mm... 431 3.1

HR.
9? .«flflfl»
av

bun—$1..“ ... x .
infixmma?
V. “ J. 4»
‘ 4n 5. ,aaxlhhmvl.

.AL‘ .A

i

. m .12.
A a. .2...
I: 1 v .

. . . I
en»... La
.méfiu

“Hunt“
3.». . . Jada};
finémmfik. i. ‘
3MHovuaanth . .‘l
i a .
.6. .1
“wk" h... {a

#1:

J..IIII
tab... D

1?? 1):. o n h .
.l :1... 5.5!.”th
€019.14!!! 3

.515

Ivar...» 6
tin}?
3.; s}.

M .- v

3'

 

In £1,301
{0.09.}. 4-

33:33

LIBRARY 7
MIFthan State
I_ u'mverSlty I

*

This is to certify that the
dissertation entitled

PEROXISOME DIVISION IN ARABIDOPSIS THALIANA

presented by
XINCHUN ZHANG

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Genetics

 

 

Major Professor's Signature

Date

MS U is an Affirmative Action/Equal Opportunity Employer

— -.-.-.-.-.-.-.-.-.-.-.fl

 

PLACE IN RETURN BOX to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

531g§3214 12
lollARétazma

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K:lProj/Aoc&Pres/CIRCIDateDw.indd

PEROXISOME DIVISION IN ARABIDOPSIS THALIANA
By

Xinchun Zhang

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILSOPHY
Genetics

2009

ABSTRACT
PEROXISOME DIVISION IN ARABIDOPSIS T HALIANA
By
Xinchun Zhang

Peroxisomes are versatile, single-membrane bound organelles with diverse functions in
eukaryotes. Their division is controlled by at least three types of proteins, PEROXINll
(PEXl l), FISSIONI (F181) and Dynamin-Related Proteins (DRPs), in yeast and humans.
The five PEXll proteins promote peroxisome elongation, which initiates peroxisome
division, while DRP3A plays a role in peroxisome fission, the late step of peroxisome
division in Arabidopsis thaliana. To fiirther determine the molecular architecture of
peroxisome division in planta, we used forward and reverse genetic strategies to search
for more players involved in this process. Four new components of the peroxisome
division machinery in Arabidopsis were identified: DRP3B, DRPSB, FISlA and FlSlB.
DRP3B is a homolog of DRP3A, and both proteins are involved in mitochondrial
division. DRP3B appears as puncta marking the fission sites or potential fission sites, not
only on mitochondria, but on peroxisomes. Disruption of DRP3B causes defects in
peroxisome fission. drp3A drp3B double mutants display stronger deficiencies than each
drp3 single mutant in peroxisome abundance, seedling establishment and plant growth,
suggesting that DRP3A and DRP3B are functionally redundant.

DRPSB is the only known DRP serving as a component of the chloroplast division
complexes. We addressed a new role for DRPSB in peroxisome division. Subcellular
localization analysis shows that DRPSB not only forms a ring on chloroplast as

previously reported, but also is co-localized with peroxisomes. Mutations in the DRP5B

gene lead to aggregated peroxisomes with membrane constriction. Furthermore, impaired
peroxisome functions caused by loss of DRPSB affect seedling establishment and plant
growth in Arabidopsis. Taken together, DRPSB mediates peroxisome division.

FISlA and FISlB that are dual-targeted to peroxisomes and mitochondria function in the
division of both organelles. Overexpression of each FISI gene increases the abundance of
both mitochondria and peroxisomes, by contrast, loss of FISI results in number reduction
of both organelles showing incomplete fission and enlarged size. Domain truncation
studies show that the C-terminal transmembrane domain is required for FISl targeting to
peroxisomes. Moreover, FISI silencing experiments demonstrate that FISlA and FISlB
play rate-limiting and partially overlapping roles in promoting the fission of peroxisomes
and mitochondria. In summary, FISlA and FISIB are involved in the fission of
peroxisomes and mitochondria.

Lastly, bimolecular fluorescence complementation (BiFC) and co-immunoprecipitation
(Co-1P) assays demonstrate that DRPSB interacts with itself, and also with both DRP3A
and DRP3B. These physical interactions suggest that the three DRPs may assemble
together to exert their functions on peroxisomal membrane fission. Additionally, F151
and PEXll proteins physically interact with DRPSB, DRP3A and DRP3B in vivo and in
vitro, indicating that two families of transmembrane proteins, FISls and PEXl ls, might
anchor DRPs to different organelles. In conclusion, our data support the view that
PEXl 1, DRPs and F181 orthologs are common conserved proteins of the peroxisomal
division apparatus across eukaryotic species, and plant-specific targeting mechanisms by

which DRPs are recruited to different organelles may have been evolved.

ACKNOWLEDGMENTS

First of all, I would like to express my sincere gratitude to my advisor, Dr. Jianping Hu,
for allowing me to work on such interesting projects, and also for the continuous support
of my Ph.D. study and research. Her invaluable guidance helps me in all the time of
research and writing of this thesis.

I am very grateful to my guidance committee, Dr. Christoph Benning, Dr. Sheng Yang
He, Dr. Katherine Osteryoung and Dr. Steve van Nocker, for their encouragement,
insightful comments and helpful suggestions concerning my research as well as my future

career.

I also want to thank all past and present members of the Hu lab for their help and support
in the lab: Chie Awai, Dr. Kalpana Manandhar-Shrestha, Travis Orth, Kyaw Aung, Dr.
Gaélle Cassin, Dr. Mintu Desai, Navneet Kaur, Dr. Bong Kwan Phee, Dr. Sheng Quan,

Dr. Pingfang Yang and Robert Switzenberg.

My sincere thanks go to Dr. Katherine Osteryoung and her lab members: Dr. Deena
Kadirjan-Kalbach and Dr. Jonathan Glynn for providing seeds of drp5B mutants and
transgenic plants. Their generous help enabled me to finish DRPSB project in a short

time.

Special thanks go to my friends, Dr. Amal Abdul-Hafez, Dr. Hui Chen, Dr. Hoo Sun
Chung, Dr. Hongbo Gao, Dr. Eliana Gonzales-Vigil and Dr. Young Nam Lee for helping
me get through the difficult times, and for their help with my comprehensive

examinations and my experiments.

iv

I want to thank Dr. Melinda Frame for her help with confocal microscopy.

1 am thankful to Dr. Kenneth Nadler (Introductory Plant Physiology) and Dr. Ian
Dworkin (Fundamental Genetics) for their helpful advice when I worked with them as a

teaching assistant.

1 thank Genetics Program and MSU-US. Department of Energy-Plant Research
Laboratory for offering me the opportunity to study at Michigan State University. I thank
all people who work in Genetics Program and DOE-PRL for their help and support
throughout my study at MSU. I would like to express my appreciation to Dr. Barbara

Sears for her help with my comprehensive examinations and teaching.

A special thought is devoted to my parents and my husband for their never-ending

support and love, which motivates me to work hard and do my best.

TABLE OF CONTENTS

LIST OF TABLES ............................................................................................................. ix
LIST OF FIGURES ............................................................................................................ x
LIST OF ABBREVIATIONS ........................................................................................... xii
Chapter 1 Introduction - Peroxisome Division ................................................................. 1
1.1 Peroxisomes are vital organelles in eukaryotic cells ............................................... 2

1.2 The biogenesis of peroxisomes - Protein import into peroxisomes ....................... 3

1.3 The biogenesis of peroxisomes — Interactions of peroxisomes with the ER ........ 5

1.4 The biogenesis of peroxisomes — Peroxisome division ........................................... 6

1.4.1 PEXll proteins are involved in the early steps of peroxisome division... 6

1.4.2 F 181 and DRPs cooperate in peroxisome fission .................................... 11

1.4.3 The link among PEXl ls, FISls and DRPs ............................................. 13

1.5 Objectives .................................................................................................................... 15
References .......................................................................................................................... 16

Chapter 2 Two Small Protein Families, DYNAMIN-RELATED PROTEIN3 and

FISSIONl, Are Required for Peroxisome Fission in Arabidopsis ................................... 23
Abstract .............................................................................................................................. 24
Introduction ....................................................................................................................... 25
Results ................................................................................................................................ 28

DRP3A and DRP3B are partially redundant in controlling peroxisome fission
.......................................................................................................................... 28
Subcellular localization of DRP3B .................................................................. 40
The two Arabidopsis F 18] proteins are localized to both peroxisomes and
mitochondria ..................................................................................................... 42
FISlA and F 1813 are involved in the fission of peroxisomes and mitochondria
.......................................................................................................................... 46
Discussion .......................................................................................................................... 50
Materials and Methods ..................................................................................................... 57
Plant growth ..................................................................................................... 57
Generation of constructs and transgenic plants ................................................ 57
Characterization of the T-DNA insertion mutants and generation of FIS I B
RNAi plants ...................................................................................................... 58
Sugar-dependence assay ................................................................................... 59
Reverse transcription (RT)-PCR analysis of SALK lines and RNAi lines ...... 59
Immunoblot analysis ........................................................................................ 60
Confocal laser scanning microscopy and image analysis ................................ 60
Acknowledgments ............................................................................................................ 61
References .......................................................................................................................... 63

vi

Chapter 3 FISSIONlA and F ISSIONlB proteins mediate the fission of peroxisomes and

mitochondria in Arabidopsis ............................................................................................. 68
Abstract .............................................................................................................................. 69
Introduction ....................................................................................................................... 70
Results ................................................................................................................................ 73

Ectopic expression of FISlA and FISlB leads to an increase in peroxisomal
and mitochondrial abundance ........................................................................... 73
FISlA and F IS 1 B are partially redundant in promoting organelle fission ....... 77
Targeting of FISl proteins to peroxisomes ...................................................... 82
Discussion .......................................................................................................................... 92
Materials and Methods ..................................................................................................... 95
Plant Growth ..................................................................................................... 96
Construct generation and plant transformation ................................................ 96
Reverse transcription (RT)-PCR analysis of overexpression and RNAi lines. 99
Immunoblot analysis ........................................................................................ 99
Confocal laser scanning microscopy and organelle quantification ................ 100
Accession numbers ......................................................................................................... 101
Acknowledgments .......................................................................................................... 101
References ........................................................................................................................ 102

Chapter 4 The Arabidopsis Chloroplast Division Protein DYNAMIN-RELATED

PROTEINSB also Mediates Peroxisome Division ......................................................... 107
Abstract ............................................................................................................................ 108
Introduction ..................................................................................................................... 109
Results .............................................................................................................................. 114

DRPSB (ARCS) is dual-targeted and controls the division of both peroxisomes
and chloroplasts .............................................................................................. 114
DRPSB contributes to peroxisome functions ................................................. 121

BiFC assays reveal interactions between DRP, FISl, and PEXll proteins... 126
Co-Immunoprecipitation assays suggest the formation of complex by DRP,

F181, and PEXll proteins .............................................................................. 137
Discussion ........................................................................................................................ 141
DRPSB plays a dual role in organelle division .............................................. 141
Distinct interactions between members of the DRP, F181, and PEXll families
on different organelles .................................................................................... 143
Materianls and Methods ................................................................................................. 149
Plant materials, growth conditions, and transformation ................................. 149
Confocal laser seaming microscopy and image analysis .............................. 150
Sugar-dependence and 2,4-DB/IBA response assays ..................................... 150
Immunoblot analysis ...................................................................................... 1 5 1
BiFC assays .................................................................................................... 151
Co-Immunoprecipitation ................................................................................ 1 52
Accession numbers ......................................................................................................... 153
Acknowledgments .......................................................................................................... 153
References ........................................................................................................................ 161

vii

Chapter 5 Conclusions and Future Directions ................................................................ 167

5.1 Conclusions ............................................................................................................... 168
5.1.1 DRP3A and DRP3B are functionally redundant in peroxisome fission and
plant growth in Arabidopsis ........................................................................... 168
5.1.2 DRPSB, a component of chloroplast division machinery, also mediates
peroxisome division in Arabidopsis ............................................................... 169
5.1.3 FISlA and FISlB control the fission of peroxisomes and mitochondria in
Arabidopsis ..................................................................................................... 170
5.1.4 BiFC and Co-IP reveal the interactions among PEXl ls, FISl and DRPs
........................................................................................................................ 171

5.2 Future directions ....................................................................................................... 174
5.2.1 Cooperation of PEXl ls, FIS l s and DRPs in plant peroxisome divison?
........................................................................................................................ 174
5.2.2 Interrelationship of plant organelle division ......................................... 176
5.2.3 Peroxisome biogenesis at large ............................................................. 177

References ........................................................................................................................ 178

viii

LIST OF TABLES

Table 4.1 Summary of interactions among members of the Arabidopsis DRP, F181, and
PEXll protein families ................................................................................................... 144

ix

LIST OF FIGURES

Images in this dissertation are presented in color.

Figure 1.1 Model of peroxisome proliferation and division. .............................................. 7

Figure 1.2 Peroxisome phenotypes conferred by reducing the expression of PEXI 1 genes

in Arabidopsis. .................................................................................................................... 8
Figure 2.1 Sequence alignments of DRP3 and F181 proteins ........................................... 29
Figure 2.2 Peroxisome phenotypes of the drp3 mutants ................................................... 35
Figure 2.3 Growth and germination phenotypes of the drp3 mutants .............................. 37
Figure 2.4 Subcellular localization of DRP3B ................................................................. 41
Figure 2.5 Peroxisome targeting of the F ISl proteins. ..................................................... 43
Figure 2.6 Co-localization of YFP-FISl fusion proteins with mitochondria. .................. 44
Figure 2.7 Growth phenotype of the fis] mutants ............................................................. 47
Figure 2.8 Peroxisomal and mitochondrial phenotypes of the fisI mutants. .................... 48
Supplemental Figure 2.9 Elongated peroxisomes in the pddl mutant root cell. .............. 62

Figure 3.1 Overexpression of F ISIA and FISI B increases the fission of peroxisomes and

mitochondria. .................................................................................................................... 74
Figure 3.2 Plant phenotype of fisI mutants. ..................................................................... 78
Figure 3.3 Peroxisomal and mitochondrial phenotypes of the fisl mutants. .................... 79

Figure 3.4 Sequence alignment of F 18] proteins and immunoblot analysis of truncated
F 131 proteins expressed in tobacco leaves ........................................................................ 83

Figure 3.5 C-terminus of FISIA and FISlB is sufficient for peroxisomal targeting. ...... 86

Figure 3.6 Analysis of the role for TMD and the C-terminal end of F 181A and F ISlB in
peroxisomal targeting ........................................................................................................ 88

Figure 4.1 DRPSB (ARCS) is involved in the division of both peroxisomes and

chloroplasts. .................................................................................................................... l 16
Figure 4.2 The role of DRPSB in plant growth. ............................................................. 122
Figure 4.3 Interactions involving DRPs and F181 as detected by BiF C ......................... 127
Figure 4.4 Interaction between DRPs and PEXll proteins detected by BiF C. .............. 132

Figure 4.5 Co-IP assays to test the interactions involving DRP, F [S], and PEXll
proteins ............................................................................................................................ 139

Figure 4.6 A hypothetical model for the targeting of DRPSB, DRP3A, and DRP3B to
peroxisome and mitochondria in A rabidopsis. ............................................................... 146

Supplemental Figure 4.7 Additional images showing peroxisomal phenotypes in drp5B
and drp5A mutants. ......................................................................................................... 154

Supplemental Figure 4.8 Confocal images from ArabidOpsis leaf mesophyll cells of wild-
type and mutant plants .................................................................................................... 155

Supplemental Figure 4.9 Growth phenotypes of plants in ambient air or elevated C02.

......................................................................................................................................... 156
Supplemental Figure 4.10 Immunoblot analysis of proteins extracted from tissues used

for BiFC assays. .............................................................................................................. 157
Supplemental Figure 4.11 BiFC assays testing the protein-protein interaction .............. 158

xi

2,4-DB
IBA

35$

arc

bar

BiFC
Co-IP
Col-0
C-terminus
ER

DRP
DsRed
EMS

FISl

GFP
GTPase
Ler
N-terminus
PEX

PTSI

LIST OF ABBREVIATIONS

2,4-dichlorophenoxybutyric acid
lndole 3-butyric acid
Cauliflower mosaic virus 35$ promoter
Accumulation and replication of chloroplasts
BASTA resistant
Bimolecular fluorescence complementation
Co-Immunoprecipitation
Columbia ecotype 0
Carboxy terminus
Endoplasmic reticulum
Dynamin-Related Protein
Discosoma sp. red fluorescent protein
Ethyl methanesulfonate
Fissionl
Green fluorescent protein
Guanosine triphosphatase
Landsberg erecta ecotype
Amino terminus
Peroxin

Peroxisomal targeting signal 1

xii

PTS2 Peroxisomal targeting signal 2
YFP Yellow fluorescent protein

UBQ Ubiquitin

xiii

Chapter 1 Introduction - Peroxisome Division

1.1 Peroxisomes are vital organelles in eukaryotic cells

Peroxisomes are pleomorphic, single-membrane-bound organelles that have diverse
metabolic and biochemical functions in eukaryotes (Titorenko and Rachubinski, 2001;
Wanders, 2004; Wanders and Waterham, 2006). Their functions are often specialized by
species, cell types and environmental cues. Fatty acid B-oxidation and hydrogen peroxide
(H202) detoxification are two widely distributed and well-conserved functions for
peroxisomes. Plant glyoxysomes that are specialized peroxisomes in germinating seeds,
harbor the glyoxylate cycle (Escher and Widmer, 1997; Graham, 2008). Peroxisomes in
some yeast are equipped with enzymes for methanol or amine oxidation and assimilation
(Veenhuis et al., 1983; Opperdoes, 1987). Additionally, mammalian peroxisomes carry
the enzymes involved in ether lipid synthesis and cholesterol synthesis (Mannaerts et al.,

2000; Wanders, 2000; Wierzbicki, 2007).

Plant peroxisomes are related to broad ranges of cellular metabolisms in addition to
glyoxylate cycle, such as photorespiration in leaves and nitrogen metabolism in roots
(Graham and Eastmond, 2002; Baker et al., 2006). Peroxisomal functions are not limited
in cellular metabolisms, their roles are also defined in embryogenesis,
photomorphogenesis, biosynthesis of jasmonic acid and conversion of the protoauxin
indole-3-butyric acid (IBA) into active auxin, indole-3-acetic acid (1AA), as well as plant
pathogen resistance (Hu et al., 2002; Weber, 2002; Fan et al., 2005; Woodward and
Bartel, 2005b, 3). Interestingly, a novel peroxisomal function has been just reported in
peroxisome-associated matrix protein degradation (Lingard et al., 2009). Together, plant
peroxisomes exert their functions in a variety of plant-specific processes.

2

1.2 The biogenesis of peroxisomes - Protein import into peroxisomes

In contrast to their functional heterogeneity, the biogenesis of peroxisomes follows a
common pathway relying on the peroxins (PEX) encoded by PEX genes. PEX proteins
are involved in the processes by which matrix and membrane proteins are assembled into
the organelle, as well as those involved in the control of peroxisome size, volume and
number. Till now, 32 Pex proteins have been found in yeast, 16 in human and 15 in plants
(Kiel et al., 2006; Orth et al., 2007). Different PEXs function in various aspects of
peroxisome biogenesis, including 1) protein import into peroxisomes, a process including
recognition of peroxisome targeting proteins through specific receptors, docking and
translocation of proteins to peroxisomal matrix and receptor recycling, 2) peroxisome de
novo biogenesis, and 3) peroxisome division (Gould and Valle, 2000; Lazarow, 2003;

Vizeacoumar et al., 2003; Vizeacoumar et al., 2004; Thoms and Erdmann, 2005).

Peroxisomes do not contain DNA or protein translation machinery, so all their proteins
are encoded by nuclear genes and imported into preoxisomal matrix post-translationally.
The import of matrix proteins into peroxisomes is a unique process, which differs
substantially from the import mechanisms into the ER, mitochondria or chloroplasts. A
major breakthrough in the elucidation of the mechanism of protein import into
peroxisomes was the identification of the first peroxisomal targeting signal (PTSI) at the
C-terminus of luciferase of the firefly Photinus pyralis (Gould et al., 1987; Gould et al.,
1989). The majority of the peroxisomal matrix proteins contain a C-terminal PTSI, and
some have an N-terminal PTS2. The PTSl- or PTS2-containing matrix proteins are

recognized by soluble receptors, PTSI by PEXS (PEXS cargo), and PTSZ by PEX7

3

(PEX7 cargo) in the cytosol, which guide them to a docking site at the peroxisomal
membrane (Baker and Sparkes, 2005). Arabidopsis PEXS and PEX7 interact with each
other, and silencing experiments of PEX5 and PEX 7 show that PEX7 is required for
PTSZ-protein import, whereas reducing PEXS affects both PTSl- and PTSZ-protein
import (Nito et al., 2002; Baker and Sparkes, 2005). In our research, fluorescence

proteins tagged with PTSI are used to mark peroxisomes in plant cells.

The PTSI receptor PEXS loaded with matrix proteins can associate with some
peroxisomal membrane proteins, referred to as docking and translocation machinery.
Yeast Pexl3, Pex14 and Pex17 are in charge of docking Pex5/Pex7-cargo at the
membrane of peroxisomes (Eckert and Erdmann, 2003). In Arabidopsis, PEX13 and
PEX14 control intracellular transport of both PTSI and PTS2 containing proteins into
three different types of peroxisomes, and silencing of PEXI4 causes defects in
peroxisome morphology, seed germination and photorespiration (Hayashi et al., 2000;
Nito et al., 2007). In yeast, three RING domain-containing peroxins, Pex2, PexlO and
Pex12, help the translocation of the receptor cargo complex loaded with matrix proteins
into peroxisome matrix, however, the mechanism of translocation of folded proteins
across the membrane and the cargo release still remain mysterious (Gould and Collins,
2002; Platta and Erdmann, 2007). Orthologs of peroxisomal RING domain-containing
proteins in Arabidopsis are essential for plant growth and development. (Hu et al., 2002;

Fan et al., 2005; Nito et al., 2007).

After translocation, Pex8 helps release the receptors in yeast (Agne et al., 2003). Further
downstream, the putative ubiquitin-conjugating enzyme Pex4 and the AAA ATPases

4

Pexl and Pex6 are required for receptor recycling and dislocation (Platta and Erdmann,
2007). Arabidopsis PEXI, PEX4 and PEX6 play similar roles to their yeast orthologs in
matrix protein import (Zolman and Bartel, 2004; Nito et al., 2007). Additionally,
mutation in AtPEX6 results in significantly reduced levels of AtPEXS, which suggests the
role for AtPEX6 in receptor recycling (Zolman and Bartel, 2004). A recent research in
Arabidopsis reveals that PEX4, PEXS, PEX6, and PEX22 are involved in peroxisome-
associated matrix protein degradation (PexAD) of damaged or obsolete matrix proteins

(Lingard et al., 2009).

1.3 The biogenesis of peroxisomes — Interactions of peroxisomes with the ER

Peroxisomes have long been viewed as semiautonomous organelles that exist outside the
secretory and endocytic pathways of vesicular flow. However, it has now become clear
that peroxisomes are evolutionarily derived from the Endoplasmic Reticulum (ER)

(Hoepfiier et al., 2005; Kragt et al., 2005; Tam etal., 2005; Matsuzaki and Fujiki, 2008).

In yeast, the peroxisomal membrane peroxins Pex3 and Pexl6 have been shown to reach
the peroxisome via the ER, and peroxisomes bud off from the ER in a Pexl9-dependent
manner (Hoepfner etal., 2005; Kragt et al., 2005; Tam et al., 2005; Matsuzaki and Fujiki,
2008). Similarly, human PEX3, PEX16 and PEX19 are essential for the formation of the
peroxisomal membrane and the localization of membrane proteins (Matsuzaki and Fujiki,
2008). AtPEX16 is the only plant peroxin ortholog known to coexist at steady state
within peroxisomes and ER, suggesting its ER-related roles in peroxisome biogenesis

(Kamik and Trelease, 2005).

In plants, several other proteins are known to reach the peroxisome through the ER rather
than by direct import from the cytosol. For instance, ascorbate peroxidase (APX) in plant
cells can be detected in a distinct portion of the ER, suggesting that they are targeted from
the cytosol directly to a preexisting subdomain of the ER membrane (Mullen et al., 1999;
Mullen et al., 2001). Tomato bushy stunt virus (TBSV) replication protein p33 expressed
on its own in plant cells is sorted initially from the cytosol to peroxisomes. And then, p33
is transported via peroxisome-derived vesicles and together with resident peroxisomal
membrane proteins (PMPs), to the ER (McCartney et al., 2005). However, whether plant

peroxisomes are originated from the ER is yet to be determined.

1.4 The biogenesis of peroxisomes — Peroxisome division

Many observations indicate that peroxisomes can not only arise from the ER, but also
possess the ability to undergo division (Thoms and Erdmann, 2005; Lingard and
Trelease, 2006; Orth et al., 2007). Peroxisome division can be divided into three
overlapping steps including elongation, membrane constriction and final fission steps
(Figure 1.1). Peroxin 11 (PEXl 1) proteins are implicated to promote the elongation step
of peroxisomes, while Fission 1 (F181) and Dynamin-Related Proteins (DRPs) are

required for the final fission step (Thorns and Erdmann, 2005).

1.4.1 PEXll proteins are involved in the early steps of peroxisome division

PEX11a,b, c, d, e FIS1A, B

 

 

DRP3A
; DRI=33B
(1) (2) (3)? O
DR.P58

Proteins known to be involved in

—>
Arabidopsis peroxisome division
_ ..... . New components of peroxisome division

machinery identified in this research

Figure 1.1 Model of peroxisome proliferation and division.

Peroxisome division is a process consisting of three partially overlapping steps, namely

(1) elongation, (2) membrane constriction and (3) fission.

Figure 1.2 Peroxisome phenotypes conferred by reducing the expression of
PEX]! genes in Arabidopsis.

(A) RT-PCR analysis of PEXII and UBQIO transcripts from RNAi plants in which the
expression of PEX] 1 0 (lines 1 to 3), PEX] 1b (lines 4 to 6), and PEX] 1c to PEX 1 1 e (lines

7 and 8) is reduced. Controls (con) are YFP-PTSI plants.

(B) Confocal microscopy of cells from (B). Bars=10 um. Green=YFP-PTS1 peroxisomal

marker, red=autofluorescence of chlorophyll.

(C) Numerical analysis of peroxisomes in leaf mesophyll cells from 4-week-old T2 RNAi
plants. Numbers shown were obtained from epifluorescence images captured from 150

mm 3 150 mm of a cell (n > 17). Error bars indicate SD.

Orth, T., Reumann, S., Zhang, X., Fan, J., Wenzel, D., Quan, S., and Hu, J. (2007). The
PEROXINll protein family controls peroxisome proliferation in Arabidopsis. The Plant

Cell 19, 333-350.

con #1 #2 #3_ con #7 #8

PEX11ai.‘ - - PEX11e—
UBQ10 ‘_—-— PEX11c '- -

con #4 #5 #6 PEX11d - —
PEX1ib-"'" -—'~

UBQ10 - - -

UBQ10 —i-——‘_.

 

C '— 120

._L
O
O

80
60
40

m annflflfimn

con #1 #2 #3 #4 #5 #6 #7 #8

peroxisome numbe

O

S. cerevisiae Pexll was the first identified factor involved in peroxisome division.
Overexpression of Pexll promotes peroxisomal elongation, whereas deletion of Pexll
causes peroxisomes to be greatly enlarged (van Roermund et al., 2000; Thoms and
Erdmann, 2005). New members of the Pexll family were found in yeast. Pex25 was
discovered as a gene that was induced in yeast cells upon growth on oleate, and Pex27
was found by homology to Pex25. Mutations in Pex25 or Pex27 result in enlarged
peroxisomes (Rottensteiner et al., 2003b; Rottensteiner et al., 2003a; Tam et al., 2003). A
triple mutant (pexI 1A pex25A pex27A) shows severe peroxisomal protein import defects
and is unable to utilize oleate for growth (Rottensteiner et al., 2003b; Rottensteiner et al.,
2003a; Tam et al., 2003). These S. cerevisiae Pexl 1p family members share significant
sequence similarity in their C-terminal segments, and all members homo-oligomerize,
which is essential for their function (Rottensteiner et al., 2003b; Rottensteiner et al.,
2003a; Tam et al., 2003). Overexpression of mammalian PEXIIa and PEX] 1,8 but not
PexIIy induced peroxisome proliferation in different cell types. Moreover, PEX] 113 is
more efficient in promoting peroxisome elongation than PEX11a (Thorns and Erdmann,

2005; Schrader and Fahimi, 2006).

To study functions of PEX11 proteins in plants, five PEX11 orthologs in the Arabidopsis
proteome were characterized in our lab. Overexpression of each PEX11 gene promotes
the elongation of peroxisomes, conversely, silencing of PEX] 1 gene results in a dramatic
reduction in peroxisome number, as shown in Figure 1.2 (Lingard and Trelease, 2006;
Orth et al., 2007). Based on changes in peroxisomal number, volume and morphology in
PEX11 overexpression and silencing lines, we conclude that the five Arabidopsis PEX11

proteins play partially overlapping, but distinct roles in peroxisome proliferation, and

10

participate in peroxisomal elongation, the early step of peroxisome proliferation.
Although it is well-known that PEX11 proteins function in the early steps of peroxisome
division in various eukaryotes, the molecular mechanism by which PEX11 proteins

promote peroxiome proliferation is still not fiilly understood.

Data shown in chapter 4 showed that PEXI ls interact with Dynamin-Related Proteins
(DRPs) in vivo and in vitro, suggesting that PEX11 proteins might function by recruiting
DRPs to peroxisomes (Chapter 4). Our data provide a clue for the molecular function of
PEX11 in other organisms since no direct interactions between PEXl ls and DRPs have
ever been reported (Thoms and Erdmann, 2005). However, whether plant PEXl ls play

roles in anchoring DRPs to peroxisomes need to be further determined.

Besides, many other yeast peroxins, such as Pex23, Pex24, Pex28, Pex29, Pex30, Pex31
and Pex32, also have more or less impacts on the morphology, number and size of

peroxisomes. (Eckert and Erdmann, 2003; Vizeacoumar et al., 2004; Kiel et al., 2006).

1.4.2 F181 and DRPs cooperate in peroxisome fission

Fisl, known to function in the mitochondrial fission, was recently found to play a role in
peroxisome fission as well in yeast and mammalian cells. Fisl has a transmembrane
domain at the C-tenninal tail responsible for its targeting to the membrane of
peroxisomes and mitochondria (Koch et al., 2005; Kobayashi et al., 2007).
Overexpression of Fisl promotes peroxisome division, while its silencing causes

tubulation in mammalian and yeast cells (Koch et al., 2005; Kobayashi et al., 2007).

11

Morphological observations of peroxisomes and mitochondria in fisI mutants indicate
Fisl might play a role in membrane constriction in mammals (Serasinghe and Yoon,
2008). To further determine the components of peroxisome division machinery in
Arabidopsis, we characterized the roles of two F ISl proteins in Arabidopsis (Chapter 2
and 3). Consistent with the functions of their orthologs in mammalian and yeast cells,
FISIA and FISIB are involved in the division of both peroxisomes and mitochondria

(Lingard etal., 2008; Zhang and Hu, 2009).

