ﬁg :ﬁ

 

,. 5,. :

m,

 

. new“. .
ya; ..
A i , "a
s.
e.

.
..
::
$4...

.6

...
9w. 5. . _
but? “an! :2.
Kai‘s: d
2mm... 5
.21.
.z

. :1
a).
2...:

0.9.3.6

\A 1!
3.19.3 .3
.2... i 1:? 2
1133.513:
24.1.. 3::
~§3§ snail
1.1.3. :3-

 

“guﬁnn
‘ \

"”101.

o 5.. 4.
whim a.

 

 

 

 

 

 

 

,2 a

,t 53 _ LIBRARY

*' * Mmhtgan State ,
.2 University
This is to certify that the

dissertation entitled

EVALUATING AND MODIFYING ADENOVIRUS VECTOR
INTERACTIONS WITH MULTIPLE ARMS OF THE INNATE
IMMUNE SYSTEM

presented by

Sergey Seregin

has been accepted towards fulﬁllment
of the requirements for the

PhD degree in Microbiology and Molecular
Genetics

 

 

 

' Major Pi'ofessof’s Signature
O ‘l' O 41 ~63 o l 0

Date

 

MSU is an Afﬁrmative Action/Equal Opportunity Employer

 

-._ - -.--a-.—.--u-t-.-p-

0'-l-'-C-O-O-I-I-I-U-l-‘-O-O-O-I-C-.-I-D-I-C-I-‘-O-O-0-O-I-I-'-I-l-l-n->-.-— a.

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5’08 K:IProleoc&Pres/ClRC/Dat90m.hdd

 

EVALUATING AND MODIFYING ADENOVIRUS VECTOR INTERACTIONS
WITH MULTIPLE ARMS OF THE INNATE IMMUNE SYSTEM

By

Sergey Seregin

A DISSERTATION
Submitted to
Michigan State University

in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Microbiology and Molecular Genetics

2010

 

 

ABSTRACT

EVALUATING AND MODIFYING ADENOVIRUS VECTOR INTERACTIONS
WITH MULTIPLE ARMS OF THE INNATE IMMUNE SYSTEM

By
Sergey Seregin

A single, universally adaptable gene transfer vector cannot be envisioned
for use in all human clinical gene transfer applications. However, Adenovirus (Ad)
based vectors offer several important beneﬁts compelling their potential for use in
a wide range of gene transfer applications. Ad vectors can be readily produced to
cGMP guidelines, which allowed their safe usage in thousands of clinical trial
subjects. Unfortunately, upon contact with the circulatory system and/or cellular
membranes, Ads induce several, innate, complement dependent toxicities that
limit more widespread utilization of this promising platform. In addition, Ad
derived transgene expression is greatly diminished when pre-existing Ad
immunity is present in the host. These limitations have driven initiation of several
distinct approaches to improve the safety/efﬁcacy proﬁles of Ad-based vectors,
including: the generation of chemically modiﬁed Ad capsids and/or chimeric Ads;
the complete replacement of common Ad-based serotypes with alternative
(human and non-human origin) Ad serotypes; genome modiﬁcation of common
(Ad5) serotype in attempts to improve the efﬁcacy of the platform as well
minimize acute innate responses to the vector itself.

In this dissertation, I describe the pivotal role that the complement system
plays in regulating Ad safety and efﬁcacy. l unveil the mechanism underlying the

complement dependent induction of neutralizing antibodies to Ad capsids as a

C3 and CR1I2-dependent phenomenon that correlates with B-oell activation.
Moreover, I have constructed several novel Ad5-based vectors, “capsid-
displaying” complement regulatory peptide (COMPinh), as ﬁber or plX fusion
proteins. These novel Ads dramatically minimize Ad-dependent activation of the
human and non-human primate complement systems. We have also
demonstrated that a simple, pre-emptive and transient glucocorticoid pre-
treatment is a viable approach to reduce Ad associated acute toxicities, without
reducing efﬁcacy of Ad mediated gene transfer, suggesting that glucocorticoid
therapy can be combined with the use of novel capsid-displaying Ads to further
improve the outcome.

Previous studies have demonstrated that several signaling pathways are
triggered by Ads, inclusive of TLR dependent pathways. Here, I have unveiled an
important role for the G-protein coupled receptor adaptors B-arrestin1 (B-Arr1)
and ﬂ-arrestinz (B-Arr2) in Ad5 vector-induced inﬂammatory responses, thereby
identifying them as new potential targets in attempts to improve Ad vector
safety/efﬁcacy proﬁle.

Future studies will expand upon these ﬁndings. I leave readers with the
view that utilizing a combination of the approaches, summarized herein will likely
improve the capabilities of this important vector platform for expanded use in a

number of additional human and agricultural applications.

DEDICATION

I would like to dedicate this dissertation to my parents. My parents, who are
both scientists, are happy that one of their four children followed their path. I'm
extremely grateful for their paramount and unbelievable support, unconditional
love and care, throughout all my educational steps. My parents live in Russia and
I miss them very much — l have not seen my Father for over four years. I’m happy
that upon Graduation I will ﬁnally have an opportunity to visit them in summer
2010. I would like to express my love to my beautiful sisters, Dina and Maria and
my brother Alexander. I love my family so much, and I would not have made it this

far without their support.

iv

ACKNOWLEDGEMENTS

I would like to take the opportunity to thank everyone who contributed to
my development as an independent investigator — the path I continue to follow to
become one. First and foremost, I express my profound gratitude to my mentor
Dr. Andrea Amalﬁtano, a leading researcher in a ﬁeld of Adenovirus-based gene
transfer. He kindly allowed me to join his newly formed lab, here at Michigan State
University in early 2006, and since then constantly supported and encouraged me
to develop scientiﬁc thinking, writing skills, critical data analysis and planning of
experiments. His sincere guideless, patience and continuous support created, in
my opinion, productive and positive atmosphere in our lab. Dr. Amalﬁtano has a
unique ability to sense a “golden middle” in supervising graduate students,
allowing them to reach an answer I accomplish a task by themselves and only
when person is puzzled, he provides precious scientiﬁc advice. This “smart
guideless” takes a lot of his time, patience and effort, and I’m extremely happy,
Dr. Amalfitano utilized this approach and feel that l have greatly improved all my
skills, associated with future scientiﬁc career. Dr. Amalﬁtano is my best role model
for a scientist, scientiﬁc advisor, teacher and person. It is my privilege to have an
opportunity to work with him. In my future career I will be trying to preserve and

elaborate upon these important personal characteristics.

I greatly appreciate the help provided by my guidance committee: Dr.

Michele M. Fluck, Dr. Robert A. Roth and Dr. Ian York. Their insightful comments

and constructive discussions have signiﬁcantly improved my research progress as

well as development of critical scientiﬁc thinking.

My sincere thanks to all current and former members of Dr.
Amalﬁtano lab: Dan Appledom, Yasser Aldhamen, Sarah Godbehere Roosa,
Jeannine Scott, Nathaniel Schuldt, Aaron McBride, Tyler Voss, Joyce Liu, Dionisia
Quiroga, William Nance, Mathew Bugold, William De Pas, Megan Hoban, Jenny
Zehnder, Brandy Burke, Anthony Sisk, Ryan Stringer. All of them are genuinely
nice and eager to help each other, and I’m glad, I have worked and interacted with
them. Together we have created wonderful positive friendly atmosphere in a lab,
an environment with a space for fruitful scientiﬁc and science unrelated

discussions, productive team work and, of course, fun and jokes!

I will forever be thankful to Jeannine Scott, who contributed greatly in my
initial training here at MSU, she was the one who taught me how to design,
construct, propagate and purify high titer Adenovirus vectors as well as other
numerous techniques. She also provided advices many times during my graduate

school career.

I would like to give my particularly special thanks to the most extraordinary
person (in all aspects), I have ever met in my life - Dan Appledom. He possesses
amazing skills in countless science related issues, he is enthusiastic, and
energetic and deﬁnitely one of the smartest people I know. He is my primary
resource for getting my science questions answered and was instrumental in
helping me to proofread this thesis. We had countless fruitful discussions, which

helped me greatly to improve my thinking skills. I know that I could always ask him

vi

for advice and opinion on any issue. He is a wonderful person, and I admire his
positive outlook and his ability to smile despite the situation. What makes Dan
even more unique is together with all this great scientiﬁc thinking, he is the main
source of fun and jokes, creating positive environment in our lab. It is very critical
to get some good laughs in a tough, 12-hour day. I'm sure that Dan will soon

become great and productive Pl.

I also thank my friend and co-worker, Yasser Aldhamen, who is a
wonderful person. It is a pleasure to work with him, in particular as a team on
some projects. He is honest, smart and responsible; he has unique ability to dig
out foundation for future experiments or projects, the skill, I tried to improve, as it

is critical piece during my future independent career.

My special thanks to Sarah Godbehere Roosa, who is a wonderful
technician and exceptionally pleasant person to work with. If not for all Sarah’s
help, my work would have taken me twice as long. I apologize that I can’t
individually thank all members of Dr. Amalﬁtano lab, as this dissertation should

contain at least a little bit of science.

My sincere thanks go to our collaborators from Duke University Medical
Center: Dr. Michael Frank, Zachary Hartman, Anne Kiang, Junping Wei, Delila
Serra, Fang Xu, Xiao Yi Zhao, Hai Xiang Jiang. We had several papers published
together and their contribution was signiﬁcant, especially in complement assays.
Anne and Zack are former Dr. Amalﬁtano Graduate students, who had started
several projects we continued to develop. In particular, I have ﬁnished several

projects, Zack has initiated back in 2003. Despite the fact that I never met him

vii

personally, we have exchanged numerous e-mails and he helped me greatly

during my research and I know that he a great person.

I would like to emphasize my paramount gratitude to Adenovirus - the best
and the most pragmatic vector platform for numerous future gene transfer
applications and all people who contributed in discovery of Ads and who started to

design Ad-based vectors. Thank you!

Special thanks to all wonderful MSU core facilities, including: ULAR and, in
particular, all employees of BPS/biochemistry animal housing facility; MSU
Histopathology labs (Amy S. Porter, Kathy A. Joseph, Rick A. Roseburry); MSU
electron microscopy facility (Ralph Common); MSU Genomics Technology
Support Facility: Flow Cytometry (Louis King), quantitative RT—PCR (Jeff
Landgraf), sequencing (Christi Hemming), Proteomics (Douglas Whitten). Without
their great performance and skilled assistance our research would not have been

possible.

I’m thankful to all faculty members and employees of the Department of
Microbiology and Molecular Genetics, especially the Chair of the department (Dr.
Walter J. Esselman), the Director of MMG Graduate program (Dr. Robert
Hausinger) and Graduate Secretary (Suzanne Peacock) for their kindness and all
their help and advises, provided during these years and their patience, when they
had to deal with my numerous questions. I would like to give my special thanks to
Administrative Assistant Coreena K. Spitzley for her countless assistance in

issues associated with lntemational student status, health insurance, and Grants

viii

submission. She is the best and the smartest administrative employee, I have

ever worked with.

American Heart Association is one of the few agencies, which accept
applications from international applicants. I’m extremely thankful to AHA for their

policy and support, which they provided to me as 2-year pre-doctoral fellowship.

My special warm thanks for my Aunt Julia Busik, who helped us a lot during
all these years, especially during ﬁrst year and upon arriving to MSU: new culture,
new country, with 11-month old child. Our ﬁrst couple of months were extremely
tough and I don’t know how we would of got by if not her constant and
unconditional help. I’m thankful to her husband Denis, who used to be semi-

professional downhill skier, for teaching us how to ski and enjoy the slopes.

I thank with all my heart to my parents for their encouragements, love and
support which motivated me to accomplish all my educational aims. My special
thanks go to my dear wife, Maria Tikhonenko and my wonderful daughter
Anastasia, who have been a source of motivation and inspiration during all those
tough moments. Maria has been a true and great supporter; she has
unconditionally loved me during my good and bad times. I feel her support and the
faith she has in me and I will continue to give her my absolute support and love to
provide her with patience and power to complete her Graduate Studies. I feel that
we became much wiser and calmer after these years; life has strengthened our

commitment and determination to our family as a whole.

ix

TABLE OF CONTENTS

LIST OF TABLES ............................................................................... xii
LIST OF FIGURES ............................................................................ xiii
List of Abbreviations .......................................................................... xvi
Chapter 1 Introduction .................................................................... 1
1.1 Ad-based vectors: the most pragmatic vectors for gene
transfer applications .......................................................... 2
1.2 Primary problem: Ad-triggered innate immune responses ......... 7
1.2.1 Toll-like receptors and Adenovirus ....................................... 8
1.2.2 The complement system: ﬁrst line of defense against
pathogens .................................................................................. 11
1.2.3 Complement and Adenovirus ............................................ 17
1.3 Approaches directed to minimize Ad-triggered immune
responses ....................................................................... 19
1.3.1 Ad capsid modiﬁcations ................................................... 21
1.3.1.1 Chemical modiﬁcations of the Ad capsid ............................. 21
1.3.1.2 Insertion of novel peptides into Ad capsid proteins ............... 22
1.3.2 lmmunosuppressive glucocorticoid Dexamethasone ............. 25
Chapter 2 Ads-triggered signaling pathways: critical roles of BArr-1
and pArr-Z adaptor proteins ............................................ 29
2.1 Introduction .................................................................... 30
2.2 Results ........................................................................ 32
2.3 Discussion .................................................................... 57
Chapter 3. Ad interactions with the complement system are pivotal
in understanding how to maximize the safety and potency
of Ad mediated gene transfer for both gene therapy and
vaccine applications ................................................................ 61
3.1 Introduction ................................................................... 62
3.2 Results ......................................................................... 65
3.3 Discussion .................................................................... 94
Chapter 4. Ads-based vectors “capsid-displaying” speciﬁc
complement inhibitor: a novel approach to improve Ad
vector safety proﬁle ..................................................... 102
4.1 Introduction ................................................................. 103
4.2 Results and Discussion .................................................. 106
Chapter 5. Simple, pre-emptive and transient glucocorticoid
pre-treatment reduces Ad5-associated acute toxicities ..... 123
5.1 Introduction ................................................................. 124

5.2
5.3

Chapter 6.
6.1.
6.1.1.
6.1.2.
6.2.
6.3.
6.4.
6.4.1.
6.4.2.
6.5.
6.6.
6.7.

6.8.

6.9.

6.10.
6.11.
6.12.
6.13.
6.14.
6.15.
6.16.
6.17.
6.18.
6.19.
6.20.
6.21.
6.22.
6.23.
6.24.

Chapter 7.

References.

Results ....................................................................... 127

Discussion .................................................................. 162
Material and Methods ................................................... 170
Adenovirus vector construction ....................................... 171
Incorporation of COMPinh in HI loop of the ﬁber protein ........ 171
Incorporation of COMPinh in the C-terminus of protein IX ...... 171
Adenovirus vector production and characterization ............. 172
Electron Microscopy of puriﬁed Ad vectors ......................... 175
Validation of VP titers of Ads ........................................... 175
Silver Staining .............................................................. 176
Western Blotting ........................................................... 177
Capsid thermostability assay ............................................ 178
Animal procedures ........................................................ 180
CytokinelChemokine/Endothelial cells activation markers

release measurement .................................................... 180
Cytokine quantiﬁcation in human PBMCs ........................... 181
Complete blood count analysis, cell type differentiation ......... 181
Platelet enumeration ...................................................... 181
Ad genome copy number per liver or spleen cell ................. 182
B-Galactosidase enzyme activity, in situ X-gal staining.........182
qRT-PCR Analysis ........................................................ 183
Kupffer cell staining ...................................................... 184
Hematoxilin and Eosin staining ....................................... 185
IFNv secretion assay (Flow Cytometry) ............................. 189
B cell activation assay (Flow Cytometry) ........................... 190
Antibody Titering Assay .................................................. 191
Neutralizing Antibody Assay .......................................... 191
Western blotting ............................................................ 192
Peritoneal macrophages isolation and infection .................. 193
Complement activation AP50 serum-based assay ............... 193
C3a-desArg ELISA and CH50 assay ................................. 194
Statistical analysis ......................................................... 195
Summary and future perspectives .................................. 197
.................................................................................. 203

xi

Table 1

Table 2

Table 3

Table 4

Table 5

Table 6

Table 7
Table 8

Table 9

LIST OF TABLES

B-Arr1-KO mice had signiﬁcantly reduced Ad5-triggered
activation of a number of genes in livers, as compared
to WT mice ........................................................................ 50

B-Arr1-KO mice had similar levels of Ad5-triggered activation
of genes in spleens, as compared to WT mice ......................... 52

B-Arr2-KO mice had signiﬁcantly higher levels of
Ad5-triggered activation of a number of genes
in livers, as compared to WT mice .......................................... 54

B—Arr2-KO mice had signiﬁcantly higher levels of
Ad5-triggered activation of a number of genes
in spleens, as compared to WT mice ...................................... 56

mCR1I2 is an important suppressor of Ad5-LacZ induced
Gene expression in livers of C57BU6 mice ............................. 75

Novel “capsid-displaying” Ads can be propagated to high titers,
similar to conventional Ad vectors. Capsid modiﬁcations do not
impair infectivity and transduction efﬁciency of novel Ads ......... 112

Dexamethasone pre—treatment abrogates Ad5-LacZ induced
gene expression in livers of 057BL/6 mice ........................... 138

Complete list of primers and oligos, utilized to
construct and validate Ad5-based vectors ............................. 174

List of primers, utilized in qRT-PCR experiments .................... 187

xii

Figure 1
Figure 2
Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Figure 11

Figure 12

Figure 13

LIST OF FIGURES
Images in this dissertation are presented in color
Diagram of Adenovirus and its genome ..................................... 5
The complement system ...................................................... 16

Current approaches to design improved Adenovirus based
gene transfer vectors ........................................................... 28

Functional B-arrestin-1 acts as positive regulator for several
chemokines released in response to Ad infection in vitro ............ 34

Functional B—arrestin-Z acts as negative regulator for several
chemokines released in response to Ad infection in
vitro. ................................................................................................ 36

Functional B—arrestin-1 acts as positive regulator of Ad
mediated systemic cytokine and chemokine release in
057BLI6 mice .................................................................... 39

Functional B-arrestin-Z acts as potent suppressor of Ad
mediated systemic cytokine and chemokine release in
057BLI6 mice ..................................................................... 41

Functional B-arrestin-1 and B-arrestin-Z have modest impact
upon liver and spleen transduction efﬁciency by Ad5 in
057BU6 mice .................................................................... 44

Functional B-arrestin-1 and B—arrestin-Z have modest impact
upon Ad derived transgene expression in both liver and
spleen tissues in CS7BL16 mice ............................................. 46

Plasma basal levels and Ad dependent activation of
complement protein C3 were identical between C57BU6 WT
and CR1l2-KO mice ............................................................. 67

Murine Complement Receptor 1/2 mitigates Ad mediated
cytokine and chemokine release in C57BU6 mice ..................... 70

Murine Complement Receptor 1/2 reduces Ad dependent
activation of endothelial cells in C57BU6 mice .......................... 73

mCR112-KO mice exhibit signiﬁcantly reduced leukocyte
inﬁltration into the liver of Ad treated mice at 28 dpi .................... 78

xiii

Figure 14

Figure 15

Figure 16

Figure 17

Figure 18

Figure 19

Figure 20

Figure 21

Figure 22

Figure 23

Figure 24

Figure 25

Figure 26

Figure 27

The efﬁcacy of Ad transduction of the liver of C57BU6 mice is

not dependent upon murine Complement Receptor 112,

but the levels of Ad derived transgene expression are

complement and mCR112-dependent ...................................... 82

mCR1I2-KO mice exhibit signiﬁcantly reduced Ad vector
capsid speciﬁc humoral immune responses ................................. 85

mCR1I2-KO mice exhibit signiﬁcantly reduced Ad capsid
speciﬁc neutralizing antibodies titer .......................................... 88

mCR1I2 and C3-KO mice have impaired B cell activation in
response to systemic Ad injection .......................................... 90

mCR1I2-KO mice have minimally reduced Ad vector
derived transgene speciﬁc humoral immune responses
as compared to WT mice ...................................................... 93

mCR112 protein plays a signiﬁcant role in down-regulation
of Ad mediated complement dependent pro-inﬂammatory

cytokines production ............................................................ 96
Schematic diagram of all Ad vectors constructed and utilized

in ourstudy.........‘ ............................................................. 108
Electron microscopy of puriﬁed Ad5 vectors ............................. 110

Novel COMPinh displaying Ads minimize Ad mediated
complement activation in several serum-based assays .............. 115

Silver staining of puriﬁed Ad vectors revealed marginal
differences in spectrophotometry determined vp titer .................. 118

Novel COMPinh displaying Ads reduce Ad-triggered activation
of pro-inﬂammatory cytokines and chemokines in PBMCs... ......121

Dexamethasone (DEX) blocks Ad-mediated systemic cytokine
and chemokine release in C57BU6 mice in a dose dependent
manner ........................................................................... 129

Dexamethasone prevents Ad mediated thrombocytopenia in
057BU6 mice ................................................................... 133

Dexamethasone minimizes Ad dependent activation of
endothelial cells in CS7BL/6 mice ......................................... 135

xiv

Figure 28

Figure 29

Figure 30

Figure 31

Figure 32

Figure 33

Figure 34

Figure 35

Figure 36

Dexamethasone treatment causes an increase in lymphopenia
and neutrophilia in a blood of C57BU6 mice, which is NOT
related to Ad treatment ........................................................ 143

Dexamethasone treatment preserves the efﬁcacy of Ad
derived transgene expression and Ads genomes
persistency in the livers of 057BL/6 mice ................................ 145

Dexamethasone treatment does not change Ad dependent
Kupfer cells degradation in a liver of C57BU6 mice .................. 147

Dexamethasone treatment results in signiﬁcantly reduced
Ad mediated leukocytes inﬁltration to the liver of C57BU6
mice at 28 dpi ................................................................... 150

Dexamethasone treatment signiﬁcantly reduced Ad vector
capsid speciﬁc humoral immune responses, including capsid-
neutralizing antibodies ....................................................... 153

Dexamethasone treatment signiﬁcantly reduced Ad vector
derived transgene speciﬁc humoral immune responses ............ 156

Dexamethasone treatment does not change natural levels of
total non-speciﬁc lgG antibodies in a blood of 057BLI6 mice ...... 158

Dexamethasone treatment does not change Ad dependent
008 positive T cells activation ............................................. 161

Dexamethasone pre-treatment mediates blockage of
Ad-induced innate immune responses: model of action ............. 166

XV

Ad
ADAR
ALT
ANOVA
AP

ATCC
B-Arr-‘I , B-Arr-Z
CAR

C3
C3a-desArg
CMV
COMPinh
CR
CRAD
CTL

‘ CXCL-9
DAF

DEX
DNA

dpi

EC

LIST OF ABBREVATIONS

Adena-associated virus

Adenovirus

Adenosine deaminase-RNA-speciﬁc (lFN-inducible)
Alanine aminotransferase

Analysis of variance

Alternative complement pathway

American type culture collection

beta-Arrestins 1 and 2

Coxsackie and adenovirus receptor
Complement component 3

stable protein, produced upon complement activation
Cytomegalovirus

peptide with ability to inhibit human complement
Complement receptor

Conditionally replicative adenoviruses

Cytotoxic T lymphocyte

Chemokine, induced by IFNy

Decay accelerating factor

Dexamethasone

Deoxyribonucleic acid

Days post injection

Endothelial cells

xvi

EDTA

EGTA

EM

fD, fI-l, ﬂ
FDAd
GAPDH

GFP

G-CSF
GM-CSF

FDA

HDAd

HVR

hpi

lCAM-1

IFNa, IFNB

I9

lL-6, IL-12p40
IRF3, IRF7, IRF8
JAK-1, JAK-3
KC (CXCL-1)

KO
LPS

Ethylene-diamine-tetra-acetic acid
Ethylene-glycol-tetra-acetic acid

Electron microscopy

Factor D, Factor H, Factor I (complement)

Fully deleted adenovirus

Glyceraldehyde 3-phosphate dehydrogenase
Green ﬂuorescent protein

Granulocyte colony-stimulating factor
Granulocyte-macrophage colony-stimulating factor
Food and drug administration

Helper-dependent adenovirus

Hypervariable region of Ad hexon protein

Hours post injection

Inter-Cellular adhesion molecule 1

lnterferons a and B (type I IF Ns)

Immunoglobulin

Interleukins 6 and 12 (pro-inﬂammatory cytokines)
Interferon Regulatory Factors 3, 7 and 8

Janus kinases 1 and 3

Keratinocyte derived chemokine, murine analog of
human lL-8

Knockout

Lipopolysaccharides

xvii

LacZ

ml

mM

mg

pl

till

#9

MAC

MAPK

MBL

MOP-1 (CCL-2)
MlP-1 p (COL-4)
My088

NAb

NFKB

NHS

NHPS

NOD-1, NOD-2
OAS-1a

OD

qRT-PCR
SPAMP

PBMC

Bacterial B-galactosidase

Milliliter

Milli-molar

Milligram

Micro-liter

Micro-molar

Microgram

Membrane attack complex

Mitogen-activated protein kinase

Mannose Iectin binding pathway (complement)
Monocyte chemotactic protein 1

Macrophage inﬂammatory protein 1 beta
Myeloid differentiation factor 88 (T LR adaptor)
Neutralizing antibody

Nuclear factor kappa B

Normal human serum

Non-human primate serum

Nucleotide-binding oligomerization domains 1 and 2
2'-5' Oligoadenylate synthetase (IF N-inducible)
Optical density

Reverse transcription and quantitative real-time PCR
Pathogen-associated molecular pattern

Peripheral blood mononuclear cells

xviii

PBS

PCR

PEG

PTA

PRR
RANTES
RNA

SD
8003-1, 8005-3
TCID
TBK-1
TLR
TNFa
TRAFpr
TRAF6
TRIF

VCAM-1
VP

Phosphate buffer saline
Polymerase chain reaction
Polyethylene glycol
Phosphotungstic acid (for EM staining)
Pattern recognition receptor
Normal T-cell Expressed, and Secreted
Ribonucleic acid
Standard deviation
Suppressors of cytokine signaling 1 and 3
Tissue culture infectious dose
TANK-binding kinase (T BK)
Toll-Like Receptor
Tumor necrosis factor alpha
TNF receptor associated factor 2 binding protein
TNF receptor associated factor 6
Toll/lnterleukin-1 receptor (TlR)-domain-containing
adaptor-inducing interferon-[3
Vascular cell adhesion molecule 1
VIral particle
WIld-type

xix

Chapter I

Introduction

1.1. Adenovirus (Ad) based vectors: the most pragmatic vectors for gene
transfer applications

Ads are non-enveloped icosahedral viruses of 60-100 nm in diameter, that
contain an ~36 kb double-stranded linear DNA genome. The human
Adenovin'dae family is comprised of more than 50 Ad serotypes (based primarily
upon the lack of cross reacting antibody neutralization between serotypes), which
are categorized into six subgroups (A-F), primarily based upon different red blood
cell agglutinating capabilities of the various subgroups. Classiﬁcation of Ad
serotypes have been historically based upon biological, biochemical as well as
structural properties, including the lack of cross-neutralization between serotypes
from different species. Subsequently, such parameters as oncogenicity, length of
ﬁber protein and genomic sequence similarity were taken into consideration to
further sub-classify Ads (1, 2). Ads have a worldwide distribution and account for
~5% of all respiratory infections in childhood (3). The viral capsid contains total of
eleven structural proteins, of which hexon (protein ll), penton base (protein III)
and ﬁber (protein IV) are termed major capsid proteins, and proteins llla, VI, VIII
and IX minor capsid proteins, four additional proteins are packaged with the DNA
inside the core (4-6). The capsid proteins hexon, and ﬁber are the major targets
of Ad speciﬁc antibodies, many of which become neutralizing (7-12).
Transcription and processing of Ad RNA occurs on both strands utilizing early (E)
and late (L) regions, resulting, mainly by mechanism of alternative splicing, in
production of over 30 non-structural proteins (13) (Figure 1). Early region (E1-
E4), is transcribed and translated ﬁrst, and resultant proteins assist is

subsequent stages of Ad replication and packaging: E1a (immediate early gene),

encodes transcription factor necessary for activation of early genes; E1b -
encodes protein, blocking apoptosis, as well together with E1a, E3 and E4
products modulate cellular transcriptional machinery to transcribe predominantly
viral genes and evade host immune responses; E2a - encodes DNA binding
protein, E2b - encodes pretenninal protein and viral polymerase. Late region
(L1-L5) predominantly encode structural proteins, necessary for virion assembly,
for example, L2 region encodes core proteins V, VII and X as well as penton

base (plll), L5 encodes ﬁber protein (2, 14).

Several generations of recombinant Ad vector has been generated. First
generation Ad vectors lack E1 region ([E1-] Ad) or E1 and portion of E3 ([E1-,
E3-] Ad). These Ad vectors are speciﬁcally propagated on transcomplementing
cell lines such as HEK293 or PER.C6, which supply the essential E1a and E1b
proteins in trans (2, 14). Advanced generation vectors encompassing additional
deletions in the E2b or E4 regions (as well as fully deleted “gutless” Ads) have
also been developed. These vectors retain the capabilities of large-scale
production noted with E1 deleted vectors. However, transcomplementing cell
lines unique to each vector (or an additional helper virus) must also be provided

to support their growth (15, 16).

Recombinant, Ad-based gene transfer vector platforms are heavily utilized
in both gene therapy and vaccine applications. This utility is based on a number
of positive attributes inherent to the use of recombinant Ads. Recombinant Ads

are capable of transducing foreign genes into a wide range of cell types inclusive

Figure 1: Diagram of Adenovirus and its genome. (A) Adenoviruses
are icosahedral, non-enveloped viruses that contain multiple features
including a double stranded DNA genome, the ﬁber protein that terminates
in the knob region (required for binding to the coxsackie adenovirus
receptor (CAR)), and the penton base (required for facilitating viral entry).
(B) Adenoviruses contain a ~36 kb genome generally organized into
regions encoding. the Early (E) expressed genes and Late (L) genes.
Various regions of the Ad genome can be removed and replaced with an
expression cassette containing a “gene of choice" and its associated
promoter and enhancer elements. Important regions of the Ad genome
that have been removed to improve the persistence and/or safety of the
vector are indicated with dotted arrows. These viruses can be grown to
high viral titers using cell lines expressing the proteins encoded by these

regions in trans.

 

Knob

 

 

 

 

Fiber
....r.s.1..., LJ,_L£,J£, estate,
fees" *5? "'EZI'"
I I I I l I l J
10,000 bp 20,000 bp 30,000 bp

of antigen presenting cells; allow for efﬁcient transgene expression, have large
cloning capacities (8-36 Kb); and can be easily produced to extremely high titers
in a current good manufacturing practices (cGMP) compliant fashion (up to
1x1013 vplml). The ability to easily “scale-up” traditional Ad vectors in a manner
that is cGMP compliant, has resulted in thousands of patients safely receiving
recombinant, Ad5-based gene transfer vectors. In fact, it is the author’s opinion
that the proven ability to mass-produce Ad-based vectors makes them one of the
most pragmatic of all gene transfer vectors currently proposed for direct in vivo
human use. For example, the lack of simple, efﬁcient, and large-scale cGMP
production capabilities has limited the clinical utilization of a number of other
proposed gene transfer platforms (i.e.: Adena-associated virus (AAV) or lentivirus
based systems) to a handful of human clinical trials (see:

http://www.wiley.co.uklwileychilgenmed/clinicall).

There are, however, several limitations to the use of recombinant Ad
vectors as a gene transfer platform, primarily: the decreased efﬁcacy of these
platforms in Ad-immune individuals, and vector-associated innate immunogenic
toxicities. Many in the lay press and, in fact, the scientiﬁc theater wrongly hold
the view that Ad-based clinical trials are no longer being conducted or pursued
due to these important issues. Thus, it is very important to note the fact that Ad5-
based vectors are currently the most widely used gene transfer vector in human
clinical trials (http:/lwww.wiley.co.uk/wileychi/genmed/clinicall). More recently, a
major advantage to the use of Ad-based vectors has also become apparent, with

the conﬁrmation that integrating viral vectors (i.e.: retrovirus, lentivirus, possibly

AAVs) can cause insertional mutagenesis and cancer in animal models and in
human clinical trial subjects, therefore such vectors may subject human
recipients to similar and/or additional risks (17-21). The natural biology of the
recombinant Ad genome to not integrate into the host chromosome as a nuclear

episome largely mitigates insertional mutagenesis risks (22).
1.2. Primary problem: Ad-triggered innate immune responses

The main problem with using Ad vectors in current applications is the
frequent need for use of high doses of the vector to achieve successful evidence
of gene transfer in several speciﬁc tissues, a problem that increases unwanted
side effects, such as vector-associated innate immune responses (23-28).
Importantly, these Ad-triggered responses are clinically relevant, unfortunately as
primarily noted in the Ornithine transcarbamylase gene transfer tragedy (29). In
that trial, the tragic death of a patient, who received 6x1011 vplkg of an Ad vector,
coincided with induction of a “cytokine storm” — a massive release of pro-
inﬂammatory cytokines (including IL-6), causing a systemic inﬂammatory
response syndrome. Although not replicated in other patients receiving similar
doses of the vector (both in this trial and in other subsequent studies (29-31), the
trial highlighted the need for greater study of Ad vector induced innate immune
responses. The lack of efﬁcient vector platforms for systemic targeting of the liver
has primarily driven the need more detailed investigation of Ad vector
interactions with multiple arms of the innate immune system in attempts to ﬁnd a
way of improving the safety proﬁle of this promising vector in these sorts of

applications. It is now known that Ad vectors elicit multiple innate immune

responses after systemic administration due to several processes: complement
system activation, anaphylotoxins release, macrophage activation,
cytokine/chemokine release, induction of granulocyte and mast cells inﬁltration,
endothelial cell activation, generalized transcriptome dysregulation in multiple
tissues, and thrombocytopenia (23-28). Several of the innate immune systems,

known to interact with Ads are described in greater detail below.
1.2.1. Toll-like receptors and Adenovirus

In the late eighteen hundreds, the famous Russian microbiologist llya llyich
Mechnikov, Nobel prize laureate, described phagocytosis and suggested the
term “innate immunity” to deﬁne an initial, nonspeciﬁc defensive mechanism that
was present for defense against newly encountered pathogens. Almost a whole
century passed before the modern scientiﬁc community discovered that pathogen
recognition receptors (PRRs) function to recognize microbes and viruses at both
the intra- and extracellular levels, triggering the induction of multiple innate
immune responses. PRRs are able to recognize pathogen-associated molecular
patterns (PAMPs), which are expressed on foreign agents. Bacterial
Iipopolysaccharides (LPS), viral/bacterial nucleic acids, lipoproteins are all
examples of PAMPs. Since these molecules are absent in host cells, they are
recognized as non-self motifs by PRRs. The most studied PRRs include 82
integrins (CD11/CDIB), Nucleotide Oligomerization Domains (NODs),
complement receptors (CR1ICD35, CR210021), RIG-I-like receptors and Toll-
Like Receptors (T LRs). TLRs were discovered in late 1990s, giving rise to

tremendous amount of studies, which shed light on TLRs signaling mechanisms

associated with the innate (and downstream adaptive) immune responses (32,
33). TLRs are expressed in many cell types: non-hematopoietic epithelial and
endothelial cells, macrophages, neutrophils and dendritic cells; 13 mammalian
TLRs (10 in humans) have been identiﬁed to date. TLRs predominantly utilize
conserved leucine rich repeat (LRR) at the N-terrnini for pathogen recognition,
although amino acid insertions and non-consensus LRRs remarkably diversify

TLR’s ability to recognize a wide range of PAMPs (34).

Ad vectors have been conﬁrmed to activate multiple PRRs both in vitro and
in vivo, including RIG-I-like receptors, TLR2, TLR4 and TLR9 (for more detailed
review please see (25)). These activations ultimately results in Ad-triggered
innate toxicities. Speciﬁcally, we have shown that acute innate (and downstream
adaptive) immune responses developed following systemic injection of Ad
vectors, are signiﬁcantly mediated by TLR adaptor proteins MyDBB and TRIF, as
shRNA-mediated stable knockdown of these molecules resulted in diminished
pro-inﬂammatory cytokine (IL-6) releases in vitro in response to Ad injection (35);
moreover, cytokine/chemokine activation (G-CSF, IL-5, lL-6, lL-12p40, MOP-1,
RANTES) and massive, pro-inﬂammatory genes induction was blunted in MyDBB
knockout mice, as compared to identically Ad-treated WT mice (23). Ad-triggered
activation of MAPK and NFkB signaling pathways, systemic cytokine release and
generation of Ad-capsid speciﬁc neutralizing antibodies (NAb) are at least
partially TLR2/TLR9/MyD88 dependent (36). Therefore, it is conﬁrmed that TLRs

play a pivotal role in mediating Ad-triggered innate immune responses both in

vitro (35, 37, 38) and in vivo (38, 39), however, continued investigations of Ad-

induwd innate immune responses and speciﬁc signaling pathways are required.

B—Arrestins 1 and 2 (B—Arr—1 and -2) are ubiquitously expressed G-protein
coupled receptor adaptors, known to have pivotal roles in regulating TLR
signaling pathways (40). B-Arr-1 and -2 were originally discovered to play a major
role in G protein coupled receptor desensitization, due to their ability to bind to
phosphorylated G protein coupled receptors and sterically block their ability to
signal downstream (40). Subsequent studies revealed more versatile roles of B-
Arr1 (arrestin-2) and B—An2 (arrestin-3), including broader regulation of cell
signaling in general, serving as scaffolds, as well as having roles in
transcriptional regulation (40). Recent studies demonstrate B-arrestins as
negative regulators of TLR-stimulated NFIcB and ERK signaling pathways in
macrophages and ﬁbroblasts (41, 42). Consistent with this role of B-arrestins,
Wang et. al. showed that deﬁciency of B-Arr2 signiﬁcantly enhances endotoxic
mortality in mice (41). In contrast to these studies, Fan et. al. (43) demonstrated
differential effects of B-Arr1 and -2 in lipopolysaccharide signaling in mouse
embryo ﬁbroblasts, suggesting that B-arrestin’s effect on TLR signaling might
depend on the cellular context. Although a role for B-arrestins has been
established using selective TLR ligands, their role in microbial infections (which

activate multiple TLRs) is not known.

