Downy mildews cannot be grown in culture, though some have
been reported to survive in host tissue cultures (Hall 1996). It has been shown that early
downy mildew colonization of a susceptible host tissue does trigger initial plant defense
mechanisms such as the release of reactive oxygen species (ROS), a rapid increase in
cytoplasmic calcium ion concentration, the synthesis of pathogen-related proteins (PR
proteins) and cell wall changes, compatible interactions occur uninterrupted. The
changes in the host in response to downy mildew infection are the same as during non-
host resistance, and are either avoided or suppressed by the pathogen (Hardham 2006;

Holub 2006; O'Connell and Panstruga 2006; Panstruga 2003).

When initial plant defenses have been compromised, biotrophic pathogens form
haustoria within the cell wall, interfacing with, but not penetrating, the plasma
membranes of their hosts. The space between host and pathogen, the interfacial matrix
layer, becomes the main location of plant-microorganism interaction and the location of
most nutrient and effector molecule exchanges (Chisholm et a1. 2006; O'Connell and
Panstruga 2006; Ponchet et al. 1999). Recently, a catalogue of effector molecules found

in various oomycetes, uncovered through scanning sequence data using a characteristic

 

motif found in effectors, was published (Kamoun 2006), though most of effector
functions have yet to be elucidated (Rehmany et al. 2005). Haustoria also represent the
only major sites for sugar uptake in other biotrophs like rusts, as deciphered by the
amount of highly expressed hexose transporter genes found exclusively in the haustorial
plasma membrane, though it is unknown if this holds true in biotrophic oomycetes.
Amino acid transporters, by comparison, are also found in the membranes of the
intercellular hyphae (O'Connell and Panstruga 2006). Unlike other biotrophs such as
rusts (Kemen et a1. 2005), downy mildews do not change their cell wall structure to
counter plant defenses, giving further indication that plant defenses are being avoided or

nullified (Ellis, Catanzariti, and Dodds 2006; Mendgen and Hahn 2002; Panstruga 2003).

Although oomycetes have the chitin-synthase genes similar to fungi, their cell
walls are mainly comprised of B-l,3- and B-l,6-glucans, and cellulose (Kamoun 2003;
Werner et al. 2002). They are typically diploid, not haploid (or dikaryotic) like most
fungi. The oomycetes, often mistaken for true fungi due to their filamentous growth
habits, are related to other motile-spore producing stamenopillous protists, and have been
reclassified into the kingdom Chromista along with the brown algae (Cooke et al. 2000;

Hardham 2006; Van de Peer and DeWatcher 1997).

Recently, Plasmopara viticola, the causal agent of downy mildew on grape, has
been transformed with GF P (green fluorescent protein) (Hammer et al. 2007). Provided

these transformations can be repeated with other downy mildews like P. cubensis, the

IV —I"‘—-'—_

mechanisms of specific oomycete-host interactions can be investigated using confocal

microscopy in living tissue.

Cucurbit Breeding and Disease Resistance

Most cucurbits can trace their origins back to Australia and Asia (Renner et al.
2007), and it is therefore not surprising that most cucurbit diseases share similar
histories. Cucurbit diseases have been a problem for growers ever since the cucumber
was first domesticated in India, 3000 years ago and a large portion of resistance genes
used in current cucurbit breeding also trace back to India (Spencer 1981). Most of the
initial breeding for downy mildew resistance in the C ucubiraceae followed the discovery
of two different accessions with multiple disease resistance genes, one in Puerto Rico, the
other in China. Several parent lines were developed in the 19505 following the discovery
of this polygenic resistance to downy mildew (as well as to a range of other diseases),
and the subsequent cultivars developed were planted extensively in the United States and
abroad. The most notable cultivars were Palmetto (released in 1948, and exhibited
moderate resistance to P. cubensis) and Poinsett (released in 1966, with high resistance)
(Wehner 2006). Recently, even the polygenic resistance that was bred into the cucurbit

lines seems insufficient in controlling the cucurbit downy mildew (Colucci et al. 2005).
Resistant cantaloupe (Cucumis melo L.) cultivars were shown to form callose-like

deposits laced with lignin-like materials to inhibit the formation of haustoria (Cohen et al.

1989). These deposits led to the formation of minute haustoria in epidermal cells and

10

 

intercellular spaces, giving rise to the small water-soaked lesions that characterize
cucurbit resistance in the early stages of infection. Taler et al. (2005) have reported that
resistance in melon to Pseudoperonospora cubensis is linked to an increase in the
expression levels of a pair of enzymatic resistance (eR) genes. These genes encode
photorespiratory peroxisomal enzyme proteins (glyoxylate aminotransferases) and are
constitutively expressed at a low level in all cultivars (Taler et al. 2004). An increase in
these proteins may provide resistance to P. cubensis in other cucumber cultivars or
cucurbit species in the future. Other studies have reported that most resistance genes in
the Cucurbitaceae cluster the similar fashion to those reported in model systems
(Brotman et al. 2002; Sakata et al. 2006), directing future breeding efforts. Ideally,
breeding lines should be challenged with a variety of pathotypes of P. cubensis, as is
done with members of the Brassicaceae and their respective downy mildew races (Sousa

et al. 1997).

Downy Mildew Epidemics and Management

A number of factors influence the spread and severity of downy mildew outbreaks
from field to field, and from year to year. Highly fecund, P. cubensis sporangial
production is one of the factors that control the speed at which an epidemic may spread.
It was noted by Cohen et al. (1971) that diurnal cycles, along with moisture, are
necessary for the production and release of sporangia in P. cubensis (Cohen et al. 1971).
Although moisture plays an important role in sporangial development, dry periods

facilitate the dispersal of sporangia. The sporangiophores of P. cubensis and other

11

 

downy mildew species contort as they desiccate, loosening sporangia and facilitating
sporangial uptake into air currents. Spore trapping methods, whereby spores are impelled
from the air onto adhesive film at a constant rate, have long been used to measure the
amount of airborne inoculum present in either field or greenhouse studies. Spore
trapping provides valuable information for correlating atmospheric sporangial
concentrations and weather phenomena (Byrne et al. 2005; Scherm and Bruggen 1994),
and occasionally weather data alone is used to forecast outbreaks (Baker et al. 2005).
Any prospective model for long distance aerial transport of downy mildew sporangia
should take into account all the factors that influence sporangial production, release,

uptake into the air stream and survivability.

A number of studies have shown maximum peaks in airborne downy mildew
sporangialcoinciding with prolonged periods (>11 hours) of moisture followed by drying.
Temperature was found to have a minimal effect on the amount of downy mildew
sporangia found with spore trapping of Peronospora antirrhini, the causal agent of
downy mildew on snapdragons, provided minimum temperature requirements were met
(Byrne et al. 2005). Similar conditions are instrumental in the spread of potato late blight
pathogen, Phytophthora infestans (Aylor 2003; Baker et al. 2005; Campbell 1999;
Harrison and Lowe 1989), and its study can yield valuable insights for P. cubensis and
other downy mildews. Wind speed has been shown to affect sporangial release from the
crop canopy and its uptake into higher levels of the atmosphere. In P. infestans, relative
wind speed was shown to affect the number of sporangia produced, with higher wind

speed correlated to more sporangia for the same levels of relative humidity (Harrison and

12

 

Lowe 1989). The amount and speed of wind necessary to stir the air layers below the
canopy and facilitate sporangial lifting into the air for P. cubensis is currently unknown,
but for other members of the Peronosporaceae, even moderate winds were reported to
cause the upward escape of up to 15% of total sporangia from the bottom fifth of the

canopy (Aylor 1990).

When sporangia are disseminated from a diseased host onto fresh hosts, a number
of factors determine whether or not they will germinate and cause disease. Solar
radiation and available surface moisture play an important part in sporangial survival and
subsequent infection. In Bremia lactucae, the causal agent of lettuce downy mildew, the
amount of sunlight poses significant restrictions on the percent germination of sporangia,
regardless of temperature and relative humidity (Wu et al. 2000). P. cubensis sporangia
are darker (having more melanizing pigments) and larger than those of Bremia and
Peronospora species, which may increase survival when exposed to UVA and UVB

radiation.

Forecasting programs have been created for various oomycete pathogens
including Peronospora destructor (Gilles et al. 2004), Peronospora sparsa (Aegerter et
al. 2003), Bremia Iactucae (Padgett-Johnson and Laemmlen, date unknown) and
Phytophthora infestans (Baker et al. 2005). These programs rely on models developed in
the lab and tested for statistical significance, and are designed to inform growers when
the highest chance for infection is likely to occur based on sporangial release and

moisture measurements. Models for the movement of P. infestans are the most complete

13

 

to date, with sporangial release rates from potato crop canopies having been assessed and
tested under field conditions and their movement successfully predicted in various
microclimates (Aylor 2003; Aylor et al. 2001; Baker et al. 2005; Harrison and Lowe
1989). Nathan et al. (2005) propose modeling long distance transport of sporangia in
silico with factors such as landscape heterogeneity, wind turbulence at ground level and
atmospheric conditions taken into account (Nathan et al. 2005). Their models remain
untested in the field to date. P. cubensis is thought to travel from temperate regions in
the southern United States coinciding with the ‘green wave’, or the planting and growth
of susceptible hosts as temperatures warm in more northern latitudes, similar to what is
shown for Peronospora tabacina, the causal agent of tobacco blue mold (Aylor 2003).
The researchers at North Carolina State University collect reports for outbreaks of P.
cubensis from the field throughout the growing season to monitor the spread of cucurbit
downy mildew in the United States (Holmes et al. 2008). At Michigan State University,
the disease is tracked as it occurs in Michigan counties (Hausbeck 2007). Growers are
kept aware of the northward spread of the disease with these regularly updated websites,

so spray programs can be ameliorated accordingly.

Although it is upheld in a number of pathosystems that disease severity decreases
significantly with increasing distance from the inoculum source, the long distance
transport of sporangia in air currents from regions with active infections to unaffected
areas is the proposed mechanism for how downy mildew epidemics arise (Aylor 2003;
Campbell 1999; Holmes et al. 2008; Nathan et al. 2005). In the United States, past

epidemics of Peronospora tabacina, causal agent of Blue Mold of tobacco, were thought

14

 

to have arisen from outbreaks in the Caribbean, moving north on weather systems, in the
late 19705 (Campbell 1999); the import of contaminated transplants may provide an
alternate explanation. The escape of P. tabacina sporangia from the greenhouse has been
documented in Europe, moving first through susceptible ornamentals to tobacco crops
from a research facility in The Netherlands in 1959 (Campbell 1999). Both long distance
transport from temperate cucurbit growing regions and greenhouse escape have been
proposed as mechanisms for the recent spread of P. cubensis in the United States
(Holmes et al. 2008). The detection and quantification of pathogen DNA with the use of
real-time PCR, which measures the amount of DNA amplified at each of the PCR cycles,
allows for rapid diagnosis of samples (Lievens et al. 2006) and can be used in place of
conventional spore trapping to quantify sporangia present. This new technology may

replace conventional spore trapping in future years.

The ability to predict future outbreaks of downy mildew can save growers both
time and money when it comes to protecting their crops; sprays can be timed to coincide
with the predicted peak in viable sporangia present in the area thus saving on fungicide
applications. Delayed treatment of infected fields can increase crop 1055, making both
regular scouting and increasing spray intervals as recommended by disease forecasts
important preventative measures (Colucci et al. 2005). In Japan, the novel fungicide
cyazofamid was shown to be both preventive and curative of P. cubensis infections on
cucumber tissue (Mitani et al. 2001). Other fungicides reported to be effective against P.
cubensis on cucurbits include systemics (metalaxyl, iprovalicarb, fosetyl-Al,

propamocarb, cymoxanil), partial sytemics (dimethomorph, azoxystrobin and some

15

 

quinone outside inhibitors (Q01)) and non-systemic or contact fungicides (fluazinam,
zoxarnide, certain inorganic copper fungicides, organic dithiocarbamates like Mancozeb,
chlorothalonil, and folpet) (Urban and Lebeda 2006). Unfortunately, not all of the
available, effective treatments are registered for all susceptible crops in the United States
and, even when a particular chemistry is known to work, resistance in downy populations

can occur and build up over time.

Resistance to the fungicide azoxystrobin is known in several Plasmopara viticola
isolates, as well as for other biotrophic fungi (Wong and Wilcox 2000). Resistance to
strobilurin fungicides has been reported for P. cubensis in Japan (Ishii et al. 2001). The
aforementioned strobilurin resistance was characterized at the molecular level; resistant
strains of P. cubensis have a single amino acid change in the coding sequence for the
cytochrome b protein targeted by that class of fungicide. Metalaxyl resistance has been
reported for P. cubensis in the United States in 1987 (Moss 1987), though the same
resistance was reported 7 years earlier in Israel (Reuveni et al. 1980). Resistance to
flumorph, a novel carboxylic acid amide recently developed to control oomycete
diseases, has been recently shown in vitro and in small field trials for P. cubensis (Zhu et
al. 2008). Zhu et al. (2008) also proposed that the reason resistance may have developed
so quickly in the field is that multiple mating types exist for P. cubensis, similar to P.
viticola, presenting a considerable resource of genetic variability (Zhu et al. 2008).
Unfortunately, there have been no published findings that support this idea. Along with
paying attention to the forecasting websites to better time sprays of effective, registered

products, other cultural practices are recommended to reduce disease impact and severity.

16

 

 

Irrigation should be implemented only as needed to avoid excessive leaf moisture
necessary for infection and reducing plant density has been shown to help reduce downy
mildew infestations (O'Neill et al. 2002). It has been shown by Ngouajio et al. (2006)
that plant densities of pickling cucumber can be lowered without a significant loss in
economic value (N gouajio et al. 2006). Alternate hosts such as wild relatives should be
minimized since, once infected, they can provide an ongoing source of inoculum

(Mieslerova et al. 2007).

Molecular Markers

Understanding the population dynamics of a pathogen in the field is invaluable
when it comes to matters of host resistance, effective fungicide chemistry and cultivation
practices. A highly variable population means a greater potential for overcoming host
resistance or becoming fungicide insensitive if enough selective pressure is placed upon
it. A number of factors contribute to the overall genetic structure of a population: gene
diversity (the increased number of alleles at a given locus), genotype diversity (the
number of genetically distinct individuals in a given population), mutation, population
size, and the rate of gene flow (McDonald and Linde 2002); each of which can give
insight on how that population may evolve. Differences among lineages can be assessed

with the use of genetic markers.

The first true molecular markers were allozymes; protein variants in enzymes that

were distinguishable by running cell fractionate through gel electrophoresis then staining

l7

 

with an enzyme-specific salt (Schlotterer 2004). Few, if any, downy mildew species
were ever characterized using this method. Endonuclease methods such as restriction
fragment length polymorphisms (RFLP) and minisatellites, which show individual
banding patterns when enzyme-digested DNA when separated by gel electrophoresis,
were followed (and often replaced) by PCR-based ‘fingerprinting’ approaches. These
approaches include random amplified polymorphic DNA (RAPD) markers, amplified
fragment length polymorphisms (AF LP) and cleaved amplified polymorphic sequence
(CAPS) analysis, simple sequence repeats (SSR, also known as microsatellites) and
single nucleotide polymorphisms (SNP). Below are brief descriptions of the main

molecular markers currently in use.

AF LPs: Genomic DNA is digested using two restriction enzymes (one with a 4 base pair
recognition site, the other with a 6 base pair recognition site) in similar fashion to RFLPs.
After digestion, the cut ends ligated to adaptor sequences and biotinylated, and a subset
amplified by PCR (Vos et al. 1995). The amplified fragments are then run on an
acrylamide gel and scored based on length. The amount of reproducibility and resolution
of genetic differences is generally high, but restricted to dominant genes. Typically
many loci are assayed at one time, making this technique frequently used for determining

population structure.

SSRs: Microsatellite loci are where the number of tandem repeats (typically di-,

tri-, and tetranucleotide repeats) in non-translated areas created by polymerase slippage

and varies from allele to allele. The genetic information provided by SSR markers is

18

similar to that of allozymes with a higher degree of discemable polymorphism in a
population and are revealed through genomic sequence comparison (Avis 2004). Primers
for flanking regions are designed for each polymorphic region used and then screened
after PCR and gel electrophoreses. Occasionally due to the high mutation rate,
microsatellites may be identical in size but not in origin and subsequently have been
reported to be problematic for determining geographic population structure (Balloux and

Lugon-Moulin 2002).

SNPs: Much like SSRs, SNPs are discovered by comparing sequence data
between isolates and looking for polymorphisms, with single base changes between the
members in a population being sought instead of short tandem repeats. Otherwise, the
method for screening SNPs is the same as for microsatellites with primer development

and testing being the rate-limiting step for marker development.

Up until very recently, the predominant molecular markers used in the study of
oomycete and fungal population genetics were microsatellites (Dracatos et al. 2006;
Garnica et al. 2006; Gobbin et al. 2003; Ivors et al. 2006; Karaoglu et al. 2004; Lees et al.
2006; Prospero et al. 2004), and to a lesser extent, AFLPs (Gevens et al. 2007; Singru et
al. 2003) and CAPS analysis (Delmotte et al. 2008). The frequency and distribution of
microsatellites in a given genome differs not only among species, but also among
chromosomes and have been known evolve quickly (significantly more so than base
substitution rates) and to cluster in non-random patterns (LaRota et al. 2005; Schlotterer

2000). SNPs are relatively new candidates for genetic diversity studies, and have been

19

 

employed for a number of plant and animal species (Lopez et al. 2005; Morin et al.
2007), including one downy mildew (Delmotte et al. 2008). To date, the core of
population knowledge for most downy mildew species is based on direct sequence
comparisons of ribosomal ITS or LSU sequence data to discern genetic diversity
(Casi‘miro et al. 2004; Choi et al. 2003, 2006; 1005 et al. 2007; Reithmuller et al. 2002).
Direct sequencing followed by manual sequence alignment is, to date, the most reliable

way discern diversity.

No single molecular method is perfectly suited to any one type of study and there
is overlap among methods for any given application. The one of the drawbacks to using
dominantly inherited markers such as AF LPs and RAPDs is that they are biallelic (with
bands either present or absent) so it is impossible to distinguish homozygotes from
heterozygotes. The clonality of lineages is easily distinguished by mini- and
microsatellite techniques while populations can be discerned using the same methods and
more. Kinship between isolates can be observed using CAPS analysis, where in known
restriction sites produce distinctive band sizes when PCR-amplified DNA is digested
with restriction enzymes. For any PCR-based method, it is essential to optimize the
extraction conditions and sample size first (Wangsomboondee and Ristaino 2002).
Nested PCR reactions, where initial PCR product is used as the template for subsequent
reactions, is common for oomycete pathogens when the DNA from the host tissue is
isolated along with your pathogen of interest (Grote et al. 2002; Zhang et al. 2006), even

if little pathogen DNA is present.

20

Population Assessment

Since little is known to date of the population genetics of downy mildews in
general, most differentiation between isolates is currently done on the basis of race. Race
is a physiological measurement typically determined by host range and relative virulence,
often using detached leaf assays in the lab (Agnola et al. 2003; Cohen et a1. 2003;
Roeckel-Drevet et al. 2003), and typically correlated to fungicide sensitivities. Currently
5 distinct pathotypes of Pseudoperonospora cubensis are recognized in the United States,
with still others present in Europe and Japan (Cohen et al. 2003; Thomas 1996). Previous
literature relies on race to discriminate between geographical populations. The actual
number of P. cubensis races is unknown; potential differences in host specificity could be
the result of single point mutations within the same initial population or races may have
coalesced and lost virulence in the absence of divergent hosts. Roeckel-Drevet et al.
(2003) showed that a novel race of Plasmopara halstedii, the causal agent of sunflower
downy mildew, found only in France, is a direct derivative of an older race found in the
same area (Roeckel-Drevet et al. 2003). Populations of Phytophthora infestans in the
United States exhibited a massive turnover in the dominant pathotype in a short amount
of time after the dissemination of infected seed (Goodwin et al. 1998). Some suspect that
races originated as some kind of local adaptation; with genotype diversity hinging on the

susceptibility of the host they were initially isolated from (Zhan et al. 2002).

Once developed, molecular markers can serve to build a population map,

diagnose samples brought in from the field, or to test seed lots for infection (1005 et al.

21

2007). One statistical method for assessing population structure with molecular markers
that is often applied when working with SNPs or microsatellites is the calculation of an

F -statistic fixation index (Fsrr). As defined by Wright (1951), the fixation index
references the homologous alleles for diploid organisms in one local subpopulation of
individuals against the total population and is calculated as FST = (h — hs)/I’IT with regards
to genetic variation, where the hg and hT are the mean expected heterozygosity of the
subpopulation and total population respectively (Wright 1951). Although this equation
assumes that any given population is in Hardy-Weinberg equilibrium, it is often used to
estimate inter-population gene flow. A more modern Bayesian clustering analysis for
population assignment based on multi-locus genotypes while also estimating population
allele frequency was introduced by Pritchard et al. (2000) and could also be used with the

results of genotyping done with either SNPs or microsatellites (Pritchard et al. 2000).

Downy Mildew Phylogenetics

Since heterothallism has not been reported in many genera, phylogenetic species
concepts are generally accepted for the downy mildews (Hall 1996). The phylogenetic
species concept (PSC) relies on shared ancestry to differentiate between species, rather
than reproductive isolation. A phylogenetic analysis based on ITS sequences done by
Choi et al. (2005) showed P. cubensis to be conspecific with Pseudoperonospora humuli,
the downy mildew of hops (Choi et al. 2005), though it has yet to be confirmed in vivo if
a downy mildew can jump between host plant families. Under PSC, both P. cubensis and

P. humuli would be considered the same species, regardless of their ability to hybridize.

22

There have been several recent and conflicting phylogenies that have attempted to clarify
relationships within the Peronosporaceae (Choi et a1. 2005; Cooke et al. 2000; Goker et
al. 2007; Scott et al. 2004; Thines 2007). A number of recent publications group P.
cubensis sister to Phytophthora species, most notably to P. infestans (Thines 2007), while

others show it to clade within Peronospora (Goker et al. 2007).

A phylogenetic tree depends not only on the appropriateness of the model chosen,
but also on the quality of the gene sequence alignments used. Although multigene
phylogenies, such as the one published by Goker et al. (2007), can yield more true-to-life
results, the alignment of individual genes often place taxa in different positions relative to
one another, resulting in trees with more polytomies, unequivocal branches and lower
scores. Single gene trees, like those presented in most papers to date, will give a window
on how divergence took place in that particular gene, from which the relationship
between taxa must be inferred. The inferences from single gene phylogenies may not
accurately reflect the true relationships within or between taxa (Olsen and Schaal 1999).
The genes used for building phylogenetic trees are the same as for population analysis-
those not under direct selection but with enough polymorphism to separate individuals or
groups. Phylogenetics can be used for other purposes as well; Choi et al. (2003) showed
that the different speciation events in Hyaloperonospora parasitica and related species
reflect their different host families (Choi et al. 2003), and for illustrating geographic

difference.

23

Recently developed phylogeographic analyses can be used to resolve the
relationships between geographical distribution and genealogical lineages, typically
within a species. Since it is predicted that Pseudoperonospora cubensis follows the
successive cucurbit plantings north from over-wintering locations in the southern United
States, it should be possible to determine any geographic variation once the population
has been genotyped. All phylogeographic study depends on there being sufficient genetic
variation in the organism of interest, and it was noted in plants that there are strong
correlations between the amount of geographic distance and the amount of diversity
among populations (Nybom 2004). Nested Cladistic Analysis (NCA) is a method for
observing geographic variation amongst subpopulations (Hammer et al. 1998; Turner et
al. 2000), wherein a phylogenetic guide tree is and generating bootstrap support values
for the branches, followed by defining the evolutionary hierarchy of haplotypes, nested
within larger steps. Geographical coordinates are used to help calculate clade distance.
Posada et al. (2000) developed GeoDis, a computer program that implements NCA
(Posada et al. 2000). Using Phytophthora infestans as a model for global migration (as in
(Goodwin 1997)), it may be possible that the recent severity of the cucurbit downy
mildew epidemic in the United States could have followed the introduction of a single
clonal P. cubensis lineage capable of causing widespread disease in newly susceptible

cultivars.

