kart: . .4.
. XXV... @1337; .
.( nluL-n 15-:

.4

y
.5: Fa: um

. (.5.
.mb... u.
. a.

03 n :5...
2 ‘9..."

Sun. . it | 1.3..)
fihn 2 iaRuM‘WW
.332“, 3 «11kg s"
513»?! a

. .3,

2.1;!
.sL-Lnannrfi
”it..." a

..

11'“!!! A‘

13.6.3...» . .vitwnu.
. urn .rx3fit

1 .

.59.. a?

tilt-lit}

.... 52.5!) .
.2"?

4!:
99:53.0. 1,}..\
.s}: {I}.

i .3 5.15. ‘

12%.":
.{lxit

 

‘ W “a 4......”
.
‘

H79 . x. . .. , ‘ . P, . .. , ,, , ‘

5%,? ‘ . , . .63.... is”. 5.99.” .2... L: #54; .2: , A.

. .L‘. . 1.... I s u . ‘. :s eta... . Aa

r . , , . figw » «Q g. km" ..... H.211: .
. . . . .. . . ‘ . . . .13.: 121‘...P: unit-toil. I}: . . .s ‘1 “kalvsiav.

 

Z r” LIBRARY
2:”? fl Michigan State ~
’ University
L..—

This is to certify that the
dissertation entitled

TWO REGIONS OF TRANSCRIPTION FACTOR SPOIIID
ALLOW A MONOMER TO BIND DNA

presented by
Paul Richard Himes

has been accepted towards fulfillment
of the requirements for the

Doctoral degree in Microbiology and Molecular
Genetics

 

 

5111i 761L173”)

Major Professor’Rignature
8/1 9/09

 

Date

MSU is an Aflinnafive Action/Equal Opportunity Employer

 

.A-g-I-n-I---O-I-I-D-‘-.-I-.-.-.-.-.-‘-

--.—.—.----.-.—.- -

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 KzlProj/Aoc8PresIClRC/Date0ue.indd

 

TWO REGIONS OF TRANSCRIPTION FACTOR SPOIIID ALLOW A MONOMER
TO BIND DNA

By

Paul Richard Himes

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Microbiology and Molecular Genetics

2009

ABSTRACT

TWO REGIONS OF TRANSCRIPTION FACTOR SPOHID ALLOW A MONOMER
TO BIND DNA

By
Paul Richard Himes
In response to nutrient limitation, Bacillus subtilis develops into two different cell
types, a mother cell and a spore. The sporulation of B. subtilis is regulated by a cascade
of sigma factors in both cell types and communication between the two cells. Regulation
of transcription by each of the sigma factors is further modulated by transcription factors.
SpoIIID is a key transcription regulator that affects, both positively and negatively,
transcription of the regulons of both mother cell sigma factors. SpoIIID has been shown
to bind directly to the promoters of a number of the genes it regulates and has been
postulated to use a predicted helix-turn-helix motif to mediate binding. Sites bound by
SpoIIID contain a 10 bp consensus sequence, and some strongly bound sites contain more
than one copy to the consensus, suggesting that SpoIIID interacts with DNA as a dimer or

binds cooperatively as monomers.

To better understand the interactions between SpoIIID and DNA, the
requirements, both in SpoIIID and DNA, for binding have been characterized. SpoIIID
was shown to be able to bind a single copy of its consensus sequence with high affinity as
a monomer. There iwas little cooperativity when SpoIIID binds DNA containing
multiple matches to its binding site consensus sequence. Analysis of the effects on
assays of in viva transcription and in vitro binding of DNA by SpoIIID of charge reversal

substitutions to residues likely to be on the surface of SpoIIID led to the identification of

two regions essential for DNA binding. In addition to the putative helix-tum-helix motif,
a second, C-terminal, basic region was shown to be required for binding to DNA. In
having two distinct regions that allow high affinity binding as a monomer, SpoIIID
appears to be unique among prokaryotic DNA-binding proteins with a single helix-tum-

helix motif.

Further analysis of the results of in vivo transcription assays of charge reversal
substitutions in SpoIHD in light of the NMR solution structure revealed 3 classes of
substitutions that negatively impact transcriptional activation. The first class of
substitutions, those affecting residues predicted to be involved in salt bridges or the
hydrophobic core, likely decrease the stability of SpoIIID. The second class involves
substitutions to residues that are proposed to be involved in DNA-binding. While the
negative effects on in vivo transcriptional activation by substitutions in the first two
classes are readily apparent, the reasons for the activation defect by the third class of
substitutions are less clear. The 4 substitutions that make up the third class (D5 1 K,
H63E, H68E, and D82K) are in positions that are not believed to interact with DNA or be
involved in the structural integrity of SpoIIID. These residues, then, are proposed to be

involved specifically in interactions with RNA polymerase to activate transcription.

To my wife, Debbie, who inspires me, and my parents who taught me to do my

best and leave the rest to God

ACKNOWLEDGEMENTS

The path to completion of this thesis has taken many unexpected turns and has
turned out to be considerably longer than it appeared at the outset. It could not have been

completed at all without the assistance of a large and willing support network.

First, I would like to thank my mentor, Dr. Lee Kroos, who has shown much
patience and provided guidance through all the twists and turns and setbacks of my
project. He has taught me what it means to do good science and also that there comes a

time when, although potential experiments may stretch out forever, you must say enough.

I would also like to thank the members of my committee, Dr. Rob Britton, Dr.
Zach Burton, Dr. Wendy Champness, and Dr. Mike Thomashow, for all their helpful
advice and for pushing me further in thinking about my project. Dr. Honggao Yan, Dr.
Aizhou Liu, and Dr. James Geiger were also instrumental in providing advice regarding

the structural aspects of SpoIIID, as were Zhenwei Lu and Stacy Hovde in their labs.

This project would not have been possible without the contributions of Bin Chen,
Steve McBryant and William Wedemyer who analyzed the NMR data to solve the
structure of SpoIIID, performed the analytical ultracentrifugation to show that SpoIIID

bound DNA as a monomer, and modeled (and taught me to model) the structure of

SpoIIID, respectively.

Current and previous members of the Kroos lab, who are too numerous to name
here, provided their expertise and help in many ways. In particular, I would like to thank
Lijuan Wang and John Perpich who also worked on a project involving SpoIIID and had

many valuable discussions with me. Dr. Ruanbao Zhou provided many stimulating

V

conversations and always had a new way of looking at things that challenged how I was

thinking.

I would also like to thank my family and friends for their love and support even if
they did not always understand what I was doing. To my parents with their constant

encouragement no matter what, I owe many thanks.

Last, but definitely not least, I must thank my wife Debbie without whom I would
never have finished. Her patience and support has been nothing short of amazing.
Words can never express my gratitude for your coming into my life, so I will just have to

settle for these three, I love you.

vi

TABLE OF CONTENTS

LIST OF TABLES ................................................................................... ix

LIST OF ABBREVIATIONS ....................................................................... xi
INTRODUCTION ................................................................................... 1
CHAPTER I: Literature Review ...................................................................... 3
An overview of Sporulation ................................................................ 5
Regulation of the Initiation of Sporulation — SpoOA .................................. 11
Stage I — Formation of the Axial Filament. ............................................. 13
Stage II — Asymmetric Cell Division .................................................... 14
Regulation of early transcription in the forespore — 0F ...................... 14
Regulation ofearly transcription in the mother cell — 0E” . 17
Stage III — Engulfment of the Forespore ............ A .................................... 1 9
Regulation of late transcription in the forespore — oG ........................ 20
Regulation of late transcription in the mother cell — oK ..................... 23
Stage IV — Cortex Formation ............................................................. 25
Stage V — Formation of the Spore Coat ................................................. 25
Stages VI-VH — Spore Maturation and Mother Cell Lysis ........................... 26
Germination ................................................................................. 27
The Role of SpoIIID in Sporulation ............ - .......................................... 27
CHAPTER II: Two regions of transcription factor SpoIIID allow a monomer to bind
DNA ................................................................................................... 32
Abstract ...................................................................................... 33
Introduction ................................................................................. 34
Experimental Procedures .................................................................. 36
Plasmids ............................................................................ 36
Overexpression of SpoIIID ...................................................... 36
Purification of SpoIIID ........................................................... 42
EMSAs .............................................................................. 43
Preparation of Samples for Analytical Ultracentrifugation .................. 44
Analytical Ultracentrifirgation ................................................... 45
Construction of B. subtilis Strains that Express SpoIIID from the thrC
Locus ................................................................................ 46
Western Blot Analysis ............................................................ 50
Measurement of spoIVCA-gusA Reporter Expression ....................... 50
Results ....................................................................................... 51
Binding of SpoIIID to DNA Containing Three Matches to the SpoIIID
Binding Site Consensus Sequence .............................................. 5]

vii

Binding of SpoIIID to DNA Containing a Single Match to the SpoHID

Binding Site Consensus Sequence .............................................. 5 9
Analytical Ultracentrifugation of SpoIIID and DNA ........................ 61
Structure Prediction for SpoIIID ................................................ 65
Mutational Analysis of spoIlID ................................................. 66
Binding of Altered SpoIIID Proteins to DNA ................................. 74
Discussion ................................................................................... 78
CHAPTER 111: Summary and Perspectives ..................................................... 90
Summary .................................................................................... 91
The NMR Solution Structure of SpoIIID ................................................ 91
Structural Features of SpoIIID ................................................... 91
DNA-binding by SpoIIID ........................................................ 94
A Structural Basis for Understanding Effects of Amino Acid
Substitutions to SpoIIID.. ........................................................ 98
Future Directions ......................................................................... 104
APPENDIX 1: Preparation of SpoIIID for NMR-based structural analysis ............... 109
Abstract .................................................................................... 1 10
Introduction ................................................................................ 1 10
Experimental Procedures ................................................................ l 1 l
Overexpression and Purification of SpoIIID ................................. 111
Preparation of Samples for NMR Analysis .................................. 112
Results and Discussion .................................................................. 113
Stability of SpoIIID in the absence of DNA ................................. 113
Comparison of NMR Spectra of SpoIIID in the Presence or Absence of
DNA ............................................................................... l 13
APPENDDI 2: Removing SpoIIID from Dependence on SpoIIID for Transcriptional
Activation ........................................................................................... 121
Abstract .................................................................................... 122
Introduction ................................................................................ 122
Experimental Procedmes ................................................................ 123
Plasmids .............................. 123
Construction of spoIID-spoIIID fusions ...................................... 123
Construction of B. subtilis Strains that Express spoIID—spoIIID fusions
fi‘om the thrC Locus ............................................................. 124
Measurement of spoIVCA-gusA Reporter Expression ...................... 124
Results and Discussion .................................................................. 128
Expression of spoIVCA-gusA in a B. subtilis strain engineered to produce
SpoIIID under the control of the spoIID promoter .......................... 128
REFERENCES .................................................................................... 128

viii

f:

Table 2.1
Table 2.2

Table 2.3

Table 2.4

Table 2.5

Table Al.1

Table A2.1

Table A2.2

LIST OF TABLES

Descriptions of certain plasmids used in this study ........................... 37
Oligonucleotides used in this study ............................................. 38
Mutations in spoIIID and corresponding plasmid and B. subtilis strain
designations ........................................................................ 47
Sequences of probes used and dissociation constants for SpoIIID-

binding .............................................................................. 54
Binding of altered SpoIIID proteins to DNA .................................. 77
Comparison of the Coordinates of IH—lsN HSQC spectra of SpoIIID in
the presence or absence of DNA ............................................... 115
Descriptions of certain plasmids used in this study ......................... 125
Oligonucleotides used in this study ........................................... 132

Figure 1.1
Figure 1.2
Figure 2.1
Figure 2.2
Figure 2.3
Figure 2.4

Figure 2.5

Figure 2.6
Figure 2.7
Figure 3.1
Figure 3.2

Figure 3.3

Figure A2.1

LIST OF FIGURES

The morphological stages of B. subtilis sporulation ........................... 7
Regulation of transcription in the mother cell ................................. 10
Purification of SpoIIID and binding to diflerent DNA probes .............. 53
Comparison of the migration of different SpoIIID-DNA complexes ...... 58
Analytical ultracentrifiigation of the SpoIIID-DNA complex ............... 63
System for mutational analysis of SpoIIID .................................... 68
Quantification of the effects of mutations in SPOIIID on transcription in

viva ......................................................... '. ........................ 72
Binding of altered SpoIIID proteins to DNA .................................. 76
Alignment of SpoIIID orthologs ................................................ 81
The solution structure of SpoIIID ............................................... 93
Interactions between SpoIIID and DNA ....................................... 96
Intramolecular interactions in SpoIIID ....................................... 100

Quantification of the effects of spoIID-spoIIID fusions on transcription in
viva ................................................................................. 130

 

cP
DNA
Da
EDTA

EMSAs

EQ

H(6)

HTH

IPTG

Kanr

LIST OF ABBREVIATIONS
adenine
ampicillin resistant
base pair
cytosine
centipoise
deoxyribonucleic acid
dalton
(ethylenedinitriol) tetra-acetic acid
electrophoretic mobility shift assays
sedimentation equilibrium
guanine
N-termina] hexa-histidine tag
helix-turn-helix
isopropyl B—D-thiogalactopyranoside

dissociation constant

kanamycin resistant

xi

kDa

LB

PCR

psi

520,w

kilodalton

Luria-Bertani media

molar

megabases

milliliter

micromolar

A, T, G, or C

nanomolar

nanometer

neomycin resistant

4-nitrophenyl-B~D-glucuronide

polymerase chain reaction

pounds per square inch

AorG

RNA polymerase

revolutions per minute

sedimentation coefficient in water at 20°C

xii

SDS sodium dodecyl sulfate

Sp spectinomycin resistant

SV sedimentation velocity

T thymine

T7 T7 RNA polymerase promoter and a translation initiation
sequence

W A or T

Y TorC

xiii

Introduction

The Gram-positive model bacterium, Bacillus subtilis undergoes a complex
development, in response to nutrient limitation, resulting in two different cell types, a
mother cell that undergoes programmed cell death and a highly resistant spore. The
stages of sporulation are highly regulated to allow proper temporal expression of a large
number of genes resulting in a fully resistant spore. This regulation is the function of a
cascade of cell-type-specific sigma factors, the activity of which is regulated by
communication between cell compartments. Transcriptional regulation by the sigma
factors is fine-tuned by temporally-regulated transcription factors in each compartment.
A key transcription factor in the mother cell, SpoIIID regulates, both positively and
negatively, the transcription of over 100 genes, including genes in controlled by both the

early and the late mother cell sigma factors.

Chapter I of this thesis discusses the relevant background literature about sporulation
with an emphasis on the events regulating the stages of sporulation in general and

SpoIIID in particular.

Chapter H discusses the interactions between SpoIIID and DNA. SpoIIID was shown
to interact with a single match to the DNA—binding consensus sequence with high affinity
whether one or multiple matches are present and to do so as a monomer. Two regions of
SpoHID were identified that contribute to this binding and each is essential for
interactions with DNA. Substitutions reversing the charge of charged residues or
introducing a charge on noncharged residues predicted to be on the surface of SpoIIID

were used to identify regions of SpoIIID important for activation of transcription in viva.

Chapter [[1 discusses the results of structural determination of SpoIIID and what
meaning that provides to the effects of the mutational analysis of SpoIIID described in
Chapter H. Three classes of substitutions causing a defect in in viva transcriptional
activation are identified, including 4 mutations that may be directly involved in
transcriptional activation and may form a surface important for recruitment of RNA

polymerase. Future directions for this project are also discussed.

Appendix 1 describes preparation of SpoIIID for the NMR studies used to solve its
structure and a comparison between the spectra that result from analysis of SpoHID in the

presence or absence of DNA.

Appendix 2 describes unsuccessful attempts to create a strain bearing a SpoIIID gene

that is not dependent on SpoIIID for its expression.

Chapter I: Literature review

'3

The question of how cells determine their fate by differentiating into distinct cell types
has long been of interest in organisms ranging in orders of complexity fiom bacteria to
humans. These decisions involve the coordinated control of complex genetic networks.
The Gram-positive soil bacterium Bacillus subtilis provides an attractive model in which
to examine the control of these decisions because, as it achieves stationary phase and the
attendant nutrient limitation, individual cells within the population have the possibility to
differentiate into one of five distinct cell types. Probably the most studied cell fate that
can be chosen by B. subtilis is sporulation to produce a highly resistant dormant spore
(Kroos, 2007, Piggot & Hilbert, 2004). Some cells can delay their entry into the
sporulation pathway by secreting toxins to cannibalize their sibling cells and use the
nutrients to allow for continued growth (Gonzalez-Pastor et a1. , 2003). Alternatively, B.
subtilis cells can respond to limited nutrients by becoming competent to uptake DNA,
which might provide them with new abilities to thrive in their environment (Dubnau &
Prowedi, 2000, Johnsen et al., 2009). In a final option, cells can make a lipopeptide
called surfactin which induces neighboring cells to secrete exopolysaccharide and other
extracellular matrix materials to form a biofilm (V larnakis et al., 2008, Lopez et al.,
2009). Smfactin—producing cells and matrix producers do not inter convert, but rather co-
exist in the biofilm. In each of these cell fates, only a subpopulation of cells becomes the
differentiated cell, and entry into the pathway to each differentiation event is typically
regulated by a bistable switch (Chai et al., 2008, Dubnau & Losick, 2006). Additionally,
vegetatively growing cells can also exist in two types, actively swimming individuals and

nonmotile chains, within the same population (Kearns & Losick, 2005).

Amongst these cell fate decisions, sporulation provides an interesting example of
communication between two different cell types as cells that enter the sporulation
pathway divide into two progeny cells that have distinct fates(Hilbert & Piggot, 2004).
The larger of the two, the mother cell, initially resides beside, later surrounds, and finally
lyses to release the second cell type, the spare, which is highly resistant to a variety of
environmental insults, while sensing environmental conditions so that it may germinate
into a vegetative cell once favorable conditions return (Setlow, 2003). The process of
sporulation has been divided into a series of distinct stages, each identified with a Roman
numeral, as determined by their morphological characteristics (Ryter, 1965). Genes in
which mutations cause a block in sporulation are identified by the three letters spa
followed by the Roman numeral indicating the stage at which sporulation was blocked
and then a letter to identify which mutation blocking that stage is being discussed (1'. e. ,
the gene SPOIIID, when mutated, results in a block at the third stage of sporulation)
(Piggot & Coote, 1976). Similarly, genes which, when mutated, result in a germination

defect are named with the three letters ger.

An overview of Sponrlation

As depicted in Figure 1.1, in the naming scheme describing the stages of sporulation,
vegetative growth is denoted as stage 0 (Hilbert & Piggot, 2004). During stage I, the cell
has two copies of the chromosome from the previous round of DNA replication, which

condense to form an axial filament. The origins of each copy are located at opposite

Figure 1.1. The morphological stages of B. subtilis sporulation. The first five stages
of sporulation are depicted with the stage at which each sigma factor becomes active are
indicated. Stages VI and V, in which the coat matures and the mother cell lyses to

release the spare are not depicted. Adapted fi'om (Kroos, 2007).

Fig. 1.1

starving cell

at?»

Stage 0 Stage I Stage II

 

coat cortex engulfment

~m~~

Stage V Stage IV Stage III

 

a

poles of the cell. Near one of the poles, usually the older of the two, the cell divides to
form two progeny of unequal volumes. The completion of the septum dividing the two
cells is the hallmark of stage II. At the beginning of stage II, two-thirds of the
chromosome belonging to the smaller progeny, or forespore, remains in the larger cell, or
mother cell, and is actively pumped into the forespore. The septum then bulges toward
the interior of the mother cell, and the ends pinch off such that the mother cell engulfs the
forespore. Completion of engulfinent is designated stage III. During stage IV, two layers
of peptidoglycan form between the cell membranes, making the cell wall and cortex. A
proteinaceous coat forms around the forespore in Stage V. Dming stage VI, the forespore
matures to gain its full resistance properties. Finally, the mother cell lyses to release the

fully resistant spore in Stage VH.

In order for formation of functional spores, each of the above steps has to occur in the
proper order. B. subtilis sporulation is regulated by a complex network of interconnected
regulatory pathways between the mother cell and forespore consisting of sequentially

activated sigma factors and transcription factors (Figures 1.1 and 1.2) (Kroos, 2007).
During stages 0 and I, 0A and 0H are the main sigma factors regulating sporulation-
specific transcription, along with the sporulation master regulator SpoOA. After the

. . F . .
asymmetric septatron that starts stage H, 0 becomes active in the forespore and causes

the activation of GB in the mother cell. At this stage, transcription is further modulated

by the transcription factors SpoIIID and GerR in the mother cell (Eichenberger et al.,

2004), and in the forespore by Rsz (Juan Wu & Errington, 2000). Engulfinent in stage

Figure 1.2. Regulation of transcription in the mother cell. The number of genes
positively and negatively regulated by each of the sigma factors and transcription factors
in the mother cell regulatory pathway is depicted. The numbers indicate the number of
genes regulated by each protein. Most of the numbers of genes listed are the results of
microarray experiments (Eichenberger et al., 2004) and, thus, may not be an indication of
direct activation or repression of transcription by each transcription factor. The design of
the experiments did not allow for examination of the effects of SpoIIID on the OK
regulon, so the data describing those effects comes in viva and in vitra transcription
assays of individual promoters and may not contain a complete set (Halberg & Kroos,

1994, Ichikawa & Kroos, 2000, Kroos et al., 1989). Adapted fiom (Kroos, 2007).

Fig. 1.2

O—A
133 « /GE
14l——GerR./
8t—SpoIIID
112“ U \3

18 r p613)
33"—
H3 :7GerE

54

 

 

 

 

III leads to the activation of 06 in the forespore, which, in turn, signals for the activation

of OK in the mother cell. The latter two sigma factors remain active throughout the rest

of sporulation in their respective cells with the activity of UK further modified by SpoIIID
and GerE (Halberg & Kroos, 1994, Ichikawa & Kroos, 2000, Eichenberger et al., 2004)
while SpoVT further regulates genes in the (:6 regulon (Wang et al. , 2006). Small, non-

coding RNAs have been found to be regulated by SpoOA, GG, and 0K, suggesting that

there is a further level of sporulation control yet to be elucidated (Silvaggi et al. , 2006).

The sporulation gene regulatory network and the resulting morphological changes are

described in more detail in the following sections.
Regulation of the Initiation of Sporulation — SpoOA

B. subtilis uses a series of kinases, KinA, KinB, KinC, KinD, and KinE (T rach &
Hoch, 1993, LeDeaux & Grossman, 1995, Jiang et al., 2000b), which, in response to
undetermined stimuli, autophosphorylate and initiate a phosphorylation cascade by
transferring their phosphates to SpoOF. SpoOF, in turn, transfers its phosphate to SpoOB.
SpoOB transfers the phosphate group to SpoOA (Brn'bulys et al. , 1991). Activation (via
phosphorylation) of SpoOA is the tipping point in the bistable switch leading to

sporulation as active SpoOA leads to the repression of a repressor of 0H, which stimulates

the transcription of KinA, SpoOF and SpoOA, creating a positive feedback loop (Dubnau

& Losick, 2006).

11

 

The level of phosphorylation of SpoOA is used to integrate a number of signals and
modulate its activity and, thereby, entry into sporulation. Sporulation cannot occur until

the cells reach a high density. RapA (Perego, 1997), RapB, and RapE (J iang et al. ,
2000a), dephosphorylate SpoOF-PO4 at low cell densities, but are inhibited by small
peptide signaling molecules when cell density increases. Nutrient limitation also has an

input on levels of SpoOA-P04. GT'P levels, serving as a stand in for intracellular energy

levels, influence the ability of CodY, a repressor of the genes encoding KinB and several
of the quorum sensing peptides in the Rap system (Molle et al., 2003b), to bind to DNA

(Ratnayake-Lecamwasam et al. , 2001).

As well as integrating cues of nutrient availability and cell density, the decision to
initiate sporulation is influenced by the state of DNA in the cell. Blocked DNA
replication leads to the production of Sda, which inhibits SpoOA activity by blocking
autophosphorylation of KinA (Burkholder et al., 2001). Proper chromosomal
partitioning is sensed by the Soj protein. In the absence of proper chromosomal

partitioning, Soj leads to the loss of SpoOA-P04 through Sda-mediated inactivation of
KinA (Murray & Enington, 2008).

SpoOA has been shown to bind to and directly regulate 121 genes (Molle et al. ,
2003a). Two thirds of these genes are negatively regulated. Many of these encode

proteins important for vegetative growth. The remaining third that are positively

regulated include (in addition to those involved in the positive feedback loop) the operons

encoding the first sigma factors specific to the forespore and mother cell (0F and 0E,

12

respectively) and their regulatory machinery; the gene encoding the protein important for
axial filament formation, RacA (Ben-Yehuda et al. , 2003); and a protein important for
asymmetric septum formation, SpoIIE (Carniol et al., 2005). SpoOA also regulates
mother cell-specific genes as it has been shown to be active specifically in the mother cell
after asymmetric septation (F ujita & Losick, 2003). Two distinct classes of genes
regulated by SpoOA have been identified (Fujita et al. , 2005). Genes requiring a low
threshold of SpoOA for activation or repression are acted on early because they have
high-affinity binding sites for SpoOA. For example, genes involved in cannibalism that

delay entry into sporulation fall into this class. Genes acted on later in sporulation by

SpoOA have lower affinity binding sites and are affected by SpoOA-P04 only when levels

rise as cells commit to enter sporulation.
Stage I — Formation of the Axial Filament

Upon the initiation of sporulation, the two newly replicated chromosomes condense
and extend across the length of the cell forming a long filament. Formation of this
filament is affected by SMC, which is important for chromosome compaction (Britton er
al. , 1998, Lindow et al., 2002). The chromosomes attach to the opposite poles of the
cells via binding by RacA near their respective origins of replication (Ben-Yehuda et al.,
2003). RacA is hypothesized to interact with DivIVA, which tethers the cell division
repressors MinCD near the poles (Edwards & Errington, 1997). The RacA-DivIVA
interaction causes release of MinCD and allows polar septum formation (Ben-Yehuda et
al., 2003). Also involved in formation of this axial filament is the DNA binding protein

Soj and its partner SpoJ (Wu & Errington, 2003).

13

Stage II — Asymmetric Cell Division

Asymmetric cell division makes use of much the same machinery, namely FtsZ, FtsA,
and MinCD, as is used during vegetative cell division (Hilbert & Piggot, 2004). As with
vegetative cell division, an FtsZ ring forms at the center of the cell, but in sporulation
then moves in a helical manner toward the poles, assisted by SpoIIE (Ben-Yehuda &
Losick, 2002). The disruption of MinCD at the poles, mediated by the RacA-DivIV A
interaction, allows polar formation of the F tsZ ring and septum formation. Though F tsZ
moves toward both poles, polar septation only occurs at one, usually the older (Hitchins,

1975). Once the septum is formed at one pole, three mother cell proteins (SpoIID,
SpoIIM, and SpoIIP) under the regulation of GE prevent the formation of a second septum
at the other pole (Eichenberger et al. , 2001). Because polar septation occurs while the
chromosomes are in an axial filament across the length of the cell, only about one third of
one chromosome is in the forespore. The remaining two thirds is rapidly pumped across
the septum by the SpoIIIE DNA translocase (Wu & Errington, 1998), but, in the 15-20
minutes required to transfer the DNA into the forespore, the transient genetic asymmetry
of the two compartments allows for spatial regulation of gene expression (Dworkin &

Losick, 2001, Frandsen et al., 1999).

. . . . F
Regglatron of early mutton 1n the forespore — o

The first compartment-specific sigma factors involved in sporulation, 0F and 0E, are

both made prior to septum formation but are only active in their proper compartments

following completion of asymmetric cell division (Hofineister, 1998, Lewis et al., 1996).

