PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE . DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K:IProj/Aoc&Pres/CIRCIDaIeDuoIindd

 

———,——-—

PAN C
AND M

PANCREATIC B-CELL FATTY ACID METABOLISM
AND MODULATION OF FUNCTION IN RESPONSE TO

GLUCOLIPOTOXICITY
By

Christopher D. Green

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Biochemistry & Molecular Biology

2009

r
MODEL}

TyPc
funCliOn in
nhhiddh
decreased in
nun.mm
increased lit
Activation 0f
gene express
0813. H6“?
hyperglycemi
andGSlS. Li
expression of
synthesis and
together with 1
enhanced base
funnier of hi
increased iipoi
as diacyigiycei

proteins reduce

ABSTRACT

PANCREATIC B-CELL FATTY ACID METABOLISM AND
MODULATION OF FUNCTION IN RESPONSE TO GLUCOLIPOTOXICITY

By
Christopher D. Green

Type 2 diabetes is associated with gradual diminishment of pancreatic islet B-cell
function in response to chronic hyperglycemia and elevated plasma free fatty acids
(FFAs), defined as glucolipotoxicity. The effects of glucolipotoxicity on B-cells include
decreased insulin gene expression, diminished glucose-stimulated insulin secretion
(G818), and ultimately decreased B-cell mass. Loss of B-cell GSIS has been linked to
increased lipogenic gene expression and triacylglyceride (TAG) accumulation.
Activation of the liver X receptor (LXR) transcription factor further increases lipogenic
gene expression and TAG accumulation but increases both basal insulin release and
G318. Here, INS-1 B-cells treated with the LXR agonist T0901317 during chronic
hyperglycemia increased lipogenic gene expression, de novo synthesis of TAG, and basal
and G818. LXR-activated INS-1 cells exhibited increased fatty acid (FA) oxidation and
expression of genes involved in mitochondrial B-oxidation. Inhibition of fatty acyl-CoA
synthesis and mitochondrial B-oxidation blocked the elevated basal insulin release. Thus,
together with the rapid turnover of TAG in LXR-activated cells, these results indicate that
enhanced basal insulin release involves oxidation of fatty acyl-CoAs generated during
turnover of neutral lipid pools. Increased synthesis and turnover of TAG suggested
increased lipolysis of complex lipids and the generation of lipid signaling molecules such
as diacylglycerol. In this manner, inhibition of TAG turnover and diacylglycerol binding

proteins reduced the LXR-mediated increase in G818.

 

LXR acli
synthesis and 61“
limiting enlimcs
to be elerated in
rat islets had red
llL'FA synthesi:
B-cell response 1
Ms. cause tox
integrity, \s'hicl‘
siRVAs and ads
was examined f
(16:0). Knocki
lNS-l cells to
SCD2 increase
toxicity. Elosl
“Slim-9) and
0"eberrpressio
Palmitate-indu
Elorl.6 and E
maintaining b;

In Con

mmOVEr and s

LXR activation in INS-1 cells also increased monounsaturated F A (MUFA)
synthesis and elevated stearoyl-CoA desaturases (SCD) l and 2 gene expression, rating-
limiting enzymes in MUFA synthesis. SCD] and 2 gene expression were then identified
to be elevated in pre-diabetic Zucker diabetic fatty (ZDF) rat islets, whereas diabetic ZDF
rat islets had reduced expression of SCDl, SCD2 and Elovl-6, a FA elongase involved in
MUFA synthesis. These findings suggested SCDs and Elovl-6 could be involved in the
B-cell response to metabolic load. Elevated exogenous FFA levels, particularly saturated
F As, cause toxic effects to B-cells that include altered endoplasmic reticulum (ER)
integrity, which is linked to induction of ER stress responses and apoptosis. Using
siRNAs and adenoviral constructs, altered SCD or Elovl-6 gene expression in INS-l cells
was examined for its effects on ER stress and apoptosis mediated by exogenous palmitate
(16:0). Knockdown of SCDs decreased MUFA synthesis and increased susceptibility of
INS-1 cells to palmitate-induced ER stress and apoptosis, whereas over-expression of
SCD2 increased palmitate desaturation to palmitoleate (16:1,n-7) and reduced palmitate
toxicity. Elovl-6 knockdown decreased palmitate conversion to stearate (18:0) and oleate
(18:1,n-9) and tended to reduce palmitate-induced ER stress and apoptosis, while Elovl-6
over-expression increased synthesis of 18:0 and 18:1,n-9 and increased susceptibility to
palmitate-induced toxicity. Further studies showed that coordinated expression of SCDs,
Elovl-6 and Elovl-S, which elongates 16:1,n-7 to vaccenate (18:1,n-7), is required for
maintaining balanced de novo synthesis of n-7 versus n-9 MUFAs.

In conclusion, these studies demonstrate that modulation of TAG synthesis and

turnover and MUFA synthesis significantly alters the B-cell response to glucolipotoxicity.

T'n'
number of
teaching in
friendship. .
like to thanl
for their gui
Dr. Busik ar.
Fourth. l apr
members oft
Katrina Linn
Fifth. my file
memorable, e

Last b
and my bf 01hr

school 1 “on

“3”“ “won,

and OUr new ]j_

would n01 be p

Acknowledgements

This disseration would not be possible without the support and help from a
number of people. First, I would like to sincerely thank my advisor Dr. Olson for
teaching me how to do scientific research and writing, as well as providing advice,
friendship, and encouragement related to research and life in general. Second, I would
like to thank my committee members Dr. Jump, Dr. Benning, Dr. DeWitt and Dr. LaPres
for their guidance throughout my dissertation research. Third, I would also like to thank
Dr. Busik and Dr. Parameswaran for their helpful discussions and technical support.
Fourth, I appreciate the technical guidance, support, and friendship of all past and present
members of the Olson, Jump, Busik, Parameswaran and Uhal labs, especially Diana Ye,
Katrina Linning, Jinghua Xu, Yun Wang, Barbara Christian and Madelina Opreanu.
Fifth, my friends outside of lab have made this journey through grad school fun and
memorable, especially Trevor Barkham and Scott Brock.

Last but not least, I would like to express my sincere appreciation to my parents
and my brother and his wife for their unconditional support throughout my life and grad
school. I would also like to sincerely express my deep appreciation and graditude for the
warm support, encouragement, and help of my wife Hui during this dissertation research
and our new life together. Without the unwavering support of these people, this work

would not be possible.

iv

TABLE OF

List of Tables.
List of Figures
List of Abbres

INTRODL'C T

Chapter 1. Li
1. Fatty Acid 1
1.1. Fatty A
1.2. Modifit
1.2.1. Dc
1.2.2. E1
13.EXOgcn
1.4. De Km
1.5 Gi}‘cen
1.6. Transcr
1.6.1. C5
1.6.2. St
1.6.3. Li

1.7. Fairy A

2. Pancreatic 1
2.1. Mechar
22- Regula
2.3. MiiOCh
2'4- Genera

TABLE OF CONTENTS

List of Tables ....................................................................................... viii
List of Figures ....................................................................................... ix
List of Abbreviations ............................................................................... xi
INTRODUCTION ................................................................................... 1
Chapter 1. Literature Review
1. Fatty Acid Metabolism and Regulation of Lipogenic Gene Expression ............... 3
1.1. Fatty Acid Structure and Classification ................................................... 3
1.2. Modification of Fatty Acid Structure ...................................................... 4
1 .2.1 . Desaturation ............................................................................ 4
1.2.2. Elongation .............................................................................. 5
1.3. Exogenous Fatty Acid Uptake and Essential Fatty Acids .............................. 8
1.4. De Novo Fatty Acid Synthesis ............................................................. 9
1.5. Glycerol 3-Phosphate Pathway of Triacylglycerol Synthesis ......................... 12
1.6. Transcriptional Regulators of Lipogenesis ............................................. 14
1.6.1. Carbohydrate Response Element Binding Protein .............................. 14
1.6.2. Sterol Regulatory Element Binding Protein-1c ................................... 15
1.6.3. Liver X Receptors .................................................................... 16
1.7. Fatty Acid Oxidation ...................................................................... 18
2. Pancreatic B-Cell Insulin Secretion and Role of Fatty Acid Metabolism ............ 20
2.1. Mechanism of B-Cell Insulin Secretion ................................................. 20
2.2. Regulation of Fatty Acid Metabolism in Pancreatic fi-cells .......................... 22
2.3. Mitochondrial Anaplerosis/Cataplerosis ................................................ 24
2.4. Generation of Lipid Signaling Molecules ............................................... 25
2.4.1. Role of Malonyl-CoA ............................................................... 25
2.4.2. Free Fatty Acid, Long Chain Acyl-CoA, and Diacylglycerol .................. 26
2.5. Lipolysis and Glycerolipid/Fatty Acid Cycling ........................................ 28
2.5.1. Neutral Glycerolipid Lipolysis ..................................................... 28
2.5.1.1. Hormone-Sensitive Lipase .................................................... 28
2.5.1.2. Adipose Triacylglyceridc Lipase .................................... ,,, ...... 29
2.5.2. Phospholipases C and D ............................................................. 30
2.5.3. Phospholipase A2 ............................................................... ,,,. . .32
3. Glucose and Fatty Acid Mediated Pancreatic fi-Cell Dysfunction .................... 34
3.1. Glucotoxicity vs. Glucolipotoxicity in Type 2 Diabetes .............................. 34
3.2. Mechanisms of B-Cell Failure ............................................................ 35
3.2.1. Endoplasmic Reticulum Stress ..................................................... 35
3.2.2. Oxidative Stress ...................................................................... 36
3.2.3. Malonyl-CoA Inhibition of Fatty Acid Oxidation and Lipid Accumulation
................................................................................................. 37

U) (J)
('71 L) I-J

. 'J‘ 4..

-".
H
C)...

L.)
L»

J D) b)
J Lu b)
J l J I...

b
U
U

4. Statemen

Chapter 2.

Methods...
1. Mater
2. F atty :
3. Huma
4. Anima
5. [NS]
6. siRVA
7. Adena
8. RNA 5
9. Weste
10. lnsul
1]. Glue-
12. Com
13. Palm
l4. Stati:

Chapter 3.

Abstract. . .
lmmductio
“"18 .....

3.1. Effe

3.2.4. Dysregulated Glycerolipid/Fatty Acid Cycling .................................. 38

3.2.5. Apoptosis-Mediated Loss of B-Cell Mass ........................................ 39
3.3. Evidence and Mechanisms of B-cell Compensation ................................... 42
3.3.1. SREBP-lc and Liver X Receptors ................................................. 42
3.3.2. Glycerolipid/Fatty Acid Cycling .................................................... 43
3.3.3. Monounsaturated Fatty Acid Synthesis ........................................... 43
4. Statement of Problem and Specific Aims ................................................... 45
Chapter 2. Materials and
Methods .............................................................................................. 47
1. Materials ...................................................................................... 47
2. Fatty acid preparation ..................................................................... 47
3. Human islets ................................................................................. 48
4. Animals and islet isolation ................................................................ 48
5. INS-l cell culture ............................................................................ 49
6. siRNA treatment ............................................................................ 49
7. Adenovirus preparation ................................................................... 50
8. RNA analysis ................................................................................. 51
9. Western blot analysis ...................................................................... 55
10. Insulin secretion studies .................................................................. 55
ll. Glucose utilization studies ............................................................... 55
12. Complex lipid and fatty acid analysis ................................................. 56
13. Palmitate oxidation .......................................... . .............................. 57
14. Statistical analysis ......................................................................... 57

Chapter 3. Elevated Insulin Secretion From Liver X Receptor-Activated Pancreatic
B-Cells Involves Increased de Nova Lipid Synthesis and Triacylglyceride

Turnover .............................................................................. 58
Abstract .............................................................................................. 58
Introduction ........................................................................................ 59
Results ................................................................................................ 62
3.1. Effect of glucose and LXR activation on SREBP-l and lipogenic gene
expression ................................................................................... 62
3.2. Effect of glucose and LXR activation on lipogenesis ................................. 65
3.3. Effect of LXR activation on FA profile ................................................. 66
3.4. Impact of LXR activation on basal and glucose-stimulated insulin secretion. .....71
3.5. Role of FA oxidation in elevated basal insulin release ............................... 74
3.6. Role of TAG turnover in elevated insulin release ..................................... 77
Discussion ........................................................................................... 85

Chapter 4. Stearoyl-CoA Desaturase Modulates Palmitate-Induced Endoplasmic

Reticulum Stress and Apoptosis in Pancreatic B-ells ........................ 91
Abstract .............................................................................................. 91
Introduction ......................................................................................... 92
Results ................................................................................................ 95

4.1. Rat islet and INS-1 cell FA desaturase and elongase gene expression profiles. ...95

vi

 

‘ 10;. "' My
fi< ink fiffii;

_i
..
. v
‘
.'
..’.
f9
::E.
vs
2"
,9
? «-‘
..:_
; ;
VJ
.,.
L).
’I
I. '
Ea.
I‘.
' r
._3‘
'19
.0
?'=.
O“
z.
-t.
I:..
-1
I;l-
1.0,
.v:
137.
It,

0' D
4d-

.3:
‘5.- 51'1”".

0‘

o. I D
r ”o"!
O

M

'. ‘ '2‘!“ 'b'i‘. '3‘. ‘Vp'-"'-9‘J‘t.i
manamngcam;

 

4.2. PA de:
4.3. Knock
4.4. Suscep
4.5. SC D k
4.6. Over:

and m:
4.7. Effect:

4.8.8631!
diac)
actisation .....
Discussion. . . .

Chapter 5. R

M
Abstract ......
introduction .
Results ........

5.1. Regulg
5.2. Elevate
ratio or

5.3. siRNA
Speciti.

5.4. Over-e
ML’FA
Discussion... .

Chapter 6. G

BIBLIOGRA.

4.2. FA desaturase and elongase gene expression in ZDF rat islets ...................... 99
4.3. Knockdown of SCD and Elovl-6 gene expression modulate MUFA synthesis. 103
4.4. Susceptibility to palmitate-induced ER stress is increased by SCD knockdown

.............................................................................................................................. 106
4.5. SCD knockdown impacts susceptibility to palmitate-induced apoptosis ......... 107
4.6. Over-expression of SCD2 and Elovl-6 differentially modulate MUFA synthesis

and markers of ER stress ................................................................ 113
4.7. Effects of SCD2 and Elovl—6 over-expression on palmitate-induced apoptosis

.............................................................................................. 114
4.8. Elevated CHOP expression by SCD knockdown coincides with increased

diacylglycerol formation and involves Ca2+-dependent PKC
activation ....... 120
Discussion ............................................................................................ 123

Chapter 5. Role of Fatty Acid Elongases in Determination of De Novo Synthesized

Monounsaturated Fatty Acid Species ......................................... 128
Abstract ............................................................................................ 128
Introduction ....................................................................................... 129
Results .............................................................................................. 131
5.1. Regulation of FA elongase and desaturase genes by glucose ....................... 131
5.2. Elevated glucose increases abundance of de novo synthesized F As and alters the
ratio of saturated to monounsaturated FA ............................................. 132
5.3. siRNA knockdown of elongases and desaturases modulates the synthesis of
specific FA species ....................................................................... 136
5.4. Over-expression of Elovl-S or Elovl-6 leads to selective synthesis of specific
MUFA species ............................................................................ 141
Discussion .......................................................................................... 147
Chapter 6. General Conclusions and Future Studies .................................... 151
BIBLIOGRAPHY ................................................................................ 1 5 7

vii

Table 2.1...

Table 2.2...

Table 2.3...

Table 4.1...

List of Tables

Table 2.1 ............................................................................................. 52
Table 2.2 ............................................................................................. 53
Table 2.3 ............................................................................................. 54
Table 4.1 ............................................................................................ 101

viii

Figure 1.
Figure 1.
Figure 1..
Figure l.-‘
Figure 1.5
Figure 1.6

Figure 1.7

Figure 3.4..
Figure 3.5..
Figure 3.6...
Hflm37u
Figure 3.8...

Figure 4.1....

List of Figures

Figure 1.1 .............................................................................................. 7
Figure 1.2 ............................................................................................. 11
Figure 1.3 ............................................................ i ................................. 13
Figure 1.4 ............................................................................................. 17
Figure 1.5 ............................................................................................. 21
Figure 1.6 ............................................................................................. 33
Figure 1.7 ............................................................................................. 41
Figure 3.1 ............................................................................................. 63
Figure 3.2 ............................................................................................. 68
Figure 3.3 ............................................................................................. 70
Figure 3.4 ............................................................................................. 73
Figure 3.5 ............................................................................................. 76
Figure 3.6 ............................................................................................. 81
Figure 3.7 ............................................................................................. 83
Figure 3.8 ............................................................................................. 85
Figure 4.1 ............................................................................................. 97
Figure 4.2 ........................................................................................... 102
Figure 4.3 ........................................................................................... 105
Figure 4.4 ........................................................................................... 109
Figure 4.5 ........................................................................................... 112
Figure 4.6 ........................................................................................... 1 16
Figure 4.7 ........................................................................................... 119

ix

Figure
Figure .'

Figure 5

I It

Figure
Figure 5.
Figure 5.

Figure 6..

Figure 4.8 ........................................................................................... 123

Figure 5.1 ........................................................................................... 133
Figure 5.2 ........................................................................................... 136
Figure 5.3 ........................................................................................... 141
Figure 5.4 ........................................................................................... 146
Figure 5.5 ........................................................................................... 148
Figure 6.1 ........................................................................................... 155

AA
ABC

AC C

Ad

ADP
AGPAT
AMP
AHPK

ATF

CEBP
CHOP
C‘nRE
ChREBP
CPT
DAG
.151)

£161)

AA
ABC
ACC

Ad

AGPAT

AMPK
_ ATF
ATGL
ATP
B-gal
bHLH
C E
C/EBP
CHOP
ChRE
ChREBP
CPT
DAG
ASD

A6D

List of Abbreviations

arachidonic acid

ATP-binding cassette

acetyl-CoA carboxylase
adenovirus

adenosine 5 ’-diphosphate
acylglycerol-3-phosphate acyltransferase
adeonsine monophosphate
AMP-activated protein kinase
activating transcription factor
adipose triglyceride lipase
adenosine 5’-triphosphate
B—galactosidase

basic helix-loop helix

cholesterol ester
CCAAT/enhancer-binding protein
C/EBP homologous protein
carbohydrate response element
carbohydrate response element binding protein
carnitine palmitoyl transferase
diacylglyceride

delta-5 desaturase

delta-6 desaturase

xi

 

 

A90
DGAT
DNA
E1011
ER

FA
FAS
FFA
GK
GLL’TZ
GPAT
GSlS
HSL
INS-l
IREI
JNK
KREB
LCAD
LC~C0A
LDL
LPA
L-PK

LuQ

A9D

DGAT

DNA

Elovl

ER

FA

FAS

FFA

GK

GLUT2

GPAT

GSIS

HSL

INS-1

IREl

JNK

KREB

LCAD

LC-CoA

LDL

LPA

L-PK

Luc

delta-9 desaturase

diacylglyerol acyltransferase
deoxyribonucleic acid

fatty acid elongase

endoplasmic reticulum

fatty acid

fatty acid synthase

free fatty acid

glucokinase

glucose transporter 2
glycerol-3-phosphate acyltransferase
glucose-stimulated insulin secretion
hormone sensitive lipase

rat insulinoma cell line

inositol requiring ER-to-nucleus signal kinase 1
c-Jun N-terminal kinase

Kreb’s Ringer bicarbonate buffer
long chain acyl CoA dehydrogenase
long chain-acyl-coenzyme A

low density lipoprotein
lysophophatidic acid

liver pyruvate kinase

luciferase

xii

 

L-\'GC C
LXR

ME

hiLX
thPAT
ML'FA
NADH
NADPH
PA

PAP

PC

PDH
PERK
PKC
PLA2
PLC
PPARo
PL'FA
W R
RVA
ROS
RP137

G

RYR

L-VGCC
LXR
ME
MLX
thPAT
MUF A
NADH
NADPH
PA

PAP

PC

PDH
PERK
PKC
PLA2
PLC
PPAROt
PUFA

qPCR

ROS

RPL32

L-type voltage-gated calcium channel

liver X receptor

malic enzyme

Max-like protein X

mitochondrial GPAT

monounsaturated fatty acid

B-nicotinamide adenine dinucleotide
B-nicotinamide adenine dinucleotide phosphate
phosphatidic acid 3

phosphatidic acid phosphatase

pyruvate carboxylase

pyruvate dehydrogenase

double-stranded RNA-activated kinase (PKR)-like ER kinase
protein kinase C

phospholipase A2

phospholipase C

peroxisome proliferator activated receptor-or
polyunsaturated fatty acid

quantitative PCR

ribonucleic acid

reactive oxygen species

ribosomal protein L32

retinoid X receptor

xiii

TO
TED
VLAD
\lDl.
Xbp 1
ZDF

ZF

16:1,n.7
18:0
18:1,n-7

1811.n-9

1333,.n-6
30:33-9
~04 11.6

i

20.5 [1,3

’

3236M

SCAP
SCD
SREBP
TAG
TCA

T0

T2D
VLAD
VLDL
Xbpl
ZDF

ZF

16:0

16: 1 ,n-7
18:0

18: 1,n-7
18:1,n-9
18:2,n-6
18:3,n-6
20:3,n-9
20:4,n-6
20:5,n-3

22:6,n-3

SREBP cleavage activating protein
stearoyl-CoA desaturase

sterol regulatory element binding protein
triacylglyceride

tricarboxylic acid acyle

T0901317

type 2 diabetes

very long chain acyl CoA dehydrogenase
very low density lipoprotein
X-box binding protein 1

Zucker diabetic fatty rat

Zucker fatty rat

palmitic acid

palmitoleic acid

stearic acid

vaccenic acid

oleic acid

linoleic acid

linolenic acid

mead acid

arachidonic acid

eicosapentaenoic acid

docosahexeanoic acid

xiv

 

Ty
projected
diabetes re
cell insulir
insulin to
dl'Sregulate
elevated p
fimCllOn,
glucolipoto
giucose-stir
majm €03]
mechanism

Mm
glue01113010

INTRODUCTION

Type 2 diabetes (T2D) accounts for more than 90% of diabetes cases, which is
projected to affect 300 million people worldwide by 2025 (1, 2). Whereas type 1
diabetes requires insulin administration due to the complete absence of pancreatic islet B-
celliinsulin secretion, T2D results, in part, from the inability of B-cells to secrete enough
insulin to overcome insulin resistance and maintain glucose homeostasis. As
dysregulated glucose metabolism develops, sustained periods of hyperglycemia and
elevated plasma free fatty acids (FFAs) contribute to the progressive loss of B-cell
function, collectively termed glucolipotoxicity (3). The adverse effects of
glucolipotoxicity on B-cells include decreased insulin gene expression, diminished
glucose-stimulated insulin secretion (GSIS), and ultimately the loss of B-cell mass (4). A
major goal of our lab is to understand how these effects develop and to identify
mechanisms to protect from B-cell dysfunction.

Modulation of fatty acid (FA) metabolism in B-cells in response to
glucolipotoxicity is essential for maintaining proper function. Chronic exposure of B-
cells to elevated levels of glucose or glucose plus FFAs increases the storage of FA in
triacylglyceride (TAG) and diminishes GSIS (3). Thus, accumulation of TAG in B-cells
has been associated with the pathogenesis of B-cell dysfunction. Evidence has emerged,
however, for protection of B-cells from glucolipotoxicity by modulating the expression
and activity of genes involved in de nova FA synthesis (lipogenesis) and TAG storage.
This includes regulation of lipogenic genes via liver X receptor (LXR) activation and
genes involved in monounsaturated FA synthesis (5, 6). This dissertation provides

insight into the mechanism of elevated insulin secretion from LXR-activated B-cells

 

r .
-<- d -.5 r

{uL-IFC» ’ 4
g-12..&o.a‘~::;

u. guano 0-: ~

 

.Q\: o I- o
I

05:75;
o~. to)?

fig; ‘10,.- . O-

r :55; .-
swat-twp."

. '3""T'~" ‘3' " 7" ""
_ 5.324%“ manger

. ,7 ‘xy'-
' 'v13
0

i

l

i

1

h under ck
desaturas
fi-ceils tc

that cault

,4:
I
!
I
i

y.
. ' '
. < - 21'! '1 =9" -..«....._,.. - .w_.-,_..

 

under chronic hyperglycemia, and examines the roles of altered expression of FA
desaturase and elongase genes involved in monounsaturated FA synthesis in response of
B-cells to exogenous saturated F As. The findings of this research identify mechanisms

that could be utilized to prevent the onset of B-cell failure and T2D.

 

Chapter
1. Fafl)‘ A
1.1. F arty
Fat
stabilizing
signal Iran
structure.
group and
hydrocarbo
saturated F
represented
unsaturated
monounsatt
iPL'FAS), C,
denoting 1h,
end_ For e:
carbons, One
PLfFA SUCh
the first do“
consisrs Of a

Chapter 1. Literature Review

1. Fatty Acid Metabolism and Regulation of Genes Involved in Lipogenesis
1.1. Fatty Acid Structure and Classification

Fatty acids (FAs) serve numerous essential biological functions, such as
stabilizing cellular membranes, providing energy storage depots, and participating in
signal transduction. The efficacy of these functions is largely dependent on the FA
structure. FAs are composed of hydrocarbon chains of various lengths with a methyl
group and a carboxyl group residing at opposite ends of each chain. FAs with
hydrocarbon chains that are completely saturated with hydrogen atoms are termed
saturated FAs. An example of a saturated FA is the sixteen-carbon FA palmitic acid,
represented as 16:0. Modified FAs containing one or more double bonds are termed
unsaturated FAs. The number of double bonds further categorizes these FAs into
monounsaturated FAs (MUFAs), containing one double bond, and polyunsaturated FAs
(PUF As), containing two or more double bonds. Unsaturated FAs are characterized by .
denoting the position of the carbon of the first double bond, counting from the methyl
end. For example, the MUFA oleic acid is represented as 18:1,n-9, as it has eighteen
carbons, one double bond, and the double bond is nine carbons from the methyl end. A
PUFA such as arachidonic acid. (20:4,n-6) has four double bonds and only the position of
the first double bond is listed. As in all cells, the cellular FA composition of islet B-Cells
consists of a broad range of saturated and unsaturated FAs, the concentrations of which

are under tight regulation.

.J.‘

25;” _

1.2. Mod
1.2.]. De:
M
reductase.
cis-double
addition 0
called stea
double bor
involved ir.
acid (18:1,r
('7). ASD ;
(20:339.). 2
and MD ar
brain and he
and B'cells (_
Stear
Particular;y I
include four
hamster {SC}
SUbStraie spec

4

p reference 101

stearic acid (

1.2. Modification of Fatty Acid Structure
1.2.1. Desaturation

Modification of F As by oxidative desaturation uses NADH-cytochrome b5
reductase, cytochrome b5, and a desaturase to convert a single carbon-carbon bond to a
cis-double bond (Figure 1.1). In mammals, the FA desaturases capable of enzymatic
addition of a cis-double bond include delta 5 desaturase (ASD), A6D, and A9D, also
called stearoyl-CoA desaturase (SCD). The ‘A’ refers to the position of the carbon the
double bond is added, counting from the carboxyl end. The ASD and A6D genes are
involved in PUFA synthesis. Substrates preferentially desaturated by the A6D are oleic
acid (18:1,n-9) and the C18 and C24 PUFAs, whereas ASD prefers C20 PUFA substrates
(7). ASD and A6D activities [are essential for the synthesis of the PUFAs mead acid
(20:3,n-9), arachidonic acid (20:4,n-6), and docosahexaenoic acid (22:6,n-3) (7, 8). ASD
and A6D are ubiquitously expressed with the highest level found in liver, followed by
brain and heart (9). The ASD and A6D genes were identified to be expressed in rat islets
and B-cells (10), but a unique role in B-cell function has not been demonstrated.

Stearoyl-CoA desaturase (SCD) is the rate-limiting enzyme for MUFA synthesis,
particularly palmitoleate (16:1,n-7) and oleate (18:1,n-9). SCD isoforms cloned thus far
include four from mouse (SCD1—4) (11-14), two in rat (SCDl and 2) (15), three in
hamster (SCD1-3) (16), and three in human (SCDl, 2, and 5) (17-19). Analysis of
substrate specificity using microsomal fractions from cells over-expressing SCD 1, 2, or
4 demonstrated the ability to desaturate C13-Cl9 saturated FAs with a particular
preference towards stearic acid (18:0) (20). SCD3 desaturated C13-C16 FAs but not

stearic acid (18:0), suggesting that SCD3 should be redefined as a palmitoyl-CoA

desaturase (3
enhanced ca;
fold higher 1
oleic acid (1
lipid storage
expression in
formation ( 1 1
SCD2 is expr
is restricted t.
for the skin (
(13).

AlthOi
and vvax ester
IiPld metabo
ellPicssion pr
Cell function 1
1.2.2. EIOnga

FA e1.
calaij'zEd in 1‘.
using NADP}
The me‘llmir;
which are Sub

m
OlBe2 rat, an

desaturase (20). SCD] is highly expressed in adipose tissue and liver, tissues with
enhanced capacity for neutral lipid storage (12). The activity of SCD] is more than 2-
fold higher for stearic acid than palmitic acid (20). This in turn increases synthesis of
oleic acid (18:1,n-9) and correlates with the requirement of SCD] activity for neutral
lipid storage, as oleic acid is the preferred substrate for TAG storage (21). SCD2
expression in mice is primarily found in the brain, presumed to be important for myelin
formation (11), and is required for lipid synthesis during early development (22). Human
SCD2 is expressed at high levels in the brain and whole pancreas (19). SCD3 expression
is restricted to skin sebaceous glands and is thought. to be involved in making wax esters
for the skin (14, 23, 24). The mouse SCD4 isoform is expressed specifically in the heart
(13).

Although studies have identified direct roles for SOD] and SCD3 in lipid storage
and wax ester synthesis, respectively, the significance of the SCD2 and SCD4 isoforms in
lipid metabolism remains unclear. More specifically to the islet B-cell, the gene
expression profile of SCDs and the contributions of specific SCD isoforms to normal [3-
cell function have not been determined.

1.2.2. Elongation

FA elongation by addition of a malonyl-CoA C2 unit to a fatty acyl-CoA is
catalyzed in four steps: condensation of the fatty acyl-CoA with malonyl-CoA, reduction
using NADPH, dehydration, and reduction to the fatty acyl-CoA product (Figure 1.1).
The rate-limiting condensation step is catalyzed by various FA elongases, the activities of
which are substrate dependent. Seven subtypes of FA elongases have been identified in

mouse, rat, and human, and are referred to as e_longation 9f yery long chain fatty acids

(Elo‘
chain
barrr’e.
mainl}
PL‘FAs
34'). T11
level bei
palmitole
tissues (3
of oleic
characteriz
Tn
Preparations
C18 ML'FA
mammalian r

Elongases in i

(Elovl-1 to 7) (www.cnsembl.org). Elovl-l, 3, and 4 elongate a broad range of very long
chain FAs (>C20) and are involved in sphingolipid synthesis, brown adipose and skin
barrier function, and retinal function, respectively (25-30). Elovl-2 and Elovl-5 are
mainly involved in n-3 and n-6 PUFA synthesis, with Elovl—2 elongating C20 and C22
PUFAs and Elovl-5 elongating C18 PUFAs as well as palmitoleic acid (16:1,n-7) (31-
34). The expression of Elovl-2 and Elovl-5 was detected in most tissues with the highest
level being in the liver (35). Elovl-6 is capable of elongating C12-16 saturated FAs and
palmitoleic acid (16:1,n-7) (31, 32). Although the expression of Elovl-6 is low is most
tissues (35), its activity significantly regulates stearic acid (18:0) synthesis, the precursor
of oleic acid (18:1,n-9) (36). Elovl-7 substrates and expression have not been
characterized.

In regards to MUFA synthesis, FA elongation assays using microsomal
preparations demonstrated Elovl-5 and Elovl-6 to elongate C16 FAs for the generation
C 18 MUFAs. The roles of these genes in the de nova synthesis of MUFAs in intact
mammalian cells, however, have not been addressed. In addition, a unique role for FA

elongases in B-cells is not known.

 

 

 

 

~ww

 

NADH 4

NAD

 

NADH:C
b5 Re

 

NADH + H)£’ (Fe 2+8)“ Stearoyl- -CoA + 02
NAD“ Fe3+ Fe3+ (HEX

Oleoyl-CoA + H20

 

NADH: Cytochrome Cytochrome b5 Stearoyl-CoA
b5 Reductase Desaturase

Fatty acyl-CoA

ml w' a...
3-Ketoacyl-CoA

—1m

3-Hydroxyacly-COA

_i D...yd......

Trans-2, 3-enoyl-COA
TER

Elongated Fatty acyl-CoA

Figure 1.1. Reaction diagrams for FA desaturation through the stearoyl-CoA
desaturase complex and general FA elongation. Microsomal FA desaturation occurs
through the transfer of two electrons from NADH to oxygen to produce a desaturated F A-
CoA and water. Microsomal FA elongation occurs through the following sequential
reactions: 1) FA-CoA condensation with malonyl-CoA to form 3-ketoacyl—COA, 2) 3-
ketoacyl-CoA reduction to 3-hydroxyacyl-COA using NADPH, 3) 3-hydroxyacyl-COA
dehydration to trans-2,3-enoyl-COA, 4) trans-2,3-enoyl-COA reduction to acyl-CoA.
KAR, 3-ketoacyl-COA reductase. TER, trans-2,3-enoyl-C0A reductase.

 

13.Ex038"°
A ma.
derived from ‘
FAs (C-g- 31b
complexes cor
cholesterol. 3.
respectively.
after digesting .
lumen of the in
and 2-monoacy
glycerol and FF
the}: are used 11
within lipoprotei
both exogenous
lipcproteins, par
LDL), are cleav e
tissues (44). FFF
TAG and cholestc
theliver(45). Sui
Either facilitated '

membrane.

Dietary F

 

linolenic acid ( 13

 

1.3. Exogenous Fatty Acid Uptake and Essential Fatty Acids

A major source of intracellular FAs comes from transport of exogenous FA
derived from circulating chylomicrons, lipoproteins, free FAs (FFAs), and protein bound
FAs (e.g. albumin). ChylomiCrons and lipoproteins consist of lipid droplet/protein
complexes composed of triacylglycerol (TAG), cholesterol esters, glycerophospholipids,
cholesterol, and apolipoproteins, and are secreted from the intestine and liver,
respectively. FAs incorporated into chylomicrons primarily originate from dietary fat
afier digesting a meal. TAG, the predominant source of dietary FA (37), is cleaved in the
lumen of the intestine by pancreatic lipase at the sn-1 and sn-3 positions to produce FF As
and 2-monoacylglcyerol (2-MAG) (3 8-40), the latter of which can be further cleaved to
glycerol and FFA (41). MAG and FFAs are then transported inside enterocytes where
they are used to reassemble TAG for chylomicron formation (42, 43). Lipid droplets
within lipoproteins that are secreted from the liver contain a mixture of FAs derived from
both exogenous and de nova (see next section) sources. Circulating chylomicrons and
lipoproteins, particularly very low density and low density lipoproteins (VLDL and
LDL), are cleaved by lipoprotein lipase to release FFAs for storage and use in peripheral
tissues (44). FFAs are also released into the circulation during fasting by activation of
TAG and cholesterol ester hydrolysis in lipid storage depots, such as adipose tissue and
the liver (45). Subsequent uptake of exogenous F FAs at peripheral tissues occurs through
either facilitated transport by FA transport proteins or by diffusion of the plasma
membrane.

Dietary FAs are the source of the essential FAs linoleic acid (18:2,n-6) and '

linolenic acid (18:3,n-3). Essential FAs are defined as essential because animals lack the

 

 

312D and A151)
linoleic acid and
docosahexeanoic
ssnthesis of ar
elongation activ
from 18:3.n-3 a
peroxisomal B-o
1.4. De .\'ovo F:

De navo
FAs that are n‘
mainly from the
COA and malon
in and out of t
moon of ti
mitochondrial l
mitochondria, )
into “Fill-Co;
for em)“ into i
EDA carbox}’1a
Fan}, acid syn
elgngaliOn and
PTOdUCe The $8

lllCleaSeg d8 ’70

A12D and A15D enzymes required for the synthesis of n-6 and n-3 FAs. Conversion of
linoleic acid and linolenic acid to other PUFAs, such as arachidonic acid (20:4,n-6) and
docosahexeanoic acid (22:6,n-3), is important for normal cellular function. Endogenous
synthesis of arachidonic acid from 18:2,n—6 requires sequential desaturation and
elongation activities of A6D, Elovl-5, and ASD, while docosahexeanoic acid synthesis
from 18:3,n-3 additionally requires elongation by Elovl-2, desaturation by A6D, and
peroxisomal B-oxidation (Figure 1.2) (7).
1.4. De Novo Fatty Acid Synthesis

De nava synthesis of FAs characterizes the intracellular, cytosolic production of
FAs that are made entirely fi'om intracellular acetyl-CoA and malonyl-CoA, derived
mainly from the tricarboxylic acid cycle‘(TCA). The accumulation of cytosolic acetyl-
CoA and malonyl-CoA is highly dependent upon glucose metabolism and the carbon flux
in and out of the TCA cycle. Exposure of cells to elevated glucose levels increases
transport of the glycolytic product pyruvate into the mitochondria, conversion of
mitochondrial pyruvate to citrate via the TCA cycle, and export of citrate from the
mitochondria. ATP-citrate lyase (ACL) then catalyzes the cleavage of cytosolic citrate
into acetyl-CoA and oxaloacetate, the latter of which can be converted back to pyruvate
for entry into the mitochondria. Carboxylation of ACL-derived acetyl-CoA via acetyl-
CoA carboxylase (ACC) provides the necessary FA elongation substrate malonyl-CoA.
Fatty acid synthase (FAS) performs all the enzymatic reactions necessary for FA
elongation and subsequently utilizes one acetyl-CoA and seven malonyl-CoA units to
produce the saturated FA palmitic acid (16:0) (46, 47). Together, elevated glucose

increases de nova FA synthesis through elevated carbon flux through the TCA cycle and

=Ii

‘ “wrawxr 4-

*1

export Of C ll
palmitate.
De n
through [we
desaturation
either Elovl-
oleic acid (1
FA produce

reducing SC

(I)

snthesis a:
excessive lg
nova FA 8};
(30:33-9)

deSaturati 0r

export of citrate, which can be sequentially converted through ACL, ACC and FAS to
palmitate.

De nova or exogenously derived palmitic acid can be used for MUFA synthesis
through two pathways: Elovl-6 elongation to stearic acid (18:0) followed by SCD
desaturation to oleic acid (18:1,n-9); SCD desaturation to palmioleic acid (16:1,n-7) and
either Elovl-6 or Elovl-5 elongation to vaccenic acid (18:1,n-7) (Figure 1.2). Synthesis of
oleic acid (18:1,n-9) has been demonstrated to be important for storing excess saturated
FA produced after exposure to a high carbohydrate diet, an effect that is blocked by
reducing SCD] gene expression (48). Thus, enhanced de nova FA synthesis drives the
synthesis and storage of MUF As as a mechanism to prevent the accumulation of
excessive levels of endogenous FFA. During conditions of essential FA deficiency, de
nova FA synthesis also provides MUFAS as substrates for PUFA synthesis of mead acid
(20:3,n—9) through sequential A6D desaturation, Elovl-l elongation, and ASD

desaturation of oleic acid (Figure 1.2) (8).

10

 

--
2 W "fur a‘o-J
bun—w...

Glucos

 

1
N6:
N3 :
E
F

Figure 1.2.
deTlVed paln
to stearic act
10 133111110191"
'Ssential FA
prOCeSSed IC
elongaSeS E
deficiency,

Elm-LL and

 

 

 

 

 

Glycalysis
A TP Citrate Lyase
Acetyl CaA Carboxylase
Fatty Acid Synthase
I Elongase
Glucose —-> 16 0 —> 18:0
Elovl6 A9D Essential fatty acid
A9D S CD Deficiency & Obesity
SCD ..............
13 1'19 —>:18: 2—>20: 2->2o: 31
Elongase A6D ' 5.3;]; " ' ' 351'; ' ' "
16:1n7 ———> 18:1n7
ElovlS/Elovl6
Diet __________________
5”" k-—--—”'”'“"“--—‘-‘:.~g‘

N6: 18:2 +18:3->2o:3->2o:4zh 22:43.1 24:4—>24:5 ------- > 22:5
A6D Elovl5 A5D Elov12 Elovl2 A6D pp-ax
N3: 18:3 —>rs:4->20.4—>20: 5—>22: 5:224: 5:224: 62:?22:6

‘-- -“'"”
‘ ----------—--—‘—’— ”
“‘ "’
~ ‘
‘--- -——’
-—----———--———

 

 

 

Essential
Fatty Acids

Figure 1.2. Synthesis of FAs de novo and from exogenous essential FAs. Glucose-
derived palmitic acid (16:0) can be further modified by two pathways: Elovl—6 elongation
to stearic acid (18:0) and SCD desaturation to oleic acid (18:1,n-9); or SCD desaturation
to palmioleic acid (16:1,n-7) and Elovl-5/Elovl-6 elongation to vaccenic acid (18:1,n-7).
Essential FAs from the diet, linoleic acid (18:2,n-6) and linolenic acid (18:3,n-3), are
processed to long chain unsaturated FAs through the desaturases A6D and ASD, the
elongases Elovl-5 and Elovl-2, and peroxisomal [ii-oxidation. During essential FA
deficiency, de nova synthesized 18:1,n-9 is converted to mead acid (20:3,n-9) by A6D,
Elovl-1, and ASD. Modified from Fatty Acid Regulation of Gene Transcription (8).