Along with spatial analyses, temporal differences within species composition can

be assessed phylogenetically. If no living cultures are available, herbarium samples can

be analysed to provide a species snapshot for a particular timepoint. Phylophthora

24

infestans DNA was successfully extracted and genotyped from preserved specimens
dating back to the Irish Potato Famine of 1845 (Ristaino et al. 2001), as was DNA from
Peronospora arborescens from preserved poppy (Montes-Borrego et al. 2009). Visual
assessment of infected herbarium samples has also been documented to measure disease
distribution (Antonovics et al. 2003). The methods for extracting pathogen DNA from
herbarium specimens, along with genotyping current populations, could help resolve how
the populations of P. cubensis in North America have changed over time and to identify

whether or not introduction events have occurred.

Genomic and Bioinformatic Resources

The relatively recent application of computer and information technology in the
field of molecular biology has improved the design and testing of molecular markers.
SNPs can be found either through whole genome comparisons (used mostly for bacteria
due to the size of their genomes) or the comparison of individual sequenced genes,
expressed tag sequences (ESTs) or multigene complexes. The ever-expanding global
network of biological databases means that multiple labs can contribute to the collective
knowledge of a given species on a molecular level. As of February 2008, the number of
annotated sequence records available to the public through National Center for
Biotechnology Information (NCBI)’5 GenBank totaled 82,853,685 and belonged to more
than 260,000 named organisms (Benson et al. 2008). Nucleotide queries can be posted
against all sequences in the database to return likely sequence homologies and, in some

cases, drive new annotation.

25

Previously, the use of SNPs was restricted to researchers working on model
organisms due to the general lack of genomic sequence data (Schlotterer 2004). This is
rapidly being overcome by declining sequencing cost, shorter run times, and greater
access to genetic sequence databases. With their specificity and co-dominance, SNP
markers seem ideally suited for use with obligate pathogens like Pseudoperonospora
cubensis. In Delmotte et al. (2008), SNPs were used to measure how the populations of
the causal agent of sunflower downy mildew, Plasmopara halsredii, changed over a 19-
year period in France (Delmotte et al. 2008) via CAPS (cleaved amplified polymorphic
sequence) analysis. Previously established EST libraries were used to develop markers
for specific polymorphisms amongst the 14 known races for this pathogen, as
characterized by their virulence on sunflower cultivars carrying known resistance genes,
and 24 isolates analyzed. When EST libraries are unavailable, housekeeping or other
genes can be amplified, sequenced and screened for the presence of SNPs. Using this
method, Foster et al. (2008) were able to create a fluorescent probe real-time SNP-based
assay that they could use to distinguish between species of the zoopathogenic bacteria
Brucella (Foster et al. 2008) in a single run. The use of fluorescent probes for the study

of downy mildew populations is currently undocumented.

26

References

Aegerter, B. J., J. J. Nunez, and R. M. Davis. 2003. Environmental factors affecting rose
downy mildew and development of a forecasting model for a nursery production
system. Plant Disease 87: 732-738.

Agnola, B., S. Boury, C. Monot, A. Quillevere, Y. Herve, and D. Silue. 2003. Evidence
that a leaf-disk test allows assessment of isolate-specific resistance in Brassica

oleracea crops against downy mildew (Peronospora parasitica). European
Journal of Plant Pathology 109: 471-478.

Antonovics, J., M. E. Hood, P. H. Thrall, J. Y. Abrams, and G. M. Duthie. 2003.
Herbarium studies on the distribution of anther-smut fungus (Microbotryum
violaceum) and Silene species (Caryophyllaceae) in the eastern United States.
American Journal of Botany 90: 1522-1531.

Avis, J. C. 2004. Molecular Markers, Natural History, and Evolution. Second Edition ed.
Sunderland, MA: Sinauer Associates Inc.

Aylor, D. E. 1990. The role of intermittenet wind in the dispersal of fungal pathogens.
Annual Review of Phytopathology 28: 73-92.

Aylor, D. E. 2003. Spread of plant disease on a continental scale: role of aerial dispersal
of pathogens. Ecology 84: 1989-1997.

Aylor, D. E., W. E. Fry, H. Mayton, and J. L. Andrade-Piedra. 2001. Quantifying the rate
of release and escape of Phytophthora infestans sporangia from a potato canopy
Phytopathology 91: 1 189-1 196.

Babadoost, M. 2001. Downy mildew of cucurbits. In Report on Plant Disease, edited by
University of Illinois Extension. Urbana-Champaign: University of Illinois.

Baker, K. M., W. W. Kirk, J. M. Stein, and J. A. Andersen. 2005. Climatic trends and

potato late blight risk in the upper great lakes region. HortTechnology 15: 510-
518.

Balloux, F ., and N. Lugon-Moulin. 2002. The estimation of population differentiation
with microsatellite markers. Molecular Ecology 1 1: 155-165.

Barnes, W. C. 1948. The performance of Palmetto, a new downy mildew resistant

cucumber variety. Proceedings of the American Society for Horticultural Science
51: 437-441.

27

Barnes, W. C., and W. M. Epps. 1950. Some factors related to the expression of
resistance of cucumbers to downy mildew. Proceedings of the American Society
for Horticultural Science 56: 377-380.

Bedlan, G. 1989. First detection of oospores of Pseudoperonospora cubensis (Berk et
Curt.) Rost. on glasshousse cucumbers in Austria. Pflantzenschutzberichte 50:
119-120.

Benson, D. A., I. Karsch-Mizrachi, D. J. Lipman, J.‘Ostell, and D. L. Wheeler. 2008.
GenBank. Nucleic Acids Research 36 (database issue): D25-30.

Brotman, Y., L. Silberstein, I. Kovalski, C. Perin, C. Dogimont, M. Pitrat, J. Klingler, G.
A. Thompson, and R. Peri-Treves. 2002. Resistance gene homologues in melon

are linked to genetic loci conferring disease and pest resistance. Theoretical and
Applied Genetics 104: 1055-1063.

Byrne, J. M., M. K. Hausbeck, and L. E. Sconyers. 2005. Influence of environment on
atmospheric concentrations of Peronospora antirrhini sporangia in field-grown
snapdragon. Plant Disease 89: 1060-1066.

Campbell, C. L. 1999. The importance of dispersal mechanisms in the epidemiology of
Phytophthora blights and downy mildews on crop plants. Ecosystem Health 5:
146-157.

Casimiro, S., M. Moura, L. Ze-Ze, R. Tenreiro, and A. A. Monteiro. 2004. Internal
transcribed spacer 2 amplicon as a molecular marker for identification of

Peronospora parasitica (crucifer downy mildew). Journal of Applied
Microbiology 96: 579-587.

Chisholm, S. T., G. Coaker, B. Day, and B. J. Staskawicz. 2006. Host-microbe
interactions: shaping the evolution of the plant immune response. Cell 124: 803-
814.

Choi, Y. J., S. B. Hong, and H. D. Shin. 2003. Diversity of the Hyaloperonospora
parasitica complex from core brassicaceous hosts based on ITS rDNA sequences
Mycological Research 107: 1314-1322.

Choi, Y. J., S. B. Hong, and H. D. Shin. 2005. A reconsideration of Pseudoperonospora
cubensis and P. humuli based on molecular and morphological data. Mycological
Research 109: 841-848.

Choi, Y. J ., S. B. Hong, and H. D. Shin. 2006. Genetic diversity within the Albugo
candida complex (Peronosporales, Oomycota) inferred from phylogenetic
analysis of ITS rDNA and COX2 mtDNA sequences. Molecular Phylogenetics
and Evolution 40: 400-409.

28

 

Cochran, F. D. 193 7. Breeding cucumbers for resistance to downy mildew. Proceedings
of the American Society for Horticultural Science 35: 541-543.

Cohen, Y., and J. Rotem. 1971. Field and growth chamber approach to epidemiology of
Pseudoperonospora cubensis on cucumbers. Phytopathology 61: 736-737.

Cohen, Y., M. Perl, and J. Rotem. 1971. The effect of darkness and moisture on
sporulation of Pseudoperonospora cubensis in cucumbers. Phytopathology 61 :
594-595.

Cohen, Y., H. Eyal, J. Hanania, and Z. Malik. 1989. Ultrastructure of Pseudoperonospora
cubensis in muskmelon genotypes susceptible and resistant to downy mildew
Physiological and Molecular Plant Pathology 34: 27-40.

Cohen, Y., I. Meron, N. Mor, and S. Zuriel. 2003. A new pathotype of
Pseudoperonospora cubensis causing downy mildew in cucurbits in Israel.
Phytoparasitica 31: 45 8-466.

Colucci, S., A. C. Thornton, M. L. Adams, and G. J. Holmes. 2005. Delayed fungicide
application to cucumber and its effect on downy mildew severity and yield, 2005.
In NCSU F &N Tests.

Cooke, D. E. L., A. Drenth, J. M. Duncan, G. Wagels, and C. M. Brasier. 2000. A
molecular phylogeny of Phytophthora and related oomycetes. Fungal Genetics
and Biology 30: 17-32.

Danielsen, S. 2001. Heterothallism in Peronosporafarinosa f. sp. chenopodii, the causal
agent of downy mildew of quinoa. Journal of Basic Microbiology 41: 305-308.

Delmotte, F., X. Giresse, S. Richard-Cervera, J. M'Baya, F. Vear, J. Tourvieille, P.
Walser, and D. Tourvieille de Labrouhe. 2008. Single nucleotide polymorphisms
reveal multiple introductions into France of Plasmopara halstedii, the plant
pathogen causing sunflower downy mildew. Infection, Genetics and Evolution 8:
534-540.

Dracatos, P. M., J. L. Dumsday, R. S. Olle, N. O. I. Cogan, M. P. Dobrowolski, M.
F ujimori, H. Roderick, A. V. Stewart, K. F. Smith, and J. W. Foster. 2006.
Development and characterization of EST-SSR markers for the crown rust
pathogen of ryegrass (Puccinia coronata f.sp. lolii). Genome 49: 572-583.

Ellis, J ., A. M. Catanzariti, and P. Dodds. 2006. The problem of how fungal and
oomycete avirulence proteins enter plant cells. Trends in Plant Science 11: 61-63.

Foster, J. T., R. T. Okinaka, R. Svensson, K. Shaw, B. K. De, R. A. Robison, W. S.
Probert, L. J. Kenefic, W. D. Brown, and P. Keim. 2008. Real-time PCR assays of

29

 

 

single-nucleotide polymorphisms defining the major Brucella clades. Journal of
Clinical Microbiology 40: 296-301.

Garnica, D. P., A. M. Pinzon, L. M. Quesada-Ocampo, A. J. Bernal, E. Barreto, N. J.
Grunwald, and S. Restrepo. 2006. Survey and analysis of microsatellites from
transcript sequences in Phythopthora species: frequency, distribution, and
potential as markers for a genus. BMC Genomics 7: 1-11.

Gevens, A. J., R. S. Donahoo, K. H. Lamour, and M. K. Hausbeck. 2007.
Characterization of Phytophthora capsici from Michigan surface irrigation water.
Phytopathology 97: 421 -428.

Gilles, T., K. Phelps, J. P. Clarkson, and R. Kennedy. 2004. Development of
MILIONCAST, an improved model for predicting downy mildew sporulation on
onions. Plant Disease 88: 695-702.

Gobbin, D., I. Pertot, and C. Gessler. 2003. Identification of microsatellite markers for
Plasmopara viticola and establishment of high throughput method for SSR
analysis. European Journal of Plant Pathology 109: 153-164.

Goker, M., H. Voglmayr, A. Reithmuller, and F. Oberwinkler. 2007. How do obligate
parasites evolve? A multi-gene phylogenetic analysis of downy mildews. Fungal
Genetics and Biology 44: 105-122.

Goodwin, S. B. 1997. The population genetics of Phytophthora. Phytopathology 87: 462-
473.

Goodwin, S. B., C. D. Smart, R. W. Sandrock, K. L. Deahl, Z. K. .Punja, and W. E. Fry.
1998. Genetic change within populations of Phytophthora infestans in the United
States and Canada during 1994 to 1996: role of migration and recombination.
Phyt0pathology 88: 939-949.

Grandon, S., and Y. Michalakis. 2002. Local adaptation, evolutionary potential and host-
parasite coevolution: interactions between migration, mutation, popultion size and
generation time. Journal of Evolutionary Biology 15: 451-462.

Grote, D., A. Ohnos, A. Kofoet, J. J. Tuset, E. Bertolini, and M. Cambra. 2002. Specific

and sensitive detection of Phytophthora nicotianae by simple and nested-PCR.
European Journal of Plant Pathology 108: 197-207.

Hall, G. S. 1996. Modern approaches to species concepts in downy mildew. Plant
Pathology 45: 1009-1026.

Hammer, M. F ., T. Karafet, A. Rasanayagam, E. T. Wood, T. K. Altheide, T. Jenkins, R.
C. Griffiths, A. R. Templeton, and S. L. Zegura. 1998. Out of Africa and back

30

again: nested Cladistic analysis of human Y chromosome variation. Molecular
Biology and Evolution 15: 427-441.

Hammer, T. R., M. Thines, and 0. Spring. 2007. Transient expression of GP P in the
obligate biotrophic oomycete Plasmopara halstedii using electroporation and a
mechanoperforation method. Plant Pathology 56: 177-182.

Hardham, A. R. 2006. Cell biology of plant-oomycete interactions. Cellular
Microbiology 9: 3 1-39.

Harrison, J. G., and R. Lowe. 1989. Effects of humidity and air speed on sporulation of
Phytophthora infestans on potato leaves. Plant Pathology 38: 585-591.

Hausbeck, M. K. 2008. Confirmed Downy Mildew Reports in Michigan as of September
I I, 2007 [cited February 22, 2008]. Available from
hnp:/@lar@athology.msu.edu/labs/hausbeck/Research/DM%20map%202007.pdf.

Heist E. P., Nesmith W. C., and C. L. Schardl. 2001. Cocultures of Peronospora tabacina
and Nicotiana Species to Study Host-Pathogen Interactions. Phytopathology 91:
1224-1230.

Holmes, G., T. Wehner, and A. Thornton. 2006. An old enemy re-emerges: downy
mildew rears its ugly head on cucumber, impacting growers up and down the
Eastern US. American Vegetable Grower (February): 14-15;

Hohnes, G., C. Main, T. Keever, and S. Colucci. Cucurbit Downy Mildew Forecast
Homepage 2008 [cited October 21, 2008] Available from
http://www.ces.ncsu.edu/depts/pp/cucurbit/.

Holub, E. 2006. Evolution of parasitic symbioses between plants and filamentous
microorganisms. Current Opinions in Plant Biology 9: 397-405.

1005, R., L. Laugustin, S. Rose, J. Tourvieille, and D. Tourvieille de Labrouhe. 2007.
Development of a PCR test to detect the downy mildew causal agent Plasmopara
halstedii in sunflower seeds. Plant Pathology 56: 209-218.

Ishii, H., B. A. Fraaije, T. Sugiyarna, K. Noguchi, K. Nishimura, T. Takeda, T. Amano,
and D. W. Hollomon. 2001. Occurrence and molecular characterization of

Strobilurin resistance in cucumber powdery mildew and downy mildew.
Phytopathology 91 : 1166-1 171.

Ivors, K., M. Garbelotto, I. D. E. Vries, C. Ruyter-Spira, B. T. E. Hekkert, N.
Rosenzweig, and P. Bonants. 2006. Microsatellite markers identify three lineages
of Phytophthora ramorum in US nurseries, yet single lineages in US forest and
European nursery populations Molecular Ecology 15: 1493-1505.

31

 

Jensen, B. D., J. Hockenhull, and L. Munk. 1999. Seedling and adult plant resistance to
dowy mildew (Peronospora parasitica) in cauliflower (Brassica oleracea convar.
botrytis var. botrytis). Plant Pathology 48: 604-612.

Kamoun, S. 2003. Molecular genetics of Pathogenic oomycetes. Eukaryotic Cell 2: 191-
199.

Kamoun, S. 2006. A catalogue of the effector secretome of plant pathogenic oomycetes.
Annual Review of Phytopathology 44: 41-60.

Karaoglu, H., C. M. Y. Lee, and W. Meyer. 2004. Survey of simple sequence repeats in
completed fungal genomes. Molecular Biology and Evolution 22: 639-649.

Kemen, E., A. C. Kemen, M. Rafiqi, U. Hempel, K. Mendgen, M. Hahn, and R. T.
Voegele. 2005. Identification of a protein from rust fungi transferred from

haustoria into infected plant cells. Molecular Plant-Microbe Interactions 18:
1130-1 139.

LaRota, M., R. V. Kantety, J. K. Yu, and M. E. Sorrells. 2005. Nonrandom distribution
and frequency of genomic and EST-derived microsatellite markers in rice, wheat
and barley. BMC Genomics 6: 1-12.

Lebeda, A., and I. Blok. 1990. Sexual compatibility types of Bremia lactucae isolates
originating from Lactuca serriola. European Journal of Plant Pathology 96: 51-
54.

Lees, A. K., R. Wattier, D. S. Shaw, L. Sullivan, N. A. Williams, and D. E. L. Cooke.
2006. Novel microsatellite markers for the analysis of Phytophthora infestans
populations. Plant Pathology 55: 311-319.

Lievens, B., M. Brouwer, A. C. R. C. Vanachter, B. P. A. Cammue, and B. P. H. T.
Thomma. 2006. Real-time PCR for detection and quantification of fungal and

oomycete tomato pathogens in plant and soil samples. Plant Science 171: 155-
165.

Lopez, C., B. Peigu, R. Cooke, M. Delseny, J. Tohme, and V. Verdier. 2005. Using
cDNA and genomic sequences as tools to develop SNP strategies in cassava

(Manihot esculenta Crantz). Theoretical and Applied Genetics 110: 425-431.

McDonald, B. A., and C. Linde. 2002. Pathogen population genetics, evolutionary
potential, and durable resistance Annual Review of Phytopathology 40: 349-379.

Mendgen, K., and M. Hahn. 2002. Plant infection and the establishment of fungal
biotrophy. Trends in Plant Science 7: 352-356.

32

MGS Horticultural Inc. 2006. Out and About in Southwestern Ontario. In BioBuzz: A
Growers Reference to Biologicals.

Mieslerova, B., I. Petrzelova, A. Lebeda, and E. Cesnekova. 2007. Occurence of lettuce
downy mildew and powdery mildew in natural populations of prickly lettuce. In
Advances in Downy Mildew Research, Volume 3 edited by A. Lebeda and P. T. N.
Spencer-Phillips. Olomouc: Palacky University and JOLA, v.o.s., Kostelec na
Hane.

Mitani, S., S. Araki, T. Yamaguchi, Y. Takii, T. Ohshima, and N. Matsuo. 2001.
Biological properties of the novel fungicide cyazofamid against Phytophthora
infestans on tomato and Pseudoperonospora cubensis on cucumber. Pest
Management Science 58: 139-145.

Montes-Borrego, M., F. J. Mufioz Ledesma, R. M. Jiménez-Diaz, and B. B. Landa. 2009.
A nested-polymerase chain reaction protocol for detection and population biology
studies of Peronospora arborescens, the downy mildew pathogen of opium

poppy, using herbarium specimens and asymptomatic, fresh plant tissues.
Phytopathology 99: 73-81.

Morin, P. A., N. C. Aitken, N. Rubio-Cisneros, A. E. Dizon, and S. Mesnick. 2007.
Characterization of 18 SNP markers for sperm whale (Physeter macrocephalus).
Molecular Ecology Notes 7: 626-630.

Moss, M. A. 1987. Resistance to metalaxyl in the Pseudoperonospora cubensis
population causing downy mildew of cucumber in South Florida. Plant Disease
71: 1045.

Nathan, R., N. Sapir, A. Trakhtenbrot, G. G. Katul, G. Bohrer, M. Otte, R. Avissar, M. B.
Soons, H. S. Horn, M. Wikelski, and S. A. Levin. 2005. Long-distance biological
transport processes through the air: can nature's complexity be unfolded in silico?
Diversity and Distributions 11: 131-137.

Ngouajio, M., G. Wang, and M. K. Hausbeck. 2006. Changes in pickling cucumber yield
and economic value in response to planting density. Crop Science 46: 1570-1575.

Nybom, H. 2004. Comparison of different nuclear DNA markers for estimating
intraspecific genetic diversity in plants. Molecular Ecology 13: 1143-1155.

O'Connell, R. J ., and R. Panstruga. 2006. Téte-a-téte inside the plant cell: establishing

compatibility between plants and biotrophic fungi and oomycetes. New
Phytologist 171 : 699-718.

O'Neill, T. M., D. Pye, and T. Locke. 2002. The effect of fungicides, irrigation and plant

density on the development of Peronospora sparsa, the cause of downy mildew
in rose and blackberry. Annals of Applied Biology 140: 207-214.

33

 

Olsen, K. M., and B. A. Schaal. 1999. Evidence on the origin of cassava: phylogeography
of Manihot esculenta. Procedings of the National Academy of Science 96: 5586-
5591.

Padgett-Johnson, M., and F. Laemmlen. date unknown. Downy mildew of lettuce
(Bremia lactucae): biology, disease symptoms and damage. Using the Downy
Mildew Index Model for disease management.

Panstruga, R. 2003. Establishing compatibility between plants and obligate biotrophic
pathogens. Current Opinions in Plant Biology 6: 320-326.

Ponchet, M., F. Panabieres, M. L. Milat, V. Mikes, J. L. Montillet, L. Suty, C.
Triantaphylides, Y. Tirilly, and J. P. Blein. 1999. Are elicitins cryptograms in

plant-oomycete interactions? Cellular and Molecular Life Sciences 56: 1020-
1047.

Posada, D., K. A. Crandall, and A. R. Templeton. 2000. GeoDis: a program for the
Cladistic nested analysis of the geographical distribution of genetic haplotypes.
Molecular Ecology 9: 487-488.

Pritchard, J. K., M. Stephens, and P. Donnelly. 2000. Inference of population structure
using multilocus genotypic data. Genetics 155: 945-959.

Prospero, S., J. A. Black, and L. M. Winton. 2004. Isolation and characterization of
microsatellite markers in Phytophthora ramorum, the causal agent of sudden oak
death. Molecular Ecology Notes 4: 672-674.

Rehmany, A. P., A. Gordon, L. E. Rose, R. L. Allen, M. R. Armstrong, S. C. Whisson, S.
Kamoun, B. M. Tyler, P. R. J. Birch, and J. L. Beynon. 2005. Differential
recognition of highly divergent downy mildew avirulence gene alleles by RPPI
resistance genes from two Arabidopsis lines. Plant Cell 17: 1839-1850.

Reithmuller, A., H. Voglmayr, M. Goker, M. Weiss, and F. Oberwinkler. 2002.
Phylogenetic relationships of the downy mildews (Peronosporales) and related

groups based on nuclear large subunit ribosomal DNA sequences Mycologia 94:
834-849.

Renner, S. S., H. Schaefer, and A. Kocyan. 2007. Phylogenetics of Cucumis
(Cucurbitaceae): cucumber (C. sativus) belongs in an Asian/Australian clade far

from melon. BMC Evolutionary Biology 7: 1-11.

Reuveni, M., H. Eyal, and Y. Cohen. 1980. Development of resistance to Metalaxyl in
Pseudoperonospora cubensis. Plant Disease 64: 1108.

34

Ristaino, J. B., C. T. Groves, and G. R. Parra. 2001. PCR amplification of the Irish potato
famine pathogen from historic specimens. Nature 411: 695-697.

