THE ROLE OF NDR1 IN PATHOGEN DEFENSE AND ARABIDOPSIS PHYSIOLOGY
By
Caleb Knepper

A DISSERTATION
Submitted to
Michigan State University
In partial fulfillment of the requirements
For the degree of
DOCTOR OF PHILOSOPHY
Genetics
2011

ABSTRACT
THE ROLE OF NDR1 IN PATHOGEN DEFENSE AND ARABIDOPSIS PHYSIOLOGY
By
Caleb Knepper

Arabidopsis thaliana NDR1 (NON-RACE SPECIFIC DISEASE RESISTANCE-1), a plasma
membrane localized protein, plays a critical role in resistance mediated by the CC-NB-LRR class
of resistance (R) proteins, which includes RPS2, RPM1 and RPS5. Infection with Pseudomonas
syringae pv. tomato DC3000 expressing the bacterial effector proteins AvrRpt2, AvrB and
AvrPphB activate resistance through the activation of the aforementioned R proteins. Whereas
the genetic requirement for NDR1 in plant disease defense signaling has been established, the
global physiological role for NDR1 in Arabidopsis remained unknown. With the use of
homology modeling, NDR1 was predicted to have a high degree of structural similarity to
Arabidopsis LEA14, a protein implicated in abiotic stress responses, as well as to mammalian
integrins, well characterized proteins involved in adhesion and signaling. This structural
homology led to the examination of a physiological role for NDR1 in preventing fluid loss and
maintaining the plasma membrane-cell wall continuum. Results demonstrated a substantial
alteration in pathogen-induced electrolyte leakage in ndr1-1 mutant plants. As an extension of
these analyses, using a combination of genetic and cell biology-based approaches, a role was
identified for NDR1 in mediating plasma membrane-cell wall (PM-CW) adhesions through a
specific protein motif. With the establishment of a distinct physiological role in PM-CW
adhesion for NDR1 and the identification of a compromised PAMP-triggered immune response
in ndr1-1, the focus shifted to the integration of NDR1 in early resistance signaling including
pathogen perception, PAMP-triggered immunity (PTI) and effector delivery, recognition and

signaling. To this end, the PAMP-specific flg22- and elf26-dependent signaling mechanisms
were analyzed to elucidate the breadth of NDR1 function in PTI. Mechanisms identified included
a role for NDR1 in the regulation of stomatal closure in response to the PAMP flg22 and the
hormone abscisic acid as well as a reduction in MAPK3/6 expression after both flg22 and elf26
exposure. Furthermore, the loss of NDR1 alters the type-three secretion system mediated
delivery of the P. syringae effector AvrRpt2 to the cell interior. The structural similarities of
NDR1 to LEA14, an abiotic stress protein, coupled with the identification of roles for NDR1 in
maintaining PM-CW adhesion and regulation of stomata led to the examination of potential
abiotic stress related functions for NDR1. By monitoring leaf relative water content as well as
electrolyte leakage under severe drought conditions, NDR1 was shown to be required for drought
tolerance in Arabidopsis. Further analysis revealed that NDR1 mediated drought tolerance is an
ABA-dependent process and the over-expression of the NDR1 protein provides increased stress
tolerance in Arabidopsis. Taken together, these data indicate not only a broad role for NDR1 in
defense signaling through both PAMP and effector mediated pathways, but also in mediating
basic physiological functions in Arabidopsis through the maintenance of the PM-CW continuum
and a requirement in stomatal aperture dynamics.

I would like to dedicate this dissertation to my loving wife, Amy.
Without her I could not have completed my degree.

iv

ACKNOWLEDGEMENTS

First I would like to thank Brad Day for taking me into his lab. As a new faculty Brad was
definitely taking a chance on a 22 year old student fresh out of Kansas State University when he
agreed to take me in. We both grew along with the lab. I would also like to thank the members of
the Day lab, both past and present for all their help with experiments as well as manuscript
writing, they put up with me for many years which was not always easy.

I would also like to thank my committee members Drs. George Sundin, Jonathan Walton,
Beronda Montgomery, and formerly Markus Pauly for helping to keep me on track and
supporting me when I needed it.

I also must thanks the National Science Foundation for their financial support of the Day lab
during my time there.

I also want to thank my parents and in-laws for being supportive even though I relocated 900
miles away and my work often seemed totally foreign to them.

Finally I want to thank my wife for always being there for me on both the good days as well as
the bad and staying encouraging through all our years in Michigan; also, our dog Missy for
checking on me those late nights in the office and reminding me when it was time to call it a
night.

v

TABLE OF CONTENTS

LIST OF TABLES .......................................................................................................................viii
LIST OF FIGURES .....................................................................................................................ix
CHAPTER 1: The Arabidopsis thaliana-Pseudomonas syringae Pathosystem: The MolecularGenetic Landscape of Host-Pathogen Interactions.
Abstract ............................................................................................................................2
Introduction ......................................................................................................................3
Host Architecture and Physiology ...................................................................................9
The Host-Pathogen Interface: Layered Defenses, Resistance and Susceptibility............20
Final Thoughts .................................................................................................................33
Acknowledgements ..........................................................................................................35
Figures..............................................................................................................................36
Literature Cited ................................................................................................................45
CHAPTER 2: Arabidopsis NDR1 is an integrin-like protein with a role in fluid loss and plasma
membrane-cell wall adhesion.
Abstract ............................................................................................................................60
Introduction ......................................................................................................................61
Results ..............................................................................................................................65
Discussion ........................................................................................................................75
Materials and Methods .....................................................................................................81
Acknowledgements ..........................................................................................................88
Figures..............................................................................................................................89
Literature Cited ................................................................................................................109
CHAPTER 3: Arabidopsis NDR1 is required for robust activation of PAMP Triggered Immunity
Abstract ............................................................................................................................118
Introduction ......................................................................................................................119
Results ..............................................................................................................................123
Discussion ........................................................................................................................130
Materials and Methods .....................................................................................................136
Acknowledgements ..........................................................................................................140
Figures..............................................................................................................................141
Literature Cited ................................................................................................................156
CHAPTER 4: NDR1 is involved in drought stress via an abscisic acid dependent pathway
Introduction ......................................................................................................................163
Results ..............................................................................................................................165
Discussion ........................................................................................................................170
Materials and Methods .....................................................................................................173
vi

Acknowledgements ..........................................................................................................177
Figures..............................................................................................................................178
Literature Cited ................................................................................................................187

CHAPTER 5: Conclusions and Future Directions
Conclusions ......................................................................................................................193
Future Directions .............................................................................................................197
Figures..............................................................................................................................201
Literature Cited ................................................................................................................203
APPENDIX
Supplemental Methods.....................................................................................................206
Supplemental Formulas ...................................................................................................207
Supplemental Tables ........................................................................................................208
Supplemental Figures.......................................................................................................217
Literature Cited ................................................................................................................232

vii

LIST OF TABLES

Table S2.1: The effect of exogenous peptide application on the HR in Col-0 and ndr1-1 mutant
plants ............................................................................................................................................208
Table S2.2: Primers used in Chapter 2 for qRTPCR and for the construction of the RGD and
AAA site-directed mutant constructs in NDR1............................................................................209
Table S2.3: P values of Pst DC3000 growth assays ...................................................................211
Table S3.1. DNA primers used in Chapter 3 for quantitative real-time PCR .............................215
Table S4.1. DNA primers used in Chapter 4 for quantitative real-time PCR .............................216

viii

LIST OF FIGURES

Figure 1.1: The Arabidopsis thaliana-Pseudomonas syringae pathosystem. .............................36
Figure 1.2: Pathogen Associated Molecular Pattern Recognition and the Activation of PAMPTriggered Immunity .....................................................................................................................37
Figure 1.3: Pathogen Effector Recognition and the Activation of Effector-Triggered Immunity
......................................................................................................................................................39
Figure 1.4: A model for the Regulation and Activation of R-Protein Mediated Defense Signaling
in Arabidopsis. .............................................................................................................................42
Figure 2.1: Homology modeling of NDR1 with the integrin-like late embryogenesis protein,
LEA14 ..........................................................................................................................................89
Figure 2.2: Enhanced nutrient leakage in the ndr1-1 mutant following inoculation with Pst
DC3000 ........................................................................................................................................90
Figure 2.3: Relative mRNA expression of biotic and abiotic responsive genes in ndr1-1
following Pst DC3000 inoculation ..............................................................................................93
Figure 2.4: NDR1 associates with itself and RIN4 in planta, and this association is unaffected by
mutations in the NGD site............................................................................................................96
Figure 2.5: ndr1-1 exhibits altered PAMP responses .................................................................98
Figure 2.6: Growth of Pst DC3000 in Arabidopsis is altered by mutations to the NGD site of
NDR1 ...........................................................................................................................................100
Figure 2.7: ndr1-1 mutant plants exhibit altered plasmolysis and plasma membrane-cell wall
focal adhesions .............................................................................................................................104
Figure 2.8: Application of exogenous peptides can alter the plasma membrane-cell wall
adhesion in WT Col-0 ..................................................................................................................107
Figure 3.1: The stomata of ndr1-1 are non-responsive to flg22 peptide.....................................141
Figure 3.2: ndr1-1 displays altered PAMP responses to elf26 ...................................................142
Figure 3.3: AvrRpt2:Cya effector fusion delivery is diminished in the ndr1-1 mutant..............144

ix

Figure 3.4: Delivery of AvrRpt2:Cya by Pst DC3000 is not reduced in the ndr1 mutant by flg22
priming of PTI..............................................................................................................................146
Figure 3.5: The growth of P. syringae DC3000 deficient in 28 effectors (D28E) is increased in
the ndr1-1 mutant .........................................................................................................................147
Figure 3.6: The oxidative burst response is reduced in the ndr1-1 mutant following PAMP
perception .....................................................................................................................................149
Figure 3.7: Benzo(1,2,3)-Thiadiazole-7-Carbothioic Acid S-Methyl Ester (BTH) restores
resistance in ndr1-1 in a PTI specific manner .............................................................................152
Figure 3.8: Summary of NDR1’s involvement in the perception of Pst DC3000 and the
subsequent activation of defense signaling in Arabidopsis .........................................................154
Figure 4.1: Relative water content, electrolyte leakage and RD29B and ERD4 marker genes
expression in response to drought stress ......................................................................................178
Figure 4.2: The stomata of ndr1-1 are non-responsive to exogenous abscisic acid application
......................................................................................................................................................182
Figure 4.3: The growth of the coronatine deficient mutant strain Pseudomonas syringae DC3118
is increased in the ndr1-1 mutant .................................................................................................183
Figure 4.4: Abscisic acid pretreatment suppresses pathogen defense responses in Col-0, but not
in ndr1-1.......................................................................................................................................185
Figure 5.1: Model of NDR1 location and interconnectivity .......................................................201
Figure S2.1: Predicted structural models of Arabidopsis NDR1 using I-TASSER and PHYRE
homolog modeling servers ...........................................................................................................217
Figure S2.2: Homology modeling of the predicted -sheet torus of NDR1 with LEA14 and
fibronectin type III domain of human Integrin beta-4 (10.2210/pdb2yrz/pdb) ...........................218
Figure S2.3: Electrolyte leakage conductance measurements ....................................................220
Figure S2.4: Expression of aquaporin homolog family mRNAs following inoculation with Pst
DC3000 expressing AvrB or AvrPphB........................................................................................223
Figure S2.5: Expression of NDR1, defense marker genes, and RPS2 in Arabidopsis following
inoculation with Pst DC3000 .......................................................................................................225
Figure S2.6: Expression levels of HA- and T7-tagged NDR1 constructs utilized .....................228
Figure S3.1: mRNA expression of FRK1 and PHI1 ...................................................................229
x

CHAPTER 1

The Arabidopsis thaliana-Pseudomonas syringae Pathosystem: The Molecular-Genetic
Landscape of Host-Pathogen Interactions.

This review was originally published in The Arabidopsis Book.
Knepper C and Day B (2010) From Perception to Activation: The Molecular-Genetic and
Biochemical Landscape of Disease Resistance Signaling in Plants: May 14, 2010. In The
Arabidopsis Book. Rockville, MD: American Society of Plant Biologists. doi: 10.1199/tab.0124,
http://www.aspb.org/publications/arabidopsis/. © 2010 The American Society of Plant
Biologists.

1

ABSTRACT

More than 60 years ago, H.H. Flor proposed the “Gene-For-Gene” hypothesis, which described
the genetic relationship between host plants and pathogens. In the decades that followed Flor’s
seminal work, our understanding of the plant-pathogen interaction has evolved into a
sophisticated model, detailing the molecular genetic and biochemical processes that control hostrange, resistance signaling and susceptibility. The interaction between plants and microbes is an
intimate exchange of signals that has evolved for millennia, resulting in the modification and
adaptation of pathogen virulence strategies and host recognition elements. In total, plants have
evolved mechanisms to combat the ever-changing landscape of biotic interactions bombarding
their environment, while in parallel, plant pathogens have co-evolved mechanisms to sense and
adapt to these changes. On average, the typical plant is susceptible to attack by dozens of
microbial pathogens, yet in most cases, remains resistant to many of these challenges. The sum
of research in our field has revealed that these interactions are regulated by multiple layers of
intimately linked signaling networks. As an evolved model of Flor’s initial observations, the
current paradigm in host-pathogen interactions is that pathogen effector molecules, in large part,
drive the recognition, activation and subsequent physiological responses in plants that give rise
to resistance and susceptibility. In this Chapter, we will discuss our current understanding of the
association between plants and pathogens, detailing the pressures placed on both host and
microbe to either maintain resistance, or induce susceptibility and disease. From recognition to
transcriptional reprogramming, we will review current data and literature that has advanced the
classical model of the Gene-for-Gene hypothesis to our current understanding of basal and
effector triggered immunity.

2

Introduction

Since the last Arabidopsis Book Chapter outlining the Arabidopsis-Pseudomonas syringae
interaction (Katagiri et al., 2002), there have been a number of advances in our understanding of
how plants perceive and respond to biotic stress. In this respect, Arabidopsis has continued the
lead the way in these advances, both in regard to understanding host defenses, as well as
uncovering pathogen virulence strategies. A plant’s response to environmental pressures is
guided by its ability to sense and process stimuli. So too is a plant’s ability to detect and respond
to pathogen infection. In total, these processes are regulated in large part by the genetic and
biochemical exchange between host and pathogen. In this Chapter, we will outline our current
understanding of how plants and pathogens communicate through the balance of resistance and
susceptibility. A “dance”, a “molecular arms race”, or simply survival, the interaction between a
plant and pathogen represents a sophisticated interplay of genetic and biochemical processes,
ultimately leading to the demise of either the host or the invader. Here, we will focus on the
architecture of the plant immune response, highlighting the key advances in our understanding of
host cell physiology, the activation of specific defense responses, and too, the evolution of
strategies by the invading pathogen to shut down defense signaling in plants.

In a recent review by Alan Jones and colleagues (Jones et al., 2008), a parallel is drawn between
research advances in humans and those that can be directly attributed to studies first conducted in
the model plant Arabidopsis thaliana. None too surprising, our understanding of human health
and disease has been greatly advanced by our understanding of similar processes in plants. For
example, approximately 70% of the genes associated with the development of cancer(s) in

3

humans have orthologues present in Arabidopsis. Furthermore, with respect to advances in
research first undertaken in Arabidopsis and subsequently “translated” in human disease
research, innate immune receptor identification in plants have made significant impacts in our
understanding of disease signaling in humans; resistance proteins were first identified and
characterized in Arabidopsis (ca. 1994) before their counterparts (e.g.,
NOD/CARD/CATERPILLAR) in humans (ca. 2000; Ting et al., 2006). Jones and colleagues
cite additional examples where research findings in Arabidopsis have advanced the broader study
of biology in humans, including research in the area of circadian rhythms (Ahmad and
Cashmore, 1993), RNA silencing (Hamilton and Baulcombe, 1999) and G-protein signaling
(e.g., Temple and Jones, 2007).

Disease and defense signaling in plants, as we will outline throughout this Chapter, is a
complicated, highly regulated process, involving the coordinated signaling networks of both host
and pathogen. In this regard, the development of model systems that are both tractable and
translational have been critical to addressing the many facets of the host-pathogen interface.
Below, we will give a broad overview of several of the processes that typify studies in the area of
plant-pathogen interactions, and too, highlight their significance towards increasing our
understanding of host defense signaling in response to pathogen infection.

a. Pseudomonas syringae

Pseudomonas syringae is a gram-negative plant pathogenic bacterium that causes bacterial speck
disease on tomato (Pedley and Martin, 2003; http://pseudomonas-syringae.org/). Towards

4

developing the laboratory-based tools we now have at our disposal, several strains were
identified in the 1980’s that would infect Arabidopsis (Katagiri et al., 2002), giving birth to a
new era in molecular plant pathology. Since the establishment of the Arabidopsis-Pseudomonas
pathosystem, research has explored nearly all facets of the interaction, from epiphytic
colonization of the leaf surface (Hirano and Upper, 2000), pathogen entry through, and
manipulation of, stomata (Melotto et al., 2006), as well as the delivery of effectors (Lindeberg et
al., 2009) and induction of cell death (Figure 1.1; reviewed in Kim et al., 2008). As a
consequence of standard mechanisms of dispersal (i.e., rain splash, insects, animals, humans,
etc.), P. syringae establishes itself on the surface of plants as an epiphyte, before gaining entry
into the intercellular space (Hirano and Upper, 2000). Once inside the intercellular space, the
pathogen employs a type III secretion system (T3SS) for the delivery of effectors proteins
directly into the host cell. In total, it is the action of these effectors that promote pathogenicity,
shutting down critical host processes required to fight pathogen infection. Thus, the T3SS is
essential for the development of disease symptoms and bacterial multiplication (reviewed in
Lindeberg et al., 2009).

In 2009, researchers in the field of plant-microbe interactions marked the 25th anniversary since
the cloning of the first bacterial type III secreted effector protein. In the November 2009 issue of
the journal Molecular Plant Pathology, Brian Staskawicz reflects on the advances in the field of
molecular plant pathology since his lab’s seminal discovery (Staskawicz et al., 1984; Staskawicz
et al., 2001; Staskawicz, 2009). Since 1984, advances in the area of plant-pathogen interactions
have shaped our understanding of microbial genetics and pathogenicity, as well as plant
physiology and evolution (reviewed in Cui et al., 2009). Collectively, these bacterial proteins,

5

called “effectors”, function to manipulate host cell processes for the purpose of enhancing
infection and pathogen proliferation. While the function of the full suite of effector proteins
remains unknown, what is known is that the complex genetic and biochemical interactions
between pathogen effectors and their cognate host proteins evokes specific responses, that when
recognized, elicit resistance, or when evaded, promote susceptibility.

b. Fungal and Oomycete Pathogens

Much like the bacterial virulence strategies described above, fungi and oomycete pathogens have
also evolved mechanisms to infect and colonize plants. Beyond the cell surface components,
such as Pathogen Associated Molecular Patterns (PAMPs), fungal pathogens have the ability to
stimulate the release of host cell wall molecules through the production of hydrolytic enzymes
during host invasion. These molecules, termed DAMPs (Danger-Associated Molecular
Patterns), can be recognized by the plant and subsequently activate the defense response
(Matzinger, 2007; Denoux et al., 2008). In addition to secreted hydrolytic enzymes and toxins,
fungal and oomycete pathogens also encode for a suite of effector proteins, putatively similar in
function to their bacterial counterparts (reviewed in De Wit et al., 2009; Schornack et al., 2009).
However, one of the major differences with regard to effector action between bacterial pathogens
and fungal or oomycete pathogens lies in the delivery of the effectors themselves. While
bacteria rely on the T3SS, fungal and oomycete pathogens do not utilize a T3SS, and must
instead rely on other mechanisms for effector delivery. At present, the mechanism(s) required
for fungal/oomycete effector delivery is unknown.

6

In general, fungal effectors fall into two groups: those that are secreted into the host apoplast,
and those that are translocated into the host cells (De Wit et al., 2009). In fungal pathogens, the
mechanism by which the effectors are translocated remains elusive, and in oomycetes, while the
specific mechanism of translocation is unknown, a conserved motif has been identified as being
sufficient for effector uptake by host cells (Whisson et al., 2007). In short, many of these
cytoplasmic oomycete effectors consist of an N-terminal region involved in secretion and
translocation, as well as a C-terminal domain possessing the biochemical activity of the effector
itself (Morgan and Kamoun, 2007). In recent years, a signature motif at the N-terminus (i.e.,
Arg-X-Leu-Arg; RxLR) has been identified and characterized as a critical component that not
only guides oomycete effector identification (i.e., bioinformatics), but is also a critical
component in the function of these secreted proteins during host interactions (Whisson et al.,
2007).

c. Non-host Systems and Resistance

As we will discuss in more detail below, a pathogen’s ability to colonize any given host is
regulated in large part by its ability to avoid structural and preformed defenses, as well as
abrogate or circumvent induced host-specific defenses. This begs the question: What are the
initial responses by both plant and pathogen that determine host-specificity? Moreover, what
differentiates host-specific from non-host interactions, and how is defense signaling regulated in
each? To answer this question, research in the area of non-host resistance has revealed at least
two layers of signaling: pre- and post-invasion resistance (reviewed in Mysore and Ryu, 2004).
While most plants are resistant to most pathogens, the cellular and genetic responses that tip this

7

balance in favor of the pathogen have been best characterized using non-adapted pathogens such
as the cucurbit powdery mildew pathogen Golovinomyces cichoracearum, and Blumeria
graminis, a powdery mildew of the grasses. As host-specific pathogens, pathogen entry is
effective, with a penetration rate of approximately 70% on their respective hosts (reviewed in
Lipka et al., 2008). However, when Arabidopsis plants are inoculated, this rate falls
dramatically. Herein lies the premise for the further characterization and identification of
components required for pathogen entry and host-mediated responses to infection.

To identify and define the host mechanisms associated with resistance to non-adapted pathogens,
initial work began with an extensive mutagenesis screen to identify host factors responsible for
abrogating pathogen entry (Collins et al., 2003). To this end, early work demonstrated that
plants attempt to prevent penetration by fungal pathogens through the formation of cell wall
appositions termed papillae (Aist and Bushnell, 1991). For example, ethyl methanesulfonate
(EMS) mutagenized Arabidopsis populations were screened for increased penetration by the
non-adapted powdery mildew fungus Blumeria graminis f. sp. hordei (Collins et al., 2003; Lipka
et al., 2005; Stein et al., 2006). Three penetration, or PEN, mutants have been characterized.
PEN1 encodes for an Arabidopsis syntaxin, which is predicted to function in the targeted
trafficking of secretory vesicles to sites of papillae formation in response to attempted fungal
pathogen penetration (Collins et al., 2003). PEN2 and PEN3 have been shown to function in the
same pathway (Stein et al., 2006), also at sites of attempted fungal penetration. Subsequent work
has gone on to show that PEN2 is a myrosinase functioning in the glucosinolate pathway (Clay et
al., 2009), while PEN3 is an ABC (ATP-binding cassette) transporter (Stein et al., 2006) thought
to be involved in the efflux of antimicrobial compounds to sites of attempted pathogen

8

penetration. In total, these observations demonstrate that preformed responses are critical to the
ability of the plant to resist penetration. As such, the suite of pre-invasive defense responses
present in plants is sufficient to limit non-host pathogen entry; these include generalized
responses such the deposition of callose at the site of attempted pathogen entry (Aist and
Bushnell, 1991; reviewed in Hématy et al., 2009), as well as a dynamic re-organization of the
host actin cytoskeleton. These responses coincide with increased cellular trafficking of
organelles and defense signaling molecules to the site of infection. As will be a common theme
throughout this Chapter, considerable overlap in defense signaling exists both in the initial
perception and activation of cell signaling to numerous pathogen species, as well as critical
defense signaling nodes associated with signal transduction amplification and the onset of
resistance. Interestingly, however, the PEN mutations have not been reported to compromise
resistance to bacterial pathogens, such as P. syringae (Lipka et al., 2008). These results suggest
that restriction of host range to phytopathogens is regulated by additional other mechanisms.

Host Architecture and Physiology

The plant cell is a remarkable evolutionary product of chemical, mechanical and electrical
engineering. The structural capacity of the plant cell to resist mechanical forces from biotic and
abiotic pressures is evidenced through the strength and elasticity of the cell wall (reviewed in
Hématy et al., 2009). As discussed below, the cell wall can serve as a passive barrier to
pathogen entry, as well as the site of first contact between host and pathogen. Serving in a more
dynamic capacity, plants have the ability to actively reinforce their cells walls in response to a

9

pathogen, such as in attempted fungal penetration, by the deposition of callose at sites of
infection (Aist and Bushnell, 1991).

Preformed Defenses

The leaf surface presents a formidable barrier to pathogen colonization and entry. Studded with
trichomes, the leaf’s waxy surface provides an unwelcoming environment from which pathogens
must attempt to colonize and gain entry into the host. The outermost layers of the leaf epidermis
consist of a modification to the cell wall known as a cuticle (Nawrath, 2006), which is comprised
of cutin and waxes secreted onto the exterior surface of the cell (Jeffree, 2006). In addition to
serving as a barrier to pathogen entry, the cutin is indispensible for the prevention of water loss
from the leaf surface (Aharoni et al., 2004). There is growing evidence for the cuticle as a major
player in Arabidopsis resistance to a wide variety of pathogen types from the bacterial pathogen
P. syringae to the fungal pathogen Botrytis cinerea (reviewed in Reina-Pinto and Yephremov,
2009).

Once P. syringae gains entry to the leaf apoplast, it must still interact with the host cytoplasm in
order to acquire nutrients; thus, the basic plant cell wall still proves a substantial barrier to
pathogen entry. The rigid cell wall can therefore be viewed as a major constituent of resistance
to non-adapted pathogens (discussed below; reviewed in Hématy et al., 2009). While the
physical barriers to pathogen entry are substantial, additional preformed defenses, such as
chemical defenses, play ubiquitous roles in basal defense responses against pathogen infection.
Among the best-characterized modes of chemical defenses are the phytoanticipins, which

10

represent a diverse group of antimicrobial compounds present in the host before pathogen
infection (VanEtten et al., 1994). This is in contrast to phytoalexins, which are by definition
formed in response to pathogen infection, such as the well-characterized Arabidopsis
phytoalexin, camalexin (reviewed in Glawischnig, 2007). Camalexin, 3-thiazol-2'yl-indole, was
originally isolated from leaves of the crucifer Camelina sativa infected with Alternaria brassicae
(Browne et al. 1991), and was subsequently identified in Arabidopsis challenged with P.
syringae (Tsuji et al., 1992), and its production was found to be induced by a wide range of
stress conditions (reviewed in Glawischnig, 2007). However, production levels (and
concentration) vary greatly within and among associated stresses. As is the case with all
pathogen-induced defense responses in plants, phytoalexins are not an impenetrable barrier to
infection and subsequent proliferation. In support of this, multiple pathogens have been
identified that are able to tolerate camalexin production in Arabidopsis through a variety of
mechanisms. Isolates of the root rot fungus Rhizoctonia solani have the ability to degrade
camalexin through the 5-hydroxlyation of its indole ring, or by the formation of an oxazoline
derivative (Pedras and Khan, 1997, 2000). In the case of the fungal pathogen B. cinerea, both
resistant and sensitive isolates have been identified (Kliebenstein et al., 2005). This mechanism
of resistance is mediated in B. cinerea through the activity of an ABC transporter, BcatrB, which
acts as an efflux pump for removing camalexin from the cell (Stefanato et al., 2009).

Hormones and Defense Signaling

Extensive research has unraveled the intimate link between plant development, responses to the
environment and pathogen perception. Through all of this, the role of plant hormones has been

11

revealed as a central, key component in not only regulating defense signaling responses within
infected cells, but also as a mediator of systemic signaling (reviewed in Spoel and Dong, 2008).
At a primary level, plant hormones are responsible for the integration and processing of
developmental and environmental cues. To this end, they are responsible not only for shaping
the dynamic regulatory processes that control development, reproduction and death, but also
priming the host cell for both biotic and abiotic stress responses. Of the major plant hormones,
salicylic acid (SA), jasmonic acid (JA) and ethylene have been shown to play key roles in
defense signaling in plants (reviewed in Bari and Jones, 2009).

It is widely known that pathogen infection affects plant development (Block et al., 2010;
Chandra and Huff, 2010), and in large part, this effect is manifested through perturbations in
hormone signaling within the host plant (Chen et al., 2007). As discussed above, pathogens have
evolved elaborate mechanisms to colonize and infect their host; typically through the
manipulation of host physiology by secreted pathogen effectors. During a typical infection, P.
syringae delivers approximately 32 effector proteins inside its host (Lindeberg et al., 2009). Of
these, one of the best characterized is AvrRpt2, a cysteine protease effector protein, whose
catalytic activity sets into motion a series of defense signaling responses which have become
hallmark tenets for the gene-for-gene and guard hypotheses. However, aside from AvrRpt2’s
well-established role in avirulence, studies investigating the manipulation of host physiology,
and more specifically hormone signaling, have revealed an intimate link between pathogen
effector action and hormone signaling. In 2007, Chen and colleagues (Chen et al., 2007)
demonstrated a link between AvrRpt2-mediated defense signaling and the elicitation of host
auxin biosynthesis. Phenotypically, plants expressing AvrRpt2 were found to be similar in

12

stature to plants over-expressing auxin; plants have longer primary roots, increased lateral root
formation and enhanced sensitivity to exogenously applied auxin (Sato and Yamamoto, 2008).
One interesting finding of this study was the link between AvrRpt2 action within the host cell
and hormone biosynthesis. In short, AvrRpt2-expressing plants were found to have elevated
levels of free indole-3-acetic acid (IAA). The link between host defense, pathogen virulence and
hormone perception was further supported as a consequence of enhanced disease symptom
development (Chen et al., 2007).

In an example analogous to manipulation of auxin biosynthesis by pathogens, described above,
recent evidence also suggests that SA inhibits pathogen growth by suppressing auxin signaling
(Wang et al., 2007). Through the use of expression profiling, Wang and colleagues (2007) found
that SA inhibits auxin-mediated signaling, partially countering the pathogen’s impact on
hormone-associated defense signaling. This work showed that the SA analog BTH
(benzothiadiazole-s-methyl ester) suppressed the expression of auxin responsive genes in an
NPR1-dependent manner. In total, this work demonstrated the host plant’s ability to
antagonistically co-regulate multiple hormone signaling networks in response to pathogen
infection, and with that, strengthens the hypothesis that plants may divert limited resources to
defense-related processes at the expense of plant growth when attacked by a pathogen.

Endocytosis, Trafficking and Cellular Dynamics

In recent years, advances in imaging and cell biology technologies have made possible the
observation of the dynamic responses to pathogen infection, such as increases in cellular

13

trafficking, (re)-localization of proteins following pathogen perception, as well as reorganization
of the actin cytoskeleton. In total, these collective works have not only enabled researchers to
glimpse the cellular processes that are impacted during pathogen infection, but to also identify
additional signaling components required for defense and resistance activation in plants. As we
discussed above, the primary defense response in plants following pathogen perception is
collectively referred to as PAMP-triggered immunity (PTI; Chisholm et al., 2006; Jones and
Dangl, 2006). In this regard, the flagellin recognition receptor, FLS2, is a key component in
both the initiation and amplification of basal defense responses in plants following pathogen
perception (Figure 1.2A). In an eloquent series of experiments by Robatzek and colleagues
(Robatzek et al., 2006), FLS2 was found to enter the endocytic pathway upon flg22 perception,
resulting in the rapid accumulation of FLS2 in intracellular vesicles. In total, this series of
experiments has led to a more complete understanding of receptor endocytosis in plants, and too,
the regulatory network that follows PAMP perception leading to activation of PTI (reviewed in
Irani and Russinova, 2009).

Once receptor-mediated endocytosis occurs, as in the case of flg22 perception via FLS2
described above, a plant’s response to pathogen perception is further amplified by the
intercellular trafficking of defense-associated compounds. Thus, from the standpoint of
resistance, the host plant must mobilize defense-associated components both to the site of
infection, as well as within, and amongst, adjacent cells. From the standpoint of pathogen
virulence, shutting down this response is key to continued infection and proliferation. Not
surprisingly, changes in the host cell endomembrane system have also been observed during
effector-triggered immunity (ETI; Chisholm et al., 2006; Jones and Dangl, 2006). For example,

14

work from the laboratory of Sheng Yang He demonstrated that the secreted effector protein
HopM1 from P. syringae localizes to plant endomembrane fractions (Nomura et al., 2006). With
this information, an investigation into possible host targets revealed an association between
HopM1 and the Arabidopsis protein MIN7 (i.e., AtMIN7). This work demonstrated that AtMIN7
encodes for an adenosine diphosphate ribosylation factor (ARF) guanine nucleotide exchange
factor (GEF), further solidifying the link between HopM1 function and the regulation of vesicle
trafficking during plant-pathogen interactions. Confirmation of these observations, using a
pharmacological approach, Nomura and colleagues found that application of the fungal-derived
antibiotic Brefeldin-A phenocopied the activity of HopM1; Brefeldin A interferes with
endomembrane protein transport from the Golgi apparatus to the endoplasmic reticulum. In
short, HopM1 was found to trigger the degradation of AtMIN7 as part of its virulence function,
leading to the hypothesis that P. syringae manipulates vesicle trafficking by targeted ARF-GEF
(i.e., AtMIN7) degradation.

Dynamic responses to bacterial phytopathogen perception have also recently been shown to
engage components of the actin cytoskeleton (Tian et al., 2009). Using a reverse genetic and
biochemical approach, Tian and colleagues identified a regulator of stochastic actin dynamics
(i.e., ACTIN DEPOLYMERIZING FACTOR-4; ADF4) as being required for the perception of
P. syringae expressing the cysteine protease effector protein AvrPphB. In mutant Arabidopsis
plants lacking ADF4, pathogen growth was unchecked, resulting in an increase in bacterial
multiplication, leading to increased disease symptoms. This work further characterized the
biochemical activity of the protein, and has led to the hypothesis that subtleties in
depolymerization activity (i.e., actin binding, F-actin severing and depolymerization) may in fact

15

account for some level of specificity regulating pathogen perception and the subsequent
remodeling of the cortical actin cytoskeleton. Interestingly, this work also identified a link
between actin depolymerization dynamics and the homeostatic control of hormone (i.e., SA and
JA) physiology, further implicating the link between hormone signaling, host cell dynamics and
the perception of pathogens by plants.

Transcriptional Regulation and Pathogenesis Related Genes

The common misconception is that plant defense responses are centrally regulated through
protein-protein interactions. While protein dynamics certainly account for a large proportion of
the overall defense response (e.g., Mackey et al., 2002, 2003; Axtell and Staskawicz, 2003; Day
et al., 2005; Liu et al., 2009; Lu et al., 2009), transcriptional regulation is a critical component in
controlling plant resistance responses to pathogen infection (reviewed in Eulgem, 2005).
Microarray analyses investigating the transcriptional reprogramming of defense signaling in
Arabidopsis following inoculation with a variety of pathogens has revealed that in addition to the
well established pathogenesis related (PR) genes (Sels et al., 2008), several hundred, even
thousands, of genes undergo differential expression both during and following pathogen
perception (Glazebrook, 2001). In fact, up to 25% of all Arabidopsis genes display altered
transcript levels in response to pathogen infection (Maleck et al., 2000; Tao et al., 2003).
Among these altered transcripts, members of several transcription factor families have also been
implicated in defense gene regulation (Eulgem, 2005).

16

An early observation in response to pathogen infection is the expression of PR genes. PR genes
are defined as the genes encoding for host proteins that accumulate after pathological or related
stimuli (Van Loon and Van Strien, 1999). Currently, PR genes are classified into seventeen
distinct families (Van Loon et al., 2006), including some of the most commonly used resistance
markers PR1 and PDF1.2 (Ryals et al., 1996; Lay and Anderson, 2005). The PR1 family of
genes are some of the most ubiquitous, showing a strong conservation across species, and as
such, appear to be represented across all plant species, with homologues present in fungi, insects
and vertebrates (Van Loon et al., 2006). Despite being such a widely conserved group, relatively
little is known of PR-1 family protein function in Arabidopsis disease resistance. Part of the
difficulty in studying these genes are the number in Arabidopsis, with 22 PR-1-type genes
present, as well as a widely-varied expression pattern; only a single member of the PR-1 gene
family is activated by pathogen infection, insect feeding, or chemical treatment, while ten PR-1type genes are constitutively expressed in roots and eight in pollen (Van Loon et al., 2006).

In

contrast to the PR-1 family, several additional PR groups have also been widely studied,
including members of the PR-12 family, also known as defensins, which have members
exhibiting antifungal activity. To this end, Terras et al. (1995) demonstrated in vitro antifungal
activity to a wide range of fungi using purified PDF1.1. In a complementary series of
experiments, Penninckx et al. (1996) showed in vitro antifungal activity to Alternaria
brassicicola and Fusarium culmorum.

PR genes, in general, appear to be only a small portion of a larger defense-signaling network
involving SA, JA and ethylene. Several compelling examples of this, discussed in Sels et al.
(2008), include an analysis of resistance in ein2 mutants, defective in JA/ET signaling, as well as

17

the SA signaling deficient npr1 mutant. The ein2 mutant was shown to have increased
susceptibility to the necrotrophic fungal pathogen B. cinerea (Thomma et al., 1999), while
showing decreased expression of several PR genes, including those from the PR-12, PR-3 and
PR-4 gene families (Thomma et al., 2001). Likewise, the npr1 mutant showed increased
susceptibility to many biotrophic pathogens including the bacterium P. syringae, with decreases
in PR-1, PR-2 and PR-5 (Thomma et al., 2001).

a. Transcription Factors

In addition to the large, ubiquitous family of PR genes described above, representatives of the
Arabidopsis TGA-bZIP, ERF, Myb, Whirly and WRKY families have been shown to bind
defense related gene promoter elements and regulate their expression (reviewed in Eulgem,
2005). Binding sites of WRKY factors (W boxes) are ubiquitously conserved in upstream
regions of genes up regulated during a variety of defense responses including SAR, R-proteinmediated resistance and basal defense (Maleck et al., 2000; Eulgem et al., 2004; Zipfel et al.,
2004). Dong et al. (2003) showed the promoters of pathogen-inducible Arabidopsis WRKY
genes were strongly enriched for W boxes, suggesting a role for feedback regulation by WRKYs
themselves. Interestingly, the conservation of binding sites in defense genes is not limited to the
WRKY family of transcription factors. The consensus binding motif of Whirly factors and a
motif with similarity to ERF binding sites are conserved in promoters of genes expressed during
incompatible interactions with Hyaloperonospora arabidopsidis (Eulgem et al., 2004).