14

The first cell-specific sigma factor to be activated is (SF in the forespore. The gene
encoding CF is the third gene in an operon that also contains the genes for SpoIIAA and
SpoIIAB. SpoIIAB fimctions as an anti-sigma factor, binding to (SF and keeping it

inactive (Decatur & Losick, 1996). Sequestration of 0F by SpoIIAB is relieved by the
anti-anti-sigma factor, SpoIIAA (Schmidt et al. , 1990), which binds SpoIIAB in a

phosphorylation dependent manner, making it unavailable to bind 0F (Min et al. , 1993).

SpoIIAB, in addition to being able to sequester 6F, acts as a kinase to phosphorylate

and inactivate SpoIIAA. SpoIIE, which localizes to the polar septum, is a phosphatase
that acts antagonistically to SpoIIAB by dephosphorylating SpoIIAA (Arigoni et al. ,
1996, Duncan et al. , 1995). The ability of SpoIIE to dephosphorylate SpoIIAA is
dependent on completion of the polar septum (King et al. , 1999). Because SpoIIE is
exclusively localized to the septum and the forepore is at least four times smaller than the
mother cell, the effective SpoIIE concentration in the forespore is higher than in the
mother cell, which, coupled with the slow kinetics of the reaction catalyzed by SpoIIE,
ensures that SpoIIE-dependent dephosphorylation of SpoIIAA is exclusive to the

forespore (Iber et al. , 2006). In addition to sequestration by SpoIIAA, the ability of

SpoIIAB to hold oF inactive is further modified by targeted degradation of SpoIIAB by

the ClipCP protease (Pan et al. , 2001). Because the SpoIIA operon containing 0F and its

cognate anti- and anti-anti-sigma factors is located distal to the origin of replication,

initially upon polar septation, these genes are not present in the forespore (F randsen et al.,

15

1999). Degradation of SpoHAB and the temporary inability to replenish it in the
forespore, coupled with SpoIIE-dependent activation of SpoIIAA to sequester SpoIIAB
allows for the activation of (IF exclusively in the forespore. A threshold level of
unphosphorylated SpoIIAA needs to be achieved before it can relieve SpoIIAB-mediated

inactivation of CF, and a population of SpoIIAA-SpoHAB complexes is proposed to act

as a reservoir for active SpoIIAA until free SpoIIAB is degraded and the stochiometric

balance is shifted in the forespore (Carniol et al., 2004). Because SpoIIAB exists in two

conformations (one with high affinity for SpoIIAA and low affinity for CF, and one with

low affinity for SpoIIAA and high affinity for 0F), as fiee SpoIIAA levels increase
relative to the concentration of SpoIIAB, the rate of conversion of SpoIIAB to a
conformation with high affinity for oF decreases due to increased time spent in a complex
with SpoIIAA (Iber et al., 2006). While these mechanisms for removing SpoIIAB-

. . . . F .
mediated mactrvatron of o are somewhat redundant and a mutation to any one of them

has a modest effect on sporulation, a combination of eliminating genetic asymmetry (by
moving the spaIIA locus near the origin) and eliminating septa] localization of SpoIIE

causes a drastic reduction in spore formation (Dworkin & Losick, 2001).

The OP regulon contains 55 genes that can be divided into two temporally divided

classes (Steil et al., 2005). While the protein Rsz is a regulator of genes under the
control of 0‘: (Juan Wu & Errington, 2000), it does not appear to be the primary agent of
this temporal division (Steil et al., 2005), and its major role appears to be regulation of

timing of the expression of the signaling protein SpoIIR (Wang et al., 2006). Included in

16

the genes regulated by GP are those encoding SpoIIR, the signal for activation of GB in
the mother cell (Hofineister et al., 1995, Karow et al., 1995); 06, the sigma factor
controlling late events in the forespore (Steil et al., 2005); SpoIIQ, which is important for
engulfment and essential for transcription of the gene encoding (:6 (Broder & Pogliano,
2006, Sun et al., 2000); SpoIVB, a protease that leads to activation of OK in the mother
cell during late sporulation (Zhou & Kroos, 2005); and BoiC, a negative regulator of

SpoIVB (W akeley et al., 20003).

Regglation of early transcripfion in the mother cell — 0E

 

As with 0F, GE is synthesized before the formation of the polar septum, and is

maintained in an inactive state until stage II, in this case being held inactive in apro form

and only becoming active upon removal of the N—terminal 27 residues by proteolytic

cleavage (LaBell et al., 1987). Pro—(rE is initially associated with the membrane, but is
processed to active 0E, which is fi'ee in the cytoplasm, by SpoIIGA, the first gene in a
two gene operon that also contains the gene for pro-oE (Jonas et al., 1988, Stragier et al. ,

1988, Hofineister, 1998). SpoIIR, transcribed in the forespore under the control of (SF, is

secreted to the inter-septa] space where it directly interacts with the membrane-associated
N-terminal domain of a SpoIIGA dimer and is proposed to cause a change in

conformation, activating the C—terminal protease domain (Imamura et al., 2008). SpoIIR

is one of the early class of genes regulated by (SF (Steil et al., 2005), allowing activation

17

of (SE in the mother cell to rapidly follow activation of (SF in the forespore. Following

septum formation, mactrve pro-o 18 present in both compartments, but it IS selectively

degraded in the forespore (Fujita & Losick, 2002). Because SpoOA is active only in the

mother cell after cell division, transcription of the spaIIG operon increases in the mother

cell (Fujita & Losick, 2003), and active oE only accumulates in the mother cell.

The GE regulon consists of 171 distinct transcription units (individual genes and

operons) that can be organized into three temporally-regulated classes (Eichenberger et
al., 2004, Steil et al., 2005). The earliest class of genes includes the genes encoding
SpoIID, SpoIIM, and SpoIIP, which comprise the mother cell machinery essential for
engulfment (Abanes-De Mello et al., 2002); the SpoIIIA operon, which is essential for

the activation of 06 in the forespore (Illing & Errington, 1991); and GerR (formerly

YlbO), which is a repressor of genes in the GE regulon (Eichenberger et al., 2004). Of the

members of this class, at least SpoIIIA and SpoIlD are repressed by the transcription

factor SpoIIID, which, along with SpoIVB, which encodes the N-terminus of OK
(Stragier et al., 1989), is a member of the second class of the OE regulon (Steil et al.,

2005). The class of genes within the GE regulon expressed latest in sporulation includes

such genes as catE, which encodes a spare coat protein (Zheng et al., 1988) and is

transcribed from multiple promoters (Zheng & Losick, 1990), and spa VJ, which has been

shown to be activated by RNA polymerase containing both 0E and 0K (Foulger &

18

Errington, 1991), and this class appears to be a convergence of regulons of the two

mother cell-specific sigmas (Steil et al., 2005).
Stage III — Engulfment of the Forespore

As described above, the mother cell proteins SpoIID, SpoIIM, and SpoIIP and the
forespore protein SpoIIQ are involved in engulfinent of the forespore by the mother cell.
SpoIID has a peptidoglycan hydrolyase activity and has been proposed to cause the lysis
of mother cell wall material starting at the septum, which leads to the forespore bulging
into the mother cell at the septum (Abanes-De Mello et al., 2002). All three mother cell
proteins localize to the leading edge of cell wall hydrolysis, and continued outward
expansion of cell wall hydrolysis appears to drive membrane migration and engulfinent.
An extracellular domain of SpoIIQ interacts with a membrane-bound mother cell protein,
SpoIIIAH, (Blaylock et al., 2004), and this interaction appears to act as a ratchet to
prevent the membrane migration from reversing direction (Broder & Pogliano, 2006). In

addition, the SpoIIQ/SpoIIIAH interaction has been shown to be important for proper
localization of the machinery that regulates the activity of the late mother cell sigma, 0K
(Doan et al., 2005, J iang et al., 2005). The DNA translocase SpoIIIE is required for the
membrane firsion that results in the final free forespore protoplast surrounded by a double
membrane inside the mother cell, though this requires a domain of SpoIIIE that is distinct

fiom that required for DNA translocation (Sharp & Pogliano, 1999, Sharp & Pogliano,

2002)

19

. . . . G
Regglatron of late transcription in the fogspgre — 0

Just as 0F and 0E are synthesized but held inactive before asymmetric cell division,
. G K . . . . . .
the late Sigma factors, a and o , exrst m an mactrve form prior to completion of
engulfinent (Hilbert & Piggot, 2004). While the gene encoding 0G is transcribed prior to

engulfment, it requires an, as yet unidentified, (IE-dependent signal fi'om the mother cell
(Partridge & Errington, 1993). Upon engulfinent, a second signal from the mother cell is
required to activate (:0 (Errington et al., 1992). The (IF anti-sigma factor, SpoIIAB, and
a (JG-specific anti-sigma factor, Gin, are able to bind and inactivate (:6 (Karmazyn-
Campelli et al., 2008, Kirchman et al., 1993), but these are not sufficient to explain the

inactivity of 0'0 prior to signaling from the mother cell in the absence of both anti-sigrna
factors (Camp & Losick, 2008). The negative efl’ects of SpoIIAB on 06 activation

appear to be mainly important for preventing aberrant activation of 06 in the mother cell

(Serrano et al., 2004).

Activation of 0'6 upon engulfinent requires the vegetative protein SpoIIIJ (Partridge &

Errington, 1993), the products of the SpoIIIA operon in the mother cell (Illing &
Errington, 1991), and the forespore protein SpoHQ (Sun et al., 2000). SpoIIIJ is a
membrane protein translocase that may be involved in the insertion into the membrane of
SpoIIIAE, one of the 8 genes in the SpoIIIA operon (Serrano et al., 2008). SpoIIIJ

produced in either the mother cell or the forespore appears to be competent to fulfill this

20

 

function (Serrano et al., 2003). At least 6 members of the SpoIIIA operon associate with
SpoIIQ from the forespore to form a multimeric complex spanning both membranes that
is essential for maintenance of the forespore (Doan et al. , 2009). The proteins SpoIIIAH
and SpoHQ appear to be the minimal components of this complex required for signaling
fiom the mother cell (in addition to their role as the ratchet in engulfinent discussed
above) and form a channel connecting the two cells that may be similar to those in type

III secretion (Camp & Losick, 2008, Meisner et al., 2008).

It has been proposed that this channel allows the transport of small molecules essential

for transcription and/or translation fiom the mother cell into the forespore to allow

expression of the (:6 operon, as presence of the channel allowed transcription by several

different RNA polymerases, including (IF-directed RNA polymerase and heterologous T7
RNA polymerase, which are unable to frmction at that time in the absence of the channel
(Camp & Losick, 2009). In this model, 0F would direct transcription fi'om the gene
encoding (:6 only at a low level because at the time of transcription the forespore would

be depleted of at least one essential nutrient and/or oF would bind weakly to the CG

promoter, and any free 06 would be bound by the oG-specific anti-sigma factor Gin.

Upon formation of the SpoIIIA-SpoIIQ channel complex, around the time of engulfment,

the limiting nutrient(s) would enter the forespore and allow resumption of transcription.

This would allow the concentration of 06 to exceed that of Gin, and the small amount of
free 06 would direct transcription from the gene encoding 06, which is autoregulated

(Sun et al., 1991), resulting in a positive feedback loop and a rapid increase in 06 levels.

21

Alternatively, presence of a gate on the mother cell face of the channel coupled with the
observation that one of the other members of the SpoIIIA operon resembles an ATPase
(Meisner et al., 2008), may indicate that a specific factor is actively transported across the

channel to relieve a general block to transcription and/or translation in the forespore.

Like the (IF and 0E regulons, the (:6 regulon can be divided into early and late classes
of genes (Steil et al., 2005). The early class contains genes encoding the transcription
regulatory proteins SpoVT and 06, in addition to operons such as spaVA, which is

involved in forespore dipicolinic acid uptake (T ovar-Rojo et al., 2002), and gerA, gerB,
and gerK, which encode the receptors leading to germination in response to various
stimuli (Setlow, 2003). Many of the small acid-soluble spore proteins (SASPs) which
comprise as much as 20% of the spore protein and provide much of the resistance in the

spore (Driks, 2002), are encoded by genes in the late class (Steil et al., 2005). In addition

to being in the late class of genes in the (IF regulon as described above, SpoIVB, which
encodes a signal leading to activation of mother cell 0K (Zhou & Kroos, 2005, Campo &

Rudner, 2007, Dong & Cutting, 2003), is also a member of the class genes in the (:6

regulon whose activity peaks late under the influence of the transcription factor SpoVT

(Bagyan et al., 1996, Steil et al., 2005). SpoVT is essential for the transcription of 9

genes within the (:6 regulon, and it represses the transcription of 27 others (Wang et al.,

2006).

’22

 

. . . . K
Wu of late transcription in the moth_er cell — o

The regulation of OK begins with a non-heritable chromosomal recombination event to
excise the 48 kb skin (sigma K i_n_tervening) element to fuse the spaIVCB and spaIIIC
genes, which encode the N— and C-terminal portions of 0K respectively (Stragier et al.,
1989), by the site-specific recombinase SpoIV CA, to form the sigK gene (Kunkel et al. ,

1990), which is transcribed under the direction of GE and SpoIIID during the second of
the three temporal classes of oE-regulated genes (Steil et al., 2005). The newly formed

sigK gene is transcribed by 013- and oK-directed RNA polymerase and this also requires

SpoHID (Halberg & Kroos, 1994, Kroos et al., 1989)

. E K . . . . . . . .
Like 0 , o is m1t1ally present as an mactrve, membrane—assocrated, pro-protem

(Zhang et al., 1998). Cytoplasmic, active 0K, which has been truncated by removal of 20

N-terminal amino acids as the end product of a proteolytic cascade (Kroos et al., 1989,

Stragier et al., 1989, Zhou & Kroos, 2005, Campo & Rudner, 2007, Dong & Cutting,

2003). Pro-oK initially accumulates in the membrane in a complex with SpoIVFB, the

intramembrane zinc metalloprotease responsible for cleaving it to the active form (Y u &
Kroos, 2000, Rudner et al., 1999); BofA, the inhibitor of SpoIVF B (Zhou & Kroos,
2004); and SpoIVFA, a scaffolding protein for the complex (Rudner & Losick, 2002).

This complex has been shown to associate with the SpoIIIAH/SpoIIQ channel that is

required for activation of 06 in the forespore (Doan et al., 2005, Jiang et al., 2005).

23

SpoIVB, a serine protease transcribed under the direction of both CF and 06 (Wang et al.,

2006), serves as the forespore signal to activate 0K (Gomez et al., 1995, Zhou & Kroos,

2005, Campo & Rudner, 2007, Dong & Cutting, 2003). Activity of SpoIV B in turn is
regulated by BofC which delays the autoproteolytic activation of SpoIVB (W akeley et
al., 20003). Upon secretion into the intermembrane space and subsequent autoproteolysis
to form an active state (Wakeley et al. , 2000b), SpoIVB cleaves the scaffold protein
SpoIVFA in the mother cell membrane (Zhou & Kroos, 2005, Campo & Rudner, 2007,
Dong & Cutting, 2003). Cleavage of SpoIVF A exposes BofA to cleavage by .Cth, a
serine protease, of which, while produced in both the forespore and the mother cell, the
forespore-derived portion is required for proper processing (Campo & Rudner, 2007,

Zhou & Kroos, 2005). Cleavage of the inhibitor, BofA, allows SpoIVFB, to process pro-

oK to active 0K (Zhou & Kroos, 2004), which is then competent to direct transcription of

the genes essential for sporulation late in the mother cell.

In addition to the sigK gene itself, the 0K regulon contains at least one gene essential

for cortex formation (Piggot & Coote, 1976), genes encoding spore coat proteins (Zhang
et al. , 1994), and genes encoding proteins responsible for coat maturation (Kobayashi et

al., 1998) and germination (Behravan et al., 2000). Temporally, genes transcribed by

(SK-containing RNA polymerase can be divided into three classes (Steil et al., 2005). The

first contains those genes whose levels peak early, many of which are later repressed by
the transcription factor GerE including gerP, an operon whose products are important for

the ability of spare receptors to sense nutrients and trigger germination (Behravan et al.,

24

2000). For a second subset of the 0K regulon, including the gene encoding GerE as well

as the cab! and catB genes, which encode spore coat proteins and are repressed and

activated by GerE respectively (Eichenberger et al., 2004), transcript levels continue to

rise throughout sporulation (Steil et al., 2005). A final class of genes regulated by GK is

only transcribed later and includes genes shown to be dependent on GerE. These genes

include those encoding the spare coat proteins catG and catX (Sacco et al. , 1995, Zhang

et al., 1994). In addition to activating oK—directed transcription of sigK, SpoIIID has

been shown to have regulatory effects on the 0K regulon by negatively regulating a

subset of the genes activated by GerE (Ichikawa & Kroos, 2000).
Stage IV — Cortex Formation

The cortex is composed of two distinct layers. The inner layer is similar to that found
in vegetative cells and has been proposed to by synthesized fi'om the forespore (Foster &
Popham, 2002). The outer layer is synthesized by the mother cell proteins SpoVD and
SpoVE (Daniel et al. , 1994, Henriques et al., 1992). The outer cortex peptidoglycan
contains a modified backbone and is significantly less cross-linked than vegetative
peptidoglycan (Atrih et al., 1996). This reduced cross-linking appears to be important for

spore heat resistance and germination (Popham et al. , 1999).
Stage V - Formation of the Spore Coat

Following synthesis of the cortex, the next stage in sporulation of B. subtilis is
formation of the proteinaceous coat. The coat has two distinct layers and consists of over
40 different peptides, comprising approximately 30% of total spore protein (Henriques &

25

Moran, 2007, Lai et al., 2003). The SpoVM protein is crucial for coat assembly and has
been shown to help target another protein essential for sporulation SpoIV A to the outer
forespore membrane (Levin et al., 1993, van Ooij & Losick, 2003, Price & Losick, 1999,
Piggot & Coote, 1976). SpoVM has recently been shown to be targeted specifically to
the forespore membrane due to the convex surface of forespore, which is not a type of
membrane surface seen in the interior of bacteria (Ramamurthi et al., 2009). SpoIV A
recruits CotE and SpoVID, and together the 3 form a basal layer upon which the coat is
built (Driks et al. , 1994, Ozin et al. , 2001). This basal layer matures through an
undetermined mechanism to form the inner coat, and CotE then recruits a large number
of proteins to form the outer coat (Henriques & Moran, 2007, Little & Driks, 2001 , Kim

et al., 2006).
Stages VI-VTI - Spare Maturation and Mother Cell Lysis

A number of the proteins in the outer layer of the coat have large numbers of cysteine
residues, and it is predicted that they are highly crosslinked (Zhang et al., 1993). In
addition, a number of irreversible covalent crosslinks between coat proteins are formed,
some of which are formed by the transglutaminase Tgl (Suzuki et al. , 2000). Currently,
GerQ is the only Tgl substrate to be identified (Ragkousi & Setlow, 2004). In addition to
its function as a structural member of the spore coat, GerQ is required to recruit Cle,
which is required for cortex lysis upon germination, to the spore coat (Paidhungat et al. ,
2001, Ragkousi et al. , 2003). Full protein crosslinking by Tgl does not take place until
after lysis of the mother cell has occurred (Zilhao et al. , 2005). Lysis of the mother cell
wall to release the forespore has been shown to be a function of the partially redundant

peptidoglycan hydrolyases CwlB, CwlC, and Cle (Kuroda & Sekiguchi, 1991,

26

Nugroho et al., 1999, Smith & Foster, 1995). Following mother cell lysis, its DNA is

degraded by the NucB nuclease (Hosoya et al. , 2007).

Germination

At least 3 spore receptors, GerA, GerB, and GerH, sense and respond to the presence
of nutrients in the environment (Setlow, 2003). Activation of the nutrient receptors leads
to the release of the spore’s store of dipicolinic acid, comprising ~10% of the spore dry
weight (Setlow et al. , 2008). The release of dipicolinic acid leads to the activation of
SleB and Cle, cell cortex hydrolase enzymes which specifically degrade the outer
cortex but not the inner spore cell wall (Ishikawa er al., 1998, Magge et al., 2008, Boland
et al. , 2000). Hydrolysis of the cortex allows rehydration of the spare, cell swelling, and

resumption of vegetative metabolism (Setlow, 2003).
The Role of SpoIIID in Sporulation

Along with GerR and GerE, SpoIIID is one of three transcription factors that
modulates the activity of the mother cell sigma factors during sporulation (Figure 1.2)

(Eichenberger et al., 2004). While the activity of the other two is restricted to either the
OE (GerR) or the 0K (GerE) regulon, SpoIIID regulates, both positively and negatively,

transcription directed by both sigma factors (Halberg & Kroos, 1994). GerR, which acts

concurrently with SpoIIID, is a recently identified repressor of 10 transcription units in
the OE regulon, about which little is known (Eichenberger et al., 2004). In contrast, GerE

has been well studied. The structure of GerE, which activates 27 transcription units in

the 0K regulon while repressing 36 (Eichenberger et al., 2004), has been solved to reveal

27

that it acts as a dimer and binds DNA through the use of a helix-turn-helix motif (Ducros
et al., 2001, Crater & Moran, 2001). Two distinct regions of GerE have been identified

that are important for the activation of transcription of different genes (catC and catX)
(Crater & Moran, 2002, Crater er al., 2002). A corresponding region in OK required for

the activation of one of those genes (catX) has been identified as well (Wade et al. ,

1999).

The SpoHID locus was originally identified in UV-mutagenesis screens as a site of
mutations that caused a block at stage III of sporulation (Ionesco et al., 1970, Rouyard et
al., 1967). The activity of SpoIIID, which is a 10.8 kDa protein of 93 amino acids with a
predicted helix-turn-helix motif (Kunkel et al. , 1989), has been shown to be exclusively

required in the mother cell (de Lencastre & Piggot, 1979). In addition to activating the
transcription of the sigK gene by both 0E and 0K (Halberg & Kroos, 1994, Kroos et al.,
1989), SpoIIID has been shown to be essential for the transcription of 8 genes or operons

in the GE regulon, while repressing 62 (Eichenberger et al., 2004). SpoIIID might repress

more genes in the OE regulon, based on microarray results, but the observed negative
regulation might instead be due to indirect effects. SpoIIID has also been shown to
repress the transcription of at least 3 genes in the 0K regulon (Halberg et al., 1995,

Ichikawa & Kroos, 2000, Kroos et al., 1989). Additionally, SpoIIID has been shown to
regulate the transcription of its own gene, with expression fi'om the spaIIID promoter
being decreased 3- to 7-fold in a strain lacking SpoIIID (Kunkel et al., 1989, Stevens &

Errington, 1990).

28

SpoIIID is co-transcribed with a small upstream gene, usd, whose translation is
required for the synthesis of SpoIIID, as translation of usd is believed to make the Shine-
Delgarno sequence of SpoHID, which is otherwise unavailable in a stem-loop structure,
accessible to binding by the ribosome (Decatur et al., 1997). SpoIIID begins to
accumulate about 3 hours into sporulation and peaks after about 5 hours, alter which

point levels decrease (Halberg & Kroos, 1992). The decrease of SpoHID late in

sporulation has been shown to be mediated by negative regulation of GE levels by UK

through two distinct mechanisms (Zhang & Kroos, 1997, Zhang et al., 1999). The
reduction of SpoIIID during late sporulation is essential for spores to achieve firll heat

and lysozyme resistance, though the effects of allowing SpoIHD levels to remain high

throughout sporulation can be abrogated by engineering 6K, whose levels decrease late in

sporulation in a GerE-dependent manner, to persist throughout sporulation as well (Wang

et al., 2007b, Wang et al., 2007a).

Regulation of transcription of many genes by SpoHID has been shown to be mediated
by direct binding of SpoIIID to DNA (Halberg & Kroos, 1994, Ichikawa & Kroos, 2000,
Zhang et al. , 1997, Eichenberger et al., 2004). Multiple binding events by SpoIIID to
DNA fragments less than 300 bp in length have been shown for a number of the genes
regulated by SpoIIID (Halberg & Kroos, 1994, Eichenberger et al., 2004). Analysis of
several sites bound by SpoIIID led to the identification of a WWRRACARNY consensus
sequence (where W is A or T, R is purine, Y is pyrimidine, and N is any nucleotide)
(Halberg & Kroos, 1994, Ichikawa & Kroos, 2000, Zhang et al., 1997). While perfect

matches to this sequence occur 4840 times in the B. subtilis genome, which is 4.2 Mb and

29

is predicted to contain 4,100 genes (Kunst et al., 1997), at least one sequence known to
be bound by SpoHID is not included. Analysis of a larger set of promoters known and
predicted to be bound by SpoHID was used to create a consensus of which the most
common bases at each position are GGACAAG (Eichenberger et al., 2004), a sequence
which occurs 582 times in the genome, but is not present in a number of known SpoIIID-
bound sequences. The WWRRACARNY consensus sequence is present multiple times
in several sequences strongly bound by SpoIIID in DNAse I protection assays, leading to
the idea that SpoIHD might bind DNA as a multimer at those sequences (Halberg &
Kroos, 1 994).

In addition to being a key regulator of development, because SpoHID is found only in
Bacillus and Clastridium species and their relatives, several of which are pathogens, the
study of SpoHID is interesting as it could lead to the development of specifically targeted
inhibitors. Its small size, coupled with the well-characterized genetics of Bacillus
subtilis, makes SpoIIID an attractive model to increase om knowledge of. DNA binding
and transcriptional regulation by helix-turn-helix proteins.

In the Chapter 2, 1 demonstrate that SpoIIID binds to a single match to its binding site
consensus as a monomer with high affinity. I also show that binding is mediated through
two distinct regions in SpoIIID. In addition to the predicted N-terminal helix-turn-helix
motif, a C-terrninal region is essential for interaction with DNA. This mechanism of
DNA binding appears to be novel among bacterial helix-turn-helix proteins. I also
examine the effects of a large number of mutations in SpoIHD on transcription in viva, as
a start toward identifying residues of SpoIIID that are important for transcriptional

activation.

30

In addition to identifying the requirements for the interaction between SpoHID and
DNA, I prepared isotopically labeled SpoIIID, both bound to DNA and free in solution,
that was then used to collect NMR data for structural analysis, as described in Appendix
I. In Chapter 3, the results of structure determination using these data described along
with their implications for a number of the results discussed in Chapter 2. In addition, I

will discuss filture directions this project could take.

31

Chapter 11: Two regions of transcription factor SpoIIID allow a monomer to bind

t

DNA

.This chapter is being submitted for publication with Steve J. McBryant of the
Department of Biochemistry and Molecular Biology at Colorado State University as an
additional author because he performed the analytical ultracentrifugation assay and was

instrumental in writing the section regarding the results of that experiment.

32

Abstract

Nutrient limitation causes Bacillus subtilis to develop into two different cell types, a
mother cell and a spare. SpoIIID is a key regulator of transcription in the mother cell. It
positively or negatively regulates more than 100 genes, in many cases by binding to the
promoter region. SpoIIID was predicted to have a helix-turn-helix motif for sequence-
specific DNA binding, and a 10-bp consensus sequence was recognized in binding sites,
but some strong binding sites were observed to contain more than one match to the
consensus sequence, suggesting that SpoIIID might bind as a dimer, or cooperatively as
monomers. Here, we show that SpoIIID binds with high aflinity as a monomer to a
single copy of its recognition sequence, and with little cooperativity to DNA containing.
more than one match to its binding site consensus sequence. Using charge reversal
substitutions of residues likely to be exposed on the surface of SpoHID, and assays for
transcriptional activation in viva and for DNA binding in vitra, we identify two regions
essential for DNA binding, the putative recognition helix of the predicted helix-turn-helix
motif and a basic region near the C-terrninus. SpoIIID appears to be unique among
prokaryotic DNA-binding proteins with a single helix-turn-helix motif in its ability to
bind DNA monomerically with high affinity. We pr0pose that the C-terminal basic
region of SpoIIID makes additional contacts with DNA, analogous to the N-terminal arm

of eukaryotic homeodomain proteins and the “wings” of winged-helix proteins.

