Lot—”2:. :.
E... 4.5.;

I
4
‘1...
.31. .

.5 .1 c 3.... 771.
www‘a .. .w:
.m‘ a. #1.:

.—
c

.. .
L432. t» »
‘5 1:.
. 1!. .

€be
1‘?

‘1 5.11.1. ‘
.3. 3:33..“ 2am“.
.215 ,
. 4??

L

.anu

ML“.
{.kmmn.‘ YE.

I5... xx! All .
.I: ‘ hvafifimmmv‘ v“—

I.

I...“

\..v.i‘.Q “I,
3.!aivku...
; x91ls§ .1
Q): r Ii
47‘; I a
i: 3.1.1.? ,
. .3144.
.IV‘GL...“
:‘lot.
.

. I.
I:.J.\
1...! u. 1..

.33. J

t
1.
s37!

. 3...
its. . a.
Itx.ll.kiA!
illicit.

5.4)}!

fl}... .9 ,
t .i . .u.3.....«..«.2€a..vr.u.
... .51. .1... .. .. m i: .11...
A 1.51. . 1 it w Ear...“

 

 

 

N
9 N

o LIBRARY
Michigan State
University

 

 

 

This is to certify that the
dissertation entitled

THE COMPLETE AND ANNOTATED GENOMIC SEQUENCE

OF FELINE HERPESVIRUS 1 (FHV-1) AND AN INFECTIOUS

BAC CLONE: A PLATFORM FOR STUDIES OF TARGETED
MUTANTS BY RECOMBINEERING

presented by

Shih-Han Tai

has been accepted towards fulfillment
of the requirements for the

Comparative Medicine and
Ph. D. degree in Integrative Biology

 

 

/‘/

/(_ (:3 OAQ‘WW" /
Major Vrofessor’s Signature /

/”r,r:)\Z f)2(W/Cs
Date

 

MSU is an Affinnative Action/Equal Opportunity Employer

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 K2IProj/AccsPresIClRCIDatoDueindd

THE COMPLETE AND ANNOTATED GENOMIC SEQUENCE OF
FELINE HERPESVIRUS l (FHV-l) AND AN INFECTIOUS BAC CLONE:
A PLATFORM FOR STUDIES OF TARGETED MUTAN TS

BY RECOMBINEERING

By

Shih-Han Tai

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
DOCTOR OF PHILSOPHY
Comparative Medicine and Integrative Biology

2010

ABSTRACT
THE COMPLETE AND ANNOTATED GENOMIC SEQUENCE OF
FELINE HERPESVIRUS 1 (FHV-l) AND AN INFECTIOUS BAC CLONE:
A PLATFORM FOR STUDIES OF TARGETED MUTANTS
BY RECOMBINEERING
By

Shih-Han Tai

Infection with feline herpesvirus-l (F HV-l) is a major cause of upper respiratory
and ocular disease in Felidae. For the first time, the complete genomic sequence of
FHV-l was determined and annotated. Complete genomic sequences were derived fi'om
both purified virion DNA and an infectious and virulent FHV-l BAC clone. The FHV -1
genome is 135,797 bp in size with an overall G+C content of 45%. A total of 78 open
reading frames were predicted, encoding 74 distinct proteins. The gene arrangement is
collinear with the majority of other sequenced varicelloviruses. A bacterial artificial
chromosome (BAC) clone of FHV-l that contains the entire FHV-l genome and has the
BAC vector inserted at the 5’-end of the UL was constructed and characterized in vitro
and in vivo. The virus regenerated from the BAC was very similar to the parental C-27
strain in vitro in terms of plaque morphology and growth characteristics, and highly
virulent in cats in a preliminary in vivo study.

Using the latest recombination-mediated genetic engineering (recombineering)
techniques, FHV-l mutants lacking the entire open reading frame encoding

glycoprotein C (gC) or E (gE) were constructed based on the FHV-l BAC clone. The
gC' FHV-l mutant virus produced primary plaques that enlarged slowly and had

relatively few secondary plaques compared to the wild type virus. Analysis on grth

kinetics showed that the gC' mutant had a growth titer reduced by approximately

6,000 — 9,000 folds compared to the wild-type virus titer, and the titer of intracellular
virus was 3.5 — 10 folds higher than the extracellular virus titer. Taken together, the
results show that the gC- FHV-l mutant is more cell-associated compared to the wild-
type virus. Thus, FHV-l gC, like is the case in other varicelloviruses, plays a significant
role in initial attachment/penetration, replication, and egress of FHV-l. In contrast, the
gE' FHV—l mutant had single-step growth kinetics that were indistinguishable from

those of the F HVlABAC, and grew to a titer that was approximately 10-fold lower than
that of the FHVlABAC in the multi-step growth kinetics. These results suggest that
virus egress, and most likely cell-to-cell spread as shown in other alphaherpesviruses,

were affected by gE deletion, while virus entry and replication were not.

A gC‘gE- and an U83 protein kinase (PK)' mutant of FHV-l were also
generated, and generation of a gE-PK' mutant are currently in progress. Both the gC-

gE_ and the PK- mutants demonstrated reduced growth rates in CRFK cells. The actual
effect of these deletions on growth properties needs to be further characterized.

The infectious FHV-l BAC clone and the complete and annotated FHV-l
genomic sequence form a very suitable starting platform for mutagenesis aiming at

functional studies of viral genes or vaccine development.

To my family

iv

ACKNOWLEDGEMENTS

I am extremely grateful to my advisor, Dr. Roger K. Maes, for his advice, help,
and encouragement during my graduate study. I am very thankful to the members of my
guidance committee, Drs. Hans Cheng, John Kruger, Annabel Wise, and Vilma
Yuzbasiyan-Gurkan, for their guidance, encouragement, and support.

I am especially thankful to Dr. Masahiro Niikura for guiding me through the
process of BAC cloning, sequencing, and mutagenesis of the FHV-l genome, and
sharing with me his research and life experience.

I would like to thank Dr. Taejoong Kim for helpful advice on the recombineering
process, Drs. Henry Hunt and Ian York for generously providing materials and advice,
and Dr. Amalfitano for the use of ultracentn'fuge. I would like to thank Dr. Jeff
Landgraf, Kevin Carr, Colleen Curry, and Shari Tjugum-Holland at the Research
Technology Supporting Facility, for oligonucleotide synthesis, 454 sequencing and
Newbler assembly. Special thanks to Tom Goodwill and Laurie Molitor at USDA-ARS
Avian Disease and Oncology Laboratory for their help on Sanger sequencing. I am
gratefiil to Michelle Brown, Janean DeVaul, Michael Engstrom, and Crystal Passmore
for technical assistance, Janice F orcier for assistance in the in vivo experiment, and
Denise Arnold and Victoria Hoelzer-Maddox for their help in administrative matters.

It was a great pleasure to work among such excellent faculty members,
researchers, and supporting staff while working in Dr. Cheng’s laboratory in the USDA-
ARS Avian Disease and Oncology Laboratory and Dr. Maes’s laboratory in the
Diagnostic Center for Population and Animal Health. Finally, I would like to thank my

fellow graduate students in and out of the Comparative Medicine and Integrative

Biology Graduate Program for their friendship and advice. I am very thankful to my

parents for their support, and to Ai-Ting for her company and support over these years.

vi

TABLE OF CONTENTS

LIST OF TABLES ........................................................................................................... ix
LIST OF FIGURES ........................................................................................................... x
LIST OF ABBREVIATIONS .......................................................................................... xi
INTRODUCTION ............................................................................................................. 1
CHAPTER 1 A REVIEW OF FELINE HERPESVIRUS TYPE 1 (FHV-l) .................. 3
1.1 Classification ................................................................................................... 4

1.2 Virus Characteristics ....................................................................................... 4

1.2.1 Morphology .......................................................................................... 4

1.2.2 Host range and Cross-reactivity ........................................................... 5

1.2.3 Genome ................................................................................................. 5

1.2.4 Genes .................................................................................................... 6

1.3 Replication ..................................................................................................... 10

1.3.1 Attachment and Entry ......................................................................... 10

1.3.2 Gene Expression and DNA Replication ............................................. 11

1.3.3 Virion Assembly and Egress .............................................................. 12

1.4 Latency .......................................................................................................... 12

1.5 Clinical Manifestations and Pathogenesis ..................................................... 14

1.6 Diagnosis ....................................................................................................... 15

1.7 Treatment and Control ................................................................................... 16

1.7.1 Supportive Treatment ......................................................................... 16

1.7.2 Antiviral Therapy ............................................................................... 17

1.8 Immunity and Vaccination ............................................................................ 19

1.9 In Vitro Models of FHV-l Infection ............................................................. 22

1.10 Conclusions ................................................................................................... 24

1.11 References ..................................................................................................... 25

CHAPTER 2 BACTERIAL ARTIFICIAL CHROMOSOME (BAC) AND

RECOMBINATION-MEDIATED GENETIC ENGINEERING

(RECOMBINEERING) ........................................................................... 33
2.1 BAC Cloning ................................................................................................. 34
2.2 Recombineering ............................................................................................. 36
2.3 References ..................................................................................................... 39

CHAPTER 3 COMPLETE GENOMIC SEQUENCE AND AN INFECTIOUS BAC

CLONE OF FELINE HERPESVIRUS 1 (FHV-l) ................................. 42
Abstract .................................................................................................................. 44
Introduction ............................................................................................................ 45
Results .................................................................................................................... 48
Discussion .............................................................................................................. 57

vii

Materials and Methods ........................................................................................... 61

Acknowledgements ................................................................................................ 68
References .............................................................................................................. 69
Tables ..................................................................................................................... 74
Figures and Figure Legends ................................................................................... 83

CHAPTER 4 GENERATION AND IN VITRO CHARACTERIZATION OF F ELINE
HERPESVIRUS 1 (FHV -1) MUTANT S LACKIN G

GLYCOPROTEINS C (gC) AND E (gE) ............................................... 95
Abstract .................................................................................................................. 97
Introduction ............................................................................................................ 98
Materials and Methods ......................................................................................... 102
Results .................................................................................................................. 107
Discussion ............................................................................................................ 109
Acknowledgements .............................................................................................. 1 13
References ............................................................................................................ l 15
Tables ................................................................................................................... 120
Figures and Figure Legends ................................................................................. 121

CHAPTER 5 GENERATION OF gC’gE', US3 PROTEIN KINASE (PK): AND

PK-gE- MUTANTS OF FELINE HERPESVIRUS l (FHV-l) .......... 130
5.1 Introduction ................................................................................................. 131
5.2 Materials and Methods ................................................................................ 132
5.3 Results and Discussions .............................................................................. 134
5.4 References ................................................................................................... 136

CHAPTER 6 CONCLUSIONS AND FUTURE DIRECTIONS ................................ 138
6.1 Conclusions ................................................................................................. 139

6.1.1 The FHV-l BAC Clone .................................................................... 139

6.1.2 The Complete Sequence of the FHV -1 Genome .............................. 139

6.1.3 FHV-l Mutants Lacking Glycoprotein C (gC) or E (gE) ................. 139

6.1.4 Other Deletion Mutants .................................................................... 140

6.2 Future Directions ......................................................................................... 140

6.2.1 Transcriptional & translational analyses .......................................... 140

6.2.2 Testing of the mutants in other feline cells ...................................... 141

6.2.3 In vivo testing of the F HV-l mutants ............................................... 141

6.2.4 A gC-complementing Cell Line ....................................................... 142

6.2.5 DIVA ELISA .................................................................................... 143

6.2.6 Further engineering of the gE- and gC- mutants ............................. 144

6.2.7 Molecular aspects of gC .........................................................................
APPENDICIES .............................................................................................................. 145
Appendix A ......................................................................................................... 145
Appendix B ..................................................................................................... 146

viii

LIST OF TABLES

Table 3.1 ......................................................................................................................... 74
Table 3.2 ......................................................................................................................... 76
Table 3.3 ......................................................................................................................... 77
Table 3.4 ......................................................................................................................... 80
Table 3.5 ......................................................................................................................... 81
Table 3.6 ......................................................................................................................... 82
Table 4.1 ....................................................................................................................... 120
Table 5.1 ....................................................................................................................... 133
Table 5.2 ....................................................................................................................... 135
Table 6.1 ....................................................................................................................... 141

ix

LIST OF FIGURES

Figure 3.1 ........................................................................................................................ 83
Figure 3.2 ........................................................................................................................ 85
Figure 3.3 ........................................................................................................................ 87
Figure 3.4 ........................................................................................................................ 89
Figure 3.5 ........................................................................................................................ 93
Figure 3.6 ........................................................................................................................ 94
Figure 4.1* .................................................................................................................... 121
Figure 4.2* .................................................................................................................... 123
Figure 4.3 ...................................................................................................................... 124
Figure 4.4 ...................................................................................................................... 125
Figure 4.5* .................................................................................................................... 126
Figure 4.6* .................................................................................................................... 127
Figure 4.7* .................................................................................................................... 128
Figure 4.8* .................................................................................................................... 129

*Images in the dissertation are presented in color.

BAC

BHV- l

BHV-S

CRFK

DIVA

EHV— l

EHV-4

ELISA

EMEM

EGFP

FBS

FCE

FCV

F CWF-4

FHV-l

LIST OF ABBREVIATIONS

bacterial artificial chromosome

bovine herpesvirus type 1 (bovine herpesvirus 1)
bovine herpesvirus type 5 (bovine herpesvirus 5)
Crandell-Reese feline kidney cells
differentiation between infected and vaccinated animals
equine herpesvirus type 1 (equid herpesvirus 1)
equine herpesvirus type 4 (equid herpesvirus 4)
enzyme-linked immunosorbent assay

Eagle’s minimum essential medium

enhanced green fluorescence protein

fetal bovine serum

feline corneal epithelial cells

feline calicivirus

felis catus whole fetus cells

feline herpesvirus type 1 (felid herpesvirus 1)
glycoprotein B

glycoprotein C

glycoprotein D

glycoprotein E

glycoprotein G

glycoprotein H

glycoprotein 1

xi

gN
HSV— 1
HSV—2
MDV
ORF
PCR
PK

PRV

Recombineering

RT-PCR

TK

VI

VN

VZV

glycoprotein J

glycoprotein K

glycoprotein L

glycoprotein M

glycoprotein N

herpes simplex virus type 1 (human herpesvirus 1)
herpes simplex virus type 2 (human herpesvirus 2)
Marek’s disease virus (gallid herpesvirus 2)

open reading frame

polymerase chain reaction

protein kinase

pseudorabies virus (suid herpesvirus 1)
recombination-mediated genetic engineering
reverse transcription-polymerase chain reaction
thymidine kinase

virus isolation

virus neutralization

varicella-zoster virus (human herpesvirus 3)

xii

INTRODUCTION

Feline herpesvirus type 1 (FHV-l) is a major cause of upper respiratory infection
in cats worldwide. In. recent years, its importance in ocular and chronic respiratory
disease has also been increasingly recognized. According to the 2007 US. Pet
Ownership & Demographics Sourcebook, there were 81,721,000 cats in the US.
Various studies have shown that 50-90% of cats have serological evidence of exposure
to the virus, more than 80% of infected cats remain latently infected for life, and ~45%
of latently infected individuals shed virus throughout life. Consequently, the economic
losses associated with F HV -1 infection are significant.

Despite its high prevalence and worldwide distribution, our knowledge of F HV-l
at the molecular level is limited. Further, vaccines currently available protect cats from
disease, but not from infection and subsequent latency. There is a need for a safer and
more effective vaccine.

The goal of the research presented in this dissertation was to obtain an overview
of the molecular composition of FHV—l, develop tools for fimctional studies on viral
genes and virulence factors, and construct potential vaccine candidates.

Chapter 1 provides a literature review of F HV-l.
Chapter 2 introduces the state-of-the-art techniques that were essential for this research,
including bacterial artificial chromosome (BAC) cloning and recombination-mediated

genetic engineering (recombineering).

Chapter 3 is a manuscript submitted to Virology, describing cloning of the entire FHV-
l genome as a BAC, in vitro and in vivo characterization of this BAC clone, and
sequencing and annotation of the entire FHV-l genome.

Chapter 4 describes the construction and in vitro characterization of F HV—l mutants
lacking glycoprotein C or E based on this FHV-l BAC clone, also in manuscript format.
Chapter 5 summarizes the generation and preliminary characterization of other deletion
mutants of FHV-l, including a gC-gE- mutant, a US3- mutant, and a US3-gE- mutant.
Chapter 6 concludes the dissertation and points out potential directions for future

research.

CHAPTER 1

A REVIEW OF F ELINE HERPESVIRUS TYPE 1 (F HV-l)

l . 1 Classification

Felid herpesvirus 1 (FeHV-l, commonly known as feline rhinotracheitis virus,
feline herpesvirus type 1, or FHV-l) is currently classified under the Order
Herpesvirales, Family Herpesviridae, Subfamily Alphaherpesvirinae, genus
Varicelloviruses (Davison et al., 2009). Prototype viruses for the Alphaherpesvirinae
and Varicelloviruses are human herpesvirus 1 (HHV-l, commonly known as herpes
simplex virus type 1, or HSV-l) and 3 (HHV-3, commonly known as varicella zoster
virus, or VZV), respectively. Other varicelloviruses of veterinary importance that will
be frequently mentioned in this and the following chapters include bovine herpesvirus 1
(BoHV-l or BHV-l) and 5 (BoHV-5 or BHV-S), equid herpesvirus 1 (commonly
known as equine herpesvirus type 1, or EHV-l) and 4 (commonly known as equine
herpesvirus type 4, or EHV-4), suid herpesvirus 1 (SuHV -1, commonly known as
pseudorabies virus, or PRV). Other alphaherpesviruses of human or veterinary medical
importance include human herpesvirus 2 (HHV-2, commonly known as herpes simplex
virus type 2, or HSV-2) and gallid herpesvirus 2 (GaHV-2, commonly known as

Marek’s disease virus, or MDV).

1.2 Virus Characteristics

1.2.1 Morphology
FHV -1 particles are 120-180 nm in diameter. Herpesvirus particles consist of four

elements: (a) an electron-opaque core containing the double-stranded viral DNA

genome, (b) an icosahedral capsid surrounding the core, (c) a largely unstructured
proteinacous layer called the tegument that surrounds the capsid, and (d) an outer lipid
bilayer envelope surrounding the tegument layer and exhibiting glycoprotein spikes on
its surface (Flint et al., 2004; Murphy et al., 1999; Pellett and Roizman, 2007; Roizman

et al., 2007).

1.2.2 Host range and cross-reactivity

Compared to some alphaherpesviruses, e. g., HSV—l and -2, FHV-l is considered
to have a narrow host range. FHV-l infects only members of the Family F elidae (Povey,
1979). In vitro, FHV-l also replicates only in cells of feline origin. Crandell-Reese
feline kidney (CRFK) cells are the cell line routinely used for propagation of FHV-l.
F elis catus whole fetus (FCWF-4) cells is another cell line that can be used. In addition,
feline alveolar macrophages, alveolar pneumocytes, CD4+ T-lymphoblastoid cells
(MYA-l and FL74 cells), and feline corneal epithelial (FCE) cells, have been shown to
be suitable for FHV-l propagation (Sandmeyer eta1., 2005a; Spatz, 1993).

FHV-l, canid herpesvirus 1 (CaHV -1, commonly known as canine herpesvirus
type 1, or CHV-l), and phocid herpesvirus 1 (PhHV-l, seal herpesvirus) are closely
related genetically and antigenetically. Cross-protection between these viruses has been

reported (Xuan et al., 1992).

1.2.3 Genome
As a member of the Herpesviridae, the FHV—l genome consists of a single linear

molecule of double-stranded DNA. FHV-l genomes of two different strains have been

mapped using restriction enzymes. Rota et a1. (1986) first constructed a SalI map of the
genome of C—27 strain and determined that it was ~l34 kb in size. Grail et al. (1991)
mapped the B927 strain and determined that the genome was ~126 kb in size. Both
studies found that the genome organization of FHV-l is similar to that of other

varicelloviruses. The genome consists of two segments of unique sequences called

Unique Long (UL) and Unique Short (Us). The Us region is flanked by a pair of
identical but inverted sequences, known as Internal Repeat Short (IRS) and Terminal

Repeat Short (TRS) (Figure 3.1).

1.2.4 Genes

One characteristics of herpesviruses is that they carry a large array of enzymes
involved in nucleic acid metabolism (e.g., thymidine kinase, thymidylate synthetase,
dUTPase, ribonucleotide reductase), DNA synthesis (e.g., DNA polymerase, helicase,
primase), and processing of proteins (e.g., protein kinases), although the exact array of
enzymes may vary from one herpesvirus to another (Pellett and Roizman, 2007).
Alphaherpesvirus genomes typically posess 65-80 open reading frames (Alba et al.,
2001). FHV-l has been shown to contain 23 virion-associated proteins (Fargeaud et al.,
1984). Eight glycoproteins have been identified, designated as gB, gC, gD, gE, gG, gH,
g1, and gL. There are only limited studies on the genes encoded by FHV-l. Most of
them are focused on envelope glycoproteins, most likely because they are predicted to
play a role in inducing host immunity, thus, have potential for vaccine development.

Studies on the functions of the first seven glycoproteins were reviewed by Maeda et a1.

(1998). It is clear from this review that much more work is needed to define their actual

fimctions and roles in viral pathogenesis and immunity.

HSV gB contains two or three transmembrane segments and is essential for entry
by fission of the envelope with the plasma membrane. Virions lacking gB egress the cell
but are not infectious. The gB protein binds heparan sulfate (Roizman et al., 2007).
Using heparin-affinity column chromatography, Maeda et al. (1997a) showed that FHV-

1 gB weakly binds to heparin.

gC

There have been very limited studies on gC of FHV-l. Willemse et al. (1994) first
determined a partial sequence of gC in 1994. They also found that the adjacent UL45
gene can be co-transcribed with gC. The complete sequence of FHV-l gC was later
determined by Maeda et al. (1997b). Based on the amino acid sequence deduced from
the nucleotide sequence, they predicted that gC is a membrane glycoprotein containing
a characteristic N-terminal hydrophobic signal sequence, nine potential N-linked
glycosylation sites, and C-terminal transmembrane and cytoplasmic domains. Maeda et
al. (1997a) further demonstrated that gC is the major heparin-binding glycoprotein
involved in the initial step in virus adsorption to cells as observed in ng of other
herpesviruses. In addition, they found that gC can agglutinate murine red blood cells,
and that infection of FHV-l is inhibited by addition of soluble heparin in cells cultures.

Some field isolates of F HV-l have been found to have genetic rearrangements in the N-

terminal region of gC, however, the function of gC did not seem to be affected
(Hamano et al., 2004).

gC homologues have been extensively studied in several alphaherpesviruses. gC
homologues are non-essential for herpesvirus replication in vitro, but they mediate
several important biological functions. First of all, gC is involved in the initial step of
viral attachment by interacting with heparan sulfate on the cell surface, as demonstrated
in HSV-l, PRV, BHV-l, and EHV-l (Herold et al., 1991; Mettenleiter et al., 1990;
Okazaki et al., 1991; Osterrieder, 1999). gC deficient mutants attach to cells with
reduced efficiency (Osterrieder, 1999). Secondly, ng of HSV-1 and -2 can bind the
complement component C3b (Frink et al., 1983; Lubinski et al., 1999). Binding of this
complement factor may protect herpesvirus-infected cells fiom complement-mediated
lysis (Fries et al., 1986). Viruses lacking complement-binding domains are less virulent
than wild-type virus (Frink et al., 1983; Herold et al., 1991; Lubinski et al., 1999). The
gC of FHV-l has been shown to be the dominant heparin-binding glycoprotein that
mediates the initial stage of viral adsorption, as observed in other herpesviruses (Maeda
et al., 1998). However, it remains to be determined whether FHV-l gC protects virus-

infected cells from complement-mediated lysis.

gD

HSV gD is a multifunctional protein with the following properties: it interacts
with three cellular receptors for entry — HveA, nectinl, and a modified heparin sulfate
and, hence, defines viral tropism. 0n receptor binding, an ensuing change in

conformation exposes profusion domains that enable firsogenic glycoprotein gB, gH,

and gL to complete fusion of the envelope with the plasma membrane. The N-terminal
domain may be replaced with ligands for entry via other receptors. gD protects the cell
from apoptosis induced by AgD mutants. Antiapoptotic activity is mediated by the
mannose-phosphate receptor. AgD mutants grown in cells ectopically expressing gD
produce Virions that exit the cell, but are not infectious (Brunetti et al., 1998; Cocchi et

al., 1998; Geraghty et al., 1998; Reynolds et al., 2001; Roizman et al., 2007).

gE and g1

In our laboratory, it has previously been shown that gE and g1 are virulence
factors (Kruger et al., 1996; Sussman et al., 1995). Unlike most commercial vaccines,
an experimental F HV-l vaccine with deletions in gE and g1 was safe and efficacious via
the oronasal route, and was able to highly reduce field virus latency loads in cats that
were first vaccinated then exposed one month later to a high dose of field virus. Both
glycoproteins have been shown to be nonessential for viral replication in vitro (Jacobs,

1994; Sussman et al., 1995; Willemse et al., 1996).

gG

Glycoprotein G (gG) homologues have been described in several
alphaherpesviruses as a minor non-essential glycoprotein (Baranowski et al., 1996).
Based on the viral species, gG has been reported either as a structural or a non-structural
protein. The protein encoded by FHV-l gG gene exists as two different forms, a
membrane-anchored form and a secreted form. The latter is generated by proteolytic

cleavage of the former (Drummer et al., 1998). A recent study by Costes et al.

demonstrated that FHV-l gG belongs to a newly discovered viral chemokine-binding
protein (vCKBP) family, binding with high afiinity to a broad spectrum of chemokines.
Both the secreted form and the membrane-anchored form of gG expressed at the surface
of virus-infected cells can bind chemokines. In addition, this study also showed that the
expression of a secreted vCKBP activity is a general property of field strains (Costes et
al., 2006). Although gG is not essential for virus growth, gG mutants of several
alphaherpesviruses have attenuated virulence and, thus, suggested as vaccine candidates.
These include PRV (Demmin et al., 2001), avian infectious laryngotracheitis virus

(Devlin et al., 2007), EHV-l and EHV-4 (Huang et al., 2005).

l .3 Replication
All alphaherpesviruses are believed to follow a similar replication pattern as
HSV-1, which has been extensively studied. The replication cycle is summarized below

(Flint et al., 2004; Pellett and Roizman, 2007; Roizman et al., 2007).

1.3.1 Attachement and Entry

The replication cycle begins with virion attachment to the cell surface via binding
of gC and gB to the heparin sulfate or chondroitin sulfate proteoglycans on the cell
surface. Following the initial attachment, gD initiates fusion of viral envelope and cell
membrane, mediated by gB, gD, gH, and gL. As a result of membrane firsion, viral
nucleocapsid is released into the cytoplasm. It attaches to microtubules and is

transported to the nucleus. Also released into the cytoplasm are the tegument proteins.

10

1.3.2 Gene Expression and DNA Replication

The expression of three classes of genes (immediate-early, early, and late) in a
temporal order is a characteristic of alphaherpesvirus replication. After viral DNA is
released into the nucleus via the nuclear pore, VP16 interacts with host transcription
proteins to initiate the transcription of immediate-early genes by host RNA polymerase
II. Immediate-early gene mRNAs are transported to the cytoplasm and translated. The
immediate-early proteins are transported back to the nucleus, activate transcription of
early genes, and down-regulate transcription of immediate-early genes. Early gene
mRNAs are also transported to the cytoplasm and translated. Early proteins are
primarily involved in DNA replication and nucleotide metabolism. Subsequently, viral
DNA synthesis is initiated from viral origins of replication. The replication of genomic
DNA is often referred to as a rolling circle model, in which DNA replication and
recombination produce long, concatemeric DNA, from a circularized template. The
concatemeric DNA serves as a template for late gene expression. Late mRN As are
transported to the cytoplasm and translated. Late proteins are primarily virion structural
proteins and additional proteins needed for virus assembly and particle egress. Envelope
glycoproteins are also late proteins that are made on and inserted into membranes of the
rough endoplasmic reticulum. The precursor glycoproteins are transported to the Golgi
apparatus for glycosylation, further modification and processing. Mature glycoproteins

are transported to the plasma membrane of the infected cell.

11

1.3.3 Virion Assembly and Egress

Newly replicated viral DNA is packaged into nucleocapsids in the nucleus. DNA-
containing nucleocapsids, surrounded by some tegument proteins, bud from the inner
nuclear membrane into the perinuclear lumen, acquiring a preliminary envelope that
contains precursor viral membrane proteins. This process is known as primary
envelopment. Immature enveloped Virions then fuse with the outer nuclear membrane
from within, and release the nucleocapsid into the cytoplasm. The nucleocapsids are
transported to and bud into the late Golgi-endosome compartment, acquiring an
envelope containing mature viral envelope proteins and the complete tegument layer.
The process is known as secondary envelopment. The enveloped virus particle then

buds into a vesicle that is transported to the plasma membrane for release by exocytosis.

1.4 Latency

Lifelong latency following the acute phase of the disease is a hallmark of
herpesvirus infections. During the latent stage, the viral genome persists in neural
tissues but infectious virus is not produced. The trigeminal ganglion is considered a
primary site of latency for F HV —1, although recent studies implied other tissues as
potential sites (Jacobi, 2008). When the latent state is established, viral DNA can
circularize and persist in the nucleus as an episome. Lytic gene expression is repressed,
while the latency-associated transcript (LAT) is expressed, which yields several RNA
species by splicing. These multiple species are collectively referred to as LATs. Low-

level or sporadic transcription of immediate-early and early genes can occur, but is not

12

sufficient to initiate a productive infection. No infectious Virions can be detected in the
ganglia during latent infection. The LAT RNA is spliced, and a stable intron in the form
of a lan'at, called the 2-kb LAT, is produced in the nucleus. The spliced LAT mRNA is
transported to the cytoplasm where several small ORFs may be translated into proteins.
The function of LAT RN As and the production of LAT proteins are still controversial.
Different biological stresses, or the administration of corticosteroids, can induce the
necessary biochemical stimuli in latently infected cells that lead to renewed production
of progeny Virions. Infectious virus is carried by anterograde axonal transport to
peripheral tissues, usually to cells at or near the site of initial infection, and is a potential
source of viral transmission (Pellett and Roizman, 2007; Roizman et al., 2007).
Depending on several factors, including the status of host immune system, the
reactivation may be asymptomatic or lead to a recurrent disease, which can vary
considerably in severity. Severe keratitis can also result from reactivation. The role of
reactivation in the epidemiology is directly related to the frequency by which it takes
place. Some herpesviruses, including F HV-l, reactivate much more easily than others
from the latent state, both under natural and experimental conditions. The ease by which
latent FHV-l is reactivated is an important element in the justification of FHV-l
infection of cats as a natural host model to study the molecular pathogenesis of

herpesvirus latency and approaches to prevent it.