Dynamin-related proteins (DRPs) are, large GTPases involved in many processes
including the division of mitochondria and chloroplasts. Progress in recent years has
revealed that peroxisomes, like plant chloroplasts and mitochondria of fungal, plant and
animal origin, divide using DRPs (Mano et al., 2004; Thorns and Erdmann, 2005).
During organelle division, DRPs act late on the cytosolic side, after some other division
machinery has constricted the membranes (Osteryoung and Nunnari, 2003; Thorns and

Erdmann, 2005).

One important DRP required for peroxisomal fission in glucose-grown S. cerevisiae
appears to be vacuolar protein sorting-associated protein 1 (Vpsl) (Hoepfner et al., 2001).
The vpsI mutant exhibits only one or two giant peroxisomes that may form long tubules
oriented along actin cables. However, cells grown in oleate have been reported to require
the yeast DRP Dnml, Fisl, and Mdvl and Caf4. Furthermore, Mdvl and Caf4 are
cytosolic WD proteins that bind to Fisl and Dnml in yeast (Kuravi et al., 2006; Motley
and Hettema, 2007; Motley et al., 2008). In addition, the four proteins are key
components of mitochondrial division in yeast (Hoppins et al., 2007). Similarly, silencing

12

of DLPI, a DRP in mammalian cells, leads to highly elongated peroxisomal tubules
which are constricted, but cannot be completely separated (Koch et al., 2003). DLPl is

also involved in mitochondrial division (Hoppins et al., 2007).

All eukaryotic species tested contain DRPs. Arabidopsis DRP3A dual-functions in the
division of mitochondria and peroxisomes (Mano et al., 2004; Fujimoto et al., 2009). It
plays a role in peroxisome fission (Figure 1.1). Since Arabidopsis has 16 DRPs, some of
which have multiple functions, it is possible that there are more DRPs involved in
peroxisome division. In the thesis, two new DRPs were identified for the peroxisome
division apparatus in Arabidopsis (Chapter 2 and Chapter 4). DRP3B, a homolog of
DRP3A, is also involved in peroxisome division (Chapter 2). A surprise, however, is that
DRPSB (also called ARCS), a component of the chloroplast division machinery, also

plays a critical role in peroxisome division (Chapter 4).

In summary, the PEX11 proteins induce peroxisome elongation which initiates
peroxisome division, while F181 and DRP proteins are involved in the fission of
peroxisomes (Figure 1.1). The relationships among these proteins are still elusive in
higher plants. For examples, it is yet to be addressed whether plant peroxisomal
membrane proteins, F181 and PEX11 orthologs, also function in recruiting DRPs to
peroxisomes If these proteins cooperate in organelle division also remains unknown. In
this dissertation, we investigated these questions by testing the physical interactions

among PEXl ls, FISls and DRPs.

1.4.3 The link among PEX11s, F 181s and DRPs

l3

As DRPs lack targeting sequence, some other factors must determine their association
with organelles (Thorns and Erdmann, 2005). Fisl is a tail-anchored membrane protein
with N-terminal tetratricopeptide repeats (TPR) for the binding of cytosolic fission
factors. F isl recruits DRPl to peroxisomes and mitochondria in mammalian cells (Yoon
et al., 2003; Kobayashi et al., 2007). In yeast, Fisl recruits Dnml to peroxisomes and
mitochondria for fission through the soluble adaptors, Mdvl and Caf4 that interact with
both Dnml and F isl (Kuravi et al., 2006; Motley and Hettema, 2007; Motley etal., 2008).
In this dissertation, the direct physical interactions between Arabidopsis FISls and DRPs
were identified using two independent approaches, suggesting that FISls may recruit

DRPs to peroxisomes and mitochondria in plants (Chapter 4).

PEX11 is another candidate that might help anchor DRPs to peroxisomes based on
genetic evidence. Overexpression of PEX] 1,8 increases preoxisome proliferation,
however, this effect is not present when mammalian DLPI is silenced in mammalian
cells (Li and Gould, 2003). Although direct interaction between PEX11 ,6 and DLPl was
not detectable, a protein complex containing PEX] IB, Fisl and DLPl was shown to form
(Kobayashi et al., 2007). These findings suggest an interconnection between PEXl Is and
DRPs. In Arabidopsis, PEX11 proteins form homo- and hetero-oligomers, and FISIB
interacts with five PEX11 proteins (Lingard et al., 2008). Our research revealed that
PEX11 proteins also interact with FISIA, more importantly, they interact with DRPs,
indicating that PEX11 proteins may also play a role in DRP recruitment (Chapter 4). Our
results support the current opinions about relationship among PEXl ls, FISls and DRPs

in peroxisome division.

14

1.5 Objectives

The major objective of this study was to determine the molecular architecture of
peroxisome division and to obtain more knowledge about how components of

peroxisomal division machinery contribute to plant growth and development.

The research presented in this dissertation is a progression of the studies involving
Arabidopsis peroxisome division. Forward and reverse genetic strategies were undertaken
to search for more plays in the process of peroxisome divison. Four new components,
DRP3B, DRPSB and two F ISl proteins have been identified for the division machinery
of peroxisomes. They are involved in peroxisome fission. In addition, analyzing these
new components of peroxisome division apparatus suggested that they play roles in plant
growth and development, which provides further information about the specific functions
of peroxisomes in planta. Bimolecular fluorescence complementation (BiFC) and co-
immunoprecipitation (Co-1P) assays demonstrate that peroxisomal membrane proteins,
PEXIIS and FISls, interact with DRPs in vivo and in vitro. These two types of
membrane proteins may anchor DRPs to peroxisomes. More importantly, the direct
physical interactions between PEXl Is and DRPs were identified for the first time in all

eukaryotic cells.

15

References

Agne, B., Meindl, N.M., Niederhoff, K., Einwachter, H., Rehling, P., Sickmann, A.,
Meyer, H.E., Girzalsky, W., and Kunau, W.H. (2003). Pex8p: an intraperoxisomal
organizer of the peroxisomal import machinery. Molecular cell 1 1, 635-646.

Baker, A., and Sparkes, LA. (2005). Peroxisome protein import: some answers, more
questions. Current opinion in plant biology 8, 640-647.

Baker, A., Graham, I.A., Holdsworth, M., Smith, S.M., and Theodoulou, FL. (2006).
Chewing the fat: beta-oxidation in signalling and development. Trends Plant Sci
11, 124-132.

Eckert, .I.H., and Erdmann, R. (2003). Peroxisome biogenesis. Reviews of physiology,
biochemistry and pharmacology 147, 75-121.

Escher, C.L., and Widmer, F. (1997). Lipid mobilization and gluconeogenesis in plants:
do glyoxylate cycle enzyme activities constitute a real cycle? A hypothesis.
Biological chemistry 378, 803-813.

Fan, J., Quan, S., Orth, T., Awai, C., Chory, J., and Hu, J. (2005). The Arabidopsis
PEX12 gene is required for peroxisome biogenesis and is essential for
development. Plant physiology 139, 231-239.

Fujimoto, M., Arimura, S.I., Mano, S., Kondo, M., Saito, C., Ueda, T., Nakazono, M.,
Nakano, A., Nishimura, M., and Tsutsumi, N. (2009). Arabidopsis dynamin-
related proteins DRP3A and DRP3B are functionally redundant in mitochondrial
fission, but have distinct roles in peroxisomal fission. Plant J.

Gould, S.G., Keller, G.A., and Subramani, S. (1987). Identification of a peroxisomal

targeting signal at the carboxy terminus of firefly luciferase. The Journal of cell
biology 105, 2923-2931.

Gould, S.J., and Valle, D. (2000). Peroxisome biogenesis disorders: genetics and cell
biology. Trends Genet 16, 340-345.

Gould, S.J., and Collins, CS. (2002). Opinion: peroxisomal-protein import: is it really
that complex? Nature reviews 3, 382-389.

16

Gould, S.J., Keller, G.A., Hosken, N., Wilkinson, J., and Subramani, S. (1989). A
conserved tripeptide sorts proteins to peroxisomes. The Journal of cell biology
108, 1657-1664.

Graham, LA. (2008). Seed storage oil mobilization. Annual review of plant biology 59,
115-142.

Graham, [A., and Eastmond, RI. (2002). Pathways of straight and branched chain fatty
acid catabolism in higher plants. Prog Lipid Res 41, 156-181.

Hayashi, M., Nito, K., Toriyama-Kato, K., Kondo, M., Yamaya, T., and Nishimura, M.
(2000). AtPex14p maintains peroxisomal functions by determining protein
targeting to three kinds of plant peroxisomes. The EMBO journal 19, 5701-5710.

Hoepfner, D., van den Berg, M., Philippsen, P., Tabak, HF, and Hettema, EH. (2001).
A role for Vpsl p, actin, and the My02p motor in peroxisome abundance and

inheritance in Saccharomyces cerevisiae. The Journal of cell biology 155, 979-
990.

Hoepfner, D., Schildknegt, D., Braakman, 1., Philippsen, P., and Tabak, HF. (2005).
Contribution of the endoplasmic reticulum to peroxisome formation. Cell 122, 85-
9S.

Hoppins, S., Lackner, L., and Nunnari, J. (2007). The machines that divide and fiise
mitochondria. Annual review of biochemistry 76, 751-780.

Hu, J., Aguirre, M., Peto, C., Alonso, J., Ecker, J., and Chory, J. (2002). A role for
peroxisomes in photomorphogenesis and development of Arabidopsis. Science
297, 405-409.

Kamik, SK, and Trelease, RN. (2005). Arabidopsis peroxin l6 coexists at steady state
in peroxisomes and endoplasmic reticulum. Plant physiology 138, 1967-1981.

Kiel, J.A., Veenhuis, M., and van der Klei, U. (2006). PEX genes in fungal genomes:
common, rare or redundant. Traffic (Copenhagen, Denmark) 7, 1291-1303.

Kobayashi, S., Tanaka, A., and Fujiki, Y. (2007). Fisl, DLPl, and Pexl 1p coordinately
regulate peroxisome morphogenesis. Experimental cell research 313, 1675-1686.

17

Koch, A., Yoon, Y., Bonekamp, N.A., McNiven, M.A., and Schrader, M. (2005). A role
for Fisl in both mitochondrial and peroxisomal fission in mammalian cells.
Molecular biology of the cell 16, 5077-5086.

Koch, A., Thiemann, M., Grabenbauer, M., Yoon, Y., McNiven, M.A., and Schrader, M.
(2003). Dynamin-like protein 1 is involved in peroxisomal fission. The Journal of
biological chemistry 278, 8597-8605.

Kragt, A., Voorn-Brouwer, T., van den Berg, M., and Distel, B. (2005). Endoplasmic
reticulum-directed Pex3p routes to peroxisomes and restores peroxisome
formation in a Saccharomyces cerevisiae pex3Delta strain. The Journal of

biological chemistry 280, 34350-34357.

Kuravi, K., Nagotu, S., Krikken, A.M., Sjollema, K., Deckers, M., Erdmann, R.,
Veenhuis, M., and van der Klei, U. (2006). Dynamin-related proteins Vpslp and

Dnml p control peroxisome abundance in Saccharomyces cerevisiae. Journal of
cell science 1 19, 3994-4001.

Lazarow, PB. (2003). Peroxisome biogenesis: advances and conundrums. Current
opinion in cell biology 15, 489-497.

Li, X., and Gould, SJ. (2003). The dynamin-like GTPase DLPl is essential for
peroxisome division and is recruited to peroxisomes in part by PEX11. The
Journal of biological chemistry 278, 17012-17020.

Lingard, M.J., and Trelease, RN. (2006). Five Arabidopsis peroxin 11 homologs
individually promote peroxisome elongation, duplication or aggregation. Journal
of cell science 119, 1961-1972.

Lingard, M.J., Monroe-Augustus, M., and Bartel, B. (2009). Peroxisome-associated
matrix protein degradation in Arabidopsis. Proceedings of the National Academy
of Sciences of the United States of America 106, 4561-4566.

Lingard, M.J., Gidda, S.K., Bingham, S., Rothstein, S.J., Mullen, RT, and Trelease, RN.
(2008). Arabidopsis PEROXINllc-e, FISSIONlb, and DYNAMIN-RELATED
PROTEIN3A cooperate in cell cycle-associated replication of peroxisomes. Plant
Cell 20, 1567-1585.

18

Mannaerts, G.P., Van Veldhoven, PP, and Casteels, M. (2000). Peroxisomal lipid
degradation via beta- and alpha-oxidation in mammals. Cell biochemistry and
biophysics 32 Spring, 73-87.

Mano, S., Nakamori, C., Kondo, M., Hayashi, M., and Nishimura, M. (2004). An
Arabidopsis dynamin-related protein, DRP3A, controls both peroxisomal and
mitochondrial division. Plant J 38, 487-498.

Matsuzaki, T., and Fujiki, Y. (2008). The peroxisomal membrane protein import receptor
Pex3p is directly transported to peroxisomes by a novel Pexl9p- and Pex16p-
dependent pathway. The Journal of cell biology 183, 1275-1286.

McCartney, A.W., Greenwood, J .S., Fabian, M.R., White, K.A., and Mullen, RT. (2005).
Localization of the tomato bushy stunt virus replication protein p33 reveals a
peroxisome-to-endoplasmic reticulum sorting pathway. The Plant cell 17, 3513-

3531.

Motley, A.M., and Hettema, EH. (2007). Yeast peroxisomes multiply by growth and
division. The Journal of cell biology 178, 399-410.

Motley, A.M., Ward, GP, and Hettema, EH. (2008). Dnmlp-dependent peroxisome
fission requires Caf4p, Mdvlp and Fislp. Journal of cell science 121, 1633-1640.

Mullen, R.T., Flynn, CR, and Trelease, RN. (2001). How are peroxisomes formed? The
role of the endoplasmic reticulum and peroxins. Trends in plant science 6, 256-
261.

Mullen, R.T., Lisenbee, C.S., Miemyk, J.A., and Trelease, RN. (1999). Peroxisomal
membrane ascorbate peroxidase is sorted to a membranous network that
resembles a subdomain of the endoplasmic reticulum. The Plant cell 11, 2167-
2185.

Nito, K., Hayashi, M., and Nishimura, M. (2002). Direct interaction and determination of
binding domains among peroxisomal import factors in Arabidopsis thaliana. Plant
& cell physiology 43, 355-366.

Nito, K., Kamigaki, A., Kondo, M., Hayashi, M., and Nishimura, M. (2007). Functional
classification of Arabidopsis peroxisome biogenesis factors proposed from
analyses of knockdown mutants. Plant & cell physiology 48, 763-774.

19

Opperdoes, FR. (1987). Topogenesis of glycolytic enzymes in Trypanosoma brucei.
Biochem Soc Symp 53, 123-129.

Orth, T., Reumann, S., Zhang, X., Fan, J., Wenzel, D., Quan, S., and Hu, J. (2007). The
PEROXINll protein family controls peroxisome proliferation in Arabidopsis.
Plant Cell 19, 333-350.

Osteryoung, K.W., and Nunnari, I. (2003). The division of endosymbiotic organelles.
Science 302, 1698-1704.

Platta, H.W., and Erdmann, R. (2007). Peroxisomal dynamics. Trends in cell biology 17,
474-484.

Rottensteiner, H., Stein, K., Sonnenhol, E., and Erdmann, R. (2003a). Conserved function

of pexl 1p and the novel pex25p and pex27p in peroxisome biogenesis. Molecular
biology of the cell 14, 4316-4328.

Rottensteiner, H., Hartig, A., Hamilton, 8., Ruis, H., Erdmann, R., and Gurvitz, A.
(2003b). Saccharomyces cerevisiae Pip2p-Oaf1p regulates PEX25 transcription
through an adenine-less ORE. European journal of biochemistry / FEBS 270,
2013-2022.

Schrader, M., and Fahimi, H.D. (2006). Growth and division of peroxisomes.
International review of cytology 255, 237-290.

Serasinghe, M.N., and Yoon, Y. (2008). The mitochondrial outer membrane protein
hFisl regulates mitochondrial morphology and fission through self-interaction.
Experimental cell research 314, 3494-3507.

Tam, Y.Y., Fagarasanu, A., Fagarasanu, M., and Rachubinski, RA. (2005). Pex3p
initiates the formation of a preperoxisomal compartment from a subdomain of the

endoplasmic reticulum in Saccharomyces cerevisiae. The Journal of biological
chemistry 280, 34933- 34939.

Tam, Y.Y., Torres-Guzman, J.C., Vizeacoumar, F.J., Smith, M., Marelli, M., Aitchison,
J .D., and Rachubinski, RA. (2003). Pexl l-related proteins in peroxisome
dynamics: a role for the novel peroxin Pex27p in controlling peroxisome size and

number in Saccharomyces cerevisiae. Molecular biology of the cell 14, 4089-
4102.

20

Thorns, S., and Erdmann, R. (2005). Dynamin-related proteins and Pexll proteins in
peroxisome division and proliferation. Febs J 272, 5169-5181.

Titorenko, V.I., and Rachubinski, RA. (2001). The life cycle of the peroxisome. Nature
reviews 2, 357-368.

van Roermund, C.W., Tabak, H.F., van Den Berg, M., Wanders, R.J., and Hettema, EH.
(2000). Pexl 1p plays a primary role in medium-chain fatty acid oxidation, a

process that affects peroxisome number and size in Saccharomyces cerevisiae. J
Cell Biol 150, 489-498.

Veenhuis, M., Van Dijken, J .P., and Harder, W. (1983). The significance of peroxisomes
in the metabolism of one-carbon compounds in yeasts. Adv Microb Physiol 24, 1-
82.

Vizeacoumar, F .J., Torres-Guzman, J.C., Tam, Y.Y., Aitchison, J.D., and Rachubinski,
RA. (2003). YHRlSOw and YDR479c encode peroxisomal integral membrane
proteins involved in the regulation of peroxisome number, size, and distribution in
Saccharomyces cerevisiae. The Journal of cell biology 161, 321-332.

Vizeacoumar, F .J., Torres-Guzman, J.C., Bouard, D., Aitchison, J.D., and Rachubinski,
RA. (2004). Pex30p, Pex31p, and Pex32p form a family of peroxisomal integral
membrane proteins regulating peroxisome size and number in Saccharomyces
cerevisiae. Molecular biology of the cell 15, 665-677.

Wanders, R.J. (2000). Peroxisomes, lipid metabolism, and human disease. Cell
biochemistry and biophysics 32 Spring, 89-106.

Wanders, R.J. (2004). Peroxisomes, lipid metabolism, and peroxisomal disorders.
Molecular genetics and metabolism 83, 16-27.

Wanders, R.J., and Waterham, HR. (2006). Peroxisomal disorders: the single
peroxisomal enzyme deficiencies. Biochimica et biophysica acta 1763, 1707-1720.

Weber, H. (2002). Fatty acid-derived signals in plants. Trends Plant Sci 7, 217-224.

Wierzbicki, AS. (2007). Peroxisomal disorders affecting phytanic acid alpha-oxidation: a
review. Biochemical Society transactions 35, 881-886.

21

Woodward, A.W., and Bartel, B. (2005a). Auxin: regulation, action, and interaction. Ann
Bot (Lond) 95, 707-735.

Woodward, A.W., and Bartel, B. (2005b). A receptor for auxin. Plant Cell 17, 2425-2429.

Yoon, Y., Krueger, E.W., Oswald, B.J., and McNiven, MA. (2003). The mitochondrial
protein hFisl regulates mitochondrial fission in mammalian cells through an

interaction with the dynamin-like protein DLPl. Molecular and cellular biology
23, 5409-5420.

Zhang, X., and Hu, J. (2009). Two small protein families, DYNAMIN-RELATED

PROTEIN3 and FISSIONl, are required for peroxisome fission in Arabidopsis.
Plant J 57, 146-159.

Zolman, B.K., and Bartel, B. (2004). An Arabidopsis indole-3-butyric acid-response
mutant defective in PEROXIN6, an apparent ATPase implicated in peroxisomal

function. Proceedings of the National Academy of Sciences of the United States
ofAmerica 101, 1786-1791.

22

Chapter 2 Two Small Protein Families, DYNAMIN-RELATED PROTEIN3 and
FISSIONI, Are Required for Peroxisome Fission in Arabidopsis

Xinchun Zhang and Jianping Hu

The Plant Journal (2009) 57:146-159

23

Abstract

Peroxisomes are multifunctional organelles that differ in size and abundance depending
on the species, cell type, developmental stage, and metabolic and environmental
conditions. The PEROXINll protein family and the DYNAMIN-RELATED
PROTEIN3A (DRP3A) protein have been shown previously to play key roles in
peroxisome division in Arabidopsis. To establish a mechanistic model of peroxisome
division in plants, we employed forward and reverse genetic approaches to identify more
players involved in this process. In this study, we identified three new components of the
Arabidopsis peroxisome division apparatus: DRP3B, a homolog of DRP3A, and
FISSIONlA and 1B (FISIA and 18), two homologs of the yeast and mammalian FISl
proteins that mediate the fission of peroxisomes and mitochondria by tethering the DRP
proteins to the membrane. DRP3B partially targets to peroxisomes and causes defects in
peroxisome fission when the gene function is disrupted. The drp3A drp3B double
mutants display stronger deficiencies than each single mutant parent in peroxisome
abundance, seedling establishment, and plant growth, suggesting partial functional
redundancy between DRP3A and DRP3B. In addition, FISIA and FISIB are each dual-
targeted to peroxisomes and mitochondria; their mutants show growth inhibition and
contain peroxisomes and mitochondria with incomplete fission, enlarged size, and
reduced number. Our results demonstrate that both DRP3 and F181 protein families
contribute to peroxisome fission in Arabidopsis and support the view that DRP and F181
orthologs are common components of the peroxisomal and mitochondrial division

machineries in diverse eukaryotic species.

24

Introduction

Plant peroxisomes orchestrate a wide array of metabolic activities such as fatty acid [3—
oxidation, the glyoxylate cycle, photorespiration, jasmonate biosynthesis, H202
detoxification, and metabolism of nitrogen and indole-butyric acid (Hayashi and
Nishimura, 2003; Nyathi and Baker, 2006; Olsen and Harada, 1995; Reumann and
Weber, 2006; Zolman et al., 2000). Peroxisomes can form de novo from the endoplasmic
reticulum (ER) or arise from division/proliferation of pre-existing peroxisomes via
multiple steps involving organelle elongation/enlargement, membrane constriction, and
peroxisome fission (Fagarasanu et al., 2007; Hoepfner et al., 2005; Motley and Hettema,
2007; Titorenko and Mullen, 2006). Peroxisome division (from one to at least two
peroxisomes) takes place constitutively or under induced conditions; induced division
(or peroxisome proliferation) is often referred to as the increase in peroxisome

abundance/volume in response to environmental and metabolic stimuli (Yan et al., 2005).

Several major components of the peroxisome division machineries are conserved in
eukaryotes. For example, orthologs of the peroxisomal membrane protein PEROXINlI
(PEX11) in fungi, animals, trypanosomes, and plants promote the first step of peroxisome
division, namely, peroxisome elongation/tubulation (Fagarasanu et al., 2007).
Arabidopsis contains five PEX11 isoforms, PEX] la to —e, all of which are targeted to
peroxisome membranes and able to induce peroxisome elongation and population
increase with some degrees of functional specificity and redundancy (Lingard and
Trelease, 2006; Nito et al., 2007; Orth et al., 2007). Decreasing the expression of
individual PEX11 or a subfamily of PEX11 genes led to reduction in the total number of

25

peroxisomes (Orth et al., 2007) or slightly enlarged peroxisomes (Nito et al., 2007).
Arabidopsis plants overexpressing individual PEX11 genes displayed significant
peroxisome tubulation and increase in peroxisome abundance (Orth et al., 2007). The
precise mode of action for PEX11 proteins remains elusive; membrane modification
through phospholipid binding, metabolite transport, and recruitment of downstream
proteins are some of the proposed functions (Fagarasanu et al., 2007; Thorns and

Erdmann, 2005).

The second class of conserved constituents of the peroxisome division apparatus consists
of dynamin-related proteins (DRPs), which mediate peroxisome fission after membrane
constriction occurs (Fagarasanu et al., 2007). Dynamin and dynamin-related proteins are
large self-assembling GTPases involved in the fission and fusion of membranes by
positioning into spiral-like structures around the membranes and acting as
mechanochemical enzymes or signaling GTPases (Hoppins et al., 2007; Koch et al.,
2004; Osteryoung and Nunnari, 2003; Praefcke and McMahon, 2004). DRPs share with
the conventional dynamins an N-terminal GTPase domain, the middle domain (MD), and
a C-terminal GTPase effector domain (GED), but lack the pleckstrin homology domain
(PH) for binding to membrane lipids and the C-terminal proline- and arginine-rich
domain (PRD) that mediates interactions with SH3 motif-containing proteins (Thorns and
Erdmann, 2005). Saccharomyces cerevisiae Vpslp and Dnmlp and the mammalian
DLPl/Drpl proteins are DRP3 required for peroxisome division, besides their roles in
mitochondrial division (Dnmlp and DLPl/Drpl) and Golgi (DLPl/Drpl) and vacuole
(Vpslp) morphogenesis (Hoepfiier et al., 2001; Koch et al., 2004; Koch et al., 2003;

Kuravi et al., 2006; Li and Gould, 2003; Schrader, 2006; Wilsbach and Payne, 1993). Of
26

the 16-member superfamily of dynamins and DRPs in Arabidopsis (Hong et al., 2003),
family 3 consists of DRP3A and DRP3B, which share 77% amino acid sequence identity
(Figure 1a). Both proteins are involved in mitochondrial division, whereas DRP3A also
controls the division of peroxisomes (Arimura et al., 2004; Arimura and Tsutsumi, 2002;
Logan et al., 2004; Mano et al., 2004). Whether or not DRP3B functions in peroxisome

fission is unclear.

The third group of proteins with a conserved function in peroxisome division, at least in
yeasts and mammals, is FISSIONI (F 181). F 181 orthologs are integral membrane
proteins dual-targeted to peroxisomes and mitochondria, acting as adaptors for the
mammalian DLPl and yeast Dnml proteins by recruiting these DRP3 to the organelles to
execute membrane fission (Kobayashi et al., 2007; Koch et al., 2003; Koch et al., 2005;
Kuravi et al., 2006). Structural features shared by FISl orthologs include a highly
conserved C-terminal transmembrane domain (TMD) and a tetratricopeptide repeat
(TPR)-like binding domain that spans over two-thirds of the protein from the N-terminus
and mediates protein-protein interaction (Figure 1b). Arabidopsis contains two homologs
of FlSl (FISIA and FISIB) that share 58% protein sequence identity (Figure 1b). The
Arabidopsis mutants of BIGYIN (FISIA) displayed a reduced number of mitochondria
and an increase in mitochondrial size (Scott et al., 2006). It remains to be determined
whether these two Arabidopsis F ISl proteins are involved in controlling the number and

size of peroxisomes and whether F ISlB is also required for mitochondrial division.

We are interested in elucidating molecular pathways underlying the environmental and
metabolic control of the abundance of plant peroxisomes, which will ultimately lead to

27

answers to the question of how peroxisomal dynamics correlates with plant physiology
and development. Transmission electron microscopic studies demonstrated that by mostly
unknown mechanisms plants increase their peroxisome numbers in response to
environmental stresses such as ozone, the herbicide isoproturon, the hypolipidemic drug
clofibrate, and high light (de Felipe et al., 1988; Ferreira et al., 1989; Oksanen et al.,
2003; Palma et al., 1991). We recently provided evidence that light induces the
proliferation of peroxisomes in Arabidopsis seedlings through the far-red light receptor
phytochrome A (phyA) and the bZIP transcription factor HYS HOMOLOG (HYH),
which coordinately activate the expression of the PEX] 1b gene (Desai and Hu, 2008). To
further dissect molecular pathways governing the environmental control of plant
peroxisome abundance, we need first to establish a precise mechanistic model for
peroxisome division in plants. All players in the division machinery need to be identified,
as some of them could be targets for plant peroxisome proliferators. To this end, we
screened for mutants deficient in peroxisome division and conducted reverse genetic
studies to characterize plant orthologs of the yeast and mammalian proteins involved in
peroxisome division. In this report we demonstrate the role of DRP3B and the two FISl
proteins in peroxisome division in Arabidopsis. The role for the F181 proteins in

mitochondrial division is also illustrated.

Results

DRP3A and DRP3B are partially redundant in controlling peroxisome fission

28

Figure 2.1 Sequence alignments of DRP3 and F181 proteins.
(a) Alignment of Arabidopsis DRP3A and DRP3B and the yeast S. cerevisiae Dnmlp

protein. The arrowhead points to the mutation in pddI. (b) Alignment of Arabidopsis
FISIA and F IS1B and the S. cerevisiae F isl p protein. Positions of the tetratricopeptide
(TPR)-like domain in the three proteins are: Fislp, 6-129; FISIA, 36-142; FISIB, 92-
125. The putative transmembrane domain (TMD) is underlined. Shaded sequences

represent identical amino acid residues in both (a) and (b).

29

man—mo
(mama

35.5 $2 _ommfio .mm Ezemugzszou 3m<mmmzt<o>o <._ o

mmdmo
(mama
38:0

man—mo

(mama
avEco

mmamo

«£de
3.55

mmamo

(mama
38:0

    

39?. 59884

- _o m> .a3<zz_mmthann >ozhxx<308>onmo
. n<zm_mmxnoann _.23xx<30a>onma

  
 

,weme memh mm><mo>vfr
meZm memhgwmx/(mntrxw 4.3/«000- Aw I

    
  

     

.>>.twmuuxmm. a..x_,mz 3.0m0mmz>>o>>onmna_e
>>azmmauxmm.nn<mx>cm233_omommz>>o>>onmna>>

m _._..>>QI .m >nmm¥04w w> 2410‘ _.cOmmZ>>O 04 Lag _D._<Z_.OIQ_>:O.§H _>O _me0¢ao>mm<i_xh m

    

 
    

    

mz<noez<am><3_nomfimx_
mz<noez<am><n_noe00x_
m2 4. z<am><n_nozmp._

 
 
 

.L :2Hm _m<m _QmQODO>Q>v:. _OQAQ>._W _- 4>Zamm 3:0 .0 _Qm>0x2m0m EZHw<m _m

3 EE _m<m Emaooo>a>f 6303» .23>zamm $3.. _an>oxzmo>nmz$<m a
.3.nzx_¢ m_oaao _a>xe_oano>3e323>gamu x4 .

mm_mmao>_m. . m ........... o ..................... -mmaxeo nonrnaameo
mm_mmuo>ame . -m ........... z ...................... <mwxc03303>aammeo_ozoma
mx_o.uo>amx <Izmmxom>mnaxeo<waom_xe>moxaz>mzoomm.3am2am_zzaon>nammc>_oeoma

Eamoifin>mmxomm0mo>><>082 C88 39: _oo§z> E :68: - ->m>fiwm ............. a305—
mama

   

 
     

    

   

.Lmom0>4<w4>wmx0mm0m0>é>ca4< CwOmO 40<u _DO._XZ> E _>wm04d < H wamaahwaahw0w>mm :32
4d0m0>4 m4 wmxowm0m0>>.4 5.5.. O. Omos 004¥Z> Q _i_ ........ Ow ......................

 

 

5N
mom

wow

wow
PNN

VNN

5..
mmw
an...

on
mm
mm

30

Figure 2.1 (a) continued

 

   

   

   

mmamo zxnmozozfi mmmm -mfidmximmofi .........