33

- Introduction

In response to nutrient limitation, the Gram-positive bacterium Bacillus subtilis
undergoes a process of endospore formation to produce a progeny cell that can survive
until conditions favorable for growth return (Kroos, 2007). The sporulation process
involves creation of two distinct cell types by polar septation; a larger mother cell and a
smaller forespore (see Chapter 1, Fig. 1.1). The mother cell engulfs the forespore, so it is
surrounded by two membranes. A peptidoglycan cortex forms between the two
membranes and a protein coat assembles on the surface of the nascent spore, which upon
maturation can withstand a variety of environmental stresses. The process is completed
when the mother cell lyses to release the matrn'e spore, which can survive in a
metabolically inert state for many years. Bacilli and Clastridia related to B. subtilis also
form endospores, which can pose a threat to human health.

For a complex process like sporulation to be successful, a tightly controlled system of

temporal and spatial gene regulation is essential. In B. subtilis this is achieved in part by

a cascade of cell-type-specific 0' subunits of RNA polymerase (RNAP). 0F becomes
active first, in the forespore, followed by GB in the mother cell, then 06 in the forespore,

and finally 0K in the mother cell (Losick & Stragier, 1992, Kroos, 2007) (Fig. 1.1).

Activation of the forespore 0 factors is coupled to morphogenesis, with polar septation
leading to activation of (IF and with completion of engulfinent signaling activation of 06.

The mother cell 0 factors are activated in response to signals fi'om the forespore, with (IF

and 06 activity required to activate 0E and 0K, respectively. In the mother cell, temporal

regulation of transcription is further controlled by three transcription factors: GerR,

34

SpoIIID, and GerE (see Chapter 1, Fig. 1.2). GerR appears to act only as a
transcriptional repressor of genes in the OE regulon early during sporulation
(Eichenberger et al., 2004). SpoIIID has been shown to activate and repress transcription

of genes in both the GE and 0K regulons, although most of its effects are on genes in the

oE regulon (Halberg & Kroos, 1994, Ichikawa & Kroos, 2000, Zhang et al., 1997,
Eichenberger et al., 2004). Genome-wide transcriptional profiling of a SpoIIID mutant in

combination with approaches to detect and predict SpoIIID-binding sites in the genome

suggests that nearly halfof the 272 genes in the OE regulon are up— or down-regulated by

SpoIIID, in many cases by binding of SpoIIID to the promoter region (Eichenberger et
al., 2004). The appearance and disappearance of SpoIIID during sporulation is tightly
regulated (Halberg & Kroos, 1992, Zhang & Kroos, 1997, Zhang et al., 1999), and
circumventing this regulation in a way that causes the SpoIIID level to remain high late

into sporulation results in spore defects (Wang et al., 2007a). GerE has been shown to

. . . . K . .
activate or repress transcription of genes in the o regulon later during sporulation

(Eichenberger et al., 2004, Ichikawa et al. , 1999, Ichikawa & Kroos, 2000, Zhang et al.,
1994, Zheng et al., 1992. GerE crystallized as a dimer and its strongest binding sites in
DNA contain inverted repeats matching the consensus sequence RWWTRGGYNNYY
(RmeansAorG,WmeansAorT,YmeansCorT,andeeansA,C, G, orT)
{Ducros, 2001 #179). Each monomer of the GerE dimer has a helix-tum-helix (HTH)
motif whose recognition helix is predicted to make contacts in the major groove of DNA.
Thus, GerE appears to achieve high-affinity binding to DNA by a mechanism similar to

that of many other HTH-containing DNA-binding proteins (Pabo & Sauer, 1992).

35

How does SpoIIID achieve high-afiinity binding to DNA? SpoIIID has a putative
HTH motif (Kunkel et al., 1989) but appeared to be monomeric when purified fiom
sporulating B. subtilis (B. Zhang and L.K., unpublished data). Because some of the
strongest binding sites for SpoIIID in DNA contain inverted repeats matching the
consensus sequence WWRRACARNY, it was suggested that monomers might bind
cooperatively at these sites (Halberg & Kroos, 1994). However, here we show that
SpoIIID binds with little cooperativity to a site containing inverted repeats and that a
SpoHID monomer is capable of binding to a single copy of the consensus sequence with
high affinity using two protein domains. One region is in the predicted HTH motif near
the N-terminus of the protein, but the other region is located near the C-terminus. We
conclude that SpoIIID, a transcription factor crucial for B. subtilis sporulation and highly
conserved in other Bacilli and Clastridia that form endospores, achieves high-affinity
DNA-binding by an unusual mechanism.

Experimental Procedures

Plasmids - The plasmids used in this study are described in Table 2.1 and the
Oligonucleotides used are listed in Table 2.2. Mutations were introduced into the spaIIID
gene using the QuikChange site-directed mutagenesis kit (Stratagene). All cloned PCR
products and all mutant spaIIID genes were sequenced at the Michigan State University
Genomics Technology Support Facility to confirm that no undesired mutations were
present.

Overexpressian afSpalIID —- Plasmids designed to overexpress vvild-type or altered

SpoIIID from a T7 RNAP promoter were transformed into Escherichia cali BL21 (DE3)

36

 

Table 2.1. Descriptions of certain plasmids used in this study

 

Plasmid

Description

Construction

Reference or
Source

 

pMLK83

Apr Nmr; vector to
make gusA fusions for
integration at amyE

(Karow et
al., 1995)

 

pAK3

Apr Spr; vector for
integration at thrC

a spectinomycin resistance gene
was inserted into the Xcml site in
the em gene of pDG795
(Guerout-Fleury et aI. , 1996)

V. Chary and
P. Piggot

 

pET-21b

Apr; T7

Novagen

 

pPHl

Apr Spr; spaIIID

the spaIIID promoter (-230 to
+303 with respect to translational
start) and coding regions were
amplified by PCR using LK421
and LK422 as primers and PY79
chromosomal DNA as template,
then the EcoRI-digested PCR
product was inserted into the
EcoRI site of pAK3

This work

 

pPH4

Apr; T7-spaIIID

the SpoIIID coding region (+2 to
+303 with respect to translational
start) was amplified by PCR using
LK566 and LK567 as primers and
PY79 chromosomal DNA as
template, then the NdeI and
BamHI digested PCR product was
inserted between the NdeI and
Baml-II sites of pET-21b

This work

 

 

pPH7

 

1' 1’
AP Nm ; PspaIVCA'
gusA transcriptional
fusion

 

the spaIV CA promoter region from
-137 to +35 (with respect to the
start of transcription) was
amplified by PCR using LK616
and LK617 as primers and PY79
chromosomal DNA as template,
then the SalI-BamHI-digested
PCR product was inserted between
the SalI and BamHI sites upstream
of the gusA gene pMLK83

 

This work

 

Abbreviations: Apr, ampicillin-resistant; Nmr, neomycin-resistant; Spr, spectinomycin-
resistant; T7, T7 RNA polymerase promoter and a translation initiation sequence.

37

 

 

Table 2.2. Oligonucleotides used in this study

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Primer Sequencea

LK1579 (1123b 5’-gggaggtcgagtggtgtggaggattacatcaaagagcg-3’
LK1580 5’-cgctctttgatgtaatcctccacaccactcgacctccc-3’

LK1581 (D3K) 5’-ggaggtcgagtggtgtgcacaaatacatcaaagagcgaac-3’
LK1582 5’-gttcgctctttgatgtatttgtgcacaccactcgacctcc-3’

LK1583 (K6E) 5’-gtgcacgattacatcgaagagcgaacaatcaag-3’

LK1584 5’-cttgattgttcgctcttcgatgtaatcgtgcac—3’

LK1585 (E7K) S’-gtgcacgattacatcaaaaagcgaacaatcaagatagg—3’
LK1586 5’-cctatcttgattgttcgctttttgatgtaatcgtgcac-3’

LK1587 (R8E) 5’-gtgcacgattacatcaaagaggaaacaatcaagataggg—3’
LK1588 5’-ccctatcttgattgtttcctctttgatgtaatcgtgcac—3’

LK1591 (K14E) 5’-gaacaatcaagataggggagtacatcgtggagac—3’

LK1592 5’-gtctccacgatgtactcccctatcttgattgttc—3’

LK1593 (E18K) 5’-gggaagtacatcgtgaagacaaagaaaaccgttc-3’

LK1594 5’-gaacggttttctttgtcttcacgatgtacttccc—3’

LK1595 (K20E) 5’-gtacatcgtggagacagagaaaaccgttcgtg-3’

LK1596 5’-cacgaacggttttctctgtctccacgatgtac-3’

LK1599 5’-ggagacaaagaaaaccgaacgtgtcattgcgaagg-3’

(V 23K)

LK1600 5’-ccttcgcaatgacacgttcggttttctttgtctcc-3 ’

LK1001 5’-gtggagacaaagaaaaccgttgctgtcattgcgaaggaatttggtg—3’
(R24A)

LK1002 5’-caccaaattccttcgcaatgacagcaacggttttctttgtctcaac-3’
LK824 (R24E) 5’-gtggagacaaagaaaaccgttgaagtcattgcgaaggaatttggtg—3’
LK825 5’-caccaaattccttcggaatgacttcaacggatttctttgactccac-3 ’
LK963 (V 25E) 5’-gagacaaagaaaaccgttcgtgaaattgcgaaggaatttggtg-3’
LK964 5’-caccaaattccttcgcaatttcacgaacggttttctttgtctc-3’
LK965 (V 25K) 5’-ggagacaaagaaaaccgttcgtaaaattgcgaaggaatttggtgtttcc—3’
LK966 5’-ggaaacaccaaattccttcgcaattttacgaacggttttctttgtctcc-3’
LK1603 (I26E) 5’-gaaaaccgttcgtgtcgaggcgaaggaatttggtg—3’

LK1604 5’-caccaaattccttcgcctcgacacgaacggttttc-3’

LK967 (A27E) 5’-gaaaaccgttcgtgtcattgagaaggaatttggtgtttcc—3’

LK968 5’-ggaaacaccaaattccttctcaatgacacgaacggttttc—3’
LK826 (K28E) 5’-cgttcgtgtcattgcggaggaatttggtgtttcc—3’

LK827 5’-ggaaacaccaaattcctccgcaatgacacgaacg—3’

LK828 (E29K) 5’-cgttcgtgtcattgcgaagaaatttggtgtttccaaaagtac-3’
LK829 5’-gtacttttggaaacaccaaatttcttcgcaatgacacgaacg-3’

 

38

 

 

Table 2.2 (cont’d).

 

 

 

 

LK 969 (F 30A) 5’-gttcgtgtcattgcgaaggaagctggtgtttccaaaagtacagtac-3’
LK970 5’-gtactgtacttttggaaacaccagcttccttcgcaatgacacgaac-3’
LK1683 (G3 IE) 5 ’-gtcattgcgaaggaatttgaggtttccaaaagtacagtac—3 ’
LK1684 5’-gtactgtacttttggaaacctcaaattccttcgcaatgac-3’
LK1685 (V 32E) 5’-gcgaaggaatttggtgagtccaaaagtacagtacacaag~3’
LK1686 5’—cttgtgtactgtacttttggactcaccaaattccttcgc-3’

LK830 (S33A) 5’-cgaaggaatttggtgttgccaaaagtacagtacacaagg-3’
LK83 1 5 ’-ccttgtgtactgtacttttggcaacaccaaattccttcg—3 ’

 

LK971 (S33R)
LK972

5 ’ -ggttcattgcgaaggaatttggtgttcgtaaaagtacagtacacaaggatttaacag~3 ’
5 ’ -ctgttaaatccttgtgtactgtacttttacgaacaccaaattccttcgcaatgacac—3 ’

 

 

 

 

 

 

 

 

 

 

 

 

 

 

LK973 (KST- 5’-gtcattgcgaaggaatttggtgtttccgctgctgcagtacacaaggatttaacagagcgtctg-3’
343 536AAA)

LK974 5’-cagacgctctgttaaatccttgtgtactgcagcagcggaaacaccaaattccttcgcaatgac-3’
LK1605 (K34E) 5’-ggaatttggtgtttccgaaagtacagtacacaagg—3’

LK1606 5’-ccttgtgtactgtactttcggaaacaccaaattcc-3’

LK1687 (S35E) 5’-cgaaggaatttggtgtttccaaagagacagtacacaaggatttaac-3’

LK1688 5’-gttaaatccttgtgtactgtctctttggaaacaccaaattccttcg—3’

LK1689 (T36E) 5’-ggaatttggtgtttccaaaagtgaagtacacaaggatttaacag-3’

LK1690 5’-ctgttaaatccttgtgtacttcacttttggaaacaccaaattcc—3 ’

LK975 (VHK- 5’{gaaggaautggtgtttccaaaagtacagctgctgcggatttaacagagcgtctgcctg-3’
373 83 9AAA)

LK976 5’-caggcagacgctctgttaaatccgcagcagctgtacttttggaaacaccaaattccttcg-3 ’
LK1691 (V 3 7B) 5 ’-ggtgtttccaaaagtacagaacacaaggatttaacag-3 ’

LK1692 5’-ctgttaaatccttgtgttctgtacttttggaaacacc-3’

LK1607 (H38E) 5’-cgtgtttccaaaagtacagtagagaaggatttaacagagcgtc-3’

LK1608 5’-gacgctctgttaaatccttctctactgtacttttggaaacacg-3’

LK1609 (K39E) 5’-caaaagtacagtacacgaggatttaacagagcgtc-3’

LK1610 5’-gtcgctctgttaaatcctcgtgtactgtacttttg-3’

LK977 (DLT- 5’—gtttccaaaagtaagtacagtacacaaggctgctgcagagcgtctgcctgaaattaacccc~3’
404142AAA)

LK978 5’-ggggttaatttcaggcagacgctctgcagcagccttgtgtactgtacttttggaaac-3’
LK161 1 5’—ccaaaagtacagtacacaagaaattaacagagcgtctgcctg-3 ’

(D40K)

LK1612 5’-caggcagacgctctgttaatttcttgtgtactgtacttttgg—3’

LK1693 (L41K) 5’-gtacagtacacaaggataaaacagagcgtctgcctg-3’

LK1694 5’-caggcagacgctctgttttatccttgtgtactgtac-3 ’

LK1695 (T42K) 5’-cagtacacaaggatttaaaagagcgtctgcctg-3’

LK1696 5’-caggcagacgctcttttaaatccttgtgtactg-3’

 

39

 

 

Table 2.2 (cont’d).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

LK1613 5’-gtacacaaggatttaacaaagcgtctgcctgaaattaac-3’

(E43K)

LK1614 5’-gttaatttcaggcagacgctttgttaaatccttgtgtac -3’

LK1615 5’-cacaaggatttaacagaggaactgcctgaaattaaccccg—3’
(R4413)

LK1616 5’-cggggttaatttcaggcagttcctctgttaaatccttgtg—3’

LK1617 (E47K) 5’-cagagcgtctgcctaaaattaaccccgacttg-3’

LK1618 5’—caagtcggggttaattttag_gcagacgctctg—3’

LK1619 5’-ctgcctgaaattaaccccaagttggcaaacgaagtgaaag-3’
(D51K)

LK1620 5’-ctttcacttcgtttgccaacttgggttaatttcag_g£ag-3’

LK1621 (E55K) 5’-cccgacttggcaaacaaagtgaaagaaatactc—3’

LK1622 5’-gagtatttctttcactttgtttgccaagtcccc—3’

LK1623 (K57E) 5’-cttggcaaacgaagtggaagaaatactcgattatc-3’

LK1624 5’-gataatcgagtatttcttccacttcgtttgccaag—3’

LK1625 (E58K) 5’—ggcaaacgaagtgaaaaaaatactcgattatcataaatcc-3’
LK1626 5’-ggatttatgataatccagtatttttttcacttcgtttgcc-3’

LK1627 5’-ggcaaacgaagtgaaagaaatactcaaatatcataaatccatcaggc-3’
(D61 K)

LK1628 5’-gcctgatggatttatgatatttgagtatttctttcacttcgtttgcc-3’
LK1629 (H63 E) 5’-gtgaaagaaatactcgattatgagaaatccatcaggcatttaagagg-3 ’
LK1630 5’—cctcttaaatgcctgatggatttctcataatcgagtatttctttcac-3’
LK1631 (K64E) 5’-gaaatactcgattatcatgaatccatcaggcatttaagag-3 ’
LK1632 5’-ctcttaaatgcctgatggattcatgataatcgagtatttc-3’

LK1635 (H68E) 5’-cataaatccatcagggagttaagaggaggagaagcgac—3’
LK1636 5’-gtcgcttctcctcctcttaactccctgatggatttatg-3’

LK1637 (R70E) 5’-cataaatccatcaggcatttagaaggaggagaagcgac—3’
LK1638 5’-gtcgcttctcctccttctaaatgcctgatggatttatg—3’

LK1639 (E73K) 5’-ggcatttaagaggaggaaaagcgacaaagctc-3’

LK1640 5’-gagctttgtcgcttttcctcctcttaaatgcc-3’

LK1641 (K76E) 5’-ggaggagaagcgacagagctcaaatataaaaaag—3’

LK1642 5’—cttttttatatttgagctctgtcgcttctcctcc-3’

LK979 5 ’-caggcatttaagaggaggagaagcgacataactcaaatataaaaaagatgaaattctcg-3’
(K76Stop)

LK98O 5’-cgagaatttcatcttttttatatttgagttatgtcgcttctcctcctcttaaatgcctg-3 ’
LK1643 (K78E) 5’-gaggagaagcgacaaagctcgaatataaaaaagatg—3’

LK1644 5’-catcttttttatattcgagctttgtcgcttctcctc-3’

LK1645 (K80E) 5’-gcgacaaagctcaaatatgaaaaagatgaaattctcgaag—3 ’
LK1646 5’-cttcgagaatttcatctttttcatatttgagctttgtcgc-3’

 

 

40

 

 

Table 2.2 (cont’d).

 

LK1647 (K81E)
LK1648

5’-gacaaagctcaaatataaagaagatgaaattctcgaagg—3’
5 ’ -ccttcgagaatttcatcttctttatatttgagctttgtc-3 ’

 

 

 

 

 

 

 

 

LK1649 5’-gacaaagctcaaatataaaaaaaaggaaattctcgaaggagagcctg—3’
(D82K)

LK1650 5’-caggctctccttcgagaatttccttttttttatatttgagctttgtc—3’
LK1651 5’-cgacaaagctcaaatataaaaaataggaaattctcgaaggagagcctg—3’
(D828top)

LK1652 5’-caggctctccttcgagaatttcctattttttatatttgagctttgtcg-3 ’
LK1655 (E86K) 5’-gatgaaattctcaaaggagagcctgttcagc-3’

LK1656 5’-gctgaacaggctctcctttgagaatttcatc~3’

LK1659 (E88K) 5’-gaaattctcgaaggaaagcctgttcagcaatcg-3’

LK1660 5’-cgattgctgaacaggctttccttcgagaatttc-3’

LK421 5’-cggaattcagttcgtttcaccccttgtc-3’

(SpoIIID -230

to +303)”

LK422 5’-cgaattccaagaaggcaatgccagg—3 ’

LK566 , 9
(SpoHID +2 to 5 -gggaa____ ttccatatgcacgattacatcaaagagcgaac-3
+3030 5’-cgggatcccaagaaggcaatgccagg—3’

LK567

LK616 5’-ac c c ac acc a gta -3’

(SpoIVC A -248 JAE—82188 ta32188 gt g

to _59)c , a

LK617 5 Wcagcfigcggtccctcgé

 

 

a Boldface type indicates location of mutation in sequence. '

b For each primer pair used in site-directed mutagenesis of pPH4, the substitution in
SpoIIID is indicated in parentheses alter the name of the primer, the top primer indicates
the coding strand, the bottom primer indicates the template strand.

6 For each primer pair used to clone sequences out of the Bacillus subtilis chromosome,
the boundaries of the region (in nucleotides, with respect to the start of translation) are
indicated in parentheses after the name of the primer, the top primer is the primer
complementary to the upstream end of the sequence cloned, and the bottom primer is
complementary to the downstream end. Sequences not part of the region cloned are

underlined.

41

 

(Novagen), a strain that can be induced to synthesize T7 RNAP by the addition of
isopropyl B-D-thiogalactopyranoside (IPT G). Transformants were grown on Luria-
Bertani (LB) agar (Sambrook et al., 1989) containing 100 ug/ml ampicillin for 10-12 h at
30°C. Small, isolated colonies (as SpoIIID overexpression causes a growth defect in E.
cali) were selected to inoculate 0.5-1 1 of LB liquid medium containing 150 rig/ml

ampicillin and the culture was incubated at 37°C with vigorous shaking until it reached

an OD600 of approximately 1, then IPTG (0.5 mM) was added and the incubation was

continued for 2.5 h. Cells were then harvested by centrifugation (7000 x g for 15 min at
4°C) and stored at -70°C.

Purification afSpaIIID - Cells were resuspended in 20 ml of lysis buffer (50 mM Tris-

HCl pH 8.0, 10 mM MgC12, 4 mM EDTA) to which 1 Complete Mini EDTA-flee

protease inhibitor tablet (Roche) had been added and lysed by passage through a French
pressure cell at 14,000 psi four times. The lysate was cleared by low-speed
centrifirgation (7000 x g for 10 min at 4°C) followed by high-speed centrifugation
(approximately 175,000 x g for 1 h at 4°C). The supernatant was passed over a 1 ml SP
Sepharose column (GE Healthcare) that had been equilibrated with SP column buffer (25
mM Tris-HCl pH 8.0, 0.1% Triton X-100, to which 1 Complete Mini EDTA-flee
protease inhibitor tablet per 10 ml had been added). The column was washed with 5 ml
SP column buffer and SpoIIID was eluted with SP column buffer supplemented with a
0.2 to 0.6 M NaCl gradient. Wild-type SpoIIID and the G87Stop form eluted at ~0.5 M
NaCl, while other mutant forms of SpoIIID eluted at different NaCl concentrations
(K34E, K39E, and R44E at ~0.3 M; H38E and K76Stop at ~0.4M; S33R, E43K, and
D828top at ~06 M). Identification of fractions containing SpoIIID and purity was

42

determined by separation on SDS-14% Proseive polyacrylamide gels (Lonza) with Tris-
Tricine electrode buffer (0.1 M Tris, 0.1 M Tricine, 0.1% SDS) followed by staining with
Coomassie solution (0.1% Coomassie brilliant blue R-250, 10% acetic acid, 45% ethanol)
and destaining with a 10% acetic acid, 45% ethanol solution. Fractions containing
SpoIIID were pooled, dispensed into 60 pl aliquots, and stored at -70°C for later use in
electrophoretic mobility shift assays (EMSAs). Alternatively, for analytical
ultracentrifugation, SpoIIID was purified as above except that SP Column buffer did not

contain 0.1% Triton X—100, and fiactions containing SpoIIID were pooled following

purification over the SP Sepharose column and passed over a 1-ml HiTrapTM Heparin

HP column (GE Healthcare) that had been equilibrated with 10 mM potassium phosphate
buffer pH 7.0 (buffer 1). SpoIIID was eluted with successive washes of buffer 1
supplemented with 0.6 M, 0.8 M, 1 M, 1.2 M, and 1.4 M NaCl. The SpoIIID used for
analytical ultracentrifugation eluted at 1.0 M NaCl. The concentration of SpoIIID
purified by either method was determined by measuring the absorbance at 280 nm.
EMSAs - Oligonucleotides corresponding to the probes listed in Table 2.4 were

synthesized at the Michigan State University Genomics Technology Support Facility,
labeled with [y-32PJATP using T4 polynucleotide kinase (New England Biolabs), and
annealed by allowing to cool to room temperature after incubating in a boiling water bath
for 10 min. Each annealed probe was visualized by autoradiography alter electrophoresis
through a 15% polyacrylarnide gel, the band corresponding to the appropriate size was
excised, and the labeled probe DNA was eluted by incubation at 37°C overnight in 150 pl

TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA).

43

Labeled probe DNA (~13 nM) was incubated at 30°C for 30 min in buffer [10 mM
Tris-HCl pH 7.5, 50 mM NaCl, 10 mM EDTA, 5% glycerol, 0.1 mM double-stranded
poly dI-dC (Roche)] with SpoIIID at the concentrations indicated. Reaction mixtures
were electrophoresed on an 8% polyacrylamide gel using 0.5x T'BE (45 mM Tris-borate,
1 mM EDTA) and dried. Bands were visualized using a Storm 820 PhosphorImager

(Molecular Dynamics) and quantified with Imageth software (GE Healthcare). The
apparent dissociation constant (Kd) was determined by plotting the linear range of the log

of the ratio of bound to flee probe DNA versus the log [SpoIIID], observing the
[SpoIIID] at which the line intersected the x-axis (i. e. [bound DNA] = [fiee DNA]), and
subtracting 6.5 nM (half the concentration of the DNA probe), since this is the [SpoIIID]
bound to DNA when [bound DNA] = [free DNA].

Preparation of Samples for Analytical Ultracentrifirgaian. Oligonucleotides identical
in sequence to probe 11 (Table 2.4) were obtained fiom the Michigan State University
Genomics Technology Support Facility and were resuspended in water. Equimolar
concentrations were combined with buffer 1 supplemented with 50 mM NaCl, placed in a
boiling water bath for 10 min, and allowed to cool to room temperature. SpoIIID purified
as described above using a Heparin HP column was diluted tenfold in buffer 1 to a 0.1 M
NaCl final concentration. Three different amounts of diluted SpoHID (10.8, 12, and 13.8
nmol) were added to a constant amount of probe 11 DNA (12 nmol) prepared as
described above and adjusted to 0.1 M NaCl in buffer 1, resulting in 3 mixtures with
slightly different protein to DNA ratios. To each mixture, 1 Complete Mini EDTA-free
protease inhibitor tablet was added and the mixtures were incubated at 4°C with rotation

for 1 h. SpoHID/DNA complexes were concentrated using Anricon Ultra 4 (5K MWCO)

(Millipore) filtration devices to a final volume of 1 m1, then shipped on ice to the
Colorado State University Specialized Facility for Protein Characterization, where they
were dialyzed extensively versus buffer 1 supplemented with 0.1 M NaCl prior to
analytical ultracentrifugation

Analytical Ultracentrifirgatian - All experiments were performed in a Beckman XL-I
using the absorbance optical system and a 4-hole, AN 60-Ti rotor. Sedimentation velocity
(SV) was performed in a 1.2-cm, 2-sector EPON centerpiece, while sedimentation

equilibrium (EQ) was performed in a 1.2-cm, 6-sector EPON centerpiece. For SV, 400

ill of sample at A260 = 0.5 was sedimented at 55,000 rpm (244,000 x g) for 4 h at 22 °C,

with a radial step size of 0.002 cm in the continuous scanning mode. A total of 53 scans
were analyzed using the method of Demeler and van Holde (Demeler & van Holde,
2004) to yield the diffusion-corrected, integral distribution of S over the boundary [G(s)]

within Ultrascan (version 9.4 for Linux). Sedimentation coefficients (s) were corrected to
that in water at 20°C (520”). C(s) fitting to determine the hydrodynamic properties and,

ultimately, model the molecular mass of the complex, was performed within Ultrascan.
The solvent density and viscosity were calculated within Ultrascan (1.0033 g/ml and
1.0095 cP, respectively). The partial specific volumes (v-bar) for the SpoIIID protein
(0.747 ml/g), DNA (0.55 ml/g), and the SpoIIID/DNA complex (0.68 ml/g) were also
estimated using Ultrascan.

Based on the hydrodynamic properties returned fiom the SV experiments, the
conditions for performing EQ (i.e., the appropriate rotor Speeds for achieving equilibrium
at o = 1-4 and the approximate time to equilibrium) were modeled using Ultrascan. For

EQ, 100 pl samples with 0.2, 0.5, and 0.7 absorbance units at 230, 260, and 280 nm,

45

respectively, were loaded into the centerpiece. The samples were centrifuged to
equilibrium (as evidenced by overlaying absorbance scans collected 4-8 hours apart) at
28,000, 34,600, 41,300, and 48,000 rpm (63,000, 96,500, 137,500, and 185,800 x g). Ten
scans at 0.001 cm radial step size were averaged for each data set. A total of 72 data sets
were available for global fitting. The data were globally fit to various models within
Ultrascan (molecular weight distribution model, single, ideal species model, and two
component, non-interacting model) as described in the Results section. The fit of the data
to the models was judged by the randomness of the residuals and the variance (with
respect to the degrees of fieedom that each model poses).