Roeckel-Drevet, P., J. Tourvieille, T. J. Gulya, G. Charmet, P. Nicolas, and D.
Tourvieille de Labrouhe. 2003. Molecular variability of sunflower downy mildew,

Plasmopara halstedii, from different continents. Canadian Journal of
Microbiology 49: 492-502.

Sakata, Y., N. Kubo, M. Morishita, E. Kitadani, M. Sugiyama, and M. Hirai. 2006. QTL
analysis of powdery mildew resistance in cucumber (Cucumis sativus L.).
Theoretical and Applied Genetics 112: 243-250.

Scherm, H., and A. H. C. van Bruggen. 1994. Weather variables associated with infection
of lettuce by downy mildew (Bremia lactucae) in coastal California.
Phytopatholog/ 84: 860-865.

Schldtterer, C. 2000. Evolutionary dymanics of microsatellite DNA. Chromosoma 109:
365-371.

Schlotterer, C. 2004. The evolution of molecular markers- just a matter of fashion?
Nature Reviews 5: 63-67.

Scott, J. B., F. S. Hay, and C. R. Wilson. 2004. Phylogenetic analysis of the downy
mildew pathogen of oilseed poppy in Tasmania, and its detection by PCR.
Mycological Research 108 (2): 198-205.

Shi, Y., B. Li, and X. Liu. 2005. Several infection factors of Pseudoperonospora
cubensis. Y ing Yong Sheng Tai Xue Bao 16: 257-261. (abstract only)

Singru, R., S. Sivaramakrishnan, R. P. Thakur, V. S. Gupta, and P. K. Ranjekar. 2003.
Detection of genetic variability in pearl millet downy mildew (Sclerospora
graminicola) by AFLP. Biochemical Genetics 41: 361-374.

Sousa, M. A., J. S. Dias, and A. A. Monteiro. 1997. Screening Portuguese cole land races

for resistance to seven indigenous downy mildew isolates. Scientia Horticulturae
68: 49-58.

Spencer, D. M. 1981. The Downy Mildews. Edited by D. M. Spencer. London: Academic
Press Inc.

Spring, 0., and R. Zipper. 2006. Evidence for asexual genetic recombination in sunflower
downy mildew, Plasmopara halstedii. Mycological Research 1 10: 657-663.

Taler, D., M. Galperin, 1. Benjamin, Y. Cohen, and D. Kenigsbuch. 2004. Plant eR genes

that encode photorespiratory enzymes confer resistance against disease. Plant Cell
16: 172-184.

35

Thines, M. 2007. Characterisation and phylogeny of repeated elements giving rise to
exceptional length of ITS2 in several downy mildew genera (Peronosporaceae).
Fungal Genetics and Biology 44: 199-207.

Thomas, C. E. 1996. Downy Mildew. In Compendium of Cucurbit Diseases, edited by T.
A. Zitter, D. L. Hopkins and C. E. Thomas. St. Paul, Minnesota: APS Press.

Turner, T. F ., J. C. Trexler, J. L. Han'is, and J. L. Haynes. 2000. Nested Cladistic analysis
indicates population fragmentation shapes genetic diversity in a freshwater
mussel. Genetics 154: 777-785.

Urban, J ., and A. Lebeda. 2006. Fungicide resistance in cucurbit downy mildew-

methodological, biological and population aspects. Annals of Applied Biology
149: 63-75.

Van de Peer, Y., and R. DeWatcher. 1997. Evolutionary relationships among eukaryotic
crown taxa taking into account site-to-site rate variation in 18S rRNA. Journal of
Molecular Evolution 45: 1-9.

Vos, P., R. Hogers, M. Bleeker, M. Reijans, T. van de Lee, M. Homes, A. Friters, J. Pot,
J. Paleman, M. Kuiper, and M. Zabeau. 1995. AP LP: a new technique for DNA
fingerprinting. Nucleic Acids Research 23: 4407-4414.

Wangsomboondee, T., and J. B. Ristaino. 2002. Optimization of sample size and DNA
extraction methods to improve PCR detection of different propagules of
Phytophthora infestans. Plant Disease 86: 247-253.

Wehner, T. C. 2007. Cucumber crop information- downy mildew resistance North
Carolina State University, 2006 [cited June 15, 2007]. Available from
http://cukehort.ncsu.edu/cucurbit/cuke/cukehndbk/cukedownymildew.htm.

Wehner, T. C., and N. V. Shetty. 1997. Downy mildew resistance of the cucumber
germplasm collection in North Carolina field tests. Crop Science 37: 1331-1340.

Werner, S., U. Steiner, R. Becher, A. Kortekamp, E. Zyprian, and H. B. Deising. 2002.
Chitin synthase during in planta growth and asexual propagation of the cellulosic
oomycete and obligate biotrophic grapevine pathogen Plasmopara viticola. FEMS
Microbiological Letters 208: 169-173.

Wong, F. P., and W. F. Wilcox. 2000. Distribution of baseline sensitivities to
Azoxystrobin among isolates of Plasmopara viticola. Plant Disease 84: 275-281.

Wright, S. 1951. The genetical structure of populations. Annals of Eugenics 15: 323-351.

36

Wu, B. M., K. V. Subbarao, and A. H. C. van Bruggen. 2000. Factors affecting the
survival of Bremia lactucae spornagia deposited on lettuce leaves.
Phytopathology 90: 827-833.

Zhan, J ., C. C. Mundt, M. E. Hoffer, and B. A. McDonald. 2002. Local adaptation and
effect of host genotype on the rate of pathogen evolution: an experimental test in a
plant pathosystem. Journal of Evolutionary Biology 15: 634-647.

Zhang, Z. G., Y. Q. Li, H. Fan, Y. C. Wang, and X. B. Zheng. 2006. Molecular detection
of Phytophthora capsici in infected plant tissues, soil and water. Plant Pathology
55: 770-775.

Zhu, S., P. Liu, X. Liu, J. Li, S. Yuan, and N. Si. 2008. Assessing the risk of resistance in

Pseudoperonospora cubensis to the fungicide flumorph in vitro. Pest
Management Science 64: 25 5-261.

37

CHAPTER 2

Developing a High-Throughput, SNP-Based Population Screening Method for
Pseudoperonospora cubensis

38

 

 

Introduction

Downy mildew, caused by the obligate biotrophic oomycete Pseudoperonospora
cubensis (Berk. & M.A. Curtis) Rostovzev 1903, is responsible for increasingly severe
economic losses over the last 4 years for cucurbit growers in the United States. Breeding
efforts in the 19405 and 19505 and the successive plantings of the resulting resistant
cultivars (Barnes 1948; J. Mitchell Jenkins 1942), were once sufficient to make downy
mildew rare in the field, with little to no management necessary to control the disease.
The resurgence in downy mildew in 2004 in the Eastern United States took Michigan
growers by surprise; requiring intense fungicide applications that cut into narrow profit

margins.

P. cubensis can cause disease on a number of cucurbit crops including
cantaloupe, watermelon, hard squash, pumpkin, various gourds and all types of
cucumber, which account for the largest amount of susceptible acres; approximately 60
thousand hectares of fresh market and pickling varieties harvested last year (USDA
2008). Michigan ranks number one in the amount of processing cucumbers (and fourth
in fresh market cucumbers) grown in the United States. Cucumbers alone represent over
40 million dollars to the state economy, with roughly 18 615 hectares planted in 2005
(Michigan Agricultural Statistics 2006), though the price per weight of both processing
and fresh market cucumbers has been in steady decline since 2001. The cucumbers

(Cucumis sativus L.) grown in the US, especially those used for processing, have a

39

 

narrow genetic base and overall yield has reached a plateau in the last 15 years (Fan et a1.

2006)

P. cubensis has become a major constraint in the production of cucurbits in the
Eastern United States with costly spray regimes required to limit epidemics. In North
America, where no oospores have been found to date, this pathogen follows successive
warm weather plantings of cucurbit crops north from over-wintering sites in southern
Florida or Texas by means of long-range aerial transport of sporangia (Holmes et al.
2008). Unfortunately, there have been no studies to date that support this hypothesis by
either examining P. cubensis subpopulations found in the Midwest and comparing them
with the early season strains in the South, or by accurately predicting new outbreaks with
forecasting models. An examination of geographically separate isolates may support

long distance transport events or provide avenues for other possibilities

Developing a better understanding of the current populations of P. cubensis in the
United States would help with cucurbit resistance breeding efforts and disease
management. Despite the segregation of other downy mildew species based on their
respective hosts families, very few studies have been done looking at within-species
variation (Choi et al. 2006; Delmotte et al. 2008; Montes-Borrego et al. 2009; Roeckel-
Drevet et al. 2003), and none for P. cubensis. The development of a high-throughput
method would allow for the screening of a broad range of isolates for distinct, identifying
polymorphisms to describe the North American P. cubensis. A number of molecular

tools, including using AFLPs and microsatellites as genetic markers, have traditionally

40

been used to classify populations of microorganisms. Since downy mildew is an obligate
pathogen, a method that is highly pathogen specific is needed. To overcome these
hurdles, a single nucleotide polymorphism (SNP)-genotyping assay based on Taqman®
chemistry (Livak et al. 1995) was designed and tested in a trial population of 205 mixed
Pseudoperonospora cubensis isolates gathered over 2 years. Assay performance was

tested and a method for finding and characterizing SNPs discussed.

Materials and methods
Sample acquisition

Downy mildew-infected cucurbit leaf tissue was obtained from various breeders,
growers, professors and extension agents during the 2007 and 2008 growing seasons. In
2007, samples were obtained from May 10th through until November 26th, and in 2008
samples were obtained from May 5th through December 5'“. Nine cucurbit growing
States (Florida, Georgia, Indiana, Michigan, New York, North Carolina, Ohio, South
Carolina and Texas) were represented in the 2007 sample collection, and 11 cucurbit
growing States in 2008 (Florida, Georgia, Indiana, Michigan, New York, North Carolina,
Ohio, Pennsylvania, South Carolina, Texas and Virginia). Samples from Delaware that
predate the severe downy mildew epidemic were obtained via NC SU and samples from
Israel for both 2007 and 2008 were obtained. Crops represented in the 2007 and 2008
collections are summarized in Table 1, and the full list of all samples collected appears in
Appendix 2. Approximately 10 to 20 symptomatic leaves were collected from affected

plots or fields. All samples were refrigerated prior to being processed in the lab.

41

 

 

2007

 

State

 

Host

FL GA IN MI NC NY OH PA SC TX VA

 

 

 

 

 

 

 

 

 

 

 

acorn squash (Cucurbita pepo subs. pepo)

 

bitter gourd (Cucurbita momordica)

 

bottle gourd (Lagenaria vulgaris)

 

cantaloupe (C ucumis melo var. reticulatus)

X X X

 

cucumber (C ucumis sativus)

XXX X

 

melon (Cucumis melo)

 

oriental pickling melon (C ucumis melo var. conomon)

X
X
><><><><><><

 

pumpkin (Cucurbita maxima)

 

hard squash (C ucurbita moschata)

 

snap melon (Cucumis melo var. acidulous)

 

Texas gourd (Cucurbita pepo var. texana)

 

 

watermelon (Citrullus lanatus)

X

 

2008

 

State

 

Host

FLIGA] rNIMrlrflNYIOHIPAISCITXIVA

 

acorn squash (Cucurbita pepo subs. pepo)

X X

 

bitter gourd (Cucurbita momordica)

 

bottle gourd (Lagenaria vulgaris)

 

cantaloupe (Cucumis melo var. reticulatus)

 

cucumber (Cucumis sativus)

><><><
XX
X

X

X

X

><

X

X

X

 

melon (Cucumis melo)

 

oriental pickling melon (Cucumis melo var. conomon)

 

pumpkin (C ucurbita maxima)

 

hard squash (Cucurbita moschata)

 

snap melon (Cucumis melo var. acidulous)

 

Texas gourd (Cucurbita pepo var. texana)

 

 

watermelon (Citrullus Ianatus)

 

 

X X

 

Table 1: Summary of samples collected. This table shows the type of samples collected from 2007
(top) or 2008 (bottom) growing seasons with respect 0 their host crop and State or origin.

42

 

 

A total of 552 samples were collected and processed in duplicate in 2007, and 589
samples in 2008. Eight samples were received from Israel from both 2007 and 2008, and
6 samples were received from elsewhere in the EU (The Netherlands, Spain, Italy and

Turkey, collectively) dating from 2001 to 2008.

Tissue preparation

Once the infected material arrived in the lab, all packaging was opened in a class
II biosafety cabinet and the samples were examined and evaluated. Each leaf was
observed using a stereoscope (Olympus SZ61, Olympus America, Inc., Center Valley,
PA) between 10x and 40x magnification to locate infected areas. Leaves with adequate
infection were placed in a ziploc bag and given an identification number. Nine 8-mm
disks were excised using a sterilized cork borer. Three disks were removed from each of
3 areas of the infected leaf. Each set of 3 leaf disks (approximately 200 mg total weight)
were lifted from the surrounding tissue with sterilized forceps and placed into a clean 1.7
ml microcentrifuge tube. Two of the tubes for each sample leaf were kept frozen in
-20°C storage until DNA extraction was performed, while the third was maintained in
cryogenic storage (-80°C). Leaf tissue remaining after the disks were removed was

rescaled and stored at -20°C.

DNA extraction
A phenol-chloroform manual DNA extraction protocol developed for fungi and
modified for use with oomycetes was used for the extraction of genomic DNA from the

P. cubensis-infected leaf material. The sample sets maintained in -20°C storage were

43

placed in liquid nitrogen until frozen prior to DNA extraction. Samples were then ground 5'
using a sterile pestle, recooling as needed, and 250 pl of CTAB extraction buffer (1% w/v
CTAB, 50 mM TRIS pH 8.0, 10 mM NazEDTA, 0.7 M NaCl, with 1% [3-
mercaptoethanol added right before use) was added to each tube. The sample was
suspended in the buffer via gentle grinding or shaking, using a pestle vortexer when
necessary.

The samples were incubated with the extraction buffer in a 65°C water for 40
minutes followed by the addition of 250 u] of phenol-chloroforrn (25 parts phenol, 24
parts chloroform and 1 part isoamyl alcohol) to each tube. The tubes were capped, and
shaken periodically through a 5 minute, room-temperature incubation step to form an
emulsion. Samples were then spun in a microcentrifuge at 13 000 x g for 10 minutes.
After centrifugation, the upper aqueous layer was transferred to a new microcentrifuge
tube and 25 pl of RNAse A (working solution of 10 ug/ml) was added and then incubated
at 37°C for 30 minutes. After incubation, 125 pl of chloroform (24 parts chloroform to 1
part isoamyl alcohol) was added, shaken to form an emulsion and spun in a
microcentrifuge again for 13 000 x g for 10 minutes. The upper aqueous layer was
transferred into a sterile microcentrifuge tube and 125 pl of ice-cold isopropyl alcohol
was added. The tube was inverted to mix the contents. If no precipitate was visible, the
samples were incubated on ice for one hour. If precipitate was visible, samples were
immediately centrifuged for 5 minutes at 13 000 x g. Following the centrifugation, the
alcohol was discarded and the DNA pellet was washed with 100 ill of cold ethanol,
centrifuged again at 13 000 x g for 5 minutes and the tubes containing the pellets were

inverted on a drying rack. Once the pellets dried and no alcohol remained in the tubes,

44

 

40 ul of 10 mM TRIS pH 8.0 was used to resuspend the DNA and 1 ul of the sample was
mixed with 2 to 3 ul of bromophenol blue/ glycerol dye, loaded into a 1% agarose gel
and checked by electrophoresis. Successful DNA extractions were characterized by the
presence of a distinct, high molecular weight band, with little or no evidence of lower
molecular weight degradation products (see Figure 3). If no DNA was obtained, the
original leaf tissue was removed from storage and a new set of disks excised and treated
as described previously. A sample was removed from analysis if no DNA was obtained

from 3 sets of disks.
The amount of DNA obtained from extraction ranged from approximately 8ng

through 857ng per sample and all DNA concentrations were standardized to 5ng/uL prior

to running analyses.

45

f

""".w-. -
v F ‘

 

Figure 3: Typical DNA extraction results. The above shows the quantity and quality of DNA obtained
from leaf disk sets after phenol-chloroforrn extraction. The variability in the samples is visible when 1 pl
of DNA is run on a 1% agarose gel. Lanes 1 and 24 are 1 Kb+ DNA ladder (Invitrogen Corporation,
Carlsbad, CA) and the arrow indicates 12 000 base pairs. The samples are 478a (left) through 488b (right)
from the 2008 sample set.

46

Primer design and PCR

Since little P. cubensis sequence was available through the public databases or
elsewhere until very recently, the initial primer design was limited to targeting known
genes from related oomycetes then testing them with P. cubensis. Primers were designed
by scanning GenBank (Benson et al. 2008) for suitable neutral genes in other downy
mildews, Phytophthora, and Pythium species. The following genes were selected in this
manner: 28 large ribosomal subunit (LSU) from Pseudoperonospora cubensis; B-tubulin
(BTUB), heat-shock protein 90 (HSP90), cytochrome oxidase subunit 1 (COXl), internal
transcribed spacer 2 (ITS2), internal transcribed spacer 4 (ITS4), ribosomal protein L10
(RPTIO), and a B-glucanase (BGLU) from Phytophthora infestans; NADH
dehydrogenase subunit 1 (N ADHI), internal transcribed spacer 1 (ITSl) and cytochrome
oxidase subunit 2 (COX2) from Hyaloperonospora arabidopsidis; and apocytochrome B
(COB) from Plasmopara viticola. Published primers were also tested, including the
nested B-tubulin primers published in Goker et al. (Goker et al. 2007). Potential genes
were not used if highly similar plant accessions were obtained after nucleotide BLASTs
were performed against NCBI’s GenBank databases (Benson et al. 2008). Initial
amplification by polymerase chain reaction was carried out at both 55°C and 58°C
annealing temperatures to maximize binding and amplification in a Bio-Rad MyCycler
thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA) using the following thermal
cycling program: 5 minutes at 94°C, then 35 cycles of 1 minute at 94°C, 1 minute at
annealing temperature, 1 minute at 72°C, and a 10 minute final extension step at 72°C.
Samples were amplified in 50 ul aliquots containing 26 ul double distilled water, 6 u]

primer mix (0.1 uM each forward and reverse), 5 ul 10x PCR buffer (500 mM KCl, 100

47

mM Tris-HCI pH 9.0 and 1% w/v Triton-X), 5 ul dimethyl sulfoxide (1/3 v/v with
ddeO), 5 ul 10x deoxynucleoside triphosphates (dNTPs), 2 ul of Taq polymerase and 1
pl of DNA template. If no amplification was achieved, the annealing temperature was
lowered to 52°C and the PCR was run again. Primers were discarded from further
analysis if no amplification occurred at the lowest temperature. All PCR reactions were
run using 3 P. cubensis isolates as well as Phytophtora infestans and non-infected
cucumber DNA for controls. After thermal cycling, 5 ul of PCR product was run on a
2% agarose gel to check amplification. A minimum of 3 isolates were amplified and

sequenced to derive new P. cubensis-specific primers.

With the recent availability of the first draft of the Pseudoperonospora cubensis
genome (Tian and Day, unpublished), different approaches to finding suitable sequence
can be used. Local BLAST (basic local glignment search 1001) analysis of the
Pseudoperonospora cubensis genome against the Hyaloperonospora arabidopsidis and
the Phytophthora ramorum genomes were helpful in locating areas in which to look for
SNPs. Primers were designed for areas with sequence homology to the following genes:
catalase/peroxidase (CatPer), GTP cyclohydrolase II for riboflavin biosynthesis
(GTPC2), SEC (SECRET AGENT) transferase (SECI), pecyin lyase (PL2), disulfide
isomerase (tigA), Chitin synthase (ChiSyn), pleiotropic drug resistance transporter
(PDRl), and a endo-1,3-beta-g1ucanase (BGLU). Primers were designed as before and
the same initial PCR conditions were used. A summary of the genes used, their sources

and outcomes, is presented in Table 2.

48

 

.com:
new cocwuoe v.03 wee—Ea 2,28%;— Zm 20:3 magnate ... of. 6335 eocwfiov 203 333 So: no 3523 use .2meva 888% 29$ mn— Zm .: .Aoocoscomv
383.com 33 532.285 8:263 .2 A38}: BEBE“ com BEE m 8: .o 852:: maniac—Ea 269m 2:. .EoEta “Ea 8:0» He Pas—gm "N «33.

 

 

 

- - - - 3 MS B<oou<ooot<ooue<<o<eo< oo<uu<<oo<u<oot<<<uo<oe ease as 3::

- - - + 3 mm un<<<oooo<<o<<<u<ooo<<oo <Loe<<eeouuto<<o<uuooo< asses as 3..

- - + + an an oeuo<<u<oo5uo5e<euot< Be<uo<<<ooo55o<<eoooe ease as 6%

- - - - .3 SN Eoo<ooEouou<oC<ou<e <<<ooo<o52bn<o<<ooeooe ease as NEE

- - + + an m: E<e<oouoo<oe<o<5o<oto cocooeoe<<toooo<<<o<ooe ease E 5&5

- - + + S can Cotooe<o<ootue<e<oou< too<ooo<<u<o5ue§ooo<< asses am 38

- - + + a. E <88<<ooe<<<uo<o<uoEo <ooeoo<<<oo<ouootoe<u<e asses as imam

- - - + a. a2 Cocooo<<e<otoe<<o<uuoe <<uuoeouoe<e<<eooou<o<<e 3:38 as <w=

- + + + B as So<u<oo<t< o2 oo< «cocoon <oo<u< <o<ooouo<e<oto<oe aces... i E:

+ + + + 3 8m B<Bu<oe<o<uoEooo<ooe E<<utooe<<<oo<u<u<uooo seas f .825

+ + + + 3 «mm ouuoeoeoeoo.E<uo<<oto< uo<<unooeuoE<uo<otoo< assess an .525

- - - + an new <otooooo<oeeooo<e<§<oe <<o<<oeo<<<o<<o<<ouoooeu asses? f 8%:

- - - - 3 8m <u<<e<uouooo5<to<ou<u< S<Eoe<u<ou<uoooooe<5 scene 4: 38o

- + + + a. E <oo<oouoou<<t<ooeoE<o Cocoootu<oot<e<uoo<<o ass? i mm:

- + + + 3 8n uo<oo<<oo<§oonooe<<<oo< oo<E<ooB<oEoo<ooCo<< assesses a: :E<z

- - - - 3 EN B<ototooo<uout<<ooon CoeBeBoEeooéCoeée assesses a: a:

- + + + S m: o<<oooo<e<ooo<<oe<<eoooe <ooo<o<eotoeo<<uo<uuue< endorses a: 88o

- + + + B .8 Boe<oou<<uu<ut<u<oo<o< 508<E<uoeu<ouooe<oe eases .E moo

- - + + S 5. <oo<o<<o<uoooo<e<oto<oe <oooo<BoB<E<eEooBoe asses E :3
%< Em 2m cocozdom .255 cam 8:258 BEE 0333. 8.38 .255 Easter,— ooczom ocoo

 

 

 

 

 

 

 

 

 

 

49

Restriction digest of genomic DNA was also utilized as a method for
polymorphism discovery. DNA was extracted from both infected and clean cucumber
tissue (cultivar- Vlaspik) using the Qiagen DNeasy Plant mini kit (Qiagen Inc., Valencia,
CA), quantified using a Thermo Scientific NanoDropTM 1000 Spectrophotometer
(NanoDrop products, Wilmington, DE) and standardized to 5 ng. Digests were
preformed overnight at 37°C using EcoRI and HindIII enzymes and their respective
buffers (New England Biolabs Inc., Ipswich, MA). After digestion of the sample DNA
and 7» DNA, the fragments were precipitated with ethanol and resaturated in 40 ul of 10
mM TRIS pH 8.0. Ten microliters of bromophenol blue/ glycerol dye was added to each
tube and the samples were run on a 4% agarose gel in TRIS-borate buffer (TBE) and

visualized after ethidiurn bromide staining.

