2.5

.1 i .

ix
.5:

I
do...“ I. ‘
v 3 ul
. as; 2. H...
t:\L\v I“ I
31\>\3...vllkl
I A." l I.
G :9:
in

I...
.81 . .
.. . v

.
. 1.’

i:
r
$

J‘
1;
3 |

‘£
99.2“
§

z
i?

: *3?
6‘33?!
E?

' a

1-93...
1.1.! _
.128.

1

A it:

1h‘lp’43
[33.1.2
til. «i

 

 

‘ Michigan State
University

 

 

 

This is to certify that the
dissertation entitled

THE ROLE OF HYPOXIA INDUCIBLE FACTORS IN LUNG
DEVELOPMENT AND COBALT-INDUCED LUNG INJURY

presented by

YOGESH SAINI

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Genetics

 

 

(ll (lead

U M o Professor’s Signature

$183200?

Date

MSU is an Alfinnative Action/Equal Opportunity Employer

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K'IProj/Acc8PrelelRCIDateDue indd

THE ROLE OF HYPOXIA INDUCIBLE FACTORS IN LUNG DEVELOPMENT
AND COBALT-INDUCED LUNG INJURY

By

Yogesh Saini

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Genetics

2009

ABSTRACT

THE ROLE OF HYPOXIA INDUCIBLE FACTORS IN LUNG DEVELOPMENT
AND COBALT-INDUCED LUNG INJURY

By

Yogesh Saini

The increasing use of disposable electronics and growing industrialization
of nation’s economies have drastically raised the risk of exposure to toxic metals.
One of these metals, cobalt, is used widely in several industries involved in the
production of coloring agent for ceramics, hard metal alloys, sintered carbides,
drilling and grinding tools. Cobalt (or hard metal) asthma caused by the
inhalation of cobalt containing dust is characterized by ainNay constriction,
alveolitis, fibrosis and associated giant cell interstitial pneumonitis. The
characterization of cobalt-induced toxicities demands comprehensive
understanding of the effects of toxicants on cell signaling and the downstream
changes in gene expression. It is well established that cobalt is a hypoxia mimic
due to its ability to induce hypoxia-like gene expression responses. To enhance
our understanding of cobalt-induced toxicity and determine the role of its ability to
mimic hypoxia signaling in the process, we generated a doxycycline inducible
lung-specific Hypoxia inducible factor 1a (HIF1ot) deficient system in mice.

In utero, lung specific deletion of H|F1o resulted in altered surfactant
metabolism and defects in alveolar epithelial differentiation that led to premature
death due to respiratory distress. In contrast, the in utero deletion of

HIF2a (another prominent form of HlFoc) from the lungs did not affect the viability

of neonates. Interestingly, the removal of both H|F1a and HlF2a from the lungs
during development led to the birth of phenotypically normal pups, suggesting
that the loss of HIFZa can rescue the lethal phenotype associated with the loss of
H|F1a from the lungs. Microarray analysis of the lungs from HlF1aA/A,
HlF2 OLA/A and HlF1/2 ozA/A identified sets of genes, involved in various cellular
pathways such as surfactant metabolism and vesicular trafficking that were
specifically affected in the HlF10tA/A neonates and these results suggest possible
mechanistic information for the role of HlFs in lung development.

In order to elucidate the role of epithelial derived-HlF1a signaling in
cobalt-induced lung injury, we deleted the transcription factor postnatally. These
mice were exposed to cobalt chloride via oropharyngeal aspiration. Compared to
control mice, mice that were H|F1oc deficient in their lungs exhibited ainNay
infiltration of eosinophils associated with airway epithelial changes, including
mucus cell metaplasia and increased levels of the chitinase-like proteins YM1
and YM2. These results suggested that airway epithelial-derived HlF1a plays a
critical role in modulating the inflammatory response of the lung. Moreover, its
disruption leads to a tissue that is biased towards a Th2-like response and
exhibits an asthma-like phenotype following cobalt challenge. Taken together,
the striking differences observed following cobalt exposure in the two mice
suggests that they will be a powerful tool to understand the relationship between

allergy-induced asthma, hypoxia, and inflammation.

ACKNOWLEDGMENTS

I would like to take this opportunity to express my profound gratitude to
my advisor Dr. John J. LaPres who gave me the opportunity to work in his lab
under his quality mentorship. I want to thank him for his sincere guidance,
generous time, patience, encouragement and continuous support throughout
my research work. His precious scientific advice and great attitude towards
science compelled me to adopt those elite qualities in my developing scientific
career which I will take with me through my entire career. I feel extremely
fortunate to have Dr. LaPres as my major advisor.

I greatly appreciate my guidance committee members; Dr. Jack R
Harkema, Dr. A. Daniel Jones, Dr. Robert A Roth, and Dr. Susan L Ewart for
their great help, insightful comments and constructive discussions. I am
indebted to them for their valuable suggestions and continued inputs to
improve my research progress as well as my scientific career.

I am thankful to the Genetics Program and Dr. Barbara Sears (Director,
Genetics Program) for accepting me in to the program which gave me great
opportunity to enhance my scientific career. I sincerely thank Jeannine Lee for
all her help from the day I submitted my application for admission to the
program. I would also like to thank Environmental and Integrative Toxicology
Program executive committee for providing me opportunity to gain expertise in

Toxicology as my second PhD major.

I am obliged to Kyung Y. Kim, Christian Merrill and Krista Greenwood
for their help in my research work. I would like to thank all the lab members
from Dr. Harkema's laboratory, especially Lori Bramble, Ryan Lewandowski,
Dr. Daher l Aibo, Dr. Neil Birmingham, Dr. James Wagner and Dr. Daven
Jackson for their endless help during my research work.

My sincere thanks are extended to all current and former colleagues in
Dr. LaPres's laboratory, especially Dr. Ajith Vengellur, Dr. Scott G Lynn,
Dorothy M Tappenden, Heyjin Hwang, Kyunghee Burkitt, Steven Proper, Amy
Bays and Dr. Kang Ae Lee for all their kind help, cooperation, and friendly
atmosphere. I also want to thank all my friends and colleagues in Genetics
Program, Integrative Toxicology Program and Biochemistry and Molecular
Biology Department. I also want to thank my friends Vishal, Shipra, Ram and
Anita for their kind help and providing me a very friendly atmosphere.

I greatly appreciate ULAR and Human Histopathology Division for their
help in my research work.

I thank with all my heart to my parents for their encouragements, love
and support which motivated me to accomplish all my educational aims.
Finally, my special thanks go to my dear wife, Sonika Patial who has been a
source of motivation during all those tough moments. lt is a very special year

of my life as we were blessed with our baby boy, Krish on 15th November.

TABLE OF CONTENTS

LIST OF TABLES ............................................................................... ix
LIST OF FIGURES ............................................................................... x
KEY TO ABBREVIATIONS .................................................................. xii
CHAPTER 1:
INTRODUCTION ................................................................................. 1
1. Oxygen ..................................................................... 1
2. Anatomy and Development of the Respiratory System ........ 2
2.A. Development of lung ............................................. 2
2.8. Anatomy of the respiratory system ........................... 6
3. Mammalian gas exchange ........................................... 1O
4. Hypoxia ................................................................... 12
4.A. Biological Significance .......................................... 12
4.3. Cellular responses to hypoxia ................................ 13
4.0. Hypoxia-responsive transcription factors .................. 18

4D. HIF signaling and regulation of gene expression........25
4.E. HlF signaling and development...............................26
4.E.1. Placentation and Hypoxia signaling............26

4.E.2. Hypoxic regulation of organogenesis .......... 30

4.E.2.a. Vascular System ............................. 31

4.E.2.b. Cardiac System .............................. 31

4.E.2.c. Lung ............................................. 33

5. Hypoxia and its effects on the lung ................................ 35
6. Hypoxia Mimics and HIF signaling .................................. 36
7. Metals ...................................................................... 37
7A. History of metals .......................................... 37

7.8. Biological significance of metals ...................... 37

7.0. Toxicity of Metals ......................................... 38

8. Cobalt ...................................................................... 41
BA. Occurrence and uses.... ............................... 41

8.8. Cobalt metabolism and Exposure ................... 42

vi

8.C. Cobalt toxicity .............................................. 43

8.0. The role of HlFs in cobalt-mediated toxicity ....... 44
Hypothesis and Specific Aims ................................................ 45
Importance ......................................................................... 47
References for Introduction ................................................... 48
CHAPTER 2:
HIF1a is essential for normal intrauterine differentiation of alveolar epith-
-eIIum and surfactant production in the newborn lung of mice .............. 60
Abstract .............................................................................. 61
Introduction ......................................................................... 62
Material and Methods ............................................................ 64
Results ............................................................................... 69
Discussion .......................................................................... 95
References .......................................................................... 99
CHAPTER 3:
Loss of HIFZot rescues the HIF1a deletion phenotype of neonatal respira-
tory distress in mice ....................................................................... 103
Abstract ............................................................................. 104
Introduction ........................................................................ 1 06
Material and Methods ........................................................... 110
Results .............................................................................. 1 19
Discussion ......................................................................... 145
References ......................................................................... 1 51
CHAPTER 4:
The role of Hypoxia Inducible Factor 1a in modulating Cobalt-Induced
Lung Inflammation: A Subchronic Study ........................................... 155
Abstract ............................................................................. 1 56
Introduction ......................................................................... 1 57
Material and Methods ........................................................... 159
Results .............................................................................. 165
Discussion ......................................................................... 192
References ......................................................................... 200

vii

CHAPTER 5:
The Role of Hypoxia Inducible Factor 10: (HlF1ot) in Modulating Cobalt -

Induced Lung Inflammation: An Acute Study ..................................... 203
Abstract ............................................................................. 204
Introduction ........................................................................ 206
Material and Methods ........................................................... 209
Results .............................................................................. 21 7
Discussion ......................................................................... 234
References ......................................................................... 240

CHAPTER 6:

Conclusions .................................................................................. 244

APPENDIX TABLE A.1. List of differentially expressed genes ................... 251

viii

Table 2.1
Table 2.2
Table 3.1
Table 3.2

Table 3.3

Table 3.4

Table 4.1
Table 4.2
Table 4.2
Table A.1

LIST OF TABLES

Primers for PCR-genotyping ............................................. 94
Primers for real-time RT-PCR ........................................... 94
Primers for real-time RT-PCR .......................................... 120
Cellular pathways affected by deletions of HlF1a,

HIF20 and HIF1/2c1 ....................................................... 136
Biological processes affected by deletions of HlF1a,

HIF20 and HIF1/2r1 ....................................................... 137
Genes involved in surfactant metabolism ........................... 139
List of genes analyzed qRT-PCR ..................................... 172
Gene Expression Changes ............................................. 191
Cytokine Profiles ......................................................... 193
List of differentially expressed genes ............................... 251

LIST OF FIGURES

Images in this dissertation are presented in color

Figure 1.1.

Figure 1.2.

Figure 1.3.

Figure 2.1.

Figure 2.2.

Figure 2.3.

Figure 2.4.

Figure 2.5.
Figure 2.6.

Figure 2.7.

Figure 3.1.

Figure 3.2.
Figure 3.3.
Figure 3.4.
Figure 3.5.
Figure 3.6.
Figure 3.7.

Figure 3.8.

Domain structure of human HIFs ....................................... 16

Structure of human HlF1a protein and
oxygen-dependent modification of HIF1a ............................ 19

Hypoxia Signaling in normoxic and hypoxic conditions ........... 22

Lung specific, doxycycline-inducible deletion of

HIF1a in triple transgenic mrce70
Effects of lung specific deletion of HlF1or ............................ 76
Pulmonary Histopathology of Lungs ................................... 79
Electron photomicrographs of alveolar

epithelium of newborn pups .............................................. 81
Surfactant protein expression ............................................ 85
Expression of developmentally important genes ................... 89

Immunohistochemistry for Cre recombinase,
HIF1ot, and HIF292

Lung specific, doxycycline-inducible deletion of HIF1a

and HlF2o in triple transgenic mice .................................. 112
Genotyping of transgenes .............................................. 114
Survivability Plot .......................................................... 121
Pulmonary Histopathology .............................................. 123
Immunohistochemistry for HlF1o ...................................... 126
Immunohistochemistry for HIF20 ...................................... 128
Periodic acid Schiff (PAS) staining ................................... 130

Differential gene expression between HIF1oA/A,
HlF2ch/A and HIF1/20 A/A ............................................. 133

Figure 3.9.

Figure 4.1.

Figure 4.2.

Figure 4.3.

Figure 4.4.

Figure 4.5.

Figure 4.6.

Figure 4.7.

Figure 4.8.
Figure 5.1.

Figure 5.2.

Figure 5.3.

Figure 5.4.

Figure 5.5.

Figure 5.6.

Figure 5.7.

QRTPCR verification of selected microarray
gene expression responses ............................................ 140

HIF10t immunohistochemistry of lungs from
control and doxycycline treated mice ................................ 166

Weight change and cell counts from cobalt
challenged control and HIF1oc A/A mice ........................... 169

Cell counts from genotype and treatment controls ............... 174

Histopathology and picro-sirius staining control

and cobalt-treated control mice ....................................... 178
Major Basic Protein Staining in lungs from

control and HlF1aA/A mice ............................................. 181
Alcian Blue/Periodic Acid Schiff Stain and YM1/2 IHC .......... 184
H&E staining and YM1/2 IHC of cobalt

treated control and HIF1orA/A mice .................................. 186
Gene expression results ............................................... 189
Experimental Design ..................................................... 210

BALF proteins and total cell counts from
control andH|F1a A/A mice ............................................. 215

Effect of cobalt treatment on inflammatory cells
Recovered in bronchoalveolar lavage fluid ........................ 218

Histopathology staining of control and cobalt-treated
control mice ................................................................. 222

Major Basic Protein (MBP) immunohistochemistry in
lungs from control and HlFlaA/A mice .............................. 225

Neutrophil (PMN) immunohistochemistry in lungs from
control and HlF1aA/A mice ............................................. 227

Cytokine levels in BALF from cobalt-treated control and
HIF 10L A/A mice ............................................................ 230

xi

ANOVA

ARNT

ATP

C/EBP

CBP

CCSP

COPD

CRE

CREB

DFO

DMOG

DPPC

DTT

EDTA

EMT

EPO

ETC

Foxa2

H&E

KEY TO ABBREVIATIONS

Analysis of Variance

Aryl hydrocarbon receptor nuclear translocator
Adenosine triphosphate
CAAT/enhancer-binging protein

CREB binding protein

Clara cell secretory protein

Chronic obstructive pulmonary disease
Cyclization recombination

cAMP response element binding
Desferrioxamine
Dimethyloxaloglutarate
Dipalmitoylphosphatidylcholine
Dithiothreitol
Ethylenediaminetetraacetic acid
Epithelial-mesenchymal transition
Erythropoietin

Electron transport chain

Forkhead box A2

Hematoxylin and eosin

xii

HAPE

HGPRT

HIF

HNF

HO-1

HRE

Lb

LoxP

MEF

MTF-1

mv

NFKB

ODD

PAS

PAS

PFK—1

PHD

PMSF

High-altitude pulmonary edema
hypoxanthine guanine phosphoribosyl transferase
Hypoxia inducible factor

Hepatocyte nuclear nactor
Haemoxygenase-1

Hypoxia responsive element
lmmunoglobulin isotype E
lmmunoglobulin isotype G

Interleukin

lamellar bodies

Locus of crossover in P1

Mouse embryonic fibroblast

Metal transcription factor-1

Microvilli

Nuclear factor-kappa B
Oxygen-dependent degradation domain
Per/Arnt/Sim

Periodic acid Schiff
Phosphofructokinase-1

Prolyl hydroxylase domain protein

Phenylmethylsulphonyl fluoride

xiii

PN

p02
pVHL
RDS
RIPA
ROS
RT-PCR
rtTA
SDS-PAGE
SEM
SP-C
TAD
TEM

TF
TGF-B1
TNF-a
VEGF

pm

Postnatal

Partial pressure of oxygen

von HippeI-Lindau protein

Respiratory distress syndrome
Radioimmunoprecipitation assay

Reactive oxygen species

Reverse transcriptase-polymerase chain reaction
Reverse tetracycline transactivator

Sodium dodecyl sulfate polyacrylamide gel electrophoresis
Standard error of mean

Surfactant protein C

Transactivation domain

Transmission electron microscopy

Transferrin

Transforming growth factor-beta 1

Tumor necrosis factor-alpha

Vascular endothelial growth factor

Micrometer

xiv

Introduction

1. Oxygen

Oxygen is the third most abundant element, after hydrogen and helium,
in the universe and makes up nearly 21% of the earth's atmosphere. Oxygen
is the most important factor for the viability of living systems, except for
obligate anaerobes. Oxygen acts as the ultimate electron acceptor in aerobic
respiration and therefore, is critical for energy production in the form of
adenosine triphosphate (ATP). Oxygen also acts as a substrate in various

biosynthetic reactions as well as breakdown product in catabolic reactions [1].

The indispensable involvement of oxygen in energy generation and
other critical cellular processes made it important to evolve sensing
mechanisms for changes in oxygen availability. Evolutionary adaptation has
selected various pathways to deal with oxygen tension fluctuations. These
pathways regulate short- and long-term responses. Every organism, either
unicellular or multicellular, possesses the ability to sense changes in the
ambient oxygen and respond through alterations in metabolism and gene

expression [2].

For strict aerobic unicellular organisms or cells in culture, oxygen
comes from the atmosphere, either directly or dissolved in the surrounding
medium. In multicellular organisms, however, oxygen is supplied by tissue

bathing fluids containing dissolved or protein-bound oxygen delivered by

specialized respiratory organs or tissue systems to allow gas exchange.
These respiratory systems consist of conducting zones leading to the gas
exchange area where oxygen diffuses into the tissue bathing fluid (blood in
mammals). Different organisms have evolved varying anatomical structures to
obtain and circulate oxygen, including very simple structures (e.g. gills and
trachea) to complex specialized structures (e.g. lungs). The mammalian

respiratory system represents one of the most complex respiratory structures.

2. Anatomy and Development of the Respiratory System

2.A. Development of the lung

Human lung development initiates at third week of gestation
(corresponds to E9.5 of mouse gestation) and proceeds through three
chronological periods: embryonic, fetal period proper and postnatal periods.
The fetal period proper is further divided in to three stages called
pseudoglandular, canalicular and saccular. Since the process of
differentiation proceeds from the center to the periphery of the lung
asynchronously between lobes, there is significant overlap between these

stages [3].

In humans, the embryonic period corresponds to 4-7 weeks after
fertilization and represents the beginning of organ development. The lung

appears, towards the end of the fourth week, as a bud ventral to the

prospective esophagus. As the Iaryngotracheal groove deepens, lung bud
grows in to the surrounding mesenchymal matrix by successive dichotomous
branching. By the end of the seventh week, the lobar, segmental and
subsegmental portion of ainNay tree with high columnar epithelium is already

formed [3].

Starting from the eighth week, the lung resembles a small tubuloacinar
(epithelial) gland, hence, the stage is called as a pseudoglandular stage which
runs from fifth week to seventeenth week (corresponds to E9.5 to E16.5 of
mouse gestation). It is in this stage that continuous growth and branching of
the peripheral portion of epithelial tube leads to the formation of prospective
conductive ainNays and appearance of acinar outline. Epithelial-mesenchymal
interactions regulate this growth and branching pattern. Removal of
mesenchyme from the tip of a sprouting tube prevents further branching
whereas plantation of mesenchyme alongside of a lower order tube results in
the appearance of new branch [4, 5]. Moreover, the presence of collagen and
mesenchyme is needed for branching and epithelial differentiation [6, 7]. By
the twelfth week, mucous glands are present as solid sprouts from the
epithelial layer and acquire canal and secretory activities by the fourteenth
week [8]. At the end of seventeenth week, acini are composed of stem tubule
(prospective terminal bronchiole), 2-4 future respiratory bronchioles and small

clusters of short tubules and buds.

The canalicular stage of lung development spans from week 17 to week
26 in humans (corresponds to E16.5 to E17.5 of mouse gestation). At this
stage compact acinar clusters grow by three processes: peripheral branching,
elongation of each tubular branch, and widening of the distal airspaces. Thus,
the tubules until about three orders of branching are referred to as canaliculi.
It is at this stage that capillarization starts taking place around the airspaces to
establish close contact with the overlaying cuboidal epithelium lined with Type
II cells. These contact points are the sites where the cuboidal epithelial cells
decrease in height and transform into Type I cells. These type I cells have
attenuated cytoplasmic processes and form the future air-blood barrier. The
two processes, close apposition of capillary epithelium to the epithelial cells
and the epithelial flattening are intimately related, but it is unclear which of the
two processes induces the other. The air blood barrier transformation starts
peripherally as the cuboidal (undifferentiated) epithelial cells (Type II cells)
towards the center are needed for further growth and branching [3]. It has
been shown that Type II cells can incorporate tritiated thymidine (cell division)
and lose their granules to differentiate eventually into Type I cells [9]. A similar
pattern of transformation has also been observed in damaged alveolar
epithelium suggesting the stem cell role of Type II cells [10]. Similarly, it has
been shown that the Clara cells, secretory cell type of the bronchioles,

represents the progenitor cells of the bronchiolar epithelium [11].

Saccular stage of lung development represents period from week 24 to
week 36 in humans (corresponds to E17.5 to PN6 of mouse gestation). In the
terminal phase of the canalicular stage, the ainlvays consist of clusters of
relatively thin-walled terminal saccules and is referred to as saccular or
terminal sac. These saccules give rise to the last generation of ainrvays, some
prospective alveolar ducts, and the alveolar sacs at the outermost periphery.
Thus each canalicule, except the last branch, goes through the stages of
being a saccule, then a smooth-walled channel, and after birth, when alveoli
have formed, a typical alveolar duct. The vast elaboration of the air space
coupled with marked decrease in interstitial tissue has an important
consequence on the alveolar capillary arrangement. The capillaries network
form a mesh round the ainNay channels and within the intersaccular septa as
the airspaces approach each other. It is in the saccular stage that the
pulmonary surfactant system matures (between week 29 and week 32 in

humans).

At birth, the lung parenchyma structure is still in an immature state
despite the complete branching pattern and number of airway generations.
Neonatal human lung contains only 20 million alveoli, which represents
approximately 10 % of the full population of 300 million observed in adult lung
[12]. At birth, the rat lung consists of smoothly contoured ducts and saccules

having thick primary septa and relatively thick layer of connective tissues. It

takes two postnatal weeks to transform these immature structures into alveolar

ducts and alveoli lined with thin inter-alveolar septa [13, 14].

2.3. Anatomy of the Respiratory System

The mammalian respiratory system is composed of two major
components: the conducting portion and the respiratory portion. The
conducting portion, situated both outside and within the lungs, conveys air
from the external milieu to the lungs whereas the respiratory portion, located
strictly within the lungs, functions in the actual exchange of oxygen for carbon
dioxide (external respiration). The conducting portion of the respiratory
system is composed of the nasopharynx, trachea, primary bronchi, secondary
bronchi (lobar bronchi), tertiary bronchi (segmental bronchi), bronchioles, and
terminal bronchioles. The bronchial tree, stemmed from trachea, divides 15 to
20 times before reaching the level of the terminal bronchioles. The left and
right lobes have 2 and 3 secondary bronchi (branches of the primary bronchi),
also known as lobar bronchi, respectively. As these secondary bronchi enter
the lobes of the lung, they subdivide into smaller branches, tertiary
(segmental) bronchi. Each tertiary bronchus arborizes and leads to the
formation of bronchioles. Each bronchiole supplies air to a pulmonary lobule.
It is generally accepted that the bronchioles represent the 10th to 15th
generation of dichotomous branching of the bronchial tree. Their diameter can

vary among authors from 0.3mm to 5mm.

The epithelial lining of larger bronchioles is primarily ciliated simple
columnar with occasional goblet cells whereas the smaller bronchioles have
simple cuboidal (many with cilia) with occasional Clara cells and no goblet
cells. Clara cells are columnar cells with dome-shaped apices that have short,
blunt microvilli. Clara cell cytoplasm houses numerous secretory granules
containing glycoproteins that protect bronchiolar epithelium. Additionally,
these cells degrade toxins in the inhaled air via cytochrome P-450 enzymes in
their smooth endoplasmic reticulum [15]. Some investigators suggest that
Clara cells produce a surfactant-like material that reduces the surface tension
of bronchioles and facilitates the maintenance of their patency [16]. It has
been shown that Clara cells divide to regenerate the bronchiolar epithelium
[17-20]. Thus, Clara cells forms a very important cell population lining the

bronchiolar epithelium.

The respiratory portion of the respiratory system is composed of
respiratory bronchioles, alveolar ducts, alveolar sacs, and alveoli. Terminal
bronchiole branch to give rise to respiratory bronchioles and forms the first
region of the respiratory system where exchange of gases can occur.
Respiratory bronchioles are similar in structure to terminal bronchioles except
that their walls are interrupted by the presence of thin-walled, pouch-like
structures known as alveoli, where efficient gaseous exchange occurs. As
respiratory bronchioles branch, they become narrower in diameter and their

population of alveoli increases. Subsequent to several branchings, each

respiratory bronchiole terminates in an alveolar duct. Alveolar ducts do not
have walls of their own; they are merely linear arrangements of alveoli. An
alveolar duct that arises from a respiratory bronchiole branches, and each of
the resultant alveolar ducts, usually ends as a blind outpouching composed of
two or more small clusters of alveoli, known as an alveolar sac. Each alveolus
is a small outpouching, about 200pm in diameter, of respiratory bronchioles,
alveolar ducts, and an alveolar sac that is composed of highly attenuated type
I pneumocytes (also known as type | alveolar cells or squamous alveolar cells)
and larger type II pneumocytes (also known as great alveolar cells, septal
cells, and type II alveolar cells). Approximately 95% of the alveolar surface is
lined by type I pneumocytes which are highly flattened with cytoplasm
thickness of approximately 80nm. The type II pneumocytes are more
numerous than type I pneumocytes, however, they occupy only about 5% of
the alveolar surface. The most distinguishing feature of these cells is the
presence of membrane-bound lamellar bodies that contain pulmonary

surfactant, the secretory product of these cells.

Pulmonary surfactants, heterogenous phospholipoproteinaceous
material consisting of 90% lipids and 10% proteins, that are synthesized on
the rough endoplasmic reticulum (RER) of type II pneumocytes. The
surfactants are composed primarily of two phospholipids
(dipalmitoylphosphatidylcholine (DPPC) and phosphatidylglycerol) a neutral

lipid, and four unique proteins (surfactant apoproteins SP-A, SP-B, SP-C, and

SP-D). The surfactants are modified in the golgi apparatus and are then
released from the trans golgi network into secretory vesicles, known as
composite bodies, the immediate precursors of lamellar bodies. The lamellar
body-bound surfactants are released via exocytosis into the lumen alveolar
lumen where it forms a lattice-like network known as tubular myelin. The
surfactants decrease surface tension, thus preventing atelectasis, namely the
collapse of the alveolus. The surfactants are continuously manufactured by
type II pneumocytes and are phagocytosed and recycled by type II
pneumocytes and, less frequently, by alveolar macrophages. In addition to
producing and phagocytosing surfactants, type II pneumocytes also act as

precursor of type I pneumocytes.

Alveolar macrophages, also known as Dust Cells, phagocytize
particulate matter in the lumen of the alveolus as well as in the interalveolar
spaces. The circulating blood monocytes, after infiltrating into the pulmonary
interstitium, become alveolar macrophages and migrate between Type I
pneumocytes into the alveolar spaces. These cells phagocytose particulate
matter, such as dust and bacteria, and thus maintain a sterile environment
within the lungs. Alveolar macrophages also assist Type II pneumocytes in
the recycling of surfactants. Approximately 100 million macrophages migrate

to the bronchi each day and are transported from there by ciliary action to the

pharynx to be eliminated by being swallowed or expectorated. Some alveolar

macrophages, however, reenter the pulmonary interstitium and migrate into

lymph vessels to exit the lungs.

3. Mammalian Gas exchange

Mammals have one of the most advanced respiratory systems.
In animal physiology, respiration is defined as the transport of oxygen from the
outside air to the cells within tissues, and the simultaneous transport of carbon
dioxide in the opposite direction. This is different from cellular respiration,
which is a biochemical oxidation pathway by which cells release energy from
the chemical bonds of food molecules (e.g. glucose) and provide that energy

for the essential processes of life.

In humans and other mammals, physiological respiration involves four
steps: Ventilation, the process of moving ambient air in to and out of alveolar
space. Pulmonary gas exchange or external respiration, the process of
gaseous exchange between the alveoli and the pulmonary capillaries. Gas
transport, movement of gases throughout the circulatory system to deliver
oxygen to peripheral tissues and to transport carbon dioxide back to the
pulmonary gas exchange site. Peripheral gas exchange, the transfer of gases

between the tissue capillaries and the tissues/cells.

The respiratory and cardiovascular systems work in concert to carry

gases to and from the tissues. Veins carry deoxygenated blood from

10

peripheral tissues to the right atrium of the heart that transfers the blood to
the right ventricle. The right ventricle pumps blood through the pulmonary
artery towards the lungs. The pulmonary artery branches out to form capillary
beds around the alveoli in close apposition to Type | pneumocytes to form
200-600 nm thick blood-gas barrier (alveolar-capillary barrier) [21]. Blood

oxygenated at the blood-gas barrier is carried via the pulmonary vein to the left

heart from where oxygenated blood (p02: 100mmHg) is pumped into the aorta

and eventually to the whole body.

The p02 in capillaries varies among different tissues and within the

tissues depending upon the location and physiological state. For example,

within the liver Iobules, the p02 varies depending on the proximity to the blood

carrying vessels. The p02 of hepatic artery is 95-105 mmHg whereas the

p02 of vena cava is approximately 40-45 mmHg [22]. At normal oxygen

concentration, oxygen levels within the body vary between tissue and cell

types. For instance, oxygen concentration required for normal brain function is

uniformly higher than that for the muscles. Thus, a range of p02 is found in

different tissues makes some tissues or organs more prone to oxygen deficit,

a condition known as hypoxia.

11

4. Hypoxia

4.A. Biological Significance

The normal p02 state is known as norrnoxia and when the p02 in the

cell or tissue drops below this normal level, a state of hypoxia is said to exist.
In the systemic context, hypoxia is categorized into four subcategories:
hypoxic, anemic and circulatory hypoxia. Hypoxic hypoxia arises due to
decrease in ambient oxygen partial pressure attributed to hypoventilation or
altitude. Anemic hypoxia results from decreased hemoglobin concentration
that leads to declined oxygen-carrying capacity of the blood. Circulatory

hypoxia arises because of impaired tissue perfusion [23].

In systemic or organ system context, the hypoxic conditions arise in

normal physiological process as well as in pathological conditions. It is well

known that mammalian embryos develop in a state of partial hypoxia (p02 =

20—30 mmHg) and hypoxic conditions within the embryo have been
characterized in the neural tubes, heart, and intersomitic mesenchyme at an
early stage of organogenesis [24]. This decreased oxygen availability is an
important regulator of proper angiogenesis and tubulogenesis [25]. Studies
have shown that fluctuation in oxygen tension within the uteroplacental
environment is an important determinant of cellular events during trophoblastic
invasion and the placental remodeling process [26]. In the pathological

settings, hypoxia is a critical feature in several diseases, including cancer,

12

myocardial ischemia, cerebral ischemia, atherosclerosis, rheumatoid arthritis,

and chronic obstructive pulmonary disease (COPD).

The lung’s integral role in oxygen uptake and supply does not preclude
it from being negatively impacted by hypoxia. Conditions like ainNay
obstruction, intra-alveolar exudates, septal thickening by edema, inflammation,
fibrosis, or damage to alveolar capillaries can induce localized hypoxic
conditions within the lung. In airway inflammatory diseases like asthma, lung
structure changes due to persistent inflammation pose obstruction to air flow,
which leads to a hypoxic condition in the affected pulmonary tissue [27].
There is a correlation between allergic airway inflammatory diseases and the
upregulation of hypoxia sensitive proteins such as glycolytic enzymes, prolyI-4-
hydroxylase, peroxiredoxin 1, and arginase [28]. In the current discussion on
hypoxia, it is clear that hypoxia and hypoxia induced downstream processes

have both beneficial as well as detrimental roles in the biological system.

4.8. Cellular Responses to hypoxia

6
An active cell might use as much as 2 x 10 molecules of ATP per

second. Many fundamental cellular processes, such as transcription,
translation, metabolic reactions, cytoskeletal movements, and ion transport
require ATP as a primary source of energy. Maintenance of a cellular

homeostatic environment using ATP-dependent ion pumping systems such as

+ +
the Na IK ATPase requires 20 to 80% of the cellular metabolic energy.

13

Reduced ATP generation results in the loss of the cell’s ability to maintain

ionic and osmotic balance. Failure of these ion-motive ATPase leads to

2+
membrane depolarization, uncontrolled Ca influx through voltage-gated

2+
Ca channels, and subsequent activation of calcium-dependent

phospholipases and proteases. These events result in uncontrolled cell
swelling, hydrolysis of biomolecules, leakage of cellular compartments and
eventually, to cell necrosis [29]. Since oxygen is the primary requirement in
efficient ATP generation in mitochondria, hypoxia exhibit its affect through a
compromised electron transport chain and reduced ATP generation. Cells
have developed selective bypass processes responsible for alternate but
efficient energy conservation or generation. These adaptive and pro-survival
processes include anaerobic glycolysis and reallocation of cellular energy

between essential and nonessential ATP demand processes.

Under hypoxia, cells switch to anaerobic glycolysis, a less efficient ATP
generating process to meet their energy demands. This switch is turned on
through allosteric regulation of phosphofructokinase-1 (PFK-1) activity and the
overexpression of enzymes involved in anaerobic glycolysis [30]. PFK-1
catalyzes the conversion of fnJctose 6-phosphate to fructose 1,6-bisphosphate
and is considered a major regulatory enzyme that controls carbon flux through
glycolysis. PFK-1 is allosterically regulated by a number of metabolites. ADP,

AMP and fructose-2,6-biphosphate are allosteric activators, whereas ATP and

14

citrate are the allosteric inhibitors of PFK—1. Under energy deficit (e.g. hypoxic
conditions), the cellular AMP/ATP ratio is elevated which results in the
activation of PFK-1 via an AMP activated protein kinase (AMPK) dependent
process. AMPK activation has also been reported to recruit Glut-4 (glucose
transporter) to the plasma membrane and to increase the expression of
hexokinase as well as some mitochondrial enzymes involved in TCA cycle and

electron transport chain (ETC) [31].

Another strategy adopted by cells to survive or adapt under hypoxic stress is
reallocation of cellular energy between essential and nonessential ATP
demand processes. Protein synthesis and ion motive ATPases account for
more than 66% and 90% of ATP consumption in rat thymocytes and rat

skeletal muscles, respectively [32]. The ATP consumption hierarchy is

+ +
rearranged in energy deficit circumstances whereby Na /K pumping and

+
Ca2 cycling processes become the higher ATP consumers instead of

replication, transcription, or translation [33].

Most of the adaptive hypoxic responses take place with in seconds
through the activation or inhibition of already synthesized structural or
regulatory proteins. However, some adaptive responses take place or are

fine-tuned at the level of gene transcription or translation. As discussed in the

15

Figure 1.1. Domain structure of human HlFs.

HIF-oc(HlF-1a, HIF-2a, HIF-3a), HIF-1B (ARNT), and ARNT2 belong to
Per-ARNT-Sim (PAS) protein superfamily. HIF-oz consists of four
structural domains: basic Helix-Loop-Helix (bHLH) domain (blue), Per-
ARNT-Sim (PAS) domain (green), oxygen-dependent degradation
domain (ODD) (purple), and transactivation (TAD) domain (yellow).
HIF-1B and ARNT2 lacks ODD but shares all the other three domains
present in HIF-or. The presence of the ODD that makes HIF-on oxygen-

labile. ”Images in this dissertation are presented in color."

16

 

 

 

mowz

 

coma Nmmx

 

Neva

17

next section, hypoxia-responsive transcription factors function at the hub of

oxygen sensing machinery.

4.C. Hypoxia-responsive transcription factors

The oxygen sensing system consists of several hypoxia—responsive
transcription factors that mediate regulation of genes responsible for
maintaining or rescuing tissue perfusion and ATP generation, including
vascular endothelial growth factor (VEGF), glycolyic enzymes, and glucose

transporters. Several transcription factors are also influenced by hypoxia,

including nuclear factor-KB (NFKB), cAMP response element binding (CREB),

activator protein 1 (AP-1), p53, Stable Protein 1 (SP-1), SP-3, Early growth
response factor 1 (EGR-1), CCAAT/enhancer-binding protein beta (C/EBPB),
GATA binding protein-2 (GATA-2) and signal transducers and activators of
transcription protein (STAT5) [34]. Although these transcription factors are
involved in the cellular response to decreases in oxygen availability, the family
of hypoxia-inducible factors (HlFs) comprises the principal regulators of the

transcriptional response to hypoxia.

HlFs are the most widely studied family of hypoxia responsive

transcription factors and they directly influence the expression of more than

1 50 genes. HlFs belong to the basic Helix-Loop-Helix (bHLH)«Per/Amt/Sim

18

Figure 1.2. Structure of human HIF1a protein and oxygen-
dependent modification of HIF1a.

The stability and transcriptional activity of HlF1oc is regulated in oxygen-
dependent manner. The oxygen-dependent degradation domains
contain conserved prolyl residues (P) 402 and 564 that undergo
hydroxylation in the norrnoxia conditions. The hydroxylated prolyl
residues, including acetylated lysyl (K-532) residue, form a binding site
for von Hippel-Lindau tumor suppressor protein (pVHL). The oxygen-
dependent hydroxylation of asparagyl residue (N-803) blocks the
binding of CBP and p300 transcriptional regulators and consequently
inhibits HIF1 mediated transcription. "Images in this dissertation are

presented in color."

19

co=m>=o<
.mcozntowcm;

comaimo

     

i cozmnfimoo

5:25:33: 1 .mEomwoaoE

(PAS) superfamily of transcription factors [35] (Fig. 1.1). HlFs are
heterodimeric factors consisting of a (HIF1o, HIF20, and HlF3o) and [3
subunits (HIF1[3 (also known as aryl hydrocarbon nuclear translocator, ARNT)
and ARNT2 [36]. These heterodimers bind at A/(G)CGTG consensus sites in
the hypoxia response elements (HREs) in the promoter regions of hypoxia
responsive genes. HIFs consists of an N-tenninal basic helix-Ioop—helix
(bHLH) domain, a central PAS domain (named for the three founding
members of the family, Per, ARNT, and Sim) and two C-terminal
transactivation domains (TADs) (Fig. 1.1). The bHLH acts to bind DNA and is
a primary dimerization surface. The PAS domain is a secondary dimerization
surface, dictating specificity of the interactions between various PAS proteins.
The TAD closest to the C-terminus (C-TAD) is the primary activator of
transcription. The interior TAD (N-TAD) has Iowertransactivation activity. The
unique feature that sets HlFas apart from HlFBs is the presence of an oxygen-
dependent degradation domain (ODD) overlapping the N-TAD. These ODDs
are responsible for rendering the protein oxygen labile. The ODD contains two
conserved prolyl residues (Pro402 and Pro564 in human HlF1a; Pro402 and
Pro577 in murine HlF1a) which are post-translationally hydroxylated under
normoxic conditions [37] (Fig. 1.2). The family of enzymes, prolyl hydroxylase
domain containing proteins (PHDs), responsible for this modification are
related to the hydroxylase involved in collagen synthesis [38]. PHDs were first

identified in C. elegans as egg laying abnormal nine homologs (EGLN) and

21

Figure 1.3. Hypoxia Signaling in normoxic and hypoxic conditions.

The hypoxia signaling in the normoxic conditions begins in the cytosol
where PHDs continuously respond to the changes in oxygen
concentrations. Under normoxic conditions, PHDs hydroxylate HlFa that,
in turn, leads to the pVHL mediated proteasomal degradation thus
inhibition of HIF1 mediated transcription (A). Under hypoxic conditions,
PHDs activity is inhibited leading to the stabilization of HlF1a. Stabilized
HlF1oc translocates into the nucleus where it binds to HIF1B to form active

HIF1heterodimer. "Images in this dissertation are presented in color."

22

 

fi
Normoxia
l

2+

   

Fe
Ascorbate
O

2
2-OG

  
   

l
' i, uccinate
' HIFIa
o/"\

 

  
   

 

 

‘ HO I‘ ’ 'r‘, Nucleus I,

‘ '0 {it I

i we 3 I: '3 ‘1'

g ARNT l

Ubiquitination g X I

é“ l

t 3 RCGTG ]

Cytoplasm g A
Hypoxia

  

2+
Fe
Ascorbate
o2

Z-OG

pVHL

x Succinate

    
 

'

4

ii
Hw1a

Cytoplasm

Nuclear
Translocation

  
 
 

AR

RCGTG

 
  
 

Nucleus

NT

 
   
    

Target Gene . 3

mRNA

 

23

later shown to have three mammalian homologs (PHD1-3) [39]. PHDs are
Fe(ll)-, ascorbate-, and 2-oxoglutarate-dependent dioxygenases that utilize
oxygen as a co-substrate. One oxygen atom of the oxygen molecule is used
in the hydroxylation of the HlFa prolyl residue (within a consensus LXXLAP

amino acid sequence) and the other reacts with 2-oxoglutarate, yielding

succinate and C02 as products [40]. Once hydroxylated, the HlFoc is

recognized by the tumor suppressor protein, von-Hippel Lindau (pVHL), which
acts as the recognition component of E3-ubiquitin ligase complex and targets

HIFa for proteolysis by the ubiquitin—proteasome pathway [41] (Fig. 1.3A).

Under hypoxic conditions, the PHDs are unable to hydroxylate the
cytoplasmic HIFa, which results in its stabilization and accumulation in the
cytoplasm (Fig. 1.3B). There are two proposed mechanisms underlying the
inhibition of PHDs under hypoxic stress. First, direct loss of substrate (i.e
oxygen) decreases the enzymes activity. The second involves hypoxia-
induced changes in reactive oxygen species (ROS) levels within the cytoplasm

that impacts various aspects of PHD’s function, including iron redox cycling.

Regardless of mechanism, it has been established that hypoxia leads to

PHD inhibition and subsequent stabilization of HlFa that initiates the

adaptation responses through gene expression [37]. Besides hypoxia, PHDs
Can also be inhibited by certain compounds referred to as hypoxia mimics.

These mimics include cobalt (competes with Fe(||)). desferrioxamine (DFO, an

24

iron chelator), and dimethyloxalylglycine (DMOG, an aKG analog). Exposure
to these compounds results in HIF1a stabilization and subsequent

transcriptional response [42].

4-0. HIF signaling and regulation of gene expression

More than 150 genes are directly regulated by HIF-mediated
transcription following exposure to hypoxia. It has been estimated that more
than 2% of human arterial endothelial cell genome is regulated by HIF-1,
directly or indirectly [43]. These genes are involved in a wide variety of
functions including cellular energy metabolism, cell proliferation, angiogenesis,
matrix and barrier functions, hormonal regulation, cytoskeletal integrity, cell

migration, vasomotor regulation, growth and apoptosis [44].

Switching to anaerobic glycolysis is probably the first pro-survival step
that cells choose under hypoxic stress (Pasteur effect). Several genes
involved in glycolysis and glucose uptake have been identified as HIF1 target
genes [45, 46]. Genes involved in cell proliferation such as transforming
growth factor-oz and [33 (TGF-a and B3), insulin-like growth factor-2 (IGF-2),
IGF binding protein 1, 2, and 3 (IGF-BP), cyclin G2 and WAF1 are some of the

known HIF target genes.

25

At the systemic and tissue level, exposure to hypoxia leads to changes
in HIF-responsive genes that regulate important processes such as
erythropoiesis, angiogenesis, and vascular remodeling. HIF regulated genes,
including erythropoietin (EPO), transferrin (TF), transferrin receptor,
ceruloplasmin (CP), haemoxygenase-1 (HO-1), VEGF, Flt-1 (VEGF receptor
1), PAI-1, adrenomedullin, endothelin 1 (END-1), inducible nitric oxide
synthase (NOSZA), endothelial nitric oxide synthase (N083) and

ferrochelatase (FECH) are all involved in enhanced oxygen supply [47].

4.E. HIF signaling and development

Perhaps, the most obvious physiological role of HIF signaling is

observed in mammalian embryonic and fetal development. Hypoxia is a
consistent feature during gestational development, with p02 ranging from 55
mmHg (conception) to 12 mmHg (late gestation). Despite the placental

formation, the late gestational p02 values in umbilical artery, umbilical vein

and amniotic fluid remains below approximately 23, 30 and 12 mmHg,
respectively [48]. Under these hypoxic conditions, embryonic and fetal stages

rely on the mechanisms dedicated to maintain oxygen supply and using the

p02 as a developmental cue.

4.E.1. Placentation and hypoxia signaling

26

 

During oocyte release and fertilization the oxygen delivery is diffusion
mediated. These stages are the most anaerobic stage of fetal development

due to several factors, including increase in the diffusion distance of oxygen to

the mitochondria and poor vascularization and low intrauterine p02. In order

to meet the increasing oxygen demands of the growing conceptus, the
process of placentation is very important. The first phase of placentation is
characterized by cytotrophoblastic proliferation into the endometrial stroma
followed by cell fusion and formation of syncytium. The mass formed by the
fusion of invading cytotrophoblasts is called the syncytiotrophoblasts and it
massively increases the surface area available for nutrient exchange between
the mother and the fetus. The second phase of placentation includes the
differentiation of remaining (non-syncytial) cytotrophoblasts to form primary villi
that penetrate the maternal decidua, myometrium and vasculature which

ultimately develop to form true placental gas exchange interface.

During placentation, the morphogenesis of placental gas exchange
interface is regulated by oxygen tension in two different forms of

cytotrophoblasts. The proliferative form of cytotrophoblasts is undifferentiated

which is characteristically prominent at the low p02 (fetal p02) whereas the

other non-proliferative (differentiated, motile and invasive) form appears at

arterial p02 [49]. The formation of placental gas exchange interface is thus,

27

precisely controlled by oxygen tension surrounding the tissues through an

oxygen sensor mechanism.

The oxygen sensor involved in the transduction of change in oxygen
tension to the physiological signal (placental gas exchange interface
establishment) has been recognized as PHDs, with the effector pathway as
HIF signaling [50]. It has been demonstrated that HlF1ot mRNA is expressed
maximally between 5 to 8 weeks of gestation and falls abruptly at 12 weeks
(corresponds to E95 and E10.5 of mouse fetus) with the establishment of
placental gas exchange process [51]. This finding suggested the possible role
of HIF responsive genes in the process of placentation. Later it was shown

that antisense mediated knockdown of HIF1a in the cultured villous implants
at fetal p02 resulted in the adoption of the differentiated, non-proliferative,
motile, and invasive form of cytotrophoblasts, which normally appears at
arterial p02. It suggested that HIF1a stabilization at low p02 signals the

retention of undifferentiated and proliferative form of cytotrophoblasts that is

relieved after the p02 is raised to arterial levels leading to HlF1a degradation
[52, 53]. It has also been shown that the knockdown of HlF1a results in the
suppression of TGFB3 (HIF1 target gene) which is responsible for the switch

from the proliferative to the invasive form. This switch was reversed on the

addition of recombinant TGFB3 [49, 54, 55]. Further, to explore the HIF

28

signaling underlying the roles of hypoxia in placental development, various

murine models with disrupted HIF pathways have been generated [50, 54, 56].

Disruption of all the three PHDs (PHD1, PHDZ and PHD3) in the murine

model has shown that mice lacking PHD1 (Phd1 'l') and PHD3 (Phd3 'l') had

-/-
apparently normal placental development whereas Phd2 exhibited several

placental defects such as abnormal distribution of trophoblast giant cells,

reduced villous branching in the labyrinth, and widespread penetration of the

-/.
labyrinth by syncytiotrophoblasts. Due to these defects, Phd2 embryos

exhibit lethality on day E 12.5 [50]. The disruption of PHDZ led to the

upregulation of HlF1oc as well as HlF2a in the placenta and embryonic tissues

./- - -
[50]. Contrary to Phd2 mice, Vhl I mice exhibited more severe defects in

the placental development such as failure to develop syncytiotrophoblasts,
lack of invasion of maternal blood vessels leading to embryonic lethality at
£95 to E10.5 (stage of placental dysgenesis) [57, 58]. The roles of HIF1B
(ARNT) in the placental development were reported in three different studies
showing embryonic mortality at day E9.5 due to defective vascularization of
labyrinth of placenta and yolk sac, an increased number of trophoblast giant
cells and defective cell fate determination [54, 59-61]. These differences
suggest additional roles of PHD2 and VHL other than mediation of HIF

stabilization or additional mechanism of regulation of HIFs activity [57].

