4_

2a...» 131.7,. .. .. ‘ . ..
gtrfi Lunar. . d. ‘ .. ......mw.vmmma~ y. . , . .
n ,rrbuaflflhfir H. .045» ‘ , . ,
‘ . 9.. , f . .. . .. V .
. . . .uu... ‘
henna... 14%...“-
..

 

£12): .1!
tier-$33.; . .
J. x
q ., , . . ‘
01‘=:IQM,‘JV¢ .n. , . V .
. , K , ‘ . . It. It}? t
:- .4..S!.hn. g
. . , ....: ‘nwhhhshgg
. . g a I {I
.. "z... .§...u..
3.1!.”— Ilflgs t).
{3.5.3. .

.5:
Nwfinrx: a...
. is

$8-. :71»

{Amati .. .
.. .1. . .
3.51.3”. . A . .
.. . . . u {3.15.
vstg'D-:lo‘
J u»... wgilynil
13.23.55;
. , its:
a q :1..b.t..233.
ti ‘\7‘3%\dlu’"ofi\d¥\‘rv
r. . {Fist

:1. .. rig-x:
.Soafl \
.6 tvtz‘

.15.!
I It}...
1’.

, t. L... 2..

.. t 5.1.517:
L11; 1251!!
.9 I\. A

hut.

 

 

 

Ag‘i..l,l\1!.3 (
t. .Jatoaldnivll

 

 

 

,rv.. {lvsht ti 1%: T.).~I!’AJ 0,. ‘60 u.
5.. .«33m cmwmfiusadhuflfiafl mu:

«at

$ v‘
. I in no .2623
E.lr..?.s . A Li}, .2 a.

, ‘Ju

..r..mw.4t . ‘ . . V
Q4hm¥fi . A , . A .‘

:23! :t.

 

 

LIBRARY
Michigan State
University

C? b3

‘,\\
C)

 

This is to certify that the
thesis entitled

ROLE OF JAZ PROTEINS IN THE REGULATION OF
JASMONATE SIGNALING IN ARABIDOPSIS

presented by

Hoo Sun Chung

has been accepted towards fulfillment
of the requirements for the

PhD. degree in Biochemistry and Molecular
Biology

 

44 {A / ‘ m
M310} Professor’s Signature — " ‘1" ‘

Aug, 2‘43 7,000!

 

Date

MSU is an Affirmative Action/Equal Opportunity Employer

 

u---------:--------------.—--------—--------.----n-o--.---a---o--------------------n--.-—--

 

PLACE IN RETURN BOX to remove this checkout from your record.
. To AVOID FINES retum on or before date due.
i MAY BE RECALLED with earlier due date if requested.

 

 

. DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K:IProi/Aoc&Pres/CIRCIDateDue.indd

 

ROLE OF JAZ PROTEINS IN THE REGULATION OF JASMONAT E
SIGNALING IN ARABIDOPSIS

By

[-100 Sun Chung

A DISSERTATION

Submitted to
Michigan State University
In partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Biochemistry and Molecular Biology

2009

ABSTRACT

ROLE OF JAZ PROTEINS IN THE REGULATION OF JASMONATE SIGNALING
IN ARABIDOPSIS

By

Hoo Sun Chung

The plant hormone jasmonate (JA) regulates a wide range of growth, developmental, and
defense-related processes. Recently, JASMONATE ZIM-domain (JAZ) proteins were
identified as negative regulators of transcription factors that control the expression of JA-
response genes. Upon perception of bioactive JA derivatives by the F-box protein
CORONATINE INSENSITIVE 1 (C011), JAZ proteins are degraded via the
SCFCOH/ubiquitin/26S proteasome pathway, thereby relieving the restraint on JA-
response genes. A highly conserved “dergon” sequence, referred to as the Jas domain,
mediates the JA-dependent interaction of JAZ proteins with C01]. The broad aim of this
thesis research is to further understand the molecular mechanism by which J AZ proteins
regulate the IA signal transduction pathway. To address this objective, the effect of
wounding, insect herbivory, and cycloheximide on the expression level of Arabidopsis
JAZ genes was determined. The results showed that most JAZ genes are rapidly induced
by tissue damage, and that JAZs are primary response genes whose expression is
activated upon turnover of labile repressor proteins. Transgenic plants that overexpress a
truncated form of JAZl lacking the Jas domain were compromised in resistance to the

generalist herbivore Spodoptera exigua, suggesting a role for JAZ proteins in the

regulation of anti-insect defenses. It was also shown that the plant-specific ZIM domain
mediates JAZ homo-and heteromeric interactions, and that these interactions are essential
for the repressive function of JAZ. Molecular characterization of three JAZlO splice
variants showed that alternative splicing events affecting the Jas domain alter the in vivo
stability of JAZ proteins by modifying their ability to interact with SCFCO”. Comparative
analysis of JAZ genes from diverse plant species identified an evolutionarily conserved
intron whose retention during pre-mRNA splicing contributes to functional

diversification of J AZ proteins through altered protein stability.

ACKNOWLEDGEMENTS

There are many people to whom I wish to convey thanks and admiration towards in their
myriad of roles in shaping not only this dissertation but my academic career. First I
would like to thank Dr. Gregg Howe for providing the opportunity to join his lab, for
giving me a chance to work on the exciting project, for his inspiration and guidance, and
for his strong support throughout my career at Michigan State University. I sincerely
thank my committee members Dr. Christoph Benning, Dr. Sheng Yang He, Dr. Beronda
Mongomery-Kaguri, and Dr. Rob Larkin for their support, their criticisms and for the
opportunity to discuss issues throughout the course of this dissertation. I also like to

thank Dr. Brad Day for his critical comments on this thesis.

Thanks to all the present and past lab members who provided a stimulating
environment that supported open discussions, troubleshooting, and constant feedback on
projects throughout my Ph.D. Many thanks go out to Eliana for being an wonderful
company in the Howe lab girls’ room and Leron for all the joyful moments in the lab and
for initiating the JAZ study. Also thanks to Abe Koo, Lalita Patel, Yuki Yoshida,
Christine Shyu, Marco Herde, Javier Moreno, Jinho Kang who have all helped in one

way or another for my Ph.D study

Besides the people that have contributed directly to my research, there are many
people through the years that have helped me reach this point through their support and
encouragement. Thank you to my family, to my mom and dad who constantly supported

and loved me and who encouraged me through life to be my best.

iv

And now I would like to give my special thanks to my fiancee Woo Jun Sul who
has been supporting me for seven years including the last five years in Michigan. I could

not have accomplished this PhD. study without his continuous encouragement and love.

TABLE OF CONTENTS

LIST OF TABLES ................................................................................ viii
LIST OF FIGURES ................................................................................ ix
CHAPTER 1: LITERATURE REVIEW ...................................................... l
l. BIOLOGICAL ROLE OF JASMONATE .................................................... 2
1.1. Defense against insect herbivores ...................................................... 2

1.2. Defense against necrotrophic pathogens ............................................... 4

1.3. Plant growth and development ........................................................ 5

2. BIOSYNTHESIS OF JA ....................................................................... 7
2.1. The octadecanoid pathway for JA synthesis ......................................... 7

2.2. JA metabolism ........................................................................... 8

2.3. Coronatine is a structural mimic of JA-Ile ......................................... 10

2.4. Regulation of IA biosynthesis ........................................................ lO

3. REGULATORY COMPONENTS OF THE JA SIGNALING PATHWAY .......... 12
3.1. The F-box protein, COIl ............................................................. 12

3.2. JAZ repressor proteins ................................................................. 13

3.2.1. Discovery of JAZ genes ..................................................... 14

3.2.2. The ZIM domain ........................................................... 15

3.2.3. The Jas domain ............................................................. 16

3.2.4. Functional diversification of JAZ proteins by alternative splicing. 19

3.3. (3R,7S)-JA-Ile is the active stereoisomer of JA-Ile ............................... 21

3.4. MYC2 is a JAZ-interacting transcription factor .................................. 22
CURRENT MODEL OF JA SIGNALING ................................................... 25
AIM OF THIS STUDY .......................................................................... 26
FIGURES AND TABLES .................................................................... 28
REFERENCES ..................................................................................... 36

CHAPTER 2: REGULATION AND FUNCTION OF ARABIDOPSIS
JASMONA TE ZIM-DOMAIN GENES IN RESPONSE TO WOUNDING AND

HERBIVORY ....................................................................................... 49
ABSTRACT ....................................................................................... 50
INTRODUCTION ................................................................................ 5 1
RESULTS .......................................................................................... 55
DISCUSSION ..................................................................................... 63
MATERIALS AND METHODS ................................................................ 72
FIGURES AND TABLES ..................................................................... 77

CHAPTER 3: A CRITICAL ROLE OF TIF Y MOTIF IN REPRESSION OF

JASMONATE SIGNALING BY A STABLE SPLICE VARIANT OF JAZ10 ....... 98
ABSTRACT ....................................................................................... 99
INTRODUCTION ............................................................................... 1 00

vi

RESULTS ........................................................................................ 104

DISCUSSION .................................................................................... 1 15
MATERIALS AND METHODS ............................................................. 121
FIGURES AND TABLES ..................................................................... 127
REFERENCE .................................................................................... 148
CHAPTER 4: ROLE OF THE JAS INTRON IN FUNCTIONAL
DIVERSIFICATION OF JAZ PROTEINS ................................................. 154
ABSTRACT ..................................................................................... 155
INTRODUCTION .............................................................................. 1 56
RESULTS ........................................................................................ 160
DISCUSSION .................................................................................... 166
MATERIALS AND METHODS ............................................................. 172
FIGURES AND TABLES ...................................................................... 176
REFERENCES .............................................................................. 194
CHAPTER 5: SUMMARY AND FUTURE PERSPECTIVES ......................... 200

vii

LIST OF TABLES
Table 1.1. The TIFY family in Arabidopsis. .................................................. 35

Supplemental Table 2.1. JAZ genes are co-expressed with JA biosynthetic genes. ....87

Supplemental Table 2. 2. Forward (F) and reverse (R) primers and the corresponding

sizes of the RT-PCR products used in this study. ............................................ 89
Table 3.1. Summary of JAZ-JAZ interactions in yeast. ................................... 139
Supplemental Table 3.1. List of constructs and primers used in this study. ............. 144

Table 4.1. Identification of JAZ genes and the conserved Jas intron in various plant

species. ............................................................................................ 188
Supplemental Table 4.1. List of JAZ proteins identified in various species. ........... 189
Supplemental Table 4.2 List of primers used in this study. ............................ 193

viii

LIST OF FIGURES

Figure 1.1. The jasmonate biosynthetic pathway in Arabidopsis. .......................... 28
Figure 1.2. Chemical structure of JA-Ile diastereomers and coronatine. 30
Figure 1.3. The TIFY protein family in Arabidopsis. ....................................... 31
Figure 1.4. Sequence similarity between the Jas and CCT domains. ...................... 33
Figure 1.5. Current model of jasmonate signaling. ........................................... 34

Figure 2.1. Expression of JAZ genes in response to herbivore feeding and mechanical
wounding ............................................................................................. 77

Figure 2.2. Effect of the coil-1 mutation on wound-induced expressionofJAZs. ....... 79

Figure 2.3. Rapid induction of JAZ transcripts and accumulation of JAs in response to
mechanical wounding. ........................................................................... 80

Figure 2.4. Wound-induced expression of JA-responsive genes in the jarl-l mutant. ..82
Figure 2.5. Effect of cycloheximide treatment on JA-responsive genes. .................. 83
Figure 2.6. coil-1 plants are deficient in wound-induced accumulation of JA. ..........84
Figure 2.7 JAZIA3A plants are compromised in resistance to feeding by S. ex'igua. ...85

Supplemental Figure 2.1. Phylogenetic tree of Arabidopsis JAZ family. ................ 86

Figure 3.1. Homo- and heteromeric interaction of Arabidopsis JAZ proteins. ......... 127

Figure 3.2. Requirement for the TIFY motif in homo- and heteromeric interaction of J AZ
proteins. .......................................................................................... 128

Figure 3.3. Identification of three JAZIO variants produced by alternative splicing. ..129

Figure 3.4. Protein-protein interaction characteristics of JAZIO isoforms. ............. 130
Figure 3.5. Subcellular localization of JAZIO splice variants. ............................. 132
Figure 3.6. Overexpression of J AZIO splice variants differentially affects JA responses.
....................................................................................................... 133
Figure 3.7. Stability of JAZIO splice variants in viva. ...................................... 134

Figure 3.8. The TIFY motif is required for repression of JA responses by JAZIO.4. ..135

ix

Figure 3.9. The 1107A mutation does not affect the accumulation or localization of
JAZIO.4. ........................................................................................... 137

Supplemental Figure 3.1. Immunoblot analysis of wild-type and mutant forms of JAZ3
and JAZIO.1. ..................................................................................... 140

Supplemental Figure 3.2. Yeast two-hybrid analysis of homo- and heteromeric
interactions between Arabidopsis ZIM, ZIM-like] (ZMLl), and ZIM-like2 (ZML2)
proteins. ........................................................................................... 141

Supplemental Figure 3.3. Detection of transcripts encoding JAZIO.3 and JAZIO.4 using
transcript-specific primers. ..................................................................... 142

Supplemental Figure 3.4. Yeast two-hybrid analysis of the effect of 1107A and G11 1A
TIFY mutations on the interaction of J AZlO.4 with other members of the JAZ family.143

Figure 4.1. Structural organization of Arabidopsis JAZ genes. ........................... 176

Figure 4.2. Retention of the Jas intron during pre-mRNA splicing is predicted to alter the
Jas domain. ....................................................................................... 177

Figure 4.3. PCR-based detection of Jas intron retention in various JAZ transcripts. ..178
Figure 4.4. Differential ligand-dependent interaction of JAZ proteins with COIl. ..... 179

Figure 4.5. Overexpression of JAZIO genomic DNA attenuates JA signaling in
Arabidopsis. ...................................................................................... 180

Figure 4.6. Phylogenetic tree of JAZ proteins from higher and lower in land plants. ..181

Supplemental Figure 4.1. Amino acid sequence alignment of Arabidopsis .JAZS and
JAZ6. .............................................................................................. 183

Supplemental Figure 4.2. Western blot analysis of JAZ proteins expressed in the yeast
strains used for the Y2H experiment shown in Figure 4.4A. ............................... 184

Supplemental Figure 4.3. Amino acid sequence alignment of the ZIM and Jas domains
of JAZ proteins from various land plants. ................................................... 185

Supplemental Figure 4.4. Structural organization of selected JAZ genes in subclade A.
....................................................................................................... 187

CHAPTER 1: LITERATURE REVIEW

l. BIOLOGICAL ROLE OF JASMONATE

Jasmonate (JA) was first identified as a volatile fragrance from the jasmine flower and
has been used as a scent in many commercial products. In plants, however, JA and its
bioactive derivatives are signaling compounds that regulate diverse aspects of plant
growth and development. Mutants that are deficient in JA synthesis and signaling have
provided powerful tools to identify the many roles of jasmonate in various plant

processes.

1.1. Defense against insect herbivores

Among various plant processes regulated by JA, defense responses against insect
herbivores are among the most extensively explored area. In contrast to other plant
responses involving complex crosstalk between several hormone pathways (Koornneef
and Pieterse, 2008), numerous studies by independent research groups suggest that defense
responses against insect herbivores is largely dependent on the IA pathway (Howe and
lander, 2008). JA—mediated defenses provide effective protection against a wide range of
arthropod herbivores, including caterpillars (Lepidoptera), beetles (Coleoptera), thrips
(Thysanoptera), leaflioppers (Homoptera), spidermites (Acari), and fungal gnats (Diptera)
(Browse and Howe, 2008).

I Mutants in Arabidopsis and other plants (e.g., tomato) that are defective in IA
perception and synthesis have demonstrated JA’s key role in plant resistance to
herbivores. Coronatine insensitive 1 (coil) mutants that are defective in JA perception
are impaired in all jasmonate responses and, as a consequence, are highly susceptible to

herbivore attack (Stintzi et al., 2001; Mewis et al., 2005; Reymond et al., 2004; Zarate et

al., 2007). Similarly, constitutive expression of truncated JASMONATE ZIM-DOMAIN
(JAZ) proteins (see below) confers strong JA insensitive phenotypes, including
compromised plant resistance against the lepidopteron herbivore Spodoptera. exigua
(Chung et al., 2008). The JA synthetic mutant acyl—coA oxidase I/acyl-coA oxidase 5
acxIacx5, which is impaired in a peroxisomal B-oxidation step of IA synthesis, is
susceptible to the lepidopteran insect Trichoplusia. ni, suggesting a strict requirement for
JA synthesis in defense against herbivores (Schilmiller et al., 2007). An intermediate
product in octadecanoid pathway for JA synthesis, 12-oxo-phytodienoic acid (OPDA),
was also reported to have a role in anti-insect defense responses (Stintzi et al., 2001).
However, current studies provide evidence that the OPDA signaling pathway is distinct
from the IA signaling pathway (Taki et al., 2005; Thines et al., 2007; Ribot et al., 2008).
Most herbivorous chewing insects activate JA synthesis and subsequent large-
scale reprogramming of defense gene expression (De Vos et al., 2005; Devoto et al.,
2005; Reymond et al., 2000, 2004). Reymond et al. (2004) reported that transcriptional
changes induced in Arabidopsis leaves by the crucifer specialist (Pieris. rapae) and the
generalist (Spodoptera. littoralis) are nearly identical, suggesting that different
lepidopteran insects activate the IA pathway in a similar way. Among the JA-regulated
genes induced by insect attack are those encoding defense proteins that directly affect
insect performance (e.g., cysteine protease that disrupts the membrane of insect gut),
enzymes involved in the synthesis of glucosinolates that are toxic secondary metabolite to
insects, and JA biosynthetic enzymes that positively regulate the JA response (Stenzel et
al., 2003; Konono et al., 2004; Mewis et al., 2005, 2006; Zhang et al., 2006; Mohan et al.,

2006; Wasternack, 2007). Interestingly, phloem-feeding insects such as the whitefly

Bemisia tabaci appear to avoid JA-regulated defenses by minimizing tissue damage

(Zarate et al., 2008).

1.2. Defense against necrotrophic pathogens

Plant defense against bacterial pathogens involves several hormone signaling pathways,
including salicylic acid (SA), abscisic acid (ABA), ethylene (ET), etc (Grant and Jones,
2009). However, plant resistance to necrotrophic pathogens, such as Alternaria
brassicicola and Botrytis cinerea, depends on the IA signaling pathway and on the
production of camalexin (Glazebrook, 2005). Camalexin is an antimicrobial compound
(Le, a phytoalexin) that is synthesized by the cytochrome P450 monoxygenase
CYP7 IBIS, PHYTOALEXIN DEFICIENT 3 (PAD3). Susceptibility of pad3 is reduced
by exogenous JA, further suggesting that JA signaling is required for plant resistance
(Thomma et al., 1998).

Several independent lines of evidence have established a critical role for JA in
plant defense against nectotrophic pathogens. The observation that mutations in the C011
locus, lead to enhanced susceptibility indicates that perception of a JA signal is required
for resistance (Thomma et al., 1998). Furthermore, pathogen-induced expression of
BOT RYT IS SUSCEPTIBLE 1 (8081), which encodes an R2R3 Myb transcription factor,
is dependent on COIl (Mengiste et al., 2003). The bosl mutation compromises resistance
of Arabidopsis to both A. brassicicola and B. cinerea (Mengiste et al., 2003; Veronese et
al., 2004). Mutations in JASMONA TE RESISTANT 1 (JARI), which encode the enzyme

catalyzing the final step in the production of JA-Ile (conjugation of IA to Isoleucine by

adenylation) (see below), also compromises plant resistance to B. cinerea, indicating that
a JA signal is necessary for the pathogen resistance response (Ferrari et al., 2003).

The JA and ET signaling pathways serve antagonistic roles in plant resistance to
B. cinerea. MYC2/JA-INSENSITIVE1 (JINl) is a basic helix-loop-helix (bHLH)
transcription factor that differentially regulates two branches of the IA signaling pathway
in a COIl-dependent manner (Lorenzo et al., 2004). MYC2 positively regulates the
expression of wound-response genes, but negatively regulates genes involved in pathogen
responses, including PLANT DEFENSIN 1.2 (PDF1.2) gene and several
PA THOGENESIS RELATED (PR) genes (Lorenzo et al., 2004). As a consequence, jin]
mutant plants are more resistant to B. cinerea, supporting the idea that MYC2 negatively
regulates pathogen responses (Lorenzo et al., 2004). Overexpression of the ETHYLENE
RESPONSE FACTOR] (ERFI) transcription factor, which regulates the two branches of
the JA pathway in a manner opposite to that of MYC2, enhances resistance to B. cinerea
(Berrocal-Lobo et al., 2002; Lorenzo et al., 2003, 2004). Furthermore, disruption of the
ET pathway by ethylene insensitive 2 (ein2) results in increased susceptibility to B.
cinerea (Ferrari et al., 2003; Thomma et al., 1999a). These results exemplify the
complexity by which different hormone signaling pathways are integrated for plant

defense responses against pathogen attack.

1.3. Plant growth and development
In addition to its essential role in plant defense responses, JA is also involved in a wide
range of plant growth and developmental processes. Historically, one of the first-

described biological effects of 1A was its senescence-promoting properties (Ueda and

Kato, 1980). Subsequent studies showed that exogenous JA induces senescence of
Arabidopsis leaves in a COIl-dependent manner (He et al., 2002). This study employed
gene expression analysis to provide additional evidence for a role of JA in senescencing
leaves. The results showed that leaf senescence is accompanied by increased levels of J A
and induction of JA-response genes. Among the induced genes were JA-biosynthetic
genes and SENESCENCE ASSOCIATED GENES (SAGs), including those involved in
photosynthesis and defense responses. JA and wounding up-regulate SAGs in defense
responses is and dbwn-regulate house-keeping genes (Wastemack and Hause, 2002;
Wastemack, 2007).

Root growth inhibition is another well-defined physiological effect of 1A
treatment (Dathe et al., 1981). Addition of picomolar amounts of JA or its methyl ester,
methyl-1A (MeJA), to the growth medium effectively inhibits root elongation (Staswick
et al., 1992). Because of the facile nature of this assay, JA-induced root growth inhibition
has been commonly used in many forward genetic screens for mutants that are impaired
in IA signaling. Examples of JA-insensitive mutants isolated in this manner include coil
(Xie et al., 1998) and myc2/jin1 (Lorenzo et al., 2004). The constitutive expression of
VSPI (cev1), constitutive expression of JA-response genes 1 (cexl), constitutive
expression of Thi mutants (cet), and bestatin resistant mutants (ber) exhibit constitutive
JA signaling and thus have roots that are shorter than wild type plants (Hilpert et al.,
2001; Xu et al., 2001; Ellis et al., 2002; Zheng et al., 2006).

The effect of JA on growth inhibition is not restricted to roots but rather extends
to above-ground tissues as well, indicting that the hormone has a general role in

negatively regulating plant growth. An inhibitory effect of MeJA on cell division and

specific phases of the cell cycle has been demonstrated (Saniewski, 1988; Swiatek et al.,
2002). More recently, Yan et a1. (2007) and Zhang et a1. (2008) reported convincing
genetic evidence showing that the IA signaling pathway is involved in wound-induced
inhibition of plant growth.

Flower development relies on the plant’s ability to synthesize and perceive JA.
Several Arabidopsis mutants that are defective in IA biosynthesis (Fig. 1.1), as well as
the mutants such as coil that are impaired in JA signaling, are male sterile as a result of
defects in anther dehiscence and filament elongation (Feys et al., 1994; McConn and
Browse, 1996; Ishiguro et al., 2001; Park et al., 2002; von Malek et al., 2002; Sanders et
al., 2000; Stinizi and Browse, 2000). Exogenous JA complements the male sterile
phenotype of all JA synthetic mutants, indicating that JA or a derivative of IA directly
regulates this developmental program in Arabidopsis (Browse, 2009). Recent studies in
maize further indicate that JA is an essential signal in determining male identity (Acosta
et al., 2009). It is interesting to note that the C011 homolog in tomato is essential for
female fertility, suggesting that the hormone exerts species-specific effects on plant
reproductive development (Li et al., 2004). Other developmental processes controlled by
JA include trichome patterning (Yoshida et al., 2009) and shade avoidance responses

(Moreno et al., 2009).

2. BIOSYNTHESIS OF JA
2.1. The octadecanoid pathway for JA synthesis
The octadecanoid pathway for JA biosynthesis is initiated in the chloroplast and

completed in the peroxisome (Figure 1.1.). Many enzymes and corresponding genes

involved in JA biosynthesis have been identified by forward and reverse genetic screens
(Wastemack, 2007). Subcellular localization studies have confirmed the intracellular
compartmentation of the various pathway enzymes. The first step of IA biosynthesis is
initiated by a chloroplastic lipase that releases linolenic acid (18:3) from membrane lipids
(Ishiguro et al., 2001; Hyun et al., 2008). The released linolenic acid is converted by a
l3-lipoxygenase to l3-hydroxyperoxylinolenic acid (l3-HPOT), which is then
metabolized to lZ-oxo-phytodienoic acid (OPDA) by the sequential action of allene
oxide synthase (AOS) and allene oxide cyclase (AOC) (Vick and Zimmerman, 1987; Lee
et al., 2008; Ziegler et al., 2000). Although it is unclear how OPDA is transported to the
peroxisome, several studies have implicated the ATP-binding cassette transporter PXAl
in this transport process (Theodoulou et al., 2005; Footitt et al., 2007). The peroxisomal
enzyme OPDA reductase3 (OPR3) reduces OPDA to 3-oxo-2(2’ [Z]-pentenyl)-
cyclopentane-l-octanoic acid (OPC-8:0), which is then activated by the carboxyl CoA
ligase, OPCLl (Sanders et al., 2000; Schaller et al., 2000; Stintzi and Browse, 2000; Koo
et al., 2006). Three cycles of B-oxidation in the peroxisome ultimately complete
production of the (3R,7S) stereoisomer of .IA (Fig. 1.1) (Vick and Zimmerman, 1984; Li

et al., 2005; Schilmiler et al., 2007).

2.2. JA metabolism

Newly synthesized JA can be further metabolized in various ways, including: 1)
methylation by JA methyl transferase (JMT) to yield MeJA; 2) decarboxylation to cis-
jasmone (Koch et al., 1997); 3) reduction of the keto group in the cyclopentanone ring to

yield cucurbic acid (Sembdner and Parthier, 1993); 4); hydroxylation of the C11 or C12

 

position to produce derivatives that are subsequently modified by glycosylation
(Sembdner and Parthier, 1993; Swiatek et al., 2004) or sulfation (Gidda et al., 2003); and
5) JARl-mediated conjugation to amino acids, including the ethylene precursor l-
aminocyclopropane-l-carboxylic acid (ACC), to the corresponding JA-amino acid
conjugates (Staswick and Tiryaki, 2004).

Of particular importance to the mechanism of JA signaling is conjugation of 1A to
isoleucine to produce JA-Ile. This reaction is catalyzed by JARl, and likely by other
members of the large acyl-activating family of enzymes (Staswick and Tiryaki, 2004).
JA-Ile is the most abundant naturally occurring JA-amino acid conjugates in Arabidopsis
leaves (Staswick and Tiryaki, 2004; Suza and Staswick, 2008; Koo et al., 2009). Genetic
and biochemical analysis of the jar] mutant has shown that JA-lle synthesis is essential
for plant defense responses against soil pathogens, lepidopteran insects, and various
abiotic stresses as well (Staswick et al., 1998; Rao et al., 2000; Kang et al., 2006). The
level of JA-Ile in jar] mutant plants is ~15-fold lower than that in wild type, indicating
that JA-Ile synthesis by JARl is essential for activation of JA signaling (Suza and
Staswick, 2008). Consistent with this interpretation, JA signaling defects in jar] plants
can be complemented with exogenous JA-Ile (Staswick and Tiryaki, 2004).

Endogenous levels of J A-Ile rapidly increase in response to mechanical wounding
(Chung et al., 2008; Glauser et al., 2008). This response is tightly correlated with
transcriptional induction of early JA-response genes (e.g., JAZs). The wound-induced
expression pattern of JA-response genes in jar] leaves is very similar to the wild-type

response, suggesting that the amount of JA-Ile produced in jar] is sufficient for

activation of expression (Chung et al., 2008). This observation, together with the fact that

jar] plants are fertile, indicates that JARl is not required for all jasmonate responses.

2.3. Coronatine is a structural mimic of JA-Ile

Coronatine is a phytotoxin produced by several plant pathogenic strains of Pseudomonas
syringae (Bender et al., 1999). Coronatine and JA induce very similar effects when
applied to plant tissues (Feys et al., 1994; Uppalapati et al., 2005). A wealth of genetic,
molecular, and physiological data support the hypothesis that coronatine exerts its
virulence effects by activating the JA signaling pathway, which subsequently suppresses
the SA signaling pathway normally responsible for host immunity to P. syringae (Feys et
al., 1994; Zhao et al., 2003; Uppalapati et al., 2005; Nomura et al., 2005; Melotto et al.,
2008a). More recent work suggests that coronatine also facilitates bacterial entry into
host plants by inducing stomatal opening (Melotto et al., 2008b). Coronatine action, like
that of IA, depends on COIl. Indeed, JA-insensitive coil mutants of Arabidopsis were
isolated in a screen for plants that are resistant to coronatine (Feys et al., 1994). The
structure of coronatine supports the current view that this bacterial toxin is a structural

and functional mimic of (3R,7S)-JA-Ile (Figure 1.2; see below).

2.4. Regulation of JA biosynthesis

1A biosynthesis is regulated by a positive feedback mechanism. Most genes encoding JA
biosynthetic enzymes, including LOX2, LOX3, AOS, AOCX, OPR3, and OPCLl, are
induced via the JA/COIl pathway in response to JA treatment or stress conditions (e.g.,

wounding) that activate JA synthesis (Reymond et al., 2000; Sasaki et al., 2001; Stenzel

IO

et al., 2003; Devoto and Turner, 2005; Koo et al., 2006; Chung et al., 2008). Many JA
biosynthetic genes are also highly induced in response to treatment with the translation
inhibitor cycloheximide (Chung etal., 2008). Thus, JA-induced expression of these genes
biosynthetic genes does not require de novo synthesis of transcription factors or other
regulatory components, but rather is likely to involve JA-induced removal of a labile
repressor.

Genetic analysis in Arabidopsis has provided additional evidence for positive
feedback regulation of IA biosynthesis. The mutant cevl constitutively overproduces JA
and exhibits constitutive expression of A 0C and other JA-response genes (Ellis et al.,
2002. The cetl and cet3 mutants also produce elevated levels of OPDA and JA, which is
associated with constitutive activation of JA signaling (Hilpert et al., 2001). Conversely,
decreased levels in the expression of IA biosynthetic genes in mutants that are deficient
in JA synthesis or perception also supports the existence of a positive feedback loop for
regulating JA synthesis (Stintzi et al., 2001; Stenzel etal., 2003; Chung et al., 2008).

Several lines of evidence indicate that JA biosynthesis is limited by substrate
availability rather than by induced expression of biosynthetic genes. For example,
constitutive expression of 1A biosynthetic enzymes does not lead elevated production of
J A in the absence of wounding or other inductive cues (Laudert et al., 2000; Stenzel et al.,
2003). It has also been observed that coil mutants are deficient in wound-induced JA
production (Chung et al., 2008; Glauser et al., 2008; Paschold et al., 2008). This
observation may be explained by the fact that coil mutant plants contain lower levels of
OPDA and other JA biosynthetic precursors (Buseman et al., 2006; Kourtchenko et al.,

2007).

ll

 

3. REGULATORY COMPONENTS OF THE JA SIGNALING PATHWAY
3.1. The F-box protein COIl
Like other phytohormones, identification of mutants that are defective in IA perception
provides essential clues to understand the molecular mechanism of J A signal transduction.
The Arabidopsis coil mutant that was isolated in a forward genetic screen to identify
mutations that confer resistance to coronatine-inhibited root elongation, are impaired in
every aspect of J A responses indicating C011 is an essential component for mediating J A
signal (Feys et al., 1994; Browse, 2009). Map-based cloning experiments revealed that
C011 encodes an F-box protein, which is a component of the E3-type of ubiquitin ligase
known as the SCF (Skp/Cullin/F-box) complex (Xie et al., 1998). F-box proteins impart
specificity to the SCF complex by recognizing a specific substrate (typically a regulatory
protein), which is then ubiquitinated and subsequently degraded by the 26S proteasome
(Moon et al., 2004). Identification of C01] as an F-box protein, together with strong JA-
insensitive phenotypes of coil mutants, suggested that protein degradation via
ubiquitin/26S proteasome pathway is a critical step in the IA signaling cascade (Xie et al.,
1994). Biochemical studies demonstrated the association of COIl with the ASKl/Z,
CULl, and RBXl components of the SCFC011 complex (Xu et al., 2002). It was also
shown that mutations in the genes encoding these and other components of the SCFCOIl
complex impair plant responses to JA (Devoto et al., 2002; Xu et al., 2002; Gray et al.,
2003; Lorenzo and Solano, 2005; Ren et al., 2005).

The ubiquitin/26S proteasome pathway plays a central role in the mechanism of

action of many plant hormones (Santner and Estelle, 2009). In the same year that C011

12

was identified, the F-box protein component of the auxin signaling pathway,
TRANSPORT INHIBITOR RESPONSE 1 (TIRI), was cloned and subsequently shown
to function as an auxin receptor (Ruegger et al., 1998; Dharmarsiri et al., 2005; Kepinski
and Leyser, 2005; Tan etal., 2007). This work led to a model for auxin response in which
binding of auxin to TIRl induces recruitment of Aux/1AA repressor proteins to SCFTIRI.
Ubiquitin-medaited degradation of the Aux/1AA substrate allows pre-existing ARF
transcription factors to promote expression of early auxin response genes (Dharmasiri
and Estelle, 2004). Sequence similarity beyween C011 and TIRl led to the hypothesis
that JA signaling may involve SCFCOH/26S proteasome-mediated degradation of proteins
that repress expression of early JA-response genes. Testing of this hypothesis required

knowledge of the SCFCO” substrates, which were not discovered until 2007. .

3.2. JAZ repressor proteins

3.2.1. Discovery of JAZ genes

Extensive genetic screening and searches for C011-interacting partners failed to identify
targets of SCF C0”. These key components of the J A signaling were finally discovered by
transcriptional profiling experiments aimed at identifying JA-response genes in
Arabidopsis stamens (Thines et al., 2007). Among 31 genes showing rapid induction afier
JA treatment, 7 of them were found to encode ZIM-domain containing proteins with
unknown functions. Based on sequence similarity, 5 additional genes encoding ZIM
domain-containing proteins were identified in the Arabidopsis genome. These twelve
genes were designated as JASMONA TE ZIM-DOMAIN (JAZ) genes (Thines et al., 2007;

Chini et al., 2007). As described below and throughout this thesis, the discovery of JAZ

l3

proteins has greatly improved our understanding on molecular mechanism of JA
signaling.

The term ZIM is derived from an Arabidopsis gene (At4g24470) named Zinc-
finger protein expressed in Inflorescence Meristem (N ishi et al., 2000). ZIM and ZIM-like
(ZML) genes encode putative transcription factors that contain a C-terminal GATA-type
zinc-finger domain presumably involved in DNA binding, a CCT (CONSTANS/CO-
like/T 0C1) domain implicated in protein-protein interaction (Robson et al., 2001), and a
novel ~36-amino-acid sequence motif located near the N-terminus (Shikata et al., 2004).
Pfam (http://pfam.sanger.ac.uk/) and InterPro (http://www.ebi.ac.uk/Databases/)
databases annotated the latter conserved sequence as a plant-specific domain called ZIM,
after the founding member (At4g24470) in which the sequence motif was described.
Database searches show that the ZIM domain is present in many plant proteins, including
J AZ and PEAPOD (PPD) proteins, which lack a GATA-type zinc—finger or any other
recognizable DNA binding motif. Use of the term ZIM to describe both the transcription
factor encoded by At4g24470 and the ZIM domain has led to the inclusion of JAZ and
PPD proteins in various plant transcription factor databases (Guo et al., 2005; Rushton et
al., 2008; Riano-Pachon et al., 2007). Available evidence indicates that JAZs exert their
effects on gene expression through physical interaction with DNA binding-type
transcription factors in the nucleus (Chini et al., 2007; Thines et al., 2007; Yan et al.,
2007; Browse, 2009). These considerations prompted Vanholm et a1. (2007) to rename
the family as TIFY, a term that reflects the ZIM domain’s most highly conserved

TIFYXG motif (Figure 1.3.B).

l4

Sequences encoding TIFY proteins are found in higher and lower (i.e., moss)
plants but not in green algae or non-photosynthetic eukaryotes (Vanholme et al., 2007;
Katsir et al., 2008a; Chico et al., 2008). In Arabidopsis, TIFY proteins are encoded by 18
genes (Table 1.1 and Figure 1.3.A). Family members can be classified into two major
subgroups depending on the presence or absence of the GATA-type zinc finger domain
(Vanholme et al., 2007). Based on existing knowledge of member function, phylogeny,
and domain architecture, family members may also be distinguished according to whether
they contain a CTT domain (3 ZIM/ZMLs) or a divergent CCT domain (see below)
previously referred to as Domain 3 (Thines et al., 2007) or the C-terminal (CT) domain
(Chini et al., 2007), but now referred to as the Jas domain (Browse, 2008; Yan et al.,
2007). Arabidopsis proteins containing the Jas domain or slight variations of this motif
include 12 JAZ and 2 PPD proteins (Figure 1.3.A). The protein encoded by At4g32570 is

unique in that it contains a ZIM domain but lacks a recognizable CCT or J as motif.

3.2.2. The ZIM domain

Conservation of the ZIM domain in JAZ, PPD and ZIM/ZML proteins suggests that this
sequence serves an important role in regulating gene expression during plant growth and
development. Until recently, however, a molecular function for the ZIM domain had not
been described for any member of the family. Yeast two-hybrid and bimolecular
fluorescence complementation assays showed that JAZ proteins have the capacity to
homodimerize (Table 1.1) (Chung and Howe, 2009; Chini et al., 2009). These studies
also revealed a network of JAZ-JAZ heteromeric interactions. JAZ-JAZ partnering may

provide combinatorial diversity that modulates the specificity or strength of J A responses.

15

Systematic analysis of truncated JAZ proteins, together with site-directed mutagenesis of
the conserved TIFYxG motif, showed that the ZIM domain is necessary and sufficient for
JAZ-JAZ interaction. The ability of ZIM and ZIM-like (ZML) proteins to homo- and
heterodimerize in yeast indicates that protein-protein interaction involving the ZIM
domain extends to other members of the TIFY family (Chung and Howe, 2009). This
observation raises the posSibility that JAZ proteins functionally interact with PPD and
ZIM/ZML proteins.

A physiological role for the ZIM domain in IA signaling was established by
experiments showing that the strong lA-insensitive phenotype of JAZIO.4-
overexpressing plants is suppressed by point mutations within the TIFY motif that block
JAZlO.4 interaction with other JAZs (Chung and Howe, 2009). The dominant negative
action of JAZIO.4 therefore depends on ZIM domain-mediated interaction with another
TIFY protein, possibly JAZlO.4 itself. The ability of dimerization-defective forms of
JAZIO.4 to accumulate in the nucleus argues against the possibility that JAZ-JAZ
interaction is required for nuclear import of the repressor. The importance of the ZIM
domain for JAZlO.4-mediated repression of IA signaling provides new insight into the

mechanism by which J AZ proteins negatively regulate the J A pathway.

3.2.3. The Jas domain

A distinguishing feature of JAZ proteins is the 27-amino-acid Jas domain located near the
C-terminus (Figure 1.3.C). Interestingly, this sequence is similar to the N-terminal
portion of the CCT domain that was first identified in the plant proteins TOCl and

CONSTANS (CO) (Strayer et al., 2000; Robson et al., 2001) (Figure 1.4.). Based on this

16

similarity, the Jas domain is described in the Pfam database as a divergent CCT motif
called CCT2 (PF09425). CONSTANS and other CCT domain-containing proteins have a
well-established role in regulating plant responses to light, temperature, and the circadian
clock. Although the C-terminal portion of the CCT domain has been implicated in
protein-protein interactions that regulate gene expression, the biochemical function of the
N-terminal CCT sequence resembling the Jas domain is not known (Wenkel et al., 2006).
It will be interesting to explore the evolutionary and functional relationship between the
J as and CCT domains.

Several independent lines of evidence indicate that the Jas domain is involved in
destabilizing JAZ repressors by a mechanism that directly couples hormone perception to
1 AZ degradation. First, JAZ proteins fused to GUS or GF P/YF P reporters are degraded in
JA-treated cells in a manner that depends on C011 and the 26S proteasome (Thines et al.,
2007; Chini et al., 2007). Second, truncated JAZ proteins (referred to as JAZAJas) that
lack the Jas domain are stable in the presence of IA (Chini et al., 2007; Thines et al.,
2007; Shoji et al., 2008; Chung and Howe, 2009). Several studies have shown that
overexpression of JAZAJas proteins results in hallmark JA-insensitive phenotypes,
including reduced expression of IA response genes and secondary metabolites, resistance
to JA-mediated inhibition of root growth, susceptibility to insect feeding, enhanced
resistance to coronatine-producing strains of Pseudomonas syringae, and male sterility
(Thines et al., 2007; Chini et al., 2007; Melotto et al., 2008; Shoji et al., 2008; Chung and
Howe, 2009). These initial observations led to the hypothesis that JAZ proteins may be

FCOII

substrates for SC and that the Jas domain mediates protein destabilization.

17

Yeast two-hybrid and in vitro protein pull-down experiments have shown that
JAZ proteins bind directly to COD in a hormone-dependent manner, and that the Jas
domain is necessary and sufficient for this interaction (Thines et al., 2007; Melotto et al.,
2008; Katsir et al., 2008b; Chung and Howe, 2009; Chini et al, 2009). Melotto et a1.
(2008) identified two adjacent basic amino acids near the N-terminal end of the Jas
domain of JAZl and JAZ9 (R205R206 and R223K224, respectively; Figure 1.3.C) that
are required for interaction with C01]. Alanine substitution of these residues blocked
hormone-induced interaction with C011 and, in the case of JAZI , conferred dominant JA
insensitivity in transgenic plants. A JAZIO splice variant (JAZlO.3) harboring a truncated
Jas domain ending in the conserved KRKER motif (Figure 1.3.C) was shown to interact
weakly with COIl in comparison to the full-length splice variant (JAZ10.1) (Chung and
Howe, 2009). Overexpression of JAZlO.3 resulted in partial insensitivity to JA, whereas
overexpression of JAZlO.l had no apparent effect on JA responsiveness (Yan et al.,
2007; Chung and Howe, 2009). These structure-function studies provide initial insight
into regions of the Jas domain that have a role in C011-JAZ interaction and JAZ
destabilization. Additional work is needed to define sequence determinants that are
necessary and sufficient for degron activity. X-ray crystallography studies, similar to
those performed with the auxin receptor TIRl (Tan et al., 2007), are expected to provide
important insight into the molecular details of how the Jas domain interfaces with C01]

in a hormone-dependent manner.

3.2.4. Functional diversification of JAZ proteins by alternative splicing

18

Alternative splicing is a fundamental process for expanding protein diversity and the
functional complexity of eukaryotic organisms. Recent studies indicate that 95% of
multiexon transcripts encoded by the human genome undergo alternative splicing (Pan et
al., 2008). Although our understanding of alternative splicing in plants is still in its
infancy, increasing evidence indicates that this process promotes plant adaptation to
stress (Barbazuk et al., 2008; Reddy et al., 2007). The recent identification of functionally
distinct splice variants of JAZlO/JASI has broadened our appreciation of the role of post-
transcriptional regulation in IA signaling (Yan et al., 2007; Chung and Howe, 2009).
Alternative splicing of JAZIO pre-mRNA generates three splice variants that differ in the
sequence of the Jas domain. The full-length JAZlO.l protein contains an intact Jas
domain similar to that of other JAZ proteins that are destabilized in the presence of JA.
JAZ10.1 strongly interacts with C011 in a ligand-dependent manner and is degraded via
the 26S proteasome pathway in response to JA treatment (Chung and Howe, 2009).
JAZlO.3, which lacks seven amino acids from the C-terminal end of the of Jas motif,
interacts weakly with COIl in a ligand-dependent manner and is degraded in planta in
response to high concentrations of exogenous JA. Consistent with the intermediate
stability of JAZlO.3, overexpression of this splice variant in Arabidopsis confers partial
insensitivity to JA (Yan et al., 2007; Chung and Howe, 2009). A third JAZIO splice
variant (JAZIO.4) lacks the entire Jas domain. As predicted, this protein does not interact
with C011 and is highly resistant to JA-mediated degradation. JAZlO.4-overexpressing
lines exhibit strong JA insensitive phenotypes similar to those observed in coil mutants.
These findings demonstrate that alternative splicing events affecting the Jas domain

expand the functional diversity of JAZ proteins in Arabidopsis. It will be interesting to

19

determine whether alternative splicing of JAZIO pre-mRNA is regulated in a manner that
favors the accumulation of a particular transcript in specific cell types, and whether
alternative splicing events affecting the Jas domain are widespread in the plant kingdom.
A common feature of hormone signaling pathways in all eukaryotes is that
prolonged stimulation decreases responsiveness to the signal, a phenomenon called
desensitization. JAZlO.3 and JAZIO.4 appear to function in this capacity. According to
this hypothesis, synthesis of JA-Ile in response to inductive cues would trigger rapid
destruction of unstable JAZs (e.g., JAZIOJ) that repress JA response genes in
unstimulated cells. Depletion of these J AZs would lead to transcriptional activation of the
JAZ/0 gene, which itself is controlled by the SCFCOH/JAZ pathway (Yan et al., 2007;
Chung et al., 2008). Alternative splicing of JAZIO pre-mRNA generates transcripts for de
novo synthesis of all three JAZIO splice variants but, owing to differences in protein
stability, only the JAZlO.3 and JAZlO.4 proteins are predicted to accumulate and
eventually attenuate the signal output. In this manner, JA—stimulated cells would become
desensitized to elevated hormone levels through the synthesis of JAZlO.3/JAZIO.4 and
perhaps other stable JAZ proteins. This model predicts that the increased sensitivity of
jazIO loss-of-function mutants (Yan et al., 2007) results from the absence of
JAZlO.3/ 10.4 rather than from reduced production of the more labile JAZlO.1. The
ability of JAZlO.3/10.4 to desensitize the signaling pathway may be important for
curtailing JA responses that are not beneficial to the plant. For example, JAZIO.4 may
attenuate the virulence activity of the P. syringae toxin coronatine. It is also possible that
stabilized JAZs play a role in promoting plant growth under environmental conditions in

which plants are faced with the “dilemma to grow or defend” (Herms and Mattson, 1992).

