Michigan State
University .

This is to certify that the

thesis entitled

ROLE OF WAAL AND UMUDC IN ERWINIA AMYLOVORA EA1189
IN OXIDATIVE STRESS AND ULTRAVIOLET RADIATION
SURVIVAL

presented by

Matthew Berry

has been accepted towards fulfillment
of the requirements for the

Master of Science degree in Genetics

 

 

Major Professor’s Signature
4 - 2 o - o 9

Date

 

MSU is an Affirmative Action/Equal Opportunity Employer

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5l08 K:IProj/Acc&Pres/ClRC/DateDue.indd

ROLE OF WAAL AND UM UDC IN ER WINIA AMYLOVORA EA1189 IN OXIDATIVE
STRESS AND ULTRAVIOLET RADIATION SURVIVAL

By

Matthew Berry

A THESIS

Submitted to
Michigan State University
In partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE
Genetics

2009

Abstract

ROLE OF WAAL AND UMUDC IN ER WHVIA AMYLOVORA EA1189 IN OXIDATIVE
STRESS AND ULTRAVIOLET RADIATION SURVIVAL

By
Matthew Berry

Bacteria are exposed to many stresses throughout their life cycle, including ultraviolet
radiation (UV) radiation and oxidative stress. Oxidative stress and ultraviolet radiation were
focused on specifically because Erwim'a amylovora has been observed to induce an oxidative
burst in host plants, and UV radiation stress was tested because few studies to date have
explored the role of UV sensitivity and virulence. A forward genetics approach was used to
identify E. amylovora Ea1189 gene mutations that resulted in an increased sensitivity to
hydrogen peroxide. Of the mutants identified, further study focused on one mutant with a
defective waaL gene, which is responsible for attaching O-antigen to the lipopolysaccharide
(LPS) layer. Other studies have shown that deficiencies in the LPS layer can lead to different
phenotypes including decreased virulence, decreased motility, and increased sensitivity to
antibiotics. Prior to the work discussed here, a relationship between a truncated LPS layer
and increased sensitivity to hydrogen peroxide had not been discovered. Complementation
of the waaL gene on the plasmid pMCB3 restored the mutant to near WT levels in hydrogen
peroxide sensitivity as well as the other phenotypes mentioned. A reverse genetics approach
was used to study the response of E. amylovora Ea1189 to UV radiation. When compared to
other Gram-negative bacteria, E. amylovora had a higher survival and mutability rate.
Survival was reduced in an umuDC knockout strain, whose gene product is responsible for
mutagenic DNA repair. Mutability was greatly reduced in the umuDC knockout strain, but
both phenotypes were restored when complemented with plasmids pJJK25 and pJJK27 which

carry the umuDC homolog ruIAB, and carry umuDC respectively.

To my Mom and Dad

iii

Acknowledgments

I would first like to thank Dr. George Sundin for being such a great mentor to me
while I have been here at MSU. Without his help I wouldn’t be where I am today.
Thanks to Dr. Barb Sears and Dr. Brad Day who were able to give helpfiil suggestions as
my committee members throughout my time at MSU. I would also like to thank Gayle
McGhee who, with a few words, could help me make an experiment more efficient or, in
some cases, actually work. Also, thanks to Youfu Zhao who created the transposon
library that allowed me to find the mutants I used in the majority of my work. Mike
Weigand helped with my UV experiments and Jessica Kozcan helped with the bacterial
TEM photoshoot. Of course thanks to everyone in the lab who made coming to lab fun
everyday. Lastly, thanks to my parents who put up with me talking about experiments

for the last three years and for being there for me.

iv

Table of Contents

List of Tables ........................................................................................ vi

List of Figures ....................................................................................... vii

Literature Review .................................................................................... 1
Introduction .................................................................................. 1
Defenses Used by Plants to Ward off Pathogen Invasion .............................. 2
Production of ROS and Genes Involved in ROS Resistance .......................... 5
Correlation Between Reactive Oxygen Species and Virulence Efficacy. . . . . . . . ....8
Introduction to the Lipopolysaccharide Layer .......................................... 9
Alterations to the Lipopolysaccharide Layer in Response to Stress. . . . . . . . . . . .....11
The Lipopolysaccharide Layer and its Contribution to Virulence .................. 12
The Lipopolysaccharide Layer and Mutualism ....................................... 14
Introduction to Ultraviolet Light Stress and DNA Repair ........................... 15
DNA Photolyase .......................................................................... 16
Nucleotide Excision Repair ............................................................. 17
Mutagenic DNA Repair .................................................................. 17
Conclusions ................................................................................ 19
References ................................................................................. 21

Chapter 1: Effect of a waaL mutation on lipopolysaccharide composition, oxidative

stress survival, and virulence in Erwinia amylovora .......................................... 29
Abstract ..................................................................................... 29
Introduction ................................................................................ 29
Materials and Methods ................................................................... 32
Results and Discussion ................................................................... 37
References .................................................................................. 46

Chapter 2: Effects of Ultraviolet Radiation Stress on Survival and Mutability in Erwinia

amylovora and other Gram-negative Bacteria .................................................. 51
Abstract .................................................................................... 51
Introduction ................................................................................ 51
Materials and Methods ................................................................... 53
Results ...................................................................................... 56
Discussion ................................................................................. 63
References ................................................................................. 65

Appendix ............................................................................................ 67

List of Tables

Table 2.1. Comparative survival of E. amylovora Ea1189 and the waaL mutant GSl
following exposure to polymyxin B ............................................................. 42

Table 2.2. Comparison of twitching motility in E. amylovora Ea1189, G81, and
GSl/pMCB3 ....................................................................................... 43

Table 3.1. Bacterial strains, plasmids, and oligonucleotide primers used in this study and
their relevant characteristics ...................................................................... 54

Table A.1. Result of hydrogen peroxide screen of the transposon mutant library of E.
amylovora Eal 189 ................................................................................. 69

Table A/2. Sequence results for the mutants found in the hydrogen peroxide screen of the
transposon library for E. amylovora Ea1189 ................................................... 70

Table A3. Comparative survival of different gram negative bacteria after exposure to 250
”M H202 ............................................................................................ 71

vi

List of Figures

Figure 1.1. Staining of superoxide in tobacco and pear respectively ........................ 4

Figure 1.2. Superoxide anion 02— generation bioassay in apple flowers and shoots of the
susceptible genotype MMlO6 ...................................................................... 5

Figure 1.3. Molecular formula illustrating the Haber-Weiss reaction. . . . . . . . . . . . . . . . . ........7
Figure 1.4. Model of the inner and outer membranes of E. coli K-12 ............................. 9

Figure 2.1. Sensitivity to hydrogen peroxide in Erwinia amylovora and Pseudomonas
aeruginosa strains ................................................................................. 38

Figure 2.2. Survival curve of E. amylovora Ea1189 and GSl afier exposure to increasing
concentrations of hydrogen peroxide ............................................................ 39

Figure 2.3. Polyacrylamide gel electrophoresis analysis of the lipopolysaccharide layer
in Erwinia amylovora strains ..................................................................... 40

Figure 2.4. Necrotic lesion size in immature pear following inoculation with Erwinia

amylovora strains .................................................................................. 41
Figure 3.1 Comparison of survival in different species of Gram-negative bacteria after
exposure to UV-C radiation ...................................................................... 57
Figure 3.2 Comparison of mutability in different species of Gram-negative bacteria after
exposure to UV-C radiation ...................................................................... 60
Figure 3.3 Comparison of survival in E. amylovora strains after exposure to UV-C
radiation ............................................................................................. 58
Figure 3.4 Comparison of mutability in E. amylovora strains after exposure to UV-C
radiation ............................................................................................. 62
Figure A.l. Virulence assays in immature pears and apple seedlings ...................... 67

Figure A.2. Transmission electron microscopy images of Erwim'a amylovora Ea1189, E.
amylovora GSl, E. amylovora GSl/pMCB3, Pseudomonas aeruginosa PAOl, and P.
aeruginosa PAOl waaL::ISph0A/hah .......................................................... 68

vii

Chapter 1
Literature Review
Introduction

Fire blight, a disease of the Rosaceae family including apple and pear, was first
observed in 1782 in North America (Bonn & van der Zwet, 2000). Early hypotheses on
the causal agent of fire blight included poisoning of the plant by insects (Skinner, 1829),
sap freezing, and lightning (Arthur, 1886); later observations led to the discovery of the
bacterium that causes fire blight (Arthur, 1886). This bacterium, Erwinia amylovora, is a
Gram-negative plant pathogen that initiates infections in the spring when bacteria, present
in ooze fiom overwintering cankers, are spread via rain and insects to flowers or open
wounds on the plant (Thomson, 2000). Systemic migration of bacterial cells from
infected flowers throughout the host occurs via the xylem (V armeste & Eden-Green,
2000). Symptoms of fire blight include water soaking, necrosis, and wilting of infected
tissue (Jones & Aldwinckle, 1990).

Fire blight causes economic losses every year, and, during epidemics, monetary
losses of millions of dollars can occur (V anneste, 2000; Norelli etal., 2003). Difficulty
in managing this disease contributes to the yearly losses. Use of the bactericides
streptomycin and copper represents the main control strategy utilized for flower infection,
but both treatments have limitations. Streptomycin resistance in E. amylovora was first
reported in the 1970’s and continues to become more prevalent over time (Jones &
Schnabel, 2000). Other antibiotics, such as oxytetracycline have been tested but are less
efficacious than streptomycin (McManus et al., 2002). Copper bactericides are effective

against E. amylovora, but can damage the plant, including the fruits, which reduces crop

value (McManus et al., 2002). Subsequently, studying the life cycle, various chemical
treatments, and host-pathogen interactions should yield valuable insights that could result
in novel methods of managing this disease.

Defenses Used by Plants to Ward off Pathogen Invasion

Plants use a variety of responses to ward off pathogen invasion such as basal
defenses, which include physical and chemical barriers as well as non-specific and
specific defenses. The cuticle is the first physical barrier that a plant possesses, and is
difficult to penetrate because it is composed of waxes and cutin (Baker & Martin, 1963;
Chassot et al., 2007). The stomata are another potential physical barrier to pathogenesis,
and impede pathogen invasion by closing. However, some plant pathogenic bacteria, for
example Pseudomonas syringae, bypass this barrier by secreting a chemical mimic of
jasmonic acid that causes the stomata to open (Melotto etal., 2006).

Basal plant defenses, such as modification of the cell wall, occur at the cellular
level. Alterations in cell wall composition exclude the pathogen from entry into the cell,
but this response can be suppressed by the pathogen (V orwerk et al., 2004; Yun et al.,
2006). Basal defenses are triggered by pathogen associated molecular patterns, which are
conserved features shared among microbial pathogens such as flagella and
lipopolysaccharides (Chisholm et al., 2006). For example, the survival of P. syringae pv.
tomato DC3000 was inhibited when Arabidopsis thaliana plants were pre-treated with
flagellin, but WT plants without pre-treatment were susceptible to infection (Zipfel et al.,
2004). Likewise, the lipopolysaccharide layer (LPS), the outermost layer of the Gram-

negative bacterial membrane to be detailed later, triggered the production of reactive

oxygen species (ROS) and induced the production of defense related genes in rice
(Desaki et al., 2006).

Plant defenses are classified into non-specific microbe recognition and those that
recognize specific elicitors released by the pathogen during infection (Jones & Dangl,
2006). Pathogen associated molecular patterns elicit a non-specific response from the
host. In contrast, the recognition of a specific pathogen effector (virulence and
pathogenesis determinants that facilitate infection in the host) by a resistance protein
triggers the hypersensitive response (HR), which results in the release of phytoalexins,
production of ROS, host cell death, and the activation of other defense responses
(Niimberger & Brunner, 2002; Chisholm et al., 2006; Jones & Dangl, 2006; Shetty et al.,
2008). One of the best known examples of a resistance protein-effector interaction is
AvrPto-Pto. AvrPto acts to suppress the innate immunity response in the host if the host
lacks Pto (Xiang et al., 2008). However, if the host plant encodes pto, then the Pto
protein will directly interact with AvrPto inducing the expression of defense genes and
the HR (Nomura etal., 2005; Xiang et al., 2008). The previous two relationships
represent compatible and incompatible interactions, respectively. For an incompatible
interaction to occur, the host plant must recognize an effector secreted by the pathogen,
which triggers the HR resulting in cell death (Giirlebeck et al., 2006; Zhao et al., 2006).
If the pathogen lacks the recognized effector or the host lacks the resistance protein that
recognizes the effector, a compatible interaction results, in which pathogenesis occurs
and the HR is suppressed (Giirlebeck et al., 2006; Zhao etal., 2006).

A compatible interaction does not appear to occur between E. amylovora and the

host because E. amylovora induces the host to produce the HR, which is similar to an

incompatible interaction (Venisse et al., 2001; Venisse et al., 2002). As examples, E.
amylovora elicits an incompatible interaction in Tobacco (not a host of Erwinia), and in

pear (a host of Erwinz'a), evidenced by the production of superoxide (V enisse et al., 2001)

(Figure 1.1).

 

Ea 1430 Ea 6089 Ba 6023 Pst 2106

 

Tobacco

 

Pear

 

 

 

 

 

 

 

 

Figure 1.1. Staining of superoxide in tobacco and pear respectively. Nitroblue
tetrazolium staining in tobacco and pear leaves 12 and 8 h, respectively, after infiltration
of E. amylovora 1430 (WT), E. amylovora 6089 (am), E. amylovora 6023 (hp), and
Pseudomonas syringae pv. tabaci 2106 (WT). The black staining indicates the presence
of 02- (Figure taken from Venisse et al., 2001).

Other work by Venisse et a1. (2001; 2002) showed that the production of

superoxide and suppression of plant antioxidants preceded invasion by E. amylovora

(Figure 1.2).

Flowers Shoots

Ea hrp Ea wt Ea wt Ea hrp
N

88 l
38

Figure 1.2. Superoxide anion 02— generation bioassay in apple flowers and shoots of the
susceptible genotype MM106. Flowers were sampled 4 days after deposit of a drop of
bacterial suspensions (107 CFU/ml) into the hypanthium. Shoots were sampled 10 days
after deposit of a drop of bacterial suspensions (107 CFU/ml) onto a fresh cut made on
young developed leaves. Samples were vacuum infiltrated with a 0.5% solution of
nitroblue tetrazolium and photographed 30 min later. Spreading of blue staining (BS),
which indicates qualitatively the presence of 02', and of necrosis (N) are indicated by
triangles. Ea wt = wild-type strain of E. amylovora CFBP1430; Ea hrp = E. amylovora
hrp secretion mutant PMV6023 derived from CFBP1430 (Figure taken from Venisse et
al., 2002).