Sequencing and SNP detection

Once P. cubensis-specific primers were validated, a sample set of diverse isolates
was amplified from the 2007 sample collection. Twelve individuals with adequate DNA
for both A and B sets were selected based on their host crop, date of collection and
location. Members of the initial test population included cucumber from Delaware
(collected prior to 2004, from DuPont via NCSU), cucumber from Michigan (06.26.07,
Monroe County), cantaloupe from North Carolina (07.18.07, Sampson County),
cantaloupe from Texas (07.24.07, Tom Green County), cucumber from Ohio (07.31.07,
Erie County), melon from Michigan (08.10.07, Clinton County), watermelon from North

Carolina (08.10.07, Sampson County), cucumber from New York (08.21.07, Ontario

50

County), pumpkin from Indiana (09.19.07, La Porte County), acorn squash from New
York (09.20.07, Suffolk County), cucumber from South Carolina (09.27.02, Charleston
County) and cucumber from Florida (11.26.07, Collier County). After PCR, the samples
were prepared for sequencing by either column purification (IsoPureTM PCR purification
Kit, Denville Scientific Inc., Metuchen, NJ) or by direct purification from the agarose gel
(GenElute"' Gel Extraction Kit, Sigma-Aldrich Corp., St. Louis, MO), following
manufacturers protocols. In either case, the final elution step was carried out with 50 ul

of buffer and. dried to half volume using a speedvac.

After cleaning, 9 ul of purified DNA was combined with 3 ul of either forward or
reverse primer and submitted for sequencing. DNA sequencing was performed onsite
using an ABI 3730 Genetic Analyzer (Applied Biosystems, Foster City, CA). The output
was coded and accessible by logging into a designated server. Completed sequence files
were downloaded and imported into SequencherTM (Gene Codes Corp., Ann Arbor, MI), a
multiple alignment and DNA sequence editing software program. Folders of gene-
specific sequence were imported and a DNA algorithm selected. Minimum match
percentages were set at 85 or higher whenever possible, and the minimum overlap
percentage was set to 20. Once initial alignments were made, sequence ends were
trimmed and everything was realigned. Prospective SNPs were checked by scrutinizing
their chromatograms to ensure that reported peaks were true peaks. Whenever a

prospective SNP was doubtful, it was eliminated from future assays.

51

 

TaqMan® assay design and real-time PCR

When SNPs were identified for a particular gene, the sequence was imported into
Applied Biosystem’s F ileBuilder 3.1 software prior to custom assay design. SNPs were
masked as requested and uploaded to the ABI website. Once ordered, sequence specific
primers and fluorescent probes were created and shipped. The probes, between 14 and 16
bases in length, contain a fluorophore (either VIC (a proprietary ABI fluorophore) or
FAM (6-carboxyfluorescein) depending on the base detected, see Table 3) at the 5’ end
and a minor groove binding non-fluorescent quencher (ABI) at the 3’ end. Before the full
test population was screened, the DNA and primer/probe concentrations were optimized.
All optimization was done at 10 ul reaction volumes, in triplicate, and run in an ABI
PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA). The
initial 2-step real-time PCR program is as follows; 10 minutes at 95°C, followed by 36
cycles of 92°C for 15 seconds and 60°C for one minute. Due to the mixed template, dual
amplification towards the end of 40 cycles was observed leading to the number of cycles
being shortened from regular protocols. DNA samples from the primer test population
were quantified at 260 nm 7» using a Thermo Scientific NanoDropTM 1000
Spectrophotometer (N anoDrop products, Wilmington, DE) and ten-fold serial dilutions
were performed for DNA from 20 ng down to 2 fg. Although fluorescence was detected
at DNA concentrations as low as 20 pg, optimal results were obtained around 5 ng of
template. Primer/probe dilutions were also performed from the standard 900 nM primers
and 200 nM probes down to 100 mM primers and 22 mM probe. No improvement was
observed so the primer/probe concentrations were left as standard. Three different types

of masterrnix were also tested; TaqMan® Universal PCR Master Mix (Applied

52

Biosystems, Foster City, CA), TaqMan® Genotyping Master Mix (Applied Biosystems,
Foster City, CA), and Type-it Fast SNP Probe PCR Kit (Qiagen lnc., Valencia, CA).
Due to the mixed DNA template, it was determined that the lower specificity of the
universal mastermix was preferable. Once the optimization was complete, reaction
volume was decreased to 5 pl (2.375 ul DNA template, 2.5 ul of the enzyme master mix
and 0.125 ul primer/probe) and a trial population of 213 isolates was screened in either

96 or 384 well plate format.

A non-template control was present in every run, and runs began with an allelic
discrimination pre-read to establish baseline fluorescence and ended with a final post-
read prior to allele calling. Although plates can be run on a regular (not real-time)
thermal cycling platform, the mixed P. cubensis-host template may yield a small amount
of non-specific fluorescence, and therefore all samples were run in real-time with reporter
fluorescence checked manually before allele assignment. Pre- and post-reads were
compared to determine allele call. During the post-read, the run data was normalized for
each allele and a genotype call is made for allele x (homozygote 1), allele y (homozygote
2), or a mix of both alleles (heterozygote). Samples that returned neither probe were
labeled as NR (no result). Allele calls for the members of the trial population are

summarized in Appendix 1.

53

 

 

 

 

 

 

 

 

 

 

 

 

Target Direction Primers Dye Probes

BTUB A Forward TCGGTGC'ITGACGTCGTT VIC C'ITCCGCTTCCTTI‘C
Reverse ACCAAGAGAGTGAGTGATCTGGAAA FAM CTTCCGATTCCT'ITC

BTUB D F onward TCCAGATCACTCACTCTCTTGGT VIC CCGGGTCCGGCATG
Reverse GGTACTC'ITCCCGAATCT'ITGAGA FA M CCGGGTCC AGCATG

BTUB E Forward GAGCCCTACAACGCTACGT VIC TGCACCAGCTTGTC
Reverse GCACATGAC'ITCATCGGCATITI‘ FA M TGCACCAACTTGTC

BTUB F Forward TCATGTGCCTGGACAACGAA VIC CCCTGTACGACATTT
Reverse AAATGGTTCAAGTCACCGTACGT FA M CCCTGTACAACA‘I'IT

BTUB G Forward TGGACAACGAAGCCCTGTAC VIC 'ITAAGTGTGCGAAAGC
Reverse AAATGGTTCAAGTCACCGTACGT FA M TTAAGTGTGCGGAAGC

BTUB H Forward GCTGACGTCGCGTGGAT VIC CAGCAGTACCGCGCC
Reverse GTCAGCTCGGGAACAGTCAA FAM CAGCAATACCGCGCC

 

Table 3: Taqman® primers and probes. The table above shows the allele assignments to either VIC or

FAM dyes for a specific SNP, along both their forward and reverse primers.

54

 

....I

Results
DNA was successfully extracted from 1093 of the 1155 samples acquired for both
2007 and 2008 (94.6%). Of these, a test population of 213 was established containing 4
pre-2004 isolates, 1 ‘non-pathogenic’ isolate, 11 isolates from outside North America, 5
isolates from Canada, 2 isolates from Mexico, 111 US isolates from 2007 and 81 US
isolates from 2008. Appendix 1 shows the full list of samples in the test population with
respect to countries, hosts and dates of origin. The trial population represents

approximately 20% of the total number of isolates collected.

Restriction enzyme digest of genomic DNA was used as a secondary method to
look for potential polymorphisms. Using samples of infected and uninfected cucumber
leaf tissue of two different cultivars and pathotypes, it was hypothesized that pathogen-
specific bands of between 1 to 3 thousand base pairs may be found. Though observable
differences between infected and non-infected tissue were recorded, poor resolution in all

three replicates meant that no distinct bands of appropriate size were seen.

Of all the primers tested with the 12-sample initial test population, only BGLU,
BTUB, CatPer, ChiSyn, COX2, ITS4, NADH, COB, LSU, PL2, and SECI produced
suitable product for sequencing. All the other genes amplified the negative controls or
failed amplification altogether, at any temperature. The returned sequence for CatPer,
PL2 and SECl was often of poor quality and/or too short for assay design (fewer than the

150-300 base pairs necessary for adequate placement of primers and probes). Sequence

55

for ChiSyn, BGLU, NADH and LSU, while sufficient in size and quality, lacked
polymorphisms when the initial test population was screened. After multiple alignment
of the remaining sequence, 15 SNPs were found in a total of 4 genes: 8 in B-tubulin, 1 in
ITS4, 4 in COX2 and 2 in COB. The position and allele change for each SNP are posted

in their respective consensus sequences, below.

B-tubulin [BTUB]

TI‘GACTCGGTGC’ITGACGTCGTTCGAAAGGAA[G/T] CGGAAAGCTGTGA'ITGTI‘TGC[A/T']GG[G
/A]'I'I‘TCCAGATCACTCACTCTCTTGGTGGCGGTACCGGGTCC[G/A]GCATGGGTACGCTTCTTA
TCTCAAAGATTCGGGAAGAGTACCCGAGACCGCATTATGTGCACGTACTCGGTATGTCCATCC
CCT AAGGTATCGGA CACGGTCGTAGAGCCCT ACAACGCTACGTTGTCTGTGCACCA[G/ A] CTT G
TCGAAAATGCCGATGAAGTCATGTGCCT GGACAACGAAGCCCT GTAC [G/ A]ACAT'ITGCTT[T/ C
]CGCACACTTAAGCTCACGACCCCTACGTACGGTGA CTTGAACCATTTGGTGTGTGCCGCCATG
TCTGGTATCACCACTTGTCTACGA'ITCCCTGGTCAGTTGAACTCGGACCTGCGCAAGTTGGCCG
TGAACCTGATTCCGTTCCCTCGTCTCCACTTCTTCATGATTGGA'ITCGCTCCGCTGACGTCGCG
TGGATCGCAGCA[G/A]TACCGCGCCTTGACTG'ITCCCGAGCTGACCCAACAGCAGTTTGACGCT
AAGAACATGATGTGCGCCGCCGACCCT C

btuA — position 33
btuB — position 55
btuC — position 58
btuD — position 99
btuE — position 237
btuF — position 289
btuG — position 300
btuH - position 504

Apocytochrome B [COB]

ACT'IT AAATATTGGTCTAAAAGCT GTA CIT CT AA'l'TTCN GATGAATI‘CGTAAAAGGGATTGTTA
ATAGAATAACTTAAAGAACCAAACATAGCGATAACACCACCAATTTTATITGGTATTGATCGT
AAAATTGCATAAAAAGGTAAAAAATA CCA'ITCTGGAACAATATGTAAAGGCGTTTTCATTGG
ATTTGCTTCAATATAATI‘ATCTGGATGACCTAAAGCATTTGGATAATAAAAAATAAAAATAAA
AAAAACTAAAAATAATATCATTAATCCAAATAAATCTTTTGTA TAAAAATATGGATAAAAAG
GTATATITTCTGTT’I'I‘TAATGTAATACCTAATGGATTA'ITTGAACCAACTTCATGTAATAAAAT
TAAATG[A/T]ATTAATACAACACCTACGATTAAAAAAGGAAAAGTAAAATGTAAACTAAAAA
ATCGA'I'I'TAATGT'I‘GGA'I'I‘ATCTACAGCAAAACCGCCCCACAACCAATCAACAATATCTTTTC
CT ATTAATGGTATCGCAGAAAATAAATTAGTA ATAACAGTTGCA[C / G] CCCAAAAACT CATTT
GTCCCCAAGGTAAAACATAACCCATAA

cobA — position 385
cobB — position 545

56

 

Cytochrome oxidase subunit 2 (COX2)

CTTTCATCATGATTTAATFFTTTTT'ITAATTGTAGTTACAGTATTCGTTTGTTGGATGTTATTTA
GAGTTA'ITACTC'IT’ITI‘GATGAAAAAAAAAATAAAA'ITCCNGCTCCGGTNGTNCAGGGGGCTN
CT ATTGAAA'ITATTNGGACTN CAATNCCAGCTITAATTITATTAATNGGAGCAATN CCTN CG'IT
GGC[C/A]TTATTATATTCTAGGGANGAAGTAATTGACCCTAT[C/T]ATTNCATTAAAAGTTATNG
GAAGCCAAGGGTATNGGAGTTATGAATATTC[CMGANAATTI‘ANAAT’ITNCCGANGAACCTT
TAGTTTTN GATAGTTATAGGGAACAAGAAGATGAT’ITACCGATCGGCCAA'ITTANAA'I'I‘TTAN
AAGTAGATAACCGGGNAGTAGTCCCAACTAATAGCCATATNCGAGTATTAAT[C/HACAGCTN
CNGAGGTTTTA CATTCAGGGGCTATNCC’I'N CATGGGGAANAAAATTANANGCANGCCCGGGA
CGT'ITAAANCAAACANCAAGGT'ITATAAAAA

coxA — position 196

coxB — position 232

coxC - position 283

coxD - position 427

Internal transcribed spacer 4 (ITS4)

CGCGAATTAAATATTCCTCCATTAATG CCATAGCAGACAAACCGATCGCCGACTGGTCACATG
GACAGCCI‘TCACAACCAGCAACGCCACAC'I'I'ITCGA GCAAAGAGAAGTACAGTTCTGTACATT
TCAAAGGACT CGCAGTCAATTCGAAAATTAGCCGCAAGACACTT CACATC’I‘ GGCATATCCT CC
ACCGACT ACACGGAAAGAA GAAAACCAAGTTTGATGT ACGGACACTGATACAGGCATACT CC
CAGGACTAACCCGGAAGTGCAATATGCGTTCAAAAT'ITCGATGACTCACTGAATCCTGCAATT
CGCATTACGTATCGCAGTTCGCAG CGTTCTT CATCGATGTGCGAGCCI‘ AGACATCCACTGCI‘ G
AAAGTI‘GCTATCTAGTTAAAAGCAGAGACTTTCGTCCCCACAGTATAATCAGTAATTAAGAAA
GGGTI‘TAAAATAAAAGCT ACT AGTTCAGACCGAAGCCCAAACGCTCGCCATGATAGGGCTCG
CCFAGCAGTAATCAACCAGCAATTA[A/T]GCTAGCGATCACCGCCAAACAAAACCCCCAATTA
ATGGGG'I‘TGATAC

itsA — position 528

Of the genes with SNPs, ITS4, COX2 and COB were rejected during the assay
design process due to abundant strings of repeated nucleotides and the subsequent
insufficient amount of appropriate binding sites for either primers or probes. Only B-
tubulin passed assay design (Table 2), and then only six out of the eight SNPs were used.
These were assigned as BTUBA, BTUBD, BTUBE, BTUBF and BUTBG following their
position in the gene. The close proximity of some SNPs to others led to their exclusion.
Of all the SNP probes that were used to screen the test population, only BTUB E and

BTUB G picked up polymorphisms. The failure of the majority of the SNP assays could

57

be in part due to false-positive resulting from non-specific amplification of host DNA or

the high GC content (~55%) of the B-tubulin gene.

Allelic discrimination reads allow for concise viewing of sample
genotypes plotted against one another. Expected alleles are present in Table 3 along with
their respective primers and probes. Detector color was assigned as green for VIC and
purple for FAM dyes and Figure 4 shows optimal reads for either heretozygote (VIC or
F AM recorded) and the homozygote (VIC and FAM recorded). Figures 5 and 6 are
representative allelic discrimination plots for BTUB E and BTUB G, respectively, as
measured by the detection threshold for each allele with calls being made based on which
dye exceeds the threshold values. Appendix 1 contains the full list of alleles called for

each sample in the test population.

Upon examination of the assay output for the SNPs that returned results, the
majority of rare alleles were found in samples that came from cucurbits other than
cucumbers. Squash, pumpkin, melon and cantaloupe, specifically those fiom over-
wintering sites in Texas and Florida, are different from those observed elsewhere along
the Eastern seaboard throughout the summer growing season. This trend, though
consistant across the B-tubulin SNPs, may not be representative across other P. cubensis
genes. More genes with SNPs and further analysis are necessary before any conclusions
can be drawn for the presence of distinct populations or host-specific strains of P.

cubensis.

58

4:895 93 a can 3 8.23 £2. 25w 5:534“ of E nmn =oEmon

«a 35 9:52: .32 9a 8% 2<m Ba 0; 50m .Sdoso :0 338mm

0 Z 5550 .8385 Eot 095—556 .26 295% com 5x3 83 9%:

5.55 38» 30:38.0: < .O m_ 0.2.x 2: 25m 5333i 06 5 mm” carica—
u< $93.3 co “BEES H2 5550 058.3 89¢ 55:50.5 dmm 29:8

.8 .32 a; Eu. 5.6: 32 B> < .< a 223 05 2% £333 2. 3

RN 8&8; 2 3.2.8 .5 Bass E 5550 8.8 3 63 53% .2:
29:3 new :83 83 E2 Baazv use E<m < 308% =owooaon oocosvom
econ Emtm ~m< 05 Eat £62 353% 382%.— mnmfiw o>onu 23. "v ensur—

 

 

393 05
« 39529.39
1 7 t
l|¢£ TABS—PM amwnfiqnmJ __. ¥_D_ _D—n_n_s.Nw—'D—o m r. m m w M M—
Sc.
m rags.“
n.
13;}: c
o;
”Joe‘QOR 1“
So
F-PAufio Vitae):
of. 0
3.35: t w
093, c a: w
§z€§§ u

 

 

 

 

 

 

 

 

 

 

a. ._ ca ..

VESIBu»... > {Beaten-um v

 

 

 

 

 

 

 

 

  

\
is”; \

 

 

 

 

 

 

 

 

 

    

 

 

2.5:: 3933530: 2.3.5 25—
. 39.5.2 2%.... _ 32521:”.
. R
11$ .15.?“ £2.33 22212.55; m N m. m . a A_ Iii an.“ 023:: .3 2 .» a a a m 4 m NF
an a. ..
m 393.3% p 35.3%
m. m. :z e . ..\\.\m 6 £13251: 9 ll 1 . 11 a
s \ t\l|
03 >1 _ .t 03
215. t Y1 2 a 2!. m L
8:51“. 3.95 \\ a; mamas: 22:5 .
0.3-: e .. .,\ w 0.3:: L m
523 c _, \ . 89 m 53¢ L N M
_ , u u
.95qu . , \ 35%;:
< a;

 

59

Allele Y (A) VIC

Allelic discrimination for BTUB E

3.5

Allele X (G) FAM

Figure 5: Allelic discrimination for all 213 samples in the test population for BTUB E based on ARN
values set for VIC (allele X) and FAM (allele Y) fluorescence. Each point represents the average between
replicates for a particular sample. Samples that contain the rare allele (X) include the two pre-2004 P.
cubensis isolates from Delaware (3 and 6), the ‘non-pathogenic’ Charleston strain of P. cubensis on melon
(42), acorn squash collected from Lenoir County, NC on 09.08.08 (485), butternut squash collected from
New Hanover County, NC on 09.10.08 (496) and others listed in Appendix 1. Heterozygotes, as
highlighted with arrow, include cucumber isolates grown in close proximity to melons in over—wintering
areas.

60

2 Allelic discrimination for BTUB G

0.8

Allele Y (G) FAM
0
O

0.6 o O |

0.4

0.2

—0.6 -0.2 0.2 0.6 1 1.4 1.8

Allele x (A) VIC

Figure 6: Allelic discrimination for all 213 samples in the test population for BTUB G based on ARN
values set for VIC (allele X) and FAM (allele Y) fluorescence. Samples that contain the rare allele (Y) still
include the two pre-2004 P. cubensis isolates from Delaware (3 and 6), the ‘non-pathogenic’ Charleston
strain of P. cubensis on melon (42), acorn squash collected from Lenoir County, NC on 09.08.08 (485),
butternut squash collected from New Hanover County, NC on 09.10.08 (496) and others listed in
Appendix 1, similar to the results obtained from BTUB E. Heterozygotes, as highlighted with arrow, are
consistent with those reported for BTUB E, though fewer in number.

61

Discussion

Due to the observed increase in virulence of Pseudoperonospora cubensis in
North America over the past 4 years, finding answers to how or why host resistance was
overcome is of utmost importance. The establishment of reliable techniques to type and
subsequently monitor changes in pathogen population can detect introduction events or
rapid changes in pathotype, both of which are possibilities that may have accounted for
how P. cubensis epidemics have become prevalent over the past few years. Although
little is known about the basic biology of P. cubensis in North America and genotype
diversity remained low across diverse isolates after direct sequencing of genomic DNA,
the possibility of sexual reproduction cannot yet be discounted. Subsequently, the
method chosen for population analysis can assume neither sexual reproduction nor

clonality.

The most prevalent techniques in similar analyses of microbiological
communities use either microsatellite (SSR) or ALFP markers, neither of which has been
implemented in P. cubensis studies to date. Although microsatellites have been
successfully implemented in recent downy mildew studies (Gobbin, Pertot, and Gessler
2003; Perumal et al. 2008), in all cases sporangia were isolated without host tissue. If a
microsatellite approach were used for the P. cubensis samples as currently processed,
they would need to be designed from isolated sporangia and tested for specificity against
both infected and uninfected host tissue. AF LPs would most likely yield unpredictable

results for current mixed template isolates as differences in host cultivar and host species

62

would yield different results. SNP genotyping was chosen above the more conventional
methods due to the markers being co—dominant, highly selective when dealing with

mixed template, and the technique novel.

Single nucleotide polymorphism genotyping is ideal for discriminating between
distinct populations or pathotypes of Pseudoperonospora cubensis in a precise, quick and
relatively inexpensive manner (running 5 ul reactions costs about 50¢ or less per reaction
per SNP for reagents, plus the cost of cycling and consumables). With the discovery of
new SNPs in different genes and their adaptability to this type of assay, a large
population can be accurately genotyped in high-throughput fashion in a relatively short
amount of time with little worry about initial sample quality. The use of real-time PCR
and the highly-specific Taqman® chemistry provides a way to categorize individual field
isolates into cohesive populations without having to worry about contamination from
other fungi or host material. Due to the degree of specificity, this assay can be used for a
myriad of other approaches including real-time spore trapping; wherein the aerial spore
load can be quantified and typed throughout a growing season in a particular location.
Changes in the population can then be monitored over time and potentially used to
predict population change or estimate P. cubensis evolution rates. Most other Taqman®
assays done to date look for differences between species rather than looking at

polymorphism within the same species.

While the advantages of this technique are many, it is not without problems. The

targeted gene approach to SNP genotyping is time intensive for finding suitable genes.

63

 

The amount of trial and error involved in gene selection and adaptation to the Taqman®
genotyping assays is not always rewarded with useable data. The failure of the majority
of the SNP assays developed in this study could be in part due to false-positive resulting
from non-specific amplification of host DNA or the high GC content (~5 5%) of the [3-
tubulin gene. So far, only genes with known function or homology to those with either
known or putative function have been considered for analysis. Looking to genes for
unnamed or scaffold proteins may uncover some potential candidates for analysis. Other
marker-assisted and cloning approaches could also be considered to speed up SNP
discovery time, though their efficacy in a mixed host/pathogen isolate has yet to be
proven. Although the use of restriction digest on the genomic DNA isolated from
infected and uninfected cucumber tissue showed differences, the lack of band separation

made further analysis impossible.

All things considered, the use of Taqman® probes as a means to separate P.
cubensis populations is useful for field applications. Once assays are designed, samples
coming in from the field can be processed quickly without the fear of misreads due to
host cultivar, host species or contamination by a variety of other fungi, bacteria or
insects. Although not much can be said without further analysis and the examination of
more SNPs from other genes, the results from the two polymorphic B-tubulin SNP
markers segregate isolates from pumpkin and hard squash from other cucurbit hosts.
Isolates that are heterozygous for both alleles come from cantaloupe and cucumber
(grown in close proximity to other melons and hard squash) respectively and occur only

in Florida and Georgia. It appears that the isolates with the common alleles are

64

 

 

cosmopolitan while those with the rare alleles are host-limited. More genes with SNPs "‘
and further analysis are necessary before any conclusions can be drawn for the presence

of distinct populations or host-specific strains of P. cubensis.

