INVESTIGATING CARBOHYDRATE UTILIZATION AND VIRULENCE IN 

ERWINIA AMYLOVORA 

By 

Emma M. Sweeney 

A THESIS 

Submitted to 

Michigan State University 

in partial fulfillment of the requirements 

for the degree of 

Plant Pathology – Master of Science 

2018 

 

 

ABSTRACT 

 

 

 

 

INVESTIGATING CARBOHYDRATE UTILIZATION AND 

VIRULENCE IN ERWINIA AMYLOVORA 

By 

Emma M. Sweeney 

Fire blight, caused by the gram-negative bacterium Erwinia amylovora, is a destructive 

disease of apple and pear trees worldwide. A unique aspect of apple and pear physiology is the 

presence of sorbitol in the leaves and shoots, glucose on the flower stigma surface and sucrose in 

the flower nectary. Erwinia amylovora cells encounter all three carbohydrates at different stages 

of infection, and it is unknown how the carbohydrate utilization genes are regulated between 

these changing nutrient environments. This thesis explores carbohydrate utilization by E. 

amylovora in relation to virulence, regulatory small RNAs (sRNAs), other virulence factors and 

host specificity. The findings presented here indicate that sorbitol utilization (srl) gene mutants 

of E. amylovora are amylovoran-deficient, and they are unable to obtain the energy base needed 

to infect apple shoots and immature pear fruits. Additionally, the sRNA Spot 42 does not 

regulate sorbitol as it does in Escherichia coli, and we hypothesize that E. amylovora has 

evolved to evade Spot 42 regulation in order to adapt to the high-sorbitol content of apple and 

pear hosts.  

 

 

 

 

ACKNOWLEDGEMENTS 

 

Foremost, I would like to thank my advisor, Dr. George Sundin, for his guidance, 

patience and endless enthusiasm over the past few years. I don’t know how he found the time, 

but George always made himself available to discuss research or to just chat.   

 

I would also like to acknowledge Dr. Ray Hammerschmidt and Dr. Shannon Manning for 

serving on my graduate committee. Thanks to both for sharing their time and offering both 

advice and encouragement.  

 

My graduate school experience would not have been what it was without the friendship 

and support of my fellow Sundin lab members. Thanks for years of goofy conversations, coffee 

and grilled cheese excursions and for helping me troubleshoot in the lab. Special thanks to Jeff 

Schachterle for teaching me almost everything I know about cloning and other molecular 

techniques.  

 

Thanks also to Dr. Nicole Donofrio (University of Delaware) for introducing me to plant 

pathology several years ago and for encouraging me to apply to MSU.  

 

And finally, I’d like to thank my family, Alex Soroka and Alison Nord for always 

listening and cheering me on. 

 
 
 

 

 

iv 

 

TABLE OF CONTENTS 

 

LIST OF TABLES ..................................................................................................................... viii 

LIST OF FIGURES ..................................................................................................................... ix 

KEY TO ABBREVIATIONS ..................................................................................................... xi 

Chapter 1. Literature Review ...................................................................................................... 1 

I. Introduction to Erwinia amylovora, causal agent of fire blight ............................................... 2 

Virulence determinants of E. amylovora ................................................................................. 3 

Infection progression and carbohydrate consumption ............................................................. 4 

Fire blight disease cycle .......................................................................................................... 6 

Carbohydrate zones in the apple tree ....................................................................................... 7 

Importance of sorbitol to fire blight infection ......................................................................... 8 

Rubus-infecting strains of E. amylovora ................................................................................. 9 

Small RNAs (sRNAs) as bacterial regulators ........................................................................ 11 

sRNA chaperone Hfq ............................................................................................................. 12 

sRNAs as regulators of sugar metabolism in E. coli ............................................................. 13 

sRNAs in E. amylovora ......................................................................................................... 14 

Objectives .............................................................................................................................. 15 

REFERENCES .......................................................................................................................... 16 

Chapter 2. Sorbitol utilization by E. amylovora ....................................................................... 22 

Abstract ..................................................................................................................................... 23 

I. Introduction ............................................................................................................................ 24 

II. Materials and Methods ......................................................................................................... 26 

Bacterial strains and growth conditions................................................................................. 26 

Construction of chromosomal mutants .................................................................................. 29 

CPC-binding assay for quantification of amylovoran production ......................................... 29 

Biofilm formation assay ........................................................................................................ 30 