 

Production of Reactive Oxygen Species and Genes Involved in ROS Resistance

The production of ROS, a pivotal component of plant defense systems, is
triggered during the HR, considered one of the first lines of defense of the host (Lamb &
Dixon, 1997; Venisse et al., 2001; Inzé & Montagu, 2002; Venisse et al., 2002). In
plants, microbes can elicit either a compatible or incompatible reaction from the host. An
incompatible reaction involves a biphasic accumulation of ROS (the oxidative burst)

where the first phase is a small transient increase of ROS followed by a second phase

consisting of a more intense continuous production of ROS (Torres et al., 2006). The
second phase of the oxidative burst is responsible for killing the invading pathogen. In
contrast, if a compatible interaction occurs, only the first transient burst of ROS is
produced allowing the pathogen to avoid the lethal second phase of ROS (Torres et al.,
2006). Plant pathogenic bacteria attempt to evade host defenses, detoxify compounds
produced by the host, or, like E. amylovora, endure the defenses produced by the host
plant (V enisse et al., 2002). Furthermore, E. amylovora induces the host to produce
ROS, while simultaneously inhibiting antioxidant enzymes that could protect the plant
from damage created as a result of generating ROS (V enisse et al., 2002).

Most bacteria encode a suite of genes that are related to oxidative stress
susceptibility. The two largest sets of genes involved in oxidative stress survival are
regulated by OxyR and SoxRS. The OxyR regulon includes the catalase-peroxidase
genes, ahpC, and peroxiredoxin (Charoenlap et al., 2005; Mongkolsuk & Dubbs, 2005;
Hishinuma et al., 2006). Catalase and peroxidase both inactivate hydrogen peroxide
(Charoenlap et al., 2005; Mongkolsuk & Dubbs, 2005; Hishinuma et al., 2006) producing
water and oxygen as end products (Inzé & Montagu, 2002). AhpC and peroxiredoxin
work together to detoxify ROS with AhpC becoming oxidized as it detoxifies and
peroxiredoxin reducing AhpC so it regains function (Charoenlap et al., 2005;
Mongkolsuk & Dubbs, 2005; Hishinuma et al., 2006). Another gene regulated by OxyR
is dps (DNA binding protein'in stationary phase). The Dps protein does not directly
inactivate ROS, but instead protects the bacterium from DNA damage by binding to
chromatin, and also serves a preventative role by binding iron, which can be used to

generate ROS (Halsey et al., 2004). Sequestering iron from the host is an important

preventative fimction because iron, in the presence of hydrogen peroxide and superoxide,
can yield hydroxyl radicals, the most damaging of the ROS (Inzé & Montagu, 2002).
This reaction recycles iron so that it can be used repeatedly to generate more hydroxyl
radicals in a process known as the Haber-Weiss reaction (Inzé & Montagu, 2002) (Figure

1.3).

 

(1) the Fenton reaction, resulting in the production of OH' from H202:
H202 + F 6+2 —' OH. + OH- + Fe+3

(2) recycling of ferrous ion by superoxide, which acts as a reductant, allowing
reaction (1) to continue:

05' + Fe+3 —> + 02 + Fe“2

(3) the net sum of reactions (1) and (2) is the so-called Haber-Weiss reaction:

H202 + 0'; —> 02 + OH' + OH-

 

 

 

Figure l.3. Molecular formula illustrating the Haber-Weiss reaction. Iron atoms are not
consumed in this reaction but recycled as hydroxyl radicals are formed. (Figure taken
from Inzé & Montagu, 2002).

Whereas OxyR is involved in hydrogen peroxide stress, SoxRS regulates genes
involved with superoxide stress survival (Wu & Weiss, 1992; Inzé & Montagu, 2002).
SoxRS regulates the transcription of many genes including sodA, fir, and nfo
(Pomposiello & Demple, 2001). Superoxide dismutase (sodA), one of the most studied of
the genes regulated by SoxRS, when expressed, detoxifies superoxide by converting two
superoxide molecules into hydrogen peroxide and oxygen (Inzé & Montagu, 2002).
SoxR, once activated, initiates the transcription of soxS, which then regulates the other
genes in the regulon (Wu & Weiss, 1992). Genes regulated by SoxS are not transcribed

as frequently when soxR is knocked out (Wu & Weiss, 1992).

DNA damage is the most destructive result of exposure to ROS. One example of
this is shown by Greenberg & Demple (1988), where Eschericia coli lacking a functional
oxyR gene resulted in a phenotype of increased spontaneous mutations by 80-fold. When
exogenous catalase or alkyl hydroperoxide reductase was added, the rate of spontaneous
mutations decreased by 10 to 20-fold compared to the mutant (Greenberg & Demple,
1988). This result would suggest that a bacterium unable to mount defenses to hydrogen
peroxide stress is damaged to an extent where repair was necessary to survive, which
could explain the evolutionary retention of oxidative stress related genes.

Correlation Between Reactive Oxygen Species and Virulence Efficacy

One factor that affects the virulence of a plant pathogen is the concentration of
ROS produced by the plant (Wu et al., 1995; Hu et al., 2003). If ROS cannot be
detoxified, avoided, or prevented from being formed, then the bacterium can be killed.
This is well represented in work by Wu et al. (1995), in which transgenic potato plants
that produced higher concentrations of hydrogen peroxide than WT inhibited growth and
virulence of the potato pathogens, Erwim'a carotovora subsp. carotovora (now called
Pectobacterium carotovorum subsp. carotovorum) and Aspergillus niger. Another
finding of note is that the increased production of hydrogen peroxide did not result in
spontaneous lesions in the transgenic potato when compared to the wild type plant (Wu et
al., 1995). Generating transgenic plants that produce a higher concentration of hydrogen
peroxide has been attempted in other plant systems such as sunflowers with similar
results (Hu et al., 2003).

E. amylovora, like some pathogens, forms a biofilm, an extracellular matrix that a

group of cells form in culture and in planta (Koczan et al., 2008). Work by Elkins et al.

(1999) provides an example of how the impact of ROS is altered by the presence of a
biofilm. Susceptibility to hydrogen peroxide was increased by 100 fold in individual
cells compared to cells in a biofilm (Elkins et a1. 1999). In addition, E. amylovora
lacking the ams operon, necessary for formation of a biofilm, is incapable of establishing
infection in the host (Koczan et al., 2008). Formation of a biofilm could be a component
a pathogen uses to survive oxidative stress in the host.
Introduction to the Lipopolysaccharide Layer

The lipopolysaccharide layer (LPS) comprises the outer layer of the outer
membrane and can represent up to 90% of the outer layer in Gram-negative bacteria
(Rosenfeld & Shay, 2006). This layer can be separated into three components (Hitchcock

etal., 1986) (Figure 1.4).

O-antigen repeat

‘—

   
  

n
‘_ Heptose 1
,__ Glucose

LPS .— Galactose I Outer Core
'— Heptose
PPEtn Inner Core
“‘- Kdo
Outer Membrane { UH ii U Lipid A
Lipoproteins ' .
_ {— Peptrdoglycan

Periplasm J m— -
Undecaprenyl —L pwr“

V MDO
.h.,....-...... lg n iii. ufittilo- W...
Inner Membrane HUD "' I M“) U I“):

‘— Protein
Cytoplasm

Figure 1.4. Model of the inner and outer membranes of E. coli K-12. (Figure taken from
Raetz & Whitfield, 2002).

The first component (lipid A) is attached to the phospholipid layer of the outer
membrane, is well conserved, and is a requirement for survival by most bacteria (Fraser
et al., 1998; Raetz & Whitfield, 2002) (Figure 1.4). Conservation of the lipid A portion
can be seen in different species of bacteria including E. amylovora (Hitchcock et al.,
1986; Ray et al., 1986).

The second component, which is attached to the lipid A, is the core
oligosaccharide, which is further divided into two subsections, the inner and outer core
(Newman et al., 2007) (Figure 1.4). The inner core is mainly composed of KDO (keto-3—
deoxyoctanate), is well conserved in bacteria, and is required for survival similar to lipid
A (Hitchcock et al., 1986; Raetz & Whitfield, 2002; Newman et al., 2007) (Figure 1.4).
The outer core can be composed of multiple sugars, including heptose, galactose,
glucose, and fucose among others. Unlike the inner core, the outer core is more variable
among bacteria, and not necessary for survival, although absence of an outer core results
in decreased fitness of the cell (Ray et al., 1986; Ray et al., 1987; Raetz & Whitfield,
2002; Newman et al., 2007) (Figure 1.4).

The last component of the LPS layer is the O-antigen, which is the most variable
of the three components, and is not necessary for survival of the bacterium (Hitchcock,
1986). Typically the O-antigen is composed of repeats of a monosaccharide, which can
be rhamnose, xylose, fucose, or others (Newman et al., 2007). To highlight the
variability of the O-antigen, when LPS from E. coli and Salmonella were compared, only
three O-antigen types were shared by both species after comparing 173 and 50 O-antigen
types, respectively (Reeves et al., 1996). Strains can also be serotyped by the type of 0-

antigen produced, and, in some cases, the O-antigen can be used as a vaccine (Goldberg

10

& Pier, 1996). This portion of the LPS layer is not as prevalent in bacteria outside of the
enteric family (Hitchcock et al., 1986), but serves as a virulence factor when the 0-
antigen is present (Bengoechea et al., 2004; Lapa®e et al., 2005; Plainvert et al., 2007).
O-anti gen acts as a virulence factor through masking the more conserved inner portions
of the LPS layer, and can also conceal receptors used by bacteriophage to initiate
infection (Whitfield et al., 1997).

The LPS layer has other properties that have not been extensively researched but
should be noted. Up to 90% of the outer leaflet of the outer membrane is composed of
LPS (Rosenfeld & Shay, 2006), and of that, up to 50% of the LPS molecules in the cell
can exhibit a rough (classified as an LPS layer lacking O-antigen or the terminal portion
of the core oligosaccharide) or semirough (an LPS layer with no more than one O-antigen
molecule attached) phenotype (Hitchcock et al., 1986, Raetz & Whitfield, 2002). In other
words, in any given wild type cell, the LPS layer can be composed of molecules with
variable lengths of O-antigen repeats or no O-antigen. This variability of the O-antigen
could explain its role as a virulence factor. Another notable property of the LPS layer is
that when any of the genes responsible for assembling the core are disrupted, subsequent
steps of LPS biosynthesis do not occur indicating that each sugar needs the previous one
to attach to the molecule, and that there is no compensatory mechanism that takes the
place of the disrupted gene so that biosynthesis can continue.

Alterations to the Lipopolysaccharide Layer in Response to Stress

The LPS layer is modified in response to stress in some bacteria In

Pseudomonas aeruginosa, an opportunistic pathogen that typically infects the lungs of

Cystic Fibrosis patients, two types of LPS known as the A-band and B-band exist

11

(Goldberg & Pier, 1996; Sabra et al., 2003). While the A-band is constitutively
expressed during all stages of infection, B-band LPS is present at its highest
concentration upon initial infection and decreases once the infection becomes chronic
(Goldberg & Pier, 1996; Sabra et al., 2003). In addition, B-band LPS is expressed at
higher oxygen concentrations, but not below 3% (microaerophilic) conditions (Sabra et
al., 2003). Although not directly related to oxidative stress, this work indicates that the
LPS layer can change in response to stress.

Klebsiella pneumoniae is another bacterium where different forms of LPS exist.
There have been at least two core types found in K. pneumoniae, type I and type H
(Regué et al., 2005). The difference in the two cores is explained by type I cores
encoding different genes (wabl and wabJ) than type 11 cores (wabK and wabM), but in
both cores, the two genes are found flanking waaL (Regué et al., 2005). Although a
strain of K. pneumoniae with both core types has not yet been discovered, it has been
demonstrated that different core types display different levels of virulence in mouse
models (Regué et al., 2005). It has yet to be explored why the more virulent type 11 core
is not more prevalent in populations of K. pneumoniae, where it composes only 19% of
the collection of 100 isolates obtained by the Regué lab. A recent study by Patil et a1.
(2007) highlights the variability of the LPS layer between different bacterial species.
Amongst the genes explored in this work, only two genes were conserved across all eight
of the Xanthomonads studied.
The Lipopolysaccharide Layer and its Contribution to Virulence

Many studies over the last few decades demonstrate the relationship between

bacterial virulence and the presence of the LPS layer (Newman et al., 2001; Erbs &

12

Newman, 2003; Bengoechea et al., 2004; Lapaque etal., 2005; Plainvert etal., 2007).
These studies have covered animals, plants, and humans, typically showing a correlation
between truncation of the LPS layer and a decrease in virulence. Mutations that cause
truncations in the LPS layer result in a number of phenotypes including sensitivity to
antibiotics and reduced motility. In Erwinia carotovora subsp. atroseptica, for example,
loss of O-antigen resulted in a deficiency in motility, decrease in virulence, and reduced
production of exoenzymes used by E. carotovora for virulence (Toth et al., 1999). In E.
coli and Salmonella strains, truncated cores resulted in an increased sensitivity to
hydrophobic antimicrobials and leakage of periplasmic enzymes into the extracellular
space (Heinrichs et al., 1998). Another study in Salmonella showed that a strain with a
mutation in waaP, a gene responsible for adding phosphate to the first heptose residue of
the inner core, was more sensitive to the antibiotics novobiocin, polymyxin, and SDS,
and was also unable to infect mouse models (Y ethon et al., 2000). In contrast, all of the
mice infected with WT Salmonella died (Y ethon et al., 2000). Further studies with K.
pneumoniae detailed effects of mutations in the outer core of the LPS layer on virulence
in mice (Izquierdo et al., 2003). Four mutants were explored with mutations in waaC,
waaF, wabG, and waaL (Izquierdo et al., 2003). With the exception of waaL, which
attaches the O-anti gen to the lipid A core, these genes are responsible for attaching
different sugars onto the Lipid A core Multiple organs were tested in mouse models to
observe bacterial colonization. While waaL was the only one of the four mutants that
could survive as well as WT in one of the organs tested (the lung), all of the mutants
tested could not survive in the other organs tested (Izquierdo et al., 2003). Also, the

mutant strains were more susceptible than WT to different antibiotics including SDS and

13

polymyxin B (Izquierdo et al., 2003). This correlation between core truncation and
sensitivity to antibiotics is also observed in Burkholderia cenocepacia, in which a mutant
that produced a truncated core lost the ability to infect the lung of rat models (Loutet et
al., 2006). As previously mentioned, purified LPS can be used as a vaccine in animal
models, but this effect is seen in plants as well. In pepper, localized resistance can last up
to 30 hours post LPS inoculation, but in tobacco, systemic resistance has been
demonstrated (Newman et al., 2001). This resistance involves processes such as the
oxidative burst, cross-linking of cell walls, and increased transcription of defense genes.
As shown by an Arabidopsis microarray, treatment with LPS caused the induction and
repression of many genes, specifically stress and defense genes at the site of inoculation
(Zeidler, 2004). This effect was also seen systemically although expression diminished
over distance (Zeidler, 2004).
The Lipopolysaccharide Layer and Mutualism

Although most of the work that has focused on the LPS layer examines the
correlation between deficiencies in the LPS layer and virulence, some work has also
focused on how mutualistic relationships are affected by LPS deficiencies. Numerous
species of Rhizobium and Bradyrhizobium are incapable of establishing a population in
host plants when genes responsible for LPS biosynthesis are knocked out. Eight LPS
mutants were investigated by Cava et al. (1989), all of which were lacking all or most of
the O-anti gen component of the LPS layer. These mutants were not able to survive in the
bean plant and could only produce what is called an abortive infection thread (Cava et al.,
1989). In Rhizobium tropici CIAT899, three mutants were explored that were missing 0-

antigen with one of the three also truncated in the outer core of LPS (Ormeflo-Orrillo et

14

al., 2008). The truncated core mutant CIAT899-E3 could not produce nodules in the
host, and the two O-anti gen mutants produced nodules but could not sustain populations
in the host (Ormefio-Orrillo et al., 2008). Other studies with Rhizobium have produced
contradictory results however. Work by D’Antuono et a1. (2005) demonstrated that the
bacterium Mesorhizobium loti sustained normal infection in the host with a truncated or
non-existent O-antigen, but the mutants were less fit than WT in a competition assay
(D’Antuono et al., 2005). Similarly, competition experiments performed by Ormefio-
Orrillo et al. (2008) showed that LPS mutants were less fit than the WT strain. Whether
this new finding has to do with the specific strain or host plant involved, or if this finding
will be observed by other researchers in the field, has yet to be determined.
Conclusions

The LPS layer serves many important roles during the bacterial life cycle.
Because the LPS layer is important for Gram-negative bacterial survival, it is recognized
as a pathogen associated molecular pattern and triggers basal immune responses. This
importance is also observed when the LPS layer is truncated due to disruption of LPS
biosynthesis genes, which increases a cell’s susceptibility to antibiotics and decreases
motility and virulence. As the next chapter will demonstrate, a defective LPS layer also

exhibits a phenotype of sensitivity to ROS.