Construction ofB. subtilis Strains that Express SpaIIIDfiam the thrC Locus —
Competent B. subtilis cells were prepared by the Gronigen method as described
previously (Harwood & Cutting, 1990). Strains BK395 (containing the spaIIID83
mutation) (Kunkel et al. , 1988)and wild-type PY79 (as a control) (Y oungrnan et al. ,

1984) were transformed with pPH7 and transformants were selected on LB agar

containing 5 ug/ml neomycin to create PH1001 and PH1003, respectively, with the
P spa [VGA-gusA firsion inserted by double crossover into the amyE gene as determined by

loss of amylase activity (Harwood & Cutting, 1990). Competent PH1001 cells were
further transformed with pPHl (creating strain PH2001) or derivatives in which the
spaIIID allele had been modified by site-directed mutagenesis (Stratagene) (see Table 2.3
for strain designations), or with pAK3 as a control (creating strain PH2000).
Transformants were selected on LB agar containing 100 ug/ml spectinomycin and 5

rig/ml neomycin, chromosomal DNA was prepared as described previously

46

 

Table 2.3. Mutations in spaIIID and corresponding plasmid and B. subtilis strain

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

designations

spaIIID mutation pAK3 derivative B. subtilis strain pET-21b derivative
N/A pAK3 PH2000
w.t. pPHl PH2001 pPH4
H2E pPHlOl PH2101
D3K pPH102 PH2102
K6E pPH103 PH2103
E7K pPH104 PH2104
R8E pPH105 PH2105
KllE pPH106 PH2106
K14E pPH107 PH2107
E18K pPH108 PH2108
K20E pPH109 PH2109
K21E pPHllO PH2110
V23K pPHl 11 PH2111
R24A pPH22 PH2022
R24E pPH9 PH2009
V25A pPH112 PH2112
V25E pPH13 PH2013
V25K pPH14 PH2014
I26E pPH113 PH2113
A27E pPHlS PH2015
K28E pp H10 PH2010
E29K pPHl l PH201 1

 

 

 

 

47

 

 

Table 2.3 (cont’d).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

F3OA pPH16 P112016
031E pPH142 PH2142

V32E pPH143 PH2143

S33A pPH12 PH2012

S33R pPH17 PH2017 pPH75
KST343536AAA pPH18 PH2018

K34E pPH114 PH2114 pPH214
S35E pPH144 PH2144

T36E pPHl45 PH2145

VHK373839AAA pPH19 PH2019

V37E pPH146 PH2146

HBSE pPHllS PH2115 pPH215
K39E pPH116 PH2116 pPH216
DLT404142AAA pPH20 PH2020

D40K pPH117 PH2117 pPH217
L41K pPH147 PH2147

T42K pPH148 PH2148

E43K pPH118 PH2118 pPH218
R44E pPH119 PH2119 pPH219
E47K pPH120 PH2120

D51K pPH121 PH2121

ESSK pPHl22 PH2122

K57E pPHl23 PH2123

 

 

 

 

48

 

 

Table 2.3 (cont’d).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

E5 8K pPH124 PI12124

D61K pPH125 PH2125

H63E pPH126 PH2126

K64E pPH127 PH2127

R67E pPH128 PH2128

H68E pPH129 PH2129

R7OE pPH130 PH2130

E73K pPH131 PH2131

K76E pPH132 PH2132

K76Stop pPH21 PH2021 pPH56
K78E pPH133 PH2133

K80E pPH134 PH2134

K81E pPH135 PH2135

D82K pPH l 36 PH2136

D828top pPH137 PH2137 pPH237
E83K pPH138 PH2138

E86K pPH139 PH2139

G87Stop pPH140 PH2140 pPH240
E88K pPH141 PH2141

 

 

 

 

49

 

(Harwood & Cutting, 1990), and PCRs with primers LK2189 and LK2190 (bordering
thrC) and with primers LK2234 and LK2235 (bordering the mutant spoIIID83 allele at
the native locus and not complementary to sequences present in pPHl and its derivatives)
were used to identify strains with spaIIID from pPHl or its derivatives inserted by double
crossover into the thrC gene and with no insertion in spaIIID83 at the native locus.

Western Blot Analysis — B. subtilis strains were induced to sporulate by nutrient
exhaustion as described previously (Harwood & Cutting, 1990), and l-ml samples were
collected at hourly intervals by centrifugation (14,000 x g for 1 min), the supernatant was
decanted, the cell pellet was rinsed with 50 mM Tris-HCl pH 8.0, centrifugation and
decanting were repeated, and the cell pellet was stored at -20°C. Whole-cell extracts
were prepared as described previously (Healy et al., 1991) except the lysis buffer did not
contain PMSF or DNase 1. After adding 1 vol of 2X sample buffer [50 mM Tris-HCl pH
6.8, 4% SDS, 20% (vol/vol) glycerol, 200 mM DTT, 0.03% bromophenol blue] and
boiling for 3 min, samples were subjected to Western blot analysis as described
previously (Kroos et al., 2002). Anti-SpoIIID antiserum (Halberg & Kroos, 1992) was
used at 1:10,000 dilution. Signals were detected using an LAS-3000 irnager (F ujifihn)
and analyzed with Multigauge version 3.0 software (Fujifilm).

Measurement of spoIVCA-gusA Reporter Expression - B. subtilis strains were
induced to sporulate and samples were collected as described above. Cells were
resuspended, treated with lysozyme, perrneabilized with toluene, and assayed for enzyme
activity as described previously (Miller, 1972) except 4-nitrophenyl-B-D-glucuronide

(NPG) served as substrate. One unit of enzyme hydrolyzes 1 umol of substrate/min per

A595 of original cell density. The background activity (as determined by the level of B-

50

glucuronidase activity in a strain lacking spaIIID assayed in the same experiment) was
subtracted from each sample and the values were determined as a percentage of the value
for a strain bearing wild type spaIIID in the same experiment. The average of 3

biological replicates was determined for each mutation.

Results

Binding afSpaIIID to DNA Containing Three Matches to the SpoIIID Binding Site
Consensus Sequence - To examine the binding of SpoHID to DNA, recombinant SpoIIID
was overproduced in E. cali and purified (Fig. 2.1A). The purified SpoIIID was then
tested for its ability to bind to DNA containing three matches to the SpoIIID binding site
consensus sequence (Probe 1, Table 2.4). This sequence was chosen because it resembles
a sequence in the B. subtilis chromosome (68 to 93 bp downstream of the sigK
transcriptional start site) that was shown previously to be protected from DNase I
digestion in footprinting assays with SpoIIID at a low concentration, indicating the
presence of one or more high-affinity binding sites (Halberg & Kroos, 1994). The Probe
1 sequence differs from that of the B. subtilis chromosome at position 12 fiom its 5’ end,
where a G to C change in the second match to the SpoIIID binding site consensus

sequence eliminated its only mismatch. Using EMSAs, SpoIIID and Probe 1 formed a
single discrete complex (Fig. 2.13) with an apparenth of 13 nM (Table 2.4), and a Hill
coefficient of 1.4 (Fig. 2. 1 C). The formation of a single complex with little cooperativity
of binding suggests that a single molecule of SpoIHD binds to a single site in Probe 1.

Because SpoIIID purified fi'om sporulating B. subtilis is primarily in a monomeric state

(B. Zhang and L.K., unpublished data), it is likely that recombinant SpoIIID is

51

Figure 2.1. Purification of SpoIIIJ) and binding to dflferent DNA probes. A)
Purified SpoIIID (8 ug) was subjected to SDS-PAGE followed by Coomassie Blue
staining. Size (in kDa) of molecular weight markers is shown. Arrowhead indicates
SpoHID. B) SpoHID at 0, 140, 70, 35, 18, or 9 nM (lanes 1-6) was incubated with DNA
probe (6 nM) containing three matches to the SpoIIID binding site consensus sequence
(Probe 1, Table 1) or a single match to the consensus sequence (Probes 2-4, Table 1) and
subjected to EMSAs. Bands were quantified with a phosphorimager. For each probe, all
lanes are from the same gel, but intervening lanes were removed for clarity. Filled
arrowheads indicate bound DNA and unfilled arrowheads indicate fi-ee DNA. C) Hill

plots of data obtained in B for Probes 1 (O), 2 (I), and 3 (A) with best-fit lines.

52

Fig. 2.1

  

A . B Probe1 Probe2
43— 1 SPOIIID. - '
29— 123456123456
*Mi-4 “we ~ ‘
18.4- _ -__
14.3.: ~ . a w ww’q
6.2_;‘-" ‘ Probe 3 Probe 4
a... SpoIIID: - -
1 2 3 4 5 6 1 2 3 4 5 6

     

O

.3
01

 

 

.\

\\

 

 

 

 

t

Log[Bound DNA/Free DNA]
<5
01 O
\

 

 

.3.
0'1

 

-8.5 -8 -7.5 —7 ' -6.5
Log[SpolllD] (M)

53

 

Table 2.4. Sequences of probes used and dissociation constants for SpoIIID-

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

binding
Avera e
Probe Sequencea g bKd
(BM)
2 ¢
1 TTGTTGTTAAACAGLCTTGTCTTTTTA 10 i 1 (5)
1 l ‘ 3
l U A
2 TgaTctaTtAtgAGCTTGTCTTTTTA 28 i 1 (3)
f 1 r 1 f 3
3 2 4" 120 35
TTcTcaTTAAACAETTGgaTTTTTA * (5)
l l l t l l
4 ‘ ' L r >15000 (3)
TTGTTGTTAAAttctTctTaggcTTA
1 I F I l I I I I
5 tgAgCTTGTCTTTTTA 28 a 7 (3)
f 3
6 ACAQCTTGTCTTTTTA 24 :l: 5 (4)
V 3
2 >
7 TTGTTGTTAAACAQCTTGTCCTaTTA 10 i 2 (4)
1 ' ‘ i
1 1 l g
8 TgaTctaTtAtgAECTTGTCcTaTTA 21 i 5 (5)
‘ it I ‘ i
9 ACA§CTTGTCcTaTTA 19 :r. 3 (4)
t i
10 AgCECTTGTCCTaaTg 8 i 2 (10)

 

 

I

 

 

54

 

 

Table 2.4 (cont’d).

 

 

 

 

 

 

 

tchCTTGTCcTaaT
:1:
11 cggGAACAGgAttaa 8 5 (3)
V i
12 gchTTG'I‘CcTaaT 9:1:3 (3)
1
13 AgchTTG'I‘CTTTaTg 16 3: 8(4)

 

l

 

 

0 Matches to the SpoIIID binding site consensus sequence are marked by arrows

indicating their orientation. Vertical bars indicate mismatches to the 5 ’-

WWRRACARNY-3’ consensus sequence. Upper case letters indicate matches to the
sequence of Probe l, and lower case letters indicate differences from Probe 1. For
clarity, the sequence for a single strand of DNA is shown for each probe except Probe
11 for which both strands are shown to demonstrate the possibility of multimerization
due to interactions between the unpaired complementary nucleotide on the 5' end of

each strand. The idealized (i) consensus sequence is 5’-TAGGACAAGC-3’.

b Kd is determined as in Figure 1 and the number of determinations is indicated in

parentheses.

55

 

monomeric and binds primarily to one of the three matches to the SpoIIID binding site
consensus sequence in Probe 1.

To further characterize binding of SpoIHD to DNA, the contribution of each match to
the SpoHID binding site consensus sequence in Probe 1 was tested individually by
altering the sequence of the other two matches (Table 2.4, Probes 2-4). Binding of
SpoIIID to each of these probes was assayed using EMSAs. Probe 2, with only the third

match to the consensus sequence intact, allowed the highest affinity binding, exhibiting

only a 2.4-fold increase in apparent Kd compared with Probe 1 (Table 2.4 and Fig. 2.1).

Probe 3, with only the second match to the consensus intact, exhibited considerably lower
binding affinity (higher apparent Kd) than Probes 1 and 2 (Table 2.4 and Fig. 2.1). Probe

4, with only the first match (containing 2 mismatches to the consensus), did not exhibit
binding even at the highest concentration of SpoIIID tested (Table 2.4 and Fig. 2.1B).
These results suggest that the third match to the consensus sequence is the major
determinant of SpoIIID binding to Probe 1. The second match to the consensus sequence
also seems to play a role in binding, while the first match appears to be dispensable.
Since the second and third matches to the consensus sequence appeared to contribute
weakly and strongly, respectively, to the binding of SpoHID to Probe 1, we considered
the possibility that more molecules of SpoIlTD bind to Probe 1 than to Probes 2 or 3,
although this did not appear to be the case based on comparison of the migration of
shifted complexes on separate gels (Fig. 2. 13). When compared on the same gel, Probes
1, 2, and 3 formed complexes with SpoIIID that co-migrated (Fig 2.2A). Taken together,

the results of EMSAs with Probes 1-4 suggest that a single molecule of SpoIIID binds

56

3

'23?! 2.; (Alums-15 1! the migrant. at 1:32:23: Snot-1 '3—{i-SA caught-us. ‘1‘,

c A “--

4 -- - o - - ’
”1"..f' l"- 4 . .0‘4 -r—rP‘ 1Arf<o—.c-.- 0. “3,- j-Fp" vi- 'm‘"l::i H ~
I l- -’ U".'_. )I ,U.'.,'/ b ..O I a p-) ’9 M! .o.*” 1 ~-~r*4-" 0‘ 0.. . L J
u '

a

. ’ '——- .9 Y. - _ ,
- .. . l .. 4' a _ .‘I ~— . .v” - ~ v“. ‘
.r' :7 n.5, 1011.552 .r'tt at”, 1’", -1}, --:r.;--., - .‘af ~21: ...L:.‘ ~- _. n1. T. 1663 : :I‘of
’ ‘ -

a g D— D-

! —‘ ’ a ‘ -— - - -
.rrmt’zféi 51”,", “IA" t‘)‘. -3 .’."."P'. ‘1' ' .6 “"5 '_'. ”V035 - 2D. - .12 Zr: 3mm

m

-’—- I - - — - - - _ - -
'/ MI I [1’5 p- ’.I;1 I’rp---.) 9 fly"- l... u-.’. .n—n— a- ..‘.Q -- .‘.d o —.- -—._ ‘Lg
‘ f ‘ 4’ cf, w c 4;- k- . . v-- - r" ~9- - O. 4.
1— 4 o ' m r a - ‘ .
[Ia—r; ’, - or)! I I If y'_-- ’ OT. 0’— .5 I " “.12 - . -ce L - L- L_. j. ‘. 3‘). A

,C
_.~,r 720: an; .5112".

S7

Fig. 2.2

ASpolllD - + — + — + BSpoIIID — + _ +
Probe1— - + + - — Probe10— — + +
Probe2+ + — — — _ Probe11+ + _ _
Pmbe 3 - - - + + l " Yd

_
H g ,. '_'_.,. .,_.
T ".5; ' 5‘15. ’
J‘ g -' '

"73‘—

   

 

 

58

with high affinity to the third match to the consensus sequence or with lower affinity to
the second match.

Binding afSpaIIID to DNA Containing a Single Match to the SpoIIID Binding Site
Consensus Sequence — If SpoHID binds with high affinity to the third match to the
consensus sequence in Probes 1 and 2 as suggested by the results presented above, it
might be possible to shorten those probes and still observe high-aflinity binding (i.e.,
comparable to that observed for Probe 2 in which the first and second matches to the
consensus were altered). Probes l and 2 were shortened to include only three base pairs
on each side of the third match to the consensus sequence. No matter whether the first

three base pairs were identical to those in Probe 2 (Probe 5, Table 2.4) or Probe 1 (Probe
6, Table 2.4), the shortened probes exhibited apparenth values similar to Probe 2

(Table 2.4). These results demonstrate that a single match to the consensus sequence is

sufficient for high-affinity binding of SpoHID to DNA.

An examination of the sequences in 20 SpoIIID binding sites mapped by DNase I
footprinting in several studies revealed the most common nucleotide for each position of
the binding site consensus sequence (Halberg & Kroos, 1994, Ichikawa & Kroos, 2000,
Zhang et al., 1997, Eichenberger et al., 2004). We call this sequence, 5’-
TAGGACAAGC-3’, the idealized consensus sequence. When this sequence was
substituted for the third match to the consensus sequence in Probe 1 (Probe 7, Table 2.4),

Probe 2 (Probe 8, Table 2.4), or Probe 6 (Probe 9, Table 2.4), no significant change in the

apparent Kd for SpoIIID binding was observed (Table 2.4). In these contexts, the two

sequences exhibited similar affinity for SpoIIID.

59

We serendipitously discovered that the sequence context of the match to the consensus
sequence can affect SpoIIID binding affinity. When two of the three base pairs on each
side of the idealized consensus were changed in Probe 9, the binding affinity increased
twofold (Probe 10, Table 2.4). The rationale for this change came from studies with the
idealized consensus sequence in the context of shorter ends. Probe 11 (Table 2.4) was
created to allow potential base-pair interactions at the ends to form repeats of the DNA
sequence. Probe 11 was bound with high affinity (Table 2.4), but this did not require the
single nucleotide overhangs at the ends (Probe 12, Table 2.4). Probe 10 was designed to
have the same two base pairs at each end of the idealized consensus sequence as Probes
11 and 12, and all three probes bound SpoIIID with about twofold higher affinity than

Probe 9 (Table 2.4). Likewise, changing the context of the third match to the consensus

sequence in this way (Probe 13, Table 2.4) lowered the average apparent Kd (compare

Probe 6, Table 2.4), although the effect was less than twofold. We conclude that the
sequence surrounding the consensus sequence can have a small effect on the affinity of
SpoIIID for short DNA probes.

While Probe 11, with single base overhangs at its 5’ ends, was designed to potentially
allow a DNA repeat with bound SpoHID to form, the migration of the complex that
formed was indistinguishable from the complex formed with Probe 10, which has blunt
ends (Fig. 2.2B). Moreover, the Hill coeflients were 1.4, 1.4, and 1.3 for Probes 10, 11,
and 12, respectively, so binding did not appear to be cooperative. Rather, it appears that
a single molecule of SpoIIID (likely. a monomer) can bind to a single match to the

consensus sequence with high affinity.

Analytical Ultracentrifitgatian afSpaIIID and DNA — To determine the composition
of the complex formed between SpoIIID and DNA containing a single copy of the
idealized consensus sequence, we used analytical ultracentrifugation. SpoIIID was mixed
with Probe 11 (Table 2.4) at slightly different ratios and the homogeneity of the complex
was assessed using absorbance-detected sedimentation velocity experiments. We
monitored the sedimentation of the complex by detecting both the DNA component (at
260 nm) and the protein component (at 230 nm). The data were analyzed using the
boundary analysis method of Demeler and van Holde (Demeler & van Holde, 2004),
which results in the diffusion-corrected, integral distribution of S over the entire
boundary. A homogenous sample will have a vertical or near vertical G(s) plot, while a
heterogeneous sample will have a G(s) plot with one or more positive slapes. As shown
in Figure 2.3A, the plots that result from analysis of the data fiom detecting at 260 nm
were nearly vertical, and >80% of each sample sedimented at ~2.SS. Less than 20% of a
smaller, slower sedimenting material was also detected. Analysis of the data fi'om
detecting the sedimentation of the protein component of the complex at 230 nm yielded
similar plots, and also detected a small fiaction of slower sedimenting material (~1 S, data
not shown). Further analysis of the data from the 1:1 mixture of Probe 11 with SpoIIID,
using C (s) analysis (Schuck & Rossmanith, 2000), resulted in the observation of two
components: ~12% of a 1.48 and 9000 Da component, and ~83% of a 2.45S and 21,000
Da component. This suggested that the majority of the sample exhibited sedimentation
properties consistent with a complex made up of one duplex of Probe 11 DNA and one
monomer of SpoIIID (calculated mol. wt. of complex = 19,946 Da). However, while the

C(s) analysis is a good first step toward analyzing a macromolecular complex in solution,

61

Figure 2.3. Analytical ultracentrifugation of the SpoIIID-DNA complex. A)
Sedimentation velocity experiments. The resulting G(s) distributions for the 1.1 :1 (e),
1:1 (0) and 0.9:1 (A) complexes of DNA:SpoIIID are shown. Sedimentation velocity

data were analyzed as described in Experimental Procedures. Sedimentation coefficients

(s) were corrected to that in water at 20°C (520”). B) Sedimentation equilibrium of the

1:1 complex of DNA:SpoIIID. Samples containing 1.1-6.3 11M of the complex were
sedimented to equilibriumat 28,000, 34,600, 41 ,300, and 48,000 rpm at 5°C. Two
equilibrium scans were collected at each speed 4-8 hours apart to ensure the sample was
at equilibrium. The resulting 72 data sets were globally fit to numerous models within
Ultrascan. Plot overlays (lower part) for the fit of the sedimentation equilibrium data to a
two-component, non-interacting model are shown. The model (solid lines) closely

overlays the data (open circles). The residuals for the fit are shown in the upper part.

The variance for the fit was 2.93 x 10-5.

62

 

323211....

 

 

 

 

 

63

 

 

a

mi...

110

00A
3. _ _ _ _
2 m m m m m
Ow 1 Aeécoauen. Emacsom
.H A

Fig. 2.3 (cont’d.)

B

 

 

1..
0

004
0.0. 0
00

3.5.8:: binom— =3sz

-0 04
-0.08

0.
l

6.
0

£25 .833

 

2
0

  

Radiusz-Radius(ref)2 in cm

it assumes that all components share a similar partial specific volume, so the mass values
returned are only accurate for a truly homogenous sample. Nonetheless, despite the small
fiaction of slower sedimenting material in the sample, G(s) and C(s) analyses showed the
1:1 mixture of Probe 11 with SpoHID to be an excellent candidate for sedimentation
equilibrium analysis to rigorously determine the molecular mass of the complex.

For sedimentation equilibrium analysis, a total of 72 data sets were collected using 4

different rotor speeds and 9 sample concentrations (fi'om 1.1 to 6.3 pM complex) with

detection at 230, 260, and 230 nm. The data were best fit (variance = 2.93 x 165) using a

2-component, non-interacting species model (Fig 2.3B), as indicated by the
sedimentation velocity analysis presented above. The two fitted components exhibited
molecular masses of 9,579 Da and 20,310 Da (partial specific volumes of 0.55 ml/g and
10.68 ml/g, respectively), the latter of which is in excellent agreement (within 1.8%) with
the calculated mol. wt. of a 1:1 complex between Probe 11 DNA and a SpoIIID
monomer. The smaller component most closely approximated the mass of the
unliganded DNA (within 4.5%), though this analysis cannot preclude the possibility that
it represents the unliganded SpoIIID monomer (within 12%). Taken together, the
analytical ultracentrifilgation analyses indicate that a SpoHID monomer forms a 1:1
complex with Probe 11 DNA, which contains a single copy of the idealized consensus
sequence.

Structure Predictianfar SpoIIID — SpoIIID has been predicted to contain an HTH
DNA-binding motif (residues 23 to 42) (Kunkel et al., 1989). In agreement with this
prediction, modeling of SpoIIID based primarily on similarity of its predicted secondary

structure with structures fiom the Protein Data Bank resulted in tertiary structure

65

predictions for SpoIIID based on the structures of two HTH DNA-binding proteins, 01
repressor protein of bacteriophage 71. (W. Wedemeyer, unpublished data) and SinR of B.
subtilis (data not shown). Both predictions depict a protein with an N-terminal core
comprised of four a-helices, including an HTH motif (helices 2 and 3). The predictions
differ at the C-terminus where the structure based on cI predicts a fifth or-helix (residues
76-85) extending away from the rest of the protein, while the SinR-based structure
predicts the region is disordered. The SinR and cI DNA-binding domains exhibit a high
degree of structural similarity and both proteins form oligomers (in contrast to SpoHID).
Mutational Analysis afspaIIID — To begin testing the validity of the structure
prediction for SpoIIID and to identify residues important for the function of SpoIIID, we
established a convenient system for analysis of spaIIID mutations. To measure the

ability of SpoIIID to bind DNA and activate transcription, we constructed a spoIVCA-

gusA transcriptional fusion reporter. Transcription fi'om the spaIV CA promoter by GE

RNA polymerase was shown previously to be activated by SpoIIID in vitra (Halberg &
Kroos, 1994), and spaIVCA failed to be expressed in spaIIID mutant cells during
sporulation (Kunkel et al., 1988, Sato et al., 1994). To allow expression of mutant
spaIIID alleles, we used a vector plasmid designed to allow genes to be recombined into
the B. subtilis chromosome at an ectopic site (thrC), which plays no known role in
sporulation gene expression. A DNA fragment encompassing spaIIID and its promoter
region was cloned into the vector plasmid. The resulting plasmid (pPHl) was
transformed into B. subtilis strain PH1001, which contains the spaIVCA-gusA reporter
integrated at the amyE locus in a spaIIID mutant background. Recombination between

the plasmid and the chromosome resulted in replacement of the thrC gene with a copy

66

Figure 2.4. System for mutational analysis of SpoIIID. A) Western blot of ectopic
SpoIIID expression during sporulation. B. subtilis strains with (PH2001) or without
(PH2000) spaIIID at the thrC locus, and bearing a mutation that prevents spaIIID
expression from the native locus, were induced to sporulate by nutrient exhaustion and
samples collected at hourly intervals were subjected to Western blot analysis with
antibodies against SpoIIID. B) Expression of a spaIVCA-gusA reporter during
sporulation. B. subtilis strains PH2001 (e), PH2000 (I), and PH1003 (A) containing
the spaIVCA-gusA reporter at the amyE locus were induced to sporulate by nutrient
exhaustion and samples collected at hourly intervals were assayed for GusA activity.

PH1003 expresses spaIIID fi'om the native locus. Points are the average of 3

determinations.

67

Fig. 2.4
A

Time of Sporulation (h)

-"' “~-r. . .

f , ._- . .-._1
._a ., ... . - Q n . ‘ . , .
"‘_I " ’ 'rrg' '11- . ","‘ ._ “ __ -,---~-- I
' ““6"“ ’T, 11:" "i.- 3‘». ""r 4"" i l
J, -' . 'gu,p.a.

 

   

SpoIIID

. .......

PH2000

GusA Activity
:1:

 

51/

0" l l l i T

1 2 3 4 5 6 7
Time of Sporulation (h)

 

68

interrupted by SpoIIID and a gene coding for neomycin resistance (used for selection),
creating strain PH2001. As expected, the ectopic copy of spaIIID was expressed
normally during sporulation (Fig 2.4A). SpoIIID began to accumulate by 3 h into
sporulation and its concentration rose by 4 h then began to decline by 6 h, as observed
previously for wild-type B. subtilis expressing SpoIIID from the native spaIIID locus
(Halberg & Kroos, 1992). As a negative control, the vector plasmid (with no spaIIID
gene) was transformed into B. subtilis strain PH1001, creating strain PH2000 with only
the neomycin resistance gene at the ectopic site. This strain failed to accumulate SpoIIID
during sporulation, although a weak signal presumably due to a protein that co—migrated
with SpoIIID and cross-reacted with antibodies against SpoIIID was observed (Fig 2.4A).
The two B. subtilis strains described above that were subjected to Western blot
analysis (Fig 2.4A) were assayed for GusA activity from the spaIVCA-gusA reporter
during sporulation (Fig 2.4B). For comparison, activity fiom the spaIVCA-gusA reporter
in an otherwise wild-type backgrormd (B. subtilis strain PH1003; expressing SpoIIID
fi'om the native spaIIID locus) was measured. GusA activity increased similarly in B.
subtilis strain PH2001, which expresses spaIIID ectopically, and in the wild-type strain
PH1003. The increase in GusA activity (Fig 2.43) correlated with accumulation of
SpoIIID (Fig 2.4A) for PH2001. In the negative control strain lacking spaIIID at the
ectopic site, PH2000, spaIVCA-gusA failed to be expressed (Fig 2.4B). These results
demonstrate that spaIVCA-gusA expression provides an assay for functional SpoIIID,
which can be synthesized ectopically, establishing a system for mutational analysis

spaIIID.