Future Directions

Since the validation of a real-time, Taqman® probe based method for looking at
SNPs in P. cubensis, a number of viable applications can be considered for use in the
near future to address the concerns of growers. Beyond allelic discrimination calls, the
data obtained from each SNP can be used to piece together a population map and new

technologies can be implemented to improve sample collection.

For a particular SNP to be informative for population analyses, the overall
between-population FST (the fixation index, a measure of heterozygosity of a
subpopulation compared with the full population) should be high and the within-
population F ST should be low. Ideally, a minimum of 20 informative SNPs should be
obtained prior to any kind of population analysis, driving further effort in finding
appropriate SNPs in P. cubensis. Regional differences can be examined by generating
FST values for sample pools obtained from over-wintering sites and elsewhere. If there
are discrete southern subpopulations for P. cubensis, it could build a case for the

pathogen being able to over-winter further north.

65

Once the population of P. cubensis has been typed, more in-depth analyses of host
specificities or virulence pockets can be conducted. With a baseline for what diversity is
present in the current North American population of P. cubensis, effector diversity can
easily be mapped on to look for host-specific virulence factors or to look for shifts in
effector type corresponding to the increase in virulence observed in the field since 2004.
There are also a number of taxonomic questions that an in-depth examination of current
P. cubensis populations could potentially answer. Choi et al. (2005) proposed a
reconsideration of Pseudoperonospora cubensis and P. humuli due to conspecificty of the
two species when ITS sequence data was compared (Choi, Hong, and Shin 2005). With a
larger body of genes surveyed with polymorphisms, conspecificity can be more

accurately proven or dismissed altogether.

Another way to improve the efficiency of population monitoring in the future
would be to streamline sampling. Real-time spore trapping can be set up to monitor if
any changes in population occur within a growing season in a specific local. DNA can be
extracted directly from field-collected spores prior to genotyping. Whatman International
Inc. (Maidstone, Kent, UK) FTA cards contain chemicals that can lyse cells, denature
proteins and protect nucleic acids in a user-friendly format. Cards could be mailed out to
growers, extension agents and other collaborators early in the season and samples taken
as the disease occurs. Since the cards fix the sample, it could replace the shipping of
infected leaf material. Figure 7 shows a comparison of an optimized DNA extraction run
and an unoptimized 30-minute F TA punch protocol, with both methods yielding the same

result.

66

 

- .J
o * r [motion Pfl
5 / mm m
I I;
Naif.“ Sm
e
'1 3 ’ A1100
is
g MMU
u

11mm: 1" :51]:- IT?
" Auo Batch!

'3 Nun‘s-Lev:

 

515'“th V“

 

 

 

- 7 ~ -. w n a 7 7M , -. an 1'3 "'3 . ,M..-
I 71 A 5 61 u ‘3IUH1.131415161:1519.0.l_.;31425.6.1.EJJDXIAUJEUSZG Eldltfihl ‘u‘

 

 

Cycle Number - 1

Conventional DNA extraction

 

mm— mm —mmw

 

 

  

 

 

 

 

M
can
. on W
050 . , /.' “to,“ WW3
we... rim:
,/
040 I
I
,- , museum:
c
:1. U :0 I Mot:
E : HMO
L)
D lhe'ldd ‘1 .1111,le
3 ‘ "igwf
\ “\‘._> _ V . Mifiom
V ‘ ‘3/
.010 . \<¥ ”mum“
‘ immune-1 .T
-U 40
l 1' l 6 V 1'1121 l I‘l:l'l$|gll;123:}jl.‘5flzTglezl ‘1'7131 3,‘:‘ .3 V“-
3 5 8 9 Lll 31 h ( z )1; 3 3 5 6 {“3ka H
Lisle Number |

 

Whatman FTA® extraction

Figure 7: Comparison of traditional DNA extraction and FTA card punches. Both outputs are for the
same sample; cucumber collected from Essex, ON, on 08.15.08, with the top being the traditional phenol-
chloroforrn DNA extraction and the bottom being a 2.0 mm punch from a FTA card on which the sample
had been rubbed. Both preparation methods would yield the same allele call. With optimization it may be
possible to achieve more consistent reads from the FTA card and reduce the costs associated with obtaining
samples.

67

With more SNPs in more genes to add to this analysis, statistical methods of
population subdivision can be used and geographic or host limits tested. Although this
study has found but one gene with a number of SNPs, the method described is ideal for
working with mixed samples like those obtained while working with obligate pathogens

like Pseudoperonospora cubensis and should be continued in the future.

68

 

References

Barnes, W. C. 1948. The performance of Palmetto, a new downy mildew resistant

cucumber variety. Proceedings of the American Society for Horticultural Science
5 l : 437-441 .

Benson, D. A., I. Karsch-Mizrachi, D. J. Lipman, J. Ostell, and D. L. Wheeler. 2008.
GenBank. Nucleic Acids Research 36: D25-30.

Choi, Y. J ., S. B. Hong, and H. D. Shin. 2005. A reconsideration of Pseudoperonospora

cubensis and P. humuli based on molecular and morphological data. Mycological
Research 109: 841-848.

Choi, Y. J., S. B. Hong, and H. D. Shin. 2006. Genetic diversity within the Albugo
candida complex (Peronosporales, Oomycota) inferred from phylogenetic
analysis of ITS rDNA and COX2 mtDNA sequences. Molecular Phylogenetics
and Evolution 40: 400-409.

Delmotte, F., X. Giresse, S. Richard-Cervera, J. M'Baya, F. Vear, J. Tourvieille, P.
Walser, and D. Tourvieille de Labrouhe. 2008. Single nucleotide polymorphisms
reveal multiple introductions into France of Plasmopara halstedii, the plant

pathogen causing sunflower downy mildew. Infection, Genetics and Evolution 8:
534—540.

Fan, Z., M. D. Robbins, and J. E. Staub. 2006. Population development by phenotypic
selection with subsequent marker-assisted selection for line extraction in
cucumber (Cucumis sativus L.). Theoretical and Applied Genetics 112: 843-855.

Gobbin, D., I. Pertot, and C. Gessler. 2003. Identification of microsatellite markers for
Plasmopara viticola and establishment of high throughput method for SSR
analysis. European Journal of Plant Pathology 109: 153-164.

Goker, M., H. Voglmayr, A. Reithmuller, and F. Oberwinkler. 2007. How do obligate
parasites evolve? A multi-gene phylogenetic analysis of downy mildews. Fungal
Genetics and Biology 44: 105-122.

Holmes, G., C. Main, T. Keever, and S. Colucci. Cucurbit Downy Mildew Forecast
Homepage 2008 [cited October 22, 2008]. Available from
http://www.ces.ncsu.edu/depts/pp/cucurbitl.

J. Mitchell Jenkins, Jr. 1942. Downy Mildew Resistance in Cucumbers. The Journal of
Heredity 33: 35-38.

Livak, K. J ., S. J. Flood, J. Marmaro, W. Giusti, and K. Deetz. 1995. Oligonucleotides
with fluorescent dyes at opposite ends provide a quencher probe system useful for

69

 

detecting PCR product and nucleic acid hybridization. PCR Methods and
Applications 4: 357-362.

Michigan Agricultural Statistics. 2006. edited by USDA, NASS and M. F. Office:
Michigan Department of Agriculture.

Montes-Borrego, M., F. J. Mufioz Ledesma, R. M. Jime’nez-Diaz, and B. B. Landa. 2009.
A nested-polymerase chain reaction protocol for detection and population biology
studies of Peronospora arborescens, the downy mildew pathogen of opium
poppy, using herbarium specimens and asymptomatic, fresh plant tissues.

Phytopathology 99: 73-81.

Perumal, R., P. Nimmakayala, S. R. Erattaimuthu, E. G. No, U. K. Reddy, L. K. Prom, G.
N. Odvody, D. G. Luster, and C. W. Magill. 2008. Simple sequence repeat
markers useful for sorghum downy mildew (Peronosclerospora sorghi) and
related species. BMC Genetics 9: 1-14.

Roeckel-Drevet, P., J. Tourvieille, T. J. Gulya, G. Charmet, P. Nicolas, and D.
Tourvieille de Labrouhe. 2003. Molecular variability of sunflower downy mildew,
Plasmopara halstedii, from different continents. Canadian Journal of
Microbiology 49: 492-502.

USDA. 2008. Vegetable Annual Summary, 01.25.2008. US. Dep. A gric. Natl. Agric.
Stat. Serv. (Online publication).

70

APPENDICES

71

Appendix 1: SNP genotyping results for each sample of the trail population. Two
hundred and thirteen P. cubensis isolates chosen from the total collected throughout the
2007 and 2008 growing seasons. Rare alleles are highlighted in yellow and those that did
not yield a result (NR) in grey. For each sample, the date, host and location of collection
are given.

72

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

267 OH Sandusky 08. 12.08 cucumber G G A C T C
274 OH Sandusky 08. 12.08 cucumber G ‘ A C T C
275 OH Sandusky 08. 12.08 cucumber G A C T C
284 OH Sandusky 08. 12.08 cucumber G ‘ ' A C T C
295 OH Sandusky 08. 12.08 cucumber G G A C T C
297 OH Seneca 08. 12.08 cucumber G G A C T C
305 OH Wayne 08.12.08 cucumber G G A C T C
3 10 OH Seneca 08. 12.08 cucumber G _3 ' A C T C
320 OH Wayne 08.12.08 cucumber G G A C T C
33] OH Wayne 08.13.08 melon G '= i A C T C
338 OH Wayne 08.13.08 cucumber G G A C T C
348 OH Wayne 08. 13 .08 cucumber G G A C T C
359 OH Medina O8. 13 .08 cucumber G G A C T C
368 OH Medina 08. 13.08 cucumber G G A C T C
381 ON Essex 08. 15.08 cucumber G G A C T C
384 ON Essex 08. 15.08 cucumber G G A C T C
394 M1 Genessee 08.21 .08 cucumber G G A C T C
399 Ml Saint Clair 08.18.08 cucumber G G A C T C
401 Ml Saint Clair 08.18.08 cucumber G G A C T C
410 Ml Saginaw 08. 19.08 cucumber G G A C T C
42 1 MI itginaw 08. 19.08 cucumber G G A C T C
422 M1 Monroe 08.20.08 cucumber G - ' "’ A C T C
428 Ml Monroe 08.20.08 cucumber G G A C T C
43 1 MI Monroe 08.20.08 cucumber G -‘ A C T C
435 Ml Montcahn 08.21.08 cucumber G . 7 A C T C
439 Ml Saginaw 08.21.08 cucumber é;- ’ - A '
447 VA Accomark 08.2 1 .08 cucumber G G A C T C
459 IN Knox 08.21.08 cucumber G '5. .. ' A C T C
470 PA Center 08.27.08 cucumber G G A C T C
472 M1 Ionia 08.29.08 cucumber G f ' '1 A C T C
474 Ml Cass 08.27.08 cucumber G G A C T C
485 NC Lenoir 09.08.08 acorn squash an G G :- ' ‘ "
486 NC Johnston 09.08.08 cucumber G L" " -i‘ A C T C
491 Ml Kent 09.05.08 cucumber G G A C T C
493 Ml Lapeer 09.07.08 cucumber G ' 1 A C T C
495 NC Johnston 09. 10.08 cucumber G is A C T C
496 NC New Hanover 09.10.08 butternut squash 'Nfi "j _ G C C C
501 NC Johnston 09.10.08 cucumber G NR A C T C
505 Ml Clinton 09. 1 1.08 cucumber G G A C T C
513 M1 Ingham 09.11.08 cucumber G .2: ' A C T C
522 Ml Calhoun O9. 1 l .08 cucumber G in A C T C
529 Ml Monroe 09. 16.08 cucumber G NR1 A C T C
535 Ml Monroe 09. 17.08 cantaloupe G G A C T C
541 TX Hidalgo 10.30.08 cucumber G NR A C T C
552 TX Hidalgo 10.30.08 cucumber G NR A c T c
566 MX Sinaloa 12.05.08 cucumber G G A C .m C
584 MX Sinaloa 12.05.08 cucumber G G A C T C
INTERNATIONAL SAMPLES
1 IS Geba Carmel 2008 cucumber G G A C T C
2 IS Ahitov 2008 cucumber G G A C T C
10 IS Tamar Sabach 2008 cucumber G G A C T C
BIU IS lar-Ilan Universi 2007 cucumber G G A C T C
4.8.8 IS lar-Ilan Universi! 2008 cucumber G G A c T c

 

76

 

 

 

 

 

 

 

 

77

Appendix 2: Records of the full number of samples collected from all sources. Host
crop, cultivar (if known), origin and date of collection are presented in this appendix. The
site and source of collection is also noted, if available.

78

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2007 SAMPLES
1D State County Date (m/d/y Host (and cultivar, if known) Site
1 DE unknown before 2004 cucumber Dupont
2 DE unknown before 2004 cucumber Dupont
9 3 DE unknown before 2004 cueufimber Dupont
4 DE unknown before 2004 __cucum ber Dupont
5 _DE unknown before 2004 prcflmmber Dupont
6 DE unknown before 2004 _fleumber Dupont
7 DE unknown before 2004 cucumber Dupont
8 DE, unknongbefore 2004i CUCEDQCL Dupont
9 DE unknown before 2004L cucumber Dupont
10 DE unknown before 39957 cucumber Dupont
11 FL Collier ”05.10.07 cucumber - straight 8 Immokalee
12 FL Collier 05.10.07 cucumber - marketer Immokalee
13 FL Collier 05.10.07 - cucumber 3 marketer Immokalee
14 FL Collier 05.10.07 cucumber - national pickle Immokalee
15 FL . Collier 05.10.07 cucumber - tablegreen 65 Immokalee
16 FL Collier 05.10.07 cucumber - f70822 Immokalee
17 FL Collier 05.10.07 cucumber - pointsett 76 Immokalee
18 FL Collier 05.10.07 . 7 cucumber - 170827 Immokalee
19 FL Collier 05.10.97 9 cucumber - f70837 Immokalee
20 FL Collier 05.10.07 1 cucumber - smr 58 Immokalee
21 FL Collier 05.10.97 ! cucumber;smr 53 Immokalee
_22 FL Collier 05.10.07 __cucumber_—_f70839 Immokalee
23 OH Ashland 06.25.07 _‘___c+antaloupe unknown
24 OH Ashland 06.25.07 . cantaloupe unknown
25 OH Lorraine 06.25.07 _ cucumber unknown
h26 OH Lorraine 06.25.97» 0 cucumber unknown
9297 OH Sandusky 96.25.07 cucumber unknown
28 MI Gatriot 99.26.07 .: cucumber Randy Hugo
29 Ml Gatriot 06.26.07 I cucumber Randy Hugo
30 MI Gatriot 06.26.07 7 cucumber RandLHugo
__31 MI Monroe 06.26.07 melon home garden b
32 MI Monroe ”06.26.07“ __ cucumber site two
33 MI Monroe 06.269977 - Meucfumber site two
34 MI Monroe 06.26.07 cucumber site two
F 35 Ml Monroe 96.26.07~+ cucumberfl_ 9 _ site two
_36 MI Monroe 06.26.07 cucumber home garden a
37 MI Monroe 06.26.07 cucumber site one
38 Ml Monlgeflwfi 706,126.07 . cucumber site one
. 39 MI Monroe .- 706.276.0717 cucumber site one
40 MI Monroe 06.96.07 cucumber _ Dave Stall
41 Ml, Monroe 06.26.07 __+ cucumber _Dave Stall
42 MI Saginaw ___06.26.07 cucumber Larach a
43 Ml Monroe ”97.1 17.97 - cucumber Dave Stall
44 MI Monroe 7 07.9191 _.07 _ ____r‘cucumber DaveStalI
__ 45 MI_ Monroe 07.11.07 ‘eucumber Dave StalI
46 Ml Monroe 07.11.07“ eueumber Dave Stall
47 MI Monroe 07.1 1 .07__ cucumber Dave Stall
94L Ml Monroe 07.11.07 A cucumber Dave Stgll
__49 FMI Monroe 07.11.07 L cucumber Dave Stall
50 MI Monroe 07.1 17.707 l cucumber Dave Stall
51 MI Lenawee 07.16.07 1 cucumber Deerfield

 

 

 

79

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

52 Ml Lenawee 07.16.07 I cucurfler Deerfield
53 MI Lenawee 07.16.07 cucumber Deerfield
54 MI . Lenawee 07.16.07 cucumber Deerfield
55 MI Lenawee 07.16.07 9 cucrunber Deerfield
56 NC Duplin 07.18.07 I cuctmiber home garden
57 NC Dgflin 07.18.07 cucumber home garden
58 NC Duplin 07.18997 cucumber home garden
59 NC Duplin 07.18.07 cueqmber home garden
60 NC Sampson 07.1 8.07 cantaloupe unknown
61 NC Sampson 07.18.07 carugloupe unknown
62 M1 Saginaw 07.19.07 cucumber unknown
1_ 63 Ml Saginaw 07.19.07 cucumber unknown
64 MI Bay 07.22.07 cucumber Meylan
65 MI Bay 07.22.07 cucumber Meylan
66 MI Bay 07.22.07 cucumber Meylan
67 Ml Bay 07.2297 F cucumber Meylan
68 MI Bay 07.22.07 cucumber Johnson
69 Ml Bay 07.22.07 cucumber Johnson
70 M1 Bay 07.22.07 cucumber Johnson
71 Ml Bay 07.22197_ cucumber Johnson
72 Ml Bay 07.22.07 cucumber Johnson
73 NY Monroe 07.24.07 . cucumber Brockport (2)-1
74 NY Monroe 97.24.07 cucumber Brockport (2)-1
75 NY Monroe 07.24.07 cucumber Brockport (2)-1
76 NY Monroe 07.24.07 cuefiumber Brockport QB
77 NY Monroe 07.24.07 cucumber Brockport (2)-1
78 NY Monroe 07.24.07 cucumber Brockport (2)-1
79 NY Monroe 07.24.07 cucumber BrockportQ)-1
80 NY Monroe 07.24.07 cucumber Brockport (2)4
F 81 NY Monroe 07.24.07 cucumber Brockport Q)-1
82 NY Monroe 07.24.07 cucumber Brockport (2)-2
__83 NY Monroe 07.24.97 1 cucumber Brockport (2)-2
84 NY Monroe 07.24.07 cucumber Brockport (2)-2
85 NY Monroe 07.24.07 cucumber Brockpprt (2)-2
86 NY Monroe 07.23.07 _I_ cucumber Brockport (2)-2
F87 NY Monroe 07.24.07 _____ cucumber Brockport (2)-2
88 NY Monroe 07.24.97 - 1 cucumber Brockport (l)-1
89 NY Monroe 07.24.97 cucumber Brockport (1)-l
90 NY Monroe _077.24:97__+_ _cuicumber Brockport (1)-l
29L. NY__MQnr9§_ _ 91.23.97- . cucumber Brockport (1)4
_ 92 NY Monroe 07.24.07 cucumber Borckport (1)-2
93 NY Monroe 07.24.07 cucumber BorckpoMI)-2
94 MI Monroe 07.24.07 cucumber spore trap
_ 95 MI Monroe 0724-01 ___ cucumbeL” spore trap
996 Ml Monroe 9077.24.07 l cucumber spore trap
97 Ml Monroe 07.24.0777 cucumber spore trap
98 MI“ Monroe 107.241071_~1___ cucumber spore trap
99 TX Tom Green “97.24.07 1 weantafiloupe unknown
100 TX Tom Green 07.24.07 1 cantaloupe ___unknown
10] TX Tom Green 07.2497w l cantaloupe unknown
402 TX Tom Green 07.24.97 cantaloupe unknown
103 TX Tom Green 07.24.07 _ Mcantaloupe unknown
104 TX Tom Green 07.24.07 cantaloupe unknown

 

80

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

105 TX Tom Green 07.24197 '1 cantaloupe unknown
106 TX Tom Green 07.24.07 camwaloupe unknown
W107 TX Tom Green 07.24.07 cantaloupe unknown
108 M1 Bay 07.25.07 cucumber unknown
109 Ml Bay 07.25.07 cucumber unknown
1 10 MI Bay 07.25.07 cucum_ber unknown
1 1 1 MI Bay 919125197 cucumber unknown
1 112 Ml Bay 07.2;97WW cucumber unknown
1 13 M1 Bax 07.2;9'7WW cucumber unknown
1 14 OH [fle____97125.07 cucumber Milan
__flS OH Erie 97.25.07 . cucumber Milan
116 OH Erie ._ 07.25.07 cucumber Milan
1 17 OH Huron 07.25.07W cucumber Celeerille
118 OH Huron 07.25.97 cucumber Celeerille
119 OH Huron 07.25.07 . cucumber Celeryville
W120 OH Huron 07.25907 cucumber Celeryville
h 121 OH Huron 07.25.07 cucumber Celeryville
122 OH Huron _07.25.07 cucumber Celeryville
123 OH Huron .._O7-2_5:97 cucumber Celeryville
__124 OH Huron 07.25.07 cucumber Celeryville
- 125 OH Huron 07.25991 cucumber Celeryville
126 OH Huron 07.295997. cucumber Celeryville
127 OH Huron 979295.97 cucumber Celeryville
_1_28 OH Huron ..-. 07.25.07 . cucumber Celeryville
129 OH Medina 97.25.07 . cucumber Homerville
130 OH Medina 07.25.07 ' cucumber Homerville
131 OH Medina 07.25.07 cucumber Homerville untrt.
__l_32 OH Medina 07.25.07 cucumber Homerville untrt.
133 OH Medjna 1107.25.07 cucumber Homerville (2)
134 OH Medina 07.25.97 cueu_mber Homerville (2)
135 Ml Saginaw 1 07.25 .07 cucumber unknown
136 Ml Saginaw 1 _ 07.25.07] cucumber unknown
137 Ml Saginaw 1 07.25.07 cucumber unknown
138 Ml Saginaw 1 07.25.07 cucumber unknown
139 Ml Saginaw 07.25.07 _ cucumber unknown
_1_40 MI Saginaw 07.25.07 . cucumber unknown
141 OH Wayne 07.25.07 cucumber Wooster home garden
__1‘12 OH Wayne 07.25.07 _____ cucumber Wooster home garden
143 OH Wayne 07.25.07” cucumber Wooster home garden
144 OH Wayne 1 97.25.07 cucumber Wooster home garden
_915 OH Wayne 07.25.07 cucumber Wooster home garden
146 OH Wayne #072507 cucumber Congress
147 OH Wayne 1 07.25.07 cucumber 1 Congress
__148 OH Wayne 1 07.25.07 cucumber 1 Congress
#19 OH Wayne T 07.25.07 1 ___eucumbep______ __ Congress
1 50 OH Wayne 1 97.25.97 1 cucumber Congress
.- 15] OH Wayne E 97.25.07 1 cucumber 1 West Salem
152 OH Wayne 07.25.07 .. cucumber West Salem
153 M1 Arenac ”1997.39.97 1 cucumber Setlak
154 M1 AgeneeWW . ”97.30.07 cucumber Setlak
155 Ml Arenac 07.30.07 cucumber Setlak
156 Ml Arenac 07.30.07 cucumber Setlak
157 Ml Arenac 07.30.07 cucumber Setlak

