Ema”:
, 1....
h.
. .m a?

4 we.
1,.

4. ..
i... EBLT,
(-er ul’a ,

W.

«Wu MW . .2
in. 7. .Nfl.

1... .1...

 

 

 

 

 

 

 

 

kw.
awn
. ..V
k

or

3

,
‘
can... ‘

«risk.

3......

u:-
J—X" v ,
1W .
v a 1".
aha-MN I! t." ..

...

I!!!
3I$xvg ‘3 ‘2‘]
a?

find“...

"HF
1,3510} ~
.i k. :s.

.u I I

 

LIBRARY
Michip» ' State

Uni ~+u

VIVIUJ

 

 

~l..-' , " m’m':'

This is to certify that the
dissertation entitled

ACQUISITION AND TRANSFER OF SULFUR BY THE MODEL
ARBUSCULAR MYCORRHIZAL FUNGUS GLOMUS
INTRARADICES

presented by

James William Baker Allen

has been accepted towards fulfillment
of the requirements for the

Doctoral degree in Plant Biplgqy

 

 

Y LAM

Major Prof FEW 5 Signature
£260 (1

Date

 

 

MSU is an Affirmative Action/Equal Opportunity Employer

 

 

—.—.-.-.-»-.---.-----.-.-.—.--—-.-—-—

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K‘/Prolecc&Pres/ClRC/DaleDuevindd

ACQUISITION AND TRANSFER OF SULFUR BY THE MODEL ARBUSCULAR
MYCORRHIZAL FUNGUS GLOM US IN T RARADICES

By

James William Baker Allen

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for a degree of
DOCTOR OF PHILOSOPHY
Plant Biology

2009

ABSTRACT

ACQUISITION AND TRANSFER OF SULFUR BY THE MODEL ARBUSCULAR
MYCORRHIZAL FUNGUS GLOM US IN T RARADICES

By

James William Baker Allen

The amount of sulfur (S) in the environment is radically changing. Anthropogenic
pollution has increased the annual worldwide terrestrial deposition of sulfur by more than
300 fold in the last 150 years. In recent decades, however, the legislated removal of S at
the source has diminished S deposition by more than 6 fold in many areas of the United
States, leading to increased reports of S deficiencies in crops. Technology in this area
continues to simplify the process of source removal with the goal of achieving pre-
industrial levels. Additionally, sulfate, the main form of S assimilated by plants, is highly
mobile in soils and can leach into the water system at a rate equal to its addition to the
soil surface depending on water addition. In response to these environmental changes, in
recent years interest in plant S acquisition and assimilation has surged.

The arbuscular mycorrhizal (AM) fungal symbiosis has co-evolved with plants
since their transition to terrestrial environments, and AM fungi are now known to
associate with an overwhelming majority of land plants. The primary role of the
symbiosis is to enhance the acquisition of nutrients in support of plant growth and
homeostasis. Although the transfer of P, and, to a lesser extent, N, have been thoroughly
analyzed, S acquisition by endo-mycorrhizal symbioses is a neglected area of research
with oficn contradictory results. The availability of a monoxenic culture system and

development of a model organism for mycorrhizal research, Glomus intraradices,

including a worldwide effort to sequence and annotate the genome, has opened the
possibility to more definitively analyze S in relation to an AM fungal symbiosis. The goal
of this thesis was to quantify and analyze the transfer of S in relation to plant demand, as
well as pioneer research in the study of the regulation of S assimilation in AMF. This
work complements the ultimate goal of mycorrhizal research: the use of AM fungi as a
viable replacement for chemical fertilization in agriculture.

The model AMF Glomus intraradices transferred physiologically significant
amounts of oxidized and reduced S forms to host roots, suggesting that S acquisition is a
likely role of this fungus in natural ecosystems. The assimilation of sulfate by the
symbiotic fungus was less regulated by reduced S sources than was the transfer to the
host roots. Additionally, the simultaneous assimilation of sulfate and met or cys by pre-
syrnbiotic mycelium is novel among studied fungi, whose sulfate assimilatory pathways
are often completely diminished in response to reduced S sources. The regulation of
sulfate acquisition, reduction, and assimilation was found to be greatly effected by
ammonia assimilation and intracellular GSH concentration, and, unlike other fungi, less
effected by reduced S forms cys and met. During germination, the addition of met led to
very similar gene expression patterns compared to the addition of GSH, which did not
correlate with uptake data. In general, changes in gene expression were not reflective of
changes in S uptake with the exception of the down-regulation of a putative high affinity
sulfate permease by cys addition in both the symbiotic and pre-symbiotic tissue. Unlike
other fungi studied, transcriptional regulation does not appear to be the primary point of

control for S acquisition by germinating spores of G. intraradices.

Copyfightby
JAMES WILLIAM BAKER ALLEN

2009

ACKNOWLEDGEMENTS

I would like to thank the members of my committee, John Ohlrogge, Frances
Trail, and Raymond Hammerschmidt, for their role in making graduate school a pleasant
learning experience.

I would especially like to acknowledge the patience and support I received from
my graduate advisor, Yair Shachar-Hill, who supported me after the failure of my first
project and I would like to thank him for believing in my abilities even when I didn’t. He
showed a great deal of compassion on a daily basis, not only to me, but to everyone who
worked in his lab. He truly shaped my understanding and approach to science, and I
couldn’t have hoped for a better advisor.

I would also like to thank past and current members of Dr. Shachar-Hill’s lab who
had an impact on my research including Heike Biicking, Doug Allen, Igor Libourel, and
Eva Collakova for teaching, supporting, teasing, listening, and aggravating me. I’m a
better scientist for having known them.

I’ve also had the pleasure of working alongside my wife, Inga Krassovskaya, for
several years. She has helped me succeed in many ways besides occasionally lending me
her expertise. Without her patient ear, her love and support I certainly would not have
succeeded in this endeavor.

Finally I would like to thank my parents and my sisters for not bugging me about
graduating and taking this whole thing seriously. My parents deserve special thanks for
letting me move back in for a couple of years at the start of graduate school, and for

giving us a place to vacation for free.

TABLE OF CONTENTS

ListofFigures.............,_.... ._

Chapter 1

..,ix

Introduction an Literature Review--- .. .. ,. .. . . ,. ,. ..

Introduction.--
Life cycle
Morphology and phylogeny

Plant benefits from AM symbioses--. . .. ..
Drought tolerance and disease reS1stance
Phosphorus acquisition-.-

Nitrogen and sulfur acquisition. - . . . ..
Sulfate assimilation in plants. .. .. .. .. ._ .
Sulfate uptake and reduction..-...-.-....... _. ._ _ . ., .. . ..
Synthesis ofcysteine._,.....-.....-.-...._. ., ., ,, . _. .
Transcriptional regulation--. _ .. .. _. .. .. .. . . _

Sulfur in agriculture.-. . . _
The role of microorgarusms in plant S nutntron

Fungal sulfate a331m11atlon- ,. .. .. ., _. . .
Saccharomyces cerevisiae. ,. .. .. .. .
Aspergillus nidulans......-. .... .. . ,. . .. . . _ .....-
Neurospora crassa..-....,..__...,..,..,.... .. ., .. .. - . ..

Conclusions and rational.........- .. .. . . , . .. . . ,

References _. .. ._ .. __ .. ., ._ ._ .. .. _

Chapter 2

Sulfur Transfer through an Arbuscular Mycorrhiza
Abstract... .
Introduction ._
Experimental procedures

Chemicals and reagents .. .
....-.55

Growth media . .. .. .. ..
Growth of roots and mycorrhrzas
Collection of roots and ERM...

Extraction procedure............................_.._.. ., .... .. . . . ., .. .. ..

. .56
_.. 57
....58

35 . .
Measurements of S in medta...-...-.... .. .. .. , ., ,. .,

Non-mycorrhizal root measurements
Addition of S metabolic regulators

RNA extraction and putative gene fragment lSOlElthIl- .. .. . ., ,. .. ,. .
59

, 62
,. ...62

Quantitative real time PCR measurements.

Result. .................................................................................................................................................... .i “ “
Growth and sulfate uptake by 11011 mYcorrhizal roots . .. , . .

vi

O\OOO\JO\O\J>UJ-N'—'

WWNNNr—‘r—Ip—Ar—dI—I
NOOOQOOOOHONUI

. .....48
53

53

55

59

Fungal uptake and transfer of sulfate is influenced by root access to
sulfate ............................................................................................................................................................... . ........................... 65
Fungal transfer of S to the mycorrhizal roots versus direct uptake by
roots ................................................................................................................................................................................................ 70
The effect of sulfur metabolites on sulfate uptake and transfer through the
mycorrhizal symbiosis ............................................................................................................................... . ............. 78
Fungal uptake and transfer to host roots ofreduced S .. .. .. . .. ., .. ...81
Gene expression measurements-.........-..-.-..-...... ._ ,. .. ,. . 81
Drscussron ._ . . .. .. , .84
References-.--.-. _ .. .. .. _ . , 90

Chapter 3
Uptake and Assimilation of S during Presymbiotic Growth of an Arbuscular Mycorrhizal
Fungus -- -m.--.-m-H.HH-m--.c-...----.-c-.--M---w H. ,,-..H- W.M96
Abstract . . ... ...... ..97
Introduction .. ., . .98
Expenmental procedure .. . .. .... .. ,, . ,. .. .. 102
Tissue culturing ., .. - .. .. ,, .. ...--102
Extraction and fracttonatron procedure .. .. .. .. .. .. . . . . ___...-_...103
Sample preparation for gene expression analysis. .. _. .. .. ,, .. ..---105
Real time quantitative PCR measurements .. ...-..-...107
Results ...................................................................................................................................................................... - . ......................... 109
Import and assimilation of sulfate by germinating spores and its regulation
by S metabolites. - 109
Uptake and assimilation ofS from cysteme .. ., .. V 113
Simultaneous uptake of sulfate and reduced S spec1es . ... 113
The expression of putative S metabolism and transport genes . . , .. - .. 107
Discussion-.... --..-.....-._ ...-... .... .. .... .. .. , ,. ,. ...._...._.121
References.....---...-....., . .. .. . .. - .. 129

Chapter4
The Relationship between N and S Assimilation in Germinating Spores of Glomus
intraradices- . .. . . . .. . - - ., . . , .. 136
Abstract .. _ . . .137
Introduction ,, . ,. .. .. ... .139
Experimental procedure . . . . . .. . . . , . _ . . .142
Amino acid quantlficatlon. .. ,. .. , . . . , .. -142

3:8- labeling experiments. - . _ .. .. .,. , . . , . . 143

15N-labeling experiments . . .. .. .. .. .-.--144

RNA extraction and gene expression measurements _ ,. .. . .. ., ...-......145
Results .......................................................................................................................................................... ................ . ....... 147
Free amino acid concentrations during germination .. .. _. .. .. ... 147

The effects of N sources on free amino acid concentrations . V . .,. . ...-154

The effects of N sources on sulfate uptake and assimilation..- ... .. ._. .. ...-.156

vii

Interactions between sulfate and nitrogen assimilation pathways. ... .. ....160
Glutathione addition in relation to sulfate assimilation and free amino acid
concentrations _ 161
Changes in gene expression of putative sulfate asmmrlatron genes in
relation to nitrogen addition-......- .. . . . . . ...,....-169
Discussion..-.----... . .. .. .. _. . . - , . 171
References.........-. . .. . . .. 179

Chapter 5
Conclusions and Future Research-......--..--.. . , . .. . , _ -..-....183
Introduction. . ., .. ._ . . . ., . . . .. ., , . ......... 184
AMP and plant S nutrltron . ..... .. . _ - ,. , 185
Uptake and assimilation ofS by AMF . _ . - .. . . . 188
Future research _. . .. . . .. . . .. . . 191
References--....-.-... . .. , , ,_.. . . .. . 194

viii

LIST OF FIGURES

Fig. 1-1. Model ofsulfate assimilation in plant cells..- . - . . - . .. . . . 12
Fig. 1-2. Model ofsulfate assimilation in fungi. . . . , .. . .. . . . . . . .21

Fig. 2-1. The effect of sulfate concentration on the growth and sulfur incorporation of
non-mycorrhizal transformed carrot roots .. _. . .. .. .. - .. . . .. ...--63

Fig. 2-2. Increased sulfate availability in the root compartments of split plates reduces

transfer of S through the distal fungal ERM. 64
Fig. 2-3. Transfer of 358042- through the fungus versus direct root uptake. .. . . . . . ..67
Fig. 2-4. The effect of common sulfur metabolite repressors cysteine, methionine, and
glutathione on the transfer and allocation of 358 in an arbuscular mycorrhiza .. .. . ...--72
Fig. 2-5. Transfer ofreduced S through a mycorrhizal symbiosis. . .. .. .. . ._ 80
Fig. 2-6. Fungal gene expression changes in response to the addition of 1 mM cysteine to
ERM .................................................... ._ ........................................................................ . ..... _ ................... _ ................................ . ........... 83
Fig. 2-7. Model depicting S transfer through an endomycorrhizal symbiosis ...... . .,._ . 88

Fig. 3-1. Three hour uptake and incorporation of radio-labeled sulfate by germinating
spores ........................................................ . ................................................................ . ................ . ............................................... . ..................... 111

Fig. 3-2. Radio-labeled sulfate uptake over time with the addition of sulfirr metabolites
........................................................................................................ 112

Fig 3-3. Combined uptake of sulfate and reduced S species cys and met . . . . . 115

Fig. 3-4. [3SS]Cysteine uptake and utilization in the presence of common sulfur
metabohtes .. .. _.--....119

Fig. 3-5. Real-time PCR analysis of changes in sulfur assimilation pathway gene
expression in response to sulfur metabolites- .. . .. ,_ . .. , .. . .. .. .. --.-120
Fig. 4-1. Time course of free amino acid concentration in germinating spores of Glomus

intraradices--.-.- ., .. .... . . .148

Fig. 4-2. Free amino acid concentrations in the presence of exogenous N sources. .. . ...-150

Fig. 4-3. Influence of N sources on 355042- uptake, reduction, and allocation , . . 155

Fig. 4-4. Effect of SO42- (A) and S metabolites (B) on 15N-labeling of free amino acids
.. ....... 157

Fig. 4-5. 35S-sulfate uptake, reduction, and allocation in the presence of ammonia and S
metabol1tes .. -..._., .. .. .. ,. 163

Fig. 4- 6. Effects of ammonia and glutathione (GSH) on [3 5S]Cysteine uptake and
utilization.- .. .. .. ._ ..- 164

Fig 4-7. Change in amino acid concentrations from glutathione addition. . . V 165

Fig. 4-8. Transcriptional changes of putative sulfur assimilation pathway genes afier
+
NH; addrtlon .. . 167

Fig 4-9. Working model of the regulation of sulfate assimilation in germinating spores of
Glomus intraradices..-._---... ., . .. . _. . . , . ............ 177

Chapter 1
Introduction and Literature Review

Sulfate Assimilation in Plants and Fungi

Introduction

Associations with symbiotic fungi, which facilitate the collection of nutrients
easily accessible to aquatic but not soil borne roots, may have made possible the
transition of plants from aquatic to terrestrial environments. Independent estimations
place the time which plants first colonized land at approximately 500 or 800 million years
ago (Wellman et al., 2003; Sanderson, 2003) while estimates of 600 to 1400 million
years ago have been made for the divergence of the order Glomeromycota encompassing
the arbuscular mycorrhizal fungi (AMF; Redecker et al., 2000; Heckman el al., 2001).
Aside from vascular plants, the symbiosis also occurs between AMP and bryophytes,
even cyanobacteria, suggesting that the symbiosis may have developed before plant roots
(Read et al., 2000; James et al., 2006). In any case, the symbiosis is proven to have at
least existed for the last 400 million years based on fossil evidence from the Rhynie chert
in Scotland (Dotzler et al. 2009) and continues to be the dominant symbiosis on the
planet (for a thorough review see Smith & Read, 2008).

In the United States, the active removal of sulfur (S) from coal and oil has
dramatically decreased the rate of anthropogenic S environmental emissions for the last
three decades (Baumgardner et al., 2002; Lefohn et al., 1999). This change has sparked
numerous studies on plant S nutrition, especially as crops begin to display signs of S
deficiency. Although the AM symbiosis is now accepted as a positive, sometimes
definitive, contributor to phosphorus (P) and nitrogen (N) nutrition in plants, their

contribution to S nutrition is still not characterized, which is the focus of this thesis.

Life Cycle

Arbuscular mycorrhizal fungi (AMF) are obligate, asexual plant symbionts
involved in plant nutrient acquisition which fimction and complete their life cycles using
photosynthetic carbohydrate (for a review, see Smith & Read, 2008). Initially, spores
germinate producing germ tubes which explore the soil for a symbiotic partner. If
unsuccessfirl, growth of the germ tube is arrested by an unknown programmed
mechanism, and the cytosol retreats into the spore in preparation for re-germination (Logi
et al., 1998). Signals released by roots, specifically strigolactones, increase germ tube
metabolism and grth (Akiyama et al., 2005). This is followed by the development of
an appresorial structure and the initiation of symbiosis at the root surface (Besserer et al.,
2008). Once the symbiosis is established, hyphae proliferate both intra- and extra-
radically, forming two distinct metabolic environments (Shachar-Hill et al., 1995)
specialized in either the acquisition and radical distribution of photosynthetically-derived
carbon substrates, or in hyphal growth through the soil matrix, acquisition, and transfer of
nutrients to the plant (Smith & Read, 2008). Intra-radical mycelium (IRM) and extra-
radical mycelium (ERM) can be equal in mass; however the IRM only occupies
approximately 2% of symbiotic roots (Olsson & Johansen, 2000). Mechanism(s)
triggering sporulation are not characterized, but appear to be connected to root
senescence. Sporulation involves a massive transfer of storage lipids, proteins, and a
large number of nuclei, hundreds to several thousands (Hosny et al. , 1998), into
developing spores. After approximately three months of growth, 90% of the ERM mass is

in the form of these large multinucleate spores (Olsson & Johansen, 2000).

The life cycle of AMF revolves around the conversion of plant photosynthate to
triacylglycerols, which are the main nutritional form of carbon required for growth,
sporulation, and germination. Glucose is imported from roots by IRM and converted to
trehalose and glycogen, then to triacyl glycerides, the main storage form of C in AMF
(ShacharHill et al., 1995; Pfeffer et al., 1999; Nagy et al., 1980). Lipid bodies transport C
from the IRM to the ERM and are utilized for mycelial growth and homeostasis through
interconversions by the glyoxylate and gluconeogenic pathways (Bago et al., 2002;
Pfeffer et al., 1999; Lammers et al., 2001). ERM tissue is incapable of hexose uptake and
is completely dependent on this transfer (Pfeffer et al., 1999). In G. intraradz'ces, the
volume occupied by lipid bodies decreases from approximately 24% to 0.5% from host
root to hyphal tip due to consumption along that length (Bago, 2000). Germinating spores
and ERM can elongate and desaturate 16C fatty acids, but their synthesis is exclusive to
IRM tissue (Trepanier et al., 2005; Pfeffer et al., 1999). The compartrnentalization of
fatty acid synthesis is a possible reason for the obligate nature of the symbiosis. Spores of
G. intarardices are 20% neutral lipid by mass, 80% of which are 16C triacyl-glycerides
(Olsson & J ohansen, 2000), demonstrating the importance of this function for the

completion of the fungal life cycle.

Morphology and Phylogeny

Gallaud (1905) was first to categorize the distinct structural classes of
mycorrhizal fungi, which he termed the Arum, Paris, hepatic, and orchid types. Arum-
and Paris-type endomycorrhiza predominate, and are characterized by the path of hyphal

growth and morphology of absoption structures. Paris-type mycorrhizae develop entirely

intracellularly with irregularly coiled hyphae which form non-terminal coiled arbusculate
structures. The endomycorrhizal fungus Glomus intraradices is an example of an Arum-
type mycorrhizal fungus, which proliferates through intercellular air spaces and form
tree-like, terminal arbuscules. These arbuscules envaginate root cortical cells, forming a
periplastic space between the root cell and arbuscular membranes that is generally
accepted as the site of nutrient transfer between the fungus and plant (Bago, 2000;
vanAarle et al., 2005). This is unlike Paris-type mycorrhizal interactions, where transfer
of nutrients occurs at both the arbuscule and IRM (vanAarle et al., 2005). While still
unclear, the availability of intercellular air spaces may influence the dominant arbuscular
mycorrhizal type (Dickson et al., 2007). Surveys of plant/mycorrhizal interactions
demonstrate that Arum-type fungi are mainly in symbiosis with fast-growing, high light
plants, while Paris-type fungi are associated with slower growing low light or woody
plants, possibly due to the presence of air spaces (Brundrett et al, 1990). A clear
characterization of these types of AMF, however, is compromised by difficulties in
discriminating between the structures, and therefore by possible misidentifications
(Dickson, 2004).

Phylogenetic analyses of 28S rRNA, the large subunit of RNA polymerase II, 18S
rRNA, and B-tubulin gene sequences (DaSilva et al., 2006; Redecker & Raab, 2006;
Shussler et al., 2001; Msiska & Morton, 2009) currently place arbuscular mycorrhizal
fungi (AMF) into ten families in the phylum Glomeromycota, order Glomerales,
Gigasporaceae, Glomaceae, Acaulosporaceae, Diversispora, Paraglomaceae,
Geosiphoaceae, Ambisporaceae, Entrophosphosporaceae and Arcaesporaceae. Within

the phylum, Glomus is the largest genus, with more than 70 species characterized by

spores which bud from hyphal tips and germinate through the subtending hypha
(Redecker & Raab, 2006). Lineages of Glomus are ubiquitous and often dominate AM
fimgal communities (Opik et al., 2003), and several of them, chiefly Glomus
intraradices, are commonly studied in laboratory settings (Smith & Read, 2008). This is
the species whose genome is being sequenced (Martin et al., 2008) and is the subject of

the work presented here.

Plant benefits from AM symbioses

The main benefit of endomycorrhizal associations with plant roots is considered
to be the improved inorganic nutrient acquisition. This is a consequence of the fungal
extra-radical hyphae increasing the range of the rhizosphere, the surface area available
for absorption of nutrients, and the ability to access micro-environments in soil normally
unavailable to roots (Allen & Allen, 1990). However, arbuscular mycorrhizal fungal
(ANIF) symbioses also result in other ecologically significant benefits, including

enhancement of drought tolerance and resistance to pathogenic fungal infection.

Drought Tolerance and Pathogen Resistance

As global climate change adjusts weather patterns, periods of drought are
increasing in many areas of the world (Shein et al., 2005) and represent a major abiotic
cause of growth, fecundity, and yield limitations (Boyer, 1996). Mycorrhizal colonization
has been shown to alleviate water stress (For a review see Ruiz-Lozano, 2003), possibly

because hyphae radiating into the soil bridge air gaps that normally impede bulk water

flow (Allen, 2007). Colonization with Glomus intraradices or Gigaspora margarita
increases stomatal conductance and drought tolerance in sorghum (Sorghum bicolor) and
bean (Phaseolus vulgaris) plants independent of P nutrition (Cho et al., 2006; Auge et al.,
2004a;2004b)

Nutrient deficiency itself is an abiotic stress making plants more susceptible to
pathogenic infections (Amtrnarm et al., 2008), and AMF colonization enhances nutrient
uptake thus enhancing the plant defensive ability. However, the symbiosis is also known
to reduce pathogenic fimgal frequency independent of nutritional effects (Yao et al. ,
2002; Grandmaison et al., 1993). Colonization by AMF is linked to the accumulation of
specific phenolic compounds in the cell walls of Allium cepa roots which induce hyphal
branching and control AMF development in planta (Grandmaison et al., 1993). This
effect, as well as the general resistance to fungal enzymatic cell wall degradation by
phenolic compound deposition in root cell walls, provides a possible mechanism for the
observed enhancement of the plant defense against invading fungi (Morandi et al., 1996;

Yao et al., 2007).

Phosphorus Aquisition

Adsorption of phosphate is positively correlated with the concentration of A1, Mn,
and Fe ions associated with clay particles (Lair et al., 2009), and is the least mobile plant
macronutrient in the soil (Gahoonia & Nielsen, 1991; Hinsinger, 2001 ). The
endomycorrhizal symbiosis is postulated to have developed in response to the challenge
plants faced with P nutrition during their transition from aquatic to terrestrial life

(Karandashov & Bucher, 2005) based on the immobility of phosphate in terrestrial

environments as well as the clear benefits to plant P nutrition that the symbiosis confers
(Hayrnan & Mosse,~1971; Bolan, 1991). The enhancement of P nutrition is therefore
widely considered to be the major function of the endomycorrhizal symbiosis.
Polyphosphates are synthesized and appear to be transported to the root depending on the
availability of C for the fungus (Solaiman et al., 1999; Biicking & Shachar-Hill, 2005),
and root phosphate transporters have been shown to be specifically induced in several
plant species by the mycorrhizal symbiosis (J avot et al., 2007; Gomez et al., 2009, Grace
et al., 2009; Nagy et al., 2009; Glassop et al., 2005). Recent evidence also exists which
shows a connection between N and P nutrition, specifically that N fertilization may
reduce colonization when P is non-limiting (Blanke et al., 2005). The relationship
between P and other nutrient transfer has been little studied and may be an important

aspect of the function of endomycorrhizal symbioses.

Nitrogen and Sulfur Aquisition

To date the majority of studies done on endomycorrhizal symbioses examine their
role in plant P nutrition (Smith & Read, 2008). However, recent evidence suggests that
the biologically significant transfer of other macro- and micro-nutrients by AMF also
takes place under natural conditions. While inorganic N is the preferred source for plant
uptake, the majority of N in soils is often in organic form and substantial quantities of N
can be transferred by AMF. Leigh and coworkers (2009) demonstrated that Glomus
intraradz'ces in association with Plantago lanceolata can transport enough N from labeled
plant material to account for 20% of total plant N. The same fungus has been shown to

increase the amount of N in mycorrhizal plants obtained from fertilizer by 38%, but only

under low N conditions (Azcon et al., 2008). Compared to N, very little research has
been done on S in relation to the endomycorrhizal symbiosis. Two studies showed little
effect of AM fungi on the translocation of S (Monison, 1962; Cooper & Tinker, 1978),
while two others found significant increases in S levels in the plant (Rhodes &

Gerdeman, 1978; Banjeree et. al., 1999). Most dramatically, Rhodes & Gerdemann

(1978) showed a 12 fold increase in the whole plant 35S content in onion plants due to

mycorrhizal transfer. Further research into the role of AMF in plant S nutrition is needed

to re-evaluate past research and accurately assess the importance of this transfer.

Sulfate assimilation in plants

Owing to its multiple oxidation states, S is linked in some way to most plant
cellular processes, including protein synthesis, redox balancing, transcriptional/post-
translational regulation, central metabolism through cofactors, and defense/ stress
responses (Droux, 2004; Rausch & Wachter, 2005; Leustek & Saito, 1999). The cysteine
component enables the efficient scavenging of oxidative metabolic byproducts by
glutathione, which has been conserved since the initiation of aerobic life (N octor et al.,
1998) and is necessary for the completion of the cell cycle in plants (May et al., 1998). In
a larger sense, the synthesis of cysteine and methionine by plants supports animal S
metabolism, making plant S aquisition and assimilation an indispensible aspect of
planetary animal life. The enzymatic pathway of S uptake, reduction, and assimilation, as

well as the allosteric/transcriptional regulation and the role of compartmentalization in

the synthesis of the branch point of plant S metabolism, cysteine, are important aspects to

the study of the role of mycorrhizal symbioses in plant S nutrition.

Sulfate uptake and reduction

Plant, fungal, and mammalian sulfate transporters share a common protein family
and significant conservation on the amino acid level (Smith et al., 1995; Vidmar et al.,
2000; Smith, 2003). S is imported by roots mostly as sulfate, moved around the plant
with a variety of specialized transporters, and stored in vacuolar sap prior to reduction in
the plastid (Ortiz-Lopez et al., 2000; Leustek & Saito, 1999). The conversion of sulfate
to sulfide is an energy intensive process requiring the equivalent of ten ATP (Hell & Jost,
1997). The initial activation step (Figure 1-1a), catalyzed by sulfate adenosyltransferase
(SAT), produces a high energy sulfur-phosphate acid anhydride bond through the
hydrolysis of pyrophosphate to form adenosyl-S’-phosphosulfate (APS; Phartiyal et al. ,
2006). Further phosphorylation, catalyzed by APS kinase (APSK), forms the molecule
3’-phosphoadenosyl-5’-phosphosulfate (PAPS). This molecule is utilized by plants solely
for direct sulfation reactions catalyzed by sulfotransferases, most notably producing
glucosinolates which give mustard its distinct taste (Vauclare et al., 2002). There is some
debate over the mechanism by which activated sulfate is reduced to sulfite (Leustek &
Saito, 1999). Based on sequence similarity with thioltransferases, it is likely that this
reaction, catalyzed by APS sulfotransferase (APSS; Bick & Leustek, 1998), transfers
sulfate to the cys moiety of glutathione (GSH) resulting in the spontaneous production of
sulfite(F i gure 1-1a). Free sulfite is further reduced through the enzyme sulfite reductase

(SIR) by oxidation of either light-generated ferredoxin (Takahashi et al, 1996) or

10

glutathione (Prior et al., 1999). Unlike other enzymes in the pathway which can have
upwards of five isoforms, there is only one known gene encoding SIR in A. thaliana, and
the localization of SIR to the plastid supports the exclusive reduction of sulfate in this

compartment (Bork, 1998).

11

Figure 1-1 Model of sulfate assimilation in plant cells. Sulfate is imported into plant cell
from the phloem and either sequestered in the vacuolar sap or transported into the plastid
for reduction to sulfide. (A) In the plastid, sulfate is attached to adenosine through Sulfate
Adenylyl Transferase (SAT) to form APS, which can be phosphorylated to PAPS by APS
Kinase (APSK), or transfer the sulfate group to the cysteine moiety of glutathione through
APS Sulfotransferase (APSS). PAPS production fuels direct sulfation reactions through a
variety of SulfoTransferase enzymes. Sulfoglutathione reacts spontaneously with reduces
glutathione to form oxidized glutathione and free sulfite, which is reduced by Sulfite
Reductase (SIR) to sulfide. (B) O-acetylserine (OAS) is synthesized exclusively in the
mitochondria by the cysteine synthase complex (CSC'). Sulfide and OAS are transported
to the cytosol by a specific transporter (open circle), where free OAS Thiol-Lyase (OAS—
T L) enzyme catalyzes their condensation to form acetate and cysteine.

12

Figure 1-1

ATP PM
o-

. f’ NH2
°=I=° SAT N/ N
°' 0 o k >
11 \N N

SULFATE ll
°'-fi-0-l|’-O-CH2
o

 

o-
PLAS TID ADENYLYL- H H
SULFATE (APS) OH OH

O'-S- O- “I? O—CH2

r r :3 >/%)C

O O'
H H
PHOSPH- _ _ _
ADENYLYL- 0 OH GS :SI 0
SULFATE (PAPS) O= P-o' SULFO- O
I - GLUTATHIONE
0
cl)- GSH
82. SIR 0:? GSSH
o-
SULHDE SULFITE
6FD(RED)

6FD(OX)

13

Figure 1-1 (cont’d)

3/ i.’ \

 

 

 

 

CoA-O-C-CH3
ACETYL-CoA coA'SH
o- 1:11-11,+ q
(:30 O=C-(I3-l --C O- -C-CH3
H H2
0' NH2+ O-ACETYLSERINE
o=c-c::- c- 0H (“3’
H H2
k MITOCHONDRIA
SERINE
CYTOSOL
r 11
o=c—<l:- c--o- -C-CH3
H H2
O-ACETYLSERINE
?' sz" (OAS)
O‘C‘?"?'SH OAS-Tl.
H H2
CYSTEINE o 52.

Chg-CH3 SULFIDE
ACETATE

Synthesis of cysteine

Cysteine synthesis is the sole entry point of reduced S into plant central
metabolism (Wirtz & Hell, 2006), and the allosteric regulation of its production differs
significantly with fungi. The enzyme serine acetyltransferase (SERAT), catalyzing the
formation of the C/N precursor molecule for cys synthesis, O-acetylserine (OAS), and O-
acetylserine thiol lyase (OAS-TL), catalyzing the condensation of OAS and free sulfide
to produce cys, together form a cysteine synthase complex (CSC; Droux, 2004).
Specifically, one SERAT hexamer binds to the catalytic sites of two OAS-TL dimers to
form the CSC (F eldman-Salit et al., 2009), which consequently only catalyzes the
formation of OAS (Wirtz and Hell, 2006; Figure l-lb). Only free OAS-TL produces cys,
but normally exhibits a 100-345 fold higher enzymatic activity than SERAT (Wirtz &
Hell, 2006; Wirtz et al., 2001; Wirtz et al., 2004). The enzyme complex is dissociated by
OAS and stabilized by sulfide in vitro (Berkowitz et al., 2002). In vivo measurements in
A. thaliana leaf cells have demonstrated that the cytosolic OAS/sulfide ratio in is too low
under normal conditions to dissociate the CSC by at least ten fold (Krueger et al., 2009),
however, the allosteric regulation becomes important in the context of enzyme
compartmentalization. In A. thaliana, three SERAT and nine OAS—TL isoforms have
been localized to the cytosol, plastids, or mitochindria (Howarth et al., 2003; Watanabe et
al. 2008). Mutagenesis of SERAT isoforms have demonstrated a relative contribution of
mitochondrial/cytosolic/plastidic OAS production of 8/2/0 (Haas et al., 2008; Watanabe
et al., 2008). Likely due to its toxic effects on the respiratory electron transport chain
(Nicholls, 1975; Truong et al., 2006), sulfide is isolated from the mitochondria in A.

thaliana and thus cys synthesis primarily occurs in the cytosol (Kreuger et al., 2009).

15

Low sulfide and high OAS concentrations in the mitochondria allosterically control OAS
synthesis by dissociation of the CSC. The high OAS-TL/SERAT ratio in the cytosol

ensures cys synthesis, which is itself feed-back inhibited (Noji et al., 1998).

Transcriptional regulation

Transcriptional regulation of the sulfate assimilation pathway is reflective of the
toxicity of sulfite and sulfide to plant cells, controlling enzymatic steps prior to their
formation. The constitutive expression of SERAT and OAS-TL (Maruyama-Nakashita et
al., 2003; Wirtz & Hell, 2006) suggests that transcriptional regulation may not be
conducive to the homeostatic maintenance of cytosolic and plastidic sulfide
concentrations. This may explain the complicated allosteric regulation of the CSC.
Several analyses have revealed a significant down-regulation of only two principle
enzymes, SAT and APSS (Kopriva, 2006). Of these two genes, APSS is under greater
transcriptional control (V auclare et al., 2002), and is the only gene in the pathway up-
regulated by S deprivation (Maruyama-Nakashita et al., 2003). It remains controversial if
GSH or cys elicit transcriptional control of APSS (Vauclare et al., 2002; Lee et al.,
2005). Recently a trans-acting positive transcriptional regulator of sulfate assimilation
was discovered (SLIMI; Maruyarna-Nakashita et al., 2006). Although analogous to
fungal transcriptional factors MET4/CYS3/METR, previous evidence does not yet

support equally strict regulation of gene expression in plants.

16

Sulfur in agriculture

Intensive agricultural practices including tillage and phosphorus amendment,
coupled with research showing the soil solution phosphorus concentration-dependent
rejection of the AMF symbiosis by plant roots (Smith & Read, 2008), have led to the
believe that the symbiosis is nonexistent in these types of agricultural systems. However,
a recent survey of 90 agricultural sites in the Chinese Sichuan province revealed an
abundance of AMF biomass and species diversity (Wang et al., 2008), suggesting a
possible role for AMF in current agricultural practices. Examining the relationship
between plant S nutrition and endomycorrhizal symbioses is a necessary step in
evaluating the use of AMF in agriculture for this purpose.