18

The transcriptional cascade leading to the SA-dependent expression of PR1 is well established,
and involves numerous transcription factors, such as WRKYs, NPR1 and TGAs (reviewed in
Eulgem, 2005). For example, following activation of SA-responsive defense signaling,
approximately 50 WRKY genes are activated, which in turn lead to the coordinate regulation of
defense signaling; this represents both the accumulation and repression of differentially regulated
transcripts (Eulgem and Somssich, 2007). Among the best-characterized responses linking
perception of SA and the activation of defense signaling is the activation of NPR1 transcription
(Yu et al., 2001). Accumulation of SA also triggers a change in the redox status of NPR1,
reducing it to a monomeric form that can then be translocated into the nucleus (Mou et al. 2003).
Once inside the nucleus, NPR1 monomers are able to interact with members of the TGA-bZIP
family of transcription factors (Fan and Dong, 2002), which in turn stimulates their binding to
TGA boxes within the promoter of PR1 (reviewed in Singh et al., 2002). In total, this multi-step
process leads to the activation and regulation of SA-dependent gene expression.

b. MAPK Signaling

Once pathogen perception has occurred, amplification and precise regulation of the signaling
cascade is required. In both PTI and ETI, this amplification step typically involves the function
of a suite of Mitogen-Associated Protein Kinases (MAPK) for downstream resistance signaling.
The utility of MAPK signaling in plants is not restricted to biotic interactions; indeed, current
literature is rife with examples, including development, reproduction and response to
environmental stress (reviewed in Andreasson and Ellis, 2010). Arabidopsis has 23 MAPKs, 10
MAPKKs and 60 MAPKKKs (hereafter collectively referred to as MAPKs; reviewed in

19

Cvetkovskai et al., 2005). In total, the primary function of MAPKs is the transduction of signals
originating from perception (i.e., ligand binding; e.g., FLS2-flg22 interaction) to the activation
and regulation of a downstream target. Whether through protein-protein interactions, regulation
of cellular trafficking or transcriptional activation, MAPKs have ubiquitous roles in the
amplification and processing of stimuli from biotic and abiotic responses. For example,
responses regulated by MAPKs that are specifically required for defense signaling include the
hypersensitive response (HR), systemic acquired resistance (SAR), generation of reactive oxygen
species (ROS), and the induction of PR gene expression. As detailed above, one of the primary
downstream responses regulated by MAPK signaling is the transcriptional regulation of
numerous genes associated with defense activation (reviewed in Eulgem, 2005).

The Host-Pathogen Interface: Layered Defenses, Resistance and Susceptibility

Sequencing of the Arabidopsis genome opened the door to a plethora of resources enabling a
detailed analysis of disease resistance signaling in plants. Homology-based analyses led to the
identification of broadly conserved gene families, such as plant resistance genes (Aarts et al.,
1998; Shen et al., 1998; Zhou et al., 2004). Coupled with forward and reverse genetic
approaches, such as EMS mutagenesis and the subsequent functional characterization of
candidate co-regulators (Century et al., 1995; Falk et al., 1999), signaling networks were soon
assembled. Through all of this, what is now evident is that resistance signaling in plants is a
multi-layered network of perception, signal amplification and regulation. Crosstalk between
these layers of responses mediates perception and specificity, as well as regulates the strength
and duration of the response.

20

Elicitors and PAMP-Triggered Immunity

Plants have evolved the ability to recognize the somewhat basic features of a pathogen for the
purpose of eliciting defense responses (reviewed in Zipfel, 2009). Among the earliest elicitors of
a plant defense response to be characterized were the oligosaccharide polymers that constitute
the outer cell walls of pathogenic organisms (Hahn et al., 1981). From a historical standpoint,
PAMPs were first observed and characterized in early experiments by Anderson-Prouty and
Albersheim (1975), which described the ability of a fungal cell wall component, -glucan, to
induce a defense response in plants. These experiments were followed by in-depth studies to
identify additional PAMPs and their associated responses, including oligogalacturonides (Davis
and Hahlbrock, 1987), chitin (Baureithel et al., 1994; Shibuya et al., 1996; Day et al., 2001;
Okada et al., 2002; Miya et al., 2007; Wan et al., 2008), and chitosan (Hadwiger et al., 1981).

In 1999, Thomas Boller’s group identified a single genetic locus in Arabidopsis that mediates the
perception of what has become the best-characterized PAMP recognition response in plants: the
FLS2-bacterial flagellin interaction (Gómez-Gómez et al., 1999). Looking back, the discovery
of the flagellin receptor (i.e., FLS2; FLAGELLIN SENSITIVE-2) in Arabidopsis represents one
of the seminal discoveries in molecular plant pathology. While the study of PAMP recognition
in plants has a long history, until the identification of a specific PAMP receptor, the classical Rprotein-effector interaction(s) was seen as the penultimate mechanism of resistance signaling,
controlling specificity, host-range, recognition and the activation of immunity in plants
(reviewed in Staskawicz et al., 2001). With FLS2, researchers were now confronting the

21

possibility that plants coordinate parallel, and to a large extent, overlapping layers of defense
signaling.

PTI occurs almost immediately following the physical interaction between host and pathogen
(reviewed in Jones and Dangl, 2006). As noted above, the identification of FLS2 provided the
first genetic evidence that PTI controls a broad range of both physiological and pathogenspecific resistance responses. In total, structure-function studies of the flg22-FLS2 interaction
have contributed to the elucidation of signaling pathways and their associated mechanisms
(Chinchilla et al., 2006; Robatzek et al., 2006; Göhre et al., 2008). However, what may be the
greatest contribution of these studies is that they have provided an understanding of the spatial
dynamics of signal perception and transduction (Robatzek et al., 2006; Heese et al., 2007).

FLS2 is a receptor protein kinase comprised of an extracellular leucine-rich repeat (LRR)
domain and an intercellular cytoplasmic serine threonine kinase domain (Figure 1.2A; GómezGómez and Boller, 2000). Following the perception of bacterial flagellin, FLS2 mediates the
activation of broad-based plant defense responses, such as the activation of MAP kinase
signaling (Asai et al., 2002), endosomal trafficking (Otegui and Spitzer, 2008) and regulation of
stomatal closure (Melotto et al., 2006) (Figure 1.2B). In short, binding of flagellin to FLS2
promotes the association with the receptor-like kinase BAK1 (Chinchilla et al., 2007; Heese et
al., 2007), which is believed to trigger the activation of at least two MAP kinase cascades. In
terms of regulating basal defense, genetic evidence seems to suggest that the MAP kinase
kinases MKK1 and MKK2 negatively regulate immune responses in response to FLS2 activation
(Ichimura et al., 2006; Qiu et al., 2008), while MPK3 and MPK6 are thought to positively

22

regulate FLS2 immune responses (Bittel and Robatzek, 2007). To add to this complexity,
evidence also points to the involvement of hormone signaling in regulating FLS2-mediated
responses (Navarro et al., 2006; Tsuda et al., 2008).

As noted throughout this Chapter, the driving force behind the association of pathogens with
plants is the acquisition of nutrients. In the first installment of the Arabidopsis Book Chapter,
which focused on the Arabidopsis-Pseudomonas interaction. Fumi Katagiri and colleagues
pointed to the role of nutrient restriction as a basal defense response that promotes host
resistance (Katagiri et al., 2002). After all, pathogens are not teleological beings; they are not
attacking the plant, they are simply in search of nutrients, which in turn, provide a means to an
end. As such, disease may simply be a consequence of a pathogen’s search for nutrients, and as
such, barriers, obstacles or processes that prevent the acquisition of nutrients must be
circumvented or disabled. Pathogen entry may therefore be viewed as a “filter” that determines
the success or demise of a pathogen. In support of this hypothesis, Melotto et al. (2006)
demonstrated that the recognition of flg22 by FLS2 induces the rapid closure of stomata, thus
restricting pathogen entry and subsequent proliferation. Interestingly, this restriction can be lifted
through the action of a P. syringae-specific toxin, coronatine, which interferes with abscisic acid
(ABA) signaling and stimulates stomatal re-opening.

A common theme in the perception of pathogens by plants, as well as the subsequent signaling of
defense-specific responses, is that there is a significant overlap in the regulation of general host
physiology and the activation and regulation of defense responses. Whether through
manipulating hormone balance, or through modulation of ubiquitous MAPK signaling pathways,

23

plants have evolved broad mechanisms to sense and abrogate pathogen infection and
proliferation. As such, the basal defense response may represent the most basic and ancient form
of plant immunity (reviewed in Chisholm et al., 2006). As discussed in the following section,
the evolution and adaptation of highly specific defense responses has occurred through gene-forgene interactions.

ETI: Gene-for-Gene Resistance and the Guard Hypothesis

The current paradigm in host-pathogen interactions is that the activation of primary defense
responses is initiated by PAMP recognition, which in turn leads to the activation of PTI
(reviewed in Jones and Dangl, 2006). With the discovery of the first bacterial avirulence protein
(Staskawicz et al., 1984), a new discipline in plant biology was born: molecular plant pathology.
Approaches such as EMS mutagenesis, transposon tagging, as well as advances in gene
expression and DNA sequencing made possible our ability to identify genetic elements
responsible for the recognition of plant pathogens. As our understanding of how plants
recognize and respond to pathogen infection increases, models have evolved, paradigms have
shifted, and too, our approaches have adapted to advances in technology. The sequencing of the
Arabidopsis genome made possible many of these advances, and more importantly, provided a
pool of candidate defense components for further characterization. In this regard, it soon became
evident that the classical gene-for-gene hypothesis could not fully explain the complex
interactions between all plants and all pathogens.

24

In 1998, Van Der Biezen and Jones proposed what is now known as the “Guard Hypothesis” to
explain the role of Prf in the AvrPto-Pto interaction, a model that has evolved to explain the
complex surveillance mechanism(s) that controls host-pathogen interactions (Van Der Biezen
and Jones, 1998). While this model does not fully explain all aspects of the dominant (e.g., Rprotein-mediated) resistance responses in plants, it does provide a benchmark for investigating
the genetic interactions between host R-proteins and their cognate pathogen effectors. Just a
few years later, in 2002, Van der Hoorn et al. (2002) made three observations that they believed
would generally validate the Guard hypothesis. First, when an R-protein serves as a guardee,
there would be no direct interaction with the cognate effector protein. This was a critical step in
addressing the few identified instances of direct R-effector interactions. Secondly, that the
indirect interaction requires an additional host protein that is specific for each effector-R-protein
pair. And finally, that this additional host protein’s structure, or general occurrence, would
qualify it as a candidate virulence target of the pathogen. As is often the case, the lack of
evidence, or in this case, the inability to demonstrate direct interaction between effector-Rprotein pairs has limited our ability to further explain the processes required for pathogen
recognition. To this end, the Guard Hypothesis finally offered an answer to explain the
interaction between host resistance proteins and cognate pathogen effectors. Perhaps more
interesting at the time was the possibility that there existed an additional host protein that was
unique for each interaction. However, one surprising caveat to this paradigm is the finding that
an absolute uniqueness does not exist in all guard-guardee interactions (Mackey et al., 2002,
2003; Axtell et al., 2003; Day et al., 2005; Chisholm et al., 2006). To this end, an additional
level of co-regulation exists among shared signaling networks comprising ETI.

25

a. Structure

Despite the ability of plants to recognize a wide range of pathogens, the suite of R-proteins
present in most plants is somewhat limited in both structural and operational diversity. As
shown in Figure 1.3A, R-proteins share a number of basic, common features, and in Arabidopsis,
approximately 150 proteins comprise this family of resistance signaling mediators (Baumgarten
et al., 2003). The largest class of R-genes encode for a nucleotide binding site-leucine-rich
repeat (NB-LRR) class of proteins (Chisholm et al., 2006; Jones and Dangl, 2006). At the
amino-terminus, the conserved nucleotide-binding (NB) site has been shown to be critical for
ATP or GTP binding (Saraste et al., 1990). At the C-terminus, the LRR domain, which exhibits
variability both in spatial organization (Istomin and Godzik, 2009) and length (Matsushima et al.,
2009), is likely a platform for protein-protein interactions and peptide/ligand binding (Jones and
Jones, 1996; Kajava, 1998). Not surprising, LRR domains are found in a diverse suite of
proteins, ranging in function as regulators of processes controlling both development and plant
defense (reviewed in Padmanabhan et al., 2009). The NB-LRR class of R-proteins can be further
sub-divided based on N-terminal structural features (Chisholm et al., 2006). Among these, one
type contains an N-terminal domain with homology to the Drosophila Toll and mammalian
interleukin 1 receptors (TIR-NB-LRRs) while the other class contains putative coiled-coil
domains (CC-NB-LRRs) (reviewed in Dangl and Jones, 2001). In Arabidopsis, the bestcharacterized R-proteins are members of the CC-NB-LRR proteins, such as RPM1 (Resistance to
Pseudomonas syringae pv. maculicola-1; Bisgrove et al., 1994), RPS5 (Resistance to
Pseudomonas syringae-5; Simonich and Innes, 1995) and RPS2 (Resistance to Pseudomonas
syringae-2; Kunkel et al., 1993). Functionally, R-protein recognition of pathogen effectors,

26

and/or the cellular perturbations elicited by the action of effectors, is critical to plant defense
(Figure 1.3B). However, these actions alone (i.e., detection of perturbations) do not account for
the full activation of resistance. To this end, additional plant proteins are required for proper Rprotein function.

b. R-protein Stability and Activation

RAR1 (Required for MLA12 Resistance-1) was demonstrated to be required for resistance
mediated by several CC-NB-LRR, as well as at least one TIR-NB-LRR class R-protein (Muskett
et al., 2002; Tornero et al., 2002). Evidence suggests that RAR1 may function through its
physical interaction with another protein (i.e., SGT1; Suppressor of G2 allele of suppressor of
kinetochore protein 1; Azevedo et al., 2002) that is also required for resistance mediated by
several CC-NB-LRR and TIR-NB-LRRs (Azevedo et al., 2002). In short, the simplest model for
a role of RAR1 in R-protein function is that it directs either the removal of a negative regulator
(Gray et al., 1999) or the activation of a positive regulator (Wang et al., 2001) by recruitment of
that factor to the SCF complex via SGT1 and subsequent ubiquitination (Tornero et al., 2002).

SGT1 was originally identified as a regulatory component of the Skp1, Cullin, F-box (SCF)
complex (Bachmair et al., 2001) that acts as an E3 ligase involved in the ubiquitination of target
proteins (Tornero et al., 2002). Since its identification, numerous genetic studies have
implicated SGT1 as a key component in pathogen resistance signaling, most likely through
regulating the expression levels and activities of R proteins (Peart et al., 2002). With the
characterization of SGT1 interactions with the chaperone HSP90, as well as with another protein,

27

RAR1 (Takahashi et al., 2003), the shape of the complex regulatory node involving R-protein
stability is starting to emerge (Figure 1.4). RAR1 is a member of the conserved CHORDcontaining family (CHP; Shirasu et al., 1999), and is distinguished by the presence of two
cysteine- and histidine-rich zinc-binding domains (CHORD I and CHORD II). In planta, RAR1
associates with SGT1, and this interaction appears to be required for full functionality of
associated R-proteins (Austin et al., 2002; Azevedo et al., 2002; Peart et al., 2002; Tör et al.,
2002). In mammals, Nod1 was recently shown to associate with HSP90, further confirming that
studies first conducted in plants are invaluable about pathways involving NLR proteins in nonplant systems (Hahn, 2005). More recently, da Silva Correia (2007) also demonstrated that
SGT1 is a positive regulator of Nod1 activation, providing compelling evidence that SGT1 is
required for signaling by Nod1 in human cells, just as it is required in innate immune signaling in
plants.

c. Regulators and Amplifiers of R-protein Signaling

In addition to the requirement for stabilizing and directing R-protein function, additional Rprotein accessory proteins have been identified as being required for the activation of disease
resistance signaling in plants. Among these, the best-characterized examples include
ENHANCED DISEASE SUSCEPTIBILITY 1 (EDS1) and NON-RACE SPECIFIC DISEASE
RESISTANCE 1 (NDR1). Both have been shown to be indispensible for the activation of
resistance mediated by nearly all TIR-NB-LRRs and CC-NB-LRRs, respectively (Aarts et al.,
1998). EDS1 has homology to eukaryotic lipases (Falk et al., 1999), and serves as a central
regulatory protein in biotic and oxidative stress signaling (reviewed in Wiermer et al., 2005).

28

Originally, EDS1 was identified in a screen for loss of resistance in Arabidopsis to isolates of the
oomycete pathogen Hyaloperonospora arabidopsidis (Parker et al., 1996), and was the first plant
L-family lipase representative to be cloned and assigned a function (Falk et al., 1999). In
subsequent studies, eds1 mutants were also implicated in a loss of resistance to specific strains of
P. syringae targeting TIR-NB-LRRs such as RPP2, RPP4, RPP5, RPP21 and RPS4 (Aarts et al.,
1998; Feys et al., 2001). In addition to the identification of a required role for EDS1 as a
signaling protein in the TIR-NB-LRR network, significant advances were also made as a result
of the identification of the first of two important interacting partners of EDS1, PHYTOALEXIN
DEFICIENT 4 (PAD4), followed by the identification of an interaction with SENESCENCEASSOCIATED GENE 101 (SAG101) (Feys et al., 2005). PAD4 and SAG101 functions appear
partially redundant, yet functionally independent. Feys et al. (2005) also demonstrated nuclear
localization for EDS1 as well as EDS1:PAD4 and EDS1:SAG101 complexes, suggesting a
dynamic role for EDS1 in defense signaling. Evidence also supports a role for EDS1, along with
PAD4, in the plant response to oxidative stress (Rusterucci et al., 2001; Mateo et al., 2004), as
well as being required for the runaway cell death response observed in LESION SIMULATING
DISEASE 1 (LSD1) mutant plants caused by photooxidative stress (Mateo et al., 2004).

In addition to EDS1, a key regulator of CC-NB-LRR R-protein activation was also identified. A
mutation in NDR1 was identified in a screen of fast-neutron mutagenized Col-0 Arabidopsis by
screening for plants that became susceptible to P. syringae expressing the effector AvrB
(discussed below; Century et al., 1995). The ndr1-1 mutant plant contains an approximately 1
kilobase-pair deletion spanning the NDR1 locus on Arabidopsis chromosome three (Century et
al., 1997). Functional characterization of NDR1 has revealed it to be a plasma membrane-

29

localized protein of 219 amino acids (Century et al., 1997), which undergoes several posttranslational modifications, including C-terminal processing and N-linked glycosylation
(Coppinger et al., 2004). Interestingly, the proposed topology of NDR1 within the plasma
membrane suggests that an approximate 18-amino acid portion lies within the cytoplasm, while
the remainder of the NDR1 protein resides on the outside surface of the plasma membrane
(Coppinger et al., 2004; Day et al., 2006). This hypothetical model raises the possibility that
NDR1 positioning within the plasma membrane may serve to facilitate signaling from within the
apoplast, across the plasma membrane, and into the cytoplasm, possibly through its interaction
with RIN4 (RPM1 Interacting Protein-4; Day et al., 2006). In total, NDR1 is required for the
activation of many CC-NB-LRRs including RPS2, RPM1 and RPS5 (Century et al., 1995), and
in support of this, ndr1-1 mutant plants are susceptible to P. syringae expressing the effector
genes AvrB, AvrRpt2, AvrRpm1 or AvrPphB (Coppinger et al., 2004). As a required signaling
component of multiple R-protein pathways in response to bacterial infection, NDR1 may also
play a role in multiple resistance networks in plants. In support of this hypothesis, ndr1-1 plants
show higher growth of P. syringae DC3000 (Century et al., 1995) suggesting the role of NDR1
may not be limited to only R-gene-mediated resistance, but could also be a critical component of
PTI.

d. R-protein-Effector Interactions

In mammalian innate immune signaling, TLRs are responsible for the recognition of PAMPs,
while their plant counterparts (i.e., R-proteins) are responsible for the recognition of secreted
pathogen effector proteins. As is the case in most receptor-ligand interactions, direct association

30

between receptor and elicitor results in the stimulation and activation of down-stream signaling
events required for activation. In total, this interaction results in the activation of signaling
required for the successful deployment of defense responses and resistance. To date, two
mechanisms of pathogen effector perception have been described in plants: direct and indirect
recognition. In 2000, Jia et al (2000) demonstrated a direct interaction between the rice CC-NBLRR R-protein Pita and its cognate effector protein AvrPita. This interaction specifies resistance
in rice to the blast fungal pathogen Magnaporthe grisea. In short, this work demonstrated for the
first time a direct interaction between a R-protein (receptor) and its ligand, a secreted effector
from an invading pathogen. Subsequent work, as conceptually described above, identified this
interaction as being mediated by the LRR domain of Pita (Bryan et al., 2000). Additional direct
interactions have also been demonstrated between other R-proteins and their cognate pathogen
effectors, such is the case with RRS1-R and the bacterial wilt pathogen effector PopP2
(Deslandes et al., 2003), as well as becoming the best-characterized examples from the flax rust
resistance loci, which recognize approximately 30 effector proteins from flax rust (reviewed in
Ellis et al., 2007). However, direct recognition of pathogen effector proteins appears to be the
exception, rather than the rule.

As described above, the “rules” governing the proposition of the guard hypothesis satisfied the
lack of additional direct interactions between host R-proteins and pathogen effectors. As a first
example of the guard hypothesis, work in Roger Innes’s lab demonstrated a multi-protein
interaction that seemed to satisfy the criteria of an indirect surveillance mechanism (Simonich
and Innes, 1995; Swiderski and Innes, 2001; Shao et al., 2003; Ade et al., 2007). In this case, the
association of the Arabidopsis R-protein RPS5 with a protein kinase, PBS1, fulfilled the all of

31

the requirements of the first experimentally validated example of the guard hypothesis. This
mechanism requires that: RPS5 associates/interacts with PBS1 (Ade et al., 2007); the P.
syringae effector AvrPphB, a cysteine protease, cleaves PBS1 (Shao et al., 2003); and, following
cleavage of PBS1, the RPS5-PBS1 association is disrupted, leading to a (likely) conformational
change in RPS5 and activation of ETI (Ade et al., 2007). Thus, the detection of the pathogen
relies on the disruption, or perturbation, of a protein-protein surveillance mechanism by the
action of the pathogen effector protein. This, in short, defines ETI.

Several years later, a series of studies presented a new twist in the guard hypothesis; one that
presented a testable model to explain the co-regulation and interplay between potentially
overlapping defense signaling pathways. In 2002, the laboratory of Jeff Dangl presented the
identification of a protein isolated as interacting with the CC-NB-LRR R-protein RPM1 (Mackey
et al., 2002). This protein, RIN4, was shown to not only associate with RPM1, yet was also
demonstrated to satisfy the requirement(s) as a guard of RPM1 activation. In short, the
Pseudomonas effector protein AvrRPM1, which activates resistance through RPM1 (Bisgrove et
al., 1994), was also demonstrated to act upon RIN4, most likely as an intermediate signaling
component in this pathway (Mackey et al., 2002). The AvrRpm1-RIN4 interaction leads to the
hyper-phosphorylation of RIN4 (Mackey et al., 2003) that is in turn recognized by RPM1. This
interaction alone would seem to perfectly represent one of the original tenets of the Guard
Hypothesis (Figure 1.3B). In a parallel series of experiments, RIN4 was also identified as a
negative regulator of the RPS2-AvrRpt2 signaling pathway (Axtell and Staskawicz, 2003;
Mackey et al., 2003). In this example, RIN4 is cleaved by AvrRpt2 (a cysteine protease), which
in turn leads to the activation of ETI (Axtell and Staskawicz, 2003; Mackey et al., 2003; Day et

32

al., 2005; Chisholm et al., 2006). While a host protein targeted by multiple effectors may not
completely conform to the classical definition of the guard hypothesis, it provides an exceptional
example of the overlapping regulation in parallel defense signaling networks. This
demonstration of a shared intermediate (e.g., RIN4) has strengthened our understanding of the Rprotein-effector interaction, and has paved the way for some of the newest concepts in molecular
plant pathology. Additional recent studies have revealed a growing, almost ubiquitous, function
for RIN4 in a variety of host-pathogen processes (Day et al., 2006; Liu et al., 2009; Luo et al.,
2009; Wilton et al., 2010).

The case of RIN4 raises an interesting question: How does specificity, in terms of recognition
and regulation, accommodate multiple processes (i.e., RPS2-specific vs. RPM1-specific) being
guarded by a single protein? To this end, one new model that may help to explain these shared
intermediates, or other putative virulence targets, is the decoy model proposed by Van der Hoorn
and Kamoun (2008). In this model, an interesting hypothesis is proposed whereby plants have
evolved the utility of proteins as decoys, whose function is, in essence, to dilute the activity of
pathogen effector proteins, or, to serve as triggers for a central alarm system alerting the host to
the presence of pathogens. Through the evolution, or adaptation of decoys, plants can, in
essence, use a single protein to guard multiple targets. This would then explain, to some extent,
the functional genetic overlap between parallel resistance signaling processes.

Final Thoughts

33

So, which is it: Gene-for-gene? The Guard Hypothesis? Are pathogen effector proteins the
magic bullets that must be stopped? The more we learn, the more evident it becomes that we are
only scratching the surface of what is to be understood in the field of plant-pathogen interactions.
In the past few years, an explosion in the area of plant pathology has led to groundbreaking
discoveries not only at the level of signaling and gene expression, but also in terms of the
application of whole genome biology to non-model systems. In this regard, the early
development and proposition that Arabidopsis is indeed a model system for translational
agriculture is starting to become a reality. Moving forward in the next 10-20 years, a significant
investment in the plant sciences will be to put into practice what has been learned from the
studies highlighted above. Can we in fact tailor crops to recognize pathogens more efficiently,
and too, can we engineer durable resistance to multiple pathogens across multiple crop species?
Based on the overlapping specificity detailed above, one would imagine that through defining the
shared mechanisms by which plants recognize diverse pathogens, the answer may be “YES!”.
However, the complexity of resistance signaling, as well as the intimate links shared between
resistance signaling and standard processes such as development, reproduction and, tolerance to
additional environmental (i.e., abiotic) pressures, a balance must be struck in engineering
resistance versus sacrificing plant health and vigor. Thus, in total, the end goal of molecular
plant pathology is to understand the processes that ultimately make breeding for durable
resistance a possibility. Whether this means that through understanding the function of all
pathogen effectors we will be able to breed plants that are more resistant, or that by defining and
better understanding the processes in plants that are minimally required for resistance, is still up
for debate. Fortunately, there is much we still do not understand and a wealth of knowledge
waiting to be discovered.

34

Acknowledgements

We would like to thank all members of the Day laboratory for critical reading of the manuscript.
Research in the Day lab is supported by a grant from the National Science Foundation (IOS0641319).

35

Figure 1.1.

Figure 1.1. The Arabidopsis thaliana-Pseudomonas syringae pathosystem. A) Phenotype of
the healthy Arabidopsis leaves, B) leaves undergoing the hypersensitive response (24 hpi), C)
leaves inoculated with a non-disease eliciting P. syringae strain, and D) leaf symptoms of the
bacterial speck disease. hpi, hours post-inoculation. For interpretation of the references to color
in this and all other figures, the reader is referred to the electronic version of this dissertation.

36

Figure 1.2.

37

Figure 1.2: Pathogen Associated Molecular Pattern Recognition and the Activation of
PAMP-Triggered Immunity. A) The PAMP receptors FLS2, CERK1 and EFR. Yellow boxes
denote leucine-rich repeats (LRRs); CC, coiled-coil; NB, nucleotide-binding site; TIR, TollInterleukin-1 Receptor. Red diamond denotes kinase domain. B) As the first layer of defense
signaling in plants, PTI is activated via the recognition of conserved pathogen elicitors, generally
referred to as PAMPs. Well-characterized PAMPs include flagellin, the bacterial elongation
factor, EF-Tu, and the fungal cell wall component, chitin. Binding of PAMPs to their
corresponding effectors (e.g., flagellin-FLS2; EF-Tu-EFR; chitin-CERK1) results in the
activation of downstream defense signaling, via MAPK activation, resulting in the elicitation of
immunity.

38

Figure 1.3.

39

Figure 1.3. (cont’d)

40

Figure 1.3. Pathogen Effector Recognition and the Activation of Effector-Triggered
Immunity. A) The largest class of resistance proteins in Arabidopsis is the CC-NB-LRR class,
whose members include the R-proteins RPM1, RPS2 and RPS5. The TIR-class of R-proteins are
represented by the well-characterized R-protein RPS4. A recently identified variant of this class,
RRS1-R, contains a WRKY domain believed to impart transcriptional regulation as part of its
function following pathogen effector recognition. B) Similar to the activation of PTI, the
elicitation of ETI results in the activation of defense signaling via the specific recognition of
pathogen-derived elicitors. As a second layer of defense signaling, ETI is the culmination in the
recognition of pathogen effector proteins. As shown, delivery of an effector protein via the type
III secretion system (T3SS) and subsequent recognition by cognate host R-proteins, leads to the
activation of an amplified defense response. The general role of pathogen effector proteins is
thought to be the inactivation of PTI, while the role of ETI is to block all mechanisms of
pathogen virulence.

41

Figure 1.4.

42

Figure 1.4. (cont’d)

43

Figure 1.4. A Model for the Regulation and Activation of R-Protein Mediated Defense
Signaling in Arabidopsis. A) In the absence of a pathogen, R-proteins are held in an inactive
state. This conformation is the result of protein-proteins interaction(s), and as a consequence of
these associations, binding of ATP/GTP to the NB domain is blocked. B) Following perception
of the pathogen, via the activity of secreted effector molecules, an induced conformational
change in the R-protein complex is induced. This change results in a possible shift in the
stoichiometry of protein-protein interactions, leading to the binding of ATP/GTP to the R-protein
NB domain. C) Once a pathogen effector is recognized, the activation of ETI results in the
initiation of defense signaling, ultimately leading to the abrogation of pathogen growth. Once
perturbations to the R-protein surveillance system are no longer perceived, the system resets
back to the resting state depicted in “A”.

44

LITERATURE CITED

45

LITERATURE CITED

Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J., and Parker, J.E. (1998).
Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R
gene-mediated signaling pathways in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 95, 1030610311.
Ade, J., DeYoung, B.J., Golstein, C., and Innes, R.W. (2007). Indirect activation of a plant
nucleotide binding site-leucine-rich repeat protein by a bacterial protease. Proc. Natl. Acad. Sci.
U.S.A. 104, 2531-2536.
Aist, J.R.B., and Bushnell, W.R. (1991). In The Fungal Spore and Disease Initiation in Plants
and Animals, G. T. Cole, H. C. Hoch, Eds. (Plenum, New York). 321-345.
Aharoni, A., Dixit, S., Jetter, R., Thoenes, E., van Arkel, G. and Pereira, A. (2004). The
SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle
properties, and confers drought tolerance when overexpressed in Arabidopsis. Plant Cell 16,
2463-2480.
Ahmad, M., and Cashmore, A.R. (1993). HY4 gene of A. thaliana encodes a protein with
characteristics of a blue-light photoreceptor. Nature 366, 110-111.
Anderson-Prouty, A.J., and Albersheim, P. (1975). Host-Pathogen interactions: VIII. Isolation
of a pathogen-synthesized fraction rich in glucan that elicits a defense response in the pathogen’s
host. Plant Physiol. 56, 286-291.
Andreasson, E., and Ellis, B. (2010). Convergence and specificity in the Arabidopsis MAPK
nexus. Trends Plant Sci. 15,106-113.
Asai, T., Tena, G., Plotnikova., Willmann, M.R., Chiu, W.L., Gomez-Gomez, L., Boller, T.,
Ausubel, F.M., and Sheen, J. (2002). MAP kinase signaling cascade in Arabidopsis innate
immunity. Nature 415, 977-983.
Austin, M.J., Muskett, P., Kahn, K., Feys, B.J., Jones, J.D., and Parker, J.E. (2002).
Regulatory role of SGT1 in early R gene-mediated plant defenses. Science 295, 2077–2080.
Axtell, M.J., and Staskawicz, B.J. (2003). Initiation of RPS2-specified disease resistance in
Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112, 369-377.
Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A., Shirasu, K., and SchulzeLefert, P. (2002). The RAR1 interactor SGT1, an essential component of R gene-triggered
disease resistance. Science 295, 2073–2076.

46

Bachmair, A., Novatchkova, M., Potuschak, T., and Eisenhaber, F. (2001). Ubiquitination in
plants: A post-genomic look at post-translational modification. Trends Plant Sci. 6, 463-470.
Bari, R., and Jones, J.D. (2009). Role of plant hormones in plant defence responses. Plant Mol.
Biol. 69, 473-488.
Baumgarten, A., Cannon, S., Spangler, R., and May, G. (2003). Genome-level evolution of
resistance genes in Arabidopsis thaliana. Genetics 165, 309-319.
Baureithel, K., Felix, G., and Boller, T. (1994). Specific, high affinity binding of chitin
fragments to tomato cells and membranes. Competitive inhibition of binding by derivatives of
chitooligosaccharides and Nod factor of Rhizobium. J. Biol. Chem. 269, 17931-17938.
Bisgrove, S.R., Simonich, S.T., Smith, N.M., Sattler, A., and Innes, R.W. (1994). A disease
resistance gene in Arabidopsis with specificity for two different pathogen avirulence genes. Plant
Cell 6, 927-933.
Bittel, P., and Robatzek, S. (2007). Microbe-associated molecular patterns (MAMPs) probe
immunity. Curr. Opin. Plant Biol. 10, 335-341.
Block, A., Guo, M., Elowsky, C., Clemente, T.E., and Alfano, J.R. (2010). The Pseudomonas
syringae type III effector HopG1 targets mitochondria, alters plant development and suppresses
plant innate immunity. Cell Microbiol. 12, 318-330.
Browne, L.M., Conn, K.L., Ayer, W.A., and Tewari, J.P. (1991) The camalexins: new
phytoalexins produced in the leaves of Camelina sativa (Cruciferae). Tetrahedron 47, 39093914.
Bryan, G.T., Wu, K.S., Farrall, L., Jia, Y., Hershey, H.P., McAdams, S.A., Faulk, K.N.,
Donaldson, G.K., Tarchini, R., and Valent, B. (2000). A single amino acid difference
distinguishes resistant and susceptible alleles of the rice blast resistance gene Pi-ta. Plant Cell.
12, 2033-2046.
Century, K., Holub, E.B., and Staskawicz, B.J. (1995). NDR1, a locus of Arabidopsis thaliana
that is required for disease resistance to both a bacterial and fungal pathogen. Proc. Natl. Acad.
Sci. U.S.A. 92, 6597-6601.
Century, K., Shapiro, A.D., Repetti, P.P., Dahlbeck, D., Holub, E., and Stascawicz, B.J.
(1997). NDR1, a pathogen-induced component required for Arabidopsis disease resistance.
Science 278, 1963-1965.
Chandra, A., and Huff, D.R. (2010). A fungal parasite regulates a putative female-suppressor
gene homologous to maize tasselseed2 and causes induced hermaphroditism in male
buffalograss. Mol. Plant Microbe Interact. 23, 239-250.