<85 ao>ozoxooo<.mmam: .293um 833on

3.55

mmamo 32mm>§ml>zxdm§>z>fi£z om>zxm>a>>mx mm _ ->>
<83 muzzmmixx E>zzdmxfiz>ixs .36 am _zxm> 53mm E&>.&mf>_ -m:
358 ZE>3.z.>moxr>z> nod $5 .8. __,ou_>m>. m 58323850nt .032”:

 

 

man—mo mGH . - - - 22x< 0 w gm - - <QKm<O <HQu<OQH _ _OZ<OmO puma... .0 < mam
(mambo Gm)--- may...) m n: m <2 (Xm<o.m>>- _OZ<OmOhdmmw o m mm
m . _ 0 v. u. >2 v.

aPEcO m .200 m<0m>QCO¥ xox - -mw<o .00.,Q>Om2v_. IOo-_I_me .meOZ .02.... ZmOOwhxmv.

 

man—mo ..:Q. I
(name >HQ am<>aId Emmx>dIa<m><xeoo EZQImhz _>Q_2m=20 .30 I
38.5 .jwo m ...... x - -mmex. 50 <we<m 0735292. («.1 .0 Smu>>mm achrmmnhww _>m _..2wx.§dzm. hm<ww I
mmdmo hwgu _dm<oo._mdor_._mw _Omm>n>wud>oa>ah<mmd0e<zo Zea _Qo<enomodo>mmhwx>d>moa :3 E<00mhm
(mama
acho

mom
vwh
cum.

vmo
ovw
mmo

09..
0mm

Dov
mnv
mt.

mum
can
can

31

Figure 2.1 continued

 

H

   

 

 

1,. ,1 . 1., . , . i. I. A no. i, , 4
i . . . i . I
liri . . . I v. .r. p r u up .
.1 . I. s z I L4 ‘4 ..i.lq. 4
.. . v . . _ . x. y. w m
\ .4. r. I . »

 

AH wmx.

mam; .. mmmfl>
<HmHm Wm wbw ,2 f Dq.m m-A, Hwy 3Q4O H
QHme r -, ......0> 226%“
rxww 0 III m H m hm m<m<< m x «g H
a...” 15...--- . a: .
flfillllmow >0 mQHMQ Omw llllllllll mw QBQB >¥HZI| H

3V

      

 

mHmHa
«HmHa
mamas

      

32

To identify more players in the peroxisome division and proliferation pathways in
Arabidopsis, we performed ethyl methane sulfonate (EMS) mutagenesis on seeds from
the peroxisome marker plant YFP-PTSI, which expresses the yellow fluorescent protein
with the PEROXISOME-TARGETING SIGNAL TYPEl (Ser—Lys-Leu) sequence
attached to the C-terminus (Desai and Hu, 2008; Fan et al., 2005; Orth et al., 2007).
Screening of the M2 population for peroxisome division/proliferation deficient mutants
(pdd) enabled us to identify several classes of mutants showing changes in peroxisome
size, shape, or number from the wild-type plants (Figure 2a). The pddl mutant exhibited
highly aggregated/inseparable (Figure 2b) and massively elongated (Supplemental Figure
l) peroxisomes, phenotypes reminiscent of those of the aberrant peroxisome morphology
l (ame) mutant alleles, which contain mutations in the DRP3A gene (Mano et al., 2004).
Sequencing of the DRP3A gene in the pddl mutant revealed a nonsense mutation at

3”Gln (Figure la and Figure 2i)-

Phylogenetic analyses of DRP sequences from various species suggested that DRP3A
and DRP3B are more closely related to the yeast Vpslp and Dnmlp and the human Drpl
than to members of the other Arabidopsis DRP families (Arimura and Tsutsumi, 2002b;
Konopka, 2008). Searches of public Arabidopsis microarray databases
(https://www.genevestigator.ethz.ch/; (Zimmermann et al., 2004) showed that DRP3A
and DRP3B are both fairly ubiquitously expressed (Supplemental Figure 2). Given the
role of DRP3A, Vpslp, Dnmlp, and Drpl in peroxisome division, it is highly likely that
DRP3B is also involved in the same process in Arabidopsis. To test this hypothesis, we
obtained two T-DNA insertion mutants of DRP3B, drp3B-I (SALK_045316) and drp3B-2

{5/LK~112233), as well as two additional mutant alleles of DRP3A, drp3A-1
33

(SALK_008 706) and drp3A-2 (SALK_14 7485) (Figure 2i). Semi-quantitative reverse
transcriptase-PCR (RT-PCR) of RNA from the mutants gave evidence that the expression

of DRP3A or DRP3B was strongly reduced in the respective mutants (insets in Figure 2c-

f).

The YFP-PTSI peroxisomal marker gene was introduced into these mutants via
A grobacterium-mediated transformation (Clough and Bent, 1998); transgenic plants were
analyzed for peroxisome phenotypes. Both drp3B mutant alleles expressing YFP-PTSI
contained many peroxisome aggregates that were constricted but failed in fission (Figure
2e-f). These phenotypes were comparable to some extent with those observed in pddl,
drp3A-1, and drp3A-2 (Figure 2b-d). However, the long and extended tails associated
with peroxisomes that were frequently seen in the drp3A alleles (Figure 2b-d) and named
by Scott et a1. (2007) as “peroxules”, were not observed in the drp3B mutants (Figure 2e-
f). Most of the individual peroxisomes in the drp3A and drp3B mutants also appeared
larger than those in the wild type (Figure 2b-f). Thus, DRP3B, like its homolog DRP3A,

is required for peroxisome division. However, DRP3B’s role may be weaker than that of

DRP3A.

Single mutants of DRP3A and DRP3B each showed deficiency in peroxisome division,
suggesting that the functions of DRP3A and DRP3B may not be completely overlapping.
TO further address this question, we generated drp3A drp3B double mutants. For

convenience in genotyping, the two T-DNA insertion lines of DRP3A were used to make

34

Figure 2.2 Peroxisome phenotypes of the drp3 mutants

(a) Genomic structures of DRP3A and DRP3B. Boxes represent exons, with the coding
region in black. Positions of the mutant alleles are also indicated. (b) Confocal
micrographs of leaf mesophyll cells from wild-type and drp3 mutant plants expressing
the YFP-PTSI peroxisomal marker gene and grown for 4 weeks. Green signals show
YFP-PTSl-labelled peroxisomes; red signals indicate chloroplasts. Scale bars = 10 um.
(c) RT-PCR analyses of RNA from corresponding mutants. In each inset, the left lane is
wild type and the right lane is the mutant; the top panel represents transcripts of the
individual DRP3 gene and bottom panel is the UBIQUITINIO transcript. (d)
Quantification of total YFP fluorescence and peroxisome number per 2500 pm2 of the

mesophyll cells in drp3 mutants (n>8, p<0.05).

35

(a) ATG pdd1(3‘9GIn-> stop) TAA ATG TAA

[i-IH-l-I-l—H-HH-l-HEZI

A A
drp3A-2 drp3A-1 drp3B—2 drp3B-1

(SALK_ 147485) (SALK_008706) (SALK_112233) (SALK_045316)
(b)

WT drp3A-1 . drp3A -2

‘

    

 

drp3A-1 (”NB-1 drp3A-2 drp3B-2
(d) ufl
UOFBSCGHCB area
.xi‘béb “’05 4555"> ‘E 6 I peroxisome number 35
a. 30 a)
DRP3A — z 7; 5 25‘5”
UBQ10 —- 3: § 4 a
q, 3 20%
U
«59 8 10':
{666? b g 1 5 §
0.
32233- - "3 ° 0 a .9 °
.. . ‘1’} 00:7 4.7 4.9361, 36.934.,:4.93
3G. .7 6e

36

Figure 2.3 Growth and germination phenotypes of the drp3 mutants

(a-b) Wild type and drp3 mutants grown for three (a) and seven weeks (b). (c) Sucrose-
dependence assay of drp3 mutants. Hypocotyl lengths of dark-grown seedlings grown for
5 days on MS plates with or without 1% sucrose were measured. Error bars indicate

standard deviations (n > 50; p<0.05).

37

YFP-PTS1 pdd1

drp3A-1 drp3A-2 drp3B-1

drp3A-2 drp3B-2

drp3B-2 drp3A-1 drp38-1

YFP 3A- 1 3A-2
PTs1pdd13A- 1 3A 2 33-1 33- 2 334 33- 2

 

A 20 I:IW/O Sucrose I'W Sucrose

 

hypocotyl length
0 A on

Qp} *7q 0] $34‘% 349 022338: 3e? 0,030 [b34‘
‘9 7 7 0' 90'
‘ 0

38

crosses. Two double mutants were obtained: drp3A-1 drp3B-1 and drp3A-2 drp3B-2.
Similar to the single mutants, the double mutants (F2) also contained many clumped
peroxisomes that were each slightly larger than those of the wild type (Figure 2g-h).
However, these morphological defects of peroxisomes in the double mutants were not
stronger than those of the single mutants. To determine whether the total number of
peroxisomes was changed in these mutants, we used Image] software to quantify
peroxisome abundance. We measured the planar area of YFP fluorescence and the
number of peroxisomes in a given field in leaf mesophyll cells, using information
extrapolated from at least 8 confocal images from each genotype. Whereas the total area
of fluorescence per 2500 um2 remained virtually unchanged from wild type to drp3
single mutants, it was decreased in the two drp3A drp3B double mutants (Figure 2j).
Compared with the wild type, the number of peroxisomes per 2500 um2 was noticeably
decreased in the single mutants; the double mutants contained the lowest number of
peroxisomes (Figure 2j). Of the two double mutants, drp3A-I drp3B-1 has a slightly
weaker phenotype, likely due to the fact that there was still a small amount of DRP3A

mRNA detected in drp3A-1 (Figure 2c).

At the seedling stage, pddl, drp3A-1, and drp3A-2 grew more slowly than the wild-type
YF P-PT SI control plants, whereas pddl exhibited the strongest growth inhibition (Figure
3a). It seems that despite our inability to detect DRP3A transcripts in drp3A-2, it is not a
null mutant. The drp3B mutant alleles showed comparable phenotypes with those of
drp3A. The two double mutants displayed stronger defects in plant size than the single

mutants (Figure 3a) and were slightly pale-green at the seedling stage (data not shown).

39

Adult plants of the wild type and single mutants were largely undistinguishable in
appearance, whereas double mutants remained reduced in plant size (Figure 3b). The
pale-green phenotype reflects defects in photorespiration, a pathway in which
peroxisomes and mitochondria play essential roles. Reduced division in both

peroxisomes and mitochondria in the drp3 mutants obviously reduced plant growth.

To determine whether disruption of the DRP3 genes led to impaired seedling
establishment, we measured hypocotyl lengths of dark-grown seedlings germinated in the
presence or absence of sucrose. The pex14 null mutant, which is defective in a
peroxisome biogenesis factor involved in peroxisomal matrix protein import and has a
sugar-dependent phenotype (Fan et al., 2005; Orth et al., 2007), was used as a control
(Figure 30). On sucrose-free medium, hypocotyl elongation was more inhibited in the
drp3A drp3B seedlings than in the single mutants and the wild type; this deficiency was
largely rescued by exogenous sucrose (Figure 30). It is likely that the drp3 mutants were
defective in lipid metabolism as a result of reduced division of peroxisomes and
mitochondria, two key venues of this physiological process. Hence, insufficient energy in
the form of carbohydrates was available for the seedlings to become established.
Collectively, results from the sugar-dependence assays and the peroxisome and plant
growth phenotype analyses of the drp3 mutants provide evidence that the DRP3A and

DRP3B mediate peroxisome division in a partially redundant manner.

Subcellular localization of DRP3B

40

 

Figure 2.4 Subcellular localization of DRP3B

Confocal images were taken fiom leaf epidermal cells of 4-week-old plants co-expressing

CFP-PTSI and YFP-DRP3B. Bars = 10 pm.

(a) Association of YFP-DRP3B (green signals) with some CFP-PTSl-labelled

Peroxisomes (red signals). (b) Association of YFP-DRP3B (green signals) with some

MitoTracker-stained mitochondria (magenta signals).

41

Given that DRP3B clearly plays a role in peroxisome division, we next sought to
determine whether this protein indeed sorted to peroxisomes. Full-length cDNA encoding
DRP3B (At2g14120) was cloned to the C-terminus of YFP in a plant expression vector
driven by the CaMV3SS promoter. This construct was co-expressed with cyan fluorescent
protein (CFP)-PTSI in Arabidopsis. Transgenic plants expressing both transgenes
exhibited many YFP signals that were tightly associated with small circular structures
labeled with CFP-PTSI (Figure 4a). Likewise, many YFP-DRP3B proteins were also

associated with mitochondria, which were stained by MitoTracker (Figure 4b).

Instead of distributing throughout these organelles, the YFP-DRP3B protein targeted to
spots on peroxisomes and mitochondria or showed juxtaposition to these compartments
(Figure 4). A similar localization pattern was previously shown for DRP3A and DRP3B
on mitochondria (Arimura et al., 2004; Arimura and Tsutsumi, 2002) and for DRP3A on
peroxisomes (Mano et al., 2004); locations of these spots were suggested to be tips and
possible sites for membrane constriction (Arimura et al., 2004; Arimura and Tsutsumi,
2002). Taken together, our data demonstrate that the DRP3B protein is partially localized

to peroxisomes in addition to targeting to mitochondria.

The two Arabidopsis FISl proteins are localized to both peroxisomes and

mitochondria

In yeast and mammals, DRP proteins are tethered to the membrane of peroxisomes and
mitochondria by the small membrane-anchored protein FISl before they participate in

division by pinching off small organelles from tubules that are already constricted

42

(a) YFP-FlSlA (b)YFP-FlS1B (c)F|S1A-YFP (d)FIS1BYFP

CFP-PTS1 YFP

oveflay

 

Figure 2.5 Peroxisome targeting ofthe FISl proteins.

Confocal images were taken from leaf epidermal cells of 4-week old plants expressing
CFP-PTSI combined with WP—FISI or FISI—ITP, as indicated on top. Each inset is an
immunoblot analysis of proteins extracted from wild-type plants expressing CFP-PT S1
only (lefl lane) and plants co-expressing CFP-PTSI and the indicated FIS] construct
(right lane). The a—GFP antiserum detected CFP-PTSI (bottom band) and the FISl-YF P

(or YFP-F181) filsion proteins (top band). Bars = 10 um.

43

(a) YFP-FlSlA (b) YFP-FlSlB

MitoTracker YFP

oveflay

 

Figure 2.6 Co-localization of YFP-FISl fusion proteins with mitochondria.

All images were captured from epidermal cells of 6-week-old leaves from the YFP-FISI

transgenic plants stained by Mito—Tracker. Scale bars = 10 um.

44

(Kobayashi et al., 2007; Koch et al., 2003; Koch et al., 2005; Kuravi et al., 2006). Data
collected from online microarray databases (https://www.genevestigator.ethz.ch/)
(Zimmermann et al., 2004) revealed that both FISIA and FISIB from Arabidopsis are
constitutively expressed. The expression level of FISIA is higher than that of FISIB in
most tissues, whereas FISIB shows very high expression in pollen (Supplemental Figure
2). FISIA (BIGYIN) was previously shown to control the size and number of
mitochondria (Scott et al., 2006). However, whether FISIB plays a role in mitochondrial
division and whether these two FISl proteins are targeted to mitochondria have not been
shown clearly. Here, we characterized Arabidopsis FISlA and FISIB to determine

whether they play a role in the division both peroxisomes and mitochondria.

Subcellular localization of these two proteins was tested. We transformed 35S promoter-
driven constructs containing YFP-FISI or FISI-YFP into Arabidopsis plants that were
already expressing the peroxisomal marker protein CFP-PTSI. Transgenic plants
expressing YFP-FISIA or YFP-FISIB fusions displayed partial co-localization of the
YFP signals with CFP-PTSI (Figure 5a-b). Unlike DRP3B, which concentrated at spots
on the peroxisome (Figure 4), the F181 proteins were evenly distributed along
peroxisomes (Figure 5a-b). In contrast, when fused to the N-terminus of YFP, FISIA and
FISIB were mostly diffused in the cytosol and nucleus (Figure 5c-d), indicating that the
C-terrninus of FISl, which contains the transmembrane domain, is important for targeting
FISl to the peroxisome. These data suggest that Arabidopsis FISlA and FISIB are
partially targeted to peroxisomes and that the C-terminus of the proteins is required for
the targeting. We also stained leaf epidermal cells from transgenic plants expressing

YFP-FISIA or YFP-FISIB with the MitoTracker dye. Confocal microscopy showed that
45

some of the YFP-FISIA and YFP-FISIB fusion proteins clearly co-localized with
MitoTracker (Figure 6a-b), thus validating the partial mitochondrial localization of these

two proteins.

FISlA and F ISlB are involved in the fission of peroxisomes and mitochondria

We obtained loss-of-function mutants to further examine the role of F 181 proteins in the
division of peroxisomes and mitochondria. A fisIA mutant (SALK_086794) has a T-
DNA insertion in the last exon (Figure 7a) and is the same allele (bigyinI-Z) used by
Scott et al (2006) for mitochondrial phenotype analysis. Using RT-PCR analysis, we
were unable to detect FISIA transcripts in this mutant (Figure 7b), which was later
crossed into the YFP-PT S1 background. Since T-DNA insertion lines for FISIB were not
available, we utilized RNAi to reduce the expression of this gene. The full-length cDNA
of FISI b (513 bp) was cloned into the pFGC5941 dsRNAi vector as inverted repeats; the
35S-driven construct was later transformed into plants expressing YFP-PT SI . We
generated a total of 59 T1 transformants that contained both sense and antisense repeats of
FISIB, seven of which were randomly picked for RT-PCR analysis. Two RNAi lines,
R15 and R47, which showed silencing of FISIB but wild-type levels of FISIA mRNA,
(Figure 7c), were selected for further analysis in T3. The fisIA T-DNA insertion mutant
and the FISIB RNAi lines both displayed growth inhibition compared with the wild-type

plant (Figure 7d).

46

(a)

ATG TAA
(0)
WT R15R47
(b) WT f M FIS1B -—
IS
FIS1A -
FIS1A ——
UBQ10 __ UBQ10—.9
(d)

W fls‘lA R15

 

Figure 2.7 Growth phenotype ofthefis] mutants.

(a) Schematic of the FISIA gene. Boxes indicate exons; coding region is in black. The
arrowhead indicates the position of the T-DNA insertion in the fisIA mutant. (b-c) RT-
PCR analysis of FISIA, FISIB, and UBIQUITINIO transcripts in wild-type,fis1A, and the
two FISIB RNAi lines. ((1) Growth comparison of 6—week-old fisI mutants and the wild-

type plants. Two plants were grown in each pot.

47

Figure 2.8 Peroxisomal and mitochondrial phenotypes of thefisl mutants.

(a-h) Confocal micrographs of leaf mesophyll (a-d) or leaf epidermal (e-h) cells from 6-
week-old wild-type and fisI mutant plants, all of which contained the YFP-PTSI
peroxisomal marker gene. Green signals, YFP-PTSl-tagged peroxisomes; red signals,
autofluorescent chloroplasts; magenta signals, MitoTracker-stained mitochondria. Bars =
10 um. (i) Quantification of total peroxisome (YFP) and mitochondrial (MitoTracker)
fluorescence and the number of these two types of organelles within 2500 um2 of leaf
cells in wild type and fisl mutants (n>8, p<0.05). (j) Sucrose-dependence assays of the
fis] mutants. Hypocotyl lengths of 5—d-old etiolated seedlings grown on MS plates with
or without 1% sucrose were measured (n > 50; p<0.05). Error bars are standard

deviations in (i-j).

48

(C)

 

(i) :1 peroxisomefluorescence (j
- mitochondrial fluorescence D W/O Sucrose
s peroxisome number

V

 

6‘ . . E18 lWSucrose
360 Imltochondnalnumber 50 E :12
g 50 40 E E12
:S 30 C : 8
§30 s 20 % ‘3 6
§20 a .8, ‘2‘
\ 10
E100 § » o g E 0 00/ 09+ ’29; ’1); '91:
~—— WT fis1A R15 R47 0 7" 7 5 )

49

Confocal microscopic analysis of peroxisomes in the mesophyll cells of rosette leaves
demonstrated that these mutants contained many enlarged peroxisomes, some of which
were clustered together and failed in fission, in contrast to the mostly spherical and
separated peroxisomes in the wild-type plants (Figure 8a-d). Quantification of YFP
fluorescence area and peroxisome abundance (per 2500 umz) from over 8 images from
each genotype revealed that, whereas the total volume of peroxisomes (measured by YFP
fluorescence area in the given field) remained largely constant, the number of
peroxisomes was significantly reduced in the fisl mutants (Figure 8i). The fisIA mutant
(bigyin-Z, SALK_086794 used in this study) was shown previously to contain enlarged
mitochondria as well as a reduced mitochondrial number per cell (Scott et al., 2006).
When stained with MitoTracker, the two FISIB RNAi lines (R15 and R47) also showed
many mitochondria that were enlarged in size and decreased in number, similar to the
fisIA mutant (Figure 8e—h). MitoTracker fluorescence area per 2500 um2 remained
constant between wild type and the single fisl mutants, yet the total number of
mitochondria strongly decreased in the mutant lines (Figure 8i). Sugar-dependence assays
were also performed on the fisI mutants. Both fislA and the two FISIB RNAi lines
showed partial growth inhibition on sucrose-free medium (Figure 8j), indicating weak
deficiencies in lipid metabolism during germination. Taken together, our results illustrate
that FISlA and FISIB are targeted to both peroxisomes and mitochondria and are

required for the division of both types of organelles in Arabidopsis.

Discussion

50

In Arabidopsis, the PEX11 protein family and the DRP3A protein have been shown to be
involved in peroxisome division (Lingard and Trelease, 2006; Mano et al., 2004; Nito et
al., 2007; Orth et al., 2007). In this study, we identified three additional components of
the Arabidopsis peroxisome division apparatus, DRP3B, FISlA, and FISIB. Whereas
PEX11 proteins are primarily responsible for the elongation/tubulation of peroxisomes,

DRP3A/3B and FISlA/1B proteins mediate the fission of peroxisomes.

We provided genetic evidence that DRP3A and DRP3B play partially redundant roles in
peroxisome division, seedling establishment, and plant growth. First, some of the YFP-
DRP3B proteins were found to be associated with spots on peroxisomes, similar to what
was discovered for DRP3A (Mano et al., 2004). Second, single and double mutants of
DRP3A and DRP3B were impaired in peroxisome division, whereas the dry3A drp3B
double mutants showed stronger phenotypes than either single mutant parent in
peroxisome number, sugar dependence, and plant stature and pigmentation. The degree of
dwarfness in the DRP3A null allele pddI shown in this study seemed to be weaker than
apm1-6, the strongest mutant allele of DRP3A identified from a previous study, which
contained a 7|Gly->Asp substitution (Mano et al., 2004). This phenotypic difference
implies that the truncated DRP3A protein encoded by pddl may still be partially
functional, whereas mutation of the N-terminal GTPase domain in apm1—6 may have
completely abolished the function of this protein. Alternatively, the mutant protein
encoded by the apm1-6 allele may have a dominant negative effect by disrupting the
function of both endogenous DRP3 proteins and possibly other DRPs that play a role in
the division of peroxisomes and mitochondria. To this end, it would be necessary to

obtain a mutant in which both DRP3 proteins are completely non-functional, in order to

51

determine the full capacity of this subfamily of DRPs in peroxisome division and plant
development. Furthermore, given that the drp3A and drp3B single mutants each
displayed apparent morphological deficiencies in peroxisomes, each gene should
maintain some unique functions in peroxisome division. The slightly different
peroxisomal phenotypes of the drp3A and drp3B mutants shown in this study may

provide support for this prediction.

Dynamins and dynamin-related proteins are engaged in endocytosis, cell division and
expansion, intracellular vesicle trafficking, and division of organelles such as plastids,
mitochondria, peroxisomes, and Golgi vesicles (Osteryoung and Nunnari, 2003; Praefcke
and McMahon, 2004). The complete functional spectra of many of the Arabidopsis DRPs
have not been characterized. Members from different DRP subfamilies can be involved in
the same function. For example, in addition to DRP3A and DRP3B (Arimura et al., 2004;
Arimura and Tsutsumi, 2002b; Logan et al., 2004; Mano et al., 2004), two members of
family 1 were also shown to participate in mitochondrial division. Mutants of DRP] C
(ADLIC) and DRPIE (ADLIE) exhibited abnormal mitochondrial elongation; the two
proteins also partially co-localized with a mitochondrial marker (J in et al., 2003). Thus, it
is likely that other Arabidopsis DRP subfamilies are also involved in peroxisome
division. In addition, the same DRP may participate in the fission of multiple types of
membranes. Such examples include the yeast Vpslp protein (Macuolar Brotein _S_orting
protein 1) that plays a role in the division of peroxisomes and biogenesis of vacuoles, and
the mammalian DLPl protein that participates in the fission of peroxisomes,
mitochondria, and Golgi bodies (Hoepfiier et al., 2001; Koch et al., 2003; Li and Gould,

2003). Therefore, despite the finding that DRP3A is involved in the division of only
52

peroxisomes and mitochondria (Mano et al., 2004), we cannot completely exclude the
possibility that DRP3B also targets to other subcellular compartments and contributes to
the division or morphogenesis of other organelles. Peroxisomes and mitochondria both
move fast. Thus, we were unable to clearly address the question of whether or not YFP-
DRP3B targets to spherical structures other than peroxisomes and mitochondria, by
visualizing YFP-DRP3B, peroxisomes, and mitochondria simultaneously in a single

image (data not shown).

We also show in this study that the two Arabidopsis F 181 homologs, FISlA and FISIB,
are targeted to both peroxisomes and mitochondria and play significant roles in the
division of these two organelles. F 181 is one of the very few proteins known to target to
the membrane of both peroxisomes and mitochondria. The C-terminus seems critical for
FISlA and FISIB to target to peroxisomes (Figure 5) in Arabidopsis, consistent with the
finding that the C-terrninal region of hFISl (including the transmembrane domain) is
both necessary and sufficient for targeting to both peroxisomes and mitochondria in
human cells (Koch et al., 2005). An open question remains as to how targeting signals are
specified within the C—terminus of the F181 protein and which organelle-specific proteins
mediate these targeting events. Among the three essential components of the
mitochondrial division machinery in yeast, namely, Dnmlp, Fislp, and Mdvlp (or its
homolog Cav4p), Mdvlp/Cav4p (molecular adaptor) appears to be species-specific and
does not have apparent structural orthologs in higher eukaryotes (Hoppins et al., 2007). It
is possible that some unidentified proteins exclusively localized to peroxisomes mediate
the specific targeting of FISl to peroxisomes in Arabidopsis and in other eukaryotes as

well.

53

Our study shows that despite having deficiencies in peroxisome fission, peroxisomal
volume (indicated by fluorescent areas) in the drp3 and fis] single mutants remains
largely unchanged from that of the wild type. This compensation of the reduced number
of peroxisomes by enlarged individual peroxisomes may be a mechanism utilized by the
cell to maintain enough volume of the organelles in order to carry out their normal
function. However, when both members of the gene family are dysfunctional, as in the
case for the drp3 double mutants, this balance was lost. We expect to see a similar trend
in the fit] double mutants, which will be generated in the lab. Besides partial redundancy
in function, we also expect to see unique function for each FISl. For example, it is
possible that FISIA and FISIB each have its specific DRP target. Whereas ectopic
expression of Arabidopsis DRP3 genes (this study and Mano et al., 2004) or the human
DLPI gene (Li and Gould, 2003) did not cause any apparent peroxisome phenotypes,
overexpressing YFP-FlSl fusion proteins seems to lead to some degree of increased
proliferation and clustering of peroxisomes (Figure 5a-b vs. 5c-d). Overproducing Myc-
hFISl in mammalian cells led to more numerous peroxisomes and segmented
mitochondria, suggesting that F131 is the limiting factor for peroxisomal and
mitochondrial fission (Koch et al., 2005). To address this question in Arabidopsis, we
will need to express untagged FISl or FIS fused with small tags to avoid possible
dominant negative effects caused by attaching the 27-kDa YFP protein to the wild-type

FISl.

A very recent study using Arabidopsis suspension cell cultures failed to show co-
localization of myc-FISIA or myc-FISIB with peroxisomes that were immunolabelled

with a—catalase antibodies; however, an increase in the number of peroxisomes was

54

observed in cells expressing myc-FISIB (Lingard et al., 2008). This study also
demonstrated that FISIB has a role in cell-cycle associated peroxisome duplication and
targeted to peroxisomes only after it was co-expressed with a PEX11 protein, whereas
FISlA does not seem to be involved in peroxisome duplication (Lingard et al., 2008). In
contrast, our study clearly demonstrates that, on their own, both YFP-FISlA and YFP-
FISlB are able to localize to peroxisomes and mitochondria and that both proteins are
involved in peroxisome fission in Arabidopsis plants. GFP and myc-fusions of the
mammalian F 181 protein (hFisl) also target to both mitochondria and peroxisomes when
expressed by themselves (Koch et al., 2005). It is possible that the role of FISlA and
FISIB in cell-cycle associated peroxisome division in cell cultures differs from their role

in peroxisomal division in intact Arabidopsis plants.

Despite their distinct evolutionary origins (endosymbiotic vs. ER-derived) and different
membrane structures (double membrane vs. single membrane), mitochondria and
peroxisomes share some of the same DRPs and their anchor proteins in the division
machinery across plant, fungal, and animal kingdoms (this study; (Schrader, 2006;
Schrader and Yoon, 2007). However, given that peroxisomes and mitochondria are
functionally linked in many metabolic activities, such as lipid metabolism and
photorespiration -—- two of the major functions involving plant peroxisomes, it is not
surprising that the divisions of these two organelles are coordinated at some levels. The
peroxisome phenotypes of fisI a and the FISI b RNAi mutants are similar to those of the
drp3A and drp3B mutants, consistent with the notion that F181 and DRP3 proteins work
closely in the same pathway. In mammalian cells hFISl and DLPl physically interact in

vivo and in vitro (Yoon et al., 2003). However, our co-immunoprecipitation (co-IP)

55

assays using HA-FISI and YFP-DRP3 proteins failed to show the co—existence of
DRP3A/3B and FISlA/1B in the same protein complex (data not shown). Using
bimolecular fluorescence complementation (BiFC), Lingard et al. (2008) did not detect
interaction between DRP3A and FISlA/FISIB in Arabidopsis cultured cells, either.
Thus, it is possible that the interaction between F 181 and DRP in Arabidopsis is rather
transient; alternatively, other proteins may bring DRP3 to FISl at the organelle
membrane, which would represent a unique feature for plant peroxisomal/mitochondrial

fission.