Innate immune responses associated with systemic injection of
Adenovirus (Ad) based vectors remain to be one of the most important obstacles

limiting the usage of these vectors in numerous clinically important applications,

10

requiring high level vector administrations, for example for liver targeted therapy.
Systemic (intravenous) administration of Ads results in acute thrombocytopenia
(26, 44), activation of the complement, TLR and lFN systems, a robust cytokine
release into the circulation sometimes referred to as a “cytokine storm" (24, 26,
27, 36), activation of endothelial cells (45) as well as massive inductions of pro-
inﬂammatory gene expression in multiple tissues, including the liver, spleen and
lung (23, 26, 46-50). Therefore, understanding the mechanisms mediating Ad
induction of these processes may allow for focused efforts to interfere with these
mechanisms to foster improved safety and/or efﬁcacy of Ad mediated gene
transfer applications. Because TLRs signiﬁcantly modulate Ad vector responses,
and since B-arrestins play a crucial role in TLR signaling, we analyzed the role of
B-arr-1 and -2 in Ad5-induced innate immune responses both in vitm and in vivo.
Our results conﬁrm that multiple Ad5 induced innate immune responses are
mediated by B—arrestin functionality. Moreover B—Arr1 and B-Arr2 differentially
mediate Ad5 induced innate responses, having somewhat opposite functions: [3-
Arr2 clearly down-regulates Ad5 induced gene induction and cytokine responses,
whereas B-Arr1 enhances portions of these responses, as detailed in chapter II

of the dissertation.
1.2.2. The complement system: ﬁrst line of defense against pathogens

The complement system, which is composed of over 30 membrane-bound
as well as ﬂuid phase proteins, represents the main non-cellular part of the innate
immune system (Figure 2). Most complement components are synthesized by

hepatic parenchymal cells in the liver, however, some may also be synthesized

ll

by macrophages (51). Complement proteins can bind and facilitate opsonization
of different types of pathogens including those not previously encountered by the

host. There are three major complement pathways:

1) Classical Complement Pathway is activated as a result of speciﬁc
antibody interactions with a previously encountered pathogen. Pre-existing
antibodies (lgG or lgM) bind to the microbe, which allows C1q complement
protein to bind to the antibody/pathogen complex. This in turn triggers C1r and
C1s binding, creating an active 01qu serine protease (Ca2+ dependent), which
cleaves proteins C4 (releasing C4a and 04b) and 02 (releasing C2a and 02b).
Reactive C2a and 04b associate with each other into a complex on the
pathogen, giving rise to the classical pathway C3 convertase: C4b2a (Mg2+
dependent). C3 convertase cleaves large amounts of C3, generating C3a
anaphylotoxin and C3b. C3b protein can activate endothelial cells (ECs) by
binding to speciﬁc receptors on EC surfaces (49). 03b can also directly bind to
pathogens, facilitating targeting of pathogens to complement receptors on
phagocytic cells (macrophages, granulocytes) (49, 52). The C4b2a3b complex is
a C5 convertase cleaving CS into 05a (a potent anaphylotoxin) and C5b. C5b
protein binds to the surface of a pathogen (or infected cell), which triggers
membrane attack complex (MAC) formation by recruitment of complement
proteins 06-09. The MAC can form a pore in bacterial or enveloped viral
pathogens, thereby initiating their .lysis. The potent anaphylotoxins C3a and C5a

efﬁciently bind to their receptors (C5aR, C3aR) on mast cells, granulocytes and

12

macrophages facilitating their activation (49), (Figure 2), thereby activating the

cellular part of the innate immune system.

2) The Iectin pathway for complement activation is homologous to the
classical pathway but is initiated by the binding of the mannan-binding Iectin to
mannose residues on the pathogen surface. This causes activation of the MBL-
associated serine proteases, MASP-1, MASP-2, MASP-3, which cleave proteins

C4 and C2, generating the C3 convertase C4b2a.

3) The alternative complement pathway has a role in combating
pathogens not previously encountered by the host immune system (i.e. there are
no pre-existing antibodies to the pathogen). Protein C3 possesses an internal
thioester bond between a cysteine and the v-carboxyl group of a glutamine
residue allowing low levels of reactive ﬂuid phase C3b-Iike molecules to be
spontaneously produced and rapidly inactivated in the blood via a “tick—over"
mechanism. However, upon pathogen encounter, pre-existing C3-OH can bind
stably to the surface of the pathogen, facilitating binding of factor B (Fb) to the
C3blpathogen complex. The complex is recognized by factor D, and Fb is
cleaved to generate the alternative pathway-derived C3 convertase C3bBb (Mg2+
dependent). Numerous C3 molecules are cleaved by this alternative pathway-
derived C3 convertase. The alternative pathway can also serve as an
ampliﬁcation loop for classical pathway-initiated complement system activation

(52-54).

Excessive complement activation can cause a number of disorders

including adult respiratory distress syndrome (ARDS), hypotensive shock,

13

anaphylactoid reactions, systemic inﬂammatory response syndrome, and
thrombocytopenia. Many of these toxicities have been observed after high dose
Ad administration into rodents, non-human primates, and humans (48-50). Our
published data conﬁrms that the intact Ad capsid interacts with human and

murine complement immediately after delivery in vitro and in vivo thereby

 

 

consuming complement components and inducing several toxicities, toxicities
that can be avoided by complement inhibition (24, 26, 46, 55), as fully detailed in

several chapters of this dissertation.

l4

Figure 2: The complement system. Three major complement pathways
are shown. Activation of either of the pathway leads to formation of C3-
convertase, which cleaves main complement protein C3 and allows to
generate CS-convertase, capable of cleaving C5 into 05a and 05b. Potent
anaphylotoxins, released during complement activation, activate cellular
arm of the innate immune system. C5b facilitates formation of membrane

attack complex (MAC), capable of lysing infected cells and pathogens.

15

 

 

Classical Lectin Alternative
. Pathwa Pathway Pathway

-\ ®

C3 convertases P

"D

 

 

 

 

Anaphylatoxins

1.2.3. Complement and Adenovirus

Ad-based vectors are capable of activating human complement via both
classical and alternative complement pathways (24, 26, 46, 47, 55). While it was
well established that Ad5 can activate the classical complement pathway in the
presence of Ad-speciﬁc antibodies, our group ﬁrst conﬁrmed that immobilized
Ad5 capsids can mediate the activation of the alternative complement pathway in
Ad-na‘lve serum (47, 55). Ad5 is also capable of activating murine complement,
justifying the use of a mouse model to investigate the role of complement in Ad-
triggered responses (26). In this regard, intravenous administration of high doses
of Ad5-based vectors in mice deﬁcient in various complement factors including
C1q and C4 (classical pathway), FB (alternative pathway), or C3 (shared
pathway) has revealed that Ad-triggered induction of thrombocytopenia is
dependent upon a functional complement system and is alternative pathway
dependent (24, 26, 46). It was also conﬁrmed that the induction of several
important pro-inﬂammatory cytokines/chemokines by Ads is also complement
dependent. The induction by Ads of some cytokines is dependent upon
alternative pathway proteins, while the induction of other cytokines by Ads is
depended upon classical pathway activation. However, the induction of most
cytokines and chemokines by Ads was found to be primarily dependent upon the
presence C3 - the complement pathway component that is a key converging

point of both the classical and alternative complement pathways (24, 26, 46, 56).

It is also known that complement system activation acts to optimize

induction of pathogen speciﬁc antibody responses (57-59). Subsequent to

17

opsonization by activated C3, pathogens are bound to B cells and dendritic cells
via binding of the pathogen bound C3 to the complement receptors (CRs). The
human CR1 and CR2 receptors have well known roles in modulating both innate
and adaptive immune responses. Human CR1 (hCR1) is a potent inhibitor of
complement activation, having both decay-accelerating and cofactor activities.
Furthermore, hCR1 has a critical role in the clearance of immune complexes, and
B cell maturation, as thoroughly reviewed elsewhere (60, 61). Human CR2
(hCR2) expression is restricted to the surface of B cells, follicular dendritic cells
and thymocytes. When hCR2 binds C3d opsonised pathogens and becomes
associated with CD19, it lowers the threshold for B cell activation by up to 1000
fold (62). HCR1 and hCR2 also play a role in T cell biology, for example,

crosslinking of hCR1 inhibits T cell proliferation and lL-12 production (63).

In contrast to their human counterparts, the murine complement receptors
(mCRs) 1 and 2 (CD35ICDZ1) are products of alternative splicing from the same
gene. mCR1 contains 21 complement control protein repeats (CCPRs), whereas
the smaller mCR2 contains only 15 C-terrninal CCPRs of mCR1 (64). mCR1/2 is
known to be expressed on B cells and dendritic cells (64). Therefore, the
expression pattern of mCR1/2 resembles that of hCR2, but not hCR1. Similar to
their human homologues, the functions of mCR1/2 related to generation of
maximal humoral responses have also been well described (65—69). Interestingly,
mCR1/2 functionality prevents excessive myocardial tissue damage subsequent

to coxsackievirus B3 infection (70), as well prevents lethal Streptococcus

18

pneumoniae infection, a role potentially indirectly reﬂective of the complement

inhibitory activities of the CRs (71).

While the role of murine CR1/2 protein has been extensively studied in
regards to adaptive immune responses, its function in inhibiting/regulating murine
complement dependent responses has not been intensely investigated, possibly
since in most mouse models, the Crry protein was suggested to play the
predominant role in controlling complement activation. Our studies, however,
now conﬁrm that the role of murine CR1/2 protein in innate immune responses
(including the ones which are known to be complement dependent) may be more
important than previously considered, as suggested by our present studies of
Adenovirus mediated gene transfer into mCR1I2-KO mice. Our results in murine
models revealed dual roles for mCR1/2; roles that include down-regulation of
multiple aspects of the Ad induced innate immune responses, while also playing
the major role in the complement dependent induction of neutralizing antibody

responses to Ads.

1.3. Approaches directed to minimize Ad-triggered immune responses

Innate toxicities, rapidly developed in response to systemic Ad injections,
signiﬁcantly limit more widespread utilization of this gene transfer platform.
Additionally, Ad-based gene transfer approaches can be limited due to adaptive
immune responses to the virus or the transgene it encodes. These adaptive
immune responses can limit the duration of transgene expression and/or limit the
ability to re-administer the vector, although this highly depends on the

immunogenicity of the transgene delivered (14). Though it is often noted that Ad

19

mediated gene delivery is transient due to these responses, there are multiple
examples that even ﬁrst generation Ads, and certainly advanced generation Ads,
can allow for long-terrn gene expression in vivo (14). For example, ﬁrst
generation Ad mediated delivery of non-immunogenic transgenes can persist for
long periods of time in both murine and non-human primate models. Similar
levels of improved efﬁcacy are more likely to occur with the use of the advanced

generation Ad-based vectors (16, 72, 73).

An important problem in regards to potential use of Ads in human clinical
applications is that the majority of the human population has been infected by
wild type Ads in childhood, and often these individuals develop pre-existing
immunity to a number of common Ad serotypes (i.e.: serotypes 2, 4, 5, and 7).
The percentage of the human population with medium to high Ad speciﬁc
antibody titers largely depends upon geographic location, with 30-50% of the
United States population, and up to 90% of the sub-Saharan African populations
having signiﬁcant Ad5 antibodies with an overall trend to having higher titers in
developing countries (74-76). Pre-existing immunity to Ad can include both
neutralizing antibodies (NAb), as well as Ad protein speciﬁc T cell responses.
Additionally, recent studies highlight a critical role for CDB“ T cells in pre-existing
Ad immunity (9, 77). This latter point is very important, as these pre-existing
responses can in fact still be harnessed when a host is exposed to a novel

(previously unencountered) Ad serotype (78-81).

Therefore, several strategies have been proposed to improve the efﬁcacy

or utility of Ad-based gene transfer vectors (78, 82, 83). Below we discuss three

20

approaches, developed to minimize Ad vector induced innate toxicities.
Importantly, these approaches have shown improved efﬁcacy in Ad-immune
hosts and/or allowed for efﬁcient re-administration of Ad vector, generating

signiﬁcantly blunted Ad-speciﬁc adaptive immune responses, including NAb.
1.3.1. Ad capsid modifications
1.3.1.1. Chemical modiﬁcations of the Ad capsid

Several groups have chemically modiﬁed the Ad5 capsid (i.e.: in a non-
covalent fashion) in an attempt to shield or hide highly antigenic epitopes on the
viral capsid (mainly hexon protein) from the immune system of the Ad-immune
host. This strategy primarily involves the addition of synthetic polymers onto the
Ad capsid. These polymers can include polyethylene glycol (PEG) (84), polyactic
glycolic acid (PLGA) (85) or other lipids (86).

PEGylation appears to be the most promising approach for non-covalent
modiﬁcation of Ad capsids. Ad5 PEGylation may not only reduce Ad-triggered
toxicities, but also allow for re-administration of such modiﬁed Ads in mice. For
example, animals were intravenously injected with an Ad5 vector expressing an
irrelevant antigen, and then re-injected with conventional or PEGylated Ad5
vectors each expressing the bacterial B-galactosidase gene (B-Gal) (87). This
simple study revealed high levels of B-Gal expression only in Ad5-immune mice
re-injected with the PEGylated Ad5 vector (87). Moreover, it was shown that
PEGylated Ad5 vectors also reduce the induction of Ad5-triggered innate

toxicities, such as thrombocytopenia, plasma ALT elevations, and release of pro-

21

inﬂammatory cytokines such as lL-6 (87, 88). PEGylation with a small PEG (5
kDa) moiety increases transduction efﬁciency of the Ad5 capsid in Ad-immune
mice (89). Use of a 5 kDa PEGylation of Ad5 can also reduce Ad5 speciﬁc
neutralizing antibody (NAb) titers generated after intranasal injection into Ad-
naive BALBIc mice (90). How PEGylation may affect the efﬁciency or tropism of
Ad5 mediated gene transduction in vivo has not been fully delineated. For
example, a dramatic reduction of liver transduction was reported after Ad
PEGylation (91), while other studies reported equal and/or increased liver
transduction by PEGylated Ads (87, 88).

In summary, characterization of how PEGylation affects the ability of so
modiﬁed Ad vectors relative to tropism changes, ability to reduce Ad-triggered
innate and adaptive immune responses, is still required to determine if these

strategies afford improved utility of PEGylated Ad-based platforms.
1.3.1.2. Insertion of novel peptides into Ad capsid proteins

Several Ad capsid proteins, including the ﬁber, penton, protein IX .and
hexon proteins have been exploited for genetic insertion of foreign peptides into
these speciﬁc capsid proteins, either as “in-frame” insertions within the proteins,
or as “in-frame” C-terrninal fusions. If the insertion does not cause a deleterious
change in the biology of the so-modiﬁed protein, (i.e.: causes misfolding, lack of
stability, lack of trimerization or lack of incorporation into the tertiary structure of
the Ad capsid) novel, recombinant Ad vectors “capsid-displaying” the respective
foreign peptide can be isolated. The penton and hexon proteins tolerate relatively

small peptide insertions: up to 18 amino acids (aa) for penton base (92, 93), and

22

up to 36 aa within the hypervariable region 5 (HVR5) of hexon (94, 95), whereas
the HI loop of the ﬁber knob and C-tenninus of protein IX allow for incorporation
of peptides of substantial size: up to 83 aa for ﬁber (96) and up to 1018 aa for plX
(97). Issues regarding capability to generate these recombinant viruses
consistently, to very high titers, or in a cGMP compliant fashion have many times
not been addressed in studies published to date, but will need to be if clinical

deployment of these vectors is to be achieved.

The insertion of foreign peptides into capsid proteins in attempts to
change the natural tropism of the Ad vector have been well-described (98, 99).
Ad5-based vectors depend on coxsackievirus-adenovirus receptor (CAR)
receptor for cell transduction: ﬁber protein, consisting of three domains (tail,
shaft, and trimeric knob), is responsible for initial cell attachment. Fiber knob I
CAR interaction is followed by the binding of the penton proteins to (NBS or dv85
integrins through a conserved Arg-Gly-Asp (RGD) consensus motif. In addition,
factor X Gla domain interactions with hypervariable region of Ad hexon were
recently identiﬁed as critical factor mediating liver Ad transduction via Heparan-

sulfate proteo-glycans (100).

Based on this simple Ad biology, ﬁber domains (and knob in particular) as
well as RGD motif from penton and hypervariable region of hexon protein are the
best targets in attempts to modify Ad5 vector tropism. Therefore, several studies
described the incorporation of polylysine or RGD motifs into different locations of
Ad5 capsid, resulting in modiﬁed tropism. Speciﬁcally, incorporation of a

polylysine motif into the plX was shown to augment Ad ﬁber knob independent

23

infection of CAR-deﬁcient cell types in vitro (101). RGD and polylysine motifs
have been incorporated into the ﬁber knob, providing an ability to infect CAR-
deﬁcient cells in vitro (102-105). Additional studies, utilizing in vitro comparative
analysis of Ads, capsid-displaying RGD peptide at HI loop of ﬁber knob, C-
terminus of ﬁber knob, C-ten'ninus of plX or HVR5 of hexon, revealed that the
most efﬁcient transduction was achieved when HI loop of ﬁber was used for RGD
incorporation (99). It has been subsequently conﬁrmed that RGD motifs
incorporated into C-tenninus of protein IX allowed for transduction of CAR-
deﬁcient cell types in vitro (106). The use of 30-75 Angstrom a—helical spacers for
incorporation of foreign peptides in pIX was suggested (106), but it is still unclear,
however, if these spacers provide any detectable beneﬁt, since numerous
studies showed promising results incorporating peptides in pIX without spacers
(99, 101). More detailed direct comparison between several alternative plX-

displaying Ads (with and without linkers) is required to answer this question.

A major limitation of these targeting approaches is that numerous
promising in vitro results fail to provide any signiﬁcant beneﬁt in vivo, primarily
due to inability to overcome natural liver tropism of Ad-based vectors. However,
several studies provide optimism by showing reduced metastasis formation and
increase survival in mice with usage of E1a CRAD (107) or 2-fold increased
tumor uptake of targeting Ad-displaying avB6 integrin-selective peptide as
compared to intact capsid-Ad, which was in parallel with reduced liver
transduction by targeting Ad (108). Future development of advanced targeting

Ads, possibly by combining approaches undertaken up to date, should be

24

continued in order to more fully determine the applicability of targeting Ad for

clinical applications (109).

Note that in this dissertation we describe a novel class of Ad5-based
vectors, capsid-displaying speciﬁc complement inhibitory peptide (COMPinh).
These novel Ads minimize complement activation (with a potential to minimize
Ad-induced complement dependent toxicities) and represent a promising tool for

numerous future gene transfer applications.
1.3.2. lmmunosuppressive glucocorticoid dexamethasone

The synthetic anti-inﬂammatory glucocorticoid dexamethasone (DEX) is
an FDA approved drug widely used to treat a number of transient and/or chronic
inﬂammatory conditions (110-115). Importantly, mechanisms of action of DEX
include preventing the activation of NFkB and AP1 transcription factors, as well
as MAP kinases, all of which have been shown by us and others to also be
important mediators of the Ad induced inﬂammatory response complex (116-
118). lL-8 and lFNB production have also been shown to be inhibited by DEX
(117, 119). As a result, the maturation of mast cell progenitors, as well GM-CSF

and TNFa secretion by mast cells are also altered by DEX treatment (120).

Very limited data is available regarding the effect of DEX treatment on
animals treated with gene transfer agents. Use of glucocorticoids has been
shown to increase the efﬁcacy of gene transfer in vitro, while in vivo studies
showed that dexamethasone could improve non-viral gene and virus derived

gene expression in experimental animal models (121-125). Relative to Ad

25

mediated gene transfer, DEX can improve Ad vector derived gene expression
when these vectors are directly administered into the spinal cord, nasal mucosa,
inner ear or lungs (124-128). Pulmonary delivery of Ad vectors into mice pre-
treated with Dexamethasonelspermine resulted in a reduced activation of limited
portions of the lung speciﬁc innate and adaptive immune response to the Ad
vector utilized (128). These results prompted us to evaluate the efﬁcacy of DEX
to prevent the numerous innate toxicities induced by systemic administration of

Ad vectors, as detailed in chapter V.

In summary, all of the approaches, summarized on ﬁgure 3 have shown
promising results in terms of improving some aspects of Ad vector safety and/or
efﬁcacy. Further development of genome modiﬁed Ad vectors, “capsid-
displaying” Ads, chemically modiﬁed Ads, chimeric Ads, as well as Ad vectors,
derived from alternative Ad serotypes is now justiﬁed. Possibly, a combination of
some (or all) of these approaches may result in construction of safer and a more
efﬁcacious Ad vector platform. In this dissertation we describe a novel class of
Ad vectors, “capsid-displaying” speciﬁc peptides, inhibiting complement
activation, and outline critical role of complement in mediating Ad-triggered
innate and adaptive immune responses. We also propose to use an FDA
approved potent immunosuppressive glucocorticoid Dexamethasone to block Ad-
induced immune responses, potentially in combination with other approaches to

further improve the outcome of gene transfer applications.

26

Figure 3: Current approaches to design improved Adenovirus based
gene transfer vectors. Group 1. Starting with a wild-type Ad5 virus the
E1 region is deleted to generate [E1-] Ad5 vectors; Group 2. Adenovirus
vectors of any group can be PEGylated; Group 3. Capsid “display” of
antigens at various locations on the Ad capsid where indicated; Group 4.
Chimeric Adenovirus vectors, that contain capsid proteins derived from 2
different Ad serotypes; Group 5. Adenovirus vectors derived completely
from alternative serotypes; Group 6. Genome Modiﬁed Adenovirus
vectors, that retain the parental serotype capsid, but are deleted for
portions of the parental genome. All of Group 1-6 vectors can be utilized in
combination with transient pre-treatment 'with synthetic
immunosuppressive glucocorticoid Dexamethasone to further improve the
outcome of an Ad-based gene transfer. Note, that we describe Group 3

approach in this dissertation.

27

      
 

 

 

Ad5 WT

 

 

M P
“2:2?" " 0' Alternative human
r \
displaying .7 . _ Ad serotype
/ Ad5 .
,. 5 7i"
”Protein IX” Alternative non-
displaying Ad5 [EH Ad human Ad serotype
upentonu l 4 ‘ l 5‘
Ad5/3 Fiber
- - E1-, E2b- Ad
displaying i l - a v Chimera
6
"Fully .
y x, “Fiber” ,i deleted” Ad5/25 HVR5/7
displaying Ad5 HDAd-J ChImera
j
"PEGylated”_.
Ad vectors

28

Chapter II

Ad5-triggered signaling pathways: critical roles of BArr-1
and BArr-2 adaptor proteins

This chapter is the edited version of a research article that was published in the

Journal of Virus Research, Volume 147, Issue 1 (123-134), November 10, 2009.

Authors: Seregin, S. S., Appledom, D. M., Patial, S., Bujold, M., Nance, W.,
Godbehere, S., Parameswaran, N., and A. Amalﬁtano.

29

2.1. Introduction

B—Arrestin-1 and -2 (B-Arr1 and 2) were originally discovered to play a
major role in G protein coupled receptor desensitization, due to their ability to
bind to phosphorylated G protein coupled receptors and sterically block their
ability to signal downstream (40). Subsequent studies revealed more versatile
roles of B-Arr1 (arrestin-2) and B—Arr2 (arrestin-3), including broader regulation of
cell signaling in general, serving as scaffolds, as well as having roles in
transcriptional regulation (40). Recent studies demonstrate B-arrestins as
negative regulators of TLR-stimulated NFIcB and ERK signaling pathways in
macrophages and ﬁbroblasts (41, 42). Consistent with this role of B-arrestins,
Wang et. al. showed that deﬁciency of B-An2 signiﬁcantly enhanced endotoxic
mortality in mice (41). In contrast to these studies, Fan et. al. (43) demonstrated '
differential effects of B-Arr1 and -2 in lipopolysaccharide signaling in mouse
embryo ﬁbroblasts, suggesting that B-arrestin’s effect on TLR signaling might
depend on the cellular context. Although a role for B-arrestins has been
established using selective TLR ligands, their role in microbial infections (which

activate multiple TLRs) is not known.

Innate immune responses associated with systemic injection of
Adenovirus (Ad) based vectors remain to be one of the most important obstacles
limiting the usage of these vectors in numerous clinically important applications.
For example, systemic administration of Ads results in acute thrombocytopenia

(26, 44), activation of the complement, TLR and IFN systems, a robust cytokine

30

release into the circulation sometimes referred to as a “cytokine storm” (24, 26,
27, 36), activation of endothelial cells (45) as well as massive inductions of pro-
inﬂammatory gene expression in multiple tissues, including the liver, spleen and
lung (23, 26, 46-50). Therefore, understanding the mechanisms mediating Ad
induction of these processes may allow for focused efforts to interfere with these
mechanisms to foster improved safety and/or efﬁcacy of Ad mediated gene
transfer applications. Because TLRs signiﬁcantly modulate Ad vector responses,
and since B-arrestins play a crucial role in TLR signaling, in this study we
analyzed the role of B-arr-1 and -2 in Ad5-induced innate immune responses
both in vitro and in vivo. Our results conﬁrm that multiple Ad5 induced innate
immune responses are mediated by B-arrestin functionality. Moreover B-Arr1 and
B—Arr2 differentially mediate Ad5 induced innate responses, having somewhat
opposite functions: B-An2 clearly down-regulates Ad5 induced gene induction

and cytokine responses, whereas B—Arr1 enhances portions of these responses.

31

2.2. Results

B-Arrestins differentially mediate Ad5 induced cytokine and
chemokine release from peritoneal macrophages in vitro. Macrophages
participate in the ﬁrst line of defense against invading pathogens by functioning
as phagocytes, antigen presenting cells, and activators of both innate and
adaptive immune responses via secretion of cytokines and chemokines that
serve as co-activating factors. Numerous studies have indicated that the
induction of cytokines and chemokines by Ad5 injection is dependent upon the
presence of macrophages, speciﬁcally liver resident macrophages known as
Kupffer cells. We have shown that the inductions of KC, MOP-1, lL-12(p40) and
RANTES are Kupffer cell dependent in vivo (36). To determine if B-Arrestins also
play a role in the secretion of cytokines and chemokines from macrophages, we
isolated peritoneal macrophages from wild type, B-Arr1, and B—Arr2 knockout
mice, exposed them to Ad5-LacZ, and measured the concentration of pro-
inﬂammatory cytokines in the growth media at various time points post Ad
exposure (Figures 4-5). Interestingly we observed that levels of MIP-1B, MCP-1
and RANTES were signiﬁcantly lower (p<0.05) in the B-Arr-I-KO macrophages
compared to the wild types. We also observed that the decrease was time-
dependent, i.e. MIP1B was lower at 6 h.p.i., whereas MCP-1 and RANTES were
decreased at 24 h.p.i., suggesting that these are potentially regulated by distinct
mechanisms (Figure 4). In contrast to these results, levels of lL-12(p40) and

MCP-1 (at 24 and 48 h.p.i.) were signiﬁcantly enhanced (p<0.05) in

32

Figure 4: Functional 8-arrestin-1 acts as positive regulator for
several chemokines released in response to Ad infection in vitro.
Peritoneal macrophages derived from WT or B-Arr1-KO C57BU6 mice
were isolated, plated and infected with Ad5-LacZ as described in Materials
and Methods. Media samples were collected at 6, 24 and 48 hours post
virus infection (hpi) and assayed using a multiplexed bead array based
system. The bars represent Mean 1 SD. Statistical analysis was
completed using Two Way ANOVA with a Bonferroni post-hoc test. The
N=4 for all groups of peritoneal macrophages, including mock-infected
groups. *, ** - indicate media cytokine values that are statistically different
from those in Mock-infected groups of the same genotype at the same
time point, p<0.05, p<0.001 respectively. ft, #11! - indicate statistically
different values in the same treatment group at the same time point,

p<0.05, p<0.001 respectively.

33

lL-6 IL-12p40

ﬂ, n n
.0- 1” it t,
E 60' n
\ n
U
n. .
40 5°.
20d
0-
6 Mil 24 1101 48 1191 S hDI 24 hal 48 hpi

 

 

 

I ! 0- U l I
6 "DI 2‘ ml OB hpi 6 Elm 24 "BI 4B 119'
MCP-1

 

= WT_Mock

E B-Arrl-KO_Mock
- WT_Ad5-LacZ

E: B-ArrI—KO_Ad5—Lacz

 

C 1191 24 hol 4. 1191

34

Figure 5: Functional B-arrestin-2 acts as negative regulator for
several chemokines released in response to Ad infection in vitro.
Peritoneal macrophages derived from WT or B—Arr2-KO CS7BL/6 mice
were isolated, plated and infected with Ad5-LacZ as described in Materials
and Methods. Media samples were collected at 6, 24 and 48 hours post
virus infection (hpi) and assayed using a multiplexed bead array based
system. The bars represent Mean 1 SD. Statistical analysis was
completed using Two Way ANOVA with a Bonferroni post-hoc test. The
N=4 for WT_Mock and WT_Ad5-LacZ groups, N=6 for B-Arr2-KO_Mock
and B-An2-KO_Ad5-LacZ groups. *, ** - indicate media cytokine values
that are statistically different from those in Mock-infected groups of the
same genotype at the same time point, p<0.05, p<0.001 respectively. #,
#If - indicate statistically different values in the same treatment group at

the same time point, p<0.05, p<0.001 respectively.

35

 

 

##
IL-B IL12p40 F1
1* ** 200 “I
100 ** ﬂ
0
6 hot 24 hpi 49 hpi 6 Mil 24 hpl 48 hpi
GCSF KC
it
it ﬁt *‘l' I1- I‘* 9*
* 200 ﬂ. *i
* 100
6 her 24 hpi 48 her a hpi 24 run 4: MI
MOP-1 Ill MIP-1ﬂ
r3. ..m ..
20000
10000
0
c not 24 MI 4. trial 6 hot 24 hot 48 MI
RANTES _
E: WT_Mock
. an B—Arr2—KO_Mock
** -WT_Ad5—LacZ
- B-Arr2—KO_Ad5-Lacz
3 MI 24 hol 48 nor

macrophages, derived from B-Arr-Z-KO mice compared to WT macrophages
(Figure 5). These results, taken together, suggest that B-Arr1 may act as a
positive regulator, and B-Arr2 as a negative regulator of Ad5-induced

inﬂammatory responses.

Positive and negative roles for B-Arrestins in Ad5 induced cytokine
and chemokine release. Our results using primary macrophages from B-Arr-1
and -2 KO mice clearly demonstrate important but differential roles for B-arrestins
in Ad-induced inﬂammatory responses. Therefore, we evaluated the potential
that B-arrestin-1 and -2 also play a pivotal role in the release of inﬂammatory
cytokines and chemokines following systemic Ad5 administrations in vivo. To
accomplish this, the plasma levels of seven cytokines/chemokines, commonly
induced following Ad5 injection were evaluated, following systemic delivery of
19:10” vps Ad5-LacZ. As expected, all seven cytokines/chemokines tested
were signiﬁcantly induced within 1 h.p.i. (IL-6, MCP-1, MlP-1B, and KC, p<0.001,
p<0.05), and/or 6 h.p.i (IL-12(p40), G-CSF, MCP-1, MlP-1B, and RANTES;
p<0.001, p<0.05) in wild-type CS7BU6 mice (Figures 6-7). Identically injected B-
Arr-1-KO mice also exhibited signiﬁcant inductions of MCP-1 and MlP-1B at 1
h.p.i. (p<0.05 and p<0.001, respectively). However, at this time point, levels of IL-
6 and KC were signiﬁcantly lower than levels found in the wild types (p<0.05) and
were not statistically induced over mock levels. Furthermore, the induction of IL-
12(p40) was signiﬁcantly lower at 6 h.p.i. in Ad5-injected B-Arr-1-KO as

compared to wild-type animals. Although levels of G-CSF and MCP-1 in B—Arr1-

37

Figure 6: Functional B-arrestin-1 acts as positive regulator of Ad
mediated systemic cytokine and chemokine release in C57BU6 mice.
WT or B-Arr1-KO 057BLI6 mice were intravenously injected with
0.75x1011 vplmouse of Ad5-LacZ vector. Plasma samples were collected
at 1 and 6 hours post virus injection (hpi). Plasma samples were analyzed
using a multiplexed bead array based system. The bars represent Mean :t
SD. Statistical analysis was completed using Two Way ANOVA with a
Bonferroni post-hoc test. The N=3 for Mock (PBS) injected animals, N=4
for virus injected mice. *, ** - indicate plasma cytokine values that are
statistically different from those in Mock-injected animals of the same
genotype at the same time point, p<0.05, p<0.001 respectively. it, #If -
indicate statistically different values in the same treatment group at the

same time point, p<0.05, p<0.001 respectively.

38

Iii IL-6 rL-12p40 #

 

1 hpl e hpl

c-csr MOP-1

 

1 hpi a hpi

RANTES

 

= WT_Mock

E 6—Arr1—KO_Mocl<
-WT_Ad5-LacZ

:3 B—ArrI-KO_Ad5—LaCZ

 

39

Figure 7: Functional B-arrestin-Z acts as potent suppressor of Ad
mediated systemic cytokine and chemokine release in C573lJ6 mice.
WT or B-Arr2-KO C57BU6 mice were intravenously injected with
0.75x1011 vplmouse of Ad5-LacZ vector. Plasma samples were collected
at 1 and 6 hours post virus injection (hpi). Plasma samples were analyzed
using a multiplexed bead array based system. The bars represent Mean :I:
SD. Statistical analysis was completed using Two Way ANOVA with a
Bonferroni post-hoc test. The N=3 for Mock (PBS) injected animals, N=4
for virus injected mice. *, ** - indicate plasma cytokine values that are
statistically different from those in Mock-injected animals of the same
genotype at the same time point, p<0.05, p<0.001 respectively. #, #If -
indicate statistically different values in the same treatment group at the

same time point, p<0.05, p<0.001 respectively.

40

**

IL-6 r31 IL-12p4o IE'

 

 

300 SM
**
'g' ...| i I 2000
B *1:
Q
1% 1M
0 0
1 hpl 6 hpl 1 hpl 6 hpI
c-csr MOP-1
.... r32. .. tit.
_ mo- * m,
«E 1500-
21M- ”00‘
500- zoom
0- o.
1 hpl 6 hpl 1 hpi 6 hpl
MIP-Ip RANTES
.... ﬁg .0. a;
—- m.
E «oo-
DD 100-
a. 1000~ *
m-
0. 0-
1 hpi e hpl 1 hpi 6 hpl
m r31 “C = WT_Mock
_ .. ** m B-Arr2—KO_MOCI<
E - WT_AdSLacZ
901000
‘1 - B-Arr2—KO_Ad5—LacZ
1 I'Ipl 0 hp!

41

KO did not reach statistically signiﬁcant differences as compared to identically
injected 057BLI6 mice, the levels of these factors were not statistically induced
over background levels in B-Arr1-KO mice in contrast to WT mice. No signiﬁcant
differences in either MIP-1B or RANTES were observed (Figure 6). Overall, the
results demonstrate that B-Arr1 regulates induction of an important subset of
Ad5-induced cytokines and chemokines following systemic injection of Ad5

vectors in vivo.

In contrast to observations in B—Arr1-KO mice, levels of all cytokines and
chemokines tested in the plasma of Ad5-injected B-Arr2-KO mice were
signiﬁcantly enhanced when compared to identically injected wild type mic».
Speciﬁcally, at the peak of the KC response, signiﬁcantly higher levels of this
chemokine were detected in Ad-injected B-Arr2-KO animals as compared to wild-
type mice. Additionally, signiﬁcantly higher levels of lL-6 (2-fold), lL-12(p40) (2-
fold), G-CSF (1.4-fold), and MCP-1 (6-fold) were detected in the plasma of 8-
Arr2-KO compared to wild type mice at 6 h.p.i. (Figure 7). Importantly, the
absolute numbers of Ad5 genomes present in the liver in either B-Arr1-KO or B-
Arr2-KO mice were not different from WT mice as measured by Ad5-genome
levels (Figure 8A-B). While there were differences in Ad genome content of the
spleens, these differences did not result in differential transduction of these
tissues as measured by LacZ protein expression, as determined using a

qualitative analysis of X-gal staining and quantitative B-Gal activity

42

Figure 8: Functional B-arrestin-1 and B-arrestin-Z have modest
impact upon liver and spleen transduction efﬁciency by Ad5 in
C573U6 mice. qPCR based quantiﬁcation of Ad5 genomes in liver and
spleen tissues harvested from (A) WT and B-Arr1-KO C57BU6 mice or (8)
WT and B-Arr2-KO C57BU6 mice at 6 hpi was performed. The bars
represent Mean :I: SD. Statistical analysis was completed using tvvo-tailed
Student t-test to compare each B-Arr-KO with WT group of virus injected
animals. # - indicate statistically different values in B-Arr1-KO_Ad5-LacZ
group or B-Arr2-KO_Ad5-LacZ group as compared to WT_Ad5-LacZ
group, p<0.05. Experiments were performed in duplicate; representative
experiment is shown. N=4 for all groups of mice, including Mock-injected

animals.

43

.1
il

 

 

 

 

 

 

 

w m... m c I» In m .m. ..
=3 .52. \ meEocou v< :3 cue...» \ «0.553 3
B
TI— . #
m. w m. h c e.» u 9.. .w
A =3 .52. \ 380cc» 3 =3 new...» \ 3505» 3

_ _ pl
wr Ad5-LacZ 6h '

WI'Mock6h'

D
-

_ _ PI
WTAdS-LacZ

WTMOdtSh

D
-

pl
6111*
cZ_6hpi

-KO Ads-Ca

mMer-Ko Moo—k
-I3A"Q

_6hpi
O_Ad5-LacZ_6hpi

EW-KO_Mcck_6hpi
1:3 W -K

44

Figure 9: Functional B-arrestin-1 and B-arrestin-Z have modest
impact upon Ad derived transgene expression in both liver and
spleen tissues in C57BU6 mice. Bacterial B-galactosidase activity levels
were analyzed in liver and spleen protein homogenates prepared at 6 hpi
from (A) WT and B-Arr1-KO C57BU6 mice or (8) WI' and B-ArrZ-KO
CS7BU6 mice. Activity levels were presented as Units per mg of total
protein (see Materials and Methods). The bars represent Mean :I: SD.
Statistical analysis was completed using two-tailed Student t-test to
compare each B-Arr-KO with WT group of virus injected animals. No

signiﬁcant differences were detected.

45

>

U / mg liver

U / mg spleen

 

 

 

E:WT_Mock_6hpi
-WT_Ad5-LacZ_6hpi
EﬂArr1-KO_Mock_6hpi
DpArrI-K0_Ad5-Lacz_6hpi

U / mg liver

U / mg spleen

46

 

 

DWT_Mock_6hpi
-WT__Ad5-LacZ_6hpi
EBArﬂ-KO_Mock_6hpi
-8Arr2-KO_Ad5-LacZ_6hpi

measurements in both liver and spleen tissues (Figure 9A-B). Therefore the
results presented here were most likely not attributable to differential transduction
of murine tissues per 39. Together these data indicate that B-Arr1 positively
regulates the induction of a subset of Ad5-induced cytokines and chemokines,
while B—Arr2 functions more globally as a negative regulator of the induction of

these innate immune factors.

B-Arrestins differentially mediate the induction of pro-inﬂammatory
genes in livers and spleens following systemic Ad5 injection. We have
previously characterized tissue speciﬁc transcriptome changes rapidly induced
after transduction by Ad5 vectors both in vitm and in vivo (23, 26, 28, 35).
Therefore we have selected a panel of genes and analyzed their expression in
the liver and spleen of Ad5-injected WI', B—Arr1-KO and B—Arr2-KO mice at 6
h.p.i. (Tables 1-4). Selected genes include those involved in innate immune
responses, such as pattern recognition receptors (T LRs, NODs), TLR signaling
pathways (MyDBB, TRIF, TRAF6, TRAF2bp, TBK1), markers of endothelial cells
activation (e-Selectin, ICAM-1, VCAM-1), interferon responsive genes (OAS1a,
IRF7, IRF8), negative regulators of cytokine signaling (8008-1, 8008-3), and
dsRNA editing enzymes (ADAR) (23, 28, 35). Our results demonstrate that Ad5-
induced activation of a number of genes in the liver of Ad5-injected B-Arr1-KO
mice were signiﬁcantly reduced compared to corresponding Ad treated WT mice
(Table 1). Speciﬁcally, B-Arr1-KO mice completely lacked Ad5-induced ADAR,
CD14, TLR6 and VCAM-1 transcripts. However, baseline levels of TLR6 were

signiﬁcantly lower in the tissues of B-Arr1-KO mock-injected animals, which may

47

have partially obscured these results. In contrast to Ad5-injected WT mice, NOD-
2 and TRIM-30 were not induced in Ad5 treated B-Arr1-KO mice. We also
observed a signiﬁcant reduction in TLR3 transcripts in the liver of Ad5-injected B-
Arr1-KO mice as compared to identically injected WI’ mice. A transcriptome
proﬁle observed in spleens isolated from these same animals, revealed

signiﬁcantly reduced levels of TLR3 transcript in B-Arr1-KO mice (Table 2).