Introduction to Ultraviolet Light Stress and DNA Repair
Almost every known organism is exposed to ultraviolet radiation (UV) at some
point in its life cycle. UV light causes direct and indirect damage to cells (J oux et al.,

1999; Kim & Sundin, 2001; Qiu et al., 2004; Zenoff et al., 2006). UV-B (280-315 nm) is

15

a higher energy radiation than UV-A (315-400 nm) and damages DNA which is lethal if
not repaired (Sinha & Hader, 2002). UV-A can indirectly damage the cell by generating
ROS, which can then damage cells in ways previously mentioned in this review (Sinha &
Hader, 2002). There is also a third type of UV light, UV-C (<280 nm), but it is absorbed
by the atmosphere before reaching the Earth’s surface (Sinha & Hader, 2002). Because
UV light is a ubiquitous part of most environments and damages cells, ahnost every
organism, from bacteria to humans, has evolved mechanisms to combat UV-induced
damage. Coping with UV damage can involve avoidance using negative phototaxis, or
absorption of light by compounds like flavenoids in plants, melanin in humans, or other
compounds (Sinha & Hader, 2002). If UV induced damage does occur, the cell employs
a suite of enzymatic systems that can repair damaged DNA resulting from UV-light
absorption by the cell.

Genes involved in UV tolerance are found in most organisms including those that
are not typically exposed to UV light. Isolates identified by Arrage et a1. (1993) that
were shielded from UV light for millions of years were resistant to UV light similarly to
isolates from the soil surface. Of the 70 isolates discovered, 31% of the isolates in the
soil were resistant to UV light whereas 26% on the soil surface were resistant (Arrage et
al., 1993). From this same work, two trends were identified: pigmented cells and Gram-
positive cells were more resistant to UV light than non-pigmented cells and Gram-
negative cells (Arrage et al., 1993).

DNA Photolyase and Photoreactivation
There are many gene products responsible for resistance to UV light in bacteria

(Sinha & Hader, 2002). One of the best characterized is DNA photolyase, encoded by

16

the phrl gene (Y asui & Chevallier, 1983; Kim & Sundin 2001). The Phr protein repairs
UV damage in a light dependent reaction, compared to other repair mechanisms that can
firnction in the dark (Kim & Sundin 2001; Sinha & Hader, 2002). DNA photolyase
repairs cyclobutane-pyrimidine dimers such as thymine-thymine (T-T) or thymine-
cytosine (T-C), which are commonly formed after exposure to UV light (Brash et al.,
1985; Kim & Sundin, 2001).
Nucleotide Excision Repair

In addition to DNA photolyase, nucleotide excision repair (NER) and base
excision repair (BER) are important in repairing DNA damage. Whereas base excision
repair specifically removes individual damaged bases, NER is responsible for removing a
larger section of DNA that disrupts the overall structure of the double helix. NER is
more complex than photoreactivation requiring around 30 genes to function (Sinha &
Hader, 2002). In Shewanella onez'densis, NER is not efficiently expressed, and this
difference makes S. oneidensis sensitive to UV light (Qiu et al., 2004). After exposure to
15 J m'z, cell survival was less than 0.1% (Qiu et al., 2004). In comparison, the survival
of E. amylovora Ea1189 does not drop to 0.1% until cells are exposed to nearly 150 J m'2
UV-C light. (Berry, unpublished). Because NER is coordinated by more than one gene,
different phenotypes can be exhibited depending on the gene that is defective. At least
three different diseases in humans are linked to defective components of NER. Each of
these diseases has a phenotype of sunlight sensitivity (de Boer & Hoeijmakers, 2000).
Mutagenic DNA Repair

umuDC and its homologs belong to the mutagenic DNA repair family of genes

and are part of the SOS system of repair, which means that these genes are regulated by

17

RecA and LexA (W itkin, 1976). LexA represses SOS response genes from being
transcribed until RecA cleaves LexA releasing it fiom the DNA and allowing
transcription to occur (Bagg et al., 1981). RecA is activated by the presence of single
stranded DNA, which is present when a DNA mutation occurs that stalls the replication
machinery (Lee et al., 1996). Mutagenic repair is a last resort of the cell to stay alive
after other repair mechanisms fail to correct DNA damage (Sinha & Hader, 2002).
Mutagenic repair is error prone, occasionally causing a mutation at the site of damage,
but allowing replication to continue ensuring cell survival.

umuDC is present throughout the enterobacteriaciae, but varies in its efficiency
(Sedgwick et al., 1991). Differences in mutability between strains‘have been observed to
be ZOO-fold even in strains with the same gene pair (Sedgwick et al., 1991). umuDC and
its homologs such as rulAB, rumAB, samAB, impCAB, and mucAB fimction in mutagenic
repair. Differences in efficiency and mutations caused by UmuDC and its homologs vary
(Szekeres Jr. et al., 1996). For example, umuDC is the most inefficient at DNA repair
compared to other UV repair homologs (Woodgate & Sedgwick, 1992; Kim & Sundin,
2000). This is because UmuD is cleaved in a RecA-mediated reaction generating
UmuD’, which forms a homodimer that complexes with UmuC (W oodgate & Sedgwick,
1992; Kim & Sundin, 2000). umuDC produces transversions, specifically T to A, five
times more often than T to C transitions (Szekeres Jr. et al., 1996). In rumAB and
mucAB, the opposite is true with the same transversion occurring five times less
fiequently than the same transition seen in umuDC strains (Szekeres Jr. et al., 1996).
Differences in mutability are variable depending on the cell in which the gene pair is

expressed. For example, when mucAB was inserted into a E. coli umuDC- cell,

18

mutability was increased. Similarly, the same experiment with rulAB resulted in
increased mutability compared to umuDC (Kim & Sundin, 2000). When the three gene
pairs were placed in P. aeruginosa, the mutabilities of the three strains were different
than when in E. coli (Kim & Sundin, 2000). For this reason it is hard to assign an order
of which gene pair makes the cell more mutable because efficiency, in part, is also
dictated by the environment (the cell) where the gene pair exists (Kim & Sundin, 2000).
However, when studies in culture are compared to in planta studies the amount of viable
cells found after UV light exposure are similar. RulAB functioned similarly in the cell
whether it was grown in LB or in a plant host (Kim & Sundin, 2000). One similarity that
the different gene homologs have in common is genomic location in the cell. umuDC
specifically is usually found on conjugative plasmids making horizontal transfer likely
and the observation of its presence in many bacterial species better understood, however,
the gene pair can also be found on chromosomal DNA (Woodgate & Sedgwick, 1992).
Conclusions

DNA repair is important to a bacterial cell because it allows replication to
continue. Without DNA repair, cells would amass mutations detrimental to survival
causing the cell to die. In some instances, the commonly used mechanisms of repair are
not sufficient to correct damage caused by UV radiation. Without mutagenic repair, the
cell would likely die in this instance, but mutagenic repair corrects damage that otherwise
could not be fixed allowing replication to continue although the cost is an increased
mutation rate.

The LPS layer and DNA repair represent ways that bacteria cope with stress. It

could be argued that bacteria are especially adapted to resisting stress because they have

19

had much more time to deal with a stress than another organism that has not been around
as long, evolutionarily speaking. For this reason, bacteria successfully inhabit ahnost

every environment on Earth.

20

References

Abeyratlme PD, Daniels C, Poon KKH, Matewish MJ & Lam, J S (2005) Functional
characterization of WaaL, a ligase associated with linking O-antigen polysaccharide to
the core of Pseudomonas aeruginasa lipopolysaccharide. J Bacterial 187: 3002-3012.

Arrage AA, Phelps TJ, Benoit RE & White DC (1993) Survival of subsurface
microorganisms exposed to UV radiation and hydrogen peroxide. Appl Environ
Microbiol 59: 3545-3550.

Arthur J C (1886) History and biology of pear blight. Proc Natl Acad Sci U S A 38: 322-
341.

Bagg A, Kenyon CJ & Walker GC (1981) Inducibility of a gene product required for UV
and chemical mutagenesis in Escherichia coli. Proc Natl Acad Sci U S A 78: 5749-5753.

Baker EA & Martin JT (1963) Cutin of plant cuticles. Nature 199: 1268-1270.

Bengoechea J A, Najdenski H & Skurnik M (2004) Lipopolysaccharide 0 antigen status
of Yersinia enterocolitica 0:8 is essential for virulence and absence of 0 antigen affects
the expression of other Yersinia virulence factors. Mal Microbial 52: 451-469.

Bonn WG & van der Zwet T Distribution and economic importance of fire blight.
Vanneste J L, ed. (2000) Fire blight the disease and its causative agent Erwinia
amylovora. New York NY: CABI Publishing. 37-54.

Brash DE, Franklin WA, Sancar GB, Sancar A & Haseltine WA (1985) Escherichia cali
DNA photolyase reverses cyclobutane pyrimidine dimers but not pyrimidine-pyrimidone
(6-4) photoproducts. J Biol Chem 260: 11438-11441.

Cava JR, Elias PM, Turowski DA & Noel KD (1989) Rhizabium leguminosarum CFN42
genetic regions encoding lipopolysaccharide structures essential for complete nodule
development on bean plants. J Bacterial 171: 8-15.

Charoenlap N, Eiarnphungpom W, Chauvatcharin N, Utarnapongchai S, Vattanaviboon P
& Mongkolsuk S (2005) OxyR mediated compensatory expression between ahpC and
katA and the significance of ahpC in protection from hydrogen peroxide in Xanthamanas
campestris. FEMS Microbiol Lett 249: 73-78.

Chassot C, Nawrath C & Métraux J-P (2007) Cuticular defects lead to full immunity to a
major plant pathogen. Plant J 49: 972-980

21

Chisholm S, Coaker G, Day B & Staskawicz B (2006) Host-microbe interactions:
shaping the evolution of the plant immune response. Cell 124: 803-814.

D’Antuono AL, Casabuono A, Couto A, Ugalde RA & Lepek VC (2005) Nodule
development induced by Mesarhizabium loti mutant strains affected in polysaccharide
synthesis. Mol Plant Microbe Interact 18: 446-457

de Boer J & Hoeijmakers JHJ (2000) Nucleotide excision repair and human syndromes.
Carcinogenesis 21: 453-460.

Desaki Y, Miya A, Venkatesh B, Tsuyumu S, Yamane H, Kaku H, Minarni E & Shibuya
N (2006) Bacterial lipopolysaccharides induce defense responses associated with
programmed cell death in rice cells. Plant cell physio! 47: 1530-1540.

Elkins, JG, Hassett, DJ, Stewart, PS, Schweizer, HP & McDermott, TR (1999) Protective
role of catalase in Pseudomanas aeruginasa biofilm resistance to hydrogen peroxide.
Appl Environ Microbial 65: 4594-4600.

Erbs G & Newman M-A (2003) The role of lipopolysaccharides in induction of plant
defence responses. Mol Plant Pathol 4: 421-425.

Fraser CM, Norris SJ, Weinstock GM, White 0, Sutton GG, Dodson R, Gwinn M,
Hickey EK, Clayton R, Ketchum KA, Sodergren E, Hardham JM, McLeod MP, Salzberg
S, Peterson J, Khalak H, Richardson D, Howell JK, Chidambararn M, Utterback T,
McDonald L, Artiach P, Bowman C, Cotton MD, Fujii C, Garland S, Hatch B, Horst K,
Roberts K, Sandusky M, Weidman J, Smith HO & Venter J C (1998) Complete Genome
Sequence of T repanema pallidum the Syphilis spirochete. Science 281: 375-388.

Goldberg JB & Pier GB (1996) Pseudomanas aeruginasa lipopolysaccharides and
pathogenesis. Trends Microbial 4: 490-494.

Greenberg J T & Demple B (1988) Overproduction of peroxide-scavenging enzymes in
Escherichia cali suppresses spontaneous mutagenesis and sensitivity to redox-cycling
agents in axyR- mutants. EMBO J 7: 2611-2617.

Giirlebeck D, Thieme F & Bonas U (2006) Type III effector proteins from the plant
pathogen Xanthamanas and their role in the interaction with the host plant. J Plant
Physiol 163: 233-255.

Halsey TA, Vazquez-Torre A, Gravdahl DJ, Fang F C & Libby SJ (2004) The ferritin-like
Dps protein is required for Salmonella enterica serovar typhimurium oxidative stress
resistance and virulence. Infect Immun 72: 1155-1158.

Heinrichs DE, Yethon JA & Whitfield C (1998) Molecular basis for structural diversity

in the core regions of the lipopolysaccharides of Escherichia cali and Salmonella
enterica. Mol Microbiol 30: 221-232.

22

Hishinuma S, Yuki M, F uirnura M & Fukumori F (2006) OxyR regulated the expression
of two major catalases, KatA and KatB, along with peroxiredoxin, AhpC in
Pseudomonas putida. Environ Microbial 8: 2115-2124.

Hitchcock PJ, Leive L, Makeléi PH, Rietschel ET, Strittrnatter W, Morrison DC (1986)
Lipopolysaccharide nomenclature-past, present, and future. J Bacteriol 166: 699-7 05.

