HIWHIWI

t

 
 

\IMIINUHW“WNWIUIHIWHIH

 

W's ear-2..“ FiY

i Meir: .2... State

:hi"? Us .iv :3r55 ty

 

 

 

This is to certify that the
thesis entitled

— -...---~-----.‘

THE DEVELOPMENT OF A NUCLEIC ACID-BASED
METHOD FOR ASSESSING THE AGE OF BLOODSTAINS

presented by

RACHEL LYNN AIKMAN

has been accepted towards fulfillment
of the requirements for the

MS. degree in Forensic Science

 

 

”V.

r,"

major Professor's Signature ,

3// 9//©

Date

MSU is an Affinnative Action/Equal Opportunity Employer

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5/08 KzlProj/Aoc8PresIClRC/Dateoue.indd

 

THE DEVELOPMENT OF A NUCLEIC ACID-BASED METHOD FOR ASSESSING
THE AGE OF BLOODSTAIN S

By

Rachel Lynn Aikman

A THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTERS OF SCIENCE
Forensic Science

2010

ABSTRACT
THE DEVELOPMENT OF A NUCLEIC ACID-BASED METHOD FOR ASSESSING
THE AGE OF BLOODSTAINS
By

Rachel Lynn Aikman

The ability to determine exactly when a crime occurred would be of great benefit to
investigators. A method to age biological evidence would also provide information
regarding a variety of crimes. The potential of using RNA degradation as a tool for aging
forensic biological evidence was investigated in the current study. A variety of mRNAs,
tRNAs, and rRNA from bloodstains aged up to five years were assayed using real-time
PCR to discern whether their quantities related to sample age. It was hypothesized that
the RNAs would undergo differential degradation based on their structural and functional
variability. 18S rRNA and valine tRNA displayed a non-linear relationship over 250
days. it is likely that the rRNA was relatively stable and that the tRNA was undergoing
variable degradation throughout the period investigated. Negative results were obtained
for B-actin, cyclophilin D, and GAPD mRNAs and serine and alanine tRNAs. While
currently limited in its forensic utility, an aging method based on RNA degradation has

the potential to establish probative value for a variety of biological evidence.

ACKNOWLEDGMENTS

I would like to gratefully acknowledge the supervision of Dr. David Foran throughout
the course of my research. Without his help this thesis would not have been possible. I
would also like to thank my committee members, Drs. Steven Dow and R. William
Henry, for their assistance.

I received technical advice from many people during this project. I wish to
acknowledge Dr. Jeff Landgraf at the MSU Research Technology Support Facility, Dr.
Aaron Tarone at the University of Southern California, Dr. Ashley Heath at Sigma
Custom Products, and Derek N ajarian at Bio-Rad Laboratories for their help with my
unusual data.

I thank the MSU Graduate School, the School of Criminal Justice, and the Biological
Sciences Program for their financial assistance.

Finally, lam grateful to my fellow graduate students, friends, and most of all, my

family for their support and endless encouragement during the past few years.

iii

TABLE OF CONTENTS

LIST OF TABLES .................................................................................... v
LIST OF FIGURES .................................................................................. vi
INTRODUCTION ..................................................................................... 1
Genetic Material as Evidence .............................................................. 1
Structural and Functional Differences in RNA Molecules ............................. 3
Messenger RNA ..................................................................... 3
Transfer RNA ........................................................................ 4
Ribosomal RNA ..................................................................... 6
The Polymerase Chain Reaction ............................................................ 7
Previous Research Involving RNA Degradation in Biological Samples ............ 11
Current Work Aging Bloodstains Using RNA Degradation ......................... l3
METHODS .......................................................................................... 14
Blood Sample Collection .................................................................. l4
Selection of RNA Targets ................................................................. 14
Isolation of RNA ........................................................................... 17
DNase I Treatment ......................................................................... 20
Reverse Transcription ..................................................................... 21
PCR ........................................................................................... 21
Real-time PCR .............................................................................. 22
RESULTS ............................................................................................ 24
DISCUSSION ........................................................................................ 34
Conclusions .................................................................................. 43
REFERENCES ...................................................................................... 45

iv

LIST OF TABLES

Table 1: Primer sequences and amplicon sizes for the RNA targets of interest ............ 16

Table 2: TaqMan® probe sequences and fluorophores for the RNA targets of interest... 17

Table 3: Optimal primer and probe concentrations for each of the RNA targets .......... 23

Table 4: CT values for each RNA target in individual and duplex reactions. . . . . . . ...2.....6

LIST OF FIGURES

Images in this thesis are presented in color.

Figure 1: The structure of an mRNA molecule .................................................. 3
Figure 2: The general structure of a tRN A molecule ............................................ 5
Figure 3: The ribosome assembled on an mRN A ................................................ 6
Figure 4: The three-step process of PCR .......................................................... 8
Figure 5: The TaqMan® real-time PCR reaction ................................................ 9

Figure 6: A series of real-time PCR amplification curves depicting the exponential and
plateau phases ....................................................................................... 10

Figure 7: The location of the custom primers and probes designed for the tRNA

molecules ............................................................................................. 15
Figure 8: A 4% agarose gel displaying the control DNA PCR products .................... 24
Figure 9: Logarithmic real-time amplification curves representing control DNA
amplification ......................................................................................... 25
Figure 10: Multiple 4% agarose gels displaying cDNA PCR products ..................... 27
Figure 11: Logarithmic duplex real-time PCR of 188 and tRNAval from bloodstain
cDNAs of differing ages ........................................................................... 29
Figure 12: A curve representing the mean CT ratio of 188 to tRNAval over time. . . . . ....30

Figure 13: Logarithmic real-time PCR amplification curves for B-actin, cyclophilin D,
GAPD and tRNASer duplexed with 18S ......................................................... 31

Figure 14: Logarithmic real-time PCR amplification curves for ISS rRNA using cDNA
templates from 0.5 or 1 mL of fresh blood ...................................................... 32

Figure 15: Logarithmic real-time PCR amplification curves for duplex B-actin and 188
using cDNA templates from 0.5 and 1 mL of fresh blood ..................................... 33

vi

INTRODUCTION
Determining exactly when a crime occurred is often one of the most important aspects
of a forensic investigation, since it impacts alibis, the witness pool, and other relevant
information. In addition, temporal analysis of crime is important to law enforcement
agencies seeking to establish patterns behind regional criminal activity. “Crime
mapping” has been championed as a method to determine the most effective allocation of
law enforcement resources. Such analyses identify trends within geographic locations,
selection of victims, and times at which crime occurs (Eck et al., 2005). Despite its
importance, however, temporal evidence is difficult to obtain, since many crimes do not
leave a signature time trail (Ratcliffe, 2002). For example, the victim is often absent
during a burglary. Unless a time-stamped video surveillance system is available to record
the theft, all that is known is that the crime occurred while the victim was gone. This is
especially problematic when a home or business is unattended for consecutive hours or
days. Even a witness does not guarantee temporal accuracy; for instance, victims of an
assault are susceptible to distorted or selective memories caused by the trauma (Ochberg,
2002).
Genetic Material as Evidence
Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are found in all biological
fluids. DNA is a valuable form of evidence that is currently used to identify an
individual or link a suspect to a crime scene, and has been extracted from sources as
diverse as contact lenses, cigarette butts, and bite marks in cheese (reviewed by
Wickenheiser, 2002). RNA has had less forensic utility, but assays of RNA levels have

increased the accuracy of insect age prediction and estimation of the postmortem interval

(PMI) (Tarone et al., 2007). These entomological assays highlight the potential of
nucleic acids as temporal indicators; however, no method exists for aging other forensic
biological evidence. A method to age bodily fluids would provide information regarding
a variety of crimes. For example, blood left by a burglar would aid in timing when the
break-in occurred. More importantly, determining time of stain deposition might
establish whether evidence has probative value.

DNA is a relatively Stable molecule that is able to withstand both time and extreme
environmental stress (Kobilinsky, 1992; Weedn and Roby, 1993). For instance, DNA has
been successfully extracted from deflagrated pipe bombs and from bones as old as 30,000
years (Foran et al., 2009; Hofreiter etal., 2001, respectively). This stability means that
DNA is not particularly useful as a temporal market. On the other hand, RNA is less
stable (Wang and Koo], 1995), and thus has the potential to provide forensically-relevant
temporal information to an investigation. Different types of RNA molecules, including
messenger RNA (mRN A), transfer RNA (tRNA), and ribosomal RNA (rRNA) have
varying stabilities resulting from their unique cellular functions. Abelson et al. (1974)
radioactively labeled total cellular mRNA, tRN A, and rRNA in resting and growing cells
in order to compare their turnover. In both cellular states, they found that mRNA half—
life was 9 hours, tRNA half-life was 36 hours, and 18S rRNA half-life was 72 hours.
Based on these findings, if rates of decay were established for RNA targets, it may be

possible to correlate their relative quantities in biological samples with the aging process.

Structural and Functional Differences in RNA Molecules
Messenger RNA
During transcription, an RNA polymerase is directed to a gene and a complementary
mRNA molecule is synthesized (Figure 1). The transcript is then both enzymatically and
chemically modified in order to remove non-coding sequences and promote protein
production. On the 5’ end, a methylated guanine nucleotide “cap” is added in order to
recruit the protein-building machinery, the ribosome, to the mRN A. In addition, the 3’

end is polyadenylated, which improves translational efficiency (W ilusz et al., 2001).

 

 

 

 

5' cep Coding eequence 3' Poly(A) tell
r-l—u r l . .——|——.
CE 3 --~ww~n

‘-r-‘ ‘ r J
5' UTR 3' UTR

Figure 1: The structure of an mRNA molecule, including the 5’ methyl-guanine cap, the 5’
untranslated region (UTR), the protein coding sequence, the 3’ UTR, and the 3’ poly(A) tail.

