 

an“. h

2;“...

 

v.
36
z

.3.
a?

.‘awmmw

£3,

3 -
1 s
31‘
—
“1%“ .3: fl:
I, i. x it
I
.
.
i

2
39......
2-361

L... ..I..(
it I}...

511..
Elm“. I.

‘2: a?

L I
.\..n|..\~.i.

} .0291...

.ﬁl -
9"

‘.

 

LIBRARY
Mich.E . “state
Umversuy

 

 

 

This is to certify that the
dissertation entitled

INTERPLAY BETWEEN ACID RESISTANCE AND
VIRULENCE IN ESCHERICHIA COLI O157:H7

presented by

SIVAPRIYA KAILASAN VANAJA

has been accepted towards fulﬁllment
of the requirements for the

Ph.D degree in Comparative Medicine and
Integrative Biology

 

 

    
 

/.7

     

Major rofessor’s Si ature

g// 21%? 9

Date

MSU is an Afﬁrmative Action/Equal Opportunity Employer

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K IProj/AccaPres/CIRC/DateDue indd

 

 

 

INTERPLAY BETWEEN ACID RESISTANCE AND VIRULENCE IN
ESCHERICHIA COLI O157:H7
BY

Sivapriya Kailasan Vanaja

A DISSERTATION

Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Comparative Medicine and Integrative Biology

2009

ABSTRACT
INTERPLAY BETWEEN ACID RESISTANCE AND VIRULENCE lN
ESCHERICHIA COLI O157:H7
By
Sivapriya Kailasan Vanaja

Escherichia coli O157:H7 is a food borne pathogen of zoonotic origin that
causes hemorrhagic colitis and hemolytic uremic syndrome in humans. Acid
resistance (AR) is an essential characteristic of pathogenic E. coli O157:H7
because during its transit from reservoir host, cattle, to humans, 0157 has to
survive acidic environments of different food vehicles and the human stomach. E.
coli O157:H7 can survive in extreme acidic conditions such as pH 1.5 - 2.5 of
human stomach with the help of four AR mechanisms. Glutamate decarboxylase
(GAD) system is the most efﬁcient of the four AR mechanisms and is regulated
by a central activator, GadE. It is possible that while integrating the laterally
acquired genes into the chromosomal regulatory network of E. coli O157:H7,
chromosomal regulators such as GadE has evolved into a global regulator with
additional functions besides regulating GAD system. However, role of GadE on a
genome wide scale remains poorly deﬁned in E. coli O157:H7. The effect of AR
induction on the expression of virulence factors of E. coli O157:H7 is not clear.
When exposed to acidic conditions, E. coli O157:H7 may downregulate its
virulence mechanisms to conserve energy. Moreover, it is possible that
differential expression of AR and virulence related genes may be the reason for

the variation in infectivity observed between different genotypes of E. coli

O157:H7. In this context, the speciﬁc aims of this project were: 1) to elucidate the
role of GadE in acid resistance and virulence of E. coli O157:H7, 2) to determine
the effect of acidic pH on the expression of the LEE pathogenicity island and to
understand the role of GAD system regulators in this effect, and 3) to determine
whether the differences in infectivity of clinical and bovine-biased genotypes of E.
coli O157:H7 is due to the differential expression of virulence and stress ﬁtness
associated genes. To address these goals transcriptional proﬁling of wild type
and mutants of GAD system regulators was conducted. Expression studies were
also conducted to identify the genes differentially expressed between clinical and
bovine-biased genotypes of E. coli O157:H7. Understanding the molecular
mechanisms of AR and their effect on virulence and pathogenesis of E. coli
O157:H7 could help in developing new methods for diagnosis, prevention and
control of this pathogen. Moreover, identifying the differentially expressed genes
between different genotypes of E. coli O157:H7 with varying infectivity would help

us to identify new targets for vaccine development.

 

Copyright By
Sivapriya Kailasan Vanaja

2009

This work is dedicated to the fond memories of

Thomas S. Whittam, my mentor.

ACKNOWLEDGEMENTS

I wish to thank my mentor, Thomas S. Whittam, for being a great advisor and for
his valuable advice and support, and for providing the resources and
opportunities for me to acquire competence in a broad range of topics. Linda
Mansﬁeld, my acting advisor, has been a great support during the ﬁnal stages of
my PhD and I thank her for her guidance. I thank my committee members, John
Linz, Robert Britton and the CMIB program director, Vilma Yuzbasian-Gurkan, for

their support, suggestions, and guidance.

Many of my current and previous lab mates have provided suggestions, support,
and technical assistance that were critical to the completion of this research. I
thank Teresa Bergholz, Shannon Manning, Galeb Abu-Ali, James Riordan, Adam
Nelson, Nicole Milton, Hans Steinsland, Lindsey Ouellette, Cody Springman,

Jillian Tietjen, Mahesh Neupane and Scott Henderson.

I wish to thank my parents, Kailasan Krishnan and Vanaja Parameswaran, my
sister, Jayapriya Anil, and my best friend, Mahrukh Banday, for their support and
encouragement. My husband Vijay Rathinam has provided me with amazing

support during my graduate career. I thank him for his love and encouragement.

vi

TABLE OF CONTENTS

LIST OF TABLES .............................................................................................. ix
LIST OF FIGURES ........................................................................................... x
Chapter 1. Introduction ..................................................................................... 1
Pathogenic Escherichia coli ........................................................................... 2
Virulence factors and pathogenesis ............................................................... 8
Acid resistance (AR) of E. coli O157:H7 ....................................................... 14
Genotypes of E. coli O157:H7 ....................................................................... 28
Rationale for this study .................................................................................. 32
Chapter 2. Characterization of the Escherichia coli O157:H7 Sakai GadE
Regulon ............................................................................................................. 35
Summary ........................................................................................................ 36
Introduction ............................................................................... ' ..................... 37
Materials and Methods ................................................................................... 41
Results ........................................................................................................... 50
Discussion ...................................................................................................... 68
Acknowledgements ........................................................................................ 75

Chapter 3. Effect of acidic pH on the expression of virulence factors of
Escherichia coli O157:H7: role of glutamate decarboxylase system regulators 76

Summary ........................................................................................................ 77
Text ................................................................................................................ 78
Acknowledgements ........................................................................................ 86
Chapter 4. Differential expression of virulence and stress-ﬁtness genes between
clinical and bovine-biased genotypes of Escherichia coli O157:H7 .................. 87
Summary ........................................................................................................ 88
Introduction .................................................................................................... 89
Materials and Methods ................................................................................... 92
Results ........................................................................................................... 98
Discussion ..................................................................................................... 1 13
Acknowledgements ....................................................................................... 1 19
Chapter 5. Summary and future directions ...................................................... 120
Summary ....................................................................................................... 121
Future directions ........................................................................................... 130
APPENDICES .................................................................................................. 137
Appendix 1 .................................................................................................... 138
Appendix 2 .................................................................................................... 140
Appendix 3 .................................................................................................... 143
Appendix 4 .................................................................................................... 149

vii

Appendix 5 .................................................................................................... 150
Appendix 6 .................................................................................................... 155

REFERENCES ................................................................................................. 164

viii

LIST OF TABLES

Table 2.1 Bacterial strains and plasmids used in GadE regulon study ............ 42
Table 2.2 Oligonucleotide primers used for one-step inactivation in GadE regulon
study ................................................................................................................ 43
Table 2.3 Effect of gadE inactivation on expression of AFI and GAD genes in
exponential and stationary phase .................................................................... 54
Table 2.4 LEE genes signiﬁcantly upregulated in the AgadE strain ................. 57

Table 2.5 Effect of pH 5.0 on expression of GAD regulators and LEE genes.. 62

Table 3.1 Alteration in expression of acid resistance and virulence genes upon

exposure to extreme acidity ............................................................................. 81
Table 3.2 Effect of gadX inactivation on the expression of LEE genes ............ 83
Table 3.3 Effect of eng inactivation on the expression of LEE genes ............ 85
Table 4.1 Virulence-associated genes upregulated in clinical genotype 1 relative
to bovine-biased genotype 5 ............................................................................ 99
Table 4.2 Genes upregulated in bovine-biased genotype 5 ............................. 101

Table 4.3 Enrichment of gene sets in clinical and bovine-biased genotypes... 103

LIST OF FIGURES

Figure 1.1. Step-wise evolution of E. coli O157:H7 from EPEC-Iike ancestor .4

Figure 1.2. Mechanism of action of GAD system ............................................. 17
Figure 1.3. Regulatory circuits involved in the induction of GAD system ........ 19
Figure 1.4. The AFI region of the E. coli K-12 genome .................................... 22
Figure 1.5. Interactions between GAD regulators and LEE ............................. 27
Figure 1.6. The phylogenetic network applied to 48 parsimoniously informative
(Pl) sites using the Neighbor-net algorithm for 528 E. coli O157 strains .......... 30
Figure 2.1. Alignment of putative GAD box sequences .................................... 53
Figure 2.2. Exponential phase expression of LEE genes in AgadE,
AgadEAIen:Km, and Alensz .......................................................................... 60
Figure 2.3. AR mechanism assays .................................................................. 65

Figure 2.4. Survival of wild-type, AgadE, and AgadE/pCR2.1gadE strains in the

M88 ................................................................................................................. 67
Figure 4.1. Double loop design for the microarray experiment ........................ 94
Figure 4.2. qRT-PCR validation of the microarray data ........... 106

Figure 4.3. Neighbor joining phylogeny of SNP genotypes representing the eight
strains used in genotype study ........................................................................ 110

Figure 4.4. Survival of clinical and bovine-biased genotypes in the model
stomach system ............................................................................................... 112

CHAPTER 1

Introduction

PATHOGENIC ESCHERICHIA COLI

Escherichia coli is a genetically diverse group of Gram-negative facultative
anaerobe that typically colonizes the large intestine and lower part of the small
intestine of mammals (66). Commensal E. coli coexist with the human host
without causing any disease whereas pathogenic forms of E. coli can cause a
number of clinical illnesses with varying degrees of severity (8, 66). Acquisition of
several virulence factors through horizontal gene transfer during evolution has
allowed pathogenic E. coli to adapt to new predilection sites in hosts and to
successfully cause a broad spectrum of diseases in them. Different combinations
of these acquired virulence factors deﬁnes speciﬁc pathotypes of E. coli, which
can cause characteristic clinical symptoms such as enteric disease, renal and
urinary tract infections, and meningitis (66).

Clinically important enteric pathotypes of E. coli include enterotoxigenic E.
coli (ETEC), enteropathogenic E. coli (EPEC), Shiga toxin (Stx)-producing E. coli
(STEC), and enterohemorrhagic E. coli (EHEC). Other enteric pathotypes are
enteroaggregative E. coli (EAEC), enteroinvasive E. coli (EIEC), and diffusely
adherent E. coli (DAEC). ETEC is the leading cause of traveler’s diarrhea in
developing countries and it harbors at least one enterotoxin; heat-labile toxin (LT)
or heat-stable toxin (ST). EPEC causes diarrhea in children younger than 2 years
and the infection is characterized by the attaching and effacing (NE) lesions in
the intestinal mucosa. This lesion is mediated by a laterally acquired
pathogenicity island, the locus of enterocyte effacement (LEE). E. coli strains

harboring one or more variants of Stx are named STEC, and EHEC is a sub

 

population of STEC deﬁned by the presence of Stx, LEE and a pO157 plasmid.
EHEC infections are characterized by hemorrhagic colitis and hemolytic uremic

syndrome (HUS) (66, 101, 109).

E. coli O157:H7

E. coli O157:H7 is the most prevalent EHEC serotype in the United States
(153). It is a zoonotic food-bome pathogen and causes hemorrhagic colitis and
HUS in humans similar to other EHEC. E. coli O157:H7 was isolated ﬁrst in 1983
from stool cultures of patients with hemorrhagic colitis associated with ingestion
of undercooked hamburgers and from sporadic cases of HUS (153). It has since
become an emerging pathogen and currently, 0157 is estimated to cause
approximately 73,000 illnesses in the US yearly with an economic burden of 0.2
— 0.6 billion (120).

E. coli O157:H7 strains are distinguished from other serotypes by their
inability to ferment sorbitol (80R) and to produce B-D—glucuronidase (GUD‘)
(101). A SOR” GUD+ EPEC serotype, E. coli 055:H7, is considered as the
evolutionary ancestor of E. coli O157:H7 (121). E. coli O157:H7 was evolved
from 055:H7 in a step-wise manner through acquisition of Stx2 and the pO157
plasmid; followed by an antigenic shift, gain of Stx1, and loss of motility, SOR“,
and GUD+ phenotypes (Fig. 1.1) (170). Whole genome sequence comparison of
E. coli O157:H7 Sakai with benign laboratory strain E. coli K-12 revealed that the

0157 genome contains 1.4-Mb of O157:H7-speciﬁc sequence most of which is

ET1

 

  

EDL-933
Ancestral
1
EPEC-like 3:9, ET 2
strain 3 activity 413
GUD+ soa+

 

 

 

GUD+ SOR+
Stx2+

‘----

ET 5 DEC so

Figure 1.1. Step-wise evolution of E. coli O157:H7 from EPEC-like ancestor.

Phenotypes of ancestors are shown (38).

contributed by foreign DNA elements that are acquired horizontally during

evolution (46).

Clinical manifestations and treatment

The infective dose of E. coli O157:H7 is extremely low: 10 -100 cells are
sufﬁcient to cause a clinical infection (68, 147, 163). The average incubation
period for E. coli O157:H7 infection is 3.7 days. The disease starts as non-bloody
diarrhea, which lasts for 1 — 3 days followed by bloody diarrhea. Bloody diarrhea
occurs in 90% of the cases due to severe hemorrhagic colitis. In 0157 infections,
most patients remain afebiile and the abdominal pain is more severe compared
to other bacterial gastroenteritis (153). The most lethal complication of E. coli
O157:H7 infection is HUS, which causes acute renal failure in 15% of the
infected children younger than 10 years old. Onset of HUS occurs typically
between 5 - 13 days of the infection and generally HUS starts as
thrombocytopenia followed by hemolysis and azotaemia (153). HUS is a
thrombotic disorder and the characteristic lesions include microvascular thrombi
and swollen endothelial cells (57, 160).

It is believed that intravenous rehydration and maintenance ﬂuids provide
optimal protection against kidney damage and thus, constitute the most common
management strategy in patients with bloody diarrhea. Expansion of parenteral
volume has been associated with attenuation of renal injury (3). However,
standard rehydration protocols are considered inadequate for 0157 infections.

lsotonic crystalloid is highly recommended for volume expansion and

maintenance in HUS. Antibiotics are not administered to patients with 0157
infections as many studies have shown a strong correlation between antibiotic

therapy and increased risk of HUS (128, 172).

Reservoir hosts of E. coli O157:H7

Cattle are the primary reservoir hosts of E. coli O157:H7 and 0157 exists
as part of normal intestinal microﬂora of cattle without causing any disease (25,
74). In addition, other food animals such as pigs, sheep, and goats (104) act as
reservoir hosts of E. coli O157:H7 (106). E. coli O157:H7 colonizes the
gastrointestinal tract of cattle, speciﬁcally the lymphoid follicle-dense mucosa of
the recto—anal junction (40, 102). Earlier surveys in cattle indicated lower
prevalence of E. coli 0157 in feces possibly due to the poor sensitivity of
isolation methods (49). Only 1.8% of fecal samples were found to contain E. coli
0157 in one of the largest surveys. However, recent studies have indicated a
markedly higher prevalence of 0157 in cattle (51, 62). An investigation on the
correlation of E. coli O157 prevalence in feces, hides and carcasses of beef
cattle during processing demonstrated that of the 30 lots sampled, 87% had at
least one 0157 positive pre-evisceration sample (36). Currently, E. coli O157:H7
is considered ubiquitous in cattle farms and the shedding rate in cattle farms is
estimated to be greater than 10%, sometimes approaching 100% (14, 45).
Interestingly, there is a seasonal effect in the prevalence of E. coli O157:H7 in
cattle with peak prevalence in summer and early fall (45). This corresponds with

the peak in outbreaks involving ground beef in summer (120).

 

Transmission of E. coli O157:H7

A factor critical for the pathogenicity of E. coli O157:H7 is its ability to be
transmitted from cattle to humans through a variety of food vehicles. In the earlier
outbreaks 0157 was typically transmitted through contaminated ground beef
(115, 118). Later it was found to be transmitted through vehicles such as apple
cider (13, 53), dry salami (116), apple juice (29), and raw milk (114). Most
recently, green leafy vegetables such as spinach and lettuce are implicated in
0157 outbreaks (52, 117). Interestingly, many of these vehicles pose multiple
environmental stresses and E. coli O157:H7 appears to be successful in
surviving under these conditions. Response of 0157 to the acidity of apple juice
(pH 3.5) has been investigated using a model apple juice (MAJ) system and it
was found that 0157 is induced for multiple stress response regulons including

the RpoS, RpoH and CpxRA regulons in response to MAJ exposure (9).

 

VIRULENCE FACTORS AND PATHOGENESIS
Important virulent factors of E. coli O157:H7 include Stx, LEE and the
pO157 plasmid. Each of these factors and their role in pathogenesis and

regulation are described'in detail below.

(i) Stx: Stx, also known as verotoxin (VT), is encoded by bacteriophages that are
inserted into the 0157 chromosome (66). There are two subgroups in the Stx
family: Stx1 and Stx2 with ﬁve allelic variants of Stx2 (Stx2, Stx20, Stx2d, Stx29
and Stx2f) (153). There is a 55% amino acid homology between Stx1 and Stx2.
Stx is a typical A35 exotoxin with ﬁve identical B subunits forming a pentamer
with a single A subunit. The A subunit of Stx has two peptide chains A1 and A2.
A1 is a N-glycosidase enzyme and A2 connects A1 with the B-pentamer (66).
The B-pentamer mediates the binding of Stx to the glycolipid
globotriaosylceramide (Gb3) receptors on the hostcell surface. This binding is
followed by a receptor-mediated endocytosis and transfer through the Golgi
apparatus and endoplasmic reticulum. During this transfer, a membrane bound
protease, furin, nicks the A subunit from the holotoxin leaving the A1 fragment
attached to A2 by a disulﬁde bond. This bond is later reduced and subsequently,
the A1 enzyme is translocated into the cytoplasm where it removes an adenine
residue from the 28s rRNA and inhibits the elongation step of protein synthesis.
Inhibition of protein synthesis leads to death of cells that carry Gb3 receptors.
There are cellular differences in the expression of Gb3 and renal glomerular

endothelial,.mesangial and tubular epithelial cells are characterized by higher

concentration of Gb3 receptors, which makes them highly susceptible to the
damage by Stx. Direct toxicity by Stx along with induction of cytokines and
chemokines cause destruction of renal endothelial cells and microvascular
occlusion ultimately leading to HUS. Stx also causes intestinal epithelial cell
death and damage in the colon leading to hemorrhagic colitis and bloody
diarrhea by a similar mechanism (7).

Stx is encoded on a single operon comprising two genes corresponding to
the A and B subunits. The 1:5 ratio of the NB subunit synthesis for generating
the A35 holotoxin is maintained by a stronger ribosomal binding efﬁciency of the
B-subunit gene resulting in increased translation of B-subunits compared to the
A-subunit (109). Stx genes are located on the late gene region of the Stx-
producing Iambdoid prophage down stream of the phage lambda Q
antiterrninator gene. Increased toxin synthesis occurs upon induction of the
prophage due to an increase in copy number as the phage genome replicates
and due to upregulation of stx expression from the phage late promoter PR'. Stx1
has its own promoter in addition to the phage late promoter and this promoter
can induce toxin gene transcription independent of phage induction. No phage
independent promoter. has been identiﬁed for Stx2. Genes encoding holin and
endolysin are located down stream of the Stx genes and therefore, it is believed
that coupling of toxin and lysis gene expression facilitates release of the toxin
from the bacterial cell (149).

Several environmental factors that regulate Stx expression have been

identiﬁed. There is a strong correlation between DNA damage and Stx phage

induction. Antibiotics such as norﬂoxacin and ciproﬂoxacin inhibit cellular DNA
gyrase activity resulting in DNA damage and SOS response, which lead to a
dramatic increase in Stx production from cells (48). Iron downregulates Stx1
expression as the ferrous iron binding protein, Fur, directly binds to the Fur box
upstream of the phage independent Stx1 promoter and represses its transcription

(20, 95).

(ii) LEE: LEE is a laterally acquired pathogenicity island that encodes a type 3
secretion system (T388) in EHEC and EPEC. The LEE consists of 41 genes
that are transcribed as ﬁve polycistronic operons, LEE1 through LEE5. LEE1
encodes the key regulator of LEE, the Ler (LEE encoded regulator), which
positively regulates the expression of LEE2 through LEE5. LEE also encodes
additional regulators such as GrIA (global regulator of LEE activator) and GrlR
(global regulator of LEE repressor). The structural components of T3SS are
mainly encoded on the 5' end of LEE whereas the outer membrane adhesin
intimin (Eae) and the translocated intimin receptor (Tir) are encoded on the
central part of LEE. The 3' end of LEE encodes translocators, effectors and
additional structural proteins of the T388. LEE-encoded T3SS is involved in
translocating effector proteins encoded on the LEE and on different locations in
the genome (158), into the host cell cytosol, which is important for the
pathogenesis of 0157 infection (41, 95).

The T3SS apparatus assembled from the products of LEE genes has the

typical multicomponent organelle structure of gram-negative T3SS with outer and

10

inner membrane ring structures and a needle complex (41 ). This TSSS is
responsible for the characteristic intimate attachment between E. coli O157:H7
and intestinal epithelial cells. Following initial adherence of E. coIiO157zH7 to the
host cell, the T388 needle apparatus is inserted into the host cell plasma
membrane and Tir is secreted into the cytoplasm, which acts as a receptor for
intimin. Binding between intimin and Tir leads to an intimate attachment of
bacteria to host cell. This induces rearrangement of actin cytoskeleton resulting
in formation of pedestal-like structures and effacement of intestinal microvilli
ultimately causing A/E lesions in the intestine, the hallmark of 0157 infection.
Regulation of LEE expression is complex and involves multiple
environmental factors and regulators (95). Growth in tissue culture medium such
as Dulbecco’s modiﬁed Eagle’s medium (DMEM) at host body temperature
(37°C), pH 7.0, and physiological osmolarity induces maximal LEE expression
(69, 70). Other environmental factors that stimulate LEE expression include
presence of iron and sodium bicarbonate. Presence of ammonium chloride and
exclusion of calcium from the growth medium can inhibit LEE expression (56). As
mentioned above, Ler is the key positive regulator of LEE and it acts by
disrupting the silencing of LEE by the histone-like DNA binding protein, H-NS
(95). Several regulatory systems such as RcsCDB phosphorelay system and the
EHEC-speciﬁc GrvA protein regulate expression of LEE by controlling the Ier
expression in 0157 (157). In addition, there is a quorum-sensing regulation of
LEE, which involves an Al-3-signaling molecule that cross talks with epinephrine

hormone and activates LEE expression (141, 142).

11

(iii) p0157 plasmid: pO157 is a laterally acquired 92 kb F-Iike plasmid present in
all E. coli O157:H7 strains (19). p0157 contains 100 open reading frames
(ORFs) and encodes a number of virulence factors such as enterohemolysin
(Eth), toxin B (ToxB) and a type 2 secretion system (T288) encoded by etp
genes (19). Enterohemolysin is a repeats in toxin (RTX) family toxin. Although
the exact role of enterohemolysin in the pathogenesis of 0157 infections is not
clear, it has been shown to cause endothelial injury and induce production 'of
cytokine, IL-18, which is a hallmark of HUS (152). eth is the structural gene of
enterohemolysin, which is encoded on a single operon containing four genes
ethABD. Eth converts Eth into an active form by the addition of a fatty acid
group (58) and Eth and D form a secretion machinery for Eth (166). Another
virulence factor encoded by pO157, ToxB, is a potential adhesin with sequence
similarity to the Chlostridium toxin family. The etp-T288 secretes StcE, a zinc
metalloprotease that cleaves the C1 esterase inhibitor of the complement
pathway, which may contribute to the tissue damage (76). StcE also has a
mucinase activity and is involved in intimate adherence of 0157 to host cells
(44).

A positive interaction exists between LEE and many of the pO157
encoded virulence genes. GrlA, the LEE encode regulator, positively regulates
the transcription of eth. Similarly, Ler upregulates the expression of stcE (44).

Furthermore, it has been shown that mutation of the toxB gene results in reduced

12

expression and secretion of proteins encoded by LEE leading to a decrease in

adherence to cultured epithelial cells (143).

13

ACID RESISTANCE (AR) OF E. COLI O157:H7

Gastric acidity (pH 1.5—2.5) is one of the ﬁrst innate defense barriers
encountered by enteric pathogens upon entry into the human body (112). Enteric
pathogens have adapted several mechanisms to breach this defense barrier and
establish infection. One common strategy is the “assault tactic’ as seen in Vibrio
cholerae and Salmonella infections, where the infectious dose of the organism is
so huge that some organisms will survive and enter the intestine. Another
strategy shown typically by Helicobacter pylori Is to mount a counterdefence
mechanism such as the urease system to neutralize the extreme acidity (39, 135,
137). E. coli O157:H7 also has to overcome the adverse conditions of the
stomach before successfully colonizing its niche, the large intestine. Similar to H.
pylori, E. coli strains have been shown to be more AR than other enteric
pathogens (83). This extreme AR is governed by four principal mechanisms in E.
coli; the oxidative (OXI) system, the GAD system, the arginine decarboxylase
(ARG) system and the lysine decarboxylase (LYS) system (39, 83). The OXI
system is the least understood AR system in E. coli. It is induced upon entry into
the stationary phase in a complex medium at pH 5.5. Once induced, the OXI
system helps the bacteria to survive in pH 2.5 in minimal medium. Global
regulatory protein CRP (cAMP receptor protein) and the stationary phase sigma
factor, RpoS are essential for the functioning of the OXI system (23, 82).
Presence of glucose in the medium inhibits CRP and hence, represses the OXI

system (23).

14

Functioning of GAD, ARG and LYS systems are dependent on the
availability of the amino acids glutamate, arginine and lysine, respectively. These
systems typically consist of pairs of amino acid decarboxylases and antiporters.
The ARG system comprises the arginine decarboxylase enzyme encoded by
adiA and the arginine-agmantine antiporter encoded by adiC (59). Anaerobic
conditions in a complex medium at low pH are essential for transcription of adiA
and adiC. It is believed that a regulator, CysB, senses these factors and induces
their transcription. An AraC-like regulator, AdiY, also activates the expression of
adiA and adiC, however, this regulator is not essential for their expression (43,
145). Similarly, RpoS is involved in the functioning of the OXI system, but is not
required for the transcription of adiA and adiC genes. The LYS system is a much
less efﬁcient system compared to the other three AR systems. It consists of
lysine decarboxylases (cadB) and the lysin'e-cadaverine antiporter (cadA) and

provides protection against mild acidity (59).

GAD system

The GAD system is the most efﬁcient AR mechanism in E. coli and
provides best protection against pH as low as 2.0 (75). The components of the
GAD system include two glutamate decarboxylase isozymes, GadA and GadB,
and a membrane-associated glutamate-gamma amino butyric acid (GABA)
antiporter, GadC (23, 24, 75). GadA and GadB are pyridoxal 5’-phosphate (PLP)-
dependent enzymes and have a hexameric structure with one PLP moiety per

monomer (16). The nucleotide sequences of GadA and GadB are 98% similar

15

and they have highly similar peptide structure with differences only in 5 amino
acid residues mainly at the N-terminal region (140). The two isozymes also share
similar biochemical characteristics such as speciﬁc activity and isoelectric points
(16). The two genes gadA and gadB map to distinct loci in the E. coli K-12
chromosome with gadB forming an operon with gadC at 33.8 min and gadA at
78.98 min as part of the acid ﬁtness island. Either one of the decarboxylases
isozymes is sufﬁcient for GAD dependent AR at pH 2.5 whereas both are
required for AR at pH 2.0. Presence of GadC is essential fOr the functioning of
GAD system at both conditions (23).

The GAD system is induced upon entry into stationary phase of growth as
well as when the cells are exposed to acidic conditions. Presence of glutamate in
the environment is essential for the functioning of the GAD system. As the
extracellular pH decreases, the intracellular pH of E. coli also goes down. At an
intracellular pH of 4.2, GadA and GadB get activated and these enzymes
catalyze the replacement of the carboxyl group of glutamate with a proton from
the cytoplasm producing GABA and C02. This reaction reduces the intracellular
H+ ion concentration and stabilizes the pH homeostasis of the cell and maintains
the pH at 4.2, which is tolerable to the E. coli physiology (39, 123). GABA is in
turn expelled into the extracellular environment via GadC, in exchange for

incoming glutamate (Fig. 1.2) (120).

16

pH 2.5

  
   

H+ + CI'Z HCI

Glutamate

GABA

COZ

Figure 1.2. Mechanism of action of GAD system. GABA= gamma amino butyric

acid. Adapted from (39).

Regulation of GAD system in E. coli

The GAD system is spontaneously induced as cells enter the stationary
phase of growth. Stationary phase sigma factor, RpoS, regulates this induction
(87). Low pH also induces the GAD system independent of RpoS (161 ), but, the
exact mechanism of this induction is not clearly deﬁned.

Previous studies in E. coli K-12 have revealed that the genetic regulation
of the GAD system is complex and involves at least 14 regulatory genes and a
central activator, GadE (39). The GadE activates the transcription of gadA and
gadBC genes by directly binding to a conserved 20 bp GadE-binding region
upstream of gadA and gadB namely, the GAD box (22, 54, 84). Distinct circuits of
regulation are induced depending on the physiological status of the cell and the
medium in which the organism is grown. These circuits are focused primarily on
regulating the expression of gadE (Fig. 1.3) (24, 39). When cells are grown in
minimal medium, the EngS two-component system is activated and it
upregulates the expression of YdeO, which in turn triggers the expression of
gadE (85, 89, 90). On the other hand, in a complex medium such as LB, during
the stationary phase of growth, another circuit comprised of CRP, RpoS and two
AraC-like regulators, GadX and GadW comes into play. RpoS induces the
expression of GadX/W, which in turn indirectly activates the transcription of
gadA/B via GadE (87, 159, 162). GadX and GadW also form a negative feed
back loop by binding to the GAD box sequences and repressing the gadA and

gadBC promoters. Because of this dual role, GadX/W can act as activators of

18

   
 

 
 

 
 

Acidity at
exponential phase
(minimal media)

   

  

Stationary phase
(complex media)

RpoS

 
  
 

  
   
  

 
 

Eng —> Eng

     
 

GadX GadW

 

 

1“ 1’
gadB gadC gadA

Figure 1.3. Regulatory circuits involved in the induction of GAD system. The

growth phase and medium that activate each circuit is given within the circles

Modiﬁed from (39).

glutamate decarboxylase under some conditions and repressors under others
(87). GadW forms another feed back loop by inhibiting RpoS, which is necessary
for the activation of GadX. Similarly, GadX can repress the transcription of
GadW. During exponential growth in complex media GadX and GadW tightly
control each other and prevent the activation of the GAD system (159). A third
regulatory circuit of the GAD system involving a GTPase protein, TrrnE (MnmE),
becomes active during growth in LB containing glucose (39, 42). TrrnE is also
required for efﬁcient translation of GAD genes (42). Unlikethe genes in these
regulatory circuits, GadE is necessary for the functioning of the GAD system at

all stages of growth in any medium (39, 84).

In addition to these regulatory circuits, other regulators such as RcsB and
RNaseE are also involved in the regulation of GAD system. Basal level
expression of RcsB, a component of RcsCDB signal transduction system, is
necessary for GAD system functioning whereas, if over-expressed, RcsB
represses GAD expression (24). RNaseE, an essential endoribonuclease
involved in processing and degradation of RNAs, is also required for induction of
the GAD system (150). Similarly, a functional topoisomerase I is essential for full
induction of the GAD system (144). PhoP, the response regulator of the
Pth/PhoP two-component system, also positively regulates the GAD system by
directly binding to upstream sequences of GadE and GadW (176). Besides
above-mentioned protein regulators, a small RNA, GadY, is also involved in
induction of the GAD system. GadY is encoded by the AFI, on the opposite

strand between gadX and gadW. There are three forms of GadY, a 105

20

nucleotide long form and two processed forms of 90 and 59 nucleotides. RpoS

controls GadY expression and it is induced at stationary phase of growth. GadY
acts by conferring increased stability to gadX mRNA by forming base pairs with
its 3’-untranslated region. This leads to accumulation of gadX mRNA, which

ultimately results in increased GAD expression (105).

One of the major repressors of GAD system is the histon-like protein, H-
NS (167). H-NS directly downregulates the GadE expression and affects the
GAD system (55). Another repressor of the GAD system is TorR, the response
regulator of the TorS/TorR two component system, which negatively regulates
gadE, gadABC and many AFI genes (18). It has been recently shown that Ler,
the key positive regulator of LEE also negatively regulates GAD expression (1).