69

To identify residues important for the ftmction of SpoIIID, we subjected the spaIIID
gene to site-directed mutagenesis and used the system described above to express the
mutant allele and measure the effect on spaIVCA -gusA expression during sporulation.
Because SpoIIID has many charged residues and these are likely to be surface-exposed,
our mutagenesis strategy was to create charge reversals throughout SpoIIID. In addition,
we mutated every residue in the predicted HTH DNA-binding motif (residues 23-42).
Each mutant allele was placed at the ectopic thrC site (as verified by diagnostic PCR) in
the chromosome of the B. subtilis strain (PH1001) that contains the spaIVCA-gusA
reporter integrated at the amyE locus in a spaIIID mutant background. Expression of
spaIVCA -gusA was measured at 5 h into sporulation, which was the time when
expression in a strain with the wild-type spaIIID gene at the ectopic site reached a plateau
(Fig 2.4B). As shown in Figure 2.5, charge reversals in the first 21 residues of SpoIIID
had modest effects (less than threefold change) on expression of the reporter, with the
exception of the R8E substitution. Substitutions in the predicted first helix (residues 23-
30) of the HTH changed reporter expression less than twofold, with the exceptions of
V23K, R24A, R24E, and I26E. Some substitutions in the predicted turn (residues 31-33)
of the HTH reduced reporter expression more than fourfold (V 32B and S33R) but others
had less than a twofold effect (G31E and S33A). Strikingly, most substitutions in the
predicted second helix (residues 34-42) of the HTH, which is the predicted “recognition
helix” that would interact directly with DNA in the major groove, dramatically reduced
or abolished expression of the spaIVCA-gusA reporter. Charge reversals in the C-
terminal halfof SpoHID had modest effects (less than threefold change) on expression of

the reporter, with the exceptions of the R44E, D5 1K, H63E, H68E, K76E, K78E, and

70

Figure 2.5. Quantification of the effects of mutations in spaIIID on transcription in
viva. B-glucuronidase activity as a percentage of wild type levels was determined as
described in Experimental Procedures. Bars indicate averages of 3 biological replicates
and error bars indicate one standard deviation. Solid bars below the x-axis indicate the
positions of the helices in the predicted structure of SpoIIID based on the cI repressor

protein of bacteriophage 7t.

71

MPH

Z KEPT-I

E xII°H

v xII°H

9 xIli’H

39E

DLT404 1 42AAA
D40K

L4 1K

72

._n

O

O
I

#091

OOZ

OSZ

 

 

 

 

 

 

D82K substitutions. We also made C-terminal truncations of SpoHID by substituting a
stop codon for codons that normally specify residues 76 or 82 of the 93-residue protein.
Elimination of 12 (D828top) residues from the C-terminal end of SpoIIID had little effect
on reporter expression, but elimination of 18 (K76Stop) residues reduced reporter
expression about fourfold. In summary, our mutational analysis revealed primarily two
regions that are important for producing functional SpoIIID; the predicted DNA
recognition helix (residues 34-42) and a basic region near the C-terminus (residues 63-
81). Charge reversals at a few other positions (R8, R24, R44, and D51) dramatically

reduced or abolished expression of the SpoIIID-dependent reporter.
Expression of the spaIVCA-gusA reporter presumably requires that SpoIIID

accumulate, bind to the spaIV CA promoter region, and activate transcription by GE RNA

polymerase (Halberg & Kroos, 1994, Kunkel et al., 1988, Sato et al., 1994). To
distinguish between mutations that prevent SpoIIID accumulation versus those that
prevent DNA binding and/or transcriptional activation, we performed Western blot
analysis with antibodies against SpoIIID. For several strains with reduced or abolished
reporter expression, we could not detect SpoIIID reliably at 5 h into sporulation (data not
shown). Because SpoIHD positively autoregulates its own expression (Kunkel et al.,
1989), mutations in spaIIID that impair expression of the spaIV CA -gusA reporter were
expected to reduce accumulation of SpoIIID. Presumably, the mutations that allow some
reporter expression do allow the altered SpoIIID protein to accumulate at a low
concentration that we could not detect reliably above the background signal in the

negative control strain (PH2000), which lacks spaIIID at the ectopic site (Fig 2.4A).

73

Binding of Altered SpoIIID Proteins to DNA - To further characterize altered SpoIIID
proteins, we engineered expression of several in E. cali (Table 2.5). All the altered
proteins we tested accumulated normally in soluble form; however, the D40K
substitution caused SpoIIID to be unstable during purification. The D40K substitution
might alter the structure of SpoIIID in a way that makes it more susceptible to E. cali
proteases. The other altered proteins were stable during purification, suggesting that they
are not unfolded.

As a step toward distinguishing between altered SpoIIID proteins that are defective for
DNA binding and those specifically impaired in transcriptional activation, their ability to
bind to DNA containing the idealized consensus sequence (Probe 10, Table 2.4) was

measured using EMSAs. Figure 2.6 shows representative results and Table 2.5 lists the

average apparent Kd of altered SpoIIID proteins. The S33R substitution in the predicted

turn of the HTH increased the apparent Kd more than tenfold (Fig 2.6B and Table 2.5),

indicating that the protein is impaired for DNA binding, and providing an explanation for
the reduced spaIVF CA -gusA expression observed when the S33R substitution was tested
in viva as described above (Fig 2.5). K34E, H3 8E, and K39E substitutions in the
predicted DNA recognition helix abolished detectable binding (Fig 2.6C and Table 2.5),
supporting the structure prediction for this region. These in vitra results are in qualitative
agreement with our in viva results as the K34E and H38E substitutions abolished

spaIV CA -gusA expression, and the K39E substitution reduced expression about fivefold
(Fig 2.5). The ability to detect expression of the reporter in the case of the K39E
substitution suggests that this assay provides a more sensitive measure for functional

SpoIIID than does the in vitra DNA-binding assay. The E43K substitution in the residue

74

Figure 2.6. Binding of altered SpoIIID proteins to DNA. Mutant alleles of 57901110
were expressed in E. cali and the proteins were purified over an SP Sepharose column.
No protein or decreasing concentrations of SpoIIID (numbers indicate nM concentration
of SpoIIID) were mixed with a DNA probe (13 nM) containing a single idealized
consensus sequence for SpoHID binding (Probe 10) and analyzed for binding as in
Figure l. Wild-type (WT) (A) and representative mutant proteins showing 15-fold
reduced binding (B); no binding (C); and 3-fold reduced binding (D). Intervening lanes
were removed for clarity in (A), (B), and (D). Filled arrowheads indicate bormd DNA

and unfilled arrowheads indicate free DNA.

75

Fig. 2.6

SpoIIID wr B SpoIIID S33R

 

76

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Table 2.5. Binding of altered SpoIIID
proteins to DNA

SpoHID Protein“ Average Kd(nM)b'c
Wild Type 8 at 2 (10)

S33R 122 i 23 (3)
K34E >9600 (3)

H38E >1500 (4)

K39E >1100 (3)

D40K Not Determinedd
E43K 74 i 20 (3)

R44E >5000 (3)
K76Stop >4100 (3)
D828top 23 :t 7 (3)

 

 

a Mutant alleles of spaIIID were expressed in E. cali and purified over an SP
Sepharose column.

b K4 was determined as in Figure 1 using Probe 10 which contains one copy of the
idealized SpoIIID binding site consensus sequence.

6 . . . . . .
The number of determinations is indicated in parentheses.

d D40K was unstable in repeated purification attempts.

77

following the predicted recognition helix reduced reporter expression about twofold (Fig

2.5) and increased the apparent Kd about sevenfold (Table 2.5), so a considerable defect

in DNA binding as measured in vitra nevertheless allowed substantial reporter expression
in viva. Likewise, the R44E substitution and the K76Stop truncation reduced reporter
expression only about fourfold (Fig 2.5), but the purified proteins failed to bind
detectably to Probe 10 (Table 2.5). The results with the K76Stop truncation indicate that
a region near the C-terminus of SpoIIID is important for DNA binding. On the other
hand, the D828top truncation had little efi‘ect on reporter expression (Fig 2.5) or DNA
binding (Fig 2.6D and Table 2.5). We conclude that in addition to the predicted
recognition helix of the HTH, one or more residues in the C-terminal region of SpoIIID
spanning from K76 to K81 are critical for DNA binding.
Discussion

We have discovered that a highly conserved, key regulator of gene expression during
sporulation binds to specific sequences in DNA as a monomer with high affinity by using
at least two regions. Dwindling resources in the mother cell during sporulation might
have favored evolution of a small (B. subtilis SpoIIID is 93 residues) transcription factor
capable of high-affinity binding to specific sites in the chromosome as a monomer. Ifour
structure prediction for SpoIIID is correct, as suggested by preliminary NMR data of
SpoIIID in complex with Probe 11 DNA (B. Chen, P. H., A. Liu, H. Yan, and L. K.,
unpublished data), SpoIIID achieves high-afiinity binding by a novel mechanism
involving an HTH motif (whose recognition helix presumably contacts the major groove
of DNA) followed by an additional or-helix (the C-terminal basic region) that makes

contacts with DNA. Below, we discuss our findings in the context of this emerging

78

model and we note additional studies that will be required to understand not only how
SpoIIID binds DNA but how it fiinctions as an activator and repressor of transcription.
SpoHID is highly conserved among Bacilli and Clastn'dia related to B. subtilis that also
form endospores (Fig 2.7). Non-sporeforining genera like Listeria and Staphylococcus,
although closer phylogenetically to Bacilli than are Clastridia, do not harbor SpoIIID
orthologs in their genomes, as is true for many other sporulation-specific genes
(Eichenberger et al., 2004, Eichenberger et al., 2003). To our knowledge, the role of
SpoIIID has not been investigated in any organism other than B. subtilis. However, a
recent study showed that expression of spaIIID in Clastridium pelfiingens is not under
control otol3 RNAP (Harry et al., 2009), as it is in B. subtilis (Kunkel et al., 1939).
Strikingly, SpoIIID orthologs exhibit highest identity in their putative recognition helix
(residues 34-42) and in their C-terminal basic region (residues 63-81) (Fig 2.7).
Conservation in the putative recognition helix was noted previously and it was inferred
that SpoIIID orthologs would bind to similar DNA sequences (Eichenberger et al., 2004).
This inference is strengthened by our finding that the C-terminal basic region is critical
for DNA binding and the observation that this region is highly conserved. The high
degree of conservation in regions shown in this study to be important for DNA binding
suggests that SpoIIID orthologs likely are key regulators of gene expression during
endospore formation by many different bacteria, including several human pathogens.
Endospore formation is triggered by nutrient limitation, and a recent study suggests
that the mother cell shares its resources with the developing forespore (Camp & Losick,
2009), so the need to conserve biosynthetic capacity might have favored evolution of a

highly efficient mode of DNA binding by SpoIIID. Proteins encoded in the spaIIIA

79

Figure 2.7. Alignment of SpoIIID orthologs. The highest scoring ortholog of SpoIIID,
as identified by a blastp search (Altschul et al., 1990, Gish & States, 1993), fi'om each
species containing one was aligned using ClustalW (Larkin et al. , 2007). The results
were then visualized using ESPript (Gouet et al. , 1999). White letters with a black

background indicate complete conservation.

80

Fig. 2.7

Huang-wac-lnenvoqnfla‘oueg
EwgaoneNFElE-ogw» HE.—
nwonnnpnpfiuluonp—H was
nwounnwnncllrwcienn
ouounnwnpslllnenovcn<wnn§
nuounnpnpglvcnfipnfi
nwounNFn—pgluauenpunr:
0H0. «Hunwcfllueunupfluebu

anon «awaken—Inca“.
vugwwurhwcllfle no: pnenwnebu
>H§HFuuwwcnloneBHebnt
nHounnwnpau—le. Hanan“...
oHounnwawEalUIu—qnwenn:
coneelnonflwn “banana—n

nwou nunnwcaluowunefl-
Donealwogwalnebb
”Euonoonc-lovecfl

0H0. nnpnwcfllnvenflonew HE:
bfleenoenFUOIIQIooeo
Ewanrenfloflunwunlonebp w
Newwovua nonwcfllflonounpouwmfiu
minnouugnnldwmen
Zhangeengpanlnwenflournwp—n
Downwuwnovennennfinlgnuuefluo
when ::-155«:».

who» HHCuIEHOHFQdOnnnpebu
wennwwcnlbfiuwwaun

whowwwcnlw woven» none—h

who» HHE—l-bnnfino»u

who» Huculnwcnwflm» out»:
wanpwwculaenocu

wen» schnapuefluneurnuean we
unnpwwcnlnoencwebu

negro “Z. aeoliannouru 56
who» chnlvewoncngu

wen» geologic-H:

manna—ban: Manly-H490
once—woven» chnlpreiebupu
Soonewwuanenflonoenu—on
UeuCHnonoBIOCHefllHoacoouu

.........................................
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
.........................................
.........................................
.........................................
.........................................
.........................................
.........................................
.........................................
.........................................
.........................................
.........................................
.........................................

.........................................

.........................................
.........................................
.........................................
.........................................
.........................................
.........................................
ccccccccccccccccccccccccccccccccccccccccc
.........................................

zzme Hzwx3m2>fixommmbbbmxzownmmemmH
ZZIMH HmezwszNDmmmbbbmwzowmmwmmmmH

.........................................

.........................................
.........................................
.........................................
.........................................

 

81

Fig. 2.7 (cont’d.)

arouse:nbculnnnvox<nu<onnflu
mVBUnouunnonwcalnwonflouw»we!
nHonnuunwflfionflcwwch
nwonnNMQHFEIch<<eHM
nuonnnwnwflfllanenovcn<unncb
Owounuwn»:EIUCn<npnc5
nponnnpnpcslvopuonuunwww
nwounnwnwcfllwonmnwbuoun
nuannnwnpcsluo<<p
>Hrhwwuwwwcnllennwwanonwnobu
>wkhwpuwFHCulonn§HDbawu
OHOunnwnwfiBlnnnnMowwo
nwomnnpnecflluvnnwonnuw
uononlnonflanQOBonnbu
nHounHFQMCBlnnwflnobn
UOHOHIHODmHonnODD
”FB»DOOOOOCmIOUocB
nuounnwmpcalnwonfionowpca
rheonounpuculhnnnuo
NDHOnUOHBOnUHPNIOHoHHF
mowpovenunawqfilloaonnuonwnca
m<unnouw0l0flln110wnep
zenHIBIeHOUncuanOHlbuw»H:-
deucwnwnovannonnclIWInuueuue
uhnpwwnnlecvflpwwu
wan»chnlllflwowpncenIOFOHu
whenwwculwnlnwc-
unapwwsulwwnveunnonlku
unapwwcllaunrHIOFI
ulnpuwcnlnvcnnbnnefluwu
unnwwwclloeHeCI
menuHus-liiprebunaurlbeulwu
unchwwcuanIncwlbu
oeovlnhwwnelwbaunourwwcn
urnpwwculwlwoncnnflu
wenhwwcu open-u»
unobFUIOHHHCnlwnndle
one-novenpwucnlpueweunw-
Ioonewwllnwenlounenpnb
Ueucwnonolbncwcflluenbnefl-

H H

UIUI
WWWU‘D‘DUUHUHF‘OUU‘OU‘DUWW’DM‘DUUU‘OUUU‘ODUUUUU‘O

,

’
F
5
V
’
F
5

F

 

82

Fig. 2.7 (cont’d.)

HEOHBOuHflcu Innnvoanp<onnbn
mfiBvHoveonoMHcBl nfionflbfifinucfl
nwounHHanBIUOnCHHDCB .
nHounHHnncalec<<eHH
oHounHHnncfilnnenouchHHon!
nwounupnucurucnwflnocfl
OHOnnHHnH:BIVOHuoHanrHH
nuannnwnwclluonunsuuouh
OHOunHHnHFEIuo<<H
ruanHuWHH¢nIBonDHHMnonwnoun
>HWDHHuWHHcMIOHIBHubaHH
nwounupnwcfllnumnuowwe
oHomnHHanHlUDHnHonnHH
Dononlnonanopnobonnbn
nHonnHHanflluowbnobu
UOHDIIHOUQHnDHOBD
xcbpuooooocmlbvecfl
nHounHHaHGBI nUonBoneHHcE
FhouonnHuOMI nuance
mDHOnronHOanHx onobuw
newHovnnnenncfllflononnHeaven!
mwunnouuosounultoHno»
zannnbaenovHCulnwonaourHHan
concwnw«oceanouwpalwnnupebuo
unOHHHSIII:VnHHHI
unnwwwnelIIKHoHpnconeoheflu
ueoHHHc-IV:BHH=I
waopwwcelwnnueanonlhe
unnHHHFII-uflrueowe
unnuwuaulnwcnpbnwebupu
uthHchloeHecu
men»Han-Iteureflunourlueu-H-
wenwuwculooancwnbu
convenwwwcnlrecnnouuwwcn
wenpwwcllrewonnnen-
utopuwcu owes-H»
u-eBHU-owwwcel Feud-e
one-boulnwwwcu IHrofleban
loonewwe Inwenflouoenpoe
beIcHHOnMEincwcllnenaneun

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
 

 

 

 

 

 

 

 

 

H 32: r .:n.4:KMHXmmmmfi .......... .......
32 u. n. . bmw. ... ........... .... .
H m 5: vamm .....................
h «2 tr ..NFHMO ...... . .......... ...
¢ 52 r. K>Hmm .....................
H fiz v. NWHmm .....................
H rz r. xHHmm .....................
H a: v. x<<m...... . ...... .......
4 72 m, wfiflbmm ............. .. ....
r F2 )1 NmNUWN<O .......... ... .....
H #2 in emeNKm ....................
x m” mxmzxwz ............ . ......
H x2 I. OOO.%NZ ............... .1
< :z I, cbmomzbwom ......... ......
4 Uzz.mn bmomQOU><OHmH ..... ......1.
4 BEE? .emomwmvm .......... . . . . . .
H <2 I. rmzmm .............. . ......
:2 H Nmz<mvxx ........... 1. .
efl rz a. mxHxxzafiyHoo ........ . .....
< hi 3 MNHLCAZM ............ . . .....
F :2 a. . ........... .. ... .
H x . .03. ...................
a :z I, wowmmHUmmmHuomfimrHNMmeHmz
H r I. 0mm .......................
H «I .NNUMHbm.Qmm<OOm..... ......
H K: vexNUerm.Qmm<oou ...........
H «a cxxmmem.nmm<xo ............
H HI xxmmem.wmm<0 .............
H «n .e.wwxmd<...mxu<wo . . ........
H «I WKMU< ..mxvCNO ............
H «I .VNNMU<. .mxu<w0 ............
H K: .wxmua...m2m<xo..... .......
H «I .xxm ..... m<w<am ............
h «I .NNOH<...%ZZ ...............
h K3 K NW>N<mm.Qm><Nbe.. ........
H «I
H «2
H H
< #2 ..
mflbm zanm»e...rc.mem ......................

 

 

83

operon are co-expressed with SpoIIID under 0E RNAP control in the mother cell, and

SpoIIIA proteins are involved in forming channels that span the intermembrane space

between the mother cell and the forespore by interacting with the extracellular domain of

SpoIIQ, which is made in the forespore under O'F RNAP control and is inserted into the

inner membrane surrounding the forespore (Camp & Losick, 2008, Meisner et al., 2008).
The channels are necessary to permit transcription and/or translation in the forespore
around the time engulfment of the forespore is completed, suggesting that the channels
are feeding tubes through which the mother cell supplies small molecules (e.g., ATP,
nucleotides, amino acids) to the forespore (Camp & Losick, 2009). If this model is
correct, the ability to produce a small protein like SpoIIID that can bind to specific sites
with high aflinity as a monomer and regulate many genes might have provided a selective
advantage evolutionarily.

Most bacterial transcription factors are homodirners that bind to palindromic sites in
DNA (Huffman & Brennan, 2002). HTH-containing transcription factors are generally
no exception to this rule, so it was somewhat surprising that SpoIIID behaved as a
monomer during gel filtration ‘chromatography after purification from sporulating B.
subtilis (B. Zhang and L.K., unpublished data). Members of the AraC/XylS family of
transcription factors bind to DNA as monomers, but the monomer contains two HTH
motifs (Gallegos et al., 1997), and SpoIIID is predicted to contain only one (Kunkel et
al., 1989). Bacteriophage 7t excisionase (Xis) is involved in site-specific recombination
of DNA, rather than transcription, but Xis has a single, winged HTH and is a small
protein that is monomeric in solution and can bind to a single site with moderate affinity,
and binds cooperatively to DNA containing more than one copy of its recognition

84

sequence (Abbani et al., 2007, Bushman et al., 1984, Sam et al., 2004). We thought that
SpoIIID might likewise achieve high—affinity binding via cooperative interactions.
Instead, we found that SpoIIID bound to a high-affinity site containing three matches to
its binding site consensus sequence with little cooperativity, forming a single shifted
complex in EMSAs, primarily by binding to the best match to an idealized consensus
sequence (5’-TAGGACAAGC-3’) deduced from 17 known SpoIIID binding sites (Figs.

1 and 2, and Table 2.4). The best match in Probe 1 to the idealized consensus sequence is
the third match (5’-AAAGACAAGC-3’; Table 2.4, see the arrow labeled 3 and note that
this is the sequence of the other strand), which has just two mismatches, whereas the
second match (5’-T‘I‘AAACAGCT-3’; Table 2.4, see the arrow labeled 2) has six
mismatches. Non-conformity of the second match to the idealized consensus sequence
might account for poor binding of SpoIIID to Probe 3, but further studies are needed with
shorter probes containing only the second match. Although SpoIIID appears to bind with
lower affinity to the second match than to the third match, simultaneous binding to both
matches in Probe 1 would have been expected to produce a second shifted complex of
lower mobility. However, a second complex was not observed even at high (> 1 nM)
SpoIIID concentrations (data not shown), suggesting that binding to the two sites is
mutually exclusive. The first match in Probe 1 (5’-T'ITAACAACA-3’; Table 2.4, see
the arrow labeled 1 and note that this is the sequence of the other strand) has five
mismatches to the idealized consensus, but two of these (at the third and tenth positions)
are also mismatches to the more general WWRRACARNY consensus, perhaps

explaining our inability to detect SpoHID binding to Probe 4.

85

The lack of cooperative binding of SpoIIID to DNA containing three matches to its
binding site consensus sequence motivated us to explore further whether SpoIIID
achieves high-affinity DNA-binding by an unusual mechanism. We found that SpoIIID
can bind with high afinity to a 14-bp duplex containing one copy of the idealized
consensus sequence with an additional 2 bp on each end (Probe 12, Table 2.4). Whether
this constitutes a minimal high-affinity site remains to be tested with shorter duplexes.
We used analytical ultracentrifugation analyses to show that SpoIIID binds as a monomer
to Probe 11, which contains a single copy of the idealized consensus sequence (Table 2.4
and Fig 2.3). Eukaryotic homeodomain proteins can bind as monomers to short DNA
segments because in addition to their HTH they have an N-terminal arm that interacts
with the adjacent minor groove (T ullius, 1995). As is typical for homeodomain proteins
and other HTH proteins (Aravind et al., 2005), our structural modeling of SpoIIID
predicts an a—helix preceding the HTH, but unlike homeodomain proteins, this helix is
predicted to extend to the N-terminus of SpoIIID, leaving no room for an N-tenninal arm.
Moreover, our mutational analysis indicated that most charge reversals in predicted helix
1 of SpoIIID had little or no effect on its fimction, as determined by ability to activate
expression of spa] VCA-gusA reporter during sporulation (Fig 2.5). In contrast, several
charge reversals in the highly-conserved C-terminal basic region (residues 63-81) (Fig
2.7) of SpoIIID greatly reduced or abolished reporter expression, as did elimination of the
18 C-terminal residues (K768top) (Fig 2.5). The truncated K76Stop SpoIIID protein did
not bind to DNA in vitro (Table 2.5). We propose that the C-terminal basic region of
SpoIIID makes additional contacts with DNA, analogous to the N-terminal arm of

eukaryotic homeodomain proteins, allowing a monomer to bind with high affinity.

86

Another strategy that DNA-binding proteins containing a single HTH use to increase
aflinity of their interaction with DNA is the winged-helix motif (Brennan, 1993).
Hepatocyte nuclear factor 37 provided the first glimpse of this motif bound to DNA and it
was recognized that histone H5 has a similar structure (Clark et al., 1993). These
monomeric, aB proteins have ‘inngs” (loops) that together with the recognition helix of
the HTH interact with DNA, resembling a butterfly perched on a rod. Two examples
from bacteriophages, Xis (mentioned above) and MuR (a transcriptional repressor of
phage Mu), have a single “wing” following their HTH that interacts with the minor
groove, and these monomeric, 04% proteins increase their aflinity for DNA by cooperative
binding (Abbani et al., 2007, Bushman et al., 1984, Sam et al., 2004, Wojciak et al.,
2001). Although our results show that SpoIIID does not require cooperativity to achieve
highpafiinity binding, the possibility that it contains two ‘fivings” following its HTH that
allow it to bind DNA with high affinity as a monomer should be considered. Recently,

the C-terminal winged-helix domain of the bacterial transcription factor, OmplL has been

shown to bind to DNA as a monomer, although the afi'mity of the interaction (Kd 2 1.5

nM) was not as high as that measured for SpoIIID (Table 2.4). However, neither our
structural modeling nor preliminary NMR data of SpoIIID in complex with Probe 11
DNA (B. Chen, P. H., A. Liu, H. Yan, and L. K., unpublished data) support the idea that
SpoIIID is an 043 protein with a winged helix. Rather, both the modeling and the data
suggest that the HTH of SpoIIID is followed by an or-helix.

We propose that the C-terminal basic region of SpoIIID is an a-helix that makes
additional contacts with DNA, analogous to the N-terminal arm of eukaryotic
homeodomain proteins and the “wings” of winged-helix proteins, but structurally distinct.

87

The structure could be similar to that of the E. coli PurR repressor, whose HTH is
followed by a “hinge” helix that becomes ordered upon ligand binding and interacts with
the minor groove of DNA (Schumacher et al., 1994). PurR is dimeric and other
characterized members of the LacI family are dimeric or tetrameric. SpoHID appears to
be unique among prokaryotic DNA-binding proteins with a single HTH in its ability to
bind DNA monomerically with high aflinity. Efforts to determine the structure of
SpoHID in complex with Probe 11 DNA (B. Chen, P. H., A Liu, H. Yan, and L. K.,
unpublished data) promise to reveal the role of the 0th basic region and the

predicted HTH in DNA binding.
While SpoHID has been implicated in up- or down-regulation of 122 genes in the OE

regulon by transcriptome analysis (Eichenberger et al., 2004) and in the regulation of a
few genes in the 0K regulon by biochemical studies (Ichikawa & Kroos, 2000), only 20
SpoIIID binding sites have been mapped by DNase I footprinting (Eichenberger et al.,

2004, Halberg & Kroos, 1994, Ichikawa & Kroos, 2000, Zhang et al., 1997). The

positions of the binding sites suggest that SpoHID can repress transcription by interfering
with RNAP (GB or UK) or activator (GerE) binding. The two sites from which SpoIIID
activates transcription overlap the spoIVCA and sigK -35 promoter regions, suggesting

that SpoIIID contacts RNAP, most likely the sigma factor (i.e., (SE at the spoIVCA

promoter, and both 0E and OK at the sigK promoter) (Halberg & Kroos, 1994). Part of

our motivation for making charge reversal substitutions throughout SpoIIID was to
identify residues that might contact RNAP. Such “positive control mutants” would have

mutations in spaIIID that reduce or eliminate transcriptional activation without impairing

88

 

DNA binding. Our mutational analysis identified several charged residues that are likely
surface—exposed and are candidates for making contact with RNAP because charge
reversal at these positions reduced spoIVCA -gusA expression more than threefold: R8,
D51, H63, K64, H68, K76, and K78 (Fig 2.5). Altered SpoIIID proteins with charge
reversals at these positions are candidates for overexpression, purification, and EMSA
studies, as shown here for K34E, 1138B, K39E, E43K, and R44E, with the results
showing involvement of these residues in DNA binding (Table 2.5). K76 and/or K78
might also be important for DNA binding, because the K76Stop protein failed to bind
DNA detectably and the K82Stop protein bound DNA almost normally (Table 2.5).
Although R24A and R24E substitutions reduced and eliminated spoIVCA-gusA
expression, respectively (Fig 2.5), the purified R24A and R24E proteins showed reduced
and undetectable binding to Probe 1 DNA, respectively (data not shown), so R24 is
important for DNA binding and is therefore not included in the list above of candidate
residues for making contact with RNAP. D82 is not a candidate residue for contacting
RNAP because D82Stop (lacking D82) activated spoIVCA-gusA expression (Fig 2.5) and
bound to DNA (Table 2.5), but the D82K substitution is interesting because it eliminates
reporter expression (Fig 2.5). We speculate that D82K might prevent K76 and/or K7 8
from contacting RNAP. Our findings provide a foundation for fiirther studies aimed at

elucidating the mechanism of transcriptional activation by SpoIIID.