Determination of virulence using immature pear and apple shoot infection assays ............. 30 

Growth in sorbitol-containing minimal medium ................................................................... 31 

Analysis of sorbitol fermentation ability using MacConkey medium ................................... 31 

qRT-PCR ............................................................................................................................... 31 

III. Results ................................................................................................................................. 33 

 

v 

 

Sorbitol utilization mutants are reduced in growth in sorbitol-containing minimal medium 33 

Biofilm formation is not affected in the sorbitol utilization mutants .................................... 36 

Sorbitol utilization mutants are reduced in virulence on immature pears and apple shoots . 38 

Amylovoran production is reduced in the sorbitol utilization mutants ................................. 41 

srlA is highly expressed in 1% sorbitol medium and 0.5% glucose + 0.5% sorbitol medium
 ............................................................................................................................................... 43 

IV. Discussion ........................................................................................................................... 46 

REFERENCES .......................................................................................................................... 48 

Chapter 3. The role of sorbitol in host specificity of E. amylovora Rubus isolates................ 51 

Abstract ..................................................................................................................................... 52 

I. Introduction ............................................................................................................................ 53 

II. Materials and Methods ......................................................................................................... 55 

Bacterial strains and growth conditions................................................................................. 55 

Construction of chromosomal mutants .................................................................................. 57 

Transfer of the sorbitol-utilization genes into E. amylovora MR1 ........................................ 57 

Determination of virulence using immature pears ................................................................ 58 

Apple shoot infection assay ................................................................................................... 58 

Analysis of sorbitol fermentation ability using MacConkey medium ................................... 58 

III. Results ................................................................................................................................. 59 

Rubus strain E. amylovora MR1∆eop1 is virulent on immature pear fruit ........................... 59 

Erwinia amylovora MR1∆eop1/srlAEBDMR exhibited improved growth in sorbitol medium 
and was more mucoid than MR1∆eop1 ................................................................................. 61 

Erwinia amylovora MR1∆eop1/srlAEBDMR exhibits increased amylovoran production ... 64 

Erwinia amylovora MR1∆eop1/srlAEBDMR is slightly more virulent on apple shoots than 
MR1∆eop1 ............................................................................................................................. 66 

IV. Discussion ........................................................................................................................... 68 

REFERENCES .......................................................................................................................... 71 

Chapter 4. sRNA regulation of carbohydrate utilization in Erwinia amylovora ................... 73 

Abstract ..................................................................................................................................... 74 

I. Introduction ............................................................................................................................ 75 

II. Materials and Methods ......................................................................................................... 77 

Bacterial strains and growth conditions................................................................................. 77 

Construction of translational fusion and fluorescence readings ............................................ 79 

III. Results ................................................................................................................................. 80 

 

vi 

 

Ea1189∆spf does not exhibit improved growth in sorbitol minimal medium ....................... 80 

SrlA translation is increased in Ea1189∆hfq but not in Ea1189∆spf. ................................... 82 

Spot 42-srlA binding site sequences are only 40% similar in E. amylovora and E. coli....... 84 

sRNAs regulate glucose utilization in E. amylovora ............................................................. 86 

IV. Discussion ........................................................................................................................... 88 

REFERENCES .......................................................................................................................... 91 

Chapter 5. Conclusions and Future Directions ........................................................................ 93 

I. Summary of Work.................................................................................................................. 94 

II. Future Directions .................................................................................................................. 96 

 
 

 

 

vii 

 

LIST OF TABLES 

 
Table 2.1. Bacterial strains, plasmids and primers used in Chapter 2.......................................... 27 
 
Table 3.1. Bacterial strains, plasmids and primers used in Chapter 3.......................................... 56 
 
Table 4.1. Bacterial strains and plasmids used in Chapter 4 ........................................................ 78 
 
 

 

 

viii 

 

LIST OF FIGURES 

 
Figure 1.1. Anatomy of apple (Malus domestica) flower with arrows indicating stigma, style, 
nectary and pedicel. ........................................................................................................................ 5 
 
Figure 2.1. Growth of E. amylovora Ea1189 and Ea1189∆srl gene mutants at RT in minimal 
medium containing 1% sorbitol. ................................................................................................... 34 
 
Figure 2.2. Growth of Ea1189 and Ea1189∆srl gene mutants on MacConkey indicator plates 
containing 1% sorbitol .................................................................................................................. 35 
 
Figure 2.3. Biofilm formation by Ea1189 srl mutants in 0.5x LB medium................................. 37 
 