Post transcriptional regulation of GAD system is not clear. However, the
fact that exponential phase cells grown under moderate acidity (pH 5.5) express
high level of GAD genes but remain acid sensitive indicates the presence of

regulation at translational level.

Acid fitness island (AFI)

Fitness islands are horizontally transferred genetic elements that provide
advantageous traits that are not directly related to the virulence of the organism.
One such element in E. coli and Shigella is the AH, the acquisition of which is
considered as a crucial step in the early evolution of these organisms. The AFI is
located at 78.8 min in E. coli K-12 chromosome and encodes 12 genes that are

involved in acid and stress resistance including gadA (Fig. 1.4) (8). Also encoded

21

Acid Fitness Island (AF l) gadA

3665210

 
   

  
 
  

yhiFD hdeBAD yhiU V gadX / E. coli K-12

I I I I I I I- I I - 78.8 4,639,675 nt
gadE gadW gadA mi" gadB

12.98 kb 1570069

Figure 1.4. The AFI region of the E. coli K-12 genome. Previous studies have
shown that the 12-kb AFI is located at 78.8 min on the K-12 chromosome and
includes the gadA gene and other metabolic stress-related genes, whereas the

duplicate gadB locus occurs across the K-12 chromosome at 33.0 min (8).

22

on AFI are three important regulators of the GAD system, GadE, GadX, and
GadW. Many of the other AFI proteins confer different types of AR in E. coli. For
example, the periplasmic acid stress chaperones, HdeAB, a putative LuxR family
regulator, YhiF, and the lipoprotein, Slp, are required for protection against self-
metabolic products at low pH and in spent medium. Similariy, a putative MgtC-
family transporter, YhiD, and a predicted inner membrane protein, HdeD, are
necessary for high cell density-dependent AR (71, 91). GadE regulates the
expression of all the AFI genes in E. coli K-12 and hence, is involved in
resistance to metabolic stress and high cell-density AR (91 ). Functions of the

remaining AFI genes, thU and thV remain unclear.

GadE regulator

GadE is a LuxR family regulator with a potential helix-tum-helix DNA-
binding domain in the secondary structure. GadE binds to a conserved 20 bp
GAD box sequence upstream of gadA and gadBC and activates the transcription
of these genes (22). A 798 bp intergenic region between gadE and the upstream
gene hdeD is essential for the expression of gadE. The highly conserved
sequence between -750 and -1 is considered as the gadE sensory integration
region as this region coordinates the environmental and genetic regulators of
gadE expression. At least nine activators and repressors of gadE converge at
this region including Eng, YdeO, GadE, TorR, Hns, PhoP, TrmE, GadX and
GadW (1 31 ).

23

GadE is transcribed as three transcripts T1, T2 and T3. T1 starts at -124
bp, T2 at -324/-317 and T3 at -566 relative to the gadE translational start site with
P1, P2 and P3 as corresponding promoters. P1 is the strongest promoter and is
typically induced at stationary phase in complex or minimal medium. P3 is highly
responsive to induction in minimal medium while P2 is expressed only in
combination with P3 or alone when there is an over-expression of GadX or YdeO
regulators. P2 is also activated by a TnnE-dependent manner in LB-glucose.
Initial induction of GadE occurs through activation of P3P2 promoters, and once
induced, GadE represses P3P2 and autoactivates P1 leading to a sustained
transcription of gadE from P1 (131). Upon removal of inducing signals, GadE is
degraded by the Lon protease, a major protease that is active in cellular protein

quality control and degradation of various naturally unstable regulators (50).

GAD system and GadE in E. coli O157:H7

A previous study in our laboratory comparing survival rates of E. coli
O157:H7 in complex acidic conditions such as a model stomach system (pH 2.0)
with that of E. coli 026:H11 and E. coli 011 1 :H8, revealed that E. coli O157:H7
has a superior ability to survive in the simulated gastric environment than the
other strains tested. The quantitative PCR data from this study also showed that
E. coli O157:H7 expresses higher transcript levels of gadA and gadB genes. This
led to the suggestion that the regulation of GAD system may be different in E.
coli O157:H7 compared to the laboratory strain E. coli K-12, in which most of the

studies about this system have been done (10). Together, these results support

24

the hypothesis that the predominance of E. coli O157:H7 in clinical cases
compared to other EHEC strains is due to its enhanced ability to resist stresses
encountered in the environment both outside and inside the host. Also, this
superior AR is considered a virulence factor because it contributes to the low
infective dose of E. coli O157:H7. Furthermore, our laboratory recently showed
that gadA and gadB sequences remain divergent in E. coli O157:H7, whereas in
other E. coli strains, they have undergone multiple gene conversion events
leading to genetic homogenization (8). All of these ﬁndings strongly suggest that
the regulation and functioning of the GAD system are distinct in E. coli O157:H7.
Much is known about the upstream regulatory circuits and downstream
effects of GadE in non-pathogenic E. coli (39, 84). However, GadE and its role in
AR and virulence are not well characterized in any of the pathogenic E. coli
strains. Genome comparisons between two sequenced O157:H7 strains and
K12 MG1655 revealed that O157:H7 has approximately 25% additional O157-
speciﬁc loci compared to E. coli K12 (46). During its evolution, O157:H7 has
acquired many mobile elements such as Iambdoid phages carrying virulence and
ﬁtness islands (121, 170). As mentioned before, important virulence factors of E.
coli O157:H7 including shiga toxins and LEE are encoded by these horizontally
transferred phage elements (77). For E. coli, Integrating these acquired elements
into the chromosomal regulatory network is critical to becoming a successful
pathogen (1 )..Although, the GadE sequence remains unchanged and maps to a
homologous location in the 0157 chromosome, it is possible that a chromosomal

regulator, such as GadE, has acquired additional functions in O157:H7.

25

However, effects of the GadE regulator on a genome-wide scale in E. coli

O157:H7 are still unknown.

Interaction of GAD system regulators with LEE

The relationship between AR and virulence of pathogenic E. coli,
especially the interaction between GAD system and LEE remains largely
unknown. A few studies in the past have reported that some of the GAD system
regulators negatively effect the LEE expression (24, 99, 138, 157) (Fig. 1.5). In E.
coli O157:H7, gadE inactivation was shown to increase the expression of LEE
encoded genes espB, espD and tir but not Ier (156). Hence, GadE mediated
down-regulation of LEE is considered Ler-independent and the pathway through
which GadE affects LEE is not known (95). Two upstream regulators of gadE
also negatively affect expression of LEE in EPEC. One of them is GadX, which
negatively regulates the expression of LEE through a plasmid encoded regulator,
PerA (138). Similarly, Eng represses the LEE expression in EPEC by activating
YdeO and YdeP (99). But, the regulation of LEE by GadX and Eng in EHEC
has not been studied. It is possible that GadX down-regulates the expression of
LEE through Pch, the PerC-homolog in EHEC. Additionally, because YdeO is a
positive regulator of gadE, the down-regulation by Eng might be mediated
through GadE. However, a detailed study is warranted in this aspect in order to
fully understand the mechanism of LEE repression by GAD system regulators in

EHEC.

26

 

 

a LEE1 LEE2 LEE3 LEE5 LEE4

Figure 1.5. Interactions between GAD regulators and LEE. Solid lines indicate
experimentally conﬁrmed mechanisms and dotted lines indicate suggested

mechanisms that are not proved experimentally.

27

GENOTYPES OF E. COLI O157:H7

Several genotyping methods such as pulse ﬁeld gel electrophoresis
(PFGE) and multi locus sequence typing (MLST) have been employed to
investigate the genetic relatedness of E. coli O157:H7 strains from various
sources. One of the most sensitive of these methods is the single nucleotide
polymorphism (SNP) typing that was established recently by our laboratory (88).
This study typed >500 clinical 0157 strains using a SNP genotyping scheme that
targets 96 SNP loci. Phylogenetic analysis classiﬁed the strains into 39 SNP
genotypes, which formed nine distinct clades (Fig. 1.6) (88). Interestingly, the
clades showed differences in the frequency and distribution of Stx genes and in
the spectrum of clinical diseases reported. lmportantly, clade 8 was found to be
an emergent subpopulation with more chances of causing severe disease with
HUS whereas groups such as clade 7 was less frequent in clinical cases and
caused less severe disease. Both spinach and lettuce strains that caused fresh
produce-associated outbreaks with severe disease and death in 2006 belonged
to clade 8. The 0157 genome strain Sakai, that was implicated in the 1996
radish sprouts outbreak in Japan belonged to clade 1 whereas the strain that
caused a Hamburger outbreak in northwest regions of the United States
grouped to clade 2 (88). Even though SNP typing has been conducted
extensively on clinical strains of E. coli O157:H7, strains of bovine origin are yet

to be classiﬁed by this method.

28

Figure 1.6. The phylogenetic network applied to 48 parsimoniously informative
(Pl) sites using the Neighbor-net algorithm for 528 E. coli O157 strains. The
ellipses mark clades supported in the minimum evolution phylogeny. The
numbers at the nodes denote the SNP genotypes (SGs) 1—39, and the white
circle nodes contain two SGs that match at the 48 Pl sites. The seven SGs found

among multiple continents are marked with squares (88).

29

ilormallve
s. The
The

a while

865 found

I.

Clade 2 4

   
 

Clade 6
24
26

p distance
0331

 

30

A recent study by Besser et al.(2007) classiﬁed E. coli O157:H7 strains of bovine
(n=80) and clinical (n=282) origin into various genotypes based on the
Stx-encoding bacteriophage insertion sites (14). A greater diversity of Stx-
encoding bacteriophage insertion sites was observed in strains from bovine
sources compared to the strains from clinical sources and these two groups were
classiﬁed into different genotypes based on this method. Subsequently, strains
that were predominant in clinical cases were typed as clinical genotypes whereas
strains that were isolated mostly from bovine sources were considered bovine-
biased genotypes (14). The basis for the variation in prevalence of clinical and

bovine-biased genotypes in human clinical cases is not clear.

31

RATIONALE FOR THIS STUDY

E. coli O157:H7 has to survive a number of environmental stresses during
transmission from the reservoir host, typically cattle, to the human
gastrointestinal tract. Surviving acid stress is a critical component of
transmission, as the typical human stomach pH ranges from 1.5-3.0 (112).
However, E. coli O157:H7 has a greater average level of survival in complex
acidic conditions such as the gastric environment than other groups of EHEC
(10). This superior AR contributes to the low infective dose of E. coli O157:H7.
The GAD system is the most effective AR system in E. coli and GadE is the
central activator of the GAD system (39). Even though the GAD system and
GadE are well characterized in non pathogenic laboratory strains of E. coli, they
remain poorly deﬁned in E. coli O157:H7. It is possible that a chromosomal
regulator, such as GadE, has acquired additional functions in O157:H7 to
integrate the mobile virulence genes acquired during its evolution into the
chromosomal regulatory network. In order to successfully colonize the host,
pathogenic E. coli must conserve energy by orchestrating their gene expression
proﬁles in such a way that only necessary genes are expressed at each step of
the infection process. It is possible that during passage through the human
stomach, E. coli O157:H7 down-regulates the virulence mechanisms needed for
later life in colon to conserve energy and activates the AR mechanisms to survive
the extreme acidic pH, thus leading to a negative interaction between AR and
virulence. However, the effect of acidic pH on virulence factors such as the locus

of enterocyte effacement (LEE) in E. coli O157:H7 has not been investigated.

32

Based on the insertion sites of Shiga toxin-encoding bacteriophages, E.
coli O157:H7 strains isolated from cattle and human sources are classiﬁed into
clinical and bovine-biased genotypes (14). Clinical genotypes are isolated from
both cattle and humans and have been shown to be associated with human
disease whereas bovine-biased genotypes are isolated mostly from bovine
sources (14). The varying infectivity of clinical and bovine-biased genotypes
could be due to the differences in expression of vimlence and stress ﬁtness-
associated genes. This proposal aims to investigate the relationship between AR
and virulence of E. coli O157:H7 and to understand whether differences in
expression of virulence and stress ﬁtness-associated genes can explain the
variation in infectivity of bovine-biased and clinical genotypes, with the following

speciﬁc aims:

Speciﬁc Aim 1: To elucidate the role of GadE in acid resistance and virulence of
E. coli O157:H7.
Hypothesis: GadE regulates the expression of the GAD system and LEE
pathogenicity island in E. coli O157:H7, thus contributing to its acid resistance

and virulence.

Specific Aim 2: To determine the effect of acidic pH on the expression of the

LEE pathogenicity island and to understand the role of GAD system regulators in

this effect.

33

Hypothesis: Acidic pH upregulates the expression of GAD system regulators,

which in turn repress the expression of LEE genes.

Specific Aim 3: To determine whether the differences in infectivity of clinical and
bovine-biased genotypes of E. coli O157:H7 is due to the differential expression
of virulence and stress ﬁtness associated genes.

Hypothesis: Virulence and stress ﬁtness associated genes are differentially

expressed between clinical and bovine-biased genotypes of E. coli O157:H7.

Chapter 2 describes the ﬁndings of speciﬁc aim 1 and parts of results from
speciﬁc aim 2. Chapter 3 is a follow up to chapter 2 that describes remaining
results from speciﬁc aim 2 and chapter 4 describes results from speciﬁc aim 3.

Summary of this study and future directions are described in chapter 5.

34

CHAPTER 2

Characterization of the Escherichia coli O157:H7 Sakai GadE regulon

Kailasan Vanaja, 8., T. M. Bergholz, and T. S. Whittam. 2009. Characterization of the

Escherichia coli O157:H7 Sakai GadE regulon. Journal of Bacteriology 191:1868—77

35

SUMMARY

Integrating laterally acquired virulence genes into the backbone regulatory
network is important for the pathogenesis of Escherichia coli O157:H7, which has
captured many virulence genes through horizontal transfer during evolution.
GadE is an essential transcriptional activator of the glutamate decarboxylase
(GAD) system, the most efﬁcient acid resistance (AR) mechanism in E. coli. The
full contribution of GadE to the AR and virulence of E. coli O157:H7 remains
largely unknown. We inactivated gadE in E. coli O157:H7 Sakai and compared
global transcription proﬁles of mutant with that of wild type in exponential and
stationary phases of growth. Inactivation of gadE signiﬁcantly altered the
expression of 60 genes independent of growth phase and 122 genes in a growth
phase-dependent manner. Inactivation of gadE markedly down-regulated the
expression of gadA, gadB, gadC and many acid ﬁtness island genes. Nineteen
genes encoded on the locus of enterocyte effacement (LEE), including Ier,
showed a signiﬁcant increase in expression upon gadE inactivation. Inactivation
of Ier in AgadE reversed the effect of gadE deletion on LEE expression,
indicating that Ler is necessary for LEE repression by GadE. GadE is also
involved in down-regulation of LEE expression at moderately acidic pH.
Characterization of AR of AgadE revealed that GadE is indispensable for a
functional GAD system and for survival of E. coli O157:H7 in a simulated gastric
environment. Altogether, these data indicate that GadE is critical for AR of E. coli
O157:H7 and that it plays an important role in vimlence by down-regulating

expression of LEE.

36

INTRODUCTION

Escherichia coli O157:H7 is the prevalent variant of enterohemorrhagic E.
coli (EHEC) associated with hemorrhagic enteritis and hemolytic uremic
syndrome (HUS) in humans in the United States (3, 67). E. coli O157:H7 has to
survive a number of environmental stresses during transmission from cows to
humans. Surviving acid stress is critical during transmission, as the typical
human stomach pH ranges from 1.5-3.0 (112). E. coli strains are more AR than
other enteric pathogens and this AR is considered a vinilence factor in E. coli
O157:H7 as it contributes to the low infective dose (23, 112). E. coli have four
distinct AR mechanisms, the oxidative (OXI) system, glutamate decarboxylase
(GAD) system, arginine decarboxylase (ARG) system and lysine decarboxylase
(LYS) system (39, 85) that are phenotypically distinct and provide protection
against low pH dependent on the type of acidic environment encountered (119).
In addition to the deﬁned mechanisms, other factors of the general stress
response, including the stress response sigma factor RpoS and the DNA binding
protein Dps, also contribute to the AR of E. coli (28, 169).

The GAD system is the most effective system in protecting E. coli cells
against low pH compared to other known AR mechanisms (23, 24, 75, 161 ). The
GAD system has three components, two GAD isozymes, GadA and GadB, and
the GABA-glutamate antiporter, GadC (39, 84). The gadA is a member of the
acid ﬁtness island (AFI), which is located at 78 min, whereas gadB and gadC

form a separate operon located at 33 min in the E. coli K12 chromosome (55, 91,

37

140). Environmental signals that induce the GAD system include entry into
stationary phase and acidic pH (84).

Regulation of the GAD system is complex, involving multiple regulatory
circuits that inﬂuence the expression of GAD components through the central
activator, GadE (39). GadE, a LuxR family regulator, is transcribed as two
transcripts of sizes 0.68 kb and 1.06 kb and its secondary structure contains a
potential helix-tum-helix DNA-binding domain (54, 84). However, a recent study
demonstrated that GadE is possibly transcribed as three transcripts of sizes 0.9
kb, 1.1 kb and 1.38 kb (J. W. Foster and A. Sayed, presented at the 108'h
General Meeting of American Society of Microbiology, Boston, MA, 1 to 5 June,
2008). GadE binds to a conserved 20 bp GAD box sequence upstream of gadA
and gadBC in E. coli K12 and activates the transcription of these genes (22, 54,
84). Although the GAD system and GadE are well-characterized in E. coli K12,
they remain pooriy deﬁned in E. coli O157:H7.

A study from our lab demonstrated that E. coli O157:H7 strains have a
greater average level of survival in complex acidic conditions, such as a
simulated gastric environment, compared to other serogroups of EHEC (11).
O157:H7 also expresses higher transcript levels of gadA and gadB genes than
other EHEC strains in minimal medium containing glucose (11). Also, we
recently showed that gadA and gadB sequences remain divergent in E. coli
O157:H7 compared to other E. coli strains (8). Taken together, these ﬁndings
suggest that the regulation and function of the GAD system may be distinct in E.
coli 01 57: H7.

38

Genome sequence comparisons revealed that the O157:H7 Sakai strain
has approximately 1650 O157-speciﬁc loci compared to E. coli K12 (47).
Through evolution, the 0157 population has acquired many mobile elements
such as Iambdoid phages carrying virulence and ﬁtness islands (121, 171 ).
Some of the important virulence factors of E. coli O157:H7, including Shiga
toxins and the LEE, are encoded by horizontally transferred phage elements
(78). The LEE, which is encoded on an acquired pathogenicity island, encodes a
type three secretion system that mediates intimate adherence of bacteria to the
intestinal mucosa through formation of attaching and effacing (AE) lesions (93).
Integrating these acquired elements into the chromosomal regulatory network is
critical for a pathogen to be successful (1). An example of this is one of the GAD
system regulators, GadX, which has been shown to inﬂuence the expression of
the LEE (138). Hence, it is possible that a chromosomal regulator such as GadE
has acquired additional functions, though the effects of the GadE regulator on a
genome-wide scale are still unknown for E. coli O157:H7. Comparison of GadE
amino acid sequences among pathogenic and non pathogenic E. coli strains
revealed no signiﬁcant divergence. Recently, a study by Tatsuno et al., found
that inactivation of gadE increases the expression of many LEE genes in
O157:H7 (156). However, gadE inactivation did not affect the expression of the
LEE encoded regulator, Ier, and hence the pathway through which this LEE
down-regulation occurs was not identiﬁed. Recently, Ler was found to negatively
regulate expression of gadE and it was suggested that there is a reciprocal

negative interaction between Ler and the GadE regulators (1).

39

The objectives of this study were to identify the genes regulated by GadE
in E. coli O157:H7 and to gain insight into the mechanism underlying the
negative regulation of the LEE by GadE. By comparing whole genome
transcription proﬁles of E. coli O157:H7 Sakai and isogenic AgadE, we found that
gadE positively inﬂuences expression of the GAD system genes and other AF l
genes, whereas it negatively impacts the expression of the LEE genes, including
Ier. Expression of gadE was markedly increased in stationary phase, thereby
affecting the expression of numerous genes in a growth phase-dependent
manner. In addition, we also demonstrate that a functional Ler is necessary for
the down-regulation of LEE by GadE. Characterization of the AR phenotype of
AgadE revealed that GadE is indispensable for a functional GAD system and for

survival of E. coli O157:H7 in a simulated gastric environment.

40

MATERIALS AND METHODS

Bacterial strains and growth conditions. Bacterial strains and plasmids
used in this study are summarized in Table 2.1. All strains were stored at -70°C
in LB broth containing 10% glycerol, inoculated into 10 ml LB broth, and grown to
an 00600 of ~01 to recover cells. To minimize the confounding effect of acidic
pH that would develop in stationary phase of growth in un-buffered medium, the
strains were grown in MOPS minimal medium buffered to pH 7.4. Cells
recovered in LB were then grown twice to stationary phase in MOPS-buffered
minimal medium before a ﬁnal transfer at 1:30 dilution into 100 ml MOPS
medium for RNA isolation and model stomach assay (12).

Genetic manipulations. E. coli O157:H7 Sakai AgadE and Aler strains
were constructed by the modiﬁed one-step gene inactivation method for EHEC
developed by Murphy et al (32, 98). Brieﬂy, recombinant PCR products
containing a kanamycin (Km) resistance marker ﬂanked by 4550 bp sequences
homologous to the upstream and downstream regions of target genes were
generated using the primers listed in Table 2.2 from plasmid pKD4 (32). PCR
products were electroporated into red recombinase-producing E. coli O157:H7
(TW15901) as described (98) and the transfon'nants were identiﬁed on LB agar
plates with 25 pg/ml Km at 37°C. The Km resistance marker was removed from
the AgadE by introducing plasmid pCP20 that encodes FLP recombinase (32).
Subsequently, the double mutant, AgadEA/er was constructed by one step

inactivation of Ier in AgadE using the method described above.

41

TABLE 2.1

Bacterial strains and plasmids used in this study

 

 

Strain or Genotype Reference or

plasmid Source

Strains

TW08264 E. coli O157:H7 RIMD0509952 (Sakai) wild (96)
type

TW15901 TW08264 harboring pKM208 plasmid This study

TW15902 A gadE This study

TW15903 AgadEA/ertsz This study

TW15904 Aler.:Km This study

TW15905 AgadE/pCR2.1gadE This study

Plasmids

pKM208 Red recombinase expression plasmid, Apr (32)

pKD4 Template plasmid for lambda Red (32)
recombination system, Kmr

pCP20 Flp recombinase expression plasmid, Cmr (32)

pCR2.1 Cloning vector lnvitrogen

pCR2.1gadE gadE cloned into pCR2.1 This study

 

42

TABLE 2.2

Oligonucleotide primers used for one step inactivation

 

Primer“ Sequence (5’ to 3’)b

 

gadE-H-F ATCAATTCCCTGTCAGAGATCAAAAAAGTAGGCAATAAACCCTTCAAGG

Tgtgtaggctggagctgcttc

gadE-H-R CTCGTCATGCCAGCCATCAATTI'CAG'ITGCT'I'ATGTCCTGACTAAAAATA

catatgaatatcctccttag

Ier-H-F" T'ITCATCTI'CCAGCTCAGTTATCGTTATCAT'ITAA'ITATTI'CATthgtaggct

ggagctgcttc

Ier-H-R* GTTGGTCCTTCCTGATAAGGTCGCTAATAGCTTAAAATA'ITAAAGcatatga

atatcctccttag

 

aThe homology regions for the Ier primers are from lyoda et al., (60)

b Priming sites for pKD4 are in lowercase letters

43

For complementation of the AgadE strain, DNA fragments of 2,630 bp
containing the Sakai gadE coding region and additional ﬂanking regions of gadE
were ampliﬁed from E. coli O157:H7 Sakai chromosomal DNA using TaKaRa LA
TaqT" polymerase (Takara Bio USA, Madison, WI). The resulting PCR products
were cloned into pCR®2.1-TOPO® vector (lnvitrogen, Carlsbad, CA) to make
pCR2.1gadE plasmid, which was transformed into the AgadE strain creating the
AgadE/pCR2.1gadE strain.

RNA isolation and cDNA labeling. For RNA isolation, the wild type
Sakai and AgadE strains were grown to early exponential phase (2.25 h, ODeoo
~0.25) and stationary phase (5.5 h, ODsoo ~1.5) in MOPS medium as described
above. RNA was isolated from ﬁve independent cultures using hot acid-
phenolzchloroform extraction. At each growth phase, 5 ml of culture was mixed
with equal volume of hot acid-phenolzchloroforrn (pH 4.5 with Iso Amyl Alcohol
(IAA), 125:2521) (Ambion, Austin, TX) and incubated at 65°C with periodic
shaking for 10 min. The samples were centrifuged at 3220 x g for 20 min and
the supernatant was subjected to further extractions with phenolzchlorofomi and
chloroform:lAA (12). RNA was precipitated overnight at -70°C in 2.5 volume
100% ethanol and 1/10 volume 3 M sodium acetate pH 5.2. RNA puriﬁcation
and DNase treatment of RNA samples were done with the RNeasy kit (Qiagen,
Valencia, CA) and RNA quality was assessed on a fonnaldehyde-agarose gel.

Six pg of RNA was used for reverse transcription reactions containing 3
pg random primers (lnvitrogen), 1x ﬁrst strand buffer (lnvitrogen), 10 mM DTT,

400 U Superscript II (lnvitrogen), 0.5 mM of dATP, dCTP and dGTP, 0.3 mM

44

d‘I‘l'P and 0.2 mM amino-allyl dUTP (12). After incubation at 42°C overnight, the
cDNAs were puriﬁed with Qiagen PCR clean up columns with phosphate wash
buffer (5 mM K2HPO4, pH 8.0, 80% ethyl alcohol) and phosphate elution buffer (4
mM K2HPO4, pH 8.5) and were coupled with either Cy3 or Cy5 dyes (Amersham
Biosciences, Piscataway, NJ) as described previously (12).

cDNA hybridizations. Hybridizations were performed according to a loop
design, which included between strain (wild type vs. mutant at same growth
phase) and within strain (same strain at two growth phases) comparisons. Five
biological replicates were included for each comparison resulting in 20 arrays. As
described (12), the cDNAs were hybridized onto microarray slides printed with
6088 ORFs including 110 ORFs from pO157 plasmid, and representing E. coli
strains K12, EDL933 and Sakai. Arrays were scanned with an Axon 4000b
scanner (Molecular Devices, Sunnyvale, CA) followed by image analysis using
GenePix 6.0 (Molecular Devices) (12).

Data analysis. The microarray data were analyzed using R (v. 2.2.1) and
the MAANOVA (v. 0.98.8) package. Raw intensity values from replicate probes
were averaged and logz transformed after normalization with the pin-tip LOWESS
method. The normalized intensity values were ﬁtted to a mixed model ANOVA
considering array and biological replicates as random factors and dye, strain and
growth phase as ﬁxed factors (30). The linear model tested was Y (intensity) =
array + dye + strain (wild type or mutant) + growth phase (exponential or
stationary) + strain*growth phase + sample (biological replicate) + error. Each

main effect had 2 levels: mutant and wild type for strain and exponential and

45

stationary phases for growth phase. The design included between and within
strain comparisons using 5 biological replicates. Signiﬁcant differences in
expression due to strain, growth phase and strain*growth phase were determined
using the Fs test in MAANOVA, which uses a shrinkage estimator for gene-
speciﬁc variance components that makes no assumption about the variances
across genes (31) with 500 random permutations to estimate the p-values.
ANOVA with a mixed linear models have been used to analyze microarray
experiments with repeated measures where transcript levels of the strains at two
different growth phases are measured (6, 63, 80). The q-value package in R was
used for determining the false discovery rate (FDR) (146).

Overrepresentation of gene sets with a common biological function in the
wild type or mutant strain were determined using the GSEA Preranked analysis
in Gene Set Enrichment Analysis (GSEA v2.0) program (Broad Institute,
Massachusetts Institute of Technology) (148). The gene sets were designated
based on the TIGR annotation for the Sakai genome (http:l/cmr.jcvi.org/tigr-
scripts/CMR/GenomePage.cgi?org=ntec03). Additionally, two gene sets, the
LEE and the AFI and GAD, also were included in the analysis (33, 41, 91, 158).
The pattern search tool in coIrBASE
(http://xbase.bham.ac.uk/colibase/pattem.pl?id;1073) was used to identify GAD
box (22, 85) sequences (5'-'I'l'AGGA'l‘I'I"I'G'l"l'AT'I'I'AAA-3') in the putative
promoter regions of genes differentially regulated between wild type and AgadE.
A cut off of 70% similarity to the query sequence was set to apply higher

stringency because experimental conﬁrmation of GadE binding was not

46

conducted. A sequence logo for the consensus sequence was created at
http://weblogo.berkeley.edu/logo.cqi.

Quantitative real-time PCR. RNA isolations were conducted at both
exponential and stationary phases of growth. For assays with
AgadE/pCR2.1gadE, AgadEA/er and AIer, RNA was isolated only at the
exponential phase. Taqman assays (11) were used for quantifying the
expression of gadA, gadB and Ier with mdh as reference for normalization. For
the remaining genes, SYBR green chemistry was used for measuring expression
levels. Primers were designed using the Primer3 server (125) based on the
published reference genome sequence of E. coli O157:H7 strain Sakai (Table
2.83 in appendix). cDNA synthesis was conducted using iScript Select cDNA
synthesis kit (BioRad, Hercules, CA) with 1 pg of total RNA according to the
manufacturer’s instructions. After reverse transcription, 5-fold serial cDNA
dilutions were used for Q-PCR assays containing 12.5 pl 2x i0 SYBR green
supermix (BioRad), 0.63 pl of each primer (10 pM stock), 9.24 pl of H20 and 2 pl
cDNA with cycle conditions of 95°C for 2 min followed by 40 cycles of 10 sec at
95°C and then 20 sec at the speciﬁc annealing temperature (12). The
expression levels of the 168 rRNA gene were used for normalization of data and
the relative expression levels were quantiﬁed using Pfafﬂ’s method (113). The
results presented are averages from at least three biological replicates :l:
standard error of mean (SEM).

Expression studies in E6 minimal medium. Wild type and AgadE cells

were grown in EG minimal medium at pH 7.0 and pH 5.0 (83) to late exponential

47

phase (ODeoo ~0.5). RNA extractions were conducted using a modiﬁed hot-
phenol extraction protocol (15) that utilized 5% acidic phenol in ethanol. cDNA
synthesis and Q-PCR methods are described above.

AR mechanism assays. AR mechanism assays for the GAD, ARG and
OXI systems were conducted as described previously (75, 83). Brieﬂy, for the
GAD system, strains grown in LB broth with 0.4% glucose (LBG) were
challenged at pH 2.0 in a test environment (EG + glutamate) and in a control
environment (EG), whereas for the ARG system, after growth in BHI broth with
0.6% glucose, strains were tested in test (EG + arginine) and control (EG)
environments at pH 2.5. For testing the OXI system, strains were grown in
LBMES (pH 5.0) and EG (pH 7.0) and challenged at pH 2.5 in EG. Samples
were withdrawn at speciﬁc time points (30 min or 1 h intervals) and plated on LB
agar plates using an Autoplate 4000 Spiral Plater (Spiral Biotech, Bethesda,
MD). Colonies were counted after overnight incubation at 37°C using the 0-
Count (Spiral Biotech). Assays were conducted for at least two biological
replicates, each with two technical replicates. CFU/ml from technical replicates
were averaged and converted to log10 CFU/ml. The results reported are
averages 21: SEM for at least three experiments.

Model stomach assay. The model stomach system (M88) (64) was
prepared as described previously (11). Gerber Turkey Rice Dinner© baby food
(30 g) was mixed with 120 ml of synthetic gastric ﬂuid (pH 1.75) yielding a ﬁnal
acidity of pH 2.5. Contents of the M88 were stomached for 30 sec, sampled,

diluted, and plated onto LB agar plates every 30 min for 1.5 h to enumerate

48

viable cells. CFU/ml from duplicate plates were averaged and converted to log10
CFU/ml. The results reported are averages 1: SEM for three experiments.
Microarray data accession. Microarray data are available at NCBI GEO

(httpzllwww.ncbi.nlm.nih.qov/geo), accession number GSE13132.