Cellular degradation pathways for mRN A can be simplified into “three basic steps:
removal of the poly(A) tail, cleavage of the 5’ cap, and degradation from the 5’ end
(Houseley and Tollervey, 2009). In vivo, this response can be both positively and
negatively impacted by a variety of stimuli. For example, Herruer et al. (1988) reported
that a temperature shift from 23 to 36°C caused a rapid, 85% decline in yeast ribosomal
protein mRNAs. mRN A degradation has also been shown to be inhibited when yeast
cells were subjected to starvation or osmotic stress (Jona et al., 2000; Greatrix and van
Vuuren, 2006). In HeLa cells, exposure to ultraviolet light stabilized mRNA by

preventing poly(A) tail removal (Gowrishankar et al., 2005). In addition, Sahmi et al.

(2006) found that mRN A levels in bovine ovarian cells were under direct hormonal
regulation.

In human cells, mRNA stability controls protein production for 5 to 10% of genes
(reviewed by Bolognani and Perrone-Bizzozero, 2008). The average half-life for a
mammalian mRNA is 7 hours, although it may be less than an hour for regulatory protein
mRNAs (such as transcription factors) or over 24 hours for those important in structure
and metabolism (e. g. cytoskeletal and housekeeping proteins) (Sharova et al., 2009).
Transfer RNA

Transfer RNAS act as carriers for amino acids during protein production. All tRNA
molecules display a cloverleaf shape and contain five main “loops” (Figure 2). The
anticodon loop base-pairs with a specific three-base sequence on an mRN A, the codon.
On the opposite side of the molecule is an acceptor arm that binds an amino acid. The
other loops in the tRNA are responsible for stabilizing the three-dimensional L-shaped

structure of the molecule (de Pouplana and Schimmel, 2001).

 

 

 

 

 

 

Figure 2: The general structure of a tRNA molecule, including the acceptor arm, anticodon loop,
and anticodon. Figure is from Mathews et al. (2000).

tRNAs are relatively stable molecules due to their three-dimensional structure (Puglisi
et al, 2003). In addition, post-transcriptional modifications to their nucleotides aid in
their integrity (Engelke and Hopper, 2006). Yeast mutants lacking enzymes necessary to
catalyze such modifications displayed cellular growth defects and tRN A half-lives similar
to those of mRNAs (Alexandrov et al., 2006). Half lives differ greatly among tissues and
are impacted by growth and development (Johnson et al., 1974). In mammalian cells,
tRNA turnover ranges from 36 to 120 hours (Schlegel et al., 1978). While pathways
responsible for tRNA degradation are still largely uncharacterized, data suggest that
multiple independent pathways are involved in this regulation (Kadaba et al., 2004;

Alexandrov et al., 2006).

Ribosomal RNA

The final step of protein production occurs in the ribosome, which consists of two
subunits that assemble on an mRNA (Figure 3). These scan along the transcript in a 5’ to
3’ direction until a start codon is reached, at which point the peptidyl-transferase
reactions involving tRNAs are initiated. rRNA plays a key role during this process, since
it binds both the codon of the mRN A and the anticodon of the tRNA (Graifer et al.,

2004).

 
 
  

Growing
Protein Chain

Figure 3: The ribosome assembled on an mRNA. rRNA is not depicted; however it is the
component of the ribosome that physically links the mRNA and tRNA molecules. Figure is
adapted from Davis (2005).

tRNAs are stable molecules, since they are shielded within a large complex consisting
of the ribosomal subunits and a variety of additional binding proteins, initiation factors,
and elongation factors (Merryman et al., 1999). It has been hypothesized that regions of
these proteins that extend into the core stabilize the rRNAs by protecting their negatively-

charged backbones (reviewed by Noller, 1991). rRNAs are perhaps most vulnerable to

degradation directly after their synthesis, prior to the formation of the ribosomal complex.
However, in a study of yeast rRN A, Deshmukh et al. (1993) found that ribosomal
protein-RNA interactions following rRNA synthesis provided at least some level of
protection even in the absence of ribosomal assembly.
The Polymerase Chain Reaction

Nucleic acids can be quantified using a variation of the polymerase chain reaction
(PCR). In its most basic form, PCR is a technique that targets a specific region of DNA
and exponentially replicates it (Figure 4). First, the double-stranded DNA is heated and
separated into single strands. Then, two short oligonucleotide primers, included in the
reaction, anneal to their complementary sequence on either side of the DNA to be
replicated. The primers act as a starting point for extension by a DNA polymerase during
the third step, where the complementary DNA strand is synthesized. This process is
repeated multiple times, resulting in the creation of billions of copies of the target
sequence during a single reaction (Saiki et al., 1988). During PCR, there are three phases
that occur based on the kinetics of the reaction (Bloch, 1991). In the exponential phase,
product formation is highly favorable and the amount of product is doubled each cycle.
The linear phase occurs when reagents limit the reaction and rate of synthesis slows.
Finally, amplification stops completely and a plateau is reached. With standard PCR,
products are detected following the plateau phase. As a result, the final amount of

product is not directly related to the initial DNA concentration.

5'liltillrrtrlllllllllllg

3.
Step 1 194°C

 

 

 

 

 

Step 2 15055°c
_-
_
Step 3 l 72 °C

 

‘ ,1 LA:-

 

1

f-\ ,
figulljlllllJ L-
_L Elllllllllllllllj'aq

Figure 4: The three-step process of PCR. In the first step the DNA is heated and separated into
two single strands. In the second step, the temperature is lowered and oligonucleotide primers
anneal to either side of the desired DNA sequence. In the third step, a DNA polymerase binds to
the primers and synthesizes the complementary DNA strands.

 

 

Measuring PCR product formation during the exponential phase allows the reaction to
be used quantitatively. Most variations of quantitative PCR capture fluorescence that is
produced as DNA product concentration increases. Real-time PCR using TaqMan®
chemistry (Applied Biosystems) is one such technique (Figure 5). In this method, an
oligonucleotide probe containing two fluorescent dyes is added to the reaction.
Following each cycle, the first dye is excited by a laser and fluorescence is measured. In

an intact probe the two dyes are in close proximity and the second quenches the

fluorescence from the first. As the DNA polymerase synthesizes a complementary strand
during the extension step, it cleaves the probe and causes the dyes to be released,
allowing the first dye’s fluorescence to be measured (Holland et al., 1991). This process
is repeated during each cycle of the reaction; the earlier the increase in fluorescence

occurs, the greater the initial DNA concentration.

 

 

 

 

 

 

 

 

 

 

 

Polymerization
Forward
primer 0 Probe 0.
, ) "_ '
5
3'
< 5-
Reverse
primer
Strand Displacement 0
-.......;.-. '~ ' > d
< —_
Cl ‘
eava
ge ’ \ Q
6—."—
Polymerization
Completed 6
s _ \ _._i.
- ’ ‘

 

Figure 5: The 'I‘aqMan® real-time PCR reaction. Figure is adapted from Applied Biosystems
TaqMan® Gene Expression Assays document (2006).

Real-time PCR amplification curves plot relative fluorescence units (RFU) at each
cycle of the reaction (Figure 6). There is always some level of background fluorescence;

therefore, a threshold fluorescence level is set above it during the exponential phase,

which remains consistent among replicates. A threshold cycle (CT) value is determined

from the intersection of an amplification curve and the threshold: a lower CT value

indicates a greater amount of starting DNA (Heid et al., 1996). Sample DNA quantities
can be directly compared to a standard containing a known amount of starting DNA, or

they can be relatively compared to one another.

 

  
 

 

 

 

 

10‘ .
10° , +—
: [Exponential phase |—} , ‘
10.1 _ ...... I. 4- Threshold
10°2 ! e V
E eeS ? fl! 7 7
0 20 30 40
Cycle

Figure 6: A series of real-time PCR amplification curves depicting the exponential and plateau
phases. The threshold is represented as a horizontal line, and the CT value for the leftmost curve
is indicated. Figure is adapted from ABI PRISM 7700 (TaqMan® assay) Amplification Curve

(2009).
PCR only amplifies DNA, so an additional step is required to quantify levels of RNA
in a biological sample. The enzyme reverse transcriptase uses single-stranded RNA as a

template to produce a complementary DNA molecule (cDNA) (Temin and Mizutani,

1970). When RNA is reverse-transcribed, the resulting cDNA represents all of the RNA
from the sample and should retain the relative quantities of the different RN As that are
present. As a result, the combination of reverse transcription and real-time PCR is a
powerful tool for quantifying RNA in biological samples.
Previous Research Involving RNA Degradation in Biological Samples

Preliminary research has been conducted to investigate whether RNA decay is a
feasible age indicator for biological samples. Bauer et al. (2003) examined two methods
for measuring RNA degradation in bloodstains: semi-quantitative duplex PCR and
competitive PCR. First, two regions of B-actin were amplified from opposite ends of the
cDNA. The authors hypothesized that PCR product near the 5’ end of the cDN A would
be more prevalent in reactions containing partially-degraded mRNA, because mRNAs are
degraded from the 5’ end (corresponding to the 3’ end of the cDN A). In the second
method, cyclophilin cDNA was amplified with a competitor: a molecule created from the
same cDNA that was engineered to contain a small deletion, making size differentiation
between the two products possible. The competitor was then added in known
concentration to the PCR reaction. The premise was that the cDNAs would compete for
use of the primers, and that the primers would act as a limiting reagent in the reaction
(Zimmermann and Mannhalter, 1996). It was hypothesized that competitor cDNA should
be present in a greater proportion when cyclophilin mRN A was more severely degraded.

The authors calculated PCR product ratios for each of the above methods: one for the
5’ and 3’ regions of B-actin and another for competitor versus endogenous cyclophilin.
Ratios for both B-actin and cyclophilin mRNAs significantly increased over a period of

180 months (p<0.05), with older bloodstains displaying greater variability. Only blood

11

samples with age differences of greater than 4 years could be differentiated with
statistical significance (p<0.05). Overall, the data Show that it is possible to detect RNA
degradation in aged bloodstains, and that the degradation is associated with sample age.
However, the lack of precision limits the application of such methods, and indicates that
semi-quantitative duplex PCR and competitive PCR are not ideal methods for RNA
quantification.

More recently, Anderson et al. (2005) employed real-time PCR to quantify the levels
of two common RNAS in bloodstains aged over 150 days. The researchers investigated

whether degradation rates differed between the molecules and if their ratio could be used

as a predictor of bloodstain age. CT ratios of 188 rRNA to B-actin mRNA were

calculated, which displayed a positive linear trend with age. Since a low CT value

corresponds to a greater amount of initial cDNA, an increase in the proportion of 18S to
B-actin indicated that 18S was degrading at a more rapid rate than B-actin. However, the

authors incorrectly stated that B-actin was less stable and decayed more rapidly than 18S.