Figure 2.4. Virulence of Ea1189 srl mutant strains on immature pears ...................................... 39 
 
Figure 2.5. Virulence of Ea1189 srl mutant strains on apple shoots. .......................................... 40 
 
Figure 2.6. Amylovoran production in srl gene mutants of E. amylovora. ................................. 42 
 
Figure 2.7. Expression of sorbitol, sucrose and glucose transporter genes (srlA, scrK and ptsG, 
respectively) of Ea1189 grown in sorbitol (A), sucrose (B) or 50% glucose, 50% sorbitol (C) 
medium ......................................................................................................................................... 44 
 
Figure 3.1. Virulence of E. amylovora strains Ea1189 (apple-infecting), MR1 (Rubus-infecting), 
and MR1∆eop1 on immature pear fruit ........................................................................................ 60 
 
Figure 3.2. Growth of E. amylovora Ea1189 (Spiraeoideae-infecting), MR1∆eop1 (Rubus-
infecting) and MR1∆eop1 /srlAEBDMR (Rubus-infecting strain complemented with apple-
infecting srl operon) in minimal medium containing 1% sorbitol. ............................................... 62 
 
Figure 3.3. Growth of Rubus-infecting strains E. amylovora MR1∆eop1 and MR1∆eop1 
/srlAEBDMR (complemented with srlAEBDMR from the Spiraeoideae-infecting strain Ea1189) 
on MacConkey indicator plates containing 1% sorbitol. .............................................................. 63 
 
Figure 3.4. Amylovoran production of E. amylovora Spiraeoideae-infecting strain Ea1189, 
Rubus-infecting strain MR1∆eop1 and MR1∆eop1 complemented with srlAEBDMR from 
Ea1189 (MR1∆eop1/srlAEBDMR). .............................................................................................. 65 
 
Figure. 3.5. Virulence of E. amylovora Spiraeoideae-infecting strain Ea1189, Rubus-infecting 
strain MR1∆eop1 and MR1∆eop1 complemented with srlAEBDMR from Ea1189 (MR1∆eop1/ 
srlAEBDMR). ................................................................................................................................ 67 
 
Figure 4.1. Growth comparison of strains Ea1189 (A) and Ea1189∆spf (B) in 1% glucose, 1% 
sucrose and 1% sorbitol minimal medium. ................................................................................... 81 
 

 

ix 

 

Figure 4.2. Translation of SrlA in Ea1189, Ea1189∆spf, Ea1189∆hfq and Ea1189∆arcZ in 2.5% 
sorbitol minimal medium. ............................................................................................................. 83 
 
Figure 4.3. Comparison of five Spot 42-mRNA binding sites in E. coli and E. amylovora. ....... 85 
 
Figure 4.4. Growth of Ea1189, Ea1189∆arcZ and Ea1189∆hfq on 1% glucose liquid (A) and 
solid (B) minimal medium. ........................................................................................................... 87 
 
 
 

 

 

x 

 

 

KEY TO ABBREVIATIONS 

 

 

 

 

 

 

 

 

CPC 
 
DPI 
 
EPS 
 
FRT 
 
GFP 
 
Hrp 
 
IPTG 
 
Kb 
 
LB 
 
MCS 
 
PAI 
 
PBS 
 
PCR 
 
RBS 
 
sRNA   
 
T3SS 
 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Cetylpyridinium chloride  

Days Post Inoculation 

Exopolysaccharide 

Flippase recognition target 

Green fluorescent protein 

Hypersensitive response and pathogenicity 

Isopropyl β-D-1-thiogalactopyranoside 

Kilobase 

Luria-Bertani 

Multiple cloning site 

Pathogenicity island 

Phosphate-buffered saline 

Polymerase chain reaction 

Ribosomal binding site 

Small RNA 

Type III secretion system 

 

xi 

 

Chapter 1. Literature Review 

 

1 

 

 
 

 

 

I. Introduction to Erwinia amylovora, causal agent of fire blight 

 

Erwinia amylovora (Burrill) Winslow et al. is a bacterial pathogen of plants in the 

Rosaceae family, including apple, pear, hawthorn, raspberry and blackberry. Fire blight is the 

highly infectious disease caused by E. amylovora, and is typically recognized by the 

development of necrosis, wilting shoots and the emergence of bacterial ooze from blighted 

tissues. On apple, fire blight symptoms can occur on most tissues of the tree, including flowers, 

shoots, large branches and rootstock crowns (Norelli et al., 2003). During the infection cycle, the 

bacterium has a brief epiphytic cycle on flower stigmas, but, following flower infection, the 

disease progression involves systemic migration through host tissues downward toward the roots. 