11

15. GlycerOI
TAG
siniheslS of
phOSPhate’ a i
first step, 3”
SEmhaase. 2
ac) ltransl‘s’rasc
1.3). 5511111551
membranes. 35
(DA is transfer
(AGPATSL 10C
Dephogphorylal
produces diacyl
svnthesis of g1}
addition of a thii
The rate of de
through both dire

ofgenes involvec

 

1.5. Glycerol 3-Phosphate Pathway of Triacylglycerol Synthesis

TAG serves as a storage depot for excess intracellular FFAs. In eukaryotes,
synthesis of TAG de nova proceeds through stepwise FA acylation of glycerol 3-
phosphate, a product of the glycolytic intermediate dihydroxyacetone phosphate. In the
first step, an activated FFA, fatty acyl-CoA (FA-CoA) formed from an acyl-CoA
synthetase, is esterified onto glycerol 3-phosphate by glycerol-3-phosphate
acyltransferase (GPAT) at the sn-1 position to form lysophophatidic acid (LPA) (Figure
1.3). Synthesis of LPA occurs at the mitochondrial and endoplasmic reticulum (ER)
membranes, as GPAT isoforms are found at both locations (49, 50). Next, another FA-
CoA is transferred to LPA by a family of l-acylg1ycerol-3-phosphate acyltransferases
(AGPATs), located in the ER membrane, to form phosphatidic acid (PA) (51, 52).
Dephosphorylation of PA by a PA phosphatase (PAP) 1, also referred to as lipin,
produces diacylglyceride (DAG) (53). Both PA and DAG can be utilized for the
synthesis of glycerolphospholipids. The final reaction in TAG synthesis involves the
addition of a third F A-CoA to DAG, catalyzed by a DAG acyltransferase (DGAT) (53).
The rate of de nova TAG synthesis is highly affected by substrate availability and,
through both direct and indirect mechanisms, substrate-induced transcriptional regulation

of genes involved in FA synthesis and storage as described below.

12

 

i

-s-‘ {:3

ngun: 1.3.
is esteriiled
acyltransfera
or the ER 1
PhOSphaIe a
dePhOSphOr}.
FA'COA is e
maciilgll'ceri
Simi'lesis (Pi,

Glycerol-3-phosphate
Acyl-CoA Acyl-CoA

GP AT Endoplasmic

Mitochondria GPAT reticulum

A l-C A
LPA Cy °

AGPAT Endoplasmic

reticulum
PI, PG, CL 4—- PA
PAP
Endoplasmi
creticulum
Pi
PC, PE, PS <——- DAG
Acyl-CoA
DGAT

 

TAG

Figure 1.3. Glycerol-3 phosphate pathway for triacylglyceride synthesis. A F A-CoA
is esterified to glycolysis-derived glycerol-3 phosphate by glycerol-3 phosphate
acyltransferase (GPAT) to form lysophosphatidic acid (LPA) at either the mitochondrial
or the ER membrane. A second FA-CoA is esterified to LPA by acylglycerol-3
phosphate acyltransferase (AGPAT) to form phosphatidic acid (PA). PA is then
dephosphorylated to diacylglycerol (DAG) by PA phosphatase (PAP). Finally, a third
FA-CoA is esterified to DAG by diacylglycerol acyltransferase (DGAT) to form the
triacylglyceride (TAG). PA and DAG can also be directly used for phospholipid
synthesis (PI, PG, CL, PC, PE, and PS).

13

1.6. TranSC
1.6.1. C arb
Glue
glycolysis.
shunt. F lux
activator of
activate the
basic helix
Binding of (
0f genes our
genes involv
[0 Contain (
GPAT (th1
that glucose I
the ChREBP
LPK. and Ml
of TC A Cycle
of citrate and
Storage of FA

31112 thPAT

1.6. Transcriptional Regulators of Lipogenesis
1.6.1. Carbohydrate Response Element Binding Protein

Glucose metabolism is initiated through uptake, phosphorylation, and subsequent
glycolysis. In addition, glycolytic intermediates can enter the hexose monophosphate
shunt. Flux through the hexose monophosphate shunt produces xyulose 5-phosphate, an
activator of protein phosphatase 2A that has been proposed to dephosphorylate and
activate the carbohydrate response element binding protein (ChREBP) a member of the
basic helix loop helix leucine zipper (bHLH/leu zip) transcription factor family (54).
Binding of ChREBP and its heteromeric partner Max-like protein X (Mlx) to promoters
of genes containing carbohydrate response elements (ChREs) activates transcription of
genes involved in glucose metabolism and de nova FA synthesis (55, 56). Genes known
to contain ChREs include L-pyruvate kinase (LPK), ACC, FAS, and mitochondrial
GPAT (thPAT) (57-59). Studies in liver using a dominant negative Mlx demonstrated
that glucose transporter 2 (GLUT2), malic enzyme (ME), and SCDl are also regulated by
the ChREBP/Mlx complex (55). Enhanced pyruvate production by increased GLUT2,
LPK, and ME expression increases pyruvate entry into the mitochondria and generation
of TCA cycle intermediates. Accumulation of TCA cycle intermediates favors the efflux
of citrate and conversion to acetyl-CoA by ACL that is driven towards synthesis and
storage of FAS via increased ChREBP/Mlx-mediated expression of ACC, FAS, SCDl,

and thPAT.

l4

 

1.6.2. 5“”
Sic
transcript}.C
conditiOnS‘
with the Si
SREBP ins
bHLH'kU .'
tranSP'Oned
include SRE
Eenes im01 "
studies” am
intracellular 3

SREBP‘IC Pl
protein abund
the SREBP SC
is still unclea:
glucose and 5}"
ACC, FAS, Eh.
increases the r:
shuttling of TC «5
manner, intake a.

(lien glucose to

insulin secreted fr

 

1.6.2. Sterol Regulatory Element Binding Protein-1c

Sterol regulatory element binding proteins (SREBPs) are bHLH/leu zip
transcription factors and key regulators of lipid synthesis (60). Under non-stimulated
conditions, inactive and unprocessed SREBPs reside in the ER membrane and interact
with the SREBP cleavage activating protein (SCAP) and Insig-2 (61-63). Activation of
SREBP involves translocation of the SREBP/SCAP complex to the Golgi where the
bHLH/leu zip domain is cleaved by site 1 and site 2 proteases and subsequently
transported into the nucleus to initiate gene transcription (64, 65). Isoforms of SREBP
include SREBP-1a, -1c, and -2. SREBP-1c is a major activator of the expression of
genes involved in FA synthesis, whereas SREBP-2 induces genes involved in cholesterol
synthesis and SREBP-1a activates genes for both FA and cholesterol synthesis (60). Low
intracellular sterol levels initiate processing of SREBP-1a and -2 but not -lc (66, 67).
SREBP-1c processing is initiated by insulin through decreased gene expression and
protein abundance of Insig-2 (68), which releases its interaction with SCAP and allows
the SREBP/SCAP complex to translocate to the Golgi (62, 63). Although the mechanism
is still unclear, insulin-mediated SREBP-1c processing increases the metabolism of
glucose and synthesis of FAs through binding to promoters of glucokinase (GK), ACL,
ACC, FAS, Elovl-6, SCD l and 2, and thPAT (59, 69-76). Elevated GK expression
increases the rate-limiting step of glycolysis, while the latter enzymes increase the
shuttling of TCA cycle intermediates into FAs that are stored in complex lipids. In this
manner, intake of dietary carbohydrates, specifically simple sugars, activates ChREBP to
divert glucose to storage as FAS, and this process is enhanced through SREBP-lo by

insulin secreted from glucose-stimulated pancreatic B-cells.

15

 

‘V

1.6.3. Liver .\'

Choic’S'
and i2 membc
LXRs are acti‘
LXR “35 Mei
isoform is Will
vvhereas LXRT;
receptor (RXR
transcription 01‘
rate-limiting en.
ABCGI, plasmé
of genes involve
ChREBP and S
synthetic agoni:
atherosclerotic p'
liter, hovvever, c.
10“ density lipOp
induced SREBP-

have reduced ex

 

illustrates that L“

 

 

1.6.3. Liver X Receptors

Cholesterol and lipid homeostasis are also regulated by liver X receptors (LXR) or
and [3, members of the nuclear hormone receptor superfamily of transcription factors.
LXRs are activated by intracellular oxysterols (cholesterol intermediates), and recently,
LXR was identified to directly bind and be activated by glucose (77). The LXRor
isoform is highly expressed in the liver, intestine, adipose tissues, and macrophages,
whereas LXRB is ubiquitously expressed (78). LXR heterodimerizes with its retinoid X
receptor (RXR) partner, which then bind LXR response elements and activate
transcription of genes involved in cholesterol catabolism and efflux such as CYP7A1, the
rate-limiting enzyme for bile acid synthesis, and ATP-binding cassette (ABC) A1 and
ABCGl, plasma membrane transporters involved in sterol transport (70, 79). Promoters
of genes involved in de nova FA synthesis that contain LXR response elements include
ChREBP and SREBP-10 as well as FAS, SCD], SCD2, and others (80-84). The
synthetic agonist T0901317 also activates LXRs, and its use in mice reduced
atherosclerotic plaques caused by cholesterol accumulation (82). LXR activation in the
liver, however, caused a significant increase in TAG accumulation and secretion of very
low density lipoproteins (85). In addition, LXR was shown to be required for insulin-
induced SREBP-1c transcription (86), and LXR or/B -/- mice fed a high carbohydrate diet
have reduced expression of some genes involved in FA synthesis (87). Together this

illustrates that LXR is a key mediator of de nova synthesis and storage of FAs.

16

“ u',‘ j. .
o

9
_.
t
1‘-
O
T.
.9.
9':
E"
2”;
€' .
‘1
D
,D
.
. ..-
.~".
T'-
I C
.
2 .
O.‘
.a,
:1».
*5
3.
..,...
.1'
V
E
'.
O’
(-2.
.v
V
a
n,
.-..‘
I
11::
.,.
1‘!
.‘g
¢

, r.
2.: t
3,

4- .‘ A14
' .0. ‘4‘"
mks-l,

4

N
O

' i; . -‘ IrWerfigm ,y.,..,,g,

 

 

Glu

Insulins

LX

Figure 1.4,
illSlliln. Dum
Slum (Harp) a
S.l'ltthesis of

Glucose

GKi

Glucose 6-phosphate

  
   
      

glycolysis
L-PK
pyruvate
HMP m TCA cycle
Glucose —>ChREBP
citrate
Insulin ACL
- ace l-CoA
t W
LXR ACC
malonyl-CoA
\ FAS
\ 16:0
Elovl-61
. SCD1I2
1621/1821

TAG

Figure 1.4. Transcriptional regulation of lipogenic gene expression by glucose and
insulin. During conditions of elevated glucose, flux through the hexose monophosphate
shunt (HMP) activates ChREBP to induce L-type pyruvate kinase (L-PK) and drive the
synthesis of pyruvate through glycolysis. Insulin secreted into the circulation from
glucose-stimulated B-cells increases SREBP-1c processing, which can induce
glucokinase to enhance glucose metabolism. Both ChREBP and SREBP-1c activation
lead to the induction of genes involves in de nova synthesis and storage of FAs. LXRs
can also bind and be activated by glucose and subsequently stimulate lipogenesis idirectly
through ChREBP and SREBP-1c and directly through F AS and SCDl/2.

1.7. F3“? ‘1
In H
through 5’0
from 21 FA-‘
utilized b). I
OH Camlilnc
camlllne fur
the F,\-cami
[0 Ver} long-
medium I0 W
transported to
During
decrease. \Vhit‘
cycle generatio
cellular energy
phosphorylatior
reducing cytosol
dependenl on car

lo FA-carniline

b—O»

 
 
  

Huibited bv ma’

relieve CPT-l in
ATP.

1.7. Fatty Acid Oxidation

In mammals, mitochondria and peroxisomes carry out chain shortening of F As
through B-oxidation. This process involves the multi-step enzymatic removal of C2 units
from a F A-CoA to produce a shortened F A-CoA and acetyl-CoA, the latter of which is
utilized by mitochondria to generate ATP. Mitochondrial B-oxidation of FA is dependent
on camitine palmitoyltransferase-l (CPT-1)—mediated conversion of FA-CoAs to FA-
camitine for transport into the mitochondria. Inside the inner mitochondrial membrane,
the FA-carnitine is converted back to FA-CoA by CPT-2, and B-oxidation reduces short

to very long-chain FA-CoAs completely to acetyl-CoAs. Peroxisomes, however, reduce

 

medium to very long-chain FA-CoAs to shorter chain FA-CoAs and acetyl-CoA that are
transported to the mitochondria for further [Bi—oxidation (88).

During periods of nutrient deprivation or fasting, TCA cycle intermediates
decrease, which leads to the induction of FA oxidation. Reduced glycolytic and TCA
cycle generation of ATP causes an increase in the AMP/ATP ratio and activation of the
cellular energy sensor AMP activated protein kinase (AMPK) (89, 90). AMPK-mediated
phosphorylation inhibits ACC and activates malonyl-COA decarboxylase, effectively
reducing cytosolic levels of malonyl-COA (89, 90). Mitochondrial B—oxidation of FA is
dependent on carnitine palmitoyltransferase-l (CPT-l)-mediated conversion of FA-CoAs
to FA-carnitine for transport into the mitochondria. CPT-l activity is allosterically
inhibited by malonyl-CoA (91). Thus, reduced TCA cycle flux and AMPK activation
relieve CPT-l inhibition by malonyl-CoA to allow for FA oxidation and the generation of

ATP.

18

 

Ge
proliferato
PPARa id.
regulates 3
glucose reg
intracellular
mitochondri
Wifli RXR It

may compel.

Genes involved in peroxisomal B—oxidation are induced by the peroxisome
proliferator activated receptor-a (PPARa) transcription factor. Natural ligands of
PPARa identified thus far include FFAs, FA-CoAs and glucose (92, 93). PPARa also
regulates some genes participating in mitochondrial B-oxidation (94). Together, direct
glucose regulation of PPARa could possibly serve to prevent accumulation of excess
intracellular FFAs during exposure to elevated levels of carbohydrates by elevating
mitochondrial and peroxisomal FA oxidation. Similar to LXR, PPARa heterodimerizes
with RXR to initiate transcription, suggesting that activation of these opposing pathways

may compete for RXR.

19

2. Pancr
2.1. 519‘“
P2
secreting-
of insulin
gl}‘CO§€n ‘
metabolism
lasting UP I
97). It is u
dependent Uj
through gb'c
phosphon'lati
potassium (K-
activation of ‘
indirectly trigg
cells in respons

acids, amino 3C1

granule exocnos

  
 
  

are less understr
ofFA metabolis

GSIS. (99, m3.

2. Pancreatic B-Cell Insulin Secretion and Role of Fatty Acid Metabolism
2.1. Mechanism of B-Cell Insulin Secretion

Pancreatic B-cells respond to a rise in circulating blood glucose levels by
secreting insulin, such as after digesting a carbohydrate-containing meal. The secretion
of insulin into the circulation, in turn, signals peripheral tissues to store glucose as
glycogen or lipid. Glucose-stimulated insulin secretion (GSIS) requires uptake and
metabolism of the sugar and occurs in two phases; an initial first-phase of insulin release
lasting up to ten minutes and an amplification second-phase that begins thereafter (95-
97). It is well accepted that the first-phase and initiation of the second-phase of GSIS is
dependent upon an increased ratio of ATP/ADP, which results from the flux of glucose
through glycolysis, the tricarboxylic acid (TCA) cycle, and mitochondrial oxidative
phosphorylation (95, 97). The increased ATP/ADP ratio inhibits ATP-sensitive
potassium (K+ATP) channel opening and causes depolarization of the plasma membrane,
activation of voltage-dependent Ca2+ channels, and influx of Ca2+ that directly and
indirectly triggers insulin release (Fig) (95-98). Stimulation of insulin secretion from [3-
cells in response to glucose can be potentiated by other stimulatory effectors (e.g. fatty
acids, amino acids, and incretin hormones) that generate secondary messengers to signal
granule exocytosis (99-102). Mechanisms involved in the amplification phase of GSIS
are less understood. Evidence has emerged, however, for glucose-stimulated regulation

of FA metabolism and the generation of lipid signaling molecules in the mechanism of

GSIS. (99, 103, 104).

20

 

iGluc

ATP ~Sensit
K’ a

Channel

Figure 1.5. m
glucose-stimula
Pancreatic fi-cel
lhl'ough glycoly;
me Of ATP to
153$ to depolar
glanules are felt
gTEmUIe exOCYIO

 

 
  
 
 
  

1‘ GIUcose

ATP -Sensitive
K+ o ......

   
 

2+
.............. .Ca \

.. . KinaSes

Figure 1.5. Mechanism of the ATP-sensitive K+ channel-dependent pathway of
glucose-stimulated insulin secretion (GSIS). Exogenous gluocose is taken up into
pancreatic B-cells through a glucose transporter (Glut2). Next, metabolism of glucose
through glycolysis and the mitochondrial (Mito.) TCA cycle generates ATP and alters the
ratio of ATP to ADP. The ATP-sensitive K+ channel is then inhibited by ATP, which
leads to depolarization of the plasma membrane and an influx of Ca2+. Finally, insulin
granules are released by both direct and indirect actions of Ca2+ on proteins involved in
granule exocytosis.

21

2.2. RegU'atiO
The P3
glucose over a
high Km of b
minimal actixi
production of l
negligible lact
mitochondrial
elei'ated gluco:
ACC-mediated
”0). In regard:
glycerol 3-phos
backbone of gly-
in B-cells coincir
cells elevated gli
35 ChREBP and f
SREBP-l
(114,115). on
ACC. FAS, Elm

bl SREBP-1c ox'

 

although both L

Will-red for ma?

incleaSed the EXY
‘ l

 

2.2. Regulation of Fatty Acid Metabolism in Pancreatic B-cells

The pancreatic B-cell is innately designed to sense and efficiently metabolize
glucose over a wide range of physiological concentrations (3-20 mM), due in part to the
high Km of both GLUT2 (17 mM) and GK (8 mM) (103). As glucose levels rise,
minimal activity through the hexose monophosphate shunt aids in driving the glycolytic
production of pyruvate (105). Together with low pyruvate conversion to lactate, due to
negligible lactate dehydrogenase (105), pyruvate in the [ES-cell is directed towards
mitochondrial TCA cycling. Studies demonstrate that stimulation of B-cells with
elevated glucose subsequently increases mitochondrial efflux of TCA intermediates,
ACC-mediated generation of malonyl-CoA, and the synthesis and storage of FAs (106-
110). In regards to [ii-cell FA storage, a considerable portion of glucose is metabolized to
glycerol 3-phosphate, from glycolytic dihydroxyacetone phosphate, for use in the
backbone of glycerolipids (99). As in the liver, glucose-stimulated de novo FA synthesis
in B-cells coincides with increased expression of L-PK, ACC, and FAS (110-113). In [3-
cells elevated glucose has been shown to induce the binding of ChREBP to L-PK as well
as ChREBP and SREBP-1c binding to FAS (111, 112).

SREBP-1c activity is essential for glucose induction of lipogenic genes in B-cells
(114, 115). Over-expression of SREBP-1c in a B-cell line induced the expression of
ACC, FAS, Elovl-6, SCD], and SCD2 (114), and in rat islets, increased ACC and FAS
by SREBP-1c over-expression correlated with elevated TAG synthesis (116). In B-cells,
although both LXRor and [3 are expressed (5), LXRB is the predominant isoform and is
required for maintenance of B-cell function (117). Pharmacological activation of LXRs

increased the expression of ABCAl, involved in cholesterol efflux, as well as SREBP-1c,

22

GK. ACC
elexated 5’
3:11.111}! 0‘
expression
Sim
regulation b
CPT-l and 1
oxidation thi
augmented if
(130). Anolh
reduction of
oxidative pho
which leads to
(121-123). El-
protein expressi
possibly througl
01 B-cells to ex
thereby blocking

Overall,

 

directing excess

ms 10 dean;

rel ' ~ '
3110115}le beta

Bulls.

 

GK, ACC, and F AS, resulting in intracellular TAG accumulation (5, 118). In addition,
elevated glucose was shown to increase LXRor translocation into the nucleus (119), the
activity of which could mediate the glucose-induced increase in ChREBP gene
expression observed in B-cells.

Similar to FA synthesis, FA oxidation in B-cells is subject to multiple levels of
regulation by glucose. Of particular importance is the interaction of malonyl-CoA with
CPT-1 and inhibition of mitochondrial FA uptake. Although high glucose reduces FA
oxidation through the generation of malonyl-COA, FA oxidation can be significantly
augmented by over-expression of CPT-1 during exposure to high glucose conditions
(120). Another mechanism for inhibiting FA oxidation is through generation of ATP, or
reduction of the AMP/ATP ratio through enhanced glycolysis and mitochondrial
oxidative phosphorylation. This is associated with decreased B-cell AMPK activity,
which leads to reduced ACC phosphorylation and increased ACC-derived malonyl-CoA
(121-123). Elevated glucose also causes a significant decrease in PPARor gene and
protein expression as well as promoter binding to genes involved in FA oxidation (124),
possibly through the decrease in AMPK activity (125). In contrast to glucose, exposure
of B-cells to exogenous FAS increases CPT-1 and decreases ACC gene expression,
thereby blocking glucose-stimulated repression of mitochondrial FA oxidation.

Overall, these mechanisms allow the pancreatic B-cell to function properly by
directing excess exogenous carbon in the form of glucose into FAs for storage or excess
FFAs to degradation via FA B-oxidation. The following sections describe the
relationship between the regulation of FA metabolism and the mechanism of GSIS from

[ES-cells.

23

2.3. Mitocho

Enhar
pyruvate has
dehydrogenas
oxaloacetate (
initiating the :
ending with c
describes the r
are fully repler
glucose-stimul.
OfPl‘TUVate to
intennediates g
secretion, inclu.
primary produc
Sl‘mllesis of p.“
mala‘e‘Pb’rux'atc
oxaloacetate-p},r

   
 
 
 
 
 

derived from (
intermediate, 1:
DINADPH COr‘

identified to be

35 l0 which p\

2.3. Mitochondrial Anaplerosis/Cataplerosis

Enhanced glucose flux through glycolysis generates pyruvate. Mitochondrial
pyruvate has two options for entry into the TCA cycle: conversion by pyruvate
dehydrogenase (PDH) to acetyl-CoA or conversion by pyruvate carboxylase (PC) to
oxaloacetate (105, 126-128). PDH and PC activities provide the necessary substrates for
initiating the sequential synthesis of TCA cycle intermediates beginning with citrate and
ending with conversion of malate to oxaloacetate to reinitiate the cycle. Anaplerosis
describes the replenishment of TCA cycle intermediates. After TCA cycle intermediates
are fully replenished, exit of carbons from the cycle is defined as cataplerosis. In B-cells,
glucose-stimulated anaplerosis via PC activity is high, metabolizing approximately half
of pyruvate to oxaloacetate (105, 126-128). This anaplerosis/cataplerosis of TCA cycle
intermediates generates second messengers thought to be involved in signaling for insulin
secretion, including the cataplerotic products NADPH, malonyl-CoA and FA (103). The
primary production of NADPH via anaplerosis/cataplerosis is pyruvate cycling, the re-
synthesis of pyruvate fi'om cycle intermediates. Pyruvate cycling processes include the
malate-pyruvate, citrate-pyruvate, isocitrate/alpha-ketoglutarate-pyruvate, and
oxaloacetate-pyruvate shuttles (127, 129-135). Studies using [U-13C]-g1ucose supported
this idea showing that two pyruvate “pools” exist in B-cells (127, 132). One pool is
derived from glycolytic pyruvate and another is synthesized from a TCA cycle
intermediate. It is hypothesized that NADPH serves as a second messenger as the level
of NADPH correlates with GSIS, and gluctaredoxin—l, an NADPH target, was recently
identified to be involved in GSIS (130, 136, 137). At this time, however, it is still unclear

as to which pyruvate cycling process is most important. Nevertheless, it is clear that

24

.Eflucose'sun1L
(100,106' I:
2.4. Gen era“
2.4.1. R0“ 0'
GluC'0
citrate. 3) con
[M from 3“)
of malonl'l'CC
FAS and lead:
molecules. 9
generation Of T
by over-exp”:
reduces GSIS 1
increases and
formation of e
accumulate “ht
140,141). ln s
cytosolic malon
estenfication, .

physiologicalh

 

COA plays an 1’
FA oxidation,

participate in in

 

 

 

glucose—stimulated cataplerosis activity is high as it drives synthesis of malonyl-CoA
(100, 106, 129, 138), the precursor for de novo FA synthesis.
2.4. Generation of Lipid Signaling Molecules
2.4.1. Role of Malonyl—CoA

Glucose-stimulated anaplerosis/cataplerosis increases 1) mitochondrial efflux of
citrate, 2) conversion of citrate to acetyl-CoA by ACL, and 3) the generation of malonyl-
CoA fiom acetyl-CoA by ACC. The role of malonyl-CoA in GSIS is based on the ability
of malonyl-CoA to inhibit CPT-1 activity (91). This blocks mitochondrial Iii-oxidation of
FAS and leads to the accumulation of FFAs, FA-CoAs, DAG and other lipid signaling
molecules. ACC gene expression is naturally high in B-cells, allowing for rapid
generation of malonyl-CoA prior to GSIS (106-108, 113, 139). Increasing FA oxidation
by over-expression of CPT-1 or knockdown of ACC gene expression significantly
reduces GSIS (120, 140, 141). Additionally, knockdown and over-expression of PPARa
increases and decreases GSIS, respectively (142, 143). Thus, GSIS involves the
formation of endogenous FAs and lipid signaling molecules, which are allowed to
accumulate when malonyl-COA levels are sufficient to block FA oxidation (100, 138,
140, 141). In support of this concept, reducing malonyl-CoA levels by over-expressing
cytosolic malonyl-COA decarboxylase (MCDc) increased FA oxidation, decreased FA
esterification, and reduced GSIS in the presence of endogenous FFA, a more
physiologically relevant state (100). The above studies show that synthesis of malonyl-
CoA plays an important role in GSIS by blocking the elimination of FA-CoAs through
FA oxidation, resulting in the accumulation of lipid signaling molecules that can

participate in insulin secretion.

25

2.4.2. Fret
lnh
accumulall
and DAG.
syndiesis.
and release
number of i
lntr:
synthesized
lipids, prodi
elevated glu.
molecules as
GSIS (145.).
1145, 146) an
bl'FFA on G.‘
stores Via the
honey“ dem.
enhancement (

endogenous lip

  

 

2.4.2. Free Fatty Acid, Long Chain Fatty Acyl-CoA, and Diacylglycerol

Inhibition of FA oxidation by malonyl-CoA permits pancreatic B-cell
accumulation of lipid signaling molecules, such as FFA, long-chain FA-CoA (LC-CoA),
and DAG. Exocytosis of insulin granules is a complex process involving granule
synthesis, transport to the plasma membrane, docking, priming, and membrane fusion
and release of insulin (144). FFA, LC-CoA, and DAG enhance insulin release through a
number of mechanisms.

Intracellular FFA and LC-CoA levels are tightly regulated. Although de novo
synthesized FAS can be rapidly converted to LC-CoA for incorporation into complex
lipids, production of FFAs themselves could affect insulin release (99). Exposure to
elevated glucose and exogenous FFA increases synthesis of intracellular lipid signaling
molecules as well as activates islet B-cell G protein-coupled receptors, which enhances
GSIS (145). GPR40 (or FFAl receptor) is highly expressed in rodent and human islets
(145, 146) and was identified to bind exogenous FFAs. The effect of GPR40 activation
by FFA on GSIS involves increased intracellular Ca2+ levels through release of ER Ca2+
stores via the Gorq-phospholipase C pathway (147). Knockdown of GPR40 in mice,
however, demonstrated that its activation accounts for only half of the exogenous F FA
enhancement of GSIS, supporting the role of FFA-induced increases in additional
endogenous lipid signaling molecules (148). In addition to circulating FFA, B-cells have
been shown to release FFA when treated with elevated glucose (149). In this way, FFA-
mediated GPR40 activation could be a possible mechanism for amplification of GSIS by

endogenously synthesized FA.

26

El€\ 3'
Proteins dires
for membram
with the pi
gnapwgamm
(152). AS dl‘
amplifi'lng the
of B-cells al:
phospholipids

DAG i
glucose (108.
GSIS through
include proteir
guanyl nucleol
INCH proteir
phosphorylatior

both Ca2+-dept

cells have addi

(155-157). Rt.

 

been Presented
existence of c
lll‘t“ detenmnav

Specific PKC

 

Elevated synthesis of LC-CoAs enhance GSIS by increasing the acylation of
proteins directly involved in insulin granule exocytosis. Protein acylation is necessary
for membrane targeting of specific proteins known to be involved in fusion of granules
with the plasma membrane, such as synaptosomal-associated protein-25 and
synaptogamin (150, 151). LC-CoAs were further shown to increase islet lipase activity
(152). As discussed in the next section, this could provide an additional mechanism for
amplifying the production of lipid signaling molecules. Additionally, glucose stimulation
of B-cells also alters the specific species of LC-CoAs that are incorporated into
phospholipids (110), which could cause membrane remodeling and effect granule fusion.

DAG is also rapidly synthesized de novo in B-cells by acute exposure to elevated
glucose (108, 110, 153). Generation of DAG by elevated glucose has been implicated in
GSIS through activation of various DAG binding proteins. DAG binding proteins
include protein kinase C isoforms (PKCs), protein kinase D (PKCu), chimaerins, Ras
guanyl nucleotide-releasing proteins, mammalian homolog of caenorhabditis elegans
UNC13 protein (Munc-13s), and DAG kinases (154). In B-cells, glucose stimulates the
phosphorylation of many proteins, in part, through PKC (155), which occurs through
both Ca2+-dependent (classical) and —independent (novel) PKC isoforms. Studies in B-
cells have additionally demonstrated that glucose promotes the translocation of PKCs
(155-157). Roles both for and against PKC activation in the mechanism of GSIS have
been presented. This is in part due to the lack of isoform specific PKC inhibitors and the
existence of compensatory mechanisms regulating protein phosphorylation that hinder
the determination of which PKCs are directly involved in GSIS (158). Thus, a role for

specific PKC isoforms in GSIS cannot be withdrawn. Enhanced activity of Munc-l3

27

potentiates
insulin seer
the role Mu
2.5. Lipolys
In at
from lipol}
hydrolytic r
glycerolipid
glycerol-3-pl
gene express.
index of lipa
glucose have
activity of 3
enhanced lipo
llPOIysis coulc
click? capable I
the fact that glt.

llpases capable

  

2'5'1' Neutral

25".]. HUI-n“:

 

potentiates normal GSIS in vitro, and islets from mice lacking Munc-13 had reduced
insulin secretion and abnormal glucose tolerance (159, 160). This is in agreement with
the role Munc-l3 binding to DAG and being involved in synaptic granule priming (161).
2.5. Lipolysis and Glycerolipid/Fatty Acid Cycling

In addition to de novo synthesis, lipid-signaling molecules can also be generated
from lipolysis of glycerolipids. Lipolysis describes the activity of lipase-catalyzed
hydrolytic removal of FAS from a range of complex lipids. The final products of
glycerolipid lipolysis are FF As and glycerol, the latter of which cannot be reactivated to
glycerol-3-phosphate for lipid synthesis in B-cells due to the absence of glycerol kinase
gene expression (162). Thus, measurement of extracellular glycerol content is used as an
index of lipase activity. Interestingly, rat islets and B-cells stimulated with elevated
glucose have increased glycerol release (99, 163, 164), which correlates with increased
activity of a number of lipases (described below) (164-167). The combination of
enhanced lipolysis and increased synthesis of glycerolipids suggested FFAs released by
lipolysis could be rapidly reincorporated into glycerolipids, creating a glycerolipid/FA
cycle capable of enhancing the generation of lipid signaling molecules (99). In light of
the fact that glucose modulates lipase activity, a number of studies have identified various
lipases capable of contributing to GSIS.
2.5.1. Neutral Glycerolipid Lipolysis
2.5.1.1. Hormone-Sensitive Lipase

Glycerolipid/FA cycling in B-cells has emerged as a new metabolic pathway
possibly involved in GSIS‘(99). Although it remains to be determined as to which pool

of glycerolipids is most important, studies have drawn attention to neutral glycerolipids,

28

Specifically
actiVlU' inC
adiponumn‘
was the {IN
(174, 175)-
mice general
responses (I ‘
mice. demon
Additionall}'~
TAG (168, l'
DAG was 001
maybe througl
(178,179). In
with a fl-Cell 5
phase of insul i
(1781. Taken 1
exocytosis. but
2.5.1.2. Adipos
Enzyma
showed that th-

(168,170, 177

 

lhan adiponutrgi

Regulation of

 

specifically TAG and cholesterol ester (CE). Lipases known to have TAG lipolysis
activity include hormone-sensitive lipase (HSL), adipose tissue TAG lipase (ATGL), .
adiponutrin, G82, and carboxylesterase 3, also termed TAG hydrolase (168-173). HSL
was the first TAG lipase identified to be expressed in B-cells and regulated by glucose
(174, 175). A role for HSL in GSIS has been unclear as independent lines of HSL null
mice generated on different genetic backgrounds exhibited inconsistent insulin secretory
responses (163, 176). Lipolysis was still present and activated by glucose in HSL null
mice, demonstrating the presence of other lipases involved in B-cell function (163).
Additionally, HSL has a higher substrate preference for DAG, MAG, and CE than for
TAG (168, 177). Studies found the hydrolysis of neutral cholesterol esters rather than
DAG was completely blocked in HSL null mice and that its effect on insulin secretion
maybe through directly regulating membrane cholesterol levels and granule exocytosis
(178, 179). In fact, HSL was found localized on insulin granule membranes (180). Mice
with a B-cell specific deletion of HSL were found to have significantly reduced first-
phase of insulin release, thus showing that HSL has a direct role in insulin exocytosis
(178). Taken together, these studies show that HSL may participate in insulin granule
exocytosis, but HSL is not the key TAG lipase linked to GSIS.
2.5.1.2. Adipose Triacylglyceride Lipase

Enzymatic characterization of ATGL, adiponutrin, GS2, and carboxylesterase 3
showed that these lipases have a higher activity for TAG than DAG compared to HSL
(168, 170, 172, 173). Recently, ATGL gene expression was identified to be much higher
than adiponutrin, GSZ, and HSL in both rat islets and the INS832/ 13 B-cell line (165).

Regulation of ATGL gene expression was found to be reduced in islets of fed versus

29

“:1

fasted rats, and Il
exposed to long-1
gene expression
decreased insuli:
hormone glucagt
displayed increa:

insulin secretion

 

 

 

 

however, there \t
glycerol release
maintain lipolyt
glycerol release
TAG pools. F'
regulated by I
molecules that
2.5.2.1’h05ph
Glycei
Old? noro 3r
Ca} influx
dll‘cct and
phOSPhOlipar

PhosphateS

parallels an

SECl’eIiOn E

fasted rats, and this correlated with reduced ATGL gene expression when B-cells were
exposed to long-term elevated concentrations of glucose (165). Knockdown of ATGL
gene expression in B-cells reduced TAG lipase activity, increased TAG content, and
decreased insulin secretion in response to glucose, exogenous FA, and the incretin
hormone glucagon-like peptide-1 (165). Similarly, isolated islets from ATGL null mice
displayed increased TAG content and decreased glucose- and exogenous FA-stimulated
insulin secretion (165). In both B-cells and mouse islets with reduced ATGL expression,
however, there was no change in total glycerol release. The absence of a change in total
glycerol release demonstrates a compensatory mechanism that could be activated to
maintain lipolytic activity. This is at odds with ATGL having a major role in total
glycerol release. The authors propose that B-cells contain fuel—insensitive and —sensitive
TAG pools. Fuel-sensitive TAG pools localized close to insulin granules could then be
regulated by ATGL and other TAG/FA cycling enzymes and provide lipid signaling
molecules that participate in insulin secretion.
2.5.2. Phospholipases C and D

Glycerophospholipids represent a considerable pool for glycerolipid/FA cycling
of de novo and exogenously derived FAs for participation in GSIS. As described above,
Ca2+ influx upon exposure to elevated glucose signals for insulin release through both
direct and indirect mechanisms. Of these mechanisms, influx of Ca2+ activates
phospholipase C (PLC), which cleaves phosphatidylinositol to generate inositol
phosphates and DAG (166, 181). Insulin secretion from glucose-stimulated B-cells
parallels an increase in the release of inositol phosphates (166), which can amplify insulin

secretion by activating the release of Ca2+ from intracellular stores (182-184).

30

 

Compared 10 ml
pronounced and
This reduced SCC
islets by phamtak
studies it is apt
phosphatidylinos

Phosphol
choline and pho
phosphatidic aci
mammals, PLD
PLD2 was local
trafficking, endt
The release of l
promoting curtl
“891 Interest
phOSPhOrylatior
phOSPhatase or

membrane fuS i

 

knockdown of
lllSllllll granUlg
phOSphatidic '4

o .

 

 

Compared to rat islets, the second—phase of insulin release in mouse islets is less
pronounced and coincides with lower levels PLC expression and activity (166, 185).
This reduced second-phase in mouse islets could be elevated to levels comparable to rat
islets by pharmacological activation of PLC or DAG binding proteins (166). From these
studies it is apparent that active release of inositol and DAG by PLC lipolysis of
phosphatidylinositol has a role in GSIS.

Phospholipase D (PLD) catalyzes the hydrolysis of phosphatidylcholine to
choline and phosphatidic acid. Subsequent dephosphorylation of phosphatidic acid by
phosphatidic acid phosphatase can also generate DAG. Two isoforms of PLD exist in
mammals, PLDl was found in the Golgi apparatus and on intracellular vesicles, while
PLD2 was localized primarily to the plasma membrane (186, 187). Intracellular vesicle
trafficking, endocytosis, and exocytosis are associated with increased PLD activity (188).
The release of phosphatidic acid derived from PLD likely aides in membrane fusion by
promoting curvature of the membrane due to the small negatively charged head-group
(189). Interestingly, PKC is able to activate PLD by direct interaction rather than
phosphorylation (186). Thus, it is feasible that generation of DAG from phosphatic acid
phosphatase or PLC could induce translocation of PKC to activate PLD and facilitate
membrane filSIOD. In B-cells, GSIS was elevated and reduced by over-expression and
knockdown of PLD], respectively (167). In addition, PLDl was partially localized to
insulin granules (167). These findings suggest PLD may have two roles, one to provide
phosphatidic acid for glycerolipid/FA cycling and another to directly effect insulin

granule exocytosis.

31

2.5.3. Phor

Lip
or sn-Z (Pl
also contril
and human
specific act
1AA) com pr
rodent islet:
inhibition 01
and in rim)
amplified GS
expression tc

Whether iPLa

 

 

2.5.3. Phospholipase A2

Lipolysis of glycerophospholipids by phospholipase A at either the sn-1 (PLAl)
or sn-2 (PLA2) position generates FFA and lysophospholipids, the latter of which can
also contribute to glycerolipid/F A cycling and act in signal transduction (190). In rodent
and human islets, a Ca2+-independent ATP-sensitive PLA2 (iPLAZB) was identified with
specific activity towards arachidonic acid at the sn-2 position (191). Arachidonic acid
(AA) comprises approximately thirty percent of the total glycerophospholipid FA mass in
rodent islets (192), and free AA accumulates in islets stimulated with glucose (193).
Inhibition of potassium channels by ATP is amplified by increased cytosolic AA (194),
and in vitro studies showed knockdown and over-expression of iPLA28 reduced and
amplified GSIS, respectively (195, 196). In mice, however, failure of iPLAZB over-
expression to amplify GSIS and inconsistencies in iPLA2l3 knockdown mice question

whether iPLA2B is involved in normal glucose homeostasis (190, 197, 198).

32

TCA
cycle

 

ATP

 

Glucose FFA

GIy3P

 

Mal-CoA

 

 

 

 

o 1i ti
ATP NADPH LSMIDAG

O. . O
.0
O

O... * ...O
4 ‘

Insulin secretion

Figure 1.6. Proposed model for the role of FA metabolism in glucose-stimulated
insulin secretion. Glucose stimulation drives the generation of pyruvate (Pyr), which
enters the TCA cycle to modulate ATP production and undergoes pyruvate cycling to
generate NADPH. Mitochondrial cataplerosis and pyruvate cycling increase the level of
malonyl-CoA, which blocks FA oxidation. De novo and exogenous FFAs are converted
to LC-CoA and esterified to glycerol 3-phosphate (Gly3P) to enter into the
glycerolipid/F A cylc (GL/F A cycle). Finally, the combination of GL/F A cycle-mediated
generation of lipid signaling molecules (LSM), such as DAG, increased NADPH, and
increased ATP/ADP ratio signal the B-cell to secreteinsulin.

33

3, Glucose
3.1. Gluco
Tit
dysfunctior
maintain g1
of insulin
responses tl‘
cells fail
Glucotoxicit
cells from C1
periods of }
diminished (
‘0 as glucor
aCCOmpanied
contribute to
referred to a
dependent up
COmbination
mechanisms

recognlzed [h

3. Glucose and Fatty Acid Mediated Pancreatic fi-Cell Dysfunction
3.1. Glucotoxicity vs. Glucolipotoxicity in Type 2 Diabetes

Type 2 diabetes (T2D) is characterized by insulin resistance and pancreatic B-cell
dysfunction, due to both genetic and environmental factors, that results in the inability to
maintain glucose homeostasis. In the early stages of the pathogenesis of T2D, the onset
of insulin resistance causes glucose levels to rise and triggers B-cell compensatory
responses that include increased synthesis and secretion ‘of insulin. T2D ensues when [3-
cells fail to secrete sufficient amounts of insulin to maintain norrnoglycemia.
Glucotoxicity and glucolipotoxicity have been proposed to underlie this progression of B-
cells from compensation towards dysfunction and eventually failure (3, 199). Sustained
periods of hyperglycemia are associated with adverse effects on the B-cell such as
diminished GSIS, decreased insulin gene expression, and apoptosis, collectively referred
to as glucotoxicity (4, 199). In obesity-associated T2D, hyperglycemia is often
accompanied by hyperlipidemia and elevated levels of plasma FFAs, which also
contribute to B-cell dysfunction (200-202). Damage due to chronic elevations in FF As,
referred to as lipotoxicity (203), was found to require FA esterification and to be
dependent upon elevated glucose (3). This concept of B-cell dysfunction from the
combination of glucose and FAs is defined as glucolipotoxicity (3). The major
mechanisms accounting for the effects of both glucotoxicity and glucolipotoxicity

recognized thus far are reviewed in the following sections.