13

1.5 Clinical Manifestations and Pathogenesis

Following entry via the oronasal route, F HV-l replicates extensively in the
mucosae of the upper respiratory tract. Pathologic examination reveals necrosis of
epithelia of the nasal cavity, pharynx, epiglottis, tonsils, larynx, and trachea. In extreme
cases and in young kittens, there can be an extensive rhinotracheitis and an associated
bronchopneumonia. Clinically, F HV-l infection manifests itself as a sudden onset of
sneezing, coughing, serous nasal and ocular discharge which can progress to
mucopurulent discharges, frothy salivation, dyspnea, anorexia, weight loss, and fever
after an incubation period of 24-48 hours. Conjunctivitis and keratitis are also common.
Occasionally there may be ulcers on the tongue. Infection in cats over six months of age
is likely to result in mild or subclinical infection. The mortality can reach 50% in kittens,
since the virus tends to generalize in this age group. Exposure of pregnant queens can
lead to abortion, but infection with FHV-l is not a common cause of abortion in cats.
The main reason is that viremia is low, because the natural temperature sensitivity of
FHV-l favors replication in the upper respiratory tract, which is below body
temperature. In addition, there is no evidence that the virus crosses the placenta and
fatally infects fetuses, and virus has not been isolated from placentas or aborted fetuses;
abortion, when it occurs, is thought to be secondary to fever and toxemia. Neurological
disorders are rare but have been observed clinically.

In recent years, the importance of FHV-l in ocular disease has been increasingly
recognized. FHV-l is the most common cause of conjunctivitis in cats (Nasisse, 1990).
Epithelial keratitis commonly occurs during acute infection in young cats and resolves

spontaneously in most cases (N asisse, 1995). In adult cats, reactivation of latent virus

14

can result in corneal ulceration, accompanied by a varying degree of conjunctivitis
(Stiles, 2000). Since herpetic stromal keratitis caused by HSV-1 is the leading cause of
infectious blindness in the industrialized countries, ocular infection of FHV-l in cats is

considered a very good natural host model.

1.6 Diagnosis

Clinically, the acute disease of FHV-l infection is very similar to that caused by
feline calicivirus (FCV). Profuse frothy salivation and corneal ulcers suggest feline
herpesvirus infection, whereas ulcers of the tongue, palate, and pharynx are encountered
more fi'equently in calicivirus infections.

In our laboratory, commonly performed diagnostics for FHV-l infection includes
virus isolation (V I), polymerase chain reaction (PCR) assays, virus neutralization (VN)
tests, and direct fluorescent antibody (FA) staining.

VI detect infectious virus and has been the gold standard for the diagnosis of
alphaherpesvirus infections (Maggs, 2005). It is performed by grinding tissue samples
or elute the virus from swabs in Borvarnick’s buffer, passing through 0.45 pm filters,

and incubate on CRFK monolayers in a 24-well plate or 25-cm2 flask. The cell culture

is observed for the development of characteristic cytopathic effect caused by F HV-l.
Compared to VI, PCR is more sensitive and efficient. Multiple PCR assays have

been described for use in the detection of FHV-l DNA (Jacobi, 2008). The TaqMan

based real-time PCR assay described by Vogtlin et al. (2002) targeting the gB gene is

routinely used in our laboratory for diagnosis of F HV-l infection. It can be converted

15

into a quantitative assay by incorporating a standard curve, consisting of a serial
dilution of FHV-l DNA whose genomic copy number had been determined. Our result
showed that the detection limit of this assay is approximately 10 copies of FHV-l
genome (unpublished data). A quantitative SYBR-Green based real-time PCR assay
targeting gE and g1 genes was also developed in our laboratory. The detection limit for
this assay is also approximately 10 copies (unpublished data). An internal control can be
spiked in the reaction to determine whether a negative reaction was caused by inhibitory
factors in the sample (unpublished data).

Virus neutralizing antibody titers are determined by VN tests, which are
commonly used to detect prior infection of FHV-l in cats. However, the presence of
neutralizing antibody in serum does not necessarily correlate with clinical disease
(Dawson et al., 1998).

Feline herpesvirus-specific proteins on conjunctival or corneal smears or biopsies
can be detected by direct FA staining. Polyclonal fluorescein conjugated antibody binds

to FHV-l epitopes on the cell surface and can be visualized by fluorescent microscopy.

1.7 Treatment and Control

1.7.1 Supportive Treatment
The European Advisory Board on Cat Diseases (ABCD) recently published a
guideline for management of this disease (Thiry et al., 2009). Like many viral infections,

supportive treatment is advised. To prevent secondary bacterial infections, broad-

16

spectrum antibiotics that achieve good penetration into the respiratory tract should be
given in all acute cases. Food intake is extremely important. Food should be highly
palatable and flavorful, since many cats will not eat because of loss of their sense of
smell or the presence of ulcers in the oral cavity. Appetite stimulants (eg,
cyproheptadine) may be used. If the cat does not eat for more than 3 days, a feeding
tube should be placed. In cats with severe clinical signs, restoration of fluids,
electrolytes and acid-base balance is required, preferably by intravenous administration.
Nasal decongestants and mucolytic drugs have been suggested to help clear airways.
Nebulization with saline can be used to ease dehydration of the airways. Eye drops or

ointrnents can be administered several times a day.

1.7.2 Antiviral Therapy

Nucleoside analogue antivirals have been widely used to treat HSV and VZV
infections. Generally speaking, in infected cells, these nucleoside analogues are
converted into triphosphates by viral thymidine kinase and other host enzymes, and
competitively inhibit viral DNA polymerase, preventing DNA chain elongation (Snoeck,
2000). As a result, viral DNA synthesis, and hence viral replication, are disrupted.
However, use of these agents against F HV -1 infection has been largely limited to
topical administration. First generation nucleoside analogues, including acyclovir and
its pro-drug valacyclovir, have little efficacy against F HV-l in vitro and moderate effect
in vivo. More importantly, they produce serious side effects in cats, including
myelosuppression, hepatotoxicity, and nephrotoxicity, when administered systemically

at therapeutic levels (Nasisse et al., 1997; Owens et al., 1996). According to the

17

European ABCD’s guideline (Thiry et al., 2009), trifluridine is the topical treatment of
choice in cats with ocular F HV-l manifestations. Acyclovir, ganciclovir, and
idoxuridine are also suggested for topical use in the guideline. Other drugs that have
been proposed for the treatment of FHV—l ocular infections include
bromovinyldeoxyuridine, cidofovir, fameiclovir, HPMA (N-[2-hydroxypropyl]
methacrylamide), penciclovir, ribavirin, valaciclovir, vidarabine, foscamet and
lactoferrin. It was noted that, except for acyclovir, there is a lack of controlled in vivo
efficacy study for these agents in the literature (Thiry et al., 2009). The efficacy of
topical application of cidofovir on primary ocular FHV -1 infection was recently
demonstrated (F ontenelle et al., 2008). F amciclovir, which is converted into penciclovir
triphosphate by viral thymidine kinase in alphaherpesvirus-infected cells, was recently
shown to be safe and efficacious when administered orally in treating ocular signs,
cutaneous disease, and rhinosinusitis induced by FHV-l infection in 10 cats (Malik et
al., 2009). Although it was not a controlled study, this is probably the first antiviral
shown to be safe for systemic administration in cats.

L-lysine is an antagonist of arginine, the latter has been shown to be essential for
human herpes simplex virus and FHV-l proteosynthesis (Maggs et al., 2003).
Treatment with L-lysine therefore decreases viral replication and has been shown to
have some inhibitory effect against both human herpesvirus and FHV-l infection
(Maggs et al., 2000; Maggs et al., 2003; Stiles et al., 2002). Oral supplementation with
L-lysine reduces the severity of experimentally induced F HV-l conjunctivitis (Stiles et
al., 2002) and ocular virus shedding associated with reactivation of latent infection

(Maggs et al., 2003). It was suggested for use early in acute disease or as a means of

18

reducing the severity of disease and virus shedding at times of stress (Gaskell et al.,
2007). Feline interferon (IFN) 0) and human IFN-a can be given systemically along with

L-lysine to reduce clinical disease (Thiry et al., 2009).

1.8 Immunity and Vaccination

Primary FHV-l infection induces both humoral and cellular immune responses. It
is likely that virus neutralizing antibodies recognize incoming virus during the acute
phase of infection, and contributes to antibody-dependent cellular cytotoxicity and
antibody-induced complement lysis (Wardley et al., 1976). The immunity induced by
natural F HV-l infection protects cats from the disease, but not from infection. In fact,
the protection becomes incomplete six months after the primary infection (Gaskell and
Povey, 1977; Walton and Gillespie, 1970), and mild clinical signs have been observed
following re-infection as soon as 150 days after the primary infection (Thiry et al.,
2009). Virus neutralizing antibody titers are generally low and in some cases
undetectable after primary infection, although after further exposure to virus, they tend
to rise to more moderate levels and thereafter remain reasonably stable (Gaskell et al.,
2007; Gaskell and Povey, 1979). Since FHV-l is a pathogen of the respiratory tract,
mucosal immune responses are important (Lappin et al., 2006).

During the first weeks of life, maternally derived antibodies protect kittens against
disease, although the exact time of protection varies considerably among individuals.
Generally speaking, maternally derived antibodies persist for 2 to 10 weeks, with mean

titers falling below detectable levels (< 1:2) by nine weeks of age (Gaskell and Povey,

l9

1982). More recent studies found that about 25% of the kittens have an antibody level
of < 1:4 at only 6 weeks of age. It should also be noted that kittens with low levels of
maternally derived antibodies are not necessarily protected from subclinical infection
and latency (Gaskell and Povey, 1982), and that these kittens may respond to early
vaccination (Dawson et al., 2001). On the other hand, in some individuals, maternally
derived antibodies may still be at interfering levels at 12—14 weeks of age (Dawson et
al., 2001; Gaskell et al., 2007). The European ABCD recommends two vaccine
injections, at 9 and 12 weeks of age, followed by yearly boosters (Thiry et a1, 2009).
The American Association of Feline Practitioners Feline Vaccine Advisory Panel
advices that the primary series of vaccination should begin as early as 6 weeks of age,
then one dose every 3 to 4 weeks until 16 weeks of age, followed by 2 doses 3 to 4
weeks apart. A single dose is given 1 year following the last dose of the primary series,
then one dose every 3 years (Richards et al., 2006).

FHV-l vaccines protect cats against disease but not against infection and, as a
consequence, latency. An approximately 90% reduction in clinical scores to
experimental challenge has been achieved with vaccination, and virus excretion is
reduced (Gaskell etal., 2007). There is complete cross-protection among FHV-l strains,
as they all belong to the same single serotype. All current commercial FHV-l vaccines
are multivalent, most commonly include FCV and feline panleukopenia virus
components, and are collectively called feline viral rhinotracheitis, calicivirus, and
panleukopenia (F VRCP) vaccines. Of the three vaccine components, the protection
induced against FHV -1 is generally the least effective (Lappin et al., 2002; Scott and

Geissinger, 1999).

20

A number of modified live and killed FVRCP vaccines for parenteral
administration are available in the United States (Lappin et al., 2006; Richards et al.,
2006). Modified-live vaccines are routinely used, but they have residual virulence and
may induce clinical signs if administered incorrectly (e.g. by accidental aerosolisation
or spillage on the skin) (Kruger et al., 1996). Killed virus vaccines are generally
preferred for use in pregnant queens (and only if absolutely necessary) and in F eLV- or
FIV-infected cats (Richards et al., 2006).

In addition to vaccines labeled for systemic immunization, an intranasal
multivalent vaccine including an FHV-l component is commercially available. Testing
under experimental conditions showed that this vaccine (Feline UltraNasal FVRC or
F VRCP Vaccine, Heska Corporation, Loveland, CO) was safe and induced protection
against the clinical signs of field virus exposure within a week post-vaccination (Lappin
et al., 2006). With systemically administered vaccine this would take 2-3 weeks (Lappin
et al., 2009). However, it is unclear whether the new, vaccine reduces the length and
level of field virus shedding. It is also unclear whether the new vaccine prevents latent
infection.

Several F HV-l deletion and/or insertion mutants have been constructed as
potential vaccine candidates, some of which have incorporated other genes including
the FCV capsid gene (Cole et al., 1990; Mishima et al., 2001; Mishima et al., 2002;
Wardley et al., 1992; Yokoyarna, 1995, 1996a, 1996b, 1998). A gE—gl deletion mutant
was previously developed in our laboratory (Kruger et al., 1996; Sussman et al., 1997;
Sussman et al., 1995). Williamse et a1. (1996) developed a gI insertional mutant, which

also appeared to affect the transcription pattern and expression of the upstream gene gD.

21

Williamse et al. (1994) also developed an FHV-l mutant by inserting B-galactosidase
marker gene into UL45, adjacent to the gC gene. Yokoyama et al. (1996c, 1998)
developed a TK- recombinant FHV-l vaccine. In general, these deletion/insertional
mutants are less virulent for cats and offer good protection against disease, especially
via the oronasal route. One reason that none has so far been marketed is probably

because the protection offered is not superior to conventionally attenuated vaccines

(Gaskell et al., 2007).

1.9 In vitro models of FHV-l infection

FHV-l infection in cats is an excellent natural model for herpes simplex virus
infection in humans, especially for ocular diseases induced by HSV-1 and -2. Other
herpesvirus infections in large animals, including EHV -1, BHV -1, and PRV, have also
been used extensively to study common aspects of herpesvirus biology. However,
animal experiments in these species are expensive, labor-intensive, and sometimes of
ethical concerns.

In recent years, several in vitro systems have been developed as substitutes for in
vivo animal experiments.

Tracheal organ cultures have been used in several species to study physiology and
infectious diseases, having the advantage over cell cultures of more closely mimicking
the natural situation (Cook et al., 1976; Dhinakar Raj and Jones, 1996). This technique
has only been used in one comparative study involving FHV-l and FCV, which showed

that viral titers peaked later in tracheal cultures than in cell monolayers (Milek et al.,

22

1976). Leeming et al. (2006) established feline tracheal organ cultures as an in vitro
system for the examination of functional and morphological effects of FHV-l on the
respiratory epithelium. Based upon daily assessment of cilia movement and tissue
morphology, the respiratory epithelium remains viable in culture for at least 120 hours,
allowing sufficient viral replication and development of lesions. Therefore, aspects of
FHV-l infection in respiratory epithelium can now be studied in a model that closely
mimics natural infection in airways.

Recently, ex vivo cultures of nasal respiratory, nasopharygeal, and tracheal
mucosa from equines have been established, the explants were maintained in vitro for
up to 96 hours on fine-meshed gauze at an air-liquid interface, mimicking the air-liquid
interface found in the respiratory tract of the living animal (V andekerckhove et al.,
2009). Ex vivo cultures of porcine nasal mucosa have also been established and
maintained for up to 60 hours post-sampling (Glorieux et al., 2007). Further, a
quantitative analysis system was established to study the kinetics of horizontal and
vertical spread of PRV, including crossing of the basement membrane, in the porcine
nasal mucosa explant system. This system was subsequently used to examine different
historical PRV strains isolated between the 19608 and 2000, and found them behave
differently in the respiratory nasal mucosa (Glorieux et al., 2009).

Ocular infection of F HV-l in cats is an excellent natural model for ocular diseases
induced by HSV-l and -2. Conjunctival and corneal epithelial tissues are the primary
targets for FHV-l in ocular infections (Bistner et al., 1971; Nasisse et al., 1989). A
primary culture of PCB cells has been established and maintained in heavily-supplied

medium for 6 passages, and CPE of FHV-l in these cells has been characterized

23

(Sandmeyer et al., 2005a). FCE cells have also been used to evaluate the effects of
interferon-alpha and cidofovir on cell viability and replication of FHV-l (Sandmeyer et

al., 2005b; Sandmeyer et al., 2005c).

1.10 Conclusions

In summary, FHV-l has long been causing a widespread and very important
respiratory disease in cats. Ocular lesions are also an important aspect of FHV-l
infections, like is the case for HSV-1 in humans. Expanding our limited knowledge of
FHV-l, particularly in the regards of gene contents and functions, molecular
pathogenesis, mechanism of latent infection, and host-virus interactions, will not only
benefit cats, but also contribute to the shared aspects of herpesvirus biology.
Furthermore, F HV-l infection in cats has potential as a natural host system for the study
of immunity against herpesvirus infections, as well as the study of antivirals and new

therapeutic approaches to treatment of herpesvirus infections.

24

1.11 References

Alba, M.M., Das, R., Orengo, C.A., Kellam, P., 2001. Genomewide function
conservation and phylogeny in the Herpesviridae. Genome Res 11, 43-54.

Baranowski, E., Keil, G., Lyaku, J., Rijsewijk, F.A., van Oirschot, J.T., Pastoret, P.P.,
Thiry, E., 1996. Structural and functional analysis of bovine herpesvirus 1 minor
glycoproteins. Vet Microbiol 53, 91-101.

Bistner, S.I., Carlson, J.H., Shively, J.N., Scott, F.W., 1971. Ocular manifestations of
feline herpesvirus infection. J Am Vet Med Assoc 159, 1223-37.

Brunetti, C.R., Dingwell, K.S., Wale, C., Graham, F.L., Johnson, DC, 1998. Herpes
simplex virus gD and Virions accumulate in endosomes by mannose 6-phosphate-
dependent and -independent mechanisms. J Virol 72, 3330-9.

Cocchi, F., Menotti, L., Mirandola, P., Lopez, M., Campadelli-Fiume, G., 1998. The
ectodomain of a novel member of the immunoglobulin subfamily related to the

poliovirus receptor has the attributes of a bona fide receptor for herpes simplex
virus types 1 and 2 in human cells. J Virol 72, 9992-10002.

Cole, G.E., Stacy-Phipps, S., Nunberg, J .H., 1990. Recombinant feline herpesviruses
expressing feline leukemia virus envelope and gag proteins. J Virol 64, 4930-8.

Cook, J.K., Darbyshire, J.H., Peters, R.W., 1976. The use of chicken tracheal organ
cultures for the isolation and assay of avian infectious bronchitis virus. Arch Virol
50, 109-18.

Costes, B., Thirion, M., Dewals, B., Mast, J ., Ackermann, M., Markine-Goriaynoff, N.,
Gillet, L., Vanderplasschen, A., 2006. Felid herpesvirus 1 glycoprotein G is a
structural protein that mediates the binding of chemokines on the viral envelope.
Microbes Infect 8, 2657-67.

Davison, A.J., Eberle, R., Ehlers, B., Hayward, G.S., McGeoch, D.J., Minson, A.C.,
Pellett, P.E., Roizman, B., Studdert, M.J., Thiry, E., 2009. The order
Herpesvirales. Arch Virol 154, 171-7.

Dawson, D.A., Carman, J., Collins, J., Hill, 8., Lappin, M.R., 1998. Enzyme-linked
immunosorbent assay for detection of feline herpesvirus 1 IgG in serum, aqueous
humor, and cerebrospinal fluid. J Vet Diagn Invest 10, 315-9.

Dawson, 8., Willoughby, K., Gaskell, R.M., Wood, G., Chalmers, W.S., 2001. A field

trial to assess the effect of vaccination against feline herpesvirus, feline calicivirus
and feline panleucopenia virus in 6-week-old kittens. J Feline Med Surg 3, 17-22.

25

Demmin, G.L., Clase, A.C., Randall, J .A., Enquist, L.W., Banfield, B.W., 2001.
Insertions in the gG gene of pseudorabies virus reduce expression of the upstream
Us3 protein and inhibit cell-to-cell spread of virus infection. J Virol 75, 10856-69.

Devlin, J.M., Browning, G.F., Hartley, C.A., Gilkerson, J.R., 2007. Glycoprotein G
deficient infectious laryngotracheitis virus is a candidate attenuated vaccine.
Vaccine 25, 3561-6.

Dhinakar Raj, G., Jones, R.C., 1996. Protectotypic differentiation of avian infectious
bronchitis viruses using an in vitro challenge model. Vet Microbiol 53, 239-52.

Drummer, H.E., Studdert, M.J., Crabb, BS, 1998. Equine herpesvirus-4 glycoprotein G
is secreted as a disulphide-linked homodimer and is present as two homodimeric
species in the virion. J Gen Virol 79, 1205-13.

Fargeaud, D., Jeannin, C.B., Kato, F., Chappuis, G., 1984. Biochemical study of the
Feline Herpesvirus 1. Identification of glycoproteins by affinity. Arch Virol 80,
69-82.

Flint, S.J., Enquist, L.W., Racaniello, V.R., Skalka, A.M., 2004. Principles of virology:
molecular biology, pathogenesis, and control of animal viruses, second ed. ASM
Press, Washington.

Fontenelle, J .P., Powell, C.C., Veir, J .K., Radecki, S.V., Lappin, M.R., 2008. Effect of
topical ophthalmic application of cidofovir on experimentally induced primary
ocular feline herpesvirus-1 infection in cats. Am J Vet Res 69, 289-93.

Fries, L.F., Friedman, H.M., Cohen, G.H., Eisenberg, R.J., Hammer, C.H., Frank, M.M.,
1986. Glycoprotein C of herpes simplex virus 1 is an inhibitor of the complement
cascade. J Irnmunol 137, 1636-41.

Frink, R.J., Eisenberg, R., Cohen, G., Wagner, E.K., 1983. Detailed analysis of the
portion of the herpes simplex virus type 1 genome encoding glycoprotein C. J
Virol 45, 634-47.

Gaskell, R., Dawson, 8., Radford, A., Thiry, E., 2007. Feline herpesvirus. Vet Res 38,
337-54.

Gaskell, R.M., Povey, R.C., 1977. Experimental induction of feline viral rhinotracheitis
virus re-excretion in F VR-recovered cats. Vet Rec 100, 128-33.

Gaskell, R.M., Povey, R.C., 1979. The dose response of cats to experimental infection
with feline viral rhinotracheitis virus. J Comp Pathol 89, 179-91.

Gaskell, R.M., Povey, R.C., 1982. Transmission of feline viral rhinotracheitis. Vet Rec
111, 359-62.

26

Geraghty, R.J., Krummenacher, C., Cohen, G.H., Eisenberg, R.J., Spear, P.G., 1998.
Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and
poliovirus receptor. Science 280, 1618-20.

Glorieux, S., Favoreel, H.W., Meesen, G., de Vos, W., Van den Broeck, W., Nauwynck,
H.J., 2009. Different replication characteristics of historical pseudorabies virus
strains in porcine respiratory nasal mucosa explants. Vet Microbiol 136, 341 -6.

Glorieux, S., Van den Broeck, W., van der Meulen, K.M., Van Reeth, K., Favoreel,
H.W., Nauwynck, H.J., 2007. In vitro culture of porcine respiratory nasal mucosa

explants for studying the interaction of porcine viruses with the respiratory tract. J
Virol Methods 142, 105-12.

Grail, A., Harbour, D.A., Chia, W., 1991. Restriction endonuclease mapping of the
genome of feline herpesvirus type 1. Arch Virol 116, 209-20.

Hamano, M., Maeda, K., Mizukoshi, F ., Mochizuki, M., Tohya, Y., Akashi, H., Kai, K.,
2004. Genetic rearrangements in the gC gene of the feline herpesvirus type 1.
Virus Genes 28, 55-60.

Herold, B.C., WuDunn, D., Soltys, N., Spear, P.G., 1991. Glycoprotein C of herpes
simplex virus type 1 plays a principal role in the adsorption of virus to cells and in
infectivity. J Virol 65, 1090-8.

Huang, J ., Hartley, C.A., Ficorilli, N.P., Crabb, B.S., Studdert, M.J., 2005. Glycoprotein
G deletion mutants of equine herpesvirus 1 (EHVl; equine abortion virus) and
EHV4 (equine rhinopneumonitis virus). Arch Virol 150, 2583-92.

Jacobi, S., 2008. Molecular pathology of FHV-l infection within feline cornea,
conjunctiva, lacrimal gland, nictitans gland, trigeminal ganglion and ciliary
ganglion, M.S. thesis, Michigan State University.

Jacobs, L., 1994. Glycoprotein E of pseudorabies virus and homologous proteins in
other alphaherpesvirinae. Arch Virol 137, 209-28.

Kruger, J.M., Sussman, M.D., Maes, R.K., 1996. Glycoproteins g1 and gE of feline
herpesvirus-1 are virulence genes: safety and efficacy of a gl-gE deletion mutant
in the natural host. Virology 220, 299-308.

Lappin, M.R., Andrews, J ., Simpson, D., Jensen, W.A., 2002. Use of serologic tests to
predict resistance to feline herpesvirus 1, feline calicivirus, and feline parvovirus
infection in cats. J Am Vet Med Assoc 220, 38-42.

Lappin, M.R., Sebring, R.W., Porter, M., Radecki, S.J., Veir, J., 2006. Effects of a
single dose of an intranasal feline herpesvirus 1, calicivirus, and panleukopenia

27

vaccine on clinical signs and virus shedding afier challenge with virulent feline
herpesvirus 1. J Feline Med Surg 8, 158-63.

Lappin, M.R., Veir, J ., Hawley, J ., 2009. Feline panleukopenia virus, feline herpesvirus-
1, and feline calicivirus antibody responses in seronegative specific pathogen-free
cats after a single administration of two different modified live FVRCP vaccines.
J Feline Med Surg 11, 159-62.

Leeming, G., Meli, M.L., Cripps, P., Vaughan-Thomas, A., Lutz, H., Gaskell, R., Kipar,
A., 2006. Tracheal organ cultures as a useful tool to study Felid herpesvirus 1
infection in respiratory epithelium. J Virol Methods 138, 191-5.

Lubinski, J., Wang, L., Mastellos, D., Sahu, A., Lambris, J.D., Friedman, H.M., 1999.
In vivo role of complement-interacting domains of herpes simplex virus type 1
glycoprotein gC. J Exp Med 190, 1637-46.

Maeda, K., Horimoto, T., Mikami, T., 1998. Properties and functions of feline
herpesvirus type 1 glycoproteins. J Vet Med Sci 60, 881-8.

Maeda, K., Yokoyama, N., Fujita, K., Maejima, M., Mikami, T., 1997a. Heparin-
binding activity of feline herpesvirus type 1 glycoproteins. Virus Res 52, 169-76.

Maeda, K., Yokoyama, N., Fujita, K., Mikami, T., 1997b. Identification and
characterization of the feline herpesvirus type 1 glycoprotein C gene. Virus Genes
14, 105-9.

Maggs, D.J., 2005. Update on pathogenesis, diagnosis, and treatment of feline
herpesvirus type 1. Clin Tech Small Anim Pract 20, 94-101.

Maggs, D.J., Collins, B.K., Thorne, J.G., Nasisse, MP, 2000. Effects of L-lysine and
L-arginine on in vitro replication of feline herpesvirus type-1. Am J Vet Res 61,
1474-8.

Maggs, D.J., Nasisse, M.P., Kass, RH, 2003. Efficacy of oral supplementation with L-
lysine in cats latently infected with feline herpesvirus. Am J Vet Res 64, 37-42.

Meme R., Lessels, N.S., Webb, 5., Meek, M., Graham, P.G., Vitale, c., Norris, J.M.,
Power, H., 2009. Treatment of feline herpesvirus-l associated disease in cats with
fameiclovir and related drugs. J Feline Med Surg 11, 40-8.

Mettenleiter, T.C., Zsak, L., Zuckermann, F ., Sugg, N., Kern, H., Ben-Porat, T., 1990.
Interaction of glycoprotein gHI with a cellular heparinlike substance mediates
adsorption of pseudorabies virus. J Virol 64, 278-86.

Milek, M., Wooley, R.E., Blue, J .L., 1976. Replication of feline herpesvirus and feline
calicivirus in cell and organ cultures. Am J Vet Res 37, 723-4.

28

Mishima, M., Xuan, X., Nishikawa, Y., Makala, L., Yokoyama, N., Nagasawa, H.,
Mikami, T., 2001. Construction of recombinant feline herpesvirus type 1
expressing Toxoplasma gondii surface antigen 1. Mol Biochem Parasitol 117,

103-6.

Mishima, M., Xuan, X., Yokoyama, N., Igarashi, I., Fujisaki, K., Nagasawa, H.,
Mikami, T., 2002. Recombinant feline herpesvirus type 1 expressing Toxoplasma

gondi ROP2 antigen inducible protective immunity in cats. Parasitol Res 88, 144-
9.

Murphy, F.A., Gibbs, E.P.J., Horzinek, M.C., Studdert, M.J., 1999. Veterinary virology,
third ed. Academic Press, San Diego.

Nasisse, MP, 1990. Feline herpesvirus ocular disease. Vet Clin North Am Small Anim
Pract 20, 667-80.

Nasisse, MP, 1995. Diagnosis and treatment of conjunctival and corneal diseases. Vet
Q 17 Suppl 1, S42-3.

Nasisse, M.P., Dorman, D.C., Jamison, K.C., Weigler, B.J., Hawkins, E.C., Stevens,
J .B., 1997. Effects of valacyclovir in cats infected with feline herpesvirus 1. Am J
Vet Res 58, 1141-4.

Nasisse, M.P., Guy, J.S., Davidson, M.G., Sussman, W.A., Fairley, N.M., 1989.
Experimental ocular herpesvirus infection in the cat. Sites of virus replication,
clinical features and effects of corticosteroid administration. Invest Ophthahnol
Vis Sci 30, 1758-68.

Okazaki, K., Matsuzaki, T., Sugahara, Y., Okada, J ., Hasebe, M., Iwamura, Y., Ohnishi,
M., Kanno, T., Shimizu, M., Honda, E., et al., 1991. BHV-l adsorption is
mediated by the interaction of glycoprotein gIII with heparinlike moiety on the
cell surface. Virology 181, 666-70.