In severe cases, fire blight can kill an entire orchard in a single growing season, with modern 

high-density plantings especially vulnerable to devastating losses. For example, in the year 2000, 

a particularly severe fire blight epidemic occurred in southwestern Michigan, resulting in losses 

estimated at $42 million including complete loss of approximately 20% of the apple acreage in 

this region (Longstroth, 2001). Fire blight disease has had a long history in the United States. 

The pathogen is endemic to the US, where it was first observed in New York State in the 1780s. 

Since then, fire blight has spread to most apple-growing regions of the world, including parts of 

Europe, the middle East and New Zealand (Bonn & Van der Zwet, 2000), and has more recently 

been reported in Central Asia and South Korea (Myung et al., 2016).  

 

2 

 

Virulence determinants of E. amylovora 
 

The coordinated use of virulence factors like type III secretion, biofilm formation, 

exopolysaccharide production and motility facilitate rapid infection by E. amylovora (Malnoy et 

al., 2012). The type III secretion system (T3SS), used by many gram-negative bacteria, plays an 

important role in host-pathogen interactions by injecting bacterial effector proteins into host 

cells. In E. amylovora, the Hrp (hypersensitive response and pathogenicity)-T3SS is responsible 

for secreting and delivering effector proteins to the plant apoplast or cytoplasm (Oh & Beer, 

2005). Hrp-T3SS mutants of E. amylovora are nonpathogenic and cannot elicit a hypersensitive 

response (HR). 

Host xylem colonization and biofilm formation are key virulence traits and adaptations 

that allow E. amylovora to thrive in the host vascular system. Koczan et al. (2009) determined 

that E. amylovora forms a biofilm spanning individual xylem vessels, which protects bacteria 

against external stressors such as environmental fluctuations, host defense responses and 

antibiotics. The exopolysaccharides (EPS) amylovoran and levan were found to be major 

components of E. amylovora biofilms (Koczan et al., 2009). 

The amylovoran EPS is a pathogenicity determinant in E. amylovora. Amylovoran is a 

heteropolymer consisting of branched repeated units of glucose, galactose and pyruvate (Nimtz 

et al., 1996). When produced in xylem vessels, EPS blocks water movement through the shoot, 

resulting in wilt symptoms (Sjulin & Beer, 1978). The ams operon encodes the amylovoran 

biosynthesis genes, and mutations of the ams genes result in a loss of pathogenicity (Bellemann 

& Geider, 1992). 

Levan, another EPS produced by E. amylovora, is an important virulence factor and a 

homopolymer of fructose residues formed in the breakdown of sucrose by the levansucrase 

 

3 

 

enzyme. The lsc gene encodes levansucrase and is regulated by the transcriptional activator RlsA 

(Zhang & Geider, 1999). Levan is required for biofilm formation, and mutation of the lsc gene 

leads to impaired bacterial virulence.  

Motility, driven by peritrichous flagella (Raymundo & Ries, 1981) is another known 

virulence factor in E. amylovora. Motility is important for bacterial blossom colonization, but not 

disease progression within the shoots (Bayot & Ries, 1987). 

Infection progression and carbohydrate consumption 
 

Fire blight infection in apple trees typically begins in the flowers, with rapid progression 

from the stigma to the nectary and into the pedicel (Figure 1.1). At each of these stages in the 

flower infection process, E. amylovora cells encounter a different primary carbohydrate source: 

glucose in the stigma, sucrose in the nectary and sorbitol in the pedicel, leaves and shoots. It is 

not known how the bacteria regulate transitions between these host carbohydrate zones. In 

addition to sugar variations within a single host, different hosts of E. amylovora are known to 

have different sugar profiles. For example, while sorbitol is the predominant photosynthate of 

apple trees, raspberry plants use the sugar sucrose. It has not been determined whether host 

carbohydrates play a role in the host specificity of E. amylovora.  

The following review will summarize current knowledge of carbohydrate utilization in E. 

amylovora focusing on 1) the importance of sorbitol utilization via the srl operon 2) Rubus-

infecting strains of E. amylovora and 3) small RNAs as regulators of E. amylovora carbohydrate 

utilization.  