Sharp increases of S deficiency over the past two decades, especially in Western
Europe, have made S nutrition an increasingly important topic in agricultural research.
Fossil fuel combustion for the production of electricity is responsible for 63% of the total
atmospheric sulfur dioxide emissions (Baumgardner et al., 2002; Lefohn et al., 1999).
The reduction in industrial S emissions from coal combustion has had a dramatic effect
on sulfur deposition. Additionally, changes in agricultural practices aimed at increasing
the efficiency of fertilizer application, which previously and perhaps unknowingly relied
on sulfirr deposition as a source of fertilizer, now contribute to the S deficiency problem
(Riley et. al., 2000). Many crop yields have doubled over the last thirty years, increasing
the demand on agricultural soils for all nutrients. Between 1974 and 1990, the amount of
N utilized worldwide has roughly doubled associated with an equal rise in yields

(Ceccotti, 1996). In comparison, S fertilization has remained the same or has decreased

17

due to the popular use of low-S fertilizers (i.e. urea) over S-containing fertilizers (i.e.
ammonium sulfate) (Riley et. al., 2000). Fertilization with N also leads to the activation
of amino acid synthesis, increasing the demand for S, which if unavailable may lead to
yield decreases on a regulatory level. Sulfur limitation in wheat results in a decrease in

grain size (Zhao et.al., 1999) while having little effect on vegetative growth.

The role of microorganisms in plant S nutrition

Soil adsorption of sulfate ions is negatively correlated with the soil pH, and
represents on average 2-5% of the total amount of S in the soil (Eriksen and Askegaard,
2000). At pH’s >6.5, it is virtually non-existent due to the neutralization of pH dependent
charges within the soil structure which otherwise bind anions, such as Al and Fe oxides
(Scherer, 2001). The application of other anions, such as phosphate, lowers the
adsorption and therefore increases the availability of sulfate to plants as well as to
leaching effects. One effect of regular fertilization with phosphate is the decrease of
sulfate in the soil by filling adsorption sites with phosphate anions, allowing sulfate ions
to mobilize into unreachable areas for plant roots. Sulfate is highly soluble in water at

normal pH ranges, resulting in efficient leaching from precipitation. The leaching of soil

on an organic farm in Denmark was found to be 20 kg S ha'1 (Eriksen and Askegaard,
2000). This is likely the reason why approximately 98% of S found in soils is in an
organically bound form (Scherer, 2001).

Microorganisms in the soil convert available sulfate to organic esters or carbon-

bonded S. In laboratory-grown firngal cultures, sulfate concentration is directly

l8

proportional to the synthesis of a common organic form of S, choline sulfate (Saggar et
al., 1981). Microbes re-mineralize organically bound sulfur when in need of carbon as an
energy supply. The amount of sulfate present in soils is therefore governed by the relative
rates of mineralization of organic S and the immobilization of free sulfate into organic

compounds, which are both mainly the result of microbial activity. An average 6 to 39 kg

S ha.1 of S is made available to plants in a variety of crop systems per year due to

mineralization (Scherer, 2001). By contrast, Kiihn and Weller (1977) conducted lysimeter
experiments on fields with or without S fertilization, and found that sulfate additions

simply leached out of the soil. It is likely that fertilization with sulfate fails to increase the
total amount of S in soil over time due to leaching, making mineralization of organic S by

soil microbes the most constant source of available S for plant nutrition.

Fungal sulfate assimilation

Compared with plants, fungi have similarities and differences in their uptake,
reduction, and assimilation of sulfate (Figure 1-2a), most notably in their use of 0-
acetylhomoserine or O-acetylserine, or both, as final sulfide acceptors. In general,
transcriptional regulation is coordinated among several assimilatory enzymes by a
positive bZIP transcription factor. However, the regulation of this factor differs
significantly between species, as does the allosteric regulation of the individual pathway
enzymes. Most research in this area is done using one of three fungal model systems:
Saccharomyces cerevisiae, Aspergillus nidulans, or Neurospora crassa. Aspects of S

assimilation will be discussed in detail with respect to each of these fungi.

19

Saccharomyces cerevisiae

The reduction of sulfate to sulfide in S. cerevisiae only differs in one aspect from
reduction by plants, although the two systems differ significantly in sulfide assimilation.
Sulfate is imported through single high or low affinity sulfate transporters (SUL1;SUL2)
and activated by attachment to the terminal phosphate group of ATP by the enzyme S-
adenosyl transferase (MET3) forming 5’-adenylylsulfate (APS). APS is further
phosphorylated by APS kinase (MET14) to 3’-phospho-5’-adenylylsulfate (PAPS). PAPS
is considered toxic to cells (Thomas & Surdin-Kerjan, 1997), which may explain why in
plants APS is further reduced to sulfide and PAPS is primarily used for direct sulfation.
In fungi, sulfate reduction takes place through PAPS (Figure 1-2a), and the toxicity is
likely countermanded by the action of a kinase which both returns PAPS to APS and is
necessary for the hydrolysis of PAP to AMP (Murguia et al. 1996). Also unlike plants, in
S. cerevisiae sulfide is assimilated by reaction with O-acetylhomoserine (OAH) through
the enzyme homocysteine synthase (MET25), not with O-acetylserine through cysteine
synthase (Figure 1-2b). Cysteine is then synthesized from homocysteine through the
intermediate molecule cystathionine by a pathway that is absent in plants (Ono et al. ,
1999), the reverse-transsulfuration or cystathionine pathway (CT pathway). In the CT
pathway, homocysteine reacts with serine to form cystathionine through the enzyme
cystathionine B-synthase (STR4). Cystathionine is then catabolized to a-ketobutyric acid,
ammonia, and cysteine by the enzyme cystathionine y-lyase (STRl). Homocysteine is
also directly converted to methionine by homocysteine methyl transferase (MET6),

making it the branch point of the pathway.

20

Figure 1-2 Model of sulfate assimilation in fungi. (A) Sulfate is imported by specialized
high and low affinity sulfate perrneases (SUL). Reduction to sulfide requires activation
through adenylation by sulfate adenyly transferase (SAT) and further phosphrylation of
the adenosyl moiety by adenyly phosphosulfate kinase (APSK). The sulfate moiety is
attached to a cys residue of the phosphoadenyly phosphosulfate reductase enzyme
(PAPSR) and reduced by two electrons. Sulfite is further reduced by thioredoxin and six
electrons to sulfide by sulfide reductase (SIR). (B) Sulfide can enter fungal metabolism at
cysteine synthase (CS) or O-acetylhomoserine thiol-lyase (OAH-T L), the latter requiring
an active reverse transsulfuration pathway for the conversion of homocysteine to cysteine
through cystathionine beta synthase (CBS), forming the intermediate cystathionine from
homocysteine and serine, and cystathionine gamma lyase (C GL), which splits
cystathionine to cysteine and homoserine.

Figure 1-2

 

 

A
ATP PPi
9' ,2 NH2
0:?” SAT N/ N
0‘ o o t >
SULFATE ll 11 N N
o--i°l.-o—1:>-o-c1-12
O 0"
ADENYLYL- H H
SULFATE (APS) OH OH
ATP
APSK
2..
s ADP
SULFIDE
1111-12
/ N
SIR 6TD(OX) |\ >
0 O \
11 11 N N
o--s-o-1=—o—CH2
6TD(RED) c") (I)_ o
H H
PHOSPH-
?' ADENYLYL- Cl) 0“
_ SULFATE (PAPS) _ -
0.3 #_ O=l|D O
I "T
o- o-

SULFITE

22

mz_20.1._.<._.w>0

-32..- .._:_-

OuoioIUIOImioioIouo
N _ N_ N _ _
+ :2 ... + ...z .0

szmm

N:
....

IOIOIOIOHO

_ _
..sz -o

<00.._>._.m 04

h Ema

nzolw101<oo

O

.93.

mz_¢mm._>._.m0<uo

N...
_...

:wuoloiwuo ...:oiwiodioiono

0

mo

mh<hm0< marina

.50
”MO
mzammoso:
N... ...

10101 1 no
mzmpmzosoz :o N. 0_U w mam-56
N: ... ... .N_._z .o N: I

:m101w1w10no szmmozoz _ _
N. N . _ 1534.0 _
... + :2 -o <oo.._>._.mo< ..NI: .0
”.953 n_..eiwiolNoo
-Nm 0
$60
.50 3.20.1255

Figure 1-2 (cont’d)

-O

N “I
T...“ _.I_

_
Ou OIOIOIOI wIUIOIqu

_ _
..Nxz N: ..N_._z .o

MIUIWIrso rum

0

_ _
+N:z -o

23

Sulfate reduction is a highly regulated process in S. cerevisiae involving feedback
inhibition of enzymatic processes at multiple steps and strict control over the synthesis of
new enzymes in the pathway (Marzluf, 1997). At the point of entry, the activity of both
SULl and SUL2 is strongly inhibited by APS, and the synthesis of these two structural
genes is completely suppressed by 0.8 mM methioine (met) and 0.2 mM 5’-
adenosylmethionine (Adomet) (Breton and Surdin—Kerkan, 1977). SAT is a
homohexamer in vivo (U llrich, 2001), and each monomer can be separated into four
domains. Of these domains, the SAT catalytic domain is linked to a domain with
structural homology to APS kinase which does not bind PAPS and has no kinase activity,
and is possible evidence of an evolutionary relationship with a bi-functional enzyme
(Lalor et al., 2003). The fungus Penicillium chrysogenum shares this APS kinase domain,
which does bind to PAPS, decreasing the affinity of the catalytic domain for sulfate
(MacRae et al., 2002). Allosteric inhibition of SAT by PAPS therefore may have been
lost in this organism. However, in S. cerevisiae the catalytic activity of SAT is strongly
inhibited by the product (APS) as well as by sulfide to a lesser extent (deVito &
Dreyfuss, 1964). The synthesis of SAT is suppressed by met and, interestingly, de-
repressed by exogenous cys. In contrast, synthesis of sulfite reductase is most strongly
suppressed by cys and only partially suppressed by met (deVito & Dreyfuss, 1964).
Sulfite reductase activity is also strongly regulated by NADP+, which completely
represses the synthesis of sulfide (Yoshimato & Sato, 1967). Exposure to met has also
been shown to increase the synthesis of the CT pathway enzymes, cystathionine [3-

synthase and cystathionine y-lyase (Paszewski & Grabski, 1974). The toxicity of PAPS

24

and the high energetic cost of sulfate reduction are likely reasons for the multi-level
control of this pathway in S. cerevisiae and other fungi.

The transcription of genes involved in methionine biosynthesis is controlled by
the intracellular concentration of Adomet sensed by a positive trans-acting basic leucine
zipper transcriptional factor, Met4p (Thomas et al., 1992; Cherest et al., 1985), although
methionyl-tRNA is also involved in regulation (Surdin-Kerjan et al. 1973). The
regulatory function of Met4p depends on its association with a complex of proteins
including a general transcription factor, centromere binding factor-1 (CBF-l), and a
second S assimilation regulatory factor, Met28p, whose expression is itself controlled by
Met4p (Kuras & Thomas, 1995). Under conditions of low met availability, the Met4p
transcriptional activation complex associates with promoter regions of genes encoding S-
adenosyl transferase (MET3), APS kinase (MET14), PAPS reductase (MET16), O-acetyl
homoserine sulfydrolase (MET25), PAPS kinase (MET22), and the first enzyme for the
synthesis of glutathione, glutamylcysteine synthetase (GSHl) (Kuras et al., 2002;
Wheeler et al., 2002), activating transcription. The activity of the Met4p complex is
controlled through the alteration or catabolism of Met4p by ubiquitylation (Kuras et al.,
2002). Ubiquitylation of Met4p is conducted by ubiquitin ligase complex associated with
an F -box protein, Met30p (Rouillon et al., 2000) whose activity is directly proportional to
its concentration. Met30p transcription is positively regulated by Met4p when Adomet is
abundant, so Met4p regulates its own breakdown (Smothers et al., 2000). However,
ubiquitylated Met4p is only degraded when S. cerevisiae is grown in minimal medium
amended with met. In rich media, ubiquitylated Met4p is not only stable, but selectively

activates genes encoding S-adenosyl methioine synthetic enzymes to supply one carbon

25

metabolism (Kuras et al., 2002), thus serving as two distinct transcription factors. The
complex between ubiquitin ligases and Met30p is stabilized by met, linking S metabolism
to the regulation of S assimilation (Mountain et al., 1993). Interestingly, the transcription
of MET4 is not regulated by S source (Mountain et al., 1993), but is regulated by another
bZIP transcription factor, Gcn4p, which also regulates amino acid synthetic genes.
Synthesis of met and cys is therefore coordinately regulated with general amino acid

synthesis as well as the intracellular Adomet concentration.

Aspergillus nidulans

Sulfate reduction in A. nidulans is analogous to the S. cerevisiae pathway
with few exceptions. Sulfate perrnease, while competitively inhibited by sulfate,
accumulates intracellular sulfate up to a concentration of 0.04 M in a knock-out mutant of
S-adenosyl transferase (sC), and a down-stream product is responsible for its allosteric
inhibition (Bradfield et al., 1970). S-adenosyl transferase is competitively inhibited by its
product, APS, but unlike S. cerevisiae, it is allosterically inhibited by PAPS

(Borgeswalmsley et al., 1995; Renosto et al., 1990). Growth in a high concentration of

met (5 mM) completely abolishes sulfate assimilation measured by 35S labeling

(Paszewski et al., 1984), however transcription of APS kinase (sD) and cysteine synthase
(cysB) does not appear to be affected (Clarke et al. 1997; Topezewski et al, 1997). In S.
cerevisiae, exogenously supplied met leads to the accumulation of met and Adomet,
while in A. nidulans it results in cystathionine accumulation (Pieniazck et al., 1973),
which may explain the difference in transcriptional regulation by met between

Saccharomyces and Aspergillus. The likely point of transcriptional regulation of sulfate

26

reduction is at the level of entry. Sulfate perrnease transcripts are reduced by at least four
fold in high met (Grynberg et al., 2001). An early study of pathway regulation indicates
that sulfate perrnease, S-adenosyl transferase, and sulfite reductase protein levels are
significantly reduced in cys, homocysteine, and met amended media (Paszewski &
Grabski, 1974), which is antithetical to current gene expression data and has not since
been repeated. These data led to the commonly held belief that the pathway is regulated
by cys (Marzluf, 1997). Few studies to date have analyzed transcriptional regulation of
sulfate reduction enzymes by cys, making this hypothesis difficult to evaluate. Unlike S.
cerevisiae, A. nidulans possesses fimctional OAS and CT pathways. The CT pathway is
now known to be the primary source of cys only when the OAS pathway is blocked
(Paszewski & Grabski 1974; Pieniazck et al., 1974), and the only biologically relevant
pathway of cys synthesis under normal growth conditions in A. nidulans is through
cysteine synthase (Brzywczy et al., 2007).

Akin to S. cerevisiae, a positive acting bZIP regulatory protein was
discovered for A. nidulans, MetRp, now known to be responsible for the transcriptional
activation of homocysteine synthase (cysD), S-adenosyl transferase (sC), and cysteine
synthase (cysB) (N atorff et al., 2003). A knock-out mutation of MetR reduces
incorporation of S from exogenous sulfate by 87% (Natorff et al., 2003). Neither MetR
nor Met4 are transcriptionally regulated by S sources themselves (N atorff et al., 2003;
Mountain et al., 1993), but are regulated on the protein level apparently by similar
mechanisms. Additionally, four negative regulatory proteins have also been discovered
through mutagenesis studies, sulfur controller proteins (soon) A, B, C, and D (Natorff et

al. 1993). The genetic sequence of sconB is homologous to met30 from S. cerevisiae and

27

contains an F-box motif for associating with ubiquitin ligase complexes as well (N atorff
et al, 1998). Based on these similarities, it is likely, although not currently proven, that S.
cerevisiae and A. nidulans contain similar ubiquitylation-based control systems for the

regulation of sulfate assimilation.

Neurospora crassa

Although N. crassa was the model fungal system in which much of the research
on global regulation of the sulfate assimilation pathway was first conducted, considerably
less is known about regulation on the enzymatic level compared to S. cerevisiae or A.
nidulans. Two sulfate perrneases have been characterized, specific to either mycelial
growth (cys-14) or germination (cys-13), and are highly expressed under S-limiting
conditions (Ketter et al., 1991). The synthesis of either isozyme is repressed completely
by high external concentrations of met and feedback inhibited by sulfate up to a
maximum of 60% (Marzluf, 1972). Interestingly, there is a time period in which there is
no effect of met addition on the synthesis of cys-13 which lasts for approximately the
first six hours of spore germination (Marzluf, 1972). This appears to be the only instance
when gerrnination-specific regulation of sulfate reduction was measured in fimgi, and
suggests that during this time transcriptional control of the pathway may differ from
normal growth. Like A. nidulans, P. chrysogenum, and P. duponti, N. crassa sulfate
adenyly] transferase enzyme is allosterically regulated by PAPS (Renosto et al., 1990).
Also similar to A. nidulans, N. crassa possessed functional CT and OAS pathways
(Flavin & Slaughter, 1964; Marzluf, 1997), and cystathionine y-lyase is strongly feedback

regulated in by cysteine both fungi, as much as 92% in N. crassa (Paszewski & Grabski

28

1974; F lavin & Segal, 1964). The relative contribution of the two pathways has not been
measured in N. crassa as it has in A. nidulans, but the overall similarity between the two
fungal pathways suggests that the OAS pathway may be dominant in N. crassa as well.
The sulfate assimilatory pathway in N. crassa is transcriptionally regulated by a
positive and negative acting control system, Cys3/Scon2, analogous to the Met3/Met30
system in S. cerevisiae and the MetR/SconB system in A. nidulans (Fu & Marzluf, 1990;
Fu et al., 1989; Paietta, 1990; Sizemore et al., 2002; for a review see Marzluf, 1997). The
F-box motif, now recognized as an important component of cell cycle regulation, was
first discovered during the analysis of the negative-acting sulfur controller gene scon2 by
Kumar and Paietta (1998), who also demonstrated that scon2 remains functional when its
F-box motif is replaced with the analogous sequence from Met30. Scon2 is
transcriptionally activated by the positive-acting transcriptional regulatory protein Cys3,
analogous to the activation of Met30 by Met4 in S. cerevisiae (Paietta, 1990; Smothers et
al. 2000). Another negative acting regulatory protein which associates with scon2 in the
formation of a ubiquitin ligase complex, scon3, is homologous to sconC from A.
nidulans, and like sconC and MetR, is not transcriptionally regulated by Cys3 (Sizemore
et al., 2002). CysB is necessary for the activation of genes encoding enzymes of the
sulfate assimilatory pathway including cysl4 and cysl 3 (J arai & Marzluf, 1991; Marzluf

& Metzenberg, 1968).

29

Conclusion and Rationale

The rise and fall of sulfur emissions is among the greatest anthropogenic
environmental changes in history. According to ice core analysis, the amount of sulfate
deposited from sea water per year has risen by 75% since 1850 (Mayaweski et al, 1990),
resulting in the addition of approximately 4.5 billion metric tons globally (Lefohn et al,
1999). Although these emissions continue to increase on a global scale, the Clean Air Act
has led to a striking decrease in S pollution in the US over the last three decades. In rural
areas of the eastern part of the US, sulfate deposition fell by 29% between 1990 and
2003, a figure which correlates closely with the 33% emissions drop from power plants in
the area over the same time period (Baumgardner et al., 2002; Lefohn et al., 1999).
Based on current legislation, emissions are projected to decrease a further 11% by the
year 2025 with nothing likely to prevent their future decline to near pre-Industrial
Revolution levels.

The simplest solution to the impending necessity to replace the S now available to
crop plants from atmospheric deposition is the fertilization of crops with sulfate. This is
an inexpensive and readily available solution as the legislation requiring removal of S
from coal and oil has led to a large excess of available sulfate. However, the soil mobility
of sulfate can result in roughly equivalent rates of environmental input from soil leaching
(Kiihn & Weller, 1977). Therefore the use of sulfate to amend S deficiencies in crops will
necessarily lead to the reintroduction of a pollutant into the water system, at least
partially negating one of very few environmental success stories of the twentieth century.

This thesis provides a foray into an alternative means of supplementing plant sulfate by

30

examining the transfer of S through a mycorrhizal symbiosis already known to enhance P
and N nutrition in plants.

The role of AMF in plant S acquisition has been a largely neglected scientific
problem. Previous studies produced inconclusive, often conflicting results (Morrison,
1962; Cooper & Tinker, 1978; Rhodes & Gerdeman, 1978a; 1978b; Banjeree et. al.,
1999). Recently, greater attention has been given to the role and regulation of S
metabolism in plants (Kopriva, 2006; Rausch & Wachter, 2005; Bloem et al., 2005)
which, with environmental reasons already discussed, make investigations into S transfer
through an AMF important. In response, three related studies were conducted of the
quantification and regulation of S transfer using a monoxenic culture system (chapter 2),
the regulation of S assimilation in the pre-symbiotic stage (chapter 3), and of connections
between the regulation of N and S assimilation (chapter 4). The results of these studies
demonstrate the ability of an AMF to import and assimilate both organic and inorganic S
in the pre-symbiotic and symbiotic stages of development, as well as transfer

physiologically relevant quantities of S to host roots.

31

References

Akiyama K, Matsuzaki K, Hayashi H. 2005. Plant sesquiterpenes induce hyphal
branching in arbuscular mycorrhizal fimgi. Nature 435(7043): 824-827.

Allen MF, Allen EB. 1990. Carbon source of va mycorrhizal fungi associated with
chenopodiaceae from a semiarid shrub-steppe. Ecology 71(5): 2019-2021.

Allen MF. 2007. Mycorrhizal fungi: Highways for water and nutrients in arid soils.
Vadose Zone Journal 6(2): 291-297.

Amtmann A, Troufflard S, Armengaud P. 2008. The effect of potassium nutrition on
pest and disease resistance in plants. Physiologia Plantarum 133(4): 682-691.

Auge RM, Moore JL, Sylvia DM, Cho KH. 2004a. Mycorrhizal promotion of host
stomatal conductance in relation to irradiance and temperature. Mycorrhiza 14(2): 85-92.

Auge RM, Sylvia DM, Park S, Buttery BR, Saxton AM, Moore JL, Cho KH. 2004b.
Partitioning mycorrhizal influence on water relations of Phaseolus vulgaris into soil and

plant components. Canadian Journal of Botany-Revue Canadienne De Botanique 82(4):

503-5 14.

Azcon R, Rodriguez R, Amora-Lazcano E, Ambrosano E. 2008. Uptake and
metabolism of nitrate in mycorrhizal plants as affected by water availability and N
concentration in soil. European Journal of Soil Science 59(2): 131-138.

Bago B. 2000. Putative sites for nutrient uptake in arbuscular mycorrhizal fungi. Plant
and Soil 226(2): 263-274.

Bago B, Pfeffer PE, Zipfel W, Lammers P, Shachar-Hill Y. 2002. Tracking
metabolism and imaging transport in arbuscular mycorrhizal fimgi. Metabolism and
transport in AM fungi. Plant and Soil 244(1-2): 189-197.

Banerjee MR, Chapman SJ, Killham K. 1999. Uptake of fertilizer sulfur by maize
from soils of low sulfur status as affected by vesicular-arbuscular mycorrhizae. Canadian
Journal of Soil Science 79(4): 557-559.

Baumgardner RE, Lavery TF, Rogers CM, Isil SS. 2002. Estimates of the atmospheric
deposition of sulfur and nitrogen species: Clean Air Status and Trends Network, 1990-
2000. Environmental Science & Technology 36(12): 2614-2629.

Berkowitz O, Wirtz M, Wolf A, Kuhlmann J, Hell R. 2002. Use of biomolecular
interaction analysis to elucidate the regulatory mechanism of the cysteine synthase
complex from Arabidopsis thaliana. Journal of Biological Chemistry 277(34): 30629-
30634.

32

Besserer A, Becard G, J auneau A, Roux C, Sejalon-Delmas N. 2008. GR24, a
synthetic analog of strigolactones, stimulates the mitosis and growth of the arbuscular
mycorrhizal fimgus Gigaspora rosea by boosting its energy metabolism. Plant Physiology
148(1): 402-413.

Bick JA, Leustek T. 1998. Plant sulfur metabolism - the reduction of sulfate to sulfite.
Current Opinion in Plant Biology 1(3): 240-244.

Blanke V, Renker C, Wagner M, Fullner K, Held M, Kuhn AJ, Buscot F. 2005.
Nitrogen supply affects arbuscular mycorrhizal colonization of Artemisia vulgaris in a
phosphate-polluted field site. New Phytologist 166(3): 981-992.

Bloem E, Haneklaus S, Schnug E. 2005. Significance of sulfur compounds in the
protection of plants against pests and diseases. Journal of Plant Nutrition 28(5): 763-784.

Bolan NS. 1991. A critical-review on the role of mycorrhizal fungi in the uptake of
phosphorus by plants. Plant and Soil 134(2): 189-207.

Borgeswalmsley MI, Turner G, Bailey AM, Brown J, Lehmbeck J, Clausen 1G.
1995. Isolation and characterization of genes for sulfate activation and reduction in
aspergillus-nidulans - implications for evolution of an allosteric control region by gene
duplication. Molecular & General Genetics 247(4): 423-429.

Bork C, Schwenn JD, Hell R. 1998. Isolation and characterization of a gene for
assimilatory sulfite reductase from Arabidopsis thaliana. Gene 212(1): 147-153.

Boyer J S. 1996. Advances in drought tolerance in plants. Advances in Agronomy, Vol 56,
187-218.

Bradfield G, Somerfield P, Meyn T, Holby M, Babcock D, Bradley D, Segel IH.
1970. Regulation of sulfate transport in filamentous fungi. Plant Physiology 46(5): 720-
727.

Breton A, Surdinkerjan Y. 1977. Sulfate uptake in saccharomyces-cerevisiae -
biochemical and genetic study. Journal of Bacteriology 132(1): 224-232.

Brundrett MC. 2002. Coevolution of roots and mycorrhizas of land plants. New
Phytologist 154(2): 275-304.

Brzywczy J, N atorff R, Sienko M, Paszewski A. 2007. Multiple fimgal enzymes
possess cysteine synthase activity in vitro. Research in Microbiology 158(5): 428-436.

Biicking H, Shachar-Hill Y. 2005. Phosphate uptake, transport and transfer by the

arbuscular mycorrhizal fungus Glomus intraradices is stimulated by increased
carbohydrate availability. New Phytologist 165(3): 899-912.

33

Ceccotti SP 1996. Plant nutrient sulphur - A review of nutrient balance, environmental
impact and fertilizers. Fertilizer Research 43:117-125.

Cherest H, Thao NN, Surdinkerjan Y. 1985. Transcriptional regulation of the met3-
gene of saccharomyces-cerevisiae. Gene 34(2-3): 269-281.

Cho KH, Toler H, Lee J, Ownley B, Stutz JC, Moore JL, Auge RM. 2006.
Mycorrhizal symbiosis and response of sorghum plants to combined drought and salinity
stresses. Journal of Plant Physiology 163(5): 517-528.

Clarke DL, Newbert RW, Turner G. 1997. Cloning and characterisation of the
adenosyl phosphosulphate kinase gene from Aspergillus nidulans. Current Genetics
32(6): 408-412.

Cooper KM, Tinker PB. 1978. Translocation and transfer of nutrients in vesicular-
arbuscular mycorrhizas .2. Uptake and translocation of phosphorus, zinc and sulfur. New
Phytologist 81(1): 43-47.

DaSilva DKA, Freitas ND, Cuenca G, Maia LC, Oehl F. 2008. Scutellospora
pemambucana, a new fungal species in the Glomeromycetes with a diagnostic
germination orb. Mycotaxon 106: 361-370.

Devito PC, Dreyfuss J. 1964. Metabolic regulation of adenosine triphosphate sulfirrylase
in yeast. Journal of Bacteriology 88(5): 1341-1345.

Dickson S, Smith FA, Smith SE. 2007. Structural differences in arbuscular mycorrhizal
symbioses: more than 100 years after Gallaud, where next? Mycorrhiza 17(5): 375-393.

Dickson S. 2004. The Arum-Paris continuum of mycorrhizal symbioses. New Phytologist
163(1): 187-200.

Dotzler N, Walker C, Krings M, Hass H, Kerp H, Taylor TN, Agerer R. 2009.

Acaulosporoid glomeromycotan spores with a germination shield from the 400-million-
year-old Rhynie chert. Mycological Progress 8(1): 9-18.

Droux M. 2004. Sulfur assimilation and the role of sulfur in plant metabolism: a survey.
Photosynthesis Research 79(3): 331-348.

Eriksen J, Askegaard M. 2000. Sulphate leaching in an organic crop rotation on sandy
soil in Denmark. Agriculture Ecosystems & Environment 78(2): 107-114.

Feldman-Salit A, Wirtz M, Hell R, Wade RC. 2009. A Mechanistic Model of the
Cysteine Synthase Complex. Journal of Molecular Biology 386(1): 37-59.

Flavin M, Segal A. 1964. Purification and properties of cystathionine cleavage enzyme
of 1. Journal of Biological Chemistry 239(7): 2220-2227.

34

Flavin M, Slaughter C. 1964. Cystathionine cleavage enzymes of neurospora. Journal
of Biological Chemistry 239(7): 2212-2224.

Fu YH, Marzluf GA. 1990. Nit-2, the major positive-acting nitrogen regulatory gene of
neurospora-crassa, encodes a sequence-specific dna-binding protein. Proceedings of the
National Academy of Sciences of the United States of America 87(14): 5331-5335.

Fu YH, Paietta JV, Mannix DG, Marzluf GA. 1989. Cys-3, the positive-acting sulfur
regulatory gene of neurospora-crassa, encodes a protein with a putative leucine zipper
dna-binding element. Molecular and Cellular Biology 9(3): 1120-1127.

Gahoonia TS, Nielsen NE. 1991. A method to study rhizosphere processes in thin soil
layers of different proximity to roots. Plant and Soil 135(1): 143-146.

Gallaud J. 1905. Etude sur les mycorrhizes endotrophes. Revue General Botany 17(5):
5-48.

Glassop D, Smith SE, Smith FW. 2005. Cereal phosphate transporters associated with
the mycorrhizal pathway of phosphate uptake into roots. Planta 222(4): 688-698.

Gomez SK, J avot H, Deewatthanawong P, Torres-Jerez I, Tang YH, Blancaflor EB,
Udvardi MK, Harrison MJ. 2009. Medicago tnmcatula and Glomus intraradices gene
expression in cortical cells harboring arbuscules in the arbuscular mycorrhizal symbiosis.
Bmc Plant Biology 9:10.

Grace EJ, Cotsaftis O, Tester M, Smith FA, Smith SE. 2009. Arbuscular mycorrhizal
inhibition of growth in barley cannot be attributed to extent of colonization, fungal

phosphorus uptake or effects on expression of plant phosphate transporter genes. New
Phytologist 181(4): 938-949.

Grandmaison J, Olah GM, Vancalsteren MR, Furlan V. 1993. Characterization and
localization of plant phenolics likely involved in the pathogen resistance expressed by
endomycorrhizal roots. Mycorrhiza 3(4): 155-164.

Grynberg M, Piotrowska M, Pizzinini E, Turner G, Paszewski A. 2001. The
Aspergillus nidulans metE gene is regulated by a second system independent from

sulphur metabolite repression. Biochimica Et Biophysica Acta-Gene Structure and
Expression 1519(1-2): 78-84.

Haas FH, Heeg C, Queiroz R, Bauer A, Wirtz M, Hell R. 2008. Mitochondrial serine
acetyltransferase functions as a pacemaker of cysteine synthesis in plant cells. Plant
Physiology 148(2): 1055-1067.

Hayman DS, Mosse B. 1971. Plant grth responses to vesicular-arbuscular mycorrhiza
.1. Growth of endogone-inoculated plants in phosphate-deficient soils. New Phytologist
70(1): 19-25.

35

Heckman DS, Geiser DM, Eidell BR, Stauffer RL, Kardos NL, Hedges SB. 2001.
Molecular evidence for the early colonization of land by fimgi and plants. Science
293(5532): 1129-1133.

Hell R, Jost R. 1997. Differential molecular and metabolic responses of Arabidopsis
thaliana to short-tenn sulfate deficiency. Plant Physiology 114(3): 748-748.

Hinsinger P. 2001. Bioavailability of soil inorganic P in the rhizosphere as affected by
root-induced chemical changes: a review. Plant and Soil 237(2): 173-195.

Hosny M, Gianinazzi-Pearson V, Dulieu H. 1998. Nuclear DNA content of 11 fungal
species in Glomales. Genome 41(3): 422-428.

Howarth JR, Dominguez-Solis JR, Gutierrez-Alcala G, Wray JL, Romero LC,
Gotor C. 2003. The serine acetyltransferase gene family in Arabidopsis thaliana and the
regulation of its expression by cadmium. Plant Molecular Biology 51(4): 589-598.

James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, Cox CJ, Celio G,
Gueidan C, Fraker E, Miadlikowska J, et al. 2006. Reconstructing the early evolution
of Fungi using a six-gene phylogeny. Nature 443(7113): 818-822.

Jarai G, Marzluf GA. 1991. Sulfate transport in neurospora-crassa - regulation,
turnover, and cellular-localization of the cys-l4 protein. Biochemistry 30(19): 4768-4773.

Javot H, Penmetsa RV, Terzaghi N, Cook DR, Harrison MJ. 2007. A Medicago
truncatula phosphate transporter indispensable for the arbuscular mycorrhizal symbiosis.
Proceedings of the National Academy of Sciences of the United States of America 104(5):
1 720- 1 725.

Karandashov V, Bucher M. 2005. Symbiotic phosphate transport in arbuscular
mycorrhizas. Trends in Plant Science 10(1): 22-29.

Ketter JS, Jarai G, Fu YH, Marzluf GA. 1991. Nucleotide-sequence, messenger-ma
stability, and dna recognition elements of cys-14, the structural gene for sulfate
perrnease-ii in neurospora-crassa. Biochemistry 30(7): 1780-1787.

Kopriva S, Buchert T, Fritz G, Suter M, Benda RD, Schunemann V, Koprivova A,
Schurmann P, Trautwein AX, Kroneck PMH, Brunold C. 2002. The presence of an
iron-sulfur cluster in adenosine 5 '-phosphosulfate reductase separates organisms utilizing

adenosine 5 '-phosphosulfate and phosphoadenosine 5 '-phosphosulfate for sulfate
assimilation. Journal of Biological Chemistry 277(24): 21786-21791.

Kopriva S. 2006. Regulation of sulfate assimilation in Arabidopsis and beyond. Annals
of Botany 97(4): 479-495.

36

Krueger S, Niehl A, Martin MC, Steinhauser D, Donath A, Hildebrandt T, Romero
LC, Hoefgen R, Gotor C, Hesse H. 2009. Analysis of cytosolic and plastidic serine
acetyltransferase mutants and subcellular metabolite distributions suggests interplay of
the cellular compartments for cysteine biosynthesis in Arabidopsis. Plant Cell and
Environment 32(4): 349-367.

Kilhn H, Weller H. 1977. 6 jahige untersuchung fiber schwefelzufuhr durch
niederschlage und schwefelverluste durch auswaschung (lysimeter). Z. Pflnzenernaehr.
Bodenk. 140: 431-440.

Kumar A, Paietta JV. 1998. An additional role for the F-box motif: Gene regulation
within the Neurospora crassa sulfur control network. Proceedings of the National
Academy of Sciences of the United States of America 95(5): 2417-2422.

Kuras L, Rouillon A, Lee T, Barbey R, Tyers M, Thomas D. 2002. Dual regulation of
the Met4 transcription factor by ubiquitin-dependent degradation and inhibition of
promoter recruitment. Molecular Cell 10(1): 69-80.

Kuras L, Thomas D. 1995. Functional-analysis of met4, a yeast transcriptional activator
responsive to s-adenosylmethionine. Molecular and Cellular Biology 15(1): 208-216.

Lair GJ, Zehetner F, Khan ZH, Gerzabek MH. 2009. Phosphorus sorption-desorption
in alluvial soils of a young weathering sequence at the Danube River. Geoderma 149(1-
2): 39-44.

Lalor DJ, Schnyder T, Saridakis V, Pilloff DE, Dong A, Tang H, Leyh TS, Pai EF.
2003. Structural and functional analysis of a truncated form of Saccharomyces cerevisiae
ATP sulfurylase: C-terrninal domain essential for oligomer formation but not for activity.
Protein Engineering 16(12): 1071 -1 079.

Lammers PJ, Jun J, Abuhaker J, Arreola R, Gopalan A, Bago B, Hernandez-
Sebastia C, Allen JW, Douds DD, Pfeffer PE, Shachar—Hill Y. 2001. The glyoxylate
cycle in an arbuscular mycorrhizal fungus. Carbon flux and gene expression. Plant
Physiology 127(3): 1287-1298.

Lee SM. 2005. Cysteine does not repress adenosine-5 '-phosphosulfate reductase through
its conversion to either sulfate or glutathione. Journal of Plant Biology 48(1): 57-63.