PEX11, DRP, and F181 represent conserved members of the peroxisome division
machineries. Recently, ternary complexes containing mammalian DLPl, F181, and
PEXllfi were identified through chemical linking methods, which began to link the
machineries controlling peroxisome elongation and fission together, suggesting that these
three groups of proteins coordinate their functions in peroxisome multiplication
(Kobayashi et al. 2007). Lately, a novel tail-anchored membrane protein, Mff, was
identified from mammalian cells; this protein promotes the fission of both mitochondria
and peroxisomes independently from the F181 protein and does not have an obvious
homolog in yeast (Gandre-Babbe and van der Bliek, 2008). It is unclear whether a plant
homolog of Mff exists. In addition, a number of yeast peroxisomal membrane proteins,
such as Pex28p, Pex29p, Pex30p, Pex31p, and Pex32p, which are known to be
specifically involved in controlling peroxisome size and abundance by means of largely
unknown mechanisms (Thorns and Erdmann, 2005), do not seem to have cognate

orthologs in plants. Proteins that mediate peroxisomal membrane constrictions are largely

56

unidentified in any given species. As such, further genetic and biochemical studies need

to be conducted to reveal plant- and peroxisome-specific players in peroxisome division.

Materials and Methods

Plant growth

All plants were in the Columbia-0 (Col-0) background and were germinated under 16-h
light (60 uE m“2 sec")/8-h dark conditions on 0.6% (w/v) agar plates with '/2 Murashige
and Skoog basal salt mixture ('/2MS) supplemented with 1% (w/v) sucrose. After two
weeks, plants were transferred to soil and grown under a photosynthetic photon flux
density of 70—80 umol m’2 sec" at 21°C with a 14-h light/lO-h dark period. Wild-type
plants expressing the CFP-PTSI or YFP-PTSI transgene (Desai and Hu, 2008; Fan et al.,

2005; Orth et al., 2007) were used to visualize peroxisomes in plants.

Generation of constructs and transgenic plants

DNA fragments used for cloning in this study were amplified by PCR using the High-
Phusion DNA polymerase according to manufacture’s instructions (New England Biolabs
Inc.). A standard gateway cloning system (Invitrogen) was used to make the constructs.
The Gateway-compatible PCR products of DRP3B, FISIA, and FISIB were cloned into
binary vectors containing the attRI-Cmr-cch-attRZ integration region using One-Tube
Format Protocol. Constructs and primers used for gateway cloning are listed in

Supplemental Figure 3. The resulting constructs were transformed into A. tumefaciens

57

(C58Cl) via electroporation. Agrobacteria containing the constructs were later
transformed into CFP-PT S1 or YFP-PTSI plants using the floral-dip method (Clough and
Bent, 1998). Stable primary transformants were selected on '/2 MS medium containing
kanamycin (50 rig/ml; for DRP3B-YFP and FISl-YFP) / glufosinate ammonium (10
ug/mL; Crescent Chemical, Augsburg, Germany, for YFP-FISI) and gentamycin (6O

ug/mL; for CFP-PTSl) and then transferred to soil for further characterization.

Characterization of the T-DNA insertion mutants and generation of FISIB RNAi
plants

drp3A-1 (SALK_008706), drp3A-2 (SALK_14 7485), drp3B-1 (SALK_0453I6), drp3B-2
(SALK_112233) and fisIA (SALK_O86 794) seeds were obtained from the ABRC (Ohio
State University). Homozygous mutants were identified by PCR analysis of genomic
DNA using gene-specific forward (LP) and T-DNA lefl border primers (LBbl, 5'-
GCGTGGACCGCTTGCTGCAACT-3') and gene-specific reverse primer (RP). PCR
products were further sequenced to confirm the insertion of the T-DNA in the gene. The
primers for genotyping are shown in Supplemental Figure 3. YFP-PTSI was expressed in
the drp3a-1, drp3a-2, drp3b-1, drp3b-2 and 1151 a mutants to visualize peroxisomes. The
double mutants drp3A-1 drp3B-1 and drp3A-2 drp3B-2 were identified through

genotyping from an F 2 generation from crosses between the single mutants.

Gene-specific primers (listed in Supplemental Figure 3) were used to amplify a 513-bp
full-length cDNA fragment of FISI B. The amplified fragment was cloned in pFGC594l
in sense and antisense orientations as described (Orth et al., 2007). The FISIB RNAi

construct was transformed into YFP-PTSI plants and T1 plants were screened on '/2 MS

58

agar plates containing 50 ug / mL kanamycin and 10 ug / mL glufosinate ammonium. To
make sure that both sense and antisense repeats of FISIB are present, we genotyped T1
primary transformants using primers upstream (forward) and downstream (reverse) of the

insertion sites (Supplemental Figure 3).

Sugar-dependence assay

Seeds of wild type and mutants were plated on 1/2 MS agar growth medium with or
without 1% sucrose, following 4 days of cold treatment. All seeds were allowed to
germinate and grow in the dark for 5 days. Five-day-old etiolated seedlings were scanned
using an EPSON scanner. Hypocotyl length was then measured using Image]

(http://rsb.info.nih.gov/ij0. For hypocotyl length measurements, n>50, p<0.05.

Reverse transcription (RT)-PCR analysis of SALK lines and RNAi lines

Total RNA was extracted using an RNeasy Plant Mini Kit (Qiagen) according to the
manufacturer’s protocol. First—strand cDNA synthesis was performed using the
Invitrogen Reverse Transcriptase, Superscript II (Invitrogen), in a 20-ul standard reaction
containing oligo dT primers. PCR amplification was carried out using primers specific
for DRP3A, DRP3B, FISIA, FISIB and UBQ10 genes (Supplemental Figure 3). PCR
(Promega) parameters were: 95°C 2 min, followed by 26 cycles of 95°C 30 s, 54°C 30 s,
72°C 1min, and a final elongation step at 72°C for 10 min. Amplified DNA was run on

0.8% agarose gel.

59

Immunoblot analysis

Total protein was extracted from leaf discs of 4-week-old plants. Homogenized leaf
tissue was kept in lXSDS-polyacrylamide gel electrophoresis (PAGE) sample buffer,
boiled for 5 min, and centrifuged for 2 min. The supernatant was run on SDS-PAGE gels
and transferred to Immobilon-P membrane for blotting (Millipore Corp., Bedford, MA).
Primary antibody used to detect YFP and CFP proteins was a rabbit polyclonal GFP
antibody (Santa Cruz Biotechnology, Inc.). The secondary antibody used was goat anti-

rabbit IgG (LI-COR Biosciences).

Confocal laser scanning microscopy and image analysis

For in vivo detection of CFP and YFP, Arabidopsis tissue was mounted in water and
viewed using a confocal laser scanning microscope (Zeiss Meta 510) to obtain confocal
images of fluorescence proteins. To analyze subcellular localizations of FISlA and
FISIB in mitochondria, leaves were treated with 500 nM MitoTracker Red CMXRos
(Mitochondrion-Selective Probes, Invitrogen) according to (Arimura and Tsutsumi,
2002a). We used 458-nm, 514-nm, 543-nm, and 633-nm lasers for excitation of CFP,
YFP, MitoTracker, and chlorophyll, respectively. For emission, we used 465-510 nm
band pass (CFP), 520-555 band pass (YFP), 560-614 band pass (Mitotracker), and 650
nm long pass (chlorophyll) filters. All images were obtained from single optical sections

of 0.14 pm in depth.

60

We used Image] (httpzl/rsb.info.nih.gov/ij/) to measure fluorescence area and count
organelle numbers in 50 um x 50 um confocal images. Color confocal images from
single channels (YF P or MitoTracker) were converted to grayscale in 8-bits. The scale for
measurement was based on scale bars on the confocal images. We used manual settings
of the Threshold function to designate black pixels (peroxisomes or mitochondria) as
objects to be measured or counted, and then the Analyze Particles function for
fluorescence area measurements and organelle counting. Organelles that were clumped
together without clear boundaries in between, which likely indicates that there were
incomplete fissions, were treated as a single organelle. The counting of the organelles
was also validated manually. Standard deviations and statistical significance for the data
were calculated using the Excel program (Microsoft). For all organelle counting and

fluorescence measurements, n>8, p<0.05.

Acknowledgments

We would like to thank the Arabidopsis Biological Resource Center (The Ohio State
University) for providing mutant seeds and the RNAi vector; Sarah Jacquart for
assistance with mutant genotyping; Dr. Melinda Frame for help with confocal
microscopy; Marlene Cameron for graphic assistance; and Karen Bird for manuscript
editing. This work was supported by the US. Department of Energy, Michigan State
University Intramural Research Grant Program (IRGP), and the National Science

Foundation (MCB 0618335) to J .H.

61

 

Supplemental Figure 2.9 Elongated peroxisomes in the pddl mutant root cell.

Green signals are YFP-PTSl-labelled peroxisomes. Scale bar = 20 um.

62

References

Arimura, S., Aida, G.P., Fujimoto, M., Nakazono, M. and Tsutsumi, N. (2004)
Arabidopsis dynamin-like protein 2a (ADL2a), like ADL2b, is involved in plant
mitochondrial division. Plant Cell Physiol, 45, 236-242.

Arimura, S. and Tsutsumi, N. (2002) A dynamin-like protein (ADL2b), rather than FtsZ,
is involved in Arabidopsis mitochondrial division. Proc Natl Acad Sci U S A, 99,
5727-5731.

Clough, SJ. and Bent, AF. (1998) Floral dip: a simplified method for Agrobacterium-
mediated transformation of Arabidopsis thaliana. Plant J, 16, 735-743.

(16 Felipe, M.R., Lucas, M.M. and Pozuelo, ].M. (1.988) Cytochemical study of catalase
and

peroxidase in the mesophyll of Lolium rigidum plants treated with isoproturon. J Plant
Physiol, 132, 67-73.

Desai, M. and Hu, J. (2008) Light induces peroxisome proliferation in Arabidopsis
seedlings through the photoreceptor phytochrome A, the transcription factor HY5
HOMOLOG, and the peroxisomal protein PEROXIN 11b. Plant Physiol, 146,
1117-1127.

Fagarasanu, A., Fagarasanu, M. and Rachubinski, RA. (2007) Maintaining peroxisome
populations: a story of division and inheritance. Annu Rev Cell Dev Biol, 23, 321-
344.

Fan, ]., Quan, S., Orth, T., Awai, C., Chory, J . and Hu, J. (2005) The Arabidopsis PEX12
gene is required for peroxisome biogenesis and is essential for development. Plant
Physiol, 139, 231-239.

Ferreira, M.B., Bird, B. and Davies, DD. (1989) The effect of light on the structure and
organization of Lemna peroxisomes. J Exp Bot, 40, 1029-1035.

Gandre-Babbe, S. and van der Bliek, A.M. (2008) The novel tail-anchored membrane
protein Mff controls mitochondrial and peroxisomal fission in mammalian cells.
Mol Biol Cell, 19, 2402-2412. .

63

Hayashi, M. and Nishimura, M. (2003) Entering a new era of research on plant
peroxisomes. Curr Opin Plant Biol, 6, 577-582.

Hoepfiier, D., Schildknegt, D., Braakman, I., Philippsen, P. and Tabak, HF. (2005)
Contribution of the endoplasmic reticulum to peroxisome formation. Cell, 122,
85-95.

Hoepfner, D., van den Berg, M., Philippsen, P., Tabak, HF. and Hettema, EH. (2001) A

role for Vpslp, actin, and the Monp motor in peroxisome abundance and inheritance in
Saccharomyces cerevisiae. J Cell Biol, 155, 979-990.

Hong, Z., Geisler-Lee, C.]., Zhang, Z. and Verma, DP. (2003) Phragmoplastin
dynamics: multiple forms, microtubule association and their roles in cell plate
formation in plants. Plant Mol Biol, 53, 297-312.

Hoppins, S., Lackner, L. and Nunnari, J. (2007) The machines that divide and fuse
mitochondria. Ann Rev Biochem, 76, 751-780.

]in, ].B., Bae, H., Kim, S.J., ]in, Y.H., Goh, C.H., Kim, D.H., Lee, Y.]., Tse, Y.C., ]iang,
L. and Hwang, I. (2003) The Arabidopsis dynamin-like proteins ADLlC and
ADLlE play a critical role in mitochondrial morphogenesis. The Plant cell, 15,
2357-2369.

Kobayashi, S., Tanaka, A. and Fujiki, Y. (2007) Fisl, DLPl, and Pexl 1p coordinately
regulate peroxisome morphogenesis. Exp Cell Res, 313, 1675-1686.

Koch, A., Schneider, G., Luers, G.H. and Schrader, M. (2004) Peroxisome elongation
and constriction but not fission can occur independently of dynamin-like protein
1. J Cell Sci, 117, 3995-4006.

Koch, A., Thiemann, M., Grabenbauer, M., Yoon, Y., McNiven, MA. and Schrader, M.
(2003) Dynamin-like protein 1 is involved in peroxisomal fission. J Biol Chem,
278, 8597-8605.

Koch, A., Yoon, Y., Bonekamp, N.A., McNiven, MA. and Schrader, M. (2005) A role
for F isl in both mitochondrial and peroxisomal fission in mammalian cells. Mol
Biol Cell, 16, 5077-5086.

64

Konopka, C.A., Bednarek, S.Y. (2008) Comparison of the dynamics and functional
redundancy of the Arabidopsis dynamin-related isoforms, DRPlA and DRPlC,
during plant development. Plant Physiol, doi:10.1104/pp108.116863.

Kuravi, K., Nagotu, S., Krikken, A.M., Sjollema, K., Deckers, M., Erdmann, R.,
Veenhuis, M. and van der Klei, I.]. (2006) Dynamin-related proteins Vpslp and
Dnmlp control peroxisome abundance in Saccharomyces cerevisiae. J Cell Sci,
119, 3994-4001.

Li, X. and Gould, S.]. (2003) The dynamin-like GTPase DLPl is essential for
peroxisome division and is recruited to peroxisomes in part by PEX11. J Biol
Chem, 278, 17012-17020.

Lingard, M.J., Gidda, S.K., Bingham, S., Rothstein, S.J., Mullen, RT. and Trelease, RN.
(2008) Arabidopsis PEROXINI lc-e, F ISSIONlb, and DYNAMIN-RELATED
PROTEIN3A cooperate in cell cycle-associated replication of peroxisomes. Plant
Cell, doi/10.1 lOS/tpc.107.057679.

Lingard, M.]. and Trelease, RN. (2006) Five Arabidopsis peroxin 11 homologs
individually promote peroxisome elongation, duplication or aggregation. J Cell
Sci, 119, 1961-1972.

Logan, DC, Scott, I. and Tobin, AK. (2004) ADLZa, like ADL2b, is involved in the
control of higher plant mitochondrial morphology. J Exp Bot, 55, 783-785.

Mano, S., Nakamori, C., Kondo, M., Hayashi, M. and Nishimura, M. (2004) An
Arabidopsis dynamin-related protein, DRP3A, controls both peroxisomal and
mitochondrial division. Plant J, 38, 487-498.

Motley, A.M. and Hettema, EH. (2007) Yeast peroxisomes multiply by growth and
division. J Cell Biol, 178, 399-410.

Nito, K., Kamigaki, A., Kondo, M., Hayashi, M. and Nishimura, M. (2007) Functional
classification of Arabidopsis peroxisome biogenesis factors proposed from
analyses of knockdown mutants. Plant & Cell Physiology, 48, 763-774.

Nyathi, Y. and Baker, A. (2006) Plant peroxisomes as a source of signalling molecules.
Biochim Biophys Acta, 1763, 1478-1495.

65

Oksanen, E., Haikio, E., Sober, ]. and Kamosky, DR (2003) Ozone-induced H202
accumulation in field-grown aspen and birch is linked to foliar ultrastructure and
peroxisomal activity. New Phytol. , 161, 791 -799.

Olsen, L]. and Harada, J. (1995) Peroxisomes and their assembly in higher plants. Annu
Rev Plant Biol, 46, 123-146.

Orth, T., Reumann, S., Zhang, X., Pan, J., Wenzel, D., Quan, S. and Hu, J. (2007) The
PEROXINll protein family controls peroxisome proliferation in Arabidopsis.
Plant Cell, 19, 333-350.

Osteryoung, K.W. and Nunnari, ]. (2003) The division of endosymbiotic organelles.
Science, 302, 1698-1704.

Palma, ].M., Garrido, M., Rodriguez-Garcia, M.I. and del Rio, LA. (1991) Peroxisome
proliferation and oxidative stress mediated by activated oxygen species in plant
peroxisomes. Arch Biochem Biophys, 287, 68-74.

Praefcke, G.]. and McMahon, HT (2004) The dynamin superfamily: universal
membrane tubulation and fission molecules? Nat Rev Mol Cell Biol, 5, 133-147.

Reumann, S. and Weber, AP. (2006) Plant peroxisomes respire in the light: some gaps of
the photorespiratory C2 cycle have become filled-~others remain. Biochim
Biophys Acta, 1763, 1496-1510.

Schrader, M. (2006) Shared components of mitochondrial and peroxisomal division.
Biochim Biophys Acta, 1763, 531-541.

Schrader, M. and Yoon, Y. (2007) Mitochondria and peroxisomes: Are the 'Big Brother'
and the 'Little Sister' closer than assumed? Bioessays, 29, 1105-1114.

Scott, I., Tobin, AK. and Logan, DC. (2006) BIGYIN, an orthologue of human and
yeast FISl genes functions in the control of mitochondrial size and number in
Arabidopsis thaliana. J Exp Bot, 57, 1275-1280.

Thorns, S. and Erdmann, R. (2005) Dynamin-related proteins and Pexll proteins in
peroxisome division and proliferation. FEBS J, 272, 5169-5181.

66

Titorenko, V.1. and Mullen, RT. (2006) Peroxisome biogenesis: the peroxisomal
endomembrane system and the role of the ER. J Cell Biol, 174, 11-17.

Wilsbach, K. and Payne, GS. (1993) Vpslp, a member of the dynamin GTPase family, is
necessary for Golgi membrane protein retention in Saccharomyces cerevisiae.
EMBO J, 12, 3049-3059.

Yan, M., Rayapuram, N. and Subramani, S. (2005) The control of peroxisome number
and size during division and proliferation. Curr Opin Cell Biol, 17, 376-383.

Yoon, Y., Krueger, E.W., Oswald, B]. and McNiven, M.A. (2003) The mitochondrial
protein hFisl regulates mitochondrial fission in mammalian cells through an
interaction with the dynamin-like protein DLPl. Mol Cell Biol, 23, 5409-5420.

Zimmermann, P., Hirsch-Hoffmann, M., Hennig, L. and Gruissem, W. (2004)
GENEVESTIGATOR. Arabidopsis microarray database and analysis toolbox.
Plant Physiol, 136, 2621-2632.

Zolman, B.K., Yoder, A. and Bartel, B. (2000) Genetic analysis of indole-3-butyric acid

responses in Arabidopsis thaliana reveals four mutant classes. Genetics, 156,
1323-1337.

67

Chapter 3 F ISSIONIA and FISSION 1B proteins mediate the fission of peroxisomes
and mitochondria in Arabidopsis

Xinchun Zhang and Jianping Hu
Molecular Plant (2008) l(6):1036-1047

68

Abstract

Peroxisomes and mitochondria are metabolically diverse organelles that act in concert in
a number of pathways in eukaryotes, including photorespiration and lipid mobilization in
plants. The division machineries of these two types of organelles also share several
components such as dynamin-related proteins (DRPs) and their organelle anchor, the
FISSIONl (FISl) protein. In Arabidopsis, members of the DRP3 and FISl small protein
families, namely, DRP3A, DRP3B, FISlA, and FISIB, are each dual-targeted to
peroxisomes and mitochondria and are required for the division of both organelles;
DRP3A and DRP3B play partially overlapping roles. To further determine the
contribution of FISIA and FISIB to the division of peroxisomes and mitochondria, we
analyzed plants overexpressing FISIA and FISIB and mutants in which the functions of
both proteins are disrupted. Domains in FISlA and FISIB required for peroxisomal
targeting were also dissected. Our results demonstrate that FISIA and F ISlB play rate-
limiting and partially redundant roles in promoting the fission of peroxisomes and
mitochondria. Furthermore, although the C-terminal half of the F181 proteins is both
necessary and sufficient for targeting these proteins to peroxisomes, the role of the
extreme C-terminal end adjacent to the transmembrane domain may differ among diverse

species in peroxisomal targeting.

69

Introduction

Peroxisomes are ER-derived and single-membrane eukaryotic organelles that mediate a
variety of oxidative metabolic pathways (Beevers, 1979; Titorenko and Mullen, 2006;
Van den Bosch et al., 1992). Plant peroxisomes play essential roles in many
developmental and physiological processes such as embryogenesis, oilseed germination,
photorespiration, jasmonate biosynthesis, and metabolism of nitrogen and indole-butyric
acid (Hayashi and Nishimura, 2003; Nyathi and Baker, 2006; Olsen and Harada, 1995;
Reumann and Weber, 2006; Zolman et al., 2000). Peroxisomes are also called “organelles
at the crossroads”, because during metabolism they often act in concert with other
subcellular compartments within close physical proximity. For example, peroxisomes
(glyoxysomes) in germinating oilseed seedlings interact with oil bodies and mitochondria
and act coordinately with these two organelles during lipid mobilization; fatty acid [3-
oxidation and the glyoxylate cycle are crucial steps in the process, both taken place inside
peroxisomes. In addition, leaf peroxisomes are also physically and functionally
associated with chloroplasts and mitochondria during photorespiration through the

glycolate recycling pathway, (Beevers, 1979).

Peroxisomes are highly dynamic, capable of changing their complement, shape, and
abundance in response to developmental and metabolic stimuli (Purdue and Lazarow,
2001). In plants, the abundance of peroxisomes can vary in response to environmental
signals (de Felipe et al., 1988; Ferreira et al., 1989; Oksanen et al., 2003; Palma et al.,
1991). Recently, a phytochrome A-dependent signaling pathway was shown to mediate
the light-induced proliferation of peroxisomes in Arabidopsis seedlings (Desai and Hu,

70

2008). Plant peroxisomes, like their counterparts in animals and fungi, can multiply by
division through several partially overlapping steps, namely, organelle elongation,
membrane constriction, and fission (Fagarasanu et al., 2007; Yan et al., 2005). To dissect
signaling pathways underlying the control of peroxisome abundance under various
environmental influences in plants, we need to first identify constituents of the machinery

that controls the division and multiplication of these organelles.

In Arabidopsis, the first step of peroxisome division, i.e., peroxisome elongation, is
promoted by a five-member family of peroxisomal membrane proteins called
PEROXINll (PEX11). Each AtPEXll isoform, PEXl la to PEXl le, is able to induce
peroxisome elongation and number increase (Lingard and Trelease, 2006; Nito et al.,
2007; Orth et al., 2007). Despite our lack of knowledge of their precise biochemical
fimction, PEX11 orthologs in diverse species play largely conserved roles (Fagarasanu et
al., 2007; Thorns and Erdmann, 2005). In support of this, Arabidopsis PEXllc and
PEXIIe partially completed the mutant phenotype of the pexl] null mutant in

Saccharomyces cerevisiae (Orth et al., 2007).

A later step in peroxisome division, namely, membrane fission, is governed by at least
two types of dual-targeted proteins: dynamin-related proteins (DRPs) and FISSIONl
(FISl), which function coordinately. A subset of DRPs in yeast and animals are involved
in the fission of peroxisomes and mitochondria (Hoepfner et al., 2001; Koch et al., 2004;
Koch et al., 2003; Kuravi et al., 2006; Li and Gould, 2003; Schrader, 2006; Wilsbach and
Payne, 1993) by serving as mechanochemical enzymes and/or signaling GTPases
(Hoppins et al., 2007; Koch et al., 2004; Osteryoung and Nunnari, 2003; Praefcke and

71

McMahon, 2004). Mammalian and yeast FISl proteins are C-tenninal tail-anchored
membrane proteins of peroxisomes and mitochondria, which use their cytoplasmically
exposed N-terminal region containing the tetratricopeptide repeat (TPR) domain to
interact with the DRPs (James et al., 2003; Kobayashi et al., 2007; Koch et al., 2003;
Koch et al., 2005; Kuravi et al., 2006; Mozdy et al., 2000; Stojanovski et al., 2004; Yoon
et al., 2003). In Arabidopsis, members of the DRP3 family, DRP3A and DRP3B, regulate
peroxisomal fission in a partially redundant manner (Mano et al., 2004; Zhang and Hu,
accepted with revision); they are also involved in mitochondrial fission (Arimura et al.,
2004; Arimura and Tsutsumi, 2002a; Logan et al., 2004; Mano et al., 2004). The AtFISl
family also constitutes two isoforms, FISlA and FISIB, which facilitate the division of
both peroxisomes and mitochondria (Zhang and Hu, accepted with revision; Scott et al.,
2006). FISlB was recently shown to be involved in cell cycle-associated replication of
peroxisomes in Arabidopsis cell cultures, whereas FISlA did not seem to play a role in

this process (Lingard et al., 2008).

Yeast and mammals each have a single F 181 protein (James et al., 2003; Kobayashi et al.,
2007; Koch et al., 2003; Koch et al., 2005; Kuravi et al., 2006; Mozdy et al., 2000;
Stojanovski et al., 2004; Yoon et al., 2003), whereas Arabidopsis contains two FISl
variants. Our previous study showed that both FISlA and FISIB are dual-targeted to
peroxisomes and mitochondria. In addition, T-DNA insertion mutant of FISIA and RNAi
lines of FISIB both showed growth inhibition and contained peroxisomes and
mitochondria with incomplete fission, enlarged size, and number decrease (Zhang and
Hu, accepted with revision). To further determine whether FISlA and FISIB each play

specific roles in the fission of peroxisomes and mitochondria, we analyzed Arabidopsis

72

plants ectopically expressing FISIA or FIS] B and mutants in which the functions of both
FISlA and FISlB are disrupted. We also dissected FISlA and FISlB to determine
domains crucial for peroxisomal targeting, in order to compare targeting mechanisms

utilized by FISI orthologs in plants and mammals.

Results

Ectopic expression of FISlA and F ISlB leads to an increase in peroxisomal and

mitochondrial abundance

In our previous study of F ISl localization, overexpression of YFP-FISIA or YFP-FISIB
appeared to cause an increase in the number of peroxisomes and mitochondria, as well as
aggregation of these organelles (Zhang and Hu, accepted with revision). These results
suggest a role for FISlA and F ISlB as limiting factors in peroxisomal and mitochondrial
division. However, we could not exclude the possibility that these phenotypes were
rendered by a dominant negative effect of FISl proteins tagged with YFP, as YFP
proteins on the surface of the organelles may interact with each other and interfere with
the proper fiinction of F 1S1. To unequivocally determine the contribution of FISIA and
FISlB to peroxisomal and mitochondrial fission and to see whether or not these two
proteins have distinct functions in promoting organelle division, we generated plants
expressing untagged FISlA or F ISlB under the control of the 35 S promoter (35S::FISI).
To visualize morphological changes of peroxisomes, we used plants containing the
peroxisomal marker CFP-PTSI (PEROXISOME IARGETING _S_IGNAL TYPE 1; a

tripeptide consisting of Ser-Lys-Leu), which were generated and characterized in the lab

73

Figure 3.1 Overexpression of FISIA and FISIB increases the fission of
peroxisomes and mitochondria.

(A-F) Confocal laser scanning microscopic images of leaf mesophyll cells (A-C) and leaf
epidermal cells (D-F) from 4-week-old Arabidopsis plants expressing CFP-PTSI. In (A-
C), green signals indicate CFP-PTSl-labelled peroxisomes; red signals indicate
chloroplasts. In (D-F), fluorescent signals represent MitoTracker-stained mitochondria.

Scale bars = 10 um.

(G) RT-PCR analysis of RNA extracted from the respective F [S 1 -overexpressing plants.

(H) Quantification of total fluorescence (CF P or MitoTracker) and organelle (peroxisome

or mitochondrial) number per 2500 pm2 of the cells (n=10, p<0.05).

74

358.1'F/878

 

WT 35S::F/81A 35S::F/S1B
G \Y‘ H E] peroxisomefluorescence
@9 l mitochondrialfluorescence
s0 <36" <54" El peroxisome number
FIS1A ’5 E300 l mitochondrial number 120 a,
a" «3 250i 100 g

 
   

UBQ10 -— ,3,

CD
9 (3200
(t5 68‘ §150
(5‘3 8100
F/S1B -—- a 50 i
UBQ10 -- g i

WT 35S.'.'Fl81A 35S.'.'F/S1B

A
O
organelle nu b

75

in previous studies (Fan et al., 2005; Orth et al., 2007), as the background for

transformation.

We obtained 43 transgenic plants containing the 35S::FISIA transgene and 47 plants
expressing the 35S:.'FISIB transgene. After RT-PCR and confocal laser scanning
microscopic (CLSM) analyses of a subset of the transgenic plants, we selected two
representative lines from the T3 generation for detailed imaging analysis. Both FISIA-
and FISIB-overexpressing plants displayed markedly increased peroxisomal abundance;
peroxisomal aggregation was more evident in the FISIB-overexpressing plants (Figure 1,
a-c). To quantify this increase, we used Image] software to measure the area of CFP
fluorescence and the number of peroxisomes. 2500 umZ/cell from 10 confocal
microscopic images obtained from each genotype was used for the measurements. The
area of CFP fluorescence in plants overexpressing FISIA or FISIB increased to
approximately 5-6 times from that of the wild-type CFP-PTSI plant (Figure lg).
Likewise, the number of peroxisomes also increased to about 3 fold in the FISI-

overexpressing plants compared with the wild type (Figure 1g).

We used the mitochondrial dye MitoTracker to stain leaf cells of the transgenic plants
and subsequently confocal microscopy to examine changes in mitochondria. A significant
increase in mitochondrial abundance was also shown in the FISI-overexpressing plants
(Figure 1, d-f). Quantification analysis showed a 1.5- to 2-fold increase in the area of
MitoTracker fluorescence and the number of mitochondria in the transgenic plants
compared with the wild type, although these increases were not as dramatic as those seen
in peroxisomes (Figure 1 g).

76

Despite having a strong induction of peroxisomal and mitochondrial volume (measured
by fluorescence area), plants ectopically expressing FISIA or FISIB did not exhibit
obvious differences in appearance from the wild type under normal growth conditions,
nor did they have distinct germination or growth rate while germinating on agar plates
supplemented with or without sucrose (data not shown). Thus, although elevated levels of
FISIA or FISIB gave rise to significant increases in the abundance of peroxisomes and

mitochondria, they did not cause obvious physiological changes to the plants.

F 181A and F ISlB are partially redundant in promoting organelle fission

Single fisl mutants, whose transcripts of FISIA or FISI B were undetectable by RT-PCR,
showed similar phenotypes, that is, they were slightly smaller than the wild-type plants
and contained peroxisomes and mitochondria that were enlarged in size, reduced in
number, and clustered together (Zhang and Hu, accepted with revision). These findings
indicate that the two homologous proteins FISIA and FISlB are not completely
redundant in function and may each carry some unique roles in organelle fission. To test
this hypothesis, a fislA fisl B double mutant was needed. A T-DNA insertion mutant of
FISIA (SALK_086794) was characterized in previous studies and found to contain
undetectable levels of the FISIA mRNA (Scott et al., 2006; Zhang and Hu, accepted with
revision), whereas a fislB knockout mutant was unavailable. To this end, we created
fislA fislB double mutants by using RNAi to silence FISIB in the fislA mutant

background. The FISI B RNAi construct was generated in our previous study and was

77

 

 

3 WT R23 R25

  

FIS 1A
FIS1B

 

Figure 3.2 Plant phenotype of fisI mutants.
(A) Plants grown for 3 weeks. R23 and R25 are fisIA plants in which the FISIB gene is

also silenced.