Hu X, Bidney DL, Yalpani N, Duvick JP, Crasta O, Folkerts O & Lu G (2003)
Overexpression of a gene encoding hydrogen peroxide-generating oxalate oxidase evokes
defense responses in sunflower. Plant Physiol 133: 170-181.

Inzé D, Van Montagu M (2002) Oxidative Stress in Plants. Boca Raton, FL: CRC Press.
1-32.

Izquierdo L, Coderch N, Piqué, N, Bedini E, Corsaro M M, Merino S, Fresno S, Tomas J
M & Regué, M (2003) The Klebsiella pneumoniae wabG gene: Role in biosynthesis of
the core lipopolysaccharide and virulence. J Bacterial 185: 7213-7221.

Jones AL & Aldwinckle HS (1990) Compendium of Apple and Pear Diseases. St. Paul,
MN: APS Press. 61-63

Jones AL & Schnabel EL The development of streptomycin-resistant strains of Erwinia

amylovora. Vanneste J L, ed. (2000) Fire blight the disease and its causative agent
Erwinia amylovora. New York NY: CABI Publishing. 235-252.

Jones JDG & Dangl J L (2006) The plant immune system. Nature 444: 323-329.

J oux F, Jeffrey WH, Lebaron P & Mitchell DL (1999) Marine bacterial isolates display
diverse responses to UV-B radiation. Appl Environ Microbiol 65: 3820-3827.

Kim JJ & Sundin GW (2000) Regulation of the rulAB mutagenic DNA repair operon of
Pseudomonas syringae by UV-B (290 to 320 nanometers) radiation and analysis of
rulAB-mediated mutability in vitro and in planta. J Bacteriol 182: 6137-6144.

Kim J] & Sundin GW (2001) Construction and analysis of photolyase mutants of
Pseudomonas aeruginasa and Pseudomonas syringae: contribution of photoreactivation,
nucleotide excision repair, and mutagenic DNA repair to cell survival and mutability
following exposure to UV-B radiation. Environ Microbial 67: 1405-1411.

Koczan J, McGrath M, Zhao Y & Sundin GW (2008) Biofilm formation in Erwinia
amylovora: implications in pathogenicity. Acta Horticulturae. 793: 67-72.

Lamb C & Dixon RA (1997) The oxidative burst in plant disease resistance. Annu Rev
Plant Physiol Plant Mol Biol 48: 251-275.

23

Lapaque N, Moriyon I, Moreno E & Gorvel J -P (2005) Brucella lipopolysaccharide acts
as a virulence factor. Curr Opin Microbiol 8: 60-66.

Lee MH, Guzzo A & Walker GC (1996) Inhibition of RecA-mediated cleavage in
covalent dimers of UmuD. J Bacterial 178: 7304-7307.

Loutet SA Flannagan RS, Kooi C, Sokol PA & Valvano MA (2006) A complete
lipopolysaccharide inner core oligosaccharide is required for resistance of Burkhalderia

cenacepacia to antimicrobial peptides and bacterial survival in vivo. J Bacteriol 188:
2073-2080.

Martin JT (1964) Role of cuticle in the defense against plant disease. Annu Rev
Phytapathol 2: 8 l-100

McManus PS, Stockwell VO, Sundin GW & Jones AL (2002) Antibiotic use in plant
agriculture. Annu Rev Phytapathol 40: 443-465.

Melotto M, Underwood W, Koczan J, Nomura K & He SY (2006) Plant stomata frmction
in innate immunity against bacterial invasion. Cell 126: 969-980.

Mongkolsuk S & Dubbs J M (2005) Chemical modulation of physiological adaptation
and cross-protective responses against oxidative stress in soil bacterium and
phytopathogen Xanthamanas. J Ind Microbial Biotechnol 32: 687-690

Newman M-A Dow JM & Daniels MJ (2001) Bacterial lipopolysaccharides and plant-
pathogen interactions. Eur J Plant Pathol 1 07: 95-102.

Newman M-A Dow JM, Molinaro A & Parrilli M (2007) Priming induction and
modulation of plant defence responses by bacterial lipopolysaccharides. J Endataxin Res
13: 69-84.

Nomura K, Melotto M & He S-Y (2005) Suppression of host defense in compatible
plant-Pseudomonas syringae interactions. Curr Opin Plant Biol 8: 361-368.

Norelli JL, Holleran HT, Johnson WC, Robinson TL & Aldwinckle HS (2003)
Resistance of Geneva and other apple rootstocks to Erwinia amylovora. Plant Dis 87:
26-32.

Niimberger T & Brunner F (2002) Innate immunity in plants and animals: emerging
parallels between the recognition general elicitors and pathogen-associated molecular
patterns. Curr Opin Plant Biol 5: 318-324.

Ormefio-Orrillo E, Rosenblueth M, Luyten E, Vanderleyden J & Martinez-Romero E

(2008) Mutations in lipopolysaccharide biosynthetic genes impair maize rhizosphere and
root colonization of Rhizobium tropici CIAT899. Environ Microbiol 10: 1271-1284.

24

Patil PB, Bogdanove AJ & Sonti RV (2007) The role of horizontal transfer in the
evolution of a highly variable lipopolysaccharide biosynthesis locus in xanthomonads
that infect rice citrus and crucifers. BMC Eval Biol 7: 243-255.

Plainvert C, Bidet P, Peigne C, Barbe V, Medigue C, Denamur E, Bingen E et al. (2007)
A new O-antigen gene cluster has a key role in the virulence of Escherichia cali
meningitis clone O45:K1:H7. J Bacterial 189: 8528-8536.

Pomposiello PJ & Demple B (2001) Redox-operated genetic switches: the SoxR and
OxyR transcription factors. Trends Biotechnol 19: 109-114.

Qiu X, Sundin GW, Chai B & Tiedje JM (2004) Survival of Shewanella aneidensis MR-l
after UV radiation exposure. Appl Environ Microbial 70: 6435-6443.

Raetz, CRH & Whitfield C (2002) Lipopolysaccharide Endotoxins. Annu Rev Biochem
71: 635-700.

Ray TC, Smith ARW, Carter KJ & Hignett RC (1986) Composition of
lipopolysaccharides from four strains of Erwinia amylovora. J Gen Microbiol 132:
3 159-3 167 .

Ray TC, Smith ARW, Wait R & Hignett RC (1987) Structure of the sidechain of
lipopolysaccharide from Erwinia amylovora T. Eur J Biochem 170: 357-361.

Reeves PR, Hobbs M, Valvano MA Skumik M, Whitfield C, Coplin D, Kido N, Klena J,
Maskell D, Rates CRH & Rick P D (1996) Bacterial polysaccharide synthesis and gene
nomenclature. Trends Microbiol 4: 495-503.

Regué, M, Izquierdo L, Fresno S, Piqué, N, Corsaro MM, Naldi T, De Castro C,
Waidelich Merino S & Tomas JM (2005) A second outer-core region in Klebsiella
pneumoniae lipopolysaccharide. J Bacterial 187: 4198-4206.

Rosenfeld Y & Shay Y (2006) Lipopolysaccharide (Endotoxin)-host defense antibacterial
peptides interactions: Role in bacterial resistance and prevention of sepsis. Biochem
Biophys Acta 9: 1513-1522.

Sabra W, Lfinsdorf H, Zeng &'A-P (2003) Alterations in the formation of
lipopolysaccharide and membrane vesicles on the surface of Pseudomonas aeruginasa

PAOl under oxygen stress conditions. Microbiology 149: 2789-2795.

Sedgwick SG, Ho C & Woodgate R (1991) Mutagenic DNA repair in enterobacteria. J
Bacterial 173: 5604-5611.

Sinha RP & Hiider D-P (2002) UV-induced DNA damage and repair: a review.
Phatochem Photobial Sci. 1: 225-236.

25

Skinner J S (1829) American Farmer. St. Paul MN: John D Toy. 212.

Somerville Jr JE, Cassiano L, Bainbridge B, Cunningham MD & Darveau RP (1996) A
novel Escherichia cali lipid A mutant that produces an antiinflarnmatory
lipopolysaccharide. J Clin Invest 97: 359-365.

Szekeres Jr ES, Woodgate R & Lawrence CW (1996) Substitution of mucAB or rumAB
for umuDC alters the frequencies of the two classes of mutations induced by a site-

specific T-T cyclobutane dimmer and the efficiency of translesion DNA synthesis. J
Bacteriol 178: 2559-2563.

Thomson SV Epidemiology of fire blight. Varmeste JL, ed. (2000) Fire blight the diseafi
and its causative ggent Erwinia amylovora. New York NY: CABI Publishing. 9-36.

Torres MA Jones J DG & Dangl J L (2006) Reactive oxygen species signaling in response
to pathogens. Plant Physiol 141: 373-378.

Toth 1K, Thorpe CJ, Bentley SD, Mulholland V, Hyman LJ, Perombelon MCM &
Salmond GPC (1999) Mutation in a gene required for lipopolysaccharide and
enterobacterial common antigen biosynthesis affects virulence in the plant pathogen
Erwinia carotovora subsp. atroseptica. Mol Plant Microbe Interact 12: 499-507.

Vanneste J L What is fire blight? Who is Erwinia amylovora? How to control it?
Vanneste J L ed. (2000) Fire blight the disease and its causativea gent Erwinia
amylovora. New York NY: CABI Publishing. 1 -6.

Vanneste J L & Eden-Green S Migration of Erwinia amylovora in host plant tissues.
Vanneste J L, ed. (2000) Fire blight the disease and its causative agent Erwinia
amylovora. New York NY: CABI Publishing. 73-84.

Venisse J -S, Gullner G & Brisset M-N (2001) Evidence for the involvement of an
oxidative stress in the initiation of infection of pear by Erwinia amylovora. Plant Physiol
125: 2164-2172.

Venisse J S, Malnoy M, Faize M, Paulin JP & Brisset MN (2002) Modulation of defense
responses of Malus spp. during compatible and incompatible interactions with Erwinia
amylovora. Mal Plant Microbe Interact 15: 1204-1212.

Vorwerk S, Somerville S & Somerville C (2004) The role of plant cell wall
polysaccharide composition in disease resistance. Trends Plant Sci 9: 203-209

Whitfield C, Amor PA & delin R (1997) Modulation of the surface architecture of
Gram-negative bacteria by the action of surface polymer: lipid A-core ligase and by
determinants of polymer chain length. Mal Microbial 23: 629-638.

26

Witkin EM (1976) Ultraviolet mutagenesis and inducible DNA repair in Escherichia cali.
Microbial Mol Biol Rev 40: 869-907.

Woodgate R & Sedgwick SG (1992) Mutagenesis induced by bacterial UmuDC proteins
and their plasmid homologues. Mal Microbial 6: 2213-2218.

Wu G, Shortt B, Lawrence EB, Levine EB, Fitzsirnmons KC & Shah DM (1995)
Disease resistance conferred by expression of a gene encoding H202-generating glucose
oxidase in transgenic potato plants. Plant Cell 7: 1357-1368.

Wu J & Weiss B (1992) Two-stage induction of the saxRS (superoxide response) regulon
of Escherichia coli. J Bacteriol 174: 3915-3920.

Xiang T, Zong N, Zou Y, Wu Y, Zhang J, Xing W, Li Y et al. (2008) Pseudomonas
syringae effector AvrPto blocks innate immunity by targeting receptor kinases. Curr Biol
18: 74-80.

Yasui A & Chevallier M-R (1983) Cloning of photoreactivation repair gene and excision
repair gene of the yeast Saccharamyces cerevisiae. Curr Genet 7: 191-194.

Yethon J A, Gunn J S, Ernst RK, Miller SI, Laroche L, Malo D & Whitfield C (2000)
Salmonella enterica Serovar Typhimuriurn waaP mutants show increased susceptibility
to polymyxin and loss of virulence in vivo. Infect Immun 68: 4485-4491.

Yun MH, Torres PS, Oirdi ME, Rigano LA, Gonzalez-Lamothe R, Marano MR,
Castagnaro AP, Dankert MA et a1. (2006) Xanthan induces plant susceptibility by
suppressing callose deposition. Plant Physiol 141: 178-187.

Zeidler D, Zéihringer U, Gerber I, Dubery I, Hartung T, Bors W & Hutzler P (2004)
Innate immunity in Arabidapsis thaliana: Lipopolysaccharides activate nitric oxide
synthase (NOS) and induce defense genes. Proc Natl Acad Sci U SA 101: 15811-15816

Zenoff VF, Sifieriz F & Farias ME (2006) Diverse responses to UV-B radiation and
repair mechanisms of bacteria isolated from high-altitude aquatic environments. Appl
Environ Microbial 72: 7857-7863.

Zhao Y, He S-Y & Sundin GW (2006) The Erwinia amylovora aerptZEa gene
contributes to virulence on pear and AerptZEa is recognized by Arabidopsis RPS2 when
expressed in Pseudomonas syringae. Mal Plant-Microbe Interact 19: 644-654.

Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JDG, Felix G & Boller T (2004)

Bacterial disease resistance in Arabidapsis through flagellin perception. Nature 428:
764-767.

27

Chapter 2
Effect of a waaL mutation on lipopolysaccharide composition, oxidative

O O O 0 O *
stress survrval, and vrrulence 1n Erwinia amylovora

Abstract
Erwinia amylovora, the causal agent of fire blight, is an enterobacterial pathogen of
Rosaceous plants including apple and pear. We have been studying the response of E.
amylovora to oxidative stress because, during infection, the bacterium elicits an oxidative
burst response in host plants. During the screening of a transposon mutant library for
hydrogen peroxide sensitivity, we identified a mutant carrying an insertion in waaL, a
gene involved in lipopolysaccharide (LPS) biosynthesis that was more sensitive to
hydrogen peroxide than the parental wild-type strain. We also confirmed that a waaL
mutant of Pseudomonas aeruginasa exhibited an increased sensitivity to hydrogen
peroxide compared to the wild-type strain. The E. amylovora waaL mutant also was
reduced in virulence, showed a decrease in twitching motility, and was more sensitive to
polymyxin B than the wild-type. Each of these phenotypes was complemented by the
cloned waaL gene. Our results highlight the importance of the LPS layer to virulence in
E. amylovora and the unexpected finding of an additional function of LPS in protection
from oxidative stress in E. amylovora and P. aeruginasa.
Introduction

The enterobacterial plant pathogen E. amylovora is the causal agent of fire blight,
an economically important disease of apple and pear trees, and other hosts in the family
Rasaceae. E. amylovora infects multiple host organs including blossoms and actively-

growing shoots, and uses a type III secretion system to directly inject effector proteins

28

such as DspA/E into host cells and initiate pathogenesis (Oh & Beer, 2005). The
exopolysaccharide amylovoran is also a pathogenicity factor (Bugert & Geider, 1995),
and other virulence factors include the type III effector AerptZE, (Zhao et al., 2006), the
iron-binding siderophore desferrioxamine (Dellagi et al., 1998) and sorbitol-utilization
genes (Aldridge et al., 1997). Infection is predominantly systemic in host plants with the
bacterium migrating through the xylem or water-conducting vascular system of the host
(Suhayda & Goodman, 1981).