89

Chapter 111: Summary and Perspectives"

*The figures presented in this chapter are adapted from those generated by Bin Chen for
a paper based on the structure of SpoIIID upon which I will be second author (B. Chen,

P. Himes, A Liu, H. Yan, and L. Kroos, unpublished data).

90

Summary

The goal of this project was to determine the requirements, both in SpoIIID and
its DNA substrate, for DNA binding by SpoIHD. To that end, we showed that a SpoIIID
monomer is able to bind with high aflinity to a single match to the SpoIIID-binding
consensus sequence on a segment of DNA with as few as 2 base pairs on each side of the
consensus. Further, we demonstrated that there are two distinct regions of SpoIIID
required for binding to DNA In addition to an N—terminal region which we have
predicted to be the third helix (1‘. e. , the recognition helix) of a traditional HTH motif; we
have also identified a C-terminal DNA-binding determinant that appears to relieve the
need for the dimerization that is required by many helix-turn-helix proteins (Hufi‘man &

Brennan, 2002).
The NMR Solution Structure of SpoIIID

Structural Features of SpoIIID — In conjunction with our studies of DNA binding
by SpoIIID, the NMR solution structure of SpoIIID in complex with DNA was
determined (B. Chen, P. Himes, A. Liu, H. Yan, and L. Kroos, unpublished data). In
agreement with the structural predictions described in Chapter II, the initial three helices
form the three-helical bundle that includes an N-terminal a—helix followed by an HTH
found in many DNA-binding proteins (Aravind et al., 2005). While, in the predicted
structures, a fourth long helix completes the core of the protein, in the NMR structure this
sequence is separated into a short helical region (residues 44-48) that extends helix 3, the
recognition helix, and is connected to it by a kink, and, after a sharp turn, continues as an

a—helix (residues 51-65) that remains within the core of the protein (Fig 3.1) (B. Chen,

91

Figure 3.1. The solution structure of SpoIIID. The 20 lowest-energy structural
models of SpoIIID as determined by NMR were averaged and depicted in a ribbon
representation in two different angles with the alpha helices labeled (A). Modeled B-
form DNA was docked to SpoIIID (residues 1-81), from which the C-terminal
unstructured region had been removed, using docking software and 3 different angles are
shown (B). Adapted fi'om figures prepared by Bin Chen (B. Chen, P. Himes, A. Liu, H.

Yan, and L. Kroos, unpublished data).

92

Fig. 3.1

 

93

P. Himes, A. Liu, H. Yan, and L. Kroos, unpublished data). After a kink at residue 66,
the NMR structure shows that helix 4 extends out from the core (residues 67-81) in a
manner that bears some similarities to helix 5 (residues 76-85) in the predicted structure
based on the c] repressor of bacteriophage 7t. Residues 81-93 appear to be disordered in

SpoIIID, based on the NMR structure.

DNA-birding by SpoIIID — Analysis of the structural data provided confirmation of
the observations that SpoIIID contains two distinct regions that interact with DNA (B.
Chen, P. Himes, A Liu, H. Yan, and L. Kroos, unpublished data). While the data used
for structure determination were collected when SpoIIID was in the presence of probe 11
DNA (see Table 2.4 of Chapter II), the DNA used was not isotopically labeled, so the
residues important for protein/DNA interactions must be inferred by two methods. In the
first, which identifies residues whose NMR signal is modified by proximity to DNA, two
distinct regions of SpoHID were shown to be significantly near DNA The first region,
encompassing helix 3 (S35, T36, I138, K39, E43, and R44), matches with the data in
Chapter H (Table 2.5) describing the effects of mutations to the putative recognition helix
on DNA binding in vitro. The C-terminal set of residues that this method determines to
be near DNA was somewhat N-terminal (K57, K64, R67, G71, A74, T75, and K76) to
the region identified by the in vitro assay of DNA-binding. Data showing a mutation
deleting residues 76-93 (K76Stop) results in a complete loss in DNA binding by SpoIIID,
while a mutation truncating residues 81-93 (D82Stop) has little effect, may indicate the
importance of residue 76, or it may show that the K76Stop deletion alters the C-terminal
structure of SpoIIID such that this region is no longer able to effectively interact with

DNA.

94

Figure 3.2. Interactions between SpoIIID and DNA. Docking and energy
minimization software was used to model the interactions between SpoHID and DNA,
depicted in ribbon and space-filling representations respectively, and the side chains
important residues in the interaction are represented in ball and stick form (A). The
important interactions between SpoIIID and DNA were summarized in schematic form
(B). Thick and thin lines between residues and DNA indicate hydrogen bonding with the
major and minor grooves, respectively. Dashed lines indicate hydrogen bond interactions
mediated by a water molecule. Adapted from figures prepared by Bin Chen (B. Chen, P.

Himes, A. Liu, H. Yan, and L. Kroos, unpublished data).

95

Fig. 3.2

 

96

Fig. 3.2 (cont’d.)
B 5’

      
    
  
  

If -___ '
® .. cu

T12 A20

.___,.- , i
54 A13 '3 19. .
71:. T15} r._

3’ ,' A16

    
  

  

 

 

97

In addition to directly examining the effects of DNA on the NMR signals of residues
of SpoIIID, docking and energy minimization software was used to model SpoIIID onto a
model of DNA containing the sequence used in structure determination (Fig 32A) (B.
Chen, P. Himes, A Liu, H Yan, and L. Kroos, unpublished data). Results of this
modeling indicate that DNA interacts with SpoIIID in the positively charged cleft
between helices 3 and 4 (Fig. 3.2B). Four residues in the HTH motif (S35, K39, T42 and
E43) and 3 C-terminal residues (R67, T75, and K7 8) appear to make base-specific
interactions while some of these and a number of other residues from both regions
interact with the sugar-phosphate backbone (R24, K34, H38, K39, D40, R44, K57, K64,

R70, T75, K78, and K81).

A Structural Basis for Undersan Eflects of Amino Acid Substitutions to SpoIIID —
The molecular dynamics simulations used to examine SpoIIID/DNA interactions also
identified two salt bridges between residues of SpoHID that appear to stabilize the
complex. The first, connecting helices l and 3, involves residues R8 and D40 (Fig 33A).
The importance of these residues is supported both by the result that altered SpoIIID
containing a charge reversal substitution, D40K, was unstable during multiple
purification attempts and by the findings that B. subtilis strains designed to express the
charge reversal substitutions R8E or D40K did not express SpoIIID-dependent spoIVCA-
gusA reporter. A second salt bridge is predicted by the model to connect helices 2 and 4,
through interactions between R24 and E73 (Fig 3.3B). While substitutions for R24

impaired DNA binding in vitro and decreased SpoIIID-dependent transcription in vivo,

98

Figure 3.3. Intramolecular interactions in SpoIIID. The 3-dimensional structure of
SpoIIID identified potential salt-bridge interactions between arginine 8 and aspartate 40
(A) and arginine 24 and glutamate 73 (B). A core of hydrophobic residues between
helices 1-4 was also identified (C). Adapted fi'om figures prepared by Bin Chen (B.

Chen, P. Himes, A Liu, H. Yan, and L. Kroos, unpublished data).

99

 

100

Fig. 3.3 (cont’d.)

 

101

the E73K substitution did not impair SpoIIID-dependent in vivo transcription, so the
predicted salt bridge might not be crucial for the structure of SpoIlID and the requirement

for R24 could be explained by its interaction with the DNA phosphate backbone.

In addition to determining the structure of SpoIIID bound to DNA, attempts were
made to collect structural data for SpoIIID in the absence of DNA (see Appendix 1). Due
to the low solubility of apo—SpoIIID (that is, lacking its DNA substrate) under conditions

suitable for NMR, we were only able to obtain a single lH-ISN HSQC spectrum.

Comparison of this spectrum to a similar one obtained from a SpoIIID/DNA complex,
demonstrates that, with a few exceptions, the peak distributions are significantly different
(Appendix 1, Table A1.1). This result (though based on a single spectrum), seems to
indicate that SpoIIID undergoes a considerable change in conformation upon binding

DNA

The structure of SpoIIID provides insights into the effects of substitutions to SpoIIID
on transcription. Because SpoIIID positively regulates its own transcription 3- to 7—fold
(Kunkel et al., 1989, Stevens & Errington, 1990), we were unable to differentiate
between SpoIIID mutants that were defective in activation of their own promoter and
mutants that were unstable in vivo. In an attempt to circumvent this problem, the coding
region for spaIIID was fused to the spoIID promoter, which does not require SpoIIID for
activation (Eichenberger et al., 2004). These fusions were unable to produce SpoIIID
that accumulated in vivo (see Appendix 2). Because we are unable to distinguish
between altered proteins that fail to accumulate and those that are unable to activate

transcription, residues such as 126 and V3 7, which, when substituted, resulted in

102

complete loss of in viva transcription, may be causing their effects not because they are
involved directly in transcription activation or DNA-binding, but because introducing a
charge at those positions disrupts the hydrophobic core indicated by the structure (Fig.
3.3C) (B. Chen, P. Himes, A Liu, H Yan, and L. Kroos, unpublished data) and thereby
destabilizes the protein so that it is unable to accumulate. The valine at residue 23 is
positioned near this hydrophobic core and may interact with it as well (Fig. 3.3C), and the
addition of a charge at this position may also affect the stability of SpoIIID. Oddly
substitution of a charged residue (lysine) for L41, which also appears to contribute to the
hydrophobic core, resulted in a slight increase in spaIVCA-gusA expression. Residues
31-33 comprise the turn of the HTH motif, so introduction of bulky charged residues at
these positions could also result in a less stably folded SpoIIID structure, explaining the
dramatic efi‘ects of the V32E and S33R mutations on transcription in viva. Also, the

purified S33R protein exhibited about lO-fold lower affinity for DNA (Chapter II, Table
2.5).

Many of the other mutations identified as resulting in a loss of transcription in viva,
alter residues that appear fiom structural data to be directly involved in interactions with,
or in very close proximity to, the DNA (Fig 3.2B) (B. Chen, P. Himes, A. Liu, H. Yan,
and L. Kroos, unpublished data). These residues include K34, S35, T36, H38, K39, E43,
R44, K64, K76, and K78. Interestingly, charge reversal substitutions K57E and K81E
did not impair transcription in viva, although these two residues are predicted to interact

with the phosphates in the backbone of DNA, suggesting these contacts are not essential.

The mutational analysis of SpoIIID did reveal, however, 4 mutations that effect
transcription in viva but are not in residues expected to interact with DNA. All but one of

103

these residues, D51, are adjacent to residues that are predicted to be involved in
protein/DNA interactions (Fig. 3.2) (B. Chen, P. Himes, A Liu, H. Yan, and L. Kroos,
unpublished data). The aspartate at residue 51 may be on the same face of helix 4 as
lysine 57, which as noted above is predicted to contact a phosphate in the DNA backbone
but the K57E substitution had no effect on transcription in viva. In any case, the
negatively charged aspartate at position 51 is not predicted to interact with DNA A
substitution of lysine for aspartate a residue 82 resulted in a nearly 20-fold decrease in
activation of transcription (Chapter II, Fig. 2.5). This result was unexpected in light of
the lack of effects on transcription of the K81E substitution (despite K81 being predicted
to contact a phosphate in the DNA backbone as noted above) and the D828top truncation.
Because aspartate 82 is the first residue of the disordered region, it is possible that a
negative charge at this location has an effect on the overall flexibility of the region that
negatively impacts DNA binding. Alternatively, as suggested in Chapter II, the D82
substitution might prevent K76 and/or K78 fiom contacting RN AP, but, in the light of the
structural data, K76 and/or K7 8 might contact DNA. The other two residues at which
substitutions result in a significant loss in activation of in viva transcription, histidines at
positions 63 and 68, while adjacent to residues predicted to be important for DNA-
binding, are on the opposite face of the helix and have long flexible side chains with
positive charges, so it is attractive to hypothesize that these positive charges could serve

as the basis for a charge-charge interaction involved in recruiting RNA polymerase to
SpoIIID—dependent promoters. The potential importance of histidine 63 is firrther
emphasized by the observation that a substitution with a glutamate at that residue results

in a 10-fold loss of activation of transcription in viva, while substitution of glutamate for

104

the adjacent lysine 64, which the structure-based modelling depicts as being involved in
DNA-binding, only causes a 3-fold decrease. Further emphasizing the importance of a
positive charge in this region, a substitution for a positive charge at a nearby residue

(D61E) results in a 2-fold increase in in viva transcription.
Future Directions

To further examine the role of SpoIIID in activation of transcription, it would be
interesting to further examine the effects of the substitutions at positions 51, 63, 68, and
82. To confirm that these residues are not involved in DNA binding, the altered SpoIIID
would be over expressed in E. cali, purified, and used subjected to in vitra DNA binding
assays as in Chapter 2. Any mutant that retains the ability bind DNA with wild-type

affinity would then be assayed for its ability to activate transcription in vitra using RNA
polymerase containing 0E. To that end, I have transformed DNA encoding a histidine-
tagged B’-subunit into a strain of B. subtilis that contains a deletion of the gene encoding

06. This should simplify purification of GE RNAP. In vitra transcription assays would

be performed on a SpoIIID- and oE-dependent promoter, presumably that of spaIVCA,

though the sigK promoter may be interesting to study as well because it is subject to more
complex regulation. Finally, should one or several of the altered SpoIIID proteins be
demonstrated to be competent for DNA binding but not transcriptional activation, a
comparison of their ability with that of wild-type SpoIIID to cause a supershift in in vitra

DNA-binding assays, when mixed with a radio-labeled SpoIIID-dependent promoter and

(IE-dependent RNA polymerase, could be used to determine whether the altered proteins

105

have a defect in the ability to recruit RNA polymerase, or whether the defect occurs at

some later stage like open complex formation.

Because the RNAP used in previous studies to demonstrate that SpoIIID activates
transcription by GE RNAP in vitra was only partially purified (Halberg & Kroos, 1994), it
is possible that in vitra transcription experiments using wild-type SpoIIID and the
histidine-tagged 0E RNAP described above would be unsuccessful due to the requirement

for a previously-unidentified cofactor in SpoIIID/RN A polymerase interactions. Should

this be the case, a B. subtilis strain expressing altered SpoIIID that is competent to bind

DNA in vitra, but unable to support transcription in viva, could be subjected to

mutagenesis to identify a mutation that allows SpoIIID-dependent transcription. Ifwild-
type SpoIIID does activate transcription by highly purified 0E RNAP in vitra, but one or
more of the altered SpoIIID proteins does not, it would still be interesting to screen for
suppressor mutations, though in a more directed manner. The sigE gene would be the
most likely location of such mutations, but, because SpoHID also activates oK-dependent

transcription of sigK (Kroos et al., 1989), they may be located in the sigK gene or the

' gene for a subunit of the RNAP core, most likely for the a-subunit based on paradigms

from other transcriptional activators.

It would also be interesting to characterize the conformational shift in SpoIIlD that my
preliminary results indicate occurs upon DNA binding. While under the conditions used,
apo-SpoIHD did not appear to be stable in high enough concentrations for NMR-based

structure determination, other conditions may be found that allow better protein stability

106

without interfering with NMR data collection. Alternatively, though I was unable to get
crystals of SpoIIID to form in the presence or absence of DNA, truncating the C-terminal
12 residues of SpoHID which are not essential for DNA binding and are disordered when
SpoIIID is bound to DNA may allow for the formation of crystals. Analysis of the
apparent conformational shift in SpoIIID may provide new insights into how SpoIIID
interacts with DNA, and, coupled with identification of the residues involved in

transcriptional activation, allow a more complete picture of the mechanisms underlying

transcriptional activation in bacteria.

107

Appendices

108

Appendix 1: Preparation of SpoIIID for NMR-based structural analysis

109

Abstract

While a number of predictions have been made with regard to the structural properties
of SpoIIID and the manner in which it contacts DNA, a better understanding of the

mechanisms by which SpoIIID functions would be provided by the determination of the

structure of SpoIIID. To that end, lsN-singly labeled and ”N, 13 C-doubly labeled

SpoHID was prepared and purified. SpoIIID, either mixed with DNA or free, was
analyzed via NMR. Although SpoIIID in the absence of DNA appears to be have been
unstable under the conditions tested, precluding a definitive result, less than 25% of the
peaks in the spectrum obtained could be aligned with the spectra of SpoIIID in the
presence of DNA, suggesting that the majority of the amino groups resided in different

chemical environments depending on whether SpoIIID is bound to DNA or fiee.
Introduction

SpoIIID is a small (10.8 kDa, 93 amino acids) protein that binds DNA in a sequence-
specific manner to both activate and repress transcription (Eichenberger et al., 2004,
Halberg & Kroos, 1994, Ichikawa & Kroos, 2000, Kunkel et al., 1989, Zhang et al.,
1997). SpoIIID has previously been predicted to make use of a helix-turn—helix motif to
interact with DNA (Kunkel et al., 1989). In Chapter II, we describe more detailed
predictions of the 3-dimensional structure of SpoIIID that suggest that it is comprised of a
4 a-helix bundle potentially followed by a fifth a-helix that extends away from the
protein. We also identify two distinct regions of SpoIIID that are required for
interactions between a monomer of SpoIIID and DNA. While DNA-binding studies

suggest that when SpoIIID functions as a transcriptional repressor it binds at or near the

110

start site of transcription or the binding site of a transcriptional activator and may
competitively inhibit interactions between the activator or RNA polymerase with DNA,
when SpoIIID activates transcription it binds near the -35 region where it is ideally
positioned to recruit RNAP to promoters to which RNAP has low affinity (Eichenberger
et al., 2004, Halberg & Kroos, 1994, Ichikawa & Kroos, 2000, Zhang et al., 1997). In an
attempt to identify residues important for the recruitment of RN AP to SpoIIID-dependent
promoters, in Chapter II we performed a screen of a large number of substitutions in
SpoIIID that either reversed the charges at many positions or introduced charges at
positions where there had previously been an uncharged residue. Mutations for that
screen were chosen based on their charge, under the assumption that charged residues
would be solvent-exposed, or on their location in the 3-dimensional models of SpoIIID.
To determine the structure of SpoIIID, which would provide insing into which of the
residues that we identified in Chapter H as being deficient in transcriptional activation in
viva were not involved in DNA-binding as well as provide other insights into the firnction
of SpoIIID, we purified isotopically-labeled SpoIIID protein and subjected it to NMR .
analysis both in the presence and absence of DNA The resulting spectra have few peaks

in common, suggesting that SpoIIID undergoes a substantial change in conformation

upon DNA-binding.

Experimental Procedures

Overexpressian and Purification afSpaIIID — A small colony of Escherichia cali
BL21 (DE3) (Novagen) strain containing the plasmid pPH7 (see Chapter II, Table 2.2)
was selected as described in Chapter II to inoculate 2 l of M9 medium (42 mM

Na2HP04, 22 mM KH2P04, 8.5 mM NaCl, 18 mM lsN—NH4C1, 0.1 mM CaClz, 0.2%

111

(w/v) dextrose, supplemented with 2 ml Advanced Formula Multivitamin (Meij er) extract

[crushed tablet was mixed with 3 ml 1 N HCl, and solids were cleared]) containing 150

ug/ml ampicillin. When SpoIIID was 15N, l3C-doubly labeled, 0.2% (w/v) l3C-glucose

was substituted for 0.2% (w/v) dextrose. The culture was grown and expression of
SpoIIID was induced as described in Chapter II. SpoIIID was purified over a SP
Sepharose column (GE Healthcare) as described in Chapter II for SpoIIID prepared for

use in analytical ultracentrifirgation, but the column was 7.5 ml rather than the 1 ml

column used in Chapter II. The protein was finther purified over the l-ml IrIiTrapTM

Heparin HP column (GE Healthcare) as described in Chapter II for SpoIIID used for
analytical ultracentrifilgation.

Preparation of Samples for Nil/Ht Analysis - Oligonucleotides containing the
sequences 5’-attaggacaagcgc—3’ and 5’tgcgcttgtcctaa-3’ were obtained fi'om W.M. Keck
Oligonucleotide Synthesis Facility, Yale University, resuspeded in 10 mM potassium
phosphate buffer pH 7 supplemented with 50 mM NaCl, and equimolar concentrations
were boiled for 10 minutes and, then, allowed to cool to room temperature. SpoIIID
purified as described above was diluted tenfold in 10 mM potassium phosphate buffer pH
7 and 500 nmol SpoIIID was mixed with 600 nmol annealed DNA inverted several times
to mix and stored on ice for 1 hour. Alternatively, for SpoIHD in the absence of DNA,
SpoIIID purified as described above was diluted in 10 mM potassium phosphate buffer
pH 7 to a final NaCl concentration of 0.6 M. The SpoIIID or SpoIIID/DNA mixture was
concentrated to a final volume of 0.5 ml using Amicon Ultra 4 (5K MWCO) (Millipore)

centrifugal filter devices, then transferred to a microcentrifuge tube and centrifuged at

112

16,000 x g for 10 minutes at 4°C, and the supernatant was transferred to a fresh tube.
Sampr were supplemented with 50 M DSS (4,4—dimethyl-4~silapentane-l-sulfonic

acid) and 1% (w/v) sodium azide and 10% D20 and transferred to NMR tubes for
analysis.

Results and Discussion

Stability afSpaIIID in the absence of DNA — We have previously shown that, at
concentrations suitable for structural studies (e.g., 500 M — lmM SpoIIID), requires
high concentrations of salt to remain stable in the absence of DNA (PH and L.K,
unpublished data). For example, using dialysis to reduce the concentration of NaCl from
1 M in 100 mM increments, SpoIIID spontaneously precipitated when the NaCl
concentration decreased below 600 mM (or 500 mM NaCl when the buffer was
supplemented with 0.1% (v/v) Triton X—100). While there was no visible precipitation
following concentration or subsequent centrifugation, the NMR signal resulting from
SpoIIID in the absence of DNA, was significantly smaller than expected and as a result a
large number of scans had to be taken to amplify the signal. This implies that there was a
substantial decrease of protein in the SpoIIID sample in the absence of DNA during or

alter concentration and that 600 mM NaCl was insuflicient to maintain protein stability in

these conditions.

C amparisan of M Spectra afSpaIIID in the Presence ar Absence of DNA — As can

be seen in Table A1 . 1, when we compared the 1H—lSN HSQC spectrum of SpoIIID in the

presence of DNA with that from free SpoIIID only a small portion of the peaks (each

peak corresponds to an amino group in the protein) aligned. While each of the spectra

113

had over 100 peaks only 26 peaks had coordinates in common. Although this experiment
was only performed once, and on one protein sample that appeared to be unstable, this
result implies that the majority of the amino groups, and therefore residues, of SpoIIID
are in different chemical environments in the two conditions analyzed. This result leads

us to hypothesize that the conformation of SpoIIID undergoes a significant change upon

interaction with DNA.

114

 

Table A1.1 Comparison of the Coordinates of lH-lSN HSQC spectra of
SpoIIID in the presence or absence of DNA

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

SpoIIID with DNA Free SpoIIID
£e__ak thpm) Hthpm) P§a_k thpm) Hthpm) Match
no.“ nag nag

0 130.48 7.962
1 128.679 8.312
2 128.672 7.899

0 126.936 8.356

1 126.784 8.515

2 126.779 8.446

3 126.779 8.434

4 126.784 8.429

5 126.779 8.338 3 126.699 8.309 1
4 126.644 7.791
5 125.555 8.857

6 124.948 6.622

7 124.805 8.41

8 124.713 8.755

9 124.713 8.498

10 124.705 8.674

11 124.645 8.406 6 124.62 8.338 2
7 124.568 8.457
8 124.349 9.091
9 124.374 7.831

12 124.252 9.243
10 124.21 7.891

13 124.169 8.374 11 124.157 8.337 3
12 124.153 8.233

14 123.993 8.207

15 123.985 7.617

16 123.965 7.805

17 123.896 7.382
13 123.861 8.175
14 123.747 8.551

18 123.439 8.278

19 123.443 8.256

20 123.441 8.228

21 123.43 8.341

22 123.431 8.299

23 123.435 8.083 15 123.406 8.061 4
16 123.358 8.136

24 123.404 7.653 17 123.369 7.61 5

 

 

 

 

 

 

 

115

 

 

Table A1.1 (cont’d).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

18 123.174 7.829
25 123.21 8.523 19 123.145 8.485 6
26 123.062 8.285 20 123.071 8.281 7
21 123.017 9.006
22 122.898 7.307
23 122.823 8.448
24 122.836 6.996
25 122.788 8.083
26 122.723 8.615
27 122.487 8.03
27 122.47 8.473
28 122.439 7.709
28 122.404 7.523
29 122.325 7.83
30 122.238 8.701
31 122.236 8.557
32 122.253 8.493
33 122.256 8.487
34 122.262 8.168
35 122.231 8.708
36 122.231 8.573
29 122.23 9.073
37 122.216 8.372
38 122.197 10.855
30 122.179 8.347
31 122.148 8.129
39 122.075 6.337
40 122.022 8.35
41 121.986 7.551 32 121.942 7.536 8
i 33 121.913 7.852
42 121.813 9.118
43 121.789 8.325
44 121.786 8.321 34 121.728 8.376 9
45 121.807 7.769
46 121.768 8.188 35 121.735 8.15 10
47 121.758 7.193
36 121.704 7.801
48 121.698 8.401
37 121.533 8.104
38 121.459 7.191
49 121.456 8.31
39 121.445 8.674
50 121.42 9.038
40 121.405 7.345

 

 

 

 

116

 

 

Table A1.1 (cont’d).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

' ,. 41 121.301 8.046

51 121.254 9.572

52 121.267 7.322

53 121.242 7.813

54 121.126 8.616

55 121.125 8.61

56 121.112 8.501

57 121.112 8.416

58 121.135 8.275

59 121.103 8.203

60 121.072 8.338

61 121.036 8.064
42 121.019 8.733
43 120.99 8.332
44 120.99 7.794
45 120.939 8.183

62 120.896 8.484

63 120.897 8.431

64 120.898 8.418

65 120.89 8.587

66 120.89 8.496

67 120.888 8.257 46 120.862 8.232 11

68 120.809 8.141

69 120.746 8.209
47 120.659 10.443
48 120.594 8.895

70 120.547 8.28
49 120.531 8.004
50 120.499 8.453
51 120.422 8.779
52 120.427 8.709
53 120.372 8.222
54 120.299 8.147

71 120.202 8.487

72 120.117 7.8 55 120.085 7.614 12

73 119.934 8.045
56 119.915 8.563

74 119.863 8.908 57 119.901 8.852 13

75 119.843 7.591
58 119.683 9.067

76 119.618 8.594 59 119.676 8.467 14
60 119.615 7.333

77 119.512 9.022

78 119.475 8.685

 

117

 

 

Table A1.1 (cont’d).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

79 119.354 7.859 61 119.375 7.79 15
80 119.345 7.624
62 119.331 8.403
81 119.292 7.812
63 119.25 8.745
82 119.172 8.379
83 119.134 8.471 64 119.116 8.484 16
84 119.143 8.388
65 119.033 7.908
66 118.964 7.829
67 118.889 8.715
68 118.754 8.01
85 118.645 8.247
69 118.403 7.469
86 118.347 7.85
87 117.855 8.061 70 117.913 8.04 17
88 117.868 7.975
89 117.84 8.868
71 117.796 7.981
90 117.734 7.073
' 72 117.664 7.906
91 117.488 8.318 73 117.489 8.517 18
92 117.33 7.774
93 116.877 8.122 74 116.826 8.279 19
75 116.539 7.119
76 116.465 8.257
77 116.422 8.17
94 116.329 8.337
78 116.294 7.45
79 116.033 7.265
95 115.947 7.67
96 115.972 7.401
97 115.922 8.568 80 115.921 8.182 20
98 115.856 7.124
81 115.819 7.928
99 115.768 7.929
82 115.664 8.495
100 115.566 8.317
101 115.46 7.411
83 115.425 8.649
102 114.865 8.49
103 114.785 8.609
104 114.617 8.034
84 114.483 8.389

 

118

 

 

Table A1.1 (cont’d).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

105 114.467 9.181
106 114.405 8.003
107 114.341 7.951
85 114.28 8.257
86 113.584 8.077
108 113.171 6.851
87 113.214 8.294
88 113.153 7.573
109 113.029 6.852
89 112.965 7.979
90 112.951 7.161
91 112.893 8.738
110 112.891 7.588
111 112.891 5.851
112 112.754 7.549
92 112.808 7.783
113 112.73 6.909 93 112.789 6.906 21
114 112.698 7.816
115 112.638 6.909
116 112.612 7.515
117 112.615 6.8
118 112.46 6.851
94 112.425 7.975
119 112.218 7.586 95 112.239 7.557 22
120 112.207 6.855 96 112.223 6.845 23
121 112.101 6.956
122 112.069 6.854
97 112.004 7.961
98 111.824 6.945
99 111.442 8.515
123 111.172 8.18
100 111.166 7.976
124 110.884 7.648
125 110.805 8.608
126 110.188 8.354 101 110.026 8.304 24
127 109.956 8.318
128 109.866 8.064
129 109.673 8.815
102 109.524 8.32
130 109.182 6.978
103 109.161 8.622
104 108.969 8.26
105 107.075 7.665
131 105.734 8.104 106 105.715 8.069 25

 

119

 

 

Table A1.1 (cont’d).