It was apparent that they misinterpreted a low CT value as a low cDNA concentration,

which inverted the results. The data were also inconsistent with previous work that
showed 18S possessing greater stability than mRNA in vivo (Abelson et al., 1974). Due
to the errors present in the study, conclusions could not be drawn regarding the stability
of the individual RNAS. However, the data did indicate that RNA undergoes differential
degradation and that relationships among molecules may be useful as indicators of age in
biological samples. In addition, the results were obtained with small volumes of blood,
demonstrating that the method would be viable with quantities of biological samples

commonly found at a crime scene.

12

Current Work Aging Bloodstains Using RNA Degradation

The aim of the research presented here was to investigate the potential of RNA
degradation as a tool for aging forensic biological evidence. Real-time PCR was used in
an attempt to quantify a variety of mRNAs, tRNAs, and rRNA, and bloodstains aged up
to five years were examined to discern whether quantities of the RN As were related to
sample age. It was hypothesized that the RNAS would undergo differential degradation
based on their structural and functional variability. If relationships between molecules
could be determined, a method for quantification of RNA degradation would have the

potential to aid investigators in establishing temporal identities for biological evidence.

13

METHODS

Blood Sample Collection

Blood samples were provided by a volunteer, including fresh blood and stains
approaching 5 years old. A region of the finger was cleaned with 70% ethanol and a
lancet was used to draw blood. Multiple blood spots were dotted onto sterile plastic petri
dishes, which were allowed to dry and stored at room temperature, protected from light.
Additional blood samples were collected over the course of the research in the same
manner. Ten were used for analysis, including a control of fresh blood that was not
allowed to dry prior to RNA extraction. The dates of sample collection ranged from
10/22/03 to 5/8/08.
Selection of RNA Targets

The mRNA targets analyzed were housekeeping genes. Two of these, B-actin and
cyclophilin D, had been used in previous research involving bloodstain aging (Bauer et
al., 2003; Anderson et al. 2005). The third was glyceraldehyde-3-phosphate
dehydrogenase (GAPD), another commonly-used RNA standard (Morse et al., 2005).
Primer sequences for B-actin were taken from Bauer et al. (2003), those for cyclophilin D

were from Medhurst et al. (2000), and the GAPD primers were developed by Carraro et
al. (2005) (Table l). The TaqMan® probe sequence for cyclophilin D was from
Medhurst et al. (2000). The probes for l3-actin and GAPD were designed by band due to
difficulties encountered using primer design software on short sequences. Probes were
labeled with a hexachloro-6-carboxyfluorescein (HEX) reporter dye and black hole
quencher (BHQl) (Table 2). The oligonucleotides were designed for the human variant

of the mRNAs.

l4

The tRNAs assayed were alanine tRNA (tRNAAh), serine tRNA (tRNAscr), and
valine tRNA (tRNAval). Oligonucleotides for the tRNAs were designed by hand,

attempting to maximize sequence length and avoid hairpin structure (Figure 7; Table 1).

TaqMan® probes were chosen based on the anticodons that are most prevalent in humans

Ala

(Ikemura, 1985), including tRNA (GGC), tRNAs“ (GCU), and tRNAV‘” (CAC). The

corresponding probes were labeled with a tetrachloro-6-carboxyfluorescein (TET)

reporter dye and black hole quencher (Table 2).

 

Probe
tRNAva' (CAC)

Figure 7: The location of the custom primers and probes designed for the tRNA molecules.
tRNAval (CAC) is pictured, however the same locations were used for tRNAAla (GGC) and
tRNAs“ (GCU). Figure is adapted from Achsel and Gross (1993).

The 18S rRNA molecule, which is part of the small ribosomal subunit, was also
assayed. Primer sequences were from Niki et al. (2000) (Table 1). The probe was
designed by hand and was labeled with a 6-carboxyfluorescein (FAM) reporter dye and

black hole quencher (Table 2).

Table 1: Primer sequences and amplicon sizes for the RNA targets of interest.

 

 

 

 

 

 

 

 

 

 

 

 

Gene Primer Sequences Size of
5,93, Amplicon
Forward Reverse
B-actin
mRN A atccacgaaactaccttcaactc gaggagcaatgatcttgatcttc 178 bp
Cyctfiplléilkn D tgagacagcagatagagccaagc tccctgccaatttgacatcttc 93 bp
313:}: ctctctgctcctcctgttcgac tgagcgatgtggctcggct 213 bp
tRNAAla
(GGC) ggggctatagctcagctggg agctatgcgggatcgaaccg 70 bp
tRNAset
(GCU) gtagtcgtggccgagtggtt tggcgtagtcggcaggattc 85 bp
tRNAval it t t ’ tt tt 76 b
(C AC) gt ccgtagtgtagtggt ggtgt ccgcccggt P
18S
rRN A cggctaccacatccaaggaa gctggaattaccgcggct 187 bp

 

 

16

 

Table 2: TaqMan® probe sequences and fluorophores for the RNA targets of interest.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Gene Probe Sequence Reporter Quencher
5’-)3’ Fluorophore Fluorophore

ml: ctgtacgccaacacagtgct HEX BHQl

€3,0an D aacctatagctttaagctgtgtactgaatattggtgct HEX BHQl

$3122 gccgcatcttcttttgcgtc HEX BHQl
tRNA“a

(GGC) agcgcctgcttgggacg TET BHQl
Ser

tIEgGU) ggcgatggactgc_taatcc TET BHQl
Val

“2:120 acgttcgcctgagacgc TET BHQl

18S
rRN A taacgaggatccattggaggg FAM BHQl
Isolation of RNA

Pipettors, disposable pipet tips, scalpels, tubes, and appropriate solutions were UV-
irradiated for 6 minutes using a Spectrolinker UV Crosslinker (Spectroline) prior to use.
The laboratory bench and pipettors were regularly treated with RNaseZap (Applied

Biosystems), and all water was diethylpyrocarbonate (DEPC)-treated. RNA was first

isolated using a guanidinium thiocyanate-phenol-chloroform extraction and TRIzol®

reagent (Invitrogen). Twenty microliters of fresh blood was deposited into two
microcentrifuge tubes. One milliliter of water was added and incubated at room

temperature for 20 minutes. The tubes were centrifuged at maximum speed for 2 minutes

and the supernatant was removed. One milliliter of TRIzol® reagent was added and a

reagent blank was initiated and cam'ed through the remainder of the procedure. Cells

17

were lysed by repetitive pipetting with a P1000 pipettor and centrifuged for 10 minutes at
12,000 x g at 4°C. The homogenates were transferred to new tubes, and the
centrifugation and transfer repeated. Samples were incubated at room temperature for 5
minutes. Two hundred microliters of chloroform was added, and tubes were inverted to
mix. They were incubated at room temperature for 5 minutes and centrifuged at 12,000 x
g for 15 minutes at 4°C. The upper aqueous phases were transferred to new tubes, and
0.5 mL of RNase-free isopropanol was added. The precipitates were incubated at room
temperature for 10 minutes and centrifuged at 12,000 x g for 10 minutes at 4°C. The
supematants were discarded and the RNA pellets were washed with 1 mL of 75%
ethanol. The tubes were centrifuged at 12,000 x g for 5 minutes at 4°C, and the ethanol
wash step was repeated twice more. The supematants were removed, and the RNA
pellets were vacuum-dried for 20 minutes and resuspended in 60 uL of water. This
procedure was subsequently repeated on the aged bloodstain collection. The samples

were scraped from petri dishes using a scalpel and the blood powder was placed into a
microcentrifuge tube. TRIzol® reagent was directly added to the tube and the remainder
of the procedure was as detailed above.

A second version of the TRIzol® procedure was also performed on the aged
bloodstains. Blood samples were collected using a scalpel as described above and 1 mL
of TRIzol® reagent was added to each tube, which were mixed and incubated at room

temperature for 5 minutes. Two hundred microliters of chloroform was added and
incubated at room temperature for 3 minutes. The tubes were centrifuged at maximum
speed for 30 minutes at 4°C, and the upper aqueous phases were transferred to new tubes.

Two hundred and fifty microliters of RNase-free isopropanol was added and incubated at

18‘

room temperature for 10 minutes. The tubes were centrifuged at maximum speed for 30
minutes at 4°C. The supematants were removed and the RNA pellets were washed with
1 mL of 75% ethanol. The tubes were centrifuged at maximum speed for 15 minutes at
4°C and the supematants were removed. The RNA pellets were air-dried in a laminar-

flow hood for 10 minutes and resuspended in 56 uL of water.

A third RNA extraction method utilized a Qiagen QIAamp® RNA Blood Mini Kit.

The protocol was first performed on one of the aged blood samples. Five variations of
the resuspension step were performed to determine an optimal procedure. One blood
sample was collected as a powder using a scalpel and placed in a microcentrifuge tube.
One hundred microliters of Buffer EL was added. For the four remaining extractions,
500 uL of Buffer EL was added directly to the petri dish, and the blood was resuspended
into the solution. Blood solution and Buffer EL were added to separate tubes in the
following volumes (in uL): 5:5, 20: 10, 100:50, and 250: 125. The rest of the procedure
followed the kit protocol. The tubes were incubated on ice for 15 minutes, being briefly
vortexed twice during the incubation. They were centrifuged at 400 x g for 10 minutes at
4°C and the supematants were removed. A volume of Buffer EL equivalent to that used
in the first step was added, and cells were resuspended by vortexing. Centrifugation was
performed at 400 x g for 10 minutes at 4°C and the supematants were removed. Three

hundred and fifty microliters of Buffer RLT was added and the tubes were vortexed. The

lysates were added directly to QIAshredder® spin columns and centrifuged at maximum

speed for 2 minutes. Three hundred and fifty microliters of 70% ethanol was added and

mixed by repetitive pipetting with a P1000 pipettor. The lysates were transferred to

QIAamp® spin columns and centrifuged for 15 seconds at 8,000 x g. The columns were

19

placed in new collection tubes and 700 uL of Buffer RWl was added. The samples were
centrifuged for 15 seconds at 8,000 x g, and the columns were transferred to new
collection tubes. Five hundred microliters of Buffer RPE was added, and the tubes were
centrifuged at 8,000 x g for 15 seconds. An additional 500 uL of Buffer RPE was added
to each column, which were centrifuged at maximum speed for 3 minutes. Columns were
placed in new collection tubes and were centrifuged at full speed for 1 minute. The spin

columns were transferred to new microcentrifuge tubes and 50 ML of water was pipetted

onto the QIAamp® membranes. The tubes were centrifuged at 8,000 x g for 1 minute.