29

A detailed study on the effect of different allelic dosage combinations of

. +/- +/+ -/- +/+ +/- +/- -/-
eitheror both HlFoc(HIF1a l2a ,HlF1a /20L ,HIF10t /20t ,HIF10t

-/— +/+ +/- +/+ -/-
/20t , HlF1oc l2a , HIF1oc l2a ) on the placental development have

-/- -/-
been undertaken. HIF10t /2a mice showed absence of placental

vasculature, increase in trophoblastic giant cells, poor invasive efficiency and

defective placental structure thus representing phenocopy of ARNT deficient

-/-
mice [56]. The defective phenotype of HlF1cx were further aggravated by
deleting either or both alleles of HIF2a, which suggested that the phenotypes
among different dosage combinations showed allele-specificity. HIF10t-l- mice

exhibited defective chrioallantoic fusion with maternal lacunae and fewer and

-/-
defective placental vascularization that were normal in E 9.5 HIF2a embryos

[56]. These results suggest that hypoxia and its signaling is also important in

the embryonic development of organ systems.
4.E.2. Hypoxic regulation of organogenesis

It is clear from above studies that murine germ line inactivation of either
HIF1oc, HIF2a, ARNT, PHD2 or the VHL tumor suppressor results in

embryonic or perinatal lethality. To overcome embryonic lethality, conditional

30

alleles for HIF1a, HIF20L, ARNT and VHL have been generated that now allow
tissue and cell type specific knock down. Several murine knockouts of HIF,
pVHL, PHD, and VEGF have demonstrated the essential role of hypoxia-

responsive pathway proteins in organogenesis.

4.E.2.a. Vascular System

Embryonic vasculature development is a crucial process contributing to
the survival of the fetus and development of the other organ systems.
Disruption studies for different members of HIF signaling pathways have
contributed vastly towards our understanding of embryonic vascularization
events. Homozygous deficiency of ARNT leads to defective angiogenesis of
the yolk sac [61]. Homozygous deficiency of HlF2a in murine embryo results
in vascular disorganization in yolk sac and failure to assemble and maintain
vascular tubular structure and leading eventually to death between day E95
and E13.5 [62, 63]. Similarly, the HlF1oc knockout mouse displayed
disorganized yolk sac vascularization with disorganized branching pattern.
HlF1a deficient embryos exhibited only a few capillaries in the neural fold with
complete absence of vascular network and also reduced size of dorsal aorta
[64]. Current insights in to the role of different HlFs in the vascularization

clearly define the importance of oxygen tension, hypoxia and HIF signaling.

4.E.2.b. Cardiac System

31

The role of HIF signaling in cardiac development has been extensively
studied by various groups using systemic, as well as, tissue specific mice
models. Systemic HlF1a knockout mice display cardiac defects such as
myocardial hyperplasia, pericardial obliteration of ventricular lumen, increased

number of myocardial cells and cardia bifida (bilateral heart tubes that develop

+ -
in to two hearts) [64-67]. Inactivation of single allele of HlF1a (HlF1a I ) had

no observable developmental phenotype, however, further analysis of these

partially deficient adult mice revealed abnormal physiological responses to

+/-
chronic hypoxic exposures. As compared to control animals, HlF1a mice

exhibited impaired physiological responses to hypoxia such as weight loss,
polycythemia, right ventricular hypertrophy, pulmonary hypertension and
pulmonary vascular remodeling [68]. The cardiac myocytes specific HlF1oc
deletion do not exhibit any lethality phenotypes or abnormalities, however,
these mice exhibited physiological abnormalities in cardiac function,
vascularity, energy availability, and calcium handling even under nonnoxia
conditions, suggesting that HIF-1o coordinates gene expression at all oxygen

levels [69].

Although systemic HlF2a null progeny from congenic CS76BL/6J strain
failed to survive due to embryonic or perinatal lethality, progeny from isogenic

12986/SvaTac strain survived with multi-organ pathologies. The surviving

HlF2a./. progenies exhibited cardiac mitochondrial hypertrophy but no

32

hyperplasia. Cardiac myocytes from HlF2a+ mice contained many

degenerating mitochondria with intact inner mitochondrial membranes [70]. In
conclusion, deletion of hypoxia signaling proteins results in the defective

cardiac development and compromised functioning.

4.E.2.c. Lung

Lung morphogenesis proceeds in a consistently low p02 environment

characterized by shallow gradients of oxygen from the fetal vasculature into
the tissue mass. Several studies have demonstrated that the hypoxic

condition that a fetus faces is an important determinant in lung development.

It has been well documented that low fetal p02 serves to maintain epithelial

lumen fluid secretion and lung expansion [71]. Land et al. have shown that rat

lung explants display increased ainNay surface complexity (complex branching

pattern) at fetal p02 (23 mmHg) as compared to ambient (142 mmHg) steady-

state p02. The observed difference in branching pattern was confined

towards the periphery suggesting the hypoxia dependency of mesenchyme
differentiation and ainlvay bifurcation events [72]. Fisher et al. have
demonstrated that the ROS produced under hypoxic conditions interferes with
the ainNay branching morphogenesis, and N-acetylcysteine (antioxidant)

treatment afforded protection against hyperoxia [73]. Similarly, several other

33

 

studies have shown the consequences of redox modulation on ainlvay

morphogenesis [74, 75].

Hypoxia and HIF signaling pathway activation have been studied
through investigation of the spatial and temporal expression of HIFNEGF
pathway proteins in the developing human lung. Expression analysis of
staged human embryo at third trimester showed consistent HIF1or expression,
and there was no observable increase in the expression of proteins of HlF1a
degradation pathway [76]. This finding suggests the continually activated
hypoxia signaling in the post-placentation lung. HlF1a expression was
restricted to branching epithelium, whereas HlF2a appeared to be present in
the vascular structures as well as branching epithelium, reflectingtheir
different roles in pulmonary development. HIF1B was shown to be present in
the mesenchymal as well as epithelial structures, providing a basis for

downstream activation of both HlF1a and HIF20L [76].

All of the systemic knockout mice models for genes involved in the HIF
signaling die in utero from various defects in organogenesis. However, some
of the HlF2a knockout embryos that survived full term exhibited postnatal
respiratory distress due to insufficient surfactant production [77]. The
midgestational lethalities of the systemic knockout models has made it

challenging to study the role of HlFs in fetal lung development.

34

5. Hypoxia and its effects on the lung

Alveolar epithelial cells require normal oxygenation to run their high
energy demanding processes like surfactant biosynthesis, fluid uptake, and
maintenance of alveolocapillary barrier. Several clinical conditions involve
hypoxic challenge to the alveolar epithelial cells resulting in functional changes
[78]. Alveolar epithelial cells survive hypoxia through several adaptive
mechanisms like increased glycolysis, increased vasculogenesis,
downregulation of high energy consuming Na,K-ATPase activity and protein
synthesis. Alveolar edema clearance requires active Na,K-ATPase. Thus,
downregulation of this protein in hypoxia results in the altered fluid uptake and
edema clearance. The most well studied hypoxia-affected processes in
alveolar epithelium are the activity and maintenance of Na,K-ATPase and
amiloride-sensitive epithelial sodium channel (ENaC) pumps. Acute
hypoxemic respiratory failure is associated with the flooding of the alveolar
spaces with fluid and the resorption of this fluid into the interstitial and vascular
spaces depends on these two ion pumps. The amiloride-sensitive ENaC
pump actively uptakes sodium ions at the apical surface of alveolar epithelial
cells, whereas at the basolateral surface sodium ions are actively transported
against a gradient in exchange for potassium ions into the interstitium,
predominantly by Na,K—ATPase. The development of ion gradient due to the
movement of sodium ions results in the movement of water into the epithelial

cells and eventually in to the interstitium via aquaporins [79-82]. High-altitude

35

pulmonary edema (HAPE), a life-threatening condition characterized by
alveolar flooding that occurs in predisposed individuals at high altitudes, has

been linked to hypoxic pulmonary vasoconstriction [83].

A direct role of hypoxia in alveolar epithelium is not well characterized.

Hypoxia (1.5% 02 for 60 min) induced Na,K-ATPase trafficking out of the

plasma membrane into the intracellular membranes, which suggests a role for
hypoxia in the regulation of topological distribution of these pumps [84]. It has
also been shown that hypoxia downregulates plasma membrane specific
Na,K-ATPase activity without affecting the whole cell protein expression levels
[85]. These effects are observed under short-term severe hypoxic exposure
and are reversible. In contrast, prolonged hypoxic conditions results in

reduction in the cellular pool of Na,K-ATPase [78]. A549 cells exposed to

1.5% 02 for 2 hours displayed approximately a 50% loss of the plasma

+
membrane bound ATP-driven Na pumps. These findings suggest that the

cells undertake this adaptive strategy to save energy and reduce oxygen
consumption through the inhibition and/or degradation of energy consuming

metabolically active molecules [86].

6. Hypoxia Mimics and HIF signaling

36

HlFa stabilizers are also known as hypoxia mimics. Agents such as
metals (Ni(ll), Co(ll), Mn(ll), and V(V)), desferroxamine (DFO) and
dimethyloxallyl glycine (DMOG) are commonly studied hypoxia mimics. It has
been shown that cobalt can stabilize HlFa, and HlFa modulates cobalt
induced cell toxicity [87]. Additionally, occupational exposure of metals like
cobalt (Co(ll)) are known to cause lung injury. Hence, it is rational to use
cobalt-induced lung injury models to understand the role of HIF signaling in
various respiratory diseases involving hypoxia such as respiratory distress

syndrome, HAPE and COPD.

7. Metals

7.A. History of metals

It was in the new Stone Age that ancient man started using metal rich
rocks as weapons and tools. The Bronze Age (3000-1000 BC) began with the
advent of metallurgical technique of mixing tin ore with copper ore to produce
bronze. Bronze proved to be a very useful alloy in the production of new tools
for farming and hunting. It was not until the start of Iron Age (1500-800 BC)
that bronze was displaced as the most widely used metal and brought the
advent of the steel industry. The New Metal Age has also posed several
health concerns especially for the workers who are involved in mining and

metal industries [88-90].

37

7.B. Biological significance of metals

The metal’s property to donate its electrons to become cations and
hence, electrophiles, makes these cations an important component of the
active site of enzymes with redox reaction mechanisms. In addition, some
metal ions form an integral part of nonenzyme proteins including hemoglobin,
ferritin, ceruloplasmin, rubredoxin, cytochromes, and cyanocobalamin.
Proteins containing bound metal ions are referred as metalloproteins
(metalloenzymes). The metal ion forms coordinated bonds with nitrogen,
sulfur or oxygen atoms of amino acids in the polypeptide chain. Approximately
25-33% of proteins require metals for proper function or maintenance of
structural integrity. Metalloproteins such as cytochromes play important roles
in cellular energy production via their role in the electron transport chain
(ETC). In addition, metalloproteins play critical roles in processes such as
signal transduction (calmodulin), metabolism (cyanocobalamin), antioxidation
(superoxide dismutase), and transport (ceruloplasmin). Not all the metals are
biologically beneficial. Metals such as lead and mercury are toxic to the
cellular machinery. Another group of metals known as trace metals (Mn, Fe,
Co, Ni, Cu, Zn, and Cd), are required in minute concentrations for cellular

functions but at higher concentrations they pose health hazards .

7.C. Toxicity of Metals

38

Metals are probably the oldest known toxicants in human medicine. For many,
the mechanism of action that leads to toxicity is not well characterized for
many of them. Biogeological cycles and industrialization have redistributed
metals in the environment and lead to the appearance of new metals in the
food chain, soil, air, and water. When injected into the atmosphere, gaseous
or particulate metals may be transported to distant places [91]. The
toxicological effects of metals depend on the time, dose and route of exposure
[92]. Toxicities are further determined by other factors such as half-life in the
tissues (varies among tissues), valence state, and ligand binding. Hexavalent
chromium is highly toxic whereas its trivalent form functions as an essential
trace element. Finally, organometallic forms of some metals differ in their toxic
properties. For instance, non ionized alkyl compounds such as methyl
mercury Is a neurotoxin, whereas mercuric chloride is a nephrotoxic

compound [92].

A majority of transition metals are characterized as nonessential to the
cellular machinery and are toxic at minimal doses. The few, such as cobalt,
that are required for cellular functions, show toxic phenotypes at higher
concentrations. These toxic phenotypes fall under three categories:
disturbance of normal metal ion equilibrium, damage to biomolecules, and
alteration in gene expression patterns. Increased concentrations of divalent
cobalt interfere with iron metabolism and compete for the iron-binding site on

metalloproteins and metalloenzymes. Certain metal exposures result in

39

damage to biomolecules such as proteins and nucleic acids. Elements such
as As, Hg and Cd form covalent bonds with the —SH group of proteins. For
example, arsenic can inactivate the pyruvate dehydrogenase complex through
covalently binding to the -SH group of dihydrolipoic acid [93]. Some redox
active transition metals including cobalt generate reactive ROS that, in turn,

oxidize cellular proteins, nucleic acid and lipids [94, 95].

Metals regulate and alter the activity and/or stability of various metal-
responsive transcriptional factors that cause changes in the level of gene
expression and activate various signaling pathways. Metals and metal-
induced ROS generation have been demonstrated to affect a number of
receptors and genes, including growth factor receptors, src kinases, ras
signaling, mitogen-activated protein kinases, and nuclear transcription factors
such as NFKB, AP-1, p53, MTF-1, NFAT, and HIF-1 [96]. NFKB is an
important redox sensitive transcription factor that is affected by metal
exposure resulting in oxidative stress. It has been shown that divalent nickel
and cobalt exposure causes NFKB induced upregulation of adhesion
molecules ICAM-1, VCAM-1, and E-selectin in endothelial cells [97]. AP-1 is
another nuclear transcription factor that is stimulated by metal induced
oxidative stress. Arsenic(|l), vanadium(V), chromium(Vl), nickel(ll),
cadmium(ll), lead, cobalt, and iron are known to activate AP-1 in a variety of
cells [96]. Metallothioneins (MTs) are a class of cysteine-rich proteins that

play a critical roles in the heavy metal metabolism and detoxification. Metal-

40

induced expression of MTs depends on the zinc-finger transcription factor,
metal transcription factor-1 (MTF-1) which acts as a cellular stress-sensor
protein [98]. MTF-1 binding to the metal responsive element on the MTF-1
targeted genes is allosterically regulated by zinc leading to elevated MTs
expression [99, 100]. Certain metals such as Co(ll), Ni(ll), V(ll), Mn(ll) are

referred as “hypoxia mimics” due to their ability to stabilize HlFoc.

Cobalt has been known to induce the expression of erythropoietin and
thus this metal was used to treat anemia. [101, 102]. Cobalt also activates
angiogenic responses through VEGF expression [103]. These responses are
known to be mediated through HlFa stabilization. Several different
mechanisms have been proposed for the cobalt-mediated stabilization of
HlF1a however; the exact mechanism is still not well understood. It has been
shown that cobalt inhibits pVHL binding to the ODD domain of HIFot [104]. In
addition, cobalt-induced ROS generation leading to ferrous oxidation,
chelating of ascorbic acid and replacing non-covalently held iron atom from the
PHDs have also been suggested as mechanisms for the metal’s ability to

stabilize HIFa [105].

8. Cobalt

8.A. Occurrence and uses

Cobalt is a rare magnetic transition metal and falls in period four of the

periodic table with nickel, iron and manganese. It primarily occurs in nature as

41

oxides, arsenides and sulfides, and its cobaltous (Co(ll)) state is
predominantly used in the chemical industry [106, 107]. Historically, it has
been used as a dye in pottery, oil paints, high speed drills and cutting
machines as a component of hard metal (tungsten carbide (BO-95%) combined
with cobalt (5-20%) and nickel (0-5%)). In present industrial settings, it is
primarily used in the production of superalloys, corrosion resistant alloys, high
speed steels, batteries, magnets, wear resistant coatings and various
metallurgical applications [95]. Other industrial uses include diamond
polishing with cobalt containing disks, radioactive isotopes in medicine and the

production of drying agents, pigments, and catalysts [107].

SB. Cobalt metabolism and Exposure

Cobalt is an essential trace element for humans and is consumed as

cobalamin (essential component of vitamin B12). Cobalamin is required for

the production of red blood cells and the prevention of pernicious anemia. In
addition, cobalamin is also required in the methionine and nucleic acid
biosynthesis pathways. For the general population, diet is the main source of
exposure and the average daily dietary intake ranges from 5 to 45 pg. Major
dietary sources of cobalt are seafoods, bran, cocoa, and certain meats [108].

Generally, the concentration of cobalt in the drinking water is low (less than 5

rig/L) I107].

42

Cobalt salts are well absorbed in the jejunum and without significant
accumulations, 80% of ingested cobalt is excreted in the urine while 15 % is
excreted in feces via enterohepathic pathway. In the human body, the total
amount of cobalt is estimated to be approximately 1.1 mg. It has been shown
that muscles contain the largest fraction whereas its highest concentration is
found in fat tissues. The normal levels in human urine and blood are about 1.0

and 0.18 ug/L, respectively.

Cobalt is found to be present in urbanized air in the range between 0.5

to 60 ng/m3 [109]. Tobacco smoke contains 0.3-2.3 mg Co/kg dry weight,

which puts smokers at higher risk of cobalt-induced lung injury [110]. In
industrial settings, metal refinery workers and those involved in the production
of certain alloys, such as tungsten carbide, are at greatest risk for cobalt-

induced toxicity.
8.C. Cobalt toxicity

Despite its use for treatment of anemic patients, associated toxic effects
were reported to be goitrogenic due to hypothyroidism and thyroid hyperplasia
[111]. Epidemiological studies have shown an association between goiter
prevalence and the elevated cobalt levels in water and soil. Cobalt induced
cardiomyopathy was observed in brewery workers who consumed cobalt-

contaminated beer. Postmortem findings included pericardial effusion,

43

myofibrillar loss and congestive heart failure [112]. Excessive erythrocytosis
(polycythemia) has been reported in cobalt miners [113]. In humans,
gastrointestinal effects such as vomiting, diarrhea, liver injury and allergic

dermatitis were also reported in case of oral exposure to cobalt [114].

Acute inhalation exposure of cobalt in humans results in respiratory
problems such as congestion, edema, and hemorrhage of the lung. Chronic
exposure to cobalt through inhalation leads to respiratory irritation, coughing,
shortness of breath, wheezing, asthma, pneumonia, and fibrosis [107].
Inhalation exposure of hard metal workers has been shown to cause hard
metal lung disease that is interchangeably used in literature with cobalt lung,

hard metal asthma, and giant cell interstitial pneumonitis. Ambient

3
concentrations of 0.002 to 0.01 mg/m have been shown to cause respiratory

3
irritation, and higher concentrations (0.1 mg Co/m or higher) can cause hard

metal lung disease [92].

8D. The role of HIFs in cobalt-mediated toxicity

The role of hypoxia signaling in cobalt-induced cellular toxicities has
been studied in various in vitro models. Cobalt chloride induced toxicity has
been tested in mouse embryonic fibroblasts (MEFs) and the in vitro role of
HlF1a has already been established in cobalt-induced toxicity [87]. The

cobaltous chloride-induced oxidative stress mechanism has been investigated

44

in skeletal muscle cell lines, where exposure to CoCl2 resulted in elevated

intracellular oxidants, the accumulation of HlF1a protein, and the expression

of VEGF [115]. In addition, CoCl2-induced astrocyte toxicity is mediated

through HIF1a regulated apoptosis [116].

Hypothesis and Specific Aims

Cobalt exposure leads to pathological conditions such as airway
constriction, alveolitis, fibrosis and associated giant cell interstitial
pneumonitis. There is little known, however, about the role of hypoxia
signaling in these conditions. Several in vitro studies have shown that HlF1a
is an important mediator of the toxic responses observed upon cobalt
exposure. Previous studies in our lab, using an immortalized mouse

embryonic fibroblast (MEFs) cell line lacking HlF1o, established the correlation

between HIF1o removal and protection against CoCI2 toxicity. Validation of

our in vitro understanding of cobalt-induced HlFs signaling necessitates the in
vivo studies of cobalt toxicity in HlFs null animals. Based on these previous

findings, I propose the following hypothesis.

Hypothesis: Cobalt-induced lung toxicity is mediated by HIF stabilization
and transcription and the subsequent changes in inflammatory

mediators and cellular response.

45

Each of the chapters in this dissertation is dedicated to address following

specific aims.

Aim 1: Create and characterize a lung specific inducible HIF1q deficient
mouse model.

To validate in vitro data, a lung-specific inducible HIF1a deficient
mouse model was generated. The generated mice were characterized using
techniques such as histopathology, western blotting, real-time PCR and

electron microscopy.

Aim 2: Determine the role of HIF1ot in cobalt-induced lung injury in mice.
A postnatal strategy to delete HlF1oc from the lung epithelial cells was
adopted. HIF1a deficient mice were used to study the time-dependent

progression of cobalt-induced lung inflammation.

Aim 3: Create and characterize combined HIF1a and HIFZa lung specific
inducible knockout model (quadruple transgenic model).

To investigate the role of HIF20L in the lung development, another
prominent isoforrn of HlFa in lungs, lung-specific inducible HlF2a deficient
mice were generated. To further enhance our understanding of the collective

role of these two HIFs in lung development, mice with a lung-specific deletion

46

 

of HIF20 (termed HIFZGNA) and HIF1/20 (termed HIF1/20AM) were

generated.

Importance:

The findings from these studies will have a great impact on our current
understanding on the roles of HlF1o and HIF2a in the lung development. The
studies on cobalt exposures in HIF-deficient mice will provide a mechanistic
understanding on the roles of these transcription factors in airway

inflammatory responses.

47

 

 

 

REFERENCES

1

10

11

Wagner, P. D. (2008) The biology of oxygen. Eur Respir J. 31, 887-890

Bunn, H. F. and Poyton, R. O. (1996) Oxygen sensing and molecular
adaptation to hypoxia. Physiological reviews. 76, 839-885

Burri, P. H. (1984) Fetal and postnatal development of the lung. Annual
review of physiology. 46, 617-628

Alescio, T. and Cassini, A. (1962) Induction in vitro of tracheal buds by
pulmonary mesenchyme grafted on tracheal epithelium. The Journal of
experimental zoology. 150, 83-94

Wessells, N. K. (1970) Mammalian lung development: interactions in
formation and morphogenesis of tracheal buds. The Journal of
experimental zoology. 175, 455-466

Spooner, B. S. and Faubion, J. M. (1980) Collagen involvement in
branching morphogenesis of embryonic lung and salivary gland.
Developmental biology. 77, 84-102

Masters, J. R. (1976) Epithelial-mesenchymal interaction during lung
development: the effect of mesenchymal mass. Developmental biology.
51, 98-108

Bucher, U. and Reid, L. (1961) Development of the mucus-secreting
elements in human lung. Thorax. 16, 219-225

Kauffman, S. L. (1980) Cell proliferation in the mammalian lung.
lntemational review of experimental pathology. 22, 131 -1 91

Crapo, J. 0., Barry, B. E., Foscue, H. A. and Shelbume, J. (1980)
Structural and biochemical changes in rat lungs occurring during
exposures to lethal and adaptive doses of oxygen. The American
review of respiratory disease. 122, 123-143

Evans, M. J., Cabral-Anderson, L. J. and Freeman, G. (1978) Role of
the Clara cell in renewal of the bronchiolar epithelium. Laboratory

48

12

13

14

15

16

17

18

19

20

21

investigation; a journal of technical methods and pathology. 38, 648-
653

Davies, G. and Reid, L. (1970) Growth of the alveoli and pulmonary
arteries in childhood. Thorax. 25, 669-681

Burri, P. H. (1974) The postnatal growth of the rat lung. 3. Morphology.
The Anatomical record. 180, 77-98

Burri, P. H., Dbaly, J. and Weibel, E. R. (1974) The postnatal growth of
the rat lung. l. Morphometry. The Anatomical record. 178, 711-730

Ji, C. M., et al. (1995) Pulmonary cytochrome P-450 monooxygenase
system and Clara cell differentiation in rats. Am J Physiol. 269, L394-
402

Mason, R. J. (1987) Surfactant synthesis, secretion, and function in
alveoli and small ainrvays. Review of the physiologic basis for
pharrnacologic intervention. Respiration; international review of thoracic
diseases. 51 Suppl 1, 3-9

Hong, K. U., et al. (2004) Basal cells are a multipotent progenitor
capable of renewing the bronchial epithelium. The American journal of
pathology. 164, 577-588

Nettesheim, P., et al. (1990) Pathways of differentiation of ainlvay
epithelial cells. Environmental health perspectives. 85, 317-329

Park, K. S., et al. (2006) Transdifferentiation of ciliated cells during
repair of the respiratory epithelium. American journal of respiratory cell
and molecular biology. 34, 151-157

Stripp, B. R. and Reynolds, S. D. (2008) Maintenance and repair of the
bronchiolar epithelium. Proceedings of the American Thoracic Society.
5, 328-333

Richard Harding, K. P., Charles Plopper. (2004) The Lung:
Development, Aging and The Environment. Academic Press

49

22

23

24

25

26

27

28

29

30

31

32

Jiang, J., et al. (1996) Measurement of P02 in liver using EPR oximetry.
J Appl Physiol. 80, 552-558

Scheufler, K. M. (2004) Tissue oxygenation and capacity to deliver 02
do the two go together? Transfus Apher Sci. 31, 45-54

Lee, Y. M., et al. (2001) Determination of hypoxic region by hypoxia
marker in developing mouse embryos in vivo: a possible signal for
vessel development. Dev Dyn. 220, 175-186

Land, 8. C. (2003) Oxygen-sensing pathways and the development of
mammalian gas exchange. Redox Rep. 8, 325-340

Cartwright, J. E., Keogh, R. J. and Tissot van Patot, M. C. (2007)
Hypoxia and placental remodelling. Advances in experimental medicine
and biology. 618, 113-126

Guzman, G. J., Cueto, A. H. and Yepez, S. H. (2008) Contribution of
hypoxia in pulmonary tissue remodeling in asthmatic processes. Rev
Alerg Mex. 55, 18-32

Fajardo, I., Svensson, L., Bucht, A. and Pejler, G. (2004) Increased
levels of hypoxia-sensitive proteins in allergic ainrvay inflammation.
American journal of respiratory and critical care medicine. 170, 477-484

Michiels, C. (2004) Physiological and pathological responses to
hypoxia. The American journal of pathology. 164, 1875-1882

Bartrons, R. and Caro, J. (2007) l-lypoxia, glucose metabolism and the
Warburg's effect. Journal of bioenergetics and biomembranes. 39, 223-
229

Hardie, D. G. and Hawley, S. A. (2001) AMP-activated protein kinase:
the energy charge hypothesis revisited. Bioessays. 23, 1112-1119

Rolfe, D. F. and Brown, G. C. (1997) Cellular energy utilization and
molecular origin of standard metabolic rate in mammals. Physiological
reviews. 77, 731-758

50

33

34

35

36

37

38

39

40

41

42

Buttgereit, F. and Brand, M. D. (1995) A hierarchy of ATP-consuming
processes in mammalian cells. The Biochemical journal. 312 ( Pt 1),
163-167

Cummins, E. P. and Taylor, C. T. (2005) Hypoxia-responsive
transcription factors. Pflugers Arch. 450, 363-371

Wang, G. L., Jiang, B. H., Rue, E. A. and Semenza, G. L. (1995)
Hypoxia-inducible factor 1 is a basic-helix-loop-helix-PAS heterodimer
regulated by cellular O2 tension. Proceedings of the National Academy
of Sciences of the United States of America. 92, 5510-5514

Semenza, G. L., et al. (1997) Structural and functional analysis of
hypoxia-inducible factor 1. Kidney lntemational. 51, 553-555

Weidemann, A. and Johnson, R. S. (2008) Biology of HIF-1alpha. Cell
death and differentiation. 15, 621-627

Kaelin, W. 6., Jr. and Ratcliffe, P. J. (2008) Oxygen sensing by
metazoans: the central role of the HIF hydroxylase pathway. Molecular
cell. 30, 393-402

del Peso, L., et al. (2003) The von Hippel Lindau/hypoxia-inducible
factor (HIF) pathway regulates the transcription of the HIF-proline
hydroxylase genes in response to low oxygen. The Journal of biological
chemistry. 278, 48690-48695

Epstein, A. C., et al. (2001) C. elegans EGL-9 and mammalian
homologs define a family of dioxygenases that regulate HIF by prolyl
hydroxylation. Cell. 107, 43-54

Cockman, M. E., et al. (2000) Hypoxia inducible factor-alpha binding
and ubiquitylation by the von Hippel-Lindau tumor suppressor protein.
The Journal of biological chemistry. 275, 25733-25741

Groenman, F. A., et al. (2007) Effect of chemical stabilizers of hypoxia-
inducible factors on early lung development. Am J Physiol Lung Cell
Mol Physiol. 293, L557-567

51

43

44

45

46

47

48

49

50

51

52

Manalo, D. J., et al. (2005) Transcriptional regulation of vascular
endothelial cell responses to hypoxia by HIF-1. Blood. 105, 659-669

Chowdhury, R., Hardy, A. and Schofield, C. J. (2008) The human
oxygen sensing machinery and its manipulation. Chemical Society
reviews. 37, 1308-1319

Wenger, R. H. (2002) Cellular adaptation to hypoxia: OZ-sensing
protein hydroxylases, hypoxia-inducible transcription factors, and 02-
regulated gene expression. Faseb J. 16, 1151-1162

Wenger, R. H. (2000) Mammalian oxygen sensing, signalling and gene
regulation. The Journal of experimental biology. 203, 1253-1263

Rocha, S. (2007) Gene regulation under low oxygen: holding your
breath for transcription. Trends in biochemical sciences. 32, 389-397

Land, S. C. (2004) Hochachka's "Hypoxia Defense Strategies” and the
develOpment of the pathway for oxygen. Comparative biochemistry and
physiology. 139, 41 5-433

Caniggia, I., et al. (2000) Hypoxia-inducible factor-1 mediates the
biological effects of oxygen on human trophoblast differentiation
through TGFbeta(3). The Journal of clinical investigation. 105, 577-587

Takeda, K., et al. (2006) Placental but not heart defects are associated
with elevated hypoxia-inducible factor alpha levels in mice lacking prolyl
hydroxylase domain protein 2. Molecular and cellular biology. 26, 8336-
8346

Rodesch, F., Simon, P., Donner, C. and Jauniaux, E. (1992) Oxygen
measurements in endometrial and trophoblastic tissues during early
pregnancy. Obstetrics and gynecology. 80, 283-285

Cowden Dahl, K. D., et al. (2005) Hypoxia-inducible factors 1alpha and
2alpha regulate trophoblast differentiation. Molecular and cellular
biology. 25, 1 0479-1 0491

52

53

54

55

56

57

58

59

60

61

62

Fryer, B. H. and Simon, M. C. (2006) Hypoxia, HIF and the placenta.
Cell cycle (Georgetown, Tex. 5, 495-498

Adelman, D. M., et al. (2000) Placental cell fates are regulated in vivo
by HIF-mediated hypoxia responses. Genes & development. 14, 3191-
3203

Schaffer, L., et al. (2003) Oxygen-regulated expression of TGF-beta 3,
a growth factor involved in trophoblast differentiation. Placenta. 24, 941-
950

Cowden Dahl, K. D., et al. (2005) Hypoxia-inducible factors 1 alpha and
2 alpha regulate trophoblast differentiation. Molecular and cellular
biology. 25, 10479-10491

Gnarra, J. R., et al. (1997) Defective placental vasculogenesis causes
embryonic lethality in VHL-deficient mice. Proceedings of the Natibnal
Academy of Sciences of the United States of America. 94, 9102-9107

Tang, N., et al. (2006) pVHL function is essential for endothelial
extracellular matrix deposition. Molecular and cellular biology. 26, 2519-
2530

Kozak, K. R., Abbott, B. and Hankinson, O. (1997) ARNT-deficient mice
and placental differentiation. Developmental biology. 191, 297-305

Abbott, B. D. and Buckalew, A. R. (2000) Placental defects in ARNT-
knockout conceptus correlate with localized decreases in VEGF-R2,
Ang-1, and Tie-2. Dev Dyn. 219, 526-538

Maltepe, E., et al. (1997) Abnormal angiogenesis and responses to
glucose and oxygen deprivation in mice lacking the protein ARNT.
Nature. 386, 403-407

Peng, J., Zhang, L., Drysdale, L. and Fong, G. H. (2000) The
transcription factor EPAS-1/hypoxia-inducible factor 2alpha plays an
important role in vascular remodeling. Proceedings of the National
Academy of Sciences of the United States of America. 97, 8386-8391

53

63

64

65

66

67

68

69

70

71

72

Patel, S. A. and Simon, M. C. (2008) Biology of hypoxia-inducible
factor-2alpha in development and disease. Cell death and
differentiation. 15, 628-634

Ryan, H. E., Lo, J. and Johnson, R. S. (1998) HIF-1 alpha is required
for solid tumor formation and embryonic vascularization. The EMBO
journal. 17, 3005-3015

Semenza, G. L. (2006) Regulation of physiological responses to
continuous and intermittent hypoxia by hypoxia-inducible factor 1.
Experimental physiology. 91, 803-806

lyer, N. V., et al. (1998) Cellular and developmental control of 02
homeostasis by hypoxia-inducible factor 1 alpha. Genes &
development. 12, 149-162

Compemolle, V., et al. (2003) Cardia bifida, defective heart
development and abnormal neural crest migration in embryos lacking
hypoxia-inducible factor-1 alpha. Cardiovascular research. 60, 569-579

Yu, A. Y., et al. (1999) Impaired physiological responses to chronic
hypoxia in mice partially deficient for hypoxia-inducible factor 1alpha.
The Journal of clinical investigation. 103, 691-696

Huang, Y., et al. (2004) Cardiac myocyte-specific HIF-1 alpha deletion
alters vascularization, energy availability, calcium flux, and contractility
in the normoxic heart. Faseb J. 18, 1138-1140

Scortegagna, M., et al. (2003) Multiple organ pathology. metabolic
abnormalities and impaired homeostasis of reactive oxygen species in
Epas1-l- mice. Nature genetics. 35, 331-340

Baines, D. L., et al. (2001) Oxygen-evoked Na-I- transport in rat fetal
distal lung epithelial cells. The Journal of physiology. 532, 105—1 13

Land, S. C. and Darakhshan, F. (2004) Thymulin evokes lL-6-
C/EBPbeta regenerative repair and TNF-alpha silencing during
endotoxin exposure in fetal lung explants. Am J Physiol Lung Cell Mol
Physiol. 286, L473-487

54

73

74

75

76

77

78

79

80

81

82

Fisher, J. C., Kling, D. E., Kinane, T. B. and Schnitzer, J. J. (2002)
Oxidation-reduction (redox) controls fetal hypoplastic lung growth. The
Journal of surgical research. 106, 287-291

Kramer, B. W., Kramer, S., lkegami, M. and Jobe, A. H. (2002) Injury,
inflammation, and remodeling in fetal sheep lung after intra-amniotic
endotoxin. Am J Physiol Lung Cell Mol Physiol. 283, L452-459

Young, S. L., Evans, K. and Eu, J. P. (2002) Nitric oxide modulates
branching morphogenesis in fetal rat lung explants. Am J Physiol Lung
Cell Mol Physiol. 282, L379-385

Groenman, F., et al. (2007) Hypoxia-inducible factors in the first
trimester human lung. J Histochem Cytochem. 55, 355-363

Compemolle, V., et al. (2002) Loss of HIF-2alpha and inhibition of
VEGF impair fetal lung maturation, whereas treatment with VEGF

prevents fatal respiratory distress in premature mice. Nature medicine.
8, 702-710

Jain, M. and Sznajder, J. l. (2005) Effects of hypoxia on the alveolar
epithelium. Proceedings of the American Thoracic Society. 2, 202-205

Matthay, M. A., Robriquet, L. and Fang, X. (2005) Alveolar epithelium:
role in lung fluid balance and acute lung injury. Proceedings of the
American Thoracic Society. 2, 206-213

Matthay, M. A., Folkesson, H. G. and Verkman, A. S. (1996) Salt and
water transport across alveolar and distal ainrvay epithelia in the adult
lung. Am J Physiol. 270, L487-503

Canessa, C. M., et al. (1994) Amiloride-sensitive epithelial Na+ channel
is made of three homologous subunits. Nature. 367, 463-467

McCann, J. D. and Welsh, M. J. (1990) Basolateral K+ channels in
airway epithelia. ll. Role in Cl- secretion and evidence for two types of
K+ channel. Am J Physiol. 258, L343-348

55

 

83

84

85

86

87

88

89

90

91

92

 

 

Scherrer, U., et al. (1999) High-altitude pulmonary edema: from
exaggerated pulmonary hypertension to a defect in transepithelial
sodium transport. Advances in experimental medicine and biology. 474,
93-107

Dada, L. A., et al. (2003) Hypoxia-induced endocytosis of Na,K-ATPase
in alveolar epithelial cells is mediated by mitochondrial reactive oxygen
species and PKC-zeta. The Journal of clinical investigation. 111, 1057-
1064

Carpenter, T. C., et al. (2003) Hypoxia reversibly inhibits epithelial
sodium transport but does not inhibit lung ENaC or Na-K-ATPase
expression. Am J Physiol Lung Cell Mol Physiol. 284, L77-83

Comellas, A. P., et al. (2006) Hypoxia-mediated degradation of Na,K-
ATPase via mitochondrial reactive oxygen species and the ubiquitin-
conjugating system. Circulation research. 98, 1314-1322

Vengellur, A. and LaPres, J. J. (2004) The role of hypoxia inducible
factor 1alpha in cobalt chloride induced cell death in mouse embryonic
fibroblasts. Toxicol Sci. 82, 638-646

Chandler, H. (1998) Metallurgy for the Non-Metallurgist. ASM
lntemational

Gunnar F. Nordberg, B. A. F., Monica Nordberg, Lars Friberg (2007)
Handbook of the Toxicology of Metals Academic Press

Nordberg, G. (2007) Handbook on the toxicology of metals. Academic
Press, Amsterdam ; Boston

Morel, F. M. and Price, N. M. (2003) The biogeochemical cycles of
trace metals in the oceans. Science (New York, NY. 300, 944-947

Casarett, L. J., Doull, J. and Klaassen, C. D. (2008) Casarett and
Doull's toxicology : the basic science of poisons. McGraw-Hill, New
York

56

93

94

95

96

97

98

99

100

101

102

Hu, Y., Su, L. and Snow, E. T. (1998) Arsenic toxicity is enzyme
specific and its affects on ligation are not caused by the direct inhibition
of DNA repair enzymes. Mutation research. 408, 203-218

Stohs, S. J. and Bagchi, D. (1995) Oxidative mechanisms in the toxicity
of metal ions. Free radical biology & medicine. 18, 321-336

Vengellur, A. (2007) The role of HlF1[alpha] signalling in metal-induced
toxicity. ed.)"eds.). pp. xiii, 227 leaves, Michigan State University.
Dept. of Genetics, 2007.

Leonard, S. 8., Harris, G. K. and Shi, X. (2004) Metal-induced oxidative
stress and signal transduction. Free radical biology & medicine. 37,
1921-1942

Goebeler, M., et al. (1995) Activation of nuclear factor-kappa B and
gene expression in human endothelial cells by the common haptens
nickel and cobalt. J Immunol. 155, 2459-2467

Lichtlen, P. and Schaffner, W. (2001) The "metal transcription factor”
MTF-1: biological facts and medical implications. Swiss Med Wkly. 131,
647-652

Westin, G. and Schaffner, W. (1988) A zinc-responsive factor interacts
with a metal-regulated enhancer element (MRE) of the mouse
metallothionein-l gene. The EMBO journal. 7, 3763-3770

Heuchel, R., et al. (1994) The transcription factor MTF-1 is essential for
basal and heavy metal-induced metallothionein gene expression. The
EMBO journal. 13, 2870-2875

Goldwasser, E., Jacobson, L. 0., Fried, W. and Plzak, L. (1957)
Mechanism of the erythropoietic effect of cobalt. Science (New York,
NY 125, 1085-1086

Goldberg, M. A., Dunning, S. P. and Bunn, H. F. (1988) Regulation of
the erythropoietin gene: evidence that the oxygen sensor is a heme
protein. Science (New York, NY. 242, 1412-1415

57

103

104

105

106

107

108

109

110

111

112

Ladoux, A. and Frelin, C. (1994) Cobalt stimulates the expression of
vascular endothelial growth factor mRNA in rat cardiac cells.
Biochemical and biophysical research communications. 204, 794-798

Yuan, Y., Hilliard, G., Ferguson, T. and Millhom, D. E. (2003) Cobalt
inhibits the interaction between hypoxia-inducible factor-alpha and von
Hippel-Lindau protein by direct binding to hypoxia-inducible factor-
alpha. The Journal of biological chemistry. 278, 15911-15916

Salnikow, K., et al. (2004) Depletion of intracellular ascorbate by the
carcinogenic metals nickel and cobalt results in the induction of hypoxic
stress. The Journal of biological chemistry. 279, 40337-40344

Malard, V., et al. (2007) Global gene expression profiling in human lung
cells exposed to cobalt. BMC genomics. 8, 147

Barceloux, D. G. (1999) Cobalt. Journal of toxicology. 37, 201 -206

Cobb, A. G. and Schmalzreid, T. P. (2006) The clinical significance of
metal ion release from cobalt-chromium metal-on-metal hip joint
arthroplasty. Proceedings of the Institution of Mechanical Engineers.
220, 385-398

Morgan, G. B., Ozolins, G. and Tabor, E. C. (1970) Air pollution
surveillance systems. Science (New York, NY. 170, 289-296

Wehner, A. P., Busch, R. H., Olson, R. J. and Craig, D. K. (1977)
Chronic inhalation of cobalt oxide and cigarette smoke by hamsters.
American Industrial Hygiene Association journal. 38, 338-346

Kriss, J. P., Carnes, W. H. and Gross, R. T. (1955) Hypothyroidism and
thyroid hyperplasia in patients treated with cobalt. Journal of the
American Medical Association. 157, 117-121

Centeno, J. A., Pestaner, J. P., Mullick, F. G. and Virmani, R. (1996) An
analytical comparison of cobalt cardiomyopathy and idiopathic dilated
cardiomyopathy. Biological trace element research. 55, 21-30

58

113

114

115

116

Jefferson, J. A., et al. (2002) Excessive erythrocytosis, chronic
mountain sickness, and serum cobalt levels. Lancet. 359, 407-408

Lauwerys, R. and Lison, D. (1994) Health risks associated with cobalt
exposure--an overview. The Science of the total environment. 150, 1-6

Ciafre, S. A., et al. (2007) CoCI(2)-simulated hypoxia in skeletal muscle
cell lines: Role of free radicals in gene up-regulation and induction of
apoptosis. Free radical research. 41, 391-401

Karovic, 0., et al. (2007) Toxic effects of cobalt in primary cultures of
mouse astrocytes. Similarities with hypoxia and role of HIF-1alpha.
Biochemical pharmacology. 73, 694-708

59

Chapter 2

HlF1a ls essential for normal intrauterine differentiation of alveolar
epithelium and surfactant production in the newborn lung of mice

This chapter is the edited version of a research article that was published in
The Journal of Biological Chemistry, Volume 283, No. 48 (33650-33657),

November 28, 2008.

Authors: Yogesh Saini, Jack R. Harkema and John J. LaPres.

60

Abstract

Neonatal respiratory distress syndrome (RDS) is mainly the result of
perturbation in surfactant production and is a common complication seen in
premature infants. Normal fetal lung development and alveolar cell
differentiation is regulated by a network of transcription factors. Functional
loss of any of these factors will alter the developmental program and impact
surfactant production and normal gas exchange. During development, the
fetus is exposed to varying oxygen concentrations and must be able to quickly
adapt to these changes in order to survive. Hypoxia-inducible factor 1a
(HlF10t) is the primary transcription factor that is responsible for regulating the
cellular response to changes in oxygen tension and is essential for normal
development. Its role in lung maturation is not well defined and to address this
knowledge gap, a lung-specific HlF1oc knockout model has been developed.
Loss of HIF1oz early in lung development elads to pups that die within hours of
parturition, exhibiting symptoms similar to RDS. Lungs from these pups
display impaired alveolar epithelial differentiation and an almost complete loss
of surfactant protein expression. Ultrastructural analysis of lungs from HIF1a
deleted pups had high levels of glycogen, aberrant septal development, and
changes in several factors necessary for proper lung development, including
HlF20t, B—catenin and vascular endothelial growth factor. These results
suggest that HIF1oc is essential for proper lung maturation and alteration in its
normal signaling during premature delivery might explain the pathophysiology

of neonatal RDS.

61

Introduction

During development an embryo is exposed to varying levels of oxygen as a
balance is created between vascularization and tissue growth. Localized
hypoxia, a decrease in available oxygen, is a normal part of this process. The
programmed responses to these decreases in available oxygen are essential
for viability [1, 2]. In utero, the embryo is supplied with oxygen and nutrients
through the placental barrier. Following parturition, oxygen is supplied by the
neonatal lungs and therefore, proper intrauterine development of the alveolar
gas exchange regions of the lung is essential for the newbom’s first breath

and for sustaining life outside the womb [3].

Lung morphogenesis is a complex process that is orchestrated by several
transcription factors, growth factors, and extracellular cues [4]. For example,
thyroid transcription factor-1 regulates the expression of the genes for Clara
cell secretory protein (CCSP) produced in Clara cells in the tracheobronchial
ainrvays and various surfactants produced by alveolar type II cells in the lung
parenchyma [5, 6]. CCAAT-enhancer binding protein a (CEBPa) is essential
for proper regulation of alveolar Type ll cell differentiation, and Forkhead box
A2 (Foxa2) controls various cellular programs involved in lung development
(eg. surfactant expression) (6-8). Ablation of any of these factors results in
major structural and functional abnormalities ranging from undeveloped
alveolar structure and/or improper ainNay branching to the faulty processing of

various secretory components [7, 8]. One of the extracellular cues that is

62

important for fetal vascular growth and lung morphogenesis is the
physiologically low 02 environment of the fetus. The ability to cope with this
developmental “hypoxia” is not only important for lung maturation but essential
for the viability of the fetus [1 , 2].

Cellular responses to decreased oxygen availability are regulated by a
family of proteins called hypoxia-inducible factors (HIFs). The ability of HIFs to
respond to hypoxia is controlled by oxygen-dependent post-translational
hydroxylation. The prolyl hydroxylases, PHDs, modify HIFs on essential
residues in an oxygen-, iron- and a—ketoglutarate-dependent manner. Once
hydroxylated, the HIF is quickly degraded in a proteasomal-dependent
process that involves the Von Hippel Lindau (VHL) tumor suppressor. HIF1a,
the most ubiquitously expressed HIF, has been shown to play a critical role in
normal development. HIF1oc regulates the expression of genes important for
cellular adaptation to hypoxia, including glycolytic enzymes and angiogenic
factors [9]. Gene deletion studies have established that HIF1a is

indispensable during fetal development as

HlF1oc_/- mice die at midgestation, in association with defects in VEGF

+ _
expression and vascularization [10-12]. In addition, HIF1 I mice developed

pulmonary hypertension and pulmonary vascular remodeling under hypoxic
conditions [13]. PHD inhibitor-induced HIF stabilization has been shown to
improve lung growth in prematurely born baboon neonates, predominantly

through enhanced expression of VEGF [14]. Finally, loss of HIF2a has been

63

shown to perturb normal lung development through loss of VEGF expression
and to subsequently decrease alveolar type II cell production of pulmonary
surfactants [15].

Previous studies using systemic HlF1a deletions have demonstrated its
central role in development and partial HlF1a deletions resulted in disrupted
normal functioning of tissues such as heart and lung [13, 16, 17]. The present
study was aimed at elucidating the role(s) of HIF1a in the in utero

differentiation of the alveolar epithelium. To this aim, mice with a lung—specific

A/A
deletion of HlF1oc (termed l-llF1c1 ) were generated. Lung specific

embryonic deletion of HIF1o earlier than 3 days prior to parturition led to

HIF1dA/Aneonates exhibiting cyanosis and respiratory failure soon after birth.

NA
The expression of surfactant proteins was significantly lower in HIF1o pups
as compared to litterrnate control pups. Examination of the lungs from
A/A . . . . .
HlF1o pups vra light and transmussron electron microscopy confirmed
defects in both alveolar epithelial differentiation and septal development that

resulted in the observed respiratory distress.