34

3.2. Mechal
3.2.1. Endol
Hint
quantities of
capacity of ‘
proteins (.204
of the unfold
integrity. anc
transmembra
stranded R}
transcription
autophosphor
box binding
activates gem
eXpOl't from t
PERK and A'
Chain binding
membrane an
Wing (21 1-;
fem01(eIF) 2

Proteins SUch

 

and resistanci

cleared, and

 

3.2. Mechanisms of B-Cell Failure
3.2.1. Endoplasmic Reticulum Stress

Hyperglycemia signals B-cells to continuously synthesize and secrete large
quantities of insulin. Over time, the rate of insulin translation exceeds the protein folding
capacity of the B-cell endoplasmic reticulum (ER), causing accumulation of unfolded
proteins (204). If sustained, buildup of unfolded proteins causes ER stress and activation
of the unfolded protein response (UPR). The UPR acts to reduce ER stress, preserve ER
integrity, and prevent cell death. Transduction of this response is mediated by the ER
transmembrane proteins inositol requiring ER-to-nucleus signal kinase (IRE) 1, double-
stranded RNA-activated kinase (PKR)-like ER kinase (PERK), and activating
transcription factor (ATP) 6 (204). BR stress induces IREl dimerization and
autophosphorylation to gain endoribonuclease activity and splice the mRNA encoding X-
box binding protein (Xbp) 1 (204). Spliced Xbpl (Xbpls) protein transcriptionally
activates genes involved in expansion of the ER, protein maturation, protein folding and
export from the ER, degradation of misfolded proteins, and lipid metabolism (205-210).
PERK and ATF6 remain inactive in the ER by binding with the ER chaperone Ig heavy
chain binding protein (BiP, also known as GRP78 and HSPAS) on the luminal side of
membrane and are activated as BiP detaches from the membrane to assist in protein
folding (211-214). PERK phosphorylates and inactivates eukaryotic translation initiation
factor (eIF) 2a, leading to decreased translation of most proteins except some specific
proteins such as ATF4 (215, 216). ATF4 induces genes important for amino acid import
and resistance to oxidative stress (217). Activated ATF6 is translocated to the Golgi,

cleaved, and transported into the nucleus to initiate transcription of ER chaperone genes

35

such as Eli)
and ATF 6 p
cell failure a

Rat i
can induce I
increased B
expression it
controls (221
activates L'P
palmitate sig
ATF4 and A‘
oleate. Acm
islets as Well

exPressing th

mICmSCOP)’ o

 

such as BiP, enhancing ER protein folding capacity (218, 219). Together, IREI, PERK,
and ATF6 pathways act to preserve ER function, which if not maintained can lead to B-
cell failure and ultimately cell death (204).

Rat islets cultured in elevated glucose demonstrated that glucotoxic conditions
can induce the UPR, exhibiting activation of IREl (by increased Xbpls) and ATF6 (by
increased BiP expression) (220). This correlates with increased Xbpls and BiP
expression in T2D human islets cultured in elevated glucose compared to non-diabetic
controls (221). Exposure of B-cells to elevated concentrations of exogenous FFAs also
activates UPR pathways. Multiple B-cell line models treated with the saturated FA
palmitate significantly induces Xbpls, eIF20t phosphorylation, and protein levels of
ATF4 and ATF6 (222-224), whereas only minimal ER stress is elicited by the MUFA
oleate, Activation of all three UPR pathways by palmitate was demonstrated in human
islets as well (222). These effects in a B-cell line could be partially reversed by over-
expressing the ER chaperone BiP (224). In addition to UPR pathways, electron
microscopy of B-cells treated with palmitate and pancreatic sections from T2D patients
observed alterations in B-cell ER integrity reflected as distention of the ER (221, 223).
Thus, the inability to maintain proper ER function in the B-cell could be a significant risk
factor for the development of T2D.

3.2.2. Oxidative Stress

Pancreatic B-cells have low levels of antioxidant enzymes compared with other
tissues (225, 226), rendering fi-cells particularly susceptible to oxidative stress. Elevated
production of reactive oxygen species during chronic hyperglycemia is detrimental to B-

cells (4). Pathways through which ROS can be produced from elevated glucose include

36

oxidative phosphorylation, glyceraldehyde autoxidation to methylglyoxal and glycation,
a-ketoaldehyde formation and glycosylation, DAG activation of PKCs, hexosamine
metabolism, and sorbitol metabolism (227). In B-cell lines and isolated islets, approaches
to reduce ROS production by use of antioxidants and over-expression of antioxidant
enzymes protected from chronically elevated glucose-induced decreases in insulin gene
expression, transcription factor binding to the insulin gene promoter, and GSIS (4, 228,
229). This demonstrates B-cell firnction is significantly affected by chronic
hyperglycemia-induced oxidative stress. The involvement of oxidative stress in FA-
mediated B-cell dysfunction, however, remains unclear, as evidence both for and against
a role of FAs in oxidative stress have been presented (230, 231).
3.2.3. Malonyl-CoA Inhibition of Fatty Acid Oxidation and Lipid Accumulation
Generation of malonyl-CoA via ACC activation during short-term glucose
exposure is essential to normal B-cell GSIS due to the ability of malonyl-CoA to interact
with CPT-1 and inhibit FA oxidation. Chronic hyperglycemia, however, continuously
drives malonyl-CoA production and subsequent synthesis and storage of FAs into TAG,
which has been linked to diminished B-cell GSIS (199, 232). The effects of chronic
hyperglycemia on de novo lipogenesis, TAG accumulation, and loss of B-cell function
was found to correlate with elevated nuclear SREBP-1c in diabetic islets (233, 234).
Over—expression of a constitutively active nuclear SREBP-1c in islets and B-cell lines
also resulted in increased lipogenesis and reduced GSIS (116, 235). This suggested that
sustained glucose-stimulated lipogenesis and TAG accumulation via SREBP-1c

activation facilitated diminished GSIS.

37

SREBP-1c has also been implicated in glucolipotoxicity during B-cell exposure to
elevated levels of exogenous FF As. Treatment of islets with elevated palmitate increased
lipogenic gene expression and the nuclear form of SREBP-1c, increased TAG content,
and decreased GSIS (236). These effects were prevented by treatment with
eicosapentaenoate (20:5,n-3), which is known to reduce SREBP-1c processing (236).
More direct evidence of a relationship between malonyl-CoA and FA oxidation comes
from examination of palmitate-induced B-cell death. Elevating FA oxidation through
AMPK and PPARa activation protected B-cells from palmitate-induced cell death,
whereas blocking CPT-l activity increased susceptibility to cell death from palmitate
(237, 238). Together, these studies demonstrate that the intracellular capacity to
modulate FA synthesis and oxidation could significantly predispose B-cells to the
damaging effects of glucotoxicity and glucolipotoxicity.

3.2.4. Dysregulated Glycerolipid/Fatty Acid Cycling

The role of glycerolipid/F A cycling in normal fi-cell function, particularly GSIS,
relies on balanced synthesis and turnover of neutral lipid pools. To determine if
excessive TAG synthesis was directly implicated in the loss of GSIS during chronic
hyperglycemia, the final step of TAG synthesis in islets was increased by over-expression
of DGATI (239). Elevated DGATl increased TAG accumulation and reduced GSIS,
demonstrating that a loss of B-cell function may occur without a paralleled increase in
TAG turnover (239). In line with this idea, knockdown of the TAG lipase ATGL
reduced TAG turnover as well as GSIS (165). Conversely, excessive neutral lipid
hydrolysis by over-expression of HSL also impairs GSIS (240), further supporting the

importance of balanced lipid synthesis and turnover for normal B-cell function. In

38

 

addition to .
TAGS than
caused by s;
cycling cont
3.2.5. Apopt
Redu
failure and a;
the level of
cells occupy
clear, loss of
3p0ptosis. L
.ATF-l-mediat
(CEBP) ho,
activation of,
lSlets cultured
and from hun
dclction in
comPOUem 01‘
Pathways, Suc
Protects fmm

bonuses pal

a

 

(.248, 249). >

addition to glucotoxicity, exogenous saturated FAs are incorporated less efficiently into
TAGS than MUFAs, which coincides with diminished GSIS and increased cell death
caused by saturated F As (241). These studies show that dysregulation of glycerolipid/F A
cycling contributes to (El-cell dysfunction.
3.2.5. Apoptosis-Mediated Loss of B-Cell Mass

Reduced B—cell mass, or number of B-cells, that occurs naturally or due to B-cell
failure and apoptosis is a critical factor in the development of T2D. In obese individuals,
the level of fasting plasma glucose inversely correlates with the average percent of [3-
cells occupying the whole pancreas (242). Although the mechanisms are not entirely
clear, loss of B-cell mass has been attributed to both ER and mitochondrial induction of
apoptosis. Unresolved ER stress can induce apoptosis via pathways that include the
ATF4-mediated transcription of the proapoptotic genes CCAAT/enhancer binding protein
(C/EBP) homologous protein (CHOP) and ATF3 (243, 244) and [RBI-mediated
activation of c-Jun N-terminal kinase (JNK) (245, 246). CHOP induction is increased in
islets cultured in hyperglycemic conditions, exposed to elevated palmitate concentrations,
and from human T2D patients (220, 222, 224). Protection from B-cell death by CHOP
deletion in multiple diabetes models further demonstrated CHOP to be a major
component of ER stress-mediated apoptosis (247). Activation of JNK affects multiple
pathways, such as CHOP induction, and inhibition of JNK activity in fi-cells partially
protects from palmitate-induced apoptosis (222). In addition to the IREl and PERK
pathways, palmitate-induced B-cell ER stress depleted Ca2+ from the ER (222), which
can trigger mitochondrial release of cytochrome C and initiation of the caspase—9 cascade

(248, 249). This cascade in part causes deoxyribonuclease-mediated DNA degradation

39

(250). at
Mitochont
(251). Ta.
conditions

apoptotic p

 

(250), an effective marker for palmitate-induced (fl-cell apoptosis (223, 224).
Mitochondrial release of cytochrome C has also been associated with generation of ROS
(251). Taken as a whole, this illustrates that (fl-cell dysfunction from exposure to chronic
conditions of glucotoxicity and glucolipotoxicity can lead to the induction of downstream

apoptotic pathways and contribute to reduced B-cell mass.

40

Glucose Exogenous SFA (16:0)
Malonyl-CoA

\
gill. l/,\/

f LC-CoA (16:0-60A)

   
 
 

  
 

”3530A GLIFA

‘. cycling
ER t Glycerolipid
s ress
- (UPR) I TAG
MitoJER Oxidative stress
- (ROS)

 

l

Diminished Glucose-Stimulated Insulin Secretion
Decreased Insulin Gene Expression
Loss of B-Cell Mass

 

 

 

 

Figure 1.7. Mechanisms involved in B-cell dysfunction from glucolipotoxicity.
Chronically elevated glucose drives malonyl-CoA synthesis, which blocks mitochondrial
FA oxidation by inhibition of CPT-1. Next, LC-CoAs formed from de novo and
exogenous saturated FA (SFA) are mostly driven towards glycerolipid storage as TAG.
Accumulation of endogenous glucose metabolites and SFA-CoAs causes ER and
oxidative stress to the B-cell, displaying activation of the unfolded protein response
(UPR) and generation of reactive oxygen species (ROS). Sustained UPR activation and
ROS generation lead to diminished glucose-stimulated insulin secretion, decreased
insulin gene expression, and ultimately a loss of B-cell mass.

41

 

3.3. Evidence

Prior Ii
mechanisms to
failure from g
through enhan
identified to p;
3.3.]. SREBP-

ln anin
expression of j
that increased
The link betm
Of a Constituti
increased T AC
by studies Sho‘
secreting

mor—

(ZDF) rat, inc
decreased GS

 

   
 
  

isolated for l.‘

1;)

mime 90nd.
1;

 

3.3. Evidence and Mechanisms of B-cell Compensation

Prior to the onset of T2D, B-cells are capable of activating various compensatory
mechanisms to com with the increased demand for insulin secretion and to prevent B-cell
failure from glucolipotoxicity. Of these mechanisms, regulation of FA metabolism
through enhanced lipogenesis, glycerolipid/FA cycling, and MUF A synthesis have been
identified to participate in B-cell compensation.
3.3.1. SREBP-1c and Liver X Receptors

In animal models of T2D, diminished GSIS has been associated with increased
expression of SREBP-1c and TAG accumulation in islets, and this led to the hypothesis
that increased neutral lipid storage via SREBP- 1c activation was toxic to B-cells (233).
The link between SREBP-1c activation and loss of GSIS was shown by over-expression
of a constitutively active form of SREBP-1c, which forced lipogenic gene expression,
increased TAG synthesis, and reduced GSIS (116). This idea, however, was contradicted
by studies showing that the ability of islets to compensate for chronic hyperglycemia by
secreting more insulin was dependent on SREBP-1c (234). In the Zucker diabetic fatty
(ZDF) rat, increased islet SREBP-1c expression coincides with elevated lipogenesis and
decreased GSIS (233). It was recently shown, however, that over-expression of a
dominant negative SREBP-1c in ZDF rat islets prevented the increase in lipogenic gene
expression and TAG content, but it did not correct for the diminished GSIS (252). In
addition to SREBP-1c, activation of LXRs with the synthetic agonist T0901317 in
isolated rat islets and fi-cell lines increased nuclear SREBP-1c accumulation, lipogenic
gene expression, and TAG content as well as elevated both basal and GSIS under normal

culture conditions (5, 118). Although elevated insulin secretion from LXR-activated (3-

42

cells was inh
Furthermore.
from B-cells
suggest that e
in response it
33.2. Glycer
Dysre
models to car
FAS into gig-(-
iats, obese 21
The ability 01
cell glucose- ;
ml islets we
CSIerif‘lCation
inhibition of]
5€Cre10ry res;
indicating Zr
eXCess FFAs

 

T2D ll] ObeSL
3.3.3. MOnO

E1e\ L:

\l’llll high ex

 

cells was inhibited by knockdown of SREBP-1c (253), its mechanism is still unknown.
Furthermore, it remains to be determined if LXR activation can enhance insulin secretion
from B-cells cultured chronically in hyperglycemic conditions. Together, these studies
suggest that enhanced de novo lipogenesis may have a critical role in B-cell compensation
in response to glucotoxic and glucolipotoxic conditions.
3.3.2. Glycerolipid/Fatty Acid Cycling

Dysregulation of glycerolipid/FA cycling in (i-cells has been shown in various
models to cause reduced GSIS. This implies that balanced incorporation and turnover of
FAs into glycerolipids is important for maintenance of B-cell function. Unlike the ZDF
rats, obese Zucker fatty (ZF) rats exhibit insulin resistance but maintain norrnoglycemia.
The ability of ZF rats to maintain glucose homeostasis was associated with enhanced (3-
cell glucose- and FA-stimulated insulin secretion compared to lean control rats (104). ZF
rat islets were identified to have increased glucose-responsive capacities for FFA
esterification and lipolysis, evidence of enhanced glycerolipid/F A cycling (104).
Inhibition of lipolysis by the general lipase inhibitor orlistat blocked the increased insulin
secretory response (104). In addition, FA oxidation tended to be elevated as well (104),
indicating ZF islets may have enhanced activation of pathways for detoxification of
excess FFAs. This in vivo evidence demonstrates that enhancing both synthesis and
turnover of glycerolipids in B-cells may significantly reduce susceptibility to developing
T2D in obese individuals.
3.3.3. Monounsaturated Fatty Acid Synthesis

Elevated TAGS often occur in obesity-associated T2D and has been correlated

with high expression and activity of SCD] in adipose and liver (254). In rodent models

43

lacking SC D
high fat- and
SC 05 could
One study.

susceptible It
associated vv
suggesting St
In agreement
levels of SCI
likely, hovvev
for example.
also exhibitec
contribute to
itself can p1
determined 1

raising the qut

 

 

lacking SCDl expression, TAG levels remain low and these animals are protected from
high fat- and high carbohydrate-diet induced obesity and T2D (48, 255), suggesting that
SCDs could be potential pharmacological targets for the treatment of these conditions.
One study, however, showed that deletion of SCDl in mice that are genetically
susceptible to obesity and T2D resulted in an earlier onset of T2D (256). This effect was
associated with the accumulation of saturated F As in islets and diminished GSIS (256),
suggesting SCDl expression and activity is important for maintenance of fi-cell function.
In agreement with this hypothesis, rat islets and B-cell lines with naturally occurring high
levels of SCD] expression are protected from palmitate-induced cell death (6, 257). It is
likely, however, that altered expression of other genes could also be involved as well.
For example, the subpopulation of palmitate-resistant B-cells from the MIN-6 B-cell line
also exhibited increased expression of CPT-1 and enhanced FA oxidation, which would
contribute to the detoxification of palmitate (6). Whether over-expression of SCD by
itself can protect (ft-cells from saturated FA-induced dysfunction remains to be
determined. Intriguingly, the SCD2 isoform is highly expressed in rat islet B-cells (257),

raising the question of whether SCD2 has a significant role in islet B-cell function.

44

4. Statemen
Reg1

lucolipoto

no

to be depei
mediated r:
activation c
bOIh basal
glucose. 11
nova lipoge
found that
S}nthesis, a
SCDS, the 1
Wm 5.1711
assays, I ex
MUFA S,Vn1
e1Gilgation i
Elongation, [
and lSlets fr
the effects .

lunction in r

“mm/2951':

Slg’llficaml;

 

4. Statement of Problem and Specific Aims

Regulation of FA metabolism significantly affects pancreatic B-cell responses to
glucolipotoxicity. The role of SREBP-1c in B—cell compensation versus failure appears
to be dependent on the level of its activation. Using a synthetic LXR agonist, LXR-
mediated regulation of SREBP-1c provides a way to examine the effects of moderate
activation of lipogenesis on B-cell function. Our lab identified LXR activation to elevate
both basal insulin secretion and GSIS from INS-l B-cells chronically cultured in high
glucose. In light of this finding, I explored the effects of LXR activation on B-cell de
nova lipogenesis and the mechanism of elevated insulin secretion. During this research I
found that LXR-activated B-cclls have an enhanced capacity for de nova MUFA
synthesis, and this coincided with increased expression of SCDl and SCD2. Unlike
SCDs, the rate-limiting enzymes for MUF A synthesis, role of FA elongases in de nova
MUFA synthesis is unknown. Thus, based on known substrate specificity elongation
assays, I examined the effects of altered Elovl-5 and Elovl-6 expression on de nova
MUFA synthesis. In contrast to the liver, less is known about FA desaturation and
elongation in B-cells. To better understand the role of B-cell FA desaturation and
elongation, I characterized FA desaturase and elongase gene expression in INS-1 B-cells
and islets from the ZDF rat model of progressive B-cell failure. In addition, I examined
the effects of altering SCD2 and Elovl-6 expression on B-cell FA metabolism and

function in response to elevated levels of exogenous saturated FAS.

I hypothesized that modulation of de nova lipogenesis and monounsaturated FA synthesis

significantly effects pancreatic ,B-cell compensation in response to glucolipotoxicity.

45

The specifis
Aim 1: To
smthesis ar
insulin relez
Aim 2: To
synthesis of
Aim 3: TO I
Ofprogressi
involved in
exogenous s
The findin

y!“
is.)
\r

H metaboli.

 

The specific aims are:

Aim 1: To characterize the effects of LXR-activation on de nova FA and neutral lipid
synthesis and to determine which aspects of FA metabolism contribute to elevated basal
insulin release and GSIS during chronic hyperglycemia.

Aim 2: To define the roles of the FA elongases Elovl-5 and Elovl-6 in the de nova
synthesis of MUFAs.

Aim 3: To characterizes the expression of FA desaturase and elongase genes in a setting
of progressive B-cell failure and to examine the effects of altering the expression of genes
involved in MUFA synthesis on fi-cell FA metabolism and viability in response to

exogenous saturated FAs.

The findings from this research will contribute to the understanding of how regulation of

FA metabolism effects B-cell compensation in response to glucolipotoxicity.

46

Chaptel
1. Mater
Palmitic :
[S-Snglt
and D-[Lf
acid-free

(Indianap
(Rank-aka
nere phos
caspase-9 l
GADDISS
l6lS-HRP;
1:3300 wer
goat anti-mi
Was from R(

2. Fatty acit

Previously (;

 

Chapter 2. Materials and Methods

1. Materials. T0901317 was purchased from Cayman Chemical (Ann Arbor, MI).
Palmitic acid was from Nu-Chek Prep, Inc. (Elysian, MN). [1-14C]palmitic acid and D-
[5-3H]glucose were from PerkinElmer Life Sciences (Boston, MA). [2-14C]acetic acid
and D-[U-14C]glucose were from ICN Pharmaceuticals, Inc (Costa Mesa, CA). Fatty
acid-free BSA for insulin secretion studies was from Roche Applied Science
(Indianapolis, IN). Fatty acid-free BSA for FA treatments was from Celliance
(Kankakee, IL). Primary antibodies used at a 1:1000 dilution, unless noted otherwise,
were phospho-JNK (pSAPK/JNK; 9255), total JNK (SAPK/JNK; 9252), and cleaved
caspase-9 (9507) from Cell Signaling Technology (Beverly, MA); SREBP-1 (IgG-2A4),
GADD153/CHOP (SC-7351) and actin-HRP (horseradish peroxidase-conjugated; sc-
1615-HRP) at 1:3300 from Santa Cruz (Santa Cruz, CA). Secondary antibodies used at
123300 were goat anti—rabbit-HRP from Vector Laboratories, Inc. (Burlingame, CA) and
goat anti-mouse-HRP from Bio-Rad Laboratories (Hercules, CA). Apoptosis ELISA kit
was from Roche Diagnostics (Cell Death Detection ELISA; Indianapolis, IN).

2. Fatty acid preparation. Palmitic acid was bound to fatty acid free BSA as described
previously (258). Briefly, stock solutions of 100 mM palmitic acid dissolved in 0.1 M
sodium hydroxide and 5% fatty acid free BSA dissolved in RPMI-1640 without glucose
were heated to 70°C and 55°C, respectively. The palmitic acid solution was then added
drop-wise into the BSA solution to make a final stock of 5 mM palmitic acid/5% BSA.
The solution was then kept at 55°C for 10 min, vortexed, brought to room temperature,
and either used immediately or stored at —20°C for up to 3 three weeks. Aliquots of the 5

mM/5% palmitic acid/BSA stocks were then thawed at 55°C for 15 min, vortexed, and

47

brought to r
concentratit'
3. Human

Foundation

of Miami. ax
RPMI-16-10
and 0.5 pg n
days in N2 r
experiments.
22.1 mM glL
same conditi.
4. Animals 3
animal care a
from Charles
10 islet isolat.
[3176721501 an
from Charles
a l2212 hr “.5
ZDF rats We!

colleqed ffCu

 

lnsulin Radi.

fIOm panCre;

 

brought to room temperature before diluting into culture media to give the final indicated
concentrations of fatty acid and BSA (0.5%).

3. Human islets. Human islets were obtained from the Juvenile Diabetes Research
Foundation Human Islet Distribution Program at the University of Minnesota, University
of Miami, and Northwest Tissue Center, Seattle. Islets were maintained in N2 medium or
RPMI-l640 plus 10% PBS containing 100 units/ml penicillin, 100 pg/ml streptomycin
and 0.5 pg/ml fungizone. For gene expression experiments, islets were cultured for three
days in N2 medium in the absence or presence of 10 pM T0901317. For lipid synthesis
experiments, islets were cultured for 36 hrs in RPMI-l640 medium containing 11.1 or
22.1 mM glucose plus 5 uM T0901317 (see below). Then incubated for 12 hrs under the
same conditions in the presence of 1 pCi [2-14C]acetic acid.

4. Animals and islet isolation. All animal procedures were approved by the institutional
animal care and use committee at Michigan State University. Sprague-Dawley rats were
from Charles River Laboratories and fed Harlan-Teklad laboratory chow (N o. 8640) prior
to islet isolation between 8-10 weeks old. Male fa/fa Zucker Diabetic Fatty rats (ZDF-
Leprfa/Crl and lean controls (fa/1’) received at 4 and 11 weeks of age were purchased
from Charles River Laboratories and fed the Purina 5008 diet. All animals were kept on
a 12:12 hr lightzdark cycle with food and water ad libitum. At 6 and 13 weeks of age,
ZDF rats were weighed and blood glucose measured. Prior to islet isolation, blood was
collected from the abdominal aorta and plasma insulin levels were measured using a Rat
Insulin Radioimmunoassay (RIA) kit (Millipore, Billerica, MA). Islets were dissociated

from pancreatic tissue by collagenase digestion and isolated by hand.

48

5.1554 “9
media Com:
mercaploeti
described (2
cm: and CU1
INS-l medi.
fatty acid tr
media conwi
6. siRNA '
Dhannacon.
using the Ar
butler (7 mM
mM glucose)
with modifiec
or with l uhl
protein analys
palmitate, €l€l
treatment wi
14Clpalmitie

glucose and

     
 

 

glucose. Cel
“ll! 1 MG {‘

CA), alter til

5. INS-l cell culture. INS-1 cells were routinely cultured in IN S-l media (RPMI-1640
media containing 11.1 mM glucose, 10% F BS, 1 mM pyruvate, 10 mM Hepes, 50 uM 2-
mercaptoethanol, 100 units penicillin/ml and 100 ug streptomycin/ml) as previously
described (259). In all experiments, cells were seeded at a density of 0.2x106 cells per
cm2 and cultured for 24 or 48 hrs in INS-l media. Cells were then cultured for 48 hrs in
INS-1 media containing 4 or 16.7 mM glucose and vehicle or 10 uM T0901317. For
fatty acid treatments, cells were cultured for the indicated times in a modified INS-1
media containing 0.5% FBS and palmitate complexed to BSA as described below.

6. siRNA treatment. Control, Elovl—5, Elovl-6 and SCD2 siRNA were from
Dharmacon, Inc. (Lafayette, CO). siRNAs were introduced into cells by electroporation
using the Amaxa Nucleofector (program D-026, Gaithersberg, MD) in electroporation
buffer (7 mM ATP, 11.6 mM MgC12-6H20, 68 mM K2HPO4, 14 mM NaHCO3, and 2.2
mM glucose). Cells were cultured for 24 hrs in INS-l media and subsequently treated
with modified INS-1 media containing increasing concentrations of palmitic acid without
or with 1 uM G66976 for the indicated times. Cells were then harvested for mRNA and
protein analysis, and apoptosis (see below). For FA and complex lipid analyses using
palmitate, electroporated cells were cultured for 24 hrs in INS-1 media followed by 12 hr
treatment with modified INS-l media plus 400 MM palmitic acid and luCi [1-
14C]palmitic acid. For de nova FA analysis, cells were cultured for 24 hrs in 5.5 mM
glucose and subsequently cultured for 24 hrs in INS-1 media containing 11.1 mM
glucose. Cells were then harvested for mRNA analysis or continued culturing overnight
with 1 uCi [2-14C]-acetic acid (51 mCi/mmol, ICN Pharmaceuticals, Inc., Coasta Mesa,

CA), after which lipids were extracted and analyzed for MC incorporation.

49

7. Aden
construct
was clan:
using

ATAGTC
ATACTC
recombin;
Vector S)
pShuttle-C
ultracompc
Adenoviru:
Rapid Tite
galactosida
transductio;
With 5 0r 1.

glucose INS

indicated lip

 

 

7. Adenovirus preparation. Elovl-5 and Elovl—6 cDNA were cloned and used for
construction of recombinant adenoviruses as previously described (35). SCD2 cDNA
was cloned into TOPO plasmids (Invitrogen) from reverse transcribed INS-1 cell mRNA
using the following primers: sense 5’-
ATAGTCGACATGCCGGCTCACATACTGCAAGAG-3 ’; antisense 5 ’-
ATACTCGAGTCAGCCACTCTTGCAGCTCTCCTCCCC-3’ (Acc. No. AB032243). A
recombinant adenovirus over-expressing SCD2 was constructed using the Adenoviral
Vector System (Stratagene). In short, the coding regions of SCD2 were ligated into
pShuttle-CMV, recombined with pAdEasy—l in BJ 5183 cells, propagated in XL10 Gold
ultracompetent cells, and packaged into adenoviral particles in Ad—293 cells.
Adenoviruses were further amplified and then titered in HEK293 cells using the Adena-X
Rapid Titer kit (Clontech, Mountainview, CA). An adenovirus over-expressing [3-
galactosidase was obtained from Dr Newgard, Duke University, North Carolina. For
transduction of genes into INS-l cells, 90% confluent cell cultures were infected for 2 hrs
with 5 or 10 pfu per cell and then cultured for an additional 24 hrs in 5.5 or 11.1 mM
glucose INS-1 media to allow for gene expression. Afierwards, cells were treated for the
indicated times in modified INS-1 media without or with increasing concentrations of
palmitic acid. Cells were then harvested for protein analysis and apoptosis. For FA and
complex lipid analyses using palmitate, cells were infected for 2 hrs, cultured for 24 hrs
in INS-l media, and treated with 400 uM palmitic acid with 3 uCi [1-14C]palmitic acid
for 12 hrs prior to lipid extraction. For de nova FA analysis, cells were cultured in INS-l
media containing 11.1 mM glucose with 1 uCi [2-14C]-acetic acid for 24 hrs prior to

lipid extraction.

50

8. RNA 2
mRNA in

fluorogeni
amounts c
Results fo
rodent isle”
(Bio-Rad.

combining
primers (Ir
qPCR Sup:
316000? q
mRNAs we
analyzed in
Prorein L 3 3.

(Tables 2_2 ,

C

 

 

8. RNA analysis. Total RNA was extracted using TRIZOL (Invitrogen). Levels of
mRNA in human islets were determined by real-time qPCR using Light Upon Extension
fluorogenic primers (Invitrogen, Table 2.1) as previously described (260). Relative
amounts of mRNA were calculated using the comparative cycle threshold method.
Results for human islets were normalized to the abundance of B—actin mRNA. For
rodent islets and INS-1 cells, cDNA were synthesized using iScript cDNA Synthesis kit
(Bio-Rad, Hercules, CA). Quantitative real—time (qRT) PCR was conducted by
combining synthesized cDNA and various sets of gene-specific forward and reverse
primers (Integrated DNA Technologies, Coralville, IA) with Platinum SYBR Green
qPCR SuperMix-UDG (Invitrogen). qRT-PCR reactions were carried out using the
Mx3000P quantitative PCR System (Stratagene, La Jolla, CA). The relative amounts of
mRNAs were determined by the comparative cycle threshold method. All samples were
analyzed in triplicate. Gene expression is reported relative to cyclophilin or ribosomal
protein L32 (RPL32) mRNA levels. Primers for SYBR Green qRT-PCR are listed in

(Tables 2.2 and 2.3).

51

Table 2

______.—.————-—-

Light I
Name
fi-actin

 

SREBP

ACC

FAS

 

ib-carbox
internal Ct
§6-carbox
reactions.

Table 2.1. Oligodeoxynucleotide sequences used for quantitative RT-PCR.

 

Light Upon Extension Quantitative RT-PCR primers

 

Name Species Direction Sequence (5’ to 3’)

B—actin Human Forward CACGCCACCTTCTACAATGAGCTGCGG#
Reverse GGTCATCTTCTCGCGGTTGG

SREBP—1 Human Forward GACGGCCTCTGGAACCTCATCCGTC§
Reverse TAGCATCCACTCGCAGAGCA

ACC Human Forward CACATGCTCCAAACCAGGCCATGTG§
Reverse GCCAGTCCACACGAAGACCA

FAS Human Forward CACCTTAACCTGGTAGTGAGTGGGAAGGTG§
Reverse CTTTCCGGGTGGTCGAAGA

 

#6-carboxy-4’,5’-dichloro-2’,7’-dimethoxy-fluorescein-labeled B-actin primer used as
internal control for all real-time RT—PCR reactions.
§6-carboxy-fluorescein—labeled forward PCR primers used for real-time RT-PCR

reactions.

52

Table 2.2

 

SYBR G
Cyclophi

 

RPL32
SREBP-l
ACCa
FAS
ABCAl
ABC 01
CPT-l a
CPT-2
VLCAD

LC AD

\

 

 

Table 2.2. Oligodeoxynucleotide sequences used for. quantitative RT-PCR.

 

SYBR Green Quantitative RT—PCR primers

 

Name Species Direction Sequence (5’ to 3’)
Cyclophilin Rat Forward CTTCTTGCTGGTCTTGCCATTCCT
Reverse TGGATGGCAAGCATGTGGTCTTTG
RPL32 Rat Forward AAACTGGCGGAAACCCAGAG
Reverse GCAATCTCAGCACAGTAAGATT
SREBP- 1 Rat Forward GATTGCACATTTGAAGACATGCTT
Reverse GGGTCCCAGGAAGGCTTCCAGAGA
ACCOt Rat Forward CGATGTI‘CTGTTGGACAACGCCTT
Reverse TCTCTGATCCACCTCACAGTTGAC
FAS Rat Forward GTGCACCCCATTGAAGGTTCC
Reverse GGTTTGGAATGCTGTCCAGGG
ABCAl Rat Forward AGCAGTTTGTGGCCCTCTTGT
Reverse TGAAGTTCCAGGTTGGGGTACTTG
ABCGl Rat Forward ATGGAAGGTTGCCACAGCTTCTC
Reverse AGTCATGGTCTTGGCCAGGTAGT
CPT-la Rat Forward AGACCGTGAGGAACTCMACCCAT
Reverse CACAACAATGTGCCTGCTGTCCTT
CPT-2 Rat Forward TCCTGCATACCAGCAGATGAACCA
Reverse ACAGTGGAGAAACTCTCGGGCATT
VLCAD Rat Forward GTGGGAATGTTCAAAGGCCAGCTT
Reverse AAGGAGTCATTCTTGGCAGGGTCA
LCAD Rat Forward AATGGGAGAAAGCCGGAGAAGTGA

Reverse

GAAACCAGGGCCTGTGCAATTTGA

 

53

 

D60
Eknl-l
EvaZ
EMVL3
Eva4
EbVLS
EmrL6
Ekwi7
Xmfls
Xhflt
ATF3

CHOP
\

 

 

Table 2.3. Oligodeoxynucleotide sequences used for quantitative RT-PCR.

 

SYBR Green Quantitative RT-PCR primers

 

Name Species Direction Sequence (:to 3’)
Insulin Rat Forward GCTTTTGTCAAACAGCACCTT
Reverse CTCCAGTGCCAAGGTCTGAAG
SCD] Rat Forward ACATTCAATCTCGGGAGAACA
Reverse CCATGCAGTCGATGAAGAAC
SCD2 Rat Forward ATGCCGGCTCACATACTG
Reverse GACCAGTGTGATCCCGTACA
D5D Rat Forward TGGAGAGCAACTGGTTTGTG
Reverse GTTGAAGGCTGACTGGTGAA
D6D Rat Forward TGTCCACAAGTTTGTCATTGG
Reverse ACACGTGCAGGCTCTTTATG
Elovl-1 Rat Forward CCCTACCTTTGGTGGAAGAA
Reverse TCCAGATGAGGTGGATGATG
Elovl-2 Rat Forward TTTGGCTGTCTCATCTTCCA
Reverse GGGAAACCGTTCTTCACTTC
Elovl-3 Rat Forward AATTCTGGTCCTGGGTCTTTC
Reverse CCAAAGCTCGTAAACAGTAGCA
Elovl-4 Rat Forward GAAGTGGATGAAAGACCGAGA
Reverse GCGTTGTATGATCCCATGAA
Elovl-5 Rat Forward ACAGCTTCATCCACGTCCTCATGT
Reverse AGCTGGTCTGGATGATTGTCAGCA
Elovl-6 Rat Forward CAACGGACCTGTCAGCAA
Reverse GTGGTACCAGTGCAGGAAGA
Elovl-7 Rat Forward TGGCGTTCAGCGATCTTAC
Reverse GATGATGGTTTGTGGCAGAG
Xbp 1 s Rat Forward GAGTCCGCAGCAGGTG
Reverse GCGTCAGAATCCATGGGA
Xbplt Rat Forward GAGCAGCAAGTGGTGGATTT
Reverse TCTCAATCACAAGCCCATGA
ATF3 Rat Forward GAAGGCACAAAGTCCCGCTTTCAA
Reverse TTCAAATACCAGTCTCCACGGGCT
CHOP Rat Forward AACTGTTGGCATCACCTCCTGTCT

Reverse

TCCTCAGCATGTGCACTGGAGATT

54

9. Western blot analysis. For analysis of SREBP-l protein, microsomes and nuclear
extracts were isolated as previously described (261). Proteins (30-100 pg) were resolved
by SDS-PAGE and transferred to nitrocellulose membranes as described previously
(262). Proteins were detected with specific primary antibodies and the corresponding
secondary antibodies and the bands were then visualized on film with SuperSignal West
Pico and Dura chemiluminescent kits (Thermo Fisher Scientific, Rockford, IL). Protein
bands were quantified by densitometry scanning.

10. Insulin secretion studies. IN S-l cells were preincubated twice for 30 min at 37°C in
Krebs Ringer bicarbonate buffer (KRBB) (259) containing 2 mM glucose and
subsequently incubated for 60 min in KRBB containing either 2 or 20 mM glucose. For
studies using etomoxir (100 uM), orlistat (50 uM) or calphostin C (1 uM), agents were
present throughout the incubation period in KRBB. Triacsin C (10 uM) was added 5 hrs
prior to secretion studies. Verapamil (100 uM) was only present during the final 1 hr
.incubation in KRBB. Insulin released into the media and insulin content from acid-
ethanol extracted cells were determined by radioimmunoassay (Linco, St. Louis, MO).
Total cell protein was determined by Lowry assay.

11. Glucose utilization studies. Glucose usage was measured using a modification of
the method of Zawalich and Matschinsky (263) as previously described (259). Briefly,
cells were incubated for 30 min at 37°C in KRBB containing either 2 or 16.7 mM glucose
and [5-3H]glucose. Duplicate 50 ul samples were added to a tube containing 1 N HCI.
The tubes were placed in vials containing 0.5 ml of H20, sealed, and incubated at 50°C

for 18 hrs. Tubes were then removed from vials, scintillation cocktail was added, and

55

 

samples “Ci
expressed as
12. Comple:
cells were c
vehicle or 1(
containing 4
acid (51 mt
extracted as
lipid extracts
(390 Quar.
Phosphoimaé
Anal)
FA analysis 1
mM glUCOSe.
was added I 0‘
KOH in 809
resusPended
phase‘HPLC
qUBntified b

Toral F As

 

quantified t:-

For:

lllCUbated ft

 

samples were counted in a Beckman scintillation counter. Glucose utilization was
expressed as picomoles of glucose metabolized per min per mg protein.
12. Complex lipid analysis and fatty acid profile. For de nova lipid synthesis, INS-l
cells were cultured for 48 hrs in INS-l media containing 4 or 16.7 mM glucose and
vehicle or 10 pM T0901317. During the last 12 hrs, cells were cultured in INS-l media
containing 4 or 16.7 mM glucose, vehicle or 5 uM T0901317, and 1 uCi [2-14C]acetic
acid (51 mCi/mmol). Cells from l4C-labeling studies were harvested and lipids
extracted as previously described by Pawar et al. (264). For analysis of complex lipids,
lipid extracts were separated by thin layer chromatography (TLC) as previously described
(264). Quantification of l4C-labeled lipids was determined on a Molecular Dynamics
Phosphoimager 820.

Analysis of 14C-labeled FA profile was performed as previously described (35).
FA analysis from glucose was determined by culturing INS-1 cells for 48 hrs in 4 or 16.7
mM glucose, and during the last 24 hrs 4 or 16.7 pl of [U-14C]glucose (260 mCi/mmol)
was added to the media. Total lipid extracts from labeling studies were saponified (0.5 N
KQH in 80% methanol, 1 hr at 50°C), neutralized, extracted in diethyl ether, dried, and
resuspended in methanol and 0.1 mM BHT. FAs were then fractionated by reverse
phase-HPLC using a J ’sphere ODS—H80 (YMC-Waters, Milford, MA) column and
quantified by flow-through scintillation counting (IN/US Systems, Inc., Brandon, FL).
Total FAS were quantified by evaporative light scatter, and unsaturated FA were
quantified by UV absorption at 192 nm.

For total FA synthesis from glucose during the insulin secretion study, cells were

incubated for 1 hr with either 2 or 20 mM glucose plus 4 or 40 pCi of [U-14C]glucose

56

(260 mCi/mmol), respectively. Cells were extracted, extracts saponified, and 14C-
labeled FA quantified as described above.

Indexes of elongation and desaturation were determined using the 14C counts
incorporated into each specific FA species and calculating the ratios of product(s) to
substrate. Elongation of 16:0 and 16:1,n-7 was determined from the ratios of 18:0 plus
18:1,n-9 to 16:0 and 18:1,n-7 to 16:1,n-7, respectively. Desaturation of 16:0 and 18:0
was determined from the ratios of 16:1,n-7 plus 18:1,n-7 to 16:0 and 18:1,n-9 to 18:0,
respectively.

13. Palmitate oxidation. INS-l cells were then incubated for 1 hr in KRBB containing 2
mM glucose, after which cells were incubated for 1 hr in KRBB containing 50 uM
palmitate, 2 pCi/ml [1-14C]palmitic acid (56 mCi/mmol), and 2 or 20 mM glucose.
Palmitate oxidation was determined by measuring [14C]C02 released into the medium
using the method of Parkera et al. (265).