Variations of this procedure included using fresh blood samples that were briefly allowed
to dry on petri dishes and various volumes of fresh blood (up to 1 mL) that were directly
added to microcentrifuge tubes. Variables included blood volume, buffer volume, and
incubation times. Reagent blanks were included in all procedures.

Portions of the RNA extractions were quantified with a Beckman DU 520 general
purpose UVN IS single-cell Spectrophotometer with l uL of RNA diluted with 199 uL
of distilled water. Purity was calculated by the absorbance at 260 nm divided by the
absorbance at 280 nm.

DNase I Treatment

Two DNase treatments were used on the RNA samples. In the first, 7 uL of DNase I
and 7 uL of DNase I buffer were added to 40 uL of RNA and incubated at 37°C for 1
hour. The enzyme was heat-inactivated for 10 minutes at 75°C. One hundred microliters
of isopropanol was added, and the samples were centrifuged at maximum speed for 30
minutes at 4°C. The supematants were removed and the RNA pellets were washed with

60 uL of 70% ethanol. Tubes were centrifuged at maximum speed for 30 minutes at 4°C

20

and the supematants were removed. The pellets were vacuum-dried for 15 minutes and
resuspended in 32 uL of water. RNAS were stored at -80°C. The second treatment
followed the one above, except 0.7 uL of 0.5 M ethylenediaminetetraacetic acid (EDTA)
was added after the incubation. The enzyme was heat-inactivated at 75°C for 10 minutes,
and RNAS were stored at -80°C.
Reverse Transcription
RNAS were reverse-transcribed using an Applied Biosystems High Capacity cDN A
Archive Kit following the manufacturer’s protocol. Sample volumes differed among
RNA preparations, but the general proportions for the 2X reaction mix were:
10 uL 10X Reverse Transcription (RT) Buffer
4 uL 25X dNTPs
10 uL 10X random hexamer primers
5 uL MultiScribeTM Reverse Transcriptase (50 U/uL)
21 uL sterile, RNase-free water
50 uL total 2X reaction mix
The mix was diluted to 1X using an equal volume of RNA. In addition, a control
lacking reverse transcriptase was prepared for each sample. Reactions were incubated at
25°C for 10 minutes and at 37°C for 2 hours. cDNAs were stored at -20°C.
PCR
Primers were optimized using standard PCR and control human DNA. Forward and
reverse primers were tested in combinations of 0.9, 0.3, and 0.05 uM. A negative control
included no DNA and the 18S primers. The reaction consisted of l uL of human DNA
(10 ng/uL), 1 uL of the forward and reverse primers, 1 uL of dNTPs (2 mM), 1 uL of
10X PCR Buffer, l uL of bovine serum albumin (BSA) (1 p. g/uL), 1 unit of Taq

polymerase and 3.8 uL of water. The PCR samples were incubated at 95°C for 5

21

minutes, followed by 40 cycles of 95°C for 30 seconds, 55°C for 45 seconds, and 72°C
for 1 minute. They remained at 72°C for an additional 5 minutes and were held at 4°C.
In reactions where non-specific products were produced, the annealing temperature was
increased to between 56 and 60°C. The PCR products were electrophoresed on a 4%
agarose gel and stained with ethidium bromide. This same procedure was repeated using
cDNA templates and controls consisting of a reagent blank, samples lacking reverse
transcriptase, and human DNA with 18S primers.

Real- Time PCR

Real-time PCR was performed on a Bio-Rad iQ5 Real-time PCR Detection System.
Reactions were performed in a 15 uL volume in clear dome-top PCR tubes or 96-well
plates with a clear adhesive cover. Control reactions contained single primer and probe
combinations, while other reactions were duplexed, including an mRNA or tRNA target
with 188 primers. Seven and a half microliters of iQ5 Supermix (Bio-Rad), 1 uL of each
primer, probe, and template DNA were included in each reaction. In some reactions, 0.5
uL of BSA (3 ug/uL) was also added.

Reactions were optimized with primer concentrations of 0.9, 0.3, and 0.05 uM and
probe concentrations of 0.25 and 0.1 uM. The optimal concentration for each
oligonucleotide is presented in Table 3. In addition, a thermal gradient of 50 to 65°C was
used to determine optimal annealing temperatures, which were used in subsequent
experiments. Reactions were performed in duplicate, and the results were analyzed using
the Bio-Rad iQS Optical System Software (Version 2.0). Amplification curves were
analyzed as background subtracted, baseline subtracted, or baseline subtracted with a

curve fit, and viewed using both logarithmic and linear scales. Thresholds were set above

22

background fluorescence and kept consistent for each replicate. CT values were recorded

and the amplification curves were examined. For two RNA molecules, CT ratios were

calculated and compared.

Table 3: Optimal primer and probe concentrations for each of the RNA targets.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Oligonucleotide Conqmation
B-actin forward primer 0.9
B-actin reverse primer 0.9

B-actin TaqMan® probe 0.25
Cyclophilin D forward primer 0.9
Cyclophilin D reverse primer 0.9

Cyclophilin D TaqMan® probe 0.25
GAPD forward primer 0.3
GAPD reverse primer 0.9

GAPD TaqMan® probe 0.25

tRNAAla forward primer ' 0.9

tRNAAla reverse primer 0.3

tRNAAIa TaqMan® probe 0.25
tRNAser forward primer 0.05
tRNAser reverse primer 0.9
tRNAser TaqMan® probe 0.25
tRNAval forward primer 0.9
tRNAval reverse primer 0.9
tRNAval TaqMan® probe 0.25
18S forward primer 0.9
188 reverse primer 0.9
188 TaqMan® probe 0.25

 

 

 

 

 

23

RESULTS
Gel electrophoresis of control DNA PCR products showed the anticipated amplicon

sizes of 178 bp for B—actin mRNA, 93 bp for cyclophilin D mRNA, 213 bp for GAPD

mRNA, 85 bp for tRNAser, 76 bp for tRNAval and 187 bp for 18S rRNA (Figure 8). The

exception was tRNAAla, which did not exhibit a product at the expected size of 70 bp.

While a faint band was present near that location, similar bands were found in some of

the other lanes and may have represented primer dimer or non-specific products.

100bp

 

Figure 8: A 4% agarose gel displaying the control DNA PCR products. Lanes from left to right:
100-bp ladder, B—actin (B), cyclophilin D (C), GAPD (G), tRNAAla (A), tRNAs"r (S), tRNAval
(V), 18S. Products of the expected sizes were visible in all lanes with the exception of tRNAA
A non-specific band in that lane is indicated by an arrow.

la

The optimized real-time PCR protocol included a 3 minute denaturation step at 95°C,

followed by 50 cycles of 95°C for 30 seconds and 55°C for 45 seconds. All targets

generated a sigmoidal curve using control DNA, except tRNAAla and tRNASEr (Figure 9).

24

188 rRNA displayed the lowest CT value, tRNAser had the highest, and tRNAAla did not

cross the threshold. CT values were not affected when mRNA or tRNA genes were

duplexed with the 18S gene in a separate reaction (Table 4).

 

 

A
O
U
L

 

 

{El—T'— ‘ tVIIal//L ,—

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

    

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5

IL

‘5

O / f /“

‘3 2 / t//% cycle

10 a

0 W ,,

3. t .

g “3 GAPD \\

3

‘2 10‘ 11.32 /i ‘39"

C

:i

. \ / i

8 ‘ u

g . \ /\ A / i tAla,

a. 100 JJKI 1 l . . . . . l
o 5 10 15 20 25 30 35 4o 45 50

Cycle

Figure 9: Logarithmic real-time amplification curves representing control DNA amplification.
The threshold is shown as a bold line. The curves for 188, B-actin, cyclophilin D (cyclo), GAPD,

and tRNAval (tVal) displayed a sigmoidal shape, while that for tRNAser (tSer) did not. The
curve for tRNAAla (tAla) did not cross the threshold.

25

Table 4: CT values for each RNA target in individual and duplex reactions. The CT value for
18S is an average, as it was included in all duplex reactions. 18S displayed the lowest CT value,
while tRNAset had the highest. The amplification curve for tRNAAla did not cross the threshold
and therefore a CT value was not calculated.

 

 

 

 

 

 

 

 

T t Individual Duplexed
arge CT Value CT Value
188 23.28 23.62

B-actin 25.19 25.19

Cyclophilin D 31.61 32.02

GAPD 30.02 29.75

Ala ‘
tRN A N/A N/A
tRNASer 41.83 41.91
Val
tRN A 24.48 24.33

 

 

 

 

 

PCR amplification of the 10 bloodstain cDNAs ranging from 0 to 1530 days old was
successful for two RNA targets (Figure 10). Reactions containing no cDNA, the reagent
blank, the DNase-free control, and the controls lacking reverse transcriptase produced no
product. Only 18S rRNA consistently amplified from the cDNA templates, producing

bright bands for days 1510, 250, 117, 74 and 0, fainter products for days 1490 and 1440,

and very weak products for days 1530 and 215. tRNAval reactions from days 1530,

1490, 1425, 250 and 0 also exhibited a product of the correct size. All other RNA targets

tested negative (tRNAAla was not tested due to the lack of product with the DNA

control).