Lefohn AS, Husar JD, Husar RB. 1999. Estimating historical anthropogenic global
sulfur emission patterns for the period 1850-1990. Atmospheric Environment 33(21):
3435-3444.

Leigh J, Hodge A, Fitter AH. 2009. Arbuscular mycorrhizal fungi can transfer

substantial amounts of nitrogen to their host plant from organic material. New Phytologist
181(1): 199-207.

37

Leustek T, Martin MN, Bick JA, Davies JP. 2000. Pathways and regulation of sulfur
metabolism revealed through molecular and genetic studies. Annual Review of Plant
Physiology and Plant Molecular Biology 51: 141 - l 65.

Leustek T, Saito K. 1999. Sulfate transport and assimilation in plants. Plant Physiology
120(3): 637-643.

Logi C, Shrana C, Giovannetti M. 1998. Cellular events involved in survival of
individual arbuscular mycorrhizal symbionts growing in the absence of the host. Applied
and Environmental Microbiology 64(9): 3473-3479.

MacRae IJ, Segel 1H, Fisher AJ. 2002. Allosteric inhibition via R-state destabilization
in ATP sulfurylase from Penicillium chrysogenum. Nature Structural Biology 9(12): 945-
949.

Martin F, Gianinazzi-Pearson V, Hijri M, Lammers P, Requena N, Sanders IR,
Shachar-Hill Y, Shapiro H, Tuskan GA, Young JPW. 2008. The long hard road to a
completed Glomus intraradices genome. New Phytologist 180(4): 747-750.

Maruyama-Nakashita A, Inoue E, Watanabe-Takahashi A, Yarnaya T, Takahashi
H. 2003. Transcriptome profiling of sulfur-responsive genes in Arabidopsis reveals
global effects of sulfirr nutrition on multiple metabolic pathways. Plant Physiology
132(2): 597-605.

Marzluf GA, Metzenberg RI. 1968. Positive control by cys-3 locus in regulation of
sulfur metabolism in neurospora. Journal of Molecular Biology 33(2): 423-427.

Marzluf GA. 1972. Control of synthesis activity and turnover of enzymes of sulfur
metabolism in neurospora-crassa. Archives of Biochemistry and Biophysics 150(2): 714-
721.

Marzluf GA. 1997. Molecular genetics of sulfur assimilation in filamentous fungi and
yeast. Annual Review of Microbiology 51: 73-96.

May MJ, Vernoux T, Leaver C, Van Montagu M, Inze D. 1998. Glutathione
homeostasis in plants: implications for environmental sensing and plant development.
Journal of Experimental Botany 49(321): 649-667.

Mayewski PA, Lyons WB, Spencer MJ, Twickler MS, Buck CF, Whitlow S. 1990.
An ice-core record of atmospheric response to anthropogenic sulfate and nitrate. Nature
346(6284): 554-556.

Morandi D 1996. Occurrence of phytoalexins and phenolic compounds in
endomycorrhizal interactions, and their potential role in biological control. Plant and Soil
185(2): 241-251.

38

Morrison TM 1962. Uptake of sulphur by mycorrhizal plants. New Phytologist 62: 21-
27.

Mountain HA, Bystrom AS, Korch C. 1993. The general arnino-acid control regulates
met4, which encodes a methionine-pathway-specific transcriptional activator of
saccharomyces-cerevisiae. Molecular Microbiology 7(2): 215-228.

Msiska Z, Morton JB. 2009. Phylogenetic analysis of the Glomeromycota by partial
beta-tubulin gene sequences. Mycorrhiza 19(4): 247-254.

Murguia JR, Belles JM, Serrano R. 1996. The yeast HAL2 nucleotidase is an in vivo
target of salt toxicity. Journal of Biological Chemistry 271(46): 29029-29033.

Nagy R, Drissner D, Amrhein N, J akobsen I, Bucher M. 2009. Mycorrhizal phosphate
uptake pathway in tomato is phosphorus-repressible and transcriptionally regulated. New
Phytologist 181(4): 950-959.

Nagy S, Nordby HE, Nemec S. 1980. Composition of lipids in roots of 6 citrus cultivars
infected with the vesicular-arbuscular mycorrhizal fimgus, glomus-mosseae. New
Phytologist 85(3): 377-384.

Natorff R, Balinska M, Paszewski A. 1993. At least 4 regulatory genes control sulfirr
metabolite repression in aspergillus-nidulans. Molecular & General Genetics 238(1-2):
185-192.

Natorff R, Sienko M, Brzywczy J, Paszewski A. 2003. The Aspergillus nidulans metR
gene encodes a bZIP protein which activates transcription of sulphur metabolism genes.
Molecular Microbiology 49(4): 1081-1094.

Nicholls P. 1975. Effect of sulfide on cytochrome-aa3 isosteric and allosteric shifts of
reduced alpha-peak. Biochimica et Biophysica Acta 396(1): 24-35.

Noctor G, Arisi ACM, Jouanin L, Kunert KJ, Rennenberg H, Foyer CH. 1998.
Glutathione: biosynthesis, metabolism and relationship to stress tolerance explored in
transformed plants. Journal of Experimental Botany 49(321): 623-647.

Noji M, Inoue K, Kimura N, Gouda A, Saito K. 1998. Isofonn-dependent differences
in feedback regulation and subcellular localization of serine acetyltransferase involved in

cysteine biosynthesis from Arabidopsis thaliana. Journal of Biological Chemistry
273(49): 32739-32745.

Olsson PA, Johansen A. 2000. Lipid and fatty acid composition of hyphae and spores of
arbuscular mycorrhizal fungi at different grth stages. Mycological Research 104: 429-
434.

39

Ono B, Hazu T, Yoshida S, Kawato T, Shinoda S, Brszczy J, Paszewski A. 1999.
Cysteine biosynthesis in Saccharomyces cerevisiae: a new outlook on pathway and
regulation. Yeast 15(13): 1365-1375.

Opik M, Moora M, Liira J, Koljalg U, Zobel M, Sen R. 2003. Divergent arbuscular
mycorrhizal fungal communities colonize roots of Pulsatilla spp. in boreal Scots pine
forest and grassland soils. New Phytologist 160(3): 581-593.

Ortiz-Ceballos AI, Pena-Cabriales JJ, Fragoso C, Brown GG. 2007. Mycorrhizal
colonization and nitrogen uptake by maize: combined effect of tropical earthworms and
velvetbean mulch. Biology and Fertility of Soils 44(1): 181-186.

Paietta JV. 1990. Molecular-cloning and analysis of the scon-2 negative regulatory gene
of neurospora—crassa. Molecular and Cellular Biology 10(10): 5207-5214.

Paszewsk.A, Grabski J. 1974. Regulation of s-amino acids biosynthesis in aspergillus-
nidulans - role of cysteine and-or homocysteine as regulatory effectors. Molecular &
General Genetics 132(4): 307-320.

Paszewski A, Prazmo W, Nadolska J, Regulski M. 1984. Mutations affecting the sulfur
assimilation pathway in aspergillus-nidulans - their effect on sulfirr amino-acid-
metabolism. Journal of General Microbiology 130(MAY): 1 113-1 121.

Pfeffer PE, Douds DD, Becard G, Shachar-Hill Y. 1999. Carbon uptake and the
metabolism and transport of lipids in an arbuscular mycorrhiza. Plant Physiologz 120(2):
587-598.

Phartiyal P, Kim WS, Cahoon RE, Jez JM, Krishnan HB. 2006. Soybean ATP
sulfurylase, a homodirneric enzyme involved in sulfur assimilation, is abundantly

expressed in roots and induced by cold treatment. Archives of Biochemistry and
Biophysics 450(1): 20-29.

Pieniazck NJ, Stepien PP, Paszewski A. 1973. Aspergillus-nidulans mutant lacking
cystathionine beta-synthase - identity of l-serine sulfl1ydrylase with cystathionine beta-
synthase and its distinctness from o-acetyl-l-serine sulfliydrylase. Biochimica Et
Biophysica Acta 297(1): 37-47.

Porcel R, Aroca R, Cano C, Bago A, Ruiz-Lozano JM. 2006. Identification of a gene
from the arbuscular mycorrhizal fungus Glomus intraradices encoding for a 14-3-3

protein that is up-regulated by drought stress during the AM symbiosis. Microbial
Ecology 52(3): 575-582.

Porcel R, Aroca R, Cano C, Bago A, Ruiz-Lozano JM. 2007. A gene from the
arbuscular mycorrhizal fungus Glomus intraradices encoding a binding protein is up-
regulated by drought stress in some mycorrhizal plants. Environmental and Experimental
Botany 60(2): 251-256.

40

Prior A, Uhrig J F, Heins L, Wiesmann A, Lillig CH, Stoltze C, 8011 J, Schwenn JD.
1999. Structural and kinetic properties of adenylyl sulfate reductase from Catharanthus

roseus cell cultures. Biochimica et Biophysica Acta-Protein Structure and Molecular
Enzymology 1430(1): 25-38.

Querejeta J1, Allen MF, Alguacil MM, Roldan A. 2007. Plant isotopic composition
provides insight into mechanisms underlying growth stimulation by AM fungi in a
semiarid environment. Functional Plant Biology 34(8): 683-691.

Quintero FJ, Garciadeblas B, RodriguezNavarro A. 1996. The SAL] gene of
Arabidopsis, encoding an enzyme with 3'(2'),5'-bisphosphate nucleotidase and inositol

polyphosphate l-phosphatase activities, increases salt tolerance in yeast. Plant Cell 8(3):
529-537.

Rausch T, Wachter A. 2005. Sulfur metabolism: a versatile platform for launching
defence operations. Trends in Plant Science 10(10): 503-509.

Read DJ, Duckett JG, Francis R, Ligrone R, Russell A. 2000. Symbiotic fungal
associations in 'lower' land plants. Philosophical Transactions of the Royal Society of
London Series B-Biological Sciences 355(1398): 815-830.

Redecker D, Kodner R, Graham LE. 2000. Glomalean fungi from the Ordovician.
Science 289(5486): 1920-1921.

Redecker D, Raab P. 2006. Phylogeny of the Glomeromycota (arbuscular mycorrhizal
fungi): recent developments and new gene markers. Mycologia 98(6): 885-895.

Renosto F, Martin RL, Wailes LM, Daley LA, Segel IH. 1990. Regulation of inorganic
sulfate activation in filamentous fiingi - allosteric inhibition of atp sulfurylase by 3'-
phosphoadenosine-S'-phosphosulfate. Journal of Biological Chemistry 265(18): 10300-
10308.

Rhodes LH, Gerdemann JW. 1975. Phosphate uptake zones of mycorrhizal and
nonmycorrhizal onions. New Phytologist 75(3): 555-&.

Rhodes LH, Gerdemann JW. 1978a. Hyphal translocation and uptake of sulfur by
vesicular-arbuscular mycorrhizae of onion. Soil Biology & Biochemistry 10(5): 355-360.

Rhodes LH, Gerdemann JW. 1978b. Influence of phosphorus nutrition on sulfur uptake
by vesicular-arbuscular mycorrhizae of onion. Soil Biology & Biochemistry 10(5): 361-
364.

Riley NG, Zhao FJ, McGrath SP. 2000. Availability of different forms of sulphur
fertilisers to wheat and oilseed rape. Plant and Soil 222(1-2): 139-147.

41

Rouillon A, Barbey R, Patton EE, Tyers M, Thomas D. 2000. Feedback-regulated
degradation of the transcriptional activator Met4 is triggered by the SCFMet3O complex.
Embo Journal 19(2): 282-294.

Ruiz-Lozano JM. 2003. Arbuscular mycorrhizal symbiosis and alleviation of osmotic
stress. New perspectives for molecular studies. Mycorrhiza 13(6): 309-317.

Saggar S, Bettany JR, Stewart JWB. 1981. Measurement of microbial sulfur in soil.
Soil Biology & Biochemistry 13(6): 493-498.

Sanderson MJ. 2003. Molecular data from 27 proteins do not support a Precambrian
origin of land plants. American Journal of Botany 90(6): 954-956.

Scherer HW. 2001. Sulphur in crop production - invited paper. European Journal of
Agronomy 14(2): 81-111.

Schussler A, Schwarzott D, Walker C. 2001. A new fungal phylum, the
Glomeromycota: phylogeny and evolution. Mycological Research 105: 1413-1421.

Shacharhill Y, Pfeffer PE, Douds D, Osman SF, Doner LW, Ratcliffe RG. 1995.
Partitioning of carbohydrate-metabolism in vesicular-arbuscular mycorrhizal leek
revealed by NMR-spectroscopy. Plant Physiology 108(2): 22-22.

Shein KA, Waple AM, Menne MJ, Christy JC, Levinson DH, Lawrimore J H,
Wuertz DB, Xie P, J anowiak JE, Robinson DA, et al. 2006. State of the climate in
2005. Bulletin of the American Meteorological Society 87(6): S6-SlOZ.

Sizemore ST, Paietta JV. 2002. Cloning and characterization of scon-3(+), a new
member of the Neurospora crassa sulfur regulatory system. Eukaryotic Cell 1(6): 875-
883.

Smith SE, Read DJ. 2008. Mycorrhizal symbiosis, 3rd edn. London, UK: Academic

Smith SE, Smith FA, J akobsen I. 2003. Mycorrhizal fungi can dominate phosphate
supply to plants irrespective of growth responses. Plant Physiology 133(1): 16-20.

Smothers DB, Kozubowski L, Dixon C, Goebl MG, Mathias N. 2000. The abundance
of met30p limits SCFMet30p complex activity and is regulated by methionine
availability. Molecular and Cellular Biology 20(21): 7845-7852.

Solaiman MZ, Ezawa T, Kojima T, Saito M. 1999. Polyphosphates in intraradical and
extraradical hyphae of an arbuscular mycorrhizal fungus, Gigaspora margarita. Applied
and Environmental Microbiology 65(12): 5604-5606.

42

Surdinkerjan Y, Cherest H, Derobichonszulmajster H. 1976. Regulation of
methionine synthesis in saccharomyces cerevisiae operates through independent signals -
methionyl-transfer-ma (met) and s-adenosylmethionine. Acta Microbiologica Academiae
Scientiarum Hungaricae 23(2): 109-120.

Takahashi S, Yoshida Y, Tamura G. 1996. Purification and characterization of
ferredoxin-sulfite reductases from leek (Allium tuberosum) leaves. Journal of Plant
Research 109(1093): 45-52.

Thomas D, Jacquemin I, Surdinkerjan Y. 1992. Met4, a leucine zipper protein, and
centromere-binding factor-i are both required for transcriptional activation of sulfur
metabolism in saccharomyces-cerevisiae. Molecular and Cellular Biology 12(4): 1719-
1727.

Thomas D, SurdinKerjan Y. 1997. Metabolism of sulfur amino acids in Saccharomyces
cerevisiae. Microbiology and Molecular Biology Reviews 61(4): 503-515.

Topezewski J, Sienko M, Paszewski A. 1997. Cloning and characterization of the
Aspergillus nidulans cysB gene encoding cysteine synthase. Current Genetics 31(4): 348-
356.

Trepanier M, Becard G, Moutoglis P, Willemot C, Gagne S, Avis TJ, Rioux JA.
2005. Dependence of arbuscular-mycorrhizal fungi on their plant host for palmitic acid
synthesis. Applied and Environmental Microbiology 71(9): 5341-5347.

Truong DH, Eghbal MA, Hindmarsh W, Roth SH, O'Brien PJ. 2006. Molecular
mechanisms of hydrogen sulfide toxicity.Drug Metabolism Reviews 38(4): 733-744.

Ullrich TC, Huber R. 2001. The complex structures of ATP sulfurylase with thiosulfate,
ADP and chlorate reveal new insights in inhibitory effects and the catalytic cycle.
Journal of Molecular Biology 313(5): 1 1 17-1 125.

VanAarle 1M, Cavagnaro TR, Smith SE, Smith FA, Dickson S. 2005. Metabolic
activity of Glomus intraradices in Arum- and Paris-type arbuscular mycorrhizal
colonization. New Phytologist 166(2): 61 1-618.

Vauclare P, Kopriva S, Fell D, Suter M, Sticher L, von Ballmoos P, Krahenbuhl U,
den Camp RO, Brunold C. 2002. Flux control of sulphate assimilation in Arabidopsis
thaliana: adenosine 5 '-phosphosulphate reductase is more susceptible than ATP
sulphurylase to negative control by thiols. Plant Journal 31(6): 729-740.

Vidmar JJ, Tagmount A, Cathala N, Touraine B, Davidian JCE. 2000. Cloning and

characterization of a root specific hi gh-affinity sulfate transporter from Arabidopsis
thaliana. Febs Letters 475(1): 65-69.

43

Wang YY, Vestberg M, Walker C, Hurme T, Zhang XP, Lindstrom K. 2008.
Diversity and infectivity of arbuscular mycorrhizal fungi in agricultural soils of the
Sichuan Province of mainland China. Mycorrhiza 18(2): 59-68.

Watanabe M, Mochida K, Kato T, Tabata S, Yoshimoto N, Noji M, Saito K. 2008.
Comparative Genomics and Reverse Genetics Analysis Reveal Indispensable Functions
of the Serine Acetyltransferase Gene Family in Arabidopsis. Plant Cell 20(9): 2484-
2496.

Wellman CH, Richardson JB. 1993. Terrestrial plant microfossils from silurian inliers
of the midland valley of scotland. Palaeontology 36: 155-193.

Wheeler GL, Quinn KA, Perrone G, Dawes IW, Grant CM. 2002. Glutathione
regulates the expression of gamma-glutamylcysteine synthetase via the Met4
transcription factor. Molecular Microbiology 46(2): 545-556.

Wirtz M, Berkowitz O, Droux M, Hell R. 2001. The cysteine synthase complex from
plants - Mitochondrial serine acetyltransferase from Arabidopsis thaliana carries a

bifunctional domain for catalysis and protein-protein interaction. European Journal of
Biochemistry 268(3): 686-693.

Wirtz M, Droux M, Hell R 2004. O-acetylserine (thiol) lyase: an enigmatic enzyme of
plant cysteine biosynthesis revisited in Arabidopsis thaliana. Journal of Experimental
Botany 55(404): 1785-1798.

Wirtz M, Hell R. 2006. Functional analysis of the cysteine synthase protein complex
from plants: Structural, biochemical and regulatory properties. Journal of Plant
Physiology 163(3): 273-286.

Yao MK, Tweddell RJ, Desilets H. 2002. Effect of two vesicular-arbuscular
mycorrhizal fungi on the growth of micropropagated potato plantlets and on the extent of
disease caused by Rhizoctonia solani. Mycorrhiza 12(5): 235-242.

Yao Q, Zhu HH, Zeng RS. 2007. Role of phenolic compounds in plant defence: Induced
by arbuscular mycorrhizal fungi. Allelopathy Journal 20(1): 1-13.

Yoshimato A, Sato R. 1968. Studies on yeast sulfite reductase .i. Purification and
characterization. Biochimica et Biophysica Acta 153(3): 555-563.

Zhao FJ, Wood AP, McGrath SP. 1999. Effects of sulphur nutrition on growth and
nitrogen fixation of pea (Pisum sativum L.). Plant and Soil 212(2): 209-219.

44

Chapter 2

Sulfur Transfer through an Arbuscular Mycorrhiza

The contents of this chapter are modified from an article published in Plant Physiology.

Allen JW, Shachar-Hill Y. 2009. Sulfur transfer through an arbuscular mycorrhiza.
Plant Physiology 149(1): 549-560.

45

Abstract

Despite the importance of sulfur for plant nutrition, the role of the arbuscular

mycorrhizal symbiosis in sulfur uptake has received little attention. To address this issue,

35 . . .
S labeling experiments were performed on mycorrhizas of transformed carrot roots and

Glomus intraradices grown monoxenically on bi-compartmental Petri dishes. The uptake

and transfer of 358042- by the fungus and resulting 358 partitioning into different

metabolic pools in the host roots was analyzed when i) altering the sulfate concentration

available to roots and ii) supplying the firngal compartment with cysteine, methionine or

glutathione. Additonally, the uptake, transfer and partitioning of 35S from the reduced S

sources [35S]cys and [35$]met was determined. Sulfate was taken up by the firngus and

transferred to mycorrhizal roots, increasing root S contents by 25% in a moderate (not
grth limiting) concentration of sulfate. High sulfate levels in the mycorrhizal root
compartment halved the uptake of ”$042- from the fngal compartment. The addition of
1 mM methionine, cysteine, or glutathione to the fungal compartment reduced the
transfer of sulfate by 26%, 45% and 80% respectively over one month. Similar quantities
of 358 were transferred to mycorrhizal roots whether 358042-, [3SS]cys, or [3SS]met was
supplied in the fungal compartment. Fungal transcripts for putative sulfur assimilatory
genes were identified, indicating the presence of the trans-sulfuration pathway. The

suppression of fungal sulfate transfer in the presence of cysteine coincided with a

reduction in putative sulfate perrnease and not sulfate adenylyltransferase transcripts,

46

suggesting a role for fungal transcriptional regulation in S transfer to the host. A testable

model is proposed describing root S acquisition through the AM symbiosis.

47

Introduction

Plants and arbuscular mycorrhizal (AM) firngi have been co-evolving since the
Devonian period (Simon et al., 1993; Brundrett, 2002). Today the AM symbiosis
involves an estimated 80% of land plant species and 92% of plant families (Wang & Qiu,
2006). This symbiosis augments nutrient uptake by roots, which deplete the rhizosphere
at a rate dependent on water availability, as well as the concentration and soil mobility of
the nutrient (Bhat et al., 1976; Li et al., 1991; Gahoonia et al., 1994; Wang et al., 2004).
Phosphorus is particularly immobile in soils (Gahoonia & Nielsen, 1991) and the AM
symbiosis can increase plant growth in P deficient soils 19 fold (Hayman & Mosse,
1971). Although P acquisition is a major benefit of the symbiosis, a growing body of
research points towards a more complex role for arbuscular mycorrhizas in nutrient
uptake (Lambers et al., 2008; Liu et al., 2002). Nitrogen nutrition, for instance, is
improved in a number of crop species (Pemer et al., 2008; Ortiz-Ceballos et al., 2007)
and a monoxenic culture system consisting of transformed roots in symbiosis with the
mycorrhizal fimgus Glomus intraradices has been used to demonstrate the capacity of
this symbiosis to transfer N (Govindaraj alu et al., 2005; J in et al. 2005).

Plants take up S primarily as the sulfate anion (Leustek, 1996), which is often
found in low concentrations in the soil. The uptake and utilization of S by plants is
reviewed by Leustek (2000) and Rennenberg et al. (2007). Sulfate is mobile and
commonly lost through soil leaching (Eriksen & Askegaard, 2000). Because of this,
typically 95% of the soil 8 is in organically bound forms such as sulfate esters (Scherer,

2001; Tabatabai, 1984) synthesized by soil microorganisms (Fitzgerald, 1976; Spencer &

48

Harada, 1960). Such forms of S are not thought to be significant sources for plants
(Leustek, 1996). In the past, the effects of leaching have likely been masked by the high
input of S fiom atmospheric pollution. However, the drastic reductions in S deposition in
North America and Europe over the last decade have led to an equally dramatic rise in
reported cases of S deficiency in crop species (Lefohn et al., 1999; Baumgardner et al.,
2002; Riley et al., 2000). Under conditions of low S availability, an arbuscular
mycorrhizal symbiosis can increase the percentage of S in pot grown onions (Guo et al.,
2007) and maize (Banjeree et al., 1999). The ability of mycorrhizal fungi to transfer N
and P from organic compounds (Joner & Jakobsen, 1994; Hawkins et al., 2000,
Govindarajulu et al. 2005) also suggests the possibility that mycorrhizal plants might
obtain S from organic sources.

The small number of reports on the effects of AM colonization on the uptake of
sulfur, which is present in amount equal to P in plants, have presented differing results
(Gray & Gerdemann, 1973; Rhodes & Gerdemann, 1978a; Cooper & Tinker, 1978). The

pioneering study by Gray & Gerdemann (1973) showing that mycorrhizal colonization in

. . 35 ,
clover and maize increased S uptake compared to non-mycorrhizal plants was repeated

by Rhodes & Gerdemann (1978a) in onion, but shown to be heavily influenced by P
nutritional benefits. Rhodes & Gerdemann (1978b) were also the first to examine the
transfer of 358042- through a mycorrhizal fungus exposed to an isolated source
unavailable to the host plant. In a study published the same year, mycorrhizal clover
grown in sterile bi-compartmental soil/agar plates failed to show a significant amount of

transfer of isolated S through the fimgus (Cooper & Tinker, 1978). More recent research

on ectomycorrhizas is more definitive on the subject (For a review see Rennenberg,

49

1999). In the association between Beech seedlings and the ectomycorrhizal fungi
Laccaria laccata or Paxillus involutus, only L. laccata was shown to increase S uptake in
S deficient conditions, and only when N was supplied (Kreuzwieser & Rennenberg,
1998). Interestingly, an analysis of free-living Laccaria bicolor showed that in contrast
with the results from other filamentous firngi and yeast, sulfate uptake was unaffected by
the presence of sulfur metabolites (Mansouri-Bauly et al., 2006). This may be an
adaptation enabling the fungus to continue supplying sulfate to the host after its own
needs are met (Mansouri-Bauly et al., 2006).

Though little is known about the mechanism of S assimilation and its regulation
in mycorrhizal fungi, these pathways have been extensively characterized in other fungal
species (For a review see Marzluf, 1997). Cysteine (cys) is the major entry point of
reduced S into metabolism, and is formed by the reaction of sulfide (made by the
successive reduction of sulfate to sulfite and of sulfite to sulfide) with O-acetylserine
catalyzed by cysteine synthase. However, through the reverse trans-sulfirration pathway,
both Aspergillus and Neurospora species are able to efficiently convert methionine (met)
to cys (Marzluf, 1993), making met an efficient sulfur source for these fungi. This
pathway is crucial in Saccharomyces cerevisiae, where sulfide is assimilated not though
cysteine synthase, but through the sulihydrolation of O-acetylhomoserine to form
homocysteine from which met is made (Ono et al., 1999; Thomas & Surdin-Kerj an,
1997). By contrast, Schizosaccharomyces pombe has been shown to be deficient in
reverse trans-sulfuration pathway enzymes making it dependent on cysteine synthase for
S assimilation (Brzywczy etal., 2002). This results in a reduced regulatory role for met in

S. pombe (Brzywczy et al., 2002). There is also evidence that the S assimilation enzymes

50

are transcriptionally regulated in S. cerevisiae specifically by levels of cys (Hansen &

J ohannesen, 2000). Both positive and negative global regulatory proteins have been
discovered in N. crassa, A. nidulans, and S. cerevisiae that share homology at the protein
level (Marzluf, 1997). In N. crassa and S. cerevisiae, the expression of the S assimilatory
genes is almost completely absent in the presence cys or met, and is greatly reduced by
glutathione (gsh) addition (Ono et al., 1999; Ono et al., 1991; Marzluf, 1997). These
same enzymes in Aspergillus nidulans, on the other hand, are not down regulated in
response to sulfur metabolites (Natorff et al., 2003; Sienko & Paszewski, 1999; Clark et
al., 1997). The transcription of sulfate perrneases is suppressed in all species studied by
low concentrations of S metabolites (Grynberg et al., 2001; Pilsyk et al., 2007; Bradfield
et al., 1970; Cherest et al., 1997; Ketter & Marzluf, 1988; Ketter et al., 1991; Marzluf,
1993; 1997). A putative cysteine synthase transcript has been identified from the AM
fimgus Glomus intraradices (http://darwin.nmsu.edu/~plammers/glomus/), which appears
to be the only report on the identity or regulation of AM fungal genes related to S
metabolism, transport, or regulation.

This study was aimed at determining the forms of S taken up, metabolized, and
transferred to its host roots by the fungal partner in the AM symbiosis. A second goal was
to identify effectors of S transfer to host roots, and to begin to identify AM fungal genes
of S handling and their regulation. Using an AM symbiosis of monoxenic cultured roots
the transfer of S was shown to be nutritionally significant and to be regulated by S
availability to the host and by S metabolite availability to the extraradical mycelia. The
uptake and transfer of reduced S through the symbiosis was also demonstrated. Putative

homologs of sulfur uptake and metabolism genes were also identified and their

51

transcriptional regulation examined, indicating that sulfate uptake is transcriptionally
regulated at the level of sulfate perrnease. These findings allow the development of a

testable model of S uptake and transfer in the AM symbiosis.

52

Experimental Procedures

Chemicals and reagents

Gel-gro gellan (MP Biomedical, Solon, OH) was used for the solidification of

growth media. Radioactively labeled sulfate was obtained as Na23SSO4 from MP

Biomedicals (Solon, OH). Labeled cys and met were separated from a crude mixture of

35S-labeled compounds (TRAN35S-LABELTM; MP Biomedicals, Solon, OH) containing

equal to or less than 70% [3SS]-met and 15% [3SS]-cys. The compounds were separated

using an amino acid analyzer (Hitachi L8800). Retention times for the amino acids were
determined using post-column ninhydrin bonding and UV absorption. The radioactive
compounds were then collected in a ninhydrin-free environment by manual collection of

the appropriate fractions.

Growth media
All experimental procedures used M medium (Fortin et al., 2002) with

modifications to reduce the sulfate content. This was autoclaved and, for culture plates,

solidified with 3.5 gL-1 Gel Gro gellan (MP Biomedicals, Solon, OH). The 3 mM
MgSO4 normally present in M medium was replaced with 0.1 mM MgC12. An additional
2 mM of calcium was added as CaClz to replace the divalent cation concentration needed

for the solidification of Gel-gro. Sulfate was supplied as NaZSO4 at different

concentrations as indicated. Normal microelement concentrations for M media containing

53

0.02 mM sulfate were used for each experiment. These were included in all experiments

with the exception of the measurement of non-mycorrhizal root growth (Figure 1a.). The

medium in the root- but not fungal-compartments contained 10 gL-1 (29.2 mM) sucrose.

NaZSO4 was added to the fungal compartments at the time of labeling as 0.2 mL of

concentrated solution.

Growth of roots and mycorrhizas

Uncolonized Ri T-DNA transformed roots of Daucus carrota (DC2; Diop et al.,

1992) were grown at 25°C with 0.02, 0.12, 0.5, or 3 mM NaZSO4 in modified liquid M

media. Roots were inoculated at plate inception as previously described (Pfeffer et al.,
1999). The roots and fungus were allowed to proliferate on both sides of bi-
compartmented Petri plates at 25°C until the fungal extraradical mycelium was well
developed (~six weeks). The colonized roots and media in each compartment were
transferred to empty compartments of new plates in which the other compartment
contained new medium. At the time of transfer, the media in which the mycorrhizal roots

were growing was supplemented with one quarter of the original nutrient contents

including sucrose and phosphorus, but excluding CaClz, added as ~0.5-1mL of a sterile

solution. Root growth over the barrier after transplantation was prevented by pruning, and
the fungal ERM typically grew over the barrier within one week of the transfer,
colonizing the empty compartment. Fungal compartments were labeled when ERM had
growth into at least half of the media, or within two weeks of crossing the barrier,

whichever was first.

54

Collection of roots and ERM

Root material was collected with forceps and rinsed for 5 min in deionized water

. 35 . .
to remove extemal- and reduce apoplastrc- S. The collected roots were rinsed again

with deionized water in a separate container, blotted dry, frozen in liquid nitrogen, and
lyophilized. ERM was collected by blending the solidified medium at high speed in 10
mM sodium citrate buffer (pH 6.0) at an approximate gel: buffer ratio of 1 :2.5 for 2 min,

which dissolves the gellan (Pfeffer et al., 1999). Tissue was collected on a sieve which

was rinsed with four 30 mL aliquots of cold 10 mM NaZSO4, followed by an equal

quantity of cold deionized water. The final flow through was checked for radioactivity,
which was not detectable by scintillation counting in a 0.5 mL aliquot. To collect ERM
from root compartments, the roots were first removed from the media under a dissecting
microscope. Fungal mycelium collected from the sieve was blotted briefly, and frozen in

liquid nitrogen. Tissue was weighed after overnight lyophilization.

Extraction procedure

For biochemical fractionation, lyophilized fungal mycelium was pulverized with
two 3 mm stainless steel beads using a bead mill (Retsch MM301). Due to the high lipid
content, 0.1 mL of cold methanolzwater (70:30) was added to aid in disruption. The
samples were shaken at 30 Hz for 4 min, and 2 uL samples were analyzed by dissecting
microscope to ensure that hyphae and any spores had been broken. After disruption, 0.9
mL of cold methanolzwater (70:30) was added and the sample was vortexed for 5 min.

Samples were then centrifuged and supematants collected. The cold aqueous methanol

55

extraction was repeated twice more using 1 mL each time, and the supematants pooled.
0.5 mL of supernatant solution was scintillation counted after adding to 5 mL of BioSafe
11 (MP Biomedicals) scintillation cocktail. In order to determine the amount of sulfate in

the samples, the sulfate was precipitated from an aliquot of the aqueous alcohol extract

by adding 0.1 mL of 100 mM NaZSO4 and 0.3 mL of 10 mM HCl solution to 0.5 mL of

the sample followed by vortexing and the addition of 0.1 mL of 100 mM BaClz. Samples

were then incubated for 30 min at 100°C. The resulting barium sulfate precipitate was
removed by centrifugation, and the sulfate-free supernatant was scintillation counted. The
amount of sulfate in each sample was determined by the subtraction of these counts from
those obtained from an aliquot of the original aqueous alcohol extract. Tests with

standards showed that 99.8 +/- 0.1 % of sulfate was removed by this procedure (three

trials with three samples each) and that 96.4 +/- 1.3 % of 35S-Cys and 95.6 +/- 1.6 % of

35 . . .
S-Met remained in solutron.

Residues after aqueous ethanol extraction were extracted using lmL of protein
extraction buffer containing 9 M urea, 1 % SDS, 25 mM Tris-HCl pH 6.8, 1 mM EDTA,
and 0.7 M 2-mercaptoethanol as described by Osherov and May (1998). After vortexing
and centrifugation at 10,000 rpm for 5 minutes, 0.5 mL of the supernatant was added to 5
ml of scintillation cocktail and counted. The remaining cellular debris was transferred to
sealed glass vials containing 0.5 mL TS-2 tissue solubilizer (MP Biomedicals) and
incubated at 70°C for 1-2 weeks until solubilized. The solubilized solution was mixed
with 5 mL of scintillation fluid and titrated to pH 7 with HCl. This solution was diluted

ten fold to diminish color quenching and analyzed by scintillation counting.

56

Dried roots were pulverized in 15 mL centrifirge tubes with ten 5 mm metal beads
for 30 min using a paint shaker. Five mL of cold methanolzwater (70:30) was added to
the powder and the tubes were vortexed for five minutes. While keeping particulates
suspended, a 1 mL aliquot of the solution was transferred to a microcentrifuge tube and

centrifuged. Subsequent steps were as for firngal samples.

Measurements of 353 in media

Three 1 cm diameter wells were excavated in the gel at the time of labeling with a
sterilized cork borer as far from one another as possible. 0.1-0.2 mL of media of the same
composition as that in the compartment being analyzed was added to each well, and this

volume was maintained through weekly refilling as needed. At the start of the

experiment, label was added to one of the wells, and 35S in each of the three wells were

measured after one week to ensure efficient diffusion of the radioactivity through the

plate. 358 contents were measured by adding 50 pl of liquid media to 5 mL of

scintillation fluid, followed by scintillation counting.

Non-mycorrhizal root measurements

Roots were grown on solidified M media containing 0.12 mM S as NaZSO4 for

four weeks and ~5cm root segments were aseptically removed, weighed, and added to

20mL of liquid M media without S (ZnSO4* 7H20 and CuSO4* 5H20 replaced by 1.2

mg of ZnCl and 0.5 mg of CuClz) for measurements of sulfur-mediated growth

57

limitation. For each sulfate concentration (0, 0.005, 0.01, 0.02, 0.05, 0.1, 0.5, and 3 mM),
roots were weighed then placed on 20 mL of solidified media per side of three bi-
compartrnental petri plates and allowed to grow for three months. The roots were
collected, dried at 70°C overnight, and weighed. To measure S uptake, roots were grown

at 0.12 mM sulfate as above and transferred into 20mL of S- media solidified with gellan

containing 0.02, 0.12, or 3mM sulfate labeled with 11.5 uCi of Naz[3SSO4]. After four

weeks, the roots were removed fi'om the media, rinsed several times in deionized water to
remove external radioactivity, lyophilized, and weighed. The extraction procedure for the

radio-labeled tissue was simplified to include only the aqueous alcohol and solubilization

steps.