14. Statistical analysis. Islet studies are representative of 5 to 6 animals per group. All
INS-l cell data represent 3 to 6 independent experiments performed in duplicate.
Statistical significance was determined using one-way ANQVA followed by Bonferroni’s
multiple comparison test for more than two groups or Student’s t-test for comparing two

groups. P values < 0.05 were considered significant.

57

Chapter 3.
Elevated Insulin Secretion From Liver X Receptor-Activated Pancreatic
B-Cells Involves Increased de Nova Lipid Synthesis and Triacylglyceride

Turnover

Abstract

Increased basal and loss of glucose-stimulated insulin secretion (GSIS) are
hallmarks of B-cell dysfunction associated with type 2 diabetes. It has been proposed that
elevated glucose promotes insulin secretory defects by activating sterol regulatory
element binding protein-1c (SREBP-1c), lipogenic gene expression and neutral lipid
storage. Activation of liver X receptors (LXR) also activates SREBP-1c and increases
lipogenic gene expression and neutral lipid storage, but increases basal and GSIS. This
study was designed to characterize the changes in de nova fatty acid (FA) and
triacylglyceride (TAG) synthesis in LXR-activated B-cells and determine how these
changes contribute to elevated basal and GSIS. Treatment of INS-l B-cells with a LXR
agonist T0901317 and elevated glucose led to markedly increased nuclear localization of
SREBP-1, lipogenic gene expression, de nova synthesis of monounsaturated fatty acids
and TAG, and basal and GSIS. LXR-activated cells hadincreased FA oxidation and
expression of genes involved in mitochondrial B-oxidation particularly camitine
palmitoyltransferase-l. Increased basal insulin release from LXR-activated cells
coincided with rapid turnover of newly synthesized TAG and required acyl-CoA
synthesis and mitochondrial B-oxidation. GSIS from LXR-activated IN S-l cells required

influx of extracellular calcium and lipolysis suggesting production of lipid-signaling

58

molecules from TAG. Inhibition of diacylglyceride (DAG)-binding proteins, but not
classic isoforms of protein kinase C, attenuated GSIS from LXR-activated INS-l cells.
In conclusion, LXR activation in B-cells exposed to elevated glucose concentrations
increases de nova TAG synthesis; subsequent lipolysis produces free fatty acids and
DAG, which are oxidized to increase basal insulin release and activate DAG—binding

proteins to enhance GSIS, respectively.

Introduction

Type 2 diabetes mellitus occurs when pancreatic B-cells fail to secrete sufficient
amounts of insulin necessary to overcome insulin resistance at peripheral tissues and to
maintain glucose homeostasis. Loss of B-cell function in type 2 diabetes has been
suggested to occur when B-cells are chronically exposed to elevated circulating glucose
and free fatty acids (F FA) — a state defined as ‘glucolipotoxicity’ (3, 4). Sterol regulatory
element binding protein 1c (SREBP-1c), a basic helix 100p helix transcription factor,
plays a major role in inducing lipogenic gene expression in liver and adipose tissue (69,
266, 267), and thereby partitions glucose towards synthesis of lipid. The ability of
elevated glucose to increase the nuclear form of SREBP-1c in B—cells (114, 115, 268) has
been proposed to serve as a possible mechanism for glucolipotoxicity, and to explain the
predominate role of elevated glucose in B-cell dysfunction (268). Consistent with this
hypothesis, expression of a constitutively active nuclear form of SREBP-1c in islets or B-
cell-lines increased lipogenic gene expression, triacylglyceride (TAG) synthesis and

storage, and suppressed glucose-stimulated insulin secretion (GSIS) (115, 116, 235, 268,

59

Ell

269). Islet failure in Zucker Diabetic Fatty (ZDF) rats is also associated with increased
expression of SREBP-1c and TAG accumulation (232, 233, 270).

Although activation of SREBP-1c is an attractive mechanism to explain
glucolipotoxicity, recent reports suggest that the role of SREPB-lc in fi-cell function is
more complex. First, SREBP-1c activation and lipid synthesis are required for adaptive
changes leading to hypersecretion of insulin from mouse islets exposed to elevated
glucose concentrations (234). Second, inactivation of SREBP-1c in ZDF rat islets failed
to restore GSIS suggesting that increased SREBP-1c and intracellular TAG are not the
principal cause of B-cell secretory dysfunction (252). Third, activation of liver X
receptors (LXR) in islets and B-cell-lines increased SREBP-1c, lipogenic gene
expression, neutral lipid storage, and basal and GSIS (5, 253).

LXRor (NR1H3) and LXRB (NR1H2), are nuclear receptors involved in
transcriptional control of genes involved in cholesterol, fatty acid, and glucose
metabolism (271). LXRor is primarily expressed in liver, kidney, intestine, and
macrophages, whereas LXRB is ubiquitously expressed (78, 272). LXR is activated by
oxysterols (273) and glucose (77). In macrophages, LXR regulates reverse cholesterol
transport through increased expression of genes encoding ATP-binding cassette (ABC)
cholesterol transporters ABCAI (274) and ABCGl (275). In liver, LXR controls
transcription of genes involved in conversion of cholesterol into bile acids (273, 276) and
excretion of biliary cholesterol (277). LXR also directly and indirectly, through
increased SREBP-1c expression, activates lipogenic gene transcription including acyl
CoA carboxylase (ACC), fatty acid synthase (FAS), and stearoyl CoA desaturase l

(SCDI) and 2 (SCD2) (81, 278-280).

60

 

CK

LXRa and LXRB are expressed in rodent and human pancreatic islets and B-cell
lines (5, 281). Islets from LXRB knockout mice accumulated lipid, have reduced
expression of cholesterol transporters, and reduced GSIS (117, 253). Treatment of islets
and B-cell lines with the LXR agonist T0901317 increased expression of lipogenic genes
and lipid accumulation (5, 118). Importantly, LXR agonists elevated basal and GSIS
from islets and B-cell lines through a mechanism dependent upon increased SREBP—1c,
and pyruvate carboxylase and ACCor activity (5, 253). These findings suggest that LXR
activation promotes insulin release by stimulating anaplerotic and cataplerotic pathways,
possibly to supply malonyl-CoA for de nova fatty acid and lipid synthesis. The principal
aims of the study presented herein were to characterize the changes in de nova FA and
TAG synthesis in LXR-activated B-cells and determine how these changes in lipid

metabolism may contribute to elevated basal and GSIS.

61

Results
3.1. Effect of glucose and LXR activation on SREBP-1 and lipogenic gene
expression.

Culturing INS-1 cells in 16.7 mM glucose for 48 h increased protein levels of
both the microsomal precursor (125 kDa) and nuclear active (65 kDa) forms of SREBP-1
(Figure 3.1A) (26]). Activation of LXR by the addition of T0901317 further increased
microsomal precursor and nuclear forms of SREBP-1 for each glucose concentration
tested. These results show that elevated glucose and direct activation of LXR by
T0901317 can independently and synergistically activate SREBP-l synthesis, processing
and nuclear localization in B-cells. Since LXR regulates only SREBP-1c and not
SREBP-la (279), these changes in SREBP-l likely reflect increased SREBP-1c nuclear
abundance.

Activation of LXR in a number of tissues results in direct and indirect induction
of genes involved in lipogenesis and cholesterol efflux. Culturing INS-1 cells in 16.7
mM glucose for 48 h led to a modest increase (1.4- to 2-fold) in mRNA levels of SREBP-
], FAS, SCDl and 2, and a large increase in ACCa (6.4-fold) (Figure 3.1B). LXR
activation with T0901317 markedly increased the expression of SREBP-1, FAS, SCD],
SCD2, ABCAl and ABCGl irrespective of the glucose concentration. T0901317 also
led to a 2.3-fold increase in ACCa gene expression in cells culture in low glucose, but
did not further increase ACCa expression in cells cultured in elevated glucose.
Treatment of human islets with T0901317 (10 pM) for 72 h also led to a 6- to 13-fold

increase in expression of SREBP-1 , FAS, and ACCa mRNA (Figure 3.1C).

62

Figure 3.1. Glucose and LXR activation increase SREBP-1 expression and
nuclear localization, and lipogenic gene expression. IN S-l cells were cultured for
48 hrs in media containing 4 or 16.7 mM glucose i 10 uM T0901317. A.
Microsomes and nuclear extracts were fractionated by SDS-PAGE and SREBP-1
immunoreactivity was detected by Western analysis. Results shown are
representative of four independent experiments. B. Total RNA was isolated and
analyzed for SREBP-1, ACC, FAS, SCDl, SCD2, ABCAl and ABCGl mRNA
expression by real-time RT-PCR. Control genes cyclophilin and ribosomal protein
L32 (RPL32) were unaffected by T0901317 or glucose (data not shown). Data are
relative to cyclophilin and normalized to cells cultured in 4 mM glucose (mean i
SEM, n = 4). C. Isolated human islets were cultured for three days in medium
supplemented without or with 10 uM T0901317. Total RNA was isolated and
mRNA expression levels were determined by real-time RT-PCR (mean i SEM, n =

3).

63

A Glucose (mM): 4 16.7
T0901317(pM): O 10 0 1O

 

 

Microsomal (125 kDa) -

 

Nuclear (65 kDa) -

 

 

 

25' E4 mM Glucose

-4 mM Glucose + T0
E16] mM Glucose
E11316] mM Glucose + TO

.3
01
I

Fold Response
a" 3.3

 

 

SREBP-1ACC FAS SCD1 SCDZ ABCA1ABCG1

Figure 3.1. Continued

      
    

i.

 

S 1
a P
d. B
.I E C S 0
n R C A
a S A F
m I § U
U
H u).
_ u u a a M
5 0 5 o 5 0 (UV
2 2 1 1 7
22.88. >3 :03265 20”. 13..
m
9
0
T

C

65

3.2. Effect of glucose and LXR activation on lipogenesis.

To assess de novo lipogenesis, INS-l cells were incubated for 36 hrs in 4 or 16.7
mM glucose :1: T0901317 and then incubated for 12 hrs under the same conditions in the
presence of [2-14C]acetic acid. Total lipids were analyzed by TLC to measure 14C
incorporation into polar lipids (phospho- and sphingolipids), FFA, TAG, cholesterol, and
cholesterol esters (264). Figure 3.2A illustrates the fractional distribution of 14C in
neutral, polar, and non-esterified lipid fractions. The percent of 14C in the polar lipid
fraction ranged from 88 to 71% and was sensitive to both glucose and T0901317. For
cells incubated in 4 mM glucose, 83.1 i 1.5% (N = 4) of 14C-labeled lipid were polar
lipids and the fractional distribution was not altered by T0901317 (82.2 i 1.4%).
Treatment of cells with 16.7 mM glucose shifted the fractional 14C distribution from
polar lipids (77.6 a: 2.0%) to neutral lipids, and this was further shifted by T0901317
(71.1 :t 1.3%).

In cells cultured in 4 mM glucose, the fractional distribution of 14C assimilation
into cholesterol, CE, FFA, and TAG was 7.7 i 0.6%, 0.6 :t 0.1%, 1.1 i 0.2%, and 1.7
i0.3%, respectively, and this was unaltered by treatment with T0901317 (Figure 3.2A).
Culturing cells in 16.7 mM glucose led to a 5.4- and 2.5-fold increase in 14C-labeled
TAG (9.1 :l: 1.6%, p < 0.01) and CE (1.4 i 0.3%, p < 0.03), respectively. Addition of
T0901317 led to an additional 2-fold increase in 14C-labeled TAG (16.7 :t 1.9%, p <
0.01) and a ~50% reduction in 14C-labeled cholesterol (4.0 :l: 0.4, p < 0.03) and CE (0.7
i 0.1, p < 0.04), respectively. Similar changes in fractional distribution of 14C-labeled
polar lipids and TAG were observed in experiments using D-[U-14C]glucose (data not

shown). Changes in 14C-labeled TAG were also proportional to changes in TAG mass

66

 

lira

lion‘- I

 

Ill

den

- _._fi,_»_‘ _.

Lei

 

3C

 

 

(data not shown). Treatment of human islets with T0901317 also increased 14C-labeled
TAG and reduced 14C-labeled cholesterol (Figure 3.3A). Overall, these results
demonstrate that activation of lipogenic genes in B-cells by elevated glucose and
T0901317 markedly increase de novo lipid synthesis and partitioning of carbon from
acetic acid or glucose into complex neutral lipids, particularly TAG.

3.3. Effect of LXR activation on fatty acid profile.

Total lipids extracted from [2-14C]acetic acid labeled INS—l cells were saponified
and the FA profile was determined by reverse-phase HPLC. When INS-1 cells were
incubated in 4 mM glucose, 4.5%, 53.1%, 23.6%, 5.7%, 5.3%, and 7.8% of 14C-labeled
FAs were myristic acid (14:0) palmitic acid (16:0), stearic acid (18:0), palmitoleic acid
(16:1,n-7), vaccenic (18:1,n-7) and oleic acid (18:1,n-9), respectively (Figure 3.2B).
Incubation of cells in 16.7 mM glucose only modestly affected the fractional distribution
of 14C-labeled FAS and this was reflected by a small increase in 14C-labeled palmitoleic
acid (16:1,n-7). In contrast, treatment of cells with T0901317 led to a large change in the
fractional distribution of 14C-labeled FAs such that 14C-labeled palmitoleic (16:1,n-7),
vaccenic (18;l,n-7) and oleic (18:1,n—9) acids increased by ~2-fold. T0901317 also led to
a ~25% reduction in 14C-labeled palmitic (16:0) and stearic (18:0) acid. The T0901317-
induced change in 14C-labeled FAs occurred with a commensurate increase in MUFA
pool size and decrease in saturated FA pool size (data not shown). Treatment of isolated
human islets with T0901317 also changed the fractional distribution of 14C-labeled F As
with an increase in palmitoleic acid (16:1,n-7) synthesis and a reduction in stearic acid
(18:0) production (Figure 3.3B). These results show that activation of LXR in B-cells

increases de nova synthesis of MUFA.

67

 

figur'
1151

T19}

Figure 3.2. Elevated glucose and T0901317 increase de nova lipid synthesis in
INS-1 cells. INS-l cells were cultured for 48 h in 4 or 16.7 mM glucose :1: 10 uM
T0901317. Cells were then incubated overnight under the same conditions in the
presence of [2-14C]-acetic acid. A. Total lipids were extracted from the cells and
separated on silica TLC plates with hexanezetherzacetic acid (90:30zl). Plates were
dried, and radioactivity was detected and quantified on a Phosphoimager. Data are
reported as percentage of total labeled lipid. Percent of labeled polar lipid is
reported as a numeric value at the top of the graph. B. Total lipids were saponified
and incorporation of 14C into fatty acids was determined by reverse—phase HPLC.
Data are reported as percentage of total labeled fatty acid. Values are the mean i:

SEM for four independent experiments.

68

A

 

Iias 1“c-potar lipid: 83.1
30-

N
(II
I

20-

Percent of total labeled lipid
a

 

our
Glucose (mM): 4
T0901317(pM): O

B 110-

100-

Percent labeled fatty acid

 

Glucose (mM): 4
T0901317(pM): 0

 

82.2 77.6 71.1 I

-Triacylglyceride
ECholesterol
-Cholesterol esters
-Free fatty acids

4 16.7 16.7
10 0 10

notifier: x
,5. Sc“ : 2392:

4 16.7 16.7
10 0 10

 

69

 

 

Figure 3.3.
isles were
all 5 till
conditions

.. ;‘ .

astronaut
described :

intestero.

acids. \"ali

Figure 3.3. T0901317 increase de nova lipid synthesis in human islets. Human
islets were cultured for 36 hrs in medium containing 11.1 or 22.2 mM without or
with 5 uM T0901317. Islets were then incubated for 12 hrs under the same
conditions in the presence of l u Ci [2-14C]-acetic acid. Assimilation and
distribution of 14C into complex lipids and fatty acids species was determined as
described in Figure 3.2. A. Incorporation of 14C into triacylglyceride, cholesterol,
cholesterol esters, and free fatty acids. B. Incorporation of 14C into specific fatty

acids. Values are means, n = 2.

70

A

L70 as ”C-polar lipid: s9", smswm__ts_z__wAgo _ l

50

 

 

QTriacylglyceride
f? Cholesterol

l Cholesterol ester
@ Free fatty acids

ZN i
N

20- \\

45 . Human islets

40‘

Percent of total labeled lipid

 

 

    

15 -
1o -
5 -
o . WW” 7% . mm W
Glucose (mM): 11.1 11.1 22.2 22.2
T0901317 (pM): 0 10 0 10
B 1731420
N1621
120 518:0
79 . Human lSletS I16:O and 18:1
8 100 .__,_ *“ ";:=,:2:::2:::s:;:
>s 5225;123:335? """""""
8 .
T) 60
.Q
S
u 40 .
C
(D
2 20
Q)
Q.

 

o
Glucose (mM): 11.1 11.1 22.2 22.2
T0901317 (uM): 0 10 0 10

71

3.4. Impact of LXR activation on basal and glucose-stimulated insulin secretion.

IN S-l cells were cultured for 48 hrs in 4 or 16.7 mM glucose d: 10 uM T0901317,
after which insulin release was measured in response to a 1 hr challenge with either 2 or
20 mM glucose. Acute treatment of INS-1 cells, previously cultured in 4 mM glucose rt
T0901317, with 20 mM glucose led to an ~2-fold increase in GSIS (Figure 3.4A). In
comparison, IN S-l cells cultured in 16.7 mM glucose for 48 hrs had reduced basal insulin
release (2 mM glucose) and GSIS. In cells cultured in 16.7 mM glucose plus T0901317,
insulin release was increased when cells were stimulated with 2 or 20 mM glucose and
there appeared to be a partial recovery of GSIS. Although long-term exposure of IN S-l
cells to elevated glucose reduces insulin expression (282), increased insulin release from
cells cultured in 16.7 mM glucose plus T0901317 was not due to increased cellular
insulin content (Figure 3.4B). Moreover, treatment of cells with T0901317 did not
significantly alter glucose utilization at either 2 or 16.7 mM glucose (Figure 3.4C).
Similar findings were also observed for glucose oxidation (data not shown). These data
indicate that LXR-activated INS-1 cells cultured under an elevated glucose load have
increased basal and stimulated insulin release, and this is independent of increased insulin

content or changes in acute glucose metabolism.

72

Figure 3.4. INS-1 cells cultured in elevated glucose and T0901317 have
increased insulin release. INS-1 cells were cultured for 48 h in 4 and 16.7 mM
glucose i 10 uM T0901317. Cells were washed and preincubated at 370C in KRB
buffer containing 2 mM glucose for 60 min. A. Acute insulin release was then
determined by incubating cells for 60 min at 370C in KRB buffer containing 2 or 20
mM glucose. Data represent the mean i SEM for four independent experiments
performed in triplicate. *, p < 0.03 when compared to cells cultured in 16.7 mM
glucose. B. Intracellular insulin content from IN S-l cells that under went an acute
glucose (2 mM) challenge as described above. Data represent the mean 5: SE. of
four independent experiments. *, p < 0.05 when compared to cells cultured in 4 mM
glucose. C. Glucose utilization was measured by incubating cells for 30 min at 370
C in KRB buffer containing either 2 or 16.7 mM glucose and [5-3H]-D-glucose.
Conversion of [5-3H]-glucose to [3H]-H20 was determined. Data represent the
mean :t SE. of five independent experiments. * and #, p < 0.04 or p < 0.001,

respectively, when compared to cells cultured in 4 mM glucose.

73

25-

.x .- N
O U! D
I I I

Insulin Release (ng/ml)
0|

 

04

Glucose (mM):
T0901317 (pM):

‘1

01

O
I

B

Insulin Content (ng/well)

 

0-
Glucose (mM):
T0901317(uM):

C

1100-
1000-
900-
800-
700-
600-
500‘
400-
300'
200-
100-

Glucose Utilization
(pmol/mIn/mg)

   

 

0-

Glucose (mM):
T0901317 (uM):

E2 mM Glucose
-20 mM Glucose

 

*'
4.016.7 16.7
0 10 0 10

 

4.0 4.0 16.7 16.7
0 10 0 10

D2 mM Glucose
-16.7 mM Glucose

 

4.0 4.0 16.7 16.7
0 10 0 10

74

 

 

3.5. '

this

aim
ill]
be n
To 1
Gilli
dot
SC
by

in

it

3.5. MUFA synthesis is not obligatory for elevated insulin release from LXR-
activated INS-l cells.

Exposure of human islets to elevated glucose and exogenous palmitate induces
apoptosis and diminishes GSIS, whereas these effects are reversed by co-exposure to
MUFAs (283). Thus, enhanced insulin secretion from LXR-activated INS-1 cells could
be mediated by the increased conversion of de novo synthesized palmitate to MUFAs.
To test this hypothesis, INS-1 cells were electroporated with SCD targeted siRNA and
cultured for 48 hrs in 16.7 mM glucose with or without T0901317. SCD siRNA knocked
down both SCD1 and SCD2 gene expression and markedly reduced the induction of
SCD1 and SCD2 by T0901317 (Figure 35A). The expression of A6D was not effected
by SCD siRNA. In cells cultured with [1-14C]-palmitate during the last 24 hrs, SCD
knockdown significantly reduced the conversion of 14C-labeled palmitate into MUFAs
(Figure 3.5B). After culture for 48 hrs in 16.7 mM glucose with or without T0901317,
insulin release from INS-l cells with reduced SCD expression was slightly increased
rather than decreased (Figure 3.5C). Nevertheless, this shows that elevated insulin
release from LXR-activated INS-1 cells is not dependent on the induction of SCD gene

expression.

75

Figure 3.5. Knockdown of SCD with siRNA does not inhibit insulin release
from LXR-activated INS-1 cells. INS-1 cells were electrophorated in the presence
of 100 nM control siRNA or siRNA against SCD1 and 2. Cells were cultured for 12
hrs in 11.1 mM glucose and then cultured for 48 hrs in 16.7 mM glucose with or
without T0901317. After which mRNA levels, MUFA synthesis from 14C-labeled
palmitate, and insulin release were assessed. A. SCD siRNA blocked the ability of
T0901317 to increase SCD l and 2 mRNA levels. SCD siRNA, however, did not
affect T0901317 induction of delta 6 desaturase (D6D) (n=3). B. Knockdown of
SCD decreased the conversion of 14C-palmitate (16:0) to palmitoleate (16:1) or
oleate (18:1) (n=3). C. Knockdown of SCD failed to decrease insulin release from

LXR-activated cells cultured in 16.7 mM glucose (11 = 6).

76

EsiCTL
-siCTL + T0
msiSCD
-siSCD + T0

 

   

 

 

 

 

 

 

 

.72
o
<
>.
3: -18:1n9
“’ 80-
u. @18fln7
E 60- -16:1n7
g E18:0
3 40- -16:0
“E
8 20-
L
o
a. 0-
T0901317(uM): o 10 0 10
siCTL siSCD
t 60"
E
m
E 45.. .T. D 2 mM Glucose
g - 20 mM Glucose
8 30-
cc
2
2
.E 15-
3
U)
E 0' ’1 I
siCTL siSCD siCTL siSCD
16.7 mM Gluc 16.7 mM Gluc + T0

77

3.6. Role of fatty acid oxidation in elevated insulin release.

To investigate the role of FA oxidation in insulin release, secretion studies were
performed in the presence of an inhibitor of long-chain acyl CoA synthetase (ACS),
triacsin C, or an inhibitor of camitine palmitoyltransferase-l (CPT-1), etomoxir. Triacsin
C prevents conversion of FFA to LC-CoA thereby indirectly inhibiting B-oxidation of
FFA, whereas etomoxir directly inhibits the rate-limiting enzyme of B-oxidation. In INS-
] cells cultured for 48 hrs in 16.7 mM glucose, etomoxir (100 pM) had no effect on
insulin release in response to a 1 hr challenge with 2 or 20 mM glucose (Figure 3.6A). In
contrast, the enhanced basal insulin release (2 mM glucose) from INS-1 cells cultured in
16.7 mM glucose plus T0901317 was reduced 25% (p < 0.001, N = 6) by etomoxir. In
LXR-activated cells cultured in 16.7 mM glucose, triacsin C reduced basal insulin release
by 38% (p < 0.001, N = 6) (Figure 3.6A). These data suggest that enhanced basal insulin
release from LXR-activated cells cultured in 16.7 mM glucose requires conversion of
FFA to LC-CoA and increased B-oxidation. Consistent with this possibility,
[14C]palmitate oxidation under basal glucose conditions (2 mM) was elevated ~3-fold in
INS-1 cells cultured for 48 h in T0901317 (Figure 3.6B). Although palmitate oxidation
was suppressed by elevated glucose (20 mM), [14C]palmitate oxidation remained
elevated ~3.5-fold in LXR-activated INS-l cells. Oxidation of [14C]palmitate in LXR-
activated cells was also inhibited ~65% by triacsin C and ~90% by etomoxir. Increased
FA oxidation in T0901317-cultured INS-1 cells correlated with increased mRNA levels
of genes involved in mitochondrial B-oxidation (Figure 3.6C) including CPT-1a,
camitine palmitoyl transferase-2 and long chain acyl CoA dehydrogenase, but not very

long chain acyl CoA dehydrogenase. These data strongly support the hypothesis that

78

LXR activation increases basal insulin release from INS-1 cells by a mechanism
involving increased B-oxidation of fatty acids.
3.7. Role of triacylglyceride turnover in elevated insulin secretion.

The relationship between enhanced insulin release and the turnover of TAG was
examined using the general lipase inhibitor orlistat. Treatment of INS-1 cells cultured in
4 mM glucose with orlistat (5-50 uM) increased basal insulin secretion (data not shown).
The mechanism accounting for the elevated basal insulin release is unknown, but may be
related to metabolic stress associated with low glucose and the inability to turnover lipid
pools. Consistent with this, orlistat (50 uM) had no effect on basal insulin release from
INS-1 cells initially cultured in 16.7 mM glucose 5: T0901317 (Figure 3.7A). Orlistat,
however, completely blocked insulin release in response to 20 mM glucose. These
results suggested that enhanced GSIS from LXR-activated INS-1 cells cultured in 16.7
mM glucose was associated with turnover of TAG. To examine TAG turnover, INS-l
cells were cultured in 16.7 mM glucose and T0901317 for 48 hrs, and during the last 6
hrs were labeled with [2-14C]acetic acid. After labeling, cells were subjected to
conditions mimicking an acute insulin release assay in the presence of orlistat and
turnover of labeled lipid was measured. Incubation of cells for 2 hrs in 2 mM glucose led
to an ~65% decrease in TAG and DAG labeling, and an ~50% decrease in FFA labeling
(Figure 3.7B). Treatment of cells for 1hr in 2 mM glucose followed by 1 hr in 20 mM
glucose tended to slow the turnover of TAG and DAG. Orlistat completely blocked the
turnover TAG and led to a precipitous fall in labeled F FA, possibly due to FA oxidation
of cellular FFA. Orlistat has also been shown to inhibit FAS (284), suggesting that

orlistat may block GSIS from LXR-activated INS-l cells by inhibiting de nova lipid

79

synthesis. To test this possibility, INS-1 cells cultured for 48 h in 16.7 mM glucose :1:
T0901317 were subjected to an acute insulin release assay in the presence of 2 or 20 mM
glucose containing [U-14C]glucose and incorporation of 14C into FA from methanol-
soluble lipids was determined. Incubation of control and LXR-activated cells for 1 h
with 20 mM glucose markedly increased 14C-labeled FA and this was further increased
by orlistat (Figure 3.7C), suggesting orlistat’s action on GSIS is independent of inhibition
of de nova lipogenesis. These data suggest that a byproduct of TAG turnover such as
DAG or FFA may participate in enhanced GSIS from LXR-activated INS—1 cells.

To investigate a potential role for DAG, acute insulin release studies were
performed in the presence of calphostin C, an inhibitor of protein kinase C (PKC) that
competitively interferes with DAG and phorbol ester binding. GSIS from LXR-activated
INS-1 cells was attenuated by calphostin C (1 uM) (Figure 3.8), but not by other PKC
inhibitors - GO6976 or GO6983 (data not shown). Because calphostin C and orlistat only
affected GSIS, the role for influx of calcium through the L-type voltage-gated calcium
channel (L-VGCC) was tested. The L-VGCC inhibitor verapamil (100 uM) completely

inhibited GSIS from LXR-activated INS-1 cells without affecting basal insulin release.

80

Figure 3.6. Elevated basal insulin release from LXR-activated INS-l cells
involves increased fatty acid oxidation. INS-l cells were incubated for 48 h in
16.7 mM glucose i T0901317 (10 uM). A. Insulin release (60 min) in response to 2
or 20 mM glucose was then assessed in the presence or absence of etomoxir (100
uM) or triacsin C (10 uM). Values are mean :h SEM for six independent
experiments. *, p < 0.001 when etomoxir- or triacsin C-treated cells are compared
to control cells. B. FA oxidation was determined by measuring [14C]C02
production from cells incubated for l h in 2 mM glucose followed by a l h
incubation with palmitic acid (50 uM), [14C]palmitic acid, and 2 or 20 mM glucose.
Data are mean :t SEM for 3 independent experiments. *, p < 0.01 when cells
cultured in 16.7 mM glucose plus T0901317 are compared to cells cultured in 16.7
mM glucose. #, p < 0.001 when triacsin C- or etomoxir-treated cells are compared
to cells cultured in 16.7 mM glucose plus T0901317. C. Total RNA was extracted
and mRNA levels for camitine palmitoyl transferase-let (CPTl), camitine palmitoyl
transferase-2 (CPT2), very long chain acyl CoA dehydrogenase (VLAD) and long
chain acyl CoA dehydrogenase (LCAD) were determined by real time RT-PCR.
Data are mean i SEM for 3 independent experiments. *, p < 0.02 when cells

cultured in 16.7 mM glucose are compared to cells cultured in 16.7 mM glucose plus

T0901317.

81

120-
110-l
100-
90-
80"
70-
60-I
50-
40'
30-
20-
10-

A

Insulin release (ng/mg/hr

 

O
l

 

 

 

 

1000-

Palmitate Oxidation (cpmlmglhr) w
m
o
O
o
I

 

0

Fold Response
‘r’

 

' 'k *
D2 mM Glucose -
-20 mM Glucose
Control TC Eto Control TC Eto
16.7 mM Gluc 16.7 mM Gluc + TO
B 2 mM Glucose
* - 20 mM Glucose

f"

 

 

 

 

 

#
#
Control Control Triac'sin C Etonitoxir
16.7 mM Gluc 16.7 mM Gluc + T0

D16] mM Glucose
* -16.7 mM Glucose + T0

CPT1 CPT2 VLAD

LCAD

82

Figure 3.7. TAG turnover is required for enhanced glucose-stimulated insulin
release from LXR-activated INS-l cells. A. Impact of orlistat on insulin release.
INS-1 cells were incubated for 48 h in 16.7 mM glucose :t T0901317 (10 pM).
Insulin release (60 min) in response to 2 or 20 mM glucose was then assessed in the
presence or absence of orlistat (50 uM). Values are mean :1: SEM for six
independent experiments. *, p < 0.001 when orlistat-treated cells are compared to
control cells. B. Impact of orlistat on turnover of de nova-derived TAG, DAG and
FFA. INS-l cells were cultured for 48 h in 16.7 mM glucose :1: T0901317 (10 pM).
During the last 6 h cells were incubated with [2-14C]-acetic acid (t=0), after which
cells were subjected to conditions for an acute insulin release study: 1 h incubation
in 2 mM glucose followed by an 1 h incubation in 2 or 20 mM glucose. Total lipids
were extracted and analyzed as described in Figure 3A. Values are mean i SEM for
3 independent experiments. Data are presented relative to 14C-labeling at t=0.
Phosphoimager intensity values at t=0 for TAG are 482,621 i 59,573, for DAG are
39,461 i 4,451 and for FFA are 37,267 :1: 3,691. C. Impact of orlistat (50 pM) on de
nova FA synthesis from glucose. INS-1 cells were incubated for 48 h in 16.7 mM
glucose :1: T0901317, and subjected to a insulin release assay with 2 or 20 mM
glucose containing 4 or 40 uCi of [U-14C]glucose, respectively. 14C-labeled FA
were quantified as described in the Experimental Procedures. Values are mean i
SEM of 3 independent experiments. *, p < 0.001 orlistat-treated cells are compared

to control cells.

83

Insulin release (ng/mglhr) >

Relative labeling

Total FA Counts/pg protein o

*

90- E2 mM Glucose
80' -20 mM Glucose
70- *
60-
50-
40-
30-
20-
10-

o-

 

 

 

 

Control Orli'stat Coritrol Orli'stat
16.7 mM Gluc 16.7 mM Gluc + T0
Et=0

-2 mM Glucose

520 mM Glucose
1_4- IIIIDZ mM Gluc + Orlistat
1.2_ -20 mM Gluc + Orlistat

 

W

   

TAG DAG1 ,2 FFA

1 0000-

8000-

E 2 mM Glucose
- 20 mM Glucose

6000-

4000-

2000-

 

 

0-
Veh Veh Orlistat

16.7 mM Gluc 16.7 mM Gluc + T0

84

3(-
3(-

 

 

 

 

 

1: 70'!
% E2 mM Glucose
g 60' -20 mM Glucose
g 50-
a) 40-
ll)
8 30-
E
‘- 20-
.E
3 10-
U)
E 0' l l I l
Control Verap Cal C Control Verap Cal C
16.7 mM Gluc 16.7 mM Gluc + T0

Figure 3.8. Enhanced glucose-stimulated insulin release from LXR-activated INS-1
cells is attenuated by verapamil or calphostin C. Insulin release (60 min) in response
to 2 or 20 mM glucose was then assessed in the presence or absence of verapamil (100
uM) or calphostin C (1 uM). Values are mean i SEM for six independent experiments.

*, p < 0.01 when verapamil- or calphostin C-treated cells are compared to control cells.

85

Discussion

Culturing INS-1 cells in elevated glucose led to increased nuclear SREBP-1c,
lipogenic gene expression, TAG synthesis, and loss of GSIS. These findings are
consistent with reports that SREBP-lo activation, either by elevated glucose or over-
expression, in B-cell lines or islets increased lipogenic gene expression, TAG synthesis
and decreased GSIS (114-116, 139, 235, 268, 269, 285). Compared to INS-l cells
cultured in elevated glucose, LXR-activated INS-1 cells had significantly elevated
microsomal and nuclear forms of SREBP-1c and lipogenic gene expression particularly
SREBP-1, FAS, SCD1 and SCD2. These findings are consistent with the role of LXR in
regulating SREBP-1 gene transcription, and LXR and SREBP-lo in regulating FAS,
SCD1 and SCD2 gene transcription (21, 286). Of the lipogenic genes examined only
ACCa mRNA levels were more strongly induced by elevated glucose than by LXR
activation. Glucose has been reported to bind and activate LXR (77), but this does not
appear to play a prominent role in INS-l cells because elevated glucose did not induce
expression of LXR target genes including ABCA1 and ABCGl. As expected, increased
lipogenic gene expression in LXR-activated INS-1 cells cultured in elevated glucose
markedly increased de nova neutral lipid synthesis. Because LXR activation only
affected lipid synthesis and insulin secretion in cells cultured in elevated glucose suggests
that the two events are linked. This is likely an adaptive effect because it has recently
been shown that metabolic flux through lipogenic pathways is not required for normal
GSIS (287, 288). Hypersecretion of insulin, however, has been shown to involve the
induction of SREBP-lo and enhanced lipid synthesis in mouse islets cultured in elevated

glucose (234).

86

Fatty acid D9 desaturases (SCD1 and SCD2) function as the rate-limiting step for
MUFA synthesis and play an integral role in neutral lipid (TAG and CE) synthesis (21).
In agreement with increased SCD1 and SCD2 mRNA levels, LXR-activated INS-1 cells
exhibited a 2-fold increase in de nova derived MUFA (16:1,n-7, 18:1,n-7, 18:1,n-9) and a
commensurate drop in synthesis of saturated FA (16:0, 18:0). The increase MUFA
synthesis in LXR-activated INS-1 cells cultured in elevated glucose corresponded with
increased MUFA mass (data not shown). Chronic exposure of islets and B-cell lines to
oleic (18:1,n-9) or vaccenic (18:1,n-7) acid have been reported to increase basal insulin
release (289-291), suggesting that increased MUFA synthesis in LXR-activated cells
might be directly involved in basal insulin release. To test this possibility, siRNA
targeting SCD1 and SCD2 were introduced into LXR-activated INS-1 cells. SCD1/2
siRNA effectively decreased SCD1 and SCD2 mRNA levels and MUFA synthesis, but
did not lower insulin release from LXR-activated INS-l cells. These data indicate that
increased de nova MUF A synthesis is not an obligatory step for enhanced insulin release
from LXR-activated INS-l cells, but likely facilitates neutral lipid synthesis.

Enhanced basal insulin release from LXR-activated INS-1 cells was attenuated by
triacsin C and etomoxir, indicating a role for increased acyl-CoA formation and FA
oxidation. Under our experimental paradigm for insulin release studies, INS-1 cells are
first preincubated for 1 hour in 2 mM glucose followed by incubation for 1 hour in either
2 or 20 mM glucose. During this timeframe, newly synthesized TAG is rapidly turned
over (Figure 3.7) and likely serves as the source of the F FA for acyl-CoA formation and
oxidation. INS-1 cells cultured in elevated glucose also have increased de novo

synthesized TAG, but do not have elevated basal insulin release. This suggests that INS-

87

1 cells cultured in elevated glucose either do not synthesize sufficient quantities of TAG
to sustain increased basal insulin release or that LXR activation stimulates additional
pathways associated with lipid metabolism. Consistent with the later, LXR activation
was shown here to increase FA oxidation and this correlated with increased expression of
genes involved in mitochondrial B-oxidation particularly CPT-lat. Recently, Colin et al.
showed that activation of LXR with synthetic agonists induced PPARCX and subsequently
its target CPT-l in the intestine, but not the liver (292). This suggests that LXR agonists
may also induce CPT-l through PPARa in B-cells. Alternatively, LXR-activation of
INS-1 cells may increase de nova synthesized FA to levels sufficient to induce CPT-lat.
This possibility is supported by the observation that long-term exposure of IN S-l cells to
long-chain FA increases CPT-1 gene expression and FA oxidation (290, 293). Our
findings also raise the possibility that LXR activation can protect the B-cell from glucose
toxicity by shuttling glucose toward FA, which can be oxidized immediately or after
release from TAG.

Lipolysis of intracellular TAG and the subsequent generation of lipid signaling
molecules including FFA, acyl-CoA and DAG have been proposed to mediate GSIS
(reviewed in (99)). TAG turnover produces a FFA and a predominantly less biologically
active sn2,3-DAG species, which can be further broken down to monoacylglyceride,
glycerol and FFA (294-296). These later products, along with de nova derived FA, can
be reincorporated into biologically active snl,2-DAG species through a glycerolipid/F F A
cycle (297). Based on this, we hypothesize that enhanced GSIS from LXR-activated
INS-1 cells results from elevated lipolysis and formation of lipid products that can

directly serve as signaling molecules (e.g. FFA) or used as substrates for the

88

glycerolipid/FFA cycle to generate snl,2-DAG. Consistent with this hypothesis, the ’
general lipase inhibitor orlistat blocked turnover of de nova derived TAG and GSIS in
LXR-activated INS-1 cells, but did not block de nova synthesis of FA (Figure 3.7).
Mulder et al. have also proposed that orlistat attenuates GSIS by blocking the formation
of an acylglyceride-coupling factor (164). If the glycerolipid/FFA cycle is involved in
enhanced GSIS from LXR-activated INS-1 cells, one would predict that inhibition of
acyl-CoA formation with triacsin C would have also blocked GSIS, which did not occur
(Figure 3.6). This might be due to the inability of triacsin C to inhibit all ACS isoforms
(298) and that triacsin C is more efficacious at inhibiting FA oxidation than lipid
synthesis in B-cells (299). It remains a possibility that enhanced GSIS from LXR-
activated INS-1 cells might also involve turnover of phospholipids and direct production
of snl,2-DAG (190). Polar lipid turnover, however, was much slower than TAG
turnover in INS-l cells and not effectively blocked by orlistat (data not shown).

DAG generated from the glycerol/FF A cycle might serve as the coupling factor to
enhance GSIS from LXR-activated IN S-l cells. Classic (at, [31, 011, y) and novel (5, e, r],
0) isoforms of PKC are activated by DAG in Ca2+-dependent and —independent manners,
respectively. Pharmacologic inhibition of many of these PKC isoforms with GO6976
(inhibits PKCa, [31) and GO6983 (inhibits PKCa, [3, y, 6, 1;), however, did not attenuate
GSIS from LXR-activated INS-1 cells (data not shown). Calphostin C, which
competitively blocks DAG-binding sites on classic and novel PKC isoforms, PKD
(PKCu) and DAG-binding proteins, significantly attenuated GSIS from LXR-activated
INS-1 cells (Figure 3.8). Blockade of the influx of extracellular Ca2+ with the L-VGCC

inhibitor also completely abrogated GSIS from LXR-activated INS-l cells. Taken as a

89

whole, these data suggest that enhanced GSIS from LXR-activated IN S-l cells does not
involve classic or novel PKC isoforms, but involves activation of a DAG-binding protein
that is calcium-dependent or mediates biochemical events upstream from the influx of
calcium. There are a number of families of DAG-binding proteins that could be involved
including PKD (PKCu), chimaerins, RasGRPs, MUNCl3s or DAG kinases (reviewed in
(154)). Further experimentation is necessary to determine the exact DAG-binding
protein(s) involved. Straub and Sharp have proposed a similar mechanism to explain
how FA depletion of rat islets caused large increases in GSIS (300). In their model, FA
depletion is proposed to cause lipid remodeling or increase breakdown of intracellular
TAG, which increases DAG production, activates a DAG-binding protein and augments
GSIS.