47

Chen, Y.F., Shakeel, S.N., Bowers, J., Zhao, X.C., Etheridge, N., and Schaller, G.E. (2007).
Ligand-induced degradation of the ethylene receptor ETR2 through a proteasome-dependent
pathway in Arabidopsis. 282, 24752-24758.
Chinchilla, D., Bauer, Z., Regenass, M., Boller, T., and Felix, G. (2006). The Arabidopsis
receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. 18, 465476.
Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nurnberger, T., Jones, J.D., Felix,
G., and Boller, T. (2007). A flagellin-induced complex of the receptor FLS2 and BAK1 initiates
plant defence. Nature 448, 497-500.
Chisholm, S. T., Coaker, G., Day, B., and Staskawicz, B.J. (2006). Host-Microbe
Interactions: Shaping the Evolution of the Plant Immune Response. Cell 124, 803-814.
Clay, N.K., Adio, A.M., Denoux, C., Jander, G., and Ausubel, F.M. (2009) Glucosinolate
metabolites required for Arabidopsis innate immune response. Science 323, 95-101.
Collins, N.C., Thordal-Christensen, H., Lipka, V., Bau, S., Kombrink, E., Qiu, J.L.,
Huckelhoven, R., Stein, M., Freialdenhoven, A., Somerville, S.C, and Schulze-Lefert, P.
(2003). SNARE-protein-mediated disease resistance at the plant cell wall. Nature 425, 973-977.
Coppinger, P., Repetti, P.P., Day, B., Dahlbeck, D., Mehlert, A., and Staskawicz, B.J.
(2004). Overexpression of the plasma membrane-localized NDR1 protein results in enhanced
bacterial disease resistance in Arabidopsis thaliana. Plant J. 40, 225-237.
Cui, J., Bahrami, A.K., Pringle, E.G., Hernandez-Guzman, G., Bender, C.L., Pierce, N.E.,
and Ausubel, F.M. (2005). Pseudomonas syringae manipulates systemic plant defenses against
pathogens and herbivores. Proc. Natl. Acad. Sci. U.S.A. 102, 1791-1796.
da Silva Correia, J., Miranda, Y., Leonard, N., and Ulevitch, R. (2007). SGT1 is essential for
Nod1 activation. Proc. Natl. Acad. Sci. U.S.A. 104, 6764–6769.
Dangl, J.L., and Jones, J.D.G. (2001). Plant pathogens and integrated defence responses to
infection. Nature 411, 826-833.
Davis, K.R, and Hahlbrock, K. (1987). Induction of Defense Responses in Cultured Parsley
Cells by Plant Cell Wall Fragments. Plant Physiol. 84, 1286-1290.
Day, B., Okada, M., Ito, Y., Tsukada, K., Zaghouani, H., Shibuya, N., and Stacey, G.
(2001). Binding site for chitin oligosaccharides in the soybean plasma membrane. Plant Physiol.
126, 1162-1173.
Day, B., Dahlbeck, D., Huang, J., Chisholm, S.T., Li, D., and Staskawicz, B.J. (2005).
Molecular basis for the RIN4 negative regulation of RPS2 disease resistance. Plant Cell 17,
1292-1305.
48

Day, B., Dahlbeck, D., and Staskawicz, B.J. (2006). NDR1 interaction with RIN4 mediates the
differential activation of multiple disease resistance pathways in Arabidopsis. Plant Cell 18,
2782-2791.
De Wit, P.J., Mehrabi, R., Van den Burg, H.A., and Steriopoulos, I. (2009). Fungal effector
proteins; past, present and future. Mol. Plant Pathol. 10, 735-747.
Denoux, C., Galletti, R., Mammarella, N., Gopalana, S., Werck, D., DeLorenzo, G., Ferrari,
S., Ausubel, F.M., and Dewdney, J. (2008). Activation of defense response pathways by OGs
and Flg22 elicitors in Arabidopsis seedlings. Mol. Plant 1, 423-445.
Deslandes, L., Olivier, J., Peeters, N., Feng, D.X., Khounlotham, M., Boucher, C., Somssich,
I., Genin, S., and Marco, Y. (2003). Physical interaction between RRS-R, a protein conferring
resistance to bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proc.
Natl. Acad. Sci. U.S.A. 100, 8024-8029.
Dong, J, Chen, C., and Chen, Z. (2003) Expression profiles of the Arabidopsis WRKY gene
superfamily during plant defense response. Plant Mol. Biol. 51, 21-37.
Ellis, J.G., Dodds, P.N., and Lawrence, G.J. (2007). The role of secreted proteins in diseases
of plants caused by rust, powdery mildew, and smut fungi. Curr. Opin. Microbiol. 10, 326-331.
Eulgem, T. (2005). Regulation of the Arabidopsis defense transcriptome. Trends Plant Sci. 10,
71-78.
Eulgem, T., Weigman, V.J., Chang, H.S., McDowell, J.M., Holub, E.B., Glazebrook, J.,
Zhu, T., and Dangl, J.L. (2004). Gene expression signatures from three genetically separable
resistance gene signaling pathways for downy mildew resistance. Plant Physiol. 135, 1129-1144.
Eulgem, T., and Somssich, I.E. (2007). Networks of WRKY transcription factors in defense
signaling. Curr. Opin. Plant Biol. 10, 366-371.
Falk, A., Feys, B.J., Frost, L.N., Jones, J.D.G., Daniels, M.J., and Parker, J.E. (1999).
EDS1, an essential component of R gene-mediated disease resistance in Arabidopsis has
homology to eukaryotic lipases. Proc. Natl. Acad. Sci. U.S.A. 96, 3292-3297.
Fan, W., and Dong, X. (2002). In vivo interaction between NPR1 and transcription factor TGA2
leads to salicylic acid-mediated gene activation in Arabidopsis. Plant Cell 14, 1377-1389.
Feys, B.J., Moisan, L.J., Newman, M.A., and Parker, J.E. (2001). Direct interaction between
the Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J. 20, 5400-5411.
Feys, B.J., Wiermer, M., Bhat, R.A., Moisan, L.J., Medina-Escobar, N., Neu, C., Cabral,
A., and Parker, J.E. (2005). Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes

49

and signals within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate
immunity Plant Cell 17, 2601-2613.
Glawischnig, E. (2007) Camalexin. Phytochemistry 68, 401-406.
Glazebrook, J. (2001). Genes controlling expression of defense responses in Arabidopsis-2001
status. Curr. Opin. Plant Biol. 4, 301-308.
Göhre, V., Spallek, T., Haweker, H., Mersmann, S., Mentzel, T., Boller, T., de Torres, M.,
Mansfield, J.W., and Robatzek, S. (2008). Plant pattern-recognition receptor FLS2 is directed
for degradation by the bacterial ubiquitin ligase AvrPtoB. Curr. Biol. 18, 1824-1832.
Gómez-Gómez, L, Felix, G, and Boller, T. (1999). A single locus determines sensitivity to
bacterial flagellin in Arabidopsis thaliana. Plant J. 18, 277-284.
Gómez-Gómez, L., and Boller, T. (2000). FLS2: an LRR receptor-like kinase involved in the
perception of the bacterial elicitor flagellin in Arabidopsis. Mol. Cell. 5, 1003-1011.
Gray, W.M., del Pozo, J.C. Walker, L., Hobbie, L., Risseeuw, E., Banks, T., Crosby, W.L.,
Yang, M., Ma, H., and Estelle, M. (1999). Identification of an SCF ubiquitin-ligase complex
required for auxin response in Arabidopsis thaliana. Genes Dev. 13, 1678-1691.
Hadwiger, L.A., Beckman, J.M., and Adams, M.J. (1981). Localization of fungal components
in the pea-Fusarium interaction detected immunochemically with anti-chitosan and anti-fungal
cell wall antisera. Plant. Physiol. 67, 170-175.
Hahn, H., and Kaufmann, S.H.E. (1981). The role of cell-mediated immunity in bacterial
infections. Rev. Infect. Dis. 3, 1221-1250.
Hahn, J.S. (2005). Regulation of Nod1 by Hsp90 chaperone complex. FEBS Lett. 579, 4513-4519.
Hamilton, A.J., and Baulcombe, D.C. (1999). A species of small antisense RNA in
posttranscriptional gene silencing in plants. Science 286, 950-952.
Hematy, K., Cherk, C., and Somerville, S. (2009). Host-pathogen warfare at the plant cell
wall. Curr. Opin. Plant Biol. 12, 406-413.
Heese, A., Hann, D.R., Gimenez-Ibanez, S., Jones, A.M., He, K., Li, J., Schroeder, J.I.,
Peck, S.C., and Rathjen, J.P. (2007). The receptor-like kinase SERK3/BAK1 is a central
regulator of innate immunity in plants. Proc. Natl. Acad. Sci. U.S.A. 104, 12217-12222.
Hirano, S.S., and Upper, C.D. (2000). Bacteria in the leaf ecosystem with emphasis on
Pseudomonas syringae-a pathogen, ice nucleus, and epiphyte. Microbiol. Mol. Biol. Rev. 64,
624-653.

50

Ichimura, K., Casais, C., Peck, S.C., Shinozaki, K., and Shirasu, K. (2006). MEKK! Is
required for MPK4 activation and regulates tissue-specific and temperature-dependent cell death
in Arabidopsis. J. Biol. Chem. 281, 36969-36976.
Irani, N.G., and Russinova, E. (2009). Receptor endocytosis and signaling in plants. Curr.
Opin. Plant Biol. 12, 653-659.
Istomin, A.Y., and Godzik, A. (2009). Understanding diversity of human innate immunity
receptors: analysis of surface features of leucine-rich repeat domains in NLRs and TLRs. BMC
Immunol. 3, 1-15.
Jeffree, C.E. (2006). The fine structure of the plant cuticle. Biology of the plant cuticle; Annual
Plant Reviews, Volume 23. Eds. Reiderer, M., and Muller, C. Blackwell publishing Ltd. p. 1116.
Jia, Y., McAdams, S.A., Bryan, G.T., Hershey, H.P., and Valent, B. (2000). Direct
interaction of resistance gene and avirulence gene products confers rice blast resistance. EMBO
J. 19, 4004-4014.
Jones, A.M., Chory, J., Dangl, J.L., Estelle, M., Jacobsen, S.E., Meyerowitz, E.M.,
Nordborg, M., and Weigel, D. (2008). The Impact of Arabidopsis on Human Health:
Diversifying Our Portfolio. Cell 133, 939-943.
Jones, D.A. and Jones, J.D.G. (1996). The roles of leucine rich repeats in plant defences. Adv.
Bot. Res. Adv. Plant Pathol. 24, 90-167.
Jones, J.D., and Dangl, J.L. (2006). The plant immune system. Nature 444, 323-329.
Kajava, A.V. (1998). Structural diversity of leucine-rich repeat proteins. J. Mol. Biol. 277, 519527.
Katagiri, F., Thilmony, R., and He, S.Y. (2002). The Arabidopsis Thaliana-Pseudomonas
Syringae Interaction. In The Arabidopsis Book. Last, R., Eds. American Society of Plant
Biologists.
Kim, C.Y., Bove, J., and Assmann, S.M. (2008). Overexpression of wound-responsive RNAbinding proteins induces leaf senescence and hypersensitive-like cell death. New Phytol. 180,
57-70.
Kliebenstein, D.J., Rowe, H.C., and Denby, K.J. (2005). Secondary metabolites influence
Arabidopsis/Botrytis interactions: variation in host production and pathogen sensitivity. Plant J.
44, 25-36.
Lay, F.T., and Anderson, M.A. (2005). Defensins-components of the innate immune system in
plants. Curr. Protein Pept. Sci. 6, 85-101.

51

Lindeberg, M., Cunnac, S., and Collmer, A. (2009). The evolution of Pseudomonas syringae
host specificity and type III effector repertoires. Mol. Plant. Pathol. 10, 767-775.
Lipka, V., Dittgen, J., Bednarek, P., Bhat, R., Wiermer, M., Stein, M., Landtag, J., Brandt,
W., Rosahl, S., Scheel, D., Llorente, F., Molina, A., Parker, J., Somerville, S., and SchulzeLefert, P. (2005). Pre- and post-invasion defenses both contribute to nonhost resistance in
Arabidopsis. Science 310, 1180-1183.
Lipka, U., Fuchs, R., and Lipka, V. (2008). Arabidopsis non-host resistance to powdery
mildews. Curr. Opin. Plant Biol. 11, 404-411.
Liu, J., Elmore, J.M., Fuglsang, A.T., Palmgren, M.G., Staskawicz, B.J., and Coaker, G.
(2009). RIN4 functions with plasma membrane H+-ATPases to regulate stomatal aperatures
during pathogen attack. PLoS Biol. 7, e1000139.
Lu, X., Tintor, N., Mentzel., T., Kombrink, E., Boller, T., Robatzek, S., Schulze-Lefert, P.,
and Saijo, Y. (2009). Uncoupling of sustained MAMP receptor signaling from early outputs in
an Arabidopsis endoplasmic reticulum glucosidase II allele. Proc. Natl. Acad. Sci. U.S.A. 106,
22522-22527.
Luo, Y., Caldwell, K.S., Wroblewski, T., Wright, M.E., and Michelmore, R.W. (2009).
Proteolysis of a negative regulator of innate immunity is dependent on resistance genes in tomato
and Nicotiana benthamiana and induced by multiple bacterial effectors. Plant Cell. 21, 24582472.
Mackey, D., Holt, B.F., Wiig, A., and Dangl, J.L. (2002). RIN4 interacts with Pseudomonas
syringae type III effector molecules and is required for RPM1-mediated resistance in
Arabidopsis. Cell. 108, 743-754.
Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R., and Dangl, J.L. (2003). Arabidopsis
RIN4 is the target of the type III virulence effector AvrRpt2 and modulates RPS2 mediated
resistance. Cell 112, 379-389.
Maleck, K., Levine, A., Eulgem, T., Morgan, A., Schmid, J., Lawton, K.A., Dangl, J.L., and
Dietrich, R.A. (2000). The transcriptome of Arabidopsis thaliana during systemic acquired
resistance. Nat. Genet. 26, 403-410.
Mateo, A., Muhlenbock, P., Rusterucci, C., Chang, C.C., Miszalski, Z., Karpinska, B.,
Parker, J.E., Mullineaux, P.M., and Karpinski, S. (2004). LESION SIMULATING DISEASE
1 is required for acclimation to conditions that promote excess excitation energy. Plant Physiol.
136, 2818-2830.
Matsushima, N., Mikami, T., Tanaka, T., Miyashita, H., Yamada, K., and Kuroki, Y.
(2009). Analyses of non-leucine-rich repeat (non-LRR) regions intervening between LRRs in
proteins. Biochim Biophys Acta. 1790, 1217-1237.

52

Matzinger, P. (2007). Friendly and dangerous signals: is the tissue in control? Nat. Immunol. 8,
11-13.
Melotto, M., Underwood, W., Koczan, J., Nomura, K., and He, S.Y. (2006). Plant stomata
function innate immunity against bacterial invasion. Cell. 126, 969-980.
Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu., K, Narusaka, Y.,
Kawakami, N., Kaku, H., and Shibuya, N. (2007). CERK1, a LysM receptor kinase, is
essential for chitin elicitor signaling in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 104, 1961319618.
Morgan, W., and Kamoun, S. (2007). RXLR effectors of plant pathogenic oomycetes. Curr.
Opin. Microbiol. 10, 332-338.
Mou, Z., Fan, W., and Dong, X. (2003). Inducers of plant systemic acquired resistance regulate
NPR1 function through redox changes. Cell 113, 935-944.
Muskett, P.R., Kahn, K, Austin, M.J., Moisan, L.J., Sadanandom, A., Shirasu, K., Jones,
J.D.G., and Parker, J.E. (2002). Arabidopsis RAR1 exerts rate-limiting control of R gene
mediated defenses against multiple pathogens. Plant Cell 14, 979-992.
Mysore, K.S., and Ryu, C. (2004). Nonhost resistance: how much do we know? Trends Plant
Sci. 9, 97-104.
Navarro, L., Dunoyer, P., Jay, F., Arnold, B., Dharmasiri, N., Estelle, M., Voinnet, O., and
Jones, J.D. (2006). A plant miRNA contributes to antibacterial resistance by repressing auxin
signaling. Science 312, 436-439.
Nawrath, C. (2006). Unraveling the complex network of cuticular structure and function. Curr.
Opin. Plant Biol. 9, 281-287.
Nomura, K., Debroy, S., Lee, Y.H, Pumplin, N., Jones, J., and He, S.Y. (2006). A bacterial
virulence protein suppresses host innate immunity to cause plant disease. Science 313, 220-223.
Okada, M., Matsumura, M., Ito, Y., and Shibuya, N. (2002). High-affinity binding proteins
for N-Acetylchitooligosaccharide elicitor in the plasma membranes from wheat, barley, and
carrot cells: conserved presence and correlation with the responsiveness to the elicitor. Plant Cell
Physiol. 43, 505-512.
Otegui, M.S., and Spitzer, C. (2008). Endosomal functions in plants. Traffic 9, 1589-1598.
Padmanabhan, M., Cournoyer, P., and Dinesh-Kumar, S.P. (2009). The leucine-rich repeat
domain in plant innate immunity: a wealth of possibilities. Cell Microbiol. 11, 191-198.
Parker, J.E., Holub, E.B., Frost, L.N., Falk, A., Gunn, N.D., and Daniels, M.J. (1996).
Characterization of eds1, a mutation in Arabidopsis suppressing resistance to Peronospora
parasitica specified by several different RPP genes. Plant Cell 8, 2033-2046.
53

Peart, J.R., Lu, R., Sadanandom, A., Malcuit, I., Moffett, P., Brice, D.C., Schauser, L.,
Jaggard. D.A.W., Xiao. S., Coleman. M.J., Dow. M., Jones. J.D.G., Shirasu., and
Baulcombe, D.C. (2002). Ubiquitin ligase-associated protein SGT1 is required for host and
nonhost disease resistance in plants. Proc. Natl. Acad. Sci. USA. 99, 10865-10869.
Pedley, K.F., and Martin, G.B. (2003). Molecular basis of Pto-mediated resistance to bacterial
speck disease in tomato. Annu. Rev. Phytopathol. 41, 215-243.
Pedras, M.S., and Khan, A.Q. (1997). Unprecedented detoxification of the cruciferous
phytoalexin camalexin by a root phytopathogen. Bioorg. Med. Chem. Lett. 7, 2255-2260.
Pedras, M.S., and Khan, A.Q. (2000). Biotransformation of the phytoalexin camalexin by the
phytopathogen Rhizoctonia solani. Phytochemistry 53, 59-69
Penninckx, I.A., Eggermont, K., Terras, F.R., Thomma, B.P., De Samblanx, G.W.,
Buchala, A., Metraux, J.P., Manners, J.M., and Broekaert, W.F. (1996). Pathogen-induced
systemic activation of a plant defensin gene in Arabidopsis follows a salicylic acid-independent
pathway. Plant Cell 8, 2309-2323.
Qiu, J., Zhou, L., Yun, B., Nielsen, H.B., Fiil, B.K., Petersen, K., MacKinlay, J., Loake, G.
J., Mundy, J., and Morris, P.C. (2008). Arabidopsis mitogen-activated protein kinases MKK1
and MKK2 have overlapping functions in defense signaling mediated by MEKK1, MPK4, and
MKS1. Plant Physiol. 148, 212-222.
Reina-Pinto, J.J., and Yephremov, A. (2009). Surface lipids and plant defenses. Plant Physiol.
Biochem. 47, 540-549.
Robatzek, S., Chinchilla, D., and Boller, T. (2006). Ligand-induced endocytosis of the pattern
recognition receptor FLS2 in Arabidopsis. Genes Dev. 20, 537-542.
Rusterucci, C., Aviv, D.H., Holt, B.F., Dangl, J.L., and Parker, J.E. (2001). The disease
resistance signaling components EDS1 and PAD4 are essential regulators of the cell death
pathway controlled by LSD1 in Arabidopsis. Plant Cell 13, 2211-2224.
Ryals, J.A., Neuenschwander, U.H., Willits, M.G., Molina, A., Steiner, H., and Hunt, M.D.
(1996). Systemic acquired resistance. Plant Cell 8, 1809-1819.
Saraste, M., Sibbald., and Wittinghofer, A. (1990). The P-loop-a common motif in ATP- and
GTP-binding proteins. Trends Biochem. Sci. 15, 430-434.
Sato, A., and Yamamoto, K.T. (2008). What’s the physiological role of domain II-less
Aux/IAA proteins? Plant Signal Behav. 3, 496-497.
Schornack, S., Huitema, E., Cano, L.M., Bozkurt, T.O., Oliva, R., Van Damme, M.,
Schwizer, S., Raffaele, S., Chaparro-Garcia, A., Farrer, R., Segretin, M.E., Bos, J., Haas,
54

B.J., Zody, M.C., Nusbaum, C., Win, J., Thines, M., and Kamoun, S. (2009). Ten things to
know about oomycete effectors. Mol. Plant Pathol. 10, 795-803.
Sels, J., Mathys, K.J., De Coninck, B.M.A., Cammue, B.P.A., and De Bolle, M.F.C. (2008).
Plant pathogenesis-related (PR) proteins: A focus on PR peptides. Plant Physiol. and Biochem.
46, 941-950.
Shen, K.A., Meyers, B.C., Islam-Faridi, M.N., Chin, D.B., Stelly, D.M., and Michelmore,
R.W. (1998). Resistance gene candidates identified by PCR with degenerate oligonucleotide
primers map to clusters of resistance genes in lettuce. Mol. Plant Microbe Interact. 11, 815-823.
Shibuya, N., Ebisu, N., Kamada, Y., Kaku, H., Cohn., and Ito, Y. (1996). Localization and
binding characteristics of a high-affinity binding site for N-Acetlychitooligosaccharide elicitor in
the plasma membrane from suspension-cultured rice cells suggest a role as a receptor for the
elicitor signal at the cell surface. Plant Cell Physiol. 37, 894-898.
Shirasu, K., Lahaye, T., Tan, M.W., Zhou, F.S., Azevedo, C., and Schulze-Lefert, P. (1999).
A novel class of eukaryotic zinc-binding proteins is required for disease resistance signaling in
barley and development in C. elegans. Cell 99, 355-366.
Shoa, F., Golstein, C., Ade, J., Stoutemyer, M., Dixon, J.E., and Innes, R.W. (2003).
Cleavage of Arabidopsis PBS1 by a bacterial type III effector. Science 301, 1230-1233.
Simonich, M.T., and Innes, R.W. (1995). A disease resistance gene in Arabidopsis with
specificity for the avrPph3 gene of Pseudomonas syringae pv. phaseolicola. Mol. Plant Microbe
Interact. 8, 637-640.
Singh, K., Foley, R.C., and Onate-Sanchez, L. (2002). Transcription factors in plant defense
and stress responses. Curr. Opin. Plant Biol. 5, 430-436.
Spoel, S.H., and Dong, X. (2008). Making sense of hormone crosstalk during plant immune
responses. Cell Host Microbe 12, 348-351.
Staskawicz, B.J., Dahlbeck, D., and Keen, N.T. (1984). Cloned avirulence gene of
Pseudomonas syringae pv. glycinea determines race-specific incompatibility on Glycine max
(L.) Merr. Proc. Natl. Acad. Sci. U.S.A. 81, 6024-6028.
Staskawicz, B.J., Mudgett, M.B., Dangl, J.L., and Galan, J.E. (2001). Common and
contrasting themes of plant and animal diseases. Science 292, 2285-2289.
Stasckawicz, B.J. (2009). First insights into the genes that control plant-bacterial interactions.
Mol. Plant Pathol. 10, 719-720.
Stefanato, F.L., Abou-Mansour, E., Buchala, A., Kretschmer, M., Mosbach, A., Hahn, M.,
Bochet, C.G., Metraux, J., and Schoonbeek, H. (2009). The ABC transporter BcatrB from

55

Botrytis cinerea exports camalexin and is a virulence factor on Arabidopsis thaliana. Plant J. 58,
499-510
Stein, M., Dittgen, J., Sanchez-Rodriquez, C., Hou, B-H., Molina, A., Schulze-Lefert, P.,
Lipka, V., and Somerville, S. (2006). Arabidopsis PEN3/PDR8, an ATP binding cassette
transporter, contributes to nonhost resistance to inappropriate pathogens that enter by direct
penetration. Plant Cell 18, 731-746.
Swiderski, M.R., and Innes, R.W. (2001). The Arabidopsis PBS1 resistance gene encodes a
member of a novel protein kinase subfamily. Plant J. 26, 101-112.
Takahashi, A., Casais, C., Ichimura, K., and Shirasu, K. (2003). HSP90 interacts with RAR1
and SGT1 and is essential for RPS2-mediated disease resistance in Arabidopsis. Proc. Natl.
Acad. Sci. U.S.A. 100, 11777-11782.
Tao, Y., Xie, Z., Chen, W., Glazebrook, J., Chang, H.S., Han, B., Zhu, T., Zou, G., and
Katagiri, F. (2003). Quantitative nature of Arabidopsis responses during compatible and
incompatible interactions with the bacterial pathogen Pseudomonas syringae. Plant Cell 15, 317330.
Temple, B.R., and Jones, A.M. (2007). The plant heterotrimeric G-protein complex. Annu.
Rev. Plant Biol. 58, 249-266.
Terras, F.R., Torrekens, S., Van Leuven, F., Osborn, R.W., Vanderleyden, J., Cammue,
B.P.A., and Broekaert, W.F. (1995). A new family of basic Cysteine-rich plant antifungal
proteins from Brassicaceae species. FEBS Lett. 316, 233-240.
Thomma, B.P., Eggermont, K., Tierens, K.F., and Broekaert, W.F. (1999). Requirement of
functional ethylene-insensitive 2 gene for efficient resistance of Arabidopsis to infection by
Botrytis cinerea. Plant Physiol. 121, 1093-1102.
Thomma, B.P., Penninckx, I.A., Broekaert, W.F., and Cammue, B.P. (2001). The complexity
of disease signaling in Arabidopsis. Curr. Opin. Immunol. 13, 63-68.
Tian, M., Chaudhry, F., Ruzicka, D.R., Meagher, R.B., Staiger, C.J. and Day, B. (2009).
Arabidopsis Actin-depolymerizing factor AtADF4 mediated defense signal transduction
triggered by the Pseudomonas syringae effector AvrPphB. Plant Physiol. 150, 815-824.
Ting, J.P., Kastner, D.L., and Hoffman, H.M. (2006). CATERPILLERs, pyrin and hereditary
immunological disorders. Nat. Rev. Immunol. 6, 183-195.
Tör, M., Gordon, P., Cuzick, A., Eulgem, T., Sinapidou, E., Mert-Turk, F., Can, C., Dangl,
J.L., and Holub, E.B. (2002). Arabidopsis SGT1b is required for defense signaling conferred by
several downy mildew resistance genes. Plant Cell 14, 993-1003.

56

Tornero, P., Merritt, P., Sadanandom, A., Shirasu, K., Innes, R.W., and Dangl, J.L. (2002).
RAR1 and NDR1 contribute quantitatively to disease resistance in Arabidopsis, and their relative
contributions are dependent on the R gene assayed. Plant Cell 14, 1005-1015.
Tsuda, K., Glazebrook, J., and Katagiri, F. (2008). The interplay between MAMP and SA
signaling. Plant Signal. Behav. 3, 359-361.
Tsuji, J., Jackson, E.P., Gage, D.A., Hammerschmidt, R., and Somerville, S.C. (1992).
Phytoalexin accumulation in Arabidopsis thaliana during the hypersensitive reaction to
Pseudomonas syringae pv syringae. Plant Physiol. 98, 1304-1309
Van der Biezen, E.A., and Jones, J.D. (1998). Plant disease-resistance proteins and the genefor-gene concept. Trends Biochem. Sci. 23, 454-456.
Van der Hoorn, R.A., De Wit, P.J., and Joosten, M.H. (2002). Balancing selection favors
guarding resistance proteins. Trends Plant Sci. 7, 67-71.
Van der Hoorn, R.A., and Kamoun, S. (2008). From guard to decoy; a new model for
perception of plant pathogen effectors. Plant Cell 20, 2009-2017.
Van Loon LC, Rep M, Pieterse CMJ (2006). Significance of inducible defense-related proteins
in infected plants. Annu. Rev. Phytopathol. 44, 135-162.
Van Loon, L.C., and Van Strien, E.A. (1999). The families of pathogenesis-related proteins,
their activities, and comparative analysis of PR-1 type proteins. Physiol. and Mol. Plant Pathol.
55, 85-97.
VanEtten, H.D., Mansfield, J.W., Bailey, J.A., and Farmer, E.E. (1994). Two classes of plant
antibiotics: Phytoalexins versus “Phytoanticipins”. Plant Cell 6, 1191-1192.
Wan, J., Zhang., X.C., and Stacey, G. (2008). Chitin signaling and plant disease resistance.
Plant Signal. Behav. 3, 831-833.
Wang, D., Pajerowska-Mukhtar, K., Culler, A.H., and Dong, X. (2007). Salicylic acid
inhibits pathogen growth in plants through repression of the auxin signaling pathway. Curr. Biol.
17, 1784-1790.
Whisson, S.C., Boevink, P.C., Moleleki, L., Avrova, A.O., Morales, J.G., Gilroy, E.M.,
Armstrong, M.R., Grouffaud, S., van West, P., Chapman, S., Hein, I., Toth, I.K., Pritchard,
L., and Birch, P.R. (2007). A translocation signal for delivery of oomycete effector proteins into
host plant cells. Nature 450, 115-118.
Wiermer, M., Feys, B.J., and Parker, J.E. (2005). Plant immunity: the EDS1 regulatory node.
Curr. Opin. Plant Biol. 8, 383-389.

57

Wilton, M., Subramaniam, R., Elmore, J., Felsensteiner, C., Coaker, G., and Desveaux, D.
(2010). The type III effector HopF2Pto targets Arabidopsis RIN4 protein to promote
Pseudomonas syringae virulence. Proc Natl Acad Sci U S A. 107, 2349-2354.
Yu, D., Chen, C., and Chen, Z. (2001). Evidence for an important role of WRKY DNA
binding proteins in the regulation of NPR1 gene expression. Plant Cell 13, 1527-1540.
Zhou, T., Wang, Y., Chen, J.Q., Araki, H., Jing, Z., Jiang, K., Shen, J., and Tian, D. (2004).
Genome-wide identification of NBS genes in japonica rice reveals significant expansion of
divergent non-TIR NBS-LRR genes. Mol. Genet. Genomics 27, 402-415.
Zipfel, C., Robatzek, S., Navarro, L., Oakeley, E.J., Jones, J.D.G., Felix, G., and Boller, T.
(2004). Bacterial disease resistance in Arabidopsis through flagellin perception. Nature 428, 764767.
Zipfel, C. (2009). Early molecular events in PAMP-triggered immunity. Curr. Opin. Plant Biol.
12, 414-420.

58

CHAPTER 2

Arabidopsis NDR1 is an integrin-like protein with a role in fluid loss and plasma
membrane-cell wall adhesion

This research was originally published in Plant Physiology.
Knepper, C., Savory, E.A. and Day, B. (2011) Arabidopsis NDR1 is an integrin-like protein
with a role in fluid loss and plasma membrane-cell wall adhesion. Plant Physiol. 156: 286-300.
www.plantphysiol.org © American Society of Plant Biologists.

59

Abstract

Arabidopsis thaliana NDR1 (NON-RACE SPECIFIC DISEASE RESISTANCE-1), a plasma
membrane localized protein, plays an essential role in resistance mediated by the CC-NB-LRR
class of resistance (R) proteins, which includes RPS2, RPM1 and RPS5.

Infection with

Pseudomonas syringae pv. tomato DC3000 expressing the bacterial effector proteins AvrRpt2,
AvrB and AvrPphB activate resistance by the aforementioned R proteins. Whereas the genetic
requirement for NDR1 in plant disease resistance signaling has been detailed, our study focuses
on determining a global, physiological role for NDR1. Through the use of homology modeling
and structure threading, NDR1 was predicted to have a high degree of structural similarity to
Arabidopsis LEA14, a protein implicated in abiotic stress responses. Specific protein motifs also
point to a degree of homology with mammalian integrins, well characterized proteins involved in
adhesion and signaling. This structural homology led us to examine a physiological role for
NDR1 in preventing fluid loss and maintaining cell integrity through plasma membrane-cell wall
adhesions. Our results show a substantial alteration in induced (i.e., pathogen inoculated)
electrolyte leakage and a compromised PAMP triggered immune response in ndr1-1 mutant
plants. As an extension of these analyses, using a combination of genetic and cell biology-based
approaches, we have identified a role for NDR1 in mediating plasma membrane-cell wall
adhesions. Taken together, our data point to a broad role for NDR1 both in mediating primary
cellular functions in Arabidopsis through maintaining the integrity of the cell wall-plasma
membrane connection, as well as a key signaling component of these responses during pathogen
infection.

60

Introduction

Defense signaling in plants following pathogen infection results in the activation of multiple,
often parallel, signaling pathways.

To accomplish this, the activation of plant resistance

signaling requires the utilization of numerous preformed defense responses, systemic and cell-tocell signaling, and in many cases, the initiation of Gene-for-Gene resistance (Knepper and Day,
2010). While examples of activation and regulation of parallel processes have been described
(van Wees et al., 2000), there are numerous instances in which bifurcation exists (Wiermer et al.,
2005). In plants, it is now evident that regulation and specificity often have overlapping nodes;
the guard hypothesis is one such example (reviewed in Chisholm et al., 2006; Jones and Dangl,
2006). In short, host resistance (R) proteins are responsible for the indirect recognition of
pathogen effectors by means of “guarding” a virulence target and initiating an effective defense
response.

The largest class of resistance (R) genes found in plants encode for nucleotide-binding siteleucine-rich repeat (NB-LRR) signaling molecules (Moffett, 2009). NB-LRR R-proteins have
been historically divided into two subgroups, based on the amino-terminal presence of either a
coiled-coil (CC) domain, or a domain with similarity to the Toll interleukin-1 receptor (TIR)
family of proteins (reviewed in Takken and Tameling, 2009). While R-proteins play a central
role in the activation of resistance following pathogen perception, R-proteins alone are not
sufficient for the initiation of resistance. As such, numerous ancillary proteins and chaperones
serving as co-activators of resistance have also been identified (Muskett et al., 2002; Tornero et
al., 2002; Azevedo et al., 2002; Hubert et al., 2003; Belkhadir et al., 2004). For example, EDS1

61

(ENHANCED DISEASE SUSCEPTIBILITY-1; Parker et al., 1996) has been shown to mediate
defense signaling through the activation of the TIR domain-containing R-proteins, while NDR1
(NON-RACE SPECIFIC DISEASE RESISTANCE-1; Century et al., 1995; Century et al., 1997;
Coppinger et al., 2004) has been shown to be required for R-proteins that contain the CC domain
(Aarts et al., 1998). There are, however, exceptions to this rule; several CC-NB-LRR R-proteins
that specify resistance to the oomycete pathogen Hyaloperonospora arabidopsidis function
independently of NDR1 (McDowell et al., 2000; Bittner-Eddy and Beynon, 2001). Thus, while
there appears to be conservation in terms of specificity, function and activation of signaling
through both EDS1 and NDR1 in terms of R-protein structure, the full mechanism(s) associated
with these pathways are unknown.

Of the two primary signaling components required for the activation of R-protein-mediated
resistance, the role of EDS1 in defense signaling is best understood. EDS1 serves as a central
regulatory protein involved in both biotic and oxidative stress signaling (reviewed in Wiermer et
al., 2005).

In this capacity, EDS1, through its interaction with PAD4 (PHYTOALEXIN

DEFICIENT 4) and SAG (SENESCENCE ASSOCIATED GENE)-101, is required for
elicitation of the hypersensitive response (HR) during bacterial infection (Feys et al., 2001,
2005). EDS1 has also been shown to function in halting post-invasive growth of non-pathogenic
fungi (Yun et al., 2003), as well as functioning in oxidative stress signaling (Wiermer et al.,
2005). Thus, EDS1 can be classified as a broad-spectrum signaling mediator required for the
activation of resistance to multiple pathogen types (Hu et al., 2005).

62

In contrast, the function of NDR1 within the CC-NB-LRR signaling pathway remains unclear.
NDR1 is a plasma membrane-localized protein (Century et al., 1997) that undergoes multiple
post-translational

modifications,

including

C-terminal

processing

(i.e.,

Glycosylphosphatidylinositol (GPI) anchoring) and N-linked glycosylation (Coppinger et al.,
2004). Unlike most GPI-anchored proteins, NDR1 appears to be unique in that the anchor at the
carboxyl-terminus is resistant to cleavage by phospholipase-C, and therefore possibly positions
NDR1 within the plasma membrane as a “double anchored” protein (Coppinger et al., 2004).
This positioning further raises the possibility that NDR1 may play a role in signaling from within
the apoplast, transducing the signal from the extracellular space to within the cell, possibly via its
association with RIN4 (RPM1-INTERACTING PROTEIN-4; Day et al., 2006), however, this
hypothesis remains untested. NDR1 has been demonstrated to associate with RIN4 (Day et al.,
2006) which has been shown to be required for both the regulation and activation of resistance
mediated by at least two member of the CC-NB-LRR class of resistance proteins (Mackey et al.,
2002, 2003; Axtell and Staskawicz, 2003; Belkhadir et al., 2004; Day et al., 2005; Chisholm et
al., 2005). The association of RIN4 with the resistance proteins RPM1 (RESISTANCE TO
PSEUDOMONAS SYRINGAE PV. MACULICOLA-1; Grant et al., 1995) and RPS2
(RESISTANCE TO PSEUDOMONAS SYRINGAE-2; Kunkel et al., 1993) is believed to
maintain the proteins in a signaling-incompetent state (Ellis and Dodds, 2003; Chisholm et al.,
2006). The association of NDR1 with a key negative regulator of R-protein activation (RIN4)
may in fact point to a role for NDR1 as a signal recognition element upstream of the activation of
specific R-protein signaling (Belkhadir et al., 2004), and moreover, may signify a role for NDR1
in broader defense and stress-associated response requiring both NDR1 and RIN4.

63

The activation of defense signaling through ligand-receptor interactions (e.g., pathogen
recognition receptor (PRR)-pathogen associated molecular pattern (PAMP)) is likely preceded
by the mechanical stimulation of responses at the onset of pathogen invasion. For example, in
mammalian innate immune and stress signaling, integrins have been characterized as a central
signaling component of the mechano-sensing apparatus of cells (Kumamoto, 2008). Integrins
are ubiquitous plasma membrane receptors that recognize extracellular glycoproteins (e.g.,
collagen and fibronectins) via the conserved, solvent exposed Arg-Gly-Asp (RGD) motif (Gee et
al., 2008).

On the cytoplasmic side, integrins connect the extracellular matrix to the

cytoskeleton, and following signal recognition, can initiate signaling responses associated with
cell differentiation (Streuli, 2009), growth and proliferation (Huveneers, et al., 2007). In plants,
peptides containing the RGD motif have been shown to block numerous processes, including
fungal toxin penetration (Manning et al., 2008), mechanoperception (reviewed in Telewski,
2006), cell wall adhesion to the plasma membrane (Canut, et al., 1998) and abiotic stress
responses (Zhu et al., 1993; reviewed in Gao et al., 2007). Similarly, RGD containing peptides
have also been shown to interfere with cell signaling responses initiated during interactions with
microorganisms, particularly those involving fungal and oomycete pathogens (Kiba et al., 1998;
Mellersh and Heath, 2001; Senchou et al., 2004).

While bona fide integrin proteins have not

been identified in plants, high affinity RGD-binding sites have been identified (Canut et al.,
1998), and it is hypothesized that these sites mediate plasma membrane-cell wall adhesion.

In the current work, we describe a role for NDR1 in both defense and stress response signaling
based on a predicted structure of NDR1 with homology to biotic and abiotic stress responsive
proteins. Using this predicted structural homology, and the known positioning of NDR1 in

64

defense signaling, we demonstrate using molecular-genetic, physiological and cell biology
approaches, that NDR1 plays a role in electrolyte release in response to bacterial pathogen
infection, as well as in maintenance of the plasma membrane-cell wall junction. Mutational
analysis of NDR1 supports a role for the RGD-like motif, NGD (Asn-Gly-Asp), as a key motif in
NDR1 involved in defense signaling following Pseudomonas syringae pv. tomato DC3000 (Pst
DC3000) infection. Taken together, our data suggest a role for NDR1 in coordinating broader
cellular processes in response to stress and bacterial pathogen infection.