Plant pathogen/host interactions have been termed “molecular arms races” due to
constant refinement of effector genes by the pathogen and resistance genes by the host.
Elicitors of defense responses include general determinants such as flagella, that are
common among most bacterial pathogens, and specific determinants such as protein
effectors secreted via type III secretion that are recognized by the products of plant
resistance genes. An integral aspect of the plant defense response against pathogens is
the occurrence of an oxidative burst in which reactive oxygen species (ROS) are
produced following pathogen recognition (Shetty et al., 2008). Avirulent or unsuccessful
pathogens often induce a biphasic response consisting of a transient first phase of ROS
accumulation of lower intensity, followed by a continuous phase of much higher intensity
(Torres et al., 2006). Most virulent pathogens are capable of avoiding or suppressing
host defenses during disease initiation and only induce the transient first phase of ROS
accumulation (Bolwell et al., 2002).

E. amylovora is one of only a few known plant pathogens that induces an
oxidative burst similar to that of a plant resistance response prior to successful

pathogenesis (Venisse et al., 2001). This host response is mediated by the recognition of

29

the type III effectors HrpN and DspA/E (V enisse et al., 2003). E. amylovora cells
survive the resulting oxidative burst, and nutrients released by host cells killed in this
process provide the energy for subsequent pathogen buildup and systemic invasion of the
vascular system (Venisse et al., 2003). While determinants such as superoxide dismutase
and catalase enzymes would be predicted to be involved in the survival of E. amylovora
exposed to oxidative stress, to date, only the siderophore desferrioxamine has been
demonstrated to contribute to the survival of E. amylovora in the presence of elevated
levels of hydrogen peroxide (V enisse et al., 2003).

Lipopolysaccharide (LPS) is composed of complex glycolipids and is the major
molecular component of the outer membrane of grarn-negative bacteria. The LPS can be
divided into three structural regions: the lipid A that binds the LPS to the outer
membrane, the core which is an oligosaccharide attached to lipid A, and the O-antigen
which is distal to the outer membrane (Raetz & Whitfield, 2002). Because of its external
location, the LPS is important for interaction with the environment and also with
potential host organisms. The O-antigen of LPS plays an important role in surface
phenomena including swarming motility (Toguchi et al., 2000), and a role in flagella
biogenesis (Abeyratlme et al., 2005). The LPS is thought of as a physical barrier that
protects the bacterium from antibacterial agents such as peptides (Rosenfeld & Shai,
2006). LPS plays multiple roles during bacterial pathogenesis and plant host response;
for example, LPS is recognized by plants and elicits a defense response (Erbs &
Newman, 2003), and LPS can prime plants to respond more rapidly to subsequent attack

by bacterial pathogens (Newman et al., 2002). The LPS may also contribute to the

30

protection of infecting bacteria from antimicrobial substances produced by plants
(Newman et al., 2001).

Because E. amylovora survives the oxidative burst response of the host during
infection, we hypothesized that the organism would exhibit tolerance to ROS and that
genes encoding ROS tolerance would be important virulence factors. As part of this
work, we screened a transposon-insertion mutant library of the pathogenic strain E.
amylovora Ea1189 for mutants reduced in virulence and with decreased survival in the
presence of hydrogen peroxide. Sequence identification of one such mutant revealed the
unexpected result of an insertion in waaL, a gene involved in LPS biosynthesis. In this
work, we characterized the waaL gene of E. amylovora and detailed the involvement of
LPS in oxidative stress survival and virulence of the fire blight pathogen.

Materials and Methods
Bacterial strains, plasmids, media, and growth conditions

The wild-type virulent strain E. amylovora Ea1189 (Burse et al., 2004) was used
in all experiments. Cloning experiments were done using Escherichia coli DHSor
(Sambrook et al., 1989). For comparative characterization analyses of the Eal 189 waaL
mutant, we obtained Pseudomonas aeruginasa PAOl and PAOl waaL::ISphaA/hah
(Jacobs et al., 2003) from the Department of Genome Sciences at the University of
Washington. All bacteria were grown in Luria-Bertani (LB) broth or solidified media
(1.5% agar). Ampicillin (100 pg ml'l) and kanamycin (50 pg ml'l) were added to media
when necessary. All bacteria were grown at 28°C except Escherichia cali and

Pseudomonas aeruginasa, which were grown at 37°C

Peroxide sensitivity assay

31

Overnight cultures were pelleted, washed, and resuspended in 0.5x PBS to an
optical density (OD600 nm) of 0.1. To determine the LDso of hydrogen peroxide of E.

amylovora Ea1189, hydrogen peroxide ([30% solution] J .T. Baker; Phillipsburg, NJ) was

added to cells in various concentrations, and the cell suspensions were incubated from

one to 20 minutes at 25°C After incubation, 25 111 samples fiom appropriate serial

dilutions were plated on LB medium. Plates were incubated at 28°C for 48 hr prior to
bacterial enumeration. The concentrations of hydrogen peroxide used to screen wild type
and mutant strains of E. amylovora and P. aeruginasa for LD50 determination were 250
uM and 600 uM, respectively. The sensitivity of E. amylovora strains to a range (250
uM-750 M) of hydrogen peroxide concentrations (15 min exposure) was also examined.
Transposon mutant library screen for hydrogen peroxide sensitive mutants

E. amylovora Ea1189 was grown overnight in LB broth at 28°C, subcultured in
LB broth, and grown to exponential phase (OD600 = 0.8). Cells were pelleted, then made
electrocompetent (Sambrook et al., 1989) and stored at -—80°C One ul of the EZ::TN
<KAN-2> Tnp transposome (Epicentre; Madison, Wisconsin) was added to the
electrocompetent cells, and electroporation was performed using a Gene Pulser (Biorad;

Hercules, California) according to the manufacturer’s recommendations. Electroporated

cells were immediately recovered by adding 1 ml of SOC medium (Sambrook et al.,
1989) and then transferred to a sterile tube and incubated on a shaker at 28°C for 2 hr.

Transformants were then plated on LB with kanamycin (LBKm) and, after 48 hr,

individual colonies were stored in 96-well plates containing LB broth with 10% glycerol

and kanamycin. The randomness of transposon insertion and confirmation of single

32

insertions was assessed for 20 randomly-selected mutants using Southern hybridization of
genomic DNA preparations digested with EcoRI, an enzyme that does not have any
recognition sites within the EZ::TN <KAN-2> Tnp transposon. Over 6,100 random
clones were recovered and stored.

Screening for the sensitivity of mutants in the library to hydrogen peroxide was

done in flat bottom 96-well plates (Evergreen Scientific; Los Angeles, CA). Mutants
were grown overnight in 250 p1 LB broth at 19.5°C A sample of 2 p1 of each culture was
then inoculated into new 96-well plates containing LB broth or LB broth amended with

250 pM H202. These two 96-well plates were also incubated at 195°C for 24 hr

following which the OD600 of each culture was determined using a Safire microplate
reader (Tecan; Research Triangle Park, NC). The lower temperature of incubation was
used to decelerate the breakdown of hydrogen peroxide. The absorbance data were then
converted to cell numbers using a standard curve previously generated for E. amylovora
(M. Berry, unpublished).
Identification of transposon insertion sites

To identify the genes that were interrupted by the EZ::Tn transposon, the random
amplification of transposon ends (RATE) PCR method of Ducey and Dyer (2002) was
utilized with slight modifications. The boiled cells were diluted ten-fold before use in the
PCR reaction, and the M gClz concentration was doubled to 30 mM. PCR products were
purified with a PCR Purification Kit (Qiagen; Gaithersburg, MD), and the resulting DNA
was sequenced at the Michigan State University Research Technology Support Facility.
All sequences were compared using BlastX to the closed E. amylovora genome sequence

available at (http://www.sanger.ac.uk/Projects/E_amylovora/), followed by comparison

33

with the NCBI database to identify homologs. The waaL gene was identified in this
manner and oligonucleotide primers WaaL 2 For (5’-
ATGCGATGCTGCCGGAATTCTGTTGTGAG-3”) and WaaL 2 Rev (5’-
ATGCCCGCGGGTCCCACCAATGCTGCTATCC-3’) were used to amplify and clone
the full-length waaL coding sequence (also including approximately 200 bp upstream and
downstream) into pGem5zf (Promega Corp, Madison, WI) downstream of the pGemSZf
lac promoter, creating the plasmid pMCB3.
Virulence assays

We used an immature pear fi'uit assay for virulence assessment of E. amylovora
strains (Zhao et al., 2005); this type of assay has been routinely used to examine
virulence of the fire blight pathogen. Bacterial inocula were grown overnight, pelleted,
and resuspended in 0.5x phosphate-buffered saline (PBS; Sigrna-Aldrich Inc.; St. Louis,
M0) to an OD600 of 0. 1. Ten pl of bacterial cells at a concentration of 108 cells/ml (or
0.5x PBS as a control) were then applied to the surface of each of 10 pears used per strain
after which a No. 2 insect pin was pushed through the bacterial droplet into the pear to a

depth of ~0.5 cm. Following inoculation, the pears were placed in a covered humidified
chamber for nine days at 28°C Lesion size was monitored daily and bacterial cell counts
were also determined in some experiments by sampling pear cores taken from the site of
inoculation using a #4 cork borer. Each core was hand ground with a sterile plastic
mortar in 500 pl of 0.5x PBS, and appropriate dilutions in 0.5x PBS were plated onto LB
medium. Cells were enumerated after incubation at 28°C for two days. A total of five

experiments were done with E31189 and four experiments were done with G81 and

GSl/pMCB3.

34

Visualization of LPS
Crude cell pellets of E. amylovora Ea1189 and GS] were extracted twice with in

11 ml 90% ethanol for 1 hr, once with 5 ml acetone and once with 2 ml diethyl ether for
30 min at 25°C Dry cell masses were suspended in 0.5 ml 10 mM tricine (pH 8.0) and

digested with 0.5 mg proteinase K overnight. A modification of the phenol/water

extraction procedure of Westphal and J ann (1965) was then used to extract LPS. Briefly,

cells were suspended in 6 ml water and heated to 65°C; 6 ml of 65°C phenol was then

added, and the cells were incubated at 65°C for 0.5 hr with stirring after which they were

centrifuged to separate phases. Aqueous phases were taken and interfacial/phenol phase
material was reextracted with water. Gels were fixed and stained using the SilverSNAP
stain kit II (Pierce; Rockford, IL) following the manufacturer’s instructions. LPS
extraction and analysis was done at the Complex Carbohydrate Research Center at the
University of Georgia.
Polymyxin B sensitivity assay

Previous studies have shown that a truncated LPS layer is correlated with an
increase in sensitivity to antimicrobial peptides including polymyxin B (Yethon et al.,
2000). We used the protocol of Loutet et al. (2006) to assess the sensitivity to polymyxin
B of E. amylovora Ea1189 and GSl. Polymyxin B (Sigma; St. Louis, MO) was added to

a final concentration of 0.25 pg ml'1 in LB broth which contained E. amylovora at an

OD600 of 0. 1. The cells were incubated at 28°C for 2 hr prior to plating to assess cell

survival.

Twitching and swimming assay

35

In P. aeruginasa, a waaL mutant was impaired in motility because of a reduction
in number of flagella per cell (Abeyrathne et al., 2005). We assessed swimming and
twitching motility of E. amylovora Ea1189 and GSl using a 0.3% agarose medium and a
stab assay, respectively. Distance traveled from the initial point of inoculation was
measured using analog calipers. Additional protocol information and results scoring
were as according to Rashid and Kornberg (2000).

Results and Discussion
Pleiotropic phenotypes of the E. amylovora waaL mutant: increased sensitivity to
hydrogen peroxide, alterations in virulence, sensitivity to polymyxin B, and motility

The LD50 exposure regime (250 pM H202) was used for screening the EZ::TN
transposon mutant library of E. amylovora Ea1189, and yielded 45 mutants with
differences in peroxide sensitivity relative to the wild type E. amylovora E31189. RATE-
PCR was used to map transposon insertion sites, and one of the mutants, GSl, had an
insertion in a gene homologous to waaL, which functions in the ligation of the O-antigen
to the lipid A core during LPS biosynthesis (Abeyrathne et al., 2005). A translation of the
waaL gene from E. amylovora Ea273 (http://www.sanger.ac.uk/Projects/E_amylovora/)
shared closest amino acid identity with the corresponding translated proteins from E.
tasmaniensis, Serratia marscescens, and Klebsiella pneumoniae (data not shown). The
other 44 EZ::TN insertion mutants will be characterized elsewhere.

The E. amylovora Eal 189 waaL mutant strain GSl exhibited a two fold reduction

in survival following 10, 15, and 20 min exposure to 250 pM H202 (Figure 2.1A).

36

 

100 o B

Percent Survival
OJ h U1 ON \I 00 \O
O O O O O O O
I L I L L l I
o

N
o
I
O

 

p—A

O
I
O

 

 

 

 

O
A
O

a

0 5 10 15 20 0 5 10 15 20

 

 

 

Time (min) Time (min)

 

Figure 2.1. Sensitivity to hydrogen peroxide in Erwinia amylovora and Pseudomonas
aeruginasa strains. (A) E. amylovora Ea1189 (closed squares) and GSl (open squares)
were exposed to 250 pM H202 for various durations, before cells were plated. (B) The
same was done for P. aeruginasa PAOl (closed circles), and P. aeruginasa
waaL::ISphoA/hah (open circles) with 600 pM H202. Results shown with standard error
and represented as a mean of the four replicates for E. amylovora E31189, three replicates
for E. amylovora GS], and two replicates for the P. aeruginasa strains tested.

Because bacterial LPS has not previously been implicated in hydrogen peroxide
sensitivity, we sought to confirm this result using another organism. An analysis using
Pseudomonas aeruginasa PAOl and the corresponding transposon mutant P. aeruginasa

waaL::ISphaA/hah also revealed differential sensitivity with four fold reductions in

37

survival observed after 15 and 20 min exposure to 600 pM H202 (Figure 2. 1B).
Exposure of Eal 189 and GSl to increased concentrations of hydrogen peroxide revealed
differences in sensitivity as large as 123 fold. The sensitivity of the GS] mutant strain

increased dramatically upon exposure to higher doses (Figure 2.2).

 

100 I
I
10
I
if
.2
Z
:1
m l
E
8
:3 I
a.
l
.1
l
.01 . . u u u
0 200 400 600 800

Concentration of H202 (pM)

Figure 2.2. Survival curve of E. amylovora Ea1189 and GS] after exposure to increasing
concentrations of hydrogen peroxide. Ea1189 (closed squares) and GSl (open squares)
were challenged with various concentrations of hydrogen peroxide from 250 pM-750 pM
for 15 minutes before plating. Standard error bars have been omitted because they were

smaller than the size of the symbols in the figure. A representative experiment of three
experimental replicates is shown.