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

158 Ml Saginaw 07.30.07 cucumber Jerry Schwab
159 OH Erie 07.31.07 cucumber Milan

160 OH Erie 07.31.07 cucumber Milan

161 OH Erie 07.31.07 cucumber Milan

162 OH Erie 07.31.07 cucumber Milan

163 OH Erie 07.31.07 cucumber Milan

164 OH Erie 07.31.07 cucumber Milan

165 OH Erie 07.31.07 cucumber Milan

166 OH Erie 07.31.07 cucumber Milan

167 OH Erie 07.3 1.07 cucumber Milan

168 OH Erie 07.31.07 cucumber Milan

169 OH Erie 07.31.07 cucumber Milan

170 OH Erie 07.31.07 cucumber Milan

171 NY Erie 07.31.07 cucumber Badding
172 NY Erie 07.31.07 cucumber Badding
173 NY Erie 07.3 1.07 cucumber Badding
174 NY Erie 07.3 1.07 cucumber Badding
175 NY Erie 07.3 1.07 cucumber Badding
176 M1 Monroe 07.31.07 cucumber spore trap
177 Ml Monroe 07.31.07 cucumber spore trap
178 Ml Monroe 07.31.07 cucumber spore trap
179 Ml Monroe 07.31.07 cucumber spore trap
180 Ml Monroe 07.31.07 cucumber spore trap
181 NY Niagara 07.3 1 .07 cucumber Zastrow
182 NY Niagara 07.3 1 .07 cucumber Zastrow
183 NY Niagara 07.31.07 cucumber Zastrow
184 NY Niagara 07.3 1 .07 cucumber Zastrow

1 85 NY Niagara 07.3 1.97 cucumber Zastrow
186 NY Orleans 07.3 1.07 cucumber Bozard

187 NY Orleans 07.3 1.07 cucumber Bozard

188 NY Orleans 07.3 1 .07 cucumber Bozard

189 NY Orleans 07.3 1 .07 cucumber Bozard

190 NY Orleans 07.3 1 .07 cucumber Bozard

191 Ml Clinton 08.02.07 cucumber muck farm
192 Ml Clinton 08.02.07 cucumber muck farm
193 Ml Clinton 08.02.07 cucumber muck farm
194 Ml Clinton 08.02.07 cucumber muck farm
195 Ml Clinton 08.02.07 cucumber muck farm
196 Ml Clinton 08.02.07 cucumber muck farm
197 Ml Saginaw 08.02.07 cucumber spore trap
198 Ml Saginaw 08.02.07 cucumber spore trap
199 M1 Saginaw 08.02.07 . cucumber spore trap
200 Ml Saginaw 08.02.07 cucumber spore trap
201 M1 Saginaw 08.02.07 cucumber spore trap
202 Ml Saginaw 08.03.07 cucumber Benkert
203 Ml Macomb 08.06.07 cucumber Reichling
204 Ml Saginaw 08.06.07 cucumber Hemlock- 4769
205 Ml Saginaw 08.06.07 _ cucumber Hemlock- 4769
206 Ml Saginaw 08.06.07 cucumber Hemlock— 4769
207 M I Saginaw 08.06.07 cucumber Hemlock- 4769
208 Ml Saginaw 08.06.07 cucumber Hemlock- 4769
209 Ml Saginaw 08.0_6_.97_W cucumber 1 Hemlock- 4769
210 Ml Saginaw 08.06.07 1 cucumber 1 Hemlock- 4-51 128

 

82

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

21] MI Saginaw 08.06.07 cucumber Hemlock- 4-51128
212 Ml Saginaw 08.06.07 cucumber Hemlock- 4-51 128
213 Ml Saginaw 08.06.07 ' cucumber Hemlock- 4-51128
214 Ml Saginaw 08.06.07 cucumber Hemlock- item6
215 Ml Saginaw 08.06.07 cucumber Hemlock- item6
216 Ml Saginaw 08.06.07 cucumber Hemlock- item6
217 Ml Saginaw 08.06.07 cucumber Hemlock- item6
218 M1 Saginaw 08.06.07 cucumber Hemlock- item6
219 Ml Saginaw 08.06.07 cucumber Hemlock- item2
220 Ml Saginaw 08.06.07 cucumber Hemlock- item2
221 Ml Saginaw 08.06.07 cucumber Hemlock- item2
222 Ml Saginaw 08.06.07 cucumber Hemlock- item2
223 Ml Saginaw 08.06.07 cucumber Hemlock- item3
224 M1 Saginaw 08.06.07 cucumber Hemlock- item3
225 Ml Saginaw 08.06.07 cucumber Hemlock- item3
226 Ml Saginaw 08.06.07 cucumber Hemlock- item3
227 Ml Saginaw 08.06.07 cucumber Hemlock- powerpak
228 Ml Saginaw 08.06.07 cucumber Hemlockjowerpak
229 Ml Saginaw 08.06.07 1 cucumber Hemlock- powerpak
230 M1 Saginaw 08.06.07 cucumber Hemlock- powerpak
231 Ml Saginaw 08.06.07 cucumber Hemlock- powerpak
232 Ml Saginaw 08.06.07 cucumber Hemlock-501 l
233 Ml Saginaw 08.06.07 cucumber Hemlock-501 1
234 M1 Saginaw 08.06.07 cucumber Hemlock-501 1
235 Ml Saginaw 08.06.07 cucumber Hemlock-501 l
236 Ml Saginaw 08.06.07 cucumber Hemlock- item5
237 Ml Saginaw 08.06.07 cucumber Hemlock- item5
238 Ml Saginaw 08.06.07 cucumber Hemlock- item5
239 Ml Saginaw 08.06.07 cucumber Hemlock- item5
240 Ml Saginaw 08.06.07 1 cucumber Hemlock- item5
241 Ml Saginaw 08.06.07 ' cucumber Hemlock- 5009
242 Ml Saginaw 08.06.07 cucumber Hemlock- 5009
243 Ml Saginaw 08.06.07 cucumber Hemlock- 5009
244 Ml Saginaw 08.06.07 cucumber Hemlock- 5009
245 M1 Saginaw 08.06.07 cucumber Hemlock- 5009
246 Ml Saginaw 08.06.07 cucumber Hemlock- 4729
247 Ml Saginaw 08.06.07 cucumber Hemlock- 4729
248 Ml Saginaw 08.06.07 1 cucumber Hemlock- 4729
249 M1 Saginaw 08.06.07 ’ cucumber Hemlock— 4729
250 Ml Saginaw 08.06.07 cucumber Hemlock- 4729
251 M1 Monroe 08.07.07 cucumber spore trap
252 Ml Monroe 08.07.07 cucumber spore trap
253 M1 Monroe 08.07.07 cucumber spore trap
254 Ml Monroe 08.07.07 cucumber spore trap
255 Ml Monroe 08.07.07 cucumber spore trap
256 Ml Clinton 08.10.07 melon muck farm
257 NC Sempsun 08.10.07 watermelon unknown
258 NC Sampson 08.10.07 watermelon unknown
259 NC Sampson 08.10.07 watermelon unknown
260 NC Sampson 08.10.07 ___ watermelon unknown
26] NC Sampson 08.10.07 wetermelon unknown
362 Ml Ingham 08.13.07 cucumber hort farm
263 Ml Ingham 08.13.07 cucumber hort farm

 

83

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

__264 Ml Ingham 08.13.07 cucmnber hort farm

265 Ml Ingham 08.13.07 cucumber hort farm

266 Ml Ingham 08.13.07 cucumber hortharm_

267 M1 Ingham 08.13.07 cucmnber hort farm
#298 Ml Ingham 08.13.07 cucumber hort farm

269 Ml lngbam 08.13.07 cucumber hort farm

270 Ml Ingham 08.13.07 eucumber hort farm

271 Ml Ingham 08.13.07 . eucumber hort farm

272 Ml Jackson 08.14.07 cucumber unknown

273 Ml Jackson 08.14.07 ermumber urugrown

274 Ml Jackson 08.14.07 cucumber unknown

275 Ml Jackson 08.14.07 cucumber unkmrwu

276 M1 Jackson 08. 14.07 cucumber unknown

277 Ml Jackson 08.14.07 cucumber unknown
W278 MI Monroe 08.14.07 cucumber spore trap

279 Ml Monroe (& 1w _. cucumber spore trap

280 Ml Monroe 08.14.07 cucumber spore trap

281 Ml Monroe 08.14.07 cucumber spore trap
_282 Ml Monroe 08.14.07 cucumber spore trap
W283 MI Monroe 08.14.07 cucumber spore trap (2)

284 Ml Monroe 08.14.07 cucumber spore trap (2)

285 Ml Monroe 08.14.07 cucumber spore trap (2)
W286 Ml Monroe 08.14.07 , eucumber more trap (2)
__287 Ml Monroe 08.14.07 . cucumber spore trap (2) W

288 Ml Bay 08.16.97 Weueumber spore trap

289 Ml Bay 08.16.97 _ cucumber spore trap

290 M1 1 Bay 08.16.07 cucumber spore trap

291 M1 1 Bay 08.16.07 cucumber spore trap
W292 MI Bay 08.16.07 1 cucumber spore trap

293 Ml Monroe 08.16.07 1 cantaloupe Dag Churc_h Dundee

294 Ml Monroe 08.16.07E cantaloupe Dag Church Dundee

295 Ml Monroe 08.16.07 cucumber Stanger
W296 MI Monroe 08.16.07 cantaloupe Dag Church Dundee

297 M1 Monroe 08.16.07 ”cucumber Dag Church Dundee

298 M1 Monroe 08.16.07 __ cucumber DagC_hurch Dundee

299 Ml Monroe 08.16.07 melon Marks
_399_WMI Monroe 08.16.07 melon Marks

301 Ml Monroe 08.16.07 melon Marks

302 Ml Monroe 08. 16.07”. -- melon Marks

303 M1 Monroe 08:§.07 melon Marks

304 Ml Monroe 08.16.07 melon Marks

305 Ml Monroe 08.16.07 melon Marks

306 Ml Monroe 08.16.07 melon Marks

307 Ml Monroe 08.16.07 hmelpu_g ___ Marks
Jill M1 Monroe 08.16.07 cantaloupe uukrlom1)____
1309 r—Ml Monroe 08.16.07 cantaloupe unknown (1)

310 Ml Munroe 08.16.07 . cantaloupe unknown (1)
_3.,,' 1 M1 Monroe 08.16107 cantaloupe unknown (1)
__312 Ml Monroe 08.16.07 cantaloupe unknown (2)

313 Ml Munroe ____0,8,-L6-07 cantaloupe unknown (2)

314 Ml Monroe 08.16.07 camaloupe unkngwn Q.)

315 Ml Monroe 08.16.07 _9cantaleupe unknown (2)

316 M 1 Monroe 08.16.07 1 cantaloupe unknown (2)

 

84

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

317 Ml Monroe 08.16.07 cantaloupe unknown (2)
3 18 Ml Monroe 08. 16.07 cantaloupe Stanger
319 M1 Ionia 08.17.07 cucumber KragLAcres
320 Ml Ionia 08.17.07 cucumber Krazmcres
321 Ml Montcalm 08.17.07 cucumber Stanton
322 Ml Montcalm 08.17.07 cucumber Stanton
323 Ml Montcalm 08.17.07 cucumber Noll Garden
324 Ml Allegan 08.20.07 cucumber spore trap
325 Ml Allegan 08.20.07 cucumber spore trap
326 Ml Allegan 08.20.07 cucumber spore trap
327 Ml Allegan 08.20.07 cucumber spore trap
328 Ml Allegan 08.20.07 cucumber spore trap
329 M1 Berrien 08.20.07 cucumber UAP
330 Ml Berrien 08.20.07 cucumber UAP
331 Ml Berrien 08.20.07 cucumber UAP
332 Ml Berrien 08.20.07 cucumber UAP
333 Ml Berrien 08.20.07 cucumber UAP
334 Ml Berrien 08.20.07 cucumber UAP
335 M1 Berrien 08.20.07 cucumber UAP
336 Ml Berrien 08.20.07 cucumber UAP
337 M1 Berrien 08.20.07 cucumber UAP
338 Ml Berrien 08.20.07 cucumber UAP
339 Ml Muskegon 08.21.07 cucumber Swanson
340 M1 Muskegon 08.21 .07 cucumber Swanson
341 Ml Muskegon 08.21 .07 cucumber Swanson
342 Ml Muskegon 08.21 .07 cucumber Swanson
343 Ml Muskegon 08.21 .07 cucumber Swanson
344 Ml Muskegon 08.21 .07 cucumber Swanson
345 M1 Muskegon 08.21 .07 cucumber Swanson
346 Ml Muskegon 08.21 .07 cucumber Swanson
_347 NY Oneida 08.21 .07 cucumber Candella
348 NY Oneida 08.21.07 cucumber Candella
349 NY Oneida 08.21.07 cucumber Candella
350 NY Oneida 08.21.07 cucumber Candella
351 NY Oneida 08.21.07 cucumber Candella
352 NY Oneida 08.21.07 cucumber Candella
353 ' NY Oneida 08.21.07 cucumber Candella
354 NY Oneida 08.21.07 cucumber Candella
355 NY Ontario 08.21.07 cucumber unknown
356 NY Ontario 08.21 .07 cucumber unknown
357 NY Ontario 08.21 .07 cucumber unknown
358 NY Ontario 08.21 .07 cucumber unknown
W359 NY Ontario 08.2 1 .07 cucumber unknown
360 NY Ontario 08.21 .07 cucumber unknown
361 NY Ontario 08.21 .07_1 _ _ _______ _. cucumber unknown
362 M1 Clinton 08.24.07 1 cucumber muck farm control 'far'
£3 MI Clinton 08.24.07 cucumber muck farm control 'far'
364 M1 Clinton 08.24.07 cucumber muck farm control 'far'
365 Ml Clinton 08.24.07 cucumber . muck farm control 'far'
365 Ml Clinton 08.24.07 cucumber ' muck farm 207
365 M1 Clinton 08.24.07 cucumber muck farm 207
365 Ml Clinton 08.24.07 cucumber muck farm 207
365 Ml Clinton 08.24.07 , cucumber muck farm 207

 

85

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

366 Ml Clinton 08.24.07 cucumber muck farm 207
366 M1 Clinton 08.24.07 cucumber muck farm 402
367 M1 Clinton 08.24.07 cucumber muck farm 402
368 Ml Clinton 08.24.07 cucumber muck farm 402
369 Ml Clinton 08.24.07 cucumber muck farm 402
370 Ml Clinton 08.24.07 cucumber muck farm 402
371 Ml Clinton 08.24.07 cucumber muck farm 408
372 Ml Clinton 08.24.07 cucumber muck farm 408
373 Ml Clinton 08.24.07 cucumber muck farm 408
374 Ml Clinton 08.24.07 cucumber muck farm 408
375 Ml Clinton 08.24.07 cucumber muck farm 408
376 Ml Clinton 08.24.07 cucumber muck farm control 'near'
377 M1 Clinton 08.24.07 cucumber muck farm control 'near'
378 M1 Clinton 08.24.07 cucumber muck farm control 'near'
379 Ml Clinton 08.24.07 cucumber muck farm control 'near'
380 M1 Clinton 08.24.07 cucumber muck farm control 'near'
381 Ml Clinton 08.24.07 cucumber muck farm 304
382 Ml Clinton 08.24.07 cucumber muck farm 304
383 Ml Clinton 08.24.07 cucumber muck farm 304
384 Ml Clinton 08.24.07 cucumber muck farm 304
385 Ml Clinton 08.24.07 cucumber muck farm 304
386 Ml Clinton 08.27.07 cucumber muck farm
387 Ml Clinton 08.27.07 cucumber muck farm
388 Ml Clinton 08.27.07 bottle gourd muck farm
389 Ml Ingham 08.27.07 pickling melon plant path farm
390 Ml Ingham 08.27.07 pickling melon plant path farm
391 M1 Ingham 08.27.07 picklinmelon Jlant path farm
392 Ml Ingham 08.27.07 cucumber plant path farm
393 M1 Ingham 08.27.07 cucumber plant path farm
394 Ml Ingham 08.27.07 cucumber plant path farm
395 Ml Ingham 08.27.07 cucumber plant path farm
396 Ml Ingham 08.27.07 cucumber plant path farm
397 Ml Mecosta 08.28.07 cucumber Springbom
398 Ml Mecosta 08.28.07 cucumber Springbom
399 Ml Mecosta 08.28.07 cucumber Springbom
400 Ml Montcalm 08.28.07 cantaloupe Springbom
401 M1 Montcalm 08.28.07 cantaloge Springbom
402 Ml Clinton 08.29.07 melon muck farm
403 M1 Clinton 08.29.07 melon muck farm
404 M1 Clinton 08.29.07 snap melon muck farm
405 Ml Clinton 08.29.07 snap melon muck farm
406 Ml Clinton 08.29.07 snap melon muck farm
407 Ml Clinton 08.29.07 pickliqumelon muck farm
408 Ml Clinton 08.29.07 pickling melon muck farm
409 Ml Clinton 08929.07 texas gourd muck farm
W410 MI Clinton 08.29.07 texas gourd muck farm
411 Ml Clinton 08.29.07 bottle gourd muck farm
412 Ml Clinton 08.29.07 bottle gourd muck farm
413 Ml Clinton 08.29.07 bitter pumpkin muck farm
414 M1 Clinton 08.29.07 bitter pumpkin muck farm
415 Ml Newaygo 09.06.07 cucumber phildo?
416 Ml Newaygo 09.06.07 cucumber diagnostics
417 Ml Newaygo 09.06.07 cucumber diagnostics

 

86

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1

4 l 8 MI Newaygo 09.06.07 cucumber diagnostics
419 Ml Newaygo 09.06.07 cucumber diagnostics
420 Ml Newaygo 09.06.07 cucumber diagnostics
42 1 MI Newaygo 09.06.07 cucumber diagpostics
422 Ml Newaygo 09.06.07 cucumber diagnostics
423 Ml Newaygo 09.06.07 cucumber diagnostics
424 Ml Newaygo 09.06.07 cucumber diagnostics
425 M1 Newaygo 09.06.07 cucumber diagnostics
426 M1 Newaygo 09.06.07 cucumber diagnostics
427 Ml Newaygo 09.06.07 cucumber diagnostics
428 Ml Newaygo 09.06.07 cucumber diagiostics
429 M1 Newaygo 09.06.07 cucumber diagnostics
430 M I Newaygo 09.06.07 cucumber diagpostics
431 Ml Newaygo 09.06.07 cucumber diagiostics
432 M1 Newaygo 09.06.07 cucumber di_agnostics
433 Ml Newaygo 09.06.07 cucumber diagnostics
434 Ml Newaygo 09.06.07 cucumber diagnostics
435 Ml Newaygo 09.06.07 cucumber diagnostics
436 Ml Newaygo 09.06.07 cucumber diagnostics
437 Ml Newaygo 09.06.07 cucumber diagnostics
438 Ml Ingham 09.19.07 cucumber Hammerschmidt
439 Ml Ingham 09.19.07 cucumber Hammerschmidt
440 Ml Ingham 09.19.07 cucumber Hammerschmidt
441 Ml Ingham 09.19.07 cucumber Hammerschmidt
442 NY Suffolk 09.20.07 cucumber Riverhead
443 NY Suffolk 09.20.07 cucumber Riverhead
__444 NY Suffolk 09.20.07 cucumber Riverhead
445 NY Suffolk 09.20.07 cucumber Riverhead
446 NY Suffolk 09.20.07 cucumber Riverhead
447 NY Suffolk 09.20.07 1 cucumber Riverhead
448 NY Suffolk 09.20.07 cucumber Riverhead
449 NY Suffolk 09.20.07 cucumber Riverhead
450 NY Suffolk 09.20.07 acorn squash Riverhead
451 NY Suffolk 09.29.07 acorn squash Riverhead
452 NY Suffolk 09.20.07 acorn squash Riverhead
453 NY Suffolk 09.20.07 acorn squash Riverhead
454 NY Suffolk 09.20.07 acorn squash Riverhead
455 NY Suffolk 09.20.07 acorn squash Riverhead
456 M I Alpena 09.10.07 cucumber Hearthcock
457 Ml Alpena 09.10.07 cucumber Hearthcock
458 Ml Alpena 09. 10.07 cucumber Hearthcock
459 Ml Alpena 09.10.07 cucumber Hearthcock
460 IN La Porte 09.19.07 Cucurbita pepo - gold dust Wanatah
461 IN La Porte 09.19.07 Cucurbita pepo - gold dust Wanatah
462 IN La Porte 09.19.07 Cucurb1ta pepo - gold dust Wanatah
463 IN La Porte 09.19.07 Cucurbita pepo - gold dust Wanatah
464 IN La Porte 09.19.07 Cucurbita pepo - gold dust Wanatah
465 IN La Porte 09.19.07 C ucurbita pepo - gold dust Wanatah
466 IN La Porte 09.19.07 Cucurbita pepo - gold dust Wanatah
467 IN La Porte 09.19.07 Cucurbita pepo - gold dust Wanatah
468 IN La Porte 09.19.07 Cucurbita pepo - gold dust Wanatah
469 IN La Porte 09.19.07 Cucurbita pepo - gold dust 1 Wanatah
470 IN La Porte 1 09.19.07 C ucurbita pepo - sweet dumpling 1 Wanatah

 

87

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

471 IN La Porte 09.19.07 C ucurbita pepo - sweet dumpling Wanatah
472 IN La Porte 09.19.07 Cucurbitapem) - sweet dumpling Wanatah
473 IN La Porte 09.19.07 Cucurbita pepo - sweet dumpling Wanatah
474 IN La Porte 09.19.07 Cucurbitapepo - sweet dumplin Wanatah
475 IN La Porte 09.19.07 Cucurbita pepo - sweet dumpling Wanatah
476 IN La Porte 09.19.07 Cucurbita pepo - sweet dumpling Wanatah
477 IN La Porte 09.19.07 Cucurbita pepo - sweet dumpling Wanatah
478 IN La Porte 09.19.07 Cucurbitamepo - sweet dumpling Wanatah
479 IN La Porte 09.19.07 Cucurbita pepo - sweet dumpling_ Wanatah
480 IN La Porte 09.19.07 Cucurbita moschta - harris butternut Wanatah
481 OH Huron 09.21.07 cucumber - lidor North Fairfield
482 OH Huron 09.21.07 cucumber - lidor North Fairfield
483 OH Huron 09.21 .07 cucumber - lidor North Fairfield
484 OH Huron 09.21.07 cucumber - lidor North Fairfield
485 OH Huron 09.21.07 cucumber - lidor North Fairfield
486 OH Huron 09.21.07 cucumber - lidor North Fairfield
487 OH Huron 09.21.07 cucumber - lidor North Fairfield
488 OH Huron 09.21.07 cucumber - cobra North Fairfield
489 OH Huron 09.21.07 cucumber - cobra North Fairfield
490 OH Huron 09.21.07 cucumber - cobra North Fairfield
491 OH Huron 09.21.07 cucumber - cobra North Fairfield
492 OH Huron 09.21.07 cucumber - cobra North Fairfield
493 OWH Huron 09.21.07 cucumber - cobra North Fairfield
494 OH Huron 09.21.07 cucumber - welchers North Fairfield
495 OH Huron 09.21.07 cucumber - welchers North Fairfield
496 OH Huron 09.21.07 cucumber - welchers North F airfield
497 OH Huron 09.21.07 cucumber - welchers North Fairfield
498 OH Huron 09.21.07 cucumber - welchers North Fairfield
499 OH Huron 09.21.07 cucumber - welchers North Fairfield
500 OH Huron 09.21.07 cucumber - welchers North Fairfield
501 OH Huron 09.21.07 cucumber - welchers North Fairfield
502 OH Huron 09.21.07 cucumber - welchers North Fairfield
503 M1 Clinton 08.24.07 texas gourd muck farm
504 Ml Clinton 08.24.07 texas gourd muck farm
505 Ml Clinton 08.24.07 texas gourd muck farm
506 FL Alachua 09.27.07 cucumber Gainesville
_5_07 SC Charleston 09.27.07 cucumber Clemson
508 SC Charleston 09.27.07 cucumber Clemson
509 SC Charleston 09.27 .07 cucumber Clemson
510 SC Charleston 09.27.07 cucumber Clemson
51 1 SC Charleston 09.27.07 cucumber Clemson
512 SC Charleston 09.27.07 cucumber Clemson
513 SC Charleston 09.27.07 cucumber Clemson
5 14 SC Charleston 09.27.07 cucumber Clemson
515 SC Charleston 09.27.07 cucumber Clemson
5 l 6 SC Charleston 09.27.07 cucumber Clemson
517 SC Charleston 09.27.07 cucumber Clemson
518 SC Charleston 09.27.07 cucumber Clemson
319 FL Lafayette 10.07 .07 cucumber Prine-l
520 FL Lafayette 10.07.07 cucumber Prine-l
i2 1 FL Lafayette 10.07.07 cucumber Prine-I
_Ln FL Lafayette 10.07.07 cucumber Prine-2
523 FL Lafayette 10.07.07 cucumber Prine-2