Addition of S metabolic regulators
Cys, met, and gsh were added to a final concentration of 1 mM (as 0.2-0.5 ml of

sterile aqueous solutions) to the fungal compartments of split plates with ten week old

roots growing with 0.52 mM NaZSO4. The uptake of 37.4 uCi of Naz[3SSO4], which was

added to fimgal compartments simultaneously with metabolic regulators and 0.12 mM

Na2804, was monitored by analyzing aliquots of media from a liquid filled well as

described above. The plates were collected at 2, 4, and 6 weeks. The fungal mycelium
was collected by dissolving the gellan in a blender with 10 mM sodium citrate (pH 6),
then sieving the blended solution. The roots were extracted from the media using forceps
and rinsed in deionized water for five minutes before freezing. The fungal and root

tissues were extracted as described above.

58

Using cultures grown as for the above experiment, 1 mM of cys labeled with 25.7

uCi of [3SS]cys or 1 mM met labeled with 54.2 uCi of [3SS]met was applied to the fungal

sides of 15 plates as the sole S source. The plates were incubated at 25°C for one month

prior to collecting and extracting the biochemical fractions as described above.

RNA extraction and putative gene fragment isolation

Sequences of putative sulfur gene fragments were identified fiom an EST
database (Jun et al., 2002) and from additional high throughput sequencing data (PJ
Lammers, Shachar-Hill and coworkers unpublished results) from cDNA made from
extraradical mycelium. To confirm their identity, total RNA was extracted using the
RNeasy Plant Mini Kit (Qiagen, Valencia, CA) from frozen G. intraradices germinating
spore tissue, disrupted as already described using a bead mill, followed by DNA removal
using RNase-fiee DNase (Turbo DNA-free; Ambion, Austin, TX). Samples were split
into two aliquots following quantification by absorbance for the synthesis of cDNA and a
control without reverse transcriptase. cDNA was synthesized using SuperScript II reverse
transcriptase(1nvitrogen corp., Carlsbad, CA). Primer sets were developed from EST and
high throughput sequencing data as follows: Putative sulfate perrnease forward primer 5’-
TAGCAATAATTACAAGAATACCAG-3’, and reverse primer 5’-
GGGATTCTTATCTTGGAA-3’; putative cystathionine B-synthase forward primer 5’-
CTAGCCACTCCTGTAATTGTTCCTC -3’, and reverse primer 5-
GAGAAAGCAGGAATACTTAAACCAGG -3’; putative cystathionine y-lyase forward
primer 5’- GGTGGAATGTTAAGTTTTAGGATTAAGG -3 ’, and reverse primer 5’-

CATCAACATCTTCGATACCGATG-3’. PCR products were separated by and isolated

59

from agarose gel using the QIAquick Gel Extraction Kit (QIAGEN GmbH, Germany)
and sequenced by an ABI PRISM® 3100 Genetic Analyzer. (Applied Biosystems, CA,
USA). Resulting sequences showed single open reading frames. The sequences studied
were submitted to GenBank and given the following accession numbers: Putative high
affinity sulfate perrnease (FJ 161947); putative sulfate adenylyltransferase (FJ 161948);

putative cystathionine y-lyase (FJ 161949); putative cystathionine [El-synthase (FJ 161950).

Quantitative real time PCR measurements

Mycorrhizal split plates were grown until the fungal compartment was
approximately half colonized. To the fungal compartment 1 mL of a filter sterilized
solution containing either sodium sulfate or sodium sulfate and cys was applied to give a
final concentration of 0.12 mM sulfate and 1 mM cys. Plates were incubated for 24 hrs
before tissue from five to seven plates was collected as described above and immediately
frozen in liquid nitrogen. RNA was extracted and converted to cDNA as described above.
The initial qRT-PCR reaction mixture containing primers at a concentration of 300 nM
and 1 ng of cDNA template was made to 0.015 mL in a 96 well plate, 0.01 mL of which
was transferred to a 384 well plate and the PCR reactions were monitored using an ABI
Prism 7900 HT Sequence Detection System (Applied Biosystems, Austin, TX) with the
following cycling program: 50°C for 2 min, 95°C for 10 min followed by 40 cycles of
95°C for 15 sec and 60°C for l min. Power SYBR Green 2-Step Master Mix (Applied
Biosystems, Austin, TX) was used for all real time PCR assays. The AACT, and
comparative CT, methods were utilized for the determination of relative gene expression

(Livak and Schmittgen, 2001). The expression of an S4 ribosomal protein was used to

60

normalize relative gene expression data as described by Govindaraj alu et al. (2005).
Other primer sequences (IDT, Syntegen, Skokie, IL) for QRT-PCR were designed using
Primer Express software from Applied Biosystems (Austin, TX) as follows: Putative high
affinity sulfate perrnease forward 5’-TTGGATCATTCTTTCATGCGTATC-3’, reverse
5’- GACACCGGCTAATGGAGTACGT-3’; putative S-adenosyl transferase forward 5’-
CCGGAGTTGATGATCCTTACG-3’, reverse 5’-
ACTGACACACTGTTTACTAACATCAACAA-3’; putative cystathionine B-synthase
forward 5’-TGCTTCAGTTGGTGTACGAACAA-3’, reverse 5’-
AAATGAGCCAGGAAAAGGTTGA-3’; putative cystathionine y-synthase forward 5’-
GACCAGCGTGAGTCATTTTAGAAG-3 ’, reverse 5 ’-
AGCTGAATCTTTGGGTGGTGTT-3’. Experimental samples were measured using six
technical replicates for each of three biological replicates per condition, and errors were

expressed as standard error of the mean.

61

Results

Growth and sulfate uptake by non-mycorrhizal roots

To establish conditions for studying S transfer between host roots and AM
fungus, the relationship between sulfate availability, root growth, and sulfate utilization
was investigated in uncolonized roots (Figure 2-1). In the absence of available sulfate
there was a three fold decrease in root growth compared to growth under saturating
sulfate levels (3 mM; Figure 2-1A). Final dry weights were not significantly different
when compared singly at sulfate concentrations above 0.005 mM, however there was a
consistent trend of increasing dry weight with increased S availability. Root growth was
detected even in roots exposed to medium containing no S, probably due to internal S

stores within the initial root segments. A much greater difference was seen in the uptake

and incorporation of sulfate when roots were labeled with 35804-2 at high (3 mM), low

(0.014 mM), or intermediate (0.114 mM) sulfate levels (Figure 1B). There was a close to
four fold increase in both aqueous alcohol-soluble and —insoluble S content from low to
intermediate S conditions, and an eleven fold increase between low and high S. A
reduction in the root compartment sulfate concentration from 3 mM to 0.12 mM resulted
in a reduction in uptake of 64% (Figure 2-1B), with little or no reduction (27% difference
in mean values, not statistically significant at the 95% confidence level) in growth
(Figure 2-1A). Lowering the sulfate available to mycorrhizal roots to less than 0.05 mM
had a negative impact on the symbiosis, reducing the number of plates where the firngal
ERM grew over the barrier from greater than 80% to less than 20% (data not shown).

There was no such reduction when 0.12 mM sulfate was utilized.

62

30-

25‘

:: -Jr’irJl—i

Root Growth (mg DW)

 

 

5)“ SS—

0 0.025 0.05 0.075 0.1 0.5 3.

O

8042' Concentration in Media (mM)

to

S Incorporation (ug mg'1 DW)

 

 

0.02 0.12 3
8042' Concentration (mM)

Figure 2-1 The effect of sulfate concentration on the growth and sulfur incorporation of
non-mycorrhizal transformed carrot roots. (A) Root growth measured as dry weight
increase at different concentrations of NaZSO4 in 20mL of modified liquid M media
(St.Arnaud et.al., 1996). (B) The incorporation of S from solid media containing 0.02,
0.12, or 3 mM NaZSO4 labeled with 11.5 uCi of Na2[35SO4] was measured in roots after
four weeks of labeled growth. Labeled root compounds were extracted with cold
MeOHzHZO (70:30) (white bars) before the cellular residue was solubilized in tissue

solubilizer (gray bars). The fractions were analyzed by liquid scintillation counting. Error
is expressed as standard error of the mean.

63

 

 

 

S Removed from Media (pg)
0)
O

o 10 20 30 4o 50 60 70
3 Days Labeled

NNWQ§§
§$8$88

1501
“Iii

  

S Incorporation (ng mg"I DW)
01
O

 

O

Fungal S- Fungal S+ Root 8- Root S+

Figure 2-2 Increased sulfate availability in the root compartments of split plates reduces
transfer of S through the distal fungal ERM. (A) The uptake of S by ERM from plates
labeled with 30 uCi of Na2[3 5 504] in 0.12 mM Na2SO4 in the fungal compartments was
measured as the removal of radioactivity from the media when the root compartments

were supplied with moderate S (0.12 mM NaZSO4; solid line) or high S (3mM NaZSO4;
broken line). (B) Measurements of S incorporated into the roots (Root S+/-) and distal
fungal (Fungal S+/-) ERM from the above experiment after 66 days of labeling; S+ refers
to high sulfate levels (3mM) in root compartments and S- to moderate levels (0.12mM).
Radioactivity was measured by scintillation counting after a crude separation by cold
MeOHzHZO (70:30) extraction (white bars) followed by solubilization of the remaining
tissue (gray bars). The aqueous alcohol extraction dissolves sulfate, sulfite, S amino
acids, and potentially also unidentified sulfated esters while the remainder includes
proteins, sulfolipids, and other unknown products. Values are presented as mean +/- s.e.m
(n25).

64

Fungal uptake and transfer of sulfate is influenced by root access to sulfate
The extraradical mycelium of Glomus intraradices takes up sulfate at significant

rates (Figure 2-2A) and transfers most of it to the mycorrhizal roots (Figure 2-2B). The

35 . . .
total amount of S in ERM tissue was less than 5% of the amount found in the root

tissue, owing to the greater than twenty-fold increase in biomass between the two (tissue
mass data not shown). The availability of S in the root compartment strongly influences
fungal uptake in the distal ERM compartment. More than twice as much sulfate was
removed from the fungal compartment when the corresponding root compartment was

exposed to 0.12 mM versus 3 mM S (Figure 2-2A). When roots were grown in 0.12 mM

sulfate, uptake by the fungus was linear up to day 40 (R2 = 0.98). The fungus removed

0.98 pg of S from the media per day during this time. Fungal uptake of S when 3 mM

sulfate was supplied to roots was linear (0.83 pg of S per day, R2 =0.92) only for the first

20 days before the rate of removal slowed.

The total amount of S transferred from the fungal compartment to roots grown at
high sulfate levels was about one quarter of that in roots exposed to moderate sulfate
levels (Figure 2-2B). In contrast, there was no significant effect of sulfate levels in the
root compartment on the incorporation of S by the distal ERM. Additionally, in roots

growing at moderate S levels the fraction containing sulfate and the sulfur amino acids

. . . 35 . . .
contained approxrmately twrce as much S as did the same fraction in the ERM.

35 . . .
The amount of S in the media of the colonlzed root compartments was

monitored throughout the experiment (see methods) and found to be low. The movement

into the root compartment media from the fungal compartment was linear (R2 = 0.98) at

65

63 ng S per day when the root compartment media contained 0.12 mM sulfate. This

represents 6.4% of the amount transfer to the roots. The movement into the high S root

media was also linear (R2 = 0.99) with 55 ng S per day being moved across the barrier,

representing 6.6% of the amount transferred to the roots.

66

Figure 2-3 Transfer of 358042- through the fungus versus direct root uptake. (A) The
uptake of S over 104 days from root and fungal compartment media. The root (proximal)

compartments of split plates were labeled with 17.3 pCi of Naz[35SO4] in 0.2 mM
NaZSO4 (171 pg S). Half of the fungal (distal) compartments were labeled with 17.3 pCi
of Na2[35SO4] in 0.2 mM Na2SO4 (171 pg S, open diamonds, solid line), while the

others contained 0.02 mM sulfate without S (closed squares, broken line). Distal uptake
was monitored from labeled plates (closed triangles, solid line). A straight broken line
denotes the total initial S content of the proximal compartment media. (B) Incorporation

of 358 by roots when the fungal side was supplied with low unlabeled (0.02 mM) or

moderate 35S-labeled (0.2 mM) sulfate was measured after 110 days of labeling by
chemical fractionation into sulfate- (white bars), amino acid- (light gray bars), and
protein-containing (medium gray bars) pools, and solubilized remaining tissue (dark gray

bars) pools measured by liquid scintillation counting. (C) Incorporation of S into
different pools of ERM collected from the root or fungal side compartments of split
plates when the filngal compartments contained 0.02mM unlabeled sulfate (S-) or 0.2mM

of 358 labeled (S+); as above the root side compartments of all plates contained 0.2mM

358 labeled sulfate . Fractions are depicted as in panel A. Values represent means +/-
s.e.m. (n24).

67

Figure 2-3

00..

our

563 9:;

ow

 

b

n. in

\IIM

.....M
NH.

 

 

ON
ow
cm
oo
oo v
ON _.
ov _.
om _.
cm 9

(6n) elpew won peaouleu s

68

Figure 2-3 (cont’d)

1.6-
1.4‘
1.2:

 

le—i

 

 

 

 

 

 

 

o.a - -.
0.6 - 1
0.4 -
0.2 l

 

S Incorporation (pg mg'1 DW)

0.02 mM 0.12 mM
$042- in Fungal Side Media (mM)

600 -
500 l
400 -
300 .

200 '

S Incorporation (ng mg-1 DW)

 

 

   

Fungal Side ERM Root Side ERM

69

Fungal transfer of s to the mycorrhizal roots versus direct uptake by roots

The relative contribution of S obtained from the fungal ERM to total root S was

determined at intermediate S levels (0.22 mM) by comparing filngal derived 358 in roots

with 358 directly absorbed by the roots themselves. Plates were labeled with 358042- in

the root compartment to determine the amount of S incorporated by direct root uptake.

Half of these plates were also labeled in the fungal compartment with 358042- at 0.22

mM sulfate while no S was added to the fungal compartments of the remaining plates.
The roots took up most of the labeled sulfate initially provided within 8 weeks (Figure 2-
3A). This uptake was not affected by the presence of sulfate in the fungal compartments.
The uptake of S from the fimgal compartment media began when the fungus crossed the
barrier (~30 days after inoculation) and was comparable to direct root uptake rates in the
next few weeks (Figure 2-3A). S incorporation by the root and fungal tissue after ~10

weeks of grth is shown in figures 33 and 3C. When the fungal compartment contained
358042: the total incorporation of S by the roots increased by ~25% (Figure 2-3B). The
largest change was in the sulfate fraction, which increased by 60%. There were no
significant differences in root grth observed when sulfate was added to the fungal

compartments (root weight data not shown), which is consistent with the lack of

significant grth increase between moderate and high sulfate growth conditions (Figure

2-1). When the fungal side was labeled, total incorporation of 35$ by the fungus was

similar in ERM collected from the fungal and root compartments when the fungal side
was labeled (Figure 2-3C), which is consistent with the absence of any known

physiological differences between the ERM in the two compartments, and showing that

70

the availability of S to the distal ERM did not affect incorporation by the ERM in the root

compartment. 358 accumulated in the fungal ERM from the unlabeled fungal

compartment showing that in a low S environment (0.02 mM) S can be moved by the

fungus from the root compartment to the distal ERM (Figure 2-3C).

71

>

 

 

 

 

 

 

140-
A

E . .I.
o 120
To: A AB
E 100- ..
or B 3
5 so g ‘
c ‘3'
.2 B
4.:
S 60‘ B
o
O.
'5
o 40~
.E
ID
.. 20-
O
O C
m ‘ ‘ A

0-1

8042' cvs MET GSH

Figure 2-4 The effect of common sulfur metabolite repressors cysteine, methionine, and
glutathione on the transfer and allocation of 35$ in an arbuscular mycorrhiza. The
incorporation of 358 into roots and fungal ERM was analyzed afier labeling the distal
compartments with 37.4 pCi of Na2[35SO4] in 0.12 mM Na2s04 (91 pg S) alone

(8042-), or with lmM cysteine (CYS), lmM methionine (MET), or lmM reduced
glutathione (GSH). Root (panels A-C) and fungal (panels D-F) was analyzed after two
(A,D), four (B,E), and six (C,F) weeks. Fungal ERM was collected from the distal
compartments of same plates as those from which root tissue was collected from the
proximal compartments. Tissue was analyzed by chemical fractionation into pools
containing sulfate (white bars), amino acids (light gray bars), proteins (medium gray
bars), and the tissue solubilized biomass remaining afier extraction (dark gray bars).
Fractions were analyzed by liquid scintillation counting. Letters within the bars represent
ANOVA single factor analyses between bars of that type. Letters above the complete bar
graphs are the analyses of total S uptake. Values are reported as mean +/- s.e.m. (n25).

72

Figure 2-4 (cont’d)

 

 

 

 

 

 

 

c c _a
CB
B
A B
A
B B B
A
l
A A 1
fl - .t — — [—I
0 O 0 0 0
0 5 0 5 0 W 0
3 2 2 1 1

cso F.mE w 9.: :0320385 m «com

CYS MET GSH

$042-

73

Figure 2-4 (cont’d)

AB

 

 

 

300 -

250 -
0

.25 :9: m

o
5 0 5
1

m5 :ozfloahoofi w «com

GSH

MET

CYS

74

Figure 2-4 (cont’d)

D

 

 

250 -

200 r
150 '
0

5

:50 F.mE w 9: 53209.85 w 395....

GSH

MET

CYS

75

Figure 2—4 (cont’d)

 

 

400 ~

0 0 0
o 5 0 5
2 1 1

:50 F.9: w 55 cozfionuoofi w _umcam

350 r
o .
250 ~

GSH

MET

CYS

76

Figure 2-4 (cont’d)

F

 

 

 

300 ‘

250 ‘
200 *
150 ‘
100 ‘
50 r

:50 F.mE w as cos—20985 m 395....

GSH

MET

CYS

77

The effect of sulfur metabolites on sulfate uptake and transfer through the
mycorrhizal symbiosis

Radio-labeled sulfate was added to the fungal compartments of split plates
together with methionine (met), cysteine (cys), and glutathione (gsh) in amounts
previously shown to suppress sulfate assimilation in other filngi (Kuras & Thomas, 1995;

Ono et al., 1999; Ketter & Marzluf, 1988; Ketter et al., 1991; Grynberg et al., 2001). The

. . . 35 . . .
distributlon of S in root and fungal tissues was then measured after two, four, and srx

weeks. Substantial quantities of S were transferred to the roots over the course of the
experiment despite the presence of 0.5 mM sulfate in the root compartments (Figure 2-4A
to C). The presence of cys decreased S transfer to the mycorrhizal roots by an average of
45% throughout the experiment, with the sulfate- and amino acid- containing pools of S

in the roots showing larger fractional decreases. Methionine had no significant effect on

. . . 35
total S transfer although there were srgnlficant decreases in the S transferred to the low

molecular weight soluble metabolite pools in mycorrhizal roots. Glutathione dramatically

35 . . . . . .
reduced S accumulation 1n the roots at all time pornts, With an average reduction of

80%. There were no significant effects of the presence of cys, met or gsh on total S
incorporation from labeled sulfate by the distal ERM and little or no effect on the
partitioning of S within this tissue (Figures 2-4D to F).

Glutathione greatly reduced the growth of fungal ERM in the distal compartment
though not the root grth (not shown) so it is unclear whether the reduction in the
transfer of S by gsh treated ERM is due to the regulation of sulfate uptake or simply to

reduced fungal growth. Neither cys nor met significantly affected the grth of fungal

78

ERM or roots, with ERM biomass approximately doubling between weeks two and four
(data not shown). Thus the effect of cys on S transfer to mycorrhizal roots does not

appear to be due to growth inhibition.

79

350 ]
300 i
250 -
200 -
150 -
100 -

50*

 

 

 

 

CYS ROOT CYS ERM MET ROOT MET ERM

Figure 2-5 Transfer of reduced S through a mycorrhizal symbiosis. Mycorrhizal roots
were grown in 0.5 mM Na2804 and the filngal partner allowed to grow into distal
compartments containing either lmM cysteine (CYS) labeled with 25.7 pCi [ S]-Cys or
lmM methionine (MET) labeled with 54.2 pCi of [3SS]-Met as the sole S source. Roots
and fungal distal ERM were collected afier four weeks of labeling and the radioactive

counts split into different biochemical fractions. Fractions included SO4 _ (white bars),
amino acids (light gray bars), proteins (medium gray bars), and the remaining solubilized
cellular material (dark gray bars) and were obtained through scintillation counting.
Values are reported as mean +/- s.e.m. (n=9).

8O

Fungal uptake and transfer to host roots of reduced 3

Fungal ERM imports and transfers substantial amounts of reduced S supplied as

cys or met (Figure 2-5). The amount of S transferred when 35S-labeled cys is the sole

source of S in the fungal compartment is comparable to the S transfer when plates are
labeled with sulfate (Figures 2-2B, 2-3B, and 2-4A to C). Roughly half of this amount
was transferred when met was provided (Figure 2-5). The incorporation of S by the
fungal mycelium per mg dry weight when labeled cys is supplied to the fungal
compartment is less than the level found in the roots by about 40%. Utilizing met as an S
source led to a 46% increase in the amino acid fraction in the ERM (Figure 2-5). There
were striking differences between the relative amount of S in the solubilized fractions in
both roots and fungal mycelia when reduced S was supplied compared to sulfate.
Labeling with cys and met resulted in a much higher percentage of labeling in the
solubilized root tissue pool (78% and 88%, respectively) than when sulfate was supplied
as the primary S source (7-21%; Figures 2-4A to D). The opposite relationship was found
in fungal mycelia, where applying cys or met as primary sources of S led to solubilized
tissue fractions that were at most 8% of total S incorporated (Figure 2-5). When labeled
sulfate was the primary S source, 5-22% of the total S incorporation is found in the tissue

solubilized fraction (Figures 2-4D to F).

Gene expression measurements

The expression of fungal transcripts encoding putative genes involved in sulfate
assimilation was analyzed in relation to the application of cys to the distal ERM. Partial
sequences of transcripts representing putative sulfur assimilatory genes were identified by

high throughput 454 sequencing of cDNA from fungal ERM grown in split plates in M

81

medium (3mM sulfate). These included a 234 bp sequence with 67% identity at the
amino acid level to SULl from S. cerevisiae, and a 247 bp sequence with 67 % and 70%
identities at the amino acid level to sulfate adenylyltransferase from A. nidulans and A.
terreus, respectively. Sequences with homology to enzymes defining the reverse trans-
sulfuration pathway were also identified. These included a 403 bp sequence with 79%
and 71% identities at the amino acid level to cystathionine B-synthase from A. fumigatus
and CYS4 from S. cerevisiae. Additionally, a 220 bp sequence was identified with 58%
and 69% amino acid identities to CYS3 from S. cerevisiae and cystathionine y-lyase from
A. fumigatus. The presence of transcripts for these putative sulfur genes is are consistent
with sulfate uptake and assimilation via the usual assimilation pathway, and also strongly
suggests the presence of the reverse trans-sulfuration pathway in AM fungi. The
expression of the sulfate perrnease and reverse trans-sulfuration enzyme candidates were
analyzed in ERM after exposure to 0.12 mM sulfate, with or without the presence of 1
mM cys. The conditions were chosen to enable the comparison between gene expression
changes and the uptake and transfer of radio-labeled sulfate with cys addition (Figure 2-
4A to C). There was a reduction in the expression of the candidate high affinity sulfate
perrnease sequence by a factor of 3.15 +/- 1.15. The expression of sequences with
homology to sulfate adenylyltransferase and cystathionine y-lyase was not significantly
different between treatments. The expression with cys addition of the putative
cystathionine y-lyase sequence studied was significantly different. However, the

difference was small (less than two fold).

82

 

 

Fold Change

 

 

SUL SAT cpsyn Cv s

Figure 2-6 Fungal gene expression changes in response to the addition of 1 mM cysteine
to ERM. Expression relative to control plates of sequences with homology to high
affinity sulfate perrnease (SUL), S-adenosyl transferase (SAT), cystathionine B-synthase
(CBsyn), and cystathionine y-lyase (Cylse) was analyzed by quantitative real-time PCR
using a ribosomal protein sequence as a control as previously reported (Govindaraj ulu et
al., 2005; see methods). RNA was extracted from ERM tissue collected after 24 hr
incubation with 0.12 mM S042; and with or without 1 mM cys added to the distal
compartments of five split plates per sample. Values are reported as mean +/- s.e.m. (n=3
biological replicates each consisting of tissue from 5 to 7 plates).

83

Discussion

The uptake of 35$ by non-mycorrhizal roots was dependent on the external sulfate

concentration (Figure 2-1B), as has been reported for tomato seedlings and carrot storage
root sections (Lopez et al., 2002; Cram, 1983). In carrot, Cram (1983) showed a
proportional increase up to an external concentration of 50 mM, leading the authors to
conclude that feedback inhibition of sulfate uptake is absent. Vegetative root growth was
less affected by alterations in available sulfate concentrations than was uptake or
reduction (Figure 2-1 A). Subsequent measurements of mycorrhizal uptake activity were
conducted using sulfate concentrations that increased potential differences in root uptake
and contents and minimized the limitation of growth by S.

Bi-compartmental Petri plate cultures are a well established model mycorrhizal
system (St. Amaud et al. 1996) used extensively in studies of mycorrhizal metabolism
and nutrient transfer (e. g. Govindarajulu et al., 2005). This system made possible the use
of defined media and the isolation of the majority of extra-radical mycelium (ERM) from
the rhizosphere, allowing S movement through the ERM to be quantified. With moderate

S levels available to the roots (0.12 mM), uptake and transfer by the fungus increased the

amount of S in the roots by 25% (Figure 2-3B). The movement of 358 into roots was also

observed in all the experiments regardless of the S-source utilized in quantities much
higher than those found in fungal ERM. Fungal uptake and transfer of S was influenced
by the concentration of sulfate available to the host roots. Increasing the sulfate
concentration in the root compartment from 0.12 mM to 3 mM resulted in a halving of

fungal uptake (Figure 2-2A), while approximately one fifth of the amount of transferred S

84

was found in roots grown in 3 mM sulfate compared to the amount found in roots grown
in 0.12 mM sulfate (Figure 2-23). These reductions may be due to host signaling and/or

to changes in the concentration gradient of S at the rootzfungal interface.

After supplying 35S-sulfate to the fungal compartment under a range of

conditions, labeled sulfate was invariably found in roots in amounts that dwarfed the total

quantities in the fungal mycelium. For example, after six weeks of labeling the fungal

. 35 2- . .
compartment With 804 , total sulfate in the fungus was 5.1% of the amount in the

roots (Figures 2-4C and F). Roots in that experiment were grown in 0.5 mM sulfate and
the distal ERM was supplied with 0.12 mM, and the same was true (5.3%) when the roots
were grown in 0.22 mM sulfate and the fungus was also labeled with 0.22 mM sulfate
(Figure 2-3B and C). Based on this evidence one may conclude that the sulfate anion is
transferred by G. intraradices to host roots. However, as shown in Figure 5, the fungus is
clearly also capable of the uptake and transfer of reduced forms of S at rates comparable
to sulfate. Thus the ERM can supply the host plant with organic forms of S from the soil.
Since an estimated 95% of the S in soils is in organic forms, the ability of mycorrhizal
plants to access S from this source is potentially important for plant nutrition.

The first steps towards understanding the regulation of sulfate uptake by a
mycorrhizal fungus in the symbiotic state were taken by analyzing the effect of common
sulfur metabolite repressors cys, met, and gsh on the uptake and transfer of radio-labeled
sulfate through the fungus. The addition of 1 mM met was shown to suppress the
expression of sulfur assimilation pathway genes in yeast (Kuras & Thomas, 1995) and the
complete suppression of uptake has been demonstrated in the presence of ten times lower

levels (Breton & Surdin Kerjan, 1977). This finding was later refined by mutant analyses

85

and the suppression shown to be due to the synthesis of cys through the reverse trans-
sulfuration pathway (Ono et al., 1999). The sulfate perrneases $3 in A. nidulans and
Cysl4 in N. crassa are also strongly suppressed by met (Ketter & Marzluf, 1988; Ketter
et al., 1991; Grynberg et al., 2001). In contrast to these organisms, the addition of 1 mM
met to the fungal compartments of mycorrhizal split plates had no significant effect on
total sulfate uptake and transfer (Figure 2-4).

By contrast the application of 1 mM cys to the ERM resulted in S transfer from
fungus to mycorrhizal roots being approximately halved, (Figures 2-4A to C). The
amount by which sulfate transfer is reduced in the presence of cys (Figure 2-4) is similar
to the level of S that is taken up as cys and transferred to the roots (Figure 2-5). Labeled
gsh has been shown to be imported by ectomycorrhizal oak trees at rates comparable to
sulfate (Seegmiiller & Rennenberg, 2002). However, the addition of 1 mM gsh to
endomycorrhizal distal ERM resulted in a suppression of the growth of this tissue. While
the transfer of sulfate continued and the assimilation by the ERM was largely unaffected
on a per mg basis, S transfer was greatly diminished. Since gsh also suppressed the
expression of the putative sulfate perrnease (data not shown), it is unclear how much of
the effect of gsh was due to regulation of transport and how much to repression of ERM
growth. Thus the regulation of S uptake and metabolism in G. intraradices is different
from that in other filamentous fungi studied to date.

The changes in expression of genes putatively involved in sulfate transport and
assimilation indicates a role for transcriptional regulation of sulfate perrnease in the
reduction in sulfate transport in the presence of cys. The reduction in S transfer of 45%

with the application of 1 mM cys to distal ERM (Figure 2-4C) correlated with a 3.8 +/-

86

1.2 fold reduction in the expression of mRNA encoding a putative sulfate perrnease. The
lack of a significant change in the expression of a cDNA sequence with high homology to
S-adenosyl transferases suggests that the reduction in S transfer is a function of reduced
uptake rather than sulfate reduction. However, the analysis of more S assimilation
pathway genes and compartment-specific sulfate pennease isozymes is needed before
concluding that the transcriptional regulation of this sulfate perrnease gene explains the
reduction in S transfer with the addition of cys. Sequences encoding putative genes with
homology to cystathionine B-synthase and cystathionine y-lyase were also identified.
Their expression is indicative of a functional reverse trans-sulfirration pathway in Glomus
intraradices, akin to A. nidulans and S. saccharomyces, but unlike S. pombe (Ono et al.,
1992a, 1992b; Paszewski and Grabski, 1975; Brzywczy et al., 2002). The putative
cystathionine B-synthase sequence was slightly down-regulated (1.49 +/- 0.41 fold) in the
presence of cys while the sequence with homology to cystathionine y-lyase showed no

significant change.

87

S042'(our)

 

 

 

 

 

 

 

 

 

ROOT 2- —» 5 REDUCED
$04 (ROOT) ( )
“ Protein
Protein
IRM I
——..’. S(REDUCED)
......— _____ 5 4| 4| _ L.._—_
2- _
SC’4 (our)

 

 

 

 

lip
\ rise—--- I l/

S042'(our)

 

 

Figure 2-7 Model depicting S transfer through an endomycorrhizal symbiosis. Roots
and fungal mycelium both import SO42- from external sources, and fungal uptake can
supply isolated mycelium. The transfer of S04} through the mycorrhizal symbiosis is
inversely proportional to root uptake. (23ys and met are imported by the fungus, resulting
in a reduction of fungal uptake of S04 _ (dashed line) and the transfer of a reduced form
of S to the root (S(REDUCED)). The reduction of 8042- and uptake of reduced S leads to
incorporation in the protein pools in both roots and fungus. Putative steps in the
assimilation pathway based on sequence data are depicted as gray arrows. Steps
involving putative sulfur assimilation genes are labeled in gray letters as follows: (a) high
affinity sulfate perrnease; (b) sulfate adenylyltransferase; (c) y-cystathionine lyase; (d) B-
cystathionine synthetase. IRM, intraradical mycelium; ERM, extraradical mycelium.

88

Figure 2-7 is a working model consistent with the findings presented. We have
demonstrated uptake, assimilation, and transfer of sulfate (Figures 2-3B and 2-4A to C)
and of reduced S (Figure 2-5) by the fungal partner to the host roots in physiologically
significant quantities, along with bidirectional transport of sulfate within the fungal ERM
(Figure 2-3C). The inverse relationship between the rhizospheric sulfate concentration
and the amount of sulfate uptake from the fungal compartment (Figures 2-2A to B)
suggests that an increase in root intracellular or apoplastic sulfate can suppress both the
transfer of sulfate from the intraradical hyphae to the host and the uptake by the
extraradical hyphae. This relationship is depicted in the model as the negative regulation
of sulfate transfer across the rootzhyphal interface by root sulfate levels, which
subsequently results in an increase in the fungal intracellular sulfate concentration and
suppression of uptake in the distal ERM. The relationship between the transfer of a
reduced form of S when cys or met are imported by the fungus and the uptake of sulfate
in the presence of cys and met suggest a simultaneous transfer of sulfate and reduced. S
and/or a regulatory response. Relative real-time PCR measurements of expression for a
putative high affinity sulfate perrnease gene revealed a ~73% reduction in transcript
levels when the ERM was exposed to 1 mM cys, indicating a regulatory effect on sulfate
uptake (Figures 2-6 and 2-7). The working model proposed is a testable interpretation of
the findings presented that invites future experiments to verify gene identities, localize

expression within the host roots and analyze regulation in mycorrhizas of whole plants.

89

References

Banerjee R, Evande R, Kabil O, tha S, Taoka S. 2003. Reaction mechanism and
regulation of cystathionine beta-synthase. Biochimica Et Biophysica Acta-Proteins and
Proteomics 1647(1-2): 30-3 5.

Baumgardner RE, Lavery TF, Rogers CM, Isil SS. 2002. Estimates of the atmospheric
deposition of sulfur and nitrogen species: Clean Air Status and Trends Network, 1990-
2000. Environmental Science & Technology 36(12): 2614-2629.

Bhat KKS, Nye PH, Baldwin JP. 1976. Diffusion of phosphate to plant roots in soil .4.
Concentration distance profile in rhizosphere of roots with root hairs in a low-P soil.
Plant and Soil 44(1): 63-72.

Bradfield G, Somerfield P, Meyn T, Holby M, Babcock D, Bradley D, Segel IH.
1970. Regulation of sulfate transport in filamentous fungi. Plant Physiology 46(5): 720-
732.

Breton A, Surdinkerjan Y. 1977. Sulfate uptake in“saccharomyces-cerevisiae -
biochemical and genetic study. Journal of Bacteriology 132(1): 224—232.

Brundrett MC. 2002. Coevolution of roots and mycorrhizas of land plants. New
Phytologist 154(2): 275-304.

Brzywczy J, Sienko M, Kucharska A, Paszewski A. 2002. Sulphur amino acid
synthesis in Schizosaccharomyces pombe represents a specific variant of sulphur
metabolism in fungi. Yeast 19(1): 29-35.

Cherest H, Davidian JC, Thomas D, Benes V, Ansorge W, SurdinKerjan Y. 1997.
Molecular characterization of two high affinity sulfate transporters in Saccharomyces
cerevisiae. Genetics 145(3): 627-635.

Clarke DL, Newbert RW, Turner G. 1997. Cloning and characterisation of the
adenosyl phosphosulphate kinase gene from Aspergillus nidulans. Current Genetics
32(6): 408-412.

Cooper KM, Tinker PB. 1978. Translocation and transfer of nutrients in vesicular-
arbuscular mycorrhizas .2. Uptake and translocation of phosphorus, zinc and sulfur. New

Phytologist 81(1): 43-55.

Cram J. 1983. Characteristics of sulfate transport across plasmalemma and tonoplast of
carrot root-cells. Plant Physiology 72(1): 204-211.

90

Diop T, Becard G, Pichey Y. 1992. Long-term invitro culture of an endomycorrhizal
filngus, Gigaspora margarita, on Ri T-dna transformed roots of carrot. Symbiosis 12:
249-259.

Eriksen J, Askegaard M. 2000. Sulphate leaching in an organic crOp rotation on sandy
soil in Denmark. Agriculture Ecosystems & Environment 78(2): 107-114.

Fitzgerald JW. 1976. Sulfate ester formation and hydrolysis - potentially important yet
often ignored aspect of sulfur cycle of aerobic soils. Bacteriological Reviews 40(3): 698-
72 1 .