Opposite results were obtained in Ad5-injected B-ArrZ-KO mice, results
that positively correlated with the increased cytokines and chemokines levels
observed in these same mice. Over half of the genes tested were induced to
signiﬁcantly higher levels in livers of Ad-injected B-Arr2-KO as compared to
identically injected WT mice (Table 3). Speciﬁcally, we detected signiﬁcantly
higher amounts of CXCL-9, lCAM-1, lRF-7, MyDBB, SOCS-1, SOCS-3, TBK-1,
TLR-2, and TRAF-2bp transcripts in livers of Ad5-injected B-Arr2-KO mice, as
compared to wild type mice. Moreover, several genes, including ADAR, IRF8,
Oas1a, which were not induced in Ad5-injected WT mice, were signiﬁcantly
induced in Ad5-injected B-Arr2-KO mice. The levels of these same transcripts in
the spleen followed a similar trend, as IRF-7, lRF-8 and MyD88 were present in
signiﬁcantly higher levels in spleens of Ad5-injected B-An’Z-KO compared to wild
type mice. In addition, CXCL9, lFNa, SOCS-1 and TLR9, which were not induced
in spleens of wild type C57BU6 mice, were signiﬁcantly induced in [3-Arr2-KO
mice following systemic Ad5 injection (Table 4). These results further support the

notion that B-Arr2 functions as a negative regulator of Ad5-induced innate

48

Table 1: B-Arr1-KO mice had signiﬁcantly reduced Ad5-triggered
activation of a number of genes in livers, as compared to WT mice.
Values represent Mean :I: SD. Statistical analysis was completed using
One Way ANOVA with a Student-Newman-Keuls post-hoc test, p<0.05
was deemed statistically signiﬁcant. N=3 for Mock-injected groups, N=4
for Ad5-LacZ injected groups. Signiﬁcant differences compared to
WT_Mock are highlighted in light grey color. Signiﬁcant differences in
transcriptional activation in B-Arr1-KO (Ad5-LacZ) group compared to WT
(Ad5-LacZ) group are indicated in table by black frame and boldface font.
* Indicate signiﬁcant differences between mock-injected animals. For full

gene names please refer to abbreviation list.

49

 

Ad5-LacZ Induced gene expression In the liver (fold over CS7BL/6 Mock, 6 h.p.I.)

 

 

 

C57BL/6 B-Arrl-KO C57BL/6 (AdS- B-Arrl-KO (Ad5-
mgck) (Mock) Laczl LacZ]
ADAR 1.0 1 0.2 0.7 1 0.1 2.2 1 0.5 1.6 1 0.2
c014 1.0 1 0.2 0.7 1 0.1 2.31 0.5 1.3 1 0.7
was 1.0 1 0.1 1.0 1 0.1 ' ‘ 10.3 1 2.4 ._ 9.91547“ ‘-,
DAF 1.0 1 0.2 0.9 1 0.1 1.2 1 0.1 1.4 1 0.2
e—Selectin 1.0 t 0.1 0.6 1 0.2 - 2.1 t 0.3 2.0 1:10.7‘ﬁ 3;]: ' ,'
ICAM 1.0 1 0.2 0.7 1 0.1 2.2 1 0.2 2.2 1 0.4 '
IFNd 1.0 1 0.2 0.6 1 0.1 1.2 1 0.3 0.7 1 0.2
IFNB 1.0 1 0.4 0.8 1 0.2 1.6 1 0.4 1.0 1 0.1
IRF-3 1.0 1 0.2 0.9 1 0.1 1210.2 1.0 1 0.1
IRF-7 1.0 1 0.1 0.9 1 0.2 15.3 1 1.5 , ' 16.0115; )
[RF-8 1.0 1 0.1 0.8 1 0.1* . 2.11.0.3; g,- 7, 234101427621"
jak-l 1.0 1 0.2 0.8 1 0.1 1.4 1 0.2 1.1 1 0.1
jak-3 1.0 1 0.1 0.7 1 0.2 1.3 1 0.1 1.3 10.1
MyD88 1.0 1 0.1 0.8 1 0.2 4.110.5'_ .- 4.65: 0.1). -. , »
NFkB" 1.0 1 0.1 1.0 1 0.1 1.7 10.2 1.6 10.2
RelA . . . .
NOD-1 1.0 1 0.1 0.7 1 01* 1.7102 1.4 1 0.4
NOD-2 1.0 1 0.1 0.6 1 02* 1.3 1 0.3 _ 1.0 1 0.2
OAS-la 1.0 1 0.3 0.7 1 0.1 . 3.1103 2.61 0.5' . :
SOCS-l 1.0 1 0.2 0.7 1 0.1 4.6 1‘ 0.6 4.6 11.4 ‘
socs-3 1.0 1 0.2 0.3 1 0.1 2.3 1 0.2 2.5 1 1.4
TBK-l 1.0 1 0.1 0.9 1 0.1 3.91 0.2 3.8110
TLR-2 1.0 1 0.1 0.7 1 0.1 ' 21.7 17.0 25.91109 57 '
TLR-3 1.0 1 0.2 0.7 1 0.1 _ 11.6 1 1.4 ‘ 7.9 1 3.8-
TLR-6 1.0 1 0.1 0.6 1 0.1* 2.0 1 0.5 1.5 1 0.2
TLR-9 1.0 1 0.2 0.6 1 0.1 2.0 10.3 1.81 0.2 -1 -
TRAFpr 1.0 1 0.2 0.6 1 0.2 6.1 1 1.1 5.9 1 3.3 '
TRAF6 1.0 1 0.2 1.2 1 0.1 1.3 1 0.1 1.3 1 0.1
TRIF 1.0 1 0.1 1.2 1 0.1 1.4 1 0.3' 1.7 1 0.1
TRIM30 1.0 1 0.2 0.6 1 0.1 11.4 1 1.5 7.0 1 5.1
VCAM 1.0 1 0.2 0.7 1 0.1 1.5 1 0.2 1.0 1 0.1

 

 

 

 

 

 

 

 

 

 

 

50

 

Table 2: B-Arr1-KO mice had similar levels of Ad5-triggered
activation of genes in spleens, as compared to WT mice. Values
represent Mean 1: SD. Statistical analysis was completed using One Way
ANOVA with a Student-Newman-Keuls post-hoc test, p<0.05 was deemed
statistically signiﬁcant. N=3 for Mock-injected groups, N=4 for Ad5-LacZ
injected groups. Signiﬁcant differences compared to WT_Mock are
highlighted in light grey color. Signiﬁcant differences in transcriptional
activation in B-Arr1-KO (Ad5-LacZ) group compared to WT (Ad5-LacZ)
group are indicated in table by black frame and boldface font. * Indicate
signiﬁcant differences between mock-injected animals. For full gene

names please refer to abbreviation list.

51

 

Ad5-LacZ Induced gene expression in the spleen (fold over C57BL/ 6 Mock, 6 h.p.i.)

 

 

 

CS7BL/6 B-Arrl—KO CS7BL/6 [AdS- B-Arrl-KO (Ad5-
(Mock) (Mock) LacZ) LacZ)
ADAR 1.0 1 0.6 1.5 1 0.4 2.7 10.2. :4 ' f ‘ 3.0.1 0.2;.“ 1‘.
c014 1.0 1 0.5 1.9 1 0.7 2.0 1 0.1 1.5 1 0.5
CXCL-9 1.1 1 1.0 3.3 1 1.0 12.4129. 4 31.9 13.11:. 2 .
_e-Selectin 1.0 1 0.2 1.5 1 0.4 1.2 1 0.1 1.5 t 0.3
ICAM 1.0 1 0.4 1.3 1 0.1 , 4.1-10.2 -~ '3 -' «43111164?- " “I
IFNd 1.0 1 0.6 2.0 1 0.8 1.8 1 0.6 1.7 1 0.3
[RF-7 1.0 1 0.3 1.4 1 0.3 34.3 14.7 ”38.4 11.1“} ,
IRF-8 1.0 1 0.3 1.2 1 0.2 2.6 1 0.4 2.41.0.3 ‘ , j
jak-l 1.0 1 0.5 1.9 1 0.3 0.7 1 0.1 0.7 1 0.1
MyD88 1.0 1 0.1 1.5 1 0.4 3.3 1 0.3 3.4 10.4:- "1 .1
NFkB-ReIA 1.0 1 0.4 0.8 1 0.1 0.9 1 0.1 1.0 1 0.4
OAS-la 1.0 1 0.5 2.6 1 04* 13.4 12.6 7 11.441113 , , , . _..;
socs-1 1.1 1 0.8 1.3 1 0.2 13:91 02 a " {33.471110 ' is,
socs-3 1.1 1 0.9 2.2 1 0.1 . 30.413.6‘ . . 33.3 1'1Q.a:,-._ ;
TBK-l 1.0 1 0.1 1.0 1 0.1 ' x: 91.61 0.1 I ' , . 2.110135} I
TLR-2 1.0 1 0.4 1.6 1 0.1 3.8 10.1 ' 46311.0 r ' ,1:
TLR-3 1.0 1 0.3 1.9 1 0.2* 10.0 1 0.6 . ., 1.6)1f‘oféi91‘f f
TLR-6 1.0 1 0.5 1.6 1 0.5 0.9 1 0.1 1.0 1 0.1 ,
TLR-9 1.1 1 0.8 1.1 1 0.1 ' 14.3 10.7 5.2 11.1" 35.1
TRAFpr 1.0 1 0.1 1.3 1 0.1 1.3 1 0.1 1.7 1 0.5

 

 

 

  
 

 

 

 

 

 

52

Table 3: B-ArrZ-KO mice had signiﬁcantly higher levels of Ad5-
triggered activation of a number of genes in livers, as compared to
WT mice. Values represent Mean 1 SD. Statistical analysis was
completed using One Way ANOVA with a Student-Newman-Keuls post-
hoc test, p<0.05 was deemed statistically signiﬁcant. N=3 for Mock-
injected groups, N=4 for Ad5-LacZ injected groups. Signiﬁcant differences
compared to WT_Mock are highlighted in light grey color. Signiﬁcant
differences in transcriptional activation in B-Arr2-KO (Ad5-LacZ) group
compared to WT (Ad5-LacZ) group are indicated in table by black frame
and boldface font. * Indicate signiﬁcant differences between mock-injected

animals. For full gene names please refer to abbreviation list.

53

 

Ad5-LacZ induced gene expression in the llver (fold over C57BL/6 Mock. 6 h.p.l.)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

C57BL/6 B-ArrZ-KO CS7BL/6 (AdS- B-ArrZ-KO (Ad5-
(Mock) (Mock) LacZ) LacZ) .
ADAR 1.0 1 0.1 0.7 1 0.1 1.3 1 0.3 * 21.6 10.11 ‘
c014 1.0 1 0.2 0.9 1 0.1 2.1 1 1.2 1.9 1 1.2
CXCL-9 1.0 1 0.3 0.6 1 0.1 5.2 1 0.7 ‘ "9".9;1E‘f2i‘l. _.
DAF 1.0 1 0.1 0.7 1 0.1 1.1 1 0.2 0.9 1 0.1
e-Selectin 1.0 1 0.2 0.7 1 0.2 2.0 1 0.0.7 ‘ “33.0 111 ‘ »
lCAM 1.0 1 0.2 0.7 1 0.2 1.9 1 0.2 ' ‘ I 7 3.231046;
lFNa 1.0 1 0.2 0.7 1 0.1 0.6 1 0.2 0.6 1 0.1
IFNB 1.0 1 0.2 0.6 1 0.1 0.6 1 0.2 0.6 1 0.1
lRF-3 1.0 1 0.1 0.6 1 0.1* 0.7 1 0.1 0.6 1 0.1
[RF-7 1.0 1 0.1 0.7 1 0.1 ' . 9112.4 . ‘ . 1 ~ ‘
[RF-8 1.0 1 0.1 0.7 1 01* 1.6 1 0.4 2.01 f . ,
lak-l 1.0 1 0.1 0.7 1 0.1* 0.7 1 0.2 0.7 1 0.1
Jak-3 1.0 1 0.1 0.7 1 0.1 1.0 1 0.3 1.11 0.1
MyD88 1.0 1 0.1 0.6 1 0.1* i -' 2.7.11.0 1411; {1.0 "i ‘
NFkB-RelA 1.0 1 0.1 0.7 1 0.1 1.0 1 0.3 1.4 1 0.2
NOD-1 1.0 1 0.3 0.8 1 0.1 1.1 1 0.1 1.4 1 0.1
NOD-2 1.0 1 0.2 0.7 1 0.1 0.7 1 0.1 0.9 1 0.1
OAS-1a 1.0 1 0.2 0.6 1 0.1 1.5 1 0.4 2,210.3 ‘
socs-1 1.0 1 0.1 0.8 1 0.1 3.9 1 1.4 75.113, .‘
socs-3 1.0 1 0.4 0.9 1 0.6 2.2 10.7 ' 415' 10.5 . j j .1 _
TBK—l 1.0 1 0.1 0.8 1 0.1 ' 17 1 0.4 . 10.5 "f
TLR-2 1.0 1 0.1 0.9 1 0.3 18.6 1 8.5 75312” ,v ,'
TLR-3 1.0 1 0.1 0.6 1 0.1* 5.9 1 1.3 , 9.0 1 3.0
TLR-6 1.0 1 0.1 0.9 1 0.1 1.2 1 0.2 1.6 1 0.4
TLR-9 1.0 1 0.1 0.6 1 01* 1.2 1 0.3 1.2 1 0.1
TRAFpr 1.0 1 0.3 0.6 1 0.1 3.7 1 1.5 11512.7 ’ '
TRAF6 1.0 1 0.1 0.8 1 01* 0.9 1 0.1 0.8 1 0.1
TRlF 1.0 1 0.1 0.9 1 0.1* 0.9 1 0.2 1.1 1 0.2
TRlM30 1.0 1 0.1 0.6 1 0.1* . 6.7 1 2.3 8.7 1 1.0
VCAM 1.0 1 0.1 0.8 1 0.1 0.7 1 0.2 0.9 1 0.1

 

54

Table 4: B-ArrZ-KO mice had signiﬁcantly higher levels of Ad5-
triggered activation of a number of genes in spleens, as compared to
WT mice. Values represent Mean 1 SD. Statistical analysis was
completed using One Way ANOVA with a Student-Newman-Keuls post-
hoc test, p<0.05 was deemed statistically signiﬁcant. N=3 for Mock-
injected groups, N=4 for Ad5-LacZ injected groups. Signiﬁcant differences
compared to WT_Mock are highlighted in light grey color. Signiﬁcant
differences in transcriptional activation in B—ArrZ-KO (Ad5-LacZ) group
compared to WT (Ad5-LacZ) group are indicated in table by black frame
and boldface font. * Indicate signiﬁcant differences between mock—injected

animals. For full gene names please refer to abbreviation list.

55

 

Ad5-LacZ Induced gene expression in the spleen (fold over C57BU6 Mock, 6 h.p.i.)

 

 

 

 

CS7BL/6 B-ArrZ-KO C57BL/6 [AdS- B-ArrZ-KO (Ad5-
[MockL (Mock) LacZ) LacZ)
ADAR 1.1 1 0.8 0.9 1 0.3 1.3 1 0.5 1.6 1 0.1
CXCL-9 1.1 1 0.9 1.2 1 0.9 3.6 1 3.3 4.61 1.9
e-Selecu'n 1.0 1 0.2 1.0 1 0.3 0.7 1 0.1 1.0 1 0.2
lCAM 1.0 1 0.5 0.5 1 0.2 1.3 1 0.4
lFNa 1.0 1 0.1 1.6 1 1.1 1.5 1 1.0
lRF-7 1.0 1 0.1 0.7 1 0.2 21.41 53
[RF-8 1.0 1 0.1 0.7 1 0.4 0.9 1 0.2
MyD88 1.0 1 0.4 1.0 1 0.1 25 1 0.1
NFkB-RelA 1.0 1 0.3 0.7 1 0.6 0.7 1 0.4
OAS-1a 1.0 1 0.1 3.4 1 3.1 12.9 1 33 '
socs-1 1.0 1 0.4 0.11 1 004* 1.9 1 1.0
socs-3 1.0 1 0.4 2.9 1 0.4* ' 12.5 1 4.4
TBK-l 1.0 1 0.2 0.7 1 0.4 0.9 1 0.5
TLR-2 1.0 1 0.3 0.9 1 0.3 2.0 1 0.2
TLR-3 1.0 1 0.3 2.2 1 1.4 ‘ 6.11 0§ ' " '
TLR-6 1.0 1 0.3 2.0 1 1.4 0.9 1 0.1
TLR-9 1.0 1 0.2 0.6 1 0.3 1.5 1 1.3
TRAFpr 1.0 1 0.7 1.1 1 0.5 1.0 1 0.2

 

 

 

 

 

 

56

 

immune responses, whereas similar responses are positively mediated by B-

Arr1 .
2.3. Discussion

Ad-based vectors possess an enormous potential for numerous gene
transfer applications based upon their broad tropism, highly efﬁcient
transductional capability, and their ease for scalable production. Based upon
these facts, Ad vectors have been the most utilized gene transfer vector in
humans to date (http://www.wiley.co.uk/wileychi/genmedlclinicall). However, the
robust innate immune response elicited shortly after intravascular Ad delivery
poses a signiﬁcant limitation to the use of this vector for numerous applications
that could beneﬁt from such administrations, such as gene transduction into the
liver. lntravascular delivery of Ads into animal models facilitates detection of Ad
induced innate immune responses, which may not be detectable when other
routes of administration (such as intramuscular) are utilized. These innate
responses include acute thrombocytopenia (26, 44), robust cytokine and
chemokine releases (24, 26, 28, 36), activation of endothelial cells (45, 129) and
inductions of inﬂammatory gene networks in multiple tissues, including both the

liver and the spleen (23, 26, 46).

It is well established that Ad5-induced innate immune responses are
mediated by the TLR adaptor proteins MyDBB and TRIF. As a receptor that
utilizes both MyD88 and TRIF, TLR4 is activated by LPS (41-43). Because both
B—Arr1 and B-Arr2 proteins have been shown to modulate LPS induced TLR4

57

mediated signaling, we sought to determine if these proteins also played a role in
Ad5-induced innate immune responses. Utilizing B—Arr1-KO and B—An’Z-KO
mouse models, we show that whereas B-Arr1 served as positive regulator of a
portion of Ad5 induced innate immune responses, B—Arr2 appears to function as

a negative regulator of Ad5 induced innate immune responses.

For example, following intravenous Ad5 injection into B-Arr1-KO mice, we
observed signiﬁcantly reduced levels of pro-inﬂammatory mediators including IL-
6, lL-12(p40) and KC, relative to levels measured in Ad5-injected WT mice.
Furthermore, we observed signiﬁcantly reduced transcription of innate immune
response genes in transdcued tissues of Ad5-injected B—Arr1-KO mice. We
additionally detected reduced expression levels of MCP-1, MlP-1B, and RANTES
in peritoneal macrophages from B-Arr1-KO mice following exposure to Ad5
vectors in vitro. The results suggest that B-Arr1 may serve as a mediator of Ad-
induced immune responses downstream of TLR signaling, speciﬁcally those that
require MyDBB as an adaptor. Consistent with this notion, we have found
signiﬁcantly reduced activation of IRF7, TLR3 and TLR6 genes in livers of [SAM-
KO mice, which further suggest the role of B—Arr1 in mediating TLR/MyD88/IRF7
pathways. The ﬁndings also highlight a relatively underappreciated role for B—Arr1
as a positive regulator of pro-inﬂammatory responses, a role that contrasts the
previously reported role for B-Arr1 as playing a negative role in the induction of
cytokine responses following LPS challenge (41). Our present results however,

are consistent with our recent study where we found that B-Arr1 is necessary for

58

the sustained production of some cytokines/chemokines after LPS challenge in

vivo (Porter et al, 2009. Manuscript submitted for publication).

The role of B-Arr2 in the induction of innate immune responses by Ad
vectors was diametrically opposite to that of B-Arr1. This was evidenced by
signiﬁcantly higher inductions by Ads of multiple cytokines and chemokines, and
inﬂammatory gene expression responses after injection into B-ArIQ-KO mice.
These responses were corroborated in vitro as detected in Ad5 infected
peritoneal macrophages, suggesting that this cell type may play an important role
in mediating this response in vivo. Interestingly, the proﬁle of innate immune
responses observed in B-Arr2-KO mice paralleled the role that TLR4 plays in
innate immune responses noted after systemic Ad5 injection(130). Our previous
work indicated that TLR4 plays a negative role in the induction of IL-12(p40) and
G-CSF following intravenous Ad5 injection. It is possible that the negative role
that TLR4 plays in Ad5 induced innate immune responses is mediated by B-Arr2,
such that loss of either protein results in a more pronounced innate immune
response triggered by Ad5. Our results also suggest that B-Arr2 may act as a
negative regulator of TLR2/MyD88/IRF7 pathways. However, it is also clear that
other factors must also play a role in these responses, since the phenotype in
Ad5-injected B—ArrZ-KO animals did not completely mimic that found in Ad5-
injected TLR4-KO mice (130). Interestingly, in a recent study, we found that B-
Arr-2 also mediates LPS/TLR4-induced cytokine responses in vivo (Porter et al,

2009, Manuscript submitted for publication).

59

In summary, our data demonstrate important roles for both B-Arr1 and B-
Arr2 as positive and negative regulators in modulating Ad5 induced innate
immune responses. B-Arr-1 and -2 interaction partners that mediate B-arrestin’s
actions in response to Ad5 administration may include proteins of the TLR

pathways or other unique proteins of the Ad5 responsive signaling pathways.

Acknowledgements

We wish to thank Michigan State University Laboratory Animal support
facility for their assistance in the humane care and maintenance of the animals
utilized in this work. 8.8.8. was supported by American Heart Association
Midwest Afﬁliate Fellowship 08156606. A.A. was supported by the National
Institutes of Health grants RO1DK-069884, P01 CA078673, the MSU Foundation
and the Osteopathic Heritage Foundation. N.P. is supported by the National
Institutes of Health grants R01AR056680, R01 HL095637, and R21AR055726.

60

Chapter III

Ad interactions with the complement system are pivotal
in understanding how to maximize the safety and
potency of Ad mediated gene transfer for both gene
therapy and vaccine applications

This chapter is the edited version of a research article that was published in the

Gene Therapy Journal, Volume 16, Issue 10 (1245-1259), June 25, 2009.

Authors: Seregin, S. S., Y. A. Aldhamen, D. M. Appledom, N. J. Schuldt, A. J.
McBride, M. Bujold, S. Godbehere, and A. Amalﬁtano.

61

3.1. Introduction

Adenovirus (Ad) based vectors offer tremendous capabilities as gene
transfer platforms. However, Ad-triggered innate immune responses and Ad-
speciﬁc neutralizing antibodies hinder the ability to repeatedly administer the
vector and preserve transgene expression for long periods of time, prompting
multiple efforts to develop alternative Ad vectors to overcome this problem. It is
with these realities in mind that studies investigating the mechanisms underlying
the induction of neutralizing antibodies to the well-characterized Ad5 vector
platform are required. Importantly, the Ad5 serotype is the only Ad serotype
utilized in all human gene transfer clinical trials (>367 as per September 2008,
comprising 24.9% of all gene therapy trials to date), please see

http://www.wiley.co.uklwileychi/genmed/clinicall).

Our previous studies have conﬁrmed that the induction of neutralizing
antibodies to Ads is dependent upon the presence of a functional complement
system in the host (24). Although we have discovered that the protein C3 is
essential in this response, the mechanisms underlying CS-dependent induction of
neutralizing antibody by Ad vectors is currently unknown. Our previous results
conﬁrm that lack of Ad interactions with the C3 protein results in a diminished
induction of pro-inﬂammatory cytokines and acute phase responses early after
Ad administration, suggesting that a lack of this initial response may contribute to
diminished induction of neutralizing antibody responses. This hypothesis is

supported by recent studies in lFN receptor KO mice that also showed

62

diminished induction of neutralizing antibody titers after Ad treatments (131). We

have utilized Ad treated CR1I2-KO mice in this study to test this hypothesis.

It is known that complement system activation acts to optimize induction of
pathogen speciﬁc antibody responses (57-59). Subsequent to opsonization by
activated C3, pathogens are bound to B cells and dendritic cells via binding of
pathogen bound C3 to the complement receptors (CRs). The human CR1 and
CR2 receptors have well known roles in modulating both innate and adaptive
immune responses. Human CR1 (hCR1) is a potent inhibitor of complement
activation, having both decay-accelerating and cofactor activities. Furthermore,
hCR1 has a critical role in the clearance of immune complexes and B cell
maturation, as thoroughly reviewed elsewhere (60, 61). Human CR2 (hCR2)
expression is restricted to the surface of B cells, follicular dendritic cells and
thymocytes. When hCR2 binds C3d opsonised pathogens and becomes
associated with 0019, it lowers the threshold for B cell activation by up to 1000
fold (62). HCR1 and hCR2 also play a role in T cell biology, for example,

crosslinking of hCR1 inhibits T cell proliferation and lL-12 production (63).

Murine complement receptors (mCRs) 1 and 2 (CD35ICD21) are products
of alternative splicing from the same gene. mCR1 contains 21 complement
control protein repeats (CCPRs), whereas the smaller mCR2 contains only 15 C-
terrninal CCPRsof mCR1 (64). mCR1/2 is known to be expressed on B cells and
dendritic cells (64). Therefore, the expression pattern of mCR1/2 resembles that
of hCR2, but not hCR1. Similar to their human homologues, the functions of

mCR1/2 related to generation of maximal humoral responses have been well

63

described (65-69). Interestingly, mCR1/2 functionality prevents excessive
myocardial tissue damage subsequent to coxsackievirus B3 infection (70), as
well prevents lethal Streptococcus pneumoniae infection, a role potentially

indirectly reﬂective of the complement inhibitory activities of the CRs (71).

While the role of murine CR1/2 protein has been extensively studied in
regards to adaptive immune responses, its function in inhibiting/regulating murine
complement has not been demonstrated, possibly since in most mouse models,
the Crry protein was suggested to play the predominant role in controlling
complement activation. We think that the role of murine CR1/2 protein in innate
immune responses (including the ones which are known to be complement
dependent) may be more important than previously considered, as suggested by
our present studies of Adenovirus mediated gene transfer into mCR1/2-KO mice.
Our results in murine models revealed dual roles for mCR1/2; roles that include
down—regulation of multiple aspects of the Ad induced innate immune responses,
while also playing the major role in the complement dependent induction of

neutralizing antibody responses to Ads.

3.2. Results

Murine Complement Receptor 1I2 regulates Ad mediated cytokine and
chemokine release in CSTBUB mice. To study the role of mCR1/2 protein in Ad
induced innate and adaptive immune responses, we utilized mCR1/2-KO mice.
These mice have been previously demonstrated to completely lack expression of
CR1/2 on B cells (71). It is also known that CR1/2 activities also impact upon
levels of activated C3, by virtue of CR1/2’s decay accelerating properties.
Utilizing western blotting with C3-speciﬁc antibodies, we conﬁrmed that mock-
injected CR1I2-KO mice have normal overall levels of C3 no different than wild-
type mice, and equivalent amounts of C3 cleavage products were present in the
plasma of virus injected WT and CR1l2-KO mice, as investigated both at 10
minutes post injection and 6 hours post injection (Figure 10). These results
suggest that CR1I2-KO mice do not have signiﬁcant alterations in the ability of
C3 to initially interact with Ads, an interaction that we have previously conﬁrmed

mediates many Ad induced innate and adaptive immune responses (23-26, 46).

Inﬂammatory cytokines and chemokines are rapidly released after
systemic Ad injection. We have identiﬁed 7 cytokines and chemokines (KC or
CXCL1, MCP-1, MIP-1B, G-CSF, RANTES, lL-6, IL-12p40) that become
signiﬁcantly elevated within hours of systemic administration of Ad vectors, some
of which are elevated in a C3—dependent fashion (24, 26). We investigated the
role that mCR1/2 has in the induction of these cytokines by administering Ads

into wild type and mCR1/2 knockout mice. Plasma samples, collected at 1 and 6

65

Figure 10: Plasma basal levels and Ad dependent activation of
complement protein C3 were identical between CSTBIIG WT and
CR1I2-KO mice. Plasma samples from WT C57BU6 and CR1/2-KO mice
were collected and Western blotting was performed as described in
Materials and Methods utilizing quantitative Licor’s Odyssey system. Intact
and activated a-chains of C3 protein are shown. There were no signiﬁcant

differences in levels of basal C3 protein or C3 protein cleavage detected.

66

N8..-mu<ro¥m:mo

82-1215,

19:32 .

0
dm
aa
t
h
MC

 

981

d
e
t
a
.N
d
A

 

or chain

50

67

hours post intravenous Ad administration conﬁrmed that KC and MCP-1
chemokines are rapidly released in response to Ad injections and reach
maximum levels by 1 hpi. Ad-injected mCR1/2-KO mice had identical levels of
activation of these 2 chemokines at 1 hpi (Figure 11), suggesting that Ad
induction of these very early mediators of the inﬂammatory responses is not
dependent upon mCR1/2 functionality. Interestingly, Ad-injected mCR1/2-KO
mice exhibited signiﬁcantly higher plasma levels of G-CSF, MCP-1 and RANTES
at 6 hours after systemic Ad injection, as compared to identically treated WT
mice (Figure 11). This result identiﬁes the role of functional mCR1/2 protein as a
complement regulator that suppresses complement activation, resulting in
diminished production of several cytokines released subsequent to Ad
administration in mice. This result may reﬂect a complement decay accelerating
property of mCR1I2 thought to be present in the extracellular portion of the

protein, based upon analogy to the human CR1/2 homologs.

Portions of the acute and chronic cellular responses to Ad vectors
are Complement Receptor 1I2 dependent. Activation of vascular endothelium
is a critical step during initiation of inﬂammatory immune responses, since many
inﬂammatory cells (i.e. platelets, neutrophils, macrophages, mast cells) utilize
activated endothelial cells (EC) as a means to localize to damaged sites. This
response is mediated by activated EC over-expression of E-selectin, ICAM-1
and/or VCAM-1 adhesion molecules on their surface, molecules that facilitate the

migration of inﬂammatory cell types into damaged organs (45, 132, 133). Soluble

68

Figure 11: Murine Complement Receptor 1I2 mitigates Ad mediated
cytokine and chemokine release in CS7BLJ6 mice. C57BU6 WT and
CR1/2-KO mice were intravenously injected with 0.75x1011 vplmouse of
Ad5-LacZ vector. Plasma samples were collected at 1 and 6 hours post
virus injection (hpi). Plasma samples were analyzed using a multiplexed
bead array based system. Statistical analysis was completed using Two
Way ANOVA with a Bonferroni post-hoc test. The N=4 for Mock (PBS)
injected animals, N=6 for virus injected mice) and 6 hpi (N=4 for Mock,
N=12 for virus treated mice. The bars represent Mean 1 SD. *, ** - indicate
plasma cytokine values that are statistically different from those in Mock-
injected animals of the same treatment at the same time point (i.e. CR1/2-
KO_Ad-LacZ group from CR1/2-KO_Mock group), p<0.05, p<0.001
respectively. #, ﬂ - indicate statistically different values in CR1/2-
KO_Ad5-LacZ group compared to WT_Ad5-LacZ group at the same time

point, p<0.05, p<0.001 respectively.

69

G-CSF

# MOP-1

   
     
   

7500 = WT Mock

EWT Ad5—LacZ
Ill CR1/2—K0 Mock

 

_ 5000 4000 **
é - CR1/2-K0 AdS—LacZ H
*-
2500 2000
o o
1 h l s h I 1 h I s h I
" RANTES " p p
ooo #
**
_ 400
E
E *
zoo
o
1 hpl 15 hpi
IL-12 p40 lL-6
1250 zoo-
**
1000 zoo~
**
- 700 150 **
i i *
500 100.
250 so.
0 o.
1 h I s h I 1 hpi
9 KC " MIP-1p
1250 ** ** ooo- **
1000 600‘
5 no
2 m.
500
**
250 2°°'
0 o.
1 hpi e hpi 1 hpi s hpi

70

forms of these cell adhesion molecules are also produced by activated E05
(134). Interestingly, while the levels of sE-selectin in Ad treated WT mice were
increased 3-fold, sE-selectin levels in Ad treated mCR1/2-K0 mice were at least
7-fold higher, as compared to mock-injected mCR1I2-KO mice, these levels were
also signiﬁcantly higher than levels noted in Ad treated WT mice (Figure 12).
Induction of both sVCAM-1 and leAM-1 was also slightly more robust in Ad
treated mCR1I2-K0 mice as compared to Ad-injected WT mice, although these
levels did not reach a signiﬁcant difference (data not shown). We have also
tested the level of lCAM-1, VCAM-1 and E-selectin mRNA transcripts in murine
liver at 6 hpi after systemic Ad injection and found signiﬁcantly increased levels
of all 3 transcripts in mCR1/2-KO mice (Table 5). These results conﬁrm that lack
of mCR1/2 functionality results in a more robust induction of cellular adhesion
molecules in Ad treated mice, suggesting that another role of mCR1/2 is to
modulate (suppress) the extent of complement dependent induction of EC

activation.

We next wished to correlate EC activation with cellular elements known to
be mobilized subsequent to Ad infections or Ad vector administrations. Acute
thrombocytopenia and/or lymphopenia can occur within hours of natural Ad
infections, and Ad induction of thrombocytopenia is a complement (C3)
dependent event (24, 26, 29). However, at 24 hours after systemic Ad injection,
mCR1I2-KO mice exhibited levels of thrombocytopenia no different than that

noted in Ad-injected WT mice (data not shown). Ad-injected mCR1I2-K0 mice

71

Figure 12: Murine Complement Receptor 1I2 reduces Ad dependent
activation of endothelial cells in C57BU6 mice. C57BU6 WT and
CR1l2-KO mice were intravenously injected with 0.75x1011 vplmouse of
Ad5-LacZ vector. Plasma samples, collected at 6 hpi (N=6 for virus treated
groups, N=4 for Mock-injected groups) were analyzed using a multiplexed
bead array based quantitative system. The bars represent Mean :l: SD.
Statistical analysis was completed using One Way ANOVA with a Student-
Newman-Keuls post-hoc test. Fold difference over WT_Mock group is
shown. *, ** - indicate values, statistically different from those in Mock-
injected animals of the same genotype, p<0.05, p<0.001 respectively. #,
ﬂ - indicate statistically different values in CR1l2-KO_Ad5-LacZ group

compared to WT_Ad5-LacZ group, p<0.05, p<0.001 respectively.

72

~336qu 602.236 N03.§.§.e§8 22.5665

    

n 333....

.o

 

010:!

73

Table 5: mCR1I2 is an important suppressor of Ad5-LacZ induced
gene expression in livers of C57BU6 mice. The numbers represent
Mean :I: SD. Statistical analysis was completed using One Way ANOVA
with a Student-Newman-Keuls post-hoc test, p<0.05 was deemed a
statistically signiﬁcant difference. Note, when signiﬁcant p<0.001 was
observed in majority of cases. N=4 for Mock-injected groups, N=6 for virus
injected groups was used. Signiﬁcant differences compared to
057BLI6_WT_Mock are highlighted in grey color. Signiﬁcant inductions of
transcriptional activation in CR1/2-KO_Ad5-LacZ group compared to
WT_Ad5-LacZ group are indicated in table with black frame and boldface
font. Note that there were no signiﬁcant differences detected between
Mock-injected WT and CR1I2-K0 mice. For full gene names please refer

to abbreviation list.

74

 

Ad5-LacZ induced gene expression in a liver (fold over C57BL/G_WT_Mocl<) I

 

 

 

CS7BL/6 WT 6 hpi Mock

CRI/Z -/- 6 hpi Mock

cs1aue wr s hpl Ad5-LacZ CW2 -/- 6 hpi Ad5-Lad
”a; “1,3” awn," ,5 . . ‘7

 

 

 

1.0 t 0.2
1.0 t 0.1
1.0 t 0.4
1.0 t 0.2
1.0 t 0.5
1.1 t 0.5
1.0 t 0.3
1.1 1: 0.7
1.1 t 0.7
1.0 t 0.3
1.0 t 0.3
1.0 :l: 0.4
1.0 :l: 0.3
1.0 t 0.3
1.1 t 0.5
1.0 :l: 0.4
1.0 t 0.4
1.1 t 0.5
1.0 i 0.2
1.0 t 0.1
1.0 :t 0.2
1.0 t 0.4
1.1 t 0.6
1.1 t 0.6
1.0 t 0.4
1.0 :l: 0.1

 

1.0 t 0.1
1.8 :l: 0.6
1.9 i: 0.1
1.4 :l: 0.2
1.6 t 0.4
0.9 t 0.2
1.0 :l: 0.1
1.2 t 0.4
2.0 t 0.5
1.0 :1: 0.2
1.2 t 0.3
1.05 t 0.03
1.1 t 0.1
1.2 t 0.3
0.2 :l: 0.1
1.2 1 0.5
1.1 :t 0.5
0.6 :l: 0.2
1.2 t 0.1
2.7 t 0.3
0.8 :l: 0.2
1.2 :l: 0.4
1.3 i 0.5
1.9 t 0.3
1.4 1: 0.2
1.0 :l: 0.1

 

H4

       

 

75

trended towards elevated levels of neutrophils and reduced levels of lymphocytes
at 24 hpi, though the changes did not reach statistical signiﬁcance when
compared to identically treated WT mice. There was also no difference in levels
of Kupffer cell necrosis in virus treated WT and mCR1I2-K0 mice, suggesting
that mCR1/2 is not involved in Kupffer cell necrosis, an event that occurs within

hours of Ad injection (data not shown) (135).

Systemically administered Ad vectors induce signiﬁcant leukocyte
inﬁltration into the liver (136, 137). The inﬁltration becomes apparent at 3 dpi,
continuously increases with the generation of an adaptive immune response to
the virus and/or antigen it expresses, and reaches maximal levels by 21-56 dpi
(137, 138). We have quantiﬁed monocellular (leukocyte) inﬁltration into the livers
of Ad treated WT and mCR1/2-KO mice at 28 dpi. Both WT and mCR1I2-K0 Ad-
injected mice exhibited signiﬁcant inﬁltration of inﬂammatory cells into their livers,
as compared to mock-injected animals. Despite the previously noted enhanced
pro-inﬂammatory cytokine responses, as well as enhanced activation of ECs in
Ad-injected mCR1I2-K0 mice, Ad-injected mCR1I2-K0 mice had signiﬁcantly
reduced periportal inﬂammation as well as total levels of hepatic inﬂammation
relative to Ad-injected WT mice (Figure 13A-B). Portal and lobular inﬂammation
were somewhat reduced in virus treated mCR1/2-KO mice as compared to
identically treated WT mice, although these differences did not reach statistical
signiﬁcance. These results suggest that maximal induction of cellular

inﬂammation after Ad vector administration is directly dependent upon mCR1/2,

76

Figure 13: mCR1I2-KO mice exhibit signiﬁcantly reduced leukocyte
inﬁltration into the liver of Ad treated mice at 28 dpi. Mice injections
and morphometric evaluation of liver sections was performed as described
in Materials and Methods. (A) Representative H&E stained liver sections
obtained at 28 dpi from three groups of mice: WT_Mock (N=4), WT_Ad5-
LacZ (N=5), CR1/2-KO_Ad5-LacZ (N=5) are shown. Note the lack of any
inﬂammation in WT_Mock, the large number of inﬂammatory cells in
WT_Ad5-LacZ and moderate inﬁltration in CR1/2-KO_Ad5—LacZ. (B)
Representative sections from each treated animal were analyzed, scored
and averaged for the levels of portal, periportal and lobular inﬂammation,
as described in Materials and Methods. The sum of averages for each
category was computed to obtain a total inﬂammation index score. The
error bars represent :l: SD. Statistical analysis was completed using two-
tailed Student t-test to compare 2 groups of virus injected animals. #, ﬂ -
indicate statistically different values in CR1/2-KO_Ad5-LacZ group

compared to WT_Ad5-LacZ group, p<0.05, p<0.001 respectively.