26

—1530days— —1510days—- -——1490days—
BGCSV1BBG CSV1836C8V189

10122103 1 1/12/03 12/4/03

—1440days——1425days—-—250days—
BGCSV1BBGCSV18 BGCSV18-

 

300bp
2001»

100bp

 

-—215days——117days——74days—
BGCSV1B BGCSV1OIGCSV18

 

9/13/07 ' ' 10/26/07

—Odays—
BGCSV18RB-O

 

-RT controls

Figure 10: Multiple 4% agarose gels displaying cDNA PCR products. Dates when the
bloodstains were collected are shown below the lanes. Ages of the bloodstains and the targets or
controls are shown above each lane (B=8—actin, G=GAPD, C=cyclophilin D, S=tRNAser,
V=tRNAval, 18=18S, RB=reagent blank, -D=DNase-free control, -RT=reverse transcriptase-free
control). All control reactions included 188 primers. 18S rRNA products were visible at all days
except 1425. tRNAval products were present at days 1530, 1490, 1425, 250, and 0. No products
were present for any of the other RNA targets.

27

The results of real-time PCR using cDNAs differed somewhat from those analyzed via

gel electrophoresis. cDNAs from bloodstains less than 250 days old consistently

generated 18S and tRNAval PCR products (Figure 11), while cDNAs from older
bloodstains did not produce both products simultaneously. 188 CT values ranged over
8.27 cycles, while those for tRNAval had a range of 14.28 cycles. The average CT value
was 30.87 for 18s and 36.37 for tRNAval.

The CT ratios of 18S to tRNAW‘l averaged among three or four replicates had

standard deviations of less than 0.001. The ratio plot was roughly parabolic (Figure 12),

remaining relatively constant at about 0.81, with 188 being more prevalent than tRNAval,

until day 74. The relative amount of 18S had decreased by day 117, where the peak ratio

was reached near 0.93. The relative concentration of tRNAval had decreased at day 215,

and further decreased until the ratio reached 0.84 at day 250.

28

188 rRNA Real-time Amplification Curves

 

 

 

 

1 l:‘:l ”4”,, 334’”
’2‘ 410 / / L _ 7 a»?
S f /ff,/
it. 2:101 4’ ,,/_.
0 (r ,/9 'V/
Z / -/
3 //
U 1 j ‘ A/,/‘T‘\. a“, __
8 10 i . ,-’ /
3 8*100 / y

e 0 ' 11'
g 610 4.73 I j
3 4.100 5.." / I
C ,1 . “
:1 ‘Ii 1 i
o It . .1
52.100 . 1.
i l ‘1
§ If 11)
10° ' ‘

 

 

 

 

 

 

 

 

 

 

 

 

O 5 10 1 5 20 25 30 35 40 45 50

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Cycle

tRNA‘“I Real-time Amplification Curves
A 6.101 :: ¢4
D ,Wflrzfif'fl—‘T:
& 4*10‘ / / ,3 T? _'
v V . .r /‘
.1: // )——/
IL 1 ,e{’ "I
0 e ,. /‘; ‘
z 210 / .
3 .
o ,1 / .1
g f / . i .3
g t 0 1er I /l / 1' ,
5:) 610 4.71 (i i I i
a 4:100 i ;
3 i i i l
0 i if i
g 2:100 . i ,. i . i
a: I \ . I i ‘ .
O i \ , ’3 ‘1 ’ I :
a 100 J1 ll 1. l \ 1 //l\’ ll '1 il l l l

0 5 10 15 20 25 30 35 40 45 50

Cycle

Figure 11: Logarithmic duplex real-time PCR of 18S and tRNAval from bloodstain cDNAs of
differing ages. Each curve displays the amplification from a single cDNA, up to the age of 250
days. The threshold is shown as a bold line. Both RNA targets amplified individually in samples
older than 250 days, although not simultaneously (data not shown).

29

0.96

 

0.94 -

0.92

0.9

0.88

Mean Ratio

0.86

0.84

 

O 50 100 150 200 250 300
Age of Bloodstaln (Days)

Figure 12: A curve representing the mean CT ratio of 188 to tRNAWll over time. Each data point
was calculated as an average of three or four replicates, producing standard deviations less than
0.001 in all cases. The curve was roughly parabolic, with a peak ratio near 0.93 occurring at 117
days. 183 was more prevalent in all of the bloodstains; however, its relative amount decreased

between days 0 and 117. The relative concentration of tRNAval decreased at day 215, and then
further decreased until the ratio reached 0.84 at day 250.

The other duplex real-time PCRS often showed successful [88 rRNA amplification
(Figure 13, region A), but the mRNA and tRNA targets did not. The real-time
amplification curves for the latter RNAS were unusual, showing an increase in
fluorescence beginning between cycles 15 and 20 and a subsequent decrease in
fluorescence between cycles 30 and 35, resulting in a rainbow-like pattern (Figure 13,
region B). In addition, several other mRN A and tRNA curves displayed an immediate
increase in fluorescence that remained relatively constant throughout the thermocycling

process (e. g., Figure 13, region C). Increasing the concentration of cDNA template five-

30

fold or decreasing it 1,000—fold produced similar results, as did varying the annealing
temperature between 55 and 60°C. Also, various combinations of protocols for RNA
extraction, DNase treatment, and cDNA generation did not increase amplification
success. Despite using different reagents, kits, reagent volumes, and lengths of time for
centrifugations and enzymatic reactions, the amplification curves for these reactions

displayed a sigmoidal shape for 18S, and produced rainbows or constant fluorescence for

the mRNAs and tRNAs”.

 

.5
o
N
I. E
l
\
l
l
l
1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

E
2‘.
.1'.’
u.
0
Z
3
0
3
o i A ,
\\ «"5“
E H \53**:
5 10‘ r f. T \
0 . 1'." ,,
.s 3 r 3.
.J ‘- \
8 i
,3 3’ r *i
..i ’7 .i
a: 4 1
8 i. i l, E \
1003 ‘
o 5 10

 

Cycle

Figure 13: Logarithmic real—time PCR amplification curves for B-actin, cyclophilin D, GAPD
and tRNAset duplexed with 18S. 18s amplification was sigmoidal (region A). Curves for the
other RNA targets were sometimes “rainbows” (region B). which slgowed an increase in
fluorescence followed by a decrease. Other curves displayed an immediate increase in
fluorescence that remained relatively constant throughout the reaction (e.g., C).

31

cDNA templates from both 0.5 and 1 mL of fresh blood successfully generated 18S

PCR products (Figure 14), and the average CT value was much lower than that of the

aged samples (22.13 versus 30.87). tRNAval PCR product was generated using both

fresh blood cDNAs, while B—actin was amplified using cDNA from the 1 mL blood
sample. The B—actin amplification curve for the 0.5 mL blood sample displayed the
rainbow shape described above; however, later in the reaction it also showed a sigmoidal
shape similar to that generated for the 1 mL blood sample (Figure 15). The remainder of
the RNA targets exhibited results similar to those for the aged bloodstains, with rainbow-

shaped curves or relatively constant fluorescence.

 

t:':l , ~**-"" '7’

 

._ ‘\
‘\

.5
o
N

 

10'

 

 

 

PCR Base Line Subtracted Curve Fit (RFU)

 

 

 

 

 

 

 

 

 

 

 

 

.-
O
O

 

30 35 40 45 5O
Cycle

Figure 14: Logarithmic real-time PCR amplification curves for 18S rRNA using cDNA

templates from 0.5 or 1 mL of fresh blood. 18S amplified from all samples when duplexed with a
tRNA or mRNA target. The average CT value among the reactions was 22.13.

32

 

 

0.5 m1. /

 

 

 

 

 

.5
O
N

 

 

 

 

 

 

 

 

 

0.5 mL

 

d
‘2.

PCR Base Line Subtracted Curve Fit (RFU)

 

 

 

 

 

 

 

 

 

 

 

[\hl

 

 

—L
O
O

10 15 20 25 30 35 40 45 50
Cycle

0
0|

Figure 15: Logarithmic real-time PCR amplification curves for duplex B-actin and 188 using
cDNA templates from 0.5 and 1 mL of fresh blood. The curve for the 0.5 mL blood sample first
displayed a rainbow shape, with a subsequent sigmoidal shape occurring later in the reaction.
The curve for the 1 mL sample was sigmoidal.

33

DISCUSSION

The aim of the research presented here was to expand on preliminary studies
examining RNA degradation as a possible bloodstain aging technique. There has been
little investigation into such a method, or the-biological processes that are responsible for
the breakdown of RNA ex vivo. Given this, predictions regarding degradation of
different RNAS were made based on their stabilities established in vi v0. It was
hypothesized that 188 rRN A would exhibit the greatest stability over time, with tRNAs
possessing moderate stability and mRNAs being the most variable and unstable. Data
were obtained for two of the RNA targets, and their relationship was estimated over a
period of 250 days. The remainder of the RNAS displayed negative results.

18S rRNA provided the most substantial results of all RNAS examined, as it was
successfully amplified from the greatest number of aged cDNA templates. Using
standard PCR, it was detected from nine of the ten bloodstains, including that aged 1530
days. 188 products were also generated in duplex with all mRNA and tRNA targets,
including real-time reactions where the other target did not amplify. Previous research
has characterized rRN A as relatively stable (Abelson et al., 1974), so these results were
not surprising. rRNAs are also abundant; mammalian cells produce ~2 x 106 ribosomes
per ~15 hour generation time, and 50—250 rRN A genes must be actively transcribed to
meet the needs of the cell. Out of nearly 10,000 RNA species in a eukaryotic cell, rRNA
consumes half of the transcriptional resources (Sollner-Webb and Tower, 1986). The
45S gene cluster that contains the 28S, 18S, and 5.8S rRNA genes is present in tandem
repeats of up to 140 units spread across five different chromosomes (Stults et al., 2008).

,In real-time PCR studies of white blood cells, Bas et al. (2004) demonstrated that strict

34

regulation of rRNA production is maintained in various cellular states; levels of other
RNAS fluctuated if the cells were resting or activated due to an immune response, but
18S concentration remained unchanged. The prevalence and stability of 188 likely
accounts for the amplification of the rRNA in the current assay, even from bloodstains

aged up to five years.