 

107

105.067

8.077

 

132 104.58

7.446

108

104.432

7.453

26

 

133 103.742

 

 

 

7.819

 

 

 

 

 

“The peaks are numbered for each spectrum separately in order of descending nitrogen
signal (fi'om 130 to 103 ppm). Peaks of similar characteristics between the two spectra

are aligned and given a match number, again organized by descending nitrogen signal,
identify the 26 peaks that may correspond to anrino groups in the same chemical

environment when SpoIIID is with or without DNA

120

 

Appendix 2: Removing spaIIID from Dependence on SpoIIID for Transcriptional

Activation

121

Abstract

Because SpoIIID has been shown to positively autoregulate transcription of spaIIID,
amino acid substitutions in SpoIIID that cause decreased stability are indistinguishable
from substitutions that impair the ability of SpoIIID to activate transcription when
SpoIIID accumulation is assayed. In an attempt to circumvent the SpoIIID-dependence
of spaIIID, the spaIIID coding region was firsed to the promoter of a gene that is
expressed at a similar time in sporulation to similar levels. When this firsion was inserted
into the chromosome of a B. subtilis strain unable to express spaIIID fiom its native
locus, the firsion was unable to support SpoIIID-dependent gene expression significantly

above background levels.
Introduction

While the gene encoding the Bacillus subtilis transcription regulator SpoIIID is

transcribed by GE RNA polymerase, full expression of spaIIID is dependent on the

presence of SpoHID (Kunkel et al., 1989, Stevens & Errington, 1990). This requirement

for SpoIIID has been proposed to be the basis for the delay of peak expression of spaIIID

after activation of GE (Steil et al., 2005). Surprisingly, there does not appear to be a

match to the SpoIIID DNA-binding consensus sequence 5’-WWRRACARNY—3’ (where
W is A or T, R is purine, Y is pyrimidine, N is any nucleotide) (Halberg & Kroos, 1994)
near the spaIIID promoter. Expression of spaIIID is firrther regulated by the presence of
a small upstream cistron, usd, with which spaIIID is co-transcribed (Decatur et al., 1997).
While there is no known firnction for the peptide encoded by usd, its translation has been
proposed to be required to disrupt a stem-loop structure in the mRN A which otherwise

122

renders the spaIIID Shine-Dalgarno sequence inaccessible to the ribosome and this is
supported by the finding that mutation disrupting the usd ribosome-binding sequence, ‘

causes a lack of SpoHID accumulation (Decatur et al., 1997).

Expression of the spaIID gene, the product of which is an essential part of the

engulfment apparatus (Abanes-De Mello et al., 2002), is also dependent on OE RNA

polymerase (Eichenberger et al., 2004, Tatti et al., 1995). Although expression of spaIID
is repressed by SpoIIID (Eichenberger et al., 2004), even in the presence of SpoIIID,
expression levels of spoIID are approximately threefold higher than those of spaIIID
(Tatti et al., 1995). Here we present the results of a fusion between the wild-type or a

mutant spaIID promoter and spaIIID.
Experimental Procedures

Plasmids — The plasmids and Oligonucleotides used in this study are described in

Tables A21 and A22 respectively.

C anstructian of spoIID-spoIIlD fusions - To create the spoIID(-31A D-spaIIID fusion,
primers LK1061 and LK1062 were used to PCR amplify the spaIID promoter (-291 to
-16 relative to translational start with the A to T mutation at -31 relative to transcriptional
start) from pSpoIID-LacZ -31AT. The product was purified and 200 ng of the reaction
was used as the upstream primer in a second PCR reaction with primer LK1063 to
amplify the spaIIID coding region (~21 to +3 03 with respect to translational start) from
pPHl. The product of this reaction was used with primers LK1061 and LK1063 in a
third PCR reaction to amplify the product. Alternatively, for the spaIID(-31A D-H(6)-
spaIIID fusion, primers LK1061 and LK1207 were used to PCR amplify the spaIID

123

promoter (-291 to -16 relative to translational start) from pSpoIID-LacZ -31AT. The
product was purified and 200 ng was used as the upstream primer in a second PCR
reaction with primer LK1063 to amplify the spaIIID coding region (+1 to +363 with
respect to the translational start) containing the N-terminal histidine tag from pPH26.
Between the sequences contained in pSpoIID-LacZ -31AT and pPH26, LK1207 contains
sequence corresponding to the 5’ untranslated region (-21 to -1 with respect to
translational start), including the ribosome binding site, of spaIIID. The product of this
reaction was used with primers LK1061 and LK1063 in a third PCR reaction to amplify
the product. The -31AT mutation was converted to wild-type sequence by using primers
LK1345 and LK1346 and the QuikChange site-directed mutagenesis kit (Stratagene) on
plasmids pPH35 and pPH36 to make plasmids pPH47 and pPH48, respectively. All
products of fusions and mutagenesis were sequenced at the Michigan State University

Genomics Technology Support Facility to ensure that the desired sequence was present.

Construction of B. subtilis Strains that Express spoIID-spoIIID fusions from the thrC
Locus — Competent PH1001 cells were transformed with pPH35, pPHB 6, pPH47, and
pPH48 to create PH2035, PH203 6, PH2047, and PH2048 as described in Chapter II.
Verification of double crossover insertion into the thrC gene and no insertion into

spaIIID was performed as described in Chapter 11.

Measurement of spoIVCA—gusA Reporter Expression — Sporulation and sample
collection were performed as described in Chapter II. Enzymatic activity of each sample
was assayed, activity of PH2000 strain (background activity) was subtracted and the
average of the activity as a percentage of PH2001 (wild type) activity for 3 biological
replicates was determined as described in Chapter II.

124

 

 

 

um. s 0" '1 4‘ .. l.~t." .13 "13.» ... t“: 1‘ ‘,“ ‘51' "
II ...I‘ ‘t 1 C-I'I‘ '1‘” 9.,9.‘ a . 00‘ y ”'2‘". " :.§ E: "3):“; .l .l
. n‘zifr0.§f. l... ‘3”... l 1., ,, J: h. “a; ‘ ‘ u H, _
inmate.cunts-pauw' . __ “134M ' {._,'_, , .1

 

le“ . . .. ,
a In." '

““1. l., “al.,
1514‘ .. Aa-QJ-i‘

 

 

 

 

 

 

 

 

 

 

Table A2. 1. Descriptions of certain plasmids used in this study
Plasmid Description Construction Reféerence or
ource
pSpoIID- Apr Nmr; vector to (Eichenberger
31:21“ make gusA firsions for $316" 52104,
mtegratron at amyE 1995)
PAK3 Apr Spr; vector for V- Chary and
integration at thrC 1" Piggot
pET-28a Kant; T7; C-terminal Novagen
His(6) tag
pPH26 Apr; T7-H(6)- spa IIID the spaIIID coding region (+2 to This work
+3 03 with respect to translational
start) was amplified by PCR
using LK566 and LK567 as
primers and PY79 chromosomal
DNA as template, then the NdeI
and BamHI digested PCR product
was inserted between the NdeI
and BamHI sites of pET-28a
pPH] Apr Spr; WIND Chapter II
pPH35 Apr Spr; PspoIID(-31A 7? the spoIID(-31A D-spalIlD fusion This work
-.spaIIID transcriptional was created as (163°wa 1n
firsion Expenmental Procedures then the
EcoRI-digested PCR product was
inserted into the EcoRI site of
pAK3
pPH36 Apr Spr; PspaIID(-31A I) the.6paIID(-31A D-H(6)-spoIIID This work
-H(6)-spaIIID firsron. was created as descrrbed 1n
transcriptional firsion Expenmental Procedures then the
EcoRI-digested PCR product was
inserted into the EcoRI site of
pAK3
pPH47 Apr Spr; PspoIID' the -31AT mutation in pPH35 This work
spaIIID transcriptional was converted t9 wild-type
fusion sequence wrth s1te-drrected
mutagenesis using primers
LK1345 and LK1346
pPH48 Apr Spr; PspaIID)'H(6)' the -31AT mutation in pPH36 This work
spaIIID transcriptional was converted t? Wild-type
fusion sequence wrth s1te-drrected

 

 

mutagenesis using primers
LK1345 and LK1346

 

 

 

12S

 

.14. '
t.._l“l
.aan"

Abbreviations: Apr, ampicillin-resistant; Nmr, neomycin-resistant; Spr, spectinomycin-

resistant; Kant, kanamycin-resistant; T7, T7 RNA polymerase promoter and a translation
initiation sequence; H(6) N-terminal histidine tag sequence from pET-28a.

126

 

 

 

 

 

 

Table A2.2. Oligonucleotides used in this study

Primer Sequence“

LK1345 5’-ccaaaacgagagtcatattagcttgtccctgccc—3’
(-31TA)"

LK1346 5’-gggcagggacaagctaatatgactctcgttttgg-3’
LK566 5’-gggaattccatatgcacgattacatcaaagagcgaac-3’
(SpoIIID +2 to

+303)”

LK567 S’Wcaagaaggcaatsccags-T

LK1061 5’ -ccgctcgaggaattcaagcttgccgctctgggcgc-3’
(spoHD -291

to -16) ‘

LK1062 5’-caccactcgacctccctaaaatgctcgggattcgactctagt-3’
(SpoHID ~21

to +303) ‘

LK1063 S’Waggcaatsccaggg-T
LK1061 5’ W cc ctctgggc c-3’
(spaIID -29l caagcttg g g

to -l6) ‘

LK1207 5’8atgatgatggagctgcggatammaasctcgsgattcgactctagtc -3’
(H(6)-SpoIHD

+1 to +3 63) °

LK1063 S’Wwatswasgs-B’

 

 

 

 

a Boldface type indicates location of mutation in sequence.

For the primer parr used 1n srte-dlrected mutagenesrs, the substitution rs lndrcated 1n
parentheses, the top primer indicates the coding strand, the bottom primer indicates the
template strand.

0 For each primer set used to clone sequences, the boundaries of the region (in
nucleotides, with respect to the start of translation) are indicated in parentheses after the
name of the primer, the upper primer is the primer complementary to the upstream end of
the sequence cloned, and the lower primer is complementary to the downstream end.
Sequences not part of the region cloned are underlined. Italicized type indicates the final
base of each sequence when two sequences are joined.

127

Results and Discussion

Expression of spoIVCA-gusA in a B. subtilis strain engineered to produce SpoIIID
under the control of the spoIlD promoter — While expression from translational fusions
of the spaIID promoter to lacZ are approximately threefold higher than similar firsions of
spaIIID to lacZ, a single-base pair A to T substitution at -31 in the spaIID promoter
reduced expression to approximately threefold less than that seen using the spaIIID
promoter (Tatti et al., 1995). Both wild-type and -31AT versions of the spaIID promoter
were transcriptionally fused to SpoIIID. The ultimate base of the spaIID promoter in
these firsions immediately preceded the Shine-Dalgarno sequence from spoIID and the
next base was the first base of the spaIIID Shine-Dalgarno sequence to eliminate the 5’
portion of the stem-loop that is believed to sequester the spaIIID Shine-Dalgarno
sequence at its native locus (Decatur et al., 1997). Because the polyclonal 1).-SpoIIID
antibodies we use to detect SpoIIID primarily interact with the C-terminus of SpoIIID
and we planned to perform C-ternrinal truncations of SpoIIID, similar firsions were made
containing the N-terrninal polyhistidine tag from pET-28a, so that they could be used to
detect SpoIIID with a-His(6) antibodies. None of these filsions, when transformed into
B. subtilis, were competent to activate expression of the SpoIIID-dependent spoIVCA-
gusA transcriptional firsion (Figure A2.1). Because the wild-type SpoIIID is encoded by
these firsions, we are unable to determine whether there is an inherent flaw in these
constructs or if SpoIIID more firlly represses the spaIID promoter when that promoter
drives SpoIIID expression than when expression of SpoHID is driven by the spaIIID

promoter.

128

Figure A2.1. Quantification of the efl'ects of spaIID-spaIIID fusions on transcription
in viva. B—glucuronidase activity as a percentage of wild type levels was determined as
described in Experimental Procedures. Bars indicate averages of 3 biological replicates

and error bars indicate one standard deviation.

129

M, Fig. A2.1

llicatcs
1 20

 

'8

 

 

8

 

 

A
O

 

20-

B-glucuronidase Activity (% Wlld Type)
on
o

 

 

 

           

wild-type PspollD PspollD PspollD- PspollD-
(-31AT)- (-31AT)-H(6 spaIIID H(6)-spaIIID
spolllD )-spo||lD

SpoIIID Fusion

130

References

131

REFERENCES

Abanes—De Mello, A, Y. L. Sun, S. Aung & K. Pogliano, (2002) A cytoskeleton-like role
for the bacterial cell wall during engulfment of the Bacillus subtilis forespore.
Genes Dev 16: 3253-3264.

Abbani, M. A, C. V. Papagiannis, M. D. Sam, D. Cascio, R C. Johnson & R. T. Clubb,
(2007) Structure of the cooperative Xis-DNA complex reveals a
micronucleoprotein filament that regulates phage lambda intasome assembly.
Prac NatlAcadSci USA 104: 2109-2114.

Altschul, S. F ., W. Gish, W. Miller, E. W. Myers & D. J. Lipman, (1990) Basic local
alignment search tool. J Mol Biol 215: 403-410.

Aravind, L., V. Anantharaman, S. Balaji, M. M. Babu & L. M. Iyer, (2005) The many
faces of the helix-turn-helix domain: transcription regulation and beyond. FEMS
Microbial Rev 29: 231-262.

Arigoni, F., L. Duncan, S. Alper, R. Losick & P. Stragier, (1996) SpoIIE governs the
phosphorylation state of a protein regulating transcription factor sigma F during
sporulation in Bacillus subtilis. Prac Natl Acad Sci U S A 93: 323 8-3242.

Atrih, A, P. Zollner, G. Allmaier & S. .1. Foster, (1996) Structural analysis of Bacillus
subtilis 168 endospore peptidoglycan and its role during difi‘erentiation. J
Bacterial 178: 6173-6183.

Bagyan, I., J. Hobot & S. Cutting, (1996) A compartmentalized regulator of
developmental gene expression in Bacillus subtilis. .1 Bacterial 178: 4500-4507.

Behravan, J., H. Chirakkal, A. Masson & A Moir, (2000) Mutations in the gerP locus of
Bacillus subtilis and Bacillus cereus affect access of germinants to their targets in
spores. J Bacterial 182: 1987-1994.

Ben-Yehuda, S. & R. Losick, (2002) Asymmetric cell division in B. subtilis involves a
spiral-like intermediate of the cytokinetic protein FtsZ. Cell 109: 257-266.

Ben-Yehuda, S., D. Z. Rudner & R. Losiclg (2003) RacA, a bacterial protein that anchors
chromosomes to the cell poles. Science 299: 532-536.

Blaylock, B., X. Jiang, A Rubia, C. P. Moran, Jr. & K. Pogliano, (2004) Zipper-like

interaction between proteins in adjacent daughter cells mediates protein
localization. Genes Dev 18: 2916-2928.

132

Boland, F. M., A. Atrih, H. Chirakkal, S. J. Foster & A. Moir, (2000) Complete spore-
cortex hydrolysis during germination of Bacillus subtilis 168 requires SleB and
YpeB. Microbialog 146 (Pt 1): 57-64.

Brennan, R G., (1993) The winged-helix DNA-binding motif: another helix-turn-helix
takeoff. Cell 74: 773-776.

Britton, R A, D. C. Lin & A D. Grossman, (1998) Characterization of a prokaryotic
SMC protein involved in chromosome partitioning. Genes Dev 12: 1254-1259.

Broder, D. H. & K. Pogliano, (2006) Forespore engulfinent mediated by a ratchet-like
mechanism. Cell 126: 917-928.

Burbulys, D., K. A. Trach & J. A Hoch, (1991) Initiation of sporulation in B. subtilis is
controlled by a multicomponent phosphorelay. Cell 64: 545-552.

Burkholder, W. F., I. Kurtser & A D. Grossman, (2001) Replication initiation proteins
regulate a developmental checkpoint in Bacillus subtilis. Cell 104: 269-279.

Bushman, W., S. an, L. L. Thio & A Landy, (1984) Determinants of directionality in
lambda site-specific recombination. Cell 39: 699-706.

Camp, A H. & R Losick, (2008) A novel pathway of intercellular signalling in Bacillus
subtilis involves a protein with similarity to a component of type HI secretion
channels. Mal Alicrabial 69: 402-417.

Camp, A. H. & R. Losick, (2009) A feeding tube model for activation of a cell-specific
transcription factor during sporulation in Bacillus subtilis. Genes Dev 23: 1014-
1024.

Campo, N. & D. Z. Rudner, (2007) SpoIVB and Cth are both forespore signals in the
activation of the sporulation transcription factor sigmaK in Bacillus subtilis. J
Bacterial 189: 6021-6027.

Carniol, K., S. Ben-Yehuda, N. King & R Losick, (2005) Genetic dissection of the
sporulation protein SpoHE and its role in asymmetric division in Bacillus subtilis.
J Bacterial 187: 351 1-3 520.

Carniol, K., P. Eichenberger & R Losick, (2004) A threshold mechanism governing
activation of the developmental regulatory protein sigma F in Bacillus subtilis. J
Biol Chem 279: 14860-14870.

Chai, Y., F. Chu, R. Kolter & R. Losick, (2008) Bistability and biofilm formation in
Bacillus subtilis. Mal Microbial 67: 254-263.

133

Clark, K. L., E. D. Halay, E. Lai & S. K. Burley, (1993) Co-crystal structure of the HNF-
3/fork head DNA-recognition motif resembles histone H5. Nature 364: 412-420.

Crater, D. L. & C. P. Moran, Jr., (2001) Identification of a DNA binding region in GerE
from Bacillus subtilis. J Bacteriol 183: 4183-4189.

Crater, D. L. & C. P. Moran, Jr., (2002) Two regions of GerE required for promoter
activation in Bacillus subtilis. J Bacteriol 184: 241-249.

Crater, D. L., K. H. Wade, 0. Resnekov, H. T. Ichikawa, L. Kroos, J. A. Brannigan & C.
P. Moran, Jr., (2002) A mutation in GerE that affects cotC promoter activation in
Bacillus subtilis. Biachim Biophys Acta 1576: 30-38.

Daniel, R A, S. Drake, C. E. Buchanan, R Scholle & J. Errington, (1994) The Bacillus
subtilis spoVD gene encodes a mother-cell-specific penicillin-binding protein
required for spore morphogenesis. J Mal Biol 235: 209-220.

de Lencastre, H. & P. J. Piggot, (1979) Identification of different sites of expression for
spo loci by transformation of Bacillus subtilis. J Gen Microbial 114: 377-3 89.

Decatur, A, M. T. McMurry, B. N. Kunkel & R. Losick, (1997) Translation of the
mRNA for the sporulation gene spoHID of Bacillus subtilis is dependent upon
translation of a small upstream open reading fi'ame. J Bacterial 179: 1324-1328.

Decatur, A L. & R Losick, (1996) Three sites of contact between the Bacillus subtilis
transcription factor sigmaF and its antisigma factor SpoHAB. Genes Dev 10:
2348-2358.

Demeler, B. & K. E. van Holde, (2004) Sedimentation velocity analysis of highly
heterogeneous systems. Anal Biochem 335: 279-288.

Doan, T., K. A. Marquis & D. Z. Rudner, (2005) Subcellular localization of a sporulation
membrane protein is achieved through a network of interactions along and across
the septum. Mal Microbial 55: 1767-1781.

Doan, T., C. Morlot, J. Meisner, M. Serrano, A O. Henriques, C. P. Moran, Jr. & D. Z.
Rudner, (2009) Novel secretion apparatus maintains spore integrity and
developmental gene expression in Bacillus subtilis. PLoS Genet 5: e1000566.

Dong, T. C. & S. M. Cutting, (2003) SpoIVB-mediated cleavage of SpoIVFA could
provide the intercellular signal to activate processing of Pro-sigmaK in Bacillus
subtilis. Mal Microbial 49: 1425-1434.

Driks, A, (2002) Proteins of the Spore Coat. In: Bacillus subtilis and Its Closest

Relatives: fi'om Genes to Cells J. A H. Abraham L. Sonenshein, and R Losick
(ed). Washington, DC: ASM Press, pp. 527-535.

134

Driks, A, S. Roels, B. Beall, C. P. Moran, Jr. & R Losick, (1994) Subcellular
localization of proteins involved in the assembly of the spore coat of Bacillus
subtilis. Genes Dev 8: 234-244.

Dubnau, D. & R Losick, (2006)Bistabi1ity in bacteria. Mollilicrobial 61: 564-572.
Dubnau, D. & R. Provvedi, (2000) Intemalizing DNA Res Microbial 151: 475-480.

Ducros, V. M., R J. Lewis, C. S. Verma, E. J. Dodson, G. Leonard, J. P. Turkenburg, G.
N. Murshudov, A J. Wilkinson & J. A Brannigan, (2001) Crystal structure of
GerE, the ultimate transcriptional regulator of spore formation in Bacillus subtilis.
J Mal Biol 306: 759-771.

Duncan, L., S. Alper, F. Arigoni, R Losick & P. Stragier, (1995) Activation of cell-
specific transcription by a serine phosphatase at the site of asymmetric division.
Science 270: 641-644.

Dworkin, J. & R Losick, (2001) Differential gene expression governed by chromosomal
spatial asymmetry. Cell 107: 339-346.

Edwards, D. H. & J. Errington, (1997) The Bacillus subtilis DivIVA protein targets to the
division septum and controls the site specificity of cell division. Mal Microbial
24: 905-915.

Eichenberger, P., P. Fawcett & R Losick, (2001) A three-protein inhibitor of polar
septation during sporulation in Bacillus subtilis. Mal Microbial 42: 1147-1162.

Eichenberger, P., M. Fujita, S. T. Jensen, E. M. Conlon, D. Z. Rudner, S. T. Wang, C.
Ferguson, K. Haga, T. Sato, J. S. Liu & R Losick, (2004) The program of gene
transcription for a single differentiating cell type during sporulation in Bacillus
subtilis. PLaS Biol 2: e328.

Eichenberger, P., S. T. Jensen, E. M. Conlon, C. van Ooij, J. Silvaggi, J. E. Gonzalez-
Pastor, M. Fujita, S. Ben-Yehuda, P. Stragier, J. S. Liu & R. Losick, (2003) The
sigmaE regulon and the identification of additional sporulation genes in Bacillus
subtilis. J Mol Biol 327: 945-972.

Errington, J., L. Appleby, R. A Daniel, H. Goodfellow, S. R Partridge & M. D. Yudkin,
(1992) Structure and firnction of the spoHIJ gene of Bacillus subtilis: a
vegetatively expressed gene that is essential for sigma G activity at an
intermediate stage of sporulation. J Gen Microbial 138: 2609-2618.

Foster, S. J. & D. L. Popham, (2002) Structure and Synthesis of Cell Wall, Spore Cortex,
Teichoic Acids, S-Layers, and Capsules. In: Bacillus subtilis and Its Closest
Relatives: from Genes to Cells J. A. H. Abraham L. Sonenshein, and R Losick
(ed). Washington, DC: ASM Press, pp. 21-41.

135

F oulger, D. & J. Errington, (1991) Sequential activation of dual promoters by different
sigma factors maintains spoVJ expression during successive developmental stages
of Bacillus subtilis. Mal Microbial 5: 1363-1373.

Frandsen, N., I. Barak, C. Karmazyn-Campelli & P. Stragier, (1999) Transient gene
asymmetry during sporulation and establishment of cell specificity in Bacillus
subtilis. Genes Dev 13: 394-399.

Fujita, M., J. E. Gonzalez-Pastor & R Losick, (2005) High- and low-threshold genes in
the SpoOA regulon of Bacillus subtilis. J Bacterial 187 : 1357-1368.

Fujita, M. & R Losick, (2002) An investigation into the compartmentalization of the
sporulation transcription factor sigmaE in Bacillus subtilis. Mal Microbial 43: 27 -
38.

Fujita, M. & R Losick, (2003) The master regulator for entry into sponrlation in Bacillus
subtilis becomes a cell-specific transcription factor alter asymmetric division.
Genes Dev 17: 1166-1174.

Gallegos, M. T., R. Schleif, A Bairoch, K. Hofinann & J. L. Ramos, (1997) Arac/XylS
family of transcriptional regulators. Microbial Mol Biol Rev 61: 393-410.

Gish, W. & D. J. States, (1993) Identification of protein coding regions by database
similarity search. Nat Genet 3: 266-272.

Gomez, M., S. Cutting & P. Stragier, (1995) Transcription of spoIVB is the only role of
sigma G that is essential for pro-sigma K processing during spore formation in
Bacillus subtilis. J Bacterial 177: 4825-4827.

Gonzalez-Pastor, J. E., E. C. Hobbs & R. Losick, (2003) Cannibalism by sporulating
bacteria. Science 301: 510-513.

Gouet, P., E. Courcelle, D. 1. Stuart & F. Metoz, (1999) ESPript: analysis of multiple
sequence alignments in PostScript. Biairyarmatics 15: 305-308.

Guerout-Fleury, A M., N. Frandsen & P. Stragier, (1996) Plasmids for ectopic
integration in Bacillus subtilis. Gene 180: 57-61.

Halberg, R & L. Kroos, (1992) Fate of the SpoHID switch protein during Bacillus
subtilis sporulation depends on the mother-cell sigma factor, sigma K. J Mol Biol
228: 840-849.

Halberg, R. & L. Kroos, (1994) Sporulation regulatory protein SpoIIID from Bacillus

subtilis activates and represses transcription by both mother-cell-specific forms of
RNA polymerase. J Mal Biol 243: 425-43 6.