 

88

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

524 FL Lafayette 10.07.07 cucumber Prine-2
525 FL Lafayette 10.07.07 cucumber Prine-2
526 FL Lafayette 10.07.07 cucumber Prine-2
527 FL Lafayette 10.07.07 cucumber Prine-Z
528 FL Collier 11.26.07 cucumber - pointsett 76 Immokalee
529 FL Collier 11.26.07 cucumber - pointsett 76 Immokalee
530 FL Collier l 1.26.07 cucumber - pointsett 76 Immokalee
53] FL Collier 11.26.07 cucumber - pointsett 76 Immokalee
532 FL Collier 11.26.07 cucumber mointsett 76 Immokalee
533 FL Collier 11.26.07 cucumber - national pickle Immokalee
534 FL Collier 11.26.07 cucumber - national pickle Immokalee
535 FL Collier 11.26.07 cucumber - national pickle Immokalee
536 FL Collier 11.26.07 cucumber - national pickle Immokalee
537 FL Collier 11.26.07 cucumber - sumter Immokalee
538 FL Collier 11.26.07 cucumber - sumter Immokalee
539 FL Collier 11.26.07 cucumber - sumter Immokalee
540 FL Collier 11.26.07 cucumber - sumter Immokalee
541 FL Collier 1 1.26.07 cucumber - sumter Immokalee
542 FL Collier 11.26.07 cucumber - straight 8 Immokalee
543 FL Collier 11.26.07 cucumber - straight 8 Immokalee
544 FL Collier 1 1.26.07 cucumber - straight 8 Immokalee
545 FL Collier 11.26.07 cucumber - straight 8 Immokalee
546 FL Collier 11.26.07 cucumber - SMR 58 Immokalee
547 FL Collier 11.26.07 cucumber - SMR 58 Immokalee
548 FL Collier 11.26.07 cucumber - SMR 58 Immokalee
549 FL Collier 11.26.07 cucumber - SMR 58 Immokalee
550 FL Collier 11.26.07 cucumber - SMR 58 Immokalee
551 FL Collier 11.26.07 cucumber - SMR 58 Immokalee
552 GA Colquitt 10.20.06 cucumber - thunder Gevens
2008 SAMPLES
ID State County Date (m/d/y Host (and cultivar, if known) Site
1 FL Collier 05.05.08 bottle gourd Immokalee
2 FL Collier 05.05.08 cantaloupe Immokalee
3 FL Collier 05.05.08 cucumber Immokalee
4 FL Collier 05.05.08 cucumber Immokalee
5 FL Collier 05.05.08 cucumber Immokalee
6 FL Collier 05.05.08 cucumber Immokalee
7 FL Collier 05.05.08 cantaloupe Immokalee
8 FL Collier 05.05.08 cucumber Immokalee
9 FL Collier 05.05 .08 cucumber Immokalee
10 FL Collier 05.05.08 cantaloupe Immokalee
1 1 FL Collier 05.05.08 cantaloupe Immokalee
_12 FL Marion 06.18.08 cucumber- straight 8 Citra
13 FL Marion 06.18.08 cucumber- straight 8 Citra
14 FL Marion 06.18.08 cucumber- straight 8 Citra
15 FL Marion 06.18.98 cucumber- straight 8 Citra
16 FL Marion 06.18.08 cucumber- straight 8 Citra
17 FL Marion 06.18.08 cucumber- straight 8 Citra
18 FL Marion 06.18.08 cucumber— straight 8 Citra
19 FL Marion 06.18.08 cucumber— straight 8 Citra
20 FL Marion 06.18.08 cucumber- straight 8 Citra
21 FL Marion 06.18.08 cucumber— straight 8 Citra
22 FL Marion 06.18.08 cucumber— straight 8 Citra

 

89

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

23 FL Marion 06.18.08 cucumber— straight 8 Citra
24 FL Marion 06.18.08 cucumber- straight 8 Citra
_ 25 FL Marion 06.18.08 cucumber— straight 8 Citra
26 FL Marion 06.18.08 cucumber— snghg8 Citra
27 NC Charleston 06.25.08 cucumber Clemson
28 NC Charleston 06.25.08 cucumber Clemson
29 NC Charleston 06.25.08 cucurfler Clemson
30 NC Charleston 06.25.08 cucumber Clemson
31 NC Charleston 06.25.08 cucumber Clemson
1 32 NC Charleston 06.25.08 cucumber Clemson
33 NC Charleston 06.25.08 cucumber Clemson
34 NC Charleston 06.25.08 cucumber Clemson
35 NC Charleston 06.25.08 cucumber Clemson
36 NC Charleston 06.25.08 cucumber Clemson
#37 NC Charleston 06.25.08 cucumber Clemson
38 Ml Monroe 07.02.08 cucumber spore trap site
39 MI Monroe 07.02.08 cucumber spore trap site
40 M1 Monroe 1#020298 cucumber more trap site
. _4WI____MI Monroe 07.02.98 cucumber spore trap site
42 SC __Charleston 9 melon- Ananas Yokneam Shaker
43 SC Charleston ? melon- Ananas Yokneam Shaker
44 NY Niagara 07.02.08 cucumber Buffalo
45 NY Niagara 07.02.08 cucumber Buffalo
W 46 NY Ontario 07.07.08 cucumber Geneva
1 47 NY Ontario 07.07.08 cucumber Geneva
_ 48 NY Ontario 07.07.08 cucumber Geneva
W 49 MI Allegan 07.09.08 cucumber spore trap site
50 Ml Allegan 07.09.08 cucumber spore trap site
W 51 MI Allegan 07.09.08 cucumber spore trap site
52 MI Alrlregan 07.09.08 cucumber spore trap site
53 M1 Allegan 07.09.08 cucumber spore trap site
p_54 MI Allegan 07.09.08 cucumber spore trap site
_ 155 Ml Allegan 07.09.08 cucumber spore trap site
a 56 Ml Allegan 07.09.08 cucumber spore trap site
_57 Ml Allegan 07.09.08 cucumber spore trap site
58 TX Waller 07.09.08 watemelon Hockley
__59 TX Waller 07.09.08 watemelorrW Hockley
_ 69 WE Waller 07.09.08 watemelon '__ Hockley
61.1 TX Waller 07.09.08 watemelon Hockley
p 62 TX Waller 07.09.08 watemelon Hockley
63 TX Waller 07.09.98 watemelon Hockley
64 TX Waller 07.09.98 watemelon Hockley
.. 65 TX Waller 07.09.08 watemelon Hockley
66 TX Waller 07.09.08 watemelon Hockley
67 TX Waller 07.09.08 . watemelon Hockley
~98ij 1 Waller 07.09.08 __ watemelon Hockley
p69 TX 1 Waller 07.09.08 watemelon Hockley
. 70 TX 1 Wa|1er 07.09.08 watemelon Hockley
_ .71 TX T Waller 9 07.09.08 watemelon Hockley
72 TX 1 Waller 07.09.08 watemelon Hockley
__73 GA Tift 07.18.08 cucumber— Jafayette Tifton
_p 74 GA Tifi ; 07.18.09 cucumber- lafayette Tifton
75 GA Tifi 1 07.18.08 cucumber— lafayette Tifion

 

 

90

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

76 GA Tift 07.18.08 cucumber- lafayette Tifion

77 GA Tifi 07.18.08 cucumber- lafayette Tifton

78 GA Tift 07.18.08 cucumber— lafayette Tifton

79 GA Tift 07. 18.08 cucumber- lafayette Ti fton

80 GA Tifi 07.18.08 cucumber- lafayette Tifion

81 GA Tift 07.18.08 cantaloupe- hales‘s best Tifton

82 GA Tift 07.18.08 canta10upe- hales's best Tifton

83 GA Tift 07.18.08 cantaloupe- hales's best Tifton

84 GA Tifi 07.18.08 cantaloupe- hales's best Tifton

85 GA Tift 07.18.08 cantaloupe- hales's best Tifton

86 GA Tift 07.18.08 acorn squash- table Queen Tifton

87 GA Tifi 07.18.08 acorn squash- table gueen Tifton

88 GA Tift 07.18.08 acorn smiash- tablequeen Tifton

89 GA Tifi 07.18.08 acorn squash- table queen Tifton

90 GA Tifi 07.18.08 acorn squash— table queen Tifton

91 GA Tift 07.18.08 watermelon- mickey lee Tifton

92 GA Tift 07.18.08 watermelon- mickey lee Tifton

93 GA Tift 07.18.08 watermelon- mickey lee Tifion

94 GA Tift 07.18.08 watermelon- mickey lee Tifton

95 GA Tift 07.18.08 watermelon- mickey lee Tifton

96 Ml Arenac 07.30.08 cucumber Randy Hugo
97 MI Arenac 07.30.08 cucumber Randy Hugo
98 MI Arenac 07.30.08 cucumber Randy Hugo
99 MI Arenac 07.30.08 cucumber RandLHugo
100 Ml Arenac 07.30.08 cucumber Randy Iggo
101 Ml Arenac 07.30.08 cucumber Randy Hugo
102 Ml Arenac 07.30.08 cucumber Randy Hugo
103 Ml Arenac 07.30.08 cucumber Randy Htfl)
104 Ml Tuscola 07.30.08 cucumber Randy Hugo
105 Ml Tuscola 07.30.08 cucumber Randy Hugo
106 Ml Tuscola 07.30.08 cucumber Randy Hugo
107 Ml Tuscola 07.30.08 cucumber Randy Hugo
108 M1 Tuscola 07.30.08 cucumber Randy Hugo
109 Ml Tuscola 07.30.08 cucumber Randy Hugo
110 Ml Saginaw 07.30.08 cucumber Randy Hugo
111 Ml Saginaw 07.30.08 cucumber Randy Hugo
1 12 MI Saginaw 07.30.08 cucumber RanggHugo
113 ON Chatham-Kent 07.27.08 cucumber- mintsett 76 Chatham
114 ON Chatham-Kent 07.27.08 cucumber- pointsett 76 Chatham
115 ON Chatham-Kent 07.27.08 cucumber— pointsett 76 Chatham
116 ON Chatham-Kent 07.27.08 cucumber— pointsett 76 Chatham
117 ON Chatham-Kent 07.27.08 cucumber- pointsett 76 Chatham
118 ON Chatham-Kent 07.27.08 cucumber— pointsett 76 Chatham
119 ON Chatham-Kent 07.27.08 cucumber- pointsett 76 Chatham
120 ON Chatham-Kent 07.27.08 cucumber- pointsett 76 Chatham
121 ON West Elgin 07.27.08 cucumber- pointsett 76 Rodney
122 ON West Elgin 07.27.08 cucumber- pointsett 76 Rodney
123 ON West Elgin 07.27.08 cucumber— pointsett 76 Rodney
124 ON West Elgin 07.27.08 cucumber- pointsett 76 Rodney
125 ON West Elgin 07.27.08 _ __cucumber- pointsett 76 Rodney
126 ON Chatham-Kent 07.27.08 cucumber Ridgetown
127 ON C hatham-Kent 07.27.08 cucumber Ridgetown
128 ON C hatham-Kent 07.27.08 cucumber Ridgetown

 

91

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

129 ON C hatham-Kent 07.2_7.98 cuptpmber Ridgetown
130 ON Chatham-Kent 07.27.08 cucumber Ridgetown
13 1 ON C hatham-Kent 07.27.08 cucumber Ridgetown
132 OH Wayne 08.07.08 cucumber— straight 8 Wooster
_133 OH Wayne 08.07.08 cucumber— straight 8 Wooster
9134 OH Wayne 08.07.08 cucumber— straight 8 Wooster
135 OH Wayne 08.0_7.08 cucumber— straight 8 Wooster
136 OH Wayne 08.07.08 cantalomie- hales's best Wooster
137 OH Wayne 08.07.08 cantalp_upe- hales's best Wooster
138 OH Wayne 08.07.08 cantaloupe- hales's best Wooster
139 OH Wayne 08.07.08 cantaloupe- hales's best Wooster
140 OH Wayne 08.07.08 cucumber- pointsett 76 Wooster
141 OH Wayne 08.07.08 cucumber— pointsett 76 Wooster
142 OH Wagne 08.07.08 cucumber— pointsett 76 Wooster
143 OH Wayne 08.07.08 cucumber- pointsett 76 Wooster
144 OH Huron 08.07.08 cucumber- pointsett 76 Celeryville
145 OH Huron 08.07.08 cucumber- pointsett 76 Celeryville
146 OH Huron 08.07.08 cucumber- pointsett 76 Celeryville
147 OH Huron 08.07.08 cucumber- pointsett 76 Celeryville
£8 OH Huron 08.07.08 cucumber— poiprsett 76 Celegville
W149 OH Huron 08.07.08 cucumber- straight 8 Celeryville
_ 150 OH Huron 08.07.08 cucumber- straight 8 Celemville
__ 151 OH Huron 08.07.08 cucumber- straight 8 Celeryville
152 OH Huron 08.07.08 cucumber- straight 8 Celerjpville
_1_53 OH Huron 08.07.08 cucumber— cobra Celelfiille
154 OH Huron 08.07.08 cucumber— cobra Celeryville
155 OH Huron 08.07.08 cucumber— cobra Celemille
156 M1 Clinton 08.08.08 cucumbep-pptraigbt 8 muck farm
157 M1 Tuscola 08.05 .08 cucumber Pink
158 MI 1 Tuscola 08.05.08 cucumber Pink
159 Ml Tuscola 08.05108 cucumber Pink
160 Ml Tuscola 08.05.08 cucumber Pink
161 Ml Tuscola 08.05.08 cucumber Pink
_1629ng Tuscola 08.05.08 cucumber Pink
163 Ml Tuscola 08.05.08 cucumber Pink
164 Ml Tuscola 08.95.08 cucumber Pink
165 Ml Tuscola 08.05.08 cucumber Pink
_1_66p_Ml Tuscola 08.05.08 cucumber Randy Hugo
167 Ml Bay 1 03,,- 12.08 cucumber Reese
168 Ml Bay 1 08.12.08 cucumber Reese
169 MI 1 Bay 1 08.12191__ cucumber Reese
170 MI 1 Bay 08.12.08 cucumber Reese
171 WM] 1 Bay 08.12.08 . cucumber Reese
[1731 M1 Bay 08.12.08 cucumber Reese
W_1_79 MI Bay 08.12.98 cucumber Reese
174 MI 1 Bay 08.12.08 cucumber Reese
EWWb/Ij 1 Bay 98.12.08 cucumber Reese
J76 _MI 1 Bay 4W9892089 ___ cucumber Reese
- 17? MI 1 Bay 1 08.12.0981: _ cucum_ber _____ spore trap site
178 M1 1 Bay 1 08.12.08 _. 1 Wcucumber ___spore tram site
179 MI 1 Bay 1 08121.08 1 cucumber spore trap site
_180p M12 Bay 1 08.12.98 1 cucumber spore trap site
181 W1 1 Bay 1 08.12.08 cucumber spore trap site

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

182 Ml Bay 08.12.08 cucumber spore tray site
183 Ml Bay 08.12.08 cucumber spore trap site
184 Ml, Bay 08.12.08 cucumber spore trap site
J35 Ml Bay 08.12.08 CLEUflbef spore trap site
186 Ml Bay 08.12.08 cucumber spore trap site
187 Ml Bay 08.12.08 cucumber DM
188 Ml Bay 08.12.08 cucumber DM
189 Ml Bay 08.12.08 cueurlber DM
190 Ml Bay 08.12.08 cucumber DM
191 Ml Bay 08.12.08 cucumber DM
JQLAM BaL 08. 12.08 cueumber DM
193 Ml Bay 08.12.08 cucumber DM
194 Ml Bay 08.12.08 cucumber DM
195 Ml Bay 08.12.08 cucumber DM
196 Ml Bay 08.12.08 cucumber DM
197 OH Sandusky 08.12.08 cantaloupe- hales's best Freemont
198 OH Sandusky 08.12.08 cantaloupe- hales's best Freemont
1_l99 OH Sandusky 08.12.08 cantaloupe- hales's best Freemont
200 OH Sandusky 08.12.08 cantaloupe- hales's best Freemont
201 OH Sandusky 08.12.08 cantalowe- hales's best Freemont
202 OH Sandusky_ 08.12.08 cantaloye- hales's best Freemont
203 OH Wayne 08.12.08 cantaloupe- hales’s best Snyder Farm
204 OH Wayne 08.12.08 cantaloupe- hales's best Snyder Farm
205 OH Wayne 08.12.08 cantaloupe- hales's best Snyder Farm
Q6 OH Wayne 08.12.08 cantaloupe- hales's best Snyder Farm
207 OH Huron 08.12.08 cucumber Wiers Farm
11 208 OH Huron 08.12.08 cucumber Wiers Farm
209 OH Huron 08.12.08 cucumber Wiers Farm
210 OH Huron 08.12.08 cucumber Wiers Farm
211 OH Huron 08.12.08 cucumber Wiers Farm
212 OH Huron 08.12.08 cucumber Wiers Farm
213 OH Huron 08.12.08 cucumber Wiers Farm
214 OH Huron 08.12.08 cucumber Wiers Farm
215 OH Huron 08.12.08 cucumber Wiers Farm
216 OH Huron 08.12.08 cucumber Wiers Farm
217 OH Huron 08.12.08 cucumber State Rd.
218 OH Huron 08.12.08 cucumber State Rd.
219 OH Huron 08.12.08 cucumber State Rd.
220 OH Huron 08.12.08 cucumber State Rd.
22] OH Huron 08.12.08 cucumber State Rd.
722 OH Huron 08.12.08 1 cucumber State Rd.
P22§4£H Huron 08.12.08 cucumber State Rd.
224 Ml Tuscola 08.12.08 cucumber unknown
225 Ml Tuscola 08.12.08 cucumber unknown
b 2.26 Ml Tuscola 08.12.08 cucumber unknown
_227 Ml Tuscola 08.12.08 cucumber 100 Acre
228 Ml Tuscola 08.12.08 cucumber 100 Acre
229 Ml Tuscola 08.12.08 cucumber 100 Acre
3.3) MI Tuscola 08.12.08 cucumber 100 Acre
.33.] Ml Tuscola 08.12.08 _1_ cucumber 100 Aere
232 Ml Tuscola 08.12.08 4 cucumber 100 Acre
11 233 Ml Saginaw 08,127.08 l cucumber Gera
234 Ml Saginaw 08.12.08 l cucumber Gera

 

93

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

235 Ml Saghiaw 08.12.08 cucumber Gera

236 M1 Saginaw 08.12.08 cucumber Gera

237 Ml Saginaw 08.12.08 . cucumber Gera

238 Ml Saginaw 08.12.08 cucumber Gera

239 M1 Sgfinaw 08.12.08 cucumber Gera

240 Ml Saginaw 08.12.08 cucumber Gera

241 M1 Saginaw 08.12.08 cucumber Gera

242 Ml Saginaw 08.12.08 cucumber Gera

243 M1 Wayne 08.13.08 cucumber Service

244 Ml Wayne 08. 13.08 cucumber Service

245 Ml Wajne 08.13.08 cucumber Service

246 M1 Wayne 08. 13.08 cucumber Service

247 M1 Wayne 08.13.08 cucumber Service

248 Ml Wayne 08.13.08 cucumber Service

249 M1 Wayne 08.13.08 cucumber Service

250 Ml Wayne 08. 13.08 cucumber Service

25 1 M1 Wayne 08.13.08 cucumber Service

252 Ml Wayne 08.13.08 cucumber Service

253 M1 Monroe 08.13.08 cucumber spore trap site

254 Ml Monroe 08.13.08 cucumber spore tra1Lsite

255 Ml Monroe 08.13.08 cucumber spore trap site

256 M1 Monroe 08.13.08 cucumber spore trap site

257 Ml Monroe 08.13.08 cucumber spore trap site

258 OH Sandusky 08.12.08 cucumber— pointsett 76 OSU sentinel plot

259 OH Sandusky 08.12.08 cucumber- pointsett 76 OSU sentinel plot

260 OH Sandusky 08.12.08 cucumber— pointsett 76 OSU sentinel plot

261 OH Sandusky 08.12.08 cucumber- pointsett 76 OSU sentinel plot

262 OH Sandusky 08.12.08 cucumber— pointsett 76 OSU sentinel plot

263 OH Sandusky 08.12.08 cucumber— pointsett 76 OSU sentinel plot

264 OH Sandusky 08.12.08 cucumber— pointsett 76 OSU sentinel plot

265 OH Sandusky 08.12.08 cucumber- pointsett 76 OSU sentinel plot

266 OH Sandusky 08.12.08 cucumber— straight 8 OSU sentinel plot

267 OH Sandusfiy 08.12.08 cucumber— straight 8 OSU sentinel plot

268 OH Sandusky 08.12.08 cucumber— straight 8 OSU sentinel plot

269 OH Sandusky 08.12.08 cucumber— straight 8 OSU sentinelJilot

270 OH Sandusky 08.12.08 cucumber- straight 8 OSU sentinel plot

271 OH Sandusky 08.12.08 cucumber- straight 8 OSU sentinel plot

272 OH Sandusky 08.12.08 cucumber— straight 8 OSU sentinel plot

273 OH Sandufl 08.12.08 cucumber- straight 8 OSU sentinel plot

274 OH Sandusky 08.12.08 cucumber— pickle valaset Reily Tvm

275 OH Sandusky 08.12.08 cucumber- harvest pickle valaset Reily Tm

276 OH Sandusky 08.12.08 cucumber- hawesgpickle valaset Reily Twp

277 OH Sandusky 08.12.08 cucumber— harvest pickle valaset Reily Twp

278 OH Sandusky 08.12.08 cucumber- harvest pickle valaset Reily Twp

279 OH Sandusky 08.12.08 cucumber- harvest pickle valaset Refly Twp

280 OH Sandusky 08.12.08 cucumber- harvest pickle valaset Refly Twp
__281 OH Sandusky 08.12.08 cucumber— harvest pickle valaset Reily Twp

282 OH Sandusky 08.12.08 cucumber— harvest pickle valaset Reily Twp

283 OH Sandusky 08.12.08 cucumber- harvest pickle valaset Reily Twp

284 OH Sandusky 08.12.08 cucumber— harvest pickle valaset Bellville

285 OH Sandusky 08.12.08 cucumber- harvest pickle valaset Bellville

286 OH Sandusky 08.12.08 cucumber— harvest pickle valaset Bellville

287 OH Sandusky 08.12.08 cucumber— harvest pickle valaset Bellville

 