(B) RT-PCR analysis of RNA fiom R23 and R25.

78

Figure 3.3 Peroxisomal and mitochondrial phenotypes of the fisl mutants.

(A-H) Confocal micrographs of leaf mesophyll cells (A-D) and leaf epidermal cells (E-
H) from 6-week-old wild-type and fisl mutant plants. All plants express the YFP-PTSI
peroxisomal marker gene. R23 and R25 are fisIA plants in which the expression of FIS] B
is also reduced. In (A-D), green signals indicate YFP-PTSI; red signals are chloroplasts.
In (E-H), fluorescent signals represent mitochondria stained by MitoTracker. Bars = 10

um.

(I) Quantification of total YFP or MitoTracker fluorescence area and the number of

peroxisomes or mitochondria within 2500 pm2 of the cells (n>8, p<0.05).

79

[:1 peroxisomefluorescence II] peroxisomenumber
I mitochondrialfluorescence. mitochondrialnumber

g," 60
501
40

00
O

 

fluorescence area (pm
A N

O

 

 

wT fis1A R23 R25-

80

 

45

~35

01
organelle number

proved to be effective in reducing FISIB expression; fislA mutant expressing the YFP-
PTSl peroxisomal marker was also generated in the same study (Zhang and Hu, accepted
with revision). 14 transgenic fislA plants containing the full-length FISIB RNAi
transgene and showing various levels of FISIB expression were obtained; two lines (R23
and R25) with strong reduction in FISIB gene expression were selected for future
analysis. R23 and R25 exhibited stronger growth inhibition than the fisIA single mutant
(Figure 2a). RT—PCR analysis confirmed that the FISIB gene was significantly silenced

in these two lines (Figure 2b).

We previously showed that although the number of peroxisomes in the fislA and fisIB
single mutants was decreased, the total volume of these organelles, as measured by
fluorescence area, remained largely constant from the wild type to the mutants (Zhang
and Hu, accepted with revision). These data suggest that plants seem to be able to
compensate for the mild division deficiencies by increasing the size of individual
peroxisomes. Confocal microscopic analysis of YFP-PTSI and MitoTracker signals in
the double mutants revealed no major differences in peroxisomal and mitochondrial
appearance and number between the double mutants and the fisIA single mutant parent
(Figure 3). All mutants contained clumped and enlarged peroxisomes and mitochondria
(Figure 3, a-h), similar to the phenotype shown in the fislA mutant (Zhang and Hu,
accepted with revision; Figure 3). However, quantification data revealed that, although
the number of these organelles was largely unchanged, the total volume of peroxisomes
and mitochondria was slightly lower in the double mutants than in the fislA single mutant

(Figure 3i). Hence, the plant growth and organelle phenotypes collectively led us to

81

conclude that FISIA and FISlB have overlapping and unique functions in controlling the

division of mitochondria and peroxisomes.

Targeting of HS] proteins to peroxisomes

The C-terminal tail (aa 92-152) of hFlSl is both necessary and sufficient for targeting
this protein to peroxisomes and mitochondria in human cells (Koch et al., 2005).
Furthermore, the transmembrane domain (TMD) along with a short basic segment at the
C-terrninal end is essential for mitochondrial and peroxisomal targeting of hFlSl (Koch
et al., 2005; Stojanovski et al., 2004). In our previous study, we demonstrated in
Arabidopsis that FISlA and F ISlB, when tagged with YFP at N-terminus (YFP-FISI),
were dual-targeted to peroxisomes and mitochondria, whereas FISl proteins with YFP
fused to the C-terminus (F ISl-YFP) were mainly diffused in the cytosol and the nucleus,
supporting the notion that the C-terminal end of the F ISl proteins is important for proper
organelle targeting in plants as well (Zhang and Hu, accepted with revision). In light of
these findings, questions arose as to what specific signals in the same FISl protein are
being recognized by the different targeting machineries of peroxisomes and mitochondria,
and whether FISl orthologs in diverse species utilize similar targeting mechanisms. As a
first step toward answering these questions, we determined regions in the AtFISl proteins
sufficient for peroxisomal targeting and tested whether the short basic segment
downstream from TMD is also essential for peroxisomal targeting in plants. Here we
chose to focus on the peroxisomal aspect of targeting due to our primary interests in this

organelle.

82

Figure 3.4 Sequence alignment of FISl proteins and immunoblot analysis of
truncated FISl proteins expressed in tobacco leaves.

(A) Alignment of Arabidopsis FISlA and FISIB and the human FISl proteins. The
“ putative transmembrane domain (TMD) is underlined. Domains used in some of the
truncation constructs are: FISIANT, aa 1-85; FISIACT, aa 86—170; FISlBNT, aa l-lOl;
FISlBCT, aa 102-167; FISIATMDICE, aa 139—170; FISIBTMDICE, aa 141-167. The boxed

region indicates TMD+CE (extreme C-terminal end).

(B) Immunoblot analysis of proteins extracted from tobacco leaves co-expressing YFP-
fusions of truncated FISl proteins and the peroxisomal marker protein CFP-PTSI.
Proteins were detected by the a-GFP antibody. Samples are: lane 1, protein marker; lane
2, tissue expressing CFP-PTSI only; lanes 3-10, leaves co-expressing CFP-PTSI and
YFP-FISlANT, YFP-FISIACT, YFP-FISIBNT, YFP-FISIBCT, YFP-FISIATMDICE, YFP-
FIS1BTMD+CE YFP-FISlAA'67"7°, and YFP-FISIBA'66"°7, respectively. Asterisks on the
left of the protein bands point to the corresponding YFP-FlSl fusions. The arrow

indicates position of the CFP-PTSI protein band.

83

...... ml

 

. sees, 6E Ea Eggsaafl Hem

 

al.; s...

H

HE Emmi-HE E, EHWEEfiafi>€ao-...zmmo Ewen

 

mum. m. anon-HE.

Essen e E. a. m,...,wa-..eszans.s

 

iémmzflmamfl

 

...e.m_ eases; .. 4E8 assess

qsnmm

PHH

 

 

  
   

umzm mm<m<m§
a .....
lllllllllllllllllllllll m>mmzn
EmmH-qooqu 11111111111111111 mww<omaHmzma>MHzl

  

Hi—ir—lr—l

mHmHmum
«HmHana
Henna
afimsm
mHmHana
«HmHaea

Hanan
ofimfla

mHmHanm
<HmHmu<
Henna
QHmHa

<.

84

Figure 3.4 continued

B

1 2 3 4 5 6 7 8 9 1O
37 .Astensks =YFP-FIS1 fusrons
25 .. gt; mCFP-PTS1

 

85

Figure 3.5 C-terminus of FISlA and FISlB is sufficient for peroxisomal
targeting.

Confocal images were taken from leaf epidermal cells of 4-week-old tobacco plants co-
infiltrated with Agrobacteria containing CF P-PTSl and YFP-FISl truncations. Bars == 10

um.

86

CF P-PTSl merged

YFP-fusion

 
 

ez<vw_u_-n_u_> Em Fm_n_-nE> 5<Fw_u_-n_n_>

 

    

5m Fw_u_-n_n_>

Figure 3.6 Analysis of the role for TMD and the C-terminal end of FISlA and
FISlB in peroxisomal targeting.

Shown are confocal images of 4-week-old tobacco leaf epidermal cells co-expressing

CFP-PTSI and YFP-fusions of FISl truncations. Bars = 10 um.

88

CFP—PTS1 merged

YFP-fusion

    

  
 
 

m0+oE<Fw_u_-n_n_> SEE-Hm Fw_u_-n_n_> ot-\.2<<vw_n_-n_n_> ETeoEm rw_u_-n_u_>

89

Arabidopsis FISlA and FISlB proteins are 58% identical in amino acid sequence and
contain predicted molecular weight of 18.7 and 17.9 kDa, respectively. They share
approximately 28% sequence identity with the 17-kDa human hFlSl protein; an
alignment of the Arabidopsis and human FISl proteins revealed strong conservation at
the C-terminus, especially in the putative TMD (Figure 4a). Basic residues are also found
to flank TMD at the 3’ end of the Arabidopsis F 1S1 proteins: FISIA has an arginine and
two lysines (diK motif), whereas FISlB only contains an arginine (Figure 4a). To
determine sequences in the AtFISl proteins sufficient for peroxisomal targeting, we
expressed in tobacco leaf epidermal cells a series of truncated F 131A and FISlB proteins,
all of which were attached to the C-terminus of YFP. 35S promoter-driven truncated FIS]
constructs used in the analysis included: YFP-)‘i‘ISIA/BNT (N-terminal half), YFP-
FISlA/BCT (C-terminal halt), YFP-FISIA/BTMD+CE (C-terminus including TMD and the
adjacent C-terminal end), YFP-FISIAA'67'170, and YFP-FISlBA'66'167. Two days afier
inoculation of the FIS] truncation constructs combined with CFP-PTSI via Agrobacteria]
infiltration, expression of the YFP-fusion proteins in tobacco leaves were confirmed by

immunoblot analysis using a—GFP antibodies (Figure 4b).

Co-localization of the YFP-fusion proteins with the peroxisomal marker CFP-PTSI was
tested by confocal microscopy. Both YFP-F IS1ANT and YFP-FISIBNT were present in
the nucleus, cytosol, and possibly on the plasma membrane (Figure 5, a-b), re-affirming
that signals required for peroxisomal targeting do not reside in the N-terrninal regions of
the F181 proteins. In contrast, YFP-FISIACT and YFP-FISIBCT showed punctate
fluorescent signals largely co-localized with CFP-PTSI. However, increases in

peroxisome number and aggregation, phenotypes caused by overexpressing YFP-FISIA

90

and YFP-FISIB proteins (Zhang and Hu, accepted with revision), did not occur in cells

I”. These results are consistent with the notion that the C-

overexpressing YFP-FIS
terminus of FISl proteins is necessary and sufficient for peroxisomal targeting but is

insufficient to confer protein function in promoting peroxisomal fission, in other words,

the N-terminus is required for proper protein function (Koch et al., 2005).

YFP-FISIATMD+CE constructs were used to further delineate domains in the C-terminus of

ATMD+CE contained the

the FIS] proteins sufficient for peroxisomal targeting. YFP-FISl
last 32 aa of FISlA, whereas YFP-FISIBTMD+CE contained the last 27 aa of FISlB
(Figure 4a). These two fusion proteins targeted to peroxisomes and to structures
characteristic of the nucleus and plasma membrane (Figure 6, a-b). Thus, the TMD
domain and its 3’ flanking sequences seem to contain major signals required for

peroxisomal targeting, but other sequences outside this region are also needed for

efficient and accurate targeting to peroxisomes.

The short C-terminal segment adjacent to the TMD was shown to be essential to
peroxisomal and mitochondrial targeting of hFlSl (Koch et al., 2005; Yoon et al., 2003).
To determine whether the same region in AtFISl is also required for peroxisomal
targeting in plants, we deleted this short stretch of sequence from the C-terminal end of
the AtFISl proteins: YFP-FISlAmm'170 was deleted for the last four amino acids (SRKK)
of FISlA and YFP-FISlBM’é'167 was deleted for the last two amino acids (RS) of FISlB.
Both proteins were largely targeted to small and spherical structures, many of which
overlapped with CFP-PTSl, although localization to structures characteristic of the
nucleus and plasma membrane was also evident (Figure 6, c-d). These data suggest that

91

the diK motif and other basic residues at the C-terminal end of Arabidopsis FISl are
involved but not critical in the peroxisomal targeting of these proteins. As such, the role
of the C-terrninal segment adjacent to TMD may differ' from plants to mammals in

targeting F 181 to peroxisomes.

Discussion

Overexpressing myc-hFISl in human COS-7 cells led to a dramatic increase in the
number of small and punctiforrn peroxisomes and a pronounced fragmentation of
mitochondria (Koch et al., 2005; Yoon et al., 2003). Similarly, elevating levels of
AtFISIA and FISIB also significantly increased the number of peroxisomes and
mitochondria in plants (Figure 1). Thus, the function of F 181 orthologs in the division of
peroxisomes and mitochondria is well conserved in diverse species. In contrast to the
dramatically elongated peroxisomes displayed in plants overexpressing each of the five
Arabidopsis PEX11 proteins (Orth et al., 2007), plants overexpressing FISIA or FISIB
primarily show completely divided and sometimes clumped peroxisomes. This fits with
the model that PEX11 proteins are responsible for the initial step of peroxisome division,
i.e., peroxisome elongation, whereas FISl proteins are mediating a later step in the
process, namely, peroxisome fission. Both PEX11 and F181 proteins are apparently
limiting factors in the division process: PEXll’s role is restricted to peroxisomes,

whereas FISl proteins perform dual functions.

Plants ectopically expressing FISlA and FISB show slightly distinct peroxisome

phenotypes, that is, peroxisomes in FISIA-overexpressors tend to be more completed in

92

fission than those in plants overexpressing FISIB (Figure 1). This difference may reflect
distinct roles of these two proteins in peroxisome fission. Consistent with this view is the
fact that single mutants of FISIA or FISIB each have deficiency in peroxisomal (and
mitochondrial) fission and are inhibited in growth (Zhang and Hu, accepted with
revision; this study). It is likely that each Arabidopsis FISl isoform may interact with
specific downstream effector proteins such as DRPs in mediating the division of
peroxisomes and mitochondria. Difference in the function of F 151A and F ISlB have also
been shown in Arabodopsis suspension cultured cells, whereby F ISlB but not FISlA was
shown to have a role in cell cycle-associated peroxisome replication (Lingard et al.,

2008).

It is surprising that our double mutants only show slightly stronger phenotypes than fislA
or fislB single mutants (this study; Zhang and Hu, accepted with revision), given that the
expression of both genes were greatly reduced in these plants. It is likely that other
proteins with little sequence identity with FlSl perform similar functions on the

membrane of these two types of organelles.

Human cells with reduced levels of hFlSl contained elongated and segmented
peroxisomes that have been constricted but not separated (Koch et al., 2005). However,
Arabidopsis mutants in which the functions of F ISlA, FISlB, or both, are disrupted are
not elongated but rather enlarged (Zhang and Hu, accepted with revision; this study).
Similarly, hFISI RNAi cells displayed extended mitochondrial tubules, whereas these
organelles in the fisl mutants in Arabidopsis are mostly enlarged in size (Zhang and Hu,
accepted with revision; Figure 3 of this study). This difference in peroxisomal and

93

mitochondrial morphology in the mutants may reflect distinct mechanisms utilized by

diverse species in coping with deficiencies in organelle division.

Although F 181 orthologs in different organisms exert conserved functions in peroxisomal
fission, targeting signals in these proteins seem to be less conserved. For example, signals
sufficient for peroxisome targeting reside in the C-terminal half of the FISl protein in
both mammals and plants, yet the exact regions to which these signals are restricted may
differ. The last 26 amino acids of hFlSl were successfully targeted to peroxisomes and
mitochondria (Koch et al., 2005), whereas AtFISl proteins containing the corresponding

1mm“) not just target to

domain plus a few extra amino acids upstream (i.e., YFP-F IS
peroxisomes but also localize to the nucleus and plasma membrane (Figure 6). In
addition, hFlSl protein lacking the last five amino acid at the C-terminal end (SKSKS;
Figure 4a) were diffused in the cytosol and failed to localize to peroxisomes (Koch et al.,
2005). In contrast, AtFISl proteins missing the corresponding segment at the extreme C-
terminus are still largely localized to peroxisomes (Figure 6), suggesting that this small
region is not essential for peroxisomal targeting in Arabidopsis. Previous studies of
hFlSl protein showed that the two lysine residues (diK motif; Figure 4a) at the extreme
C-terminus are required for mitochondrial targeting, as replacing both lysine residues
with alanines led to mis-targeting of the hFlSl protein to the ER (Stojanovski et al.,
2004). Given the targeting pattern of the C-terminal end-deleted Arabidopsis FISl
proteins in our study, we predict that this C-terminal segment may not be essential for
mitochondrial targeting in plants, either. More detailed dissection of the C-terminal

region is required to precisely locate residues required for FISl targeting to peroxisomes

vs. mitochondria in plants, since such information cannot be accurately derived from

94

studies of FlSl orthologs in other kingdoms. In fact, targeting mechanism may even
differ in different research systems of the same organism. For example, on their own,
neither myc-FISlA nor myc-FlSlB was able to target to peroxisomes labeled by d—

catalase antibodies in Arabidopsis suspension cell cultures (Lingard et al., 2008).

Peroxisomes and mitochondria, two subcellular compartments with different evolutionary
origins, distinct structures, and unique metabolic function, share the same DRP and F181
proteins in their division machines. This fact may bear some physiological significance.
Given that plant peroxisomes and mitochondria act in collaboration in two of the most
important physiological processes in plants, namely, lipid metabolism and
photorespiration (Beevers, 1979), it is likely that these organelles also coordinate to some
degrees in multiplication in order to carry out these collaborative processes to successful

completion.

Taken together, our analysis of gain- and loss-of-funCtion mutants of the Arabidopsis
FISIA and FISIB genes and peroxisomal targeting analysis of truncated FISl proteins
have revealed that FISl orthologs in diverse species contain conserved as well unique
features in their targeting mechanism and in their role in mediating the fission of
peroxisomes and mitochondria. In order to uncover additional and plant-specific features
of organelle division, we need to perform further forward genetic and biochemical

screens to identify novel components of the division machines.

Materials and Methods

95

Plant Growth

Seedlings (all in Col-0 background) were germinated under 16h light (60 uE m"2
sec—l)/8h dark cycles and 21°C on plates containing 0.6% (w/v) agar, ‘/2 Murashige and
Skoog salt mixture ('/2MS), and 1% (w/v) sucrose. 2w plants were transferred to soil and
grown under a photosynthetic photon flux density of 70—80 umol m‘2 sec’1 at 21°C with
14h light/ 10h dark cycles. The wild-type plants expressing the YFP-PTSI or CFP-PTSI
transgene were generated from previous studies (Desai and Hu, 2008; Fan et al., 2005;
Orth et al., 2007). The fislA mutant was characterized in a previous study (Zhang and

Hu, accepted with revision).

Construct generation and plant transformation

We used the proofreading High-Phusion DNA polymerase to amplify DNA fragments
used for cloning, with conditions suggested by the manufacturer (New England Biolabs
lnc.). Primers used to amplify The FIS] genes were: FISlA forward GGGGTACC
ATGGATGCTAAGATC and reverse ACGCGTCGACTCATTTCTTGCGAGAC; and
FISlB forward GGGGTACCATGGACGCGGCGATAG and reverse
ACGCGTCGACTTAGCTGCGTAATATG. The PCR products were digested by KpnI
and Sall and individually cloned into a binary vector containing the 35S promoter. The
FISIB RNAi construct was made in a previous study (Zhang and Hu, accepted with

revision).

96

Standard gateway cloning system (Invitrogen) was used to make the FIS] truncation
constructs. The Gateway-compatible PCR products of FIS] truncations were cloned into
binary vectors containing YFP-attRI-Cm’-cch—attR2 integration region using One-Tube

Format Protocol. Primers used in PCR amplifications are as follows:

YFP-FISIA”:

Forward
GGGGACAAGTITGTACAAAAAAGCAGGCTTCATGGATGCTAAGATCGG,
Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTGTCAAGGGG
CACTGCTTTC.

YFP-FISIA CT.-
Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTC ATG
CCATTGGAGGACCG,

Reverse
GGGGACCACTTTGTACAAGAAAGCTGGGTGTCATTTCTTGCGAGACATCGC.

YFP-FISIB”:

Forward
GGGGACAAGTTTGTACAAAAAAGCAGGCTTGATGGACGCGGCGATAGGG,
Reverse GGGGACCACTTTGTACAAGAA AGCTGGGTG
TTATCTTGAAAAGTCACC.

YFP-FISIB”:
Forward GGGGACAAGTTTGTACAAAAAAGCAGGCTTTC
ATGAGCCGGGATTGTAT,

Reverse
GGGGACCACTTTGTACAAGAAAGCTGGGTGTTAGCTGCGTAATATGGCTGC.

YFP-FISIA TMD+CE;
Forward
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAAGGATGGTGTTATAG GG,

Reverse
GGGGACCACTTTGTACAAGAAAGCTGGGTGGCTTGCATGCCTGCAGGTCC.

YFP-FISIBTMWE:
Forward
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAAAGATGGTG TGATTGGC,

97

Reverse
GGGGACCACTTTGTACAAGAAAGCTGGGTGGCTTGCATGCCTGCAGGTCC.

YFP-FISIAWW;

Forward
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGATGCTAAGATCGG,
Reverse GGGGACCACTTTGTACAAGAAAGCTGGGTTTTACATCGCTG
CTACGATACC.

YFP-FISIBMN“:

Forward
GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGACGCGGCGATAGGG
Reverse
GGGGACCACTTTGTACAAGAAAGCTGGGTTTTATAATATGGCTGCAGC
AATAC.

The resulting constructs were transformed into A. tumefaciens (C58C1) via
electroporation. We used the floral-dip method (Clough and Bent, 1998) to transform the
35S:.'FISIA/IB constructs into wild-type plants already expressing CFP-PTSI, and to
transform the FISIB RNAi construct (Zhang and Hu, accepted with revision) into fisIA
mutants already expressing YFP-PTSI (Zhang and Hu, accepted with revision). Stable
primary transformants were selected on '/2 MS medium containing kanamycin (50 ug/ml;
for 35S::FISI) combined with gentamycin (60 ug/mL; for CFP-PTSI) to select for FISl
overexpressing plants, and kanamycin (50 ug/ml; for YFP-PTSI) plus glufosinate
ammonium (10 ug/mL; Crescent Chemical, Augsburg, Germany, for FISIB RNAi) to
select for fislA mutants containing the FISIB RNAi transgene. For tobacco infiltration,
Agrobacteria containing the YFP-fusion constructs were co-infiltrated with CFP-PTSI in
leaves of four-week-old Nicotiana tabacum (cv. Petit Havana) plants grown at 25°C
(Goodin et al., 2002). Method for identification of plants in which FISIB is silenced is

described previously (Zhang and Hu, accepted with revision).

98

Reverse transcription (RT)-PCR analysis of overexpression and RN Ai lines

Total RNA was extracted using an RNeasy Plant Mini Kit (Qiagen) using protocols
suggested by the manufacturer. First-strand cDNA was synthesized using the Invitrogen
Reverse Transcriptase, Superscript II (Invitrogen). PCR amplification was carried out
using the following gene-specific primers: FISlA (At3g57090) forward
ATGGATGCTAAGATCGGACAATTC, reverse GCGAGACATCGCTGCTACGATA
CC; FISlb (At5g12390) forward ATGGACGCGGCGATAGGGAAGGT, reverse
GCTGCGTAATATGGCTGCAGCAA; UBQ-I 0 (At4g05320) forward
TCAATTCTCTCTACCGTGATCAAGATGCA, reverse GGTGTCAGAACTCTC
CACCTCAAGAGTA. PCR conditions were: 95°C 2 min, 26 cycles of 95°C 30 s, 54°C
30 s, 72°C 1min, and a final elongation step at 72°C for 10 min. Amplified DNA was run

on 0.8% agarose gel.

Immunoblot analysis

After 48 hours of Agrobacterial infiltration, we ground tabacum leaf discs in liquid
nitrogen and then suspended the leaf powder in IXSDS-polyacrylamide gel
electrophoresis (PAGE) sample buffer. The samples were boiled for 5 min followed by
centrifugation for 2 min. The supernatant was run on SDS-PAGE gels and transferred to
Immobilon-P membrane for blotting (Millipore Corp., Bedford, MA). Primary antibody
used to detect YFP and CFP proteins was a rabbit polyclonal GFP antibody (Santa Cruz
Biotechnology, Inc.). The secondary antibody was goat anti-rabbit IgG (LI-COR

Biosciences).

99

Confocal laser scanning microscopy and organelle quantification

Confocal laser scanning microscopes (Zeiss Meta 510 or Zeiss Pascal) were used to
obtain images of fluorescence proteins in plant cells. To detect YFP and CFP, plant tissue
was mounted in water before analysis. For detection of mitochondria, leaves were first
treated with 500 nM MitoTracker Red CMXRos (Mitochondrion-Selective Probes,
Invitrogen) according to a previous study (Arimura and Tsutsumi, 2002b). Lasers used
for fluorophore excitation were: CFP, 458 nm; YF P, 514 nm; MitoTracker, 543 nm, and
chlorophyll, 633 nm. For emission, the following filters were used: 465-510 nm band
pass for CF P, 520-555 band pass for YFP, 560-614 band pass for MitoTracker, and 650

nm long pass for chlorophyll. All images were acquired from single optical sections.

Image] (http://rsb.info.nih.gov/ij/) was used to measure fluorescence area and organelle
number in 50 um X 50 pm of confocal images. Confocal images obtained from YFP or
MitoTracker single channels were first converted to grayscale (8-bits). Scale for
measurement was set based on scale bar on the confocal images. We used manual
settings of the Threshold function to designate objects (organelles) to be measured or
counted and the Analyze Particles function to measure fluorescence area and count the
number of organelles. Organelles aggregated together without clear separation from each
other would be treated as a single one. The Excel program (Microsoft) was used to
calculate standard deviations and statistical significance. For all organelle counting and
fluorescence measurement shown in Figure 1 and Figure 3, >8 images from each plant

were analyzed, p<0.05.

100

Accession numbers

Sequence data from this article can be found in the EMBL/GenBank data libraries under
accession numbers: hFlSl, NP 057152; FISlA, Q9M1] 1 (At3g57090); FISlB, Q94CK3

(At5g12390).

Acknowledgments

We would like to thank Marlene Cameron for graphic assistance and Karen Bird for
manuscript editing. This work was supported by the US. Department of Energy and the

National Science Foundation (MCB 0618335) to ].H. No conflict of interest declared.

101

References

Arimura S, Aida GP, Fujimoto M, Nakazono M, Tsutsumi N. Arabidopsis dynamin-like
protein 2a (ADL2a), like ADL2b, is involved in plant mitochondrial division.
Plant Cell Physiol (2004) 45:236-242.

Arimura S, Tsutsumi N. A dynamin-like protein (ADL2b), rather than FtsZ, is involved
in Arabidopsis mitochondrial division. Proceedings of the National Academy of
Sciences of the United States of America (2002a) 99:5727-5731.

Arimura S, Tsutsumi N. A dynamin-like protein (ADL2b), rather than FtsZ, is involved
in Arabidopsis mitochondrial division. Proceedings of the National Academy of
Sciences of the United States of America (2002b) 99:5727-5731.

Beevers H. Microbodies in higher plants. Ann Rev Plant Physiol (1979) 30: 159-193.

Clough SJ, Bent AF. Floral clip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant J (1998) 16:735-743.

de Felipe MR, Lucas MM, Pozuelo JM. Cytochemical study of catalase and peroxidase in
the mesophyll of Lolium rigidum plants treated with isoproturon. J Plant Physiol
(1988) 132:67-73.

Desai M, Hu J. Light induces peroxisome proliferation in Arabidopsis seedlings through
the photoreceptor phytochrome A, the transcription factor HY5 HOMOLOG, and
the peroxisomal protein PEROXIN 1 lb. Plant Physiol (2008) 146:1 117-1127.

Fagarasanu A, Fagarasanu M, Rachubinski RA. Maintaining peroxisome populations: a
story of division and inheritance. Annu Rev Cell Dev Biol (2007) 23:321-344.

Fan J, Quan S, Orth T, Awai C, Chory J, Hu J. The Arabidopsis PEX12 gene is required
for peroxisome biogenesis and is essential for development. Plant Physiol (2005)
139:231-239.

Ferreira MB, Bird B, Davies DD. The effect of light on the structure and organization of
Lemna peroxisomes. J Exp Bot (1989) 40: 1029-1035.

102

Goodin MM, Dietzgen RG, Schichnes D, Ruzin S, Jackson AO. pGD vectors: versatile
tools for the expression of green and red fluorescent protein fusions in
agroinfiltrated plant leaves. Plant J (2002) 31:375-383.

Hayashi M, Nishimura M. Entering a new era of research on plant peroxisomes. Curr
Opin Plant Biol (2003) 6:577-582.

Hoepfner D, van den Berg M, Philippsen P, Tabak HF, Hettema EH. A role for Vpslp,
actin, and the Monp motor in peroxisome abundance and inheritance in
Saccharomyces cerevisiae. J Cell Biol (2001) 155:979-990.

Hoppins S, Lackner L, Nunnari J. The machines that divide and fuse mitochondria.
Annual review of biochemistry (2007) 76:751-780.

James DI, Parone PA, Mattenberger Y, Martinou JC. hFisl, a novel component of the
mammalian mitochondrial fission machinery. The Journal of biological chemistry
(2003) 278:36373-36379.

Kobayashi S, Tanaka A, Fujiki Y. Fisl, DLPl, and Pexll p coordinately regulate
peroxisome morphogenesis. Exp Cell Res (2007) 313:1675-1686.

Koch A, Schneider G, Luers GH, Schrader M. Peroxisome elongation and constriction
but not fission can occur independently of dynamin-like protein 1. J Cell Sci
(2004) 117:3995-4006.

Koch A, Thiemann M, Grabenbauer M, Yoon Y, McNiven MA, Schrader M. Dynamin-
like protein 1 is involved in peroxisomal fission. J Biol Chem (2003) 278:8597-
8605.

Koch A, Yoon Y, Bonekamp NA, McNiven MA, Schrader M. A role for Fisl in both
mitochondrial and peroxisomal fission in mammalian cells. Mol Biol Cell (2005)
16:5077-5086.

Kuravi K, et a1. Dynamin-related proteins Vpslp and Dnmlp control peroxisome
abundance in Saccharomyces cerevisiae. J Cell Sci (2006) 119:3994-4001.

Li X, Gould S]. The dynamin-like GTPase DLPl is essential for peroxisome division and
is recruited to peroxisomes in part by PEX11. J Biol Chem (2003) 278:17012-
17020.

103

Lingard MJ, Gidda SK, Bingham S, Rothstein SJ, Mullen RT, Trelease RN. Arabidopsis
PEROXINl lc-e, FISSIONlb, and DYNAMIN-RELATED PROTEIN3A
Cooperate in Cell Cycle-Associated Replication of Peroxisomes. The Plant cell
(2008).

Lingard MJ, Trelease RN. Five Arabidopsis peroxin 11 homologs individually promote
peroxisome elongation, duplication or aggregation. J Cell Sci (2006) 119:1961-
1972.

Logan DC, Scott I, Tobin AK. ADLZa, like ADL2b, is involved in the control of higher
plant mitochondrial morphology. J Exp Bot (2004) 55:783-785.

Mano S, Nakamori C, Kondo M, Hayashi M, Nishimura M. An Arabidopsis dynamin-
related protein, DRP3A, controls both peroxisomal and mitochondrial division.
Plant] (2004) 38:487-498.

Mozdy AD, McCaffery J M, Shaw JM. Dnmlp GTPase-mediated mitochondrial fission is
a multi-step process requiring the novel integral membrane component F islp. The
Journal of cell biology (2000) 151:367-380.

Nito K, Kamigaki A, Kondo M, Hayashi M, Nishimura M. Functional classification of
Arabidopsis peroxisome biogenesis factors proposed from analyses of knockdown
mutants. Plant Cell Physiol (2007) 48:763-774.