Osterrieder, N., 1999. Construction and characterization of an equine herpesvirus 1
glycoprotein C negative mutant. Virus Res 59, 165-77.

Owens, J .G., Nasisse, M.P., Tadepalli, S.M., Dorman, DC, 1996. Pharmacokinetics of
acyclovir in the cat. J Vet Pharrnacol Ther 19, 488-90.

Pellett, P.E., Roizman, B., 2007. The family Herpesviridae: a brief introduction, in:
Knipe, D.M., Howley, P.M. (Eds.), Fields Virology. Lippincott Williams &
Wilkins, Philadelphia, pp. 2479-99.

Povey, R.C., 1979. A review of feline viral rhinotracheitis (feline herpesvirus I
infection). Comp Irnmunol Microbiol Infect Dis 2, 373-87.

29

Reynolds, A.E., Ryckrnan, B.J., Baines, J.D., Zhou, Y., Liang, L., Roller, R.J., 2001.
U(L)31 and U(L)34 proteins of herpes simplex virus type 1 form a complex that

accumulates at the nuclear rim and is required for envelopment of nucleocapsids.
J Virol 75, 8803-17.

Richards, J.R., Elston, T.H., Ford, R.B., Gaskell, R.M., Hartrnann, K., Hurley, K.F.,
Lappin, M.R., Levy, J.K., Rodan, I., Scherk, M., Schultz, R.D., Sparkes, A.H.,
2006. The 2006 American Association of Feline Practitioners Feline Vaccine
Advisory Panel report. J Am Vet Med Assoc 229, 1405-41.

Roizman, B., Knipe, D.M., Whitley, R.J., 2007. Herpes simplex viruses, in: Knipe,
D.M., Howley, P.M. (Eds.), Fields Virology. Lippincott Williams & Wilkins,
Philadelphia, pp. 2502-601.

Rota, F.A., Maes, R.K., Ruyechan, W.T., 1986. Physical characterization of the genome
of feline herpesvirus-l. Virology 154, 168-79.

Sandmeyer, L.S., Keller, C.B., Bienzle, D., 2005a. Culture of feline corneal epithelial
cells and infection with feline herpesvirus-l as an investigative tool. Am J Vet
Res 66, 205-9.

Sandmeyer, L.S., Keller, C.B., Bienzle, D., 2005b. Effects of cidofovir on cell death
and replication of feline herpesvirus-l in cultured feline corneal epithelial cells.
Am J Vet Res 66, 217-22.

Sandmeyer, L.S., Keller, C.B., Bienzle, D., 2005c. Effects of interferon-alpha on

cytopathic changes and titers for feline herpesvirus-1 in primary cultures of feline
corneal epithelial cells. Am J Vet Res 66, 210-6.

Scott, F.W., Geissinger, C.M., 1999. Long-term immunity in cats vaccinated with an
inactivated trivalent vaccine. Am J Vet Res 60, 652-8.

Snoeck, R., 2000. Antiviral therapy of herpes simplex. Int J Antimicrob Agents 16, 157-
9.

Spatz, S.J., 1993. Genetic Analysis of the Genes Encoding the Major Glycoproteins of
Feline Herpesvirus Type 1, PhD. thesis, Michigan State University.

Stiles, J ., 2000. Feline herpesvirus. Vet Clin North Am Small Anim Pract 30, 1001-14.
Stiles, J., Townsend, W.M., Rogers, Q.R., Krohne, S.G., 2002. Effect of oral

administration of L-lysine on conjunctivitis caused by feline herpesvirus in cats.
Am J Vet Res 63, 99-103.

30

Sussman, M.D., Maes, R.K., Kruger, J.M., 1997. Vaccination of cats for feline

rhinotracheitis results in a quantitative reduction of virulent feline herpesvirus-1
latency load after challenge. Virology 228, 379-82.

Sussman, M.D., Maes, R.K., Kruger, J.M., Spatz, S.J., Venta, P.J., 1995. A feline
herpesvirus-1 recombinant with a deletion in the genes for glycoproteins g1 and
gE is effective as a vaccine for feline rhinotracheitis. Virology 214, 12-20.

Thiry, E., Addie, D., Belak, S., Boucraut-Baralon, C., Egberink, H., Frymus, T.,
Gruffydd-Jones, T., Hartmann, K., Hosie, M.J., Lloret, A., Lutz, H., Marsilio, F.,
Pennisi, M.G., Radford, A.D., Truyen, U., Horzinek, M.C., 2009. Feline

herpesvirus infection. ABCD guidelines on prevention and management. J Feline
Med Surg 11, 547-55.

Vandekerckhove, A., Glorieux, S., Broeck, W.V., Gryspeerdt, A., van der Meulen,

K.M., Nauwynck, H.J., 2009. In vitro culture of equine respiratory mucosa
explants. VetJ 181, 280-7.

Vogtlin, A., Fraefel, C., Albini, S., Leutenegger, C.M., Schraner, E., Spiess, B., Lutz, H.,
Ackermann, M., 2002. Quantification of feline herpesvirus 1 DNA in ocular fluid
samples of clinically diseased cats by real-time TaqMan PCR. J Clin Microbiol 40,
519-23.

Walton, T.E., Gillespie, J.H., 1970. Feline viruses. VII. Immunity to the feline
herpesvirus in kittens inoculated experimentally by the aerosol method. Cornell
Vet 60, 232-9.

Wardley, R.C., Berlinski, P.J., Thomsen, D.R., Meyer, A.L., Post, LE, 1992. The use

of feline herpesvirus and baculovirus as vaccine vectors for the gag and env genes
of feline leukaemia virus. J Gen Virol 73, 1811-8.

Wardley, R.C., Rouse, B.T., Babiuk, L.A., 1976. Observations on recovery mechanisms
from feline viral rhinotracheitis. Can J Comp Med 40, 257-64.

Willemse, M.J., Chalmers, W.S., Cronenberg, A.M., Pfundt, R., Strijdveen, I.G.,
Sonderrneijer, P.J., 1994. The gene downstream of the gC homologue in feline
herpes virus type 1 is involved in the expression of virulence. J Gen Virol 75,
3107-16.

Willemse, M.J., Chalmers, W.S., Sondermeijer, P.J., 1996. In vivo properties of a feline

herpesvirus type 1 mutant carrying a lacZ insertion at the g1 locus of the unique
short segment. Vaccine 14, 1-5.

Xuan, X., Horimoto, T., Limcumpao, J .A., Tohya, Y., Takahashi, E., Mikami, T., 1992.

Glycoprotein-specific immune response in canine herpesvirus infection. Arch
Virol 122, 359-65.

31

Yokoyama, N., Fujita, K., Damiani, A., Sato, E., Kurosawa, K., Miyazawa, T., Ishiguro,
S., Mochizuki, M., Maeda, K., Mikami, T., 1998. Further development of a
recombinant feline herpesvirus type 1 vector expressing feline calicivirus
immunogenic antigen. J Vet Med Sci 60, 717-23.

Yokoyama, N., Maeda, K., Fujita, K., Ishiguro, S., Sagawa, T., Mochizuki, M., Tohya,
Y., Mikami, T., 1996a. Vaccine efficacy of recombinant feline herpesvirus type 1

expressing immunogenic proteins of feline calicivirus in cats. Arch Virol 141,
2339-51.

Yokoyama, N., Maeda, K., Kawaguchi, Y., Ono, M., Tohya, Y., Mikami, T., 1995.
Construction of the recombinant feline herpesvirus type I deleted thymidine
kinase gene. J Vet Med Sci 57, 709-14.

Yokoyama, N., Maeda, K., Tohya, Y., Kawaguchi, Y., Fujita, K., Mikami, T., 1996b.
Recombinant feline herpesvirus type 1 expressing immunogenic proteins

inducible virus neutralizing antibody against feline calicivirus in cats. Vaccine 14,
1657-63.

Yokoyama, N., Maeda, K., Tohya, Y., Kawaguchi, Y., Shin, Y.S., Ono, M., Ishiguro, S.,
Fujikawa, Y., Mikami, T., 1996c. Pathogenicity and vaccine efficacy of a
thymidine kinase-deficient mutant of feline herpesvirus type 1 in cats. Arch Virol
141, 481-94.

32

CHAPTER 2

BACTERIAL ARTIFICIAL CHROMOSOME (BAC) AND
RECOMBINATION—MEDIATED GENETIC ENGINEERING

(RECOMBINEERIN G)

33

2.1 BAC Cloning

Traditionally, functional studies of viral genes have been achieved by creating
mutant alleles and screening for phenotypic alterations, an approach known as reverse
genetics. Because the natural mutation rate in DNA viruses sUch as herpesviruses is low,
experimental generation of viral mutants is necessary. However, the fact that the
frequency of the experimentally induced mutation must be controllable, in order to
prevent accumulation of multiple mutations, makes the process inefficient. In addition,
to map these mutations, time-consuming and labor-intensive procedures are required
(Schaffer, 1975; Schaffer et al., 1984).

Advances in molecular cloning technologies facilitated functional Studies at the
level of isolated genes. Viral genes and genomic fragments can be cloned, then
manipulated in vitro and reintroduced into the viral genome. Nevertheless, due to the
limitations in the capacity of vectors, this method allowed only step-by-step analysis for
large and complex genomes. In the late 1980s herpesvirus genomes were subcloned as a
set of overlapping cosmid clones in Escherichia coli. After co-transfecting cells with
the cosmid set, infectious virus can be reconstituted by multiple homologous
recombinations via the overlapping sequences (van Zijl et al., 1988). Mutations can be
introduced into one of the fiagrnents. Because recombination procedures in cells cannot
be controlled, mutagenesis is often associated with unwanted and illegitimate mutations
and extensive post-mutagenesis analysis of the isolated mutants is therefore required.
Null mutants of an essential gene can only be propagated in cell lines that provide the
gene product in trans (DeLuca and Schaffer, 1985). In addition, the successful use of

these strategies is determined by the replication efficiency of the virus under study. The

34

plentiful selection of mutants available for herpes simplex viruses is in contrast to the
paucity of mutants of other herpesviruses that remain cell associated, that replicate
slowly or that have the propensity to enter the lytic cycle only under specific conditions.

Yeast artificial chromosomes (YACs) were the first cloning vectors for large
genomic DNA fiagments. Unfortunately, YACs also caused difficulties, such as
frequent spontaneous rearrangements and insert instability, and there can be substantial
contamination of purified YACs with yeast DNA (Ramsay, 1994; Schalkwyk et al.,
1995)

Bacterial artificial chromosomes (BACs) are single copy F-factor-based plasmid
vectors that can stably hold 300 kb or more of foreign DNA (Shizuya et al., 1992).
BACs have several advantages over the other methods. First of all, BACs are much
more stable than other vectors, because the strict control of the F-factor replicon
maintains a single copy of the BAC per bacterial cell. This reduces the risk of otherwise
frequent recombination events via repetitive DNA elements present in the DNA inserts
(Kimman et al., 1994; Shizuya et al., 1992). The capacity and stability of BACs enables
the cloning of an entire herpesvirus genome into a single plasmid. Secondly, for
subsequent fimctional genetics study, once a viral genome is cloned into a BAC, it can
be manipulated within E. coli. Utilizing prokaryotic recombinases, such as recA, recE,
recT (Horsburgh et al., 1999; Link et al., 1997; Narayanan et al., 1999) or the mini-
lambda system (Costantino and Court, 2003; Court et al., 2003), site-specific mutations
can be introduced, theoretically anywhere in the viral genome. All mutagenesis steps
can be controlled and analyzed in E. coli, and the manipulated viral genome can be

stably maintained in the E. coli. This is in contrast to the other methods, where the

35

recombination takes place in eukaryotic cells and the analyses can only start after the
virus has been reconstituted and isolated. Unwanted additional changes that may have
occurred in the viral genome, such as deletions, rearrangements or illegitimate
recombinations frequently can only be observed after considerable expense of time and
effort. Finally, it is safer to work with herpesviruses when the viral genome is
maintained as a BAC. These properties have made BACs the vectors of choice for the
cloning of eukaryotic genome libraries, and have attracted herpesvirologists as well.
Several herpesvirus genomes of medical and veterinary importance have been cloned in
BAC since the first infectious BAC of herpesvirus reported in 1997 (Messerle et al.,
1997), including herpes simplex virus (Saeki et al., 1998; Stavropoulos and Strathdee,
1998), Epstein-Barr virus (Delecluse et al., 1998), human cytomegalovirus (Borst et al.,
1999; Marchini et al., 2001; Yu et al., 2002), pseudorabies virus (Smith and Enquist,
1999), equine herpesvirus 1 (Rudolph et al., 2002), and Marek’s disease virus Wiikura

et al., 2006; Schumacher et al., 2000).

2.2 Recombineering

Recombineering is a powerful method for fast and efficient manipulation of the
BAC. (See Figure 2 for overview.) It allows DNA cloned in E. coli to be modified via
lambda (k) Red-mediated homologous recombination, obviating the need for restriction
enzymes and DNA ligases. Specific bacterial strains have been constructed for this
purpose (Lee et al., 2001; Warming et al., 2005; Y‘u et al., 2000). A defective I.

prophage (mini- it) is inserted into their bacterial genome and encodes three genes that

36

make recombineering possible: exo, bet and gam. Exo is a 5'-3' exonuclease that creates
single-stranded overhangs on linear DNA introduced into the bacteria. Bet protects
these overhangs and assists in the subsequent recombination process. Garn prevents
degradation of linear DNA by inhibiting E. coli RecBCD protein. Exo, bet, and gam are
transcribed from the XPL promoter. This promoter is repressed by the temperature-
sensitive repressor c1857 at 32°C and derepressed (the repressor is inactive) at 42°C.
When bacteria containing mini-X prophage are kept at 32°C, no recombination proteins
are produced. However, after 15 minutes of heat shock at 42°C, sufficient amounts of
recombination proteins are produced. Linear DNA (PCR product, oligonucleotide, etc.)
with sufficient homology in the 5' and 3' ends to a target DNA molecule already present
in the bacteria (plasmid, BAC, or the bacterial genome itself) can be introduced into
heat-shocked and electrocompetent bacteria using electroporation. The introduced DNA
will now be modified by Exo and Bet and undergo homologous recombination with the
target molecule. In our case, once a viral genome is cloned into a BAC, it can be easily
and efficiently manipulated within E. coli. Utilizing recombineering techniques, site-
specific mutations can be introduced anywhere in the viral genome, provided that the
genomic sequence is known. All mutagenesis steps can be strictly controlled and
analyzed in E. coli, and the manipulated viral genome can be stably maintained in the E.
coli. This is in contrast to the other methods, where the recombination takes place in
eukaryotic cells and the analyses can only start after the virus has been reconstituted and
isolated. Unwanted additional changes that may have occurred in the viral genome, such
as deletions, rearrangements or illegitimate recombinations frequently can only be

observed after considerable expense of time and effort.

37

In 2006, Tischer et al. published a technique called two-step Red-mediated
recombination, which further improves the efficiency of recombineering. This
technique is suitable for site-specific deletion, insertion, and point mutation. An

overview of this technique is provided in Figure l of Chapter 4.

38

2.3 References

Borst, E.M., Hahn, G., Koszinowski, U.H., Messerle, M., 1999. Cloning of the human
cytomegalovirus (HCMV) genome as an infectious bacterial artificial
chromosome in Escherichia coli: a new approach for construction of HCMV
mutants. J Virol 73, 8320-9.

Costantino, N., Court, D.L., 2003. Enhanced levels of lambda Red-mediated
recombinants in mismatch repair mutants. Proc Natl Acad Sci U S A 100, 15748-
53.

Court, D.L., Swaminathan, 8., Yu, D., Wilson, H., Baker, T., Bubunenko, M., Sawitzke,
J ., Sharan, SK, 2003. Mini-lambda: a tractable system for chromosome and BAC
engineering. Gene 315, 63-9.

Delecluse, H.J., Hilsendegen, T., Pich, D., Zeidler, R., Hammerschmidt, W., 1998.
Propagation and recovery of intact, infectious Epstein-Barr virus from prokaryotic
to human cells. Proc Natl Acad Sci U S A 95, 8245-50.

DeLuca, N.A., Schaffer, P.A., 1985. Activation of immediate-early, early, and late
promoters by temperature-sensitive and wild-type forms of herpes simplex virus
type 1 protein ICP4. Mol Cell Biol 5, 1997-2008.

Horsburgh, B.C., Hubinette, M.M., Qiang, D., MacDonald, M.L., Tufaro, F., 1999.
Allele replacement: an application that permits rapid manipulation of herpes
simplex virus type 1 genomes. Gene Ther 6, 922-30.

Kimman, T.G., De Wind, N., De Bruin, T., de Visser, Y., Voermans, J., 1994.
Inactivation of glycoprotein gE and thymidine kinase or the US3-encoded protein
kinase synergistically decreases in vivo replication of pseudorabies virus and the
induction of protective immunity. Virology 205, 511-8.

Lee, E.C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D.A., Court, D.L.,
Jenkins, N.A., Copeland, N.G., 2001. A highly efficient Escherichia coli-based

chromosome engineering system adapted for recombinogenic targeting and
subcloning of BAC DNA. Genomics 73, 56-65.

Link, A.J., Phillips, D., Church, G.M., 1997. Methods for generating precise deletions
and insertions in the genome of wild-type Escherichia coli: application to open
reading frame characterization. J Bacteriol 179, 6228-37.

Marchini, A., Liu, H., Zhu, H., 2001. Human cytomegalovirus with IE2 (UL122)
deleted fails to express early lytic genes. J Virol 75, 1870-8.

39

Messerle, M., Crnkovic, I., Hammerschmidt, W., Ziegler, H., Koszinowski, U.H., 1997.
Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial
artificial chromosome. Proc Natl Acad Sci U S A 94, 14759-63.

Narayanan, K., Williamson, R., Zhang, Y., Stewart, A.F., Ioannou, P.A., 1999. Efficient
and precise engineering of a 200 kb beta-globin human/bacterial artificial
chromosome in E. coli DHlOB using an inducible homologous recombination
system. Gene Ther 6, 442-7.

Niikura, M., Dodgson, J ., Cheng, H., 2006. Direct evidence of host genome acquisition
by the alphaherpesvirus Marek's disease virus. Arch Virol 151, 537-49.

Ramsay, M., 1994. Yeast artificial chromosome cloning. Mol Biotechnol 1, 181-201.

Rudolph, J ., O'Callaghan, D.J., Osterrieder, N., 2002. Cloning of the genomes of equine
herpesvirus type 1 (EHV-l) strains KyA and racLll as bacterial artificial
chromosomes (BAC). J Vet Med B Infect Dis Vet Public Health 49, 31-6.

Saeki, Y., Ichikawa, T., Saeki, A., Chiocca, E.A., Tobler, K., Ackermann, M.,
Breakefield, X.O., Fraefel, C., 1998. Herpes simplex virus type 1 DNA amplified
as bacterial artificial chromosome in Escherichia coli: rescue of replication-

competent virus progeny and packaging of amplicon vectors. Hum Gene Ther 9,
2787-94.

Schaffer, P.A., 1975. Temperature-sensitive mutants of herpesviruses. Curr Top
Microbiol Irnmunol 70, 51-100.

Schaffer, P.A., Weller, S.K., Pancake, B.A., Coen, D.M., 1984. Genetics of herpes
simplex virus. J Invest Derrnatol 83, 42S-47S.

Schalkwyk, L.C., Francis, F ., Lehrach, H., 1995. Techniques in mammalian genome
mapping. Curr Opin Biotechnol 6, 37-43.

Schumacher, D., Tischer, B.K., Fuchs, W., Osterrieder, N., 2000. Reconstitution of
Marek's disease virus serotype 1 (MDV-1) from DNA cloned as a bacterial

artificial chromosome and characterization of a glycoprotein B-negative MDV-1
mutant. J Virol 74, 11088-98.

Shizuya, H., Birren, 8., Kim, U.J., Mancino, V., Slepak, T., Tachiiri, Y., Simon, M.,
1992. Cloning and stable maintenance of 300-kilobase-pair fragments of human
DNA in Escherichia coli using an F -factor-based vector. Proc Natl Acad Sci U S
A 89, 8794-7.

Smith, G.A., Enquist, L.W., 1999. Construction and transposon mutagenesis in
Escherichia coli of a full-length infectious clone of pseudorabies virus, an
alphaherpesvirus. J Virol 73, 6405-14.

40

Stavropoulos, T.A., Strathdee, C.A., 1998. An enhanced packaging system for helper-
dependent herpes simplex virus vectors. J Virol 72, 7137-43.

Tischer, B.K., von Einem, J ., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated
recombination for versatile high-efficiency markerless DNA manipulation in
Escherichia coli. Biotechniques 40, 191-7.

van Zijl, M., Quint, W., Briaire, J., de Rover, T., Gielkens, A., Berns, A., 1988.
' Regeneration of herpesviruses from molecularly cloned subgenomic fragments. J
Virol 62, 2191-5.

Warming, 8., Costantino, N., Court, D.L., Jenkins, N.A., Copeland, N.G., 2005. Simple
and highly efficient BAC recombineering using galK selection. Nucleic Acids
Res 33, e36.

Yu, D., Ellis, H.M., Lee, E.C., Jenkins, N.A., Copeland, N.G., Court, D.L., 2000. An
efficient recombination system for chromosome engineering in Escherichia coli.
Proc Natl Acad Sci U S A 97, 5978-83.

Yu, D., Smith, G.A., Enquist, L.W., Shenk, T., 2002. Construction of a self-excisable

bacterial artificial chromosome containing the human cytomegalovirus genome
and mutagenesis of the diploid TRL/IRL13 gene. J Virol 76, 2316-28.

41

CHAPTER 3

COMPLETE GENOMIC SEQUENCE AND AN INFECTIOUS BAC CLONE OF

F ELIN E HERPESVIRUS-l (FHV-l)

Tai, S.H., Niikura, M., Cheng, H.H., Kruger, J .M., Wise, A.G., Maes, R.K., 2009.
Complete genomic sequence and an infectious BAC clone of feline herpesvirus-1
(FHV-l), submitted to: Virology.

42

Complete Genomic Sequence and an Infectious BAC Clone of Feline Herpesvirus-1

(FHV-l)

S. H. Sheldon Taia, Masahiro Niikurab’c’l, Hans H. Chenga’c, John M. Krugera’d,

Annabel G. Wisee, Roger K. Maesa’b’e’*

a Graduate Program in Comparative Medicine and Integrative Biology, College of
Veterinary Medicine, Michigan State University, East Lansing, MI 48824, USA

b Department of Microbiology and Molecular Genetics, College of Veterinary Medicine,
Michigan State University, East Lansing, MI 48824, USA

c United States Department of Agriculture, Agricultural Research Service, Avian

Disease and Oncology Laboratory, 3606 East Mount Hope Road, East Lansing, MI

48823, USA

d Department of Small Animal Clinical Sciences, College of Veterinary Medicine,
Michigan State University, East Lansing, MI 48824, USA

c Diagnostic Center for Population and Animal Health, College of Veterinary Medicine,

Michigan State University, 4125 Beaumont Road, Lansing, MI 48910, USA

* Corresponding author. Diagnostic Center for Population and Animal Health, College

of Veterinary Medicine, Michigan State University, 4125 Beaumont Road, Lansing, MI
48910, USA. Fax: +1 517 432 6527.

E-mail address: Maes@dcpah.msu.edu (R.K. Maes).

43

1 Present address: Faculty of Health Sciences, Simon Fraser University, Burnaby, BC,

V5A IS6, Canada.

ABSTRACT

Infection with feline herpesvirus-1 (FHV-l) is a major cause of upper respiratory
and ocular disease in Felidae. We report the first complete genomic sequence of FHV-l,
as well as the construction and characterization of a bacterial artificial chromosome

(BAC) clone of FHV-l, which contains the entire FHV-l genome and has the BAC
vector inserted at the left-hand side (5’-end) of the UL region. Complete genomic

sequences were derived from both the FHV-l BAC clone and purified virion DNA. The
FHV-l genome is 135,797 bp in size with an overall G+C content of 45%. A total of 78
open reading frames were predicted, encoding. 74 distinct proteins. The gene
arrangement is collinear with that of most sequenced varicelloviruses. The virus
regenerated from the BAC was very similar to the parental C-27 strain in vitro in terms
of plaque morphology and growth . characteristics, and highly virulent in cats in a

preliminary in vivo study.

Keywords: Feline herpesvirus; FHV-l; genomic sequence; infectious BAC clone

INTRODUCTION

Feline herpesvirus-1 (FHV-l) is a significant viral pathogen of Felidae, first
isolated in 1957 by Crandell and Maurer (1958). FHV-l accounts for approximately
50% of all diagnosed viral upper respiratory infections in cats and is also a significant
cause of oeular lesions (Nasisse, 1990). The pathobiology of F HV-l has been reviewed
(Gaskell, 2007; Maggs, 2005; Stiles, 2003). Briefly, following entry via the oronasal
route, FHV-l replicates extensively in the mucosae of the upper respiratory tract
resulting in high fever, depression, anorexia, sneezing, conjunctivitis, keratitis, and
ocular and nasal discharge. The acute phase of the disease is followed by life-long
latency, a hallmark of herpesvirus infections. During the latent stage, viral DNA
appears to persist mainly in sensory ganglia. Different biological stresses, or
administration of corticosteroids, can induce the necessary biochemical stimuli in
latently infected cells that lead to renewed production of infectious virus, which can
travel to the periphery and is a potential source of viral transmission. In addition to the
primary disease, FHV-l is also a contributor to feline chronic rhinosinusitis (Johnson
and Maggs, 2005). Despite its high morbidity and worldwide distribution, currently
available vaccines cannot totally protect cats from field virus infection and, as a
consequence, from field virus latency (Gaskell and Povey, 1979; Tharn and Studdert,
1987). In addition, some commercial vaccines are avirulent when administered
subcutaneously, but virulent when administered oronasally (Kruger et al., 1996; Povey,

1979). Since reactivation of latent FHV-l is common, vaccinated cats may act as

45

asymptomatic carriers and contribute to the spread of virulent virus (Gaskell and Povey,
1982)

Our knowledge of FHV -1 at the molecular level is still limited. F HV-l is a member
of Herpesviridae family, Alphaherpesvirinae subfamily, genus Varicellovirus (Davison
et al., 2009). All FHV-l isolates appear to be relatively similar, and belong to one
serotype. The FHV-l genome, mapped by restriction endonuclease digestion techniques,
is approximately 134 kb, and has a typical type D structure similar to other varicelloviruses

(Figure 3.1). The double-stranded DNA genome consists of two segments of unique
sequences, known as Unique Long (UL) and Unique Short (U s)- The Us region is
flanked by a pair of identical but inverted repeat sequences, known as Terminal Repeat
Short (TRS) and Inverted Repeat Short (IRS) (Grail et al., 1991; Rota et al., 1986).

Alphaherpesviruses usually encode 65-80 open reading flames (ORFs) (Alba et al., 2001).
FHV-l has been shown to contain 23 virion-associated proteins (Fargeaud et al., 1984).

Eight glycoproteins have previously been identified and designated as gB, gC, gD, gE, gG,
gH, g1 and gL. Knowledge about the fimctions of these glycoproteins has been reviewed
by Maeda et al. (1998) though it is clear that much more work is needed to define their
actual functions and roles in viral pathogenesis and immunity. In recent years, many
herpesvirus genomes of human and veterinary medical importance have been

completely sequenced and annotated, among them herpes simplex virus types 1 (HSV-1)
(McGeoch et al., 1988) and 2 (HSV-2) (Dolan et al., 1998), varicella-zoster virus (V ZV)
(Davison and Scott, 1986), bovine herpesvirus types 1 (BHV-l) (Schwyzer and
Ackermann, 1996) and 5 (BHV-S) (Delhon et al., 2003), equine herpesvirus types 1

(EHV-l) (Telford et al., 1992) and 4 (EHV-4) (Telford et al., 1998), Marek’s disease

46

virus (MDV) (Lee et al., 2000; Tulman et al., 2000), and pseudorabies virus (PRV)
(Klupp et al., 2004). Prior to this report, only portions of the FHV-l genomic sequence
were available. I

Bacterial artificial chromosomes (BACs) are single copy F-factor-based plasmid
vectors that can stably hold 300 kb or more of foreign DNA (Shizuya et al., 1992). BACs
have advantages over other vectors including higher cloning capacity, greater stability in E.
coli, and the efficiency of manipulation. Because of these advantages, BACs have been
widely used for cloning of entire herpesvirus genomes, and the resulting clones have been
shown to be infectious. Herpesviruses that have been cloned as BACs include HSV-l
(Saeki et al., 1998; Stavropoulos and Strathdee, 1998), Epstein-Barr virus (Delecluse et al.,
1998), human cytomegalovirus (Borst et al., 1999; Marchini etal., 2001; Yu et al., 2002),
PRV (Smith and Enquist, 1999), EHV-l (Hansen et al., 2006; Rudolph et al., 2002), MDV
(Schumacher et al., 2000; Niikura et al., 2006), canine herpesvirus (Arii et al., 2006; Strive
et al., 2006), and FHV—l (Costes etal., 2006).

In this report, we present the first complete and annotated genomic sequence of
FHV-l, as well as a BAC clone that contains the entire FHV-l genome, and is

infectious both in vitro and in vivo.

47

RESULTS

Cloning of the FHV-l genome as a BAC

The C-27 strain F HV-l genome was cloned as a BAC. U54, which encodes gG,
was selected as the target site for the BAC cassette insertion because it has been shown
to be non-essential for virus growth in several alphaherpesviruses (Balan et al., 1994;

Baranowski et al., 1996) including FHV-l (Costes et al., 2006). Analyses later revealed
that the BAC vector was in fact inserted at the genomic termini, or between UL and TRS

in the circular DNA (Figure 3.1). In addition, an unknown sequence of ~2.7 kb in size
was present immediately upstream of the BAC vector.

Restriction pattern analysis was used to examine the overall integrity of the FHV-
l genome in the BAC clone. The SalI digestion pattern of the BAC clone was very
similar to that of the parent strain (Figure 3.2).