77

 

Portal inﬂammation Periportal inﬂammation

Score

  
    

   

WT Ads-LacZ cn1r2+<o Ad5-LacZ WT_AdS-Lacz CR -K0.MB an

Lobular inﬂammation Total inﬂammation index

WT_AdB-Lacz CR1!2-KO_Ad6-Lacz

 

WT_AdS-LacZ C R1f2-KO_Ad5-Lac2

78

despite enhanced activation of the innate immune system in the same animals

earlier.

Murine Complement Receptor 112 downregulates Ad induction of pro-
inﬂammatory genes in livers of Ad treated C57BU6 mice. We have
previously conﬁrmed that systemic administrations of Ad vectors results in a
rapid and profound transcriptome response in the murine liver, responses that
are mediated by Ad interactions with the murine complement system (23, 26, 35).
Based in part upon those studies, we analyzed expression levels of several liver
gene transcripts, including those participating in innate immune responses, i.e.:
pattern recognition receptors (T LRs, NODs), TLR signaling pathways (MyD88,
TRIF, TRAF6, TRAF2bp, TBK1), markers of EC activation (ICAM1, VCAM1, E-
selectin), interferon responsive genes (ADAR, OAS1a, IRF7, IRF8), all listed in
Table 5. Note, that none of the genes tested showed any differences in basal
transcription levels between mock-injected WT and mCR1/2-KO mice liver
derived transcripts. However, the levels of 13 liver transcripts, although
signiﬁcantly induced in Ad-injected WT mice at 6 hpi, were induced to
signiﬁcantly greater levels in Ad treated mCR1l2-KO mice. These Ad induced,
but mCR1/2 suppressed genes included ADAR, ICAM1, VCAM1, E-selectin,
My088, TBK1, TLR2, TLR3, JAK3, SOCS1. Importantly, 5 gene transcripts, that
were not induced in Ad-injected WT mice (as compared to Mock-injected
animals) also revealed signiﬁcant inductions in mCR1/2-KO Ad treated mice
(Table 5). These observations allowed us to conclude that mCR1/2 plays a

signiﬁcant role in down-regulating Ad induction of pro-inﬂammatory gene

79

expression. Importantly, the Ad induction of most of these genes has also been
previously shown by us to be a complement protein C3-dependent event,
suggesting that mCR1/2 downregulates Ad activation of pro-inﬂammatory genes
by suppressing and/or regulating the overall levels of Ad induced, C3-dependent

activation of the complement system (24, 26).

Ad mediated transduction in vivo is not dependent upon murine
Complement Receptor 1I2, but the levels of Ad derived transgene
expression are complement and mCR1I2-dependent. We next conﬁrmed that
Ad mediated liver transduction of Ad genomes was not diminished at any time
point tested during our studies (Figure 14A), in part conﬁrming our previously
published results that complement does not signiﬁcantly mediate Ad transduction

efﬁcacy in vivo (24).

Ad derived transgene expression in livers of treated mice was then tested
by two independent techniques: qualitatively by staining liver sections with X—Gal
(Figure 14B) and by quantitative measurement of B-galactosidase activity at 6
hpi, 24 hpi and 28 dpi (Figure 14C). We found a signiﬁcant reduction of B—Gal
activity in mCR1I2-K0 mice as compared to WT mice both at 24 hpi and 28 dpi,
but not at 6 hpi (Figure 14B-C). Ad-injected C3—KO mice also exhibited
signiﬁcantly reduced B-Gal activity both at 6 hpi and 24 hpi, a trend that we and
others have noted previously (24, 26, 139). Our observations conﬁrm that lack of
mCR1/2 functionality does not dramatically alter the ability of Ads to transduce

their genomes into the murine liver per se, but rather results in a more rapid

80

Figure 14: The efﬁcacy of Ad transduction of the liver of C57BU6
mice is not dependent upon murine Complement Receptor 112, but
the levels of Ad derived transgene expression are complement and
mCR1I2-dependent. (A) qPCR based quantiﬁcation of Ad5-LacZ
genomes in livers harvested from C57BU6 WT and CR1/2-KO mice at 6
hpi, 24 hpi, 28 dpi. The bars represent Mean :I: SD. Statistical analysis was
completed using two-tailed Student t-test to compare 2 groups of virus
injected animals. #, ## - indicate statistically different values in CR1/2-
K0_Ad5-LacZ group compared to WT_Ad5-LacZ group, p<0.05, p<0.001
respectively. Note the difference in scale for different time points. (B) In
situ visualization of bacterial B-galactosidase in liver of Ad5-LacZ treated
C57BU6 WT and mCR1l2-K0 mice. Representative sections for each of
the groups are shown. Total magniﬁcation of 200x was used to obtain
images. N=6 for all virus injected groups at 6 hpi, N=4 for all virus injected
groups at 24 hpi, N=5 for all virus injected groups at 28 dpi, N=4 for all
Mock-injected groups at all time points. (C) Bacterial B-galactosidase
activity levels were analyzed at 6 hpi, 24 hpi and 28 dpi from four groups
of mice. Activity levels were presented as Units per mg of total protein.
The bars represent Mean :1: SD. Statistical analysis was completed using
two-tailed Student t-test to compare 2 groups of virus injected animals. #,
#ll - indicate statistically different values in CR1I2-KO_Ad5-LacZ group

compared to WT_Ad5-LacZ group, p<0.05, p<0.001 respectively.

81

ID

6 hpi 24 hpi 28 dpi

.-
M

Ad genomes I llvor cell
A

ND

 
 

 

 

   

CRUZ—ML“ CR1I2-KO_ Mm CR1I2-KO_ Hock CR1R-KO_ Ads-LacZ CR1!2-K0_ lock CR1I2-KO_ Ad5-LacZ

C

Ulmg
s s

 

- WT_AdS-Lacz
- CR1/2-KO_Ad5-Lacz
a 03-K0_Ad5-LacZ

82

shutdown of CMV enhancer dependent transgene expression from Ad vectors, a

complex ﬁnding elaborated upon further in the discussion section of this chapter.

Murine Complement Receptor 1I2 is required for generation of Ad vector
speciﬁc, but not transgene speciﬁc adaptive immune responses. Ad speciﬁc
adaptive immune responses can be primed by the robustness of innate immune
responses (63, 131, 140). Our results conﬁrm that mCR1/2 protein suppresses or
down-regulates many Ad induced innate immune responses, therefore we
wished to determine whether enhanced induction of Ad induced innate immune
responses (due to lack of mCR1/2 function) altered subsequent adaptive immune
responses to the vector capsid, and/or the transgene product the Ad vector
expresses. Importantly, we ﬁrst conﬁrmed that baseline IgG levels in mock-
injected WT and mCR1/2-KO mice were identical (data not shown), conﬁrming
previously published observations (63, 65, 66, 140). However, our results
demonstrated that Ad-injected mCR1I2-KO mice had diminished Ad-capsid
speciﬁc primary humoral responses (as compared to identically treated WT mice)
both at 14 and 28 dpi (Figure 15). lgA, total lgG, lgG1, lgG2a, lgGS subtypes of
Ad capsid speciﬁc antibodies tested in Ad treated mCR1l2-KO mice were
signiﬁcantly reduced at least at one of the two time points tested as compared to
Ad-injected WT mice, moreover all were diminished both at 14 and 28 dpi in
mCR1I2-KO mice (Figure 15). Additionally, Ad-injected mCR1I2-KO mice did not
generate signiﬁcant titers of Ad-capsid neutralizing antibodies, as determined

both at 14 and 28 dpi (Figure 16). These observations strongly parallel our

83

Figure 15: mCR1I2-KO mice exhibit signiﬁcantly reduced Ad vector
capsid speciﬁc humoral immune responses. Three groups of mice
were treated as described in Materials and Methods: WT_Mock (N=4),
WT_Ad5-LacZ (N=5), CR1I2-KO_Ad5-LacZ (N=5). Plasma samples,
collected at 14 dpi and 28 dpi, were analyzed for anti Ad capsid speciﬁc
total lgM, lgA and lgG antibodies and various lgG subclasses. The error
bars represent :l: SD. Statistical analysis was completed using two-tailed
Student t-test to compare 2 groups of virus injected animals. #, #ll -
indicate statistically different values in CR1l2-KO_Ad5-LacZ group
compared to WT_Ad5-LacZ group, p<0.05, p<0.001 respectively. *, ** -
indicate values, statistically different from animals of the same group at

different time point, p<0.05, p<0.001 respectively.

84

OD450

OD450

OD450

OD450

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

  

—0— Mock
—I—WT_AdS-Lacz
-- «a -- CR1/2-KO_AdS-Lscz

 

 

85

previously published data noting that Ad-injected C3-KO mice also exhibit a
diminished capacity to generate anti-Ad capsid speciﬁc humoral responses, as

well as neutralizing antibody responses (24).

Since B cells are known to express high levels of mCR1/2, and depend
upon mCR1/2 for induction of antigen speciﬁc B cell activation, we quantiﬁed B
cell activation 48 hours after systemic Ad injection into WT, C3-KO and mCR1/2-
KO mice. We conﬁrmed that the number of activated B cells (i.e.: CD19”ICD69+
splenocytes) was signiﬁcantly increased in WT mice injected with Ad vectors as
compared to uninfected WT mice (Figure 17). Interestingly, the levels of B cell
activation were signiﬁcantly and identically reduced in both Ad treated C3 and
mCR1/2-KO mice, again as compared to identically injected WT mice,
suggesting that the C3-dependent portion of induction of neutralizing antibody
responses to Ad capsids may be entirely mediated by interactions mediated by
the CR1/2 protein (Figure 17). This result positively correlates with our ﬁndings
that functional mCR1/2 protein is required to generate Ad capsid speciﬁc humoral
immune responses (Figures 15-16), a response that is at least in part a
complement dependent event (24). The overall results suggest that induction of
neutralizing antibodies to Ads is dependent upon C3 opsonized Ads interacting

with mCR1/2 present on B cells, resulting in their activation.

Finally, we have previously published that the lack of complement protein
C3 did not reduce the induction of transgene speciﬁc humoral responses in Ad-

injected mice (24). Interestingly, mCR1I2-KO mice injected with Ad5-LacZ

86

Figure 16: mCR1I2-KO mice exhibit signiﬁcantly reduced Ad capsid
speciﬁc neutralizing antibodies titer. Three groups of mice were treated
as described in Materials and Methods: WT_Mock (N=4), WT_Ad5-LacZ
(N=5), CR1/2-KO_Ad5-LacZ (N=5). Plasma samples were collected at 28
dpi and assayed for neutralizing antibodies using successive dilutions (see
Materials and Methods). The error bars represent :l: SD. Statistical
analysis was completed using One Way ANOVA with a Student-Newman-
Keuls post-hoc test, p<0.05 was deemed a statistically signiﬁcant
difference. *, ** - indicate values, statistically different from those in
WT_Mock-injected animals, p<0.05, p<0.001 respectively. #, ## - indicate
statistically different values in CR1/2-KO_Ad5-LacZ group compared to
WT_Ad5-LacZ group, p<0.05, p<0.001 respectively. The bottom bar graph
shows endpoint neutralizing antibody titer. Note signiﬁcant difference in
endpoint NAb titer detected between WT and CR1/2-KO virus injected

groups by two-tailed Student t-test.

87

00492

0.45

0.35 ~,

0.25

0.15 4

0.05 -

-0.05 ,

1._~4-.._.. _L_ ..___

-0.15

2.5-

Log (Neutralizing Ab titer)

 

 

4: —o— C578L/6-Mock

—o— CS78L/6_WT_AdS—Lac2

--¢'- CRUZ-K0 Ad5-LacZ

 

 

1:25 1:50 1:100 1:200

 

l_"_l

WT_AdS-LacZ CR1f2-KO_Ad5-LacZ

88

Figure 17: mCR1I2 and C3-KO mice have impaired B cell activation in
response to systemic Ad injection. C57BU6_WT, C3-KO and CR1/2-
KO mice were intravenously injected with 0.75x1011 vplmouse of Ad5-
LacZ vector. Splenocytes were isolated at 48 hpi and processed as
described in Materials and Methods. Percentage of activated B cells
(CD19”/CD69+ splenocytes) was determined by ﬂow Cytometry based
methods. Statistical analysis was completed using One Way ANOVA with
a Student-Newman-Keuls post-hoc test, p<0.05 was deemed a statistically
signiﬁcant difference. The bars represent Mean :l: SD. *, ** - indicate
values statistically different from those in Mock-injected animals of the
same treatment (is. CR1I2-KO_Ad-LacZ group from CR1I2-KO_Mock
group), p<0.05, p<0.001 respectively. #, ## - indicate statistically different
values in virus injected complement deﬁcient mice groups compared to

WT_Ad5-LacZ group, p<0.05, p<0.001 respectively.

89

CR1I2-KO

C3-KO

C57BU6 WT

NonJé—i x002

 

‘

__,

v—w

.
I. _
4
v.

 

 

 

 

18 3%
3.241

 

 

 

 

 

 

 

 

 

 

CD69 positive splenocytes

 

u w m m w
3.33.53.38

 

 

 

‘

8:858 9:58 28

 

—— WT
—— co-Ko
~-~ CR1I2-KO

 

 

90

generated levels of transgene speciﬁc (B-Gal) antibodies that paralleled those
noted in identically treated WT mice (Figure 18). Only 8 -Gal speciﬁc lgA, total
lgG and lgGZa reached signiﬁcant differences, and this occurred at only one of
the two time points tested. These results suggest that Ad expressed, transgene

speciﬁc adaptive immune responses are not dependent upon mCR1/2.

91

Figure 18: mCR1I2-KO mice have minimally reduced Ad vector
derived transgene speciﬁc humoral immune responses as compared
to WT mice. A) Three groups of mice were treated as described in
Materials and Methods: WT_Mock (N=4), WT_Ad5-LacZ (N=5), CR1/2-
KO_Ad5-LacZ (N=5). Plasma samples, collected at 14 dpi and 28 dpi,
were analyzed for anti B-Gal (Ad derived transgene) speciﬁc total lgM, lgA
and lgG antibodies and various lgG subclasses. The error bars represent
:l: SD. Statistical analysis was completed using two-tailed Student t-test to
compare 2 groups of virus injected animals. #, ## - indicate statistically
different values in CR1l2-KO_Ad5-LacZ group compared to WT_Ad5-
LacZ group, p<0.05, p<0.001 respectively. *, ** - indicate values,
statistically different from animals of the same group at different time point,

p<0.05, p<0.001 respectively.

92

 

-0.05

OD450

OD450

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

  

-—o—Mock
—-I—WT_Ad5-l.acz
- at — CRUZ-KOJdS-Lacz

 

 

 

93

3.3. Discussion

Despite the fact that the role of murine Complement Receptor 1/2
(mCR1/2) in modulating adaptive immune responses has been extensively
studied (65, 66, 141, 142), very little information is available regarding the role of
mCR1/2 in regulating aspects of the innate immune system, including
complement mediated responses. In this study we have investigated the role of
mCR1/2 protein in regulating Ad vector induced innate immune responses and
also assess what impact these roles have upon downstream adaptive immune

responses to the Ad vector, and/or the transgene the vector expresses.

We have previously described the pivotal role the complement system has
in generating robust innate immune responses subsequent to Ad treatment,
including systemic pro-inﬂammatory cytokines/chemokine release, EC activation,
acute thrombocytopenia, and liver transcriptome dysregulation (24, 26). In this
study we have shown that many of these complement dependent responses are

modulated (suppressed) by mCR1/2.

To highlight how mCR1/2 speciﬁcally down-regulates Ad dependent
induction of pro-inﬂammatory cytokines and chemokine responses we have
combined data obtained in this study with our previously published data in Ad
treated C3-KO mice (24), (Figure 19). Note, that MCP-1, lL-12p40, G-CSF and
RANTES are all induced in a complement dependent manner (evident by the
lack of induction of these cytokines/chemokines in C3-KO mice). Moreover,

mCR1/2 protein down-regulates the induction of these very chemokines (MOP-1,

94

Figure 19: mCR1I2 protein plays a signiﬁcant role in down-regulation
of Ad mediated complement dependent pro-inﬂammatory cytokines
production. This graph summarizes data obtained in this study (Figure
11) and our previously published data on Ad mediated cytokine release in
C3—KO mice (24). Plasma levels (at 6 hpi) of pro-inﬂammatory cytokines
and chemokines in Ad-injected CR1/2-KO and C3-KO mice are
normalized to the levels of WT_Ad5-LacZ. Levels higher than the ones
observed in WT mice have positive fold induction (CR1l2-KO mice),
whereas reduced levels compared to the levels of WT mice (C3-KO) have
negative fold induction. Shaded area represents the levels of cytokines
release in Ad-injected WT mice. *, ** - represent a statistically signiﬁcant
differences between Ad-injected WT and complement (CR1/2 or C3)
knockout mice, p<0.05, p<0.001 respectively. Note, that MCP-1, lL-12p40,
G-CSF and RANTES are all induced in a complement dependent manner
(evident by the lack of induction of these cytokines/chemokines in C3-KO
mice). Moreover, mCR1/2 protein down-regulates the induction of these

very molecules (MCP-1, G-CSF and RANTES).

95

Fold over WT Ad5-LacZ

N

**

 

**

1..
I I *
*

 

 

MCP-1

lL-6

lL-12p40 G-CSF MlP-lB RANTES

96

I C3-KO
' Clu/Z-KO

G-CSF and RANTES) as compared to Ad treated wild-type mice. These overall
results reveal that mCR1/2 plays a very important role in suppressing overall
innate immune responses induced by complement system activation by Ad

vectors.

This suppressive activity of mCR1/2 is not without precedent, as it has
been shown that mCR1/2 is required to prevent excessive tissue damage
subsequent to coxsackievirus B3 infection (70). In addition, lack of mCR1/2
functionality results in an enhanced susceptibility (i.e.: lethality) subsequent to
Streptococcus pneumoniae (71 ). Note, that none of these studies focused on the
role of mCR1/2 in innate immunity, as most studies regarding modulation of the
murine complement system and the innate immune responses have focused
upon the complement receptor-1 related protein (Crry) (143, 144). Those studies
indirectly suggest that murine Crry has taken over some hCR1 functions, i.e.:
those roles relative to mCR1/2 acting as a murine complement inhibitor (64, 145).
We think that our studies conﬁrm a signiﬁcant role for mCR1/2 in suppressing the
activation of the murine complement system, and innate immune responses
derived from that activation. Why the mouse has what appears to be a redundant
complement inhibiting activities (present in Crry and mCR1/2) will require future
experimentation, but this redundancy may have contributed as to why humans
lack Crry.

Pre-existing immunity to Adenoviruses remains a main hindrance for
numerous applications utilizing Ad-based vectors as a gene transfer platform. In

light of this fact, it is of critical importance to study the mechanisms underlying

97

generation of Ad capsid speciﬁc antibody responses. Increased innate immune
responses are generally thought to positively correlate with enhanced inductions
of humoral, and/or cellular adaptive immune responses (63, 131, 140). The
complement system is well known to impact signiﬁcantly upon the generation of
humoral responses to pathogens by facilitating interactions between the innate

and adaptive response systems (60-62).

Our previous results demonstrated that Ad vector administrations into C3-
KO mice resulted in diminished cytokine and chemokine responses, and a
diminished induction of neutralizing antibodies to Ad (24, 26). However, despite
enhanced induction of pro-inﬂammatory cytokines and chemokines rapidly after
Ad vector administrations into CR1/2-KO mice, we still found a dramatically
reduced induction of neutralizing antibodies to the Ad vector capsid. These
results positively correlated with a lack of activation of B cells in Ad-injected C3-
KO and mCR1/2-KO mice. The combined observations suggest that lack of
induction of pro-inﬂammatory cytokine responses early after Ad administrations
into C3 -KO mice is not the reason for lack of neutralizing antibody induction in
the Ad treated C3-KO mice (24). Rather, C3 opsonized Ad interactions with
mCR1/2 on murine B cells is primarily responsible for induction of neutralizing
antibodies to the Ad vector capsid. This insight suggests that further investigation
of this interaction may promote strategies to proactively modulate the induction of

neutralizing antibodies to Ad vectors.

Zaiss et al. detected evidence of Ad induction of neutralizing antibodies in

an alternative CR1/2-KO mouse model (56). That strain of CR1l2-KO mouse has

98

a different portion of the murine Cr2 gene disrupted, relative to the CR1I2-KO
mouse strain utilized in our studies, which may be relevant to the different
results. Additional technical caveats including the use of a signiﬁcantly different
assay system may also explain the differing results. Our multiple ﬁndings
demonstrating a lack of signiﬁcant induction of Ad capsid neutralizing antibodies
in both Ad treated CS-KO and CR1/2-KO mice, as well as our ﬁnding that Ad
induction of B cell activation is also signiﬁcantly decreased in these same strains
of mice strongly support our conclusion that CR1/2 does play an important role in
the induction of neutralizing antibodies to Ad vectors. While Zaiss etal. did not
report whether or not induction of neutralizing antibodies to Ads occurred in Ad
treated C3-KO mice, they did ﬁnd that mCR1/2 functions were also necessary for
induction of neutralizing antibodies to AAV based vectors. The latter results,
combined with ours, suggest that mCR1/2 may be playing a role in the induction
of neutralizing antibodies to several commonly utilized gene transfer vectors.
Interestingly, activation of type I interferons (lFNa/B), have also been shown to
play a role in the induction of Ad speciﬁc humoral adaptive immune responses.
Whether these responses are due to or a result of Ad interactions with the
complement system, and CR1/2 speciﬁcally, will require future investigations

(131).

In a similar vein, we found that an increased induction of Ad induced innate
immune responses in mCR1/2-KO mice did not correlate with increased
induction of adaptive immune responses to a foreign antigen expressed by an Ad

vector. The reasons for this observation are not due to a diminished ability of the

99

Ad vector to transduce cells in mCR1I2-KO mice, but rather appear to correlate
with reduced transgene expression levels in Ad vector treated mCR1/2-KO mice
both at 24 hpi and 28 dpi. Possibly, the globally altered cytokine and chemokine
responses noted after Ad administration into CR1/2-KO mice indirectly decreases
activity of the CMV derived enhancer/promoter element utilized to drive
expression of the expression foreign transgene encoded by the vector, a

possibility that will require experiments beyond the scope of this study.

We previously reported that transgene speciﬁc adaptive immune
responses were higher in Ad treated C3—KO mice as compared to identically Ad
treated WT mice (24). At the least, those results suggested that lack of
complement activation does not signiﬁcantly interfere with generation of
transgene speciﬁc antibody responses by Ad vectors. Thus, targeted blockade of
complement system activation that prevents C3 opsonized Ads from interacting
with the CR1 I2 receptor may minimize induction of antibody responses to the Ad
capsid while simultaneously preserving or enhancing the ability of the Ad to

induce beneﬁcial immune responses to Ad expressed foreign antigens.

Our results may also suggest a possible mechanism as to how non-
covalent modiﬁcations of Ad vectors, (such as Ad PEGylation) may allow for
avoidance of induction of neutralizing antibodies by indirectly minimizing their
induction of the wmplement system (146-148). We also suggest that these
ﬁndings may allow for improved use of Ad vectors as a gene transfer platform,
though such studies are beyond the scope of this dissertation. However, several

previous studies indirectly conﬁrmed roles for the complement system in

100

generation of robust Ad induced adaptive immune responses, in particular in Ad

vaccine settings utilizing C4-binding protein or C3d as novel adjuvants (149-153).

In conclusion, we have conﬂrrned the role of mCR1/2 in regulating and/or
suppressing several Ad induced innate immune responses, as well conﬁrmed
that mCR1/2 modulates the induction of adaptive immune responses to the Ad
vector. While the former observation now conﬁrms that in mice, mCR1/2 can play
an important role in down-regulating complement dependent innate immune
responses in a manner that is independent of Crry, the latter observations
suggests that Ad vector interactions with mCR1/2 also ﬁgure prominently in

induction of neutralizing antibodies to Ads.

Acknowledgement:

We wish to thank Michigan State University Laboratory Animal support
facility for their assistance in the humane care and maintenance of the animals
utilized in this work and Michigan State University Investigative Histopathology
Laboratory for performing H&E stains of liver tissues. 8.8.8. was supported by
American Heart Association Midwest Afﬁliate Fellowship 08156606. A.A. was
supported by the National Institutes of Health grants RO1DK-069884, P01

CA078673, the MSU Foundation as well the Osteopathic Heritage Foundation.

101

Chapter IV

Ad5-based vectors “capsid-displaying” speciﬁc
complement inhibitor: a novel approach to improve Ad
vector safety proﬁle

This chapter is the edited version of a research article that was published in the

Journal of Innate Immunity, DOI: 10.1159/000284368, February 11, 2010.

Authors: Seregin, S. S., Hartman, 2. C., Appledom, D. M., Godbehere, S.,

Jiang, H., Frank, M. M., and A. Amalfrtano.

102

4.1. Introduction

The complement system is one of the ﬁrst lines of innate defense against
invading pathogens. Pathogen interactions with pre-existing antibodies and/or
circulating complement proteins results in activation of one or more of the three
major complement pathways: the Classical (antibody dependent), Alternative
(antibody independent), and the Lectin (antibody independent) complement
pathways. Activation of each of the pathways results in the rapid production of
C3-convertases. This activation eventuates in the direct production of potent
anaphylotoxins (i.e.: C3a, 05a), indirectly promotes the high level production of
several cytokines and chemokines, and thereby initiates the recruitment of
cellular elements of the innate and adaptive immune systems to the site of

infection (49, 52-54).

Inappropriate or excessive complement activation can, however, also
cause thrombocytopenia, anaphylactoid reactions, systemic inﬂammatory
responses, adult respiratory distress syndrome (ARDS), and/or death. Many of
these same toxicities have been observed after high dose administrations of Ads
into rodents and non-human primates, as well in human trial subjects (24, 26, 28,
46—50, 55). Ad capsids are now known to interact with and activate complement
proteins m and m interactions that induce several complement
dependent toxicities in several species. Importantly, Ad capsids are non-
enveloped and therefore are not thought to be directly lysed by terminal
complement C6-C9n Membrane Attack Complexes, however, it has been

conﬁrmed that Ads become opsonized by complement components, mainly C3b

103

and 04b, both in vitro (55, 146) and in vivo (154). Complement opsonization
facilitates phagocytosis of Ad virions by cells of macrophage origin, if the latter
contain proper complement receptors (CR1 (60)) on their membranes. These
important interactions with the complement system lead to Ad vector triggered,
complement dependent release of pro-inﬂammatory cytokines and chemokines.
These responses also augment activation of the cellular part of the innate
immune system, resulting in the recruitment of macrophages and granulocytes,
and activation of endothelial cells. Importantly, many of these toxicities are
avoided when Ad vectors are administered into complement deﬁcient (C3-KO)
mice (24, 26, 27, 46, 55). Based upon these observations, we have attempted to
provide the Ad capsid with an inherent complement inhibitory activity, in an effort
to mitigate Ad capsid activation of human complement, and/or complement

dependent toxicities.

A 13 amino acid synthetic peptide with complement inhibitory activity
(COMPinh), was initially identiﬁed by others in a high-throughput, phage-based
screening effort (155-157). Importantly, COMPinh, amino acid sequence:
lCVWQDWGAHRCT, is an optimized version of the originally described peptide
(156). COMPinh is able to bind and inhibit complement component C3 of human
and non-human primate origin, but not C3 from other species (155-157). In this
report, we conﬁrm that we can successfully construct and isolate high titers of
these novel Ad vectors “displaying” COMPinh directly on the Ad capsid surface

as a fusion protein with several Ad capsid proteins. Based upon this observation,

104

we have performed relevant testing of the novel Ads utilizing several human

model assays of Ad dependent complement activation.

105

4.2. Results and Discussion

We constructed two Ad5-based vectors capsid-displaying a 13 amino acid
sequence with known complement inhibitory properties (COMPinh). The
COMPinh DNA sequence was inserted in-frame into two sites of the Ad genome,
forcing expression of the COMPinh peptides as (1) a carboxy-terminal fusion
displayed from the cement capsid protein IX (Ad5-LacZ-IX-dCOMPinh), and (2)
embedded within the HI loop of the Ad ﬁber protein (Ad5-LacZ-Fiber—dCOMPinh)
as diagrammed in Figure 20. The viability and infectivity of all Ad vectors utilized
in our studies was conﬁrmed by electron microscopy of puriﬁed Ads (Figure 21),
infectious unit titering assay (T ClD50) and transducing unit titering assays. Viral
particle titers were determined by spectrophotometry and validated by SDS-
PAGE electrophoresis of puriﬁed Ads followed by silver staining and/or western
blotting. COMPinh displaying Ads preserve VPfl' CID ratios typically observed for
conventional Ad vectors (Table 6). Direct sequencing of DNA derived from all
CsCl puriﬁed Ad vectors and capsid thermostability assays further conﬂrrned the

integrity of the constructs (data not shown).

To investigate the potential of COMPinh displaying Ads to diminish
complement activation, we utilized two different Normal Human Serum (NHS)
based assays: the AP50 and C3a-desArg ELISA. For example, identical amounts
of control or COMPinh displaying Ads were incubated with NHS (+EGTA) and the
residual complement activity remaining in the human serum was then measured

in the AP50 assay. NHS pre-incubated with WT_Ad5, Ad5-LacZ and

106

Figure 20: Schematic diagram of all Ad vectors constructed and
utilized in our study. Genome maps of all Ads constructed are shown.
Ad vectors were designed as described in Materials and Methods. Capsid
protein IX and ﬁber are outlined as Ad capsid proteins utilized for fusion
with COMPinh. Genome sizes are shown relative to WT Ad5 genome
(top). Letter “d” prior to COMPinh or GFP deﬁnes that this peptide is

“capsid-displayed”. Note: genomes are not drawn to scale.

107

 

xlIIIIJ

 

 

 

 

 

. z...— 2., .85... W $85.63 .202, v83 m 3 the}? a... 1.:
_ 1.5 ﬂ .zé... .II 88x68 869, 84.3 m 2 M . Nos—.26
(111.1111

 

rlllllllk...

     

EH1. 41114188“.secessﬁuﬁarsﬁllluﬁH. 65.26

 

_ z: A Legal»? 0:863 562, comma n 3 7:; sofa—nu

 

gas 11.1

 

 

 

 

]

 

 

EH .2...

oEocwa m 3 Huh... E am a...— _

 

108

Figure 21: Electron microscopy of puriﬁed Ad5 vectors. Cesium
chloride puriﬁed Ad vectors were stained with 1% PTA and electron
micrographs were taken, exactly as described in Materials and Methods.
lcosahedral virion structures approximately 100 nm in diameter are clearly
visible for all Ads. There is no signiﬁcant amount of damaged capsids
and/or free capsid proteins detected. Photographs were taken from

representative areas from each sample.

109

Ag5-LacZ-lXﬁCQMPlnh Ad5-LacZ-Fi9gr-dCOMPlnh

    

110

Table 6: Novel “capsid-displaying” Ads can be propagated to high
titers, similar to conventional Ad vectors. Capsid modiﬁcations do

not impair infectivity and transduction efﬁciency of novel Ads.

VP — viral particles

TU — transducing units

BFU - blue-forming units (for Ads expressing B-Gal)

TCID — tissue cuIture infections dose (measure of Ad infectivity)

TEM - transmission electron microscopy

111

 

VP titer

TU titer

TCID titer

VP/TU/

Silver

 

 

 

 

 

Virus (vplml) (BFU/ml) (TCID/ml) 3:00 Stain TEM
Ad5‘CMV' 2.86x10‘2 1.8x10" 1.6x10‘° 179““ Intact Intact

LacZ 1
Ad5-lX—dGFP 3.54x1o12 NA 6.3x10‘° 56/NA/1 Intact Intact
Ad-LacZ-IX- 12 1o
dCOMPinh 4.75x10 ND 6.3x10 75/ND/1 Intact Intact
Ad-LacZ- ‘

Fiber- 2.06x1o12 7.0x1o‘° 1.0x1o‘° 206/7/1 Intact Intact
dCOMPinh

 

 

 

 

 

 

 

112

 

Ad5-lX-dGFP control viruses revealed signiﬁcant complement consumption
(~80%) as compared to NHS samples pre-incubated with PBS, conﬁrming that
conventional Ad vectors signiﬁcantly activate the alternative complement
pathway. Note that the Ad5-lX-dGFP virus displays a non-speciﬁc peptide
sequence (GFP) from plX, conﬁrming that random display of foreign peptides on
the Ad capsid does not result in complement inhibitory activity in this assay.
Complement consumption was dramatically reduced in NHS incubated with
similar particle numbers of the COMPinh displaying Ads (Figure 22A) relative to
conventional Ad vectors. Speciﬁcally, when NHS was incubated with Ad5-LacZ-
lX-dCOMPinh particles, only 20% of the available complement activity in the
NHS was consumed. Notably, the display of COMPinh from the pix protein
facilitated a signiﬁcantly improved ability to prevent complement activation,
relative to the ﬁber protein display of COMPinh. This may be due to several
reasons, inclusive of the simple fact that the pIX protein is present in 240 copies

on each Ad capsid, vs. 36 copies for the ﬁber protein.

To further investigate the properties of COMPinh displaying Ads, we
incubated NHS with the novel Ad vectors and measured C3a-desArg protein
levels generated after the incubations. Control Ad vectors including WT_Ad5,
Ad5-LacZ and Ad5-lX-dGF P signiﬁcantly activated complement, as the levels of
C3a-desArg detected after these incubations were 8-10 times higher than those

observed in NHS pre-incubated with PBS (Figure 22B). Novel Ad vectors

113

Figure 22: Novel COMPinh displaying Ads minimize Ad mediated
complement activation in several serum-based assays. (A) AP50 was
performed and residual complement activity was normalized to human
serum (HS), incubated with media (no_virus control). The error bars
represent 1: SD. Statistical analysis was completed using One Way
ANOVA with a Student-Newman-Keuls post-hoc test. * - indicate values,
statistically different from WT_Ad5 and Ad5-LacZ, p<0.05; ## - indicate
statistically different values from WT_Ad5 Ed. Ad5-lX-dGFP, a_nd_ Ad5-
LacZ, p<0.001. (B) Overall complement activation mediated by Ads in HS
was determined by C3a-desArg speciﬁc ELISA. Negative control was HS
incubated with PBS prior to ELISA. *, ** - indicate values, statistically
different from no_virus controls, p<0.05, p<0.001 respectively. #, ﬂ -
indicate statistically different values from Ad5_WT, Ad5-lX-dGF P and Ad5-
LacZ, p<0.05, p<0.001 respectively. (C) Overall complement activation
mediated by Ads in NHPS was determined by C3a-desArg speciﬁc ELISA.
** - indicate values, statistically different from PBS control, p<0.01; # -
indicate statistically different values from Ad5-LacZ, p<0.05. (D) Activation
of classical complement pathway mediated by Ads was performed. After
NHPS/Ad incubations, residual CH50 activity was measured and graphed
in CH50 units equivalent per ml. *, ** - indicate values, statistically different
from PBS control, p<0.05, p<0.01 respectively. # - indicate statistically

different values from Ad5-LacZ aLd Ad5-IX-dGFP, p<0.05.

114

HS: C3a-desArg levels

HS: AP50

M-
Q
Q
t?

mnwao

PzwzmAQZOU .3

NHPS: CH50

NH PS: CSa-desArg levels

10000

 

 

115

displaying COMPinh in either protein IX or ﬁber were able to signiﬁcantly reduce

the production of caa-desArg in this assay (Figure 22B).

Subtle differences in the levels of C3a-desArg produced after incubation
with WT_Ad5 as compared to the Ad5-LacZ ﬁrst generation Ad vector may be
possibly explained by a slightly increased number of viral particles in the
WT_Ad5 virus preparations as compared to Ad5-LacZ, as was validated by silver
staining (Figure 23). We did not detect any signiﬁcant differences in CH50
activity, when control or COMPinh-displaying Ads were incubated with NHS (data
not shown). This result may have been due to the presence of pre-existing
neutralizing antibodies to Ad being present in the NHS, (as the latter was derived
from numerous individuals) complicating the efficacy of capsid displayed
COMPinh to inhibit complement activation in this assay, in contrast to COMPinh
mediated inhibition of complement activation in the C3a-desArg assay or NHP

based assays.

Since COMPinh has been proven to be effective in inhibiting complement
activation not only in human serum, but also in non-human primate serum
(NHPS) (155-157), we evaluated the properties of COMPinh displaying Ads upon
incubation with Rhesus monkey serum. High homology between human and
Rhesus monkey complement proteins allowed using human speciﬁc antibodies to
detect the level of complement activation in NHPS (158). We found that overall
complement activation was signiﬁcantly reduced when Ad5-LacZ-lX-dCOMPinh

was incubated with NHPS as compared to Ad5-LacZ

116

Figure 23: Silver staining of puriﬁed Ad vectors revealed marginal
differences in spectrophotometry determined vp titer. Total of 1010 vp
of puriﬁed virions of each Ad vector were separated by 10% SDS-PAGE
and subsequently stained with silver nitrate as described in Materials and
Methods. Amount of hexon protein (above 98 kDa) was quantiﬁed for each
vector by scanning densitometry, as shown in table. Note, that VP titers
determined by spectrophotometry fall within ~1.13 fold window conﬁrming
that capsid-displaying Ad5 vectors did not contain less virions as

compared to conventional ﬁrst generation Ad5 vectors.

117

Ad5-Lad-Flrer—dCOMPInh
Ad5oLacZ-lX-dCOMPlnh
AdS-GF-lX-dGFP

Ad54ad

Ad5_WT

Marker

 

 

err-«new

 

 

Hexon integrated

Adenovirus vector Fold over Ad5_W'l'

density
Ad5)” 14847 1.00
Ad5-LacZ 13008 0.03
MS-Lecz-IX-dCOMPlnh 14908 1.00
MS-Lacz-Flber-dCOMPlnh 10730 1.13

Ad5-IX-IIGFP 1 ‘I 108 0.75

 

118

 

ﬁrst generation vector, as measured by C3a-desArg levels in NHPS exposed to
the respective vectors (Figure 22C). Moreover, both pIX-dCOMPinh and Fiber-
dCOMPinh capsid-displaying Ads caused a reduced activation of classical
complement pathway as compared to conventional Ad vectors, as evident by
signiﬁcantly higher CH50 unit equivalents being measured in NHPS exposed to
COMPinh capsid-displaying Ads as compared to NHPS exposed to control Ads
(Figure 220). Finally, to determine if COMPinh displaying Ads can minimize Ad-
triggered cytokine releases from human cells, we have infected human peripheral
blood mononuclear cells (PBMCs) with control or experimental Ad5 vectors, and
quantiﬁed the cytokine/chemokine released from those cells into the media at 6,
24 and 48 hours post infection (hpi). Our results demonstrated that human
PBMCs exposed to pix-dCOMPinh and Fiber-dCOMPinh displaying Ads
triggered signiﬁcantly reduced lL-6 (at all time points tested), lL-8 and RANTES
(at 24 and 48 hpi) levels as compared to similar exposures of the PBMCs to the
control Ad vector (Figure 24). These studies highlight previously published
studies demonstrating that membrane-localized complement components can
mediate Ad-triggered innate inﬂammatory responses. This previously described
mechanism may be responsible for our results utilizing COMPinh displaying Ads

in vitro (146).