20

3.3. (3R,7S)-JA-Ile is the active stereoisomer of JA-Ile

Bioactive JAs can be defined as JA derivatives that directly promote the formation of
C011-JAZ complexes (Katsir et al., 2008a). Non-bioactive JAs are either precursors or
deactivated forms of the bioactive compounds. Protein-protein interaction studies have
shown that binding of several JAZ proteins to C01] is stimulated by the JA-amino acid
conjugate JA-Ile (Thines et al., 2007; Katsir et al., 2008b; Melotto et al., 2008).
Significantly, JA, methyl-IA (MeJA), and the JA precursor OPDA do not promote these
interactions. Identification of JA-Ile as a causal signal for COIl-JAZ binding extends the
groundbreaking work by Staswick and colleagues showing that IA is activated by JARl-
mediated conjugation to Ile (Staswick and Tiryaki, 2004; Staswick, 2008). The combined
genetic analysis of jarl mutants (Staswick and Tiryaki, 2004) and use of cell-free and
yeast-based assays to study JA-Ile action (Thines et al., 2007) definitively establishes this
conjugate as the bioactive form of the hormone. Structurally related JA-amino acid
conjugates, including JA-Val and JA—Leu, also promote interaction between tomato C011
and JAZl/3 proteins to varying degrees in vitro (Thines et al., 2007; Katsir eta1., 2008b).
These conjugates did not stimulate interaction between Arabidopsis C011 and JAZ3/9
proteins (Forseca et al., 2009), suggesting possible differences in the binding
characteristics of CO“ proteins from different plant species. Several studies have
provided evidence that non-conjugated JA derivatives elicit distinct responses (Hopke et
al., 1994; Blechert et al., 1999; Miersch et al., 1999; Stintzi et al., 2001; Wang et al.,
2008; Ribot et al., 2008). However, all C011-JAZ interaction studies reported to date

show that these compounds do not promote C011-J AZ interactions.

21

Plants contain two stereoisomers of JA-Ile, referred to as (3R,7S)-JA-Ile and
(3R,7R)-JA-lle, that differ with respect to the orientation of the pentenyl side chain
(Figure 1.2.) (Creelman and Mullet, 1997; Wastemack, 2007). Initial C011-JAZ
interaction studies (Thines et al., 2007; Katsir et al., 2008b; Melotto et al., 2008) used a
standard synthetic preparation of JA-Ile that contains predominantly (3R,7S) and minor
amounts of the thermodynamically less stable (3R,7R) isomer, in equilibrium (Miersch
et al., 1986; Creelman and Mullet, 1997; Wastemack et al., 2007). These studies
established the specificity of JA-Ile as the chemical mediator of COIl-JAZ binding but,
because of the mixed stereoisomeric composition of the preparation, did not draw
conclusions about the relative activity of the (3R,7S) and (3R,7R) isomers. Because
(3R,7S)-JA-Ile is stereochemically similar to coronatine (Figure 1.2), this isomer was
generally assumed to be the active form of JA-lle (Staswick, 2008). This was recently
confirmed in studies performed with purified stereoisomers of (3R,7S)-JA-Ile and
(3R,7R)-JA-Ile (Fonseca et al., 2009). In showing that (3R,7R)-JA-Ile is unable to
promote interaction of C011 and JAZ proteins from Arabidopsis, Fonseca et al. (2009)
proposed that (3R,7S)-JA-Ile may be inactivated by epimerization to (3R,7R)-JA-Ile in

vivo.

3.4. MYC2 is a JAZ-interacting transcription factor

JA exerts its many effects through large-scale reprogramming of gene expression. DNA
microarray studies employing various treatments and mutant backgrounds have identified
hundreds of JA-response genes in Arabidopsis and other plants (Schenk et al., 2000;

Reymond et al., 2000; Sasaki, 2001; Goossens et al., 2003; Sasaki-sekimoto et al., 2005;

22

Suzuki et al., 2005; Devoto et al., 2005; Uppalapati et al., 2005; Mandaokar et al., 2006;
Reymond et al., 2004). Meaningful interpretation of this expression data requires
identification of the relevant transcription factors and their biological functions in IA
signaling. Forward and reverse genetic screens have identified a number of transcription
factors involved in JA-mediated transcriptional changes. These include a bHLH
transcription factor MYC2, members of ApetalaZ(AP2)/ERF family including ERFl,
ERF2, ERF4, OCTADECANOID RESPONSIVE ARABIDOPSIS AP2/ERF 37
(ORA37), ORA47, ORA59, and several WRKY proteins including WRKY18, WRKY70,
(Fujimoto et al., 2000; Lorenzo et al., 2003, 2004; Atallah, 2005; Wastemack, 2007;
Chico et al., 2008; Wang et al., 2008).

The bHLH protein MYC2 is the only transcription factor known to directly
interact with JAZ proteins and to regulate the expression of early JA-response genes.
M YC2 mutants were identified in two independent screens for JA-insensitive plants; these
mutants were named fin] and jai1 (jasmonate-insensitivel) (Berger et al., 1996; Lorenzo
et al., 2004). jinI/jail mutants exhibit reduced sensitivity to JA-mediated root growth
inhibition, a typical JA-resistant phenotype. As mentioned above, MYC2 differentially
regulates two branches of JA-mediated responses (Lorenzo et al., 2004). Mutant analysis
in Arabidopsis has also revealed that MYC2 acts as an integrator of light, ABA, and JA
signaling pathways (Abe et al., 1997; Abe et al., 2003; Lorenzo et al., 2004; Yadav et al.,
2005; Dombrecht et al., 2007).

JAZ proteins do not contain a known DNA-binding domain, but rather are
hypothesized to regulate gene expression through interaction with DNA-binding

transcription factors. Because MYC2 is a key transcription factor in JA responses, Chini

23

et al. (2007) considered MYC2 to be a potential candidate for direct interaction with JAZ
proteins. Indeed, MYC2 physically associates with most JAZ proteins in yeast two-
hybrid and pull-down assays (Table 1.1) (Chini et a1, 2007; Chung and Howe, 2009;
Chini et al., 2009). Promoter analysis revealed that the MYC2-binding G-box motif, or a
variant called the T/G-box, is over-represented in JAZ promoters. Protein-DNA binding
studies confirmed that MYC2 binds directly to the JAZ3 promoter region that contains
these motifs (Chini et al., 2007). Furthermore, many JAZ genes are repressed in
myc211;in_1 mutants and constitutively expressed in MYC2-overexpressing plants. These
and other recent results suggest that MYC2-mediated expression of JA-early response
genes, including JAZ genes, is controlled by JAZ3 and other JAZs via direct protein
interaction (Chini et al., 2007; Chung et al., 2008; Melotto et al., 2008; Chung and Howe,
2009).

Chini and colleagues (2007) showed that JAZ3 interacts with the N-terminal
region of MYC2. Interestingly, this plant-specific region of MYC2 is conserved in only a
subgroup of plant bHLH proteins (Heim et al., 2003). Identification of specific sequence
determinants in MYC2 that interact with JAZs could be helpful for identifying other
transcription factors that are controlled by JAZ proteins. Indeed, MYC2 cannot be the
only transcription factor targeted by JAZ repressors because mch/jinl loss-of-function
mutants are not deficient in all JA responses; for example, these mutants are not male
sterile (Lorenzo et al., 2004).

Although information about sequence determinants within JAZ proteins that
interact with MYC2 is beginning to emerge, a single MYC2-interacting sequence

common to all JAZs has not been identified. Pull-down and yeast two—hybrid assays

24

showed that the Jas domain is necessary and sufficient for interaction of JAZ3 with
MYC2 (Chini et al., 2007; Chini et al., 2009). Mutations in the Jas domain that block
hormone-dependent interaction of JAZ9 with COIl did not affect MYC2 binding,
suggesting that the C011 and MYC2 interaction surfaces of JAZ9 are not identical
(Melotto et al., 2008). Yeast two-hybrid assays showed that the Jas domain of JAZIO is
not required for interaction MYC2, indicating that sequences outside the Jas domain are
responsible for repression of IA signaling by JAZlO.4 (Chung and Howe, 2009).

A greater understanding of how JAZ proteins interact with MYC2 (and other
transcription factors) will likely shed light on the molecular mechanism by which JAZs
repress the expression of JA-responsive genes. In contrast to the initial model put forth by
Chini et al. (2007), recent studies suggest that repression of IA signal output by JAZlO.4
and JAZ3AJas may involve ZIM domain-mediated interaction with another JAZ protein
(Chung and Howe, 2009; Chini et al., 2009). The fact that bHLH transcription factors
typically function as homo- or heterodimers (Heim et al., 2003) is consistent with the idea
that a JAZ dimer is the functional unit for MYC2 repression. JAZ-MYC2 complexes may
directly repress MYC2 activity, for example by preventing MYC2 from binding target
promoter regions. It is also possible that JAZ-MYC2 complexes recruit transcriptional

co-repressors to the pre-initiation complex (Browse, 2009).

4. CURRENT MODEL OF JA SIGNALING
Identification of JAZ repressor proteins has provided many new insights into the
molecular mechanism of IA signaling. In healthy (e.g., unwounded) plants, low levels of

JA-Ile allow JAZ proteins to accumulate and repress expression of JA-response genes

25

(Figure 1.5.). This repressed stage is established by direct interaction of JAZ proteins
with transcription factors such as MYC2 that promote the expression of target genes. In
response to various biotic or abiotic stresses or developmental cues, accumulation of JA-
Ile promotes direct interaction of JAZ with SCFCO”. Formation of the resulting COIl-JA-
JAZ complex leads to ubiquitination and degradation of JAZ proteins via the 26S
proteasome, which releases MYC2 from repression. Among the early JA-response genes
activated by MYC2 are those encoding JAZ proteins and several JA biosynthetic
enzymes. Increased expression of the latter may reflect a positive feedback loop to
enhance JA biosynthetic capacity. In contrast, induced expression of JAZ proteins
appears to provide the cell with a means to rapidly attenuate JA signaling. Such fine
tuning of the IA signaling pathway may allow the plant to mount a response that is

commensurate with the nature of the threat encountered.

5. AIMS OF THE THESIS RESEARCH

The research described in this thesis was initiated shortly after the discovery of JAZ
proteins as negative regulator of IA signaling in Arabidopsis (Thines et al., 2007).
Although Thines et al (2007) clearly established a role for JAZ proteins in repressing JA
signaling, very little was known about the general mechanism of JAZ action. Two initial
aims of this thesis research were to determine: 1) how the JAZ gene family in
Arabidopsis is regulated by JA and wound stress, and 2) whether J AZ proteins play a role
in plant defense responses to insect herbivores. The results of experiments designed to
address these questions are described in Chapter 2 (Chung et al., 2008). Another central

aim of this thesis was to investigate the biochemical function of the conserved ZIM and

26

Jas domains in JAZ proteins. The results of experiments aimed at addressing this issue
are described in Chapter 3 (Chung and Howe, 2009). During the course of these studies,
it was discovered that several JAZ genes (e.g., JAZIO) are subject to alternative splicing
events that modify the Jas domain. Following up on this observation, a detailed
comparative analysis of JAZ genes from diverse plant species was undertaken. This
research, which is described in Chapter 4, identified an evolutionarily conserved intron
whose retention during pre-mRNA splicing contributes to functional diversification of

J AZ proteins through altered protein stability.

27

Figure 1.1. The jasmonate biosynthetic pathway in Arabidopsis.

Enzymes of the pathway are boxed. Arabidopsis mutants that are defective in the corresponding
enzyme activity are indicated to the right (italicized symbols). fad, fatty acid desaturase; dad],
defective in anther dehiscence]; 10x2, lipoxygenaseZ; aos, allene oxide synthase; opr3, opda
reductase3; opcll ; opc-830 CoA ligase] ; acx, acyl CoA oxydase.

28

radsradr t...

I dad1

a-llnolenlc acld

 

I FS-Lipoxygenase ] 10x2
OOH

\ _

13(S)-hydroperoxyllnolenlc acld

 

COOH

 

I Fellene oxide synthasrfl aos

 

o
\ __

12, 13(8)-epoxyl|nolenlc acld

COOI'I

 

I [Allene oxide cyclasej

 

 

 

o
coon
(98,136)-12-oxo-cls-10,15-phytodlenolc acld (OPDA)
I [OPDA reductaseJ opr3
o
coon

3-oxo-2v(cls-2’~pentenyl)-cyclopentane-1-octanolc acld (CFC-8:0)
I (CPO-8:0 CoA ligase I cpcl1

 

O

 

O
'é-S-COA

3-oxo-2~(cls-2’-pentenyl)-cyclopentane-1-octanoyl CoA (OPC-8:0-CoA)

* B-oxidation x 3 acxt acx5

coon
(3R,78)-jasmonlc acld (JA)

29

\

\I

 

\\
Chloroplastlc steps

1'
l
I

 

 

\
s Peroxlsomal steps

I!
l

 

 

(3R,7S)—JA—L-lle (3R,7R)-JA-L-lle

 

Coronatine

Figure 1.2. Chemical structure of JA-Ile diastereomers and coronatine.
(3R, 7S)-JA-Ile can epimerize to (3R, 7R)-JA-Ile.

30

Figure 1.3. The TIFY protein family in Arabidopsis.

(A) The phylogenetic tree includes all known Arabidopsis TIFY proteins, including 14 members
of the JAZ subfamily. Full-length amino acid sequences were aligned using clastalW and the tree
was constructed by Neighbor Joining (NJ) method. The relative position of the conserved
domains in each protein is shown in color.

(B-C) Sequence logo (Crooks et al., 2004) of the ZIM (B) and Jas (C) domains found in
Arabidopsis. PPD proteins contain a diverged Jas domain that lacks the conserved PY at the C-
terrninal end (Fig. 1.4). Sequences used to create the ZIM and Jas domain logos were 36 and 27
amino acids, respectively, in length. Secondary structure (or—helix, red; B-sheet, yellow) in each
domain was predicted by Jpred3 (Cole et al., 2008; http://www.compbio.dundee.ac.uk/~www-
jpred/) and is depicted below the logo.

31

 

ZIM

Jas

CCT

GATA ZInc-finger

 
   
  
 

 

 

J— JAZ11 cm
L- JAZ12 21:21:
T ZIM
|_‘{: ZML1 :2-2-2-2
ZML2 1:21:31:

 

'llWl'U

 

AT4G32570 £22.22:

 

 

co
€011
€012
€013
€010
(301.5
€016
COL?
€010
€013
€01.10
€01.11
€01.12
€01.13
€01.14
€01.15
€01.16

".1
m2
m1
m2
m1
m2
me
ms
ms
“5
m7

m9

mm
mu
£13312

CCT domain

 

 
     

         
     
       
     
   
  
  
  
 
 
     

     

  

 

 

20 30 so 50
WIHm-mt IIII ---1
LS “1’ n In l-I:I_II;H I ‘1 .-I4 II . -‘I I tit 11 It" I-I’I 'I-—-
LSP “15:11 [In] ”Hz-t: :1 :IHII . - WEFII'I:I$I.I’11H———
LT :I."?! I t-l I: :I: .l-‘il aI-HII I —-~l Ignml il --l-:t.I.-l I ———
LSP III Afll- t-l KIIHI Iii mum-l — ~l- I Air-drum III rn——-
LI :Itll‘tfil ..l I: III-Z le‘l led-CHI In .- It. nil-um ltl rn—--
AS ‘ t- II.“ II t.l I: Itlvil nil III: II". — urtEIzilugxmzl ra———
ADD tilt-t RES: [.1 III I I-ihill’i it HI-iIr'Izmrl" S--—
SS!) :I.-n ~14! 1l :II'II-i'l‘ n. tilt-imam ' tS——-
in wl-L‘HI-II-II‘II-l iIIi-I-Ir't' *I'IfidI-"P-HIJ-‘I SL-——
first -I I: -I: I:.'l -I:- I". . : -rt ‘1: I.- I:l.l.-l cz—-—
.. 151.1 I:-I:!l.-!l ‘Kflll‘f - .- 15.x“ :‘lHKtJH ' an---
..I—. ".l“.. ,ql. I‘ll. .
1 ‘14! t-gLI.$It-I '1’; I I! t - ‘I-‘Ifi¥'lt 11.1-ilmtlll- SOB—--
1 I"; II: t 'IP~‘I~ FELIPY : art It Ir I:l.ItI ' —-—
l cuff-d H-vrlgI-'HK:I It". - Igfl . IJ-l-Nil—hl-‘l —--
MI’T:I I::K:I-’EH lI<"I' . 1*n. trip-Emu I'D--—
mo Irmlll-"l'.'l P2113“ unnullw - T - -‘ -I* AlAS!—--—
t8!) - :I: n It't' - l- I:Iz It Ink -I In I S---
CSLLII;:IIIi :KIIA’REI:H‘-I-Yr SSfl—u-
mu? :1 I I-' I:ItI:.-I2*l iHHIItTT— I SAKS—~—
rSIPIIr A .l l. I.III:=.-i -I< 'lR'l’ SAKS—-
ZGI Paar : - ———-
28! I: - ‘-.I !————
BL? Itinxl CL--—
31.? H.713] SIP——r—NPAILSSR-—
ALP I‘m: —ssrncuflsuszcxsssr.s——
sto II'A‘J *SSIDCR'I'IJSBCVSCPPAwe
VIII! Irl'nm OMYPPKPBIVTGQPL—~—
.t- t-n “.1 8811— -LPPKPBIVAPSIKS9—
1| :1 - t‘-.<,l
NP! ~I"~.II
SW 1'. 1'in I _ : _. I LDLSTOBSSG—IDIISSTSPT——
nut It- I ~HI ”i=1 I::ItI I-LVSTS 15A —————————————————————
WP I I'qul KII‘PM ‘SATrsnAnmm'l‘SPm ,
DLP i:+- I III. lI;ll n ~LVNKNP -rprsnmrmrows1mrpr-—

 

Jas domain

Figure 1.4. Sequence similarity between the Jas and CCT domains.

Sequence alignment of the Jas domain of Arabidopsis JAZ and PPD proteins with the CCT
domain of Arabidopsis ZIM, ZIM-like (ZML), CONSTANS (CO), and CO-like (COL) proteins
using Clustal W. Sequences used for the alignment consisted of 50 amino acids that span the
domain. Sequences less than 50 amino acids in length were used for those JAZ proteins that

terminate shortly after the J as domain

33

Developmental cues

Bioticl Ablotlc stress
JAZ Unstable JAZs
SCFCO" JA.||° "‘ JAZ ‘ Stable JAZS
v

@ ° o
0 00°
JA7 \. "JAZ“
— ,
.----> JAZ "a ’JAZI'L‘

l \w/ Early genes Early genes
o I

 

 

" ‘i' x

km/ Early genes I
. _____ I d' JAZs, _J
O $58231

G biosynfijefic genes) Negative regulation

Jasmonate responses

Figure 1.5. Current model of jasmonate signaling.

Low levels of JA in the cell allow JAZ repressors to inhibit the activity of transcription factors
(TF, e.g., MYC2) and repress expression of early JA-response genes. Bioactive JAs (e.g., JA-Ile)
are synthesized in response to developmental cues and biotic/abiotic stresses. Increased levels of
JA-Ile in the cell stimulate degradation of stable JAZ proteins via the ubiquitin/26S proteasome
pathway mediated by SCFCO”. Transcription of JAZ genes and alternative splicing of primary
JAZ mRNAs results in production of JAZ variants that are stabilized against JA-mediated
turnover. Accumulation of stable JAZ proteins in the cell desensitizes JA responses.

34

Table 1.1. The TIFY family in Arabidopsis

 

 

If TIFY 1»le Homo- Interaction Interaction
Protein name 1 AGI number motlf Locallzatlon Dlmerlzatlon 2’3 wlth COI1 wlth MYC2
ZIM TIFY1 AT4624470 TISFRG Nuclear Yes/nd nd Nd
ZML1 TIFY2a AT1651600 TLSFQG Nd Yes/nd nd Nd
ZML2 TlFY2b AT3621175 TLSFQG Nd Yes/nd nd Nd
JAZ1 TlFY10a AT1619180 TIFYAG Nuclear Yes/Y es Yes Yes
JAZZ TIFY10b AT1674950 TIFYGG Nd Yes/No nd Yes
JAZ3 TlFY6b AT3617860 TIFYAG Nuclear Yes/Yes Yes Yes
JAZ4 TIFY6a AT1648500 TIFYAG Nd Yes/Yes nd Yes
JA25 TIFY11a AT1617380 TIFFGG Nd Yes/No nd Yes
JA26 TlFY11b AT1672450 TIFFGG Nuclear Yes/No nd Yes
JAZ7 TlFY5b AT2634600 TIFYNG Nd No/No nd No
JAZ8 TIFY5a AT1630135 TIFYNG Nd No/No nd Yes
JAZQ TIFY7 AT1670700 TIFYGG Nd No/Y es Yes Yes
JAZ10.1 TIFY9 AT5613220.1 TIFYNG Nuclear Yes/No Yes Yes
JAZ10.3 AT5613220.3 TIFYNG Nuclear Yes/nd Yes (weak) Yes
JAZ10.4 AT5613220.4 TIFYN6 Nuclear Yes/nd No Yes
JAZ11 TlFY3a AT3643440 TllF66 Nd No/No nd Yes
JAZ12 TlFY3b AT5620900 TIFFGG Nd NolNo nd Yes
PPD1 TIFY4a AT4614713 TIFYSG Nd nd/nd nd Nd
PPD2 TlFY4b AT4614720 TIFYSG Nd nd/nd nd Nd
Unknown TlFY8 AT4632570 TIFYGG Nd nd/nd nd Nd

 

 

 

1 Vanholme et al. (2007)

2/3 Homodimerization capacity as determined by yeast two-hybrid analysis in two different
studies (Chung and Howe, 2009/Chini et al., 2009). Differences in the JAZ-JAZ interactions
reported in these studies may reflect differences in the stringency of the yeast two-hybrid
assays employed.

4 Indicates JA-Ile- or coronatine-dependent JAZ interaction with COIl in yeast two-hybrid and/or
in vitro pull-down assay (Thines et al., 2007 ;Melotto et al., 2008; Chung and Howe, 2009;
Chini et al., 2009).

5 As determined by yeast two-hybrid and/or in vitro pull-down assay (Chini et al., 2007; Melotto
et al., 2008; Chung and Howe 2009; Chini et al, 2009).

nd, not determined.

35

REFERENCES

Abe, H., Yamaguchi-Shinozaki, K., Urao, T., Iwasaki, T., Hosokawa, D., Shinozaki,
K. (1997). Role of arabidopsis MYC and MYB homologs in drought- and abscisic
acid-regulated gene expression. Plant Cell 9: 1859-1868.

Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K., Yamaguchi-Shinozaki, K. (2003).
Arabidopsis AtMYCZ (bHLH) and AtMYBZ (MYB) function as transcriptional
activators in abscisic acid signaling. Plant Cell 15: 63-78.

Acosta, I.F., Laparra, H., Romero, S.P., Schmelz, E., Hamberg, M., Mottinger, J.P.,
Moreno, M.A., Dellaporta, S.L. (2009). tasselseedl is a lipoxygenase affecting
jasmonic acid signaling in sex determination of maize. Science. 323: 262-265.

Barbazuk, W.B., Fu, Y., and McGinnis, K.M. (2008). Genome-wide analyses of
alternative splicing in plants: Opportunities and challenges. Genome Res. 18:
1381-1392.

Bender, C.L., Alarcon-Chaidez, F., Gross, D.C. (1999). Pseudomonas syringae
phytotoxins: mode of action, regulation, and biosynthesis by peptide and
polyketide synthetases. Microbiol Mol Biol Rev. 63: 266-292.

Berrocal-Lobo, M., Molina, A., Solano, R. (2002). Constitutive expression of
ETHYLENE-RESPONSE-FACTORI in Arabidopsis confers resistance to several
necrotrophic fungi. Plant J. 29: 23-32.

Blechert, S., Bockelmann, C., Fusslein, M., Von Schrader, T., Stelmach, B., Niesel,
U., Weller, E.W. (1999). Structure-activity analyses reveal the existence of two
separate groups of active octadecanoids in elicitation of the tendril-coiling
response of Bryom'a dioica J acq. Planta 207: 470—479.

Browse, J. (2009). Jasmonate Passes Muster: A Receptor and Targets for the Defense
Hormone. Annu. Rev. Plant Biol. 60: 183-205.

Browse, J., Howe, G.A. (2008). New weapons and a rapid response against insect attack.
Plant Physiol. 146: 832-838.

Buseman, C.M., Tamura, P., Sparks, A.A., Baughman, E.J., Maatta, S., Zhao, J.,
Roth, M.R., Esch, S.W., Shah, J., Williams, T.D. et al. (2006). Wounding
stimulates the accumulation of glycerolipids containing oxophytodienoic acid and
dinor-oxophytodienoic acid in Arabidopsis leaves. Plant Physiol 142: 28—39

Chico, J.M., Chini, A., Fonseca, S., Solano, R. (2008). JAZ repressors set the rhythm in
jasmonate signaling. Curr. Opin. Plant Biol. 11: 486-494.

36

Chini, A., Fonseca, S., Fernandez, G., Adie, B., Chico, J.M., Lorenzo, 0., Garcia-
Casado, 6., Lopez-Vidriero, 1., Lozano, F.M., Ponce, M.R., Micol, J.L., and
Solano, R. (2007). The JAZ family of repressors is the missing link in jasmonate
signalling. Nature 448: 666-671.

Chini, A., Fonseca, S., Chico, J., Fernandez-Calvo, P., Solano, R. (2009). The ZIM
domain mediates homo- and heteromeric interactions between Arabidopsis JAZ
proteins. Plant J. (in press)

Chung, H.S., Koo, A.J.K., Gao, X., Jayany, S., Thines, B., Jones, A.D., Howe, G.A.
(2008). Regulation and function of Arabidopsis JASMONA TE ZIM-domain genes
in response to wounding and herbivory. Plant Physiol. 146: 952-964.

Chung, H.S., Howe, G.A. (2009). A critical role for the TIFY motif in repression of
jasmonate signaling by a stabilized splice variant of the JASMONATE ZIM-
domain protein JAZIO in Arabidopsis. Plant Cell 21: 131-145.

Creelman, R.A., Mullet, J.E. (1997). Oligosaccharins, brassinolides, and jasmonates:
nontraditional regulators of plant growth, development, and gene expression.
Plant Cell 9: 1211-1223.

Dathe, W., R6nsch, H., Preiss, A., Schade, W., Sembdner, G., Schreiber, K. (1981).
Endogenous plant hormones of the broad bean, Vicia faba L. ( - )-Jasmonic acid,

a plant growth inhibitor in pericarp. Planta 155: 530-535.

Dharmasiri, N., Estelle, M. (2004). Auxin signaling and regulated protein degradation.
Trends Plant Sci. 9: 302-308.

Dharmasiri, N., Dharmasiri, S., Estelle, M. (2005). The F-box protein TIRl is an auxin
receptor. Nature 435: 441-445.

De Vos, M., Van Oosten, V.R., Van Poecke, R.M., Van Pelt, J.A., Pozo, M.J.,
Mueller, M.J., Buchala, A.J., Métraux, J.P., Van Loon, L.C., Dicke, M.,
Pieterse, CM. (2005). Signal signature and transcriptome changes of
Arabidopsis during pathogen and insect attack. Mol Plant Microbe Interact. 18:
923-937.

Devoto, A., Nieto-Rostro, M., Xie, D., Ellis, C., Harmston, R., Patrick, E., Davis, J.,
Sherratt, L., Coleman, M., Turner, J. G. (2002). C011 links jasmonate
signalling and fertility to the SCF ubiquitin-ligase complex in Arabidopsis. Plant J.
32: 457-466.

Devoto, A., Turner, J.G. (2005). Jasmonate-regulated Arabidopsis stress signalling
network. Physiol Plant 123: 161—172.

37

Devoto, A., Ellis, C., Magusin, A., Chang, H.S., Chilcott, C., Zhu, T.,and Turner,
J.G. (2005). Expression profiling reveals COIl to be a keyregulator of genes
involved in wound- and methyl jasmonate-inducedsecondary metabolism, defence,
and hormone interactions. Plant Mol. Biol. 58: 497—513.

Dombrecht, B., Xue, G.P., Sprague, S.J., Kirkegaard, J.A., Ross, J .J., Reid, J.B., Fitt,
G.P., Sewelam, N., Schenk, P.M., Manners, J.M. et al. (2007). MYC2
differentially modulates diverse jasmonate-dependent functions in Arabidopsis.
Plant Cell 19: 2225—2245.

Ellis, C., Karafyllidis., I., Turner, J.G. (2002). Constitutive activation of jasmonate
signaling in an Arabidopsis mutant correlates with enhanced resistance to

Erysiphe cichoracearum, Pseudomonas syringae, and Myzus persicae. Mol Plant
Microbe Interact. 15: 1025-1030.

Ferrari, S., Plotnikova, J.M., De Lorenzo, G., Ausubel, EM. (2003). Arabidopsis
local resistance to Botrytis cinerea involves salicylic acid and camalexin and
requires EDS4 and PADZ, but not SID2, EDS5 or PAD4. Plant J. 35: 193—205.

Feys, B., Benedetti, C.E., Penfold, C.N., Turner, J.G. (1994). Arabidopsis mutants
selected for resistance to the phytotoxin coronatine are male sterile, insensitive to
methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell 6: 751—759.

Fonseca, S., Chini, A., Hamberg, M., Adie, B., Porzel, A., Kramell, R., Miersch, 0.,
Wastemack, C., Solano R. (2009). (+)-7-iso-Jasmonoy1-L-isoleucine is the
endogenous bioactive jasmonate. Nat Chem Biol. 5: 344-350 .

Footitt, S., Dietrich, D., Fait, A., Fernie, A.R., Holdsworth, M.J., Baker, A.,
Theodoulou, EL. (2007). The COMATOSE ATP-binding cassette transporter is
required for full fertility in Arabidopsis. Plant Physiol. 144:1467-1480.

Fujimoto, S.Y., Ohta, M., Usui, A., Shinshi, H., Ohme—Takagi, M. (2000).
Arabidopsis ethylene-responsive element binding factors act as transcriptional

activators or repressors of GCC box-mediated gene expression. Plant Cell. 12:
393-404.

Gidda, S.K., Miersch, 0., Levitin, A., Schmidt, J., Wastemack, C., Varin, L., (2003).
Biochemical and molecular characterization of a hydroxyjasmonate
sulfotransferase from Arabidopsis thaliana. J Biol Chem. 278: 17895-17900.

Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic and
necrotrophic pathogens. Annu. Rev. Phytopathol. 43: 205—227.

38

Glauser, G., Grata, E., Dubugnon, L., Rudaz, 8., Farmer, E.E., Wolfender, J.L.
(2008). Spatial and temporal dynamics of jasmonate synthesis and accumulation
in Arabidopsis in response to wounding. J Biol Chem. 283: 16400-16407.

Goossens, A., Hakkinen, S.T., Laakso, 1., Seppanen-Laakso, T., Biondi, S., De Sutter,
V., Lammertyn, F., Nuutila, A.M., Soderlund, H., Zabeau, M., Inze, D., and
Oksman-Caldentey, K.M. (2003). A functional genomics approach toward the
understanding of secondary metabolism in plant cells. Proc. Natl. Acad. Sci. USA
100: 8595—8600.

Grant, M.R., Jones, J.D. (2009). Hormone (dis)harmony moulds plant health and
disease. Science. 324: 750-752.

Gray, W. M., deI Pozo, J. C., Walker, L., Hobbie, L., Risseeuw, E., Banks, T.,
Crosby, W. L., Yang, M., Ma, H. and Estelle, M. (1999). Identification of an
SCF ubiquitin-ligase complex required for auxin response in Arabidopsis thaliana.
Genes Dev. 13: 1678-1691.

Guo, A., He, K., Liu, D., Bai, S., Gu, X., Wei, L., Luo, J. (2005). DATF: a database of
Arabidopsis transcription factors. Bioinformatics 21: 2568-2569.

He, Y., Fukushige, H., Hildebrand, D.F., Gan, S. (2002). Evidence supporting a role of
jasmonic acid in Arabidopsis leaf senescence. Plant Physiol. 128: 876-884.

Heim, M. A., Jakoby, M., Werber, M., Martin, C., Weisshaar, B. and Bailey, P. C.
(2003). The basic helix-loop-helix transcription factor family in plants: a genome-
wide study of protein structure and functional diversity. Mol. Biol. Evol. 20: 735-
747.

Howe, G.A., Jander, G. (2008). Plant immunity to insect herbivores. Annu Rev Plant
Biol. 59: 41-66.

Hilpert, B., Bohlmann, H., op den Camp, R.O., Przybyla, D., Miersch, 0., Buchala,
A., Apel, K. (2001). Isolation and characterization of signal transduction mutants
of Arabidopsis thaliana that constitutively activate the octadecanoid pathway and
form necrotic microlesions. Plant J. 26: 435-446.

Hopke, J., Donath, J., Blechert, S., Boland, W. (1994). Herbivore-induced volatiles:
the emission of acyclic homoterpenes from leaves of Phaseolus lunatus and Zea

mays can betriggered by a B-glucosidase and jasmonic acid. FEBS Lett. 352:
I46—150.

Hyun, Y., Choi, S., Hwang, H.J., Yu, J., Nam, S.J., Ko, J., Park, J.Y., Seo, Y.S., Kim,
E.Y., Ryu, S.B., Kim, W.T., Lee, Y.H., Kang, H., Lee, I. (2008). Cooperation

39

and functional diversification of two closely related galactolipase genes for
jasmonate biosynthesis. Dev Cell. 14: 183-192.

Kepinski, S. and Leyser, O. (2005). The Arabidopsis F-box protein TIRl is an auxin
receptor. Nature 435, 446-451.

Koch, T., Bandemer, K., Boland, W., (1997). Biosynthesis of cis-jasmone: a pathway
for the inactivation and the disposal of the plant stress hormone jasmonic acid to
the gas phase? Helvetica Chimica Acta 80: 838—850.

Ishiguro, S., Kawai-Oda, A., Ueda, J., Nishida, 1., Okada, K. (2001). The
DEFECTIVE IN ANTHER DEHISCIENCE gene encodes a novel phospholipase
A1 catalyzing the initial step of jasmonic acid biosynthesis, which synchronizes

pollen maturation, anther dehiscence, and flower opening in Arabidopsis. Plant
Cell. 13: 2191-2209.

Kang JH, Wang L, Girl A, Baldwin IT. (2006) Silencing threonine deaminase and
JAR4 in Nicotiana attenuata impairs jasmonic acid-isoleucinemediated defenses
against Manduca sexta. Plant Cell 18: 3303—3320.

Katsir, L., Chung, H.S., Koo, A.J.K., Howe, G.A. (2008a.) Jasmonate signaling: a
conserved mechanism of hormone sensing. Curr. Opin. Plant Biol. 11: 428-435.

Katsir L., Schilmiller A.L., Staswick P.E., He S.Y. Howe GA. (2008b). C011 is a
critical component of a receptor for jasmonate and the bacterial virulence factor
coronatine. Proc. Natl. Acad. Sci. USA 105: 7100-7105.

Kepinski, S. and Leyser, O. (2005). The Arabidopsis F-box protein TIRI is an auxin
receptor. Nature 435: 446-451.

Koo, A.J.K., Chung, H.S, Kobayashi, Y., Howe, G.A. (2006). Identification of a
peroxisomal acyl-activating enzyme involved in the biosynthesis of jasmonic acid
in Arabidopsis. J Biol Chem 281: 33511—33520.

Koo, A.J., Gao, X., Daniel Jones, A., Howe, G.A., (2009). A rapid wound signal
activates the systemic synthesis of bioactive jasmonates in Arabidopsis. Plant J.
(In press)

Koornneef, A., Pieterse, CM. (2008). Cross talk in defense signaling. Plant Physiol.
146: 839-844.

Kourtchenko, 0., Andersson, M.X., Hamberg, M., Brunnstrom, A., Gobel, C.,
McPhaiI, K.L., Gerwick, W.B., Feussner, 1., Ellerstrom, M. (2007).
Oxophytodienoic acid containing galactolipids in Arabidopsis: jasmonate
signaling dependence. Plant Physiol 145: 1658—1669..

40

Laudert, D., Schaller, F., Weiler, E.W. (2000). Transgenic Nicotiana tabacum and
Arabidopsis thaliana plants overexpressing allene oxide synthase. Planta. 211:
163-165.

Lee, D.S., Nioche, P., Hamberg, M., Raman, C.S. (2008). Structural insights into the
evolutionary paths of oxylipin biosynthetic enzymes. Nature. 455: 363-368.

Li, L., Zhao, Y., McCaig, B.C., Wingerd, B.A., Wang, J., Whalon, M.E., Pichersky,
E., Howe, G.A. (2004). The tomato homolog of CORONATINE-INSENSITIVEI
is required for the maternal control of seed maturation, jasmonate-signaled
defense responses, and glandular trichome development. Plant Cell 16: 126-143.

Li, C., Schilmiller, A.L., Liu, C., Lee, G.I., Jayanty, S., Sageman, C., Vrebalov, J.,
Giovannoni, J.J., Yagi, K., Kobayashi, Y., Howe, G.A. (2005). Role of beta-
oxidation in jasmonate biosynthesis and systemic wound signaling in tomato.

Plant Cell. 17: 971-986.

Lorenzo, 0., Piqueras, R., Sénchez-Serrano, J.J., Solano, R. (2003). ETHYLENE
RESPONSE FACTOR] integrates signals from ethylene and jasmonate pathways
in plant defense. Plant Cell. 15: 165-178.

Lorenzo, O., Chico, J. M., Sanchez-Serrano, J. J. and Solano, R. (2004).
JASMONATE-INSENSITIVEI encodes a MYC transcription factor essential to

discriminate between different jasmonate-regulated defense responses in
Arabidopsis. Plant Cell 16: 1938-1950.

Lorenzo, O. and Solano, R. (2005). Molecular players regulating the jasmonate
signalling network. Curr. Opin. Plant Biol. 8: 532-540.

Mandaokar, A., Thines, B., Shin, B., Lange, B. M., Choi, 6., K00, Y. J., You, Y. J.,
Choi, Y. D. and Browse, J. (2006). Transcriptional regulators of stamen

development in Arabidopsis identified by transcriptional profiling. Plant J. 46:
984-1008.

McConn, M., Browse, J. (1996). The critical requirement for linolenic acid is pollen
development, not photosynthesis, in an Arabidopsis Mutant. Plant Cell. 8: 403-
416.

Melotto, M., Mecey, C., Niu, Y., Chung, H.S., Katsir, L., Yao, J., Zeng, W., Thines,
B., Staswick, P.E., Browse, J., Howe, G.A., He, S.Y. (2008a). A critical role of
two positively charged amino acids in the Jas motif of Arabidopsis JAZ proteins

in mediating coronatine- and jasmonoyl isoleucine-dependent interactions with
the C011 F -box protein. Plant J. 55: 979-988.

41

Melotto, M., Underwood, W., He, S.Y. (2008b). Role of stomata in plant innate
immunity and foliar bacterial diseases. Annu. Rev. Phytopathol. 46: 101-122.

Mengiste T, Chen X, Salmeron J, Dietrich R. (2003). T heBOTRYTIS SUSCEPTIBLEI
gene encodes an R2R3MYB transcription factor protein that is required for biotic
and abiotic stress responses in Arabidopsis. Plant Cell 15: 2551—2265.

Miersch, O., Kramell, R., Parthier, B., Wastemack, C. (1999). Structure-activity
relations of substituted, deleted or stereospecifically altered jasmonic acid in gene
expression of barley leaves. Phytochemistry 50: 353—361.

Mewis, 1., Appel, H.M., Hom, A., Raina, R., Schultz, J.C. (2005). Major signaling
pathways modulate Arabidopsis glucosinolate accumulation and response to both
phloem-feeding and chewing insects. Plant Physiol. 138: 1149—1162.

Moon, J., Parry, G. and Estelle, M. (2004). The ubiquitin-proteasome pathway and
plant development. Plant Cell 16: 3181-3195.

Moreno, J.E., Tao, Y., Chory, J., Ballaré, CL. (2009). Ecological modulation of plant
defense via phytochrome control of jasmonate sensitivity. Proc Natl Acad Sci U S
A. 106: 4935-4940.

Nishii, A., Takemura, M., Fujita, H., Shikata, M., Yokota, A., Kohchi, T. (2000).
Characterization of a novel gene encoding a putative single zinc-finger protein,

ZIM, expressed during the reproductive phase in Arabidopsis thaliana. Biosci.
Biotechnol. Biochem. 64: 1402-1409.

Nomura, K., Melotto, M., He, S.Y., (2005). Suppression of host defense in compatible
plant-Pseudomonas syringae interactions. Curr. Opin. Plant Biol. 8: 361-368.

Park, J.B., Halitschke, R., Kim, H.B., Baldwin, I.T., Feldmann, K.A., Feyereisen, R.
(2002). A knock-out mutation in allene oxide synthase results in male sterility and
defective wound signal transduction in Arabidopsis due to a block in jasmonic
acid biosynthesis. Plant J. 31: 1-12.

Paschold, A., Bonaventure, G., Kant, M.R., Baldwin, LT. (2008). Jasmonate
perception regulates jasmonate biosynthesis and JA-Ile metabolism: the case of
C01] in Nicotiana attenuata. Plant Cell Physiol. 49: 1165-1175.

Rao, M.V., Lee, H., Creelman, R.A., Mullet, J.E., Davis, KR. (2000). Jasmonic acid

signaling modulates ozone-induced hypersensitive cell death. Plant Cell 12:
1633—1646.

42

Reddy, A.S.N. (2007). Alternative splicing of pre-messenger RNAs in plants in the
genomic era. Annu. Rev. Plant Biol. 58: 267-294.

Ren, C., Pan, J., Peng, W., Genschik, P., Hobbie, L., Hellmann, H., Estelle, M., Gao,
B., Peng, J., Sun, C. and Xie, D. (2005). Point mutations in Arabidopsis Cullinl
reveal its essential role in jasmonate response. Plant J. 42: 514-524.

Reymond, P., Weber, H., Damond, M., Farmer, E.E. (2000). Differential gene
expression in response to mechanical wounding and insect feeding in Arabidopsis.
Plant Cell 12: 707-720.

Reymond, P., Bodenhausen, N., Van Poecke, R.M., Krishnamurthy, V., Dicke, M.,
Farmer, E.E. (2004). A conserved transcript pattern in response to a specialist
and a generalist herbivore. Plant Cell 16: 3132—31347.

Riafio-Pachon, D.M., Ruzicic, S., Dreyer, 1., Mueller-Roeber, B. (2007). PlnTFDB: an
integrative plant transcription factor database. BMC Bioinformatics 8: 42.

Ribot, C., Zimmerli, C., Farmer, E.E., Reymond, P., Poirier, Y. (2008). Induction of
the Arabidopsis PHOl;H10 gene by 12-oxo-phytodienoic acid but not jasmonic
acid via a CORONATINE INSENSITIVEl-dependent pathway. Plant Physiol.
147: 696-706.

Robson, F., Costa, M.M., Hepworth, S.R., Vizir, 1., Pifieiro, M., Reeves, P.H.,
Putterill, J., Coupland, G. (2001). Functional importance of conserved domains
in the flowering-time gene CONSTANS demonstrated by analysis of mutant
alleles and transgenic plants. Plant J. 28: 619-631.

Ruegger, M., Dewey, E., Gray, W.M., Hobbie, L., Turner, J., Estelle, M. (1998). The
TIRI protein of Arabidopsis functions in auxin response and is related to human
SKPZ and yeast grrlp. Genes Dev. 12: 198-207.

Rushton, P.J., Bokowiec, M.T., Laudeman, T.W., Brannock JF, Chen X, Timko MP.
(2008). TOBFAC: the database of tobacco transcription factors. BMC
Bioinformatics 9: 53.

Sanders, P.M., Lee, P.Y., Biesgen, C., Boone, J.D., Beals, T.P., Weiler, E.W.,
Goldberg, RB. (2000). The arabidopsis DELAYED DEHISCENCEI gene
encodes an enzyme in the jasmonic acid synthesis pathway. Plant Cell. 12: 1041-
1061.

Saniewski, M. (1988). The effect of methyl jasmonate and benzyladenine of epiphyllous
bud formation in Bryophyllum diagremontianum. Bull. Acad. Pol. Sci. Biol. 36:
39—44.

43

Santner, A., Estelle, M. (2009). Recent advances and emerging trends in plant hormone
signalling. Nature. 459: 1071-1078.