In addition to the restriction pattern analysis, PCR assays were used to examine
the insertion of the BAC vector. Using primers targeting different BAC vector
components (Table 3.1), including the enhanced green fluorescence protein (EGFP)
gene (RM0901 and RM0944, or RM0945 and RM0911), the chloramphenicol resistance
gene (RM0955 and RM0956), and the bacterial origin of replication (RM0957 and
RM0958), PCR assays confirmed that the BAC vector was inserted into the FHV-l
genome (data not shown). However, PCR primers targeted to the expected junction
between the BAC vector and the viral sequence (RM0910 and RM0959) failed, and

primers RM0988 and RM0989 amplified the full length of an intact US4. These results

48

suggested that the BAC was inserted into the FHV-l genome, but not into US4 as

intended.

Sequencing of the FHV-l genome
Using “454” next generation sequencing technology, complete genome sequences
were generated de novo for both the viral genomic DNA and BAC clone, and then
compared to one another. The sequence assembly of the BAC clone represented 97.62%
of the entire FHV-l genome with an average read depth of 33x. The assembly of the
viral DNA represented 97.52% of the entire genome with an average read depth of 25x.
To complete the sequences, gaps were filled by primer walking, using both pure

viral DNA and BAC DNA as template. Three major gaps were present in both

assemblies. Gap no. 1 represents the junction of UL and IRS, gap no. 2 was located
inside both IRS and TRS, and gap no. 3 contained the genomic termini, or the junction

of TRS and UL when the genome is circularized. Based on the S011 restriction pattern,

the estimated sizes for gaps l, 2, and 3 were 1.0 kb, 0.6 kb, and 1.0 kb, respectively.
Attempts to close these gaps by primer walking were partially successfirl. Gaps 1 and 3
were completely closed, and the sequence lengths were as predicted. Gap 2 could not be
fully sequenced. Primer walking results revealed that this region contains repetitive
units of very high G+C content (77%). Use of additional sequencing chemistry (i.e.,
dGTP BigDye Terminator) failed to sequence through this gap. The remaining ~314 bp
lacking sequence was tentatively filled with the same repetitive unit found at both ends

of the gap. No ORFs were found inside or spanning these repeats.

49

When sequences derived flom the viral genome and BAC were compared to each

other, they were completely identical, except for the insertion of the BAC vector
between UL and TRS in the BAC clone, an addition of a 2.7-kb fragment (Contig 3) in

the BAC clone, and three aforementioned gaps whose sequence could only be
determined flom the BAC clone. A BLASTN search against the non-redundant
nucleotide collection database nr/nt (Altschul et al., 1997) found that Contig 3 did not
resemble any known herpesvirus sequence. A BLAST search in the WGS Contigs
database of the cat genome project
(http://www.ncbi.nlm.nih.gov/projects/genome/seq/BlastGen/BlastGen.cgi?pid=10703)
revealed that a 219-bp portion near the right hand side (5’-end) of Contig 3 is highly
similar to a genomic region of cat DNA. PCR primers RM1025 and RM1026 (Table 3.1)
targeting sequences near the left hand side (3’-end) of Contig 3 successfully amplified
the same 225-bp sequence flom the DNA of uninfected Crandell-Reese feline kidney
(CRFK) cells (data not shown). Therefore, it is very likely that Contig 3 is a part of the
cat genome, presumably acquired by the virus during the recombination process in
CRFK cells.

The complete, FHV-l genomic sequence was compared to all FHV-l DNA
sequences in GenBank that contained at least one complete gene. The results are
presented in Table 3.2. The DNA sequences were highly similar across strains. The
differences observed were mostly limited to single bases. It was noted that the copy
number of repetitive sequences can vary between strains, or even within the same strain.

The complete DNA sequences of the FHV-l genome and the FHV-l BAC clone

were deposited in GenBank under accessions F J478159 and GU250525 respectively.

 

50

Structure of the FHV-l Genome

The FHV-l genome is 135,797 bp in length. The overall G+C content of FHV-l
genome is 45%. The genome consists of a 106,369 bp UL and a 8,424 bp Us region,

with the former being flanked by an inverted 33-bp sequence, and the latter being

flanked by IRS and TRs elements of 10,469 bp each.

ORF finding, gene content, and gene arrangement

To identify all proteins encoded in the genome, we employed two methods. First,
ORFs encoding proteins of Z 60 amino acids with a methionine start codon were
evaluated for coding potential by searching for homologs in other alphaherpesviruses.
Homology searches were conducted using BLASTX on the non-redundant protein
sequence database nr (Altschul et al., 1997). Other criteria used included compact gene
arrangements on both strands with little gene overlap. To find novel genes in the FHV-l
genome ab initio and as a second approach to verify the annotation, the sequence was
submitted to GeneMarkS (Besemer et al., 2001). GeneMarkS predicted 10 fewer genes,
namely UL3, ULI 1, UL24, UL26.5, UL43, UL53, U52, US6, US8.5, and US9. However,
these genes are consistently present among varicelloviruses (Tables 3.3 and 3.4), and
were easily identified using BLASTX, except for US2. Despite the low degree of
sequence similarity, US2 was also predicted based on relative position similar to other
varicelloviruses.

Table 3.3 lists all FHV-l ORFs predicted in the genomic sequence and

summarizes the characteristics of the predicted gene products. The arrangement of these

51

ORFs in the FHV-l genome is shown in Figure 3.3. Seventy-eight ORFs were predicted

in the FHV-l genome, encoding 74 different proteins, as genes encoding ICP4, U81,
and US10 proteins are found twice, once in the IRS and once in the TRS, and UL15
consists of two ORFs. Seventy-two ORFs are present as single copies with 64 located in

the UL, seven located entirely in the Us, and one that initiates in the Us and ends in the
TRS. Three ORFs are located entirely in the repeat region, each present once in IRS and

once in TRS. All ORF start locations were assumed to be the first possible ATG. The

name of each protein was given based on its homology to HSV-1 and VZV genes. The
predicted properties and functions assigned to each predicted gene were based on those
assigned to other varicelloviruses by Refseq entries in the NCBI database. In addition to
the ORFs listed in Table 3.3, 53 ORFs with a coding capacity of more than 60 amino
acids were identified: 25 were found on the top strand and 28 were on the bottom strand.
However, searches for cellular or viral homologs of these ORFs failed to find any
significant match, and none of these ORFs were considered as strong candidates for
new genes.

Table 3.3 also lists the amino acid sequence similarity of each protein to their
counterparts in the other sequenced varicelloviruses. All F HV-l gene products showed
some degree of homology to the gene products of the other varicelloviruses. Not
surprisingly, genes involved in nucleotide metabolism, DNA replication and packaging
were among the most conserved. Glycoprotein genes were less conserved, although gB
did show a high degree of similarity to gB of the other varicelloviruses. FHV-l proteins
were most similar to homologues of EHV-l and EHV-4, averaging 49.4% and 49.2%

animo acid identity, respectively. Phylogenetic relationships between FHV-l and other

52

varicelloviruses were examined using single glycoprotein and concatenated amino acid
sequence alignments (McGeoch et al., 2000). The results are presented in Figure 3.4
and showed that FHV-l is most closely related to EHV-l and EHV-4.

The arrangement of FHV-l genes is collinear with VZV, BHV-l, BHV-5, EHV-l
and EHV-4. The gene content is highly similar to those of varicelloviruses, especially
EHV-l and -4, with a few exceptions (Table 3.4). FHV-l lacks the homologs of V67
and US5, while both are present in EHV-l and -4. V67 was found in EHV-l, EHV-4,
BHV -1, BHV-S, and VZV, but is absent in PRV. US5, encoding g], was found only in

EHV-l and -4. None of the genes identified were unique to FHV-l.

Polyadenylation signals and splice sites

The PolyADQ program (Tabaska and Zhang, 1999) was used to search for all
potential polyadenylation signals in the FHV-l genome. The search found 323 sites;
each was given a score between 0 and 1. In the PRV study (Klupp et al., 2004),
experimental results were used to determine a cut off score. Since there were very few,
if any, data for the mapping of F HV-l transcripts, every signal was located in the
complete genomic sequence initially. Many signals did not associate with any upstream
gene, while very often multiple signals were found for a given ORF or a set of
coterrninal transcripts. The polyadenylation signals for each gene were annotated based
on the assumption that each transcript either ends near the termination codon or is a
member of a 3’-coterminal family. The ones that are closest to the stop codon and have

the highest scores were annotated.

53

UL15 is made up of two exons and is well conserved among herpesviruses. The
region between and including the two exons of UL15 were submitted to the Neural
Network Splice Site Prediction program conditioned for human splice site recognition
(Reese et al., 1997). The predicted donor site with the highest score (0.98) located 39 bp
upstream flom the end of the first ORF of UL15. The predicted acceptor site with the
highest score (0.99) located between the ORF of ULI 7 and the second ORF of UL15.

The spliced mRNA would encode a protein of 734 amino acids.

Origins of replication and tandem repeats
The origins of replication of herpesviruses are characterized by the presence of an

AT-rich palindromic sequence. EHV -1, EHV-4, and PRV have at least 3 origins of

DNA replication: one copy of OriL found in UL, between ULZI and UL22, and two

copies of OriS found in IRS and TRS (Klupp et al., 2004; Telford et al., 1992; Telford et
al., 1998). In contrast, VZV lacks an OriL (Davison and Scott, 1986). In the FHV-l
genome, the OriS palindrome was found in IRS and TRS. However, no sequence that
resembles an OriL was found in the region between UL21 and UL22. Comparison of the
DNA sequences in this region between the BAC clone and wild type C-27 strain (data
not shown) has ruled out the possibility that a similar palindrome might have been mis-
assembled or deleted during cloning.

Using the Tandem Repeats Finder program (Benson, 1999), eight different types

of tandem repeat elements at 16 locations in the FHV -1 genome were identified (Table
3.5). One tandem repeat element was found in UL, one in Us, and six in IRS/TRS. Four

tandem repeat elements were located near genomic termini. In addition, the Tandem

54

Repeats Finder found an imperfect 78-mer repeat in the ORF of UL44. The two repeat

units have a 91% match with each other.

Reconstitution of virus particles flom BAC clone and excision of the BAC vector

Virus particles were reconstituted flom the BAC by transfecting CRFK cells with
BAC DNA. The reconstituted virus, with the BAC vector in its genome, produced
fluorescent plaques in CRFK monolayers (data not shown). To reduce possible effects
the BAC vector might have on viral growth characteristics and virulence, CRFK cells
were co-transfected with BAC DNA and pcDNA-Cre. pcDNA-Cre expresses Cre
protein, which specifically recognizes the loxP sites flanking the BAC cassette and
EGFP gene, excises them, and re-ligates the DNA leaving a single loxP site (Figure 3.1).
After plaque purification, no fluorescent plaques were found. The excision of BAC
vector was also verified by PCR and sequence analysis (data not shown). The BAC-
excised FHV-l BAC clone, FHVlABAC, was used for subsequent in vitro and in vivo

characterizations.

In vitro characterization of F HVlABAC

To define the in vitro grth characteristics of the BAC-derived virus, plaque
morphologies and multiple-step growth curves for the C-27 strain and FHVlABAC
were compared. Plaques produced by the C-27 strain and F HVlABAC virus are
morphologically undistinguishable flom each other. The average size of 100 plaques
was determined for each virus strain. The mean plaque diameter of the FHVIABAC

virus was 101% of the C-27 parent strain and not significantly different (p = 0.740).

55

Multi-step growth curves were constructed for both the FHVlABAC virus and the
C-27 parent strain (Figure 3.5). At 48 and 72 hours p.i., the FHVlABAC virus grew to
titers 0.5 - 1 logs lower than those of the parent strain. Analysis of the growth curves by
ANOVA indicated that the differences at 48 hours (p = 0.003) and 72 hours p.i. (p =

0.013) were statistically significant.

Preliminary in vivo characterization

In order to investigate possible attenuation resulting flom BAC cloning, a
preliminary challenge experiment was carried out using four specific-pathogen-flee
(SPF) cats. Two cats were inoculated with the F HVlABAC virus, one cat with the C-27
strain (positive control), and another cat was inoculated with cell culture medium
(negative control). The results are summarized in Table 3.6 and Figure 3.6. The
negative control cat did not show any clinical signs throughout the study. The cats
inoculated with the C-27 strain and FHVlABAC virus all developed similar clinical
signs. The cumulative clinical scores of the FHVlABAC-infected cats and the cat
inoculated with the parent strain were comparable. Virus shedding was detected by
virus isolation in the cats inoculated with the C-27 strain and the FHV lABAC virus on
days 3, 6, and 9 p.i. Virus neutralization tests demonstrated that the positive control cat
and the FHVIABAC virus-infected cats all showed seroconversion on day 14 p.i. The
neutralizing antibody titers of the FHVlABAC virus-infected cats and the cat inoculated

with the parent strain were very similar.

56

DISCUSSION

We report here the first BAC clone containing the entire C-27 strain FHV-1
genome that exhibits very high virulence in preliminary in vivo inoculation experiments.
The restriction pattern of this BAC clone was nearly identical to that of the parent C-27
strain with all exceptions being related to the insertion of the BAC vector or
circularization of the genome (Figure 3.2). The size of the genome, derived flom both
the sequence assembly and the restriction pattern analysis, is consistent with the
literature (Rota et al., 1986).

An unexpected 2.7-kb cat DNA was inserted along with the BAC at the genomic
termini. A possible explanation is the fact that herpesviruses can acquire parts of host
genomes, through an unknown mechanism, during virus replication (Niikura et al.,
2006).

The BAC clone-derived FHV-l virus was characterized in vitro by observing its
plaque morphology and comparative growth curve analysis. Plaques produced by the
BAC clone-derived virus were identical in size to those produced by the parent C-27

strain. The comparative growth curve analysis also showed that the BAC clone-derived
virus can grow to > 107 TCleo/ml, which was 0.5-1.0 logs lower than its parent strain

(Figure 3.5). Although the BAC vector was excised flom the genome through Cre-loxP
recombination, parts of the recombination arms, as well as the cellular sequence still
remained. The presence of these sequences, totaling 3.5 kb, might have subtle

influences on virus growth.

57

In a limited in vivo study, the BAC clone-derived virus showed very similar
pathogenicity in the infected cats. The delayed onset of clinical signs and the longer
persistence could be related to the slightly slower replication of the BAC-derived virus,
as shown in the in vitro characterization. However, since the number of cats used was
very small, it could also be just a difference in susceptibility between individuals.
Although the number was very small, the fact that both of the cats developed symptoms
similar to the wild-type strain suggested that the BAC-derived virus is infectious, and its
virulence appears to be similar to that of the parent strain. Moreover, in previous studies,
it was shown that the symptoms induced by FHV-l in experimentally infected cats are
quite consistent (Kruger et al., 1996; Sussman et al., 1995). The fact that this BAC-
derived virus behaves very similarly to its parent strain both in vitro and in vivo makes
it an excellent starting platform for defining the function of individual viral genes,
especially those mediating the virulence of FHV-l.

We also present the first complete and annotated sequence of the FHV-1 genome,
and a complete overview of the molecular composition of FHV-1. Prior to this study,
sequencing efforts were focused on smaller flagrnents of the genome or individual
genes flom various strains. A firll list of FHV-l genes completely sequenced prior to
this report is included in Table 3.2. Envelope glycoprotein genes drew the most interest;
8 out of 11 had been completely sequenced.

The sequence presented in this report was obtained by sequencing both the FHV-l
DNA genome and the FHV-l BAC clone using automated high-throughput
pyrosequencing. This system is rapid, provides high read depth, does not require any

subcloning, and is more economical than traditional Sanger sequencing. One

58

disadvantage of this method is its short read length. Compared to 500-1000 base read
lengths of Sanger sequencing, the read lengths of pyrosequencing averaged 100 bases.
Recently, however, the read length has been improved to ~500 bases. The short read
length poses difficulties for assembly of repetitive sequences, such as the “a” sequences
at the genomic termini. The “a” sequences, which consists complex tandem repeats,
could not be assembled, and had to be resolved by primer walking. Another inherent
problem of pyrosequencing is the difficulty in determining the number of incorporated
nucleotides in homopolymeric regions of 5 or more nucleotides (Ronaghi and Elahi,
2002). Therefore, despite the high redundancy, there is a slight possibility that the
lengths of such repeats in this genomic sequence are not entirely accurate.

The physical structure of the FHV-l genome was first mapped in 1986 when Rota
et al. reported a SalI restriction map of the C-27 strain (Rota et al., 1986). In 1991, Grail
et al. mapped another strain of F HV-l, B927 (Grail et al., 1991). The complete genomic
sequence showed that the gene arrangement in the F HV -1 genome is collinear with that
of many varicelloviruses, including BHV-l, BHV-5, EHV-l, EHV-4, and VZV. The
shuffling of gene blocks found in the PRV genome did not appear in the FHV-1 genome
of this strain. A search for SalI sites in our genomic sequence revealed that the Sall map
of C-27 is very similar to that of the B927 strain, with only a few differences. The
region in the B927 strain where there is a 16.5-kb SalI flagment contains a 13.5- and a
13.6-kb flagment in the C-27 strain. This could explain why the predicted length of the
B927 genome was ~9 kb shorter than our sequence. The second and fourth flagrnents in

the C-27 strain seem to have exchanged their locations in the B927 strain, implying a

possible re-arrangement of the genes, as seen in the PRV genome (Klupp et al., 2004).

59

Most of the FHV-1 ORFs were identified by homology search except for US2 and
US26.5. Due to its low similarity to the counterparts in the other varicelloviruses, USZ
was annotated based on its relative position in the genome, which was similar to the
other varicelloviruses. UL26.5 is in the same reading flame as UL26, but use alternative
start codons. It was also annotated based on its relative position. The ab initio gene
finding program did not identify new genes unique to FHV- 1.

A few alphaherpesviruses, including HSV-1, HSV-2, BHV-l, and PRV, have
evolved genomes with a relatively high G+C content. In these genomes, the third codon
position is particularly biased towards G or C, since it is the most flexible concerning
the amino acid encoded. In PRV, all functional ORFs could be easily identified by
screening for ORFs with a high G+C content on the third nucleotide position of codons
(Klupp et al., 2004). The FHV-l genome has not acquired this characteristic. The
average G+C percentage of FHV-l genome was 45%, one of the lowest among
sequenced varicelloviruses. Therefore, this method was not applicable for FHV-1.

The number of tandem repeats found in the FHV-1 genome is far lower than in
other varicelloviruses. Due to the short read length of the pyrosequencing, it is possible
that multiple copies of the same repetitive unit were assembled into far fewer copies.
However, many of the reiterated elements in varicellovirus genomes are shorter than 50
bp, which means in the sequence assembly there should still be at least two copies, if
they are present, hence detectable by the Tandem Repeats Finder program. Therefore, it
is more likely that the FHV-1 genome does not have as many tandem repeat elements.
In other alphaherpesvirus genomes, tandem repeats are flequently found between two

polyadenylation signals flom convergent transcripts, or within 1 kb flom the genomic

60

termini. Based on the location of the repeats, it was hypothesized that they play possible
roles in insulation against accidental read-through by RNA polymerase into the
oppositely transcribed gene, as well as in the process of genome circulization (Klupp et
al,2004)

In conclusion, the F HV-l BAC clone we report contains the entire FHV-1
genome, the BAC clone-derived virus grows to slightly lower titers in vitro compared to
the C-27 parent strain, and its plaque morphology is not significantly altered.
Preliminary indications are that its in vivo virulence is also similar to that of the C-27
parent strain. Recent advances in recombineering (recombination-mediated genetic
engineering) techniques have made it easier to introduce site-specific mutations into a
BAC clone (Tischer et al., 2006). In addition, random libraries of herpesvirus BAC
mutants can be generated by the use of transposon-mediated insertion mutagenesis
(Brune et al., 1999). These characteristics, along with the availability of the complete
genome sequence, will make the BAC clone an excellent starting platform for future
mutagenesis-based fimctional studies of viral genes and ultimately for future vaccine

developments.

MATERIALS AND METHODS

Cells and Viruses

CRFK cells (ATCC, Manassas, VA) were cultured in Eagle’s Minimum Essential

Medium (EMEM) containing 10% fetal bovine serum (FBS) and 10 ug/ml of

61

ciprofloxacin. The FHV-l prototype strain C-27 (ATCC, Manassas, VA) was
propagated in the CRFK cells and used as wild-type virus throughout this study. The
purified FHV-1 Virions were prepared by pelleting the supernatant through a 20%

potassium tartrate cushion at 24,000 x g for 2 hours at 4°C.

Plasmids and Vectors

The 0.6-kb upstream homologous region, which includes the 3’-end of US3 gene,
the intergenic region of US3 and US4, and the 5’-end of US4 (gG) gene, was amplified
flom purified FHV-1 genomic DNA by PCR using the Extended High Fidelity PCR
System (Roche Applied Science, Indianapolis, IN) with the following primers: RM0874,
which contains a MIuI site at the 5’-end; and RM0875, which contains a SwaI site, a
BerI site, and a loxP site at the 5’-end (Table 3.1). The PCR product was cloned into a
pCRH vector (Invitrogen, Carlsbad, CA), resulting in pCRII-UgG.

The 1.0-kb downstream homologous region, which includes the intergenic region
of US4 (gG) and US6 (gD), and the 5’-end of US6 (gD) gene, was amplified flom
purified FHV-l genomic DNA by PCR using the Extended High Fidelity PCR System
with the following primers: RM0876, which contains a HindIII site, a SalI site, and a
loxP site at the 5’-end; and RM0877, which contains a MluI site at the 5’-end (Table
3.1). The PCR product was also cloned into a pCRII vector, resulting in pCRII-DgG.

pCRH-EGFPmZ was constructed as follows. The vector pEGFP-Nl (Clontech
Laboratories, Mountain View, CA) was digested by XhoI and SalI and re-ligated,
eliminating X7201, SacI, HindIII, and SaII sites. The 1.6-kb region containing the

modified EGFP expression cassette, which includes the CMV immediate early promoter,

62

the EGFP ORF, and SV40 early mRNA polyadenylationsignal, was amplified from the
modified pEGFP-Nl by PCR using Extended High Fidelity PCR System with the
following primers: RM0872, which contains a BszWI site at the 5’-end; and RM0873,
which contains a Sad and SalI site at the 5’-end (Table 3.1). The PCR product was
cloned into a pCRII vector, resulting in pCRII-EGFPmZ.

pGEM3Zf-DUgG2, which contains two homologous regions and two loxP sites,
was constructed by ligation of the following flagrnents: the MIuI-SwaI flagment of
pCRII-UgG; the HindIII-Mlul flagment of pCRH-DgG; and the pGEM-3Zf vector
(Promega, Madison, WI), digested with HindIII and SmaI.

pGEM3Zf-DUgGEGFP2, which contains two homologous regions, two loxP sites,
and a EGFP expression cassette, was constructed as follows: pCRII-EGFPm2 was
digested with BsiWI and Sacl, and the fragment containing EGFP expression cassette
was ligated with pGEM3Zf-DugG2, also digested with BsNVI and SacI.

To target the BAC cassette insertion site to US4, the BAC vector pBAC04, which
contains the BAC cassette, two (upstream and downstream) homologous recombination
arms between two loxP sites and an EGFP expression cassette, was constructed as
follows. The BAC vector pBeloBACll (Invitrogen, Carlsbad, CA) was digested with
SalI and dephosphorylated; the 6.4-kb flagment was purified and ligated with the SalI
flagment of pGEM3Zf-DUgGEGFP2.

To construct pcDNA-Cre, a plasmid that expresses Cre recombinase, the entire
ORF of Cre was excised by KpnI and SmaI digestions flom pGIKS-Cre (ATCC,
Manassas, VA) and ligated with pcDNA3.1 vector (Invitrogen, Carlsbad, CA), digested

with KpnI and EcoRV.

63

All the plasmid constructs were verified by both restriction digestion and
sequencing. pBAC04 was transformed into the E. coli strain DHlOB (Invitrogen,
Carlsbad, CA). All the other constructs were transformed into the E. coli strains TOP10
or DHSa (both flom Invitrogen). The transformants were plated on selective agar that

contained 75 ug/ml of ampicillin or 34 ug/ml of chloramphenicol.

DNA Extraction

Pure viral genomic DNA was prepared as follows: Purified Virions were
incubated in lysis buffer (0.1 M Tris-Cl, pH8.0, 1 mM EDTA, 1% SDS) with 50 ug/ml
proteinase K at 37°C. DNA was subsequently extracted with phenol-chloroform-
isoamylalcohol (25:24: 1), and precipitated with 100% ethanol. Care was used to avoid
shearing the DNA. High copy number plasmids were extracted using the Plasmid Mini
Kit (Qiagen, Valencia, CA). Small-scale BAC DNA purifications were carried out using
the alkaline lysis method (Sambrook and Russell, 2001). Large-scale and high-purity
BAC DNA purifications were carried out using the Large Construct Kit (Qiagen,

Valencia, CA) following the manufacturer’s instructions.

BAC Cloning

The strategy used for cloning FHV-1 genome as a BAC exploits spontaneous
homologous recombinations in the transfected CRFK cells, and was similar to those
used in previous reports (Costes et al., 2006; Niikura et al., 2006). To reduce possible
sequence alterations during in vitro passage in cell culture, low-passage C-27 strain

virus (P4) was used for BAC cloning. Purified FHV-1 genomic DNA and pBAC04

64

were co-transfected into CRFK cells using Lipofectamine 2000 (Invitrogen, Carlsbad,
CA) according to the manufacturer’s instructions. The supernatant of co-transfected
cells was collected for plaque assay and plaques were examined for EGFP expression.
One virus clone that consistently produced fluorescent plaques was obtained. After two
times of plaque purification, CRFK cells were inoculated with this virus clone, and the
circular form replication intermediate of the virus genome was extracted from the cells
using the method of Hirt (1967) and transformed into E. coli DHlOB cells. Colonies
growing on the chloramphenicol plate were examined for the presence of F HV-l
genome and BAC vector by restriction pattern analysis and PCR. A clone that had a
SalI pattern representative of most bacterial clones and most similar to that of the C-27

strain was used for all subsequent studies.

Reconstitution of infectious virus flom BAC
The CRFK cells were co-transfected with 1 pg of the BAC DNA and 1 ug of
pcDNA-Cre using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the

manufacturer’s instructions.

Sequencing, sequence assembly and gap closure

The majority of the sequence was determined by shotgun sequencing, using the
high-throughput pyrosequencing instrument Genome Sequencer 20 (Roche Applied
Science, Indianapolis, IN) at the Genomics Core of Michigan State University’s
Research Technology Support Facility (RTSF). The reads were assembled using the

Newbler assembly program (Roche Applied Science, Indianapolis, IN) at the

65

Bioinforrnatics Core of RTSF. Gaps were closed by primer walking. Gap closure was
carried out using BigDye Terminator 3.0 and dGTP BigDye Terminator chemistries and

Gene Analyzer 3100 (Applied Biosystems, Foster City, CA).

ORF finding and sequence analysis

To identify the genes encoded in the FHV-1 genome, all potential ORFs with a
minimum length of 60 codons and a methionine as start codon were analyzed for
homology to known proteins using BLASTX against non-redundant protein database
(Altschul et al., 1997). To find novel genes in the FHV-l genome ab initio, and as a
second approach to verify the annotation, the sequence was submitted to GeneMarkS
(Besemer et al., 2001). To search for polyadenylation signals, the FHV-l genome
sequence was submitted to PolyADQ, a eukaryotic polyadenylation signal search
engine (Tabaska and Zhang, 1999). The Neural Network Splice Site Prediction program
conditioned for human splice site recognition (Reese et al., 1997) was used to identify
possible splice donor and acceptor sites of UL15. The Tandem Repeats Finder program
(Benson, 1999) was used to search for tandem repeats. Phylogenetic analyses were

carried out using the MEGA4 software (Tamura et al., 2007).

Plaque Morphology
One hundred fifty TCID50 units of the virus were inoculated on CRFK

monolayers. Afier one-hour adsorption, the diluted viruses were removed, and flesh

grth medium added. The cells were then incubated at 37°C in an atmosphere of 5%

C02. After 40 hours of incubation, 100 plaques produced by each virus were

66

photographed and the diameters determined using the QCapture software (QIrnaging,

Surrey, BC, Canada). The measurements were analyzed by AN OVA.

Multiple-step Growth Curve

The wild type virus and the BAC clone were inoculated on CRFK monolayers in
triplicate at an moi. of 0.01. After one-hour adsorption, the diluted viruses were
removed and the cells overlaid with flesh medium. The first supernatant samples were
collected at this time as 0 hour p.i. The monolayers were then incubated at 37°C in an

atmosphere of 5% C02. Supematants were collected at 0, 6, 24, 48, and 72 hours p.i.

and stored at -80°C until titration. The mean titers of each time point were analyzed by

ANOVA.

Cats

Four 12-week old, female SPF cats were used (Liberty Research, Waverly, NY).
Cats were housed in individual cages in rooms with controlled temperature, humidity,
and lighting. They were fed a combination of dry and moist diets. Each group of cats

was housed in a separate Biocontainment Level-2 room. All cats were acclimated for 13

days before virus exposure. Two cats were inoculated oronasally with 2 x 105 TCID50
of the FHVlABAC. The other two cats were either inoculated oronasally with 2 x 105

TCID50 of the C-27 strain wild type virus (positive control) or Eagle’s Minimum

Essential Medium (negative control). The titers were re-checked prior to inoculation.
Clinical signs induced by inoculation of the viruses were scored as described in the

USDA Supplemental Assay Method 311 (U .S. Department of Agriculture, Animal and

67

Plant Health Inspection Service, National Animal Veterinary Services Laboratory, 1985;
Table 3.1). Oral swabs were collected flom each cat at days 0, 3, 6, 9, 14, and 21 p.i. for
virus isolation. Serum samples were collected flom each cat at days 0, 14, and 21 p.i.
for virus neutralization testing. The cat study was reviewed and approved by the

Institutional Animal Care and Use Committee at Michigan State University.

ACKNOWLEDGEMENTS

This research was funded by the Companion Animal Fund and the Center for
Feline Health and Well-Being at Michigan State University’s College of Veterinary
Medicine. We would like to thank Dr. Jeff Landgraf, Kevin Carr, Colleen Curry, and
Shari Tjugum-Holland at the Research Technology Supporting Facility at Michigan
State University, for nucleotide synthesis, pyrosequencing and Newbler assembly, all of
which were invaluable for the completion of this project. We would also like to thank
Torn Goodwill and Laurie Molitor for their excellent technical assistance in Sanger
sequencing, Dr. Henry Hunt for supply of materials used in the BAC cloning, Janice
Forcier for assistance in the in vivo experiment, Crystal Passmore for assistance in the
VN tests, Dr. Patricia Schenck for advice on statistical tests, and Dr. Vilma Yuzbasiyan-

Gurkan for helpful discussions and critical reading of the manuscript.