Overall, our results conﬁrm that the functional activity of a peptide to
speciﬁcally inhibit portions of an important innate immune response can be

retained when displayed from the Ad5 capsid. Speciﬁcally, the COMPinh peptide

119

Figure 24: Novel COMPinh displaying Ads reduce Ad-triggered
activation of pro-inﬂammatory cytokines and chemokines in PBMCs.
Peripheral blood mononuclear cells were cultured and stimulated by
adding PBS (Mock), Ad5-LacZ control ﬁrst generation Ad, Ad5-LacZ-IX-
dCOMPinh or Ad5-LacZ-Fiber-dCOMPinh at MOI=5000 vp/cell, N=4 for all
groups. At indicated time points media was collected and cytokine
concentrations were analyzed using a multiplexed bead array based
quantitative system. Statistical analysis was completed using Two Way
ANOVA with a Bonferroni post-hoc test. The bars represent Mean :I: SD. *,
** - indicate cytokine values that are statistically different from those in
Mock samples at the same time point, p<0.05, p<0.001 respectively. #, ##
- indicate statistically different values from Ad5-LacZ group at the same

time point, p<0.05, p<0.001 respectively.

120

 

6 hpi

6 hpi

24 hpi
RANTES

24 hpi

48 hpi

*ir

48 hpi

121

IL-8
10000 **

6 hpi 24 hpi 48 hpi

DMock

-Ad5—LacZ
-Ad5-LacZ—lX—dCOMPinh
-Ad5-LacZ-Fiber-COMPinh

can retain its anti-complement activity when displayed as a genetic fusion
peptide in several locations on the Ad capsid. As these vectors can be
propagated to high titer without need for post-puriﬁcation chemical modiﬁcations
(such as PEGylation, or other potentially non-scalable manipulations) they may
allow for more widespread, and safer use of so-modiﬁed Ad vectors in gene

transfer applications.

Acknowledgement:

We wish to thank Michigan State University Electron Microscopy support
facility for their assistance in performing electron microscopy of puriﬁed Ad
vectors. 8.8.8. was supported by American Heart Association Midwest Afﬁliate
Fellowship 0815660G. A.A. was supported by the National Institutes of Health
grants RO1DK—069884, P01 CA078673, the MSU Foundation and the

Osteopathic Heritage Foundation.

122

Chapter V

Simple, pre-emptive and transient glucocorticoid pre-
treatment reduces Ad5-associated acute toxicities

This chapter is the edited version of a research article that was published in the

Molecular Therapy Journal, Volume 17, Issue 4 (685-696), January 29, 2009.

Authors: Seregin, S. 8., D. M. Appledom, A. j. McBride, N. j. Schuldt, Y. A. Aldhamen,

'1'. Voss, ]. Wei, M. Bujold, W. Nance, S. Godbehere, and A. Amalﬁtano.

123

5.1. Introduction

Adenovirus (Ad) based vectors continue to be the most commonly utilized
gene transfer vector for a variety of potential applications. Ad vectors can be
easily produced to high titers (scalability is a critical point when considering
potential human applications), possess the ability to transduce dividing and non-
dividing cells without the need for chromosomal integration, and have an
extremely broad tropism. These advantages have resulted in the initiation of 342
human clinical trials utilizing Ad vectors since the ﬁrst Ad clinical trial in 1993
(http://www.wiley.co.ukMileychi/genmedlclinicall). Furthermore, ﬁrst generation
Ad vectors have been repeatedly demonstrated to persist for long periods of time
when transducing non-immunogenic transgenes (159, 160). Limitations to long
term persistence of ﬁrst generation Ads transducing immunogenic transgenes
has been largely overcome with the development of multiply deleted, helper
independent, or fully deleted helper virus dependent advanced generation Ad-
based vectoring systems (14). Despite these encouraging facts, safety concerns
regarding Ad vector associated innate toxicities, responses that often prime
subsequent adaptive immune responses, has severely limited progress as to the
use of this important vector class for systemic applications, such as gene transfer

to the liver.

Several approaches have been studied to minimize the inﬂammatory
responses acutely induced by systemic exposure to Ad vectors. These
approaches include genetic modiﬁcation of the Ad capsid to alter the tropism of

the vector for liver cells; pre-emptive depletion (or blockade) of Ad sequestration

124

by liver macrophages to minimize induction of macrophage dependent
inﬂammatory responses, use of immunosuppressive drugs (such as anti-TNF
blockers, TLR-9 inhibitors, ERK inhibitors and others) to transiently block acute
inﬂammatory responses, as well surgical isolation procedures to minimize
systemic distribution of recombinant Ads (36, 38, 46, 161-170). All of these
approaches have an ability to reduce portions of the multi-faceted Ad induced
innate immune response, but their ability to impact upon the full inﬂammatory
response induced by recombinant Ads is either limited, or has not been fully
determined. Furthermore, many of these approaches have inherent problems of
their own, such as known toxicities prohibiting their use in human applications
(i.e.: clodronated liposomes for liver macrophage depletions, Ad capsid changes
that may result in enhanced innate toxicity, and/or technical difﬁculties associated
with moderate to signiﬁcantly invasive surgical procedures (46, 163, 171, 172).
What is needed is a safe, simple, transient, inexpensive, and widely accepted
method for the reduction and/or elimination of the myriad Ad vector induced

inﬂammatory responses induced after systemic administration.

We have, therefore, tested if pre-treatment with anti-inﬂammatory
glucocorticoid Dexamethasone can be utilized to address these issues. In our
study we intravenously injected high doses of a ﬁrst generation (E1-deleted) Ad5
vector encoding a highly immunogenic transgene (Bacterial B-galactosidase
(LacZ)) into either control or DEX pre-treated C57BU6 mice, and investigated the
subsequent innate and adaptive immune responses to the Ad and the transgene

product expressed by the vector. Our results demonstrate that multiple aspects

125

of the systemic inﬂammatory response induced rapidly after systemic delivery of
Ads can be obliterated by simple, transient pre-treatment with a potent

glucocorticoid.

126

5.2. Result

Dexamethasone blocks Ad mediated cytokine and chemokine release
in CS7BL16 mice in a dose dependent manner. We quantiﬁed the release of
inﬂammatory cytokines and chemokines in murine plasma at 1 and 6 hours after
systemic Ad delivery utilizing a multi-plexed, bead array based detection system.
Based on our previous publications, as well those of others, we focused upon
seven cytokines and chemokines that are known to be rapidly (within 1-6 hours)
induced following systemic injection of Ad vectors (26, 46). KC (CXCL1) and
MCP-1 are the ﬁrst inﬂammatory chemokines to be induced (within 1 hour of Ad
injection). These murine chemokines are known to recruit neutrophils and
monocytes to the sites of tissue damage, comprising one of the ﬁrst defensive
barriers to Ad vectors (26, 46). At 6 hpi, plasma levels of lL-6, lL-12p40, G-CSF,
MlP-1B and RANTES also reach a peak, further activating the cellular arm of the
innate immune system (26, 46). As expected, these 7 cytokines and chemokines
were induced after Ad injection into WT mice (Figure 25). To investigate the
impact of DEX pre-treatment (15 hours and 2 hours prior to intravenous Ad5-
LacZ injection) in the induction of these pro-inﬂammatory factors, we completed a
dose response study where mice were pre-treated with 10 mglkg, 1 mglkg, or 0.1
mglkg of DEX. At 1 hour post injection of Ad5-LacZ, the level of KC in the serum
of DEX pretreated mice (all dosages) was signiﬁcantly lower compared to mice
identically injected with Ad. RANTES levels at 6 hpi were also equivalently

reduced by DEX. Interestingly, we did not observe a dose dependent reduction of

127

Figure 25: Dexamethasone (DEX) blocks Ad-mediated systemic
cytokine and chemokine release in C573U6 mice in a dose
dependent manner. CS7BU6 mice were intravenously injected with
0.75x1011 vplmouse of Ad5-LacZ vector. Dexamethasone (DEX) pre-
treatment was performed via intraperitoneal injection at 15 and 2 hours
before virus injection. Plasma samples were collected at 1 and 6 hours
post virus injection (hpi). Plasma samples were analyzed using a
multiplexed bead array based system. The bars represent Mean :I: SD. *,
** - indicate plasma cytokine values that are statistically different from
those in Mock-injected animals of the same treatment at the same time
point (is. WT_DEX_Ad5-LacZ group from WT-DEX-Mock group), p<0.05,
p<0.001 respectively. #, M - indicate statistically different values in
WT_DEX_Ad5-LacZ group compared to WT_Ad5-LacZ group at the same
time point, p<0.05, p<0.001 respectively. Statistical analysis was
completed using Two Way ANOVA with a Bonferroni post-hoc test. The

N=4 for Mock (PBS) injected animals, N=6 for virus injected mice.

128

RANTES

= Mock

uAdS—Lacl

a 10 mglkg_Dex + Mock
m 10 mglkg__Dex + Ad5-LacZ
l mglkg_Dex + Ad5-LacZ
-0 I mglkg_Dex + Ad5—LacZ

 

pglml

129

 

 

these chemokines, as the 0.1 mglkg dose was as efﬁcacious as the 10 mglkg

dose in modulating the induction of both KC and RANTES.

At a dose of 10 mglkg, DEX completely blocked the release of lL-6 and
MlP-1B (p<0.001) at 6 hpi, and MOP-1 and lL-12(p40) at both 1 and 6 hpi
(p<0.001). The levels of lL-12(p40) and MCP-1, at both time points, were also
signiﬁcantly reduced when mice were pre-treated with either 1.0 or 0.1 mglkg
DEX. Serum levels of MlP-18 and IL-6 were also signiﬁcantly lower in mice pre-
treated with 10.0 or 1 mglkg DEX, but were not signiﬁcantly reduced in Ad-
injected mice pre-treated with 0.1 mglkg DEX. Finally, plasma levels of G-CSF
were only signiﬁcantly reduced when Ad-injected mice were pre-treated with 10
mglkg DEX (Figure 25). These results demonstrate that DEX pre-treatment of
animals can abrogate Ad induction of the “cytokine storm” noted after systemic
delivery of Ad5-based vectors (24). Because pre-treatment of mice with 10 mglkg
DEX maximally suppressed these responses, we evaluated the ability of this
dose to further prevent the induction of other detrimental responses typically

observed following systemic Ad-vector administrations.

Dexamethasone prevent Ad induction of thrombocytopenia in
CS7BLI6 mice. Next, we determined if DEX treatment could prevent the acute,
consumptive thrombocytopenia typically observed within 24 hours after systemic
Ad injection, an event that we have shown to be due to Ad activation of the
alternative complement pathway (24, 26, 44). As expected, thrombocytopenia

developed in WT mice treated with Ad5-LacZ (Figure 26). DEX pre-treated mice

130

did not develop thrombocytopenia after Ad injection, as their platelet levels were

not different from mock-injected animals (Figure 26).

Dexamethasone minimizes Ad dependent activation of endothelial
cells in C57BU6 mice. Endothelial cell activation facilitates the inﬁltration of
inﬂammatory cells, including macrophages, granulocytes and mast cells, into the
parenchyma of inﬂamed tissues and organs. When endothelial cells become
activated, they overexpress surface as well as soluble forms of adhesion
molecules such as e-Selectin, ICAM-1, VCAM-1 (45, 132, 133). Intravenous
injection of Ad vectors is known to induce endothelial cell activation, an event
that is mediated by Ad interactions with Kupffer cells, and can result in signiﬁcant
hypotension (129). We have measured plasma levels of soluble ICAM-1 and e-
Selectin molecules in Ad-injected mice at 6 hpi. Ad treated WT mice had at least
3-fold higher levels of soluble ICAM-1 and e-Selectin molecules, than levels
measured in mock-injected animals (Figure 27). DEX pre-treatment completely
blocked Ad dependent activation of synthesis of these 2 molecules, indirectly
demonstrating that DEX pre-treatment can reduce the Ad dependent activation of

endothelial cells (Figure 27).

Dexamethasone pre-treatment minimizes the induction of pro-
inﬂammatory genes in livers of Ad treated C57BU6 mice. We have
previously and extensively characterized the cell or tissue speciﬁc transcriptome
changes rapidly induced after transduction by Ad vectors both in vitro and in vivo

(23, 26, 35). These studies revealed that Ads induce the expression of genes

131

Figure 26: Dexamethasone prevent Ad mediated thrombocytopenia
in C57BU6 mice. 057BU6 mice were intravenously injected with
0.75x1011 vplmouse of Ad5-LacZ vector. DEX pre-treatment and platelets
enumerations were performed as described in Materials and Methods.
Four groups of wild type mice were analyzed: WT_Mock (N=4),
WT_DEX_Mock (N=4), WT_Ad5-LacZ (N=5), WT_DEX_Ad5-LacZ (N=5).
The bars represent Mean :I: SD. Statistical analysis was completed using
One Way ANOVA with a Student-Newman-Keuls post-hoc test, p<0.05
was deemed a statistically signiﬁcant difference. *, ** - indicate values,
statistically different from those in WT_Mock-injected animals, p<0.05,
p<0.001 respectively. Note: Normal range levels were adapted from
Jackson laboratories studies on C57BU6 mice

(http://phenome.iax.org/pub-

 

cgi/ghenome/mpdcgiﬁtmprejects/details&sym=Peter33).

132

Platelets x 103 [pl

 

WT_Mo ck

 

WT_Ad5-LacZ WT_DEX_Mock WT_DEX_AdS—Lacl

133

Figure 27: Dexamethasone minimizes Ad dependent activation of
endothelial cells in C57BU6 mice. DEX pretreated or non-treated
CS7BL/6 mice were intravenously injected with 0.75x1011 vplmouse of
Ad5-LacZ vector. Plasma samples, collected at 6 hpi (N=6 for virus treated
groups, N=4 for Mock-injected groups) were analyzed using a multiplexed
bead array based quantitative system. The bars represent Mean :I: SD.
Statistical analysis was completed using One Way ANOVA with a Student-
NeWman-Keuls post-hoc test. Fold difference over WT_Mock group is
shown. *, ** - indicate values, statistically different from those in Mock-
injected animals of the same treatment. p<0.05, p<0.001 respectively. #,
ﬂ - indicate statistically different values in any group compared to

WT_Mock group, p<0.05, p<0.001 respectively.

134

lCAM-1
* *

 
  
 
  
 

 

NWT Mock

IIIWT Ad5—LacZ

3 WT DEX Mock
mnWT DEX Ad5-LacZ

FOLD

##

  

e-Selectin

*

FOLD

 

135

involved in innate immune responses, such as pattern recognition receptors
(T LRs, NODs), TLR signaling pathways (MyD88, TRIF, TRAF6, TRAF2bp,
TBK1), markers of endothelial cells activation (e-Selectin, lCAM-1, VCAM-1),
interferon responsive genes (OAS1a, lRF7, IRF8), negative regulators of
cytokine signaling (SOCS-1, SOCS-3) and dsRNA editing enzymes (ADAR) (23,
35). We have also previously shown that in 057BU6 mice, systemically
administered Ads mediate induction of maximal liver transcription dysregulation
at 6 hpi (23). Therefore this time point was selected to determine whether
pretreatment with DEX might block and/or minimize Ad vector induction of
transcription of these pro-inﬂammatory genes (Table 7). Besides the genes
mentioned above, we interrogated the expression of several additional genes:
DAF - potent membrane-bound complement inhibitor; NFkB-RelA - subunit of
transcription factor; JAK1, JAK3 - molecules involved in cytokine signaling in this
assay. Thus a total 23 genes were tested by qRT-PCR based methods. Our
results demonstrate that all of the genes tested (except IFNa) were signiﬁcantly
induced at 6 hpi in the livers of C57BU6 mice systemically treated with Ad5-
LacZ, as compared to mock-injected animals (p<0.05), whereas only ADAR and
TLR3 were induced in DEX pre-treated Ad5-LacZ injected mice, as compared to
mock-injected animals. Importantly, the level of transcription induction of all the
genes except one was signiﬁcantly reduced in virus injected DEX pre-treated
mice, compared to the virus treated group (p<0.05, in vast majority of cases

p<0.001). Some of the genes in the DEX treated, mock-infected groups of mice

136

Table 7: Dexamethasone pro-treatment abrogates Ad5-LacZ induced
gene expression in livers of C57BU6 mice. The numbers represent
Mean :I: SD. Statistical analysis was completed using One Way ANOVA
with a Student-Newman-Keuls post-hoc test, p<0.05 was deemed a
statistically signiﬁcant difference. Note, when signiﬁmnt p<0.001 was
observed in majority of cases. N=4 for Mock-injected groups, N=6 for virus
injected groups was used. Signiﬁcant differences compared to WT_Mock
are highlighted in grey color. Signiﬁcant reductions of transcriptional
activation in WT_DEX_Ad5-LacZ group compared to WT_Ad5-LacZ group
are indicated in table with black frame and boldface font. For full gene

names please refer to abbreviation list.

137

 

Ads-LacZ induced gene expression In a liver of C578L/6 mice (fold over Mock, 6 hpi)

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

C578L/6 WT Mock csm/s wr Dex_Mock C57BU6 WT Dexamethasone Ads-Iacz CS—7_8_L/6 WT Ad5-LacZ
ADAR 1.0102 0.472003 _ 2 ~ - , 4 1,111.2 [ " '
— '. .
cxc1—9 1.0 1 0.1 0.10 2 0.01 l . a: 0. _
DAF 1.0 t 0.4 0.6 1 0.1 i. n 0.
1cm 1.0 1 0.5 0.6 2 0.1 . It 0.
lFNu 1.1 t 0.5 0.7 1 0.2 1.
IRF-7 1.1 t 0.7 0.16 t 0.02 1.
lRF-8 1.1 t 0.7 0.3 1 0.1 0.
Jak-l 1.0 1 0.3 0.61 0.1 0.
lak-S 1.0 t 0.3 03 :t 0.1 0.
Myooa 1.0 t 0.4 0.5 1 0.1 . 2.
NFkB-RelA 1.0 t 0.3 0.6 i 0.1 . t .
non—1 1.0 a 0.3 y 04020.04 .I . .
NOD-2 1.1 t 0.5 * 0.10.: 0.01 : .
OAS-la 1.0 c 0.4 0.2 c 0.1 .
secs-1 1.0 i 0.4 0.4 1 0.1 A. .
TBK-l 1.0 1 0.2 0.5 i 0.1
TLR—2 1.0 1 0.1 0.9 1 0.3 a I
TLR-3 1.0 1 0.2 0.371 0.03 . s
—
TLR-6 1.0 t 0.4 0.7 1 0.1 .0 t 1.
TRAFpr 1.1 t 0.6 0.13 2 0.05 .6 t 0.
mass 1.1 t 0.6 1.0 2 0.2 .1 1 0.
—
rats 1.0 t 0.4 1.0 1 0.2 1.20 t 0.1
—
VCAM 1.0 t 0.1 as a 0.1 035 2 0.01
i

 

138

 

 

also had lower levels of transcription relative to mock-infected mice not treated
with DEX, but in only ﬁve genes did this reach statistically signiﬁcant levels:
JAK1, JAK3, VCAM-1, NOD-1 and NOD-2, which indicates that several genes
non-speciﬁcally respond to DEX treatment. These data strongly indicate that
despite the huge redundancy inherent to the Ad induced host transcriptome
response mechanism, DEX can efﬁciently block all of these responses. Possibly,
DEX can block transcription activation pathways and/or directly downregulate the
transcription of pro-inﬂammatory genes typically responsive to glucocorticoid
receptor activation, although posttranscriptional modiﬁcations altering RNA
stability is a legitimate alternative explanation of DEX mediated blockage of gene

induction (173, 174).

Dexamethasone treatment causes an increase in lymphopenia and
neutrophilia in CS7BU6 mice, an effect NOT related to Ad treatment.
Besides acute thrombocytopenia, high dose, systemic Ad injections can induce
lymphopenia and neutrophilia (175). At the dose of Ad we used (0.75x1011
vplmouse) we did not detect any increase in neutrophils and/or decrease in
lymphocytes in CS7BU6 mice at 24 hpi as compared to mock-injected mice
(Figure 28A-B). Interestingly, both groups of mice treated with DEX experienced
neutrophilia and lymphopenia when compared with non-treated WT mice (Figure
28). These phenomena were not related to Ad injection, since there were no
signiﬁcant differences between the DEX pre-treated, mock or Ad5-LacZ injected
groups. DEX has been shown to induce lymphopenia and neutrophilia in several

animal models, including C57BU6 mice (176), rabbits (177) and cattle (178).

139

Dexamethasone pre-treatment preserves the efﬁcacy of Ad mediated
gene transduction of the liver of C57BU6 mice. It is known that systemic
injection of high dose Ad vectors results in over 90% of an Ad vector bolus
becoming sequestered in liver Kupffer cells, with the remaining virus primarily
infecting hepatocytes, as the 100 nm Ad capsid can pass through the fenestrated
liver endothelium (46, 179, 180). Having determined that DEX pre-treatment
efﬁciently blocked the vast majority of the acute toxicities typically elicited rapidly
after systemic Ad administrations, it was critical to conﬁrm whether DEX pre-
treatment impacted upon the efﬁcacy of Ad transduction of the murine liver. With
this information, we analyzed the level of Ad derived transgene expression (8-
Gal) in the liver hepatocytes of Ad vector treated CS7BU6 mice at 6 hpi, 24 hpi
and 28 dpi (Figure 29A-B). The liver activity of Ad vector derived B-Gal was not
different between Ad5-LacZ groups that did or did not receive DEX at 24 hpi and
28 dpi, suggesting similar transductional efﬁcacy. Although transgene derived
enzyme activity was highest at 24 hpi, enzyme activity was still present at

signiﬁcant levels at 28 dpi.

We noted signiﬁcant differences (p<0.001) in initial transgene expression (at
6 hpi) between virus injected DEX pre-treated mice and mice treated with virus
alone (Figure 29B), which were not due to different levels of liver transduction by
the Ad in these two experimental groups (Figure 29C). DEX did not diminish the
efﬁcacy of liver transduction by Ads, as Ad genome content in the liver was not
different in all Ad5-LacZ treatment groups at all time points tested (Figure 290).

Moreover, we noted a mild, though signiﬁcant, increase in the number of Ad

140

vector genomes per liver cell at 24 hpi in DEX pre-treated group (p<0.05), which
possibly suggests a somewhat reduced level of clearance of Ad vectors by the
host innate immune system at initial time points. Despite this ﬁnding, an
increased number of Ad genomes at 24 hpi in DEX pretreated, Ad5-LacZ treated
mice did not result in signiﬁcant increases in enzyme activity, suggesting that

LacZ expression was already at maximal levels.

Dexamethasone treatment does not change Kupffer cell loss in livers
of Ad-injected mice. Resident liver macrophages, Kupffer cells, comprise a
primary innate defensive system, a system known to non-speciﬁcally engulf,
sequester and destroy Ads prior to hepatocyte encounter (179). It is known that
systemic injection of high dose Ad vectors results in Kupffer cell dependent
increases in plasma cytokine and chemokine responses (as well endothelial cell
activation), which is quickly followed by a rapid Kupffer cells necrosis and loss
from the liver (46, 129, 135). Therefore it was important to determine if DEX pre-
treatment altered Kupffer cell responses to systemic Ad. We tested if DEX
prevented Ad induced Kupffer cell destruction by staining frozen liver sections
with the macrophage speciﬁc F4/80 antibody at 24 hpi (Figure 30). As expected,
a signiﬁcant decrease of Kupffer cell numbers occurred in the livers of Ad5-LacZ
treated mice as compared to mock-infected mice. Similarly, DEX pre-treated, Ad
injected mice also had Kupffer cells destroyed at 24 hpi at rates no different from
Ad5-LacZ injected mice. Finally, DEX treatment by itself did not have any

signiﬁcant effect on Kupffer cell populations in the murine liver based on this

141

Figure 28: Dexamethasone treatment causes an increase in
lymphopenia and neutrophilia in a blood of C57BU6 mice, which is
NOT related to Ad treatment. CS7BL/6 mice were intravenously injected
with 0.75x1011 vplmouse of Ad5-LacZ vector. DEX pre-treatment and CBC
differential count was performed as described in Materials and Methods.
Total four groups of mice (N=4) analyzed: WT_Mock, WT_DEX_Mock,
WT_Ad5-LacZ, WT_DEX_Ad5-LacZ. The bars represent Mean :I: SD.
Statistical analysis was completed using One Way ANOVA with a Student-
Newman-Keuls post-hoc test, p<0.05 was deemed a statistically
signiﬁcant difference. #, #lf - indicate statistically different values in
WT_DEX_Ad5-LacZ group compared to WT_Ad5-LacZ group, p<0.05,
p<0.001 respectively. Normal ranges for Neutrophils (A) and Lymphocytes
(B) count in male C57BU6 mice are indicated by light grey shaded boxes.
Note: Normal range levels were adapted from Jackson laboratories
studies on C57BU6 mice (http://phenome.iax.org/pub-

cgi/phenome/mpdcgi?rtn=projects/details&svm=Peter53).

142

Neutrophils 96

Lymphocytes 96

 

 

‘., All}.
.. i I
..' I
. r
. e
» I
. . .. ~ -
1 ‘. r
. e
. r
u
.7 . I I
u
. n
. ' I
~ I
.r .. ,..
. nu-

 

 

llllllllll

”m ' "“ — llllllllllllllll
WT_MOCK WT_Ad5-L802 WT_DEX_Mock WT_DEX_Ad5-LOCZ

llllIllllllllllllllllllllllllllll

 

 

 

WT_lIl 00k WT_AdS-Lacz WT_DEX_Mock WT_DEX_AGS-Lacz

143

Figure 29: Dexamethasone treatment preserves the efﬁcacy of Ad
derived transgene expression and Ads genomes persistency in the
livers of C57BU6 mice. (A) In situ visualization of bacterial B-
galactosidase in liver of Ad5-LacZ treated CS7BLI6 mice. Cryosections of
liver from all groups of mice were stained for B-Gal in situ. Representative
sections for each of the groups are shown. Total magniﬁcation of 200x
was used to obtain images. N=6 for all virus injected groups at 6 hpi, N=4
for all virus injected groups at 24 hpi, N=5 for all virus injected groups at
28 dpi, N=4 for all Mock-injected groups at all time points. (B) Bacterial B-
galactosidase activity levels were analyzed at 6 hpi, 24 hpi and 28 dpi
from four groups of C57BU6 mice: WT_Mock, WT_DEX_Mock, WT_Ad5-
LacZ, WT_DEX_Ad5-LacZ. Activity levels were presented as Units per mg
of total protein. The bars represent Mean :I: SD. Statistical analysis was
completed using two-tailed Student t-test to compare 2 groups of virus
injected animals. #, ## - indicate statistically different values in
WT_DEX_Ad5-LacZ group compared to WT_Ad5-LacZ group, p<0.05,
p<0.001 respectively. (C) qPCR based quantiﬁcation of Ad5-LacZ
genomes in livers harvested from C57BU6 mice at 6 hpi, 24 hpi, 28 dpi.
The bars represent Mean :I: SD. Statistical analysis was completed using
two-tailed Student t-test to compare 2 groups of virus injected animals. #,
ﬂ - indicate statistically different values in WT_DEX_Ad5-LacZ group

compared to WT_Ad5-LacZ group, p<0.05, p<0.001 respectively.

144

a

 

WT_DEX_Mock WT_DEX_MS-LOGZ WT_DEX_Mock WT_DEX_MS-LICZ WT DEX Mock WT_DEX_MS-Lacz

 

“1'

 

Mgenomesllver

- WT Mock

an WT Ad5-LacZ
=WT DEX Mock
Inn WT DEX Ads-LacZ

145

Figure 30: Dexamethasone treatment does not change Ad dependent
Kupffer cells degradation in a liver of C57BU6 mice. 7 pm liver
sections obtained at 24 hpi were stained with macrophage speciﬁc F4/80
antibody. Pixel density of both Kupffer cell staining and DNA staining
(DAPI) was quantiﬁed. Kupffer cells values were normalized to DAPI
values to control for cell density variation. Values were subsequently
divided by WT_Mock average values to give percent difference. Error bars
indicate :I:SD. N=4 for all groups tested, pictures represent one of at least
12 sections derived from 4 mice in each group: WT_Mock,
WT_DEX_Mock, WT_Ad5-LacZ, WT_DEX_Ad5-LacZ. Statistical analysis
was completed using One Way ANOVA with a Student-Newman-Keuls
post-hoc test, p<0.05 was deemed a statistically signiﬁcant difference. *, **
- indicate values, statistically different from those in WT_Mock-injected

animals, p<0.05, p<0.001 respectively.

146

WT_Mock WT_D EX_Mock

WT_Ad5-LacZ WT_DEX_Ad5-LacZ

   
   

.s .L
O G
O O

Relative Units (% of WT_Mock)
at
O

 

O

m WT_Mock

Ill WT_DEX_Mock
= WT_Ad5-LacZ

m WT_D EX_AdS-Lacz

147

assay. Therefore, although it is known that the induction by Ads of a number of
pro-inﬂammatory cytokines, chemokines, and markers of endothelial cell
activation after systemic Ad injection is Kupffer cell dependent, Kupffer cell
destruction by Ads is not directly responsible for many of these responses per so

(135).

Dexamethasone treatment signiﬁcantly reduces leukocyte inﬁltration
into the liver of Ad treated mice. To test if DEX pretreatment can impact upon
the known propensity of systemically administered Ads to induce leukocyte
inﬁltration into the murine liver, we quantiﬁed leukocyte inﬁltration in liver sections
collected at 28 dpi from control and experimental animal groups (Figure 31A-B),
(137, 138). Treatment of mice with only Ad5-LacZ induced signiﬁcant inﬁltration
of macrophages and lymphocytes into the liver (Figure 31A-B). DEX pre-
treatment signiﬁcantly (p<0.05) reduced portal inﬂammation in virus-injected
animals, and trended to lower periportal and lobular inﬂammation at this time
point as well. Furthermore, the total inﬂammation index score was signiﬁcantly
(p<0.01) lower in DEX treated, virus injected mice, as compared to mice
receiving only the virus. We have also evaluated leukocyte inﬁltration in livers of
Ad treated mice at 6 and 24 hours after Ad injection. We did not detect any
signiﬁcant inﬁltrations of inﬂammatory cells by this assay in any of the groups

tested (data not shown).

148

Figure 31: Dexamethasone treatment result in signiﬁcantly reduced
Ad mediated leukocytes inﬁltration to the liver of C57BU6 mice at 28
dpi. Mice injections and morphometric evaluation of liver sections was
performed as described in Materials and Methods. (A) Representative
H&E stained liver sections obtained at 28 dpi from three groups of mice:
WT_Mock (N=4), WT_Ad5-LacZ (N=5), WT_DEX_Ad5-LacZ (N=5) are
shown. Note the lack of any inﬂammation in WT_Mock, the large number
of inﬂammatory cells in WT_Ad5-LacZ and moderate inﬁltration in
WT_DEX_Ad5-LacZ. (B) Representative sections from each treated
animal were analyzed, scored and averaged for the levels of portal,
periportal and lobular inﬂammation, as described in Materials and
Methods. The sum of averages for each category was computed to obtain
a total inﬂammation index score. The error bars represent :I: SD. Statistical
analysis was completed using two-tailed Student t-test to compare 2
groups of virus injected animals. #, #1! - indicate statistically different
values in WT_DEX_Ad5-LacZ group compared to WT_Ad5-LacZ group,

p<0.05, p<0.001 respectively.

149

 

Portal inﬂammation Periportal inﬂammation

 

WT_AdB-Lacz WT_DEX_AdS-Lacz WT_Ad5-LacZ WT_DEX_Ad5-Lec2

Lobular inﬂammation "Total inﬂammation index

Score
Score

   

WT_AdS-LacZ WT_DEX_AdG-Lacl WT_M-lJcZ WT_DEX_M-Lacz

150

Dexamethasone pre-trealment signiﬁcantly alters Ad vector and transgene
speciﬁc adaptive immune responses. With the knowledge that pretreatment
with DEX minimizes and/or abrogates multiple Ad-triggered innate immune
responses, we next determined how these blunted innate responses impacted
upon subsequent adaptive immune responses. We and others have previously
shown that anti-Ad speciﬁc primary humoral responses reach their peak at 7-14
days post-virus treatment, whereas anti-transgene responses peak at 23-28 days
(24, 36). We have performed a series of ELISAs to determine the levels of total
Ad virus or LacZ speciﬁc lgM, lgA, lgG and lgG isotype (lgG1, 2a, 2b and 3)
antibody levels at 14 and 28 dpi. Pre-treatment of Ad5-LacZ injected mice with
DEX signiﬁcantly reduced the levels of all antibodies generated against the Ad
capsid (Figure 32A). Speciﬁcally, lgG1 and IgG3 were signiﬁcantly reduced at 14
dpi, whereas lgM, lgA, total lgG, lgGZa and lgG2b were all signiﬁcantly reduced
both at 14 and 28 dpi relative to Ad5-LacZ treated mice not treated with DEX

(Figure 32A).

The lgG2a/IgG1 ratio is considered to reﬂect the relative contribution of the
Th1lTh2 response. DEX treatment noticeably altered the Th1/Th2 ratio from 1.21
in Ad-injected mice to 0.74 in DEX pre-treated, Ad-injected mice at 28 dpi.
Similar reductions were observed at 14 dpi (Figure 32B). Previous reports
suggest that glucocorticoids such as DEX can suppress Th1 responses while
exaggerating Th2 responses (181, 182). In an attempt to clarify the altered

Th1/Th2 balance, we also investigated the systemic induction of Th1 (lFNy) and

151

Figure 32: Dexamethasone treatment signiﬁcantly reduced Ad vector
capsid speciﬁc humoral immune responses, including capsid-
neutralizing antibodies. (A) Plasma samples, collected at 14 dpi and 28
dpi, were analyzed for anti Ad capsid speciﬁc total lgM, lgA and lgG
antibodies and various IgG subclasses. The error bars represent :I: SD.
Statistical analysis was completed using two-tailed Student t-test to
compare 2 groups of virus injected animals. #, ## - indicate statistically
different values in WT_DEX_Ad5-LacZ group compared to Wl'__Ad5-LacZ
group, p<0.05, p<0.001 respectively. *, ** - indicate values, statistically
different from animals of the same group at different time point, p<0.05,
p<0.001 respectively. (B) lgG2al|gG1 ratio, indicative of Th1/Th2

response were calculated based on subclass titering.

152

OD450

OD450

OD450

OD450

 

 

 

 

 

 

 

 

 

 

14 28

—-l—WT_AdS-Lac2
- «a - WT_DEX_AdS-Lacz

153

 

 

 

 

 

 

 

 

 

 

lgGZa/lgG1 ratio (Th1/Th2)

 

14 dpi

28 dpi

 

WT_Ad5-LacZ 0.96

1.21

 

 

WT_DEX_AdS-Lacz 0.68

 

 

0.74

 

 

Th2 (IL-4 and IL-5) speciﬁc cytokines at both 6 and 24 hpi, however, we were
unable to detect signiﬁcant inductions of any of these factors in the plasma of the
treated mice (data not shown). We next determined if these differences in
primary humoral immune responses resulted in any signiﬁcant changes in Ad
neutralizing antibody (NAb) titers at 28 dpi. We found that at several plasma
dilutions, Ad5-LacZ injected mice had signiﬁcant amounts of anti-Ad NAb titers,
whereas DEX pre-treated, virus injected mice had signiﬁcantly lower NAb titers

(data not shown).

DEX pre-treatment also reduced anti transgene (B-Gal) humoral immune
responses since LacZ speciﬁc lgM and lgA antibodies titers were signiﬁcantly
lower in DEX pre-treated, Ad5-LacZ treated animals relative to Ad-LacZ treated
mice. However, similar levels of LacZ speciﬁc lgG antibody isotypes were
induced in Ad-injected mice, regardless of DEX pre-treatment status. The LacZ
speciﬁc Th1 IT h2 ratio was slightly reduced in DEX treated animals as compared
to WT mice not treated with DEX (Figure 33A-B). Overall, several anti-transgene
speciﬁc humoral immune responses were reduced with DEX treatment, although
less signiﬁcantly than the DEX induced reductions in anti-capsid responses.
Importantly, we have shown that DEX treatment did not interfere with antibody
production in 057BLI6 mice, since levels of total non-speciﬁc mouse lgG
measured in Mock-injected animals were identical in DEX pre-treated mice

(Figure 34).

Finally, we determined whether transient pretreatment of mice with DEX had

154

Figure 33: Dexamethasone treatment signiﬁcantly reduced Ad vector
derived transgene speciﬁc humoral immune responses. (A) Three
groups of mice were treated as described in Materials and Methods:
WT_Mock (N=4), WT_Ad5-LacZ (N=5), WT_DEX_Ad5-LacZ (N=5).
Plasma samples, collected at 14 dpi and 28 dpi, were analyzed for anti [3-
Gal (Ad derived transgene) speciﬁc total lgM, lgA and lgG antibodies and
various lgG subclasses. The error bars represent :I: SD. Statistical analysis
was completed using two-tailed Student t-test to compare 2 groups of
virus injected animals. #, ﬁt - indicate statistically different values in
WT_DEX_Ad5-LacZ group compared to WT_Ad5-LacZ group, p<0.05,
p<0.001 respectively. *, ** - indicate values, statistically different from
animals of the same group at different time point, p<0.05, p<0.001
respectively. (B) lgGZa/lgG1 ratio, indicative of Th1/Th2 response were

calculated based on subclass titering.

155

0)

OD450

 

 

 

 

OD450

 

 

OD450

 

 

 

 

—e—WT_Ads-Lacz
- «a - WT_DEX_AdS-LacZ

28

156

 

 

 

 

 

 

 

 

 

lgGZa/lgG1 ratio (Th1/Th2)

 

 

 

 

 

 

14 dpi 28 dpi
WT_Ad5-LacZ 0.43 0.63
WT_DEX_AdS-LacZ 0.35 0.57

 

 

 

 

Figure 34: Dexamethasone treatment does not change natural levels
of total non-speciﬁc lgG antibodies in a blood of C57BU6 mice.
Plasma samples from Mock-injected mice (WT _Mock and
WT_DEX_Mock, N=4 for each group) were analyzed for total non-speciﬁc
lgG antibodies. The bars represent Mean :l: SD. Statistical analysis was
completed using two-tailed Student t-test to compare 2 groups of Mock-
injected animals, p<0.05 was deemed a statistically signiﬁcant difference.

No signiﬁcant difference was found.

157

OD450

Total lgG in Mock injected animals

 

m CSTBU6_WT_Mock
I!!! C57BL/6_WT_DEX_Mock

158

any effect on systemically administered Ad vector induction of cellular adaptive
immune responses. We derived total splenocytes from virus-injected mice and
performed ﬂow cytometry experiments after ex vivo stimulation of the
splenocytes with a LacZ speciﬁc peptide (Figure 35). DEX pre-treated, Ad5-LacZ
injected C57BU6 mice induced similar numbers of lFNy positive, LacZ speciﬁc
CD8+ T cells as noted in non DEX treated Ad5-LacZ injected mice (3.6% versus

4.6%).