Material and methods

fl -
Transgenic mice and genotyping: HlF1oc ox/flox and SP-C-rtTA ltg/(tetO)7-

tg/tg

CMV-Cre transgenic mice were generous gifts of Randall Johnson

(UCSD) and Jefferey Whitsett (Cincinnati Children's Hospital Medical Center),

64

respectively [10, 17-19]. HlFmflox/flox mice were mated to SP-C-rtTA-ltg/

(tetO)7-CMV-Cretglt9 transgenic mice to generate SP-C-rtTA-ltg/(tetOh-CMV-

fl x/fl
Cretg/tg/HIFm o ox mice line capable of respiratory epithelium specific

conditional recombination in the floxed HlF1oc gene. In this model, depending

on the day doxycycline is administered to the darn, various cell populations

fl fl
within the lung undergo recombination in HIF10t ox/ ox alleles (20).

Genotyping screening of the mice progeny was performed by PCR for all the
three loci using previously published primer sequences (Table 1). Genomic
DNA extraction from tail clipping was performed using Direct PCR extraction
system (Viagen Biotech, CA) via manufacturer's instructions. PCR conditions
were standardized for all the three alleles: denaturation at 94°C for 3 min; 38
cycles of denaturation at 940 for 45 sec, annealing at 60'C for 45 sec and
polymerization at 72°C for 60 sec. followed by a 7 min extension at 720. Size

of the amplified products obtained were approx 210 bp for HlF1a (wild type);

fl x/fl
244bp for HIF1oc O 0X; 370 for Cre transgene; 350 for rtTA transgene (Fig.

1B).

Doxycycline treatment and animal husbandry: Dams bearing triple (SP-C-

rtTA'ltgltteto)7-CMV-Cret9/t9/HIF1JIM/fl”) and double ((tetO)7-CMV-

fl x/fl
Cretg/tg/HlFm 0 OX) transgenic embryos were maintained on doxycycline

65

feed (625 mg doxycycline/Kg; Harlan Teklad, Madison, WI) and drinking water
(0.8 mg/ml: Sigma chemicals Co.). The day of parturition was taken as

reference point to calculate the duration of doxycycline exposure. Control and

NA
HlF1o pups exposed to doxycycline treatment for 0 to14 Days in utero were

sacked within one hour of parturition. All pups were sacrificed by decapitation.
Mice used in this study were kept at the animal housing facility under the strict
hygienic and pathogen free conditions approved by the university laboratory

animal resource (ULAR) regulatory unit.

Lungs harvesting and processing: 3-8 pups were analyzed from each
genotype and doxycycline treatment. Pups were assessed for total body and
lung weight. Lung tissues were isolated and left lung lobe was fixed in 10%
neutral buffered formalin (NBF) or 4% glutaraldehyde for morphological
analysis. The remaining lung tissue was divided; half was snap frozen for
Western blotting, half was stored in RNA/ater RNA Stabilization Reagent

(Qiagen) for RNA isolation and qRT—PCR analysis.

Western blotting: Snap frozen lung tissue (10 mg) was lysed and
homogenized in RIPA buffer (50 mM Tris HCI, 1% NP-40, 0.25% sodium
deoxycholate, 150 mM NaCI, 1 mM each of EDTA, PMSF, sodium vandate,
sodium fluoride, 1 M DT‘I') containing protease inhibitors (1ug/ml each of
aprotinin, leupeptin, pepstatin) using a bead beater system (45 seconds at 30

Hz frequency). Insoluble material was removed by centrifugation (10,000 x g

66

for 10 min.) and protein concentration was measured in supernatant using
Bradford protein assay [20]. Protein samples (30 pg) were separated by SDS-
PAGE (NuPage 4-12% Bis-Tris gradient gel, lnvitrogen, CA) and transferred to
a nitrocellulose membrane. Western blots were performed with rabbit or goat
antibodies against surfactant associated proteins (SP-A (sc 13977, Santa
Cruz, CA), SP-B (AB 3780, Chemicon), SP-C (so-13979, Santa Cruz, CA) and
SP-D (SC 7709, Santa Cruz, CA), and B—actin (loading control; SC-7210,
Santa Cruz, CA). Proteins were visualized with HRP-conjugated goat anti-
rabbit lgG (SC-2004, Santa Cruz, CA) or rabbit anti-goat (sc-2768, Santa Cruz,

CA) and ECL western blot system (Pierce, USA).

Histopathology and immunohistochemistry: At least four to six pups of
each genotype and doxycycline treatment were analyzed for histopathological
changes. Fon'nalin fixed left lung lobe tissues were paraffin embedded and 5-
micron thick sections were mounted on glass slides and stained with
hematoxylin and eosin (H&E), periodic acid Schiff (PAS), or immunostained
with SP-B (1: 500 dilution, A33780, Chemicon, MA), SP-C (1:4000 dilution,
antibody kindly provided by Jeffrey Whitsett) and CRE (1:100 dilution,
AB24608; Abcam, Cambridge, MA). Briefly, tissue sections were
deparaffinized and endogenous peroxidase activity was quenched by
incubation with 6% H202 for 30 min. Immunostaining was performed using
Rabbit Vector Elite ABC kit (Vector Laboratories, CA), according to the

manufacturer's recommendations.

67

Transmission electron microscopy: Neonatal lung sections were fixed in
4% buffered glutaraldehyde overnight at 4°C, stored in the 10% NBF fixative
until postfixation with 1% phosphate-buffered osmium tetroxide. Tissues were
dehydrated through a graded series of ethanol and propylene oxide, and
embedded in Poly/Bed-Araldite resin (Polysciences, lnc., Warrington, PA).
One pm-thick sections were cut and stained with toluidine blue for light
microscopic identification of specific tissue sites for transmission electron
microscopy (TEM). Ultrathin tissue sections for TEM were cut at
approximately 75 nm and stained with lead citrate and uranyl acetate.
Sectioning was performed with an LKB Ultratome III (LKB Instruments, Inc.,
Rockville, MD). Ultrastructural tissue examination and photography were
performed with a JEOL JEM 1OOCXII electron microscope (JEOL Ltd., Tokyo,

Japan)

RNA isolation and real-time PCR analysis: 10 mg lung tissue stored in
RNA/afar RNA Stabilization Reagent was homogenized in RLT buffer (RNeasy
RNA isolation Kit, Qiagen, Maryland) using a Retsch MM200 bead beater
system (Retsch, Haan, Germany). Total RNA quantification was performed
spectrophotometrically (NanoDrop ND-1000 UV-Vis Spectrophotometer).
Total RNA (1 pg) was reverse transcribed using superscript |I reverse
transcriptase kit (lnvitrogen, CA). Expression level of selected genes involved
in surfactant metabolism and lung development were analyzed by Real-Time

PCR using SYBR green (Applied Biosystems, Foster City, CA) as previously

68

described [21]. Gene specific primers are listed Table 2. Copy number was
determined by comparison with standard curves of the respective genes. This
measurement was controlled for RNA quality, quantity, and RT efficiency by
normalizing it to the expression level of the hypoxanthine guanine
phosphoribosyl transferase (HGPRT) gene. Statistical significance was

determined by use of normalized relative changes and ANOVA.

Quantitative analysis: qRT-PCR analysis was performed using unpaired two-
tailed Student's t-test on GraphPad Prism. Results were considered significant

at the 5% level.

Results

Conditional inactivation of HIF1a in the lung:

The HIF1a gene was inactivated in the lung by mating HIF1a conditional

fl fl
null mice (HIF1o ox/ ox) [10] to an inducible bitransgenic mouse, SPC-rtTA,

that expresses the reverse tetracycline transactivator (rtTA) under the control
of the human surfactant protein C (SP-C) promoter and the Cre recombinase
gene with a tetracycline operon (Fig. 2.1A) [18]. SPC-rtTA mice have been
shown to express Cre recombinase specifically in the epithelial cells of the
primordial lung buds as well as in the alveolar and bronchiolar epithelium of
postnatal mice in the presence of an inducer (i.e. doxycycline) [19]. In the

present study, compound litters from reciprocal matings between SP-C

flox/flox tg/tg

-rtTA'/t9/ (tetOh-CMV-Cretg/tg/ HIF1a and (tetO)7-CMV-Cre /

69

Figure 2.1. Lung specific, doxycycline-inducible deletion of HIF1a

In triple transgenic mice.

(A) Triple transgenic mice were generated to induce expression of rtTA
protein in the epithelial cells of the lung. rtTA expression is controlled

by human SP-C promoter. Another transgene is (tetO)7-CMV-Cre
recombinase transgene in which Cre recombinase expression is
controlled by (tetO)7-CMV promoter in the presence of doxycycline, and

rtTA protein. Cre recombinase recognizes the onP sites flanking exon 2
of HlF1a locus and facilitates homologous recombination and thus
inactivation of HlF1oc locus. (B) Genotyping of transgenes. Gel shows
the genotyping results for all the combinations of three transgenes.
Floxed HlF1a size is 274 bp and wild type HIF1a is 240 bp. C, qRT-

PCR results for HlF1a mRNA from triple transgenic mice in the

NA
absence (Control) and presence (HIF1o ) of doxycycline (14 day in

utero exposure). Values are the average of five separate animals per

group. D, Western blot analysis for HlF1a from lungs of triple

transgenic mice in the absence (Control) and presence (HlF1oA/A) of

doxycycline (14 day in utero exposure). Blots were also probed with a
tubulin-specific antibody to demonstrate equal loading. Two
independent animals from both groups are shown (1—4). "Images in this
dissertation are presented in color."

70

 

 

 

_ <5. Ulfi LouoEoE 0mm 52:3:

38. 5E: 22:28

ownEnEooE 29:03.:

<._.t-on_w:

71

Figure 2.1. Continued.

BE: 25 25>
5E: .3on

 

 

>080

 

<._.t

 

wmo

 

 

X“.

 

X“.

 

X”.

 

Xu—

 

X“.

 

X“.

 

 

 

Us ”:1

 

 

72

Figure 2.1 Continued.

C 0.6-
g 0.5-
0.4-
u5:03-
-.-; 0.2-
o:

0.1-
0.0-

p-value= 0.0091

  

 

 

 

Control I-IIF1orAIA

D

Control HIF1aA/A
1 2 3 4

 

 

FHF1a

Tubufin

 

 

73

fl fl
HlF1q ox/ ox mice were composed of pups with mixed genotypes with respect

to SPC-rtTA transgene. Their genotypic ratios were in accordance with
Mendelian inheritance as demonstrated by genotyping (Fig. 2.1 B). Analysis Of
these ratios from litters studied (N=30 litters and 190 pups) confirmed no in
utero mortalities (data not shown). In the absence of doxycycline treatment,
pups were phenotypically indistinguishable between litters. The functionality
of the doxycyline treatment was demonstrated by the significant decrease in
HlF1o mRNA as measured by qRT-PCR (Fig. 2.10) and loss of HIF1a protein
by Western blot analysis (Fig. 2.1 D)

Lung-specific deletion of HIF1a causes lethal phenotype: To determine if
in utero loss of HlF1a influenced litter size or the Mendelian distribution of
pups, dams carrying triple transgenic embryos were exposed to doxycyline
through feed and water for various lengths of time prior to parturition (i.e. 2, 4,
6, 8, 10, 12, and 14 days). Our findings indicate pups exposed to doxycyline
in utero for more than 8 days prior to parturition had a 100% mortality rate,
while those receiving the drug for 4-6 days prior to parturition had

approximately a 15% chance of survival (Fig. 2.2A). Following parturition,

A
HlF1qA/ pups [doxycyline-induced] developed respiratory distress, severe

cyanosis, and died within an hour of birth (range of 10-60 minutes) (Fig. 2.23).

NA
At necropsy, the lungs from HlF1o pups were dark red and atelectic, in

contrast to pink, aerated lungs from control (in the absence of doxycycline

treatment) pups. Excised lung lobes from HlF1ch/A pups weighed slightly

74

more than the lungs from control mice and sank to the bottom of a saline-filled
vial in contrast to the langs from control litterrnates which floated in saline

(Figs. 2.20 and 2.2D). At birth, the average total body weights of control

litterrnate and HIF1aA/A were 1.318 :I: 0.018 (SEM) and 1.288 :I: 0.024 grams,

respectively.

Defective lung morphology: The lungs of HlF1ch/A pups had histologic and

ultrastructural features that indicate an impairment of normal in utero
differentiation of alveolar epithelium, with a related loss of lung surfactant

proteins that are essential for preventing collapse of individual alveoli and

ensuring proper gas exchange to maintain life. Lungs of HIF1aA/A pups at

birth had abnormally thickened alveolar septa (Fig 2.3C) lined by
undifferentiated cuboidal epithelial cells (immature pneumocytes) containing
large amounts of intracytoplasmic periodic acid Schiff(PAS)-positive material
(Fig 2.3D) that was ultrastructurally identified, via transmission electron
microscopy, as glycogen (Figs. 2.40 and 2.4D). There was a marked
reduction of alveolar airspaces in the lungs of these mice due in part to the
thickened septa and to focal areas of atelectasis. In contrast, the lungs of
control mice at birth had uniformly dilated alveolar airspaces with much thinner
alveolar septa that were lined by more differentiated surface epithelium

containing much less PAS-positive glycogen (Figs. 2.3A and 2.3B).

75

Figure 2.2. Effects of lung specific deletion of HlF1o .

Graph of the percent viability of pups at birth versus intrauterine
doxycycline treatment days. Doxycycline-induced lethality was more
pronounced when the drug was delivered more than 4 days before
parturition (circles). No lethality was observed in control group (no

doxycyline, squares) or other possible genotype controls (data not
_ A/A . .

shown). (B) At birth HIF1d pups were cyanotlc (nght) compared to

normal, pink well oxygenated controls (left). (C) Mean lung weights of

NA
control (black bar) and HlF1o pups (white bar). The asterisk

indicates a significant difference (P value < 0.05) based on a two-tailed
ttest for samples of unequal variance. The P value is indicated. (D)

Vial containing excised lungs from newborn pups. Lungs from

A
HIF10N (A/A) pups sink whereas control (Ctrl) lungs float in saline.

"Images in this dissertation are presented in color."

76

Viability (%)

120

100

80—

60-

4o-

20-

 

 

 

* 777 #7

i —0— Control l

g+ Doxy ,

e e e e *5_,
-
l l 1' Hr

 

 

Treatment Days

 

    

 

A 1

Control HIFltlA/A

77

Figure 2.2. Continued.

 

 

 

 

 

Control HIF1 aA/A

Control ->

 

Hll=1oiAIA

 

9

78

Figure 2.3. Pulmonary Histopathology of Lungs.

Light photomicrographs of hematoxylin and eosin stained lung sections

from control (A) and HlF1aA/A (C) pups. Lung from HIF1otA/A pup has

less alveolar airspace (a) and thicker alveolar septa (S) compared to

control. Large cuboidal epithelial cells line the alveolar septa of

A
HIF1oA/ pup while the alveolar septa of control pup is lined primarily

by squamous epithelial cells (type 1) and only a few widely scattered

cuboidal cells (type II). Periodic acid Schiff (PAS) stained lung sections

from control (B) and HIF1aA/A (D) pups. Cuboidal epithelium lining

A/
alveolar septa in HIF1a A pup has greater PAS-stained glycogen

(arrows) than that of the control pup (D). "Images in this dissertation are

presented in color."

79

 

.9550

80

Figure 2.4. Electron photomicrographs of alveolar epithelium of
newborn pups.

Lung from control pup (A, B) has a well differentiated alveolar
epithelium containing both type I and II cells (B). Stipled arrow indicates
thin, squamoid, type I cells and solid arrows indicate tubular myelin
figures (secreted surfactant) within the alveolar airspace of control pup.
Type II cells have numerous intracytoplasmic lamellar bodies (lb) and

NA
apical microvilli (mv). In contrast the alveolar surface in HlF1o pup

(C, D) is lined by large undifferentiated cuboidal epithelial cells The
cytoplasm of these epithelial cells are primarily filled with glycogen (it).
No lamellar bodies are present in these cells. C, Capillary; rbc, red
blood cells; ll, type II alveolar epithelial cell; I, type I alveolar epithelial
cell; if, interstitial fibroblast; *, glycogen; n, nucleus; 1, mitochondrion; 2,
rough endoplasmic reticulum; pl, pleural surface; solid black arrows,
tubular myelin; stipled arrow, type I cells. ”Images in this dissertation

are presented in color."

81

 

82

Figure 2.4 Continued.

 

83

Ultrastructurally the luminal epithelium lining the alveolar airspace of
control pups consisted of both alveolar type I and II cells (differentiated
pneumocytes). Distinctive lamellar bodies were present in the apical
cytoplasm of alveolar type II cells along with tubular myelin and secreted
lamellar material (ultrastructural features of secreted surfactant) widely
scattered along the alveolar luminal surface (Figs. 2.4A and 2.4B). These
distinctive cuboidal epithelial cells also had a round to ovoid nucleus, an apical
luminal surface lined by short microvilli, and numerous cytoplasmic organelles
consisting of mitochondria, rough endoplasmic reticulum, and lysosomes. In
contrast, Type I cells were identified by their thin squamous morphology
containing few organelles and a fusifonn nucleus (Figs. 2.4A and 2.48).
Interestingly, there were no microscopically detectable differences in the
morphology of intrapulmonary conducting ainlvays (preterminal and terminal
bronchioles), lined principally by ciliated cells and nonciliated cuboidal (Clara)

cells, between control and HIF1dA’A pups at birth.

Altered surfactant metabolism:

qRT-PCR analysis of the genes for surfactant proteins show a decreased
expression of SP-A, SP-B, and SP-C in the HlF1r1A/A mice compared to

control pups (Fig. 2.5A). SP-D mRNA expression was not significantly
different between the two genotypes.

84

Figure 2.5. Surfactant protein expression.
(A) mRNA levels for Surfactant associated proteins (SP-A, SP-B, SP-C

and SP-D). Each expression level is expressed relative to HGPRT. (B)

lmmunoblot analysis of surfactant associated proteins (SP-A, SP-B, SP-C,

and SP-D) in lung homogenates from control and HIF1aA/A pups (n=3). [3-

actin (actin) was used as loading control. (C) lmmunohistochemical

staining of SP-B (left panels) and SP-C (right panels) in lung sections from

control (upper panels) and HIF‘IGA/A (lower panels) pups. HIF1oA/A

pups show decreased expression of SP-B and SP-C as compared to
control littermates. The asterisk indicates a significant difference (P value
< 0.05) based on a two-tailed ttest for samples of unequal variance. The

P values are indicated. "Images in this dissertation are presented in color."

85

O
'3
2
fl'
|.I.l
E
E
at"

Relative Expression

(HQ
0

40

‘8'!“
0°00

Control

Control

SPA

SPB

Acti n

SPC

SPD

    
  

*

HIF1aA A
SPC

Control

Relative Expression

HIF1aA’A

Relative Expression

 

 

Control

 

HIF1aA’A

SPD

T

 

 

 

Control

HIF1<1AIA

Hll=1'o,AIA

 

 

 

 

Acti n

 

86

 

 

 

Figure 2.5. Continued.

 

 

87

A/A
Western blot analysis of protein extract from HIF1a and control animals

was also performed to determine if surfactant protein levels were similar to

gene expression patterns. All four surfactants displayed a substantial

A/A
reduction in protein levels in the HlF1d mice as compared to control pups

(Fig. 2.5B). lmmunohistochemical staining on lung sections confirmed the

NA
reduced levels of SP-B and SP-C in the HIF1q compared to control pups

(Fig. 25C). The reduced levels of surfactant mRNA and protein expression

were consistent with the lack of alveolar epithelial differentiation and

NA
respiratory distress in the HlF1o pups.

Altered Gene expression: To begin to understand how loss of HIF10t
induced changes in lung morphology, qRT-PCR was performed on several
critical genes known to be involved in lung development. These genes include
B-catenin, clara cell secretory protein (CCSP), forkhead box A2 (Foxa2),
forkhead box protein A1 (Foxa1, also known as HNF3o), thyroid transcription
factor 1 (TTF-1), GATA binding protein 6 (Gata6), ATP-binding cassette, sub-
family A (ABC1 member 3 (ABCA3), and CCAAT/enhancer binding protein
alpha (CEBPa). There were no significant differences in the expression levels
of Foxa2, ABCA3, CEBPo, ‘l‘l'F-1, Foxa1, or GATA, suggesting that HIF10t is
not required for their normal expression and is most likely involved in later

events in lung development (Fig. 2.6). However, lower levels of B-catenin,

88

figure
Quanlll
various
express
a slgnll

sample

Figure 2.6. Expression of developmentally important genes.
Quantitative real time PCR was used to measure the mRNA levels of
various genes known to play a role in lung development. Each
expression level is expressed relative to HGPRT. The asterisk indicates
a significant difference (P value < 0.05) based on a two-tailed ttest for
samples of unequal variance. The P values are indicated.

89

Relative Expression
I“ 9' .“
0| 0 0|

0.

Control

     

pro

bio

   
 

Relative Expression

    

HIMF

 

HlF1aA/A

VEGF

 

 

 

 

99
O

  

Control

Control

 

Control

HlF1Ex “4

HIFZG

*

TTF

HIF1a A’A

 

 

 

 

Hing,“

 

    

_.1_

Control HIF1aA’A
B-catenin

C

.2

In

In

0

I-

2

I: 0.10

g 0.05 *

O

n: 0.00
Control HIF1aA/A

CCSP

C

.2

Z“: 750

h

D.

”’5 500 *

2 I

E 250

O

m I
Control HIF1aA’A

FoxA2

C

'2 0.03

i

i- 0.02

2 I

I.“

.‘z’

E

d)

n:

 

90

Relative Expression
9 .° P
O O O
O A N

 

CEBPa

 

 

 

 

 

 

 

 

 

 

 

Control

HIF121A’A

 

CCSP, HIMF, VEGF and HlF2q mRNA in neonatal HIF1c1A/A pups compared

to control littermates suggest that HIF10t plays a role in controlling their
expression during maturation of the lung [15, 22]. Given the established role
of these factors in regulating lung development, our data suggest that HIF10t is
centrally located in the transcriptional network that is necessary for proper lung
morphogenesis.

The previously described role of HIF20t in lung development, the similarity

in phenotype between the HlF20t knockout survivors and HlF10t lung deletion

strains, and the loss of HlF20t expression in the l--llF10lA/A pups led us to

determine the level of HlF20t expression at the protein level using
immunohistochemistry [15]. In the presence of doxycyline there was a
pronounced expression of Cre recombinase in all cell types of the lung (Fig.
2.7D). There was a corresponding loss in HlF10t expression in the alveolar
tissue (Fig. 2.7E). Though HIF10t is not expressed ubiquitously throughout the
lung, its cell specific expression was abrogated upon doxycycline treatment in
the triple transgenic animal (Fig. 2.7). Surprisingly, the increased Cre
recombinase and subsequent loss of HlF10t expression also led to a drastic

decline in HIF20t levels in the lung (Figs. 2.70 and 2.7F).

91

Figure 2.7. Immunohistochemistry for Cre recombinase, HlF10l,
and HIF20t.

Lung sections from control (A,B,C) and HlF10tA/A pups (D,E,F) were

immunostained for Cre recombinase (A,D), HlF1ot (BE) and HlF20t

(C,F). Immunohistochemistry for Cre recombinase shows strong
staining of HIF10tA/A mouse alveolar epithelial cells (D, brown color).
Positively stained cells for HlFtot and HIF20t are depicted by solid
arrows. HIF10tA/A pups show decreased expression of HIF10t and

HIF20t as compared to control littermates. a, air space; p, pleural

surface; s, septa. "Images in this dissertation are presented in color."

92

 

 

Cre Recomblnue

   
 

 

93

 

Table 2.1: Primers for PCR-genotyping.

 

 

 

 

 

 

 

Allele Forward Primer (5’-3’) Reverse Primer (5’-3’)
HIF 1a gca gtt aag agc act agt tg gga gct atc tct cta gac c

Cre tgc cac gac caa gtg aca gca atg aga gac gga aat cca tcg etc 9
rtTA gac aca tat aag acc ctg gtc a aaa atc ttg cca gct ttc ccc

 

 

Table 2.2: Primers for real-time RT-PCR.

 

 

 

 

 

 

 

 

 

 

Gene Forward Primer (5’-3’) Reverse Primer (5’-3’)
SPA gct gtc agt ggg gga taa ag ctt tgt aat gct tgc gat gg
SPB ctt gtc ctc (Ea tgt tcc ac ggc ctggfigat cac aga ct
SPC cagctc cag gaa cct act 90 got tag agg tgg gtg tgg ag
SPD gag gtt_gcc ttc tcc cac ta agc ctg ttt gca cat ctc ct
HIF1-a t ctc cct ata tcc caa tg ggt ctg ctg lea ccc agt aa
HIF2-a gag caa gcc ttc caa gac ac ttc gca ctg atg gtc ttg to
B- ggc agc agc agt ctt act tg aag gac tgg gaa aag cct tg
catenin

 

VEGF tca cca agg cca gca cat ag aat gct ttc tcc gct cgaa
CCSP cat cat gaa gct cac gga ga ggg aca cag ggc agtgac aa

FoxA2 gcc ag_c_gag tta aggtat gc tca tgt tgc tca cgg aag ag

 

 

 

 

 

HNF 3- ccc ttt ctc cct ttc act cc gtg gtg ggc cta aca aca ac
a
TTF-1 gct ggc ctt tca gaa aat tg gga cta ggg act mad gg

 

 

CEBPa gca agc cag gac tag gag at c g aaa gtc tct cgg tct ca
HGPRT aag cct aag atg agc gca ag tta cta ggc aga tgg cca ca
PPI-A agc ata cag gtc ctg gca tc ttc acc ttc cca aag acc ac
ABCA3 gagctt tgc cca cct aca ac gaa act ggg agg gag agg ac

GATA caa aag ctt gct ccg gta ac ctg agg tgg tcg ctt gtg ta
6
Retnla tat gaa cag atg ggc ctc ct ggt cca gtc aac gag taa gca

 

 

 

 

 

 

 

 

 

 

94

Discussion

Mammalian lung development and successful transition to extrauteline
respiration involves a wide battery of biochemical, cellular and ultrastructural
changes. This complex process begins at embryonic day E9.5 with most of
the alveolar epithelial differentiation events starting at embryonic day E17.5.
Several transcription factors control the temporal and positional epithelial
differentiation process, as well as, the function of these differentiated cells.
When the function of these critical factors is disrupted during development,
lung function is compromised, leading to respiratory distress at birth. Our
results have added HlF1oc to this list of transcription factors that are critical for
lung development. We have also demonstrated that loss of HIF10t during
development leads to changes in the expression of other critical factors, such
as HlF20t, VEGF and 0t-catenin [23].

HlFs are a class of transcription factors that play a critical role in oxygen
sensing and the metabolic adaptations to hypoxia. Previous studies have
shown that HIF1a levels are predominant during lung development until day
E135, at which time, HlF20t becomes the major HIF in this tissue [24, 25].
Targeted gene disruption of the HIF1a locus results in the embryonic lethality
due to cardiovascular defects [12]. Mice partially deficient for HIF1o alleles
showed normal development but were physiologically compromised as they
exhibited impaired pulmonary vascular remodeling under chronic hypoxic

stress. In addition, the heterozygote was used to show that partial loss of

95

HlF1o alleles results in impaired pulmonary arterial myocyte
electrophysiological responses under hypoxic stress [13, 25, 26]. The study
presented here has shown that the lung-specific loss of HIF10t leads to

neonatal respiratory distress syndrome due to impaired alveolar epithelial

A/A
differentiation. Interestingly, the lungs of HlF1o pups had normal

morphogenesis of conducting airways with phenotypic alterations restricted to
the alveolar parenchyma. These results suggest that HlF1ot is involved in the
late events of lung morphogenesis and alveolar epithelial differentiation but
not in the early lung biogenesis and airway branching morphogenesis.
Respiratory distress syndrome and associated histopathology are
phenotypic hallmarks of targeted deletion of several transcription factors, such
as Foxa2, CEBPa, GATA-6, SMAD3, Calcineurin b1, and thyroid transcription
factor-1, suggesting an intricate network of transcriptional regulation governing
the complex ultrastructural maturation of lungs [8, 27-30]. Expression analysis
demonstrated that the levels of Foxa2, Foxa1, CEBPa, and GATA-6 are
comparable among pups with and without HIF10t (Fig. 2.6). This suggests that
HIF’IG acts either downstream or independent of these transcription factors.
In contrast, the loss of HIF10t led to a decreased expression of other critical
factors, including CCSP, B-catenin, HIMF, VEGF, and HlF20t (Fig. 2.6).
Recently, the loss of HlF20t and subsequent decrease in VEGF has been

linked to respiratory distress syndrome [15]. These experiments involved a

./-
subset of HIF20t mice that were viable up to parturition and displayed similar

96

pathology to the HIF10tA/A mice described here. Delivery of VEGF, either

./-
intrauterine or postnatal intratracheal instillation protected the HlF20t mice

from symptoms of respiratory distress syndrome. Given that HIF20t

'

expression is abrogated in the HIF1 (IA/A pups suggests that HIF10t regulates

HlF20t early in lung development and the subsequent loss of VEGF might

explain the pathology of the HIF‘ICXA/A pups. It remains to be seen if the

decrease in VEGF expression is due to direct loss of HlF10t or indirectly

through the loss of HlF20t expression. More importantly, the pathophysiology

of the HlF1aA/A mouse resembles that of the HIFZG-I- mouse in relation to the

lack of differentiation of type II pneumocytes and increased septal thickness.

A/A
In addition, the HlF1o pups display large glycogen stores with concurrent

loss of surfactant protein expression.

In conclusion, these studies provide evidence that HIF10t plays an
important role in lung development. The respiratory failure induced by lung-
sDecific deletion of HlF1o, suggests that hypoxia and HIF10t-regulated genes
play an essential role in lung maturation, especially proper differentiation of
tElbe ll alveolar cells. HlF10t’s potential upstream regulatory function of HlF20t
and VEGF expression, directly or indirectly, offers a mechanism of action for

the phenotypic observations. Finally, the results suggest that the hypoxia

Signaling cascade is important during the later stages of lung development but

97

 

not essential in the initial patterning of the tissue. HlFs seem to play a later
roIe in directing cell differentiation and regulating growth factors necessary for
lung remodeling required for sustaining life extrauterine. Understanding the
pathways necessary for proper HIF expression and function and the
downstream pathways influenced by these factors will impact our ability to

treat RDS and other diseases of the lung.

98

RE FERENCES

1 Webster, W. S. and Abela, D. (2007) The effect of hypoxia in
development. Birth Defects Res C Embryo Today. 81, 215-228

2 Giaccia, A. J., Simon, M. C. and Johnson, R. (2004) The biology of
hypoxia: the role of oxygen sensing in development, normal function,
and disease. Genes Dev. 18, 2183-2194

3 James Metcalfe, H. B., Waldemar Moll. (1967) Gas Exchange in the
Pregnant Uterus. Physiol. Rev. 47, 782-838.

4 Groenman, F., Unger, S. and Post, M. (2005) The molecular basis for
abnormal human lung development. Biology of the Neonate. 87, 164-
177

5 Cassel, T. N., Suske, G. and Nord, M. (2000) C/EBP alpha and TTF-1

synergistically transactivate the Clara cell secretory protein gene.
Annals of the New York Academy of Sciences. 923, 300-302

6 deFelice, M., et al. (2003) TTF-1 phosphorylation is required for
peripheral lung morphogenesis, perinatal survival, and tissue-specific
gene expression. Journal of Biological Chemistry. 278, 35574-35583

7 Mucenski, M. L., et al. (2003) beta-Catenin is required for specification
of proximal/distal cell fate during lung morphogenesis. J Biol Chem 278,
40231-40238

8 Wan, H. J., et al. (2004) Foxa2 is required for transition to air breathing
at birth. Proceedings of the National Academy of Sciences of the United
States of America. 101, 14449-14454

Semenza, G. L. (2000) HIF-1: mediator of physiological and
pathophysiological responses to hypoxia. Journal of Applied
Physiology. 88, 1474-1480

99

1O

11

12

13

14

15

16

17

18

79

Ryan, H. E., Lo, J. and Johnson, R. S. (1998) HIF-1 alpha is required
for solid tumor formation and embryonic vascularization. Embo Journal.
17, 3005-3015

Kotch, L. E., lyer, N. V., Laughner, E. and Semenza, G. L. (1999)
Defective vascularization of HIF-1 alpha-null embryos is not associated
with VEGF deficiency but with mesenchymal cell death. Developmental
Biology. 209, 254-267

lyer, N. V., et al. (1998) Cellular and developmental control of O2
homeostasis by hypoxia-inducible factor 1 alpha. Genes &
Development. 12, 149-162

Yu, A. Y., et al. (1999) Impaired physiological responses to chronic
hypoxia in mice partially deficient for hypoxia-inducible factor 1alpha. J
Clin Invest. 103, 691-696

Asikainen, T. M., et al. (2006) Improved lung growth and function
through hypoxia-inducible factor in primate chronic lung disease of
prematurity. Faseb Journal. 20, (E986-E994) 1698-1700

Compemolle, V., et al. (2002) Loss of HIF-2alpha and inhibition of
VEGF impair fetal lung maturation, whereas treatment with VEGF
prevents fatal respiratory distress in premature mice. Nat Med. 8, 702-
710

Tomita, S., et al. (2003) Defective brain development in mice lacking
the Hif-1 alpha gene in neural cells. Mol Cell Biol. 23, 6739-6749

Ryan, H. E., et al. (2000) Hypoxia-inducible factor-1 alpha is a positive
factor in solid tumor growth. Cancer Research. 60, 4010-4015

Perl, A. K., et al. (2002) Early restriction of peripheral and proximal cell
lineages during formation of the lung. Proc Natl Acad Sci U S A. 99,
10482-10487

Lobe, C. G., et al. (1999) Z/AP, a double reporter for ore-mediated
recombination. Dev Biol. 208, 281-292

100

 

20

21

22

23

24

25

26

27

28

Bradford, M. M. (1976) A rapid and sensitive method for the quantitation
of microgram quantities of protein utilizing the principle of protein-dye
binding. Analytical biochemistry. 72, 248-254

Vengellur, A. and LaPres, J. J. (2004) The role of hypoxia inducible
factor 1 alpha in cobalt chloride induced cell death in mouse embryonic
fibroblasts. Toxicological Sciences. 82, 638-646

Mucenski, M. L., et al. (2003) beta-catenin is required for specification
of proximal/distal cell fate during lung morphogenesis. Journal of
Biological Chemistry. 278, 40231-40238

Maeda, Y., Dave, V. and Whitsett, J. A. (2007) Transcriptional control of
lung morphogenesis. Physiological reviews. 87, 219-244

Ema, M., et al. (1997) A novel bHLH-PAS factor with close sequence
similarity to hypoxia-inducible factor 1alpha regulates the VEGF
expression and is potentially involved in lung and vascular
development. Proc Natl Acad Sci U S A. 94, 4273-4278

Shimoda, L. A., et al. (2001) Partial HIF-1 alpha deficiency impairs
pulmonary arterial myocyte electrophysiological responses to hypoxia.
American Journal of Physiology-Lung Cellular and Molecular
Physiology. 281, L202-L208

Semenza, G. L. (2005) Pulmonary vascular responses to chronic
hypoxia mediated by hypoxia-inducible factor 1. Proceedings of the
American Thoracic Society. 2, 68-70

Dave, V., et al. (2006) Calcineurin/Nfat signaling is required for
perinatal lung maturation and function. The Journal of clinical
investigation. 116, 2597-2609

Devriendt, K., Vanhole, C., Matthijs, G. and de Zegher, F. (1998)
Deletion of thyroid transcription factor-1 gene in an infant with neonatal
thyroid dysfunction and respiratory failure. New England Journal of
Medicine. 338, 1317-1318

101

 

29

30

Liu, C., Morrisey, E. E. and Whitsett, J. A. (2002) GATA-6 is required
for maturation of the lung in late gestation. American Journal of
Physiology-Lung Cellular and Molecular Physiology. 283, L468-L475

Martis, P. C., et al. (2006) C/EBP alpha is required for lung maturation
at birth. Development. 133, 1 155-1164

102

Chapter 3

Loss of HIF20l rescues the HIF10t deletion phenotype of neonatal
respiratory distress in mice

103

 

Abstract

Hypoxia is defined as a state of decreased oxygen reaching the tissues of the
body. During normal prenatal development, the fetus is exposed to hypoxic
conditions and the fetus’ response to these localized occurrences of oxygen
deprivation is essential for proper organogenesis and survival. The
mammalian response to these decreases in oxygen availability is regulated by
the hypoxia-inducible factors (HIFs). HlFs are transcription factors responsible
for regulating the cellular adaptation to hypoxia through direct modulation of
key genes involved in glycolysis, angiogenesis, and erythropoiesis. HlF10t
and HIF20l, two key isoforms, are important in embryonic development,
however; their role in lung maturation is not well defined. We have recently
shown that the loss of HIF1oc early in lung development leads to pups that die
within an hour of parturition, exhibiting symptoms similar to neonatal
respiratory distress syndrome (RDS). To further investigate the independent
role of HlF20t and its ability to alter HlF10t-mediated lung maturation, we
generated two additional lung-specific HIF0t knockout models (HIF20t and
HlF10t+HlF20t). Our current study has shown that the intrauterine loss of
HlF20t does not display signs of RDS. More interestingly, survivability
observed after the loss HIF10t and HlF20t suggests that the loss of HIF20t is
capable of rescuing the neonatal RDS phenotype seen in HIF10t deficient
pups. Microarray analyses on the total mRNA from these three genotypes

have identified several factors, such as MMP-9, Acct-9, CDS-1, and lL1R-ll,

104

that are differentially regulated by the two isoforms of HlFa. These results
suggest that HlFor isoforrns are involved in lung maturation and differentiation

and further understanding of mechanisms underlying the observed phenotype

might explain the pathophysiology of neonatal RDS.

105

Introduction

During gestation, the oxygen needs of the developing fetus are met via
placental gas exchange. Developmental defects specific to the lung fail to
manifest until the parturition stage, when placental roles of oxygen and
nutrient supply are taken over by the neonate. Thus, proper intrauterine
development of the alveolar gas exchange regions of the lung is essential for
the newbom’s first breath and for sustaining life outside the womb [1]. Lung
development, similar to all the other tissues in the fetus, is a highly
coordinated series of events involving complex intracellular and extracellular
signals that control transcriptional programs leading to proper cellular behavior

and morphogenesis.

Lung morphogenesis and alveoli formation processes are regulated
through the temporo-spatial expression of a plethora of transcription factors,
growth regulators, and environmental signals [2]. Proteins, such as TTF-1,
TGF-B, CEBPot, GATA-6, CEBP-a, KLF-5, Foxa1, and Foxa2 have been
shown to be critical for proper lung development [3-9]. Alveolar epithelium-
specific ablation of these and several other genes compromise lung function
and perinatal survivability [6, 10]. Most of these factors function to transduce
extracellular signals into developmental outcomes. One important
extracellular signal is oxygen availability. A decrease in available oxygen,

referred to as hypoxia, is a natural occurring condition within a fetus. Sensing

106

hypoxia is essential for proper development and mammals use a family of

proteins called, the hypoxia inducible factors (HlFs) to perform this task.

There are three cytosolic HlFs, HIF10t,HlF20t, HIF30t, and each is
oxygen labile. In the presence of adequate oxygen, these HIFs are modified
by prolyl hydroxylases(PHDs), in an oxygen-, iron- and oc-ketoglutarate-
dependent manner. Upon hydroxylation, the cytosolic HIF becomes a
substrate for ubiquitination by the Von Hippel Lindau (VHL) tumor suppressor
and thereafter, HIF0t is proteasomaly degraded. Under the conditions of
oxygen deprivation, PHD activity is inhibited leading to the stabilization and
translocation of HIch into the nucleus and subsequent dimerization with the
aryl hydrocarbon nuclear translocator (ARNT, also known as HIF1B). The
active dimer binds to the hypoxia responsive element sequence in the

promoter region of hypoxia responsive genes [11].

HIF target genes have been shown to play important roles in processes
such as glycolysis, angiogenesis, erythropoiesis and development. Studies
have suggested that the low oxygen environment in the developing lung is
required for HIF-regulated pathways that are essential for proper
organogenesis [12, 13]. For example, mice lacking HlF10t, the most
ubiquitously expressed HIF, display disorganized yolk sac vascularization and
cardiac defects [14]. HIF10t-deficient embryos also exhibited only a few

capillaries in the neural fold with complete absence of vascular network and

107

+ _
also reduced size of dorsal aorta [15]. In addition, HIF1 I mice developed

pulmonary hypertension and pulmonary vascular remodeling under hypoxic
conditions [16]. Similarly, homozygous deficiency of HlF20t in murine embryo
results in vascular disorganization in yolk sac and failure to assemble and

maintain vascular tubular structure and leading eventually to death between

day E95 and E13.5 [17, 18]. The defective phenotype of HIF10t'l. were

further aggravated by deleting either or both alleles of HlF20t. HlF10t./-/20t'/'

mice showed absence of placental vasculature, increase in trophoblastic giant
cells, poor invasive efficiency and defective placental structure thus
representing phenocopy of ARNT deficient mice [13]. The mid-gestational
lethality of the systemic knockout models has made it challenging to study the

role of different HIF proteins in fetal lung development.

Current understanding of the role of HIF signaling in the lung
development is limited. It has been shown that the PHD inhibitor, FG-4095,
can improve lung growth in prematurely born baboon neonates, predominantly

through HIF-mediated enhanced expression of VEGF [19]. In addition, some

of the progeny from HIFZa-l- mice within the isogenic 129S6/SvaTac strain

survive to parturition and die shortly after birth from a respiratory distress
syndrome-like pathology. The cause of this was linked to loss of VEGF

expression that resulted in pulmonary surfactant deficiency [20]. Finally, lung-

108

specific knockout mice demonstrated that HIF10t is indispensable for lung
development and is an important factor in surfactant production and cellular
differentiation [21]. Moreover, the lung-specific deletion of HlF10t alters the

expression of factors with putative roles in lung development, including HlF20t.

The collective role of HIF10t and HIF20t in lung development, their place
in the transcriptional network necessary for proper cellular differentiation, and
their potential redundant function in lung development are still unclear. To

increase our understanding of the role of these two HlFs in lung development,

mice with a lung-specific deletion of HlF1oc (termed HlF1otA/A), HIF20 (termed

HIFZCNA), and both HIF10t and HIF20 (termed HIF1/2qA/A) were generated.

These studies confirmed that HIF10t is essential for proper lung development.
Interestingly, the lung specific deletion of HlF20t did not confirm previous
published reports and displayed no lethality upon parturition. More
importantly, simultaneous deletion of both isoforrns of HIF rescued the
respiratory distressed phenotype that was observed after HIF10tdeletion. In
addition, a battery of genes has been identified that might be related to the
described phenotype in each of the genotypes. These results demonstrate a
non-redundant function for HIF10t and HIF20t in lung development and
establish hypoxia and HIF-mediated signaling pathways that are altered upon

their manipulation.

109

Material and methods

Transgenic mice and genotyping: HIF1qflox’flox, HlF2<1floxm0x and SPC-

rtTA-ltg/ (tetOh-CMV-Cretg/tg transgenic mice were generous gifts from

Randall Johnson (UCSD), M. Celeste Simon (University of Pennsylvania) and
Jeffrey Whitsett (Cincinnati Children’s Hospital Medical Center), respectively

[22-26]. In the present study, we used these three transgenic mice to
generate three genotypically different mice lines, SPC-rtTA'ltg/(tetOh-CMV-

floxfflox

Cretg/ t9/Hll=1or “mm”,

,sPc-rtTA'ltg/(teto)y-CMV-Cretg/tg/Hli=2o and

-/tg tg/tg flox/flox floxlflox

SPC-rtTA /(tetO)7-CMV-Cre /HIF1o /HIF20 [21]. All of

these three mice lines are capable of respiratory epithelium specific
conditional recombination in the floxed HIFCI alleles (Fig. 3.1). In this model,
depending upon the day doxycycline is administered to the darn, various cell
populations within the lung undergo recombination in the floxed alleles [24].
Genotyping screening of the mice progeny was performed by PCR for all the
three loci using previously published primer sequences. Genomic DNA
extraction from tail clipping was performed using Direct PCR extraction system
(Viagen Biotech, CA) via manufacturer’s instructions. PCR conditions were
standardized for all the three alleles: denaturation at 94°C for 3 min; 38 cycles
of denaturation at 94°C for 45 sec, annealing at 60°C for 45 sec and
polymerization at 72°C for 60 sec. followed by a 7 min extension at 72°C. Size

of the amplified products obtained were approx 210 bp for HlF1o (wild type);

110

fl fl
244 bp for HlF1o °XI °x; 410 bp for HlF2o (wild type); 444bp for

HlFZGflox/flox; 370 for Cre transgene; 350 for rtTA transgene (Fig. 3.2). Each

mouse line was maintained in a mixed C57BL/6zFVB background.

Doxycycline treatment and animal husbandry: Triple and quadruple
transgenic pups were exposed to doxycycline in utero to generate lung-
specific HIF-deficient pups. Dams were maintained on the doxycycline feed
(625 mg doxycycline/Kg; Harlan Teklad, Madison, WI) and drinking water (0.8

mg/ml: Sigma chemicals Co.) from day E4.5 until day PN1. All the HIF-

deficient pups born from these dams will be referred to as HIF1qA/A,

HlF2aA/A or HIF1oA’A/HIF20A/A. Triple and quadruple transgenic mice that

were not exposed to doxycycline will be referred to as controls. All the animal
handling and necropsy protocols were approved by the ULAR regulatory unit
of Michigan State University. Mice used in this study were kept at the animal
housing facility under the strict hygienic and pathogen free conditions

approved by the university laboratory animal resource (ULAR) regulatory unit.

A/

Lungs harvesting and processing: Control and HlF1o A, HIFZCIA/A o

I'

HlF1c1A/A/HIF20A/A pups were either sacrificed within one hour of parturition

111

Figure 3.1. Lung specific, doxycycline-inducible deletion of HIF10t

and HIFZot in triple transgenic mice.
Triple transgenic mice were generated to induce expression of rtTA

protein in the epithelial cells of the lung. rtTA expression is controlled by

the human SP-C promoter. Another transgene is (tetO)7-CMV-Cre

recombinase transgene in which Cre recombinase expression is controlled

by (tetO)7-CMV promoter. In the presence of doxycycline, the rtTA protein

is produced and activates the expression of the Cre-recombinase. Cre
recombinase recognizes the loxP sites flanking exon 2 of the HIF10t
and/or HlF20t locus and facilitates homologous recombination and thus
inactivation of respective HlFa locus.

“Images in this dissertation are presented in color".

112

ZOCMAwD 4<ZO_._.UZDu_ :N...:I ZO_._.wr_mo 4<ZOFUZDm SEE

 

 

 

m :98 a :98 m :93 H :96
@ + @ +
N xw HM N :93 ”Mu
38.. £2: 35550 2.8.. 3a.: aeoeacoo
m :98 N :96 a zoom. m :96 N :98 u :96
0.5 mmo A
a u . 0.5.. AOumt

     

a,

4. Kara...‘ Eek.
« q o a

  

1:. I
.a a m

uc:u>u>xoo (ht <._.t Luna—hash. Utm:

o... C u HIIIIHH—LIIJ $5.63:

 

113

Figure 3.2. Genotyping of transgenes.
Gel shows the PCR genotyping results for all the combinations of four

transgenes. Sizes of the amplified products obtained are: 240 bp for
. flox/flox .
HlF1a (Wild type); 274 bp for HlF1q ; 410 bp for HlF2d (Wild type);

444bp for HIFZGflOXIflOX; 370 for Cre transgene; 350 for rtTA transgene.
One representative sample from each of three generated mice (SPC-rtTA-
ltg/(tetOh-Cre-Itg/ H | F1 aflm (Lane 1 ), SPC-rtTA-Itg/(tetOh-Cre-
ltg/lezolfl/fl mouse (Lane 2), and SPC-rtTA-ltg/(tetOh -Cre'

It fl/fl
g/HIF10t/20t (Lane 3)) was genotyped for the four transgenes.