Nyathi Y, Baker A. Plant peroxisomes as a source of signalling molecules. Biochim
Biophys Acta (2006) 1763: 1478-1495.

Oksanen E, Haikio E, Sober J, Kamosky DF. Ozone-induced H202 accumulation in field-
grown aspen and birch is linked to foliar ultrastructure and peroxisomal activity.
New Phytol. (2003) 161:791-799.

Olsen LJ, Harada J. Peroxisomes and their assembly in higher plants. Annu Rev Plant
Biol (1995) 46:123-146.

Orth T, et al. The PEROXIN 11 protein family controls peroxisome proliferation in
Arabidopsis. Plant Cell (2007) 19:333-350.

Osteryoung KW, Nunnari J. The division of endosymbiotic organelles. Science (2003)
302: 1698-1704.

104

Palma JM, Garrido M, Rodriguez-Garcia MI, del Rio LA. Peroxisome proliferation and
oxidative stress mediated by activated oxygen species in plant peroxisomes. Arch
Biochem Biophys (1991) 287:68-74.

Praefcke G], McMahon HT. The dynamin superfamily: universal membrane tubulation
and fission molecules? Nat Rev Mol Cell Biol (2004) 5:133-147.

Purdue PE, Lazarow PB. Peroxisome biogenesis. Annu Rev Cell Dev Biol (2001)
17:701-752.

Reumann S, Weber AP. Plant peroxisomes respire in the light: some gaps of the
photorespiratory C2 cycle have become filled--others remain. Biochim Biophys
Acta (2006) 1763: 1496- l 5 1 0.

Schrader M. Shared components of mitochondrial and peroxisomal division. Biochimica
et biophysica acta (2006) 1763:531-541.

Stojanovski D, Koutsopoulos OS, Okamoto K, Ryan MT. Levels of human Fisl at the

mitochondrial outer membrane regulate mitochondrial morphology. J Cell Sci
(2004)117:1201-1210.

Thorns S, Erdmann R. Dynamin-related proteins and Pexll proteins in peroxisome
division and proliferation. FEBS J (2005) 272:5169-5181.

Titorenko VI, Mullen RT. Peroxisome biogenesis: the peroxisomal endomembrane
system and the role of the ER. J Cell Biol (2006) 174:11-17.

Van den Bosch H, Schutgens R, Wanders R, Tager J. Biochemistry of Peroxisomes. Ann
Rev Biochem (1992) 61:151-197.

Wilsbach K, Payne GS. Vpslp, a member of the dynamin GTPase family, is necessary
for Golgi membrane protein retention in Saccharomyces cerevisiae. The EMBO
journal (1993) 12:3049-3059.

Yan M, Rayapuram N, Subramani S. The control of peroxisome number and size during
division and proliferation. Curr Opin Cell Biol (2005) 17:376-383.

105

Yoon Y, Krueger EW, Oswald BJ, McNiven MA. The mitochondrial protein hFisl
regulates mitochondrial fission in mammalian cells through an interaction with
the dynamin-like protein DLPl. Mol Cell Biol (2003) 23:5409-5420.

Zolman BK, Yoder A, Bartel B. Genetic analysis of indole-3-butyric acid responses in

Arabidopsis thaliana reveals four mutant classes. Genetics (2000) 156:1323-1337.

106

Chapter 4 The Arabidopsis Chloroplast Division Protein DYNAMIN-RELATED
PROTEINSB also Mediates Peroxisome Division

Xinchun Zhang and J ianping Hu

Submitted to the Plant Cell (2009)

107

Abstract

Peroxisomes are highly dynamic organelles involved in various metabolic pathways. The
division of peroxisomes is controlled by the PEROXINll (PEX11) proteins that initiate
peroxisome elongation, and the dynamin-related proteins (DRPs) and FISSIONI (FISl)
proteins that function together to mediate peroxisome fission that is the late step of
peroxisome division. In Arabidopsis, DRP3A/DRP3B and F IS1A/F ISlB are two pairs of
homologous proteins known to be shared by peroxisomal and mitochondrial division.
Here we report that DRPSB, a DRP distantly related to DRP3 and originally identified as
a chloroplast division protein, also contributes to peroxisome division. DRPSB is dual-
targeted to peroxisomes and chloroplasts. Mutations in the DRPSB gene lead to
peroxisome division defects and compromised peroxisome functions. Using bimolecular
fluorescence complementation (BiFC) and co-immunoprecipitation (Co-IP) assays, we
further demonstrate that DRPSB forms homodimers and interacts with DRP3A, DRP3B,
FISIA, and all five Arabidopsis PEX11 isoforms. Specific interactions among individual
DRP, F131, and PEX11 proteins occur on peroxisomes and mitochondria, prompting the
hypothesis that distinct targeting mechanisms may have been created in plants to recruit
DRPSB, DRP3A, and DRP3B to various organelles and that proteins involved in the

early and late stages of peroxisome division may act coordinately.

108

Introduction

Peroxisomes are ubiquitous eukaryotic organelles that participate in diverse metabolic
fianctions. In plants, these single membrane-bound subcellular structures are involved in
biochemical and physiological processes such as photorespiration, fatty acid metabolism,
hydrogen peroxide degradation, synthesis of jasmonic acid, and metabolism of indole- 3-
butyric acid, and are essential to embryo viability. Peroxisomes are often found to be in
intimate physical contact with other subcellular compartments such as mitochondria and
chloroplasts, and act in concert with these organelles in a number of metabolic pathways

(reviewed in Kaur et al., 2009).

Peroxisomes are highly dynamic, changing their abundance in response to environmental,
metabolic, and development cues for proper functioning under diverse conditions (Purdue
and Lazarow, 2001; Yan et al., 2005). Despite continuous debates over the evolutionary
origin of peroxisomes, it is commonly believed that these organelles arose from the
endoplasmic reticulum (ER) during evolution and can also be formed de novo in the ER
in cells previously deprived of peroxisomes, at least in yeast (Hoepfner et al., 2005;
Gabaldon et al., 2006; Schluter et al., 2006; Titorenko and Mullen, 2006). Evidence from
yeasts also demonstrate that peroxisomes multiply primarily from pre—existing
peroxisomes through either constitutive or induced division; the latter is also called
proliferation. Both division and proliferation involve peroxisome elongation (growth),
constriction and fission, during which at least two peroxisomes are formed from a single
pre-existing peroxisome (Yan et al., 2005; Fagarasanu et al., 2007). Previous studies have
identified a number of key factors in peroxisome division/proliferation, among which

109

PERXINll (PEX11), dynamin-related proteins (DRPs), and FISSIONI (FISl) represent
three evolutionarily conserved families of proteins that control various stages of division
and proliferation (reviewed in Kaur et al., 2009). PEX11 proteins are exclusively
involved in the early step of peroxisome division, whereas DRP and F151 are shared by
the division apparatus of peroxisomes and mitochondria, executing the fission of these

organelles in diverse species (Delille et al., 2009).

PEX11 is believed to play a rate-limiting role in initiating peroxisome
elongation/tubulation, the first step of peroxisome division. This conclusion is based on
the fact that overexpressing PEX11 promotes peroxisomal elongation, whereas deletion
or silencing of the gene(s) causes fewer and/or larger peroxisome. Yeast species each
carry a single PEX11, whereas three isoforrns of PEX11 (PEX1la, -B, and -y) exist in
mammals, with PEX] 10 being essential for embryo viability (Yan et al., 2005;
Fagarasanu et al., 2007; Kaur and Hu, 2009). Arabidopsis contains five PEX11 isoforms
categorized into three subfamilies, PEXl 1a, PEXl lb, and PEXI 10 to -e, all of which are
integral membrane proteins of the peroxisome performing functions similar to those of
their yeast and animal orthologs (Lingard and Trelease, 2006; Orth et al., 2007).
Members of the Arabidopsis PEX11 family are partially redundant in function and
display distinct expression patterns; among them PEX11b plays a specific role in
mediating the phytochrome A-dependent light induction of peroxisome proliferation in
seedlings (Orth et al., 2007; Desai and Hu, 2008). The PEX11 protein (Pexllp) in
Saccharomyces cerevisiae is able to form homooligomers, resulting in the inhibition of
its function (Marshall et al., 1996). Mammalian PEX] 113 self interacts in two-hybrid and

co-immunoprecipitation (co-1P) assays (Kobayashi et al., 2007), and results from

110

bimolecular fluorescence complementation (BiFC) assays in Arabidopsis cultured cells
support the ability for all five Arabidopsis PEX11 isoforrns to homo- and heterodimerize
(Lingard et al., 2008). The biological consequences of PEX11 dimerization in plants and
animals and the molecular mechanism for the function of PEX11 proteins in any given

species remain elusive.

Dynamins and DRPs are large GTPases involved in biological processes such as
endocytosis, intracellular vesicle trafficking, cytokinesis, and organelle division, by self-
assembling into ring-like structures around membranes and mediating their fusion and
fission (Osteryoung and Nunnari, 2003; Koch et al., 2004; Praefcke and McMahon, 2004;
Hoppins et al., 2007). Mutations in the mammalian Drpl (DLPI) and the yeast Dnml or
Vpsl genes lead to fewer and enlarged/elongated peroxisomes that have already
undergone membrane constriction, indicating the function of DRPs in the final fission of
these organelles. Drpl and Dnmlp are also involved in mitochondrial division, whereas
Vpslp has an additional role in vacuole morphogenesis (Yan et al., 2005; Fagarasanu et
al., 2007). Arabidopsis has 16 DRPs, which are divided into six families based on protein
structure and sequence similarity (Hong et al., 2003). DRP3 family includes DRP3A and
DRP3B, two proteins sharing 77% amino acid sequence identity and dual localized to
peroxisomes and mitochondria. Peroxisomal and mitochondrial division deficiencies are
observed in drp3A and drp3B mutants, with the former displaying stronger peroxisome
and plant growth phenotypes than the latter (Mano et al., 2004; Fujimoto et al., 2009;
Zhang and Hu, 2009). Consistent with the notion that dimer formation is central to the
GTPase activity of DRPs (Praefcke and McMahon, 2004), DRP3A and DRP3B homo-

and heterodimerize in yeast two-hybrid assays (Fujimoto et al., 2009). Although the

111

drp3A drp3B double mutants display defects in organelle division and plant growth, the
plants are not severely impaired, implying that other members of the Arabidopsis DRP

superfamily may be at work in peroxisomal fission (Zhang and Hu, 2009).

Yeast and mammalian species each have a single F ISl protein, which is anchored to the
membrane of peroxisomes and the outer membrane of mitochondria by the C terminus,
recruiting cytosolic DRPs to the organelle membranes through interactions via the N-
terminal tetratricopeptide repeat (TPR) domain (Koch et al., 2003; Koch et al., 2005;
Kuravi et al., 2006; Kobayashi et al., 2007; Serasinghe and Yoon, 2008). Arabidopsis has
two FISl homologs, FISlA and F ISIB, which are 58% identical at protein level and both
dual-targeted to peroxisomes and mitochondria. The fisl loss-of-function mutants contain
fewer and enlarged peroxisomes and mitochondria, whereas ectopic expression of FISIA
or FIS] B results in increased numbers of these organelles, reinforcing the rate-liming role
for FISI in organelle fission (Zhang and Hu, 2008; Zhang and Hu, 2009). The C terminus
of Arabidopsis FISlA or FISlB is necessary and sufficient for peroxisomal targeting in
tobacco leaves, in a manner similar to their mammalian ortholog (Zhang and Hu, 2008).
The mammalian F 1S1 self-interacts on the outer membrane of mitochondria, necessitating
its function in mitochondrial fission (Serasinghe and Yoon, 2008). Whether FISlA and
FISlB also form oligomers and are responsible for recruiting DRPs to peroxisomes in

plants have yet to be demonstrated.

Chemical cross-linking and co-immunoprecipitation studies in Chinese hamster ovary
cells (CHO) reported the formation of a ternary heterocomplex consisting of PEX] 113,

Drpl (DLPl), and FlSl on the peroxisomal membrane, suggesting that the functions of

112

these proteins may be coordinated. The same study also found F 181 to interact with
PEX] 10 through the C-terminal region of PEX] 113 (Kobayashi et al., 2007). Likewise,
BiFC experiments in Arabidopsis cultured cells found all five PEX11 proteins to interact
with FISlB (Lingard et al., 2008). However, attempts to show physical interaction
between DLPl and PEX] 10 in mammals and between PEX] Is and DRP3A in
Arabidopsis cell cultures have not been successful (Li and Gould, 2003; Kobayashi et al.,
2007; Lingard et al., 2008). In addition, overexpression of PEXl 113 can no longer induce
peroxisome proliferation in mammalian cells in which the expression of DLPI was
silenced through RNAi (Li and Gould, 2003). These data together suggest that besides
FISl, PEX11 may also work with DRPs for proper function/targeting of DRPs on/to
peroxisomes. Whether plant PEX11, DRP, and F181 proteins also form a complex on

peroxisomal membranes and coordinately regulate peroxisome division is unknown.

To get a complete mechanistic view of how peroxisomes divide in plants and to correlate
dynamics of the abundance of these organelles with plant physiology, we searched for
additional players in peroxisome division. We also began to investigate how the three
classes of proteins, i.e., PEX11, DRP, and HS], interplay at the peroxisome in plants.
Given the further expansion of PEXl l, DRP, and F 1S1 families in Arabidopsis compared
with yeasts and mammals, it is especially important to determine whether specific
interactions occur between individual isoforrns of these families and on specific
organelles. Here we report that Arabidopsis DRP5B, a protein previously shown to be
required for plastid division, plays an additional role in the division of peroxisomes and

contributes to proper peroxisomal functions. We also comprehensively analyzed the

113

interaction between members of the DRP, F181, and PEX11 protein families in

Arabidopsis and provide a more detailed model of peroxisome division in plants.

Results

DRPSB (ARCS) is dual-targeted and controls the division of both peroxisomes and

chloroplasts

To search for new proteins in peroxisome division, we first focused on other members of
the Arabidopsis DRP superfamily. DRPSB, also called ARCS, is the only Arabidopsis
DRP besides DRP3A and DRP3B known to play a direct role in organelle division.
DRPSB forms a discontinuous ring at the division site on chloroplasts, executing the
fission of these organelles (Gao et al., 2003). Interestingly, GFP-DRPSB was also
reported to exist as “cytosolic patches” (Glynn et al., 2008), leading us to speculate that
this protein may target to other organelles such as peroxisomes and exerts its function in

the division of multiple types of organelles.

To investigate whether DRPSB plays a role in peroxisome division, we expressed the
peroxisomal marker protein YFP-PTSI, a fusion of the yellow fluorescent protein and a
C-terrninal Peroxisome Targeting Signal type 1 tripeptide (PTSI, ser-lys-leu), in the
drp5B mutants. The two drp5B null alleles used are drp5B -1 (in Ler), which creates a
stop codon in the middle of DRPSB, and drp5B -2 (SAIL 71D_l 1, in C 01—0), which has a
T-DNA insertion in the 8’h intron (Gao et al., 2003; Miyagishima et al., 2006). We also

analyzed two drp5A mutant alleles, drp5A-l (SALK_065118) and drp5A-2

114

(SALK_062383) that have a T-DNA inserted in the 4th intron and the 7’h exon,
respectively (Miyagishima et al., 2008). DRPSA is the other member of the DRPS family
and shares similar domain structure with DRPSB, but it was recently shown to be

involved in cytokinesis instead of chloroplast division (Miyagishima et al., 2008).

Confocal laser scanning microscopic (CLSM) image analysis of mesophyll cells from T3
drp5B mutants expressing YFP-PTSI confirmed the previously described phenotypes,
i.e., enlarged chloroplasts that do not divide (Gao et al., 2003); additionally, it also
revealed highly aggregated peroxisomes that are each slightly enlarged compared with
those in the wild type plants (Figure 1A). Similar peroxisomal phenotypes were observed
in roots and etiolated seedlings of the drp5B mutants (Suppl. Figure lA-lF). To quantify
the abundance and volume of peroxisomes, we used ImageJ software to measure
peroxisome area and number. In drp5B mutants, peroxisome fluorescence area, which
represents the total volume of peroxisomes, is increased, whereas peroxisome number,
indicated by the number of YFP-labeled organelles (or organelle clusters without clear
boundaries), is reduced (Figure 18). These results together point to defects in peroxisome
fission in the drp5B mutants. In contrast, no abnormalities in peroxisome morphology
was observed in either of the drp5A mutants (Fig.1A; Suppl. Figure 1G), thus excluding

the involvement of DRPSA in peroxisome division.

115

Figure 4.1 DRPSB (ARCS) is involved in the division of both peroxisomes and
chloroplasts.

(A) Peroxisomal and chloroplast morphologies in wild-type and drp5 mutants. Confocal
images were taken from leaf mesophyll cells from four-week-old plants expressing the
YFP-PTSI peroxisome marker protein. Green signals come from YFP, and red signals

are emitted from the chlorophyll. Scale bars = 10 pm.

(B) Quantification of peroxisome number and total YFP fluorescence area per 2500 um2
of mesophyll cells from plants shown in (A). n=8, p<0.05, error bars represent standard

deviations.

(C) Dual targeting of GFP-DRPSB in Col-0 plants co-expressing the 35S:DsRed2-PTSI
and 35S:GFP-DRP5B (or PDRP5B:GFP—DRP5B) transgenes. Images were taken from

mesophyll cells of four-week-old transgenic plants. Magenta signals represent DsRed2-

PTSl. Scale bars = 10 mm.

(D) Immunoblot analysis detecting the GFP-DRPSB and DsRedZ-PTSl proteins from

plants in (C), using polyclonal a-GF P and a-DsRed antibodies, respectively.

116

drp5B-2+DRP5B

 

 

AsEzvmwem 8:88.03:

000000000
7654
..._

'8
'3
-2
"1

El peroxisomenumber
- fluorescencearea

O

 

 

117

Fgme4lmmmmd

C GFP-DRPSB DsRedz-PTS1 Chlorophyll Merged

             

PDRPSB

Iii
75—
25—F. » Err-DsRed

H8

To further confirm that the peroxisome phenotypes in drp5B mutants were caused by the
mutations in DRP5B, we expressed DsRedZ-PTSI in drp5B-2 mutant expressing GFP-
DRP5B fusion gene (driven by the DRP5B native promoter) (Miyagishima et al., 2008).
In addition to rescuing the chloroplast division deficiency, DRP5B also largely
complemented the peroxisome phenotype in drp5B-2, as seen by the re-appearance of
numerous spherical peroxisomes similar to those of the wild type (Figure lA-lB). We
conclude that DRP5B is not only involved in chloroplast division, but clearly plays a role

in the division of peroxisomes as well.

Given that DRP5B had not been demonstrated previously to exert a function in
peroxisome division, we re-checked the subcellular localization of this protein by co-
expressing the peroxisome marker DsRed2-PT SI and GFP-DRP5B fusion gene in wild-
type Arabidopsis. The GFP-DRP5B gene was under the control of the CaMV35S
promoter (P35S:GFP-DRPSB) or the DRP5B native promoter (PDRP5B:GFP—DRP5B).
Plants containing both DsRedZ-PTSI and the GFP-DRP5B transgene were examined
using confocal microscopy. GFP fluorescent signals were detected not only as a
discontinuous ring structure at the chloroplast division sites, but also on peroxisomes
tagged by DsRedZ-PTSI, suggesting that DRP5B targets to both chloroplasts and
peroxisomes (Figure 1C). The punctate structures labeled by GFP-DRP5B were never
found to co-localize with mitochondrial markers (data not shown). Immunoblot analysis
showed that the GFP-DRP5B and DsRed2-PTS1 proteins are indeed expressed in
P3SS:GFP-DRP5B and PDRP5BsGFP-DRP5B lines, with higher GFP-DRPSB
expression detected in the former (Figure 1D). Despite the fact that GFP-DRP5B is

functional in complementing the drp5B mutant phenotypes (this study and Gao et al.,

119

2003), no apparent differences in peroxisome appearance or abundance were found
between P35SsGFP-DRPSB and PDRP5BsGFP-DRP5B lines (Figure 1C). This result is
in line with previous findings that overexpressing DRP3A or DRP3B does not affect
peroxisome size and number (Mano et al., 2004; Zhang and Hu, 2009), suggesting that

DRP proteins by themselves are insufficient to induce organelle division.

The close functional association between plastids and peroxisomes prompted us to check
peroxisome morphology in two chloroplast division mutants, arc3 and arc6 (Vitha et al.,
2003; Glynn et al., 2008), to test out the scenario that the peroxisomal division defect in
drp5B is caused indirectly by the abnormal division of chloroplasts. Chloroplast division
is orchestrated by multiple molecular machineries composed of a number of proteins,
among which ARC3 is localized in the stroma and required for the correct positioning of
the division rings, and ARC6 spans the inner envelope and is responsible for recruiting
DRP5B to the chloroplast surface through the outer-envelope proteins PDVl and PDV2
(Yang et al., 2008; Okazaki et al., 2009). To visualize peroxisomes, YFP-PTSI was
introduced to arc3 and DsRed2-PTS1 was transformed into arc6. Despite having
dramatically enlarged chloroplasts that fail to divide, arc3 and arc6 do not have obvious
changes in peroxisome morphology and number (Suppl. Figure 2A). Given ARC6’s role
in recruiting DRP5B to chloroplasts (Vitha et al., 2003; Glynn et al., 2008), we also
assessed the subcellular targeting of GFP-DRP5B in the arc6 mutant. DsRedZ-PTSI and
GFP-DRP5B were co-expressed in arc6 and progenies containing both transgenes were
examined by confocal microscopy. In arc6, although GFP-DRP5B is not targeted to ring
structures on chloroplasts, its peroxisomal localization is unaffected (Suppl. Figure 2B).

These results largely rule out the possibility that peroxisome division deficiency in drpSB

120

0'.-

mutants is merely a side effect of chloroplast morphology and number changes.
Furthermore, DRP5B is likely the only protein shared by chloroplast and peroxisome

division.

DRP5B contributes to peroxisome functions

To elucidate the impact of DRPSB on plant growth and development, especially on
peroxisome-related processes, we examined its role in photorespiration, a major function
of leaf peroxisomes. Photorespiration is coordinated by chloroplasts, peroxisomes, and
mitochondria. It uptakes O2 and releases CO2 in the light, salvaging and recycling
phosphoglycolate back to the chloroplast. Since this pathway is not required under high
CO2 conditions, photorespiration mutants display much stronger growth phenotypes in
normal air (Kaur et al., 2009). The pexl4 mutant, which contains a T-DNA insertion in
the peroxisome biogenesis factor PEROXIN14 (PEX14), serves as a positive control in
this study (Figure 2) and in many of our previous studies (Fan et al., 2005; Orth et al.,
2007; Zhang and Hu, 2009). After growing in ambient air for 3-4 weeks, drp5B mutants
start to show retarded growth compared with wild-type plants, and this phenotype can be
rescued by growing the mutants in elevated (3000 ppm) CO2. In contrast, wild-type
plants, drp5B mutants expressing GFP-DRP5B, and even other are mutants such as arc3
have similar plant sizes irrespective of the CO2 level in the growth environment (Figure
2A; Suppl. Figure 3). These data demonstrate that DRP5B is involved in

photorespiration, possibly owing to its function in the division of both peroxisomes and

121

Figure 4.2 The role of DRP5B in plant growth.

(A) Comparison of four-week-old plants grown in the air and under 3000 ppm CO2.

(B) Sucrose dependence assay. Hypocotyls of seedlings grown for five days in the dark
on 1/2 MS media with or without the supplement of 1% sucrose (w/v) were measured

(n=60, p<0.05).

(C) Effect of 2,4-DB on primary root elongation. Plants were grown for five days in the

light on 1/2 LS media with or without 0.8 uM 2,4-DB (n=60, p<0.05).

(D) Effect of IBA on primary root elongation. Plants were grown for five days in the light

on 1/2 LS media supplemented by IBA in the indicated concentrations (n=60, p<0.05).

(E) and (F) Expression levels of the DRP5B gene in different tissues (E) and at various
developmental stages (F). The y axis depicts expression values assigned by

GENEVESTIGATOR (https://www.genevestigator.ethz.ch/).

122

A
Ler

drp5B 7 drp5B—2

   

air high 002 air high 002

drp5B-2 + DRPSB

 

 

 

25
20'
15'

    

El withoutS I with S

hypocotyl length (mm)

 

 

$0$
nwithout2,4-DB Iwith 2,4-DB p58

root length (mm)

 

 

p 4 a O 0' 0’
94-74 9;- $58. 0A0 7358. 7’58.
7 2 2.0

So
So

123

 

3568 95:9...
2938 mag 33:3
336 mg 2929

 

 

«9:6 529
cacao
$56qu Hommzm
<ocso 38am
$3.5m
cm§3m$a .4.me

 

 

 

 

mac: 88mm
E<m32m 8mmzm

 

no

no

no

9.

1 M F 0 0 0 0 0 n.

. 4. 9. no Re R._4

5 1W 2 2 2 1 1 1

2 n .

.1 m 8026.

0 m rl 8052325
1 n i 588.32
.5 w I 3.06

7. m l m___ncm

. C l 52023838
5 M l msoonmbmx

. l .I 203

5 .l mmzmmomzzofi
2 I 0956

no

 

 

 

 

Figure 4.2 continued

_ . _ 882m _mm<mm

 

 

 

 

Mo “.0 .4 M2 .0 8 6 4 2 0 0 8239mm;
AEEV 59... “oo. owawaanww. m
I m0¢Q=3©
ii,“ .336

 

E
3500-
3000-
2500'
2000
1500
1000

500

124

chloroplasts, two major participants of the glycolate recycling pathway in
photorespiration. We later determined the effect that DRP5B imparts on fatty acid [3—
oxidation, a primary peroxisome function required for the conversion of triacylglycerol
(TAG) to sucrose to fuel postgerrninative seedling establishment (Kaur et al., 2009).
First, drp5B mutant seeds were germinated in media with or without sucrose. In the
absence of sucrose, hypocotyls of dark-grown drpSB-I and drp5B-2 are shorter than
those of wild-type and the complemented drpSB-Z plants; this phenotype is largely
rescued by application of sucrose to the media (Figure 2B). This data indicates a role of
DRP5B in storage oil mobilization during hypocotyl elongation in germinating seedlings.
Second, we directly examined the role of DRP5B in B—oxidation by measuring the
response of the drp5B mutants to IBA (indole 3-butyric acid) and the synthetic auxin 2,4-
DB (2,4-dichlorophenoxybutyric acid). IBA and 2,4-DB are proto-auxins that can be
metabolized to the bioactive auxins IAA or 2,4-D through peroxisomal B—oxidation.
Mutants impaired in B—oxidation would show resistance to the inhibitory effect of these
compounds on primary root elongation (Hayashi et al., 1998; Zolman et al., 2000). Partial
resistance to both 2,4-DB and IBA were observed in drp5B mutant seedlings, compared
with the wild-type and the rescued drp5B-2 mutant plants (Figure 2C-2D), suggesting

that DRP5B is involved in peroxisomal B—oxidation during seedling establishment.

Overall, the drp5B mutants show relatively weaker phenotypes in fatty acid B—oxidation
than in photorespiration, indicating that DRP5B may play a stronger role in green leaves
than in seedlings. To determine whether this difference correlates with the expression
levels of the DRP5B gene in development, we used the Genevestigator tool with data

collected from Arabidopsis microarray databases (httpsz/lwww.genevestigator.ethz.ch/) to

125

investigate the expression profiles of DRPSB. DRPSB is ubiquitously expressed in all
tissues and throughout development, with high expression levels in green tissues such as
cotyledons and cauline and rosette leaves (Figure 2E). In addition, DRP5B’s expression
starts out at a relatively low level during seed germination, increases significantly as the
plants develop leaves, reaches its peak during bolting, and declines after plants enter the
reproductive phase (Figure 2F). These results support the prominent role for DRP5B in

green tissues, major sites for photorespiration.

BiFC assays reveal interactions between DRP, F181, and PEX11 proteins

Having established a role for DRP5B in peroxisome division, we began to address the
question whether this protein is able to interact with itself and with DRP3A and DRP3B,
as DRP3A and DRP3B had been shown to homo- and heterodimerize in yeast two-hybrid
systems (Fujimoto et al., 2009). In addition, given the reported interaction between FISl,
DRP and PEX11 in mammalian cells (see Introduction), we also wanted to test whether
members of the DRP, F 181, and PEX11 families in Arabidopsis form complexes.
Interaction between proteins involved in early and late stages of peroxisome division may

indicate that these distinct machineries are coordinated in function.

126

Figure 4.3 Interactions involving DRPs and FISl as detected by BiFC

Confocal images were taken from N. tabacum leaf epidermal cells expressing the YN-
and YC-fusions along with the indicated organelle marker. YFP fluorescence (green) is
an indication of BiFC, red signals come from CFP-PTSI, and magenta signals represent
mitochondria stained by Mito-Tracker or chloroplasts that emit autofluorescence. The
merged images show colocalization of YFP and the indicated organelles. Scale bars, 10

pm.

127

 

CF P-PTSl
Mito-Tracker

YFP

 

o> + z> menace: $55-2 mesmoo> + Eamon; +
C <mamo-z> mnemo-z>

A
B

Figure 4.3 continued

   

D

< H m_n_-o> +
mmamo-2>

 

m Fw_u_-o> +
mmamorz>

<FwE-O>+ <nn_morz>

l

m Fw_n_-0>+ <mamorz>

129

Figure 4.3 continued

G

YN-DRP3B + YC-FIS1A

 

Mite-Tracker

YN-DRP3B + YC-FIS1 B

 

l-

Mito-Tracker

130

To test for protein-protein interaction, we first employed bimolecular fluorescence
complementation (BiFC), because this in vivo assay not only determines whether proteins
interact or reside in close proximity, but also detects locations for such interactions. To
this end, N- and C-terminal fragments of YFP (YN and YC) were respectively fused to
the N terminus of each of DRP5B, DRP3A, DRP3B, FISIA, FISIB, and PEX] 1a to -e
genes to generate YN—Gene and YC-Gene filSlOlI constructs. For subsequent evaluation of
protein expression, an HA tag was added to the N terminus of YN and a 6XHis tag was
fused to the N terminus of YC. All fusion genes were driven by the 35S promoter. Each
YN- and YC-fusion pair, along with the peroxisomal maker CFP-PTSI, was transiently
co-expressed in Nicotiana tabacum leaves using Agrobacterium tumefaciens—mediated
transformation. Epidermal cells of the inoculated tissues were analyzed by confocal
microscopy after 48 hours. To ensure that the proteins are expressed, proteins extracted
from the inoculated tissues were also subjected to immunoblot analysis, using a—HA, (1-
His, and a—GFP antibodies to detect the YN-, YC-, and CFP-PTSI fusion proteins,

respectively (Suppl. Figure 4).

131

Figure 4.4 Interaction between DRPs and PEX11 proteins detected by BiF C.

Images were taken from N. tobacum leaf epidermal cells expressing the indicated YN and

YC protein pairs and the CFP-PTSI peroxisomal marker. Scale bars, 10 pm.

132

S
T
9..
P
F
C

O>+Z>

mFFXwaro>+ QSXMQ-O>+ oemeE-O>+
mmmmorz> mmmmorz> mmamorz>

U r meQ-O> + or ern.