Sasaki, Y., Asamizu, E., Shibata, D., Nakamura, Y., Kaneko, T., Awai, K., Amagai,
M., Kuwata, C., Tsugane, T., Masuda, T. et al. (2001). Monitoring of methyl
jasmonate-responsive genes in Arabidopsis by cDNA macroarray: selfactivation
of jasmonic acid biosynthesis and crosstalk with other phytohorrnone signaling
pathways. DNA Res 8: 153—161.

Sasaki-Sekimoto, Y., et a1. (2005). Coordinated activation of metabolic pathways for
antioxidants and defence compounds by jasmonates and their roles in stress
tolerance in Arabidopsis. Plant J. 44: 653-668.

Schaller, F., Biesgen, C., Miissig, C., Altmann, T., Weiler, E.W. (2000). 12-
Oxophytodienoate reductase 3 (OPR3) is the isoenzyme involved in jasmonate
biosynthesis. Planta. 210: 979-984.

Schenk, P.M., Kazan, K., Wilson, I., Anderson, J.P., Richmond, T., Somerville, S.C.,
and Manners, J.M. (2000). Coordinated plant defense responses in Arabidopsis
revealed by microarray analysis. Proc. Natl. Acad. Sci. USA 97: 11655—11660.

Schilmiller, A.L., Koo, A.J., Howe, G.A. (2007). Functional diversification of acyl-
coenzyme A oxidases in jasmonic acid biosynthesis and action. Plant Physiol.
143: 812-824.

Shoji, T., Ogawa, T., Hashimoto, T. (2008). Jasmonate-induced nicotine formation in
tobacco is mediated by tobacco C011 and JAZ genes. Plant Cell. Physiol. 49:
1003-1012.

Staswick, P.E., Su, W., Howell, S.H. (1992). Methyl jasmonate inhibition of root
growth and induction of a leaf protein are decreased in an Arabidopsis thaliana
mutant. Proc Natl Acad Sci U S A. 89: 6837-6840.

Staswick, P.E., Yuen, G.Y., Lehman, CC. (1998). Jasmonate signaling mutants of
Arabidopsis are susceptible to the soil fungus Pythium irregulare. Plant J 15:
747—754.

Stintzi, A., Weber, H., Reymond, P., Browse, J., Farmer, E.E. (2001). Plant defense in
the absence of jasmonic acid: the role of cyclopentenones. Proc. Natl. Acad. Sci.
USA 98: 12837—12842.

Stintzi, A., Browse, J. (2000). The Arabidopsis male-sterile mutant, opr3, lacks the 12-

oxophytodienoic acid reductase required for jasmonate synthesis. Proc Natl Acad
Sci USA. 97: 10625-10630.

44

Staswick, P.E., Tiryaki, I. (2004). The oxylipin signal jasmonic acid is activated by an
enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16: 2117—2127.

Strayer, C., Oyama, T., Schultz, T.F., Raman, R., Somers, D.E., Mas, P., Panda, S.,
Kreps, J.A., Kay, S.A. (2000). Cloning of the Arabidopsis clock gene TOCI, an
autoregulatory response regulator homolog. Science 289: 768-771.

Sembdner, G., Parthier, B. (1993). The biochemistry and the physiological molecular

actions of Jasmonates. Annual Review of Plant Physiol. and Molecular Biol. 44:
569-589.

Stenzel, 1., Hause, B., Miersch, 0., Kurz, T., Maucher, H., Weichert, H., Ziegler, J.,
Feussner, 1., Wastemack, C. (2003). Jasmonate biosynthesis and the allene
oxide cyclase family of Arabidopsis thaliana. Plant Mol Biol. 51: 895-911.

Suza, W.P., Staswick, P.E. (2008). The role of JARI in jasmonoyl-L-isoleucine
production in Arabidopsis wound response. Planta 227: 1221-1232.

Suzuki, H., Reddy, M.S., Naoumkina, M., Aziz, N., May, G.D.,Huhman, D.V.,
Sumner, L.W., Blount, J.W., Mendes, P., and Dixon,R.A. (2005). Methyl
jasmonate and yeast elicitor induce differentialtranscriptional and metabolic rc-

programming in cell suspensioncultures of the model legume Medicago truncatula.
Planta 220: 696—707.

Swiatek, A., Lenjou, M., Van Bockstaele, D., Inzé, D., Van Onckelen, H. (2002).
Differential effect of jasmonic acid and abscisic acid on cell cycle progression in
tobacco BY-2 cells. Plant Physiol. 128: 201-211.

Taki, N., Sasaki-Sekimoto, Y., Obayashi, T., Kikuta, A., Kobayashi, K., Ainai, T.,
Yagi, K., Sakurai, N., Suzuki, H., Masuda, T., Takamiya, K., Shibata, D.,
Kobayashi, Y., Ohta, H. (2005). 12-oxo-phytodienoic acid triggers expression of
a distinct set of genes and plays a role in wound-induced gene expression in
Arabidopsis. Plant Physiol. 139: 1268-1283.

Tan, X., Calderon-Villalobos, L.I., Sharon, M., Zheng, C., Robinson, C.V., Estelle,
M., Zheng, N. (2007). Mechanism of auxin perception by the TIRl ubiquitin
ligase. Nature 446: 640-645.

Theodoulou, F.L., Job, K., Slocombe, S.P., Footitt, S., Holdsworth, M., Baker, A.,
Larson, T.R., Graham, LA. (2005). Jasmonic acid levels are reduced in
COMATOSE ATP-binding cassette transporter mutants. Implications for
transport of jasmonate precursors into peroxisomes. Plant Physiol. 137: 83 5-840.

45

Thomma, B.P., Eggermont, K., Tierens, K.F., Broekaert, W.F. (1999). Requirement
of functional ethylene-insensitive 2 gene for efficient resistance of Arabidopsis to
infection by Botrytis cinerea. Plant Physiol. 121: 1093—1102.

Thomma, B.P., Nelissen, 1., Eggermont, K., Broekaert, W.F. (1999). Deficiency in
phytoalexin production causes enhanced susceptibility of Arabidopsis thaliana to
the fungus Alternaria brassicicola. Plant J. 19: 163—171.

Thomma, B.P.H.J., Eggermont, K., Penninckx, I.A.M.A., Mauch-Mani, B.,
Vogelsang, R. et al. (1998). Separate jasmonate-dependent and salicylate-
dependent defense-response pathways in Arabidopsis are essential for resistance
to distinct microbial pathogens. Proc. Natl. Acad. Sci. USA 95: 15107—15111.

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, C., Nomura, K., He,
S.Y., Howe, G.A., and Browse, J. (2007). JAZ repressor proteins are targets of
the SCFCO” complex during jasmonate signalling. Nature 448: 661-665.

Ueda, J., Kato, J. (1980). Isolation and Identification of a Senescence-promoting
Substance from Wormwood (Artemisia absinthium L.). Plant Physiol. 66: 246-
249.

Uppalapati, S.R., Ayoubi, P., Weng, H., Palmer, D.A., Mitchell, R.E., Jones, W., and
Bender, CL. (2005). The phytotoxin coronatine and methyl jasmonate impact
multiple phytohormone pathways in tomato. Plant J. 42: 201—217.

Vanholme, B., Grunewald, W., Bateman, Kohchi, T., Gheysen, G. (2007) The tify
family previously known as ZIM. Trends Plant Sci. 12: 239-244.

van Wees, S.C., Chang, H.S., Zhu, T., Glazebrook, J. (2003). Characterization of the
early response of Arabidopsis to Alternaria brassicicola infection using

expression profiling. Plant Physiol. 132: 606—617.

Veronese, P., Chen, X., Bluhm, B., Salmeron, J., Dietrich, R., Mengiste, T. (2004).
The BOS loci of Arabidopsis are required for resistance to Botrytis cinerea
infection. Plant J. 40: 558—574.

Vick, B.A., Zimmerman, D.C. (1984). Biosynthesis of Jasmonic Acid by Several Plant
Species. Plant Physiol. 75: 458-461.

von Malek, B., van der, Graaff E., Schneitz, K., Keller, B. (2002). The Arabidopsis
male-sterile mutant dde2-2 is defective in the ALLENE OXIDE SYNTHASE
gene encoding one of the key enzymes of the jasmonic acid biosynthesis pathway.
Planta. 216: 187-192.

46

Wastemack, C., Hause, B. (2002). Jasmonates and octadecanoids: signals in plant stress
responses and development. Prog Nucleic Acid Res Mol Biol. 72: 165—221.

Wastemack, C. (2007). Jasmonates: an update on biosynthesis, signal transduction and
action in plant stress response, growth and development. Ann Bot (Lond) 100:

681-697.

Wang, L., Allmann, S., Wu, J., Baldwin, LT. (2008). Comparisons of LOX3- and
JAR4/6-silenced plants reveal that JA and JA-AA conjugates play different roles
in herbivore resistance of Nicotiana attenuata. Plant Physiol. 146: 904-915.

Wenkel, S., Turck, F., Singer, K., Gissot, L., Le Gourrierec, J., Samach, A.,
Coupland, G. (2006). CONSTANS and the CCAAT box binding complex share
a functionally important domain and interact to regulate flowering of Arabidopsis.
Plant Cell 18: 2971-2984.

Xie, D. X., Feys, B. F., James, S., Nieto-Rostro, M. and Turner, J. G. (1998). C011:
an Arabidopsis gene required for jasmonate-regulated defense and fertility.
Science 280: 1091-1094.

Xu, L., Liu, F., Wang, Z., Peng, W., Huang, R., Huang, D., Xie, D. (2001). An
Arabidopsis mutant cexl exhibits constant accumulation of jasmonate-regulated
AtVSP, Thi2.l and PDFI.2. FEBS Lett. 494: 161-164.

Xu, L., Liu, F., Lechner, E., Genschik, P., Crosby, W. L., Ma, H., Peng, W., Huang,
D. and Xie, D. (2002). The SCF(COII) ubiquitin-ligase complexes are required
for jasmonate response in Arabidopsis. Plant Cell 14: 1919-1935.

Yadav, V., Mallappa, C., Gangappa, S. N., Bhatia, S. and Chattopadhyay, S. (2005).
A basic helix-loop-helix transcription factor in Arabidopsis, MYC2, acts as a
repressor of blue light-mediated photomorphogenic growth. Plant Cell 17: 1953-
1966.

Yan, Y., Stolz, S., Chetelat, A., Reymond, P., Pagni, M., Dubugnon, L., and Farmer,
E.E. (2007). A downstream mediator in the growth repression limb of the
jasmonate pathway. Plant Cell 19: 2470-2483.

Yoshida, Y., Sano, R., Wada, T., Takabayashi, J., Okada, K. (2009). Jasmonic acid
control of GLABRA3 links inducible defense and trichome patterning in
Arabidopsis. Development. 136: 1039-1048.

Zarate, S.l., Kempema, L.A., Walling, LL. (2007). Silverleaf whitefly induces

salicylic acid defenses and suppresses effectual jasmonic acid defenses. Plant
Physiol. 143: 866-875.

47

Zhao, Y., Thilmony, R., Bender, C.L., Schaller, A., He, S.Y., Howe, G.A. (2003).
Virulence systems of Pseudomonas syringae pv. tomato promote bacterial speck
disease in tomato by targeting the jasmonate signaling pathway. Plant J. 36: 485-
499.

Zheng, W., Zhai, 0., Sun, J., Li, C.B., Zhang, L., Li, H., Zhang, X., Li, S., Xu, Y.,
Jiang, H., Wu, X., Li, C. (2006). Bestatin, an inhibitor of aminopeptidases,
provides a chemical genetics approach to dissect jasmonate signaling in
Arabidopsis. Plant Physiol. 141: 1400-1413.

Zhou, N., Tootle, T.L., Glazebrook, J. (1999). Arabidopsis PAD3, a gene required for
camalexin biosynthesis, encodes a putative cytochrome P450 monooxygenase.
Plant Cell 11: 2419—2428.

Ziegler, J., Stenzel, 1., Hause, B., Maucher, H., Hamberg, M., Grimm, R., Ganal, M.,
Wasternack, C. (2000). Molecular cloning of allene oxide cyclase. The enzyme

establishing the stereochemistry of octadecanoids and jasmonates. J Biol Chem.
275: 19132-19138.

48

CHAPTER 2: REGULATION AND FUNCTION OF ARABIDOPSIS JASMONA TE
ZIM-DOMAIN GENES IN RESPONSE TO WOUNDING AND HERBIVORY

The work presented in this chapter has been published:

Hoo Sun Chung, Abraham J.K. Koo, Xiaoli Gao, Sastry Jayanty, Bryan Thines, A.
Daniel Jones, and Gregg A. Howe (2008)

Plant Physiology 146, 952-964

Author’s contributions:

Abraham J .K K00 and Xiaoli Gao measured J A-Ile levels in wounded Arabidopsis leaves
and helped with manuscript review. Sastry Jayanty measured wound-induced
accumulation of JA in coil and wild type plants. Hoo Sun Chung conducted the
remainder of the research and wrote the manuscript. Bryan Thines was involved in
initiation and development of the project. A. Daniel Jones supervised the quantification
of JA-Ile. Gregg A. Howe supervised the entire project and was involved in all aspects of

the manuscript writing.

49

ABSTRACT

Jasmonic acid (JA) and its amino acid conjugate, jasmonoyl-isoleucine (JA-Ile), play
important roles in regulating plant defense responses to insect herbivores. Recent studies
indicate that JA-Ile promotes the degradation of JAsmonate Zim-domain (JAZ)
transcriptional repressors through the activity of the E3 ubiquitin-ligase SCFCO”. Here,
we investigated the expression pattern and function of JAZ genes during the interaction of
Arabidopsis with the generalist herbivore Spodoptera exigua. Most members of the JAZ
gene family were highly expressed in response to S. exigua feeding and mechanical
wounding. JAZ transcript levels increased within 5 min of mechanical tissue damage,
coincident with a large (~25-fold) rise in JA and JA-Ile levels. However, wound-induced
expression of JAZ and other C011-dependent genes was not significantly impaired in the
jarI-I mutant that is deficient in the conversion of JA to JA-Ile. Experiments performed
with the protein synthesis inhibitor cycloheximide provided evidence that JAZs, M YC2,
and genes encoding several JA biosynthetic enzymes are primary response genes whose
expression is de-repressed upon C011-dependent turnover of a labile repressor protein(s).
We also show that overexpression of a modified form of JAZl (JAZIA3A) that is stable
in the presence of jasmonate compromises host resistance to feeding by S. exigua larvae.
These findings establish a role for JAZ proteins in the regulation of plant anti-insect
defense, and suggest that signals other than (or in addition to) JA-Ile activate COIl-
dependent wound responses in Arabidopsis. Our results also indicate that the timing of
jasmonate-induced transcription in response to wounding is more rapid than previously

realized.

50

INTRODUCTION

Jasmonic acid (JA) and its bioactive derivatives, collectively known as jasmonates,
control many aspects of plant protection against biotic and abiotic stress. Jasmonates play
a central role in regulating immune responses to arthropod herbivores and necrotrophic
pathogens, as well as stress responses to UV light and ozone (Devoto and Turner, 2005;
Glazebrook, 2005; Schilmiller and Howe, 2005; Gfeller et al., 2006; Wastemack et al.,
2006; Balbi and Devoto, 2007; Wastemack, 2007; Howe and Jander, 2008). Jasmonates
also exert control over various developmental processes, including pollen maturation,
anther dehiscence, embryo maturation, and trichome development (Li et al., 2004;
Browse, 2005; Schaller et al., 2005). In general, jasmonates appear to promote defense
and reproduction while inhibiting growth-related processes such as photosynthesis and
cell division (Devoto and Turner, 2005; Giri et al., 2006; Yan et al., 2007). These
contrasting activities of the hormone imply a broader role for the jasmonates in regulating
shifts between growth- and defense-oriented metabolism, thereby optimizing plant fitness
in rapidly changing environments.

CORONATINE-INSENSITIVE 1 (C011) is a Ieucine-rich repeat (LRR)/F-box
protein that determines the substrate specificity of the SCF-type E3 ubiquitin ligase
SCFCO" (Xie et al., 1998; Xu et al., 2002). The importance of C01] in jasmonate
signaling is exemplified by the fact that null mutations at this locus abolish jasmonate
responses in diverse plant species (Feys et al., 1994; Li et al., 2004). JAsmonate ZIM-
domain (JAZ) proteins are targeted by SCFCO“ for degradation during jasmonate
signaling (Chini et al., 2007; Thines et al., 2007). JAZ proteins belong to the larger

family of tify proteins that share a conserved TIFYxG sequence within the ZIM motif

51

(Vanholme et al., 2007). A second defining feature of JAZs is the highly conserved Jas
motif, which has a SLXZFXZKRX2RX5PY consensus sequence near the C-terminus
(Chini et al., 2007; Thines et al., 2007; Yan et al., 2007). Recent studies indicate that JAZ
proteins act as repressors of jasmonate—responsive genes. For example, JAZ proteins are
degraded in a C011- and 26S proteasome-dependent manner in response to JA treatment.
Also, dominant mutations affecting the conserved Jas motif stabilize JAZ proteins against
degradation and, as a consequence, reduce the plant’s responsiveness to jasmonate (Chini
et al., 2007; Thines et al., 2007; Yan et al., 2007). Current models indicate that, in the
presence of low jasmonate levels, JAZ proteins repress the expression of jasmonate-
responsive genes by interacting directly with the basic helix-loop-helix (bHLH)
transcription factor MYC2 (also known as JINI), which is a positive regulator of
jasmonate responses (Lorenzo et al., 2004; Chini et al., 2007). Increased jasmonate levels
promote binding of JAZs to C011 and subsequent degradation of JAZ repressors via the
ubiquitin/26S proteasome pathway, resulting in de-repression of early response genes.
The JAZ-mediated transition between repressed and de-repressed states of gene
expression is likely subject to several additional layers of regulation. It is well established,
for example, that the expression of JA biosynthetic genes in Arabidopsis and other plants
increases in response to jasmonate treatment and wounding (Ryan, 2000; Sasaki et al.,
2001; Reymond et al., 2000; Stenzel et al., 2003; Delker et al., 2006; Farmer, 2007;
Wastemack, 2007). This observation implies the existence of a positive feedback loop
that reinforces or amplifies the plant’s capacity to synthesize jasmonate in response to
continuous tissue damage, such as that associated with biotic stress. JAZ genes are also

upregulated in response to jasmonate treatment. Because at least some JAZ proteins act

52

as negative regulators, it was suggested that jasmonate-induced JAZ expression
constitutes a negative feedback loop in which newly synthesized JAZ repressors dampen
the response by inhibiting the activity of transcription factors such as MYC2 (Thines et
al., 2007; Chini et al., 2007). This idea is analogous to the explanation for why auxin
rapidly induces the expression of Aux/1AA genes, which encode negative regulators of the
auxin signaling pathway (Abel et al., 1995; Abel, 2007). Indeed, the emerging picture of
jasmonate action is remarkably similar to that of the auxin signaling pathway in which
auxin promotes the degradation of the Aux/1AA transcriptional repressors by the E3
ubiquitin-ligase SCFTIRI (Dharmasiri et al., 2005; Kepinski and Leyser, 2005; Tan et al.,
2007)

Many plant antiherbivore defense responses are activated upon wound-induced
accumulation of JA. The initial steps in the octadecanoid pathway for JA synthesis occur
in the chloroplast, whereas the latter half of the pathway operates in the peroxisome
(Schilmiller and Howe, 2005; Schaller et al., 2005; Wastemack et al., 2006; Wastemack,
2007). Analysis of mutants impaired in peroxisomal B-oxidation enzymes has shown that
JA production is strictly required for defense against herbivorous caterpillars and thrips
(Schilmiller et al., 2007; Li et al., 2005). It is now clear that metabolism of JA plays a
critical role in regulating jasmonate-based defense repsonses. In particular, synthesis of
the jasmonoyl-isoleucine (JA-Ile) conjugate by JASMONATE RESISTANT 1 (JARI)
(Staswick and Tiryaki, 2004) and related JA-conjugating enzymes is required for plant
protection against necrotrophic soil pathogens (Staswick et al., 1998), lepidopteran
insects (Kang et al., 2006), and various abiotic stresses as well (Rao et al., 2000). Recent

work by Thines et al. (Thines et al., 2007) showed that JA-Ile, but not JA, MeJA, or their

53

chloroplastic C18 precursor 12-oxo—phytodienoic acid (OPDA), stimulates COII binding
to JAZ proteins. Collectively, these results support the hypothesis that JA-Ile is a primary
jasmonate signal, which we define here as a compound that evokes a physiological
response upon binding to a jasmonate receptor.

In addition to regulation by exogenous jasmonate (Chini et al., 2007; Thines et al.,
2007), JAZ expression is also induced by high salinity and other environmental stress
conditions (Jiang and Deyholos, 2006; Vanholme et al., 2007). Transcript profiling
experiments in Arabidopsis (Yan et al., 2007) and hybrid peplar (Major and Constabel,
2006) showed that JAZ genes are upregulated in response to wounding and simulated
herbivory. Yan et al. (2007) also demonstrated that JASMONA T E—ASSOCIA T EDI (JASI),
which is identical to JAZIO, is induced by mechanical wounding in a C011-dependent
manner. Moreover, a splice variant of JASI/JAZIO that encodes a C-terminally-truncated
protein (JASl.3) acts as a repressor of JA-mediated growth inhibition (Yan et al., 2007).
This finding provides new mechanistic insight into jasmonate’s dual role in promoting
defense and inhibiting growth. A role for JAZ proteins in promoting plant defense against
herbivory, however, remains to be established.

Here, we show that mechanical wounding and herbivory increase the expression
of 11 of the 12 JAZ genes in Arabidopsis. We employed the protein synthesis inhibitor
cycloheximide, jasmonate measurements, and two well-defined jasmonate mutants (coiI-
1 and jar] -1) to study the mechanism by which tissue damage activates the expression of
JAZ and other early response genes. Our results support a model in which wound-induced

ll
FCO

jasmonate synthesis triggers SC -mediated degradation of JAZ repressors and

subsequent expression of early genes that further regulate the response both positively

54

and negatively. These regulatory circuits have the potential to orchestrate host defenses
that are commensurate with the intensity and duration of herbivore attack. We also

provide evidence that J AZ proteins play a role in plant defense against insect herbivores.

RESULTS

Feeding by Lepidopteran Herbivores Induces JAZ Expression

The central role of j asmonate signaling in plant resistance to lepidopteran insects led us to
investigate whether members of the Arabidopsis JAZ family are differentially regulated
in response to feeding by the generalist Spodoptera exigua. S. exigua larvae were allowed
to feed on rosette leaves for either 2 or 24 h. Damaged (local) and undamaged (systemic)
leaf tissue was harvested for RNA extraction and gel blot analysis with gene-specific
probes for each of the 12 members (JAZ1 -— JAZ12) in the Arabidopsis JAZ family (Chini
et al., 2007; Thines et al., 2007; Vanholme et al., 2007). Insect feeding resulted in
increased expression of all JAZ3, except JAZ11, in damaged leaves (Fig. 2.1A). Various
members of the JAZ family were expressed at different levels in herbivore-challenged
plants. For example, JAZ1, JAZZ, JAZS, JAZ6, JAZ9, JAZIO and JAZIZ transcripts
accumulated to relatively high levels in damaged leaves, whereas JAZ3, JAZ4, JAZ 7, and
JAZ8 showed weaker expression. Herbivore-induced expression of JAZ4 was very weak,
and detection of these transcripts required prolonged exposure of autoradiographic films.
In damaged leaves, transcript levels of most of the inducible JAZs at the 24 h time point
were similar to or slightly greater than those at the 2 h time point. Several JAZs (e.g.,
JAZ1) were also systemically expressed within 2 h of the onset of insect feeding,

indicating that both the local response is relatively rapid (i.e., < 2 h). These results

55

demonstrate that feeding by a lepidopteran insect results in major re-programming of JAZ
expression, and that different JAZ genes exhibit distinct patterns of herbivore-induced

expression.

The Jasmonate Pathway Mediates Rapid Induction of JAZ Genes in Response to
Mechanical Wounding
We next performed RNA blot analyses to determine the JAZ expression pattern in rosette
leaves subject to mechanical wounding with a hemostat. Similar to the results obtained
with insect feeding, all JAZ mRNAs except JAZ] I accumulated in mechanically damaged
leaves (Fig. 2.18). Expression of JAZ], JAZZ, JAZS, JAZ6, JAZ7, JAZ8, and JAZ9 was
strongly induced within 30 min of wounding, with mRNA levels declining at later time
points. In contrast to these genes, wound-induced accumulation of JAZ3, JAZ4, JAZIO,
and JAZ/2 mRNAs was delayed and weaker. Although the overall JAZ expression
patterns elicited by mechanical wounding and herbivory by S. exigua were qualitatively
similar, some reproducible quantitative differences were also apparent. For example, we
reproducibly observed that JAZ 7 and JAZ8 mRNAs accumulated to lower levels (relative
to other JAZ transcripts) in insect-damaged leaves compared to mechanically damaged
leaves. Because the specific activity of radiolabeled JAZ probes and autoradiographic
film exposure times were similar for each JAZ analyzed, this observation suggests that
JAZ7 and JAZ8 expression is either enhanced by mechanical damage or suppressed by
insect feeding.

Plants harboring null mutations in C01] provide a useful tool to determine the

contribution of the jasmonate pathway to the expression of wound-responsive genes.

56

Previous studies with the jasmonate-insensitive Arabidopsis coil mutant (Feys et al.,
1994) have defined general classes of genes whose wound-induced expression is either
strictly dependent on C011, partially dependent on C011, or completely independent of
C011 (Titarenko et al., 1997; Reymond et al., 2000; Cruz Castillo et al., 2004; Devoto et
al., 2005; Koo et al., 2006). To determine the extent to which COI] regulates the wound-
induced expression of JAZ genes, we assessed the expression pattern of selected JAZs in
wild-type (WT) and coil plants (Fig. 2.2). MYC2 expression was also analyzed in these
experiments because this gene is known to be induced by wounding in a C011-dependent
manner (Lorenzo et al., 2004). The results showed that accumulation of all wound-
inducible JAZ mRNAs and MYC2 was largely dependent on COIl (Fig. 2.2). Prolonged
exposure times of autoradiographic film (data not shown), however, indicated that all
JAZs were expressed at low levels in the coil mutant. This experiment also showed that
wound-induced accumulation of M YCZ and several JAZ transcripts occurred within 15

min of leaf damage, which prompted us to further investigate the timing of the response.

Rapid Activation of JAZ Genes is Correlated with JA and JA-Ile Accumulation

To define more precisely the timing of the wound response, we assessed the expression
level of various genes at very early time points after wounding. The steady-state level of
JAZ], JAZ5, JAZ 7, and MYC2 transcripts increased within 5 min of wounding (Fig. 2.3A),
as did the expression of JAZZ, JAZ6, and JAZ9 (data not shown). Quantification of 32P-
Iabeled probe intensities on RNA blots showed that the level of JAZ 7 mRNA increased ~
l3-fold during the first 5 min afier wounding. The strong dependence of wound-induced

JAZ expression on COIl (Fig. 2.2) indicated that increased expression of these genes is

57

likely triggered by elevated jaSmonate levels. We used liquid chromatography-mass
spectrometry (LC-MS) to measure JA and JA-Ile levels at early time points after
mechanical damage (Fig. 2.38 and C). The levels of JA and JA-Ile in undamaged leaves
were 29.5 :I: 11.2 and 4.5 d: 1.3 pmol/g fresh weight (FW) tissue, respectively. These
levels increased by ~25-fold (to 784 :t 99 and 111 d: 4, respectively) within the first 5 min
after wounding. At the 30-min time point, JA and JA-Ile levels increased to 4402 d: 499
and 972 i 132 pmol/g FW, respectively. The steady increase in JA and JA-Ile levels
during the first 30 min after wounding was tightly correlated with changes in gene
expression. In the latter half of the time course, decreased JAZ 7 and MYC2 mRNA levels

were correlated with waning J A-Ile accumulation.

Wound-induced JAZ Expression Does Not Require JARl

To test further the hypothesis that wound-induced, C011-dependent expression of JAZ
genes is mediated by JA-Ile, we analyzed the pattern of wound-induced gene expression
in the jar] -1 mutant that is impaired in the conversion of JA to JA-Ile (Staswick et al.,
2002; Staswick and Tiryaki, 2004). As shown in Fig. 2.4, the level of JAZ5, JAZ7, and
MYC2 transcripts in wounded jarI-l plants was comparable to that observed in WT
plants. Parallel analysis of gene expression in the coil -1 mutant confirmed that the
induced expression of these genes is dependent on an intact jasmonate signaling pathway.
Similar results were obtained for two JA biosynthesis genes, ALLENE OXIDE
SYNTHASE (AOS) and 12-0PDA REDUCTASE3 (OPR3), whose wound-induced

expression is also C011-dependent (Reymond et al., 2004; Devoto etal., 2005; Koo et al.,

58

2006). These findings indicate that JARl activity is not strictly required for wound-

induced expression of these jasmonate-responsive genes.

JAZ, MYC2, and JA Biosynthetic Genes are Primary Response Genes in the
J asmonate Signaling Pathway

The current model of jasmonate signaling indicates that JAZ genes are transcribed by
MYC2 following jasmonate-induced degradation of one or more J AZ repressors (Chini et
al., 2007; Thines et al., 2007). This model implies that JAZs are primary response genes
in the jasmonate signaling pathway, which is consistent with their rapid induction
following mechanical wounding (Figs. 2.2 and 2.3A). To test directly whether JAZs are
primary response genes, we used the protein synthesis inhibitor cycloheximide (CHX) to
determine whether jasmonate-induced expression of JAZs and MYC2 requires de novo
protein synthesis. Treatment of liquid-grown seedlings with MeJA induced the
expression of JAZs and MYC2, as expected (Fig. 2.5A). CHX treatment resulted in the
accumulation of MYC2, JAZ], JAZIO and all other JAZ transcripts except JAZII (Fig.
2.5A and data not shown). Induction of JAZs and M YC2 by MeJA was not inhibited by
CHX. Rather, seedlings treated with both MeJA and CHX accumulated higher levels of
these mRNAs than seedlings treated with either compound alone (Fig. 2.5A). These
results support the notion that JAZs and MYC2 are primary response genes. VSPI and
LOXZ were used as markers for secondary response genes. In agreement with previous
reports (Rojo et al., 1998; Jensen et al., 2002), we found that MeJA-induced expression
of VSPI and LOXZ was blocked by CHX. The conclusion that JAZ/MYC2 and

VSPI/LOXZ are primary and secondary response genes, respectively, is supported by

59

differences in their temporal expression patterns: JAZ and M YC2 transcript levels peaked
early (e.g., 0.5 h) after hormone treatment, whereas VSPI and LOXZ expression was
delayed and more gradual.

We used the Expression Angler data-mining tool (Toufighi et al., 2005) to
identify genes that are co-regulated with JAZs. Among the genes that were consistently
identified as being co-expressed with JAZs and MYC2 in both hormone and pathogen
data sets were several JA biosynthetic genes, including LIPOXYGENASE3 (LOX3),
LOX4, ALLENE OXIDE SYNTHASE (AOS), ALLENE OXIDE CYCLASE3 (AOC3), 12-
OPDA REDUCTASE3 (OPR3), and OPC-8:0 CoA LIGASE (OPCLI) (Table SI). LOXZ
was not identified in this list of co-regulated genes. We therefore hypothesized that, like
JAZ and MYC2, co-regulated JA biosynthesis genes are primary response genes in the
jasmonate signaling pathway. To test this idea, we compared the effects of MeJA and
CHX treatments on the expression of IA biosynthesis genes to those of JAZ and MYC2.
As shown in Fig. 2.5A, the MeJA- and CHX-induced expression patterns of LOX3, LOX4,
AOS, AOC3, OPR3, and OPCLI were very similar to those of JAZ], JAZIO, and MYC2.
Specifically, the MeJA-induced expression of these JA biosynthesis genes was not
inhibited by CHX, and the effects of MeJA and CHX were additive. Moreover, the
timing of MeJA-induced expression of these JA biosynthesis genes, iwith the exception of
AOC3, was similar to that of M YC2 and JAZI/JAZIO.

The JAZ repressor model predicts that CHX-induced expression of primary
response genes results from cellular depletion of one or more JAZ repressors. Because
CHX blocks de novo synthesis of JAZ proteins, the ability of CHX alone to activate

primary response genes (Fig. 2.5A) suggests that JAZ repressors are highly unstable in

60

WT seedlings, even in the absence of exogenous jasmonate. To test the hypothesis that
SCFCO” contributes to JAZ turnover in the absence of exogenous MeJA, we determined
the expression pattern of JAZ, MYC2, and JA biosynthesis genes in WT and coil
seedlings treated with either CHX or a mock control (Fig. 2.58). CHX-induced
accumulation of primary gene transcripts was severely attenuated in coil compared to
WT seedlings. Interestingly, the accumulated level of JAZ] and M YCZ mRNAs in CHX-
treated coil plants was much greater than that of other genes tested (JAZ 7, JAZIO, AOS,
and OPR3). CHX-induced expression of JAZZ, JAZ5, and JAZ9 was also strongly
suppressed in coil plants (data not shown). These results are consistent with the idea that
COII promotes the turnover of JAZ repressors even in the absence of exogenous

j asmonate.

Wound-Induced JA Accumulation is Dependent on C01]

The finding that CHX-induced expression of A OS and OPR3 is dependent on COII (Fig.
2.5B) is consistent with other studies showing that wound- and jasmonate-induced
expression of these genes requires COII (Reymond et al., 2000; Cruz Castillo et al.,
2004; Devoto et al., 2005; Koo et al., 2006). To directly test the idea that CO“ activity
promotes JA production in response to wounding, we used gas chromatography-mass
spectrometry (GC-MS) to measure JA levels in unwounded (control) and mechanically
damaged leaves of WT and coil plants (Fig. 2.6). The basal level of JA in unwounded
WT and coil plants was not significantly different (0.20 i 0.07 and 0.19 d: 0.09 nmol/g
F W tissue, respectively). The JA content in WT plants increased rapidly after wounding,

with peak levels (6.94 3: 0.42 nmol JA/g FW) attained 1 h after treatment. In comparison

61

to this robust response, wounded coil leaves were severely deficient in JA accumulation.
Mechanical wounding increased the IA content in WT and coil leaves by approximately
35-fold and 4-fold, respectively, at the I h time point. The amount of JA in coil leaves at
all time points after wounding ranged between 9 and 14% of WT levels. These results
demonstrate that COII activity plays an important role in promoting the accumulation of

JA in wounded Arabidopsis leaves.

Disruption of Jasmonate Signaling by a Truncated Form of JAZI Compromises
Resistance to S. exigua Feeding

JAZ proteins that lack the C-terminal J as motif reduce the plant’s sensitivity to jasmonate
and, as a consequence, cause several jasmonate-related phenotypes (Chini et al., 2007,
Thines et al., 2007, Yan et al., 2007). To test whether such truncated JAZ derivatives
alter host resistance to herbivory, we compared the defense response of S. exigua-
challenged WT plants to that of a previously characterized transgenic line (Thines et al.,
2007) expressing a Jas-motif-deleted form (JAZIA3A) of JAZl. As shown in Fig. 2.7A
and B, larvae reared on JAZIA3A plants gained significantly more weight than larvae
grown on WT plants (Student’s t test, P < 0.0001). Thus, perturbation of jasmonate
signaling by overexpression of JAZIA3A decreases host resistance to S. exigua feeding.
RNA blot analysis was used to determine the effect of JAZIA3A on the expression of
various wound-response genes. In WT plants subjected to insect feeding for 13 d, M YC2,
JAZ5, OPR3, and VSPl transcripts were highly elevated in comparison to untreated
control plants (Fig. 2.7C). Herbivore-induced levels of MYC2, JAZ5, and OPR3 mRNAs

in JAZIA3A plants were significantly less than those in the WT. The expression level of

62

VSPI in insect-damaged JAZIA3A plants, however, was similar to that in WT plants (Fig.
2.7C). These findings indicate that decreased resistance of JAZIA3A plants to S. exigua
feeding is correlated with reduced expression of some, but not all, jasmonate responsive

genes.

DISCUSSION

Wound-Induced Expression of JAZ Genes in Arabidopsis

The recent discovery of J AZ proteins as negative regulators of jasmonate signaling marks
an important advance in our mechanistic understanding of how plants respond to biotic
stress through changes in growth- and defense-related processes (Chini et al., 2007;
Thines et al., 2007; Yan et al., 2007). Given the central role of jasmonates in the control
of induced resistance to insect attack, we initiated the present study with the goal of
characterizing the expression pattern of the Arabidopsis JAZ family in response to
mechanical wounding and herbivory. With the exception of JAZII, all JAZs exhibited
increased expression in response to both mechanical wounding and feeding by S. exigua
larvae. The various wound-responsive JAZs showed differences in the timing and
amplitude of expression. Most JAZs (e.g., JAZI) were expressed strongly and rapidly (i.e.,
<0.5 h) in response to mechanical wounding. Induced expression of other JAZs, including
JAZ3, JAZ4, JAZIO, and JAZIZ, was temporally delayed and relatively weak by
comparison. Our results are in good agreement with previous studies showing that most
JAZ genes are rapidly induced by jasmonate treatment (Chini et al., 2007; Thines et al.,
2007), and that some Arabidopsis JAZs are wound responsive (Yan et al., 2007). Wound-

induced expression of JAZ genes in poplar (Major and Constabel, 2006) and tomato (L.

63

Katsir and G.A. Howe, unpublished results) has also been observed, indicating that this
phenomenon is conserved in the plant kingdom.

All JAZ genes induced by mechanical wounding were also induced by S. exigua
feeding. This finding is consistent with studies showing that mechanical tissue damage
and herbivory (or simulated herbivory) elicit similar, although not identical, changes in
gene expression (Reymond et al., 2000; Major and Constabel, 2006; Mithofer et al.,
2005; Ralph et al., 2006). We cannot exclude the possibility that mechanical wounding
and herbivory elicit quantitative differences in JAZ expression. It is interesting to note,
for example, that JAZ 7 and JAZ8 mRNAs accumulated to lower levels in insect-damaged
leaves compared to mechanically damaged leaves, which suggests that JAZ7 and JA28
expression may be suppressed by insect feeding. Previous studies have provided evidence
for compounds in insect oral secretions that suppress the expression of host plant
defenses (Schittko et al., 2001; Musser et al., 2005).

The physiological significance of wound-induced JAZ expression remains to be
determined. Based on the function of JAZ proteins as repressors of jasmonate-responsive
genes, however, it was suggested that rapid synthesis of new JAZ proteins serves to
attenuate the transcriptional response soon after it is initiated (Thines et al., 2007). In the
context of plant defense responses to herbivory, wound-induced production of JAZ
proteins may provide a mechanism to restrain the expression of energetically demanding
defensive processes. Such restraint may be particularly important when jasmonate levels
decline, for example upon cessation of insect feeding. This putative mechanism of
negative feedback control suggests that jasmonate-based defenses operate more as a

dynamic continuum than as discrete induced and uninduced states.

64

Rapid Wound-Induced Expression of JAZs is Mediated by the J asmonate Pathway
We found that wound-induced expression of JAZs and MYC2 occurs within the first 5
min after tissue damage. Moreover, the accumulation of these transcripts was tightly
correlated with large (~25-fold) increases in the level of JA and JA-Ile. Based on the
magnitude (i.e., >10-fold induction) of the increase in both hormone and transcript (e.g.,
JAZ7) levels at this early time point, the actual time between wound trauma and
transcriptional activation is likely much shorter than 5 min. The timing of this wound
response is thus comparable to other rapidly induced hormonal effects, including auxin-
induced expression of AUX/1AA genes (Abel et al., 1995). An important physiological
function of both JAZ and Aux/1AA repressor proteins is their ability to promote rapid
changes in gene expression by inhibiting the activity of transcription factors that are
poised to act immediately upon hormone-induced removal of the repressor. Degradation
of JAZ repressors following perception of a wound-induced jasmonate signal would
enable the host plant to respond rapidly to insect attack.

The dependence of wound-induced JAZ expression on COIl (Fig. 2.2; Yan et al.,
2007) indicates that a primary jasmonate signal(s) produced in wounded tissue triggers
SCFCOH/26S proteasome-mediated destruction of JAZ repressors and subsequent
transcription of early response genes. The correlation between gene expression and
accumulation of JA and JA-Ile in damaged leaves (Fig. 2.3) suggests that JA and/or JA-
Ile could function as a primary wound signal. The ability of JA-Ile, but not JA/MeJA, to
promote COIl interaction with JAZI argues in favor of JA-Ile as the active signal, as
does the established role of this conjugate in plant responses to biotic stress (Staswick et

al., 1998; Kang et al., 2006). Surprisingly, however, wound-induced expression of C011-

65

dependent genes in the JA-Ile-deficient jarl -1 mutant was not significantly impaired (Fig.
2.4). One interpretation of this result is that JA is indeed inactive and that the jarl-I
mutant produces a sufficient amount of JA-Ile to promote the expression of wound
responsive genes. It was recently shown that jarI-l reduces JA-Ile accumulation in
wounded leaves to approximately 10% of WT levels and that the pool of JA-Ile in jar] -1
plants results from the activity of another JA-conjugating enzyme (P. Staswick, personal
communication). Thus, JARI is not strictly required for wound-induced expression of
C011-dependent genes. An alternative explanation for our results is that the primary
jasmonate signal is J A or a J A derivative whose synthesis does not depend on JARl. This
hypothesis is supported by recent work indicating that JA or one of its precursors or
metabolites complements the function of JA-Ile in promoting defense responses in N.
attenuata (Wang et al., 2008). The hypothesis that JA is active per se as a signal predicts
the existence of one or more JAZ proteins whose interaction with C011 is promoted by
JA. It will thus be important to determine the jasmonate specificity of the complete
repertoire of JAZ proteins in plants such as Arabidopsis that have a well-defined JAZ

family.

Positive Feedback Regulation of JA Biosynthesis is a Primary Response of
Jasmonate Signaling

Hormone-induced changes in physiology typically involve the expression of primary
response genes that, in turn, control secondary transcriptional responses. The protein
synthesis inhibitor CHX provides a useful reagent to identify primary and secondary

response genes in the jasmonate signaling pathway (van der Pits and Memelink, 2001;

66

Pauw and Memelink, 2005). The ability of CHX to block MeJA-induced expression of
LOX2 and VSPI indicates that these genes are secondary response genes, in agreement
with previous studies (Rojo et al., 1998; Jensen et al., 2002). In contrast to LOX2 and
VSPI, the insensitivity of MeJA-induced MYC2 and JAZ expression to CHX indicates
that these genes can be classified as primary response genes. This interpretation is
consistent with the ability of MYC2 to recognize the G-box motif found in the promoter
of JAZ genes, and the proposed direct inhibitory action of JAZ3 on MYC2 (Chini et al.,
2007). There is also evidence to indicate that MYC2 binds to a G-box motif in the MYC2
promoter, thereby regulating its own transcription (Dombrecht et al., 2007). We thus
suggest a scenario in which CHX-induced turnover of JAZ repressors releases JAZ-
mediated inhibition on MYC2, which would then transcribe JAZ, MYC2 and other target
genes. Our results differ from those of Dombrecht et al. (2007), who reported that MYC2
is a secondary response gene. These workers also reported that the expression of VSPl,
although a secondary response gene, is induced by CHX, whereas our results and those of
Rojo et al. (1998) indicate that VSPI is not induced by CHX. These discrepancies may
reflect differences in the methodology of the plant treatments or transcript quantification.
Several studies have shown that Arabidopsis genes encoding JA biosynthetic
enzymes are upregulated via the jasmonate/C011 pathway in response to wounding and
jasmonate treatment (Sasaki et al., 2001; Reymond et al., 2000; Stenzel et al., 2003;
Devoto and Turner, 2005; Koo et al., 2006). The generally accepted view of this
regulatory phenomenon is that it provides a positive feedback mechanism to reinforce or
amplify the plant’s capacity to synthesize J A in response to long-term environmental (e.g.,

herbivory) or developmental cues (Stenzel et al., 2003; Farmer, 2007; Wastemack, 2007).

67

Although the sensitivity of MeJA-induced LOX2 expression to CHX suggests that this
feedback mechanism is a secondary response, our results indicate that many other known
or putative JA biosynthetic genes are primary targets of jasmonate signaling. First, we
observed that AOS, AOC3, OPR3, OPCLI, LOX3, and LOX4 (but not LOX2) are tightly
co-regulated with MYC2 and JAZs (Table S1). Second, these biosynthetic genes were
induced by CHX treatment, and superinduced in response to treatment with both MeJA
and CHX. Finally, CHX-induced expression of AOS and OPR3 was largely dependent on
COIl. We thus conclude that JA biosynthetic genes, like JAZ genes, are negatively
regulated by one or more labile proteins whose turnover is dependent on COIl activity.
JAZ proteins are obvious candidates for such repressors.

Among the five LOXs in Arabidopsis, LOX2 is the only isoforrn known to be
involved in IA biosynthesis (Bell et al., 1995). The sequences of LOX3 and LOX4
predict that they are 13-LOXs that, like LOX2, catalyze formation of JA precursors in the
plastid (Feussner and Wastemack, 2002; Liavonchanka and Feussner, 2006). The co-
expression of LOX3 and LOX4 with other JA biosynthesis genes (Fig. 2.4 and Table
S2.l) leads us to speculate that these LOXs may also serve a role in JA synthesis.
Rigorous testing of this idea will require analysis of 10x3 and 10x4 mutants.