114

 

115

HlF10t

HlF20t

CRE

SPC

or at day PN60 (HIFZGNA or HIF1ch/A/HIF20A/A pups only). All neonatal

pups were sacrificed by decapitation and lung tissue was harvested as
described previously [21]. Briefly, the adult mice were anesthetized with
sodium pentobarbital (50 mg/ml), and a midline Iaparotomy was performed to
canulate the trachea. The lung and heart were removed en bloc. The left lobe
was fixed via perfusion inflation method with 10% neutral buffered formalin for
histopathological analysis. The remaining lung lobes were divided: half were
stored in RNA/ater RNA stabilizing reagent (Qiagen, Valencia, CA) for RNA
isolation and qRT-PCR analysis, and half were snap frozen for protein
extraction.

Histopathology and immunohistochemistry: At least four to six pups of
each genotype and doxycycline treatment were analyzed for histopathological
changes. Formalin fixed left lung lobe tissues were paraffin embedded and 5-
micron thick sections were mounted on glass slides and stained with
hematoxylin and eosin (H&E), periodic acid Schiff (PAS), or immunostained
with HIF10t (1:250 dilution, NB100-479, Novus Biologicals, CO) and HlF20t
(1:150 dilution, NB100-122, Novus Biologicals, CO). Briefly, tissue sections
were deparaffinized and endogenous peroxidase activity was quenched by
incubation with 6% H202 for 30 min. Immunostaining was performed using
Rabbit Vector Elite ABC kit (Vector Laboratories, CA), according to the

manufacturer's recommendations.

116

RNA Isolation

Lung tissue (10 mg) stored in RNAIater RNA Stabilization Reagent was
homogenized in RLT buffer (RNeasy RNA isolation Kit, Qiagen, Maryland)
using a Retsch MM200 bead beater system (Retsch, Haan, Germany). Total
RNA quantification was performed spectrophotometrically (NanoDrop ND-

1000 UV-Vis Spectrophotometer). Isolated RNA was resuspended in

RNAase free water, quantified (A250), and concentration was calculated by
spectrophotometric methods (A250). Purity was assessed by the

A260:A280 ratio and by visual inspection of 3 pg on a denaturing gel.

Microarray Experimental Design

The lung RNA samples extracted from HlF1oA/A, HIFZCNA or

HIF1/2(1A/A and control animals were individually hybridized to 4 x 44K whole

mouse genome oligo microarrays (Agilent Technologies, Inc., Santa Clara,
CA). Hybridizations were performed with four biological replicates per group,
using one-color labeling (Cy3), according to the manufacturer’s protocol
(Agilent Manual: 64140-90040 v. 5.7). Briefly, 1 pg of total RNA from each
sample was reverse-transcribed to cDNA in the presence of RNA One-Color
Spike-In mix, T7 Promoter primer, 5X First Strand Buffer, 0.1M DDT, 10 mM
dNTP mix, MLV-RT and RNaseOut during 2 h incubation at 40°C. Obtained
cDNA was then converted to fluorescently labeled cRNA and amplified using

4X Transcription Buffer, 0.1M DDT, NTP mix, 50% PEG, RNaseOut, Inorganic

117

pyrophosphatase, T7 RNA Polymerase and Cyanine 3-CTP (Cy3) during
second 2 h incubation at 40°C. The cRNA was purified using RNeasy
Isolation Kit (Qiagen) and eluted with RNase—free water. Purified cRNA was
assessed for Cy3 absorbance and concentration using NanoDrop
spectrophometry. Fluorescently labeled cRNA was fragmented using 25X
Fragmentation Buffer and 10X Blocking Agent for 30 min at 60°C before
samples were hybridized. After 17 h incubation at 65°C, microarray slides
were washed and scanned at 532 nm (Cy3) on a GenePix 40008 scanner
(Molecular Devices, Union City, CA). Images were analyzed for feature and
background intensities using GenePix Pro 6.0 (Molecular Devices). All data

were managed in TIMS deach data management system [27].

Microarray Analysis and Functional Annotation

All microarray data in this study passed quality assurance protocols [28].
Microarray data were normalized using a semiparametric approach [29] and
the posterior probabilities were calculated using an empirical Bayes method
based on a per gene and group basis using model-based t-values [30]. Gene
expression data were ranked and prioritized using a [fold changel2l.5 and
P1(t) values 20.95 to identify differentially expressed genes that were used for
further investigation and interpretation. Annotation and functional
categorization of differentially regulated genes was performed using Database

for Annotation, Visualization and Integrated Discovery (DAVID) [31].

118

RNA isolation and real-time PCR analysis: Lung tissue (10 mg) stored in
RNAlater RNA Stabilization Reagent was homogenized in RLT buffer (RNeasy
RNA isolation Kit, Qiagen, Maryland) using a Retsch MM200 bead beater
system (Retsch, Haan, Germany). Total RNA quantification was performed
spectrophotometrically (NanoDrop ND-1000 UV-Vis Spectrophotometer).
Total RNA (1 pg) was reverse transcribed using superscript ll reverse
transcriptase kit (lnvitrogen, CA). Expression level of selected genes involved
in surfactant metabolism and lung development were analyzed by Real-Time
PCR using SYBR green (Applied Biosystems, Foster City, CA) as previously
described [32]. Gene specific primers are listed in Table 3.1. Copy number
was determined by comparison with standard curves of the respective genes.
This measurement was controlled for RNA quality, quantity, and RT efficiency
by normalizing it to the expression level of the hypoxanthine guanine
phosphoribosyl transferase (HGPRT) gene. Statistical significance was

determined by use of normalized relative changes and ANOVA.

Quantitative analysis: qRT-PCR analysis was performed using unpaired
two-tailed Student’s t-test on GraphPad Prism. Results were considered

significant at the 5% level.

Results:
Generation of HIF10t and HlF20t deficient mice and their survivability:
Three strains of mice were generated that were capable of inducible lung-

specific deletion of HIF10t, HIF20t, or HlF1oz/HIF20t as described in materials

119

Table 3.1. Primers for real-time RT-PCR.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Gene ID Gene Name Forward Reverse
20505 Solute carrier family 34 ttgfiactaccactacagcc agtaggatgcccgagatgtt
841 12 Succinate receptor 1 RW tcctcaaattgggcatgata
Methenyltetrahydrofolate
234814 synthetase domain cccaccggggtcatcactac atccttcccagcctgtttct
75512 Glutathione peroxidase 6 gcagtatgcaggaaagcaca caaaacggtgacgttgaatg
Glutathione S-transferase
68214 omega 2 cgcctggacgtatatggact ttcaagaagcccaggaagac ‘
Single-minded homolog 1
20464 (Drosophila) tcgtcagcgtcaactacgtc ccgagatagtgggagtggaa
Arginine vaSOpressin receptor
1 2000 2 ccccttgagtggagactaa ctgttgctgggagagctagg
Heparan sulfate 3-0-
54710 sulfotransferase 3B1 att ct a ttcct c c t at t atct tccctt a tt
320376 BCL6 co-repressor-Iike 1 gggc_tggggtgatatcctga aflagagccagatggtttc
BRCA1 interacting protein,
237911 helicase 1 tggctactaaaaficcctca ccaaaagggggc_ttg§ga
3-hydroxy-3-methylglutaryl-
15357 Co A reductase aagggactccccatcgag ggatatflggcattgacc
Calcitonin/calcitonin-related
1 2310 golypeptide, alpha aagaagaagttcgcctgctg tgcaggatctcttctgagca
16178 Interleukin 1 receptor, type II ctcccctggggacaatacca agccgagataaaggtgctgt
BRCA1/BRCA2-containing
210766 complex, subunit 3 agctgccaaaaatcctgtgt tgctgacatctgactgcaca
108030 Lin-7 homolog A (C. Elegans) agcagcaacaacaaccacaa tttttctgtgtggtgggattc
56360 Acyl-coa thioesterase 9 agacaaggtgggggagaiag tcattttcctggtggtagl
18145 Niemann Pick type C1 agggccatttaccatcattc agcagtcctggcagctacat
245195 Resistin like gamma (F IZZ3) ggaacttcggccaatcggg tagcacaagcacaaccaL
Stearoyl-Coenzyme A
20249 desaturase 1 ccgggggaatatcctggttt We
CDP-diacylglycerol synthase
74596 1 ctccctccctccattcctac gaatccactggcaaagaagc
Glutathione S-transferase,
14866 mu 5 acggtacatctgtggggaag at c ttactct a
17395 Matrix metallopeptidase 9 thflct ctcatggtccaccttgttca
75646 retinoic acid induced 14 gtcctccccaggatcaataa cctgcagtactgtcgctcag

 

 

120

ii,

VII

 

100 93.33

) a

L0 0 H

O O O
L_._Lg l

(percent
01 \I 00
O O O

wmm
~sss

I—I
O

O
2.‘ ,_I_._,I~..I ..

O
l
l

1aAIA 2dAIA 112dAIA

 

 

 

Figure 3.3. Survivability Plot.

Viability of neonatal HlF1aA/A,HlF2aA/A and HlF1/2aA/A pups. All the
HIF1aA/A pups showed signs of respiratory distress whereas all the
HlF2aA/A pups were viable with no signs of respiratory distress. Simultaneous
removal of both the form of HIFa resulted in approximately 7% deaths. The
data plotted is from n>~300 for HIF10tA/A, n>~100 for HIF2otA/A, n= 41 of
HlF1/2aA/A pups.

“Images in this dissertation are presented in color”.

121

and methods. To achieve recombination of the floxed alleles, dams were
exposed to doxycycline as previously described [21]. Dams of genotype
controls for the triple or quadruple embryos were maintained on regular feed
and water. The litters were genotyped via PCR using established primers.
Lung-specific deletion of HIF10t leads to 100% lethality upon parturition from a
pathology that resembles respiratory distress syndrome (Fig. 3.3) [21]. In
contrast, deletion of HlF20t in the developing lung shows no adverse
consequences to the animal. HlF20tA/A mice are born in appropriate
Mendelian ratios and display no signs of R08 (Fig. 3.3). These results
suggest that HlF20t is not essential for proper lung development as previously
reported [20]. Interestingly, the HlF1/20tA/A mice also displayed little
pathology. There was a slight decrease in survivability but othenlvise the
double deficient pups appeared identical to their Iittermate and genotype
controls (Fig. 3.3). These results suggest that loss of HlF20t can rescue the

RDS-like phenotype seen in the HlF1orA/A mice.

Histopathological analysis of neonatal HIF-deficient mice: Pups were
euthanized approximately 1 hour post-parturition and the lungs were
examined. HlF10lA/A mice confirmed previous finding and displayed
attenuated alveolar space and thickened septa compared to controls (Fig.
3.4A and 3.4B)[21]. In contrast, the lungs from HIFZqA’A mice displayed
thinner septa and larger alveolar space than controls (Fig. 3.4A and 3.4C).

Finally, the HIF1/20’”A pups appeared similar to control pups. They displayed

122

Figure 3.4. Pulmonary Histopathology.

Light photomicrographs of hematoxylin and eosin stained lung sections

from control (A) and HIF1oA/A (B), HIF2aA/A (C), HIF1/20AM (o) pups.

Lung from HlF1aA/A pup has less alveolar airspace (a) and thicker

alveolar septa (S) compared to control. The lungs from HlF2c1A’A mice
displayed thinner septa and larger alveolar space than controls. The
lungs from HIF1/20“"A mice resembled lungs from control in terms of
septal thickness and alveolar space. "Images in this dissertation are

presented in color."

123

 

124

normal septa and alveolar architecture when compared to controls (Fig. 3.4A

and 3.4D).

Expression of HIF10t and HIFZot In the three genoptypes: To access the
efficiency of HIF deletion, immunohistochemistry was performed on lung
sections from HIF1GNA, HIF2oA’A, HIF1/20M, and their respective controls. In
neonates, the expression of HlF10t is predominantly localized to alveolar and
bronchiolar epithelial cells in controls and HlF2ch’A mice (Fig. 3.5A, C, D, and
E). The level of HIF10t positive staining was drastically reduced in the
HIF10lA/A and HlF1/20tA/A mice (Fig. 3.58 and F). The extent of HlF10t
staining increased in HlF2rxA’A pups at the neonatal stage (Fig. 3.5D).

In neonates, the level of HlF20t staining was attenuated in each of the
three deficient genotypes as compared to their controls (Fig. 3.6). This
confirmed the recombination at this HlF20t floxed locus in the HIF20iA/A and
HlF1/2orA/A mice. Moreover, it supports the previous observation that loss of
HIF10t leads to a decrease in HIF20t expression (Fig 3.6A and B) [21]. The
results confirm the functional deletion of the floxed loci and suggest that there
is some level of coordination between the expression of these two hypoxia
regulated factors and this coordination plays a role in lung development

During development, the newly differentiated Type II cells use glycogen
Stores to produce surfactants. Lung sections from HIF1<1“’A pups (Fig. 3.78)
had larger reserves of glycogen as compared to HIF2aA’A pups (Fig. 3.7D). In

contrast, lung sections from HIF1QNA/HIF20NA pups (Fig. 3.7F) were devoid of

125

Figure 3.5. Immunohistochemistry for HIF10t.

Lung sections from control (A,C,E) and HlF10tA/A(B), HIFZGA/A (C),

HIF1/2mmA (F) pups were immunostained for HIF10tas described in

“materials and methods". Representative positively stained cells for
HIF10t are depicted by solid arrows. "Images in this dissertation are
presented in color."

126

 

127

Figure 3.6. Immunohistochemistry for HIFZot.

Lung sections from control (A,C,E) and HIF10tA/A(B), HIFZaA/A (C),

HIF1/20cmA (F) pups were immunostained for HlF20t as described in

“materials and methods” Positively stained cells for HlF20l are depicted

by solid arrows. "Images in this dissertation are presented in color."

128

 

129

Figure 3.7. Periodic acid Schiff (PAS) staining

Periodic acid Schiff (PAS) stained lung sections from control (B) and

HIF1c1A/A (D) pups. Cuboidal epithelium lining alveolar septa in HIF1uA/A

pup has greater PAS-stained glycogen (arrows) than that of the control

pup (D). "Images in this dissertation are presented in color."

130

 

131

PAS-positive cells and were undistinguished from control pups (Fig. 3.7A,

3.70, 3.75).

Genomic Response to HIF10t and HlF20t Deletions

To understand the collective roles of HIF10t and HIF20l in the fetal lung
development, gene expression was assessed using the 4 x 44 K Mouse
Agilent array containing approximately 44,000 oligonucleotide probes,
representing 34,204 annotated genes, including approximately 20,969 unique
genes. Model-based t-values that compared treated and vehicle responses
followed by Empirical Bayes analysis identified 1,174 differentially expressed
genes based on a p1(t) > 0.95 and absolute fold change 21.5-fold (Fig. 3.8A).

Overall, 632 genes were induced and 439 genes were repressed in the

HIF10tA/A as compared to control pups. The change in gene expression in
NA . . . .
HIF10t ranged from 37.07-fold induction (Solute carrier family 34) to -16.00-
. A/A
fold repressmn (StearoyI-Coenzyme A desaturase 1). In HlF2ot 102 genes

were induced and 45 genes were repressed whereas in HIF1/2053]A 43 genes

were induced and 108 genes were repressed. The changes in gene
expression were ranged from 9.00-fold (Fc receptor-like 6) and 5.84-fold

(glutathione S-transferase, mu 5) induction to -3.03-fold (olfactory receptor

583) and -6.6-fold (apolipoprotein F) repression in HIF20tA/A and HIF1/20tA/A,

132

Figure 3.8 Differential gene expression between HIF1aNA, HIFZCNA

and HIF1/2aNA.

Identification of differentially regulated genes (A). Comparative gene
expression analysis between HIF1oA’A, HIF2<1"“’A and HIF1/20’1"A pups. The
Venn diagram illustrates common and unique differentially expressed
genes (8).

“Images in this dissertation are presented in color”.

133

 

A

 

 

 

Probes [ m44,000 ]
Entrez GenelD
filter ‘1,
Unique annotated
genes [ 20,969. ]
| Fold change I 21.5 ‘1’
P1(t) 2 0.95

 

Differentially regulated [ 11 74 ]

unique genes

 

B 10tA/A (1069) ZaA/A (155)

 

1/2orNA (149)

134

respectively. List of differentially expressed genes is provided in Appendix

Table A.1.

Database for Annotation, Visualization, and Integrated Discovery
(DAVID) Analysis

To further investigate the pattern of cellular and physiological impacts of the
HIFoc deletions, Analysis through DAVID was conducted to allow detection of
biological pathways and processes affected due to the deletion of either or
both the isoforrns of HIFoc. Entrez gene ID list of 1174 differentially expressed
unique genes were analyzed using all the genes representing mouse genome
oligo-microarrays as a background. Given the wide array of biological
processes regulated by HlFs and their roles in perinatal development, the
effects on biological processes and cellular pathways were determined.
Important cellular pathways that were affected include cell cycle and vesicular
transport (table 3.2). Gene set enrichment analysis using the differentially
expressed genes showed 45 biological processes that were significantly (p s
0.05) affected by deletions of HIF10t, HlF20t and HIF1/2a (table 3.3).

Surfactant biosynthesis and secretion pathways affected by HIF1a and

HIF2a Deletions
An extensive literature search and microarray analysis identified changes in

genes known to be involved in surfactants biosynthesis, processing and

135

Table 3.2. Cellular pathways affected by deletions of HlF1ot, HIF2oi and HIF1/2a

 

Cellular pathways affected by deletions of HIF1a, HIF201 and HIF1/2a

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Genomic
Catemry Pathways Response Count P-Value
KEGG
Pathways Cell cycle Upregulation 8 0.007
KEGG SNARE interactions in vesicular
Pathways transport Downregulation 5 0.014
Biocarta The role of FWE-finger proteins
Pathways in vesicle transport Downregulation 3 0.021
KEGG Leukocyte transendothelial
Pathways migration Downrggulation 8 0.037
KEGG
Pathways Prostate cancer Downregulation 7 0.046
KEGG
Pathways Butanoate metabolism Downregulation 5 0.046
KEGG
Pathways ABC transporters - General [flewtion 4 0.054
KEGG
Pathways Ubiquitin mediated proteolysis ggregulation 7 0.054
KEGG Urea cycle and metabolism of
Pathways amino goups Downrefllation 4 0.055
KEGG
Pathways Cell Communication Downregulation 8 0.058
KEGG
Pathways Tifljunction Downregulation 8 0.060
KEGG Glycosylphosphatidylinositol(GPl)-
Pathways anchor biosynthesis Upregulation 3 0.073
KEGG
Pathwgys Tryptophan metabolism Upregulation 4 0.090

 

136

 

Table 3.3. Biological processes affected by deletions of HlF1ot, HIan and

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1/2a
Term Count P-Value

1 Biopolymer metabolic process 285 1.48E-05

2 RNA metabolic process 168 5.99E-04

3 Cell division 25 0.0020

4 Macromolecule metabolic process 343 0.0041

5 Intracellular signaling cascade 84 0.0044

6 Small gtpase mediated signal transduction 34 0.0059

7 Intracellular transport 51 0.0068

Nucleobase, nucleoside, nucleotide and nucleic acid

8 metabolic process 201 0.0069

9 Biopolymer modification 108 0.0071
10 Primary metabolic process 385 0.0091
1 1 Intracellular protein transport 35 0.0103
12 Gene expression 184 0.0128
13 Cellular localization 61 0.0136
14 Protein modification process 102 0.0150
15 Post-translational protein modification 90 0.0160
16 Establishment omrotein localization 52 0.01 73
17 RNA procesfig 31 0.0194
18 Regulation of transcription, DNA-dependent 1 30 0.0197
19 Transcription 140 0.0210
20 Protein localization 55 0.021 7
21 Cellular component organization and biogenesis 153 0.0218
22 Response to X-ray 4 0.0220
23 Metabolic process 418 0.0232
24 mRNA metabolic process 23 0.0243
25 Regiation of liquid surface tension 3 0.0246
26 Hindgut morphogenesis 3 0.0246
27 Regulation of macrophage activation 3 0.0246
28 Response to ionizing radiation 5 0.0256
29 Establishment of cellular localization 58 0.0263
30 Regulation of cellular process 216 0.0268
31 Biopolymer catabolic process 23 0.0272
32 Macromolecule localization 56 0.0276
33 Transcription, DNA-dependent 130 0.0277
34 RNA biosLnthetic process 130 0.0287
35 Protein transport 48 0.0288
36 Mitosis 17 0.0318
37 Rho protein signal transduction 11 0.0320
38 M phase 21 0.0323
39 M phase of mitotic cell cycle 17 0.0332
40 Biological remilation 256 0.0347
41 ReQJIaIion of angi_ogenesis 6 0.0380
42 Regulation of transcription 133 0.0409

 

137

 

Table 3.3. Continued.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Term Count P-Value
43 Embryonic organ development 6 0.0421
44 Cellular metabolic process 376 0.0475
45 Amino acid transport 7 0.0489
Regulation of nucleobase, nucleoside, nucleotide and
46 nucleic acid metabolic process 134 0.0551
47 Carboxylic acid transport 8 0.0561
48 Phosphcmid biosynthetic process 8 0.0561
49 Membrane lipid biosynthetic process 9 0.0571
50 Oganic acid transport 8 0.0599
51 Regulation of cell size 13 0.0602
52 Cellular zinc ion homeostasis 3 0.0620
53 Zinc ion homeostasis 3 0.0620
54 Vacuolar transport 4 0.0647
55 Protein targeting 19 0.0675
56 Regulation of biological process 231 0.0680
57 Dephosphorylation 1 3 0.0685
58 Cengrowth 1 2 0.0687
59 Regulation of smooth muscle contraction 4 0.0739
60 Negative regulation of angi_ogenesis 4 0.0739
61 Nucleocytoplasmic transport 1 1 0.0749
62 Protein-RNA complex assembly 9 0.0760
63 Macrophage activation 3 0.0770
64 Central nervous system neuron axonogenesis 3 0.0770
65 Nuclear transport 1 1 0.0784
66 Ras protein signal transduction 16 0.0784
67 Rgpilation of gene expression 138 0.0796
68 Phosphate transport 9 0.0844
69 Transition metal ion transport 7 0.0868
70 Ectodermal gut development 3 0.0930
71 Cerebellar Purkinje cell differentiation 3 0.0930
72 Cerebellar Purkinje cell layer formation 3 0.0930
73 Cerebellar Purkinje cell layer morphogenesis 3 0.0930
74 Lysosomal transport 3 0.0930
75 Ectodermal gut morphogenesis 3 0.0930
76 Pyrimidine nucleotide biosynthetic process 4 0.0941
77 Ubiquitin mle 33 0.0962

 

138

 

Table 3.4 Genes involved in surfactant metabolism

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF10l HIF20i HIF1I20t
Gene Symbol Ratio Ratio Ratio
surfactant associated protein 8 Sftpb -2.40 -1.07 -1.81
surfactant associated protein A1 Sftpat -4.70 -1.02 -1.47
synaptosomaI-associated protein 23 Snap23 -1.50 1.27 -1.13
golgi SNAP receptor complex member 1 Gosr1 -1.54 1.44 -1.19
golgi SNAP receptor complex member 2 Goer 202 1.34 -1.25
syntaxin 19 Stx19 -2.14 1.04 -1.10
swtaxin 11 Stx11 -1.98 1.28 -1.06
ATP-binding cassette, sub-family A (ABC1),
member 1 Abca1 -1.72 1.16 -1.20
ATP-binding cassette, sub-family A (ABC1),
member 6 Abca6 -4.46 1.98 -1.48
acfl-Coenzyme A oxidase 2, branched chain Acox2 -1.69 1.32 -1.14
stearoyl-Coenzyme A desaturase 1 Scd1 16.67 -1.08 -3.58
sterol reguZIatoerelement bindingfactor 2 Srebf2 -1.51 1.05 -1.23
low density lipoprotein receptor Ldlr -1.33 1.04 -1.09
CDP-diacnglycerol synthase 1 Cds1 -2.30 1.07 -1.39
acyl-CoA thioesterase 1 Acot1 -1.18 1.16 -1.28
apyl-CoA thioesterase 9 Acot9 -2.29 1.12 -1.38
lysophosphatidylcholine acyltransferase 1 chat1 -2.93 -1.04 -2.52
CDP-diacylglycerol synthase (phosphatidate
cytidylyltransferase) 2 Cdsz -1.09 1.28 -1.14
phosphatidylethanolamine binding protein 2 Pbp2 -2.91 -1.06 -1.13
inositol pohrphostjlate-S-phosphatase A lnpp5a -1 .51 1 .17 -1.09
inositol 1,4,5-trisphosphate 3-kinase A Itpka -2.38 1.10 1.12
phosphatidylinositol glycan anchor
biosynthesis, class A Figa -1.27 1.25 1.21
phosphatidylglycerophosphate synthase 1 3951 -1.32 -1.10 -1.28
choline phosphotransferase 1 Chpt1 -1.74 1.27 -1.11
choline kinase alpha Chka -1.03 1.03 1.26
1-acylglycerol-3-phosphate O-
acyltransferase 3 Agpat3 -1.30 1.02 -1.10
fatty acid synthase Fasn -1.34 1.17 -1.28
CAMP responsive element bintfipg protein 5 Creb5 -1.66 1.24 -1.40
CAMP responsive element bindigg protein 3 Creb3 -2.94 1.10 1.00
syntaxin 6 Stx6 -1.16 1.33 -1.51
syntaxin 3 Stx3 -2.04 1.38 -1.71
syntaxin 5A Stx5a -1.41 1.30 -1.18
N-ethylmaleimide sensitive fusion protein st -1.47 1.26 -1.23

 

139

 

Figure 3.9 QRTPCR verification of selected microarray gene
expression responses.

The same RNA used for CDNA microarrays was examined by QRTPCR.
All fold changes were calculated relative to controls. Iars (left y-axis) and
lines (right y-axis) represent QRT-PCR and microarray data, respectively.

Expression levels are expressed relative to HGPRT. “a” means statistically

different from 2qA/A, “b" means statistically different from 1oA/A,“c” means

statistically different from 1/2CIA/A. a, b and c designate statistical

significance at p 50.05.

140

CDP-diacylglycerol Synthase 1

[:QRT-PCR
'V' Microarray

.A
U"

 

 

 

 

 

 

 

 

.1.
'0
easy UOISSOdea museum

9
m

 

P
o

 

EIQRT-PCR
'V' Microarray

 

 

 

 

 

 

 

 

.3.
0"

.1
'0

easy uoissedea ABJJBOJOIW

I
P
m

 

P
o

 

2 1.25 b
"if
a; 1.00« I i
.9. A
g 0.75- \
a. 1
iii 0.50 if
m x
o
E 0.25
0.00
10LNA Zeb“ 1/20. NA
HIF Deletion Strain
3-HMG Coenzyme A Reductase
o 1.5
E
g t
- 1.0-
I -
5 c
a: 0.5 I
ii
at
o 0 0
. 1a.NA 2(1.AVA 1/20.AVA

HIF Deletion Strain

141

Figure 3.9. Continued.

|:|QRT-PCR
'0' Microarray

Matrix Metallopeptidase 9

 

 

 

 

 

 

 

 

 

 

o 1.0 1 0 g
.— O
3'3
5 a
a <
3 w
a 0.5 -0.5 '2
III a
a: 3;.
0 ac o
’ 3
0.0 , ~ 0.0 °
1a.NA 206MA “20.13,A
HIF Deletion Strain
:IQRT-PCR
'V' Microarray
Interleukin 1 Receptor- II
o 3 2 s
z 0
-§ 2. Q
3 Q
s -1 2
O
3 1- E.
u a o
3
t E a
0 0 °

 

 

 

 

 

1(1NA ZQNA 1/20.Am
HIF Deletion Strain

142

Figure 3.9. Continued.

CJQRT-PCR
'0' Microarray

Glutathione S-transferase mu 5

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2 a 10.0 g
3°: §
5 12‘ ~7.5 a
“g a f“
5 3‘ ~50 13
a 3
m 2.
E 4* ~2.5 3
tr :0
0 III .3
0 0.0 °
1U.NA ZaNA 1,2“ NA
HIF Deletion Strain
:lQRT-PCR
Hs3st3b1 'V' Microarray
o 10.0 a.c 4 g
f 3
‘2 7.5-« 1: -35
'15. e
m
'3 5.0- - 2 13
3 o
(r 3.
g 2.51 -1 g
a: :0
O b 3..
O
0.0 E ,
1am. ZaNA 1120. NA

HIF Deletion Strain

143

Figure 3.9. Continued.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

[:QRT-PCR
'V' Microarray
Niemann Pick type C1
0 2.0 1.5 g
:3 2
0: c o
g 1.5 3
'5 -1.0 Q
3 L“
a 1.0- 1.3,
a 3
a: I ~0.5 g.
g 0.51 a
a: '1; 2.:
o 0.0 A, A, 0.0 3'
1aA’A 2a. A 1/2or A
HIF Deletion Strain
[:lQRT-PCR
'V' Microarray
Glutathione S-transferase 00-2
2 4 g
£- I 3'
a: . g.
g I .-3 it
.- 9
a a 7;,
0
.. t
5 x -1 §
it ~ :0
o 3.
0 A! A/ A/ O 0
1a. A 20. A 1I2a A

HIF Deletion Strain

144

secretion pathways. The comparison of HlF1oA/A expression patterns and
those of HIF1/20mm identified several genes that showed rescued expression
upon loss of both HIF isoforrns. These genes are important in lipid
biosynthesis (e.g. acyl-CoA thioesterase 9, sterol regulatory element binding
factor 2) or surfactant transport and secretions (e.g. golgi SNAP receptor
complex member 2, SNAP 23). Interestingly, some of the genes such as
stearoyl- Coenzyme A desaturase 1 and surfactant protein B did not exhibit

significantly increased expression after accompanied deletion of HlF2a.

QRTPCR verification of selected microarray gene expression responses.

Quantitative real-time PCR (QRT-PCR) was used to verify the differential
expression for a selected subset of differentially expressed genes representing
different response profiles and functions (table 3.1). In general, there was a
good agreement in the level of differential expression when

comparing microarray and QRT-PCR data (Fig. 3.9).

Discussion

Normal prenatal lung development is essential for the smooth transition of
the placental gas transport to an air breathing at the birth. This complex
process is characterized by biochemical, cellular and ultrastructural changes
that are precisely controlled by the spatiotemporal pattern of expression (or

activity) of large number of transcriptional and paracrine factors. Several

145

transcription factors including KLF5, Foxa2, CEBPa, GATA-6, B-catenin and
thyroid transcription factor-1 have already been added to the list of
indispensables for lung development [3-7, 9]. However, further testing for the
other devel0pmentally critical transcriptional factors, individually or collectively,
will provide a broader understanding on the intricate networks and cascades
involved in lung development.

HlFs are a class of transcription factors that play a critical role in oxygen
sensing and the metabolic adaptations to hypoxia. HlFla is a most widely
expressed isoform of HlFs. Previous studies have shown that targeted gene
disruption of the HlF1a locus results in the mid-gestational lethality due to
cardiovascular defects [15, 33]. Mice partially deficient for HlF1o alleles
showed normal development but were physiologically compromised as they
exhibited impaired pulmonary vascular remodeling under chronic hypoxic
stress [16, 34]. Similarly, targeted disruption of HlF2a, another pulmonary
isoform of HlFs, have shown that reduced VEGF expression leads to

respiratory distress at birth [20].

Recently, using a lung-specific HlF1a deficient mouse model, epithelial-
derived HlF1a deletion led to compromised lung development and altered
surfactant metabolism [21]. The epithelial-specific loss of HlF1oc leads to
neonatal respiratory distress syndrome due to impaired alveolar epithelial
differentiation. Morphogenesis of conducting ainNays, however, was

unaffected, suggesting the involvement of HlF1oc in late events in lung

146

morphogenesis rather than in the early lung biogenesis and airway branching

morphogenesis.

To further investigate the role of HlF2a in lung development, lung-specific
HlF2a deficient and HlF1od2a deficient mice were generated. The results
suggest that lung-specific loss of HlF2a does not result in the respiratory
distress. The difference between these results and previously published
reports most likely stems from genotype and strain differences of the mice
used [20]. The previously published report used traditional HlF2a knockout
mice generated in a specific genetic background and the conclusions were
based on a percentage of mice that survived until parturition. These
differences in genetic background, genotype, and the loss of HIF2a from other
organs, most notably the cardiac tissue, are potentially confounding factors.
The data presented here suggests that loss of HlF2a specifically from the
lungs leads to no overt phenotype and actually might lead to more developed

lungs when compared to genotype controls (Fig. 3.4).

The simultaneous deletion of HlF1a and HlF2a isoforrns rescues the
respiratory distress phenotype that was observed in HlF1oc deficient mice. To
investigate the mechanisms underlying these interesting, microarray analysis
was performed to identify differentially expressed genes. Extensive data
mining and literature search revealed that the deficiency of HlF1a protein

results in the differential expression of 1069 unique genes whereas the

147

deficiency of HlFZa protein affected the expression of only 155 genes.
Interestingly, after HlF1a/2a deficiency the list of differentially expressed
genes was reduced to only 149 out of which 113 genes overlapped with HlFla
deficient mice (Fig. 3.88). Out of 1069 genes, the expression patterns of 890
genes were specifically disturbed in HlF1or deficient mice. Previous study on
the characterization of the respiratory distress phenotype in HlF1a deficient
mice highlighted the altered surfactant proteins expression and the expression
of developmentally critical genes [21]. However, the screening for the
biological processes affected by the deletion of HlF1a returned a list of wide
variety processes such as biopolymer metabolic processes, RNA metabolism,
cell division, intracellular signaling cascades and intracellular protein sorting
(Table 3.3). Further search for the cellular pathways affected revealed the
perturbation of vesicular transport pathways and cell cycle pathways (Table
3.2). Proper functioning and regulation of vesicular transportation is an
important step in the processing and secretion of surfactants and associated

proteins.

Pulmonary surfactants are modified in the golgi apparatus and are then
released from the trans golgi network into secretory vesicles, known as
composite bodies, the immediate precursors of lamellar bodies. The lamellar
body-bound surfactants are released via exocytosis into the lumen alveolar
lumen where it forms a lattice-like network known as tubular myelin. The

processes involving intracellular sorting (golgi transport, vesicular fusion) and

148

surfactant biosynthesis (fatty acid metabolism, cholesterol sythesis,
plospholipids biosynthesis) are specifically affected in HlF1a deficient mice

(Table 3.4).

Genes involved in vesicular transport such as Gosr2, SNAP-23,
Syntaxins are downregulated in HlF1or deficient mice but were restored to
normal levels in HlF1o/2a deficient mice [35]. Similarly, levels of expressions
of genes involved in lipid metabolism such as Acot9, CDS-1, SOD-1, Acox2,
CDS-2, Chpt-1, Itpka were increased in HlF1a/2a deficient mice [36, 37]. PAS
staining for glycogen deposition also suggested the complete utilization of
glycogen in HlF2a and HlF1a/2a deficient mice (Fig.3.7). Taken together,
these findings suggest the global alteration of the surfactant metabolism
starting from the phospholipids and protein biosynthesis to the final exocytosis
of packaged surfactants into the alveolar space upon perturbation of the

hypoxia signaling cascade in the lungs.

Interestingly, genes involved in cellular processes such as cell cycle
and biopolymer metabolism showed differential gene expression pattern. The

first category includes genes such as interleukin 1 receptor type II (lL1-Rll)

that are minimally expressed in from HIF1aA/A lungs but show higher

expression in HIF1/2(1A/A lungs. The second category includes genes such as

heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1 (Hs3st331) that are

149

highly expressed in HlF1c1A/A lungs but show lower expression in HIF1/2(1A/A

lungs (Fig. 3.9). Interleukin 1 (lL1oc and IL1B) has been shown to promote
lung function and surfactant biosynthesis [38]. Similarly, heparan sulphate
proteoglycans are required for various signaling pathways critical in the lung
development [39].
I In conclusion, the present study provides evidence that HlF1a plays an
important role in multiple processes including surfactant metabolism,
metabolic pathways, signal transduction cascades and vesicular trafficking.
The lung-specific deletion of HlF2a alone, however, is not lethal to the
neonatal pups and there was no sign of observable pathology. Interestingly,
the rescue of respiratory distress was observed after simultaneous deletion of
both the isoforms of HlFs. Microarray analysis of the lungs has identified

interesting genes that might be the focus of further investigation.

150

REFERENCES

1

James Metcalfe, H. B., Waldemar Moll. (1967) Gas Exchange in the
Pregnant Uterus. Physiol. Rev. 47, 782-838.

Groenman, F., Unger, S. and Post, M. (2005) The molecular basis for
abnormal human lung development. Biology of the Neonate. 87, 164-
177

DeFelice, M., et al. (2003) TTF-1 phosphorylation is required for
peripheral lung morphogenesis, perinatal survival, and tissue-specific
gene expression. The Journal of biological chemistry. 278, 35574-
35583

Liu, C., Morrisey, E. E. and Whitsett, J. A. (2002) GATA-6 is required
for maturation of the lung in late gestation. Am J Physiol Lung Cell Mol
Physiol. 283, L468-475

Martis, P. C., et al. (2006) C/EBPalpha is required for lung maturation at
birth. Development (Cambridge, England). 133, 1 155-1 164

Mucenski, M. L., et al. (2003) beta-Catenin is required for specification
of proximal/distal cell fate during lung morphogenesis. The Journal of
biological chemistry. 278, 40231-40238

Wan, H., et al. (2004) Foxa2 is required for transition to air breathing at
birth. Proceedings of the National Academy of Sciences of the United
States of America. 101, 14449-14454

Yang, H., et al. (2002) GATA6 regulates differentiation of distal lung
epithelium. Development (Cambridge, England). 129, 2233-2246

Wan, H., et al. (2008) Kruppel-like factor 5 is required for perinatal lung
morphogenesis and function. Development (Cambridge, England). 135,
2563-2572

151

10

11

12

13

14

15

16

17

18

19

Dave, V., et al. (2006) Calcineurin/Nfat signaling is required for
perinatal lung maturation and function. The Journal of clinical
investigation. 116, 2597-2609

Semenza, G. L. (2000) HIF-1: mediator of physiological and
pathophysiological responses to hypoxia. J Appl Physiol. 88, 1474-1480

Groenman, F., et al. (2007) Hypoxia-inducible factors in the first
trimester human lung. J Histochem Cytochem. 55, 355-363

Cowden Dahl, K. D., et al. (2005) Hypoxia-inducible factors 1 alpha and
2 alpha regulate trophoblast differentiation. Molecular and cellular
biology. 25, 10479-10491

Compemolle, V., et al. (2003) Cardia bifida, defective heart
development and abnormal neural crest migration in embryos lacking
hypoxia-inducible factor-1 alpha. Cardiovascular research. 60, 569-579

Ryan, H. E., Lo, J. and Johnson, R. S. (1998) HIF-1 alpha is required
for solid tumor formation and embryonic vascularization. The EMBO
journal. 17, 3005-3015

Yu, A. Y., et al. (1999) Impaired physiological responses to chronic
hypoxia in mice partially deficient for hypoxia-inducible factor 1alpha.
The Journal of clinical investigation. 103, 691-696

Peng, J., Zhang, L., Drysdale, L. and Fong, G. H. (2000) The
transcription factor EPAS-1/hypoxia-inducible factor 2alpha plays an
important role in vascular remodeling. Proceedings of the National
Academy of Sciences of the United States of America. 97, 8386-8391

Patel, S. A. and Simon, M. C. (2008) Biology of hypoxia-inducible
factor-2alpha in development and disease. Cell death and
differentiation. 15, 628-634

Asikainen, T. M., et al. (2006) Improved lung growth and function
through hypoxia-inducible factor in primate chronic lung disease of
prematurity. Faseb Journal. 20, (E986-E994) 1698-1700

152

2O

21

22

23

24

25

26

27

28

29

Compemolle, V., et al. (2002) Loss of HIF-2alpha and inhibition of
VEGF impair fetal lung maturation, whereas treatment with VEGF

prevents fatal respiratory distress in premature mice. Nature medicine.
8, 702-710

Saini, Y., Harkema, J. R. and LaPres, J. J. (2008) HlF1alpha is
essential for normal intrauterine differentiation of alveolar epithelium
and surfactant production in the newborn lung of mice. The Journal of
biological chemistry. 283, 33650-33657

Ryan, H. E., Lo, J. and Johnson, R. S. (1998) HIF-1 alpha is required
for solid tumor formation and embryonic vascularization. Embo Journal.
17, 3005—301 5

Ryan, H. E., et al. (2000) Hypoxia-inducible factor-1 alpha is a positive
factor in solid tumor growth. Cancer Research. 60, 4010-4015

Perl, A. K., et al. (2002) Early restriction of peripheral and proximal cell
lineages during formation of the lung. Proc Natl Acad Sci U S A. 99,
10482-10487

Lobe, C. G., et al. (1999) Z/AP, a double reporter for ore-mediated
recombination. Dev Biol. 208, 281-292

Gruber, M., et al. (2007) Acute postnatal ablation of Hif-2alpha results
in anemia. Proceedings of the National Academy of Sciences of the
United States of America. 104, 2301-2306

Burgoon, L. D. and Zacharewski, T. R. (2007) deach toxicogenomic
information management system. Pharrnacogenomics. 8, 287-291

Burgoon, L. D., et al. (2005) Protocols for the assurance of microarray
data quality and process control. Nucleic acids research. 33, e172

Eckel, J. E., et al. (2005) Normalization of two-channel microarray
experiments: a semiparametric approach. Bioinforrnatics (Oxford,
England). 21, 1078-1083

153

30

31

32

33

34

35

36

37

38

39

Eckel, J. E., et al. (2004) Empirical bayes gene screening tool for time-
course or dose-response microarray data. Journal of biopharrnaceutical
statistics. 14, 647-670

Dennis, G., Jr., et al. (2003) DAVID: Database for Annotation,
Visualization, and Integrated Discovery. Genome biology. 4, P3

Vengellur, A. and LaPres, J. J. (2004) The role of hypoxia inducible
factor 1 alpha in cobalt chloride induced cell death in mouse embryonic
fibroblasts. Toxicological Sciences. 82, 638-646

lyer, N. V., et al. (1998) Cellular and developmental control of 02
homeostasis by hypoxia-inducible factor 1 alpha. Genes &
Development. 12, 149-162

Semenza, G. L. (2005) Pulmonary vascular responses to chronic
hypoxia mediated by hypoxia-inducible factor 1. Proceedings of the
American Thoracic Society. 2, 68-70

Abonyo, B. 0., et al. (2004) Syntaxin 2 and SNAP-23 are required for
regulated surfactant secretion. Biochemistry. 43, 3499-3506

Zhang, F., Pan, T., Nielsen, L. D. and Mason, R. J. (2004) Lipogenesis
in fetal rat lung: importance of C/EBPalpha, SREBP—1c, and stearoyl-
CoA desaturase. American journal of respiratory cell and molecular
biology. 30, 174-183

Batenburg, J. J. and Haagsman, H. P. (1998) The lipids of pulmonary
surfactant: dynamics and interactions with proteins. Progress in lipid
research. 37, 235-276

Willet, K. E., et al. (2002) lntra-amniotic injection of lL-1 induces
inflammation and maturation in fetal sheep lung. Am J Physiol Lung
Cell Mol Physiol. 282, L411-420

Hu, 2., et al. (2009) NDST1-dependent heparan sulfate regulates BMP
signaling and internalization in lung development. Journal of cell
science. 122, 1145-1154

154

Chapter 4

The Role of Hypoxia Inducible Factor 10: (HlF1a) in Modulating Cobalt-
lnduced Lung Inflammation

This chapter is the edited version of a research article that was published in
American Journal of Physiology, Lung Cellular and Molecular Physiology.

2009 Nov 13.

Authors: Yogesh Saini, Kyung Y. Kim, Ryan Lewandowski, Lori A. Bramble,

Jack R Harkema, John J. LaPres

155

ABSTRACT

Hypoxia plays an important role in development, cellular homeostasis, and
pathological conditions, such as cancer and stroke. There is also growing
evidence that hypoxia is an important modulator of the inflammatory process.
Hypoxia inducible factors (HlFs) are a family of proteins that regulate the
cellular response to oxygen deficit and loss of HlFs impairs inflammatory cell
function. There is little known, however, about the role of epithelial-derived
HIF signaling in modulating inflammation. Cobalt is capable of eliciting an
allergic response and promoting HlF signaling. To characterize the
inflammatory function of epithelial derived HIF in response to inhaled cobalt, a
conditional lung specific HlF1or deletion mouse was created. Wild type mice
showed classic signs of metal-induced injury following cobalt exposure,
including fibrosis and neutrophil infiltration. In contrast, HlF1or deficient mice
displayed a Th2 response that resembled asthma, including increased
eosinophilic infiltration, mucus cell metaplasia, and chitinase-like protein
expression. The results suggest that epithelial derived HIF signaling has a
critical role in establishing a tissue’s inflammatory response, and compromised

HlF1or signaling biases the tissue towards a Th2-mediated reaction.

156

INTRODUCTION

Lung diseases, including chronic obstructive pulmonary disease and
asthma, involve a large inflammatory component. The lung's response to
allergens involves a complex interplay between resident inflammatory and
epithelial cells, cytokine signaling, and the environmental conditions within the
tissue. One of the critical environmental features that can impact the

inflammatory process is hypoxia.

Hypoxia, a decrease in available oxygen reaching the tissues of the body,
has profound cellular and metabolic consequences. The cellular response to
hypoxia is regulated by a family of transcription factors called the hypoxia
inducible factors (HlFs) [1]. HlFs are primarily regulated at the level of protein
stability by a family of prolyl hydroxylases. These prolyl hydroxylase domain
(PHDs) proteins are members of a broader family of non-heme, iron- and 2-
oxoglutarate dependent dioxygenases [2]. Cobalt has been shown to inhibit
PHDs and this inhibition causes very similar transcriptional outputs to that of
hypoxia [3, 4]. Recent research using human peripheral blood mononuclear
cells has shown that this transcriptional overlap applies to tungsten carbide-

cobalt particles, linking hard metal lung disease to hypoxia signaling [5].

HlF1or is the most ubiquitously expressed and widely studied HIF isoform.
HlF1or heterodimerizes with the aryl hydrocarbon receptor nuclear translocator

(ARNT, also known as HIF1B) forming the functional transcription factor HIF1.

157

HIF1 regulates the expression of over one hundred genes, including genes for
glycolytic enzymes, sugar transporters, and pro-angiogenic and inflammatory
factors [6-9]. Moreover, HlF1or has also been shown to modulate
inflammation indirectly by influencing the NFKB signaling pathway [8, 10].
Given the relationship between cobalt, HlF1a, and inflammation, it seems
likely that HlF1or will impact cobalt-induced injury in vivo. More specifically, it
is hypothesized that cobalt-induced HIF1-mediated transcription will impact

cobalt-related asthma and/or hard metal lung disease [5].

Cobalt (or hard metal) asthma is one of three occupational respiratory
diseases associated with exposure to the transition metal. The other two are
hypersensitivity pneumonitis and interstitial lung disease with fibrosis. These
diseases are caused by the inhalation of hard metal particles and are
characterized by airway constriction, alveolitis, fibrosis and associated giant
cell interstitial pneumonitis [11]. Asthma associated with cobalt exposure most
likely involves an allergic response and has variable latency periods following
initial sensitization [12-14]. Cobalt-specific lmmunoglobulin isotype E (lgE),
has been characterized in workers with signs of cobalt asthma, and their
symptoms can be relieved upon removal from the contaminated environment
[12]. Besides acting as a pro-oxidant and sensitizer in the lung and skin,

cobalt has also been characterized as a hypoxia mimic [4].