 

 

 

4 

 

Figure 1.1. Anatomy of apple (Malus domestica) flower with arrows indicating stigma, style, 
nectary and pedicel. 

 
 

 

 

 

  

 

 

 

 

 

 

 

 

 

 

 

5 

 

Fire blight disease cycle 
 

Erwinia amylovora cells overwinter in cankers formed in the branches or trunk of the tree 

(Schroth, 1974). When spring temperatures reach between 21ºC and 28ºC (Pusey & Curry, 

2004), the bacteria emerge from the cankers in the form of ooze droplets. Ooze, a matrix of very 

large populations of E. amylovora cells embedded in amylovoran (Eden-Green & Billing, 1974; 

Slack et al., 2017), is dispersed via wind, rain and insects to flower stigmas, and serves as 

primary inoculum to promote new flower and shoot infections (Thomson, 2000). 

Open flowers are highly susceptible to fire blight infection and remain so until petal fall. 

Symptoms of flower infection include water-soaking, wilt and necrosis. The infection process 

typically begins with the epiphytic establishment of E. amylovora on the stigma surface; here, 

the bacteria rapidly multiply and can reach populations of 1x106-7 cfu/µl (Koczan et al., 2009). 

After stigma colonization, the bacteria use flagellar motility to migrate down the style into the 

hypanthium, or nectary, of the flower, a movement facilitated by rain or heavy dew (Thomson, 

2000). Natural openings at the base of the hypanthium called nectarthodes serve as the primary 

bacterial entry point into the tree where the pathogen uses type III secretion to initiate infections 

and begin moving systemically within the host. As the systemic infection progresses, the bacteria 

can also emerge via ooze to provide secondary inoculum for further infections.  

 

 Shoot blight is the result of secondary infection from blighted flowers or cankers 

(Vanneste, 2000). In addition to entry though flowers, the bacteria enter through natural openings 

in the shoot tips (hydathodes) or through wounds in damaged leaves. Symptoms of shoot 

infection are first observed as necrosis along the main leaf vein and culminate in the 

characteristic “shepherd’s crook” wilt. This is the direct result of biofilm formation in the xylem, 

which effectively blocks the movement of water (Koczan et al., 2009). Systemic infection and 

further movement in the trees is accomplished by E. amylovora cells migrating via intercellular 

 

6 

 

spaces in the cortical parenchyma utilizing type III secretion to cause plant cell death and 

provide energy resources for the bacteria.  Ultimately, infection can continue systemically into 

rootstocks, or spread into rootstocks through wounds, and can kill the tree in a single season.  

Carbohydrate zones in the apple tree  
 

The carbohydrate composition of pome flowers likely promotes the epiphytic survival 

and success of E. amylovora. In an analysis of stigma exudates, glucose and fructose were the 

predominant free sugars detected in all apple and pear varieties tested (Pusey et al., 2008). 

Although free glucose and fructose are minor components of stigma exudates in terms of mass, 

Pusey et al. (2008) suspect that these carbon sources are important for microbial growth. Free 

monosaccharide quantities available to bacteria were estimated to be greater than 3 µg, which the 

authors suggested is enough to support bacterial growth of 106 or 107 cfu per flower. Increases of 

glucose and fructose on the stigma were also found to occur at the same time as bacterial growth 

and sugar consumption.  

Analysis of free sugars in both stigma exudates and nectar from the same flower showed 

that sucrose is a major constituent of nectar while largely absent in stigma exudates (Pusey et al., 

2008). As the bacteria spread from the nectary into the vascular system of the tree, however, they 

encounter sorbitol, which is the predominant translocation carbohydrate of apple and pear trees 

(Aldridge et al., 1997). 

The findings above suggest that as E. amylovora cells first arrive on the stigma surface, 

they primarily consume glucose and fructose. As monosaccharides, these sugars likely serve as 

efficient sources of energy important for the initial bacterial population increase. As the bacteria 

move into the nectar-containing hypanthium of the flower, the sugar sucrose is readily available 

for consumption. Finally, the bacteria navigate through the nectarthodes and into the vascular 

 

7 

 

system of the tree, where they encounter sorbitol as the predominant carbohydrate. It is largely 

unknown how E. amylovora regulates the transitions between these three carbohydrate zones. 