Enhanced insulin release from LXR-activated B-cells has been reported to be
associated with increased mRNA levels of de-l, insulin and GLUT2 (253) suggesting a
role for LXR or SREBP-1c in augmenting B-cell phenotype and glucose sensing.
SREBP-l is also required for elevated glucose to increase mRNA levels of de-l and
genes involved in glucose sensing including GLUT2 and glucokinase (234). Similar
changes in gene expression may play a role in enhanced insulin release from LXR-
activated INS-1 cells. Nevertheless, this seems unlikely because glucose utilization and
insulin content were not significantly increased in LXR-activated INS-1 cells.

In conclusion, our study shows that LXR activation of INS-1 B-cells exposed to
elevated glucose increases TAG synthesis; and subsequent TAG turnover can lead to the

production of lipid signaling molecules resulting in elevated insulin release. Similar

90

mechanisms may account for the ability of SREBP-1c to establish hypersecretion of

insulin in some models of hyperglycemia.

91

Chapter 4.
Stearoyl-CoA Desaturase Modulates Palmitate-Induced Endoplasmic

Reticulum Stress and Apoptosis in Pancreatic fi-Cells

Abstract

Chronic elevations in exogenous free fatty acids (FF As) have been implicated in
the pathogenesis of B-cell failure and the development of type 2 diabetes. The effects of
exogenous FF A, particularly saturated fatty acids (FAS), on B-cells include endoplasmic
reticulum (ER) stress and downstream induction of apoptosis. Regulation of
monounsaturated FA (MUFA) synthesis through altered FA desaturase and elongase gene
expression may serve to protect B-cells from exogenous saturated FAS. In the Zucker
diabetic fatty (ZDF) rat model of progressive [El-cell failure, islets from 6-week old pre-
diabetic ZDF rats showed a 1.5- to 2.3-fold induction in the stearoyl-CoA desaturases
(SCD) l and 2 mRNA, respectively, compared to control rats. At 13 weeks of age, ZDF
rats were hyperglycemic and exhibited decreased plasma insulin levels, an indicator of B-
cell dysfunction. This was associated with markedly decreased mRNA levels of insulin,
SCD1, SCD2 and Elovl-6, which elongates 16:0 to 18:0 and 16:1,n-7 to 18:1,n-7. These
findings suggested enhanced expression of SCD1/2 and other FA modifying genes may
protect B-cells from damage caused by exogenous saturated FAs. Next, siRNAs and
adenoviral constructs were used to investigate the role of altered SCD and Elovl-6
expression in IN S-l fi-cells exposed to exogenous palmitate. Knockdown of SCD gene
expression decreased conversion of palmitate to MUFA and increased the susceptibility

to palmitate-induced ER stress, as measured by splicing of Xbpl, induction of ATF 3 and

92

CHOP, and JNK phosphorylation. Palmitate-induced apoptosis was also increased by
SCD knockdown, as shown by elevated caspase-9 cleavage and DNA fragmentation.
Over-expression of SCD2 increased synthesis of n-7 MUFAs and markedly reduced the
ER stress and apoptosis induced by palmitate. Elovl-6 knockdown decreased palmitate
elongation and tended to reduce palmitate toxicity, whereas Elovl-6 over-expression
increased palmitate elongation to stearate (18:0) and increased susceptibility to palmitate-
induced JNK phosphorylation and apoptosis. In addition, elevated ER stress in INS-1
cells with decreased SCD expression involved reduced palmitate incorportation into TAG
and activation of Ca2+-dependent protein kinase Cs (PKCs). These findings demonstrate
that altered expression and activity of SCD2 and Elovl-6 modulate the susceptibility of B-

cells to the toxic effect of saturated F As.

Introduction

Type 2 diabetes arises from an inability of pancreatic B-cells to compensate for
insulin resistance in peripheral tissues. The progressive loss of B-cell compensation is
likely due to reduced insulin secretory capacity or B-cell mass (301-305). Elevated levels
of plasma non-esterified free fatty acid (FF A), a risk factor for insulin resistance and type
2 diabetes (201, 202), have been associated with the pathogenesis of B-cell dysfunction
(4, 203). The response of fi—cells to long-term elevations in fatty acids (FAs), however, is
largely dependent on the FA composition. Saturated FAS, such as palmitate (16:0), cause
diminished insulin secretion and insulin gene expression and the induction of apoptosis
through multiple processes, including generation of ceramides, reactive oxygen species,

and endoplasmic reticulum (ER) stress (223, 237, 306-308). Monounsaturated PAS

93

(MUFAs), such as palmioleate (16:1,n-7) and oleate (18:1,n-9), and the polyunsaturated
FA (PUFA) eicosapentaenoate (20:5,n-3) can protect B-cells from apoptosis and insulin
secretory defects induced by saturated FAs (236, 283, 308). In addition to exogenous FA
structure, evidence has demonstrated that the intracellularcapacity to modulate FA fate
has an important role in B-cells.

Alterations in FA metabolism critically affect the response of B-cells to
exogenous FAs, particularly the lipotoxicity of saturated FAs. Approaches used to
enhance FA oxidation and triacylglyceride (TAG) storage have demonstrated significant
alterations in the effects of exogenous saturated FAs on B-cell function (309-311).
Studies have also shown that regulation of FA structure may participate in modulating the
effects of FAS on B-cellsi Subpopulations of MIN-6 and rat B-cells identified to be
resistant to palmitate-induced apoptosis were associated with increased expression of the
FA delta-9 desaturase, stearoyl-CoA desaturase (SCD) 1, and hence increased conversion
of palmitate to MUFAs (6, 257). The level of SCD1 gene expression has also been
correlated with the susceptibility of B-cell lines and islets to ER stress in vitra and with
the severity of diabetes in viva in a mouse model of obesity (256, 312).

FA desaturase and elongase enzymes modify fatty acids by adding a cis-double
bond or two-carbons to a fatty acyl-CoA, respectively. These activities are essential for a
variety of cellular functions, including maintenance of membrane FA composition and
generation of signaling molecules. The desaturase subtypes in mammals include delta 5
desaturase (ASD), delta 6 desaturase (A6D), and SCD. Isoforms of SCD include four in
mouse (SCD1-4) (1 1-14), two in rat (SCD1 and 2) (15), three in hamster (SCD1—3) (16),

and three in human (SCD1, 2, and 5) (17-19). FA elongase (Elovl) subtypes range from

94

Elovl-l to 7 in mouse, rat, and human (www.cnsembl.org). Synthesis of PUFAs from
essential dietary FAs occurs through the desaturases A5D and A6D and the elongases
Elovl-2 and Elovl-5 (7, 31, 32). SCD, the rate-limiting enzyme in C16 and C18 MUFA
synthesis, and Elovl-6 synthesize the MUFAs oleate, palmitoleate, and vaccenate (18:1,n-
7) (20, 31). Elovl-5 can also elongate palmitoleate to vaccenate (32). Elovl-1, -3, and -4
elongate a broad array of very long chain FAs (>C20) and are involved in sphingolipid
synthesis, brown adipose and skin barrier function, and retinal degeneration, respectively
(25-30). Unique roles for these enzymes in pancreatic B-cells, however, remain to be
defined.

In this study, we first characterized FA desaturase and elongase gene expression
in rat islets and IN S-l B-cells. Next, using the Zucker diabetic fatty (ZDF) rat model, FA
desaturase and elongase genes were identified to be differentially expressed between pre—
diabetic and diabetic ZDF rat islets. Specifically, SCD1 and SCD2 were increased in pre-
diabetic islets and, along with Elovl-6, reduced in diabetic islets. Thus, we hypothesize
that regulation of genes required for MUFA synthesis may significantly affect B-cell
compensation and failure in the pathogenesis of T2D. The results demonstrate that
altered expression of SCD2 and Elovl-6 in INS-1 cells modulate the effects of exogenous
palmitate on ER stress and apoptosis. In addition, enhanced ER stress in the absence of
SCD1 and SCD2 expression may involve altered FA partitioning into neutral lipids and

activation of protein kinase C (PKC).

95

Results
4.1. Rat islet and INS-1 cell FA elongase and desaturase gene expression profiles.

To determine which FA elongase and desaturase genes are expressed in B-cells,
elongase and desaturase mRNA levels were characterized in rat islets and INS-l cells
under non-stimulatory glucose conditions. In rat islets and INS-1 B-cells, mRNA
expression was detected for the FA elongases Elovl-l, Elovl-2, Elovl-4, Elovl-5, Elovl-6
and Elovl-7, and the FA desaturases SCD1, SCD2, A5D and A6D (Figure 4.1A-D).
There was no difference between A5D and A6D mRNA levels in either rat islets or INS-1
cells. For SCD mRNA levels, however, the expression of SCD2 was greater than 4-fold
higher than SCD1 in both rat islets and INS-l cells. This suggests that SCD2 may have a
larger role in B-cells, whereas SCD1 is highly expressed in tissues with large lipid storage

capacities such as adipose and liver.

96

Figure 4.1. Fatty acid elongase and desaturase gene expression in rat islets and
INS-l cells. Total RNA was isolated from Sprague-Dawley rat islets (A and B) and
INS-l cells (C and D) and analyzed for Elovl-1 to 7, SCD1, SCD2, D5D, and D6D
mRNA expression by real-time RT-PCR. Gene expression is reported relative to

RPL32 and represents mean :t SEM for three independent experiments.

97

°-°5' Rat Islets

0.04-
- 0.03-1
0.02-

' 0.01-

Relative Expressron (mRNA) >

 

 

Elovl-1 Elovl-2 Elovl-3 Elovl-4 Elovl-5 Elovl-6 Elovl-7

0.077 Rat Islets

P

O

a:
I

0.05-
' 0.04-
0.03-
0.02-

0.01-

Relative Expressron (mRNA) w

 

0.00-

 

SCD1 SCD2 05D

Figure 4.1. Continued

C
All-04' INS-1 Cells

.0

0

w
I

0.02!

0.01-

 

Relative Expression (mRNA
0

Elovl-1 Elovl-2 Elovl-3 Elovl-4 Elovl-5 Elovl-6 Elovl-7

0-20' INS-1 Cells

9

.3

01
I

0.10-

0.05-

Relative Expression (mRNA) U

 

0.00-

SCD1 SCDZ

 

4.2. FA elongase and desaturase gene expression in ZDF rat islets.

Before 10 weeks of age ZDF rats are pre-diabetic, displaying obesity and insulin
resistance while maintaining normal glucose levels (313). Here, 6-week-old ZDF rat
blood glucose levels were normal and plasma insulin levels were elevated
(Supplementary Table 2), which coincided with increased islet insulin mRNA expression
(Figure 4.2A and B). ZDF islet expression of Elovl-5, SCD1, and A6D were modestly
increased from 1.4- to 1.6-fold compared to control rats at 6 weeks. Expression of SCD2,
however, was increased fitrther to 2.3-fold over control. After 13 weeks of age, ZDF rats
were hyperglycemic and both plasma insulin and insulin mRNA levels were diminished,
possibly indicating islet failure. Except for A5D and A6D, which decreased with age in
both control and ZDF rat islets, a large 60% decrease in expression was found for Elovl-6
and SCD2 in ZDF islets from 6 to 13 weeks. These results suggest the expression of
enzymes involved in monounsaturated fatty acid synthesis may have an important role in

islet function.

100

 

Table 4.1

Physiolggical parameters of 6 and 13 week old Control (fal?) and ZDF rats

 

 

 

Control (fa/?) ZDF (Leprfa/Crl)

6 week 13 week 6 week 13 week
Body weight (g) 173.8 330.4 179.3 353.5

+/- 9.0 +/- 5.8 , ** +/- 4.0 +/- 11.1 , **
Insulin (ng/ml) 2.0 3.6 9.2 2.6

+/- 0.3 +/- 1.1 +/- 1.4 , "‘ +/- 0.5 , **
Glucose (mg/d1) 83.0 80.6 117.0 316.7

+/- 3.5 +/— 4.0 +/- 5.0 , * +/- 25 , * , *"‘

 

Data are mean +/- SEM. Glucose values are fed blood glucose. *, p < 0.006
compared to Zucker control age matched. **, p < 0.008 compared to 6 week old with
same phenotype.

101

 

 

Figurt
ll W
in
in?)

nll\'

MCI

Figure 4.2. Differential expression of fatty acid elongase and desaturase genes
in pre-diabetic and diabetic ZDF rat islets. A and B. Total RNA was isolated
from control (fa/1’) and ZDF (Leprfa/Crl) rat islets at 6 and 13 weeks of age and
analyzed for insulin, Elovl-2, Elovl-5, Elovl-6, SCD1, SCD2, D5D, and D6D
mRNA expression by real-time RT-PCR. Data are reported relative to cyclophilin
and represent mean i SEM for five or six animals per group. *, p < 0.04 and #, p <
0.03 when compared to 6 week control and ZDF islets, respectively. **, p < 0.04

when compared to 13 week control islets.

102

>

 

 

E 6 week

 

 

 

 

1000- 0.014
A -13 week i
<
0.012-
E 800- *
E 0.0104 *
8 *
'13 60°" 0.008-
aa *
a
X 400- 0.006' **
”J #
d)
3 ,,,. 0.004-
5 200- #
<0 0.002- # **
05 **
I 0-
Control ZDF Control ZDF Control ZDF Control ZDF
Insulin Elovl-2 Elovl-5 Elovl-6
0.06-
*
A 0.05-
g I
g 0.04- *
S
g 0.03-
2 #
g- 0.02-
m *
113
.g 0.01- * # #
2 # * ** *7:
d)
I! 0.00- -
Control ZDF Control ZDF Control ZDF Control ZDF

 

SCDl

SCD2 D5D DGD

4.3. Knockdown of SCD and Elovl-6 gene expression modulate MUFA synthesis.

To determine if SCD and Elovl-6 expression alter FA metabolism in B-cells,
siRNAs were introduced into INS-l cells and examined for effects on palmitate
metabolism. In cells cultured for 36 hrs in INS-l media, SCD siRNA effectively reduced
both SCD1 and SCD2 mRNA levels compared to control (siCTL), but resulted in
increased Elovl-6 mRNA (Figure 4.3A). Elovl-6 siRNA reduced Elovl-6 mRNA but did
not affect SCD1 or SCD2. As a control, neither SCD nor Elovl-6 siRNAs affected Elovl-
5 mRNA levels. Effects of siRNAs on FA metabolism were determined by culturing
INS-l cells for 12 hrs in 400 uM palmitate plus [1-14C]palmitic acid. Total lipids were
extracted, saponified, and the FA profile analyzed by reverse-phase HPLC. In IN S-l
cells with control siRNA, 14C-labeled palmitate was distributed by 83.9, 6.7, 6.4, 1.0,
and 1.9% into palmitic acid (16:0), stearatic acid (18:0), palmitoleic acid (16:1,n-7),
vaccenic acid (18:1,n-7), and oleic acid (18:1,n-9), respectively (Figure 4.3B). SCD
siRNA significantly reduced the ability to convert palmitate into MUFA, as the fractional
distribution of 14C-labeled 16:1,n-7, 18:1,n-7, and 18:1,n-9 decreased between 66 and
97%. This resulted in increased accumulation of 14C-labeled palmitic acid and the ratio
of saturated FAs to MUFAs (data not shown). Elovl-6 siRN A caused a marked decrease
in palmitate elongation, as shown by an approximate 50% reduction in the fractional
distribution of 14C-labeled 18:0 and 18:1,n-9. This led to a 1.5-fold increase in labeled
16:1,n-7. These results show that knockdown of SCDs or Elovl-6 effectively decreases

the respective desaturation and elongation of palmitate and alters MUF A synthesis.

104

Figure 4.3. Modulation of SCD and Elovl-6 gene expression alters synthesis of
specific MUFAs species derived from exogenous palmitate. A. Effect of SCD2
and Elovl-6 siRNAs an mRNA levels. INS—1 cells were electroporated with siRNAs
for control (siCTL), SCD (siSCD) or Elovl-6 (siElovl-6) and cultured for 36 hrs in
INS-1 media. Levels for Elovl-5, Elovl-6, SCD1 and SCD2 mRNA were
normalized to RPL32 mRNA and reported as fold expression relative to siCTL
.treated cells. Data are mean :1: SEM for three independent experiments. *, p < 0.02
when compared to siCTL cells. B. Effect of SCD and Elovl-6 siRNAs on
conversion of exogenous palmitate to MUFA. INS-1 cells electroporated with
siRNAs for siCTL, siSCD, or siElovl-6 were treated with INS-l media containing
400 uM palmitate and [1-14C]-palmitic acid for 12 hrs. Total lipids were extracted,
saponified, and incorporation of 14C into FAs was determined by reverse-phase
HPLC. Data represent the percent of labeled FA. Values are the mean 3: SEM for

three independent experiments.

105

Fold Response

EElovl-S
25., -Elovl-6
ESCD1
2.0_ -SCD2

*

0.5-

 

0.0-

110-

.3

O

O
l

(O
O
l

 

Percent Palmitate Incorporation
01
?

siCTL

   
     

  

/////}}////1

/

'.' L

-18:1n9
—‘ mwnm
-16:1n7
E18zo
-16:0

siSCD siElovl-6

106

4.4. Susceptibility to palmitate-induced ER stress is increased by SCD knockdown.

Loss of B-cell function upon exposure to exogenous FFAs, particularly saturated
FAs, involves activation of the ER stress response pathways inositol requiring ER to
nucleus signal kinase (IRE)1, PKR-like ER kinase (PERK), and, to a lesser extent,
activating transcription factor (ATF)6 (204). In ZDF islets, the response to exogenous
FFAs could be affected by altered SCD and Elovl-6 gene expression, described in Figure
4.2. To test whether reduced SCD or Elovl-6 expression affects the [El-cell response to
exogenous FFAs, INS-1 cells treated siRNAs were cultured for 9 hrs with 0, 200, or 400
uM palmitate and examined for the induction of ER stress. In control cells, only 400 uM
palmitate induced a 2.3- to 4-fold increase in splicing of X-box binding protein 1 (Xbpls)
and mRNA levels of ATF3 and CHOP, markers of IREl and PERK activation,
respectively (Figure 4.4A). Palmitate induction of CHOP mRNA levels corresponded
with a 5.5-fold increase in CHOP protein (Figure 4.4B). In IN S-l cells treated with 200
MM palmitate, decreased SCD expression significantly increased the sensitivity to Xbpl
splicing and induction of ATF3 and CHOP mRNA by approximately 2-fold. Compared
to control cells, induction of ATF3 mRNA, CHOP mRNA, and CHOP protein by 400
pM palmitate was increased further by SCD siRNA. In contrast, decreased Elovl-6
expression tended to reduce Xbpl splicing and CHOP protein levels induced by palmitate
at 400 uM, but it was not significant.

IREl also mediates phosphorylation of Jun N-terminal kinase (JNK) (245), which
can lead to enhanced CHOP expression and apoptosis (204). In B-cells treated with
F FAs, INK was phosphorylated prior to the induction of CHOP expression (314). INS-l

cells treated for 6 hrs with 400 uM palmitate displayed increased JNK phosphorylation,

107

and this was markedly increased 2-fold by decreased SCD expression (Figure 4.4C).
These findings demonstrate that susceptibility to palmitate-induced ER stress is enhanced
in [ii-cells with a reduced capacity to synthesize MUFAs.

4.5. SCD knockdown impacts susceptibility to palmitate-induced apoptosis.

INS-1 cells with decreased SCD and Elovl-6 expression were then examined to
determine whether early changes in sensitivity to ER stress correlated with the induction
of apoptosis. In response to increasing concentrations of palmitate, control cells treated
for 24 hrs with 300 and 400 uM palmitate had increased caspase-9 cleavage and DNA
fragmentation, markers of apoptosis (Figure 4.5A and B). The susceptibility to both
caspase-9 cleavage and DNA fragmentation in cells with decreased SCD expression were
significantly increased at 200 uM palmitate. Compared to control cells, the induction of
apoptosis was further increased at 300 and 400 uM palmitate by SCD knockdown,
whereas knockdown of Elovl-6 did not affect either apoptotic marker. Thus, this data
confirms a recent report that palmitate induced lipotoxicity is increased by simultaneous

knockdown of both SCD1 and SCD2 (257).

108

Figure 4.4. Sensitivity to palmitate-induced ER stress is increased by SCD
knockdown. INS-1 cells electroporated with siRNAs for control (siCTL, C), SCD
(siSCD, S), or Elovl-6 (siElovl-6, B) were treated for 9 hrs with modified INS-l
media containing increasing palmitate concentrations. A. Effect of knockdown of
SCD and Elovl-6 on levels of spliced Xbpl (Xbpls), Xbpl total (Xbplt), ATF3 and
CHOP mRNA. Data are mean i SEM for three independent experiments and are
expressed relative to siCTL cells. * and #, p < 0.02 when compared to 0 uM siCTL
cells and siCTL cells at the same palmitate concentration, respectively. B. Effect of
SCD or Elovl-6 siRNA on CHOP protein levels. Whole cell protein extracts were
fractionated by SDS-PAGE and CHOP protein was analyzed by Western blotting.
Data are mean :2 SEM for four independent experiments. * and #, p < 0.03 when
compared to 0 pM siCTL cells and siCTL cells at 400 uM palmitate, respectively.
C. Effect of SCD and Elovl-6 siRNA on JNK phosphorylation. INS-1 cells
electroporated with siRNAs for control (siCTL, C), SCD (siSCD, S) or Elovl-6
(siElovl-6, E) were treated for 6 hrs without or with 400 uM palmitate.
Phosphorylated and total JNK (pJNK and JNKt) were analyzed by Western blotting.
Data are mean d: SEM for three independent experiments. * and #, p < 0.03 when

compared to 0 uM siCTL cells and siCTL cells at 400 uM palmitate, respectively.

109

A 4' EsiCTL

A * -siSCD
E 3. * -siElovl-6
‘5 \‘
o x
U \
2 2. §
a s
< x
z 1. \
0! \
E x
x
.\

 

   

0-
16:0 (11M): o 200 400 o 200 400

 

Xbp1s Xbp1t
10' :lsicrL
_siSCD
8' # .siElovl-G

 

l/I/I/I/I/I/I/A =31:

 

 

110

Figure 4.4. Continued

 

 

3 16:0 (um: o 200 400
c s E c s E c s E
CHOPl —-

 

 

Actin l—-—'—--————l

 

18- .
ESICTL #

-siSCD
14' -siElovl-6

.3
a)
I

_l A
O N
I I

h a:
I I

2-

 

CHOP Protein (Fold Control)
CO

0
16:0 (uM :

 

 

 

 

 

 

C 16:0(uM): o 400
s E c s E
pJNKl - ~ 2 l
JNK: |.—. :::: 7:: ---
35- |:|sicrL
-siSCD
€30“ -siElovl-6 #
*5 25-
0 20..

pJNK (Fold
e a

0|
I

 

 

111

Figure 4.5. Suceptibility to palmitate-induced apoptosis is increased by SCD
knockdown. IN S-l cells electroporated with siRNAs for control (siCTL, C), SCD
(siSCD, S), or Elovl-6 (siElovl-6, B) were treated for 24 hrs with increasing
palmitate concentrations. A. Effect of SCD and Elovl-6 siRNA on caspase-9
cleavage. Cleaved caspase-9 proteins were analyzed by Western blotting. Results
shown are representative of six independent experiments. B. Effect of SCD and
Elovl-6 siRNA on DNA fragmentation as determined by ELISA. Data represent
fold induction and are mean :1: SEM for six independent experiments. *, p < 0.02
when compared to 0 pM Luc. #, p < 0.04 when compared to siCTL at the same

palmitate concentration.

112

 

16:0 (11M): 0 200 300 400

 

 

 

 

 

 

 

 

 

 

Cleaved 38kDa "
Caspase-Q 17kDa __. __.......—
Actinl ‘-—--—-——~—_____.._._]
16:0 (pm: 0 200 300 400
C E C E C E C E
Cleaved 38kDa
Caspase-9 17kDa __

 

Actin I———-——-————-—-~———J

25 :lsicrL #

: -siSCD
.2 E 2° -siElovl-6
3i .9
= *5
d)
E 3
U) C
N _
LT. E

O
:1, e
D

 

 

0
16:0 (11M): 0 200 300 400

113

4.6. Over-expression of SCD2 and Elovl-6 differentially modulate MUFA synthesis
and markers of ER stress.

Naturally occurring elevated expression of SCD1 and SCD2 in rat islets and [3-
cells coincides with reduced palmitate-mediated lipotoxicity, presumably due to SCD1
activity (6, 238). In rat islets and B-cells, however, the SCD2 isoform is expressed much
higher than SCD1 (Figure 4.1 and 4.2) (257). To test whether enhanced SCD2 and Elovl-
6 gene expression alone affect B-cell FA metabolism and ER stress, adenoviral constructs
were used to over-express the respective genes in INS-1 cells treated with palmitate. In
cells over-expressing luciferase (Luc) and cultured for 12 hrs in 400 uM palmitate plus
[1-14C]palmitic acid, 14C-labeled palmitate was distributed by 71.5, 10.6, 10, 2.5, and
5.3% into palmitic acid (16:0), stearic acid (18:0), palmitoleic acid (16:1,n-7), vaccenic
acid (18:1,n-7), and oleic acid (18:1,n-9), respectively (Figure 4.6A). Over-expression of
SCD2 significantly increased palmitate conversion to MUFAs, as the fractional
distribution of 14C-labeled 16:1,n-7 and 18:1,n-7 was increased 1.3- and 2.1-fold,
respectively. This resulted in a marked increase in the accumulation of n-7 rather than n-
9 MUFAs (data not shown). Elovl-6 over-expression, however, significantly increased
palmitate elongation products, as the distribution of 14C-labeled 18:0 and 18:1,n-9 were
increased 2.3- and 1.8-fold, respectively. These results demonstrate that in [fl-cells over-
expression of SCD2 preferentially drives synthesis of n-7 MUFAs, whereas over-
expression of Elovl-6 drives synthesis of stearate (18:0) and oleate (18:1,n-9).

Next, IN S-l cells over-expressing either SCD2 or Elovl-6 were treated with 400
uM palmitate and examined for activation of ER stress. In contrast to SCD knockdown,

over-expression of SCD2 resulted in a marked 56% reduction in CHOP protein levels

114

after 9 hrs of palmitate treatment compared to control cells (Figure 4.68). Palmitate—
induced JNK phosphorylation at 6 hrs was also reduced 40% by SCD2 over-expression
(Figure 4.6C). Although Elovl-6 over-expression did not alter CHOP protein, it resulted
in a significant 1.6-fold increase in JNK phosphorylation in palmitate treated cells
compared to control cells. Together, this shows that enhanced SCD2-mediated synthesis
of n-7‘ MUFAs protects from ER stress induced by exogenous palmitate, whereas ER
stress is potentiated by enhanced Elovl-6 expression.
4.7. Effects of SCD2 and Elovl-6 over-expression on palmitate-induced apoptosis.
INS-l cells with elevated SCD2 and Elovl-6 gene expression were then treated for
24 hrs with increasing concentrations of palmitate and monitored for apoptosis. Control
cells over-expressing luciferase exhibited significant capase-9 cleavage at 400 uM
palmitate and a dose-dependent increase in DNA fragmentation at 200, 300, and 400 uM
palmitate (Figure 4.7A and B). Over-expression of SCD2 showed a marked reduction in
cleaved caspase-9 and a 30-60% decrease in DNA fragmentation at each FA
concentration tested compared to control cells. Elovl-6 over-expression increased both
apoptotic markers at intermediate levels of palmitate but not at the 400 uM level. These
results provide the first direct evidence that enhanced SCD2 and Elovl-6 expression

modulate lipotoxicity in B-cells.

115

Figure 4.6. SCD2 and Elovl-6 over-expression on MUFA synthesis and
palmitate-induced ER stress. A. Effect of SCD2 and Elovl-6 over-expression on
MUFA synthesis. INS-1 cells treated with Ad-CMV-Luciferase (Luc), Ad—CMV-
SCD2 (SCD2), or Ad-CMV-Elovl-6 (Elovl-6) were treated with INS-1 media
containing 400 uM palmitate and [l-l4C]-palmitic acid for 12 hrs. Total lipids were
extracted, saponified, and incorporation of 14C into F As was determined by reverse-
phase HPLC. Values are the mean 3: SEM for three independent experiments. B.
Effect of SCD2 and Elovl-6 over-expression on CHOP protein levels. INS-l cells
treated with Ad-CMV-Luciferase (Luc, L), Ad-CMV-SCDZ (SCD2, S) or Ad-CMV-
Elovl-6 (Elovl-6, B) were treated for 9 hrs with INS-l media containing increasing
palmitate concentrations, after which CHOP protein was analyzed by Western
blotting. Data are mean :t SEM for six independent experiments. * and #, p < 0.02
when compared to control (Luc) cells treated with 0 or 400 uM palmitate,
respectively. C. Effect of SCD2 and Elovl-6 over-expression on JNK
phosphorylation. INS-1 cells treated with Ad-CMV-Luciferase (Luc, L), Ad-CMV-
SCD2 (SCD2, S) or Ad-CMV-Elovl-6 (Elovl-6, E) were treated for 6 hrs without or
with 400 uM palmitate. Phosphorylated and total JNK (pJNK and JNKt) were
analyzed by Western blotting. Data are mean i SEM for three independent
experiments. * and #, p < 0.03 when compared to control (Luc) cells treated with 0

or 400 uM palmitate, respectively.

116

 

     

 

 

 

 

 

C
'3 100‘ .\\\\\
g 90. iiiiiiiiiiiiiiiiiii :§:§:5: Etta-1821119
g ao-l mwnnr
E 70' -16:1n7
60-
g 50_ Emma
g 40- -16:0
(U
9:. 30-
§ 20-
; 10-
a. 0_
Luc SCD2 Elovl-6
B 16:0(uM): o 400
L S E L S E
CHOP [ -- -—1
25' ELuc
-SCD2

N
O

- Elovl-6 *

    

_I
U!
I

.L
O
I

0|
I

 

CHOP Protein (Fold Control)

0-
16:0 (pM): 0 400

117

Figure 4.6. Continued

C 16:0 (M): o 400 o 400

Marl—"9‘1 FLLLh

JNK! :7r5—l [é-‘TIZZ'I

 

 

 

8" ELUC 8' ELuc
"9‘ 7' -SCD2 7- -Elovl-6
*5 6- 6- #
o *

o 5' 5-
E 4' 4' *
o
E; 3|! # 3-
x - I
z 2 2
31- 1-
0-

0-
16:0(uM): o 400 o 400

118

Figure 4.7. SCD2 and Elovl-6 over-expression on palmitate-induced apoptosis.
INS-1 cells treated with Ad-CMV-Luciferase (Luc, L), Ad-CMV-SCD2 (SCD2, S)
or Ad-CMV—Elovl-6 (Elovl-6, E) were treated for 24 hrs with increasing palmitate
concentrations. A. Effect of SCD2 and Elovl-6 over-expression on caspase-9
cleavage. Cleaved caspase-9 proteins were analyzed by Western blotting. Results
shown are representative of six independent experiments. B. Effect of SCD2 and
Elovl-6 over-expression on DNA fragmentation as determined by ELISA. Data
represent fold induction and are mean d: SEM for six independent experiments. *, p
< 0.03 when compared to 0 uM Luc. #, p < 0.03 and 5, p < 0.05, when compared to

Luc at the same palmitate concentration.

119

A

 

 

 

 

 

 

 

16:0 (uM): 0 200 300 400
L S L S L S L S
Cleaved 33"“ _.
Caspase-9 17kDa __’
Actin [
16:0 (M): 0 200 300 400

L E L E L E L E

 

Cleaved 38kDa
Caspase-9 17kDa ,

 

 

 

 

 

Actin I ——

20-
B ELuc
: -SCD2
.g E‘ 15- -Elovl-6 *
.‘E .2
c H
E g 0 #
mg 10"
E —
. a
‘2‘ L‘- 5-
D

  

 

 

0-
16:0(uM): o 200 300 400

120

4.8. Elevated CHOP expression by SCD knockdown coincides with increased
diacylglycerol formation and involves Ca2+-dependent PKC activation.

Palmitate-induced lipotoxicity has been proposed to involve reduced
incorporation into TAG and cholesterol ester (CE) compared with MUFAs (6, 315). To
determine if modulation of palmitate toxicity in INS-1 cells involved changes in neutral
lipid synthesis, cells treated for 12 hrs with 400 uM palmitate plus [1-14C]palmitic acid
were analyzed for 14C-labeled palmitate incorporation into complex lipids. Compared to
control cells, INS-1 cells treated with SCD siRNA had a 25% reduction in palmitate
incorporation into TAG, resulting in a significant 2.4-fold increased accumulation of
DAG (Figure 4.8A). In cells over-expressing SCD2 complex lipid synthesis was not
significantly altered (data not shown), suggesting protection from palmitate toxicity by
enhanced SCD2 expression may not involve changes in neutral lipid synthesis. Elovl-6
siRNA did not affect TAG levels but reduced DAG levels by 23%, whereas complex
lipid synthesis was not affected by over-expression of Elovl-6 (data not shown).

ER stress mediated by exogenous palmitate has been associated with release of
ER Ca2+ into the cytoplasm (222). The combination of increased ER Ca2+ release with
accumulation of DAG could cause B-cell dysfunction through sustained Ca2+-dependent
protein kinase C (PKC) activation. To test this possibility, INS-1 cells treated with
control or SCD siRNA were treated for 9 hrs with 400 uM palmitate and without or with
the Ca2+-dependent PKC inhibitor G66976. In SCD knockdown cells, inhibition of
Ca2+-dependent PKCs resulted in a significant 41% reduction of CHOP protein levels

(Figure 4.88). Taken together, increased susceptibility to palmitate-induced B-cell

121

 

dysfunction by SCD knockdown involves increased DAG accumulation and PKC

activation.

122

Figure 4.8. Effect of SCD knockdown on palmitate-induced ER stress involves
diacylglycerol accumulation and activation of Ca2+-dependent PKCs. A. INS-1
cells electroporated with siRNAs for control (siCTL), SCD (siSCD), or Elovl-6
(siElovl-6) were treated with modified INS-l media containing 400 uM palmitate
and [l-l4C]-palmitic acid for 12 hrs. Total lipids were extracted, fractionated by
TLC and 14C-labeled palmitate incorporation into complex lipids was determined
by densitometry. Data represent fold change and are mean i SEM for three
independent experiments. *, p <0.01 when compared to siCTL. B. INS-1 cells
electroporated with siRNAs for control (siCTL, C) or SCD (siSCD, S) were treated
for 9 hrs with 400 uM palmitate and without or with 1 uM G66976. Whole cell
protein extracts were fractionated by SDS-PAGE and CHOP protein was analyzed
by Western blotting. Data are mean i SEM for three independent experiments. *, p

< 0.02 when compared to siCTL cells.

123

>

     

 

 

2_5. * ESiCTL
c V -siSCD
% ’5 2_o. § -siElovl-6
2: Q
g E 1.0- \
:2 2 * §
:8“ Er 0.5! § §

   

TAG DAG 1,2 FFA CE

Vehicle 666976
16: 0 (pm: 0 400 400

cscoscs
CHOPI —]

ActinI-——v—-—~—-—-——-]

 

 

 

 

50] |:|siCTL
|||ysco

N w A

c o o

l l I
3(-

HOP Protein (Fold Control)
8

 

U 0-
16:0 (uM): 0 400 0 400
Vehicle 666976

124

 

Discussion

Chronic elevations in F F As are associated with loss of fi-cell function and the risk
of developing type 2 diabetes (4, 203). Modulation of intracellular FA metabolism in [3-
cells is essential for preventing the toxic effects of F F As and maintaining proper function.
This study examined whether alterations in FA desaturase and elongase gene expression
contribute to B-cell compensation and failure in response to lipotoxicity. Rat islets and
INS-1 B-cells were found to express the desaturases SCD1, SCD2, ASD, and A6D, and
the elongases Elovl-1, Elovl-2, and Elovls-4 to -7. In contrast to liver and adipose tissue,
SCD2 is the predominant SCD isoform expressed in rat islets and B-cells (Fig 1) (257),
and to date, the importance of SCD2 in B—cell MUFA synthesis has not been addressed.
In addition, altered expression of SCDs and Elovl-6 in pre-diabetic and diabetic ZDF rat
islets emphasizes that the capacity to synthesize MUFAs could significantly affect
function, including the susceptibility of B-cells to lipotoxicity.

ZDF rats exhibit gradually increased plasma FFAs levels prior to the onset of
overt diabetes (313). Thus, alterations in B-cell FA metabolism likely affect the response
of ZDF islets to exogenous FFAs. Pre-diabetic ZDF rats at 6 weeks of age maintained
euglycemia but were hyperinsulinemic, which correlated with increased islet insulin gene
expression. Islets from pre-diabetic ZDF rats expressed significantly higher levels of
SCD1, A6D, Elovl-S, and particularly SCD2, than control rats. This is consistent with
studies showing elevated expression of SCD1, A6D, and Elovl-5 in livers of ZDF rats,
Zucker fatty rats, and insulin resistant ob/ob mice (316-318). Increased Elovl-5
expression may serve as a negative feedback mechanism due to the ability of PUF As to

inhibit transcriptional activity of the sterol regulatory element binding protein-lo, a

125

regulator of lipogenesis (319, 320). More importantly, increased SCD gene expression in
pre-diabetic ZDF rat islets may have a protective role by increasing the conversion of
lipotoxic saturated FAs into MUFAs as observed in Zucker fatty rat islets (257). SCD
and A6D gene expression is induced by insulin in liver (318, 321). Thus, elevated plasma
insulin levels in ZDF pre-diabetic rats and Zucker fatty rats likely contribute to increased
islet desaturase gene expression (Fig. 2) (257). As both control and ZDF rat islets aged,
ASD and A6D gene expression decreased significantly, consistent with decreased PUFA
desaturase activity found during aging in other tissues (322, 323). Hyperglycemic,
diabetic ZDF rats at 13 weeks had decreased plasma insulin levels that coincided with
reduced islet insulin gene expression, indicating islet failure. These islets also had
reduced expression of SCD1, SCD2, and Elovl-6. Decreased SCD expression could be a
result of islet failure due to reduced plasma insulin levels and a lack of islet insulin
signaling. Loss of SCD expression and activity could contribute to islet failure due to
increased accumulation of saturated FAS. Reduced Elovl-6 expression may have a
protective role by decreasing elongation of palmitate to stearate and allowing it to be
immediately desaturated to palmitoleate, a less lipotoxic FA.

Altered SCD and Elovl-6 gene expression in pre-diabetic and diabetic ZDF rat
islets raised the possibility that changes in MUFA synthesis may modulate B-cell
function. To examine the roles of SCDs and Elovl-6 in B-cells, these genes were
knocked down and over-expressed in INS-1 cells and subsequently treated with elevated
levels of palmitate. SCDs primarily desaturate the saturated FAs palmitate (16:0) and
stearate (18:0). Reduced SCD1 and SCD2 expression in INS-1 cells exposed to

exogenous palmitate significantly decreased total MUFA synthesis and increased the

126

ratio of saturated FA to MUFAs. Over-expression of SCD2, however, selectively
increased n-7 MUFAs palmitoleate (16:1,n-7) and vaccenate (18:1,n-7), not oleate
(18:1,n—9). This is at odds with increased oleate in cells over-expressing SCD1 (315),
and raises the possibility that SCD2 preferentially desaturates palmitate over stearate.
Elovl-6 elongates both palmitate and palmitoleate. Reduced Elovl-6 expression in INS-1
cells decreased palmitate elongation and increased palmitoleate accumulation. Over-
expression of Elovl-6 strongly drove elongation of palmitate but not palmitoleate,
resulting in enhanced synthesis of stearate and oleate. Taken together, conversion of
exogenous palmitate into specific MUFAs, n-7 or n-9, in INS-1 cells is dependent on the
level of expression and activity of SCD2 and Elovl-6.

ER stress results in activation of the unfolded protein response pathways IREl,
PERK and ATF6 (204). IRE] induces genes important for ER expansion and reducing
protein load by splicing and, in turn, activating the transcriptional activator Xbpl (206).
PERK phosphorylates eukaryotic translation initiation factor 2a (eIF20t) to inhibit
general protein translation while enhancing others such as ATF4 (244). Sustained
PERK-ATF4 activation induces the pro-apoptotic genes ATF3 and CHOP (244, 324).
Active ATF6 induces ER protein chaperones to aid in protein folding (219). In B-cells,
exogenous saturated F As largely activate the IRE] and PERK pathways, increasing Xbpl
splicing, eIF2a phosphorylation, ATF4 protein, and mRNA and protein levels of ATP 3
and CHOP (222, 223). Here, IN S-l cells treated with palmitate exhibited increased Xbpl
splicing, ATP 3 and CHOP mRNAs, and CHOP protein. Decreased SCD gene expression
significantly increased the sensitivity to palmitate induction of each of these ER stress

markers, whereas decreased Elovl-6 tended to reduce Xbpl splicing and CHOP protein.

127

Over-expression of SCD2 reduced palmitate induction of CHOP protein, demonstrating
for the first time that SCD2 can modulate ER stress. Liver X receptor (LXR)-activated [3-
cells display increased SCD1/2 gene expression and protection from lipotoxicity (257,
325). LXR activation, however, did not alter ER stress, suggesting other mechanisms
were involved (257). CHOP is also mediated through IRE] activation of the cJun/cFos
pathway by phosphorylation of JNK (204). INS-1 cells exposed to elevated palmitate
had increased JNK phosphorylation, and this was significantly enhanced and reduced by
knockdown and over-expression of SCDs, respectively. Decreased Elovl-6 expression
tended to lower JNK phosphorylation by elevated palmitate, whereas over-expression of
Elovl-6 increased palmitate-induced JNK phosphorylation. Thus, altered stearate
production could affect ER stress. Overall, these findings directly demonstrate that
enhanced MUFA synthesis, particularly through SCD2, reduces the susceptibility to
palmitate-induced ER stress.