49

RESULTS

Identification of genes regulated by GadE. Inactivation of gadE did not
cause a signiﬁcant difference in the growth rate of E. coli O157:H7; the
generation time of wild type was 43.7 min and that of AgadE was 44.1 min. A
two-factor ANOVA with two main effects (strain and growth phase) and the
interaction effect (strain*growth phase) was used to determine the impact of
gadE inactivation on the transcriptome of E. coli O157:H7 at both exponential
and stationary phase. Genes with FDR < 0.1 for strain effect and FDR < 0.05 for
interaction effect were considered as regulated by GadE. Signiﬁcant strain
effects were identiﬁed for 60 genes, indicating differential expression between
the wild type and AgadE (FDR < 0.1) (Table 2.81 in appendix). Of these, 58
genes had higher transcript levels in AgadE demonstrating that GadE has a
negative inﬂuence on their transcription, and 2 genes had lower transcript levels
in AgadE, indicating that GadE has a positive inﬂuence on their transcription.
Among the 2 genes with lower transcript levels in AgadE, ECs3904 had
signiﬁcantly greater transcript levels in exponential phase compared to stationary
phase, and ECs2294 had greater levels in stationary phase. Among the 58
genes with higher transcript levels in AgadE, 33 were signiﬁcantly higher in
exponential phase, including LEE genes tir, espF and cesT, and 25 were higher
in stationary phase, including genes vgrE, iIvG, and treR (Table 2.81 in
appendix). A signiﬁcant interaction effect, which indicates that inactivation of
gadE affects expression of genes differently at each growth phase, was identiﬁed

for 122 genes, including the AFI and GAD genes gadA, gadB and gadC (FDR <

50

 

0.05) (Table 2.82 in appendix). GSEA analysis identiﬁed signiﬁcant enrichment
of the AFI and GAD genes (FDR < 0.05) in wild type and LEE genes (FDR <
0.05) in AgadE. In summary, the array data demonstrated that inactivation of
gadE had an effect on several genes, including members of the LEE
pathogenicity island, in addition to the GAD and AF I genes.

Interaction effects of gadE inactivation and growth phase.
Expression of gadE was 84.2 t 13.4-fold higher in stationary phase compared to
exponential phase in wild type as measured by Q-PCR. Since the expression of
gadE is growth phase-dependent, it affected the expression of 122 genes in a
growth phase-dependent manner leading to a signiﬁcant interaction effect (FDR
<0.05) (Table 2.82 in appendix). Genes with a signiﬁcant interaction effect
included several genes belonging to the AFI and GAD system, as well as a
number of genes involved in energy metabolism and genes encoding
transcriptional regulators. In exponential phase, GadE exhibited a positive effect
on transcript levels of genes such as cyoDC, sdhCDAB, and sucAB involved in
energy metabolism, while in stationary phase, GadE exhibited a negative effect
on transcript levels of these genes (Table 2.82 in appendix). Transcript levels of
genes encoding sigma factors and transcriptional regulators such as rpoS, IysR,
and pspF were slightly elevated in AgadE in exponential phase, but were 1.3- to
2.9-fold higher in the wild type compared to AgadE in stationary phase, indicating
that these genes are positively regulated by GadE at stationary phase (Table

2.82 in appendix).

51

Putative GadE binding site upstream of GadE regulated genes. To
determine whether differentially expressed genes identiﬁed by the microarray
analysis are regulated directly by GadE, a pattern search against the E. coli
O157:H7 Sakai genome was conducted in coerASE to identify potential GAD
boxes upstream of these genes. A conserved GAD box sequence described
previously in E. coli K12 (22, 85) was used for the pattern search. Typically one
GAD box is observed upstream of GadE regulated genes, gadA and gadBC, in
E. coli K12 (22). Sequences with 270% similarity to the query sequence were
considered as putative binding sites of GadE. Matching sequences were
detected upstream of 8 genes that were signiﬁcantly differentially expressed in
AgadE. As expected, GAD box sequences preceding gadA and gadB showed
100% similarity to the conserved sequence in E. coli K12. There were two
putative GadE binding regions identiﬁed upstream of hdeD. Matching sequences
also were identiﬁed in the upstream regions of vgrE and 3 LEE genes (sepZ,
9300, and Ier) (Fig. 2.1).

Expression of AFI and GAD genes in AgadE. Inactivation of gadE
resulted in a decrease in expression of many of the AFI and GAD genes and the
magnitude of decrease was dependent on the growth phase. Six AFI and GAD
genes, including gadA, gadBC and hdeBAD had a signiﬁcant interaction effect
(Table 2.3). These results were veriﬁed with Q-PCR. At exponential phase, for
gadA, gadB, gadC, hdeA and hdeB, microarray data revealed higher expression
in the mutant, whereas Q-PCR detected higher expression in wild type. This

discrepancy could be due to the negligible expression of these genes at

52

 

Gene % identity Sequence

 

gadA 100 TTAGGATI'I'I‘GTTAT'ITAAA
gadB 100 TI‘AGGATTI‘TG’ITA'ITI‘AAA
pspF 7o TI‘ATCTT'I’ITGATTTATAAA
hdeD1* 75 'ITAGGAAATI'I‘TTATTAAAT
hdeDz * 7o ATCAGATA’I'I'ITI‘AT'ITCAA
vgrE 7o TGA'I‘TA'I'ITTGTTGACTAAA
sepZ 7o GGATAA'I'ITGG'ITATTTATA
escC 7o ”I'I‘CGACTCT'I'I‘TTAA'I'I‘AAA
Ier 7o ATATGATTITI'I'TGTI‘GACA

 

 

M iiilanAA

Figure 2.1. Alignment of putative GAD box sequences. Sequences upstream of 8
gadE- regulated genes with greater than 70% identity to the conserved GAD box
sequence were identiﬁed by the pattern search tool in coIrBASE. Letters in
boldface in the table are unmatched bases. Asterisks indicate the two matching

sequences found upstream of hdeD.

53

TABLE 2.3
Effect of gadE inactivation on expression of AFI and GAD genes in exponential

and stationary phase

 

 

 

Exponential phase Stationary phase
expression ratio expression ratio (WT/
(wrr AgadE) AgadE )
ECS :1 Micro Micro
number Gene Function
array QPCRb array QPCRb
E03 4389 M98 Periplasmic 0.6 5.2120 2.8 31.411.5
chaperone
ECs 4390 hdeA Protection from 0.3 3.2103 11.1 39.3130
organic acid
metabolites
E05 4391 hdeD Acid resistance at 0.6 2.5
high cell densities
ECs 4397 gadA Glutamate 0.4 2210.8 6.4 46.3113]
decarboxylase
isozyme
E03 2097 gadC* Glutamate-GABA 0.5 2310.5 4.1 1610.9
antiporter
ECs 2098 gadB* Glutamate 0.4 2211.5 8.0 22.511.67
decarboxylase
isozyme

 

3 Genes marked with an asterisk are GAD system genes not encoded in AF I,
genes in bold face have putative GAD boxes upstream of their sequence.

° Fold change1SEM as determined by Q-PCR

54

exponential phase in minimal medium at neutral pH (84). It has been shown that
microarrays are less sensitive than Q-PCR in detecting changes in expression
when the transcript levels are low (21 ). At stationary phase, Q-PCR supported
the
microarray results for these 5 genes, though a greater difference was detected in
transcript levels compared to the microarray (Table 2.3). This underestimation of
fold changes by microarrays has been reported in many of the previous studies
(27, 174). The fold increase in expression of gadA and gadB in wild type
compared to AgadE was approximately 10-20 times higher at stationary phase
than at exponential phase. Similarly, the increase in expression of hdeAB in wild
type was 6-12 times higher at stationary phase than at exponential phase (Table
2.3). In summary, both microarray and QPCR data demonstrated that the
difference in expression of AFI and GAD genes between wild type and AgadE
was minimal at exponential phase whereas at stationary phase there was a
marked decrease in expression of gadABC and hdeAB in the mutant. Moreover,
in the wild type, the expression of AFI and GAD genes increased markedly from
exponential to stationary phase whereas in the AgadE their expression
decreased minimally or remained unchanged as the cells entered stationary
phase. This demonstrates that inactivation of gadE abrogates the growth phase
regulation of AFI and GAD genes in E. coli O157:H7.

Six AF I genes did not show differential expression between the mutant
and wild type, including two AraC-Iike regulators of the GAD system, gadX and

gadW. A signiﬁcant increase in expression of multi drug resistance-related efﬂux

55

pump gene, yhiU, was observed in the mutant (Table 2.81 in appendix).
Consistent with previous observations (12), all of the AFI and GAD genes had
signiﬁcantly higher expression at stationary phase than at exponential phase.
GSEA analysis conﬁrmed the enrichment of the gene set representing AF I and
GAD genes in the wild type.

GadE represses expression of LEE. Inactivation of gadE signiﬁcantly
elevated the expression of 19 LEE genes independent of the growth phase,
among which 8 genes showed 21.35-fold increase in expression in the mutant
(Table 4). Fold changes in expression between mutant and wild type detected by
microarray and Q-PCR were highly correlated for the LEE genes (Table 2.4).
Contrary to previous ﬁndings (156), the LEE encoded regulator, Ier, was up-
regulated by 2.2-fold in the mutant as determined by Q-PCR (1 .35-fold in the
microarray). Other LEE genes such as fir and espD were up—regulated by 1.8-
and 1.6-fold, respectively (microarray detected 1.4-fold for both) (Table 2.4).
Most of the LEE genes with signiﬁcant differential expression between AgadE
and the wild type also had higher expression in exponential phase compared to
stationary phase. Six LEE genes, including sepZ (espZ), had higher expression
at stationary phase and sepZ showed a 1.4-fold (1 .36-fold in microarray)
increase in expression in the mutant. Two non-LEE encoded effectors, nIeGZ-2
and nIeG2-3, also had signiﬁcant increase in expression in the mutant at
stationary phase. In the array data, eae, espA and espB were not signiﬁcantly

up-regulated, whereas Q-PCR identiﬁed an Increase in expression of 1.3-1.6-fold

56

TABLE 2.4

LEE genes signiﬁcantly up-regulated in AgadE (FDR<0.1)

 

 

ECs Genea Function Micro Q-PCR Microarray
number array ( (AgadE/ (Stationary/
AgadE WT) b Exponential)
NVT) C
ECs 4550 espF type III secretion 1.30 1.34100 0.6
system, secreted 8
effector
E05 4553 cesD2 type III secretion 1.36 0.5
system chaperone
E05 4554 espB* type III secretion 1.20 13810.0
system, secreted 9
translocator
ECs 4555 espD type III secretion 1.38 1.63100
system, secreted 4
translocator
E05 4555 espA" type III secretion 1.10 1.58102
system, secreted
translocator
ECs 4558 9300 type III secretion 1.18 1.3
system, structural
protein
ECs 4558 eae’ gamma intimin 1.20 1.3101
ECs 4560 cesT type III secretion 1.38 0.3
system,
chaperone
E03 4561 tir translocated 1.39 18410.0 0.5
intimin receptor 6
protein
ECs 4562 map type III secretion 1.26
system, secreted
effector
ECs 4563 cesF type III secretion 1.31 1.6
system,
chaperone
E05 4564 espH type III secretion 1.33 3.1
system, secreted
effector
ECs 4565 sepQ type III secretion 1.27 2.9

system, structural
protein

 

57

 

Table 2.4 continued...

 

E05 4567 orf15 orf of unknown 1.19 0.9
function

ECs 4571 sepZ type III secretion 1.36 1.44100 6.4
system, secreted 6
effector

ECs 4572 rorf8 orf of unknown 1.26 3.0
function

ECs 4575 escC type III secretion 1.21 0.3
system, structural
protein

E03 4584 orf5 orf of unknown 1.34 0.5
function

E05 4585 orf4 orf of unknown 1.41 0.6
function

E03 4586 orf3 orf of unknown 1.37 0.6
function

ECs 4587 cesAB type III secretion 1.35 0.6
system,
chaperone

ECs 4588 Ier type III secretion 1.35 2.23102 0.8
system, regulator 6

E05 4590 espG type III secretion 1.27 0.6
system, secreted
effector

ECs 1994 nIeGZ-Z non LEE-encoded 1.26 2.5
effector

ECs 2156 nIeGZ-3 non LEE-encoded 1.28 2.9
effector

8 Genes underlined are non LEE-encoded effectors and genes with asterisks are not

signiﬁcant in microarray, but detected as up-regulated by Q-PCR. Genes in bold face

have putative GAD boxes upstream of their sequence.

b Exponential phase fold change1SEM as determined by Q-PCR

c Ratios are reported only for genes with a signiﬁcant growth phase effect (FDR<005)

58

in the mutant, similar to other signiﬁcant LEE genes (Table 2.4). Signiﬁcant
enrichment of the LEE gene set in AgadE was detected by GSEA. To further
conﬁrm the negative inﬂuence of GadE on LEE expression, exponential phase
transcript levels of select LEE genes were measured in the complement strain,
AgadE/pCR2.1gadE, which over-expresses gadE. Expression of Ier decreased
by 6-fold in the complement, whereas espD and sepZ decreased by 9.9- and 9.5-
fold, respectively. Altogether, these data demonstrate that GadE is a repressor
of LEE genes, including Ier, in E. coli O157:H7.

Repression of LEE by GadE is mediated through Ler. Expression data
from AgadE and gadE-over expressing strains demonstrated that GadE
negatively regulates the expression of Ier. Moreover, a pattern search in
coIrBASE to ﬁnd GAD box sequences in the LEE island region revealed a
putative GAD box upstream of Ier (-199 to -180bp) with 6 mismatches (70%
identity). To determine whether repression of LEE genes by GadE is mediated
by Ler, we inactivated Ier in both the AgadE and wild type strains and compared
the expression of select LEE genes. If GadE down-regulates LEE expression
independent of Ier, then an increase in expression of LEE genes in the double
mutant, AgadEA/er, similar to AgadE was expected. In this study, however,
expression of tir, sepZ, espA, espB and espD decreased by 11.6-, 20.1 -, 38.2-,
17.9- and 33.4—fold, respectively in AgadEA/er (Fig. 2.2). A similar decrease in
LEE expression was observed in Mar. These data demonstrate that the positive
effect of gadE inactivation on LEE expression is reversed by Ier inactivation,

suggesting that Ier is essential for the repression of LEE by GadE.

59

 

 

 

 

 

 

 

Fold change in expression

 

 

'50 T ﬁ j I I T
tir sepZ espA espB espD Ier

 

Gene

Figure 2.2. Exponential phase expression of LEE genes, tir, sepZ. espA, espB,
espD and Ier in AgadE (grey bars), AgadEA/en:Km (black bars) and Aleme
(white bars) compared to the wild type. Results shown are average fold change
in expression measured by QPCR with standard error of mean (SEM) from at

least three biological replicates.

6O

Effect of acidic pH on expression of LEE genes. To determine the
inﬂuence of acidic pH on expression of the LEE genes, wild type and AgadE
cultures were grown to exponential phase (0D600~0.5) in EG minimal medium
adjusted to pH 7.0 (control) and pH 5.0 (moderately acidic) for comparing gadE
and LEE expression. Growth in EG pH 5.0 resulted in a 34-fold increase in the
wild type expression of gadE. Expression of three LEE genes, Ier, espD and
sepZ, was down-regulated in EC pH 5.0 compared to EG pH 7.0 in the wild type
(Table 2.5). To determine if the down-regulation of LEE genes in response to
moderate acidity was directed exclusively by GadE, the expression of LEE genes
in AgadE grown in EG pH 5.0 was assessed. There was a 3.9- and 6.5-fold
decrease in expression of espD and sepZ, respectively, in AgadE, however, this
decrease was lower relative to the wild type, where expression of espD and sepZ
decreased by 7.5- and 9.4-fold, respectively. Interestingly, the pattern of Ier
expression at acidic pH was different from the other 2 LEE genes tested. In the
wild type, there was a 6-fold decrease in Ier expression, whereas in AgadE, Ier
expression increased 4.5-fold at pH 5.0 (Table 2.5). Together, these
observations indicate that down-regulation of the major LEE regulator, Ier, is
mediated through GadE in response to moderate acid stress, whereas
repression of other LEE genes under the same conditions involve additional
GadE/Ler-independent factors.

Two regulators that may affect the expression of LEE genes at acidic pH,
independent of GadE and Ler, are GadX and Eng, which have a negative effect

on LEE expression in EPEC (99, 138). Hence, we measured the expression of

61

TABLE 2.5

Effect of pH 5.0 on expression of GAD regulators and LEE genes

 

Fold change in expression

 

 

(pH 5.0/pH7.0)

Gene WT AgadE
gadE 34.4169 no expression
gadX 10412.5 4311.0
eng 2.8103 3.4107

Ier 0.16100 4.5104
espD 0.161006 02610.02
sepZ 01210.04 01710.05

 

62

these regulators in EG pH 7.0 and EG pH 5.0 in wild type and AgadE and
observed a strong induction of both genes in both strainsat pH 5.0. The gadX
gene had > 2-fold higher induction in wild type, whereas eng induction was
similar in both wild type and AgadE (Table 2.5).

Functional GadE is necessary for optimal performance of the 3
principal AR mechanisms in E. coli O157:H7. To functionally conﬁrm the
microarray data, which revealed a marked decrease in expression of GAD and
AFI genes in AgadE, we conducted AR mechanism assays for the GAD, ARG
and 0Xl systems. The ARG and OXI systems were included in the study since
GadE has been shown to inﬂuence their function in E. coli K12 (84). The AgadE
strain could not survive in the test environment for the GAD system (pH 2.0 with
glutamate) even for 30 min, indicating a non-functional GAD system (Fig. 2.3A).
The wild type and complement showed a log reduction of 0.20 1 0.08 and 0.17 1
0.02 CFU/ml, respectively, after 6 h of exposure to the test environment. In the
ARG system test environment (pH 2.5 with arginine), survival of AgadE was
similar to the wild type and complement for up to 2 h. However, at 4 h there was
reduction in viable cell numbers and the mutant showed high variation in cell
numbers up to 5.5 h, and by 6 h, no viable mutants were recovered. The wild
type and complement showed a log reduction of 1.07 1 0.08 and 1.22 1 0.16
CFU/ml, respectively, after 6 h (Fig. 2.3B). The OXI system was less effective in
protecting all three strains compared to the ARG system. The mutant survived
for only 3 h at pH 2.5 and the log reduction in CFU/ml after 4 h was 2.27 1 0.1 for

wild type (Fig. 2.30). Interestingly, the complement also did not survive after 3 h,

63

Figure 2.3 A-C. AR mechanism assays. Survival of wild type (white bars), AgadE
(grey bars) and AgadE/pCR2.1gadE (black bars) strains in the 3 AR systems. (A)
Survival for the GAD system test at pH 2.0 (B) Survival for the ARG system test
at pH 2.5 (0) Survival for the OXI system test at pH 2.5. The results presented

are average CF U/ml with SEM from 3 experiments for each AR system.

64

w

m

 

 

D
.1.

3 as:

N

Fmdo

 

 

 

 

 

 

 

 

 

 

 

 

1
Y

 

 

E 2::

omﬁmmév deo

L

 

 

 

 

 

 

L

 

 

J

 

 

J.

A
Y

 

 

 

 

[\(OIDVC‘ONi—O

NCDIOVOONw—O

3 see

c

 

 

 

 

 

 

 

A
1

 

 

 

NCDlDV'OONv-O

IUJ/ndO 60I

65

indicating that gadE in trans does not reconstitute the phenotype for the OXI
system. It is possible that ﬂooding the cell with multiple copies of gadE, as in the
complement, adversely effected the functioning of OXI system. These ﬁndings
demonstrate that inactivation of gadE abolished the functioning of the GAD
system and rendered ARG and OXI systems less effective in protecting the cells
against low pH.

Survival of AgadE in a simulated gastric environment. Since the 3
principal AR systems were defective in protecting the AgadE from acidic stress in
deﬁned minimal test conditions, the ability of AgadE to survive in a complex
acidic environment was assessed using the M88 (pH 2.5). The wild type and
complemented cells showed an average log reduction of 1.05 1 0.06 and 0.32 1
0.04 CFU/ml, respectively, after 1.5 h in the M88 (Fig. 2.4). Viable cells could
not be recovered from the M88 inoculated with AgadE, which indicates that

functional gadE is necessary for survival in the simulated gastric environment.

66

 

log”) CFU/ml
N U) A LII 0 \l

_.

 

 

 

 

0 30 60 90
Time (min)

Figure 2.4. Survival of wild type (white bars), AgadE (grey bars) and

AgadE/pCR2.1gadE (black bars) strains in M88. The average log CFU/ml with

SEM from 3 experiments is plotted for each time point.

67

DISCUSSION

Although the upstream regulatory circuits and downstream effects of
GadE in non-pathogenic E. coli has been examined (39, 84), little is known about
GadE and its role in AR and virulence among pathogenic E. coli strains. Here,
the role of the GadE regulator in AR and virulence of E. coli O157:H7 was
investigated by constructing an isogenic AgadE strain and comparing its
expression proﬁles with that of the wild type strain. Our ﬁndings demonstrate
that besides being a positive regulator of GAD and many AFI genes, GadE acts
as a negative regulator of the LEE pathogenicity island, an important factor in the
virulence of E. coli O157:H7. GadE, along with additional regulators, is involved
in the down-regulation of LEE expression at moderately acidic pH. In addition,
the characterization of AR phenotypes of AgadE revealed that GadE is
indispensable for a functional GAD system and plays a vital role in the survival of
E. coli O157:H7 in a simulated gastric environment.

In this study, the microarray data demonstrated that inactivation of gadE in
E. coli O157:H7 altered expression of 60 genes independent of growth phase
and 122 genes in a growth phase-dependent manner. The genes with altered
expression included both AR and virulence genes, indicating that the regulatory
function of GadE is not restricted to AR, but has a more global effect on the
transcriptome of E. coli O157:H7. Over-expression of gadE in non-pathogenic E.
coli was shown to affect the expression of ~40 genes, including GAD genes (54).

Most of these genes, however, differed from those identiﬁed following inactivation

68

of gadE in O157:H7, suggesting that apart from its effect on the GAD system,
GadE has additional regulatory functions in E. coli O157:H7.

Expression of gadA, gadB and gadC were not completely abolished in E.
coli O157:H7 AgadE similar to E. coli K12 where minimal expression of GadAB
proteins was observed in AgadE (84). Expression of GAD system components in
the absence of GadE could be induced by the GadX regulator, which has been
shown to bind to and activate gadA and gadBC transcription directly under in
vitro conditions, but not during in vivo growth (132, 159, 162). Another interesting
observation was that at stationary phase, the magnitude of increase in
expression of gadA and gadB in the wild type compared to AgadE were different,
indicating that the inactivation of gadE affects these duplicated genes in distinct
ways. This corroborates the recent ﬁnding that the sequences of gadA and
gadB are divergent in E. coli O157:H7 in contrast to other E. coli strains where
gene conversion events between gadA and gadB have led to genetic
homogenization (8). In contrast to the wild type, no increase in expression of
GAD genes was observed in AgadE as the cells entered stationary phase
demonstrating that GadE is required for the growth phase regulation of GAD
genes.

This study demonstrates that gadE inactivation has differential effects on
the expression of AFI genes in E. coli O157:H7. In non-pathogenic E. coli strains,
gadE induces the expression of AFI genes such as hdeB, hdeA, hdeD, gadX and
thF in addition to gadA (54, 91, 126). In this study, expression of gadA and

hdeBAD showed growth phase-dependent down-regulation in AgadE. However,

69

gadX and yhiF were not differentially expressed in AgadE indicating that at pH
7.0, loss of gadE does not inﬂuence the expression of these two genes in E. coli
O157:H7. These differences between O157:H7 and non pathogenic strains could
also be due to the differences in growth conditions, since strains were grown in
rich or minimal media at acidic pH in most of the previous studies.

The relationship between AR and virulence of pathogenic E. coli,
particularly the interactions between the GAD system and LEE, remains poorly
deﬁned. Few studies in the past have shown that some 'of the GAD system
regulators negatively affect LEE expression (24, 99, 138, 157). In E. coli
O157:H7 Sakai, gadE inactivation was found to increase the expression of LEE
encoded espB, espD and tir genes, but not Ier (156). Hence, Mellies et al.
considered that GadE mediated down-regulation of LEE was independent of Ler
and the pathway through which GadE affects LEE was undetermined (95).
Moreover, the extent to which GadE inhibits the transcription of LEE genes has
not been demonstrated quantitatively before. The data presented here
demonstrate that GadE has a global effect on LEE genes: GadE inﬂuences the
expression of at least 19 LEE encoded genes belonging to all ﬁve LEE operons
and 2 non-LEE encoded effectors. These data also provide insight about the
mechanism underlying GadE-mediated LEE down-regulation. In contrast to the
previous study (156), there was a signiﬁcant increase in the expression of Ier in
AgadE, which may be due to differences in growth medium used. The previous
study used DMEM containing glycerol (156) whereas in this study MOPS minimal

medium was used for growing the cells. This discrepancy could also be due to

70

difference in sensitivity of the assays used (northern blotting vs. QPCR and
microarray). The negative correlation between expression of gadE and Ier was
marked in the gadE-over expressing strain in which Ier expression was
substantially down-regulated. Furthermore, the identiﬁcation of a putative GAD
box sequence upstream of Ier with 70% identity to the conserved GAD box
sequence provides additional evidence of direct regulation, as GadE has been
shown to bind to box sequences with as low as 60% identity to the conserved
sequence (85). Additionally, inactivation of Ier in AgadE led to a marked
decrease in LEE expression, conﬁrming that Ier is essential for the up-regulation
of LEE in AgadE. Taken together, these ﬁndings illustrate that GadE indirectly
down-regulates LEE expression most likely through down-regulation of Ler.
However, additional putative GAD boxes were observed upstream of other LEE
genes, sepZ and escC, also and therefore, it is possible that GadE directly
regulates these LEE genes independent of Ler.

Because GadE negatively inﬂuences LEE expression, we hypothesized
that environmental conditions that induce gadE may down-regulate the
expression of LEE. Two conditions that lead to induction of gadE are entry into
stationary phase and acidic pH (39). Stationary phase expression of LEE genes
has been described previously (12). Similarly, inﬂuence of several environmental
factors such as temperature, bicarbonate ion concentration and membrane
stress on the expression of LEE has been investigated (2, 100, 157, 164).
However, the effect of pH on LEE expression and the factors regulating that

effect in EHEC remain largely unknown. Our experiments demonstrated that

71

exposure to moderately acidic pH strongly induces gadE and has a substantial
negative effect on LEE expression in E. coli O157:H7. This inhibitory effect could
be more profound in extreme acidic conditions such as the gastric environment.
To determine whether the acidic pH-induced down-regulation of LEE is
exclusively regulated by GadE, we measured the expression of LEE genes in the
AgadE following growth at pH 5.0. Except for Ier, a partial down-regulation at
acidic pH was observed in the expression of the LEE genes in AgadE, indicating
that GadE is not the only regulator responsible for the pH induced down-
regulation of LEE. This partial down-regulation of LEE is not mediated through
Ler, as expression of Ier was increased in the AgadE at pH 5.0. To understand
this phenomenon further, we analyzed the expression of other AR regulators that
could act on LEE, independent of GadE, and found that gadX and eng were
also strongly induced at acidic pH in both wild type and AgadE. GadX has been
shown to negatively regulate the expression of LEE genes through the plasmid
encoded regulator, Per, in EPEC (138). However, the effect of GadX on
expression of LEE in EHEC has not been determined. It is possible that GadX
regulates LEE through an unknown regulator in EHEC. The decrease in LEE
gene expression in an acidic environment in the AgadE is likely to be mediated
by Eng also. Previously, Eng has been shown to repress LEE, independent of
Ler, by activating ydeO and ydeP (99). Because YdeO is a positive regulator of
gadE, the partial decrease in LEE expression in AgadE may occur through YdeP.
Collectively these experiments suggest that GadE, GadX and Eng may

cooperatively repress the expression of LEE genes at acidic pH and that GadE is

72

the sole regulator responsible for the changes in expression of Ier in the acidic
conditions used in this study.

The AR of AgadE also was characterized by assessing survival at pH 2.0
and 2.5 in the minimal AR mechanism environments and in the complex acidic
conditions of the M88. The AgadE failed to survive the acid challenge at pH 2.0
+ glutamate, indicating lack of a functional GAD system. Inactivation of gadE in
E. coli O157:H7 negatively impacted the protective ability of the ARG and OXI
AR systems. The survival of AgadE was tested in the M88, which evaluates the
ability of bacterial strains to survive in a gastric environment after ingestion of
food (64). The GadE central regulator, and thus a functional GAD system, is a
critical component for survival, as inactivation of gadE abrogated the ability of E.
coli O157:H7 to survive in the M88. Hence, GadE most likely plays a protective
role during the passage of 0157 through the gastric environment. This
assumption is supported by a previous study by Price et al., (119) which
demonstrated that gadC is required for the survival of E. coli O157:H7 in calves.

In summary, this study shows that GadE is an important regulator that
modulates the expression of AR and virulence genes in E. coli O157:H7 in
response to environmental conditions similar to those that are found in various
food matrices and the human gastrointestinal tract. GadE has acquired
additional functions in E. coli O157:H7 and it acts as a link between AR and
virulence: it activates the GAD system of AR and at the same time down-
regulates the expression of LEE genes, which are important for the adhesion of

the organism to intestinal mucosa and development of AE lesions.

73

Consequently, we propose that during passage through the human stomach
GadE protects E. coli O157:H7 by inducing the GAD system and aids in energy
conservation by inhibiting the unnecessary expression of the LEE genes. As the
organism reaches the intestine, environmental changes including alkaline pH and
high NaHCO3 concentration induce the LEE regulator, Ler, which negatively

regulates expression of gadE (1) leading to inhibition of the GAD system.

74

ACKNOWLEDGMENTS

This work was supported by Food Safety NRI #2005-35201-16362 from
the United States Department of Agriculture, and in part by funds from the NIAID,
NIH, DHHS, under the Food and Waterbome Diseases Integrated Research
Network (NIH Research Contract N01-Al-30058).

The authors wish to thank Vanessa Sperandio, University of Texas South
Western Medical center, for helpful suggestions for creating genetic
complements and Galeb Abu-Ali, James T. Riordan and Shannon Manning for

critical review of the manuscript.

75

CHAPTER 3
Effect of acidic pH on the expression of virulence factors of Escherichia

coli O157:H7: role of glutamate decarboxylase system regulators

76

SUMMARY

Effect of gastric acidity on the expression of vimlence factors remains less
investigated in an important enteric pathogen, Escherichia coli O157:H7. We
hypothesized that exposure to extreme acidity downregulates the expression of
virulence factors in E. coli O157:H7. Stationary phase cells of E. coli O157:H7
were exposed to pH 2.0 and pH 7.0 for 10 min to analyze the expression of
virulence and acid resistance genes. Supporting the hypothesis, exposure to pH
2.0 resulted in a marked decrease in the expression of the major virulence
factors of E. coli O157:H7 such as Shiga toxins, locus of enterocyte effacement
(LEE) and p0157 plasmid encoded genes. 0n the other hand, acid resistance
genes such as gadA, gadB, and gadC showed increased expression at pH 2.0.
Furthermore, we investigated whether two acid resistance regulators that
negatively regulate LEE expression in enteropathogenic E. coli (EPEC), GadX
and Eng, have a similar effect on LEE expression in E. coli O157:H7. Contrary
to EPEC, inactivation of gadX had only a minimal effect on the expression of LEE
genes in E. coli O157:H7 whereas inactivation of eng resulted in a marked
increase in expression of the LEE genes, tir, espD, eae, and sepZ similar to

EPEC.

77

E. coli O157:H7 is the most prevalent enterohemorrhagic E. coli (EHEC)
serotype in the United States (67). It is a food borne zoonotic pathogen and
causes hemorrhagic colitis and hemolytic uremic syndrome (HUS) in human
beings (153). HUS is a thrombotic disorder that causes kidney damage in 15% of
the children infected with E. coli O157:H7 (153). Before colonizing the lower
intestinal tract of humans, E. coli O157:H7 has to pass through the stomach,
which presents one of the ﬁrst host defense barriers. Gastric acidity (pH 1.5 -
2.5) is lethal to most bacteria including many enteric pathogens (112). E. coli
strains are extremely acid resistant and can survive gastric acidity efﬁciently (39).
At least four mechanisms contribute to this acid resistance of E. coli, among
which glutamate decarboxylase (GAD) system is the most efﬁcient (39).

The effect of acidity on the expression of virulence factors of E. coli
O157:H7 is largely unknown. Major virulence factors of E. coli O157:H7 include
one or more Shiga toxins (Stx), a pathogenicity island namely locus of enterocyte
effacement (LEE) and a plasmid, p0157 (170). Several environmental factors
such as growth phase, temperature, presence of iron, osmolarity, and presence
of antibiotics have been shown to affect the expression of these virulence factors
(12, 20, 95). However, the effect of acidity on the expression of Stx, LEE and
p0157 genes remains less clear. Therefore, a study on the expression of
virulence factors at acidic pH is critical as it could provide important insights
about how E. coli O157:H7 synchronizes the expression of acid resistance genes
and virulence genes when exposed to extreme acidic environments such as the

human stomach. In this context, we hypothesized that upon exposure to extreme

78

acidity such as pH 2.0, E. coli O157:H7 downregulates its virulence factors and
upregulates the acid resistance genes in order to facilitate survival and conserve
energy.