Our observation that coil plants are severely deficient in wound-induced JA
accumulation supports the idea that JA biosynthesis is regulated by a positive feedback
loop (Farmer, 2007; Wastemack, 2007). Given the jasmonate/COIl-dependent
expression of JA biosynthesis genes, one interpretation of this finding is that coil leaves
contain limited amounts of one or more JA biosynthetic enzymes. Support for this idea

comes from the observation that unwounded leaves of the opr3 mutant contain

68

significantly reduced levels of AOC protein (Stenzel et al., 2003). This scenario is clearly
different from WT in plants in which wound-induced JA biosynthesis is limited by
substrate availability rather than by the level of octadecanoid pathway enzymes (Stenzel
et al., 2003; Wastemack, 2007). It is also possible that the JA deficiency in wounded coil
leaves reflects reduced amounts of the initial substrate for JA synthesis, or the increased
activity in the mutant of an enzyme that metabolizes JA. The former hypothesis is
supported by recent work showing that coil plants are deficient in the accumulation of
OPDA- and dinor-OPDA-containing galactolipids that may function as precursors for J A

synthesis (Buseman et al., 2006; Kourtchenko et al., 2007).

Regulation of Early Response Genes by JAZ Repressors

The identification of JAZ proteins as negative regulators that link the action of SCFCOIl to
transcription factors such as MYC2 has led to a relatively simple model of jasmonate
signaling (Thines et al., 2007; Chini et al., 2007). One prediction of this model is that the
jasmonate-insensitive phenotype of coil plants results from the accumulation of JAZ
repressors. Our results provide indirect support of this idea. First, wound-responsive JAZ
genes exhibit low basal expression in the coil mutant, indicating that JAZ proteins are
likely synthesized in the coil mutant. Similar results were obtained for JAZ genes in the
C011-deficient jail -1 mutant of tomato (L. Katsir and G.A. Howe, unpublished results).
Second, our data showing that CHX-induced accumulation of JAZ transcripts is
attenuated in coil seedlings is consistent with the idea that JAZ proteins are destabilized
by SCFCOH-mediated ubiquitination (Chini et al., 2007; Thines et al., 2007). Taken

together, these findings imply that JAZ proteins are more stable in the absence of

69

SCFCO" ligase activity and, as a consequence, accumulate in coil plants to levels that
effectively repress gene expression. This model predicts that JAZ repressors also
accumulate in mutants that are deficient in JA synthesis. Measurement of JAZ protein
levels in wild-type, coil, and jasmonate synthesis mutants will provide an important test
of this hypothesis.

It is interesting to note that the coil mutation had a differential effect on CHX-
induced expression of various primary response genes. For example, coil nearly
abolished CHX-induced accumulation of JAZ7 mRNA, whereas JAZI and MYC2
transcripts persisted to higher levels in CHX-treated coil seedlings. One interpretation of
this finding is that different JAZ genes are repressed by different JAZ proteins. For
example, rapid accumulation of JAZ 7 transcripts in CHX-treated WT but not coil
seedlings suggests that the JAZ repressor of JAZ 7 is relatively stable in the absence of
€011. Likewise, the putative JAZ repressor of JAZI and MYC2 would appear to be less
stable in the absence of €011. Chini et al. (2007) demonstrated that MYC2 interacts
directly with JAZB. Because MYC2 is implicated in the transcriptional regulation of most
JAZ genes (Chini et al., 2007), we speculate that JAZ proteins other than JAZ3 also
inhibit MYC2 function. Other interpretations, including differential distribution of
positively acting transcription factors at various JAZ promoters, or differences in the
stability of JAZ mRNAs, may also explain why coil differentially affects CHX-induced

expression of different primary response genes.

70

A Role for JAZ Proteins in Defense Against Insect Herbivores
We found that S. exigua larvae reared on JAZIA3A plants gained significantly more
weight than larvae reared on WT plants (Fig. 2.7). This result provides evidence that JAZ
proteins play an important role in regulating the expression of plant processes that confer
resistance to insect herbivores. The increased susceptibility of JAZIA3A plants to S.
exigua can most likely be attributed to the fact that this mutant exhibits decreased
responsiveness to JA and several other coil -Iike phenotypes, including male sterility
(Thines et al., 2007). The reduced accumulation of various wound/jasmonate-responsive
transcripts in herbivore-challenged JAZIA3A plants is consistent with this interpretation.
Moreover, recent studies have shown that S. exigua larvae perform better on coil than
WT plants (Mewis et al., 2005; 2006).

JAZIA3A mutants are presumably deficient in defensive compounds that normally
act to deter S. exigua feeding on WT plants. Some Arabidopsis VSPs are expressed in a
C011-dependent manner and are known to function as anti-insect proteins (Benedetti et
al., 1995; Liu et al., 2005). However, because herbivore-treated JAZIA3A plants were not
significantly affected in VSPl expression, we do not favor this hypothesis. Mewis and co-
workers demonstrated that increased performance of S. exigua on the coil mutant
correlates with reduced production of glucosinolates, which have a well-established role
in defense against generalist herbivores such as S. exigua (Mewis et al., 2005; 2006). This
observation raises the possibility that JAZIA3A plants are defective in glucosinolate-
based defenses. Transgenic expression of JAZIA3A or other C-terminally-truncated

JAZs may provide a useful approach to further understand the many C011-dependent

71

processes that confer plant protection to insect herbivores and other forms of

environmental stress.

MATERIALS AND METHODS

Plant Material and Growth Conditions

ArabidOpsis thaliana ecotype Columbia-0 (Col-0) was used as the wild type (WT) for all
experiments. Soil-grown plants were maintained in a growth chamber at 21°C under 16 h
light (100 uE m'2 s") and 8 h dark. For growth of seedlings in liquid media, seeds were
surface-sterilized with 30% (v/v) commercial bleach for 15 min and washed ten times
with sterile water. Approximately 100 seeds were placed in 50 mL Murashige and Skoog
(MS) medium in a 125-mL Erlenmeyer flask. The flasks were placed at 4°C for four d in
darkness, and then incubated under normal growth conditions (described above) for 12 d
prior to treatment. Flasks were rotated on an orbital shaker (150 rpm) for the duration of
the experiment. Seeds collected from heterozygous coil -1 plants (Feys et al., 1994) were
germinated on MS medium containing 50 11M MeJA to select for jasmonate-insensitive
coil-l homozygous plants, which were then transferred either to soil or MS liquid
medium for further experiments. Seed for the jar] -1 mutant (Staswick et al., 2002) was
obtained from the Arabidopsis Biological Resource Center. The jasmonate-insensitive
root growth phenotype of jarI-l plants was verified by germinating seeds on MeJA-
containing MS medium (Staswick et al., 2002). A male sterile line of Arabidopsis
expressing the 35S-JAZIA3A-GUS transgene (Thines et al., 2007) was propagated by
outcrossing to wild-type pollen. F1 progeny containing the transgene were selected on

MS medium containing kanamycin (50 ug/mL).

72

Plant Treatments

Spodoptera exigua eggs were obtained from Benzon Research (Carlisle, PA) and hatched
at 27°C. For the insect feeding experiment shown in Fig. 2.1A, newly hatched larvae
were transferred to a petri dish and reared on Arabidopsis leaves for 3 to 4 d. Prior to the
feeding experiment, second instar larvae were transferred into a new petri dish and
starved for 14 h. Approximately 10 larvae were transferred to fully expanded rosette
leaves (2 to 3 larvae per leaf) on 5-week-old plants. Insect-challenged and control
unchallenged plants were maintained under continuous light at 26°C. Two h after transfer
of larvae to the plants, insect-damaged leaf tissue was harvested for RNA extraction.
Approximately 5% of the leaf area (local response) was removed by feeding at this time
point. A second set of plants was used to collect tissue for the 24 h time point, at which
time 20 to 60% of the leaf area was damaged by herbivory. Undamaged leaves from
challenged plants were harvested at both the 2 and 24 h time points to determine the
effect of insect feeding on systemic expression of JAZ genes.

For the herbivore performance assay shown in Fig. 2.7, newly hatched
Spodoptera exigua larvae were transferred to five-week-old wild-type and JAZ 1A3A -GUS
plants. Eight larvae were reared on each of 48 wild-type and 48 transgenic plants. Plants
were maintained under standard grth conditions (see above). The weight of individual
larvae was determined 9 d after the start of the feeding trial. Larvae were returned to the
same set of plants and, after 4 additional days of feeding, were weighed again.

For mechanical wound treatments, fully expanded rosette leaves on 5-week-old plants
were wounded three times by crushing the leaf across the mid-rib with a hemostat. This

wounding protocol, which resulted in damage to ~40% of the leaf area, was administered

73

to ~six rosette leaves per plant. At various times after wounding, damaged leaves were
harvested, immediately frozen in liquid nitrogen, and stored at -80°C until use for RNA
extraction.

Stock solutions (100 mM) of MeJA and CHX (Sigma) in dimethyl sulfoxide (DMSO)
were added to liquid cultures of Arabidopsis seedlings (see above) to a final
concentration of 50 M. To determine the effect of CHX treatment on MeJA—induced
gene expression, liquid-grown seedlings were pretreated with 50 uM CHX for 1.5 h prior
to the addition of MeJA. Seedlings were treated with 0.2% (v/v) DMSO as a mock
control. At various times after treatment, seedlings were harvested, frozen in liquid

nitrogen, and stored at -80°C until needed for RNA extraction.

Quantification of Jasmonate Levels

Leaf extracts were prepared essentially as described by Wang et al. (2007), with minor
modifications. Briefly, 400 to 500 mg of leaf tissue was frozen in liquid N2 and ground
to a fine powder with a mortar and pestle. Dihydro-JA and l3C-JA-Ile were added as
internal standards for quantification of JA and JA-Ile, respectively. Following addition of
2.5 mL ethyl acetate, homogenates were mixed and centrifuged at 12,000g for 10 min at
4°C. The supernatant was transferred to a new glass tube and the pellet was re-extracted
with 1 mL ethyl acetate. The combined extracts were evaporated at 55°C under a stream
of N2 gas. The remaining residue was dissolved in 0.3 mL 70% methanol/water (v/v) and
filtered through a 0.2-uM PTFE membrane (Millipore, Bedford, MA). Compounds in the
resulting extract (5 uL sample per injection) were separated on a UPLC BEH C18

column (1.7 uM, 2.1 X 50 mm) attached to an Acquity Ultra Performance Liquid

74

Chromatography (UPLC) system (Waters Corporation, Milford, MA). A gradient of
0.15% aqueous formic acid (solvent A) and methanol (solvent B) was applied in a 3-min
program with a mobile phase flow rate of 0.4 mL/min. The column, which was
maintained at 50°C, was interfaced to a Quattro Premier XE tandem quadrupole mass
spectrometer (Waters Corporation, Milford, MA) equipped with electrospray ionization
(negative mode). Transitions from deprotonated molecules to characteristic product ions
were monitored for JA (m/z 209 > 59), dihydroJA (m/z 211>59), JA-Ile (m/z 322>l30),
and l3C6-JA-Ile (m/z 328>136) using a 20 V collision cell potential for each ion. Peak
areas were integrated, and the analytes were quantified based on standard curves
generated by comparing analyte responses to the corresponding internal standard. Details
regarding the performance of this method will be described elsewhere. Because this
method does not distinguish J A-Ile from JA-Leu, values reported for J A-Ile represent the
sum of JA-Ile plus JA-Leu (Wang et al., 2007). The level of JA-Leu in Arabidopsis
seedlings is reported to be <25% of JA-Ile levels (Staswick et al., 2004). l3C-JA-Ile was
synthesized by conjugation of cis-(i)-JA (Sigma, St Louis, MO, USA) to ['3c,]-L-
isoleucine (Cambridge Isotope Laboratories, Andover, MA, USA) as previously
described (Kramell et al., 1988; Staswick et al., 2004). For the experiment shown in Fig.
2.5, total JA was extracted from 200 to 300 mg of leaf tissue using a vapor phase
extraction method (Schmelz et al., 2004) and quantified by GC-MS as previously

described (Li et al., 2005).

75

RNA Gel-Blot Analysis

Primers used to amplify cDNA probes are described in Table S2. cDNAs were obtained
by reverse transcription (RT)-PCR of RNA isolated from wounded Arabidopsis (Col-O)
leaves. Amplified cDNA fragments were cloned into vector pGEM-T Easy (Promega)
and verified by DNA sequencing. These clones were used as templates for PCR reactions
with gene-specific primers (Table S2) to generate cDNA fragments that were used as
probes in RNA blot hybridization experiments. The nucleotide identity between all pair-
wise combinations of the 12 JAZ cDNAs ranged between 11 and 66%. The percent
nucleotide identity between the most closely related pairs of JAZ genes is: JAZI and
JAZZ, 66%; JAZ5 and JAZ6, 62%; and JAZ7 and JAZ8, 60%. Thus, under the high
stringency conditions used for hybridization experiments, full-length cDNA probes were
assumed to be gene specific. RNA extraction and gel-blot analyses were performed as
described previously (Li et al., 2002). Probed RNA blots were visualized with a
phosphorimager and the signal intensities quantified with the Quantity One-4.2.2
program (Bio Rad). Values for each time point were normalized to the AC T8 loading

control.

76

Figure 2.1. Expression of JAZ genes in response to herbivore feeding and mechanical
wounding.

(A) Five-week-oldwild-type plants were challenged with S. exigua larvae. At the indicated times
(h) after feeding, damaged local (L) leaves and undamaged systemic (S) leaves were harvested
for RNA extraction. A separate set of unchallenged plants was used as a control (C). Five
micrograms of total RNAwas loaded in each lane and blots were hybridized with the indicated
cDNA probes. A CTIN8 (ACTS) was used as a loading control. JAZ4- and JAZII-probed blots
were exposed to autoradiographic film for 16 h, whereas all other blots were exposed for 6 h. The
contrast of JAZ4-probed blots was adjusted to facilitate visualization of the JAZ4 signal.

(B) Five-week-old wild-type plants were wounded three times across the midrib with a hemostat
and damaged leaves were collected for RNA extraction at the indicated times (h) after wounding.
Ten micrograms of total RNA was loaded in each lane and blots were hybridized to gene-specific
probes for each of the 12 JAZ genes, as well as AC T 8 as a loading control. JAZ4-, JAle-, and
AC T 8-probed blots were exposed to autoradiographic film for 16 h, whereas all other blots were
exposed for 5 h.

77

JAZ1

JAZ2

JAZ3

JAZ4

JAZS

JAZG

JAZ7

JA28

JAZQ

JAZ10

JAZ11

JAZ12

ACTB

Time after feeding

 

211 2411

 

 

C L S C L S

 

 

 

 

 

 

 

 

 

 

 

rag-am...

 

 

 

 

 

 

 

 

 

 

 

 

 

a

 

 

 

”uflfi'wfiw

 

 

78

h:

JAZ1

JAZZ

JAZ3

JAZ4

JAZ5

JAZG

JAZ7

JAZ8

JAZ9

JAZ10

JAZ11

JAZ12

ACTB

Time after wounding

 

00.513 612

 

prim

 

 

fig“ W we

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

WT COI1-1
min: 0 15 3O 60 0 15 30 60

 

 

 

Q'W

JAZ1

 

 

JAZZ

 

 

JAZ3

 

 

JAZS

 

 

JAZ6

 

 

 

JAZ7

 

 

JAZ8

 

 

3'4. u» *3 M
JAZQ

 

 

 

 

JAZ10

 

 

M YCZ

 

 

 

ACT8 ..... "r" .. w" 1...... “- ---' w

 

 

 

Figure 2.2. Effect of the coil-I mutation on wound-induced expressionof JAZs.

Mechanical wound treatments and RNA gel-blot analysis were performed as described in the
legend to Figure 18. Damaged leaves were collected for RNA extraction at the indicated times
(min) after wounding. Blots were hybridized to gene-specific probes for each of the indicated JAZ
genes, M YCZ, and AC T8 as a loading control. All blots were exposed to autoradiographic film for
8 h.

79

Figure 2.3. Rapid induction of JAZ transcripts and accumulation of JAs in response to
mechanical wounding.

(A) RNA gel-blot analysis of JAZ expression in wounded leaves. Wound treatments and northem-
blot analyses were perforrned as described in the Figure 2.13 legend. Damaged leaves were
collected for RNA extraction at the indicated times (min) after wounding. M YCZ- and JAZ-probed
blots were exposed to autoradiographic film for 4 and 14 h, respectively.

(B) and (C) Time course of JA (B) and JA-Ile (C) accumulation in response to mechanical
wounding. Leaf tissue from the same set of plants used for RNA blot analysis (A) was harvested
at the indicated time points after wounding for extraction of JAs, as described in “Materials and
Methods”. JA and JA-Ile (measured as the total of JA-Ile plus JA-Leu) levels were determined
by liquid chromatography-mass spectrometry according to the procedure described in “Materials
and Methods.” Each data point represents the mean :tSD of four biological replicates.

80

0

Time after wounding (min)

 

JAZ1

l.___ _____ -_ ~.-.-...-..———. --.-

.— .

 

5 10 15 20 30 60

 

JA 25

 

 

 

JAZ7

 

 

 

M YC2

”qua--

 

 

 

 

 

JA (pmollg FW)

 

 

 

l l l 1 l I

10 20 30 40 50 60 70
Time after wounding (min)

 

1400

O

1 200
1 000
800
600
400

JA-lle (pmollg FW)

200

l

l

 

 

l 1 l L J L

 

10 20 30 40 50 60 70
Time after wounding (min)

81

WT coi1-1 jar1-1

 

 

 

MYCZ

JAZ5

JAZ7

 

AOS

OPR3

 

 

 

 

ACT8

 

 

 

 

Figure 2.4. Wound-induced expression of JA-responslve genes in the jarl-I mutant.

Five-week-old wild-type, coil-I, and jarI-I plants were mechanically wounded as described in
the legend to Figure 2.1B. Damaged leaves were collected for RNA extraction at the indicated
times (h) after mechanical wounding. Blots were hybridized to probes for MYC2, JAZ5, JAZ7,
two JA biosynthesis genes (AOS and OPR3), as well as ACT8 as a loading control. All blots
except AC T8 were exposed to autoradiographic film for 6 h. The AC T8 blot was exposed for 16 h.

82

a v no.“ Baaaomuflofia 203 $03 =< 96%

contempt ma vofiotoa 203 Ema—mam 83-6w <79— 93 EoEuwob XIU .mocow o>_m=o%8-<_. mo 2:88on counci¢nzo no 7:8 mo Locum Amy

.: m no.“ Bide—36833 82> $65 55o =a macho—LB

E 3 L8 EE 9 8898 203 803 concenékbq USN -mkbq ._obuoo wEUmS x mm vow: ma? EUV .93: 83 mecca c0822: 2: 8 33253
225 $03 EB 28— :08 E 893— mg, <Zm 130:0 mEEwEQME 02”— 45.58.: Loan 9: mafia @0529: 05 a 5:255 <ZM L8 880:8
2o; amigos 22E ...mooeoz as 282%.. a 83:88 a 930+sz 55 was <32 co accesses a s .0228 855:2vo :1
om .5): <3: :1 ow .635 .58 39.8 3.88 s has as, 858: one Sea: 2%: a $2» 85.83 oasis. ansozoaeg

 

 

 

2 :1

x10

...rmo:
..28

“WM... 8
xzo
ts

 

: _ “NS.

i .lll

. 1.3.3.1 2
x8:

 

.mouou o>_m=on_mo..-<_. :o “5:53.: oEEu—oaeomo no Baum .WN v.5»...—

wkU<

AWE. . Wm)

rill L.

I . ,Em>

 

 

”I .. ,rmmls Hun .

In..." moo cl l:i!

 

m «we a rial.“ a... o w w no a: E
x192. .20 2.. 095 <

83

8000

 

 

 

 

 

 

+ WT
—0— coi1-1
3
1.1.
g:
T: 40004
E
.9:
5., 2000 .
492 fie
0 . . . r .
0 1 2 3 4

Time after wounding (h)

Figure 2.6. coil-I plants are deficient in wound-induced accumulation of JA.

Rosette leaves on 5-week-old wild-type (black circles) and coil-1 mutant (white circles) plants
were mechanically wounded at the distal end with a hemostat. Wounded leaves were harvested
for JA extraction at the indicated times (h) after wounding. Unwounded leaf tissue was used as a
control for the 0-h time point. Each data point represents the mean iSD of three samples from
independent sets of plants.

84

 

5 +wr
5. -o—JAz1A3A

Larval weight (mg)
§

 

 

 

 

 

 

 

o .
Days of feeding

B C WT JAZ1A3A
C W C W
MYC2 O '-

JA25 '-
AOS '. '
OPR3 ! :-
vsp1 ! '

wr JAZ1A3A Ac"

 

 

 

Figure 2.7. JAZIA3A plants are compromised in resistance to feeding by S. exigua.

(A) Newly hatched S. exigua larvae were reared on wild-type (WT in the image) and JAZIA3A
transgenic plants. Larval weights were measured 9 and 13 d after the start of the feeding trial.
Values indicate the mean :l:SE. The number of wild-type-reared larvae at the 9- and l3-d time
points was 79 and 73, respectively, whereas the number of JAZIA3A-reared larvae was 87 and
111, respectively.

(B) Representative S. exigua larvae recovered wild-type and JAZIA3A plants at the 13-d time
point.

(C) Expression of various wound-responsive genes in undamaged control (C) and S. exigua-
damaged (W) wild-type and JAZIA3A plants. The arrow in C denotes a higher-Mr JAZI
transcript that presumably is derived from the JAZIA3A -GUS transgene. RNA was extracted
from S. exigua-damaged leaves collected at the 13-d time point, or from a set of undamaged
plants grown in parallel. Northem-blot analyses were performed as described in the Figure 2.1
legend.

85

100 ._ JAZ1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

64 ~-————— JAZZ
~—————JA25
100 JAZG
JAZ1 1
99 JAZ12
JAZ10
JAZQ
'“7 JAZ4
98 JA23
JAZ7
100 JAZ8
T

Supplemental Figure 2.1. Phylogenetic tree of Arabidopsis JAZ family.

The phylogenetic tree of twelve JAZ proteins was constructed with the Neighbor Joining (NJ)
method using MEGA 4 software (Molecular Evolutionary Genetics Analysis) available at
http://www.megasoftware.net/index.htrnl. Values on each node are percentage of bootstrap values
(only values greater than 50 are shown).

86

 

 

 

 

5 £8 E :3 a: 83 as a; a: 89 33 § 3 «.93
c2 2: 2: 2e 2: 2: 2: «5:.
ea 88 a: .33 2: at 5:. 2: E: a: 83 SE.
2: 8: ES 2: as 39° 2.. 2: as no; a?»
as 83 5 83 s: E «8... 2: 2: ca 9.8 mg
66 80.0 a: SS 2: ea 2: e2 2 c 83 Rs.
:9 and 5 82. 89 3:. as «Ed 2: E: as $8 «CNS.
2: E *8... as :2. at A49 88 a: 8a... 1.2 £5.
39 83 § mm; 2: 89 9o... 2: E: a: :2. Rs.
63 86... a: 83 2: 89 Rod 2: 2: c c «8.: «5%
E 23 E «:3 89 ES 89 Ed 3. :9 58 S 88... .NS.
288:< 8889‘ 8595. 885m? 86%an 816.? Summer: a
:80 Eco 89. mo... .23 .083 we»: a

 

 

«om Sea ESE—o: amoegxmaooz 05 5 85» 3655on <~ use NE. 50389 nose—oboe 5.5855 mo baa—ham .<

43qu 9305535 «A. .53 38055.3 one «one» NE. .—.N 03:. 32.059395

87

.mocow 8mmo5xoéo 808 2: 06 waoEa 8828 8: ”E: c

.85 boss 05 88:2: homo—o 82: 8:5 868538 08:3 beam a 82865 :7. 50 L85 :8 < .3055 9: so 85> 5.858 a mafia 88w
83655-8 50 a: 2: E 08w 2: so L85 x8 2: 3 858:8 885855 5 £882 .5085 86855.8 18:82 8 88:8 o._ so 83>
L =< 8:5 93 8238 85855-8 50 858 05 $5865 AEBoEooo 8:20on :89: 83>; an 9 858:8 033. 05 E 89:52 o
.85 E86 N3. 05 5:5 55855-8 muse? ionow 085.585 3. can NOE 9.632: .momow o>fi8=omoe8m a

.fiom 88 ...85 E 5085 so: 203 ~ NNVN. Ea

“4N3. .wwoesxmcogxx a flow 88 Am: 8.555 5 3s 2555: 05 556 5 88—5860 05 85 85% @382 8 beau a as 8a: 083 £3. 8% a

 

 

 

 

as was as Ea s: as 88 s: s: as 3 8S
2: s: s: s: a: s: E a; «5%
s: as 8:. s: s: s: s: 2.. EN:
as 88 as was as and as as; s: as as; :s mad 8.:
A8 5 83 as 58 as 88 s: as and as 38 s: 8%
as as; as 8a... as «.85 s: as Ed as :8 2.. 5%
as :8 As was as 8a... 2.. a: 88 as as; s: 8%
s: a: 28 as 88 s: a. sad as as; 2.. a8
2: cs 8:. a: as 8:. s: as 8:. as 8:. as“
as :8 a. :8 as 8:. as 3:. s: as 3:. as and 8%
as 28 as 88 as 83 s: s: as 88 s: as.
2885 888m? 8882 88.82 8892 8.292 8805. /
:80 88 8... «.3 sea axes 83 a

 

 

Low San— :omofiam mmo5xm80~< 05 E 88w 085585 S. was N3. :838 coca—0:8 558536 90 SE55 .m

855:8 —.N flash. _3=ofio_55=w

88

.n8((P0<h<80h0h<0800<<P§.b a

 

 

 

 

 

 

 

 

 

 

3n .n Oho<<o<h<oo<hoo<<<wgoh<ot<<9n m 88.82 ENS.
.20000E0h0h<<0<<h<050h<ooa a

v8 b-h000hoE<o<o<<<ooh§h u 883.? oNS.
.n.<ohwoo<»00h<<oh00p00p<t§-a a

8n .noghotéoogfioogzufluaa u. 8.89? mNS.
biowwwépwohoooépowohfiooxao5am, a

he .n-ooho<<<<<o»<oh<oh<oh<oh<§b n. 8382 RS.
.n-Eoo<<ot0<otoo<(<hofl<loaa a

c5 80500000o<<o<00oo<<ohoh<ot<<oum H. 8.892 oNS.
.n-Eo»<o<oo~<o<toow<p<hod§-a a

mam .n-poohgohgoégogozotx‘fiva ... 82.92 nNS.
.n-oE00hooowuh<<o<o»0h<0h§.m a

can .n-oE<o<ooo<<<hoo<0500h<§a u. 883,? vNS.
.n-bo<<o<<o<o<050<0<ootwuot<<0-a a

mac. .ndtoooohooE5<o<o<ooh<§a n. o8¢ofl< mNS.
.néohooioowghoghooo<tw<o05-.m m

o2 .nfiobuaaoowhoE0<oo~ob<ot<<¢a u 893.? «NS.
.n-o<woo<<<bowpow<oE<h<ohq<duHu-a a

85 .nfiotwhioobfiotofiuohepatic.a M. 83.9? .NS.

33 gm 888m BEE .oz _0< ~80

 

~33... £5 5 8m: 3928.:— KUA—hm 95 no 8% ufivuon—motcu 2: «Eu 825.:— 55 9898.. can E BEEP.— .N .N 935—. .3aqu_n.—=m

89

..wa

ms:

m8

how—

08

”Pm

owm

mks.

h:

 

.m-h0<(00t0<¢0t00<(<0h00b<00.b ~—
b-<00h0t((0h0<0t000k(§h u
.m.((000(00((<<<000000<0<0h-b a
.n¢((000(<0<0000000<0h<-.n n.
.n-h0000<00h00<<h0<00pmu80-b a
.n-POPOP<POOPOOhUtOtOtOmYb u.
.meEOG<.-.UO<<<<POP0<PO<-® m
.m-0<<0E<h0t000h<h0<.—.0<..n “—
.mOtOOOQSOOéEOEOOOPOP-b m
héhéb<0<0h<<h00<E08h$b u.
.m-0<0000t<0t0h0(((0<0h<huw w.
.8h<<.P—.O<0((<h00(:0000h<.b u.
.n-h<0<h00tOPOP8HOOPO§O<JO m
.900POCOOPO<O<O<POt<h0h<Jm ..h.
.m-<<0h<(<0htt<000<<t§-b m
.m-<0(h00000<t<0h0<0h<<§.m u.
b-t00h00t<(<00t0<0¢(<h8t<<0-h N.
.m-(000<0h(0(<0h00(<h0<0h(§b m

 

.n8<00h0(0<0h<0h<0<00h0<t§.b a

.n-<(<00((0h0t<0._.8t<00h<0t(<0.b u

Swamp?

omcwommfis

85882

8832‘

883.2

83.92

3.332

ogoopz

c.8882

canon?

cos—5:8 N .N 03:. ..aaufioimam

“ QOQO

MQQO

000<

m0<

VXOQ

nXOq

NXOq

NOS

Nch“.

s wNi.

9O

REFERENCES

Abel, S., Nguyen, M.D., Theologis, A. (1995). The PS-IAA4/5-like family of early
auxin-inducible mRNAs in Arabidopsis thaliana. J. Mol. Biol. 251: 533-549.

Abel, S. (2007). Auxin is surfacing. ACS Chem. Biol. 2: 380-384.

Balbi, V., Devoto, A. (2007). Jasmonate signalling network in Arabidopsis thaliana:
crucial regulatory nodes and new physiological scenarios. New Phytol. 122: 301-
318.

Bell, E., Creelman, R.A., Mullet, J.E. (1995). A chloroplast lipoxygenase is required
for wound-induced jasmonic acid accumulation in Arabidopsis Proc Natl Acad
Sci U S A 92: 8675-8679.

Benedetti, C.E., Xie, D., Turner, J.G. (1995). C011-dependent expression of an
Arabidopsis vegetative storage protein in flowers and siliques and in response to
coronatine or methyl jasmonate. Plant Physiol. 109: 567-572.

Browse, J. (2005). Jasmonate: An oxylipin signal with many roles in plants. Vitamins
and Hormones 72: 431-456.

Buseman, C.M., Tamura, P., Sparks, A.A., Baughman, E.J., Maatta, S., Zhao, J.,
Roth, M.R., Esch, S.W., Shah, J., Williams, T.D., Welti, R. (2006). Wounding
stimulates the accumulation of glycerolipids containing oxophytodienoic acid and
dinor—oxophytodienoic acid in Arabidopsis leaves. Plant Physiol. 142: 28-39.

Chini, A., Fonseca, S., Fernandez, C., Adie, B., Chico, J.M., Lorenzo, 0., Garcia-
Casado, G., Lopez-Vidriero, 1., Lozano, F.M., Ponce, M.R., Micol, J.L.,

Solano, R. (2007). The JAZ family of repressors is the missing link in jasmonate
signalling. Nature 448: 666-671.

Cruz Castillo, M., Martinez, C., Buchala, A., Metraux, J.P., Leon, J. (2004). Gene-
speciflc involvement of B-oxidation in wound-activated responses in Arabidopsis.
Plant Physiol. 135: 85-94.

Delker, C., Stenzel, 1., Hause, B., Miersch, 0., Feussner, 1., Wastemack, C. (2006).
Jasmonate biosynthesis in Arabidopsis thaliana - Enzymes, products, regulation.
Plant Biol. 8: 297-306.

Devoto, A., Ellis, C., Magusin, A., Chang, H.S., Chilcott, C., Zhu, T., Turner, J.G.
(2005). Expression profiling reveals COIl to be a key regulator of genes involved
in wound- and methyl jasmonate-induced secondary metabolism, defence, and
hormone interactions. Plant Mol. Biol. 58: 497-513.

91

Devoto, A., Turner, J.G. (2005). Jasmonate-regulated Arabidopsis stress signalling
network. Physiol. Plantarum 123: 161-172.

Dharmasiri, N., Dharmasiri, S., Estelle, M. (2005). The F-box protein TIRl is an auxin
receptor. Nature 435: 441-445.

Dombrecht, B., Xue, G.P., Sprague, S.J., Kirkegaard, J.A., Ross, J.J., Reid, J.B., Fitt,
G.P., Sewelam, N., Schenk, P.M., Manners, J.M., Kazan, K. (2007). MYC2
differentially modulates diverse jasmonate-dependent functions in Arabidopsis.
Plant Cell 19: 2225-2245.

Farmer, E.E. (2007). Plant biology: jasmonate perception machines. Nature 448: 659-
660

Feussner, 1., Wastemack, C. (2002). The lipoxygenase pathway. Annu. Rev. Plant Biol.
53: 275-297.

Fey, B., Benedetti, C.E., Penfold, C.N., Turner, J.G. (1994). Arabidopsis mutants
selected for resistance to the phytotoxin coronatine are male sterile, insensitive to
methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell 6: 751-759.

Gfeller, A., Liechti, R., Farmer, E.E. (2006). Arabidopsis jasmonate signaling pathway.
Sci STKE 2006: cm].

Giri, A.P., Wunsche, H., Mitra, S., Zavala, J.A., Muck, A., Svatos, A., Baldwin, LT.
(2006). Molecular interactions between the specialist herbivore Manduca sexta

(Lepidoptera, Sphingidae) and its natural host Nicotiana attenuata. Plant Physiol.
142: 1621-1641.

Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic and
necrotrophic pathogens. Annu. Rev. Phytopathol. 43: 205-227.

Howe, G., Jander, G. (2008). Plant immunity to insect herbivores. Annu Rev Plant Biol.
59: 41-66.

Jensen, A.D., Raventos, D., Mundy, J. (2002). Fusion genetic analysis of jasmonate-
signalling mutants in Arabidopsis. Plant J. 29: 595-606.

Jiang, Y., Deyholos, M.K. (2006). Comprehensive transcriptional profiling of NaCl-
stressed Arabidopsis roots reveals novel classes of responsive genes. BMC Plant
Biol. 6: 25.

Kang, J.H., Wang, L., Giri, A., Baldwin, LT. (2006). Silencing threonine deaminase

and JAR4 in Nicotiana attenuata impairs jasmonic acid-isoleucine-mediated
defenses against Manduca sexta. Plant Cell 18: 3303-3320.

92

Kepinski, S., Leyser, O. (2005). The Arabidopsis F-box protein TIRl is an auxin
receptor. Nature 435: 446-451.

Kourtchenko, 0., Andersson, M.X., Hamberg, M., Brunnstrom, A., Gobel, C.,
McPhail, K.L., Gerwick, W.B., Feussner, 1., Ellerstriim, M. (2007). Oxo-
phytodienoic acid containing galactolipids in Arabidopsis: Jasmonate signaling
dependence. Plant Physiol. 145: 1658-1669.

Koo, A.J.K., Chung, H.S., Kobayashi, Y., Howe, G.A. (2006). Identification of a
peroxisomal acyl-activating enzyme involved in the biosynthesis of jasmonic acid
in Arabidopsis. J. Biol. Chem. 281: 33511-33520.

Kramell, R., Schmidt, J., Schneider, C., Sembdner, G., Schreiber, K. (1988).
Synthesis Of N-(Jasmonoyl)Amino Acid Conjugates. Tetrahedron 44: 5791-5807.

Liavonchanka, A., Feussner, I. (2006). Lipoxygenases: occurrence, functions and
catalysis. J. Plant Physiol. 163: 348-357.

Li, L., Li, C., Lee, G.I., Howe, G.A. (2002). Distinct roles for jasmonate synthesis and
action in the systemic wound response of tomato. Proc. Natl. Acad. Sci. USA 99:
6416-6421.

Li, L., Zhao, Y., McCaig, B.C., Wingerd, B.A., Wang, J., Whalon, M.E., Pichersky,
E., Howe, G.A. (2004). The tomato homolog of CORONATINE-INSENSITIVE]
is required for the maternal control of seed maturation, jasmonate-signaled
defense responses, and glandular trichome development. Plant Cell 16: 126-143.

Li, C., Schilmiller, A.L., Liu, C., Lee, G.I., Jayanty, S., Sageman, C., Vrebalov, J.,
Giovannoni, J.J., Yagi, K., Kobayashi, Y., Howe, G.A. (2005). Role of [3-

oxidation in jasmonate biosynthesis and systemic wound signaling in tomato.
Plant Cell 17: 971-986.

Liu, Y.L., Ahn, J.E., Datta, S., Salzman, R.A., Moon, J., Huyghues-Despointes, B.,
Pittendrigh, B., Murdock, L.L., Koiwa, H., Zhu-Salzman, K. (2005).
Arabidopsis vegetative storage protein is an anti-insect acid phosphatase. Plant
Physiol. 139: 1545-1556.

Lorenzo, 0., Chico, J.M., Sanchez-Serrano, J.J., Solano, R. (2004). JASMONATE-
INSENSITIVEI encodes a MYC transcription factor essential to discriminate
between different jasmonate-regulated defense responses in Arabidopsis. Plant
Cell 16: 1938-1950.

Major, I.T., Constabel, CF. (2006). Molecular analysis of poplar defense against

herbivory: comparison of wound- and insect elicitor-induced gene expression.
New Phytol. 172: 617-635.

93

Mewis, 1., Tokuhisa, J.G., Schultz, J.C., Appel, H.M., Ulrichs, C., Gershenzon, J.
(2006). Gene expression and glucosinolate accumulation in Arabidopsis thaliana
in response to generalist and specialist herbivores of different feeding guilds and
the role of defense signaling pathways. Phytochemistry 67: 2450-2462.

Mewis, 1., Appel, H.M., Hom, A., Raina, R., Schultz, J.C. (2005). Major signaling
pathways modulate Arabidopsis glucosinolate accumulation and response to both
phloem-feeding and chewing insects. Plant Physiol. 138: 1149-1162.

Mithofer, A., Maitrejean, M., Boland, W. (2005). Structural and biological diversity of
cyclic octadecanoids, jasmonates, and mimetics. J. Plant Growth Regul. 23: 170-
178.

Musser, R.O., Cipollini, D.F., Hum-Musser, S.M., Williams, S.A., Brown, J.K.,
Felton, G.W. (2005). Evidence that the caterpillar salivary enzyme glucose

oxidase provides herbivore offense in Solanaceous plants. Arch. Insect Biochem.
Physiol. 58: 128-137.

Pauw, B., Memelink, J. (2005). Jasmonate-responsive gene expression. J. Plant Growth
Regul. 23: ZOO-210.

Ralph, S.C., Yueh, H., Friedmann, M., Aeschliman, D., Zeznik, J.A., Nelson, C.C.,
Butterfield, Y.S., Kirkpatrick, R., Liu, J., Jones, S.J., Marra, M.A., Douglas,
C.J., Ritland, K., Bohlmann, J. (2006). Conifer defence against insects:
microarray gene expression profiling of Sitka spruce (Picea sitchensis) induced
by mechanical wounding or feeding by spruce budworms (Choristoneura
occidentalis) or white pine weevils (Pissodes strobi) reveals large-scale changes
of the host transcriptome. Plant Cell Environ. 29: 1545-1570.

Rao, M.V., Lee, H., Creelman, R.A., Mullet, J.E., Davis, K.R. (2000). Jasmonic acid
signaling modulates ozone-induced hypersensitive cell death. Plant Cell 12: 1633-
1646.

Reymond, P., Weber, H., Damond, M., Farmer, E.E. (2000). Differential gene
expression in response to mechanical wounding and insect feeding in Arabidopsis.
Plant Cell 12: 707-720.

Reymond, P., Bodenhausen, N., Van Poecke, R.M., Krishnamurthy, V., Dicke, M.,
Farmer, E.E. (2004). A conserved transcript pattern in response to a specialist
and a generalist herbivore. Plant Cell 16: 3132-3147.

Rojo, E., Titarenko, E., Leon, J., Berger, S., Vancanneyt, G., Sanchez-Serrano, J.J.
(1998). Reversible protein phosphorylation regulates jasmonic acid-dependent

94

and -independent wound signal transduction pathways in Arabidopsis thaliana.
PlantJ 13: 153-165.

Ryan, GA. (2000). The systemin signaling pathway: differential activation of plant
defensive genes. Biochim Biophys Acta 1477: 112-121.

Sasaki, Y., Asamizu, E., Shibata, D., Nakamura, Y., Kaneko, T., Awai, K., Amagai,
M., Kuwata, C., Tsugane, T., Masuda, T., Shimada, H., Takamiya, K., Ohta,
H., Tabata, S. (2001). Monitoring of methyl jasmonate-responsive genes in
Arabidopsis by cDNA macroarray: self-activation of jasmonic acid biosynthesis
and crosstalk with other phytohormone signaling pathways. DNA Res. 8: 153-161.

Schaller, F., Schaller, A., Stintzi, A. (2005). Biosynthesis and metabolism of jasmonates.
J. Plant Growth Regul. 23: 179-199.

Schilmiller, A.L., Howe, G.A. (2005). Systemic signaling in the wound response. Curr.
Opin. Plant Biol. 8: 369-377.

Schilmiller, A.L., Koo, A.J., Howe, G.A. (2007). Functional diversification of acyl-CoA
oxidases in jasmonic acid biosynthesis and action. Plant Physiol. 143: 812-824.

Schittko, U., Hermsmeier, D., Baldwin, LT. (2001). Molecular interactions between the
specialist herbivore Manduca sexta (Lepidoptera, Sphingidae) and its natural host

Nicotiana attenuata. II. Accumulation of plant mRNAs in response to insect-
derived cues. Plant Physiol 125: 701-710.

Schmelz, EA., Engelberth, J., Tumlinson, J.B., Block, A., Alborn, H.T. (2004). The
use of vapor phase extraction in metabolic profiling of phytohormones and other
metabolites. Plant J. 39: 790-808.

Staswick, P.E., Yuen, G.Y., Lehman, CC. (1998). Jasmonate signaling mutants of
Arabidopsis are susceptible to the soil fungus Pythium irregulare. Plant J. 15:
747-754.

Staswick, P.E., T iryaki, L, Rowe, M.L. (2002). Jasmonate response locus JARl and
several related Arabidopsis genes encode enzymes of the firefly luciferase
superfamily that show activity on jasmonic, salicylic, and indole-3-acetic acids in
an assay for adenylation. PLant Cell 14: 14051415.

Staswick, P.E., Tiryaki, l. (2004). The oxylipin signal jasmonic acid is activated by an
enzyme that conjugates it to isoleucine in Arabidopsis. Plant Cell 16: 2117-2127.

Stenzel, 1., Hause, B., Miersch, 0., Kurz, T., Maucher, H., Weichert, H., Ziegler, J.,

F eussner, 1., Wastemack, C. (2003) Jasmonate biosynthesis and the allene oxide
cyclase family of Arabidopsis thaliana. Plant Mol Biol 51: 895-911.

95

Tan, X., Calderon-Villalobos, L.I., Sharon, M., Zheng, C., Robinson, C.V., Estelle,
M., Zheng, N. (2007). Mechanism of auxin perception by the TIRl ubiquitin
ligase. Nature 446: 640-645.

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, C., Nomura, K., He,
S.Y., Howe, G.A., Browse, J. (2007). JAZ repressor proteins are targets of the
SCF(COIl) complex during jasmonate signalling. Nature 448: 661-665.

Titarenko, E., Rojo, E., Leon, J., Sanchez-Serrano, J.J. (1997). Jasmonic acid-
dependent and -independent signaling pathways control wound-induced gene
activation in Arabidopsis thaliana. Plant Physiol 115: 817-826.

Toufighi, K., Brady, S.M., Austin, R., Ly, E., Provart, NJ. (2005). The botany array
resource: e-Northems, expression angling, and promoter analyses. Plant J. 43:
153-163.

van der Fits, L., Memelink, J. (2001). The jasmonate-inducible AP2/ERF-domain
transcription factor ORCA3 activates gene expression via interaction with a
jasmonate-responsive promoter element. Plant J. 25: 43-53.

Vanholme, B., Grunewald, W., Bateman, A., Kohchi, T., Gheysen, G. (2007). The
tify family previously known as ZIM. Trends Plant Sci. 12: 239-244.

Wang, L., Halitschke, R., Kang, J.H., Berg, A., Harnisch, F., Baldwin, LT. (2007).
Independently silencing two JAR family members impairs levels of trypsin
proteinase inhibitors but not nicotine. Planta 226: 159-167.

Wang, L., Allmann, S., Wu, .J, Baldwin, LT. (2008). Comparisons of LOX3- and
JAR4/6-silenced plants reveal that JA and JA-AA conjugates play different roles
in herbivore resistance of Nicotiana attenuata. Plant Physiol. 146: 904-915.

Wastemack, C., Stenzel, 1., Hause, B., Hause, G., Kutter, C., Maucher, H.,
Neumerkel, J., Feussner, L, Miersch, 0 (2006). The wound response in tomato
- Role of jasmonic acid. J Plant Physiol 163: 297-306.

Wastemack, C. (2007). Jasmonates: an update on biosynthesis, signal transduction and
action in plant stress response, growth and development. Ann. Bot. (Lond) 100:
681-697.

Xie, D.X., Feys, B.F., James, S., Nieto-Rostro, M., Turner, J.G. (1998). C011: an

Arabidopsis gene required for jasmonate-regulated defense and fertility. Science
280: 1091-1094.

96

Xu, L., Liu, F., Lechner, E., Genschik, P., Crosby, W.L., Ma, H., Peng, W., Huang,
D., Xie, D. (2002). The SCF(COIl) ubiquitin-ligase complexes are required for
jasmonate response in Arabidopsis. Plant Cell 14: 1919-1935.

Yan, Y., Stolz, S., Chetelat, A., Reymond, P., Pagni, M., Dubugnon, L., Farmer, E.E.

(2007). A downstream mediator in the growth repression limb of the jasmonate
pathway. Plant Cell 19: 2470-2483.