RESULTS

NDR1 shares predicted structural homology with LEA14, an integrin-like protein

Two independent methods were used to generate a predicted structure for NDR1 (Figure 2.1A).
First, the protein fold recognition server PHYRE (Kelley and Sternberg, 2009) was used to
generate a predicted structural model.

In the second approach, we utilized the automated

homology modeling server I-TASSER to generate five predicted structures for NDR1 (Figure
S2.1). Both PHYRE and I-TASSER generated similar homology model predictions for NDR1.
The outputs of these predictions were then used as a template to guide our structure-function
analyses described in the present study. Homology modeling and structure threading was used to
predict a tertiary fold of NDR1. Once a secondary structure for NDR1 was predicted using
PHYRE, homology modeling was performed using MODELLER (Marti-Renom et al., 2000) and
Chimera (Pettersen et al., 2004). The output of this analysis was then threaded onto the solved
structure of the Arabidopsis LEA14 protein (LATE EMBRYOGENESIS ABUNDANT-14;

65

Figure 2.1B; pdb_1yyc; Singh et al., 2005), a member of the late embryogenesis family of
proteins.

Further analysis of the predicted structure was performed, in a domain-by-domain manner, from
which we identified several striking similarities with mammalian proteins involved in signal
perception and innate immune responses (Figure S2.2). For example, the large β-sheet torus
(Figure 2.1A; blue arrows) resembles the core structure of type III fibronectins (Potts and
Campbell, 1994). Further modeling (Figure S2.2) suggests the primary core structure of NDR1
shares strong structural similarity with the membrane bound subunit (i.e., fibronectin FNIII
domain) of integrin, with the putative transmembrane domains of both NDR1 and integrin
connected to large single β-sheets (Hynes, 2009). Adjacent to the 3-amino acid -helix (Figure
2.1B, small red/orange helix; compare homologous position in Figure 2.1C), we identified the
presence of a solvent-exposed RGD-like motif (i.e., NGD) at amino acid position 178 to 180. In
host-fungal interactions, the role of RGD motifs in defense signaling has been characterized as a
potential ligand binding site involved in cell wall-plasma membrane adhesion (Manning et al.,
2008; reviewed in Dodds et al., 2009). Moreover, RGD sites have also been postulated as both a
target, and mode of action, for pathogen effector proteins and secretion systems, presumably to
facilitate pathogen entry through disrupting cell wall-plasma membrane focal adhesions
(Jimenez-Soto et al., 2009; Wang et al., 2009).

NDR1 plays a role in limiting electrolyte leakage in response to Pst DC3000 infection

66

Based on the proposed function of LEA proteins in Arabidopsis, we hypothesized that NDR1
may play a broad role in regulating fluid loss. While the precise function of the LEA family of
proteins remains elusive, numerous studies have linked LEAs to a variety of biotic and abiotic
stress responses (De Meutter et al., 2005; Goyal et al., 2005; Battaglia et al., 2008). In support
of this, Singh et al. (2005) proposed LEAs to have a role in stopping or slowing the process of
fluid loss in response to wounding or dehydration. Based on the predicted structural homology
of NDR1 to LEA14, we hypothesized that defense signaling may be regulated, in part through
NDR1, as a function of controlling nutrient availability during pathogen infection (Katagiri et al.,
2002). When inoculated with the phytopathogenic bacterium Pst DC3000, ndr1-1 plants show
altered electrolyte leakage, compared with Col-0 plants. These data are in agreement with
similar plant-pathogen studies that have utilized electrolyte leakage as a physiological marker for
the HR as well as the activation of defense signaling in plants (Baker et al., 1991; Mackey et al.,
2002).

While previous methods used to measure electrolyte leakage relied on simple

conductance measurements over a relatively short time scale (i.e., 24 hours; Figure S2.3), we
chose to examine the changes in leakage in response to disease progression, and not simply in
correlation to the HR, by utilizing a method previously applied to abiotic stress (Gilmour et al.,
1988).

When ndr1-1 plants were dip inoculated with Pst DC3000 the leakage measurements

observed paralleled those of Col-0 (Figure 2.2A). These data are consistent with previously
published bacterial growth data and the enhanced disease susceptibility phenotype(s) (Century et
al. 1995), while also indicating a possible alteration in membrane permeability in the ndr1-1
mutant. When plants were inoculated with Pst DC3000 expressing the cysteine protease effector
protein AvrRpt2 (Axtell et al., 2003), the difference in measured electrolytes between ndr1-1 and
Col-0 are in greater contrast, with the most striking difference observed at 2 days post-

67

inoculation (dpi; Figure 2.2B).

This result provides further evidence for an alteration in

membrane integrity in the ndr1-1 mutant, as a simple increase in programmed cell death cannot
explain the dramatic difference in leakage observed; ndr1-1 does not undergo HR in response to
AvrRpt2 (Century et al., 1995).

The large observed difference in leakage also correlates with

the onset of disease symptoms in ndr1-1 (Figure 2.2E). To this end, while ndr1-1 does not
exhibit a significant increase in leakage, our findings would suggest that the ndr1-1 mutant is
unable to restrict leakage induced following Pst DC3000-AvrRpt2 inoculation. This apparent
loss in restricting leakage may be a primary mechanism through which AvrRpt2 is able to
enhance susceptibility in ndr1-1. Indeed, this hypothesis is further supported by previous results
from Freeman and Beattie (2009), which shows that Arabidopsis responds to the effector
AvrRpm1 by restricting vascular flow to the infected area. Related to the work presented herein,
it is noteworthy that both AvrRpm1 and AvrRpt2 are known to target RIN4 (Mackey et al.,
2002; 2003), the only previously identified interacting partner of NDR1 (Day et al., 2006). Pst
DC3000 expressing the effector proteins AvrPphB (Shao et al., 2003) or AvrB (Mackey et al.,
2002) did not elicit a statistically significant difference in the electrolyte release response in
ndr1-1 plants compared with Col-0 (Figure 2.2C-D).

The ndr1-1 mutant displays altered mRNA expression of several biotic and abiotic stress
responsive genes

Given the differences between the disease phenotypes in the ndr1-1 mutant versus Col-0 plants,
as well as the observation of enhanced electrolyte leakage, we hypothesized that a relationship
between these phenotypes and gene expression may exist. We reasoned that altered expression

68

of genes that are known to be associated with nutrient and water stress, as well as other general
abiotic stresses associated with drought tolerance may be indicators of an altered stasis in ndr1-1.
Based on the general role of LEA proteins in both biotic and abiotic stress responses, as well as
the predicted similarity of NDR1 to LEA14 (Figure 2.1), we hypothesized that NDR1 may also
play a role in abiotic stress tolerance, or may be functionally affected by these stresses. We
compiled a candidate list of genes from publicly available microarray and expression data (Sato
et al., 2007) whose expression profiles may correlate with our observed electrolyte phenotypes.
Two members of the LEA family met our search criteria and were investigated for altered mRNA
expression in ndr1-1 plants. LEA group 1 domain containing protein (At1g32560) showed a
nearly 3-fold increase in expression in ndr1-1 mutant plants as compared to Col-0 when
inoculated with Pst DC3000 (Figure 2.3A).

LEA group 1 domain containing protein also

showed altered levels of expression in ndr1-1 plants when inoculated with Pst DC3000
expressing AvrRpt2, but when inoculated with Pst DC3000 expressing AvrPphB, a rapid
induction was observed in ndr1-1 leading to a nearly 4 fold increase in mRNA expression at 48
hours post inoculation (hpi; Figure 2.3A).

The expression patterns of LEA14 were nearly

identical between Col-0 and ndr1-1 under all conditions with the exception of Pst DC3000
expressing AvrRpt2 which showed a nearly 3 fold increase in mRNA at 48 hpi in ndr1-1 plants
(Figure 2.3A). This differential expression in LEA family genes observed between Col-0 and
ndr1-1 suggests an increase in cellular stresses occurring within an ndr1-1 cell following
pathogen inoculation, and may also indicate a similar role for NDR1 in cellular stress responses
as that of LEA14.

69

Genes associated with water regulation and ion release (e.g., aquaporin homologs; AtPIP1;3,
AtPIP1;4, AtPIP1;5, AtPIP2;5, AtPIP2;6) were also examined. No significant differences in
expression were observed between Col-0 and ndr1-1 at 0 hpi (Figure 2.3B). However, two of
the aquaporin homologs (AtPIP1;4 and AtPIP2;5) showed a rapid induction in ndr1-1 compared
with Col-0 when infected with Pst DC3000 alone, or expressing AvrRpt2 (Figure 2.3B).

This

finding provides further evidence that NDR1 may play a role in mediating fluid loss as AtPIP1;4
and AtPIP2;5 have been previously demonstrated to be up-regulated in response to drought
stress (Alexandersson et al., 2005). Consistent with our observed electrolyte leakage data, we did
not detect a significant differences in the aquaporin homologs tested between Col-0 and ndr1-1
following inoculation with Pst DC3000 expressing either AvrB or AvrPphB (Figure S4). These
data further suggest increased water stress within the cells of ndr1-1 plants following inoculation
with Pst DC3000. Interestingly, we observed an increase in PDF1.2 mRNA expression at 24 hpi
with Pst DC3000 expressing AvrB in the ndr1-1 mutant (Figure S5), which is consistent with
previously published observations in RIN4-associated mutants (Cui et al., 2010),

NDR1 self-associates in planta via the formation of oligomers

One of the primary characteristics of integrins, and integrin-like proteins, is their association in
vivo as dimers (Zhao and Newman, 2001). Based on the predicted structural similarity of NDR1
to integrin-like proteins, we hypothesized that NDR1 exists as multimers in planta. To test this,
differentially epitope-tagged (e.g., T7 and HA epitope) NDR1 constructs were expressed in
Nicotiana benthamiana using Agrobacterium tumefaciens-mediated transient expression. As
shown in Figure 2.4A, using epitope-tagged NDR1 constructs, we detected a self-association in

70

reciprocal co-immunoprecipitation pull-downs, providing another example of integrin-like
structure. The band intensity observed for the reciprocal self-associations correlated with
differences in total tagged NDR1 protein detection rates (Figure S6).

The NGD motif is not required for the interaction of NDR1 with RIN4, nor self-association
as a multimeric protein complex

RIN4 has been shown to interact with NDR1 (Day et al., 2006). Based on the similarity of the
NGD motif to known ligand binding sites (i.e., the RGD site found in integrins), the possibility
exists that this site serves to stabilize the NDR1-RIN4 interaction, or as an additional point of
interaction between the two associated proteins. Co-immunoprecipitation experiments were
performed to isolate the NDR1-RIN4 protein complex (Figure 2.4D). T7-tagged NDR1, as well
as variants with mutations within the NGD motif (i.e., 178AAA180 and 178RGD180), were
tested for association with HA-tagged RIN4. In all cases, an interaction between NDR1 and
RIN4 was detected, despite alterations to the NGD motif (Figure 2.4E-F). These data suggest
that the NGD motif is not required for the NDR1 association with RIN4 in planta, in agreement
with the previous finding that the association occurs within the N-terminal region of NDR1 (Day
et al., 2006). Based on the proposed topology of NDR1 (Coppinger et al., 2004), our results are
not surprising, and moreover, they are consistent with published data describing integrin
dimerization and protein association (van der Flier and Sonnenberg, 2001; Zhao and Newman,
2001).

71

We also tested the impact of mutations in the NGD motif on the NDR1-NDR1 self-association
identified in this study. Unlike the NDR1-RIN4 association, the specific residues or motifs
required for the formation of multimeric complexes of NDR1 are unknown. HA-epitope-tagged
NDR1 along with various T7-tagged NDR1 proteins (i.e., 178NGD180, 178AAA180 and
178RGD180) were transiently expressed in N. benthamiana using Agrobacterium-mediated
transient expression. Complexes consisting of NDR1 along with NDR1 variants containing an
altered NGD site could successfully be isolated using co-immunoprecipitation (Figure 2.4B-C).
These data also demonstrate that the NGD site is not required for the formation of self-associated
multimeric NDR1 protein complexes.

The ndr1-1 mutation has a reduced response to the PAMP flg22

While it has long been known that ndr1-1 mutant plants are compromised in resistance to Pst
DC3000, as well as in addition to strains expressing several specific bacterial effector proteins
(Century et al., 1995), the underlying mechanism(s) of this process have never been explored. In
the current study, we explored this through the analysis of the expression of FRK1 (FLG22INDUCED RECEPTOR-LIKE KINASE 1), an early marker of MAPK (Mitogen-Activated
Protein Kinase) pathway activation (Asai et al., 2002), in both Col-0 and ndr1-1 plants treated
with the PAMP flg22. As shown in Figure 2.5B, the ndr1-1 mutant showed a significantly
weakened response to flg22 treatment, as measured by MAPK activation. Furthermore, total
protein levels of MAPK3 and MAPK6, both of which are required for priming of the biotic stress
response (Beckers et al., 2009), were reduced in ndr1-1 plants treated with flg22 as compared to
Col-0 (Figure 2.5C).

72

Mutation of the NGD site in NDR1 may compromise resistance to Pseudomonas syringae
DC3000

Our experimental approach assessing the role of the NGD site in mediating protein-protein
interactions revealed no detectable impact on the NDR1-RIN4 or NDR1-NDR1 associations
(Figure 2.4), the question remains whether mutations in this site alter the overall resistance
response to Pst DC3000. To test this, we generated stable T7-tagged transgenic lines in the
ndr1-1 mutant background expressing the two mutant variants of NDR1 (i.e., RGD and AAA) at
positions 178-180, as well as an NDR1-complemented line (i.e., NGD). As shown in Figure
2.6A, the NGD complemented line displayed resistance to Pst DC3000 and Pst DC3000
expressing each of the 3 effector proteins described above, at a level comparable to WT Col-0.
Similarly, conversion of the NGD motif to RGD also resulted in a near WT level of resistance to
all Pst DC3000 strains tested (Figure 2.6B). When the NGD motif was changed to AAA, a
complementation of resistance to Pst DC3000 over-expressing any of the 3 effector genes was
observed, however only an intermediate level of resistance to Pst DC3000 was detected (Figure
2.6C). The 1 log increase in bacterial growth observed in the AAA lines as compared to Col-0,
while not statistically significant under our assigned p value (p<0.05; Table S2.3), is nonetheless
an interesting finding and strengthens the case for the NGD site of NDR1 as playing a critical
role in specific defense responses. Pst DC3000 demonstrates an increased growth on ndr1-1
plants as compared to Col-0 (Century et al., 1995). This, together with our observations of the
AAA complemented line, suggests that NDR1 may be involved in mediating PAMP triggered, or
basal, immunity. Indeed, this hypothesis is further supported by the alteration observed in the

73

MAPK pathway response to the PAMP flg22 in the ndr1-1 mutant (Figure 2.5). The inability of
the AAA complemented lines to fully complement resistance would suggest that this site may in
fact play a role in resistance signaling to Pst DC3000, possibly through mediating association
with an as yet-unidentified ligand, similar to the function of integrin RGD binding sites (Plow, et
al., 2000).

ndr1-1 mutant plants have altered cell wall adhesions

Several pieces of evidence point to a role for NDR1 in the adhesion of the plasma membrane to
the cell wall; predicted structural similarity to integrins, as well as the putative orientation of
NDR1 within the plasma membrane (Coppinger et al., 2004). To test this hypothesis, 8-day-old
ndr1-1 and Col-0 hypocotyls were visualized pre- and post-CaCl2-induced plasmolysis to assess
the integrity of plasma membrane-cell wall adhesion. As shown in Figure 2.7A, a distinctive
concave shape was observed in the membranes of Col-0 hypocotyls cells undergoing
plasmolysis, with obvious attachments to the cell wall still visible (Figure 2.7A, arrows). These
data are in agreement with previously observed results using hypocotyls or suspension-cultured
cells (Canut et al., 1998; Gouget et al., 2006). Surprisingly, CaCl2-induced plasmolysis of the
ndr1-1 mutant was significantly altered (Figure 2.7A, 2.7C), resulting in the complete
detachment of the plasma membrane from the cell wall, yielding spherical protoplasts with no
remaining attachments (convex plasmolysis). Complementation of the ndr1-1 mutant with a
constitutively expressed (i.e., 35S) GFP:NDR1 fusion protein restored the cell wall attachment
phenotype to wild-type (Figure 2.7B).

74

Disruption of plasma membrane-cell wall adhesion has been previously correlated with the
function of the RGD motif (Canut et al., 1998). Moreover, it has been well-established that the
conversion from concave to convex plasmolysis can be induced in cells with the addition of
exogenous RGD-containing or RGD-binding peptides (Canut et al., 1998; Mellersh and Heath,
2001; Senchou et al., 2004; Gouget et al., 2006). As shown in Figure 2.8, addition of exogenous
peptides did not alter the plasmolysis phenotype in ndr1-1 hypocotyls. Interestingly, the addition
of „VNGDG‟ peptide prior to the addition of CaCl2 was able to alter the plasmolysis pattern of
Col-0 hypocotyls from concave to convex in the same manner as the addition of „VRGDG‟
peptide, suggesting that the NGD motif might function similarly to the RGD motif. In addition,
complemented ndr1-1 lines expressing either PNDR1:NGD or PNDR1:RGD behaved similarly to
Col-0 without peptide treatment, as well as when treated with exogenous peptides. Conversely,
PNDR1:AAA complemented lines responded in the same manner as ndr1-1 under both treatment
conditions (Figure 2.8), strengthening the case for the NGD motif functioning in adhesion in
NDR1.

DISCUSSION

NDR1 was identified more than 15 years ago in a screen for enhanced disease susceptibility
mutants in Arabidopsis following Pst DC3000 inoculation (Century et al., 1995). Numerous
studies have speculated on a role for NDR1 in defense signaling (Belkhadir et al., 2004;
Coppinger et al., 2004; Zhang et al., 2004; Day et al., 2006), however, a functional role has
remained elusive. Our primary goal in this study was to look beyond the general defense

75

signaling processes with which NDR1 is known to be associated, and focus on determining a
broader physiological role for NDR1. This knowledge would both give insight into the general
role of NDR1 and also enable us to hypothesize on its function in plant disease resistance
signaling.

Studies have shown that NDR1 is required for a specific subset of resistance signaling pathways
in plants (Innes, 1998). A conceptual model has evolved that infers that a biochemical role for
NDR1 must encompass a multitude of specific signaling pathways associated with the activation
of resistance. For example, NDR1 is required for the activation of a majority of CC-NB-LRR Rproteins in Arabidopsis (Aarts et al., 1998). However, there are exceptions to this requirement
(McDowell et al., 2000; Bittner-Eddy and Beynon, 2001). With this in mind, how do we broadly
assign a role for NDR1 in defense signaling, while also explaining exceptions to the rule?

The association of NDR1 with RIN4 provides a possible mechanism through which NDR1
participates in defense signaling (Day et al., 2006). As a required component of signaling
mediated by three CC-NB-LRR resistance proteins (e.g., RPM1, RSP2 and RPS5), association
with RIN4 physically links NDR1 to two of these R-proteins: RPM1 and RPS2 (Mackey et al.,
2003; Axtell and Staskawicz, 2003).

Day et al. (2006) speculated that the NDR1-RIN4

association might serve as a protein scaffold, directly or indirectly linking multiple signaling
components at the plasma membrane. The association of NDR1 with RIN4, as well as the
association of RIN4 with both RPM1 and RPS2, provides the potential for the assembly of a
multi-protein complex at the plasma membrane.

76

The control of electrolyte release during host-pathogen interactions (Baker et al., 1991; Mackey
et al., 2002) as well as the desiccation responses induced in plants as a result of pathogen
infection (Wright and Beattie, 2004), led us to hypothesize that NDR1 may play a role in similar,
associated responses. This proved successful, as our data suggest a role for NDR1 in electrolyte
release following infection with Pst DC3000 (Figure 2.2A-D). However, our data do not fully
define the precise role of NDR1 in the general process of nutrient release.

The simplest

explanation, given the proposed role of NDR1 in membrane adhesion, may be that the absence of
NDR1 results in a weakened membrane system, one that is unable to prevent or restrict leakage
in response to a virulent pathogen. Alternatively, NDR1 may be associated with additional
proteins, such as membrane-associated transporters and/or regulatory processes, in the host plant
which themselves are involved in nutrient release-associated mechanisms. In support of this,
recent work by Liu et al., (2009) identified several interacting partners of RIN4, thereby
potentially linking NDR1 to a multitude of host cell processes, including guard cell dynamics
and membrane potential.

The predicted structural homology of NDR1 with LEA14 (Figure 2.1), and by inference, with
integrins (Figure S2.2), prompted us to investigate a general role for NDR1 in stress responses
that are regulated by the LEA family of proteins. In plants, LEA proteins have been described as
playing a role in a broad range of biotic and abiotic responses, including salt tolerance, as well as
cold, heat and drought stress (De Meutter et al., 2005; Goyal et al., 2005; Battaglia et al., 2008).
Our observation of an increase in LEA14 mRNA expression in ndr1-1 plants in response to Pst
DC3000 infection may in fact suggest that ndr1-1 plants undergo increased water stress during
pathogen infection. We reason that this increase in LEA14 expression may be an attempt by the

77

plant to compensate for the increased electrolyte leakage observed in ndr1-1 plants. Therefore,
we hypothesize that NDR1 plays a role in limiting fluid loss. A similar role was proposed for
LEA14 in response to wounding and dehydration (Singh et al., 2005). Changes in expression
patterns of LEA group 1 domain containing transcripts further strengthens the argument for
NDR1 in the regulation of abiotic stress tolerance, while increases in the expression of PIP1;4
and PIP2;5 (Figure 2.3) demonstrates an increase in drought stress within the cells of ndr1-1
mutant plants inoculated with Pst DC3000 expressing AvrRpt2. Linking the physiological and
phenotypic observations with the mRNA expression data provide a more complete picture of the
role NDR1 plays in processes associated with electrolyte release, water movement, drought
tolerance and pathogen response.

In mammals, integrins are viewed as the primary signal response elements having critical roles in
adhesion signaling (Huveneers and Danen, 2009). Based on the predicted structural homology
with the fibronectin protein fold, we hypothesized that NDR1 may be involved with the plasma
membrane-cell wall network. Based on the “double anchor” model (Coppinger et al., 2004), we
hypothesized that NDR1 may function by mediating signaling processes or play a role in plasma
membrane-cell wall adhesion. During compatible or incompatible plant-pathogen interactions,
adhesion between the plasma membrane and cell wall can be disturbed or strengthened,
respectively, and elicitation of defense responses is dependent on adherence (Mellersh and
Heath, 2001). Our work shows that ndr1-1 mutant plants lack observable adhesion points
between the plasma membrane and cell wall under CaCl2-induced plasmolysis (Figure 2.7A).
Interestingly, we observed that addition of peptides with the NDR1 motif NGD (i.e., „VNGDG‟)
to Col-0 hypocotyls prior to plasmolysis resulted in conversion from the concave to convex
78

plasmolysis phenotype. This is in agreement with previous work described by Canut et al.
(1998), who characterized the role of RGD peptides in the disruption of plasma membrane-cell
wall adhesion. Furthermore, complemented ndr1-1 lines expressing NDR1 with the wild type
NGD, or mutant RGD, site behaves, as one would predict, with both NDR1 variants able to
complement the mutation and thus restore normal plasmolysis. Conversely, by substituting AAA
into the NGD site mirrored the lack of adhesion and convex plasmolysis observed in ndr1-1
mutant plants.

In support of our proposed role for NDR1 in mediating these processes, there are numerous
examples describing the role of plasma membrane-cell wall adhesion in basic plant physiology
(Gouget et al., 2006), mediating resistance during host-pathogen interactions (Mellersh and
Heath, 2001), as well as a potential virulence target during pathogen invasion (Pieterse et al.,
1992; Senchou et al., 2004). In each of these instances, exogenous application of RGD peptides
altered host cell membrane dynamics. In the current study, the addition of exogenous peptides
(e.g., VNDGG, VRGDG or VAAAG), while significantly altering plasma membrane-cell wall
adhesion, did not alter the HR observed in either Col-0 or ndr1-1 plants (Table S2.1). This
finding indicates that the role of NDR1 in adhesion does not fully account for the ndr1-1
mutant‟s loss of HR in response to the effector AvrRpt2. Based on the role(s) NDR1 plays in
defense signaling processes initiated by a diverse array of plant pathogens, we hypothesize that
the role of NDR1 in these processes are 1) mediating plasma membrane-cell wall adhesion, 2)
regulation of fluid movement in response to pathogen infection, 3) the perception of mechanical
stimuli initiated at the plasma membrane-cell wall interface 4) the transmission of this signal

79

from the apoplast to/through the plasma membrane either via its association with RIN4 or other
associated proteins.

The proposed role of NDR1 in mediating leakage may partially explain the differential
requirements for NDR1 in CC-NB-LRR mediated resistance to bacterial pathogens and to the
oomycete pathogen Hyaloperonospora arabidopsidis (McDowell et al., 2000; Bittner-Eddy and
Beynon, 2001).

Wright and Beattie (2004) have previously shown that limiting leaf water

availability results in restricted P. syringae growth, thereby supporting our hypothesis that the
inability of ndr1-1 mutants to restrict leakage provides a more suitable environment to support
bacterial growth. Given the different mechanisms of infection and disease progression between a
bacterial and an obligate oomycete pathogen such as H. arabidopsidis, it is not surprising that
NDR1 would have a much stronger effect on defense responses associated with a specific subset
of CC-NB-LRR proteins.

While much work remains to fully define the role of NDR1 in plant defense signaling, the
current work described herein provides a foundation for moving forward with additional
biochemical analyses. To date, the genetic role of NDR1 in defense signaling has been narrowly
defined without having a biochemical function for NDR1. As such, the role of NDR1 has been
defined based almost exclusively on the absence (e.g., ndr1-1 mutant) of the protein. In total,
our work proposes a role for NDR1 in mediating electrolyte leakage, and in part, regulating
processes associated with desiccation and drought tolerance; processes that are primary tenants
of plant disease resistance and abiotic stress response. As a role for LEA14 may be the
preservation of nutrient and fluid loss during biotic and abiotic stresses (Singh et al., 2005),

80

NDR1 may have a similar role, while also having evolved parallel functionality as an integral
signaling component of the plant defense network, possibly linking both ETI and PTI induced
signaling following P. syringae infection.

MATERIALS AND METHODS

Homology Modeling and Structure Threading

The primary amino acid sequence of NDR1 (AT3G20600) was submitted to the PHYRE (Protein
Homology/analogY

Recognition

(http://www.sbg.bio.ic.ac.uk/phyre/).

Engine)

protein

fold

recognition

server

The predicted structure was analyzed using the

MODELLER comparative homology modeling software (Marti-Renom et al., 2000). The output
of this analysis, a predicted model of all non-hydrogen atoms based on spatial restraints, was
then viewed using Chimera (Pettersen et al., 2004). Image overlays were performed using the
solved NMR structure of the LEA (LATE EMBRYOGENESIS ABUNDANT protein)-14
(AT1G01470; 1yyca; Singh et al., 2005). Further analysis (Figure S2.1) was performed by
submitting

the

primary

amino

acid

sequence

(http://zhanglab.ccmb.med.umich.edu/I-TASSER/),

an

NDR1

internet-based

service.

Plant Growth Conditions

81

of

to

structure

I-TASSER
prediction

Arabidopsis thaliana plants were grown at 20°C under a 12 hour/12 hour light/dark cycle at 60%
relative humidity in a Bio Chambers Incorporated model FLX-37 growth chamber. Nicotiana
benthamiana plants were grown under the same conditions.

DNA Cloning and Mutagenesis

Cloning of DNA constructs was performed using standard protocols. Site-directed mutagenesis
of NDR1 was performed according to previously published protocols (Day et al., 2005),
modified from the QuikChange PCR Mutagenesis Kit (Stratagene). Two site-directed mutations
within the NGD site of NDR1, located at amino acids 178-180, were constructed. A template
plasmid (i.e., pTOPO-NDR1) containing the open reading frame of NDR1 flanked by SalI (5‟)
and SacI (3‟) restriction enzyme sites was used in combination with the DNA oligonucleotide
primer sets labeled „RGD‟ and „AAA‟ in Table S2.1. Following 18 cycles (95C, 1 minute +
55C, 3 minutes + 68C, 5 minutes) on a BioRad MyCycler thermal cycler (BioRad
Laboratories) using Pfu Turbo DNA polymerase (Clontech), the product was then treated with
DpnI for 1 hour at 37C. Five l of the digested DNA reaction was transformed into Escherichia
coli DH5 cells and grown on Luria-Bertani media containing 100µg mL

-1

kanamycin,

overnight at 37C. Mutant NDR1 constructs were cloned into either the native promoter vector
pDDNDR (Coppinger et al., 2004) or the 35S binary vector pMD-1 with an amino- terminal T7
epitope tag (Day et al., 2005). To make pDDNDR native promoter constructs, primers were
designed to add a 5‟ T7 epitope tag and SalI site and a 3‟ SpeI site (Table S2.2). Amplicons from
the site-directed mutant constructs were ligated into pGEM T-EASY vector (Promega) and
subsequently digested with SalI and SpeI and ligated into pDDNDR (Coppinger et al., 2004).
82

DNA plasmids were transformed and maintained in E. coli DH5 cells. The fidelity of all DNA
constructs was confirmed by DNA sequencing (ABI 3730 Genetic Analyzer, Applied
Biosystems). Agrobacterium tumefaciens strain GV3101 (pMP90) (Lazo et al., 1991) and strain
C58C1 (Tai et al., 1999; for N. benthamiana expression) were transformed with WT and NDR1
mutant constructs by electroporation.

All native, WT NDR1 T7- and HA-fusion constructs were previously demonstrated to be
functional and fully complement the ndr1-1 mutation (Coppinger et al., 2004; Day et al., 2006).

Cloning of NDR1 mutant constructs.

Two site-directed mutations within the NGD site of NDR1, located at amino acids 178-180, were
constructed using a quick change PCR approach. A template plasmid (i.e., pTOPO-NDR1)
containing the open reading frame of NDR1 flanked by SalI (5‟) and SacI (3‟) restriction enzyme
sites was used in combination with the DNA oligonucleotide primer sets labeled „RGD‟ and
„AAA‟ in Table S2.1. Following 18 cycles (95C, 1 minute + 55C, 3 minutes + 68C, 5
minutes) on a BioRad MyCycler thermal cycler (BioRad Laboratories) using Pfu Turbo DNA
polymerase (Clontech), the product was then treated with DpnI for 1 hour at 37C. Five l of the
digested DNA reaction was transformed into Escherichia coli DH5 cells and grown on Luria-1

Bertani media containing 100µg mL

kanamycin, overnight at 37C. Resultant site-directed

mutant constructs were digested with SalI and SacI restriction enzymes and ligated into the
respective sites in the 35S binary vector pMD-1-T7, which incorporates a 5‟ T7 epitope tag (Day
et al., 2005). To make pDDNDR native promoter constructs, primers were designed to add a 5‟
83

T7 epitope tag and SalI site and a 3‟ SpeI site (Table S2.1). Amplicons from the site-directed
mutant constructs were ligated into PGEM T-EASY vector (Invitrogen) and subsequently
digested with SalI and SpeI and ligated into pDDNDR (Coppinger et al., 2004). DNA plasmids
were transformed and maintained in E. coli DH5 cells. Agrobacterium tumefaciens strain
GV3101 (pMP90) (Lazo et al., 1991) and strain C58C1 (Tai et al., 1999; for N. benthamiana
expression) were transformed with WT and NDR1 mutant constructs by electroporation.

All native, WT NDR1 T7- and HA-fusion constructs were previously demonstrated to be
functional and fully complement the ndr1-1 mutation (Coppinger et al., 2004; Day et al., 2006).

Arabidopsis thaliana Transformation
Flowering Arabidopsis plants were transformed and selected for homozygosity, as described by
-1

Clough and Bent (1998), on MS media containing 1% Bacto agar and 25µg mL kanamycin.

Pathogen Inoculation and Growth Assays

Pseudomonas syringae pv. tomato DC3000 strains containing pVSP61 (empty vector), or
pVSP61-containing AvrRpt2, AvrB or AvrPphB were described previously (Kunkel et al., 1993;
Simonich and Innes, 1995). To assay for bacterial growth, four-week-old plants were dip7

-1

inoculated in bacterial suspensions of 3 x 10 cfu mL . Leaves were pre-selected and marked to
ensure analyses were performed on developmentally similar leaves. At 0 and 4 days postinoculation, 3 leaf discs of 0.7 cm diameter were collected from a single plant into a microcentrifuge tube containing 1 mM MgCl2 + 0.1% Triton X-100. Bacterial growth assays were
84

performed as described in Tornero and Dangl (2001) with the modification of plating 5 µl
instead of 2 µl, as described in Tian et al. (2009). Results were analyzed for significance using
SAS (Version 9.2; SAS Software) using an ANOVA model modified from Tsuda et al., 2008
(Formula S2.1). Log10 transformed bacterial titer counts were compared using Tukey‟s test.

Electrolyte Leakage

Electrolyte leakage was measured in 4 to 5-week-old plants using a protocol modified from
Gilmour et al., (1988). Leaves were pre-selected and marked based on similarity in size before
7

-1

plants were dip inoculated at 3 x 10 cfu mL . After inoculation, plants were covered with a
clear plastic dome for 30 minutes before the 0 hour time point leaves were removed. The
remaining pots were left covered for another 2.5 hours. A single leaf was removed from a plant
and a disc (0.7 cm diameter) was harvested using a number 3 size cork borer. Excised leaf discs
were floated in a bath of sterile dH2O and quickly swirled before being placed in a tube
containing 3 mL of sterile dH2O. Four plants were used for each replicate. Tubes containing
leaf disks were shaken on an orbital rocker at 35 rpm for 3 hours. After 3 hours, leaf disks were
removed and the solution was assayed for conductance using a conductance meter (Traceable
23226-505; VWR Scientific). Leaf disks were frozen at -80°C for 1 hour. After the freeze cycle,
the leaf punch was returned to the original sample tube and rocked for an additional 3 hours at
room temperature.

After 3 hours, the leaf punch was removed and the conductance was

measured, recorded as total leakage. Electrolyte leakage was recorded and calculated as percent
leakage of total (i.e., first reading/second reading) adjusted to percent maximal.
85

RNA Isolation and qRT-PCR

Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen). First strand
cDNA was synthesized from 1 µg total RNA using SuperScript II reverse transcriptase
(Invitrogen). Quantitative RT-PCR was performed on a Mastercycler ep Realplex real-time PCR
(Eppendorf) using HotStart-IT SYBR Green qPCR Master Mix (2x) (USB). Cycle time for all
replicates was 95°C 2 min followed by 40 cycles 95°C 15s, 60°C 15s, 72°C 45s. Data was
analyzed by two-way ANOVA using Prism 4 (GraphPad Software) with outliers removed by
Grubb‟s test (α= 0.05) utilizing the QuickCalcs online outlier calculator (GraphPad Software;
http://www.graphpad.com/quickcalcs/Grubbs1.cfm).

Aquaporin homolog primers used are

described in Alexandersson et al. (2009). All primer sets utilized are listed in Table S2.2.

Hypersensitive Response Assay

The hypersensitive response was assayed as described in Century et al., (1995) slightly modified,
by hand infiltration of Arabidopsis leaves with Pst DC3000 using a needleless syringe at a
7

2

concentration of 1x 10 cfu/cm , following a 6 or 12 hour pretreatment by hand infiltration of 5
mM „VAAAG‟, „VNGDG‟ or „VRGDG‟ peptide solutions in 1 mM MgCl2 buffer or a mock
control of only buffer. The leaves were evaluated for tissue collapse 20 h after infiltration of the
bacteria.

Plasmolysis
86

Plasmolysis experiments were performed based on the methods of Gouget et al. (2006) using 8day-old etiolated hypocotyls with the cotyledons and roots removed. Hypocotyl sections were
immersed in 50 mM Tris (pH 8.0) for 1 hour at room temperature, rinsed in sterile distilled
water, and then stained with 0.05% neutral red for 5-30 minutes. Sections were rinsed in sterile
distilled water and mounted on a coverslip in 15 µL sterile water. A second coverslip was placed
on top of the section, offset to the first coverslip. To plasmolyze the cells, 15 µL of 1.0 M CaCl2
was placed on the sample where the second coverslip overlapped the first, allowing the solution
to cover the sample via capillary action. Stained, plasmolyzed hypocotyls were observed on an
Olympus IX-71 inverted microscope, and images acquired with an Olympus DP70 camera.
Images were processed and adjusted for contrast using Canvas X (ACD Systems).
Approximately 100 hypocotyls of each genotype were observed in total from > 5 biological
replicates. For peptide addition experiments, the same method as described above was followed,
with the exception that the hypocotyls were mounted in 15 µL of 5 mM peptide in dH 2O.
Peptides (VRGDG, VAAAG and VNGDG) were synthesized by EZ-Biolabs at a purity of
>99%.

Tagged Protein Constructs and Co-Immunoprecipitation

Co-immunoprecipitation experiments were performed as described in Day et al (2006), with
slight modifications. In brief, Agrobacterium tumefaciens strains expressing the epitope tagged
(e.g., T7 or HA) NDR1, RIN4 and NDR1 mutant constructs fused to a 35S promoter were
infiltrated into 5-week-old leaves on N. benthamiana at a final, individual, concentration of 4 x
87

8

10 cells/mL. Leaves were incubated at room temperature for 40 hours, after which time, 162

1cm leaf disks were harvested into liquid nitrogen, and held at -80C until processing. Samples
were processed according to Day et al. (2005).

T7 epitope monoclonal and T7-HRP conjugated antibodies were purchased from Novagen. HA
epitope monoclonal antibody was purchased from Covance. HA-HRP conjugated antibody and
protease inhibitors were purchased from Roche.