Accumulation of endogenous palmitate causes the release of ER Ca2+ stores,
which could activate the intrinsic apoptosis pathway (204, 222). Increased ER stress in
INS-1 cells with decreased SCD expression coincided with increased sensitivity to
palmitate-induced caspase-9 cleavage and DNA fragmentation, hallmarks of apoptosis.
This confirms that SCD knockdown increases susceptibility to B-cell dysfunction (256,
257). Consistent with a role of SCD to protect B-cells from palmitate-induced ER stress,
SCD2 over-expression significantly reduced both markers of apoptosis. Decreased
Elovl-6 expression did not significantly affect palmitate-induced apoptosis, whereas it
was increased by over-expression of Elovl-6. The minimal effect of reduced Elovl-6 on

ER stress and apoptosis could be due to the absence of a simultaneous increase in SCD

128

gene expression. Thus, Elovl-6 knockdown increases palmitoleate synthesis, but SCD2
over-expression drives it further and additionally increases total MUFA synthesis.

Protection from lipotoxicity in cells with elevated expression of SCD] has been
proposed to involve enhanced palmitate incorporation into neutral lipids (6, 315).
Surprisingly, SCD2 over-expression did not enhance storage of exogenous palmitate into
TAG or cholesterol ester (data not shown). This absence of an effect of SCD2 on neutral
lipid synthesis could be due to enhanced glycerolipid/FA cycling or FA oxidation, thus
the role of SCD2 in neutral lipid synthesis is under investigation. INS—1 cells with
decreased SCD1 and SCD2 expression had lower palmitate incorporation into TAG and
CE but a buildup of DAG, consistent with SCD1 involvement in TAG and CE synthesis
(21, 315). Palmitoyl-CoA has been shown to activate PKCs (Corkey 2000).
Accumulation of DAG and palmitoyl-CoA combined with release of ER Ca2+ could
cause sustained activation of Ca2+-dependent PKCs, which may result in increased B-cell
dysfunction such as ER stress. In support of this possibility, treatment with the Ca2+-
dependent PKC inhibitor G66976 reduced the effect of palmitate on CHOP protein levels
in INS-1 cells with decreased SCD expression.

In conclusion, we demonstrate that altered SCD and Elovl-6 expression in INS-1
cells modulates MUFA synthesis and susceptibility to palmitate-induced B-cell
lipotoxicity. These findings emphasize that regulation of SCDs and Elovl-6 may
significantly contribute to the preservation or loss of B-cell function and the development

of type 2 diabetes.

129

 

Chapter 5.
Role of Fatty Acid Elongases in Determination of De Novo Synthesized

Monounsaturated Fatty Acid Species

Abstract

Enhanced production of monounsaturated fatty acids (FAS) derived from
carbohydrate-enriched diets has been implicated in the development of obesity and
insulin resistance. The FA elongases Elovl-5 and Elovl-6 are regulated by changes in
nutrient and hormone status and have been shown using intact yeast and mammalian
microsome fractions to be involved in the synthesis of monounsaturated FAs. Herein,
targeted knockdown and over-expression of Elovl-5 or Elovl-6 was used to determine
their roles for de novo synthesis of specific species of monounsaturated FA in
mammalian cells. Treatment of INS-1 cells with elevated glucose increased de novo FA
synthesis and reduced the ratio of saturated to monounsaturated FAs. Elovl-5
knockdown decreased elongation of 16:1,n—7, whereas Elovl-5 over-expression increased
synthesis of 18:1,n-7 but was dependent on stearoyl-CoA desaturase driven substrate
availability of 16:1,n-7. Knockdown of Elovl-6 decreased elongation of both 16:0 and
16:1,n-7, resulting in accumulation of 16:1,n-7. In contrast to Elovl-5, Elovl-6 over-
expression preferentially drove synthesis of 16:0 elongation products 18:0 and 18:1,n-9
but not 18:1,n-7. These findings demonstrate that coordinated induction of FA elongase

and desaturase gene expression is required for balanced synthesis of specific n-7 versus

130

n-9 monounsaturated FA species. Furthermore, Elovl-6 is identified as a critical
regulator in determining de novo synthesized FA end products.
Introduction

Diets high in carbohydrates and saturated fat are well established to cause altered
fatty acid (FA) metabolism and elevated triglyceride accumulation, contributing to the
development of obesity and type 2 diabetes. Elevated levels of carbohydrates specifically
enriched in mono- and disaccharides induce the transcription of genes that increase
glucose metabolism and lipogenesis in the liver (57, 326, 327), diverting excess catabolic
metabolites into FAS for storage as triglycerides and cholesterol esters. FA elongase and
desaturase enzymes catalyze the conversion of saturated F As synthesized de novo from
glucose into monounsaturated FAs (MUFAs) such as palmitoleate or oleate. The
accumulation of MUFAs have been associated with hypertriglyceridemia and adiposity
(254, 328, 329), and inhibition of MUFA synthesis decreases triglyceride levels and
protects from diet-induced obesity and insulin resistance (36, 48, 255). Interestingly,
palmitoleate was recently identified as an adipose tissue-derived lipid hormone capable
of enhancing muscle insulin sensitivity (330). These findings emphasize the importance
of understanding the mechanisms regulating the production of MUFAs.

Synthesis of de novo FAs involves the enzymes acetyl-CoA carboxylase (ACC)
and fatty acid synthase (FAS) which carboxylate cytosolic acetyl-CoA to malonyl-CoA
and covalently bond malonyl-CoA C2 units to produce the C16 FA palmitate (16:0),
respectively (8). After activation to palmitoyl-CoA, a FA elongase adds an additional
malonyl-COA to make stearoyl-COA (18:0). MUFAs not derived from exogenous

sources are synthesized by a delta-9 desaturase addition of a cis-double bond to

131

 

palmitoyl-CoA and stearoyl-CoA to form, palmitoleoyl-COA (16:1,n-7) and oleoyl-CoA
(18:1,n-9), respectively. Palmitoleoyl-COA may also be elongated to vaccenyl-CoA
(18:1,n-7).

Stearoyl-CoA desaturases (SCDs) are delta-9 desaturases and rate limiting for
MUFA synthesis (20). SCD subtypes identified in mammalian cells thus far include
SCDs 1-5 (1 1-15, 18). Saturated FAS desaturated by SCDs contained chain lengths from
Cl3-19 for SCDs 1, 2, and 4 and C12-16 for SCD3 (20). Synthesis of C18 MUFAs de
novo from glucose requires chain elongation of C16 FAS by a FA elongase (Elovl), yet it
remains uncertain which elongases are involved in synthesis of specific MUFA species
(e.g. 18:1,n-7 versus 18:],n-9).

Substrate specificity analyses using yeast and in vitro microsomal preparations
identified the elongases Elovl-5 (FAEI, Relol, Helol) and Elovl-6 (LCE, FACE, rElo2)
to be involved in MUFA synthesis (31-33, 331). Elovl-6 and SCD gene expression are
induced by insulin, liver X receptors, sterol regulatory element binding protein-l
(SREBP-1), and glucose induction of the carbohydrate-regulatory element binding
protein/MAX-like factor X heterodimer (318, 325). In mice, hepatic Elovl-5, Elovl-6 and
SCDs are induced by activation of peroxisome proliferator-activated receptor a and in
leptin deficient, obese (ob/ob) mice, whereas they are suppressed by long-term feeding of
diets high in saturated fat (318). Coordinated expression of elongases and desaturases by
transcription factors that regulate lipogenic pathways, thus control the levels of MUFAs.
In vitro assays have shown that Elovl-5 elongates unsaturated FAs, including 16:1,n-7,
18:3,n6 and 18:4,n3 (32, 33, 33]). Relative to Elovl-5, Elovl-6 more effectively

elongates C12-16 saturated FAs and 16:1,n-7 (31, 32). Because oleate (18:1,n-9) is the

132

predominate MUFA in cells, Elovl-6 may play a larger role in MUFA synthesis than
Elovl-5 by converting palmitate to stearate, a saturated precursor of oleate.

Modulating the expression of FA elongase and desaturase genes has physiological
significance, as mice with knockdowns of either Elovl-6 or SCD1 are protected from
diet-induced obesity (36, 48, 255). The mechanism regulating the determination of
specific de novo derived MUFA end products, however, remains to be defined. This
study presents a comprehensive analysis of the effects of both decreased and increased
expression of Elovl-5, Elovl-6, and SCDs on FAs synthesized de novo from glucose in a
mammalian cell line. The results demonstrate that altering the expression of each

enzyme causes significant changes in select MUFA species synthesized de novo.

Results
5.]. Regulation of FA elongase and desaturase genes by glucose

Studies characterizing the substrate specificity of FA elongases in mammalian
cells have focused primarily on in vitro assays using cellular extracts or fractions. These
in vitro assays indicated that Elovl-5 preferentially elongates 16:1,n-7 and
polyunsaturated FAS, while Elovl-6 elongates 14:0, 16:0, and 16:1,n-7 (31-33, 331).
Little is known, however, about their substrate preference in intact cells, particularly in
regards to de novo derived FAS. To study the roles of Elovl-5 and Elovl-6, INS—1 cells
were used to model intracellular de novo FA synthesis, as these cells are known to induce
lipogenic gene expression in response to glucose (112, 234). INS-1 cells were treated

with either 4 mM or 16.7 mM glucose to determine the glucose responsiveness of

133

 

lipogenic genes and FA elongase and desaturase genes indicated to be involved in MUF A
synthesis (Figure 5.1A).

Genes required for de novo synthesized palmitate (16:0), ACC and FAS, were
increased 7.9- and 1.8-fold, respectively, by 16.7 mM glucose compared to 4 mM glucose
(Figure 5.]B). The expression of Elovl-5 and Elovl-6 was increased 1.3-fold, whereas
SCD expression was elevated 2.6-fold for SCD1 and 3.2-fold for SCD2. These results
show that between the FA elongases and desaturases involved in MUFA synthesis, the
expression of SCDs in INS-l cells is more responsive to glucose than Elovl-5 and Elovl-
6. Further, this suggests that modulating the expression of Elovl—5, Elovl-6, and SCDs
could significantly alter the elongation and desaturation status of newly synthesized FAs.
5.2. Elevated glucose increases the abundance of de novo synthesized FAs and alters
the ratio of saturated to monounsaturated FAs.

Synthesis of de novo FAs in response to glucose was determined by measuring
14C-glucose incorporation into FAS in cells cultured for 48 hrs in either 4 mM or 16.7
mM glucose. INS-1 cells cultured in 16.7 mM glucose showed a 6- to 13-fold increase in
14C-labeled saturated FA and MUFA compared to cells cultured in 4 mM glucose
(Figure 5.2A). The percent of labeled FAs was significantly increased for 16:1,n—7,
18:1,n-7 and 18:1,n-9, and decreased for 16:0 and 18:0 (Figure 5.28). Thus, there was a
38% decrease in the ratio of total saturated FA to MUFAs in 16.7 mM glucose treated
cells (Figure 5.2C). These data demonstrate that elevated glucose increases both the
abundance of de novo synthesized F As and the conversion of saturated FAs to MUFAs.
INS-l cells cultured in 11.1 mM glucose were subsequently used to examine the role of

Elovl—5 and Elovl-6 for synthesis of specific 18:] FA species.

134

 

A

ACC
FA Elon ase
CoA (Elovl-6)
Delta-9 Delta-9
Desaturase Desaturase
(SCD) (SCD)
18:1 n9

Elongase

16:1 n7 ———->18:1n7
(EIovl-5/Elovl-6)

B

101 * E 4 mM Glucose

2 - 16.7 mM Glucose

Fold Response

 

 

ACC FAS Elovl-5 Elovl-6 SCD1 SCDZ

Figure 5.1. Glucose increased mRNA levels of genes involved in de novo lipogenesis

and FA elongation and desaturation. A. Diagram of genes regulating end products of

de novo FA synthesis. B. Levels of mRNA of de novo FA synthesis genes. Total mRNA

was extracted from cells cultured for 48 hrs in 4 mM versus 16.7 mM glucose and

analyzed by qRT—PCR. Data are relative to RPL32 expression and normalized to cells

cultured in 4 mM glucose.

compared to 4 mM glucose.

135

Data represent mean t SE. (n=3).

Figure 5.2. Elevated glucose increased de novo FA abundance and
monounsaturated FA synthesis. Cells were cultured for 48 hrs in 4 mM or 16.7
mM glucose. During the last 24 hrs the culture media was supplemented with [U-
l4C]-glucose (specific activity of glucose was held constant). Total lipids were
extracted, saponified, and 14C incorporation into F As was quantified by rp-HPLC.
A. Newly synthesized FAs are represented as counts incorporated into specific FA
species normalized to protein. B. Percentage of total labeled FA. The percentage of
labeled 16:1,n-7, 18:0, 18:1,n-7, and 18:1,n-9 in high glucose cultured cells are
significantly different when compared to cells cultured in low glucose (p < 0.05). C.
Ratio of total saturated FAS to total MUFAs. Data are the mean : SE for three

independent experiments. *, p < 0.03 when compared to low glucose.

136

 

A 50000-

-14:o *
-16:0 | |

40000- E218:0
E16:1n7

30000_ @18fln7
-18:1n9

20000-

10000-

Counts Incorporated/pg protein

 

0-

   

B 120-

 

'0
0 .
110° - -18:1n9
g 30- .m1sz1n7
: ‘- E16z1n7
% 60-
.Q
3 40- -18:0
‘5‘, --16:0
g 20. -14:0
l

_ mm:-

 

 

4 mM Glucose 16.7 mM Glucose

137

Figure 5.2. Continued

C

N w J:-
I l I

Ratio Saturated FA/MUFA

 

 

4 mM Glucose 16.7 mM Glucose

138

5.3. Selective knockdown of Elovl-5 or Elovl-6 impact synthesis of specific MUFA
species.

siRNAs were used to determine the relative contributions of Elovl-5, Elovl-6 or
SCD1/2 on the de novo synthesis of specific FAs species in INS-1 cells cultured in
elevated glucose. siRNAs selective against Elovl-5 or Elovl-6 decreased expression of
the target mRNA by 75% and 81% with no significant effect on non-target mRNA levels
(Figure 5.3A). SCD siRNA reduced SCD1 and SCD2 by 91% and resulted in a 1.68-fold
increase in Elovl-6. Next, de novo FA synthesis was assessed in siRNA treated cells
using 14C-acetic acid. Decreased expression of Elovl-5 mRNA led to increased 14C-
labeling of 16:1,n-7 and decreased labeling of 16:0 (Figure 5.3B). There was no
significant change in 14C-labeled 18:0 and 18:1,n-7, but there was a trend for increased
14C-labeled 18:1,n-9. These data are consistent with reduced elongation of 16:1,n-7 and
increased flux to 18:1,n-9 production. Decreased expression of Elovl-6 led to decreased
14C-labeling of 18:0 and 18:1,n-9, and increased 14C-labeling of 16:0 and 16:1,n-7.
There was no change in labeled 18:1,n-7. These data are consistent with Elovl—6
mediating elongation of 16:0 to 18:0. Reduction of SCD expression decreased 16:1,n-7,
18:1,n-7 and 18:1,n-9 synthesis and led to increased 14C-labeling of 16:0 and 18:0.

Indexes of elongation and desaturation were calculated to determine the effects of
decreased Elovl—5, Elovl-6, and SCD expression on the handling of specific FAs. In
control cells, the elongation indexes for 16:0 and 16:1,n-7 are the same, whereas the
desaturation index for 18:0 is approximately 3-fold greater than 16:0 (Figure 5.3C and
D). Elovl-5 siRNA decreased 16:1,n-7 elongation and resulted in increased 16:0

elongation and desaturation, but caused no change in 18:0 desaturation. Elovl-6 siRNA

139

reduced 16:0 and 16:1,n-7 elongation and 18:0 desaturation. Elovl-6 siRNA had no
effect on 16:0 desaturation. Reduced SCD expression decreased 16:0 elongation and
caused a greater decrease in 16:1,n-7 elongation. As expected, desaturation of 16:0 and
18:0 with siSCD was also markedly decreased. These results demonstrate that decreased
expression of Elovl-5 or Elovl-6 has dramatic effects on the synthesis of specific FA

species derived de novo from glucose.

140

 

Figure 5.3. FA elongase and desaturase siRNA decreased gene expression and
modulated MUFA synthesis. Cells electroporated with control (CTL), Elovl-5,
Elovl-6 and SCD siRNA were cultured for 24 hrs in media containing 11.1 mM
glucose followed by RNA extraction or overnight treatment with the same
conditions plus [2-14C]-acetic acid. A. Levels of Elovl-5, Elovl-6, SCD1, and
SCD2 mRNA, relative to RPL32 mRNA levels. Data are normalized to siCTL cells
and represent the mean .4.- S.E. (n=3). *, p < 0.02 when compared to siCTL. B. Total
lipids were extracted, saponified, and 14C incorporation into FAS was quantified by
rp-HPLC. Data presented as percentage of total labeled FA species (n=3). C.
Elongation index for each specific siRNA. Data are the mean :t SE. (n=3). *, p <
0.05 for 16:0, and #, p < 0.03 for 16:1n-7 when compared to siCTL. D. Desaturation
index for each specific siRNA. Data are the mean t SE. (n=3). *, p < 0.04 for

16:0, and #, p < 0.02 for 18:0 when compared to siCTL.

141

 

A 2,0. EElovl-5 -E|ov|-6
-SCD1 -SCDZ

Fold Response
$

   

 

III/II/II/II/III/I 3(-

  
  

III/I/IIIIE

 

L

siCTL siElovl-5 siElovl-6 siSCD

 

B 120.

N
O
I

1
U

i100 ____________ -18:1n9
E 80‘ 1:.:.:.:.:.:.:.:.:.:.:- ______ IIIIII l i m 1 8 z 1 n7
'0 E16:1n7
% 60‘ Elmo
E -14:0
3

3

D.

 

O
I

   

siCTL siElovl-5 siElovl-6 siSCD

142

Figure 5.3. Continued

C 2.0- I:I16:o

 

-16:1n7

g 1.6-
'O
5 12-
.5 ' * #
2’ # *
2

0.0-

 

siCTL siElovI-5 siElovl-G siSCD

U

. E16:0
1 -18:0

Desaturation Index
9 .° .°
.5 a) on
I I 1

.°
N
l

 

 

 

HI nl’i

siCTL siElovl-5 siElovl-6 siSCD

 

P
O
I

143

5.4. Over-expression of Elovl-5 or Elovl-6 leads to selective synthesis of specific
MUFA species.

To further examine the selectivity of Elovl-5, Elovl-6, and SCD2 in de novo FA
synthesis, adenoviruses were constructed to over-express each individual gene and
examined for their effect on de novo FA end products. Compared to a control adenovirus
containing B—galactosidase (AdB—gal), over-expression of Elovl-6 resulted in a large
increase in 14C-labeled 18:0 and 18:1,n-9 and decreased labeling of 16:0, 16:1,n-7, and
18:1,n-7 (Figure 5.4A). The elongation index from cells over-expressing Elovl-6 showed
a large 3.6-fold increase in 16:0 elongation to 18:0 with no change in the rate of 18:0
desaturation to 18:1,n-9 (Figure 5.4B and C). The increased 16:0 elongation led to a 54%
decrease in 16:0 desaturation and only a small, insignificant increase in 16:1,n-7
elongation. These results are consistent for production of 18:1,n-9 at the expense of
16:1,n-7 and 18:1,n-7.

Elovl-5 over-expression had a limited effect on 14C-acetic acid incorporation into
FAs compared to Elovl-6 over-expression. Elevated Elovl-5 expression led to decreased
14C-labeled 16:0 and 16:1,n-7, and increased 14C-labeled 18:0 and 18:1,n-7 (Figure
5.5A). The effect of Elovl-5 on 16:1,n-7 and 18:1,n-7 labeling corresponded with a
significant increase in the elongation index of 16:1,n-7 (Figure 5.5B). The minimal effect
of Elovl-5 might be due to low 16:1,n-7 substrate availability. To test this possibility,
cells were treated with an adenovirus over-expressing SCD2 alone or in combination with
Elovl-5 over-expression. SCD2 over-expression caused a decrease in 14C-labeled 16:0
and 18:0 and a marked increase in 14C-labeled 16:1,n-7 and 18:1,n-7. This resulted in a

5-fold increase in the 16:0 desaturation index and a 1.5-fold increase in the 18:0

144

desaturation index (Figure 5.5C). Compared to SCD2 alone, the combination of Elovl-5
and SCD2 further increased 18:1,n-7 and reduced 16:1,n-7, demonstrating that Elovl-5
elongates de novo synthesized 16:1,n-7. These results emphasize a larger role of Elovl-6
and SCD than Elovl-5 in de novo FA synthesis in this cell model and point to the

elongase Elovl-6 as being critical for regulating newly synthesized FA end products.

145

 

Figure 5.4. Effect of increased Elovl-6 expression on de novo FA end product
formation. IN S—l cells were infected with adenoviruses expressing B-galactosidase
(B-gal) and Elovl—6 and were then cultured for 24 hrs in 11.1 mM glucose and [2-
14C]-acetic acid. Total lipids were extracted, saponified, and 14C incorporation into
F As was quantified by rp-HPLC. A. Percentage of total labeled FA species (n=3).
B. Effect of B-galactosidase and Elovl-6 on elongation index. Data are the mean :t
SE (n=3). #, p < 0.01 for 16:0 when compared to B-gal. C. Effect of [3-
galactosidase and Elovl-6 on desaturation index. Data are the mean :1: SE. (n=3). *,

p < 0.006 for 16:0 when compared to B-gal.

146

 

 

   

 

 

 

 

'U
3 -18:1n9
g: m1sz1n7
3 -16:1n7
g Chem
:1 -16:0
g -14:0
5
D.
B-gal Elovl-6

6- |:|16:o
>< 5. -16:1n7 #
a: .1
2 4-
C
.2 3.
'65
2’ 2-
.0
LL] 1_

- B-gal EloiII-B

1.2- D16:0
><1.0- -18:0
d)
'0
50.3-
C
.9
50.6-
3
150.4-
10
0
00.2-

0.0-

 

   

B-gal Elovl-6

147

Figure 5.5. Effect of increased Elovl-5 or SCD2 expression on de novo end
product formation. INS-1 cells were infected with adenoviruses that express (3-
galactosidase (B—gal), Elovl-5 or SCD2. Cells were cultured for 24 hrs in 11.1 mM
glucose and [2-14C]-acetic acid. Total lipids were extracted, saponified, and 14C
incorporation into FAs was quantified by rp-HPLC. A. Percentage of total labeled
FA species (n=3). B. Effect of B-gal, Elovl-5 and SCD2 on elongation index. Data
are the mean 1 SE. (n=3). #, p < 0.02 for 16:1,n-7 when compared to B-gal. C.
Effect of B-gal, Elovl-5 and SCD2 on desaturation index. Data are the mean :1: SE.

(n=3). *, p < 0.007 for 16:0, and #, p < 0.002 for 18:0 when compared to B-gal.

148

 
 
 
 
 
 

120-
'U
'5 100-
i -18:1n9
% 8 0" ':-;-;-;-;-;-;-:-;.;-;-; 1:53-32 552 E 1 8: 1 n7
I'-::16:1n7
d)
jg 60‘ [:18:0
3 40- -16:0
E -14:0
2 2o-
0
D.

o-

Elongation Index

><1.

Desaturation Inde

 

 

Bgal Elovl-5/SCD2

 

 

Bgal Elovl-5 SCD2 Elovl-5ISCD2

 

 

Bgal Elovl-5 SCD2 Elovl-5/SCD2

149

 

 

Discussion

The expression of FA elongases and desaturases is highly regulated by
transcription factors involved in glycolytic and lipogenic gene expression (318). This
coordinates changes in nutrient and hormone status with the activation of lipogenic genes
and altered synthesis of specific FAs and complex lipids, which can impact the
susceptibility to disease. Exposure to elevated carbohydrates activates transcription
factors such as SREBP-1c and ChREBP that induce the expression of genes that enhance
glucose metabolism as well as the synthesis and storage of FAS (69, 57). As shown here,
elevated glucose induced the expression of ACC, FAS, and FA elongases and
desaturases, which increased the synthesis of de novo derived FAs. The role FA of
elongases in determining end products of de novo FA synthesis from glucose has been
largely speculative. Although substrate specificities of Elovl-5 and Elovl-6 in vitro using
yeast and microsomal preparations indicated elongation of 16 carbon PAS (31, 32), the
effect of altered expression of these enzymes on the specific species of FA synthesized
from glucose has not been addressed. This study is the first to characterize the effects of
both reduced and enhanced expression of Elovl-5 and Elovl-6 on the intracellular end
products of de novo derived FAs in mammalian cells. The findings reveal a significant
role for FA elongase activity in regulating the synthesis of de novo derived MUFAs and
establishing the balance between 16:1,n-7, 18:1,n-7, and 18:1,n-9.

Elongation of FA by Elovl-5 is essential for control of hepatic lipid homeostasis
as over-expression in liver decreased triglyceride content and knockdown led to
activation of SREBP-1c, increased lipogenic gene expression, and hepatic steatosis (320,

332). Elovl-5 substrates include polyunsaturated FAs such as 18:4,n3, a precursor for

150

20:5,n3 FA synthesis, as well as 16:1,n-7 (32, 33, 331). Elevated levels of carbohydrate
leads to increased synthesis of both 18:1,n-7 and 18:1,n-9 FA in INS-1 cells and liver
(48). Targeted reduction of Elovl-5 expression decreased the elongation of 16:1,n-7 to
18:1,n-7 and increased elongation of 16:0 to 18:0 and the synthesis of 18:1,n-9,
illustrating an ex vivo role for Elovl—5 in the elongation of 16:1,n-7. Findings in INS-l
cells are in stark contrast to Elovl-5 null mice, which have increased rather than
decreased hepatic levels of 18:1,n-7 (320). Although 18:1,n-7 levels were unexpectedly
elevated in Elovl-5 null mice, PUFA levels were reduced as expected. The increased
levels of hepatic 18:1,n-7 maybe associated with reduced synthesis of 22:6,n3, an
inhibitor of SREBP-1 processing (8, 320). Indeed Elovl-5 null mice had increased
SREBP-1c levels, de novo FA synthesis, and Elovl-6 expression, which can elongate
16:1,n—7 to 18:1,n-7 (320). Over-expression of Elovl-5 in INS-l cells decreased the
amount of de novo derived 16:1,n-7 but only had a minimal effect on 18:1,n-7. The
minimal effect of increased Elovl-5 expression was likely due to limited substrate
availability as INS-1 cells have very low concentrations of 16:1,n-7 relative to 16:0.
Consistent with this possibility, over-expression of SCD2 significantly increased 16: 1 ,n-7
synthesis, which was available for Elovl-5 to elongate to 18:1,n-7. Under many
physiologic states, increased SCD expression occurs with increased expression of Elovl-5
(and Elovl-6) (318). Elovl-5 might function to keep cellular concentrations of 16:1,n-7
low, thereby preventing accumulation of 16:1,n-7 that can serve as a cell-signaling
molecule (330). Although the mechanism is unknown, exposure of cells to 16:],n-7
enhances insulin signaling and its accumulation in the blood has been shown to correlate

with increased muscle insulin sensitivity and protection from hepatic steatosis (3 6, 330).

151

 

The preferred substrate for triglyceride storage of excess FAs is the MUFA oleate
(18:1,n-9) (21). Synthesis of 18:1,n-9 de novo requires the elongation of 16:0 to 18:0
prior to desaturation. Elovl-6 over—expression in INS-1 cells largely drove the elongation
of 16:0 to 18:0 and promoted synthesis of 18:1,n-9 rather than elongation of 16:1,n-7 to
18:1,n-7. Conversely, reduced expression of Elovl-6 significantly decreased the products
of 16:0 elongation (i.e. 18:0 and 18:1,n-9) while increasing 16:1,n-7. In addition,
elongation of 16:1,n-7 to 18:1,n-7 was also decreased with siElovl-6. A role for Elovl-6
in 16:0 elongation is supported by Elovl-6 null mice, which displayed decreased hepatic
accumulation of 18:0 and 18:1,n-9 and increased 16:0 and 16:1,n-7 (36). The effect of
decreased elongation of both 16:0 and 16:1,n-7 by reduced Elovl-6 expression and
activity is a shuttling of de novo synthesized FA towards the production of 16:1,n-7. Our
data shows expression and activity of Elovl-6 is mostly involved in elongation of de novo
synthesized 16:0 to produce n-9 MUFA species.

Although Elovl-5 and Elovl-6 activities can influence synthesis of specific MUFA
species, SCD activity clearly plays the predominate role in total MUFA synthesis. This
was exemplified by the large reduction in 16:1,n-7, 18:1,n-7 and 18:1,n-9 in INS-1 cells
with reduced SCD1 and SCD2. Interestingly, Elovl-6 mRNA, but not Elovl-5 mRNA,
was induced in SCD deficient INS-1 cells. This finding supports the unique role of
Elovl-6 in synthesis of 18:1,n-9, the predominate MUFA in cells, and suggests that
MUFA provide negative-feedback control on Elovl-6 expression. Over-expression of
SCD2 in IN S-l cells, in the absence of increased Elovl-5/Elovl-6, led to increased 16:1,n-

7 and 18:1,n-7, but had little impact on 18:1,n-9 synthesis. These data suggest that

152

 

without coordinate regulation of FA elongases, elevated SCD activity will disrupt the
balance of 16:1,n-7, 18:1,n-7 and 18:1,n-9.

In conclusion, this study presents a comprehensive analysis of the effects of altered
expression of Elovl-5 and Elovl-6 on de novo synthesized MUFAs. Our results
demonstrate that Elovl-5 preferentially converts 16:1,n-7 to 18:1,n-7, whereas Elovl-6
preferentially elongates 16:0 to 18:0, which can be further desaturated to 18:1,n-9. Loss

of coordinate control of Elovl-5, Elovl-6 and SCD can disrupt production of specific

 

MUFA species, which may negatively influence cell function.

 

153

Chapter 6. General Conclusions and Future Studies

Chronic hyperglycemia and elevated FFA levels have been associated with the
pathogenesis of (fl-cell dysfunction and T2D (4). Pancreatic [ii-cell FA metabolism is a
growing area of research focused on identifying mechanisms to prevent the adverse
effects of glucolipotoxicity. Recent studies demonstrated that [El-cells possess innately
enhanced regulation of specific FA metabolic pathways that contribute to preserving
proper function (6, 104, 234, 257). This dissertation provides novel information into how
changes in FA metabolism through activation of LXRs and alterations in MUFA
synthesis modulate B-cell firnction in response to glucolipotoxicity.

Islet B-cells from hyperglycemic animal models of T2D exhibit diminished GSIS
in conjunction with elevated lipogenic gene expression, de novo FA synthesis, and TAG
accumulation (116, 233). This association between diminished GSIS and lipogenesis has
been proposed to occur through activation of SREBP-1c, a major transcriptional regulator
0f lipogenic genes (116, 233). The findings presented here, however, demonstrate that
enhanced activation of SREBP-1c, lipogenic gene expression, and TAG synthesis by

aetivation of LXRs results in elevated basal insulin release and GSIS during chronic
h)"perglycemia. These results conflict with studies showing over-expression of a
c30nstitutively active SREBP-lo increases TAGS and causes loss of GSIS (116). The
difference could be that B-cells are sensitive to the level of SREBP-1c activation, as its
expression is required for LXR-mediated enhancement of insulin secretion (253). In
addition, LXR activation may affect other FA metabolism pathways that impact B-cell
1:LlIIction. Consistent with this possibility, elevated basal insulin release from LXR-

activated INS-1 cells was blocked by inhibition of acyl-CoA formation and FA oxidation,

154

Glucose Exogenous SFA (16:0)

Malonyl- -CoA

CPT-1 1. LC- CoA (16: o- -CoA)
B-oxid.

  

 

 

 

 

 

. 1FQSCDZ
11‘16'1/1821,n-7
LciCoADA DAG ATAG?
F
119166
. ‘QA.
v p"
FA-induced ER stress Qtelycem'm'd 1 LXR
-(UPR) 1TAG 1 SCDZ alone
1 MitoJER Oxidative stress
-(ROS) 7??

 

LXR-mediated Increased TAG Synthesis, FA-Oxidation,
and Elevated insulin Secretion

SCDZ-mediated Reduction of Palmitate-Induced ER stress
and Preservation of B-Cell Mass

 

 

 

Figure 6.1. Mechanisms of protection from glucolipotoxicity by activation of LXRs
and enhanced MUFA synthesis. LXR activation during chronic hyperglycemia drives
de novo synthesis of 16:0, conversion of 16:0 to n-7 MUFAs, and TAG synthesis. In
addition, LXR activation increased CPT-1 gene expression and FA oxidation.
Subsequent lipoylsis of glycerolipid pools in LXR-activated B-cells increased basal
insulin secretion, via the enhanced FA oxidation, and increased GSIS through generation
of DAG. ER stress and loss of B—cell mass from exposure to excess exogenous palmitate
was reduced by enhanced SCD2-mediated synthesis of n-7 MUFAs.‘ Whether LXR
activation and increased MUFA synthesis affect oxidative stress remains to be
determined. Furthermore, how SCD2 protects from palmitate toxicity is still unknown.
Overall, utilization of mechanisms designed to enhance LXR and SCD2 activity could
provide significant protection of B-cells from glucolipotoxicity.

155

 

which coincided with increased FA oxidation and expression of genes involved in
mitochondrial B-oxidation. The link between LXR activation and increased CPT-1 gene
expression and FA oxidation is unclear, but may involve FA-mediated regulation of
AMPK and ACC or an effect of LXR on PPARor as shown in the intestine (292).

Enhanced TAG synthesis and FA oxidation combined with the observation that
TAGS are turned over rapidly indicated that the effect of LXR activation on GSIS
involved turnover of neutral lipid pools. Inhibition of lipolysis by treatment of INS-1
cells with the general lipase inhibitor orlistat blocked the turnover of TAG and reduced
GSIS. Turnover of TAG could, in turn, provide lipid signaling molecules such as DAG
to enhance insulin secretion. In support of this hypothesis, elevated GSIS from LXR-
activated cells was reduced by inhibition of DAG binding proteins. Thus, elevated GSIS
by activation of LXRs involves TAG turnover and signaling through DAG. Our findings
indicate that a balance between synthesis and turnover of neutral lipid pools is necessary
for enhanced glycerolipid/FA cycling to protect B-cells from chronic hyperglycemia.
This is supported by studies showing that altering only synthesis or turnover of neutral
lipids causes reduced GSIS (104, 165, 239, 240).

Taken together, LXR activation elevates insulin secretion through a mechanism
involving increased de novo synthesis and turnover of TAG and enhanced mitochondrial
B-oxidation. These findings support the emerging role of increased glycerolipid/FA
cycling in B-cell compensation (99). Obese ZF rats maintain normoglycemia, in part,

through enhanced islet glucose- and FA-stimulated insulin secretion (104). Interestingly,

156

ZF rat islets display increased FA esterification, lipolysis, and FA oxidation as well as
increased LXRa gene expression (104, 257). Therefore, LXRs could be key regulators of
B-cell glycerolipid/FA cycling. Future studies will be necessary to determine if LXR is
required for glycerolipid/F A cycling.

In conjunction with elevated TAG synthesis, LXR activation increased MUFA
synthesis and expression of the FA desaturases SCD1 and SCD2. Characterization of FA
elongase and desaturase genes in rat islets and INS-1 cells identified expression of the
elongases Elovls 1, 2, 4, 5, 6 and 7, and the desaturases SCD1, SCD2, ASD and A6D. In
contrast to the liver, SCD2 was the predominant SCD isoform expressed in B-cells, as
shown recently (257). In addition, we demonstrated that SCD1 and SCD2 gene
expression is elevated in pre-diabetic ZDF rat islets and reduced, along with Elovl-6, in
diabetic ZDF rat islets. Prior to the onset of T2D, ZDF rats display gradually increasing
concentrations of plasma FFAs (313), which are associated with loss of B-cell function
(4). This suggested that regulation of genes involved in MUFA synthesis could be
involved in B-cell compensation and failure during the development of T2D. In support
of this hypothesis, we show that knockdown of SCD] and SCD2 increased the
susceptibility of INS-l cells to palmitate-induced ER stress and apoptosis, confirming
that SCD expression is required for protection against lipotoxicity (257). Increased
palmitate toxicity in SCD knockdown cells was associated with reduced TAG, increased
DAG, and Ca2+—dependent PKC activation. This correlates with studies showing that
palmitate toxicity is associated with reduced incorportation into neutral lipids compared
to MUFAs (241, 315). Although reduced palmitate toxicity in rat islets and MIN-6 [3-

cells correlates with enhanced SCD1 and SCD2 expression (6, 257), enhanced regulation

157

 

of other FA metabolism pathways could account for this protection as well. For example,
ZF rat islets and MIN-6 B-cells have increased expression of SCDS and CPT-1, which
coincided with increased FA oxidation (6, 104, 257). Here, we show for the first time
that elevated expression of only SCD2 protects from palmitate-induced ER stress and
apoptosis. Protection by SCD2 over-expression, however, did not coincide with
increased TAGS. Further studies are needed to determine how enhanced SCD2
expression modulates lipotoxicity. In addition, palmitate toxicity tended to be reduced by
Elovl-6 knockdown, whereas it was enhanced by Elovl-6 over-expression. This
correlates with Elovl-6 knockdown having beneficial effects in liver, as Elovl-6 null mice
are protected from diet-induced insulin resistance (36).

In the liver, increased MUFA synthesis coincides with increased expression of
both SCD and Elovl-6 (318). Here, we show that elevated expression of either SCD2 or
Elovl-6 alone alters the conversion of exogenous palmitate into specific MUFA species,
n-7 versus n-9. The increased palmitate toxicity in cells over-expressing Elovl-6 is likely
due to the significantly increased stearate production in the absence of a simultaneous
increase in SCD expression. Interestingly, Elovl-6 drove the synthesis of both exogenous
palmitate and de novo derived FAS towards stearate and oleate, rather and vaccenate.
This demonstrates that although Elovl-6 elongates palmitate and palmitoleate in vitro (31,
32), its primary function is to elongate palmitate to provide the precursor for oleate
synthesis. The FA elongase Elovl-5 is also involved in MUFA synthesis, as it elongates
16:1,n-7 to 18:1,n-7 (32, 33). Although Elovl-5 knockdown in INS-1 cells decreased
elongation of de novo synthesized 16:1,n-7, its over-expression had a limited effect on

18:1,n-7 synthesis, which depended on SCD driven substrate availability of 16:1,n-7.

158

 

'~'_.__n3..m

Taken together, our results Show that altered expression of either SCD, Elovl-6 or Elovl-5
significantly effects MUFA end products, emphasizing the importance of coordinated

regulation of these genes for maintaining balanced synthesis of n-7 versus n-9 MUFAs,

as found in liver (318).

 

159

' 10.

ll.

BIBLIOGRAPHY

Amos AF, McCarty DJ, Zimmet P 1997 The rising global burden of diabetes and

its complications: estimates and projections to the year 2010. Diabet Med 14
Suppl 5:81-85

King H, Aubert RE, Herman WH 1998 Global burden of diabetes, 1995-2025:
prevalence, numerical estimates, and projections. Diabetes Care 21:1414-1431

Prentki M, Joly E, El-Assaad W, Roduit R 2002 Malonyl-CoA Signaling, lipid
partitioning, and glucolipotoxicity: role in beta-cell adaptation and failure in the
etiology of diabetes. Diabetes 51 Suppl 3:8405-413

Poitout V, Robertson RP 2008 Glucolipotoxicity: fuel excess and beta—cell
dysfunction. Endocrine reviews 29:351-366

Efanov AM, Sewing S, Bokvist K, Gromada J 2004 Liver X receptor activation
stimulates insulin secretion via modulation of glucose and lipid metabolism in
pancreatic beta-cells. Diabetes 53 Suppl 3:875-78

Busch AK, Gurisik E, Cordery DV, Sudlow M, Denyer GS, Laybutt DR, Hughes
WE, Biden TJ 2005 Increased fatty acid desaturation and enhanced expression of

stearoyl coenzyme A desaturase protects pancreatic beta-cells from lipoapoptosis.
Diabetes 54:2917-2924

Sprecher H 2000 Metabolism of highly unsaturated n-3 and n-6 fatty acids.
Biochimica et biophysica acta 1486:219-231

Jump DB 2004 Fatty acid regulation of gene transcription. Critical reviews in
clinical laboratory sciences 41:41-78

Cho HP, Nakamura M, Clarke SD 1999 Cloning, expression, and fatty acid
regulation of the human delta-5 desaturase. The Journal of biological chemistry
274:37335-37339

Ramanadham S, Zhang S, Ma Z, Wohltmann M, Bohrer A, Hsu FF, Turk J 2002
Delta6-, Stearoyl CoA-, and DeltaS-desaturase enzymes are expressed in beta-

cells and are altered by increases in exogenous PUFA concentrations. Biochimica
et biophysica acta 1580:40-56

Kaestner KH, Ntambi M, Kelly TJ, Jr., Lane MD 1989 Differentiation-induced
gene expression in 3T3-L1 preadipocytes. A second differentially expressed gene

encoding stearoyl-CoA desaturase. The Journal of biological chemistry
264:14755-14761

160

 

12.

l3.

14.

15.

16.

17.

18.

19.

20.

21.

22.