In a previous study, we determined the effect of acidity on LEE expression
by growing the E. coli O157:H7 cells at pH 5.0 and demonstrated a marked
decrease in expression of Ier, espD, and sepZ, at pH 5.0 (65). However, the
expression pattern of genes observed at pH 5.0, although interesting, may not be
representative of the expression at gastric pH as pH 5.0 represents only
moderate acidic conditions. Moreover, the change in expression of other major
virulence factors such as Stx and p0157-encoded genes at acidic pH was not
investigated. Therefore, to determine the effect of gastric pH on the expression of
virulence and acid resistance genes, we exposed stationary phase (00600 ~ 1.5)
cells of E. coli O157:H7 Sakai strain to EG minimal medium containing glutamate
(65, 83) at pH 2.0 and pH 7.0 for 10 min and compared the expression of
selected virulence genes. The virulence genes tested were LEE genes, Ier, tir,
sepZ (espZ), and espD that are involved in causing attaching and effacing
lesions in the intestine; Stx genes, stx1 and stxZ, which encode two variants of
Shiga toxins; p0157 genes, eth, which encodes enterohemolysin, and etpC, a
type II secretion system gene involved in adhesion to the epithelial cells.
Additionally, to determine the effect of pH 2.0 on acid resistance genes, the
expression of three GAD system genes gadA, gadB and gadC was analyzed. For
all the experiments described in this report, RNA was extracted using modiﬁed

hot phenol extraction method as described previously (9). One microgram of

79

RNA was converted into cDNA, which was then used for quantitative real time
PCR (qRT-PCR) as described before (65). The fold change in expression of
genes was calculated by Pfafﬁ’s method (113).

Exposure to pH 2.0 altered the expression of all the genes tested. There
was a 2 - 5-fold upregulation of the three components of GAD system, gadA,
gadB and gadC. This is an expected result as the GAD system has been shown
to provide maximum protection to the cells at extreme acidity (39, 75). In
contrast, all of the virulence genes tested showed decrease in expression of
different magnitudes at pH 2.0 with some of them showing a dramatic decrease
in expression. stx1 had a 28.2-fold decrease in expression whereas stx2 was
down regulated by only 2.3-fold upon exposure to pH 2.0. Similarly, the LEE
genes tested demonstrated decreased expression at pH 2.0, among which the
highest repression of 74.1- and 60.9-fold were observed for fir and Ier,
respectively. espD had a 23.6-fold decrease in expression whereas sepZ showed
only a 2-fold decrease in expression at pH 2.0. The two p0157 plasmid-encoded
genes eth and etpC also showed decrease in expression of 16.2- and 9.6-fold,
respectively (Table 3.1).

In our previous study (65), the central activator of the GAD system, GadE
(39), was involved in the decrease in expression of the LEE genes at acidic pH in
E. coli O157:H7. However, inactivation of gadE only partially relieved the acid-
induced repression of LEE and therefore, in this study, we hypothesized that

additional regulators such as GadX and Eng are also involved in this

80

TABLE 3.1
Alteration in expression of acid resistance and virulence genes upon exposure to

extreme acidity

 

 

Gene Fold change
(pH 2.0/pH 7.0)*

gadA 2.6108
gadB 2.3107
gadC 5211.4
sepZ -210.2

tir -74.1114.5
espD -23.613.3
Ier -60.9129.2
thA -16.217.8
etpC -9.610.9
stx1 -28.2116.3
stx2b -2.310.3

 

* Positive values indicate increased expression at pH 2.0 and negative values

indicate decreased expression at pH 2.0.

81

phenomenon as GadX and Eng have been previously shown to negatively
regulate LEE expression in EPEC (99, 139).

To determine whether GadX and Eng regulate the expression of LEE in
EHEC, AgadX and Aeng E. coli O157:H7 Sakai strains were constructed
through a one step inactivation method (32, 98) and the LEE expression was
analyzed by qRT-PCR. Wild type (WT) and AgadX strains were grown in
previously described gadX-inducing conditions (39, 139) to analyze the
expression of LEE genes. This included growth in morpholino propane sulfonic
acid (MOPS) minimal medium at pH 7.4 and Dulbecco’s modiﬁed Eagle’s
medium (DMEM) at pH 5.5 (0.2% glucose, 3.7% NaHCO3, pH adjusted with
morpholino ethane sulfonic acid (MES)) upto an 00600 of 0.5. Expression
analysis was not conducted at pH 2.0 as AgadX is not viable at this pH.

Inactivation of gadX resulted in a minimal increase in expression of some
of the LEE genes at neutral pH (Table 3.2). Interestingly, this effect was not
observed at pH 5.5 (Table 3.2). This result is in contrast with that of EPEC,
where inactivation of gadX had a signiﬁcant effect on LEE expression at pH 5.5
but not at neutral pH. GadX negatively regulates LEE expression in EPEC by
downregulating a plasmid encoded positive regulator of LEE, PerA (139). No
PerA homolog has been identiﬁed in EHEC (61) and that could be the reason for
the observed differences in GadX-mediated LEE regulation in E. coli O157:H7.

Subsequently, the expression of LEE genes in Aeng was analyzed in
previously described eng-inducing conditions (39). The cells were grown to

exponential phase (00600 = 0.5) in minimal medium (E minimal medium with

82

TABLE 3.2

Effect of gadX inactivation on the expression of LEE genes

 

Gene AgadX/WT AgadX/WT

 

(pH 7.4) (pH 5.5)
tir 1.1102 0.5101
espD 1.8101 0.8101
eae 1.5102 0810.2
sepZ 1.5103 0.8102

 

83

0.2% glucose and 12mM M9804) at pH 7.0 and pH 5.0. There was a marked
increase in expression of LEE genes in the Aeng (Table 3.3) at neutral pH
indicating that a negative interaction between Eng and LEE, similar to that in
EPEC, exists in E. coli O157:H7 as well. Interestingly, this effect was not as
pronounced at pH 5.0 as at neutral pH (Table 3.3). As in EPEC (99), this
negative regulation of LEE by Eng could be mediated through YdeO and GadE
regulators.

The ability to orchestrate gene expression in response to environmental
conditions is an important requirement for being a successful pathogen.
Expression of virulence factors in inappropriate environments, particularly where
they are not needed, can negatively affect energy conservation and markedly
impair survival of the pathogen in the host. It has been shown in BordeteIIa
bronchiseptica that ectopic expression of ﬂagellar regulon interferes with the
tracheal colonization by the pathogen (4). During passage through human
stomach, the main objective of E. coli O157:H7 is its survival and therefore, it is
expected that genes that provide protection at extreme acidity are positively
selected for upregulation and at the same time, expression virulence factors that
are not required in that environment is suppressed. The results from this study
support this argument; upon exposure to gastric acidity E. coli O157:H7
upregulated acid resistance genes such as GAD genes and downregulated major
virulence factors such as Stx, LEE and p0157 genes. This may be beneﬁcial to
the organism as decreased LEE expression prevents attaChement of the bacteria

to the gastric mucosa and allows for faster transit through stomach.

84

TABLE 3.3

Effect of eng inactivation on the expression of LEE genes

 

Aeng/WT Aeng/WT

 

Gene (pH 7.0) (pH 5.0)
tir 3.7105 1.4105
espD 4.4105 1.2103
eae 3.8106 1.0101

sepZ 5311.5 1.2104

 

85

Additionally, this pattern of gene expression may help in maximum energy
conservation by the organism. We hypothesize that GAD system regulators such
as GadE and Eng are involved in the decrease in LEE expression at extreme
acidity. It is possible that the EngS two-component system senses the acidity in
the environment and upregulates the expression of GadE, which in turn induces
GAD expression and suppresses LEE expression. We do not know the factors
that are involved in the repression of Stx and p0157 genes at extreme acidity at
this time because none of the GAD system regulators investigated in this study
have been shown to regulate their expression. Further work is needed in this
aspect to identify the genes controlling this response and the mechanism of
downregulation.

This work was supported by Food Safety NRI #2005—35201-16362 from
the United States Department of Agriculture, and in part by funds from the NIAID,
NIH, DHHS, under the Food and Waterbome Diseases Integrated Research

Network (NIH Research Contract N01-AI-30058).

86

CHAPTER 4
Differential Expression of Virulence and Stress Fitness Genes between

Clinical and Bovine-biased Genotypes of Escherichia coli O157:H7

This chapter is submitted to Applied and Environmental Microbiology

87

SUMMARY

Escherichia coli O157:H7 strains can be classiﬁed into different genotypes
based on the presence of speciﬁc Shiga toxin-encoding bacteriophage insertion
sites. Certain O157:H7 genotypes predominate among human clinical cases
(clinical genotypes), while others are more frequently found in bovines (bovine-
biased genotypes). To determine whether inherent differences in gene
expression explains the variation in infectivity of these genotypes, we compared
the expression patterns of clinical genotype 1 strains with those of bovine-biased
genotype 5 strains using microarrays. Important O157:H7 virulence factors
including locus of enterocyte effacement genes, the enterohemolysin, and
several p0157 genes, showed increased expression in the clinical versus
bovine-biased genotype. In contrast, genes essential for acid resistance (e.g.,
gadA, gadB, and gadC) and stress ﬁtness were upregulated in bovine-biased
genotype 5 strains. Increased expression of acid resistance genes was
conﬁrmed functionally using a model stomach assay, in which strains of bovine-
biased genotype 5 had a 2-fold higher survival rate than strains of clinical
genotype 1. Overall, these results suggest that the increased prevalence of
O157:H7 illness caused by clinical genotype 1 strains is due in part to the
overexpression of key virulence genes. The bovine-biased genotype 5 strains,
however, are more resistant to adverse environmental conditions, a characteristic

that likely facilitates asymptomatic O157:H7 colonization of bovines.

88

INTRODUCTION

Escherichia coli O157:H7, a food-bome zoonotic pathogen that causes
hemorrhagic colitis and hemolytic uremic syndrome (HUS) in humans, is the
most prevalent type of enterohemorrhagic E. coli (EHEC) in the United States
(67, 153). Cattle are the primary reservoir of E. coli O157:H7 and the fecal
shedding rate on cattle farms can be up to 100% (45). While colonized cattle do
not exhibit clinical disease (127), it has been reported that only 10-100 cells of E.
coli O157:H7 are sufﬁcient to induce overt disease in humans (163). Although it
has been suggested that bovine-derived E. coli O157:H7 strains vary in their
ability to cause human disease (14), the basis behind this variation is not known.

E. coli O157:H7 possesses unique virulence properties that facilitate
disease development including Shiga toxins (Stx), the locus of enterocyte
effacement (LEE) pathogenicity island, and the p0157 vimlence plasmid (171).
The LEE encodes a type 3 secretion system (T388) that mediates the formation
of attaching and effacing lesions (94), while the p0157 plasmid encodes several
putative virulence factors such as an enterohemolysin (Eth or EHEC-HlyA) (78)
and a type 2 secretion system (T288) (133). Both the LEE and p0157 have
shown to be critical for disease pathogenesis (66, 81). Shiga toxins, which are
the cytotoxins responsible for renal damage in HUS (66), are encoded by genes
located on lysogenic Iambdoid phages that are inserted into the O157:H7
chromosome at speciﬁc locations (136). A prior study of 80 bovine isolates and
282 clinical isolates from humans with 0157-associated disease demonstrated

that the distribution of Stx insertion sites varies between isolate types (14).

89

Furthermore, these isolates were classiﬁed into different genotypes based on the
insertion sites of Stx-encoding bacteriophages and genotypes 1 - 3, although
isolated from cattle also, were predominant in clinical isolates and were
considered as clinical genotypes. 0n the other hand, genotypes such as 5 and 7
were overrepresented among the cattle isolates and therefore, considered as
bovine-biased genotypes (14). Similarly, octamer-based genome scanning of
bovine and clinical isolates of E. coli O157:H7 identiﬁed two genetically distinct
lineages, of which lineage I was isolated mostly from humans and lineage ll,
mostly from bovines (72). Comparing the presence of virulence genes between
E. coli O157:H7 isolates from various sources using DNA microarrays also has
revealed that 0157 isolates from beef cattle and humans are genetically distinct
(79).

In addition to intrinsic differences, it is possible that there are differences
in the expression of important virulence genes as well as variation in the degree
of resistance to adverse environmental conditions between clinical and bovine-
biased genotypes. To investigate this hypothesis, the exponential phase
transcriptomes of four clinical genotype 1 strains were compared to the
transcriptomes of four bovine-biased genotype 5 strains using microarrays. All
the strains used in this study were from bovine sources and they belonged to
either genotype 1 or 5. Therefore the Genotype 1 strains used in this study are in
fact bovine-derived clinical genotype strains. The goal of this study was to
identify speciﬁc genes that are differentially expressed between the two

genotypes to better understand why genotype 1 strains cause more clinical

90

disease than genotype 5 strains. The identiﬁcation of genes that are upregulated
in clinical versus bovine-biased genotypes is important for detecting and

controlling those strains that are more likely to cause E. coli O157:H7 infections

in humans.

91

MATERIALS AND METHODS

Bacterial strains. The eight bacterial strains used in this study were
selected based on the Stx-encoding bacteriophage insertion site genotypes
determined in a prior study (14). Strains representing genotypes 1 (clinical
genotype) and 5 (bovine-biased genotype) were selected among 80 bovine
strains originally isolated between 1991 and 2004 as described (14). Although
the clinical genotype 1 strains in this study were bovine-derived, their genotype
was identical to those genotype 1 strains isolated in a prior study from humans
with 0157 infections (14). Four strains of each genotype were included in the
microarray analyses. A previously described (88) stx2/stx2c RFLP demonstrated
that all the genotype 1 strains used in this study harbored stx2 alone, whereas
the genotype 5 strains contained only stx20.

Growth conditions. Each strain was stored at -70°C in LB broth
containing 10% glycerol, was inoculated into 10 ml LB broth, and grown to an
ODeoo of ~01 to recover cells. Cells were grown twice to stationary phase in
MOPS-buffered minimal medium (pH 7.4) before transferring at a 1:30 dilution
into 100 ml Dulbecco’s Modiﬁed Eagle Medium (DMEM) (0.45% glucose) for both
RNA isolation and the model stomach assay. To minimize the confounding effect
of acidic pH that develops in stationary phase of growth in un-buffered medium,
the DMEM was buffered with MOPS to pH 7.4.

Microarray design. To compare global gene expression proﬁles between
genotypes 1 and 5, microarrays were hybridized in a double loop design, thereby

allowing strains from one genotype to be directly compared to strains from the

92

other genotype (Fig. 4.1). The four strains from each genotype represent
biological replicates and therefore, signiﬁcant differences in gene expression are
representative of the two genotypes.

RNA isolation and cDNA labeling. For RNA isolation, the strains were
grown to exponential phase (~2.25 h, 00600 ~05) in DMEM and RNA extractions
were performed using a modiﬁed version of the previously described hot-phenol
method (15). Brieﬂy, 5 ml of the culture was mixed with 1/10V of 10%
phenolzethanol buffer to stabilize the RNA, and centrifuged at 4° C (4300 x g) for
30 min to pellet cells. The supernatant was decanted and cell pellets were
suspended in 5 ml of buffer (2 mM EDTA, 20 mM NaOAc, pH 5.2) before RNA
extraction with hot-phenol. Reverse transcription reactions and the coupling of
cDNA with Cy3 or Cy5 dyes were conducted as described elsewhere (12).

cDNA hybridizations. Hybridizations were performed according to the
double loop microarray design (Fig. 1). As described (12), the cDNAs were
hybridized onto microarray slides printed with 6,088 ORFs representing E. coli
genome strains K12 (17), EDL933 (110) and Sakai (46);110 ORFs from the
p0157 plasmid were included. Arrays were scanned with an Axon 4000b
scanner (Molecular Devices, Sunnyvale, CA) followed by image analysis using
GenePix 6.0 (Molecular Devices).

Data analysis. Microarray data were processed as previously described
(65) and ﬁtted to a mixed ANOVA model (30). The linear model tested was Y
(intensity) = array + dye + strain (clinical or bovine-biased) + sample (biological

replicate) + error. Signiﬁcant differences in expression were determined using the

93

/ \\..
\ /<

BZA

 

 

 

C4¢

 

 

 

 

Figure 4.1. Double loop design for the microarray experiment. B1-B4 represent
four different strains of the bovine-biased genotype 5, whereas C1-C4 represent
four different strains of the clinical genotype 1. Each arrow indicates a

hybridization with the arrow head representing Cy3 and tail Cy5 dyes.

94

Fs test in MAANOVA with 500 random permutations to estimate the p-values.
This test uses a shrinkage estimator for gene-speciﬁc variance components that
makes no assumption about the variance across genes (31 ). In addition, the q-
value package in R was used to determine the false discovery rate (FDR) (146).
Additionally, signiﬁcance analysis of microarrays (SAM) was used to analyze
data with a FDR of 0.05.

Overrepresentation of gene sets with a common biological function in the
two genotypes was determined using the Gene Set Enrichment Analysis (GSEA)
Preranked analysis program (GSEA v2.0; Broad Institute, Massachusetts
Institute of Technology) (148). The gene sets were designated based on the
annotation for the Sakai genome (46) available through the J. Craig Venter
Institute (http:l/cmr.jcvi.org/tigr-scripts/CMR/GenomePage.cgi?org=ntecO3).
Additionally, genes for the LEE and the AFI-GAD, which represents the
glutamate decarboxylase (GAD) system and acid ﬁtness island (AF I), also were
included in the analysis.

Quantitative real-time PCR (qRT-PCR). Select genes that had
signiﬁcantly different levels of expression between genotypes in the microarray
analysis were conﬁrmed by qRT-PCR. Taqman assays (11) were used to
quantify the expression of gadA, gadB, and Ier, with mdh as a reference for
normalization. For all other genes, SYBR green was used as described
elsewhere (65); methods for cDNA synthesis and qRT-PCR also were described
previously (65). The expression level of the 16S rRNA gene was used for

normalization of data and the relative expression levels were quantiﬁed using

95

modiﬁed Livak method (134). The results presented are averages from four
biological replicates 1 standard error of mean (SEM).

Single Nucleotide Polymorphism (SNP) Genotyping. Genomic DNA
was extracted with the Purgene DNA extraction kit (Gentra systems,
Minneapolis, MN) for use with the GenomeLab SNPstreamT" system (Beckman
Coulter, Fullerton, CA). SNP genotyping via the SNPstreamTM was performed
using a modiﬁed version of a previously described protocol (88) according to the
manufacturer’s instructions. Brieﬂy, PCR was conducted using four panels of 48-
plex primers targeting 192 distinct SNP loci identiﬁed previously via the
comparison of three O157:H7 genomes (88). The primers, which differed from
the original protocol, were designed using the Autoprimer program (175). After
cleaning, the PCR products were subjected to single base primer extension
reactions that add a labeled nucleotide to the SNP site followed by hybridization
onto a 384-well SNP microarray plate. Detection and processing were performed
via the SNPstreamT" lmager (version 2.3; GenomeLab). A total of 52 of the 192
SNPs were found to be informative; these SNPs were concatenated in MEGA4
(151) to construct a neighbor-joining tree (130) for examining the phylogenetic
relationships between the eight strains. SNP data from reference strains
representing each of the nine O157:H7 clades (88) were included in the analysis.

Model stomach assay. The model stomach system (M88) (64) was
prepared as described previously (11). Gerber Turkey Rice Dinner© baby food
(30 g) was mixed with 120 ml of synthetic gastric ﬂuid (pH 1.70), yielding a ﬁnal

pH of 2.5. Strains, grown to an 00300 ~2.5 in DMEM, were inoculated into the

96

MSS at the rate of 10° cells/ml. Contents of the M88 were stomached for 30 sec,
sampled, diluted, and plated onto LB agar plates every 30 min for 1.5 h to
enumerate viable cells. CFU/ml from duplicate plates were averaged and
converted to Iog10 CFU/ml. Survival rates were calculated as the log decrease in
viable cell count per 30 min, and the average from two experimental replicates
were reported.

Microarray data accession. Microarray data are available at NCBI GEO

(http://www.ncbi.nlm.nih.gov/geo), accession number GSE15783.

97

RESULTS

Differentially expressed genes between clinical and bovine-biased
genotypes of E. coli O157:H7. The F3 test identiﬁed signiﬁcant differential
expression of 191 genes between the two genotypes, of which 71 were
upregulated in the clinical genotype and 120 were upregulated in the bovine-
biased genotype (FDR<0.1, fold change 2 1.5) (Table 4.81 in appendix).
Additionally, SAM identiﬁed more genes to be signiﬁcantly differentially
expressed between the two genotypes; 154 were upregulated in the clinical and
238 were upregulated in the bovine-biased genotype (FDR<005, fold change
>1 .5) (Table 4.82 in appendix). One hundred and sixteen genes were found. to be
differentially expressed by both MAANOVA and SAM. Differentially expressed
genes included those involved in virulence, response to stress, acid resistance
and metabolism. Overall, important O157:H7 virulence factor genes were
upregulated in the clinical genotype (Table 4.1), whereas genes related to acid
resistance and stress ﬁtness were upregulated in the bovine-biased genotype
(Table 4.2). GSEA also identiﬁed enrichment of 8 gene sets in the clinical
genotype and 6 gene sets in the bovine-biased genotype (Table 4.3), thereby
providing additional support for the MAANOVA and SAM results.

The LEE genes. There was an overall increase in expression of the LEE
genes in clinical genotype 1 relative to bovine-biased genotype 5 strains;
expression was signiﬁcantly different in12 genes (Table 4.1). For example,
secreted proteins encoded by espF and espG, T388 proteins encoded by escF,

sepQ, escT, and escR, and the cesD chaperone were upregulated in genotype 1

98

TABLE 4.1

Virulence-associated genes upregulated in clinical genotype 1 relative to bovine-

 

 

biased genotype 5
Expression

ECs no.‘I Gene Function ratio (CIB) ° Test °
LEE genes
ECs4550 espF Effector protein 2.0 S
ECs4552 escF T388 EscF protein 2.1 S
ECs4565 sepQ T388 structural protein 1.6 M
ECs4566 orf16 Secretion of translocators 2.2 S
ECs4570 orf12 T388 2.1 S
ECs4574 sepD T3SS SepD protein 2.0 S
ECs4576 cesD T388 chaperone 1.8 M
ECs4579 rorf3 T388 1 .9 S
ECs4581 escT T388 structural protein 2.0 S
ECs4583 escR T388 structural protein 1.9 S
ECs4590 espG Effector protein 1.9 S
ECs4591 rorf1 Unknown 1 .6 M
Genes encoded by p0157 plasmid
p01 57p02 etpC T288 2.8 M
p01 57p05 eth T288 1 .9 M+S
p01 57p07 etpH T288 1 .9 M
p01 57p09 eth T288 2.0 M+S
p01 57p10 etpK T288 2.2 M+S
p0157p1 1 etpL T288 1 .8 M
p01 57p12 etpM T288 1 .9 M+S
p0157p14 etpO T288 1.7 M
p01 57p18 eth enterohemolysin 1 .7 M
p0157p24 repFIB replication protein 1.7 M
p0157p58 toxB toxin B 1.6 M
p0157p79 unknown 2.4 M+S
p0157p80 unknown 2.1 S '
p0157p81 unknown 2.1 M+S

 

a Locus ID for E. coli O157:H7 Sakai strain (Genbank # BA000007)
° Expression ratio between two genotypes; C=clinical genotype, B=bovine-biased

genotype

99

°Test that identiﬁed a gene as statistically signiﬁcant; M=MAANOVA, S=SAM

100

TABLE 4.2

Genes upregulated in bovine-biased genotype 5

 

 

ECs no. a Gene Function (BIC) b Test °

GAD and AFI genes

ECs2097 gadC GABA-glutamate antiporter 2.5 M+S

ECs2098 gadB Glutamate decarboxylase 4.4 M+S
isozyme

ECs4377 slp Outer membrane protein 2.5 M+S

ECs4389 hdeB Periplasmic chaperone 3.4 M+S

ECs4390 hdeA Protection from organic acid 5.6 M+S
metabolites

ECs4391 hdeD Acid resistance at high cell 2.7 M+S
density

ECs4392 gadE Central activator of the GAD 2.6 8
system

ECs4394 yhiV lVIulti drug efﬂux pump protein 2.2 M+S

ECs4395 gadW ARAC-type GAD system 1.8 M+S
regulator

ECs4397 gadA Glutamate decarboxylase 1.9 M+S
isozyme

Stress ﬁtness-associated genes

ECsO890 dps DNA protection during 3.6 M+S
starvation

ECsOQ66 cspD Cold shock protein 2.5 M+S

ECs1722 chaB Cation transport regulator 2.4 M+S

ECs4871 katG Catalase-peroxidase 1 .7 M+S

ECs2086 osmC Osmotically inducible protein 2.1 M+S

EC35334 osmY Osmotically inducible protein 3.0 M+S

ECs4367 uspA Universal stress protein 2.6 S

EC30968 prA Degradation of abnormal 2.0 8
proteins

ECs1723 chaC Cation transport regulator 2.2 S

RpoN regulated (involved in nitrogen

metabolism)

ECs0169 glnD uridylyltransferase acts on 1.8 S
regulator of gInA

ECsO504 gInK nitrogen regulatory protein P-ll 11.6 S
2

ECsO505 amtB probable ammonium transporter 14.9 S

 

101

Table 4.2 continued...

 

ECsO692 gItK glutamate/aspartate transport 1.9 8
system permease

E050693 gltJ glutamate/aspartate transport 2.2 8
system permease

ECs0889 glnH permease of periplasmic 2.1 S
glutamine-binding protein

ECs2784 nac nitrogen assimilation control 12.7 8
protein

ECs3194 argT periplasmic arginine binding 1.5 M
protein

ECs4091 gltB glutamate synthase, large 1.9 S
subunﬁ

ECs4790 gInG nitrogen regulator l 2.6 8

Mac regulated

ECs1743 oppA oligopeptide transport 2.1 M+S

ECs1744 oppB oligopeptide transport 1 .6 M+S

ECs1746 oppD oligopeptide transport 1 .8 M+S

ECs1747 oppF oligopeptide transport 1 .7 M+S

E053522 gabD succinate-semialdehyde 3.7 S
dehydrogenase

E053523 gabT 4-aminobutyrate 3.2 S
aminotransferase activity

ECs4424 dppA dipeptide transport protein 1.9 S

RpoN-regulated (not involved in nitrogen

metabolism)

EC53582 hypA pleiotrophic effects on 3.0 S
hydrogenase isozymes

ECs3583 hypB hydrogenase isoenzyme HypB 2.6 S

ECs5061 fth subunit of formate 2.1 S

dehydrogenase H

 

a Locus ID for E. coli O157:H7 Sakai strain (Genbank # BA000007)

° Expression ratio between two genotypes; B=bovine-biased genotype, C=clinical

genotype
cTest that identiﬁed a gene as statistically signiﬁcant; M=MAANOVA, S=SAM

102

TABLE 4.3

Enrichment of gene sets in clinical and bovine-biased genotypes

 

 

FDR-q
Gene set NES' value”
Enriched in clinical genotype 1
LEE 2.58 0.000
Folic acid biosynthesis 1.88 0.008
tRNA rRNA base modiﬁcation 1.87 0.006
Pyrimidine ribonucleotide biosynthesis 1.82 0.013
RNA processing 1.74 0.026
Nucleotide and nucleoside
interconversions 1 .69 0.037
Toxin production and resistance 1.68 0.036
Ribosomal protein synthesis and
modiﬁcation 1 .65 0.040
Enriched in bovine-biased genotype 5
AFI-GAD -2.09 0.000
Adaptations to atypical conditions -1.94 0.004
Glutamate family -1.90 0.004
Pyruvate family -1.89 0.004
Gcholysis/gluconeogenesis -1 .89 0.003
Fermentation -1.78 0.010

 

a NES= normalized enrichment score indicating the degree to which a gene set is
overrepresented in the top or bottom of the ranked list of genes.

° F DR-q value 5 0.05, indicates false discovery rate.

103

 

 

strains (Table 4.1). Although the remaining 29 LEE genes were not signiﬁcantly
different between genotypes, 27 were upregulated in genotype 1 relative to
genotype 5. Members of all the ﬁve LEE operons showed change in expression
in the same direction. The insigniﬁcant result is possibly due to inter-strain
variation within the genotypes. To conﬁrm expression differences, qRT-PCR was
used to examine the expression of four important LEE genes including Ier, espB,
espD and tir that were not signiﬁcantly different by microarrays (Fig. 4.2). More
than a two-fold increase in expression was observed for espB, espD and tir by
qRT-PCR in the clinical genotype (Fig. 4.2), a level that was similar to the
microarray data for the 12 signiﬁcant genes. Expression of Ier was slightly lower
than the other genes, though it still exhibited a 1.4—fold increase in clinical strains
(Fig. 4.2). Additionally, GSEA conﬁrmed the enrichment of the entire set of 41
LEE genes in the clinical genotype (Table 4,3).

p0157 plasmid encoded genes. The p0157 plasmid encodes a number
of virulence associated genes in E. coli O157:H7 strains. Fourteen of these
genes, which includes eth (EHEC-hlyA; enterohemolysin), toxB (toxin B), and
eight of the thirteen genes that encode the T288 were signiﬁcantly upregulated
in the clinical genotype 1 (Table 4.1). The T288 etp cluster (133) showed a 1.8-
to 2.8-fold increase in expression in the clinical genotype, which was conﬁrmed
by qRT-PCR (Fig. 4.2). The eth and toxB also were conﬁrmed to have a 2.2-
and 2.1-fold increase in expression by qRT-PCR (Fig. 4.2). Expression of some
virulence genes encoded by p0157 such as ethBD and stcE, were not

signiﬁcantly different between the two genotypes.

104

Figure 4.2. qRT-PCR validation of microarray data. The expression ratio between
clinical and bovine-biased genotypes as calculated by microarrays and qRT-PCR
are given. Results shown are average fold change in expression with standard

error of mean (SEM) from four biological replicates (strains) per genotype.

105

mace m8: <8: 88 meme 328 x98 mums one 9.9 SE s 38 meme 5

 

 

L p F p p F mNI
«61ch _H_ . om-
28890:). I

H . m..-

I OFI

 

 

 

 

 

 

. .II—i

 

 

 

106

(euera/ieoiuuo) eﬁueuo Pl0:I

Acid resistance and stress ﬁtness-associated genes. Numerous
genes that are essential for acid resistance in E. coli were signiﬁcantly
upregulated in the bovine-biased genotype 5 strains. This included genes that
encode all three components of the GAD system, gadA, gadB, and gadC (39). In
addition, the twelve AF I genes (91) had increased expression in the bovine-
biased genotype, with eight of the 12 having signiﬁcantly different levels (Table
4.2). The increased expression of GAD system genes was conﬁrmed by qRT-
PCR, which showed a more than 10-fold increase relative to clinical genotype 1
(Fig. 4.2). Similarly, there was a 3.6-, 5.6-, 6.6- and 7.5-fold increase in
expression of gadX, gadE, hdeA and hdeB, respectively, by qRT-PCR (Fig. 4.2).
The upregulation of gadX, however, was not statistically signiﬁcant in the
microarray analysis, though the direction was the same. This discrepancy is
possibly due to high inter-strain variation in expression within the genotype.

Expression of dps, which is involved in protecting DNA during starvation
and acid stress (28), was upregulated by 3.6-fold in the bovine-biased genotype
strains. Similarly, prA, a chaperone necessary for protein degradation by the
ClpAP protease (73), showed a 2-fold increase in expression. Other stress
ﬁtness-associated genes with increased expression in the bovine-biased
genotype included the cold shock protein, cspD (173), cation transport
regulators, chaBC (107) and the universal stress protein, uspA (26, 111) (Table
4.2). Moreover, expression of katG (108), osmC and osmY (168), the genes

involved in resistance to peroxide and osmotic stress, also were upregulated

107

(Table 4.2). Interestingly, the general stress sigma factor, rpoS (169), was not
differentially expressed between the two genotypes.

The RpoN regulon. Several metabolic genes, including nine genes
involved in the nitrogen regulatory response that are regulated by the sigma
factor RpoN (122), were upregulated in the bovine-biased genotype. The
nitrogen regulatory protein, gan, and the ammonium transporter, amtB, were
both upregulated by 11.6- and 14.9-fold respectively. glnD, which is involved in
the post transcriptional modiﬁcation of gan, also was upregulated in bovine-
biased strains as were the nitrogen regulator l (gInG), a permease of the
periplasmic glutamine binding protein (glnH), and genes associated with
glutamate biosynthesis (gltB, gItK and gltJ) (Table 4.2).

Furthermore, nac, which encodes the nitrogen assimilation control protein,
was upregulated by 12.7-fold in the bovine-biased genotype. Consequently, a
number of Nae-regulated genes including oppA, oppB, oppD, oppF, gabD, gabT,
and dppA, had higher expression levels in bovine-biased strains. Other RpoN-
regulated genes such as hypA, hypB and fth, also had increased expression in
the bovine-biased genotype (Table 4.2).