MAPK Western blotting

To detect MAPK 3/6 activity, 40 µg total protein was loaded onto a 12% SDS-PAGE gel and
transferred onto nitrocellulose membrane, followed by incubation for 1 hour with an antibody
specific for anti-pTEpY (catalog number 9101S, Cell Signaling Technology). An anti-rabbit
horseradish peroxidase secondary antibody was used for detection on film.

Acknowledgements

We would like to thank Katie Porter for technical support on qRT-PCR analyses as well as
Wenzhao Yang for assistance with the statistical analysis of bacterial growth assays.

88

Figure 2.1.

Figure 2.1. Homology modeling of NDR1 with the integrin-like late embryogenesis protein,
LEA14.
(A) Predicted structure of NDR1. (B) The solved structure of LEA14 (pdb_1yyc; Singh et al.,
2005). (C) NDR1 predicted structure threaded onto the solved structure of LEA14 highlighting
the predicted structural homology. „N‟ denotes amino-terminal. PHYRE anaylsis returned an
estimated structural homology precision of 95%, with an E-value of 0.008. Additional predicted
models are shown in Figure S2.1.

89

Figure 2.2.

90

Figure 2.2. (cont’d)

91

Figure 2.2 (cont’d)

Figure 2.2. Enhanced nutrient leakage in the ndr1-1 mutant following inoculation with Pst
DC3000.
Levels of electrolyte leakage from Col-0 and ndr1-1 plants in response to DC3000 inoculation
are displayed as percent maximal leakage. Treatments include Pst DC3000 expressing (A)
vector control, (B) AvrRpt2, (C) AvrB, (D) AvrPphB.

The dramatic increase in leakage

observed in ndr1-1 as compared to Col-0 when inoculated with Pst DC3000 correlates with the
onset of disease symptoms. (E) Col-0 and ndr1-1 leaves at 0, 2, 3, and 4 days post inoculation
(dpi) with Pst DC3000 expressing AvrRpt2. Error bars display standard deviation from 4
technical replicates from 2-3 biological replicates. Significance was determined using two-way
ANOVA where * represents a statistically significant difference between Col-0 and ndr1-1. *
p<0.05; ** p<0.01; *** p<0.001.

92

Figure 2.3.

93

Figure 2.3 (cont’d)

94

Figure 2.3.

Relative mRNA expression of biotic and abiotic responsive genes in ndr1-1

following Pst DC3000 inoculation.
(A) Altered levels of expression in WT Col-0 and ndr1-1 mutant plants of LEA family genes in
response to Pst DC3000 or Pst DC3000 expressing AvrRpt2, AvrB or AvrPphB. (B) Expression
levels of aquaporin homologs known to be drought responsive in Arabidopsis when inoculated
with Pst DC3000 or Pst expressing AvrRpt2. Error bars display standard deviation from 1-2
technical replicates from 2 biological replicates. Samples taken at 0, 24 and 48 hours post
inoculation (hpi). Expression displayed as fold Col-0 0 h average. Significance was determined
using two-way ANOVA where * represents a statistically significant difference between Col-0
and ndr1-1 and # represents statistically significant change over time. * p<0.05; ** p<0.01; ***
p<0.001.

95

Figure 2.4.

96

Figure 2.4. NDR1 associates with itself and RIN4 in planta, and this association is unaffected by
mutations in the NGD site.
Agrobacterium expressing HA:NDR1 or HA:RIN4, along with Agrobacterium expressing
T7:NDR1 with substitutions in the NGD motif (wild-type „NGD‟, „RGD‟, or „AAA‟) were
infiltrated into N. benthamiana. Tagged proteins were immunoprecipitated from samples taken
48 h after infiltration using anti-HA (NDR1 or RIN4; right lane) or anti-T7 (NDR1; left lane)
antibodies. Proteins were detected by blotting with anti-T7 (upper blot) or anti-HA HRP (lower
blot) conjugated antibody. (A) T7:NDR1 „NGD‟-HA:NDR1, (B) T7:NDR1 „AAA‟ -HA:NDR1,
(C) T7:NDR1 „RGD‟ -HA:NDR1, (D) T7:NDR1 „NGD‟-HARIN4, (E) T7:NDR1 „AAA‟ HA:RIN4, (F) T7:NDR1 „RGD‟ -HA:RIN4. Western blots in Figure S6 show relative detection
limits.

97

Figure 2.5.

98

Figure 2.5. ndr1-1 exhibits altered PAMP responses.
(A-B) The expression levels of FRK1 mRNA was analyzed by qRTPCR in Col-0 and ndr1-1
mutant plants in response to flg22 or mock treatment. Error bars display standard deviation from
2 technical replicates from 1 biological replicate. Expression displayed as fold Col-0 untreated
average. Statistical significance was determined using one-way ANOVA followed by Tukey‟s
test where * represents statistical difference as compared to Col-0 untreated and # represents a
statistically significant difference between Col-0 and ndr1-1. * p<0.05; ** p<0.01; *** p<0.001.
(C) Western blot analysis of MAPK3/6 in Col-0 and ndr1-1 mutant plants in response to flg22 or
mock treatment.

99

Figure 2.6.

100

Figure 2.6. (cont’d)

101

Figure 2.6. (cont’d)

102

Figure 2.6. Growth of Pst DC3000 in Arabidopsis is altered by mutations to the NGD site of
NDR1.
Bacterial growth assay of Pst DC3000 (EV) and Pst DC3000 expressing AvrRpt2, AvrB or
AvrPphB dip inoculated on ndr1-1 lines complemented with native NDR1 promoter with NDR1
NGD (ndr1-1/PNDR1:NGD; A), NDR1 RGD (ndr1-1/PNDR1:RGD; B), or NDR1 AAA (ndr11/PNDR1:AAA; C). Growth was assayed at 0 days and 4 days post inoculation (dpi). Growth
2

expressed as log cfu/cm . Error bars display standard deviation from 3 technical replicates from
2 biological replicates. Statistical significance was determined using unbalanced two-way
ANOVA (model included Figure S7) where * represents a statistically significant difference
between Col-0 and ndr1-1. * p<0.1; ** p<0.01; *** p<0.0001 (p values Table S2.3).

103

Figure 2.7.

104

Figure 2.7. (cont’d)

105

Figure 2.7. ndr1-1 mutant plants exhibit altered plasmolysis and plasma membrane-cell wall
focal adhesions.
(A) Time course (left to right: 0 (before), 2, and 5, min after treatment) of 8-day-old Col-0 or
ndr1-1 CaCl2-plasmolyzed hypocotyls. In contrast to plasmolyzed WT Col-0 hypocotyl cells,
which reveal plasma membrane-cell wall attachments (arrows), the plasma membrane of ndr1-1
cells quickly loses adhesion following induction of plasmolysis, yielding spherical protoplasts
within the cell wall. Scale bars = 25 µm. (B) Complemented ndr1-1 mutant line constitutively
expressing a GFP:NDR1 protein exhibits wild-type plasma membrane-cell wall adhesions
(arrows). DIC (top panel) and confocal-DIC overlay (bottom panel) images of CaCl2-induced
plasmolysis. Arrows indicate Hechtian strand formation, illustrating significant physical
linkages with the plasma membrane and cell wall. Scale bars = 30 µm. (C) Hechtian strands are
absent, or significantly reduced, in the ndr1-1 mutant plant. Scale bar = 10 µm.

106

Figure 2.8.

107

Figure 2.8. Application of exogenous peptides can alter the plasma membrane-cell wall adhesion
in WT Col-0.
Application of exogenous „VNGDG‟ or „VRGDG‟ peptide results in reduced plasma membranecell wall adhesions in Col-0, ndr1-1/PNDR1:NGD, and ndr1-1/PNDR1:RGD hypocotyl cells. Both
ndr1-1 and ndr1-1/PNDR1:AAA hypocotyls are unaltered in adhesion phenotypes upon addition
of purified „VRGDG‟, „VNGDG‟, and „VAAAG‟ peptides. Arrows indicate cell wall adhesion
points. DIC microscopy images were collected 5 minutes after induction of plasmolysis. Scale
bars = 25 µm.

108

LITERATURE CITED

109

Literature Cited

Aarts N, Metz M, Holub E, Staskawicz BJ, Daniels MJ and Parker JE (1998) Different
requirements for EDS1 and NDR1 by disease resistance genes define at least two R genemediated signaling pathways in Arabidopsis. Proc Natl Acad Sci USA 95: 10306-10311
Alexandersson E, Fraysse L, Sjovall-Larsen S, Gustavsson S, Fellert M, Karlsson M,
Johanson U and Kjellbom P (2005) Whole gene family expression and drought stress
regulation of aquaporins. Plant Mol Biol 59: 469-484
Alexandersson E, Danielson JAH, Rade J, Moparthi VK, Fontes M, Kjellbom P and
Johanson U (2010) Transcriptional regulation of aquaporins in accessions of Arabidopsis in
response to drought stress. Plant J 61: 650-660
Asai T, Tena G, Plotnikova J, Willmann MR, Chiu W, Gomez-Gomez L, Boller T, Ausubel
FM and Sheen J (2002) MAP kinase signaling cascade in Arabidopsis innate immunity. Nature
415: 977-983
Axtell MJ and Staskawicz BJ (2003) Initiation of RPS2-specified disease resistance in
Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112: 369-377
Axtell MJ, Chisholm ST, Dahlbeck D and Staskawicz BJ (2003) Genetic and molecular
evidence that the Pseudomonas syringae type III effector protein AvrRpt2 is a cysteine protease.
Mol Microbiol 49: 1537-1546
Azevedo C, Sadanandom A, Kitagawa K, Freialdenhoven A, Shirasu K and SchulzeLefert P (2002) The RAR1 interactor SGT1, an essential component of R gene-triggered
disease resistance. Science 295: 2073–2076
Baker CJ, O’Neill NR, Keppler LD and Orlandi EW (1991) Early responses during plantbacteria interactions in tobacco cell suspensions. Phytopathology 81: 1504-1507
Battaglia M, Olvera-Carrillo Y, Garciarrubio A, Campos F and Covarrubias AA (2008)
The enigmatic LEA proteins and other hydrophilins. Plant Physiol 148: 6-24
Beckers GJM, Jaskiewicz M, Liu Y, Underwood WR, He SY, Zhang S and Conrath U
(2009) Mitogen-Activated Protein Kinases 3 and 6 are required for Full Priming of Stress
Responses in Arabidopsis thaliana. Plant Cell 21: 944-953
Belkhadir Y, Subramaniam R and Dangl JL (2004) Plant disease resistance protein signaling:
NBS-LRR proteins and their partners. Curr Opin Plant Biol 7: 391-399

110

Bittner-Eddy PD and Beynon JL (2001) The Arabidopsis downy mildew resistance gene,
RPP13-Nd, functions independently of NDR1 and EDS1 and does not require the accumulation
of salicylic acid. Mol Plant Microbe Interact 14: 416-421
Canut H, Carrasco A, Galaud J, Cassan C, Bouyssou H, Vita N, Ferrara P and Pont-Lezica
R (1998) High affinity RGD-binding sites at the plasma membrane of Arabidopsis thaliana link
the cell wall. Plant J 16: 63-71
Century K, Holub EB and Staskawicz BJ (1995) NDR1, a locus of Arabidopsis thaliana that is
required for disease resistance to both a bacterial and fungal pathogen. Proc Natl Acad Sci USA
92: 6597-6601
Century K, Shapiro AD, Repetti PP, Dahlbeck D, Holub E and Stascawicz BJ (1997)
NDR1, a pathogen-induced component required for Arabidopsis disease resistance. Science 278
1963-1965
Chisholm S T, Coaker G, Day B and Staskawicz BJ (2006) Host-Microbe Interactions:
Shaping the Evolution of the Plant Immune Response. Cell 124: 803-814
Clough SJ and Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant J 16: 735–743
Coppinger P, Repetti PP, Day B, Dahlbeck D, Mehlert A and Staskawicz BJ (2004)
Overexpression of the plasma membrane-localized NDR1 protein results in enhanced bacterial
disease resistance in Arabidopsis thaliana. Plant J 40: 225-237
Cui H, Wang Y, Xue L, Chu J, Yan C, Fu J, Chen M, Innes RW and Zhou JM (2010)
Pseudomonas syringae effector protein AvrB perturbs Arabidopsis hormone signaling by
activating MAP kinase 4. Cell Host Microbe 7: 164-175
Day B, Dahlbeck D, Huang J, Chisholm ST, Li D and Staskawicz BJ (2005) Molecular basis
for the RIN4 negative regulation of RPS2 disease resistance. Plant Cell 17: 1292-1305
Day B, Dahlbeck D and Staskawicz BJ (2006) NDR1 interaction with RIN4 mediates the
differential activation of multiple disease resistance pathways in Arabidopsis. Plant Cell 18:
2782-2791
De Muetter J, Robertson L, Parcy F, Mena M, Fenoll C and Gheysen, G (2005) Differential
activation of ABI3 and LEA genes upon plant parasitic nematode infection. Mol Plant Pathol 6:
321-325
Dodds PN, Rafiqi M, Gan PH, Hardham AR, Jones DA and Ellis JG (2009) Effectors of
biotrophic fungi and oomycetes: pathogenicity factors and triggers of host resistance. New
Phytol 183: 993-1000

111

Ellis J and Dodds P (2003) Plant pathology: monitoring a pathogen-targeted host protein. Curr
Biol 13: R400-402
Feys BJ, Moisan LJ, Newman MA and Parker JE (2001) Direct interaction between the
Arabidopsis disease resistance signaling proteins, EDS1 and PAD4. EMBO J 20: 5400-5411
Feys BJ, Wiermer M, Bhat RA, Moisan LJ, Medina-Escobar N, Neu C, Cabral A and
Parker JE (2005) Arabidopsis SENESCENCE-ASSOCIATED GENE101 stabilizes and signals
within an ENHANCED DISEASE SUSCEPTIBILITY1 complex in plant innate immunity. Plant
Cell 17: 2601-2613
Freeman BC and Beattie GA (2009) Bacterial Growth Restriction During Host Resistance to
Pseudomonas syringae is associated with Leaf Water Loss and Localized Cessation of Vascular
Acivity in Arabidopsis thaliana. Mol Plant Microbe Interact 22: 857-867
Gao H, Gong Y and Yuan Y (2007) RGD-Dependent Mechanotransduction of Suspension
Cultured Taxus Cell in Response to Shear Stress. Biotechnol Prog 23: 673-679
Gee EP, Ingber DE and Stultz CM (2008) Fibronectin unfolding revisited: modeling cell
traction-mediated unfolding of the tenth type-III repeat. PLoS One 3: e2373.
doi:10.1371/journal.pone.0002373
Gilmour SJ, Hajela RK and Thomashow MF (1988) Cold Acclimation in Arabidopsis
thaliana. Plant Physiol 87: 745-750
Gouget A, Senchou V, Govers F, Sanson A, Barre A, Rouge P, Pont-Lezica R and Canut H
(2006) Lectin Receptor Kinases Participate in Protein-Protein Interactions to Mediate Plasma
Membrane-Cell Wall Adhesions in Arabidopsis. Plant Physiol 140: 81-90
Goyal K, Walton LJ and Tunnacliffe A (2005) LEA proteins prevent protein aggregation due
to water stress. Biochem J 388: 151-157
Grant MR, Godiard L, Straube E, Ashfield T, Lewald J, Sattler A, Innes RW and Dangl
JL (1995) Structure of the Arabidopsis RPM1 gene enabling dual specificity disease resistance.
Science 269: 843-846
Hu G, deHart AK, Li Y, Ustach C, Handley V, Navarre R, Hwang CF, Aegerter BJ
Williamson VM and Baker B (2005) EDS1 in tomato is required for resistance mediated by
TIR-class R genes and the receptor-like R gene Ve. Plant J 42: 376-391
Hubert DA, Tornero P, Belkhadir Y, Krishna P, Takahashi A, Shirasu K and Dangl JL
(2003) Cytosolic HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance
protein. EMBO J 22: 5679-5689
Huveneers S, Truong H and Danen EHJ (2007) Integrins: signaling, disease, and therapy. Int J
Radiat Biol 83: 743-751
112

Huveneers S and Danen EHJ (2009) Adhesion signaling-crosstalk between integrins, Src and
Rho. J Cell Sci 122: 1059-1069
Hynes RO (2009) The extracellular matrix: not just pretty fibrils. Science 326: 1216-1219
Innes RW (1998) Genetic dissection of R gene signal transduction pathways. Curr Opin Plant
Biol 1: 299-304
Jiménez-Soto LF, Kutter S, Sewald X, Ertl C, Weiss E, Kapp U, Rohde M, Pirch T, Jung
K, Retta SF, Terradot L, Fischer W and Haas R (2009) Helicobacter pylori type IV secretion
apparatus exploits beta1 integrin in a novel RGD-independent manner. PLoS Pathog 5(12):
e1000684
Jones JD and Dangl JL (2006) The plant immune system. Nature 444: 323-329
Kelley LA and Sternberg MJ (2009) Protein structure prediction on the Web: a case study
using the Phyre server. Nat Protoc 4: 363-371
Kiba A, Sugimoto M, Toyoda K, Ichinose Y, Yamada T and Shiraishi T (1998) Interaction
between cell wall and plasma membrane via RGD motif is implicated in plant defense responses.
Plant Cell Physiol 39: 1245-1249
Knepper C and Day B (2010) From Perception to Activation: The Molecular-Genetic and
Biochemical Landscape of Disease Resistance Signaling in Plants: May 14, 2010. In The
Arabidopsis Book. Rockville, MD: American Society of Plant Biologists. doi: 10.1199/tab.0124,
http://www.aspb.org/publications/arabidopsis/.
Kumamoto CA (2008) Molecular mechanisms of mechanosensing and their roles in fungal
contact sensing. Nat Rev Microbiol 6: 667-673
Kunkel BN, Bent AF, Dahlbeck D, Innes RW and Staskawicz BJ (1993) RPS2, an
Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae strains
expressing the avirulence gene avrRpt2. Plant Cell 5: 865–875
Lazo GR, Stein PA and Ludwig RA (1991) A DNA transformation-competent Arabidopsis
genomic library in Agrobacterium. Bio/Technology 9: 963-967
Liu J, Elmore JM, Fuglsang AT, Palmgren MG, Staskawicz BJ and Coaker G (2009) RIN4
functions with plasma membrane H+-ATPases to regulate stomatal apertures during pathogen
attack. PLoS Biol 7(6): e1000139. doi:10.1371/journal.pbio.1000139
Mackey D, Holt BF, Wiig A and Dangl JL (2002) RIN4 interacts with Pseudomonas syringae
type III effector molecules and is required for RPM1-mediated resistance in Arabidopsis. Cell
108: 743-754

113

Mackey D, Belkhadir Y, Alonso JM, Ecker JR and Dangl JL (2003) Arabidopsis RIN4 is the
target of the type III virulence effector AvrRpt2 and modulates RPS2 mediated resistance. Cell
112: 379-389
Manning VA, Hamilton SM, Karplus PA and Ciuffetti LM (2008) The Arg-Gly-Aspcontaining, solvent-exposed loop of Ptr ToxA is required for internalization. Mol Plant Microbe
Interact 21: 315-325
Martí-Renom MA, Stuart AC, Fiser A, Sánchez R, Melo F and Sali A (2000) Comparative
protein structure modeling of genes and genomes. Annu Rev Biomol Struct 29: 291-325
McDowell JM, Cuzick A, Can C, Beynon J, Dangl JL and Holub EB (2000) Downy mildew
(Peronospora parasitica) resistance genes in Arabidopsis vary in functional requirements for
NDR1, EDS1, NPR1 and salicylic acid accumulation. Plant J 22: 523-529
Mellersh DG and Heath MC (2001) Plasma Membrane-Cell Wall Adhesion is required for
Expression of Plant Defense Responses during Fungal Penetration. Plant Cell 13: 413-424
Moffett P (2009) Mechanisms of recognition in dominant R gene mediated resistance. Adv
Virus Res 75: 1-33, 228-229
Muskett PR, Kahn K, Austin MJ, Moisan LJ, Sadanandom A, Shirasu K, Jones
JDG and Parker JE (2002) Arabidopsis RAR1 exerts rate-limiting control of R gene
mediated defenses against multiple pathogens. Plant Cell 14: 979-992
Parker JE, Holub EB, Frost LN, Falk A, Gunn ND and Daniels MJ (1996) Characterization
of eds1, a mutation in Arabidopsis suppressing resistance to Peronospora parasitica specified by
several different RPP genes. Plant Cell 8: 2033-2046
Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC and Ferrin
TE (2004) UCSF Chimera--a visualization system for exploratory research and analysis. J
Compt Chem 25: 1605-1612
Pieterse CMJ, de Wit PJGM and Govers F (1992) Molecular aspects of the potatoPhyrophthora infestans interaction. Neth J Plant Pathol 98: 85-92
Plow EF, Haas TA, Zhang L, Loftus J and Smith JW (2000) Ligand Binding to Integrins. J
Biol Chem 275: 21785-21788
Pont-Lezica RF, McNally JG and Pickard BG (1993) Wall-to-membrane linkers in onion
epidermis: some hypotheses. Plant Cell and Environ 16: 111-123
Potts JR and Campbell ID (1994) Fibronectin structure and assembly. Curr Opin Cell Biol 6:
648-655

114

Sato M, Mitra RM, Coller J, Wang D, Spivey NW, Dewdney J, Denoux C, Glazebrook J
and Katagiri F (2007) A high-performance, small-scale microarray for expression profiling of
many samples in Arabidopsis-pathogen studies. Plant J 49: 565-577
Senchou V, Weide R, Carrasco A, Bouyssou H, Pont-Lezica R, Govers F and Canut H
(2004) High affinity recognition of a Phytophthora protein by Arabidopsis via an RGD motif.
Cell Mol Life Sci 61: 502-509
Shao F, Golstein C, Ade J, Stoutemyer M, Dixon JE and Innes RW (2003) Cleavage of
Arabidopsis PBS1 by a bacterial type III effector. Science 301: 1230-1233
Simonich MT and Innes RW (1995) A disease resistance gene in Arabidopsis with specificity
for the avrPph3 gene of Pseudomonas syringae pv. phaseolicola. Mol Plant Microbe Interact 8:
637–640
Singh S, Cornilescu CC, Tyler RC, Cornilescu G, Tonelli M, Lee MS and Markley JL
(2005) Solution structure of a late embryogenesis abundant protein (LEA14) from Arabidopsis
thaliana, a cellular stress-related protein. Prot Sci 14: 2601-2609
Streuli CH (2009) Intergrins and cell fate determination. J. Cell Sci 122: 171-177
Takken FL and Tameling WI (2009) To nibble at plant resistance proteins. Science 324: 744746
Telewski FW (2006) A unified hypothesis of mechanoperception in plants. Amer J Bot 93:
1466-1476
Tian M, Chaudry F, Ruzicka DR, Meagher RB, Staiger CJ and Day B (2009) Arabidopsis
Actin-Depolymerizing Factor AtADF4 Mediates Defense Signal Transduction Triggered by the
Pseudomonas syringae Effector AvrPphB. Plant Physiol 150: 815-824
Tornero P and Dangl JL (2001) A high-throughput method for quantifying growth of
phytopathogenic bacteria in Arabidopsis thaliana. Plant J 28: 475–481
Tornero P, Merritt P, Sadanandom A, Shirasu K, Innes RW and Dangl JL (2002)
RAR1 and NDR1 contribute quantitatively to disease resistance in Arabidopsis, and their relative
contributions are dependent on the R gene assayed. Plant Cell 14: 1005-1015
Tsuda K, Sato M, Glazebrook J, Cohen JD and Katagiri F (2008) Interplay between MAMPtriggered and SA-mediated defense responses. Plant J 53: 763-775
van der Flier A and Sonnenberg A (2001) Function and interactions of integrins. Cell Tissue
Res 305: 285-298
van Wees SC, de Swart EA, van Pelt JA, van Loon LC and Pieterse CM (2000)
Enhancement of induced disease resistance by simultaneous activation of salicylate- and
115

jasmonate-dependent defense pathways in Arabidopsis thaliana. Proc Natl Acad Sci USA 97:
8711-8716
Volgger M, Lang I, Ovecka M and Lichtscheidl I (2009) Plasmolysis and cell wall deposition
in wheat root hairs under osmotic stress. Protoplasma 243: 51-62
Wang J, Cao Y, and Zheng G (2009) Mutation in the RGD motif decreases the esterase
activity of Xcc_est. Biotechnol Lett 31: 1445-1449
Wiermer M, Feys BJ and Parker JE (2005) Plant immunity: the EDS1 regulatory node. Curr
Opin Plant Biol 8: 383-389.
Wright CA and Beattie GA (2004) Pseudomonas syringae pv. tomato cells encounter
inhibitory levels of water stress during the hypersensitive response of Arabidopsis thaliana. Proc
Natl Acad Sci USA 101: 3269-3274
Yun BW, Atkinson HA, Gaborit C, Greenland A, Read ND, Pallas JA and Loake GJ (2003)
Loss of actin cytoskeletal function and EDS1 activity, in combination, severely compromises
non-host resistance in Arabidopsis against wheat powdery mildew. Plant J 34: 768-777
Zhang Y, Dorey S, Swiderski M and Jones JDG (2004) Expression of RPS4 in tobacco
induces an AvrRps4-independent HR that requires EDS1, SGT1 and HSP90. Plant J 40: 213-224
Zhao T and Newman PJ (2001) Integrin activation by regulated dimerization and
oligomerization of platelet endothelial cell adhesion molecule (PECAM)-1 from within the cell. J
Cell Biol 152: 65-73
Zhu JK, Shi J, Singh U, Wyatt SE, Bressan RA, Hasegawa PM and Carpita NC (1993)
Enrichment of vitronectin- and fibronectin-like proteins in NaCl-adapted plant cells and evidence
for their involvement in plasma membrane-cell wall adhesion. Plant J 3: 637-646

116

CHAPTER 3

Arabidopsis NDR1 is required for robust activation of PAMP Triggered Immunity

117

Abstract

Much of the progress made towards the identification of a specific cellular role for Arabidopsis
(Arabidopsis thaliana) NON-RACE-SPECIFIC DISEASE RESISTANCE1 (NDR1) has focused
on effector-triggered immunity (ETI) signaling. Previous work in our laboratory provided the
first mechanistic understanding of the global physiological role of NDR1 in plasma membranecell wall adhesion and its impact on disease resistance to Pseudomonas syringae. With distinct
physiological and effector-dependent signaling roles for NDR1 now firmly established, our
present study focuses on the integration of NDR1 in early pathogen perception and PAMPtriggered immunity (PTI), with effector delivery, recognition and signaling. To this end, we
analyzed flg22- and elf26-specific signaling mechanisms to elucidate the breadth of NDR1
function in PTI. These mechanisms include a role for NDR1 in the regulation of stomatal closure
in response to the PAMP flg22 as well as a reduction in MAPK3/6 expression after elf26
exposure. Furthermore, the loss of NDR1 alters the delivery of the P. syringae effector AvrRpt2
to the cell interior by the type-three secretion system. These findings, together with previous
results, have allowed us to develop a basic model where NDR1 is involved at numerous stages of
pathogen defense signaling from pathogen entry to ETI signaling.

118

Introduction

In 1995, Century et al. identified an Arabidopsis mutant that exhibited a loss in resistance to the
bacterial pathogen Pseudomonas syringae pv. tomato DC3000 (Pst DC3000) expressing the
bacterial effector proteins AvrB, AvrRpt2, AvrRpm1 or AvrPphB (Century et al. 1995). In the
absence of host-effector recognition (i.e., compatible interaction), this mutant displayed an
enhanced susceptibility phenotype, suggestive of a broad compromise in basal resistance
activation. The gene, NON-RACE-SPECIFIC DISEASE RESISTANCE1 (NDR1), has since been
characterized as being required for signaling and activation of resistance through the coiled-coil
nucleotide binding-site leucine-rich repeat (CC-NB-LRR) class of resistance (R) genes (Aarts et
al. 1998). In terms of resistance and susceptibility, the difference(s) in pathogen growth between
the ndr1-1 mutant and WT Col-0 is most striking in an effector-dependent manner, particularly
in the presence of Pst DC3000 expressing the effector AvrRpt2, where a significantly higher
level of growth is observed in the ndr1-1 mutant (Century et al. 1995). Much of this difference in
resistance can be accounted for by R-gene mediated defenses (i.e., effector-triggered immunity;
ETI; Chisholm et al. 2006). At present, the molecular-genetic basis for enhanced susceptibility in
the ndr1-1 mutant in the absence of effector recognition remains undefined.

A possible mechanism for NDR1 function in the regulation of disease resistance signaling was
described when Day et al. (2006) identified an interaction between NDR1 and RPM1
INTERACTING PROTEIN4 (RIN4), an R-gene accessory protein that functions as a negative
regulator of activation and signaling (Mackey et al. 2002, 2003; Axtell and Staskawicz, 2003).
RIN4 is cleaved in the presence of AvrRpt2, a mechanism through which activation of the
119

AvrRpt2 cognate R-protein RESISTANCE TO PSEUDOMONAS SYRINGAE2 (RPS2) occurs
(Axtell and Staskawicz, 2003; Chisholm et al. 2005). In the ndr1-1 mutant, RIN4 is cleaved, yet
effector-mediated resistance is not activated (Axtell and Staskawicz, 2003). This observation
affirms that resistance signaling following the recognition of the effector AvrRpt2 by the host Rprotein requires the presence of a functional NDR1. In total, this points to a broader role for
NDR1, not in the direct physical recognition of the effector, but in the activation of the
subsequent defense signaling cascades upon effector recognition. While ETI can account for a
portion of the bacterial growth difference, Century et al. (1995) also observed that when plants
are inoculated with Pst DC3000 higher growth is observed in the ndr1-1 mutant, which is
suggestive of a potential role for NDR1 in the activation of basal immunity. Subsequent work
has corroborated this early observation (Coppinger et al. 2004; Knepper et al. 2011), and further
suggests that ETI alone cannot account for all differences in resistance observed in the mutant
line. These data, taken together, demonstrated that NDR1 is required for the full activation of not
only a subset of R-genes, but also for a robust activation of basal immunity.

Among the initial defense responses activated during host-pathogen interactions are those
mediated by the recognition of conserved pathogen motifs known as pathogen associated
molecular patterns (PAMP; e.g., chitin, flagellin, LPS) by cell surface pattern recognition
receptors (PRR) (reviewed in Zipfel, 2008). One of the best-characterized PAMP-PRR
interactions is the recognition of the conserved 22 amino acid flagellin peptide flg22 by the
receptor FLAGELLIN SENSITIVE2 (FLS2; Gomez-Gomez et al. 1999). Following receptorligand association (i.e., recognition of flg22), a defense signaling cascade is initiated, including
the activation of MITOGEN ASSOCIATED PROTEIN KINASE (MAPK) signaling (Asai et al.
120

2002), stomatal closure (Melotto et al. 2006) and endosomal trafficking (Otegui and Spitzer,
2008). The activation of PAMP triggered immunity (PTI) is often classified as a separate, initial
response within the broader, more robust activation of plant defense signaling. However, an
increasing number of studies have begun to link PTI and ETI into a larger global defense
signaling network (Xiang et al. 2008; Zhang et al. 2010; Knepper et al. 2011; Qi et al. 2011). For
example, recent work identified a requirement for NDR1 in the signal cascade initiated following
flg22 perception (Knepper et al. 2011). These data demonstrated that the ndr1-1 mutant displays
both a reduced and delayed MPK3/6 response to flg22, as well as significantly diminished
expression of the MAPK cascade marker gene FLG22-INDUCED RECEPTOR-LIKE KINASE1
(FRK1).

The identification of several roles for NDR1 in defense signaling, as well as in basic host
physiological processes, first suggested that NDR1 may be involved in multiple steps throughout
the infection process. While the molecular-genetic interactions described above are among the
best-characterized mechanisms known to be required for the activation of resistance in plants,
there are numerous basic physiological processes that are also required for pathogen perception
and subsequent resistance signaling. In total, NDR1 appears to be involved in numerous defense
mechanisms starting with the initial interaction between host and pathogen, at the level of
stomatal aperture at the guard cells. Many plant pathogens, including Pst DC3000, gain access to
the interior of host through stomata (Melotto et al. 2006). As an active defense response, the host
has evolved mechanisms (e.g., PAMP detection) through which to recognize the presence of
potential pathogens. Once recognition occurs, an abscisic acid (ABA)-dependent signaling
cascade initiates the rapid closure of stomata, thus restricting pathogen entry. To counter this
121

response, Pst DC3000 has evolved a mechanism to drive stomata opening via the action of a
jasmonic acid (JA) mimic, coronatine (Ma et al. 1991; Bender et al. 1999). As a function of PTI,
the PAMP flg22 has been shown to induce stomata closure (Melotto et al. 2006). Previous
studies have also shown that numerous PTI host signaling components can act in a PAMPspecific manner to regulate stomata closure (Desakin et al. 2008).

Plasma membrane (PM)-cell wall (CW) adhesion, a basic physiological process required for
growth, development and response to the environment, is also required for host response to
pathogen infection (Mellersh and Heath 2001). The maintenance of proper PM-CW adhesion is
critical for the defense signaling cascade (Kiba et al. 1998; Mellersh and Heath 2001). When
adhesion is defective, the host plant is reduced in the ability to detect and respond to pathogen
infection. Recent work from our laboratory has shown that NDR1 functions in adhesion between
the plasma membrane and cell wall (Knepper et al. 2011). A potential consequence of the loss of
the PM-CW continuum in ndr1-1 is a reduction in the ability of effectors to be delivered to the
plant and concomitantly, a reduction in their detection and subsequent initiation of ETI. The
reduction in adhesion observed in the ndr1-1 mutant plants was shown to be coordinated with an
increase in leakage across the membrane in response to pathogen infection, which potentially
allows for a more favorable apoplastic environment for pathogen growth (Knepper et al. 2011).

The requirement for NDR1 in PM-CW adhesion provides much of the foundation for the
analyses presented in the current study. The delivery of effectors by way of the type threesecretion system (T3SS) requires bacterial pathogens, such as Pst DC3000, to directly interact
with both the CW and PM of the host. In the current study, we demonstrate that effector delivery
122

is reduced significantly in the ndr1-1 mutant, as compared to WT Col-0. Following the initial
perception of pathogens at the host cell surface, subsequent defense signaling is dependent upon
membrane-bound PRRs (Gomez-Gomez et al. 1999; Zipfel et al. 2006). In the ndr1-1 mutant, the
activation of MAPK signaling following perception of flg22 by FLS2 is reduced (Knepper et al.
2011). Herein, we present a detailed analysis of the broad requirement for NDR1 across multiple
steps of Pst DC3000 infection - from the first contact of host and pathogen to dissecting the
specific requirement for NDR1 in PTI signaling. Our data demonstrate that NDR1, a critical
signaling component of innate immune signaling in plants, engages Pst DC3000 at multiple steps
of the infection process, linking primary physiological processes with the activation of defensespecific signaling.

Results

Flg22-induced stomata closure is reduced in the ndr1-1 mutant.

Defense signaling downstream of flg22 perception has been demonstrated to be compromised in
the ndr1-1 mutant (Knepper et al. 2011). To examine the physiological implication of reduced
flg22 signaling and/or perception, the stomatal aperture response following flg22 perception was
analyzed in the ndr1-1 mutant. As shown in Figure 3.1, when epidermal peels were exposed to
flg22, WT Col-0 stomata exhibited a significant closure of stomatal aperture as compared to
ndr1-1. One hour after peels were exposed to flg22 peptide, the stomatal apertures of ndr1-1
were, on average, greater than 1 µm wider than those of Col-0. No significant differences in
aperture width were identified in either the untreated controls or mock treated peels in either Col123

0 or ndr1-1 (Figure 3.1). The stomata of the ndr1-1 mutant appeared completely nonresponsive
to flg22 peptide treatment one hour post treatment, indicating that the perception of flg22 in the
ndr1-1 mutant fails to initiate the wild-type response of stomatal closure usually observed in
response to a PAMP trigger. With NDR1 apparently required for stomatal closure in response to
a bacterial pathogen the mutant line is lacking the first active physical barrier to prevent
pathogen entry.

NDR1 is required for a robust PTI response following elf26 perception.

Previous work (Knepper et al. 2011) demonstrated a reduced MAPK cascade in response to
recognition of flg22 in the ndr1-1 mutant as compared to Col-0. While the recognition of flg22
by the pattern recognition receptor FLS2 seems to be widely conserved across species (reviewed
in Zipfel and Felix, 2005), the recognition of bacterial elongation factor-Tu (EF-Tu) is restricted
to the Brassicales (Kunze et al. 2004). In Arabidopsis, the perception of EF-Tu by the EF-Tu
RECEPTOR, EFR, activates a cascade similar to what is observed in the recognition of flg22 by
FLS2 (Zipfel et al. 2006). In Col-0, PAMP perception elicits the robust activation of a MAPK
cascade, resulting in the phosphorylation of MAPK3 and MAPK6 (Asai et al. 2002). To examine
the specificity and role of NDR1 in PAMP-mediated signaling, leaves of Col-0 and ndr1-1 were
infiltrated with an active 26 amino acid subunit of EF-Tu (elf26; Kunze et al. 2004) in order to
induce MAPK3 and MAPK6 phosphorylation. As shown in Figure 3.2, treatment of leaves with
elf26 resulted in a reduced and delayed PTI response, similar to the previously observed flg22induced response observed in the ndr1-1 mutant (Knepper et al. 2011). The levels of
phosphorylated MAPK3 and MAPK6, shown to be required for the priming of biotic stress
124

responses (Beckers et al. 2009), are reduced greater than 50 % in the ndr1-1 mutant ten minutes
after infiltration with elf26 (Figure 3.2). Twenty minutes after elf26 infiltration, ndr1-1 showed
slightly higher MAPK3 and MAPK6 phosphorylation, corresponding with the reduced and
delayed response previously observed in ndr1-1. As determined by western blot analysis of
MAPK phosphorylation, we observed both a delay in phosphorylation, as well as a slightly more
diffuse response following PAMP elicitation in the ndr1-1 mutant as compared to WT Col-0.
The measured reduction in MAPK3 and MAPK6, while not clarifying a specific point of
regulation in the PTI response or MAPK cascade in which NDR1 is involved, demonstrates that
Arabidopsis plants lacking functional NDR1 cannot fully activate downstream resistance
signaling following pathogen perception. Differences in the mRNA expression of markers for
both MAPK signaling and CDPK signaling were also tested with corroborative results (Figure
S3.1). These results, taken together with the established role for NDR1 in flg22 signaling
(Knepper et al. 2011), confirm a broad requirement for NDR1 in PTI, in a manner that is not
specific to a single PAMP, but indicative of a broader role in multiple PAMP recognition and
signaling cascades.