68

REFERENCES

Alba, M.M., Das, R., Orengo, C.A., Kellam, P., 2001. Genomewide function
conservation and phylogeny in the Herpesviridae. Genome Res. 11, 43-54.

Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J ., Zhang, 2., Miller, W., Lipman,
D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucleic Acids Res. 25, 3389-3402.

Arii, J., Hushur, O., Kato, K., Kawaguchi, Y., Tohya, Y., Akashi, H., 2006.
Construction of an infectious clone of canine herpesvirus genome as a bacterial
artificial chromosome. Microbes Infect. 8, 1054-1063.

Balan, P., Davis-Poynter, N., Bell, S., Atkinson, H., Browne, H., Minson, T., 1994. An
analysis of the in vitro and in vivo phenotypes of mutants of herpes simplex virus

type 1 lacking glycoproteins gG, gE, gI or the putative gJ. J. Gen. Virol. 75, 1245-
1258.

Baranowski, E., Keil, G., Lyaku, J., Rijsewijk, F.A., van Oirschot, J.T., Pastoret, P.P.,
Thiry, E., 1996. Structural and functional analysis of bovine herpesvirus 1 minor
glycoproteins. Vet. Microbiol. 53, 91-101 .

Benson, G., 1999. Tandem repeats finder: a program to analyze DNA sequences.
Nucleic Acids Res. 27, 573-580.

Besemer, J ., Lomsadze, A., Borodovsky, M., 2001. GeneMarkS: a self-training method
for prediction of gene starts in microbial genomes. Implications for finding
sequence motifs in regulatory regions. Nucleic Acids Res. 29, 2607-2618.

Borst, E.M., Hahn, G., Koszinowski, U.H., Messerle, M., 1999. Cloning of the human
cytomegalovirus (HCMV) genome as an infectious bacterial artificial

chromosome in Escherichia coli: a new approach for construction of HCMV
mutants. J. Virol. 73, 8320-8329.

Brune, W., Menard, C., Hobom, U., Odenbreit, S., Messerle, M., Koszinowski, U.H.,
1999. Rapid identification of essential and nonessential herpesvirus genes by
direct transposon mutagenesis. Nat. Biotechnol. 17, 360-364.

Czostes, B., Thirion, M., Dewals, B., Mast, J ., Ackermann, M., Markine-Goriaynoff, N.,
Gillet, L., Vanderplasschen, A., 2006. Felid herpesvirus 1 glycoprotein G is a

structural protein that mediates the binding of chemokines on the viral envelope.
Microbes Infect. 8, 2657-2667.

69

Crandell, R.A., Maurer, RD, 1958. Isolation of a feline virus associated with
intranuclear inclusion bodies. Proc. Soc. Exp. Biol. Med. 97, 487-490.

Davison, A.J., Eberle, R., Ehlers, B., Hayward, G.S., McGeoch, D.J., Minson, A.C.,
Pellett, P.E., Roizman, B., Studdert, M.J., Thiry, E., 2009. The order
Herpesvirales. Arch Virol 154, l71-7.

Davison, A.J., Scott, J .E., 1986. The complete DNA sequence of varicella-zoster virus.
J. Gen. Virol. 67, 1759-1816.

Delecluse, H.J., Hilsendegen, T., Pich, D., Zeidler, R., Hammerschmidt, W., 1998.
Propagation and recovery of intact, infectious Epstein-Barr virus flom prokaryotic
to human cells. Proc. Natl. Acad. Sci. U. S. A. 95, 8245-8250.

Delhon, G., Moraes, M.P., Lu, 2., Afonso, C.L., Flores, E.F., Weiblen, R., Kutish, G.F.,
Rock, D.L., 2003. Genome of bovine herpesvirus 5. J. Virol. 77, 10339-10347.

Dolan, A., Jamieson, F.E., Cunningham, C., Barnett, B.C., McGeoch, D.J., 1998. The
genome sequence of herpes simplex virus type 2. J. Virol. 72, 2010-2021.

F argeaud, D., Jeannin, C.B., Kato, F., Chappuis, G., 1984. Biochemical study of the
Feline Herpesvirus 1. Identification of glycoproteins by affinity. Arch. Virol. 80,
69-82.

Gaskell, R., Dawson, 8., Radford, A., Thiry, E., 2007. Feline herpesvirus. Vet. Res. 38,
337-354.

Gaskell, R.M., Povey, R.C., 1979. Feline viral rhinotracheitis: sites of virus replication
and persistence in acutely and persistently infected cats. Res. Vet. Sci. 27, 167-
174.

Gaskell, R.M., Povey, R.C., 1982. Transmission of feline viral rhinotracheitis. Vet. Rec.
111, 359-362.

Grail, A., Harbour, D.A., Chia, W., 1991. Restriction endonuclease mapping of the
genome of feline herpesvirus type 1. Arch. Virol. 116, 209-220.

Hansen, K., Napier, I., Koen, M., Bradford, S., Messerle, M., Bell, E., Seshadri, L.,
Stokes, H.W., Birch, D., Whalley, J .M., 2006. In vitro transposon mutagenesis of
an equine herpesvirus 1 genome cloned as a bacterial artificial chromosome. Arch.
Virol. 151, 2389-2405.

Hirt, B., 1967. Selective extraction of polyoma DNA flom infected mouse cell cultures.
J. Mol. Biol. 26, 365-369.

70

101

M

N]

Pc

R:

R0

Johnson, L.R., Maggs, D.J., 2005. Feline herpesvirus type-l transcription is associated
with increased nasal cytokine gene transcription in cats. Vet. Microbiol. 108, 225-
233.

Klupp, B.G., Hengartner, C.J., Mettenleiter, T.C., Enquist, L.W., 2004. Complete,
annotated sequence of the pseudorabies virus genome. J. Virol. 78, 424-440.

Kruger, J.M., Sussman, M.D., Maes, R.K., 1996. Glycoproteins g1 and gE of feline
herpesvirus-1 are virulence genes: safety and efficacy of a gl-gE deletion mutant
in the natural host. Virology 220, 299-308.

Lee, L.F., Wu, P., Sui, D., Ren, D., Kamil, J., Kung, H.J., Witter, R.L., 2000. The
complete unique long sequence and the overall genomic organization of the GA
strain of Marek's disease virus. Proc. Natl. Acad. Sci. U. S. A. 97, 6091-6.

Maeda, K., Horimoto, T., Mikami, T., 1998. Properties and functions of feline
herpesvirus type 1 glycoproteins. J. Vet. Med. Sci. 60, 881-888.

Maggs, D.J., 2005. Update on pathogenesis, diagnosis, and treatment of feline
herpesvirus type 1. Clin. Tech. Small Anim. Pract. 20, 94-101.

Marchini, A., Liu, H., Zhu, H., 2001. Human cytomegalovirus with IE-2 (UL122)
deleted fails to express early lytic genes. J. Virol. 75, 1870-1878.

McGeoch, D.J., Dahymple, M.A., Davison, A.J., Dolan, A., Frame, M.C., McNab, D.,
Perry, L.J., Scott, J .E., Taylor, R, 1988. The complete DNA sequence of the long

unique region in the genome of herpes simplex virus type 1. J. Gen. Virol. 69,
1531-1574.

McGeoch, D.J., Dolan, A., Ralph, A.C., 2000. Toward a comprehensive phylogeny for
mammalian and avian herpesviruses. J. Virol. 74, 10401-6.

Nasisse, MP, 1990. Feline herpesvirus ocular disease. Vet. Clin. North Am. Small
Anim. Pract. 20, 667-680.

Niikura, M., Dodgson, J ., Cheng, H., 2006. Direct evidence of host genome acquisition
by the alphaherpesvirus Marek's disease virus. Arch. Virol. 151, 537-549.

Povey, R.C., 1979. A review of feline viral rhinotracheitis (feline herpesvirus 1
infection). Comp. Immunol. Microbiol. Infect. Dis. 2, 373-387.

Reese, M.G., Eeckman, F.H., Kulp, D., Haussler, D., 1997. Improved splice site
detection in Genie. J. Comput. Biol. 4, 311-323.

Ronaghi, M., Elahi, E., 2002. Discovery of single nucleotide polymorphisms and
mutations by pyrosequencing. Comp. Funct. Genomics. 3, 51-56.

71

Rota, P.A., Maes, R.K., Ruyechan, W.T., 1986. Physical characterization of the genome
of feline herpesvirus-l. Virology 154, 168-179.

Rudolph, J ., O'Callaghan, D.J., Osterrieder, N., 2002. Cloning of the genomes of equine
herpesvirus type 1 (EHV-l) strains KyA and racLll as bacterial artificial
chromosomes (BAC). J. Vet. Med. B Infect. Dis. Vet. Public Health 49, 31-36.

Saeki, Y., Ichikawa, T., Saeki, A., Chiocca, E.A., Tobler, K., Ackermann, M.,
Breakefield, X.O., Fraefel, C., 1998. Herpes simplex virus type 1 DNA amplified
as bacterial artificial chromosome in Escherichia coli: rescue of replication-

competent virus progeny and packaging of amplicon vectors. Hum. Gene Ther. 9,
2787-2794.

Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual. Cold
Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Schumacher, D., Tischer, B.K., Fuchs, W., Osterrieder, N., 2000. Reconstitution of
Marek's disease virus serotype 1 (MDV-1) flom DNA cloned as a bacterial

artificial chromosome and characterization of a glycoprotein B-negative MDV-l
mutant. J. Virol. 74, 11088-11098.

Schwyzer, M., Ackermann, M., 1996. Molecular virology of ruminant herpesviruses.
Vet. Microbiol. 53, 17-29.

Shizuya, H., Birren, B., Kim, U.J., Mancino, V., Slepak, T., Tachiiri, Y., Simon, M.,
1992. Cloning and stable maintenance of 300-kilobase-pair flagments of human

DNA in Escherichia coli using an F-factor-based vector. Proc. Natl. Acad. Sci. U.
S. A. 89, 8794-8797.

Smith, G.A., Enquist, L.W., 1999. Construction and transposon mutagenesis in
Escherichia coli of a full-length infectious clone of pseudorabies virus, an

alphaherpesvirus. J. Virol. 73, 6405-6414.

Stavropoulos, T.A., Strathdee, C.A., 1998. An enhanced packaging system for helper-
dependent herpes simplex virus vectors. J. Virol. 72, 7137-7143.

Stiles, J., 2003. Feline herpesvirus. Clin. Tech. Small Anim. Pract. 18, 178-185.

Strive, T., Hardy, C.M., French, N., Wright, J.D., Nagaraja, N., Reubel, G.H., 2006.
Development of canine herpesvirus based antifertility vaccines for foxes using
bacterial artificial chromosomes. Vaccine 24, 980-988.

Sussman, M.D., Maes, R.K., Kruger, J.M., Spatz, S.J., Venta, P.J., 1995. A feline

herpesvirus-l recombinant with a deletion in the genes for glycoproteins g1 and
gE is effective as a vaccine for feline rhinotracheitis. Virology 214, 12-20.

72

Tabaska, J .E., Zhang, M.Q., 1999. Detection of polyadenylation signals in human DNA
sequences. Gene 231, 77-86.

Tamura, K., Dudley, J ., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24, 1596-1599.

Telford, E.A., Watson, M.S., McBride, K., Davison, A.J., 1992. The DNA sequence of
equine herpesvirus-1. Virology 189, 304-316.

Telford, E.A., Watson, M.S., Perry, J., Cullinane, A.A., Davison, A.J., 1998. The DNA
sequence of equine herpesvirus-4. J. Gen. Virol. 79, 1197-1203.

Tham, K.M., Studdert, M.J., 1987. Clinical and immunological responses of cats to
feline herpesvirus type 1 infection. Vet. Rec. 120, 321-326.

Tischer, B.K., von Einem, J ., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated
recombination for versatile high-efficiency markerless DNA manipulation in
Escherichia coli. Biotechniques 40, 191-197.

Tulman, E.R., Afonso, C.L., Lu, Z., Zsak, L., Rock, D.L., Kutish, G.F., 2000. The
genome of a very virulent Marek's disease virus. J. Virol. 74, 7980-7988.

Yu, D., Smith, G.A., Enquist, L.W., Shenk, T., 2002. Construction of a self-excisable

bacterial artificial chromosome containing the human cytomegalovirus genome
and mutagenesis of the diploid TRL/IRL13 gene. J. Virol. 76, 2316-2328.

73

TABLES

Table 3.1 List of primers used in this study

 

 

 

 

Primer Sequence 45' - 3)

BAC Construction

RM0872 QQTAQ GTAGTTATTAATAGTAATCAATTACGG

RM0873 QTQQAC GAGCTCACGCCTTAAGATACATTGATGAG

RM0874 ACGCGTGAATI'CCCAGGCGACCCGAC

RM0875 ATTTAAAT CGTACGA TAACTTCG TA TAA TG TA TGC
TA TA C GAA G TTA TTATCTCTGGTGATCTTGAAGAG

RM0876 AAGCTT GTCGACA TAA C ITC G TA TAG CA TA CA TTA
TA C GAA G TTA TTAAACTGATTAAATTTAATTAAAG

RM0877 MGAGATAGTTGTACCATAAAATCTG

Sequence verification of the transfer plasmid BA C 04

RM0898 CAA'ITTCACACAG GAAACAG

RM0899 ACGGATTTTTAAGCACACCA

RMOQOO TATTCGAAC CATACAACTATC

RM0903 AAGGCGATTAAGTTGGGTA

RM0904 GTTGGGGTCTTTGCTCAGGG

RM0905 AAGAAGTCGTG CTGCTTCATG

RM0906 GGAGTTGTTACGACATTITGG

RM0907 TTACTATGGGAACATACGTC

PCR Assays

RM0901 ATACGATTGTATGTCAAAATAC

RM091O AACGGAGTAACCTCGGTGTG

RM091 1 AATGCTTAATGAATTACAACAG

RM0944 GCGTTACTATGGGAACATAC

RM0945 ATCAGCCATACCACATTTGTAG

RM0955 ACCAATTCTCATGTTTGACAGC

RM0956 ATCGGCACGTAAGAGGTTCC

RM0957 TGGACAGAACAACCTAATGAAC

RM0958 ATGACAGATCCATGTGAAGTG

RM0959 TAATCACGAG CTCCATCAAGGC

RM0988 ATTACGTITATTGGACCCGAG

RM0989 TGAGACTTTAATTAAATI'TAATCAG

RM1 025 ACTTCTTTTCTACTTGCCCTGG

RM1026 TAACCCCAGCTTAAACAGAAC

 

Restriction sites are underlined; loxP sites are in italic.

74

Table 3.1, continued

Primer

Sequence (5‘ — 3’)

Gap closure by primer walking

RM1023
RM1024
RM1027
Rm1028
RM1037
RM1038
RM1039
RM1040
RM1041
GTS565
GT8569
RM1240
RM1242
RM1243
RM1244
RM1245
RM1246

AATATCACCCCGGTAAACGACAC
ACTTCCTGGAATAATGCACATC
GTT'ITI'GTTAATACTTCTGTGGAT
AGTATATATAAACCCTACCTACG
ACACCTCTCGCTTCTCCTCTGAC
TCAGAGACGAAACTGCTCGCATAG
AATAGTTAT'IT'I'I'ATCTCACATGC
CCTCCGCGGGTTCTAAAACTTG
GAGGACGCGGAGAGTGGATGGTTC
CATATTCAAATCTGGCCTAAT
AGATTTGAATATTTACTGATGTGA
TCCTTATTAGGCCAGATTGAATATG
TCTACATATGAATAGTAGATTTGAATA'ITTACT
TATTTACTGATGTGATAACTCGATCC
GGGGGAAAAAAATTGAGTTGGAGCTC
TGAGTTGGAGCTCAGTCTCCATATACG
CATATACGGAGGTGGACAGTGTAG

Restriction sites are underlined; loxP sites are in italic.

75

Table 3.2 Comparison of the complete FHV-l genomic sequence with sequences
available in GenBank

 

 

 

X98449

. Encoded genes
Strain or Sequence . . . Sequence
Am“ N°' isolate length (nt) “’“h mp'ete w'th '"gggnp'ete identity (%) ”“95
D14563 62620 3.038 UL45 UL46. UL44 99.9
GM036023 N/A 10,803 UL45. UL44. UL46. UL39 99.6
UL43, UL42.
UL41, UL40
Ax018721 N/A 2,956 UL45. UL44 UL46. UL43 99.9
AR018958, N/A 1,007 UL45 UL46. UL44 99.9
158415
086616 07301 2.337 UL44 UL45 99.8
AX244515. N/A 1,602 UL44 — 99.9
80396132
M006454 8927 5,587 UL40. UL39 UL41, UL38 99.4
N224971 8927 4.848 UL30 UL31, UL29 99.5
866371 C-27 3,340 UL27 UL28 99.5
849775 C7301 3.240 UL27 UL28 99.8
AX24451 1. N/A 2,829 UL27 — 99.7
BD396130
GM981 1 19 N/A 2,847 UL27 — 99.8
E12463 N/A 1,619 UL23 UL24. UL22 99.9
M26660 UCD 1.619 UL23 UL24. UL22 100.0
864566 C7301 3.746 ‘ UL22 UL23. UL21 100.0
A8112595 00-035 3.007 UL17 UL16 100.0
AF022391 C-27 4.918 UL2. UL1. ICPO UL3 99.4 21-mer repeat: >11 vs
11 copies
DQ452613 Taichung 1 882 UL2 — 99.7
D30766 C7301 6.175 ICPO — 100.0 20-mer repeat: 20.1 vs
6.1 copies
AY740677 8927 3.127 U84 U83, U86 99.9 16-mer repeat 3 vs 12
copies
872415 C-27 6.208 U84. U86, U87. U83. U88.5 99.6 16-mer mpeat: 13 vs
U88 12 copies
D3076? C7301 2.317 U86 U84, U87 100.0 16-mer repeat: 7 vs 12
copies
042113 62620 8.276 U86, U87. U88. U84 99.9 16-mer repeat: 9 vs 12
U885. U89. copies
U810. U81
AX244521. N/A 1,122 US6 — 100.0
80396135
GM981 120 N/A 1,125 U86 — 99.7
A37005. N/A 6,154 U87, U88, — 99.9
AR281844 U885. U89.
U810. U81
X98448 8927 1.155 U87 — 99.7
8927 1,599 U88 — 100.0

 

76

Table 3.3 Predicted FHV-l ORFs

 

 

 

77

Protein Length aa identity (%) Predicted function or
(aa) EHV-1 EHV-4 8HV-1 8HV-5 PRV vzv property
UL56 203 22.9 23.2 N/A N/A 10.5 19.7 membrane protein UL56
V1 144 27.0 23.9 N/A N/A NlA 15.3 membrane protein V1
myristyiated tegument
CIRC 278 32.0 31.7 31.5 31.5 N/A 26.1 protein CIRC
UL55 209 47.5 46.0 N/A N/A NlA 33.9 nuclear protein UL55
multifunctional expression
UL54 438 40.7 41.8 42.1 42.5 42.1 30.8 regulator
UL53 344 44.9 46.1 34.0 33.2 34.3 42.6 envelope glycoprotein K
UL52 1,062 46.1 47.3 40.5 43.0 43.9 39.9 gjgfiifte‘pmase pnmase
UL51 242 46.4 46.6 38.7 37.8 41.6 38.6 tegument protein UL51
deoxyuridine
UL50 325 38.8 38.8 32.8 34.1 36.7 27.7 tripho s ph at a s e
UL49.5 95 40.0 41.1 31.5 35.2 35.2 32.2 envelope glycoprotein N
UL49 345 26.2 26.8 26.7 23.6 27.3 19.9 tegument protein VP22
transactivating tegument
UL48 447 54.6 54.4 44.0 43.7 46.6 42.6 protein VP16
UL47 858 39.3 38.4 29.5 30.8 31.6 19.5 tegument protein VP13I14
UL46 720 38.8 38.8 31.0 30.7 28.5 27.9 tegument protein VP11/12
UL45 193 28.3 28.3 N/A N/A N/A N/A membrane protein UL45
UL44 534 32.1 30.9 29.0 28.2 20.0 28.3 envelope glycoprotein C
UL43 415 40.3 39.4 27.3 26.7 22.5 24.1 envelope protein UL43
DNA polymerase
UL42 395 38.7 39.8 30.5 28.7 27.5 24.1 p r oce s sivity subunit
tegument host shutoff
UL41 453 59.6 59.4 52.4 52.6 56.6 40.8 protein
ribonucleotide reductase
UL40 331 67.0 66.2 65.6 68.3 70.3 64.4 subunit 2
UL39 786 64.6 64.7 57.9 56.5 61.2 52.9 gfigflflgfiwde '°°”°t°°°
UL38 463 50.6 50.9 45.8 44.2 48.2 40.6 capsid triplex subunit 1
UL37 1,027 43.9 43.8 34.0 33.5 37.2 32.2 tegument protein UL37
UL36 3,033 42.5 42.6 33.9 34.2 34.9 32.3 large tegument protein
UL35 108 46.7 43.9 50.0 49.1 54.0 36.8 small capsid protein
01.34 271 49.8 48.5 44.4 42.0 44.2 44.1 33;?" °9'°°° m°"'°'°”°
UL33 123 46.3 45.0 49.1 49.5 45.0 39.0 Bfgpad‘aging °’°t°i"
UL32 582 54.3 53.8 48.8 49.6 53.4 52.6 Bfgpawaging °'°‘°i"
nuclear egress lamina
UL31 337 63.4 62.5 54.1 52.8 61.0 55.3 protein
UL30 1.205 64.9 65.1 59.0 59.4 62.7 56.7 Elifirpitolymerase °°‘°'V"°

Table 3.3, continued

 

protein Length 33 identity (%) Predicted function or
(88) EHV-1 EHV-4 8HV-1 env-5 PRV vzv property

 

 

single-stranded DNA-
UL29 1,200 66.2 66.2 57.7 57.5 59.9 54.4 binding protein

DNA packaging terminase
UL28 779 57.8 59.0 51.3 51.6 53.8 50.5 subunit2

UL27 948 58.2 59.1 59.2 59.1 59.4 53.2 envelope glycoprotein B
V32 130 47.2 43.0 N/A N/A N/A 36.9 protein V32
UL26.5 294 37.3 36.0 21.4 23.2 16.2 26.0 capsid scaffold protein

capsid maturation
UL26 598 49.1 47.3 39.6 40.0 42.0 34.4 protease

DNA acka in te ument
UL25 623 56.1 55.1 52.0 52.0 49.7 49.2 ”0,6,5" UL295 9 9

UL24 260 48.6 50.2 38.1 37.6 55.6 36.2 nuclear protein UL24
UL23 343 47.4 48.0 37.9 36.9 47.3 35.3 thymidine kinase

UL22 821 33.8 33.1 30.0 29.5 27.4 29.0 envelope glycoprotein H
UL21 527 47.5 46.9 35.2 36.3 40.4 39.0 tegument protein UL21
UL20 229 45.9 43.2 31.6 30.7 26.7 33.2 envelope protein UL20
UL19 1,377 72.8 72.2 65.9 66.3 68.1 60.0 major capsid protein
UL18 312 64.1 64.1 59.8 61.1 58.8 55.3 capsid triplex subunit 2

DNA packaging tegument
UL17 691 51.2 50.8 41.8 41.4 44.4 37.0 protein UL17

UL16 363 52.1 51.0 44.0 45.3 39.1 37.3 tegument protein UL16

DNA packaging terminase
UL15 734 71.3 71.0 63.6 63.5 61.3 61.3 subunit1

UL14 322 34.5 35.4 32.5 32.7 42.7 31.6 tegument protein UL14

tegument serine/threonine
UL13 606 49.2 49.0 36.8 36.0 31.9 35.5 protein kinase

UL12 544 59.9 60.4 41.0 41.2 47.1 37.6 deoxyribonuclease

myristylated tegument
UL11 76 36.1 35.6 33.8 34.7 25.4 36.1 protein

UL10 422 40.7 40.5 36.7 37.0 39.6 33.2 envelope glyCOprotein M

DNA replication origin-
UL9 860 58.5 58.4 48.8 51.5 49.8 46.5 binding helicase

UL8 782 46.0 45.2 36.8 36.5 36.2 36.6 heiicase-primase subunit
UL7 296 46.1 44.9 36.9 38.5 40.4 37.3 tegument protein UL7
UL6 717 57.9 58.7 50.9 53.5 60.1 48.2 capsid portal protein

UL5 663 70.7 70.0 64.9 65.0 60.5 66.1 gjgfiifte'i’mase "9"“39

UL4 236 43.6 42.9 36.4 37.8 32.4 26.7 nuclear protein UL4
UL3.5 181 21.9 21.4 18.3 16.3 18.0 22.5 protein V57

UL3 201 67.7 69.5 54.5 51.0 44.4 43.0 nuclear protein UL3
UL2 293 49.8 49.8 50.0 48.1 46.2 43.4 uracil-DNA glycosylase
UL1 147 28.6 28.8 25.4 27.3 24.6 27.1 envelope glycoprotein L
ICPO 498 23.4 22.0 21.4 20.1 18.9 14.2 ubiquitin E3 ligase ICPO

78

Table 3.3, continued

 

protein Length 33 identity (%) Predicted function or
(88) EHV—1 EHV-4 BHV-1 8HV-5 PRV vzv property
ICP4 1,396 42.7 43.2 39.6 40.7 40.2 35.4 :‘Cagjmp‘ma' regu'am'
US1 334 54.8 53.4 44.3 43.5 33.5 31.2 regulatory protein ICP22
U810 213 45.0 44.5 N/A NIA N/A 27.1 virion protein U810
U82 102 12.7 11.8 10.8 11.8 13.7 N/A virion protein U82

serine/threonine protein
US3 351 54.4 51.6 41.9 41.0 46.1 38.2 kinase U83

U84 434 36.3 36.3 28.7 28.4 27.0 NIA envelope glycoprotein G
U86 374 24.9 25.1 30.1 30.2 26.3 NIA envelope glycoprotein D
US? 384 35.4 36.7 23.6 23.4 22.9 23.3 envelope glycoprotein I
U88 532 45.9 45.4 30.8 29.8 22.9 25.2 envelope glycoprotein E
US8A 100 13.0 14.6 NIA NIA NIA NIA membrane protein U88A
U89 152 30.1 35.2 25.9 26.3 35.8 26.7 membrane protein U89

U810 213 virion protein U810
U81 334 regulatory protein ICP22

transcriptional regulator
ICP4 1.398 ICP4

 

79

Table 3.4 Differences in gene composition among sequenced Varicellovirus genomes

Predicted Function or

 

Protein FHV-1 EHV-1 EHV-4 8HV-1 8HV-5 PRV VZV P r o perty
UL56 + + + — — + + membrane protein UL56
V1 + + + — — — + membrane protein V1

m 'st ated te ument
C'RC + + + + + ‘ + prbi'eiri'CIRc g
UL55 + + + - — — + nuclear protein UL55
VZV ORF 13 — - - - — — + thymidylate synthase
UL45 + + + — — — - membrane protein UL45
V32 + + + — — — + protein V32
V67 — + + + + — + virion protein V67
U810 + + + — — — + vin’on protein U810
US4 + + + + + + — envelope glycoprotein G
U85 — + + — — — - envelope glycoprotein J
US6 + + + + + + — envelope glycoprotein D
US8A + + + - — — membrane protein U88A

 

8O

Table 3.5 Tandem repeats within the FHV-1 genome

Repeat unit

Total length

 

Location size 1132) Copy no. Sequence (bp) Note
121 — 497 17 22.2 tggagtctaggtgtggg 377 UL / Gap3
106.506 - 106.736 21 11 ggcctaataaggaaggggagg 231 Re, / Gap1
(135.497 - 135.727) (TRs I Gap3)
106.734 — 106,949 30 7.2 tctggcggtttgtgggttggcatattcaaa 216 Rs / Gap1
(135,284 — 135.499) (TRs / Gap3)
106,963 - 107,066 30 3.5 104 IRS I Gap1
(135.167 - 135,270) (T Rs I Gap3)
1 10.463 — 110,501 18 2.2 tggagcgacgctcactga 39 RS / ICP4
(131.732 — 131.770) (TRs / ICP4)
1 11,766 — 1 11,877 20 6.1 accttcgctcctcccctcgt 122 IR; / Between ICP4 and U81
(130.346 - 130.467) (TFLc. / Between ICP4 and U81)
112,613 - 112.814 53 3.8 aggttggaagccatgttgttccggttgcac 202 IR; / Between ICP4 and U81
atctaatctacatgaaagtggga
(129.419 - 129.620) (T Re I Between ICP4 and U81)
112.851 - 113.459 26 23.4 gggggatcgagggggggcagagggga 609 Re. I Gap2
(128.774 - 129.382) (T Fig / Gap2)
120.219 — 120,410 16 12 W 192 Us / Between U84 and U86

 

 

81

Table 3.6 Cumulative clinical score, virus shedding pattern, and virus neutralizing

antibody titers of SPF cats inoculated with the C-27 parent strain, the FHVlABAC
strain, or mock-inoculated with cell culture medium

 

 

 

 

 

 

 

Days AJJ5 AJCZ AJC3 AJDB

p.i. (C-27) (FHV1A8AC) LFHV1ABAQ (EMEM)

Vl VN VI VN VI VN VI VN

0 — <4 - <4 - <4 — <4

3 + ND + ND + ND — ND

6 + ND + ND + ND — ND

9 + ND + ND + ND — ND

14 — 64 - 32 - 32 — <4

21 - 64 — 32 - 64 — <4

Cumulative

clinical score 22 22 26 0

 

VI: virus isolation; VN: virus neutralization; ND: not determined.

82

FIGURES AND FIGURE LEGENDS

Figure 3.1 Diagrams showing (A) structure of FHV-1 genome, (B) location of the
BAC cassette and cellular sequence insertion, (C) the composition of the BAC cassette,
and (D) the FHV-l BAC clone after excision of the BAC cassette. The diagram is not to
scale.

