.4.
t
.. x. o. u 1.... a ‘ u...

23.3....me

$38.... km...“ fawn

O

....... z .3 ..
. “Mm...“ film.
, iii...“ .20. u x .
$394M. a»:
ta... .3. . u.

 

«£wa
V’Inl
a»... whet... 3. u Ari...
1...... 12.15....
. cu... .Hwnu€s._utv
.a...,.......,....:: P 1.". ‘
.. . 5.-
33.311)...
3. u.

.6

A.

.t.{l’(5 0.0.533...

Ii); 1 Id"...

9.. Hull“... 1|

am. It...“
2.

rfiir

 

 

)\ i a.
.§lllla!(tll‘l.1||’.:np:l
Intfiyaillttlvr :9” J.- 0‘.

"”3?

"we-mama».

o

m

t

wasmutvmcuwuv

:3

V!

‘am’fi'w

. .. to: ‘

it? . .. , . , . . _ .. aw, a ... ...
fir... _ . , , . ._. . . . . . . . , . m
I. . . .. . . .. . . . .. .. . . . . , . . ka......\..:§. .

 

I...

 

 

 

27 . LIBRARY
1"- '3 Michigan State
University“

 

 

This is to certify that the
dissertation entitled

CHARACTERIZING CHICKEN STEM CELL ANTIGEN 2, A
PUTATIVE MAREK’S DISEASE GENE

presented by

WEIFENG MAO

has been accepted towards fulfillment
of the requirements for the

Ph.D degree in GENETICS

 

 

at... m 0,.

Majorprfissor’s Signature

DEC. [7’ 3007

Date

MSU is an Affirmative Action/Equal Opportunity Employer

 

 

PLACE IN RETURN Box to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K:/Proj/Aoc&Pres/CIRC/Dateoue.indd

. .___.._

CHARACTERIZING CHICKEN STEM CELL ANTIGEN 2, A PUTATIVE MAREK’S
DISEASE RESISTANT GENE

By

WEIFENG MAO

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILSOPHY
Genetics

2009

ABSTRACT
CHARACTERIZING CHICKEN STEM CELL ANTIGEN 2, A PUTATIVE MAREK’S
DISEASE RESISTANT GENE
By
WEIF ENG MAO

Marek’s disease virus (MDV) is an alpha-herpesvirus that is the causative agent
of Marek’s disease (MD), a lymphomatous disease of chicken. MD is a serious chronic
disease of concern to the poultry industry worldwide, although it has been controlled
through the use of vaccination since the 1970’s. MD vaccines prevent the formation of
lymphomas but are not sterilizing and do not prevent MDV infection or replication in the
bird. Consequently, the observed increase in MDV virulence over the years may be an
undesirable response to the widespread use of MD vaccines. With increases in MDV
virulence expected in the future and the most effective MD vaccine (Rispens) already in
use, additional approaches such as genetic resistance to control MD are needed to
augment vaccinal control of MD. The overall purpose of this project is to characterize
stem cell antigen 2 (SCA2), the product of the putative MD resistant gene, and its role in
MDV biology I

To analyze the biological properties of chicken SCA2, SCA2 protein was
expressed and purified in E. coli, and a polyclonal antibody was developed. Utilizing this
anti-SCA2 antibody, SCA2 was identified to be a 13 kDa cell surface protein anchored
by a GPI moiety as is the case for most other Ly6 family members. In vivo studies
showed unique SCA2 expression pattern in bursal cortical medullary epithelial cells

(CMEC), which are surrounded by MHC class II presenting cells. Expression profiles of

bursal cells induced by contact with SCA2-expressing cells in vitro demonstrated down-
regulation of numerous genes that are involved in the B cell receptor and immune
response signaling pathways. These data suggest that SCA2 plays a role in regulating
chicken B lymphocytes.

The viral USIO protein was previously demonstrated to interact with SCA2 in an
E. coli two hybrid screen followed by confirmation using an in vitro binding assay. To
analyze the fimctional interaction of SCA2 and USlO for MDV growth properties, two
recombinant MDVs were developed in which viral US10 gene was fused to or replaced
with an enhanced green fluorescent protein (EGFP) coding region. Over-expressing
SCA2 impairs both MDV plaque size and the percent of fibroblasts infected in vitro but
this effect is dependent on the presence of U810. We conclude that MDV USIO is both
sufficient and required for this growth impairment via association with SCA2.

A missense point mutation in MDV UL41 gene was found out when cloning the
viral genome into bacterial artificial chromosome (BAC). Monitoring the frequency of
each SNP by pyrosequencing during virus passages determined the ratio of each viral
genome in a single monolayer. This point mutation in UL41 gene enhanced the viral
fitness in the competitive growth assay in vitro, but abolished the virion host shutoff (vhs)
activity of UL41. This result suggests that the enhanced fitness in vitro for MDV with

inactive vhs was due to reduced degradation of viral transcripts.

Dedicated to:

Yunli Liu
Eric Mao

ACKNOWLEDGEMNETS

I would like to thank my mentor, Dr. Hans Cheng, for introducing me to a
fascinating and challenging project, his guidance through my graduate program and my
academic career planning. Without his help and support, the writing of this thesis will not
have been done. I would also like to express my gratitude to my committee members, Dr.
Jerry Dodgson, Dr. Michele Fluck, Dr. Suzanne Thiem and Dr. Cathy Earnst for their
additional guidance and suggestions on how to improve myself as a scientist. I would
also like to thank Dr. Henry Hunt for his guidance and help for my research.

I would like to thank my lab-mate and friend, Laurie Molitor, for her friendship
and invaluable assistance. I would also like to thank Dr. Melinda Frame, Dr. Lucy Lee,
Dr. Robert Silver, Dr. Huanmin Zhang, Dr. Masahiro Niikura, Dr. Kyle Maclea, Dr.
Tajoong Kim, Lonnie Milam, Noah Koller for their help and useful suggestions.

I would like to thank my parents, Shudui Lin, and Hanchong Mao, for their love
and support.

I would like to thank my wife, Yunli Liu. She is always along with me during this
long journey. My son, Eric Mao, joined us three years ago. They gave me innumerable
loves and wishes.

Finally, I would like to thank Genetics program, and the USDA, ARS, avian
disease and oncology laboratory. Without their support, completion of my research and

degree would not have been possible.

TABLE OF CONTENTS

LIST OF TABLES ................................................................................. ix
LIST OF FIGURES .................................................................................. x
LIST OF ABBREVIATIONS .................................................................. xii
Chapterl.

Introduction and literature review ................................................................... 1
Introduction ........................................................................................ 2
History of Marek’s disease (MD) .............................................................. 3
Marek’s disease vaccines ......................................................................... 4
Marek’s disease virus (MDV) ................................................................... 5

Pathogenesis of MDV infection ............................................................. 5
The genomic structure MDV ............................................................... 7
MDV virion host shutoff gene (vhs; UL41) ........................................ 8

MDV ICP4 gene ....................................................................... 10

MDV USIO gene ....................................................................... 10
Bacterial artificial chromosome-cloned MDV genomes ........................... 11
The morphogenesis of MDV ............................................................ 11
Immune responses to MDV infection ...................................................... 12
Innate immune responses ................................................................. 12
Adaptive immune responses .............................................................. 13

Genetic resistance to MD ....................................................................... 14

Stem cell antigen 2 (SCA2; Ly-6E/TSA1) .................................................. 17
Lymphocyte complex antigen 6 (Ly-6) family .......................................... 17
Chicken Stem cell antigen 2 ............................................................... 19

Avian lymphoid tissues ......................................................................... 22

Avian bursa of Fabr1c1u322
Avian thymu323

Chapter 2.

Cloning of and functional characterization of chicken stem cell antigen 2. . . ..............37
Abstract ...................................................................................... 38
Introduction .................................................................................... 39
Materials and methods .................................................................... 41

Cells and animals ......................................................................... 41
Development of anti-SCA2 rabbit antisera ........................................... 41
Generation of chicken SCA2 eukaryotic expression vector and stable

transfection cell line ..................................................................... 42
Flow cytometry analysis .................................................................. 43
Cleavage of GPI—linked cell surface SCA2 molecules ............................... 43
Western blots and immunoprecipitation ............................................. 44
Immunohistochemistry .................................................................... 44
Affymetrix array processing and data analysis ......................................... 45

vi

Real-Time quantitative reverse transcription PCR ................................... 47

Results .......................................................................................... 49
Chicken SCA2 is a 13 kDa cell surface protein anchored by a GPI moiety ........ 49
Tissue distribution of chicken SCA2 ..................................................... 52
Gene expression profiling of bursal cells in contact with
SCA2-expressing cells .................................................................... 58
Discussion ................................................................................... 64
Chapter 3.
Chicken stem cell antigen 2 modulates Marek's disease virus growth
properties in vitro via USIO ...................................................................... 73
Abstract .......................................................................................... 73
Introduction ...................................................................................... 76
Materials and methods ....................................................................... 79
Cells ........................................................................................ 79
Recombinant BAC clones ................................................................. 80
Generation of viruses ...................................................................... 82
One step growth curve assay and plaque area determination ........................ 82
Immunofluorescence and confocal image analysis ................................. 83
Western blot analysis ..................................................................... 84
Flow cytometry analysis .................................................................. 84
Results ............................................................................................ 86
Construction of USIOEGFP and AUSlOEGFP MDV-BAC clones ............... 86
Generation and growth properties of the mutant viruses in CEF .................... 89
Cellular localization of USlO-EGFP and SCA2 proteins ............................. 92
Growth properties of US lOEGFP and AUS lOEGFP mutant viruses
on Vector-DFl and SCA2Flag-DF1 cells ............................................... 96
Discussion ...................................................................................... 100
Chapter 4.

Quantitative evaluation of viral fitness due to a single nucleotide
polymorphism in the Marek’s disease virus UL41 gene via an in

vitro competition assay ........................................................................ 108
Abstract ....................................................................................... 109
Introduction .................................................................................... 1 10
Materials and methods ..................................................................... 113

Culture method for MDV and DNA purification .................................. 113

Mini-7t mutagenesis to generate pMDV-UL41*Arg and

pMDV-UL41*Cys-rev .................................................................. 113

Growth rates of individual viruses ................................................... 116

Standard curve .......................................................................... 116

Competitive assay ....................................................................... 116

UL41 activity assay in vitro ............................................................. 115
Results ........................................................................................ 117

Generation of pMDV-UL41*Arg and pMDV-UL41*Cys—rev

by mini-7t mutagenesis ................................................................ 119

vii

Growth rates of individual viruses in vitro ............................................ 120

Standard curve for pyrosequencing .................................................... 120
Increasing virus fitness of MDV—UL41*Cys in virus
populations in vitro ...................................................................... 121
Wild type MDV UL41 (MDV-UL41*Arg) has vhs activity
and this enzyme activity is abolished in MDV-UL41*Cys .......................... 125
Discussion ...................................................................................... 127
Chapter 5.
Future work ........................................................................................ 134

viii

LIST OF TABLES

Table 2-1 Primers used for quantitative real-time PCR validation of microarray data

.......................................................................................................... 48
Table 2-2 Genes under-express in SCA2 induced bursal cells ............................... 59
Table 2-3 Genes over-express in SCA2 induced bursal cells ............................. 61

Table 2-4 Real-time quantitative reverse transcription PCR analysis of differential
expression for bursal cells incubated with SCA2-expressing or control DFl cells
......................................................................................................... 63

LIST OF FIGURES

Figure 1—1 Protein sequences of chicken SCA2 with homologous mice Ly-6 family
members. ............................................................................................. 21

Figure 2-1 Western blots using anti-Flag mAb or anti-SCA2 antisera ..................... 50

Figure 2-2 Flow cytometry analysis of SCA2Flag-DF1 and vector-DFl with anti-Flag
mAb and anti-SCA2 antisera ..................................................................... 51

Figure 2-3 Immunohistochemical analysis of chicken SCA2 expression in chicken
tissues ................................................................................................ 53

Figure 2-4 Immunoprecipitation and western blot analysis of SCA2 expression in chicken

tissues ................................................................................................ 55
Figure 2-5 Immunohistochemical analysis of SCA2 expression in bursal follicles ........ 56
Figure 3-1 Schematic diagram of recombinant MDV-BAC clones ........................... 87

Figure 3-2 BamHI digestion pattern of purified USlOEGFP-BAC and AUSIOEGFP-BAC
clones ................................................................................................ 88

Figure 3-3 Western blot analysis of USlOEGFP and AUSIOEGFP
viruses .......................................................................................... 90

Figure 3-4 One step growth curve assay of er5-B40, USlOEGFP, AUSIOEGFP
viruses in CEF cells ................................................................................ 91

Figure 3-5 The confocal image of sub-cellular localization of U810 in CEF infected with
USlOEGFP virus through green fluorescence ................................................ 93

Figure 3-6 Confocal immunofluoresence images of SCA2 in SCA2Flag-DF1 cells ...... 94

Figure 3-7 Confocal immunofluoresence images of USlO-EGFP and SCA2 in SCA2Flag-
DF1 cells infected with USlOEGFP virus ....................................................... 95

Figure 3-8 Plaques of USlOEGFP and AUSIOEGFP viruses on Vector-D’Fl and
SCA2Flag-DF1 cells .............................................................................. 97

Figure 3-9 Relative plaque areas of US lOEGFP and AUSlOEGFP viruses on Vector-DFl
and SCA2FIag-DF1 cells ................................................................................................... 98

Figure 3-10 The percentage of infected cells within Vector-DFl and SCA2Flag-DF1 cells
with USlOEGFP and AUSIOEGFP viruses ................................................... 99

Figure 4-1 Partial UL41 DNA and amino acid sequences for the parental Mdll strain, the
original MDV-BAC clone (MDV-UL41*Cys), and the two recombinant viruses (MDV-

UL41*Arg and MDV-UL41*Cys-rev) ......................................................... 1 15
Figure 4-2 Growth rates of individual viruses in vitro ....................................... 120
Figure 4-3 Standard curve of pyrosequencing for UL41 alleles.............................121
Figure 4-4 The percentage of MDVs genomes in the competition assay ................... 124

Figure 4-5 The [3- galactosidase assay for MDV UL41*Arg, UL41*Cys activity and the
controls .............................................................................................. 126

Figure 5-1 SCA2 is up-regulated on the surface of BrdU-induced RPl (MDV transformed)
T cell line ........................................................................................... 139

Figure 5-2 Partial ICP4 DNA and amino acid sequences for the parental Mdll strain, the
recombinant virus (MDV-ICP4*Ser), the original MDV-BAC clone (MDV-ICP4*Leu),
and the recombinant viruse (MDV-ICP4*Leu-rev) ........................................... 140

Figure 5-3 The percetange of MDVs genomes containing SNPs in ICP4 alleles in a
competition assay .................................................................................. 142

xi

ADOL

BAC

BCR

BLNK

CEF

CMEC

CTL

EGFP

EID

ERC

FBS

GAPDH

GPI

HC

HSC

HSV-1

HSV-2

LIST OF ABBREVIATIONS

xii

Avian Disease and Oncology Laboratory
Bacterial artificial chromosome
B cell receptor

B cell linker

Chicken embryo fibroblasts
Cortico-medullary epithelial cells
Cytotoxic T lymphocyte
Enhanced green fluorescent protein
Embryonic incubation day
Epithelial reticular cells

Fetal bovine serum
Glyceraldehyde 3-phosphate
dehydrogenase
Glycosylphosphatidyl-inositol
Hematopoietic cells
Hematopoeitic stem cells

Herpes simplex virus 1

Herpes simplex virus 2
Immediate-early genes

Interferon

Interleukin 2

Latency-associated transcripts

LM

Ly-6

MD
MDV
MHC
ORFs
pAb
PCR
PFU

PI-PLC

PLCG2
qRT-PCR
QTL
RMA
SAM
SCA2
SNP
SYK

T2ECs

TCR

UL

xiii

Liebovitz's L-15 and McCoy 5A
Lymphocyte complex antigen 6
Monoclonal antibody

Marek's disease

Marek's disease virus

Major histocompatibility complex
Open reading frames

Polyclonal antibody

Polymerase chain reaction
Plaque-forming units

Phosphatidylinositol-specific
phospholipase C

Gamma 2-phospholipase C
Quantitative reverse transcription PCR
Quantitative trait loci

Robust multichip average
Significance analysis of rnicroarrays
Stem cell antigen 2

Single nucleotide polymorphism
Spleen tyrosine kinase

Transforming growth factor-induced
erythrocytic cells

T cell receptor

Unique long

US lOEGFP

AUS lOEGFP

US

vhs

vv+MDV

vaDV

VZV

xiv

er5-B40-US lOEGFP
erS-B40-AUS 1 OEGFP
Unique short

Virion host shutoff
Very virulent plus MDV
Very virulent MDV

Varicella—zoster virus

Chapter 1

Introduction and literature review

Introduction

Marek’s disease virus (MDV) is a highly oncogenic alpha-herpesvirus that
induces Marek’s disease (MD), a lymphomatous disease of chicken. MD is considered
the most serious persistent infectious disease of concern to the poultry industry
worldwide, although it has been primarily controlled through vaccination and changes in
animal husbandry since the 19703. Even with vaccines, MD still has a significant
economic impact to the poultry industry as there are sporadic outbreaks, which require
the continuous vaccination and monitoring of birds. Consequently, there is a need for
alternative methods, such as enhanced genetic resistance to MD, to augment vaccinal
control of MD.

This chapter reviews the pathogenesis of MDV infection, the genomic structure of
MDV, and genetic resistance to MD, while also discussing the prevention and control of
the disease. MDV UL41, ICP4, USIO genes, as well as chicken SCA2, a putative MD
resistant gene, are discussed. The possibility that SCA2 plays role in MDV spread
through regulating MDV maturation and cell-cell adhesion is hypothesized.

The overall purpose of this thesis was to determine and characterize the biological
function of chicken SCA2, and through its interaction with MDV U810, investigate the
role of SCA2 in MDV infection. By identifying the properties of SCA2 and its putative
functions, we hoped to obtain a better understanding of the host protein and its
involvement in the MDV life cycle. The impact of single nucleotide polymorphisms

(SNPs) in MDV UL41 and ICP4 genes were also elucidated in this thesis.

1. History of Marek’s disease (MD)

The first report of what is later called Marek’s disease (MD) occurred in 1907 by
Dr. Joseph Marek, an eminent veterinary clinician and pathologist at the Royal Hungarian
Veterinary School in Budapest (Marek, 1907). In the report, Dr. Marek described a
disease in four adult cockerels that were affected by paralysis of the legs and wings, and
the pathological changes that occurred in the central and peripheral nervous system. The
disease is characterized by a mononuclear infiltration of the peripheral nerves, gonads,
various viscera, muscles, skin, and partial or complete paralysis as a result of the
accumulation of tumor cells in peripheral nerves. In the 19405 and 19503, diagnosis relied
on pathological examination and MD was confused with other leukotic diseases under the
term “avian leukosis complex” because of the difficulty of distinguishing between the
visceral lymphoma of MD and lymphoid leukosis. Subsequently, on the basis of the
studies in the field and transmission experiments, it was concluded that this avian
lymphomatous disease would more appropriate to MD than leukosis. Biggs and Payne
(1963, 1967) described that the transmission of this disease with blood or lymphoma cells
from diseased birds and the transmission was dependent on whole cells as the destruction
of cells resulted in loss of infectivity. The behavior of MD in chickens suggests that it
was an infectious disease, and the causative agent was likely to be a cell-associated virus.
In 1967, a cell-associated herpesvirus was isolated from blood and kidney tumor cells of
infected chickens (Churchill and Biggs, 1967), and then in infected duck embryo
fibroblasts (Nazerian et a1. 1968; Solomon et al. 1968). Because the herpesvirus was
associated with cases of MD, the ability of the herpesvirus-infected cells to produce

cytopathic effects in cell culture was quantitatively associated with lesions of MD, and

the virus was highly cell-associated similar to the infectious agent of MD, this cell-
associated herpesvirus was concluded to be the aetiological agent of MD and came to be

referred to as the Marek’s disease virus (MDV).

2. Marek’s disease vaccines

MDV and its close relatives are grouped by serotype. Serotype 1 viruses include
MDV (gallid herpesvirus type 2, GaHV-2) and are the only ones that are oncogenic.
Serotype 2 MDVs (GaHV-3, MDV-2) are naturally occurring strains that are non-
oncogenic. Serotype 3 is turkey herpes virus 1 (INT; MDV-3), a close relative
(Osterrieder et al., 2006). Serotype 1 is further categorized into very virulent plus
(vv+MDV), very virulent (vaDV), virulent (vMDV), rrrild (mMDV) and attenuated
strains based on their ability to induce disease in unvaccinated and vaccinated flocks
(Witter, 1997).

MDV can lead to tremendous economic losses to the poultry industry. After the
introduction and widespread use of vaccines in the early 19705, the disease was first
controlled. The first widely used MDV vaccine was the antigenically similar HVT. HVT
has been widely used in the United States, and appears to offer good protection (Witter et
al., 2000). The current and most effect MD vaccine is CV1988 (also referred to as
Rispens), a cell culture-attenuated serotype 1 MDV strain that offers effective protection
against challenge with the very virulent pathotypes of MDV. The principle underlying
successful immunization remains unknown. One speculation is “substrate deprivation”
where the targeted B and T cells infected by the live attenuated vaccine are no longer

susceptible to wild type virus infection or transformation. The major concern of MD

vaccines is that they are not sterilizing, i.e., the vaccines block tumor formation but do
not prevent viral replication or spread in birds. MDV continues to replicate and
potentially evolve in MD vaccinated birds, consequently, the co—existence of the vaccines
and wild type viruses in vaccinated flocks may speed up the virus recombination and
viral evolution. The evolution of MDV to greater virulence (Witter, 1997; Nair, 2005) in
the near future is one of the major driving forces to develop new alternative approaches
to augment vaccinal control of MD. For example, recombinant MDV vaccines such as a
Meg-deleted MDV serotype 1 strain, has shown improved vaccine protection (Lee et al.,
2008).

Apart from its economic impact, MDV is of interest to biomedical researchers in
that it is the only naturally-occurring alpha-herpesvirus that induces tumors in its host and
is controlled by vaccination. These characteristics of MDV make it a good model for the

study of the mechanisms of viral induced T cell lymphoma.

3. Marek’s disease virus

3.1. Pathogenesis of MDV infection

MDV is a highly cell-associated herpesvirus, and horizontal transmission occurs
through enveloped virion particles produced at the superficial layers of the feather follicle
epithelium. Poultry dusts containing these epithelial cell-enveloped MDV are infectious
to both chickens and cultured cells (Biggs, 2000). These results provide a reasonable
explanation for why the cell-associated virus can be highly contagious.

Lyrnphomagenesis results from MDV infection in susceptible birds. Lymphomas may

develop in most of the visceral organs: spleen, liver, kidney, heart, pancreas, gonads, and
also in other organs including muscle, peripheral nerves, eye, and skin. Lymphomas in
visceral organs may be the most proliferative but the lesions in other tissues may also be
obvious. The involvement of lymphoma in various organs is influenced to some extent by
both the virus strain and the genotype of the host.

The pathogenesis of MDV in susceptible chickens has been divided into four
phases: (1) early cytolytic, (2) latent, (3) late cytolytic and (4) transforming. The initial
infection of chicken occurs via the respiratory tract following the inhalation of the cell-
associated MDV from the contaminated environment. In the respiratory tract,
macrophages or dendritic cells are infected and presumed to carry the virus to lymphoid
organs such as the bursa of Fabricius (bursa), thymus, and spleen (Calnek et al., 2000). A
cytolytic infection in these lymphoid organs occurs between 3 and 6 days postinfection.
During the Iytic phase, the virus is able to infect B cells and activated CD4+ T cells, and
rarely CD4-CD8- T cells or CD8+ T cells (Calnek et al., 2000). After 7 to 8 days, the
infection in lymphoid organs switches from Iytic to latent infection mostly in CD4+ T
cells. No extracellular virus can be detected in the blood in any infected bird, so it is
concluded that virus spread is cell-to-cell. Interestingly, despite significant efforts, the
putative receptor for MDV attachment or entry has not been resolved. The latent phase is
defined as the presence of the viral genome without production of infectious virions. In
contrast to other members of the alpha-herpesvirus subfamily, MDV goes latent in
activated T cells but not in sensory nerve ganglia (Calnek et al., 2000). During latency,

latency-associated transcripts (LAT s) are among the few active viral transcripts. Latently

infected cells can become transformed cells leading to lymphoma formation;
lymphomatous tumors caused by MDV can appear as early as 12-14 days postinfection.
Various potentially important genes and latency-related transcripts that could
contribute to oncogenicity of MDV have been reported. The most studied one to date is
Meq. Meq is a gene that encodes a protein with 339 amino acids and is completely
contained in the MDV EcoRI Q fragment, hence the name Meq. Overexpressed Meq is
associated with lymphocytic tumors and confer these cells with anti-apoptotic activities.
Anti-sense transcripts of Meq inhibit the growth of MDV-transformed T cells (Xie et al.,
1996). Thus, the evidence strongly supports Meq as a significant viral oncogene for
transformation. Further studies have shown Meq has transactivating activity, and binds to
Jun/Fos cellular oncogenes to activate oncogenic pathways (Jones et al., 1992; Liu et al.,
1999; Shamblin 2004; Levy et al., 2005; Brown et al., 2009). In addition to the viral
oncogene, certain host cell genes, such as the tumor suppressor gene, p53, and proto-
oncogene, Bel-2 could also play roles in the pathogenesis of MD (Venugopal and Payne,

1995).

3.2. The genomic structure of MDV

Like other herpesviruses, MDV contains a linear, double-stranded DNA genome
surrounded by an icosahedral protein capsid core, which in turn is surrounded by
tegument proteins and a lipid-containing envelop to enclose the mature virion (Silva et al.,
2000). The 180 kb MDV genome consists of unique long (UL) and unique short (US)
regions, each flanked by inverted repeats: terminal repeat long (TRL), internal repeat

long (IRL), internal repeat short (IRS), and terminal repeat short (TRS). The genomic

structure resulted in MDV being classified as an alpha-herpesvirus (Roizman et al., 1992)
although it was originally thought to have been a gamma-herpesvims due to its biological
characteristics, especially the ability to produce lymphoid tumors. MDV genomic
structure is very similar that of herpes simplex virus 1 (HSV-1; the prototype alpha-
herpesvirus) and human herpesvirus 3 (varicella-zoster virus, VZV) (Osterrieder et al.,
2006). As a herpesvirus, MDV genes are classified as immediate-early genes (IE), early
genes and late genes based on the timing of expression of their homologs during the lytic
cycle. The IE proteins migrate to the nucleus to transactivate other MDV IE genes. The
IE genes in turn regulate the expression of early and late genes. Some of the early genes
are enzymes required for viral DNA replication, while the late genes include most of the

structural genes such as capsid, envelope, and tegument proteins (Lupiani et al., 2000).

3.2.1. MDV virion host shutoff gene (vhs; UL41)

One viral defense mechanism common to alpha-herpesviruses is to degrade the
host mRNA and inhibit processing of new synthesized host mRNA. This degradation is
an important feature of the early stage of infection, and this activity is contained in the
virion host shutoff (vhs or UL41) gene of HSV-1 (Read and Frenkel, 1983; Schek and
Bachenheimer, 1985; Kwong et al., 1988). It was later demonstrated that UL41 is an
endoribonuclease that degrades mRNA and does not discriminate between cellular or
viral origin (Jones et al., 1995; Pak et al., 1995; Taddeo and Roizman, 2006). However,
because the viral mRNA is much more abundant, the effect is to downregulate host gene
expression. HSV UL41 is a late gene and the gene product is packaged into the virion as a

part of the tegument. Immediately after ingress of mature virions into cells, UL41 is

released from the virion and degrades host mRNA in the cytoplasm. As a result, there is
down regulation of MHC class I and class II proteins, and the degradation of Jakl and
Stat2 to block IFN signaling, suggesting that UL41 modulates the host’s immune defense
to viral infection. UL41 also contributes to the ability of the virus to evade the host
adaptive immune response due to reduced cytotoxic T-lymphocyte recognition (Suzutani
et al., 2000; Kopper-Lalic et al., 2001; Murphy et al., 2003). In addition to evasion of the
host immune response, HSV UL41 also facilitates the transition from IE to E (Kwong
and Frenkel, 1987; Oroska and Read, 1987). While UL41 represents a significant
virulence factor in virus latency and pathogenesis, deletion of UL41 in HSV-l did not
alter one-step growth curves in vitro but impaired growth in corneas, trigeminal ganglia,
and brains of mice. Viral DNA within trigeminal ganglia infected with the UL41-deleted
virus was reduced by 30—fold compared to wild type HSV-1 (Strelow and Leib, 1995,
Strelow et al., 1997). In herpes simplex virus 2 (HSV-2), U1A1 also plays an important
role in vivo by interfering with the IFN-alphafbeta-mediated antiviral response and is a
determinant in HSV-2 pathogenesis (Smith et al., 2002, Murphy et al., 2003).