 

A; +

mmamorz> mmmmorz>

Figure 4.4 continued

aerMn— 0>+ anXwn—r 0>+ oFern— O>+ UFFXm—m- O>+
(mam—02> <mmmorz> (mun—mo-z> <mmmorz>

 

    

m _. Pom—90> +
(mmmorz>

134

Figure 4.4 continued

 

mwFXmm-0>+ QFFXmmro>+ owFXmmro>+ U3Xm.n...0>+ OFFXmmro>+
mammorz> mammorz> many—02> mmmmo-z> mmmmorz>

135

As shown in Figure 3A, leaf tissues infiltrated with the empty vectors YC and YN
showed no YFP signals, whereas YN-DRPSB and YC-DRP5B, when combined,
conferred YFP fluorescence on CFP-PTSl-tagged peroxisomes as wells as chloroplasts
that are marked by chlorophyll autofluorescence (Figure 3B). In addition, DRP5B
interacts with DRP3A and DRP3B on peroxisomes (Figure 3C). These data together
suggest that, similar to DRP3A and DRP3B, DRP5B is also able to interact with itself. In

addition, DRP5B heterodimerizes with DRP3A and DRP3B.

In mammals, the DRP protein Drpl is recruited to the peroxisome and mitochondrion by
the membrane-anchored protein F 181 (Koch et al., 2003; Koch et al., 2005; Kuravi et al.,
2006; Kobayashi et al., 2007; Serasinghe and Yoon, 2008). Hence, it would be crucial to
determine whether this is the case in plants for DRP and FISl homologs. If so, it would
also be interesting to see whether there is any specific interaction between individual
DRP and FISI isoforrns on peroxisomes and mitochondria, given that more DRPs and
FISl are involved in Arabidopsis compared with animals. To this end, we closely
examined the interaction between the FISlA/1B and DRP5B/3A/3B proteins. When
DRP3A and DRP3B are involved, we also stained the tissue with Mito-Tracker to
visualize mitochondria, besides using CFP-PTSI for peroxisome labeling. Interestingly,
DRP5B, DRP3A, and DRP3B show distinct patterns of interaction with respect to the
FISl partner they are associated and the location of the interactions (Figure 3D-3H;
Suppl. Figure 5A). DRP5B interacts with FISlA, but not FISlB, on peroxisomes (Figure
3D; Suppl. Fig. 5A). As for DRP3A, its interaction with FISlA was detected on Mito-
Tracker-stained mitochondria but not on CFP-PTSl-labeled peroxisomes (Figure 3E);

however its interaction with FISlB was only seen on peroxisomes (Figure 3F). DRP3B,

136

on the other hand, interacts with both FISIA and FISIB exclusively on peroxisomes
(Figure 3G); no interaction was detected on mitochondria with either FISlA or FISlB
(Figure 3H). Lastly, we investigated interactions among FISI proteins, as
homodimerization was found to occur for the mammalian FlSl ortholog (Serasinghe and
Yoon, 2008). FISIA and FISlB each form homodimers on peroxisomes and
mitochondria, but they do not seem to heterodimerize on either type of organelles (Suppl.

Figure 5B-5C).

Lingard et al (2008) used BiFC to show in Arabidopsis cell cultures that all five
Arabidopsis PEX11 proteins form homo- and heterodimers, and that they each interact
with FISlB but not FISIA or DRP3A. In our BiFC system, we were able to reproduce the
positive interaction results by Lingard et al (2008), and in addition to show association
between FISlA and PEXI 1a, PEX11b, PEX11d, and PEX11e (Suppl. Figure 6). When
testing interaction between DRP and PEXl ls, we detected peroxisome-localized
association between DRP5B and each of the five PEX11 isoforms, between DRP3A and
PEX] 1a, PEX11b, PEX11d, and PEX] 1e, and between DPR3B and PEX1la, PEXl lb,
PEX11c, and PEX11e (Figure 4). These data collectively suggest that members of the
PEX11 family interact with DRP5B, DRP3A, DRP3B, and FISlA/1B in vivo in

Arabidopsis.

Co-Immunoprecipitation assays suggest the formation of complex by DRP, F181,

and PEX11 proteins

137

To support the data obtained by BiFC, we used co-immunoprecipitation as an
independent approach to test for protein-protein interaction. We constructed 35S-driven
gene fusions, in which HA and FLAG tags were cloned respectively to the N terminus of
the inquest proteins, and introduced the construct pairs into N. benthamiana leaves via
Agrobacterium infiltration. Proteins from the infiltrated leaves expressing each of the
HA- and FLAG-tagged protein pairs were first subjected to immunoblot analysis to
ensure that the fusion proteins are expressed (Figure 5A). Subsequently, total protein
extracts were incubated with agarose beads conjugated with a-HA, and proteins pulled
down by a-HA were subjected to immunodetection using a-FLAG and a-HA antibodies.
Detection of the two HA- and FLAG-fusion proteins in the same co-immunoprecipitation
would suggest that the two proteins are in the same complex. Because of the large
number of protein pairs involved, we only tested interactions in which the three DRP

proteins are involved.

The Co-IP results largely corroborate with those obtained by BiFC; an additional
interaction between PEXl 1d and DRP3B was also detected (Figure 5B). However, in
contrast to the positive BiFC data between PEXIIa and DRP5B/DRP3A/DRP3B and
between PEXI 1c and DRP3B (Figure 4), PEXI 1a was not co-immunoprecipitated with
any of the three DRP proteins and PEXl 1c was not pulled down by DRP3B (Figure 5B),
suggesting that follow-up studies are needed to authenticate the protein-protein
interactions involving PEX11a and between DRP3B and PEXl 10. In summary, the co-IP
results reinforce the notion that members of the DRP, HS], and PEX11 families interact

(summarized in Table I) and potentially form complexes in vivo.

138

 

Figure 4.5 Co-IP assays to test the interactions involving DRP, FISl, and PEX11
proteins.

(A) Immunoblot analysis of proteins extracted from tobacco leaves expressing the
indicated HA- and FLAG-fusion proteins.

(B) Immunoblot analysis of proteins bound to anti-HA beads.

Sizes of the molecular markers (in kD) are indicated to the left of the gels. Different gels

are separated by lines.

139

indui

LAG

- a—FLAG a

-O

 

BSdHCl'SV'lzl + aLLXEld'VH
VSdtlel‘S-DV'H + 9 L LXBd'VH
SSdHCl'SV'H + aLLXBd'VH

9LLX3d'VH
SSdHO'OWd + pLLXSd'VH
VSdHG'OV'Izl + PLLXSd'VH
QSdHCl'OV'H + P L LXHd'VH

PLLXEd'VH
BSdBCl'SV'Izl + oLLXEld'\7’H
VEdHO'SV'H + OLLXSd'VH
SQdUCI'C-JV'H + 9 L LXEd'VH

oLLXEd'VH
BSdHG'OV'Izl + q LLXEld‘VH
VSdHG'SV'H + q L LXBd'VH
SQdHG'SV'Id + q L LXEd‘VH

QLLXEld'VH
BSdHCl'SV'H + 9 L LXEd'VH
VEdHG'SWd + eLLXEd'VH
BQdHO'SWd + 9 L LXBd'VH

BLLXEd'VH

“Hm HHH'

HHH

"‘ “Na-F

H _... _ .1 a-HA

l

——d—c—a -Hi—u- _a -H HH—

25—

-~. u-.-

. - 5.14:3

75—

me

i .n a-HA

it.

 

ll
N
Is

25-'

 

QEdHCl'OV'Izl + 8 LSl:l'VH
V8dthl'9V‘lzl + 8 LSId'VH
GSdHG‘SV'Izl + 8 LSlzi'VH

8 LSH'VH
BSdHG‘E-JV‘H +VLSl:l'VH
VSdHG'SV'Izl +VLSl:l‘VH

GQdHO‘SV'ld + V LSlzl'VH
VLSH'VH

”'7” 75— “H“

“~—

75—

.. —-H

 

m = r

75—-

 

BSdHG'SV'Izl + QQdHO'VH
VSdUCI‘OV'H + QQdHO'VH
GQdHCI'SVTA + QQdHCl'VH

ESdHCl'VH

<

 

_.——o

75—

 

75—

 

i
_~

 

 

LN.
75

I i 257- "'" u..-

hug'

75—1

 

 

140

 

 

Discussion
DRPSB plays a dual role in organelle division

DRP5B was originally identified for its function in chloroplast division (Gao et al.,
2003). Here we provide several lines of evidence to demonstrate that this protein has an
additional role in the division of peroxisomes and is involved in maintaining proper
peroxisomal activities. First, GFP-DRP5B targets not only to chloroplast division rings
but also to spherical structures labeled by the CFP-PTSI peroxisomal marker protein.
Second, besides the previously reported phenotypes such as enlarged and dumbbell-
shaped chloroplasts, drpSB mutants also exhibit highly aggregated and/or enlarged
peroxisomes that fail to divide completely. Third, peroxisomal functions such as
photorespiration and fatty acid B—oxidation are compromised in the drp5B mutants.
Lastly, deficiencies in peroxisomal morphology and function in the drp5B mutants can be
rescued by expression of the wild-type DRP5B protein. In summary, DRP5B has joined
DRP3A and DRP3B as plant DRPs involved in peroxisome division. The list of DRPs
associated with peroxisome division may not be complete, as there are over a dozen
Arabidopsis DRPs, most of which have not been characterized with respect to their

relevance to peroxisomes (Hong et al., 2003).

The discovery that DRPSB also participates in peroxisome fission is somewhat
unexpected. DRP3A and DRP3B are highly identical in sequence and both contain the
GTPase, middle, and GTPase effector domains (Hong et al., 2003). As a result, these two

proteins are interchangeable in mitochondrial division and partially redundant in the

141

division of peroxisomes (Fujimoto et al., 2009; Zhang and Hu, 2009). However, DRP5B
shares little sequence similarity with DRP3s and contains an additional pleckstrin
homology (PH) domain, which is believed to be capable of binding to membrane
phospholipids (Hong et al., 2003). DRP5B and DRP3A/3B also differ in their peroxisome
localization patterns. When fused to YFP or GFP, DRP3A and DRP3B were shown to be
in juxtaposition to peroxisomes (Mano et al., 2004; Fujimoto et al., 2009; Zhang and Hu,
2009), whereas P3SS:GFP-DRP5B or PDRPSBzGFP-DRPSB is evenly distributed along
peroxisomes (Figure 1C). Finally, the “head and tail” peroxisome phenotype, which is
frequently observed in drp3A mutants, was not shown in drpSB mutants. These data
collectively point toward the possibility that the role for DRP5B in peroxisome division
is to some extent distinct from that of DRP3A and DRP3B. To test this hypothesis, it will
be crucial to determine in the future whether DRP5B can substitute the function of DRP3

in peroxisome division.

In addition to DRP3A, DRP3B, and DRP5B, another example of a single DRP
participating in diverse functions comes from the Arabidopsis DRPl family. The DRPI
family is generally believed to be involved in cytokinesis and cell expansion (Konopka
and Bednarek, 2008), however, DRPlC and DRPlE were also reported to act in
mitochondrial morphogenesis (Jin et al., 2003). In non-plant systems, the yeast Vpslp
and Dnmlp and the mammalian DLPl (Drpl) proteins are DRPs involved in the
division/vesiculation of more than one type of organelle (Wilsbach and Payne, 1993;
Hoepfner et al., 2001; Koch et al., 2003; Li and Gould, 2003; Koch et al., 2004; Kuravi et
al., 2006; Schrader, 2006). These results together suggest that a given DRP, which

normally lacks intrinsic organelle targeting signals, can be recruited to different types of

142

 

subcellular structures to facilitate with membrane fission. However, recruitment of DRPs
seems to have some specificities. For example, DRP3A, DRP3B, and DRP5B do not
participate in the fission of membrane structures other than peroxisomes, mitochondria,
and chloroplasts, whereas DRPSA, despite being structurally similar to DRP5B, functions
in cytokinesis instead of chloroplast division (Miyagishima et al., 2008; Fujimoto et al.,

2009; Zhang and Hu, 2009).

Photorespiration, fatty acid metabolism, and jasmonic acid biosynthesis are among some
of the metabolic pathways coordinated by peroxisomes and other organelles, including
chloroplasts and mitochondria (Kaur et al., 2009). The efficiency of these metabolic
processes is dependent on the intimate physical association and functional cooperation
between the organelles involved. In Arabidopsis, DRP3 and its putative anchor, FISl, are
shared by the division machineries of peroxisomes and mitochondria, and DRP5B is
shared by peroxisomes and chloroplasts. The use of shared fission components could be a
mechanism to render coordinated division among the metabolically linked subcellular
compartments. It will be interesting to determine whether such coordinated division truly
takes places in plants, and if so, whether there are biological significances for this

phenomenon.

Distinct interactions between members of the DRP, FISl, and PEX11 families on

different organelles

143

Table 4.1 Summary of interactions among members of the Arabidopsis DRP,
FISl, and PEX11 protein families

 

 

 

Q)
2>77+++++++
f5+++ ******
a.
'U
=77>+++++++
fi++' **-x--x--x--x-
G.
3v ><
~ >< .++++++
fil— + *«x-x-ar-x-x-
O:
.D
27>7+++++++
fi+++ ******
9..
3xx
§++++++++++
m arrears-*9:-
O...
m 77
et++'+:::::
LL
<
EZZ:+-++u++
LT.
m
M>++++n +.+
22+«x-ar-
G
<7
§+++++++.++
*4-
D
59>
g++++n+++++
Q
“.0 “U
mfg ><
none-WEEEEE

"‘ indicate known interactions, which also serve as positive controls in this study. + or -
denote interactions or lack of interactions detected by BiFC in this study. ‘1 or x indicate

interactions or lack of interactions detected by co-IP in this study.

144

In this study, we have provided a more detailed map of how DRP5B, DRP3A, and
DRP3B may be recruited to peroxisomes. Multiple factors, such as protein expression
levels, rates of protein folding, and protein stability, may contribute to variations in the
detection of protein-protein interaction by BiF C, leading to false positive/negative results
(Lalonde et al., 2008). To this end, we also used co-IP as an independent method to test
for protein-protein interaction. Results from these two approaches confirmed the
interaction among members of the DRP, FISl, and PEX11 families in planta. Our data
are consistent with the current knowledge about the interplay between these proteins in
mammalian cells, where the DRP proteins homo-oligomerize, FISl helps to recruit DRP
proteins, and DRP, F181, and PEX11 may form a ternary complex (Thorns and Erdmann,
2005; Yan et al., 2005; Delille et al., 2009). More importantly, we have been able to show
specific interaction patterns for the plant DRP, F181, and PEX11 isoforms (depicted in
Figure 6). For example, DRP5B interacts with FISIA, but not FISlB, on peroxisomes
(this study), whereas its recruitment to chloroplasts is obviously dependent on a group of
chloroplast envelope proteins, i.e., ARC6, PDVl and PDV2 (Gao et al., 2003;
Miyagishima et al., 2006; Glynn et al., 2008). DRP3A interacts with FI—SlA on
mitochondria, yet its interaction with FISlB only occurs on the peroxisome. Furthermore,
DRP3B is associated with both FISlA and FISIB exclusively on peroxisomes. Finally,
although BiFC and co-IP showed discrepant results regarding the interaction between
PEXl 1a/PEX11d and DRPs, both methods demonstrated the interaction between
majority of the Arabidopsis PEX11 proteins with DRP5B, DRP3A, and DRP3B, and the
protein. Given that no interaction between F ISlB and DRP3A/DRP3B is detected on lack

of interaction between PEX] 1c and DRP3A (Figure 4 & 5). The diversification of the

145

 

Figure 4.6 A hypothetical model for the targeting of DRP5B, DRP3A, and
DRP3B to peroxisome and mitochondria in Arabidopsis.

DRP5B is recruited to peroxisomes by FISIA. The targeting of DRP3A to the
peroxisome requires F ISl B, yet its localization to mitochondria seems to be dependent on
FISlA and ELMl. DRP3B may be recruited to peroxisomes by either FISlA or FISIB,
whereas its targeting to mitochondria may rely on the function of ELMI and an unknown
mitochondria, FISlB (together with ELMl) may be responsible for recruiting other DRPs
on mitochondria. On the peroxisome, DRP5B, DRP3A and DRP3B each interact with at
least four of the five PEX11 proteins; the significance of this interaction is yet to be
determined. PEX11 proteins followed by a “?” indicate that the interaction between this
PEX11 and the corresponding DRP protein was supported by BiFC or co-IP but not both

methods.

146

   
   
   
    

PEX1la,b,c,d(?),e

PEX11a,b,d,e

Peroxisome

Mitochondrion

147

DRP, HS], and PEX11 families in plants may have led to the specific recruitment of the
DRP proteins by distinct anchor proteins on the various types of organelles (Figure 6).
The lack of detectable interaction between F ISIB and any of the three DRP proteins and
between DRP3B and FISlA/FISIB on mitochondria is intriguing. These data suggest that
FISlB may be responsible for recruiting DRPs other than DRP5B/3A/3B to mitochondria
and that other mitochondrial membrane proteins may act as anchors for DRP3B (Figure
6). One candidate for such mitochondrial anchors is ELMl (Elongated Mitochondrial), a
plant-specific protein that exclusively targets to the outer membrane of mitochondria,
interacts with both DRP3A and DRP3B, and is required for the mitochondrial targeting of
(at least) DRP3A (Arimura et al., 2008). It is also possible that FISl and ELMl are part
of the same mitochondrial membrane complex responsible for recruiting DRP proteins
(Figure 6). In this case, in vivo interaction between FISl and ELMI need to be shown. In
addition, yeast mitochondrial and peroxisomal divisions both require Mdvlp (or Caf4p),
a cytosolic linker that interacts with both DRP and FlSl proteins on these organelles
(reviewed in Delille et al., 2009). Although the orthologs for Mdvlp/Caf4p were not
identified in mammals, we cannot rule out the possibility that they exist in plants and

carry out similar functions.

Transgenic Arabidopsis plants, cultured Arabidopsis cells, or tobacco epidermal cells
overexpressing individual FISl or PEX11 isoforrns exhibit marked increases in
peroxisome numbers or dramatic elongation of the organelles (Lingard and Trelease,
2006; Orth et al., 2007; Zhang and Hu, 2008; Zhang and Hu, 2009). However, in our
BiFC assays, YFP complementation mostly takes places on peroxisomes that are not

elongated and in cells where dramatic increases in peroxisome abundance are not

148

observed. These results indicate that interaction between DRP, F181, and PEX11 proteins
may take place before peroxisome division is initiated. The biological consequences of
the interaction between PEX11 and FISl/DRP, two groups of proteins responsible for

different steps of peroxisome division, also remain to be determined.

Materianls and Methods

Plant materials, growth conditions, and transformation

Arabidopsis plants were germinated under 16-h light (60 uE rn_2 sec")/8-h dark
conditions on 0.6% (w/v) agar plates with '/2 MS supplemented with 1% (w/v) sucrose.
After two weeks, seedlings were transplanted onto soil and grown under a photosynthetic

photon flux density of 70—80 umol m—2 sec_1 at 21°C with a 14-h light/ 10-h dark period.

CFP-PTSI, YFP-PTSI (Fan et al., 2005; Orth et al., 2007; Zhang and Hu, 2008; 2009)
and DsRed2-PTS1 were used as markers to visualize peroxisomes. To determine
subcellular localization of DRP5B, Arabidopsis plants expressing the GFP-DRP5B
transgene (driven by CaMV35S or the DRP5B native promoter) were transformed with
DsRedZ-PTSI. To visualize peroxisomes in various mutant background, YFP-PTSI or
DsRedZ-PTSI was expressed in drpSB-I, drp5B-2 (SAIL 7ID_11), drp5A-1
(SALK_065118), drp5A-2 (SALK_062383), arc3 and arc6. The Agrobacterium
tumefaciens strain C58Cl was used for all plant transformations, and selection of

transgenic plants was performed as described previously (Zhang and Hu, 2009).

149

 

Confocal laser scanning microscopy and image analysis

For co-localization and mutant analyses, rosette leaves of four-week old Arabidopsis
plants were analyzed by using a confocal laser scanning microscope (Zeiss Meta 510,
http://www.zeiss.com/) to capture images of fluorescent proteins. Confocal microscopic
observation was performed as previously described (Zhang and Hu, 2009). We used 458-
nm, 488-nm, 514-nm, 543-nm, and 633-nm lasers for excitation of CFP, GFP, YFP,
DsRed and chlorophyll, respectively. For emission, we used 465-510 nm band pass
(CFP), 505-530 band pass (GFP), 520-555 band pass (YFP), DsRed2 (560-615) and 650
nm long pass (chlorophyll) filters. All images were obtained from optical sections of 6
pm in depth. Image] (http://rsb.info.nih.gov/ij/) was used to measure the fluorescence
area and count peroxisome numbers in confocal images (50 um X 50 um) and statistical

analysis was done as described previously (Zhang and Hu, 2009).

Sugar-dependence and 2,4-DB/IBA response assays

For sugar dependence analysis, seeds were placed on ‘/2 MS agar plates supplemented
with or without 1% (w/v) sucrose, stratified at 4°C for two days in the dark, and exposed
to 24 hours of light to induce germination before being placed in dark conditions. After 5
days of seedling growth in the dark, hypocotyl length was measured using Image]. To
study the response to 2,4-DB and IBA, 2,4-DB (0.8 pM) or IBA (final concentration 0,
2.5, 5, 7.5, 10, 12.5, 15, 20, 30 11M) was added to 1/2 LS agar media supplemented with
0.5% sucrose. After 2 days of stratification, seeds were kept under low-intensity light for

5 days. Hypocotyls (for sugar dependence assay) and roots (for IBA and 2,4-DB

150

response) were scanned using an EPSON scanner and measured using Image]

(http://rsb.info.nih.gov/ij/). For all statistic analyses, n=60, p<0.05.

Immunoblot analysis

Total protein was extracted from leaf discs of 4-week-old Arabidopsis plants or tobacco
leaves. Homogenized leaf tissue was kept in IXSDS-polyacrylamide gel electrophoresis
(PAGE) sample buffer, boiled for 5 min, and centrifuged for 5 min. The supernatant was
run on SDS-PAGE gels and transferred to Immobilon-P membrane for blotting (Millipore
Corp., Bedford, MA). Primary antibodies used to detect proteins include: a rabbit
polyclonal GFP antibody for CFP and GFP (Santa Cruz Biotechnology, Inc.), a mouse
monoclonal His antibody for the 6XHis tag (Millipore Antibodies, www.millipore.com),
a rabbit monoclonal HA antibody for HA tag (Cell Signaling Technology, Inc.,
www.cellsignal.com), and a rabbit monoclonal FLAG antibody for FLAG tag (Cell
Signaling). The secondary antibody used was goat anti-rabbit IgG (tr-GFP, a-HA, a-
FLAG) or goat anti-mouse IgG (or-His) from LI-COR Biosciences

(http://www.1icor.com).

BiFC assays

The full-length coding sequence of DRP5B, DRP3A, DRP3B, PEX1 la, PEX1 lb,
PEX1 1c, PEX1 1d, PEX1 1e, FISlA or FISlB was cloned into binary vectors to generate
YN—protein (N-terrninal fragment of YFP fused to the N terminus of each protein) and

YC-protein (C-terrninal fragment of YFP fused to the N terminus of each protein), as

151

described previously (Bracha-Drori et al., 2004). A HA tag was added to the N terminus
of YN-protein, and a 6XHis tag was added to the N terminus of YC-protein. The HA
epitope sequence used in this study is YPYDVPDYA; the 6XHis sequence is KKKKKK.
Mixtures of Agrobacteria (strain C58C1) containing each protein pair along with the
peroxisomal marker CFP-PTSI were co-infiltrated into leaves of four-week-old
Nicotiana tabacum (cv. Petit Havana) plants grown at 25°C (Goodin et al., 2002),
resulting in co-expression of these proteins in the same infiltrated area. Imaging analysis
of epidermal cells in the infiltrated area was performed by confocal laser scanning
microscopy as described above. Immunoblot analysis was also conducted on the

infiltrated tissue to confirm co-expression of the proteins.

Co-Immunoprecipitation

The full-length coding sequence of the tested proteins was cloned into binary vectors to
generate HA-protein (HA fused to the N terminus of each protein) and FLAG-protein
(FLAG fused to the N terminus of each protein). The FLAG epitope sequence used is
DYKDDDDK, and the HA epitope is YPYDVPDYA. Agrobacteria containing each HA
and FLAG protein pair were co-infiltrated in leaves of four-week-old Nicotiana tabacum
(cv. Petit Havana) plants grown at 25°C (Goodin et al., 2002). After 48 hours, leaf discs
were collected and homogenized in lysis buffer (Nomura et al., 2006). The samples were
then centrifuged at 20,000Xg for 15 min at 4°C to remove insoluble debris. The
supernatant was incubated with anti-HA agarose beads (Sigma-Aldrich) overnight at 4°C,
and the mixture was centrifuged at 500 Xg for 1 min to collect agarose beads, which were
then washed three times with lysis buffer and resuspended in lXSDS-PAGE sample

152

 

buffer for immunoblot analysis. Proteins were separated on SDS-PAGE gels and
transferred to Immobilon-P membrane, followed by immunodetection by a-F LAG and (1-

HA antibodies.

Accession numbers

Sequence data from this article can be found in the GenBank/EMBL databases under the
following accession numbers: PEX1 la (Atlg47750), PEX11b (At3g47430), PEX1 1c
(Atlg01820), PEX1 1d (At2g45740), PEX1 1e (At3g61070), FISIA (At3g57090), FISlB

(At5g12390), DRP3A (At4g33650), DRP3B (At2gl4120), and DRP5B (At3gl9720).

Acknowledgments

We would like to thank Dr. Katherine Osteryoung and her lab members Dr. Deena
Kadirjan-Kalbach and Jonathan Glynn for providing seeds of drp5B (arc5), drp5A, arc3,
and arc6 mutants and the GFP-DRP5B lines. This work was supported by the National
Science Foundation (MCB 0618335) and by the Chemical Sciences, Geosciences and
Biosciences Division, Office of Basic Energy Sciences, Office of Science, US.

Department of Energy (DE-FG02-91ER20021) to J .H.

153

  

.LEerBdrp5B-1drp58-2

Supplemental Figure 4.7 Additional images showing peroxisomal phenotypes in
drp5B and drp5A mutants.

 

Confocal micrographs were taken from root (A—C) and mesophyll (G) cells of four-week-

old plants or from cotyledon cells of 3d dark-grown seedlings (D-F).

154

 

A
arC3(Ler) arcmcom)
B
arc6
GFP-DRPsB DsRed2-PTS1 Chlorophyll -———«merged

Supplemental Figure 4.8 Confocal images from Arabidopsis leaf mesophyll cells
of wild-type and mutant plants

 

   

Mutants expressing YFP-PTSI(A) or the indicated fluorescent proteins (B). Scale bars =

10 pm.

155

air C02 air CO2

 

 

Ler
drp5B-1

3 weeks

   

3 weeks

 

 

 

arc3

 

Supplemental Figure 4.9 Growth phenotypes of plants in ambient air or elevated
C02.

156

 

-GFP (CFP-PTS1)

2* a-HA
'- o-His

>0rm_I + >Zr<I

25kD-~°‘

.6
H
m

momma->055 + mmnHmD.>Zr<I m
mmamor>0rmf +<mmmor>zr<I H mmamor>0-m_I +<mamor>zr<I EM.

mmamor>ormf + mmamor>zr<I H

75 kD-

 

3 Que-55.: + magma->2-..
2 536.2: + magma->2- <
figs->05... + mango->2- <1
age->05... + Sumo->24: H . .
figs->05... + Sumo->24... H .
m 5.455.: + Same->24... H.
Ema-5-4.: + magma->24:

I.

eHHan..>o-e.... 28%->24: H.

368-55.: ESE->24: H...
H-
I.

I I
“a“ a-HA

o H. wxmar>ormHI + (mama->23...

a F waar>ormf + <ma¢0->2-<I

m w Cam->055 + <m¢10->Z-<I
m Hw_uHr>Orw_I + <mnHmor>Zr<I
< H. w_u_.>0-m_I + (mama->22}.

H
u
H.
figs->05... + Sumo->24: H.
2 545-4.... + momma->24... E
e H 545...: + menace/2-..... H.
£545-21 + Sumo->24... u
etxms.>o-e_z + Snag->23. H
m. 5.45-4.1 + Same->24: n
Ema->92: + Sumo->24: H
Same->05... + game->24: E

mmamor>0rfl1 + mmamor>zr<I Hr.

""-"""1t"1 a-GFP

25 kD- -----r-=HHH H;- .. H _,

a a

w a

s w

.61“.- ®

m m

r e

f w

d S

m a

C

a m

s m.

x

e m

S

n .w

.1 t

m a

m ..m

P .m

f

o m

S t

.w cm

.n1a w 7

n d 5

a m 1

t M

m w

.w o

n .m

u

m a

m w

I .w

0 t s

1. m .w

4 . t. M
S

m v. m m

We m an n

.1 S d a

F. a w W

.l... C :1

mm a a

n .1 U c

e B x D.

m e S
r. e
0 S .1

b1» f .m e

mm m .h-

u S m y

S u P b

Supplemental Figure 4.1 1 BiFC assays testing the protein-protein interaction

The protein-protein interaction involving DRP5B and F181 proteins (A), and homo- (B)

and heterodimerization (C) of FISl proteins.

Confocal images were obtained from tobacco leaves co-expressing the indicated gene

fusions. Scale bars, 10 um.

158

A

YN—FIS1A+

YN-FIS1B+

YC—FIS1A

YC-FIS1 B

 

YFP CFP- PTS1 Merged

      
 

   
 
 

 

.

 

159

Supplemental Figure 4.11 continued

C YFP CFP-PTS1 Merged

 

YN-FIS1A+
YC-FIS1B

YN-FIS1 B +
YC-FIS1A

 

 

160

References

Arimura, S., Fujimoto, M., Doniwa, Y., Kadoya, N., Nakazono, M., Sakamoto, W., and
Tsutsumi, N. (2008). Arabidopsis ELONGATED MITOCHONDRIAI is required
for localization of DYNAMIN-RELATED PROTEIN3A to mitochondrial fission
sites. Plant Cell 20, 1555-1566.

Bracha-Drori, K., Shichrur, K., Katz, A., Oliva, M., Angelovici, R., Yalovsky, S., and
Ohad, N. (2004). Detection of protein-protein interactions in plants using
bimolecular fluorescence complementation. Plant J 40, 419-427.

Delille, H.K., Alves, R., and Schrader, M. (2009). Biogenesis of peroxisomes and
mitochondria: linked by division. Histochem Cell Biol 131, 441-446.

Desai, M., and Hu, J. (2008). Light induces peroxisome proliferation in Arabidopsis
seedlings through the photoreceptor phytochrome A, the transcription factor HY5
HOMOLOG, and the peroxisomal protein PEROXIN] 1b. Plant Physiol 146,
1117-1127.

Fagarasanu, A., Fagarasanu, M., and Rachubinski, RA. (2007). Maintaining peroxisome
populations: a story of division and inheritance. Annu Rev Cell Dev Biol 23, 321-
344.

Fan, J., Quan, S., Orth, T., Awai, C., Chory, J., and Hu, J. (2005). The Arabidopsis
PEX12 gene is required for peroxisome biogenesis and is essential for
development. Plant physiology 139, 231-239.