SNP genotyping and re-analysis of microarray data. Because the eight
strains in this study were only characterized by the distribution of Stx insertion
sites and represented the same multilocus sequence type (14), a more sensitive
SNP genotyping method (88) was used to better understand the phylogenetic
relationships of strains within and between the two genotypes. Among the four

strains representing clinical genotype 1, three grouped together with a clade 8

108

control strain and one with a clade 1 control strain (Fig. 4.3). By contrast, all four
strains representing the bovine-biased genotype 5 belonged to clade 7 (Fig. 4.3).
Since one clinical genotype 1 strain was part of a phylogenetically distinct
lineage (clade 1) relative to the other three clinical genotype 1 strains (clade 8),
the microarray data was re-analyzed after excluding the data generated from the
clade 1 strain. The PS test identiﬁed signiﬁcant upregulation of 400 genes in the
clinical genotype and 349 genes in the bovine-biased genotype (FDR <01, fold
change >1 .5) in this re-analysis. All but three genes (bioB, dps and ycaL)
identiﬁed to be differentially expressed in the ﬁrst analysis were also differentially
expressed in the second analysis. Further, 561 additional genes were identiﬁed
in the second analysis, as elimination of the clade 1 strain likely reduced the
within-genotype variation. Twenty eight LEE genes including the genes encoding
intimin (eae), the translocated intimin receptor (ﬁr), and a positive regulator of
LEE (gr/A), were signiﬁcantly upregulated in the three clinical genotype strains.
Similarly, p0157-encoded genes such as eth, toxB, and 11 genes of the etp
polycistron that encodes a T288, also were upregulated in the clinical genotype.
As expected, the bovine-biased genotype strains showed increased expression
of GAD and AF I genes relative to the three clinical genotype strains. One
additional gene was gadX, which was signiﬁcantly upregulated in the second
analysis, but not the ﬁrst analysis. The stationary phase sigma factor, rpr, and
adiY, which encodes an ARAC-like regulator of the arginine decarboxylase acid
resistance system, also were upregulated in the bovine-biased genotype as were

a number of stress ﬁtness-associated and RpoN-regulated genes.

109

I Clinical genotype1 Sakai control Clade 1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A Bovine biased genotype 5 95 .10916
84 99 10045 control Clade 2
97 - 10008 control Clade 3
~ 14618 control Clade 5
14283 control Clade 6
01663 control
A 10917
94 A 10938 Clade 7
94 A 10957
A 10948
90 08635 control
99 II13:19:7 Ciade 8
I-—-I 97
0.02 TI—I10950

Figure 4.3. Neighbor joining phylogeny of single nucleotide polymorphism (SNP)
genotypes representing the eight strains examined in the study. Three of the four
clinical genotype 1 strains (black squares) belong to clade 8, whereas one
clinical genotype 1 strain is part of clade 1. All four bovine-biased genotype 5

strains (black triangles) are members of clade 7.

110

Model stomach assay. To determine whether the increased expression
of acid resistance genes in the bovine-biased genotype translates to a
phenotypic difference, model stomach assays were conducted. These assays
were used to directly compare the survival of both genotypes in a complex acidic
environment that simulates the human stomach. Consistent with the microarray
expression data, there was a signiﬁcant difference (P = 0.003) between the
survival rates of clinical and bovine-biased genotypes, as bovine-biased strains
had a 2-fold increase in survival in the M88 (Fig. 4.4). The average survival rate
per 30 min for the clinical genotype was 05510.04, whereas the bovine-biased

genotype was 0271004.

111

 

-0.2 ‘

 

 

 

 

 

-O.3 ~

-0.4 -

 

-0.5 -

 

~0.6 -

 

 

 

-0.7 -

 

 

Survival rate (log decrease per 30 min)

 

-08 , j
Clinical Bovine-biased

Figure 4.4. Survival of clinical and bovine-biased genotypes in the model
stomach system. The average survival rate (log decrease in CFU/ml per 30 min)

with the standard error of mean (SEM) from two independent experiments is

plotted for each genotype.

112

DISCUSSION

Genotyping based on Stx-encoding bacteriophage insertion sites has
demonstrated that the E. coli O157:H7 strains present in the bovine reservoir are
considerably more diverse when compared to strains that cause human
infections (14). Furlhennore, it was suggested that some bovine-biased
genotypes have reduced virulence and hence, cause disease less frequently
relative to those bovine-derived clinical genotypes that are commonly isolated
from patients (14). This variation could be due to gene content differences,
including allelic variation in key genes among genotypes or due to expression
differences in critical genes. Here, we describe differences in the expression of
important genes that provide an explanation for the variation in infectivity
between bovine-biased and clinical genotypes. Speciﬁcally, genome-wide
expression proﬁling revealed differential expression of key virulence and stress
ﬁtness genes between the two genotypes, which was conﬁrmed by qRT-PCR
and a phenotypic assay. Because microarrays and qRT-PCR target different
regions per gene, we suspect that the differential expression of genes identiﬁed
in this study is not due to differences in gene content or allelic variation between
genotypes, as both microarrays and qRT-PCR detected similar levels of
expression.

One of the most important differences identiﬁed was the upregulation of
the LEE in clinical versus bovine-biased genotypes. The LEE is considered a
critical factor in E. coli O157:H7 disease pathogenesis, as it encodes a T388 that

mediates adherence to the intestinal mucosa (94). Because strains of the clinical

113

genotype expressed key LEE genes at a higher level, it is likely that these strains
have an enhanced ability to adhere to the intestinal epithelium and cause the
attaching and effacing lesions that initiate the disease process. By contrast, it is
possible that increased expression of negative LEE regulators suppresses the
expression of important LEE genes in the bovine-biased genotype, thereby
reducing adherence and subsequent disease. The increase in gadE expression
in the bovine-biased genotype supports this hypothesis, as our prior study
determined that GadE, the central activator of the GAD system, negatively
regulates LEE in O157:H7 strains (65). Similariy, GadX, a negative regulator of
LEE in enteropathogenic E. coli (EPEC) (138), also was upregulated in the
bovine-biased genotype as was yhiF, an AFI-encoded regulator that suppresses
LEE expression in EHEC (156).

Similar to the LEE, another important factor in E. coli O157:H7 disease
pathogenesis is the possession of the p0157 plasmid. The 92 kb plasmid carries
genes for many putative virulence factors including eth (enterohemolysin)
(129), toxB (toxin B) (19), and a number of etp genes necessary for a T288 that
secretes factors such as the StcE protease (44); all were upregulated in the
clinical genotype. eth is a cell-associated, pore forming toxin from the repeats-
in-toxin (RTX) family (129). Although the exact role of the enterohemolysin in
O157:H7 pathogenesis is not clear, it has been shown to induce production of
the interleukin-1 beta (IL-1B) proinﬂammatory cytokine, which is a serum marker
of HUS (152), and to cause injury to microvascular endothelium (5). The

increased expression of ngA, a LEE-encoded positive regulator of eth (129),

114

 

may partly explain why eth was upregulated in the clinical genotype. StcE, a
protease that is involved in the intimate adherence of EHEC to host cells, is
secreted by the T288 encoded by the etp gene cluster (44); eight of the etp
genes were signiﬁcantly upregulated in the clinical genotype. Similarly, toxB,
which was upregulated in clinical genotype strains, also has been shown to be
important for complete adherence to human epithelial cells (154). Together,
these data demonstrate that the clinical genotype 1 strains are expressing factors
important for adherence, suggesting that genotype 1strains may have an
enhanced ability to adhere to human host cells and thus, are inherently more
vinilent than bovine-biased genotype 5 strains. A comparison of Stx expression
was not possible as the genotypes used in this study do not have the same stx
proﬁles.

During passage through the bovine gastrointestinal tract, E. coli O157:H7
has to survive a number of adverse environmental conditions, including extreme
acidity in the abomasum (165), organic acid stress from volatile fatty acids in the
nimen and colon, and occasional hyperosmolarity. Therefore, the capacity to
withstand acidity and other environmental stresses is critical for O157:H7 strains
to successfully persist in cattle. Consistent with this, we observed upregulation of
acid resistance and stress ﬁtness-associated genes in the bovine-biased
genotype relative to the clinical genotype. The GAD system is the most efﬁcient
acid resistance system in E. coli (23, 75) and is essential for the survival of E. coli
O157:H7 in bovines (119). All three GAD system genes (gadA, gadB and gadC

(39)) had increased expression in the bovine-biased genotype. Moreover, AFI

115

genes, which are also involved in acid resistance (91), showed increased
expression in the bovine-biased genotype. This increased expression of GAD
and AFI genes is possibly induced by the upregulation of GadE, an essential
activator of GAD and many AFI genes in E. coli O157:H7, as shown recently
(65). DMEM buffered with MOPS maintains a neutral pH at exponential phase
and therefore, it appears that under non-inducing conditions, the expression level
of gadE and the GAD system genes is markedly higher in the bovine-biased
genotype, which may enhance survivability in the bovine gastric environment (pH
2.1) (165). This inference was conﬁrmed by the model stomach assays, where
bovine-biased strains survived better than clinical genotype strains. The model
stomach represents a complex acidic environment and hence, the increased
survivability of bovine-biased strains may also be attributable to the increased
expression of stress ﬁtness genes such as dps, prA and uspA, in addition to the
acid resistance genes. Together, these ﬁndings indicate that strains of the
bovine-biased genotype 5 are more resistant to adverse environmental
conditions, which likely facilitates survival and the subsequent colonization of
bovines. A prior study observed similar results by comparing resistance to acetic
acid (pH 3.3) among E. coli O157:H7 strains isolated from environmental sources
and humans (103). Speciﬁcally, those isolates from humans were found to be
less resistant to acetic acid than isolates obtained from bovine feces (103). Our
study suggests that this difference in acetic acid resistance could be due to
differences in expression of important acid and stress resistance genes. The

variation in resistance to acidity among different genotypes within the bovine

116

population is interesting, and we demonstrate that those bovine-derived strains
that can infect humans are actually less resistant to acid than those strains that
colonize the bovine. This characteristic enables less resistant strains, or
genotypes, to express alternative factors, particularly those involved in
adherence, when in contact with human cells mainly due to the negative
interaction between acid resistance regulators and adherence genes. Although
bovine-biased genotypes that are highly resistant to acid can get transmitted to
humans, these strains cause disease much less frequently, which could possibly
be due to the decreased expression of important virulence factors.

As the nitrogen source in DMEM is glutamine, strains face an ammonia
limiting condition during growth in DMEM. This condition leads to the induction of
the nitrogen regulatory response (122), and expression data from this study
indicates that bovine-biased strains are more efﬁcient at mounting this response
at the transcriptional level. Ten RpoN-regulated genes involved in the response
were upregulated in bovine-biased strains, and important regulators and
assimilation proteins such as gan, amtB and nac, had more than a 10-fold
increase in expression. These observations indicate that strains of the bovine-
biased genotype are equipped with a more efﬁcient nitrogen regulatory response
system, which can enhance survival in ammonia limiting conditions. Such
conditions are likely encountered in the bovine gastrointestinal tract or external
environment.

A recent study from our laboratory classiﬁed clinical O157:H7 strains into

nine clades based on a highly sensitive SNP genotyping method (88). The

117

severity of disease was shown to vary between the clades, with clade 8 being
associated with HUS. Interestingly, three of the four clinical genotype 1 strains
used in this study belonged to clade 8, thereby demonstrating the presence of
this clade in the bovine reservoir. After excluding the phylogenetically distinct
clinical genotype 1 strain, the three clade 8 strains still had increased expression
of several LEE and p0157 genes. In contrast, all of the bovine-biased strains
used in this study belonged to clade 7, a lineage that was associated with less
severe clinical disease (88).

Decreasing the prevalence of 0157 colonization in cattle has become
increasingly signiﬁcant in the current strategies to control 0157 infections, as it is
less feasible to completely prevent fecal contamination of food vehicles such as
vegetables, fruit juices and beef (34). In this context, identifying the genes that
are critical for 0157 persistence in cattle is important for developing novel
prevention strategies against this pathogen. This study, along with previous
studies (119), indicates that acid and stress resistance genes encompass an
important set of genes that are crucial for survival of E. coli O157:H7 in cattle and
hence, can be used as targets for prevention measures. In addition, there is
considerable variation in the expression of different genes between genotypes of
E. coli O157:H7 isolated from cattle, with strains of clinical genotype 1 having
increased expression of important virulence factors. The upregulation of key
virulence components provides a possible explanation for the predominance of

this genotype in clinical cases.

118

ACKNOWLEDGEMENTS
This project has been supported by Federal funds from the National
Institute of Allergy and Infectious Diseases, National Institutes of Health,
Department of Health and Human Services, under Contract No. N01-AI-30055.
The authors wish to thank Lindsey M. Ouellette and Hans Steinsland for
technical assistance, Teresa M. Bergholz for helpful suggestions for the
microarray design, and Linda 8. Mansﬁeld, Galeb S. Abu-Ali and James T.

Riordan for critical review of the manuscript.

119

CHAPTER 5

Summary and future directions

120

 

 

SUMMARY

Acid resistance (AR) is a critical factor in the pathogenicity of E. coli
O157:H7 as it confers the ability to be transmitted through a variety of food
vehicles and to breach one of the ﬁrst host defense barriers—the gastric
acidity—while passing through the human stomach. E. coli O157:H7 has been
shown to be more efﬁcient in resisting complex acidic conditions when compared
to other strains of E. coli (10). This superior AR is considered as the main
contributing factor for the low infective dose of E. coli O157:H7. Four distinct
mechanisms are known to contribute to the AR of E. coli including the OXI
system, GAD system, ARG system, and LYS system, of which GAD system is
most efﬁcient (39, 75). The GAD system is comprised by two glutamate
decarboxylase isozymes, GadA and GadB, and a GABA-glutamate antiporter,
GadC. The GAD system is one of the most complexly regulated systems in E.
coli, which indicates the importance of this system in the maintenance of normal
physiology of the organism (39). Furthermore, animal experiments have shown
that a functional GAD system is necessary for the survival of E. coli O157:H7 in
cattle (1 19).

Maximum GAD expression is induced at stationary phase of growth or
when the cells are exposed to acidic pH (12, 39). At least 14 regulators are
involved in the regulation of GAD system, among which GadE functions as the
central activator of the system. A functional GadE is essential for the expression
of GAD components at all growth phases in rich or minimal media (54, 84). GadE

is a DNA binding LuxR family regulator and it induces GAD expression by directly

121

binding to the 20 bp GAD box region upstream of gadA and gadBC genes. Even
though the GAD system and its regulation are well characterized in benign
laboratory strains of E. coli, these aspects remain largely unknown in pathogenic
strains of E. coli. Most importantly, the function of GadE at a genome wide scale
is not known for any of the pathogenic strains of E. coli. E. coli O157:H7 genome
is markedly different from the laboratory strains of E. coli as it has acquired many
foreign DNA elements through horizontal gene transfer during evolution. It is
possible that during the process of integrating laterally acquired DNA elements
into the chromosomal regulatory network, a chromosomal regulator such as
GadE has evolved into a global regulator with multiple functions. Therefore, I
hypothesized that GadE has additional functions besides the positive regulation
of GAD system and the purpose of the ﬁrst part of this project was to identify the
GadE regulon and to characterize the AR phenotype of a gadE mutant E. coli
01 57: H7.

The E. coli O157:H7 Sakai strain isolated from the radish sprout outbreak
in Japan was used in this part of study (46, 96). Here, the experimental approach
for identifying the GadE regulon was to compare the transcription proﬁles of wild
type (WT) and AgadE strains at different growth phases to detect the genes
whose expression is affected by the inactivation of gadE. An E. coli O157:H7
AgadE strain was constructed by a one step inactivation method (32, 98).
Inactivation of gadE did not affect the growth patterns of E. coli O157:H7. WT
and mutant strains were grown in MOPS minimal medium up to exponential and

stationary phase and the transcriptomes were compared using whole genome

122

microarrays. Inactivation of gadE affected the expression of 60 genes
independent of growth phase and 122 genes in a growth phase-dependent
manner. Expression of gadE has been shown to be growth phase-dependent
(12) and hence, this growth phase effect on genes was expected. Additionally,
putative GadE binding sequences or GAD boxes were observed upstream of
eight genes that had signiﬁcant differential expression due to gadE inactivation
indicating a direct regulation of these genes by GadE.

Genes involved in AR such as the GAD and AFI genes comprised an
important part of the GadE regulon. Expression of all the three components of
the GAD system, gadA, gadB and gadC, was markedly decreased by the
inactivation of gadE. Similarly, hdeBAD, the AF I genes involved in resistance to
self metabolites and AR at high cell density showed decrease in expression in
AgadE. These ﬁndings were similar to that in the laboratory strain, E. coli K-12 in
which inactivation of gadE completely abolished the expression of GAD and
markedly reduced the expression of AFI genes (84, 91). Here, we also found that
the effect of gadE inactivation on GAD and AFI genes was signiﬁcantly higher at
stationary phase than at exponential phase. The regulation of GAD and AFI
genes by GadE appears to be direct because GAD boxes with 100% similarity
were detected upstream of gadA and gadBC and two putative Gad boxes were
identiﬁed upstream of hdeD.

The acid resistance phenotype of AgadE was characterized using
functional assays such as AR mechanism assays and a model stomach assay.

AR mechanism assays for GAD, ARG and OXI systems assess the effect of

123

gadE inactivation on the functioning of the three systems. As expected, there
was complete abrogation of GAD system functioning in the AgadE. Interestingly,
inactivation of gadE also affected the ability of ARG and OXI systems to protect
the strains from acidic challenge. Complementation with wild type gadE restored
the phenotype for GAD and ARG systems, but not for the OXI system. We
believe that ﬂooding the cells with wild type gadE through a multi copy plasmid
might have negatively affected the OXI system. In the model stomach system,
inactivation of gadE abolished the ability of E. coli O157:H7 to survive in this
complex acidic environment. The AgadE did not survive for even 30 min in the
model stomach whereas wild type and complement survived up to 90 min with
minimal decrease in cell counts. This demonstrates that gadE is essential for the
survival of E. coli O157:H7 in a simulated gastric environment.

A previous study in E. coli O157:H7 Sakai strain has shown an increased
adherence phenotype for AgadE. Expression analysis of WT and AgadE from the
same study found that inactivation of gadE resulted in increased expression of
LEE4 genes (155). However, the mechanism underlying this negative regulation
was not identiﬁed as the expression of Ler, the key positive regulator of LEE,
remained unchanged in the AgadE (95). Our study found that GadE negatively
regulates genes of all ﬁve of the LEE operons including Ier. To determine the
mechanism by which GadE negatively regulates LEE, a AgadEA/er strain was
constructed and the expression of LEE genes was analyzed. Inactivation of Ier

reversed the effect of gadE inactivation on LEE indicating that GadE acts through

124

Ler. Presence of a putative GAD box upstream of Ier also suggested that GadE
directly suppresses Ier expression resulting in decreased LEE expression.

Expression of LEE is affected by several environmental factors such as
temperature, osmolarity and bicarbonate ion concentration in the medium (2,
157, 164). However, the effect of acidity on the LEE is not well investigated. It is
important to understand how acidic pH affects a major virulence factor of E. coli
O157:H7 such as LEE as it may provide insights into the temporal expression of
virulence factors as the organism passes through the stomach. As GadE is a
negative regulator of LEE and as acidic pH induces GadE, LEE expression
possibly decreases at low pH. Supporting this, there was a 6 — 9-fold decrease in
expression of LEE genes including, Ier, when E. coli O157:H7 cells were grown
at pH 5.0, a moderate acidic condition. GadE appears to control this decrease in
expression of Ier as there was no reduction in Ier expression in the AgadE at pH
5.0. However, the other LEE genes tested still showed a partial decrease in
expression in the AgadE at acidic pH indicating that other regulators may also be
involved in this mechanism.

Other GAD regulators such as GadX and Eng have been shown to
negatively regulate LEE expression in EPEC (99, 139). GadX negatively
regulates LEE expression through the PerA regulator at pH 5.5 in a complex
medium (139). To determine whether the same mechanism exists in E. coli
O157:H7, a AgadX strain was constructed and the LEE expression was analyzed
at different growth conditions. Unlike in EPEC, inactivation of gadX did not have

a marked positive effect on the expression of LEE genes at acidic conditions in

125

E. coli O157:H7. The PerA regulator is not present in E. coli O157:H7 (61) and
that may be the reason for the lack of GadX regulation of LEE. On the other
hand, eng inactivation in E. coli O157:H7 resulted in a marked upregulation of
the LEE genes tir, espD, eae, and sepZ demonstrating that similar to EPEC (99),
a negative interaction between Eng and LEE exists in EHEC as well.
Subsequently, to determine the effect of gastric acidity on the expression
of the major virulence factors of E. coli O157:H7, stationary phase cells were
exposed to pH 2.0 and the expression of virulence factors were analyzed.
Exposure to pH 2.0 resulted in a marked decrease in the expression of virulence
genes, stx1, ser, LEE genes and p0157 genes. 0n the other hand, there was
an increase in expression of the three GAD system genes, gadA, gadB and
gadC. These results indicate that upon exposure to extreme acidity, E. coli
O157:H7 upregulates the expression of AR genes that are required for protection
from acidity and concurrently downregulates the expression of virulence genes
whose expression is not required in such an environment. This appears to be an
efﬁcient survival strategy because E. coli O157:H7 is not a gastric pathogen and
therefore, expressing the virulence factors in stomach is unnecessary and may

cause a heavy burden on the energy conservation and survival of the organism.

126

Identiﬁcation of differentially expressed genes between E. coli O157:H7
genotypes

E. coli O157:H7 strains isolated from clinical cases and from cattle can be
broadly divided into two genotypes, clinical and bovine-biased. Clinical
genotypes predominate in clinical cases, but are also isolated from bovine
sources. 0n the other hand, bovine-biased genotypes are isolated mostly from
bovine sources and rarely from clinical cases (14). We hypothesized that this
variation in infectivity of the two genotypes is due to differential expression of
virulence and stress ﬁtness-associated genes.

To test this hypothesis, four strains were selected from each genotype and
their exponential phase expression proﬁles were compared. A large number of
genes were differentially expressed between the two genotypes. lmportantly,
major virulence factors of E. coli O157:H7 such as LEE and p0157 plasmid
encoded genes had increased expression in clinical genotype strains. On the
other hand, genes that are essential for acid and stress resistance had higher
expression in bovine-biased genotype strains. All of the three components of the
GAD system, gadA, gadB and gadC, and many of the AFI genes were
upregulated in strains of the bovine-biased genotype. The central activator of
GAD system, gadE, also had higher expression in bovine-biased genotype,
which could be the reason for increased expression of GAD and AFI genes. The
increased expression of gadE could have contributed to the decreased
expression of LEE in the bovine-biased genotype because as we demonstrated

in these studies GadE is a negative regulator of LEE in E. coli O157:H7 (65,

127

155). This increased expression of AR genes in strains of the bovine-biased
genotype was conﬁrmed functionally by a model stomach assay in which bovine-
biased strains demonstrated at least twice as much survival rate as the clinical
genotype strains. Also upregulated in strains of the bovine-biased genotype were
the genes of the RpoN regulon. These genes are involved in the nitrogen
regulatory response in ammonia limiting conditions (122) and hence, their
increased expression could contribute to better survival in a nutrient limiting
environment.

Single nucleotide polymorphism (SNP) genotyping of the clinical and
bovine-biased genotype strains used in this study conﬁrmed that they belong to
distinct genetic populations. Three of the clinical genotype strains belonged to
clade 8, which has been shown to be associated with more severe disease
including a higher incidence of HUS (88) and one strain belonged to clade 1,
which has also been frequently isolated from clinical cases (88, 96). Bovine-
biased genotype strains on the other hand belonged to a clade that is less
frequently isolated from clinical cases, clade 7 (88).

Together, the ﬁndings from this study suggest that one of the reasons for
the variation in distribution of E. coli O157:H7 genotypes between clinical cases
and cattle could be the differences in expression levels of genes involved in
virulence and resistance to environmental conditions. Presence or absence of
genes could also lead to variation in infectivity; however, we have not addressed
that aspect in this study. Based on the results from this study, we hypothesize

that increased expression of virulence factors such as LEE and p0157 genes is

 

128

the basis for the predominance of clinical genotype strains in human cases. In
contrast, bovine-biased strains are more resistant to acid and other
environmental stress, which helps them persist in the bovine reservoir. At the
same time, due to the negative interactions between acid resistance and
virulence genes, bovine-biased genotype strains express virulence factors at a
lower level, which may be the reason for their decreased prevalence in clinical
cases. It is possible that these highly environmental stress-resistant bovine-
biased strains reach the humans through various food vehicles, but dUe to
decreased expression of important adherence and virulence factors do not cause
disease in humans. This study also demonstrated that clinical and bovine-biased
genotype strains belong to distinct SNP genotypes or clades, which vary in their
ability to cause disease in humans. Presence of clade 8 strains among the
clinical genotype strains isolated from cattle supports the argument that clade 8
outbreak strains such as the spinach strain could have originated from a cattle
farm. Moreover, it demonstrates that SNP genotyping could be used as a
technique for detecting highly virulent strains in the reservoir host itself, which

may help in prevention and control of E. coli O157:H7 outbreaks.

129

FUTURE DIRECTIONS

Effects of gadE inactivation on the survival and virulence of E. coli O157:H7
In vlvo

An important ﬁnding from this study was that inactivation of gadE in E. coli
O157:H7 resulted in increased expression of important adherence factors that
are needed for colonization of the host. Furthermore, a functional gadE was
found to be necessary for the survival of E. coli O157:H7 in a simulated gastric
environment. Naturally, the next step is to assess the survival and virulence of
AgadE in vivo using the best animal models of the human disease. Based on the
expression results, we hypothesize that even though E. coli O157:H7 AgadE
expresses virulence factors such as LEE at a higher level, it may not be able to
cause disease because of its inability to cross the gastric acid barrier in the
absence of GadE.

However, lack of a good animal model has been an issue hindering in vivo
studies for E. coli O157:H7. Several animal models such as rabbits, conventional
mice, speciﬁc pathogen free (SPF) mice and streptomycin-treated mice have
been used as disease models. However, in most of them development of clinical
signs and pathological lesions are only minimal (97, 124). Recently, germ free
Swiss-Webster mice have been shown to develop HUS after EHEC infection
even with infectious dose as low as 100 cells. In these germ free mice, the
bacteria were found adherent to the cecal and ileal mucosa and caused renal

lesions unlike other animal models (35). Therefore, germ free mice could be used

130

for assessing the pathogenicity of AgadE E. coli O157:H7. A caveat in using a
mouse model for determining the survival of AgadE is that the gastric pH of mice
is signiﬁcantly higher than that of the human stomach (92). The mouse stomach
pH varies between 3.0 (fed) and 4.0 (fasted) (92) and hence, the AgadE may be
able to survive better and the results may not be representative of the conditions
when bacteria must pass through the human stomach.

An alternative approach is to use cattle as animal models for assessing
the survival of AgadE. Cattle are the reservoir hosts of E. coli O157:H7 and the
pH of cattle abomasum (the true stomach) is similar to that of the human
stomach (165). Cattle could provide an ideal environment to determine the role of
GadE in survival in gastric acid in vivo. However, the pathogenicity of AgadE
cannot be assessed in cattle as 0157 does not cause any clinical disease in
them. Also the presence of a four chambered stomach including the rumen in
cattle may affect the results. Altemately, the rabbit animal model could be used,
which has a stomach pH of 1 — 2 (37). However, similar to some of the mouse
models, rabbit is not a well-established model for clinical symptoms for E. coli
O157:H7. Therefore, assessing the survival and pathogenicity of AgadE E. coli
O157:H7 in the same animal model appears to be a less feasible option

currently.

131

GAD system in E. coli O157:H7

This study, along with some of the previous studies from our lab (8, 10)
demonstrates that there are many differences in regulation and functioning of
GAD system in E. coli O157:H7 compared to the laboratory strain E. coli K-12, in
which most of the studies on GAD system have been conducted. However, many
aspects of the GAD system in E. coli O157:H7 still remain unclear. Most
importantly, the contribution of GadA and GadB to the AR of 0157 has not been
investigated. Speciﬁcally, it is not known whether one of these genes is sufﬁcient
or both are necessary for AR of 0157. In E. coli K-12, at pH 2.0 both gadA and
gadB are required for AR whereas at higher pH such as 2.5 either one of them
can provide protection (23). This aspect could be different in 0157 because
unlike other E. coli strains gadA and gadB sequences remain divergent with
distinct regulatory regions in 0157 (8), which might allow them to function more
independently. Also, E. coli O157:H7 has been shown to have superior AR
compared to other E. coli strains (10). Hence, a study comparing the survival of
AgadA and AgadB E. coli O157:H7 strains at pH 2.0 — 2.5 in minimal and
complex environments is needed to understand the functioning of GAD system in
0157. l hypothesize that under a minimal acidic environment where the only
stress is acidity, presence of either gadA or gadB is sufﬁcient for survival of E.
coli O157:H7. However, in a complex acidic condition such as model stomach,
which presents multiple stresses, both these genes may be essential for

maximum survival.

132

Two conditions that induce the GAD system are stationary phase of
growth and acidic pH. Stationary phase induction of GAD system is well
investigated and it is known that the alternative sigma factor, RpoS regulates the
GAD expression through GadXW at the stationary phase (39). However, the
signaling pathways and regulators that induce the GAD system at acidic pH,
especially at exponential phase, remain unknown. It has been shown that low pH
conditions lower the physiological concentration of CAMP and CRP. This
reduction in CAMP-CRP levels can initiate increased transcription of RpoS, which
can then induce gadX and gadE transcription leading to increased expression of
gadABC (86). However, the expression of RpoS is minimal at exponential phase
(39) and therefore I hypothesize that other unidentiﬁed regulators are also
involved in the acidic induction of GAD system at exponential phase. To address
this, a transposon mutagenesis approach could be used in which the survival of
mutants at acidic pH during exponential phase is assessed. This might help to
identify the regulators that are involved in the induction of the GAD system at

acidic pH.

133

Interactions between GadE and Ler in E. coli O157:H7

Comparison of E. coli O157:H7 wild type and AgadE expression proﬁles
showed that GadE is a negative regulator of LEE and a functional Ler is essential
for this negative regulation. Presence of a putative GAD box region upstream of
Ier implied that GadE directly binds to this GAD box and repress the Ier
expression. However, this binding was not conﬁrmed experimentally. An
electrophoretic mobility shift assay (EMSA) with tagged-GadE protein and a DNA
fragment containing the putative GAD box upstream of Ier could conﬁrm whether
the Ier GAD box is a functional GadE binding region. Further, once conﬁrmed as
a GadE binding region, this GAD box could be inactivated in a gadE-over
expressing strain to demonstrate that in the absence of the Ier GAD box, GadE

mediated repression of Ier and LEE does not occur.

134

Differences between clinical and bovine-biased genotypes of E. coli
O157:H7

Numerous virulence and acid/stress resistance genes were found to be
differentially expressed between strains of the clinical and bovine-biased
genotypes of E. coli O157:H7 in this study. Increased expression of AR genes in
the bovine-biased genotype was conﬁrmed functionally by model stomach
assays. However, phenotypic assays have not been done to conﬁrm that the
statistically signiﬁcant upregulation of LEE genes and p0157 encoded virulence
genes in the clinical genotype is biologically signiﬁcant.

l hypothesize that increase in expression of adherence factors such as
LEE in clinical genotype can lead to an increase in adherence of these strains to
the epithelial cells. This could be conﬁrmed by epithelial cell association assays,
which measure the adherence and invasion of bacteria to the epithelial cell. In
our lab, bovine mammary epithelial cells (MAC-T) have been used extensively to
assess the association of E. coli O157:H7 with host cells and the same could be
used for comparing clinical and bovine-biased genotypes. Another approach
would be to quantify the association of bacteria with epithelial cells using ﬂow
cytometry, in which the bacteria would be labeled with CF DA-SE dye and the
labeled bacteria would be used to infect the MAC-T cells. The level of
ﬂuorescence from MAC-T cells, as assessed by ﬂow cytometry, will indicate
levels of adherence/invasion of E. coli O157:H7.

Enterohemolysin (Ehx) assay, which quantiﬁes the hemolytic activity of E.

coli O157:H7 in deﬁbrinated sheep blood (129) could be used to conﬁrm the

135

increased expression of p0157-encoded hemolysin (eth) in clinical genotype
strains.

Finally, animal model experiments comparing the pathogenicity of clinical
and bovine-biased genotypes are needed to conﬁrm the results of expression
studies and phenotypic assays. Germ free mice, which have been recently
established as a model for E. coli O157:H7-induced disease, could be used for
this purpose.

SNP genotyping of the strains used in this study showed that clinical and
bovine-biased strains belong to distinct genetic populations of E. coli O157:H7.
Clinical genotype strains belonged to hyper virulent clade 8 and clade 1 whereas
bovine-biased strains were all clade 7, a group that causes human disease less
frequently (88). An extension of these ﬁndings would be to conduct SNP
genotyping of a larger number of bovine E. coli O157:H7 isolates that belong to
clinical and bovine-biased genotypes and analyze the distribution of clades
between them. If the clinical genotype strains isolated from bovines belong to
groups that cause severe disease such as clade 8 and clade 2, that could
provide further explanation to the predominance these genotypes in human
cases. This will also validate SNP genotyping as a superior method for identifying

virulent E. coli O157:H7 strains in clinical settings and cattle farms.