The central region of MDV UL41 is highly conserved among all MDV serotypes
as well as exhibiting high protein sequence identity with herpes simplex (29%) and
varcella-zoster (33%) virus homologs (Gimeno and Silva, 2008). A recombinant MDV
lacking UL41 replicated in cell culture as well as the parental MDV, but resulted in a
longer early cytolytic infection in the lymphoid organs. The deletion did not affect either
levels of latency or the ability to reactivate from latency and did not decrease the
replication of the virus in lymphoid organs or feather follicle epithelium. Thus, MDV

UL41 may facilitate the normal cascade of immediate early, early, and late gene

expression but the role of MDV UL41 in MDV pathogenesis is not nearly as great
compared to HSV vhs, although the MDV UL41 is functionally equivalent to the HSV-1

vhs.

3.2.2. MDV ICP4 gene

MDV ICP4 is a homologue of HSV ICP4 and lies in the inverted repeat that
flanks the unique short region of the genome (Anderson et al., 1992). HSV ICP4 protein
is a transcriptional regulator required for the induced transcription of most of the
remaining HSV genes and is essential for viral replication (Compel and DeLuca, 2003;
Su et al., 2006). The exact role of ICP4 in MDV replication has not been completely
determined although it is speculated to play a role similar to HSV ICP4, is associated
with maintenance of transformation, and is essential for MDV growth in chicken embryo
fibroblasts (CEF) (Endoh, 1996; Chattoo et al., 2006). A number of studies demonstrated
that LATs of MDV include a 10 kb RNA that is antisense to ICP4, and the suppression of
ICP4 by LATs plays an important role in MDV latency as well as maintenance of
transformation (Cantello et al., 1994; Xie et al., 1996; Cantello et al., 1997; Li et al.,

1998).

3.2.3. MDV US10 gene

HSV-1 USlO is a phosphorylated tegument protein that copurifies with the
nuclear matrix (Yamada et al., 1997). Homologues of US10 protein are also encoded by
other alpha-herpesviruses including HSV-2, VZV, and MDV (Brown and Harland, 1987;

Davison and Scott, 1986; Sakaguchi et al., 1992). MDV USlO is not essential for virus

replication in CEF but a ~4.8 kb deletion in the MDV US region that includes U510 and
adjacent MDV reading open frames (USI, U52, SORF 1, SORFZ, SORF3) decreased early
cytolytic infection, mortality, and tumor incidence in viva (Parcell et al., 1994; Parcell et
al., 1995). The role of US10 in the MDV life cycle remains uncertain. Liu et a1. (2003)
demonstrated that MDV US10 interacts with chicken SCA2 protein through a E. coli
two-hybrid screen followed by an in vitro binding assay, suggesting that US10 may be

involved in MD genetic resistance via SCA2 (Liu et al., 2003; Niikura et al., 2004).

3.2.4. Bacterial artificial chromosome-cloned MDV genomes

The development of recombinant MDV DNA using infectious bacterial artificial
chromosome (BAC)-cloned MDV genomes has contributed greatly to the ability of
researchers to study viral genes and gene function including viral morphogenesis.
Through recombinant MDVs, viral gB, gE, g], and UL49-VP22 genes have been
demonstrated to be indispensible for MDV growth in vitro (Schumacher et al., 2000;
Schumacher et al., 2001; Dorange et al., 2002). The viral genes Meq, vLIP, gC, pp38,
US3, vIL-8, vTRm are involved in pathogenesis and immune evasion in vivo (reviewed in

Osterrieder et al., 2006).

3.2.5. The morphogenesis of MDV

MDV morphogenesis is proposed to be like a typical alpha-herpesvirus. The
assembly process begins in the nucleus, where the viral genome is packaged into capsids.
Then, nucleocapsids which follow with the envelope at the nuclear membrane exit from

the nucleus to the cytOplasm, bind to tegument proteins, and are enveloped a second time

11

at the trans-Golgi network or endosomal membranes. The final egress step is assumed
through exocytosis of vesicles (reviewed in Johnson and Huber, 2002; Mettenleiter 2002;
Campadelli-Fiume and Roizman, 2006; Sugimotoqet al., 2008). Using a recombinant
MDV that expresses a structural protein (VP22, which is encoded by UL49)-EGFP fusion
protein, an ultrastructural study of MDV morphogenesis showed that, compared to other
alpha-herpesviruses, MDV seems deficient in a few crucial steps of viral morphogenesis,
i.e., release from the nucleus, secondary envelopment and the final egress (Denesvre et al.,
2007). The number of enveloped MDV virions in the cytoplasm is very low, which may
partially explain why infectious MDV cannot be recovered from cell lysates by freeze-
thawing or sonication. However, due to its strict cell association, MDV morphogenesis is

still not well understood.

3.3. Immune responses to MDV infection

The innate and acquired immune responses of the chicken play important roles in
different phases of MDV infection. After the virions are engulfed by macrophages, they
are delivered to replicate in bursal follicles, in which MDV mostly replicates in B
lymphocytes. Later, activated T lymphocytes are infected through intimate contact
between B and T cells (Schat and Marlowski-Grimsrud, 2000). A complex set of innate
and acquired immune responses are consequences of the maintenance of viral latent

infection and tumor formation.

3.3.1. Innate immune responses

Innate immune responses of MDV-infected chickens include activation of
macr0phages, natural killer (NK) cells, cytokines, and other soluble mediators. The role
of macrophages in MDV pathogenesis is significant. Phagocytosis of MDV by
macrophages is important to the transportation of MDV from lung, the initial entry point,
to other lympoid tissues. However, MDV does not replicate in these macrophages and, in
fact, activation of macrophage inhibits viral DNA replication in chicken spleen cells (Lee
et al., 1979). In vivo studies also have shown an increasing number of activated
macrophages reduces virus replication and delays the onset of MD tumors (Gupta et al.,
1989). These results demonstrate that macrophages play an important role in inhibiting
MDV replication.

MDV Iytic infection, as well as the establishment of latency in lymphocytes,
causes the differential expression of cytokines and other soluble mediators. The up-
regulation of IFN-gamma is one of the first immune responses after MDV infection
(Schat and King, 2000). Some expression of IE, early, and late MDV genes is down-
regulated by IFN-alpha (Volpini et al., 1996). Buscaglia and Calnek demonstrated that
two soluble factors maintained MDV latency in spleen cell culture, but these factors have
not been characterized (Buscaglia and Calnek, 1988). The increased NK cells activities
induced by MDV suggests its role in protection against MDV infection (Lessard et al.,

1996).

3.3.2. Adaptive immune responses
Adaptive immunity to MDV consists of the development of viral antigen-specific

antibodies and cytotoxic T lymphocyte (CTL) responses. During infection, virus-

13

neutralizing antibodies are generated to protect against infection. Antibodies to several
MDV glycoproteins have been demonstrated but only antibodies to MDV gB are believed
to play an important role in MDV protection based on its ability to neutralize MDV
(lkuta et a., 1984; Nazerian et al., 1992). The non-neutralizing antibodies also play a role
in adaptive immunity. Maternal antibodies passed from vaccinated hens or transferred by
injection can reduce the severity of morbidity, mortality, and tumor formation of MD
(Schat and Markowski-Grimsrud, 2000).

The CTL response is of particular importance in immunity to MDV due to its
highly cell-associated nature. Effector cells were characterized as CD4'CD8‘TCR0LBI+
(Omar and Schat, 1997). MDV glycoproteins have been implicated as determinants of
CTL responses. MDV gB was shown to induce a significant CTL response (Omar and
Schat, 1996). The down-regulation of MHC class I on the surface of infected cells by
MDV is involved in the immune evasion of MDV in Iytic infection (Hunt et al., 2001).
This escape from MHC class I may restrict cytotoxicity and facilitate Iytic MDV spread
and the maintenance of latency. The hypothesis of MHC class I down-regulation and
antigen processing blocked by MDV proteins has been pr0posed, but the mechanism of

CTL evasion through MDV proteins is still inclusive.

4. Genetic resistance to MD

Chickens resistant to MD are those that fail to deve10p characteristic symptoms
upon exposure to MDV. Genetics resistance to MD is controlled by multiple genes or
QTL (Schat and Xing, 2000; Vallejo et al., 1998; Yonash et al., 1999). The United States

Department of Agriculture (USDA), Avian Disease and Oncology Laboratory (ADOL),

l4

 

has generated inbred chicken lines selected for resistance and susceptibility to MD since
the 19403. Three of the original lines are presently maintained. These include line 6
which is MD resistant, and lines 7 and 15 which are MD susceptible. Less than 1% of line
6 chickens compared to 76-80% of line 7 chickens were shown to develop MD after
infection with GA or JM strains of MDV (Bacon et al., 2000).

The best understood mechanism for the involvement of genetic resistance to MD
involves the MHC or, as it is known in the chicken, the B complex. The MHC contains
three tightly linked regions known as 8-17 (class 1), 8—0 (class II), and B—L (class IV),
which control cell surface antigens. The B-G locus is expressed in erythrocytes, which
enables convenient typing of blood groups. By measuring the allelic frequency of specific
blood groups, it has been observed that certain B alleles are associated with resistance or
susceptibility. Chickens with the B*2l allele have been found to be more resistant than
those with other B haplotypes (Bacon and Witter, 1994). Other studies have allowed for
the relative ranking of the other B alleles: moderate resistance, B*2, B*6, B*14;
susceptibility, B*l, B*3, B*S, B*13, B*15, B*19, B*27 (Bacon, 1987; Bacon and Witter,
1992) The MHC also influences vaccinal immunity as some haplotypes develop better
protection with vaccines of one serotype than of a different serotype (Bacon and Witter,
1992; 1994).

ADOL lines 6 and 7 chickens share the same MHC, B haplotype, yet differ with
respect to resistance to MD (Lee et al., 1981; Hunt and Fulton, 1998). Thus, non-MHC
factors also play a major role in genetic resistance to MD. Using genetic markers spaced
throughout the chicken genome, 14 QTL (7 significant and 7 suggestive) were discovered

that explain one or more MD-associated traits (Vallejo et al., 1998; Yonash et al., 1999).

15

Also, a few non-MHC genes have been correlated with resistance to MD. The BUl allele
(antigens on bursal lymphocytes) of line 6 was associated with resistance to MD in
progeny of a (6x7)x7 backcross population (Tregaskes et al., 1996; Bacon et al., 2000).
Chicken SCA2 was significantly associated with length of survival and the indicence of
proventricular tumors following MDV challenge in a commercial layer resource
population (Liu et al., 2003). The chicken growth hormone allele is linked with MD QTL
and polymorphism in the growth hormone gene is associated with the number of tissues
with tumors in commercial White Leghorn chickens with the MHC B*2/B*15 genotype
(Liu et al., 2001).

DNA microarrays have been employed to identify candidate genes for QTL and
pathways involved in MD resistance. Host genes that were reproducibly induced by
infection of CEF with MDV included macrophage inflammatory protein (MIP),
interferon response factor 1 (IRFl), interferon-inducible protein, SCA2, MHC class I,
and MHC class 11 (Morgan et al., 2001). To sufficiently resolve the QTL containing the
genes conferring genetic resistance to MD, the expression of genes in peripheral blood
lymphocytes from uninfected and MDV-infected line 6 and line 7 chickens were
analyzed through microarray. The microarray results were refined by genetic mapping of
the differentially-expressed genes. Microarray results showed that up to 25% of the genes
detectable show differential expression between the resistant and susceptible lines.
Integration of microarrays with genetic mapping data was achieved with a sample of 15
genes in which the SCA2, growth hormone, and MHC class I were involved (Liu et al.,
2001). DNA microarrays provided a complementary approach for identifying positional

candidate MD resistant genes. Aside from the the DNA and RNA variation associated

l6

with MD resistance, host and MDV protein interactions associated with MD resistance
were examined through a bacterial two-hybrid system (Niikura et al., 2004). One
example is chicken growth hormone which interacted with MDV SORF2 and combined
with linkage and differential expression, was defined as a MD resistant gene (Liu et al.,
2000). Another putative MD resistant gene is SCA2 which is associated with the genetic
resistance QTL mapping, differentially transcribed between Line 6 and Line 7 following
MDV infection, and interacts with MDV US10 (Liu etal., 2003).

In addition to defining host genes associated with MD resistance, other
alternatives to enhancing MD resistance include the transgenics approach such as RNA
interference to MDV. A successful report of RNA interference that inhibits MDV in vitro

and in vivo has been described (Mo et al., 2008).

5. Stem cell antigen 2 (SCA2; Ly-6E/TSA1)

Chicken SCA2 has been proposed as a MD resistance gene due to the following
criteria: (1) association with MD resistance in a commercial resource population, (2)
transcriptional differences between MD resistant and susceptible experimental chicken
lines following challenge with MDV, and (3) a direct protein interaction with MDV
USlO as determined by a two-hybrid screen followed by an in vitro binding assay. These
potential effects in MD encouraged us to investigate the properties of chicken SCA2 and

its role in MDV infection.

5.1. Lymphocyte complex antigen 6 (Ly-6) family

17

The majority of research on Ly-6 family members has been conducted using mice.
The mouse Ly-6 locus encodes a family of 10-12 kDa proteins are characterized by their
remarkable conservation of cysteine residues and, with few exceptions, are linked to the
cell surface via a g1ycosylphosphatidyl-inositol (GPI) anchor. Ly-6 proteins have a wide
range of functions but, in general, are thought to be involved in cell signaling and cell
adhesion (reviewed in Bamezai, 2004). Ly-6 proteins are broadly expressed in tissues of
hematopoietic stem cells (HSC) origin and, consequently, are often used as differential
markers for developmental stages in these cells (reviewed in Rock et al., 1986; Shevach
et al., 1989; Gumley et al., 1995). Ly—6A.2 (also known as stem cell antigen 1 and T cell-
activating protein) is expressed on the murine stem cells of bone marrow and T cell
lineages, and contributes to regulating HSC renewal and development of progenitor cells
(Uchida et al., 1994; Ito et al., 2003). Ly-6C is expressed on a majority of bone marrow
cells, some subsets of immature T cells and B cells, and was shown to promote
differentiation of B cells into antibody-generating plasma cells (reviewed in Gumley et
al., 1995; Schlueter et al., 1997; McHeyzer—Williams and McHeyzer-Williams, 2004).
Ly-6E (also known as stem cell antigen 2, SCA2; thymic shared antigen 1, TSAl) is
expressed on the majority of immature double negative thymocytes, B cells, and also
expressed in lymphoid epithelial cells (Godfrey et al., 1992; MacNei et al., 1993; Classon
and Coverdale, 1996; Antica et al., 1997; Zammit et al., 2002). Ly-6G is a granulocyte-
differentiation antigen and serves as a marker for identifying mature granulocytes
(Fleming et al., 1993). Ly—6M is expressed on hematopoietic cells (HC), especially

monocytes and myeloid precursors (Patterson et al., 2000).

In the chicken genome, there are 3 annotated genes showing similar molecular
size and conserved cysteine residues with mice Ly-6 genes, but it is not certain whether

these chicken genes belong to the same Ly-6 family.

5.2. Chicken stem cell antigen 2

Chicken SCA2 transcript was first identified through a subtraction cDNA library
of v-Rel (a NF-kappaB family member) — transformed avian bone marrow cells regulated
by a conditional v-Rel estrogen receptor (Petrenko et al., 1997). Bresson-Mazet et al.
reported that SCA2 was involved in the self-renewal of chicken erythroid progenitor
(Bresson-Mazet et al., 2008). But the protein properties of chicken SCA2 were not
defined due to the lack of antibodies to SCA2.

Chicken SCA2 has the 10 cysteine residues conserved among Ly—6 members (Fig. I
1-1), however, it is not known if this chicken homolog has the same biological
characteristics of mice SCA2 (Ly-6E) or other Ly-6 members. While the biological role
of chicken SCA2 protein is not defined, its homologues in the mouse Ly-6 family provide
clues for investigation. Mature mice SCA2 is a cell surface protein of 82 amino acids
anchored on the cell membrane by a C-terminal GPI moiety; highly expressed in
immature T cells, bone marrow cells, and peripheral B cells, with low levels in peripheral
mature T cells. SCA2 is implicated in regulating intracellular signaling events via TCR
and cell-cell adhesion as a receptor on the lymphocyte membrane. The ability of anti-
SCA2 mAb to block thymopoiesis in fetal thymic organ culture indicates that SCA2
functions in T cell development (Randle et al., 1993). Fleming and Malek (1994)

demonstrated that anti-SCA2 mAb inhibited anti-CD3-induced interleukin 2 (IL-2)

production and this inhibition is independent on the GPI anchor (Fleming and Malek,
1994. This finding was further supported by Kosugi et al. (1994). Saitoh et a1. (1995)
demonstrated that SCA2 plays an important role in the TCR signaling pathway in that the
tyrosine phosphrylation of CD3§-chains following TCR stimulation was reduced by anti-
SCA2 mAb. Anti-TCR/CD3-induced T cell apoptosis was blocked by anti-SCA2 mAb,
which confirmed the function of SCA2 through the TCR signaling pathway (Noda et al.,
1996), and the physical interaction between SCA2 and CD3 may clarify their functional
interaction (Kosugi et al., 1998). Aside from lymphocytes, SCA2 is also expressed in
other tissues, including the embryonic adrenal gland and liver and adult kidney and liver
and in various epithelial cells (MacNeil et al., 1993; Classon and Coverdale, 1996).
SCA2 deficient (SCA2-/-) mice exhibited abnormal development, impaired function of
the embryonic adrenal gland and midgestational lethality at embryonic day 15 due to the
cardiac abnormalities, but the lymphoid development is not impaired, suggesting SCA2 is
not an obligate requirement for normal differentiation of lymphocytes (Zammit et al.,
2002).

One common expression pattern of SCA2 shared within different species is that
SCA2 transcripts are overexpressed in malignant cells which suggest it may play role in
tumorigenesis (Eshel et al., 1995; Petrenko et al., 1997; He and Chang, 2004; Darniola et

al., 2004).

20

5.8 57mm rmméfifiznmmqmnel--mimeéoméiomifiémo?mx<xzzrmr3lmenzHmmZerQx<z<5mEOmormz
22.8 57mm rom<mm<m<3mammei-->Smx>moman>ozHm5momom-xx_.§_~omrmnt-mn>l-m<3xo_uz:~m3mmmmormz
23.8 8% rom<znez3>lomx7--><znmmo_ue>m_.:x> ......... orofizxmzxmmxmzmzofiawrxmzlmrqéxxermz

ninxm: mn>~ Smnmnmc>mmzz>m5n<l-xgmzmmzm<j<<m<3n-mxmmommemmmglmnmut-->aHz..mH>>>m<<Eom_urmz

Ewan 7—. 3.08m: mascasoom cm 0328: m0>~ 2:: soaoamocm 38o Era 335. 303603.
.38 8:328 Seam: 839.3 30 38.on 3. Ba.

2]

6. Avian lymphoid tissues

Avian lymphoid tissues include the bursa of Fabricius, thymus, spleen, and other
tissues including bone marrow and blood system. The avian bursa of Fabricius is the site
for hematopoiesis, B lymphocyte differentiation and proliferation, and lies between the
cloaca and the sacrum. The avian thymus is where T lymphocytes differentiate and
proliferate, and lies parallel to the vagus nerve and internal jugular veins on each side of
the neck where there are 7-8 separate lobes. The spleen is not a primary site for
lymphocyte antigen-independent differentiation and proliferation but has an important
role in embryonic lymphopoiesis (Olah et al., 2008). Here we only discuss the structure

of bursa and thymus as these are the organs where SCA2 may potentially function.

6.1. Avian bursa of Fabricius

The bursa is unique to birds and has a critical role in development of antibody
responses. The bursa is an epithelial and lymphoid organ, and contains 15-20 longitudinal
folds in the lumen. The bursal folds are filled with hundreds of bursal follicles. Each
bursal follicle consists of a medulla and cortex with the supporting epithelium cells
between the medulla and the cortex. The cellular composition of the medulla consists of
epithelial cells and blood-bome HC including dendritic cells, lymphoid cells, and
macrophages. The cortex is separated from the medulla by the cortico—medullary
epithelial cells (CMEC). Once the cortical and medullary regions have been separated,
bursal B cell proliferation continues in the cortex but the rate of cell division in the

medulla is reduced more than 10 fold (Reynolds, 1987). This result suggests that

22

medullary and cortical regions have functional as well as structural differences (Ratcliffe,
2008).

The function of the CMEC in bursa follicles is not understood but it is suggested
to have a kind of “nursing “or regulatory function for B cell development. The murine
Notch 1 plays important roles in T and B lymphocyte development (reviewed in Schmitt
and Zuniga-Pflucker, 2006). The avian Notch ligand, Serrate2, is expressed exclusively
in the CMEC and is suggested to regulate B cell differentiation by association with Notch
displayed on the B cells (Morimura, et al., 2001). Ram et al., (1991) suggested that the
CMEC represent a macrophage subpopulation. The CMEC express neither B cell antigen
nor dendritic cell antigen and are resistance to infectious bursal disease virus (Ramm et

aL,199l)

6.2. Avian thymus

The avian thymus lies parallel to the vagus nerve and internal jugular veins. The
avian thymus begins to develop as an epithelial outgrowth of the pharyngeal pouches at
the age of 5 days of embryonic development, and the thymic epithelium begins to attract
blood-bome HC at embryonic incubation days (BID) 6. 12 and 18 (Coltey et al., 1989).
At these stages, some molecules expressed on the surface of the bone marrow T cell
progenitor have been identified, including MHC class II, c-kit, and aIIB3integrin (Ody et
al., 2000). During embroyonic development, the thymic mass gradually increases with
colonization of HSC and results in the appearance of the medulla. Blood-bome HC
invade the epithelial analage of the thymus, and immature and proliferating T

lymphocytes are present in the subcapsular zone from where they migrate to the medulla

during T cell maturation. The cortex and medulla are established by EID 12 and stromal
epithelial cells form a network containing lymphoid cells (Coltey et al., 1987). In the
thymic cortex, the epithelial reticular cells (ERC) are densely packed with thymocytes
and may have a nursing function (Rieker et al., 1995). The development of the T cell
lineage was traced using mAb recognizing different chains of the T cell receptor (TCR).
At EID 12, a subpopulation of thymocytes begins to express the ySTCR-CD3 complex
(TCR"'1) on the thymoctye surface (Sowder et al., 1988). The expression patterns of
TCR+2 and TCR+3 are similar to mammalian aBTCR cells where the dual expression of
the CD4 and CD8 molecules are on the surface of both of TCR+2 and TCR+3 cortical
thymocytes (Coltey et al., 1989). These CD4+CD8+ double-positive cells mature to
become either single positive CD4+ or CD8+ T cells (Davidson and Boyd, 1992). The
histological structure in the thymic medulla is an epithelial cell aggregation but it is not
certain if they are actual epithelial cells or stages of differentiation of lympoid cells, and
their functional significance is not known, but an endocrine function has been suggested
(Isler, 1976; Audhya et al., 1986; Watanabe et al., 2005). The cortico-medullary border
contains a dendritic cell barrier expressing the MHC class II and a large number of
peroxidase-positive cells, which may play a role in the negative selection of T cells

(Guillemot et al., 1984).

24

References

l.

10.

ll.

12.

13.

Anderson, A. S., A. Francesooni, and R. W. Morgan. 1992. Complete
nucleotide sequence of the Marek's disease virus ICP4 gene. Virology 189:657-67.

Antica, M., L. Wu, and R. Scollay. 1997. Stem cell antigen 2 expression in adult
and developing mice. Immunol Lett 55:47-51.

Audhya, T., D. Kroon, G. Heavner, G. Viamontes, and G. Goldstein. 1986.
Tripeptide structure of bursin, a selective B-cell-differentiating hormone of the
bursa of fabricius. Science 231:997-9.

Bacon, L. D. 1987. Influence of the major histocompatibility complex on disease
resistance and productivity. Poult Sci 66:802-11.

Bacon, L. D., Hunt, H.D., and Cheng, H.H. 2000. Genetic resistance to Marek's
Disease, p. 121-142. In K. Hirai (ed.), Mareks' Disease. Springer, Berlin.

Bacon, L. D., and R. L. Witter. 1992. Influence of turkey herpesvirus
vaccination on the B-haplotype effect on Marek's disease resistance in 15.8-
congenic chickens. Avian Dis 36:378-85.

Bacon, L. D., and R. L. Witter. 1994. B haplotype influence on the relative
efficacy of Marek's disease vaccines in commercial chickens. Poult Sci 73:481-7.

Bamezai, A. 2004. Mouse Ly—6 proteins and their extended family: markers of
cell differentiation and regulators of cell signaling. Arch Immunol Ther Exp
(Warsz) 52:255-66.

Biggs, P. M. 2000. The History and Biology of Marek's Disease Virus, p. 1-24. In
K. Hirai (ed.), Marek's Disease. Springer, Berlin.

Bresson-Mazet, C., O. Gandrillon, and S. Gonin-Giraud. 2008. Stem cell
antigen 2: a new gene involved in the self-renewal of erythroid progenitors. Cell
Prolif 41:726-38.

Brown, A. C., L. P. Smith, L. Kgosana, S. J. Baigent, V. Nair, and M. J.
Allday. 2009. Homodimerization of the Meq viral oncoprotein is necessary for
the inductidn of T cell lymphoma by Marek's disease virus (MDV). J Virol.

Brown, S. M., and J. Harland. 1987. Three mutants of herpes simplex virus type
2: one lacking the genes U810, U811 and USl2 and two in which Rs has been
extended by 6 kb to 0.91 map units with loss of Us sequences between 0.94 and
the Us/TRs junction. J Gen Virol 68 (Pt 1): 1-18.

Burnside, J ., E. Bernberg, A. Anderson, C. Lu, B. C. Meyers, P. J. Green, N.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

Jain, G. Isaacs, and R. W. Morgan. 2006. Marek's disease virus encodes
MicroRNAs that map to meq and the latency-associated transcript. J Virol
80:8778-86.

Buscaglia, C., and B. W. Calnek. 1988. Maintenance of Marek's disease
herpesvirus latency in vitro by a factor found in conditioned medium. J Gen Virol
69 ( Pt 11):2809-18.

Calnek, B. W. 2000. Pathogenesis of Marek's disease, p. 25-55. In K. Hirai (ed.),
Marek's Disease. Springer, Berlin.

Campadelli-Fiume, G., and B. Roizman. 2006. The egress of herpesviruses
from cells: the unanswered questions. J Vir0180:6716-7; author replies 6717-9.

Cantello, J. L., A. S. Anderson, and R. W. Morgan. 1994. Identification of
latency-associated transcripts that map antisense to the ICP4 homolog gene of
Marek's disease virus. J Virol 68:6280-90.

Cantello, J. L., M. S. Parcells, A. S. Anderson, and R. W. Morgan. 1997.
Marek's disease virus latency-associated transcripts belong to a family of spliced
RNAs that are antisense to the ICP4 homolog gene. J Virol 71:1353-61.

Chattoo, J. P., M. P. Stevens, and V. Nair. 2006. Rapid identification of non-
essential genes for in vitro replication of Marek's disease virus by random
transposon mutagenesis. J Virol Methods 135:288-91.

Chen, M., W. S. Payne, H. Hunt, H. Zhang, S. L. Holmen, and J. B. Dodgson.
2008. Inhibition of Marek's disease virus replication by retroviral vector-based
RNA interference. Virology 377:265-72.

Churchill, A. E., and P. M. Biggs. 1967. Agent of Marek's disease in tissue
culture. Nature 215:528-30.

Classon, B. J., and R. L. Boyd. 1998. Thymic-shared antigen-1 (TSA-l). A
lymphostromal cell membrane Ly—6 superfamily molecule with a putative role in
cellular adhesion. Dev Immunol 6: 149-56.

Classon, B. J., and L. Coverdale. 1994. Mouse stem cell antigen Sea-2 is a
member of the Ly-6 family of cell surface proteins. Proc Natl Acad Sci U S A
91:5296-300.

Classon, B. J ., and L. Coverdale. 1996. Genomic organization and expression of
mouse thymic shared antigen-1 (TSA-l): evidence for a processed pseudogene.