Type III effector delivery is reduced in the ndr1-1 mutant.

Knepper et al. (2011) identified a role for NDR1 in mediating plasma membrane (PM)-cell wall
(CW) focal adhesion. From a structural standpoint, we hypothesized that a loss in adhesion could
impact numerous host cell processes associated with defense signaling at the membrane, such as
ROS production (Kiba et al. 1998) and penetration resistance (Mellersh and Heath, 2001). From
the standpoint of pathogen infection, we further hypothesized that a loss in PM-CW adhesion
125

may also negatively impact the ability of P. syringae to efficiently delivery type III secretion
system effectors (T3Es). As a result of a reduction in T3E delivery into the host cell, the
pathogen would proliferate, unencumbered by the activation of ETI. To test this hypothesis, we
investigated if type III secretion system (T3SS)-dependent delivery of effectors is altered as a
result of the loss of PM-CW adhesion in the ndr1-1 mutant. Utilizing a P. syringae DC3000
strain expressing an AvrRpt2-adenylate cyclase fusion (i.e., AvrRpt2:Cya; Casper-Lindley et al.
2002), the in planta translocation of the bacterial effector protein AvrRpt2 was monitored. As
shown in Figure 3.3, by five hours post-inoculation, a substantial difference in cAMP levels was
observed indicating a reduction in effector delivery to the ndr1-1 mutant. The quantity of
AvrRpt2 delivered to the ndr1-1 mutant line remained lower when compared to Col-0
throughout the duration of the time course. Based on these data, we hypothesize that the loss of
functional NDR1 reduces the ability of P. syringae to deliver T3SS effectors. Coupled with our
previous analyses (Knepper et al. 2011), we posit that reduced adhesion between the PM and
CW negatively impacts the pathogen's ability to interact with the host cell and therefore limits its
ability to deliver effector proteins. The recognition of effectors by corresponding host R-proteins
serves as a critical step in the initiation of ETI and the amplification of defense responses in
Arabidopsis. This reduced delivery of effectors in addition to previous findings indicating a loss
of defense signaling at the PM-CW interface when adhesion is reduced (Kiba et al. 1998;
Mellersh and Heath, 2001; Knepper et al. 2011), indicate that the role of NDR1 in maintaining
PM-CW adhesion may be critical for both PTI and ETI.

Effector delivery is not reduced by flg22 priming in the absence of NDR1.

126

The activation of basal immunity through the perception of PAMPs is the first line of defense for
the host plant during pathogen infection; thus, a robust PTI response may serve to “prime” the
host against escalating pathogen virulence. Recently, Crabill et al. (2011) showed that PTI can
restrict T3SS delivery of effectors. This restriction can be overcome in a susceptible interaction,
presumably via a mechanism whereby effectors are able to suppress the PTI response (Hauck et
al. 2003; Kim et al. 2005). In resistant lines, the recognition of effectors and subsequent
activation of ETI prevents PTI from being suppressed by the delivered effectors. Based on our
previous findings describing a reduction in flg22-mediated signaling in the ndr1-1 mutant
(Knepper et al. 2011), as well as the original observation of a reduced response in ndr1-1 to
several P. syringae effectors (Century et al. 1995), we hypothesized that plants lacking
functional NDR1 may be unable to actively suppress the delivery of effectors by the T3SS. To
test this, both Col-0 and ndr1-1 plants were inoculated with flg22 peptide concurrently with P.
syringae AvrRpt2:Cya or plants were pre-treated with the flg22 peptide two hours before
bacterial inoculation. In Col-0, the pre-treatment with flg22 led to a slight reduction in effector
delivery, as measured by cAMP levels (Figure 3.4), in contrast to the ndr1-1 mutant, in which no
difference was observed between pre-treated and simultaneously inoculated samples. The fact
that cAMP levels in ndr1-1 were unaffected by flg22 pretreatment further supports a role for
NDR1 in flg22 signaling. Taken together, these results suggest that the activation of layered
defenses in Arabidopsis is critical for disease resistance and that NDR1 is an important
component in the transition from basal immunity to the activation of a more robust ETI signaling
response.

Pst DC3000 D28E shows increased growth in the ndr1-1 mutant as compared to WT Col-0.
127

Recently, Cunnac et al. (2011) developed a Pst DC3000 polymutant strain that permits a finetuned analysis of PTI without the need for cell-free systems (i.e., PAMP treatment) or T3SSdeficient bacteria. In short, the 28 expressed native effectors of Pst DC3000 were systematically
deleted, leading to bacterium with an intact T3SS that is functionally effector-less, designated
Pst DC3000 D28E (deficient in 28 effectors, CUCPB5585). To determine the impact of the
NDR1 mutation on PTI signaling in response to Pst DC3000 D28E inoculation, we analyzed the
growth of the effector-less strain in the ndr1-1 mutant. As shown in Figure 3.5, while a deletion
of the native Pst DC3000 effectors yields a significantly weakened pathogen, we observed an
increase in growth four days post inoculation (dpi) in the ndr1-1 mutant, as compared to WT
Col-0. This growth differential is mirrored in the Pst DC3000 D28E T3SS deficient line,
CUCPB5589 (Figure 3.5). While not statistically significant using a threshold of p<0.05, a
reproducible increase in bacterial growth was observed in the ndr1-1 mutant in both
CUCPB5585 and CUCPB5589 compared to Col-0. These data further support that the ndr1-1
mutant is, as long-speculated, deficient in PTI.

The oxidative burst response is diminished in the ndr1-1 mutant.

In Arabidopsis, the initiation of PTI leads to the activation of numerous defense signaling
processes, including the generation of reactive oxygen species (ROS; reviewed in Bolwell and
Wojtaszek 1997; Davies et al. 2006). The accumulation of ROS is a central component of plant
defenses serving numerous functions including direct toxicity to pathogens (Keppler et al. 1989),
cross linking of plant cell walls (Fry et al. 2002) and signaling (Grant and Loake, 2000).
128

Previously, OXIDATIVE SIGNAL-INDUCIBLE1 (OXI1) was identified as being an integral
signaling component of the MAPK pathway, which is induced in response to ROS stimuli
(Rentel et al. 2004; Petersen et al. 2009). As a result, OXI1 mRNA accumulation is a marker for
the generation of ROS in response to pathogen infection. As shown in Figure 3.6B, qRT-PCR
analysis revealed an increase in OXI1 expression three hours after elf26 infiltration in WT Col-0,
in agreement with ROS production in Col-0 following Pst DC3000 infection (Torres et al. 2002).
Likewise, qRT-PCR analysis revealed a similar response in Col-0 three hours after infiltration
with flg22 peptide (Figure 3.6D). In contrast, we did not observe a rapid increase in OXI1
mRNA accumulation in the ndr1-1 mutant, which is suggestive of a diminished ROS response
following elf26 or flg22 recognition (Figure 3.6B, 3.6D). The failure of OXI1 induction observed
in the absence of NDR1 indicates that NDR1 is required for a robust PTI response, not only in
the upstream activation of defense signaling, but also in the downstream activation of ROS
production and subsequently in the activation of defense. This is further supported by 3,3’diaminobenzidine (DAB) staining for ROS in leaves infiltrated with elf26 or flg22 peptide
(Figure 3.6E), with more of the characteristic brown staining observed in Col-0 compared to
ndr1-1 mutant leaves.

BTH pre-treatment fails to restore ETI in the ndr1-1 mutant background.

In plants, benzo(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester (BTH) is metabolized into a
salicylic acid (SA) analog, and has been shown to elicit a response similar to exogenous SA
application (Lawton et al. 1996). Previously, the downstream marker gene for SA signaling,
PR1, was analyzed in the ndr1-1 mutant background, showing that PR1 mRNA expression was
129

reduced following inoculation with Pst DC3000 AvrRpt2 in the ndr1-1 mutant as compared to
WT Col-0 (Knepper et al. 2011). Shapiro and Zhang (2001) observed a potential link between
the ndr1-1 mutation and the activation of systemic acquired resistance (SAR). In short, this study
found that pre-treatment of ndr1-1 mutant plants with BTH restores resistance to Pst DC3000,
which is likely the result of systemic basal defense responses (Shapiro and Zhang, 2001). In the
present study, pre-treatment with BTH, while able to restore resistance to Pst DC3000, failed to
fully restore resistance in the ndr1-1 mutant following infection with Pst DC3000 expressing the
cysteine protease effector AvrRpt2 (Figure 3.7). In addition, an increase in bacterial growth was
observed in the ndr1-1 line following BTH pre-treatment, indicating that while NDR1 appears to
be important for the full activation of SA-dependent defense signaling, SA defense signaling
alone cannot account for the resistance deficiencies observed in the ndr1-1 mutant.

Discussion

NDR1 is a key component of the Arabidopsis defense-signaling network required for resistance
to the phytopathogen Pseudomonas syringae pv. tomato DC3000 (Century et al. 1995; Century
et al. 1997; Coppinger et al. 2004; Day et al. 2006; Knepper et al. 2011). While much progress
has been made toward the identification of a specific cellular role for NDR1 in effector-triggered
immunity (ETI) signaling, recent work represents the first mechanistic understanding of the role
of NDR1 in defense signaling, linking basic host physiological processes to the activation of
resistance following Pst DC3000 perception (Knepper et al. 2011). As a mediator of the host
plasma membrane (PM)-cell wall (CW) continuum, NDR1 was shown to play a role in
regulating fluid movement across the membrane in response to pathogen infection (Knepper et
130

al. 2011). This observation offers a possible mechanism to explain the enhanced bacterial growth
phenotype in the ndr1-1 mutant. As nutrient acquisition is the primary factor driving the
virulence capacity of pathogens (Katagiri et al. 2002), restricting access by the host is a means to
limit pathogen proliferation, and disease. Taken together, our previous work suggests that the
specific physiological niche NDR1 occupies within Arabidopsis defense signaling provides a
platform through which NDR1’s role in maintenance of PM-CW adhesion ultimately impacts
multiple steps of pathogen infection, perception and subsequent activation of defense signaling
(Figure 3.8). In total, the loss of NDR1 diminishes the temporal and spatial recognition of Pst
DC3000 by Arabidopsis, resulting in both a delay in perception as well as a compromise in broad
signaling of defense.

In the current study, we show that an interruption of the PM-CW continuum in the ndr1-1 mutant
not only affects fluid movement as previously demonstrated (Knepper et al. 2011), but also
disrupts the host-pathogen interaction through an abrogation in the delivery of bacterial effectors
by the type III secretion system (T3SS; Figure 3.3). In an analysis of defense signaling in plantfungal interactions, Mellersh and Heath (2001) observed that signaling at the CW is reduced
during the penetration of non-host plants by biotrophic fungal pathogens. Based on this
observation, it was hypothesized that the expression of CW-associated defense responses is
dependent upon proper PM-CW adhesion. In the case of host-phytopathogenic bacterial
interactions, the role of PM-CW focal adhesion is largely unknown. As an intimate point of
contact between the host and pathogen, it is reasonable to hypothesize that a disruption in the
normal function of this interface would impact numerous processes, including host resistance
signaling. Indeed, we demonstrate that a loss in adhesion between the PM and CW also affects
131

the ability of Pst DC3000 to efficiently deliver T3SS effectors (T3E) into the host, possibly via a
disruption of the normal function of the T3SS. In support of this, we observed a reduction in the
delivery of an AvrRpt2:Cya reporter construct, in planta (Figure 3.3). Despite the obvious
differences in mechanisms of infection utilized by fungal and bacterial pathogens, the
maintenance and function of PM-CW adhesion would appear to be a conserved point of function
in defense signaling in plants. Our data support the hypothesis that in Arabidopsis, NDR1 is a
mediator of this role, specifically in the case of phytopathogenic bacterial infection. To the best
of our knowledge, an extensive analysis of the role of NDR1 in fungal penetration in plants has
not been investigated. Based on our data presented herein, it is tempting to speculate that fungal
penetration in the ndr1-1 mutant would also be affected.

Crabill et al. (2010) found that the activation of PTI within the host leads to a reduction in the
ability of P. syringae to deliver T3SS effectors. Our data support the hypothesis that PTI
suppresses T3E delivery and demonstrate that NDR1 is required for this activity. Figure 3.4
shows that when ndr1-1 mutant plants are pre-treated with flg22, we did not observe a reduction
in effector delivery, which is in contrast to the reduction observed in WT Col-0. This observation
supports the hypothesis that suppression of effector delivery in the ndr1-1 mutant is likely due to
the reduced flg22 response (Knepper et al. 2011). Crabill et al. (2010) argued that PTI in
Arabidopsis is more effective at restricting effector injection by P. syringae strains in
incompatible rather than compatible interactions because in compatible interactions, effectors are
still delivered at a low level during PTI-induced injection restriction. Presumably, this would
permit T3Es to suppress PTI in the compatible host, thus leading to a reduction of the PTI-

132

induced effector delivery restriction. Based on the results from this study it appears that NDR1 is
required for Arabidopsis to actively restrict effector delivery after PTI activation.

When first identifying the ndr1-1 mutation as being involved in resistance in an effector-specific
fashion, Century et al. (1995) also made the observation that NDR1 contributed, to some degree,
to the activation of basal immunity. In support of this early observation, Knepper et al. (2011)
identified a distinct signaling function of NDR1 with respect to the perception and downstream
signaling associated with flg22 perception, thereby establishing a mechanistic link between
NDR1 and PTI signaling. In total, a reduction in FRK1 mRNA expression, coupled with a
delayed and weakened MPK3/6 protein expression profile provides the first definitive evidence
of a requirement for NDR1 in PTI signaling (Knepper et al. 2011). Broadly considering the hostpathogen interface, downstream PTI signaling pathways appear to be shared following PAMP
association with specific PRRs (reviewed in Schwessinger and Zipfel, 2008). In the ndr1-1
mutant, it appears that the PTI signals measured in the ndr1-1 mutant are reduced after elf26
treatment compared to those previously observed after flg22-induced defenses (Figure 3.2;
Knepper et al. 2011). This seems to indicate that NDR1 plays a stronger role in PTI signaling
downstream of flg22 perception as compared to elf26 perception. The connection between
NDR1 and flg22 signaling is further strengthened by the results of the stomatal aperture assay
(Figure 3.1) that indicates a disconnect between the perception of flg22 by FLS2 and the closure
of stomata in the ndr1-1 mutant plants. In the absence of NDR1 stomata fail to close in response
to a potential pathogen signal which leaves the mutant plants vulnerable to pathogen entry.

133

Shapiro and Zhang (2001) observed that localized treatment of ndr1-1 plants with BTH restores
a moderate level of resistance, presumably as a function of the activation of SAR. Based on this
observation and our data presented in Figure 3.7, we propose that the level of resistance observed
in the ndr1-1 mutant following BTH treatment (Shapiro and Zhang, 2001) is linked to basal
immunity. In the present study, pre-treatment of ndr1-1 with BTH fails to restore wild-type
levels of resistance following inoculation with P. syringae expressing the effector AvrRpt2
(Figure 3.7). While the observation of moderate resistance in ndr1-1 after BTH pre-treatment is
intriguing, the specificity of this resistance to P. syringae DC3000 raises many new questions as
to the nature of SAR and NDR1. These data indicate that while NDR1 is required for full
pathogen resistance, alternative pathways may exist that allow for some level of activation, even
in the absence of a functional NDR1 gene.

A mechanistic analysis of plant defense activation and signaling following perception of the
bacterial pathogen P. syringae has provided numerous insights into the broader role of host gene
function and the regulation of resistance signaling (Chisholm et al. 2006). However, a full
understanding of the shared and convergent regulation of ETI and PTI remains elusive. Recently,
Cunnac et al. (2011) developed P. syringae strains that are essentially effector-less. While it is
known that the ndr1-1 mutant line is defective in the robust activation of basal resistance
signaling, a precise understanding of the molecular-genetic mechanism(s) remains unknown. In
the absence of the native 28 P. syringae effectors, the ndr1-1 mutant supported an increase in
bacterial growth compared with WT Col-0 (Figure 3.5). In total, this data supports a role for
NDR1 in PTI activation, yet the precise signaling mechanism(s) underpinning this observation
remain largely undefined.
134

The production of ROS is a well-established component of plant immunity (reviewed in Bolwell
and Wojtaszek, 1997). While it has been suggested that NDR1 functions downstream of ROS
production (Shapiro and Zhang, 2001), our data presented herein indicates that in the absence of
NDR1, ROS production is significantly reduced following perception of the PAMPs elf26 or
flg22 (Figure 3.6B, 3.6D). This indicates that NDR1 is required for robust ROS production in
response to PAMP signals. The reduction in ROS production may indicate that NDR1 functions
upstream of ROS production, at least in a PTI-dependent manner.

Given the established physiological role for NDR1 in maintaining PM-CW adhesion and the
mediation of fluid movement in response to pathogen infection, in addition to the mounting
evidence linking NDR1 to an array of defense signaling pathways, it is becoming increasing
likely that NDR1 may serve as a signaling hub within Arabidopsis. This hypothesis is further
supported by recent findings physically linking the PRR FLS2 and the R-protein RPS2 (Qi et al.
2011); both of which require the presence of NDR1 for the full activation of downstream
signaling. We set forth a model showing several critical steps in plant pathogen defense from
pathogen entry to effector recognition and signaling in which NDR1 has been shown to impact
the host response (Figure 3.8). NDR1 appears to be a critical component of defense signaling in
both an effector- and PAMP-mediated fashion; it is due to this wide ranging requirement for
NDR1 in defense signaling that the interconnected nature of basal and effector-triggered
immunity becomes more clear. Given the success in experimentally associating NDR1 with a
multitude of defense responses it may be possible that other plant defense components
previously thought of as ancillary R-gene accessory proteins, may be involved in a multitude of
135

defensive functions. However, the extent to which NDR1 is so deeply integrated into nearly all
aspects of defense, from stomatal aperture regulation to PTI activation and effector mediated
defense, appears unique. The position and physiological function of NDR1 in Arabidopsis may
help to explain the extensive nature of NDR1’s involvement in plant pathogen perception and
defense signaling.

Materials and Methods.

Plant Growth Conditions

Arabidopsis thaliana plants were grown in a BioChambers model FLX-37 growth chamber
(Manitoba, Winnipeg, Canada) at 20°C under a 12 h/12 h light/dark cycle with 60% relative
humidity and a light intensity of 120 mol photons m-2s-1.

CyA Inoculation Assay and cAMP Extraction

CyA inoculation assays were performed as previously described (Casper-Lindley et al. 2002;
Crabill et al. 2010), with slight modifications. Four- to five-week-old WT Col-0 and ndr1-1
mutant leaves were hand-infiltrated with Pst DC3000 containing AvrRpt2:CyA at a
concentration of 3 x 108 cells/ml in 5 mM MES pH 5.5. After inoculation, plants were kept under
continuous light (100 µE.m-2.s-1) until 2 leaf discs (0.56 cm2) per sample (3 samples per
treatment) were harvested at 0, 3, 5, 8 and 24 hours post inoculation (hpi), frozen immediately in
liquid nitrogen and stored at -80ºC until processed. Samples were ground in liquid nitrogen to a
136

fine powder and resuspended in 100 µl of 0.1 M HCl. Next, samples were mixed by vortexing
and centrifuged at 1000 x g for 10 minutes. Supernatants were recovered and the total protein
concentration was determined using a Bradford assay. Samples were adjusted to 10 ng/µl, and
dilutions ranging from 1:2 to 1:7 were used. cAMP levels were measured using a direct cAMP
immunoassay kit (Cayman Chemical, Ann Arbor, MI, USA) according to the manufacturer’s
instructions. For flg22 priming studies leaves were hand-infiltrated with 1uM flg22 peptide with
a needless syringe either immediately before P. syringae infiltration or 2 hours prior to bacteria
infiltration. Samples were then collected and processed as described above. Results were
analyzed using Prism 4 (GraphPad Software) with outliers removed by Grubb’s test (α=0.05)
using the QuickCalcs online outlier calculator (GraphPad Software;
http://www.graphpad.com/quickcalcs/Grubbs1.cfm). Statistical significance was determined by
either Student’s t-test.

Pathogen Inoculation and Growth Assays

Pseudomonas syringae pv tomato DC3000 strains containing the pVSP61 vector (Pst DC3000)
or pVSP61 containing AvrRpt2 were previously described in Kunkel et al. (1993). The effectordeficient Pst DC3000 strain CUCPB5585 (D28E) and the T3SS deficient strain CUCPB5589
were previously described in Cunnac et al. (2011). To assess bacterial growth, plants were
handled using the method described in Knepper et al. (2011). Four- week-old plants were dip
inoculated in bacterial suspensions of 3 x 107 colony forming units (cfu) mL-1. Three leaf discs
of 0.7 cm were harvested 0 and 4 days post-inoculation. Growth assays were performed as
described in Tornero and Dangl (2001) and Tian et al. (2009). At day 0 leaves were surface
137

sterilized by submerging in 10% bleach for 30 seconds with gentle swirling followed by 30
seconds in sterile dH20. Results were analyzed using Prism 4 (GraphPad Software) with outliers
removed by Grubb’s test (α=0.05) using the QuickCalcs online outlier calculator (GraphPad
Software; http://www.graphpad.com/quickcalcs/Grubbs1.cfm). Statistical significance was
determined by either one way ANOVA with Tukey’s post test (Figure 3.7) or Student’s t-test
(Figure 3.5).

Benzo(1,2,3)-Thiadiazole-7-Carbothioic Acid S-Methyl Ester (BTH) pretreatment

Leaves were treated using a method modified from Shapiro and Zhang (2001). Leaves were
hand-infiltrated with 0.12 mM benzo(1,2,3)-thiadiazole-7-carbothioic acid S-methyl ester (BTH;
Sigma, St. Louis, MO, USA) in 1 mM MgCl2 buffer or 1 mM MgCl2 buffer only (mock) using a
needless syringe 48 h before being dip-inoculated for the bacterial growth assay.

RNA Isolation and Quantitative Real-Time PCR

Total RNA was extracted from leaves using the PrepEase Plant RNA Spin kit (USB Affymetrix,
Santa Clara, CA, USA). First-strand cDNA was synthesized from 1 g Total RNA using the
First-Strand cDNA Synthesis kit (USB Affymetrix). qRT-PCR was performed using the
Mastercycler ep Realplex system (Eppendorf AG, Hamburg, Germany), as previously described
(Knepper et al. 2011), using the Hot Start SYBR Master mix 2X (USB Affymetrix). Ubiquitin
(UBQ10) was used as an endogenous control for amplification. All replicates were performed
using a cycle, previously used in Knepper et al. (2011), of 95 °C for 2 min followed by 40 cycles
138

of 95 °C for 15 s, 60 °C for 15 s and 72 °C for 45 s. Results were analyzed using Prism 4
(GraphPad Software) with outliers removed by Grubb’s test (α=0.05) using the QuickCalcs
online outlier calculator (GraphPad Software;
http://www.graphpad.com/quickcalcs/Grubbs1.cfm). Statistical significance was determined by
one-way ANOVA with Tukey’s post test. All primer sets utilized are listed in Supplemental
Table S3.1.

MAPK Phosphorylation and Western Blot Analysis

Arabidopsis leaves were hand-infiltrated with 1 µM elf26 peptide in 1 mM MgCl2. Samples were
collected 10, 20 and 30 min post inoculation. To detect the activity of MAPK3/6, 70 µg of total
protein was loaded onto a 12% SDS-PAGE gel and transferred to nitrocellulose membrane. This
was followed by 1 h incubation with an anti-pTEpY specific antibody (Cell Signaling
Technology, Danvers, MA, USA). An anti-rabbit HRP conjugated secondary antibody was used
for chemiluminescence detection. MAPK3/6 protein was quantified using Image J software
(National Institutes of Health).

Stomatal Aperture Assay

Stomatal aperture was assayed using a method modified from Melotto et al. (2006). In brief, 4-5week-old plants were placed under continuous light for 24 h, covered with a plastic dome to
maintain humidity. Epidermal peels were taken from five separate leaves and placed on a glass
139

slide covered with either dH2O or 1 µM flg22 peptide in dH2O. Slides containing peels were
placed in a petri plate covered to maintain humidity and placed under growth lights for 1 h
(immediately for controls) before stomata were imaged using an Olympus IX-71 inverted
microscope with an Olympus DP70 camera. Stomata apertures were measured from images
using Image J software (National Institutes of Health). Results were analyzed using Prism 4
(GraphPad Software). Statistical significance was determined by Student’s t-test.

3,3’-diaminobenzidine (DAB) staining

One half of Arabidopsis leaves were hand-infiltrated using a needless syringe with 1 µM flg22 or
elf26 peptide in 1 mM MgCl2 or 1 mM MgCl2 alone (mock). Leaves were collected 24 hours
post infiltration and placed submerged in 1mg/ml 3,3’-diaminobenzidine and rocked gently at
room temperature overnight. The leaves were then cleared in 100% ethanol.

Acknowledgements

We thank Katie Porter for technical support on the analysis of MAPK3/6 expression, and
Elizabeth Savory for technical support on the microscopy analysis. Alyssa Burkhardt is
acknowledged for critical reading of the manuscript. This work was supported by the National
Science Foundation (Early CAREER Award IOS-0641319 to B.D.). The authors acknowledge
Fundação para a Ciência e Tecnologia, grant SFRH/BPD/43228/2008 to P.S. (co-financed by the
Portuguese PIDDAC program and European Social Fund, under the third framework program).

140

Figure 3.1.

Figure 3.1. The stomata of ndr-11 are non-responsive to flg22 peptide.
A, Stomatal aperture widths after Col-0 and ndr1-1 epidermal peels were exposed to 1 µM flg22
peptide. Peels of untreated samples were scored for aperture width immediately following
placement on slide. Mock (dH2O alone) samples were included as controls. Error bars display
standard deviation from two biological replicates with n=50-130 stomata. Significance was
determined using Student’s t-test, where * represents statistically significant differences between
Col-0 and ndr1-1: * P < 0.05. B, Representative stomata of Col-0 (left) and ndr1-1 1 h after
flg22 treatment.

141

Figure 3.2.

142

Figure 3.2. ndr1-1 displays altered PAMP responses to elf26.
A and B, Western blot analysis of MAPK3 and MAPK6 phosphorylation in Col-0 and ndr1-1 in
response to 1 µM elf26 peptide. Mock (water only) inoculations were included as controls.
Ponceau stained blots display equal loading of 70 µg total protein per lane. C, Percent maximal
phosphorylation of MAPK3 and MAPK 6 protein expression after elf26 treatment. Blot and
graph are representative of one of two replicates performed with similar results.

143

Figure 3.3.

144

Figure 3.3. AvrRpt2:Cya effector fusion delivery is diminished in the ndr1-1 mutant.
A, Effector delivery expressed as cAMP activity was measured in wild-type Col-0 and ndr1 at 0,
3, 5, 8 and 24 hours post inoculation (hpi) with Pst DC3000 expressing AvrRpt2:CyA. B, Leaves
of Col-0 display the onset of the hypersensitive response (HR) by 24 hpi demonstrating
recognition of the AvrRpt2:CyA. The HR response is absent in the ndr1-1 mutant. Error bars
display standard deviation from two biological replicates with n=3-6. Significance was
determined using Student’s t-test, where * represents statistically significant differences between
Col-0 and ndr1-1: * P < 0.05.

145

Figure 3.4.

Figure 3.4. Delivery of AvrRpt2:Cya by Pst DC3000 is not reduced in the ndr1-1 mutant by
flg22 priming of PTI.
Leaves were infiltrated with 1 µM flg22 peptide either immediately prior (flg22 + 0 h) or 2 hours
prior (flg22 + 2 h) to inoculation with Pst DC3000 expressing AvrRpt2:CyA. Effector delivery
expressed as cAMP activity was measured in wild-type Col-0 and ndr1-1 16 hours post
inoculation (hpi). Error bars display standard deviation from two biological replicates with n=7.
Significance was determined using Student’s t-test, where * represents statistically significant
differences between non-pretreated Col-0 (flg22 + 0h) and ndr1-1: * P < 0.05.

146

Figure 3.5.

147

Figure 3.5. The growth of P. syringae DC3000 deficient in 28 effectors (D28E) is increased in
the ndr1-1 mutant.
A, Bacterial growth assay of P. syringae DC3000 D28E (CUCPB5585) or B, type III secretion
system deficient D28E (CUCPB5589) at 0 and 4 days-post-inoculation (dpi). Error bars
represent the standard deviation from n=3; day 0 and n=9; day 4. Significance was determined
using Student’s t-test, where * represents statistically significant differences between Col-0 and
ndr1-1: * P < 0.05.

148

Figure 3.6.

149

Figure 3.6. (cont’d)

150

Figure 3.6. (cont’d)

Figure 3.6. The production of reactive oxygen species is reduced in the ndr1-1 mutant following
PAMP perception.
Expression of OXI1 mRNA, displayed as fold Col-0 untreated, following 1 µM elf26 (B) or 1
µM flg22 (D) treatment or mock treated corresponding with the PAMP treatments (A, elf26; C,
flg22). E, 3,3’-diamainobenzidine (DAB) stained leaves showing altered reactive oxygen species
generation in Col-0 (upper panel) and ndr1-1 (lower panel) in response to mock, elf26 or flg22
treatment. Error bars display standard deviation from three biological replicates. Significance
was determined using one-way ANOVA followed by Tukey’s post test, where * represent
statistically significant differences between Col-0 and ndr1-1: * P < 0.05 and *** P < 0.001.

151

Figure 3.7.

152

Figure 3.7. Benzo(1,2,3)-Thiadiazole-7-Carbothioic Acid S-Methyl Ester (BTH) restores
resistance in ndr1-1 in a PTI specific manner.
Leaves were hand infiltrated with 0.12 mM BTH 48 hours prior to bacterial dip inoculation.
Assay for bacterial growth in Col-0 and ndr1-1 of P. syringae DC3000 or DC3000 expressing
the effector AvrRpt2 at 0 (A) and 4 (B) days post inoculation (dpi). Growth is expressed as log
cfu cm-2. Error bars display standard deviation from n=3; day 0 and n=9; day 4. Significance was
determined using one-way ANOVA followed by Tukey’s post test, where * represent
statistically significant differences between Col-0 and ndr1-1: * P < 0.05.

153

Figure 3.8.

154

Figure 3.8. Summary of NDR1’s involvement in the perception of Pst DC3000 and the
subsequent activation of defense signaling in Arabidopsis.
NDR1 has been shown to be involved in multiple steps of perception and resistance activation
following Pst DC3000 inoculation. Steps in which NDR1 has been shown to be involved include
pathogen entry (Figure 3.1), plasma membrane-cell wall (PM-CW) adhesion (Knepper et al.,
2011), PAMP signaling (Figure 3.2; Knepper et al., 2011), effector delivery (Figure 3.3 and 3.4)
and effector recognition and resistance signaling (Century et al., 1995, Coppinger et al., 2004;
Day et al., 2006; Knepper et al., 2011).

155

LITERATURE CITED

156

LITERATURE CITED

Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J. and Parker, J.E. (1998)
Different requirements for EDS1 and NDR1 by disease resistance genes define at least two R
gene-mediated signaling pathways in Arabidopsis. Proc. Natl. Acad. Sci. U.S.A. 95: 1030610311.
Asai, T., Tena, G., Plotnikova, J., Willmann, M.R., Chiu, W., Gomez-Gomez, L., Boller, T.,
Ausubel, F.M. and Sheen, J. (2002) MAP kinase signaling cascade in Arabidopsis innate
immunity. Nature 415: 977-983.
Axtell, M.J. and Staskawicz, B.J. (2003) Initiation of RPS2-specified disease resistance in
Arabidopsis is coupled to the AvrRpt2-directed elimination of RIN4. Cell 112: 369-377.
Bender, C.L., Alarcon-Chaidez, F. and Gross, D.C. (1999) Pseudomonas syringae
phytotoxins: mode of action, regulation, and biosynthesis by peptide and polyketide synthetases.
Microbiol. Mol. Biol. Rev. 63: 266-292.
Beckers, G.J.M., Jaskiewicz, M., Liu, Y., Underwood, W.R., He, S.Y., Zhang, S. and
Conrath, U. (2009) Mitogen-activated protein kinases 3 and 6 are required for full priming of
stress responses in Arabidopsis thaliana. Plant Cell 21: 944-953.
Bolwell, G.P. and Wojtaszek, P. (1997) Mechanisms for the generation of reactive oxygen
species in plant defence- a broad perspective. Physiol. Mol. Plant Pathol. 51: 347-366.
Boudsocq, M., Willmann, M.R., McCormack, M., Lee, H., Shan, L., He, P., Bush, J.,
Cheng, S. and Sheen, J. (2010) Differential innate immune signaling via Ca2+ sensor protein
kinases. Nature 464: 418-423.
Casper-Lindley, C., Dahlbeck, D., Clark, E.T. and Staskawicz, B.J. (2002) Direct
biochemical evidence for type III secretion-dependent translocation of the AvrBs2 effector
protein into plant cells. Proc. Natl. Acad. Sci. U. S. A. 99: 8336-8341.
Century, K., Holub, E.B. and Staskawicz, B.J. (1995) NDR1, a locus of Arabidopsis thaliana
that is required for disease resistance to both a bacterial and fungal pathogen. Proc. Natl. Acad.
Sci. U.S.A. 92: 6597-6601.
Century, K.S., Shapiro, A.D., Repetti, P.P., Dahlbeck, D., Holub, E. and Staskawicz, B.J.
(1997) NDR1, a pathogen-induced component required for Arabidopsis disease resistance.
Science 278: 1963-1965.
Chisholm, S.T., Coaker, G., Day, B. and Staskawicz, B.J. (2006) Host-microbe interactions:
shaping the evolution of the plant immune response. Cell 124: 803-814.
157

Coppinger, P., Repetti, P.P., Day, B., Dahlbeck, D., Mehlert, A. and Staskawicz, B.J. (2004)
Overexpression of the plasma membrane-localized NDR1 protein results in enhanced bacterial
disease resistance in Arabidopsis thaliana. Plant J. 40: 225-237.
Crabill, E., Joe, A., Block, A., van Rooven, J.M. and Alfano, J.R. (2010) Plant immunity
directly or indirectly restricts the injection of type III effectors by the Pseudomonas syringae
type III secretion system. Plant Physiol. 154: 233-244.
Cunnac, S., Chakravarthy, S., Kvitko, B.H., Russell, A.B., Martin, G.B. and Collmer, A.
(2011) Genetic disassembly and combinatorial reassembly identify a minimal functional
repertoire of type III effectors in Pseudomonas syringae. Proc. Natl. Acad. Sci. U.S.A. 15: 29752980.
Davies, D.R., Bindschedler, L.V., Strickland, T.S. and Bolwell, G.P. (2006) Production of
reactive oxygen species in Arabidopsis thaliana cell suspension cultures in response to an
elicitor from Fusarium oxysporum: implications for basal resistance. J. Exp. Bot. 57: 1817-1827.
Day, B., Dahlbeck, D. and Staskawicz, B.J. (2006) NDR1 interaction with RIN4 mediates the
differential activation of multiple disease resistance pathways in Arabidopsis. Plant Cell 18:
2782-2791.
Forzani, C., Carreri, A., de la Fuente van Bentem, S., Lecourieux, F. and Hirt, H. (2011)
The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signalinducible 1 and mitogen-activated protein kinases. FEBS J. 278: 1126-1138.
Fry, S.C., Willis, S.C. and Patterson, A.E.J. (2000) Intraprotoplasmic and wall localized
formation of arabinoxylan-bound diferulates and larger ferulate coupling products in maize cellsuspension cultures. Planta 211: 679-692.
Gómez-Gómez, L., Felix, G. and Boller, T. (1999) A single locus determines sensitivity to
bacterial flagellin in Arabidopsis thaliana. Plant J. 18: 277-284.
Grant, J.J. and Loake, G.J. (2000) Role of reactive oxygen intermediates and cognate redox
signaling in disease resistance. Plant Physiol. 124: 21-29.
Hauck, P., Thilmony, R. and He, S.Y. (2003) A Pseudomonas syringae type III effector
suppresses cell wall-based extracellular defense in susceptible Arabidopsis plants. Proc. Natl.
Acad. Sci. USA 100: 8577-8582.
Katagiri, F., Thilmony, R. and He, S.Y. (2002) The Arabidopsis thaliana-Pseudomonas
syringae interaction. The Arabidopsis Book 1: e0039, doi/10.1199/tab.0039.