83

 

mEE
canes—=89.
5:6

\ / \
ElxlU a

mucczuum
L23=ou

3.»
6x3
EB Eu
c323E82 cgunsnEouo.
_stna _Stma
28 ES Ema may. 95 m5! nEOM

 

can 0:!
ea. es.
00:0360m
\Lm_:__ou
0mm:

.5

 

 

FigureZ3J

84

Figure 3.2 Three bacterial clones of FHV—1 BAC (lanes 1-3) and C-27 parent strain
genomic DNA (lane 4) were treated overnight with restriction endonuclease SalI at
37°C. The DNA flagrnents were resolved and visualized using a 0.7% agarose gel
stained with ethidium bromide. Based on sequence analysis, the linear FHV-1 C-27
strain genome contains the following SalI flagrnents. A: 16,123 bp; B: 14,011 bp; C:
13,648 bp; D: 13,466 bp; E: 11,730 bp; F: 10,121 bp; G: 9,559 bp; H: 9,119 bp; 1: 8,564
bp; J: 6,977 bp; K: 6,701 bp; L: 4,951; M: 3,996 bp; N: 2,587; 0: 1,724 bp; P: 769 bp;
Q: 677 bp. The 414-bp R flagment and two 330-bp S flagrnents were not visible in this
picture. G and M flagments that contained genomic termini (marked by diamonds in
lane 4) would have been ligated when the genome circularized, but were instead
resolved as three flagrnents because of the introduction of additional SaII sites by the
BAC insertion. The first two of these flagrnents, 9,445 and 9,171 bp in size (arrows),
form a triple band with the H fragment. The other flagment was 6,384-bp in size
(arrows) The size of the K fiagrnent was found to be variable among bacterial clones
(arrowheads). Position of 1 kb DNA ladders are indicated at the left side.

85

12K
11K
10K—
9K .
8K
7K

6K6 ~

5K

4K“-

3K

2K

1.6K

 

Figure 3.2

86

'

. , 994...:
I it"
m3: 433 m3: 8.15 ~m>

 

 

A

A613......

 

mg: amt—D 0.3:

~33

5.5

Figure 3.3 Predicted FHV-l gene arrangement.

87

A

 

 

(am:
i T T 9 I it 2':
«do. 55 o5: own 3: Km: om:
oooeor ooommv oooomp oooowp oooomp ooovmw ooowwr 883
BE.

V

, 5:
I A E ' T T '.

mm: 5: .3.0. odO. «.5
88: 88:. 89.: 88:- 88: .ooomop--- 889 89.9 ooomow
mm.

V ' I A .I
35 S: . m5 . . :5 , 2.5
V ti! .f T t 2

m4: 3: m4: 3: 3: o5: N5:

 

 

 

I T T
25
t 'I
3.5 2.5 2.5 9.5 2.5 8.5 3.5 8.5

 

Figure 3.3, continued

88

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

FHV-1
100
EHV-1
100 —— EHV-4
PRV
100 .__... BHV-5
VZV
l———-l
0.05
B
UL53 (9K)
95 FHV-1
VZV
»— EHV-1
100 ._ EHV-4
PRV
100 BHV-5
i———l
0.1
UL49.5 (gN)
FHV-1
56
— EHV-1
_ 100 ._ EHV-4
PRV
100 ——- BHV-5
VZV
0 1

Figure 3.4 Phylogenetic analyses based on concatenated amino acid sequence
alignment of conserved genes (A) and individual glycoprotein amino acid sequence
alignments (B). Trees were generated using the neighbor-joining method. Bootstrap
values (1,000 replicates) are given for each branch. Scale bars represent number of
amino acid substitutions per site.

89

UL44 (gC)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

FHV-1
43
r —— EHV-1
100 —— EHV-4
100 — BHV-1
BHV-5
3“ PRV
vzv
1—1
0.1
UL27 (gB)
FHV-1
94
EHV-1
F 100 EHV-4
PRV
97 .— 8HV-1
100 -— BHV-5
vzv
0.05
UL22 (gH)
FHV-1
91
EHV-1
99
100 EHV-4
vzv
PRV
BHV-1
100 — BHV-5
I——|

0.1

Figure 3.4, continued.

90

UL10 (9M)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

50 FHV-1
[— EHV-1
100 EHV-4
PRV
72 BHV-1
100 . BHV-5
VZV
0 1
UL1(gL)
57 FHV-1
BHV-1
32, 100 BHV-5
EHV-1
100 EHV-4
VZV
PRV
l-——l
0.1
US4 (gG)
85 FHV-1
EHV-1
100 EHV-4
PRV
Bl-N-1
100 BHV-5
l-——-l
0.1
Figure 3.4, continued.

91

 

 

U86 (gD)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

63 FHV'1
PRV
BHV-1
100 .— BHV-5
EHV-1
100 .— EHV4
F—-l
0.1
US7 (gl) FHV 1
91
EHV-1
100 —— EHV4
7"
PRV
97 BHV-1
100 BHV-5
VZV
' 0.2 T
US3 (95)
-1
100 FHV
EHV-1
100 -— EHV-4
VZV
PRV
95 ‘ BHV-1
100 BHV-5
l——-l

0.1

Figure 3.4, continued.

92

Time (Hr)

 

 

 

 

 

; T . e . r i C
CD 66 N <0 ID V to N ‘- O
(“rm/090131 501) 1311.1.

Figure 3.5 Multi-step grth curve of the parent wild type strain C-27 (grey) and the
BAC-derived virus (black). The wild type virus and the FHVlABAC were inoculated
on CRFK monolayers at an moi. of 0.01, and supernatants collected and titrated at 0, 6,
24, 48, and 72 hours post inoculation (p.i.). Error bars at each data point represent :l:1
standard deviation.

93

14

 

13

 

12

 

 

10

 

”1

__-
__-
1

 

I-

$093309

Days Post Inoculation

 

__-
__-
___--
---_
6

 

 

 

 

 

 

5),“! £010) 9,0400 19,0410)
23% 266 265 233

Figure 3.6 Durations of clinical signs and virus shedding in cats inoculated with the C-
27 parent strain (Cat AJJ5) or the FHVlABAC virus (Cats AJC2 and AJC3). The Gantt
chart shows the time flame during which a specific clinical sign or virus shedding
persisted. The cat number is shown next to its respective bar. A bar is shown only if a
clinical sign was observed or virus shedding occurred.

94

CHAPTER 4

GENERATION AND IN VITRO CHARACTERIZATION OF
FELINE HERPESVIRUS 1 (FHV-1) MUTAN TS
LACKING GLYCOPROTEIN S C (gC) AND E (gE)

Tai, S.H., Cheng, H.H., Niikura, M., Kim, T., Engstrom, M.D., Maes, R.K.

Generation and in vitro characterization of feline herpesvirus 1 (FHV-1) mutants
lacking glycoproteins C (gC) and E (gE). In preparation for submission.

95

Generation and in vitro characterization of feline herpesvirus 1 (FHV-1) mutants

lacking glycoproteins C (gC) and E (gE)

S. H. Sheldon Taia, Hans H. Chen 5|"), Masahiro Niikurab’l, Taejoong Kimb’z, Michael
g

D. Engstromc, Roger K. Maesa’c’d’*

a Graduate Program in Comparative Medicine and Integrative Biology, College of
Veterinary Medicine, Michigan State University, East Lansing, MI 48824, USA
b Avian Disease and Oncology Laboratory, Agricultural Research Service, United

States Department of Agriculture, 3606 East Mount Hope Road, East Lansing, MI

48823, USA

c Department of Microbiology and Molecular Genetics, College of Veterinary Medicine,
Michigan State University, East Lansing, MI 48824, USA

d Diagnostic Center for Population and Animal Health, College of Veterinary Medicine,

Michigan State University, 4125 Beaumont Road, Lansing, MI 48910, USA

* Corresponding author. Diagnostic Center for P0pulation and Animal Health, College

of Veterinary Medicine, Michigan State University, 4125 Beaumont Road, Lansing, MI
48910, USA. Fax: +1 517 432 6527.

E-mail address: Maes@dcpah.msu.edu (R.K. Mass).
1 Present address: Faculty of Health Sciences, Simon Fraser University, Burnaby, BC,

V5A 186, Canada.

96

 

 

2 Present address: Poultry Diagnostic and Research Center, University of Georgia,

Athens, GA 30602, USA.

ABSTRACT

Feline herpesvirus 1 (FHV-1) mutants lacking the entire open reading frames

encoding glycoprotein C (gC) or E (gE) were constructed, based on a FHV-1 BAC
clone. The gC' FHV-1 mutant virus produced primary plaques that enlarged slowly and

had relatively few secondary plaques compared to the wild type virus. Analysis on
multi-step growth kinetics showed that the mutant virus grew to titers that were reduced
by approximately 6,000 — 9,000 folds, compared with the wild-type virus. Analysis of
the mutant virus on single-step growth kinetics showed that the titer of intracellular
virus was 3.5 - 10 folds higher than the extracellular virus titer. Taken together, the
results indicate that the mutant virus is more cell-associated compared to the wild-type

virus. Thus, FHV-1 gC, like is the case in other varicelloviruses, plays a significant role
in initial attachment/penetration, replication, and egress of FHV-1. In contrast, the gE-

FHV-1 mutant had single-step growth kinetics that were indistinguishable flom those of
the FHVlABAC, and grew to a titer that was approximately 10-fold lower than that of
the FHVlABAC in the multi-step growth kinetics. These results suggested that virus
egress, and most likely cell-to-cell spread as shown in other alphaherpesviruses, were

affected by gE deletion, while virus entry and replication were not.

97

 

Keywords: Feline herpesvirus 1, FHV-1, glycoprotein C, glycoprotein E, mutant,

infectious BAC clone, virulence

INTRODUCTION

Feline herpesvirus 1 (FHV-l) is an important viral pathogen of Felidae and has a
world-wide distribution. Infection with FHV-l not only accounts for approximately
50% of all diagnosed viral upper respiratory infections, but is also a significant cause of
ocular diseases in cats (Nasisse, 1990). Pathobiology and clinical manifestations
associated with FHV-1 have recently been reviewed (Gaskell, 2007; Maggs, 2005;
Stiles, 2000). Primary infection, acquired via the oronasal route, results in fever,
sneezing, ocular and nasal discharge, conjunctivitis, and keratitis. Like herpesvirus
infections in other species, the acute phase of the disease is followed by lifelong latency.
During the latent stage, the FHV-1 genome persists in neural tissues but infectious virus
is not produced. Different biological stresses, or administration of corticosteroids, can
induce the necessary biochemical stimuli in latently infected cells that lead to renewed
production of infectious virus, which then travel to the periphery and is a potential
source of viral transmission. Despite the clinical significance and high prevalence of
FHV-1 infection, currently available vaccines can not totally protect cats flom field
virus infection and, as a consequence, flom field virus latency (Gaskell, 1993; Harbour
et al., 1991; Nasisse et al., 1997; Tham and Studdert, 1987). Furthermore, most vaccines

are safe only when administered subcutaneously (Kruger et. al., 1996).

98

 

FHV-1 has a double-stranded DNA genome and a genomic organization similar
to that of other varicelloviruses of the Alphaherpesvirus subfamily (Grail et al., 1991;
Rota et al., 1986), which includes the prototype varicella zoster virus (VZV), bovine
herpesvirus 1 (BHV-l), bovine herpesvirus 5 (BHV-S), equine herpesvirus 1 (EHV—l),
equine herpesvirus 4 (EHV-4), and pseudorabies virus (PRV), among others. The
complete 135,797-bp sequence of the FHV-1 genome has been determined and 74
encoding proteins have been identified, including 11 glycoproteins (Tai et al.,
submitted). FHV-1 has been shown to contain 23 virion-associated proteins (Fargeaud
etal., 1984). The functions of seven glycoproteins, gB, gC, gD, gE, gG, gH and g1, had
been reviewed by Maeda et al. (1997).

Glycoprotein C (gC) homologues have been extensively studied in several
alphaherpesviruses. gC homologues are non-essential for herpesvirus replication in vitro,
but they mediate several important biological functions. gC is involved in the initial step
of viral attachment by interacting with heparan sulfate on the cell surface, as
demonstrated for herpes simplex virus-1 (HSV-1) , PRV, BHV-l, and EHV-l (Herold
et al., 1991; Mettenleiter et al., 1990; Okazaki et al., 1991; Osterrieder, 1999). gC
deficient mutants attach to cells with reduced efficiency (Osterrieder, 1999). ng of
HSV-1 and -2 can bind the complement component C3b (Geraghty et al., 1998;
Lubinski et al., 1999). Binding of this complement factor may protect herpesvirus-
infected cells flom complement-mediated lysis (Fries et al., 1986). Viruses lacking
complement-binding domains are less virulent than wild-type virus (Frink et al., 1983;
Herold et al., 1991; Lubinski et al., 1999). The gC of FHV-1 has been shown to be the

dominant heparin-binding glycoprotein that mediates the initial stage of viral adsorption,

99

as observed in other herpesviruses (Maeda et al., 1997). However, it remains to be
determined whether FHV-1 gC protect virus-infected cells flom complement-mediated
lysis.

A deficiency of gC is commonly seen in strains of herpesviruses attenuated by
serial passage in cell cultures. The PRV Bartha vaccine strain carries mutations within
the gC gene that include an alteration in the amino terminal signal sequence, resulting in
inefficient intracellular translocation and incorporation of this protein into the viral
envelope (Robbins et al., 1989). The VZV vaccine strain Oka is defective in gC
expression compared to wild type VZV strains (Kinchington et al., 1990). In addition, a
genetically engineered TK-gC- vaccine strain has been licensed for use in control of
pseudorabies (Kit, 1990). A sensitive and highly specific ELISA kit was developed for
use in conjunction with this vaccine to distinguish non-infected and/or vaccinated pigs
flom those infected with PRV field strains (Kit et al., 1990).

Glycoprotein E (gE) is a virulence factor of FHV-1. In alphaherpesviruses,
glycoprotein E (gE) and glycoprotein I (g1) form a heterodimer that fimctions in cell-to-
cell spread of the virus and spread of infection throughout the host nervous system,
which is ultimately the cause of neurovirulence. Generally, alphaherpesvirus mutants
that lack these glycoproteins are replication-competent in cell culture but produce
smaller plaques, due to reduced capacity for cell-to-cell spread. gE/gI deletion mutants
of herpes simplex virus type 1 (HSV-1) and other alphaherpesviruses such as
pseudorabies virus (PRV) and bovine herpesvirus 1 (BHV-l), show impaired ability to
spread flom cell to cell (Balan et al., 1994; Dingwell et al., 1994; Dingwell and Johnson,

1998; Otsuka and Xuan, 1996; Zuckermann et al., 1988). The gE/gI heterodimer

100

appears to play an even greater role in the spread of varicella-zoster virus (V ZV) (Frink
et al., 1983; Mallory et al., 1997; Mallory et al., 1998) and in Marek’s disease virus
(MDV), in which the gE/gl heterodimer has been found to actually be essential for
grth in cultured cells (Schumacher et al., 2001). Previous studies have shown that
gE/gI complex of FHV-l is not essential for virus growth, although virulence is
significantly reduced and the virus produces smaller plaques when the gE/gI genes are
deleted (Sussman et al., 1995). The FHV-l gE/gI mutant, when administered via the
oronasal route, can protect cats flom clinical signs and significantly reduce viral loads
in subsequent challenge with a high dose of field virus. However, this mutant at higher
dose levels still retained partial virulence as it can produce mild clinical signs in a dose-
dependent manner (Kruger et al., 1996; Sussman et al., 1997).

Bacterial artificial chromosome (BAC) cloning and recombination-mediated
genetic engineering (recombineering) are two state-of-the-art techniques to facilitate the
mutagenesis of herpesviruses. BACs are single copy F-factor-based plasmid vectors
which can stably hold 300 kb or more of foreign DNA (Shizuya et al., 1992). The
BACs’ larger capacity and greater stability over the other vectors have made BAC the
vector of choice for the cloning of entire herpesvirus genomes. Many alphaherpesvirus
genomes have been cloned as BACs since the first infectious BAC of a herpesvirus was
reported in 1997 (Messerle et al., 1997). These include HSV (Saeki et al., 1998;
Stavropoulos and Strathdee, 1998), PRV (Smith and Enquist, 1999), EHV-l (Rudolph
et al., 2002), and MDV (Niikura et al., 2006; Schumacher et al., 2000). Recently, we
have constructed a BAC clone that contains the entire FHV-1 genome, and virus

derived flom this BAC clone has been shown to possess in vitro and in vivo

101

characteristics very similar to the prototype C-27 strain (Tai et al., submitted). This
FHV-1 BAC clone is therefore a suitable starting platform for characterizing virulence
factors and development of vaccine candidates.

Recombineering is a powerfirl method for fast and efficient manipulation of the
BAC. It allows DNA cloned in E. coli to be modified via lambda (it) Red-mediated
homologous recombination, obviating the need for restriction enzymes and DNA
ligases. Site-specific and “scarless” deletions, insertions, and point mutations can be
introduced efliciently using a recombineering procedure developed by Tischer et al.
(2006), known as two-step Red-mediated recombination (See Figure 4.1 for an
overview.)

In this report, we present the construction and in vitro characterization of the first
FHV-1 gC-deletion mutant, as well as a gE-deletion mutant. Both were constructed
based on an infectious FHV-1 BAC clone by the two-step Red-mediated recombination

approach.

MATERIALS AND METHODS

Cells and Viruses
Crandell-Reese feline kidney (CRFK) cells (ATCC CCL-94, Manassas, VA) were
cultured in Eagle’s Minimum Essential Medium (EMEM) containing 10% fetal bovine

serum (FBS) and 10 ug/ml of ciprofloxacin. The FHV-l prototype strain C-27 (ATCC

102

VR-636, Manassas, VA) was propagated in the CRFK cells and used as the wild-type

virus throughout this study.

Construction of Mutant FHV-1 BACs

“Scarless” deletions of the entire open reading flame (ORF) of gC or gE were
introduced into the FHV-l BAC clone (Tai et al., submitted) using the two-step Red-
mediated recombination method described by Tischer et a1. (2006) and illustrated in
Figure 4.1. First, a mutating DNA fragment that contained 50-bp of upstream
recombination arm, 50-bp of downstream recombination arm, kanamycin resistance
gene expression cassette (kan), and a restriction site of homing endonuclease I-SceI was
generated by PCR using the Extended High Fidelity PCR System (Roche Applied
Science, Indianapolis, IN). The 25 pl reaction consisted of 1x Expand High Fidelity
buffer, 1.5 mM of MgC12, 200uM of each dNTP, 600 nM of each dUL44F and dUL44R
primer (Integrated DNA Technologies, Coralville, IA) (Table 1), 2 ng of pEPkan-S as
template, and 1.4 U of Expand High Fidelity enzyme mix. PCR amplification was
carried out in a Thermal Cycler 2720 (Applied Biosystems, Foster City, CA). The
program started with an initial denaturation step at 94°C for 2 minutes, followed by 40
cycles of 94°C for 1 minute, 55°C for 1 minute, and 68°C for 1 minute. Following the
last elongation step at 68°C for 10 minutes, the template plasmid was degraded by
adding 40 U of Dpnl (New England BioLabs, Ipswich, MA) to the PCR reaction and
incubating at 37°C for 1 hour. The 1,145-bp amplicon was resolved in a 1% agarose gel
and purified using the QIAquick Gel Extraction Kit (Qiagen, Valencia, CA). The gel-

purified DNA was then transformed into E. coli SW105 cells (Warming et al., 2005)

103

 

containing the FHV-1 BAC clone, which was induced for the expression of
recombination genes exo, bet and gam at 42°C for 15 min. Candidate colonies grown on
LB agar plates containing 50 pg/ml of chloramphenicol and 75 pg/ml of kanamycin
were checked by PCR using primers RM1206-RM1207 and RM1208-RM1209 (Table
1), and restriction pattern analysis. Positive clones were further engineered to remove
the kan insertion. The second recombination was carried out by inducing the expression
of recombination genes at 42°C for 15 min and the expression of I-SceI by 1% of
arabinose. The successfully engineered gC- and gE-deleted FHV-1 BAC clones were
identified based on the restriction pattern, results of colony PCR, and sequence analysis,

and designated as FHV lBACAUL44 and FHVlBACAUS8, respectively.

Reconstitution of Infectious Viruses flom BACs

To reconstitute mutant FHV-l Virions flom the mutant BAC clones and excise the
BAC cassette flom the viral genome, CRFK cells were co—transfected with either
FHVlBACAUL44 or FHVlBACAUSS DNA, and pcDNA-Cre plasmid using
Lipofectamine 2000 (Invitrogen, Carlsbad, CA) (Tai et al., submitted). Briefly, 300,000
CRFK cells were seeded in each well of a 24-well plate and incubated overnight at

37°C in an atmosphere of 5% C02 until the cultures reached ~95% confluence. To form

DNA-Lipofectamine 2000 complexes, 1 pg of either FHVlBACAUL44 DNA or
FHVlBACAUS8 DNA, and 1 pg of pcDNA-Cre plasmid were diluted in 50 pl of
EMEM without antibiotics or FBS, and combined with 3 pl of Lipofectamine 2000, also
diluted in 50 pl of EMEM without antibiotics or F BS. The cell culture medium was

replaced with 100 pl of each DNA-Lipofectamine 2000 complex and 500 pl of flesh

104

EMEM containing 10 pg/ml of ciprofloxacine and 10% PBS. After 5 — 7 days of
incubation, the supernatants were harvested and progeny virus that produced non-
fluorescent plaques was plaque-purified before being propagated in CRFK cells.
Reconstituted gC-deleted virus that had the BAC cassette removed thru Cre-loxP
recombination was designated as FHVlAgC. Reconstituted gE-deleted virus that had
the BAC cassette removed was designated as FHVlAgE. The removal of BAC cassette
was verified by PCR using primhers RM1101 and RM1102 (Table 4.1) and direct
sequencing of the purified PCR product. Deletions of gC and gE was verified again by

PCR and direct sequencing of the purified PCR product as described above.

Plaque Morphology and Plaque Size Analysis
Fifty TCID50 of the viruses to be tested were inoculated on confluent CRFK

monolayers in a 6-well plate. After a one-hour adsorption at room temperature, the

inoculum was removed, and flesh growth medium was added. The cells were then

incubated at 37°C in an atmosphere of 5% C02 and observed daily for 5 days. Plaques

produced by each virus were photographed using a QImaging camera (QImaging,
Surrey, BC, Canada).
To perform plaque size analysis, 150 TCID50 of the viruses to be tested were

inoculated on confluent CRFK monolayers grown in a 6-well plate. After a one-hour
adsorption at room temperature, the inoculum was removed, and flesh growth medium

containing 0.8% carboxymethylcellulose was added. The cells were then incubated at
37°C in an atmosphere of 5% C02. After 5 days of incubation, the infected monolayers

were fixed and plaques were stained using fluorescein—conjugated anti-FHV-l

105

antibodies. One hundred plaques produced by each virus were photographed and the
diameters were determined using a QImaging camera and the QCapture Pro software
(QImaging, Surrey, BC, Canada). ANOVA was used to assess whether differences in

plaque size were statistically significant.

Growth Kinetics

Single-step growth curves were constructed as follows: monolayers of CRFK
cells were infected in triplicate with the C-27 strain or the deletion mutants at a
multiplicity of infection (MOI) of 3. After an adsorption period of 1 hour, cells were
washed with 0.1 M phosphate buffered saline, pH 7.2 (PBS), overlaid with growth
medium, and incubated at 37°C in an atmosphere of 5% C02. The cell culture
supernatant and infected cells were harvested separately at successive intervals between
4 and 48 hours post inoculation (p.i.) and the amount of infectious virus was titrated on
CRFK cells, as described previously (Sussman et al, 1995).

Multi-step grth curves were constructed by infection of CRFK monolayers in
triplicate with the C-27 strain or the deletion mutants at an MOI of 0.01. After an
adsorption period of 1 hour, cells were washed with PBS, overlaid with growth medium,
and incubated at 37°C in an atmosphere of 5% C02. Culture supernatants and infected
cells were harvested separately at successive intervals between 6 and 120 hours p.i. The

amount of infectious virus was titrated on CRFK cells as described previously.

106

RESULTS

Construction of Mutant FHV-1 BACs

Using two-step Red-mediated recombination techniques (Tischer et al., 2006),
FHV-1 mutants lacking the entire ORF of gC or gE were generated, based on the F HV-
] BAC clone previously constructed in our laboratory (Tai et al., submitted). The
mutagenesis of the BAC clone was confirmed by colony PCR (data not shown),

restriction pattern analysis (Figure 4.2), and sequence analysis (data not shown).

Reconstitution of Infectious Virus flom BACs

The removal of the BAC vector in the reconstituted FHVlAgC and FHVlAgC
viruses was verified by the loss of fluorescence resulting flom the EGFP gene in the
BAC vector, PCR and direct sequencing of purified PCR products. The deletions of gC
and gE were also verified by PCR (Figure 4.3) and direct sequencing of purified PCR

products (data not shown).

Plaque Morphology and Plaque Size Analysis

Figure 4.4 shows the development of plaques produced by the FHVlAgE and the
parent C-27 strain on CRFK monolayers without carboxymethycellulose overlay. On
day l p.i., plaques produced by both FHVlAgC and C-27 parent strain were very small.
After day 2 p.i., FHVlAgC plaques expanded gradually, while C-27 strain plaques
spread rapidly. Overall, plaques produced by F HVlAgC developed slower and

remained focal, while the FHV-1 C-27 strain produced extensive CPE on day 4 p.i.

107

Relatively few secondary plaques were produced by FHVlAgC compared to the C-27
strain.
Preliminary plaque size analysis did not show a significant difference between the

FHVlAgC and the C-27 strains.

Growth Kinetics

Single-step (Figures 4.5 and 4.7) and multiple-step (Figures 4.6 and 4.8) growth
curves were constructed for FHV-l C-27 strain, FHVlABAC, FHVlAgC, and
FHVlAgE. FHV lABAC grows to a titer that is approximately 2 — 12 fold lower than
the C-27 strain.

When inoculated at an MOI of 3 on CRFK monolayers, both the wild type and the
gC-deletion mutant started to replicate extensively in CRFK cells after 8 hours post
inoculation (Figure 4.5). Compared to the wild type, the gC-deletion mutant replicated
much less efficiently and released fewer Virions into the medium. In case of the wild
type, the amount of extracellular virus surpassed the amount of intracellular virus
between 20 and 24 hours p.i. In contrast, the amount of extracellular virus of the gC-
deletion mutant never surpassed the intracellular virus. For both viruses, CPE was
nearly complete at 24 hours p.i., all the cells were showing CPE. The amount of
intracellular viruses remained constant, and the amount of extracellular viruses
continued to increase. In contrast, the gE-deletion mutant has a grth curve very
similar to FHVlABAC (Figure 4.7).

When inoculated at an MOI of 0.01 on CRFK monolayers, the wild type virus

started to replicate extensively in CRFK cells between 6 and 16 hours p.i. (Figure 4.6).

108

 

The amount of the intracellular virus reached a plateau at 48 hours p.i. The amount of
extracellular virus surpassed intracellular virus between 48 and 72 hours p.i., and
reached a plateau at 72 hours p.i. After 96 hours p.i., cell lysis was extensive and the
virus titer started to decrease. The amounts of extracellular and intracellular virus of the
gC-deletion mutant started to increase between 16 and 24 hours p.i., and were very
similar between 24 and 72 hours p.i. The gC-deletion mutant also reached a plateau at
72 hours p.i., but the titer was 6,000 — 9,000 fold lower than the wild type titer. The gE-
deletion mutant grew to a titer that was approximately 10-fold lower than the

FHVlABAC (Figure 4.8).

DISCUSSION

Previous work in our laboratory involved cloning of the entire FHV-1 genome as
an infectious BAC. Virus generated flom this BAC clone was shown to behave very
similarly to the parent C-27 strain, both in vitro and in vivo (Tai et al., submitted).
Therefore, it was considered to be a suitable starting platform for mutagenesis and
virulence studies. Based on this BAC clone, we constructed FHV-1 mutants in which
the entire ORF of gC or gE was deleted.

The FHV-1 gC-deletion mutant had in vitro characteristics that suggested
attenuation. The results of this study suggested that gC could play a role at three

different stages of viral infection: attachment/penetration, replication, and/or egress.

109

FHV-1’s attachment/penetration abilities were impaired by gC deletion. In plaque
assays without carboxymethylcellulose overlay, the gC-deletion mutant produces
relatively few secondary plaques, while the wild type produces many secondary plaques
and spreads to the entire monolayer very quickly. Adsorption conditions can influence
virus titer. When the inocula were not removed flom the monolayers after an hour of
adsorption, essentially allowing longer time for adsorption, the titer of combined

intracellular and extracellular virus stock of the F HV -1 gC-deletion mutant could reach

105 TCleo/ml, about 10 times higher than as shown in Figure 4.6. A stock of 106

TCIDso/ml could be grown by co-cultivation of uninfected and FHV lAgC-infected

CRFK cells (data not shown). It is well-documented that herpesvirus gC orthologues are
the major protein that confers the initial attachment of the virion to the host cell, by
electrostatically binding to heparin- and chondroitin-like glycosaminoglycans on the
cell surface (Herold et al., 1991; Mettenleiter et al., 1990; Okazaki et al., 1991;
Osterrieder, 1999). This binding step can be blocked with soluble heparin (Okazaki et
al., 1991). In addition to attachment, PRV gC was shown to play a role in penetration,
independently flom its attachment firnction (Mettenleiter, 1989; Rue and Ryan, 2002).
A gC-deficient mutant of EHV-l, a very close relative of FHV-1, attaches to cells with
reduced efficiency, and penetration assays showed that this mutant’s penetration ability
was impaired in primary equine cell culture, and severely impaired in a rabbit cell line
(Osterrieder, 1999).

The FHV-1 gC-deletion mutant grew to a lower titer and showed a lower growth
rate, as shown in the single-step (Figure 4.5) and multi-step (Figure 4.6) growth curves.