Immunogenetics 44:222-6.

Coltey, M., R. P. Bucy, C. H. Chen, J. Cihak, U. Losch, D. Char, N. M. Le

26

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

36.

Douarin, and M. D. Cooper. 1989. Analysis of the first two waves of thymus
homing stem cells and their T cell progeny in chick-quail chimeras. J Exp Med
170:543-57.

Coltey, M., F. V. Jotereau, and N. M. Le Douarin. 1987. Evidence for a cyclic
renewal of lymphocyte precursor cells in the embryonic chick thymus. Cell Differ
22:71-82.

Compel, P., and N. A. DeLuca. 2003. Temperature-dependent conformational
changes in herpes simplex virus ICP4 that affect transcription activation. J Virol
77 :3257-68.

Damiola, F., C. Keime, S. Gonin-Giraud, S. Dazy, and O. Gandrillon. 2004.
Global transcription analysis of immature avian erythrocytic progenitors: from
self-renewal to differentiation. Oncogene 23:7628-43.

Davidson, N. J., and R. L. Boyd. 1992. Delineation of chicken thymocytes by
CD3-TCR complex, CD4 and CD8 antigen expression reveals phylogenically
conserved and novel thymocyte subsets. Int Immunol4:1175-82.

Davison, A. J., and J. E. Scott. 1986. The complete DNA sequence of varicella-
zoster virus. J Gen Virol 67 ( Pt 9): 1759-816.

Denesvre, C., C. Blondeau, M. Lemesle, Y. Le Vern, D. Vautherot, P.
Roingeard, and J. F. Vautherot. 2007. Morphogenesis of a highly replicative
EGFPVP22 recombinant Marek‘s disease virus in cell culture. J Virol 81:12348-
59.

Dorange, F., B. K. Tischer, J. F. Vautherot, and N. Osterrieder. 2002.
Characterization of Marek's disease virus serotype 1 (MDV-1) deletion mutants
that lack UL46 to U149 genes: MDV-l UL49, encoding VP22, is indispensable
for virus growth. J Virol 76:1959-70.

Endoh, D. 1996. Enhancement of gene expression by Marek's disease virus
homologue of the herpes simplex virus-1 ICP4. Jpn J Vet Res 44:136-7.

Eshel, R., M. Firon, B. Z. Katz, O. Sagi-Assif, H. Aviram, and I. P. Witz.
1995. Microenvironmental factors regulate Ly-6 A/E expression on PyV-
transforrned BALB/c 3T3 cells. Immunol Lett 44:209-12.

Feng, P., D. N. Everly, Jr., and G. S. Read. 2001. mRNA decay during
herpesvirus infections: interaction between a putative viral nuclease and a cellular
translation factor. J Virol 75: 10272-80.

Feng, P., D. N. Everly, Jr., and G. S. Read. 2005. mRNA decay during herpes
simplex virus (HSV) infections: protein-protein interactions involving the HSV

27

37.

38.

39.

40.

41.

42.

43.

45.

46.

47.

virion host shutoff protein and translation factors eIF4H and eIF4A. J Virol
79:9651-64.

Fleming, T. J., M. L. Fleming, and T. R. Malek. 1993. Selective expression of
Ly-6G on myeloid lineage cells in mouse bone marrow. RB6-8C5 mAb to

granulocyte-differentiation antigen (Gr—1) detects members of the Ly-6 family. J
Immunol 151:2399-408.

Fleming, T. J., and T. R. Malek. 1994. Multiple g1ycosylphosphatidylinositol-
anchored Ly-6 molecules and transmembrane Ly-6E mediate inhibition of IL-2
production. J Immunol 153:1955-62.

Gimeno, 1., and R. F. Silva. 2008. Deletion of the Marek’s disease virus UL41
gene (vhs) has no measurable effect on latency or pathogenesis. Virus Genes
36:499-507.

Godfrey, D. I., M. Masciantonio, C. L. Tucek, M. A. Malin, R. L. Boyd, and
P. Hugo. 1992. Thymic shared antigen-l. A novel thymocyte marker
discriminating immature from mature thymocyte subsets. J Immunol 148:2006-11.

Guillemot, F. P., P. D. Oliver, B. M. Peault, and N. M. Le Douarin. I984.
Cells expressing Ia antigens in the avian thymus. J Exp Med 160:1803-19.

Gumley, T. P., I. F. McKenzie, and M. S. Sandrin. 1995. Tissue expression,
structure and function of the murine Ly-6 family of molecules. Immunol Cell Biol
73:277-96.

Gupta, M. K., H. V. Chauhan, G. J. Jha, and K. K. Singh. 1989. The role of
the reticuloendothelial system in the immunopathology of Marek's disease. Vet
Microbiol 20:223-34.

He, J., and L. J. Chang. 2004. Functional characterization of hepatoma-specific
stem cell antigen-2. Mol Carcinog 40:90-103.

Hunt, H. D., and J. E. Fulton. 1998. Analysis of polymorphisms in the major
expressed class I locus (B-FIV) of the chicken. Immunogenetics 47 :456-67.

Hunt, H. D., B. Lupiani, M. M. Miller, I. Gimeno, L. F. Lee, and M. S.
Parcells. 2001. Marek's disease virus down-regulates surface expression of MHC
(B Complex) Class 1 (BF) glyc0proteins during active but not latent infection of
chicken cells. Virology 282:198-205.

Ikuta, K., S. Ueda, S. Kato, and K. Hirai. 1984. Identification with monoclonal

antibodies of glycoproteins of Marek's disease virus and herpesvirus of turkeys
related to virus neutralization. J Virol 49:1014-7.

28

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

58.

59.

Isler, H. 1976. Fine structure of chicken thymic epithelial vesicles. J Cell Sci
20:135-47.

Ito, C. Y., C. Y. Li, A. Bernstein, J. E. Dick, and W. L. Stanford. 2003.
Hematopoietic stem cell and progenitor defects in Sca—l/Ly-6A-null mice. Blood
101:517-23.

Johnson, D. C., and M. T. Huber. 2002. Directed egress of animal viruses
promotes cell-to-cell spread. J Virol 76:1-8.

Jones, D., L. Lee, J. L. Liu, H. J. Kung, and J. K. Tillotson. 1992. Marek
disease virus encodes a basic-leucine zipper gene resembling the fos/jun
oncogenes that is highly expressed in lymphoblastoid tumors. Proc Natl Acad Sci
U S A 89:4042-6.

Jones, F. E., C. A. Smibert, and J. R. Smiley. 1995. Mutational analysis of the
herpes simplex virus virion host shutoff protein: evidence that vhs functions in the

absence of other viral proteins. J Virol 69:4863-71.

Koppers-Lalic, D., F. A. Rijsewijk, S. B. Verschuren, J. A. van Gaans-Van
den Brink, A. Neisig, M. E. Ressing, J. Neefjes, and E. J. Wiertz. 2001. The
UL41-encoded virion host shutoff (vhs) protein and vhs-independent mechanisms
are responsible for down-regulation of MHC class I molecules by bovine
herpesvirus 1. J Gen Virol 82:2071-81.

Kosugi, A., S. Saitoh, S. Narumiya, K. Miyake, and T. Hamaoka. 1994.
Activation-induced expression of thymic shared antigen-1 on T lymphocytes and
its inhibitory role for TCR-mediated H.-2 production. Int Immunol 6:1967-76.

Kosugi, A., S. Saitoh, S. Noda, K. Miyake, Y. Yamashita, M. Kimoto, M.
Ogata, and T. Hamaoka. 1998. Physical and functional association between
thymic shared antigen-l/stem cell antigen-2 and the T cell receptor complex. J
Biol Chem 273: 12301-6.

Kwong, A. D., and N. Frenkel. 1987. Herpes simplex virus-infected cells contain
a function(s) that destabilizes both host and viral mRNAs. Proc Natl Acad Sci U S
A 84: 1926-30.

Kwong, A. D., J. A. Kruper, and N. Frenkel. 1988. Herpes simplex virus virion
host shutoff function. J Virol 62:912-21.

Lee, L. F. 1979. Macrophage restriction of Marek's disease virus replication and
lymphoma cell proliferation. J Immunol 123: 1088-91.

Lee, L. F., B. Lupiani, R. F. Silva, H. J. Kung, and S. M. Reddy. 2008.
Recombinant Marek's disease virus (MDV) lacking the Meq oncogene confers

29

60.

61.

62.

63.

65.

66.

67.

68.

69.

protection against challenge with a very virulent plus strain of MDV. Vaccine
26:1887-92.

Lee, L. F., P. C. Powell, M. Rennie, L. J. Ross, and L. N. Payne. 1981. Nature
of genetic resistance to Marek's disease in chickens. J Natl Cancer Inst 66:789-96.

Lessard, M., D. L. Hutchings, J. L. Spencer, H. S. Lillehoj, and J. S. Gavora.
1996. Influence of Marek's disease virus strain AC-l on cellular immunity in
birds carrying endogenous viral genes. Avian Dis 40:645-53.

Levy, A. M., O. Gilad, L. Xia, Y. Izumiya, J. Choi, A. Tsalenko, Z. Yakhini,
R. Witter, L. Lee, C. J. Cardona, and H. J. Kung. 2005. Marek's disease virus
Meq transforms chicken cells via the v-Jun transcriptional cascade: a converging

transforming pathway for avian oncoviruses. Proc Natl Acad Sci U S A
102:14831-6.

Li, D., G. O'Sullivan, L. Greenall, G. Smith, C. Jiang, and N. Ross. 1998.
Further characterization of the latency-associated transcription unit of Marek's
disease virus. Arch Virol 143:295-311.

Liu, H. C., H. H. Cheng, V. Tirunagaru, L. Sofer, and J. Burnside. 2001. A
strategy to identify positional candidate genes conferring Marek's disease

resistance by integrating DNA microarrays and genetic mapping. Anim Genet
32:351-9.

Liu, H. C., H. J. Kung, J. E. Fulton, R. W. Morgan, and H. H. Cheng. 2001.
Growth hormone interacts with the Marek's disease virus SORF2 protein and is
associated with disease resistance in chicken. Proc Natl Acad Sci U S A 98:9203-
8. '

Liu, H. C., M. Niikura, J. E. Fulton, and H. H. Cheng. 2003. Identification of
chicken lymphocyte antigen 6 complex, locus E (LY6E, alias SCA2) as a putative
Marek's disease resistance gene via a virus-host protein interaction screen.
Cytogenet Genome Res 102:304-8.

Liu, J. L., Y. Ye, Z. Qian, Y. Qian, D. J. Templeton, L. F. Lee, and H. J.
Kung. 1999. Functional interactions between herpesvirus oncoprotein MEQ and
cell cycle regulator CDK2. J Virol 73:4208-19.

Lupiani, B., Lee, LE, and Reddy, S.M. 2000. Protein-coding content of the
sequence of Marek's disease virus serotype-1., p. 159-190. In K. Hirai (ed.),
Marek's disease. Springer, Berlin.

MacNeil, I., J. Kennedy, D. I. Godfrey, N. A. Jenkins, M. Masciantonio, C.
Mineo, D. J. Gilbert, N. G. Copeland, R. L. Boyd, and A. Zlotnik. 1993.
Isolation of a cDNA encoding thymic shared antigen-1. A new member of the

30

70.

71.

72.

73.

74.

75.

76.

77.

78.

79.

80.

81.

Ly6 family with a possible role in T cell development. J Immunol 151:6913-23.

Marek, J. 1907. Mutiple nervenentzundung(Polyneuritis) bei Huhnem. Dtsch.
Tierarztl. Wschr. 15:417-421.

McHeyzer-Williams, L. J., and M. G. McHeyzer-Williams. 2004.
Developmentally distinct Th cells control plasma cell production in vivo.
Immunity 20:231-42.

Mettenleiter, T. C. 2002. Herpesvirus assembly and egress. J Virol 76:1537-47.

Morgan, R. W., L. Sofer, A. S. Anderson, E. L. Bernberg, J. Cui, and J.
Burnside. 2001. Induction of host gene expression following infection of chicken
embryo fibroblasts with oncogenic Marek's disease virus. J Virol 75:533-9.

Morimura, T., S. Miyatani, D. Kitamura, and R. Goitsuka. 2001. Notch
signaling suppresses IgH gene expression in chicken B cells: implication in

spatially restricted expression of Serrate2/Notch1 in the bursa of Fabricius. J
Immunol 166:3277-83.

Murphy. J. A., R. J. Duerst, T. J. Smith, and L. A. Morrison. 2003. Herpes
simplex virus type 2 virion host shutoff protein regulates alpha/beta interferon but
not adaptive immune responses during primary infection in vivo. J Virol 77:9337-
45.

Nair, V. 2005. Evolution of Marek's disease -- a paradigm for incessant race
between the pathogen and the host. Vet J 170:175-83.

Nazerian, K., L. F. Lee, N. Yanagida, and R. Ogawa. 1992. Protection against
Marek's disease by a fowlpox virus recombinant expressing the glycoprotein B of
Marek's disease virus. J Virol 66: 1409-13.

Nazerian, K., J. J. Solomon, R. L. Witter, and B. R. Burmester. 1968. Studies
on the etiology of Marek's disease. H. Finding of a herpesvirus in cell culture.
Proc Soc Exp Biol Med 127:177-82.

Niikura, M., J. Dodgson, and H. Cheng. 2006. Direct evidence of host genome
acquisition by the alphaherpesvirus Marek's disease virus. Arch Virol 151:537-49.

Niikura, M., H. C. Liu, J. B. Dodgson, and H. H. Cheng. 2004. A
comprehensive screen for chicken proteins that interact with proteins unique to
virulent strains of Marek's disease virus. Poult Sci 83:1117-23.

Noda, S., A. Kosugi, S. Saitoh, S. Narumiya, and T. Hamaoka. 1996.
Protection from anti-TCR/CD3-induced apoptosis in immature thymocytes by a
signal through thymic shared antigen-l/stem cell antigen-2. J Exp Med 183:2355-

3|

82.

83.

84.

85.

86.

87.

88.

89.

90.

91.

92.

93.

60.

Ody, C., S. Alais, C. Corbel, K. M. McNagny, T. F. Davison, O. Vainio, B. A.
Imhof, and D. Dunon. 2000. Surface molecules involved in avian T-cell
progenitor migration and differentiation. Dev Immunol 7 :267-77.

Olah, I. a. V., L. 2008. Structure of the avian lymphoid system, p. 13-50. In F.
Davison (ed.), Avian Immunology. Elsevier, London.

Omar, A. R., and K. A. Schat. 1996. Syngeneic Marek's disease virus (MDV)-
specific cell-mediated immune responses against immediate early, late, and
unique MDV proteins. Virology 222:87-99.

Omar, A. R., and K. A. Schat. 1997. Characterization of Marek's disease
herpesvirus-specific cytotoxic T lymphocytes in chickens inoculated with a non-
oncogenic vaccine strain of MDV. Immunology 90:579-85.

Oroskar, A. A., and G. S. Read. 1987. A mutant of herpes simplex virus type 1
exhibits increased stability of immediate-early (alpha) mRNAs. J Virol 61:604-6.

Osterrieder, N., J. P. Kamil, D. Schumacher, B. K. Tischer, and S. Trapp.
2006. Marek's disease virus: from rniasma to model. Nat Rev Microbiol 4:283-94.
Pak, A. S., D. N. Everly, K. Knight, and G. S. Read. 1995. The virion host
shutoff protein of herpes simplex virus inhibits reporter gene expression in the
absence of other viral gene products. Virology 211:491-506.

Parcells, M. S., A. S. Anderson, J. L. Cantello, and R. W. Morgan. 1994.
Characterization of Marek's disease virus insertion and deletion mutants that lack
USl (ICP22 homolog), U810, and/or US2 and neighboring short-component open
reading frames. J Virol 68:8239-53.

Parcells, M. S., A. S. Anderson, and T. W. Morgan. 1995. Retention of
oncogenicity by a Marek's disease virus mutant lacking six unique short region
genes. J Virol 69:7888-98.

Patterson, J. M., M. H. Johnson, D. B. Zimonjic, and T. A. Graubert. 2000.
Characterization of Ly-6M, a novel member of the Ly-6 family of hematopoietic
proteins. Blood 95:3125-32.

Petrenko, 0., I. Ischenko, and P. J. Enrietto. 1997. Characterization of changes
in gene expression associated with malignant transformation by the NF-kappaB
family member, v-Rel. Oncogene 15:1671-80.

Ramm, H. C., T. J. Wilson, R. L. Boyd, H. A. Ward, K. Mitrangas, and K. J.
Fahey. 1991. The effect of infectious bursal disease virus on B lymphocytes and
bursal stromal components in specific pathogen-free (SPF) White Leghorn

32

94.

95.

96.

97.

98.

99.

100.

101.

102.

103.

104.

chickens. Dev Comp Immunol 15:369-81.

Ramm, H. C., T. J. Wilson, R. L. Boyd, H. A. Ward, K. Mitrangas, and K. J.
Fahey. 1991. The effect of infectious bursal disease virus on B lymphocytes and
bursal stromal components in specific pathogen-free (SPF) White Leghorn
chickens. Dev Comp Immunol 15:369-81.

Randle, E. S., G. A. Waanders, M. Masciantonio, D. I. Godfrey, and R. L.
Boyd. 1993. A lymphostromal molecule, thymic shared Ag-l, regulates early
thymocyte development in fetal thymus organ culture. J Immunol 151:6027-35.

Ratcliffe, M. 2008. B cells, the bursa of Fabricius and the generation of antibody
repertoires., p. 67-90. In F. Davison (ed.), Avian Immunology. Elsevier, London.

Read, G. S., and N. Frenkel. 1983. Herpes simplex virus mutants defective in
the virion-associated shutoff of host polypeptide synthesis and exhibiting
abnormal synthesis of alpha (immediate early) viral polypeptides. J Virol 46:498-
512.

Reynaud, C. A., V. Anquez, H. Grimal, and J. C. Weill. 1987. A
hyperconversion mechanism generates the chicken light chain preimmune
repertoire. Cell 48:379-88.

Rieker, T., J. Penninger, N. Romani, and G. Wick. 1995. Chicken thymic nurse
cells: an overview. Dev Comp Immunol 19:281-9.

Rock, K. L., H. Reiser, A. Bamezai, J. McGrew, and B. Benacerraf. 1989. The
LY-6 locus: a multigene family encoding phosphatidylinositol-anchored
membrane proteins concerned with T-cell activation. Immunol Rev 111:195-224.

Roizmann, B., R. C. Dosrosiers, B. Fleckenstein, C. Lopez, A. C. Minson, and
M. J. Studdert. 1992. The family Herpesviridae: an update. The Herpesvirus
Study Group of the International Committee on Taxonomy of Viruses. Arch Virol
123:425-49.

Sakaguchi, M., T. Urakawa, Y. Hirayama, N. Miki, M. Yamamoto, and K.
Hirai. 1992. Sequence determination and genetic content of an 8.9-kb restriction
fragment in the short unique region and the internal inverted repeat of Marek's
disease virus type 1 DNA. Virus Genes 6:365-78.

Schat, K. A., and Z. Xing. 2000. Specific and nonspecific immune responses to
Marek's disease virus. Dev Comp Immunol 24:201-21.

Schat, K. A. a. M.-G., C. J. 2000. Immune Responses to Marek's Disease Virus
Infection. In K. Hirai (ed.), Marek‘s Disease. Springer, Berlin.

33

105.

106.

107.

108.

109.

110.

111.

112.

113.

114.

115.

116.

Schek, N., and S. L. Bachenheimer. 1985. Degradation of cellular mRNAs
induced by a virion-associated factor during herpes simplex virus infection of
Vero cells. J Virol 55:601-10.

Schlueter, A. J., T. R. Malek, C. N. Hostetler, P. A. Smith, P. deVries, and T.
J. Waldschmidt. 1997. Distribution of Ly-6C on lymphocyte subsets: 1. Influence
of allotype on T lymphocyte expression. J Immunol 158:4211-22.

Schmitt, T. M., and J. C. Zuniga-Pflucker. 2006. T-cell deveIOpment, doing it
in a dish. Immunol Rev 209:95-102.

Schumacher, D., B. K. Tischer, W. Fuchs, and N. Osterrieder. 2000.
Reconstitution of Marek's disease virus serotype 1 (MDV-1) from DNA cloned as

a bacterial artificial chromosome and characterization of a glycoprotein B-
negative MDV-l mutant. J Virol 74:11088-98.

Schumacher, D., B. K. Tischer, S. M. Reddy, and N. Osterrieder. 2001.
Glycoproteins E and I of Marek‘s disease virus serotype 1 are essential for virus
growth in cultured cells. J Virol 75: 1 1307-18.

Shamblin, C. E., N. Greene, V. Arumugaswami, R. L. Dienglewicz, and M. S.
Parcells. 2004. Comparative analysis of Marek's disease virus (MDV)
glyc0protein-, Iytic antigen pp38- and transformation antigen Meq-encoding

genes: association of meq mutations with MDVs of high virulence. Vet Microbiol
102: 147-67.

Shevach, E. M., and P. E. Korty. 1989. Ly-6: a multigene family in search of a
function. Immunol Today 10:195-200.

Silva, R. F. 2000. The Genome Structure of Marek‘s Disease Virus, p. 143-158.
In K. Hirai (ed.), Marek's Disease. Springer, Berlin.

Smith, T. J., L. A. Morrison, and D. A. Leib. 2002. Pathogenesis of herpes
simplex virus type 2 virion host shutoff (vhs) mutants. J Virol 76:2054—61.

Solomon, J. J., R. L. Witter, K. Nazerian, and B. R. Burmester. 1968. Studies
on the etiology of Marek's disease. I. Propagation of the agent in cell culture. Proc
Soc Exp Biol Med 127:173-7.

Sowder, J. T., C. L. Chen, L. L. Ager, M. M. Chan, and M. D. Cooper. 1988.
A large subpopulation of avian T cells express a homologue of the mammalian T
gamma/delta receptor. J Exp Med 167:315-22.

Strelow, L., T. Smith, and D. Leib. 1997. The virion host shutoff function of

herpes simplex virus type 1 plays a role in corneal invasion and functions
independently of the cell cycle. Virology 231:28-34.

34

117.

118.

119.

1 20.

121.

122.

123.

124.

125.

126.

127.

Strelow, L. 1., and D. A. Leib. 1995. Role of the virion host shutoff (vhs) of
herpes simplex virus type 1 in latency and pathogenesis. J Virol 69:6779-86.

Su, Y. H., X. Zhang, X. Wang, N. W. Fraser, and T. M. Block. 2006. Evidence
that the immediate-early gene product ICP4 is necessary for the genome of the
herpes simplex virus type 1 ICP4 deletion mutant strain d120 to circularize in
infected cells. J Virol 80:11589-97.

Sugimoto, K., M. Uema, H. Sagara, M. Tanaka, T. Sata, Y. Hashimoto, and
Y. Kawaguchi. 2008. Simultaneous tracking of capsid, tegument, and envelope
protein localization in living cells infected with triply fluorescent herpes simplex
virus 1. J Vir0182:5198-211.

Suzutani, T., M. Nagamine, T. Shibaki, M. Ogasawara, I. Yoshida, T.
Daikoku, Y. Nishiyama, and M. Azuma. 2000. The role of the U14] gene of
herpes simplex virus type 1 in evasion of non-specific host defence mechanisms
during primary infection. J Gen Vir0181:1763-71.

Taddeo, B., and B. Roizman. 2006. The virion host shutoff protein (UIAI) of
herpes simplex virus 1 is an endoribonuclease with a substrate specificity similar
to that of RNase A. J Virol 80:9341-5.

Taddeo, B., M. T. Sciortino, W. Zhang, and B. Roizman. 2007 . Interaction of
herpes simplex virus RNase with VP16 and VP22 is required for the accumulation
of the protein but not for accumulation of mRNA. Proc Natl Acad Sci U S A
104:12163-8.

Tregaskes, C. A., N. Bumstead, T. F. Davison, and J. R. Young. 1996.
Chicken B-cell marker chB6 (Bu-1) is a highly glycosylated protein of unique
structure. Immunogenetics 44:212-7.

Uchida, N., H. L. Aguila, W. H. Fleming, L. Jerabek, and I. L. Weissman.
1994. Rapid and sustained hematopoietic recovery in lethally irradiated mice
transplanted with purified Thy-1.110 Lin-Sca-1+ hematopoietic stem cells. Blood
83:3758-79.

Vallejo, R. L., L. D. Bacon, H. C. Liu, R. L. Witter, M. A. Groenen, J. Hillel,
and H. H. Cheng. 1998. Genetic mapping of quantitative trait loci affecting
susceptibility to Marek's disease virus induced tumors in F2 intercross chickens.
Genetics 148:349-60.

Venugopal, K., and L. N. Payne. 1995. Molecular pathogenesis of Marek's
disease-recent developments. Avian Pathol 24:597-609.

Volpini, L. M., B. W. Calnek, B. Sneath, M. J. Sekellick, and P. 1. Marcus.

35

128.

129.

l 30.

131.

132.

133.

l 34.

135.

1996. Interferon modulation of Marek's disease virus genome expression in
chicken cell lines. Avian Dis 40:78-87.

Watanabe, N., Y. H. Wang, H. K. Lee, T. Ito, W. Cao, and Y. J. Liu. 2005.

Hassall's corpuscles instruct dendritic cells to induce CD4+CD25+ regulatory T
cells in human thymus. Nature 436:1181-5.

Witter, R. L. 1997. Increased virulence of Marek’s disease virus field isolates.
Avian Dis 41:149-63.

Witter, R. L. and Kreager, K. S. 2004. Serotype 1 viruses modified by
backpassage or insertional mutagenesis: approaching the threshold of vaccine
efficacy in Marek’s disease. Avian Dis 48: 149-163.

Xie, Q., A. S. Anderson, and R. W. Morgan. 1996. Marek's disease virus
(MDV) ICP4, pp38, and meq genes are involved in the maintenance of
transformation of MDCC-MSBI MDV-transformed lymphoblastoid cells. J Virol
70:1125-31.

Yamada, H., T. Daikoku, Y. Yamashita, Y. M. Jiang, T. Tsurumi, and Y.
Nishiyama. 1997. The product of the US10 gene of herpes simplex virus type 1 is

a capsid/tegument-associated phosphoprotein which copurifies with the nuclear
matrix. J Gen Virol78 (Pt 11):2923-31.

Yao, Y., Y. Zhao, H. Xu, L. P. Smith, C. H. Lawrie, M. Watson, and V. Nair.
2008. MicroRNA profile of Marek's disease virus-transformed T—cell line MSB-l:
predominance of virus-encoded microRNAs. J Vir0182:4007-15.

Yonash, N., L. D. Bacon, R. L. Witter, and H. H. Cheng. 1999. High resolution
mapping and identification of new quantitative trait loci (QTL) affecting ‘
susceptibility to Marek's disease. Anim Genet 30: 126-35.

Zammit, D. J., S. P. Berzins, J. W. Gill, E. S. Randle—Barrett, L. Barnett, F.
lKoentgen, G. W. Lambert, R. P. Harvey, R. L. Boyd, and B. J. Classon. 2002.
Essential role for the lymphostromal plasma membrane Ly-6 superfamily
molecule thymic shared antigen 1 in development of the embryonic adrenal gland.

Mol Cell Biol 22:946-52.

36

Chapter 2

Cloning of and functional characterization of chicken stem cell antigen 2

37

Abstract: Stem cell antigen 2 (SCA2) is a Ly-6 family member whose function is largely
unknown. To characterize biological properties and tissue distribution of chicken SCA2,
SCA2 was expressed in E. coli, purified, and a polyclonal antibody developed. Utilizing
the polyclonal antibody, SCA2 was detected to be a 13 kDa cell surface protein anchored
by a glycosyl-phosphatidylinositol (GPI) moiety. SCA2 is expressed in connective tissues
of thymus and bursa based on immunohistochemistry, immunoprecipitation, and western
blots. In bursal follicles, SCA2 is specifically expressed on the cortical-medullary
epithelial cells (CMEC) surrounded by MHC class H presenting cells. Expression profiles
of bursal cells induced by contact with SCA2-expressing cells show down-regulation of
numerous genes including CD793, B cell linker (BLNK), spleen tyrosine kinase (SYK),
and gamma 2-phospholipase C (PLCGZ) that are involved in the BCR and immune
response signaling pathways. These results suggest chicken SCA2 plays a role in

regulating B lymphocytes.