94

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

288 OH Sandusky 08.12.08 cucumber- harvest pickle valaset Bellville
289 OH SanduskL 08.12.08 cucumber— harvest pickle valaset Bellville
290 OH Sandusky 08.12.08 cucumber- harvest pickle valaset Bellville
291 OH Sandusky 08.12.08 cucumber— harvest pickle valaset Bellville
292 OH Sandusky 08.12.08 cucumber— harvest pickle valaset Bellville
293 OH Sandusky 08.12.08 cucumber- harvest pickle valaset Bellville
294 OH Sandusky 08.12.08 cucumber- harvest pipckle valaset Bellville
295 OH Sandusky 08.12.08 cucumber— McALhur Reily Twp
296 OH SanduskL 08.12.08 cucumber- McArthur ReiTwp
297 OH Seneca 08.12.08 cucumber- thunder Pleasant Twp
298 OH Seneca 08.12.08 cucumber— thunder Pleasant Twp
299 OH Seneca 08.12.08 cucumber- thunder Pleasant Twp
300 OH Seneca 08.12.08 cucumber- thunder Pleasant Twp
301 OH Seneca 08. 12.08 cucumber- thunder Pleasant Twp
302 OH Seneca 08.12.08 cucumber— thunder Pleasant M
303 OH Seneca 08.12.08 cucumber— thunder Pleasant Twp
304 OH Seneca 08.12.08 cucumber- thunder Pleasant Twp
305 OH Wayne 08.12.08 cucumber- dasher ll Moreland
306 OH Wayne 08.12.08 cucumber- dasher Il Moreland
307 OH Wayne 08.12.08 cucumber- dasher ll Moreland
38 OH Wayne 08.12.08 cucumber- dasher ll Moreland
309 OH Wayne 08.12.08 cucumber- dasher ll Moreland
310 OH Seneca 08.12.08 cucumber- harvest pickle valaset JC
31 1 OH Seneca 08.12.08 cucumber- harvest pickle valaset JC
312 OH Seneca 08.12.08 cucumber— harvest pickle valaset JC
313 OH Seneca 08.12.08 cucumber- harvest pickle valaset JC
314 OH Seneca 08.12.08 cucumber- harvest pickle valaset JC
315 OH Seneca 08.12.08 cucumber- harvest pickle valaset J_C
316 OH Seneca 08.12.08 cucumber- harvest pickle valaset JC
317 OH Seneca 08.12.08 cucumber- harvest pickle valaset JC
318 OH Seneca 08.12.08 cucumber- harvest pickle valaset JC
319 OH Seneca 08.12.08 cucumber- harvest pickle valaset JC
320 OH Wayne 08.12.08 cucumber- dasher ll Homerville
321 OH Wayne 08.12.08 cucumber- dasher ll Homerville
322 OH Wayne 08.12.08 cucumber- dasher ll Homerville
323 OH Wayne 08.12.08 cucumber— dasher ll Homerville
324 OH Wayne 08.12.08 cucumber— dasher ll Homerville
325 OH Wayne 08.12.08 cucumber- dasher ll Homerville
326 OH Wayne 08.12.08 cucumber— dasher ll Homerville
327 OH Wayne 08.12.08 cucumber— dasher ll Homerville
328 OH Wayne 08.12.08 cucumber— dasher [1 Homerville
329 OH Wayne 08.12.08 cucumber— dasher ll Homerville
_3_30 OH Wayne 08.13.08 melon Homerville
331 OH Wayne 08.13.08 melon Homerville
332 OH Wayne 08.13.08 _ melon Homerville
333 OH Wayne 08.13.08 melon Homerville
334 OH Wage 08.13.08 melon Homerville
335 OH Wayne 08.13.08 melon Homerville
336 OH Wayne 08.13.08 melon Homerville
337 OH Wayne 08.13.08 melon Homerville
338 OH Wayne 08.13.08 cucumber EAW
339 OH Wayne 08.13.08 cucumber EAW
340 OH Wayne 08.13.08 cucumber EAW

 

 

 

 

 

 

 

95

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

34] OH Wayne 08.13.08 cucumber EAW
342 OH Wayne 08.13.08 cucumber EAW
343 OH Wayne 08. 13.08 cucumber EAW
344 OH Wayne 08. 13.08 cucumber EAW
_345 OH Wayne 08.13.08 cucumber EAW
346 OH Wayne 08.13.08 cucumber EAW
347 OH Wayne 08.13.08 cucumber EAW
348 OH Wayne 08.13.08 cucumber AJH
349 OH Wayne 08.13.08 cucumber AJH
350 OH Wapne 08.13.08 cucumber AJH
35 1 OH Wayne 08.13.08 cucumber AJH a
352 OH Wayne 08.13.08 cucumber AJH
353 OH Wayne 08.13.08 cucumber AJH
354 OH Wayne 08.13.08 cucumber AJH
355 OH Wayne 08.13.08 cucumber AJH
356 OH Wayne 08.13.08 cucumber AJH
357 OH Wayne 08.13.08 cucumber A] H
358 OH Medina 08.13.08 cucumber- dasher ll Homerville
359 OH Medina 08.13.08 cucumber- dasher ll Homerville
360 OH Medina 08.13.08 cucumber- dasher II Homerville
361 OH Medina 08.13.08 cucumber- dasher ll Homerville
_362 OH Medina 08.13.08 cucumber- dasher ll Homerville
363 OH Medina 08.13.08 cucumber- dasher 11 Homerville
364 OH Medina 08.13.08 cucumber— dasher ll Homerville
365 OH Medina 08.13.08 cucumber- dasher ll Homerville
366 OH Medina 08.13.08 cucumber- dasher ll Homerville
J97 OH Medina 08.13.08 cucumber- dasher ll Homerville
368 OH Medina 08.13.08 cucumber— intimidator Black River School Rd.
369 OH Medina 08.13.08 cucumber— intimidator Black River School Rd.
370 OH Medina 08.13.08 cucumber— intimidator Black River School Rd.
3.7. 1 OH Medina 08.13.08 cucumber- intimidator Black River School Rd.
372 OH Medina 08.13.08 cucumber- intimidator Black River School Rd.
373 OH Medina 08.13.08 cucumber- intimidator Black River School Rd.
374 OH Medina 08.13.08 cucumber— intimidator Black River School Rd.
375 OH Medina 08.13.08 cucumber- intimidator Black River School Rd.
376 OH Medina 08.13.08 cucumber— intimidator Black River School Rd.
377 OH Medina 08.13.08 cucumber— intimidator Black River School Rd.
378 ON Essex 08.15.08 cucumber Harrow (OMAFRA)
379 ON Essex 08.15.08 cucumber Harrow (OMAFRA)
£0 ON Essex 08.15.08 cucumber Harrow (OMAFRA)
381 ON Essex 08.15.08 cucumber Harrow (OMAFRA
382 ON Esse_x_ 08.15.08 cucumber Harrow (OMAFRA)
383 ON E_s_sex 08.15.08 ‘ cucumber Harrow (OMAFRA)
A 84 _O_Na1_' __ESSCX 08.15.08 cucumber Harrow (OMAFRA)
p38? ON Essex 08.15.08 cucumber Harrow (OMAFRA)
386 ON Essex 08.15.08 cucumber Harrow QMAFRA)
387 ON Essex 08.15.08 cucumber Harrow @MAFRA)
i8ifl Essex 08.15.08 cucumber Harrow (OMAFRA)
389 ON Essex 08.15.08 cucumber Harrow (OMAF RA)
390 ON Essex 08.15.08 cucumber Harrow (OMAFRA)
p391 ON Essex 08.15.08 cucumber Harrow (OMAFRA)
392 ON Essex 08.15.08 cucumber Harrow (OMAFRA)
393 Ml Genessee 08.21.08 1 cucumber ?

 

96

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

394 Ml Genessee 08.21 .08 cucumber ?

395 Ml Genessee 08.21.08 cucumber ?

396 Ml Genessee 08.21.08 cucumber ?

397 Ml Saginaw 08.19.08 cantaloupe- hales's best sentinel plot
398 Ml 11mm 08.18.08 cucumber— straight 8 Plant Pathology Farm
399 Ml Saint Clair 08.18.08 cucumber Emmet
400 Ml Saint Clair 08.18.08 cucumber Peroni (Yale)
401 Ml Saint Clair 08.18.08 cucumber Peroni(Yale)
402 Ml Saint Clair 08.18.08 cucumber Peroni (Yale)
403 M1 Saint Clair 08.18.08 cucumber Peroni (Yale)
404 Ml Saint Clair 08.18.08 cucumber Peroni (Yale)
405 Ml Saint Clair 08.18.08 cucumber Peroni (Yale)
406 Ml Saint Clair 08.18.08 cucumber Peroni (Yale)
407 M1 Saint Clair 08.18.08 cucumber Peroni (Yale)
408 Ml Saint Clair 08.18.08 cucumber Peroni (Yale)
409 Ml Saint Clair 08.18.08 cucumber Peroni (Yale)
410 M1 Saginaw 08.19.08 cucumber- straight 8 sentinenglot
411 Ml Saginaw 08.19.08 cucumber- straight 8 sentinefiot
412 M1 Saginaw 08.19.08 cucumber- straight 8 sentinel plot
413 Ml Saginaw 08.19.08 cucumber— straight 8 sentinel plot
414 M1 Saginaw 08.19.08 cucumber- straLght 8 sentinemlot
415 M1 Saginaw 08.19.08 cucumber- straight 8 sentinel plot
416 Ml Saginaw 08.19.08 cucumber- straight 8 sentinel plot
417 M1 Saginaw 08.19.08 cucumber— straight 8 sentinel plot
418 Ml Saginaw 08.19.08 cucumber- straight 8 spore trap site
419 Ml Saginaw 08.19.08 cucumber— straight 8 spore trap site
420 Ml Saginaw 08.19.08 cucumber— straight 8 spore trap site
421 Ml Saginaw 08.19.08 cucumber— straight 8 spore trap site
422 Ml Monroe 08.20.08 cucumber spore trap site
423 Ml Monroe 08.20.08 cucumber spore trap site
424 Ml Monroe 08.20.08 cucumber spore trap site
425 Ml Monroe 08.20.08 cucumber spore trap site
426 M1 Monroe 08.20.08 cucumber spore trap site
427 M 1 Monroe 08.20.08 cucumber- straight 8 sentinel plot
428 M1 Monroe 08.20.08 cucumber- straight 8 sentinel plot
429 Ml Monroe 08.20.08 cucumber— pointsett 76 sentinel plot
430 Ml Monroe 08.20.08 cucumber— pointsett 76 sentinel plot
431 Ml Monroe 08.20.08 cucumber- pointsett 76 sentinel plot
432 Ml Monroe 08.20.08 cantaloupe- hales's best sentinel plot
433 Ml Monroe 08.20.08 cantaloupe- hales's best sentinel plot
435 M1 Montcalm 08.21.08 cucumber- vlaspik F. Springbom
436 Ml Montcalm 08.21.08 cucumber- vlaspik F. Springbom
437 Ml Montcalm 08.21.08 cucumber— vlaspik F. Springbom
438 M1 Montcalm 08.21.08 cucumber- vlaspik F. Springbom
439 Ml Saginaw 08.21.08 cucumber— 5517 Merrill
440 M1 Saginaw 08.21.08 cucumber— 5517 Merrill
441 M1 Saginaw 08.21.08 cucumber- 5517 Merrill
442 Ml Saginaw 08.21.08 cucumber— 5517 Merrill
443 Ml Saginaw 08.21.08 cucumber- 5517 Merrill
444 Ml Saginaw 08.21.08 cucumber- 5517 Merrill
445 Ml Saginaw 08.21.08 cucumber- 5517 Merrill
446 VA Accomack 08.21.08 cucumber- pointsett 76 Painter
447 VA Accomack 08.21.08 cucumber— pointsett 76 Painter

 

 

 

 

 

 

97

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

448 VA Accomack 08.21.08 cucumber— pointsett 76 Painter

449 VA Accomack 08.21.08 cucumber- pointsett 76 Painter

450 VA Accomack 08.21.08 cucumber— pointsett 76 Painter

451 VA Accomack 08.21.08 cucumber-Jointsett 76 Painter

452 VA Accomack 08.21.08 cucumber- straight 8 Painter

453 VA Accomack 08.21.08 cucumber— straight 8 Painter

454 VA Accomack 08.21.08 cucumber— straight 8 Painter

455 VA Accomack 08.21.08 cucumber— straim 8 Painter

456 VA Accomack 08.21.08 cucumber- straight 8 Painter

457 VA Accomack 08.21.08 cucumber— straight 8 Painter

458 VA Accomack 08.21.08 cucumber— straight 8 Painter

459 IN Knox 08.21.08 cucumber- straight 8 sentinel plot

460 IN Knox 08.21.08 cucumber- straight 8 sentinel plot

461 IN Knox 08.21.08 cucumber— straight 8 sentintfllot

462 IN Knox 08.21.08 cucumber- straight 8 sentinel plot

463 IN Knox 08.21.08 cucumber- straight 8 sentineliflot

464 IN Knox 08.21.08 cucumber- straight 8 sentinel plot

465 IN Knox 08.21.08 cucumber— straight 8 sentinemot
__466 IN Knox 08.21.08 cucumber- straight 8 sentinel plot

467 IN Knox 08.21.08 cucumber— straight 8 sentinel plot

468 IN Knox 08.21.08 cucumber- straight 8 sentinel plot

469 PA Center 08.27.08 cucumber— marketmore PSU research plot

470 PA Center 08.27.08 cucumber- marketmore PSU research plot

471 PA Center 08.27.08 cucumber- marketmore PSU research plot

472 M1 Ionia 08.29.08 cucumber home garden

473 Ml lonia 08.29.08 cucumber home garden

474 Ml Cass 08.27.08 cucumber Wilbur Ellis

475 Ml Cass 08.27.08 cucumber Wilbur Ellis

476 M1 Cass 08.27.08 cucumber Wilbur Ellis

477 Ml Cass 08.27.08 cucumber Wilbur Ellis

478 M1 Cass 08.27.08 cucumber Wilbur Ellis

479 Ml Cass 08.27.08 cucumber Wilbur Ellis

480 M1 Cass 08.27.08 cucumber Wilbur Ellis

481 Ml Cass 08.27.08 cucumber Wilbur Ellis

482 Ml Cass 08.27.08 cucumber Wilbur Ellis

483 Ml Cass 08.27.08 cucumber Wilbur Ellis
__484 NC Lenoir 09.08.08 acorn squash- table queen Kinston sentinel plot

485 NC Lenoir 09.08.08 acorn squash- table queen Kinston sentinel plot

486 NC Johnston 09.08.08 cucumber— pointsett 76 Clayton sentinel plot

487 NC Johnston 09.08.08 cucumber- pointsett 76 Clayton sentinel plot

488 NC Johnston 09.08.08 cucumber- pointsett 76 Clayton sentinel plot

489 NC Johnston 09.08.08 cucumber— pointsett 76 Clayton sentinel plot

490 NC Johnston 09.08.08 cucumber- pointsett 76 Clayton sentinel plot

491 Ml Kent 09.05.08 cucumber homggarden

492 Ml Lapeer 09.07.08 cucumber— northern pickle Granke

493 Ml Lapeer 09.07.08 cucumber- northern pickle Granke

494 Ml Lapeer 09.07.08 cucumber— northern pickle Granke

495 NC Johnston 09.10.08 cucamaber- straight 8 Clayton sentinel plot

496 NC New Hanover 09.10.08 butternut squash- Waltham Butternut Clayton sentinel plot

497 NC New Hanover 09.10.08 butternut squash- Waltham Butternut Clayton sentinel plot

498 NC New Hanover 09.10.08 butternut aquash- Waltham Butternut Clayton sentinel plot

499 NC New Hanover 09.10.08 butternut squash- Waltham Butternut Clayton sentinel plot

500 NC Johnston 09.10.08 cucumber- straight 8 Clayton sentinel plot

 

98

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

501 NC Johnston 09.10.08 cucumber— straight 8 Clayton sentinel plot
502 NC Johnston 09.10.08 cucumber— straight 8 Clayton sentinel plot
503 NC Johnston 09.10.08 cucumber— straight 8 Clayton sentinel plot
504 NC Johnston 09.10.08 cucumber- straight 8 Clayton sentinel plot
505 Ml Clinton 09.11.08 cucumber- vlaspik muck farm
506 Ml Clinton 09.11.08 cucumber- vlasflk muck farm
507 Ml Clinton 09.11.08 cucumber— vlaspik muck farm
508 Ml Clinton 09.11.08 cucumber— vlaspik muck farm
509 Ml Clinton 09.11.08 cucumber— vlaspik muck farm
510 M1 Clinton 09.11.08 cucumber- vlaspik muck farm
511 Ml Clinton 09.11.08 cucumber— vlaspik muck farm
512 Ml Clinton 09.11.08 cucumber- vlaspik muck farm
513 Ml Ingham 09.11.08 cucumber- vlaspik Plant Pathology Farm
514 M1 Ingham 09.11.08 cucumber- vlaspik Plant Pathology Farm
515 M1 Ingham 09.11.08 cucumber- vlaspik Plant Pathology Farm
516 Ml Iggham 09.11.08 cucumber- vlaspik Plant Pathology Farm
517 Ml Ingham 09.11.08 cucumber— vlagik Plant Pathology Farm
518 M1 Ingham 09.11.08 cucumber- vlaapik Plant Pathology Farm
519 M1 Ingham 09.11.08 cucumber— vlaapik Plant Pathology Farm
520 Ml Calhoun 09.1 1.08 cucumber— lafayette BC
521 Ml Calhoun 09.1 1 .08 cucumber- lafayette BC
522 Ml Calhoun 09.1 1.08 cucumber- lafapette BC
523 Ml Calhoun 09.1 1.08 cucumber- lafagette BC
524 Ml Calhoun 09.1 1.08 cucumber- lafayette BC
525 Ml Calhoun 09.1 1.08 cucumber- lafayette BC
526 Ml Calhoun 09.1 1.08 cucumber- lafayette BC
527 Ml Calhoun 09.1 1.08 cucumber— lafayette BC
528 Ml Calhoun 09.1 1.08 cucumber- lafayette BC
529 M1 Monroe 09.16.08 cucumber- pointsett 76 sentinel plot
530 Ml Monroe 09.16.08 cucumber— pointsett 76 sentinel plot
531 Ml Monroe 09.16.08 cucumber— pointsett 76 sentinel plot
532 Ml Monroe 09.16.08 cucumber- pointsett 76 sentinel plot
533 M1 Monroe 09.16.08 cucumber— pointsett 76 sentinel plot
534 M1 Monroe 09.16.08 cucumber- pointsett 76 sentinel plot
535 M1 Monroe 09.17.08 cantaloupe- hales's best sentinel plot
536 Ml Monroe 09.17.08 cantaloupe- hales's best sentinel plot
537 M1 Monroe 09.17.08 cantaloupe- hales's best sentinegplot
538 M1 Monroe 09.17.08 cantaloupe- hales's best sentinel plot
539 Ml Monroe 09.17.08 cantaloupe- hales's best sentintfilot
540 M1 Monroe 09.17.08 cantaloupe- hales's best sentinel plot
541 TX Hidalgo 10.30.08 cucumber- colt 125 acre
542 TX- Hidalgo 10.30.08 cucumber— colt 125 acre
543 TX Hidalgo 10.30.08 cucumber- colt 125 acre
544 TX Hidalgo 10.30.08 cucumber- colt 125 acre
545 TX Hidalgo 10.30.08 cucumber- colt 125 acre
546 TX Hidalgo 10.30.08 cucumber- colt 125 acre
547 TX Hidalgo 10.30.08 cucumber— colt 125 acre
548 TX Hidalgo 10.30.08 cucumber- colt 125 acre
549 TX Hidalgo 10.30.08 cucumber- colt 125 acre
F550 TX Hidalgo 10.30.08 . cucumber- colt 125 acre
1—552m~ TX Hidalgo 10.30.08 cucumbegNaploeon classic 125 acre
géi TX Hidalgo 10.30.08 cucumber— Naploeon classic 125 acre
557 TX Hidalgo 10.30.08 1 cucumber- Naploeon classic 125 acre

 

99

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

558 TX 1 Hidalgo 1 10.30.08 cucumber— Naplpeopcflasaic l 125 acre
559 TX Hiaalgo 10.30.08 cucumber- Naglpeon classic 1 125 acre
560 MX Sinal_oa1_L_ _1.__2,-0_5;Q§._1 cugmabep—gtpaight 8 1 Los Mochis
561 MX Sjggoa g1 12.05.08 crguglber- straigna 1 Los Mochis
562 MX Sinaloa- 1 __12._05:08 L cucumber— straight 8 _Los Mochis
563 MX Sinalpa_____ __112_.05.08fi cucumber— straight 8 1 Los Mochis
564 MX Sinaloa ___ 1,105.08 cucumber— straightfl8 ' Los Mochis
ASS MX Sinaloa __ a_112.05.08 cucumber- pointsett 76 Los Mochis
566 MX SiLnalgam 12.05.08 cucumber— pointsett 76 Los Mochis
567 MX Sinaloa 1172.05.08 cucumber— pointsett 76 Los Mochis
568 MX Sinaloa 12.05.08 cucumber- pcprltseLtt 76 Los Mochis
569 MX Sinaloa 12.05.08 cucgpcfi paintSLett 76 Los Mochis
570 MX Sinaloa 12.05.08 cucunaper- SMR 58 Los Mochis
571 MX Sinaloa 12.05.08 cucumber- 8MB 58 Los Mochis
572 MX Sinaloa l_2£5_.08_~ 1 cucumber— SMR_ 58 Los Mochis
573 MX SinaloaL 12:05.08 cucumber- SMR 58 Los Mochis
574 MX Sinaloa 1112.05.08 cucumber- SMR 58 Los Mochis
575 MX Sinaloa 12.05.08 cucumber— GY11_4_ 1 Los Mochis
_576 MX Sinaloa 12a0_5.08 cucumber— GY714 1 Los Mochis
F1577 MX Sinaloa 1;05.08 1 cucumber— GY 14 1L Los Mochis
578 MX Sinaloa 12.05.08 1 cucumber— CY 14 Los Mochis
579 MX Sinaloa 12.05.08 T cucumber- CY 14 Los Mochis
580 MX SifirfloaL__12L5.(£a 1_ cucumber— natiorflcgkle Los Mochis
__581 fix ___Spialoa __1l2_.05.08 cucumber- nationalpickle. Los Mochis
a582 MX Sinaloa _fl __1;05.08 cucumber— national pickle Los Mochis
583 MX S_inaloa__ 1‘ _1__12.05.08 cucumber- natio_nal pickle Los Mochis
584 MX Sina1pa_ -s_- 12.05.08 cucumber- natipnaipigkle Los Mochis
585 MX Sinaloa 12.05.08 cucumber- sumter Los Mochis
586 MX Sinaloa 12.05.08 cucumber— sumter 1 Los Mochis
587 MX Sinaloa 12:05.08 cucumber— sumter 1L Los Mochis
L588 MX Sirfloa 12.05.08 cucuanber- sumter j Los Mochis
589 MX Sinaloa 1 12.05.08 cucumber— sumter 1 Los Mochis
INTERNATIONAL SAMPLES
1 Y 18 Geba Carmel 2008 cucumber 1 BlU
_ 2 IS 1 Ahitov 2008 cucumber BIU
6 IS ' Ahitov 2008 cugumber BIU
__L 1S___ Ahitpv___ 2008 cucumber BIU
1 10 T15 Tamar Sabach, 2008 cucumber BIU
1 1 L841Menashepavid___2008 cucumber BlU
- BIU lS Bar-[Ian Univ. 2007 cucumber BIU
18.7. [S Bar-llan Univ. 11__A270p08 cucumber DMMxl
13.8.8 18 Bar-11am Univ. 2008 cucumber _ MPDxl
1 NL unknown 2001 cucumber 1 __ Enza Zaden
L2 1 SP unknown 2001 cucumber 1 Enza Zaden
3__LSP____pnknpwnL1__ __200_6_____ ' cucumber _ _1_ Enza Zaden
1 L _ _SILLunknognflw 1___gg03__ squash = Enza Zaden
5 1 IT 91151391119." _ #901 f squash Enza Zaden
6 TK unknown 1 2008 squash Enza Zaden

 

100

 

3 1293 03062 837