Ntambi JM, Buhrow SA, Kaestner KH, Christy RJ, Sibley E, Kelly TJ, Jr., Lane
MD 1988 Differentiation-induced gene expression in 3T3-L1 preadipocytes.
Characterization of a differentially expressed gene encoding stearoyl-CoA
desaturase. The Journal of biological chemistry 263:17291-17300

Miyazaki M, Jacobson MJ, Man WC, Cohen P, Asilmaz E, Friedman JM, Ntambi
JM 2003 Identification and characterization of murine SCD4, a novel heart-

specific stearoyl-CoA desaturase isoform regulated by leptin and dietary factors.
The Journal of biological chemistry 278:33904-33911

Zheng Y, Prouty SM, Harmon A, Sundberg JP, Stenn KS, Parimoo S 2001 Scd3--
a novel gene of the stearoyl-CoA desaturase family with restricted expression in
skin. Genomics 71:182-191

Mihara K 1990 Structure and regulation of rat liver microsomal stearoyl-CoA
desaturase gene. Journal of biochemistry 108:1022-1029

Wang J, Yu L, Wang H, Gao Y, Schrementi JP, Porter RK, Yurek DA, Kuo M,
Suen CS, Cao G, Bean J S, Kauffinan RF, Qian Y 2008 Identification and
characterization of hamster stearoyl-CoA desaturase isoforms. Lipids 43: 197-205

Zhang L, Ge L, Parimoo S, Stenn K, Prouty SM 1999 Human stearoyl-CoA
desaturase: alternative transcripts generated from a single gene by usage of
tandem polyadenylation sites. The Biochemical journal 340 ( Pt 1):255-264

Wang J, Yu L, Schmidt RE, Su C, Huang X, Gould K, Cao G 2005
Characterization of HSCDS, a novel human stearoyl-CoA desaturase unique to
primates. Biochemical and biophysical research communications 332:735-742

Zhang S, Yang Y, Shi Y 2005 Characterization of human SCD2, an oligomeric

desaturase with improved stability and enzyme activity by cross-linking in intact
cells. The Biochemical journal 388:135-142

Miyazaki M, Bruggink SM, Ntambi JM 2006 Identification of mouse palmitoyl-
coenzyme A Delta9-desaturase. Journal of lipid research 472700-704

Ntambi JM, Miyazaki M 2004 Regulation of stearoyl-CoA desaturases and role in
metabolism. Progress in lipid research 43:91-104

Miyazaki M, Dobrzyn A, Elias PM, Ntambi JM 2005 Stearoyl-CoA desaturase-2
gene expression is required for lipid synthesis during early skin and liver
development. Proceedings of the National Academy of Sciences of the United
States of America 102:12501-12506

161

23.

24.

25.

26.

27.

28.

29.

30.

31.

Green SC, Stewart ME, Downing DT 1984 Variation in sebum fatty acid

composition among adult humans. The Journal of investigative dermatology
83:114-117

Turkish AR, Henneberry AL, Cromley D, Padamsee M, Oelkers P, Bazzi H,
Christiano AM, Billheimer JT, Sturley SL 2005 Identification of two novel
human acyl-CoA wax alcohol acyltransferases: members of the diacylglycerol
acyltransferase 2 (DGAT2) gene superfamily. The Journal of biological chemistry
280: 14755-14764

Oh CS, Toke DA, Mandala S, Martin CE 1997 ELOZ and ELO3, homologues of
the Saccharomyces cerevisiae ELO] gene, function in fatty acid elongation and

are required for sphingolipid formation. The Journal of biological chemistry
272:]7376-17384

Tvrdik P, Westerberg R, Silve S, Asadi A, Jakobsson A, Cannon B, Loison G,
Jacobsson A 2000 Role of a new mammalian gene family in the biosynthesis of

very long chain fatty acids and sphingolipids. The Journal of cell biology
149:707-718

Agbaga MP, Brush RS, Manda] MN, Henry K, Elliott MH, Anderson RE 2008
Role of Stargardt-3 macular dystrophy protein (ELOVL4) in the biosynthesis of
very long chain fatty acids. Proceedings of the National Academy of Sciences of
the United States of America 105:12843-12848

Westerberg R, Mansson J E, Golozoubova V, Shabalina IG, Backlund EC, Tvrdik
P, Retterstol K, Capecchi MR, Jacobsson A 2006 ELOVL3 is an important
component for early onset of lipid recruitment in brown adipose tissue. The
Journal of biological chemistry 281:4958-4968

Westerberg R, Tvrdik P, Unden AB, Mansson JE, Norlen L, Jakobsson A,
Holleran WH, Elias PM, Asadi A, F lodby P, Toftgard R, Capecchi MR,
Jacobsson A 2004 Role for ELOVL3 and fatty acid chain length in development
of hair and skin firnction. The Journal of biological chemistry 279:5621-5629

Zhang K, Kniazeva M, Han M, Li W, Yu Z, Yang Z, Li Y, Metzker ML,
Allikmets R, Zack DJ, Kakuk LE, Lagali PS, Wong PW, MacDonald IM, Sieving
PA, Figueroa DJ, Austin CP, Gould RJ, Ayyagari R, Petrukhin K 2001 A 5-bp
deletion in ELOVL4 is associated with two related forms of autosomal dominant
macular dystrophy. Nature genetics 27:89-93

Moon YA, Shah NA, Mohapatra S, Warrington JA, Horton JD 2001 Identification

of a mammalian long chain fatty acyl elongase regulated by sterol regulatory
element-binding proteins. The Journal of biological chemistry 276:45358-45366

162

 

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

Inagaki K, Aki T, F ukuda Y, Kawamoto S, Shigeta S, Ono K, Suzuki 0 2002
Identification and expression of a rat fatty acid elongase involved in the

biosynthesis of C18 fatty acids. Bioscience, biotechnology, and biochemistry
66:613-62]

Leonard AE, Bobik EG, Dorado J, Kroeger PE, Chuang LT, Thurmond JM,
Parker-Bames JM, Das T, Huang YS, Mukerji P 2000 Cloning of a human cDNA
encoding a novel enzyme involved in the elongation of long-chain
polyunsaturated fatty acids. The Biochemical journal 350 Pt 32765-770

Leonard AE, Kelder B, Bobik EG, Chuang LT, Lewis CJ, Kopchick JJ, Mukerji
P, Huang YS 2002 Identification and expression of mammalian long-chain PUFA
elongation enzymes. Lipids 37:733-740

Wang Y, Botolin D, Christian B, Busik J, Xu J, Jump DB 2005 Tissue-specific,
nutritional, and developmental regulation of rat fatty acid elongases. Journal of
lipid research 46:706-715

Matsuzaka T, Shimano H, Yahagi N, Kato T, Atsumi A, Yamamoto T, Inoue N,
Ishikawa M, Okada S, Ishigaki N, Iwasaki H, Iwasaki Y, Karasawa T, Kumadaki
S, Matsui T, Sekiya M, Ohashi K, Hasty AH, Nakagawa Y, Takahashi A, Suzuki
H, Yatoh S, Sone H, Toyoshima H, Osuga J, Yamada N 2007 Crucial role of a
long-chain fatty acid elongase, Elovl6, in obesity-induced insulin resistance.
Nature medicine 13:] 193-1202

Carey MC, Small DM, Bliss CM 1983 Lipid digestion and absorption. Annual
review of physiology 45:651-677

Mattson FH, Beck LW 1956 The specificity of pancreatic lipase for the primary
hydroxyl groups of glycerides. The Journal of biological chemistry 219:735-740

Mattson FH, Volpenhein RA 1964 The Digestion and Absorption of
Triglycerides. The Journal of biological chemistry 239:2772-2777

Mattson FH, Volpenhein RA 1968 Hydrolysis of primary and secondary esters of
glycerol by pancreatic juice. Journal of lipid research 9:79-84

Hofmann AF, Borgstrom B 1963 Hydrolysis of long-chain monoglycerides in
micellar solution by pancreatic lipase. Biochimica et biophysica acta 70:317-331

Borgstroem B 1964 Influence of Bile Salt, Ph, and Time on the Action of
Pancreatic Lipase; Physiological Implications. Journal of lipid research 5:522-531

Mansbach CM, 2nd, Gorelick F 2007 Development and physiological regulation
of intestinal lipid absorption. 11. Dietary lipid absorption, complex lipid synthesis,

163

44.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

and the intracellular packaging and secretion of chylomicrons. Am J Physiol
Gastrointest Liver Physiol 2932G645-650

Wang H, Eckel RH 2009 Lipoprotein lipase: fiom gene to obesity. American
journal of physiology 297:E27l-288

Wang S, Soni KG, Semache M, Casavant S, F ortier M, Pan L, Mitchell GA 2008
Lipolysis and the integrated physiology of lipid energy metabolism. Molecular
genetics and metabolism 95:117-126

Aprahamian SA, Arslanian MJ, Wakil SJ 1982 Comparative studies on the kinetic
parameters and product analyses of chicken and rat liver and yeast fatty acid h
synthetase. Comparative biochemistry and physiology 7 1 2577-5 82 '

Wakil SJ 1989 Fatty acid synthase, a proficient multifunctional enzyme.
Biochemistry 2824523-4530

Miyazaki M, Flowers MT, Sampath H, Chu K, Otzelberger C, Liu X, Ntambi JM
2007 Hepatic stearoyl-CoA desaturase-l deficiency protects mice from L
carbohydrate-induced adiposity and hepatic steatosis. Cell metabolism 62484-496 '

 

Gonzalez-Baro MR, Lewin TM, Coleman RA 2007 Regulation of Triglyceride
Metabolism. 11. Function of mitochondrial GPAT] in the regulation of
triacylglycerol biosynthesis and insulin action. Am J Physiol Gastrointest Liver

Physiol 292:G1195-1 199

Gimeno RE, Cao J 2008 Thematic review series: glycerolipids. Mammalian
glycerol-3-phosphate acyltransferases: new genes for an old activity. Journal of
lipid research 4922079-2088

Agarwal AK, Garg A 2003 Congenital generalized lipodystrophy: significance of
triglyceride biosynthetic pathways. Trends in endocrinology and metabolism:
TEM 142214-221

Shindou H, Hishikawa D, Harayama T, Yuki K, Shimizu T 2009 Recent progress
on acyl CoA: lysophospholipid acyltransferase research. Journal of lipid research
50 Supp12S46-51

Reue K, Brindley DN 2008 Thematic Review Series: Glycerolipids. Multiple
roles for lipins/phosphatidate phosphatase enzymes in lipid metabolism. Journal
of lipid research 49:2493-2503

Kabashima T, Kawaguchi T, Wadzinski BE, Uyeda K 2003 Xylulose 5-phosphate
mediates glucose-induced lipogenesis by xylulose 5-phosphate-activated protein
phosphatase in rat liver. Proceedings of the National Academy of Sciences of the
United States of America 10025107-5112

164

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

65.

Ma L, Tsatsos NG, Towle HC 2005 Direct role of ChREBP.Mlx in regulating

hepatic glucose-responsive genes. The Journal of biological chemistry 280212019-
12027

Stoeckman AK, Ma L, Towle HC 2004 Mlx is the functional heteromeric partner
of the carbohydrate response element-binding protein in glucose regulation of
lipogenic enzyme genes. The Journal of biological chemistry 279: 15662-15669

Yamashita H, Takenoshita M, Sakurai M, Bruick RK, Henzel WJ, Shillinglaw W,
Amot D, Uyeda K 2001 A glucose-responsive transcription factor that regulates
carbohydrate metabolism in the liver. Proceedings of the National Academy of
Sciences of the United States of America 98:9116-9121

Ishii S, Iizuka K, Miller BC, Uyeda K 2004 Carbohydrate response element
binding protein directly promotes lipogenic enzyme gene transcription.

Proceedings of the National Academy of Sciences of the United States of America
101215597-15602

Guha P, Aneja KK, Shilpi RY, Haldar D 2009 Transcriptional regulation of
mitochondrial glycerophosphate acyltransferase is mediated by distal promoter
via ChREBP and SREBP-l. Archives of biochemistry and biophysics

Eberle D, Hegarty B, Bossard P, Ferre P, Foufelle F 2004 SREBP transcription
factors: master regulators of lipid homeostasis. Biochimie 862839-848

Nohturfft A, Brown MS, Goldstein JL 1998 Topology of SREBP cleavage-
activating protein, a polytopic membrane protein with a sterol-sensing domain.
The Journal of biological chemistry 273:17243-17250

Yabe D, Komuro R, Liang G, Goldstein JL, Brown MS 2003 Liver-specific
mRNA for Insig-2 down-regulated by insulin: implications for fatty acid

synthesis. Proceedings of the National Academy of Sciences of the United States
of America 10023155-3160

Yellaturu CR, Deng X, Park EA, Raghow R, Elam MB 2009 Insulin enhances
biogenesis of the nuclear SREBP-1c by posttranscriptional downregulation of
Insig-2a and its dissociation from SCAP-SREBP-lc complex. The Journal of
biological chemistry

Wang X, Sato R, Brown MS, Hua X, Goldstein J L 1994 SREBP-1, a membrane-
bound transcription factor released by sterol-regulated proteolysis. Cell 77:53-62

Sakai J, Rawson RB, Espenshade P], Cheng D, Seegmiller AC, Goldstein JL,
Brown MS 1998 Molecular identification of the sterol-regulated luminal protease

165

 

66.

67.

68.

69.

70.

71.

72.

73.

74.

75.

that cleaves SREBPS and controls lipid composition of animal cells. Molecular
cell 22505-514

Brown MS, Goldstein J L 1999 A proteolytic pathway that controls the cholesterol
content of membranes, cells, and blood. Proceedings of the National Academy of
Sciences of the United States of America 96:11041-11048

Sheng Z, Otani H, Brown MS, Goldstein JL 1995 Independent regulation of sterol
regulatory element-binding proteins 1 and 2 in hamster liver. Proceedings of the
National Academy of Sciences of the United States of America 922935-938

Hegarty BD, Bobard A, Hainault I, Ferre P, Bossard P, F oufelle F 2005 Distinct
roles of insulin and liver X receptor in the induction and cleavage of sterol
regulatory element-binding protein- 1c. Proceedings of the National Academy of
Sciences of the United States of America 102:791-796

Foretz M, Guichard C, F erre P, F oufelle F 1999 Sterol regulatory element binding
protein-1c is a major mediator of insulin action on the hepatic expression of

glucokinase and lipogenesis-related genes. Proceedings of the National Academy
of Sciences of the United States of America 96: 12737-12742

Amemiya—Kudo M, Shimano H, Hasty AH, Yahagi N, Yoshikawa T, Matsuzaka
T, Okazaki H, Tamura Y, Iizuka Y, Ohashi K, Osuga J, Harada K, Gotoda T, Sato
R, Kimura S, Ishibashi S, Yamada N 2002 Transcriptional activities of nuclear
SREBP-la, -lc, and -2 to different target promoters of lipogenic and
cholesterogenic genes. Journal of lipid research 43:]220-1235

Magana MM, Lin SS, Dooley KA, Osborne TF 1997 Sterol regulation of acetyl
coenzyme A carboxylase promoter requires two interdependent binding sites for
sterol regulatory element binding proteins. Journal of lipid research 38:1630—1638

Magana MM, Osborne TF 1996 Two tandem binding sites for sterol regulatory
element binding proteins are required for sterol regulation of fatty-acid synthase
promoter. The Journal of biological chemistry 271:32689-32694

Koo SH, Dutcher AK, Towle HC 2001 Glucose and insulin function through two
distinct transcription factors to stimulate expression of lipogenic enzyme genes in
liver. The Journal of biological chemistry 276:9437-9445

Kumadaki S, Matsuzaka T, Kato T, Yahagi N, Yamamoto T, Okada S, Kobayashi
K, Takahashi A, Yatoh S, Suzuki H, Yamada N, Shimano H 2008 Mouse Elovl-6
promoter is an SREBP target. Biochemical and biophysical research
communications 368:261-266

Bene H, Lasky D, Ntambi JM 2001 Cloning and characterization of the human
stearoyl-CoA desaturase gene promoter: transcriptional activation by sterol

166

 

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

regulatory element binding protein and repression by polyunsaturated fatty acids
and cholesterol. Biochemical and biophysical research communications 28421194-
1198

Tabor DE, Kim JB, Spiegelman BM, Edwards PA 1999 Identification of
conserved cis-elements and transcription factors required for sterol-regulated

transcription of stearoyl-CoA desaturase 1 and 2. The Journal of biological
chemistry 274:20603-20610

Mitro N, Mak PA, Vargas L, Godio C, Hampton E, Molteni V, Kreusch A, Saez E
2007 The nuclear receptor LXR is a glucose sensor. Nature 4452219-223

Willy PJ, Umesono K, Ong ES, Evans RM, Heyman RA, Mangelsdorf DJ 1995 a

LXR, a nuclear receptor that defines a distinct retinoid response pathway. Genes
& development 9: 1033-1045

Costet P, Luo Y, Wang N, Tall AR 2000 Sterol-dependent transactivation of the
ABC] promoter by the liver X receptor/retinoid X receptor. The Journal of a
biological chemistry 275:28240-28245

 

Cha JY, Repa JJ 2007 The liver X receptor (LXR) and hepatic lipogenesis. The

carbohydrate-response element-binding protein is a target gene of LXR. The
Journal of biological chemistry 282:743-751

Yoshikawa T, Shimano H, Amemiya—Kudo M, Yahagi N, Hasty AH, Matsuzaka
T, Okazaki H, Tamura Y, Iizuka Y, Ohashi K, Osuga J, Harada K, Gotoda T,
Kimura S, Ishibashi S, Yamada N 2001 Identification of liver X receptor-retinoid
X receptor as an activator of the sterol regulatory element-binding protein 1c gene
promoter. Molecular and cellular biology 21:2991-3000

Terasaka N, Hiroshima A, Koieyama T, Ubukata N, Morikawa Y, Nakai D, Inaba
T 2003 T-0901317, a synthetic liver X receptor ligand, inhibits development of
atherosclerosis in LDL receptor-deficient mice. F EBS letters 53626-11

Joseph SB, Laffitte BA, Patel PH, Watson MA, Matsukuma KE, Walczak R,
Collins JL, Osborne TF, Tontonoz P 2002 Direct and indirect mechanisms for

regulation of fatty acid synthase gene expression by liver X receptors. The Journal
of biological chemistry 27721 1019-] 1025

. Chu K, Miyazaki M, Man WC, Ntambi JM 2006 Stearoyl—coenzyme A desaturase

1 deficiency protects against hypertriglyceridemia and increases plasma high-
density lipoprotein cholesterol induced by liver X receptor activation. Molecular
and cellular biology 26:6786-6798

Grefhorst A, Elzinga BM, Voshol PJ, Plosch T, Kok T, Bloks VW, van der Sluijs
F H, Havekes LM, Romijn JA, Verkade HJ, Kuipers F 2002 Stimulation of

167

 

 

 

86.

87.

88.

89.

90.

91.

92.

93.

94.

95.

lipogenesis by pharmacological activation of the liver X receptor leads to
production of large, triglyceride-rich very low density lipoprotein particles. The
Journal of biological chemistry 277:34182-34190

Chen G, Liang G, Ou J, Goldstein JL, Brown MS 2004 Central role for liver X
receptor in insulin-mediated activation of Srebp-lc transcription and stimulation

of fatty acid synthesis in liver. Proceedings of the National Academy of Sciences
of the United States of America 101211245-11250

Denechaud PD, Bossard P, Lobaccaro JM, Millatt L, Staels B, Girard J, Postic C
2008 ChREBP, but not LXRS, is required for the induction of glucose-regulated
genes in mouse liver. The Journal of clinical investigation 118:956-964

Kunau WH, Dommes V, Schulz H 1995 beta-oxidation of fatty acids in
mitochondria, peroxisomes, and bacteria: a century of continued progress.
Progress in lipid research 342267-342

Ruderman N, Prentki M 2004 AMP kinase and malonyl-CoA: targets for therapy
of the metabolic syndrome. Nature reviews 3:340-351

Kahn BB, Alquier T, Carling D, Hardie DG 2005 AMP-activated protein kinase:
ancient energy gauge provides clues to modern understanding of metabolism. Cell
metabolism 1:15-25

McGarry JD, Brown NF 1997 The mitochondrial camitine palmitoyltransferase
system. From concept to molecular analysis. European journal of biochemistry /
FEBS 244:1-14

Hostetler HA, Petrescu AD, Kier AB, Schroeder F 2005 Peroxisome proliferator-
activated receptor alpha interacts with high affinity and is conformationally

responsive to endogenous ligands. The Journal of biological chemistry
280:18667-18682

Hostetler HA, Huang H, Kier AB, Schroeder F 2008 Glucose directly links to
lipid metabolism through high affinity interaction with peroxisome proliferator-
activated receptor alpha. The Journal of biological chemistry 283:2246-2254

Leone TC, Weinheimer CJ, Kelly DP 1999 A critical role for the peroxisome
proliferator-activated receptor alpha (PPARalpha) in the cellular fasting response:
the PPARalpha-null mouse as a model of fatty acid oxidation disorders.

Proceedings of the National Academy of Sciences of the United States of America
96:7473-7478

Henquin JC, Ravier MA, Nenquin M, Jonas JC, Gilon P 2003 Hierarchy of the

beta-cell signals controlling insulin secretion. European journal of clinical
investigation 33 2742-750

168

96.

97.

98.

99.

100.

101.

102.

103.

104.

105.

106.

107.

Newgard CB, McGarry JD 1995 Metabolic coupling factors in pancreatic beta-
cell signal transduction. Annual review of biochemistry 64:689-719

Straub SG, Sharp GW 2002 Glucose-stimulated signaling pathways in biphasic
insulin secretion. Diabetes/metabolism research and reviews 182451-463

Jacobson DA, Philipson LH 2007 Action potentials and insulin secretion: new
insights into the role of Kv channels. Diabetes, obesity & metabolism 9 Suppl
2:89-98

Nolan CJ, Madiraju MS, Delghingaro-Augusto V, Peyot ML, Prentki M 2006
Fatty acid signaling in the beta-cell and insulin secretion. Diabetes 55 Suppl
22S16-23

Roduit R, Nolan C, Alarcon C, Moore P, Barbeau A, Delghingaro-Augusto V,
Przybykowski E, Morin J, Masse F, Massie B, Ruderrnan N, Rhodes C, Poitout V,
Prentki M 2004 A role for the malonyl-CoA/long-chain acyl-CoA pathway of
lipid signaling in the regulation of insulin secretion in response to both fuel and
nonfuel stimuli. Diabetes 53:1007-1019

Newsholme P, Bender K, Kiely A, Brennan L 2007 Amino acid metabolism,
insulin secretion and diabetes. Biochemical Society transactions 35:1180-1186

Drucker DJ 2006 The biology of incretin hormones. Cell metabolism 3: 153-165

Nolan CJ, Prentki M 2008 The islet beta-cell: fuel responsive and vulnerable.
Trends in endocrinology and metabolism: TEM 192285-291

Nolan CJ, Leahy J L, Delghingaro-Augusto V, Moibi J, Soni K, Peyot ML, F ortier
M, Guay C, Lamontagne J, Barbeau A, Przybytkowski E, Joly E, Masiello P,
Wang S, Mitchell GA, Prentki M 2006 Beta cell compensation for insulin
resistance in Zucker fatty rats: increased lipolysis and fatty acid signalling.
Diabetologia 49:2120-2130

Schuit F, De Vos A, Farfari S, Moens K, Pipeleers D, Brun T, Prentki M 1997
Metabolic fate of glucose in purified islet cells. Glucose-regulated anaplerosis in
beta cells. The Journal of biological chemistry 272:18572-18579

Farfari S, Schulz V, Corkey B, Prentki M 2000 Glucose-regulated anaplerosis and
cataplerosis in pancreatic beta-cells: possible implication of a pyruvate/citrate

shuttle in insulin secretion. Diabetes 492718-726

Liang Y, Matschinsky FM 1991 Content of CoA-esters in perifused rat islets
stimulated by glucose and other fuels. Diabetes 40:327-333

169

108.

109.

110.

111.

112.

113.

114.

115.

116.

117.

Corkey BE, Glennon MC, Chen KS, Deeney JT, Matschinsky FM, Prentki M
1989 A role for malonyl-CoA in glucose-stimulated insulin secretion from clonal
pancreatic beta-cells. The Journal of biological chemistry 264221608-21612

Macdonald MJ, Hasan NM, Longacre MJ 2008 Studies with leucine, beta-
hydroxybutyrate and ATP citrate lyase-deficient beta cells support the

acetoacetate pathway of insulin secretion. Biochimica et biophysica acta
1780:966-972

MacDonald MJ, Dobrzyn A, Ntambi J, Stoker SW 2008 The role of rapid
lipogenesis in insulin secretion: Insulin secretagogues acutely alter lipid

composition of INS-1 832/ 13 cells. Archives of biochemistry and biophysics
470:153-162

Wang H, Wollheim CB 2002 ChREBP rather than USF2 regulates glucose

stimulation of endogenous L-pyruvate kinase expression in insulin-secreting cells.

The Journal of biological chemistry 277:32746-32752

da Silva Xavier G, Rutter GA, Diraison F, Andreolas C, Leclerc I 2006 ChREBP
binding to fatty acid synthase and L-type pyruvate kinase genes is stimulated by
glucose in pancreatic beta-cells. Journal of lipid research 47:2482-2491

Brun T, Roche E, Kim KH, Prentki M 1993 Glucose regulates acetyl-CoA
carboxylase gene expression in a pancreatic beta-cell line (INS-1). The Journal of
biological chemistry 268: 18905-1 89] 1

Sandberg MB, Fridriksson J, Madsen L, Rishi V, Vinson C, Holmsen H, Berge
RK, Mandrup S 2005 Glucose-induced lipogenesis in pancreatic beta-cells is
dependent on SREBP-1. Molecular and cellular endocrinology 240294-106

Andreolas C, da Silva Xavier G, Diraison F, Zhao C, Varadi A, Lopez-Casillas F,
Ferre P, F oufelle F, Rutter GA 2002 Stimulation of acetyl-CoA carboxylase gene
expression by glucose requires insulin release and sterol regulatory element
binding protein 1c in pancreatic MIN6 beta-cells. Diabetes 51:2536-2545

Diraison F, Parton L, Ferre P, F oufelle F, Briscoe CP, Leclerc I, Rutter GA 2004
Over-expression of sterol-regu1atory-element-binding protein-1c (SREBPlc) in
rat pancreatic islets induces lipogenesis and decreases glucose-stimulated insulin

release: modulation by 5-aminoimidazole-4-carboxamide ribonucleoside
(AICAR). The Biochemical journal 378:769-778

Gerin I, Dolinsky VW, Shackman JG, Kennedy RT, Chiang SH, Burant CF,
Steffensen KR, Gustafsson J A, MacDougald 0A 2005 LXRbeta is required for
adipocyte growth, glucose homeostasis, and beta cell function. The Journal of
biological chemistry 280:23024-23031

170

 

 

118.

119.

120.

121.

122.

123.

124.

125.

126.

127.

Choe SS, Choi AH, Lee JW, Kim KH, Chung JJ, Park J, Lee KM, Park KG, Lee
IK, Kim JB 2007 Chronic activation of liver X receptor induces beta-cell
apoptosis through hyperactivation of lipogenesis: liver X receptor-mediated
lipotoxicity in pancreatic beta-cells. Diabetes 56:1534-1543

Helleboid-Chapman A, Helleboid S, Jake] H, Timmerman C, Sergheraert C,
Pattou F, F ruchart-Najib J, Fruchart JC 2006 Glucose regulates LXRalpha

subcellular localization and function in rat pancreatic beta-cells. Cell research
162661-670

Rubi B, Antinozzi PA, Herrero L, Ishihara H, Asins G, Serra D, Wollheim CB,
Maechler P, Hegardt F G 2002 Adenovirus-mediated overexpression of liver
camitine palmitoyltransferase I in INSlE cells: effects on cell metabolism and
insulin secretion. The Biochemical journal 364:2]9-226

Salt IP, Johnson G, Ashcroft SJ, Hardie DG 1998 AMP-activated protein kinase is
activated by low glucose in cell lines derived from pancreatic beta cells, and may
regulate insulin release. The Biochemical journal 335 ( Pt 3):533-539

Zhang S, Kim KH 1995 Glucose activation of acetyl-CoA carboxylase in

association with insulin secretion in a pancreatic beta-cell line. J Endocrinol
147:33-41

Chen J, Jeppesen PB, Nordentoft I, Hermansen K 2007 Stevioside improves
pancreatic beta-cell function during glucotoxicity via regulation of acetyl-CoA
carboxylase. American journal of physiology 2922E1906-19l6

Roduit R, Morin J, Masse F, Segall L, Roche E, Newgard CB, Assimacopoulos-
Jeannet F, Prentki M 2000 Glucose down-regulates the expression of the
peroxisome proliferator-activated receptor-alpha gene in the pancreatic beta -cell.
The Journal of biological chemistry 275:35799-35806

Ravnskjaer K, Boergesen M, Dalgaard LT, Mandrup S 2006 Glucose-induced
repression of PPARalpha gene expression in pancreatic beta-cells involves PP2A
activation and AMPK inactivation. J Mol Endocrinol 36:289-299

Khan A, Ling ZC, Landau BR 1996 Quantifying the carboxylation of pyruvate in
pancreatic islets. The Journal of biological chemistry 271:2539-2542

Lu D, Mulder H, Zhao P, Burgess SC, Jensen MV, Kamzolova S, Newgard CB,
Sherry AD 2002 13C NMR isotopomer analysis reveals a connection between
pyruvate cycling and glucose-stimulated insulin secretion (GSIS). Proceedings of
the National Academy of Sciences of the United States of America 9922708-2713

171

 

128.

129.

130.

131.

132.

133.

134.

135.

136.

137.

MacDonald MJ 1993 Estimates of glycolysis, pyruvate (de)carboxylation, pentose
phosphate pathway, and methyl succinate metabolism in incapacitated pancreatic
islets. Archives of biochemistry and biophysics 305:205-214

Guay C, Madiraju SR, Aumais A, Joly E, Prentki M 2007 A role for ATP-citrate
lyase, malic enzyme, and pyruvate/citrate cycling in glucose-induced insulin
secretion. The Journal of biological chemistry 282:35657-35665

Ronnebaum SM, Ilkayeva O, Burgess SC, Joseph JW, Lu D, Stevens RD, Becker
TC, Sherry AD, Newgard CB, Jensen MV 2006 A pyruvate cycling pathway
involving cytosolic NADP-dependent isocitrate dehydrogenase regulates glucose-

stimulated insulin secretion. The Journal of biological chemistry 281230593-
30602

Joseph JW, Jensen MV, Ilkayeva O, Palmieri F, Alarcon C, Rhodes CJ, Newgard
CB 2006 The mitochondrial citrate/isocitrate carrier plays a regulatory role in

glucose-stimulated insulin secretion. The Journal of biological chemistry
281:35624-35632

Pongratz RL, Kibbey RG, Shulman GI, Cline GW 2007 Cytosolic and
mitochondrial malic enzyme isoforms differentially control insulin secretion. The
Journal of biological chemistry 282:200-207

MacDonald MJ 1995 Feasibility of a mitochondrial pyruvate malate shuttle in

pancreatic islets. Further implication of cytosolic NADPH in insulin secretion.
The Journal of biological chemistry 270:20051-20058

Cline GW, Lepine RL, Papas KK, Kibbey RG, Shulman GI 2004 13C NMR
isotopomer analysis of anaplerotic pathways in INS-1 cells. The Journal of
biological chemistry 27924437 0-44375

Stark R, Pasquel F, Turcu A, Pongratz RL, Roden M, Cline GW, Shulman GI,
Kibbey RG 2009 Phosphoenolpyruvate cycling via mitochondrial pepck links
anaplerosis and mitochondrial GTP with insulin secretion. The Journal of
biological chemistry

Ivarsson R, Quintens R, Dejonghe S, Tsukamoto K, in 't Veld P, Renstrom E,
Schuit FC 2005 Redox control of exocytosis: regulatory role of NADPH,
thioredoxin, and glutaredoxin. Diabetes 54: 2132- 2142

Reinbothe TM, Ivarsson R, Li DQ, Niazi O, Jing X, Zhang B, Stenson L, Brybom
U, Renstrom E 2009 Glutaredoxin-l mediates NADPH-dependent stimulation of

calcium-dependent insulin secretion. Molecular endocrinology (Baltimore, Md
23:893-900

172

 

138.

139.

140.

141.

142.

143.

144.

145.

146.

Flamez D, Berger V, Kruhoffer M, Omtofi T, Pipeleers D, Schuit FC 2002
Critical role for cataplerosis via citrate in glucose-regulated insulin release.
Diabetes 51:2018-2024

Brun T, Roche E, Assimacopoulos-Jeannet F, Corkey BE, Kim KH, Prentki M
1996 Evidence for an anaplerotic/malonyl-COA pathway in pancreatic beta-cell
nutrient signaling. Diabetes 45: 190-198

Herrero L, Rubi B, Sebastian D, Serra D, Asins G, Maechler P, Prentki M,
Hegardt F G 2005 Alteration of the malonyl-CoA/camitine palmitoyltransferase 1

interaction in the beta-cell impairs glucose-induced insulin secretion. Diabetes
54:462-471

Zhang S, Kim KH 1998 Essential role of acetyl-CoA carboxylase in the glucose-

induced insulin secretion in a pancreatic beta-cell line. Cellular signalling 10235-
42

Gremlich S, Nolan C, Roduit R, Burcelin R, Peyot ML, Delghingaro-Augusto V,
Desvergne B, Michalik L, Prentki M, Wahli W 2005 Pancreatic islet adaptation to
fasting is dependent on peroxisome proliferator-activated receptor alpha
transcriptional up-regulation of fatty acid oxidation. Endocrinology 146:3 75-3 82

Tordjman K, Standley KN, Bemal-Mizrachi C, Leone TC, Coleman T, Kelly DP,
Semenkovich CF 2002 PPARalpha suppresses insulin secretion and induces
UCP2 in insulinoma cells. Journal of lipid research 432936-943

Bratanova-Tochkova TK, Cheng H, Daniel S, Gunawardana S, Liu YJ,
Mulvaney-Musa J, Schermerhorn T, Straub SG, Yajima H, Sharp GW 2002
Triggering and augmentation mechanisms, granule pools, and biphasic insulin
secretion. Diabetes 51 Suppl 12S83-90

Itoh Y, Kawamata Y, Harada M, Kobayashi M, Fujii R, Fukusumi S, Ogi K,
Hosoya M, Tanaka Y, Uejima H, Tanaka H, Maruyama M, Satoh R, Okubo S,
Kizawa H, Komatsu H, Matsumura F, Noguchi Y, Shinohara T, Hinuma S,

Fujisawa Y, Fujino M 2003 Free fatty acids regulate insulin secretion from
pancreatic beta cells through GPR40. Nature 4222173-176

Tomita T, Masuzaki H, Iwakura H, Fujikura J, Noguchi M, Tanaka T, Ebihara K,
Kawamura J, Komoto I, Kawaguchi Y, F ujimoto K, Doi R, Shimada Y, Hosoda
K, Imamura M, Nakao K 2006 Expression of the gene for a membrane-bound
fatty acid receptor in the pancreas and islet cell tumours in humans: evidence for

GPR40 expression in pancreatic beta cells and implications for insulin secretion.
Diabetologia 49:962-968

173

 

147.

148.

149.

150.

151.

152.

153.

154.

155.

156.

157.

Shapiro H, Shachar S, Sekler I, Hershfinkel M, Walker MD 2005 Role of GPR40
in fatty acid action on the beta cell line INS-1E. Biochemical and biophysical
research communications 33 5297- 104

Latour MG, Alquier T, Oseid E, Tremblay C, Jetton TL, Luo J, Lin DC, Poitout V
2007 GPR40 is necessary but not sufficient for fatty acid stimulation of insulin
secretion in vivo. Diabetes 56: 1087- 1094

Martins EF, Miyasaka CK, Newsholme P, Curi R, Carpinelli AR 2004 Changes of
fatty acid composition in incubated rat pancreatic islets. Diabetes & metabolism
30221-27

Gonzalo S, Linder ME 1998 SNAP-25 palmitoylation and plasma membrane
targeting require a functional secretory pathway. Molecular biology of the cell
92585-5 97

Chapman ER, Blasi J, An S, Brose N, Johnston PA, Sudhof TC, Jahn R 1996
Fatty acylation of synaptotagmin in PC12 cells and synaptosomes. Biochemical
and biophysical research communications 225:326-332

Hu L, Deeney JT, Nolan CJ, Peyot ML, A0 A, Richard AM, Luc E, Faergeman
NJ, Knudsen J, Guo W, Sorhede-Winzell M, Prentki M, Corkey BE 2005
Regulation of lipolytic activity by long-chain acyl-coenzyme A in islets and
adipocytes. American journal of physiology 2892E1085-1092

Peter-Riesch B, Fathi M, Schlegel W, Wollheim CB 1988 Glucose and carbachol
generate 1,2-diacylglycerols by different mechanisms in pancreatic islets. The
Journal of clinical investigation 81:] 154-1 161

Yang C, Kazanietz MG 2003 Divergence and complexities in DAG signaling:
looking beyond PKC. Trends in pharmacological sciences 242602-608

Prentki M, Matschinsky FM 1987 Ca2+, CAMP, and phospholipid-derived
messengers in coupling mechanisms of insulin secretion. Physiological reviews
67:1185-1248

Yedovitzky M, Mochly-Rosen D, Johnson JA, Gray MO, Ron D, Abramovitch E,
Cerasi E, Nesher R 1997 Translocation inhibitors define specificity of protein

kinase C isoenzymes in pancreatic beta-cells. The Journal of biological chemistry
272:1417-1420

Pinton P, Tsuboi T, Ainscow EK, Pozzan T, Rizzuto R, Rutter GA 2002
Dynamics of glucose-induced membrane recruitment of protein kinase C beta I]

in living pancreatic islet beta-cells. The Journal of biological chemistry
277:37702-37710

174

 

158.

159.

160.

161.

162.

163.

164.

165.

166.

167.

168.

Biden TJ, Schmitz-Peiffer C, Burchfield JG, Gurisik E, Cantley J, Mitchell CJ,
Carpenter L 2008 The diverse roles of protein kinase C in pancreatic beta-cell
function. Biochemical Society transactions 362916-919

Sheu L, Pasyk EA, Ji J, Huang X, Gao X, Varoqueaux F, Brose N, Gaisano HY
2003 Regulation of insulin exocytosis by Munc13-l. The Journal of biological
chemistry 278:27556-27563

Kwan EP, Xie L, Sheu L, Nolan CJ, Prentki M, Betz A, Brose N, Gaisano HY
2006 Muncl3-1 deficiency reduces insulin secretion and causes abnormal glucose
tolerance. Diabetes 55:1421-1429

Rhee J S, Betz A, Pyott S, Reim K, Varoqueaux F, Augustin I, Hesse D, Sudhof P
TC, Takahashi M, Rosenmund C, Brose N 2002 Beta phorbol ester- and

diacylglycerol-induced augmentation of transmitter release is mediated by
Muncl3s and not by PKCS. Cell 108:121-133

Noel RJ, Antinozzi PA, McGarry JD, Newgard CB 1997 Engineering of glycerol- :
stimulated insulin secretion in islet beta cells. Differential metabolic fates of E
glucose and glycerol provide insight into mechanisms of stimulus-secretion

coupling. The Journal of biological chemistry 272: 18621-18627

 

Peyot ML, Nolan CJ, Soni K, Joly E, Lussier R, Corkey BE, Wang SP, Mitchell
GA, Prentki M 2004 Horrnone-sensitive lipase has a role in lipid Signaling for

insulin secretion but is nonessential for the incretin action of glucagon-like
peptide 1 . Diabetes 5321733-1742

Mulder H, Yang S, Winzell MS, Holm C, Ahren B 2004 Inhibition of lipase
activity and lipolysis in rat islets reduces insulin secretion. Diabetes 532122-128

Peyot ML, Guay C, Latour MG, Lamontagne J, Lussier R, Pineda M, Ruderman
NB, Haemmerle G, Zechner R, Joly E, Madiraju SR, Poitout V, Prentki M 2009

Adipose triglyceride lipase is implicated in fuel- and non-firel-stimulated insulin
secretion. The Journal of biological chemistry 284:16848-16859

Zawalich WS, Zawalich KC 1996 Regulation of insulin secretion by
phospholipase C. The American journal of physiology 271:E409-416

Hughes WE, Elgundi Z, Huang P, Frohman MA, Biden TJ 2004 Phospholipase
Dl regulates secretagogue-stimulated insulin release in pancreatic beta-cells. The
Journal of biological chemistry 279:27534-27541

Zechner R, Strauss JG, Haemmerle G, Lass A, Zimmerrnann R 2005 Lipolysis:
pathway under construction. Current opinion in lipidology 162333-340

175

169.

170.

171.

172.

173.

174.

175.

176.

177.

178.

Raben DM, Baldassare JJ 2005 A new lipase in regulating lipid mobilization:
hormone-sensitive lipase is not alone. Trends in endocrinology and metabolism:
TEM 16:35-36

Wolf G 2005 The mechanism and regulation of fat mobilization from adipose
tissue: desnutrin, a newly discovered lipolytic enzyme. Nutrition reviews 63: 166-
170

Baulande S, Lasnier F, Lucas M, Pairault J 2001 Adiponutrin, a transmembrane
protein corresponding to a novel dietary- and obesity-linked mRNA specifically
expressed in the adipose lineage. The Journal of biological chemistry 276233336-
33344

Lake AC, Sun Y, Li JL, Kim JE, Johnson JW, Li D, Revett T, Shih HH, Liu W, _
Paulsen J E, Gimeno RE 2005 Expression, regulation, and triglyceride hydrolase 1,.
activity of Adiponutrin family members. Journal of lipid research 4622477-2487 i

Soni KG, Lehner R, Metalnikov P, O'Donnell P, Semache M, Gao W, Ashman K,
Pshezhetsky AV, Mitchell GA 2004 Carboxylesterase 3 (EC 3.1.1.1) is a major L
adipocyte lipase. The Journal of biological chemistry 279:40683-40689 '

 

Mulder H, Holst LS, Svensson H, Degerrnan E, Sundler F, Ahren B, Rorsman P,
Holm C 1999 Hormone-sensitive lipase, the rate-limiting enzyme in triglyceride
hydrolysis, is expressed and active in beta-cells. Diabetes 482228-232

Winzell MS, Svensson H, Arner P, Ahren B, Holm C 2001 The expression of
hormone-sensitive lipase in clonal beta-cells and rat islets is induced by long-term
exposure to high glucose. Diabetes 50:2225-2230

Fex M, Olofsson CS, Fransson U, Bacos K, Lindvall H, Sorhede-Winzell M,
Rorsman P, Holm C, Mulder H 2004 Hormone-sensitive lipase deficiency in
mouse islets abolishes neutral cholesterol ester hydrolase activity but leaves

lipolysis, acylglycerides, fat oxidation, and insulin secretion intact. Endocrinology
145:3746-3753

Holm C, Osterlund T, Laurel] H, Contreras JA 2000 Molecular mechanisms

regulating hormone—sensitive lipase and lipolysis. Annual review of nutrition
202365-393

Fex M, Haemmerle G, Wierup N, Dekker-Nitert M, Rehn M, Ristow M, Zechner
R, Sundler F, Holm C, Eliasson L, Mulder H 2009 A beta cell-specific knockout
of hormone-sensitive lipase in mice results in hyperglycaemia and disruption of

exocytosis. Diabetologia 522271-280

176

179.