38

Introduction

Stem cell antigen 2 (SCA2), also known as lymphocyte antigen 6 complex, locus
E (Ly-6E) and thymic shared antigen-1 (TSA-l), is a member of the lymphostromal cell
membrane Ly-6 superfamily. Ly-6 family members are low molecular weight (10-12 kDa)
proteins with 8-10 conserved cysteine residues, anchored to the cell surface via a
glycosyl-phosphatidylinositol (GPI) moiety. In mouse, SCA2 is expressed on thymic
medullary epithelial cells and immature T lymphocytes, B lymphocytes, and activated T
cells (Godfrey et al., 1992; Classon et al., 1994; Antica and Scollay, 1997). Aside from
lymphoid organs, SCA2 is also expressed in other mouse tissues including embryonic
adrenal gland and liver, and adult kidney and liver (MacNeil et al., 1993; Classon and
Coverdale, 1996; Zammit et al., 2002). SCA2 has been suggested to function in cell-cell
adhesion (Classon and Boyd, 1998), signaling transduction via T cell receptor, and T cell
development (Randle et al., 1993; Fleming and Malek, 1994; Saitoh et al., 1995; Noda et
al., 1996). Some studies showed mouse SCA2 expression was highly associated with
tumorigenicity (Eshel et al., 1995; He and Chang, 2004) although the role of SCA2 in
tumor progression is not well defined.

The SCA2 homologue in chicken was initially identified as a transcript highly
expressed in v-Rel-transformed avian bone marrow cells (Petrenko et al., 1997). In self-
renewing avian erythrocytic progenitor cells called T2ECs (transforming growth factor
(TGF)-0t, TGF-B induced erythrocytic cells), SCA2 mRNA is up-regulated T2ECs in
comparison to differentiated T2ECs, and inhibition of SCA2 expression through RNA
interference substantially reduced cell proliferation and increased differentiation of

T2ECs (Gandrillon et al., 1999; Damiola et al., 2004; Bresson-Mazet et al., 2008). These

39

results imply that SCA2 supports the self-renewal of chicken lymphoid cells, and the up-
regulation of SCA2 may promote the transformation of lymphoid cells. We previously
reported that the allele of the chicken SCA2 can influence resistance to Marek’s disease
(MD), a viral-induced T cell lymphoma, based on linkage to MD resistance and related
traits, induced transcription in Marek’s disease virus (MDV)-infected chicken embryo
fibroblasts (CEF), transcriptional differences between MD resistant and susceptible
experimental chicken lines following challenge with MDV, and direct protein interaction
with MDV USlO (Liu et al., 2003). Although studies (Gandrillon et al., 1999; Damiola et
al., 2004; Bresson-Mazet et al., 2008) have shown that chicken SCA2 may participate in
cell proliferation, differentiation, or tumorigenesis, the biochemical and biological
properties of SCA2 are not understood. These studies are further hindered by the lack of
a specific antibody to SCA2.

In this report, we describe the purification of chicken SCA2 protein in E. coli and
development of a polyclonal antibody to SCA2. Utilizing this antibody, the biological
properties of chicken SCA2 were investigated. Chicken SCA2 is a 13 kDa protein that is
anchored on the cell surface by a GPI moiety. In vivo studies show chicken SCA2 is
expressed in liver cells, and cells in connective tissues of thymus and bursa. Within bursa
follicles, the MHC class II presenting cells are adjacent to the cortical-medullary
epithelial cells (CMEC) expressing SCA2. Bursa] cells incubated with a SCA2-
expressing cell line down-regulate many genes involved in BCR and immune response
signaling pathways. These results suggest a role of SCA2 as a microenvironment factor
regulating B cell deve10pment, and. it may act as a functional regulator in lymphomatous

disease.

40

Materials and methods
Cells and animals

DFl, an immortalized cell line from chicken embryonic fibroblasts (Himly et al.,
1998), was used for transfection of the SCA2Flag-pSELECT-zeo-mcs vector (Invivogen,
San Diego, CA, USA). Chicken lines 0 (lacks endogenous avian leucosis viruses), 63
(inbred and MD resistant), and 72 (inbred and MD susceptible) were maintained at the
Avian Disease and Oncology Laboratory (ADOL), USDA. White rabbits were purchased

from Harlan Laboratories, Inc. (Indianapolis, IN, USA).

Development of anti-SCA2 rabbit antisera

Primers (SCA2F: 5’ GC GAA TCC CAC TCA TCT GCT TIT CGT GCT CG 3’;
SCA2R: 5’ CG CTC GAG TGG GCC GCC TAA TAG CTG GCT TTA ACG C 3’;
restriction sites are underlined) based on GenBank accession no. NM_204775 were
designed to amplify chicken SCA2 without the signal peptide and GPI anchor (bases 115
to 375). Using a chicken spleen cDNA library as template. the amplicon was cloned into
the pET-28c prokaryotic expression vector between the EcoRI and XhoI sites (Novagen,
Madison, WI, USA), forwarded by DNA sequencing to verify the construct. The
recombinant vector containing both N- and C-terminal His tags was transformed into E.
coli strain BL21 (DE3) (Novagen). The expression and purification of the SCA2-His
recombinant protein followed the pET system protocol (Novagen). The expressed SCA2
was examined through western blotting using anti-His tag monoclonal antibody (mAb;
Invitrogen, Carlsbad, CA, USA) and purified through His . Bind kits (Novagen). Purified

chicken SCA2 was electrophoresed through a 10% SDS-PAGE gel, and the 13 kDa band

41

removed and mixed with Irnject Alum (Pierce, Rockford, IL, USA). The antigen-alum
mixture was administered into multiple intramuscular, intradermal, or subcutaneous sites
of two rabbits. Four weeks after the primary immunization, booster immunizations were
given and the animals were bled 7 days later. The anti-SCA2 sera were obtained after the

fifth boost.

Generation of chicken SCA2 eukaryotic expression vector and stable transfection
cell line

Primers (SCA2SalIF: 5’ ATCG GTC GAC ATG AAG GCG TIT CTG TTC GC
3’; SCA2NCOIR: 5’ ATCG CCA TGG TCA CTC ACG AGC CCT GAG G 3’;
restriction sites are underlined) were designed to amplify the entire coding portion of
chicken SCA2 (bases 55 to 435). The amplicon was inserted between the Sall and NcoI
sites of the pSELECT—zeo-mcs vector (Invivogen) to generate SCA2-pSELECT-zeo—mcs.
A Flag tag was inserted immediately downstream of the signal peptide of SCA2 by PCR
using SCA2-pSELECT-zeo—mcs as the template with the primers (SCA2SalIF;
Sca2FlagNsiIR: 5’ GTT GGA GG ATG CAT CCG AGC ACG AAA AGC AGA TGA
GCT TAT CGT CGT CAT CCT TGT AAT CCG TGT GGG CTC TCT CCA CG 3’;
restriction sites are underlined, Flag tag sequences are in italic). The amplicon was
inserted between the Sall and Nsil sites of SCA2-pSELECT-zeo-mcs to construct
SCA2F1ag-pSELECT, which was confirmed by DNA sequencing. The SCA2F1ag-
pSELECT-zeo—mcs and empty pSELECT—zeo—mcs vector were independently transfected
into the DFl cell line using the Basic Nucleofector Kit (Amaxa Inc., Gaithersburg, MD,

USA). The transfected cells were incubated in medium containing Liebovitz’s L-15 and

McCoy 5A media (1:1) supplemented with 5% fetal bovine serum (FBS), penicillin,
streptomycin, and zeocin (300 ng/ml) until single colonies appeared. The expression of
SCA2 was tested by western blots using anti-Flag mAb and anti-SCA2 antisera. The
single colony with the best SCA2 expression was maintained and called the SCA2F1ag-
DFl cell line. The single colony with the empty vector was maintained and named the

Vector-DFl cell line.

Flow cytometry analysis

Cell surface expression of SCA2 was measured as previously reported (Hunt et al.,
2001). SCA2F1ag-DF1 cells and DFl cells were trypsinized and harvested (lOOOxg, 5
min.). Thymocytes were collected from 2 to 4-week old ADOL Line 72 and Line 63
chicken thymus, followed by centrifugation (lOOOxg, 5 min.). 105 cells were washed with
cold flow cytometry buffer (phosphate buffered saline containing 1% FBS and 0.1%
sodium azide). Anti-Flag M2 mAb (1:100; Sigma-Aldrich Inc, Milwaukee, WI, USA)
and anti-SCA2 antisera (1:100) were diluted in flow cytometry buffer and reacted with
cells for 20 min. at 4 0C, followed by washing and incubation with goat anti-mouse and
goat anti-rabbit IgG conjugated with FITC (1:100; Zymed, South San Francisco, CA,
USA). The cells were analyzed using a Becton-Dickinson FACScaliber flow cytometer

and CellQuest Pro software (BD Bioscience, San Jose, CA, USA).
Cleavage of GPI-linked cell surface SCA2 molecules

105 SCA2F1ag-DF1 and DFl cells were incubated with 0.2-0.5 unit of

phosphatidylinositol-specific phospholipase C (PI-PLC; Sigma-Aldrich Inc.) in 200 pl

43

flow cytometry buffer at 37 0C for 30 min. Cells were analyzed by flow cytometry

analysis as described in section 2.4.

Western blots and immunoprecipitation

Cells and tissues were lysed in Cellytic M Mammalian Cell lysis reagent (Sigma-
Aldrich Inc., Milwaukee, WI, USA), supplemented with 1% P8340 protease inhibitor
cocktails (Sigma-Aldrich Inc.), followed by sonication and centrifugation. Cell lysates
were mixed with loading and reducing buffer, heated to 70°C for 10 min. and resolved
using 10% SDS-PAGE gels (Invitrogen). The samples were blotted on Immobilon-PSQ
PVDF transfer membranes (Millipore, Billerica, MA, USA). After blocking in PBS
containing 5% non-fat milk for 1 hour at room temperature, membranes were probed with
anti-Flag M2 mAb (1:100) or anti-SCA2 antisera (1:100) at 4 0C overnight. Membranes
were washed three times in PBS before incubation with goat anti-mouse or goat anti-
rabbit IgG conjugated with horseradish peroxidase (Zymed) at room temperature for 1
hour. Proteins were detected using ECL Western blotting substrate (Pierce) after washing
three times. Immunoprecipitation using anti-SCA2 antisera followed the instructions of

the Immunoprecipitation Kit (Roche, Indianapolis, IN, USA).

Immunohistochemistry

Multiple tissues were collected from 4-week old ADOL Line 72 birds. The tissues
were soaked into compound optimum cutting temperature embedding medium (Tissue-
Tek, Torrance, CA, USA) and stored at -80 0C. Samples of flash frozen chicken bursa

were sectioned at 5 pm on a Cryotome FSE (Thermo Fisher, Pittsburgh, PA, USA) at -

44

20 0C. Slides were placed in -70 DC for storage until staining. Reagent incubation was as
follows: anti-SCA2 antisera (1:1000) in normal antibody diluent (NAD) (Scytek
Laboratories, Logan, UT, USA) for 60 min. at room temperature; biotinylated goat anti-
rabbit IgG (h+l) (Vector Laboratories, Burlingame, CA, USA) in NAD for 30 min.;
Alkaline Phosphatase Complex Reagent (Kirkeguard & Perry Laboratories, Gaithersburg,
MD, USA) for 60 min.; and developed using Vector Red substrate I (Vector Laboratories,
Burlingame, CA, USA) for 8 min.

Double staining was performed on the frozen bursa follicles. Tissue sections were
incubated with anti-SCA2 antisera (121000) in NAD for 60 min. at room temperature;
biotinylated goat anti-rabbit IgG(h+l) in NAD for 30 min.; Vectastain Elite ABC Reagent
(Vector Laboratories) for 30 min.; and developed using DAB (Vector Laboratories) for
15 min.; followed with the second antibody anti-MCH II mAb TAPl (1:200;
Developmental Studies Hybridoma Bank. Iowa City, IA, USA) in NAD for 60 min. at
room temperature; biotinylated horse anti-mouse IgG(h+l) (Vector Laboratories) in NAD
for 40 min.; Alkaline Phosphatase Complex Reagent for 60 min.; and developed using

Vector Red substrate I for 8 min.

Affymetrix array processing and data analysis

Bursa of 3-week old line 0 chickens were collected and manually teased to
harvest the bursal cells. 2x106 bursal cells were spread on the monolayers of SCA2F1ag-
DFl cells or control Vector-DFI cells in triplicate. After growth in the mixture of
Liebovitz’s L-15 and McCoy 5A media (1:1) supplemented with 4% FBS, penicillin, and

streptomycin for overnight at 37 °C in 5% CO2, the bursal cells were recovered by

45

washes from the adhesive DFl cells followed by gentle centrifugation at 1000xg for 10
min. Total RNA was isolated using the absolutely RNA microprep kit (Stratagene, La
Jolla, CA, USA). The quantity and quality of total RNA were analyzed on an Agilent
2100 Bioanalyzer using the RNA 6000 Nano Chip Kit according to the manufacturer’s
instructions (Agilent Technologies, Santa Clara, CA, USA). The cDNA synthesis,
labeling, hybridization and scanning of Affymetrix GeneChip Chicken Array (Affymetrix,
Inc., Santa Clara, CA, USA) were carried out at the Michigan State University Research
Support Technology Facility (RSTF). The .CEL files (GEO accession no.GSE18506)
were provided and normalized at the probe level using the robust multichip average
(RMA) method (Irizarry et al., 2003) implemented into the Affymetrix Expression
Console software; RMA is a robust linear model analyzing data for background
adjustment, quantile normalization, and log2-transformation of the perfect match probe
intensities for each probe set. Statistical comparison of differences between the
normalized mRNA expression in SCA2-induced and control bursal cells was performed
through significance analysis of microarrays (SAM) software (Tusher, et al., 2001). The
significant differential expressions between SCA2-induced and control samples were
filtered based on the following criteria: 1) false discovery rate<5% and 2) fold change 22.
Gene ontology annotations associated to Affymetrix DNA probe sets were analyzed
through Ingenuity Pathways Analysis software (Ingenuity Systems Inc, Redwood, CA,
USA). Biological processes were identified by inputting differentially expressed gene
sets into the Metacore database (GeneGo Inc., St. Joseph, MI, USA) and the biological

processes were ranked according to their P value.

46

Real-Time quantitative reverse transcription PCR

Selected chicken transcripts were measured using real time quantitative reverse
transcription PCR (qRT-PCR). Briefly, 1 pg of total RNA was used for cDNA synthesis
with the Improm-II Reverse Transcription System according to the manufacturer’s
protocol (Promega, Madison, WI, USA). The primers were designed using Primer
Express Software v3.0 (Applied Biosystems, Foster City, CA, USA). Primers listed in
Table 2-1 were synthesized by Operon Biotechnologies, Inc (Huntsville, Al, USA). 2.5
uM of each forward and reverse primer were used in the presence of 25 ul SYBR
GREEN PCR master mix (Applied Biosystems, Foster City, CA, USA) in a final volume
of 50 pl. The real-time PCR program was as follows: 95 °C for 10 min., 40 cycles at 95
°C for 15 sec followed by 60 °C for 1 min., in an ABI 7500 Sequence Detection System
(Applied Biosystems). The expression of each gene was normalized to the expression of
glyceraldehyde 3-phosphate dehydrogenase (GAPDH) through relative quantification

using the 2'AACT method (Livak and Schmittgen, 2001).

47

Table 2-1. Primers used for quantitative real-time PCR validation of microarray data

 

 

Gene Primer Sequence (5’ to 3’)

GAPDH Forward TGCCATCACAGCCACACAGAAG
Reverse ACT I ' I 'CCCCACAGCCT'I‘AGCAG

CD798 Forward AGGAGTI’CCACGTGCTGGAT
Reverse GAAGCTGATGCGGTCA'I'I'I'GT

S YK Forward CCAAAAACCTCAGCTGGAGAA
Reverse TCTGACTCTI‘CCCGAGAGATCCT

BTK Forward CCCAGAGCTCATCACGTACCA
Reverse GACACGGGATACTTCAGTCTGGAT

BLNK Forward GCC'ITGCCCAGACCAAAGA
Reverse CCCTCGGCTI‘CAGTGGTAATI‘

PLCGZ Forward GAA'I'I'I'GATCTGCGTCTCACTGA
Reverse CCTCGACTCAAGTTGCTATAGTACCA

TH YI Forward CAGCGTCTCCGAGAACGTCTA

Reverse

GAGGCACACCAGGTTCTTGTG

48

Results
Chicken SCA2 is a 13 kDa cell surface protein anchored by a GPI moiety

The eukaryotic expression vector SCA2F1ag-pSELECT-zeo-mcs includes the
entire SCA2 cDNA sequence and a Flag tag immediately downstream of the SCA2 signal
peptide. In SCA2F1ag-DP] stably transfected cells, SCA2F1ag ran with a mobility of
about 13 kDa on denatured SDS-PAGE gels as measured by western blot analysis
utilizing both anti-Flag mAb and anti-SCA2 polyclonal antisera (Fig. 2-1). SCA2 encodes
126 amino acids and the mature SCA2 protein is predicted to possess 85 amino acids.
The 13 kDa molecular size suggests potential posttranslational modifications of SCA2 in
DFl cells. In SCA2F1ag-DF1 cells, SCA2 is displayed on the cell surface as determined
by flow cytometry using both anti-Flag mAb and anti-SCA2 antisera (Fig. 2-2). When the
viable SCA2F1ag-DF1 cells were incubated with PI-PLC, a phospholipase that
specifically cleaves the GPI anchor, the SCA2 molecule is cleaved from the surface of
SCA2F1ag-DP] cells in a dose dependent manner. The surface expression of control DFl
cells were not affected by the enzyme. These results confirm the surface expression of

SCA2 with a direct attachment of the GPI anchor to the C terminus of SCA2.

49

IdG'JODQA
[d0'10139A

U)
o 8
> >
N N
3 3
vi a?
a a

75 kDa 75 kDa
50”” 50 kDa
37 kDa 37kDa
23:3: 2....

20 kDa
131$: 15 kDa

10 kDa

   

Figure 2-1. Western blots using anti-Flag mAb or anti-SCA2 antisera. DFl cells
transfected with SCA2F1ag or empty vector probed with a) anti-Flag mAb or b) anti-
SCA2 antisera. The size of the protein standards are indicated. The molecular size of
SCA2 is about 13 kDa.

50

a)

 

 

 

 

b)

 

 

 

 

Figure 2—2. Flow cytometry analysis of SCA2F1ag-DP] and vector-DFI with anti-Flag
mAb and anti-SCA2 antisera. a) SCA2F1ag-DF1 (green line) and Vector-DFI (black line)
stained with anti-Flag mAb; SCA2F1ag-DP] treated with 0.2 units and 0.5 units of PI-
PLC stained with anti-Flag mAb (pink and blue dotted lines, respectively). b) SCA2F1ag-
DFl stained with anti-SCA2 antisera (green line) and prebleed antisera (black line); and
SCA2F1ag-DP] treated with 0.2 units and 0.5 units of PI-PLC and stained with anti-
SCA2 antisera (pink and blue dotted lines, respectively), SCA2F1ag-DF1 treated with 0.5
units of PI-PLC and stained with prebleed antisera (purple dotted line).

51

Tissue distribution of chicken SCA2

Frozen sections of selected organs were stained with the anti-SCA2 polyclonal
antisera or prebleed antisera as a negative control. As shown (Fig. 2-3), SCA2 is strongly
expressed in liver cells and connective cells in thymus and bursa. In the liver, hepatocytes
were stained uniformly for SCA2 and the endothelial cells also stained strongly. In the
thymus, SCA2 is expressed on connective epithelial cells. In bursa, SCA2 is specifically
expressed on CMEC and medullary reticular epithelial cells. In the spleen, weak staining
was observed in red pulp areas. Weak staining was also observed in gonad, heart and
lung tissues. The molecular weight of SCA2 expression in these organs was determined
by western blot. SCA2 ran with a mobility of 13 kDa, consistent with SCA2F1ag
expressed in SCA2F1ag-DF1 cells (Fig. 2-4). The results show abundant SCA2
expression in thymus, bursa, liver and spleen and relatively sparse expression in gonads,
heart and lung.

In bursal follicles, SCA2 is specifically expressed in CMEC and reticular
epithelial cells in the medulla (Fig. 2-5a). In the immunohistochemistry image of bursa
follicles stained with both anti-SCA2 antisera and anti-MHC class H mAb, the majority
of MHC class II presenting cells are located adjacent to the CMEC on which SCA2 is
strongly and specifically stained (Fig. 2-5b, c). Under the fluorescent microscope, the
areas positive for MHC class II and the areas positive for SCA2 do not overlap. The
immunohistochemistry results show CMEC and MHC class II presenting cells are two
distinct types of cells, and the MHC class II presenting cells are probably attracted to the

CMEC on both sides of the medullar cortex.

52

Figure 2-3. Immunohistochemical analysis of chicken SCA2 expression in
chicken tissues. Tissues from 4-week old line 72 birds were stained with anti-
SCA2 antisera. Magnification of the bursal follicle is 400x. All the other
magnifications are 100x.

53

 

Figure 2-3

-l I" l— C) :1: u)

a s 2 s a 2 5 5

3 0° 2 n: :1 8 (’3 g

a ‘1 = 6
75kDa
50kDa
37kDa
25kDa
20kDa
15kDa

lOkDa

 

Figure 2-4. Immunoprecipitation and western blot analysis of SCA2 expression in
chicken tissues. Cell lysates fi'om chicken tissues were immunoprecipitated with anti-
SCA2 antisera and detected with anti-SCA2 antisera through western blots. The size of
the protein standards are indicated.

55

Figure 2-5. Immunohistochemical analysis of SCA2 expression in bursal
follicles. a) Bursa] follicles were doubly stained with anti-SCA2 antisera
(gray/black) and anti—MHC class H mAb (red). An identical section viewed
under b) bright and c) fluorescent lighting; with the fluorescent microscope,
only MHC class II is illuminated in red.

56

 

a)

b)

C)

Figure 2—5

Gene expression profiling of bursal cells in contact with SCA2-expressing cells
Bursa] cells incubated with SCA2-expressing (SCA2F1ag-DF1) or negative
control (Vector-DFI) cells were profiled using Affymetrix chicken genome arrays and
analyzed. 95 genes are significantly under-expressed (Table 2-2) and 68 genes are over-
expressed (Table 2-3) in the SCA2-induced bursal cells in comparison to the control. In
contrast to the over-expressed genes, many of the genes with decreased expression were
related to B cell proliferation, development, and immune response. The results of
biological process analysis through the MetaCore database showed the set of down-
regulated genes is induced in a statistically significant manner in comforrnent of several
pathways including the BCR signaling pathway (P _<_ 1.6 x 107) and immune response
signaling in B lymphocytes (P g 3.2 x 10'“). To validate the microarray results, selected
under-expressed (CD798, SYK, BLNK BTK, PLCGZ) and over-expressed (THY-I) genes
were analyzed by qRT-PCR. Using the chicken GAPDH gene for normalization, all the
queried genes showed an expression pattern similar to the results from the microarray

(Table 2-4).

58

Table 2-2. Genes under-express in SCA2 induced bursal cells

Probe ID
Gga.5273.1.Sl_at
GgaAffx.9065.1.Sl_at
GgaAffx.2l699.1.Sl_at
Gga.7334.1.Sl_at
member 1
GgaAffx.7881.l.Sl_s_at
Gga.19387. l.Sl_at

G gaAffx.20426. 1 .S l_at
Gga.3738.1.Sl_at
GgaAffx.] 1885.1 .Sl_s_at
Gga.10069.l.Sl_at
translocated to, 3
Gga.5128.l.Sl_at
GgaAffx.] 1849.1.Sl__s_at
Gga.998.2.Sl_a_at
Gga.14078.1.Sl_s__at
GgaAffx. 151.1.Sl_s_at
Gga.17250.1.Sl_at
Gga.9816.l.Sl_s_at
GgaAffx. 12918.1.Sl_s_at
GgaAffx.21308.1.Sl__s_at
Gga.19843.].S1_s_at
Gga.3573.2.Sl_a_at
Gga.6002. l .S l_a_at
Gga.6032.1.Sl_at
Gga.445.1.Sl_at
Gga.8031.2.Sl_a_at
Gga.13533.1.S1_at
Gga.4564.2.Sl_a_at
Gga.588. 1 .S l_at
GgaAffx.]3238.1.Sl_s_at
Gga.9138.l.Sl_at
Gga.5289.1.Sl_at
Gga.1092.1.Sl_s_at
Gga.10880.1.Sl_at
GgaAffx.] 1705. l .Sl_at
GgaAffx.] 1387.1.Sl__s__,at
Gga.11016.1.Sl_at
Gga.13336.2.Sl_x_at
Gga.16655.l.Sl_at
Gga.14571.1.Sl_s_at
Gga.11539.l.Sl_at
Gga.3366. 1 .Sl_at
Gga.4326. 1 .S l_at

G gaAffx.26566. l .Sl_at
Gga.1235.2.Sl_at
subfamily, beta member 2
Gga.9912.1.S1_at
GgaAffx.] l727.l.Sl__at
GgaAffx. 13207.1 .Sl_s_at

Gene Svmbol
ADRB K2
AICDA
AN KRD44
APBB NP
2.86
ARHGAP l 5
ATXN7
BCLl 1A
BLNK
BTK
CBFA2T3
2.25
CCL20
CD36
CD3D
CD72

CD7 93
CDKN l B
CLIC2
CYTH4
DCBLDl
DENNDSB
DKK3
DNMT3A
DOCK8
EG667604
FAM 1 8A
FAM6SB
FMO6
GFRAI
GLCCIl
GMIP
GPD]
GPR174
GRAP
HAGHL
HCLSl
HLA-DMA
HLA-DRB 1
HMHAI
HPSS
IFI3O
IL20RA
JAK3
IP6K2
KCNAB2
2.70
KLHL6
LCPl
LIMD2

Gene Name

adrenergic, beta, receptor kinase 2

activation-induced cytidine deaminase

ankyrin repeat domain 44

amyloid beta (A4) precursor protein-binding. family B,

Rho GTPase activating protein 15

ataxin 7

B-cell CLL/lymphoma 11A (zinc finger protein)
B-cell linker

Bruton agammaglobulinemia tyrosine kinase
core-binding factor, runt domain, alpha subunit 2;

chemokine (C-C motif) ligand 20

CD36 molecule (thrombospondin receptor)

CD3d molecule, delta (CD3-TCR complex)

CD72 molecule

CD79b molecule, immunoglobulin-associated beta
cyclin-dependent kinase inhibitor 1B (p27, Kip1)
chloride intracellular channel 2

cytohesin 4

discoidin, CUB and LCCL domain containing 1
DENN/MADD domain containing SB

dickkopf homolog 3 (Xenopus laevis)

DNA (cytosine-5-)-methyltransferase 3 alpha
dedicator of cytokinesis 8

predicted gene, EG667604

family with sequence similarity 18, member A
family with sequence similarity 65, member B
flavin containing monooxygenase 6 pseudogene
GDNF family receptor alpha 1

glucocorticoid induced transcript 1

GEM interacting protein

glycerol-3-phosphate dehydrogenase l (soluble)
G protein-coupled receptor 174

GRB2-related adaptor protein
hydroxyacylglutathione hydrolase-like
hematopoietic cell-specific Lyn substrate 1

major histocompatibility complex, class 11, DM alpha
major histocompatibility complex, class 11, DR beta ‘1
histocompatibility (minor) HA-l
Hermansky-Pudlak syndrome 5

interferon, gamma-inducible protein 30
interleukin 20 receptor, alpha

Janus kinase 3 (a protein tyrosine kinase, leukocyte)
inositol hexakisphosphate kinase 2

potassium voltage-gated channel, shaker-related

kelch-like 6 (Drosophila)

lymphocyte cytosolic protein 1 (L-plastin)
LIM domain containing 2

59

Continued Table 2-2. Genes under-express in SCA2 induced bursal cells

GgaAffx.5229.l.S1_at
Gga.449l.l.Sl_s_at
Gga.4354.1.S1_at
GgaAffx.6232.l.Sl_s__at
Gga.5323.1.Sl_at
GgaAffx.]2551.1.Sl__at
Gga.8736. 1.S l_at
domain containing 1
Gga.8880.1.Sl__at
Gga.16267.1.Sl_at
GgaAffx.] 1413.1.S1_s_at
G gaAffx. l 1420.1.Sl_s_at
Gga.17430.l.Sl_at
Gga.1329l.l.Sl_at
Gga.12076.1.Sl_at
Gga.11516.1.Sl__at