This observation is not consistent with all studies in other herpesviruses. An EHV-l gC-

110

negative mutant has been shown to have a 5- to 10-fold reduction in titer when grown in
rabbit and equine cell lines, and a 48- to 210-fold reduction when grown in primary
equine cells (Osterrieder, 1999). gC-negative mutants of HSV-1 and PRV grow to titers
that are only reduced by approximately lO-fold in cultured cells (Osterrieder, 1999). In
contrast, deletion of gC in BHV-l did not change its growth kinetics significantly in a
bovine kidney cell line (Liman etal., 2000), and gC-negative VZV Oka strain exhibited
accelerated and more efficient growth in cultured melanoma cells compared to the wild-
type Oka strain (Cohen and Seidel, 1994). The reason for FHVlAgC’s lower titer and
slower grth may be due to reduced ability of the mutant virus to attach, thus resulting
in lower virus load compared to the wild type. It is possible that a higher titer can be
reached by inoculating the cells with more virions, as done in the studies of EHV -1 and
BHV -1, which used 5 M01 to construct single-step grth curves. However, in order to
carry out an inoculation at 5 M01, pelleting of FHVlAgC virions would have been
necessary. In addition, different cell type could affect the virus’s growth, as shown in
the EHV-l study. This issue can be addressed by using different types of cells, such as
feline corneal epithelial cells (Sandmeyer et al., 2005) and Felis catus whole fetus cells
(Jacobse-Geels and Horzinek, 1983; Pedersen et al., 1981).

It is also possible that FHV-1 gC plays a role in virus replication. In BHV-l, gC
has been shown to be important for maintaining the efficacy of viral replication in the
natural host (Liang et al., 1992).

Yet another reason for the reduced growth could be the reduced ability of the
mutant virus to egress. The gC-deletion mutant is more cell-associated than the wild

type, suggesting a possible impairment in viral egress. As demonstrated in single-step

lll

growth curve (Figure 4.5), which characterizes virus replication in individual cells, most
of the gC-deleted mutant virus remained in the cell. Specifically, the titer of
intracellular virus was 3.5 — 10 times higher than the extracellular virus. This is in
contrast to the wild type, where the titer of extracellular virus can be ~29-fold higher
than the intracellular virus. This finding is less obvious in the multi-step grth curves.
Herpesvirus gC is not considered to have a major role in viral egress or release.
Nonetheless, it was noted that the reduction in titer of the gC- mutant of EHV-l in
primary equine cells was partially due to impairment in viral egress (Osterrieder, 1999).

The limited ability of the FHV-1 gC- mutant to spread in cultured epithelial
CRFK cells, as demonstrated in Figure 4.4, suggest that when administered via the
natural oronasal route in vivo, it could spread slower on the mucosal epithelial cells at
the primary infection site, allowing more time for the immune system to respond, and
hence induce a stronger immune response. In addition, it is known that herpesvirus gC
plays an important role in immune evasion. gC inhibits the activation of the
complement cascade by binding to complement component C3b, and by blocking the
binding of properdin and C5 to C3b (Frink et al., 1983; Lubinski et al., 1999, Roizman
et al., 2007). It has been shown in HSV that gC-negative mutants are more easily
inactivated by complement than the wild-type (Hidaka et al., 1991). Therefore, by
deleting F HV-l gC, it is likely that the virus will induce a stronger immune response
and fewer clinical signs. Although in vivo experiments are necessary to substantiate this
hypothesis, it is reasonable to assume that the F HV-l gC- mutant will show reduced

virulence in the natural host.

112

The fact that single-step grth property of the gE-deletion mutant was
practically indistinguishable flom that of the FHVlABAC (Figure 4.6) and the multi-
step growth curve showed reduced titer suggests that virus egress but not entry and
replication was affected by gE deletion. This observation is consistent with previous
studies that showed gE plays an important role in cell-to-cell spread (Balan etal., 1994;
Dingwell et al., 1994; Dingwell and Johnson, 1998; Otsuka and Xuan, 1996;
Zuckermann et al., 1988).

In summary, the gC- and gE- mutants have potential as vaccine candidates that
are safer and more immunogenic than existing vaccines. An additional advantage of
these mutants over current commercially available vaccines is that they can be
serologically differentiated flom field virus. A distinct advantage of the
recombineering-based approach to create deletion is that additional deletions could be
made in either one of these mutants, should it be evident flom future in vivo

experiments that they still have residual virulence.

ACKNOWLEDGEMENTS

Funding for this research was provided by Michigan State University College of
Veterinary Medicine’s Feline Health Endowment and Center for Feline Health and
Well-Being. The authors thank Biological Resources Branch at National Cancer

Institute for providing E. coli SW105 cells, and Dr. Nikolaus Osterrieder for generously

113

 

providing plasmids which were essential for two-step Red-mediated recombination. The

authors also thank Laurie Molitor for excellent technical assistance.

114

REFERENCES

Balan, P., Davis-Poynter, N., Bell, S. Atkinson, H., Browne, H., Minson, T., 1994. An
analysis of the in vitro and in vivo phenotypes of mutants of herpes simplex virus
type 1 lacking glycoproteins gG, gE, g1 or the putative gJ. J Gen Virol 75, 1245-
58.

Cohen, J.I., Nguyen, H., 1997. Varicella-zoster virus glycoprotein I is essential for
growth of virus in Vero cells. J Virol 71, 6913-20.

Cohen, J .I., Seidel, KB, 1994. Absence of varicella-zoster virus (VZV) glycoprotein V
does not alter growth of VZV in vitro or sensitivity to heparin. J Gen Virol 75,
3087-93.

Dingwell, K.S., Brunetti, C.R., Hendricks, R.L., Tang, Q., Tang, M., Rainbow, A.J.,
Johnson, DC, 1994. Herpes simplex virus glycoproteins E and I facilitate cell-to-
cell spread in vivo and across junctions of cultured cells. J Virol 68, 834-45.

Dingwell, KS, and Johnson, DC, 1998. The herpes simplex virus gE-gI complex
facilitates cell-to-cell spread and binds to components of cell junctions. J Virol 72,
8933-42.

Fargeaud, D., Jeannin, C.B., Kato, F., Chappuis, G., 1984. Biochemical study of the
Feline Herpesvirus 1. Identification of glycoproteins by affinity. Arch Virol 80,
69-82.

Fries, L.F., Friedman, H.M., Cohen, G.H., Eisenberg, R.J., Hammer, C.H., Frank, M.M.,
1986. Glycoprotein C of herpes simplex virus 1 is an inhibitor of the complement
cascade. J Irnmunol 137, 1636-41.

Frink, R.J., Eisenberg, R., Cohen, G., Wagner, E.K., 1983. Detailed analysis of the
portion of the herpes simplex virus type 1 genome encoding glycoprotein C. J
Virol 45, 634-47.

Gaskell, R.M., 1993. Upper respiratory disease in the cat (including chlamydia): control
and prevention. Feline Pract 21, 29-34.

Grail, A., Harbour, D.A., Chia, W., 1991. Restriction endonuclease mapping of the
genome of feline herpesvirus type 1. Arch Virol 116, 209-20.

Harbour, D.A., Howard, P.E., Gaskell, R.M., 1991. Isolation of feline calicivirus and
feline herpesvirus flom domestic cats 1980 to 1989. Vet Rec 128, 77-80.

115

 

Herold, B.C., WuDunn, D., Soltys, N., Spear, P.G., 1991. Glycoprotein C of herpes
simplex virus type 1 plays a principal role in the adsorption of virus to cells and in
infectivity. J Virol 65, 1090-8.

Hidaka, Y., Sakai, Y., Toh, Y., Mori, R., 1991. Glycoprotein C of herpes simplex virus
type 1 is essential for the virus to evade antibody-independent complement-

mediated virus inactivation and lysis of virus-infected cells. J Gen Virol 72, 915-
21.

Jacobse-Geels, H.E., Horzinek, M.C., 1983. Expression of feline infectious peritonitis
coronavirus antigens on the surface of feline macrophage-like cells. J Gen Virol
64 (Pt 9), 1859-66.

Kinchington, P.R., Ling, P., Pensiero, M., Moss, B., Ruyechan, W.T., Hay, J., 1990.
The glycoprotein products of varicella-zoster virus gene 14 and their defective
accumulation in a vaccine strain (Oka). J Virol 64, 4540-8.

Kit, S., 1990. Genetically engineered vaccines for control of Aujeszky's disease
(pseudorabies). Vaccine 8, 420-4.

Kit, S., Awaya, Y., Otsuka, H., Kit, M., 1990. Blocking ELISA to distinguish
pseudorabies virus-infected pigs flom those vaccinated with a glycoprotein gIII
deletion mutant. J Vet Diagn Invest 2, 14-23.

Kruger, J M., Sussman, M.D., and Maes R.K., 1996. Glycoproteins g1 and gE of feline
herpesvirus-1 are virulence genes: safety and efficacy of a gI-gE deletion mutant
in the natural host. Virology 220, 299-308.

Liang, X., Babiuk, L.A., Zamb, T.J., 1992. An in vivo study of a glycoprotein gIII-
negative bovine herpesvirus 1 (BHV-l) mutant expressing beta-galactosidase:
evaluation of the role of gIII in virus infectivity and its use as a vector for mucosal
immunization. Virology 189, 629-39.

Liman, A., Engels, M., Meyer, G., Ackermann, M., 2000. Glycoprotein C of bovine
herpesvirus 5 (BHV-S) confers a distinct heparin-binding phenotype to BHV-l.
Arch Virol 145, 2047-59.Lubinski, J ., Wang, L., Mastellos, D., Sahu, A., Lambris,
J.D., Friedman, H.M., 1999. In vivo role of complement-interacting domains of
herpes simplex virus type 1 glycoprotein gC. J Exp Med 190, 1637-46.

Lubinski, J., Wang, L., Mastellos, D., Sahu, A., Lambris, J.D., Friedman, H.M., 1999.
In vivo role of complement-interacting domains of herpes simplex virus type 1
glycoprotein gC. J Exp Med 190, 1637-46.

Maeda, K., Horimoto, T., Mikami, T., 1998. Properties and firnctions of feline
herpesvirus type 1 glycoproteins. J Vet Med Sci 60, 881-8.

116

 

Maeda, K., Yokoyama, N., Fujita, K., Maejima, M., Mikami, T., 1997. Heparin-binding
activity of feline herpesvirus type 1 glycoproteins. Virus Res 52, 169-76.

Mallory, S., Sommer, M., Arvin, A.M., 1998. Analysis of the glycoproteins I and E of
varicella-zoster virus (V ZV) using deletional mutations of VZV cosmids. J Infect
Dis 178 Suppl 1, S22-6.

Mallory, S., Sommer, M., Arvin, A.M., 1997. Mutational analysis of the role of
glycoprotein I in varicella-zoster virus replication and its effects on glycoprotein
E conformation and trafficking. J Virol 71, 8279-88.

Messerle, M., Crnkovic, I., Hammerschmidt, W., Ziegler, H., Koszinowski, U.H., 1997.
Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial
artificial chromosome. Proc Natl Acad Sci U S A 94, 14759-63.

Mettenleiter, T.C., 1989. Glycoprotein gIII deletion mutants of pseudorabies virus are
impaired in virus entry. Virology 171, 623-5.

Mettenleiter, T.C., Zsak, L., Zuckermann, F ., Sugg, N., Kern, H., Ben-Porat, T., 1990.
Interaction of glycoprotein gIII with a cellular heparinlike substance mediates
adsorption of pseudorabies virus. J Virol 64, 278-86.

Mettenleiter, T.C., 1989. Glycoprotein gIII deletion mutants of pseudorabies virus are
impaired in virus entry. Virology 171, 623-5.

Okazaki, K., Matsuzaki, T., Sugahara, Y., Okada, J ., Hasebe, M., Iwamura, Y., Ohnishi,
M., Kanno, T., Shimizu, M., Honda, E., et al., 1991. BHV-l adsorption is
mediated by the interaction of glycoprotein gIII with heparinlike moiety on the
cell surface. Virology 181, 666-70.

Osterrieder, N., 1999. Construction and characterization of an equine herpesvirus 1
glycoprotein C negative mutant. Virus Res 59, 165-77.

Otsuka, H., Xuan, X., 1996. Construction of bovine herpesvirus-1 (BHV-l)
recombinants which express pseudorabies virus (PRV) glycoproteins gB, gC, gD,
and gE. Arch Virol 141, 57-71.

Pedersen, N.C., Boyle, J .F., Floyd, K., 1981. Infection studies in kittens, using feline
infectious peritonitis virus propagated in cell culture. Am J Vet Res 42, 363-7.

Robbins, A.K., Ryan, J .P., Whealy, M.E., Enquist, L.W., 1989. The gene encoding the

gIII envelope protein of pseudorabies virus vaccine strain Bartha contains a
mutation affecting protein localization. J Virol 63, 250-8.

117

Roizman, B., Knipe, D.M., Whitley, R.J., 2007. Herpes simplex viruses, in: Knipe,
D.M., Howley, P.M. (Eds), Fields Virology. Lippincott Williams & Wilkins,
Philadelphia, pp. 2502-601.

Rota, P.A., Macs, R.K., Ruyechan, W.T., 1986. Physical characterization of the genome
of feline herpesvirus-1. Virology 154, 168-79.

Rudolph, J ., O'Callaghan, D.J., Osterrieder, N., 2002. Cloning of the genomes of equine
herpesvirus type 1 (EHV-l) strains KyA and racLll as bacterial artificial
chromosomes (BAC). J Vet Med B Infect Dis Vet Public Health 49, 31-6.

Rue, C.A., Ryan, P., 2002. Characterization of pseudorabies virus glycoprotein C
attachment to heparan sulfate proteoglycans. J Gen Virol 83, 301-9.

Sandmeyer, L.S., Keller, C.B., Bienzle, D., 2005. Culture of feline corneal epithelial
cells and infection with feline herpesvirus-l as an investigative tool. Am J Vet
Res 66, 205-9.

Saeki, Y., Ichikawa, T., Saeki, A., Chiocca, E.A., Tobler, K., Ackermann, M.,
Breakefield, X.O., F raefel, C., 1998. Herpes simplex virus type 1 DNA amplified
as bacterial artificial chromosome in Escherichia coli: rescue of replication-

competent virus progeny and packaging of amplicon vectors. Hum Gene Ther 9,
2787-94.

Schumacher, D., Tischer, B.K., Reddy, S.M., Osterrieder, N., 2001. Glycoproteins E
and I of Marek's disease virus serotype 1 are essential for virus grth in cultured
cells. J Virol 75, 11307-18.

Schumacher, D., Tischer, B.K., Reddy, S.M., Osterrieder, N., 2001. Glycoproteins E
and I of Marek's disease virus serotype 1 are essential for virus growth in cultured
cells. J Virol 75, 11307-18.

Shizuya, H., Birren, B., Kim, U.J., Mancino, V., Slepak, T., Tachiiri, Y., Simon, M.,
1992. Cloning and stable maintenance of 300-kilobase-pair flagrnents of human

DNA in Escherichia coli using an F -factor-based vector. Proc Natl Acad Sci U S
A 89, 8794-7.

Smith, G.A., Enquist, L.W., 1999. Construction and transposon mutagenesis in
Escherichia coli of a full-length infectious clone of pseudorabies virus, an

alphaherpesvirus. J Virol 73, 6405-14.

Stavropoulos, T.A., Strathdee, C.A., 1998. An enhanced packaging system for helper-
dependent herpes simplex virus vectors. J Virol 72, 7137-43.

118

Sussman, M.D., Macs, R.K., Kruger, J .M., 1997. Vaccination of cats for feline
rhinotracheitis results in a quantitative reduction of virulent feline herpesvirus-1
latency load after challenge. Virology 228, 379-82.

Sussman, M.D., Maes, R.K., Kruger, J.M., Spatz, S.J., Venta, P.J., 1995. A feline
herpesvirus-1 recombinant with a deletion in the genes for glycoproteins g1 and
gE is effective as a vaccine for feline rhinotracheitis. Virology 214, 12-20.

Tai, S.H., Niikura, M., Cheng, H.H., Kruger, J.M., Wise, A.G., Maes, R.K. Complete
sequence of the feline herpesvirus type 1 (FHV-1) genome derived flom a firlly
virulent BAC clone. Submitted.

Tham, K.M., Studdert, M.J., 1987. Clinical and immunological responses of cats to
feline herpesvirus type 1 infection. Vet Rec 120, 321-6.

Warming, S., Costantino, N., Court, D.L., Jenkins, N.A., Copeland, N.G., 2005. Simple
and highly efficient BAC recombineering using galK selection. Nucleic Acids
Res 33, e36.

Weigler, B.J., Guy, J .S., Nasisse, M.P., Hancock, S.I., Sherry, B., 1997. Effect of a live
attenuated intranasal vaccine on latency and shedding of feline herpesvirus 1 in
domestic cats. Arch Virol 142, 2389-400.

Zuckermann, F.A., Mettenleiter, T..C., Schreurs, C., Sugg, N., Ben-Porat, T., 1988.

Complex between glycoproteins gI and gp63 of pseudorabies virus: its effect on
virus replication. J Virol 62, 4622-6.

119

TABLES

 

 

 

 

 

 

 

 

 

 

Table 4.1 Primers used in this study
Primer Sequence (5’ — 3’) Used for
dUL44F taagtagtcccgcgagacgatttacatcccgggatcaccaacaa Generation of gC-
tctgchGGATGACGACGATAAGTAGGG mutating flagrnent
dUL44R ataaccgctgaaacacgggtgataagfltttatacgaactataag
ggcgcagattgttggtgatcccgggatgtaaatcgtctcgcggga
ctacttaCAACCAATTAACCAATTCTGATTAG
dUS3F agacgtagggcaggtttctgttatttaggaagtgtatacgtttggct Generation of gE-
aatAGGATGACGACGATAAGTAGGG mutating flagment
dUS3R ctctgggtgaacctttagagtggttataactttacgaagatggttgc
gggattagccaaacggmcacuccmaamcagawcctgccct
acggctCAACCAATTAACCAATTCTGATTAG
RM1188 AGTCGAAATCACAGGCAGTG Differentiation of gC-
RM1189 TGGAGTCGGT'I'TATATCCATAC mutant and wild type
RM94 GGTCATGTGTAATGTTGACG Differentiation of gE-
RMl 193 ATACAATATACGCGTTTGACG mutant and wild type
RM1206 GCGGTTGTGTCTAATAACTG Confirmation of kan
RM1207 GCTTCCCATACAATCGATAGAT insertion in gC (5’-end)
RM1208 GATTTTGATGACGAGCGTAAT Confirmation of kan
RM1209 CGGTTTATATCCATACGAATGA insertion in gC (3’-end)
RM1210 CGCATAGTGGGTGGTGACCTAA Confirmation of kan
RM1211 ATCATTGGCAACGCTACCTTT insertion in gE (5’-end)
RM1212 TTGCCATTCTCACCGGATTCA Confirmation of kan
RM1213 CCCGGATCGACTAGTGTGAAC insertion in gE (3’-end)
RM1101 TGCCCCTCCCCCGTTCATGCTGTG Confirmation of the
RM1102 TGGAGCCTGTTTCCGATTCTGTGT excision of BAC cassette

 

Sequences in upper-case, nucleotides annealing to template; lower-case, hanging
nucleotides; italic, upstream homologous recombination arm; underlined, downstream
homologous recombination arm.

120

FIGURES AND FIGURE LEGENDS

Figure 4.1 An overview of the two-step Red-recombination approach (Tischer et al.,
2006) used to construct the gC-deleted FHV-1 BAC. Diagrams at the left column depict
events at cellular level, while the right column depicts events at DNA level.
Recombination arms with the same sequence are shown by a line in the same color (red
and blue). Kan: kanamycin resistance gene expression cassette; S: I-SceI recognition
site; arrows: priming sites of RM1188 and RM1189. 1: E. coli SW105 cells carrying
FHV-l BAC were induced for expression of recombination proteins, which were
encoded in mini-lambda DNA. 2: Cells flom step 1 were transformed with a mutating
DNA flagment produced by PCR. 2A: Homologous recombination results in the
replacement of the gC gene by kan. 3: Cells flom step 2 were transformed with pBAD-
I-Scel, a plasmid that carries endonuclease I-Scel. 4: Expression of I-Scel was induced
by arabinose. 5: Cells were induced for expression of recombination proteins. 5A: BAC
DNA was excised by I-Scel, and kan was removed by the second homologous
recombination, resulted in a scarless gC deletion. 6: The gC-deleted FHV-1 BAC was
isolated flom E. coli.

121

 

mini-7.

119021113

gimme FHV-1 BAC
E. CO/i/ gigao target
SW105 gene

1. Induction at 42°C

 

 

 

 

 

2A- ” .
”“8“"9 mm FHV-1
PCR fragment UL43 ' UL45 BAC
~ .
§-— Mutating
4425.. 2. Electroporation kan PCRf'agme'“
O pBADrlrSQeI A ‘ ' 4."
Odo UL43 UL45
0?)
4'. 3. Electroporation
5A. i_‘, ._
UL43 UL45
I 4. Induction with arabinose l
UL45
[ 5. Induction at 42°C .
@J
FHV-1 BAC
[6. BAC isolation @ ”“5 gC‘ mutant

0

Figure 4.1

122

2K
1.6K

 

Figure 4.2 SalI flagments of purified FHV-l BAC (A), FHVlBACAUL44 (B), and
FHVlBACAUS8 (C) were resolved in a 0.7% agarose gel and visualized by ethidium
bromide staining. DNA fragments of 10,120 bp and 769 bp (pink arrows) merged into a
10,120 bp fragment because of gC deletion. DNA flagrnents of 14,020 bp (blue arrows)
became 12,417 bp because of gE deletion. Sizes of the ladder are indicated in bp.

123

 

Figure 4.3 (A) PCRs carried out using primers RMl 188 and RM1189 were resolved in
a 1% agarose gel and visualized by ethidium bromide staining. The 1,879-bp fragment
was amplified flom the FHV-l C-27 strain (Lane 1), and the 274-bp flagment was
amplified from FHVlAgC (Lane 2). (B) PCRs carried out using primers RM94 and
RM1193 were resolved in a 1% agarose gel and visualized by ethidium bromide
staining. The 1,867-bp fragment was amplified flom the FHV-l C-27 strain (Lane 2),
and the 268—bp fragment was amplified flom FHVlAgC (Lane 1). Sizes of the ladders
are indicated in bp.

124

 

Figure 4.4 Development of one FHVlAgC plaque (right panel) and one C-27 strain
plaque (left panel) over a period of 5 days. Magnification, 10X.

125

 

   

  

_ «I
... I

. .3 i ,
T I A _ I." _ ‘3’ ‘—0— FHV-1 C-27 extracellular
‘-r— FHV-1 C-27 intracellular .
+ FHV1AgC extracellular
—r *— FHV1AgC intracellular
- FHV1ABAC extracellular
‘ ~ FHV1ABAC intracellular I

Log Titer ncrcsolml)
A

 

0 7 ' ‘ ' i r
0 10 20 30 40 50
Time (hours p.|.)

Figure 4.5 Single-step growth kinetics of the FHV-1 C-27 strain, FHV IABAC, and the
FHVlAgC. The CRFK cells were infected with the respective virus strain at an MOI of
3. At the indicated times intracellular and extracellular virus were harvested and titrated
on CRFK cells. All growth kinetics was performed in triplicate except for intracellular
and extracellular FHV1 ABAC (1 repeat). Error bars represent :l:l standard deviation.

126

 

‘—¢— FHV—1 C-27 extracellular
i—o— FHV-1 c-27 intracellular l
i -— FHV1AgC extracellular
i_D_ Fl-N1AgC intracellular ‘
Fl-N1ABAC extracelluliag

Log Tlter (T CIDsoIml)

 

0 24 48 72 96 120
Time (hours p.|.)

Figure 4.6 Multi-step growth kinetics of the FHV-1 C—27 strain, FHVlABAC, and the
FHV1 AgC. The CRFK cells were infected with the respective virus at an MOI of 0.01.
At the indicated times intracellular virus (open symbols) and extracellular virus (filled
symbols) were harvested and titrated on CRFK cells. All growth kinetics was performed
in triplicate. Error bars represent :tl standard deviation.

127

 

 

E —+— Fl-N-1 C-27 extracellular
3 -°- FHV-1 C-27 intracellular
g --1-— FHV1ABAC extracelular
5 r FHV1ABAC intracellular
i: + FHV1AgE extracelular
_6'.’

 

,,*ET_EW1A9§l9£@QflIar

 

 

0 10 20 30 40 50
Time (hours p.|.)

Figure 4.7 Single-step growth kinetics of the FHV-l C-27 strain, FHVIABAC, and the
FHVlAgE. The CRFK cells were infected with the respective virus strain at an MOI of
3. At the indicated times intracellular and extracellular virus were harvested and titrated
on CRFK cells. Growth kinetics for FHV-1 C-27 strain was performed in triplicate.

Growth kinetics for FHVIABAC and F HVlAgE is shown in 1 repeat. Error bars
represent i1 standard deviation.

128

 

 

 

—o— Fl-N-1 C-27 extracellular

—o- Fl-N-1 C-27 intracellular
a. Fl-N1ABAC extracellular

«__Lwizlggexrragelular,

 

Log Titer (1'6ngde

 

 

0 24 48 72 96 1 20
Time (hours p.i.)

Figure 4.8 Multi-step growth kinetics of the FHV-1 C-27 strain, FHVIABAC, and the
FHV lAgE. The CRFK cells were infected with the respective virus at an MOI of 0.01.
At the indicated times intracellular virus (open symbols) and extracellular virus (filled
symbols) were harvested and titrated on CRF K cells. All growth kinetics was performed
in triplicate. Error bars represent :l:1 standard deviation.

129

 

CHAPTER 5

 

GENERATION OF gC-gE-, US3 PROTEIN KINASE (PK):

AND PK-gE- MUTANTS OF F ELINE HERPESVIRUS 1 (F HV—l)

130

5. 1 Introduction

In addition to the glycoprotein C (gC) and E (gE) deleted FHV-l mutants
described in Chapter 4, additional FHV-l genes were selected, individually or in
combination, as targets for mutagenesis.

As reviewed in Chapters 1 and 4, glycoprotein E (gE) is a virulence factor of
FHV-1. The gE/gI heterodimer functions in cell-to-cell spread of the virus and spread of
infection throughout the host nervous system, ultimately contributing to neurovirulence. A
partial gE/ g1 deletion mutant previously generated in our laboratory using traditional
methods produced smaller plaques and exhibited significantly reduced virulence (Sussman
et al., 1995). This FHV-l gE/gI mutant, when administered via the oronasal route, can
protect cats from clinical signs and significantly reduce viral loads in subsequent challenge
with a high dose of field virus (Kruger et al., 1996; Sussman et al., 1997). However, this
mutant at higher dose levels still retained partial virulence as it can produce mild clinical
signs. We hypothesize that further attenuation can be achieved by deletion of additional
virulence factors, resulting in a vaccine candidate that is safer and more efficacious.

The US3 gene of FHV-1 encodes a serine/threonine protein kinase (PK), and its
amino acid sequence is conserved in the subfamily Alphaherpesvirinae (Frame et al.,
1987; McGeoch and Davison, 1986; Purves et al., 1987). Possible functions of PK
include blocking of apoptosis induced by both viral and cellular proteins (Leopardi et al.,
1997; Munger et al.,. 2001; Munger and Roizman, 2001; Ogg et al., 2004), regulation of
the nuclear egress of progeny nucleocapsids (Reynolds et al., 2001; Reynolds et al.,

2002), and control of the morphology of infected cells (Kato et al., 2008; Murata et al.,

131

 

2002). Kimman et al. demonstrated that 3 PK' mutant of pseudorabies virus (PRV) has

strongly reduced virulence, and animals inoculated with PK-gE- PRV mutant and

subsequently challenged with wild-type virus has reduced virus shedding (Kimman et
aL,1994)

We expect that single deletion of PK will attenuate FHV-1, and an additional gC
or PK deletion in the gE-deleted FHV-1 mutant will further attenuate the virus, and thus

improve its safety as a vaccine.

5.2 Materials and Methods
Cells, Viruses, Plasmids, and DNA Preparation

The methodologies are presented in Chapters 3 and 4.

Construction of Mutant Viruses

FHV-l PK- mutant was constructed using the FHV-l BAC clone described in
Chapter 3. FHV-1 gC-gE', and PK'gE' mutants were constructed using the FHV-l

gE' BAC clone described in Chapter 4. Site-specific and “scarless” deletions of F HV -1
open reading frames (ORFs) UL44 (encoding gC) and U58 (encoding gE) were carried
out using the two-step Red-mediated recombineering methods developed by Tischer et
al. (2006), as described in Chapter 4. Briefly, mutating DNA fragments were generated
by PCR using the primers dUL44F/dUL44R (for gC deletion), dUSSF/dUSSR (for gE

deletion), or dUS3F/dUS3R (for PK deletion) (Table 5.1). In the first recombination,

132

 

these PCR mutating fragments replaced target gene with kanamycin resistance gene
(kan), an I-SceI recognition site, and an additional 50-bp upstream recombination arm.
The entire ORF of gC and gE was deleted. Because part of the US3 gene was present
twice in the FHV-l I BAC (Chapter 3), only the first 793 hp at the N-terminal of the
entire 1,056-bp ORF were deleted. The kan, I-SceI site, and additional recombination
arm were subsequently removed in the second recombination, resulting in a scarless
deletion. Mutant FHV-1 virions were reconstituted from the mutated BAC as described
in Chapters 3 and 4. PCR assays were designed for differentiation of deletion mutants

and wild type virus throughout the entire process (Table 5.1).

Table 5.1 Primers used in this study

 

 

Primer Sequence (5’ - 3’) Use
dUL44F taagtagtcccgcgagacgatttacatcccgggatcaccaacaat Generation of gC-
ctgchGGATGACGACGATAAGTAGGG mutating fragment

dUL44R ataaccgctgaaacacggttatgataagtaatttatacgaactata

agagcgcagattgtjggtgatcccgggatgtafltcgtctcgcggga
WWgtagttaCAACCAATTAACCAATTCTGATTAG
dUS3F agacgtagggcaggtttctgttatttaggaagtgtatacgtttggcta Generation of gE-
atAGGATGACGACGATAAGTAGGG mutating fragment

dUS3R ctctgggtgaacctttagagtggttataactttacgaagatggttgcg

33W
ggCAACCAATTAACCAATTCTGATTAG

 

 

 

RM1188 AGTCGAAATCACAGGCAGTG Differentiation of gC-
RM1189 TGGAGTCGGTTTATATCCATAC mutant and wild type
RM1343 AGGCACTCAGTGGGCCAAAGT Differentiation of PK-
RM1346 AGGCTGTCTTACACATGAGGCA mutant and wild type

 

Sequence in upper-case, nucleotides annealing to template; lower-case, hanging
nucleotides; italic, upstream homologous recombination arm; underlined, downstream
homologous recombination arm.