158

Kiba, A., Sugimoto, M., Toyoda, K., Ichinose, Y., Yamada, T. and Shiraishi, T. (1998)
Interaction between cell wall and plasma membrane via RGD motif is implicated in plant
defense responses. Plant Cell Physiol. 39: 1245-1249.
Kim, M.G., da Cunha, L., McFall, A.J., Belkhadir, Y., DebRoy, S., Dangl, J.L. and Mackey,
D. (2005) Two Pseudomonas syringae type III effectors inhibit RIN4-regulated basal defense in
Arabidopsis. Cell 121: 749-759.
Keppler, L.D., Baker, C.J. and Atkinson, M.M. (1989) Activated oxygen production during a
bacteria induced hypersensitive reaction in tobacco suspension cells. Phytopathology 79: 974978.
Knepper, C., Savory, E.A. and Day, B. (2011) Arabidopsis NDR1is an integrin-like protein
with a role in fluid loss and plasma membrane-cell wall adhesion. Plant Physiol. 156: 286-300.
Kunkel, B.N., Bent, A.F., Dahlbeck, D., Innes, R.W. and Staskawicz, B.J. (1993) RPS2, an
Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae strains
expressing the avirulence gene avrRpt2. Plant Cell 5: 865–875.
Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T. and Felix, G. (2004) The N
terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant
Cell 16: 3496-3507.
Lawton, K.A., Friedrich, L., Hunt, M., Weymann, K., Delaney, T., Kessmann, H., Staub,
T., Ryals, J. (1996) Benzothiadiazole induces disease resistance in Arabidopsis by activation of
the systemic acquired resistance signal transduction pathway. Plant J. 10: 71-82.
Ma, S.W., Morris, V.L. and Cuppels, D.A. (1991) Characterization of a DNA region required
for production of the phytotoxin coronatine by Pseudomonas syringae pv. tomato. Mol. Plant
Microbe Interact. 4, 69–77.
Mackey, D., Holt, B.F., Wiig, A. and Dangl, J.L. (2002) RIN4 interacts with Pseudomonas
syringae type III effector molecules and is required for RPM1-mediated resistance in
Arabidopsis. Cell 108: 743-754.
Mackey, D., Belkhadir, Y., Alonso, J.M., Ecker, J.R. and Dangl, J.L. (2003) Arabidopsis
RIN4 is the target of the type III virulence effector AvrRpt2 and modulates RPS2 mediated
resistance. Cell 112: 379-389.
Mellersh, D.G. and Heath, M.C. (2001) Plasma membrane-cell wall adhesion is required for
expression of plant defense responses during fungal penetration. Plant Cell 13: 413-424.
Melotto, M., Underwood, W., Koczan, J., Nomura, K. and He, S.Y. (2006) Plant stomata
function in innate immunity against bacterial invasion. Cell 126: 969-980.
159

Otegui, M.S. and Spitzer, C. (2008) Endosomal functions in plants. Traffic 9: 1589-1598.
Petersen, L.N., Ingle, R.A., Knight, M.R. and Denby, K.J. (2009) OXI1 protein kinase is
required for plant immunity against Pseudomonas syringae in Arabidopsis. J. Exp. Bot. 60:
3727-3735.
Qi, Y., Tsuda, K., Glazebrook, J. and Katagiri, F. (2011) Physical association of patterntriggered immunity (PTI) and effector-triggered immunity (ETI) immune receptors in
Arabidopsis. Mol. Plant Pathol. 12: 702-708.
Rentel, M.C., Lecourieux, D., Ouaked, F., Usher, S.L., Peterson, L., Okamoto, H., Knight,
H., Peck, S.C., Grierson, C.S., Hirt, H. and Knight, M.R. (2004) OXI1 kinase is necessary for
oxidative burst-mediated signaling in Arabidopsis. Nature 427: 858-861.
Schwessinger, B. and Zipfel, C. (2008) News from the frontline: recent insights into PAMPtriggered immunity in plants. Curr. Opin. Plant Biol. 11: 389-395.
Shapiro, A.D. and Zhang, C. (2001) The role of NDR1 in avirulence gene-directed signaling
and control of programmed cell death in Arabidopsis. Plant Physiol. 127: 1089-1101.
Tian, M., Chaudry, F., Ruzicka, D.R., Meagher, R.B., Staiger, C.J. and Day, B. (2009)
Arabidopsis actin-depolymerizing factor AtADF4 mediates defense signal transduction triggered
by the Pseudomonas syringae effector AvrPphB. Plant Physiol. 150: 815-824.
Tornero, P. and Dangl, J.L. (2001) A high-throughput method for quantifying growth of
phytopathogenic bacteria in Arabidopsis thaliana. Plant J. 28: 475–481.
Torres, M.A., Dangl, J.L. and Jones, J.D.G. (2002) Arabidopsis gp91phox homologues AtrbohD
and AtrbohF are required for the accumulation of reactive oxygen intermediates in the plant
defence response. Proc. Natl. Acad. Sci. U.S.A. 99: 517-522.
Xiang, T., Zong, N., Zou, Y., Wu, Y., Zhang, J., Xing, W., Li, Y., Tang, X., Zhu, L., Chai, J.
and Zhou, J. (2008) Pseudomonas syringae effector AvrPto blocks innate immunity by
targeting receptor kinases. Curr. Biol. 18: 74-80.
Zhang, J., Lu, H., Li, X., Li, Y., Cui, H., Wen, C., Tang, X., Su. Z. and Zhou, J. (2010)
Effector-triggered and pathogen-associated molecular pattern-triggered immunity differentially
contribute to basal resistance to Pseudomonas syringae. Mol. plant Microbe Interact. 23: 940948.
Zipfel, C. and Felix, G. (2005) Plants and animals: a different taste for microbe? Curr. Opin.
Plant Biol. 8: 353-360.

160

Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D., Boller, T. and Felix, G.
(2006) Perception of the bacterial PAMP EF-Tu by the receptor EFR restricts Agrobacteriummediated transformation. Cell 125: 749-760.
Zipfel, C. (2008) Pattern-recognition receptors in plant innate immunity. Curr. Opin. Immunol,
20: 10-16.

161

CHAPTER 4

NDR1 is involved in drought stress via an abscisic acid dependent pathway

162

INTRODUCTION

Numerous biotic and abiotic stresses impact plant health and crop production. Among these,
disease pressure and water availability are two primary factors limiting agricultural
productivity. To combat drought stress, plants have evolved a series of mechanisms to cope
with low water availability. For example, one of the primary plant responses to drought stress
is the reduction of transpiration, mediated by the rapid closure of stomata on the leaf surface.
This process is regulated by the activity of the plant hormone abscisic acid (ABA; Shinozaki
and Yamaguchi-Shinozaki, 2000; Finkelstein et al., 2002; Xiong et al., 2002), and is one of
the primary mechanisms governing water loss in plants (Schroeder et al., 2001; Sirichandra et
al., 2009). Membrane integrity is also a primary physiological process associated with
dehydration, solute leakage and metabolic dysfunction (García-Gómez et al., 2000; Mahajan
and Tuteja 2005). Solute leakage is a process by which plants attempt to overcome limited
water availability by adjusting ionic as well as osmotic equilibrium of the cell in order to
maintain cellular homeostasis under stress conditions (reviewed in Chaves et al., 2003). As
plants attempt to respond to drought stress many changes occur in the cell including the
activation of major stress responsive genes such as RESPONSIVE TO DEHYDRATION (RD)
family

genes

(Yamaguchi-Shinozaki

and

Shinozaki,

1993),

synthesis

of

LATE

EMBRYOGENESIS ABUNDANT (LEA)/dehydrin-type proteins, synthesis of molecular
chaperones which help in protecting the partner protein from degradation and proteinases that
function to remove denatured and damaged proteins along with the synthesis of osmolytes
(Mahajan and Tuteja 2005) and activation of enzymes involved in the production and removal
of reactive oxygen species (ROS; Cushman and Bohnert 2000; Zhu 2002).

163

Many of these drought responsive genes are also activated by ABA (Ingram and Bartels,
1996; Seki et al., 2002). Recent evidence suggests the existence of a significant overlap
between water stress and disease resistance pathways (Lee and McNellis 2009; Mosher et al.
2010). ABA is of particular importance in the overlap of these two seemingly different stress
responsive pathways. ABA-dependent signaling appears to be able to modulate responses
between drought and pathogen stresses leading to the suppression of defense responses during
severe water stress (reviewed in Beattie 2011). Previously the exogenous application of ABA
has been shown to enhance disease susceptibility (Yasuda et al. 2008; Fan et al. 2009) while
an insensitivity to ABA enhances disease resistance (Cao et al. 2011).

Several of the resistance mechanisms by which plants respond to pathogen infection appear
somewhat similar to those that occur early in drought stress. Arabidopsis has evolved multiple
layers of both constitutive and induced defenses to respond to pathogen infection beginning
on the cell surface where Pattern Recognition Receptors (PRRs) detect conserved Pathogen
Associated Molecular Patterns (PAMPs) activating basal immunity including the closure of
stomata to prevent pathogen entry (Melotto et al., 2006). Stomata also serve an important
function in the regulation of water stress, by regulating the rate of transpiration through plant
leaves (Chaves et al. 2003). The regulation of stomatal aperture is an ABA-dependent process
in which ABA signaling causes a conformational change in the shape of the guard cells
leading to a decrease in aperture size (review by Chaves et al. 2003). As such, modulation of
stomatal aperture appears to be an important initial response for both disease resistance as
well as the prevention of water loss, further supporting an overlap between biotic and abiotic
stress responsive mechanisms

NON-RACE SPECIFIC DISEASE RESISTANCE1 (NDR1; Century et al., 1995; Century et
al., 1997; Coppinger et al., 2004) is one of many resistance (R)-gene accessory proteins that
164

serve as a co-activator of resistance. Recently, a physiological role for NDR1 in regulating
fluid loss and plasma membrane-cell wall (PM-CW) adhesion has been proposed (Knepper et
al. 2011). As a primary physiological process required for mediating cellular response to
abiotic and biotic stress signaling, PM-CW adhesion has been well-characterized (Canut et al.,
1998; Kohorn, 2000; Mellersh and Heath, 2001; Knepper et al., 2011). A loss of PM-CW
adhesion in ndr1-1 leads to a reduction in effector delivery by the type-three secretion system
to the plant and a subsequent reduction in effector detection and initiation of robust defense
responses including the initiation of Effector Triggered Immunity (ETI; Knepper et al.,
submitted).

Based on previous results, indicating a strong connection between NDR1 and PM-CW
adhesion and electrolyte leakage (Knepper et al., 2011), along with the link between NDR1
and stomatal response (Knepper et al., submitted) we hypothesized that NDR1 may fulfill a
physiological and/or signaling role in the response to drought stress. Furthermore, it has been
shown that members of the NDR1/HIN1-LIKE (NHL) gene family, which includes NDR1 and
are involved in defense responses to pathogens, also have non-defensive roles (Zheng et al.,
2004; Takahashi et al. 2004; Quirino et al. 2000; Pontier et al. 1999). Additionally, Zhang et
al., (2011) reported that a related gene, HRF1, when over-expressed in rice, enhances
resistance to both pathogens and abiotic stress. In this study we demonstrate NDR1 is in fact
required for drought tolerance and serves as a mediator between disease resistance and abiotic
stress signaling. Furthermore, the over-expression of NDR1 increases the resistance of
Arabidopsis to drought.

RESULTS

NDR1 functions in drought stress tolerance in Arabidopsis thaliana.
165

Previous studies have demonstrated that an increase in electrolyte leakage following
Pseudomonas syringae pv. tomato (Pst) DC3000 infection in the ndr1-1 mutant is correlated
with a loss in focal adhesion between the plasma membrane (PM) and cell-wall (CW) in ndr11 (Knepper et al. 2011). Based on these observations, we hypothesized that NDR1 would play
a role in abiotic stress responses, specifically the response to drought stress. To assess the
involvement of NDR1 in drought stress tolerance, two basic parameters for assaying drought
stress in leaves were utilized; relative water content (RWC %) and electrolyte leakage. As
shown in Figures 4.1A and 4.1C, Col-0, ndr1-1 and the NDR1 over-expressing line (347;
Coppinger et al., 2004) displayed similar RWC and electrolyte leakage measurements
throughout the course of the experiment when soil moisture was maintained at non-stress
conditions. However, under severe drought stress conditions, differences in RWC were
observed (Figure 4.1B) in a genotype-dependent manner. In wild-type Col-0 no changes in
RWC were observed until eight days after the initiation of drought stress after this period, the
RWC in Col-0 fell to 34% and by day 12 Col-0 had lost all turgor pressure. The ndr1-1
mutant showed a decline in RWC beginning four days after watering was ceased. By day
eight, the RWC of ndr1-1 was reduced to 45%, and by day 11 the ndr1-1 plants were dead. In
contrast to the loss in drought tolerance observed in the ndr1-1 mutant, the NDR1 overexpressor, 347, maintained RWC through day eight. After eight days of drought stress the
RWC of 347 began to decrease slowly reaching 50% by day 12. A striking difference in each
genotype’s response to drought stress can be observed in Figure 4.1F, where eight days after
the initiation of drought stress both Col-0 and ndr1-1 plants show substantial decreases in
overall plant health as compared to the over-expression line. These results were further
supported by the electrolyte leakage observed in the three lines (Figure 4.1D). An increase in
leakage was observed just before plants lost turgor pressure and could not be recovered from
the drought stress. In ndr1-1, this increase in electrolyte leakage was observed at day 10,
166

whereas a smaller increase was observed in Col-0 at day 10 aligning with plant death for both
lines; Col-0 at day 11 and ndr1-1 at day 10. In the NDR1 over-expression line,an increase in
leakage was not observed until day 12 and plants survived until day 14. This finding further
supports the hypothesis that NDR1 is involved in tolerance to drought stress. The loss of
NDR1 reduced the ability of Arabidopsis to withstand drought while the over-expression of
NDR1 yielded a plant more tolerant of drought conditions than the wild-type Col-0.

To understand the genetic basis of the role of NDR1 in drought tolerance, we examined the
expression profiles of several well-characterized genes associated with the induction of
drought stress in Arabidopsis. Analysis was performed using qRT-PCR utilizing two common
drought stress markers genes including the abscisic acid (ABA)-dependent RESPONSIVE TO
DESICCATION (RD29B; Yamaguchi-Shinozaki and Shinozaki 1993) and ABA-independent
EARLY-RESPONSIVE TO DEHYDRATION (ERD4; Kiyosue et al. 1994) gene. As shown in
Figure 4.1E, on day eight a significant increase (P < 0.001) in RD29B mRNA expression was
observed in the ndr1-1 mutant as compared to Col-0 and 347. No differences were observed
in mRNA expression for the ABA-independent drought marker ERD4. These data indicate
that the loss of ndr1-1 increases drought stress within Arabidopsis in an ABA-dependent
manner, suggesting that NDR1 functions in the ABA-dependent pathway linked to drought
stress signaling.

NDR1 is required for ABA-dependent stomata closure

Based on two observations, the response of the ABA-dependent drought marker gene RD29B
(Figure 4.1E) as well as the reduced stomatal response to a Pathogen Associated Molecular
Pattern (PAMP) trigger previously observed in the ndr1-1 mutant (Knepper et al., submitted),
we hypothesized that NDR1 plays a role in the regulation of stomatal closure in an ABA167

dependent manner. To determine the role of NDR1 in stomatal closure, epidermal peels of
Col-0 and ndr1-1 were treated with 10 µM ABA, and after one hour, the guard cell aperture
was measured. As shown in Figure 4.2, we observed a significant reduction in guard cell
aperture in WT Col-0, as compared to ndr1-1, following ABA treatment. The stomata
apertures of ndr1-1 showed no change between mock and ABA treatments. These results
indicate that guard cell dynamics and aperture are impacted in the ndr1-1 mutant and that
NDR1 is required for stomata closure in an ABA-dependent manner. It appears based on these
data as well as previous results (Knepper et al., submitted) that in the absence of NDR1 there
is a disconnect between the perception of a signal to close stomata (e.g. ABA or PAMP) and
the physical change in guard cells leading to a reduction in aperture width.

A coronatine deficient Pseudomonas syringae strain can grow to higher levels in the
ndr1-1 mutant.

Many plant pathogens, including P. syringae, enter the host through stomata. In response, one
of the first resistance mechanisms activated in Arabidopsis to potential pathogen invasion is
the closure of stomata to prevent pathogen entry. Previous work has shown that stomata close
within one hour after exposure to Pst DC3000 (Melotto et al., 2006). In Pst DC3000 the
production of the jasmonic acid (JA) mimic coronatine can re-open stomata by three hours
allowing pathogen entry (Melotto et al., 2006). Based on previous findings linking NDR1 to
PAMP-induced as well as ABA-induced stomata closure (Knepper et al., submitted; Figure
4.2) we hypothesized that defects in stomatal closure in the ndr1-1 mutant would allow for a
coronatine deficient strain of Pst DC3000 (Pst DC3118; Ma et al., 1991) to gain access to the
leaf interior and thus grow to higher levels in the mutant. The ndr1-1 mutant showed an
increase in growth of Pst DC3000 of greater than one log cfu/cm2 (colony forming units/cm2)
as compared to wild-type Col-0 (Figure 4.3). When the growth of the coronatine mutant, Pst
168

DC3118, was assessed an increase in growth was observed of 0.75 log cfu/cm2 as compared
to Col-0. Brooks et al. (2004) demonstrated that coronatine-deficient mutant strains show a
decrease in growth when surface inoculated; when syringe infiltrated, thus bypassing the
stomata, the growth observed is similar to strains that produce coronatine. In the ndr1-1
mutant, the increase in growth observed when surface inoculated with DC3118, as compared
to Col-0, indicates that NDR1 is required for stomata aperture closure in response to P.
syringae, which corroborates previous results with PAMP induced stomatal closure (Knepper
et al., submitted). The ability of the coronatine-deficient mutant to enter the host, as measured
by increased pathogen growth, indicates that the stomata in ndr1-1 are open to bacterial entry.
These data demonstrate a direct resistance consequence for NDR1 in stomata aperture
regulation, as stomata that are unresponsive to potential pathogen invasion leave the host
vulnerable to pathogen infection.

Disease resistance is not suppressed by ABA in the ndr1-1 mutant.

The hormone ABA accumulates in response to drought stress, promoting physiological
changes such as stomatal closure under conditions of low humidity. ABA also can interfere
with plant-pathogen interactions leading to the suppression of defense responses (MauchMani and Mauch, 2005; Asselbergh et al., 2008). Several studies have demonstrated the
ability of ABA to suppress defense signaling, including the exogenous application of ABA
being shown to enhance disease susceptibility (i.e., suppression of systemic acquired
resistance; Yasuda et al., 2008; Fan et al., 2009) while ABA insensitive plants have
demonstrated enhanced resistance (Cao et al., 2011). These varied responses to ABA appear to
indicate a metabolic tradeoff between drought tolerance and disease resistance. As shown in
Figure 4.2, stomata of the ndr1-1 mutant are less responsive to the exogenous application of
ABA. Therefore, we hypothesized that bacterial growth in ndr1-1 plants will be unaltered in
169

response to the application of ABA, whereas growth of Pst DC3000 in Col-0 is likely to
increase with ABA-induced defense suppression. To test this, four-week-old Col-0 and ndr1-1
plants were pre-treated by soil drench with 400 μM ABA or water (control) five days prior to
inoculation with Pst DC3000. Bacterial growth was assayed zero and four days post
inoculation. As shown in Figure 4.4, wild type Col-0 plants pre-treated with ABA had an
increase in growth of Pst DC3000 of greater than 0.5 log cfu/cm2 as compared to control Col0 plants. In ndr1-1 only a negligible change in bacterial growth was observed with ABA pretreatment. While the difference in bacterial growth in wild type Col-0 plants is not assigned
statistically significance at P<0.05, it is a reproducible increase observed across three
biological replicates (n = 9). The results of this analysis suggest that in the absence of NDR1,
plants are less responsive to exogenous ABA treatment, and this can be observed in the lack
of ABA-based defense suppression. In contrast, Col-0 shows a consistent increase in bacterial
growth after ABA application showing the previously established suppression of defenses in
response to exogenous ABA application (Yasuda et al., 2008; Fan et al., 2009). While the
differences in bacterial growth changes were somewhat smaller than anticipated these data,
taken with previous results (Figure 4.2), support a mechanistic link between ABA and NDR1
function.

DISCUSSION

For more than 15 years the identification of a functional role for NDR1 in plant disease
resistance, to complement the strong genetic requirement first identified (Century et al.,
1995), has been a slow but rewarding endeavor. Recent results from our laboratory (Knepper
et al., 2011) were able to identify a specific requirement for NDR1 in the maintenance of PMCW adhesion as well as a functional consequence in the mediation of fluid loss. With a basic
physiological function for NDR1 beyond the scope of disease resistance established, our focus
170

shifted to the identification of specific consequences of NDR1 in Arabidopsis biology. Based
on the functions assigned for NDR1 in adhesion and fluid movement, plus the link between
NDR1 and stomata function (Knepper et al., submitted) we hypothesized that NDR1 would
function in drought stress signaling. This was further strengthened by the structural homology
between NDR1 and LATE EMBRYOGENESIS ABUNDANT-14 (LEA14; Knepper et al.,
2011), a protein known to function in desiccation resistance (Singh et al., 2005) and a member
of the LEA family of proteins closely associated with abiotic stress resistance (Goyal et al.,
2005; Battaglia et al., 2008), as well as the recent report of the harpin-encoding HRF1
increasing resistance to drought when over-expressed in rice (Zhang et al., 2011).

While the ndr1-1 mutant line has been examined for years in the context of disease resistance,
pursuing a function for NDR1 proved challenging. This study required the analysis of both a
knock-out mutant (ndr1-1) and an over-expression line (347) to fully understand the
functional significance of NDR1 in drought tolerance. By examining the RWC and electrolyte
leakage within the leaves of Col-0, ndr1-1 and 347 several trends were identified. In the ndr11 mutant RWC began to decrease earlier and the plants lost turgor pressure and died earlier
than either the Col-0 or 347 plants (Figure 4.1B, 4.1F). The electrolyte leakage data further
supported this in that an increase in leakage corresponding with plant death is observed at day
ten in ndr1-1 which is prior to plant death in Col-0. In contrast, Arabidopsis over-expressing
NDR1 demonstrated a reduction in water loss under drought stress conditions, observed as
reduced loss of RWC through day 12 (Figure 4.1B). Plants over-expressing NDR1 also do not
exhibit an increase in electrolyte leakage for nearly two days after the ndr1-1 mutant and one
day later than wild-type Col-0. Together with the increase in RD29B expression observed in
drought stressed ndr1-1 plants it is clear that NDR1 is a critical component of drought
tolerance in Arabidopsis.

171

With a link now established between NDR1 and drought tolerance we began to examine the
mechanism behind NDR1-dependent drought tolerance likely involving the regulation of
stomata, which serve as both a critical regulator of pathogen entry (Melotto et al., 2006) and a
regulator of water loss through the control of leaf transpiration (Chaves et al., 2003), based on
the recent demonstration of a link between NDR1 and stomata aperture regulation (Knepper et
al., submitted). Arabidopsis plants that are unable to regulate stomata aperture width, such as
ndr1-1, could potentially lose leaf water content more rapidly than wild-type plants, leading to
a reduction in tolerance to water stress. The regulation of stomatal closure is an ABAdependent process leading to a conformational change in guard cells and a decrease in
aperture size (reviewed in Chaves et al., 2003). Plants lacking a functional NDR1 were shown
to be insensitive to ABA-induced stomatal closure (Figure 4.2). This may partially explain
why the ndr1-1 mutant shows increased rates of water loss, potentially due to improper
regulation of leaf transpiration through stomata. The role of NDR1 in ABA signaling is
further supported in the insensitivity to exogenous ABA-induced disease resistance
suppression observed in ndr1-1.

With the defects observed in the ndr1-1 mutant we hypothesized that a Pst DC3000 strain that
is coronatine defective would be more virulent on ndr1-1 plants as compared to Col-0, based
on the inability of ndr1-1 to close stomata in response to either PAMP signals (Knepper et al.,
submitted) or exogenous ABA application. Pst DC3118 which is defective in entry to the leaf,
has been shown to grow to levels equivalent those of a coronatine producing strain if syringeinfiltrated and thus bypassing stomata entry (Brooks et al., 2004). The coronatine deficient
strain is able to grow to higher levels in the ndr1-1 mutant as compared to Col-0 indicating
stomata do not serve as an effective barrier in ndr1-1. This result shows the interconnected
nature of NDR1-dependent signaling in that both drought tolerance and disease resistance are
strongly altered in plants lacking functional NDR1.
172

With the identification of a physiological role for NDR1 the way in which resistance
associated proteins are viewed has begun to change. Based on the data presented herein,
NDR1 can be considered a protein of physiological relevance first, and not simply an R-gene
accessory protein as long thought. The examination of metabolic and physiological trade-offs
within plants to biotic and abiotic stresses are and will continue to be a critical part of plant
biology research. The identification of proteins such as NDR1 with functions in both disease
resistance and drought stress tolerance will help to integrate our knowledge of biotic and
abiotic stress signaling. By demonstrating a function for NDR1 in abiotic stress tolerance we
have further cemented the importance of NDR1 not only in disease resistance signaling and
PM-CW adhesion, but also in the mediation of tolerance to an abiotic stress of ever increasing
importance: drought.

MATERIALS AND METHODS

Plant Growth Conditions

Arabidopsis thaliana Col-0, ndr1-1 (Century et al., 1995) and 347 (NDR1 over-expressor;
Coppinger et al. 2004) plants were grown in square potting trays (weighed and adjusted for
initial moisture content) during four weeks under standard watering conditions (100% soil
moisture), in a model GC8-2H growth chamber (Environmental Growth Chambers LTD.,
Winnipeg, Manitoba, Canada) at 20°C, with a 12 h/12 h light/dark cycle, 60% relative
-2 -1

humidity and a light intensity of 120 mol photons m s .

Drought stress treatment
173

After 4 weeks, the water content of the flats was adjusted to 100 % (day 0) and plants were
then subjected to 2 watering regimes: 1) control (C), where plants were watered three times
weekly, and 2) drought stress (DS) conditions, where plants received no additional water for
the remainder of the experiment. Leaf samples were harvested at 0, 2, 6, 8, 10 and 12 days
after drought stress and immediately frozen in liquid nitrogen and kept at -80ºC.

Relative Water Content Measurements

Relative water content (RWC %; Catsky, 1960) was measured in leaves from plants submitted
to control and drought stress conditions as described: 4-8 leaves from 3-4 plants were harvest
at 0, 2, 6, 8, 10 and 12 days after drought stress and immediately weighed to obtain the fresh
weight (FW). Next, the leaves were left to float on a covered Petri dish containing deionized
water, during 24 hours, in the dark. The turgid weight (TW) of these leaves was then
measured. Finally, the leaves were dried in an oven at 80 ºC, for 24 hours, taken out 15
minutes before the dry weight (DW) was measured. RWC was calculated according to the
formula: RWC (%) = (FW)-(DW)/(TW)-(DW) X 100.

Electrolyte leakage Assay

Electrolyte leakage was performed as previously described (Knepper et al., 2011), with
samples harvested at 0, 2, 4, 6, 8, 10 and 12 days after drought stress. In brief, a single leaf
disc (0.7 cm diameter) was harvested from each plant. Four plants were used for each
replicate. Leaf discs were quickly washed by submerging and gently swirling in sterile dH2O
before being placed in a tube with 3 mL sterile dH2O. Samples were rocked at 35 rpm for 3 h
174

on an orbital shaker. After 3 h, the leaf disc was removed and the solution was measured
using a conductance meter (Traceable 23226-505; VWR Scientific). The leaf discs were
frozen for 1 h at -80°C, and then returned to the original tubes and rocked for an additional 3
h before the disc is discarded and the final conductance measurement was taken. Readings
were calculated as percent leakage of total (i.e. (first reading - background)/second reading)
adjusted for background.

Stomatal Aperture Assay

Aperture width of stomata was assayed using a modified method from Melotto et al. (2006).
Four-to-five-week old plants were covered with a clear plastic dome, to maintain high
humidity, and kept under continuous light for 24 hours. Epidermal peels were collected from
five leaves and placed on a glass slide covered with 10 µM abscisic acid (ABA) in dH2O or
dH2O (mock). The prepared samples were then placed into a petri plate and covered to
maintain humidity. These were placed back under growth lights for 1 h before peels were
imaged using an Olympus IX-71 inverted microscope with an Olympus DP70 camera. The
aperture widths of the stomata were measured using Image J software (National Institutes of
Health). Results were analyzed using Prism 4 (GraphPad Software). Statistical significance
was determined by one-way ANOVA followed by Tukey’s post-test.

Pathogen Inoculation and Growth Assays

Pseudomonas syringae pv. tomato DC3000 containing the pVSP61 vector (Pst DC3000) was
previously described in Kunkel et al. (1993). The Pst DC3118 coronatine deficient strain was
previously described in Ma et al. (1991). Bacterial growth assays were performed as described
175

in Knepper et al. (2011). Four-week-old plants were dip inoculated in bacterial suspensions of
7

-1

3 x 10 colony forming units (cfu) mL . Three leaf discs of 0.7 cm were harvested 0 and 4
days post-inoculation. Results were analyzed using Prism 4 (GraphPad Software). Statistical
significance was determined by ANOVA followed by Tukey’s post-test.

Exogenous ABA treatment

Four-week-old plants were pretreated with water (Control) or ABA (400 µM in water; Yasuda
et al. 2008)) by soil drenching five days prior to inoculation of Pst DC3000 as described
before (see Pathogen Inoculation and Growth Assays).

RNA Isolation and Quantitative Real-Time PCR

Total RNA was extracted from leaves using the PrepEase Plant RNA Spin kit (USB
Affymetrix, Santa Clara, CA, USA). First-strand cDNA was synthesized from 1 g Total
RNA using the First-Strand cDNA Synthesis kit (USB Affymetrix). qRT-PCR was performed
using the Mastercycler ep Realplex system (Eppendorf AG, Hamburg, Germany), as
previously described (Knepper et al., 2011), using the Hot Start SYBR Master mix 2X (USB
Affymetrix). Ubiquitin (UBQ10) was used as an endogenous control for amplification. All
replicates were performed using a cycle, previously used in Knepper et al. (2011), of 95 °C
for 2 min followed by 40 cycles of 95 °C for 15 s, 60 °C for 15 s and 72 °C for 45 s. Results
were analyzed using Prism 4 (GraphPad Software) with outliers removed by Grubb’s test
(α=0.05)

using

the

QuickCalcs

online

outlier

calculator

(GraphPad

Software;

http://www.graphpad.com/quickcalcs/Grubbs1.cfm). Statistical significance was determined

176

by one-way ANOVA followed by Tukey’s post test. All primer sets utilized are listed in
Supplemental Table S4.1.

ACKNOWLEDGEMENTS

This work was supported by the National Science Foundation (Early CAREER Award IOS0641319 to B.D.). The authors acknowledge Fundaçãopara a Ciência e Tecnologia, grant
SFRH/BPD/43228/2008 to P.S. (co-financed by the Portuguese PIDDAC program and
European Social Fund, under the third framework program).

177

Figure 4.1.

178

Figure 4.1. (cont’d)

179

Figure 4.1. (cont’d)

180

Figure 4.1. Relative water content, electrolyte leakage and RD29B and ERD4 marker genes
expression in response to drought stress.
A, Relative water content (RWC%) from leaves of wild type Col-0, ndr1-1 and the NDR1
over-expressor (347) plants, 12 days after control (normal watering) or (B) drought stress (no
water added after day 0; n = 3-4). (C) Electrolyte leakage (% leakage) from Col-0, ndr1-1 and
347 under control or (D) drought stress conditions (n = 3). E, Levels of expression in
Arabidopsis of the ABA-dependent drought stress marker RD29B and the ABA-independent
drought marker ERD4. Expression is displayed as fold Col-0 0 day average (n = 7). F,
Phenotypes of Arabidopsis plants at eight days after the iniation of drought stress or control.
Samples were collected 0, 2, 4, 6, 8, 10 and 12 days after the initiation of drought stress. *
represents a statistically significant difference between Col-0 and ndr1-1. *** p<0.001.

181

Figure 4.2.

Figure 4.2. The stomata of ndr1-1 are non-responsive to exogenous abscisic acid application.
A, Stomatal aperture widths (µm) after Col-0 and ndr1-1 epidermal peels were exposed to 10
µM abscisic acid (ABA) or dH2O (mock) for 1 hour. Error bars display standard deviation
from two biological replicates with n=50-100 stomata. Significance was determined using
one-way ANOVA followed by Tukey’s post test, where * represents statistically significant
differences between Col-0 and ndr1-1: *** P < 0.001. Representative stomata of Col-0 (B)
and ndr1-1 (C) 1 h after ABA treatment.

182

Figure 4.3.

183

Figure 4.3. The coronatine-deficient mutant strain Pseudomonas syringae DC3118 reaches
higher cell densities in the ndr1-1 mutant.
Bacterial growth of Pst DC3000 and the coronatine deficient mutant Pst DC3118 at 0 (A)
and 4 (B) days post inoculation in Col-0 and ndr1-1 leaves. Bacterial growth is expressed as
2

log cfu/cm . Error bars represent standard deviation from 3 biological replicates (n=9).
Statistical significance was determined using one-way ANOVA followed by Tukey’s post
test, where * represents statistically significant differences between Col-0 and ndr1-1: * P <
0.05.

184

Figure 4.4.

185

Figure 4.4. Abscisic acid pretreatment fails to suppress pathogen defense responses in ndr1-1.
Col-0 and ndr1-1 plants were pretreated with either water or 400 μM ABA in water for five
days by soil saturation. Growth of Pst DC3000 was assayed from both the water control
(DC3000) and the ABA treated plants (+ABA) at 0 (A) and 4 (B) days post inoculation (dpi).
2

Bacterial growth is expressed as log cfu/cm . Error bars display standard deviation from 3
technical replicates from 3 biological replicates. Statistical significance was determined using
two-way ANOVA where * represents a statistically significant difference between Col-0 and
ndr1-1. * P < 0.05.