38

Complementation of GSl with pMCB3 restored wild type levels of hydrogen peroxide
sensitivity (data not shown).

Analysis of the LPS produced by the wild type strain Ea1189 revealed a typical
ladder-like pattern produced as a result of varying lengths of O-antigen attached to the

Lipid A core (Figure 2.3; Lane 1).

 

Figure 2.3. Polyacrylamide gel electrophoresis analysis of the lipopolysaccharide layer in
Erwinia amylovora strains. Lane 1, E. amylovora Ea1189 aqueous phase; lane 2, E.
amylovora Ea1189 phenol phase; lane 3, E. amylovora GSl aqueous phase; lane 4, E.
amylovora GSl phenol phase

The O-antigen side chains were absent in the waaL mutant GSl (Figure 2.3; Lane 3),
although very faint bands of a smaller molecular weight than the O-antigen bands from
Ea1189 were present. These bands could be a contaminant or could possibly represent a
low level of O-antigen addition by a Wzy-independent pathway (Raetz & Whitfield,
2002). Electrophoresis of the phenol phase from the LPS extractions demonstrated that

the phenol phase harbored small amounts of LPS that was similar to the main LPS of the

39

aqueous phase (Figure 2.3, Lanes 2 and 4). The ladder-like pattern of O-antigen lengths
was restored in the complemented strain GSl/pMCB3 (data not shown).

In an immature pear assay, E. amylovora GSl was markedly reduced in virulence
compared to the wild type strain Ea1189 and GSl/pMCB3 as evidenced by a decreased

lesion size (Figure 2.4).

 

 

 

 

 

 

 

 

 

 

3000 ‘ I Ea1189 GSI GSl/pMCB3
2500 i

A
N

E 2000 -

E

v

.2

8

:3 1500 -

0.)

Z

Q—t

0

§ 1000 r

< I Erwinia amylovora E31189

I Erwinia amylovora 051
5m ‘ I Erwinia amylovora GSl/pMCBS
0 r u
2 3 5 7 9
‘ ' Time (days)

Figure 2.4. Virulence assays. Necrotic lesion size in immature pear following inoculation
with Erwinia amylovora strains. This experiment was performed over nine days with
measurements taken at days 2, 3, 5, 7, and 9. A total of 10 immature pears were used for
each strain in each experiment. A total of five experiments were conducted with E.
amylovora Ea1189, and four experiments were conducted with E. amylovora GS] and
GSl/pMCB3. Results shown are the average of experimental replicates and are shown with
standard error. Inset: Representative pears at day 9. Strains inoculated, from left to right,
were E. amylovora Eal 189, GS], and GSl/pMCB3.

4O

Differences in lesion size were notable by five days post inoculation and more distinctive
over the remainder of the experiment. By day 9, a nearly 3.5 fold reduction in lesion size
was seen in E. amylovora GSl compared to the other two strains tested. Compared to
Ea1189, GSl exhibited a 7.6 to 45.6 fold reduction in population over a four day period
following inoculation in immature pears (data not shown). These population reductions
are similar to those observed with other E. amylovora virulence mutants such as the
aerptZ mutant (Zhao et al., 2006). Complementation of GSl with the waaL gene on
pMCB3 restored population to wild-type levels (data not shown).

After exposure to polymyxin B, a two log reduction was observed in the waaL
mutant GSl when compared to Ea1189, whereas there was little difference between

Ea1189 and the waaL-complemented strain GSl/pMCB3 (Table l).

 

Strain Logm Loglo Logm Cfir/mL Percent Survival
Starting cfu/mL after after Polymyxin after Polymyxin B
chL PBS B Exposure Exposure

Exposure

 

E. amylovora
Ea1189 8.6 8.6 8.3 52.6

E. amylovora
GSl 8.6 8.5 6.2 0.4

E. amylovora
GS 1/pMCB3 8.5 8.5 8.0 29.9

 

Table 2.1. Comparative survival of E. amylovora Ea1189 and the waaL mutant GSl
following exposure to polymyxin B The bacteria were exposed to either polymyxin B
(diluted in 0.5x PBS) or an equivalent volume of 0.5x PBS as a control for 2 hr in LB broth

prior to plating. This test was done in triplicate, and the means of the three experimental
replicates are shown.

41

No reductions in cell number were observed following exposure to PBS in control
cultures (Table 1). A significant reduction (P < .01) in twitching motility was observed

in the waaL mutant GSl compared to Ea1189 (Table 2).

 

 

Strain Average distance P value when P value when
(m) compared to E. compared to E.
amylovora Eal 189 amylovora GSl
E. amylovora 0.53 (0.04) NA 0.00034
1 189
E. amylovora 0.37 (0.02) 0.00034 NA
GS l
E. amylovora 0.49 (0.03) 0.55761 0.00995
GSl/pMCB3

 

Table 2.2. Comparison of twitching motility in E. amylovora Ea1189, G81, and
GSl/pMCB3. A total of 42 replicates were performed with strains Ea1189 and GSl, and
15 replicates were performed with GS l/pMCB3. All results are shown as a mean of the
replicates with standard error in parentheses.

This reduction in GSl was restored to wild-type levels following complementation with
the waaL gene on pMCB3 (Table 2). No significant differences in swimming motility
were observed between GSl and E31189 (data not shown).

The LPS covers more than 90% of the gram-negative bacterial cell surface and
acts as a physical barrier in particular against antimicrobial peptides (Rosenfeld & Shai,
2006). In addition, deficiencies in LPS formation result in other pleiotropic phenotypes
including reduction of swarming motility in Salmonella enterica (Toguchi et al., 2000),
and reductions in swimming and twitching motility and flagella production in P.
aeruginasa (Abeyrathne et al., 2005). However, an association between LPS and

protection from oxidative stress has not, to our knowledge, been previously reported.

There are other examples of a requirement of bacterial structural proteins for optimal

42

survival in the presence of hydrogen peroxide including porins in E. cali and a 59-kDa
outer membrane protein in S. enterica serovar Typhimurium (Stinavage et al., 1990; De
Spiegeleer et al., 2005). The differences in hydrogen peroxide sensitivity observed in the
waaL mutants of E. amylovora and P. aeruginasa in this study highlight another fimction
of LPS in bacterial physiology.

We demonstrated the importance of an intact LPS to virulence in E. amylovora.
This was expected because an intact LPS layer is an important virulence determinant in
many bacterial plant pathogens (for examples, see Schoonej ans et al., 1987 ; Dow et al.,
1995; Toth et al., 1999). We also anticipated correlations between hydrogen peroxide
sensitivity and reduced virulence because of the induction of an oxidative burst in plant
hosts prior to successful infection by E. amylovora. What was unexpected, however, was
that the LPS layer itself was involved in increased survival following hydrogen peroxide
challenge. Because of its location on cell surfaces, LPS plays a key role in bacterial host-
pathogen interactions. LPS is a pathogen-associated molecular pattern recognized by
plants leading to an induction of defense responses in nonhost plants (Newman et al.,
2007). However, LPS can also prevent the induction of the hypersensitive response of
plants and suppresses defense responses during nodulation by Sinarhizabium melilati
(Tellstroem et al., 2007). Finally, other roles for LPS including cell-cell contact and
protection fi'om plant antimicrobials likely contributes to pathogen virulence in plants. In
E. amylovora, the role of LPS in protection from plant antimicrobials including ROS is
likely the prominent functional role of LPS in virulence since this organism elicits an

oxidative burst defense response in its host during infection (Venisse et al., 2001).

43

In summary, our results indicate that inactivation of waaL in E. amylovora
Ea1189 resulted in a truncated LPS layer with consequences including decreased survival
following hydrogen peroxide exposure and reduced virulence. This work confirms that
the importance of the bacterial LPS is multifold, providing both protective functions and

possibly aggressive functions during pathogenesis.

Acknowledgements

We thank the Manoil laboratory, Department of Genome Sciences, University of
Washington for the P. aeruginasa waaL mutant. This work was funded by a special
grant from the United States Department of Agriculture and the Agricultural Experiment

Stations of Michigan and Illinois.

References

Abeyrathne PD, Daniels C, Poon KKH, Matewish MJ & Lam J S (2005) Functional
Characterization of waaL, a ligase associated with linking O-antigen polysaccharide to
the core of Pseudomonas aeruginasa lipopolysaccharide. J Bacterial 187: 3002-3012.

Aldridge P, Metzger M & Geider K (1997) Genetics of sorbitol metabolism in Erwinia
amylovora and its influence on bacterial virulence. Mol Gen Genet 256: 611-619.

Bolwell GP, Bindschedler LV, Blee KA et al. (2002) The apoplastic oxidative burst in
response to biotic stress in plants: a three-component system. J Exp Bot 53: 1367-1376.

Bugert P & Geider K (1995) Molecular analysis of the arns operon required for
exopolysaccharide amylovoran synthesis of Erwinia amylovora. Mal Microbial 15: 917-
933.

Burse A, Weingart H & Ullrich MS (2004) NorM, an Erwinia amylovora multidrug
efflux pump involved in vitro competition with other epiphytic bacteria. Appl Environ
Microbial 70: 693-703.

Dellagi A, Brisset MN, Paulin JP & Expert D (1998) Dual role of desferrioxamine in
Erwinia amylovora pathogenicity. Mal Plant-Microbe Interact 11: 734-742.

De Spiegeleer P, Sermon J, Vanoirbeek K, Aertsen A & Michiels CW (2005) Role of
porins in sensitivity of Escherichia cali to antibacterial activity of the lactoperoxidase
enzyme system. Appl Environ Microbial 71: 3512-3518.

Dow JM, Osbourn AE, Wilson TJ & Daniels MJ (1995) A locus determining
pathogenicity of Xanthamanas campestris is involved in lipopolysaccharide biosynthesis.
Mal Plant-Microbe Interact 8: 768-777.

Ducey TF & Dyer DW (2002) Rapid identification of EZ::TNTM transposon insertion
sites in the genome of Neisseria ganorrhoeae. EPICENTRE Forum. 9: 6-7.

Erbs G & Newman M (2003) The role of lipopolysaccharides in induction of plant
defence responses. Mal Plant Pathol 4: 421-425.

Jacobs MA, Alwood A, Thaipisuttikul I et al. (2003) Comprehensive transposon mutant
library of Pseudomonas aeruginasa. Proc Natl Acad Sci USA 100: 14339-14344.

Loutet SA, Flannagan RS, Kooi C, Sokol PA & Valvano MA (2006) A complete
lipopolysaccharide inner core oligosaccharide is required for resistance of Burkholderia

cenacepacia to antimicrobial peptides and bacterial survival in vivo. J Bacterial 188:
2073-2080.

45

Maxson-Stein K, McGhee GC, Smith JJ, Jones AL & Sundin GW (2003) Genetic
analysis of pathogenic Erwinia sp. isolated from pear in Japan. Phytopathalagy 93:
1393-1399.

Newman M-A, Dow JM & Daniels MJ (2001) Bacterial lipopolysaccharide and plant-
pathogen interactions. Eur J Plant Pathol 107: 95-102.

Newman M-A, Dow JM, Molinaro A & Parrilli M (2007) Priming, induction and
modulation of plant defence responses by bacterial lipopolysaccharides. J Endatax Res
13: 69-84.

Newman M-A, von Roepenack-Lahaye E, Parr A, Daniels MJ & Dow JM (2002) Prior
exposure to lipopolysaccharide potentiates expression of plant defenses in response to
bacteria. Plant J 29: 487-495.

Oh C-S & Beer SV (2005) Molecular genetics of Erwinia amylovora involved in the
development of fire blight. FEMS Microbial Lett 253: 185-192.

Raetz CR & Whitfield C (2002) Lipopolysaccharide endotoxins. Annu Rev Biochem 71:
635-700.

Rashid MH & Kornberg A (2000) Inorganic polyphosphate is needed for swimming,
swarming, and twitching motilities of Pseudomonas aeruginasa. Proc Natl Acad Sci USA
97: 4885-4890.

Rosenfeld Y & Shai Y (2006) Lipopolysaccharide (endotoxin)-host defense antibacterial
peptides interactions: role in bacterial resistance and prevention of sepsis. Biochem
Biophys Acta 1758: 1513-1522.

Sambrook J, Fritsch ER & Maniatis TA (1989) Molecular Cloning: A Laboratory
Manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Schoonej ans E, Expert D & Toussaint A (1987) Characterization and virulence properties
of Erwinia chrysanthemi lipopolysaccharide-defective, phi EC2-resistant mutants. J
Bacteriol 1 69: 401 1-401 7.

Shetty NP. J orgensen HJL, Jensen JD, Collinge DB & Shetty HS (2008) Roles of reactive
oxygen species in interactions between plants and pathogens. Eur J Plant Pathol 121:
267-280.

Stinavage PS, Matrin LE & Spitznagel JK (1990) A 59 kilodalton outer membrane

protein of Salmonella typhimurium protects against oxidative intraleukocytic killing due
to human neutrophils. Mal Microbial 4: 283-293.

46

Suhayda CG & Goodman RN (1981) Early proliferation and migration and subsequent
xylem occlusion by Erwinia amylovora and the fate of its extracellular polysaccharide
(EPS) in apple shoots. Phytapathalagy 71: 697-707.

Tellstroem V, Usadel B, Thimm O, Stitt M, Kuester H & Niehaus K (2007) The
lipopolysaccharide of Sinarhizabium melilati suppresses defense-associated gene

expression in cell cultures of the host plant Medicaga truncatulata. Plant Physio] 143:
825-837.

Toguchi A, Siano M, Burkhart M & Harshey RM (2000) Genetics of swarming motility
in Salmonella enterica serovar Typhimurium: critical role for lipopolysaccharide. J
Bacterial 182: 6308-6321.

Torres MA, Jones JDG & Dangl J L (2006) Reactive oxygen species signaling in response
to pathogens. Plant Physio] 141: 373-378.

Toth 1K, Thorpe CJ, Bentley SD et a]. (1999) Mutation in a gene required for
lipopolysaccharide and enterobacterial common antigen biosynthesis affects virulence in

the plant pathogen Erwinia carotovora subsp. atroseptica. Mal Plant-Microbe Interact
12: 499-507.

Venisse J -S, Barny M-A, Paulin J -P & Brisset M-N (2003) Involvement of three
pathogenicity factors of Erwinia amylovora in the oxidative stress associated with
compatible interaction in pear. FEBS Lett 537: 198-202.

Venisse J -S, Gullner G & Brisset M-N (2001) Evidence for the involvement of an
oxidative stress in the initiation of infection of pear by Erwinia amylovora. Plant Physio]
125: 2164-2172.

Yethon J A, Gunn J S, Ernst RK et a]. (2000) Salmonella enterica serovar typhimurium
waaP mutants show increase susceptibility to polymyxin & loss of virulence in vivo.
Infect Immun 68: 4485-4491.