97

CHAPTER 3: A CRITICAL ROLE FOR THE TIFY MOTIF IN REPRESSION OF
JASMONATE SIGNALING BY A STABILIZED SPLICE VARIANT OF THE
JASMONATE ZIM-DOMAIN PROTEIN JAZIO IN ARABIDOPSIS

The work presented in this chapter has been published:

Hoo Sun Chung and Gregg A. Howe (2009)

Plant CellZl, 131-145

Author’s contributions:
Hoo Sun Chung designed and performed experiments, analyzed the data, and wrote the
manuscript. Gregg A. Howe supervised the entire project and was involved in all aspects

of the manuscript writing.

98

ALBEYFFUA(TT

JASMONATE ZIM-domain (J AZ) proteins act as repressors of jasmonate (J A) signaling.
Perception of bioactive JAs by the F-box protein CORONATINE INSENSITIVEI
(COIl) causes degradation of JAZs via the ubiquitin-proteasome pathway, which in turn
activates the expression of genes involved in plant growth, development, and defense.
JAZ proteins contain two highly conserved sequence regions: the Jas domain that
interacts with C01] to destabilize the repressor and the ZIM domain of unknown function.
Here, we show that the conserved TIFY motif (TIFF/YXG) within the ZIM domain
mediates homo- and heteromeric interactions between most Arabidopsis thaliana JAZs.
We have also identified an alternatively spliced form (JAZIO.4) of JAZIO that lacks the
Jas domain and, as a consequence, is highly resistant to JA-induced degradation. Strong
JA-insensitive phenotypes conferred by overexpression of JAZlO.4 were suppressed by
mutations in the TIFY motif that block JAZ10.4-JAZ interactions. We conclude that
JAZlO.4 functions to attenuate signal output in the presence of IA and further suggest that
the dominant-negative action of this splice variant involves protein—protein interaction
through the ZIM/TIFY domain. The ability of JAZIO.4 to interact with MYC2 is
consistent with a model in which a JAZ10.4-containing protein complex directly
represses the activity of transcription factors that promote expression of JA response

genes.

99

INTRODUCTION

The lipid-derived hormone jasmonate (JA) regulates many physiological activities during
the plant life cycle. JA is well known for its ability to promote plant defense responses
against insect herbivores, necrotrophic pathogens, and various abiotic stresses as well
(Pozo et al., 2004; Glazebrook, 2005; Browse and Howe, 2008; Howe and Jander, 2008).
JA also plays an important role in normal plant growth and development, including cell
division, cell fate determination, photomorphogenesis, and sexual reproduction ( McConn
and Browse, 1996; Li et al., 2004; Sineshchekov et al., 2004; Browse, 2005; Chen et al.,
2007; Balbi and Devoto, 2008). An important attribute of JA is its ability to act both as a
potent inhibitor of vegetative growth and as a positive regulator of reproductive and
defensive processes (Yan et al., 2007; Howe and Jander, 2008; Mitra and Baldwin, 2008;
Pauwels et al., 2008). These antagonistic activities of JA suggest a broader role for the
hormone in dealing with the “dilemma of plants to grow or defend” (Herms and Mattson,
1992) in rapidly changing environments.

J A exerts its many effects through large-scale changes in gene expression (Schenk
etal., 2000; Sasaki etal., 2001; Goossens et al., 2003; Reymond et al., 2004; Suzuki et al.,
2004; Devoto et al., 2005; Sasaki-Sekimoto et al., 2005; Uppalapati et al., 2005;
Mandaokar et al., 2006; Schmidt and Baldwin, 2006). Activation of JA-response genes is
mediated in part by the basic helix-loop-helix transcription factor MYC2 (also known as
JlNl) (Abe et al., 2003; Lorenzo et al., 2004; Laurie-Berry etal., 2006; Chini et al., 2007;
Dombrecht et al., 2007; Takahashi et al., 2007). Current models of JA signaling indicate
that, in the absence of JA, MYC2’s function as a transcriptional activator is repressed by

members of the JASMONATE ZIM-domain (JAZ) family of proteins that physically

100

interact with MYC2 (Chini et al., 2007; Melotto et al., 2008). Elevated levels of JA
trigger the release of MYC2 from this repression by increasing the rate of JAZ turnover.
Bioactive JAs promote interaction of JAZ proteins with the CORONATINE
INSENSITIVEI (C01 1) component of the ubiquitin E3 ligase SCFCOH (Xie et al., 1998;
Thines et al., 2007; Katsir et al., 2008b; Melotto et al., 2008). This interaction leads to
ubiquitination and degradation of JAZs by the 26S proteasome. Ligand binding studies
have shown that jasmonoyl-isoleucine (JA-lle) and structurally related JA-amino acid
conjugates stimulate COIl-JAZ interactions through the formation of a stable COIl/JA-
Ile/JAZ complex (Katsir et al., 2008b). The bacterial toxin coronatine is a structural
mimic of JA-lle and a potent agonist of this intracellular receptor system (Katsir et al.,
2008b; Melotto et al., 2008).

Several lines of evidence indicate that the C-terminal Jas domain plays a key role
in destabilizing JAZ repressors in response to increased JA levels. JAZ-GUS (Thines et
al., 2007) and JAZ-GFP (Chini et al., 2007) fusion proteins are degraded in JA-treated
cells, whereas truncated JAZ proteins (referred to here as JAZAJas) that lack the Jas
domain are stable in the presence of the hormone. Ectopic expression of JAZAJas
proteins results in various JA-insensitive phenotypes, including male sterility, resistance
to JA-mediated inhibition of root growth, reduced expression of JA-responsive genes and
secondary metabolites, susceptibility to insect feeding, and enhanced resistance to
coronatine-producing strains of Pseudomonas syringae (Chini et al., 2007; Thines et al.,
2007; Chung et al., 2008; Melotto et al., 2008; Shoji et al., 2008). Biochemical studies
have shown that the Jas domain is sufficient for formation of COIl/JAZ complexes and

associated ligand binding (Katsir et al., 2008b; Melotto et al., 2008). In addition, point

101

mutations in the Jas domain that block hormone-induced COll/JAZ interaction confer
dominant JA insensitivity (Melotto et al., 2008).

A simple hypothesis to explain the dominant action of JAZAJas proteins is that
they interact with and repress the activity of MYC2. This idea can account for the JA-
insensitive phenotype of plants that overexpress JAZ variants (e.g., JAZI-A205A206) that
fail to interact with C01] but retain the ability to bind MYC2 (Melotto et al., 2008).
However, this model does not explain the action of JAZAJas proteins that do not interact
with MYC2. Chini et al. (2007) reported that a truncated form of JAZ3 (also known as
J A13) that lacks the Jas domain interacts with C01] in a JA-independent manner but fails
to interact with MYC2. These workers proposed a “poison complex” model in which
hormone-independent binding of JAZ3AJas (JAI3AC) to C01] obstructs access of
SCFCO” to endogenous JAZs, thereby allowing endogenous JAZs to repress MYC2.
Elucidation of the mechanism by which JAZAJas proteins repress JA responses is
important for understanding the role of J AZ proteins in hormone signaling.

JAZ proteins in Arabidopsis are encoded by 12 genes, designated JAZI — JAZ12.
The JAZ repressor model predicts that loss-of-function jaz mutations should result in
constitutive or hypersensitive J A responses. Analysis of various jaz null mutants suggests
functional redundancy between family members (Chini et al., 2007; Thines et al., 2007).
Interestingly, however, transgenic plants silenced for the expression of JAZ1 0 (also called
JASI) were more sensitive than wild type to JA (Yan et al., 2007). These workers
identified an alternatively spliced form of JAZIO (referred to here as JAZ10.3) that lacks
seven amino acids from the C-terminal end of the Jas domain. Overexpression of this

truncated protein, but not the Jas domain-containing full-length protein (JAZ10.1),

102

conferred partial insensitivity to JA. This finding highlights the potential importance of
alternative mRNA splicing as a mechanism to generate functionally distinct J AZ
isoforms, and strengthens the rationale for studies aimed at determining how JAZAJas
proteins regulate JA signal output.

JAZ proteins are classified as members of the tify family, also known as ZIM
(Vanholme et al., 2007). The defining feature of all family members is the highly
conserved TIFY motif (TIFF/YXG) located within a larger conserved region referred to
as the ZIM (or TIFY) domain (Chini et al., 2007; Thines et al., 2007; Vanholme et al.,
2007; Yan et al., 2007). The tify family in Arabidopsis includes the so-called ZIM and
ZIM-like (ZML) transcription factors that are implicated in cell expansion (Shikata et al.,
2004), as well as PEAPOD (PPD) proteins that regulate leaf size and shape (White, 2006).
Unlike the ZIM and ZML proteins that possess a zinc-finger DNA-binding domain, JAZs
do not contain a known DNA-binding domain. Rather, JAZs are proposed to exert their
effects on gene expression through interaction with MYC2 (Chini et al., 2007) and
perhaps other transcription factors. This idea is supported by the nuclear location of
several JAZ family members (Chini et al., 2007; Thines et al., 2007; Yan et al., 2007).
The occurrence of the ZIM domain in proteins from higher and lower (i.e., moss) plants
but not in green algae suggests an important role for JAZs in the evolution of land plants
(Vanholme et al., 2007; Chico et al., 2008; Katsir et al., 2008a). The molecular function
of the ZIM domain has not been described for any member of the tify family.

Here, we provide evidence that the ZIM domain mediates formation of homo- and
heteromeric complexes involving most members of the Arabidopsis JAZ family. We

identify a novel alternatively spliced form of JAZIO (JAZ10.4) that, unlike the previously

103

characterized JAZlO.3, lacks the entire Jas domain and confers severe JA-insensitivity
when overexpressed in Arabidopsis. JAZlO.4 fails to interact with COIl but retains the
ability to interact with MYC2 and with other JAZ proteins. We demonstrate that severe
dominant JA-insensitive phenotypes resulting from JAZlO.4 overexpression are
suppressed by mutations in the TIFY motif that block JAZlO.4-JAZ interactions. These
results indicate that JAZIO.4 functions to dampen signal output in the presence of IA, and
that the repressive activity of this splice variant depends on the TIFY motif. The data are
consistent with a model in which a JAZlO.4-containing protein complex directly impairs
the activity of transcription factors (e.g., MYC2) that control expression of IA response

genes.

RESULTS

Homo- and Heteromeric Interaction of JAZ Proteins

We used the yeast two-hybrid (Y2H) system to determine the homomeric interaction
potential of the 12 members of the Arabidopsis JAZ family. Each full-length JAZ was
fused separately to the LexA DNA-binding domain (BD) and the B42 activation domain
(AD). Homodimeric interactions were assessed by co-expression of the BD and AD
fusion proteins in yeast cells containing a lacZ reporter gene under the control of a LexA-
dependent operator. As shown in Fig. 3.1A, JAZI, JAZZ, JAZ3, and JAZIO.1 strongly
interacted as homodimers, as determined by strong LacZ reporter activity. Weaker
homomeric interactions were observed for JAZ4, JAZS, and JAZ6, whereas the
remaining five family members (JAZ7, JAZ8, JAZ9, JAle, and JAZIZ) failed to

interact. Western blot analysis showed that all JAZ fusion proteins were expressed in

104

yeast cells (Fig. 3.1B), indicating that the absence of interaction cannot be attributed to a
lack of protein expression.

We next used a bimolecular fluorescence complementation (BiFC) assay to
determine whether JAZ-JAZ homomeric complexes form in planta. JAZ3 was chosen for
this analysis because it self-associates strongly in yeast (Fig. 3.1A) and, when expressed
as a fusion with green fluorescent protein (GFP), is localized to the nucleus (Chini et al.,
2007). N— and C-terrninal fragments of YFP (nYFP and cYFP, respectively) were fused
to either the N- or C-terrnini of JAZ3 to produce four constructs (JAZ3-nYFP, JAZ3-
cYFP, nYFP-JAZ3, and cYFP-JAZ3). Agrobacterium-mediated transformation was used
to co-express each of the four possible combinations of nYFP and cYFP JAZ-fusion
constructs in epidermal cells of Nicotiana tabacum. Co-expression of JAZ3-nYFP and
cYFP-JAZ3, but not any other combination tested, resulted in a YFP signal within the
nucleus (Fig. 3.1C). This finding confirms the Y2H results and further demonstrates that
J AZ3 can self-associate in the plant nucleus.

We also employed Y2H assays to systematically test all possible JAZ-JAZ
heteromeric interactions. Because protein-protein interactions in the Y2H system are
often observed in one BD/AD orientation but not in the reciprocal orientation, each JAZ
was tested in both orientations against the remaining 1 1 family members. Out of a total of
132 possible heteromeric combinations in both BD and AD orientations, we observed 47
interactions of varying strengths involving all family members except JAZ7 (Table 3.1).
Nine of these interactions (JAZI-JAZZ, JAZl-JAZIO.1, JAZZ-JAZS, JAZZ-JAZ6, JAZ3-
JAZ4, JAZS-JAZ6, JAZ6-JAZIO.1, JAZ6-JA212, and JAZ9-JAZ]0.1) were detected in

both BD and AD orientations. Several JAZ proteins that interacted strongly as

105

homodimers tended to interact with a larger number of JAZs. For example, JAZI and
JAZ3 interacted with 9 and 7 other family members, respectively, in one or both BD/AD
orientations. We also found examples of proteins (e.g., JAZS) that did not form
homomeric complexes but did interact with several other family members. We conclude

that most J AZ proteins in Arabidopsis form homo- and heteromeric complexes in yeast.

Involvement of the TIFY Motif in JAZ-J AZ Interactions

As an initial approach to identify sequence determinants that mediate JAZ-J AZ binding,
we examined the ability of various deletion mutants of JAZ3 (Fig. 3.2A) to interact with
full-length JAZ3 and JAZlO.1. Deletion of 140 amino acids from the N-terminus of JAZ3
(AN), including the weakly conserved N-terminal region observed by Thines et al. (2007),
resulted in a slight reduction in the strength of homomeric and heteromeric interactions
with JAZ3 and JAZlO.1, respectively (Fig. 3.28). A JAZ3 variant (Jas) that lacks both
the N-terminal and ZIM domains was previously shown to interact with COIl in a
hormone-dependent manner (Melotto et al., 2008). This C-terminal fragment of JAZ3
failed to interact with either full-length JAZ3 or JAZlO.1 (Fig. 3.2B). A third deletion
construct (AJas) that lacks the Jas domain interacted strongly with full-length JAZ3 and
JAZlO.1. Western blot analysis confirmed that the JAZ3 deletion variants used in these
experiments were expressed in yeast cells (Fig. 3.2C). Taken together, these results
indicate that the N-terminal region and the Jas domain are not required for JAZ3-JAZ
interactions, thus implicating the ZIM domain as an important determinant for JAZ-JAZ

binding.

106

To further investigate the role of the ZIM domain in JAZ-JAZ binding, we
performed Ala-scanning mutagenesis of the highly conserved TIFY motif found in the
ZIM domain of JAZ3 and all other family members (Fig. 3.2D). We assessed the
interaction of the resulting mutant JAZB variants with both wild-type JAZ3 and JAZlO.1
in the Y2H system. Ala substitution of Gly185 abolished the interaction with wild-type
JAZ3, whereas replacement of Thrl80, Ile181, Phe182, and Tyr183 did not affect this
interaction (Fig. 3.2B). Heteromeric interaction of JAZ3 with JAZlO.l was also disrupted
by the G185A mutation, as well as by an 1181A mutation in JAZB (Fig. 3.2B). Site-
directed mutagenesis of the TIFY motif in JAZlO.l yielded similar results. In this case,
Ala substitution of either Ile107 or Glyl 11 abrogated JAZlO.1 binding to itself and to
J AZ6 (Fig. 3.2F). Western blot analysis showed that all Ala-substituted mutants of JAZ3
and JAZlO.1 were expressed in yeast (Fig. S3.1). These findings establish an essential
role for the TIFY motif in JAZ-J AZ interactions.

The ZIM domain was originally identified in ZIM, ZML1, and ZML2 members of
the tify family. All three of these proteins possess a GATA-type Zn-finger DNA-binding
motif and are thought to act as transcription factors (Vanholme etal., 2007; Shikata et al.,
2004). If the ZIM domain functions as a protein-protein interaction determinant, we
reasoned that ZIM, ZML1, and ZML2 may interact with one another. Indeed, we found

that each protein forms both homo- and heteromeric complexes in yeast (Fig. 53.2).

Characterization of a Novel JAZ10 Splice Variant that Lacks the Jas Domain
During efforts to isolate a full-length cDNA for JAZ10, we identified three distinct

transcripts from this gene. These included the At5g13220.l and At5g13220.3 transcripts

107

that are predicted by TAIR (The Arabidopsis Information Resources) to encode the
longest isoform (i.e., JAZlO.1) and the JAZlO.3/JAS1.3 isoform containing a partially
truncated Jas domain (Yan et al., 2007). The third transcript we identified (designated
At5g13220.4), which was not annotated in the TAIR database, is predicted to encode a
l67-amino-acid protein, designated JAZIO.4. The sequence of At5g13220.4 indicates
that it is produced by the use of an alternative splice donor site in the third exon of the
JAZ10 gene (Fig. 3.3A). This splicing event causes a frame-shift mutation that deletes the
entire Jas domain, and adds 20 amino acids C-terminal to Ser147 (Fig. 3.3B). Reverse
transcriptase (RT)-PCR was used to verify the occurrence of At5g13220.4 in wounded
Arabidopsis leaves. As shown in Fig. 3C, three RT-PCR products ranging in size between
~500 and 650 bp were distinguishable by agarose gel electrophoresis. Cloning and
sequencing of these PCR products confirmed their identity as At5g13220.1, At5g13220.3,
and At5g13220.4. RT-PCR experiments performed with transcript-specific primers also
detected the At5g13220.3 and At5g13220.4 splice variants in wounded leaves (Fig. 83.3).
The role of the Jas domain as a JAZ destabilization element led us to test the hypothesis
that JAZlO.1, JAZlO.3, and JAZIO.4 differentially interact with con. We assessed the
three isoforrns for their ability to interact with C01] in a ligand-dependent manner in the
Y2H system. Coronatine, a potent signal for COIl-JAZ interactions (Katsir et al., 2008b;
Melotto et al., 2008), stimulated JAZlO.1 binding to C01] in a dose-dependent manner
(Fig. 3.4A). JAZlO.3 interacted with C01] in the presence of relatively high
concentrations of coronatine (e.g., 200 uM), whereas JAZIO.4 did not interact with COIl
at any concentration of coronatine tested. Quantification of B-galactosidase activity

confirmed that the JAZlO.3 weakly interacts with COIl in comparison to JAZlO.1, and

108

also showed that JAZlO.4 fails to bind CO“ in the presence of 200 uM coronatine (Fig.
3.48). Western blot analysis showed that all three JAZIO proteins were produced in yeast
cells (Fig 3.4C). We also performed Y2H assays to determine whether the JAZIO splice
variants interact with the bHLH transcription factor, MYC2. As shown in Fig. 3.4D, all
three JAZIO isoforms interacted with MYC2 in the absence of coronatine. These findings
indicate that the Jas domain is critical for interaction of JAZIO splice variants (e.g.,
JAZlO.1) with C01] but is not required for binding of JAZlO isoforms to MYC2.

To further investigate potential functional differences between the JAZIO
isoforms, we tested whether JAZlO.3 and JAZlO.4, like JAZlO.l (Fig. 3.1; Table 3.1),
form homo- and heteromeric complexes in the Y2H system. As shown in Fig 3.4E, the
JAZ interaction pattern of JAZlO.3 was identical to that of JAZlO.1, with both variants
partnering with eight of the 14 JAZ proteins tested. In addition to interacting with the
same set of eight JAZs, JAZIO.4 also formed heteromeric complexes with JAZ2 and
JAZ3 (Fig 3.4E). Western blot analysis of protein extracts from yeast strains co-
transformed with JAZ3 and each JAZlO splice variant showed that each JAZ was
expressed in these strains (Fig. 3.4F). The lack of interaction between JAZlO.l and
JAZZ/3 in this assay (Fig. 3.4E) may be a false negative result because this splice variant
interacted strongly with JAZZ and JAZ3 in the opposite BD/AD orientation (Table 3.1).
We therefore conclude that the three JAZlO variants interact with a similar set of JAZs in
the Y2H system.

Previous studies have shown that several JAZ family members, including
JAZlO.1 and JAZlO.3, are located in the nucleus (Thines et al., 2007; Chini et al., 2007;

Yan et al., 2007). To determine whether the modified C-terminus of JAZIO.4 affects the

109

targeting of the protein to the nucleus, we used confocal laser microscopy to examine the
subcellular location of a JAZlO.4-YFP fusion protein transiently expressed in tobacco
epidermal cells. Control experiments showed that whereas YFP alone partitions to both
the cytosol and the nucleus, JAZlO.1-YFP and JAZlO.3-YFP are located predominantly
in the nucleus, as previously reported (Yan et al., 2007) (Fig. 3.5). JAZlO.4-YFP
exhibited a nuclear localization pattern that was similar to that of the other two isoforms.

We conclude that the C01 1 -noninteracting splice variant JAZIO.4 localizes to the nucleus.

Overexpression of JAZ10 Splice Variants Differentially Affects JA Signal Output

The absence of a Jas motif in JAZlO.4 suggested that this splice variant might exert
dominant negative effects on JA signaling, as previously observed for JAZlO.3 (Yan et
al., 2007) and other JAZs in which the Jas motif was removed by targeted deletion or
mutagenesis (Chini et al., 2007; Thines et al., 2007; Melotto et al., 2008; Shoji et al.,
2008). To investigate this possibility, we assessed JA-related phenotypes in transgenic
plants overexpressing JAZlO.1, JAZlO.3, or JAZlO.4. As previously reported by Yan et
al. (2007), overexpression of JAZlO.l and JAZlO.3 did not have overt effects on plant
fertility. In contrast, we observed that ~30% (49 of 150 plants examined) of T1 plants
expressing a 35S-JAZ10.4 transgene were male sterile as a result of defects in filament
elongation and anther dehiscence (Fig. 3.6A-D). These flower phenotypes, which are
hallmarks of strong JA synthesis and perception mutants (Feys et al., 1994; McConn and
Browse, 1996; Sanders et al., 2000; Stintzi and Browse, 2000; Ishiguro et al., 2001; Park
et al., 2002), were not rescued by exogenous MeJA (data not shown). Fertilization of

sterile 35S-JAZIO.4 flowers with wild-type pollen yielded F1 progeny in which the sterile

110

phenotype strictly co-segregated with the 35S-JAZ1 0.4 transgene. To determine whether
overexpression of JAZlO.4 affects other JA responses, we compared JA-mediated root
growth inhibition in 3SS-JAZIO.4 seedlings to that of wild-type, coil-l, 35S-JAZ10.1,
and 35S-JAZ]0.3 seedlings (Fig 3.6E and F). As reported by Yan et a1. (2007), root
growth of 3SS-JAZ10.3 seedlings was moderately resistant to JA, whereas 35S-JAZ10.1
roots were as sensitive as wild-type seedlings to the hormone. 3SS-JAZIO.4 seedlings
exhibited a strong JA-insensitive root growth phenotype, which was comparable to that

of coil-I seedlings.

Differential Stability of JAZlO Splice Variants in vivo

The strong JA-insensitive phenotypes conferred by JAZ10.4 overexpression, together
with the inability of this splice variant to interact with COIl, suggested that JAZIO.4 is
stabilized against JA-induced degradation. To test this idea, we generated stable
transgenic lines expressing JAZlO.1-YFP, JAZlO.3-YFP, and JAZlO.4-YFP fusion
proteins under control of the 358 promoter. Root growth assays showed that the JA
response phenotype of each line was essentially identical to that of JAZlO.1-, JAZlO.3-,
and JAZlO.4-overexpresing plants; the root length of wild-type, 35S-JAZIO.1-YFP, 35S-
JAZ10.3-YFP, and 35S-JAZ10.4-YFP seedlings grown on MS plates containing 50 uM
MeJA was 5.6 i 1.0 mm, 5.4 :t 0.8 mm, 11.5 3: 0.5 mm, and 16.9 :t 1.3 mm, respectively.
To investigate the hormone-dependent stability of each JAZIO isoform in vivo, we
monitored YFP fluorescence in roots of 7-d-old transgenic seedlings that were either
treated (for 2 h) or not treated with MeJA. In the absence of MeJA, a nuclear-localized

YFP signal was observed in all three genotypes (Fig. 3.7A). Analysis of several

111

independent lines (at least 5 lines per construct) showed that the strength of the YFP
signal in 35S-JAZIO.1-YFP plants was consistently less than that in 355-JAZIO.3—YFP
and 35S-JAZIO.4-YFP seedlings (Fig. 3.7A, Mock). Treatment with 1 uM MeJA
completely eliminated nuclear YFP fluorescence in 35S-JAZ10.1-YFP roots but did not
obviously affect the signal in 35S-JAZIO.3-YFP and 35S-JAZIO.4-YFP seedlings.
Treatment of seedlings with 100 uM MeJA resulted in loss of the JAZlO.3-YFP nuclear
signal, although a diffuse (presumably cytosolic) fluorescence pattern in roots was still
detected. The fluorescence pattern in 35S-JAZIO.4-YFP seedlings was unaffected by 100
uM MeJA. We conclude that the relative stability of the three JAZIO splice variants in
hormone-stimulated plants is JAZlO.4 > JAZlO.3 > JAZlO.1, and that JAZlO.4 is highly
resistant to JA-induced degradation. Pretreatment of seedlings with MG132, a specific
inhibitor of the 26S proteasome, impaired JA-induced turnover of JAZlO.1-YFP (Fig.
3.78). This finding indicates that JA-induced degradation of this Jas domain-containing

isoform is mediated by 26S-proteasome pathway.

The Dominant Negative Effect of JAZ10.4 Requires a Functional TIFY Motif

We next investigated whether the strong repression of JA responses by JAZIO.4 is
dependent on a functional TIFY motif. To address this question, we generated transgenic
lines that overproduce JAZlO.4I'>A and JAZIO.4G'>A proteins harboring 1107A or G11 1A
point mutations, respectively, in the TIFY motif of JAZIO.4. Although these mutations
abrogate JAZlO.1 interaction with other JAZs in the Y2H system (Fig. 3.2F), it was
necessary to determine the effect of these mutations on JAZlO.4-JAZ interactions. As

shown in Figure 3.8A, JAZIO.4">A lost the ability to interact with all four JAZ partners

112

tested, including JAZ6, JAZlO.1, JAZlO.3, and JAZIO.4. JAZIO.4G’>A also failed to bind
JAZIO.4 but did retain ability to interact with JAZ6, JAZlO.1, and JAZlO.3. Western blot
analysis of protein extracts from yeast strains co-transformed with JAZlO.1 and mutant
forms of JAZIO.4 showed that the JAZ fusion proteins were expressed (Fig. 3.8B). These
findings, together with results of assays to test JAZIO.4G'>A and JAZIO.4">A interaction
with other members of the JAZ family (Fig. 53.4), indicate that 1107A is generally more
effective than G11 1A at disrupting JAZIO.4 heterodimerization with other JAZs.

Having established the effect of 1107A and G1 1 1A on JAZlO.4-JAZ interactions
in yeast, we assessed JA-mediated fertility phenotypes in transgenic plants that
overexpress JAZIO.4I'>A and JAZlO.4G'>A. Of 150 independent 35S-JAZIO.4">A plants
(Tt generation) examined, none showed defects in filament elongation, anther dehiscence,
silique development, or viable seed production (Fig. 3.8C and D), indicating that I107A
completely suppresses JAZlO.4-mediated male sterility. In a population of 40
independent Tt 35S-JAZ10.4G'>A plants, 12 individuals exhibited reduced fertility; these
plants produced only a few mature siliques during the latter stage of reproductive
development (Fig. 3.8C). Some flowers produced by this group of semi-fertile 35S-
JAZ10.4G'>A plants were indistinguishable from wild-type flowers (data not shown),
whereas other 35S-JAZ10. 40'” flowers had anther filaments that failed to fully elongate
(Fig. 3.8E and F).

We also studied the effect of TIFY point mutations (1107A and GI 1 1A) on the
JA-resistant root growth phenotype that results from JAZIO.4 overexpression (Fig. 3.6E
and F). In agreement with the ability of 1107A to strongly suppress JAZlO.4-medaited

sterility, 35S-JAZ10.4">A roots were as sensitive to JA-induced growth arrest as wild-type

113

roots (Fig. 3.8G and H). 35S-JAZ10.4G'>A roots, by contrast, were less sensitive to JA
than wild-type roots, but significantly more sensitive (P < 0.0001; Student’s t-test) than
35S-JAZ1 0.4 roots. These results show that the ability of JAZIO.4 to repress JA signaling
in various tissues is strongly suppressed by 1107A and moderately suppressed by G11 1A.

l->.4

To test the possibility that normal JA responsiveness of 35S-JAZIO.4 plants
results from low expression of the JAZIO.4I'>A mutant protein in planta, we compared the
level of B-glucuronidase activity in stable transgenic lines that constitutively express
either JAZlO.4-GUS or JAZlO.4I'>A-GUS fusion proteins. Seedlings expressing the 35S-
JAZ10.4">’4-GUS transgene exhibited a pattern of strong blue staining (in roots,
cotyledons, and leaves) that was very similar to that of 35S-JAZIO.4-GUS seedlings (Fig.
3.9A). 3SS-JAZIO.4-GUS plants were male sterile and highly insensitive to JA-induced
root growth arrest (Fig. 3.9B and C; Fig. 3.6H), indicating that JAZlO.4-GUS, like
JAZIO.4, strongly represses JA signal output. Plants overexpressing JAZIO.4">"-GUS,
however, were fully fertile and exhibited normal sensitivity to exogenous JA (Fig. 3.98
and C). We also examined the subcellular localization of JAZlO.4-YFP and JAZlO.4"M3
YFP fusion proteins to determine whether the 1107A mutation affects subcellular protein
distribution. Following transient Agrobacterium-mediated expression of these proteins in
tobacco leaf epidermal cells, laser seaming confocal microscopy revealed that both
JAZlO.4-YFP and JAZIO.4">A-YFP are targeted to the nucleus (Fig. 3.9D). These results

show that the 1107A mutation does not affect the stability or subcellular localization of

JAZIO.4.

114

DISCUSSION

Functional Diversification of JAZ Proteins by Alternative Splicing

Alternative splicing plays an important role in increasing protein diversity and, ultimately,
biological complexity. Our characterization of functionally distinct JAZIO splice variants
adds to a growing body of literature indicating that alternative splicing of pre-mRNAs
provides a general mechanism to alter the proteome in ways that optimize plant
adaptation to stress (Reddy, 2007; Barbazuk et al., 2008). In addition to the JAZlO.1 and
JAZlO.3 isoforrns described by Yan et al. (2007), we identified a third JAZIO splice
variant (JAZlO.4) that lacks the entire Jas domain. Several observations indicate that
differential association of JAZIO variants with COIl affects the stability and action of
each isoform in different ways. We showed that JAZlO.] interacts with C01] in a ligand-
dependent manner, whereas JAZIO.4 fails to bind COIl. JAZlO.3, which contains a
partially truncated Jas domain, interacted weakly with C01]. Analysis of JAZIO-YFP
reporter lines provided direct evidence that JAZlO.] is degraded via the 26S proteasome
pathway in response to JA treatment, whereas JAZ10.4 is highly resistant to hormone-
induced destruction (Fig. 3.7). Consistent with C011-interaction studies performed in
yeast, high concentrations of JA were required to induce turnover of JAZlO.3-YFP in
vivo. The differential physical interaction of the three splice variants with C01] can
explain the JA-related phenotypes associated with ectopic expression of each isoform.
Specifically, overexpression of JAZlO.3 and JAZIO.4 conferred weak and strong JA-
insensitive phenotypes, respectively, whereas 35S-JAZ10.1 plants that produce the full-
length protein did not exhibit altered sensitivity to the hormone. We conclude that

functional differences between JAZIO splice variants can be attributed in large in part to

115

differences in the extent to which these proteins interact with COIl in JA-stimulated cells,
which is a direct consequence of splicing-induced sequence changes in the Jas domain.

Based on the strong JA-insensitive phenotype of JAZlO.4-overexpressing plants
and the inability of JAZIO.4 to interact with COIl, we suggest that the function of this
protein in wild-type plants is to attenuate signal output in the presence of bioactive JAs.
Previously characterized JAZ proteins appear to repress JA responses in the absence of
JA, and are degraded by regulated proteolysis in the presence of the hormone (Thines et
al., 2007; Chini et al., 2007). In contrast, JAZIO.4 appears to be a potent negative
regulator of signal output in hormone-stimulated cells. This view is consistent with the
observation that JAZIO RNAi-silenced plants are hypersensitive to JA (Yan et al., 2007),
whereas null mutations in several other JAZ genes do not cause such a phenotype (Thines
et al., 2007; Chini et al., 2007). Our results indicate that the increased sensitivity of
JAZIO silenced lines to JA likely reflects a deficiency in JAZIO variants (e.g., JAZlO.4)
that are stabilized against JA-induced turnover. The ability of JAZIO.4 to restrain signal
output may be particularly important for reigning in IA responses that are energetically
demanding and potentially damaging to the cell. It is also possible that COIl-
noninteracting JAZs attenuate JA-mediated growth inhibition under environmental
conditions where rapid growth is required to compete for limited resources (Izaguirre et
al., 2006; Yan et al., 2007). A more precise understanding of the normal function of
JAZlO splice variants will require additional information about the downstream targets
and tissue/cell-type-specific expression of each isoform.

Our results are consistent with a scenario in which negative feedback control of

signal output by JAZIO.4 and JAZlO.3 is initiated upon transcriptional activation of

116

JAZIO in response to wounding or other inductive cues that trigger JA-Ile synthesis (Yan
et al., 2007; Chung et al., 2008). Although it is possible that wounding regulates
alternative splicing of JAZ10 pre-mRNA in a manner that favors the accumulation of a
specific transcript (Bove et al., 2008), our data and those of Yan et al. (2007) show that
all three transcripts accumulate in wounded leaves. Our results also indicate that protein
stability is likely to be a major factor in determining the relative abundance of each
JAZIO isoform in cells that express JAZ10. JAZ isoforms that fail to interact (JAZIO.4)
or weakly interact (JAZlO.3) with COIl are predicted to accumulate to higher levels in
JA-stimulated cells than JAZ proteins (e.g., JA210.1) that interact strongly with C01].
Differential accumulation of JAZIO-YFP reporter proteins in JA-treated cells (Fig. 3.7)

provides direct support for this idea.

The ZIM Domain Mediates Protein-Protein Interaction

The ZIM domain is the defining feature of the tify protein family that contains J AZ, PPD,
and ZIM/ZML proteins (Vanholme et al., 2007). Notably, however, a biochemical
function for this conserved sequence motif has not previously been described. We present
several lines of evidence to indicate that the ZIM domain mediates homo- and
heteromeric protein-protein interactions among JAZ proteins. We have identified nine
Arabidopsis JAZs (including the three JAZIO splice variants) that self-associate in yeast.
BiFC experiments showed that JAZ3 homomeric complexes accumulate in the plant
nucleus. Our results also revealed an extensive network of heteromeric JAZ interactions.
In a Y2H experiment to test all 66 possible heterodimeric combinations between 12 full-

length Arabidopsis JAZs (Table 3.1), we identified 38 heteromeric interactions involving

117

most but not all JAZs. Given that protein dimerization is a common regulatory
mechanism in signal transduction (Klemm et al., 1998), it is conceivable that
combinatorial interactions among various JAZs plays a role in generating diverse JA
signal outputs. Additional work is needed to determine the physiological relevance of
these interactions, and to assess whether differences in the interaction potential of various
JAZs have functional significance.

Site-directed mutagenesis studies showed that the TIFY motif is a key
determinant of JAZ homo- and heteromerization. Because the ZIM domain contains
several highly conserved residues in addition to the TIFY motif (Fig. 3.2D), it is likely
that other regions of the domain are also important for protein-protein interaction. Y2H
assays with JAZ3 deletion constructs and JAZIO.4 showed that JAZ-JAZ binding does
not require the N-terminal region or the C-terminal Jas domain. Although this finding
supports the notion that the ZIM domain is the primary determinant for intermolecular
contact between JAZ proteins, it remains to be determined whether the ZIM “domain” is
a self-stabilizing structure that is sufficient for protein-protein interaction. The ability of
ZIM and ZML proteins to homo- and heterodimize in yeast (Fig 83.2) shows that protein-
protein interaction is not specific for JAZ proteins, but rather extends to other members
of the tify family. This finding raises the possibility that JAZs functionally interact with
PPD and ZIM/ZML proteins.

Finally, we note that our results extend the functional analogy between JAZ
proteins and Aux/1AA proteins that are substrates for the SCFTIR' E3 ligase component of
the auxin response pathway. JAZ proteins appear to share several key features with

Aux/1AA repressor proteins, including hormone-induced rapid degradation by the

118

SCF/ubiquitin/26S proteasome pathway, interaction with transcription factors in the
nucleus, and rapid induction of their corresponding genes in response to increased
hormone levels (Thines et al., 2007; Chini et al., 2007; Chico et al., 2008; Katsir et al.,
2008b; Chung et al., 2008). A role for the ZIM domain in JAZ-JAZ interactions is
reminiscent of the ability of Aux/1AA protein domains III and IV to mediate homo- and
heterodimer formation among Aux/1AA proteins (Kim et al., 1997). Domains III and IV
are conserved in ARF transcription factors that control expression of auxin response
genes, which enables Aux/IAAs to bind to and repress ARF activity (Kim et al., 1997;
Ulmasov et al., 1999). The ZIM domain does not appear to be conserved in MYC2, and
available experimental evidence indicates that this domain is not required for JAZ-MYC2
partnering (Chini et al., 2007). Nevertheless, the possibility that the ZIM domain

mediates JAZ interaction with proteins outside the tify family cannot be excluded.

A Role for the ZIM Domain in Regulating JAZ Function

We took advantage of the strong JA-insensitive phenotype of 35S-JAZ1 0.4 plants to study
the functional significance of the ZIM domain in JA signaling. The main conclusion of
these experiments is that mutations (e.g., 1107A) in the TIFY motif that disrupt JAZlO.4
interaction with other JAZs also abrogate the dominant-negative effects of JAZIO.4 on JA
signal output. Importantly, functional analysis of JAZIO.4 TIFY mutants (JAZIO.4">A
and JAZlO.4G'>A) showed that the capacity of JAZlO.4 to interact with other JAZs in
yeast is tightly correlated with the strength of the JAZlO.4-mediated dominant-negative
effect. Because mutation of the TIFY motif did not appear to affect the accumulation or

nuclear localization of JAZIO.4, the most straightforward interpretation of these results is

119

 

 

that the repressive activity of JAZIO.4 depends on the ability of its ZIM domain to
interact with another protein. Our Y2H analyses support the hypothesis that JAZIO.4
interacts in planta either with itself or with another tify protein to repress JA signaling.
Interestingly, Ouellet and colleagues (2001) showed that a mutation (in domain III) that
impairs the ability of an Aux/1AA protein to homo- and heterodimerize suppresses auxin-
related phenotypes conferred by an intragenic mutation that stabilizes the Aux/1AA
against auxin-induced degradation. Thus, the repressive activity of stabilized JAZ and
Aux/1AA variants depends on their ability to interact with other family members or with
downstream transcription factors.

Our results raise the possibility that a network of JAZ-JAZ complexes
differentially interact with transcription factors to control the specificity and strength of
JA signal output. Among the important factors that would determine the composition and
stiochiometry of JAZ-JAZ dimers (or higher order oligomers) in any given cell type are
(l) the rate of JAZ synthesis, (2) the rate of JAZ degradation, and (3) the interaction
capacity of each JAZ expressed in that cell type. Inductive cues that increase the synthesis
of bioactive JAs are predicted to remodel J AZ-J AZ partnering by increasing the rate of de
novo JAZ synthesis and the selective degradation of unstable JAZs. We suggest that
complexes containing stabilized JAZs (e.g., JAZIO.4) will accumulate in JA-stimulated
cells and, eventually, attenuate expression of JA response genes.

Ectopic expression of JAZlO.4 likely perturbs the normal balance of JAZ proteins
by creating a situation in which JAZIO.4 predominates over more labile JAZ isoforms. A
simple model to explain the requirement for the TIFY motif in JAZlO.4-mediated

repression of signal output is that JAZIO.4 homo- or heteromeric complexes are the

120

functional unit for direct repression of MYC2. The ability of JAZIO.4 to interact with
MYC2 (Figure 3.4D) in the Y2H system is consistent with this model, as is a site-directed
mutagenesis study indicating that the C011 and MYC2 interaction surfaces of JAZ9 are
likely not identical (Melotto et al., 2008). This model may also explain the dominant-
negative action of JAZIAJas (Thines et al., 2007) and other JAZAJas proteins that have
the capacity to form homo- and heterodimers (Table 3.1). This scenario, however, would
not appear to explain the repressive action of JAZ3AJas, which was shown to interact
with C01] but not with MYC2 (Chini et al., 2007). These workers proposed a model in
which binding of JAZ3AJas to SCFCO“ impairs the turnover of endogenous JAZs that
would accumulate and repress MYC2 activity. The necessary biochemical and genetic
tools are now available to rigorously test these models of JAZAJas action. Further study
of naturally occurring JAZ isoforms that evade degradation by the JA/COIl pathway
promises to provide new inSight into the molecular mechanisms underlying the control of

J A responses.

MATERIALS AND METHODS

Plant Material and Growth Conditions

Arabidopsis thaliana ecotype Columbia (Col-0) was used as the wild type for all
experiments. Soil-grown plants were maintained in a growth chamber at 21°C under 16 h
light (100 uE m'2 s") and 8 h dark. Arabidopsis was transformed with Agrobacterium
tumefaciens (strain C58C1) using the floral dip method (Clough and Bent, 1998). A list
of transgenic plants used in this study is provided in Table S1. Transformed lines (T1

generation) were selected on MS plates containing kanamycin (50 ug/mL) and

121

vancomycin (100 ug/mL). At least 40 independent Tl plants per genotype were
transferred to soil for subsequent phenotypic analysis. We identified homozygous lines
by testing T3 progeny for resistance to kanamycin. We propagated male sterile 355-
JAZ10.4 lines by outcrossing to wild-type pollen. F 1 progeny containing the transgene
were selected on Murashige and Skoog (MS) medium plates containing kanamycin (50
ug/mL). The 35S—JAZI-GUS transgenic line was described previously (Thines et al.,
2007). Nicotiana tabacum (cv Petit Havana) was grown in a growth chamber maintained

under 17 h of light (200 uE/m'z/sec) at 28°C and 7 h of dark at 18°C.

Yeast Two-hybrid Assays

Yeast two-hybrid (Y2H) assays were performed with the Matchmaker LexA system
(Clontech). Full-length JAZ cDNAs were isolated as previously described (Chung et al.,
2008). cDNAs encoding JAZIO splice variants were generated from RNA prepared from
rosette leaves collected 1.5 h after mechanical wounding. RT-PCR reactions were
performed with Pfu Turbo DNA polymerase (Stratagene) and the primer sets listed in
Table S3.l. JAZ cDNAs were subcloned into the Matchmaker pGILDA vector to
generate fusions of the “bait” protein with the LexA DNA-binding domain (DB). These
cDNAs were also subcloned into the pB42AD vector to generate fusions of the “prey”
protein with the B42 activation domain (AD). Yeast transformation and selection of
transformants were conducted as described in Melotto et al. (2008). JAZ-JAZ interaction
assays were performed as follows. A l-mL culture of yeast transformants in SD—glucose
medium (BD Biosciences) supplemented with —Ura/-His/-Trp dropout solution was

grown to an OD600 of 1.0 - 1.2. Cells were recovered by centrifugation and resuspended

122

in 0.4 mL distilled water. Four uL of the resulting cell suspension was placed on SD-
galactose/raffinose (-Ura/-His/-Trp)-inducing media (in 96-well plates) containing 80
ug/mL X-gal. To test the interaction of JAZIO variants with COIl, coronatine (Sigma)
was added to the medium before the yeast cells were plated. All photographic images of
Y2H plates were taken afier 48 h of incubation of the plate at 30°C. Expression of the
AD- and BD-fusion proteins was detected by western blot analysis using anti-
hemagglutinin (HA; Covance) and anti-LexA (Upstate) antibodies, respectively. B-
galactosidase activity in yeast cells was measured with liquid cultures as described by the

manufacturer (Clontech), using ortho-nitrophenyl-B-d-galactopyranoside as a substrate.

Site-Directed Mutagenesis

A PCR-based protocol (Stratagene) was used to perform Ala-scanning mutagenesis of the
TIFY motif in JAZ3, JAZlO.1, and JAZIO.4. PCR reactions were performed with JAZ3,
JAZlO.1, and JAZ10.4 cDNAs in pB42AD or pGEM-T Easy vectors, and the mutagenic
primers listed in Table $3.1. The presence of the desired mutation was confirmed by

DNA sequencing.