Fujimoto, M., Arimura, S., Mano, S., Kondo, M., Saito, C., Ueda, T., Nakazono, M.,
Nakano, A., Nishimura, M., and Tsutsumi, N. (2009). Arabidopsis dynamin-
related proteins DRP3A and DRP3B are functionally redundant in mitochondrial
fission, but have distinct roles in peroxisomal fission. Plant J 58, 388-400.

Gabaldon, T., Snel, B., van Zimmeren, F., Hemrika, W., Tabak, H., and Huynen, M.A.
(2006). Origin and evolution of the peroxisomal proteome. Biology Direct 1, 8.

Gao, H., Kadirjan-Kalbach, D., Froehlich, J .E., and Osteryoung, K.W. (2003b). ARCS, a
cytosolic dynamin-like protein from plants, is part of the chloroplast division
machinery. Proc Natl Acad Sci USA 100, 4328-4333.

161

Glynn, J.M., Froehlich, J.E., and Osteryoung, K.W. (2008). Arabidopsis ARC6
coordinates the division machineries of the inner and outer chloroplast
membranes through interaction with PDV2 in the intermembrane space. Plant
Cell 20, 2460-2470.

Goodin, M.M., Dietzgen, R.G., Schichnes, D., Ruzin, S., and Jackson, AD. (2002). pGD
vectors: versatile tools for the expression of green and red fluorescent protein
fusions in agroinfiltrated plant leaves. Plant J 31, 375-383.

Hayashi, M., Toriyama, K., Kondo, M., and Nishimura, M. (1998). 2,4-
Dichlorophenoxybutyric acid-resistant mutants of Arabidopsis have defects in
glyoxysomal fatty acid beta-oxidation. Plant Cell 10, 183-195.

Hoepfner, D., van den Berg, M., Philippsen, P., Tabak, HR, and Hettema, EH. (2001).
A role for Vpslp, actin, and the My02p motor in peroxisome abundance and
inheritance in Saccharomyces cerevisiae. J Cell Biol 155, 979-990.

Hoepfner, D., Schildknegt, D., Braakman, I., Philippsen, P., and Tabak, HF. (2005).
Contribution of the endoplasmic reticulum to peroxisome formation. Cell 122, 85-
95.

Hong, Z., Bednarek, S.Y., Blumwald, E., Hwang, I., Jurgens, (3., Menzel, D.,
Osteryoung, K.W., Raikhel, N.V., Shinozaki, K., Tsutsumi, N., and Verma, DP.
(2003). A unified nomenclature for Arabidopsis dynamin-related large GTPases
based on homology and possible functions. Plant Mol Biol 53, 261-265.

Hoppins, S., Lackner, L., and Nunnari, J. (2007). The machines that divide and fuse
mitochondria. Annu Rev Biochem 76, 751-780.

Jin, J.B., Bae, H., Kim, S.J., Jin, Y.H., Goh, C.H., Kim, D.H., Lee, Y.J., Tse, Y.C., Jiang,
L., and Hwang, I. (2003). The Arabidopsis dynamin-like proteins ADLlC and
ADLlE play a critical role in mitochondrial morphogenesis. Plant Cell 15, 2357-
2369.

Kaur, N., and Hu, J. (2009). Dynamics of peroxisome abundance: a tale of division and
proliferation. Curr Opin Plant Biol 12.

Kaur, N., Reumann, S., and Hu, J. (2009). Peroxisome biogenesis and function. In The
Arabidopsis Book., C.R. Somerville and EM. Meyerowitz, eds. American
Society of Plant Biologists.

162

 

Kobayashi, S., Tanaka, A., and Fujiki, Y. (2007). F isl, DLPl, and Pexl 1p coordinately
regulate peroxisome morphogenesis. Exp Cell Res 313, 1675-1686.

Koch, A., Schneider, 0., Luers, G.H., and Schrader, M. (2004). Peroxisome elongation
and constriction but not fission can occur independently of dynamin-like protein
1. J Cell Sci 117, 3995-4006.

Koch, A., Yoon, Y., Bonekamp, N.A., McNiven, M.A., and Schrader, M. (2005). A role
for F isl in both mitochondrial and peroxisomal fission in mammalian cells. Mol
Biol Cell 16, 5077-5086.

Koch, A., Thiemann, M., Grabenbauer, M., Yoon, Y., McNiven, M.A., and Schrader, M.
(2003). Dynamin-like protein 1 is involved in peroxisomal fission. J Biol Chem
278, 8597-8605.

Konopka, C.A., and Bednarek, S.Y. (2008). Comparison of the dynamics and functional
redundancy of the Arabidopsis dynamin-related isoforms DRPlA and DRPlC
during plant development. Plant Physiology 147, 1590-1602.

Kuravi, K., Nagotu, S., Krikken, A.M., Sjollema, K., Deckers, M., Erdmann, R.,
Veenhuis, M., and van der Klei, U. (2006). Dynamin-related proteins Vpsl p and

Dnmlp control peroxisome abundance in Saccharomyces cerevisiae. J Cell Sci
119, 3994-4001.

Lalonde, S., Ehrhardt, D.W., Loque, D., Chen, J., Rhee, S.Y., and Frommer, W.B.
(2008). Molecular and cellular approaches for the detection of protein-protein
interactions: latest techniques and current limitations. Plant J 53, 610-635.

Li, X., and Gould, SJ. (2003). The dynamin-like GTPase DLPl is essential for
peroxisome division and is recruited to peroxisomes in part by PEX11. J Biol
Chem 278, 17012-17020.

Lingard, M.J., and Trelease, RN. (2006). Five Arabidopsis peroxin 11 homologs
individually promote peroxisome elongation, duplication or aggregation. J Cell
Sci 119,1961-1972.

Lingard, M.J., Gidda, S.K., Bingham, S., Rothstein, S.J., Mullen, R.T., and Trelease,
RN. (2008). Arabidopsis PEROXINllc-e, FISSIONlb, and DYNAMIN-
RELATED PROTEIN3A cooperate in cell cycle-associated replication of
peroxisomes. Plant Cell 20, 1567-1585.

163

Mano, S., Nakamori, C., Kondo, M., Hayashi, M., and Nishimura, M. (2004). An
Arabidopsis dynamin-related protein, DRP3A, controls both peroxisomal and
mitochondrial division. Plant J 38, 487-498.

Marshall, P.A., Dyer, J.M., Quick, M.B., and Goodman, ].M. (1996). Redox-sensitive
homodimerization of Pexllp: a proposed mechanism to regulate peroxisomal
division. J Cell Biol 135, 123-137.

Miyagishima, S.Y., Froehlich, J.E., and Osteryoung, K.W. (2006). PDVl and PDV2
mediate recruitment of the dynamin-related protein ARC5 to the plastid division
site. Plant Cell 18, 2517-2530.

Miyagishima, S.Y., Kuwayama, H., Urushihara, H., and Nakanishi, H. (2008).
Evolutionary linkage between eukaryotic cytokinesis and chloroplast division by
dynamin proteins. Proc Natl Acad Sci USA 105, 15202-15207.

Nomura, K., Debroy, S., Lee, Y.H., Pumplin, N., Jones, J., and He, S.Y. (2006). A
bacterial virulence protein suppresses host innate immunity to cause plant disease.
Science 313, 220-223.

Okazaki, K., Kabeya, Y., Suzuki, K., Mori, T., Ichikawa, T., Matsui, M., Nakanishi, H.,
and Miyagishima, S.Y. (2009). The PLASTID DIVISIONI and 2 components of
the chloroplast division machinery determine the rate of chloroplast division in
land plant cell differentiation. Plant Cell 21, 1769-1780.

Orth, T., Reumann, S., Zhang, X., Fan, J., Wenzel, D., Quan, S., and Hu, J. (2007). The
PEROXINll protein family controls peroxisome proliferation in Arabidopsis.
Plant Cell 19, 333-350.

Osteryoung, K.W., and Nunnari, J. (2003). The division of endosymbiotic organelles.
Science 302, 1698-1704.

Praefcke, G.J., and McMahon, I-l.T. (2004). The dynamin superfamily: universal
membrane tubulation and fission molecules? Nat Rev Mol Cell Biol 5, 133-147.

Purdue, RB, and Lazarow, PB. (2001). Peroxisome biogenesis. Annu Rev Cell Dev Biol
17, 701-752.

164

Schluter, A., Fourcade, S., Ripp, R., Mandel, J.L., Poch, 0., and Pujol, A. (2006). The
evolutionary origin of peroxisomes: an ER-peroxisome connection. Mol Biol Evol
23, 838-845.

Schrader, M. (2006). Shared components of mitochondrial and peroxisomal division.
Biochim Biophys Acta 1763, 531-541.

Serasinghe, M.N., and Yoon, Y. (2008). The mitochondrial outer membrane protein
hFisl regulates mitochondrial morphology and fission through self-interaction.
Exp Cell Res 314, 3494-3507.

Thorns, S., and Erdmann, R. (2005). Dynamin-related proteins and Pexll proteins in
peroxisome division and proliferation. FEBS J 272, 5169-5181.

Titorenko, V.I., and Mullen, RT. (2006). Peroxisome biogenesis: the peroxisomal
endomembrane system and the role of the ER. J Cell Biol 174, 11-17.

Vitha, S., Froehlich, J.E., Koksharova, 0., Pyke, K.A., van Erp, H., and Osteryoung,
K.W. (2003). ARC6 is a J-domain plastid division protein and an evolutionary
descendant of the cyanobacterial cell division protein Ftn2. Plant Cell 15, 1918-
1933.

Wilsbach, K., and Payne, GS. (1993). Vpslp, a member of the dynamin GTPase family,
is necessary for Golgi membrane protein retention in Saccharomyces cerevisiae.
EMBO J 12, 3049-3059.

Yan, M., Rayapuram, N., and Subramani, S. (2005). The control of peroxisome number
and size during division and proliferation. Curr Opin Cell Biol 17, 376-383.

Yang, Y., Glynn, J.M., Olson, B.J., Schmitz, A.J., and Osteryoung, K.W. (2008). Plastid
division: across time and space. Curr Opin Plant Biol 11, 577-584.

Zhang, X., and Hu, J. (2008). FISSIONlA and FISSIONIB proteins mediate the fission
of peroxisomes and mitochondria in Arabidopsis. Mol Plant 1, 1036-1047.

Zhang, X., and Hu, J. (2009). Two small protein families, DYNAMIN-RELATED
PROTEIN3 and FISSIONl, are required for peroxisome fission in Arabidopsis.
Plant J 57, 146-159.

165

Zolman, B.K., Yoder, A., and Bartel, B. (2000). Genetic analysis of indole—3-butyric acid
responses in Arabidopsis thaliana reveals four mutant classes. Genetics 156,
1323-1337.

166

 

Chapter 5 Conclusions and Future Directions

167

5.1 Conclusions

5.1.1 DRP3A and DRP3B are functionally redundant in peroxisome fission and

plant growth in Arabidopsis (Chapter 2)

DRPs have evolved in eukaryotic cells to function in diverse processes such as
cytokinesis, endocytosis, membrane trafficking, organelle division, plant cell plate
formation, and resistance to viral infection (Osteryoung and Nunnari, 2003; Praefcke and
McMahon, 2004; Thoms and Erdmann, 2005; Miyagishima et al., 2008). Sometimes,
more than one function is assigned to the same DRP. For instance, DLPl is a mammalian
DRP controlling the division of mitochondria and peroxisomes; VPSl, a DRP in yeast, is
required for peroxisome morphology and also for protein trafficking to the vacuole
(Kuravi et al., 2006). DRPs mediating organelle division are believed to act in membrane

fission after organelle membrane is constricted.

The involvement of DRP3A in peroxisome division was observed using a forward
genetic strategy in Arabidopsis. drp3A (amp) mutants show an aberrant mitochondrial
morphology. Interestingly, peroxisomes in those mutants are elongated and enlarged with
a reduction in number (Mano et al., 2004). Our lab also isolated a drp3A null mutant
exhibiting highly aggregated/inseparable and massively elongated peroxisomes (Zhang
and Hu, 2009). DRP3B is a homolog of DRP3A. Despite the high similarity in sequence
between DRP3A and DRPBB, deletion of DRP3B results in aggregated peroxisomes with
slightly reduced peroxisome number, a subtle peroxisome phenotype compared to

peroxisomes in drp3A mutants. These observations suggest that DRP3B may plays a

168

minor role in peroxisome division relative to DRP3A (Zhang and Hu, 2009). Aggregated
preoxisomes in both drp3A and drp3B mutants show membrane constriction, indicating
that DRP3 proteins are involved in peroxisome fission after other factors already
committed membrane constriction. In addition, drp3A drp3B double mutants display
stronger deficiencies than each drp3 single mutant in peroxisome abundance, seedling
establishment and plant growth. Therefore, DRP3A and DRP3B are partially functionally
redundant in peroxisome division and plant growth (Zhang and Hu, 2009). Another report
about DRP3 family supports the view that DRP3B plays a weaker role in peroxisome
division, and that the two DRP3 proteins are functionally redundant in plant growth, as
well as in mitochondrial division (Fujimoto et al., 2009). The authors further claim that

DRP3A and DRP3B may play distinct roles in peroxisome division in Arabidopsis.

5.1.2 DRPSB, a component of chloroplast division machinery, also plays a role in

peroxisome division in Arabidopsis (Chapter 4)

DRP5B (ARCS) is an Arabidopsis DRP involved in chloroplast division (Gao et al.,
2003). Our study has identified a new function for DRP5B in peroxisome division.
Mutations in DRP5B gene result in aggregated peroxisomes showing membrane
constriction. Silencing of each DRP gene leads to peroxisome enlargement with
constricted membranes. However, peroxisomes in drp5B mutants are different from those
in drp3 mutants. Knowing that DRPs generally function on constricted organelles before
fission in mammalian and yeast systems, and that the disruption of DRP3A, DRP3B and
DRPSB in Arabidopsis leads to peroxisome enlargement with membrane constriction ,
we conclude that at least three Arabidopsis DRPs are involved in the fission of

169

peroxisomes. It has been shown that mitochondria and peroxisomes share components of
their division machinery, such as F131 and DRP3 proteins, DRP5B is the only identified

factor shared by the division machineries of chloroplasts and peroxisomes.

Subcellular localization analysis of transgenic lines expressing GFP-DRPSB driven by
355 or DRP5B native promoter shows that DRP5B not only forms a ring on the cytosolic
surface of chloroplasts as previously reported, but also localize to peroxisome in
Arabidopsis. DRP3A and DRP3B appear as puncta attached on both peroxisomes and
mitochondria, and these puncta mark the potential sites of organelle fission. By contrast,
DRPSB is completely co-localized with peroxisomes. The functions of these three DRPs
in organelle division have not yet been clear. Many questions remain unanswered, such
as, whether they are functionally redundant, and if they play roles in peroxisome division

coordinately.

5.1.3 FISlA and FISlB control the fission of peroxisomes and mitochondria in

Arabidopsis (Chapters 2 and 3)

Sharing the key components of their division machineries appears to be a ubiquitous and
general principle of peroxisomes and mitochondria in many eukaryotes. Fisl protein is a
C-terminal tail anchored membrane protein involved in the fission of peroxisomes and
mitochondria in mammals and yeast (Yoon et al., 2003; Thorns and Erdmann, 2005;
Kobayashi et al., 2007; Serasinghe and Yoon, 2008). Members of the FIS] family, FISIA
and FISlB, have been shown to be involved in peroxisomal and mitochondrial division in

Arabidopsis thaliana (Lingard et al., 2008; Zhang and Hu, 2009). Ectopic expression of

170

each FIS] gene induces an increase in the numbers of peroxisomes and mitochondria,
whereas silencing of FIS] gene results in reduced numbers of both organelles (Zhang and
Hu, 2008; Zhang and Hu, 2009). Domain truncation analysis indicates that the C-terminal
domain of FIS] is required for its targeting to peroxisomes. Furthermore, analysis of
plants in which both FISIA and FISIB are silenced shows that FISIA and FISlB play
partially redundant roles in promoting the fission of peroxisomes and mitochondria

(Zhang and Hu, 2008).

5.1.4 BiFC and Co-IP reveal the interactions among PEXIIS, F181 and DRPs

(Chapter 4)

Mammalian PEX1 10 forms homodimers, and interacts with Fisl which anchors DLPl to
mitochondria and peroxisomes. Furthermore, Fisl, PexllB, and DLPl form ternary
complexes and function in a concerted manner (Kobayashi et al., 2007). This provides
clues for the peroxisome research in plants. BiF C analysis using protoplasts indicates that
five Arabidopsis PEX11 proteins form homodimers and heterodimers, and interact with
FISlB (Lingard et al., 2008). Although PEX1 ls, FISls and DRPs are three types of
conserved proteins involved in peroxisome division in various eukaryotic cells, whether
these proteins act coordinately in planta remain largely unknown. Our research of
protein-protein interactions among PEX11, F181 and DRP proteins shows that these

proteins might function in protein complexes.

We performed a comprehensive protein interaction analysis among DRPs, PEX1 Is and

FISls by using BiFC, which not only tells if two proteins interact, but also shows where

171

interaction happens. Another approach, Co-IP, was employed to confirm protein-protein

interaction conferred by BIFC assay.

Consistent with previous results from yeast two-hybrid analysis, our BiFC and Co-IP
assays show that DRP3A and DRP3B form homo- and hetero-dimers (Fujimoto et al.,
2009). Our results also demonstrate that DRP5B forms homodimer, and interacts with
DRP3A and DRP3B on peroxisomes, suggesting that these DRP proteins may hetero-
oligomerize and further assemble together to exert their roles in the fission of

peroxisomes.

In our study, BiF C and Co-IP assays show that DRPSB does not interact with FISlB, but
only with FISIA on peroxisomes. DRP3A interacts with FISIA exclusively on
mitochondria, while it interacts with FISIB only on peroxisomes. In addition, DRP3B
interacts with both FISIA and FISIB on peroxisomes. Taken together, FISl proteins
interact with DRPs in vivo and in vitro. The physical interactions between FISls and
DRPs provide evidence that FIS] proteins may act as an anchor for DRPs to peroxisomes

and mitochondria in planta.

Genetic evidence shows that PEX11 and DRP interact in different organisms. A double
deletion of Pex28 and Pex29, which play roles in peroxisome abundance, can be
complemented by the overexpression of VpsI or Pex25, indicating a genetic interplay
between the PEX11 family and DRP family in yeast (Vizeacoumar et al., 2003; Thoms
and Erdmann, 2005). Interestingly, when mammalian DLPl was reduced by RNAi,

overexpression of PEXllB could no longer induce peroxisome proliferation. This

172

provides the genetic evidence that PEX11 proteins and DRPs act co-coordinately in
peroxisome division in mammals. However, evidence of physical interaction is absent (Li
and Gould, 2003; Kobayashi et al., 2007). Therefore, the physical interactions between

PEX1 Is and DRPs have been speculated to be indirect or transient.

In our research, we were able to detect interactions between DRPs and PEX1 ls using
transient expression in tobacco leaves. DRP5B interacts with each of the five PEX11
proteins. DRP3A and DRP3B also interact with PEX11 proteins in vivo and in vitro.
However, some BiF C and Co-IP results are discrepant from each other. For example, Co-
IP assay could not detect any interaction between PEX1 1a and DRPs, while BiFC assay
shows that PEX1 1a interacts with DRP3A, DRP3B and DRPSB. Despite the discrepancy,
our data support the view that DRPs and PEX1 ls may act in protein complexes. Another
interesting phenomenon we observed is that PEX11 proteins interact with DRPs only on
small peroxisomes before they elongate, suggesting that these two types of proteins may

interact with each other at certain time and the interaction might be transient.

In summary, DRP3A, DRP3B and DRP5B are three proteins involved in peroxisome
fisssion, and they physically interact with each other, suggesting that they may assemble
and function together in Arabidopsis. FISI and PEX11 proteins are two types of
peroxisomal membrane proteins that may serve as adaptors for DRP recruitment to
different organelles. Besides, two FISl proteins interact with members of PEX11 protein
family. These findings indicate that PEX11, FIS] and DRP proteins may form ternary
complexes and play roles in organelle division, especially peroxisome fission, in a
concerted manner in plants. However, it is still unclear whether PEX11 and F151 proteins

173

recruit DRPs to peroxisomes in Arabidopsis. And, questions remain as to how these three
types of proteins cooperate in peroxisome division. Elucidation of the genetic relationship
among these three types of proteins will provide answers to the question that if they
function coordinately in plant peroxisome division. Plant-specific targeting mechanisms

by which DRPs are recruited to different organelles may have been created.

5.2 Future directions

5.2.1 Cooperation of PEX11s, FISls and DRPs in plant peroxisome divison?

PEX11 or FIS] silencing results in a decrease in peroxisome numbers. Loss of the DRPs,
DRP3A, DRP3B or DRPSB has an effect on peroxisome number reduction in
Arabidopsis. Conversely, PEX11 overexpression can induce peroxisome proliferation,
ectopic expression of FIS] increases peroxisome abundance, whereas DRP
overexpression does not have an impact on peroxisome number or morphology (Mano et
al., 2004; Thorns and Erdmann, 2005; Fujimoto et al., 2009; Zhang and Hu, 2009). These
data are consistent with the current model of peroxisome division in which PEX11 family
members act earlier by causing membrane elongation, and then FISl serves as an anchor
for DRPs that function in organelle membrane scission. Furthermore, physical
interactions among these proteins promote speculation that plant PEX1 ls, F181 and

DPRs may form tertiary complexes and cooperate in peroxisome division in plants.

ELMl (Elongated Mitochondria), a plant-specific protein that exclusively targets to the

outer membrane of mitochondria, interacts with both DRP3A and DRP3B, and is

174

required for the mitochondrial targeting of DRP3A (Arimura et al., 2008). Since both
F 151 and ELMI interact with DRP3A and DRP3B, it is possible that they act as a protein
complex on mitochondrial membrane to recruit DRP proteins. However, physical
interactions between F 181 and ELMl proteins are yet to be identified (Arimura et al.,
2008). In addition, Mdvlp/Caf4p is a cytosolic adaptor interacting with both Dnml and
F is] proteins in yeast mitochondrial and peroxisome division (Delille et al., 2009). It is
an interesting question whether other F ISl-interacting linker proteins that are functionally

similar to Mdvl and Caf4, exist in higher plants.

Future work will determine if and how these various proteins coordinate in peroxisome
division. To further investigate the roles of DRPs in plants, we are trying to generate
drp3A drp3B drp5B triple mutants and to express DRP5B in the drp3A drp3B double
mutants. Future results will answer if they are functionally redundant in peroxisome
division and plant growth. Analyzing the subcellular localization of DRPs in pexll or
fisl knockout mutants will tell whether PEXlls and FISls are involved in DRP
recruitment to organelles. In addition, ectopic expression of PEX11 or FIS] in drp
mutants will further provide clues for the question of how these proteins cooperate in
plant peroxisome division. These studies will provide new insights into the molecular
mechanism underlying organelle division. A recent report showed that the targeting of
Fisl to peroxisomes depends on PEX19, a factor involved in peroxisomal membrane
protein import in mammalian cells (Delille and Schrader, 2008). Whether the targeting of
FISl also relies on PEX19, or other peroxisomal membrane proteins, remains unknown
in plants. It raises the question of how PEX11 and F181 proteins are targeted to

organelles.

175

 

 

5.2.2 Interrelationship of plant organelle division

Growing new evidence in mammals, yeast and plants suggests. that peroxsiomes and
mitochondria exhibit a greater co-dependent relationship than previously assume
(Hoepfner et al., 2001; Li and Gould, 2003; Thoms and Erdmann, 2005; Schrader and
Yoon, 2007; Fujimoto et al., 2009; Zhang and Hu, 2009). Peroxisomes and mitochondria
are metabolically linked in the B-oxidation of fatty acids in all eukaryotic cells. They also
share some of the fission factors, FISl and DRP proteins. In addition, a new outer-
membrane mitochondria-anchored protein ligase (MAPL) was found to be associated
with peroxisomes. MAPL-containing vesicles fuse with a subset of peroxisomes, which
marks a novel vesicular transport pathway from mitochondria to peroxisomes in
mammalian cells (Neuspiel et al., 2008). Therefore, peroxisomes and mitochondria are
interconnected not only metabolically, but also physically in their division and
mitochondrion-to-peroxisome vesicle transport. It is of interest to explore if there is a
vesicle transport pathway between mitochondria and peroxisomes in plants and what is

the fate of the putative vesicle remnant.

Peroxisomes and mitochondria share less common aspects with chloroplasts, except that
photorespiration is accomplished in the three compartments in plant cells. Our DRPSB
work represents the first report of a crosstalk between the division of chloroplasts and
peroxisomes. We have identified an unexpected DRP, DRP5B, as a direct link between
the two organelles concerning their divisions that had been known to operate in separate
manners. There is so far no evidence for shared components in the biogenesis of
mitochondria and chloroplasts. Many aspects of peroxisome biology are still mysterious.

176

What determines the specific assembly of the shared division components on
peroxisomes, mitochondria or chloroplasts, and how is their division coordinated? What

are the biological contributions of this coordination?

5.2.3 Peroxisome biogenesis at large

Peroxisome biogenesis in a cell can be considered to be regulated by a number of
incompletely understood processes, including peroxisome proliferation by division,
peroxisome de novo biogenesis, peroxisome inheritance, peroxisome degradation by
pexophagy, as well as peroxisome abundance responding to environmental cues (Thorns
and Erdmann, 2005). The research in this dissertation has contributed to establishing a
mechanistic model of peroxisome division and proliferation in plants. However, our
knowledge about the other aspects of peroxisome biogenesis is rather limited. Addressing
these questions will bring new insights into our understanding of peroxisome biogenesis
and their specific roles in plant growth and development. Peroxisomal research in planta

will provide important clues for the studies of peroxisomes in other eukaryotes.

177

References

Arimura, S., Fujimoto, M., Doniwa, Y., Kadoya, N., Nakazono, M., Sakamoto, W., and
Tsutsumi, N. (2008). Arabidopsis ELONGATED MITOCHONDRIAI is required
for localization of DYNAMIN-RELATED PROTEIN3A to mitochondrial fission
sites. Plant Cell 20, 1555-1566.

Delille, H.K., and Schrader, M. (2008). Targeting of hFisl to peroxisomes is mediated by
Pexl9p. The Journal of biological chemistry 283, 31107-31115.

Delille, H.K., Alves, R., and Schrader, M. (2009). Biogenesis of peroxisomes and
mitochondria: linked by division. Histochemistry and cell biology 131, 441-446.

F ujimoto, M., Arimura, S.I., Mano, S., Kondo, M., Saito, C., Ueda, T., Nakazono, M.,
Nakano, A., Nishimura, M., and Tsutsumi, N. (2009). Arabidopsis dynamin-
related proteins DRP3A and DRP3B are functionally redundant in mitochondrial
fission, but have distinct roles in peroxisomal fission. Plant J.

Gao, H., Kadirjan-Kalbach, D., Froehlich, J .E., and Osteryoung, K.W. (2003). ARCS, a
cytosolic dynamin-like protein from plants, is part of the chloroplast division

machinery. Proceedings of the National Academy of Sciences of the United States
of America 100, 4328-4333.

Hoepfner, D., van den Berg, M., Philippsen, P., Tabak, HF, and Hettema, EH. (2001).
A role for Vpslp, actin, and the My02p motor in peroxisome abundance and
inheritance in Saccharomyces cerevisiae. The Journal of cell biology 155, 979-
990.

Kobayashi, S., Tanaka, A., and Fujiki, Y. (2007). Fisl, DLPl, and Pexl 1p coordinately
regulate peroxisome morphogenesis. Experimental cell research 313, 1675-1686.

Kuravi, K., Nagotu, S., Krikken, A.M., Sjollema, K., Deckers, M., Erdmann, R.,
Veenhuis, M., and van der Klei, U. (2006). Dynamin-related proteins Vpslp and
Dnmlp control peroxisome abundance in Saccharomyces cerevisiae. Journal of

cell science 1 19, 3994-4001.

Li, X., and Gould, SJ. (2003). The dynamin-like GTPase DLPI is essential for
peroxisome division and is recruited to peroxisomes in part by PEX11. The
Journal of biological chemistry 278, 17012-17020.

178

 

Lingard, M.J., Gidda, S.K., Bingham, S., Rothstein, S.J., Mullen, R.T., and Trelease,
RN. (2008). Arabidopsis PEROXIN 1 lc-e, F ISSIONlb, and DYNAMIN-
RELATED PROTEIN3A cooperate in cell cycle-associated replication of
peroxisomes. Plant Cell 20, 1567-1585.

Mano, S., Nakamori, C., Kondo, M., Hayashi, M., and Nishimura, M. (2004). An
Arabidopsis dynamin-related protein, DRP3A, controls both peroxisomal and
mitochondrial division. Plant J 38, 487-498.

Miyagishima, S.Y., Kuwayama, H., Urushihara, H., and Nakanishi, H. (2008).
Evolutionary linkage between eukaryotic cytokinesis and chloroplast division by
dynamin proteins. Proceedings of the National Academy of Sciences of the
United States of America 105, 15202-15207.

Neuspiel, M., Schauss, A.C., Braschi, E., Zunino, R., Rippstein, P., Rachubinski, R.A.,
Andrade-Navarro, M.A., and McBride, HM. (2008). Cargo-selected transport
from the mitochondria to peroxisomes is mediated by vesicular carriers. Curr Biol

18,102-108.

Osteryoung, K.W., and Nunnari, J. (2003). The division of endosymbiotic organelles.
Science 302, 1698-1704.

Praefcke, G.J., and McMahon, HT. (2004). The dynamin superfamily: universal
membrane tubulation and fission molecules? Nature reviews 5, 133-147.

Schrader, M., and Yoon, Y. (2007). Mitochondria and peroxisomes: are the 'big brother'
and the 'little Sister' closer than assumed? Bioessays 29, 1105-1114.

Serasinghe, M.N., and Yoon, Y. (2008). The mitochondrial outer membrane protein
hFisl regulates mitochondrial morphology and fission through self-interaction.
Experimental cell research 314, 3494-3507.

Thoms, S., and Erdmann, R. (2005). Dynamin-related proteins and Pexll proteins in
peroxisome division and proliferation. Febs J 272, 5169-5181.

Vizeacoumar, F.J., Torres-Guzman, J.C., Tam, Y.Y., Aitchison, J .D., and Rachubinski,
RA. (2003). YHR150w and YDR479c encode peroxisomal integral membrane
proteins involved in the regulation of peroxisome number, size, and distribution in
Saccharomyces cerevisiae. The Journal of cell biology 161, 321-332.

179

 

Yoon, Y., Krueger, E.W., Oswald, B.J., and McNiven, M.A. (2003). The mitochondrial
protein hFisl regulates mitochondrial fission in mammalian cells through an
interaction with the dynamin-like protein DLPl. Molecular and cellular biology
23, $409-$420.

Zhang, X., and Hu, J. (2009). Two small protein families, DYNAMIN-RELATED
PROTEIN3 and FISSIONI, are required for peroxisome fission in Arabidopsis.
Plant J 57, 146-159.

Zhang, X., and Hu, J ., (2008) FISSIONIA and FISSIONIB proteins mediate the fission
of peroxisomes and mitochondria in Arabidopsis. Molecular Plant 1(6):1036-1047

180

 

M'11111111711111!flijflfllljllllliljlllES