Westphal O & J ann K (1965) Bacterial lipopolysaccharides. Methods Carbohydr Chem
33: 1 58-1 74.

Zhao YF, Blumer SE & Sundin GW (2005) Identification of Erwinia amylovora genes
induced during infection of immature pear tissue. J Bacteria] 187: 8088-8103.

Zhao Y, He S-Y & Sundin GW (2006) The Erwinia amylovora aerptZEa gene

contributes to virulence on pear and AerptZE,I is recognized by Arabidopsis RPS2 when
expressed in Pseudomonas syringae. Mo] Plant-Microbe Interact 19: 644-654.

47

Chapter 3

Survival and Mutability in Response to Ultraviolet Radiation in Erwinia amylovora
Abstract
Erwinia amylovora is a Gram-negative bacteria] plant pathogen that infects members of
the family Rasacea including apple and pear. This organism, like most on Earth, is
exposed to ultraviolet (UV) radiation during the life cycle. Of the mechanisms used to
repair damage caused by UV radiation, mutagenic repair is one of the last ones utilized
since mutagenic repair is error prone and causes mutations in DNA. We discovered that
Erwinia species survived UV light exposure and exhibited mutability in response to UV
light at a higher rate when compared to E. cali and Pseudomonas strains. Survival and
mutability were both decreased when the gene pair responsible for mutagenic repair,
umuDC, was knocked out, but complementation with either umuDC from E. cali, or
rulAB, a homolog of umuDC, fi'om Pseudomonas was able to restore survival and
mutability to wild type levels.
Introduction
Like most organisms on Earth, E. amylovora is exposed to ultraviolet (UV) stress during
the life cycle. Repair mechanisms including photoreactivation, nucleotide excision
repair, and recombinational repair exist in the bacterium that allow this pathogen to
survive exposure to UV light and colonize the host (Y asui & Chevallier, 1983; Brash et
al., 1985; Sinha & Hader, 2002). These systems have overlapping functions so that if one
system is defective, the cell can survive with the repair systems that remain. Of the
different repair mechanisms that exist, mutagenic repair is one of the last ones used to

repair DNA damage because it is error prone and can cause a mutation at the site of DNA

48

damage (Sinha & Hader, 2002). Without mutagenic repair; some damage to DNA could
not be corrected, which would stall replication to the point where the cell would die. In
enteric bacteria, mutagenic repair is most commonly encoded by the gene pair umuDC
(Sedgwick et al., 1991). This gene pair is part of the SOS response, which means it is
regulated by two proteins, RecA and LexA (Witkin, 1976; Bagg et al., 1981). RecA
detects damage induced by UV via the presence of single stranded DNA, after which
RecA becomes activated and facilitates the autoproteolytic cleavage of LexA that
functions as a repressor of SOS response genes including umuDC (Bagg et al., 1981; Lee
et al., 1996). Once cleaved, LexA is released from its binding site allowing transcription
of the SOS response genes to continue. umuDC is dicistronic with the two genes
overlapping by 1 bp (Sedgwick et al., 1991). After translation, the UmuD protein is
autoproteolytically cleaved at the 24th amino acid (W oodgate & Sedgwick, 1992; Kim &
Sundin, 2000). This form of UmuD is known as UmuD’, which forms a homodimer
before binding with UmuC (Woodgate & Sedgwick, 1992; Kim & Sundin, 2000). This
complex then repairs DNA damage by inserting a base opposite the damaged base so that
replication can proceed. Since the template’s base is not used to determine which base is
inserted, a mutation occurs when an incorrect base is incorporated opposite the original
damaged base. Each step in the transcription of these SOS response genes is necessary
for the genes to be transcribed at the appropriate level. In P. syringae, the absence of a
firnctional recA gene results in cells that are over 10,000 fold more sensitive to UV
radiation at the lowest dosage administered (Sundin, 1996).

Other homologs to umuDC include mucAB, rulAB, and samAB. While these are

regulated and function similarly to umuDC, differences in efficiencies have been

49

observed in different systems (Sedgwick et al., 1991; Szekeres Jr. et al., 1996). These
differences have been shown to be variable depending on the cell system that expresses
the homologs. For example, differences of 100 fold have been observed in different
species in the genus Enterabacteriaciae with umuDC (Sedgwick et al., 1991). Another
study also noted differences in the umuDC homolog, rulA, at the amino acid level. Seven
pathovars of P. syringae were compared for amino acid differences in the RulA protein,
which yielded differences in every comparison between two pathovars of at least one
amino acid and up to eight or more amino acids (Sundin, 2000). Although a bacterium
can survive without mutagenic repair, a negative affect on survival and mutability is
observed. In P. syringae FF 5, loss of rulAB results in a 10 fold decrease in survival both
in culture and in planta (Sundin, 1996; Sundin, 1999). Often, cells expressing umuDC
are not as efficient as the other homologs, in mutagenic repair, because the step involving
autoproteolytic cleavage of UmuD into UmuD’ does not proceed as rapidly as in the
other homologs (Woodgate & Sedgwick, 1992; Kim & Sundin, 2000). In this work, we
sought to observe any differences in survival and mutability when comparing different
Gram-negative strains as well as a knockout of umuDC and strains complemented with

homologs of umuDC.
Materials and Methods

Bacterial strains, plasmids, media, and growth conditions
All bacteria were grown in Luria-Bertani (LB) broth or solidified media (1.5%
agar). Ampicillin (100 pg mL'l), chloramphenicol (20 pg mL'l), gentamicin (15 pg mL'

1), rifampicin (250 pg mL'l), and spectinomycin (100 pg mL'l) were added to media

50

when appropriate. All bacteria were grown at 28°C except Escherichia cali, which was

grown at 37°C (Table 2.1)

 

 

Strain or Plasmid Relevant Characteristics Source or Reference
Strains-Eggrimental
may:
Erwinia amylovora
Ea1189 Wild type Burse, 2004
Erwinia amylovora
Ea273 Wild type Bogdanove, 1998
Erwinia amylovora
LebB66 Wild type Foster, 2004
Escherichia coli
DH5a Strain used for cloning G.W. Sundin
Escherichia cali
K12 Enteric bacterium ATCC 47076
Pseudomonas cichorii Zhang, 2004
302959 Plant pathogen
Pseudomonas syringae Legard, 1993
B86- 1 7 Plant pathogen
Plasmids
pJJK25 2.45 kb umuDC promoter + rulAB as SalI and Kim & Sundin, 2000
BamHI in pJB321
pJJK27 2.45 kb umuDC promoter + umuDC as SalI Kim & Sundin, 2000
and BamHI in pJB321
Primers
Cm + umuDC For 5 '-ccgttatgccgcttatccgtccgctcgacattgattg This Study
ctccctgctacttgtgtaggctggagctgcttc -3 ’
Cm + umuDC Rev 5'-ccgcatcacttcgccacgggaagatcggcatagc This Study
gagtggtgtaagcgggcatatgaatatcctcctta -3 '
umuDC For 5'-atggctggcctgctgttattc -3 ' This Study
umuDC Rev 5 '-ccatgcggttatctttctgttgc -3 ' This Study

 

(ATCC) American Type Culture Collection
Table 3.1. Bacterial strains, plasmids, and oligonucleotide primers used in this study and

their relevant characteristics

51

UV-C Survival Assay

Cells were grown overnight as described before centrifugation and resuspension
in 0.85% saline. After measuring UV output of the lamp used (output around 1.46
J/m2*s), bacteria were exposed to five 20 8 doses of UV-C light and plated before the first
dose and after each of the five doses applied. Following growth for two days at the
appropriate temperature in darkness, cell counts were enumerated.
UV-C Mutability Assay

Cells were prepared and exposed to UV as described in the previous experiment
except three 20 3 doses were applied instead of five. Following exposure, one mL of the
bacterial suspension was added to one mL of 2x LB broth and grown overnight in
darkness at the appropriate temperature and plated on rifampicin (250 pg mL'l) the
following day. Two days after plating, rifampicin resistant colonies were counted.
Generation of umuDC Knockout

Methods for generating the umuDC knockout were adapted from the work by
Datsenko (2000), in which a chloramphenicol resistance gene replaced the gene pair
umuDC. The following changes were made to the protocol: cells were washed in ice cold
water and incubation was at 28°C with heat shocking of cells not exceeding 37°C
Complementation of umuDC

umuDC was complemented with two different plasmids to assess differences in
survival and mutability compared to the knockout. pJJK25, which encodes the gene pair
rulAB and pJJK27, which encodes the gene pair umuDC (Kim & Sundin, 2000) were

electroporated into E. amylovora Ea1189 umuDC generating E. amylovora Ea1189

52

umuDC/pJJK25 and E. amylovora Ea1189 umuDC/pJJK27 respectively. Both plasmids
are driven by an E. cali umuDC promoter.
Hydrogen Peroxide Mutability Assay
Cells were grown overnight in appropriate conditions before exposure to hydrogen
peroxide. Concentrations of hydrogen peroxide used were 0 pM, 250 pM, 500 pM, 750
pM, and 1 mM. Cells were exposed to the appropriate concentration of hydrogen
peroxide for 15 minutes before one mL of cells was placed in one mL of 2x LB broth,
which was then incubated ovemight. The hydrogen peroxide was diluted out in the 2x
LB broth, and any remaining hydrogen peroxide was deactivated by the incubation
temperature. The overnight cultures were then plated on LB amended with rifampicin
(250 pg mL'l), and colony forming units (CFU) were enumerated two days later.
Results
UV-C Survival

To observe how well E. amylovora Ea1189 survives UV stress, a comparison was
performed using bacteria fi'om the genera Erwinia, Escherichia, and Pseudomonas. Of
the six strains tested, the Erwinias (Ea1189, Ea273, and LebB66) had the highest rate of
survival followed by E. coli K12, P. syringae B86-17, and P. cichorii 302959 (Figure

3.1).

53

 

 

 

100 F
10 '
E 1
E.
3
(I)
5
E
94
0.1 r
0.01
0.001
0 40 80 120 160
J/m2

Figure 3.1. Comparison of survival in different species of Gram-negative bacteria afier
exposure to UV-C radiation. E. amylovora Ea1189 (closed diamonds) was compared to
other E. amylovora strains Ea273 (closed squares) and LebB66 (closed triangles) as well
as compared to other Grarn-negative bacteria Pseudomonas syringae B86-17 (stars)
Pseudomonas cichorii 302959 (crosses) and E. cali K12 (dashes) to assess survival in

response to increasing doses of UV-C radiation. A representative of one of the three
replicates is shown.

54

This trend was observed in each of the three replicates performed. This experiment was
repeated using a strain of E. amylovora Ea1189 in which the umuDC gene pair was
knocked out via gene replacement (called E. amylovora umuDC). The umuDC mutant
was 1.5 to 32 fold more sensitive to UV light than the WT strain over the five doses

administered (Figure 3.3).

100

\

 

Percent Survival

0.1 ‘

0.01 .

 

0.001

 

0 20 40 60 80 100 120 140 160
J/m2

Figure 3.3. Comparison of survival in E. amylovora strains after exposure to UV-C
radiation. E. amylovora Ea1189 (closed diamonds) was compared to Eal 189 umuDC (closed
squares) and two complemented strains Ea1189 umuDC/pJJK25 (closed triangles) and
Ea1189 umuDC/pJJK27 (closed circles) to assess mutability in response to increasing doses
of UV-C radiation. A representative of one of the three replicates is shown.

55

This knockout was complemented with plasmids previously generated by Kim & Sundin
(2000). These plasmids pJJK25 and pJJK27 restored the mutant to near WT levels where
both plasmids were within 1.5 fold of the WT strain throughout the course of the
experiment (Figure 3.3).
UV-C Mutability

Because there is a correlation between survival after UV exposure and an
increase in mutability, the six strains from the previous experiment were compared for

mutability on rifampicin plates (Figure 3.2).

56

1 0000

 

1000;
100g
e .
£9
E“; /
To
53%" l/
at
gum. 10 ,r
at?
:2
._.o ,
it.) .
§3° i
go
a" /
l
i
0.1
0.01 -c . . . , . -

 

 

010 20 30 40 50 60 7o 80 90
J/m2

Figure 3.2. Comparison of mutability in different species of Gram-negative bacteria after
exposure to UV-C radiation. E. amylovora Ea1189 (closed diamonds) was compared to other E.
amylovora strains Ea273 (closed squares) and LebB66 (closed triangles) as well as compared to
other Gram-negative bacteria Pseudomonas syringae B86—17 (X’s) Pseudomonas cichorii 302959
(crosses) and E. coli K12 (dashes) to assess mutability induced by increasing doses of UV-C
radiation. A representative of one of the three replicates is shown.

57

The relative mutability of the strains in response to UV was similar to their relative
sensitivity to UV as assayed by cell survival. The Erwinia strains were the most mutable
with strain LebB66 possessing the highest mutability followed by strain Ea273 and
E31189. One difference fi'om the UV-C survival experiment was that P. cichorii 302959
was more mutable than E. cali K12 and P. syringae B86-17 was the least mutable. As in
the UV survival experiment, the umuDC mutant and the umuDC mutant complemented

with either pJJK25 or pJJK27 were examined for differences in mutability (Figure 3.4).

58

Rifampicin Resistant Cells per 108
Colony Forming Units

 

60 ‘
J/m2 90

Figure 3.4. Comparison of mutability of E. amylovora strains after exposure to UV-C
radiation. E. amylovora Eal 189 (white bars) was compared to the umuDC mutant
Ea1189 umuDC (black bars) and two complemented strains E31189 umuDC/pJJK25
(black bars with white dots) and Ea1189 umuDC/pJJK27 (white bars with black dots) to
assess survival in response to increasing doses of UV-C radiation. A representative of
one of the three replicates is shown.

Compared to the WT strain, the mutant was 18 to 260 fold less mutable in response to
UV light exposure (Figure 3.4). The two plasmid complements were able to restore

mutability to near WT levels with a range of l to 4 fold difference in mutability (pJJK25)

59

and 1 to 6 fold difference (pJJK27) (Figure 3.4). Mutability in response to hydrogen
peroxide exposure was also assessed in both Ea1189 and Ea1189 umuDC, but no
difference was observed between the two strains at any of the concentrations tested (data
not shown).