158

To characterize the role of HlF1or in cobalt-induced lung injury, a lung
specific HlF1or knock out mouse model was created. In utero deletion of
HIF1or led to lethality due to respiratory distress upon parturition [15]. In the
present study, post-natal deletion of HlF1oc from Type II and Clara cells had no
observable pathology. In order to elucidate the role of epithelial derived-
HlF1a signaling in cobalt-induced lung injury, these mice were exposed to
cobalt chloride via oropharyngeal aspiration. Compared to control mice, mice
that were HlF1or deficient in their lungs (HIF10rA/A) exhibited airway infiltration
of eosinophils associated with airway epithelial changes, including mucus cell
metaplasia and increased levels of the chitinase-like proteins YM1 and YM2.
Mice deficient in HlF1a also showed a drastic change in cytokine profiles in
their lavage fluid when compared to their control. These results suggest that
loss of HlF1or from alveolar Type II epithelial and Clara cells of the lungs leads
to cellular and molecular processes that are associated with asthma following
cobalt exposure and that airway epithelial-derived HlF1or plays a critical role in

modulating the inflammatory response of the lung.
MATERIALS AND METHODS

Description of mice: Triple transgenic mice were created by mating

HlF1orfl°wIOX (a generous gift of Randall Johnson, Univ. Califomia-San Diego)

and SP-C-rtTA'ltg/(tetO)-/-CMV-Cretg/t9 transgenic mice (a generous gifts of

159

Jeffrey A. Whitsett Cincinnati Children’s Hospital Medical Center) [16-19]. The

generated mice, SP-C-rtTA-ltg/(tetO)7-CMV-Cretg/tg/H|F1afloxmox, are capable

of respiratory epithelium specific conditional recombination in the floxed HIF1o
gene upon exposure to doxycycline [18]. In addition to the triple transgenic
controls, four additional genotypes were employed to rule out effects of any

one locus in the presence and absence of doxycycline. These include, SP-C-

nTA'ltg/(tetO)7-CMV-Cre'l'lHlF1a+/+ (sTH), SP-C-rtTA'l'AtetOh-CMV-

Cretg/tg/HIF1(1+/+ (StH), SP-C-rtTA'ltg/(tetOh-CMV-Cretg/tg/HlF10+” (stH) and

SP-C-rtTA'l'/(tetO)7-CMV-Cre'l'lHlF1afloxmox (STh). The HlF1ofl°xm°x were

originally maintained in a CS7BL/6 background, whereas the SP—C-rtTA'ltg/

(tetO)7-CMV-Cretg/tg were generated in an FVB/N genetic background.

These parental strains were carefully mated to acquire the necessary
genotypes for the described experiments and all of the mice used in this study
have been maintained in this mixed CS7BL/6 and FVB/N background.
Genotyping of the mice was performed by PCR for all the three loci as

previously described [15].

Doxycycline treatment and animal husbandry: In utero exposure to
doxycycline in the triple transgenic mice led to lethality upon parturition [15].
Postnatal recombination was carried out by exposing lactating dams to

doxycycline containing feed (625 mg doxycycline/Kg; Harlan Teklad, Madison,

160

WI) and drinking water (0.8 mg/ml: Sigma chemicals Co.) until weaning. Triple
transgenic mice were then maintained on the same doxycycline containing
food and water until they were approximately 7 weeks of age. Doxycycline
treatment was terminated 7-10 days prior to first exposure to metals. These

mice will be referred to as HlF1adeficient or HlF1aA/A throughout the

chapter. Control animals used in the study were triple transgenic (SP-C-rtTA'

Itg/(tetO)7-CMV-Cretg/tnglF1afloxmox) mice that were maintained on normal

food and water ad Iibitum. All of the remaining genotype control lines
described above were exposed to doxycycline for the same 7 week paradigm
when appropriate. Mice used in this study were kept at the animal housing
facility under the strict hygienic and pathogen free conditions approved by the
university laboratory animal resource (ULAR) regulatory unit. All the animal
handling and necropsy protocols were approved by the ULAR regulatory unit

of Michigan State University.

Cobalt exposure, tissue harvesting and processing: 18 mice from each
genotype were randomly assigned to one of three groups. Mice were treated
with saline, 5 mM, or 10 mM cobalt chloride in 25 [LL volume by oropharyngeal
aspiration. These cobalt concentrations correspond to 30 and 60 pg daily
exposure, respectively. Mice were treated for 5 days on, 2 days off, 5 days on
and then euthanized 72 hours after the last exposure. Mice were assessed for
total body weight prior to first treatment and assessed again prior to sacrifice.

Following exposure, mice were anesthetized with sodium pentobarbital (50

161

mg/ml), and a midline Iaparotomy was performed. The trachea was exposed
and cannulated. The lung and heart were removed en bloc and the lungs
were lavaged with two successive 1 ml volumes of sterile saline. These
fractions were combined and total cell counts were performed using a
hemocytometer. Differential cell counts were performed in cytospin samples
using Diff-Quik reagent (Baxter, FL). The remaining BALF was frozen for
cytokine profiling. The right lung lobe was removed and stored in RNA/afar
RNA stabilizing reagent (Qiagen, Valencia, CA) for RNA isolation. The left
lobe was perfusion inflated and fixed in 10% neutral buffered formalin for

histopathological analysis.

Histopathology and immunohistochemistry: At least four to six mice from
each genotype and treatment group were analyzed for histopathological
changes. Formalin fixed left lung lobe tissues were paraffin embedded and 5-
micron thick sections were mounted on glass slides and stained with
hematoxylin and eosin (H&E) or immunostained with HlF1a (1: 500 dilution,
NB100-479, Novus Biologicals, Littleton, CO), major basic protein (1:500
dilution, Mayo Clinic, AZ), or YM1 (1:100 dilution, ABZ4608; Abcam,
Cambridge, MA) as previously described [15]. Other lung sections were
histochemically treated with picro-sirius red solution for interstitial collagen
staining to identify areas of pulmonary fibrosis or with Alcian Blue (pH
2.5)lPeriodic Acid Schiff (AB-PAS) stain to identify mucosubstances in mucous

cells.

162

RNA isolation and quantitative real-time PCR (qRT-PCR) analysis: Lung
tissue (10 mg) stored in RNA/ater RNA Stabilization Reagent was
homogenized in RLT buffer (RNeasy RNA isolation Kit, Qiagen, Maryland)
using a Retsch MM200 bead beater system (Retsch, Haan, Germany). Total
RNA quantification was performed spectrophotometrically (NanoDrop ND-
1000 UV-Vis Spectrophotometer). Total RNA (1 ug) was reverse transcribed
using superscript ll reverse transcriptase kit (lnvitrogen, CA). cDNAs from
each experimental group were pooled and quantitative real-time PCR array
analysis reactions were carried out in duplicate on an ABI Prism 7900HT 384-
well block using TaqMan assays (ABI, Applied Biosytems, Foster City, CA).
The complete table of the genes analyzed is listed in table 4.1. Changes in
gene expression were calculated using the 21““:t method. An average of the
number of cycles of three housekeeping genes, GAPDH, Actin-B, and 188,
was used to normalize the expression between samples. Genes that had
greater than a 2 fold change in expression level when compared to the control
group were further analyzed by qRT-PCR using individual samples run in
duplicate to confirm the PCR array results. Samples exhibiting Ct values
greater than 40 were deemed undetermined and removed from subsequent
analysis. Outliers were removed by Grubbs test and averages compared.

The fold changes for these genes are listed in Table 4.2.

Determination of cytokine levels by Bead array: Bronchoalveolar lavage

fluid was analyzed for lL-1B, Eotaxin, KC, lL-6, lL-10, lL-12, lL-4,|L-5, lL-13, IL-

163

2, Rantes, GM—CSF, INF-y, TNF-a, MOP-1, VEGF, MlP-2, MlP-1or using a Bio-
Plex 200 system and reagents (Bio-Rad Laboratories Inc, Hercules, CA, USA)
according to manufacturer's instructions. Briefly, cytokine specific antibody
coupled color-coded beads are allowed to react with the cytokines present in
the sample. Following extensive washing, a biotinylated detection antibody is
added to the cytokine bound beads. The sandwich complex formation is
detected by the addition of streptavidin-phycoerythrin. Cytokines are identified
and quantitated based on bead color and fluorescence. Cytokine levels are
calculated by system-specific software (Bio-Plex Manager”) using a standard
curve derived from a recombinant cytokine standard. A multiplex assay was
performed by mixing beads specific to each of above listed cytokines and
incubating them with 50 pl of undiluted BALF in the provided 96 well filter plate.
Following washing, all the respective detection antibodies were added to wells
followed by addition of streptavidin-phycoerythrin. Values from blank wells for
each cytokine were subtracted from the corresponding cytokine values in each
sample. Negative values were set to zero. Outliers were removed by Grubbs’
Test, averages were calculated, and significance determined by ANOVA

followed by Tukey’s HSD test.

Quantitative analysis: All cell counts and cytokine and gene expression data
were analyzed by ANOVA followed by a Tukey’s HSD test. All the data from
the study was presented as standard error of the mean (SEM). Statistical

difference of P value less than 0.05 was considered as significant.

164

RESULTS:

Post-natal deletion of HlF1a: The initial description of the lung specific cre
recombinase model had very little data regarding post-natal deletion, however,
it can be assumed that doxy-induced cre expression will be restricted to Clara
and Type II cells since SPC expression is restricted to these cells types in the
adult animal [18]. To determine if prolonged exposure to doxycyline (Dox)
could induce recombination within the conditional HlF1or locus, mice were
exposed to Dox for approximately 7 weeks starting on post-natal day 4 (PN4).
Initially, they received the drug through their mother’s milk, and then through

their food and water. These mice will be referred to as HlFlor deficient or

HlF1orA/A. The mice referred to as controls throughout the studies are triple

transgenic (SP-C-rtTA-ltg/(tetO)7-CMV-Cretg/tg/HlF1dfloxmox) mice that were

maintained on regular feed and water. The lungs of control and Dox treated
mice were then removed and analyzed for HIF1or expression via
immunohistochemistry (IHC). Control mice showed pronounced HlF1cr
expression in the Clara cells lining the bronchiolar airway and Type II cells of
the alveoli (Figs. 4.1A and 4.1B). In contrast, the HlF1dA/A mice showed a
marked decrease in expression in these cells, with only minor staining visible
in the bronchiolar ainlvay lining cells and little or no staining in the alveoli (Figs.

4.1C and 4.1 D).

165

Figure 4.1. HIF1a immunohistochemistry of lungs from control
and doxycycline treated mice

Lung tissue sections from control (A and B) and HlF1aA/A (C and D)
were analyzed by immunohistochemistry using a HlF1a—specific
antibody. Control (A and B) and doxycycline (C and D) treated mice
were compared. HlF1astaining is prominent in the epithelial cell (e)
lining the bronchiolar airway (BA) and type II cells (Solid arrow) in the
alveolar duct (AD) and alveolus (a). Staining is greatly reduced in the
postnatally doxycycline treated animals (C and I).

"Images in this dissertation are presented in color."

166

 

167

The results suggest that postnatal exposure to Dox can induce significant
recombination of the HlF1alocus and that the triple transgenic mouse is a

viable model to test the role of HlF1a in cobalt-induced lung injury.

Body weight change and cell counts in lavage fluid: To characterize the
role of HlF1or in cobalt-induced lung injury, control and HlF1orA/A mice were
randomly assigned to three groups. Individual groups received, sterile saline,
30, or 60 [lg cobalt chloride by oropharyngeal aspiration per day using a two
week protocol, 5 days on, 2 days off, 5 days on, and 2 days off. Total body
weight of some of the control mice rose slightly during the course of the
exposure however the body weight gain remained largely unchanged. In
contrast, the HlF1orA/A mice lost weight in a dose dependent fashion (Fig.
4.2A). Though this decrease was not significant, it was the first indication that
the HlF1or deficient mice responded differently to cobalt challenge. After the
final 2-day incubation, mice were euthanized, BALF was collected, and lung
tissue was processed for light microscopic examination, IHC, and RNA
isolation. HlF1a—deficient mice treated with 60 ug cobalt chloride showed
significant increase in total BALF cells as compared to 60 pg cobalt chloride
treated control mice suggesting that loss of HlF1or in the Clara and Type II
cells made the mice more susceptible to injury (Fig. 4.23). Specific cellularity

within the BALF was also different between the two genotypes.

168

Figure 4.2. Weight change and cell counts from cobalt challenged
control and HlF1aA/A mice.

Mice were exposed to saline, 30 pg (5 mM) or 60 pg (10 mM) CoClz for
2 week, 5 days/week paradigm. Total animal weight change (A) in
control (white bars) and HlF1aA/A (black bars) were calculated by
subtracting animal weight on the day of sacrifice from weight at the start
of exposure. Total cell counts from BALF (B) were assessed from all of
the mice and averaged. Cell differential counts were performed for
macrophages (C), lymphocytes (D), neutrophils (E), and eosinophils (F).

N>5 mice/group. * = Significance (p values noted).

169

  

 

  

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

. , an
TI; .1
,,, 8
31: g 1001) > d .
f0
.5 '5. 3
2 g redo > d e g
:3 '8
LL]
5 .‘s’
IOO'O 3" d t 75
m
:1. ' In ' In ' Z-t '
(you) rw Jed srrad
LI-
2
8
.2
'5 in 3
U = o
'5 “g. ‘“
r“? a
g .5
".5:
(son) rw Jad 51183 N 7'
(,(nx) nu 13d snag
I.“
a:
“:2
o 21';
I ‘° °
$9
3 ‘6 on
o g. 3'
I m g 8
.c
.‘s’ g-
7; U
- I. - f” 3 =-
e-q O H Vt
+ 0
sun afiue Bra
1 a) "3 W ° M (you) rw Jad Suez)
o
<

170

Cobalt-treated control and HlF1ch/A mice showed dose-dependent increases
in lymphocytes and macrophages, however, only HlF1aA/A mice treated with
60 pg cobalt was significant when compared to saline (macrophages and
lymphocytes) and 30 pg (macrophages only) treated HlF1aA/A mice (Figs.
4.2C and 4.2D). Moreover, the 60 pg treated HlF1aA/A mice displayed a
significant increase in macrophages as compared to control mice treated with
60 pg cobalt. Lymphocytes and neutrophils displayed no significant changes
when control and HlF1aA/A mice were compared within treatment groups.
Control mice displayed a non-significant increase in neutrophils compared to
HlF1or deficient mice (Fig. 4.2E). In contrast, the HlF1aA/A mice following
cobalt (60 pg) exposure displayed a significant increase in eosinophils when
compared to all other groups, suggesting that HlF1a plays a role in modulating
the lung’s inflammatory response to metals (Fig. 4.2F). These changes were
specific to the loss of HlF1or and not due to Dox treatment or the SPC-rtTA or

tet-Cre transgenes as different doxycycline treated monotransgenic and

bitransgenic (SP-C-rtTA'ltg/(tetOh-CMV-Cre"'/HIF10+” (sTH), SP-C-rtTA'l'

lltetOh—CMV-Cretg/tg/HlF1q+/+ (StH), SP-C-rtTA'ItQ/(tetOh-CMV-

Cretg/tg/HIF1a+/+ (stH) and SP-C-rtTA'I'AtetOh-CMV- Cre"'/Hrr=1a“°"’"°"

(STh)) mice behaved similar to control mice (SP-C-rtTA'ltg/(tetOh-CMV—

Cret9“9/HIF1a"°"’"°" (sth) (Fig. 4.3).

171

Table 4.1. List of genes analyzed qRT-PCR

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Gene
Symbol Gene Description TaqMan Assay ID
188 188 4352930E
Actb Beta Actin 4352933E
Arbp acidic ribosomal phosphoprotein P0 Mm01974474 gH
Gapd Glyceraldehyde 3phosphate dehfliggenase 4352932E
Gusb Muronidase, beta Mm00446953_m1
Alf4 activating transcription factor 4 Mm00515324_m1
Cat catalase Mm00437992__m1
CcI2 Monocyte chemotactic protein-1 Mm00441242_m1
Ccl3 Macrophage inflammatory protein 1 alpha Mm00441258_m1
Ccl4 Macrophageinflammatory protein 1 beta Mm00443111_m1
Regulated upon activation, normal T cell expressed and
00/5 secreted Mm01 30242 7_m1
Ccl1 1 Eotaxin Mm00441238_m1
Chi3/3 chitinase 3-like 3 (YM1) Mm00657889_mH
Chi3l4 chitinase 3-like 4 (YM2) Mm00840870_m1
Clca3 chloride channel calcium activated 3 (Gob-5) Mm00489959_m1
Crp C-reactive protein, pentraxin-related Mm00432680 g1
Cxcl1 Cxcl1 keratinogtte chemoattractant Mm00433859_m1
Cxcl2 Cxcl2 macrophage-inflammatory protein-2 Mm00436450_m1
Cyp291 cytochrome P450, family2, subfamily e, polypeptide1 Mm00491127_m1
Efl epidermal flwth factor receptor Mm00433023_m1
F2r coggulation factor II (thrombin) receptor Mm00438851_m1
(ng fibroblast growth factor 9 Mm00442795_m1
fgf10 fibroblast growth factor 10 Mm00433275_m1
fgf18 fibroblast growth factor 18 Mm00433286_m1
Foxa1 forkhead box A1 Mm00484713_m1
Foxa2 forkhead box A2 Mm00839704_mH
Foxp3 forkhead box P3 Mm00475165_m1
Gata3 GATA binding protein 3 Mm00484683;m1
Gclc flamate-cysteine ligase, catalytic subunit Mm00802655_m1
Gclm glutamate-cysteine ligase, modifer subunit Mm00514996_m1
Gstk1 glutathione S-transferase kappa 1 Mm00504022_m1
Gstm1 glutathione S-transferase, mu 1 Mm00833915 g1
Gstp1 glutathione S-transferase, pl 1 Mm00496606_m1
Hmox heme oxygenase (decycling) 1 Mm00516004_m1
[er9 interferon gamma Mm00801778_m1
IL 1b interleukin 1 beta Mm00434228_m1
Il1rn interleukin 1 receptor antagonist Mm01337566_m1
IL2 interleukin 2 Mm00434256_m1
IL4 interleukin 4 Mm00445259_fl1
IL5 interleukin 5 Mm00439646_m1
IL6 interleukin 6 Mm00446190_m1
IL10 interleukin 10 Mm00439616_m1
lL-13 interleukin 13 Mm00434204_m1

 

 

 

172

 

Table 4.1 . Continued.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Gene
Symbol Gene Description TaqMan Assay ID
IL23a interleukin 23, alpha subunit p19 Mm00518984_m1
Mt1 metallothionein 1 Mm00496660 g1
Muc5ac mucin 5, subtypes A & C, tracheobronchial/gastric Mm01276725 g1
Nfe2l2 nuclear factor, erythroid derived 2, like 2 Mm00477784_ m1
Nos2 nitric oxide synthase 2, inducible Mm00440485_m1
Nqo1 NAD(P)H dehydrcgenase, quinone 1 Mm00500821_m1
Pcna proliferating cell nuclear antigen Mm00448100 g1
Pdgfrb platelet derived growth factor receptor, beta polypeptide Mm01262489_m1
Ppari peroxisome proliferator activated receptor gamma Mm00440945_m1
Pth prostaglandin-endoperoxide synthase 2 Mm00478374_m1
Saa3 serum amyloid A3 Mm00441203_gi1
chflm secretglobin, family 1A, member 1 (uteroglobin) Mm00442046_m1
Serpine1 serine (or cysteine) peptidase inhibitor, clade E, member 1 Mm01204469_m1
Sftpc surfactant associated protein C Mm00488144_m1
Sfipd surfactant associated protein D Mm00486060_m1
Socs3 suppressor of cytokine signaling3 Mm00545913_s1
Sod1 superoxide dismutase 1, soluble Mm01344233 g1
Sod2 superoxide dismutase 2, mitochondrial Mm00449726_m1
Stat6 signal transducer and activator of transcription 6 Mm01160477_m1
Tmiz tissue factor pathway inhibitor 2 Mm00436948_m1
Tgfb1 transforminggrowth factor, beta 1 Mm01178820_m1
Tnfa tumor necrosis factor(TNF superfamileember 2) Mm00443258_m1
Vegfa vascular endothelial growth factor A Mm01281447_m1

 

 

 

173

Figure 4.3. Cell counts from genotype and treatment controls.
Genotypic control mice were exposed to saline or 60 pg (10 mM) CoCIz
for 2 week, 5 days/week paradigm. Total cell counts from BALF (A)
were assessed from all of the mice and averaged. Cell differential
counts were performed for macrophages (B), neutrophils (C),
lymphocytes (D), and eosinophils (E). N>5 mice/group.

"Images in this dissertation are presented In color.”

174

Figure 4.3. Cell counts from genotype and treatment controls.

 

 

  

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

U)
_ d.)
;
U
0
S
D.
E
~ 3
(h
0
on
(B
.C
Q N
O
L
U .—
(D
2
QWNQ'Q"! cmomcm
HHHOOO MNNHH
m (orxlsrraa Q lorxlsuaa
s v
1’
a a
‘—’ E
g e
'- ‘5
0)
Z
mcmom
omom
«soil-is" ”NH”

(vorx) sued

 

175

sth StH STH

Genotype

sTH

stH

stH sTH sth StH STH

Genotype

Figure 4.3. Continued.

I11

Cells(X104)
H N W h In 01 \l

 

 

Doxy Cobalt (60pg)

EI- .-
u- +
l:l+ -
r:1+ +

S-no hSPC-rtTA transgene (WT)
s- hSPC-rtTA transgene/+
T-notet-cre transgene (WT)

t- tet-cre transgene present
H-WT HlFlot allele

h- floxed HlFlot allele

 

 

stH sTH sth StH STH

Genotype

176

 

Histopathology of Cobalt-induced Injury: Histologically, no pulmonary
lesions were found in control or HIF10tA/A mice that were instilled with saline
alone. In contrast, control mice repeatedly instilled with cobalt had a mild-
moderate chronic bronchopneumonia that was histologically characterized by
a mononuclear cell infiltrate (mainly small and large lymphocytes, monocytes,
and occasional plasma cells) admixed with lesser numbers of neutrophils and
eosinophils in the interstitial tissues surrounding large- and small-diameter
conducting airways (i.e., axial, preterminal and terminal bronchioles) and
extending into the centriacinar regions of the lung (alveolar ducts and adjacent
alveoli) (Figs. 4.4A and 4.48). Interstitial fibrosis was a prominent remodeling
feature of the alveolar septa in affected parenchymal regions along with
minimal to mild hyperplasia of alveolar type II cells and accumulation of mildly
hypertrophic macrophages and varying numbers of inflammatory cells
(lymphocytes and neutrophils) in alveolar airspaces (Figs. 4.4C and 4.40).
These cobalt-induced airway and alveolar changes were dose-dependent and
were more consistently found in the hilar rather than the distal aspects of the
lunglobe.

A similar mild-moderate chronic bronchopneumonia with peribronchiolar
lymphoplasmacytic inflammation and variable amounts of interstitial alveolar
fibrosis airway was present in the lung lobes of cobalt-exposed HlF1aA/A mice

(data not shown). There were, however, marked differences in the character

177

Figure 4.4. Histopathology and picro-sirius staining control and
cobalt-treated control mice

Light photomicrographs of the lungs of control mice instilled with saline
(A and C) or cobalt (B and D). Lung sections in A and B were stained
with hematoxylin and eosin, while sections in C and D were
histochemically treated with picro-sirius red solution that stains
interstitial collagen (red chromagen in interstitial tissues in the alveolar
septa and around bronchiolar airways). ln cobalt-treated lungs (B and
D), there is marked inflammation and interstitial fibrosis (asterisk in B)
around pre-terrninal bronchioles (ptb) and terminal bronchioles (tb) and
extending distally into alveolar ducts (ad) and adjacent alveoli (a).
There is increased picro-sirius red stained collagen (solid arrows) in the
alveolar septa of the cobalt-treated mouse (D) compared to that in the
saline-treated control mouse (C). p, pulmonary pleura; e, bronchiolar
epithelium; stippled arrow, mixed inflammatory cell infiltrate. "Images

in this dissertation are presented in color.”

178

 

 

179

of the inflammatory, airway epithelial, and alveolar macrophage changes in the
lungs of these transgenic mice compared to their control counterparts. Along
with the lymphocytes and plasma cells, there were markedly more eosinophils
in the peribronchiolar and alveolar mixed inflammatory cell infiuxes in
HIF10rA/A mice compared to those of control mice (Fig. 4.5D). Another
distinctive change found only in HlF1orA/A mice was mucous cell metaplasia in
the airway epithelium lining axial and preterminal bronchioles. This airway
epithelial lesion in large-diameter bronchioles consisted of numerous Alcian
Blue/Periodic Acid Schiff stained mucous goblet cells in bronchiolar epithelium
that is normally devoid of these mucus-secreting cells in mice (Figs. 4.6A and
4.6B). These areas of epithelial mucous cell metaplasia in cobalt-treated
HlF1orA/A mice were also lmmunohistochemically positive for YM1/2 chitinase-

like proteins (Figs. 4.60 and 4.60).

Characterization of eosinophils and YM1/2 Expression: In addition to
these unique eosinophil and epithelial responses, alveolar macrophages
accumulating in alveolar airspaces of cobalt-exposed mice were larger and
more eosinophilic in the HIF10rA/A mice compared to those in similarly
exposed control mice (Figs. 4.7A and 4.78). lmmunohistochemically, the
cytoplasm of these phenotypically distinctive macrophages stained positive for
YM1/2 protein similar to the mucous goblet cells in the metaplastic bronchiolar

epithelium of HIF1dA/A mice (Figs. 4.60 and 4.60).

180

Figure 4.5. Major Basic Protein Staining in lungs from control and
HlF1aA/A mice.

Light photomicrographs of the lungs of saline (A and C) or cobalt-
instilled (B and D) control (A and B) and HlF1aA/A (C and D) mice. All
lung sections were immunohistochemically stained for major basic
protein to identify infiltrating eosinophils (red chromagen; arrows) and
counterstained with hematoxylin. A mixed inflammatory infiltrate
consisting of mononuclear leukocytes, eosinophils and lesser numbers
of neutrophils are restricted to the lungs in cobalt-treated mice (B and
D). Markedly more eosinophils are present in the peribronchiolar and
alveolar regions of the cobalt-treated HIF1or A/A mouse (D) compared to
that of the cobalt-treated control mouse (B). ptb, pre-tenninal bronchiole;
pa, pulmonary arteriole, a, alveolar airspace; e, bronchiolar epithelium.

"Images in this dissertation are presented in color.”

181

  

    

reef
W5“:

nexfk tW9
w...

.o‘

 

 

182

Variably sized needle-shaped or rectangular refractile eosinophic crystals
were also present within these alveolar macrophages or free in the alveolar
airspaces (Fig. 4.73). These crystals also stained positive for YM1/2 (Fig.
4.7D). Multinucleated giant cells were also more frequently observed in the

cobalt-induced alveolitis of HlF1aA/A mice compared to those of control mice.

Cobalt-induced gene expression changes: The differences in cobalt-
induced pulmonary pathology between the control and HlF1aA/A suggested
an alteration in the stress response upon loss of HlF1a. To begin
characterizing this difference, the expression of 63 key genes involved in
immunity, inflammation, oxidative stress, and other stress pathways, was
assessed by quantitative real time PCR (qRT-PCR) (table 4.1). Initially,
samples from each treatment group and genotype were pooled and screened.
Those genes that showed a difference when compared to untreated controls
within a genotype or between genotypes were characterized as individual
samples (table 4.2). Six of these genes showed significant changes in
expression when compared between genotype and within treatment or within
genotype and between treatments (Fig. 4.8). Two other genes, Ym1 and IL6,
were near significance (0.069 and 0.055 respectively). The expression of Ym2
in the HlF1or deficient mice was significantly increased following challenge
with 60 pg cobalt compared to the saline treated HlF1aA/A mice and the 60 pg

cobalt treated control animal.

183

Figure 4.6. Alcian Blue/Periodic Acid Schiff Stain and YM1/2 IHC

Light photomicrographs of pre-terrninal bronchioles (ptb) of cobalt-
lnstilled control (A and C) and HlF1aA/A (B and D) mice. Tissues
were stained with Alcian Blue (pH 2.5)lPeriodic Acid Schiff (AB/PAS; A
and B) to identify acidic and neutral mucosubstances (magenta stain;
arrows) in mucous cells within the bronchiolar epithelium (e).
Numerous AB/PAS-stained mucous cells are present only in the airway
epithelium lining the pre-terrninal bronchiole in the cobalt-treated
HlF1aA/A mouse (B). Tissues in C and D were
immunohistochemically stained for YM1/2 protein (brown chromagen;
arrows) and counterstained with hematoxylin. YM1/2 proteins were
present only in the bronchiolar epithelium of the cobalt-treated
HlF1aA/A mouse (D). Arrow in C identifies a few alveolar
macrophages that were positive for YM1/2 proteins. "Images in this

dissertation are presented ' in color."

184

        

   

\

A A. r .
332.94...

,: a ...I.
7...? .

 

til . . ...v.

185

Figure 4.7. H&E staining and YM1/2 IHC of cobalt treated control
and HIF1orA/A mice

Light photomicrographs of alveolar macrophages in cobalt-instilled
control (A and C) and HlF1aA/A (B and D) mice. Lung tissues were
histochemically stained with hematoxylin and eosin (H&E; A and B) or
immunohistochemically for YM1/2 proteins (C and D). H&E-stained
alveolar macrophages in the cobalt-instilled HlF1aA/A mouse (B) are
larger (hypertrophic) and more eosinophilic than the similarly stained
lung section from the cobalt-instilled control mouse (A). In B, a group of
macrophages are surrounding an extracellular aggregate of eosinophilic
crystals (arrow). In addition, more alveolar macrophages with
immunohistochemically staining for YM1/2 proteins (solid arrows) are
present in lung section from the cobalt-instilled HlFlor A/A mouse (D) as
compared to that of the cobalt-instilled control mouse (C). Stippled
arrow in C, alveolar macrophage with no detectable YM1/2 proteins.

"Images in this dissertation are presented in color."

186

 

187

Gob5 expression followed a similar pattern of expression as that of Ym2;
however, its expression was only significantly changed when the 60 pg cobalt
treated HlF1orA/A animals were compared to the 30 pg treated ones. Muc5ac
and IL5 showed dose dependent changes in expression within genotypes and
in the case of lL5, expression was significantly elevated in saline treated
HlF1crA/A mice compared to saline treated controls. Eotaxin was also
significantly elevated in the HIF1orA/A mice when the saline treated mice were
compared. Moreover, eotaxin was also significantly different between the

genotypes in the 60 pg cobalt treated mice.

Cytokine profiling: The pathology of the lung and the gene expression
patterns suggested a change in the inflammatory response upon loss of
HlF1afrom Type II and Clara cells. To determine if the changes in cytokine
gene expression led to changes in the chemoattractants found in the BALF,
profiling of 18 cytokines was performed using a bead array (BioRad). Of the
18 characterized, 10 showed significant difference when compared across
genotype or within treatment groups (Table 4.3). Interestingly, several of
these were different when the saline treated groups of the control and
HlF1aA/A mice were compared (i.e. lL-1B, lL-5, lL-12, GM-CSF, RANTES,
TNFa and VEGF [Table 4.3]). This suggests that loss of HIF1a from Type II
and Clara cells alters the tissue's native cytokine profile. Moreover, cobalt
exposure caused a more pronounced phenotype in the HIF1aA/A animals with

respect to cytokine changes.

188

Figure 4.8. Gene expression results

The expression of 63 genes was analyzed by qRT-PCR. Those
genes that showed a difference as pooled samples were further
analyzed as independent replicates. White bars represent control
groups and black bars represent HIF1or deficient groups.
Expression levels were normalized to the saline treated control
animal and expressed as fold change. a = p < 0.07, * = p < 0.05, **

=p<001

189

5 Ym2 I——l=_.lj 15
at: at: :1: F j
0 124
-5 9-
-10 6.
-15 3.
-20 o.
10 Gob5 * l—'—‘| 1o. IL5
0 8-
-1o 6.
-20
4.
-30
-4o 2'
-50 0-
Ym1

F

 

E

 

 

5' HmOx
4. a 4
3- 3 ar:
2- 2
1- 1
o. 0
5- MuCSac 4 Eotaxin
4- 3
3‘ ** 2 * **
2
1
0

o.
Saline 30 pg 60 pg Saline 30 pg 60 pg
COCIZ COCIZ COCIZ COCIZ

Table 4.2 Gene Expression Changes

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Control HIF1 aA/A
Gene Saline 30 L 60 gg Saline 30 pl 60 pg__
1.00 +I- 1.04 +I- 1.06 +I- 1.15 +I- 1.07 +I- 1.02 +I-
185 0.04 0.03 0.04 0.05 0.02 0.03
1.00 +l- -1.14 +I- -1.13 +I- -1.05 +I- -1.08 +l- -1.06 +I-
B-Actin 0.05 0.05 0.03 0.02 0.04 0.02
1.00 +I- 1.08 +I- 1.05 +I- -1.10 +I- -1.01 +I- 1.02 +I-
GAPDH 0.05 0.07 0.03 0.05 0.04 0.02
1.00 +I- 1.70 +I- 1.18 +I- 2.38 +I- 1.10 +I- -1.62 +I-
MCP 0.35 0.96 0.48 1.03 0.27 0.40
1.00 +I- 1.79 +I- 2.40 +I- 2.39 +I- 2.19 +I- 2.43 +I-
MIP1a 0.21 0.46 0.62 0.56 1.83 0.34
1.00 +l- 1.42 +I- 1.15 +I- 1.88 +I- 1.49 +I- 2.52 +I-
Eotaxin 0.08 0.23 0.15 0.23 0.10 0.36
1.00 +l- 1.21 +I- 1.88 +I- 1.56 +I- 3.00 +I- 3.38 +I-
Ym1 0.25 0.36 0.51 0.62 0.42 0.41
1 .00 +l- -5.88 +l- -3.36 +I- -4.46 +l- 2.04 +I- 2.82 +I-
Ym2 0.80 3.99 1.82 2.58 1.63 0.63
1.00 +I- -34.02 +l- -6.91 +I- -2.30 +I- 2.19 +I- 2.03 +I-
GOBS 0.60 16.99 2.93 1.54 1.83 0.75
1.00 +I- 2.82 +I- -1.11 +I- 2.92 +I- 2.21 +I- 1.40 +I-
KC 0.45 1.73 0.17 1.03 1.02 0.26
1.00 +I- 1.88 +I- 2.72 +I- 1.02 +I- 2.87 +I- 2.08 +I-
HmOx 0.19 0.48 0.34 0.09 0.54 0.16
1.00 +I- 1.55 +I- 3.37 +I- -1.90 +I- -1.51 +l- -2.34 +I-
IFN'y 0.48 0.82 2.32 0.41 0.40 0.29
1.00 +I- 1.30 +I- -2.50 +I- 1.24 +I- -1.16 +I- -1.69 +I-
IL1B 0.43 0.32 0.41 0.30 0.22 0.62
1.00 +I- -1.03 +I- 1.31 +I- 1.05 +I- 1.34 +I- 1.27 +I-
lL4 0.22 0.14 0.17 0.28 0.40 0.24
1.00 +I- 1.60 +I- 1.09 +I- 8.44 +I- 3.71 +I- 2.02 +I-
lL5 0.1 9 0.67 0.46 3.02 1.36 0.23
1.00 +I- 2.43 +I- 1.29 +I- 1.93 +I- 1.86 +I- 2.13 +I-
lL6 0.48 1.22 0.19 0.37 0.31 0.50
1.00 +I- 1.11 +I- 1.89 +l- -2.65 +I- -1.46 +I- -1.26 +I-
IL10 0.67 0.51 1.23 0.47 0.50 0.32
1.00 +I- -1.73 +I- -1.18 +I- 1.34 +I- 1.40 +l- 2.46 +I-
lL13 0.41 0.22 0.37 0.34 0.44 0.51
1.00 +I- 1.87 +I- 3.08 +I- 1.56 +I- 1.98 +I- 3.36 +I-
MUC5ac 0.24 0.39 0.50 0.27 0.23 0.41
1.00 +I- 1.91 +I- 2.59 +I- -1.23 +I- -1.01 +I- 1.15 +I-
iNOS 0.14 0.72 1.49 0.22 0.18 0.12
1.00 +I- 1.46 +I- 3.47 +I- -1.18 +I- -1.17 +I- 1.09 +I-
SAA3 0.73 0.69 2.13 0.17 0.41 0.58
1.00 +I- -1.10 +I- 1.40 +I- -1.01 +I- 1.72 +l- 1.48 +I-
SPC 0.22 0.23 0.29 0.22 0.19 0.05
1.00 +I- 1.48 +I- 2.11 +l- 1.21 +l- 1.07 +I- 1.02 +I-
TNFa 0.17 0.28 0.70 0.11 0.17 0.13
1.00 +I- -1.10 +I- -1.47 +l- 1.13 +I- -1.31 +I- -1.51 +I-
VEGF 0.08 0.12 0.24 0.13 0.05 0.14

 

 

 

 

 

 

 

191

 

DISCUSSION:

The research describes a model for the post-natal deletion of HlF1or from
Clara and Type II cells of the lung with the intention of determining the role of
the transcription factor in cobalt-induced injury. Control mice repeatedly
exposed to cobalt via aspiration had classic signs of metal-induced injury,
including increased neutrophils, peribronchial inflammation, and fibrotic
lesions. In contrast, the mice deficient in HIF1or in their Clara and Type II cells
exhibited a Th2-mediated response in response to cobalt challenge. In fact,
these HlF1dA/A mice displayed a pathology that can be described as asthma-
like, including increased eosinophilic infiltration, increased chitinase-like
protein expression, and mucus cell metaplasia. In addition, these HlF1or
deficient mice expressed an altered panel of cytokines in the absence and
presence of cobalt. These results suggest that alveolar epithelium-derived
HlF1a plays a critical role in determining the inflammatory response to cobalt
challenge and loss of this critical transcription factor can alter the lung’s ability

to cope with the toxicant insults.

Attempts to study cobalt-induced injury in animal models have successfully
mimicked some facets of hard metal lung disease (HMLD). For example,
rabbits exposed to low doses of cobalt chloride (0.4 and 2 mg/m3) for 14-16
weeks (6 hrs/day) displayed increased macrophages and lysozyme activity in
BALF, interstitial inflammation, and the presence of large vacuolated

macrophages [20-22].

192

Table 4.3. Cytokine Profiles

Control and HlF1aA/A mice were exposed to saline, 30 pg, or 60 pg
CoCl2 for 2 week, 5 days/week paradigm. The levels of cytokines in
BALF were assessed using the Bio-Rad Bio-Plex cytokine suspension
array system. N>5 mice/group. Yellow = p<0.05, when HlF1a A/A saline
is compared to control saline. Blue = p<0.05 compared to genotype
matched control. ** = p<0.05 when similar treatments are compared

between genotypes.

Black shade = significance at 0.05 when compared

 

to saline control between genotypes

# = significance at 0.05 when compared to saline
treated mice within genotype

** = significance at 0.05 when compared between
_*genotypes and within treatment group

 

 

 

193

.nj<m c. 20:33 accuubcoucou 05.85 3:03.52 20 was? on...

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Table 4.3. Cytokine Profiles

 

     

     

 

 

 

 

       

 

 

  

  

 

 

 

  

 

 

 

   

 

 

 

 

 

 

 

1100.0 -1 8.0 0... -1 «0.. 00.. -1 8.0 «.0 -1 8.. m... .1 8.0 00.. -1 04.0 .202
...18.0.. -1 8.08 a0.0.10.3. -1 8.000 8.0. -1 00.08 0.00 -1 8.000 0.0. -1 00.0.0 08>
00.8 -1 $.00 00.0 -1 00.8 $.00 -1 8.8 3R -1 ta... 8.0. -1 $.00 50 -1 0......- 2.:
080.0 -1 00.0 0000.0 -1 8.0 8.0 .1 00.0 8.0 .1 00,0 00.0 -1 00.0 35
8.0 -1 8.0. .00 -1 B... . . 0.80.0 -1 02.. 0.0.0.. -1 8.8 8.. -1 8.0 0.0-.25.
00.. .1 8...... .00 .1 8.0 :0 -1 00.0. 0.... -1 8.0 00.0 -1 00.. 00.0 -1 00.0 .32
4.38.00 -1 0.0.. 00.. -1 00.0 «0.0 .1 00.00 8.0 -1 8.8 00.0. .1 0.0.. 04.0 -1 0.. .0 9.
00.0 -1 00.. 8.0 -1 I. .0. -1 8.0 8.0 -1 0.0 8.0 -1 00.. 04.0 -1 00.0 .2...
00.0 .1 A... $0 -1 00.0 . 00.. -1 8.0 00.0 .1 8.. 00.0 -1 00.0 emu-Eu
8.0 -1 8.0 8.. .1 00.0 00.0 -1 00.0 8.0 -1 0. .0 8.0 -1 0.0 8.0 -1 0.0 00.38
00.0 .1 00.. 0.0 .1 2.0 80 .1 8.. .00 -1 1.. a0. .0 -1 00.0 «0.0 -1 00.. 3....
0.0 -1 00.. 8.0 -1 8.. 00.0 -1 00.0 00.0 -1 8.0 8.0 -1 00.0 NS.
00.0 -1 0.0 «m0 -1 00.0 00.0 .1 00.0 8.0 -1 0.0 8.0 -1 0.0 00.0 -1 00.0 03.
0.0 -1 03 8.0 -1 8.0 00.0 -1 .00 00.0 -1 00.0 5.0 -1 00.. .00 -1 8.. 0.0.
.080 -1 00.0 4.3 -1 00.0 .0 0.11 00 0. 00.0 -1 8.0 00.. .1 00.0 00.0 -1 00.0 3.
.Jv
8.0 -1 00.0 11...... -1 :0 8.0 .1 00.01 8.0 -1 00.0 00.0 -1 00.0 00.0 -1 8.0 4....
00.0 -1 8.0 00.0 .1 00.0 00.0 .1 8.0 8.0 -1 00.0 00.0 -1 00.0 00.0 -1 00.0 3.
0.8.0 -1 8.0 8.0 -1 8.0 .0 m -1 8 . 00.0 -1 8.0 00.0 -1 00.0 3%
a
a: 8 u: 8- n: 8 01 on 20.8
$482.: _ .288

 

 

 

 

194

Guinea pigs exposed to 2.4 mg/m3 of cobalt chloride for 2 weeks (6 hrs/day)
had a higher rate of BALF neutrophilic and eosinophilic infiltration when
presensitized to the metal [23]. The National Toxicology Program exposed
rats and mice to cobalt sulfate heptahydrate at doses ranging from 0.3 to 30
mg/m3 for 13 weeks (6 hrs/day) and described interstitial fibrosis, epithelial
hyperplasia, and lesions in the upper airways that were more pronounced in
the rats [24, 25]. Finally, hamsters instilled with cobalt chloride (1-1000 pg/kg)
displayed signs of oxidative stress, including increased GSSG (oxidized
glutathione) :GSH (reduced glutathione) ratio [26]. To the best of our
knowledge, none of these models described chronic eosinophilic infiltration,
mucous cell metaplasia, or the increase in chitinase-like proteins as seen in
the HlF1aA/A mice. It has been suggested that an animal model is needed
that combines the toxic properties of cobalt with its allergenic potential [11].
The HlF1aA/A mice might be this model. In the presence of cobalt, HlF1aA/A
mice respond with an asthma-like phenotype (i.e. eosinophil infiltration and
mucus cell metaplasia) and increased expression of the chitinase-like proteins,

Ym1 and Ym2.

Chitins are acetylated glucosamine biopolymer not found in mammalian
systems and chitinase and chitinase-like proteins are believed to function as
protection against chitin containing organisms. Ym1 and Ym2 are chitinase-

like proteins that share considerable protein homology to the human protein,

195

YKL-40 (also known as human cartilage glycoprotein 39 and chitinase 3-like
1). YKL-40 has recently been identified in the lungs and circulation of
asthmatics [27]. Not only was there a correlation with the presence of YKL-40
and asthma, the levels also correlated with the severity of the disease and the
thickening of the subepithelial basement membrane [27]. The biological
relationship between these enzymes and the etiology of asthma has not been
characterized. What is known, however, is that chitinase and chitinase-like
proteins are upregulated in asthma models and in the case of chitinase
proteins, this induction is dependent upon IL13. IL13 gene expression is
slightly elevated in the cobalt treated HlF1aA/A mice and its lack of
significance is most likely due to the timing of analysis (Le 14 days after the
start of exposure). Increased chitinase expression is required for the
subsequent eosinophilia and lymphocytic infiltration [28]. Ym2 was
significantly increased in the 60 pg treated HIF1orA/A mice when compared to
the 60 pg treated control mice. Moreover, Ym1 expression was approaching
significance (p < 0.07) when a similar comparison was made. In contrast,
Ym2 show a cobalt-induced decrease in expression in the control animals, and
Ym1 is unchanged by cobalt treatment in these control mice. These results
suggest that cobalt exposure in the HlF1aA/A mice induces a series of events
within the lungs that resembles the progression of asthma in other asthma
models, including increased IL13, subsequent increases in Ym1 and Ym2

expression, and the recruitment of eosinophils.

196

The results suggest that the ability of Type II and Clara cells to respond to
hypoxia is necessary for the proper lung inflammatory response to metal-
induced stress. It is important to point out that this response is not due to loss
of HlF1or in resident macrophages. HlF1or expression is still strong in these
cells following post-natal doxycycline exposure and confirms that the SPC
promoter confines the expression of cre recombinase to Type II and Clara
cells (data not shown). In addition, it implies that the observed inflammatory
response is not due to the previously established role of HlF1a in myeloid cell
mediated inflammation [29]. Taken together, the results suggest a model for
the inflammatory differences between the control and HlF1a deficient mice
following metal exposure. Initially, the cobalt challenge leads to damage
within the lung, either at Type I or II cells. This damage is communicated to
the remaining viable Type II cells of the parenchyma directly or through
resident macrophages. In control lungs, HlF1a will regulate the expression of
classic hypoxia target genes as well as others involved in the inflammatory
response. This HIF1-regulated transcription will dictate the lung’s
inflammatory response to the metal challenge. The modest increases in
cytokines, such as IFNy, and the resulting pathology suggest a Th1 mediated
response. Loss of HlF1cr in the remaining viable Type II cells of the HlF1aA/A
mice would lead to an alteration in the cell’s ability to respond to the incoming
signals from the cobalt damaged cells. The decreased levels of HIF1a would
compromise the lung’s ability to respond to cobalt as a toxicant and putative

allergen. Ultimately, this difference in epithelium derived HlF1or alters the

197

pattern of released cytokines and presumably leads to the differential
expression of Th2 chemokines, such as IL4, IL5, IL10, and IL13. These
changes in cytokines will promote the expression of the chitinase and
chitinase-like proteins, such as Ym2 and this would lead to the eosinophilic
infiltration seen in the HlF1dA/A mice following cobalt challenge (Fig. 4.7).
This proposed model explains the difference in the inflammatory response
between the control and HlF1aA/A mice; however, it is based on collected
data at the end of cobalt exposure. Validation of the model will require a

detailed dose and time course response to cobalt challenge.

The striking differences observed following cobalt exposure in these two
mice genotypes suggests that they will be a powerful tool to understand the
relationship between allergy-induced asthma, hypoxia, and inflammation.
More importantly, direct comparison of the responses of the control and
HlF1dA/A mice in other asthma models (e.g. ovalbumin challenge) and to
other inflammatory inhalants (e.g. ozone) will correlate this relationship to
specific cytokines. The research also raises several important questions:
Does the loss of HIF1or alter an organism’s susceptibility to asthma using
other allergens? What role does HlF1or derived from other cell types (e.g.
infiltrating inflammatory cells and Type I cells) play in modulating this
inflammatory response? Does post-natal deletion of HlF1a alter HlF2a and if
so, what impact does this have on the inflammatory response [15]? Most

importantly, does a decrease in HlF1or functionality lead to an increased

198

susceptibility to asthma in humans? More specifically, is it possible that loss
or decrease in HlF1or function biases the lung towards a Th2 immune
polarization and this increases the susceptibility of individuals towards
extrinsic asthma? Even with these unanswered questions, the HlF1aA/A mice
offer an important step forward In understanding the role of the HlF1a
signaling cascade in allergy-induced asthma. Finally, it established epithelial-
derived HIF1or as a major regulator of the lung’s response to allergenic
compounds and creates a new tool to help understand the relationship

between inflammation and asthma progression.

199

REFERENCES

1 Bunn, H. F. and Poyton, R. O. (1996) Oxygen sensing and molecular
adaptation to hypoxia. Phys. Rev. 76, 839-885

2 Epstein, A. C., et al. (2001) C. elegans EGL-9 and mammalian
homologs define a family of dioxygenases that regulate HIF by prolyl
hydroxylation. Cell. 107, 43-54.

3 Salnikow, K., et al. (2004) Depletion of intracellular ascorbate by the
carcinogenic metals nickel and cobalt results in the induction of hypoxic
stress. J Biol Chem. 279, 40337-44.

4 Vengellur, A., Phillips, J. M., Hogenesch, J. B. and LaPres, J. J. (2005)
Gene expression profiling of hypoxia signaling in human hepatocellular
carcinoma cells. Physiol. Genomics. 22, 308-318

5 Lombaert, N., Lison, D., Van Hummelen, P. and Kirsch-Volders, M.
(2008) In vitro expression of hard metal dust (WC-Co)-responsive
genes in human peripheral blood mononucleated cells. Toxicol Appl
Pharrnacol. 227, 299-312

6 Semenza, G. L., Roth, P. H., Fang, H. M. and Wang, G. L. (1994)
Transcriptional regulation of genes encoding glycolytic enzymes by
hypoxia-inducible factor 1. J. Biol. Chem. 269, 23757-23763

7 Forsythe, J. A., et al. (1996) Activation of vascular endothelial growth
factor gene transcription by hypoxia-inducible factor 1. Mol. Cell. Biol.
16, 4604-461 3

8 Jung, Y., et al. (2003) Hypoxia-inducible factor induction by tumour
necrosis factor in normoxic cells requires receptor-interacting protein-
dependent nuclear factor kappa B activation. Biochem J. 370, 1011-
1017.