136

APPENDICES

137

APPENDIX 1

RIMAANOVA: steps in expression data analysis

1. Preparing the data ﬁle

Assemble the data from all the arrays into one MS excel ﬁle that contains the
following information; i) location information for a spot including grid, metarow,
metacolumn, row and column ii) probe lD iii) data from each array in the order,
Cy3, Cy5 and ﬂag. Save the ﬁle in TAB delimited text format.

2. Preparing the design ﬁle

This ﬁle contains information about the microarray experimental design. It is
prepared in MS excel. The number of rows depends on the number of arrays and
number of columns depends on the number of factors that are included in.the
design. The ﬁle should include information about array, dye and sample. Sample
indicates the biological replicate. Also included in design ﬁle is information about
the factors included in the experimental design such as strain, growth phase, and
treatment. Save the ﬁle in TAB delimited text format.

3. Launch R and load MAANOVA

4. Load the data

Use read.madata function.

5. Normalize the data

Use transfonnmadata function to normalize the data by spatial-intensity joint
lowess (rlowess).

6. Create the data

138

The ﬁnal data set used for statistical analysis is created by createData function
by collapsing the replicates and log transforming the values.

7. Make the model

Make a statistical model for the data analysis using makeModel function. Include
all the factors in the formula such as array, dye, sample, strain, and growth
phase in the same order as in the design ﬁle and mention which are the random
factors.

8. Fit the model into the data

Use ﬁtmaanova function. Here the statistical model is ﬁtted into the data for each
gene.

9. Test for differential expression

Use matest function. Signiﬁcant differences in expression are identiﬁed by F test.
Four types of F tests are available in maanova among which Fs test is
considered to provide the best results as it does not assume variance is
homogenous across genes. P-values are calculated by permutation test.

10. Correction for multiple comparisons

Use adevaI function. This step calculates FDR adjusted p-values for the test

results by Benjamini-Hochberg linear step-up correction.

139

APPENDIX 2

TABLE 2.81: Genes showing signiﬁcant strain effect (FDR < 0.1)

 

 

ECs Geneb Function Expression Expre
number'3 ratioc ssion
(AgadE/ ratiod
WT) (Stat/e
nil
Genes signiﬁcantly down-regulated in AgadE
ECs 2294 putative oxidoreductase, major subunit 0.75 1.8
E05 3904 putative transport periplasmic protein 0.82 0.5
Genes signiﬁcantly up-regulated In AgadE
ECs 0323 yagZ hypothetical protein 1.32 2.0
ECs 1114 nusA partial putative tail component of prophage 1.22 1.8
CP-933R
ECs 1305 ”CT putative helicase 1.19 3.2
ECs 1471 fabG 3—oxoacyl-[acyl-carrier-protein] reductase 1.25 1.14
ECs 1830 yciF putative structural proteins 1.31 6.2
ECs 1994 nIeG2-2 non-LEE effector protein 1.26 2.5
ECs 2060 vgrE * unknown protein associated with Rhs 1.24 2.2
element, VgrE protein
E03 2156 nIeGZ-3 non-LEE effector protein 1.28 2.9
ECs 4262 hypothetical protein 1.26 0.5
ECs 4270 cysG hypothetical membrane protein 1.29 0.6
ECs 4271 recG putative ATP binding protein of ABC 1.29 1.3
transporter
E05 4272 pde hypothetical membrane protein 1.32 3.5
ECs 4280 iIvG putative DNA processing chain A 1.30 3.3
ECs 4300 hcaT putative membrane protein 1.43 7.9
E05 4307 bass Signal transduction mechanisms 1.43 5.4
E09 4326 yeeA unknown function 1.22 0.2
ECs 4327 putative phospholipid biosynthesis 1.17 0.3
acyltransferase
ECs 4334 rhaB hypothetical protein 1.23 0.6
ECs 4335 yegB putative membrane! transport protein 1.43 0.6

140

 

ECs Geneb Function Expression Expre
number‘ ratioc ssion
(AgadE/ ratioCl

WT) (Stat/e

 

xp)
E05 4336 equ hypothetical membrane protein 1.32 0.6
E03 4337 ynhE hypothetical lipoprotein 1.28 0.6
ECs 4338 MM putative 3-oxoacyl-synthase II 1.27 0.8
E03 4339 putative beta-hydroxydecanoyl-ACP 1.22 0.8
dehydrase
ECs 4382 chuT putative hemin binding protein 1.39 7.6
ECs 4393 thU member of acid ﬁtness island, component of 1.46 1.5
the MthF multidrug transporter
ECs 4550 espF type III secretion system, secreted effector 1.30 0.6
protein
ECs 4553 cesDZ type III secretion system chaperone 1.36 0.5
E05 4555 espD type III secretion system, secreted 1.38
translocator protein
ECs 4558 escD type III secretion system, structural protein 1.18 1.3
ECs 4560 cesT type III secretion system, chaperone 1.38 0.3
ECs 4561 tir translocated intimin receptor protein 1.39 0.5
ECs 4562 map type III secretion system, secreted effector 1.26
protein
ECs 4563 cesF type III secretion system, chaperone 1.31 1.6
ECs 4564 espH type III secretion system, secreted effector 1.33 3.1
protein
E03 4565 sepQ type III secretion system, structural protein 1.27 2.9
ECs 4567 orf15 orf of unknown function 1.19 0.9
E03 4571 sepZ * type III secretion system, secreted effector 1.36 6.4
protein
ECs 4572 rorf8 orf of unknown function 1.26 3.0
ECs 4575 ’ escC * type III secretion system, structural protein 1.21 0.3
ECs 4584 orf5 orf of unknown function 1.34 0.5
E03 4585 orf4 orf of unknown function 1.41 0.6
ECs 4586 orf3 orf of unknown function 1.37 0.6
ECs 4587 cesAB type III secretion system, chaperone 1.35 0.6
ECs 4588 Ier * type III secretion system, regulator 1.35 0.8

141

 

ECs Gene” Function Expression Expre

 

number” ratio” ssion
(AgadEl ratio”
WT) (Stat/e
xp)
ECs 4590 espG type III secretion system, secreted effector 1.27 0.6
protein
ECs 5072 putative carbohydrate ABC transport system 1.23 0.5
permease
E05 5074 IysA putative histidine protein kinase 1.30 0.5
ECs 5110 yde lysine tRNA synthetase, inducible; heat 1.39 0.8
shock protein
ECs 5218 treR repressor of treA,B,C 1.28 4.8
ECs 5242 putative integrase 1.31 0.3
ECs 5248 orf of unknown function 1.28 1.2
ECs 5249 putative resolvase 1.23 1.2
E03 5256 orf of unknown function 1.28 0.5
ECs 5257 orf of unknown function 1.23 0.6
ECs 5305 orf of unknown function 1.21
ECs 5532 orf of unknown function 1.26 0.7
p0157p38 plasmid gene 1.23 1.4
p0157p80 plasmid gene 1 .23 0.09

 

” Locus ID for E. coli 0157:H7 Sakai strain (Genbank # BAOOOOO7).

” The genes marked with asterisks have putative GAD boxes upstream of their sequence.

° Expression ratio = 2 [”32 (”gadE ) “ WWW

” Expression ratio between two growth phases = 2 “”22 (“at )’ “Map” determined by

microarray, ratios are reported only for genes with a signiﬁcant growth phase effect

(FDR<005)

142

APPENDIX 3
TABLE 2.82: Genes with signiﬁcant Interaction between growth phase

(exponential and stationary) and strain (wild type and A gadE) effects

 

 

(FDR< 0.05)

E05 Gene” Function WT/ WT/

number AgadE AgadE

Exp Stat
phase phase

ECs0017 nhaA putative cell division protein 1.2 0.7

ECsO120 lpdA lipoamide dehydrogenase (NADH); 1 .1 0.8
component of 2-oxodehydrogenase and
pyruvate complexes

ECsO282 unknown protein from prophage CP-933H 1.1 0.8

5030283 Iny unknown protein from prophage CP-933H 1.1 0.9

ECsO345 yng hypothetical protein 1.2 0.8

ECsO464 tsx nucleoside channel; receptor of phage T6 1.1 0.8
and colicin K

ECs0483 cyoD cytochrome c ubiquinol oxidase subunit IV 1.2 0.8

ECs0484 cyoC cytochrome c ubiquinol oxidase subunit III 1.2 0.8

ECs0681 ybeL putative alpha helical protein 0.8 1.3

ECsO702 erB putative RNA 0.8 1.4

ECs0746 sdhC succinate dehydrogenase, cytochrome 1.2 0.8
b556

ECsO747 sth succinate dehydrogenase, hydrophobic 1.2 0.8
subunn

ECs0748 sdhA succinate dehydrogenase, ﬂavoprotein 1.2 0.8
subunﬁ

ECsO749 sth succinate dehydrogenase, iron sulfur 1.2 0.7
protein

ECsO750 - hypothetical protein 1.1 0.7

ECs0751 sucA 2-oxoglutarate dehydrogenase 1.2 0.7

(decarboxylase component)

143

 

 

ECs Gene‘ Function WT/ WTI
number AgadE AgadE
Exp Stat
phase phase
ECs0752 sucB 2-oxoglutarate dehydrogenase 1.1 0.7
(dihydrolipoyltranssuccinase E2
component)
ECs0759 htrE unknown function 1.1 0.8
ECsO804 - unknown protein encoded by prophage CP- 1.1 0.9
933K
ECs0881 ybiI hypothetical protein 0.7 1.5
ECs1012 ompF outer membrane protein 1a (la;b;F) 1 .1 0.8
ECs1028 ych putative chaperone 1.1 0.9
ECs1122 - partial putative outer membrane protein 1.1 0.9
Lom precursor encoded by prophage CP-
933R
ECs1257 - putative synthetase 0.9 1 .3
ECs1271 ych hypothetical protein 1.2 0.8
ECs1355 terD putative tellurium resistance protein TerD 1.1 0.8
ECs1356 terE putative phage inhibition, colicin resistance 1.1 0.8
and tellurite resistance protein
ECs1377 yjiM unknown function 1 .1 0.9
ECs1490 ych hypothetical protein 0.8 1.3
ECs1663 ompT outer membrane protein 3b (a), protease 1.2 0.7
VII
ECs1668 minE cell division topological speciﬁcity factor, 1 .1 0.8
reverses MinC inhibition of ftsZ ring
formation
ECs1669 minD cell division inhibitor, a membrane ATPase, 1.1 0.8
activates minC
ECs171 1 ychM hypothetical protein 0.7 2.1
ECs1722 chaB cation transport regulator 0.6 3.2
ECs1744 oppB oligopeptide transport permease protein 1.2 0.8
ECs1825 yicL unknown function 1 .1 0.8

144

 

 

ECs Genea Function WT/ WT/
number AgadE AgadE
Exp Stat
phase phase
E031829 yciE hypothetical protein 1.2 0.7
E031879 goaG 4-aminobutyrate aminotransferase 0.8 1 .4
E031880 pspF* psp operon transcriptional activator 0.6 2.9
E031902 tyrR putative acyltransferase 0.5 3.4
E032018 ygiB unknown function 1 .1 0.9
E032061 - unknown protein associated with Rhs 1.1 0.8
element
E032097 gadC" Glutamate-GABA antiporter 0.5 4.1
E032098 gadB* glutamate decarboxylase isozyme 0.4 8.0
E032099 pqu putative peptidase 0.8 1.5
ECs2100 yddB hypothetical protein 0.7 2.0
E032260 unknown protein encoded by cryptic 0.5 4.3
prophage 0P-933P
E032279 mdoB putative repressor protein encoded by 0.8 1.2
cryptic prophage 0P-933P
E032432 - hypothetical protein 0.9 1.2
ECs2453 - hypothetical protein 0.8 1.4
E032514 fadD acyl-CoA synthetase, long-chain-fatty-acid— 0.8 1 .4
00A ligase
E032613 ﬁn cytoplasmic ferritin (an iron storage protein) 1.2 0.8
E032692 - hypothetical protein 0.8 1.3
E032839 - GDP-mannose dehydratase 1.2 0.8
E032840 cchA glycosyl transferase 1.1 0.8
E032841 ydeB perosamine synthetase 1.2 0.8
E032887 baeR hypothetical protein 0.9 1.3
E033027 rﬁ‘H putative salicylate hydroxylase 1.2 0.8

145

 

 

E03 Gene” Function WT/ WT/
number AgadE AgadE
Exp Stat
phase phase
E033041 mgIA ATP-binding component of methyl- 1.2 0.8
galactoside transport and galactose taxis
ECs3174 - putative aminotransferase 1 .1 0.8
ECs3213 aroC chorismate synthase 0.8 1.8
ECs3221 - putative ﬁmbrial usher 1.1 0.8
E033223 hypothetical protein 0.8 1.4
E033224 - putative enzyme 07 2.4
E033228 - hypothetical protein 1.2 0.7
5033306 amiA N-acetylmuramoyl-l-alanine amidase l 1.2 0.8
5033307 hemF coproporphyrinogen III oxidase 1.2 0.8
E033340 dapA dihydrodipicolinate synthase 1.1 0.8
ECs3389 pepB putative peptidase 1.2 0.8
E033390 yﬂ'rJ hypothetical protein 1.1 0.8
E033391 fdx [2FE-2S] ferredoxin, electron carrer protein 1.1 0.8
E033393 yﬂiE hypothetical protein 1.1 0.8
E033395 NifU-Iike protein 1.2 0.7
E033396 yth cysteine desulfurase 1.1 0.8
E033397 - hypothetical protein 1.2 0.8
E033416 yth hypothetical protein 1.2 0.8
E033422 yfhK putative prophage integrase 0.8 1.6
E033540 proV ATP-binding component of transport 0.9 1.2
system for glycine, betaine and proline
E033595 rpoS RNA polymerase, sigma S (sigma38) factor 0.8 1.5
ECs3596 nIpD lipoprotein 0.9 1 .3

146

 

 

503 Gene” Function WT/ WT/
number AgadE AgadE
Exp Stat
phase phase
5033696 IysR positive regulator for lys 0.9 1.3
5033704 yqu putative sensory transducer 0.6 2.4
5033720 yraJ putative transcriptional regulator 1.1 0.9
5033721 phnE putative integral membrane protein- 1.1 0.8
component of type III secretion apparatus
503391 1 ygiN hypothetical protein 0.9 1 .3
5033929 ribB 3,4 dihydroxy-2-butanone-4-phosphate 1.1 0.8
synthase
5033969 ygiR hypothetical protein 0.9 1.3
5034000 yhaB hypothetical protein 0.9 1.4
5034188 hopD leader peptidase HopD 1.1 0.8
5034213 yth hypothetical protein 0.9 1.3
5034294 yhhA hypothetical protein 0.8 1.4
5034363 yhiM hypothetical protein 0.5 2.8
5034389 hdeB member of acid ﬁtness island 0.6 2.8
5034390 hdeA member of acid ﬁtness island 0.3 11.1
5034391 hdeD* member of acid ﬁtness island 0.6 2.5
5034392 gadE member of acid ﬁtness island 0.5 4.4
5034397 gadA" glutamate decarboxylase isozyme 0.4 6.4
5034483 IIdD L-Iactate dehydrogenase 0.5 4.8
5034484 yibK hypothetical protein 0.4 5.4
5034485 cysE serine acetyltransferase 0.8 1.6
5034490 yibO putative 2,3-bisphosphoglycerate- 0.4 5.9
independent phosphoglycerate mutase
5034491 yibP putative membrane protein 0.6 3.4

147

 

 

503 Gene” Function WT/ WT/
number AgadE AgadE
Exp Stat
phase phase
5034579 yﬁl hypothetical protein 0.9 1.3
5034608 - unknown function 0.9 1.2
5034636 dnaN DNA polymerase III, beta-subunit 0.6 2.8
5034683 gidA glucose-inhibited division; chromosome 1.1 0.8
replication?
5034737 - hypothetical protein 0.5 5.4
5034738 cyaY, Iron binding frataxin homolog 0.6 2.6
5034739 dapF diaminopimelate epimerase 0.6 2.8
5034745 - hypothetical protein 0.8 1.6
5034854 mch unknown function 0.7 1.9
5034891 udhA soluble pyridine nucleotide 1.1 0.8
transhydrogenase
5035030 yij hypothetical protein 1.2 0.8
5035080 phnK hypothetical protein 1.2 0.8
5035092 ych hypothetical protein 1.1 0.8
50351 16 n’dC hypothetical protein 0.7 2.5
5035124 mopA GroEL, chaperone Hsp60, heat shock 1 .1 0.8
protein
5035163 aidB putative acyl coenzyme A dehydrogenase 0.8 1.5
5035215 nrdD anaerobic ribonucleoside-triphosphate 0.9 1 .2
reductase
5035253 hemN partial putative integrase 0.8 1.2
5035334 osmY hyperosmotically inducible periplasmic 0.8 1.3
protein
5035496 - unknown function 0.9 1.3

 

148

a The genes marked with asterisks have putative GAD boxes upstream of their sequence.

APPENDIX 4

T ABLE 2.83: Primer sequences used for Q-PCR (SYBR Green chemistry).

 

Primer Sequence (5’ to 3’) Annealing
temperature

163-982 CGATGCAACGCGAAGAACCT 55°C
163-1143 CCGGACCGCTGGCAACAAA

tir-664 ACTTCCAGCCTTCGTTCAGA 57°C
tir-869 TTCTGGAACGCTTCT'ITCGT

espZ-46 GCGACCTCACTCAGTGGAA 55°C
espZ-193 CCGCTGCAATACCTGTACCT

espD-F GGTTACAAGTCGCACTGAGGA 59°C
espD-R CCAGGGATAACAGAGTGACCA

espF-F AGCAGCCAGGTGACTTCATT 54°C
espF-R CTGTGCAATGGGCGGTAAAG
eae-2188 GCCGGTAAAGCGACTGTTAG 55°C
eae-2325 ATTAGGCAACTCGCCTCTGA
espA-128 AGGCTGCGATTCTCATGTTT 57°C
espA-310 GAAGTTTGGCTTTCGCA‘I‘I'C
espB-319 TCAGCATTGGGGATCTTAGG 57°C
espB-487 CTGCGACATCAGCAACAC‘I‘I’
gadC-571 TGCAAGACCTTCTTCCCTGA 55°C
gadC-694 GCCCTGGGTTACTCATTTCA

hdeA-F GAAGAT'I'I'CCTGGCTGTGGA 59°C
hdeA-R ACGGTTGCAATACCCTGAAC

hdeB-F CACTGGTGAACGCACAATCT 59°C
hdeB-R TTTCTTCATGCAGCATCCAC

gadX-F 'I‘I'ACAACCGAACATGCGAAC 59°C
gadX-R CAGACTTGGACTCATCAACAGC

eng-F GAGTTGACTGAAGGCGGAAG 59°C
eva-R GGTCA‘ITI'TTAGCGGAGACG

 

149

APPENDIX 5
TABLE 4.81: Genes signiﬁcantly differentially expressed between clinical
genotype 1 and bovine-biased genotype 5 as detected by MAANOVAIFs
test (FDR < 0.1)

 

503 no. Gene Function CIB
Genes up-regulated in clinical genotype 1

5030124 speD S-adenosylmethionine decarboxylase 1 .72
5030125 speE sperm idine synthase 1 .78
5030228 hypothetical protein 2.39
5030239 hypothetical protein 2.09
5030273 hypothetical protein 4.48
5030274 unknown 1 .91
5030288 hypothetical protein 2.07
5030290 hypothetical protein 1.76
5030291 hypothetical protein 1.71
5030299 putative DNA binding protein 1.71
5030331 putative NADH-dependent ﬂavin oxidoreductase 1.51
5030445 rdgC recombination associated protein 1.60
5030603 Rhs core protein 1.70
5030744 putative ﬁmbrial-Iike protein 3.1 1
5030754 sucD succinyl-CoA synthetase alpha subunit 1.59
5030764 putative glutamate mutase S - hypothetical protein 1.65
5030815 anti-termination protein 1.53
5030829 putative protease/scaffold protein 2.13
5030837 putative tail length tape measure protein precursor 1.52
5030852 bioA 7,8—diaminopelargonic acid synthetase 1.60
5030853 bioB biotin synthetase 1.53
5031053 ych putative sulﬁte reductase 1.58
5031 127 hypothetical protein 3.1 3
5031 139 ych hypothetical protein 1 .53
5031 166 hypothetical protein 1 .95
5031 1 67 hypothetical protein 2.1 5
5031220 putative terminase large subunit 1 .97
5031222 hypothetical protein 2.91
5031224 hypothetical protein 1.76
5031225 hypothetical protein 1.55
5031226 hypothetical protein 1.57
5031228 putative tail ﬁber protein 4.50
5031230 hypothetical protein 2.53
5031235 hypothetical protein 1 .66
5031327 ureG 2.60
5031349 hypothetical protein 3.03
5031370 putative glucosyl-transferase 1 .92
5031378 hypothetical protein 1 .79
5031386 hypothetical protein 1.68

150

 

 

5031386 hypothetical protein 1.83
5031 389 hypothetical protein 1 .78
5031814 hypothetical protein 3.00
5032116 putative ATP-binding component of a transport system 2.04
50321 56 hypothetical protein 1 .55
5032276 putative replication protein 1.76
5032332 hypothetical protein 1.73
5032813 sch exonucleasel 1.97
5032947 putative minor tail protein 1.67
5033075 rsuA 168 pseudouridylate 516 synthase 1.74
5033078 yejK nucleoid-associated protein 1.59
5033550 gshA gamma-glutamate-cysteine ligase 1.85
5034426 putative ﬁmbrial protein precursor 2.17
5034565 sepQ TTSS 1.61
5034576 cesD Secretion of EspD 1.77
5034591 rorf1 unknown 1 .58
5034653 hypothetical protein 2.92
5035073 putative ATP-binding component of sugar ABC transporter 1.81
5035318 yjiN putative oxidoreductase 1.55
p0157p02 etpC T288 2.75
p0157p05 eth T288 1.86
p0157p07 etpH T288 1.91
p0157p09 eth T288 2.01
p0157p10 etpK T288 2.22
p0157p11 etpL T288 1.75
p0157p12 etpM T288 1.92
p0157p14 etpO T288 1.69
p0157p18 thA hemolysin A 1 .73
p0157p24 repFIB RepFlB 1.67
p0157p58 toxB toxin B 1.59
p0157p79 hypothetical protein 2.44
p0157p81 hypothetical protein 2.12
ECs no. Gene Function BIC
Genes up-regulated In bovine-biased genotype 5

5030068 araC transcriptional regulator for ara operon 1.79
5030075 IeuD isopropylmalate isomerase subunit 2.49
5030076 leuC 3-isopropylmalate isomerase (dehydratase) subunit 2.45
5030077 IeuB 3-isopropylmalate dehydrogenase 2.40
5030231 unknown function 1.62
5030419 tauA taurine transport system periplasmic protein 1.65
5030420 tauB taurine ATP-binding component of a transport system 1.74
5030499 ybaE hypothetical protein 1.67
5030538 ybaS putative glutaminase 3.00
5030645 ahpF hypothetical protein 1.51
5030732 hypothetical protein 2.04
5030848 unknown protein encoded by prophage CP-933K 4.20
5030868 hypothetical protein 1.86
5030890 dps DNA protection during starvation 3.56
5030892 ome outer membrane protein X 1.71

151

5030957
5030966
5030992
5031 077
5031 159
5031 181
5031 182
5031 197
5031 201
5031 31 1
5031 428
5031 508
5031 509
5031 546
5031 683
5031 722
5031 743
5031 744
5031 746
5031 747
5031 769
5031 769

5031 800
5031 831
5031 878
5031 975
5032044
5032053
5032086
5032097
5032098
50321 96
5032206

5032236
5032300
5032370
5032384
5032430
5032431
5032546
5032595
5032692
5032758
5032761
5032825
5032900
5032942
5033018
5033061

cspD
ycaL

ninE
ninG

ych
chaB
oppA
oppB
oppD
oppF

yciG

ordL

yncB
osmC
gadC
gadB

mlc

Ipp

tap

hisA

yehZ
fruB

pyruvate oxidase

cold shock protein

putative heat shock protein

hypothetical protein

hypothetical protein

putative anti-termination protein N

hypothetical protein

hypothetical protein

unknown protein encoded by bacteriophage BP-933W
unknown in IS600

hypothetical protein

unknown protein encoded by prophage CP-933N
unknown protein encoded by prophage CP-933N
unknown protein encoded by prophage 0P-933N
putative sporulation protein

cation transport regulator

oli90peptide transport; periplasmic binding protein
oligopeptide transport permease protein

ATP-binding protein of oligopeptide ABC transport system
ATP-binding protein of oligopeptide ABC transport system
ﬁmbrial minor pilin protein precursor

putative ﬁmbrial minor pilin protein precursor

putative tail component encoded by cryptic prophage CP-
933M

hypothetical protein

probable oxidoreductase

unknown protein encoded by cryptic prophage CP-933M
putative transport protein

putative oxidoreductase

osmotically inducible protein

GABA-glutamate antiporter

glutamate decarboxylase isozyme

hypothetical protein

unknown protein encoded within prophage CP-9330
putative tail assembly protein of cryptic prophage CP-
933P

putative NAGC-like transcriptional regulator
cyclopropane fatty acyl phospholipid synthase

murein lipoprotein

hypothetical protein

hypothetical protein

hypothetical protein

methyl-accepting chemotaxis protein IV

hypothetical protein

hypothetical protein

unknown protein encoded within prophage CP-933U
imidazolecarboxamide isomerase

hypothetical protein

hypothetical protein

putative transport system permease protein

PTS system, fructose-speciﬁc IlAlfpr component

152

2.48
2.49
1.59
1.70
2.96
3.06
3.55
2.31
1.74
2.02
1.63
2.02
2.44
1.64
2.96
2.37
2.10
1.56
1.82
1.73
2.60
3.09

1.53
1.55
1.50
2.02
1.54
1.55
2.14
2.48
4.35
2.32
2.05

1.54
1.51
1.96
1.99
1.83
2.47
1.69
1.56
2.52
2.05
2.57
2.14
1.50
1.74
1.73
4.47

5033092
50331 04
503311 1
50331 89
50331 94
5033206
5033326
5033327
5033409
5033533
5033680
5033839
5033973
5033974
5033980
5033981
503421 2
503421 3
5034273
5034275
5034276
5034278
5034377
5034389
5034390
5034391
5034394
5034395
5034397
503441 2
5034427
5034440
5034483
5034490
5034660
5034706
5034734
5034737
5034760
5034871
5034957
5034958
5034959
5034969
5034970
5035038
5035039
50351 20
50351 33
5035253

ompC

argT

taIA

ppdC
mItC

uxaA
uxaC

yqiD

algP
9’90
ngX
asd
slp
hdeB
hdeA
hdeD
yhrV

gadW

gadA

IIdD
yibO
phoU
iIvA
hemD

YSQA
katG

frdC

cytochrome c-type protein

outer membrane protein 1b

hypothetical protein
UDP-galactopyranose mutase

Iysine-, arginine-, ornithine-binding periplasmic protein
putative transport protein

transaldolase A

transketolase 2 isozyme

hypothetical protein

hypothetical protein

hypothetical protein

transport of nucleosides, permease protein
altronate hydrolase

uronate isomerase

hypothetical protein

hypothetical protein

induced in stationary phase, recognized by rpoS
hypothetical protein

glycogen phosphorylase
glucose-1-phosphate adenylyltransferase
part of glycogen operon, a glycosyl hydrolase
aspartate-semialdehyde dehydrogenase
outer membrane protein

periplasmic chaperone

protection from organic acid metabolites
acid resistance at high cell density
multidrug efflux pump protein

ARAC-type GAD system regulator
glutamate decarboxylase isozyme
hypothetical protein

hypothetical protein

hypothetical protein

L-lactate dehydrogenase

Putative phosphoglycerate mutase
negative regulator for pho regulon
threonine deaminase (dehydratase)
uroporphyrinogen lll synthase
hypothetical protein

putative enzyme

catalase; hydroperoxidase HPI(I)
hypothetical protein

hypothetical protein

hypothetical protein

putative portal protein

hypothetical protein

hypothetical protein

hypothetical protein

aspartate ammonia-Iyase (aspartase)
fumarate reductase, anaerobic

partial putative integrase

153

2.19
1.51
2.52
2.24
1.54
2.43
1.97
2.19
1.69
2.58
2.08
1.57
1.52
1.57
1.97
1.91
2.37
2.21
1.52
1.50
1.55
1.61
2.45
3.37
5.60
2.67
2.24
1.79
1.87
1.77
1.74
1.82
1.70
1.56
1.78
1.80
2.13
3.38
1.81
1.71
2.37
2.89
2.17
1.90
2.61
2.21
2.18
2.83
1.54
1.87

5035303
503531 2
503531 3
5035325
5035326
5035334

yti
1270
bglJ

osmY

hypothetical protein

hypothetical protein

putative carbon starvation protein

putative regulator

2-component transcriptional regulator
hyperosmoticajy inducible periplasmigarotein

154

1.84
2.52
3.58
1.67
2.13
3.01

APPENDIX 6
TABLE 4.82: Genes differentially expressed between clinical genotype 1

and bovine-biased genotype 5 as detected by SAM (FDR < 0.05)

 

50s no. Gene Function CIB
Genes upregulated in clinical genotype 1

5030026 rpsT 308 ribosomal subunit protein 820 2.04
5030063 rapA probable ATP-dependent RNA helicase 2.27
5030201 abc ATP-binding component of a transporter 2.29
5030207 dniR transcriptional regulator for nitrite reductase 3.17
5030228 hypothetical protein 2.27
5030239 hypothetical protein 2.1 5
5030251 yafK hypothetical protein 1.99
5030265 gpt guanine-hypoxanthine phosphoribosyltransferase 3.14
5030273 unknown protein from prophage CP-933H 4.14
5030274 repressor protein CI 1.89
5030288 unknown protein encoded by IS2 1.92
503031 1 putative transcriptional regulator 2.17
5030338 putative dehydrogenase 1.89
5030351 Unknown function 1.96
5030456 queA synthesis of queuine in tRNA 2.19
5030477 yajK putative oxidoreductase 1.90
5030488 yajG putative polymerase/proteinase 1.88
5030510 yIaB hypothetical protein 2.17
5030522 apt adenine phosphoribosyltransferase 2.12
5030584 purK phosphoribosylaminoimidazole carboxylase 1.84
5030586 ybbF hypothetical protein 1.83
5030588 cysS cysteine tRNA synthetase 1.88
5030673 mrdA cell elongation 2.18
5030699 erA hypothetical protein 1.92
5030716 ybe hypothetical protein 2.06
5030744 ybgD putative ﬁmbriae structural protein 3.34
5030771 ybgC hypothetical protein 2.19
5030772 toIQ inner membrane protein 2.17
5030800 yth putative integrase encoded by prophage CP- 2.11
933K
5030829 putative protease encoded in prophage CP-933K 2.11
5030883 putative outer membrane receptor for iron 2.07
transport
5030896 ybiS hypothetical protein 2.26
503091 5 yIiG hypothetical protein 1 .97
5030939 ybjF putative enzyme 1.85
5030944 artM arginine 3rd transport system permease protein 1.53
5030945 artQ arginine 3rd transport system permease protein 1.81
5030946 art! arginine 3rd transport system periplasmic binding 1.94
protein
5030947 artP ATP-binding component of 3rd arginine transport 1.65

155

5030960
5030997
5031 127

5031142
5031166
5031167
5031192

5031 203
5031 220
5031 222
5031228
5031230
5031 233

5031234
5031236

5031 327
5031 349
5031 362
5031 370
5031 378
5031 379
5031 386
5031 387
5031 398
5031433
5031464
5031494
5031 500

5031564
5031605
5031612

ECs1 646

5031 703 .