133

 

 

5.3 Results and Discussions
Current progress of the construction and in vitro characterization of FHV-1

mutants are summarized in Table 5.2. Construction and in vitro characterization of

FHV-l gC- and gE_ mutants has been completed and reported in Chapter 4. FHV-1
gC' and gE- mutant viruses that carry the BAC vector and EGFP marker was also

generated, but not yet characterized. Construction of PK’ and gC'gE- mutant viruses,
with and without the BAC vector, has been completed. Preliminary findings shows that
these mutant FHV-1 viruses grew poorer in CRFK cells compared to the gC- mutant,
and needed to be propagated by co-cultivating infected and uninfected cells. The US3
gene in a gE' FHV-l BAC clone has been replaced by kan, resulting in a gE'PK"kan+
BAC clone. To obtain scarless deletion mutant viruses, either with or without the BAC
vector and EGFP marker (i.e., gE‘PK'BAC+ or gE'PK'BAC‘), kan will need to be

removed by the second Red-mediated recombination.

134

 

 

Table 5.2 Current progress of the construction and in vitro characterization of FHV-1
mutants.

 

 

 

 

 

Construction In vitro characterization
First Second Propaga- Multi- Single- Plaque
Virus recom- recom- tron Of step step size
bination bination mutant gr OWth gr OWth analysis
vrrus curve curve
gC'BAC+ o o o o O o
gC‘BAC' O O O O O I
gE-BAC+ o o o o o o
gE-BAC' O O O O G O 1
PK'BAC+ o o o o o o .-
PK-BAC' O O O 1 O O :
gC-gE'BAC+ O O O O O O j
gC‘gE‘BAC‘ o o o o o o -
gE'PK'BAc+ o c o O o o l
gE'PK—BAC' O C O O O O

 

0: completed, 1: in progress, 0: to be done.

135

5.4 Reference

Frame, M.C., Purves, F.C., McGeoch, D.J., Marsden, H.S., Leader, DR, 1987.
Identification of the herpes simplex virus protein kinase as the product of viral
gene US3. J Gen Virol 68, 2699-704.

Kato, A., Tanaka, M., Yamamoto, M., Asai, R., Sata, T., Nishiyama, Y., Kawaguchi, Y.,
2008. Identification of a physiological phosphorylation site of the herpes simplex
virus l-encoded protein kinase US3 which regulates its optimal catalytic activity
in vitro and influences its function in infected cells. J Virol 82, 6172—89.

Leopardi, R., Van Sant, C., Roizman, B., 1997. The herpes simplex virus 1 protein
kinase US3 is required for protection from apoptosis induced by the virus. Proc
Natl Acad Sci U S A 94, 7891-6.

Kimman, T.G., De Wind, N., De Bruin, T., de Visser, Y., Voermans, J., 1994.
Inactivation of glycoprotein gE and thymidine kinase or the US3-encoded protein
kinase synergistically decreases in vivo replication of pseudorabies virus and the
induction of protective immunity. Virology 205, 511-8.

Kruger, J.M., Sussman, M.D., Maes, R.K., 1996. Glycoproteins g1 and gE of feline
herpesvirus-l are virulence genes: safety and efficacy of a gl-gE deletion mutant
in the natural host. Virology 220, 299-308.

McGeoch, D.J., Davison, A.J., 1986. Alphaherpesviruses possess a gene homologous to
the protein kinase gene family of eukaryotes and retroviruses. Nucleic Acids Res
14, 1765-77.

Munger, J ., Chee, A.V., Roizman, B., 2001. The U(S)3 protein kinase blocks apoptosis
induced by the d120 mutant of herpes simplex virus 1 at a premitochondrial stage.
J Virol 75, 5491-7.

Munger, J., Roizman, B., 2001. The US3 protein kinase of herpes simplex virus 1
mediates the posttranslational modification of BAD and prevents BAD-induced

programmed cell death in the absence of other viral proteins. Proc Natl Acad Sci
U S A 98,10410-5.

Murata, T., Goshima, F., Nishizawa, Y., Daikoku, T., Takakuwa, H., Ohtsuka, K.,
Yoshikawa, T., Nishiyama, Y., 2002. Phosphorylation of cytokeratin 17 by herpes
simplex virus type 2 US3 protein kinase. Microbiol Immunol 46, 707-19.

Ogg, P.D., McDonell, P.J., Ryckman, B.J., Knudson, C.M., Roller, R.J., 2004. The

HSV-1 US3 protein kinase is sufficient to block apoptosis induced by
overexpression of a variety of Bel-2 family members. Virology 319, 212-24.

136

 

 

 

Purves, F.C., Longnecker, R.M., Leader, D.P., Roizman, B., 1987. Herpes simplex virus
1 protein kinase is encoded by open reading frame US3 which is not essential for
virus growth in cell culture. J Virol 61, 2896-901.

Reynolds, A.E., Ryckman, B.J., Baines, J.D., Zhou, Y., Liang, L., Roller, R.J., 2001.
U(L)3l and U(L)34 proteins of herpes simplex virus type 1 form a complex that

accumulates at the nuclear rim and is required for envelopment of nucleocapsids.
J Virol 75, 8803-17.

Reynolds, A.E., Wills, B.G., Roller, R.J., Ryckman, B.J., Baines, J.D., 2002.
Ultrastructural localization of the herpes simplex virus type 1 UL31, UL34, and

US3 proteins suggests specific roles in primary envelopment and egress of
nucleocapsids. J Virol 76, 8939-52.

Sussman, M.D., Maes, R.K., Kruger, J.M., 1997. Vaccination of cats for feline
rhinotracheitis results in a quantitative reduction of virulent feline herpesvirus-1
latency load after challenge. Virology 228, 379-82.

Sussman, M.D., Macs, R.K., Kruger, J.M., Spatz, S.J., Venta, P.J., 1995. A feline
herpesvirus-l recombinant with a deletion in the genes for glycoproteins g1 and
gE is effective as a vaccine for feline rhinotracheitis. Virology 214, 12-20.

Tischer, B.K., von Einem, J ., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated

recombination for versatile high-efficiency markerless DNA manipulation in
Escherichia coli. Biotechniques 40, 191-7.

137

 

CHAPTER 6

CONCLUSIONS AND FUTURE DIRECTIONS

138

 

 

6. 1 Conclusions
6.1.1 The FHV-l BAC Clone

The entire FHV-1 genome was cloned as a BAC and transformed into E. coli for
maintenance and fiiture manipulation. The virus derived from this BAC clone grew to a
high titer in cell culture, produced plaques that are similar in size to those produced by
the C-27 parent strain, and is virulent in vivo. Therefore, this FHV-1 BAC clone is a
very suitable starting platform for studies on viral virulence, as well as development of

future vaccine candidates.

6.1.2 The Complete Sequence of the FHV-1 Genome
Complete genomic sequences were derived from both the FHV-1 BAC clone and
purified virion DNA. The FHV-l genome is 135,797 bp in size with an overall G+C

content of 45%. A total of 78 open reading frames were predicted, encoding 74 distinct

proteins. The gene arrangement is collinear with that of most sequenced varicelloviruses.

6.1.3 F HV-l Mutants Lacking Glycoprotein C (gC) or E (gE)
FHV-1 mutants lacking the entire open reading flames encoding gC or gE were
constructed, based on the FHV-1 BAC clone. Results of in vitro characterization

indicate that gC plays a role in initial attachment/penetration, replication, and egress of
FHV-1. The gC- mutant is more cell-associated and has a reduced in growth rate. In
contrast, the gE' FHV-l grew to a high titer in cell culture. Results of in vitro

characterization suggest that virus egress, and most likely cell-to-cell spread were

affected by gE deletion, while virus entry and replication were not. Both mutants are

139

 

likely to be attenuated, and further studies are necessary to evaluate their in vivo

characteristics and potential as vaccine candidates.

6.1.4 Other Deletion Mutants
A gC’gE‘, an US3 protein kinase (PK)_, and a gE—PK"l<an+ mutant of FHV-l
were generated. Both the gC-gE‘ and the PK' mutants demonstrated reduced growth

rates in CRF K cells.

6.2 Future Directions
6.2.1 Transcriptional & translational analyses

The construction of deletion mutants was verified by PCR, restriction pattern
analyses, and sequencing. No parts of other predicted ORFs, promoters, or
polyadenylation signals were deleted in our mutants. Nonetheless, it would be of
interest to check the transcription and translation of both the deleted and adjacent genes.
Transcriptional analyses can be carried out by infecting CRFK cells with respective
mutant virus, harvesting infected cells when they reach 50% CPE, extracting total RNA
from those cells, and performing RT-PCR using primer sets listed in Table l.
Monoclonal antibodies specific for the proteins encoded by UL44, US3, US8, and their
adjacent genes will be needed to perform translational analyses. After infecting CRFK
cells with respective mutant virus, and allowing for CPE to develop, total protein can be
extracted, separated on a polyacrylamide gel, and transferred to a membrane for

immunoblots.

140

 

 

Table 6.1 Primers for transcriptional analysis

 

 

 

Target gene Primer Sequence (5’ — 3’)
UL45 RM1409 acgacagctatttcatcgcgtagg
RM1410 ctccaacagcagatgcggtgg
UL44 RM1350 acgcgacactcgggatccta
RM1351 cactgcacataccgcctcaaagg
UL43 RM 141 1 gcctcggtattgcatgctcga
RM 1412 cggtagaccatcaaaggttccagg
U82 RM1419 agattcatacatacgacagataaac
RM 1420 ttggcccactgagtgcctaatgtg
US3 RM1421 aacgaagctcctcgtggtatgctg
RM 1422 aacgggtgtctcactccctgga
US4 RM 1423 cggggatgttttcccgaattgg
RM1424 catggttcggtcgtaggctcga
US7 RM1413 cctctatgcaccaatacgatcagc
RM 1414 gtccgcatgatgtcgatgaccac
US8 RM 1 352 caccaacgcttctgggttgtacg
RM 1353 tctccgtggtaggcgactgc
USSA RM 1415 agctgctcgtaaactccgtgag
RM1416 cataggacggatagtcccatgtg
US9 RM 1417 tgccacagatgataattgcttagacac
RM1418 tgtcggatagagtttcatccgcaa

 

6.2.2 Testing of the mutants in other feline cells

The mutants may behave differently in different types of cells. Other cell lines
that can be used include Felis catus whole fetus (FCWF-4) cells, feline corneal
epithelial (FCE) cells, feline alveolar macrophages, alveolar pneumocytes, and CD4+
T-lymphoblastoid cells (MYA-l and FL74 cells). Tracheal organ culture and mucosal

explants can also be used for future characterization of the mutants.

6.2.3 In vivo testing of the FHV-1 mutants
Attenuation and potential of the FHV-1 mutants as vaccine candidates need to be
assessed in vivo. To evaluate residual virulence, a safety study can be carried out with

groups of SPF cats, each inoculated intranasally with the FHV-1 mutant under study, or

141

mock-inoculated. Clinical signs would be scored, and swab and serum samples
analyzed as described in Chapter 3. To evaluate the protection against field virus
infection, each group of cats would be challenged with a high dose of wild-type virus.
Clinical signs are scored, and swab and serum samples analyzed as described in Chapter

3.

6.2.4 A gC-complementing Cell Line
Ideally, a vaccine candidate should grow to a high titer to reduce production costs.

This is not always feasible, as in vitro high growth titer is often associated with

virulence. It is very likely that the FHV-1 gC- and gC-gE- mutants are safe and can
induce strong immune response in vivo. The reduction of the gC' and especially the

gC'gE' mutant can be complemented by supplying gC in trans. A gC-complementing

cell line can be constructed by cloning the ORF of gC into an eukaryotic expression
vector, and transfecting CRFK cells with the plasmid clone. A gC-complementing cell
line can be obtained by screening transfected cells for the expression of marker genes
(e.g., fluorescent proteins), and clonal expansion of positive cells. Expression of gC on
the cell surface can be verified using polyclonal antibodies and direct or indirect FA
staining procedures. Progeny virions produced by infecting this cell line with FHV-1
gC- mutant should carry gC on their envelope but not the ORF encoding gC.

Using the same method, a gE-expressing cell line can also be constructed. It is not

as necessary to complement gE in gE- FHV-1 mutants, since the reduction in grth of

the gE- mutant is minimal. However, it can be useful as described in Section 6.2.5.

142

 

6.2.5 DIVA ELISA

Cell lines expressing FHV-1 gC or gE are useful for more than complementing
respective glycoproteins. An enzyme-linked immunosorbent assay (ELISA) capable of
differentiating between infected and vaccinated animals (DIVA) can be established
using a gC- or gE-expressing cell line. Monolayers of gC- or gE-expressing cells are
grown in wells of a 96-well plate, fixed in acetone and stored at -20°C until needed.
Sera collected from cats are added to the individual wells, allowing binding of anti-gC
or anti-gE antibodies. Secondary anti-cat IgG antibodies conjugated with an enzyme are
added, followed by a substrate/chromogen mixture to develop color. Alternatively,
fluorescein isothiocyanate (F IT C) -lableled anti-species antibodies can be used. Cats
infected by the field strains have antibodies against gC or gE, and can be detected by
this assay. Cats infected by the deletion mutant do not have antibodies against gC
and/or gE, and will be negative in this assay.

Another potential DIVA ELISA format consist of coating wells with affinity
purified gC or gE produced by a eukaryotic expression vector.

The availability of DIVA is important for disease control. Since none of the
current vaccines can be serologically differentiated from field strains, such DIVA

ELISA assays add value to the FHV-1 deletion mutants as vaccine candidates.

143

6.2.6 Further engineering of the gE- and gC- mutants

To further attenuate the gE' and gC- mutants, mutations can be introduced into
additional FHV-l genes, using the same methodology. A reasonable target gene is
UL23, encoding the thymidine kinase (TK). TK' mutants of many alphaherpesviruses,

including FHV-l, have been shown to be attenuated. Components of other important
viruses infecting cats, e.g. feline calicivirus, feline immunodeficiency virus, or feline

panleukopenia virus, can be inserted into the FHV-1 BAC as well.

144

APPENDICES

Appendix A USDA scoring method for clinical signs of FHV-1 infections.

 

 

Clinical signs Days Score
Fever
103.0 to 103.9°F 1 each day
104.0 to 104.9°F 2 each day
>105°F 3 each day
Conjunctivitis
Serous discharge only 1 to 3 1
>4 2
Mucopurulent discharge 1 to 2 2
3 to 5 4
a6 6
Rhinitis
Serous discharge only 1 to 3 1
>4 2
Mucopurulent discharge 1 to 2 2
3 to 5 4
36 6
Sneezing 1 each day
Dyspnea
Audible rales 2 each day
Coughing 2 each day
Open mouth breathing 3 each day
Depression
Anorexia 1 each day
Dehydration 1 to 2 3
23 4
Hypothermia <99°F 2 each day
Oral ulcers (linguinal or oral mucosa)
1 ulcer <4 mm 1 to 5 2
6 to 9 3
310 4
Multiple ulcers <4 mm 1 to 4 3
5 to 8 5
>9 7
Ulcer or ulcers >4 mm 1 to 4 5
5 to 8 7
29 9
Salivating 1 each day
Extenal ulcers (lip or nares)
Nonbleeding ulcer 4
Bleeding ulcer 6
Death 15 ‘

 

Sussman, M.D., Maes, R.K., Kruger, J.M., Spatz, S.J., Venta, P.J., 1995. A feline herpesvirus-l
recombinant with a deletion in the genes for glycoproteins g1 and gE is effective as a vaccine for

feline rhinotracheitis. Virology 214, 12-20.

USDA Supplemental Assay Method 311 (US. Department of Agriculture, Animal and Plant Health
Inspection Service, National Animal Veterinary Services Laboratory, 1985.)

145

Appendix B Clinical scores recorded in the pilot in vivo study (Chapter 3)

Cat Identification: AJ03 Group: Negative Control
Color: Orange Sex: F Age: 11-13 weeks
Scoring: Janice
Quail Cement

mmmmm
mmmmmafimmmm

 

0 09/04/07 N N N N N
1 09/05/07 N N N N N N N
2 09/06/07 N N N N N N N
3 09/07/07 N N N N N N N
4 09/08/07 N N N N N N N
5 09/09/07 N N N N N N N
6 09/10/07 N N N N N N N
7 09/11/07 N N N N N N N
6 09/12/07 N N N N N N N
9 09/13/07 N N N N N N N
10 09/14/07 N N N N N N N
11 09/15/07 N N N N N N N
12 09/16/07 N N N N N N N
13 09/17/07 N N N N N N N
14 09/16/07 N N N N N N N

Score - 0 0 0 0 - — 0

Nasal Qtai External 122:

max Discharge Salazar/m 1119mm: ulceration lmtratiszn Alumna 12mm 19mm
0 N N N N N Y 36. 6 97. 9
1 N N N N N Y - -
2 N N N N N Y — -
3 N N N N N Y - -
4 N N N N N Y - —
5 N N N N N Y - -
6 N N N N N Y — —
7 N N N N N Y - -
8 N N N N N Y - -
9 N N N N N Y — —
10 N N N N N Y — —
11 N N N N N Y - -
12 N N N N N Y - -
13 N N N N N Y - —
14 N N N N N Y — -

Score 0 0 0 0 0 0 — 0

Total Score = 0

Y: yes; N: no; S: serous; MP: mucopurulent; —: not applicable.

146

Appendix B, continued

Cat Identification: AJ03 Group: Negative Control
Color: Orange Sex: F Age: 11-13 weeks
Scoring: Sheldon
Qnen Qnmeel

MenthBLennzuleenniannuler
QAXQateSneezeQnennBeleeflre'fmeneeleneeimmlme

0 09/04/07 N N N N N
1 09/05/07 N N N N N N N
2 09/06/07 N N N N N N N
3 09/07/07 N N N N N N N
4 09/08/07 N N N N N N N
5 09/09/07 N N N N N N N
6 09/10/07 N N N N N N N
7 09/11/07 N N N N N N N
8 09/12/07 N N N N N N N
9 09/13/07 N N N N N N N
10 09/14/07 N N N N N N N
11 09/15/07 N N N N N N N
12 09l16/07 N N N N N N N
13 09/17/07 N N N N N N N
14 09I18/07 N N N N N N N

Score — 0 0 0 0 - — 0

Nasal Qrel External 122
nnx Qienlleme Salli/alien uleeLallnn itinerarinn Malina Anmiite Ielnnlm Iemnifl
N N N N 36 6 97.9

1 N N N N N Y 37.3 99.1
2 N N N N N Y — —
3 N N N N N Y - —
4 N N N N N Y — -
5 N N N N N Y — —
6 N N N N N Y — -
7 N N N N N Y - —
a N N N N N Y - —
9 N N N N N Y — —
10 N N N N N Y - -
11 N N N N N Y - -
12 N N N N N Y - -
13 N N N N N Y - -
14 N N N N N Y - -

Score 0 0 O O O 0 — 0

Total Score = 0

Y: yes; N: no; S: serous; MP: mucopurulent; —: not applicable.

147

 

Appendix B, continued

Cat Identification: AJCZ Group: BAC
Color: Grey Tabby Sex: F Age: 11-13 weeks
Scoring: Janice

Qnen Corneal
Merlinmannzmnelenflnder
QMQetefimezeQnuehBeheflreehenaethneniMQieeneme

0 09/04/07 N N N N N N
1 09/05/07 N N N N N N N
2 09/06/07 N N N N N N N
3 09/07/07 N N N N N N N
4 09/08/07 N N N N N N N
5 09/09/07 N N N N N N S
6 09/10/07 Y N N N N N S
7 09/11/07 Y N Y N N N S
8 09/12/07 Y Y Y N N N S
9 09/13/07 Y N Y N N N N
10 09/14/07 N N Y SLIGHT N N N N
11 09/15/07 N N Y SLIGHT N N N N
12 09/16/07 N N N N N N N
13 09/17/07 Y N Y SLIGHT N N N N
14 09/18/07 N N N N N N N
Score - 5 2 12 0 - — 2
Diesel 913! Enemel De;
12A! Discharge W Uleeratien uleeralinn lmlretinn Annette Iemnfl). Iemnlfl
0 N N N N 37. 2 99.0
1 N N N N N Y 37.1 98.8
2 N N N N N Y 33.1 91.6
3 N N N N N Y 37.0 98.6
4 N N N N N Y 37.8 100.0
5 N N N N N Y 38.0 100.4
6 N N N N N Y 37.0 98.6
7 S N N N Y SLIGHT Y 37.5 99.5
8 N N N N N Y SLIGHT 37.0 98.6
9 S N N N Y SLIGHT N 37.6 99.7
10 N N N N N Y 37.1 98.8
11 N N N N N Y 37.0 98.6
12 S N N N N Y 37.6 99.7
13 N N N N N Y 37.0 98.6
14 N N N N N Y 37.7 99.9
Score 1 0 0 0 3 2 - 0
Total Score = 27

Y: yes; N: no; S: serous; MP: mucopurulent; —: not applicable.

148

Appendix B, continued

Cat Identification: AJCZ Group: BAC
Color: Grey Tabby Sex: F Age: 11-13 weeks
Scoring: Sheldon

an Semeal
Mnethfllennzttleenalengnular
DAYQateSneezeSnuehBaleeEreathenaethnanlMDIeename

09/04I07 N N N
1 09/05/07 N N N N N N N
2 09/06/07 N N N N N N N
3 09I07/07 N N N N N N N
4 09/08/07 N N N N N N N
5 09/09/07 N N N N N N S
6 09/10/07 Y N N N N N S
7 09l1 1/07 Y Y N N N N S
8 09l12/O7 Y Y N N Y N S
9 09/13/07 Y N N N N N N
10 09/14/07 N N N N N N N
1 1 09I15/07 N N N N N N N
12 09I16/07 N N N N N N N
13 09/17/07 Y N N N N N N
14 09/18/07 N N N N N N N
Score — 5 4 0 0 - - 2

Qrel External De;
DA! WWWWMMMM

N N N N 37. 2 99. 0
1 N N N N N Y 37.3 99.1
2 N N N N N Y 38.4 101.1
3 N N N N N Y 37.0 98.6
4 N N N N N Y 37.8 100.0
5 N N N N N Y 38.0 100.4
6 N N N N N Y 37.2 99.0
7 S N N N Y Y 37.5 99.5
8 N N N N N N 37.0 98.6
9 N N N N N Y 37.6 99.7
10 S N N N N Y 37.1 98.8
1 1 S N N N N Y 37.5 99.5
12 S N N N N Y 37.0 98.6
13 N N N N N Y 37.0 98.6
14 N N N N N Y 37.7 99.9
Score 2 0 0 0 3 1 - 0
Total Score = 17

Y: yes; N: no; S: serous; MP: mucopurulent; —: not applicable.

149

Appendix B, continued

Cat identification: AJCS Group: BAC
Color: Brown Grey Tabby Sex: F Age: 11-13 weeks

Scorinnganice

Qnen Semeal

Mnutn Slenn; weenainn Qallar
12A! Date Sneeze Senna Bales SLeNatn enaem lQnaeInaQieenarne

 

0 09/04/07 N N N N N
1 09/05/07 N N N N N N N
2 09/06/07 N N N N N N N
3 09/07/07 N N N N N N N
4 09/08/07 N N N N N N N
5 09/09/07 Y N N N N N N
6 09/10/07 N N N N Y N N
7 09/11/07 Y N Y N Y N S
8 09/12/07 Y N Y N Y N S
9 09/13/07 N Y Y N Y N S
10 09/14/07 Y Y Y N N N S
11 09/15/07 Y N Y SLIGHT N N N S
12 09/16/07 Y N Y SLIGHT N N N S
13 09/17/07 Y N Y SLIGHT N N N MP?
14 09/18/07 N N N N N N S
Score — 7 4 14 0 - — 2
Nasal Qrel Extemal Qt
12A! Discharge Sallxatine Mineratinn tlleetattnn hieratinn Annette Iean’Qt Iemnlfl
N N N N 37. 2 99. o
1 N N N N N Y 37.3 99.1
2 N N N N N Y 37.4 99.3
3 N N N N N Y 36.0 96.8
4 N N Y N N Y 38.6 101.5
5 N N Y N N Y 38.0 100.4
6 N N Y N N Y 38.3 100.9
7 S N N N Y SLIGHT Y 37.0 98.6
8 S N Y N Y N 37.4 99.3
9 S N N N Y SLIGHT N 37.7 99.9
10 MP N N N Y N 36.3 97.3
11 S N N N Y SLIGHT Y 37.2 99.0
12 S N N N N Y 36.8 98.2
13 N N N N N Y 37.5 99.5
14 S N N N N Y 37.0 98.6
Score 2 0 2 0 4 3 — 0
Total Score = 38

Y: yes; N: no; S: serous; MP: mucopurulent; —: not applicable.

150

Appendix B, continued

Cat identification: AJC3 Group: BAC
Color: Brown Grey Tabby Sex: F Age: 11-13 weeks
Scoring: Sheldon

Qnen Semen!

Mnlltn Eleni]; weenatnn inlar
0A1 Date Sneeze Seven Bales Steam enaem thenim Discharge
09/04/07
09/05/07
09/06/07
09/07/07
09/08/07
09/09/07
09/10/07
09/11/07
09/12/07
09/13/07
09/14/07
09/15/07
09/16/07
09/17/07
09/18/07

uz<<<<z<<z<zzzzz
0222222222222222
0222222222222222
0222222222222222
Izzzzzz<z<zzzzzz
lzzzzzzzzzzzzzzz
mzzzzzmmmmmzzzzz

ggagjaomwmmhwmao

Qral Eternal D:
12A! WWWWWMMM

0 N N N N 37. 2

1 N N N N N Y 37.4 99. 3
2 N N N N N Y 38.1 100.6
3 N N N N N Y 36.8 98.2
4 N N 1 N N Y 38.6 101.5
5 N N 1 N N Y 38.0 100.4
6 N N 1 N N Y 38.3 100.9
7 S N 1 N N Y 37.0 98.6
8 N (MP?) N 1 N N Y 36.8 98.2
9 N N N N N Y 37.7 99.9
10 MP N N N N Y 36.3 97.3
11 N (MP?) N N N N Y 37.7 99.9
12 S N N N N Y 36.8 98.2
13 N N N N N Y 37.5 99.5
14 N N N N N Y 37.0 98.6

Score 2 0 2 0 0 0 - 0
Total Score = 13

Y: yes; N: no; S: serous; MP: mucopurulent; —: not applicable.

151

Appendix B, continued

Cat identification: AJJ5 Group: Positive Control
Color: Black Sex: F Age: 1 1-13 weeks
Scoring: Janice
an Serneal

Menthfllenntuertelaneeler
QAXDateSneezeSnunnBaleeEreatnenaemignaeMQieenflne

 

0 09/04/07 N N N N N
1 09/05/07 N N N N N N N
2 09/06I07 N N N N N N N
3 09/07/07 Y N N N N N N
4 09/08/07 Y N N N N N S
5 09/09/07 Y N N N N N S
6 09/10/07 Y N N N N N S
7 09/11/07 Y N Y Y N N S
8 09/12/07 Y N Y N N N S
9 09/13/07 N N Y N N N S
10 09/14/07 N N Y N N N S
11 09/15/07 N N Y SLIGHT N N N S
12 09/16/07 N N N N N N S
13 09/17/07 Y N Y N N N MP
14 09/18/07 N N N N N N MP
Score - 7 0 12 3 - — 2
Nasal Qral External D:
DAY Qieeherne Sainlatlne ulneratien itineratinn mam Annette lemnifl Iemnlfl
0 N N N N 37. 1
1 N N N N N Y 37.0 98.6
2 N N N N N Y 37.2 99.0
3 N N N N N Y 38.0 100.4
4 N N N N Y SLIGHT Y 40.1 104.2
5 S N N N N Y 37.8 100.0
6 S N N N N Y 35.0 95.0
7 N N N N N Y 38.1 100.6
8 S N N N N Y 37.0 98.6
9 S N N N N Y 37.0 98.6
10 S N N N N Y 37.4 99.3
11 s N N N N Y 37.6 99.7
12 S N N N N Y 36.3 97.3
13 MP BLOODY N N N N Y 37.0 98.6
14 MP BLOODY N N N N Y 38.0 100.4
Score 2 0 0 0 3 0 — 1
Total Score = 30

Y: yes; N: no; S: serous; MP: mucopurulent; —: not applicable.

152

Appendix B, continued

Cat Identification: AJJ5 Group: Positive Control
Color: Black Sex: F Age: 1 1-13 weeks
Scoring: Sheldon
gm Corneal
Melltn Benn tlleerlam Sealer
2A1 Date Sneeze Snuen Bales Breath eneem thaeilxi Qieeharee

0 09/04/07 N N N N N
1 09/05/07 N N N N N N N
2 09/06/07 Y N N N N N N
3 09/07/07 Y N N N N N N
4 09/08/07 Y N N N N N S
5 09/09/07 Y N N N N N S
6 09/10/07 Y N N N N N S
7 09/1 1/07 Y N N N N N S
8 09/12/07 Y N N N N N S
9 09/13/07 N N N N N N S
10 09/14/07 N N N N N N S
1 1 09/15/07 N N N N N N S
12 09/16/07 N N N N N N S
13 09/17/07 N N N N N N S
14 09/18/07 N N N N N N MP
Score - 7 0 0 0 - — 2

9:31 External 0:
DAY WWWWWMMM

0 N N N N 37. 1 98. 8
1 N N N N N Y 37.7 99.9
2 N N N N N Y 38.2 100.8
3 N N N N N Y 38.6 101.5
4 N N N N N Y 40.1 104.2
5 S N N N N Y 37.8 100.0
6 S N N N N Y 35.0 95.0
7 S N N N N Y 38.1 100.6
8 N (MP?) N N N N Y 37.0 98.6
9 N N N N N Y 37.4 99.3
10 MP N N N N Y 37.4 99.3
11 MP N N N N Y 37.6 99.7
12 MP N N N N Y 36.5 97.7
13 MP N N N N Y 37.0 98.6
14 MP N N N N Y 38.0 100.4
Score 4 0 0 0 0 0 — 1
Total Score = 14

Y: yes; N: no; S: serous; MP: mucopurulent; —: not applicable.

153

    

  
 

NS

will)llllllillilliilillilfllllllllililllllEs