The other RNA for which positive results were obtained was tRNAval, which
amplified from five of the ten aged cDNA templates using standard PCR, including
cDNA from the 1530-day-old bloodstain. tRNAval was also detected in real-time PCR
using the most aged cDNA template, though it was not simultaneously amplified with
188 from templates older than 250 days. While not as abundant as 18S, tRNAWl has a
relatively high copy number in the human genome; at least 13 genes have been
discovered, including a gene cluster encoding multiple tRNAval and tRNALys genes
(Arnold et al., 1986; Craig et al., 1989). Also given the relative stability of tRNAs in vivo

(Puglisi et al., 2003), the detection of tRNAval from aged bloodstains was not surprising.

18S and tRNAval were successfully co-amplified using cDNAs from bloodstains aged

up to 250 days, so their relative degradation could be compared over time. Data were

reproducible among four real-time PCR replicates from two RNA extractions, and each

calculated ratio of 18S to tRNAval CT value was consistent (had a standard deviation of

less than 0.001). While the limited number of data points prevented precise curve-fitting,

the overall pattern indicated that degradation occurred in a variable, non-linear manner.

The CT ratio appeared relatively constant between days 0 and 74, but the lack of

35

interpolating data points meant that the ratio could have fluctuated. The subsequent

'1
IL

upward trend in the curve signified that 188 was less stable than tRNAval. Following
day 115, a negative slope was observed, indicating that the rate of decay of tRNAval was

greater than that of the rRNA; either tRNAval degradation had increased, 18S

degradation had decreased, or some combination of the two.

It seems likely that the relative degradation curve pattern resulted from fluctuations in

tRNAval decay, given the widely accepted stability of rRNA. Assuming this, the upward

slope of the curve after day 74 meant tRNAval degradation had slowed, with the
subsequent downward slope caused by increased tRN A degradation. The mechanism
responsible for variable tRNAval degradation is unclear, though it may result from the

tRNA’s complex structure. The T‘I’C and variable loops of tRNAs are largely resistant to
nucleases, while the anticodon loop and 3’-terminal CCA are most sensitive due to the
tertiary structure of the molecules (reviewed by Rich and Rathandary, 1976). 188 was

likely shielded from nuclease attack owing to its location within the ribosomal complex

(Merryman et al., 1999), but tRNAval would have had no such protection. The tRNA

was also assayed in its entirety, so any structural weaknesses were located within the
amplicon. While 18S has regions of nuclease susceptibility (Matveeva et al., 1997), only

10% of the molecule was amplified, decreasing the probability that these areas were

included. The exposed nature and structural sensitivity of tRNAWl likely accounts for

the dynamic pattern of the CT ratio curve.

36

Given the roughly parabolic shape of the relative degradation curve, an average CT

ratio of 0.88 (for example) corresponds to an estimated bloodstain age of either 100 or
225 days. The difference between these two dates could dramatically impact the nature
of a forensic investigation. Used in conjunction with other evidence, however, it is
possible that such information would be valuable. The ability to establish whether a
bloodstain is relatively fresh or aged could be used to determine whether it has probative

value, even if a precise temporal location could not be estimated.

It was expected that tRNAAla and tRNASfir would provide results similar to tRNAval;

however, these molecules behaved very differently. tRNAAla did not amplify using a

DNA template, suggesting there was a problem with the primers. The Spatial

arrangement of the primers was similar to those of the other tRNAs, so perhaps the

. . Al .
negative results were caused by the unique structure of the molecule. tRNA a 18 70 bp

in size, compared to 76 bp for tRNAval and 85 bp for tRNAser. It also has the highest

GC content (52.8%), which should increase the strength of its secondary structure since

about half of the guanines and cytosines are located within the hairpins of the tRNA.

tRNAser and tRNAval had similar GC percentages, at 41.2% and 40.1%, respectively. It

. . . Al
rs possrble that the smaller srze and more pronounced secondary structure of tRN A a

was less conducive to primer binding and prevented its amplification even from a DNA

template. The annealing temperature was raised incrementally up to 10°C to address this

contingency, but did not lead to the generation of tRNAAla PCR product. Varying the

37

 

concentration of the primers and adding BSA also did not increase the success of the

 

“fl.-.-

reaction.

Ser

tRNA PCR products were generated using a DNA template, but negative cDNA

results were obtained from both aged and fresh bloodstains. No tRNAS‘3r products were

visible on a gel following standard PCR of cDN A. In addition, real-time reactions
containing tRNAser displayed rainbow-shaped amplification curves, which showed an

increase in fluorescence beginning between cycles 15 and 20 and a subsequent decrease
in fluorescence between cycles 30 and 35. No mention of such amplification curves was
found in the literature, and inquiries with technical support from the instrument and

reagent manufacturers confirmed that there had been no previous reports of similar

results. It is possible that the data obtained for tRNAval and tRNAS‘Br stemmed from

differences in their cellular prevalence. Goh et al. (2004) surveyed 27,711 genes from
120 organisms and found that the average composition of serine and valine codons was
6.7% and 6.9%, respectively. A correlation exists between codon usage and intracellular
tRN A content (Ikemura, 1982), so the corresponding tRNAs would also be maintained in
equivalent concentrations. For the current study, tRNA real-time PCR probes were

designed using the most prevalent human anticodons for each of the tRNAs;

Ala Ser

tRNAval(CAC;48.5%), tRNA (GGC;41.5%), and tRNA (GCU;25.5%) (Ikemura,

1985). This still does not explain the successful amplification of only tRNAval, though,

since the variability in initial tRN A concentration would reflect a difference of less than

one PCR cycle. Although tRNAser was present in half the initial quantity of tRNAva],

38

Ser

tRNA PCR product should have been generated if its cDNA was present in the

 

reaction.

Cellular modifications may have also impacted tRNAs differently. tRNAs are
extensively altered in order to promote efficiency of protein production (Yarian et al.,
2002), including methylation, adenylation, ubiquitination, and atom exchange (e.g., sulfur
for oxygen), among many others (Nakai et al., 2008). Modifications can also involve
complex sequential reactions that result in formation of unique nucleosides, such as
queuosine or inosine (Bjork et al., 1987). While modifications of tRNA occur normally,
they can increase when cells undergo a change in environment. Wust and Rosen (1972)
demonstrated that tRNA in younger rats was more methylated than that from older rats.
In addition, studies of monkey kidney epithelial cells experiencing methionine starvation
showed that phenylalanine tRNAs lacked the wye base, a derivative of guanosine
normally present in eukaryotic cells (Pergolizzi et al., 1978). No studies involving the

impact of these altered bases on PCR amplification were found in the literature. It is

. S . . V l
possrble that tRNA er possessed a greater number of modifications than tRNA a , or that

tRNAser contained a specific modified nucleoside that hindered primer binding during

reverse transcription. This would have prevented creation of the cDNA and account for
its lack of real-time PCR detection. Otherwise, the structures of the tRNAs near the ends
of the molecules are similar and should not have caused differential primer binding.

The housekeeping mRNAs B-actin, cyclophilin D, and GAPD were all successfully
amplified using DNA templates, but displayed negative results from cDNA templates. It
is likely that the rainbow real-time amplification curves obtained for these RNAS were

caused by a technical problem, since researchers routinely use real-time PCR to quantify

39

mRNA levels in blood. Dheda et al. (2004) compared B-actin, cyclophilin, and GAPD as

internal standards for gene expression in whole blood and peripheral blood mononuclear

cell cultures and found that all had CT values 'of less than 30. In addition, Raghavan et al.

(2002) used real-time PCR to confirm results from microarray gene expression analysis
in white blood cells and demonstrated that mRNA half-lives obtained using both methods
were well-correlated. Data from the microarrays indicated that the majority of the
mRNAs had half-lives greater than 6 hours, and that many were selectively stabilized or
degraded following lymphocyte activation. These studies used large quantities of RNA
for cDNA synthesis; Dheda et al. (2004) isolated up to 5 pg from 2.5 mL of whole blood,
and Raghavan et al. (2002) extracted 10—15 11g from cultured lymphocytes. Anderson et
al. (2005) demonstrated success with much smaller quantities of RNA; B-actin was
amplified using RNA isolated from less than 1 uL of fresh blood. In the current study,
the aged bloodstains were approximately 10 11L in volume and dried onto a petri dish, so
it is reasonable to suggest that RNA purification from these samples was more difficult.
However, the use of large volumes of fresh blood still resulted in the rainbow
amplification curves for cyclophilin and GAPD mRNAs.

One mRNA in the current study did amplify using large volumes of blood; B-actin
cDN A from the 0.5 mL blood sample produced a rainbow amplification followed by a
standard sigmoidal curve, while the 1 mL sample produced a normal curve. These results
indicate that initial cDN A concentrations impacted the shape of the amplification curve,
and that the rainbow curve was associated with smaller starting amounts of cDNA.

Because cDNA from the 1 mL blood sample was twice as concentrated as that from the

0.5 mL sample, the difference between them Should have been one PCR cycle. The CT

40

 

 

values for each reaction were even closer than this: 35.92 for the 0.5 mL sample and

 

35.63 for the 1 mL sample. Therefore, the initial increase in fluorescence observed \

between cycles 15 and 20 did not likely represent creation of PCR product. Additionally,

the CT values associated with the rainbow curves were lower than the 188 CT values for

the 0.5 and 1 mL blood samples, and it is improbable that less-prevalent targets from
aged templates would have been present at higher concentrations than the rRNA. The
subsequent decrease in fluorescence is also unlikely to represent the loss of product
during the therrnocycling process, since DNA routinely withstands denaturation. The
fact that positive mRN A results were only obtained using such a large initial volume of
blood suggests that there may have been a problem with the quality of the RNA. It is
possible that mRNAs were experiencing rapid degradation immediately following RNA
purification, and that B-actin was only present in detectable quantities in the 1 mL sample
prior to cDN A synthesis. This explanation is unconvincing, since RNA extraction
methods require less time than is average for an mRNA half-life (Sharova et al., 2009).

If exogenous RNase activity were to blame, it would be expected that the other RNAS

would be affected, but both 188 and tRNAval displayed positive results for the fresh

blood samples. The differences in CT values for 183 and tRNAWl using the large

volumes of blood were consistent with the results attained from the aged bloodstain

cDNAs; average CT values for the aged cDNAs were 30.87 for 188 and 36.37 for

tRNAval, while those for the fresh blood samples were 22.13 for 18S and 30.42 for

tRNAVa'.