5031 705
5031 709
5031 733
5031 740
5031814
5031854
5031859

ybjE
msbA

ymcC

ureG

yceA
yceC
ych
potC

yceC

tdk

pyrF
rnb

system

putative surface protein

ATP-binding transport protein

unknown protein encoded by cryptic prophage
CP-933M

putative regulator

hypothetical protein
hypothetical protein

unknown protein encoded by bacteriophage BP-

933W

antitermination protein 0 of bacteriophage BP-
933W

partial putative terminase large subunit of
bacteriophage BP-933W

unknown protein encoded by bacteriophage BP-

933W
putative tail ﬁber protein of bacteriophage BP-
933W

unknown protein encoded by bacteriophage BP-

933W

unknown protein encoded by bacteriophage BP-

933W
putative outer membrane protein

putative outer membrane protein of
bacteriophage BP-933W

Unknown function

Unknown function

Unknown function

putative glucosyltransferase

Unknown function

hypothetical protein

Unknown function

Unknown function

Unknown function

hypothetical protein

hypothetical protein

hypothetical protein

spermidinelputrescine transport system
permease

I82 hypothetical protein

hypothetical protein

putative replication protein P of bacteriophage
BP-933W

putative tail component of prophage CP-933K
putative PTS system enzyme l

putative dihydroxyacetone kinase (50 2.7.1.2)
peptidyl-tRNA hydrolase

a protaminelike protein

thymidine kinase

hypothetical protein

orotidine-5'-phosphate decarboxylase

RNase II, mRNA degradation

156

2.34
1.94
2.92

1.81
2.01
2.09
1.78

2.60
1.86
2.67
3.90
2.54
2.36

1.73
2.00

2.51
2.97
2.05
1.93
1.67
1.79
1.79
1.86
1.80
1.81
2.00
1.77
1.87

2.16
1.94
1.74

2.82
2.04
1.69
1.68
1.94
1.95
2.90
2.13
1.87

5031872
5031 928
5032021
5032099
50321 00
50321 16

5032229
5032259
5032337
5032367

503251 6
5032653
503281 3
503281 6
5032828

5032873
5032889
5032973

5032974
5032975
5032992

5033002
5033048
5033067
5033079
5033223
5033309
5033362
5033380
5033399
5033530
5033550

5033620
5033673
5033689
5033818
5033948
5034043
5034054
5034069
50341 32
50341 33
5034214
5034238

ymr'A
ydaO
aIdA

pqu
yddB

purR

yeaZ
yecF
sch
yeeF

udk

yegQ
stx1b

stx1a

IysP
SPF
yell-

purN
ndk
suhB
stpA

ych
mItA

metK

deaD
secG
yrbA
yth
ﬁs

ppiA

hypothetical protein

hypothetical protein -

aldehyde dehydrogenase, NAD-linked

putative peptidase

hypothetical protein

putative ATP-binding component of a transport
system

unknown protein encoded by prophage CP-9330
putative lysozyme

hypothetical protein

transcriptional repressor for pur regulon, glyA,

glnB, prsA, speA
hypothetical protein

hypothetical protein

exonuclease I, 3' -> 5' speciﬁc

putative amino acid/amine transport protein
regulator of length of O-antigen component of
Iipopolysaccharide chains

uridine/cytidine kinase

hypothetical protein

shiga-like toxin 1 subunit B encoded within
prophage CP-933V

shiga-like toxin 1 subunit A encoded within
prephage 0P-933V

putative antitermination protein 0 for prophage
CP-933V

unknown protein encoded within prophage 0P-
933V

putative exonuclease of bacteriophage BP-933W
lysine-speciﬁc permease

putative lipoprotein

hypothetical protein

hypothetical protein

hypothetical protein

phosphoribosylglycinamide formyltransferase 1
nucleoside diphosphate kinase

extragenic suppressor

DNA-binding protein

unknown protein encoded by bacteriophage BP-
933W

putative 6-pyruvoyl tetrahydrobiopterin synthase
membrane-bound lytic murein transglycosylase A
putative transport protein

methionine adenosyltransferase 1

308 ribosomal subunit protein 821

inducible ATP-independent RNA helicase
protein export - membrane protein

hypothetical protein

putative dehydrogenase

site-speciﬁc DNA inversion stimulation factor
peptidyl-prolyl cis-trans isomerase A (rotamase A)
peptidoglycan synthetase; penicillin-binding

157

1.92
1.86
2.31
2.51
2.13
2.08

1.79
2.83
1.83
2.19

1 .89
2.42
2.01
3.83
2.39

2.08
2.46
19.82

15.10
1.89
4.28

1.76
2.17
1.63
1.82
2.10
1.94
1.84
2.14
3.30
2.24
1.84

1.80
2.05
2.18
1.91
2.27
2.07
2.17
1.72
2.50
2.18
1.83
1.96

ECs4426

protein 1A

 

 

putative ﬁmbrial subunit 1.89
5034461 yiaU putative transcriptional regulator LYSR-type 2.35
5034550 espF secreted protein/effector 1.97
5034552 escF T388 2.09
5034566 orf16 secretion of translocators 2.16
5034570 orf12 T388 2.1 3
5034574 sepD 2.04
5034579 rorf3 1.91
5034581 escT T388 1 .98
5034583 escR T388 1 .91
5034590 espG secreted protein/effector 1.88
5034606 uhpA response regulator, positive activator of uhpT 2.24
transcription
5034638 508 ribosomal subunit protein L34 2.38
5034639 rnpA RNase P, protein component; protein 05; 2.73
processes tRNA, 4.58 RNA
5034653 Unknown function 2.97
5034976 hypothetical protein 1.83
5034982 hypothetical protein 1.84
5035074 Unknown function 1.80
5035147 miaA hypothetical protein 2.09
5035246 Unknown function 2.59
5035252 putative transcriptional regulator 1.88
5035320 yjiA putative glycoprotein/receptor 1.72
p0157p02 etpC T288 3.04
p01 57p05 eth T288 1 .98
p01 57p09 etoJ T288 2.21
p0157p10 etpK T288 2.33
p0157p12 etpM T288 2.02
p0157p79 hypothetical protein 2.43
p01 57p80 hypothetical protein 2.07
p0157p81 hypothetical protein ‘ 2.30
pOSAK1_02 hypothetical protein 8.58
pOSAK1_03 hypothetical protein 20.66
ECs no. Gene Function BIC
Genes upregulated in bovine-biased genotype 5
5030007 yan inner membrane transport protein 2.01
5030068 araC transcriptional regulator for ara operon 1.84
5030075 IeuD isopropylmalate isomerase subunit 2.77
5030076 IeuC 3-isopropylmalate isomerase subunit 2.68
5030077 IeuB 3-isopropylmalate dehydrogenase 2.62
5030078 IeuA 2-isopropylmalate synthase 1.94
50301 18 9095 pyruvate dehydrogenase (decarboxylase 3.10
component)
50301 19 aceF pyruvate dehydrogenase 3.61
(d ihydrolipoyltransacetylase component)
5030169 glnD uridylyltransferase acts on regulator of glnA 1.83
5030191 yan hypothetical protein 2.19
5030287 yhrV putative AraC-type regulatory protein encoded in 1.99

158

5030357
5030358

5030408
5030504
5030505
5030537
5030538
5030646
5030681
5030692
5030693
5030694
5030732
5030780
5030781
5030848
5030868
5030873
5030889

5030890
5030892
5030916
5030927
5030957
5030966
5030968
5031002
5031 037
5031 077
5031091
5031 159
5031 159
5031 180
5031 181
5031 182
5031 183
5031 184
5031 185
5031 197
5031 201

5031252
5031253
5031 254
5031255
5031 256
5031 257
503131 1

betA
betB

mhpT
gInK
amtB
ybaR
ybaS
ybdQ
ybeL
gItK
gltJ
ybeJ
ybgA
ybgR

yth

glnH

dps
ome

yjiU
poxB
espD
prA

rmf
gef

ych
wrbA
poIB

citB
yde
ﬁgK
yiaW
ych

ych

prophage 0P-933H

choline dehydrogenase, a ﬂavoprotein
NAD+-dependent betaine aldehyde
dehydrogenase

putative transport protein

nitrogen regulatory protein P-ll 2

probable ammonium transporter

putative ATPase

putative glutaminase

hypothetical protein

putative alpha helical protein
glutamate/aspartate transport system permease
glutamate/aspartate transport system permease
putative periplasmic binding transport protein
hypothetical protein

putative transport system permease protein
putative homeobox protein

unknown protein encoded by prophage 0P-933K
hypothetical protein

putative membrane protein

permease of periplasmic glutamine-binding
protein

global regulator, starvation conditions

outer membrane protein X

putative receptor

hypothetical protein

pyruvate oxidase

cold shock protein

ATP-binding component of serine protease
hypothetical protein

ribosome modulation factor

hypothetical protein

putative transcriptional regulator
hypothetical protein

trp repressor binding protein

hypothetical protein

putative anti-termination protein N
hypothetical protein

hypothetical protein

hypothetical protein

putative cl repressor protein

hypothetical protein

unknown protein encoded by bacteriophage BP-
933W
putative transport protein

hypothetical protein
putative enzyme

putative acetyltransferase
hypothetical protein
putative synthetase
unknown in l8600

159

2.02
1.70

2.19
11.58
14.94

1.98

3.30

2.50

2.24

1.91

2.16

3.52

2.00

3.00

2.07

4.00

1.88

1.77

2.12

3.98
1.70
9.18
1.99
2.75
2.55
1.99
4.08
3.11
1.71
2.22
3.47
2.94
2.15
3.37
3.79
2.26
2.19
2.49
2.31
1.77

3.56
2.61

6.83
10.01
8.93
5.59
2.03

5031 316
5031 360
5031442
5031 508
5031 509
5031 572
5031683
5031684
5031 71 O
5031 722
5031 723
5031 728
5031 741
5031 743
5031 746
5031 747
5031 769
5031 775
5031 91 4
5031975

5032084
5032086
5032087

5032088

5032089
5032090
5032091
5032092
5032097
5032098
50321 96
5032203
5032206

5032209

503221 2
5032299
5032370
5032384
5032429
5032430
5032431
5032450
5032451
5032452
5032454
5032467

gpr
yjiO

pepT
yegB
dadA
ychH
chaB
chaC
narK
adhE
oppA
oppD
oppF

ydaA
adhE

rpsV
osmC

gadC
gadB
mch
pstC

ydaU

ybj T

yng

pﬂrB

ydiS

cstC
gdhA

putative diacylglycerol kinase

putative sensor-type regulator

glutaredoxin 2

unknown protein encoded by prophage 0P-933N
unknown protein encoded by prophage 0P-933N
putative peptidase T

putative sporulation protein

D-amino acid dehydrogenase subunit
hypothetical protein

cation transport regulator

cation transport regulator

nitrite extrusion protein

CoA-Iinked acetaldehyde dehydrogenase
oligopeptide transport

oligopeptide transport

oligopeptide transport

putative phage replication protein

hypothetical protein

hypothetical protein

unknown protein encoded by cryptic prophage
0P-933M

308 ribosomal subunit protein 822
osmotically inducible protein

putative ATP-binding component of a transport
system

putative ATP-binding component of a transport
system

putative transport protein

putative transport system permease protein
putative hemin-binding lipoprotein
hypothetical protein

GABA-gluatame antiporter

glutamate decarboxylase isozyme
hypothetical protein

hypothetical protein

unknown protein encoded within prophage CP-
9330

putative repressor protein encoded within
prophage CP-9330

hypothetical protein

hypothetical protein

cyclopropane fatty acyl phospholipid synthase
murein lipoprotein

6-phosphofructokinase ll; suppressor of pka
hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative aldehyde dehydrogenase
acetylomithine delta-aminotransferase
NADP-speciﬁc glutamate dehydrogenase

160

2.06
1.92
2.08
2.01
2.55
2.66
3.23
1.94
4.95
2.45
2.23
1.91
3.83
2.18
1.83
1.77
3.17
2.12
2.72
2.04

2.63
2.27
5.17

6.60

2.75
3.55
8.57
9.17
2.50
4.70
2.42
2.14
2.13

1.71

2.11
2.91
2.10
1.95
1.90
1.95
2.69
5.68
6.96
12.07
9.53
2.12

5032492
5032543
5032603
5032604
5032614
5032670
5032692
5032705
503271 2
5032737
5032737
5032758
5032761

5032783
5032784
5032792
5032825
5032882
5032887
5032927
5032942
503301 8
5033035
5033058
5033060
5033061
5033092
5033097
50331 1 1
50331 89
5033206
5033226
5033257
5033259
5033326
5033327
5033346
5033358
5033445
5033460
503351 9
5033522
5033523
5033533
5033543
5033582
5033583
5033643
5033644
5033655

yeaG

yecG
otsA

yecH
yedL

yedU

uxaB
araF
aas

cbl
nac

hisA

baeR
yehL
ymﬂll
yehZ

yeiC
ﬁ’uK
I‘l’uB

napF

ng

taIA
tktB

hny
yﬁD

gabD
gabT

proX
hypA
hypB
chpR
reIA

ygdH

hypothetical protein

hypothetical protein

putative regulator

trehalose-6-phosphate synthase
hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative cytochrome

putative transcriptional regulator

putative transcriptional regulator
hypothetical protein

unknown protein encoded within prophage CP-
933U

transcriptional regulator cys regulon
nitrogen assimilation control protein
hypothetical protein
imidazolecarboxamide isomerase
putative membrane protein

hypothetical protein

hypothetical protein

hypothetical protein

putative transport system permease protein
cytidine/deoxycytidine deaminase

putative kinase

fructose-1-phosphate kinase

PTS system, fructose-speciﬁc IIAI‘fpr component
cytochrome c-type protein

ferredoxin-type protein: electron transfer
hypothetical protein
UDP-galactopyranose mutase

putative transport protein

hypothetical protein

hypothetical protein

putative aminotransferase

transaldolase A

transketolase 2 isozyme

hydrogenase 4 membrane subunit
putative DNA replication factor

putative formate acetyltransferase
putative yhbH sigma 54 modulator
hypothetical protein
succinate-semialdehyde dehydrogenase
4-aminobutyrate aminotransferase activity
hypothetical protein

hypothetical protein

pleiotrophic effects on 3 hydrogenase isozymes
hydrogenase isoenzyme HypB
suppressor of inhibitory function of ChpA
(p)ppGpp synthetase l (GTP pyrophosphokinase)
hypothetical protein

161

6.18
2.46
2.78
2.42
2.10
2.05
2.70
1.95
1.80
2.29
2.32
2.13
2.61

9.76
12.69
2.28
1.90
1.87
2. 54
2.15
1.71
1 .68
2. 79
3.99
2.04
5.30
2.12
2.48
2.46
2.11
2. 34
3. 28
2.52
3.09
2.10
2.29
2.51
3.09
6.10
5.01
6.97
3.69
3.22
2.88
2.47
2.96
2.61
2.10
2.35
1.85

5033669
5033680
5033689
5033799
5033842
5033891
5033904
5033931
5033980
5033981
5034034
5034038
5034089
5034091
5034141
5034142
503421 2
503421 3
503421 6
5034250
5034309
5034323
5034366
5034367
5034377
5034389
5034390
5034391
5034392
5034394
5034395
5034397
5034402
503441 2
5034424
5034427
5034440
5034456
5034477
503461 5
5034624
5034660
5034706
5034708
5034734
5034737
5034760
5034787
5034790
5034803

ybbF
ngA

gIgS

m5
yth
yhbT
ach
gltB

ﬁc
yth
nirB
feoA

yhiO
uspA
slp
hdeB
hdeA
hdeD
gadE
yhrV

gadW

gadA
yth
yth
dppA
yde
yiaG
yial
mtIR
yidF
yidP
phoU
iIvA
iva
hemD

ysgA
yihA
gInG
yihS

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative transport protein

hypothetical protein

putative transport periplasmic protein
glycogen biosynthesis, rpoS dependent
hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

aerobic respiration sensor-response protein
glutamate synthase, large subunit
putative periplasmic binding transport protein
putative transport system permease protein
induced in stationary phase

hypothetical protein

nitrite reductase (NAD(P)H) subunit
ferrous iron transport protein A
high-afﬁnity amino acid transport system
hypothetical protein

hypothetical protein

universal stress protein

outer membrane protein

periplasmic chaperone

protection from organic acid metabolites
acid resistance at high cell density
central activator of GAD system
multidrug efflux pump protein
ARAC-type GAD system regulator
glutamate decarboxylase isozyme
hypothetical protein

hypothetical protein

dipeptide transport protein

hypothetical protein

hypothetical protein

hypothetical protein

repressor for mﬂ

putative transcriptional regulator
putative transcriptional regulator
negative regulator for pho regulon
threonine deaminase (dehydratase)
ketol-acid reductoisomerase
uroporphyrinogen lll synthase

orf, hypothetical protein

putative enzyme

orf; Unknown function

nitrogen regulator I

hypothetical protein

162

1.85
2.08
7.67
2.82
2.23
4.13
2.72
2.27
2.11
1.95
1.75
2.44
1.99
1.91
5.55
3.15
2.64
2.45
1.82
2.68
4.99
7.11
2.32
2.64
2.52
3.38
6.12
3.64
2.56
2.31
1.77
1.92
1.88
1.84
1.89
1.75
1.86
1.95
2.13
1.93
2.35
1.86
1.80
3.70
2.20
3.53
1.91
1.98
2.64
2.44

5034847
5034848
5034856
5034893
5034956
5034957
5034958
5034968
5034969
5034970
5034973
503501 2
5035036
5035038
5035039
5035052

5035061

5035100
5035120
50351 34

50351 35

5035184
5035189
5035190
5035253
5035303
503531 1
503531 2
503531 3
503531 5

5035316

503531 7
5035326
5035334

yiiS
yii T
menG
yheN

yral
zipA
purH

menC
hde

9W3
yij

yij
yjbR
nrfA

fth

ﬁdB
frdA

hemN
ms
ﬁiA
yer
yji Y
tsr

yjiZ
yiiM
ngJ

osmY

hypothetical protein

putative regulator

menaquinone biosynthesis

putative citrate permease

hypothetical protein

hypothetical protein

hypothetical protein

hypothetical protein

putative portal protein

hypothetical protein

putative protease protein

hypothetical protein

tyrosine aminotransferase

hypothetical protein

hypothetical protein

periplasmic cytochrome c(552): plays a role in
nitrite reduction

selenopolypeptide subunit of formate
dehydrogenase H

regulator of melibiose operon

aspartate ammonia-lyase (aspartase)
fumarate reductase, anaerobic, iron-sulfur protein
subunu

fumarate reductase, anaerobic, flavoprotein
subunn

hypothetical protein

hypothetical protein

putative oxidoreductase

partial putative integrase

hypothetical protein

hypothetical protein

hypothetical protein

putative carbon starvation protein
methyl-accepting chemotaxis protein I, serine
sensor receptor

putative transport protein, cryptic, orf, joins former
yjiZ and yij

hypothetical protein

2-component transcriptional regulator
hyperosmotically inducible periplasmic protein

163

2.08
2.15
1.91
1.78
1.91
2.47
2.23
1.81
1.98
2.77
2.11
2.10
1.92
2.45
2.34
2.33

2.08

2.01
3.15
2.22

2.49

2.14
2.05
2.14
1.84
1.93
2.09
2.68
3.84
1.92

2.09

2.37
2.10
3.33

REFERENCES

164

Abe, H., A. Miyahara, T. Oshima, K. Tashiro, Y. Ogura, S. Kuhara, N.
Ogasawara, T. Hayashi, and T. Tobe. 2008. Global Regulation by
Horizontally Transferred Regulators Establishes the Pathogenicity of
Escherichia coli. DNA Res 15:25-38.

Abe, H., I. Tatsuno, T. Tobe, A. Okutani, and 0. Sasakawa. 2002.
Bicarbonate Ion Stimulates the Expression of Locus of Enterocyte
Effacement-Encoded Genes in Enterohemorrhagic Escherichia coli
O157:H7. Infect. Immun. 70:3500—3509.

Ake, J. A., S. Jelacic, M. A. Ciol, S. L. Watkins, K. F. Murray, D. L.
Christie, 5. J. Klein, and P. I. Tarr. 2005. Relative nephroprotection
during Escherichia coli D157:H7 infections: association with intravenous
volume expansion. Pediatrics 1 1 5:e673-80.

Akerley, B. J., P. A. Cotter, and J. F. Miller. 1995. Ectopic expression of
the ﬂagellar regulon alters development of the BordeteIIa-host interaction.
Cell 80:611-20.

Aldick, T., M. Bielaszewska, W. Zhang, J. Brockmeyer, H. Schmidt, A.
W. Friedrich, K. S. Kim, M. A. Schmidt, and H. Karch. 2007. Hemolysin
from Shiga toxin-negative Escherichia coli 026 strains injures
microvascular endothelium. Microbes Infect 9:282-90.

Alignan, M., T. Hewezl, M. Petitprez, G. Dechamp-Guillaume, gory,
and L. Gentzbittel. 2006. A cDNA microarray approach to decipher
sunﬂower (Helianthus annuus) responses to the necrotrophic fungus
Phoma macdonaldii. New Phytologist 170:523-536.

Andreoli, S. P., H. Trachtman, D. W. Acheson, R. L. Siegler, and T. G.
Obrig. 2002. Hemolytic uremic syndrome: epidemiology, pathophysiology,
and therapy. Pediatr Nephrol 17:293—8.

Bergholz, T. M., 0. L. Tarr, L. M. Christensen, D. J. Betting, and T. S.
Whittam. 2007. Recent Gene Conversions between Duplicated Glutamate
Decarboxylase Genes (gadA and gadB) in Pathogenic Escherichia coli.
Mol Biol Evol 24:2323-2333.

Bergholz, T. M., S. K. Vanaja, and T. S. Whittam. 2009. Gene

expression induced in Escherichia coli O157:H7 upon exposure to model
apple juice. Appl Environ Microbiol 75:3542-53.

165

 

10.

11.

12.

13.

14.

15.

16.

17.

18.

Bergholz, T. M., and T. S. Whittam. 2007. Variation in acid resistance
among enterohaemorrhagic Escherichia coli in a simulated gastric
environment. J Appl Microbiol 102:352-362.

Bergholz, T. M., and T. S. Whittam. 2007. Variation in acid resistance
among enterohaemorrhagic Escherichia coli in a simulated gastric
environment. Journal of Applied Microbiology 102:352-362.

Bergholz, T. M., L. M. Wick, W. 01, J. T. Riordan, L. M. Ouellette, and
T. S. Whittam. 2007. Global transcriptional response of Escherichia coli
O157:H7 to growth transitions in glucose minimal medium. BMC Microbiol
7:97.

Besser, R. 5., S. M. Lott, J. T. Weber, M. P. Doyle, T. J. Barrett, J. G.
Wells, and P. M. Grifﬁn. 1993. An outbreak of diarrhea and hemolytic
uremic syndrome from Escherichia coli O157:H7 in fresh-pressed apple
cider. Jama 269:2217-20.

Besser, T. 5., N. Shaikh, N. J. Holt, P. I. Tarr, M. 5. Konkel, P. Malik-
Kale, C. W. Walsh, T. S. Whittam, and J. L. Bono. 2007. Greater
diversity of Shiga toxin-encoding bacteriophage insertion sites among
Escherichia coli O157:H7 isolates from cattle than in those from humans.
Appl. Environ. Microbiol. 73:671-679.

Bhagwat, A. A., R. P. Phadke, D. Wheeler, S. Kalantre, M. Gudipati,
and M. Bhagwat. 2003. Computational methods and evaluation of RNA
stabilization reagents for genome-wide expression studies. Journal of
Microbiological Methods 55:399-409.

Biase, D. D., A. Tramonti, R. A. John, and F. Bossa. 1996. Isolation,
Overexpression, and Biochemical Characterization of the Two lsoforrns of
Glutamic Acid Decarboxylase from Escherichia coli. Protein Expression
and Puriﬁcation 8:430-438.

Blattner, F. R., G. Plunkett, 3rd, 0. A. Bloch, N. T. Pema, V. Burland,
M. Riley, J. Collado-Vides, J. D. Glasner, C. K. Rode, G. F. Mayhew, J.
Gregor, N. W. Davis, H. A. Kirkpatrick, M. A. Goeden, D. J. Rose, B.
Mau, and Y. Shao. 1997. The complete genome sequence of Escherichia
coli K-12. Science 277: 1 453-74.

Bordi, 0., L. Theraulaz, V. Mejean, and C. Jourlin-Castelli. 2003.

Anticipating an alkaline stress through the Tor phosphorelay system in
Escherichia coli. Mol Microbiol 48:21 1-23.

166

19.

20.

21.

22.

23.

24.

25.

26.

27.

28.

Burland, V., Y. Shao, N. Pema, G. Plunkett, H. Soﬁa, and F. Blattner.
1998. The complete DNA sequence and analysis of the large virulence
plasmid of Escherichia coli O157:H7. Nucl. Acids Res. 26:4196-4204.

Calderwood, S. B., and J. J. Mekalanos. 1987. Iron regulation of Shiga-
Iike toxin expression in Escherichia coli is mediated by the fur locus. J
Bacteriol 169:4759-64.

Canales, R. D., Y. Luo, J. C. Willey, B. Austermiller, C. 0. Barbacioru,
C. Boysen, K. Hunkapiller, R. V. Jensen, 0. R. Knight, K. Y. Lee, Y.
Ma, B. Maqsodi, A. Papallo, 5. H. Peters, K. Poulter, P. L. Ruppel, R.
R. Samaha, L. Shi, W. Yang, L. Zhang, and F. M. Goodsaid. 2006.
Evaluation of DNA microarray results with quantitative gene expression
platforms. Nat Biotech 24:11 15-1 122.

Castanie-Comet, M.-P., and J. W. Foster. 2001. Escherichia coli acid
resistance: cAMP receptor protein and a 20 bp cis-acting sequence
control pH and stationary phase expression of the gadA and gadBC
glutamate decarboxylase genes. Microbiology 147:709-715.

Castanie-Comet, M.-P., T. A. Penfound, D. Smith, J. F. Elliott, and J.
W. Foster. 1999. Control of acid resistance in Escherichia coli. J.
Bacteriol. 181:3525-3535.

Castanle-Comet, M.-P., H. Treffandier, A. Francez-Charlot, C.
Gutierrez, and K. Cam. 2007. The glutamate-dependent acid resistance
system in Escherichia coli: essential and dual role of the His-Asp
phosphorelay RcsCDB/AF. Microbiology 153:238-246.

Chapman, P. A., C. A. Siddons, D. J. Wright, P. Norman, J. Fox, and
E. Crick. 1993. Cattle as a possible source of verocytotoxin-producing
Escherichia coli 01 57 infections in man. Epidemiol Infect 1 1 1 :439-47.

Chen, J., and M. W. Grifﬁths. 1999. Cloning and sequencing of the gene
encoding universal stress protein from Escherichia coli O157:H7 isolated
from Jack-in-a-Box outbreak. Lett Appl Microbiol 29:103-7.

Chen, J., J. Lozach, 5. W. Garcia, B. Barnes, S. Luo, I. Mikoulitch, L.
Zhou, G. Schroth, and J.-B. Fan. 2008. Highly sensitive and speciﬁc
microRNA expression proﬁling using BeadArray technology. Nucl. Acids
Res. 36ze87.

Choi, S. H., D. J. Baumler, and C. W. Kaspar. 2000. Contribution of dps

to Acid Stress Tolerance and Oxidative Stress Tolerance in Escherichia
coli O157:H7. Appl. Environ. Microbiol. 66:3911-3916.

167

29.

30.

31.

32.

33.

34.

35.

36.

37.

38.

Cody, S. H., M. K. Glynn, J. A. Farrar, K. L. Cairns, P. M. Griffin, J.
Kobayashi, M. Fyfe, R. Hoffman, A. S. King, J. H. Lewis, B.
Swaminathan, R. G. Bryant, and D. J. Vugia. 1999. An outbreak of
Escherichia coli 01572H7 infection from unpasteurized commercial apple
juice. Ann Intern Med 130:202-9.

Cui, X., and G. A. Churchill. 2003. Statistical tests for differential
expression in cDNA microarray experiments. Genome Biol 4:210.

Cui, X., J. T. Hwang, J. Qiu, N. J. Blades, and G. A. Churchill. 2005.
Improved statistical tests for differential gene expression by shrinking
variance components estimates. Biostatistics 6:59-75.

Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of
chromosomal genes in Escherichia coli K-12 using PCR products.
Proceedings of the National Academy of Sciences 97:6640-6645.

Deng, W., J. L. Puente, S. Gruenheid, Y. Li, B. A. Vallance, A.
Vazquez, J. Barba, J. A. lbarra, P. O'Donnell, P. Metalnikov, K.
Ashman, S. Lee, D. Goode, T. Pawson, and B. B. Finlay. 2004.
Dissecting virulence: Systematic and functional analyses of a
pathogenicity island. Proceedings of the National Academy of Sciences
1 01 :3597-3602.

Diez-Gonzalez, F., T. R. Callaway, M. G. Kizoulis, and J. B. Russell.
1998. Grain feeding and the dissemination of acid-resistant Escherichia
coli from cattle. Science 281 :1666-8.

Eaton, K. A., D. I. Friedman, G. J. Francis, J. S. Tyler, V. B. Young, J.
Haeger, G. Abu-Ali, and T. S. Whittam. 2008. Pathogenesis of renal
disease due to enterohemorrhagic Escherichia coli in gerrn-free mice.
Infect Immun 76:3054-63.

Elder, R. 0., J. 5. Keen, G. R. Siragusa, G. A. Barkocy-Gallagher, M.
Koohmaraie, and W. W. Laegreid. 2000. Correlation of
enterohemorrhagic Escherichia coli O157 prevalence in feces, hides, and
carcasses of beef cattle during processing. Proc Natl Acad Sci U S A
97:2999-3003. ‘

Fann, M. K., and D. O'Rourke. 2001. Normal bacterial ﬂora of the rabbit
gastrointestinal tract: a clinical approach. Seminars in Avian and Exotic
Pet Medicine 10:45-47.

Feng, P., K. A. Lampel, H. Karch. and T. S. Whittam. 1998. Genotypic

and phenotypic changes in the emergence of Escherichia coli O157:H7. J
Infect Dis 177:1750-3.

168

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.

Foster, J. W. 2004. Escherichia coli acid resistance: tales of an amateur
acidophile. Nat Rev Micro 2:898-907.

Fox, J. T., X. Shi, and T. G. Nagaraja. 2008. Escherichia coli 0157 in the
rectoanal mucosal region of cattle. Foodbome Pathog Dis 5:69-77.

Garmendia, J., G. Frankel, and V. F. Crepin. 2005. Enteropathogenic
and Enterohemorrhagic Escherichia coli Infections: Translocation,
Translocation, Translocation. Infect. Immun. 73:2573-2585.

Gong, 8., Z. Ma, and J. W. Foster. 2004. The Era-like GTPase TrrnE
conditionally activates gadE and glutamate-dependent acid resistance in
Escherichia coli. Molecular Microbiology 54:948-961.

Gong, S., H. Richard, and J. W. Foster. 2003. deE (AdiC) Is the
ArgininezAgmatine Antiporter Essential for Arginine-Dependent Acid
Resistance in Escherichia coli. J. Bacteriol. 185:4402-4409.

Grys, T. 5., M. B. Siegel, W. W. Lathem, and R. A. Welch. 2005. The
StcE protease contributes to intimate adherence of enterohemorrhagic
Escherichia coli O157:H7 to host cells. Infect Immun 73:1295—303.

Hancock, D., T. Besser, J. Lejeune, M. Davis, and D. Rice. 2001. The
control of VTEC in the animal reservoir. Int J Food Microbiol 66:71-8.

Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K.
Yokoyama, C. G. Han, 5. Ohtsubo, K. Nakayama, T. Murata, M.
Tanaka, T. Tobe, T. lida, H. Takami, T. Honda, 0. Sasakawa, N.
Ogasawara, T. Yasunaga, S. Kuhara, T. Shiba, M. Hattori, and H.
Shinagawa. 2001. Complete genome sequence of enterohemorrhagic
Escherichia coli 0157:H7 and genomic comparison with a laboratory
strain K-12. DNA Res 8:11-22.

Hayashi, T., K. Makino, M. Ohnishi, K. Kurokawa, K. Ishii, K.
Yokoyama, C.-G. Han, 5. Ohtsubo, K. Nakayama, T. Murata, M.
Tanaka, T. Tobe, T. lida, H. Takami, T. Honda, 0. Sasakawa, N.
Ogasawara, T. Yasunaga, S. Kuhara, T. Shiba, M. Hattori, and H.
Shinagawa. 2001. Complete Genome Sequence of Enterohemorrhagic
Eschelichia coli O157:H7 and Genomic Comparison with a Laboratory
Strain K-12. DNA Res 8:11-22.

Herold, S., J. Siebert, A. Huber, and H. Schmidt. 2005. Global

expression of prophage genes in Escherichia coli O157:H7 strain EDL933
in response to norﬂoxacin. Antimicrob Agents Chemother 49:931-44.

169

49.

50.

51.

52.

53.

54.

55.

56.

57.

Herriott, D. 5., D. D. Hancock, 5. D. Ebel, L. V. Carpenter, D. H. Rice,
and T. 5. Besser. 1998. Association of herd management factors with
colonization of dairy cattle by Shiga toxin-positive Escherichia coli 0157. J
Food Prot 61:802-7.

Heuvellng, J., A. Possling, and R. Hengge. 2008. A role for Lon
protease in the control of the acid resistance genes of Escherichia coli.
Mol Microbiol 69:534-47.

Heuvelink, A. 5., F. L. van den Biggelaar, J. Zwartkruis-Nahuis, R. G.
Herbes, R. Huyben, N. Nagelkerke, W. J. Melchers, L. A. Monnens,
and 5. de Boer. 1998. Occurrence of verocytotoxin-producing Escherichia
coli 0157 on Dutch dairy farms. J Clin Microbiol 36:3480-7.