Subcellular Protein Localization

The pBI-eYFP binary vector was prepared by subcloning the eYFP coding sequence into
the Kpnl and Sacl restriction sites of the pBI-TS binary vector (Koo et al., 2006;
Schilmiller et al., 2007), which is a modified version of pB112 l. The PCR-amplified open
reading frames (without a stop codon) of JAZlO.1, JAZ1 0.3, JAZ10.4, and JAZIO.4,“

were subcloned into pGEM-T Easy (Promega), followed by re-cloning into the BamHI

123

site of pBI-eYFP. The resulting constructs encode fusion proteins in which the JAZ C-
terminus is fused in-frame to the N-terminus of eYFP. Oligonucleotide primers used to
generate these constructs are listed in Table 83.1. Agrobacterium tumefaciens (strain
C58Cl) harboring binary vector constructs were grown overnight at 28°C in YEP
medium containing 50 ug/mL kanamycin and 50 ug/mL rifampicin. Bacterial cells were
resuspended in induction medium (10 mM MES, pH 5.6, 10 mM MgC12, and 150 uM
acetosyringone) and incubated for 1.5 h at room temperature prior to infiltration. Leaves
of five-week-old N. tabacum plants were syringe-infiltrated with the bacterial suspension
(ODboo = 0.2), and plants were maintained in a growth chamber for 2 d. Confocal
microscopy was performed with a Zeiss LSM 510 META microscope (Carl Zeiss, Jena,
Germany) and imaging software provided by the manufacturer. To visualize nuclei,
tobacco leaves that were previously infected with Agrobacterium were syringe-infiltrated
2 h prior to imaging with a solution containing 10 ug/mL DAPI (Sigma). YFP and DAPI
fluorescence were monitored simultaneously by excitation at 514 nm (argon laser) and
405 nm (diode laser), respectively. YFP and DAPI fluorescence was detected after

passage through band pass 530-600 nm and 474-525 nm emission filters, respectively.

Blmolecular Fluorescence Complementation Assays

The full-length JAZ3 coding sequence was cloned into the pSY728, pSY738, pSY735,
and pSY736 vectors (Bracha-Drori et al., 2004) to generate JAZ3-nYFP, JAZ3-cYFP,
nYFP-JAZ3, and cYFP-JAZ3, respectively. See Table 83.1 for primer information. These
constructs were subcloned into the XhoI and Sail restriction sites of pBl-TS and

transformed into Agrobacterium tumefaciens strain C58C1. Mixtures of two

124

Agrobacterium strains were co-infiltrated into tobacco leaves, such that each of the four
possible combinations of nYFP and cYFP JAZ3-fusion constructs was co-expressed.
Imaging of protein-protein interaction was performed by confocal laser microscopy as

described above.

In vivo Protein Degradation Assay

Seedlings of transgenic plants expressing JAZlO.1-YFP, JAZlO.3-YFP, and JAZIO.4-
YFP fusion proteins grown for 7 d on MS plates were transferred to 48-well microtiter
plate for JA treatment. Seedlings were incubated with JA (0, l, and 100 uM MeJA) for 2
h at room temperature on an orbital shaker with low speed (70 rpm). To test the effect of
proteasome-specific inhibitor on protein stability, seedlings expressing JAZlO.1-YFP
were pretreated with water or 50 uM MG132 (Sigma) for 2 h prior to 10 uM MeJA
treatment. Fluorescence of JAZlO.1-YFP fusion proteins was analyzed with Zeiss Axio
Scope fluorescence microscope (Carl Zeiss, Oberkochen, Germany). Images were taken

using the software AxioVision 4.7 provided by the manufacturer.

Root Growth Inhibition Assay

Seeds were surface-sterilized with 30% (v/v) commercial bleach for 15 min and washed
ten times with sterile distilled water. Seeds of each genotype were placed on square Petri
plates (Fisher) containing MS medium that was supplemented with 50 uM MeJA. Plates
were incubated at 4°C for 4 d in darkness, and then incubated under normal growth
conditions for the remainder of the experiment. Plates were oriented in a vertical position

6 to 7 (1 prior to measurement of primary root length. Wild—type (Col-0) and coil -1 seeds

125

 

(or other appropriate lines) were included as controls for JA-sensitive and JA-resistant
phenotypes, respectively.

Histochemical Staining

Seedlings grown on MS medium (either containing or not containing 50 uM MeJA), as
described in the legends to Figs. 3.6 and 7, were transferred to a 48-well microtiter plate
for GUS staining. Seedlings were vacuum-infiltrated with GUS staining buffer (50 mM
KPO4 buffer, pH 7.2, 2 mM potassium ferricyanide, 2 mM potassium ferrocyanide,
0.1 % (v/v) Triton X-100, and 2 mM X-Gluc) for 15 min and then incubated for 12 h at
37°C. A graded series of ethanol washes (up to 70% ethanol) was used to remove
chlorophyll, as described previously (Schilmiller et al., 2007). Photographic images were
taken with a Leica M216 dissecting microscope. Strong GUS staining was also observed
in several (at least five per construct) independent 35S-JAZ10.4-GUS and 35S-JAZIO.4"

)A-GUSlines within 2 to 3 h of incubation with the X-Gluc substrate.

126

 

 

B AD-JAZ proteins BD-JAZ proteins

 

 

1 2 3 4 5 6 7 8 9 10.11112 1 2 3 4 5 6 7 8 9 10.11112
_.- — - ..u .. ’
..I-c- ‘= a: -
A a-l-IA a-LIXA
DAPI YFP Merged

JAZ3-nYFP
+
cYFPslAZ3

 

Figure 3.1. Homo— and heteromeric interaction of Arabidopsis JAZ proteins.

(A) Yeast two-hybrid (Y2H) assay for homomeric JAZ interactions. Yeast strains co-expressing
activation domain (AD) and DNA-binding domain (BD) fusions to each of the 12 full-length JAZ
proteins were plated on media containing X-gal. Based on the intensity of LacZ-mediated blue-
color formation, the strength of each interaction was rated as strong (e.g., JAZI), medium (e.g.,
JAZS), weak (e.g., JAZ6), or undetectable (e.g., JAZ8). See Table 3.1 for ratings on all
interactions.

(B) Immunoblot analysis of JAZ proteins in yeast strains used for Y2H assays shown in panel A.
Each lane contains total protein extracted from cells expressing AD and BD fusions of the
indicated JAZ protein (e.g., “1” corresponds to JAZI). AD—JAZ and BD-JAZ fusion proteins
were detected with anti-HA (left panel) and anti-LexA (right panel) antibodies, respectively.

(C) Bimolecular fluorescence complementation assay of JAZ3-JAZ3 homomeric interaction in
planta. YFP fluorescence was detected in N. tabacum leaves co-infiltrated with Agrobacterium
strains expressing JAZ3-nYFP and cYFP-JAZ3. DAPI staining shows the location of nuclei. The
merged image shows colocalization of DAPI and YFP fluorescence.

127

 

 

 

 

 

 

 

 

 

 

 

A Buzz «210.1 C AD-JAZ3
1 N ZIMITIFY Jas 352 ‘6 ,9
x‘ 9’
.. b 3 9
WT HT m I . . . .
1‘1 352
a. [2111:1121
a.
101 352
Jas
1 as
A"ml H [J 1
a-HA
D ZIMdomaln E w
11" [WT “30A 1131‘ F1m Y1m 6185A
m1 ELTIELLC_.‘JIVE:.DF.ELEKF-KB‘JIIA
Jazz ELTIFE": -R‘J’M‘JE’DDZ~’...l-EKI-KE‘JZDLL.
JAZ: ,L'TZF'fl-i1"}C‘J'1'DDIF'FEFE-Kéllfllé
4m .L::5‘;L-3:’JL'\J'; DIL: EKL,L.Ii4; 1L.
w ,L’TIFEIFEK‘JLV': .EE: JDKL KEI NEW.
«3 ,;:::~’E=;:K'J)4'JK.E‘.: :EDK; KEIMEJ‘L F mm
M IL'TITY.étiMCV‘iDLTHLEr’ LI:::L. m H mm H Y1 11“
m RI’TIFE 'f-Kr4cr :DiJTh;,L EIIP'IL “A m m°
Mn .LT:E"‘-‘"- '-J:~‘ :..:;DKL,'L.:M;CL
4.11.3147: av: JF— v- R KL E. MK-JL.
N11,Li"-_‘S‘J:D_I_rEYJE
M211 .LTZFKL‘CJ W D LESEKV EILR: L

 

 

 

 

Figure 3.2. Requirement for the TIFY motif in homo— and heteromeric interaction of JAZ
proteins.

(A) Schematic diagram of JAZ3 deletion constructs analyzed in (B) and (C). The diagram shows
the highly conserved J as (blue) and ZIM (pink, with TIFY motif) domains, as well as the weakly
conserved sequence (orange, labeled “N”) at the N-terminus (Thines etal., 2007).

(B) Y2H assay to assess the interaction of each JAZ3 deletion construct (AD fiJsion) shown in A
with full-length JAZ3 and JAZIO.1 (BD fusions).

(C) Immunoblot analysis of J AZ3 deletion proteins in yeast strains tested in (B). AD-JAZ3 fusion
proteins were detected with an anti-HA antibody.

(D) Amino acid sequence alignment of the ZIM domain in 12 Arabidopsis JAZs. The highly
conserved TIFY motif (TIFF/YXG) is boxed.

(E) Ala-scanning mutagenesis of the JAZ3 TIFY motif. Wild-type (WT) and mutant forms (e.g.,
T180A) of JAZ3 (AD fusions) were tested in the Y2H system for interaction with WT JAZ3 and
JAZIO.1 (BD fusions).

(F) Ala-scanning mutagenesis of the JAZIO.1 TIFY motif. Wild-type (WT) and mutant forms
(e.g., T106A) of JAZIO.1 (AD fusions) were tested in the Y2H system for interaction with WT
JAZ10.1 and JAZ6 (BD fusions).

128

A

T GA A a /\ c /\ o A “AI 5
AT5613220.1 _) e in ..as...
Arc TM

AT561 3220.3 Wmmfiman-
'> (-

AT TAG

G
AT5613220.4 _) <-

B
JA210.1 147 8 VI L PTTL R P K L F G Ci N L E GDLPIARRK§LQRFL§KR5£RLV.31ii:i_:y_‘t P TS A“ 197
JA210.3 147 SVI L PTTLR P K L F6 0 N L E GDLPIARRK§LQBFL§5RK§E 185
JAZ1 0.4 147 SIFPSQGESHCNVFSRSARRD“ 167
c

650 bp-> . - < JAZ10.3
— 4 JAZ10.1
500 bp-> ‘ JAZ10.4

Figure 3.3. Identification of three JAZl0 variants produced by alternative splicing.

(A) Schematic diagram of alternatively spliced transcripts At5g13220.l, At5g13220.3, and
At5g13220.4 encoding JAZlO.1, JAZlO.3, and JAZIO.4, respectively. Thick lines (black,
translated; grey, untranslated) represent exons (labeled A to E). Modified exons in At5g13220.3
and At5g13220.4 result from use of alternative splice sites marked D’ and C’, respectively.

(B) Alternative splicing differentially affects the sequence of the C-terrninal Jas domain in the
three JAZIO splice variants. Amino acid sequences N-terrninal to Ser147 are identical in the three
isoforms and are not shown. Amino acids comprising the Jas domain are underlined, whereas
amino acids encoded by exon D are in bold. A frame shift in exon D of At5g13220.4 (resulting
from alternative splicing of exon C) removes the Jas domain and adds 20 unrelated amino acid
residues C-terrninal to Ser147. Asterisks indicate the stop codon.

(C) RT-PCR analysis of JAZ10 transcripts in RNA isolated from wounded leaves. The location of
primers used for RT-PCR is indicated by arrows in (A). PCR products were separated by gel
electrophoresis and the resulting gel was stained with ethidium bromide. Arrows denote
transcripts encoding the three JAZI 0 splice variants.

129

 

 

 

Figure 3.4. Protein-protein interaction characteristics of JAZ10 isoforms.

(A) Coronatine-dependent interaction of three JAZIO splice variants with C01] in the Y2H
system. Yeast strains co—transformed with AD-JAZIO isoforms (JAZlO.1, JAZlO.3, or JAZIO.4)
and BD-COIl were plated on media containing the indicated concentration of coronatine (COR).
(B) Quantification of B—galactosidase activity in yeast strains shown in (A). Each strain was
grown in the absence of coronatine (“0”), or in the presence of 30 pM or 200 uM coronatine
(COR). Data show the mean i SD of triplicate technical replicates.

(C) Immunoblot analysis of JAZIO and C011 proteins in yeast cells tested in (A). JAZ10 splice
variants and C011 were detected with anti-HA and anti-LexA antibodies, respectively.

(D) Interaction of three JAZIO splice variants with MYC2 in the Y2H system. Yeast strains co-
transfonned with AD-MYC2 and BD-JAZlO variants (JAZlO.1, JAZlO.3, and JAZIO.4) were
plated on the media containing X-gal. A yeast strain co-transformed with AD-MYC2 and an
empty BD vector (pGILDA) is shown as a control (empty + MYC2).

(E) Homo- and heteromeric interaction of JAZIO splice variants. Yeast strains co-transformed
with one of the three JAZIO isoforms (as an AD fusion) and other members (as 3 BD fusion) of
the JAZ family were plated on media containing X-gal.

(F) Western blot analysis of JAZIO isoforms and JAZ3 in yeast strains used for the Y2H
experiment shown in (D). JAZIO splice variants and JAZ3 were detected with anti-HA and anti-
LexA antibodies, respectively.

130

COR (psi)
0 1 5 10 30 50 100 200

JAZ10.1
*COH

JAZ10.3
+0011

JAZ10.4
+COI1

 

 

 

 

 

 

B
450 N '5 tr
_ «9‘ \9' \9‘
g 400 “$210.1 , 5,1. 3,1- 5,1-
3 350 l 1 l
300
"' zoo HA
(1-
15° con
. 100
z w ’ — -
o .
0 30 200
COR (11M) (it-LexA
E JAZ proteins

 

7 8 9 10.1 10.3 10.4 11 12

a
N
to
&
0|
0

JAZ10.1

JAZ10.3

JAZ10.4 - 7

 

F .9" o9 .9"

.4 .w

131

JAZ1 0.1 -YFP JAZ1 0.3-YFP JAZ10.4-YFP YFP
DAPI -
YFP -

Merged .

 

Figure 3.5. Subcellular localization of JAZ10 splice variants.

JAZIO-YFP fusion proteins were transiently expressed by Agrobacterium-mediated
transformation of tobacco epidermal cells. YFP fluorescence was detected with a confocal laser
scanning microscope. DAPI fluorescence was used as a marker for the nucleus. YFP alone (not
fiised to JAZ10) is located in both the nucleus and the cytosol.

132

 

WT JAZ10.4 JAZ10.1 JAZ104 JAZ10.3 COI1—1

4

 

Root length (mm)

 

WT JAZ10.1 JAZ10.4 JAZ10.3 coi1-1

Figure 3.6. Overexpression of JAZl0 splice variants differentially affects JA responses.
(A-D) JAZ10.4-overexpressing plants are male sterile. (A) Wild-type (left) and 35S-JAZ10.4
(right) inflorescence. Close-up view of a wild-type flower (B) and JAZIO.4 flowers (C and D)
that have short filaments and non-dehisced anthers.

(E) Differential effect of JAZIO isoforms on JA-mediated inhibition of root growth. Germinated
seedlings of the indicated genotype were grown for 7 d on MS medium containing 50 pM MeJA.
Bar indicates 5 mm.

(F) Quantification of JA-induced root grth inhibition of seedlings shown in (B). Data show the
mean i SD (n = 15 seedlings per genotype).

133

A

 
 
 
 
 

JAZ10.1-YFP

10011M JA

JAZ10.3-YFP
Mock 1 11M JA 100 11M JA

JAZ10.4-YFP
1 11M JA 10011M JA

B
Mock MG132 + JA

Figure 3.7. Stability of JAZ10 splice variants in vivo.

(A) Differential stability of three JAZIO splice variants in response to JA. Transgenic seedlings
expressing JAZlO.1-YFP, JAZlO.3-YFP, or JAZIO.4-YFP fusion proteins were treated either
with water (Mock) or with the indicated concentration of MeJA (“IA”). Two h after treatment,
YF P signal in root tissue was visualized by fluorescence microscopy. The exposure times for
each image in A and B were identical.

(B) Proteasome-dependent degradation of JAZlO.1-YFP. Seedlings expressing the 35S-JAZ10.1-
YFP transgene were pretreated with water or the 26S proteasome-specific inhibitor MG132 (50
uM) for 2 h, at which time seedlings were treated with either MeJA (“JA”, 10 uM) or water
(Mock) for 2 h. YFP signal in root tissue was visualized by fluorescence microscopy.

 

 

 

 

 

 

 

 

v: ’V‘
A c w, y. B
N N QNQ 1}
s 3 s * °'
,. . ...L- .. ,, s1- 1 re '8' '9
JA26 i ._. j 3 5. 5
L ~;. __Mh._.._3-.a__j
t i ’ 3 Way:
JA210.1 ., , 7, 3
\ ‘xgr” I
L 1‘3” :fif‘; fifth—TA: “'HA
1 ‘ l
, .. JAZ10.1
JAZ10.3‘ " ' . , ‘
.. t... .1 f ,
Eff-‘1; 15:”; :fi‘: it'- ~
JAZ10.4 :f aw) i
3 'VJ . .xU-’ e --'.~ .2; a'LOXA

Figure 3.8. The TIFY motif is required for repression of JA responses by JAZ10.4.

(A) Y2H analysis of the effect of 1107A and GlllA TIFY mutations on the interaction of
JAZIO.4 with JAZ6, JAZlO.1, JAZlO.3, and JAZIO.4. Yeast strains co-transformed with AD
fusions of JAZlO.4 (or JAZ10.4”A and 115.210.4‘3‘)A mutants) and BD-JAZ fusions (JAZ6,
JAZlO.1, JAZlO.3, and JAZlO.4) were plated on Xgal-containing medium.

(B) Immunoblot analysis of JAZ proteins in yeast cells co-transformed with AD fusions of
JAZIO.4 (or JAZlO.4l'>A and JAZIO.4G'>A mutants) and BD-JAZIO.1, which were tested in (A).
AD- and BD-J AZ fusions were detected with anti-HA and anti-LexA antibodies, respectively.
(C—F) Mutations (1107A and GlllA) in the TIFY motif differentially lack the male-sterile
phenotype conferred by overexpression of wild-type JAZI 0.4. Complete lack of sterility is shown
by the inflorescence (C, left) and floral (D) phenotype of 35S- JAZ10.4" ” plants. Partial lack of
JAZlO.4-mediated sterility is indicated by development of a few mature silques on the
inflorescence of 35S- JAZ10. 40' ”4 plants (CD, right). 355- JAZ10.4G"’A plants produced a mixture
of wild-type-like flowers (E) and flowers with shortened anther filaments (F).

(G) Differential effect of 1107A and GlllA mutations on JAZlO.4-mediated changes in root
grth in the presence of JA. Seedlings of the indicated genotype were grown for 6 d on MS
medium containing 50 uM MeJA. Bar indicates 5 mm.

(H) Measurement of primary root length of seedlings shown in (G). Data are the mean :1: SD (n =
19 seedlings per genotype).

135

Figure 3.8 continued
C JAZ10.4'->A JAZlO.4G->A ' . .
‘ ' I ' [1" 1“

JAZIO.4”A

JAz1ti.4€*‘->A

 

I
N
o

.3
0'1

Root length (mm)
0' 8

 

     

WT JAZiOJ JAZ10.1">‘ JAZ10.1°'>‘

136

Figure 3.9. The 1107A mutation does not affect the accumulation or localization of JAZ10.4.
(A) Histochemical GUS staining of 35S-JAZ10.4-GUS and 35S-JAZ10.4 1' i"”-GUS transgenic
seedlings. Seedlings were grown on MS medium containing kanamycin (50 pg/mL) for 14 d prior
to transferring to a 48-well microtiter plate for GUS staining.

(B) The male sterile phenotype conferred by overexpression of JAZ10.4-GUS (left) is not shown
by plants overexpressing the 1107A mutant form of JAZlO.4-GUS (right).

(C) The JA-insensitive root growth phenotype conferred by overexpression of JAZlO.4-GUS is
not shown by plants overexpressing the 1107A mutant form of JAZlO.4-GUS.

(D) Subcellular localization of JAZlO.4-YF P and JAZ10.4 I'>A-YF P fusion proteins that were
transiently expressed by Agrobacterium-mediated transformation of tobacco epidermal cells.
eYFP and DAPI fluorescence was detected by confocal laser scanning microscopy.

137

”at! Vd—NS. 80.122

mbwra. . YENS. m30-v.eN<fi

 
 

  
  

 

  

.. o
8922
r u
U
I o— m
w
an; r or W
m
I ON IN
I ON . . r
. \\
:3 - ...f
.2
I 8 . v/N
an?! «.252. 3.3.25; 0 0 30.... «.852. 804.22.. <

138

 

28w 5 523:3: 2a 28:85.5 Om v5 Q< £3 E 52030
25:85:: 058055: .3 038555: 5 A+v x53 A++v 825:. A+++v wcobm mm 5:2 53 55825 55 go Swear; 2: .5558
8392.5 5358-53 he .3652: 05 5 58m .55.? fl :OSSEQEGQEO: NS. .5» 3:58 .«o .9253 < .AmcosaEnEoo 058055;
NMS Eons—0E 35$ 2 wig—:25. 05 Hmfimwa 22.8510 am 98 Q< Eon E 53.8 53 £5. m_mmou58< £w5_-=_¢ S 05 no 5am

 

. - - . . - +++ - . - - - «5:.
t t + + + .. t t t + +++ ++ + FPN<5
+ .. +++ + t .. ++ t +++ +++ +++ +++ v.0 FN<—..
t t + .. t t t t . +++ + t ON<__.

+++ . +++ + r .. +++ +++ +++ +++ +++ +++ sz.
.. - .. r .. r r r - r .. - hN<_..

++ - ++ - r .. + + - . +++ .. oN<-.
.1. t r t t t + ++ t 1 ++ t mN<fi
t t t .. t t .. t + +++ .. t VN<—.

t t t t t t t t + +++ t .. MN<fi
+ t t .. t t + + t +++ +++ +++ NN<3
+++ t + + .. t ++ + +++ +++ +++ +++ FN<S

 

N..N<_. 3N5: ...opNs. mNE. aNSa 5N5. oNS. mNSa VN<3 «N5. «N5.' FN<...

 

.5an 5 2359.33 N<—..N<—. he rain—am .—.m «33.

139

JAZ3
WT T180A I181A F182A Y183A G185A

1

a-HA

 

 

 

 

JAZ10.1
WT T106A I107A F108A Y109A G111A

 

 

a-HA

 

 

 

Supplemental Figure 3.1. Immunoblot analysis of wild-type and mutant forms of JAZ3 and
JAZlO.1.

Protein was extracted from yeast strains used for the yeast two-hybrid assays shown in Figures 2E
and F. Expression of wild-type (WT) JAZ3-AD and JAZlO.1-AD fusion proteins, as well as
mutant derivatives harboring the indicated point mutation in the TIFY motif, was detected with
an anti-HA antibody.

140

AD

 

Empty ZIM ZML1 ZML2

     

       

Empty

ZIM

ZML1

ZML2

 

Supplemental Figure 3.2. Yeast two-hybrid analysis of homo— and heteromeric interactions
between Arabidopsis ZIM, ZIM-like] (ZML1), and ZIM-like2 (ZML2) proteins.

Yeast strains co-transformed with empty or ZIM-, ZML1-, and ZML2-containing BD (pGILDA)
and AD (pB42AD) vectors were plated on media containing X-gal. The photograph was taken
after 48 h of incubation of the plate at 30°C. Blue color formation is indicative of a positive
protein-protein interaction.

141

650 bp—>

500 bp—>

 

Supplemental Figure 3.3. Detection of transcripts encoding JAZlO.3 and JAZ10.4 using
transcript-specific primers.

(A) Schematic diagram of transcripts encoding JAZlO.3 and JAZIO.4. Left-pointing arrows
denote the location of Oligonucleotide primers that are specific for each transcript. Primer
sequences are listed in Supplemental Table 1. The gene-specific primer for JAZ10.4 hybridizes to
a sequence created from splicing of the altematedonor site in exon 3 to the acceptor site in exon 4.
(B) Result of an RT-PCR experiment using total RNA isolated from wounded (6 hr post
wounding) Arabidopsis leaves and the transcript-specific primers indicated in (A). PCR products
were visualized by agarose gel electrophoresis and ethidium bromide staining.

142

JAZproteins
1 2 3 4 5 6 7 8 9 10.1 11 12

JAZ10.4
JAZ10.4 ""

JAZ10.4 6"

 

Supplemental Figure 3.4. Yeast two-hybrid analysis of the effect of 1107A and G1 11A TIFY
mutations on the interaction of JAZ10.4 with other members of the JAZ family.

Yeast strains were co-transformed with plasmids encoding an AD-fusion of JAZIO.4 (or the
JAZlO.4I->A and JAZIO.4G->A mutants; lefi column) and a BD—fusion of one of the indicated
(top row) twelve J AZ family members. Co-transforrned strains were plated on medium containing
X-gal. The photograph was taken after 48 h of incubation of the plate at 30°C. Blue color
formation is indicative of a positive protein-protein interaction.

143

 

(04.9. .m-._._.EOO<<0t.O<otbmv<<<h00<00k05m .m-0<0000Oow<<o<0000<<0h0h<ot<<wum QNE.

5 ram new

054mg oN<_..o<

<0.=OQ .m-Eo._.<O<OOh<O<.E.ooo<h<h00<ooh05m .mFo0h<<<<0h<<00<00b00hOh<ot<<05m mNs.

.0 .0m new

9&va mN<_.-o<

<0.=Oa .m-OEOOHOOOw0h<<o<ohoh<ohot<<wum .m-o._.000OOFOE<0<0<0<OOh<ot<<OJm vNS.

5 .0m new

9&va vN<_.-o<

9&va s .m-._.oo_.<o<<<<h<0ooow<<0...o<<<o<o<<<...-.m a .m-<EO.POEO<otOOQOOP<EOh<OU<Jm <35

mN<sro<

o<~vma a .m-0ho<<ohOOH<O<<<UO<OOOUO<<OFO<<<U$ a .m-0EO<ot0OOOOHUOEOh<wo<ot0<OJm <3 ;

mN<?D<

9&va a .m-0000._.o<<0h00h<00O<<h<oowoo<<oho<um a .méoflutwooo0h<t000h<oo<wt0<00005m <NmE

mN<70<

9&va a .m-00<0000ho<<0h00000<<<<h<ooooo<<wum a .méto0000h<E00000<0tO<0009.00% <3:

mN<_.-o<

9&va a .m-<ohoo<o000k0<<0000h<0<<<<h<00Gum a .m (on;

-000 b; E o._.< 000 0:. 0<o 000 .50 (Chum mN<70<

03”va .m-<0<._.00t<0<._t_.<000<<._.0o<wohoum .m-0h<o»<hoot0<oO<b0wtot<<03m $3me

-04.

(Dawn .m-ho<<o<<0<0<0ho0<0<005000t<<05m .méOEUkOéO...ooo...<ot<00-.m mmme<70<
Lo
Enema

<0.__Oa .m-»0<<0<<0<0<0h00<o<oOCOOUCEOB .m-0~<0h<hoot.0<00<.roototéw-.m z<mN<70<
Lo
9&va

(04.9. .m-»o<<0<<0<0<0._.oO<0<OOCOOOC<<OJm .m-0.E.OoOOPOOE<O<O<0<OOH<OC<<0$ mNS.

5 tom ucm

9&va mN<_.-o<

(04.9. .m-00._.00<<000<0h0<<0»000<t0<00p05m .méwpwaswooOHOE0<QOHOh<OC<<OJm S...

.0 ram new

98% ~N<3<

ENS. 2.5.2..
tom van 3.;

FN<70<

35> 225.... 09.33. 32:..."— Button. 558“:

26.0

 

5:5 £5 5 .52. 955?:— 15 82.5239 he 55 ._.n ozah 3.5.5.395

144

<o.__oq

Eden 8
o<~vma
<o.__0a a
9&3“.
<o.__0a .o
9&va
52% .o
ofivma
<o._.wq .o
05va
05va

9.3%
<o.__oe

..o
o<~vma

<o._.oa 5
9&5.“
o<~vma
05.va
9&va
0&va

o<mvma

<39 8
9&va
<o.__0a .o
ofivma

.m.0...0...<.E.OOt0<0h0h0<0h0<00k9.m
.m-0._.0.r<<.r00t0H0h0h0<0h0<00k0Jm
.m-._.<0<0<<.r00<0h<0._.0<tO<OOFOJm
.mAE.OOCEOGKG<UO<<POOOOOOQM
.m-0O<OOHO<O<OP<0F<O<O0H0<t0t<<mvum

.m
a
-0<<00<._.<O._.OOh<<000<h0t<00t0<0<um

D
.m-._.0<0<<0O<H<OHOOOO<<0<POE<OOEOJm
.m-<0t0t0GUOEUOFOHOF<<HUOE<<OJm

.m-0(0OPOEOOOOEOOHOHO<EOC<<O-.m

a
.mFOOH<<<<O<POE<OOPPO<O<<<0FO<<<<Jm
n
.m-00<P<QHOOP<<<<0000t<00t0<0<<<um
.m

a
-0<<0 0<._.<O._.OO._.<<U00<h0t<00t0<0<um
a .m-._.0<0<<00<h<0.r000O<<O<h0t<ootoum

a MVP—L.0<O<<00<h<0000k<<<<0<hwt<0um

m

.m-<O._.OOU<._.00h<<0h00b00h<t0<00...O-.m

.m-<0000<<HO0P000<<h000h<H00<OOFOJm

.m-00<<00h<0<k00<0h<06h<0t<<0nb
.m-0<<00l_.<0t0h<0h<mv®h<0t<<03m
.m-.E.<OOt<OOOOPOOtOk<Ot<<OJm

.m-<0._.<0<<0._.00<<._.0<0._.<<000000-.m
.m-<<<00<<0h0t<0h00t<00h<0t<<03m

.m
n
-.POH0<<60._k<0<._bO0t<00<0h<h00tmvum

a
.m-0<<0OH<<U<POEOOOO<Ok<POOt0hO<Jm
.m.0._.0<<0<l_.<00<._.0O<<<OOPGH<OE<<GJm

.m-Oh0<<O<H<OO<._.UO<<<OOHOH<OE<<OJm

a
RYEO<OEOFO<<OOh<<O<HQEF<GO<Jm
a .m-EOPO<<00P<<OOOOEF<OO<0F<FOOJm

.m
n
-h0h0<<00._.<<0<._.000t<0U<0H<hoot03m

n
.m-0<<0O...<<O<._.OE0000<0h<h00t®h0<um
a .m-0._.<<0<._.OEF<0000...<._.OO._I_.O._.0<<OO-.m

<

.m-0<0.r0t<<<<00<0<h00<<mvh<0<00h0Jm

.m-00._.U<<<<<O._.<O._.<O._.<O._.<0._.<O.E.<<O-.m

fies—5:3 fin 03.; _3=oEo_aa=m

oEOOém

323m
2... 35-9
35.8

Em 55-9
255

95 EN?

N F238

95 N FN<7o<
:Nsém

Em :N<70<
3:2???

fi-.v.2~<?o<

35:.
dm Em
v.o§<7o<
new:

.8 E5
as???
<36
..SN<_,.o<
<8;
9.9539“
<8:
.2222
<8:
:2???
<0on
:2???
8538
2m $342

wNSadm
tam wN<70<
nN<70m
new ~N<70<

145

mm~>ma
mm~>ma
w->ma

au>m
4mg

au>o
4mg

au>o
4mg

au>w
4mg

m»;mg

szma

52mg

wh4ma
mFAma
mh4ma
mh4ma

wFAma

 

.m-mv<0._.00<0<00._|_.0O<tOHOO<OJm
.m-<0<0<0.r00<0<0OtGOHOUGOOOQOO-.m
.m-<0<0<0._.00<0<00t00h000000000um

a .m-._.G<O<<GO<h<Q._.OOO0<<0<H0t<00t0Jm

.m-<0.E.U.EUOUOEOOPOPOH/«Oobxwmvum

.m-0<00._.0t000OEOOFOHOOOOH’xOOJm

.m-@0<<.r0<._.<0OOHOh<OOOOOOOH<OOJm

.m-<00HOOhOO<O<hOtO<OPOHUO<OJm

a .m-._.0<0<<muO<h<0k0000<<0<b0t<00t0$

.m-._.00k<<<<0<h0t<00t0<0<<<0h0<<<<um

a .m-b00h<<<<0<._.0t<00t0<0<<<0ko<<<<um
a .m-h0<0<<00<h<0kmvoo0<<0<b0t<00t9b
.m-<0._1_.0._1r0OOOEUOHOFOP<<FOOHOG<0Jm
.m-0<00._.0t0OOOEOOPOPO<tOHOQ<OJm

.m-00<<._.0<l_.<000H0h<60000<t0h00<wum

.m-0h0E<0<0<0<0Oh<<0<00h09m
.mQPQE<O<O<O<O0h<<0<00h0um
.mdhOE<O<O<0<OQb<<O<OOPGum
a .m-O<<00...<<O<._.OEOG00<0h<k00t0b0<um

.m-<<0<._.<0O<HOO<<<OUHOH<OOP<OOum

.m-<<0<h<00<._.00<<<00._.0._.<00h<00-.m

.m-<<0<._.<00<._.00<<<00l_.0._.<0OH<OGum

.m-0<O0<OOOOO<<OO<OHOOF<OO<hOOum

a .m-0<<00l_.<<0<HOEOOOO<0H<HOOEOFO<Jm

.m-EL.O<OEOH0<<OOh<<0<hOhE<OO<um

a .m-E._.0<OEQ._.0<<O0h<<O<POHE<GO<Jm
a b-04200h<<0<hOEUGOO<0k<POOtO._.0<..m
.m-0._.0<<0<._.<OO<._.00<<<OOHOh<OO<h00..m
.m.0._.0<<0<._.<00<._.0O<<<00h0h<00<h00am

.m.0._.0<<0<h<00<._.00<<<00._.0H<OO<POOJm

dos—5:8 1m «Ssh. .3noEoinsm

mN<7nE>c
mun—>32...
au>cnmN<w

au>m
-Ewofis,
-mmm

au>m
-VOPN<3
-mmm

au>m
IndP~<a
-wmm

mu>o
-voFN<a
-mmm
E>vmmm

mam
(4.19%.,
-wmm

wno
.vd.N<s
-mmm
(3189.,
-mmm
$L1oPN<a
-mmm
vva<a
-mmm
n¢VN<a
-mmm
toFN<a
-mmm

533298
E035...

8c:
"acouncah
035m

146

 

magnum? 9:62 Coowv .m 8 .8th E 898me u
m_mcwmmSE 889585 .2 29:5 9

835 ”mm ., em: 88% _m .o 2.222 s 356me w

 

89mg

.m-0<0._.00<0<00t00<t0h00<muum

.m-OPUPE<0<0<O<G0h<<0<00h03m mN<7nE>o

dos—5:3 —.n 03:. Kwanzaa—am

147

REFERENCES

Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K., and Yamaguchi-Shinozaki, K.
(2003). Arabidopsis AtMYCZ (bHLH) and AtMYB2 (MYB) function as
transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78.

Balbi, V., and Devoto, A. (2008). Jasmonate signalling network in Arabidopsis thaliana:
crucial regulatory nodes and new physiological scenarios. New Phytol. 177: 301-
318.

Barbazuk, W.B., Fu, Y., and McGinnis, K.M. (2008). Genome-wide analyses of
alternative splicing in plants: Opportunities and challenges. Genome Res. 18:
1381-1392.

Bove, J., Kim, C.Y., Gibson, C.A., and Assmann, S.M. (2008). Characterization of
wound-responsive RNA-binding proteins and their splice variants in Arabidopsis.
Plant Mol. Biol. 67: 71-88.

Bracha-Drori K, Shichrur K, Katz A, Oliva M, Angelovici R, Yalovsky S, Ohad N.
(2004). Detection of protein-protein interactions in plants using bimolecular
fluorescence complementation. Plant J. 40: 419-27.

Browse, J. (2005). Jasmonate: An oxylipin signal with many roles in plants. Vitam.
Horm. 72: 431-456.

Browse, J., and Howe, G.A. (2008). Update on jasmonate signaling: New weapons and
a rapid response against insect attack. Plant Physiol. 146: 832-838.

Chen, I.C., Huang, I.C., Liu, M.J., Wang, Z.G., Chung, S.S., and Hsieh, H.L. (2007).
Glutathione S-transferase interacting with far-red insensitive219 is involved in
phytochrome A-mediated signaling in Arabidopsis. Plant Physiol. 143: 1189-1202.

Chico, J.M., Chini, A., Fonseca, S., and Solano, R. (2008). JAZ repressors set the
rhythm in jasmonate signaling. Curr. Opin. Plant Biol. 11: 486-494.

Chini, A., Fonseca, S., Fernandez, G., Adie, B., Chico, J.M., Lorenzo, 0., Garcia-
Casado, C., Lopez-Vidriero, 1., Lozano, F.M., Ponce, M.R., Micol, J.L., and
Solano, R. (2007). The JAZ family of repressors is the missing link in jasmonate
signalling. Nature 448: 666-671.

Chung, H.S., Koo, A.J.K., Gao, X., Jayany, S., Thines, B., Jones, A.D., and Howe,

G.A. (2008). Regulation and function of Arabidopsis JASMONA TE ZIM-domain
genes in response to wounding and herbivory. Plant Physiol. 146: 952-964.

148

Clough, S.J., and Bent, A.F. (1998). Floral dip: A simplified method for
Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16:
735-743.

Devoto, A., Ellis, C., Magusin, A., Chang, H.S., Chilcott, C., Zhu, T., and Turner,
J.G. (2005). Expression profiling reveals COIl to be a key regulator of genes
involved in wound- and methyl jasmonate-induced secondary metabolism,
defence, and hormone interactions. Plant Mol. Biol. 58: 497-513.

Dombrecht, B., Xue, G.P., Sprague, S.J., Kirkegaard, J.A., Ross, J.J., Reid, J.B., Fitt,
G.P., Sewelam, N., Schenk, P.M., Manners, J.M., and Kazan, K. (2007).
MYC2 differentially modulates diverse jasmonate-dependent functions in
Arabidopsis. Plant Cell 19: 2225-2245.

Feys, B., Benedetti, C.E., Penfold, C.N., and Turner, J.G. (1994). Arabidopsis mutants
selected for resistance to the phytotoxin coronatine are male sterile, insensitive to
methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell 6: 751-759.

Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic and
necrotrophic pathogens. Annu. Rev. Phytopathol. 43: 205-227.

Goossens, A., Hakkinen, S.T., Laakso, 1., Seppanen-Laakso, T., Biondi, S., De Sutter,
V., Lammertyn, F., Nuutila, A.M., Soderlund, H., Zabeau, M., Inze, D., and
Oksman-Caldentey, K.M. (2003). A functional genomics approach toward the
understanding of secondary metabolism in plant cells. Proc. Natl. Acad. Sci. USA
100: 8595-8600.

Griffiths, S., Dunford, R.P., Coupland, C., and Laurie, D.A. (2003). The evolution of
CONSTANS-like gene families in barley, rice, and Arabidopsis. Plant Physiol.
131: 1855-1867.

Herms, D.A., and Mattson, W.J. (1992). The dilemma of plants - To grow or defend. Q.
Rev. Biol. 67: 283-335.

Howe, G., and Jander, G. (2008). Plant immunity to insect herbivores. Annu. Rev. Plant
Biol. 59: 41-66.

Ishiguro, S., Kawai-Oda, A., Ueda, J., Nishida, I., and Okada, K. (2001). The
DEFECTIVE IN ANTHER DEHISCIENCE gene encodes a novel phospholipase
A1 catalyzing the initial step of jasmonic acid biosynthesis, which synchronizes
pollen maturation, anther dehiscence, and flower opening in Arabidopsis. Plant
Cell 13: 2191-2209.

Izaguirre MM, Mazza CA, Biondini M, Baldwin IT, Ballaré CL. (2006). Remote

sensing of future competitors: impacts on plant defenses. Proc. Natl. Acad. Sci.
USA 103: 7170-7174.

149

Katsir, L., Chung, H.S., Koo, A.J.K., and Howe, G.A. (2008a). J asmonate signaling: a
conserved mechanism of hormone sensing. Curr. Opin. Plant Biol. 11: 428-435.

Katsir, L., Schilmiller, A.L., Staswick, P.E., He, S.Y., and Howe, G.A. (2008b). C011
is a critical component of a receptor for jasmonate and the bacterial virulence
factor coronatine. Proc. Natl. Acad. Sci. USA 105: 7100-7105.

Kim, J., Harter, K., and Theologis, A. (1997). Protein-protein interaction among the
Aux/1AA proteins. Proc. Natl. Acad. Sci. USA 94: 11786-11791.

Klemm, J.D., Schreiber, S.L., and Crabtree, GR. (1998). Dimerization as a regulatory
mechanism in signal transduction. Annu. Rev. Immunol. 16: 569-592.

Koo, A.J.K., Chung, H.S., Kobayashi, Y., and Howe, G.A. (2006). Identification of a
peroxisomal acyl-activating enzyme involved in the biosynthesis of jasmonic acid
in arabidopsis. J. Biol. Chem. 281: 33511-33520.

Laurie-Berry, N., Joardar, V., Street, I.H., and Kunkel, B.N. (2006). The Arabidopsis
thaliana JASMONA TE INSENSIT I VB 1 gene is required for suppression of
salicylic acid-dependent defenses during infection by Pseudomonas syringae. Mol.
Plant. Microbe Interact. 19: 789-800.

Li, L., Zhao, Y., McCaig, B.C., Wingerd, B.A., Wang, J., Whalon, M.E., Pichersky,
E., and Howe, G.A. (2004). The tomato homolog of CORONATINE-
INSENSITIVEI is required for the maternal control of seed maturation,

jasmonate-signaled defense responses, and glandular trichome development. Plant
Cell 16: 126-143.

Lorenzo, 0., Chico, J.M., Sanchez-Serrano, J.J., and Solano, R. (2004).
JASMONATE-INSENSITIVEI encodes a MYC transcription factor essential to
discriminate between different jasmonate-regulated defense responses in
Arabidopsis. Plant Cell 16: 1938-1950.

Mandaokar, A., Thines, B., Shin, B., Lange, R.M., Choi, G., Koo, Y.J., Yoo, Y.J.,
Choi, Y.D., Choi, G., and Browse, J. (2006). Transcriptional regulators of

stamen development in Arabidopsis identified by transcriptional profiling. Plant J.
46: 984-1008.

McConn, M., and Browse, J. (1996). The critical requirement for linolenic acid is
pollen development, not photosynthesis, in an Arabidopsis mutant. Plant Cell 8:
403-416.

Melotto, M., Mecey, C., Niu, Y., Chung, HS, Katsir, L., Yao, J., Zeng W., Thines, B.,
Staswick. P.E., Browse, J., Howe, GA, He SY. (2008). A critical role of two

150

positively charged amino acids in the Jas motif of Arabidopsis JAZ proteins in
mediating coronatine- and jasmonoyl isoleucine-dependent interactions with the
C011 F-box protein. Plant J. 55: 979-988

Mitra, S., and Baldwin, LT. (2008). Independently silencing two photosynthetic
proteins in Nicotiana attenuata has different effects on herbivore resistance. Plant
Physiol. 148: 1128-1138.

Ouellet, F., Overvoorde, P.J., and Theologis, A. (2001). IAA17/AXR3: Biochemical
insight into an auxin mutant phenotype. Plant Cell 13: 829-841.

Park, J.H., Halitschke, R., Kim, H.B., Baldwin, I.T., Feldmann, K.A., and
Feyereisen, R. (2002). A knock-out mutation in allene oxide synthase results in
male sterility and defective wound signal transduction in Arabidopsis due to a
block in jasmonic acid biosynthesis. Plant J. 31: 1-12.

Pauwels, L., Morreel, K., De Witte, E., Lammertyn, F., Van Montagu, M., Boerjan,
W., Inze, D., and Goossens, A. (2008). Mapping methyl jasmonate-mediated
transcriptional reprogramming of metabolism and cell cycle progression in
cultured Arabidopsis cells. Proc. Natl. Acad. Sci. USA 105: 1380-1385.

Pozo, M.J., Van Loon, L.C., and Pieterse, C.M.J. (2004). Jasmonates - Signals in
plant-microbe interactions. J. Plant Growth. Regul. 23: 211-222.

Reddy, A.S.N. (2007). Alternative splicing of pre-messenger RNAs in plants in the
genomic era. Annu. Rev. Plant Biol. 58: 267-294.

Reymond, P., Bodenhausen, N., Van Poecke, R.M., Krishnamurthy, V., Dicke, M.,
and Farmer, E.E. (2004). A conserved transcript pattern in response to a
specialist and a generalist herbivore. Plant Cell 16: 3132-3147.

Sanders, P.M., Lee, P.Y., Biesgen, C., Boone, J.D., Beals, T.P., Weiler, E.W., and
Goldberg, RB. (2000). The Arabidopsis DELAYED DEHISCENCEI gene

encodes an enzyme in the jasmonic acid synthesis pathway. Plant Cell 12: 1041-
1061.

Sasaki-Sekimoto, Y., Taki, N., Obayashi, T., Aono, M., Matsumoto, F., Sakurai, N.,
Suzuki, H., Hirai, M.Y., Noji, M., Saito, K., Masuda, T., Takamiya, K.,
Shibata, D., and Ohta, H. (2005). Coordinated activation of metabolic pathways
for antioxidants and defence compounds by jasmonates and their roles in stress
tolerance in Arabidopsis. Plant J. 44: 653-668.

Sasaki, Y., Asamizu, E., Shibata, D., Nakamura, Y., Kaneko, T., Awai, K., Amagai,

M., Kuwata, C., Tsugane, T., Masuda, T., Shimada, H., Takamiya, K., Ohta,
H., and Tabata, S. (2001). Monitoring of methyl jasmonate-responsive genes in

151

Arabidopsis by cDNA macroarray: self-activation of jasmonic acid biosynthesis
and crosstalk with other phytohormone signaling pathways. DNA Res. 8: 153-161.