G gaAffx.9707. 1 .S 1_s_at
domain containing 1

G ga.49 16. 1.52_s_at
inhibitor)
Gga.71.1.Sl_at

LRRNI
LSPI
M6PR
MDM l
MEF2C
MGC33894
MICALI
2.28
MME
MR1
NCOA7
NECAP2
NUP210
OIT3
P2RX5
P2RY6
PCMTDI
2. 10
PDCD4
2.40
PDGFB

sarcoma viral oncogene homolog)

Gga.10030.1.Sl_s_at
Gga.7 148.2.A1_at
Gga.19667.1.Sl_at
exchange factor 1
Gga.8329.1.Sl__at
Gga.9379. 1 .S 1_s_at
GgaAffx. 12720. 1 .S l_at
GgaAffx.] l475.1.Sl_s_at
Gga.9386. l .Sl_at
Gga.15728. l.Sl_at
Gga.352.1.Sl_at

Gga.41 l3.l.Sl_at
GgaAffx.235 l .28 1_s_at
G ga.408. l .S l_at
GgaAffx.]2264.1.Sl_s_at
Gga.7956.1.Sl_at
Gga.6286. l .S l_at
Gga.8508. 1.82_s_at
GgaAffx.] 1711.1.S1_s_at

Gga.6976. 1 .S l_at
GgaAffx.4780.1.Sl_at
GgaAffx.943. l .S 1_s_at
Gga.1148.1.S2_at
GgaAffx. 12873. LS l_at
GgaAffx. 12646.1.S1_at
Gga.11781.1.S1_at
Gga.16833.1.Sl_at
GgaAffx. 12557. LS 1_s_at
GgaAffx. 12475.1.Sl_at
Gga.15780.1.S1_at
Gga.17034.1.S1_s_at

PIK3R5
PLCG2
PREX]
3.33
PRKCH
PTPN6
RABGAP l L
RASSFZ
RBP7
RCSDI
RGSZO
RHOF
RORA
RPE65
SASH3
SH3BGRL
SIAH2
SLA
SNAP91
3.29
SPINKS
STAT4
SPNS3
ST6GAL1
STRBP
SYK
TM6SF]
TP53INPI
TPST2
TRAFS
WDR66
YPEL2

leucine rich repeat neuronal l

lymphocyte-specific protein 1

mannose-6-phosphate receptor (cation dependent)

Mdml nuclear protein homolog (mouse)

myocyte enhancer factor 2C

transcript expressed during hematopoiesis 2

microtubule associated monoxygenase, calponin and LIM

membrane metallo-endopeptidase

major histocompatibility complex, class I-related
nuclear receptor coactivator 7

NECAP endocytosis associated 2

nucleoporin 210kDa

oncoprotein induced transcript 3

purinergic receptor P2X, ligand-gated ion channel, 5
pyrimidinergic receptor P2Y, G-protein coupled, 6
protein-L-isoaspartate (D-aspartate) O-methyltransferase

programmed cell death 4 (neoplastic transformation

platelet-derived growth factor beta polypeptide (simian
2.27

ph03phoinositide-3-kinase, regulatory subunit 5
phospholipase C, gamma 2 (phosphatidylinositol-specific)
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac

protein kinase C, eta
protein tyrosine phosphatase, non-receptor type 6
RAB GTPase activating protein 1-like
Ras association (RalGDS/AF-6) domain family member 2
retinol binding protein 7, cellular
RCSD domain containing 1
regulator of G-protein signaling 20
ras homolog gene family, member F (in filopodia)
RAR-related orphan receptor A
retinal pigment epithelium-specific protein 65kDa
SAM and SH3 domain containing 3
SH3 domain binding glutamic acid-rich protein like
seven in absentia homolog 2 (Drosophila)
Src-like-adaptor
synaptosomal-associated protein, 91kDa homolog (mouse)

serine peptidase inhibitor, Kaza] type 5

signal transducer and activator of transcription 4
spinster homolog 3 (Drosophila)

ST6 beta-galactosamide alpha-2,6-sialyltranferase l
spennatid perinuclear RNA binding protein
spleen tyrosine kinase

transmembrane 6 superfamily member 1

tumor protein p53 inducible nuclear protein 1
tyrosylprotein sulfotransferase 2

TNF receptor-associated factor 5

WD repeat domain 66

yippee-like 2 (Drosophila)

60

Table 2-3. Genes over-express in SCA2 induced bursa] cells

Probe ID
GgaAffx.6058.].S1_at
Gga.10984.1.S1__at
Gga.1232l.1.S1_at

Gene Symbol

AADAT
AIDA
ALG] 1

mannosyltransferase homolog (yeast)

Gga.2301.l.Sl_at
Gga.] 1793.1.S1_at
Gga.8363.1.S1_at
Gga.2840.1.Sl_at
polypeptide 1
Gga.12194.1.S1_at
GgaAffx.218l7.l.Sl_s_at
Gga.2592.1.Sl_at
Gga.4257. l .S l_at
Gga.2584. 1 .Sl_s_at
Gga.4211.l.Sl_at
Gga.184. 1 .S l_a_at
Gga.16050.1.Sl_s_at
Gga.9493.1.Sl__at
GgaAffx. l 1017.5.Sl_s_at
Gga.17040.2.Sl_a_at
Gga.8858.1.Sl_s_at
Gga.2663. l .S l_at
GgaAffx. 1557.1.S1_at
GgaAffx.4054.1.Sl_at
Gga.13785.1.S1_at
Gga.3066.1.Sl__at
Gga.4724. 1 .S2_at
Gga.892.l.Sl_at
loop-helix protein
GgaAffx.20617. l.Sl_at
Gga.14123.1.Sl_at
Gga.16230.2.Sl_a_at
Gga.7898. 1 .S l__at
Gga.15876.].S1_at
Gga.13l62.l.Sl_at
Gga.2550.1.Sl_at
Gga.6218.l.Sl_at
Gga.10617.].S1_a_at
Gga.3332.1.S1_at
Gga.18504.1.S1_at
Gga.5300.1.S1_at
Gga.3398.2.Sl_a_at
Gga.4726.l.Sl_at
Gga.9989.l.Sl_at
Gga.4856. 1 .S 1_s_at
Gga.11468.1.Sl__a_at
Gga.1546. l .S2_a_at
Gga.5640. l .S l_at
Gga.9612.1.Sl_at
Gga.5921.1.Sl_at
Gga.8500. l .S l_at
Gga.10018.l.S1_at

APCDDI
ATG l 0
AXlN2
B4GALT1
2.59
CBYI
CDH13
COL5A]
COL6A2
CPNE2
CRTAP
CSPGS
DNAJ C3
DPYSL3
DYNCZHI
FGF2
FKBP7
FKBP9
GPCI
HECT D2
HNRPLL
HS lBP3
HSP9OB 1
ID]

5.1 l
IFI81
ISM 1
KCT D3
LCLATI
LRIG3
MANEA
MAT l A
MFAPS
MSRB3
MXRA8
PARVA
PDE6D
PITX2
PLODl
PLXDC2
PMP22
PPIC
PRRXI
PRS823
RDH l4
REEPS
RG32
RIN 3

Gene Name

aminoadipate arninotransferase

axin interactor, dorsalization associated
asparagine-linked glycosylation 11, alpha-1,2-

2.02

adenomatosis polyposis coli down-regulated 1
ATGIO autophagy related 10 homolog (S. cerevisiae)
axin 2

UDP-GalzbetaGlcNAc beta 1,4- galactosyltransferase,

chibby homolog 1 (Dr030phila)

cadherin 13, H-cadherin (heart)

collagen, type V, alpha I

collagen, type V], alpha 2

c0pine II

cartilage associated protein

chondroitin sulfate proteoglycan 5 (neuroglycan C)
DnaJ (Hsp40) homolog, subfamily C, member 3
dihydropyrimidinase-like 3

dynein, cytoplasmic 2, heavy chain 1

fibroblast growth factor 2 (basic)

FK506 binding protein 7

FK506 binding protein 9, 63 kDa

glypican l

HECT domain containing 2

heterogeneous nuclear ribonucleoprotein L-like
HCLSI binding protein 3

heat shock protein 90kDa beta (Grp94), member 1
inhibitor of DNA binding 1, dominant negative helix-

intraflagellar transport 81 homolog (Chlamydomonas)
isthrnin 1 homolog (zebrafish)

potassium channel tetramerisation domain containing 3
lysocardiolipin acyltransferase l

leucine-rich repeats and immunoglobulin-like domains 3
mannosidase. endo-alpha

methionine adenosyltransferase 1, alpha

microfibrillar associated protein 5

methionine sulfoxide reductase B3
matrix-remodelling associated 8

parvin, alpha

phosphodiesterase 6D, cGMP-specific, rod, delta
paired-like homeodomain 2

procollagen-lysine l, 2-oxoglutarate 5—dioxygenase 1
plexin domain containing 2

peripheral myelin protein 22

peptidylprolyl isomerase C (cyclophilin C)

paired related homeobox 1

protease, serine, 23

retinol dehydrogenase l4 (all-trans/9-cis/ l l -cis)
receptor accessory protein 5

regulator of G-protein signaling 2, 24kDa

Ras and Rab interactor 3

61

Continued Table 2-3. Genes over-express in SCA2 induced bursal cells

Gga.4516.2.Sl_at
Gga.7890. l .S l_at
Gga.13449.l.S1_s_at
GgaAffx.8046. l .S 1_s_at
Gga.19099.2.Sl_a_at
Gga.17868. l.Sl_s_at
Gga.16722.1.Sl_at
Gga.485. l .Sl_a_at
Gga.9244.2.Sl_a_at
GgaAffx.4539. l .S l_at
Gga.4153. 1.32_a_at
GgaAffx. 13062.1.S1_at
Gga.19252.1.Sl_s_at
Gga.10985.1.Sl_at
GgaAffx.6948. l .S l_at
G ga.4975. l .S l_a_at
GgaAffx. 12952.1.Sl_at
Gga.3250. 1 .S l_at
Gga.116ll.l.Sl_at

SEPT] l
SFRP4
SGCE
SLC4 1 A2
SPARC
SPATA6
SRGAP l
TEAD4
TEKT4
TEKTS
THYI
TMEM129
TMEM184C
TMEM45A
TMTC2
TPM3
USP28
VSNLI
WIF]

septin ll

secreted frizzled-related protein 4

sarcoglycan, epsilon

solute carrier family 41, member 2

secreted protein, acidic. cysteine-rich (osteonectin)
sperrnatogenesis associated 6

SLIT-ROBO Rho GTPase activating protein 1
TBA domain family member 4

tektin 4

tektin 5

Thy-l cell surface antigen

transmembrane protein 129

transmembrane protein 184C

transmembrane protein 45A

transmembrane and tetratricopeptide repeat containing 2
tropomyosin 3

ubiquitin Specific peptidase 28

visinin-like 1

WNT inhibitory factor 1

Table 2-4. Real-time quantitative reverse transcription PCR analysis of differential
expression for bursal cells incubated with SCA2-expressing or control DFl cells

 

 

Gene SCA21 Controll Fold
Change

CD798 6.561082 3.21 $0.39 -10.2
BLNK 6.38 $0.63 4.82 10.36 -2.9
BTK 11.94 10.89 7.86 $0.36 -l6.9
PLCGZ 10.67 10.74 7.62 10.41 -8.2
S YK 10.79 10.76 7.48 $0.39 -9.9
THY-1 4.95 3:080 8.33 10.53 10.4

lCt mean and standard deviation for three replicates.

63

Discussion

Although chicken SCA2 gene expression was associated with tumorigenicity and
self-renewal of avian erythroid progenitors, the natural biochemical and biological
pr0perties of SCA2 protein are unknown. We here describe the development of a
polyclonal antibody to chicken SCA2 and its application to the analysis of the biological
properties and tissue distribution of SCA2. SCA2 is a 13 kDa small molecular weight,
cell surface protein anchored by a GPI moiety, which is similar to homologs in other
species. The expression pattern of SCA2 in chicken is relatively wide, and it is
abundantly expressed in some tissues. In thymus, strong staining using anti-SCA2
antisera was on the connective cells. In bursa, SCA2 was specifically expressed on the
CMEC. SCA2 also shows strongly expression in hepatocytes and endothelial cells in
liver. Anti-SCA2 antisera stained weakly in the spleen, lung, heart and gonad. The
expression pattern of SCA2 is similar in chicken and mouse in which SCA2 was
abundantly expressed in thymic epithelial cells in thymus and in other tissues including
the embryonic adrenal gland and liver and adult kidney and liver.

Although the function of mouse SCA2 is not well defined, the literature suggests
its participation in cell-cell adhesion, signal transduction, and T cell differentiation. The
deletion of SCA2 in mouse resulted in abnormal adrenal gland and midgestational
lethality due to cardiac abnormalities (Zammit et al., 2002). Chicken SCA2 has been
suggested to have an association with tumorigenesis based on the up-regulation of the
SCA2 transcript in transformed cell lines, and the role of SCA2 in self-renewal and
proliferation of avian erythroid progenitors (Petrenko et al., 1997; Gandrillon et al., 1999;

Damiola et al., 2004; Bresson-Mazet et al., 2008). Based on our anti-SCA2 antisera,

64

chicken SCA2 is specifically expressed on medullary reticular epithelial cells and CMEC
that are surrounded by MHC class II presenting cells in bursal follicles. Therefore, SCA2
may function in maintaining or mediating the proliferation or differentiation of B
lymphocytes located at the cortex-medullar border.

To provide insights into the biological function induced by SCA2, we performed
a microarray experiment on bursal cells in contact with SCA2. After sorting for
differential expression at Z2-fold changes defined by SAM, the expression of 95 genes
were reduced in SCA2-induced bursal cells in comparison to control bursal cells, and
many of them are related to signaling, proliferation, immunity response and control of
transcription of B cells. Although 68 genes were up-regulated in SCA2-induced bursal
cells, the majority of these genes are not specific to B cells. Real time PCR assays with a
limited number of genes indicate the array results are valid.

The development of B lymphocytes from hematopoietic stem cells is regulated by
Specific signaling mechanisms and the BCR pathway serves a central role during this
progression (Reviewed in Kurosaki, 1998; Kurosaki 1999; Gauld et al., 2002; Jumaa et
al., 2005). Of the down-regulated genes profiled and validated in the SCA2-induced
bursal cells, CD79B, SYK, BLNK BTK, and PLCGZ are components of the BCR signaling
pathway and play critical roles in B cell development. CD79B is a subunit of the BCR
complex, and phosphorylation of CD79B by protein tyrosine kinase results in the
recruitment of SYK, another tyrosine kinase, that facilitates down-stream signaling
cascades (Sanchez et al., 1993; Pao et al., 1998; Kurosaki et al., 1995). BTK is a
nonreceptor tyrosine kinase, and BTK-deficient mice show an X-linked

immunodeficiency phenotype with immature peripheral B cells (Kemer et al., 1995;

65

Khan et al., 1995; Hendriks et al., 1996). Phosphorylated BLNK provides docking sites
for various signaling proteins including BTK and PLCG2, and pre-B cells deficient in
BLNK show an increased proliferation rate resulting in a pre-B cell leukemia, suggesting
that BLNK is a tumor suppressor for limiting the proliferation of pre-B cells (Pappu et al.,
1999; Minegishi et al., 1999; Jumaa et al., 2003). Therefore, the ability of chicken SCA2
in down-regulating critical components for normal B cell deve10pment and proliferation,
such as the putative tumor suppressor BLNK, indicate SCA2 may be functionally
associated with transformation by delivering proliferation signals.

The role of CMEC, where SCA2 is specifically localized, is still not clear
although these cells are suggested to provide a “nursing” function for regulating the
development of bursa cells. Notch family transmembrane receptor proteins function in
mediating cell development and differentiation (reviewed by Robey, 1999), and have
been known to be expressed in medullary B cells located close to CMEC, and the Notch
ligand Serrate2 is expressed exclusively in the CMEC (Morimura et al., 2001). Although
the ligands for SCA2 are not known, the tissue localization of SCA2 is closely related to
Serrate2 and may also function similarly as a B cell developmental signal. K-l antigen
has also been identified to be expressed in CMEC and reticular epithelial cells in bursa
(Kaspers et al., 1993; Olah et al., 2002). K-l antigen is a cell surface antigen consisting
of a heterodimer with polypeptide chains of molecular weights of 135 kDa and 61-68
kDa, and it is expressed on chicken thrombocytes, macrophages, and a virus transformed
phagocytic cell line, but not on T and B cells. Although both K-l and SCA2 are located

on CMEC, no apparent homology is observed between SCA2 and K-l antigen.

66

Mice Ly—6 family members are broadly used as a differential marker for
hemotopoeitic stem cells. In this report, we did not thoroughly investigate SCA2 as a
differential marker of chicken hemotopoeitic stem cells. We did not obtain the detectable
level of cell surface expression of SCA2 on thymocyte cells from 1-4 week old birds.
Therefore, either the expression of SCA2 is restricted to certain stages of lymphoid cells,
or it is mainly expressed in epithelial cells.

In conclusion, chicken SCA2 has been identified as a cell surface antigen
anchored by GPI moiety, and the tissue distribution of SCA2 was determined. SCA2 is
Specifically expressed on CMEC in bursal follicles, which are surrounded by MHC class
II expressing cells. The down-regulation of genes in the BCR signaling pathway induced
by contact with SCA2-expressing cells suggests SCA2 may function in mediating B cell
proliferation and differentiation via interaction with receptors on the B cell surface.
Further analysis of the role of SCA2 in B cell proliferation is warranted and may

elucidate its function in B cell deve10pment.

Acknowledgments

We thank L. Molitor and N. Koller for technical support, and AS. Porter, K.A.
Joseph, and RA. Rosebury for their assistance with immunohistochemistry, which was
carried out at the Investigative Histophathology Laboratory, Department of
Physiology/Division of Human Pathology, Michigan State University. We thank J.
Landgraf and A. Thelen for their assistance with the Affymetrix array experiment, which

was carried out at Research Technology Support Facility, Michigan State University. We

67

also thank Dr. Heidari for technical assistance with real-time PCR. This work was

supported in part by the USDA NRICGP grant #2003-05414.

68

References

1.

10.

11.

12.

Antica, M., L. Wu, and R. Scollay. 1997. Stem cell antigen 2 expression in adult
and developing mice. Immunol Lett 55:47-51.

Bresson-Mazet, C., O. Gandrillon, and S. Gonin-Giraud. 2008. Stem cell
antigen 2: a new gene involved in the self-renewal of erythroid progenitors. Cell
Prolif 41:726-38.

Cheng, A. M., B. Rowley, W. Pao, A. Hayday, J. B. Bolen, and T. Pawson.
1995. Syk tyrosine kinase required for mouse viability and B-cell development.
Nature 378:303-6.

Classon, B. J., and R. L. Boyd. 1998. Thymic-shared antigen-1 (TSA-l). A
lymphostromal cell membrane Ly-6 superfamily molecule with a putative role in
cellular adhesion. Dev Immunol 6: 149-56.

Classon, B. J., and L. Coverdale. 1994. Mouse stem cell antigen Sea-2 is a
member of the Ly-6 family of cell surface proteins. Proc Natl Acad Sci U S A
91:5296-300.

Classon, B. J ., and L. Coverdale. 1996. Genomic organization and expression of
mouse thymic shared antigen-1 (TSA-l): evidence for a processed pseudogene.
Immunogenetics 44:222-6.

Damiola, F., C. Keime, S. Gonin-Giraud, S. Dazy, and O. Gandrillon. 2004.
Global transcription analysis of immature avian erythrocytic progenitors: from
self-renewal to differentiation. Oncogene 23:7628-43.

Eshel, R., M. Firon, B. Z. Katz, 0. Sagi-Assif, H. Aviram, and I. P. Witz.
1995. Microenvironmental factors regulate Ly-6 A/E expression on PyV-
transformed BALB/c 3T3 cells. Immunol Lett 44:209-12.

Fleming, T. J., and T. R. Malek. 1994. Multiple glycosylphosphatidylinositol-
anchored Ly—6 molecules and transmembrane Ly-6E mediate inhibition of IL—2
production. J Immunol 153:1955-62.

Gandrillon, O., U. Schmidt, H. Beug, and J. Samarut. 1999. TGF-beta
cooperates with TGF-alpha to induce the self-renewal of normal erythrocytic
progenitors: evidence for an autocrine mechanism. Embo J 18:2764—81.

Gauld, S. B., J. M. Dal Porto, and J. C. Cambier. 2002. B cell antigen receptor
signaling: roles in cell development and disease. Science 296: 1641-2.

Godfrey, D. 1., M. Masciantonio, C. L. Tucek, M. A. Malin, R. L. Boyd, and
P. Hugo. 1992. Thymic shared antigen-1. A novel thymocyte marker

69

l3.

14.

15.

16.

17.

18.

19.

20.

21.

23.

24.

discriminating immature from mature thymocyte subsets. J Immunol 148:2006-11.

He, J., and L. J. Chang. 2004. Functional characterization of hepatoma-specific
stem cell antigen-2. Mo] Carcinog 40:90-103.

Hendriks, R. W., M. F. de Bruijn, A. Maas, G. M. Dingjan, A. Karis, and F.
Grosveld. 1996. Inactivation of Btk by insertion of lacZ reveals defects in B cell
development only past the pre-B cell stage. Embo J 15:4862—72.

Hunt, H. D., B. Lupiani, M. M. Miller, I. Gimeno, L. F. Lee, and M. S.
Parcells. 2001. Marek's disease virus down-regulates surface expression of MHC
(B Complex) Class I (BF) glycoproteins during active but not latent infection of
chicken cells. Virology 282:198-205.

Irizarry, R. A., B. Hobbs, F. Collin, Y. D. Beazer-Barclay, K. J. Antonellis, U.
Scherf, and T. P. Speed. 2003. Exploration, normalization, and summaries of
high density oligonucleotide array probe level data. Biostatistics 4:249—64.

Jumaa, H., L. Bossaller, K. Portugal, B. Storch, M. Lotz, A. Flemming, M.
Schrappe, V. Postila, P. Riikonen, J. Pelkonen, C. M. Niemeyer, and M. Reth.
2003. Deficiency of the adaptor SLP-65 in pre-B-cell acute lymphoblastic
leukaemia. Nature 423:452-6.

Jumaa, H., R. W. Hendriks, and M. Reth. 2005. B cell signaling and
tumorigenesis. Annu Rev Immunol 23:415-45.

Kaspers, B., H. S. Lillehoj, and E. P. Lillehoj. 1993. Chicken macrophages and
thrombocytes share a common cell surface antigen defined by a monoclonal.
antibody. Vet Immunol Immunopathol 36:333-46.

Kerner, J. D., M. W. Appleby, R. N. Mohr, S. Chien, D. J. Rawlings, C. R.
Maliszewski, O. N. Witte, and R. M. Perlmutter. 1995. Impaired expansion of
mouse B cell progenitors lacking Btk. Immunity 3:301-12.

Khan, W. N., F. W. Alt, R. M. Gerstein, B. A. Malynn, I. Larsson, G.
Rathbun, L. Davidson, S. Muller, A. B. Kantor, L. A. Herzenberg, and et al.

1995. Defective B cell development and function in Btk-deficient mice. Immunity
3:283-99.

Kurosaki, T. 1998. Molecular dissection of B cell antigen receptor signaling
(review). Int J Mol Med 1:515-27.

Kurosaki, T. 1999. Genetic analysis of B cell antigen receptor Signaling. Annu
Rev Immunol 17:555-92.

Kurosaki, T., S. A. Johnson, L. Pao, K. Sada, H. Yamamura, and J. C.

70

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

Cambier. 1995. Role of the Syk autophosphorylation site and SH2 domains in B
cell antigen receptor signaling. J Exp Med 182:1815-23.

Liu, H. C., M. Niikura, J. E. Fulton, and H. H. Cheng. 2003. Identification of
chicken lymphocyte antigen 6 complex, locus E (LY6E, alias SCA2) as a putative

Marek's disease resistance gene via a virus-host protein interaction screen.
Cytogenet Genome Res 102:304-8.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.
Methods 25:402-8.

MacNeil, 1., J. Kennedy, D. I. Godfrey, N. A. Jenkins, M. Masciantonio, C.
Mineo, D. J. Gilbert, N. G. Copeland, R. L. Boyd, and A. Zlotnik. 1993.
Isolation of a cDNA encoding thymic shared antigen-1. A new member of the
Ly6 family with a possible role in T cell development. J Immunol 151:6913-23.

Minegishi, Y., J. Rohrer, E. Coustan-Smith, H. M. Lederman, R. Pappu, D.
Campana, A. C. Chan, and M. E. Conley. 1999. An essential role for BLN K in
human B cell development. Science 286:1954-7.

Morgan, R. W., L. Sofer, A. S. Anderson, E. L. Bernberg, J. Cui, and J.
Burnside. 2001. Induction of host gene expression following infection of chicken
embryo fibroblasts with oncogenic Marek's disease virus. J Virol 75:533-9.

Morimura, T., S. Miyatani, D. Kitamura, and R. Goitsuka. 2001. Notch
signaling suppresses IgH gene expression in chicken B cells: implication in
spatially restricted expression of Serrate2/Notch] in the bursa of Fabricius. J

Immunol 166:3277-83.

Noda, S., A. Kosugi, S. Saitoh, S. Narumiya, and T. Hamaoka. 1996.
Protection from anti-TCR/CD3-induced apoptosis in immature thymocytes by a

signal through thymic shared antigen-I/stem cell antigen-2. J Exp Med 183:2355-
60.

Olah, 1., K. H. Gumati, N. Nagy, A. Magyar, B. Kaspers, and H. Lillehoj.
2002. Diverse expression of the K-1 antigen by cortico-medullary and reticular
epithelial cells of the bursa of Fabricius in chicken and guinea fowl. Dev Comp
Immun0126:481-8.

Pao, L. 1., S. J. Famiglietti, and J. C. Cambier. 1998. Asymmetrical
phosphorylation and function of immunoreceptor tyrosine-based activation motif

tyrosines in B cell antigen receptor signal transduction. J Immunol 160:3305-14.

Pappu, R., A. M. Cheng, B. Li, Q. Gong, C. Chiu, N. Griffin, M. White, B. P.
Sleckman, and A. C. Chan. 1999. Requirement for B cell linker protein (BLNK)

71

35.

36.

37.

38.

39.

40.

41.

42.

43.

in B cell development. Science 286:1949-54.

Petrenko, O., I. Ischenko, and P. J. Enrietto. 1997. Characterization of changes
in gene expression associated with malignant transformation by the NF—kappaB
family member, v-Rel. Oncogene 15:1671-80.

Randle, E. S., G. A. Waanders, M. Masciantonio, D. I. Godfrey, and R. L.
Boyd. 1993. A lymphostromal molecule, thymic shared Ag-l, regulates early
thymocyte development in fetal thymus organ culture. J Immunol 151:6027-35.

Ratcliffe, M. J. 2006. Antibodies, immunoglobulin genes and the bursa of
Fabricius in chicken B cell development. Dev Comp Immunol 30:101-18.

Robey, E. 1999. Regulation of T cell fate by Notch. Annu Rev Immunol 17 :283-
95.

Saitoh, S., A. Kosugi, S. Noda, N. Yamamoto, M. Ogata, Y. Minami, K.
Miyake, and T. Hamaoka. 1995. Modulation of TCR-mediated signaling
pathway by thymic shared antigen-l (TSA-l)/stem cell antigen-2 (Sea-2). J
Immunol 155:5574-81.

Sanchez, M., Z. Misulovin, A. L. Burkhardt, S. Mahajan, T. Costa, R.
Franke, J. B. Bolen, and M. Nussenzweig. 1993. Signal transduction by
immunoglobulin is mediated through Ig alpha and Ig beta. J Exp Med 178:1049—
55.

Turner, M., P. J. Mee, P. S. Costello, 0. Williams, A. A. Price, L. P. Duddy,
M. T. Furlong, R. L. Geahlen, and V. L. Tybulewicz. 1995. Perinatal lethality

and blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature
378:298-302.

Tusher, V. G., R. Tibshirani, and G. Chu. 2001. Significance analysis of
microarrays applied to the ionizing radiation response. Proc Natl Acad Sci U S A
98:5116-21.

Zammit, D. J., S. P. Berzins, J. W. Gill, E. S. Randle-Barrett, L. Barnett, F.
Koentgen, G. W. Lambert, R. P. Harvey, R. L. Boyd, and B. J. Classon. 2002.
Essential role for the lymphostromal plasma membrane Ly-6 superfamily

molecule thymic shared antigen 1 in development of the embryonic adrenal gland.
Mol Cell Biol 22:946-52.