Hilbom, 5. D., J. H. Mennin, P. A. Mshar, J. L. Hadler, A. Voetsch, C.
Wojtkunski, M. Swartz, R. Mshar, M. A. Lambert-Fair, J. A. Farrar, M.
K. Glynn, and L. Slutsker. 1999. A multistate outbreak of Escherichia coli
O157:H7 infections associated with consumption of mesclun lettuce. Arch
Intern Med 159:1758-64.

Hilbom, E. D., P. A. Mshar, T. R. Fiorentino, Z. F. Dembek, T. J.
Barrett, R. T. Howard, and M. L. Cartter. 2000. An outbreak of
Escherichia coli O157:H7 infections and haemolytic uraemic syndrome
associated with consumption of unpasteurized apple cider. Epidemiol
Infect 124:31-6.

Hommais, F., E. Krin, J.-Y. Coppee, C. Lacroix, 5. Yeramlan, A.
Danchin, and P. Bertin. 2004. GadE (YhiE): a novel activator involved in
the response to acid environment in Escherichia coli. Microbiology 150:61-
72.

Hommais, F., 5. Krin, C. Laurent-Winter, O. Soutourina, A. Malpertuy,
J.-P. Le Caer, A. Danchin, and P. Bertin. 2001. Large-scale monitoring
of pleiotropic regulation of gene expression by the prokaryotic nucleoid-
associated protein, H-NS. Molecular Microbiology 40:20-36.

lde, T., S. Michgehl, S. Knappstein, G. Heusipp, and M. A. Schmidt.
2003. Differential modulation by Ca2+ of type III secretion of diffusely
adhering enteropathogenic Escherichia coli. Infect Immun 71 :1725-32.

Inward, C. D., A. J. Howie, M. M. Fitzpatrick, F. Rafaat, D. V. Milford,

and C. M. Taylor. 1997. Renal histopathology in fatal cases of diarrhoea-
associated haemolytic uraemic syndrome. Pediatr Nephrol 11 :556-9.

170

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

68.

Issartel, J. P., V. Koronakis, and 0. Hughes. 1991. Activation of
Escherichia coli prohaemolysin to the mature toxin by acyl carrier protein-
dependent fatty acylation. Nature 351 :759-61.

Iyer, R., C. Williams, and C. Miller. 2003. Arginine-agmatine antiporter in
extreme acid resistance in Escherichia coli. J Bacteriol 185:6556-61.

lyoda, S., and H. Watanabe. 2004. Positive effects of multiple pch genes
on expression of the locus of enterocyte effacement genes and adherence
of enterohaemorrhagic Escherichia coli O157 : H7 to HEp-2 cells.
Microbiology 150:2357-2571.

lyoda, S., and H. Watanabe. 2004. Positive effects of multiple pch genes
on expression of the locus of enterocyte effacement genes and adherence
of enterohaemorrhagic Escherichia coli 0157 : H7 to HEp-2 cells.
Microbiology 150:2357-571.

Jackson, S. G., R. B. Goodbrand, R. P. Johnson, V. G. Odorico, D.
Alves, K. Rahn, J. B. Wilson, M. K. Welch, and R. Khakhria. 1998.
Escherichia coli 0157:H7 diarrhoea associated with well water and
infected cattle on an Ontario farm. Epidemiol Infect 120:17-20.

Jln, W., R. M. Riley, R. D. Wolfinger, K. P. White, G. Passador-Gurgel,
and G. Gibson. 2001. The contributions of sex, genotype and age to
transcriptional variance in Drosophila melanogaster. Nat Genet 29:389-
395.

Just, J. R., and M. A. Daeschel. 2003. Antimicrobial Effects of Wine on
Escherichia coli O157:H7 and Salmonella typhimurium in a Model
Stomach System. Journal of Food Science 68:285-290.

Kailasan Vanaja, S., T. M. Bergholz, and T. S. Whittam. 2009.
Characterization of the Escherichia coli O157:H7 Sakai GadE regulon. J.
Bacteriol. 191:1868-1877.

Kaper, J. B., J. P. Nataro, and H. L. Mobley. 2004. Pathogenic
Escherichia coli. Nat Rev Microbiol 2:123-40.

Karch, H., P. l. Tarr, and M. Bielaszewska. 2005. Enterohaemorrhagic
Escherichia coli in human medicine. Int J Med Microbiol 295:405-18.

Keene, W. 5., J. M. McAnulty, F. C. Hoesly, L. P. Williams, Jr., K.
Hedberg, G. L. Oxman, T. J. Barrett, M. A. Pfaller, and D. W. Fleming.
1994. A swimming-associated outbreak of hemorrhagic colitis caused by
Escherichia coli O157:H7 and Shigella sonnei. N Engl J Med 331 :579-84.

171

69.

70.

71.

72.

73.

74.

75.

76.

77.

78.

79.

Kenny, B., A. Abe, M. Stein, and B. B. Finlay. 1997. Enteropathogenic
Escherichia coli protein secretion is induced in response to conditions
similar to those in the gastrointestinal tract. Infect Immun 65:2606-12.

Kenny, B., and B. B. Finlay. 1995. Protein secretion by enteropathogenic
Escherichia coli is essential for transducing signals to epithelial cells. Proc
Natl Acad Sci U S A 92:7991-5.

Kern, R., A. Malki, J. Abdallah, J. Tagourti, and G. Richanne. 2007.
Escherichia coli HdeB Is an Acid Stress Chaperone. J. Bacteriol. 189:603-
610.

Kim, J., J. Nietfeldt, and A. K. Benson. 1999. Octamer-based genome
scanning distinguishes a unique subpopulation of Escherichia coli
O157:H7 strains in cattle. Proc Natl Acad Sci U S A 96:13288-93.

Kress, W., H. Mutschler, and E. Weber-Ban. 2007. Assembly pathway
of an AAA+ Protein: tracking ClpA and ClpAP complex formation in real
time. Biochemistry 46:6183-6193.

Laegreid. W. W., R. 0. Elder, and J. E. Keen. 1999. Prevalence of
Escherichia coli O157:H7 in range beef calves at weaning. Epidemiol
Infect 123:291-8.

Large, T. M., S. T. Walk, and T. S. Whittam. 2005. Variation in acid
resistance among Shiga toxin-producing clones of pathogenic Escherichia
coli. Appl. Environ. Microbiol. 71:2493—2500.

Lathem, W. W., T. 5. Grys, S. 5. Witowski, A. G. Torres, J. B. Kaper, P.
I. Tarr, and R. A. Welch. 2002. StcE, a metalloprotease secreted by
Escherichia coli O157:H7, speciﬁcally cleaves 01 esterase inhibitor. Mol
Microbiol 45:277-88.

Law, D. 2000. Virulence factors of Escherichia coli 0157 and other Shiga
toxin-producing E. coli. J Appl Microbiol 88:729-45.

Law, D. 2000. Virulence factors of Escherichia coli 0157 and other Shiga
toxin-producing E. coli. Journal of Applied Microbiology 88:729-745.

Lefebvre, B., M. S. Diarra, H. Moisan, and F. Malouin. 2008. Detection
of virulence-associated genes in Escherichia coli 0157 and non-0157
isolates from beef cattle, humans, and chickens. J Food Prot 71 :1774-
1784. .

172

80.

81.

82.

83.

84.

85.

86.

87.

88.

Li, H., C. Wood, T. Getchell, M. Getchell, and A. Stromberg. 2004.
Analysis of Oligonucleotide array experiments with repeated measures
using mixed models. BMC Bioinforrnatics 5:209.

le, J. Y., H. Sheng, K. S. Seo, Y. H. Park, and C. J. Hovde. 2007.
Characterization of an Escherichia coli O157:H7 plasmid 0157 deletion

mutant and its survival and persistence in cattle. Appl Environ Microbiol
73:2037-47.

Lin, J., I. S. Lee, J. Frey, J. L. Slonczewski, and J. W. Foster. 1995.
Comparative analysis of extreme acid survival in Salmonella typhimurium,
Shigella ﬂexneri, and Escherichia coli. J Bacteriol 177:4097-104.

Lin, J., M. Smith, K. Chapin, H. Balk, G. Bennett, and J. Foster. 1996.
Mechanisms of acid resistance in enterohemorrhagic Escherichia coli.
Appl. Environ. Microbiol. 62:3094-3100.

Ma, Z., S. Gong, H. Richard, D. L. Tucker, T. Conway, and J. W.
Foster. 2003. GadE (Y hi5) activates glutamate decarboxylase-dependent
acid resistance in Escherichia coli K-12. Molecular Microbiology 49:1309-
1 320.

Ma, Z., N. Masuda, and J. W. Foster. 2004. Characterization of 5ngS-
YdeO-GadE Branched Regulatory Circuit Governing Glutamate-
Dependent Acid Resistance in Escherichia coli. J. Bacteriol. 186:7378-
7389.

Ma, Z., H. Richard, and J. W. Foster. 2003. pH-Dependent modulation of
cyclic AMP levels and GadW-dependent repression of RpoS affect
synthesis of the GadX regulator and Escherichia coli acid resistance. J
Bacteriol 185:6852-9.

Ma, Z., H. Richard, D. L. Tucker, T. Conway, and J. W. Foster. 2002.
Collaborative Regulation of Escherichia coli Glutamate-Dependent Acid
Resistance by Two AraC-Like Regulators, GadX and GadW (YhiW). J.
Bacteriol. 184:7001-7012.

Manning, S. D., A. S. Motiwala, A. C. Springman, W. Qi, D. W. Lacher,
L. M. Ouellette, J. M. Mladonicky, P. Somsel, J. T. Rudrik, S. E.
Dietrich, W. Zhang, B. Swaminathan, D. Alland, and T. S. Whittam.
2008. Variation in virulence among clades of Escherichia coli O157:H7
associated with disease outbreaks. Proc Natl Acad Sci U S A 105:4868-
73.

173

89.

90.

91.

92.

93.

94.

95.

96.

97.

98.

99.

Masuda, N., and G. M. Church. 2002. Escherichia coli Gene Expression
Responsive to Levels of the Response Regulator 5ng. J. Bacteriol.
184:6225-6234.

Masuda, N., and G. M. Church. 2003. Regulatory network of acid
resistance genes in Escherichia coli. Molecular Microbiology 48:699-712.

Mates, A. K., A. K. Sayed, and J. W. Foster. 2007. Products of the
Escherichia coli Acid Fitness Island Attenuate Metabolite Stress at
Extremely Low pH and Mediate a Cell Density-Dependent Acid
Resistance. J. Bacteriol. 189:2759-2768.

McConnell, E. L., A. W. Basit, and S. Murdan. 2008. Measurements of
rat and mouse gastrointestinal pH, ﬂuid and lymphoid tissue, and
implications for in-vivo experiments. Journal of Pharmacy and
Pharmacology 60:63-70. .

McDaniel, T., K. Jarvis, M. Donnenberg, and J. Kaper. 1995. A Genetic
Locus of Enterocyte Effacement Conserved Among Diverse
Enterobacterial Pathogens. Proceedings of the National Academy of
Sciences 92:1664-1668.

McDaniel, T. K., K. G. Jarvis, M. S. Donnenberg, and J. B. Kaper.
1995. A genetic locus of enterocyte effacement conserved among diverse
enterobacterial pathogens. Proc Natl Acad Sci U S A 92:1664-8.

Mellies, J. L., A. M. S. Barron, and A. M. Carmona. 2007.
Enteropathogenic and Enterohemorrhagic Escherichia coli Virulence Gene
Regulation. Infect. Immun. 75:4199-4210.

Michino, H., K. Arakl, S. Minami, S. Takaya, N. Sakai, M. Miyazaki, A.
Ono, and H. Yanagawa. 1999. Massive outbreak of Escherichia coli
O157:H7 infection in schoolchildren in Sakai City, Japan, associated with
consumption of white radish sprouts. Am J Epidemiol 150:787-96.

Mundy, R., F. Girard, A. J. FitzGerald, and G. Frankel. 2006.
Comparison of colonization dynamics and pathology of mice infected with
enteropathogenic Escherichia coli, enterohaemorrhagic E. coli and
Citrobacter rodentium. FEMS Microbiol Lett 265:126-32.

Murphy, K., and K. Campellone. 2003. Lambda Red-mediated
recombinogenic engineering of enterohemorrhagic and enteropathogenic
E. coli. BMC Molecular Biology 4:11.

Nadler, 0., Y. Shifrin, S. Nov, 8. Kobi, and I. Rosenshine. 2006.
Characterization of Enteropathogenic Escherichia coli Mutants That Fail

174

100.

101.

102.

103.

104.

105.

106.

107.

108.

To Disrupt Host Cell Spreading and Attachment to Substratum. Infect.
Immun. 74:839-849.

Nakanishi, N., H. Abe, Y. Ogura, T. Hayashi, K. Tashiro, S. Kuhara, N.
Sugimoto, and T. Tobe. 2006. ppGpp with DksA controls gene
expression in the locus of enterocyte effacement (LEE) pathogenicity
island of enterohaemorrhagic Escherichia coli through activation of two
virulence regulatory genes. Molecular Microbiology 61:194-205.

Nataro, J. P., and J. B. Kaper. 1998. Diarrheagenic Escherichia coli. Clin.
Microbiol. Rev. 1 1 :142-201 .

Naylor, S. W., J. 0. Low, T. E. Besser, A. Mahajan, G. J. Gunn, M. C.
Pearce, I. J. McKendrick, D. G. Smith, and D. L. Gally. 2003. Lymphoid
follicle-dense mucosa at the terminal rectum is the principal site of
colonization of enterohemorrhagic Escherichia coli O157:H7 in the bovine
host. Infect Immun 71 :1505-12.

Oh, D. H., Y. Pan, 5. Berry, M. Cooley, R. Mandrell, and F. Breidt, Jr.
2009. Escherichia coli O157:H7 strains isolated from environmental
sources differ significantly in acetic acid resistance compared with human
outbreak strains. J Food Prot 72:503-9.

Ollveira, M. G., J. R. Brito, T. A. Gomes, B. E. Guth, M. A. Vieira, Z. V.
Naves, T. M. Vaz, and K. Irlno. 2008. Diversity of virulence proﬁles of
Shiga toxin-producing Escherichia coli serotypes in food-producing
animals in Brazil. Int J Food Microbiol 127:139-46.

Opdyke, J. A., J.-G. Kang, and G. Storz. 2004. GadY, a Small-RNA
Regulator of Acid Response Genes in Escherichia coli. J. Bacteriol.
186:6698-6705.

Oporto, B., J. I. Esteban, G. Aduriz, R. A. Juste, and A. Hurtado. 2008.
Escherichia coli O157:H7 and non-0157 Shiga toxin-producing E. coli in
healthy cattle, sheep and swine herds in Northern Spain. Zoonoses Public
Health 55:73-81.

Osborne, M. J., N. Siddiqui, P. lannuzzi, and K. Gehring. 2004. The
solution structure of ChaB, a putative membrane ion antiporter regulator
from Escherichia coli. BMC Struct Biol 4:9.

Park, S., X. You, and J. A. Imlay. 2005. Substantial DNA damage from

submicromolar intracellular hydrogen peroxide detected in pr- mutants
of Escherichia coli. Proc Natl Acad Sci U S A 102:9317-9322.

175

109.

110.

111.

112.

113.

114.

115.

116.

117.

118.

Paton, J. 0., and A. W. Paton. 1998. Pathogenesis and diagnosis of
Shiga toxin-producing Escherichia coli infections. Clin Microbiol Rev
1 1 :450-79.

Pema, N. T., G. Plunkett, 3rd, V. Burland, B. Mau, J. D. Glasner, D. J.
Rose, G. F. Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G.
Posfai, J. Hackett, S. Klink, A. Boutin, Y. Shao, L. Miller, 5. J.
Grotbeck, N. W. Davis, A. Lim, 5. T. Dimalanta, K. D. Potamousis, J.
Apodaca, T. S. Anantharaman, J. Lin, G. Yen, D. C. Schwartz, R. A.
Welch, and F. R. Blattner. 2001. Genome sequence of
enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-33.

Persson, O., A. Valadi, T. Nystrom, and A. Farewell. 2007. Metabolic
control of the Escherichia coli universal stress protein response through
fructose-6-phosphate. Mol Microbiol 65:968-78.

Peterson, W. L., P. A. Mackowiak, C. C. Barnett, M. Marling-Cason,
and M. L. Haley. 1989. The human gastric bactericidal barrier.
mechanisms of action, relative antibacterial activity, and dietary
inﬂuences. J Infect Dis 159:979-83.

Pfafﬂ, M. W. 2001. A new mathematical model for relative quantification in
real-time RT-PCR. Nucl. Acids Res. 29:e45.

Prevention, 0. f. D. C. a. 2007. Escherichia coli O157:H7 infection
associated with drinking raw milk—Washington and Oregon, November-
December 2005. MMWR Morb Mortal Wkly Rep 56:165-7.

Prevention, 0. f. D. C. a. 1997. Escherichia coli 0157:H7 infections
associated with eating a nationally distributed commercial brand of frozen
ground beef patties and burgers—Colorado, 1997.

Prevention, 0. f. D. C. a. 1995. Escherichia coli 0157:H7 outbreak linked
to commercially distributed dry-cured salami—Washington and California,
1994. MMWR Morb Mortal Wkly Rep 44:157-60.

Prevention, 0. f. D. C. a. 2006. Ongoing multistate outbreak of
Escherichia coli serotype O157:H7 infections associated with consumption
of fresh spinach—United States, September 2006. MMWR Morb Mortal
Wkly Rep 55:1045—6.

Prevention, 0. f. D. C. a. 1993. Update: multistate outbreak of

Escherichia coli O157:H7 infections from hamburgers—westem United
States, 1992-1993. MMWR Morb Mortal Wkly Rep 42:258-63.

176

119.

120.

121.

122.

123.

124.

125.

126.

127.

128.

129.

Price, S. B., J. C. Wright, F. J. DeGraves, M.-P. Castanie-Comet, and
J. W. Foster. 2004. Acid Resistance Systems Required for Survival of
Escherichia coli O157:H7 in the Bovine Gastrointestinal Tract and in Apple
Cider Are Different. Appl. Environ. Microbiol. 70:4792-4799.

Rangel, J. M., P. H. Sparling, C. Crowe, P. M. Griffin, and D. L.
Swerdlow. 2005. Epidemiology of Escherichia coli O157:H7 outbreaks,
United States, 1982-2002. Emerg Infect Dis 11:603-9.

Reid, S. D., C. J. Herbelin, A. C. Bumbaugh, R. K. Selander, and T. S.
Whittam. 2000. Parallel evolution of virulence in pathogenic Escherichia
coli. Nature 406:64-7.

Reitzer, L., and B. L. Schneider. 2001. Metabolic context and possible
physiological themes of sigma(54)—dependent genes in Escherichia coli.
Microbiol Mol Biol Rev 65:422-44.

Richard, H., and J. W. Foster. 2004. Escherichia coli Glutamate- and
Arginine-Dependent Acid Resistance Systems Increase lntemal pH and
Reverse Transmembrane Potential. J. Bacteriol. 186:6032-6041.

Robinson, 0. M., J. F. Sinclair, M. J. Smith, and A. D. O'Brien. 2006.
Shiga toxin of enterohemorrhagic Escherichia coli type O157:H7 promotes
intestinal colonization. Proc Natl Acad Sci U S A 103:9667-72.

Rozen, S., and H. Skaletsky. 2000. Primer3 on the WWW for general
users and for biologist programmers. Methods Mol Biol 132:365-86.

Ruiz, 0., L. M. McMurry, and S. B. Levy. 2008. Role of the Multidrug
Resistance Regulator MarA in Global Regulation of the hdeAB Acid
Resistance Operon in Escherichia coli. J. Bacteriol. 190:1290-1297.

Russell, J. B., F. Diez-Gonzalez, and G. N. Jarvis. 2000. Potential effect
of cattle diets on the transmission of pathogenic Escherichia coli to
humans. Microbes Infect 2:45-53.

Safdar, N., A. Said, R. E. Gangnon, and D. G. Maki. 2002. Risk of
hemolytic uremic syndrome after antibiotic treatment of Escherichia coli
0157:H7 enteritis: a meta-analysis. Jama 288:996-1001.

Saitoh, T., S. lyoda, S. Yamamoto, Y. Lu, K. Shimuta, M. Ohnishi, J.
Terajima, and H. Watanabe. 2008. Transcription of the ehx
enterohemolysin gene is positively regulated by GrlA, a global regulator
encoded within the locus of enterocyte effacement in enterohemorrhagic
Escherichia coli. J Bacteriol 190:4822-30.

177

130.

131.

132.

133.

134.

135.

136.

137.

138.

139.

Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol Evol 4:406-25.

Sayed, A. K., and J. W. Foster. 2009. A 750 bp sensory integration
region directs global control of the Escherichia coli GadE acid resistance
regulator. Mol Microbiol 71 :1435-50.

Sayed, A. K., C. Odom, and J. W. Foster. 2007. The Escherichia coli
AraC-family regulators GadX and GadW activate gadE, the central
activator of glutamate-dependent acid resistance. Microbiology 153:2584-
2592.

Schmidt, H., B. Henkel, and H. Karch. 1997. A gene cluster closely
related to type II secretion pathway operons of Gram-negative bacteria is
located on the large plasmid of enterohemorrhagic Escherichia coli O157
strains. FEMS Microbiol Lett. 148:265-272.

Schmittgen, T. D., and K. J. Livak. 2008. Analyzing real-time PCR data
by the comparative C(T) method. Nat Protoc 3:1101-8.

Scott, D. R., E. A. Marcus, D. L. Weeks, A. Lee, K. Melchers, and G.
Sachs. 2000. Expression of the Helicobacter pylori urel gene is required
for acidic pH activation of cytoplasmic urease. Infect Immun 68:470-7.

Serra-Moreno, R., J. Jofre, and M. Muniesa. 2007. Insertion site
occupancy by stx2 bacteriophages depends on the locus availability of the
host strain chromosome. J Bacteriol 189:6645-54.

Shao, 0., Q. Zhang, W. Tang, W. Qu, Y. Zhou, Y. Sun, H. Yu, and J.
Jia. 2008. The changes of proteomes components of Helicobacter pylori
in response to acid stress without urea. J Microbiol 46:331-7.

Shin, S., M.-P. Castanie-Comet, J. W. Foster, J. A. Crawford, 0.
Brinkley, and J. B. Kaper. 2001. An activator of glutamate decarboxylase
genes regulates the expression of enteropathogenic Escherichia coli
virulence genes through control of the plasmid-encoded regulator, Per.
Molecular Microbiology 41 :1 133-1150.

Shin, S., M.-P. Castanie-Comet, J. W. Foster, J. A. Crawford, 0.
Brinkley, and J. B. Kaper. 2001. An activator of glutamate decarboxylase
genes regulates the expression of enteropathogenic Escherichia coli
vimlence genes through control of the plasmid-encoded regulator, Per.
Mol. Microbiol. 41:1133-1150.

178

140.

141.

142.

143.

144.

145.

146.

147.

148.

149.

Smith, D. K., T. Kassam, B. Singh, and J. F. Elliott. 1992. Escherichia
coli has two homologous glutamate decarboxylase genes that map to
distinct loci. J. Bacteriol. 174:5820-5826.

Sperandio, V. 2004. Striking a balance: inter-kingdom cell-to-cell
signaling, friendship or war’? Trends lmmunol 25:505-7.

Sperandio, V., A. G. Torres, B. Jarvis, J. P. Nataro, and J. B. Kaper.
2003. Bacteria-host communication: the language of hormones. Proc Natl
Acad Sci U S A 100:8951-6.

Stevens, M. P., A. J. Roe, I. Vlisidou, P. M. van Diemen, R. M. La
Ragione, A. Best, M. J. Woodward, D. L. Gally, and T. S. Wallis. 2004.
Mutation of toxB and a Truncated Version of the efa-1 Gene in
Escherichia coli O157:H7 Inﬂuences the Expression and Secretion of
Locus of Enterocyte Effacement-Encoded Proteins but not Intestinal
Colonization in Calves or Sheep. Infect. Immun. 72:5402-5411.

Stewart, N., J. Feng, X. Liu, D. Chaudhuri, J. W. Foster, M. Drolet, and
Y.-C. Tse-Dinh. 2005. Loss of topoisomerase I function affects the RpoS-
dependent and GAD systems of acid resistance in Escherichia coli.
Microbiology 1 51 :2783—2791 .

Stim-Hemdon, K. P., T. M. Flores, and G. N. Bennett. 1996. Molecular
characterization of adiY, a regulatory gene which affects expression of the
biodegradative acid-induced arginine decarboxylase gene (adiA) of
Escherichia coli. Microbiology 142 ( Pt 5):1311-20.

Storey, J. D., and R. Tibshlrani. 2003. Statistical signiﬁcance for
genomewide studies. Proceedings of the National Academy of Sciences
100:9440-9445.

Strachan, N. J., D. R. Fenlon, and l. D. Ogden. 2001. Modelling the
vector pathway and infection of humans in an environmental outbreak of
Escherichia coli O157. FEMS Microbiol Lett 203:69-73.

Subramanian, A., P. Tamayo, V. K. Mootha, S. Mukherjee, B. L. Ebert,
M. A. Gillette, A. Paulovich, S. L. Pomeroy, T. R. Golub, E. S. Lander,
and J. P. Mesirov. 2005. From the Cover: Gene set enrichment analysis:
A knowledge-based approach for interpreting genome-wide expression
proﬁles. Proceedings of the National Academy of Sciences 102:15545-

1 5550.

Sung, L. M., M. P. Jackson, A. D. O'Brien, and R. K. Holmes. 1990.

Transcription of the Shiga-like toxin type II and Shiga-like toxin type II
variant operons of Escherichia coli. J Bacteriol 172:6386-95.

179

150.

151.

152.

153.

154.

155.

156.

157.

158.

159.

Takada, A., G. Umitsuki, K. Nagai, and M. Wachi. 2007. RNase E is
required for induction of the glutamate-dependent acid resistance system
in Escherichia coli. Biosci Biotechnol Biochem 71 :1 58-64.

Tamura, K., J. Dudley, M. Net, and S. Kumar. 2007. MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol
Evol 24:1 596-9.

Taneike, l., H. M. Zhang, N. Wakisaka-Saito, and T. Yamamoto. 2002.
Enterohemolysin operon of Shiga toxin- -producing Escherichia coli: a

virulence function of inﬂammatory cytokine production from human
monocytes. FEBS Lett 524: 219-24.

Tarr, P. l., C. A. Gordon, and W. L. Chandler. 2005. Shiga-toxin-
producing Escherichia coli and haemolytic uraemic syndrome. Lancet
365:1073—86.

Tatsuno, l., M. Horie, H. Abe, T. Miki, K. Makino, H. Shinagawa, H.
Taguchi, S. Kamiya, T. Hayashi, and C. Sasakawa. 2001. toxB gene on
p0157 of Enterohemorrhagic Escherichia coli O157:H7 is required for full
epithelial cell adherence phenotype. Infect. Immun. 69:6660-6669.

Tatsuno, l., K. Nagano, K. Taguchi, L. Rong, H. Mori, and C.
Sasakawa. 2003. Increased adherence to Caco-2 cells caused by
disruption of the yhiE and yhiF genes in enterohemorrhagic Escherichia
coli O157:H7. Infect Immun 71:2598-606.

Tatsuno, l., K. Nagano, K. Taguchi, L. Rong, H. Mori, and C.
Sasakawa. 2003. Increased Adherence to Caco-2 Cells Caused by
Disruption of the yhiE and yhiF Genes in Enterohemorrhagic Escherichia
coli O157:H7. Infect. Immun. 71:2598-2606.

Tobe, T., H. Ando, H. lshikawa, H. Abe, K. Tashiro, T. Hayashi, S.
Kuhara, and N. Sugimoto. 2005. Dual regulatory pathways integrating
the RcsC-RcsD-RcsB signalling system control enterohaemorrhagic
Escherichia coli pathogenicity. Molecular Microbiology 58:320-333.

Tobe, T., S. A. Beatson, H. Taniguchi, H. Abe, C. M. Bailey, A. Fivian,
R. Younis, S. Matthews, 0. Marches, G. Frankel, T. Hayashi, and M. J.
Pallen. 2006. An extensive repertoire of type III secretion effectors in
Escherichia coli 0157 and the role of Iambdoid phages in their
dissemination. Proceedings of the National Academy of Sciences
103:14941-14946.

Tramonti, A., M. De Canio, I. Delany, V. Scarlato, and D. De Biase.
2006. Mechanisms of Transcription Activation Exerted by GadX and

180

160.

161.

162.

163.

164.

165.

166.

167.

168.

169.

GadW at the gadA and gadBC Gene Promoters of the Glutamate-Based
Acid Resistance System in Escherichia coli. J. Bacteriol. 188:8118-8127.

Tsai, H. M., W. L. Chandler, R. Sarode, R. Hoffman, S. Jelacic, R. L.
Habeeb, S. L. Watkins, C. S. Wong, G. D. Williams, and P. I. Tarr.
2001. von Willebrand factor and von Willebrand factor-cleaving
metalloprotease activity in Escherichia coli O157:H7-associated hemolytic
uremic syndrome. Pediatr Res 49:653-9.

Tucker, D. L., N. Tucker, and T. Conway. 2002. Gene Expression
Proﬁling of the pH Response in Escherichia coli. J. Bacteriol. 184:6551-
6558.

Tucker, D. L., N. Tucker, Z. Ma, J. W. Foster, R. L. Miranda, P. S.
Cohen, and T. Conway. 2003. Genes of the GadX-GadW Regulon in
Escherichia coli. J. Bacteriol. 185:3190—3201.

Tuttle, J., T. Gomez, M. P. Doyle, J. G. Wells, T. Zhao, R. V. Tauxe,
and P. M. Grifﬁn. 1999. Lessons from a large outbreak of Escherichia coli
O157:H7 infections: insights into the infectious dose and method of
widespread contamination of hamburger patties. Epidemiol Infect
122:185-92.

Umanski, T., l. Rosenshine, and D. Friedberg. 2002. Therrnoregulated
expression of virulence genes in enteropathogenic Escherichia coli.
Microbiology 148:2735-2744.’

Van Winden, S. 0., K. E. Muller, R. Kuiper, and J. P. Noordhuizen.
2002. Studies on the pH value of abomasal contents in dairy cows during
the ﬁrst 3 weeks after calving. J Vet Med A Physiol Pathol Clin Med
49:157-60.

Wagner, W., M. Vogel, and W. Goebel. 1983. Transport of hemolysin
across the outer membrane of Escherichia coli requires two functions. J
Bacteriol 1 54:200-10.

Waterman, S. R., and P. L. 0. Small. 2003. Transcriptional Expression of
Escherichia coli Glutamate-Dependent Acid Resistance Genes gadA and
gadBC in an hns rpoS Mutant. J. Bacteriol. 185:4644-4647.

Weber, A., S. A. Kogl, and K. Jung. 2006. Time-dependent proteome
alterations under osmotic stress during aerobic and anaerobic growth in
Escherichia coli. J. Bacteriol. 1 88:71 65-71 75.

Weber, H., T. Polen, J. Heuveling, V. F. Wendisch, and R. Hengge.
2005. Genome-Wide Analysis of the General Stress Response Network in

181

170.

171.

172.

173.

174.

175.

176.

Escherichia coli: {sigma}S-Dependent Genes, Promoters, and Sigma
Factor Selectivity. J. Bacteriol. 1 87:1591-1603.

Wick, L. M., W. Qi, D. W. Lacher, and T. S. Whittam. 2005. Evolution of
genomic content in the stepwise emergence of Escherichia coli O157:H7.
J Bacteriol 187:1 783-91.

Wick, L. M., W. Qi, D. W. Lacher, and T. S. Whittam. 2005. Evolution of
Genomic Content in the Stepwise Emergence of Escherichia coli
O157:H7. J. Bacteriol. 187:1783—1791.

Wong, 0. S., S. Jelacic, R. L. Habeeb, S. L. Watkins, and P. I. Tarr.
2000. The risk of the hemolytic-uremic syndrome after antibiotic treatment
of Escherichia coli O157:H7 infections. N Engl J Med 342:1930-6.

Yamanaka, K., W. Zhang, 5. Crooke, Y. H. Wang, and M. Inouye. 2001.
CspD, a novel DNA replication inhibitor induced during the stationary
phase in Escherichia coli. Mol Microbiol 39:1572-84.

Yuen, T., E. Wunnbach, R. L. Pfeffer, B. J. Ebersole, and S. C.
Sealfon. 2002. Accuracy and calibration of commercial Oligonucleotide
and custom cDNA microarrays. Nucl. Acids Res. 30:e48.

Yuryev, A. 2007. PCR primer design using statistical modeling. Methods
Mol Biol 402:93-104.

Zwir, I., D. Shin, A. Kato, K. Nishino, T. Latiﬁ, F. Solomon, J. M. Hare,
H. Huang, and E. A. Groisman. 2005. Dissecting the PhoP regulatory
network of Escherichia coli and Salmonella enterica. Proc Natl Acad Sci U
S A 102:2862-7.

182