180.

181.

182.

183.

184.

185.

186.

187.

188.

189.

190.

Larsson S, Wierup N, Sundler F, Eliasson L, Holm C 2008 Lack of cholesterol
mobilization in islets of hormone-sensitive lipase deficient mice impairs insulin
secretion. Biochemical and biophysical research communications 3762558-562

Lindvall H, Nevsten P, Strom K, Wallenberg R, Sundler F, Langin D, Winzell
MS, Holm C 2004 A novel hormone-sensitive lipase isoform expressed in
pancreatic beta-cells. The Journal of biological chemistry 27923828-3 836

Mathias PC, Best L, Malaisse WJ 1985 Stimulation by glucose and
carbamylcholine of phospholipase C in pancreatic islets. Cell biochemistry and
function 32173-177

Prentki M, Janjic D, Biden TJ, Blondel B, Wollheim CB 1984 Regulation of
Ca2+ transport by isolated organelles of a rat insulinoma. Studies with

endoplasmic reticulum and secretory granules. The Journal of biological
chemistry 259:10118-10123

Prentki M, Biden TJ, Janjic D, Irvine RF, Berridge MJ, Wollheim CB 1984 Rapid
mobilization of Ca2+ fiom rat insulinoma microsomes by inositol-1,4,5-
trisphosphate. Nature 309:562-564

Biden TJ, Prentki M, Irvine RF, Berridge MJ, Wollheim CB 1984 Inositol 1,4,5-
trisphosphate mobilizes intracellular Ca2+ from permeabilized insulin-secreting
cells. The Biochemical journal 223:467-473

Zawalich WS, Zawalich KC, Kelley GG 1995 Regulation of insulin release by
phospholipase C activation in mouse islets: differential effects of glucose and
neurohumoral stimulation. Endocrinology 13624903-4909

Exton JH 2002 Phospholipase D-structure, regulation and fimction. Reviews of
physiology, biochemistry and pharmacology 14421-94

Liscovitch M, Czarny M, Fiucci G, Lavie Y, Tang X 1999 Localization and

possible functions of phospholipase D isozymes. Biochimica et biophysica acta
1439:245-263

Jones D, Morgan C, Cockcroft S 1999 Phospholipase D and membrane traffic.
Potential roles in regulated exocytosis, membrane delivery and vesicle budding.
Biochimica et biophysica acta 1439:229-244

Kooijman EE, Chupin V, dc Kruijff B, Burger KN 2003 Modulation of membrane
curvature by phosphatidic acid and lysophosphatidic acid. Traffic (Copenhagen,
Denmark) 4:162-174

Poitout V 2008 Phospholipid hydrolysis and insulin secretion: a step toward
solving the Rubik's cube. American journal of physiology 2942E214-216

177

 

191.

192.

193.

194.

195.

196.

197.

198.

199.

Gross RW, Ramanadham S, Kruszka KK, Han X, Turk J 1993 Rat and human
pancreatic islet cells contain a calcium ion independent phospholipase A2 activity
selective for hydrolysis of arachidonate which is stimulated by adenosine
triphosphate and iS specifically localized to islet beta-cells. Biochemistry 32:327-
336

Ramanadham S, Bohrer A, Mueller M, Jett P, Gross RW, Turk J 1993 Mass
spectrometric identification and quantitation of arachidonate-containing
phospholipids in pancreatic islets: prominence of plasmenylethanolamine
molecular species. Biochemistry 32:5339-5351

Wolf BA, Pasquale SM, Turk J 1991 Free fatty acid accumulation in
secretagogue-stimulated pancreatic islets and effects of arachidonate on
depolarization-induced insulin secretion. Biochemistry 30:63 72-6379

Jacobson DA, Weber CR, Bao S, Turk J, Philipson LH 2007 Modulation of the
pancreatic islet beta-cell-delayed rectifier potassium channel Kv2.1 by the

polyunsaturated fatty acid arachidonate. The Journal of biological chemistry
282:7442-7449

Ma Z, Ramanadham S, Wohltmann M, Bohrer A, Hsu FF, Turk J 2001 Studies of
insulin secretory responses and of arachidonic acid incorporation into
phospholipids of stably transfected insulinoma cells that overexpress group VIA
phospholipase A2 (iPLA2beta ) indicate a signaling rather than a housekeeping
role for iPLA2beta. The Journal of biological chemistry 276213198-13208

Bao S, Bohrer A, Ramanadham S, J in W, Zhang S, Turk J 2006 Effects of stable
suppression of Group VIA phospholipase A2 expression on phospholipid content
and composition, insulin secretion, and proliferation of INS-l insulinoma cells.
The Journal of biological chemistry 281:187-198

Bao S, Song H, Wohltmann M, Ramanadham S, Jin W, Bohrer A, Turk J 2006
Insulin secretory responses and phospholipid composition of pancreatic islets
from mice that do not express Group VIA phospholipase A2 and effects of

metabolic stress on glucose homeostasis. The Journal of biological chemistry
281:20958-20973

Bao S, Jacobson DA, Wohltmann M, Bohrer A, Jin W, Philipson LH, Turk J 2008
Glucose homeostasis, insulin secretion, and islet phospholipids in mice that
overexpress iPLA2beta in pancreatic beta-cells and in iPLA2beta-null mice.
American journal of physiology 2942E217-229

Unger RH, Grundy S 1985 Hyperglycaemia as an inducer as well as a

consequence of impaired islet cell firnction and insulin resistance: implications for
the management of diabetes. Diabetologia 282119-121

178

200.

201.

202.

203.

204.

205.

206.

207.

208.

209.

210.

211.

Shafiir E, Gutman A 1965 Patterns of Decrease of Free Fatty Acids During
Glucose Tolerance Tests. Diabetes 14:77-83

Reaven GM, Hollenbeck C, Jeng CY, Wu MS, Chen YD 1988 Measurement of
plasma glucose, free fatty acid, lactate, and insulin for 24 h in patients with
NIDDM. Diabetes 37: 1020- 1 024

Paolisso G, Tataranni PA, Foley JE, Bogardus C, Howard BV, Ravussin E 1995
A high concentration of fasting plasma non-esterified fatty acids is a risk factor
for the development of NIDDM. Diabetologia 38:1213-1217

Unger RH 1995 Lipotoxicity in the pathogenesis of obesity-dependent NIDDM.
Genetic and clinical implications. Diabetes 442863-870

Eizirik DL, Cardozo AK, Cnop M 2008 The role for endoplasmic reticulum stress
in diabetes mellitus. Endocrine reviews 29:42-61

Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K 2001 XBP] mRNA is
induced by ATF6 and Spliced by IREl in response to ER stress to produce a
highly active transcription factor. Cell 107:881-891

Calfon M, Zeng H, Urano F, Till JI-I, Hubbard SR, Harding HP, Clark SG, Ron D
2002 IRE] couples endoplasmic reticulum load to secretory capacity by
processing the XBP-l mRNA. Nature 415292-96

Lee AH, Chu GC, Iwakoshi NN, Glimcher LH 2005 XBP-l is required for
biogenesis of cellular secretory machinery of exocrine glands. The EMBO journal
24:4368-4380

Lee AH, Iwakoshi NN, Glimcher LB 2003 XBP-l regulates a subset of
endoplasmic reticulum resident chaperone genes in the unfolded protein response.
Molecular and cellular biology 23:7448-7459

Lee K, Tirasophon W, Shen X, Michalak M, Prywes R, Okada T, Yoshida H,
Mori K, Kaufman RJ 2002 IREl-mediated unconventional mRNA splicing and
S2P-mediated ATF6 cleavage merge to regulate XBPl in signaling the unfolded
protein response. Genes & development 162452-466

Lee AH, Scapa EF, Cohen DE, Glimcher LH 2008 Regulation of hepatic
lipogenesis by the transcription factor XBP]. Science (New York, NY 32021492-
1496

Domer AJ, Wasley LC, Kaufman RJ 1992 Overexpression of GRP78 mitigates

stress induction of glucose regulated proteins and blocks secretion of selective
proteins in Chinese hamster ovary cells. The EMBO journal 1121563-1571

179

212.

213.

214.

215.

216.

217.

218.

219.

220.

221.

222.

Bertolotti A, Zhang Y, Hendershot LM, Harding HP, Ron D 2000 Dynamic
interaction of BiP and ER stress transducers in the unfolded-protein response.
Nature cell biology 22326-332

Liu CY, Schroder M, Kaufman RJ 2000 Ligand-independent dimerization
activates the stress response kinases IRE] and PERK in the lumen of the
endoplasmic reticulum. The Journal of biological chemistry 275224881-24885

Shen J, Chen X, Hendershot L, Prywes R 2002 ER stress regulation of ATF6
localization by dissociation of BiP/GRP78 binding and unmasking of Golgi
localization signals. Developmental cell 3299-111

Hinnebusch AG 1993 Gene-specific translational control of the yeast GCN4 gene

by phosphorylation of eukaryotic initiation factor 2. Molecular microbiology
102215-223

Harding HP, Novoa 1, Zhang Y, Zeng H, Wek R, Schapira M, Ron D 2000
Regulated translation initiation controls stress-induced gene expression in
mammalian cells. Molecular cell 621099-1 108

Harding HP, Zhang Y, Zeng H, Novoa 1, Lu PD, Calfon M, Sadri N, Yun C,
Popko B, Paules R, Stojdl DF, Bell JC, Hettmann T, Leiden JM, Ron D 2003 An
integrated stress response regulates amino acid metabolism and resistance to
oxidative stress. Molecular cell 112619-633

Yoshida H, Haze K, Yanagi H, Yura T, Mori K 1998 Identification of the cis-
acting endoplasmic reticulum stress response element responsible for
transcriptional induction of mammalian glucose-regulated proteins. Involvement

of basic leucine zipper transcription factors. The Journal of biological chemistry
273233741-33749

Okada T, Yoshida H, Akazawa R, Negishi M, Mori K 2002 Distinct roles of
activating transcription factor 6 (ATF6) and double-stranded RNA-activated
protein kinase-like endoplasmic reticulum kinase (PERK) in transcription during
the mammalian unfolded protein response. The Biochemical journal 366:585-594

Elouil H, Bensellam M, Guiot Y, Vander Mierde D, Pascal SM, Schuit FC, Jonas
JC 2007 Acute nutrient regulation of the unfolded protein response and integrated
stress response in cultured rat pancreatic islets. Diabetologia 50: 1442-1452

Marchetti P, Bugliani M, Lupi R, Marselli L, Masini M, Boggi U, Filipponi F,
Weir GC, Eizirik DL, Cnop M 2007 The endoplasmic reticulum in pancreatic beta
cells of type 2 diabetes patients. Diabetologia 5022486-2494

Cunha DA, Hekerman P, Ladriere L, Bazarra-Castro A, Ortis F, Wakeham MC,
Moore F, Rasschaert J, Cardozo AK, Bellomo E, Overbergh L, Mathieu C, Lupi

180

223.

224.

225.

226.

227.

228.

229.

230.

231.

232.

R, Hai T, Herchuelz A, Marchetti P, Rutter GA, Eizirik DL, Cnop M 2008
Initiation and execution of lipotoxic ER stress in pancreatic beta-cells. Journal of
cell science 12122308-2318

Karaskov E, Scott C, Zhang L, Teodoro T, Ravazzola M, Volchuk A 2006
Chronic palmitate but not oleate exposure induces endoplasmic reticulum stress,

which may contribute to INS-l pancreatic beta-cell apoptosis. Endocrinology
14723398-3407

Laybutt DR, Preston AM, Akerfeldt MC, Kench JG, Busch AK, Biankin AV,
Biden TJ 2007 Endoplasmic reticulum stress contributes to beta cell apoptosis in
type 2 diabetes. Diabetologia 502752-763

Grankvist K, Marklund SL, Taljedal [B 1981 CuZn-superoxide dismutase, Mn-
superoxide dismutase, catalase and glutathione peroxidase in pancreatic islets and
other tissues in the mouse. The Biochemical journal 1992393-398

Tiedge M, Lortz S, Drinkgern J, Lenzen S 1997 Relation between antioxidant

enzyme gene expression and antioxidative defense status of insulin-producing
cells. Diabetes 46: 1733-1742

Robertson RP 2004 Chronic oxidative stress as a central mechanism for glucose
toxicity in pancreatic islet beta cells in diabetes. The Journal of biological
chemistry 279242351-42354

Tanaka Y, Gleason CE, Tran PO, Harmon J S, Robertson RP 1999 Prevention of
glucose toxicity in HIT-T15 cells and Zucker diabetic fatty rats by antioxidants.

Proceedings of the National Academy of Sciences of the United States of America
96210857-10862

Hohmeier HE, Thigpen A, Tran W, Davis R, Newgard CB 1998 Stable
expression of manganese superoxide dismutase (MnSOD) in insulinoma cells
prevents IL-lbeta- induced cytotoxicity and reduces nitric oxide production. The
Journal of clinical investigation 10] 2181 1-1820

Oprescu AI, Bikopoulos G, Naassan A, Allister EM, Tang C, Park E, Uchino H,
Lewis GF, F antus IG, RozakiS-Adcock M, Wheeler MB, Giacca A 2007 Free
fatty acid-induced reduction in glucose-stimulated insulin secretion: evidence for
a role of oxidative stress in vitro and in vivo. Diabetes 56:2927-2937

Moore PC, Ugas MA, Hagman DK, Parazzoli SD, Poitout V 2004 Evidence
against the involvement of oxidative stress in fatty acid inhibition of insulin
secretion. Diabetes 5322610-2616

Zhou YT, Shimabukuro M, Lee Y, Koyama K, Higa M, Ferguson T, Unger RH
1998 Enhanced de novo lipogenesis in the leptin-unresponsive pancreatic islets of

181

233.

234.

235.

236.

237.

238.

239.

240.

241.

prediabetic Zucker diabetic fatty rats: role in the pathogenesis of lipotoxic
diabetes. Diabetes 47: 1904-1908

Kakuma T, Lee Y, Higa M, Wang Z, Pan W, Shimomura I, Unger RH 2000
Leptin, troglitazone, and the expression of sterol regulatory element binding
proteins in liver and pancreatic islets. Proceedings of the National Academy of
Sciences of the United States of America 9728536-8541

Diraison F, Ravier MA, Richards SK, Smith RM, Shimano H, Rutter GA 2008
SREBP] is required for the induction by glucose of pancreatic beta-cell genes
involved in glucose sensing. Journal of lipid research 492814-822

Takahashi A, Motomura K, Kato T, Yoshikawa T, Nakagawa Y, Yahagi N, Sone
H, Suzuki H, Toyoshima H, Yamada N, Shimano H 2005 Transgenic mice
overexpressing nuclear SREBP-1c in pancreatic beta-cells. Diabetes 542492-499

Kato T, Shimano H, Yamamoto T, Ishikawa M, Kumadaki S, Matsuzaka T,
Nakagawa Y, Yahagi N, Nakakuki M, Hasty AH, Takeuchi Y, Kobayashi K,
Takahashi A, Yatoh S, Suzuki H, Sone H, Yamada N 2008 Palmitate impairs and
eicosapentaenoate restores insulin secretion through regulation of SREBP-10 in
pancreatic islets. Diabetes 5722382-2392

El-Assaad W, Buteau J, Peyot ML, Nolan C, Roduit R, Hardy S, Joly E, Dbaibo
G, Rosenberg L, Prentki M 2003 Saturated fatty acids synergize with elevated
glucose to cause pancreatic beta-cell death. Endocrinology 14424154-4163

Hellemans K, Kerckhofs K, Hannaert JC, Martens G, Van Veldhoven P, Pipeleers
D 2007 Peroxisome proliferator-activated receptor alpha-retinoid X receptor

agonists induce beta-cell protection against palmitate toxicity. The FEBS journal
274:6094-6105

Kelpe CL, Johnson LM, Poitout V 2002 Increasing triglyceride synthesis inhibits
glucose-induced insulin secretion in isolated rat islets of langerhans: a study using

adenoviral expression of diacylglycerol acyltransferase. Endocrinology 14323326-
3332

Winzell MS, Svensson H, Enerback S, Ravnskjaer K, Mandrup S, Esser V, Amer
P, Alves-Guerra MC, Miroux B, Sundler F, Ahren B, Holm C 2003 Pancreatic

beta-cell lipotoxicity induced by overexpression of hormone-sensitive lipase.
Diabetes 52:2057-2065

Cnop M, Hannaert JC, Hoorens A, Eizirik DL, Pipeleers DG 2001 Inverse

relationship between cytotoxicity of free fatty acids in pancreatic islet cells and
cellular triglyceride accumulation. Diabetes 5021771-1777

182

242.

243.

244.

245.

246.

247.

248.

249.

250.

251.

252.

Haataja L, Gurlo T, Huang CJ, Butler PC 2008 Islet amyloid in type 2 diabetes,
and the toxic oligomer hypothesis. Endocrine reviews 292303-316

Ma Y, Brewer JW, Diehl JA, Hendershot LM 2002 Two distinct stress signaling
pathways converge upon the CHOP promoter during the mammalian unfolded
protein response. Journal of molecular biology 31821351-1365

Jiang HY, Wek SA, McGrath BC, Lu D, Hai T, Harding HP, Wang X, Ron D,
Cavener DR, Wek RC 2004 Activating transcription factor 3 is integral to the

eukaryotic initiation factor 2 kinase stress response. Molecular and cellular
biology 2421365-1377

Urano F, Wang X, Bertolotti A, Zhang Y, Chung P, Harding HP, Ron D 2000
Coupling of stress in the ER to activation of JNK protein kinases by
transmembrane protein kinase IRE]. Science (New York, NY 287:664-666

Nishitoh H, Matsuzawa A, Tobiume K, Saegusa K, Takeda K, Inoue K, Hori S,
Kakizuka A, Ichijo H 2002 ASK] is essential for endoplasmic reticulum stress-

induced neuronal cell death triggered by expanded polyglutamine repeats. Genes
& development 16:1345-1355

Song B, Scheuner D, Ron D, Pennathur S, Kaufman RJ 2008 Chop deletion
reduces oxidative stress, improves beta cell function, and promotes cell survival

in multiple mouse models of diabetes. The Journal of clinical investigation
11823378-3389 -

Chinnaiyan AM 1999 The apoptosome: heart and soul of the cell death machine.
Neoplasia (New York, NY 125-15

Hill MM, Adrain C, Duriez PJ, Creagh EM, Martin SJ 2004 Analysis of the
composition, assembly kinetics and activity of native Apaf-l apoptosomes. The
EMBO journal 23:2134-2145

Enari M, Sakahira H, Yokoyama H, Okawa K, Iwamatsu A, Nagata S 1998 A
caspase-activated DNase that degrades DNA during apoptosis, and its inhibitor
ICAD. Nature 391243-50

Odinokova IV, Sung KF, Mareninova OA, Hermann K, Evtodienko Y, Andreyev
A, Gukovsky I, Gukovskaya AS 2009 Mechanisms regulating cytochrome c
release in pancreatic mitochondria. Gut 582431-442

Parton LE, McMillen PJ, Shen Y, Docherty E, Sharpe E, Diraison F, Briscoe CP,
Rutter GA 2006 Limited role for SREBP-1c in defective glucose-induced insulin
secretion from Zucker diabetic fatty rat islets: a functional and gene profiling
analysis. American journal of physiology 2912E982-994

183

253.

254.

255.

256.

257.

258.

259.

260.

261.

Zitzer H, Wente W, Brenner MB, Sewing S, Buschard K, Gromada J, Efanov AM
2006 Sterol regulatory element-binding protein 1 mediates liver X receptor-beta-

induced increases in insulin secretion and insulin messenger ribonucleic acid
levels. Endocrinology 147:3898-3905

Attie AD, Krauss RM, Gray-Keller MP, Brownlie A, Miyazaki M, Kastelein JJ,

Lusis AJ, Stalenhoef AF, Stoehr JP, Hayden MR, Ntambi JM 2002 Relationship
between stearoyl-CoA desaturase activity and plasma triglycerides in human and
mouse hypertriglyceridemia. Journal of lipid research 4321899-1907

Ntambi JM, Miyazaki M, Stoehr JP, Lan H, Kendziorski CM, Yandell BS, Song
Y, Cohen P, Friedman JM, Attie AD 2002 Loss of stearoyl-CoA desaturase-l
function protects mice against adiposity. Proceedings of the National Academy of
Sciences of the United States of America 99211482-11486

Flowers JB, Rabaglia ME, Schueler KL, Flowers MT, Lan H, Keller MP, Ntambi
JM, Attie AD 2007 Loss of stearoyl-CoA desaturase-1 improves insulin

sensitivity in lean mice but worsens diabetes in leptin-deficient obese mice.
Diabetes 56:]228-1239

Hellemans KH, Hannaert JC, Denys B, Steffensen KR, Raemdonck C, Martens
GA, Van Veldhoven PP, Gustafsson JA, Pipeleers D 2009 Susceptibility of
pancreatic beta cells to fatty acids is regulated by LXR/PPARalpha-dependent
stearoyl-coenzyme A desaturase. PloS one 42e7266

Cousin SP, Hugl SR, Wrede CE, Kajio H, Myers MG, Jr., Rhodes CJ 2001 Free
fatty acid-induced inhibition of glucose and insulin-like growth factor I-induced
deoxyribonucleic acid synthesis in the pancreatic beta-cell line INS-1.
Endocrinology 1422229-240

Wells WW, Xu DP, Washburn MP, Cirrito HK, Olson LK 2001
Polyhydroxybenzoates inhibit ascorbic acid activation of mitochondrial glycerol-
3-phosphate dehydrogenase: implications for glucose metabolism and insulin
secretion. The Journal of biological chemistry 276:2404-2410

Linning KD, Tai MH, Madhukar BV, Chang CC, Reed DN, Jr., Ferber S, Trosko
JE, Olson LK 2004 Redox-mediated enrichment of self-renewing adult human

pancreatic cells that possess endocrine differentiation potential. Pancreas 292e64-
76

Botolin D, Jump DB 2003 Selective proteolytic processing of rat hepatic sterol

regulatory element binding protein-l (SREBP-1) and SREBP-2 during postnatal
development. The Journal of biological chemistry 278:6959-6962

184

262.

263.

264.

265.

266.

267.

268.

269.

270.

271.

272.

Ye DZ, Tai MH, Linning KD, Szabo C, Olson LK 2006 MafA expression and
insulin promoter activity are induced by nicotinamide and related compounds in
INS-1 pancreatic beta-cells. Diabetes 552742-750

Zawalich WS, Matschinsky FM 1977 Sequential analysis of the releasing and fuel
function of glucose in isolated perifused pancreatic islets. Endocrinology 10021-8

Pawar A, Xu J, Jerks E, Mangelsdorf DJ, Jump DB 2002 Fatty acid regulation of
liver X receptors (LXR) and peroxisome proliferator-activated receptor alpha
(PPARalpha ) in HEK293 cells. The Journal of biological chemistry 277239243-
39250

Parkera SM, Moorea PC, Johnsona LM, Poitout V 2003 Palmitate potentiation of

glucose-induced insulin release: a study using 2-bromopalmitate. Metabolism
5221367-1371

Foretz M, Pacot C, Dugail I, Lemarchand P, Guichard C, Le Liepvre X,
Berthelier-Lubrano C, Spiegelman B, Kim JB, Ferre P, Foufelle F 1999
ADDl/SREBP-lc is required in the activation of hepatic lipogenic gene
expression by glucose. Molecular and cellular biology 19:3760-3 768

Kim JB, Sarraf P, Wright M, Yao KM, Mueller E, Solanes G, Lowell BB,
Spiegelman BM 1998 Nutritional and insulin regulation of fatty acid synthetase
and leptin gene expression through ADDl/SREBPI. The Journal of clinical
investigation 10121-9

Wang H, Maechler P, Antinozzi PA, Herrero L, Hagenfeldt-Johansson KA,
Bjorklund A, Wollheim CB 2003 The transcription factor SREBP-1c is

instrumental in the development of beta-cell dysfunction. The Journal of
biological chemistry 278:16622-16629

Yamashita T, Eto K, Okazaki Y, Yamashita S, Yamauchi T, Sekine N, Nagai R,
Noda M, Kadowaki T 2004 Role of uncoupling protein-2 up-regulation and
triglyceride accumulation in impaired glucose—stimulated insulin secretion in a

beta-cell lipotoxicity model overexpressing sterol regulatory element-binding
protein-1c. Endocrinology 145 23566-3577

Lee Y, Hirose H, Zhou YT, Esser V, McGarry JD, Unger RH 1997 Increased
lipogenic capacity of the islets of obese rats: a role in the pathogenesis of
NIDDM. Diabetes 462408-413

Mohan R, Heyman RA 2003 Orphan nuclear receptor modulators. Curr Top Med
Chem 321637-1647

Teboul M, Enmark E, Li Q, Wikstrom AC, Pelto-Huikko M, Gustafsson JA 1995
OR-l, a member of the nuclear receptor superfamily that interacts with the 9-cis-

185

273.

274.

275.

276.

277.

278.

279.

280.

281.

retinoic acid receptor. Proceedings of the National Academy of Sciences of the
United States of America 92:2096-2100

Lehmann JM, Kliewer SA, Moore LB, Smith-Oliver TA, Oliver BB, Su JL,
Sundseth SS, Winegar DA, Blanchard DE, Spencer TA, Willson TM 1997
Activation of the nuclear receptor LXR by oxysterols defines a new hormone
response pathway. The Journal of biological chemistry 27223137-3140

Repa JJ, Turley SD, Lobaccaro JA, Medina J, Li L, Lustig K, Shan B, Heyman
RA, Dietschy JM, Mangelsdorf DJ 2000 Regulation of absorption and ABC]-

mediated efflux of cholesterol by RXR heterodimers. Science (New York, NY
28921524-1529

Laffitte BA, Repa JJ, Joseph SB, Wilpitz DC, Kast HR, Mangelsdorf DJ,
Tontonoz P 2001 LXRS control lipid-inducible expression of the apolipoprotein E
gene in macrophages and adipocytes. Proceedings of the National Academy of
Sciences of the United States of America 982507-512

Peet DJ, Turley SD, Ma W, J anowski BA, Lobaccaro JM, Hammer RE,
Mangelsdorf DJ 1998 Cholesterol and bile acid metabolism are impaired in mice
lacking the nuclear oxysterol receptor LXR alpha. Cell 93 2693-704

Repa JJ, Berge KE, Pomajzl C, Richardson JA, Hobbs H, Mangelsdorf DJ 2002
Regulation of ATP-binding cassette sterol transporters ABCGS and ABCG8 by

the liver X receptors alpha and beta. The Journal of biological chemistry
277: 18793-18800

Schultz JR, Tu H, Luk A, Repa JJ, Medina J C, Li L, Schwendner S, Wang S,
Thoolen M, Mangelsdorf DJ, Lustig KD, Shan B 2000 Role of LXRS in control of
lipogenesis. Genes & development 14:2831-2838

Repa JJ, Liang G, On J, Bashmakov Y, Lobaccaro JM, Shimomura I, Shan B,
Brown MS, Goldstein J L, Mangelsdorf DJ 2000 Regulation of mouse sterol

regulatory element-binding protein-lo gene (SREBP-1c) by oxysterol receptors,
LXRalpha and LXRbeta. Genes & development 14:2819-2830

Stulnig TM, Steffensen KR, Gao H, Reimers M, Dahlman-Wright K, Schuster
GU, Gustafsson JA 2002 Novel roles of liver X receptors exposed by gene
expression profiling in liver and adipose tissue. Mol Pharrnacol 62: 1299-1305

Shalev A, Pise-Masison CA, Radonovich M, Hoffmann SC, Hirshberg B, Brady
JN, Harlan DM 2002 Oligonucleotide microarray analysis of intact human

pancreatic islets: identification of glucose-responsive genes and a highly regulated
TGF beta signaling pathway. Endocrinology 14323695-3698

186

282.

283.

284.

285.

286.

287.

288.

289.

290.

291.

292.

Olson LK, Qian J, Poitout V 1998 Glucose rapidly and reversibly decreases INS-1
cell insulin gene transcription via decrements in STF-l and C1 activator
transcription factor activity. Molecular endocrinology (Baltimore, Md 122207-219

Maedler K, Oberholzer J, Bucher P, Spinas GA, Donath MY 2003
Monounsaturated fatty acids prevent the deleterious effects of palmitate and high

glucose on human pancreatic beta-cell turnover and function. Diabetes 52:726-
733

Kridel SJ, Axelrod F, Rozenkrantz N, Smith J W 2004 Orlistat is a novel inhibitor
of fatty acid synthase with antitumor activity. Cancer Res 64:2070-2075

Roche E, F arfari S, Witters LA, Assimacopoulos-Jeannet F, Thumelin S, Brun T,
Corkey BE, Saha AK, Prentki M 1998 Long-term exposure of beta-INS cells to
high glucose concentrations increases anaplerosis, lipogenesis, and lipogenic gene
expression. Diabetes 47: 1086-1094

Steffensen KR, Gustafsson JA 2004 Putative metabolic effects of the liver X
receptor (LXR). Diabetes 53 Suppl 12836-42

Joseph JW, Odegaard ML, Ronnebaum SM, Burgess SC, Muehlbauer J, Sherry
AD, Newgard CB 2007 Normal flux through ATP-citrate lyase or fatty acid

synthase is not required for glucose-stimulated insulin secretion. The Journal of
biological chemistry 282231592-31600

Ronnebaum SM, Joseph JW, Ilkayeva O, Burgess SC, Lu D, Becker TC, Sherry
AD, Newgard CB 2008 Chronic suppression of acetyl-CoA carboxylase 1 in beta-
cells impairs insulin secretion via inhibition of glucose rather than lipid
metabolism. The Journal of biological chemistry 283: 14248-14256

Zhou YP, Grill VB 1994 Long-term exposure of rat pancreatic islets to fatty acids
inhibits glucose-induced insulin secretion and biosynthesis through a glucose fatty
acid cycle. The Journal of clinical investigation 932870-876

Alstrup KK, Brock B, Hermansen K 2004 Long-Term exposure of INS-1 cells to
cis and trans fatty acids influences insulin release and fatty acid oxidation
differentially. Metabolism 5321 158-1165

Zhang Y, Xiao M, Niu G, Tan H 2005 Mechanisms of oleic acid deterioration in
insulin secretion: Role in the pathogenesis of type 2 diabetes. Life Sci

Colin S, Bourguignon E, Boullay AB, Tousaint JJ, Huet S, Caira F, Staels B,
Lestavel S, Lobaccaro JM, Delerive P 2008 Intestine-specific regulation of
PPARalpha gene transcription by liver X receptors. Endocrinology 14925128-
5135

187

 

 

293.

294.

295.

296.

297.

298.

299.

300.

301.

302.

303.

Assimacopoulos-Jeannet F, Thumelin S, Roche E, Esser V, McGarry JD, Prentki
M 1997 Fatty acids rapidly induce the camitine palmitoyltransferase I gene in the
pancreatic beta-cell line IN S-l. The Journal of biological chemistry 27221659-
1664

Boni LT, Rando RR 1985 The nature of protein kinase C activation by physically
defined phospholipid vesicles and diacylglycerols. The Journal of biological
chemistry 260: 10819-10825

Bimer-Gruenberger R, Susani-Etzerodt H, Waldhuber M, Riesenhuber G,
Schmidinger H, Rechberger G, Kollroser M, Strauss JG, Lass A, Zimmermann R,
Haemmerle G, Zechner R, Hermetter A 2005 The lipolytic proteome of mouse
adipose tissue. Mol Cell Proteomics 421710-1717

Duque M, Graupner M, Stutz H, Wicher I, Zechner R, Paltauf F, Hermetter A
1996 New fluorogenic triacylglycerol analogs as substrates for the determination
and chiral discrimination of lipase activities. Journal of lipid research 372868-876

Prentki M, Madiraju SR 2008 Glycerolipid metabolism and signaling in health
and disease. Endocrine reviews 292647-676

Soupene E, Kuypers FA 2008 Mammalian long-chain acyl-CoA synthetases. Exp
Biol Med (Maywood) 233:507-521

Antinozzi PA, Segall L, Prentki M, McGarry JD, Newgard CB 1998 Molecular or
pharrnacologic perturbation of the link between glucose and lipid metabolism is
without effect on glucose-stimulated insulin secretion. A re-evaluation of the
long-chain acyl-CoA hypothesis. The Journal of biological chemistry 273216146-
16154

Straub SG, Shanmugam G, Sharp GW 2004 Stimulation of insulin release by
glucose is associated with an increase in the number of docked granules in the
beta-cells of rat pancreatic islets. Diabetes 5323179-3183

Butler AE, Janson J, Bonner-Weir S, Ritzel R, Rizza RA, Butler PC 2003 Beta-
cell deficit and increased beta-cell apoptosis in humans with type 2 diabetes.
Diabetes 522102-110

Clark A, Wells CA, Buley 1D, Cruickshank JK, Vanhegan RI, Matthews DR,
Cooper GJ, Holman RR, Turner RC 1988 Islet amyloid, increased A-cells,

reduced B-cells and exocrine fibrosis: quantitative changes in the pancreas in type
2 diabetes. Diabetes Res 92151-159

Kloppel G, Lohr M, Habich K, Oberholzer M, Heitz PU 1985 Islet pathology and

the pathogenesis of type 1 and type 2 diabetes mellitus revisited. Surv Synth
Pathol Res 42110-125

188

 

304.

305.

306.

307.

308.

309.

310.

311.

312.

313.

Yoon KH, Ko SH, Cho JH, Lee JM, Ahn YB, Song KH, Yoo SJ, Kang MI, Cha
BY, Lee KW, Son HY, Kang SK, Kim HS, Lee IK, Bonner-Weir S 2003

Selective beta-cell loss and alpha-cell expansion in patients with type 2 diabetes
mellitus in Korea. J Clin Endocrinol Metab 88:2300-2308

Sakuraba H, Mizukami H, Yagihashi N, Wada R, Hanyu C, Yagihashi S 2002
Reduced beta-cell mass and expression of oxidative stress-related DNA damage
in the islet of Japanese Type 11 diabetic patients. Diabetologia 45285-96

Kelpe CL, Moore PC, Parazzoli SD, Wicksteed B, Rhodes CJ, Poitout V 2003
Palmitate inhibition of insulin gene expression is mediated at the transcriptional
level via ceramide synthesis. The Journal of biological chemistry 278230015-
30021

Carlsson C, Borg LA, Welsh N 1999 Sodium palmitate induces partial
mitochondrial uncoupling and reactive oxygen species in rat pancreatic islets in
vitro. Endocrinology 140:3422-3428

Maedler K, Spinas GA, Dyntar D, Moritz W, Kaiser N, Donath MY 2001 Distinct
effects of saturated and monounsaturated fatty acids on beta-cell turnover and
function. Diabetes 50:69-76

Lalloyer F, Vandewalle B, Percevault F, Torpier G, Kerr-Conte J, Oosterveer M,
Paumelle R, F ruchart JC, Kuipers F, Pattou F, Fievet C, Staels B 2006
Peroxisome proliferator-activated receptor alpha improves pancreatic adaptation
to insulin resistance in obese mice and reduces lipotoxicity in human islets.
Diabetes 55:1605-1613

Sol EM, Sargsyan E, Akusjarvi G, Bergsten P 2008 Glucolipotoxicity in INS-1E
cells is counteracted by camitine palmitoyltransferase ] over-expression.
Biochemical and biophysical research communications 3752517-521

Borg J, Klint C, Wierup N, Strom K, Larsson S, Sundler F, Lupi R, Marchetti P,
Xu G, Kimmel A, Londos C, Holm C 2009 Perilipin is present in islets of

Langerhans and protects against lipotoxicity when overexpressed in the beta-cell
line INS-1. Endocrinology 15023049-3057

Lai E, Bikopoulos G, Wheeler MB, RozakiS-Adcock M, Volchuk A 2008
Differential activation of ER stress and apoptosis in response to chronically

elevated free fatty acids in pancreatic beta-cells. American journal of physiology
2942E540-550

Lee Y, Hirose H, Ohneda M, Johnson JH, McGarry JD, Unger RH 1994 Beta-cell
lipotoxicity in the pathogenesis of non-insulin-dependent diabetes mellitus of
obese rats: impairment in adipocyte-beta-cell relationships. Proceedings of the
National Academy of Sciences of the United States of America 91210878-10882

189

 

314.

315.

316.

317.

318.

319.

320.

321.

322.

323.

324.

Martinez SC, Tanabe K, Cras-Meneur C, Abumrad NA, Bemal-Mizrachi E,
Permutt MA 2008 Inhibition of Foxo] protects pancreatic islet beta-cells against

fatty acid and endoplasmic reticulum stress-induced apoptosis. Diabetes 572846-
859

Listenberger LL, Han X, Lewis SE, Cases S, F arese RV, Jr., Ory DS, Schaffer JE
2003 Triglyceride accumulation protects against fatty acid-induced lipotoxicity.

Proceedings of the National Academy of Sciences of the United States of America
10023077-3082

Kakuma T, Lee Y, Unger RH 2002 Effects of leptin, troglitazone, and dietary fat
on stearoyl CoA desaturase. Biochemical and biophysical research
communications 297: 1259- l 263

Toyama T, Kudo N, Mitsumoto A, Kawashima Y 2005 Regulation of palmitoyl-
CoA chain elongation by clofibric acid in the liver of Zucker fa/fa rats. Lipids
402463-470

Wang Y, Botolin D, Xu J, Christian B, Mitchell E, Jayaprakasam B, Nair 'MG,
Peters JM, Busik JV, Olson LK, Jump DB 2006 Regulation of hepatic fatty acid

elongase and desaturase expression in diabetes and obesity. Journal of lipid
research 4722028-2041

Botolin D, Wang Y, Christian B, Jump DB 2006 Docosahexaneoic acid (22:6,n-3)
regulates rat hepatocyte SREBP-1 nuclear abundance by Erk- and 26S
proteasome-dependent pathways. Journal of lipid research 472181-192

Moon YA, Hammer RE, Horton JD 2009 Deletion of ELOVLS leads to fatty liver
through activation of SREBP-1c in mice. Journal of lipid research 502412-423

Waters KM, Ntambi JM 1994 Insulin and dietary fructose induce stearoyl-CoA
desaturase 1 gene expression of diabetic mice. The Journal of biological
chemistry 269227773-27777

Hrelia S, Bordoni A, Celadon M, Turchetto E, Biagi PL, Rossi CA 1989 Age-
related changes in linoleate and alpha-linolenate desaturation by rat liver
microsomes. Biochemical and biophysical research communications 1632348-355

Bordoni A, Biagi PL, Turchetto E, Hrelia S 1988 Aging influence on delta-6-
desaturase activity and fatty acid composition of rat liver microsomes. Biochem
Int 17:1001-1009

Pirot P, Ortis F, Cnop M, Ma Y, Hendershot LM, Eizirik DL, Cardozo AK 2007

Transcriptional regulation of the endoplasmic reticulum stress gene chop in
pancreatic insulin-producing cells. Diabetes 5621069-1077

190

325.

326.

327.

328.

329.

330.

331.

332.

Green CD, Jump DB, Olson LK 2009 Elevated insulin secretion from liver X
receptor-activated pancreatic beta-cells involves increased de novo lipid synthesis
and triacylglyceride turnover. Endocrinology 15022637-2645

F oufelle F, Ferre P 2002 New perspectives in the regulation of hepatic glycolytic
and lipogenic genes by insulin and glucose: a role for the transcription factor

sterol regulatory element binding protein-lo. The Biochemical journal 3662377-
391

Nagai Y, Nishio Y, Nakamura T, Maegawa H, Kikkawa R, Kashiwagi A 2002
Amelioration of high fructose-induced metabolic derangements by activation of
PPARalpha. American journal of physiology 2822B] 180-1190

Okada T, Furuhashi N, Kuromori Y, Miyashita M, Iwata F, Harada K 2005

Plasma palmitoleic acid content and obesity in children. Am J Clin Nutr 822747-
750

Paillard F, Catheline D, Duff FL, Bouriel M, Deugnier Y, Pouchard M, Daubert
JC, Legrand P 2008 Plasma palmitoleic acid, a product of stearoyl-coA desaturase

activity, is an independent marker of triglyceridemia and abdominal adiposity.
Nutr Metab Cardiovasc Dis 182436-440

Cao H, Gerhold K, Mayers JR, Wiest MM, Watkins SM, Hotamisligil GS 2008
Identification of a lipokine, a lipid hormone linking adipose tissue to systemic
metabolism. Cell 134:933-944

Parker-Bames JM, Das T, Bobik E, Leonard AE, Thurmond JM, Chaung LT,
Huang YS, Mukerji P 2000 Identification and characterization of an enzyme
involved in the elongation of n-6 and n-3 polyunsaturated fatty acids. Proceedings
of the National Academy of Sciences of the United States of America 9728284-
8289

Wang Y, Torres-Gonzalez M, Tripathy S, Botolin D, Christian B, Jump DB 2008
Elevated hepatic fatty acid elongase-5 activity affects multiple pathways

controlling hepatic lipid and carbohydrate composition. Journal of lipid research
4921538-1552

191