Importance of sorbitol to fire blight infection 
 
 

Although sucrose is the predominant photosynthate of many plant species, rosaceous 

plants such as apple use the sugar sorbitol as the major transport carbohydrate. Less commonly 

known as glucitol, sorbitol is a sugar alcohol obtained by the reduction of glucose. In the 

Enterobacteriaceae, hexitols such as sorbitol are transported and phosphorylated by the 

phosphoenolpyruvate-dependent phosphotransferase system (PTS). In E. coli, the sorbitol PTS is 

encoded by the glucitol (gut) operon (Yamada & Saier, 1987). 

 

Through sequence comparison, a sorbitol-utilization operon was uncovered in E. 

amylovora that shares high similarity with the gut operon in E. coli; both are identical in length 

(Aldridge et al., 1997). The roles of individual genes of the sorbitol utilization operon in E. 

amylovora were elucidated, and the genes were named srlA, srlE, srlB, srlD, srlM and srlR in 

analogy with the gut operon of E. coli. 

In E. coli, gutA encodes the EIICB domain, which is responsible for sorbitol uptake 

(Aldridge et al., 1997). In E. amylovora, SrlA and SrlE are highly similar to GutA, indicating 

that the same domains are active in the EII complex. SrlB of E. amylovora is only 48% identical 

to GutB, which is the EIIA domain that phosphorylates the incoming carbohydrate. These 

changes in SrlB may increase its ability to accept a phosphate group from the histidine protein 

(HPr), which may be beneficial in the high-sorbitol environment of the apple tree. SrlM (68% 

similarity to GutM) and SrlR (75% similarity to GutR) are regulators of transcription in the srl 

operon of E. amylovora. The low homology of srlM to gutM may also be an adaptation to the 

high sorbitol concentrations encountered by E. amylovora. 

 

8 

 

Sorbitol mutants of E. amylovora displayed reduced symptom formation on apple shoots, 

but had no delay in infection of immature pears (Aldridge et al., 1997). The authors concluded 

that shoot infection could not take place due to the inability of the mutants to utilize sorbitol 

contained within the shoot tissues. The gut operon of E. coli was successfully able to 

complement the E. amylovora sorbitol mutants, restoring growth on sorbitol.  

Rubus-infecting strains of E. amylovora 
 

E. amylovora can be divided into two host-specific groupings: Strains that infect the sub-

family Spiraeoideae including apple, pear, hawthorn and quince, and strains that infect plants in 

the genus Rubus, including raspberry and blackberry (Goesmann et al., 2013). The Spiraeoideae-

infecting strains of E. amylovora are both genetically and phenotypically homogenous, whereas 

the Rubus-infecting strains exhibit greater genetic diversity (Momol & Aldwinckle, 2000). 

Genome comparison of a Rubus-infecting strain (ATCC BAA-2158) to an apple-infecting strain 

(CFBP 1430) revealed that 90% of the coding sequences are conserved between the two strains 

(Goesmann et al., 2013). In addition, no major differences exist in the amylovoran biosynthesis 

cluster or Rcs phosphorelay system of the two strains (Wang et al., 2009). 

 

Interestingly, the apple-infecting strains have the capability to infect both apple trees and 

plants in the Rubus genus, while the Rubus-infecting strains infect only Rubus plants and are not 

pathogenic to apple. In previous studies, Rubus-infecting strains were unable to cause disease in 

apple shoots, while some could cause infection in immature apple and pear fruit (Braun & 

Hildebrand, 2005; Ries & Otterbacher, 2005; Triplett et al., 2006).  

 

In order to find the host specificity factor of the Rubus-infecting strains of E. amylovora, 

the hrp pathogenicity islands of apple-infecting and Rubus-infecting isolates were compared 

(Asselin et al., 2011). The gene eop1 was determined to be particularly divergent between the 

 

9 

 

isolates, with only 73% identity. The cause of this divergence was a 21-base pair deletion in eop1 

of the Rubus-infecting isolate. In apple-infecting isolates, Eop1 is both secreted and translocated 

by the type III secretion system into plant cells but has no demonstrated virulence role. 

 

To assess the role of Eop1 in host specificity, eop1 mutants were created in both the 

Rubus and apple-infecting strains (Asselin et al., 2011). The authors determined that the eop1 

deletion mutant of the Rubus isolate gained virulence in immature pear fruit and no longer 

exhibited delay in symptom development as compared with the wild-type Rubus strain. A 

transposon insertion mutant of the eop1 gene in the apple-infecting strain, however, showed no 

altered symptoms to the wild-type apple strain. Due to the gain-of-virulence phenotype produced 

by the eop1 deletion in the Rubus-infecting strains, the authors concluded that Eop1 in Rubus 

isolates is a host range-limiting factor.  