9 Mojsilovic—Petrovic, J., et al. (2007) Hypoxia-inducible factor-1 (HIF-1)
is involved in the regulation of hypoxia-stimulated expression of
monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5
(Ccl12) in astrocytes. J Neuroinflamm. 4, 12

200

‘IO

11

12

13

14

15

16

17

18

19

20

Rius, J., et al. (2008) NF-kappaB links innate immunity to the hypoxic
response through transcriptional regulation of HIF-1alpha. Nature. 453,
807-81 1

Lison, D., Lauwerys, R., Demedts, M. and Nemery, B. (1996)
Experimental research into the pathogenesis of cobalt/hard metal lung
disease. Eur Respir J. 9, 1024-1028

Shirakawa, T., et al. (1988) The existence of specific antibodies to
cobalt in hard metal asthma. Clin Allergy. 18, 451-460

Gheysens, B., Auwerx, J., Van den Eeckhout, A. and Demedts, M.
(1985) Cobalt-induced bronchial asthma in diamond polishers. Chest.
88, 740-744

Shirakawa, T., et al. (1989) Occupational asthma from cobalt sensitivity
in workers exposed to hard metal dust. Chest. 95, 29—37

Saini, Y., Harkema, J. R. and LaPres, J. J. (2008) HlF1[alpha] Is
Essential for Normal Intrauterine Differentiation of Alveolar Epithelium
and Surfactant Production in the Newborn Lung of Mice. J. Biol. Chem.
283, 33650-33657

Ryan, H. E., Lo, J. and Johnson, R. S. (1998) HIF-1 alpha is required
for solid tumor formation and embryonic vascularization. EMBO
Journal. 17, 3005-3015

Ryan, H. E., et al. (2000) Hypoxia-inducible factor-1 alpha is a positive
factor in solid tumor growth. Cancer Res. 60, 4010-4015

Perl, A. K., et al. (2002) Early restriction of peripheral and proximal cell
lineages during formation of the lung. Proc Natl Acad Sci U S A. 99,
10482-10487.

Lobe, C. G., et al. (1999) Z/AP, a double reporter for cre-mediated
recombination. Dev Biol. 208, 281-292.

Johansson, A., et al. (1986) Rabbit alveolar macrophages after long-
term inhalation of soluble cobalt. Environ Res. 41, 488-496

201

21

22

23

24

25

26

27

28

29

Johansson, A., Robertson, B. and Camner, P. (1987) Nodular
accumulation of type II cells and inflammatory lesions caused by

inhalation of low cobalt concentrations. Environmental research. 43,
227-243

Johansson, A., Camner, P., Jarstrand, C. and Wiemik, A. (1983)
Rabbit alveolar macrophages after inhalation of soluble cadmium,
cobalt, and copper: a comparison with the effects of soluble nickel.
Environ Res. 31, 340-354

Camner, P., et al. (1993) Inhalation of cobalt by sensitised guinea pigs:
effects on the lungs. Br J Ind Med. 50, 753-757

Bucher, J. R., et al. (1990) Inhalation toxicity studies of cobalt sulfate in
F344/N rats and BGC3F1 mice. Fundam Appl Toxicol. 15, 357-372

Bucher, J. R., et al. (1999) Inhalation toxicity and carcinogenicity
studies of cobalt sulfate. Toxicol Sci. 49, 56-67.

Lewis, C. P., Demedts, M. and Nemery, B. (1991) lndices of oxidative
stress in hamster lung following exposure to cobalt(ll) ions: in vivo and
in vitro studies. Am J Respir Cell Mol Biol. 5, 163-169

ChUpp. G. L., et al. (2007) A Chitinase-Iike Protein in the Lung and
Circulation of Patients with Severe Asthma. N Engl J Med. 357, 2016-
2027

Zhu, 2., et al. (2004) Acidic mammalian chitinase in asthmatic Th2
inflammation and IL-13 pathway activation. Science. 304, 1678-1682

Cramer, T., et al. (2003) HIF-11: Is Essential for Myeloid Cell-Mediated
Inflammation. Cell. 112, 645-657

202

Chapter 5

The Role of Hypoxia Inducible Factor 1a (HlF1a) in Modulating Cobalt-
lnduced Lung Inflammation: An Acute Study

203

ABSTRACT:

Air pollution is a critical factor in the development and exacerbation of
pulmonary diseases. Ozone, automobile exhaust, cigarette smoke, and
metallic dust are among the potentially harmful pollution components that are
linked to disease progression. Transition metals, such as cobalt have been
identified at significant levels in air pollution. Cobalt exerts numerous biological
effects, including mimicking hypoxia. Similar to hypoxia, cobalt exposure
results in the stabilization of hypoxia inducible factors (HIFs). HlFs are a family
of proteins that regulate the cellular response to oxygen deficit. HlFs also play
an important role in innate immunity and inflammatory processes. Moreover,
epithelial-derived HIF signaling has been shown to modulate the lung’s
inflammatory response to subchronic exposure to cobalt and biased the tissue
towards a Th2-mediated response. To further understand the role of HlF1a,
the most ubiquitously expressed HIF, in establishing the lung’s inflammatory
response to cobalt, a series of acute studies was performed. An inducible lung-
specific HlF1a deletion model was employed to characterize the inflammatory
function of epithelial derived HIF in response to inhaled cobalt. Control mice
showed classical sign of metal-induced injury following cobalt exposure,
including neutrophilic infiltration and induction of Th1 cytokines. In contrast,
HlF1or deficient mice exhibited pronounced eosinophil counts in BALF and lung
tissue complemented with Th2 cytokine induction. These results suggests that

the loss of epithelial-derived HlF1or result in an asthma-like phenotype following

204

acute cobalt exposure and that HlF1or is an important mediator in establishing

the lung’s inflammatory response.

205

INTRODUCTION

Postnatal lungs require pollution free ambient air for proper function and
development. Air pollution is also a critical factor in the occurrence and
exacerbation of lung pathological conditions, such as ainNay hypersensitivity,
asthma, chronic obstructive pulmonary disease (COPD) and lung cancer. A
plethora of airborne particles are injected into the environment through

anthropogenic activities.

The first line of defense against airborne particles is innate immunity.
Various lung diseases, such as asthma and COPD, occur due to detrimental
effects of these particles on epithelial integrity, resident macrophages
activations and recruitment of inflammatory cells. Airborne pollutants, such as
smoke, dust particles, ozone, noxious gases, automobile exhausts, and metals
can induce lung injury with a strong inflammatory component. Depending
upon the degree of exposure and tissue injury, inflammatory reactions

facilitate repair and remodeling processes.

Hard metal lung disease (HMLD) and cobalt asthma are occupational
respiratory diseases affecting workers involved in the manufacture and
maintenance of hard metals (material consisting of tungsten carbide cemented
in a matrix of cobalt), diamond polishing, and coal mining. These workers are
exposed to cobalt dust and manifest airway constriction, alveolitis, fibrosis and

associated giant cell interstitial pneumonitis [1]. The mechanism for the

206

cobalt-induced pathology remains largely unknown, however, several
possibilities have been proposed. One of these possibilities is that ability of
cobalt to promote a hypoxic-like response in cells. Given the link between
hypoxia and inflammation, cobalt-induced hypoxia mimickry offers a logical
link between metal exposure and the observed pathologies of HMLD and

cobalt asthma [2, 3].

Hypoxia, a decrease in available oxygen reaching the tissues of the body,
can influence the processes such as normal cellular homeostasis, repair, and
inflammation. The cellular response to hypoxia is regulated by a family of
transcription factors called the hypoxia inducible factors (HlFs) [4]. HlFs are
primarily regulated at the level of protein stability by a family of prolyl
hydroxylases. These prolyl hydroxylase domain (PHDs) proteins are
members of a broader family of non-heme, ferrous ion- and 2-oxoglutarate
dependent dioxygenases [5]. Upon exposure to decreases in oxygen
availability PHDs become inhibited and HlF1or the most ubiquitously
expressed isoform of HIFs, becomes stabilized. Once stable,

HlF1atranslocates to the nucleus and heterodimerizes with the aryl

hydrocarbon receptor nuclear translocator (ARNT, also known as HIF1B)
forming the functional transcription factor HIF1. HIF1 regulates the expression
of over one hundred genes, including ones involved in energy metabolism,
matrix/barrier function, angiogenesis, and inflammation [6-9]. Similar to

hypoxia, cobalt has been shown to inhibit PHDs and this inhibition causes very

207

similar transcriptional outputs to that of hypoxia [2, 10, 11]. Recent study in
human peripheral blood mononuclear cells has shown similar transcriptional
overlap upon tungsten carbide-cobalt particles treatment, linking hard metal

lung disease to hypoxia signaling [12].

Recently, using a lung-specific HlF1or deficient mouse model, a
compromised HIF signaling system was shown to alter the tissue’s response
to subchronic cobalt exposure. The loss of HlF10t from type II and Clara cells
was shown to bias the lung’s inflammatory response towards a Th2-mediated
process. Moreover, these HlF1a-deficient mice displayed an asthma-like
phenotype, including pronounced eosinophil infiltration, mucus cell metaplasia
of airway epithelium, and increased levels of the chitinase-like proteins YM1
and YM2 following cobalt challenge. These results suggest that airway
epithelial-derived HlF1cr plays a critical role in modulating the inflammatory
response of the lung. However, to understand the progression of cobalt-
induced lung injury, further investigation on the role of HlF1or in cobalt-induced
acute inflammation is required. In the present study, control and HlF1or
deficient mice were exposed to cobalt daily for 1, 2, or 5 days.
Bronchoalveolar lavage fluid (BALF) cellularity from HlF1ct deficient mice
displays a progressive eosinophilic infiltration whereas control mice displayed
a transient increase in neutrophils. Histological analysis revealed accelerated
tissue injury following acute cobalt challenge in HlF1or deficient mice. Finally,

BALF cytokine analysis showed lL-5 elevation specific to cobalt-treated HlF1or

208

deficient mice. In contrast, control mice showed specific induction of lL-6 and
tumor necrosis factor or (TNFa) following cobalt treatment. These results
suggests that epithelial-derived HlF1or is essential for regulating early
inflammatory events following cobalt challenge and loss of this regulation
biases the lung towards a Th2 mediated process and an asthma-like

pathology following metal exposure.

MATERIALS AND METHODS:

Description of mice: The mice used in these studies were created by mating

HIF1 aflox/fiox (a generous gift of Dr. Randall Johnson, Univ. Califomia-San
. -/tg tg/tg . .
Diego) and SP-C-rtTA /(tetO)7-CMV-Cre transgenic mice (a generous

gifts of Dr. Jeffrey A. Whitsett, Cincinnati Children’s Hospital Medical Center)
[13-16]. The generated triple transgenic mice, SP-C-rtTA-Itg/(teton-CMV-

t/t flx/fl
regg o ox

C /HlF1or , are capable of respiratory epithelium specific

conditional recombination in the floxed HIF1a gene upon exposure to
doxycycline (20). All the mice genotypes used in this study have been
maintained in a mixed C57/BL6 and FVB/N background. Genotyping of the

mice was performed by PCR for the three loci as previously described [17].

209

Figure 5.1. Experimental Design. HIF1ch/A mice were generated
through postnatal doxycycline treatment paradigm (doxycycline given from
PN4 to PN42). Control (n=36) and HIF10rA/A (n=36) male mice randomly
assigned to three different treatment groups (24, 48, and 120 hrs). For
each time point, mice were challenged with saline-(n=6) or cobalt chloride
(60 pg, n=6) via oropharyngeal aspiration. Animals were euthanized 24
hours after their first dose (24 hrs treatment group), second dose (48 hrs

treatment group) or fifth dose (120 hrs treatment group).

210

Saline
or

60pg CoClz

PN4 PN42 8 g E
‘ ‘ fl. 0. O.

Doxy

PN55
PN56

24 hrs—>
48 hrs —>
120 hrs —>

I

Euthanize Mice: Harvest
Lung Tissue and BALF

211

Doxycycline treatment and animal husbandry: Postnatal recombination
was carried out by exposing lactating dams to doxycycline feed (625 mg
doxycycline/Kg; Harlan Teklad, Madison, WI) and drinking water (0.8 mg/ml:
Sigma chemicals Co.) until weaning. Triple transgenic mice were then
maintained on the same food and water until they were approximately 7 weeks
of age. In order to eliminate the effects of doxycycline, the treatment was
terminated 7-10 days prior to first exposure to metals. These mice will be
referred to as HlF1adeficient or HlF1aA/A. Genotypic designation of these

-/tg A

mice is SP-C-rtTA / (tetOh-CMV-Cretgltg/HIF1orN . Control animals used

in the study were of the same genotype that were maintained on normal food
and water ad Iibitum. Mice used in this study were kept at the animal housing
facility under the strict hygienic and pathogen free conditions approved by the
university laboratory animal resource (ULAR) regulatory unit. All the animal
handling and necropsy protocols were approved by the ULAR regulatory unit

of Michigan State University.

Cobalt exposure, tissue harvesting and processing: Control and
HlF1aA/A male mice were randomly assigned to one of 6 groups. Mice were
treated with saline, or 10 mM cobaltous chloride in 25 pL volume by

oropharyngeal aspiration daily for 1, 2 or 5 days. The 10 mM cobalt chloride

concentrations correspond to daily exposure of 60 pg of CoClz. Animals were

sacrificed 24 hours following the final exposure. In the case of the one day

212

treatment group, a single dose of cobalt was administered and mice were
sacrificed 24 hours later. For the two day time point, two doses were delivered
at 24 hours interval and animals were sacrificed 24 hours after second dose.
Finally, for five days time point, five doses were delivered at 24 hours intervals
and animals were sacrificed 24 hours after fifth dose. Following exposure,
mice were anesthetized with sodium pentobarbital (50 mg/ml), and a midline
laparotomy was performed. The trachea was exposed and cannulated. The
lung and heart were removed en bloc and the lungs were lavaged with two
successive one ml volumes of sterile saline. These fractions were combined
and total cell counts were performed using a hemocytometer. Differential cell
counts were performed in cytospin samples using Diff-Quik reagent (Baxter,
FL). The remaining BALF was frozen for cytokine profiling. The right lung
lobe was removed and stored in RNAIater RNA stabilizing reagent (Qiagen,
Valencia, CA) for protein and RNA isolation. The left lobe was fixed in 10%

neutral buffered formalin for histopathological analysis.

Protein Assay: The total amount of protein in the BALF was quantified using
the Bradford assay [18]. Briefly, BALF sample were diluted in distilled water
and mixed with dye reagent via manufacturer’s instructions (Bio-
Rad,Hercules, CA). Absorbance was read at 595nm using
spectrophotometer (GeneQuant 100, GE Heatlthcare Piscataway, NJ).
Protein concentrations were determined by comparison to a standard curve
created from serially diluted bovine serum albumin standards of known

concentrations.

213

Histopathology and immunohistochemistry: At least four to six mice from
each genotype and treatment group were analyzed for histopathological
changes. Formalin fixed left lung lobe tissues were paraffin embedded and 5-
micron thick sections were mounted on glass slides and stained with
hematoxylin and eosin (H&E) or major basic protein (1:500 dilution, Mayo
Clinic, AZ), 40kDa antigen of neutrophils (MCA771GA 1:100 dilution, Serotec,

Raleigh, NC) as previously described [17].

Determination of cytokine levels by Bead array: Levels of cytokines from
acellular BALF samples were measured using BD CBA Mouse Soluble Protein
Flex Sets and FACSCaIibur flow cytometer according to the manufacturer’s
instruction (CBA; BD Biosciences, San Diego, CA). Cytokines measured were
lL-2, KC, lL-4, lL-5, lL-13, TNFor, lL-6, lL-10, INF-y and Rantes. Briefly, BALF
was mixed with capture beads and incubated for 1 hour at room temperature.
Subsequently, PE detection reagent was added and incubation for 1 hours at
room temperature. Following extensive washing, samples were analyzed on a
BD FACSArray bioanalyzer (BD Biosciences) according to the

manufacturer’s instruction.

Quantitative analysis: All cell counts and cytokine and gene expression data
were analyzed by ANOVA followed by a Bonferroni posttest. All the data from
the study was presented as standard error of the mean (SEM). Statistical

difference of P value less than 0.05 was considered as significant.

214

Figure 5.2. BALF proteins and total cell counts from control and
HIF1a A/A mice.

Total protein concentrations (A) and cell counts (B) were assessed from
BALF of saline (white bars),and cobalt (hatched bars) treated control
mice and saline (checkered bars) and cobalt (black bars) treated
HlF1orA/A mice as described in materials and methods. N>5 mice/group.

Data are expressed as meantSE. * = P5105.

E] Ctrl-Saline

HIF1orA’A - Saline

% Ctrl - 60 pg CoClz
l HIF1aA’A - 60 pg CoClz

 

215

 

     

TI

.00-0v...

 

5 days

 

 

.0080.

 

 

3....- r ////////////////////////

  

2 days

 

     

 

.00-0V0.

 

.00-0v...

 

y

/d

 

 

 

7o-
60-
o-
o-
o-
o.
o-
o-

A_18:9¢ £305 :33.

 

 

 

 

 

 

 

 

M .0. .n. u.
.10. x. _E .8 2.8

RESULTS:

BALF protein exudation and cellularity: To characterize the role of HlF1a
in cobalt-induced lung injury, control and HlF1aA/A mice were randomly
assigned to saline-or cobalt-treated groups. Individual groups received sterile
saline or 60 pg cobalt chloride by oropharyngeal aspiration daily for 1, 2, or 5
days (Fig. 5.1). Mice were euthanized 24 hours after last exposure, BALF
was collected and lung tissue was processed for light microscopic
examination, IHC, and RNA isolation. Total BALF protein concentration was
measured as an index of lung epithelial permeability and hence, lung injury.
Cobalt-treated control and HlF1aA/A mice showed significantly higher protein
concentration indicating that lung injury initiates as soon as 24 hours after the
initial exposure (Fig. 5.2A). The level of protein exudation in cobalt-treated
control mice remained within narrow range of 35-45 ug/100ul at all the three
time points. In contrast, cobalt-treated HlF1aA/A mice showed significantly
higher protein exudation (60.71162) at the 48 hours time point as compared
to respective control (38.9153) counterparts (Fig. 5.2A). suggesting these
mice are more prone to metal-induced lung injury. The total cell count from
BALF was also measured to follow the progression of injury. Total cells in
BALF showed a significant increase in both control and HIF1aA/A mice
following 5 days of cobalt exposure. There was no difference between control
and HlF1aA/A mice at any time point. These results suggest that acute
cobalt-induced changes in total cell infiltration in the lung are not affected by

loss of HIF10L.

217

Figure 5.3. Effect of cobalt treatment on inflammatory cells recovered
in bronchoalveolar lavage fluid.

Differential cell counts were performed for macrophages (A), lymphocytes
(B), neutrophils (C), and eosinophils (D) from BALF of saline (white bars),
and cobalt (hatched bars) treated control mice and saline (checkered
bars) and cobalt (black bars) treated HlF1aA/A mice. N>5 mice/group.

Data are expressed as meaniSE. * = P4105.

Ctrl-Saline

HlF1ocA’A - Saline

% Ctrl - 60 pg CoClz
I HIFmNA - 60 pg CoClz

 

 

218

       

  

 

 

 

 

 

 

 

 

 

 

 

 

 

V///////////// m
— ////////// s = a...“ w
S e _ So. ov
e 9 _ . ._
.T. 8 So ov ..
PVVJ In _3.ova. W
p a
O O dea d
h r Save 2
p C
m a mcdva.
LY M

 
 

 

 

 

m.

. o e a. e
o o 0. o

A p25 .5 n“=3. 2.8 B Ame to .E .8. 2.8

2.5-

e. a. m.
2

0.5-

219

Figure 5.3. Continued.

 

C. Neutrophils
2.0- III—

E .

IE 1.01

l

3

 

 

 

 

 

D. Eosinophils
1.5- ———|

'9

 

Cells per ml (x105)

.°
‘1'

 

 

 

1 day 2 days 5 days

220

To characterize the types of inflammatory cell infiltration that made up
the total cells in BALF, differential cell counts was performed. Similar to total
cell counts, total macrophages and lymphocytes showed time dependent
increase in numbers, however, no significance difference was noticed between
cobalt-treated control and HlF1aA/A mice at any of the three time points (Fig.
5.3A and 5.38). In contrast, there was a distinct difference between the two
genotypes in the numbers of neutrophils and eosinophils found in the BALF.
The control mice displayed a significant increase in neutrophils following
cobalt exposure at the 48 hour time point that was not seen in the HlF1a
deficient mice. Moreover, this increase was resolved by the 5 day treatment
time (Fig. 5.30). The HlF1aA/A mice displayed a large and sustained
increase in eosinophil infiltration into the lung following cobalt exposure. This
increase was observed as early as 2 days post-treatment and reached
significance by 5 days of treatment (Fig. 5.3D). These genotype-specific
inflammatory cells infiltrations suggest that epithelium-derived HIF10l is an

important regulator in the inflammatory responses to metal insults.

Histopathology of Cobalt-induced injury: Histologically, no pulmonary

lesions were found in control (Fig 5.4A) or HlF1oA/A (Fig 5.4E) mice that were

221

Figure 5.4. Histopathology staining of control and cobalt-treated
control mice.

H & E stained lung sections from control (A-D) and HlF1aA/A (E-H) mice
that were either saline-treated (A and E) or treated with one (B and E),
two (C and G) or 5 consecuitive (D and H) doses of cobalt (60ug).
bronchiolar airway (BA), terminal bronchioles (tb), alveolar ducts and

adjacent alveoli (a). "Images in this dissertation are presented in color."

222

.. ,......... 3.. EV .. .,
fl..H....ll L.‘ .
. szVfi.” raw ... u
. . am”, {.9 2...
\uk ....nw. ... . ..
. ., .,.,.

. . s
\ 1.2.!
. ,9...
I : ..I

.)

 

223

instilled with saline alone. Cobalt-treatment induced time-dependent increase
in lung damage that appeared slightly more pronounced in the HlF1aA/A mice
(Fig. 548-0 and 5.4F-G). To verify the cell infiltration, lung tissues from
control and HIF10lA/A mice were analyzed via immunohistochemistry using an
antibody specific to major basic protein, an eosinophilic specific marker. No
eosinophils were observed in saline treated mice of either genotype (data not
shown). Control mice, following a single dose of cobalt showed a modest
increase in MBP positive cells in the interstitium of proximal lung (Fig. 5.5A).
This staining was absent in the 2 and 5 days lung section of control mice
(Figs. 5.50 and E). In contrast, HlF1a deficient mice showed a pronounced
and prolonged eosinophilia following cobalt exposure (Figs. 5.58, D, and F).
The level of neutrophilic infiltration was also assessed using
immunohistochemistry. Again, there was little PMN positive staining observed
in either control or HIF1aA/A saline treated mice (data not shown). In control
mice, there was substantial PMN positive staining as early as 24 hours after
the first cobalt exposure (Fig. 5.6A), This staining remained following 2 days
of cobalt exposure, however, it was slightly diminished. Following 5 days of
exposure, control mice still displayed some neutrophil positive staining but it
restricted to peribronchial regions. HlF1aA/A mice also showed strong PMN
positive staining following a single dose of cobalt (Fig. 5.63). In contrast to the
control mice, this PMN infiltration was absent in the 2 and 5 day treated HlF1a

deficient mice. These results are in agreement with the differential cell counts

224

Figure 5.5. Major Basic Protein (MBP) immunohistochemistry in
lungs from control and HlFlaA/A mice.

Lung sections from control (A, C and E) and HlF1aA/A mice (B, D and F)
following exposure to cobalt (60 pg) for 24 hrs (A and B), 48 hrs (C and
D), or 120 hrs (E and F) were immunohistochemically stained for MBP, an
eosinophil-specific marker, to identify infiltrating eosinophils (red
chromagen) and counterstained with hematoxylin. "images in this

dissertation are presented in color.”

225

 

§

.
u r
r
...u

\

Wu“?
‘ ...
.&‘

.P-

. ., . ...
uh“ .

I PK
...»...

(«v/:1.
l .

r
..n,
. .

v

\.
.

A
is.
if

‘94

...M¢.V...4. law
I . u ,
K393)“

. ...a

’ .

 

226

Figure 5.6. Neutrophil (PMN) immunohistochemistry in lungs from
control and HIF1aA/A mice. Lung sections from control (A, C and E) and
HlF1aA/A mice (B, D and F) following exposure to cobalt (60 pg) for 24 hrs
(A and B), 48 hrs (C and D), or 120 hrs (E and F) were
immunohistochemically stained for a 40 kDa antigen, a neutrophil-specific
marker, to identify infiltrating neutrophils (red chromagen) and
counterstained with hematoxylin. "Images in this dissertation are

presented in color."

227

v/
.v .

.r
A

m

.11: a g ....
. ”MM—«mes. EU»... . ...

I

«.ht .. .
, ......47.
.svuvww.
,fiu .
u 1.4 ...Htv
. a ...HVI.
I‘ll ... WV ...
,. V)...“ , ..

......

 

. .
.n _...v...}....-...s.~¢...

228

and suggest that a compromised HlF1a causes a shift in the inflammatory
response of the lungs following cobalt exposure. The repeated instillation of
cobalt in control (Fig 5.40) as well as HlF1aA/A (Fig 5.4H) mice for five
consecutive days resulted in marked bronchopneumonia characterized by a
mononuclear cell infiltrate (heteromorphic lymphocytes, monocytes, and
occasional plasma cells). However, these lesions were infiltrated with
numerous eosinophils specifically in HlF1aA/A mice (Fig. 5.6F) and displayed

PMN positive staining specifically in the control mice.

Cytokine profiling: The pathology of the lung and the BALF cellularity
patterns suggested a change in the inflammatory response upon loss of HlF1a
from Type II and Clara cells. To determine the mechanism underlying these
patterns, 10 cytokines (viz. lL-2, KC, lL-4, lL-5, lL-13, TNFa, lL-6, lL-10, INF-y,
Rantes) were profiled in the cell-free BALF. Out of these profiled cytokines
four showed significant difference when compared across genotype or within
treatment groups (Fig. 5.7). lL-5, a key mediator in eosinophil activation, was
significantly elevated in BALF collected from mice following 1 and 2 day cobalt
exposure to HlF1aA/A mice as compared to control mice (Fig. 5.7A). On the
other hand, cobalt treated control mice had significantly higher levels of lL-6
and TNF—a at 48 hours time point suggesting their proinfiammatory
involvement in cobalt induced acute inflammation and further transition to

chronic inflammation (Fig 5.73 and 5.70). .

229

Figure 5.7. Cytokine levels in BALF from cobalt-treated control and
HIF to: NA mice.

Control and HlF1aA/A mice were exposed to saline or 60 pg CoClz. The
levels of cytokines in BALF were assessed using BD CBA Mouse Soluble
Protein Flex Sets and FACSCaIibur flow cytometer. N>5 mice/group.
Outliers were removed by Grubb’s test and ANOVA was performed with
Boneferroni posttest. Asterisks indicate significant difference between
cobalt-treated control mice and cobalt—treated HlF10l deficient mice. * =P

< 0.05, ** =P < 0.01, *** =P < 0.001

El Ctrl-Saline

HIF1CXA’A - Saline

% Ctrl - 60 pg CoClz
I HlF1alA’A - 60 pg CoCIz

 

230

IL5

*Wk*'

 

100'

75I

48 Hours 5 Days

24 Hours

6
H.

5Days

     
 

48Ho

24

 

125-
100

75-
50

25-
0

231

Figure 5.7. Continued.

TNF-oc

 

 

5 Days

 

 

232

Figure 5.7. Continued.

RANTES

 

 

lNF-‘y

        

_. Hm, H
... . a. m
I

     

24 Hours

 

mmwfiaemrhm

F

..Eg

233

DISCUSSION:

Hard metal lung disease (HMLD) and cobalt asthma are occupational
respiratory diseases affecting workers involved in manufacture and
maintenance of hard metals (material consisting of tungsten carbide cemented
in a matrix of cobalt), diamond polishing, and coal mining. The incidence of
HMLD in diamond polishers who were exposed to cobalt-containing dust
suggests cobalt as a sole etiological agent in HMLD [1]. These workers
manifested ainlvay constriction, alveolitis, fibrosis and associated giant cell
interstitial pneumonitis [1]. Despite the countless incidences of cobalt induced

toxicities, a complete mechanistic understanding is still lacking.

Several in vitro studies have shown that cobalt acts as a stabilizer of HlFs.
Hypoxia-like cellular responses have also been observed following cobalt
exposure [19, 20]. In addition, a defined role for HlFs in inflammation and
tissue injury has been established. HlF1or target genes such as VEGF and
MMPs have been shown to be unregulated in inflammatory conditions [21].
Similarly, hypoxia induced activation of genes involved in inflammatory
processes suggests links between hypoxia and inflammation [22]. Based on
the links between cobalt and hypoxia as well as hypoxia and inflammation,
cobalt-induced HlF1or stabilization might be an important player in

inflammatory manifestations of metal-induced lung disease.

234

To characterize the progression of cobalt induced inflammation, we
performed short-term cobalt exposure studies in a lung epithelium—specific
HlF10l deficient mice model. Subchronic cobalt exposure in the same model
has elucidated the role of HlF1or in modulation of lung inflammation. These
results suggest that airway epithelial-derived HlF1or plays a critical role in
modulating the inflammatory response of the lung, however, the signals
necessary to instigate the differences in inflammatory response could not be
discerned from the single time point tested. The results presented in this
study suggest that loss of epithelial derived HlF1or signaling is necessary for

establishing the proper Th1 response to cobalt challenge.

In recent years, Clinical and experimental studies have generated
evidences highlighting various pathological changes in the lungs of exposed
humans as well as experimental animals. The pathology observed in cobalt-
induced inhalation toxicity includes degeneration of the olfactory epithelium,
hyperplasia and squamous metaplasia in the epithelium of the respiratory
turbinates and larynx, hemorrhage, macrophage infiltration in the alveolar
spaces, lung edema [23] and fibrosing alveolitis [24]. In clinical case of cobalt-
fume exposure, positive correlation between TNFor and cobalt
pneumoconiosis has been reported that suggests TNFor’s has a potential role
in the pathogenesis of interstitial lung disease [25]. However, the similar
elevation of TNFor was not seen in rat alveolar macrophage culture as well as

in in vivo intranasal exposure studies in rats [26]. Interestingly, levels of TNFor

235

are specifically higher in control mice after 1 and 2 days of cobalt chloride
treatments that was not observed in their HIF1CXNA counterparts (Fig. 5.7).
These results suggest that HlFlor is capable of regulating the cytokines

correlated with manifestations of lung disease.

Early in the course of injury, similar to the classical responses to cobalt
exposure, neutrophils are seen in cobalt-treated HlF1or deficient as well as
cobalt-treated control mice 24 hours after first exposure (Figs. 5.6A and 5.6B).
This finding suggests that the initial acute inflammatory events in response to
the cobalt exposure are similar between control and HlF1a deficient mice.
Cobalt-treated HIF10r deficient mice exhibited less neutrophilic infiltration
upon repeated exposure (Figs. 5.60 and 5.60). The possibility of early
removal of neutrophils from cobalt-treated HlF1or deficient mice explains the
significant reduction of BALF neutrophils 24 hours after second exposure (Fig.
5.30). Neutrophilic influx in to the lung and alveolar space is the characteristic
feature of the acute lung injury (ALI) where they act as a key player in the
pathogenesis of the injury. Mice deficient in CXCR2, a neutrophil membrane
receptor for CXC chemokines KC/CXCL1 and MlP-2/CXCL2/3, showed
marked reduction in neutrophilic reduction in response to ventilator-induced
lung injury [27]. Neutrophil recruitment is mediated by KC in conjunction with
several other factors such as CXC chemokines (Fig 5.7D). Although important
for the immune response, neutrophil-predominant inflammatory responses are

involved in diffused alveolar tissue damage through the release of proteases

236

(MMPs, protease 3, neutrophil elastase, cathepsin G) and reactive oxygen
metabolites (hydrogen peroxide, hypohalous acids, hydroxyl radicals) [28].
Neutrophils generate chemotactic signals that regulate the recruitment of
monocytes and dictate macrophage differentiation towards pro- or anti-
inflammatory state [29]. Similar to activated alveolar macrophages, alveolar
epithelial cells also produced cytokines and chemokines. It has been shown,

similar to macrophages, LPS exposed type II cells also act as an important

source of cytokines such as MCP-1 and lL-8 [30]. Given the growing

evidence of the inflammatory roles of HlFs. It is possible that the loss of HlF1or
from the type II cells result in their altered response to the signals received

from inflammatory cells such as neutrophils and activated macrophages.

All three time points tested in the present study have shown significant
interstitial eosinophil infiltration in cobalt-treated HlF1or deficient mice as
compared to cobalt-treated control mice (Figs. 5.53, 5.50 and 5.5F).
However, the BALF eosinophilia cobalt-treated HlF10l deficient mice reached
significance only after 5 exposures (Fig. 5.30). Interestingly, interstitial
eosinophilic infiltration was present in cobalt-treated control mice that were
exposed to one dose but the degree of infiltration was remarkably less as
compared to cobalt-treated HlF1or deficient mice (Fig. 5.5A). Eosinophils are
differentiated from myeloid precursor cells under the influence of interleukin IL-
3, granulocyte-macrophage colony-stimulating factor (GM-CSF), and IL5

These cells are selectively recruited into the always through Th2 cytokines.

237

HlF1or deficient mice specific recruitment of eosinophils suggests the epithelial
origin of the inflammatory switch. To date, the role of HlFs in eosinophilic
inflammation is unclear. Moreover, the role of epithelial-derived mediators as
modulator of inflammatory responses has not been examined directly. Taken
together, the findings from the current study supplements the data collected in
the recent study and suggests critical role of epithelial-derived HlF1a in the
observed inflammatory switch. However, further investigation on the chemical
signals released by the HlF1or deficient type II and Clara cells will further help
us to understand the mechanism underlying the recruitment of eosinophils and

other downstream events.

The BALF cytokine analyses for lL-2, KC, lL-4, lL-5, lL-13, TNFor, lL-6, IL-
10, INF-y and Rantes have shown the genotype specific changes after cobalt
exposure. Control mice showed significant induction of TNFor, a Th1 cytokine
secreted by activated macrophages, as well as INF-y (Figs. 5.70 and 5.7F). In
accordance to the finding that TNF-or and INF-y stimulates Rantes production,
the levels of Rantes in cobalt-treated control mice followed TNFor like pattern
(Fig. 5.7E) [31]. lL-6 cytokine that promotes Th2 cells differentiation is
elevated in the cobalt-treated control mice (Fig. 5.78). In contrast to control
mice, cobalt-treated HlFlor deficient mice had significantly increased lL-5 that
mediates Th2 cytokine-producing capacity of eosinophils (Fig. 5.7A). These

changes in the cytokine levels further suggest that the loss of HlF1or in lung

238

epithelial cells of the HIF10L deficient mice results in an alteration in the cell’s

ability to respond to the incoming signals from the cobalt damaged cells.

Taken together, the data collected from the current study consolidates
our understanding of the course and nature of cobalt induced inflammation. In
conclusion, the data supports a model in which epithelial-derived HIF1or
activity regulates the lung’s response to metal challenge by controlling the
expression of cytokines necessary to recruit the proper inflammatory
response. Loss of this regulatory mechanism leads to the tissue being biased
towards a Th2-mediated inflammation. The mechanism that leads to this
alteration in the inflammatory response remains unknown and is the focus of

new investigations.

Acknowledgements: The authors appreciate the gift of the conditional HlF1a
mice from Dr. Randall Johnson (University of California San Diego) and the
SP-C-rtTA/(tetO)7-CMV-Cre transgenic from Dr. Jeffrey A. Whitsett (Cincinnati

Children’s Hospital Medical Center).

Grants: This work was supported by funds from the National Institutes of

Health (NIH) R01-ES12186 and P42 ESO4911-17

239

REFERENCES

1

Lison, D., Lauwerys, R., Demedts, M. and Nemery, B. (1996)
Experimental research into the pathogenesis of cobalt/hard metal lung
disease. Eur Respir J. 9, 1024-1028

Vengellur, A., Phillips, J. M., Hogenesch, J. B. and LaPres, J. J. (2005)
Gene expression profiling of hypoxia signaling in human hepatocellular
carcinoma cells. Physiol. Genomics. 22, 308-318

Jain, M. and Sznajder, J. I. (2005) Effects of hypoxia on the alveolar
epithelium. Proceedings of the American Thoracic Society. 2, 202-205

Bunn, H. F. and Poyton, R. O. (1996) Oxygen sensing and molecular
adaptation to hypoxia. Phys. Rev. 76, 839-885

Epstein, A. C., et al. (2001) C. elegans EGL-9 and mammalian
homologs define a family of dioxygenases that regulate HIF by prolyl
hydroxylation. Cell. 107, 43-54.

Semenza, G. L., Roth, P. H., Fang, H. M. and Wang, G. L. (1994)
Transcriptional regulation of genes encoding glycolytic enzymes by
hypoxia-inducible factor 1. J. Biol. Chem. 269, 23757-23763

Forsythe, J. A., et al. (1996) Activation of vascular endothelial growth
factor gene transcription by hypoxia-inducible factor 1. Mol. Cell. Biol.
16, 4604-4613

Jung, Y., et al. (2003) Hypoxia-inducible factor induction by tumour
necrosis factor in normoxic cells requires receptor-interacting protein-
dependent nuclear factor kappa B activation. Biochem J. 370, 1011-
1017.

Mojsilovic-Petrovic, J., et al. (2007) Hypoxia-inducible factor-1 (HIF-1) is
involved in the regulation of hypoxia-stimulated expression of monocyte
chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in
astrocytes. J Neuroinflamm. 4, 12

240

10

11

12

13

14

15

16

17

18

19

Salnikow, K., et al. (2004) Depletion of intracellular ascorbate by the
carcinogenic metals nickel and cobalt results in the induction of hypoxic
stress. J Biol Chem

Vengellur, A., Phillips, J. M., Hogenesch, J. B. and LaPres, J. J. (2005)
Gene expression profiling of hypoxia signaling in human hepatocellular
carcinoma cells. Physiological genomics. 22, 308-318

Lombaert, N., Lison, D., Van Hummelen, P. and Kirsch-Volders, M.
(2008) In vitro expression of hard metal dust (WC-Co)-responsive
genes in human peripheral blood mononucleated cells. Toxicol Appl
Pharrnacol. 227, 299-312

Ryan, H. E., Lo, J. and Johnson, R. S. (1998) HIF-1 alpha is required for
solid tumor formation and embryonic vascularization. EMBO Journal.
17, 3005-301 5

Ryan, H. E., et al. (2000) Hypoxia-inducible factor-1 alpha is a positive
factor in solid tumor growth. Cancer Res. 60, 4010-4015

Perl, A. K., et al. (2002) Early restriction of peripheral and proximal cell
lineages during formation of the lung. Proc Natl Acad Sci U S A. 99,
10482-10487.

Lobe, C. G., et al. (1999) Z/AP, a double reporter for ore-mediated
recombination. Dev Biol. 208, 281-292.

Saini, Y., Harkema, J. R. and LaPres, J. J. (2008) HlF1{alpha} Is
Essential for Normal Intrauterine Differentiation of Alveolar Epithelium
and Surfactant Production in the Newborn Lung of Mice. J. Biol. Chem.
283, 33650-33657

Bradford, M. M. (1976) A rapid and sensitive method for the quantitation
of microgram quantities of protein utilizing the principle of protein-dye
binding. Analytical biochemistry. 72, 248-254

Vengellur, A. and LaPres, J. J. (2004) The role of hypoxia inducible
factor 1alpha in cobalt chloride induced cell death in mouse embryonic
fibroblasts. Toxicol Sci. 82, 638-646

241

20

21

22

23

24

25

26

27

28

29

Karovic, O., et al. (2007) Toxic effects of cobalt in primary cultures of
mouse astrocytes. Similarities with hypoxia and role of HIF-1alpha.
Biochemical pharmacology. 73, 694-708

Elson, D. A., et al. (2000) Coordinate up-regulation of hypoxia inducible
factor (HlF)-1 alpha and HIF-1 target genes during multi-stage epidermal
carcinogenesis and wound healing. Cancer research. 60, 6189-6195

Walmsley, S. R., Cadwallader, K. A. and Chilvers, E. R. (2005) The role
of HIF-1alpha in myeloid cell inflammation. Trends in immunology. 26,
434-439

Bucher, J. (1991) NTP technical report on the toxicity studies of Cobalt
Sulfate Heptahydrate in F344/N Rats and B6C3F1 Mice (Inhalation
Studies) (CAS No. 10026-24-1 ). Toxicity report series. 5, 1-38

Lison, D. (1996) Human toxicity of cobalt-containing dust and
experimental studies on the mechanism of interstitial lung disease (hard
metal disease). Critical Reviews in Toxicology. 26, 585-616

Rolfe, M. W., Paine, R., Davenport, R. B. and Strieter, R. M. (1992)
Hard metal pneumoconiosis and the association of tumor necrosis
factor-alpha. The American review of respiratory disease. 146, 1600-
1602

Huaux, F., Lasfargues, G., Lauwerys, R. and Lison, D. (1995) Lung
toxicity of hard metal particles and production of interleukin-1, tumor
necrosis factor-alpha, fibronectin, and cystatin-c by lung phagocytes.
Toxicology and applied pharmacology. 132, 53-62

Belperio, J. A., et al. (2002) Critical role for CXCR2 and CXCR2 ligands
during the pathogenesis of ventilator-induced lung injury. The Journal of
clinical investigation. 110, 1703-1716

Nathan, C. (2006) Neutrophils and immunity: challenges and
opportunities. Nat Rev Immunol. 6, 173-182

Bennouna, S., Bliss, S. K., Curiel, T. J. and Denkers, E. Y. (2003)
Cross-talk in the innate immune system: neutrophils instruct recruitment

242

30

31

and activation of dendritic cells during microbial infection. J Immunol.
171, 6052-6058

Thorley, A. J., et al. (2007) Differential regulation of cytokine release
and leukocyte migration by Iipopolysaccharide-stimulated primary
human lung alveolar type II epithelial cells and macrophages. J
Immunol. 178, 463-473

Teran, L. M., et al. (1999) Th1- and Th2-type cytokines regulate the
expression and production of eotaxin and RANTES by human lung
fibroblasts. American journal of respiratory cell and molecular biology.
20, 777-786

243

CHAPTER 6
CONCLUSIONS

The increasing use of disposable electronics and growing
industrialization of nation’s economies have drastically raised the risk of
exposure to toxic metals. Mining operations, the burning of fossil fuels and
globalization have pushed metals into close proximities of neighborhoods and
the general population. The most “at risk” group, however, remains workers in
various industrial settings, including large-scale smelting operations and alloy
manufacturers.

One of these metals, cobalt, is used as a coloring agent for ceramics
and the production of alloys. ‘Cobalt is used widely in several industries
involved in the production of coloring agent for ceramics, hard metal alloys,
sintered carbides, drilling and grinding tools. The people who manufacture
these metals and use the end products are at particular risk for exposure. It
has been estimated that more than 1 million workers in the United States are
exposed to cobalt due to the nature of their work. Moreover, cobalt is present
in 426 of the 1,636 National Priorities List (NPL) hazardous waste sites
identified by the Environmental Protection Agency (EPA). Finally, the
correlation of high environmental cobalt levels to a cluster of lung diseases
makes the understanding of cobalt-induced signaling and toxicity important to

workers and the public at large.

244

Workers exposed to cobalt dust from welding, grinding, or diamond
polishing operations have displayed multiple lung pathologies. Cobalt (or hard
metal) asthma is one of three occupational respiratory diseases associated
with exposure to the transition metal. The other two are hypersensitivity
pneumonitis and interstitial lung disease with fibrosis. These diseases are
caused by the inhalation of hard metal particles and are characterized by
ainlvay constriction, alveolitis, fibrosis and associated giant cell interstitial
pneumonitis. Therefore, mechanistic understanding of the toxicities of cobalt
and related metals such as nickel is important to devise treatment strategies.
The characterizations of these toxicities demands comprehensive
understanding of the effects of toxicants on the cell signaling and the
downstream changes in the gene expression. It is well established that cobalt
is a hypoxia mimic due to its ability to induce hypoxia-like gene expression
responses. To enhance our understanding on the involvement of hypoxia-
mimicking properties of cobalt in its toxic responses, we developed and used a
mouse model system. This mouse model is an inducible lung-specific

HlF1or deficient system based on Cre-LoxP recombination strategy.

HIFs are the most widely studied family of hypoxia responsive
transcription factors and they directly influence the expression of more than
150 genes. Among three known HlFor’s, oxygen labile isoforms, HIF1or is
most widely expressed isoform that has been studied extensively. Previous

studies in our lab, using an immortalized mouse embryonic fibroblast (MEFs)

245

cell line lacking HlF1a, established the correlation between HIF1a removal

and protection against CoCI2 toxicity. Validation of our in vitro understanding

of cobalt-induced HlFs signaling necessitates the in vivo studies of cobalt
toxicity in HIFs null animals.

Our attempt to generate the inducible lung-specific HlF1adeficient mice
model led us to an interesting investigation on the roles of HlF1ain lung
development. Lung specific embryonic deletion of HlF1a earlier than 3 days
prior to parturition led to HlF1q deficient neonates exhibiting cyanosis and
respiratory failure soon after birth. The expression of surfactant proteins was
significantly lower in HlF1a deficient neonates as compared to Iitterrnate
control pups. Examination of the lungs from HlF1q deficient neonates via light
and transmission electron microscopy confirmed defects in both alveolar
epithelial differentiation and septal development that resulted in the observed
respiratory distress. It was interesting to note the decreased expression of
HlF20r, another prominent form of HIFor in lungs, in HlF1a deficient neonates
that led us to further investigate the roles of both HIF isoforms, individually and
collectively.

The attempts to generate viable HlF20r mice revealed that the removal of
this isoform from the lung does not affect the viability of neonates. However,
the removal of both the isoforms from the lungs revealed an interesting rescue
phenotype. Microarray analysis of the lungs from HlF1aA/A, HIF2 orA/A and
HIF1/2 orA/A mice identified genes and cellular pathways. The majority of

these pathways, such as surfactant metabolism and vesicular trafficking, were

246

specifically affected in the HlF1aA/A neonates. However, the expression
profile of some genes, such as IL1R—ll and ODS-1, were significantly reduced

in the HlF1or deficient mice and regained their expression levels after the

simultaneous removal of HlF10r and HIF2 or. Further studies to understand the

intricate network of developmentally important factors relative to HlFs
necessitates conducting future experiments using rescue or complementation
strategies.

Given the extremely complex developmental network involved in the
lung development, it would be rational to approach to investigate the observed
findings through multidimensional approach specific to each of the affected
cellular pathway. The upregulation of genes involved in cell cycle processes
suggests the shift from cell differentiation pathways to more cell proliferation
pathways. This is in agreement with the pathology in which the HIF1or
deficient mice exhibited signs of stalled differentiation of immature cuboidal
alveolar epithelial cells. It is assumed that these immature cuboidal alveolar
epithelial cells are the precursors of differentiated alveolar type II cells that, in
turn, differentiate into type | cells. The most striking function of type II cells in
the developing lungs is surfactant biosynthesis which necessitates the cell-
specific upregulation of genes involved in fatty acid synthesis, cholesterol
biosynthesis, surfactant proteins biosynthesis and the specialized vesicular
transport system. Surfactant biosynthesis and their vesicular transportation to
the cell membrane are characteristic of alveolar type II cells. It is clearly a cell-

specific temporal mode of expression of genes involved in these processes.