Fortin JA, Becard G, Declerck S, Dalpe Y, St-Arnaud M, Coughlan AP, Piche Y.
2002. Arbuscular mycorrhiza on root-organ cultures. Canadian Journal of Botany-Revue
Canadienne De Botanique 80(1): 1-20.

Gahoonia TS, Nielsen NE. 1991. A method to study rhizosphere processes in thin soil
layers of different proximity to roots. Plant and Soil 135(1): 143-146.

Gahoonia TS, Raza S, Nielsen NE. 1994. Phosphorus depletion in the rhizosphere as
influenced by soil-moisture. Plant and Soil 159(2): 213-218.

Govindarajulu M, Pfeffer PE, Jin HR, Abuhaker J, Douds DD, Allen JW, Bucking
H, Lammers PJ, Shachar-Hill Y. 2005. Nitrogen transfer in the arbuscular mycorrhizal
symbiosis. Nature 435(7043): 819-823.

Gray LE, Gerdemann JW. 1973. Uptake of sulphur-35 by vesicular-arbuscular
mycorrhizae. Plant and Soil 39: 687-689

Grynberg M, Piotrowska M, Pizzinini E, Turner G, Paszewski A. 2001. The
Aspergillus nidulans metE gene is regulated by a second system independent from

sulphur metabolite repression. Biochimica et Biophysica Acta-Gene Structure and
Expression 1519(1-2): 78-84.

Guo T, Zhang JL, Christie P, Li XL. 2007. Pungency of spring onion as affected by
inoculation with arbuscular mycorrhizal firngi and sulfur supply. Journal of Plant
Nutrition 30(7-9): 1023-1034.

Hansen J, Johannesen PF. 2000. Cysteine is essential for transcriptional regulation of
the sulfur assimilation genes in Saccharomyces cerevisiae. Molecular and General

Genetics 263(3): 535-542.

Hawkins HJ, Johansen A, George E. 2000. Uptake and transport of organic and
inorganic nitrogen by arbuscular mycorrhizal fungi. Plant and Soil 226(2): 275-285.

91

Hayman DS, Mosse B. 1971. Plant growth responses to vesicular-arbuscular mycorrhiza
.1. Growth of endogone-inoculated plants in phosphate-deficient soils. New Phytologist
70(1): 19-27.

Jin H, Pfeffer PE, Douds DD, Piotrowski E, Lammers PJ, Shachar—Hill Y. 2005. The
uptake, metabolism, transport and transfer of nitrogen in an arbuscular mycorrhizal
symbiosis. New Phytologist 168: 687-696.

Joner EJ, J akobsen I. 1994. Contribution by 2 arbuscular mycorrhizal fungi to p-uptake
by cucumber (cucumis-sativus 1) from p-32 labeled organic-matter during mineralization
in soil. Plant and Soil 163(2): 203-209.

Jun J, J A, Rehrer C, Pfeffer PE, Shachar—Hill Y, Lammers PJ. 2002. Expression in
an arbuscular mycorrhizal fungus of genes putatively involved in metabolism, transport,
the cytoskeleton and the cell cycle. Plant and Soil 244: 141-148.

Ketter JS, J arai G, Fu YH, Marzluf GA. 1991. Nucleotide-sequence, messenger-ma
stability, and dna recognition elements of cys-l4, the structural gene for sulfate
permease-ii in neurospora-crassa. Biochemistry 30(7): 1780-1787.

Ketter JS, Marzluf GA. 1988. Molecular-cloning and analysis of the regulation of cys-
14+, a structural gene of the sulfur regulatory circuit of neurospora-crassa. Molecular and
Cellular Biology 8(4): 1504-1508.

Kreuzwieser J, Rennenberg H. 1998. Sulphate uptake and xylem loading of
mycorrhizal beech roots. New Phytologist 140(2): 319-329.

Kuras L, Thomas D. 1995. Functional-analysis of met4, a yeast transcriptional activator
responsive to s-adenosylmethionine. Molecular and Cellular Biology 15(1): 208-216.

Lambers H, Raven JA, Shaver GR, Smith SE. 2008. Plant nutrient-acquisition
strategies change with soil age. Trends in Ecology & Evolution 23(2): 95-103.

Lefohn AS, Husar JD, Husar RB. 1999. Estimating historical anthropogenic global
sulfur emission patterns for the period 1850-1990. Atmospheric Environment 33(21):
3435-3444.

Leustek T. 1996. Molecular genetics of sulfate assimilation in plants. Physiologia
Plantarum 97(2): 41 1-419.

Leustek T, Martin MN, Bick JA, Davies JP. 2000. Pathways and regulation of sulfur
metabolism revealed through molecular and genetic studies. Annual Review of Plant

Physiology and Plant Molecular Biology 51: 141-165.

Li XL, George E, Marschner H. 1991. Extension of the phosphorus depletion zone in
va-mycorrhizal white clover in a calcareous soil. Plant and Soil 136(1): 41-48.

92

Liu A, Hamel C, Elmi A, Costa C, Ma B, Smith DL. 2002. Concentrations of K, Ca
and Mg in maize colonized by arbuscular mycorrhizal fungi under field conditions.
Canadian Journal of Soil Science 82(3): 271 -278.

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)). Methods 25: 402-408

Lopez J, Bell CI, Tremblay N, Dorais M, Gosselin A. 2002. Uptake and translocation
of sulphate in tomato seedlings in relation to sulphate supply. Journal of Plant Nutrition
25(7): 1471-1485.

Mansouri-Bauly H, Kruse J, Sykorova Z, Scheerer U, Kopriva S. 2006. Sulfur uptake
in the ectomycorrhizal fungus Laccaria bicolor S23 8N. Mycorrhiza 16(6): 421-427.

Marzluf GA. 1993. Regulation of sulfur and nitrogen-metabolism in filamentous fungi.
Annual Review of Microbiology 47: 31-55.

Marzluf GA. 1997. Molecular genetics of sulfur assimilation in filamentous fungi and
yeast. Annual Review of Microbiology 51: 73-96.

N atorff R, Sienko M, Brzywczy J, Paszewski A. 2003. The Aspergillus nidulans metR
gene encodes a bZIP protein which activates transcription of sulphur metabolism genes.
Molecular Microbiology 49(4): 1081-1094.

Ono B, Hazu T, Yoshida S, Kawato T, Shinoda S, Brszczy J, Paszewski A. 1999.
Cysteine biosynthesis in Saccharomyces cerevisiae: a new outlook on pathway and
regulation. Yeast 15(13): 1365-1375.

Ono B, Heike C, Yano Y, Inoue T, Naito K, Nakagami S, Yamane A. 1992a. Cloning
and mapping of CYS4 gene of Saccharomyces cerevisiae. Current Genetics 21: 285-289.

Ono B, Tanaka K, Naito K, Heike C, Shinoda S, Yamamoto S, Ohmori S, Oshima T,
Toh-e A. 1992b. Cloning and characterization of CYS3(CYIl) gene of Saccharomyces
cerevisiae. Journal of Bacteriology 174: 3393-3 347.

Ono BI, Naito K, Shirahige YI, Yamamoto M. 1991. Regulation of cystathionine
gamma-lyase in Saccharomyces-cerevisiae. Yeast 7(8): 843-848.

Ortiz-Ceballos AI, Pena-Cabriales JJ, Fragoso C, Brown GG. 2007. Mycorrhizal
colonization and nitrogen uptake by maize: combined effect of tropical earthworms and
velvetbean mulch. Biology and Fertility of Soils 44(1): 181-186.

Osherov N, May GS. 2001. The molecular mechanisms of conidial germination. F ems
Microbiology Letters 199(2): 153-160.

93

Paszewski A, Grabski J. 1975. Enzymatic lesions in methionine mutants of Aspergillus
nidulans: role and regulation of an alternative pathway of cysteine and methionine
synthesis. Journal of Bacteriology 124: 893-904

Perrier H, Rohn S, Driemel G, Batt N, Schwarz D, Kroh LW, George E. 2008. Effect
of nitrogen species supply and mycorrhizal colonization on organosulfur and phenolic
compounds in onions. Journal of Agricultural and Food Chemistry 56(10): 3538-3 545.

Pfeffer PE, Douds DD, Becard G, Shaehar-Hill Y. 1999. Carbon uptake and the
metabolism and transport of lipids in an arbuscular mycorrhiza. Plant Physiology 120(2):
587-598.

Pilsyk S, Natorff R, Sienko M, Paszewski A. 2007. Sulfate transport in Aspergillus
nidulans: A novel gene encoding alternative sulfate transporter. Fungal Genetics and
Biology 44(8): 715-725.

Rennenberg H. 1999. The significance of ectomycorrhizal flmgi for sulfur nutrition of
trees. Plant and Soil 215(2): 115-122.

Rennenberg H, Herschbach C, Haberer K, Kopriva S. 2007. Sulfur metabolism in
plants: Are trees different? Plant Biology 9: 620-637.

Rhodes LH, Gerdemann JW. 1978a. Hyphal translocation and uptake of sulfur by
vesicular-arbuscular mycorrhizae of onion. Soil Biology & Biochemistry 10(5): 355-360.

Rhodes LH, Gerdemann JW. 1978b. Influence of phosphorus nutrition on sulfur uptake
by vesicular-arbuscular mycorrhizae of onion. Soil Biology & Biochemistry 10(5): 361-
364.

Riley NG, Zhao FJ, McGrath SP. 2000. Availability of different forms of sulphur
fertilisers to wheat and oilseed rape. Plant and Soil 222(1-2): 139-147.

Scherer HW. 2001. Sulphur in crop production - invited paper. European Journal of
Agronomy 14(2): 81-111.

Seegmuller S, Rennenberg H. 2002. Transport of organic sulfur and nitrogen in the
roots of young mycorrhizal pedunculate oak trees (Quercus robur L.). Plant and Soil
242: 291-297.

Sienko M, Paszewski A. 1999. The metG gene of Aspergillus nidulans encoding
cystathionine beta-lyase: cloning and analysis. Current Genetics 35(6): 638-646.

Simon L, Bousquet J, Levesque RC, Lalonde M. 1993. Origin and diversification of
endomycorrhizal fungi and coincidence with vascular land plants. Nature 363: 67-69.

94

Spencer B, Harada T. 1960. Role of choline sulphate in the sulphur metabolism of
fungi. Biochemical Journal 77: 305-315.

StArnaud M, Hamel C, Vimard B, Caron M, Fortin JA. 1996. Enhanced hyphal
grth and spore production of the arbuscular mycorrhizal fungus Glomus intraradices in

an in vitro system in the absence of host roots. Mycological Research 100: 328-332.

Tabatabai MA. 1986. Sulfur in Agriculture. American Society of Agronomy, Madison,
WI.

Thomas D, SurdinKerjan Y. 1997. Metabolism of sulfur amino acids in Saccharomyces
cerevisiae. Microbiology and Molecular Biology Reviews 61(4): 503-515.

Wang B, Qiu YL. 2006. Phylogenetic distribution and evolution of mycorrhizas in land
plants. Mycorrhiza 16(5): 299-363.

Wang ZY, Kelly JM, Kovar JL. 2004. In situ dynamics of phosphorus in the
rhizosphere solution of five species. Journal of Environmental Quality 33(4): 1387-1392.

95

Chapter 3

Uptake and Assimilation of S during Presymbiotic Growth of an
Arbuscular Mycorrhizal Fungus

96

Abstract

Arbuscular mycorrhizal fungal spores germinate in pure water yet readily import C

and N. The biological significance of this uptake is unknown and the use of other

macronutrients including S is unexplored. The uptake of 35$042., [35S]cys, and

[35$]met, and the incorporation of 35S into different metabolic pools during the

presymbiotic growth of Glomus intraradices were measured by scintillation counting.
Sulfate assimilation was analyzed in relation to sulfate concentration and exposure to
unlabeled and labeled cys and met, glutathione (GSH) and buthionine sulfoximine
(BSO). Corresponding changes in relative gene expression of putative sulfate
assimilation pathway genes were measured by quantitative real-time PCR. Glomus

intraradices showed little preference for reduced S sources over sulfate. Exposure to cys

or GSH initially reduced sulfate uptake by 35% and 63% respectively. Met addition did

not decrease sulfate uptake while gene expression measurements suggested the presence
of a functional cystathionine pathway. Gene expression measurements revealed a two
fold decrease in S-related genes after cys addition while GSH or met more than doubled
the expression of all genes analyzed. S acquisition by germinating spores of G.
intraradices appears to be regulated post-transcriptionally and to a lesser extent than in

other fungi studied.

97

Introduction

The arbuscular mycorrhizal (AM) fiingal symbiosis evolved more than 400
million years ago (Dotzler et al., 2006) and remains the most widespread underground
symbiosis. AM fungi can be found in association with more than 90% of plant families in
all biomes filled by land plants excluding arctic tundra (Wang & Qiu, 2006). Although
the AM symbiosis helps plants take up mineral nutrients, especially phosphorus, from the
soil (Cooper & Tinker, 197 8; Li et al., 1991; Gahoonia et al., 1994; Wang et al., 2004;
Hepper & Warner, 1983), the application of AM fungi to agriculture has been limited by
their obligate biotrophic nature and resulting difficulties in efficient large scale
propagation of inoculum (Douds et al., 2006). It is therefore a goal of mycorrhizal
research to increase the practical use of AM fungi by determining a culturing method that
enables their propagation in the absence of host roots.

The transition fi'om pre-symbiotic to symbiotic growth was an early focus of
efforts to identify a method of root-less propagation of AM fungi (Hepper, 1984; Carr et
al., 1985). Fungal spores germinate without external mineral or carbon sources although
they are imported when available (Bucking et al., 2008; Smith & Read, 2008; Gachomo
et al., 2009), and germ tubes severed from the spore rely on them to extend normally
(Hepper, 1983). Germinating spores are limited in the uptake and use of exogenous
carbon sources and lack some primary metabolic pathways including de novo fatty acid
synthesis (Bago et al., 1999). Recently, chemicals in root exudates including an isolated
signaling molecule, strigolactone, have been shown to alter the metabolism and gene

expression of AM ftmgal germinating spores in the absence of a host (Besserer et al.,

98

2008). The addition of root exudates alters gene expression in Gigaspora rosea, inducing
changes in physiological state in preparation for root penetration (Tamasloukht et al. ,
2003). A better understanding of the regulation of metabolic functions and nutrient
allocation during pre-symbiotic growth may thus reveal signaling pathways that govern
the developmental stages of the firngus. This study examined the regulation of sulfiir
assimilation in germinating spores of Glomus intraradices as part of the ongoing effort to
achieve axenic propagation of AM fungi.

Direct reduction of sulfate with NADPH is a highly endergonic reaction, and is
bypassed in fungi through adenylation and firrther phosphorylation of the adenosyl group
(Lowe, 1991; Marzluf, 1997). These steps are carried out by S-adenylyl-transferase
(SAT) and adenylyl-sulfate kinase (APSK), respectively, and are followed by the two
step reduction of the activated sulfate moiety to sulfide. The initial reduction of the
sulfate moiety by thioredoxin oxidation is mediated by the enzyme 3’-phosphoadenosine-
5’-phosphosulfate reductase (PAPSR); sulfite reductase is responsible for further
reduction to sulfide. Sulfide is incorporated into either O-acetylserine (OAS) or 0-
acetylhomoserine (OAH), forming cysteine or homocysteine, respectively. Fungi and
archaebacteria are the only organisms known to possess both assimilation pathways
(Marzluf, 1997; Zhou and White, 1991).

The dominant path of sulfide incorporation varies among fungi studied (Marzluf,
1997). The assimilation of sulfide through OAH requires the conversion of homocysteine
to cysteine by a specific two-step enzymatic pathway, the Cystathionine (CT) pathway,
which involves the conversion of homocysteine and serine to cystathionine by the

enzyme cystathionine B-synthase (CBS) followed by the cleavage of cystathionine to a-

99

ketobutyric acid, ammonia, and cysteine by cystathionine y-lyase (CGL). In
Saccharomyces cerevisiae, cysteine synthesis occurs solely through the CT pathway
(Cherest & Surdin-Kerjan, 1992; Ono et al., 1999), while the pathway is absent in the
closely related yeast Candida valida (Piotrowska, 1993). This is also true for
Schizosaccharomyces pombe (Brzywczy et al., 2002), although the possession of both
pathways is the norm. Aspergillus nidulans and Neurospora crassa contain the enzymes
to assimilate sulfide into either cysteine or homocysteine, as do the yeast Yarrowia
lipolytica, Cephalosporium acremonium, and T richosporon cutaneum (Brzywczy &
Paszewski, 1993; Paszewski & Grabski, 1974; Morzycka & Paszewski, 1979; Jackobsen
& Metzenberg, 1977; Lewandowska & Paszewski, 1987). although in A. nidulans the
synthesis of cysteine is dominant (Brzywczy et al.. 2007). Other fungi may have similar
biases.

Regulation of S assimilation in fungi is mediated by the transcription and
allosteric control of S assimilation enzymes (Marzluf, 1997; Foster et al., 1994; Renosto
et al., 1990; Bradfield et al., 1970). A homologous positive regulator controlling a host of
S assimilation genes has been identified for Neurospora crassa (CYS3; Marzluf and
Metzenberg, 1968), Aspergillus nidulans (METR; Natorff et al., 2003), and
Saccharomyces cerevisiae (MET4; Thomas et al., 1992). Repression of sulfate
assimilation by the addition of a reduced S source such as met is mediated by controlling
the activity of the positive regulatory protein through transcriptional regulation (Marzluf,
1997) or ubiquitination (Kuras et al., 2002). Additionally, SAT is strongly inhibited by
the product of the second enzymatic step, 3’-phosphoadenosine-5’-phosphosulfate

(PAPS), in A. nidulans, Penicillium chrysogenum, Penicillium duponti, and N. crassa

100

(Renosto et al., 1990), and sulfate uptake is completely suppressed by an order of
magnitude lower concentration of met in S. cerevisiae (Breton & Surdin-Kelj an, 1977).
The results presented here show that germinating spores of Glomus intraradices
can assimilate S from sulfate, cysteine (cys) and methionine (met). The addition of cys
reduced sulfate assimilation, but less than it does in other fungi, and with diminishing
potency after its addition. Met addition had little effect on the utilization of S from sulfate
'or cys, but increased the expression of putative genes of the sulfate assimilatory pathway.
In contrast to labeling data, putative genes encoding CT pathway enzymes were up-
regulated by more than four fold in response to met, suggesting the induction of the
pathway from met to cys. In contrast to other fungi, assimilation of reduced and oxidized
forms of S was simultaneous and non-preferential. Exposure to reduced glutathione
(GSH) resulted in a reduction in sulfate uptake similar to cys addition and changes in
gene expression similar to met addition, whereas buthionine sulfoximine, a specific
inhibitor of GSH synthesis, increased sulfate utilization and had no effect on gene
expression. The results demonstrate that presymbiotically growing G. intraradices
assimilates S and possesses a complex regulatory system for S metabolism with

distinctive features compared to all other fungi studied to date.

101

Experimental Procedures

Tissue culturing

Standardized germination cultures were prepared under sterile conditions by
blending spores (Shenk & Smith; DAOM 181602) with solidified Gel-gro agar (MP
Biomedicals, Solon, OH) and transferring 2 mL into each well of a sterile 12-well
polystyrene plate. Glomus intraradices spores purchased from Premier Tech

Biotechnologies (Reviere-du-Loup, Québec, Canada) were used throughout. Prior to

labeling, spore cultures contained only Gel-gro, spores, 2 mM CaClz, and 2 mM MES

buffer (pH 6.0). This process resulted in consistent sample weights and a uniform spore
density of approximately 2500 spores mL-l. MES contains S, however its addition did
not alter radio-labeled sulfate uptake (not shown). Germination plates were stored at 4°C
for a minimum of one week before use. All experiments were conducted using
germination plates unless, as in the 3 hr time point tested (Fig. 3-1) and the germination
of tissue for gene expression analysis (Fig. 3-5), the timing of tissue collection was

critical for the success of the experiment. For experiments where germination plates were

impractical, spores were germinated in liquid media.

Radio-labeled sulfate (N a2[3SSO4]; MP Biomedicals) was supplied to spores with

0.1 mM Na2SO4 with two exceptions. The examination of 35S-labeling from amino acids

and sulfate combined (Fig. 3-3) was conducted with 0.1 mM total S, each source

comprising 0.05 mM S. Also, the measurement of uptake at three hours from various

sulfate concentrations (Fig. 3-1) utilized 0.01, 0.014, 0.022, 0.04, 0.1 or 0.2 mM NaZSO4.

102

Labeled cys and met (L-[3SS]cysteine and L-[35S]methionine; MP Biomedicals) were

supplied with either 0.1 mM (Fig. 3-3) or 0.05 mM (Fig. 3-4) of the corresponding non-
labeled amino acid.

In all experiments conducted filter-sterilized stock solutions were added as a 1 mL
solution to each well and spores germinated in a 30°C incubator. Samples in blended Gel-
gro were collected by first transferring the contents of a well to a plastic bottle with 100
mL of 10 mM sodium citrate buffer (pH 6.0) to disintegrate the gellan. Surface

radioactivity was removed by a sieving procedure described previously (Allen &

Shachar-Hill, 2009). Briefly, 30 mL of cold 10 mM Na2804 was allowed to flow through

the sample. This was repeated three times followed by 30 mL of cold deionized water.

Samples were immediately frozen in liquid nitrogen, lyophilized, and weighed. In the

case of 35S-labeled samples not germinated in Gel-gro (Fig. 3-1), the sodium citrate

buffer was replaced by 100mL of cold MiliQ water. Spores germinated for the
measurement of gene expression were only washed with approximately 10 mL of MiliQ

water over a sieve followed by immediate collection and freezing in liquid nitrogen. The

collection of 3"SS-labeled spores and mycelia lasted approximately five minutes while the

collection of material for gene expression measurements took less than one minute.

Samples for gene expression analysis were stored in a -80°C freezer until extracted.

Extraction and fractionation procedure

The relative allocation of 353 was determined by the crude separation of the

cellular components according to chemical solubility (Allen & Shachar-Hill, 2009). In

103

this way, fractions containing, but not limited to, sulfate, the free amino acids cysteine
and methionine, proteins, and sulfonated lipids were isolated from one another. Two 3
mm stainless steel beads were added to each dried sample in 1.5mL screw-top centrifuge
vials along with 0.1 mL of methanol:water solution (70:30). Fungal spore and mycelial
structures were disintegrated using a bead mill (Retsch MM301) set at 30Hz for four
minutes at 4°C. A representative sample was taken from each milling and examined
under a dissecting microscope to ensure complete breakage. Another 0.9 mL of
methanol:water solution (70:30) was added and the samples vortexed for five minutes to
isolate ionic and small organic compounds including sulfate, sulfite, free amino acids,

and glutathione. The samples were centrifuged and supematants collected. A portion of

the alcohol extract (0.5 mL) was added to a solution containing Na2S04 and slightly

acidified with 0.05 mL of 1 N HCl, followed by the addition of BaClz solution. The final

concentrations of sulfate and barium were 10 mM and 11 mM, respectively. Samples
were placed in a 100°C heat block for 30min resulting in the precipitation of BaSO4. In
control experiments (not shown), this procedure was determined to be more than 99%

effective in removing a known amount of radio-labeled sulfate from solution. The

comparison between radioactivity levels in the pre- and post-barium precipitation

. . 35 . . . .
solutions determined the amount of S in the sulfate and ammo ac1d pools. Protelns

were extracted from the remaining pellets using Urea/SDS buffer consisting of 9 M urea,
1% SDS, 0.7 M B-mercaptoethanol, 25 mM Tris-HCl (pH 6.8), and 1 mM EDTA
(Osherov and May, 1998). To completely solubilize the proteins, samples were heated to

100°C on a heat block for 5 min, vortexed for l min, and heated again for 1 min. After

104

centrifugation at 14,000 g for 5 min, 0.5 mL of the supernatant was analyzed by
scintillation counting. The effect on counting efficiency of adding 1 M urea to
scintillation fluid (BioSafe 11, MP Biomedicals) was analyzed and found to be negligable
(not shown). Pellets were transferred to glass ampules containing 0.5 mL TS-2 tissue
solubilizer (MP Biomedicals), sealed over a gas flame, and incubated at 70°C for one
week. Scintillation fluid (Bio-Safe II, MP biomedicals) was added directly to the tissue
solubilizing solution followed by scintillation counter analysis, and was titrated with l N

HCl solution until neutral before scintillation counting.

Sample preparation for gene expression analysis

Samples were pulverized using a bead mill (Retsch MM301) set to 30 Hz with
100 pL of RNA extraction buffer and two 3 mM stainless steel beads. Care was taken not
to allow drawing by milling the samples for 2 min intervals followed by re-freezing in
liquid nitrogen for three to four cycles. A small aliquot of two samples were checked
under a dissecting microscope for tissue disruption. Total RNA was then extracted using
the RNeasy Plant Mini Kit (Qiagen, Valencia, CA) immediately followed by DNA
removal using RNase-fiee DNase (Turbo DNA-free; Ambion, Austin, TX). Following
quantification of RNA by spectroscopy, an equal concentration of cDNA for each sample
was synthesized with SuperScript II reverse transcriptase (Invitrogen corp., Carlsbad,
CA) from each sample. Simultaneously, a set of reverse transcriptase free control samples
were created.

Sequences of gene fragments with high homology to known sulfur assimilatory

genes from filamentous filngi and yeast were obtained through a combination of high

105

throughput sequencing data (PJ Lammers, Y Shachar-Hill and coworkers unpublished
results) and a published EST database (Jun et al., 2002). These sequence conti gs were
verified by standard PCR using cDNA (obtained as already described) derived from
spores germinated in water for one week followed by sequencing using an ABI PRISM®
3100 Genetic Analyzer (Applied Biosystems, CA, USA). A QIAquick Gel Extraction Kit
(QIAGEN GmbH, Germany) was used to isolate the DNA fragments after separation by
electrophoresis. The primer sequences (IDT, Syntegen, Skokie, IL) used and fragment
sizes are listed here: putative high affinity sulfate perrnease (482 bp), forward 5’-
CGGGATTCCAGATGCACTT-3 ’ , reverse 5 ’ -GGGAAGTTCATTCCATGGTC-3 ’;
putative sulfate adenylyl-transferase (902 bp), forward 5’-
ATATCGACCATTATACAAGAGTAAGAGTC-3 ’, reverse 5 ’-
CGATATATCCGTCCTTTTCGA-3’; putative phosphoadenylyl sulfate reductase (764
bp), forward 5’-ACCCGCGAATCAGTATATCG-3’, reverse 5’-
CCCACCTTCCATCTCTTTCA-3’; putative cysteine synthase (1404 bp), forward 5’-
AAACCAACAAAGGGACAACG-3 ’, reverse 5 ’-TTTATCCAGTTCCGGCAGTC-3 ’;
putative cystathionine B-synthase (605 bp), forward 5’-
ATGGAGTCTAATGACAAAGAAAATAATTG-3 ’, reverse 5 ’-
GAGAGATTTTGCAACTTGAATTGCTGCC-3’; putative cystathionine y-lyase (922
bp), forward 5’-CCAAATCGAAGTGCATTTGAAGAGTC-3’, reverse 5’-

CCTAGCAAATCATCAACATCTTCGATACC-3 ’ .

106

Real time quantitative PCR measurements

Gene expression was analyzed using an ABI Prism 7900 HT Sequence Detection
System (Applied Biosystems, Austin, TX) using the following cycling program: 50°C for
2 min, 95°C for 10 min followed by 40 cycles of 95°C for 15 sec and 60°C for 1 min.
Power SYBR Green 2-Step Master Mix (Applied Biosystems, Austin, TX) was used to
produce 0.015 mL samples containing 1 ng of cDNA and 300 nM primers per sample.
From these, 0.01 mL was transferred to a 384 well plate for analysis.

Gene expression of putative S assimilation genes was measured relative to the
expression of an S4 ribosomal protein as described by Govindarajalu et al. (2005) using
the AAC1~ (Livak & Schmittgen, 2001) and comparative CT methods. Primer Express
software (Applied Biosystems, Austin, TX) was used to create qRT-PCR specific primer
sets for all sequences studied. Primer sequences for qRT-PCR are listed here: putative
high affinity sulfate perrnease forward 5’-CAATTCTGGGATTTTATGGTCTTTTT-3’,
reverse 5’-GATTCCATATTCGACGGTAGTGAA-3’; putative sulfate adenylyl-
transferase forward 5’-AGCTTTTGTAGCAGAGCTAAC-3’, reverse 5’-
GGCAAACGGAGCAATTGG-3’; putative phosphoadenylyl sulfate reductase forward
5’-AAAATCTTGGAATGGGCTCTT-3’ and reverse 5’-
GTGAGGCCGAAAGCAGTTG-3’; putative cystathionine B-synthase forward 5’-
CAATTATTGAGCCAACTTCTGGAA-3’, reverse 5’-
TCCTTTGATAGCAGCCGCTAA-3’; putative cystathionine y-lyase , forward 5’-
AGCAAAGAAACAGGCAAGAGGAT-3 ’, reverse 5 ’-

TGCTTCCTTAAAACCACCATTAAT-3’; S4 ribosomal protein forward 5’-

107

AACAGGTGGTAGAAATATGGGAAGA-3’ and reverse 5’-

AAGCCGCCTACGTGTCGTT-3 ’.

108

Results

Import and assimilation of sulfate by germinating spores and its regulation by S
metabolites
The uptake and assimilation of exogenous sulfate during presymbiotic growth was

measured by supplying radio-labeled sulfate to spores germinated 7 days prior. The rate

of import increased linearly (R2 = 0.983) when sulfate was supplied at concentrations

ranging from 10-100 pM sulfate (Fig. 3-1). In this range there was also a linear

relationship between external sulfate concentration and incorporation into different

biochemical fractions: sulfate (R2 = 0.978), amino acids (R2 = 0.964), extractable

proteins (R2 = 0.989), and tissue solubilized cell material (R2 = 0.901). In proportion to

the total S uptake, incorporation into the amino acid fraction decreased by 5 fold, while
intracellular sulfate doubled between 10 and 100 pM external sulfate. There was no
firrther increase in uptake or assimilation of S into any fraction with concentrations

exceeding 100 pM (Fig. 3-1; data not shown).
Import, reduction, and incorporation of 35S from sulfate was continuous for at
least 7 days and was affected by some, but not all, sulfur metabolites tested (Fig. 3-2).
. . 35 . . 2 .
The total incorporation of S over 2, 4, and 7 days increases linearly (R = 0.977) wrth

analogous increases in pools containing proteins and aqueous-alcohol soluble S-
containing molecules. The uptake of sulfate was reduced by the addition of cysteine (cys)

or reduced glutathione (GSH), but not methionine (met). Cysteine initially reduced total

109

35S uptake by 35 i 4% by day 2, however, the effect of cys diminished to a 21 :l: 4%

reduction by day 4 and finally a 13 i 4% reduction by day 7. Less than 10% of the cys
available in the media was consumed during the experiment. GSH addition and the
inhibition of GSH synthesis had the most dramatic effects on sulfate uptake by the spores
(Fig. 3-2). Uptake was reduced by 63 i 1% and 64 fl: 3% at days 2 and 4, respectively,
when 1 mM GSH was added. At day 7, however, this effect was diminished to the point
that a difference in uptake was not statistically significant between the control and GSH
samples, similar to the diminished effect of cys addition. Buthionine sulfoximine (BSO)
irreversibly inhibits GSH synthesis at the point of glutamate-cysteine ligase (Griffith &
Meister, 1979). The effect of adding 10 mM B80 was to increase sulfate uptake,

compared to control samples by 30 +/- 2% (day 2), 47 +/- 9% (day 4), and 82 +/- 10%
(day 7). 35$ incorporation into the sulfate and reduced sulfur-containing small molecule
pools increased most (Fig 3-2). Taken together the effects of GSH and BSO strongly
suggest that intracellular GSH concentrations regulate sulfate assimilation. The uptake of

sulfate in germinating spores exposed to exogenous met was not statistically significantly

different fi'om the uptake by spores germinated in sulfate alone at any time point.

110

1.2 .

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1 . E E
§ l
9 0.8 .
'c»
E
U)
E 0.6 .
C
.9
'5
0
e- o.4 .
O
O
E D
a) c f if"
0.2 . ""‘ }. " * L
B
A
et- Fe
0 - "7“, ‘1’
1o 14 22 40 100 200

Sulfate Concentration (pM)

Figure 3-1 Three hour uptake and incorporation of radio-labeled sulfate by germinating
spores. Spores were germinated in an S-free media for five days prior to the addition of

10, 14, 22, 40, 100, 120, 150, 200, or 300 pM sulfate labeled with 353042' at a specific

activity of 7.2 pCi pg-1 S. Tissue was collected and counts fractionated into pools
containing but not limited to sulfate (white bars), amino acids (light gray bars), proteins
(gray bars), and tissue solubilized cell debris (dark gray bars). Error bars depict standard

error of the mean (11 = 5). Statistical analyses done by ANOVA single factor analysis,
alpha = 0.05.

111

200 .

 

 

 

   

      

 

   

180- H
§ 160- +
o
'7 140 .
U)
E
U)
120-
E 9+
c +- ~..
.2 100- c
E
O
8
0 so ~
0
5
a) 60 -
4o -
20 -
0 2d4d 7d 2d4d 7d 2d4d 7d 2d4d 7d 2d4d 7d
H20 cvs MET GSH 380

Figure 3-2 Radio-labeled sulfate uptake over time with the addition of sulfur metabolites.

Spores were germinated for 2 (2d), 4 (4d), or 7 (7d) days with 7.85 pCi of ”$042- in the
presence or absence of 1 mM L-cysteine hydrochloride (CYS), 1 mM L-methionine
(MET), 1 mM reduced glutathione (GSH), or 10 mM buthionine sulfoximine (BSO), an
inhibitor of GSH synthesis. Tissue was collected and counts fractionated into pools
containing but not limited to sulfate (white bars), amino acids (light gray bars), proteins
(gray bars), and tissue solubilized cell debris (dark gray bars). Error bars depict standard
error of the mean (n = 5). Statistical analyses done by ANOVA single factor analysis,
alpha = 0.1.

112

Uptake and assimilation of S from cysteine

35S incorporation from labeled cys and the effect of sulfate, met, GSH, BSO or

O-acetylserine (OAS) addition was examined (Fig. 3-3) and the statistical significance of

the results determined by ANOVA single factor analysis (p-value < 0.05). GSH addition

increased (44 i 11 %) while BSO addition decreased (1 l :l: 6 %) total uptake of [3SS]cys

compared to controls. No other treatments significantly altered uptake including OAS, a
precursor of cys, either with or without added sulfate. None of the compounds added
significantly altered the amino acid or protein fractional content derived from labeled cys.
The data also shows no significant synthesis of sulfate or sulfite from cys-derived S (Fig.

3-3). Any counts in this fraction are within the range of errors from contamination of the

. . 35 . . . . . . .
sulfate fi'actlon by organlc S during sulfate precrpltatlon and countlng maccuracres

before and after precipitation.

Simultaneous uptake of sulfate and reduced S species
An experiment was conducted to determine the degree of preference for the

importation and assimilation of organic S sources (cys and met) compared to sulfate (Fig.

3-4). The incorporation of 358 was measured when added as 3SS-sulfate or 35S-amino

acids in the presence of unlabeled amino acids and sulfate respectively, or when both

. . . . . 35
sulfate and an ammo acrd were labeled. This was compared to the incorporatlon of S

added as either sulfate or an amino acid alone. When [3SS]cys and ”$042. were

113

introduced to germinating spores together, the resulting labeling was equivalent to the

sum of the labeling from either source individually to within the experimental accuracy.

Labeled S from [35$]cys was more readily taken up than from sulfate by 48% (Fig. 3-4),

while the opposite was true for met, labeling with which resulted in an 18.7% decrease in

total 358 uptake compared to 35SO4-2 labeled samples. Overall labeling from 35SO42-

was roughly equivalent whether unlabeled cys or met was added, only changing by 5 :l: 2

%. This finding was similar to ”$042. uptake with cys and met addition after 7 days

from figure 2, which did not result in a statistically significant difference (2 i 12%).

While the overall uptake was similar, when the label was supplied as [35S]cys compared
to 358042., there was a 13 fold increase in the total counts discovered in the solubilized

fraction (Fig. 3-4), and an increase in this fraction was also seen in the [35S]CYS/35SO4

samples. Labeled met increased the solubilized fraction by 2.4 fold compared to labeled
sulfate. The reason for this fractional increase is not clear, however it shows that inter-
conversion of cys and met is limited and suggests that the insoluble fraction contains cys

or a derivative thereof.