186

LITERATURE CITED

187

LITERATURE CITED

Aarts N, Metz M, Holub E, Staskawicz BJ, Daniels MJ, Parker JE (1998) Different
requirements for EDS1 and NDR1 by disease resistance genes define at least two R gene
mediated signaling pathways in Arabidopsis. Proc Natl Acad Sci USA 95: 10306-10311
Asselbergh B, De Vleesschauwer D, Hofte M (2008) Global switches and fine-tuning-ABA
modulates plant pathogen defense. Mol Plant-Microbe Interact 21: 709-719
Battaglia M, Olvera-Carrillo Y, Garciarrubio A, Campos F and Covarrubias AA (2008)
The enigmatic LEA proteins and other hydrophilins. Plant Physiol 148: 6-24
Beattie GA (2011) Water relations in the interaction of foliar bacterial pathogens with plants.
Ann Rev Phytopathol 49: 533-555
Boyer JS (1992) Plant productivity and environmental potential for increasing crop plant
productivity, genotypic selection. Science 218: 443-448
Brooks DM, Hernandez-Guzman G, Kloek AP, Alarcon-Chidez F, Sreedharan A,
Rangaswamy V, Penaloza-Vazquez A, Bender CL, Kunkel BN (2004) Identification and
characterization of a well-defined series of coronatine biosynthetic mutants of Pseudomonas
syringae pv. tomato DC3000. Mol Plant Microbe Interact 17: 162-174
Canut H, Carrasco A, Galaud J, Cassan C, Bouyssou H, Vita N, Ferrara P and PontLezica R (1998) High affinity RGD-binding sites at the plasma membrane of Arabidopsis
thaliana link the cell wall. Plant J 16: 63-71
Cao FY, Yoshioka K, Desveaux D (2011) The roles of ABA in plant-pathogen interactions.
J Plant Res 124: 489–499
Catsky J (1960) Determination of water deficit in discs cut out from leaf blades. Biol Plant 2:
76-77
Century K, Holub EB, Staskawicz BJ (1995) NDR1, a locus of Arabidopsis thaliana that is
required for disease resistance to both a bacterial and fungal pathogen. Proc Natl Acad Sci
USA 92: 6597-6601
Century KS, Shapiro AD, Repetti PP, Dahlbeck D, Holub E, Staskawicz BJ (1997)
NDR1, a pathogen-induced component required for Arabidopsis disease resistance. Science
278: 1963-1965
Chaves MM, Maroco J, Pereira JS (2003) Understanding plant responses to drought- from
genes to whole plant. Funct Plant Biol 30:239-264
Chaves MM and Davies B (2010) Drought effects and water use efficiency: improving crop
production in dry environments. Funct Plant Biol 37: iii–vi

188

Coppinger P, Repetti PP, Day B, Dahlbeck D, Mehlert A and Staskawicz BJ (2004)
Overexpression of the plasma membrane-localized NDR1 protein results in enhanced
bacterial disease resistance in Arabidopsis thaliana. Plant J 40: 225-237
Cushman JC and Bohnert HJ (2000) Genomic approaches to plant stress tolerance. Curr
Opin Plant Biol 3: 117–124
Fan J, Hill L, Crooks C, Doerner P, Lamb C (2009) Abscisic acid has a key role in
modulating diverse plant-pathogen interactions. Plant Physiol 150: 1750-1761.
Finkelstein RR, Gampala SSL, Rock CD (2002) Abscisic acid signaling in seeds and
seedlings. Plant Cell 14: S15–S45.
Goyal K, Walton LJ, Tunnacliffe A (2005) LEA proteins prevent protein aggregation due to
water stress. Biochem J 388: 151-157
Ingram J and Bartels D (1996) The molecular basis of dehydration tolerance in plants. Annu
Rev Plant Physiol Plant Mol Biol 47: 377–403
Kiyosue T, Yamaguchi-Shinozaki K, Shinozaki K (1994) Cloning of cDNAs for genes that
are early-responsive to dehydration stress (ERDs) in Arabidopsis thaliana L.: identification of
three ERDs as HSP cognate genes. Plant Mol Biol 25: 791-798
Knepper C, Savory E, Day B (2011) Arabidopsis NDR1is an integrin-like protein with a
role in fluid loss and plasma membrane-cell wall adhesion. Plant Physiol 156: 286-300
Knepper C, Santos P and Day B (submitted) Arabidopsis NDR1 is required for robust
activation of PAMP Triggered Immunity Mol. Plant Microbe Interact.
Kohorn BD (2000) Plasma membrane-cell wall contacts. Plant Physiol 124: 31-38
Kunkel BN, Bent AF, Dahlbeck D, Innes RW, Staskawicz BJ (1993) RPS2, an
Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae strains
expressing the avirulence gene avrRpt2. Plant Cell 5: 865–875
Lee T-F, McNellis TW (2009) Evidence that the BONZAI1/COPINE1 protein is a calciumand pathogen-responsive defense suppressor. Plant Mol Biol 69:155–166
Ma SW, Morris VL, Cuppels DA (1991) Characterization of a DNA region required for
production of the phytotoxin coronatine by Pseudomonas syringae pv. tomato. Mol Plant
Microbe Interact 4: 69–77
Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: An overview. Arch
Biochem Biophys 444: 139–158
Mauch-Mani B, Mauch F (2005) The role of abscisic acid in plant-pathogen interactions.
Curr Opin Plant Biol 8: 409-414
Mellersh DG, Heath MC (2001) Plasma membrane-cell wall adhesion is required for
expression of plant defense responses during fungal penetration. Plant Cell 13: 413-424
189

Melotto M, Underwood W, Koczan J, Nomura K, He SY (2006) Plant stomata function in
innate immunity against bacterial invasion. Cell 126: 969-980
Mosher S, Moeder W, Nishimura N, Jikumaru Y, Joo S-H, Urquhart W, Klessig DF,
Kim S-K, Nambara E, Yoshioka K (2010) The lesion-mimic mutant cpr22 shows
alterations in abscisic acid signaling and abscisic acid insensitivity in a salicylic aciddependent manner. Plant Physiol 152: 1901–1913
Pontier D, Gan S, Amasino RM, Roby D, Lam E (1999) Markers for hypersensitive
response and senescence show distinct patterns of expression. Plant Mol Biol 39: 1243–1255
Quirino BF, Noh Y-S, Himelblau E, Amasino RM (2000) Molecular aspects of leaf
senescence. Trends Plant Sci 5: 278–282
Schroeder JI, Allen GJ, Hugouvieux V, Kwak JM, Waner D (2001) Guard cell signal
transduction. Ann Rev Plant Physiol Plant Mol Biol 52: 627–658
Seki M, Ishida J, Narusaka M, Fujita M, Nanjo T, Umezawa T, Kamiya A, Nakajima M,
Enju A, Sakurai T, Satou M, Akiyama K, Yamaguchi-Shinozaki K, Carninci P, Kawai
J, Hayashizaki Y, Shinozaki K (2002) Monitoring the expression pattern of around 7,000
Arabidopsis genes under ABA treatments using a full-length cDNA microarray. Funct Integr
Genomics 2: 282-291
Shinozaki K, Yamaguchi- Shinozaki K (2000) Molecular responses to dehydration and low
temperature: differences and cross-talk between two stress signaling pathways. Curr Opin
Plant Biol 3: 217-223.
Singh S, Cornilescu CC, Tyler RC, Cornilescu G, Tonelli M, Lee MS, Markley JL (2005)
Solution structure of a late embryogenesis abundant protein (LEA14) from Arabidopsis
thaliana, a cellular stress-related protein. Prot Sci 14: 2601-2609
Sirichandra C, Wasilewska A, Vlad F, Valon C, Leung J (2009) The guard cell as a singlecell model towards understanding drought tolerance and abscisic acid action. Journal of
Experimental Botany 60: 1439–1463
Takahashi Y, Berberich T, Yamashita K, Uehara Y, Miyazaki A, Kusano T (2004)
Identification of tobacco HIN1 and two closely related genes as spermine-responsive genes
and their differential expression during the Tobacco mosaic virus-induced hypersensitive
response and during leaf- and flower-senescence. Plant Molecular Biology 54: 613–622
Tian M, Chaudry F, Ruzicka DR, Meagher RB, Staiger CJ and Day B (2009)
Arabidopsis Actin-Depolymerizing Factor AtADF4 Mediates Defense Signal Transduction
Triggered by thePseudomonas syringae Effector AvrPphB. Plant Physiol 150: 815-824
Tornero P, Dangl JL (2001) A high-throughput method for quantifying growth of
phytopathogenic bacteria in Arabidopsis thaliana. Plant J 28: 475–481
Xiong L, Schumaker K, Zhu J-K (2002) Cell signaling during cold, drought and salt stress.
Plant Cell 14 (suppl.): S165–S183

190

Yamaguchi-Shinozaki K, Shinozaki K (1993) Arabidopsis DNA encoding two desiccationresponsive rd29 genes. Plant Physiol 101: 1119-1120
Yasuda M, Ishikawa A, Jikumaru Y, Seki M, Umezawa T, et al. (2008) Antagonistic
interaction between systemic acquired resistance and the abscisic acid-mediated abiotic stress
response in Arabidopsis. Plant Cell 20: 1678-1692
Zhang L, Xiao S, Li W, Feng W, Li J, Wu Z, Gao X, Liu F Shao M (2011)
Overexpression of a harpin-encoding gene hrf1 in rice enhances drought tolerance. Journal
Exp Biol 62: 4229- 4238
Zheng MS, Takahashi H, Miyazaki A, Hamamoto H, Shah J, Yamaguchi I and Kusano
T (2004) Up-regulation of Arabidopsis thaliana NHL10 in the hypersensitive response to
Cucumber mosaic virus infection and in senescing leaves is controlled by signaling pathways
that differ in salicylate involvement. Planta 218:740-750
Zhu JK (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol 53:
247–273

191

CHAPTER 5

Conclusions and Future Directions

192

Conclusions

Since the identification of NDR1 in 1995 (Century et al., 1995), followed by the publication of
Knepper et al., (2011a), NDR1 had been primarily associated with plant-pathogen defensive
functions. This narrow focus had made the study of NDR1 difficult, and as a result, little
progress had been made toward the elucidation of NDR1’s biochemical and genetic function.
The focus of this dissertation project was to broaden the scope of our understanding of NDR1
function in order to identify a global physiological role for NDR1 in Arabidopsis. Our hypothesis
was that NDR1 had a primary function outside of its role in defense and was co-opted into the
defense signaling pathway. This proved at least partially correct as NDR1 was shown to be
critical for proper plasma membrane-cell wall (PM-CW) adhesion. That, combined with its
ability to mediate fluid loss in response to pathogen infection marked a true paradigm shift in
how pathogen defensive proteins are viewed.

Prior to the work described herein, the genetic requirement for NDR1 in pathogen defense had
been established, but the mechanisms underlying the requirement were not understood. To
attempt to understand these mechanisms we began with a detailed analysis of the NDR1 protein
itself, ignoring its pre-established role in defense. The use of homology modeling led to the
identification of a strong structural homology between NDR1 and the abiotic stress related
protein LEA14 (Figure 2.1). Perhaps more interestingly, NDR1 also showed a high degree of
similarity to mammalian integrins, a class of proteins not known to exist in plants. Based on
these structural models, multiple protein motifs were identified that appeared to be functionally
relevant in NDR1. One such motif was the three amino acid NGD peptide sequence. The NGD

193

motif, similar in both peptide sequence and location within the protein to the known mammalian
ligand binding RGD motif, indicated that NDR1 could be involved in ligand binding.. This motif
proved to be of critical importance in the physiological role identified for NDR1, that of
mediating PM-CW adhesion. The identification of a role for NDR1 in PM-CW adhesion
presented an entirely new perspective on defense associated proteins. To this end, we have now
described a physiological role for NDR1, revealed through analyzing electrolyte leakage in
response to pathogen infection (FIGURE 2.2). Cells of the ndr1-1 mutant, when inoculated with
P. syringae DC3000 expressing the effector AvrRpt2, are unable to restrict fluid leakage across
the membrane. This evidence, showing a strong physiological requirement for NDR1 outside of
defense, supports the hypothesis that NDR1 may have been co-opted into the defense network,
potentially through its interaction with RIN4. This would support the hypothesis that NDR1
serves a non-pathogen-defensive role, in addition to its role in innate immune signaling.

Interestingly, the role of NDR1 in maintaining the PM-CW continuum proved to have function
beyond that of the regulation of fluid loss. Previous studies have shown that PM-CW adhesion
can be important for interaction of plant and pathogen and the subsequent defense signaling
(Mellersh and Heath 2001). In the absence of NDR1 mediated PM-CW adhesion it was
hypothesized that the interaction between the pathogen type III secretion system may be altered.
By monitoring effector delivery in the ndr1-1 mutant it was shown that the loss of PM-CW
adhesion reduces the ability of effectors to be delivered into the cell interior. The recognition of
pathogen effectors by R-proteins is an important step in the activation of plant defense, and with
a reduction in the volume of effectors delivered the ability of the host to recognize and respond
appropriately may also be reduced.

194

Beyond the identification of a role in adhesion, work to examine the function of NDR1 yielded a
unique result that helped to bridge the connection between ETI and PTI. When challenged with
the PAMP flg22, ndr1-1 mutant plants showed significant reductions in expression of the MAPK
pathway marker FRK1, along with a reduction in phosphorylated MAPK3/6 protein as compared
to Col-0. This novel discovery served as a basis on which much of my future research was based.

While NDR1 has long been associated with defense signaling linked to the recognition of
specific effectors and the subsequent activation of defense, the level at which NDR1 was
integrated into both PTI and ETI was not well established. To begin to analyze the specifics of
NDR1's role in PAMP-mediated defense signaling, the requirement for NDR1 was examined at
every stage of the infection process. At the first stage, that of pathogen entry, the ndr1-1 mutant
plant was shown to be insensitive to the PAMP flg22 (Figure 3.1). The failure of the mutant to
respond to a potential pathogen stimuli results in stomatal aperture that do not close
appropriately leaving the plant “open” to pathogen infection.

After P. syringae successfully enters the interior space of the leaf, the next stage of defenses
involves the recognition of conserved protein motifs of the pathogen by plant cell surface
receptors. NDR1 was shown to be required for the robust activation of the MAPK signaling
cascade after the perception of the PAMPs flg22 and elf26. The demonstration of the
requirement for NDR1 in PAMP signaling was able to answer a curious previous observation in
which ndr1-1 mutant plants when inoculated with Pst DC3000 showed an increase in bacterial
growth as compared to wild-type Col-0. Additionally, the production of Reactive Oxygen

195

Species (ROS) is often associated with the activation of PTI. In the ndr1-1 mutant ROS
generation was reduced in response to multiple PAMP elicitors, providing more evidence that the
signaling cascade initiated in response to PAMP detection is abrogated in ndr1-1. Furthermore,
by positively linking NDR1 to PAMP triggered immunity we are able to link basal immunity
directly to effector triggered immunity, with NDR1 serving as an important point of connectivity
between the two (Figure 5.1)

Beyond the identification of a role for NDR1 in mediating both basal immunity and R-gene
mediated defenses the role of NDR1 in stomata aperture signaling and PM-CW adhesion led to
perhaps the most significant and unexpected finding of this dissertation; the association of NDR1
to drought stress tolerance. After initial homology modeling revealed a high degree of structural
homology to LEA14 a protein involved in desiccation resistance, and a member of an abiotic
stress responsive protein family we began to speculate on a role for NDR1 in abiotic stress
responses. With the demonstration of NDR1 as a critical component of PM-CW adhesion
followed by the definitive connection between NDR1 and stomata aperture (Figure 3.1) the
potential for an association between NDR1 and drought stress became increasingly likely. By
analyzing several metrics associated with free water potential including relative water content,
electrolyte leakage and drought responsive gene expression a link between NDR1 and drought
stress was established (Figure 4.1). Furthermore, the over-expression of NDR1 was shown to
increase the tolerance of Arabidopsis to severe drought stress. The connection of a disease
resistance associated gene, NDR1, with abiotic stresses is a major step forward in integrated
research, which in the future will allow for the examination of metabolic and physiological trade-

196

offs associated with resistance to multiple varied stresses; more closely mirroring natural
conditions.

Future directions

While much progress has been made during the course of my dissertation work in the area of
NDR1 function, several important questions remain unanswered. Several of these remaining
questions are specific to the NDR1 protein itself. The localization of the NDR1 protein in the
plasma membrane has been previously established (Coppinger et al., 2004), but the specific
orientation of the protein within the membrane remains unknown. Two models currently exist,
one in which a single transmembrane domain and a C-terminal GPI anchor link NDR1to the
membrane with nearly the entirety of the protein on the cell exterior. The other model utilizes a
predicted second transmembrane domain, which places the majority of the protein within the
cytoplasm and only a small loop on the exterior. Current evidence from Knepper et al. (2011)
supports the former model. The role of NDR1 in PM-CW adhesion was shown to require the
NGD protein motif, which would necessitate this motif's location in the apoplast, thus supporting
the former model with the majority of the protein outside the cytoplasm. Establishing the specific
orientation of NDR1 will be necessary in the future in order to identify both the mechanism by
which NDR1 functions in PM-CW adhesion as well as its interacting partner(s), whether they are
cell wall components or membrane proteins.

Another important question that remains to be answered in regards to the NDR1 protein is the
number and nature of protein modifications present in NDR1. NDR1 was identified as containing

197

seven putative glycosylation sites (Coppinger et al., 2004) and treatment of NDR1 to remove Nlinked glycosylations resulted in a downshift in protein size, thus showing at least some of these
putative sites are, in fact, glycosylated. An in-depth analysis is needed to identify the number and
nature of N-linked glycosylations along with other potential protein modifications to NDR1 that
may impact its function, including PM-CW adhesion and defense activation and signaling.

A final NDR1 protein-related question that must be examined is the identification of the motif
involved in the self-association of NDR1. A strong similarity, previously described in this
dissertation (Chapter 2), is that between NDR1 and mammalian integrins, including the
formation of multimers. While the self-association of NDR1 proteins has been established
(Knepper et al., 2011) the precise number involved in the multi-protein complex, as well as the
specific protein motif(s) involved in this interaction has not been established. The identification
of the self-associating motif in NDR1 could allow for a better understanding of complex
formation and potential signaling functions that can be linked to the formation of or disillusion of
protein multimers. This is possibly one more link to the integrin-like function of NDR1 in
Arabidopsis. Furthermore, the identification of a motif required for NDR1 self-association could
allow for data mining in Arabidopsis as well as in related species, looking for other multimer
forming proteins that could be involved in signaling mechanisms similar to those of NDR1.
Beyond the scope of NDR1 protein analysis, several physiological functions of NDR1 warrant
exploration. While the link between NDR1 and drought stress (Chapter 4) has proved to be a
significant shift in how R-gene accessory proteins are viewed, there may remain links to other
abiotic stress signaling pathways in which NDR1 could function. Given the strong connection
between NDR1 and drought stress, it is likely that NDR1 may also function to mediate other

198

abiotic stresses. An interesting long term project would be to thoroughly assay for abiotic stress
phenotypes other than drought in the ndr1-1 mutant. NDR1 could potentially serve as a
regulatory hub in both biotic and abiotic stress signaling.

When this dissertation project began, NDR1 was merely an R-gene accessory protein with an
established genetic requirement in pathogen defense. It was known that many CC-NB-LRR Rgenes required the presence of a functional NDR1 protein to properly initiate defensive cascades
upon pathogen effector detection. Working from this important, but narrow knowledge base, I
was able to expand the very idea of what a defense-related protein could be, starting with the
identification of a specific physiological function for NDR1 in PM-CW adhesion. Beyond a
mechanical role in adhesion, NDR1 was also identified as a required component to mediate fluid
loss in response to a pathogen. NDR1 proved to be a required component in PAMP signaling,
necessary for robust PTI activation, as well as playing a role in the stomatal aperture response.
Currently, many projects focusing on plant-pathogen interactions are beginning to examine
cross-talk between the PTI and ETI signal cascade, which were once thought of as separate but
complementary systems. The findings herein, which connect NDR1 to both basal and effectormediated resistance, will likely lend support to the hypothesis of a strongly interconnected
defense network that is reliant on both PAMP and effector signals for robust activation.
Furthermore, showing a definitive connection between NDR1 and drought stress suggests that
the primary function of NDR1 may, in fact, be of a physiological capacity where it serves to
mediate PM-CW adhesion and regulate fluid movement, and that through interactions with
defensive regulatory proteins, such as RIN4, NDR1 was co-opted into the defense network
where it serves as a signaling hub. In conclusion, with the knowledge generated through this

199

dissertation project the NDR1 paradigm has truly shifted. Where NDR1 was formerly recognized
as simply an R-gene accessory protein, it can now stand on its own as a critical component of
Arabidopsis biology.

200

Figure 5.1.

201

Figure 5.1. Model of NDR1 location and interconnectivity.
NDR1 (NON-RACE SPECIFIC DISEASE RESISTANCE-1) is a plasma membrane localized,
GPI-anchored protein that is capable of forming multimers. NDR1 contains an NGD (Asn-GlyAsp) motif located in the putative apoplastic-localized region of the protein, shown to be
important for maintaining cell wall-plasma membrane adhesion points through either direct or
indirect interaction with components of the cell wall that are as yet unknown. The role of NDR1
in ETI has been further strengthened through the identification of an interaction between NDR1
and RIN4 (RPM1 INTERACTING PROTEIN 4; Day et al., 2006). RIN4 has been shown to
associate with the R-protein, RPS2 (RESISTANCE TO PSEUDOMONAS SYRINGAE 2), and it
is through RIN4’s cleavage by the P. syringae DC3000 effector protein AvrRpt2 and the
subsequent recognition of this event by RPS2 (Kunkel et al., 1993), that ETI is activated. NDR1
has also been linked directly to the activation of the MAPK (MITOGEN ACTIVATED
PROTEIN KINASE) pathway and PTI (PAMP Triggered Immunity). Although the specific
interaction of NDR1 in the upstream components of PTI signaling remain unknown. Figure
originally printed in Knepper et al., (2011b).

202

LITERATURE CITED

203

LITERATURE CITED

Century, K., Holub, E.B. and Staskawicz, B.J. (1995) NDR1, a locus of Arabidopsis thaliana
that is required for disease resistance to both a bacterial and fungal pathogen. Proc. Natl. Acad.
Sci. U.S.A. 92: 6597-6601.
Coppinger, P., Repetti, P.P., Day, B., Dahlbeck, D., Mehlert, A. and Staskawicz, B.J. (2004)
Overexpression of the plasma membrane-localized NDR1 protein results in enhanced bacterial
disease resistance in Arabidopsis thaliana. Plant J. 40: 225-237.
Day, B., Dahlbeck, D. and Staskawicz, B.J. (2006) NDR1 interaction with RIN4 mediates the
differential activation of multiple disease resistance pathways in Arabidopsis. Plant Cell 18:
2782-2791.
Knepper, C., Savory, E.A. and Day, B. (2011a) Arabidopsis NDR1is an integrin-like protein
with a role in fluid loss and plasma membrane-cell wall adhesion. Plant Physiol. 156: 286-300.
Knepper, C., Savory, E.A. and Day, B. (2011b) The role of NDR1 in pathogen perception and
plant defense signaling. Plant signal. behav. 6: 1114-1116.
Kunkel, B.N., Bent, A.F., Dahlbeck, D., Innes, R.W. and Staskawicz, B.J. (1993) RPS2, an
Arabidopsis disease resistance locus specifying recognition of Pseudomonas syringae strains
expressing the avirulence gene avrRpt2. Plant Cell 5: 865–875.
Mellersh, D.G. and Heath, M.C. (2001) Plasma membrane-cell wall adhesion is required for
expression of plant defense responses during fungal penetration. Plant Cell 13: 413-424.

204

APPENDIX

205

Supplemental Methods

Electrolyte Leakage: supplemental conductance method

Electrolyte leakage was measured for Figure S3 in 4-week-old plants using a protocol modified
7

-1

from Mackey et al. (2002). Plants were dip inoculated at 3 x 10 cfu mL . After inoculation,
plants were covered with a clear plastic dome for 1 hour before the 0 hour time point leaves were
removed. A leaf disc (0.7 cm diameter) was harvested using a number 3 size cork borer from 2
leaves each from 4 plants. The punches were added to a glass container containing 50 mL of
sterile dH2O and allowed to rotate on orbital shaker for 30 minutes at 20 rpm. After this wash
step the dH2O was removed and replaced by 10 mL sterile dH2O that had been previously
measured for conductance to allow for background to be removed. The samples were allowed to
remain on shaker with measurements conducted at 3 hour intervals for 24 hours. Electrolyte
leakage was recorded as conductance (µS). To allow for the calculation of percent maximal
leakage, after the final measurement was taken the leaf punches were frozen at -80°C for 24
hours before being returned to their respective samples, followed by 3 hours on the shaker and a
final measurement recorded as total leakage. Total percent leakage can be calculated as first
reading/second reading adjusted to percent maximal leakage.

206

Supplemental Formulas

Formula S2.1

Log10(n)ijk=Ti+ Gj + TiGj + ek

Formula S2.1. Statistical model for analysis of bacterial growth assays.
Where T, treatment; G, genotype; TG, treatment:genotype; e, residual; i, treatment index (1 to 4);
j, genotype index (1 to 4), k, replicate index (4 to 6).

207

Supplemental Tables

Table S2.1.
6 h pretreatment

12 h pretreatment

peptide
Line

pretreatment

HR +

HR -

HR +

HR -

Col-0

mock

31

1

30

2

VNGDG

32

0

29

1

VRGDG

32

0

28

2

VAAAG

33

0

28

3

mock

1

31

2

27

VNGDG

2

28

1

30

VRGDG

7

24

2

25

VAAAG

4

29

0

34

ndr1-1

Table S2.1. The effect of exogenous peptide application on the hypersensitive response (HR) in
WT Col-0 and ndr1-1 mutant plants.
Pre-treatment of Col-0 or ndr1-1 mutant plants, at either 6 or 12 h with 5 mM ‘VAAAG’,
‘VNGDG’ or ‘VRGDG’ peptide solutions in 1 mM MgCl2 or 1 mM MgCl2 alone did not
significantly alter the number of leaves undergoing HR after inoculation with Pst DC3000
expressing AvrRpt2.

208

Table S2.2.
Gene
NDR1
(AT3g20600)
LEA14
(At1g01470)
LEA group 1
domain
containing protein
(At1g32560)
PIP2;6
(At2g39010)
PIP2;5
(At3g54820)
PIP1;5
(At4g23400)
PIP1;4
(At4g00430)
PIP1;3
(At1g01620)
PR1 (At2g14610)
PDF1.2
(At5g44420)
RPS2
(At3g03600)
FRK1
(At2g19190)
‘RGD’site
directed
mutagenesis
‘AAA’site
directed
mutagenesis

Forward Primer (5'-3')

Reverse Primer (5'-3')

CGGTTTTACGAGCGGTTTTG
ACCTCAAAGACGTGAACCGT
GACT

CCAACTTCAACCCCATACCTC
GGCGCTGTGGAAAGTGAAACTG
AT

AAGAGATAGCGCACCAACGG
AGAA
GGCATCTCTGGTGGACACAT
C
TGGTGGGCATATTAATCCGG
CAGT
GCTGGAATCTCAGGAGGACA
TATT

ATTATGCCCGTAACCGTGTCCCA
T

TGGGATGACCATTGGATTTT

TCTGGACCGTGGAATCTTTC

GGAATCTCTGGTGGGCACAT
CTGCGAACACGTGCAATGGA
GTTT
GCTGCTCTTGTTCTCTTTGCT
GCT
TCTTATCGTTGGCTGTGCTCA
GGT
CGGTCAGATTTCAACAGTTT
GTC

CTCCGAGACATTGCATCACG
TACACCTCACTTTGGCACATCCG
A
AACTTCTGTGCTTCCACCATTGC
C
ACGTATGGCCTTCAAGTCACCG
AT

GTTGAAGTCAGGGGTGATGG
AG

GTTGAAGTCGCCGCTGCTGG
AG
GTCGACATGGCTTCAATGAC
AAGGTGGTCAACAAATGGGT
NDR1 T7 Sal1 ATGAATAATCAAAATGAAGA
For
CACAG

CAACTCCACAAGTGGCTCCG
TGACCAAAGCCACACCACAAAT
GG
AGCTCCAAGGCACTGCATTACT

AATAGCAGGTTGGCCTGTAATC

CTCCATCACCCCTGACTTCAAC

CTCCAGCAGCGGCGACTTCAAC

ACTAGTTTAACGAATAGCAAAG
AATAC

NDR1 SpeI Rev

209

Table S2.2. Primers used in Chapter 2 for qRTPCR and for the construction of the RGD and
AAA site-directed mutant constructs in NDR1.
All primer sets utilized including primers for qRTPCR and primers for site directed mutagenesis
for development of the NDR1 NGD (RGD and AAA) site mutants. Aquaporin homolog primers,
PIPs, are from Alexandersson et al., 2010.

210

Table S2.3.

Arabidopsis lines compared 'NGD'
Col-0
ndr1-1
Col-0
ndr1-1/P

Pst DC3000
EV
EV

Adjusted
p values
0.002
0.9128

Col-0

ndr1-1/PNDR1:NGD-3

EV

0.3045

ndr1-1

ndr1-1/PNDR1:NGD-1

EV

0.0002

ndr1-1

ndr1-1/PNDR1:NGD-3

EV

<.0001

ndr1-1/PNDR1:NGD-1
Col-0
Col-0

ndr1-1/PNDR1:NGD-3
ndr1-1

EV

0.6931

ndr1-1/PNDR1:NGD-1

AvrRpt2
AvrRpt2

<.0001
0.064

Col-0

ndr1-1/PNDR1:NGD-3

AvrRpt2

0.0341

ndr1-1

ndr1-1/PNDR1:NGD-1

AvrRpt2

<.0001

ndr1-1

ndr1-1/PNDR1:NGD-3

AvrRpt2

<.0001

ndr1-1/PNDR1:NGD-1
Col-0
Col-0

ndr1-1/PNDR1:NGD-3
ndr1-1

AvrRpt2

0.9825

ndr1-1/PNDR1:NGD-1

AvrB
AvrB

0.0001
0.9912

Col-0

ndr1-1/PNDR1:NGD-3

AvrB

0.9799

ndr1-1

ndr1-1/PNDR1:NGD-1

AvrB

0.0007

ndr1-1

ndr1-1/PNDR1:NGD-3

AvrB

0.0009

ndr1-1/PNDR1:NGD-1
Col-0
Col-0

ndr1-1/PNDR1:NGD-3
ndr1-1

AvrB

0.9997

ndr1-1/PNDR1:NGD-1

AvrPphB
AvrPphB

0.0003
0.9428

Col-0

ndr1-1/PNDR1:NGD-3

AvrPphB

0.883

ndr1-1

ndr1-1/PNDR1:NGD-1

AvrPphB

0.0011

ndr1-1

ndr1-1/PNDR1:NGD-3

AvrPphB

<.0001

ndr1-1/PNDR1:NGD-1

ndr1-1/PNDR1:NGD-3

AvrPphB

0.5282

NDR1:NGD-1

211

Table S2.3. (cont’d)

Arabidopsis lines compared 'RGD'
Col-0
ndr1-1
Col-0
ndr1-1/P

Pst DC3000
EV
EV

Adjusted
p values
0.0067
0.0047

Col-0

ndr1-1/PNDR1:RGD-3

EV

0.5256

ndr1-1

ndr1-1/PNDR1:RGD-1

EV

<.0001

ndr1-1

ndr1-1/PNDR1:RGD-3

EV

<.0001

ndr1-1/PNDR1:RGD-1
Col-0
Col-0

ndr1-1/PNDR1:RGD-3
ndr1-1

EV

0.1422

ndr1-1/PNDR1:RGD-1

AvrRpt2
AvrRpt2

<.0001
0.0835

Col-0

ndr1-1/PNDR1:RGD-3

AvrRpt2

0.9843

ndr1-1

ndr1-1/PNDR1:RGD-1

AvrRpt2

<.0001

ndr1-1

ndr1-1/PNDR1:RGD-3

AvrRpt2

<.0001

ndr1-1/PNDR1:RGD-1
Col-0
Col-0

ndr1-1/PNDR1:RGD-3
ndr1-1

AvrRpt2

0.0348

ndr1-1/PNDR1:RGD-1

AvrB
AvrB

0.0004
0.1828

Col-0

ndr1-1/PNDR1:RGD-3

AvrB

0.9999

ndr1-1

ndr1-1/PNDR1:RGD-1

AvrB

<.0001

ndr1-1

ndr1-1/PNDR1:RGD-3

AvrB

0.0002

ndr1-1/PNDR1:RGD-1
Col-0
Col-0

ndr1-1/PNDR1:RGD-3
ndr1-1

AvrB

0.1309

ndr1-1/PNDR1:RGD-1

AvrPphB
AvrPphB

<.0001
0.9999

Col-0

ndr1-1/PNDR1:RGD-3

AvrPphB

0.9063

ndr1-1

ndr1-1/PNDR1:RGD-1

AvrPphB

<.0001

ndr1-1

ndr1-1/PNDR1:RGD-3

AvrPphB

<.0001

ndr1-1/PNDR1:RGD-1

ndr1-1/PNDR1:RGD-3

AvrPphB

0.8816

NDR1:RGD-1

212

Table S2.3. (cont’d)

Arabidopsis lines compared 'AAA'
Col-0
ndr1-1
Col-0
ndr1-1/P

Pst DC3000
EV
EV

Adjusted
p values
0.0713
0.3311

Col-0

ndr1-1/PNDR1:AAA-3

EV

0.4212

ndr1-1

ndr1-1/PNDR1:AAA-1

EV

0.8447

ndr1-1

ndr1-1/PNDR1:AAA-3

EV

0.7546

ndr1-1/PNDR1:AAA-1
Col-0
Col-0

ndr1-1/PNDR1:AAA-3
ndr1-1

EV

0.9982

ndr1-1/PNDR1:AAA-1

AvrRpt2
AvrRpt2

<.0001
0.3475

Col-0

ndr1-1/PNDR1:AAA-3

AvrRpt2

0.8406

ndr1-1

ndr1-1/PNDR1:AAA-1

AvrRpt2

<.0001

ndr1-1

ndr1-1/PNDR1:AAA-3

AvrRpt2

<.0001

ndr1-1/PNDR1:AAA-1
Col-0
Col-0

ndr1-1/PNDR1:AAA-3
ndr1-1

AvrRpt2

0.7901

ndr1-1/PNDR1:AAA-1

AvrB
AvrB

0.0102
0.9966

Col-0

ndr1-1/PNDR1:AAA-3

AvrB

0.921

ndr1-1

ndr1-1/PNDR1:AAA-1

AvrB

0.0192

ndr1-1

ndr1-1/PNDR1:AAA-3

AvrB

0.0007

ndr1-1/PNDR1:AAA-1
Col-0
Col-0

ndr1-1/PNDR1:AAA-3
ndr1-1

AvrB

0.8277

ndr1-1/PNDR1:AAA-1

AvrPphB
AvrPphB

0.0231
0.5109

Col-0

ndr1-1/PNDR1:AAA-3

AvrPphB

0.9332

ndr1-1

ndr1-1/PNDR1:AAA-1

AvrPphB

0.4553

ndr1-1

ndr1-1/PNDR1:AAA-3

AvrPphB

0.0023

ndr1-1/PNDR1:AAA-1

ndr1-1/PNDR1:AAA-3

AvrPphB

0.1814

NDR1:AAA-1

213

Table S2.3. p values of Pst DC3000 growth assays in WT Arabidopsis and NGD/RGD/AAAcomplemented lines.
Adjusted p values were determined in SAS version 9.2 by the use of an unbalanced two-way
ANOVA (model Formula S2.1) and Tukey’s test.

214

Table S3.1.

Gene
FRK1

Locus tag
At2g19190

PHI1

At1g35140

OXI1

At3g25250

Forward primer (5’-3’)
CGGTCAGATTTCAACAGTTT
GTC
TTGGTTTAGACGGGATGGTG
GACGAGATTATCAGATTTTA
CGC

Reverse primer (5’-3’)
AATAGCAGGTTGGCCTGT
AATC
ACTCCAGTACAAGCCGAT
CC
AACTGGTGAAGCGGAAGA
GAC

Table S3.1. DNA primers used in Chapter 3 for quantitative real-time PCR.
FRK1 and PHI1 primer sequences are from Boudsocq et al. (2010). OXI1 primer sequences are
from Forzani et al. (2011).

215

Table S4.1.

Gene
RD29B

Locus tag
At5g52300

ERD4

AT1G30360

Forward primer (5’-3’)
GATACCTTCCGACCAGATAG
C
CGCAACAGAAAACAGCAAG
G

Reverse primer (5’-3’)
TTCCTTCTCCACCTTTTCCT
TC
TTGTTTACCGACTAGCCCA
C

Table S4.1. DNA primers used in Chapter 4 for quantitative real-time PCR.
RD29B and ERD4 primer sequences for qRT-PCR.

216

Supplemental Figures

Figure S2.1.

Figure S2.1. Predicted structural models of NDR1.
(A)-(E), I-TASSER-generated homology models of NDR1. I-TASSER analysis returned results
of comparison Model A and closest Protein Database result 1yycA (LEA14; Singh et al., 2005)
with a TM-score of 0.6393 and RMSD 2.96. (F) PHYRE-based prediction of NDR1 structure.

217

Figure S2.2.

218

Figure S2.2. Predicted (NDR1; I-TASSER) and solved (LEA14 and fibronectin type III domain
of human Integrin beta-4.) structures of the -sheet torus.
(A) NDR1. (B) LEA14. (C) Fibronectin type III (FNIII) domain of human Integrin beta-4
(10.2210/pdb2yrz/pdb). (D) NDR1- fibronectin type III domain of human Integrin beta-4
(10.2210/pdb2yrz/pdb) overlay. (E) LEA14- fibronectin type III domain of human Integrin beta4 (10.2210/pdb2yrz/pdb) overlay. (F) Overlay of NDR1, LEA14 and fibronectin type III domain
of human Integrin beta-4 (10.2210/pdb2yrz/pdb). Overlays of predicted and solved structures
were generated using CHIMERA. For generation of the NDR1 -sheet model, amino acids 34195 were used. For LEA14, amino acids 40-162 were used, based on the solved structure
pdb_1yyca (Singh et al., 2005).

219

Figure S2.3.

220

Figure S2.3. (cont’d)

221

Figure S2.3. Electrolyte leakage Conductance measurements.
As a control for the method of electrolyte leakage utilized in this study, an experiment was
performed using a technique adapted from Mackey et al. (2002; Appendix).

Levels of

electrolyte leakage from Col-0 and ndr1-1 plants in response to DC3000 inoculation are
displayed as conductance adjusted for background. Treatments include Pst DC3000 expressing
(A) vector control and (C) AvrRpt2. (B,D) data from the same experiments displayed in percent
maximal leakage the method of calculation used in this study. Error bars display standard
deviation from 2 technical replicates from 1 biological replicate. Significance was determined
using two-way ANOVA where * represents a statistically significant difference between Col-0
and ndr1-1. * p<0.05.

222

Figure S2.4.

223

Figure S2.4. Expression of aquaporin homolog family genes in response to Pst DC3000
expressing AvrB or AvrPphB.
mRNA expression levels of aquaporin homolog genes observed in WT Col-0 and ndr1-1 plants
in response to inoculation with Pst DC3000 expressing either AvrB or AvrPphB. Error bars
display standard deviation from 1 technical replicate from 2 biological replicates. Samples taken
at 0, 24, and 48 hours post inoculation (hpi). Expression values displayed as fold Col-0 0 h
average. Statistical significance was determined using two-way ANOVA where * represents
statistical difference between Col-0 and ndr1-1 and # represents statistical change over time. *
p<0.05; ** p<0.01; *** p<0.001.

224

Figure S2.5.

225

Figure S2.5. (cont’d)

226

Figure S2.5. Expression of defense marker genes.
mRNA expression levels of NDR1, the defense marker genes PR1 and PDF1.2, and the R-gene
RPS2 in WT Col-0 and the ndr1-1 mutant plants in response to inoculation with Pst DC3000 and
Pst DC3000 expressing the effectors AvrRpt2, AvrB or AvrPphB. Error bars display standard
deviation from 1 technical replicate from 2 biological replicates. Samples taken at 0, 24 and 48
hours post inoculation (hpi).

Expression values are displayed as fold Col-0 0 h average.

Statistical significance was determined using two-way ANOVA where * represents statistical
difference between Col-0 and ndr1-1 and # represents statistical change over time. * p<0.05; **
p<0.01; *** p<0.001.

227

Figure S2.6.

Figure S2.6. Expression levels of HA- and T7-tagged NDR1 constructs utilized.
Expression of all constructs showed modest variability, which accounts for, in part, the variation
of band intensity observed in Figure 2.4. Differences in antibody affinities (i.e., T7-HRP versus
HA-HRP) are also in part responsible for the observed differences. (A) T7-tagged NDR1
constructs (wild type NDR1 with the NGD site along with NDR1 altered in the NGD site to
either AAA or RGD) along with (B) HA-tagged NDR1 and HA-tagged RIN4 utilized in this
project.
228

Figure S3.1.

229

Figure S3.1.

230

Figure S3.1. mRNA expression of FRK1 and PHI1.
Expression of the MAPK marker FRK1 (A) and the CDPK marker PHI1 (B) after 1 µM elf26
treatment. Samples were collected 1, 3 and 6 hours post infiltration. Expression is displayed as
fold Col-0 untreated. Error bars display SD from three biological replicates. No statistical
significance was observed using one-way ANOVA followed by Tukey’s post-test.

231

LITERATURE CITED

232

LITERATURE CITED

Alexandersson, E., Fraysse, L., Sjovall-Larsen, S., Gustavsson, S., Fellert, M., Karlsson, M.,
Johanson, U. and Kjellbom, P. (2005) Whole gene family expression and drought stress
regulation of aquaporins. Plant Mol Biol 59: 469-484.
Boudsocq, M., Willmann, M.R., McCormack, M., Lee, H., Shan, L., He, P., Bush, J.,
Cheng, S. and Sheen, J. (2010) Differential innate immune signaling via Ca2+ sensor protein
kinases. Nature 464: 418-423.
Forzani, C., Carreri, A., de la Fuente van Bentem, S., Lecourieux, F. and Hirt, H. (2011)
The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signalinducible 1 and mitogen-activated protein kinases. FEBS J. 278: 1126-1138.
Mackey, D., Holt, B.F., Wiig, A. and Dangl, J.L. (2002) RIN4 interacts with Pseudomonas
syringae type III effector molecules and is required for RPM1-mediated resistance in
Arabidopsis. Cell 108: 743-754.

233