Chapter 3
Chicken stem cell antigen 2 modulates Marek’s disease virus grthh properties in

vitro via U810

73

Abstract: Marek’s disease virus (MDV) is a highly cell-associated oncogenic
alphaherpesvirus and the causative agent for Marek’s disease (MD), a
lymphoproliferative disease in chickens. Understanding the molecular mechanisms for
pathogenesis is of both academic and commercial interest. Chicken stem cell antigen 2
(SCA2) is a putative MD resistance gene based on (1) genetic linkage of SCA2 to MD
resistance and related traits, (2) differential transcription of SCA2 between MD resistant
and susceptible chickens following MDV challenge, and (3) a confirmed and direct
protein interaction of SCA2 with MDV U810 in vitro. The functional relevance of the
interaction between SCA2 and U810 proteins has not been elucidated. Two recombinant
MDVS were developed: er5-B40-U810EGFP (referred to as USlOEGFP) expresses a
U810-enhanced green fluorescent protein (EGFP) fusion protein, and er5-B40-
AUSIOEGFP (referred to as AUSIOEGFP) replaces US 10 with EGFP. Neither
modification impacted viral replication rate in vitro. These two mutant viruses were
employed to examine the sub-cellular localization of U810 and SCA2, and the “potential
influence of their interaction on viral growth properties. As judged by EGFP expression,
U810 is found exclusively in the cytoplasm of DF1 cells, an immortalized chicken
embryo fibroblast cell line. SCA2, which is normally found on the cell surface, co-
localizes with U810 in DFI cells stably expressing a SCA2-Flag fusion protein. The
expression of SCA2 in DFl cells results in MDV plaques that are significantly smaller at
6 days post-infection but only when U810 is present. The ability of SCA2 to impact
MDV growth properties is in agreement with the percentage of USlOEGFP or
AUSIOEGFP-infected DFl cells as measured using flow cytometry. Over-expression of

SCA2 impairs MDV Spread in vitro but this influence is dependent on the presence of

74

U810. This is the first report showing a direct influence of SCA2 on MDV, and it
provides insights on how this chicken protein may impact MDV replication and MD

pathogenesis, and helps to confirm its role as an MD resistance gene.

75

Introduction

Marek’s disease (MD) is a lymphoproliferative disease of chickens characterized
by T cell lymphomas and nerve enlargements. The causative agent is the highly
oncogenic alphaherpesvirus Marek’s disease virus (MDV). The 180 Kb MDV genome
has a typical alphaherpesvirus structure with a linear double-stranded DNA genome
consisting of unique long (UL) and unique short (US) regions, each flanked by inverted
repeats (Tulman et al., 2000; Silva et al., 2000). The viral genome is enclosed by viral
nucleocapsids surrounded by a tegument protein layer and an outer viral glycoprotein
envelope (Kato and Hirai, 1985). Viral products and host elements participate within
different structures of the cell for virion packaging and egress. We have reported nine
specific chicken-MDV protein-protein interactions via a bacterial two-hybrid screen

following by in vitro binding assays for confirmation (Niikura et al., 2004).

MD is considered the most serious persistent infectious disease of concern to the
poultry industry worldwide, although it has been controlled through vaccination since
19703. Even with vaccines, MD still has a significant economic impact to the poultry
industry as there are sporadic outbreaks, which require the continuous vaccination and
monitoring of birds. Consequently, there is a need for alternative methods, such as
enhanced resistance to MD, to augment vaccinal control of MD. Chicken stem cell
antigen 2 [SCA2, also known as lymphocyte antigen 6 complex, locus E (LY6E) and
thymic shared antigen 1 (TSA1)], which directly interacts with MDV U810, was further
investigated and shown to be a putative MD resistance gene based on its genetic
association with MD incidence and related traits, and differential transcription following

MDV challenge between MD resistant and susceptible chicken lines (Liu et al., 2006). To

76

address the putative function(s) of SCA2 in MDV biology through association with viral
U810 product, validating their co-localization in chicken cells and determining the
relevance of this interaction is important.

MDV U810 is located in the US region of the viral genome and encodes a 213
amino acid protein. U810 homologues are encoded by other herpesviruses including
herpes simplex virus type 1 (HSV-1), varicella—zoster virus (VZV), and equine
herpesvirus type 1 (EHV-l) (McGeoch et al., 1985; Brown and Harland, 1987; Davison
and Scott, 1986; Telford et al., 1992; Sakaguchi et al., 1992). Based on properties of
HSV-1, MDV U810 in virions is predicted to be a capsid/tegument phosphoprotein
(Yamada et al., 1997). MDV U810 in lymphoblastoid cell lines derived from MD tumors
show U810 is localized in the cytoplasm near patches of glycoprotein B (gB) on the cell
surface, suggesting U810 is associated with virion assembly (Parcells et al., 1999). The
deletion of the MDV U8 region containing U810 and adjacent MDV open reading frames
(ORFs) indicates that U810 is not essential for MDV growth in vitro, however, this
deletion decreases early cytolytic infection, mortality, and tumor incidence in vivo
(Parcells et a1, 1994; Parcells et a1, 1995).

Chicken SCA2 transcription is induced by MDV infection in cultured chicken
embryo fibroblast (CEF) cells (Morgan et al., 2001). However, the function of chicken
SCA2, as in other Species, is not well defined. Chicken SCA2 is associated with v-Rel—
transformed avian bone marrow cells and plays a role in self-renewal of avian erythroid
progenitors (Petrenko et al., 1997; Bresson-Mazet et al., 2008). The majority of work
characterizing SCA2 has been done in mice. Mouse SCA2 is a member of the

lymphostromal cell membrane Ly6 superfamily, and it localizes on the cell surface via a

77

glycosyl-phosphatidylinositol (GPI)-anchor (Classon et al., 1994). Mouse SCA2
functions in regulating intracellular signaling events via T cell receptor and cell-cell
adhesion as a receptor on the lymphocyte membrane (Randle et al., 1993; Fleming and
Malek, 1994; Saitoh et al., 1995; Noda et al., 1996).

Here we report the development of recombinant MDVS that either lack or have
U810 fused with EGFP. Utilizing chicken cell lines stably expressing SCA2, we find that
SCA can co—localize with U810 in the cytoplasm. Furthermore, SCA2 alters the size and
percentage of MDV infected cells but this effect is dependent on the MDV genome

containing US10.

78

Materials and methods

Cells

MDV was propagated on secondary CEF from 10—day old line 0 chicken embryos
and cultivated on a mixture of Liebovitz’s L-15 and McCoy 5A (LM) media (1:1)
supplemented with 4% fetal bovine serum (FBS), penicillin, and streptomycin. DF-l cells
were cultured in LM media with 4% FBS, penicillin and streptomycin. The Vector—DF]
cell line is the DF-l stably transfected with the pSELECT-zeo-mcs vector (Invivogen,
CA, USA). The SCA2F1ag-DP] cell line is identical to Vector-DFl except the vector was
engineered to constitutively express a SCA2F1ag recombinant protein with the Flag tag
inserted immediately downstream of the signal peptide of SCA2. In brief, the entire
coding portion of chicken SCA2 (bases 55 to 435 based on GenBank accession no.
NM_204775) was amplified from a chicken spleen cDNA library by PCR using primers
(SCA28allF: 5’ atcg gt£ga_c_ atg aag gcg ttt ctg ttc gc 3’; SCA2NcoIR: 5’ atcg ga_tgg tca
ctc acg agc cct gag g 3’; restriction sites are underlined). The amplicon was inserted
between the Sall and Ncol sites of the pSELECT-zeo-mcs vector to generate SCA2-
pSELECT-zeo-mcs, and DNA sequenced to confirm that the construct was correct. A
Flag tag was inserted immediately downstream of the signal peptide of SCA2 by PCR
using SCA2-pSELECT—zeo-mcs as the template with the primers (SCA2SalIF;
Sca2FlagNsiIR: 5’ gtt gga gg a_tg_c_at ccg agc acg aaa agc aga tgag ctr atc gtc gtc atc ctr
gta arc cgt gtg ggc tct ctc cac g 3’; restriction sites are underlined, Flag tag sequences are
in italic). The amplicon was inserted between the Sall and N311 sites of SCA2-pSELECT-
zeo-mcs to produce SCA2F1ag-pSELECT-zeo-mcs. The SCA2F1ag-p8ELECT—zeo—mcs

and pSELECT-zeo-mcs vectors were each transfected into the DP] cell line using the

79

Basic Nucleofector Kit (Amaxa Inc., Gaithersburg, MD, USA). The transfected cells
were incubated in medium containing LM media supplemented with 5% FBS, penicillin,
streptomycin, and zeocin (300 ng/ml) until single colonies appeared. The expression of
SCA2 was tested by western blots using anti-Flag mAb and anti-SCA2 antisera. The
single colony with the best SCA2 expression was maintained as the SCA2F1ag-DP] cell

line.

Recombinant BAC clones

To insert EGFP into MDV U810 gene, two step Red-mediated recombination
techniques were applied (Tischer et al., 2006). All PCR amplifications used in BAC
recombineering were conducted with Expand High Fidelity PCR system (Roche,
Indianapolis, IN, USA). Briefly, the kanamycin gene (aphAI) and I-SceI cassette from
pEP-kanS (kindly provide from Niklaus Osterrieder, Cornell University) were amplified
with pEPEGFP.F (5’-TCC TGTACA AGT AAA GCG GCC GCG ACT CTA GAT CAT
AAT CAG CCA T AC CAC ATT TAG GGA TAA CAG GGT AAT CGA TT-3’;
italicized sequence for BerI restriction sites, underlined sequence for Red
recombination, bold sequence to amplify I-Scel cassette from pEP-kanS) and
pEPEGFP.R (5’-TCC TGTACA CTA GCC AGT GTT ACA ACC AAT TAA CC-3’;
italicized sequence for BerI restriction Sites, bold sequence to amplify I-Scel cassette
from pEP-kanS). The primer sets were synthesized by Integrated DNA Technologies
(IDT, Coralville, IA, USA). The PCR amplicon and pEGFP-Nl (Clontech, E Palo Alto,
CA, USA) were digested with BerI and the resulting fragment (~1053 bp) cloned into

pEGFP-Nl to create the pEP-EGFP—Nl construct. The EGFP, aphA] and I-SceI cassette

8O

was amplified from the pEP-EGFP—Nl construct with the primers, U810-EGFP-fus.F (5’-
TAT CTG ACA AAT CTT CGG GAA TCG CCA ACA GGA GAC GGG GAA TCC
TAC TIA ATG GTG AGC AAG GGC GAG GAG CTG T-3’; underlined sequences
for homologous recombination, bold sequences to amplify EGFP, aphAI and I-Scel
cassette) and U810-EGFP.R (5’-CGT TAG TAG CAG TIT TTC CTA AAA TCC TAT
TAA TAA TTG TGC GAT TAG TTA AAA GCA AGT AAA ACC TCT ACA AAT-3’;
underlined sequences for homologous recombination, bold sequences to amplify EGFP,
aphAI and I-Scel cassette). The PCR amplicon with U810-EGFP-fus.F and U810-
EGFP.R was used for Red recombination in SW105 E. coli as earlier described
(Warming et a] 2005, Tischer et a], 2006) to insert between the 212th amino acid
sequence and the downstream stop codon of U810 (155616-155617 nucleotide in Gallid
herpes virus 2 genome, GenBank accession number: NC_002229) of er5-B4O BAC
(Niikura et a1, 2006).

To replace the MDV U810 gene with EGFP, the EGFP, aphAI and I-Scel cassette
was amplified from pEP-EGFP-Nl construct with USlO-EGFP-rep.F (5’ TIT GAA TAC
TGG AGA CGA GCG CCG TGT AAG ATI‘ AAA ACA TAT TGG AGA GGT ATG
GTG AGC AAG GGC GAG GAG CTG T-3’; underlined sequences for homologous
recombination, bold sequences to amplify EGFP, aphAI and I-SceI cassette) and U810-
EGFP.R. The PCR amplicon with U81-EGFP-rep.F and U810-EGFP.R was used for Red
recombination to replace the U810 from the start to stop codons (154978-155617
nucleotide in Gallid herpes virus 2 genome, GenBank accession number: NC_002229) of
er5-B40 BAC (Tulman et al., 2000; Niikura et a1, 2006). After Red recombination

using the above PCR fragment, kanamycin-resistant BAC clones were selected, then I-

81

SceI induced from pBAD-I-Scel plasmid by treatment with arabinose—containing media.
The digestion of I—SceI recognition site in MDV-BAC and subsequent second Red
recombination at duplicated sequences were conducted in SW105 cells. After the second
Red recombination, the positive MDV-BAC clone was kanamycin sensitive, thus,
screened via PCR amplification using U810fl.F (5’-GAGAGGAGA
ACGTGT'ITGAATAC-3’) and EGFP.R (5’-CTGCTTCATGTGGTCG GGGTAG-3’)
primers.

The resulting MDV-BAC clone containing the U810-EGFP fusion protein was
named USlOEGFP and the MDV-BAC clone with the replacement of U810 by EGFP
was named AUSIOEGFP. Both BAC clones were purified, digested with BamHI, and

their digestion patterns analyzed by gel electrophoresis.

Generation of viruses

To generate MDVS from all three BAC clones, purified plasmids (er5-B40
BAC, USlOEGFP and AUSIOEGFP) were individually transfected into CEF. The
nucleofector II (Amaxa Biosystems, Gaithersburg, MD, USA) was used to transfect
MDV-BAC into CEF. All CEF cultures were incubated at 37 C°, 5% CO2 incubator in
LM media supplemented with 4% FBS, penicillin, and streptomycin. The PBS was

reduced from 4 % to 1 % after virus inoculation until MDV plaques were observed.

One step growth curve assay and plaque area determination
Plaque growth assays were performed as previously reported (Mao et al., 2008).

Briefly, 100 PFU of various viruses were inoculated onto CEF cells seeded on 35-mm

dishes. On 1, 2, 3, 4, and 5 days after inoculation, the infected cells were trypsinized,
serial dilutions inoculated onto fresh cells, and plaques of the different dilutions counted 7
days later in triplicate to determine growth characteristics of er5-B40-derived,
US lOEGFP and AUSIOEGFP viruses.

500 PFU USlOEGFP or AUSIOEGFP were inoculated onto 5x105 Vector-DFI
and SCA2F1ag-DF1 cells seeded on 35-mm dishes, and the cell cultures incubated with
LM supplemented with 1% FBS, penicillin, and streptomycin. Virus plaques on Vector-
DF] and SCA2F1ag-DF1 cells 7 days post-infection in three replicates were examined
under a LEICA DM [RB/E inverted fluorescence microscope (Leica Wetzlar, Germany).
7-10 plaques were counted on each dish and 21-30 plaques for each virus were counted in
total. Images were captured by a DEL-750CE digital system (Optronics, Goleta, CA,
USA), and plaque sizes determined using the Image] software
(rsb.info.nih.gov/ij/index.html). Statistical significance of plaque areas were performed

using the Student’s T—test.

Immunofluorescence and confocal image analysis

SCA2F1ag-DP] and fresh CEF cells grown on glasscovers were inoculated with
1000 PFU of recombinant viruses, and incubated in LM medium with 4% FBS, penicillin,
and streptomycin at 37°C. The CEF with recombinant viruses were fixed with 100%
acetone, washed 3 times with PBS , and stained with Hoechest 33342 (Invitrogen,
Carlsbad, CA, USA). SCA2F1ag-DP] cells with recombinant virus were incubated with
anti-Flag M2 mAb (1:100) for 20 min at 4°C, then Rhodamine-conjugated anti-mouse

goat IgG (1:400; Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA) as second Abs

83

for 20 min at 4°C, and stained with Hoechest 33342 after 3 washes with PBS. The stained
cells were analyzed with Olympus fluoview 1000 confocal microsc0pe (Olympus, Tokyo,

Japan) and the images analyzed using FVlO-ASW software (Olympus, Tokyo, Japan).

Western blot analysis

CEF with recombinant viruses were lysed in Cellytic M Mammalian Cell lysis
reagent (Sigma-Aldrich Inc., Milwaukee, WI, USA), supplemented with 1% P8340
protease inhibitor cocktails (Sigma-Aldrich Inc., Milwaukee, WI, USA) and followed
with sonication and centrifugation. Cell lysates were mixed with loading and reducing
buffer, heated at 70°C for 10 min and loaded on 10% SDS-PAGE gel (Invitrogen,
Carlsbad, CA, USA). The samples were blotted on Immobilon-PSQ PVDF transfer
membrane (Millipore, Billerica, MA, USA). After blocking in PBS containing 5% non-
fat milk for 1 hour at room temperature, membranes were probed with anti-GFP mAb
(Sigma-Aldrich Inc., Milwaukee, WI, USA) at 4°C overnight. Membranes were washed
three times in PBS before incubation with a goat anti-mouse IgG conjugated with
horseradish peroxidase (Zymed, South San Francisco, CA, USA) at room temperature for
1 hour. Proteins were detected using ECL Western blotting substrate (Pierce, Rockford,

IL, USA) after washing for three times.

Flow cytometry analysis
Three replicates of SCA2F1ag-DE] and Vector-DP] cells infected with
USlOEGFP or AUSlOEGFP viruses were trypsinized and harvested (1000xg, 5 min).

After 7 days post-infection, 106 cells were washed with cold flow cytometry buffer

84

(phosphate buffered saline containing 1% FBS and 0.1% sodium azide). The cells were
analyzed using a Becton-Dickinson FACScaliber flow cytometer and CellQuest Pro

software (BD Bioscience, San Jose, CA, USA).

85

Results

Construction of USlOEGFP and AUSlOEGFP MDV-BAC clones

Insertion of EGFP to generate either a fusion protein with U810 on the C-
tenninal end or to delete U810 were performed using the er5-B40-BAC clone, which
generates virulent MDV, and BAC modification techniques (Fig. 3-1). To produce a
recombinant MDV-BAC that expresses a U810-EGFP fusion protein, the EGFP-
containing amplicon was inserted between the 212th amino acid and the stop codon of
U810 resulting in er5-B40-U810EGFP (referred to as USlOEGFP). Likewise, the
MDV-BAC clone lacking USIO was produced by replacing U810 with EGFP from the
start to Stop codons to generate er5-B40-AU810EGFP (referred to as AUSIOEGFP).
Both USlOEGFP and AUSlOEGFP BAC clones retain the natural USIO promoters for
downstream expression of U810-EGFP and AUSlO-EGFP recombinant genes.
Nucleotide analysis of the two BAC clones confirmed the genetic modifications. Analysis
of the BAC clones compared to the parental er5-B4O also indicates that no unexpected
modifications occurred in the generation of the recombinant MDV-BAC clones (Fig. 3-2);
unfortunately, the U810-containing BamHI fragment is too large to detect a change in
size after the EGFP insertion into er5-B40 (21.6, 21.5, and 20.9 kb for er5-B40,

USlOEGFP, and AUSIOEGFP, respectively).

86

a)

TRL - IRL 1R3 US TRS

[:1 Llfi—ZZI

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

J
U510 EGFP
b)
TRL '_. IRL IRS US TRS
1:1 4 l 1--——-E::I
[ :1 T J
22> r:l> fi- <L u

 

 

 

Figure 3-1. Schematic diagram of recombinant MDV-BAC clones. a) Schematic diagram
of MDV U810 and neighboring MDV ORFS in USlOEGFP—BAC. The insertion of EGF P
to generate a fusion protein at the C-terminus of MDV U810. b). Schematic diagram of

MDV U810 and neighboring MDV ORFS in AUSIOGFP-BAC where US10 is replaced
with EGFP.

87

23 kb

9.4 kb _

6.6 kb —

4.4 kb —

1.5kb -

600 bp _

 

Figure 3-2. BamHI digestion pattern of purified USlOEGFP-BAC and AUSIOEGFP—
BAC clones. MDV-BAC clones are purified and digested with BamHI. Digestion
patterns are compared with er5-B4O BAC clone. Lane 1, DNA size marker; Lane 2,
erS—B40; Lane 3, USlOEGFP; and Lane 4, AUSIOEGFP.

88

Generation and growth properties of the mutant viruses in CEF

Recombinant MDVs were generated by transfection of the USlOEGFP and
AUSIOEGFP-BAC clones into CEF, and grown until virus plaques were visualized. The
expression of the USlOEGFP fusion protein or EGFP protein in CEF from the
USlOEGFP and AUSIOEGFP viruses, respectively, were detected by western blots using
anti-GFP mAb. As predicted, the USlOEGFP and EGFP proteins migrated to 52 and 28
kDa, respectively (Fig. 3-3).

After determination of virus titers, 100 PFU of each virus was inoculated onto
CEF cells to compare growth properties of the parental and recombinant viruses. The
plaque assay showed that neither USlOEGFP or AUSIOEGFP were impaired for virus
grth properties in vitro (Fig. 3-4), which confirmed that U810 is dispensable for virus

growth in vitro (Parcell, et al., 1994).

89

ddDEIOlSIl
ddDEIOISflV
)IOOW

rut-n... — 52 kDa

‘— 28 kDa

Figure 3-3. Western blot analysis of USlOEGF P and AUSIOEGFP viruses. CEF infected
with USlOEGFP and AUSIOEGFP viruses, as well as an uninfected control CEF (mock),
were detected using anti-GFP mAb. The molecular size of USlOEGFP and AUSIOEGFP
are 52 kDa and 28 kDa respectively.

4.5 ~

-0- er5-B40
-I- US l OEGFP
+ AUS 1 OEGFP

(lw/"Jd) or 301 19111 mm

 

 

 

Figure 3-4. One step grth curve assay of er5-B40, USlOEGFP, AUSIOEGF P viruses
in CEF cells. 100 PFU of various viruses were inoculated onto CEF cells seeded onto 35-
mm dishes. On 1, 2, 3, 4, and 5 days afier inoculation, the infected cells were trypsinized,
serial dilutions inoculated onto fresh cells, and plaques of the different dilutions were

counted 7 days later in triplicate to determine growth characteristics of rMDS-B40,
USlOEGFP and AUSIOEGFP viruses.

91

Cellular localization of U810-EGFP and SCA2 proteins

CEF infected with USlOEGFP virus were grown on cover glass slides for 3 days, .
and the sub-cellular localization of U810 were analyzed by visualization of EGFP under
the fluorescent microscope. U810 is exclusively localized in the cytoplasm in infected
cells (Fig. 3-5). Some co—localization of U810 and the cytoplasmic DNA fragment
(stained by Hoechest 33342, and marked with an * in Fig. 3-5a) suggests U810 is
associated with viral DNA and virion assembly.

SCA2F1ag is expressed on the cell surface of SCA2F1ag-DF1 cell lines through
immunofluorescence using anti-Flag M2 mAb (Fig. 3-6). After inoculation of
USlOEGFP virus on the SCA2F1ag-DP] cells, the sub-cellular localization of U810 and
SCA2 was observed through EGFP and immunofluorescence using anti-Flag M2 mAb. In
the SCA2F1ag-DF1 cells infected with USlOEGFP, SCA2 can co-localized with U810 in
the cytOplasm (marked by an * in Fig. 3-7c). In the uninfected SCA2F1ag-BF] cells, the

majority of SCA2 is on the cell surface.

b

   

 

Figure 3-5. Confocal imaging to determine sub-cellular localization of U810 in CEF
infected with USlOEGFP virus. a) USlOEGFP-infected CEF stained with Hoechst 33342
(blue). Bar, 40 um. b) USlOEGFP visualized as green fluorescence. c) Merged image of
a and b. Co—localization of U810-EGFP and cytoplasmic viral DNA are marked by
asterisks. d) Infected CEF visualized through differential interference contrast (DIC)
lmaglng.

 

Figure 3-6. Confocal images of SCA2 in SCAZFIag-DFI cells. a) SCA2F1ag-DF]
strained with Hoechst 33342 (blue). Bar, 20 um. b) SCA2F1ag—DH stained with anti-
Flag M2 mAb and goat anti-mouse IgG conjugated with Texas Red (red). c) Merged
image ofa and b. d) SCA2F1ag-DFI cells visualized through DIC imaging.

 

Figure 3-7. Confocal immunofluoresence images of U810-EGFP and SCA2 in
SCA2F1ag-DP] cells infected with USlOEGFP virus. a) SCA2F1ag-DP] culture image to
Show U810-EGFP (green) and Hoechst 33342 (blue). Bar, 20 um. b) SCA2F1ag-DP]
culture stained with Hoechst 33342 (blue), and anti-Flag M2 Ab and goat anti-mouse IgG
conjugated with Texas Red (red). c) Merged image of a and b. Co—localization of SCA2
and U810-EGFP in the cytoplasm are marked by asterisks.

Growth properties of U810EGFP and AU810EGFP mutant viruses in Vector-DFl
and SCA2F1ag-DF1 cells

Two cells lines were produced. Vector-DFl are DFl cells stably transfected with
the pSELECT-zero-mcs vector only. SCA2F1ag-BF] are identical except the vector was
engineered to constitutively express a recombinant SCA2 protein where a Flag tag was
inserted immediately downstream of the SCA2 signal peptide. These cell lines allowed us
to examine the growth pr0perties of USlOEGFP and AUSIOEGFP recombinant viruses in
the presence or absence of SCA2. 500 PFU U8 lOEGFP and AUSIOEGFP were seeded on
both Vector-DFI and SCA2F1ag-DH cells. At 6 days post-infection, the plaque areas on
Vector-DFl and SCA2F1ag-DF1 cells were determined and analyzed by monitoring
fluorescence expressed from the viruses. Plaque sizes of USlOEGFP on SCA2F1ag-DF1
cells were significantly reduced (P<0.000001) to 56% in comparison to the plaque areas
of the same virus grown on Vector-DF] cells (Fig. 3-8, 3-9a). The reduction of plaque
area was not observed when the recombinant virus lacked US10 (Fig 3-8, 3-9b). These
results demonstrate that an effect of SCA2 on MDV plaque size is dependent on the
presence of U510.

To help confirm and extend the results of plaque size determinations, the percent
of USlOEGFP and AUS 10EGF-infected cells were analyzed via flow sorting (Fig. 3-10).
At 6 days post-infection, the percent of AUSlOEGFP-infected cells was not significantly
different between those grown on SCA2F1ag-DP] or Vector-DP] cells (1.3% vs. 1.38%).
In contrast and consistent with the plaque assays, expression of SCA2 in SCA2F1ag-DP]

cells reduced the percent of U8 lOEGFP-infected cells compared to the Vector-DF] cells.

96

. AUSIOEGFP USlOEGFP

Vector-DFI

 

SCA2F1ag-DF1

Mock

 

Figure 3-8. Plaques of USlOEGFP and AUSIOEGFP viruses on Vector-DFI and
SCA2F1ag-DF1 cells. 500 PFU of USlOEGFP and AUSIOEGFP viruses were inoculated
on Vector-DP] and SCA2F1ag-DP] cells in three replicates. Infected cells with
USlOEGFP and AUSlOEGFP viruses were detected with green fluorescence. The
plaques afier 6 days post-infection were photographed with a fluorescence microscope
and captured with a DEL-750CE digital system. Bars, 200 um.

8)
Vector-DF l

SCA2F1ag—DF 1

I

care anbeld aAllelaH

 

US l OEGFP

Vector-DF l

b) SCA2F1ag-DF1

ease anbejd slump};

 

AUS 1 OEGFP

Figure 3-9. Relative plaque sizes of recombinant USlOEGFP and AUSIOEGFP viruses
on Vector-DP] and SCA2F1ag-DP] cells. Vector-DFl and SCA2F1ag-BF] cells were
infected with USlOEGFP (a) and AUSlOEGFP (b) in three replicates, and used for
determination of plaque sizes. Plaque areas of USlOEGFP and AUSlOEGF P viruses were
detected through the green fluorescence of EGFP. The plaques after 6 days post-infection
were photographed with a fluorescence microscope, captured with a DEL-750CE digital
system, and measured with the Image J software. Seven to ten plaques were counted in
each 35 mm dish, and 21-30 plaques in total for each virus were counted. Means and
stande deviations (error bars) of relative plaque area are given.

    

 

 

 

   

 

 
 

 

 

 

 

0.54% 0.33%
' l
Vector-DP] with USlOEGFP SCA2F1ag-DF1 with USlOEGFP
,r‘ 1.3% 1.38%
Vector-DFl with AUSlOEGFP SCA2F1ag-DP] with AUSIOEGFP

Figure 3-10. The percentage of infected cells within Vector-DP] and SCA2F1ag-BF 1
cells infected with USlOEGFP and AUSl OEGFP viruses. The average percentage of three
replicates of infected cells within Vector-DF] and SCA2F1ag-DP] cells with USlOEGFP
(a) and AUSIOEGFP (b) were determined by flow cytometry.