41

The amplification of 18S and tRNAval from both fresh and aged blood templates

 

indicates that RNA was present in sufficient quantities for reverse transcription following \
purification and suggests that the negative results obtained for the other RNAS resulted
from problems during this process. There are three mechanisms by which cDNAs can be
generated: random priming, oligo-dT priming, or target-specific priming (reviewed by
Bustin and Nolan, 2004). Target-specific priming is the most sensitive, but is time-
consuming since separate reverse transcription reactions must be carried out for each
RNA target. In addition, it requires larger amounts of starting RNA, less than ideal in a
forensic setting. Oligo-dT priming is specific to mRNA as the primers anneal to the
poly(A) tail; therefore, it was not viable in this study. Random primers anneal to RNA in
multiple locations and create cDNAs of varying lengths, which can misrepresent cDNA
copy numbers (Zhang and Byrne, 1999). However, random primers are best for targets
with strong secondary structure (reviewed by Bustin and Nolan, 2004), which was
important in the current study given tRNAs and rRN A were assayed. Those authors
stated that the majority of cDNA synthesized from total RNA using random primers
come from rRNA, and proposed the potential for inefficient priming of less-prevalent
RNAS. The relative abundance of 188 might have out—competed cDNA priming of

lower-copy targets and led to the unsuccessful results for the other RNAS in the research

. . . . . V 1
presented here. If this were true, the posrtlve results attalned usrng tRNA 3 suggest that

it was the only other RNA present in sufficient quantities to be primed and copied into
cDNA. This explanation is most plausible for the aged bloodstains, since degradation of

the mRNAs would cause them to be more under-represented in the RNA extracts.

42

However, it still does not satisfactorily account for the negative results obtained using
fresh blood.

Other technical factors that could have resulted in the unexpected amplification curves
were errors in the real-time PCR detection system and its analysis of the fluorescence
generated during the reactions. The curves were examined using multiple modes of
analysis, but even the raw data exhibited patterns similar to the curves when viewed with
a logarithmic scale. Calibration errors were ruled out as a possible cause of the negative
results, since all dyes were detected in real-time reactions using DNA as a template.
Additionally, other researchers in the laboratory have used the same instrument,
calibration methods, and dyes, without experiencing rainbow amplification curves.

CONCLUSIONS

The ability to link deposition of a bodily fluid to a point in time would greatly benefit
a criminal investigation. Unfortunately, the results of the current study indicate there are
pitfalls associated with the analysis of RNA degradation in aged bloodstains. The
method as presented here could not be used to age biological evidence collected from a
crime scene. However, the most plausible explanation for the negative results is a
technical problem, which may be overcome through further investigation. Rainbow

amplification curves were obtained from fresh blood as well as aged samples, showing

that those results were not related to sample age. The mRN As and tRNAser may have

been out-competed by 188, so inclusion of less-prevalent targets might establish a more
dynamic range for real-time PCR. Such targets could include small nuclear RNAS
(snRNAs), which process pre-mRNA (Kramer, 1996), ribonuclease MRP RNAS, which

cleave rRNA precursors (Lopez et al., 2009), or precursor tRNAs, which contain introns

43

 

in extended anticodon loops (Swerdlow and Guthrie, 1984). These non-coding RNAS

 

KWJV-_

have unique secondary structures and likely possess intermediate stabilities, lacking the
decay elements present in mRNAs or the protein protection provided rRNAs (Guhaniyogi
and Brewer, 2001; Merryman et al., 1999). Genome copy-number bias could also be
eliminated through concurrent DNA analysis. Real-time PCR amplification of cDN A
could be normalized to amplification of the corresponding DNA, with cDNA primers
spanning intron-exon boundaries and preventing DNA amplification.

Despite the problems encountered during this study, two of the RNAS displayed
positive results using aged bloodstain cDNAs, meaning it is possible to detect RNA from

samples aged up to five years. The fluctuating degradation pattern observed for 18S and

tRNAval could limit its forensic applicability, but was based on data gathered from a

limited number of aged bloodstains. An analysis of samples collected more frequently
over a longer period of time could establish whether a more predictable pattern of
degradation between these two markers exists. Even if a precise time of stain deposition
could not be ascertained, an aging method based on RNA degradation may be used to
establish whether a biological stain has probative value. This could aid investigators in
determining whether a location was the scene of a crime, or if a biological stain should

undergo further DNA analysis.

REFERENCES l

 

Abelson, H.T., Johnson, L.F., Penman, S. and Green, H. 1974. Changes in RNA in
relation to growth of the fibroblast. II. The lifetime of mRN A, rRNA and tRNA in
resting and growing cells. Cell 1:161-165.

ABI PRISM 7700 (TaqMan® assay) Amplification Curve. 2009. Cosmo Bio Co., Ltd.
website. Available at
<http://www.cosmobio.co.jp/export_e/products/molecular/products_TYB_200609
07.asp>.

Achsel, T. and Gross, HI. 1993. Identity determinants of human tRNAser : sequence

elements necessary for serylation and maturation of a tRN A with a long extra
arm. EMBO Journal 12: 3333—3338.

Alexandrov, A., Chemyakov, 1., Cu, W., Hiley, S.L., Hughes, T.R., Grayhack, E]. and
Phizicky, EM. 2006. Rapid tRNA decay can result from lack of nonessential
modifications. Molecular Cell 21: 87—96.

Anderson, S., Howard, B, Hobbs,.G. and Bishop, C. 2005. A method for determining
the age of a bloodstain. Forensic Science International 148: 37—45.

Arnold, G.J., Schmutzler, C., Thomann, U., Van Tol, H. and Gross, H]. 1986. The

human tRNAval gene family: organization, nucleotide sequences and homologous
transcription of three single-copy genes. Gene 44(2): 287-297.

Bas, A., Forsberg, G., Hammarstrom, S. and Hammarstrom, ML. 2004. Utility of the
housekeeping genes 18S, B-actin and glyceraldehyde-3-phosphate dehydrogenase
for normalization in real-time quantitative reverse transcriptase-polymerase chain
reaction analysis of gene expression in human T lymphocytes. Scandinavian
Journal of Immunology 59(6): 566-573.

Bauer, M., Polzin, S. and Patzelt, D. 2003. Quantification of RNA degradation by semi-
quantitative duplex and competitive RT-PCR: a possible indicator of the age of
bloodstains? Forensic Science International 138: 94—103.

Bjtirk, G.R., Ericson, J .U., Gustafsson, C.E.D., Hagervall, T.G., Jdnsson, Y.H. and
Wikstrtim, M. 1987. Transfer RNA modification. Annual Review of
Biochemistry 56: 263—287.

Bloch, W. 1991. A biochemical perspective of the polymerase chain reaction.
Biochemistry 30: 2735—2747.

Bolognani, F. and Perrone-Bizzozero, NI 2008. RNA-protein interactions and control
of mRNA stability in neurons. Journal of Neuroscience Research 86: 481—489.

45

Bustin, SA. and Nolan, T. 2004. Pitfalls of quantitative real-time reverse-transcription
polymerase chain reaction. Journal of Biomolecular Techniques 15: 155—166.

 

Carraro, G., Albertin, G., Fomeris, M. and Nussdorfer, G.G. 2005. Similar sequence-
free amplification of human glyceraldehyde-3-phosphate dehydrogenase for real
time RT-PCR applications. Molecular and Cellular Probes 19(3): 181—186.

Craig, L.C., Wang, L.P., Lee, M.M., Pirtle, LL. and Pirtle, L.M. 1989. A human tRNA
gene cluster encoding the major and minor valine tRNAs and a lysine tRNA.
DNA 8:457-471.

Davis, A. 2005. Cells 101: Business Basics. In: Inside the Cell. National Institutes of
Health publication. Available at
<http://publications.nigms.nih.gov/insidethecell/pdf/inside_the_cell.pdf>.

de Pouplana, LR. and Schimmel, P. 2001. Operational RNA code for amino acids in
relation to genetic code in evolution. Journal of Biological Chemistry 276(10):
6881—6884.

Deshmukh, M., Tsay, Y., Paulovich, AG. and Woolford, J .L. 1993. Yeast ribosomal
protein L1 is required for the stability of newly synthesized 5S rRN A and the
assembly of 60S ribosomal subunits. Molecular and Cellular Biology 13(5):
2835—2845.

Dheda, K., Huggett, J .F., Bustin, S.A., Johnson, M.A., Rook, G. and Zumla, A. 2004.
Validation of housekeeping genes for normalizing RNA expression in real-time
PCR. Biotechniques 37(1): 112—117.

Eck, J ., Chainey, 8., Cameron, J ., Leitner, M. and Wilson, R. 2005. Mapping crime:
Understanding hot spots. US. National Institute of Justice Special Report.

Engelke, DR. and Hopper, AK. 2006. Modified view of tRN A: stability amid sequence
diversity. Molecular Cell 21: 144—145.

Foran, D.R., Gehring, M.E., and Stallworth, SE. 2009. The recovery and analysis of
mitochondrial DNA from exploded pipe bombs. Journal of Forensic Sciences
54(1): 90—94.

Goh, C., Lan, N., Douglas, S.M., Wu, B., Echols, N., Smith, A., Milbum, D., Montelione,
G.T., Zhao, H. and Gerstein, M. 2004. Mining the structural genomics pipeline:
identification of protein properties that affect high through-put experimental
analysis. Journal of Molecular Biology 336: 115—130.

46

Gowrishankar, G., Winzen, R., Bollig, F., Ghebremedhin, B., Redich, N., Ritter, B.,
Resch, K., Kracht, M. and Holtmann, H. 2005. Inhibition of mRN A
deadenylation and degradation by ultraviolet light. Biological Chemistry 386(12):
1287—1293.

Graifer, D., Molotkov, M., Styazhkina, V., Demeshkina, N., Bulygin, K., Eremina, A.,
Ivanov, A., Laletina, E., Ven’yaminova, A. and Karpova, G. 2004. Variable and
conserved elements of human ribosomes surrounding the mRNA at the decoding
and upstream sites. Nucleic Acids Research 32(11): 3282—3293.