114

Figure 3-3 Combined uptake of sulfate and reduced S species cys and met. Equal
amounts (0. 05 mM) of sodium sulfate and either cys or met were added to 3germinating

spores5 with labeling supplied as 8. 8 pCi Na32[3 5SO4] (CSYS/3 5804; MET/3 S04), 8. 2
pCi [3 5S]cys ([3 SSJCYS/SO4), or 8.5 pCi [3 5S]met ([3 5S]MET/SO4). The uptake and
incorporation of S was compared between additions of single labeling and double
labeling with both Na2[35SO4] and [35S]cys ([3531cvsfssoa), or Na7_[35SO4] and

[35S]met ([35S]MET/35SO4). The resulting labeling was chemically separated after 7
days of germination into fractions containing but not limited to sulfate (white bars),
amino acids (light gray bars), proteins (medium gray bars), and tissue solubilized residue
(dark gray bars) and analyzed by scintillation counting. Error is expressed as standard
error of the mean (11 = 4). The total uptake was significantly different for all conditions by
ANOVA single factor analysis (alpha = 0.05).

115

Figure 3-3

vowcepmzacm eomcmzfimm «omentmz

 

 

«Omanamerowmm Swab—mam ”.8365

 

 

 

 

 

.2.

(MCI L.Bul Bu) uogrelodlooug s

116

The expression of putative S metabolism and transport genes

An expressed gene sequence was identified by 454 sequencing of cDNA from
extraradical mycelium that has close similarity to 3’-phosphoadenylsulfate reductase
(PAPSR). This sequence was amplified from presymbiotic cDNA by PCR and sequenced
to confirm its identity. PAPSR catalyzes the first reduction step converting sulfate to
sulfite (see introduction). A BLAST search using the nonredundant database at NCBI
revealed one conserved PAPSR-specific domain (chl 713; E-value = 5e-33). The protein
sequence shares 54% identity with PAPSR from a fungal plant pathogen, Pyrenophora
tritici-repentis (XP_001937780; E-value = 9e-70), 51% identity with MET16 (PAPSR)
from Aspergillus nidulans (XP_662374; E-value = 4e-65), and 50% identity with PAPSR
from Neurospora crassa (XP_964870; E-value = 2e-60), and MET16 from
Sacchaomyces cerevisiae (NP_015493; E-value = 4e-59). The analyses of putative
sequences encoding a high affinity sulfate perrnease (SUL), sulfate-adenylyl transferase
(SAT), cystathionine B-synthase (CBL), and cystathionine y-lyase (CGL) were previously
reported (Allen & Shachar-Hill, 2009).

Exposure to cys led to both a reduction in SUL expression of 63 +/- 9% after a
6hr induction period (Fig. 3-5) and a reduction of total 358 uptake of 35 i 4% after two
days of presymbiotic labeling (Fig. 3-2). In contrast, addition of either met or GSH to
germinating spores resulted in increased gene expression for SUL, SAT, and PAPSR, and
greatly increased expression of CBS and CGL. CBS expression was increased 3.5 :t 0.8

fold by met and 4.4 :l: 0.8 fold by GSH addition, whereas CGL expression was increased

4.4 i 0.8 fold by met and 4.9 :t 0.2 fold by GSH addition. Although BSO greatly

increased uptake of 35SO42- (Fig. 3-2), it had little effect on the expression of any gene

117

analyzed. Changes in the expression of putative gene sequences encoding a high affinity
sulfate perrnease (SUL) and the first and third steps of sulfate assimilation, sulfate-
adenylyltransferase (SAT), and 3’-phosphoadenylsulfate reductase (PAPSR), were not
biologically significant (between 0.5 and 2 fold) for cys, met, or GSH treated samples

(Fig. 3-5).

118

s Incorporation (119 mg’1 DW)

 

 

H20 8042' MET GSH BSO OAS OASISO42'

Figure 3-4 [35S]Cysteine uptake and utilization in the presence of common sulfur
metabolites. S ores were germinated in a 30°C incubator for 7 days in the presence of

5.25 pCi of [3 S]cys and 0.1 mM sulfate (S04), 1 mM methionine (MET), 1 mM reduced
glutathione (GSH), 10 mM buthionine sulfoximine (BSO), 1 mM O-acetyl serine (OAS),
1 mM OAS with 0.1 mM sulfate (OAS/S), or nothing else (H20). Samples were collected
and the S species separated by chemical fractionation yielding fractions containing but
not limited to sulfate (white bars), amino acids (light gray bars), and proteins (dark gray
bars), analyzed by scintillation counting. Error is expressed as standard error (n=3). Stars
signify statistical differences (total uptake) from all other treatments by AN OVA single
factor analysis (alpha = 0.1).

119

 
   

     

5

4.5. 4‘ §
\

a " S s
a 31 s s
2 2.5J §
IE 2. §
1.5 \
l s
\
0.54 ‘\
N
‘S

 

Figure 3-5 Real-tirne PCR analysis of changes in sulfur assimilation pathway gene
expression in response to sulfur metabolites. Spores of G. intraradices were germinated
for five days in 2 mM MES (pH 6.0) prior to induction for six hours with 0.1 mM sodium

sulfate (8042-), 1 mM L-cysteine hydrochloride (CYS), 1 mM L-methionine (MET), 1
mM reduced glutathione (GSH), or 10 mM buthionine sulfoximine (BSO). Expression as
fold change was calculated relative to control samples labeled with only deionized water.
Putative sequences of the S assimilation pathway including a high affinity sulfate
perrnease (SUL; white), S-adenosyl transferase (SAT; horizontal lines),
phosphoadenylsulfate reductase (PAPSR; vertical lines), cytathionine B-synthase (CBS;
gray), and cystathionine y-lyase (CGL; down-slashed lines) were analyzed. Values are
reported as mean :t SEM (n = 3 biological replicates).

120

Discussion

Germinating spores of Glomus intraradices remain metabolically active for
approximately two weeks in the absence of host roots before germ tube cytoplasm
retreats and spores regain dormancy (Smith & Read, 2008). Exogenously supplied
phosphorus, nitrogen, acetate, amino acids, and glucose'are imported if available
(Bucking et al., 2008; Lammers et al., 2001; Thomson et al., 1990; Hepper & Jakobsen,
1983; Bago et al., 1999; Gachomo et al., 2009), however little is currently known of the
function of this uptake capacity. Imported nutrients and root secreted signaling
compounds can affect extension and branching of the germ tube, as well as their
metabolic capability (Hepper & J akobsen, 1983; Besserer et al., 2008; Tamasloukht et
al., 2003; 2007; Nagahashi et al., 1996).

Sulfur is a macronutrient required in quantities similar to phosphorus and its
assimilation is regulated similarly among other fimgal species (Marzluf, 1997).
Exogenously supplied sulfate is readily imported, reduced, and incorporated by
germinating spores of G. intraradices, producing stable proportions of S incorporation
into proteins and amino acids. This proportional relationship was unaffected by sulfate
concentration (Fig. 3-1), the application of S amino acids, GSH or an inhibitor of GSH
synthesis (Fig. 3-2), or total sulfate uptake. These data show that the relative rates of
sulfate reduction and incorporation into proteins are constant, and but that sulfate uptake
is less closely regulated relative to assimilation.

Sulfate assimilation is an energy intensive process and other fiingi control the

assimilation of different S forms through strict transcriptional and allosteric regulation of

121

sulfate uptake and reduction so as to preferentially use reduced forms of S when available
(Foster et al., 1994; Renosto et al., 1990; Lowe, 1991). In S. cerevisiae for instance,
exposure to 0.75 mM met results in a complete absence of sulfate perrnease activity
(Breton & Surdin-Kerjan, 1977). In contrast both organic and inorganic S are imported
and assimilated by spores of Glomus intraradices throughout germination and germ tube
extension with no detectable preference for reduced forms of S (Fig. 3-4). The addition of
met and its uptake by presymbiotic G. intraradices had no effect on sulfate uptake. In S.
pombe, which lacks the enzymes needed to convert met to cys (Brzywczy et al., 2002),
met addition also fails to regulate sulfate uptake, presumably because the demand for cys
cannot be met by met. Cysteine initially suppressed uptake by G. intraradices during
spore germination although much less than in other fungi, and even this effect diminished
during development. One week of exposure to cys as the sole S source led to S
incorporation comparable to that from sulfate (Fig. 3-3), so the diminishing effect of cys
on sulfate uptake is likely not due to a reduction in the import of cys. The simultaneous
uptake and assimilation of sulfate and S amino acids was confirmed for cys and met (Fig.
3-4), and to our knowledge represents the only such case among fungi. Interestingly, the
relative rates of incorporation of S from sulfate into amino acid and protein pools are not
altered by the simultaneous uptake and incorporation of S from reduced sources (Figs. 3-
2, 3-4), suggesting that assimilation of reduced and oxidized forms of S are regulated
separately.

Regulation of sulfate perrnease expression controls the flux through the S
assimilation pathway in fungi (For a review, see Marzluf 1997). The transcription of

genes encoding a high affinity sulfate perrnease in N. crassa, and high and low affinity

122

sulfate perrneases from A. nidulans, P. chrysogenum, and S. cerevisiae is completely
suppressed by the availability of reduced S or high concentrations of sulfate (Cherest et
al., 1997; Pilsyk et al., 2007 ; Van de Kamp et al., 2000; Ketter and Marzluf, 1988;
Natorff et al., 2003). In A. nidulans, a mutant lacking a functional S-adenosyl transferase
(SAT) accumulate up to 40 mM sulfate demonstrating that the reduction of sulfate is
required for permease regulation (Bradfield et al., 1970), and sulfate perrneases in this
species as well as N. crassa are known to be transcriptionally regulated by sulfur
metabolite repression mediated through cys (Pilsyk et al., 2007; Ketter et al., 1991). In G.
intraradices, the expression of a putative sulfate permease (SUL) was suppressed by the
presence of cys. The reduction in SUL expression by cys agreed with the reduction in
uptake of sulfate. This is consistent with data on this sequence previously published in
which addition of 1 mM cys decreased both uptake of sulfate and expression of SUL by
roughly half in the extraradical mycelium during the symbiotic phase of the life cycle
(Allen & Shachar-Hill, 2009). However, met addition, while having no effect on sulfate
uptake, doubled the expression of SUL. Sulfate uptake and SUL expression were also

differently affected when spores were exposed to GSH or BSO (Figs. 3-2, 3-5),

suggesting that changes in SUL transcript levels are not the primary level at which SO42-

uptake is regulated in this fungus.

There was no increase in the uptake of sulfate when it was supplied in
concentrations higher than 0.1 mM, which agrees with the presence of a single high
affinity transport system (Fig. 3-1). Single high and low affinity sulfate perrnease genes
have been identified in the genomes of S. cerevisiae, N. crassa, and P. chrysogenum

(Cherest et al., 1997 ; Ketter et al., 1991; Van de Kamp et al, 2000), and only in A.

123

nidulans has a third sulfate transporter been characterized (Pilsyk et al., 2007). This third
transporter is distinct from other known sulfate perrneases, belonging to a separate family
of ion perrneases than the highly conserved SulP family in which other sulfate perrneases,
and SUL, are part of (Pilsyk et al., 2007). The genome of G. intraradices is smaller than
that of other filamentous fungi and from the large amount of unpublished genomic and
EST sequence available, there is no evidence that G. intraradices possesses more
isoforms of other genes than do other fungi. It is therefore unlikely that there is another
high affinity sulfate transporter in the G. intraradices genome, and it seems more
probable that the changes in uptake observed are due to post-translational modifications
or alloteric controls on perrnease activity.

The S assimilation pathway enzymes sulfate adenosyltransferase (SAT) and
phosphoadenosyl phosphosulfate reductase (PAPSR), catalyzing the first and third steps
of sulfate reduction, are transcriptionally regulated in A. nidulans (Natorff et al., 2003),
and S. cerevisiae (Thomas et al., 1990; 1992) by sulfur metabolite repression. In S.
cerevisiae, the addition of 2 mM met to the media lowers transcription of the SAT gene
by ten fold (Cherest et al., 1985), and 1 mM met completely suppresses the expression of
the gene encoding PAPSR (Thomas et al., 1990). In A. nidulans, expression of the gene
encoding SAT is strongly repressed by 5 mM met addition (Borges-Walmsley et al.,
1995). The expression of putative sequences encoding SAT and PAPSR from G.
intraradices germinating spores was different than that of other filngal SAT’s. Spore
SAT and PAPSR shared the expression profile of SUL (Fig. 3-5), and it is likely that
these three sequences are regulated coordinately as SAT and PAPSR genes are in S.

cerevisiae and A. nidulans (Marzluf, 1997). The putative SAT sequence shared the

124

greatest homology with SAT from P. chrysogenum, including a cys residue implicated in
the allosteric control of the P. chrysogenum protein (Renosto et al., 1990). Additionally.
the G. intraradices putative SAT sequence has homology with a PAPS-binding region in
SAT genes from P. chrysogenum, A. nidulans, and A. terreus (Clarke et al., 1997;
Schierova et al., 2000). In Aspergillus terreus, the activity of SAT is reduced by 90%
after the addition of 1 mM met (Schierova et al., 2000). The addition of met to
germinating spores of G. intraradices doubled the expression of SUL, SAT, and PAPSR
without changing the uptake or assimilation of sulfate (Figs. 3-2. 3-5).

The conversion of met to cys requires the enzymes cystathionine beta synthase
(CBS) and cystathionine gamma lyase (CGL), constituting the CT pathway. This capacity
varies among fungal species and its absence is associated with a lack of effect of met on
transcriptional regulation. In contrast to cys, met addition had no effect on sulfate
assimilation in G. intraradices, suggesting an absence of the CT pathway (Fig. 3-2). The
presence of putative sequences with homology to CBS and CGL and their expression
profiles, however, contradicted this hypothesis, and the expression of these putative genes
differs from other fungi. In A. nidulans CBS is not transcriptionally regulated by cys or
sulfate (Sienko & Paszewski, 1999) whereas cys suppressed transcript levels in G.
intraradices twofold In S. cerevisiae, CGL transcript levels are reduced 15 fold by met
addition (Ono et al., 1993) while the G. intraradices transcript level was unaffected by
sulfate or cys addition, and exposure to met increased it by more than 4 fold (Fig. 3-5).
Glutathione addition yielded similar results to met exposure, although the effects of GSH

and met on sulfate and cysuptake were dissimilar (Figs. 3-2, 3-3). Changes in expression

of CBS and CGL were, like SUL, not reflected by the 35S uptake data. In S. cerevisiae,

125

CGL transcription is coordinately regulated with a high affinity GSH transporter

(GSHl 1) (Hiraishi et al., 2008) through a cis-element linked to the TOR pathway
(Miyake et al., 2003), which coordinates cell growth with grth factors and nutrient
availability (reviewed by Dann & Thomas, 2006). It is possible that in G. intraradices the
CT pathway enzymes are also regulated by more than one signal.

While the assimilation of sulfate in relation to reduced S has been well studied,
reduced S assimilation itself has not. The addition of precursors of cys synthesis in other
firngi, met and O-acetyl serine (OAS), failed to affect incorporation of cys-S by G.
intraradices (Fig. 3-3). At least one strain of S. cerevisiae is unable to import OAS (Ono
et al., 1996). The failure of OAS addition, with or without sulfate, to alter assimilation of
S from cys may also be due to an inability of G. intraradices to import the substance, as
OAS also failed to alter sulfate assimilation (unpublished data). Although mct addition
up-regulated putative CT pathway genes, it also had no effect on cys-S acquisition,

suggesting that either met uptake is reduced in the presence of cys, or that met conversion

through the CT pathway is low. Consistent with this possibility, [3SS]cys increased the

. . . . . . . 35 ..
proportion of radloactlvrty in the insoluble S fractions much more than [ S]met (Flg. 3-

4). In a reverse of their effects on sulfate uptake (Fig. 3-2), GSH increased while BSO
decreased cys uptake (Fi g. 3-3), again suggesting that the intracellular concentration of
GSH is an important regulator of S uptake and assimilation. Cys-S incorporation was
otherwise essentially constitutive.

Glutathione is present in millimolar quantities in fungal cells (Penninckx and
Jaspers, 1982; Pocsi et al., 2004) and is considered a reservoir of reduced S as its

catabolism produces free cys (Miyake et al., 1999). In S. cerevisiae and S. pombe,

126

exogenous GSH produces changes in gene expression and enzymatic activity similar to
the addition of cys (Kumar et al., 2003; Wheeler et al., 2002; Brzywczy et al., 2002).
Both GSH and cys addition to germinating spores of G. intraradices had a suppressive
effect on sulfate uptake which diminished over time (Fig. 3-2), yet had opposite effects
on gene regulation (Fig. 3-5). Additionally, glutathione increased the assimilation of cys-
S (Fig. 3-3), which, together with the gene expression results, is indicative that GSH
effects are not the result of the catabolic breakdown to cys. In support of this, an inhibitor
of GSH synthesis, buthionine sulfoximine (BSO), nearly doubled sulfate assimilation
while having no effect on the transcript levels of putative S assimilation genes (Fi g. 3-5).
Thus it seems that the assimilation of sulfate is negatively correlated with intracellular
GSH levels. This should be tested by measuring the intracellular concentration of GSH.
In fungi, GSH has a broad range of effects on cellular processes (Pocsi et al., 2004), one
example of which is the regulation of vacuolar H+-ATPase by redox state in barley
leaves and the bacterium Dictyostelium discoideum (Tavakoli et al., 2001; J eong et al.,
2006). Vacuolar and plasma membrane H+-ATPases are also coordinately regulated in S.
cerevisiae in response to cytoplasmic pH (Fernandez & Sa-Correia, 2001), which has the

potential to impact the activity of sulfate perrnease, a proton syrnporter.

Summary

The addition of cys led to decreased uptake of radio-labeled sulfate and decreased
transcription of putative genes encoding a high affinity sulfate perrnease, CT pathway,
sulfate assimilatory pathway enzymes (Fig. 3-5). Unlike other fungi studied with the

exception of S. pombe, met addition failed to change sulfate uptake or the transcription of

127

related genes (Fig. 3-2). In S. pombe, the failure of met addition to elicit a regulatory
response is due to the lack of a CT pathway converting met to cys, and the observation
agrees with the hypothesis that cys is the principal regulatory molecule in filngi
(Brzywczy et al., 2002; Schierova et al., 2000). G. intraradices germinating spores,
however, possess putative transcripts homologous to the CT pathway genes, CBS and
CGL, and these transcripts are up-regulated by met addition suggesting functionality
(Fig. 3-5). Cysteine addition had moderate effects in G. intraradices, reducing
transcription by two fold compared to similar studies in other fungi demonstrating much
more extreme reductions of five to ten fold (Thomas et al., 1990; Cherest et al., 1985;
Borges-Walrnsley et al., 1995). Aside from cys effects, sulfate assimilation in G.
intraradices germinating spores was independent of transcriptional regulation (Fig. 3-5).
These observations, along with the apparent up-regulation of putative S assimilation
genes by GSH (Fig. 3-5), demonstrate that G. intrardices germinating spores are unique

in the regulation of S assimilation among filngi studied.

128

References

Allen JW, Shachar-Hill Y. 2009. Sulfilr transfer through an arbuscular mycorrhiza.
Plant Physiology 149(1): 549-560.

Bago B, Pfeffer PE, Douds DD, Brouillette J, Becard G, Shachar-Hill Y. 1999.
Carbon metabolism in spores of the arbuscular mycorrhizal fungus Glomus intraradices
as revealed by nuclear magnetic resonance spectroscopy. Plant Physiology 121(1): 263-
271.

Besserer A, Becard G, J auneau A, Roux C, Sejalon-Delmas N. 2008. GR24, a
synthetic analog of strigolactones, stimulates the mitosis and growth of the arbuscular

mycorrhizal fungus Gigaspora rosea by boosting its energy metabolism. Plant
Physiology 148(1): 402-413.

Borgeswalmsley MI, Turner G, Bailey AM, Brown J, Lehmbeck J, Clausen IG.
1995. Isolation and characterization of genes for sulfate activation and reduction in
Aspergillus-nidulans - implications for evolution of an allosteric control region by gene
duplication. Molecular & General Genetics 247(4): 423-429.

BradfieI.G, Somerfie.P, Meyn T, Holby M, Babcock D, Bradley D, Segel IH. 1970.
Regulation of sulfate transport in filamentous fungi. Plant Physiology 46(5): 720-727.

Breton A, Surdinkerjan Y. 1977. Sulfate uptake in Saccharomyces-cerevisiae -
biochemical and genetic study. Journal of Bacteriology 132(1): 224—232.

Brzywczy J, Natorff R, Sienko M, Paszewski A. 2007. Multiple fungal enzymes
possess cysteine synthase activity in vitro. Research in Microbiology 158(5): 428-436.

Brzywczy J, Paszewski A. 1993. Role of O-acetylhomoserine sulflrydrylase in sulfur
amino-acid synthesis in various yeasts. Yeast 9(12): 1335-1342.

Brzywczy J, Sienko M, Kucharska A, Paszewski A. 2002. Sulphur amino acid
synthesis in Schizosaccharomyces pombe represents a specific variant of sulphur
metabolism in filngi. Yeast 19(1): 29-35.

Bucking H, Abuhaker J, Govindarajulu M, Tala M, Pfeffer PE, Nagahashi G,

Lammers P, Shachar-Hill Y. 2008. Root exudates stimulate the uptake and metabolism
of organic carbon in germinating spores of Glomus intraradices. New Phytologist 180(3):
684-695.

Carr GR, Hinkley MA, Letacon F, Hepper CM, Jones MGK, Thomas E. 1985.

Improved hyphal growth of 2 species of vesicular arbuscular mycorrhizal fungi in the
presence of suspension-cultured plant-cells. New Phytologist 101(3): 417-426.

129

Cherest H, Davidian JC, Thomas D, Benes V, Ansorge W, SurdinKerjan Y. 1997.
Molecular characterization of two high affinity sulfate transporters in Saccharomyces
cerevisiae. Genetics 145(3): 627-635.

Cherest H, Surdinkerjan Y. 1992. Genetic-analysis of a new mutation conferring
cysteine auxotrophy in Saccharomyces-cerevisiae - updating of the sulfur metabolism
pathway. Genetics 130(1): 51-58.

Cherest H, Thao NN, Surdinkerjan Y. 1985. Transcriptional regulation of the MET3-
gene of Saccharomyces-cerevisiae. Gene 34(2-3): 269-281.

Clarke DL, Newbert RW, Turner G. 1997. Cloning and characterisation of the
adenosyl phosphosulphate kinase gene from Aspergillus nidulans. Current Genetics
32(6): 408-412.

Cooper KM, Tinker PB. 1978. Translocation and transfer of nutrients in vesicular-
arbuscular mycorrhizas .2. Uptake and translocation of phosphorus, zinc and sulfur. New
Phytologist 81(1): 43-47.

Dann SG, Thomas G. 2006. The amino acid sensitive TOR pathway fi'om yeast to
mammals. Febs Letters 580(12): 2821-2829.

Dotzler N, Krings M, Taylor TN, Agerer R. 2006. Germination shields in
Scutellospora (Glomeromycota : Diversisporales, Gigasporaceae) fi'om the 400 million-
year-old Rhynie chert. Mycological Progress 5(3): 178-184.

Douds DD, Nagahashi G, Pfeffer PE, Reider C, Kayser WM. 2006. On-farrn
production of AM fungus inoculum in mixtures of compost and vermiculite. Bioresource
Technology 97(6): 809-818.

Fernandes AR, Sa-Correia I. 2001. The activity of plasma membrane H+-ATPase is
strongly stimulated during Saccharomyces cerevisiae adaptation to growth under high
copper stress, accompanying intracellular acidification. Yeast 18(6): 511-521.

Foster BA, Thomas SM, Mahr JA, Renosto F, Patel HC, Segel IH. 1994. Cloning and
sequencing of ATP sulfurylase from Penicillium-chrysogenum - identification of a likely
allosteric domain. Journal of Biological Chemistry 269(31): 19777-19786.

Fu YH, Paietta JV, Mannix DG, Marzluf GA. 1989. CYS-3, the positive-acting sulfur
regulatory gene of Neurospora-crassa, encodes a protein with a putative leucine zipper
DNA-binding element. Molecular and Cellular Biology 9(3): 1120-1 127.

Gachomo E, Allen JW, Pfeffer PE, Govindarajulu M, Douds DD, Jin H, Nagahashi
G, Lammers PJ, Shachar—Hill Y, Bucking H. 2009. Germinating spores of Glomus
intraradices can use internal and exogenous nitrogen sources for de novo biosynthesis of
amino acids. New Phytologist. doi: 10.111l/j.l469-8137.2009.02968.x.

130

Gahoonia TS, Raza S, Nielsen NE. 1994. Phosphorus depletion in the rhizosphere as
influenced by soil-moisture. Plant and Soil 159(2): 213-218.

Griffith OW, Meister A. 1979. Potent and specific-inhibition of glutathione synthesis by
buthionine sulfoximine (s-normal-butyl homocysteine sulfoximine). Journal of
Biological Chemistry 254(16): 7558-7560.

Hepper CM, Jakobsen I. 1983. Hyphal growth from spores of the mycorrhizal fungus
Glomus-caledonius - effect of amino-acids. Soil Biology & Biochemistry 15(1): 55-58.

Hepper CM, Warner A. 1983. Role of organic-matter in grth of a vesicular-
arbuscular mycorrhizal fungus in soil. Transactions of the British Mycological Society
81(AUG): 155-156.

Hepper CM. 1983. Limited independent growth of a vesicular-arbuscular mycorrhizal
firngus invitro. New Phytologist 93(4): 537-542.

Hepper CM. 1984. Inorganic sulfur nutrition of the vesicular arbuscular mycorrhizal
fungus Glomus-caledonium. Soil Biology & Biochemistry 16(6): 669-671.

Hiraishi H, Miyake T, Ono B. 2008. Transcriptional regulation of Saccharomyces
cerevisiae CYS3 encoding cystathionine gamma-lyase. Current Genetics 53(4): 225-234.

Jacobson ES, Metzenberg RL. 1977. Control of arylsulfatase in a serine auxotroph of
Neurospora. Journal of Bacteriology 130(3): 1397-1398.

Jeong SY, Choi CH, Kim J S, Park SJ, Kang SO. 2006. T hioredoxin reductase is
required for grth and regulates entry into culmination of Dictyostelium discoideum.
Molecular Microbiology 61(6): 1443-1456.

Jun J, J A, Rehrer C, Pfeffer PE, Shachar—Hill Y, Lammers PJ. 2002. Expression in
an arbuscular mycorrhizal firngus of genes putatively involved in metabolism, transport,
the cytoskeleton and the cell cycle. Plant and Soil 244: 141-148.

Ketter J S, Jarai G, Fu YH, Marzluf GA. 1991. Nucleotide-sequence, messenger-ma
stability, and dna recognition elements of cys-l4, the structural gene for sulfate
perrnease-ii in neurospora—crassa. Biochemistry 30(7): 1780-1787.

Ketter JS, Marzluf GA. 1988. Molecular-cloning and analysis of the regulation of cys-
14+, a structural gene of the sulfur regulatory circuit of neurospora-crassa. Molecular and
Cellular Biology 8(4): 1504-1508.

Kumar C, Sharma R, Bachhawat AK. 2003. Utilization of glutathione as an exogenous
sulfur source is independent of gamma-glutamyl transpeptidase in the yeast
Saccharomyces cerevisiae: evidence for an alternative gluathione degradation pathway.
F ems Microbiology Letters 219(2): 187-194.

131

Kuras L, Rouillon A, Lee T, Barbey R, Tyers M, Thomas D. 2002. Dual regulation of
the Met4 transcription factor by ubiquitin-dependent degradation and inhibition of
promoter recruitment. Molecular Cell 10(1): 69-80.

Lammers PJ, Jun J, Abuhaker J, Arreola R, Gopalan A, Bago B, Hernandez-
Sebastia C, Allen JW, Douds DD, Pfeffer PE, Shachar—Hill Y. 2001. The glyoxylate
cycle in an arbuscular mycorrhizal fungus. Carbon flux and gene expression. Plant
Physiology 127(3): 1287-1298.

Lewandowska M, Paszewski A. 1987. Regulation of sulfur arnino-acids metabolic
enzymes in Cephalosporium-acremonium strains differing in antibiotic production. Acta
Microbiologica Polonica 36(1-2): 39-45.

Li XL, George E, Marschner H. 1991. Extension of the phosphorus depletion zone in
VA-mycorrhizal white clover in a calcareous soil. Plant and Soil 136(1): 41-48.

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)). Methods 25: 402-408.

Lowe G. 1991. Mechanisms of sulfate activation and transfer. Philosophical
Transactions of the Royal Society of London Series B-Biological Sciences 332(1263):
141-148.

Marzluf GA, Metzenberg RI. 1968. Positive control by CYS-3 locus in regulation of
sulfur metabolism in Neurospora. Journal of Molecular Biology 33(2): 423-437.

Marzluf GA. 1997. Molecular genetics of sulfilr assimilation in filamentous fungi and
yeast. Annual Review of Microbiology 51: 73-96.

Miyake T, Hiraishi H, Sammoto H, Ono BI. 2003. Involvement of the VDE homing
endonuclease and raparnycin in regulation of the Saccharomyces cerevisiae GSHll gene

encoding the high affinity glutathione transporter. Journal of Biological Chemistry
278(41): 39632-39636.

Miyake T, Sammoto H, Kanayama M, Tomochika K, Shinoda S, Ono B. 1999. Role
of the sulphate assimilation pathway in utilization of glutathione as a sulphur source by
Saccharomyces cerevisiae. Yeast 15(14): 1449-1457.

Morzycka E, Paszewski A. 1979. 2 pathways of cysteine biosynthesis in
Saccharomycopsis-lipolytica. F ebs Letters 101(1): 97-100.

Nagahashi G, Douds DD, Abney GD. 1996. Phosphorus amendment inhibits hyphal
branching of the VAM fungus Gigaspora margarita directly and indirectly through its
effect on root exudation. Mycorrhiza 6(5): 403-408.

132

Natorff R, Sienko M, Brzywczy J, Paszewski A. 2003. The Aspergillus nidulans metR
gene encodes a bZIP protein which activates transcription of sulphur metabolism genes.
Molecular Microbiology 49(4): 1081-1094.

Ono B, Hazu T, Yoshida S, Kawato T, Shinoda S, Brszczy J, Paszewski A. 1999.
Cysteine biosynthesis in Saccharomyces cerevisiae: a new outlook on pathway and
regulation. Yeast 15(13): 1365-1375.

Ono B, Kijima K, Ishii N, Kawato T, Matsuda A, Paszewski A, Shinoda S. 1996.
Regulation of sulphate assimilation in Saccharomyces cerevisiae. Yeast 12(11): 1153-
1 162.

Ono Bl, Ishii N, Naito K, Miyoshi SI, Shinoda S, Yamamoto S, Ohmori S. 1993.
Cystathionine gamma-lyase of Saccharomyces-cerevisiae - structural gene and
cystathionine gamma-synthase activity. Yeast 9(4): 389-397.

Ono BI, Naito K, Shirahige Y], Yamamoto M. 1991. Regulation of cystathionine
gamma-lyase in Saccharomyces-cerevisiae. Yeast 7(8): 843-848.

Paszewski A, Grabski J. 1974. Regulation of s-amino acids biosynthesis in Aspergillus-
nidulans - role of cysteine and-or homocysteine as regulatory effectors. Molecular &
General Genetics 132(4): 307-320.

Penninckx MJ, Jaspers CJ. 1982. On the role of glutathione in microorganisms.
Bulletin De L Institut Pasteur 80(4): 291-301.

Pilsyk S, Natorff R, Sienko M, Paszewski A. 2007. Sulfate transport in Aspergillus
nidulans: A novel gene encoding alternative sulfate transporter. Fungal Genetics and
Biology 44(8): 715-725.

Piotrowska M. 1993. Candida-valida - a yeast lacking the reverse transsulphuration '
pathway. Acta Microbiologica Polonica 42(1): 35-39.

Pocsi I, Prade RA, Penninckx MJ 2004. Glutathione, altruistic metabolite in fungi.
Advances in Microbial Physiologr 49: 1-76.

Renosto F, Martin RL, Wailes LM, Daley LA, Segel IH. 1990. Regulation of inorganic
sulfate activation in filamentous fungi - allosteric inhibition of atp sulfurylase by 3'-
phosphoadenosine-S'-phosphosulfate. Journal of Biological Chemistry 265(18): 10300-
10308.

Schierova M, Linka M, Pazoutova S. 2000. Sulfate assimilation in Aspergillus terreus:
analysis of genes encoding ATP-sulfurylase and PAPS-reductase. Current Genetics
38(3): 126-131.

133

Sienko M, Paszewski A. 1999. The metG gene of Aspergillus nidulans encoding
cystathionine beta-lyase: cloning and analysis. Current Genetics 35(6): 638-646.

Smith SE, Read DJ. 2007. Mycorrhizal symbiosis, 3rd edn. London, UK.

Tamasloukht M, Sejalon-Delmas N, Kluever A, J auneau A, Roux C, Becard G,
Franken P. 2003. Root factors induce mitochondrial-related gene expression and fungal
respiration during the developmental switch fiom asymbiosis to presymbiosis in the
arbuscular mycorrhizal fungus Gigaspora rosea. Plant Physiology 131(3): 1468-1478.

Tamasloukht M, Waschke A, Franken P. 2007. Root exudate-stimulated RNA
accumulation in the arbuscular mycorrhizal fungus Gigaspora rosea. Soil Biology &
Biochemistry 39(7): 1824-1827.

Tavakoli N, Kluge C, Golldack D, Mimura T, Dietz KJ. 2001. Reversible redox
control of plant vacuolar H+-ATPase activity is related to disulfide bridge formation in
subunit E as well as subunit A. Plant Journal 28(1): 51-59.

Thomas D, Barbey R, Surdinkerjan Y. 1990. Gene-enzyme relationship in the sulfate
assimilation pathway of Saccharomyces-cerevisiae - study of the 3'-
phosphoadenylylsulfate reductase structural gene. Journal of Biological Chemistry
265(26): 15518-15524.

Thomas D, Jacquemin I, Surdinkerjan Y. 1992. Met4, a leucine zipper protein, and
centromere-binding factor-i are both required for transcriptional activation of sulfur

metabolism in Saccharomyces-cerevisiae. Molecular and Cellular Biology 12(4): 1719-
1 727.

Thomson BD, Clarkson DT, Brain P. 1990. Kinetics of phosphorus uptake by the
germ-tubes of the vesicular arbuscular mycorrhizal fungus, Gigaspora-margarita. New
Phytologist 116(4): 647-653.

van de Kamp M, Schuurs TA, Vos A, van der Lende TR, Konings WN, Driessen
AJM. 2000. Sulfur regulation of the sulfate transporter genes sutA and sutB in
Penicillium chrysogenum. Applied and Environmental Microbiology 66(10): 4536-4538.

Wang B, Qiu YL. 2006. Phylogenetic distribution and evolution of mycorrhizas in land
plants. Mycorrhiza 16(5): 299-363.

Wang ZY, Kelly JM, Kovar JL. 2004. In situ dynamics of phosphorus in the
rhizosphere solution of five species. Journal of Environmental Quality 33(4): 1387-1392.

Wheeler GL, Quinn KA, Perrone G, Dawes IW, Grant CM. 2002. Glutathione

regulates the expression of gamma-glutamylcysteine synthetase via the Met4
transcription factor. Molecular Microbiology 46(2): 545-556.

134

Zhou D, White RH. 1991. Transsulfuration in archaebacteria. Journal of Bacteriology
173(10): 3250-3251.

135

Chapter 4

The Relationship between N and S Assimilation in Germinating

Spores of Glomus intraradices

136

Abstract

The relationship between the assimilation of two macronutrients, N and S, was

analyzed in germinating spores of the arbuscular mycorrhizal fungi Glomus intraradices

. . 35 2- .
by measuring the effect of varlous N sources on S04 uptake, sequestratlon, and

assimilation into amino acid and protein pools. Additionally, 15N-labeling of free amino

acids by GC-MS and HPLC based amino acid concentration analyses were used to
determine the effect of various S sources on N assimilation. Changes in putative S uptake

and assimilation genes associated with exogenous ammonia availability were measured

. . . . . . 35
usrng quantitative real-tlme PCR and the results analyzed in relation to S-uptake data.