159

Figure 35: Dexamethasone treatment does not change Ad dependent
CD8 positive T cells activation. Two groups of mice were treated as
described in Materials and Methods: WT_Ad5-LacZ (N=3), WT_DEX_Ad5-
LacZ (N=3). Total splenocytes were collected, stimulated with LacZ
peptide (3 pg/ml) or positive controls PMA or ionomycin for 6 hours. lFNy
secretion assay was performed as described in Materials and Methods.
Statistical analysis was completed using two-tailed Student t-test to
compare 2 groups of virus-injected animals. No signiﬁcant differences

found.

160

_lon omycin

_ _ mycinWTAdS

 

WT Ad5 PMA

365:8 928m

 

 

 

Nom...mn<r.§> N03¢n<IXon§>

 

3.99% i

I...

. . ~ “
% . % _ % m
5 W 6 _ m
9 w J . . . . _
1 . . ..c\ 4 . J.v 4 r...

. L .. U.
W . a
2 la . m, .

 

 

 

 

 

WT DEX Ad5 Iono

6:80:23 9:08 moo

 

 

lNFy positive

 

161

5.3. Discussion

Toxicities that rapidly develop after intravenous injection of Ad vectors is a
major problem, limiting the usage of Ads in gene therapy applications requiring
systemic administration; i.e.: for high-level liver transduction (46, 78, 183, 184).
To improve the risk/beneﬁt ratio of systemic administration of Ad vectors requires
simultaneous blockade of several Ad induced innate immune responses, such as
acute thrombocytopenia (44), cytokines/chemokine release (26, 185, 186),
induction of pro-inﬂammatory gene expression (23, 25, 26, 46) and activation of
endothelial cells (45, 129, 132). In this study, we attempted to block all of these
responses with a simple pretreatment with a clinically convenient and the widely
utilized glucocorticoid, in this instance, Dexamethasone. Our results conﬁrmed
that transient pretreatment of mice with several doses of Dexamethasone can
abrogate most innate toxicities attributable to systemic delivery of Ad-based
vectors, improving the risk/beneﬁt ratio of this vector class for numerous
applications such as liver gene therapy. The drug dosages used in our studies
parallel doses routinely utilized in humans, doses that range from those
attempting to capitalize upon the anti-inﬂammatory effects of DEX to treat mild
conditions, to doses used to treat complications of sepsis and clinical shock (187-

189).

The mechanism of action of glucocorticoids is relatively well known.
Glucocorticoid hormones bind to their respective glucocorticoid receptors (GR),
which dimerize and translocate to the nucleus, where they bind to speciﬁc DNA

sequences, the Glucocorticoid response elements (GRE) and either activate

162

transcription of anti-inﬂammatory genes (IL-10, lL-1_RA) or indirectly
downregulate transcription of a number of pro-inﬂammatory genes (cytokines,
adhesion molecules) through a variety of mechanisms (113-115). Glucocorticoids
are known to change chromatin structure allowing for increased (or decreased)
accessibility for transcriptional machinery (173). A number of reports conﬁrm the
role of high dose glucocorticoids in reducing transcription of pro-inﬂammatory
genes mediated by GRs (113-115), in particular in LPS-induced models (190-
192). Systemic activation of the innate immune system can also be minimized by
high dose DEX pre-treatment (or other glucocorticoids) at least in part by GR-
mediated blocking of pro-inﬂammatory genes transcription (127, 187, 190, 192,
193).

Based upon this analysis, we thought that many of the same innate immune
response pathways that are induced by Ad vectors may also be impacted upon
by glucocorticoids. Clearly, our results conﬁrm this notion, as DEX pretreatment
can minimize or prevent numerous Ad vector induced innate immune responses.
In Figure 36, we have attempted to summarize some of the known innate
immune response pathways induced by Ad that appear to be responsive to DEX

pretreatment (Figure 36).

We found that DEX pre-treatment signiﬁcantly diminished the Ad dependent
activation of most innate immune responses noted after systemic delivery of Ads
(44-46, 129, 132, 185, 186). Speciﬁcally, the systemic release of pro-
inﬂammatory cytokines/chemokines within 6 hours of Ad injection was partially or

completely blocked by pretreatment of mice with escalating doses of DEX. At

163

maximal DEX dosages, Ad induction of thrombocytopenia was prevented, the
transcriptional activation of multiple, pro-inﬂammatory liver genes at 6 hpi was
completely blocked, and endothelial cell activation were all mitigated by transient
DEX pre-treatment of Ad-injected mice. DEX pre-treatment also blocked
leukocyte inﬁltration into the Ad transduced liver at 28 dpi. Our previous studies
and those of others suggests that this effect was. likely mediated by signiﬁcantly
altering Ad interactions with the TLR and complement systems, since these
systems are known to mediate Ad interactions with macrophages, dendritic cells,
mast cells, endothelial cells, and/or granulocytes (23-26, 35, 36, 46, 163, 194,

195).

Cellular inﬁltration of the liver by elements of the mammalian innate immune
response is dependent upon activation of endothelial cells. Elevated expression
of adhesion molecules on their surface, such as the P and E selectins, mediate
tethering and rolling of leukocytes, whereas increased expression of ICAM-1,
lCAM-2 and VCAM-l mediate ﬁrm adhesion of leukocytes. It is known that high
dose Ad vectors cause rapid activation of endothelial cells both in vitro (45) and
in vivo (45, 129, 132). We have shown that plasma levels of endothelial cell
derived activation markers were induced at least 3 fold in Ad-injected mice as
compared to mock-injected animals (e-Selectin, lCAM-1). This induction was
completely blocked with DEX pre-treatment of Ad-injected mice, a result veriﬁed
by qRT-PCR analysis of lCAM-1 and VCAM-1 gene transcriptions. Since we

conﬁrmed that systemic Ad injection into DEX pretreated mice still resulted in

164

Figure 36: Dexamethasone pre-treatment mediates blockage of Ad
induced innate immune responses: model of action. Ad interactions
with the complement system, as and/or Ad capsid triggered TLR signaling
results in nuclear translocation of inﬂammatory Transcription Factors, such
as NFkB, IRF7 and others. The expression of a number of genes involved
0 in innate immune responses becomes upregulated in response to
systemic injection of Ads. This leads to cytokine and chemokine release
and signal ampliﬁcation by autocrine and paracrine cytokine signaling.
DEX, when injected prior to Ad treatment, causes Glucocorticoid Receptor
dimerization and nuclear translocation, where GR interacts with genes
containing the target DNA sequence (GRE). Thus, GR activation by DEX
pretreatment interferes with induction of transcription of pro-inﬂammatory
genes, to block Ad induced transcription of adhesion molecules (lCAM-1,
VCAM-1) minimize systemic cytokine release and therefore in lack of
induction of IFN responsive genes, such as Oas1a or ADAR. See (23-26,

35, 36, 44-46, 129, 132, 163, 185, 186, 194, 195) for further details.

165

  

3&2

 

sagas»

2...;

 

I
\

166

Kupffer cell necrosis, we have now conﬁrmed that Kupffer cell dependent innate
immune responses induced by Ads are likely consequent to immediate
interactions with Kupffer cells, rather than due to Ad induced Kupffer cell necrosis
per se (36, 129, 196). Interestingly, DEX pre-treatment did not have any effect on
Ad-dependent Kupffer cell necrosis, which suggests that DEX does not mediate

damage associated molecular pattern molecules inﬂammatory responses.

We further conﬁrmed that pre-treatment with DEX did not prevent Ad
vectors from transducing the murine liver with transgenes. Interestingly, DEX pre-
treatment increased the detectable number of Ad genomes in the murine liver
early after injection, but this did not elevate Ad derived B-Gal expression levels in
murine liver at 24 hpi and 28 dpi. This paradox may be due to the fact that in the
vectors utilized in this study the LacZ gene was expressed under control of the
CMV promoter/enhancer element. This enhancer is known to contain Nuclear
factor KB (NF-KB) response elements (197). NF-KB is a key transcription factor
activating pro-inﬂammatory gene expression, and is induced over 2 fold in the
livers of Ad5-LacZ treated C57BU6 mice at 6 hpi compared to Mock-injected
animals. In contrast, DEX pre-treated virus injected animals had NF-KB transcript
levels no different from mock-injected animals; in fact they had 1.6 fold less NF-
KB transcripts compared to WT_Mock group. This over 3.5 fold difference
between DEX treated and non-treated Ad5-LacZ injected animals may explain
why CMV promoter/enhancer derived LacZ gene transcription did not correlate

with Ad vector genome copy numbers (198).

167

DEX pre-treatment of mice minimized Ad induced innate immune
responses, an effect that also resulted in blunted adaptive immune responses.
Neutralizing antibody titers, anti-Ad and anti-LacZ antibody titers were
signiﬁcantly reduced in DEX pre-treated Ad-injected mice relative to non-DEX
treated, Ad vector treated mice. The fact that DEX pre-treatment diminished the
generation of anti-Ad NAb may have signiﬁcant applicability in Ad re-

administration scenarios (199).

In summary, results obtained in this study conﬁrm that the simple pre-
emptive and transient use of a potent glucocorticoid prior to systemic delivery of
an Ad vector can allow for safer systemic Ad mediated gene transfer. This
approach avoids the complications associated with long-terrn glucocorticoid
usage, while simultaneously signiﬁcantly improving the safety proﬁle of systemic
Ad administration for use in gene therapy strategies requiring widespread liver
transduction. Furthermore, this method can be simply applied in conjunction with
use of either advanced generation Ad vectors, and/or other pre-emptive
strategies previously shown to impact on Ad induced innate immune responses
to further improve the safety proﬁle of this important gene transfer platform.
These beneﬁts, coupled with DEX dependent diminishment of generation of Ad

speciﬁc neutralizing antibodies further highlights the importance of this study.

168

Acknowledgement:

We wish to thank Michigan State University Laboratory Animal support
facility for their assistance in the humane care and maintenance of the animals
utilized in this work. 8.8.8. was supported by American Heart Association
Midwest Afﬁliate Fellowship 0815660G. A.A. was supported by the National
Institutes of Health grants RO1DK-069884, P01 CA078673, the MSU Foundation

as well the Osteopathic Heritage Foundation.

169

Chapter VI

Materials and Methods

170

6.1. Adenovirus vector construction

6.1.1. Incorporation of COMPinh in HI loop of the ﬁber protein

All novel Ad vectors were constructed utilizing pAdEasy based system
(200) with modiﬁcations. pAdEasy plasmid was digested with Spa! and Feel
restriction enzymes and the 6.20 kb fragment containing the ﬁber gene was gel
puriﬁed and subcloned into the pBSX plasmid, giving rise to pBSX-FiberHI. The
Fiber HI loop was ﬂanked with in frame, Natl and Xbal restriction sites, using an
approach similar to that described in Fontana et.a|. (201) generating pBSX-
FiberHI-I-Not/Xba. Next, 45-mer complementary oliogonucleotides, encoding the
13-mer COMPinh nucleotide sequence were synthesized. When hybridized
together, these oligomers yielded Net! and Xbal compatible overhangs, allowing
in-frame subcloning into the HI ﬁber loop of pBSX-FiberHl+Not/Xba. The plasmid
obtained, pBSX-FiberHI+Not/Xba-COMPinh, was digested with Spa! and Feel
and the 6.25 kb fragment was cloned back into the pAdEasy backbone, giving
rise to pAd-Fiber-COMPinh. Bacterial homologous recombination of pAd-Fiber-
COMPinh with Pmel linearised pShuttle-CMV-LacZ yielded the pAd-CMV-LacZ-
Fiber-COMPinh plasmid. Further manipulations with this plasmid are identical to

the ones described below.

6.1.2. Incorporation of COMPinh in the C-terminus of protein IX

Oligonucleotides encoding COMPinh with Nhel compatible ends were
subcloned in-frame into the C-terminus of viral protein IX into pShuttle-lX/Nhel,

the latter contains an Nhel site just upstream of the pix stop codon (101). A LacZ

171

expression cassette was inserted into the MOS of the pShuttle-lX-COMPinh as
previously described (15, 26). pShuttle-LacZ-lX-COMPinh, was linearised with
Pmel restriction enzyme and homologously recombined with the plasmid
pAdEasyl (200), yielding pAd-LacZ-lX-COMPinh plasmid. HEK293 cells were
transfected with Pacl linearised Ad5-LacZ-lX-COMPinh or Ad5-LacZ-Fiber-
COMPinh plasmids. Recombinant viable viruses were isolated, ampliﬁed, and
puriﬁed in CSCIz gradients as previously described (185, 202). Note that a
complete list of primer sequences utilized for construction and validation studies
is in table 8. All viruses were designed to be [E1-,E3-] and found to be RCA free

(23).
6.2. Adenovirus vector production and characterization

A ﬁrst-generation, human Adenovirus type 5 derived replication deﬁcient
vector (deleted for the E1 and E3 genes) encoding B-galactosidase (LacZ) as a
transgene (Ad5-LacZ) was used in these studies. Virus construction, propagation
and puriﬁcation was performed as previously described (27, 28, 185, 202).
Brieﬂy, a number of serial passages on HEK293 cells allowed high titer
puriﬁcation of Ad5-LacZ by sequential, cesium chloride density gradient
centrifugations. Puriﬁed virus was dialyzed against 10 mM Tris (pH 8.0) and
stored in 1% sucrose, 1 X PBS at -80° C until use. VIral particle (vp) and
transducing unit titers (bfu/ml) were determined as previously described, and
were 2.6 x 1012 vplml and 1.8 x 1011 bfulml respectively (15, 26). The vp to bfu

ratio was ~14:1. Infectious titers of all Ads were determined by standard Tissue

172

 

Table 8: Complete list of primers and oligos, utilized to construct and
validate Ad5-based vectors. Oligos, utilized to subclone COMPinh into
plX and ﬁber are shown. Important sequencing primers used to conﬁrm
integrity of plasmids constructed are also presented. Note, validation
primers were used to sequence plasmids at all stages and puriﬁed virus

derived DNA.

173

 

Primer
name

Primer sequence (5’-3’)

Used for

 

Comp-Nhe-F

CTAGCatctgcgtgtggcaggattggggcgcccacaggtgcaccG

compinh in plX

Cloning

 

Comp-Nhe-R

CTAGngtgcacctgtgggcgccccaatcctgccacacgcagatg

compinh in pIX

Cloning

 

Comp-Xba-Fc

CTAGAatctgcgtgtggcaggattggggcgcccacaggtgcaccCG

Cloning
compinh in
Fiber

 

Comp-Not-Rc

GGCCGngtgcacctgtgggcgccccaatcctgccacacgcagatT

Cloning
compinh in
Fiber

 

Knob-F1

AGGCAG'ITI'GGCTCCAATATCTG

Natl/Xbal
insertion in
Fiber

 

knob-XbalNot—R1

GCGGCCGCACCTCTAGATGTGTCTCCTGTITCCTGTGTA

Natl/Xbal
insertion in
Fiber

 

knob-XbalNot-FZ

TCTAGAGGTGCGGCCGCTCCAAGTGCATACTCTATGTCATI’
T

Natl/Xbal
insertion in
Fiber

 

knob-R2

GCTATGTGGTGGTGGGGCTATACTA

Natl/Xbal
insertion in
Fiber

 

CMV-F

TGGGAGTTTGTITI'GGCACC

Sequencing
transgene

 

SV40polyA-R

TTCATTTTATG'ITTCAGG'ITCAGGG

Sequencing

transgene

 

plX-S EQ—F 1

GCAAGCAGTGCAGCTI’CCCG

Sequencing
plX display

 

plX-SEQ-F2

GATCTGCGCCAGCAGG'ITI'C

Sequencing
plX display

 

plX-SEQ-R

CAGGACCCTCAACGACCGAG

Sequencing
plX display

 

Ad5-Comp-R

CCGCCCTATCCTGATGCACG

Sequencing
Fiber display

 

Cominh-SEQ-F

ATCTGCGTGTGGCAGGATI’G

Sequencing
compinh

 

 

plX-upstream-R

 

CCACGCCCACACATTTCAGTACC

Sequencing of

 

Ads to test for
RCA

 

 

174

Culture Infectious Dose 50 (T CIDSO) method (AdEasy Adenoviral vector system
manual, Qbiogene, Carlsbad, CA). Infections titer was calculated by using
KARBER statistical method: TCID50/ml titer=10 x101 * “(Sf-5’, where d is the
log(10) of the dilution and S is the sum of ratios from the ﬁrst dilution.
VP/T U/T CID results are summarized in table 6. Note, that VP/T UIT CID ratios of
capsid-displaying Ads were not dramatically different from the same ratios for
control Ads (table 6). These experiments validated the viability of novel capsid-

displaying Ads.

All viruses were found to be RCA free both by RCA PCR (E1 region
ampliﬁcation) and direct sequencing, methods as previously described (23). Ad
vectors have also been tested for the presence of bacterial endotoxin as
previously described (136) and were found to contain <0.01 EU per injection

dose.
6.3. Electron Microscopy of puriﬁed Ad vectors

Negative staining of CSCIz puriﬁed Ad vectors was performed as follows.
Ads diluted to 1012 vplml in 10 mM Tris were adsorbed to FormvarlCarbon ﬁlm
300 mesh Copper grids (Electron Microscopy Sciences, Hatﬁeld, PA) and stained
with a freshly prepared, 1% solution of phosphotungstic acid (1 g PTA, 50 pl of
FBS, 50 ml miliQ water, pH 6.0, adjusted by KOH) for 30 seconds and examined
by using transmission electron microscope (Philips EM410). Photographs were

taken from representative areas from each sample (Figure 21).

6.4. Validation of VP titers of Ads

175

 

6.4.1. Silver Staining

To verify that particle number quantiﬁcation was accurate across all Ads
constructed, 101o vps of lysed puriﬁed virions of each Ad were separated by 10%
SDS-PAGE and subsequently stained with silver nitrate utilizing a Silver stain kit
for proteins (Sigma, St. Louis, MO). The amount of hexon protein was quantiﬁed
for each Ad vector by scanning densitometry using lmageJ software, ver. 1.29
(developed at the US. National Institutes of Health and available on the lntemet
at http://rsb.info.nih.govlnih-image/). Results from this analysis indicated that the
VP titers of all viruses determined by spectrophotometry fall within ~1.13 fold of
each other, thus capsid-displaying Ad5 vector preparations did not contain less
virions as compared to ﬁrst generation Ad5 vectors, based on this assay (Figure

23 and data not shown).
6.4.2. Western Blotting

To further verify that particle number quantiﬁcation was accurate across all
Ads constructed, 1010 of lysed puriﬁed virions of each Ad were separated by 10%
SDS-PAGE and Western blotting was performed utilizing hexon speciﬁc
antibodies (Abcam, Cambridge, MA). Electrophoretically separated capsid
protein samples were transferred onto nitrocellulose membranes and probed with
rabbit polyclonal Ad5 hexon speciﬁc antibody, followed by probing with a
ﬂuorescent secondary antibody as previously described (36). Membranes were
scanned and hexon concentrations quantiﬁed using Licor's Odyssey scanner

(36). Results from this analysis indicated that the VP titers determined by

176

spectrophotometry fall within ~1.3 fold of each other based on this assay, thus
capsid-displaying Ad5 vector preparations did not contain less virions as
compared to conventional ﬁrst generation Ad5 vectors based on this assay (data

not shown).
6.5. Capsid thermostability assay

It has been shown that Ad capsids containing functional ple are more
resistant to temperature inactivation as compared to Ad capsids lacking plX or
plX functionality (203, 204). Therefore, we pre-incubated control Ads, and plX-
COMPinh displaying Ads at 45° C or 56° C, infected HEK293 cells and
determined the percentage of LacZ positive HEK293 cells as previously
described (15, 26). We did not detect signiﬁcant differences between the ability of
Ad-LacZ-lX-dCOMPinh to transduce 293 cells compared to control vectors Ad-
LacZ. This conﬁrms that COMPinh displaying vectors contain a functional protein
IX.

Capsid thermostability assay was performed according to previously
described protocol (101, 203, 204) with modiﬁcations. 400,000 HEK293 cells
were plated in each well of a 24 well tissue culture plate. Ads were diluted from
CsClz puriﬁed stocks in complete media (1.55x107 vp in 500 pl of media) and
were either not heat treated, or heated to 45° C or 56° C for 1 hour. Following
incubation viruses were added to 293 cells. Following a 12-hour incubation, the
cells were stained with X—gal (15, 26) and the percentage of LacZ positive cells

was determined for every sample. The results indicated that all Ads retained

177

about 10-20% of LacZ positive cells after incubation at 45° C as compared to the

non-heat treated Ads.
6.6. Animal procedures

Adult C57BU6 WT and B612984-C3tmlCrr (C3-KO) mice were purchased
from Jackson Laboratory (Bar Harbor, ME). mCR1l2-KO mice in CS7BLI6
background were a kind gift from Dr. Tedder, Duke University Medical Center
(71, 205). B-arrestin-1 and -2 KO mice have been backcrossed to CS7BL6
background for more than 10 generations and have been described previously
(206). These mice were kindly provided by Dr. Robert Leﬂtowitz (Duke

University).

The Ad vector was injected intravenously (via the retro-orbital sinus) into 8-
10 week old male C57BU6 mice after performing proper anesthesia with
isoﬂuorane. A total of 0.75 x 1011 vp in 200 pl of PBS was injected per mouse.
Dexamethasone (America Pharmaceutical Partners, INC, Schauburg IL, USA)
was administered by intraperitoneal injection (10 mglkg, 1 mglkg, 0.1 mglkg), at
15 hours and 2 hours prior to Ad vector administration. Note, that 0.1 mglkg and
1 mglkg DEX was used only in measuring Ad induced cytokines/chemokines
release. The highest dose of DEX was selected based upon current dose
regimens utilized to treat bacterial sepsis and shock human clinical applications
(187-189), Ad vector induced inﬂammatory responses closely resemble these
conditions. These dosages have been widely used in a number of studies on

animal models (127, 193).

178

Four groups of mice were analyzed in DEX study: Wild-type (WT) mice
mock-injected with PBS, WT mice pre-treated with DEX and then mock-injected
with PBS (to identify DEX mediated responses not directly attributed to Ad), WT
mice injected only with Ad5-LacZ, and WT mice pre-treated with DEX and
subsequently injected with Ad5-LacZ. Control and experimental mice were
sacriﬁced at different times after mock or virus treatment: 6 hours post injection
(hpi), (N=6 for virus injected groups, N=4 for Mock-injected groups), 24 hpi (N=4

for all groups), 28 dpi (N=5 for all groups).

Four groups of mice were analyzed in CR1/2 study: C57BU6 Wild-type
(WT) and CR1/2-KO mice, Mock-injected with PBS and C57BU6_WI' or CR1I2-
KO mice injected with Ad5-LacZ. For some of the control experiments C3-KO
mice were utilized (N=4 for all C3-KO groups). Mice were sacriﬁced at different
times after mock or virus treatment: 6 hours post injection (hpi), (N=6 for virus
injected groups, N=4 for Mock-injected groups), 24 hpi (N=4 for all groups), 28

dpi (N=5 for all groups).

For both B-Arr and B-Arr2 four groups of mice were analyzed: VVIld-type
(WT) mice mock-injected with PBS, B-Arr or B-ArrZ-KO mice mock-injected with
PBS, WT mice injected with Ad5-LacZ, and B—Arr or B-Arr2-KO mice injected with
Ad5-LacZ. Control and experimental mice were sacriﬁced at 6 hours after mock

or virus treatment: N=4 for virus injected groups, N=3 for Mock-injected groups).

Plasma and tissue samples were collected and processed at the indicated

time points in accordance with Michigan State University Institutional Animal

179

 

Care and Use Committee. All procedures with recombinant Ads were performed
under BSL-2, and all vector treated animals were maintained in ABSL-2
conditions. All animal procedures were reviewed and approved by the Michigan
State University ORCBS and IACUC. Care for mice was provided in accordance

with PHS and AAALAC standards.

6.7. CytokineIChemokineIEndothelial cells activation markers release

measurement

Ad induced systemic release of pro-inﬂammatory cytokines/chemokines in
murine plasma was measured in all groups of mice utilizing a multiplex bead
array system. Plasma samples were collected using heparinized capillary tubes
and EDTA coated microvettes (Sarstedt, Nlimbrecht, Germany) and centrifuged
at 3400 rpm for 10 min to retrieve plasma samples. Samples were assayed for 7
independent cytokines/chemokines, which we have previously shown to be
rapidly induced by systemically injected Ad vectors (MCP-1, KC, MlP-1B, lL-6, lL-
12p40, G-SCF, RANTES) (23, 25, 26). All procedures were performed exactly as
previously described according to manufacturer’s instructions (Bio-Rad,
Hercules, CA) via Luminex 100 technology (Luminex, Austin, TX) (23). For in
vitro experiments utilizing peritoneal macrophages, media collected at speciﬁed
time points was assayed for the same 7 analytes as per manufacturer’s
instructions. The measurement of soluble lCAM-1 and e-Selectin molecules
(endothelial cells activation markers) in murine plasma (collected at 6 hpi) was
performed utilizing mouse cardiovascular disease panel LlNCOplex kit (Millipore,

Billerica, MA) as per manufacturer's instructions.

180

6.8. Cytokine quantiﬁcation in human PBMCs

Human PBMCs were plated as previously described (207). Brieﬂy, PBMCs
were resuspended in RPMI-1640 with 10% FBS, 1% PSF and plated into 24-well
tissue culture plate at a concentration of 106 PBMClmI. Upon 24 hour incubation,
cells were washed two times with HBSS and exposed to the following Ad5
vectors at a multiplicity of infection 5000 (5x109 vplwell): Ad5-LacZ, Ad5-LacZ-IX-
dCOMPinh, Ad5-LacZ-Fiber—dCOMPinh. Media was collected at 6, 24 and 48
hpi, stored at -20° C until use, and levels of human lL-6,_ IL-8, RANTES, GCSF,
lL-10, MOP-1 and MlP-1B measured utilizing a multiplex bead array system
exactly as previously described (27, 28). Only levels of lL-6, "-8 and RANTES
are reported, since levels of other analytes were not induced over Mock (IL-10,
GCSF) or were not signiﬁcantly different between Ad-injected groups (MOP-1,

MlP-1 B).
6.9. Complete blood count analysis and cell type differentiation

Total blood (0.3-0.4 ml) was collected into EDTA coated 1.0 ml Lavender
tubes (BD Microtainer, Franklin Lakes, NJ) at 24 hpi. For complete blood counts
(CBCs), blood was analyzed on an Advia 120 Hematology System (Bayer, New
York) by the Clinical Pathology Laboratory of the Diagnostic Center for
Population and Animal Health at Michigan State University (East Lansing, MI). In
addition, all blood samples were examined microscopically and underwent

manual differential count.

6.1 0. Platelet enumeration

181

To access Ad vector induced thrombocytopenia in mice, platelets were
measured 24 hpi after systemic Ad injection by using Unopette (Fisher Scientiﬁc)
system as previously described (23, 26) as per manufacturer's
recommendations. Platelets were subsequently manually counted using

Neubauer hemocytometer.

6.11. Ad genome copy number per liver or spleen cell

To determine the number of Ad genome copies per spleen and/or liver cell
at different time points post-transduction, tissues (<01 9) were snap frozen in
liquid nitrogen, crushed to a ﬁne powder using a mortar and pestle and total DNA
was extracted from as previously described (208). Ad genome copy numbers
were assessed using Real-Time PCR based quantiﬁcation. PCR reactions were
performed on an ABI 7900HT Fast Real-Time PCR System using the SYBR
Green PCR Mastennix as described for qRT-PCR technique. Primers generated
against the Ad5 Hexon gene have been previously described (46). As an intemal
control for ensuring adequate DNA ampliﬁcation, DNA was quantiﬁed using
primers spanning the GAPDH gene. Standard curves were run in duplicate and
consisted of 6 half-log dilutions using total genomic DNA, or DNA extracted from
the puriﬁed Ad5-LacZ virus. These standard curves were used to determine the
number of viral genomes present per liver/spleen cell. Melting curve analysis

conﬁrmed the quality and speciﬁcity of the PCR (data not shown).

6.12. B-Galactosidase enzyme activity and in situ X-gal staining

182

 

Ad mediated expression of the transgene LacZ was measured both
qualitatively and quantitatively. Liver and spleen sections from animals sacriﬁced
at 6 hpi, 24 hpi and (in case of DEX and CR1/2 experiments) 28 dpi were
embedded in Optimal Cutting Temperature (OCT) compound, frozen and stored
at -80° C until use. Frozen samples were sectioned (7 pm sections) on a Leica
cryostat and were ﬁxed and in situ stained for LacZ expression using 5-bromo-4-
chloro-3-indolyl-b-D-galactopyranoside (X-Gal, 1 mg/ml) as previously described
(138). For quantitative assay, enzyme B-Galactosidase (B-gal) activity was
measured in snap frozen liver samples. Liver samples (<01 9) were
homogenized and total protein concentration was determined by bicinchoninic
acid (BCA) assay, Pierce (Rockford, IL). B-gal activity was quantiﬁed by use of a
B—gal activity detection kit (Stratagene, La Jolla, CA) according to manufacturers
instructions and as previously described (137). Data were reported as Units of [3-

gal activity per pg of total protein.
6.13. qRT-PCR Analysis

To determine relative levels of a speciﬁc, liver or spleen derived RNA
transcript, corresponding tissues were snap frozen in liquid nitrogen and RNA
was harvested from =100mg of frozen tissue using TRIzol reagent (Invitrogen,
Carlsbad, CA) per the manufacturer's protocol. Following RNA isolation, reverse
transcription was performed on 180ng of total RNA using SuperScript ll
(Invitrogen, Carlsbad, CA) reverse transcriptase and random hexamers (Applied
Biosystems, Foster City, CA) per manufacturer's protocol. RT reactions were

diluted to a total volume of 60pl and 2pl was used as the template in the

183

 

subsequent PCR reactions. Primers were designed using Primer Bank web
based software (http:llpga.mgh.harvard.edulprimerbankl). Some primers used for
ampliﬁcation have been previously described (26, 28, 46). Complete list of
primers utilized in this study is available in table 9. Q-PCR was carried out on an
ABI 7900HT Fast Real-Time PCR System using SYBR Green PCR Masterrnix
(Applied Biosystems, Foster City, CA) in a 15pl reaction. All PCRs were
subjected to the following procedure: 95.0° C for 10 minutes followed by 40
cycles of 950° C for 15 seconds followed by 60.0° C for 1 minute. The
comparative Ct method was used to determine relative gene expression using
GAPDH to standardize expression levels across all samples. Relative expression
changes were calculated based on comparing experimental levels of a respective
liver/spleen transcript to those quantiﬁed in liver/spleen samples, derived from

Mock-injected animals.

6.14. Kupffer cell staining

Liver blocks, preserved in OCT compound at -80°C, were sliced into 7pM
sections using a cryostat, placed on glass slides and frozen at -80°C for future
use. Slides were thawed, ﬁxed in 100% ethanol for 15min, and washed in KPBS
containing 0.2% gelatin and 0.05% tween-20. Sections were permeabilized in
0.1% triton-X100 and blocked with KPBS containing 0.1% gelatin, 1% tween-20,
and 5% BSA for 60 min at RT. To prevent non-speciﬁc binding of the secondary
antibody, 5% rabbit serum in wash buffer was added and incubated at RT for 30
min. Rat anti-mouse F4I80 antibody (Invitrogen, Carlsbad, CA) diluted to 5.2

pg/mL in wash buffer containing 2% rabbit serum was added to the sections and

184

incubated overnight at 4° C. Sections were washed and incubated at RT for 45
min with rabbit anti-rat Alexaﬂuor—488 (Invitrogen, Carlsbad, CA) secondary
antibody diluted 1:25.000 in wash buffer containing 2% rabbit serum. Sections
were then washed, stained with DAPI (Invitrogen, Carlsbad, CA) for 5 min at RT
and mounted using VECTASHIELD (Vector Laboratories, Burlingame, CA).
Images were obtained using a Leica DMLB microscope, and captured using
SPOT software v.3.5.9. Both DAPI and F4I80 stained images were transferred to
Adobe Photoshop and converted to grayscale. The background threshold was
set based on mock-injected livers, and pixels were quantiﬁed. F4I80 ﬂuorescence
values were normalized to DAPI ﬂuorescence values to control for cell number
differences. Values are reported as percent relative to number of Kupffer cells

identically enumerated in liver tissues derived from mock-injected control mice.
6.15. Hematoxilin and Eosin staining

To study Ad vector mediated hepatic inﬂammation (at 28 dpi), Hematoxilin and
Eosin (H&E) staining of mouse liver samples was performed as previously
described (137). Brieﬂy, tissues were ﬁxed in 10% neutral formalin for 12 hours,
washed in 70% ethanol, embedded in parafﬁn and 6-pm sectioned were stained
with H&E. We have adapted a previously developed semi-quantitative scoring
system, which allows the level of hepatic pathology between different liver
sections to be quantiﬁed and statistically compared (137). For every mouse, 10
liver sections obtained at different portions of the liver (0-1000 pm from liver

surface) were analyzed and given a numerical score (0-3) for three different

185

 

Table 9: List of primers, utilized in qRT-PCR experiment. A pair of
Fonivard (For) and Reverse (Rev) primers is provided for every transcript
tested by qRT-PCR based methods. The primers were designed as
described in Materials and Methods section; the length of resulted PCR

products was 100-160 nucleotides.

186

 

ADAR
CXCL-9»
DAF
GAPDH
GATAS
ICAM-l
IFNa
Imp
IRE-'7
IRF- 8
Jak-l
Jak-3
:My088
NFkB-RelA
NOD - 1
NOD-2
OAS—1a
SOCS-l
SOCS-3
TEX-1
TLR-2
TLR-3
TLR-6
TRAFZbP
TRAFG
TRIF
VCAM-l

 

ADAR-Mm-Rev 5'
CXCLQ-Mm-Por S'
CXCL9-Mm-Rev 5'
DAF~Mm For 5’

DAF-Mm-Rev 5' —

GAPDH—Mm—For 5’
GAPDH-Mm-Rev 5’
GATA3—Mm—For 5’
GATAB—Mm-Rev 5’
ICAMl—Mm-For 5'
ICAMl-Mm-Rev 5'
IFNal—Mm—For 5’
IFNal-Mm—Rev 5’
IFNB-Mm-For 5’
IFNB-Mm-Rev 5’
IRF7—Mm—For 5'
IRFI—Mm—Rev 5'
TRF8-Mm—For S'
IRF8—Mm—Rev 5'
Jakl-Mm—For 5'
Jakl-Mm—Rev 5’
Jak3—Mm—For 5'
JakB—Mm-Rev 5’
MyD88—Mm-For 5'
MyD88-Mm-Rev 5'

NFkB-RelA-Mn-For 5' -
NFkB-RelA—Mn-Rev 5’

NODl-Mm-For 5'
NODI-Mm-Rev 5’
NODZ-Mm-For 5’
NODZ—Mm—Rev 5'
OASla-Mm—For 5'
CASla-Mm—Rev 5'
SOCSi-Mm-Pnr 5'
SOCSI-Mm-Rev 5'
SOCSB—Mm~For 5'
SOCS3-Mm-Rev 5’

TBKl—Mm—For 5'
TBKl-Mm-Rev 5’
TLRZ-Mm—For 5’
TLRZ-Mm-Rev 5’
TLR3-Mm-For 5’
TLR3-Mm-Rev 5'
TLR6—Mm-For 5'
TLR6-Mm-Rev 5'
TRAF2bp-Mm-For
TRAFpr Mm-Rev
IRAF6-Mm-F01 5’
TRAF6—Mm-Rev 5’
TRTP-Mm-For 5'
TRIF—Mm-Rev 5'
VCAMl-Mm-For 5'

VCAMl—Mm—Rev 5'

ADAR-Mm-For LI - AGGATTGGTSAGCTCGTCAG

- CCCCTCTTTCTTCCTCTCTC
- GCCCCAATTCCAACAAAACTC
- CCTCTTTTGCTTTTTCTTTTGGCTG
GGCCAATGGTCGAGCCACG
CGAAATCCTGGCCGACACTC
- AGAACATCATCCCTGCATCC
- CACATTGGGGGTAGGAACAC
- CCTACTACGGAAACTCCGTCAGG
- GCCSCCATCCAGCCAGG
- GGCATTGTTCTCTAATGTCTCCG
- GCTCCAGGTATATCCGAGCTTC
- GCCTTGACACTCCTGGTACAAATGAG
- CAGCACATTGGCAGACGAASACAG
- TGGGTGGAATGAGACTATTGTTG
CTCCCACGTCAATCTTTCCTC
- TGAACGAGGCTCGCACAGTC
- GGCAGGTTAACTCCACTAGGTG
- GTTTACCGAATTGTCCCCGAS
- CTCCTCTGGSTCATACCCATGTA
GCTGTGCATCAGGGCCGCC
- GCGGTAGTGGAGCCGGAGAG
- GTGTGCGAGCTGCCAAGG
- GCCTGTAGACCAAGACTTGAGTGTCC
- AGAGCTGCTGGCCTTGTTAG
- TTCTCGGACTCCTGGTTCTG
GGCGCTCAGCGGGCAGTATTC
- CCACAAGTTCATGTSGATGAGGC
- CCCCTTCCCAGCTCATTCG
- TGTGTCCATATAGGTCTCCTCCA
- CAGGTCTCCGAGAGGGTACTG
GCTACGGATGAGCCAAATGAAG
- CAGGAGGTGGAGTTTGATGTG
- CCGTGAAGCAGGTAGAGAACTC
- CTGCGGCTTCTATTGGGGAC
— AAAAGGCAGTCGAAGGTCTCG
CAAGAACCTACGCATCCAGTG
- CCAGCTTGAGTACACAGTCGAA
- AGGACCATCAGAAGAAGTACGG
- CCCCTCGAASGGTCTAAACG
- CCAGACACTGGGGGTAACATC
- CGGATCGACTTTAGACTTTGGG
- GGGGTCCAACTGGAGAACCT
- CCGGCGAGAACTCTTTAAGTGG
- AGGAACCTTACTCATGTCCCC
- TGTTGTGGGACAGTCTCAGAA
5' - CAGGTTCGGAGAGTATCAGTTCC
5' - CTCTGGTATGGGATTCTSTGTTG
- GCGAGAGATTCTTTCCCTGACG
- CGTTGGCACTGGGGACAATTC
- AACCTCCACATCCCCTCTHTT
— CGGGCACCTSAAATTCCTCA
- AGTTGGGGATTCGGTTGTTCT
- CCCCTCATTCCTTACCACCC

 

187

 

categories of liver pathology:

1. Portal inﬂammation:
0 — no portal inﬂammation
1 — low-moderate number of inﬂammatory cells (macrophages,
lymphocytes) evident in <1I3 of portal tracts
2 — moderate number of inﬂammatory cells in 1/3-2/3 of portal tracts
3 — high number of inﬂammatory cells in over 2/3 of portal tracts

2. Periportal inﬂammation

 

0 - no inﬂammation
1 - low-moderate number of inﬂammatory cells inﬁltration evident
around <1I3 of portal tracts
2 — moderate number of inﬂammatory cells inﬁltrated through 1l3-2l3
of portal tracts, in majority of which they take less that 50% of
circumference. Minimum hepato-cellular necrosis observed.
3 - moderate-high number of inﬂammatory cells inﬁltrated through
over 2/3 of portal tracts or inﬁltrated through over 1l3 of tracts but
occupy over 50% of circumference in at least 50% of them.
Signiﬁcant hepato-cellular necrosis observed.