Greatrix, BW. and van Vuuren, H.J. 2006. Expression of the HXT13, HXT15 and
HXT17 genes in Saccharomyces cerevisiae and stabilization of the HXTl gene
transcript by sugar-induced osmotic stress. Current Genetics 49: 205—217.

Guhaniyogi, J. and Brewer, G. 2001. Regulation of mRNA stability in mammalian cells.
Gene 265(1—2): 11-23.

Heid, C.A., Stevens, J ., Livak, KJ. and Williams, RM. 1996. Real time quantitative
PCR. Genome Research 6: 986—994.

Herruer, M.H., Mager, W.H., Raué, H.A., Verken, P., Wilms, E. and Planta, R.J. 1988.
Mild temperature shock affects transcription of yeast ribosomal protein genes as
well as the stability of their mRN As. Nucleic Acids Research 16(16): 7917—7929.

Hofreiter, M., Serre, D., Poinar, H., Kuch, M., and Piiiibo, S. 2001. Ancient DNA.
Nature 2: 353-359.

Holland, P.M., Abramson, R.D., Watson, R. and Gelfand, DH. 1991. Detection of
specific polymerase chain reaction product by utilizing the 5'-3' exonuclease

activity of Therrnus aquaticus DNA polymerase. Proceedings of the National
Academy of Sciences 88: 7276—7280.

Houseley, J. and Tollervey, D. 2009. The many pathways of RNA degradation. Cell
136(4): 763-776.

Ikemura, T. 1982. Correlation between the abundance of yeast transfer RNAS and the
occurrence of the respective codons in protein genes. Journal of Molecular
Biology 158: 573—597.

Ikemura, T. 1985. Codon usage and tRNA content in unicellular and multicellular
organisms. Molecular Biology and Evolution 2: 13—34.

Johnson, L.F., Abelson, H.T., Green, H. and Penman, S. 1974. Changes in RNA in
relation to growth of the fibroblast. I. Amounts of mRNA, rRNA, and tRN A in
resting and growing cells. Cell 1: 95—100.

47

 

 

Jona, G., Choder, M. and Gileadi, O. 2000. Glucose starvation induces a drastic
reduction in the rates of both transcription and degradation of mRN A in yeast.
Biochimica et Biophysica Acta 1491: 37—48.

Kadaba, S., Krueger, A., Trice, T., Krecic, A.M., Hinnebusch, AG. and Anderson, J.
2004. Genes & Development 18: 1227—1240.

Kobilinsky, L. 1992. Recovery and stability of DNA in samples of forensic science
Significance. Forensic Science Review 4: 67—87.

Kramer, A. 1996. The structure and function of proteins involved in mammalian pre-
mRN A splicing. Annual Review of Biochemistry 65: 367409.

Lopez, M.D., Rosenblad, MA and Samuelsson, T. 2009. Conserved and variable
domains of RNase MRP RNA. RNA Biology 6(3): 209—220.

Mathews, C., Van Holde, KB. and Ahem, K. 2000. Biochemistry. 3rd Edition. San
Francisco: Addison Wesley Longman.

Matveeva, O., Felden, B., Audlin, S., Gesteland, RF. and Atkins, J .F. 1997. A rapid in
vitro method for obtaining RNA accessibility patterns for complementary DNA
probes: correlation with an intracellular pattern and known RNA structures.
Nucleic Acids Research 25(24): 5010—5016.

Medhurst, A.D., Harrison, D.C., Read, S.J., Campbell, C.A., Robbins, M.J. and Pangalos,
MN. 2000. The use of TaqMan RT-PCR assays for semiquantitative analysis of
gene expression in CNS tissues and disease models. Journal of Neuroscience
Methods 98(1): 9—20.

Merryman, C., Moazed, D., Daubresse, G. and Noller, HF 1999. Nucleotides in 23S
rRNA protected by the association of 30S and 50S ribosomal subunits. Journal of
Molecular Biology 285(1): 107-1 13.

Morse, D.L., Carroll, D., Weberg, L., Borgstrom, M.C., Ranger-Moore, J. and Gillies,
R.J. 2005. Determining suitable internal standards for mRNA quantification of
increasing cancer progression in human breast cells by real-time reverse
transcriptase polymerase chain reaction. Analytical Biochemistry 342(1): 69—77.

N akai, Y., Nakai, M. and I-Iayashi, II. 2008. Thio-modification of yeast cytosolic tRN A
requires a ubiquitin-related system that resembles bacterial sulfur transfer
systems. Journal of Biological Chemistry 283(41): 27469—27476.

Niki, T., Iba, S., Tokunou, M., Yamada, T., Matsuno, Y. and Hirohashi, S. 2000.
Expression of vascular endothelial growth factors A, B, C, and D and their
relationships to lymph node status in lung adenocarcinoma. Clinical Cancer
Research 6: 2431—2439.

48

Noller, HF 1991. Ribosomal RNA and translation. Annual Review of Biochemistry 60:
191-227.

Ochberg, F. 2002. A primer on interviewing victims. In Simple and Complex Post-
Traumgtic Stress Disorder: Strategies for Comprehensive Treatment in Clinical
Practice. Edited by M. Williams and] . Sommer Jr. Haworth Press: 351-357.

 

Pergolizzi, R.G., Engelhardt, D.T. and Grunberger, D. 1978. Formation of
phenylalanine tRN A lacking the Wye base in Vero cells during methionine
starvation. Journal of Biological Chemistry 253: 6341—6343.

Puglisi, J .D., Piitz, J ., Florentz, C. and Giegé, R. 1993. Influence of tRNA tertiary
structure and stability on aminoacylation by yeast aspartyl-tRNA synthetase.
Nucleic Acids Research 21(1): 41—49.

Raghavan, A., Ogilvie, R.L., Reilly, C., Abelson, M.L., Raghavan, S., Vasdewani, J .,
Krathwohl, M. and Bohjanen, RR. 2002. Genome-wide analysis of mRNA
decay in resting and activated primary human T lymphocytes. Nucleic Acids
Research 30(24): 5529—5538.

Ratcliffe, J. 2002. Aoristic signatures and the spatio-temporal analysis of high volume
crime patterns. Journal of Quantitative Criminology 18(1): 23-43.

Rich, A. and Rathandary, UL. 1976. Transfer RNA: Molecular structure, sequence,
and properties. Annual Review of Biochemistry 45: 805—860.

Sahmi, M., Nicola, ES. and Price, CA. 2006. Hormonal regulation of cytochrome P450
aromatase mRNA stability in non-luteinizing bovine granulosa cells in vitro.
Journal of Endocrinology 190: 107—115.

Saiki R.K., Gelfand D.H., Stoffel S., Scharf S.J., Higuchi R., Horn G.T., Mullis KB. and
Erlich HA. 1988. Primer-directed enzymatic amplification of DNA with a
therrnostable DNA polymerase. Science 239:487—491.

Schlegel, R.A., Iversen, P. and Rechsteiner, M. 1978. The turnover of tRNAs
microinjected into animal cells. Nucleic Acids Research 5(10): 3715—3729.

Sharova, L.V., Sharov, A.A., Nedorezov, T., Piao, Y., Shaik, N. and Ko, M.S.H. 2009.
Database for mRN A half-life of 19,977 genes obtained by DNA microarray
analysis of pluripotent and differentiating mouse embryonic stem cells. DNA
Research 16: 45—58.

Sollner-Webb, B. and Tower, J. 1986. Transcription of cloned eukaryotic ribosomal
RNA genes. Annual Review of Biochemistry 55: 801—830.

49

 

Stults, D.M., Killen, M.W., Pierce, H.H. and Pierce, A.J. 2008. Genomic architecture
and inheritance of human ribosomal RNA gene clusters. Genome Research
18: 13-18.

Swerdlow, H. and Guthrie, C. 1984. Structure of intron-containing tRNA precursors.
The Journal of Biological Chemistry 259(8): 5197—5207.

TaqMan® Gene Expression Assays for Validating Hits from Fluorescent Microarrays.

2006. Applied Biosystems White Paper TaqMan® Gene Expression Assays
document. Available at
<http://www3.appliedbiosystems.com/cms/groups/mcb_marketing/documents/ge
neraldocuments/cms_040 l 98.pdf>.

Tarone, A., Jennings, K. and Foran, D. 2007. Aging blow fly eggs using gene
expression: a feasibility study. Journal of Forensic Sciences 52(6): 1350—1354.

Temin, HM. and Mizutani, S. 1970. Viral RNA-dependent DNA polymerase: RNA-
dependent DNA polymerase in virions of Rous Sarcoma Virus. Nature 226:
1211—1213.

Wang, S. and K001, ET. 1995. Origins of the large differences in stability of DNA and
RNA helices: C-5 methyl and 2’-hydroxyl effects. Biochemistry 34(12): 4125-
4132.

Weedn, V.W. and Roby, R.K. 1993. Forensic DNA Testing. Archives of Pathology and
Laboratory Medicine 1 17(5): 486—49 1.

Wickenheiser, R. 2002. Trace DNA: A review, discussion of theory, and application of
the transfer of trace quantities of DNA through skin contact. Journal of Forensic
Sciences 47: 442—450.

Wilusz, C.J., Wormington, M., and Peltz, SW. 2001. The cap-to-tail guide to mRN A
turnover. Nature Reviews Molecular Cell Biology 2: 237—246.

Wust, Cl. and Rosen, L. 1972. Aminoacylation and methylation of tRN A as a function
of age in the rat. Experimental Gerontology 7: 335—343.

Yarian, C., Townsend, H., Czestkowski, W., Sochacka, E., Malkiewicz, A., Guenther, R.,
Miskiewicz, A. and Agris, P. 2002. Accurate translation of the genetic code
depends on tRN A modified nucleosides. Journal of Biological Chemistry
277(19): 16391—16395.

Zhang, J. and Byrne, CD. 1999. Differential priming of RNA templates during cDNA

synthesis markedly affects both accuracy and reproducibility of quantitative
competitive reverse transcriptase PCR. Biochemical Journal 337: 231-241.

50

 

Zimmermann, K. and Mannhalter, J .W. 1996. Technical aspects of quantitative
competitive PCR. Biotechniques 21(2): 268-272, 274—279.

51

 

lllllilililllllllllllillilllilllll

Hill

29

3 03063 5274

31