All N sources tested increased sulfate uptake by a minimum of two fold. Ammonia and

. . 2-
urea led to the greatest increases in 804 uptake, and were also preferred N sources as

. . . . 15 .
reflected by lncreased free amino ac1d concentratlons and N-labellng compared to

supplementation with nitrate, Gln, and Arg. Ammonia addition failed to increase sulfate
uptake in the presence of reduced glutathione (GSH), which also halved the
concentrations of amino acids related to N assimilation and doubled that of Leu, which is
a regulator of S assimilation in other organisms. Cysteine, methionone, and 0-
acetylserine addition failed to counteract the effect of armnonia addition. When S was
supplied to germinating spores as cysteine, ammonia addition had no effect on
assimilation in the presence of absence of GSH, whereas GSH increased assimilation by
30%. The transcription of putative high affinity sulfate perrnease, sulfate adenosyl

transferase, phosphoadenosylephosphosulfate reductase, cystathionine beta-synthase, and

137

cystathionine gamma-lyase was analyzed in relation to labeling data and found to be
unrelated. While N assimilation is not altered by S addition, S assimilation is increased
with N addition in proportion to general increases in amino acid concentrations from de

novo synthesis.

138

Introduction

In fungi, N assimilation is tightly controlled on a transcriptional level and
involves a global positive acting transcriptional factor and a host of associated pathway
specific regulatory proteins (Marzluf, 1993). Orthologs of the global transcriptional factor
responsible for the amino acid control circuit (gC) in yeasts and cross pathway control
circuits (CPC) in filamentous fungi have been characterized in Neurospora crassa (Nit2;
Chiang & Marzluf, 1995), Aspergillus nidulans (AreA/NirA; Okamoto et al., 1993) and
Saccharomyces cerevisiae (Gcn4/Gln3; Sosa et al., 2003; Roussou et al. , 1988).
Additionally, orthologs have been identified in the basidiomycete biotrophic plant
pathogen Ustilago maydis (McCann & Snetselaar, 2008), the ascomycete
ectomycorrhizal truffle Tuber borchii (TbNrel; Guescini et al., 2009), the yeast Hansula
polymorpha (Siverio et al., 2002), as well as several other Aspergilli (Braus et al., 2006),
which show a high degree of conservation. Amino acid control in S. cerevisiae is initiated
by the binding of a sensor kinase, Gcn2p, to uncharged tRNAs, resulting in a
phosphorylation cascade, the general reduction of the translation initiation rate, and the
increase in the transcription of Gcn4-controlled sequences (Dong et al., 2000). Both
AreA and Nit2 contain putative glutamine (gln) binding sites, disruption of which results
in a loss of sensitivity to N repression (Marzluf, 1993). Intracellular gln concentrations in
A. nidulans are inversely related to the activity of AreAp, suggesting that the cross
pathway control regulatory system senses gln (Berger et al., 2008).

There are direct and indirect associations between N and S assimilation on both

the enzymatic and transcriptional level. The Gcn4p/Nit2 proteins directly or indirectly

139

regulate the expression of hundreds of genes (Tian et al, 2007; Natarajan et al., 2001),
including genes involved with S amino acid synthesis and sulfate reduction pathways. In
S. cerevisiae, several of these genes have known Gcn4 promoter sequences including
methionine synthase, sulfite reductase, 3’-phospho-5’-adenylylsulfate (PAPS) reductase,
and the positive transcriptional activator Met4 (Thomas & Surdin-Kelj an, 1997).
Interestingly, the only known transcriptional regulator of Met4, which is not regulated ny
S source, is Gcn4p (Mountain et al., 1993). Additionally, an analysis of conserved direct
targets of Gcn4 and orthologs in S. cerevisiae, C. albicans, and N. crassa using genomic
and transcriptomic data by Tian and co-workers (2007) revealed ten directly regulated
genes, one of which is part of the transsulfuration pathway converting cysteine to
methionine, cystathionine B-synthase. 0n the level of metabolism, the synthesis of met is
directly related to threonine (thr) and indirectly related to aspartate (asp) and branched
chain amino acid synthesis (Thomas & Surdin-Kerjan, 1997).

General amino acid control over transcription is known to be required for life
cycle completion and survival in several fungi. The expression of AreA/Nit2/Gcn4 are
required for complete virulence of A. funigatus in immuno-suppressed mice,
morphogenesis in C. albicans, and cell-cell or cell-surface adhesion in S. cerevisiae
(Braus et al., 2006; Yin et al., 2004; Braus et al., 2003; Kleinschmidt et al., 2005). The
TbNrel gene is also specifically upregulated in the T uber borchii symbiotic state,
demonstrating a possible role for cross pathway control in a mycorrhizal symbiosis
(Guescini et al., 2009). The widespread use of the endomycorrhizal symbiosis in
agriculture is currently restricted by difficulties obtaining large scale inoculum, a

consequence of their obligatory symbiotic nature. The study of nutrient regulation may

140

uncover the limitations on the transition from the pre-symbiotic to symbiotic state in
arbuscular mycorrhizal fungi, enabling their large scale agricultural use.

In Glomus intraradices pre-gerrninating spores both N and S are imported and
utilized, though exogenous sources are unnecessary for germination (Gachomo et al,
2009; Smith & Read, 2008). The present study examined the inter-relationship between N

and S metabolism in arbuscular mycorrhizal fimgi using germinating spores of Glomus

. . 35 .
intraradices as a model system. Labeling With S revealed a dramatic response of

increased sulfate uptake and assimilation when N sources, especially ammonia, were '
supplied. The addition of glutathione (GSH) counteracted the effects of ammonia on
sulfate uptake whereas cys and met had no suppressive effects. The addition of a specific
inhibitor of GSH synthesis, buthionine sulfoximine increased sulfate uptake with and
without available ammonia. The concentrations of free amino acids related to ammonia
assimilation were halved when GSH was supplied exogenously. The data suggests that
intracellular GSH concentrations supercede the affects of N source availability on sulfate
acquisition by altering the assimilation of ammonia. Gene expression analysis of putative
sulfate assimilation genes failed to correlate with sulfate uptake data, and transcriptional
regulation therefore does not explain the control of sulfate assimilation by ammonia.

Finally, a model is presented in interpretation of the results of the study and discussed.

141

Experimental Procedures

Amino acid quantification

Approximately 25,000 spores (Premier Tech Biotechnologies, Quebec, Canada)
were germinated per sample at 30°C in sterile 12 well petri plates containing lmL of M
medium (St.Amaud et al., 1996) modified to remove N (Govindarajalu et al., 2005) and
sucrose. Four samples were analyzed for each condition for each experiment (Figures 4-

1, 4-2, and 4-8). Additional to the modified M medium, MilliQ water, 2 mM urea, 4 mM

NH4C1, 4 mM KNO3, 2 mM L-glutamine, or 2 mM L-arginine hydrochloride (Si gma-

Aldrich, St. Louis, M0) were added as 0.05 mL of filtered stock solutions to study the
effect of exogenous nitrogen sources (Figure 4-2). Germinating spores were collected at
0, 7, or 14 days (Figure 4-1) by sieving and immediate freezen in liquid nitrogen,
lyophilized and weighed. Measurements of the effects of GSH addition on amino acid
concentration were made by adding 2 mM MES (pH 6.0) with or without 1 mM GSH.
Free amino acids were extracted by first disintegrating spores and germ tubes in
0.1 mL of a 0.01 N HCl solution using a bead mill (Retsch MM301) set to 30 Hz and two
3 mM stainless steel beads for 4 min. The complete disintegration was confirmed by
analyzing small aliquots of five randomly chosen samples under a dissecting microscope.
An additional 0.4 mL of 0.01 N HCl was added followed by 10 min of vortexing.
Approximately 2500 pmols of norleucine was added as an internal standard prior to
extraction. Chloroform (0.5 mL) was added followed by 5 min of further vortexing, after
which the chloroform, aqueous solution, and cell debris were separated by centrifugation.

The supematants were collected and lyophilized. Dried samples were re-dissolved in 0.02

142

mL of 0.02 N HCl , 0.06 ml of 0.1 M sodium borate buffer (pH 10.0), and 0.02 mL of
AccQ-FluorTM reagent (6-aminoquinolyl-N-hydroxysuccinimidylcarbarnate; Waters,
Milford, MA, USA). Free amino acids were analyzed from aliquots of 0.01 or 0.02 mL of
each sample by HPLC-fluorescence using a Waters 2695 Alliance HPLC (Waters,
Milford, MA) equipped with a 37°C column oven, a Waters 2474 Fluorescence Detector,
and Empower software (Waters, Milford, MA). A four buffer system was used for HPLC:
A and B, sodium acetate buffer (Waters, Milford, MA) adjusted to pH 5.7 and pH 6.8

with phosphoric acid; C, acetonitrile; and D, methanol:water (1:9).

35S-Iabeling experiments

Approximately 5x103 sterile spores of Glomus intraradices (Premier Tech

Biotechnologies, Reviere-du-Loup, Québec, Canada) per sample were washed on a 300
mesh sieve, collected, and blended together with cold solidified sterile Gel-gro agar (MP
Biomedicals, Solon, OH) using a Waring blender to form a slurry of uniform spore

density, and aliquots of 2 mL were transferred to the wells of sterile 12 well polystyrene

plates. The germination slurry contained only 2 mM MES buffer (pH 6.0), 2 mM CaClz,

and spores, and were maintained at 4°C for at least one week prior to labeling with either
. 35 . 35 . . .

16.5 pCi of Na2[ S04] or 9.3 pCl of L-[ S]cystelne (MP Biomedicals, Solon, OH).

Labeled sulfate was supplied with 0.1 mM NaZSO4, and 35S-cysteine with 0.1. mM

unlabeled cysteine as carrier molecules. Additionally, 1 mM O-acetylserine, 1 mM

reduced glutathione, 1 mM cysteine, 1 mM methionine, or 10 mM buthionine

sulfoximine were added with or without 4 mM NH4Cl (Figures 4-5 and 4-6). For the

143

analysis of N source effects on sulfate uptake (Figure 4-3), N was supplied as 4 mM

KN03, 2 mM L-glutamine, 2 mM L-arginine, 2 mM urea, or 4 mM NH4C1. Spores were

germinated for seven days after labeling in a 30°C incubator. Samples were collected and
S-containing compounds extracted and fractionated into different biochemical pools

exactly as described in Chapter 3.

15N-labeling experiments
. . . 15 . 15
Experiments exarnrnmg percent N-labelrng used 4 mM NH4C1 or 4 mM
K15N03 as N sources in Gel-gro gellan (MP Biomedicals, Solon, OH), 2 mM CaClz, and

2 mM MES (pH 6.0) as previously described (Chapter 3). All sources of 15N were 98%

labeled. Approximately 1x104 sterile spores of Glomus intraradices (Premier Tech

Biotechnologies, Reviere-du-Loup, Québec, Canada) were germinated per sample in a

30°C incubator and in the presence of 15N label prior to collection after one week.

Additionally, 0.1 mM Na2S04, 1 mM L-cysteine hydrochloride, 1 mM reduced

glutathione, or 10 mM buthionine sulfoximine were added at the time of labeling.
Samples were collected by adding them to 100 mL of cold 10 mM sodium citrate buffer

(pH 6.0) and sieving the solution two minutes later on a 300 mesh wire sieve, followed

immediately by liquid N2 freezing and lyophilization. Amino acids were extracted by

pulverizing each sample in 0.1 mL of 0.01 M HCl solution with two 3 mm stainless steel
beads using a bead mill (Retsch MM301) oscilating at 30Hz for four minutes (Allen and

Shachar-Hill, 2009). The amino acid pool was extracted by the addition of 0.4 mL of 0.01

144

M HCl followed by moderate vortexing for 10 min. Proteins and non-polar compounds
were removed by the addition of 0.5 mL of CHC13 followed by 2 min of moderate

vortexing. Samples were centrifilged at 14,000 g for 10 min and the supematants

collected. The final solutions were dried under gaseous N2 streams, heated to 60°C on a

heat block. The dried amino acid extracts were reconstituted in 0.1 mL of MilliQ water,
transferred to GC-MS vial inserts, and lyophilized in preparation of derivatization.
Amino acid samples were derivatized in pyridine: N-tert-butyldimethylsilyl-

trifluoroacetamide (MTBSTFA) (1:1) for 1 hr at 55°C prior and l pL injected at 280°C
using an Agilent 7683 series injector (Santa Clara, CA, USA) into an Agilent GC-MS
system (6890N Netwrok GC System and 5973 inert Mass Selective Detector) equipped
with a J &W Scientific 30m DB5-ms column (Agilent Technologies, Santa Clara, CA,
USA). The oven temperature was maintained at 100°C for 4 min, ramped to 200°C at
5°C/min, then to 300°C at 10°C/min where it was held for 2min. Amino acid standards

were used to identify GC peaks and mass fragments.

RNA extraction and gene expression measurements

RNA was extracted from frozen tissue as described in previous chapters. Briefly,
tissue for extraction was oscillated in 1.5 mL screw-cap microcentrifuge tubes at 30 Hz in
the presence of 100uL extraction buffer (RN easy Plant Mini Kit, Qiagen, Valencia, CA)
and two 3 mm stainless steel beads using a Retsch MM301 bead mill three times for two
minutes each time. Five 2 min homogenation steps were done in total and the samples
were refrozen in liquid nitrogen between steps. Aliquots of 2 pL were examined

microscopically for complete spore breakage. Extractions using an RNeasy Plant Mini

145

Kit (Qiagen, Valencia, CA) were followed by treatment with RNase-free DNase (Turbo
DNA-free; Ambion, Austin, TX), after which aliquots were measured by UV absorbance
to determine RNA concentration and approximate purity. Equal quantities of RNA were
used to synthesize cDNA with SuperScript II reverse transcriptase (Invitro gen corp.,
Carlsbad, CA), and negative controls were generated with parallel sample sets which did
not contain the enzyme. Sequences of putative sulfate assimilation-related genes were
obtained by BLAST batch analyses using homologous sequences of conserved regions of
each gene of interest as previously described (chapters 2 & 3), and these sequences were
verified by PCR amplification and sequencing using an ABI PRISM® 3100 Genetic
Analyzer (Applied Biosystems, CA, USA). Primer sequences used (Primer Express
software, Applied Biosystems, Austin, TX; [DT, Syntegen, Skokie, IL) are identical to
those listed in chapter 3. Gene expression measurements were analyzed as previously

reported in chapter 3.

146

Results

Free amino acid concentrations during germination

Free amino acid (FAA) concentrations were measured at three time points, 0, 7, and 14
days (Figure 4-1). The total N content in the FAA pool decreased by 27 i 4% between 0
and 7 days of germination, 72 i 14% of that amount was due to a fall in asp content. The
total N content of the FAA pool did not significantly change significantly between days 7
and 14 by AN OVA single factor analysis (alpha = 0.05). Aspartate represented almost
half (41 :l: 0.7%) of the total N in this pool before germination, dropping to 20 :t 2% by
day 14. On day 14 the levels of five FAA’s, asn, gly, leu, pro, and gln, had increased and
three FAA’s, ala, asp, and ile, had decreased more than two fold compared to the levels at
day 0. Fewer than half of the FAA concentrations changed significantly between days 7
and 14 (ANOVA; alpha = 0.05), and only two out of nineteen, glycine and leucine,
showed greater than two fold differences. With few exceptions FAA concentrations were
stable after 7 days of germination, and experiments were therefore conducted over one

week time periods.

147

Figure 4-1. Time course of free amino acid concentration in germinating spores of
Glomus intraradices. Spores were germinated in deionized water for 0 (white bars), 7
(down slashed bars), and 14 (gray bars) days prior to the extraction of free amino acids
and quantification by HPLC analysis, 11 = 4 i SEM.

148

Figure 4-1

(0
‘—

 

V' N o co co ‘1- N

(MCI l.6ui slowu) uoirelruaouoo pioe 01.1va

149

Ala Arg Asn Asp Cys Gln Glu Gly His Met Ile Leu Lys Phe Pro Ser 1hr Tyr Val

Figure 4-2 Free amino acid concentrations in the presence of exogenous N sources. The
free amino acid composition of extracts of Glomus intraradices spores germinated for 7
days with no nitrogen source (white bars), 4mM KN O3 (horizontally striped bars), 2mM
Gln (light gray bars), 2mM Arg (up slashed bars), 2mM urea (dark gray bars), or 4mM

NH4C1 (down slashed bars). The charts represent concentrations (A) above or (B) below

2 nmols mg.1 DW, and (C) the total N concentration under each condition derived from

the sum of amino acid concentrations adjusted for the number of N atoms per molecule, n
= 4 i SEM.

150

Figure 4-2

Z .

7,
;‘.:‘:::‘:"'""“"’""‘"‘"""""""""::::::§
~ , “1* ~~~771-r~ r--~--*---~~--~~~.~~~-i

RR\\\\\\\\\\‘

 

.\\\\\\\\\Q~'

 

x\\\\\\
Z

_ r
Mi

:3. \\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\
:i;7////////////////4
m

 

 

 

l l I I I l I '
IO 0 ID 0 ID 0
m M N N F 1- '0 O

< (MCI l_Bru slowu) suoirerrueouoo prov ourruv

151

Asn Asp Gln Glu Gly His Pro Ser

Arg

Figure 4-2 (cont’d)

t-\\\\\\\\\\\\‘

 

§§§§§§§§§:3I.\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\‘

‘7/4

     

-
2\\\\\\\\\\\\\\\\\\2\\\\\\\\‘
{xx/(e

    

pt

it k\\\\\\\\\\\\\\\\\\\\\\\\\\\\
I’I/I/A

 
 

  

 

 

-
S\\\\V

:§\\\\\\\\\\\\\\\\\\\\\\\‘

  

 

3
5
2
15-
5

In (MCI L_Iiru sioruu) suoireuueouoo prov ouiulv

152

Cys Met Ile Leu Lys Phe Thr Tyr Val

Ala

  
   

 

~. '. -.‘.: ...._'-;‘- I ;. .5 3"».3:12.22‘...'?‘-;‘A‘.‘;t."..r.'-.'-_‘_‘.-'__£ 25.41: '2‘"

 

..
‘l
n
':
vl
'-
h.
:

 

 

 

 

 

 

 

 

 

 

 

The effects of N sources on free amino acid concentrations

The reduction of sulfate and nitrate are energy intensive processes and the
oxidative state of either nutrient may have an effect on the assimilation of the other
through the consumption of reducing equivalents. Control of the S assimilation pathway

has also been directly linked to general amino acid control in S. cerevisiae (Mountain et

al., 1993). Organic (arg and gln), reduced inorganic (NH4+ and urea), or oxidized

inorganic (N 03-) N were therefore supplied to germinating spores to determine the

plasticity of the FAA content (Figure 4-2). Inorganic N sources had equivalent effects on
the FAA pool overall, although there were differences in responses of glu, tyr, his, and
pro. The total N content in the FAA pool increased by more than 6 fold compared to
control samples with ammonia, urea, or nitrate addition; the response to these N sources
was not statistically distinct by ANOVA single factor analysis (Figure 4-2). In fungi, gln
concentrations modulate the amino acid control circuit (gC) in yeasts and cross pathway
control circuits (CPC) in filamentous fungi by directly binding to a global transcriptional
regulatory protein (Marzluf, 1993; Berger et al., 2008), and arg is a putative form of N
transfer to the hosts of AM filngal symbioses (Govindarajale et al., 2005). In contrast to
the inorganic N sources, supplying arg or gln led to only 2.5 i 0.5 fold or 1.2 i 0.2 fold

increases in total N. However, an analysis of percent labeling by 15N revealed that

15N03- labeled amino acids 43 i 5% less on average than comparable amounts of

15 + . . . . . . . .
NH4 (Figure 4-3), reveallng that the utllrzatlon of external nitrate is different than that

of reduced inorganic N. The internal source of N which makes up the difference in the

FAA total N content was not identified.

154

300-
D
250-
% 200
bl
g c
E.
c 150' +
.2
E D
§1m- B a B c
0
E
U)

 

 

 

 

 

 

H20 N03' GLN ARG URE NH4*

Figure 4-3 Influence of N sources on 35SO42- uptake, reduction, and allocation. Spores
were germinated in the presence of 0.1 mM Na2SO4 and 16.5 pCi of Naz[3SSO4] for
seven days. Prior to germination at 30°C, 4 mM KN03 (N03), and NH4C1 (NH4), 2 mM
urea (URE), glutamine (GLN), and arginine (ARG) were added. Samples were collected
and 3 S separated by chemical fractionation yielding fractions containing but not limited
to sulfate (white bars), amino acids (light gray bars), and proteins (dark gray bars),
analyzed by scintillation counting. Error is expressed as standard error of the mean from
the analysis of five samples per condition, and letters ANOVA single factor analyses
(alpha = 0.05) between fractions and total uptake (above white bars).

155

The effects of N sources on sulfate uptake and assimilation

The addition of different N sources revealed a general stimulation of S
incorporation into all fractions tested, disproportionately increasing sulfate sequestration
in some cases. While gln and arg addition did not change the amount of S incorporation
into the protein pool compared to nitrate addition, the introduction of urea and ammonia
produced significant increases in this S pool (Figure 4-3). Urea increased protein S by
37% more than nitrate, which increased protein S by 2.1 +/- 0.24 fold compared to
controls germinated without N. Ammonia addition doubled protein S incorporation
compared to nitrate, which caused an increase of the protein fraction of 4.1 +/- 0.24 fold
over controls, and also led to a disproportionately large amount of sequestered sulfate
(Figure 4-3). The type of N added had the greatest effect on the sulfate fractions. Urea

addition led to an increase in the sulfate fraction of 6.1 +/- 0.08 fold compared to

35 . . . . . .
controls, % less than ammonia addition. Sulfate fractions from urea and gly addltlons

were not statistically different by AN OVA analysis. Other treatments led to a doubling of
the sulfate fraction compared to controls and 2-3 fold increases in S incorporation into the
protein and amino acid (Figure 4-3). The addition of ammonia, however, led to a
disproportionate 9.4 +/- 0.2 fold increase in the sulfate fraction, the largest change
measured (Figure 4-3). Compared to the absence of N, nitrate, gln, arg, gly, urea, or
ammonia addition led to total increases in S incorporation of 2.31 +/- 0.08, 2.03 +/- 0.21,

2.46 +/- 0.10, 4.61 +/- 0.26, 4.41 +/- 0.08, and 6.66 +/- 0.16 fold, respectively.

156

Figure 4-4 Effect of SO42- (A) and S metabolites (B) on 15N-labeling of free amino
acids. (A) Spores were germinated at 30°C for 7 days in the presence of 4 mM K[15NO3]
either alone (white bars) or with 0.1 mM Na2S04 (down slashed bars); or with 4 mM
[ISNH4]CI either alone (light gray bars) or with 0.1 mM Na2804 (up slashed bars). (B)
Spores were germinated at 30°C for 7 days in the presence of 4 mM [ISNH4]C1 and

either no S source (white bars), or 0.1 mM NaZSO4 (down slashed bars), 1 mM L-
cysteine (light gray bars), 1 mM reduced glutathione (up slashed bars), or 10 mM
buthionine

157

   
      

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

       

 

 

 

 

 

Figure 4-4
7/////////////////////////////////////z '6
—
:\\\\\\\\\\\\\\\\\\\\\\s >
W/////////////////////////////////////////////////A ;
l-
h
m
U)
o
S
a.
‘63
E
3
at
.1
2b
0
E
(D
2
(D
:7//////////////////// g
;\\\\\\\\\\\\\\' 0
I.
WWW/”WWW; %
<
2
<
l f T I T I I T I T :'l
O o o o o o o o
2 a) 8 l~ to to v to 8 ,_ o
< (%) Burlaqe'l N9,

158

Figure 4-4 (cont’d)

 

 

 

 

. . =3€5${{:7//////////////////////////

 

 

 

 

 

 

 

100 ‘

(%) Burleqe'l N9,

159

Interactions between sulfate and nitrogen assimilation pathways
The interaction of N and S metabolism was examined in two experiments. In the

first, the effects of S on N metabolism was examined by supplying 15N nitrate or 15N

ammonium with or without SO42' or S metabolites and analyzing the 15N-labeling of

free amino acids (Figure 4-4). In the second experiment the effect of N on the regulation

of S assimilation was examined through an analysis of 35SO42- labeling in different S

fractions when S metabolites were added in the presence or absence of ammonia (Figure

4-5). Reduced glutathione altered both the labeling of FAA’s from 15N-ammonia and

also the effect of ammonia on sulfate uptake. When supplied with 15N-ammonia, the

average labeling after one week of germination was 74.5 d: 12.6% for all amino acids
measured (Figure 4-5). Among the compounds examined, only reduced glutathione
(GSH) significantly altered percent labeling, reducing it modestly in all amino acids
examined. The largest reductions were in val, leu, met, and tyr which were 31.5 i 5.1%,
27.2 :t 10.3%, 22.7 d: 9.5%, and 12.9 i 4.1% less labeled than the average of other
treatments, respectively. The experiments revealed little effect of sulfate, cys, or a
specific inhibitor of GSH synthesis, buthionine sulfoximine (BSO).

The effect of ammonia addition (which stimulates S assimilation, Figure 4-3) was
further analyzed by the introduction of 1 mM 0-acetyl serine (oas), the immediate
precursor of cysteine biosynthesis in A. nidulans and N. crassa (Marzluf, 1997). S uptake
and assimilation was not significantly different when oas was added (Figure 4-4A). The
simultaneous addition of oas and 2 mM ammonia reduced S incorporation into sulfate

(34.4 +/- 3.3%), amino acids (16.5 +/- 0.5%), and the solubilized fraction (31.6 +/- 4.4%).

160

There was no significant effect of ammonia on S incorporation into the protein fractions
(ANOVA; alpha = 0.05). In contrast, the addition of 1 mM GSH sharply reduced total
and fractional S incorporation in the presence or absence of ammonia (Figure 4-4B).
GSH addition reduced S incorporation by 88.5 +/- 4.5%. Introducing 2 mM ammonia
with gsh failed to significantly alter either fractional or total S incorporation compared to

GSH alone.

Glutathione addition in relation to sulfate assimilation and free amino acid
concentrations

An inhibitor of GSH synthesis, buthionine sulfoximine (BSO) was used to
determine if the effects of GSH addition were mediated via the intracellular GSH
concentration (Figure 4-4B). Inhibiting GSH synthesis with 10 mM 880 resulted in
significant changes in S incorporation only in the amino acid fraction, which was
increased by 3.1 +/- 0.5 fold. The addition of 2 mM ammonia (Figures 4-4A and B) led to
less S incorporation than 4 mM (Figure 4-3). Both figures 4A and 4B show a more than 3
fold increase in total S incorporation (3.3 +/- 0.2 fold in both cases) compared to the 6.7
+/- 0.2 fold enhancement shown in Figure 4-3.

To examine the effects of N and GSH on the uptake and incorporation of organic

S, [3SS]cys was supplied in the presence or absence of ammonia and/or GSH. Sulfate was

not added to the germination solution and the 0.1 mM cys added was the only S source
available. Ammonia (2 mM) had no effect on incorporation alone or with GSH addition
(1 mM). The application of GSH resulted in three changes: a 71 +/- 11% reduction in

amino acid fraction radioactive counts, a 2.1 +/- 0.21 fold increase in protein fraction

161

counts, and an increase of 56 +/- 17% in tissue solubilized fraction counts (Figure 4-5).
The possibility of conversion of cys to sulfate was also analyzed by measuring the sulfate
fractions, which contained less than 1.5% of the total radioactivity under all conditions.
This low level is within the error intrinsic to the barium sulfate precipitation procedure.
Since glutathione was the only compound tested that affected both ammonia
(Figure 4-5) and sulfate (Figure 4-6) assimilation, we analyzed its effects on N
metabolism further. Exposure to GSH in the absence of an N source led to decreased
concentrations of glu (2.3 i 0.1 fold), gln (1.9 d: 0.2 fold), asp (2 i 0.1 fold), asn (1.8 :I:
0.2 fold), and arg (1.5 i 0.1 fold) compared to germination in pure water, while most of
the FAA concentrations measured did not change (Figure 4-7). Aside from ala, which
showed a slight increase, the only FAA to increase in concentration was leu, which more

than doubled (2.1 :t 0.2 fold) in the presence of GSH.

162

35o . F

300 ‘

250 ‘

 

 

 

 

 

 

S Incorporation (ng S mg" DW)

 

 

N- M N- N+ N- N+ N. m N- N+ N- M
H20 OAS CYS MET GSH 380

Figure 4-5 35S-sulfate uptake, reduction, and allocation in the presence of ammonia and
S metabolites. Spores were germinated for 7 days at 30°C with 0.1 mM Na2S04 labeled

with 16.53 pCi of ”$042- per sample and 1 mM O-acetylserine (OAS), 1 mM reduced
glutathione (GSH), 1 mM L-cysteine hydrochloride (CYS), 1 mM L-methionine (MET),
or 10 mM buthionine sulfoximine (BSO) ill the absence (N-) or presence (N+) of 4 mM
ammonium chloride. Tissue was collected and S fractionated into pools containing sulfate
(white bars), amino acids (light gray bars), proteins (gray bars), and solubilized cell
debris (dark gray bars), n = 4 i SEM.

163

350 -

B
300~
E _
o 250
b:
E
m 200—
U!
E.
C
.2
H .
g 150
o
O.
h
o
O
5 1001
to
50-
0..

 

 

H20 NH4“ GSH NH4+IGSH

Figure 4-6 Effects of ammonia and glutathione (GSH) on [3SS]Cysteine uptake and
utilization. Spores were germinated for 7 days in a 30°C incubator with 0.1 mM L-
cysteine labeled with 9.3 pCi of [35S]Cys in the presence of water alone (H20), 4 mM
ammonia (NH4+), 1 mM reduced glutathione (GSH), or 1 mM GSH with 4 mM NH4+
(GSH/NH4+). Samples were collected and the S species separated by chemical
fiactionation yielding fractions containing but not limited to sulfate (white bars), amino

acids (light gray bars), proteins (medium gray bars), and tissue solubilized cellular debris
(dark gray bars), analyzed by scintillation counting, n = 6 :1: SEM.

164

Figure 4-7 Change in amino acid concentrations from glutathione addition. The free
amino acid composition of spores germinated for 7 days in water (gray bars) or with 1
mM reduced glutathione (up slashed bars) were evaluated by HPLC, n = 4 i SEM.

165

It llifi

ll if. f

Figure 4-7

('0 N ‘- o

(MCI L.tSur slowu) uolrelrueouoo prov oulwv

166

 

Ile Leu Lys Phe Pro Ser Thr Tyr Val

Ala Arg Asn Asp Glu Gln Gly His

Figure 4-8 Transcriptional changes of putative sulfur assimilation pathway genes after
NH4+ addition. Spores of G. intraradices were germinated for five days in 2 mM MES
(pH 6.0) prior to induction for six hours with 4 mM NH4C1 (up slashed bars) or a

combination of 4 mM NH4C1 and 0.1 mM Na2S04 (down slashed bars). Expression was
calculated relative to control samples given only deionized water and reported as fold
change. Putative sequences of the S assimilation pathway including a high affinity sulfate
perrnease (SUL), S-adenosyl transferase (SAT), phosphoadenylsulfate reductase
(PAPSR), cytathionine B-synthase (CBS), and cystathionine y-lyase (CGL) were
analyzed, 11 = 3 i SEM.

167

Figure 4-8

5 r
/

f

///////
Z

V
7

’/ .

 

efiueuo Pl0:I

168

 

SAT PAPSR CBS CGL

SUL

Changes in gene expression of putative sulfate assimilation genes in relation to
nitrogen addition

Genes from Glomus intraradices germinating spores were identified from 454
sequencing data based on homology to fungal sequences encoding a high affinity sulfate
transporter (SUL), sulfate adenylytransferase (SAT), 3’-phosphoadenylsulfate reductase
(PAPSR), and the enzymes making up the reverse transsulfuration pathway (CT pathway)
cystathionine B-synthase (CBS) and cystathionine y-lyase (CGL) (see chapters 2 & 3).
The expression of these genes was analyzed after a six hour induction by the addition of
ammonia to spores germinated for seven days prior (Figure 4-8). Changes in expression
more than two fold greater or lower than two fold lesser than control samples were
considered biologically significant. None of the sequences were biologically significantly
down-regulated, and only CBS, which controls the condensation of homocysteine and
serine to form the intermediate cystathionine, was significantly up-regulated (3 :t 0.58
fold). The second step of the pathway converting cystathionine to cysteine and or-
ketobutyric acid governed by CGL was not up-regulated (1 i 0.23 fold). The addition of
sulfate with ammonia had the opposite effect on the expression of CBS, down-regulating
it by 60 a: 4% (0.41 :t 0.04 fold; Figure 4-8), and also halved expression of CGL (0.45 :l:
0.13 fold). The high affinity sulfate perrnease putative sequence tested (SUL) was
generally down-regulated by ammonia addition, and the fold change from sulfate addition
with the ammonia was not statistically different (ANOVA; alpha = 0.05) from the
addition of ammonia alone (Figure 4-8). Expression of SAT and PAPSR was not
statistically significantly different from 1 as measured by ANOVA single factor analysis

(alpha = 0.05), with or without sulfate addition. In general there were few changes in

169

gene expression of the sequences tested due to ammonia addition, and the reduction of
expression from ammonia/sulfate addition does not clearly correlate to the increase in

sulfate uptake and assimilation under these conditions (Figure 4-3).

170

Discussion

During spore germination exogenous nitrogen sources were readily taken up and
used to synthesize amino acids; they also increased the uptake, reduction and
incorporation of exogenous sulfate. Stable isotope labeling and amino acid concentration
data demonstrated a preference for ammonia and urea, and both of these reduced N
sources also led to larger increases sulfate uptake than the organic and oxidized inorganic
N sources (Figure 4-3). Urea is catabolized to, and nitrate is reduced to, ammonia before
assimilation, and their effects are likely reflective of the efficiency of their uptake and
conversion to ammonia. The results of these experiments suggest a correlation between
the amount of N assimilated and the uptake of sulfate. The addition of organic N as gln or
arg, however, seems to be in opposition to a direct correlation between N and S
assimilation, as neither increased the total N content of the amino acid pool as much as
nitrate addition (Figure 4-2A), and both led to similar increases in sulfate assimilation
compared to nitrate addition (Figure 4-3). Additionally, gln is imported by germinating
spores of G. intraradices at ten times the rate of arg (Gachomo et al., 2009). Glutamine is
known to have a regulatory role in fungal gene expression. The global positive acting
transcriptional factors controlling cross pathway control circuits (CPC) in A. nidulans
(AreA) and N. crassa (N it2) have gln binding sites, and in A. nidulans the concentration
of gin negatively correlates with the activity of AreA (Marzluf, 1993; Berger et al.,
2008). The concentration of gln in the FAA pool, however, does not correlate with the
amount of sulfate uptake, although there is a slight increase from urea or ammonia

assimilation (Figure 4-2A). The data is therefore suggestive, but inconclusive, that gln

l7l

and arg addition led to a regulatory effect on sulfate assimilation unrelated to both the
total N in the FAA pool and the concentration of specific amino acids.

In Aspergillus nidulans, a result of biotin deficiency is an increase in ammonia
assimilation, which leads to a 70% increase in protein content as well as higher
concentrations of glu, asp, leu, and met (Desai, 1979). Data presented in this study are
consistent with the hypothesis that ammonia availability influences protein synthesis in
Glomus intraradices as well. As the largest N pool, the rate of protein synthesis or

degradation likely determines the intracellular concentration of F AA’s. If these rates

. . . . 15 . . .
remain static, an increase in % N labeling of an ammo ac1d from an exogenous N source

. . . . . . . . . 15 +
wrll lead to an equivalent relative increase 1n lts concentratlon. The addltlon of NH4 ,

however, resulted in 30% more labeling in the free amino acid (FAA) pool than did

adding 15N03' (Figure 4-4), while ammonia addition led to an increase of only 12% in

the total N in the FAA pool relative to nitrate addition (Figure 4-2C). Since 35S labeling

results indicate a nearly twofold increase in the protein-S pool when ammonia is added

compared to nitrate, it is likely that ammonia increases protein synthesis (Figure 4-9),

leading to less total N in the FAA pool than expected from the 1SN-labeling data.