Expression of the eop1 gene from a Rubus strain in an apple strain reduced its virulence, 

providing further evidence that this gene serves as a host range-limiting factor (Asselin et al., 

2011). The authors reported that at 7 days post inoculation, shoots inoculated with this altered 

apple strain had no measurable lesions. Additionally, eop1 was not found necessary for virulence 

of either E. amylovora strain in raspberry plants. Over-expression of the apple eop1 did not 

change the virulence of either strain.  

 

While a gain-of-virulence phenotype was seen in immature pear fruit, the deletion of 

eop1 was never successful in making the Rubus mutant an aggressive pathogen of apple shoots 

(Asselin et al., 2011). The authors concluded, “…Rubus strains must harbor other avirulence 

genes or lack factors necessary to effectively infect apple shoots”. Sucrose is the predominant 

sugar within raspberry canes, while sorbitol is the most abundant translocation carbohydrate in 

 

10 

 

apple (Bieleski, 1977). The authors did not explore this difference as a potential reason for Rubus 

isolate’s failure to infect apple.  

Authors Braun and Hildebrand (2005) sought to determine whether sorbitol and sucrose 

play a role in cross-infection for apple and raspberry isolates. Because apple isolates are equally 

virulent on apple, which contains predominantly sorbitol, and raspberry, which contains mostly 

sucrose, the authors concluded that sucrose does not play a role in host specificity. The authors 

also concluded that sorbitol does not influence host specificity because apple isolates can infect 

apple flowers. While no relationship was found between the pathogenicity of apple and raspberry 

isolates and host sugar content, the study predates the Eop1 study completed by Asselin et al. 

Braun and Hildebrand therefore lacked a key piece of information on Eop1 as a host-limiting 

factor in Rubus isolates. 

Small RNAs (sRNAs) as bacterial regulators 
 

Bacteria frequently experience abrupt environmental changes like fluctuations in 

available nutrients, and rapid physiological response to these changes requires swift coordination 

of regulatory networks. Such regulation is often mediated by small RNAs (sRNAs), which can 

be divided into four main classes: cis-encoding RNAs, trans-encoded RNAs, CRISPRs and 

RNAs that modulate protein activity (Storz et al., 2011). The largest known class of sRNA 

regulators are trans-encoded sRNAs, which control mRNA translation and stability by base 

pairing with the target mRNA. Trans-encoded sRNAs function by binding to the 5’ UTR of the 

target mRNA, which blocks the ribosome-binding site (RBS) and inhibits translation (Sharma et 

al., 2007). The sRNA-mRNA duplex is subsequently degraded by RNase E, which reinforces 

translational repression and makes it irreversible (Massé et al., 2003). While most regulation by 

trans-encoded sRNAs in negative (Aiba, 2007; Gottesman, 2005), sRNAs can also activate the 

 

11 

 

expression of an mRNA by preventing formation of an RBS-inhibitory secondary structure 

(Hammer & Bassler, 2007). 

 

Unlike cis-encoded sRNAs, which have extended regions of complementarity with their 

target mRNAs, trans-encoded sRNAs undergo discontinuous base pairing with targets. Only a 

fraction of nucleotides in the sRNA-mRNA interaction are necessary for regulation, and the 

region of base pairing typically involves only about 10 – 25 nucleotides (Kawamoto et al., 2006). 

In addition, the chromosomal locations of trans-encoded sRNAs and their targets are not 

correlated, and each sRNA can base pair with multiple mRNAs (Gottesman, 2005). Most trans-

encoded sRNAs are highly expressed under specific growth conditions, such as in the presence 

or absence of certain nutrients, sugar phosphate accumulation and oxidative stress (De Lay et al., 

2013).  

sRNA chaperone Hfq 
 

The RNA chaperone Hfq facilitates efficient base pairing between the sRNA and mRNA 

(Waters & Storz, 2009), an important role due to the limited complementarity between sRNAs 

and mRNAs (Aiba, 2007; Valentin-Hansen et al., 2004). Although the exact mechanism is 

unknown, it is thought that Hfq serves as a platform to allow sRNAs and mRNAs to test their 

complementarity, which increases the likelihood of base pairing. The Hfq protein is a ring-

shaped hexamer with two distinct surfaces, the proximal side and the distal side, which bind 

specific sequences in sRNAs and mRNAs (Schumacher et al., 2002; Link et al., 2009). The 

proximal side binds U-rich sequences often contained in sRNAs, while the distal side binds 

mRNAs. It is not known, however, if all mRNAs must bind Hfq to be regulated by Hfq (Biesel 