136

Halberg, R, V. Oke & L. Kroos, (1995) Effects of Bacillus subtilis sporulation regulatory
protein SpoIHD on transcription by sigma K RNA polymerase in vivo and in
vitro. J Bacterial 177: 1888-1891.

Harry, K. H, R Zhou, L. Kroos & S. B. Melville, (2009) Sporulation and enterotoxin
(CPE) synthesis are controlled by the sporulation-specific sigma factors SigE and
SigK in Clostridium perfiingens. J Bacterial 191: 2728-2742.

Harwood, C. R. & S. M. Cutting, (1990) Molecular Biological Methods for Bacillus.
John Wiley & Sons Ltd, Chichester, England.

Healy, J ., J. Weir, 1. Smith & R. Losick, (1991) Post-transcriptional control of a
sporulation regulatory gene encoding transcription factor sigma H in Bacillus
subtilis. Mal Microbial 5: 477-487.

Henriques, A 0., H. de Lencastre & P. J. Piggot, (1992) A Bacillus subtilis morphogene
cluster that includes spoVE is homologous to the rum region of Escherichia coli.
Biachimie 74: 735-748.

Henriques, A. O. & C. P. Moran, Jr., (2007) Structure, assembly, and firnction of the
spore surface layers. Annu Rev Microbial 61: 555-588.

Hilbert, D. W. & P. J. Piggot, (2004) Compartmentalization of gene expression during
Bacillus subtilis spore formation. Microbial Mal Biol Rev 68: 234-262.

Hitchins, A D., (1975) Polarized relationship of bacterial spore loci to the "old" and
"new" ends of sporangia. J Bacteriol 121: 518-523.

Hofrneister, A, (1998) Activation of the proprotein transcription factor pro-sigmaE is
associated with its progression through three patterns of subcellular localization
during sporulation in Bacillus subtilis. J Bacterial 180: 2426-2433.

Hofrneister, A. E., A Londono-Vallejo, E. Harry, P. Stragier & R Losick, (1995)
Extracellular signal protein triggering the proteolytic activation of a
developmental transcription factor in B. subtilis. Cell 83: 219-226.

Hosoya, S., Z. Lu, Y. Ozaki, M. Takeuchi & T. Sato, (2007) Cytological analysis of the

mother cell death process during sporulation in Bacillus subtilis. J Bacterial 189:
2561-2565.

Huffman, J. L. & R G. Brennan, (2002) Prokaryotic transcription regulators: more than
just the helix-turn-helix motif. Curr Opin Struct Biol 12: 98-106.

Iber, D., J. Clarksorr, M. D. Yudkin & I. D. Campbell, (2006) The mechanism of cell
differentiation in Bacillus subtilis. Nature 441: 371-374.

137

Ichikawa, H, R Halberg & L. Kroos, (1999) Negative regulation by the Bacillus subtilis
GerE protein. J Biol Chem 274: 8322-8327.

Ichikawa, H. & L. Kroos, (2000) Combined action of two transcription factors regulates
genes encoding spore coat proteins of Bacillus subtilis. J Biol Chem 27 5: 13849-
13855.

Illing, N. & J. Errington, (1991) The spoIIIA operon of Bacillus subtilis defines a new
temporal class of mother-cell-specific sporulation genes under the control of the
sigma E form of RNA polymerase. Mal Microbial 5: 1927-1940.

Imamura, D. ,R Zhou, M. Feig & L. Kroos, (2008) Evidence that the Bacillus subtilis
SpoHGA protein is a novel type of signal-transducing aspartic protease. J Biol
Chem 283: 15287-15299.

Ionesco, H, J. Michel, B. Cami & P. Schaefl‘er, (1970) Symposium on bacterial spores:
H. Genetics of sporulation in Bacillus subtilis Marburg. J Appl Bacterial 33: 13-
24.

Ishikawa, S., K. Yarnane & J. Sekiguchi, (1998) Regulation and characterization of a
newly deduced cell wall hydrolase gene (cle) which affects germination of
Bacillus subtilis spores. J Bacterial 180: 1375-1380.

Jiang, M., R Grau & M Perego, (2000a) Difl‘erential processing of propeptide inhibitors
of Rap phosphatases in Bacillus subtilis. J Bacterial 182: 303-310.

Jiang, M., W. Shao, M. Perego & J. A. Hoch, (2000b) Multiple histidine kinases regulate
entry into stationary phase and sporulation in Bacillus subtilis. Mal Microbial 38:
53 5-542.

Jiang, X., A. Rubio, S. Chiba & K. Pogliano, (2005) Engulfrnent-regulated proteolysis of
SpoHQ: evidence that dual checkpoints control sigma activity. Mal Microbial 58:
102-1 15.

Johnsen, P. J ., D. Dubnau & B. R Levin, (2009) Episodic selection and the maintenance
of competence and natural transformation in Bacillus subtilis. Genetics 181:
1521-1533.

Jonas, R M., E. A Weaver, T. J. Kenney, C. P. Moran, Jr. & W. G. Haldenwang, (1988)
The Bacillus subtilis spoHG operon encodes both sigma E and a gene necessary
for sigma B activation. J Bacterial 170: 507-511.

Juan Wu, L. & J. Errington, (2000) Identification and characterization of a new prespore-
specific regulatory gene, rsz, of Bacillus subtilis. J Bacterial 182: 418-424.

138

Karmazyn-Campelli, C., L. Rhayat, R Carballido-Lopez, S. Duperrier, N. Frandsen & P.
Stragier, (2008) How the early sporulation sigma factor sigmaF delays the switch
to late development in Bacillus subtilis. Mal Microbial 67: 1169-1180.

Karow, M. L., P. Glaser & P. J. Piggot, (1995) Identification of a gene, spoHR, that links
the activation of sigma E to the transcriptional activity of sigma F during
sporulation in Bacillus subtilis. Prac Natl Acad Sci U S A 92: 2012-2016.

Kearns, D. B. & R. Losick, (2005) Cell population heterogeneity during growth of
Bacillus subtilis. Genes Dev 19: 3083-3094.

Kim, H., M. Hahn, P. Grabowski, D. C. McPherson, M. M. Otte, R. Wang, C. C.
Ferguson, P. Eichenberger & A Driks, (2006) The Bacillus subtilis spore coat
protein interaction network. Mal Microbial 59: 487-502.

King, N., O. Dreesen, P. Stragier, K. Pogliano & R. Losick, (1999) Septation,
dephosphorylation, and the activation of sigmaF during sporulation in Bacillus
subtilis. Genes Dev 13: 1156-1167.

Kirchman, P. A, H. DeGrazia, E. M. Kellner & C. P. Moran, Jr., (1993) Forespore-
specific disappearance of the sigma-factor antagonist spolIAB: implications for
its role in determination of cell fate in Bacillus subtilis. Mal Microbial 8: 663-
671.

Kobayashi, K., K. Hashiguchi, K. Yokozeki & S. Yamanaka, (1998) Molecular cloning
of the transglutaminase gene fiom Bacillus subtilis and its expression in
Escherichia coli. Biasci Biatechnal Biochem 62: 1109-1114.

Kroos, L., (2007) The Bacillus and Myxococcus developmental networks and their
transcriptional regulators. Annu Rev Genet 41: 13-3 9.

Kroos, L., B. Kunkel & R Losick, (1989) Switch protein alters specificity of RNA
polymerase containing a compartment-specific sigma factor. Science 243: 526-
529.

Kroos, L., Y. T. Yu, D. Mills & S. Ferguson-Miller, (2002) Forespore signaling is
necessary for pro-sigmaK processing during Bacillus subtilis sporulation despite
the loss of SpoIVF A upon translational arrest. J Bacterial 184: 5393-5401.

Kunkel, B., L. Kroos, H. Poth, P. Youngman & R. Losick, (1989) Temporal and spatial
control of the mother-cell regulatory gene spoIHD of Bacillus subtilis. Genes Dev
3: 1735-1744.

Kunkel, B., R Losick & P. Stragier, (1990) The Bacillus subtilis gene for the
development transcription factor sigma K is generated by excision of a

dispensable DNA element containing a sporulation recombinase gene. Genes Dev
4: 525-535.

139

Kunkel, B., K. Sandman, S. Panzer, P. Youngman & R Losick, (1988) The promoter for
a sponrlation gene in the spoIVC locus of Bacillus subtilis and its use in studies of
temporal and spatial control of gene expression. J Bacterial 170: 3513-3522.

Kunst, F ., N. Ogasawara, I. Moszer, A M. Albertini, G. Alloni, V. Azevedo, M. G.
Bertero, P. Bessieres, A. Bolotin, S. Borchert, R Boniss, L. Boursier, A Brans,
M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B. Caldwell, V.
Capuano, N. M. Carter, 8. K. Choi, J. J. Codani, I. F. Connerton, A. Danchin & et
al., (1997) The complete genome sequence of the gram-positive bacterium
Bacillus subtilis. Nature 390: 249-256.

Kuroda, A & J. Sekiguchi, (1991) Molecular cloning and sequencing of a major Bacillus
subtilis autolysin gene. J Bacterial 173: 7304-7312.

LaBell, T. L., J. E. Trempy & W. G. Haldenwang, (1987) Sporulation-specific sigma
factor sigma 29 of Bacillus subtilis is synthesized from a precursor protein, P31.
Prac Natl Acad Sci USA 84: 1784-1788.

Lai, E. M., N. D. Phadke, M. T. Kachman, R Giorno, S. Vazquez, J. A. Vazquez, J. R
Maddock & A Driks, (2003) Proteomic analysis of the spore coats of Bacillus
subtilis and Bacillus anthracis. J Bacterial 185: 1443-1454.

Larkin, M. A, G. Blackshields, N. P. Brown, R Chenna, P. A. McGettigan, H.
McWilliam, F. Valentin, I. M. Wallace, A Wilm, R Lopez, J. D. Thompson, T. J.
Gibson & D. G. Higgins, (2007) Clustal W and Clustal X version 2.0.
Biainfannatics 23: 2947-2948.

LeDeaux, J. R. & A. D. Grossman, (1995) Isolation and characterization of kinC, a gene
that encodes a sensor kinase homologous to the sporulation sensor kinases KinA
and KinB in Bacillus subtilis. J Bacterial 177: 166-175.

Levin, P. A, N. Fan, E. Ricca, A. Driks, R Losick & S. Cutting, (1993) An unusually
small gene required for sporulation by Bacillus subtilis. Mal Microbial 9: 761-
77 1.

Lewis, P. J ., T. Magnin & J. Errington, (1996) Compartrnentalized distribution of the
proteins controlling the prespore-specific transcription factor sigmaF of Bacillus
subtilis. Genes Cells 1: 881-894.

Lindow, J. C., R A. Britton & A. D. Grossman, (2002) Structural maintenance of
chromosomes protein of Bacillus subtilis affects supercoiling in vivo. J Bacterial
184: 5317-5322.

Little, S. & A Driks, (2001) Functional analysis of the Bacillus subtilis morphogenetic
spore coat protein CotE. Mal Microbial 42: 1107-1120.

140

Lopez, D., M. A. Fischbach, F. Chu, R Losick & R. Kolter, (2009) Structurally diverse
natural products that cause potassium leakage trigger multicellularity in Bacillus
subtilis. Prac Natl Acad Sci U S A 106: 280-285.

Losick, R & P. Stragier, (1992) Crisscross regulation of cell-type-specific gene
expression during development in B. subtilis. Nature 355: 601-604.

Magge, A, A. C. Granger, P. G. Wahome, B. Setlow, V. R Vepachedu, C. A Loshon, L.
Peng, D. Chen, Y. Q. Li & P. Setlow, (2008) Role of dipicolinic acid in the
germination, stability, and viability of spores of Bacillus subtilis. J Bacterial 190:
4798-4807.

Meisner, J ., X. Wang, M. Serrano, A. O. Henriques & C. P. Moran, Jr., (2008) A channel
connecting the mother cell and forespore during bacterial endospore formation.
Prac NatlAcadSci USA 105: 15100-15105.

Miller, J. H, (1972) Experiments in molecular genetics. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.

Min, K. T., C. M. Hilditch, B. Diederich, J. Errington & M. D. Yudkin, (1993) Sigma F,
the first compartment-specific transcription factor of B. subtilis, is regulated by an
anti-sigma factor that is also a protein kinase. Cell 74: 73 5-742.

Molle, V., M. Fujita, S. T. Jensen, P. Eichenberger, J. E. Gonzalez-Pastor, J. S. Liu & R
Losick, (2003a) The SpoOA regulon of Bacillus subtilis. Mal Microbial 50: 1683-
1701.

Molle, V., Y. Nakaura, R. P. Shivers, H. Yamaguchi, R. Losick, Y. Fujita & A. L.
Sonenshein, (2003b) Additional targets of the Bacillus subtilis global regulator
CodY identified by chromatin immunoprecipitation and genome-wide transcript
analysis. J Bacterial 185: 1911-1922.

Murray, H. & J. Errington, (2008) Dynamic control of the DNA replication initiation
protein DnaA by Soj/ParA Cell 135: 74-84.

Nugroho, F. A, H. Yamamoto, Y. Kobayashi & J. Sekiguchi, (1999) Characterization of
a new sigrna-K-dependent peptidoglycan hydrolase gene that plays a role in
Bacillus subtilis mother cell lysis. J Bacterial 181: 6230-6237.

Ozin, A. J., C. S. Sarnford, A O. Hemiques & C. P. Moran, Jr., (2001) SpoVID guides
SafA to the spore coat in Bacillus subtilis. J Bacterial 183: 3041-3049.

Pabo, C. O. & R. T. Sauer, (1992) Transcription factors: structural families and principles
of DNA recognition. Annu Rev Biochem 61: 1053-1095.

141

Paidhungat, M., K. Ragkousi & P. Setlow, (2001) Genetic requirements for induction of
germination of spores of Bacillus subtilis by Ca(2+)-dipicolinate. J Bacterial 183:
4886-4893.

Pan, Q., D. A Garsin & R Losick, (2001) Self-reinforcing activation of a cell-specific
transcription factor by proteolysis of an anti-sigma factor in B. subtilis. Mal Cell
8: 873 -883.

Partridge, S. R. & J. Errington, (1993) The importance of morphological events and
intercellular interactions in the regulation of prespore-specific gene expression
during sporulation in Bacillus subtilis. Mal Microbial 8: 945-955.

Perego, M., (1997) A peptide export-import control circuit modulating bacterial
development regulates protein phosphatases of the phosphorelay. Prac Natl Acad
Sci USA 94: 8612-8617.

Piggot, P. J. & J. G. Coote, (1976) Genetic aspects of bacterial endospore formation.
Bacterial Rev 40: 908-962.

Piggot, P. J. & D. W. Hilbert, (2004) Sporulation of Bacillus subtilis. Curr Opin
Microbial 7: 579-586.

Popham, D. L., M. E. Gilmore & P. Setlow, (1999) Roles of low-molecular-weight
penicillin-binding proteins in Bacillus subtilis spore peptidoglycan synthesis and
spore properties. J Bacterial 181: 126-132.

Price, K. D. & R Losick, (1999) A four-dimensional view of assembly of a
morphogenetic protein during sporulation in Bacillus subtilis. J Bacterial 181:
781-790. *

Ragkousi, K., P. Eichenberger, C. van Ooij & P. Setlow, (2003) Identification of a new
gene essential for germination of Bacillus subtilis spores with Ca2+-dipicolinate.
J Bacterial 185: 23 15-2329.

Ragkousi, K. & P. Setlow, (2004) Transglutaminase-mediated cross-linking of GerQ in
the coats of Bacillus subtilis spores. J Bacterial 186: 5567-5575.

Ramamurthi, K. S., S. Lecuyer, H. A Stone & R Losick, (2009) Geometric cue for
protein localization in a bacterium. Science 323: 1354-1357.

Ratnayake-Lecarnwasam, M., P. Serror, K. W. Wong & A. L. Sonenshein,'(2001)

Bacillus subtilis CodY represses early-stationary-phase genes by sensing GTP
levels. Genes Dev 15: 1093-1103.

142

Rouyard, J. F., H. Ionesco & P. Schaefier, (1967) [Genetic classification of certain
sporulation mutants of Bacillus subtilis, Marburg]. Ann Inst Pasteur (Paris) 113:
67 5-683.

Rudner, D. Z., P. Fawcett & R Losick, (1999) A family of membrane-embedded
metalloproteases involved in regulated proteolysis of membrane-associated
transcription factors. Prac Natl Acad Sci U SA 96: 14765-14770.

Rudner, D. Z. & R. Losick, (2002) A sporulation membrane protein tethers the pro-
sigmaK processing enzyme to its inhibitor and dictates its subcellular localization.
Genes Dev 16: 1007-1018.

Ryter, A, (1965) [Morphologic Study of the Sporulation of Bacillus Subtilis.]. Ann Inst
Pasteur (Paris) 108: 40-60.

Sacco, M., E. Ricca, R Losick & 8. Cutting, (1995) An additional GerE-controlled gene
encoding an abundant spore coat protein fi'om Bacillus subtilis. J Bacterial 17 7:
372-3 77.

Sam, M. D., D. Cascio, R. C. Johnson & R. T. Clubb, (2004) Crystal structure of the
excisionase-DNA complex from bacteriophage lambda. J Mal Biol 338: 229-240.

Sambrook, J., E. F. Fritsch & T. Maniatis, (1989) Molecular Cloning: A laboratory
Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Sato, T., K. Harada, Y. Ohta & Y. Kobayashi, (1994) Expression of the Bacillus subtilis
spoIVCA gene, which encodes a site-specific recombinase, depends on the
spoHGB product. J Bacterial 176: 935-937.

Schmidt, R, P. Margolis, L. Duncan, R. Coppolecchia, C. P. Moran, Jr. & R Losick,
(1990) Control of developmental transcription factor sigma F by sporulation
regulatory proteins SpoHAA and SpoHAB in Bacillus subtilis. Prac Natl Acad Sci
USA 87: 9221-9225.

Schuck, P. & P. Rossmanith, (2000) Determination of the sedimentation coefficient
distribution by least-squares boundary modeling. Biapalymers 54: 328-341.

Schumacher, M. A, K. Y. Choi, H. Zalkin & R G. Brennan, (1994) Crystal structure of
LacI member, PurR, bound to DNA: minor groove binding by alpha helices.
Science 266: 763-770.

Serrano, M., L. Corte, J. Opdyke, C. P. Moran, Jr. & A. O. Henriques, (2003) Expression

of spoIHJ in the prespore is sufficient for activation of sigma G and for
sporulation in Bacillus subtilis. J Bacterial 185: 3905-3917.

143

Serrano, M., A. Neves, C. M. Soares, C. P. Moran, Jr. & A O. Henriques, (2004) Role of
the anti-sigma factor SpoHAB in regulation of sigmaG during Bacillus subtilis
sporulation. J Bacterial 186: 4000-4013.

Serrano, M., F. Vreira, C. P. Moran, Jr. & A. O. Henriques, (2008)1Processing of a
membrane protein required for cell-to-cell signaling during endospore formation
in Bacillus subtilis. J Bacterial 190: 7786-7796.

Setlow, B., P. G. Wahome & P. Setlow, (2008) Release of small molecules during
germination of spores of Bacillus Species. J Bacterial 190: 4759-4763.

Setlow, P., (2003) Spore germination. Curr Opin Microbial 6: 550-556.

Sharp, M. D. & K. Pogliano, (1999) An in vivo membrane fusion assay implicates
SpoHIE in the final stages of engulfment during Bacillus subtilis sporulation.
Prac Natl Acad Sci USA 96: 14553-14558.

Sharp, M. D. & K. Pogliano, (2002) Role of cell-specific SpoIIIE assembly in polarity of
DNA transfer. Science 295: 137-139.

Silvaggi, J. M., J. B. Perkins & R Losick, (2006) Genes for small, noncoding RNAs
under sponrlation control in Bacillus subtilis. J Bacterial 188: 532-541.

Smith, T. J. & S. J. Foster, (1995) Characterization of the involvement of two
compensatory autolysins in mother cell lysis during sporulation of Bacillus
subtilis 168. J Bacterial 177: 3855-3862.

Steil, L., M. Serrano, A. O. Henriques & U. Volker, (2005) Genome-wide analysis of
temporally regulated and compartment-specific gene expression in sporulating
cells of Bacillus subtilis. Microbiology 151: 399-420.

Stevens, C. M. & J. Errington, (1990) Differential gene expression during sporulation in
Bacillus subtilis: structure and regulation of the spoIHD gene. Mal [Microbial 4:
543 -55 1 .

Stragier, P., C. Bonamy & C. Karmazyn—Campelli, (1988) Processing of a sporulation
sigma factor in Bacillus subtilis: how morphological structure could control gene
expression. Cell 52: 697-704.

Stragier, P., B. Kunkel, L. Kroos & R Losick, (1989) Chromosomal rearrangement
generating a composite gene for a developmental transcription factor. Science
243: 507-512.

Sun, D. X, R M. Cabrera-Martinez & P. Setlow, (1991) Control of transcription of the

Bacillus subtilis spoIHG gene, which codes for the forespore-specific
transcription factor sigma 'G. J Bacterial 173: 2977-2984.

144

Sun, Y. L., M. D. Sharp & K. Pogliano, (2000) A dispensable role for forespore-specific
gene expression in engulfment of the forespore during sporulation of Bacillus
subtilis. J Bacterial 182: 2919-2927.

Suzuki, S., Y. Izawa, K. Kobayashi, Y. Eto, S. Yamanaka, K. Kubota & K. Yokozeki,
(2000) Purification and characterization of novel transglutaminase fi'om Bacillus
subtilis spores. Biasci Biatechnal Biochem 64: 2344-2351.

Tatti, K. M., M. F. Shuler & C. P. Moran, Jr., (1995) Sequence-specific interactions
between promoter DNA and the RNA polymerase sigma factor B. JMalBi01253:
8-16.

Tovar-Rojo, F., M Chander, B. Setlow & P. Setlow, (2002) The products of the spoVA
operon are involved in dipicolinic acid uptake into developing spores of Bacillus
subtilis. J Bacterial 184: 584-587.

Trach, K. A & J. A Hoch, (1993) Multisensory activation of the phosphorelay initiating
sporulation in Bacillus subtilis: identification and sequence of the protein kinase
of the alternate pathway. Mal Microbial 8: 69-79.

Tullius, T., (1995) Homeodomains: together again for the first time. Structure 3: 1143-
1 145.

van Ooij, C. & R Losick, (2003) Subcellular localization of a small sponrlation protein in
Bacillus subtilis. J Bacterial 185: 1391-1398.

Vlamakis, H, C. Aguilar, R Losick & R Kolter, (2008) Control of cell fate by the
formation of an architecturally complex bacterial community. Genes Dev 22: 945-
953.

Wade, K. H., G. Schyns, J. A. Opdyke & C. P. Moran, Jr., (1999) A region of sigmaK
involved in promoter activation by GerE in Bacillus subtilis. J Bacterial 181:
4365-4373.

Wakeley, P., N. T. Hoa & S. Cutting, (2000a) BofC negatively regulates SpoIVB- ‘
mediated signalling in the Bacillus subtilis sigmaK-checkpoint. Mal Microbial 36:
1415-1424.

Wakeley, P. R, R Dorazi, N. T. Hoa, J. R Bowyer & S. M. Cutting, (2000b) Proteolysis
of SpoIVB is a critical determinant in signalling of Pro-sigmaK processing in
Bacillus subtilis. Mal Microbial 36: 1336-1348.

Wang, L., J. Perpich, A. Driks & L. Kroos, (2007a) Maintaining the transcription factor

SpoHH) level late during sporulation causes spore defects in Bacillus subtilis. 'J
Bacterial 189: 7302-7309.

145

Wang, L., J. Perpich, A. Driks & L. Kroos, (2007b) One perturbation of the mother cell
gene regulatory network suppresses the efi‘ects of another during sporulation of
Bacillus subtilis. J Bacterial 189: 8467-8473.

Wang, S. T., B. Setlow, E. M. Conlon, J. L. Lyon, D. Imamura, T. Sato, P. Setlow, R
Losick & P. Eichenberger, (2006) The forespore line of gene expression in
Bacillus subtilis. J Mol Biol 358: 16-3 7.

Wojciak, J. M., J. Iwahara & R T. Clubb, (2001) The Mu repressor-DNA complex
contains an immobilized ‘wing' within the minor groove. Nat Struct Biol 8: 84-90.

Wu, L. J. & J. Errington, (1998) Use of asymmetric cell division and SpoIIIE mutants to
probe chromosome orientation and organization in Bacillus subtilis. Mal
Microbial 27: 777-786.

Wu, L. J. & J. Enington, (2003) RacA and the Soj-SpoOJ system combine to effect polar
chromosome segregation in sporulating Bacillus subtilis. Mal Microbial 49: 1463-
1475.

Youngman, P., J. B. Perkins & R. Losick, (1984) Construction of a cloning site near one
end of Tn917 into which foreign DNA may be inserted without afl‘ecting
transposition in Bacillus subtilis or expression of the transposon-bome errn gene.
Plasmid 12: 1-9.

Yu, Y T. & L. ’ Kroos, (2000) Evidence that SpoIVFB is a novel type of membrane
metalloprotease governing intercompartrnental communication during Bacillus
subtilis sporulation. J Bacterial 182: 3305- 3309.

Zhang, B., R A. Daniel, J. Errington & L. Kroos, (1997) Bacillus subtilis SpoHID
protein binds to two sites in the spoVD promoter and represses transcription by
sigmaE RNA polymerase. J Bacterial 179: 972-975.

Zhang, B., A. Hofrneister & L. Kroos, (1998) The prosequence of pro-sigmaK promotes
membrane association and inhibits RNA polymerase core binding. J Bacterial
180: 2434-2441.

Zhang, B. & L. Kroos, (1997) A feedback 100p regulates the switch from one sigma
factor to the next in the cascade controlling Bacillus subtilis mother cell gene
expression. J Bacterial 179: 6138-6144.

Zhang, B., P. Struffr & L. Kroos, (1999) sigmaK can negatively regulate sigE expression
by two different mechanisms during sporulation of Bacillus subtilis. J Bacterial
181: 4081-4088.

Zhang, J ., P. C. Fitz-James & A. I. Aronson, (1993) Cloning and characterization of a

cluster of genes encoding polypeptides present in the insoluble fraction of the
spore coat of Bacillus subtilis. J Bacterial 175: 3757-3766.

146

Zhang, J ., H Ichikawa, R Halberg, L. Kroos & A. I. Aronson, (1994) Regulation of the

transcription of a cluster of Bacillus subtilis spore coat genes. J Mal Biol 240:
405-41 5.

Zheng, L., R Halberg, S. Roels, H. Ichikawa, L. Kroos & R. Losick, (1992) Sporulation
regulatory protein GerE from Bacillus subtilis binds to and can activate or repress

transcription from promoters for mother-cell-specific genes. J Mal Biol 226:
1037-1050.

Zheng, L. B., W. P. Donovan, P. C. Fitz-James & R Losick, (1988) Gene encoding a
morphogenic protein required in the assembly of the outer coat of the Bacillus
subtilis endospore. Genes Dev 2: 1047-1054.

Zheng, L. B. & R. Losick, (1990) Cascade regulation of spore coat gene expression in
Bacillus subtilis. J Mal Biol 212: 645-660.

Zhou, R & L. Kroos, (2004) BofA protein inhibits intramembrane proteolysis of pro- ‘
sigmaK in an intercompartrnental signaling pathway during Bacillus subtilis
sporulation. Prac Natl Acad Sci U S A 101: 6385-63 90.

Zhou, R & L. Kroos, (2005) Serine proteases from two cell types target different
components of a complex that governs regulated intramembrane proteolysis of
pro-sigmaK during Bacillus subtilis development. Mal Microbial 58: 83 5-846.

Zilhao, R, R Isticato, L. O. Martins, L. Steil, U. Volker, E. Ricca, C. P. Moran, Jr. & A.

O. Henriques, (2005) Assembly and function of a spore coat-associated
transglutaminase of Bacillus subtilis. J Bacterial 187 : 7753-7764.

147