The addition of reduced glutathione (GSH) counteracted the increased sulfate
uptake measured when spores were germinated with ammonia whereas the addition of
buthionine sulfoximine (BSO), a specific inhibitor of the first enzyme of GSH synthesis,
y-glutamylcysteine synthetase, induced sulfate uptake and assimilation (Figure 4-3).
These data repeat the finding of the previous chapter on GSH and B30 addition at seven

days in the absence of ammonia, as well as the data on cys and met addition (Chapter 3).

172

In contrast to GSH, addition of cys slightly increased ammonia stimulation of sulfate
uptake (Figure 4-5). Since cys is readily imported by germinating spores (Figure 4-6),
GSH does not appear to affect sulfate uptake by contributing to the cys pool through its
catabolism. In S. cerevisiae, GSH is readily imported and utilized as a source of cys
(Elskens et al., 1991; Kumar et al., 2003; Miyake et al., 1999). Addition of 10 mM BSO
has been shown to reduce the intracellular GSH concentration by 76% in the yeast
Kluyveromyces lactis (Coulon et al., 2007) and 70% in S. cerevisiae (Rossi et al., 1997).
The intracellular concentration of GSH in G. intraradices was not measured directly, and
therefore the effects of GSH and BSO addition on GSH concentration in the germinating
spores is uncertain, although it seems plausible that both have their effects either through
changes in the free GSH levels or indirectly through their effects on FAA levels.

The concentrations of the amino acids that are synthesized from glu, gln and arg
either directly or through transarnination reactions involving glu, asp, and asn, were
reduced by roughly half with GSH addition (Figure 4-7). Glutamate and asp
concentrations have been shown to specifically increase in A. nidulans in response to
increased assimilation of ammonia (Desai, 1979), as expected fiom N assimilation
through the GS/GoGAT cycle. Both gln and arg addition increased the concentration of
glu by more than two fold (Figure 4-2A), however, preliminary evidence suggests that
the addition of glu has no effect on sulfate uptake with or without N addition (data not
shown). Based on these data, the concentration of glu is likely to be symptomatic of the
efficiency of N assimilation into the FAA pool rather than being directly involved in
sulfate uptake. Glutathione may therefore effect sulfate assimilation indirectly by

reducing ammonia assimilation in this fungus.

173

In contrast to other amino acids measured under GSH exposure, leu accumulated
to more than double the concentration found in control samples (Figure 4-5). In S.
cerevisiae, genes encoding two enzymes in the leu biosynthetic pathway, isopropylmalate
isomerase (LE U1 ) and beta-isopropylmalate dehydrogenase (LE U2) are transcriptionally
suppressed by the regulatory protein Leu3p or activated by Leu3p complexed with the
pathway intermediate alpha-isopropylmalate (Kohlhaw, 2003). The influence of Leu3p
extends to seven genes including GDHI (Kohlhaw, 2003; Hu et al., 1995), which
encodes an NADP+-dependent glutamate dehydrogenase, an integral enzyme in the
assimilation of ammonia. All of the amino acid concentrations reduced when GSH is
present are either synthesized from or transaminated by glu (Figure 4-7). Leucine
accumulation is possibly symptomatic of how GSH exposure negates the hyper-
accumulation of sulfate when ammonia is added to germinating spores, by affecting leu
pathway intermediate concentrations, and is suggestive that a similar regulatory system
exists in G. intraradices as S. cerevisiae and N. crassa with regard to Leu3p (Baichwal et
al., 1983; Gross, 1965). Additionally in S. cerevisiae, S-adenosylrnethionine transport to
the vacuole is greatly reduced by leu (Murphy & Spence, 1972), which may increase the
concentration of the cytosolic pool and affect S assimilation.

Exposure to BSO leads to a reduction in GSH (Rossi et al., 1997; Coulon et al.,
2007), which may leave the germinating spores vulnerable to oxidative damage, as has
been shown in S. cerevisiae (Izawa et al., 1995; Grant et al., 1996). Also in S. cerevisiae,

transcriptional suppression of the S assimilatory pathway is known to be superseded by

. . ++ . . . . . .
oxrdatlve stress. Under Cd stress, the ubrqumatlon controlling the actrvrty of the

positive regulatory protein met4p is removed, up-regulating S assimilatory pathway

174

enzymes and increasing GSH synthesis (Barbey et al., 2005). This filrther illustrates the
possibility that S assimilation is regulated independently by the oxidative state of the
germ tube. However, not enough data is presented here to draw any definite conclusions
about the mechanism by which BSO exerts its regulatory effects, or about its relationship
to N—mediated effects on sulfate assimilation.

By contrast with sulfate assimilation, uptake of reduced S in the form of cys was
unaffected by ammonia and was increased by GSH addition, suggesting that the
assimilation of exogenous cys is not regulated by the same mechanism as sulfate
utilization. The increase in cys utilization with GSH addition has been previously
demonstrated (Chapter 3), and was repeated here. A single cys transporter was recently
shown to be the primary route of entry into S. cerevisiae cells (Kaur & Bachhawat, 2007),
and its regulation has not been studied. To date, little other evidence exists concerning
cys transport in filngi.

Although ammonia addition increased sulfate uptake and assimilation, it failed to
alter the transcription of putative sulfate perrnease or primary S assimilatory pathway
genes after six hours of induction (Figure 4-8). Ammonia added without sulfate led to a
three fold increase of a putative sequence encoding cystathionine B-synthase (CBS), the
first step of the reverse trans-sulfuration pathway (CT pathway), however sulfate added
in equal quantity as in uptake experiments reduced the expression of this gene by roughly
six fold in comparison (chapter 3). The data for gene expression in the presence of both
sulfate and ammonia is similar to data obtained from cys addition (Chapter 3), and may
indicate the results of a short term increase of cys concentration. The data is clear that six

hours of incubation with ammonia and sulfate does not result in transcriptional changes

175

that would account for the stimulation of sulfate uptake. Further analyses are necessary to
determine the relationship between N source availability and transcriptional regulation of
the S assimilatory pathway at later time points to form meaningful conclusions of the

interaction between N and S assimilation pathway regulation.

176

 

BSO GSH 804 NH4 N03 URE

 

BSO GSH -I® 69 N03 URE

 

 

 

 

 

 

 

 

 

 

 

 

GD
FAA . > PRO

 

 

 

Figure 4-9 Working model of the regulation of sulfate assimilation in germinating spores
of Glomus intraradices. Sulfate uptake was increased by exogenous ammonia (NH4) and
buthionine sulfoximine (BSO). Nitrate (N 03) and urea (URE) likely affect S metabolism
through their conversion to ammonia. Reduced glutathione (GSH) antagonized the
stimulatory effect of ammonia on sulfate uptake, reduced ammonia assimilation through
glu, and has been previously shown to decrease importation of sulfate. Ammonia also
increased both the assimilation of sulfate into free amino acids (FAA) and their
incorporation into protein (PRO). There is evidence that ammonia generally increases the
flux from the free amino acid to protein pool as well.

177

Sufficient evidence was obtained from this study to make an initial model of the
relationship between N assimilation and the regulation of the S assimilatory pathway

(Figure 4-9). The addition of N sources increased sulfate uptake, assimilation, and

sequestration. Additionally, an analysis of the 15N labeling of the FAA pool in relation to

. . . . 35 . . . .
the concentration of ammo ac1ds, coupled wrth S-labelrng evrdence, 1ndlcates that

ammonia increased the synthesis of proteins. Glutathione had opposing effects on the
ability of the ftmgus to use exogenous sources of oxidized and organic S, slightly
decreasing sulfate assimilation and increasing uptake of cys. It was the only compound
tested which antagonized the stimulation of sulfate acquisition fiom ammonia addition.
The addition of BSO increased uptake and assimilation of sulfate alone and in an
ammonia background. The data overall reveals a close relationship between N and S

assimilation, which may be mediated by FAA concentrations.

178

References

Allen JW, Shachar—Hill Y. 2009. Sulfur transfer through an arbuscular mycorrhiza.
Plant Physiology 149(1): 549-560.

Baichwal VR, Cunningham TS, Gatzek PR, Kohlhaw GB. 1983. Leucine biosynthesis
in yeast - identification of 2 genes (leu4, leu5) that affect alpha-isopropylmalate synthase
activity and evidence that leul and leu2 gene-expression is controlled by alpha-
isopropylmalate and the product of a regulatory gene. Current Genetics 7(5): 369-377.

Barbey R, Baudouin-Cornu P, Lee TA, Rouillon A, Zarzov P, Tyers M, Thomas D.
2005. Inducible dissociation of SCFMet30 ubiquitin ligase mediates a rapid
transcriptional response to cadmium. Embo Journal 24(3): 521-532.

Berger H, Basheer A, Bock S, Reyes-Dominguez Y, Dalik T, Altmann F, Strauss J.
2008. Dissecting individual steps of nitrogen transcription factor cooperation in the
Aspergillus nidulans nitrate cluster. Molecular Microbiology 69(6): 1385-1398.

Braus GH, Sasse C, Krappmann S. 2006. Amino acid acquisition, cross-pathway
control, and virulence in Aspergillus. Medical Mycology 44: S91-S94.

Chiang TY, Marzluf GA. 1995. Binding-affinity and functional-significance of nit2 and
nit4 binding-sites in the promoter of the highly regulated nit-3 gene, which encodes
nitrate reductase in neurospora-crassa. Journal of Bacteriology 177(21): 6093-6099.

Coulon J, Matoub L, Dossot M, Marchand S, Bartosz G, Leroy P. 2007. Potential
relationship between glutathione metabolism and flocculation in the yeast
Kluyveromyces lactis. Fems Yeast Research 7(1): 93-101.

Desai JD. 1979. Factors affecting protein-synthesis during biotin deficiency in
aspergillus-nidulans. Folia Microbiologica 24(5): 379-&.

Dong JS, Qiu HF, Garcia-Barrio M, Anderson J, Hinnebusch AG. 2000. Uncharged
tRNA activates GCN2 by displacing the protein kinase moiety from a bipartite tRNA-
Binding domain. Molecular Cell 6(2): 269-279.

Elskens MT, Jaspers CJ, Penninckx MJ. 1991. Glutathione as an endogenous sulfur
source in the yeast Saccharomyces-cerevisiae. Journal of General Microbiology 137:
637-644.

Gachomo E, Allen JW, Pfeffer PE, Govindarajulu M, Douds DD, Jin H, Nagahashi
G, Lammers PJ, Shachar-Hill Y, Bucking H. 2009. Germinating spores of Glomus
intraradices can use internal and exogenous nitrogen sources for de novo biosynthesis of
amino acids. New Phytologist. doi: 10.1111/j.1469-8137.2009.02968.x.

179

Govindarajulu M, Pfeffer PE, Jin HR, Abuhaker J, Douds DD, Allen JW, Bucking
H, Lammers PJ, Shachar-Hill Y. 2005. Nitrogen transfer in the arbuscular mycorrhizal
symbiosis. Nature 435(7043): 819-823.

Grant CM, MacIver FH, Dawes IW. 1996. Glutathione is an essential metabolite
required for resistance to oxidative stress in the yeast Saccharomyces cerevisiae. Current
Genetics 29(6): 51 1-515.

Gross SR. 1965. Regulation of synthesis of leucine biosynthetic enzymes in neurospora.
Proceedings of the National Academy of Sciences of the United States of America 54(6):
1 53 8-&.

Guescini M, Stocchi L, Sisti D, Zeppa S, Polidori E, Ceccaroli P, Saltarelli R,
Stocchi V. 2009. Characterization and mRNA expression profile of the TbNrel gene of
the ectomycorrhizal fungus Tuber borchii. Current Genetics 55(1): 59-68.

Hu YM, Cooper TG, Kohlhaw GB. 1995. The saccharomyces-cerevisiae Leu3 protein
activates expression of gdhl , a key gene in nitrogen assimilation. Molecular and Cellular
Biology 15(1): 52-57.

Izawa S, Inoue Y, Kimura A. 1995. Oxidative stress-response in yeast - effect of
glutathione on adaptation to hydro gen-peroxide stress in Saccharomyces-cerevisiae. F ebs
Letters 368(1): 73-76.

Kaur J, Bachhawat AK. 2007. thlp, a novel, high-affinity, cysteine-specific
transporter from the yeast Saccharomyces cerevisiae. Genetics 176(2): 877-890.

Kleinschmidt M, Grundmann O, Bluthgen N, Mosch HU, Braus GH. 2005.
Transcriptional profiling of Saccharomyces cerevisiae cells under adhesion-inducing
conditions. Molecular Genetics and Genomics 273(5): 382-393.

Kohlhaw GB. 2003. Leucine biosynthesis in fungi: Entering metabolism through the
back door. Microbiology and Molecular Biology Reviews 67(1): 1-+.

Kumar C, Sharma R, Bachhawat AK. 2003. Utilization of glutathione as an exogenous
sulfur source is independent of gamma-glutamyl transpeptidase in the yeast
Saccharomyces cerevisiae: evidence for an alternative gluathione degradation pathway.
F ems Microbiology Letters 219(2): 187-194.

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-
time quantitative PCR and the 2(-Delta Delta C(T)). Methods 25: 402-408.

Marzluf GA. 1993. Regulation of sulfur and nitrogen-metabolism in filamentous fungi.
Annual Review of Microbiology 47 : 31-55.

180

Marzluf GA. 1997. Molecular genetics of sulfur assimilation in filamentous fungi and
yeast. Annual Review of Microbiology 51: 73-96.

McCann MP, Snetselaar KM. 2008. A genome-based analysis of amino acid
metabolism in the biotrophic plant pathogen Ustilago maydis. Fungal Genetics and
Biology 45: S77-S87.

Miyake T, Sammoto H, Kanayama M, Tomochika K, Shinoda S, Ono B. 1999. Role
of the sulphate assimilation pathway in utilization of glutathione as a sulphur source by
Saccharomyces cerevisiae. Yeast 15(14): 1449-1457.

Mountain HA, Bystrom AS, Korch C. 1993. The general amino-acid control regulates
met4, which encodes a methionine-pathway-specific transcriptional activator of
saccharomyces-cerevisiae. Molecular Microbiology 7(2): 215-228.

Murphy JT, Spence KD. 1972. Transport of s-adenosylmethionine in Saccharomyces-
cerevisiae. Journal of Bacteriology 109(2): 499-5 08.

Natarajan K, Meyer MR, Jackson BM, Slade D, Roberts C, Hinnebusch AG,
Marton MJ. 2001. Transcriptional profiling shows that Gcn4p is a master regulator of

gene expression during amino acid starvation in yeast. Molecular and Cellular Biology
21(13): 4347-4368.

Okamoto PM, Garrett RH, Marzluf GA. 1993. Molecular characterization of
conventional and new repeat-induced mutants of nit-3, the structural gene that encodes
nitrate reductase in neurospora-crassa. Molecular & General Genetics 238(1-2): 81-90.

Rossi C, Poli P, Candi A, Buschini A. 1997. Modulation of mitomycin C mutagenicity
on Saccharomyces cerevisiae by glutathione, cytochrome p-450, and mitochondria
interactions. Mutation Research-Genetic Toxicology and Environmental Mutagenesis

390(1-2): 113-120.
Roussou I, T hireos G, Hauge BM. 1988. Transcriptional-translational regulatory circuit
in Saccharomyces-cerevisiae which involves the gcn4 transcriptional activator and the

gcn2 protein-kinase. Molecular and Cellular Biology 8(5): 2132-2139.

Siverio JM. 2002. Assimilation of nitrate by yeasts. F ems Microbiology Reviews 26(3):
277-284.

Smith SE, Read DJ. 2007. Mycorrhizal symbiosis, 3rd edn. London, UK.
Sosa E, Aranda C, Riego L, Valenzuela L, DeLuna A, Cantu JM, Gonzalez A. 2003.

Gcn4 negatively regulates expression of genes subjected to nitrogen catabolite repression.
Biochemical and Biophysical Research Communications 310(4): 1175-1180.

181

StArnaud M, Hamel C, Vimard B, Caron M, Fortin JA. 1996. Enhanced hyphal
growth and spore production of the arbuscular mycorrhizal filngus Glomus intraradices in
an in vitro system in the absence of host roots. Mycological Research 100: 328-332.

Thomas D, SurdinKerjan Y. 1997. Metabolism of sulfur amino acids in Saccharomyces
cerevisiae. Microbiology and Molecular Biology Reviews 61(4): 503-532.

Tian CG, Kasuga T, Sachs MS, Glass NL. 2007. Transcriptional profiling of cross
pathway control in Neurospora crassa and comparative analysis of the Gcn4 and CPCl
regulons. Eukaryotic Cell 6(6): 1018-1029.

Yin ZK, Stead D, Selway L, Walker J, Riba-Garcia I, Mclnerney T, Gaskell S,

Oliver SG, Cash P, Brown AJP. 2004. Proteomic response to amino acid starvation in
Candida albicans and Saccharomyces cerevisiae. Proteomics 4(8): 2425-2436.

182

Chapter 5

Conclusions and Future Research

183

Introduction

Global atmospheric sulfur emissions increased by more than 3000% between
1860 and 1990 (Lefohn et al., 1999), representing approximately 0.0003% of terrestrial
plant evolutionary time (Welhnan et al., 2003). In the absence of anthropogenic sources,
plants and other organisms evolved complex regulatory mechanisms for the attainment
and assimilation of sulfur from the environment. Additionally, terrestrial plant life
evolved in conjunction with arbuscular mycorrhizal fungi (AMF) since the Devonian
Period (400 MYA; Pirozynsky & Malloch, 1975). The symbiosis assists plant roots in
obtaining otherwise unavailable soil nutrient resources (Smith & Read, 2008) and is
today found in an estimated 80% of land plants (Wang & Qiu, 2006). Although the
mycorrhizal symbiosis is widely considered to be a defining factor in plant phosphorus
nutrition (Cress et al., 1979; Murdock et al., 1967), and several studies point towards an
important role in plant nitrogen acquisition (Govindaraj alu et al., 2005; Hodge et al.,
2001), the role of mycorrhizal symbioses in sulfur acquisition has not been as well
characterized, and the assimilation of sulfur by mycorrhizal fungi themselves not
analyzed at all. The removal of sulfur from fossil fuel sources prior to combustion has
reduced sulfilr emissions in the United States by more than 50% between 1980 to 2000
(Baumgardner et al., 2002), increasingly leading to sulfur deficiency symptoms in crop
plants. Since mycorrhizae constitute the dominant soil symbiosis, information of their
role in plant S nutrition is important for assessing the impact of the rise and fall of
environmental sulfur concentrations. In this thesis, three major aspects of mycorrhizal S

acquisition were analyzed using the AMF Glomus intraradices: their role in plant S

184

nutrition, their assimilation of S in the absence of the host, and the regulation of uptake in

comparison to other known fungal systems.

AMF and plant S nutrition

The role of AMF in plant S nutrition has been little and inconclusively studied. A
lack of basic measurements make it impossible to even assess whether or not AMF
transfer S to plants in physiologically relevant amounts. Therefore, the research outlined

in chapter 2 was to provide reliable, basic measurements of S transfer through an AMF.
. 35 . . . .
These measurements were achieved through S tracer studies usrng a monoxenlc, bl-
compartmental petri dish system containing a mycorrhiza established between Glomus
intradarices and transformed Daucus carota roots (StAmaud et al., 1986). This system

allows the fungal mycelium to separate itself from the colonized roots, and enables the

isolated labeling of fungus and host. Measuring in parallel experiments the uptake of

35SO42- by mycorrhizal roots and the transfer of ”$042. from the fungal sides, the

transfer of S through the symbiosis was quantified in a non-growth limiting sulfate

. . . 35 . .
concentration 1n the context of dlrect root uptake. The amount of S supplied to roots in

this condition amounted to 25% of total root uptake during the labeling period. The
percentage of a nutrient obtained from mycorrhizal transfer compared to direct uptake has
only been measured in one other study. Mycorrhizal transfer of P has been measured for
flax, medic, and tomato plants, and constitutes close to 100% of the total plant uptake

during the labeling period (Smith et al., 2003), leading the authors to speculate that AMF

185

directly affect direct root uptake of P. Smith an co-workers (2003) used pot- grown plants,
which generally obtain higher percentages of mycorrhzial root length, whereas
colonization in the monoxenic split plate system is normally much lower. Given this,

whether or not AMF directly affect the ability of roots to import sulfate is inconclusive

based on the data obtained as much of the direct 35S uptake was likely by non-

mycorrhizal root sections. Additionally, whether effects on direct root uptake mediated
by AMF are systemic or localized to colonized root sections, or if photosynthetic tissue
has a role, are all unknowns. However, the 25% of total uptake measured is clearly of

physiological importance. Additional to this measurement, the functional importance of

fungal S supply to the plant was also assessed by tacking 35$ transferred through the

.AMF to roots grown in limiting or non-limiting S concentrations. Transfer under non-
limiting conditions was halved compared to low S concentrations, suggesting that the
transfer amount is relative to root S status and not constitutive. This implies that AMF
may play a functional role in the acquisition of S for plant hosts.

Having assessed the regulation of sulfate transfer through an AMF from the
perspective of the plant S status, a further goal of the research outlined in chapter 2 was
to assess the regulation of uptake by the fimgus itself. To achieve this, S metabolites

known to have regulatory effects on sulfate assimilation in other fungi were exogenously

supplied to isolated mycorrhizal mycelium and 358042- transfer tracked. Methionine

(met) and cysteine (cys) reduced transfer by 26% and 45%, respectively, over a one
month labeling period. Also due to cys addition, quantitative real-time PCR

measurements of G. intarardices extra-radical mycelium revealed a roughly four fold

186

 

decrease in the expression of a putative high affinity sulfate permease gene, suggesting

this may be the cause of the lower transfer rate for labeled sulfate. Uptake of ”$042. by

the fungus was not significantly reduced by met and was halved by cys addition, in
contrast to other fungi. Equivalent concentrations of cys or met completely suppress the
expression of sulfate assimilation genes in S. cerevisiae, A. nidulans, and N. crassa
(Kuras & Thomas, 1995; Breton & Surdin Keljan, 1977; Ketter & Marzluf, 1988; Ketter
et al., 1991; Grynberg et al., 2001).

Sulfate was shown to be transferred through an AMF symbiosis in physiologically
significant quantities which are inversely related to sulfate availability to host roots.
Additionally, the transfer of reduced S sources cysteine and methionine was
demonstrated, which could provide plants an alternate option to their dependency on re-
mineralized sulfate from organic material by microorganisms in the soil. Interestingly,
cysteine, and to a lesser extent methionine, made available to the extra-radical fungal
mycelium reduced transfer of sulfate to the roots. Since these amino acids are transferred
in a reduced state to host roots, whether or not this is due to regulation by the fungus was
investigated by measuring gene expression changes from exogenous cys application.
There was a roughly four fold reduction in mRNA concentration for a putative high
affinity sulfate perrnease gene corresponding to the reduction in uptake and transfer of
sulfate. Other putative pathway genes were not down-regulated significantly, suggesting
that control of sulfate transfer to the host may be on the level of extra-radical mycelial

uptake.

187

Uptake and assimilation of S by AMF

The use of pre-symbiotic fungal mycelium for the study of the sulfate
assimilation pathway reduces the time needed for an experiment from a minimum of two
months to one week as well as the variability inherent to split plate studies due to
differences in colonization time and extent within the roots. It is also necessary to remove
the influence of the host roots on the regulation of fungal uptake and transfer to assess
fungal-specific regulation. The study of S metabolism in pre-symbiotic AMF is therefore
an important component in understanding the regulation of S transfer in the symbiotic
phase. To this end, two lines of research were conducted using germinating spores: the
regulation of S assimilation and the interaction between N and S regulation.

Regulation of sulfate assimilation and the synthesis of cysteine is well studied in
S. cerevisiae, A. nidulans, and N. crassa (for a review see Marzluf, 1997). Symbiotic
transfer of nutrients, however, requires uptake of those nutrients when uptake by other
fungi would likely be suppressed. Since fungal regulatory systems for S assimilation and
metabolism are well conserved in fungi, differences between AMF and other fungal
systems are possibly specific to the symbiosis and may therefore provide valuable
information concerning the transition from pro-symbiotic to symbiotic fungal states. The
ability of germinating spores to import sulfate and the fractionation profiles of the
incorporation of imported sulfate into various metabolic pools was analyzed and the
results compared with data from other fungi. Exposure to unlabeled and labeled cys and
met, glutathione (GSH) and buthionine sulfoximine (BSO) was analyzed. In contrast to

other fungi, Glomus intraradices did not show a preference for reduced or oxidized S, but

188

imported an assimilated both sources simultaneously and to a relatively equal extent. The
addition of met failed to reduce sulfate uptake at all, and cys reduces uptake by a third at
the most, far less suppression than in other fungi (Grynberg et al., 2001; Marzluf, 1997).
The symbiotic nature of AMF may reduce the sensitivity of the regulatory system for
sulfate assimilation. Additionally, based on the data it is likely that the intracellular
concentration of GSH is negatively correlated with the importation of sulfate, as GSH
addition initially reduced uptake by more than two thirds, while the addition of B80, a
specific inhibitor of GSH synthesis, more than doubled it. Although GSH is considered to
be a reservoir for reduced S in fungi (Miyake et al., 1999), increased incorporation from

BSO addition suggests that the effect of GSH/BSO is not due to GSH catabolism. In

support of this argument, the exogenous addition of GSH does not decrease %15N

labeling of cys from ammonia, and actually increases [35$]cys uptake by about a third.

Vacuolar H+-ATPase in S. cerevisiae is regulated by redox state (Fernandez et al., 2003),
altering transport of S metabolites to and from the vacuole. This may provide an
explanation for the effect of GSH/BSO, however the full determination of this aspect of S
assimilation in AMF is beyond the scope of this thesis.

The assimilation of N and S are linked through a set of orthologous positive
acting global transcriptional factors controlling the amino acid control circuit (gC) in
yeasts, or the cross pathway control circuits (CPC) in filamentous fungi (Chiang &
Marzluf, 1995; Sosa et al., 2003; Okamoto et al., 1993). In S. cerevisiae, expression of
the S regulatory protein, Met4p, is not controlled by S metabolite concentrations, but
through the gC (Mountain et al., 1993). The addition of various sources of N uniformly

led to a minimum two fold increase in sulfate uptake. Ammonia addition had the most

189

 

pronounced effect of the N sources, increasing sulfate uptake by six fold. This was also
the most pronounced effect of any exogenously supplied substance, suggesting that the
assimilation of N, and subsequent demand for S-amino acids, controls sulfate
assimilation to a greater extent than S metabolite availability in this fungus. 111 support of
this, the combinatory effect of adding S metabolites and ammonia was equivalent to the

addition of ammonia alone with the exception of GSH, which completely negated the

ammonia effect. An analysis of free amino acid (FAA) concentrations and %15N labeling

in relation to N addition demonstrated a likely positive correlation between ammonia
availability and protein synthesis. This is in agreement with the hypothesis that sulfate
assimilation is demand driven. Further analysis of the mechanism of the GSH mediated
reduction in sulfate assimilation by FAA concentration measurements revealed that GSH
addition roughly halved the concentrations of amino acids associated directly with
ammonia assimilation. This supports a hypothesis that GSH reduces sulfate assimilation
by countermanding ammonia assimilation by an unknown mechanism, although a
speculative mechanism based on control at the level of gene expression was discussed in
chapter 4.

The analysis of transcriptional regulation of putative genes involved in
sulfate assimilation demonstrated extreme differences between the AMF studied and
other fungi. Additionally, changes in gene expression failed to correlate in most cases
with uptake data. The most apparent difference is the induction of pathway genes by met
addition in AMF, compared to their complete suppression in other fungi under similar
conditions (Natorff et al., 2003; Cherest et al., 1985; Borges-Walmsley et al., 1995;

Marzluf, 1997; Schierova et al., 2000). Exposure to met and GSH had very similar effects

190

 

of gene expression, increasing the transcript levels of the enzymes of the reverse-
transsulfiiration pathway, cytathionine B-synthase and cystathionine y-lyase, by more
than four fold. In comparison, met had no effect on sulfate uptake, and GSH reduced
uptake of sulfate by two thirds. The expression of the putative high affinity sulfate
perrnease gene did, however, coincide with uptake measurements. Exposure to cys led to
a halving of transcript levels and a reduction of uptake of a third after two days of
labeling. The addition of ammonia failed to affect gene expression of putative pathway
enzymes in most cases, and certainly failed to account for the dramatic increases in
sulfate uptake and assimilation under similar conditions. These data do not support the
hypothesis that transcriptional regulation in AMF is controlled by an orthologous
transcriptional regulator responding to amino acid starvation, as in S. cerevisiae
(Mountain et al., 1993), however uptake data does. Gene expression data obtained
demonstrate that AMF may have a distinct transcriptional regulatory environment among
the fungi with respect to sulfate uptake and assimilation. However, the incongruity with
uptake data requires further examination of these findings, possibly through yeast
complementation experiments where the comparison between AMF genes and those of S.

cerevisiae are more direct.

Future research

The thesis presented was designed to provide key and conclusive data on S
assimilation and transfer by AM fungi which can be used as a basis for further research.

The transport and reduction of sulfate, as well as the synthesis of cysteine, are well

191

conserved and studied pathways in fungi. Therefore, much of the future research on this
subject lies in the comparison between pathway elements fi'om AMF, S. cerevisiae, A.
nidulans, and N. crassa. In the short term, obtaining full length sequence information for
all of the genes identified to this point would allow for complementation studied of
known S. cerevisiae pathway mutants to determine if, and the extent to which, fimctional
and regulatory homologies exist between the two systems. Unreported in this thesis,
putative sequences obtained from Glomus intraradices germinating spore 454 sequencing
data of both a positive and a negative transcriptional regulatory gene were discovered.
Complementation studies of these genes would immediately reveal the correlations
existing between AMF and other fungi in transcriptional regulation of the sulfate
assimilation pathway. Additionally, the over-expression of these genes in a yeast
background would make possible kinetic analyses of the pathway components, which
could be compared to previously determined flmgal enzyme kinetics.

The importance of S metabolic regulation to the AMF symbiosis is a topic of
interest with respect to the root-less propagation of the firngus. Regulation of the S
assimilation genes is connected to N assimilation and nutrient status in fungi, and
therefore may provide an indicator of important steps in elucidating the genetic basis of
the changes in life cycle stages. A study analyzing the expression patterns of sulfate
assimilatory pathway genes in relation to life cycle stage would be a good first step in this
regard, and may lead to a global regulatory cycle.

Finally, the incorporation of mutant Medicago truncatula plants impaired in
sulfate assimilatory pathway genes would help determine more definitively to what

extent AMF contribute to plant S metabolism. A mutant with impairment in sulfate

192

 

transport, for instance, could directly demonstrate the extent to which AMF can replace
plant uptake by roots. A selective screening of S assimilation mutants for the ability to
create a functional AMF symbiosis also has the potential for discovery of any S-related

genes required for the establishment of a functional endomycorrhiza.

193

References

Baumgardner RE, Lavery TF, Rogers CM, Isil SS. 2002. Estimates of the atmospheric
deposition of sulfirr and nitrogen species: Clean Air Status and Trends Network, 1990-
2000. Environmental Science & Technology 36(12): 2614-2629.

Borges-Walmsley MI, Turner G, Bailey AM, Brown J, Lehmbeck J, Clausen IG.
1995. Isolation and characterization of genes for sulfate activation and reduction in
aspergillus-nidulans - implications for evolution of an allosteric control region by gene
duplication. Molecular & General Genetics 247(4): 423-429.

Breton A, Surdinkerjan Y. 1977. Sulfate uptake in saccharomyces-cerevisiae -
biochemical and genetic study. Journal of Bacteriology 132(1): 224-232.

Cherest H, Thao NN, Surdinkerjan Y. 1985. Transcriptional regulation of the met3-
gene of saccharomyces-cerevisiae. Gene 34(2-3): 269-281.

Chiang TY, Marzluf GA. 1995. Binding-affinity and functional-significance of nit2 and
nit4 binding-sites in the promoter of the highly regulated nit-3 gene, which encodes
nitrate reductase in neurospora-crassa. Journal of Bacteriology 177(21): 6093-6099.

Cress WA, Throneberry GO, Lindsey DL. 1979. Kinetics of phosphorus absorption by
mycorrhizal and non-mycorrhizal tomato roots. Plant Physiology 64(3): 484-487.

Govindarajulu M, Pfeffer PE, Jin HR, Abuhaker J, Douds DD, Allen JW, Bucking
H, Lammers PJ, Shachar—Hill Y. 2005. Nitrogen transfer in the arbuscular mycorrhizal
symbiosis. Nature 435(7043): 819-823.

Grynberg M, Piotrowska M, Pizzinini E, Turner G, Paszewski A. 2001. The
Aspergillus nidulans metE gene is regulated by a second system independent fi'om
sulphur metabolite repression. Biochimica Et Biophysica Acta-Gene Structure and

Expression 1519(1-2): 78-84.

Hodge A, Campbell CD, Fitter AH. 2001. An arbuscular mycorrhizal fungus
accelerates decomposition and acquires nitrogen directly from organic material. Nature
413(6853): 297-299.

Ketter JS, J arai G, Fu YH, Marzluf GA. 1991. Nucleotide-sequence, messenger-ma
stability, and dna recognition elements of cys-14, the structural gene for sulfate
perrnease-ii in neurospora-crassa. Biochemistry 30(7): 1780-1787.

Ketter JS, Marzluf GA. 1988. Molecular-cloning and analysis of the regulation of cys-

l4+, a structural gene of the sulfur regulatory circuit of neurospora-crassa. Molecular and
Cellular Biology 8(4): 1504-1508.

194

Kuras L, Thomas D. 1995. Functional-analysis of met4, a yeast transcriptional activator
responsive to s-adenosylmethionine. Molecular and Cellular Biology 15(1): 208-216.

Lefohn AS, Husar JD, Husar RB. 1999. Estimating historical anthropogenic global
sulfur emission patterns for the period 1850-1990. Atmospheric Environment 33(21):
3435-3444.

Marzluf GA. 1997. Molecular genetics of sulfur assimilation in filamentous fungi and
yeast. Annual Review of Microbiology 51: 73-96.

Miyake T, Sammoto H, Kanayama M, Tomochika K, Shinoda S, Ono B. 1999. Role
of the sulphate assimilation pathway in utilization of glutathione as a sulphur source by
Saccharomyces cerevisiae. Yeast 15(14): 1449-1457.

Mountain HA, Bystrom AS, Korch C. 1993. The general amino-acid control regulates
met4, which encodes a methionine-pathway-specific transcriptional activator of
saccharomyces-cerevisiae. Molecular Microbiology 7(2): 215-228.

Natorff R, Sienko M, Brzywczy J, Paszewski A. 2003. The Aspergillus nidulans metR
gene encodes a bZIP protein which activates transcription of sulphur metabolism genes.
Molecular Microbiology 49(4): 1081-1094.

Okamoto PM, Garrett RH, Marzluf GA. 1993. Molecular characterization of
conventional and new repeat-induced mutants of nit-3, the structural gene that encodes
nitrate reductase in neurospora-crassa. Molecular & General Genetics 238(1-2): 81-90.

Pirozynski KA, Malloch DW. 1975. Origin of land plants - matter of mycotropism.
Biosystems 6(3): 153-164.

Schierova M, Linka M, Pazoutova S. 2000. Sulfate assimilation in Aspergillus terreus:
analysis of genes encoding ATP-sulfurylase and PAPS-reductase. Current Genetics
38(3): 126-131.

Smith SE, Smith FA, J akobsen I. 2003. Mycorrhizal fungi can dominate phosphate
supply to plants irrespective of growth responses. Plant Physiology 133(1): 16-20.

Sosa E, Aranda C, Riego L, Valenzuela L, DeLuna A, Cantu JM, Gonzalez A. 2003.
Gcn4 negatively regulates expression of genes subjected to nitrogen catabolite repression.
Biochemical and Biophysical Research Communications 310(4): 1175-1180.

StArnaud M, Hamel C, Vimard B, Caron M, Fortin JA. 1996. Enhanced hyphal
grth and spore production of the arbuscular mycorrhizal fungus Glomus intraradices in
an in vitro system in the absence of host roots. Mycological Research 100: 328-332.

Wang B, Qiu YL. 2006. Phylogenetic distribution and evolution of mycorrhizas in land
plants. Mycorrhiza 16(5): 299-363.

195

Wellman CH, Richardson JB. 1993. Terrestrial plant microfossils from silurian inliers
of the midland valley of scotland. Palaeontology 36: 155-193.

196

TATE UNIVERSI

62

”Willi

293 030

Illllllllllllllfs
9541