3. Lobular inﬂammation / damage
0 — no inﬂammation
1 - minimum-moderate necrosis observed in <1I3 of lobules

2 - moderate hepatocellular necrosis observed in 1l3-2I3 of lobules

188

3 - moderate-severe hepato-cellular necrosis observed in over 2/3 of
lobules
Two independent researchers have scored all the slides in a blind manner
and the averages of their scores were taken. The sum of scores (10 slides) for
each mouse was taken and individual category scores were averaged for each
group. Total inﬂammation index was computed by averaging the sum of all three
individual category scores for each mouse.

6.16. lFNy secretion assay (Flow Cytometry)

lFNy-secreting cells were detected using the APC-IFNy secretion assay
(Miltenyi Biotec, Auburn, CA) according to the manufacturer’s instructions.
Brieﬂy, after harvesting splenocytes from individual mice at 28 days post
injection, RBCs were lysed by using ACK lysis buffer (Invitrogen, Carlsbad, CA).
Splenocytes were subsequently washed two times with RPMI medium 1640
(Invitrogen, Carlsbad, CA) supplemented with 10% FBS, 2 mM L-glutamine, 1%
PSF (penicillin, streptomycin, fungizone), counted, and stimulated for 6 hours
with PMA (5 nglml), ionomycin (25 nglml) or H2b restricted LacZ peptide
(DAPIYTNV, 3 pg/ml) constructed by Genscript (Piscataway, NJ) at 37° C under
5% 002 (or left unstimulated). After stimulation splenocytes (1x106) were
transferred to 5 ml tubes and washed with 3 ml cold FACS-buffer (1600 rpm, 5
min, 4° C). The cell pellet was resuspended in 90 pl of cold complete RPMI and
15 pl lFNy catch reagent. After 5 min of incubation (labeling) at 4° C, 2 ml of
warm (37° C) medium was added to each tube. The cells were then incubated at

37° C and brieﬂy shaken every 10 min to allow cytokine secretion for 55 min.

189

Following incubation, cells were placed on ice and washed with 4 ml cold FACS-
buffer (1600 rpm, 5 min, 4° C), resuspended in 90 pl ‘cold FACS-buffer. The
secreted lFNy was stained with 15 pl APO-conjugated lFNy-speciﬁc antibody
(lFNy detection reagent). After 10 min incubation at 4° C, the cells were washed
with cold FACS- buffer, pelleted (1600 rpm, 5 min, 4° C), and resuspended in
FACS-buffer. For surface molecules staining, the antibodies were prepared in the
supernatant of the 2.462 hybridoma cell line, cells were stained with PE-CD8 (6
jig/ml), PeGCCy5.5-CD19 (8 pglml) (all BD Biosciences, San Diego, CA), and
. incubated on ice for 30 minutes. Samples were analyzed on BD LSR Il

instrument and analyzed using FlowJo software.
6.17. B cell activation assay (Flow Cytometry)

Early activation of B cells was studied by Flow Cytometry based methods.
0.75x1011 vplmouse of Ad5-lacZ was injected intravenously into WT, CR1I2-KO
or C3-KO mice. Forty-eight hours after Ad injection splenocytes were harvested
and CD19+ cells examined for expression of CD69 activation marker. Brieﬂy,
after harvesting splenocytes at 48 hpi from individual mice, RBCs were lysed by
using ACK lysis buffer (Invitrogen, Carlsbad, CA). Splenocytes were
subsequently washed two times with RPMI medium 1640 (Invitrogen, Carlsbad,
CA) supplemented with 10% FBS, 2 mM L-glutamine, 1% PSF (penicillin,
streptomycin, fungizone), resuspended and counted. Two million cells were ﬁrst
washed two times with cold FACS buffer and then incubated for 15 minutes with
puriﬁed rat anti-mouse CD16/CD32 Fc block (BD Biosciences, San Diego, CA).

For surface staining, cells were washed one time with FACS buffer and

190

 

incubated on ice for 30 minutes with the following antibodies, APC-CD3 (8
pglml), PeGCCy5.5-CD19 (8 pg/ml) and FlTC-CDB9 (10 pg/ml), (all BD
Biosciences, San Diego, CA). Samples were analyzed on BD LSR ll instrument

and analyzed using FlowJo software (Tree Star, San Carlos, CA, USA).
6.18. Antibody Titering Assay

ELISA based titering experiments were essentially completed as
previously described (209). Brieﬂy, 5 x 108 vplwell or 0.2 pg recombinant LacZ
protein/well (each diluted in PBS) was used to coat wells of a 96 well plate
overnight at 4°C. Plates were washed with PBS-Tween (0.05%) solution, and
blocking buffer (3% BSA in PBS) was added to each well and incubated for 1-3
hours at room temperature. For titering of total lgG antibodies, plasma was
diluted in 1:800 in blocking buffer, added to the wells, and incubated at RT for 1
h. Wells were washed using PBS-Tween (0.05%) and HRP conjugated rabbit
anti-mouse antibody (BioRad, Hercules, CA) was added at a 1:4000 dilution in
PBS-Tween. TMB (Sigma-Aldrich, St. Louis, MO) substrate was added to each
well, and the reaction was stopped with 1 N phosphoric acid. Plates were read at
450nm in a microplate spectrophotometer. Subisotype titering was completed
using a hybridoma subisotyping kit (Calbiochem, La Jolla, CA) using plasma at a

dilution of 1:200 per manufacturer’s recommendations.
6.19. Neutralizing Antibody Assay
2 x 103 HEK293 cells were seeded in microwells in 125pl of complete

media (DMEM, 10% FBS, 1% PSF). Cells were cultured overnight in a 37° C, 5%

191

CO; incubator. To inactivate complement, plasma was heat inactivated for 60
min at 56° C and brought to room temperature. Dilutions were made as indicated
in complete media in a total volume of 100pl for each well. 1.3 x 106 viral
particles of Ad5-LacZ (~650 vplcell) was next added to each dilution, mixed well
and incubated at room temperature (RT) for 1 hour. 100 pl of the
medium/plasmalvirus mixture was applied to cells and incubated for 2-3 days.
Control samples were incubated with either virus alone or complete media alone.
CELLTITER 96 A0...mus One solution (Promega, Madison, WI) was added to each
well and incubated for 2 hours in a 37° C, 5% 002 incubator. 150 pl of media
from each well was removed into a new microtiter plate and read at 492 nm in a

microplate spectrophotometer. Blank subtracted OD492 values are reported.
6.20. Western blotting

To determine if mCR1/2 protein has any effect on levels of major
complement protein C3 (or its cleavage products) in murine plasma, we have
performed Western blotting utilizing murine C3 speciﬁc polyclonal antibody,
which also recognizes C3 cleavage products (Abcam, Cambridge, MA). Assay
was performed as previously described (144). Brieﬂy, 5 pl of murine plasma,
collected at 10 minutes post injection or 6 hpi from all 4 groups of mice, utilized in
this study was loaded on 7.5% SDS-PAGE, transferred onto PVDF membranes
and probed with C3 antibody. Subsequently, the blot was probed with secondary
ﬂuorescent antibodies, scanned and quantiﬁed utilizing Licor’s Odyssey scanner

(210).

192

6.21. Peritoneal macrophages isolation and infection

Murine peritoneal macrophages were elicited by injection of 1 ml of sterile
Brewer's thioglycollate medium (4.05 gl100 ml; Sigma) into the peritoneal cavity
of CS7BU6 WT, B—Arr1-KO or [3-Arr2-KO mice. After 4 days, mice were
euthanized. PBS (10 ml) was injected into the peritoneum, and lavage ﬂuid was
removed as previously described (211, 212). Peritoneal cells were washed twice
by centrifugation, resuspended in 10% fetal bovine serum (US origin, endotoxin
tested (less than 0.3 EU/ml), heat inactivated, mycoplasma, virus and
bacteriophage tested from Gibco/Invitrogen) supplemented RPMI-1640 medium
(Gibcollnvitrogen) and then plated in 12-well plates and allowed to adhere to the
wells for 8 h in 5% 002 at 37 °C. Nonadherent cells were removed by two
washes with fresh culture medium (RPMI supplemented with 0.5% FBS), and the
remaining adherent peritoneal macrophages were used for the subsequent
infection with 20,000 vplcell of Ad5-LacZ. Perotineal macrophages were
extracted from four WT mice, four B-Arr1-KO mice and six 8-Arr2-KO mice and
plated onto multiple wells at the concentration of 1.5x106 cells/well. For every
time point independent wells were utilized: N=4 for WT and B-Arr1-KO, N=6 for [3-
Arr2-KO. Total media was collected at corresponding time point (6, 24 or 48 hpi)

and stored at -80° C until use.
6.22. Complement activation AP50 serum-based assay

Normal adult human serum (pooled from 30 individuals) was purchased

from Complement Technology Inc. (Tyler, TX), Rhesus monkey serum was

193

purchased from Innovative Research (Novi, MI), human PBMCs were obtained
from Astarte Biologics (Redmond, WA). Alternative pathway 50 complement
activation assay was performed as previously described (24) with modiﬁcations.
NHS was diluted 1l5 in EGTA-GVBS++ (8 mM EGTA) and mixed with the
respective Ads (2x1011 vp). NHS/Ad mixtures were incubated at 37° c for 30
min., and rabbit erythrocytes were added to each tube (0.75x108 in EGTA-

GVBS”)

After incubation at 37° C for 1 hour, 2 ml of EDTA-GVBS (10 mM EDTA)
was added to each tube and tubes were centrifuged at 3500 rpm for 5 min.
Following centrifugation absorbance of all tubes was read at 414 nm. All
reagents including NHS (pooled from 30 healthy individuals) were purchased
from Complement Technology Inc. (Tyler, TX). AP50 assay experiment was
repeated 4 times yielding similar results. Data from one representative
experiment are reported. In every experiment we have utilized N=3 technical

replicates.
6.23. C3a-desArg ELISA and CH50 assay

200 pl of NHS or NHPS was mixed with ma” vp of each or: the
respective Ad vectors (ﬁnal concentration equal to 5x1010 vplml of serum) and
incubated at 37° C for 90 min. The reaction was then stopped by adding EDTA to
a ﬁnal concentration of 10 mM. C3a-desArg was then quantiﬁed using ELISA as
per the manufacturer's instructions (Fitzgerald Industries lntl, former Research

Diagnostic lnc., Concord, MA) or (Quidel Corporation, San Diego, CA). Activation

194

of Classical complement pathway was measured by CH50 assay using the
MicroVue CH50 Eq E1A Kit (Quidel Corporation, San Diego, CA). For this assay,
after exposure of the serum to the control or respective Ad5 vectors aliquots
were taken, without exposure to EDTA, mixed with complement activator and an
ELISA that speciﬁcally detects the complement terminal complexes was
performed according to the manufacturer’s instructions (Quidel Corporation, San
Diego, CA). Note, that the residual amounts of terminal complement complexes
present in the control or Ad vector exposed serum samples were quantiﬁed as

CH50 unit equivalents per ml.
6.24. Statistical analysis

For every experiment, pilot trials were performed with 3 mice per group (or
N=3 for in vitro experiments). This allowed us to determine effect size and
sample variance so that Power Analysis could be performed to correctly
determine the number of subjects per group required to achieve a statistical
Power > 0.8 at the 95% conﬁdence level. Statistically signiﬁcant differences in
toxicities associated with innate immune response (i.e. platelet counts, gene
induction, etc.) were determined using One Way ANOVA with a Student-
Newman-Keuls post-hoc test (p value < 0.05). Furthermore, a Two Way ANOVA
with a Bonferroni post-hoc test was used to analyze the levels of cytokines at 1
and 6 hpi (or other speciﬁed time points) to determine signiﬁcant differences (p
value < 0.05) between groups. For antibody titering assays, liver H&E stains, 8-
Gal activity and Ad genomes in mouse liver, a two-tailed Student t-test was used

to compare 2 groups of virus-injected animals (p < 0.05). All graphs are

195

 

presented as Mean of the average :I: SD. GraphPad Prism software was utilized

for statistical analysis.

196

Chapter VII

Summary and Future Perspectives

197

 

The use of Ad5 vectors as a platform for gene transfer applications has
been gaining steady momentum. The large number of patients safely treated with
the Ad5 platform conﬁrms its high likelihood for acceptance by regulatory bodies,
relative to less well tested platforms, an important point when considering the
considerable risks and costs involved in developing new therapeutics.
Unfortunately, despite this tremendous track record for safe and efﬁcacious
delivery of transgenes in numerous applications, conventional, E1 deleted Ad5-
based vectors have several conﬁrmed limitations. These include Ad vector
triggered innate toxicities and a dramatically reduced efﬁcacy for gene transfer in
Ad-immune hosts. These facts indicate a need for development of more
efﬁcacious Ad-based vectors. We have summarized how many groups have
attempted to address the need to improve the efﬁcacy of Ad-based vectors in
general, and/or avoid the problem of pre-existing Ad5 immunity speciﬁcally, as
summarized in Figure 3. Some groups have proposed the utilization of alternative
human Ad serotype based vectors (some derived from non-human primates) as
a relatively simple method to avoid pre-existing Ad5 immunity (209, 213-215).
However, use of alternative serotype based Ad vectors also poses several new
serious problems including: (1) lack of previous usage in humans, (2) signiﬁcantly
altered biodistribution proﬁles and (3) induction of more deleterious inﬂammatory
immune responses relative to Ad5, in some cases causing excessive morbidity
and mortality in animal models (46, 75, 163, 209). All of these caveats may
prevent/hinder regulatory approval of alternative serotype based Ad vectors for

widespread deployment.

198

As a result of these considerations, it is clear that each of the modiﬁed Ad
vectors may be better utilized for some clinical applications, but not for others.
Despite this context speciﬁc utility, one should also be impressed that the Ad
platform appears to be highly “plastic” and capable of tolerating a number of
elegant molecular manipulations. In many instances, these modiﬁcations not only
preserve important beneﬁts inherent to the use of the traditional Ad5-based
platform, but also provide for improved efﬁcacy, even in the context of pre-

existing Ad5 immunity.

Future studies will expand upon these ﬁndings. Incorporation of some of
the modiﬁcations summarized herein will likely improve the capabilities of this
important platform for expanded use in a number of additional human and
agricultural applications, not targeted to date. One can also envision combining
some of the approaches described in this dissertation. However, theoretical
contemplation of these multiply modiﬁed vectors is not a guarantee for reduction
to practice, as nuances regarding compatibility of multiple manipulations to allow

for viability and large scale production of the resultant vector must be respected.

In regards to Ad-triggered innate toxicities, various strategies were
designed to minimize these acute immune responses, including non-covalent
modiﬁcation of Ad capsids (PEGylation) (87), usage of immunosuppressive
M, such as Dexamethasone (28), Makines ([NFa) blockers (167) or ﬂ
(lLR9) inhibitors (38). They have all shown initial promising results, but may
have limited applicability due to either non-speciﬁc off target effects, a signiﬁcant

alteration of Ad transductional efﬁciency, lack of scalability, and/or alteration of

199

Ad vector biodistribution proﬁles. As a result, continued investigations of Ad-
induced innate immune responses are required in order to more fully understand
the mechanisms by which immune responses against Ad vectors are generated

within the host.

In attempts to investigate the role of PRRs in mediating Ad-triggered
responses, we have studied the roles of B-Arr-1 and B-Arr—2 in modulating these
inﬂammatory responses. We were the ﬁrst to identify p-Arr-2 as potent inhibitor of
Ad-induced immune responses in mice. Although the biochemical mechanisms
by which B-arrestins mediate or inhibit the innate immune responses of Ad5 are
not known, previously reported interactions of B-arrestins with TRAF6, lea and
p105 might play a role in this process (41, 42, 216). It is also possible that
scaffolding functions of p-arrestins unique to Ad5 signaling pathways might be
important. It has recently been shown that Ad5 vectors trigger TLR-independent
pathways, such as NALP3/ASC inﬂammasomes (cytoplasmic NOD-like
receptors) (58), resulting in activation of lL-1B and lL-18, lL-1odlL-1Rl mediated,
nucleic acid independent signaling, and Ad interactions with mucosal defensins
have also been identiﬁed as mediating Ad5-induced innate immune responses
(217, 218). The potential roles of B-arrestins in mediating these responses

remain to be determined and represent a target for future studies.

In this dissertation, we have described the pivotal role the complement
system plays in generating robust innate and adaptive immune responses

subsequent to Ad treatment, (including systemic pro-inﬂammatory

200

cytokines/chemokine release, EC activation, acute thrombocytopenia, and liver
transcriptome dysregulation (24, 26)), while identifying that Ad-triggered toxicities
are modulated by C3 and CR1/2. Importantly, in our studies we have
demonstrated the critical role of these complement components (C3 and CR1/2)
in mediating generation of Ad-capsid speciﬁc humoral responses, including Ad
capsid-speciﬁc neutralizing antibodies. Future studies will shed light if the use of
C3-blockers or CR1/2 receptor antagonists may be a viable approach to improve
the efﬁcacy of Ad-mediated gene transfer, possibly by reducing the generation of

Ad capsid speciﬁc neutralizing antibodies.

The role of cytokines/chemokines in mediating Ad-triggered cellular
immune responses has not been fully investigated. Our studies provide a body of
evidence conﬁrming that the systemic release of pro-inﬂammatory
cytokines/chemokines is Cit-dependent, and regulated by CR1/2 protein (Figure
19). Speciﬁcally, since both MCP-1 and G-CSF are known to activate
macrophages (219), and both RANTES and G-CSF activate neutrophils (219), it
might be hypothesized that lack of mCR1/2 might result in an enhanced
inﬁltration of these inﬂammatory cells to the sites normally transduced by Ad
vectors (i.e. liver). However, our results were not able to detect substantial
increases in acute, Ad induced cellular responses in the livers of Ad-injected
mCR1l2-KO mice, suggesting that recruitment of these cells requires additional

factors.

In one of the most exciting chapters of this dissertation we have described

the construction and analysis of a novel class of Ad5-based vectors, “capsid-

201

displaying" speciﬁc complement inhibitors. We have began to test these novel
COMPinh-displaying Ads in several models and reported improved properties of
such-modiﬁed vectors. Furthermore, the use of COMPinh displaying Ads could
be combined with other methods (i.e.: prophylactic glucocorticoid therapy, or
surgical bypass techniques) (28, 170) to further reduce aspects of the Ad vector
triggered innate toxicities and improve the outcomes of gene transfer
applications. Based upon these data, future, more advanced studies are now
justiﬁed. We leave our readers with the view that despite all pragmatic limitations,
fully described in this dissertation, the continued improvement of Ad-based
vectors is likely to yield several important vector platforms that will have high

utility in a number of clinical and agricultural applications.

202

References

203

10.

11.

12.

Bailey, 11., and V. Mautner. 1994. Phylogenetic relationships among
adenovirus serotypes. Virology 205:438-452.

Russell, W.C. 2000. Update on adenovirus and its vectors. 1 Gen Virol
81:2573-2604.

Volpers, C., and S. Kochanek. 2004. Adenoviral vectors for gene transfer
and therapy. ] Gene Med 6 Suppl 1:8164-171.

Parks, RJ. 2005. Adenovirus protein 1X: a new look at an old protein.
Moi Ther 11:19-25.

Rux, 1.1., and RM. Burnett. 2004. Adenovirus structure. Hum Gene Ther
15:1167-1176.

Vellinga, 1., S. Van der Heijdt, and RC. Hoeben. 2005. The adenovirus
capsid: major progress in minor proteins. ] Gen Virol 86:1581-1588.

Cali, 1., A. Kass-Eisler, L. Leinwand, and E. Falck-Pedersen. 1996.
Adenovirus type 5 and 7 capsid chimera: ﬁber replacement alters
receptor tropism without affecting primary immune neutralization
epitopes. 1 Viral 70:2116-2123.

Gall, 1.6., KG. Crystal, and E. Falck-Pedersen. 1998. Construction and
characterization of hexon-chimeric adenoviruses: speciﬁcation of
adenovirus serotype. 1 Viral 7 2:10260-10264.

Molinier-Frenkel, V., R. Lengagne, F. Gaden, 5.8. Hong, I. Choppin, H.
Gahery-Segard, P. Boulanger, and LG. Guillet. 2002. Adenovirus hexon
protein is a potent adjuvant for activation of a cellular immune
response.) Viral 76:127-135.

Roy, 5., PS. Shirley, A. McClelland, and M. Kaleko. 1998. Circumvention
of immunity to the adenovirus major coat protein hexon. 1 Viral
72:6875-6879.

Wu, 11., 1. Dmitriev, E. Kashentseva, 'l'. Seki, M. Wang. and D.’l‘. Curiel.
2002. Construction and characterization of adenovirus serotype 5
packaged by serotype 3 hexon. ] Viral 76:12775-12782.

Myhre, 8., P. Henning, 0. Granio, A.S. Tylo, P.A. Nygren, S. Olofsson, P.
Boulanger, L. Lindholm, and 8.8. Hong. 2007. Decreased immune
reactivity towards a knobless, afﬁbody-targeted adenovirus type 5
vector. Gene Ther 14:376-381.

204

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

Appledom, D.M., S. Seregin, and A. Amalﬁtano. 2008. Adenovirus
vectors for renal-targeted gene delivery. Contrib Nephrol 159:47-62.

Amalﬁtano, A., and RJ. Parks. 2002. Separating fact from ﬁction:
assessing the potential of modiﬁed adenovirus vectors for use in human
gene therapy. Current gene therapy 2:111-133.

Amalﬁtano, A., M.A. Hauser, H. Hu, D. Serra, C.R. Begy, and LS.
Chamberlain. 1998. Production and characterization of improved
adenovirus vectors with the E1, E2b, and E3 genes deleted. 1 Viral
72:926-933.

Palmer, D.]., and P. Ng. 2005. Helper-dependent adenoviral vectors for
gene therapy. Hum Gene Ther 16:1-16.

Hacein-Bey-Abina, S., C. Von Kalle, M. Schmidt, M.P. McCormack, N.
Wulffraat, P. Leboulch, A. Lim, C.S. Osborne, R. Pawliuk, E. Morillon, R.
Sorensen, A. Forster, P. Fraser, [.1. Cohen, G. de Saint Basile, l. Alexander,
U. Wintergerst, T. Frebourg, A. Aurias, D. Stoppa-Lyonnet, S. Romana, l.
Radford-Weiss, F. Gross, F. Valensi, E. Delabesse, E. Macintyre, F. Sigaux,
I. Soulier, L.E. Leiva, M. Wissler, C. Prinz, T.H. Rabbitts, F. Le Deist, A.
Fischer, and M. Cavazzana-Calvo. 2003. LMOZ-associated clonal T cell
proliferation in two patients after gene therapy for SClD-XI. Science
302:415-419.

Seggewiss, R., and C.E. Dunbar. 2005. A new direction for gene therapy:
intrathymic T cell-speciﬁc lentiviral gene transfer. 1 (.‘lin Invest
115:2064-2067.

Puck, ].M., and BL. Malech. 2006. Gene therapy for immune disorders:
good news tempered by bad news. The journal of allergy and clinical
immunology 117:865-869.

Donsante, A., D.G. Miller, Y. Li, C. Vogler, E.M. Brunt, D.W. Russell, and
MS. Sands. 2007. AAV vector integration sites in mouse hepatocellular
carcinoma. Science 317:477.

Dave, U.P., K. Akagi, R. Tripathi, S.M. Cleveland, M.A. Thompson, M. Yi, R.
Stephens, ].R. Downing, NA. lenkins, and N.G. Copeland. 2009. Murine
leukemias with retroviral insertions at Lmoz are predictive of the
leukemias induced in SClD-Xl patients following retroviral gene
therapy. PLoS Genet 5:e1000491.

Harui, A., S. Suzuki, 8. Kochanek, and K. Mitani. 1999. Frequency. and
stability of chromosomal integration of adenovirus vectors. ] Viral
73:6141-6146.

205

 

23.

24.

25.

26.

27.

28.

29.

30.

31.

Hartman, Z.C., A. Kiang, R.S. Everett, D. Serra, XX. Yang, T.M. Clay, and A.
Amalﬁtano. 2007. Adenovirus infection triggers a rapid, MyD88-
regulated transcriptome response critical to acute-phase and adaptive
immune responses in vivo. ] Vir0181:1796-1812.

Appledom, D.M., A. McBride, S. Seregin, ].M. Scott, N. Schuldt, A. Kiang, S.
Godbehere, and A. Amalﬁtano. 2008. Complex interactions with several
arms of the complement system dictate innate and humoral immunity
to adenoviral vectors. Gene Ther 15:1606-1617.

Hartman, Z.C., D.M. Appledom, and A. Amalﬁtano. 2008. Adenovirus
vector induced innate immune responses: impact upon efﬁcacy and
toxicity in gene therapy and vaccine applications. Virus research 132:1-
14.

Kiang, A., Z.C. Hartman, R.S. Everett, D. Serra, H. Jiang, M.M. Frank, and A.
Amalﬁtano. 2006. Multiple innate inﬂammatory responses induced
after systemic adenovirus vector delivery depend on a functional
complement system. Mol Ther 14:588-598.

Seregin, S.S., Y.A. Aldhamen, D.M. Appledorn, NJ. Schuldt, AJ. McBride,
M. Bujold, S.S. Godbehere, and A. Amalﬁtano. 2009. CR1/2 is an
important suppressor of Adenovirus-induced innate immune responses

and is required for induction of neutralizing antibodies. Gene Ther
16:1245-1259.

Seregin, S.S., D.M. Appledom, A.l. McBride, NJ. Schuldt, Y.A. Aldhamen,
T. Voss, I. Wei, M. Bujold, W. Nance, S. Godbehere, and A. Amalﬁtano.
2009. Transient pretreatment with glucocorticoid ablates innate
toxicity of systemically delivered adenoviral vectors without reducing
efﬁcacy. Mal Ther 17:685-696.

Raper, S.E., N. Chirmule, F.S. Lee, N.A. Wivel, A. Bagg. G.P. Gao, I.M.
Wilson, and M.L. Batshaw. 2003. Fatal systemic inﬂammatory response

syndrome in a ornithine transcarbamylase deﬁcient patient following
adenoviral gene transfer. Mol Genet Metab 80:148-158.

Makower, D., A. Rozenblit, H. Kaufman, M. Edelman, M.E. Lane, I.
Zwiebel, H. Haynes, and S. Wadler. 2003. Phase ll clinical trial of
intralesional administration of the oncolyﬁc adenovirus ONYX-015 in
patients with hepatobiliary tumors with correlative p53 studies. Clin
Cancer Res 9:693-702.

Grines, C.L., M.W. Watkins, 1.]. Mahmarian, A.E. lskandrian, 1.]. Rade, P.
Marrott, C. Pratt, and N. Kleiman. 2003. A randomized, double-blind,
placebo-controlled trial of Ad5FGF-4 gene therapy and its effect on

206

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

myocardial perfusion in patients with stable angina. journal of the
American College of Cardiology 42:1339-1347.

lwasaki, A., and R. Medzhitov. 2004. Toll-like receptor control of the
adaptive immune responses. Nature immunology 5:987-995.

Akira, S., and K. Takeda. 2004. Toll-like receptor signalling. Nat Rev
Immunol 4:499-511.

Lemmers, B., L. Salmena, N. Bidere, H. Su, E. Matysiak-Zablocki, K.
Murakami, P.S. Ohashi, A. lurisicova, M. Lenardo, R. Hakem, and A.
Hakem. 2007. Essential role for caspase-8 in Toll-like receptors and
NFkappaB signaling] Biol Chem 282:7416-742 3.

Hartman, Z.C., E.P. Black, and A. Amalﬁtano. 2007. Adenoviral infection
induces a multi-faceted innate cellular immune response that is
mediated by the toll-like receptor pathway in A549 cells. Virology
358:357-372.

Appledom, D.M., S. Patial, A. McBride, S. Godbehere, N. Van Rooiien, N.
Parameswaran, and A. Amalﬁtano. 2008. Adenovirus vector-induced
innate inﬂammatory mediators, MAPK signaling, as well as adaptive
immune responses are dependent upon both TLR2 and TLR9 in vivo. J
Immunol 181:2134-2144.

Nociari, M., 0. Ocheretina, ].W. Schoggins, and E. Falck-Pedersen. 2007.
Sensing infection by adenovirus: Toll-like receptor-independent viral
DNA recognition signals activation of the interferon regulatory factor 3
master regulator. 1 Viral 81:4145-4157.

Cerullo, V., M.P. Seiler, V. Mane, N. Brunetti-Pierri, C. Clarke, T.K. Bertin,
].R. Rodgers, and B. Lee. 2007. Toll-like receptor 9 triggers an innate
immune response to helper-dependent adenoviral vectors. Mal Ther
15:378-385.

Shayakhmetov, D.M., A. Gaggar, 8. Ni, Z.Y. Li, and A. Lieber. 2005.
Adenovirus binding to blood factors results in liver cell infection and
hepatotoxicity. 1 Viral 79:7478-7491.

DeWire, S.M., S. Ahn, RJ. Leﬂmwitz, and S.K. Shenoy. 2007. Beta-
arrestins and cell signaling. Annual review of physiology 69:483-510.

Wang, Y., Y. Tang, L. Teng, Y. Wu, K. Zhao, and G. Pei. 2006. Association of
beta-arrestin and TRAF6 negatively regulates Toll-like receptor-
interleukin 1 receptor signaling. Nature immunology 7:139-147.

207

42.

43.

45.

46.

47.

48.

49.

50.

51.

52.

Parameswaran, N., C.S. Pao, K.S. Leonhard, D.S. Kang, M. Kratz, S.C. Ley,
and 1.L. Benovic. 2006. Arrestin-Z and G protein-coupled receptor
kinase 5 interact with NFkappaBl p105 and negatively regulate
lipopolysaccharide-stimulated ERK1/2 activation in macrophages. 1
Biol Chem 281:34159-34170.

Fan, H., L.M. Luttrell, G.E. Tempel, ].1. Senn, P.V. Halushka, and ].A. Cook.
2007. Beta-arrestins 1 and 2 differentially regulate LPS-induced
signaling and pro-inﬂammatory gene expression. Molecular
immunology 44:3092-3099.

Wolins, N., ]. Lozier, 'I‘.L. Eggerman, E. ]ones, E. Aguilar-Cordova, and 1.6.
Vostal. 2003. Intravenous administration of replication-incompetent
adenovirus to rhesus monkeys induces thrombocytopenia by
increasing in vivo platelet clearance. British journal of haematology
123:903-905.

Liu, Q., A.K. Zaiss, P. Colarusso, K. Patel, G. Halian, T.]. Wickham, and D.A.
Muruve. 2003. The role of capsid-endothelial interactions in the innate
immune response to adenovirus vectors. Hum Gene Ther 14:62 7-643.

Appledom, D.M., A. Kiang, A. McBride, H. ]iang, S. Seregin, ].M. Scott, R.
Stringer, Y. Kousa, M. Hoban, M.M. Frank, and A. Amalﬁtano. 2008. Wild-
type adenoviruses from groups A-F evoke unique innate immune
responses, of which HAd3 and SAd23 are partially complement
dependent. Gene Ther 15:885-901.

Cichon, G., S. Boeckh-Herwig, H.H. Schmidt, E. Wehnes, T. Muller, P.
Pring-Akerblom, and R. Burger. 2001. Complement activation by
recombinant adenoviruses. Gene Ther 8:1794-1800.

Kirschﬁnk, M. 1997. Controlling the complement system in
inﬂammation. Immunopharmacology 38:51-62.

Makrides, S.C. 1998. Therapeutic inhibition of the complement system.
Pharmacological reviews 50:59-87.

Barrington, R., M. Zhang, M. Fischer, and MC. Carroll. 2001. The role of
complement in inﬂammation and adaptive immunity. Immunol Rev
180:5-15.

Wagner, E., and MM. Frank. Therapeutic potential of complement
modulation. Nature reviews 9:43-56.

Mollnes, T.E., W.C. Song, and ].D. Lambris. 2002. Complement in
inﬂammatory tissue damage and disease. Trends in immunology 23:61-
64.

208

53.

54.

55.

56.

57.

58.

59.

60.

61.

62.

63.

64.

Atkinson, 1.P. 2006. C5a and chamma receptors: a mutual admiration
society. 1 Clin Invest 116:512-52 0.

Atkinson, 1.P., and MM. Frank. 2006. Bypassing complement:
evolutionary lessons and future implications. 1 Clin Invest 116:1215-
1218.

1iang, H., Z. Wang, D. Serra, M.M. Frank, and A. Amalﬁtano. 2004.
Recombinant adenovirus vectors activate the alternative complement
pathway, leading to the binding of human complement protein C3
independent of anti-ad antibodies. Mal Ther 10:1140-1142.

Zaiss, A.K., M.]. Cotter, L.R. White, S.A. Clark, N.C. Wong, V.M. Holers, ].S.
Bartlett, and D.A. Muruve. 2008. Complement is an essential component

of the immune response to adeno-associated virus vectors. ] Virol
82:2727-2740.

Carlisle, R.C., Y. Di, A.M. Cerny, A.F. Sonnen, R.B. Sim, N.K. Green, V. Subr,
K. Ulbrich, R.]. Gilbert, K.D. Fisher, R.W. Finberg, and L.W. Seymour.
2009. Human erythrocytes bind and inactivate type 5 adenovirus by
presenting Coxsackie virus-adenovirus receptor and complement
receptor 1. Blood 113:1909-1918.

Muruve, D.A., V. Petrilli, A.K. Zaiss, L.R. White, S.A. Clark, P.1. Ross, R.].
Parks, and 1. Tschopp. 2008. The inﬂammasome recognizes cytosolic
microbial and host DNA and triggers an innate immune response.
Nature 452:103-107.

Xu, 2., ]. Tian, ].S. Smith, and A.P. Byrnes. 2008. Clearance of adenovirus
by Kupffer cells is mediated by scavenger receptors, natural antibodies,
and complement] Viral 82:11705-11713.

Gasque, P. 2004. Complement: a unique innate immune sensor for
danger signals. Molecular immunology 41:1089-1098.

Kawano, M. 2000. Complement regulatory proteins and autoimmunity.
Archivum immunologiae et therapiae experimentalis 48:367-372.

Morgan, B.P., K.]. Marchbank, M.P. Longhi, C.L. Harris, and AM.
Gallimore. 2005. Complement: central to innate immunity and bridging
to adaptive responses. Immunol Lett 97:171-179.

Kemper, C., and 1.P. Atkinson. 2007. T-cell regulation: with
complements from innate immunity. Nat Rev Immunol 7:9-18.

Prechl, 1., and A. Erdei. 2000. lmmunomodulatory functions of murine
CR1/2. Immunopharmacology 49:117-124.

209

65.

66.

67.

68.

69.

70.

71.

72.

73.

74.

Tedder, T.F., M. lnaoki, and S. Sato. 1997. The CD19-CD21 complex
regulates signal transduction thresholds governing humoral immunity
and autoimmunity. Immunity 6:107-118.

Tedder, T.F., K.M. Haas, and ].C. Poe. 2002. CD19-CD21 complex
regulates an intrinsic Src family kinase ampliﬁcation loop that links
innate immunity with B-lymphocyte intracellular calcium responses.
Biochemical Society transactions 30:807-811.

Carroll, M.C. 2004. The complement system in B cell regulation.
Molecular immunology 41:141-146.

Boackle, S.A., V.M. Holers, and DR. Karp. 1997. CD21 augments antigen
presentation in immune individuals. Eur] Immunol 27:122-129.

Holers, V.M., and L. Kulik. 2007. Complement receptor 2, natural
antibodies and innate immunity: Inter-relationships in B cell selection
and activation. Molecular immunology 44:64-72.

Fairweather, D., S. Frisancho-Kiss, D.B. Nioku, ].F. Nyland, Z. Kaya, S.A.
Yusung, S.E. Davis, ].A. Frisancho, M.A. Barrett, and N.R. Rose. 2006.
Complement receptor 1 and 2 deﬁciency increases coxsackievirus B3-
induced myocarditis, dilated cardiomyopathy, and heart failure by
increasing macrophages, lL-1beta, and immune complex deposition in
the heart.) Immunol 176:3516-3524.

Haas, K.M., M. Hasegawa, D.A. Steeber, ].C. Poe, M.D. Zabel, C.B. Bock,
D.R. Karp. D.E. Briles, ].H. Weis, and T.F. Tedder. 2002. Complement
receptors CD21/35 link innate and protective immunity during
Streptococcus pneumoniae infection by regulating lgG3 antibody
responses. Immunity 17:713-723.

Ding, E.Y., B.L. Hodges, H. Hu, A.1. McVie-Wylie, D. Serra, F.K. Migone, D.
Pressley, Y.T. Chen, and A. Amalﬁtano. 2001. Long-term efﬁcacy after
[E1-, polymerase-l adenovirus-mediated transfer of human acid-alpha-
glucosidase gene into glycogen storage disease type ll knockout mice.
Hum Gene Ther 12:955-965.

Svensson, E.C., H.B. Black, D.L. Dugger, S.K. Tripathy, E. Goldwasser, z.
Hao, L. Chu, and ].M. Leiden. 1997. Long-term erythropoietin expression
in rodents and non-human primates following intramuscular injection
of a replication-defective adenoviral vector. Hum Gene Ther 8:1797-
1806.

Lasaro, M.C., and H.C. Ertl. 2009. New Insights on Adenovirus as Vaccine
Vectors. Mol Ther

210

75.

76.

77.

78.

79.

81.

82.

83.

Abbink, P., A.A. Lemckert, B.A. Ewald, D.M. Lynch, M. Denholtz, S. Smits,
L. Holterman, l. Damen, R. Vogels, A.R. Thomer, K.L. O'Brien, A. Carville,
K.G. Mansﬁeld, 1. Goudsmit, M.1. Havenga, and D.H. Barouch. 2007.
Comparative seroprevalence and immunogenicity of six rare serotype
recombinant adenovirus vaccine vectors from subgroups B and D. 1
Viral 81:4654-4663.

Cohen, P. 2006. lmmunity's yin and yang. A successful vaccine must ﬁrst
avoid being eliminated by pre-existing immunity before it can promote
a protective immune response. IAVIRep 10:1-5.

Molinier-Frenkel, V., H. Gahery-Segard, M. Mehtali, C. Le Boulaire, S.
Ribault, P. Boulanger, T. Tursz, 1.G. Guillet, and F. Farace. 2000. Immune
response to recombinant adenovirus in humans: capsid components
from viral input are targets for vector-speciﬁc cytotoxic T lymphocytes.
] Viral 74:7678-7682.

Sumida, S.M., D.M. Truitt, M.G. Kishko, ].C. Arthur, S.S. 1ackson, D.A.
Gorgone, M.A. Lifton, W. Koudstaal, M.G. Pau, S. Kostense, M.1. Havenga,
1. Goudsmit, N.L. Letvin, and D.H. Barouch. 2004. Neutralizing antibodies
and CD8+ T lymphocytes both contribute to immunity to adenovirus
serotype 5 vaccine vectors. 1 Viral 78:2666-2673.

Flomenberg, P., V. Piaskowski, R.I.. Truitt, and 1.T. Casper. 1995.
Characterization of human proliferative T cell responses to adenovirus.
[Infect Dis 171:1090-1096.

Tang. 1., M. Olive, K. Champagne, N. Flomenberg, L. Eisenlohr, S. Hsu, and
P. Flomenberg. 2004. Adenovirus hexon T-cell epitope is recognized by
most adults and is restricted by HLA DP4, the most common class II
allele. Gene Ther 11:1408-1415.