99

Discussion

MDV is a highly cell-associated virus and the aetiological agent of MD. Although
MD has been controlled through vaccination since the 1970’s, MD is still a significant
threat to the poultry industry as there are sporadic outbreaks. Consequently, alternative
methods, such as genetic resistance, are needed to augment vaccinal control of MD. We
previously reported that chicken SCA2 is a MD resistance gene due to the following
criteria: (1) association to MD incidence and related traits in a commercial resource
population, (2) transcriptional differences between MD resistant and susceptible
experimental chicken lines following challenge with MDV, and (3) a direct protein
interaction with MDV U810 as determined by a two-hybrid screen followed by an in
vitro binding assay (Liu et al., 2003). The potential role of SCA2 in MD biology
encouraged us to investigate its properties and impact on MDV infection.

The recombinant USlOEGFP and AUSlOEGFP viruses were develop to help
confirm the interaction of SCA2 and U810 proteins in vitro. During the course of these
studies, it was noticed that expression of SCA2 altered the size of virus plaques but only
for USlOEGFP. Specifically, plaque sizes of USlOEGFP on 8CA2Flag—DF1 cells were
significantly reduced in the SCA2 over-expressing cells (Fig. 3-8, 3-9a), however, this
effect on plaque Sizes was not observed for AUSlOEGFP between the two cell lines (Fig.
3-8, 3-9b). This suggests that SCA2 can influence MDV replication or spread in vitro but
this effect is dependent on the presence of U510 in the viral genome. To further analyse
and confirm this result, the percent of infected SCA2Flag-D‘Fl and Vector-DFI cells with
USlOEGFP and AU810EGFP viruses were analyzed via flow cytometry. The results

were consistent with those results from the plaque size assays as the percent of infected

SCA2F1ag-DP] and Vector-DF] cells for USlOEGFP virus reflected their plaque size
changes (44% reduced plaque areas vs. 39% reduced infected cells), and the
AUSlOEGFP virus did not either form statistically significantly different plaque areas nor
different percentages of infected cells (Fig 3-9, 3-10). Based on the results, we concluded
that the over-expression of SCA2 impairs MDV growth in vitro, and this impairment is
dependent on the expression of MDV U810.

Based on the putative function of mouse SCA2, we hypothesize three putative
roles of SCA2 in MD resistance. These putative roles are summarized as: (l) SCA2
promotes cell-cell adhesion for MDV spread, (2) SCA2 transduces signals for the
transformation of lymphocytes with latent MDV, and (3) SCA2 interferes in virion
assembly and egress via association with MDV U810. While our results do not rule out
the first two possible roles, the impact of SCA2 on MDV plaque size and number of
infected cells supports a role for SCA2 in influencing MDV assembly.

Although the expression of SCA2 in our results is associated with inhibition of
viral replication, this is likely an artifact of unregulated and over-expression of SCA2. All
other lines of evidence suggest that SCA2 expression promotes viral replication.
Specifically, in naturally-occurring lymphocytes of MD susceptible chicken lines where
there are high levels of MDV replication and in cultured CEF infected with MDV, SCA2
transcription is induced (Liu et al., 2003, Morgan et al., 2001). The confirmed protein-
protein interaction between SCA2 and U810 would also support a favorable action of
SCA2 on MDV as it is highly unlikely that an unfavourable interaction would be
evolutionarily conserved. It is interesting to note that CD59, the closest Ly6 superfamily

member to SCA2, was found packaged in HSV-1 virions (Loret et al., 2008), which

101

indicates other Ly-6 family members may play roles in replication of other alpha-
herpesviruses.

The requirement of U810 for impaired MDV growth due to the over-expressed
SCA2 strongly supports the physical interaction of SCA2 and viral U810 proteins (Liu et
al., 2003). The localization of U810 and SCA2 was examined to provide additional
support for this protein interaction. U810 is only localized to the cytoplasm (Fig. 3-5). In
the presence of U810, SCA2 can be found in the cytoplasm and co-localized with U810
(marked by * in Fig. 3-7c), but the majority of SCA2 remains on the cell surface (Fig. 3-
6). We did not observe cell surface expression of U810 protein. These observations,
though not conclusive, support the protein interaction and our result that over-expression
of SCA2 protein interferes in virus morphogenesis via its direct association with MDV
U810 in the cytoplasm.

HSV U810 is a capsid/tegument phosphoprotein and it co-purifies with the
nuclear matrix (Yamada et al., 1997). We did not find U810 protein in the nucleus. The
accumulation of U810 in the cytoplasm sometimes co-localized with DNA fragments
(marked by * in Fig. 3-5c), which could be the viral DNA genome as no cytoplasmic
DNA staining was observed in adjacent uninfected cells. As an alpha-herpesvirus, MDV
capsid particles containing viral DNA are transported from the nucleus to cytoplasmic
organelles for envelopment with the various tegument proteins. Consequently, these
observations suggest MDV U810 is a viral tegument protein and plays a role in virion
assembly in the cytoplasm.

In examining the expression patterns of SCA2 in chicken tissues, we found a

unique pattern in the bursa. SCA2 is specifically expressed on the cortical-medullary

102

epithelial cells (CMEC) surrounded by MHC class H presenting cells. Furthermore,
expression profiling of bursal cells induced by contact with SCA2-expressing cells shows
down-regulation of numerous genes including CD798, B cell linker (BLNK), spleen
tyrosine kinase (S YK), and gamma 2-phospholipase C (PLCGZ) that are involved in the B
cell receptor (BCR) and immune response signaling pathways. Combined, these results
support the impact of SCA2 in MDV-induced transformation of lymphocytes though the
mechanism(s) is unknown. However, while SCA2 mRNA is induced by MDV infection,
SCA2 protein has not been detected in MDV-infected CEF using polyclonal antibodies
against SCA2. These somewhat contradictory results indicate that further studies are
needed to fully elucidate the role of SCA2 in MDV replication and pathogenesis.

In summary, we developed two recombinant viruses to investigate the sub-cellular
localization of MDV U810 and its potential influence on SCA2. MDV U810 was
localized in the cytoplasm and could not be seen in the nucleus. In the cytoplasm, MDV
U810 could co—localize with SCA2, which is normally found on the cell surface.
USlOEGFP virus formed significantly smaller plaques on cells in which SCA2 was over-
expressed. The plaque areas of AUSlOEGFP were not significantly different between
Vector-DF] and SCA2F1ag-DP] cells. Therefore, we conclude over-expression of SCA2
impairs MDV spread via association with MDV U810 protein in a cultured cell line but it

is likely that under natural conditions, expression of SCA2 favors viral morphogenesis.

Acknowledgements

We thank Laurie Molitor, Lonnie Milam, and Dr. Melinda Frame for their

excellent technical assistance with DNA sequencing, cell transfection and laser scanning

103

confocal microscopy. We thank Dr. Henry Hunt for FACS analysis and Dr. Dodgson for

useful suggestions. This work was supported in part by USDA to HHC.

104

References

1.

10.

ll.

12.

Biggs, P. M. 2000. The History and Biology of Marek's Disease Virus, p. 1-24. In
K. Hirai (ed.), Marek’s Disease. Springer, Berlin.

Bresson-Mazet, C., O. Gandrillon, and S. Gonin-Giraud. 2008. Stem cell
antigen 2: a new gene involved in the self-renewal of erythroid progenitors. Cell
Prolif 41:726-38.

Brown, S. M., and J. Harland. 1987. Three mutants of herpes simplex virus type
2: one lacking the genes U810, U81] and U812 and two in which Rs has been
extended by 6 kb to 0.91 map units with loss of Us sequences between 0.94 and
the Us/TRS junction. J Gen Virol 68 ( Pt 1):l-18.

Classon, B. J., and L. Coverdale. 1994. Mouse stem cell antigen Sca-2 is a
member of the Ly-6 family of cell surface proteins. Proc Natl Acad Sci U S A
91:5296-300.

Davison, A. J., and J. E. Scott. 1986. The complete DNA sequence of varicella-
zoster virus. J Gen Virol 67 ( Pt 9):]759-816.

Fleming, T. J., and T. R. Malek. 1994. Multiple glycosylphosphatidylinositol-
anchored Ly—6 molecules and transmembrane Ly-6E mediate inhibition of IL-2
production. J Immunol 153:1955-62.

Kato, 8., and K. Hirai. 1985. Marek's disease virus. Adv Virus Res 30:225-77.

Liu, H. C., M. Niikura, J. E. Fulton, and H. H. Cheng. 2003. Identification of
chicken lymphocyte antigen 6 complex, locus E (LY6E, alias SCA2) as a putative
Marek's disease resistance gene via a virus-host protein interaction screen.
Cytogenet Genome Res 102:304-8.

Loret, 8., G. Guay, and R. Lippe. 2008. Comprehensive characterization of
extracellular herpes simplex virus type 1 virions. J Vir0182z8605-18.

Mao, W., M. Niikura, R. F. Silva, and H. H. Cheng. 2008. Quantitative
evaluation of viral fitness due to a single nucleotide polymorphism in the Marek's
disease virus UL41 gene via an in vitro competition assay. J Virol Methods
148:125-31.

McGeoch, D. J., A. Dolan, 8. Donald, and F. J. Rixon. 1985. Sequence
determination and genetic content of the Short unique region in the genome of
herpes simplex virus type 1. J Mol Biol 181:1-13.

Morgan, R. W., L. Sofer, A. S. Anderson, E. L. Bernberg, J. Cui, and J.
Burnside. 2001. Induction of host gene expression following infection of chicken

105

13.

14.

15.

l6.

l7.

18.

19.

20.

21.

22.

embryo fibroblasts with oncogenic Marek's disease virus. J Virol 75:533-9.

Niikura, M., H. C. Liu, J. B. Dodgson, and H. H. Cheng. 2004. A
comprehensive screen for chicken proteins that interact with proteins unique to
virulent strains of Marek's disease virus. Poult Sci 83:1117-23.

Niikura, M., Dodgson, J.B., Silva, R., Cheng, H.H. 2006. Presented at the 4th
International workshop on the molecular pathogenesis of Marek's disease virus,
Newark, Delaware.

Noda, 8., A. Kosugi, S. Saitoh, S. Narumiya, and T. Hamaoka. 1996.
Protection from anti-TCR/CD3-induced apoptosis in immature thymocytes by a

signal through thyrrric shared antigen-llstem cell antigen-2. J Exp Med 183:2355-
60.

Parcells, M. 8., A. S. Anderson, J. L. Cantello, and R. W. Morgan. 1994.
Characterization of Marek's disease virus insertion and deletion mutants that lack
USl (ICP22 homolog), U810, and/or U82 and neighboring short-component open
reading frames. J Virol 68:8239-53.

Parcells, M. 8., A. S. Anderson, and T. W. Morgan. 1995. Retention of
oncogenicity by a Marek's disease virus mutant lacking six unique short region
genes. J Virol 69:7888-98.

Parcells, M. 8., R. L. Dienglewicz, A. S. Anderson, and R. W. Morgan. 1999.
Recombinant Marek's disease virus (MDV)-derived lymphoblastoid cell lines:

regulation of a marker gene within the context of the MDV genome. J Virol
73:1362-73.

Petrenko, O., I. Ischenko, and P. J. Enrietto. 1997. Characterization of changes
in gene expression associated with malignant transformation by the NF-kappaB
family member, v-Rel. Oncogene 15: 1671-80.

Prigge, J. T., V. Majerciak, H. D. Hunt, R. L. Dienglewicz, and M. S. Parcells.

2004. Construction and characterization of Marek's disease viruses having green
fluorescent protein expression tied directly or indirectly to phosphoprotein 38
expression. Avian Dis 48:471-87.

Randle, E. 8., G. A. Waanders, M. Masciantonio, D. I. Godfrey, and R. L.
Boyd. 1993. A lymphostromal molecule, thymic shared Ag-l, regulates early
thymocyte development in fetal thymus organ culture. J Immunol 151:6027-35.

Saitoh, 8., A. Kosugi, S. Noda, N. Yamamoto, M. Ogata, Y. Minami, K.
Miyake, and T. Hamaoka. 1995. Modulation of TCR-mediated signaling
pathway by thymic shared antigen-1 (TSA-1)/stem cell antigen-2 (Sea-2). J
Immunol 155:5574-81.

106

 

23.

24.

25.

26.

27.

28.

29.

Sakaguchi, M., T. Urakawa, Y. Hirayama, N. Miki, M. Yamamoto, and K.
Hirai. 1992. Sequence determination and genetic content of an 8.9-kb restriction
fragment in the short unique region and the internal inverted repeat of Marek's
disease virus type 1 DNA. Virus Genes 6:365-78.

Silva, R. F. 2000. The Genome Structure of Marek's Disease Virus, p. 143-158.
In K. Hirai (ed), Marek's Disease. Springer, Berlin.

Telford, E. A., M. 8. Watson, K. McBride, and A. J. Davison. 1992. The DNA
sequence of equine herpesvirus-1. Virology 189:304—16.

Tischer, B. K., J. von Einem, B. Kaufer, and N. Osterrieder. 2006. Two-step
red-mediated recombination for versatile high-efficiency markerless DNA
manipulation in Escherichia coli. Biotechniques 40:191-7.

Tulman, E. R., C. L. Afonso, Z. Lu, L. Zsak, D. L. Rock, and G. F. Kutish.
2000. The genome of a very virulent Marek's disease virus. J Virol 74:7980-8.

Warming, 8., N. Costantino, D. L. Court, N. A. Jenkins, and N. G. Copeland.
2005. Simple and highly efficient BAC recombineering using galK selection.
Nucleic Acids Res 33:e36.

Yamada, H., T. Daikoku, Y. Yamashita, Y. M. Jiang, T. Tsurumi, and Y.
Nishiyama. 1997. The product of the U810 gene of herpes simplex virus type 1 is

a capsid/tegument-associated phosphoprotein which copurifies with the nuclear
matrix. J Gen Virol 78 (Pt 11):2923-31.

107

Chapter 4
Mao, W., M. Niikura, R. F. Silva, and H. H. Cheng. (2008) Quantitative evaluation
of viral fitness due to a single nucleotide polymorphism in the Marek’s disease virus

UL41 gene via an in vitro competition assay. J Virol Methods 148:125-31.

108

Abstract: Marek’s disease, a T cell lymphoma, is an economically important disease of
poultry caused by the Marek’s disease virus (MDV), a highly cell-associated alpha-
herpesvirus. A greater understanding of viral gene function and the contribution of
sequence variation to virulence should facilitate efforts to control Marek’s disease in
chickens. To characterize a naturally-occuning single nucleotide polymorphism (SNP;
AY510475:g.108,206C>T‘) in the MDV UL41 gene that resulted in a missense mutation
(AA801683:p.Arg377Cys), bacterial artificial chromosome (BAC)-derived MDVs that
differed only in the UL41 SN P were evaluated using a head-to-head competition assay in
vitro. Monitoring the frequency of each SNP by pyrosequencing during virus passage
determined the ratio of each viral genome in a single monolayer, which is a very sensitive
method to monitor viral fitness. MDV with the UL41*CyS allele showed enhanced fitness
in vitro. To evaluate the mechanism of altered viral fitness caused by this SNP, the
virion-associated host shutoff (vhs) activity of both UL41 alleles was determined. The
UL41*Cy3 allele had no vhs activity, which suggests that enhanced fitness in vitro for
MDV with inactive vhs was due to reduced degradation of viral transcripts. The in vitro

competition assay should be applicable to other MDV genes and mutations.

Introduction

Marek’s disease virus (MDV; family Herpesviridae, genus Mardivirus, species
Gallid herpesvirus 2) is an infectious pathogen and the cause of Marek’s disease, which
is characterized by T cell lymphomas, neurological disorders, and death in susceptible
chickens (Osterrieder et al. 2006). Periodic yet unpredictable disease outbreaks that
vaccines cannot adequately protect make Marek’s disease a serious problem for the
poultry industry worldwide. As the molecular basis of the increasing virulence is
unknown, there is a need to understand the role of naturally-occurring mutations in MDV
genes on virulence (Witter, 1996). In this report, a head-to-head competition assay is
described that contributes to the understanding of the molecular basis for viral fitness
variance, and should enable more efficacious vaccines and other methods that provide
improved disease control.

MDV has an alpha—herpesvirus structure that is similar to herpes simplex virus
type-1 (HSV-1) with ~100 genes contained within its 175 kb DNA genome (Silva et al.,
2001). Recently, MDV genomes have been cloned into bacterial artificial chromosome
(BAC) vectors (Schumacher et al., 2000; Petherbridge et al., 2004; Niikura et al., 2006).
Besides providing a platform for infectious molecular clones, MDV-BACS can be readily
manipulated even at the nucleotide level, which enables the direct association of specific
sequences to phenotypes. Ideally, recombinant MDVs would be engineered in sites where
mutations may account for the observed variation in virulence (e.g., Spatz and Silva,
2007; Spatz et al., 2007).

During the cloning and full genome sequencing of virulent MDV Mdll strain

(.Niikura et al., 2006), a nonsynonymous single nucleotide polymorphism (SNP;

110

AY510475zg.108,206C>T) was found in the UL41 gene that resulted in Arg to Cys
substitution in residue 377 (AA801683zp.Arg377Cys). UL41 encodes the virion-
associated host shutoff (vhs) protein, which degrades both host and viral mRNA during
the viral cytolytic infection and assists the virus in evading the host immune response
(Read and Frenkel, 1983; Kwong and Frenkel, 1988; Read et al., 1993; Suzutani et al.,
2000; Murphy et al., 2003; Barzilai et al., 2006). The UL41 point mutation identified in
the MDV clone is interesting because it is located in a critical amino acid that is
conserved among alpha-herpesvirus genomes (Everly and Read, 1999). Thus, questions
arise as to whether this point mutation would affect viral fitness or activity of the MDV
UL41 gene product, and is there any relationship between the MDV UL41 gene and
virulence?

The straightforward and preferred way of quantifying viral fitness is by a head-to-
head competition experiment using Stable genetic markers. This is because the two
different viruses must compete in the same environment, and assuming the viruses do not
recombine, the genetic markers provide proxies for each genome. Competition
experiments have applied in other viruses including vesicular stomatitis virus (Novella,
2003), human immunodeficiency virus type-l (Holland et al., 1991; Yuste et al., 2005),
and tobacco etch virus (Carrasco et al., 2007). This method might be particularly useful
for MDV as the traditional plaque assay counts infectious foci generated from a single
infected cell rather than a single virion due to the strict cell—associated nature of this virus.
Furthermore, many studies examining defined recombinant MDVs have shown that
growth rate measurements are not very sensitive and, more importantly, are not good

predictors of in vivo effects (Reddy et al., 2002; Silva et al., 2004; Prigge et al., 2004;

ll]

Kamil et al. 2005; Schumacher et al., 2005), thus, a more sensitive in vitro method is
desired.

For MDV, pyrosequencing was used to monitor the UL41 SNP. Pyrosequencing
is a DNA sequencing technology based on a 4-enzyme real-time monitoring of DNA
synthesis, and accurately measures the relative abundance of each SNP nucleotide
(Ronaghi et al., 1998; Ronaghi, 2001). This technology has been applied to determine the
influence of specific HIV SNPs on resistance to protease inhibitors among others
(O’Meara et al., 2001; Lahser et al., 2003). In this study, viral fitness was quantified by
evaluating the relative SNP frequency for MDV populations that differed only in UL41
alleles following repeated passages in cell culture. Also, the UL41 vhs activity for each

allele was measured in an attempt to help explain the affect on viral fitness.

112

Materials and methods
Culture method for MDV and DNA purification

MDV was propagated on secondary CEF from line 0 chicken embryos cultivated
on a mixture of Liebovitz’s L-15 and McCoy 5A media (1:1) supplemented with 4% FBS,
penicillin, and streptomycin. DNA of MDV-infected cells was extracted in Tris buffer
(0.1 M, pH 8.0) containing 1% SDS, 1 mM EDTA, 0.1 M NaCl and 100 rig/ml proteinase

K, followed by phenol extraction and ethanol precipitation.

Mini-l mutagenesis to generate pMDV-UL41*Arg and pMDV-UIAI"Cys-rev

As shown in Fig. 4-1, recombinant BAC clones containing the entire MDV strain
Mdll genome were generated that differ only in the genomic sequence that encodes
UL41 amino acid residue 377 (GenBank no. AA801683) using the mini-it mutagenesis as
described by Court et a1. (2003) and Costantino and Court (2003). Briefly, the
oligonucleotides UL41mut (5’
GCTGTCTCATCACGTCCCTCTTGCATI‘ATAGGGAACCGTITCAAAATACTAAC
CCTGGAAGTTCTGCGCT 3’) and UL41mutRev (5'
GCTGTCTCATCACGTCCCTCTTGCATTATAGGGAAGCACTTCAAAATACTAAC
CCTGGAAGTTCTGCGCTI‘ 3') were designed to introduce specific point mutations and
synthesized (Operon, Huntsville, AL, USA). UL41mut was mixed with competent cells
containing the Mdl 1ngoxP5-12 MDV-BAC clone (Niikura et al., 2006), which has the
UL41*Cys allele (Cys at amino acid residue 377) and referred to as pMDV-UL41*Cys,
and screened by PCR using primers 97556F (5’ CGATAGTGCTAGCTICATCTAC 3’)

and 97628AtGR (5’ GAACTTCCAGGGTTAGTA'I'I'I'IGAAACGG 3’) to generate

ll3

pMDV-UL41*Arg. Similarly, UL41mutRev was mixed with the competent cells
containing pMDV-UL41*Arg, subjected to electroporation, and screened by PCR using
primers 97556F and 97628UL41rev (5’ GAACTTCCAGGGTI’AGTATITTGAAGTGC
3)’ to generate pMDV-UL41*Cys-rev. pMDV-UL41*Cys and pMDV-UL41*Cys-rev
encode the same UL41 amino acid sequence but differ for a silent SNP
(AY510475:g.108,207A>G), which allows molecular tracking of both viral genomes in
mixed populations. The new BAC clones were purified using a Large-Construct Kit
(Qiagen, Valencia, CA, USA) and a ~500 bp region that encompasses the UL41 SNP was
confirmed by DNA sequencing. To generate MDV, BAC DNA (50-100 ng) was added to
a CEF cell suspension and electroporated using a cell electroporation system at a setting

of 330 uF and 400 V (Life Technologies, Rockville, MD, USA).

114

Parental

MDV—U L41 *Cys

MDV-U L41 *Arg

MDV-U L41 *Cys-rev

Figure 4-1. Partial UL41 DNA and amino acid sequences for the parental Mdll strain,
the original MDV-BAC clone (MDV-UL41*Cys), and the two recombinant viruses
(MDV-UL41*Arg and MDV-UL41*Cys-rev). The position of the given sequences for
the first and last bases are 108.209 and 108,204 based on the Mdll strain sequence
(GenBank no. AY510475). The asterisk (*) indicates the SNP between the parental Mdll
and MDV-UL41*Cys that resulted in an amino acid difference at amino acid residue 377
(GenBank no. AA801683). In addition to altering this position by the mini-7t mutagenesis
procedure, the third base of the same codon (position 108,204) was mutated to increase
the efficiency of recovering the correct recombinants. Plus, the third base of the Lys
codon was changed (AY510475:g.108207A>G) in MDV-UL41*Cys-rev to allow
tracking and allele quantification by pyrosequencing between MDV-UL41*Cys and

MDV-UL41*Cys-rev.

115

AAA
Lys

AAA
Lys

AAA
Ly s

l
AAG

Lys

CGC
Ar g

*

TGC
Cys

l l
CGG

Arg

1 I
TGC

Cys

 

Growth rates of individual viruses

Growth characteristics of each individual cloned virus was determined. Briefly,
100 PFU were inoculated onto CEF cells seeded on 35-mm dishes. On 1, 2, 3, 4, and 5
days after inoculation, the infected cells were trypsinized, serial dilutions inoculated onto

fresh cells, and plaques of the different dilutions were counted 7 days later in triplicate.

Standard curve

UL41-containing fragments were cloned from MDV-BAC clones containing the
UL41*Arg and UL41*Cys alleles by PCR using primers 97628F (5’
TTCAACTGCTGTCTCATCAC 3’) and 97628R (5’ TCCCAGAGCGCAGAACTTCC
3’). Amplicons containing the UL41*Arg and UL41*Cys alleles were cloned individually
into the TOPO TA Vector (Invitrogen, Carlsbad, CA, USA) and the entire segment
verified by DNA sequencing. DNA pools containing the two vectors in 10% increments
were generated. The artificial DNA pools were analyzed by pyrosequencing using
primers 97628fBiotin (5’ [BioTEG] TTCAACTGCTGTCTCATCAC 3’) and 97628R for
PCR amplification, primer 97628Rseq (5’ CCAGGGTTAGTATTTI‘GAA 3’) for

sequencing, and the PSQ 96M software (Biotage, Uppsala, Sweden).

Competitive assay

Three experimental groups were established. Viruses with the UL41*Arg,
UL41*Cys. UL41*Cys—rev alleles at amino acid residue 377 (see Fig. 4—1), referred to as
MDV-UL41*Arg, MDV-UL41*Cys, and MDV-UIAI*Cys-rev, respectively, were

generated by transfections into CEF individually from pMDV-UL41*Arg, pMDV-

116

UL41*Cys, and pMDV-UL41*Cys-rev, respectively. Viral stocks of all three MDV types
were made and the titers determined. CEF containing 1,000 unit PFU of MDV-
UL41*Arg and MDV-UL41*Cys each, MDV—UL41*Arg and MDV-UL41*Cys-rev each,
or MDV-UL41*CyS and MDV-UL41*Cys-rev each were mixed in triplicate. MDV-
UL41*Arg, MDV-UL41*Cys, or MDV-UL41*Cys-rev were passed individually as
controls. Virus DNA was extracted on every passage for SNP frequency determination

and each sample was measured once by pyrosequencing.

UL41 activity assay in vitro

Chicken DFl cell line (Himly etal., 1998) was used for UL41 activity assays, and
were cultured using the same conditions described for CEF. UL41 alleles from pMDV-
UL41*Arg and pMDV-UL41*Cys were amplified using the primers UL41HindIIIF
(5’ATCGAAGCTICGCCACCATGGGAGTATATGGATGTATG 3’) and
UL41EcoRIR (5’ ATCGGAATTCTCAGTCATI‘AGATCGTGTTG 3’). The PCR
products were digested with HindIII and EcoRI, cloned into the HindIII and EcoRI sites
of the pcDNA3.1/Zeo vector (Invitrogen, Carlsbad, CA, USA), and the entire region
verified by DNA sequencing. DFl cells were co—transfected with 0.5 pmoles of the B-
galactosidase expression plasmid pON249 (Geballe et al., 1986) along with 0.01 to 0.5
pmoles of the UL41*Arg or UL41*Cys expressing plasmid. Two HSV-1 UL41-
containing constructs, pCMVvhs and pCMVvhs-l, which express functional and inactive
forms of the UL41 protein, respectively, were used as positive and negative controls
(Jones et al-, 1995); kindly provided by Jeffery Cohen (NIAID, NIH). The

pcDNA3.1/Zeo vector was added to each co-transfection reaction to maintain a constant

117

amount of the CMV promoter and total DNA. All transfections were performed in
duplicate. Two days after co-transfection, the DP] cells were lysed by alternate cycles of
freeze-thaw. B—galactosidase activity was measured at an OD of 420 nm in conjunction

with the B—Gal Assay Kit (Invitrogen, Carlsbad, CA, USA).

118

Results
Generation of pMDV-UL41*Arg and pMDV-UL41*Cys-rev by mini-2. mutagenesis
The mini-2t phage recombinant mutagenesis system was used to introduce a point
mutation into the original MDV-BAC clone to alter a specific UL41 amino acid (residue
377). Furthermore, additional point mutations were utilized to increase the efficiency of
recovering the correct recombinant (AY510475:g.108,204C>G), or for differentiating
between two viruses with the same amino acid sequence (AY510475:g.108,207A>G). A
recombinant BAC clone that generates MDV with a UL41*Arg allele was generated from
pMDV-UL41*CyS, the original MDV-BAC clone. pMDV-UL41*Cys-rev was generated
from pMDV-UL41*Arg, which contains the same amino acid but a different nucleotide
sequence compared to pMDV-UL41*Cys (Fig. 4-1). This reverse mutant was generated
as a negative control for the head-to-head competitive assay. All of the MDV-BAC
clones were confirmed by restriction enzyme digestions using 8amHI or HindIII for the

intact viral genome, and sequencing of the UL41 SNP and flanking regions.