247

In addition to the cell cycle processes, the genes involved in the
vesicular transport and surfactant pathways are downregulated in HIF1or
deficient mice. There could be two possible explanation of these observed
expression pattern. First, the stalled differentiation might be the consequence
of the deletion of HlF1or that leads to the perturbation of the downstream
developmentally critical cascades. This effect could be explained by the
observed gene expression pattern of transcriptional factors such as B-catenin
that were significantly downregulated upon HIF1or deletion. It is quite possible
that some other developmentally critical (transcriptional) factors fall directly or
indirectly downstream of HlF1or in the cellular differentiation cascades. Thus,
the altered expression of the surfactants might be the consequence of stalled
differentiation process. The seCond possible explanation of the respiratory
distress phenotype observed in HlF1or deficient mice might be more intimately
related to the surfactant metabolism. The genes involved in the surfactant
metabolism are still not well studied for their hypoxia responsiveness. Further
studies on the selected genes will certainly provide avenues for the
development of treatment strategies to combat neonatal distress syndrome.

The lethality following in utero deletion of HlF1a, led us to adopt
postnatal strategy of doxycycline treatment and functional deletion of HlF1a.
The post-natal deletion of HIF1or from Type II and Clara cells had no
observable pathology. In order to elucidate the role of epithelial derived-
HlF1or signaling in cobalt-induced lung injury these mice were exposed to

cobalt chloride via oropharyngeal aspiration. Compared to control mice, mice

248

that were HlF1adeficient in their lungs exhibited airway infiltration of
eosinophils and airway epithelial changes, including mucus cell metaplasia
and increased levels of the chitinase-like proteins YM1 and YM2. Mice
deficient in HlF1or also showed a drastic change in cytokine profiles in their
lavage fluid when compared to their control.

These results suggested that loss of HlF1or from alveolar Type II
epithelial and Clara cells of the lungs leads to cellular and molecular
processes that are associated with asthma following cobalt exposure.
Moreover, the results suggest that ainlvay epithelial-derived HlF1or plays a
critical role in modulating the inflammatory response of the lung. These
results also suggested a difference in the inflammatory response between the
control and HIF10lA/A mice; however, it is based on collected data at a single
time point following two weeks of cobalt exposure. Thus, to consolidate our
understanding on the course and nature of cobalt induced inflammation further
time course studies were planned.

In the time course studies, control and HIF1or deficient mice were
exposed to cobalt daily for 1, 2, or 5 days. Bronchoalveolar lavage fluid
(BALF) cellularity from HlF1adeficient mice displayed a progressive
eosinophilic infiltration whereas control mice displayed a transient Increase in
neutrophils. Histological analysis revealed accelerated tissue injury following
acute cobalt challenge in HlF1or deficient mice. Finally, BALF cytokine
analysis showed lL-5 elevation specific to cobalt-treated HIF1or deficient mice.

In contrast, control mice showed specific induction of lL-6 and tumor necrosis

249

factor or (TNFa) following cobalt treatment. These results suggests that
epithelial-derived HlF1or is essential for regulating early inflammatory events
following cobalt challenge and loss of this regulation biases the lung towards a
Th2-mediated process and an asthma-like pathology following metal
exposure.

Taken together, the striking differences observed following cobalt
exposure in the two mice suggests that they will be a powerful tool to help
understand the relationship between allergy-induced asthma, hypoxia, and
inflammation. More importantly, direct comparison of the responses of the
control and HIF1orA/A mice in other asthma models (e.g. ovalbumin challenge)
and to other inflammatory inhalants will correlate this relationship to specific
cytokines. The research also raises several important questions: Does the
loss of HIF1or alter an organism’s susceptibility to asthma using other
allergens? What role does HlF1or derived from other cell types (e.g.
infiltrating inflammatory cells and Type I cells) play in modulating this
inflammatory response. Does post-natal deletion of HlF1or alter HlF20r and if
so, what impact does this have on the inflammatory response. Most
importantly, does a decrease in HlF1or functionality lead to an increased
susceptibility to asthma in humans? More specifically, is it possible that loss
or decrease in HlF1or function biases the lung towards a Th2 immune
polarization and this increases the susceptibility of individuals towards

extrinsic asthma?

250

Table A.1. List of differentially expressed genes

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene Name ratio ratio ratio
Solute carn'er family 34 (sodium phosphate),
20505 member 1 37.07 -1.00 -l.19
Similar to Ankyrin repeat domain-
546994 containing gotein 26 28.05 -1.00 -1.02
15395 Homeo box A10 21.62 2.30 1.24
56183 Neuromedin U 16.00 1.27 5.62
212070 Clarin3 13.84 -1.19 -1.09
15378 Hepatic nuclear factor 4, alpha 13.40 1.08 -1.82
84112 Succinate receptor 1 11.10 1.40 1.06
228491 Zinc finger protein 770 10.52 -1.16 1.10
14866 Glutathione S-transferase, mu 5 8.64 1.48 5.84
17748 Metallothionein 1 8.42 4.34 3.44
241516 Fibrous sheath-interactigg protein 2 6.46 -1.13 1.47
13653 Early gowth remnse 1 6.25 -1.30 2.35
215627 Zinc finger and BTB domain containing 8 5.54 1.33 2.20
654824 Ankyrin repeat domain 37 5.31 1.04 2.14
75656 RIKEN cdna 1700020A23 gene 5.13 1.22 2.54
230766 Cdna sequence BC030183 4.80 1.10 1.37
66261 Transmembrane 4 L six family member 20 4.23 -1.11 1.27
Methenyltetrahydrofolate synthetase domain
234814 containing 3.88 -1.52 1.24
75512 Glutathione peroxidase 6 3.85 1.12 -1.04
20423 Sonic hedgfig 3.74 1.35 1.08
Chromodomain helicase DNA binding
71389 protein 6 3.72 -1.19 1.24
72650 RIKEN cdna 2810006K23 gene 3.69 1.00 1.13
Cytochrome P450, family 2, subfamily c,
13099 polypeptide 40 3.68 1.51 -1.79
239250 SLIT and NTRK-like family, member 6 3.65 -1.03 1.39
68214 Glutathione S-transferase omeEaZ 3.64 -1.20 -1.29
58909 RIKEN cdna D43OOISBOI gene 3.62 1.08 1.34
67951 Tubulin, beta 6 3.37 1.03 1.46
19434 Retina and anterior neural fold homeobox 3.36 -1.00 -1.31
232339 Ankyn'n repeat domain 26 3.32 -1.48 1.23
20464 Single-minded homolog 1 (Drosophila) 3.31 -1.06 -l .02
53601 Protocadherin 12 3.27 1.28 1.01
12000 Arginine vasopressin receptor 2 3.25 -1.35 -l .00
13193 Doublecortin 3 .24 -1.00 1.05

 

251

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
207742 Ring finger protein 43 3.14 - l .09 1.03
380773 RIKEN cdna 1810035L17 gene 3.13 -1.52 1.07
Heparan sulfate (glucosamine) 3-0-
54710 sulfotransferase 381 3.10 -1.13 1.42
66950 Transmembrane protein 206 3.09 -1.17 1.07
Haloacid dehalogenase-like hydrolase
72748 domain containing 3 3.09 1.04 1.10
320803 RIKEN cdna C130022MO3 gene 3.06 -l.08 1.31
72080 RIKEN cdna 20103171324 gene 3.04 1.41 1.14
22295 Cadherin 23 (otocadherin) 3.04 1.74 -2.20
56742 Proline/serine-rich coiled-coil 1 3.02 1.57 2.66
68750 Ras responsive element binding protein 1 3.01 1.14 1.22
74043 Peroxisome biogenesis factor 26 3.00 1.20 1.55
18762 Protein kinase C, zeta 2.98 -1.02 1.47
216829 Cdna segrence BC025076 2.96 -1.21 1.34
Anterior pharynx defective lb homolog (C.
208117 Elegg‘») 2.92 1.47 1.63
15438 Homeo box D9 2.88 -1.20 -1.17
215693 Zinc tiger, matrin type 1 2.88 -1.22 1.31
13841 Eph receptor A7 2.87 1.32 1.19
78320 RIKEN cdna 2210415111£ne 2.87 1.06 1.83
71263 Maestro 2.87 1.59 1.49
Proline/serine-n'ch
56742 coiled-coil 1 2.84 1.60 2.03
18828 Phospholipid scramblase 2 2.84 1.13 1.28
RAS-like, estrogen-regulated, growth-
232441 inhibitor 2.84 -1.43 -1.14
16182 Interleukin 18 receptor 1 2.82 -l.25 1.65
18510 Paired box gene 8 2.81 -l.05 1.11
Mediator of RNA polymerase 11
329650 transcription 2.80 1.03 1.29
18828 Phospholipid scramblase 2 2.80 1.14 1.40
328425 Deleted in lymphocytic leukemia, 2 2.78 1.16 1.47
Adaptor-related protein complex 3, mu 1
55946 subunit 2.77 -1.07 1.33
98685 RIKEN cdna 1190005F20 Elle 2.77 1.02 1.12
103573 Exportin 1, CRMl homolog (yeast) 2.76 1.06 1.41
215494 Expressed sequence C85492 2.75 -1.23 1.51
100177 Zinc finger, MYM-type 6 2.74 -1.00 -2.39
218763 Leucine rich repeat containinL33 2.73 -1.00 1.09
Inhibitor of growth family,
69260 member 2 2.73 -1.07 1.38

 

 

 

 

 

252

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio
171282 Acyl-coa thioesterase 4 2.70 1.14 1.07
433940 Cdna sequence BC057022 2.70 -1.52 1.20
66315 SUMOI/sentrin specific peptidase 7 2.70 1.03 1.20
12160 Bone morphogenetic protein 5 2.69 1.52 1.11
244071 ATP/GTP binding protein-like 1 2.68 -1.00 -1.08
320573 RIKEN cdna C130024JOZ gene 2.68 -1.09 1.08
77418 RIKEN cdna C030015Al9jene 2.67 -1.62 1.31
83486 RNA bindingmotif protein 5 2.67 -1.26 1.06
66274 RIKEN cdna 1810012P15 gene 2.65 1.15 1.48
330256 Hypotheticalprotein 9530028C05 2.64 1.46 1.36
56742 Proline/serine-rich coiled-coil 1 2.64 1.63 1.77
228880 Protein kinase C binding protein 1 . 2.64 1.00 1.21
Tumor necrosis factor receptor superfamily,
22163 member 4 2.64 1.12 1.48
DEAH (Asp-Glu-Ala-His) box polypeptide
216877 33 2.64 1.10 -1.22
72852 RIKEN cdna 2900024010 gene 2.64 1.07 1.55
78004 Proline rich 15 2.63 1.37 1.22
67892 RIKEN cdna 1810063B05 gene 2.63 -1.40 1.19
381853 Gastric inhibitory polypeptide receptor 2.63 1.59 1.67
21683 Tectorin alpha 2.63 -1.06 -1.30
218100 Zinc finger protein 322a 2.63 -1.16 1.20
791282 Predicted gene, ENSMUSGOOOOOOS7802 2.61 1.03 -1.01
434179 Predicted gene, EG434179 2.60 1.29 1.34
13423 Deoxyribonuclease II alpha 2.58 -1.23 1.42
71599 SUMO/sentrin specific peptidase 8 2.58 -1.10 1.43
67790 RAB39B, member RAS oncogene family 2.58 -1.18 1.33
RIKEN cdna
77609 C330001K17 gene 2.56 1.58 1.16
217716 Mutl homolog 3 (E coli) 2.56 1.16 1.03
68281 RIKEN cdna 4930430F08 gene 2.56 -1.12 1.24
56335 Methyltransferase-like 3 2.55 -1.04 1.07
16428 IL2-inducible T-cell kinase 2.55 1.02 1.28
UPF3 regulator of nonsense transcripts
68134 homolog B (yeast) 2.55 1.34 1.31
193736 Zinc finger and BTB domain containing 12 2.54 -1.11 1.22
Methylmalonic aciduria (cobalamin
109136 deficiency) type A 2.53 -1.04 1.28
Structural maintenance of
14211 chromosomes 2 2.52 1.09 1.47
67283 Solute carrier family 25 , member 19 2.52 -1.13 1.26

 

253

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
218850 DNA segment, Chr 14, Abbott 1 expressed 2.51 -l.10 -1.09
THAP domain containing, apoptosis
66816 associated protein 2 2.50 -1.34 1.21
72397 RNA binding motif protein 12B 2.50 1.48 -1.09
Ventricular zone expressed PH domain
72789 homolog 1 (zebrafish) 2.49 -1.05 1.63
22635 Zonadhesin 2.49 1 .09 1 .10
75387 Sirtuin 4 (S. Cerevisiae) 2.49 -1.03 1.42
66522 Pyroflltamyl-peptidase I 2.47 -1.29 -1.04
50780 Rgulator of G-g‘otein signaling 3 2.47 -1.04 1.04
30838 F-box and WD-40 domain protein 4 2.46 -1.15 -1.04
235442 RABSB, member RAS onc0jene famill 2.46 -1.04 1.20
77857 RIKEN cdna 9430065F17 gene 2.45 -1.04 1.22
SH3-domain GRB2-like (endophilin)
73094 interacting protein 1 2.45 -1.12 -1.08
Oxidized low density lipoprotein (lectin-
108078 like) receptor 1 2.43 -1.53 -1.16
625963 Hypothetical protein LOC625963 2.42 1.20 1.36
268853 Gene model 671, (NCBI) 2.41 -1.12 1.01
13176 Deleted in colorectal carcinoma 2.40 -1.17 -1.12
58240 HCLSI bindigg protein 3 2.39 1.02 1.21
58894 RIKEN cdna 4732460K03 Que 2.38 -1.58 1.68
75787 RIKEN cdna 4930471M09 gene 2.38 -1.18 1.05
21808 Transforminggrowth factor, beta 2 2.38 1.05 1.09
Bromodomain and WD repeat domain
93871 containing 1 2.38 1.28 1.24
Golgi-specific brefeldin A-resistance factor
107338 1 2.38 1.05 1.27
74455 NOLl/NOPZ/Sun domain family 6 2.37 1.11 1.14
228880 Protein kinase C binding protein 1 2.37 1.09 1.15
57432 Zinc finger CCCH type containing 8 2.37 -1.01 1.23
434234 RIKEN cdna 2610020H08 gene 2.36 -l.00 1.30
67382 Bromodomain containing3 2.35 -1.35 1.07
225283 Cdna sequence BC021395 2.35 -1.26 1.36
Neural precursor cell expressed,
17997 developmentally down-regulated gene 1 2.34 -1.12 1.16
21848 Tripartite motif-containing 24 2.33 -1.25 -1.10
94281 Sideroflexin 4 2.33 -1.08 1.49
Zinc finger with KRAB and SCAN domains
72739 3 2.32 1.09 1.20
77940 RIKEN cdna A930004D18gg1e 2.31 -1.12 -1.12
78004 Proline rich 15 2.31 -l .02 1.07

 

 

 

 

 

254

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio
72103 RIKEN cdna 2010301N04 gene 2.31 -1.25 -1.03
11994 Protocadherin 15 2.30 -1.21 1.07
77519 RIKEN cdna 5730601FO6 gene 2.29 -1.08 1.23
73242 RIKEN cdna 2610110612 gene 2.28 1.10 1.27
66821 BCSl-like (yeastL 2.28 -1.00 1.26
69008 Calcium bindingprotein 39-1ike 2.27 1.00 1.29
Transmembrane and tetratricopeptide repeat
70551 containing 4 2.27 1.04 1.38
434179 Predicteigme, EG434179 2.27 1.27 1.44
240641 Kinesin family member 20B 2.26 1.05 1.12
Rho guanine nucleotide exchange factor
213649 (GEF) 19 2.26 1.37 1.28
109731 Monoamine oxidase B 2.24 1.18 1.27
Mitogen-activated protein kinase kinase
26404 kinase 12 2.24 1.04 1.24
74087 Solute carrier family 7, member 13 2.24 1.02 -1.21
26414 Mitogen-activated protein kinase 10 2.24 -1.10 -1.00
18205 Neurotrophin 3 2.23 -1.21 1.20
268822 Aarf domain containing kinase 5 2.23 -1.00 1.44
231832 Transmembrane protein 184a 2.23 1.25 1.27
338320 Melanoma inhibitory activity 2 2.23 -1.09 -1.14
76742 Sorting nexin family member 27 2.23 -1 . 14 1.09
387334 Defensin beta 50 2.22 -1.11 1.07
19331 RABl9, member RAS oncogene family 2.22 -1.01 1.25
DEAD (Asp-Glu-Ala-Asp) box polypeptide
230073 58 2.21 1.17 1.22
Enoyl Coenzyme A hydratase domain
67856 containing 3 2.20 1.26 1.25
320376 BCL6 co-repressor-like 1 2.20 -1.26 1.05
113854 Vomeronasal 1 receptor, B4 2.19 -1.03 1.15
52335 Ataxin l-like 2.19 -l.08 1.08
Rap guanine nucleotide exchange factor
268480 (GEF)-like 1 2.19 -1.03 1.40
12858 Cytochrome c oxidase, subunit Va 2.19 1.04 1.16
Thiosulfate sulfurtransferase,
221 17 mitochondrial 2.19 1 .28 1.46
Beta-1,3-glucuronyltransferase 2
280645 (glucuronosyltransferase S) 2.19 -1.06 1.31
Lymphocyte antigen 6 complex, locus
114654 G6D 2.18 -1.08 1.27
240638 Solute carrier family 16 , member 12 2.18 1.20 1.42
245886 Ankyrin repeat domain 27 (V PS9 domaign) 2.18 -1.17 1.03

 

255

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio
Small nuclear RNA activating complex,
77634 polypeptide 3 2.18 -1.01 -1 .18
Sfil homolog, spindle assembly associated
78887 (yeast) 2.18 1.00 1.09
21778 Testis expressed gene 9 2.17 1.47 1.10
Vezatin, adherens junctions transmembrane
215008 protein 2.17 1.08 1.25
75763 RIKEN cdna 4833418A01 gene 2.17 -l.01 1.08
Poly (ADP-ribose) polymerase family,
101187 member 11 2.16 -1.33 1.22
30054 Ring finger protein 17 2.16 -l .00 1.18
12009 5-azacytidine induced gene 1 2.16 1.02 1.07
269023 Zinc fingr protein 608 2.15 1.04 1.23
22718 Zinc finggr protein 60 2.15 -1.58 1.13
26450 Retinoblastoma binding protein 9 2.15 1.31 1.52
V-set and immunoglobulin domain
57276 containing 2 2.15 1.24 1.26
18044 Nuclear transcription factor-Y alpha 2.14 -1.54 -1.15
381293 Kinesin family member 14 2.14 1.23 1.07
320488 RIKEN cdna D130039L10 gene 2.14 -1.12 -1.07
20689 Sal-like 3 (Drosophila) 2.14 -1.00 -1.14
671 18 Bifunctional apoptosis regulator 2.14 1 .04 1.30
225283 Cdna sequence BC021395 2.14 -1.01 1.18
67459 Nuclear VCP-like 2.13 -1 . 13 1.15
13639 EphrinA4 2.13 1.11 1.16
224055 Receptor transporter protein 2 2.13 -1.20 -1.09
28019 Inhibitor of growth family, member 4 2.13 1.12 1.05
19650 Retinoblastoma-like 1 (p107) 2.13 1.16 1.28
27369 Deoxyguanosine kinase 2.13 -1.02 1.10
RAB3A interacting protein
74760 (rabin3)-like 1 2.13 1.11 1.44
78745 RIKEN cdna 9530097N15 gene 2.12 1.12 -1.03
20585 Helicase-like transcription factor 2.12 1.08 1.34
Zinc finger, RAN-binding domain
53861 containing 2 2.12 -1.06 1.45
100177 Zinc finger, MYM-type 6 2.12 1.03 1.28
SAFB-like, transcription
66660 modulator 2.12 1.03 1.29
231807 Cdna sequence BC037034 2.11 -1.20 1.01
Zinc finger with KRAB and SCAN domains
72739 3 2.11 1.05 1.13
Potassium channel tetramerisation domain
212919 containing 7 2.11 -1.02 -1.06

 

 

 

 

 

256

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
Splicing factor, arginine/serine-rich 1
110809 (ASF/SF2) 2.10 -1.03 1.04
237465 Coiled-coil domain containing 38 2.10 -1.31 1.02
57869 Aarf domain containing kinase 2 2.10 -1.03 1.15
77593 Ubiquitin specific petidase 45 2.10 -1.11 1.12
320575 RIKEN cdna C230057HO2 gene 2.10 -1.05 -1.00
21 1329 Nuclear receptor coactivator 7 2.09 -1.32 -1.67
230848 Zinc finger and BTB domain containing 40 2.09 -1.11 1.02
320720 FAST kinase domains 1 2.09 1.05 1.10
19364 RADSl-like 3 (S. Cerevisiae) 2.09 1.16 1.12
240028 Leucyl/cystinyl aminopgptidase 2.09 -1 .57 1 .08
1 1512 Adenylate cyclase 6 2.09 1.17 1.04
57277 Secreted Ly6/Plaur domain containing 1 2.09 1.13 1.17
Ankyrin repeat and sterile alpha motif
72615 domain containing 2.09 1.01 -1.02
54678 Zinc finger protein 108 2.09 -1.03 1.17
17763 Mature T-cell proliferation 1 2.08 1.03 1.35
67288 SFRSlZ-interacting protein 1 2.08 -1.08 1.13
17268 Meis homeobox 1 2.08 -1.02 1.12
PRP38 pre-mma processing factor 38
66921 (yeast) domain containing B 2.08 1.12 1.29
12349 Carbonic anhydrase 2 2.08 1.24 1.12
Metallophosphoesterase domain containing
77015 2 2.08 1.17 1.23
SAM pointed domain containing ets
30051 transcription factor 2.08 -1.54 1.84
242297 RIKEN cdna 1700012H17 gene 2.07 1.29 1.36
494448 Chromobox homolog 6 2.07 -1.00 -1.03
52592 Breast cancer metastasis-sumessor 1-like 2.07 -1.02 1.20
209176 Indoleamine-pyrrole 2,3 dioxygenase-like 1 2.07 -1.05 1.13
BRCA1 interacting protein C-terminal
237911 helicase 1 2.07 -1.18 1.04
16924 Ligand of numb-protein X 1 2.06 1.23 1.68
258472 Olfactory receptor 899 2.06 1.57 1.12
Cholinergic receptor, nicotinic, beta
108015 polypeptide 4 2.06 1.18 -1.05
Serine (or cysteine) peptidase inhibitor,
331535 clade A, member 7 2.05 -1.13 2.53
675815 Similar to quaking type II 2.05 -1.52 1.06
30840 F-box and leucine-rich repeat protein 6 2.05 1.10 1.11
69847 WNK lysine deficient protein kinase 4 2.05 1.12 1.19
230098 RIKEN cdna E130306D19 gene 2.05 1.25 1.22

 

257

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
73683 Autophagy related 16 like 2 (S. Cerevisiae) 2.05 -1.06 -1.03
108912 Cell division cycle associated 2 2.05 1.14 1.11
Killer cell lectin-like receptor, subfamily A,
16634 member 3 2.04 -1.00 -1.06
76432 RIKEN cdna 2310001H17 gene 2.04 1.05 -1.07
434903 Expressed sequence CN716893 2.04 -1.05 1.04
103733 Tubulin, gamma 1 2.04 1.00 1.23
98463 Expressed sequence A1851716 2.04 1.17 1.12
353165 Taste receptor, type 2, member 136 2.04 -1.29 -1.09
71774 Shroom fanny member 1 2.04 -1.01 -1.04
237073 RNA binding motif Eotein 41 2.04 -1.08 -2.02
78808 Syntaxin binding protein 5 (to_mosyn) 2.04 -1.14 -1 . 10
22619 Sialic acid acgtylesterase 2.04 1.17 1.15
494448 Chromobox homolog 6 2.04 -1.08 1.10
68490 Zinc finger protein 579 2.03 1.02 1.33
NIMA (never in mitosis gene a)-related
23955 expressed kinase 4 2.03 -1.07 1.14
Cystic fibrosis transmembrane conductance
12638 regulator homologfi 2.03 -2.26 1.1 1
229487 PET112-like (yeast) 2.03 1.48 1.41
19653 RNA binding motif protein 4 2.03 -1.06 -1.03
215641 Melanoma antigen family B, 18 2.03 -1.00 1.27
Potassium channel, subfamily V,
240595 member 2 2.02 -1.00 -1.22
56229 Thrombospondin, type 1, domain 1 2.02 1.02 -1.29
14149 F erredoxin reductase 2.02 1.07 1.56
68607 Serine hydrolase-like 2.02 1.44 1.36
56711 Pleiomorphic adenoma gene 1 2.01 -1. 16 -1.17
76511 RIKEN cdna 2010004M13 gene 2.01 -1.00 1.33
General transcription factor II H,
23894 polypeptide 2 2.01 1.07 1.05
68837 Forkhead box K2 2.01 1.01 -1.09
237211 Fanconi anemia, complementatirggroup B 2.01 -1.24 1.03
93728 Poly A binding protein, cytoplasmic 5 2.01 1.16 1.48
54141 Sperm associated antigen 5 2.01 1.61 1.03
67454 RIKEN cdna 1200009F10 gene 2.00 1.02 1.33
225283 Cdna sequence BC021395 2.00 -1.01 1.23
Tial cytotoxic granule-associated RNA
21843 binding protein-like 1 2.00 -l.12 1.21
69754 F-box protein 7 1.99 1.00 -1.01
101563 Expressed sequence A1426330 1.99 1.01 1.23

 

 

 

 

 

258

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio
68053 RIKEN cdna 3110003A22 gene 1.99 1.07 1.41
Potassium channel tetramerisation domain
207474 containing 2b 1.99 1.06 1.22
78248 Armadillo repeat containing, X-linked 1 1.99 -1.04 -1.02
234686 Formin homology 2 domain containing 1 1.99 -1.15 -1.02
Visual system homeobox 1 homolog
114889 (zebrafish) 1.99 -1.06 -1.32
67493 Methyltransferase 10 domain containing 1.98 -1.30 1.20
3-hydroxymethyl-3-methylglutaryl-
208982 Coenzyme A 1yase-like 1 1.98 -1.16 1.50
Threonyl-tma synthetase 2, mitochondrial
71807 (putative) 1.98 -1.12 1.13
14302 bin-related kinase 1.98 -1.26 -1.02
64176 Synaptic vesicle glycoprotein 2 b 1.97 1.03 1.13
Developmentally regulated GTP binding
13494 protein 1 1.97 -1.36 -1.04
72852 RIKEN cdna 2900024010 gene 1.97 1.14 1.16
246293 Kelch-like 8 (Drosophila) 1.97 -1.10 -l.00
74042 RIKEN cdna 4921501E09 gene 1.97 -1.02 -1.07
Ubiquitin protein ligase E3 component n-
22222 recognin l 1.97 -1.05 1.08
68364 RIKEN cdna 0610030E20 gene 1.96 1.03 1.13
ST3 beta-galactoside alpha-2,3-
20454 sialyltransferase 5 1.96 -1.02 1.10
74498 Gplgi reassembly stacking protein 1 1.96 1.12 1.09
213409 LEM domain containing 1 1.96 -l.10 1.20
319806 RIKEN cdna D630022N01 gene 1.96 -1.01 1.13
233424 Transmembrane channel-like gene family 3 1.96 -1.30 -1.55
21390 Thromboxane A2 receptor 1.96 -1.04 -1.08
320230 RIKEN cdna C130023OIO gene 1.95 -1.00 1.19
668173 Peroxisome biogenesis factor 10 1.95 1.49 1.13
13829 Erythrocyte protein band 4.9 1.95 -1. 17 -1.34
104248 Calcineurin binding protein 1 1.95 -1 . 10 -1.11
SH3 domain and tetratricopeptide
225608 repeats 2 1.95 1.04 -1.05
103161 Apolipoprotein F 1.94 1.08 -6.60
Imprinted gene in the Prader-Willi
16353 syndrome gion 1.94 -1.47 -1.12
Gamma-aminobutyric acid (GABA-A)
57249 receptor, subunit theta 1.94 -1.00 -1.01
17684 Cbp/p300-interacting transactivator, 2 1.94 -1.03 1.62
68082 Dual specificity phosphatase 19 1.94 1.09 1.34
246104 Rhomboid, veinlet-like 3 (Drosophilg) 1.94 -1.23 1.06

 

259

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio

245638 TBCl domain family, member 8B 1.94 1.22 1.18

68366 Transmembrane protein 129 1.93 1.01 -1. 15
ATP-binding cassette, sub-family G

192663 (WHITE), member 4 1.93 -1.31 1.01

218734 RIKEN cdna 3830406C13 gene 1.93 1.01 1.12

231642 Alkb, alkylation repair homolog 2 (E. Coli) 1.92 -1.03 1.08

54721 Tyrosine kinase 2 1.92 1.23 -1.04

113859 Vomeronasal 1 receptor, C2 1.92 1.07 -1.06
Musashi homolog 1

17690 (Drosophila) 1.92 -1.20 -1.20

27059 SH3 domain protein D19 1.92 -1.15 1.00
01igonucleotide/oligosaccharide-binding

109019 fold containingZA 1.92 -1.11 1.37

140500 Centaurin, beta 5 1.92 1.09 -1.01

232237 FYVE, rhogef and PH domain containing 1.92 1.07 1.03

18120 Mitochondrial ribosomal protein L49 1.92 1.27 1.04

77781 EPMZflaforin) interacting protein 1 1.91 1.08 -1.07

277463 G protein-coupled receptor 107 1.91 1.12 -1.02

21684 Tectorin beta 1.91 -1.26 -1.26

75425 RIKEN cdna 2610036D13 gene 1.91 1.28 1.08

17222 Anaphase promoting complex subunit 1 1.91 -1.00 1.09

231214 Coiled-coil and C2 domain containing 2A 1.91 1.14 1.28
CDC14 cell division cycle 14 homolog A

229776 (S. Cerevisiae) 1.91 -1.25 -1.00
Src homology 2 domain-containing

20420 transforming protein D 1.90 1.38 1.05
CDC23 (cell division cycle 23, yeast,

52563 homolog) 1.90 1.02 -1.11
Grpe-like 2,

17714 mitochondrial 1.90 1.36 1.85
Major facilitator superfamily domain

213006 containing 4 1.90 -1.20 -1.01
Chromodomain helicase DNA binding

71389 protein 6 1.90 -1.07 1.02

73373 Phosphatase, orphan 2 1.90 -1.00 -1.05
TEL2, telomere maintenance 2, homolog (S.

71718 Cerevisiae) 1.90 -1.10 -1.01
DEAH (Asp-Glu-Ala-Asp/His) box

106794 polypeptide 57 1.89 -1.21 1.06

72915 RIKEN cdna 2900017F054mne 1.89 -1.07 1.08
Fibrous sheath CABYR

623046 bind'fl protein 1.89 -1.00 -1.08

328801 Zinc finger protein 414 1.89 -1.11 1.12

233545 RIKEN cdna 2210018M11 gge 1.89 -1.27 1.18

 

 

 

260

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
224111 UBX domain containing 1.88 —1.04 1.14
70359 GTP binding protein 3 1.88 1.14 1.08
DCNl, defective in cullin neddylation 1,
102323 domain containing 2 1.88 -1.09 1.07
233335 Desmuslin 1.88 -1.46 1.19
20540 Solute carrier family 7, member 7 1.88 -1.07 1.37
101700 Tripartite motif-containing 68 1.88 -1.03 1.07
19213 Pancreas specific transcription factor, 1a 1.87 -1.06 -l .08
56032 Tumor suppressor candidate 4 1.87 1.10 1.15
19769 Ras-like without CAAX 1 1.87 -1.06 1.04
235606 Acylpeptide hydrolase 1.86 1.03 1.34
50915 Growth factor receptor bound motein 14 1.86 1.14 1.41
83563 Ubiquitin specific peptidase 26 1.86 -1.04 -1.00
Mannosyl (alpha-1,3-)-g1ycoprotein beta-
67569 1,4-NAG transferase 1.86 -1.24 -1.06
57890 Interleukin 17 receptor E 1.86 -1.29 -1.20
Trna-yw synthesizing protein 1 homolog (S.
100929 Cerevisiae) 1.86 1.01 -1.04
105351 Expressed sequence AW209491 1.86 -l.09 -1.02
23966 Odd Oz/ten-m homolog 4 (Drosophila) 1.86 1.10 1.01
225912 Cytochrome b, ascorbate dependent 3 1.86 -1.04 1.24
16351 IAP promoted placental gene 1.85 1.10 1.15
71609 TNFRSFlA-associated via death domain 1.85 -1.16 -l .03
DCNI , defective in cullin neddylation 1,
102323 domain containing 2 (S. Cerevisiae) 1.85 1.04 1.07
Pleckstrin homology domain interacting
83946 protein 1.85 1.24 1.37
73238 RIKEN cdna 3110049103 gene 1.85 -1.05 1.07
217026 HEAT repeat containing 6 1.85 -1.10 1.29
105000 Dynein, axonemal, light chain 1 1.85 -1.13 1.29
106064 Expressed sequence AW549877 1.85 1.09 1.36
215789 Phosphatase and actin regulator 2 1.85 1.21 1.33
208760 Aquaporin 12 1.85 -1.23 1.14
Phosphodiesterase 6D, cgmp-specific, rod,
18582 delta 1.84 1.10 1.05
Nudix (nucleoside diphosphate linked
67725 moiety X)-type motif 13 1.84 1.15 1.19
74356 RIKEN cdna 4931428FO4 gene 1.84 -1.07 1.16
Poly(A) binding protein,
241989 cytoplasmic 4-like 1.84 1.10 1.07
213988 Trinucleotide repeat containing6b 1.84 -1.05 -1.08
27059 SH3 domain protein D19 1.84 1.09 -1.07

 

 

 

 

 

261

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio

246317 Neuropilin (NRP) and tolloid (TLL)-like 1 1.83 -1.08 -1.20

80890 Tripartite motif-containing 2 1.83 1.12 1.18

101214 Transformer 2 alpha homolog (Drosrmhila) 1.83 -1.18 1.25
Trna splicing endonuclease 54 homolog

76265 (SEN54, S. Cerevisiae) 1.83 -1.11 1.03

107375 Solute carrier family 25, member 45 1.83 1.04 -1.05
Progressive external ophthalmoplegia 1

226153 (human) 1.82 1.08 1.03

240186 Zinc finger protein 438 1.82 1.04 1.52
Chromobox homolog 1 (Drosophila HPl

12412 beta) 1.82 1.08 -1.13

69401 PLAC8-1ike 1 1.82 -1.02 -1.17
Similar to Spetex-2E

624633 protein 1.82 1.13 -1.01

13829 Erythrocyte protein band 4.9 1.81 -1.01 -1.10

67544 RIKEN cdna 4932442KO8 gene 1.81 -1.29 1.14

72656 Integrator complex subunit 8 1.81 1.08 -1.06
V-erb-b2 erythroblastic leukemia viral

13866 oncogene homolog 2 1.81 1.01 1.10

328801 Zinc finEr protein 414 1.81 -1.08 1.21
ST8 alpha-N-acetyl-neuraminide alpha-2,8-

20452 sialyltransferase 4 1.80 1.19 1.17
COP9 (homolog, subunit 7b (Arabidopsis

26895 thaliana) 1.80 -1.11 1.17
GRAM domain

235283 containing 1B 1.80 1.21 -1.18

16551 Kinesin family member 11 1.80 -1.07 -1.18

52463 Tet oncogene 1 1.80 1.08 -l.06

14625 Glycerol kinase-like 1 1.80 1.03 1.05
Branched chain ketoacid dehydrogenase

12041 kinase 1.80 1.19 -1.09

215951 Lactation elevated 1 1.80 1.19 1.24
Ankyrin repeat and zinc finger domain

52231 containing 1 1.80 1.01 1.12
Adenosine monophosphate deaminase 2

109674 (isoform L) 1.79 -1.21 1.07

212442 Lactamase, beta 2 1.79 1.41 1.14
Oligonucleotide/oligosaccharide-binding

108689 fold containing 1 1.79 1.08 1.07
Ankyrin repeat and zinc finger domain

52231 containing; 1.79 1.37 -1.08

215819 NHS-likel 1.79 1.13 1.21

192976 Cdna sequence BC046404 1.79 1.14 -1.23

66336 Centromere protein P 1.79 -1.01 1.02

 

 

 

 

 

262

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio

Phosphatidylinositol glycan anchor

228812 biosynthesis, class U 1.79 1.07 1.15

69369 RIKEN cdna 1700017D01 gene 1.78 -l.69 1.12
Hexosaminidase (glycosyl hydrolase family

238023 20, catalytic domapi) containing 1.78 1.17 1.05

69807 Tripartite motif-containing 32 1.78 1.11 1.24

69089 Oxidase assembly 1-1ike 1.78 1.08 1.23

194744 Solute carrier family 25, member 43 1.78 -1.03 -1.13

229759 Olfactomedin 3 1.78 1.11 -1.00

208098 Pannexin 3 1.78 -1.02 -1.35

56771 Mediator complex subunit 20 1.78 1.05 -1.04
Solute carrier family 16 (monocarboxylic

72472 acid transporters), member 10 1.78 -1.12 1.02
2-4-dienoyl-Coenzyme A reductase 2,

26378 peroxisomal 1 .78 1 .24 1 .07

100473 Expressed sequence BBO31773 1.78 1.03 1.53

226539 Aspartyl-trna synthetase 2 (mitochondrial) 1.78 1.04 1.27
NUF2, NDC8O kinetochore complex

66977 component, homolog (S. Cerevisiae) 1.77 -1. 14 1.08

13175 Doublecortin-like kinase 1 1.77 1.30 1.00
Bromodomain adjacent to zinc finger

116848 domain, 2A 1.77 -1.07 -1.05
Far upstream element (FUSE) binding

51886 protein 1 1.77 -1.18 1.02

24071 Synaptojanin 2 binding protein 1.77 1.01 1.30
BCL2/adenovirus EIB interacting protein 1,

224630 NIPl 1.76 1.35 1.06

567 71 Mediator complex subunit 20 1.76 1.21 1.03
Paroxysmal nonkinesiogenic

56695 dyskinesia 1.76 1.24 1.29
Coactivator-associated arginine

59035 methyltransferase 1 1.76 -1.08 1.11

171254 Vomeronasal 1 receptor, 13 1.76 1.06 1.26

80890 Tripartite motif-containirg 2 1.76 1.11 1.00

227624 RIKEN cdna BZ30208H17 gene 1.76 1.01 1.05
RGPl retrograde golgi transport homolog

242406 (S. Cerevisiae) 1.76 -1.04 1.03
SWI/SNF related, matrix associated,

67155 subfamily a, member 2 1.76 -1.38 1.08

54201 Zinc finger protein 316 1.76 1.21 1.21

207213 TD and P02 domain containingl 1.75 -1.08 -1.10

. ATP-binding cassette, sub-family B

74610 (MDR/TAP), member 8 1.75 1.40 1.03
Anaphase promoting complex

17222 subunit 1 1.75 1.07 1.22

 

 

 

 

 

263

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
494448 Chromobox homolog 6 1.74 -1.01 1.09
76547 Transmembrane protein 101 1.74 1.16 1.02
Cytidine monophosphate (UMP-CMP)
22169 kinase 2, mitochondrial 1.74 1.22 1.09
380669 Lin-28 homolog B (C. Elegans) 1.74 -1.18 -1.18
68364 RIKEN cdna 0610030E20 Erie 1.74 -l .05 1.11
21685 Thyrotroph embryonic factor 1.73 1.46 1.27
74653 RIKEN cdna 4930444A02 gene 1.73 1.00 1.27
234371 Transmembrane protein 161A 1.73 -1.07 1.11
210035 Transmembrane protein 194 1.73 1.15 1.21
258872 Olfactory receptor 908 1.73 -1.01 -1.00
67230 Zinc finger mtein 329 1.73 1.06 -1.19
RAB7, member RAS oncogene family-like
226422 1 1.73 -1.14 1.09
52710 G protein-coupled receptor 1723 1.72 -1.06 1.18
Cell division cycle 27 homolog (S.
217232 Cerevisiae) 1.72 -1.06 -1.06
73747 RIKEN cdna 1110034G24 gene 1.72 1.02 1.10
78323 RIKEN cdna 2310046006 gene 1.72 -1.03 1.04
245638 TBCI domain family, member SB 1.72 -1.07 1.12
Rap guanine nucleotide exchange factor
76089 QEF) 2 1.72 1.00 -1.11
258752 Olfactory receptor 583 1.72 -3.03 1.18
331195 RIKEN cdna A430089119gene 1.71 1.18 -1.00
76429 RIKEN cdna 2310007H09 gene 1.71 -1.02 1.14
FUS interacting protein (serine-arginine
14105 rich) 1 1.71 -1.26 1.10
76788 RIKEN cdna 2410127E18 gene 1.71 1.05 -1.02
Arginyl aminopeptidase
215615 (aminopeptidase B) 1.71 1.03 1.33
108899 RIKEN cdna 2700081015 gene 1.71 -1.06 -1.07
Phosphatidylinositol glycan anchor
70325 biosynthesis, class W 1.71 1.14 -1.09
78913 Zinc finger protein 294 1.71 -1.05 1.1 1
Mitochondria-associated protein involved in
66449 GM-CSF signal transduction 1.71 -1.01 1.27
208198 BTB (POZ) domain containifl 2 1.70 1.01 1.09
Myelin-associated oligodendrocytic basic
17433 protein 1.70 1.02 -1 . 12
19155 Aminopeptidase puromycin sensitive 1.70 1.06 1.20
56187 Rab geranylgeranyl transferase, a subunit 1.70 1.10 1.11
13185 Down syndrome critical region gene 3 1.70 -1.01 1.08
320727 Importin 8 1.70 -1.05 1.02

 

 

 

 

 

264

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio

65102 Nggl interacting factor 3-1ike 1 (S. Pombe) 1.70 -1.18 1.03

171235 Vomeronasal 1 receptor, F4 1.70 -1.16 -1.07
Rho/rac guanine nucleotide exchange factor

102098 (GED 18 1.70 -1.00 1.05

68936 RIKEN cdna 1190017012 gene 1.69 -1.08 1.08

17532 Muscle and microspikes RAS 1.69 -1.21 1.25

237636 NPCl-like 1 1.69 -1.01 1.01

14050 Eyes absent 3 homolog(Drosophila) 1.69 1.04 1.05
Phosphodiesterase 4D interacting protein

83679 (myomegalin) 1.69 -1.06 1 .07
Phosphoinositide-3-kinase, regulatory

104709 subunit 6 1.69 1.04 -1 . 17

170753 Zinc finger protein 704 1.69 -1.34 -1.02

67105 RIKEN cdna 1700034H14pgene 1.69 -1.01 1.13

214498 Cell division cycle 73 1.69 -1.16 1.04
Polymerase (DNA—directed), epsilon 4 (p12

66979 subunit) 1.69 -1 . 19 1.15

54131 Interferon regulatory factor 3 1.68 -1.28 -1.11
Par-6 (partitioning defective 6,) homolog

56513 plpha (C. Elegans) 1.68 1.01 1.06

29808 MAX gene associated 1.68 1.02 -1.01
Processing of precursor 5, ribonuclease

117109 PfMRP family LS. Cerevisiae) 1.68 -1.11 1.01

240899 Leucine rich repeat containing 52 1.68 -1.26 -2.55

277562 Olfactory receptor 1286 1.67 -1.00 -1 . 18

71701 Polyribonucleotide nucleotidyltransferase 1 1.67 1.12 1.20
Mitochondrial translational initiation factor

76784 2 1.67 1.20 1.03

76894 Methyltransferase 5 domain containing 1 1.67 1.17 1.29

59015 Nucleoporin 160 1.67 -1.01 -1.08
Solute carrier family 4 (anion exchanger),

20534 member 1, adaptor protein 1.67 -1.04 -1.13
BCL2/adenovirus ElB interacting protein 1,

224630 NIPI 1.67 1.13 1.08
lmmunoglobulin superfamily containing

320563 leucine-rich repeat 2 1.67 -1.52 -1.13
Epidermal grth factor receptor pathway

13859 substrate 15-like 1 1.66 -1.03 -1.03
Solute carrier family 30 (zinc transporter),

210148 member6 1.66 -1.14 1.16
Transcriptional adaptor 2 (ADA2 homolog,

217031 yeast)-like 1.66 -1.01 1.1 1

103012 RIKEN cdna 6720401G13 gene 1.66 1.32 1.16

78408 RIKEN cdna 2900046G09 gfle 1.66 -1.01 1.22

 

265

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio
69757 Leukocyte receptor cluster (LRC) member 1 1.65 1.16 1.15
23897 HCLSl associated X-l 1.65 -1.04 1.00
Mitogen-activated protein kinase kinase
26407 kinase 4 1.65 -1.07 1.12
66574 RIKEN cdna 2510017J16g'pne 1.65 1.48 -1.05
13644 Embryonal F yn-associated substrate 1.64 -1.04 1.25
18854 Promyelocgic leukemia 1 .64 1 .06 1. 12
244895 RIKEN cdna C230081A13 gene 1.64 1.11 1.01
CAP-GLY domain containing linker protein
78785 family, member 4 1.64 1.46 1.12
258409 Olfactory receptor 1431 1.64 -1.00 -1.02
74114 Carnitine O-octanoyltransferase 1.64 1.09 1.07
268281 SNF2 histone linker PHD RING helicase 1.64 -1.03 1.09
56695 Paroxysmal nonkinesiogenic dyskinesia 1.64 1.22 1.13
236732 RNA binding motif protein 10 1.63 -l .07 -1.06
71382 Peroxisome biogenesis factor 1 1.63 -1.06 1.04
78323 RIKEN cdna 2310046006 gene 1.63 -1.03 -1.13
547150 Similar to p47 protein 1.63 -1 . 10 1.24
BRCA1/BRCA2-containing complex,
210766 subunit 3 1.63 1.03 1.16
18174 Solute carrier family 11 , member 2 1.63 -1.33 1.13
330963 Predicted gene, EG330963 1.63 1.11 1.23
66050 RIKEN cdna 0610009322 gene 1.63 1.04 1.18
Cytosolic iron-sulfur protein assembly 1
26371 homolog (S. Cerevisiae) 1.63 -1.02 -1.07
72016 RIKEN cdna 1600002H07 gene 1.63 -1.05 -1.11
12338 Calpain 6 1.62 1.66 1.02
66609 Crystallin, zeta (quinone reductase)-like 1 1.62 1.27 1.09
17101 Lysosomal traffickinmulator 1 .62 -1 .07 1.01
Digeorge syndrome critical region
94223 gene 8 1.62 -1.00 -1.10
319953 Tubulin tyrosinejgase-like 1 1.62 1.09 1.12
223483 Hypothetical protein A830021M18 1.62 -1.16 -l.25
15468 Protein gginine N-methyltransferase 2 1.62 -1.24 1.06
Phosphatidylinositol-specific phospholipase
239318 C, X domain containing 3 1.62 -1.20 -1 .05
67892 RIKEN cdna 1810063B05 ggc 1.61 1.01 1.20
NIMA (never in mitosis gene a)-related
23954 expressed kinase 3 1.60 1.14 1.03
Translocase of inner mitochondrial
30057 membrane 8 homologb (yeast) 1.60 1.05 1.23
330050 Expressed sequence A1847670 1.60 1.18 1.22

 

266

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio

Ligand dependent nuclear receptor

209707 corepressor-like 1.60 -1 .03 1 .02
Nicotinamide nucleotide adenylyltransferase

66454 1 1.60 -1.07 1.11

193796 Jumonji domain containingiB 1.60 1.18 -1.17

72320 RIKEN cdna 2510003E01gme 1.60 -1.03 1.11
Protein kinase, camp dependent, catalytic,

18749 beta 1.60 -1.02 1.13

72904 RIKEN cdna 2900034E22 gene 1.59 -l.13 -1.04

442825 RIKEN cdna A230083G16 gene 1.59 1.10 1.00
Insulin-like growth factor 2 ma binding

140486 protein 1 1.59 1.19 -1.01

68223 RIKEN cdna 1700063117 gene 1.59 -1.22 -2.83
HECT domain and ankyrin repeat

209462 containing, E3 ubiquitin protein ligase 1 1.59 1.01 1.31

52856 GTP binding protein 5 1.58 1.16 -1.07

74385 RIKEN cdna 4932432K03 gene 1.58 1.01 1.21
COX19 cytochrome c oxidase assembly

68033 homolog (S. Cerevisiae) 1.58 -1.09 1.00
Cell division cycle 25 homolog A (S.