Tang, 1., M. Olive, R. Pulmanausahakul, M. Schnell, N. Flomenberg, L.
Eisenlohr, and P. Flomenberg. .2006. Human CD8+ cytotoxic T cell
responses to adenovirus capsid proteins. Virology 350:312-322.

Hashimoto, M., 1.L. Boyer, N.R. Hackett, ].M. Wilson, and R.G. Crystal.
2005. Induction of protective immunity to anthrax lethal toxin with a
nonhuman primate adenovirus-based vaccine in the presence of
preexisting anti-human adenovirus immunity. Infect Immun 73:6885-
6891.

Hackett, N.R., S.M. Kaminsky, D. Sondhi, and R.G. Crystal. 2000.
Antivector and antitransgene host responses in gene therapy. Curr Opin
Mol Ther 2:376-382.

211

 

84.

85.

86.

87.

89.

90.

91.

92.

93.

O'Riordan, C.R., A. Lachapelle, C. Delgado, V. Parkes, S.C. Wadsworth,
A.E. Smith, and G.E. Francis. 1999. PEGylation of adenovirus with
retention of infectivity and protection from neutralizing antibody in
vitro and in vivo. Hum Gene Ther 10:1349-1358.

Matthews, C., G. 1enkins, 1. Hilﬁnger, and B. Davidson. 1999. Poly-L-
lysine improves gene transfer with adenovirus formulated in PLGA
microspheres. Gene Ther 6:1558-1564.

Lee, S.G., 5.]. Yoon, C.D. Kim, K. Kim, D.S. Lim, Y.I. Yeom, M.W. Sung, D.S.
Heo, and N.K. Kim. 2000. Enhancement of adenoviral transduction with
polycationic liposomes in vivo. Cancer Gene Ther 7:1329-1335.

Croyle, M.A., H.T. Le, K.D. Linse, V. Cerullo, G. Toietta, A. Beaudet, and L.
Pastore. 2005. PEGylated helper-dependent adenoviral vectors: highly
efﬁcient vectors with an enhanced safety proﬁle. Gene Ther 12:579-587.

Croyle, M.A., N. Chirmule, Y. Zhang, and ].M. Wilson. 2002. PEGylation of
E1-deleted adenovirus vectors allows signiﬁcant gene expression on
readministration to liver. Hum Gene Ther 13:1887-1900.

Wortrnann, A., S. Vohringer, T. Engler, S. Corjon, R. Schirmbeck, 1.
Reimann, S. Kochanek, and F. Kreppel. 2008. Fully detargeted
polyethylene glycol-coated adenovirus vectors are potent genetic
vaccines and escape from pre-existing anti-adenovirus antibodies. Mal
Ther 16:154-162.

Weaver, E.A., and M.A. Barry. 2008. Effects of Shielding Adenoviral
Vectors with Polyethylene Glycol (PEG) on Vector-speciﬁc and Vaccine-
mediated Immune Responses. Hum Gene Ther

Ogawara, K., M.G. Rots, R.1. Kok, H.E. Moorlag, A.M. Van Loenen, D.K.
Meiier, H.]. Haisma, and G. Molema. 2004. A novel strategy to modify
adenovirus tropism and enhance transgene delivery to activated
vascular endothelial cells in vitro and in vivo. Hum Gene Ther 15:433-
443.

Einfeld, D.A., D.E. Brough, P.W. Roelvink, l. Kovesdi, and T.1. Wickham.
1999. Construction of a pseudoreceptor that mediates transduction by
adenoviruses expressing a ligand in ﬁber or penton base. 1 Viral
73:9130-9136.

Wickham, T.1., D.M. Sega], P.W. Roelvink, M.E. Carrion, A. Lizonova, G.M.
Lee, and I. Kovesdi. 1996. Targeted adenovirus gene transfer to
endothelial and smooth muscle cells by using bispeciﬁc antibodies. 1
Viral 70:6831-6838.

212

94.

95.

96.

97.

98.

99.

100.

101.

102.

103.

McConnell, M.1., X. Danthinne, and M.1. lmperiale. 2006.
Characterization of a permissive epitope insertion site in adenovirus
hexonJ Viral 80:5361-5370.

McConnell, M.1., P.C. Hanna, and M.1. lmperiale. 2006. Cytokine response
and survival of mice immunized with an adenovirus expressing Bacillus
anthracis protective antigen domain 4. Infect Immun 74:1009-1015.

Belousova, N., V. Krendelchtchikova, D.T. Curiel. and V. Krasnykh. 2002.
Modulation of adenovirus vector tropism via incorporation of
polypeptide ligands into the ﬁber protein. ] Viral 76:8621-8631.

Matthews, Q.L., D.A. Sibley, H. Wu, 1. Li, M.A. Stoff-Khalili, R. Waehler, ].M.
Mathis, and D.T. Curiel. 2006. Genetic incorporation of a herpes simplex
virus type 1 thymidine kinase and ﬁreﬂy luciferase fusion into the

adenovirus protein [X for functional display on the virion. Mal Imaging
5:510-519.

Worgall, S., A. Busch, M. Rivara, D. Bonnyay, P.L. Leopold, R. Merritt, N.R.
Hackett, P.W. Rovelink, 1.T. Bruder, T.1. Wickham, I. Kovesdi, and R.G.
Crystal. 2004. Modiﬁcation to the capsid of the adenovirus vector that
enhances dendritic cell infection and transgene-speciﬁc cellular
immune responses. 1 Viral 7 8:2572-2 580.

Kurachi, S., N. Koizumi, F. Sakurai, K. Kawabata, H. Sakurai, S.
Nakagawa, T. Hayakawa, and H. Mizuguchi. 2007. Characterization of
capsid-modiﬁed adenovirus vectors containing heterologous peptides
in the ﬁber knob, protein IX, or hexon. Gene Ther 14:266-274.

Waddington, S.N., ].H. McVey, D. Bhella, A.L. Parker, K. Barker, H. Atoda,
R. Pink, S.M. Buckley, ].A. Greig, L. Denby, 1. Custers, T. Morita, l.M.
Francischetti, R.Q. Monteiro, D.H. Barouch, N. van Rooiien, C. Napoli, M.1.
Havenga, S.A. Nicklin, and A.H. Baker. 2008. Adenovirus serotype 5
hexon mediates liver gene transfer. Cell 132:397-409.

Dmitriev, l.P., E.A. Kashentseva, and D.T. Curiel. 2002. Engineering of
adenovirus vectors containing heterologous peptide sequences in the C
terminus of capsid protein IX. 1 Viral 76:6893-6899.

Wickham, T.1., P.W. Roelvink, D.E. Brough, and I. Kovesdi. 1996.
Adenovirus targeted to heparan-containing receptors increases its gene
delivery efﬁciency to multiple cell types. Nat Biatechnal 14:1570-1573.

Koizumi, N., H. Mizuguchi, N. Utoguchi, Y. Watanabe, and T. Hayakawa.
2003. Generation of ﬁber-modiﬁed adenovirus vectors containing
heterologous peptides in both the HI loop and C terminus of the ﬁber
knob. ] Gene Med 5:267-276.

213

 

104.

105.

106.

107.

108.

109.

110.

111.

112.

113.

Dmitriev, I., V. Krasnykh, C.R. Miller, M. Wang, E. Kashentseva, G.
Mikheeva, N. Belousova, and D.T. Curiel. 1998. An adenovirus vector
with genetically modiﬁed ﬁbers demonstrates expanded tropism via
utilization of a coxsackievirus and adenovirus receptor-independent
cell entry mechanism. I Viral 72:9706-9713.

Wu, H., T. Han, N. Belousova, V. Krasnykh, E. Kashentseva, l. Dmitriev, M.
Kataram, P.1. Mahasreshti, and D.T. Curiel. 2005. Identiﬁcation of sites
in adenovirus hexon for foreign peptide incorporation. ] Viral 79:3382-
3390.

Vellinga, 1., M.1. Rabelink, S.1. Cramer, D.]. van den Wollenberg. H. Van
der Meulen, K.N. Leppard, F.1. Fallaux, and RC. Hoeben. 2004. Spacers
increase the accessibility of peptide ligands linked to the carboxyl
terminus of adenovirus minor capsid protein lX. ] Viral 78:3470-3479.

Heise, C., T. Hermiston, L. ]ohnson, G. Brooks, A. Sampson-1ohannes, A.
Williams, L. Hawkins, and D. Kim. 2000. An adenovirus ElA mutant that
demonstrates potent and selective systemic anti-tumoral efﬁcacy. Nat
Med 6:1134—1139.

Coughlan, L., S. Vallath, A. Saha, M. Flak, LA. McNeish, G. Vassaux, ].F.
Marshall, LR. Hart, and G1. Thomas. 2009. In vivo retargeting of
adenovirus type 5 to alphavbeta6 integrin results in reduced
hepatotoxicity and improved tumor uptake following systemic delivery.
1 Viro183:6416-6428.

Rein, D.T., M. Breidenbach, and D.T. Curiel. 2006. Current developments
in adenovirus-based cancer gene therapy. Future oncology (London,
England) 2:137-143.

Kroot, E.1., A.M. Huisman, 1. Van Zeben, ].M. Wouters, and H.C. Van
Paassen. 2006. Oral pulsed dexamethasone therapy in early
rheumatoid arthritis: a pilot study. Ann N YAcad Sci 1069:300-3 06.

Kardash, K.1., F. Sarrazin, M.1. Tessler, and A.M. Velly. 2008. Single-dose
dexamethasone reduces dynamic pain after total hip arthroplasty.
Anesthesia and analgesia 106:12 53-12 57, table of contents.

Ebrahimi, 8., and B. Sarkari. 2007. Comparative efﬁcacy of
dexamethasone versus hydrocortisone in severe acute pediatric
asthma. Iranian journal of allergy, asthma, and immunology 6:159-160.

Pace, T.W., F. Hu, and A.H. Miller. 2007. Cytokine-effects on
glucocorticoid receptor function: relevance to glucocorticoid resistance
and the pathophysiology and treatment of major depression. Brain,
behavior, and immunity 21:9-19.

214

114.

115.

116.

117.

118.

119.

120.

121.

122.

123.

Chinenov, Y., and I. Rogatsky. 2007. Glucocorticoids and the innate
immune system: crosstalk with the toll-like receptor signaling network.
Molecular and cellular endocrinology 275:30-42.

Liberman, A.C., 1. Druker, M.1. Perone, and E. Arzt. 2007. Glucocorticoids
in the regulation of transcription factors that control cytokine
synthesis. cytokine & growth factor reviews 18:45-56.

Ma, W., K. Gee, W. Lim, K. Chambers, ].B. Angel, M. Kozlowski, and A.
Kumar. 2004. Dexamethasone inhibits IL-12p40 production in
lipopolysaccharide-sﬁmulated human monocytic cells by down-
regulating the activity of c-1un N-terminal kinase, the activation
protein-1, and NF-kappa B transcription factors. I Immunol 172:318-
330.

Mogensen, T.H., R.S. Berg, S.R. Paludan, and L. Ostergaard. 2008.
Mechanisms of dexamethasone-mediated inhibition of Toll-like
receptor signaling induced by Neisseria meningitidis and Streptococcus
pneumoniae. Infect Immun 76:189-197.

Vital, A.L., M. Goncalo, M.T. Cruz, A. Figueiredo, C.B. Duarte, and M.C.
Lopes. 2003. Dexamethasone prevents granulocyte-macrophage
colony-stimulating factor-induced nuclear factor-kappaB activation,
inducible nitric oxide synthase expression and nitric oxide production
in a skin dendritic cell line. Mediators of inflammation 12:71-78.

Gessani, S., S. McCandless, and C. Baglioni. 1988. The glucocorticoid
dexamethasone inhibits synthesis of interferon by decreasing the level
of its mRNA. 1 Biol Chem 263:7454-7457.

Smith, S.1., A.M. Piliponsky, F. Rosenhead, U. Elchalal, A. Nagler, and F.
Levi-Schaffer. 2002. Dexamethasone inhibits maturation, cytokine
production and Fe epsilon RI expression of human cord blood-derived
mast cells. Clin Exp Allergy 32:906-913.

Braun, S., C. 1enny, C. Thioudellet, F. Perraud, M.C. Claudepierre, F.
Langle-Rouault, D. Ali-Hadii, K. Schughart, and A. Pavirani. 1999. In
vitro and in vivo effects of glucocorticoids on gene transfer to skeletal
muscle. FEBS letters 454:277-282.

Liu, Y., H.D. Liggitt, 8. Dow, C. Handumrongkul, T.D. Heath, and R1. Debs.
2002. Strain-based genetic differences regulate the efﬁciency of
systemic gene delivery as well as expression. 1 Biol Chem 277:4966-
4972.

Malone, R.W., M.A. Hickman, K. Lehmann-Bruinsma, T.R. Sih, R. Walzem,
D.M. Carlson, and IS. Powell. 1994. Dexamethasone enhancement of

215

 

124.

125.

126.

127.

128.

129.

130.

131.

132.

gene expression after direct hepatic DNA injection. 1 Biol Chem
269:29903-29907.

Boulis, N.M., D.E. Turner, ].A. Dice, V. Bhatia, and EL. Feldman. 1999.
Characterization of adenoviral gene expression in spinal card after
remote vector delivery. Neurosurgery 45:131-137; discussion 13 7-138.

lshimoto, S., K. Kawamoto, T. Stover, S. Kanzaki, T. Yamasoba, and Y.
Raphael. 2003. A glucocorticoid reduces adverse effects of adenovirus
vectors in the cochlea. Audiology & neuro-atalagy 8:70-79.

Otake, K., D.L. Ennist, K. Harrod, and BC. Trapnell. 1998. Nonspeciﬁc
inﬂammation inhibits adenovirus-mediated pulmonary gene transfer
and expression independent of speciﬁc acquired immune responses.
Hum Gene Ther 9:2207-2222.

Kumahara, K., H. Nagata, K. Watanabe, N. Shimizu, Y. Arimoto, K.
lsoyama, Y. Okamoto, and H. Shirasawa. 2005. Suppression of
inﬂammation by dexamethasone prolongs adenoviral vector-mediated
transgene expression in murine nasal mucosa. Acta ata-laryngalagica
125:1301-1306.

Price, A.R., M.P. Limberis, ].M. Wilson, and S.L. Diamond. 2007.
Pulmonary delivery of adenovirus vector formulated with
dexamethasone-spermine facilitates homologous vector re-
administration. Gene Ther 14:1594—1604.

Schiedner, G., W. Bloch, S. Hertel, M. 1ohnston, A. Molojavyi, V. Dries, G.
Varga, N. Van Rooijen, and S. Kochanek. 2003. A hemodynamic response
to intravenous adenovirus vector particles is caused by systemic
Kupffer cell-mediated activation of endothelial cells. Hum Gene Ther
14:1631-1641.

Appledom, D.M., S. Patial, S. Godbehere, N. Parameswaran, and A.
Amalﬁtano. 2009. TRIF, and TRIF-lnteracting TLRs Differentially
Modulate Several Adenovirus Vector-Induced Immune Responses. ] Inn
Imm 1:376-388.

Zhu,1., X. Huang, and Y. Yang. 2007. Type I lFN signaling on both B and
CD4 T cells is required for protective antibody response to adenovirus. ]
Immunol 178:3505-3 510.

Li, Y., D.A. Muruve, R.G. Collins, S.S. Lee, and P. Kubes. 2002. The role of
selectins and integrins in adenovirus vector-induced neutrophil
recruitment to the liver. Eur] Immunol 32:3443-3452.

216

133.

134.

135.

136.

137.

138.

139.

140.

141.

142.

143.

Schiedner, G., S. Hertel, and S. Kochanek. 2000. Efﬁcient transformation
of primary human amniocytes by E1 functions of Ad5: generation of
new cell lines for adenoviral vector production. Hum Gene I'her
11:2105-2116.

Miwa, K., A. Igawa, and H. Inoue. 1997. Soluble E-selectin, ICAM-1 and
VCAM-l levels in systemic and coronary circulation in patients with
variant angina. Cardiovasc Res 36:37-44.

Manickan, E., 1.8. Smith, 1. Tian, T.L. Eggerman, 1.N. Lozier, 1. Muller, and
A.P. Byrnes. 2006. Rapid Kupffer cell death after intravenous injection
of adenovirus vectors. Mal Ther 13:108-117.

Cotter, M.1., A.K. Zaiss, and D.A. Muruve. 2005. Neutrophils interact with
adenovirus vectors via Fc receptors and complement receptor 1. 1 Viral
79:14622-14631.

Hu, H., D. Serra, and A. Amalﬁtano. 1999. Persistence of an [E1-,
polymerase-1 adenovirus vector despite transduction of a neoantigen
into immune-competent mice. Hum Gene Ther 10:355-364.

Everett, R.S., B.L. Hodges, E.Y. Ding, F. Xu, D. Serra, and A. Amalﬁtano.
2003. Liver toxicities typically induced by ﬁrst-generation adenoviral
vectors can be reduced by use of E1, E2b-deleted adenoviral vectors.
Hum Gene Ther 14:1715-1726.

Zinn, K.R., A.]. Szalai, A. Stargel, V. Krasnykh, and TR Chaudhuri. 2004.
Bioluminescence imaging reveals a signiﬁcant role for complement in
liver transduction following intravenous delivery of adenovirus. Gene
Ther 11:1482-1486.

Hawlisch, H., and 1. Kohl. 2006. Complement and Toll-like receptors: key
regulators of adaptive immune responses. Molecular immunology
43:13-21.

Carroll, M. 1999. Role of complement receptors CD21/CD35 in B
lymphocyte activation and survival. Current topics in microbiology and
immunology 246:63-68; discussion 69.

Sato, S., A.S. Miller, M.C. Howard, and T.F. Tedder. 1997. Regulation of B
lymphocyte development and activation by the CD19/CD21/CD81/Leu
13 complex requires the cytoplasmic domain of CD19. ] Immunol
159:3278-3287.

Miwa, T., and W.C. Song. 2001. Membrane complement regulatory

proteins: insight from animal studies and relevance to human diseases.
lntemational immunapharmacalagy 1:445-459.

217

 

144.

145.

146.

147.

148.

149.

150.

151.

152.

153.

154.

Miwa, T., L. Zhou, R. Tudoran, ].D. Lambris. M.P. Madaio, M. Nangaku, H.
Molina, and W.C. Song. 2007. DAF/Crry double deﬁciency in mice
exacerbates nephrotoxic serum-induced proteinuria despite markedly
reduced systemic complement activity. Molecular immunology 44:139-
146.

Turnberg, D., and M. Botto. 2003. The regulation of the complement
system: insights from genetically-engineered mice. Molecular
immunology 40:145-153.

Tian,]., Z. Xu, 1.S. Smith, S.E. Hoﬂrerr, M.A. Barry, and A.P. Byrnes. 2009.
Adenovirus activates complement by distinctly different mechanisms in
vitro and in vivo: indirect complement activation by virions in vivo. ]
Viral .

Croyle, M.A., N. Chirmule, Y. Zhang, and ].M. Wilson. 2001. ”Stealth"
adenoviruses blunt cell-mediated and humoral immune responses
against the virus and allow for signiﬁcant gene expression upon
readministration in the lung. 1 Viral 75:4792-4801.

Ricklin, D., and ].D. Lambris. 2008. Compstatin: a complement inhibitor
on its way to clinical application. Advances in experimental medicine and
biology 632:273-292.

Green, T.D., B.R. Newton, P.A. Rota, Y. Xu, H.L. Robinson, and TM. Ross.
2001. C3d enhancement of neutralizing antibodies to measles
hemagglutinin. Vaccine 20:242-248.

Ross, T.M., Y. Xu, R.A. Bright, and H.L. Robinson. 2000. C3d enhancement
of antibodies to hemagglutinin accelerates protection against inﬂuenza
virus challenge. Nature immunology 1:12 7-13 1.

Draper, 5.1., A.C. Moore, A.L. Goodman, C.A. Long, A.A. Holder, S.C.
Gilbert, F. Hill, and AN. Hill. 2008. Effective induction of high-titer
antibodies by viral vector vaccines. Nat Med 14:819-821.

Ogun, S.A., L. Dumon-Seignovert1.B. Marchand, A.A. Holder, and F. Hill.
2008. The oligomerization domain of C4-binding protein (C4bp) acts as
an adjuvant, and the fusion protein comprised of the 19-kilodalton
merozoite surface protein 1 fused with the murine C4bp domain
protects mice against malaria. Infect Immun 76:3817-3823.

Ricklin, D., and ].D. Lambris. 2007. Complement-targeted therapeutics.
Nat Biotechnol 25:1265-12 7 5.

Muruve, D.A. 2004. The innate immune response to adenovirus vectors.
Hum Gene Ther 15:1157-1166.

218

155.

156.

157.

158.

159.

160.

161.

162.

163.

164.

165.

Sahu, A., B.K. Kay, and ].D. Lambris. 1996. Inhibition of human
complement by a C3-binding peptide isolated from a phage-displayed
random peptide library. ] Im‘munal 157:884-891.

Mallik, B., M. Katragadda, L.A. Spruce, C. Caraﬁdes, C.G. Tsokos, D.
Morikis, and ].D. Lambris. 2005. Design and NMR characterization of
active analogues of compstatin containing non-natural amino acids.
journal of medicinal chemistry 48:2 74-2 86.

Sahu, A., D. Morikis, and ].D. Lambris. 2003. Compstatin, a peptide
inhibitor of complement, exhibits species-speciﬁc binding to
complement component C3. Molecular immunology 39:557-566.

Yeatman, M., C.W. Daggett, C.L. Lau, G.W. Byrne, 1.8. Logan, 1.L. Platt, and
RD. Davis. 1999. Human complement regulatory proteins protect swine
lungs from xenogeneic injury. Ann Thorac Surg 67:769-775.

Maelandsmo, G.M., P.1. Ross, M. Pavliv, R.A. Meulenbroek, C. Evelegh,
D.A. Muruve, F.L. Graham, and R1. Parks. 2005. Use of a murine secreted

alkaline phosphatase as a non-immunogenic reporter gene in mice. 1
Gene Med 7:307-315.

Van Linthout, S., M. Lusky, D. Collen, and B. De Geest. 2002. Persistent
hepatic expression of human apo A-l after transfer with a helper-virus
independent adenoviral vector. Gene Ther 9:152 0-1528.

Mathis, ].M., M.A. Stoff-lﬂralili, and D.T. Curiel. 2005. Oncolytic
adenoviruses - selective retargeting to tumor cells. Oncogene 24:7775-
7791.

Stone, D., Y. Liu, Z.Y. Li, S. Tuve, R. Strauss, and A. Lieber. 2007.
Comparison of adenoviruses from species B, C, e, and f after intravenous
delivery. Mal Ther 15:2146-2153.

Hartman, Z.C., D.M. Appledom, D. Serra, 0. Glass, T.B. Mendelson, T.M.
Clay, and A. Amalﬁtano. 2008. Replication-attenuated Human
Adenoviral Type 4 vectors elicit capsid dependent enhanced innate
immune responses that are partially dependent upon interactions with
the complement system. Virology 374:453-467.

Kuzmin, A.l., M.1. Finegold, and RC. Eisensmith. 1997. Macrophage
depletion increases the safety, efﬁcacy and persistence of adenovirus-
mediated gene transfer in vivo. Gene Ther 4:309-316.

Kay, M.A., L. Meuse, A.M. Gown, P. Linsley, D. Hollenbaugh, A. Aruffo, H.D.
Ochs, and CB. Wilson. 1997. Transient immunomodulation with anti-
CD40 ligand antibody and CTLA4lg enhances persistence and secondary

219

166.

167.

168.

169.

170.

171.

172.

173.

adenovirus-mediated gene transfer into mouse liver. Proc Natl Acad Sci
U SA 94:4686-4691.

Kuriyama, S., K. Tominaga, A. Mitoro, H. Tsujinoue, T. Nakatani, M.
Yamazaki, S. Nagao, Y. Toyokawa, S. Okamoto, and H. Fukui. 2000.
lmmunomodulation with FK506 around the time of intravenous re-
administration of an adenoviral vector facilitates gene transfer into
primed rat liver. lntemational journal of cancer 85:83 9-844.

Song, M.Y., S.K. Park, C.S. Kim, T.H. Yoo, B. Kim, M.S. Kim, Y.S. Kim, W.].
Kwag, B.K. Lee, and K. Baek. 2008. Characterization of a novel anti-
human TNF-alpha murine monoclonal antibody with high binding
afﬁnity and neutralizing activity. Experimental & molecular medicine
40:35-42.

Ho, P.P., P. Fontoura, M. Platten, R.A. Sobel, 1.1. DeVoss, L.Y. Lee, B.A.
Kidd, B.H. Tomooka, 1. Capers, A. Agrawal, R. Gupta, 1. Zernik, M.K. Yee,
B.1. Lee, H. Garren, W.H. Robinson, and L. Steinman. 2005. A suppressive
oligodeoxynucleotide enhances the efﬁcacy of myelin cocktail/lL-4-
tolerizing DNA vaccination and treats autoimmune disease. 1 Immunol
175:6226-6234.

Ren, L., ].B. Blanchette, L.R. White, S.A. Clark, D.]. Heffner, LA. Tibbles,
and D.A. Muruve. 2005. Soluble ﬁbronectin induces chemokine gene

expression in renal tubular epithelial cells. Kidney international
68:2111-2120.

Brunetti-Pierri, N., G.E. Stapleton, D.1. Palmer, Y. Zuo, V.P. Mane, M.1.
Finegold, A.L. Beaudet, M.M. Leland, C.E. Mullins, and P. Ng. 2007.
Pseudo-hydrodynamic delivery of helper-dependent adenoviral vectors
into non-human primates for liver-directed gene therapy. Mal Ther
15:732-740.

Shayakhmetov, D.M., Z.Y. Li, S. Ni, and A. Lieber. 2004. Analysis of
adenovirus sequestration in the liver, transduction of hepatic cells, and
innate toxicity after injection of ﬁber-modiﬁed vectors. 1 Viral 78:5368-
5381.

Shayakhmetov, D.M., A.M. Eberly, Z.Y. Li, and A. Lieber. 2005. Deletion of
penton RGD motifs affects the efﬁciency of both the internalization and

the endosome escape of viral particles containing adenovirus serotype
5 or 35 ﬁber knobs. ] Viral 79:1053-1061.

Barnes, P.1. 1998. Anti-inﬂammatory actions of glucocorticoids:
molecular mechanisms. Clin Sci (Land) 94:557-572.

220

174.

175.

176.

177.

178.

179.

180.

181.

182.

183.

Huang, H.W., W. Bi, G.N. 1enkins, and 1.L. Alcorn. 2008. Glucocorticoid
regulation of human pulmonary surfactant protein-B mRNA stability
involves the 3'-untranslated region. American journal of respiratory cell
and molecular biology 38:47 3-482.

Schnell, M.A., Y. Zhang, 1. Tazelaar, G.P. Gao, Q.C. Yu, R. Qian, 8.]. Chen,
A.N. Varnavski, C. LeClair, S.E. Raper, and ].M. Wilson. 2001. Activation
of innate immunity in nonhuman primates following intraportal
administration of adenoviral vectors. Mal Ther 3:708-722.

Miller, T.A., and F.W. Schaefer, 3rd. 2007. Changes in mouse circulating
leukocyte numbers in C57BL/6 mice immunosuppressed with
dexamethasone for Cryptosporidium parvum oocyst production.
Veterinary parasitalagy 149:147-157.

1eklova, E., L. Leva, Z. ]aglic, and M. Faldyna. 2008. Dexamethasone-
induced immunosuppression: a rabbit model. Veterinary immunology
and immunapathalagy 122:231-240.

Anderson, B.H., D.L. Watson, and LG. Colditz. 1999. The effect of
dexamethasone on some immunological parameters in cattle.
Veterinary research communications 23:399-413.

Lieber, A., C.Y. He, L. Meuse, D. Schowalter, l. Kirillova, B. Winther, and
M.A. Kay. 1997. The role of Kupffer cell activation and viral gene
expression in early liver toxicity after infusion of recombinant
adenovirus vectors. 1 Viral 71:8798-8807.

Stone, D., Y. Liu, D. Shayakhmetov, Z.Y. Li, S. Ni, and A. Lieber. 2007 .
Adenovirus-platelet interaction in blood causes virus sequestration to
the reticuloendothelial system of the liver. 1 Viral 81:4866-4871.

Franchimont, D., 1. Galon, M. Gadina, R. Visconti, Y. Zhou, M. Aringer,
D.M. Frucht, G.P. Chrousos, and 1.1. O'Shea. 2000. Inhibition of Th1
immune response by glucocorticoids: dexamethasone selectively
inhibits IL-12-induced Stat4 phosphorylation in T lymphocytes. 1
Immunol 164:1768-1774.

Ramirez, F., D.]. Fowell, M. Puklavec, S. Simmonds, and D. Mason. 1996.
Glucocorticoids promote a TH2 cytokine response by CD4+ T cells in
vitro. ] Immunol 156:2406-2412.

Olive, M., L. Eisenlohr, N. Flomenberg, S. Hsu, and P. Flomenberg. 2002.
The adenovirus capsid protein hexon contains a highly conserved
human CD4+ T-cell epitope. Hum Gene Ther 13:1167-1178.

221

184.

185.

186.

187.

188.

189.

190.

191.

192.

193.

Sumida, S.M., D.M. Truitt, A.A. Lemckert, R. Vogels, ].H. Custers, M.M.
Adda, S. Lockman, T. Peter, F.W. Peyerl, M.G. Kishko, S.S. 1ackson, D.A.
Gorgone, M.A. Lifton, M. Essex, B.D. Walker, 1. Goudsmit, M.1. Havenga,
and D.H. Barouch. 2005. Neutralizing antibodies to adenovirus serotype
5 vaccine vectors are directed primarily against the adenovirus hexon
protein. j Immunol 174:7179-7185.

Hodges, B.L., H.K. Evans, R.S. Everett, E.Y. Ding, D. Serra, and A.
Amalﬁtano. 2001. Adenovirus vectors with the 100K gene deleted and

their potential for multiple gene therapy applications. 1 Viral 75:5913-
5920.

Hodges, B.L., D. Serra, H. Hu, C.A. Begy, 1.5. Chamberlain, and A.
Amalﬁtano. 2000. Multiply deleted [E1, polymerase-, and pTP-]
adenovirus vector persists despite deletion of the preterminal protein. j
Gene Med 2:2 50-2 59.

Dietzman, R.H., R.A. Ersek, ].M. Bloch, and RC. Lillehei. 1969. High-
output, low-resistance gram-negative septic shock in man. Angialagy
20:691-700.

Lefering, R., and EA. Neugebauer. 1995. Steroid controversy in sepsis
and septic shock: a meta-analysis. Critical care medicine 23:12 94-1303.

Oaks, W.W., and H.B. Cohen. 1967. Endotoxin shock in the geriatric
patient. Geriatrics 22:120-130.

Wang, X.Q., X. Zhou, Y. Zhou, L. Rang, L. Gao, and W. Xu. 2008. Low-dose
dexamethasone alleviates lipopolysaccharide-induced acute lung injury
in rats and upregulates pulmonary glucocorticoid receptors.
Respirolagy (Carlton, Vic

Zhou, Y., EA. Ling, and S.T. Dheen. 2007. Dexamethasone suppresses
monocyte chemoattractant protein-1 production via mitogen activated
protein kinase phosphatase-1 dependent inhibition of 1un N-terminal
kinase and p38 mitogen-activated protein kinase in activated rat
microglia. journal of neurachemistry 102:667-678.

Lee, C.W., ].H. Chuang, P.W. Wang, N.K. Chang, H.C. Wang, CC. Huang,
M.M. Tiao, and S.K. Lo. 2006. Effect of glucocorticoid pretreatment on

oxidative liver injury and survival in jaundiced rats with endotoxin
cholangitis. Warldjaumal of surgery 30:2217-2226.

Hafner, D., and P.G. Germann. 1999. Dexamethasone enhances the
activity of rSP-C surfactant but not of exosurf in a rat model of the acute
lung injury. journal of pharmacological and toxicological methods 42:39-
48.

222

 

194.

195.

196.

197.

198.

199.

200.

201.

202.

203.

204.

Schiedner, G., S. Hertel, M. ]ohnston, V. Dries, N. van Rooijen, and S.
Kochanek. 2003. Selective depletion or blockade of Kupffer cells leads
to enhanced and prolonged hepatic transgene expression using high-
capacity adenoviral vectors. Mal Ther 7:35-43.

Zsengeller, 2., K. Otake, S.A. Hossain, P.Y. Berclaz, and B.C. Trapnell.
2000. lntemalization of adenovirus by alveolar macrophages initiates
early proinﬂammatory signaling during acute respiratory tract
infection. j Viral 74:9655-9667.

Tao, N., G.P. Gao, M. Parr, 1. ]ohnston, T. Baradet, ].M. Wilson, 1. Barsoum,
and S.E. Fawell. 2001. Sequestration of adenoviral vector by Kupffer
cells leads to a nonlinear dose response of transduction in liver. Mal
Ther 3:28-35.

Everett, R.S., H.K. Evans, B.L. Hodges, E.Y. Ding, D.M. Serra, and A.
Amalﬁtano. 2004. Strain-speciﬁc rate of shutdown of CMV enhancer
activity in murine liver conﬁrmed by use of persistent [E1(-), E2b(-)]
adenoviral vectors. Virology 32 5:96-105.

Cross, S.L., . IN.F. Halden, M.1. Lenardo, and w.]. Leonard. 1989.
Functionally distinct NF-kappa B binding sites in the immunoglobulin

kappa and lL-2 receptor alpha chain genes. Science 244:466-469.

Yang, T.C., ].B. Millar, N. Grinshtein, 1. Bassett, 1. Finn, and 1.L. Bramson.
2007. T-cell immunity generated by recombinant adenovirus vaccines.
Expert review of vaccines 6:347 -3 56.

He, T.C., S. Zhou, L.T. da Costa, 1. Yu, K.W. Kinzler, and B. Vogelstein.
1998. A simpliﬁed system for generating recombinant adenoviruses.
PracNatlAcad Sci U S A 95:2509-2514.

Fontana, L., M. Nuzzo, L. Urbanelli, and P. Monaci. 2003. General
strategy for broadening adenovirus tropism. j Viral 77:11094—11104.

Ng. P., and F.L. Graham. 2002. Construction of ﬁrst-generation
adenoviral vectors. Methods in molecular medicine 69:389-414.

Sargent, K.L., P. Ng. C. Evelegh, F.L. Graham, and R1. Parks. 2004.
Development of a size-restricted pix-deleted helper virus for
ampliﬁcation of helper-dependent adenovirus vectors. Gene 'l'her
11:504-511.

Colby, W.W., and T. Shenk. 1981. Adenovirus type 5 virions can be
assembled in vivo in the absence of detectable polypeptide IX. j Viral
39:977-980.

223

205.

206.

207.

208.

209.

210.

211.

212.

213.

214.

Gommerman, 1.L., D.Y. Oh, X. Zhou, T.F. Tedder, M. Maurer, S.1. Galli, and
M.C. Carroll. 2000. A role for CDZ 1/CD35 and CD19 in responses to
acute septic peritonitis: a potential mechanism for mast cell activation.
1 Immunol 165:6915-6921.

Rajagopal, K., E.1. Whalen, ].D. Violin, ].A. Stiber, P.B. Rosenberg, R.T.
Premont, T.M. Coffrnan, H.A. Rockman, and RJ. Leﬂtowitz. 2006. Beta-
arrestinZ-mediated inotropic effects of the angiotensin II type 1A
receptor in isolated cardiac myocytes. Proc Natl Acad Sci U S A
103:16284-16289.

Higginbotham, 1.N., P. Seth, R.M. Blaese, and W1. Ramsey. 2002. The
release of inﬂammatory cytokines from human peripheral blood

mononuclear cells in vitro following exposure to adenovirus variants
and capsid. Hum Gene Ther 13:129-141.

Hofstetter, 1.R., A. Zhang, A.R. Mayeda, T. Guscar,1.l. Nurnberger, ]r., and
D.K. Lahiri. 1997. Genomic DNA from mice: a comparison of recovery

methods and tissue sources. Biochemical and molecular medicine
62:197-202.

Hensley, S.E., A.S. Cun, W. Giles-Davis, Y. Li, Z. Xiang, M.O. Lasaro, B.R.
Williams, R.H. Silverman, and H.C. Ertl. 2007. Type I interferon inhibits
antibody responses induced by a chimpanzee adenovirus vector. Mal
Ther 15:393-403.

Loniewski, K.1., S. Patial, and N. Parameswaran. 2007. Sensitivity of
TLR4- and -7-induced NF kappa Bl p105-TPL2-ERK pathway to TNF-
receptor-associated-factor-6 revealed by RNAi in mouse macrophages.
Molecular immunology 44:37 15-3 723.

1ia, Q., H.R. Zhou, Y. Shi, and 1.1. Pestka. 2006. Docosahexaenoic acid
consumption inhibits deoxynivalenol-induced CREB/ATFI activation
and lL-6 gene transcription in mouse macrophages. The journal of
nutrition 136:366-372.

Loniewski, K., Y. Shi, 1. Pestka, and N. Parameswaran. 2008. Toll-like
receptors differentially regulate GPCR kinases and arrestins in primary
macrophages. Molecular immunology 45:23 12-2322.

Farina, S.E., G.P. Gao, Z.Q. Xiang, 1.]. Rux, R.M. Burnett, M.R. Alvira, 1.
Marsh, H.C. Ertl, and ].M. Wilson. 2001. Replication-defective vector
based on a chimpanzee adenovirus. 1 Viral 75:11603-11613.

Lemckert, A.A., S.M. Sumida, L. Holterman, R. Vogels, D.M. Truitt, D.M.
Lynch, A. Nanda, B.A. Ewald, D.A. Gorgone, M.A. Lifton, 1. Goudsmit, M.1.
Havenga, and D.H. Barouch. 2005. Immunogenicity of heterologous

224

 

215.

216.

217.

218.

219.

prime-boost regimens involving recombinant adenovirus serotype 11
(Adll) and Ad35 vaccine vectors in the presence of anti-ads immunity.
1 Viral 79:9694-9701.

Liu, 1., K.L. O'Brien, D.M. Lynch, N.L. Simmons, A. La Porte, A.M. Riggs, P.
Abbink, R.T. Coffey, L.E. Grandpre, M.S. Seaman, G. Landucci, D.N.
Forthal, D.C. Monteﬁori, A. Carville, K.G. Mansﬁeld, M.1. Havenga, M.G.
Pau, 1. Goudsmit, and D.H. Barouch. 2009. Immune control of an SIV
challenge by a T-cell-based vaccine in rhesus monkeys. Nature 457:87-
91.

Gao, H., Y. Sun, Y. Wu, B. Luan, Y. Wang, B. Qu, and G. Pei. 2004.
Identiﬁcation of beta-arrestin2 as a G protein-coupled receptor-
stimulated regulator of NF-kappaB pathways. Molecular cell 14:303-
317.

Di Paolo, N.C., E.A. Miao, Y. Iwakura, K. MuraIi-Krishna, A. Aderem, R.A.
Flavell, T. Papayannopoulou, and D.M. Shayakhmetov. 2009. Virus
binding to a plasma membrane receptor triggers interleukin-1 alpha-

mediated proinﬂammatory macrophage response in viva. Immunity
31:110-121.

Smith, 1.G., and G.R. Nemerow. 2008. Mechanism of adenovirus
neutralization by Human alpha-defensins. Cell Host Microbe 3:11-19.

Maser, B., and K. Willimann. 2004. Chemokines: role in inﬂammation
and immune surveillance. Annals of the rheumatic diseases 63 Suppl
2:ii84-ii89.

225