Discussion

Mutagenic DNA repair is one of the last mechanisms a cell can employ to repair DNA
damage in order to survive. In E. amylovora, this repair is especially important since a
portion of the life cycle can include exposure to UV light. E. amylovora is exposed to
UV light when on the leaf surface or oozing from a film, canker, or other organ of the
plant. E. amylovora strains exhibited higher survival rates when compared to the enteric
bacterium E. cali, and two other plant pathogens, both Pseudomonads. This higher
survival could be expected if any one of the repair mechanisms in E. amylovora are more
rapidly induced or more efficiently processed than in other bacteria. It has been
observed that E. amylovora can withstand exposure to hydrogen peroxide and actually
induces the host to produce hydrogen peroxide as part of the infection process (V enisse et
al., 2002). This survival after exposure to hydrogen peroxide is due, in part, because of
different DNA repair mechanisms, which also repair damage caused by UV light.
Perhaps in Erwinia these repair mechanisms are slightly more efficient based on the
observations that Erwinia has higher survival and mutability after exposure to UV when
compared to the other bacteria previously mentioned. Also, mutagenic repair genes
demonstrate different efficiencies in bacteria and their products could be more efficiently
processed in E. amylovora, than in the other bacteria tested here. A knockout of the gene

pair responsible for mutagenic repair, umuDC, did not decrease survival to a noticeable

60

amount until higher doses of UV light, but these differences were small. This was
expected because a cell has many DNA repair mechanisms that still firnction in an
umuDC knockout background. Mutability, however, was greatly reduced in the umuDC
knockout compared to the WT strain. This result could be interpreted to mean that E.
amylovora only encodes umuDC as the mutagenic repair system in this organism. Had
mutability been reduced to a lesser extent than was found in our research, it could be
argued that, like some other organisms, a second gene pair homologous to umuDC was
contributing to the mutability of this organism.

Ultraviolet radiation is a part of life for ahnost every organism on Earth. The
ability to repair damage created by UV light is critical for survival. As was observed in
this study, lmocking out one of the mechanisms for repair does have an impact on
survival. Because part of bacterial survival is the ability to adapt to harsh conditions,
mutability was also tested. In E. amylovora, the gene pair umuDC is the only gene pair
discovered that functions in mutagenic repair, but umuDC causes increased mutability
compared to other bacterial strains in this study. Although causing mutations in the cell
can be damaging to the organism, it can also provide an advantageous mutation that will
benefit the cell during future stress, and for this reason, evolutionary retention of an error

prone repair system can be explained.

61

References

Bagg A, Kenyon CJ & Walker GC (1981) Inducibility of a gene product required for UV
and chemical mutagenesis in Eschericia cali. Proc Nat] Acad Sci U S A 78: 5749-5753.

Bogdanove AJ, Bauer DW & Beer SV (1998) Erwinia amylovora secretes DspE a
pathogenicity factor and functional Aer homolog through the Hrp (type HI) secretion
pathway. J Bacterial 180: 2244-2247.

Brash DE, Franklin WA, Sancar GB, Sancar A & Haseltine WA (1985) Eschericia cali
DNA photolyase reverses cyclobutane pyrimidine dimers but not pyrimidine-pyrimidone
(6-4) photoproducts. J Biol Chem 260: 11438-11441.

Burse A, Weingart H & Ullrich MS (2004) NorM an Erwinia amylovora multidrug efflux
pump involved in vitro competition with other epiphytic bacteria. Appl Environ
Microbial 70: 693-703.

Datsenko KA & Wanner BL (2000) One-step inactivation of chromosomal genes in
Eschericia cali K-12 using PCR products. Proc Nat] Acad Sci U S A 97 : 6640-6645.

Foster GC, McGhee GC, Jones AL & Sundin GW (2004) Nucleotide sequence genetic
organization and distribution of pEU30 and pEL60 from Erwinia amylovora. Appl
Environ Microbial 70: 7539-7544.

Kim JJ & Sundin GW (2000) Regulation of the rulAB mutagenic DNA repair operon of
Pseudomonas syringae by UV-B (290 to 320 nanometers) radiation and analysis of
rulAB-mediated mutability in vitro and in planta. J Bacteria] 182: 6137-6144.

Lee MH, Guzzo A & Walker GC (1996) Inhibition of RecA-mediated cleavage in
covalent dimers of UmuD J Bacteria] 178: 7304-7307.

Legard DE, Aquadro CF & Hunter JE (1993) DNA sequence variation and phylogenetic
relationships among strains of Pseudomonas syringae pv. syringae inferred from

restriction site maps and restriction fragment length polymorphism. Appl. Environ.
Microbial. 59: 4180—4188.

Sedgwick SG, Ho C & Woodgate R (1991) Mutagenic DNA repair in enterobacteria. J
Bacteria] 173: 5604-5611.

Sinha RP & Hader D-P (2002) UV-induced DNA damage and repair: a review.
Photochem. and Photobial. Sci. 1: 225-236.

Sundin GW & Murillo J (1999) Functional analysis of the Pseudomonas syringae rulAB
determinant in tolerance to ultraviolet B (290-320 nm) radiation and distribution of rulAB
among P syringae pathovars. Environ Microbial 1: 75-87.

62

Sundin GW, Kidarnbi SP, Ullrich M & Bender CL (1996) Resistance to ultraviolet light
in Pseudomonas syringae: sequence and functional analysis of the plasmid-encoded
rulAB genes. Gene 177: 77-81.

Sundin GW, Jacobs JL & Murillo J (2000) Sequence diversity of rulA among natural
isolates of Pseudomonas syringae and effect on function of rulAB-mediated UV radiation
tolerance Appl Environ Microbial 66: 5167-5 1 73 .

Szekeres Jr. ES, Woodgate R & Lawrence CW (1996) Substitution of mucAB or rumAB
for umuDC alters the frequencies of the two classes of mutations induced by a site-
specific T-T cyclobutane dimmer and the efficiency of translesion DNA synthesis. J
Bacteria] 178: 2559-2563.

Witkin EM (1976) Ultraviolet mutagenesis and inducible DNA repair in Eschericia cali.
Microbial Mo] Biol Rev 40: 869-907.

Woodgate R & Sedgwick SG (1992) Mutagenesis induced by bacterial UmuDC proteins
and their plasmid homologues. Mal Microbial 6: 2213-2218.

Venisse J S, Malnoy M, Faize M, Paulin JP & Brisset M N (2002) Modulation of defense
responses of Malus spp. during compatible and incompatible interactions with Erwinia
amylovora. Mol Plant Microbe Interact 15: 1204-1212.

Yasui A & Chevallier M-R (1983) Cloning of photoreactivation repair gene and excision
repair gene of the yeast Saccharamyces cerevisiae. Curr Genet 7: 191-194.

Zhang S & Sundin GW (2004) Mutagenic DNA repair potential in Pseudomonas spp. and

characterization of the rulAch operon from the highly mutable strain Pseudomonas
cichorii 302959. Can J Microbial. 50: 29-39.

63

Appendix

 

 

 

 

 

 

 

A 1012 B
A 1:?)
£0 \
a :3.
V :9.
3.!
g E
o
8 2
.— .g
2;; 53’
m 102 __
o
10 I I l l l 100 T T T T 1
0 l 2 3 4 0 2 4 6 8 10
Time (Days) Time (Days)

 

 

 

 

Figure A.l. Virulence assays in immature pears and apple seedlings. Erwinia amylovora
Ea1189 (closed squares) was compared to the mutant strain Erwinia amylovora GSl
(open squares) and the waaL complement E. amylovora GS 1/pMCB3 (triangles) in (A)
immature pears and (B) apple seedlings. A representative of the two experimental
replicates is shown for the apple seedling assay, while an average of the two experiment
experimental replicates are shown for the pear assay. Each data point is shown with
standard error unless the error bars could not be visualized on the graph due to the size of
the symbol in which case they were removed for clarity.

64

200nm .. 7; “ : 100nm

 

‘4 i 5..

50 um

i J um ': ‘uu, : '1" » "29“.". i
E .
200 um 50 nm

Figure A.2. Transmission electron microscopy images of Erwinia amylovora E31189, E.
amylovora GSl, E. amylovora GSl/pMCB3, Pseudomonas aeruginasa PAOl , and P.
aeruginasa PAOl waaL::ISphaA/hah. Colurnnl represents the longitudinal view of the cell,
column 2 represents the vertical view, and column three is a close up of the outer membrane.
Bacteria observed include E. amylovora E31189 (A), E. amylovora GSl (B), E. amylovora
GSl/pMCB3 (C), Pseudomonas aeruginasa PAOl (D), and P. aeruginasa PAOl
waaL::ISphaA/hah (E).

 

65

 

 

Mean of three Mean of three

Mutant ID measurements Mutant ID measurements
MT1 C9 -61.3 (31.8) MT23 E9 -19.2 (18.2)
MT1 G6 -50.6 (27.3) MT25 D10 -15.9 (43.2)
MT3 GQ +470.2 (265.2) MT25 F12 -91.5 (17.4)
MT3 H7 +540.4 (447.4) MT25 G9 -60.3 (8.0)
MT3 H11 +4281 (373.8) MT29 C3 -54.5 (31.1)
MT5 G7 +2223.6 (1328.4) MT32 C3 +101.5 (121.1)
MT6 A3 +147.5 (107.7) MT34 H4 -36.4 (28.9)
MT6 BS +57.7 (113.8) MT36 59 -30.7 (30.9)
MT7 F12 +933 (121.4) MT37 E2 -60.4 (34.1)
MT8 A3 -33.3 (7.5) MT37 H12 -26.8 (17.6)
MT9 F11 +170.5 (129.1) MT45 F1 +4887 (505.2)
MT9 H1 480 (27.6) MT45 F7 +3378 (397.1)
MT14 F4 -22.6 (24.5) MT46 F8 -18.0 (18.8)
MT14 G4 -27.8 (17.5) MT47 E8 -79.7 (45.4)
MT14 H10 -33.2 (30.5) MT49 GG -41.6 (19.0)
MT15 E7 -54.5 (29.1) MT50 CZ -56.7 (14.9)
MT16 E6 -26.6 (17.6) MT53 E8 -15.4 (12.8)
MT17 E3 -34.1 (22.0) MT55 D11 +1322 (125.2)
MT17 H6 +22.1 (39.8) MT56 A6 -8.6 (25.3)
MT19 H11 +591.1 (593.3) MT59 82 -17.6 (15.6)
MT21 C10 +316.9 (304.6) MT60 E11 +2.3 (59.1)
MT21 E12 +97.2 (37.0) MT60 G4 -61.1 (29.0)
MT23 E8 -18.2 (15.2) WT 0.0 (10.1)

 

Table A.1. Comparison of 45 mutants obtained from screening over 6,000 transposon
insertion mutants of E. amylovora Ea1189 for survival in 250 pM of hydrogen peroxide.
Means of the three experimental replicates are shown as a percent difference when
compared to E. amylovora Ea1189 with the standard error in parentheses. Positive
numbers denote a percent increase in survival compared to the WT strain, whereas
negative numbers denote a decrease in survival.

66

.3: Em
596356 .m no.“ >35: :omonSE 2: mo condom 02x83 come—o»: 05 E 938 $532: 05 now £sz oozescom .N.< Saab

 

 

OZ: 38.39% :ouoeoom E 059C. 3:5 SQSEEVS SEEM c 5% nmv S E. amen
oz: 388% 8:888 E 2:9 53m carcasses SEEM o :e 5. S 3 35m
8 515m 522m 308.8%: Sim carcasses 552m film 4: SN R R .52
:37. 528m coast: :00 ath SSSSSnS SSEM mode new 36 me we wmmm
2B3 seaweed. 3830 35m E§§s§ 552m o 42: c8 8 S 8%
2a... manage. Seesaw E 85m assuage 552m Sam. 5 SN 3 9 89.

09C. .3085 289:2 mo 5.5858...“ ooSSm
Sam Basra Seesaw 8:5 «assesses ssz 872 a? 5 3 mm was.

5 09¢. o5 wSm: mourn—om no.“ £29m toaxm
5 38 seem 330.8%: 3 8 a. Sesame samaewsa. no. new SN 3. a E?
omSEmG oExeBasm no: 98 amoeawcaz anm SESEEMS SSEM 3 TB 5.. non ma mm mmhm
233 announced. Smooth—O 32mm SESSEaS SSEM c 33 OS no em amen
£2-5sz seen 5852:: 35m: .9 885E: $78 5m 8m 2 mm ES
N SEE 98.285. .5830 assess 32m $8333 safe 5-3 Sm 8m 8 4w So:
883E 522a Ecoaofim seem assesses ssz 3-3 a? «mm S 2 mm:
omo3I<hm S085 .8558»: ath SESSSnS SEEM 3.0a 0.3 mm. mm mm mm?
oaaeaosm m: :8 .m 83 4mm 8m 8 8 E:

£8on 85 338m omflwoza omega—
zfia canoes; 389:0 2695 Sam aaanessa 552m 87% m? mam mm E 2%
use... 3%: avian Oceanus... < 2;: 33m neeaesas 553m Er: e8 4:. a a wee
o>coor<hm 588m 33852:: ath SESSEuS SSEM E To. 3% GEL :. mm m<o
$88 seem .8353»: aéaoe can 33:52» SSS. 8-0m 2m 3 3 am 5m
m2: ...ae.aaw 8:33 E 25 83m massages 5525 Sam EN QR S 8 EM
oz: manage 8:58 E 25 Sim assesses asEm o «S New a 5 son
was aegis <zei§ei ca seséensasfiefi See an we. 8 me S:
0:32 0:00 6&5qu o:_e>-m Boom 5&2 Eo< 358m >552 oEaZ

“mm

SEE

“coupon

Beach 3832

 

67

 

Bacterial Species and

Percent Survival

 

Strains 3 min 10 min 15 min 20 min

”0313‘; dada’m' 94.8 (7.7) 87.5 (3.1) 78.3 (1.7) 76.7 (6.2)
Pantoea agglomerans

NCPPB 2971 90.2 (1.6) 85.9 (4.1) 80.4 (5.0) 67.2 (10.3)
Psegggmonas Synngae 91.3 (5.3) 72.5 (1.0) 58.3 (0.8) 53.8 (5.9)
Erwinia pyrifoliae

1/96 90.3 (4.2) 71.1 (9.4) 51.4 (24.2) 42.1 (20.5)
Erwinia sp.

EJP556 90.0 (1.1) 57.2 (10.1) 56.8 (13.2) 26.5 (2.5)
Erwinia am ylovora

Ea1189 68.3 (4.0) 47.2 (6.4) 29.5 (4.7) 21.3 (3.0)
Eschericia coli

SY2 15.0 (1.9) 14.0 (4.6) 13.6 (5.9) 8.7 (4.4)
Xanthamanas campestris

pv.phaseoli 5.7 (2.3) 2.2 (1.3) 2.7 (2.5) 2.8 (2.6)
Erwinia tracheiphila

NCPPB 2452 9.8 (3.2) 5.8 (2.9) 1.9 (1.7) 1.2 (1.0)
Shewanella ”ne‘dens‘s 0.4 (0.4) 0.5 (0.5) 0.1 (0.1) 0.0 (0.0)

MR-l

 

Table A.3. Comparative survival of different Gram-negative bacteria after exposure to
250 MM H202. All results shown as a mean of three replicates and with standard error in

parentheses.

68

   

"'Wl’iifixiflfiufifligl‘xgfinfififlflffiifliflflmflfiflflfifs