12530 Pombe) 1.58 1.03 1.11
Thioredoxin domain containing 3

73412 (spermatozoa) 1.58 1.13 -1.10

20892 Stimulated by retinoic acid 13 1.58 1.08 1.15
Zinc finger (CCCH type), RNA binding

22184 motif and serine/arginine rich 2 1.58 1.14 1.16

79264 KRITI, ankyrin repeat containing 1.58 -1.21 -1.16
Pleckstrin homology domain containing,

269608 member 5 1.58 1.14 -1.01

58805 MLX interacting protein-like 1.57 1.42 1.03

171236 Vomeronasal 1 receptor, F5 1.57 -1.00 -1.00

57443 F-box protein 3 1.57 -1.04 1.11
Alkb, alkylation repair homolog 8

67667 (E. Coli) 1.57 1.09 -l .1 1

75632 RIKEN cdna 1700003011 gene 1.57 -1.46 1.01

68691 RIKEN cdna 1110028C15gene 1.57 -1.11 1.26
Ankyrin repeat and SOC S box-containing

78910 protein 15 1.56 -1.04 -1.00

241556 Tetraspanin 18 1.56 1.07 2.29

70733 RIKEN cdna 6330411EO7 gene 1.56 -1.17 -1.15

22061 Transformation related protein 63 1.56 -1.40 -1.08

244417 Gene model 501, (NCBI) 1.56 1.04 -1.19
COX19 cytochrome c oxidase assembly

68033 homolcg (S. Cerevisiae) 1.56 -l .08 1.13

 

 

 

 

 

267

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
67784 Plexin D1 1.55 1.28 -1.13
16882 Ligase 111, DNA, ATP-dependent 1.55 -1.16 -1. 18
Phosphatidylinositol glycan anchor
18701 biosynthesis, class F 1.55 -1.10 1.16
Golgi associated, gamma adaptin ear
260302 containing, ARF bindflgprotein 3 1.55 -1.12 1.22
Origin recognition complex, subunit 4-like
26428 (S. Cerevisiae) 1.55 1.11 1.26
CD244 natural killer cell
18106 receptor 2B4 1.55 -1.27 -l.15
Mitogen-activated protein kinase kinase
26407 kinase 4 1.55 -1.07 1.18
CAP-GLY domain containing linker protein
76686 3 1.55 1.21 1.34
75458 Chemokine-like factor 1.55 -1.14 1.06
Amyloid beta (A4) precursor protein-
225372 binding, family B, member 3 1.55 1.10 -1.04
21853 Timeless homolog(Drosophila) 1.55 1.24 -1.11
Melanoma associated antigen
68114 (mutated) 1 1.55 -1.11 -1.08
16650 Karyopherin (importin) alpha 6 1.54 -1.04 1.06
UDP-glcnaczbetagal beta-1 ,3-N-
227327 acetmlucosaminyltransferase 7 1.54 1.10 -1.39
68347 RIKEN cdna 0610011F06 gene 1.54 1.13 1.12
66880 Arginine/serine-rich coiled-coil 1 1.54 1.02 1.06
83429 Cystinosis, nephropathic 1.54 1.04 -1.12
258334 Olfactory receptor 1396 1.54 1.84 1.02
12724 Chloride channel 2 1.53 -1.14 1.05
104859 RIKEN cdna 4930573119 gene 1.53 -1.10 -1.02
MAP/microtubule affmity-regulating kinase
13728 2 1.53 -1.02 -1.04
1E+08 Predicted gene, ENSMUSG00000052469 1.53 1.02 -1.20
57837 Era (G-protein)-like 1 (E. Coli) 1.53 1.07 -1.05
22702 Zinc finger protein 42 1.53 -1.08 1.19
75339 M-phase phosphoprotein 8 1.53 1.15 1.10
258402 Olfactory receptor 1079 1.53 -1.00 -1.80
170762 Nucleoporin 155 1.53 1.01 -1.04
67707 Mitochondrial ribosomal protein L24 1.53 1.25 1.30
56700 RIKEN cdna 0610031106 gene 1.52 1.03 1.10
677296 Fc receptor-like 6 1.52 9.00 1.09
73327 RIKEN cdna 1700040103gpne 1.52 1.18 1.04
321006 Vpr (HIV-l) binding protein 1.52 -1.19 1.05
1E+08 Butyrophilin-like 1 1.52 -1.18 -1.08

 

 

 

 

 

268

1 .
‘.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio
227154 Amyotrophic lateral sclerosis 2 (juvenile) 1.52 1.01 1.22
Nicotinate phosphoribosyltransferase
223646 domain containing 1 1.51 1.27 1.26
NIMA (never in mitosis gene a)-related
59125 expressed kinase 7 1.51 1.35 -l .03
Smg-6 homolog, nonsense mediated mrna
103677 decay factor (C. Elegans) 1.51 1.00 -1.00
320816 Ankyrin repeat domain 16 1.51 1.25 1.36
RNA pseudouridylate synthase domain
71989 containing4 1.51 —1.06 1.10
237943 G patch domain containing 8 1.51 -1.02 1.11
72519 Transmembrane protein 55A 1.51 1.06 1.05
12828 Coflpgen, type IV, alpha 3 1.51 1.98 1.35
60364 Downstream neighbor of SON 1.51 -1.04 -1.02
227326 G protein-coupled receptor 55 1.51 1.03 1.29
67706 Transmembrane protein 179B 1.51 -1.02 1.00
Tubulin, gamma complex associated protein
328580 6 1.50 1.07 1.03
231003 Kelch-like 17 (Drosophila) 1.50 1.06 1.07
216578 Poly(A) polymerase gamma 1.50 1.15 -1.56
216119 RIKEN cdna A130042E20 Elle 1.50 1.05 -1.06
Coagulation factor C homolog (Limulus
12810 polyphemus) 1.50 1.54 1.10
225998 RAR-related orphan receptor beta 1.48 1.85 1.14
258457 Olfactory receptor 108 1.47 1.86 -1.16
Thrombospondin, type 1, domain containing
210417 7B 1.43 -1.00 -1.98
14654 Glycine receptor, alpha 1 subunit 1.43 -l .02 1.83
72892 RIKEN cdna 2900018K06 gene 1.43 1.98 -1.11
70950 RIKEN cdna 49215281014ene 1.38 1.96 1.09
71248 RIKEN cdna 4933428MO9 gene 1.38 -1.17 -1.82
75506 RIKEN cdna 1700017107 gene 1.38 -1.88 1.17
229707 RIKEN cdna 6330569M22 gene 1.37 -1.69 -1.21
13491 Dopamine receptor 4 1.36 -1.90 1.02
Fumarylacetoacetate hydrolase domain
68126 containing 2A 1.36 1.60 1.30
258973 Olfactory receptor 1228 1.35 -2.55 -1.11
Non imprinted in Prader-Willi/Angelman
93790 syndrome 2 homolog (humari 1.35 -1.14 1.55
Apoptosis-inducing, TAF9-like
69928 domain 1 1.33 2.04 1.11
24057 Sh3 domain YSC-like 1 1.33 1.05 2.51
239368 Cdna sequence BC030476 1.30 1.14 -2.05

 

 

 

 

 

269

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
27389 Dual specificity phosphatase 13 1.27 -1.51 1,05
258562 Olfactotmceptor 1014 127 -227 -1 .03
Cyclic nucleotide gated
12788 channel alpha 1 1.27 -1.73 -1.33
74967 RIKEN cdna 4930474H20 gene 1.26 1.23 -2.21
67944 RIKEN cdna 1700025DO3 gene 1.26 -1.12 2.89
13176 Deleted in colorectal carcinoma 1.25 2.20 -1.04
320899 RIKEN cdna A430110C17 gene 1.24 1.75 1.15
170725 Calpain 8 1.23 1.58 -1.00
170654 Keratin associated protein 16-4 1.23 -1.67 -1.02
RAB, member of RAS oncogene family-like
67286 5 1.23 1.63 1.05
237310 Interleukin 22 receptor, alpha 2 1.22 -1.18 2.25
Protein tyrosine phosphatase, receptor type,
19264 C 1.22 -2.29 1.07
14177 Fibroblast growth factor 6 1.22 -1.16 -2.17
71229 RIKEN cdna 4933428P19 gene 1.22 1.06 2.56
328918 RIKEN cdna C230097124 gene 1.21 -1.76 1.21
80986 Cytoskeleton associated protein 2 1.21 1.76 1.01
Growth arrest and DNA-damage-inducible,
102060 amma interactig protein 1 1.21 1.38 -1.95
Retinitis pigmentosa gtpase regulator
77945 mteracfipg protein 1 1.21 1.55 -1.08
DNA segment, Chr 16, human D22868OE,
27883 expressed 1.20 1.54 1 . 15
224480 NADPH oxidase 3 1.19 -1.59 -1.21
16184 Interleukin 2 receptor, alpha chain 1.19 -1.24 1.59
Cytoplasmic polyadenylation element
67579 binding protein 4 1.19 -2.11 1.04
Potassium voltage-gated channel, Shal-
16508 related family, member 2 1.19 2.35 1.39
71701 Polyribonucleotide nucleotidyltransferase 1 1.19 2.35 1.08
382059 Defensin related cryptdin 22 1.18 2.01 1.13
111174 Trace arnine-associated receptor 1 1.18 -1.32 -2.33
258356 Olfactory receptor 564 1.18 1.06 -2.74
DEXH (Asp-Glu-X-His) box
80861 polypeptide 58 1.17 1.05 -2.47
ATP-binding cassette, sub-family A
27403 (ABC1), member 7 1.17 -1.78 1.01
71388 RIKEN cdna 5530401A14gene 1.17 -2.03 -1.04
319720 RIKEN cdna 9630028104 gene 1.15 1.04 -1.74
241656 P21 (CDKNIA)-activated kinase 7 1.14 1.92 -1.09
258555 Olfactory receptor 862 1.12 2.06 1.19

 

270

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
DNA segment, Chr 3, ERATO Doi 300,
56790 expressed 1 .1 1 -1 .00 -2.13
74438 Retinaldehyde binding protein l-like 1 1.11 -1.10 -1.63
70147 RIKEN cdna 2210019111gene 1.09 -1.14 -1.56
ATP-binding cassette, sub-family A
381072 (ABC1), member 17 1.09 5.12 1.17
229521 Synaptotagmin XI 1.09 -1.98 -1.11
101533 Kallilqein related-peptidase 9 1.08 -1.38 1.79
110606 Farnesyltransferase, CAAX box, beta 1.06 1.87 1.14
245847 Amidohydrolase domain containing 2 1.05 2.46 1.29
328839 Predicted gene, EG328839 1.05 -1.85 1.10
14057 Sideroflexin 1 1.04 -1.62 -2.00
70954 RIKEN cdna 4922502801 ggc 1.04 -1.00 -1.69
Chromobox homolog 3 (Drosophila HPl
12417 gamma) 1.04 -2.57 -1.03
258822 Olfactory receptor 39 1.04 1.36 2.62
258944 Olfactory receptor 351 1.03 -1.84 1.02
100647 Uroplakin 33 1.02 1.15 -1.52
258393 Olfactory receptor 1325 1.02 -1.01 1.52
20234 Spermine binding protein 1.02 1.93 1.10
NADH dehydrogenase (ubiquinone) Fe-S
226646 protein 2 1.01 1.71 1.01
76633 RIKEN cdna 1700112E06 gene 1.00 -2.39 1.07
269587 Erythrocyte protein band 4.1 -1.01 -1.08 -1.72
Cytochrome P450, family 2, subfamily j,
13110 polypeptide 6 -1.02 1.57 -1.05
G-rich RNA sequence
231413 binding factor 1 -1.02 1.57 1.06
74916 RIKEN cdna 1700066022 gene -1.04 -1.85 -1.03
75231 RIKEN cdna 4930529122 gene -1.04 3.03 -1.21
Biregional cell adhesion molecule-related
117606 binding protein -1.06 1.51 1.01
12411 Cystathionine beta-synthase -1.06 1.72 1.17
16675 Keratin 27 -1.08 -2.71 1.03
21673 Deoxynucleotidyltransferase, terminal -1 .08 -2.26 -l .24
77900 RIKEN cdna 6720473M11 gene -1.08 1.34 -1.93
Alkb, alkylation repair homolog 3
69113 (E. Coli) -1.09 1.61 -1.14
11898 Argininosuccinate synthetase 1 -1.12 1.61 1.20
Proteasome (prosome, macropain) subunit,
19177 beta type7 -1.12 1.69 1.10
Solute carrier family 6 (neurotransmitter
21366 transporter, taurine), member 6 -1.13 1.11 -1.69

 

271

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio
76117 Rho gtpase activat'flprotein 15 -1.16 -243 -1 .00
Transformation related protein 53 inducible
277414 protein 11 -1.17 2.04 -1.07
75089 UHRFl (ICBP90) binding protein 1-like -1.17 -1.19 -1.53
74841 Ubiquitin specific peptidase 38 -1.18 1.19 -1.75
76937 RIKEN cdna 2810429104 gene -1.18 -1.71 -1.05
17339 Major intrinsic protein of eye lens fiber -l.18 -1.23 1.79
Enoyl Coenzyme A hydratase, short chain,
93747 1, mitochondrial -1.19 1.52 -1.17
320500 RIKEN cdna A930001M 12 gene -1.21 1.06 -1.95
Succinate-coa ligase, GDP-forming, alpha
56451 subunit ' -1.21 1.64 1.00
170788 Crumbs homolog 1 (Drosophila) -1.22 -2.56 -1.05
109054 Prefoldin 4 -1.26 1.51 1.29
381062 RIKEN cdna 221040411 1 gene -1.29 1.70 -1.07
Aldehyde dehydrogenase 1 family, member
107747 L1 -1.30 1.83 -1.17
Kv channel interacting protein 3,
56461 calsenilin -1.31 1.98 1.11
102527 RIKEN cdna 6720458D17 gene -1.31 -1.13 -1.76
69354 Solute carrier family 38, member 4 -1.35 2.14 -1.19
548632 Cdna sequence BC023719 -1.35 3.09 1.27
66898 BAIl-associated protein 2-like l -1.39 1.64 -1.13
234875 Tetratricopeptide repeat domain 13 -1.50 1.14 -1.31
20403 Intersectin 2 -1.50 1.12 -1.24
20788 Sterol Egplatory element binding factor 2 -1.51 1.05 -1.23
14390 GA repeat binding protein, alpha -l.51 1.13 -l.13
RNA terminal phosphate cyclase
66368 domain 1 -1.51 1.10 -1.11
212111 Inositol polyphosphate-S-phosfltase A -1.51 1.17 -1.09
Tetratricopeptide repeat, ankyrin repeat and
66860 coiled-coil containing 1 -l.51 1.36 -1.35
216164 Downstream ofStkll -1.52 1.12 -1.04
171580 Microtubule associated monoxygenase, 1 -1.53 -1 . 12 -1.27
18321 Olfactory receptor 23 -1.53 2.05 1.00
75608 Chromatin modifying protein 4B -1 .53 -l.02 -1.10
11566 Adenylosuccinate synthetase, non muscle -1.53 1.07 -1.16
80914 Uridine-cytidine kinase 2 -1.53 -1-22 '1-03
53334 Golgi SNAP receptor complex member 1 -1.54 1.44 -1.19
Translocase of outer mitochondrial
28185 membrane 70 homolog A (yeast) -1.54 1.24 -1.25
21985 Tumor protein D52 -1.54 1.21 -1.16

 

 

 

 

 

272

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio

Serine (or cysteine) peptidase inhibitor,

20317 clade F, member 1 -l .55 1.11 -1.32
TRAF family member-associated Nf-kappa

21353 B activator -1.55 1.13 -1.04

100273 Oxysterol binding protein-like 9 -1.55 1.65 -1.32

75007 RIKEN cdna 4930504E06 gene -1.56 1.18 -1.47
Protein phosphatase 2 (formerly 2A),alpha

51792 isoform -1.56 1.38 -1.17
EGF-like repeats and discoidin I-like

13612 domains 3 -1.56 -1.00 1.02
Receptor-interacting serine-threonine kinase

56532 3 -1.56 -1.07 -1.27
Par-6 partitioning defective 6 homolog

93737 gamma (C. Elegans) -1.56 1.17 -1.26
Syntaxin binding protein 5

78808 (tomosyn) -1.56 1.13 -l .26
U2 small nuclear ribonucleoprotein auxiliary

108121 factor (U2AF) 1 -1.57 1.21 -1.09

76273 Nedd4 family interacting protein 2 -1.57 1.21 -1.19

94088 Tripartite motif-containing 6 -1.57 1.57 1.55
Survival motor neuron domain

76479 containing 1 -1.57 1.15 -1.08
Solute carrier family 36 (proton/amino acid

234967 symporter), member 4 -1.58 1.17 -1.15
Suppressor of variegation 4-20 homolog 1

225888 (Drosophila) -1.58 1.01 -1.26

11908 Activating transcription factor 1 -1.58 1.15 -1.22
Taxl (human T-cell leukemia virus type I)

52440 binding protein 1 -1.58 1.39 -1.22
F-box and WD-40 domain protein 7,

50754 archipelago homolog (Drosophila) -1.58 1.23 -1.29

57912 CDC42 small effector 1 -l.59 1.15 -1.33
Shwachman-Bodian-Diamond syndrome

66711 homolog (human) -1.60 1.41 -1.30

70834 Sperm associated antigen 9 -1.60 1.03 -1.49
Src homology 2 domain-containing

214547 transforminflrotein E -1.60 1.07 -1.55

77929 Yipl domain family, member 6 -l .60 1.20 -1.07

71472 Ubiquitin specific peptidase 19 -1.60 1.27 -1.24

50770 Atpase, class VI, type 11A -1 .61 -1.04 -1.40

66674 RIKEN cdna 6330409N04 gene -1.61 1.17 -1.09

233315 Myotubularin related protein 10 -1.61 1.01 -l.23

' Proteasome (prosome, macropain)

26443 subunit, alpha type 6 -1.61 1.17 -1.08
Acyl-Coenzyme A binding domain

74159 containing 5 -1.62 -1.00 -1.13

 

273

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
14118 Fibrillinl -1.63 1.12 1.04
224691 Zinc finger protein 472 -1.64 1.19 -1.13
69329 RIKEN cdna 1700003Mlflene -1.64 1.26 1.03
Partner of NOB] homolog
66249 (S. Cerevisiae) -1.64 -1.03 -1.21
Protein tyrosine phosphatase, mitochondrial
66461 1 -1.64 1.01 -1.08
20277 Sodium channel, nonvoltagggated 1 beta -1.64 1.36 -1.19
208449 Sphingomyelin synthase 1 -l .64 1.15 -1.29
16803 Lipopolysaccharide binding protein -1.65 1.33 -1.44
76267 Fatty acid desaturase 1 -1.65 1.43 -1.17
12913 Camp responsive element bindingprotein 3 -1.66 1.24 -1.40
Protein phosphatase 1B, magnesium
19043 dependent, beta isoform -1.66 1.35 -1.42
Castor homolog 1, zinc finger
69743 (Drosophila) -1 .66 -1 .06 -1.27
242691 G patch domain contairfl 3 -1.66 1.18 -1.23
27984 EF hand domain containing 2 -1.66 1.17 -1.28
56389 Syntaxin 5A -1.66 1.26 -1.34
RNA terminal phosphate
59028 cyclase-like 1 -1.66 1.04 -1.55
228859 RIKEN cdna D930001122 gene -1.67 1.00 -1.30
16923 SHZB adaptor protein 3 -1.67 1.09 -1.29
98238 Leucine rich repeat containing59 -1.67 1.22 -1.45
55963 Solute carrier family 1 , member 4 -1.67 1.16 -1.25
General transcription factor 11F, polypeptide
68705 2 -1.67 1.15 -l.22
18570 Programmed cell death 6 -l .67 1.14 -1.20
Ring finger and CHY zinc finger domain
68098 containing 1 -l.67 1.11 -1.15
79555 Cdna sequence BC005537 -1.68 1.12 -1.27
210529 RIKEN cdna G430022H21 gene -1.68 -1.00 1.32
70354 RIKEN cdna 3110001120 gene -1.68 1.16 -1.45
12834 Collagen, type V1, alpha 2 -1.69 -1.20 -1.05
22688 Zinc finger protein 26 -1.69 1.03 -1.01
Regulatory factor X, 2 (influences HLA
19725 class II expression) -1.69 -l .07 -1.06
77446 HEG homologlizebrafish) -1.69 1.15 -1.50
226352 Erythrocyte motein band 4.1-like 5 -1.69 1.21 -1.29
258908 Olfactory receptor 853 -1.70 -l .30 -1.29
66193 RIKEN cdna1110049F12 gene -1.70 1.29 -1.11
22022 Protein-tyrosine sulfotransferase 2 -1.70 1.12 -1.24

 

274

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio

Protein phosphatase 1, regulatory (inhibitor)

232807 subunit 12C -1.70 1.25 -1.31

215449 RAS related protein 1b -1.71 1.07 -l .10

15007 Histocompatibility 2, Q regn locus 10 -1.71 1.44 -1.38

98758 Heterogeneous nuclear ribonucleoirotein F -1.71 1.23 -1.27

54170 Ras-related GTP bind'g C -1.71 1.36 -1.43
Protein phosphatase 1A, magnesium

19042 dependent, alpha isoform -1.72 1.30 -1.49

56494 Golgi SNAP receptor complex member 2 . -1.72 1.26 -1.44

258573 Olfactory receptor 1020 -1.72 -1.00 -1.03
Sema domain, transmembrane domain

214968 (TM), (semaphorin) 6D -1.72 1.24 -1.60
Retinol dehydrogenase 14 (all-trans and 9-

105014 cis) -1.72 -1.13 -1.18
CCR4-NOT transcription complex, subunit

78893 10 -1.73 1.59 -1.13

100494 Zinc finger, ANl-type domain 2A -1.73 1.08 -l.14
Eukaryotic translation initiation factor IA

69860 domain containing -1.73 1.36 -1.51

56722 LPS-induced TN factor -1.73 1.25 -1.23
Protein tyrosine phosphatase, receptor type,

19267 E -1.74 -1.28 -1.39
F asciculation and elongation protein zeta 2

225020 (zygin II) -1.74 1.45 -1.43

20437 Seven in absentia 1A -1.74 1.37 -1.06
Fusion, derived from t(12;l6) malignant

233908 liposarcoma (human) -1.74 1.57 -1.30
Platelet/endothelial cell adhesion

18613 molecule 1 -l.76 1.33 -1.43

68904 Abhydrolase domain containifl 13 -1.76 1.35 -1.41

1 10351 Rapl gtpase-activatingp'otein -1.76 1.35 -1.46

223455 Membrane-associated ring finger (C3HC4) 6 -1.76 1.37 -l .11

108030 Lin-7 homolog A (C. Elegans) -1.76 -1.17 1.02
DEAD (Asp-Glu-Ala-Asp) box polypeptide

56200 21 -1.77 -1.01 -1.29

208659 Cdna sequence BC029169 -1.77 -1.08 -1.25
Zinc finger, MYND domain containing

67187 19 -1.77 1.06 -1.50

242418 WD repeat domain 32 -1.78 1.09 -1.43

217410 Tribbles homolog 2 (Drosophilp) -1.78 1.17 -1.57

192897 Wu beta 4 -1.78 -1.24 -1.08

70611 F-box protein 33 -1.78 -1.06 -1.31
Potassium channel tetramerisation domain

239217 containing 12 -1.79 1.03 -1.07

 

 

 

 

 

275

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
22156 Tuftelin 1 -1.79 1.28 -1.21
110651 Ribosomal protein S6 kinase polypeptide 3 -1.79 1.30 -1.35
74504 RIKEN cdna 2410018C17 gene -1 .80 1.20 -1.32
223827 Glycosyltransferase 8 domain containifi 3 -1.80 -1 . 10 1.03
67010 RNA binding motif protein 7 -1.80 1.08 -1.28
17912 Myosin [B -1.80 1.35 -1.20
Heterogeneous nuclear ribonucleoprotein U-
232989 like 1 -1.80 1.29 -1.08
12616 Centromere protein B -l .81 1.37 -l.46
Ubiquitin-conjugating enzyme E2D 3
66105 (UBC4/5 homolog, yeast) -1.81 1.25 -1.22
18196 Neuron specific gene family member 1 -1.81 -1.08 -1.44
28035 Ubiquitin specific peptidase 39 -1.81 1.28 -1.22
Solute carrier family 2 (facilitated glucose
20527 transporter), member 3 -1.81 1.12 -1.18
Protein kinase, camp dependent regulatory,
19087 type 11 alpha -l.82 1.14 -1.13
CLP 1 , cleavage and polyadenylation factor I
98985 subunit, homolog -1.82 1.21 -1.40
56550 Ubiquitin-conjugating enzyme E2D 2 -1.82 1.19 -1.08
50528 Transmembrane protease, serine 2 -1.82 1.08 -1.53
La ribonucleoprotein domain family,
67557 member 6 -1.82 -1.22 -1.08
107702 Ribonuclease/angiogenin inhibitor 1 -l.82 1.16 -l.l9
22034 Tnf recgptor-associated factor 6 -l .83 1.08 -1.13
27965 Spastic paraplpgia 21 homolog (human) -1.83 1.67 -1.27
21985 Tumor protein D52 -1.83 1.09 -1 . 19
75909 Transmembrane protein 49 -1 .84 1.41 -1.56
59069 Tropomyosin 3, gamma -1.84 1.42 -1.19
16885 LIM-domain containing, protein kinase -1.84 -1.22 -l .38
228790 Additional sex combs like 1 (Drosophila) -1.84 1.12 -1.28
20224 SARI gene homolog A (S. Cerevisiae) -1.84 1.11 -1.14
170736 Parvin, beta -1.84 1.20 -1.48
WD repeat and FYVE domain
69368 containipng 1 -1.85 -1.02 -1.31
Nuclear distribution gene E-like homolog 1
83431 (A. Nidulans) -1.85 1.40 -l .40
Protein phosphatase 1A, magnesium
19042 dependent, alpha isoform -1.85 1.25 -1.37
15006 Histocompatibility 2, Q region locus 1 -1.85 1.70 -1.29
16012 Insulin-like growth factor binding protein 6 -1.85 1.57 -1 . 14
Mitochondrial carrier homolog 1 (C.
56462 Eleggns) -1.85 1.37 -1.28

 

 

 

 

 

276

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio

74596 CDP-diaLflglycerol synthase 1 -1.86 1.31 -1.38
Capping protein (actin filament) muscle Z-

12343 line, alpha 2 -1.86 1.26 -l.10

72508 Ribosomal protein S6 kinasemlypeptide l -1.86 1.39 -1.32

16190 Interleukin 4 receptor, alpha -1.86 1.18 -1.46
Ubiquitin-conjugating enzyme E2D 3

66105 (UBC4/5 homolog, yeast) -1.86 1.27 -1.26
3-hydroxy-3-methylglutaryl-Coenzyme A

15357 reductase -1.87 1.23 -l.l7

223433 Cdna sequence BC052328 -1.87 1.32 -1.38

11308 Abl-interactor 1 -1.87 1.29 -1.30

67951 Tubulin, beta 6 -1.87 -1.05 -1.25

109163 RIKEN cdna 3010003L21 gene -1.87 -1.14 -l.58
Fibronectin type 3 and ankyrin repeat

66930 domains 1 -1.87 1.07 -l.03

57439 Transmembrane protein 183A -1.87 1.07 -1.40

69718 Inositol polyphosphate multikinase -1.87 -1.02 -1.14

225280 RIKEN cdna D030070L09 gene -1.88 1.32 -1.37

22433 X-box bindirg protein 1 -1.88 1.19 -1.33

192897 Integrin beta 4 -1.88 -1.42 1.03
Clathrin, light polypeptide

74325 (ch) -1.88 1.14 -1.25
Nuclear undecaprenyl pyrophosphate

52014 synthase 1 homolog -1.88 1.07 -1.41

67946 Spermatogenesis associated 6 -1.89 1.51 -1.28
ADP-ribosylation factor-like 2 binding

107566 protein -1.89 1.23 -1.47
Eukaryotic translation initiation factor 2

15467 alpha kinase 1 -1.89 -1.06 -1.05

208659 Cdna sequence BC029169 -1.89 -1.09 -1.27

29809 RAB gtpase activating protein l-like -1.89 1.14 -1.48
Solute carrier family 30 (zinc transporter),

66500 member 7 -l .89 1.19 -l .24

18008 Nestin -1.90 -1.27 -1.56
MARVEL (membrane-associating) domain

218518 containingZ -1.90 -1.01 -1.35
Dnaj (Hsp40) homolog, subfamily A,

15502 member 1 -1.90 1.20 -1.24

215449 RAS related protein 1b -1.90 1.21 -1.17
Dnaj (Hsp40) homolog, subfamily A,

15502 member 1 -1.90 1.40 -1.22
Histocompatibility 2, K1,

14972 K region -1.92 1.35 -1.10

50523 Large tumor suppressor 2 -1.92 1.12 -1.21

 

 

 

 

 

277

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio

193670 Ring finger protein 185 -1.92 1.38 -1.36

13136 CD55 antigen -1.92 -1.31 -1.22
Serine (or cysteine) peptidase inhibitor,

20708 clade B, member 6b -1.92 -1.06 -1.18
Fusion, derived from t(12; 16) malignant

233908 lipOsarcoma (humap) -1.92 1.71 -1.38

14155 Feminization 1 homolog b (C. Elegans) -1.93 1.39 1.12
Solute carrier family 9 (sodium/hydrogen

236794 exchanger), member 6 -1.93 1.08 -1.23
Frequently rearranged in advanced T-cell

14296 lymphomas -1.93 1.19 -1.42

12827 Collagen, type IV, alpha 2 -1.93 1.22 -1.28

24128 5'-3' exoribonuclease 2 -1.94 1.46 -1.22

66748 RIKEN cdna 4933404M02 gene -1.96 1.15 -1.01

26367 CBA-related cell adhesion molecule 2 -1.96 -1.44 -1.39
Eukaryotic translation initiation factor 3,

78655 subunit .1 -1.97 -1.03 -1.23
Potassium channel tetramerisation domain

239217 containing 12 -1.97 1.15 -1.16

74732 Syntaxin 11 -1.98 1.28 -1.06

13723 Embigin -1.98 -1.02 -1.83

11752 Annexin A8 -1.99 -1.10 -l.13
Serine/threonine kinase 17b (apoptosis-

98267 inducing) -1.99 1.34 -1.08
Pleckstrin homology, Sec7 and coiled-coil

19159 domains 3 -1.99 1.33 -1.30
Zinc finger and BTB domain

268294 containing 24 -1.99 1.50 -1.12

16891 Lipase, endothelial -2.00 1.08 -1.08

80907 Lactamase, beta -2.00 1.42 -1.23

71013 RIKEN cdna 4933400F03 gene -2.00 -1.01 -1.10

70231 Golgi reassembly stacking protein 2 -2.01 1.21 -1.40

243538 Coiled-coil domain containing 37 -2.01 1.04 -1.1 1

319622 RIKEN cdna E030018N11 gene -2.01 1.21 -1.16

381217 Gene model 967, (NCBI) -2.01 1.19 -1.49
Zinc finger, DHHC domain

69035 containing 3 -2.01 1.04 -1.31
Non-metastatic cells 5, (nucleoside-

75533 diphosphate kinase) -2.01 1.20 -1.00

22688 Zinc finger protein 26 -2.01 1.57 -1.17
V-rel reticuloendotheliosis viral oncogene

19697 homolog A (aviary -2.01 1.06 -1.44

330836 Solute carrier family 7 , member 6 -2.02 1.55 -1.40

69863 RIKEN cdna 1810054D07 gene -2.02 1.15 -1.20

 

 

 

 

 

278

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
237806 Dynein, axonemal, heavy chain 9 -2.02 -1.00 1.19
13386 Delta-like 1 homolog (Drosophila) -2.02 1.01 -1.62
Tumor necrosis factor, alpha-induced
21927 protein 1 (endothelial) -2.03 1.27 -l.35
21983 Trophoblast glycoprotein -2.03 1 .47 -1 .26
52502 Calcium regulated heat stable protein 1 -2.03 1.08 -1.22
20674 SRY-box containinggene 2 -2.03 -1.14 -1.11
320791 RIKEN cdna A130071D04jene -2.04 -1.27 1.16
Negative regulator of ubiquitin-like protein
53312 1 -2.05 1.57 -l.32
Sparc/osteonectin, cwcv and kazal-like
94214 domains proteoglycan 2 -2.05 1.24 -1.21
74122 Transmembrane protein 43 -2.05 -1.07 -1.42
94242 Tubulointerstitial nephritis antigen-like -2.06 1.15 -1 .3 1
Phorbol- 1 2-myristate- 1 3-acetate-induced
58801 protein 1 -2.06 1.33 1.08
18263 Omithine decarboxylase, structural 1 -2.08 1.81 -1.33
16418 Eukaryotic translation initiation factor 6 -2.08 1.16 -1.] 8
22041 Transferrin -2.08 -1.12 -1.88
70747 Tetraspanin 2 -2.09 -1.04 -1 .09
24109 Ubiguitin-like 3 -2.09 1.25 -1.36
76964 RIKEN cdna 2610028H24 gene -2.09 1.30 1.03
Protein phosphatase 2C, magnesium
381511 dependent, catalytic subunit -2.09 1.40 -1.05
320982 ADP-ribosylation factor-like 4C -2.10 1.38 -1.27
Interferon-related developmental
15982 regulator 1 -2.10 1.20 -1.14
195733 Grainyhead-like 1 (Drosophila) -2.10 1.15 1.06
24063 Sprouty homolog 1 (Drosophila) -2.11 1.04 -1.27
Ring finger and CHY zinc finger domain
68098 containing 1 -2.11 1.25 -1.17
Related RAS viral (r-ras) oncogene homolog
66922 2 -2.11 1.23 -1.57
225363 Eukaryotic translation termination factor 1 -2. 12 1.19 -1.05
Aldehyde dehydrogenase family 1,
11668 subfamily A1 -2. 12 1.10 1.01
l 191 1 Activating transcription factor 4 -2. 12 1.45 -1.28
19883 RAR-related orphan receptor alpha -2. 13 1.34 -1.29
12953 Cryptochrome 2 (photolyase-like) -2.13 1.39 -1.36
69131 Cch-related kinase, arginine/serine-rich -2. 13 1.07 -1.45
Transmembrane BAX inhibitor motif
69660 containing] -2.13 1.18 -1.27
68800 RIKEN cdna 1110059M19 gene -2. 13 -1.24 -1.72

 

279

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio

Endothelial differentiation sphingolipid G-

13609 protein-coupled receptor 1 -2.13 1.25 —1.19
Protein kinase C and casein kinase substrate

23970 in neurons 2 -2.13 1.41 -1.65

68159 Syntaxin 19 -2.14 1.04 -l.10
Protein phosphatase 1, regulatory (inhibitor)

66849 subunit 2 -2. 14 1.01 -1.27

22135 Trans-go_lgi network protein 2 -2. 14 1.01 -1.56

381741 Leucine rich repeat containing 43 -2. 14 -1.07 1.00
Synaptotagmin binding, cytoplasmic RNA

56403 interacting protein -2.15 1.16 -1.21

14461 GATA binding protein 2 -2.15 1.08 -1 .27

68283 RIKEN cdna 9530077C05 gene -2.15 -1.30 -1.27

70019 RIKEN cdna 2410039M03 gene -2.16 -] .00 -1.03
Histocompatibility 2,

14972 K], K region -2. 17 1.22 -1.43

50708 Histone cluster 1, hlc -2.17 1.99 -1.02

435337 Predicted gene, EG435337 -2. 17 1.17 -1.23

110310 Keratin 7 -2.18 1.25 -1.30

269966 Nucleoporin 98 -2.18 1.21 -1.16
Radial spoke head 1 homolog

22092 (Chlamydomonas) -2. 18 1 .3 3 1.01

16782 Laminin, gamma 2 -2.18 1.33 -1.43
Engulfment and cell motility 2, ced-12

140579 homolog (C. Elegans) -2.19 1.25 -l.45
Ras association (ralgds/AF-6) domain

56289 family member 1 -2.20 1.12 -1.52

234797 RIKEN cdna 6430548M08 E116 -2.22 1.15 -1.06

219148 Cdna sequence BC065085 -2.22 1.59 -1.23
3-hydroxy-3-methylglutaryl-Coenzyme A

15357 reductase -2.22 1.14 -1 .24
Lymphatic vessel endothelial hyaluronan

114332 receptor 1 -2.22 1.11 -l .29
Notch-regulated ankyrin

67122 repeat protein -2.23 1.08 -1.33

75564 RIKEN cdna 1700027N10 gene -2.23 -1.06 1.26

72147 Zinc finger and BTB domain containing 46 -2.23 1.17 -1.19

234734 Alanyl-trna smthetase -2.23 1.28 -1.39
Rho GDP dissociation inhibitor (GDI)

14570 gamma -2.23 1.29 -1.07

75137 RIKEN cdna 4930535803 gene -2.23 1.94 -1.50

22436 Xanthine dehydrogenase -2.23 1.40 -1.58

330260 Paraoxonase 2 -2.24 1.19 -1.41

68498 Tetraspanin 11 -2.24 -1.02 -1.98

 

280

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio
73075 Peptidylprolyl isomerase (cyclophilin)-like 6 -2.25 1.27 1.08
Heterogeneous nuclear ribonucleoprotein D-
50926 like -2.25 1.98 -1.15
58809 Ribonuclease, rnase A family 4 -2.25 -1.12 -1.50
12492 Scavenger receptor class B, member 2 -2.25 1.07 -1.28
64085 Calsyntenin 2 -2.26 -1.09 -1.16
Triggering receptor expressed on myeloid
71326 cells-like 1 -2.26 -1.20 -1.38
Enhancer of polycomb homolog 1
13831 (Drosophila) -2.26 1.05 -1.18
66540 RIKEN cdna 3110001Al3 gene -2.27 1.04 -1.39
75568 Calcyphosine-like -2.28 1.1 1 1.18
56360 Acyl-coa thioesterase 9 -2.29 1.12 -1.38
383295 Yippee-like 5 (Drosophila) -2.29 1.25 -1.24
74596 CDP-diacylglycerol synthase 1 -2.30 1.07 -1.39
69797 RIKEN cdna 1600029114 gene -2.30 1.07 1.06
14461 GATA binding protein 2 -2.31 1.23 -1.33
194655 Kruppel-like factor 11 -2.32 -1.15 -1.38
20568 Secretory leukocyte peptidase inhibitor -2.32 -1.19 -1.22
19153 Periaxin -2.34 1.18 -1.75
320769 Peroxiredoxin 6, related sequence 1 -2.34 1.08 -1.20
330260 Paraoxonase 2 -2.34 1.26 -1.43
MARVEL (membrane-associating) domain
218518 containing 2 -2.35 1.61 -1.41
71667 RIKEN cdna 0610007L01 gene -2.35 1.10 -] .29
66270 RIKEN cdna 1810015CMjene -2.36 1.72 -1.17
Metal response element binding
17764 transcription factor 1 -2.36 1.33 -1.36
66629 Golgiphosphoprotein 3 -2.37 1.16 -1.31
20104 Ribosomal protein S6 -2.37 1.09 -1.38
71823 RIKEN cdna 3300002A11 gene -2.38 -1.11 1.10
Colony stimulating factor 3 receptor
12986 ( anulocyte) -2.38 -1.08 -1.07
Inositol 1,4,5-trisphosphate
228550 3-kinase A -2.38 1.10 1.12
19243 Protein tyrosine phosphatase 4a] -2.40 1.27 -1.08
Solute carrier family 30 (zinc transporter),
22782 member 1 -2.40 1.23 -1.33
20388 Surfactant associated protein B -2.40 -1.07 -1.81
71648 Optineurin -2.40 1.50 -1.54
78781 Zinc finger CCCH type, antiviral 1 -2.42 1.48 -1.26
17713 Grpe-like 1, mitochondrial -2.42 1.59 -1.52

 

 

 

 

 

281

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF 2 HIF1/2
GeneID Gene name ratio ratio ratio
57349 Pro-platelet basic protein -2.44 -1.62 -1.57
104009 Quiescin Q6 sulflrydryl oxidase 1 -2.45 1.28 -1.23
215449 RAS related protein 1b -2.45 1.18 -1.14
317757 thase, IMAP family member 5 -2.45 1.33 -1.66
Protein phosphatase 1, regulatory (inhibitor)
66849 subunit 2 -2.46 1.45 -1.26
230678 Transmembrane protein 125 -2.46 -1.09 -1 . 15
74471 RIKEN cdna 4933440N224ene -2.47 1.15 -1 .60
18286 Outer dense fiber of sperm tails 2 -2.48 1.62 -1.23
11987 Solute carrier family 7 , member 1 -2.48 -] .05 -1.43
Transmembrane BAX inhibitor motif
69660 containing 1 -2.48 1.06 -1.21
170706 Transmembrane protein 37 -2.50 2.14 1.16
64898 Lipin 2 -2.50 1.29 -1.53
218215 Ring finger protein 144B -2.52 1.32 -1.16
72477 Transmembrane protein 873 -2.52 1.36 -1.16
11758 Peroxiredoxin 6 -2.53 1.14 -1.22
20515 Solute carrier family 20, member 1 -2.54 1.00 -1.27
18791 Plasminogen activator, tissue -2.56 1.29 -1.72
18145 Niemann Pick type C] -2.56 1.24 -1.52
Leucine-rich repeats and guanylate kinase
74354 domain containing -2.57 1.08 1.17
13649 Epidermal growth factor receptor -2.57 -1.16 -1.60
Calcitonin/calcitonin-related polypeptide,
12310 alpha -2.58 1.16 1.02
94242 Tubulointerstitial nephritis antigen-like -2.58 1.39 -1.27
75646 Retinoic acid induced 14 -2.58 1.02 -1.82
Par-6 (partitioning defective 6) homolog
58220 beta (C. Elggpns) -2.59 1.23 -1.32
Lymphatic vessel endothelial hyaluronan
114332 receptor 1 -2.63 1.68 -1.66
59043 WD repeat and SOCS box-containing 2 -2.63 1.26 -1.63
67876 Coenzyme Q10 homolfl B (S. Cerevisiae) -2.64 1.28 -1.28
320213 SUMO/sentrin 3&cific peptidase 5 -2.64 1.13 -l.56
1422] Four jointed box 1 (Drosophila) -2.64 1.21 -1.35
78801 Adenylate kinase 7 -2.66 -1.07 1.22
15982 Interferon-related developmental Eulator 1 -2.68 1.33 -1.11
14623 Gap junction protein, beta 6 -2.69 1.23 -1.61
17130 MAD homologpgosophila) -2.70 -1.01 -l .54
Enhancer of polycomb homolog 1
13831 (Drosophila) -2.70 1.16 -1 . 10

 

282

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
73472 Spermatogenesis associated 18 -2.72 1.38 -1.24
64085 Calsyntenin 2 -2.73 1.18 -1.27
Sodium channel, nonvoltage-gated 1
20278 amma -2.74 1.32 -1.41
Tumor necrosis factor (ligand) superfamily,
50930 member 14 -2.75 1.01 -1.34
66070 CWC15 homolog (S. Cerevisiae) -2.76 -1.28 -1.03
17395 Matrix metallopeptidase 9 -2.77 -1.27 -1.36
236904 Kelch-like 15 (Drosophila) -2.80 1.21 -1.05
56542 Intestinal cell kinase -2.81 1 .28 -1 .20
21414 Transcription factor 7, T-cell specific -2.81 -1.25 -1.68
101351 RIKEN cdna A1300221M —2.82 -1.11 -1.24
64833 Acyl-coa thioesterase 10 -2.82 1.26 -1.50
17395 Matrix metallopeptidase 9 -2.84 -1.12 -1 .07
66166 $100 calcium binding protein A14 -2.86 -1.12 -1.71
67647 RIKEN cdna 4930523cm -2.87 1.19 -1.23
FK506 binding protein 12-rapamycin
56717 associated protein 1 -2.90 1.63 -1.56
11845 ADP-ribosylation factor 6 -2.92 1.44 -1.63
382137 RIKEN cdna D630004A14 gene -2.92 1.25 -1.10
11669 Aldehyde dehydrogenase 2, mitochondrial -2.93 1.43 -1.12
18260 Occludin -2.93 1.07 -1.55
Feline leukemia virus subgroup C cellular
226844 receptor 1 -2.93 -1 . 14 -1.76
Lysophosphatidylcholine
210992 acyltransferase 1 -2.93 -1-04 '2-52
66102 Chemokine (C-X-C motif) ligand 16 -2.93 1.15 -1.82
231991 Camp responsive element binding protein 5 -2.94 1.10 1.00
14102 Fas (TNF receptor superfamily member. 6) -2.95 1.04 -1.30
CDP-diacylglycerol synthase (phosphatidate
110911 cytidylyltransferase) 2 '2-97 1-25 '1-58
66270 RIKEN cdna 1810015C04 gene -2.98 1.56 .-1.15
67109 Zinc finger protein 787 -2.99 1.28 -1.21
104263 Jumonji domain containing 1A -3.01 1.56 -l .15
84004 Melanoma cell adhesion molecule -3.02 1.36 -] .93
Carbohydrate (N-acetylgalactosamine 4-0)
68947 sulfotransferase 8 -3.04 -1.15 -1.00
20863 Stefin A3 -3.10 -1.29 -1.40
Solute carrier family 7
20539 member 5 -3.13 1.41 -: .6:
55948 Stratifin -3.15 1.01 - . 7
66938 RIKEN cdna 1700029G01 gene -3.16 1.59 -1.6

 

 

 

283

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio

Processing of precursor 4, ribonuclease

66161 P/MRP family, (S. Cerevisiae) -3.17 1.41 1.26
Guanine nucleotide binding protein, alpha

14674 13 -3.18 1.34 -1.42

69480 Tetratricopeptide repeat domain 9 -3.20 1.34 -1.87

78781 Zinc fingg CCCH type, antiviral l -3.20 1.23 -1.26

12274 Complement component 6 -3.24 -1.20 -3.52

29815 Breast cancer anti-estrogen resistance 3 -3.26 1.30 -1.13

213208 Interleukin 20 receptor beta -3.28 1.60 -1.39
8100 calcium binding protein A8

2020] (cglggnulin A) -3.28 -1.05 -1.45

319520 Dual specificity phosphatase 4 -3.30 -1.26 -1.53

56195 Polypyn'midine tract binding protein 2 -3.31 1.36 -1.43

66395 AHNAK nucleoprotein (desmoyokin) -3.31 1.70 -1.72
Solute carrier family 34 (sodium phosphate),

2053] member 2 -3.31 -1.01 -2.13
Anterior gradient homolog 3 (Xenopus

403205 laevis) -3.31 1.10 1.19

1E+08 Cdna sequence BC 1 179090 -3.32 -1.37 -1.37

74750 RIKEN cdna 5830410009 gene -3.33 -1.00 1.19

68603 Phosphomevalonate kinase -3.38 1.12 -1.99
C-type lectin domain family 4,

17474 member d -3.41 1.11 -1.41
A disintegrin and metallopeptidase

11501 domain 8 -3.42 -1.45 -1.01

109272 RIKEN cdna 8030451F13 gene -3.42 -1.14 -1.37

17394 Matrix metallopeptidase 8 -4.20 1.34 -1.39

228765 Sgtdecan binding protein (syntenin) 2 -4.26 1.09 -1.86

71908 Claudin 23 -4.29 -1.16 -1.74
Protein phosphatase 1, regulatory (inhibitor)

66849 subunit 2 -4.46 1.56 -1.35
ATP-binding cassette, sub-family A

76184 (ABC1), member 6 -4.46 1.98 -1.48

75137 RIKEN cdna 49305351303 gene 4.73 1.68 -1-58

66895 RIKEN cdna 1300014106 gene -5.03 -1-21 -1-94

77914 Keratin associated protein 17-1 -5.12 -1.20 -l.97

268885 Stefin A2 like 1 f -5.13 -1-11 '1-34
Hi h mobilit on box transcription actor

73389 1 g y gr p -5.30 1.83 -1.17

- ' t d lcium si nal transducer

56753 :umor assoma 6 ca g -5.62 1.10 -1.86
Myosin, heavy polypeptide 1, skeletal

17879 muscle, adult -5.66 -1.46 1.;‘57

14066 Coagplation factor II] -5.78 1.42 -l.

 

284

 

 

 

 

 

 

 

 

 

 

 

 

 

HIF1 HIF2 HIF1/2
GeneID Gene name ratio ratio ratio
Cystatin 8 (cystatin-related epididyrnal
13012 spermatogenic) -6.32 -1.56 -5.78
12654 Chitinase 3-1ike 1 -6.44 -1.34 -1.94
72432 Serine peptidase inhibitor, Kazal type 5 -6.77 -2.09 -3.26
16178 Interleukin 1 receptor, type II -6.85 1.67 -1.14
245195 Resistin like gamma -9.15 1.06 -1.39
20249 Stearoyl-Coenzyme A desaturase 1 -16.7 -1.08 -3.58

 

285