Schenk, P.M., Kazan, K., Wilson, I., Anderson, J.P., Richmond, T., Somerville, S.C.,
and Manners, J.M. (2000). Coordinated plant defense responses in Arabidopsis
revealed by microarray analysis. Proc. Natl. Acad. Sci. USA 97 : 11655-11660.

Schilmiller, A.L., Koo, A.J., and Howe, G.A. (2007). Functional diversification of acyl-
CoA oxidases in jasmonic acid biosynthesis and action. Plant Physiol. 143: 812-
824.

Schmidt, D.D., and Baldwin, LT. (2006). Transcriptional responses of Solanum m'grum
to methyl jasmonate and competition: a glasshouse and field study. Func. Ecol.
20: 500-508.

Shikata, M., Matsuda, Y., Ando, K., Nishii, A., Takemura, M., Yokota, A., and
Kohchi, T. (2004). Characterization of Arabidopsis ZIM, a member of a novel
plant-specific GATA factor gene family. J. Exp. Bot. 55: 631-639.

Shoji, T., Ogawa, T., and Hashimoto, T. (2008). Jasmonate-induced nicotine formation
in tobacco is mediated by tobacco C011 and JAZ genes. Plant Cell. Physiol. 49:
1003-1012.

Sineshchekov, V.A., Loskovich, A.V., Riemann, M., and Nick, P. (2004). The
jasmonate-free rice mutant hebiba is affected in the response of phyA 'lphyA "

pools and protochlorophyllide biosynthesis to far-red light. Photochem. Photobiol.
Sci. 3: 1058-1062.

Stintzi, A., and Browse, J. (2000). The Arabidopsis male-sterile mutant, opr3, lacks the
12-oxophytodienoic acid reductase required for jasmonate synthesis. Proc. Natl.
Acad. Sci. USA 97: 10625-10630.

Suzuki, H., Reddy, M.S., Naoumkina, M., Aziz, N., May, G.D., Huhman, D.V.,
Sumner, L.W., Blount, J.W., Mendes, P., and Dixon, R.A. (2005). Methyl
jasmonate and yeast elicitor induce differential transcriptional and metabolic re-

programming in cell suspension cultures of the model legume Medicago
truncatula. Planta 220: 696-707.

Takahashi, F ., Yoshida, R., Ichimura, K., Mizoguchi, T., Seo, S., Yonezawa, M.,
Maruyama, K., Yamaguchi-Shinozaki, K., and Shinozaki, K. (2007). The
mitogen-activated protein kinase cascade MKK3-MPK6 is an important part of
the jasmonate signal transduction pathway in Arabidopsis. Plant Cell 19: 805-818.

152

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., Nomura, K., He,
S.Y., Howe, G.A., and Browse, J. (2007). JAZ repressor proteins are targets of
the SCFCO” complex during jasmonate signalling. Nature 448: 661-665.

Ulmasov, T., Hagen, G., and Guilfoyle, T.J. (1999). Dimerization and DNA binding of
auxin response factors. Plant J. 19: 309—319.

Uppalapati, S.R., Ayoubi, P., Weng, H., Palmer, D.A., Mitchell, R.E., Jones, W., and
Bender, CL. (2005). The phytotoxin coronatine and methyl jasmonate impact
multiple phytohormone pathways in tomato. Plant J. 42: 201-217.

Vanholme, B., Grunewald, W., Bateman, A., Kohchi, T., and Gheysen, G. (2007).
The tify family previously known as ZIM. Trends Plant Sci. 12: 239-244.

Wenkel, S., Turck, F., Singer, K., Gissot, L., Le Gourrie rec, J., Samach, A., and
Coupland, G. (2006). CONSTANS and the CCAAT box binding complex share
a functionally important domain and interact to regulate flowering of Arabidopsis.
Plant Cell 18: 2971-2984.

White, D.W.R. (2006). PEAPOD regulates lamina size and curvature in Arabidopsis.
Proc. Natl. Acad. Sci. USA 103: 13238-13243.

Xie, D.X., F eys, B.F., James, S., Nieto-Rostro, M., and Turner, J.G. (1998). C011: an
Arabidopsis gene required for jasmonate-regulated defense and fertility. Science
280: 1091-1094.

Yan, Y., Stolz, S., Chetelat, A., Reymond, P., Pagni, M., Dubugnon, L., and Farmer,

E.E. (2007). A downstream mediator in the growth repression limb of the
jasmonate pathway. Plant Cell 19: 2470-2483.

153

CHAPTER 4: ROLE OF JAS INTRON IN FUNCTIONAL DIVERSIFICATION OF
JAZ PROTEINS

154

ABSTRACT

JASMONATE ZIM-domain (JAZ) proteins are negative regulators of jasmonate (JA)
signaling. Bioactive forms of JA activate the expression of JA response genes by
targeting JAZ proteins for ubiquitin-mediated proteolysis via the SCFCOU/26S
proteasome pathway. The Jas domain interacts directly with C01] in a hormone-
dependent manner and is thus a key determinant of the stability and repressive function of
JAZs. Here, we report that 9 of the 12 JAZ genes in Arabidopsis contain a conserved
intron (the Jas intron) that separates the N-terrninal 20 amino acids and C-terminal 7
amino acids of the Jas domain. Retention of the Jas intron during splicing of JAZ pre-
mRNAs results in the production of alternatively spliced transcripts that encode JAZ
isoforms with a modified or truncated Jas domain. We demonstrate a role for Jas intron
retention in generating splice variants of JAZZ, JAZ3, and JAZIO that have reduced
affinity for C011. Conservation of the J as intron in angiosperms, S. maellendorflii, and P.
patens suggests that this sequence has provided an enduring selective advantage during
the evolution of land plants. We conclude that alternative splicing plays a central role in

generating functional diversity of J AZ proteins through altered protein stability.

155

INTRODUCTION
The lipid-derived hormone jasmonate (JA) is implicated in diverse aspects of plant
growth and development. JA is particularly well known for regulating plant stress
responses, including defense against insect herbivores and pathogens, and exposure to
UV radiation and ozone (Glazerbrook, 2005; Howe and Jander, 2008; Conconi et al.,
1996; Browse, 2005). In healthy plants, JA also plays an important role in cell division,
carbon partitioning, photomorphogenesis, reproductive development, and trichome
development (McConn and Browse, 1996; Creelman and Mullet, 1997; Li et al., 2004;
Feys et al., 1994; Sineshchekov et al., 2004; Browse, 2005; Yoshida et al., 2009). JA
exerts this wide range of effects through large-scale reprogramming of gene expression.
Hundreds of JA response genes in many plant species have been identified and
characterized (Schenk et al., 2000; Reymond et al., 2000; Sasaki, 2001; Goossens et al.,
2003; Sasaki-sekimoto et al., 2005; Suzuki et al., 2004; Devoto et al., 2005; Uppalapati et
al., 2005; Mandaokar et al., 2006; Schmidt and Baldwin, 2006; Reymond et al., 2004).
The expression of many JA-response genes is positively regulated by the basic
helix-loop-helix transcription factor MYC2/JASMONATE INSENSITIVE 1 (JINl) (Abe
et al., 2003; Lorenzo etal., 2004; Laurie-Berry et al., 2006; Chini etal., 2007; Dombrecht
et al., 2007; Takahashi et al., 2007). Current models of JA signaling indicate that, in at
the presence of low JA levels, MYC2 is directly repressed by JASMONATE ZIM-
domain (JAZ) proteins (Chini et al., 2007, 2009; Melotto et al., 2008; Chung and Howe,
2009). Increased production of JA in response to environmental or developmental cues
leads to ubiquitin-mediated proteolysis of JAZ proteins, which releases MYC2 from

repression and permits expression of early JA-response genes (Chini et al., 2007; Thines

156

et al., 2007; Chung and Howe, 2009). A key event in this signal transduction chain is the
hormone-induced targeting of JAZ proteins to the E3 ubiqutin ligase complex, SCFCO“.
JAZs physically interact with the F-box protein CORONATINE IN SENSITIVE 1 (C011)
in a manner that depends on bioactive forms of JA, such as (3S,7R)-jasmonoyl-L-
isoleucine (JA-Ile) (Xie et al., 1998; Thines et al., 2007; Katsir et al., 2008b; Melotto et
al., 2008; Katsir et al., 2008b; Fonseca et al., 2009). The JA-Ile-induced JAZ-COIl
interaction leads to ubiquitination and subsequent degradation of JAZs by the 26S
proteasome. Direct evidence of J AZ ubiquitination was recently reported by Saracco et al.
(2009). The bacterial toxin coronatine is a structural mimic of JA-Ile and a potent agonist
of the COIl-JAZ receptor system (Feys et al., 1994; Melotto et al., 2008; Katsir et al.,
2080b; Chung and Howe, 2009).

A highly conserved 27-amino-acid sequence motif, referred to as the Jas
(JASMONATE-ASSOCIATED) domain, is located near the C-terminal end of JAZ
proteins. Yeast two-hybrid and in vitro pull-down experiments have shown that this
sequence is necessary and sufficient for hormone-dependent binding of JAZ to C01]
(Thines et al., 2007; Karsir et al., 2008b; Melotto et al., 2008; Chini et al., 2009; Chung
and Howe, 2009). These studies also showed that full-length JAZ proteins fused to GUS
or GFP/YFP are degraded in JA-treated cells, whereas JAZ proteins lacking the Jas
domain (JAZAJas) are stabilized against JA-induced protein degradation. Significantly,
expression of JAZAJas proteins in Arabidopsis produces various JA-insensitive
phenotypes, including male sterility, resistance to JA-inhibited root growth, resistance to
pathogen infection, and susceptibility to insect herbivores (Thines et al., 2007; Chini et

al., 2007; Yan et al., 2007; Chung et al., 2008; Chung and Howe, 2009). The dominant

157

negative effect of JAZAJas proteins on JA signal output is consistent with a role for JAZs
as negative regulators of JA signaling whose abundance is controlled by the
ubiquitin/26S proteasome pathway.

Alternative splicing (AS) of pre-mRNA provides an important mechanism for
creating protein diversity and biological complexity in eukaryotic organisms. It has been
shown that approximately 95% of all human genes undergo AS (Pan et al., 2008), and
that many of the resulting proteins serve essential roles in physiology and development
(Leeman and Gilmore, 2008; Irimia et al., 2009; Tazi et al., 2009). Cross-species
conservation in the exon-intron organization within a gene family often reflects the
biological importance of AS events (Kalyna et al., 2006; Iida et al., 2006; Li et al., 2006).
Although it is now clear that AS contributes to the high complexity of plant
transcriptomes, our understanding of the functional significance of AS in plants is still
largely unexplored (Wang and Brendel, 2006; Reddy et al., 2007). There is evidence to
indicate that AS is important for plant adaptation to stress (Barbazuk et al., 2008; Reddy
et al., 2007). However, recent bioinformatics studies provided evidence that conserved
splicing events across plant species are rare, thus suggesting a limited role for AS in
generating functionally diversified proteins (Severing et al., 2009).

The recent identification of functionally distinct splice variants of JAZIO (also
known as JASl) has provided new insight into the role of AS in the regulation of JA
signaling. Differential splicing of JAZ10 pre-mRNA generates three transcripts that
encode proteins that differ in the sequence of the Jas domain. The JAZ10.) transcript
(At5g13220.l) encodes a full-length protein harboring an intact Jas domain. This protein

strongly interacts with C01] in a ligand-dependent manner and is readily degraded via

158

 

the 26S proteasome pathway in response to JA treatment (Chung and Howe, 2009). The
JAZlO.3 protein (encoded by At5g13220.3) lacks seven amino acids from the C-terminal
end of the of Jas motif (Yan et al., 2007). JAZlO.3 interacts weakly with COIl in a
ligand-dependent manner and is degraded in planta in response to high concentrations of
exogenous JA (Chung and Howe, 2009). Consistent with the intermediate stability of
JAZlO.3, overexpression of this splice variant in Arabidopsis confers partial insensitivity
to JA (Yan et al., 2007; Chung and Howe, 2009). A third JAZIO splice variant (JAZlO.4)
lacks the entire Jas domain and, as predicted, does not interact with C011 and is highly
resistant to J A-mediated degradation (Chung and Howe, 2009).

Although these findings establish a role for AS in the production of functionally
distinct JAZ isoforms, it is not known whether this phenomenon is specific for
Arabidopsis JAZIO or whether it reflects a general mechanism to create diverse JAZ
isoforms. Here, we show that the Jas domain of most JAZ genes from Physcomitrella
patens (a moss), Selaginella moellendmflii (a vascular non-seed plant), and diverse seed-
bearing plants is encoded by two exons separated by a highly conserved intron, which we
refer to as the Jas intron. As is the case for JAZlO.3, retention of the Jas intron during
processing of these JAZ pre-mRNAs is predicted to generate truncated JAZ proteins
lacking the C-terminal 7 amino acids of the Jas domain. We present experimental
evidence for the existence of these AS transcripts in Arabidopsis, and show that the
corresponding protein products for JAZZ, JAZ3, and JAZIO have reduced capacity to
interact with C01] in the presence of coronatine and JA-Ile. We conclude that AS events
involving retention of the Jas intron play a central role in generating functional diversity

of JAZ proteins through altered protein stability.

159

RESULTS

Structural Organization of Arabidopsis JAZ Genes and Identification of the Jas
Intron

We used gene models at TAIR (The Arabidopsis Information and Resources;
http://www.arabidopsisorg) to compare the structural organization of the 12 Arabidopsis
JAZ genes. In general, genes encoding phylogenetically related proteins, such as
JAZ3/JAZ4/JAZ9 and JAZS/JAZ6, shared a similar intron-exon organization (Fig. 4.1A;
Fig. $4.1). This finding supports the hypothesis that expansion of the Arabidopsis JAZ
family involved gene duplication events giving rise to paralogous gene pairs (Vanholme
et al., 2007). One notable exception to this was JAZI and JAZ2 which, despite their
overall amino acid sequence similarity, are encoded by structurally diverse genes that
serve non-redundant roles in JA signaling (Grunewald et al., 2009).

The structural organization of sequences encoding the Jas domain is remarkably
similar for all Arabidopsis JAZ genes except of JAZ1, JAZ 7, and JAZ8. Specifically, we
found that the Jas domain of nine JAZ proteins is encoded by two exons, the first (5’) of
which specifies the N-terminal 18 to 20 amino acids (depending on the specific gene) of
the domain (Fig. 4.1A and B). With the exception of JAZ5 and JAZ6, this short exon (55
to 61 nucleotides) does not code for amino acids outside the Jas domain. The second (3’)
exon encodes the C-terminal 7 amino acids of the Jas domain and the remainder of the
protein’s C-terminus (Fig. 4.1). In all nine JAZ genes that share this structure, the intron
separating the two exons is located at the same position and phase (i.e., +2). We

henceforth refer to this conserved intron as the J as intron.

160

 

 

 

A functional role for the bipartite organization of the Jas domain coding region
was established for JAZlO.3, which is generated by an alternative splicing event
involving retention of the Jas intron (Yan et al., 2007; Chung and Howe, 2009). In this
case, retention of the 5’ end of Jas intron creates an in-frame stop codon immediately
after the highly conserved KRKXR motif (Fig. 4.1B). Y2H studies showed that this
naturally truncated JAZ interacts weakly with C011 and, as a consequence, is stabilized
against JA-induced degradation in vivo (Chung and Howe, 2009). Our sequence analysis
revealed that, like JAZIO, hypothetical retention of the Jas intron in JAZZ, JAZ6, and
JAZI 1 would create an in-frame stop codon after the KRKXR motif (Fig. 4.2). Similarly,
retention of the Jas intron in JAZ3 and JAZ4 is predicted to generate splice variants

containing one and five amino acids, respectively, afler the KRKXR motif.

Identification of Alternatively Spliced JAZ Transcripts with a Retained Jas Intron

The TAIR database contains an EST-supported gene model for JAZ4 (Atlg—iSStiOQ.
JAZ4.2) and JAZIO (At5g13220.2, JAZlO.2; At5g13220.3, JAZlO.3) that are indicative
of Jas intron retention. To systemically determine whether the Jas intron is retained
during splicing of other JAZ pre-mRNAs, we performed reverse transcriptase-mediated
PCR (RT-PCR) with primers designed to specifically amplify transcripts in which 5’ end
of the Jas intron is retained (i.e. the 5’ splicing donor site is not used). Using RNA from
JA-treated seedlings as a template for RT-PCR, this experiment identified Jas intron-
containing transcripts for JAZZ, JAZ3, JAZ4, JAZ6, JAZ9, JAZIO, and JAZIZ but not
JAZ5 and JAZ/1 (Fig. 4.3A). Sequence analysis of cloned PCR products showed that

these transcripts contain the Jas intron but not other intron sequences, therefore excluding

161

the possibility of genomic DNA contamination in the PCR reactions. Control experiments
using reverse primers that span the two Jas domain-coding exons showed that JAZ
transcripts lacking the Jas intron are also present in JA-treated seedlings (Fig. 438).
Based on these results, we conclude that the Jas intron in most (at least 7) Arabidopsis

JAZ genes can be retained during pre-mRNA processing.

Retention of the Jas Intron Produces JAZ Isoforms with Altered Function

The importance of the Jas domain as a JAZ destabilization element via a mechanism
involving hormone-dependent COIl interaction is now well established (Thines et al.,
2007; Katsir et al., 2008b; Melotto et al., 2008; Chung and Howe, 2009; Fonseca et al.,
2009). Given the effect of Jas-intron retention on the function of JAZlO.3 (Yan et al.,
2007; Chung and Howe, 2009), we tested the hypothesis that other JAZ isoforms
produced by this intron retention event are altered in their capacity to interact with COI1.
We first used the yeast two-hybrid (Y2H) system to assess all 12 full-length JAZ proteins
for their ability to bind COIl in a ligand-dependent fashion. In the presence of COR, a
potent mimic of JA-Ile (Feys et al., 1994; Staswick, 2008; Katsir et al., 2008), C011
interacted strongly with JAZ1, JAZZ, JAZ3, JAZ9, and JAZlZ, and moderately with
JAZ4 and JAZlO.] (Fig. 4.4A). COR-dependent interaction of COIl with JAle was
very weak but nevertheless detectable, whereas no interaction with the four remaining
family members (JAZ5, JAZ6, JAZ7, and JAZ8) was observed in this system. These
results are consistent with previous studies showing that COR stimulates COI1 binding to
JAZI, JAZ3, JAZ9, and JAZ10.1 (Katsir et al., 2008b; Melotto et al., 2008; Chung and

Howe, 2009; Fonseca et al., 2009).

162

 

We also assessed COIl-JAZ interactions in the presence of the two native
stereoisomers of JA-Ile, namely (3R,7S)-JA-Ile and (3R,7R)-JA-Ile. In agreement with
recent studies (Fonseca et al., 2009) showing that the (3R,7S) isomer is the active form of
the endogenous hormone, we observed that (3R,7S)-JA-Ile but not (3R,7R)-JA-Ile
stimulates COIl-JAZ binding (Fig. 4.4A and data not shown). At the concentration of
(3R,7S)-JA-Ile used in this experiment, a positive COIl-JAZ interaction was observed
only with those JAZs (i.e., JAZ1, JAZZ, JAZ3, and JAZ12) that interacted strongly with
C01] in the presence of COR. Western blot analysis showed that all 12 JAZ proteins
were produced in yeast cells used for this experiment (Fig. $4.2). These results suggest
that members of the JAZ family differentially interact with C01], and provide a rational
basis for selecting specific JAZs for further study.

We chose JAZZ and JAZ3 for additional studies aimed at characterizing splice
variants that are produced as a consequence of Jas intron retention. In accordance with
established gene models in TAIR, we refer to proteins produced from the completely
spliced transcripts as JAZZ.1 and JAZ3.1, and the corresponding splice variants encoded
by Jas intron-containing transcripts as J AZ2.Z and JAZ3.4. Both COR and (3R,7S)-JA-Ile
stimulated the interaction of COIl with JAZZ.1 and JAZ3.1 in a dose-dependent manner
(Fig. 4.4B). COR appeared to be more active than (3R,7S)-JA-Ile over the range of
concentrations tested. Parallel analysis of J A222 and J AZ3.4 showed that these truncated
isoforms interact more weakly with COIl in comparison to the full-length JAZZ.1 and
JAZBJ proteins. This effect was observed both in the presence of COR and (3R,7S)-JA-
Ile. Notably, relatively high concentrations of COR stimulated COIl interaction with

JAZZ.Z and JAZ3.4, whereas (3R,7S)-JA-Ile did not promote these interactions at any of

163

the concentrations tested. These findings provide evidence that retention of the Jas intron
during pre-mRNA splicing represents a general mechanism for producing functional

diversity among JAZ proteins.

Alternative Splicing of JAZIO pre-mRN A Affects JA Signal Output

Previous fiinctional analyses of JAZIO isoforms produced by alternative splicing relied
on overexpression of cDNAs encoding specific splice variants (Yan et al., 2007; Chung
and Howe, 2009). To further test the hypothesis that alternative splicing of JAZ pre-
mRNA in vivo has an effect on JA signal output, we generated stable lines of Arabidopsis
that express the full-length JAZIO genomic DNA (Fig. 4.1A) under the control of the
Cauliflower Mosaic Virus (CaMV) 358 promoter. Fifteen of 20 independent Tl lines
expressing the 35S-JAZIOG transgene produced progeny that were insensitive to JA-
induced root growth inhibition. Subsequently, we compared the root growth phenotype of
three representative T2 homozygous lines (JAZI 06-2, JAZI 06-4, and JAZI OG-5) to lines
overexpressing one of the three specific JAZ10 splice variants, JAZlO.1, JAZlO.3, or
JAZ10.4 (Chung and Howe, 2009). Root length measurements performed 9 days after
germination showed that the level of JA insensitivity exhibited by all three 35S-JAZIOG
lines was comparable to that of 35S—JAZIO.4 plants (Fig. 4.5A and B). This finding
indicates that 35S-JAZI OG plants produce one or more dominant negative splice variants
(i.e., JAZlO.3 and/or JAZ10.4) as a result of alternative splicing of JAZ/0 pre-RNA by
the endogenous splicing machinery. In contrast to the male-sterile phenotype of 35S-
JAZIO.4 plants (Chung and Howe, 2009), we failed to observe reproductive defects in

any of the 50 independent 35S-JAZIOG lines tested, including homozygous lines (data

164

not shown). This result suggests that alternative splicing of JAZIO pre-RNA may occur in

a tissue-specific manner.

Conservation of the Jas Intron during Evolution of Land Plants
To gain insight into the evolutionary significance of Jas intron retention as a mechanism
for modulating JA signaling, we analyzed the intron-exon structure of JAZ genes in
phylogenetically diverse taxa. Among the species in which JAZ genomic sequences were
identified were Physcomitrella patens, Selaginella moellendorflii, Oryza sativa,
Brachypodium distachyon, Populus trichocarpa, Vitis vim’fera, and Arabidopsis (see
Methods). A total of 72 JAZ genes were identified from these seven species (Tab. 4.1).
Although the overall amino acid sequence similarity between proteins from different
species was low, multiple sequence alignments showed that the ZIM and Jas domain
signature sequences are strongly conserved across species (Fig. 34.3). A phylogenetic
tree constructed from the 72 proteins indicated that the family can be divided into four
subgroups (Fig. 4.6). All P. patens and S. moellendorflii sequences clustered in subgroup
A, which also contained JAZ proteins from the flowering plants. Arabidopsis JAZ3,
JAZ4, JAZ9, which are encoded by highly similar genes (Fig. 4.1A), belong to this
subgroup and thus appear to be related to the earliest evolved JAZ proteins. In contrast,
members of subgroup D (e. g., Arabidopsis JAZ7/8) appear to have evolved more recently
in eudicots.

Remarkably, we found that the position and phase (+2) of the Jas intron is
conserved in the vast majority (56 of 72; 78%) of JAZ genes from all species examined,

including P. patens and S. moellendorflii (Tab. 4.1). Retention of the Jas intron during

165

pre-mRNA processing of 32 (57%) of these genes is predicted to produce an in-frame
stop codon immediately after the conserved KRKXR motif (Tab. $41), as is the case for
the alternative splicing event giving rise to Arabidopsis JAZlO.3. In many other cases, an
in-frame stop codon near the 5’ end of the retained Jas intron is predicted to produce a
JAZ variant containing less than 10 amino acids C-terrninal to the KRKXR motif (Tab.
$4.1). EST sequence databases provide empirical evidence for the existence of Jas intron-
containing transcripts in species other than Arabidopsis. For example, Jas intron-
containing transcripts for JAZB3 and JAZB4 from B. distachyon (identification numbers
Bradi4g31240.l and Bradi5gZ4410.l, respectively) were identified in the Brachypodium
database (http://www.brachybaseorg:8075/). These observations suggest that the Jas
intron existed in an ancestral JAZ gene prior to the divergence of the gene family. The
persistence of the Jas intron through evolution further suggests an important biological

role for this sequence.

DISCUSSION

The J as Domain is Encoded by DNA Having a Conserved Intron-Exon Structure

We report here that the intron-exon organization of DNA encoding the Jas domain of
most JAZ proteins is conserved in diverse land plants. In all 54 JAZ genes that share this
organization (Tab. 84.1), the Jas domain is encoded by a 5’ exon that specifies the N-
terminal 18 to 20 amino acids of the domain ending in the conserved KRKXR, and a 3’
exon specifying the C-terminal seven amino acids ending in the conserved PY (referred
to as the FY motif; Fig. 4.18). These two exons are split by a sequence we refer to as the

Jas intron. The presence of the Jas intron in JAZ orthologs from P. patens and S.

166

moellendorflii is noteworthy because JAZs and other members of the TIFY family appear
to have arisen in early land plants (Vanholme et al., 2007; Chico et al., 2008; Katsir et al.,
2008a). These observations suggest that the Jas intron arose early in the evolution of the
TIFY family, and has been retained during the time since P. patens diverged from higher
plants approximately 450 million years ago. Precise conservation of the position and
phase (+2) of the Jas intron in all species strongly suggests an important biological role
for this sequence (see below).

The sequence of the N-terminal region of the Jas domain encoded by the 5’ exon
resembles the CCT (C0, CO-like, T 0C1) domain that was first identified in the plant
proteins TOCl and CONSTANS (CO), which serve important roles in controlling plant
responses to environmental signals (Strayer et al., 2000; Robson et al., 2001). This
sequence similarity is restricted to the N-terminal part of the CCT domain (Fig. 1.4).
Although the C-terminal portion of the CCT domain has been implicated in protein-
protein interaction, the biochemical function of the N-terminal CCT sequence resembling
the Jas domain is not known (Wenkel et al., 2006). The presence of a CCT domain-
containing C0 gene in Chlamydomonas reinhardtii (Griffiths et al., 2003; Serrano et al.,
2009) indicates that the CCT domain predates the evolution of the TIFY family, which
first appeared in lower plants (Vanholme et al., 2007). ZIM and ZIM-like (ZML)
members of the TIFY family contain a CCT domain that, like the CCT domain in CO and
CO-like proteins, is encoded by a single exon (Griffiths et al., 2003; Vanholme et al.,
2007). These observations raise the speculative but interesting possibility that Jas domain
evolved from an ancestral TIFY protein in which the CCT domain-coding region was

interrupted by the J as intron.

167

Role of the Jas Intron in Functional Diversification of JAZ Proteins

Initial insight into the phenomenon of JAZ alternative splicing came from the discovery
that overexpression of a JAZ10 splice variant (JAZlO.3) lacking the C-terminal PY motif
results in partial loss of JA responsiveness (Yan et al., 2007). Subsequent analyses
showed that JAZlO.3 interacts weakly with COIl in vitro, and is stabilized against JA-
dependent degradation in planta (Chung and Howe, 2009). Arabidopsis JAZlO.3 is
encoded by a transcript (At5g13220.3) in which the 5' splice donor site of the Jas intron is
not used. As a consequence, an in-frame stop codon (TAA) immediately following
Argl 85 produces a truncated protein lacking the FY motif.

Our results show that Jas intron retention is not specific for JAZIO but rather
reflects a general mechanism for generating JAZ isoforms with an altered J as domain. At
least two mechanisms can be proposed to explain how jas intron retention affects
dominant negative effects on JA signal output. YZH studies performed with splice
variants of JAZZ, JAZ3, and JAZ10 support the hypothesis that removal of the FY motif
reduces the strength of hormone-dependent JAZ binding to C01] (Chung and Howe,
2009; this study). In vitro pull-down assays performed with JAZlO.1, JAZlO.3, and
JAZlO.4 confirmed the differential, hormone-dependent interaction of these proteins with
COIl (T Cooke, HS Chung, GA Howe, unpublished results). Functional analysis of
additional splice variants will be useful to further test this hypothesis, as will structural
elucidation of COIl-ligand-JAZ complexes. It is interesting to note that some JAZ genes
in which the Jas intron is correctly spliced give rise to proteins that lack the PY motif
(Fig. $4.3). The PEAPOD (PPD) members of the TIFY family also contain a Jas-like

domain lacking the FY motif (Chung et al., 2009). Genetic analysis has shown that PPDs

168

regulate leaf size and shape in Arabidopsis (White, 2006). There is no evidence to
indicate, however, that PPDs play a role in JA responses or function as substrates for
SCFCO“.

It is also possible that alteration of the Jas domain via intron retention affects
protein subcellular distribution. A recent study provided evidence that the PY motif of
JAZI is part of a larger nuclear localization signal (NLS) that includes basic amino acids
within the Jas domain (Grunewald et al., 2009). Interestingly, NLSs having an overall
basic character followed by a C-terminal R/K/HX2-5PY motif have been identified in
yeast (Lee et al., 2006; Siiel and Chook, 2009). A dual role for the Jas domain as a C01]-
interacting degron and an NLS (Grunewald et al., 2009) raises the possibility that
modification of the domain via Jas intron retention affects both JAZ stability and
localization. In the case of JAZlO.3, however, removal of the PY motif did not prevent
nuclear targeting of the protein (Chung and Howe, 2009). Based on the recent findings of
Grunewald et a1 (2009), additional studies are needed to determine whether splice
variants produced by Jas intron retention are affected in their distribution within the

nucleus.

Regulation of JA Responses by Alternative Splicing

Previous analysis of JAZ alternative splicing relied on the use of transgenic plants that
overexpress cDNAs encoding individual splice variants (Yan et al., 2007; Chung and
Howe, 2009). To determine whether these isoforms are produced in vivo from JAZIO pre-
mRNA, we generated and analyzed 35S-JAZIOG transgenic plants that constitutively

express a genomic copy of JAZIO. The JA-insensitive root growth phenotype of these

169

lines indicates that alternative splicing of JAZIO pre-mRNA results in production of
splice variants that are resistant to JA-induced degradation. The fact that the strength of
the 35S-JAZIOG root growth phenotype was more similar to 3SS—JAZIO.4 plants than to
35S-JAZIO.3 plants indicates that this effect likely involves JAZ10.4. This finding
supports our previous proposal (Chung and Howe, 2009) that induced expression of
JAZIO in response to wounding (Yan et al., 2007; Chung et al., 2008) or other inductive
cues is sufficient to attenuate JA signaling through the production of stabilized JAZ10
isoforms. The identification herein of additional splice variants (JAZZ.Z and JAZ3.4) that
weakly interact with C01] suggests that Jas intron retention is part of a general
mechanism of negative feedback regulation of JA signaling. Gene models described at
TAIR provide evidence that alternative splicing events other than Jas intron retention
may be involved in functional diversification of the JAZ family. For example, EST
sequence information supports the existence of transcripts encoding two splice isoforms
of JAZ3 (JAZ3.Z and JAZ3.3) that lack a segment of the N—terminus but retain the ZIM
and J as domains. Functional analysis of these isoforms may provide new insight into the
role of the N-terminal region of JAZ3 and other “ancient” JAZs that comprise JAZ
subgroup A.

Alternative splicing plays a central role in expanding protein diversity in
eukaryotic organisms. Our results indicate that the Jas intron has been maintained during
the evolution because its retention during pre-mRNA splicing diversifies the cellular
repertoire of JAZs. This conclusion provides a counter argument to the view that
alternative splicing plays a limited role in generating functionally diversified proteins in

plants (Severing et al., 2009). Indeed, our results are more in keeping with the view that

170

alternative splicing optimizes plant adaptation to environmental stress (Reddy, 2007;
Barbazuk et al., 2008).

Based on the results presented here and elsewhere (Yan et al., 2007; Chung and
Howe, 2009), we propose that splice variants generated by Jas intron retention are more
stable in the presence of J A and therefore act, in a dominant negative fashion, to attenuate
JA-induced changes in gene expression. The high fitness cost associated with expression
of JA-regulated defenses in the absence of stress (Baldwin, 1998) may explain why
conditional expression of stabilized JAZs would be advantageous to the plant. Efficient
mechanisms to attenuate JA responses may also serve to protect the cell from toxic
effects associated with hyperactivation of the JA pathway. In addition to hormone
desensitization, production of JAZ isoforms having a wide range of stabilities may
increase versatility in J A responses.

It is also possible that alternative splicing of JAZ genes is regulated in a tissue or
cell type-specific manner. Several examples of tissue-specific mRNA splicing have been
described in plants (Reddy, 2007; Fang et al., 2004; Zhang et al., 2009). Our finding that
overexpression of the JAZIO gene results in strong JA insensitivity in roots but
presumably not in flowers (as determined by fertility) suggests that JAZIO pre-mRNA
may be differentially spliced in a tissue-specific manner. Additional studies are currently

in progress to address this hypothesis.

171

 

MATERIALS AND METHODS

Plant Material and Growth Conditions

ArabidOpsis thaliana ecotype Columbia (Col-0) was used as the wild type for all
experiments. Soil-grown plants were maintained in a growth chamber at 21°C under 16 h
light (100 uE rn’2 s") and 8 h dark. Arabidopsis was transformed with Agrobacterium
tumefaciens (strain C58Cl) using the floral dip method (Clough and Bent, 1998).
Transformed lines (T1 generation) were selected on MS plates containing kanamycin (50
ug/mL) and vancomycin (100 ug/mL). F ifly independent Tl plants per genotype were
transferred to soil for subsequent phenotypic analysis. Homozygous lines were identified

by testing T3 progeny for resistance to kanamycin.

Identification of Alternatively Spliced JAZ Transcripts

JAZ transcripts containing or not containing the Jas intron were amplified by RT-PCR
from RNA prepared from x-day-old wild-type seedlings treated with 100 uM MeJA for 2
h as previously described (Chung et al., 2008?). PCR reactions were performed with Taq
DNA polymerase (Invitrogen) and the transcript-specific primer sets listed in Table S2.
PCR products were cloned into pGEM-T easy vector (Promega) and sequenced with T7

and SP6 primers.

Yeast Two-Hybrid Assays
Cloning of 12 JAZ cDNAs and cloning into pB42AD vector is described in Chung and
Howe (2009). cDNAs encoding JAZZZ and JAZ3.4 were subcloned into the Matchmaker

pB42AD vector (Clonetech) to generate JAZ fusions with the B42 activation domain

172

(AD). Oligonucleotide primers used to generate these constructs are listed in Table 82.
Yeast transformation, selection of transformants, and ligand-dependent yeast two-hybrid
assays were conducted as described by Melotto et al. (2008) and Chung and Howe (2009).
Coronatine (Sigma-Aldrich) or stereoisomers of JA-Ile ((3R,7S)-, (3S,7S)-, (3S,7R), and
(3R,7R)-JA-Ile) was added to the medium before the yeast cells were plated.
Stereoisomers of JA-Ile were preare described by Ogawa and Kobayashi (2008).
Expression of the BD fusion JAZ proteins was detected by protein gel blot analysis using

anti-hemagglutinin (HA; Covance) antibody.

Construction of 35S-JAZMG

Full-length JAZIO genomic DNA was amplified from DNA prepared from Arabidopsis
rosette leaves. PCR reaction was performed with Pfu Turbo DNA polymerase
(Stratagene) and the primers listed in Supplemntal Table 2. The amplified JAZIO
genomic DNA was subcloned into pGEM-T Easy (Promega), followed by recloning into

the BamHI site of pBI-TS (Schilmiler et al., 2007).

Root Growth Inhibition Assay

Seeds were surface sterilized with 30% (v/v) commercial bleach for 15 min and washed
10 times with sterile distilled water. Seeds of each genotype were placed on square plates
(Fisher) containing MS medium that was supplemented with 50 uM MeJA. Plates were
incubated at 4°C for 4 d in darkness and then incubated under normal growth conditions
for the remainder of the experiment. Plates were oriented in a vertical position for 9 d

prior to measurement of primary root length. 35S-JAZ]0.I, 35S-JAZIO.3, and 355-

173

 

JAZIO.4 transgenic lines, which exhibit different levels of JA sensitivity (Chung and

Howe, 2009), were used as controls.

Identification of JAZ Genes in Various Plant Species

JAZ gene sequences were identified in publically available genome sequences of P.
patens (Rensing et al., 2007), S. moellendorflii (htggfl/genomejgi-
psforg/Selmol/Selmol.home.html), 0. sativa (Goff et al., 2002; ref), B. distachyon
(http://www.brachybaseorg:8075/), P. trichocarpa (Tuskan et al., 2006), and V. vinifera
(http://wwwncbi.nlm.nih.gov/genome/secfl3lastGen/BlastGen.cgi?taxid=Z9760). Using
Arabidopsis JAZI as a query, databases (with default algorithm parameters) were
searched with BLASTP and TBLASTN. Retrieved JAZ sequences for a particular species
were then used to re-query the database for that species. Following removal of redundant
sequences, all unique protein sequences were manually annotated for the presence of the
ZIM and Jas domains. The intron-exon structure of all candidate genes was assessed with
the genome browser in the respective database, as well as by ClustalW-based alignment
of the genomic DNA sequence with predicted coding sequence of the gene. , A Hidden
Markov Model gene prediction program (HMM-FGENESH) available at Soflberry
(http://linuxl.softberry.com/berry.phtml) was used to confirm the structural organization

of all genes.

Sequence Alignment and Phylogenetic Analysis
Full-length JAZ protein sequences were aligned and analyzed with the ClustalW program

and Bioedit v.7.0.9 software (Thopmson et al., 1 994;

174

http://wwwmbioncsu.edu/BioEdit/bioedit.html). The resulting multiple sequence
alignment was used for construction of a phylogenetic tree with the neighbor-joining (NJ)
method and MEGA4.1 software (http://wwwmegasofiware.net/; Tamura et al., 2007).

Node confidence was assessed with 1,000 bootstrap replicates.

175

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

i—JAZ1 . *-
i—JAZZ 1.- H'l I 1
_—-—JA25 -—I- - -
-——JAZO ~ H- -
——JAZ11 :I-fll—J—I I I
i—JAZ12 El+—I.l I.
JAZ10.1 'I-I-I—I + I
JAZO ml :
i—JAZ3 ' I————ml. _
i—JAZA I “II. I
.__JAz7 2...;
.__Jm H...
— 0.2kb

 

 

Jas Intron lneertlon

Figure 4.1. Structural organization of Arabidopsis JAZ genes.

A) Phylogenetic tree constructed by the neighbor-joining method from the amino acid sequence
of JAZ proteins (lefi), and the intron-exon organization of the corresponding genes (right). Thick
black and gray bars indicate coding regions and non-coding untranslated regions in exons,
respectively. Introns are depicted by a thin black horizontal line or, in the case of the Jas intron, 3
blue line. Sequences encoding the TIFY motif and Jas domains are shown in red and blue,
respectively. B) Web logo (Crooks et al., 2004) constructed for the Jas domain of 12 Arabidopsis
JAZ proteins. The location of conserved Jas intron is indicated by the arrow. In 7 of the 9 Jas
intron-containing genes, the N-terrninal l8 (JAZ9), l9 (JAZZ, JAZIO, JAZl 1, and JAZlZ)), or 20
(JAZB and JAZ4) amino acids of the Jas domain, ending in the conserved KRKXR motif, are
encoded by a single exon (underlined).

176

+2

JAZZ —ITGCATTTTAATGAAAACATAATAT

R F L E K R K D R

+2
JAZ3 _5TACGCAACACTTCTTLZEAATACACCA
R F L E K R K E R Y A L ’

T L

+2
JAZ4 —GTACE€£GCTACAAGATTATTCACTTAT
R F L E K R K E R Y '

‘d

 

TATTTAACCTTATCATACTTTTTGAAA

R F F A K R K D R Y L T L S Y F L K

+2
JAZB —GmAcrAAAcrcccAmcrcnnsr
R F F A K R K D R ’

+2

 

JAZ! TTTGATTTTGTATTTTTTTTCTTTATA

R F L E K R K E R F D F V F F F F I

+2
JAZ“ _GIETGATTCTTCAACAATCCAAGGM
a r r A K a K o R +
+2
JAZ11 —GIZETTAGATATTCAGTGrrchrrrA
R F F E K i! R H R ‘
+2
JA212 “TATGCAGCCTTTAAAATTACACTTCAT
R r L E K a R o a v A

A F K I T L H

Figure 4.2. Retention of the Jas intron during pre-mRNA splicing is predicted to alter the
Jas domain.

Exon and Jas intron sequences are highlighted in black and gray, respectively. Only the last 26
nucleotides of the exon encoding N-terrninal portion of the Jas domain (ending in the KRKXR
motif) are shown. In all cases, the Jas intron disrupts the exon in the +2 position. The predicted
amino acid sequence is shown below the genomic DNA sequence. In the case of JAZZ, JAZ3,
JAZ4, JAZ6, JAZIO, and JAZI 1, an in-frame stop codon (highlighted in dark gray) is found near
the 5’ end of the Jas intron.

177

JAZZ JAZ3 JAZ4 JAZ5 JAZ6 JAZ9 JAZ10 JAZ11 JAZ12

 

Figure 4.3. PCR-based detection of Jas intron retention in various JAZ transcripts.

RT-PCR was used to amplify JAZ transcripts in which the Jas intron was either spliced out (A) or
retained (B). Gene-specific primers and RNA from MeJA-treated Arabidopsis seedlings was used
as a template for reactions (see Methods). PCR-amplified products were separated by agarose gel
electrophoresis and visualized by staining with ethidium bromide.

178

JAZ1 JA22 JAZ: JA24 JA25 JA26 JAZ7 JAZ8 JA29JA210. 1 JAZ11JA212
- 77W7x. 1'. - - , .
1' o — . .
{' _ V ' J Mock

*--' 7.17.:- 77171 .7. “rs-5" i:’.'m~.""“2’37’7~¥~, ‘3? '“ m *7 .TTA' :7. :7.-."'~*<:.:--',—a-.“7r,—-a: or“. -
I - '

 

         

COR (9”)

 

 

0 1 5 10 30 100
, ' *Wr‘vmwmr“ ‘7
JA22.1 (\l ' . . ..

JAZZZ ( 7777777)
ALWA‘JAMAMA

JAZ3.1( ,- » . 3'3; 4‘”) :25)

. A. IA‘JA‘J‘U‘J

 

 

Figure 4.4. Differential ligand-dependent interaction of JAZ proteins with C011.

(A) Full-length JAZ proteins (expressed in pB42AD) were tested in the YZH system for
interaction with C01] (expressed in pBILDA) in the presence of 50 uM coronatine (COR; top
panel) or 100 uM (3R,7S)-JA-Ile (JA-Ile; bottom panel).

(B) Full-length JAZZ (JAZZ.1) and JAZ3 (JAZ3.1) proteins, together with their respective splice
variants (JAZZ.Z and JAZ3 .4) derived fi'om retention of the Jas intron (Fig. 2 and 3), were tested
for C011 binding in YZH assays performed in the presence of the indicated concentration of COR
(left panel) or (3R,7S)-JA-Ile (right panel).

179

WT JAZ101 JAZTOJ JAZ704 JAZ10G-2JAZ1OG-4JA210G5

 

.5
01

10

Root length (mm)

WT JAZ10.1 JAZ10.3 JAZ10.4 JAZ1OG-2 JAZ1OG-4 JAZ1OG-5

Figure 4.5. Overexpression of JAZIO genomic DNA attenuates JA signaling in Arabidopsis.
(A) Wild-type (WT) and transgenic seedlings of the indicated genotype were grown for 9 d on
MS medium containing 50 uM MeJA. JAZIOJ, JAZlO.3, JAZIO.4 refer to control transgenic
lines overexpressing cDNAs that encode the JAZlO.1, JAZlO.3, and JAZIO.4 splice variants,
respectively. The JA-mediated root growth inhibition phenotype of these lines was compared to
that of three independent transgenic lines (JAZIOG-Z, JAZI 06-4, and JAZIOG-5) overexpressing
the JAZIO genomic DNA.

(B) Quantification of JA-induced root growth inhibition of seedlings shown in A). Data show the
mean :I: SD (n = 11 seedlings per genotype).

180

Figure 4.6. Phylogenetic tree of JAZ proteins from higher and lower in land plants.
Unrooted neighbor-joining tree of predicted JAZ proteins from A. thaliana (black), P. patens
(red), S. moellendorfiii (orange), 0. sativa (blue), B. aystachyon (light blue), P. trichocarpa
(green), and V. vinifera (purple). Multiple sequence alignment was performed with ClutalW. Four
JAZ subclades are indicated as A-D. The Arabidopsis JAZ nomenclature is as previously
described (Thines et al., 2007; Chini et al., 2007). The nomenclature for all other JAZs is based
on the phylogeneic classification within subclades A-D.

181

 

A B C D
0
91 64 0 3 2

12mm 334 mmuzaumnmzznngifé asnnuunnn1291u ....m_...,.J 1mmmmn1? sum
7.7.. 7.7.. AAAAAAAZA Z7.— 2 7.. 7.7.7.. 7..
AAAfingflAAanqnfinA “A“ JJJJJ JAJJA AAAAAAAAAA11Annn56nnnn12nnnnn1n“AT-Ban“
JJJJMJJJnmwwmmmJJN mmm m mJmmwpuwwmumfiuwnMJJmouJJuMJJuJuJJJrzerJJ
mmWWJWWHMJJOO PPpWPPSSnams SMSSPPOBOOOBOBOOJ mBJJHMWJmeo mmmJJMWW

z

E?