119

Growth rates of individual viruses in vitro

MDV-UL41*Cys, MDV-UL41*Arg, and MDV-UL41*Cys-rev were generated
from the appropriate MDV-BAC clones. To determine potential effects of the UL41
polymorphisms, each virus was grown individual in vitro. As shown in Fig. 4-2, there

was no significant difference between any of the three MDVs.

 

 

~~e—--- UL41*Arg

 

+ UL41*Cys

Plaques

 

 

—+- UL41*Cys-
I'BV

 

 

 

 

Day

Figure 4-2. Growth rates of individual viruses in vitro. MDV-UL41*Cys, MDV-
UL41*Arg, and MDV-UL41*Cys-rev were grown on CEF, harvested and titered on the
days indicated. The experiment was performed in triplicate and the average is given.

Standard curve for pyrosequencing

A standard curve was generated to calibrate the pyrosequencing technology using
DNA pools containing a known mixture of cloned UL41*Arg and UL41*Cys alleles in

10% increments. The standard curve showed that the pyrosequencing signals for the

120

SNPs accurately reflected the original proportion of the two recombinant vectors without

a need for extrapolation (Fig. 4-3).

 

l
90

 

 

 

 

60 ' /
50 ’ /
4o

30

 

 

 

20 .,--.__.___- ____ _ -__.- s _. _at ~-__ss _.-_ v a ._ _.

 

 

 

10

 

 

 

 

 

 

 

 

 

 

Percent of UL41*Arg as determined by pyrosequencing

 

O 10 20 3O 4O 50 60 70 80 90 100

Percent of UL41*Arg in the DNA pool

Figure 4-3. Standard curve of pyrosequencing for UL41 alleles. DNA fragments
containing the UL41*Arg and UL41*Cys alleles were mixed at known amounts to
generate DNA pools that differed in 10% increments (X axis). The percent of UL41*Arg
was determined by pyrosequencing (Y axis).

Increasing virus fitness of MDV-UL41*Cys in virus populations in vitro
In the group containing MDV-UL41*Arg and MDV-UL41*Cys, the average
percentage of MDV-UL41*Arg steadily decreased from 52% to 5% after 20 passages,

while the average percentage of MDV-UL41*Cys increased from 48% to 95% (Fig. 4-4a).

In the MDV-UL41*Arg and MDV-UL41*Cys-rev mixed group, the average percentage
of MDV-UL41*Arg decreased from 50% to 5%, and the percentage of MDV-UL41*Cys-
rev increased from 50% to 95% relatively over 20 passages (Fig. 4—4b). Note that control
groups that contained MDV-UL41*Cys and MDV-UL41*Arg separately, the SNP
frequency was constant at 100%. To exclude the possibility that these results were
attributed to unexpected mutations during the mutagenesis approach itself, the virus
growth in a mixed group containing the same amino acid (Cys) but different SNPs were
evaluated. In contrast to other mixtures, following 20 passages, the proportion of MDV-
UL41*Cys and MDV-UIAl*Cys-rev genomes remained at a similar proportion (Fig. 4-

4C).

Figure 4-4. The percentage of MDVs genomes in the competition assay. A.
The percent of MDV genomes with the UL41*Arg alleles among a mixture of
CEF infected with viruses containing either UL41*Arg or UL41*Cys alleles as
determined by pyrosequencing. EXP 1, EXP2 and EXP3 represent three
independent replicates. MDV-UL41*Cys Control is the result where CEF were
infected with MDV containing the UL41*Cys allele only. B. Results from the
same experimental design as A except that MDVs differed in having either
UL41*Arg or UL41*Cys-rev alleles. MDV-UL41*Arg Control. results are
from infected CEF where MDV containing the UMI*Arg allele only were
passaged. C. Results from the same experimental design as A and B except that
MDVS differed in having either UL41*Cys or UL41*Cys-rev alleles. MDV-
UL41*Cys-rev Control results are from infected CEF where MDV containing
the UL41*CyS-rev allele only were passaged.

123

 

Figure 4-4

 

124

iii}

itii

iii}

EXP 1
EXP2

EXP3
Control

EXP l
EXP2
EXP3
Control

EXP l
EXP2
EXP3
Control

Wild type MDV UL41 (MDV-UL41*Arg) has vhs activity and this enzyme activity is
abolished in MDV-UL41*Cys

When DFl cells were co-transfected with plasmids expressing MDV UL41*Arg
and B—galactosidase, B—galactosidase activity decreased as the concentration of the UL41-
expressing plasmid increased (Fig. 4-5). On the other hand, the B-galactosidase activity
did not change with varying MDV UL41*CyS expressing plasmid amounts when co-
transfected with a B-galactosidase expression plasmid into the DP] cells (Fig. 4—5). The
HSV-1 vhs plasmid, the positive control, showed vhs activity that was dependent on the
amount of plasmid DNA while the HSV-1 vhs-l plasmid, the negative control, did not
show any detectable vhs activity (Fig. 4-5). The background B-galactosidase activity of

DFl cells only was less than 0.15 when measured at an OD of 420 nm.

2.5

 

 

 

t...

'5 +UL41*Arg

OD420

+UL41*Cys

 

+HSV-1 vhs

0.5 \ —x—Hsv-1 vhs—1

0 T l I 1
0 0.1 0.2 0.3 0.4 0.5 0.6
pmol of UL41-expressing plasmid

 

 

 

 

Figure 4—5. The B— galactosidase assay for MDV UL41*Arg, UL41*Cys activity and the
controls. Plasmids expressing MDV UL41*Cys, MDV UL41*Arg, HSV-l UL41 (vhs,
positive control), or a mutant form of HSV-1 UL41 (vhs-1, negative control) were co-
transfected into chicken DFl cells along with the fi-galactosidase expression plasmid
pON249. and after two days, the cell lysates were measured for B—galactosidase activity.
The values on the X axis indicate the amount of the UL41 expressing plasmid that was
transfected; in addition, 0.5 pmole of pON249 was added along with varying amounts of
pcDNA3. l/Zeo vector to keep CMV promoter constant. This figure shows the result from
one of two replicates, which were consistent.

126

Discussion

Understanding gene function in MDV has been greatly facilitated by the ability to
make defined recombinant viruses through MDV-BAC clones. However, it is often the
case that recombinant MDVs lacking a gene of interest show little to no altered
phenotype in vitro but significant changes in viva (e.g., Reddy et al., 2002; Silva et al.,
2004; Prigge et al., 2004; Kamil et al. 2005; Schumacher et al., 2005). This suggests that
the in vitro assays are not very sensitive in detecting relevant mutations, which may be
compounded by the fact that there are different environmental conditions and selective
pressures in vitro compared to those in viva. To provide an alternative and more efficient
screening method for evaluating recombinant MDVs in vitro, a head-to-head competition
assay was employed, which is very sensitive to detect differences in viral fitness,
combined with pyrosequencing to quantify each viral genome.

The missense mutation in MDV-UL41 that results in Cys at amino acid 377 was
found to enhance the viral fitness in cell culture by the head-to-head competition assay
but not with the traditional in vitro grth curves of individual viruses. In addition, the
growth advantage was not shown in the mixed viral population with MDV-UL41*Cy3
and MDV-UL41*Cys-rev, viruses that have identical U141 amino acids. Thus, mixed
MDV populations favor the growth of viruses with inactive forms of vhs in cell culture,
and the pyrosequencing approach could quantify this difference in viral fitness.

During 20 passages, the MDV-UL41*Arg was almost replaced by MDV-
UL41*Cys in the viral population when the initial ratio of the two viruses was 1:1. This
adaptability of MDV-UL41*Cys is gradual, consistent between replicates, and constant,

which suggests the UL41*Cys allele provides a moderate relative fitness advantage at

 

 

each passage. Also, a similar fitness advantage was observed in viral p0pulations where
the ratio of MDV-UL41*Arg to MDV-UL41*CyS was 4:1 suggesting that viral fitness
depends on the number of passages rather than the initial ratio. The separate MDV-
UL41*Arg and MDV-UL41*Cys viruses did not Show any SNP frequency change after
20 passages. These controls provide evidence that MDV with different UL41 alleles are
capable of growing in cell culture, there is no contamination among plates, and the SNPS
are stable.

As the fitness advantage was dependent on the UL41 amino acid composition,
UL41 activity was evaluated. The Arg in the variant amino acid site was reported to be
conserved in all alpha-herpesviruses, and the replacement of Arg to His in HSV-1
abolishes endoribonuclease activity of UL41 (Everly and Read, 1999). Using the same [3-
galactosidase functional assay, the effect of the Arg to Cys substitution in MDV UL41
was determined. UL41*Cys lacks any detectable endoribonuclease activity. However, the
wild type MDV UL41 containing Arg has endoribonuclease activity at levels similar to
HSV-l UL41. Thus, in the competitive assay, the null MDV UL41 gene is beneficial to
MDV replication when competing with MDV with the UL41 wild type allele. It has been
reported that HSV with a non—functional UL41 showed impaired growth comparing with
wild type HSV in mice though there is no obvious growth difference in cell culture
(Smith et al., 2002). The HSV-1 UL41 gene had been demonstrated to play an important
role in the virus life cycle as it is capable of degrading the host mRNA although this
degradation, for the most part, does not discriminate among host and viral mRNAs
(Kwong and Frenkel, 1987; Esclatine et al., 2004). One possible hypothesis for this

contradictory result is that a functional MDV UL41 gene is advantageous for virus

growth and spread in viva where its vhs may interfere with the host immune response,
however in vitro, a null UL41 allele confers a slight viral replication advantage as the
viral transcripts are not degraded. This slight difference might not be detected by classical
plaque assay as a previous report demonstrated that the effect of vhs deletion on viral
replication in tissue is minimal (Smith et al., 2002). If true, then these results support a
role for MDV UL41 in interfering with the host immune system although further studies
are required to determine the detail mechanism of UL41 gene in MDV biology.

In summary, this study presents a quantitative approach for head-to-head viral
competition assays using SNPs as genetic markers for MDV. This approach is capable of
directly detecting the ratio of virus genomes represented by the SNP on genomes and
providing very sensitive monitoring at every passage. The use of this approach should
help evaluate whether other MDV genes and genetic variation have functional roles in

vitro and potentially in vivo.

Acknowledgements

We thank Thomas Goodwill, Laurie Molitor, and Lonnie Milam for their
excellent technical assistance with pyrosequencing and B-Gal assays, and Dr. Dodgson
for useful suggestions. This work was supported in part by USDA NRICGP #2002-03407

toHHC.

129

References

l.

1.0.

Barzilai, A., Zivony-Elbom, I., Sarid, R., Noah, E., Frenkel, N. 2006. The
herpes simplex virus type 1 vhs-UL41 gene secures viral replication by

temporarily evading apoptotic cellular response to infections with elements of
cellular mRN A degradation machinery. J Vir0180: 505-513.

Carrasco, P., Daros, J.A., Agudelo-Romero, P., Elena, SF. 2007. A real-time
RT-PCR assay for quantifying the fitness of tobacco etch virus in competition
experiments. J Virol Meth 139: 181-188.

Costantino, N., Court, D.L. 2003. Enhanced levels of 7s Red-mediated
recombinants in mismatch repair mutants. Proc Natl Acad Sci USA 100: 15748-
15753.

Court, DL, Swaminathan, 8., Yu, D., Wilson, H., Baker, T., Bubunenko, M.,
Sawitzke, J ., Sharan, SK. 2003. Mini-2.: a tractable system for chromosome and
BAC engineering. Gene 315: 63-69.

Esclatine, A., Taddeo, B., Roizman, B. 2004. The UL41 protein of herpes
simplex virus mediates selective stabilization or degradation of cellular mRNAs.
Proc Natl Acad Sci USA 101: 18165-18170.

Everly, D.N., Read, GS. 1999. Site-directed mutagenesis of the virion host
shutoff gene (UL41) of herpes simplex virus (HSV): analysis of functional
differences between HSV type 1 (HSV-1) and HSV-2 alleles. J Virol 73: 9117-
9129.

Geballe, A.P., Spaete, R.R., Mocarski, ES. 1986. A cis—acting element within
the 5’ leader of a cytomegalovirus B transcript determines kinetic class. Cell 46:
865-872.

Himly, M., Foster, D.N., Bottoli, I., Iacovoni, J .S., Vogt, P.K. 1998. The DF-l
chicken fibroblast cell line: transformation induced by diverse oncogenes and cell
death resulting from infection by avian leucosis viruses. Virology 248: 295—408.

Holland, J.J., de la Torre, J.C., Clarke, D.K., Duarte, EA. 1991.
Quantification of relative fitness and great adaptability of clonal populations of
RNA viruses. J Virol 65: 2960-2967.

Jones, F.E., Smibert, C.A., Smiley, J .R. 1995. Mutational analysis of the herpes

simplex virus virion host shutoff protein: Evidence that vhs functions in the
absence of other viral proteins. J Virol 69: 4863-4871.

130

11.

12.

13.

14.

15.

l6.

17.

18.

19.

20.

21.

22.

Kamil, J.P., Tischer, B.K., Trapp, 8., Nair, V.K., Osterrieder, N., Kung, HJ.
2005. vLIP, a viral lipase homologue, is a virulence factor of Marek's disease
virus. J Virol 79: 6984-6996.

Kwong, A.D., Frenkel, N. 1987. Herpes simplex virus-infected cells contain a
function(s) that destabilizes both host and viral mRNAs. Proc Natl Acad Sci USA
84: 1926-1930.

Kwong, A.D., Frenkel, N. 1988. Herpes simplex virus virion host shutoff
function. J Virol 62: 912-921.

Lahser, F.C., Wright-Minogue, J., Skelton, A., Malcolm, B.A. 2003.
Quantitative estimation of viral fitness using pyrosequencing. BioTech 34: 26-28.

Murphy, J .A., Duerst, R.J., Smith, T.J., Morrison, LA. 2003. Herpes Simplex
virus type 2 virion host shutoff protein regulates alpha/beta interferon but not

adaptive immune responses during primary infection in vivo. J Virol 77: 9337-
9345.

Niikura, M., Dodgson, J, Cheng, H.H. 2006. Direct evidence of host genome
acquisition by the alphaherpesvirus Marek’s disease virus. Arch Virol 151: 537-
549.

Novella, 1.8. 2003. Contributions of vesicular stomatitis virus to the
understanding of RNA virus evolution. Curr Opin Microbiol 6: 399-405.

O’Meara, D., Wilbe, K., Leitner, T., Hejdeman, B., Albert, J., Lundeberg, J.
2001. Monitoring resistance to human innunodeficiency virus type 1 protease
inhibitors by pyrosequencing. J Clin Microbiol 39: 464-473.

Osterrieder, N., Kamil, J.P., Schmacher, D., Tischer, B.K., Trapp, S. 2006.
Marek’s disease virus: from miasma to model. Nature Rev Micro 4: 283-294.

Petherbridge, L., Brown, A.C., Baigent, S.J., Howes, K., Sacco, M.A.,
Osterrieder, N., Nair, V.K. 2004. Oncogenicity of virulent Marek's disease virus
cloned as bacterial artificial chromosomes. J Virol 78: 13376-13380.

Prigge, J .T., Majerciak, V., Hunt, H.D. Dienglewicz, R.L., Parcells, MS, 2004.
Construction and characterization of Marek's disease viruses having green
fluorescent protein expression tied directly or indirectly to phosphoprotein 38
expression. Avian Dis 48: 471-487.

Read, G.S., Frenkel, N. 1983. Herpes simplex virus mutants defective in the

virion-associated shutoff polypeptide synthesis and exhibiting abnormal synthesis
of alpha (immediate early) viral polypeptides. J Virol 46: 498-512.

131

23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

Read, G.S., Karr, B.M., Knight, K. 1993. Isolation of a herpes simplex virus
type 1 mutant with a deletion in the virion host shutoff gene and identification of
multiple forms of the vhs (UL41) polypeptide. J Virol 67: 7149-7160.

Reddy, S.M., Lupiani, B., Gimeno, I.M., Silva, R.F., Lee, L.F., Witter, R.L.
2002. Rescue of a pathogenic Marek's disease virus with overlapping cosmid
DNAs: Use of a pp38 mutant to validate the technology for the study of gene
function. Proc Natl Acad Sci USA 99: 7054-7059.

Ronaghi, M. 2001. Pyrosequencing sheds light on DNA sequencing. Genome
Res 11: 3-11.

Ronaghi, M., Uhlen, M., Nyren, P. 1998. A sequencing method based on real-
time pyrophosphate. Science 281: 363-365.

Schumacher, D., Tischer, B.K., Fuchs, W., Osterrieder, N. 2000.
Reconstitution of Marek's disease virus serotype 1 (MDV-1) from DNA cloned as
a bacterial artificial chromosome and characterization of a glycoprotein B-
negative MDV-l mutant. J Virol 74: 11088-11098.

Schumacher, D., Tischer, B.K., Trapp, 8., Osterrieder, N. 2005. The protein
encoded by the U83 orthologue of Marek's disease virus is required for dfficient
de-envelopment of perinuclear virions and involved in actin stress fiber
breakdown. J Virol 79: 3987-3997.

Silva, R.F., Lee, L.F. Kutish, G.F. 2001. The genomic structure of Marek’s
disease virus, in: Hirai, K. (Ed.), Marek’s Disease. Springer, Berlin, pp. 143-158.

Silva, R.F., Reddy, S.M., Lupiani, B. 2004. Expansion of a unique region in the
Marek's disease virus genome occurs concomitantly with attenuation but is not
sufficient to cause attenuation. J Virol 78: 733-740.

Smith, T.J., Morrison, L.A., Leib, D.A. 2002. Pathogenesis of herpes simplex
virus type 2 virion host shutoff (vhs) mutants. J Virol 76: 2054-2061.

Spatz, S.J., Peterbridge, L., Zhao, Y., Nair, V. 2007. Comparative full-length
sequence analysis of oncogenic and vaccine (Rispens) strains of Marek’s disease
virus. J Gen Virol 88: 1080-1096.

Spatz, S.J., Silva, R.F. 2007. Polymorphisms in the repeat long regions of
oncogenic and attenuated pathotypes of Marek’s disease virus 1. Virus Genes 35:
41-53.

Suzutani, T., Nagamine, M., Shibaki, T., Ogasawara, M., Yoshida, 1.,
Daikoku, T., Nishiyama, Y., Azuma, M. 2000. The role of the UL41 gene of

35.

36.

herpes simplex virus type 1 in evasion of non-specific host defense mechanisms
during primary infection. J Gen Virol 81: 1763-1771.

Witter, R.L. 1996. Increased virulence of Marek’s disease virus field isolates.
Avian Dis 41: 149-163.

Yuste, E., Borderia, A.V., Domingo, E., Lopez-Galindez, C. 2005. Few

mutations in the 5’ leader region mediate fitness recovery of debilitated human
immunodeficiency type lviruses. J Virol 79: 5421-5427.

133

Chapter 5

Future work

134

This thesis described the cloning and functional characterization of chicken SCA2,
and its influence on MDV growth properties in vitro via association with viral U810
protein. To investigate the biological properties of chicken SCA2, chicken SCA2 was
expressed and purified in E. coli, and a polyclonal antibody was developed. Utilizing this
anti-SCA2 antibody, SCA2 was identified to be a 13 kDa cell surface protein anchored
by a GP] moiety as is the case for most other Ly-6 members (Classon and Coverdale,
1994). In viva studies showed that SCA2 is expressed in a number of chicken tissues. Of
particular interest was the unique SCA2 expression pattern in bursal CMEC that were
often surrounded by MHC class II presenting cells. Expression profiles of bursal cells
induced by contact with SCA2-expressing cells shows down-regulation of numerous
genes including CD798, B cell linker (BLNK), spleen tyrosine kinase (S YK), and gamma
2-phospholipase C (PLCGZ) that are involved in the BCR and immune response
signaling pathways. These results suggest chicken SCA2 plays a role in regulating B
lymphocytes.

Based on the identified functions and expression patterns of SCA2, we
hypothesize three putative roles for SCA2 in MDV biology. First, SCA2 promotes MDV
spread as SCA2 may function in cell-cell adhesion with direct cell-cell contact required
for MDV spread. Second, SCA2 transduces signals for cell proliferation that could affect
transformation of cells harboring latent MDV. Third, SCA2 promotes virion maturation
or egress via interacting with viral proteins. Some reports have demonstrated that chicken
SCA2 is associated with v-Rel—transformed avian bone marrow cells and plays a role in
self-renewal of avian erythroid progenitors (Petrenko et al., 1997; Bresson-Mazet et al.,

2008). We also found the cell surface SCA2 was up-regulated in a MDV transformed T

135

cell line (RPl) when induced for MDV replication (Fig. 5-1). An important question that
one could address is whether up-regulation of SCA2 is specific for MDV or it is a
response from host immune system. The preliminary results suggest that cell surface
SCA2 was not induced by a reticuloendotheliosis virus in RPl-transformed T cell line.
Consequently, the up-regulation of SCA2 could be induced by MDV gene products.
SCA2 transcription was induced by MDV infection in CEF, a fibroblast cell line.
Therefore, these results support the conclusion that MDV gene products, probably US 10,
induce the SCA2 transcription and further SCA2 cell surface expression. Interestingly,
SCA2 transcription was up-regulated in many malignant tumor cell lines (Bresson-Mazet,
2008). Consequently, the question arises as to whether virus-induced SCA2 promotes
virus-induced lymphomogenesis. The expression profiling results from B lymphocytes
upon contact with SCA2-expressing cells indicated that SCA2 is involved in BCR and
immune response signal pathways. Therefore, future efforts should be directed to
investigate the role of SCA2 in signal transduction in chicken lymphocytes.

While we are the first to show a biological role for MDV U810, the role of MDV
U810 is stil not well defined. The interaction of U810 and SCA2, and the putative
function of SCA2 in lymphocytes proliferation suggest that U810 may regulate chicken
lymphocyte via interacting with SCA2. Therefore, to elucidate the role of MDV U810
protein and the functional interaction of SCA2 and U810 for transformation or immune
responses of lymphocytes, we could profile the expression of host genes of lymphocytes
infected with MDV and AUSl’O-MDV to find out the immune response pathways in
which U810 is involved. Parcell et al. (1994) reported that MDV lacking USI, U82

SORFI, SORF2, SORF3 and USIO showed decreased early cytolytic infection, mortality,

136

tumor incidence, and horizontal transmission, but the role of U810 alone in MDV
pathogenicity was not identified. A AUSIO-MDV recombinant BAC has been generated,
which we could use to characterize U810 with respect to MDV pathogenicity.

The US lOEGFP-MDV we developed could also be employed for studies on MDV
morphogenesis. An ideal assay for MDV morphogenesis analysis would be to label MDV
membrane, tegument, and capsid proteins each with unique fluorescent tags. By utilizing
this recombinant MDV, one could track the MDV dynamics of viral replication in living
fibroblast cells. This would allow one to address areas such as: l) The timing of new
virion maturation and egress to the neighboring cells. 2) Is an intact virion required for
MDV spread between cell-cell? 3) Does the virion transmit between cells mainly through
cell—cell fusion? 4) The efficiency of super-infection. Due to the highly cell-associated
characters, we would use MDVs labeled with fluorescent proteins to synchronize MDV
infection. Furthermore, MDVs with fluorescent proteins might also be employed for
tracking and collecting infected-lymphocytes in viva.

Finally, on an unrelated subject, during the cloning and full genome sequencing of
virulent MDV Mdll strain (Niikura et al., 2006), another nonsynonymous single
nucleotide polymorphism (SNP; AY510475:g.l60,3l9 A>G) was found in the ICP4 gene
that resulted in a Leu to Ser substitution in residue 256 (AA801711.1:p.Leu2568er; Fig.
5-2). Monitoring the frequency of each SNP by pyrosequencing during virus passages
determined the ratio of each viral genome in a single monolayer, which is a very sensitive
method to monitor viral fitness. MDV with the ICP4*Ser allele showed enhanced fitness
in vitro (Fig. 5-3). HSV ICP4 protein is a transcriptional regulator required for the

induced transcription of most of the remaining HSV genes and essential for viral

137

replication (Compel and DeLuca, 2003; Su et al., 2006). The exact role of ICP4 in MDV
replication has not been well determined although it is speculated to play a role similar to
the ICP4 of other alpha-herpesviruses as a transcription regulator, and it is associated
with maintenance of transformation and is essential for MDV growth in CEF (Endoh,
1996; Chattoo et al., 2006). Therefore, we would identify the effect of the SNP on the

role of ICP4 as a transcriptional activator, and further on the virus evolution.

138

RP 1 00118 BrdU-induced cells
with anti-SCA2

anti-SCA2 antisera inactivated cells with
anti-SCA2

 

inactivated cells with
prebleed antisera

BrdU-induced cells
with prebleed antisera

 

 

Figure 5-1. SCA2 is up-regulated on the surface of BrdU-induced RPl (MDV
transformed) T cell line.

139

Parental

MDV-ICP4*Ser

MDV-ICP4*Leu

MDV-ICP4*Leu-rev

Figure 5-2. Partial ICP4 DNA and amino acid sequences for the parental Mdll strain, the
recombinant virus (MDV-ICP4*Ser), the original MDV-BAC clone (MDV-ICP4*Leu),

and the recombinant viruse (MDV-ICP4*Leu-rev).

140

GC C
A] a

GCC
A] a

GCC
Al 21

l
GCG
A] a

TT G
LC u

TCG
Se r
I

TTG
Leu

TTG

Leu

Figure 5-3. The percetange of MDVs genomes containing SNPs in ICP4 alleles
in a competition assay. A. The percent of MDV genomes with the ICP4*Leu
alleles among a mixture of CEF infected with viruses containing either
ICP4*Leu or ICP4*Ser alleles as determined by pyrosequencing during 8
passages. Exp 1, Exp 2 and Exp 3 represent three independent replicates. B.
Results from the same experimental design as A except that MDVs differed in
having either ICP4*Ser or ICP4*Leu-rev alleles. C. Results from the same
experimental design as A and B except that MDVs differed in having either
ICP4*Leu or ICP4*Leu-rev alleles.

I41

 

 

 

 

EXP l
EXP2

EXP3

 

 

 

Hi

 

 

 

 

 

' Y 1 fi fi— 1? a? a

Passages

 

 

EXP]
EXP2

EXP3

 

Hi

 

 

 

 

 

Passages

EXP 1
EXP2

EXP3

Hi

 

Passages

Figure 5-3

142

References

1.

Bresson-Mazet, C., O. Gandrillon, and S. Gonin-Giraud. 2008. Stem cell
antigen 2: a new gene involved in the self-renewal of erythroid progenitors. Cell
Prolif 41:726-38.

Chattoo, J. P., M. P. Stevens, and V. Nair. 2006. Rapid identification of non-
essential genes for in vitro replication of Marek's disease virus by random
transposon mutagenesis. J Virol Methods 135:288-91.

Classon, B. J., and L. Coverdale. 1994. Mouse stem cell antigen Sca-2 is a
member of the Ly-6 family of cell surface proteins. Proc Natl Acad Sci U S A
91:5296-300.

Compel, P., and N. A. DeLuca. 2003. Temperature-dependent conformational
changes in herpes simplex virus ICP4 that affect transcription activation. J Virol
77:3257-68.

Endoh, D. 1996. Enhancement of gene expression by Marek's disease virus
homologue of the herpes simplex virus-l ICP4. Jpn J Vet Res 44:136-7.

Niikura, M., J. Dodgson, and H. Cheng. 2006. Direct evidence of host genome
acquisition by the alphaherpesvims Marek's disease virus. Arch Virol 151:537-49.

Parcells, M. 8., A. S. Anderson, J. L. Cantello, and R. W. Morgan. 1994.
Characterization of Marek's disease virus insertion and deletion mutants that lack
U81 (ICP22 homolog), U810, and/or U82 and neighboring short-component open
reading frames. J Virol 68:8239-53.

Petrenko, O., I. Ischenko, and P. J. Enrietto. 1997. Characterization of changes
in gene expression associated with malignant transformation by the NF-kappaB
family member, v-Rel. Oncogene 15:1671-80.

Su, Y. H., X. Zhang, X. Wang, N. W. Fraser, and T. M. Block. 2006. Evidence
that the immediate-early gene product ICP4 is necessary for the genome of the
herpes simplex virus type 1 ICP4 deletion mutant strain d120 to circularize in
infected cells. J Virol 80:11589-97.

143