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

182

33.25 MSSSNENAKA QAPEKSDFTR RCSLLSRYLK EKGSFGNIDL GLYRKPDSSL ALPGKFDPPG

31126 14er ------ QAPEKSNFSQ RCSLLSRYLK EKGSPGNINM GLARKSD--L ELAGKFDLKG
m5 KQNAMHKAGH sx ------------ csps'rs sccm--nv ADLSESQP-- GSSQLTIFFG
m6 QQNVIKKVET SETRPPKLIQ Krsrcnas'rs TEDKAIYIDL SEPAKVAPES GNSQLTIFFG
m5 GKVLVYNEFP VDKAKEIMEV AKQAKPVTEI NIQTPINDEN NNNKSSMVLP DLNEPTDNNH
JAZG GKVMVFNEFP Bumsmzv AREANHVAVD smsuosan NLDKSNWIP DLNEPTSSG-
JAZS LTKEQQQQQE QNQIVERIAR RASLHRFFAK RKDRAVARAP YQVNQNAGHH RYPPKPEIVT
ms -NNEDQETGQ QHQVVERIAR RASLHRFFAK RRDRAVARAP YQVNQHGSH- ~LPPKPEMVA
m5 GQPLEAGQSS QRPPDNAIGQ rmrrtsnco KDDIMKIEEG OSSKDLDLRL"

JAZ6 PS-IKSGQSS QHIATPPKPK AHNHMPMBVD K ------ KEG QSSKNLELKL“

Exon1 Exon2 Exon3 Exon4

Supplemental Figure 4.1. Amino acid sequence alignment of ArabidOpsis JAZS and JAZ6.
Both genes contain three introns and four exons. Amino acids encoded by each exon are indicated
with different colors.

183

AD-JAZ proteins
123456789 101112

 

   

Supplemental Figure 4.2. Western blot analysis of JAZ proteins expressed in the yeast
strains used for the Y2H experiment shown in Figure 4.4A.

Total protein extracted from yeast cells expressing activation domain (AD)-JAZ fusion proteins
(JAZl-JAZlZ) and the DNA binding domain (BD)-C011 fusion protein was analyzed by western
blot analysis. D-JAZ proteins were detected with an anti-HA antibody.

184

Supplemental Figure 4.3. Amino acid sequence alignment of the ZIM and Jas domains of
JAZ proteins from various land plants.

JAZI] contains an internal duplication and is predicted to encode a protein with two ZIM
domains and two Jas domains. The ZIM and Jas domains located at the C-terminal end of JAle
were used for the alignment. See Table 81 for additional information.

185

rJA:h<
;r.l,\:[ir
7r.lJ,:l-7
:IJATDH
P'JAILQ

p

311' I?"

 

186

  
   
   
     

4 ITAKEAA'E~-—
. 3.7!;1.“ .._

:l--
13--
TIK‘Si-K— »

--”Lgucn2-
LVSKJ'I- ~

 

 

-:vvaz—-rt
—ZTTIK—-FY
vaa‘ -——
‘ ‘HVTHI — - ~-
J ..........
loauafl||—-»
yvarannnrv
Ira -

33

l.
J.
A
A

y.
l
l

 

 

 

 

 

PpJAZA4 “Hm -

SmJAZAQ -*I—-l--

OsJAZ3 I———--J-—I -

AtJAZ3 I I If”! I

PtJAZM r m- — I
VVJAZA4 I "m- "- I

 

 

 

Supplemental Figure 4.4. Structural organization of selected JAZ genes in subclade A. Thick
black and gray bars indicate coding regions and non-coding untranslated regions in exons,
respectively. Introns are depicted by a thin black horizontal line or, in the case of the Jas intron, a
blue line. Sequences encoding the TIFY motif and Jas domains are colored red and blue,
respectively. The 3’ end of the genes (boxed), including the last 4 exons and three introns, show
the highest level of structural conservation.

187

Table 4.1. Identification of JAZ genes and the conserved Jas intron in various plant

 

 

species
Species Number of JAZ genes Number ofJAZ genes with the
Jas intron (phase)

P. patens 9 7 (+2)

S. moellendorflii 9 9 (+2)

0. sativa 15 9 (+2)

B. dystachyon 4 3 (+2)

A. thaliana 12 9 (+2)

P. trichocarpa 14 12 (+2)

V. vinifera 9 7 (+2)
Total 72 56

 

188

 

Z .mm<>4a<<<m§mxm._umq_wmx2m40m< 02>“: NN<BO omwmoonomo
.Smommxmdmcamxmmsnfio > >m<¥w>._mmommxwdmOJwImmSaqo 60E... PNSamO oummmmeomo $58 «$60
.mmxmmcammhqm<xm<0n_._> > mimggmmxmmcfimbm<xm<0m4> 0<>u_._. m<N<wEm 3mm 3‘
. . .Gmmimoxmwaum—Iqmlxxméa40 > xom¥<ugmoxm¥m4mm14m§méaqo 02KB... w<N<wEw mvwmmv
...IIw>omoxm—x>._umm_m<¥m<0>oz > m<ax<wgmoxm¥>fimw5§m<0>oz 02>“..F ~<N<...Em 8mm:
.mommxSum04m<mm>On_._o > mmmZOmen—mmxfiumcamlxwmzvaa Gw>n=._. o<N<wEm 580v
.xOxmeJumgmsu—méaaw > mz>_>hOxOxm¥O.EmC_w<~—m<0a._0 0<>n=._. m<N<sz $.53
.mwxmxmaum04m<¥m<0n_4< > m_>mv..0wmxmxw4um04w<¥m<0a..< 00>...2h v<N<wEw 8va
.mmeXMAum04m<¥m<Oa..< > m8<omowwxmxw4mmcaw<¥m<0aq< 093$; m<N<wEm 3on
.xwmmm04m104w<¥m<0n3w > w<<wx<§wmmmadm04m§m<da4m wot—2... N<N<3cm 85$.
.xmmmmofimcamsiémqw > w<<mx<§wmmm04um04w<xm<0m4w 00>n=2h F<N<_.Em moms: NgbcgooE
mamsumxom
.moxmxwgumfimgméaam > >m_..>.5moxmv_w..um<._m<xm<ca._m 05C: m<N<3a wowwmomop
z >_>v.v.>moxmv_w..n_m<._w<xm<0a4w 0<>u_._. w<N<3a @8889
Z >aoxx>mo¥m¥w4um<4w<xm<0a4w 656:... ~<N<3a rmommowow
.mxmmodmfimzxmgazm > wmocwmwmxmmoqumjmzxm’xzaan. wot... m<N<3a 9838p
...w4<>4mxmw04umm4mmxm<ha4a > ommoomxmxmwOJummemxmghd 09E; m<N<..dn_ mwormowop
.mommmwfimngmgaam > >awhm>mommmwdmfim<xm<0a4w 0<>u_._. v<N<3a $8889
...I>mw0mommmw..n_m<._w<v.m<0n_._w > >amhm<mommmm4umfim<¥m<0m4m o<>m:. m<N<3m @3589.
.z>moxmxo._um<i_m<xm<0n3w > >a0xm>moxmxofimjw<xm<cmqm 0<>n=m N<N<3n_ 8388..
...mim>moxmxw4umjw<¥m<0a4w > >a0xm>moxmxw4um<4w<xm<da4m 05rd... ..(Nidn. mm 3589 3.23
gméEoowxcl
ache. concave» 05!. a. 530.5
cow—.82 cob... ‘3 5qu.. 22. £555.. «2. 8.00am
8.. >u=._. Ni. toe—5: .0

 

«33% 38...; E tout—.02 8.39:— N<—. he 3: ._.v «Ea... 13582.3.5

9
8
l

.moxmfimmmzqmém<_mw>

. . .w4h4>moxm¥<um114m<mm5mw>
«>mmxmxw4umngmk0Q46
.44h<>mm¥m¥m._um<i_w<¥m<4n_._<
.moxmxwgmmzmwémmSQAm—

.SmommmeumGJWImm/xiqo
..0m4>m0xm¥w4mmIqmzmm—<E._D
.KIXKXIAmmOJm<¥m<._n—._D

. . .<H<0mm2mmm¥w>um04m>¥m>>m._0

.mzxmxcqumOJwfim—Saim

.mmuxmxwgn—m Imwzmmfiago
.moxmquumIgwngQED
.moxmxmqumIAm/xxméaqo

. . .ZOOm>mw¥mxw4mm04m¥hE4mwx
.mmxmxwgum5w<¥m<ca><

. . .IOmx>mmxmv_m4mKSw<¥w—<OQ><

z>->->->->-z

z>->->-

>->->->->->-zzz>-z>-z

>n_w._.<0_m..mmx0._n_w1._wmx2m<¥0>
>a<m<><moxm¥<uum14w<mmsmw>
>a<m<><mcxm¥<umm14m<mm5mw>
>n_w>z_>mw¥mv_m._um<n_w<¥m.r0m._0
>am>m§mmxmxmqmm<4m<¥mjm4<
>Q<¥wtm0¥mxm._u_ml._m<mm<_n3w
>a<¥mgmoxm¥m4um14w<mm<iaw

>n_<v.m>_momm¥w..u_m0._m1114.540
>Q<¥<_>mOxmxmdmmzawzmmgmmo
>QKIO<P<>O¢IxKXIqumOJw<¥mSQAD
>Q<K<quoxmxwum104w<¥m.2.qu

.XOXKXOJumOAthmfin—SS
._.>.=I>>m_2mmm¥w>n_m04w>¥m>>n30
>a00m<<4mOxmxmfium04m<¥m<>mgo
>ame.mI¥m—¥O.Emci_w<xm<_n_2w
a..aw<>>_mzxmxwgumcmmngQED
>at§moxmx<umm04w<¥12520
>wwm<w<ah<¥m¥5um¥4w<¥m<ifio
>Q<Z<2210xm¥mfiiIAmZZmSnSO
>n_._.x<zAmoxm¥m4u114w§mfiafio
>a<¥<04moxm¥m._u_mrqm<¥m<0n_..o
>n_0...mhqmwxmxwmmmOJmXPKPAwa
>Q<Emmxmxw4um<4w<¥m<0m><
>a<>mm>mm¥mxw4mm<4w<¥m<cm><

02>..E.
Own—u;
00mm;
0<>n=h
O<>n=._.
00E:
0<>n=H

00>“.E.
00>n=h
ODE—2h
00>H=H

00>):
00>S=¥
00>..E.
00E:
00E:
0®>n=h
0<>n=k
00>uz.
00:2.
00>n=h
02>u_._.r
0<>n=._.
00E;

5N3:
0N3.
mN<...
VNS.
mNs.
NN<...
..NS:

3225
mmNSabm
NmN<2vm
FmNsfim

m PN<wwO
v wN<30
m wN<me
N FN<me
_. FN<me
o FN<wwO
mN<me
mN<wwO
nN<me
oN<fimO
mN<7mO
VN<wwO
mN<...wO

12:—3:3 fie 03:. .3aoEo_.E=m

88mm?
8vfia2<
8335‘
883%
833?.
08:92
85.92

Swansea...”
ovmrmmsosm
ommmmmmfiem

Sum

SmRmmomo
ommmmoopmo
088830
ommmmmofio
88%88
82388
23388
858258
28388
ovmwmmmomo
owvmmmvomo
088268
85888

8&3.
883mg

3383.5
EEUOszoEm

190

.moxmxmqmmIAmzmm/xfifim
.m..m..x>mw¥mv.w._mm<..m<¥m<0a><
.mmxmxwgumfim<v.m<0n_><
.mmxmquumjm<¥m<0n.><
.KMXKXMJumSm<¥m<OQ><

. . .u4¥I>moxxxwm>m04w<¥mmmew
.moxmquumIAwémSnfio
.KGXKXMAumOJWXKmsQAD
.mmVEXMJLKCvaEm/xaao
.mommXqumOAmOmm’x—nfiw

. . . .Ou2>mommv.mmumOAwImmfinfim

.>mwv.mv.mun.mr..m<mh<1n.>o
.>m0¥mxmu.um_14m<mm<f.n.>o
...w><>>mw¥m¥m..um<..m<¥m<0n_><
. . .._.><>n_mwv.mv_w._n.m<n.m<v.m<0a><
.mwxmqumm5m<¥m<0n_><
.mmxmxmqmmsmwgméngm

...xu<<>mommxw4um04mImmSnfio
.mImmxwmmmOJmmmm<_a>o
.mwxmv. Mgumcgmxmmgnfio

. . .uioummxmxw4m15m<¥m<ca>m

>->->->->->-zz>->->->->->->->->->->

z>>>->-

>m<¥mz>moxmxw4umIAmZm—msamw
>am<m221wxm¥w4um<4w<¥m<0a><
>Qm<w22mw¥m¥m.fimjm<¥m<0n.><
>n.<._.w_2>m wxmxwmum5m<¥m<nva><
>02.V..Cmmv.mv.m..n_m<l_w<¥m<0a><

>v.m.v.Z¥u¢0¥¥¥Mt>m04w<¥mWrw0w
>n.<v.<_.moxmxwgumImmémSQAD
>am>wh4mmexwgumGwamm/xiao
>n.._.<w._...mmxmxw4mm04w¥mm$nfi5
>n.mxm>4momm¥¥uum04wcmm5n...w
>am¥m>qmommxwmumOAWImmSQJm.
Daub/‘03I¥m¥¥4um04wm¥2Q40>a
>n.w_<w<m¥¥m¥0..mm_04mm¥4wi.0n.n.
>a<m<<>mw¥mxmumm14m<mh<za>o
>Q<K<H>moxm¥mumm14m<mm<za>o
>th02>mw¥m¥w4umjw<¥m<nua><
>awhcgmm¥m¥mJumSw<¥m<Oa><
>Q<<Z§>mmxm¥m..u.m<..w<¥m<0n_>w
>n. wghéwxmquum5w<¥m<0a>m

>n.Z¥Z>Jmomm¥wqumOJmIm—mfiafiu
>Q¥HI>uEImmxmmumOmemmSnso
>n.m._.m>..mmxmxmqmmOAmxmm—lximo
>Q2<w24mmxm¥m..mm<n.w<¥m<0n.>m
>n.m._.<0.m.xmxcmuwcqwxxiwgaz

0<>...=._.
0<>m_._.
0<>n=...
0<>n=._.
0<>n=._.

00E...
0<>n=h
OZ>u:...
02C...
G0>u=h
00E;
02>n:...
02>...=...
O<>n=._.
0<>u=._.
0<>n=h
0<>n=._.
O<>n._._.
0.4:...

06mm...

00......
02>n._._.
00E...
02>n._._.

mmN<w>>
v<N<w>>
m<N<_.>>
N<N<...>>
_.<N<..>>
v r<N<2n.
m .mN<3n_
N rONSJn.
. PON<Bn.
o .mN<2n.
mmNSJQ
wON<2n_
NON<BQ
mmN<2a
mmN<2Q
v<N<.Jn.
m<N<2a
N<N<2n.
.<N<2n.

N ..N<_.
.. FN<_..
o .Nfi.
mN<fi
mN<...

62.533 _.v 93:. .5:oEuE.—=w

mmwmmmhww
honmvmhm ..
mNooowhvp
mmmwmme F
gmomwnvw

vwoNQOVNN
oomw©OVNN
nvmmmowNN
mmvmhovNN
mmvaFVNN
thwwowNN
movawVNN
mNowwOVNN
mNmmFPVNN
OO©MNOVNN
mNomMPVNN
ooowaVNN
PNQFOPVNN
thwOFVNN

25882
o§v92
99282
88.92
Au...u.o...92

$85.: 83

«9805.5

«Enact

191

 

:.uzmz>mwxmxmn_um1._m¥mm<._a._o

.moxmmemmIAw<¥m<_n3m

>-ZZ>-

>Q>>mh4mwmeMAmmIvafi—mjala
>Qwh<mEmzxmxcqumOAmmxfimeuha
>mwh<m.mZXKXOmemqwm—xiwqwhm
>m<m<tmoxm¥w4mmIJw<¥m<Eqw

02E;
02E;
Oo>n=k
00>..E.

m0N<...>>
wON<_.>>
BON<6>>
omN<...>>

355:3 3. «Ban. _5=oEo=—n=m

w 25¢»st
Nmmommumw
commons:
wmvmvmsmr

I92

:92: mag 55 flatomcmb N2... he Eon—tn 85>":— 9
EEE mg :55; muatomcmb N3. .5“ MEET—Q 0833. a

 

.m-O<H<OOkUOO<<<E<<POHO<um

.m-0<._.000._.<.r<0<00h0<00<<0<<um

.m-0<t<0._.<<0<<0t0t<00-.m

.m
-OHOHUO<<<O._.<<<<0<h<<<<<<<<0<..m
.m-0<EO<EO<OOOEO<O<<<-.m

.m
-O<h<<<t00<<H<0h<hO<<<<<OEO<
-.m

.m-<00<0<k<k<<00O<<00<<<<0<..m

.m-t0<0<0<<<0<000<O<OOU<<<..m
.m-<0t<._.<0O<h0<OO<EOO<<<Jm

.m
-<OU<EOE<<._.<.E.OOO._.<00-.m

.m-<h000:0h0<<0<<<h00t<<0-.m
.m-EOPUOtUOH<kOO<t0<GOPOJm

.m
uOhOEOFOhOOOOFOhOOFrothéO
-.m

.m
-OkOPOOOOhGPOOIxOOHOOEOOOJm
.m-<0._.<._.0<t<0<0<00<<00-.m

.m
-OGOOEUhOHOO0<<P<Oho<003m
.m-OEO._.0hOOOO<O<OOO<-.m

.m-OOOEO._.0.PO._.00<O<OOOJm

.mPGOOEUEOOO<O._.<<tOO<Jm
.m-._.OOOEUEOOU<O._.00h000<um
.m.0k00t00h<k00h<0h0k<0Eum

.m
-<<0<Oh<0<0._.0h0<<<<<00.r<00um

.m-0HOE<0<0<O<00._.<0t<<0-.m
.m-OOGPOEtO<00hOH<O.C.<<OJm

.m-@<0._.<0<<<0.—.00<<._.O<0H<-.m

.m-._.<0<000<<<h00<0h0GOP/Fm

.m-<<0<._.<00<._.00<<<00._.0._.<..m
.m-hOGOhUE<0<O<<<00P<Jm

.m-000000<<O<0000<<0h0h<um
.m-b<<<<0h<<00<muoh00h®h<um

.m-0000._.0E._.<0<0<0<00._.<..m
.m-GOQOHOPE<O<O<O<OO._.<Jm
.m-0<0000h0.—FEO<OO._.OP<J0

005N625 ghNS.
.mmm

v.mN<q.

NNN<w >3

IN>

NFNS.

:NS.

2N5.
9N3.

0N5.
nNS.

vNi,
m N S.
NN$.. mums—k

 

anEtm 0293.

.808...“ 3.261

905...". p.220“.

 

>05... £5 5 tom: £25.:— uc an: N6 «3:. .3550395

193

REFERENCES

Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K. and Yamaguchi-Shinozaki, K.
(2003). Arabidopsis AtMYCZ (bHLH) and AtMYBZ (MYB) function as
transcriptional activators in abscisic acid signaling. Plant Cell 15: 63-78.

Reusing, S.A., Lang, D., Zimmer, A.D., Terry, A. et al. (2008). The Physcomitrella
genome reveals evolutionary insights into the conquest of land by plants. Science.
319: 64-69.

Baldwin, LT. (1998). Jasmonate-induced responses are costly but benefit plants under
attack in native populations. Proc Natl Acad Sci USA. 95: 8113-8118.

Barbazuk, W.B., Fu, Y., and McGinnis, K.M. (2008). Genome-wide analyses of
alternative splicing in plants: Opportunities and challenges. Genome Res. 18,
1381-1392.

Browse, J. (2009). Jasmonate Passes Muster: A Receptor and Targets for the Defense
hormone. Annu. Rev. Plant Biol. 60: 183-205.

Chico, J.M., Chini, A., Fonseca, S., Solano, R. (2008). JAZ repressors set the rhythm in
jasmonate signaling. Curr. Opin. Plant Biol. 11: 486-494.

Chini, A., Fonseca, S., Fernandez, G., Adie, B., Chico, J.M., Lorenzo, 0., Garcia-
Casado, G., Lopez-Vidriero, 1., Lozano, F.M., Ponce, M.R., Micol, J.L., and
Solano, R. (2007). The JAZ family of repressors is the missing link in jasmonate
signalling. Nature 448: 666-671.

Chini, A., Fonseca, S., Chico, J., Fernandez-Calm, P., Solano, R. (2009) The ZIM
domain mediates homo- and heteromeric interactions between Arabidopsis JAZ
proteins. Plant J. (in press)

Chung, H.S., Koo, A.J.K., Gao, X., Jayany, S., Thines, B., Jones, A.D., Howe, G.A.
(2008). Regulation and function of Arabidopsis JASMONA TE ZIM-domain genes
in response to wounding and herbivory. Plant Physiol. 146: 952-964.

Chung, H.S., Howe, G.A. (2009). A critical role for the TIFY motif in repression of
jasmonate signaling by a stabilized splice variant of the JASMONATE ZIM-
domain protein JAZIO in Arabidopsis. Plant Cell 21: 131-145.

Conconi, A., Smerdon, M. J., Howe, G. A. and Ryan, C. A., (1996). The octadecanoid

signalling pathway in plants mediates a response to ultraviolet radiation. Nature
383: 826-829.

194

Creelman, R.A., Mullet, J.E. (1997). Oligosaccharins, brassinolides, and jasmonates:
nontraditional regulators of plant growth, development, and gene expression.
Plant Cell 9: 1211-1223.

Devoto, A., Ellis, C., Magusin, A., Chang, H.S., Chilcott, C., Zhu, T.,and Turner,
J.G. (2005). Expression profiling reveals C011 to be a keyregulator of genes
involved in wound- and methyl jasmonate-inducedsecondary metabolism, defence,
and hormone interactions. Plant Mol. Biol. 58: 497—513.

Dombrecht, B., Xue, G.P., Sprague, S.J., Kirkegaard, J.A., Ross, J.J., Reid, J.B., Fitt,
G.P., Sewelam, N., Schenk, P.M., Manners, J.M., et al. (2007). MYC2
differentially modulates diverse jasmonate-dependent functions in Arabidopsis.
Plant Cell 19: 2225—2245.

Fang, Y., Hearn, S., Spector, D.L. (2004). Tissue-specific expression and dynamic
organization of SR splicing factors in Arabidopsis. Mol. Biol. Cell. 15: 2664-
2673.

Feys, B., Benedetti, C.E., Penfold, C.N., Turner, J.G. (1994). Arabidopsis mutants
selected for resistance to the phytotoxin coronatine are male sterile, insensitive to
methyl j asmonate, and resistant to a bacterial pathogen. Plant Cell 6: 751—759.

F onseca, S., Chini, A., Hamberg, M., Adie, B., Porzel, A., Kramell, R., Miersch, 0.,
Wastemack, C., Solano R. (2009). (+)-7-iso-Jasmonoyl-L-isoleucine is the
endogenous bioactive jasmonate. Nat. Chem. Biol. 5: 344-350.

Glazebrook, J. (2005). Contrasting mechanisms of defense against biotrophic and
necrotrophic pathogens. Annu. Rev. Phytopathol. 43: 205—227.

Goff, S.A., Ricke, D., Lan, T.R., Presting, G. et al. (2002). A draft sequence of the rice
genome (Oryza sativa L. ssp. japonica). Science. 296: 92-100.

Griffiths, S., Dunford, R.P., Coupland, G., Laurie, D.A. (2003). The evolution of
CONSTANS-like gene families in barley, rice, and Arabidopsis. Plant Physiol.
131: 1855-1867.

Grunewald, W., Vanholme, B., Pauwels, L., Plovie, E., Inzé, D., Gheysen, G.,
Goossens, A. (2009). Expression of the Arabidopsis jasmonate signalling
repressor JAZ1/TIFY10A is stimulated by auxin. EMBO Rep. 10: 923-928.

Howe, G.A., Jander, G. (2008). Plant immunity to insect herbivores. Annu Rev Plant
Biol. 59: 41-66.

Iida, K., Go, M. (2006). Survey of conserved alternative splicing events of mRNAs
encoding SR proteins in land plants. Mol. Biol Evol. 23: 1085-1094.

195

Irimia, M., Rukov, J.L., Roy, S.W., Vinther, J., Garcia-Fernandez, J. (2009).
Quantitative regulation of alternative splicing in evolution and development.
Bioessays. 1: 40-50.

Kalyna, M., Lopato, S., Voronin, V., Barta, A. (2006). Evolutionary conservation and
regulation of particular alternative splicing events in plant SR proteins. Nucleic
Acids Res. 34: 4395-4405.

Katsir, L., Chung, H.S., Koo, A.J.K., Howe, G.A. (2008a). Jasmonate signaling: a
conserved mechanism of hormone sensing. Curr. Opin. Plant Biol. 11: 428-435.

Katsir, L., Schilmiller, A.L., Staswick, P.E., He, S.Y., Howe, G.A. (2008b). C011 is a
critical component of a receptor for jasmonate and the bacterial virulence factor
coronatine. Proc. Natl. Acad. Sci. USA 105: 7100-7105.

Laurie-Berry, N., Joardar, V., Street, I.H., Kunkel, B.N. (2006). The Arabidopsis
thaliana JASMONATE INSENSITIVE 1 gene is required for suppression of
salicylic acid-dependent defenses during infection by Pseudomonas syringae. Mol
Plant Microbe Interact. 19: 789-800.

Leeman, J.R., Gilmore, TD. (2008). Alternative splicing in the NF-kappaB signaling
pathway. Gene. 423: 97-107.

Li, L., Zhao, Y., McCaig, B.C., Wingerd, B.A., Wang, J., Whalon, M.E., Pichersky,
E., Howe, G.A. (2004). The tomato homolog of CORONATINE-
INSENSITIVEI is required for the maternal control of seed maturation,
jasmonate-signaled defense responses, and glandular trichome development. Plant

Cell 16: 126-143.

Lorenzo, 0., Chico, J. M., Sanchez-Serrano, J. J. and Solano, R. (2004).
JASMONATE-INSENSITIVEI encodes a MYC transcription factor essential to
discriminate between different jasmonate-regulated defense responses in
Arabidopsis. Plant Cell 16: 1938-1950.

Mandaokar, A., Thines, B., Shin, B., Lange, B. M., Choi, G., Koo, Y. J., Yoo, Y. J.,
Choi, Y. D. and Browse, J. (2006). Transcriptional regulators of stamen
development in Arabidopsis identified by transcriptional profiling. Plant J. 46:
984-1008.

Melotto, M., Mecey, C., Niu, Y., Chung, H.S., Katsir, L., Yao, J., Zeng, W., Thines,
B., Staswick, P.E., Browse, J., Howe, G.A., He, S.Y. (2008a). A critical role of
two positively charged amino acids in the Jas motif of Arabidopsis JAZ proteins

in mediating coronatine- and jasmonoyl isoleucine-dependent interactions with
the C011 F -box protein. Plant J. 55: 979-988.

196

McConn, M., Browse, J. (1996). The Critical Requirement for Linolenic Acid Is Pollen
Development, Not Photosynthesis, in an Arabidopsis Mutant. Plant Cell. 8: 403-
416.

Ogawa, N. and Kobayashi, Y. (2008). Strategy for synthesis of the isoleucine conjugate
of epi-jasmonic acid. Tetrahedron Lett. 49: 7124—7127.

Pan, Q., Shai, 0., Lee, L.J., Frey, B.J., Blencowe, B.J. (2008). Deep surveying of
alternative splicing complexity in the human transcriptome by high-throughput
sequencing. Nat Genet. 40: 1413-1415.

Reddy, A.S.N. (2007). Alternative splicing of pre-messenger RNAs in plants in the
genomic era. Annu. Rev. Plant Biol. 58: 267-294.

Reymond, P., Weber, H., Damond, M., Farmer, E.E. (2000). Differential gene
expression in response to mechanical wounding and insect feeding in Arabidopsis.
Plant Cell 12: 707—720.

Reymond, P., Bodenhausen, N., Van Poecke, R.M., Krishnamurthy, V., Dicke, M.,
Farmer, E.E. (2004). A conserved transcript pattern in response to a specialist
and a generalist herbivore. Plant Cell 16: 3132—31347.

Robson, F., Costa, M.M., Hepworth, S.R., Vizir, 1., Pifleiro, M., Reeves, P.H.,
Putterill, J., Coupland, G. (2001). Functional importance of conserved domains
in the flowering-time gene CONSTANS demonstrated by analysis of mutant
alleles and transgenic plants. Plant J. 28: 619-631.

Sasaki, Y., Asamizu, E., Shibata, D., Nakamura, Y., Kaneko, T., Awai, K., Amagai,
M., Kuwata, C., Tsugane, T., Masuda, T., et al. (2001). Monitoring of methyl
jasmonate-responsive genes in Arabidopsis by cDNA macroarray: selfactivation

of jasmonic acid biosynthesis and crosstalk with other phytohormone signaling
pathways. DNA Res 8: 153—161.

Sasaki-Sekimoto, Y., et al. (2005). Coordinated activation of metabolic pathways for
antioxidants and defence compounds by jasmonates and their roles in stress
tolerance in Arabidopsis. Plant J. 44: 653—668.

Schenk, P.M., Kazan, K., Wilson, 1., Anderson, J.P., Richmond, T., Somerville, S.C.,
and Manners, J.M. (2000). Coordinated plant defense responses in Arabidopsis
revealed by microarray analysis. Proc. Natl. Acad. Sci. USA 97 : 11655—11660.

Schilmiller, A.L., Koo, A.J., and Howe, G.A. (2007). Functional diversification of acyl-

CoA oxidases in jasmonic acid biosynthesis and action. Plant Physiol. 143: 812-
824.

197

Schmidt, S., Baldwin, LT. (2006). Systemin in Solanum nigrum. The tomato-
homologous polypeptide does not mediate direct defense responses. Plant Physiol.
142: 1751-1758.

Serrano, G., Herrera-Palau, R., Romero, J .M., Serrano, A., Coupland, G., Valverde,
F. (2009). Chlamydomonas CONSTANS and the evolution of plant
photoperiodic signaling. Curr Biol. 19: 359-368.

Severing, E.I., van Dijk, A.D., Stickema, W.J., van Ham, RC. (2009). Comparative
analysis indicates that alternative splicing in plants has a limited role in
functionalexpansion of the proteome. BMC Genomics. 10: 154.

Sineshchekov, V.A., Loskovich, A.V., Riemann, M., Nick, P. (2004). The jasmonate-
free rice mutant hebiba is affected in the response of phyA'/phyA" pools and

protochlorophyllide biosynthesis to far-red light. Photochem. Photobiol. Sci. 3:
1058-1062.

Staswick, P.E. (2008). JAZing up jasmonate signaling. Trends Plant Sci. 13: 66-71.

Strayer, C., Oyama, T., Schultz, T.F., Raman, R., Somers, D.E., Mas, P., Panda, S.,
Kreps, J.A., Kay, S.A. (2000) Cloning of the Arabidopsis clock gene TOCI, an
autoregulatory response regulator homolog. Science 289: 768-771.

Suzuki, H., Reddy, M.S., Naoumkina, M., Aziz, N., May, G.D.,Huhman, D.V.,
Sumner, L.W., Blount, J.W., Mendes, P., and Dixon,R.A. (2005). Methyl
jasmonate and yeast elicitor induce differentialtranscriptional and metabolic re-
programming in cell suspensioncultures of the model legume Medicago truncatula.

Planta 220: 696—707.

Takahashi, F., Yoshida, R., Ichimura, K., Mizoguchi, T., Seo, S., Yonezawa, M.,
Maruyama, K., Yamaguchi-Shinozaki, K., Shinozaki, K. (2007). The mitogen-
activated protein kinase cascade MKK3-MPK6 is an important part of the
jasmonate signal transduction pathway in Arabidopsis. Plant Cell. 19: 805-818.

Tazi, J., Bakkour, N., Stamm, S. (2009). Alternative splicing and disease. Biochem.
Biophys. Acta. 1792: 14-26.

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., Nomura, K., He,
S.Y., Howe, G.A., and Browse, J. (2007). JAZ repressor proteins are targets of
the SCFCO“ complex during jasmonate signalling. Nature 448: 661-665.

Uppalapati, S.R., Ayoubi, P., Weng, H., Palmer, D.A., Mitchell, R.E., Jones, W., and

Bender, C.L. (2005). The phytotoxin coronatine and methyl jasmonate impact
multiple phytohormone pathways in tomato. Plant J. 42: 201—217.

198

Vanholme, B., Grunewald, W., Bateman, Kohchi, T., Gheysen, G. (2007). The tify
family previously known as ZIM. Trends Plant Sci. 12: 239-244.

Wang, B.B., Brendel, V. (2006). Genomewide comparative analysis of alternative
splicing in plants. Proc Natl Acad Sci U S A. 103: 7175-7180.

Wenkel, S., Turck, F ., Singer, K., Gissot, L., Le Gourrierec, J., Samach, A.,
Coupland, G. (2006). CONSTANS and the CCAAT box binding complex share
a functionally important domain and interact to regulate flowering of Arabidopsis.
Plant Cell 18: 2971-2984.

White, D.W.R. (2006). PEAPOD regulates lamina size and curvature in Arabidopsis.
Proc. Natl. Acad. Sci. USA 103: 13238-13243.

Yan, Y., Stolz, S., Chetelat, A., Reymond, P., Pagni, M., Dubugnon, L., and Farmer,
E.E. (2007). A downstream mediator in the growth repression limb of the
jasmonate pathway. Plant Cell 19: 2470-2483.

Yoshida, Y., Sano, R., Wada, T., Takabayashi, J., Okada, K. (2009). Jasmonic acid
control of GLABRA3 links inducible defense and trichome patterning in
Arabidopsis. Development. 136: 1039-1048.

Zhang, X.N., Mount, S.M. (2009). Two Alternatively Spliced Isoforms of the

Arabidopsis SR45 Protein Have Distinct Roles during Normal Plant Development.
Plant Physiol. 150: 1450-1458.

199

CHAPTER 5: SUMMARY AND FUTURE PERSPECTIVES

200

At the time this thesis research was initiated, little was known about the molecular
mechanism of JAZ action in the regulation of IA responses. The study described in
Chapter 2 was conceived with the goal of characterizing the expression pattern of
Arabidopsis JAZ genes in response to mechanical wounding and herbivory and to test the
model that JAZ proteins are destabilized by SCFCOIl-mediated ubiquitination in response
to JA. Most JAZ genes exhibit increased expression in response to both mechanical
wounding and feeding by S. exigua larvae (Fig. 2.1). The rapid expression of JAZ genes
in response to mechanical wounding is dependent on C011 (Fig. 2.2) and is correlated
with accumulation of JA and JA-Ile in damaged leaves (Fig. 2.3). This result is consistent
with the hypothesis that JA-Ile is a wound signal that triggers degradation of JAZ
repressors and subsequent transcription of early response genes. CHX-induced
accumulation of JAZ transcripts is dependent on COIl (Fig. 2.5), which agrees with the
idea that JAZ proteins are destabilized by SCFCOH-mediated ubiquitination (Chini et al.,
2007; Thines et al., 2007). Perturbation of IA signaling by overexpression of JAZIA3A
decreased plant resistance to S. exigua feeding (Fig. 2.7). This finding indicates that JAZ
proteins play an important role in regulating the expression of plant processes that confer
resistance to insect herbivores.

Alternative splicing of pre-mRNAs provides a general mechanism to increase
protein diversity from a limited number of loci and, ultimately, contributes to biological
complexity. The work presented in Chapters 3 and 4 provides several independent lines
of evidence that JAZ proteins are functionally diversified by alternative splicing. Chapter
3 describes the characterization of three JAZ10 splice variants differing in the sequence

of the Jas domain. JAZlO.] contains an intact Jas domain that interacts with C011 in a

201

ligand-dependent manner. JAZIO.4, which lacks the entire J as domain, fails to bind C01 1,
whereas J AZ10.3, which contains a partially truncated Jas domain, interacts weakly with
COIl (Fig. 3.4). Analysis of JAZIO-YFP reporter lines provided direct evidence that
JAZlO.] is degraded via the 26S proteasome pathway in response to JA treatment, and
that JAZIO.4 is highly resistant to JA-induced destruction (Fig. 3.7). Consistent with
C011-interaction studies, high concentrations of JA were required to induce turnover of
JAZlO.3-YFP in viva. Consequently, overexpression of JAZlO.3 and JAZ10.4 conferred
weak and strong JA-insensitive phenotypes, respectively, whereas 35S-JAZ10.1 plants
that produce the full-length protein did not exhibit altered sensitivity to JA (Fig. 3.6).
Interestingly, constitutive expression of JAZ10 pre-mRNA confered severe insensitivity
to JA-induced root growth inhibition (Fig. 4.5). This finding indicates that one or more
stable JAZIO variants (e.g., JAZ10.4) are produced by the endogenous splicing
machinery and affect JA signal output.

Comparative analysis of the structural organization of JAZ genes revealed that the
position and phase of the intron involved in generating the JAZlO.3-encoding transcript
(At5g13220.3) is conserved in 56 of 72 JAZ genes identified in diverse plant species (Tab.
4.1). Among the 56 JAZ genes that harbor the Jas intron (Tab. 4.1), 40 of these are
predicted to encode proteins that terminate immediately or shortly after the KRKXR
motif if the intron is retained during mRNA splicing (Tab. S1). The presence of the Jas
intron in JAZ orthologs from P. patens suggests that this sequence arose early in the
evolution of the JAZ family and has been retained in higher plants. Presumably, truncated
JAZ isoforms generated by Jas intron retention participate in cellular processes that

increase plant fitness. The reduced C011-binding capacity of JAZ2.2, JA23.4, and

202

 

JAZlO.3 provides evidence that Jas intron retention plays an essential role in functional
diversification of JAZ proteins through increased protein stability and increased
repression of JA signaling.

The ZIM domain is the defining feature of the TIFY protein family that includes
JAZ, PPD, and ZIM/ZML proteins (Vanholme et al., 2007). Experiments described in
Chapter 3 demonstrate that the ZIM domain mediates homo- and heteromeric protein-
protein interactions among JAZ proteins. Site-directed mutagenesis studies showed that
the TIFY motif within the ZIM domain is a key determinant of JAZ3 and JAZ10 homo-
and heteromerization (Fig. 3.2). Mutations in the TIFY motif that disrupt JAZ10.4
interaction with other JAZs also abrogate the dominant-negative effects of JAZIO.4 on JA
signal output (Fig. 3.8), suggesting that a functional ZIM domain is critical for JAZ-

mediated repression of JA signaling.

Future Perspectives

The research described in this thesis has led us to a better understanding of the molecular
mechanism by which JAZ proteins regulate JA responses. However, many interesting
questions remain to be answered. Differential binding of JAZ proteins to C011 (Fig. 4.4)
suggests that individual members of the family have different stabilities in JA-stimulated
cells. Based on current evidence that the Jas domain is sufficient for JAZ interaction with
C011, it is likely that sequence variation in the Jas domain is a key determinant of JAZ
stability. Site-directed mutagenesis studies (Melotto et al. 2008) are beginning to provide

insight into regions of the domain that are required for C011 interaction. X-ray

203

 

crystallography studies are needed to provide more precise information about the
structural basis of hormone-induced formation of C011-JAZ complexes.

Modification of the Jas domain through alternative splicing further increases the
diversity JAZs that differentially interact with C011. The involvement of alternative
splicing in functional diversification of JAZ proteins increases our understanding of the
complexity and dynamic nature of IA responses. Several studies have shown that
differential pre-mRNA processing in plants is regulated by environmental cues and by
cell type-specific factors (Lopato et al., 1999; Fang et al., 2004; Reddy et al., 2007;
Barbazuk et al., 2008). Future studies of JAZ alternative splicing will benefit from
quantitative analysis of the abundance of alternative transcripts, as well the development
of approaches to detect specific protein variants in specific tissue and cell types. This
information will ultimately lead to a better understanding of how the expression of
diverse J A responses is temporally and spatially regulated.

The ability of JAZ proteins to interact with one another (Chapter 3) raises the
possibility that a network of JAZ-JAZ complexes differentially interacts with
downstream transcription factors (TFs). Given the role of JA in such a wide range of
plant biological processes, it is possible that different JAZ-JAZ complexes regulate
distinct J A responses by interacting with different TFs that control specific subsets of JA
response genes. It will be interesting to identify direct targets of each JAZ using ChIP
experiments. Detailed phenotypic analysis of single and high-orderjaz null mutants will
provide additional information about the biological relevance of JAZ-JAZ interaction in

regulating various JA responses.

204

Although several TFs involved in IA signaling have been identified, MYC2 is the
only TF known to be directly targeted by JAZs (Chini et al., 2007; Chung and Howe,
2009; Chini et al., 2009). Given that JA signaling in myc2/jin1 mutants is only partially
impaired, other TFs must also be targeted by the SCFCOH/JAZ pathway. Establishment of
functional links between JAZs and other TFs implicated in JA signaling, as well as
identification of novel transcriptional regulator(s) whose function is controlled JAZs, are
important directions for future research.

The outpouring of genome sequence information from diverse plant species
provides new opportunities to study the evolutionary roots of JA synthesis and signaling.
In addition to containing several JAZ genes, P. patens also contains six F -box C011-like
(F CL) genes (Chini et al., 2008). These observations, together with the absence of JAZ
and F CL genes in photosynthetic aquatic eukaryotes, suggest that the JA signaling
pathway arose during the evolution of early land plants. Although P. patens contains
genes encoding plastidic enzymes of the octadecanoid pathway (e.g., allene oxide
synthase/cyclase), it does not appear to produce JA or JA-Ile (Browse, 2009; Feussner,
2008). It is tempting to speculate that an ancient SCFCO'l/JAZ receptor system in P.
patens recognizes an alternative oxylipin signal such as OPDA or an amino acid
conjugated form of OPDA to regulate stress responses. Elucidation of the function and
mechanism of action of JAZ and F CL genes in P. patens will provide important insight

into evolution of the J A signaling pathway.

205

 

REFERENCES

Barbazuk, W.B., Fu, Y., and McGinnis, K.M. (2008) Genome-wide analyses of
alternative splicing in plants: Opportunities and challenges. Genome Res. 18,
1381-1392

Browse, J. (2009) Jasmonate Passes Muster: A Receptor and Targets for the Defense
hormone. Annu. Rev. Plant Biol. 60: 183-205.

Chini, A., Fonseca, S., Fernandez, G., Adie, B., Chico, J.M., Lorenzo, 0., Garcia-
Casado, G., Lopez-Vidriero, 1., Lozano, F.M., Ponce, M.R., Micol, J.L., and
Solano, R. (2007) The JAZ family of repressors is the missing link in jasmonate
signalling. Nature 448: 666-671.

Chini, A., Fonseca, S., Chico, J., Fernandez-Calvo, P., Solano, R. (2009) The ZIM
domain mediates homo- and heteromeric interactions between Arabidopsis JAZ
proteins. Plant J (in press)

Chung, H.S., Koo, A.J.K., Gao, X., Jayany, S., Thines, B., Jones, A.D., Howe, G.A.
(2008). Regulation and function of Arabidopsis JASMONA TE ZIM-domain genes
in response to wounding and herbivory. Plant Physiol. 146: 952-964.

Chung, H.S., Howe, G.A. (2009) A critical role for the TIFY motif in repression of
jasmonate signaling by a stabilized splice variant of the JASMONATE ZIM-
domain protein JAZ10 in Arabidopsis. Plant Cell 21: 131-145.

Fang Y, Hearn S, Spector DL. (2004) Tissue-specific expression and dynamic
organization of SR splicing factors in Arabidopsis. Mol Biol Cell. 15: 2664-2673.

Feussner I. (2008) Oxylipins, evolutionary conserved signals in plants, mosses, fungi
and bacteria. 18’” Int. Symp. Plant Lipids. Abstr. 036. http://www.isp12008-
bordeaux.cnrs.fr/

Lopato S, Kalyna M, Dorner S, Kobayashi R, Krainer AR, Barta A. (1999) atSRp30,
one of two SF2/ASF-like proteins from Arabidopsis thaliana, regulates splicing of
specific plant genes. Genes Dev. 13: 987-1001.

Melotto, M., Mecey, C., Niu, Y., Chung, H.S., Katsir, L., Yao, J., Zeng, W., Thines,
B., Staswick, P.E., Browse, J., Howe, G.A., He, S.Y. (2008a). A critical role of
two positively charged amino acids in the Jas motif of Arabidopsis JAZ proteins

in mediating coronatine- and jasmonoyl isoleucine-dependent interactions with
the C011 F-box protein. Plant J. 55: 979-988.

Reddy, A.S.N. (2007) Alternative splicing of pre-messenger RNAs in plants in the
genomic era. Annu. Rev. Plant Biol. 58: 267-294.

206

 

 

Thines, B., Katsir, L., Melotto, M., Niu, Y., Mandaokar, A., Liu, G., Nomura, K., He,
S.Y., Howe, G.A., and Browse, J. (2007) JAZ repressor proteins are targets of
the SCFCO” complex during jasmonate signalling. Nature 448: 661-665.

Vanholme, B., Grunewald, W., Bateman, Kohchi, T., Gheysen, G. (2007) The tify
family previously known as ZIM. Trends Plant Sci. 12: 239-244.

207

 

   

”'111111111111111111111111ll“

063 2495