& Storz, 2011). Each Hfq hexamer binds only one sRNA and one mRNA at one time 

(Updegrove et al., 2011). Over 100 sRNAs have been identified in E. coli, and all trans-encoded 

 

12 

 

sRNAs require Hfq to regulate a target mRNA; sRNAs completely lose regulation of their target 

mRNAs in the absence of Hfq, as the chaperone protects unpaired sRNAs from RNase attack 

(Vogel & Luisi, 2011).  

sRNAs as regulators of sugar metabolism in E. coli 
 
 

The ability to rapidly coordinate regulatory networks is crucial for bacteria to take 

advantage of energy sources present in an environment. In E. coli, several sRNAs are known to 

control sugar uptake and metabolism, including Spot 42 and SgrS. The former is a 109 

nucleotide-long sRNA encoded by the spf (spot 42) gene, and is broadly conserved within the 

Enterobacteriaceae family. Under in vitro conditions, null mutants of spf are viable, indicating 

that Spot 42 is non-essential (Hatfull & Joyce, 1986). In E. coli, Spot 42 plays an important role 

as a regulator of carbohydrate metabolism and uptake. The sRNA works synergistically with 

catabolite repression as part of a feedforward loop with the catabolite repressor protein (CRP), a 

central regulator in catabolite repression. 

 

When a variety of carbon sources are present in an environment, catabolite repression 

allows bacteria to prioritize the consumption of specific sugars. Energetically efficient 

monosaccharides such as glucose are typically utilized first. In E. coli, the Spot 42 sRNA 

contributes to catabolite repression by accelerating repression of secondary carbohydrate 

utilization genes when glucose is present. Spot 42 reduces leaky expression of certain secondary 

sugar utilization genes, which helps to divert metabolic energy and resources towards the 

consumption of glucose.  

 Spot 42 was found to accumulate in the presence of glucose and decrease in cells grown 

in secondary carbon sources (Sahagan & Dahlberg, 1979). This direct response to glucose is due 

to the repression of spf by the cAMP-CRP complex under low glucose conditions (Polayes et al., 

 

13 

 

1988). When glucose is present, levels of the second messenger cyclic AMP (cAMP) are low and 

spf is not repressed. When secondary carbon sources are predominant (no glucose), the cAMP-

CRP complex binds to the spf promoter, which negatively regulates transcription of Spot 42 

(Bækkedal & Haugen, 2015). 

 

Authors Biesel and Stroz demonstrated through reporter fusions and microarray analysis 

that at least fourteen operons are regulated by Spot 42 (2011). A number of these operons 

contain genes implicated in the utilization of non-preferred carbohydrates. The Spot 42 sRNA 

was found to repress levels of the srlA mRNA, which is the first gene of the sorbitol operon and 

responsible for sorbitol uptake. Over-expression of Spot 42 limited growth on medium 

containing sorbitol (Biesel & Storz, 2011). 

sRNAs in E. amylovora 
 

 

Approximately 40 Hfq-dependent sRNAs were identified in E. amylovora via RNA-seq 

analysis and a Rho-independent terminator search (Zeng & Sundin, 2014). Analysis of hfq 

deletion mutants of E. amylovora indicate that Hfq and the sRNAs it regulates function as 

regulators of virulence traits like biofilm production, type III secretion and motility (Zeng et al., 

2013). Of the total Hfq-dependent sRNAs expressed at 12 hrs in Hrp-inducing minimal medium, 

10% of the total sRNA reads were the Spot 42 sRNA (Zeng & Sundin, 2014). In E. amylovora, 

the Spot 42 deletion mutant was not affected in motility, amylovoran production, biofilm 

formation, nor hypersensitive response on tobacco (Zeng & Sundin, 2014). As detailed above, 

the Spot 42 sRNA in E. coli is known to contribute to catabolite repression. It is not known, 

however, whether Spot 42 regulates sugar utilization in E. amylovora.  

 

 

 

14 

 

Objectives 
 

The objectives of my Masters research are 1) to characterize the sorbitol utilization genes 

in E. amylovora and to determine their effect on virulence traits 2) to evaluate the role of Spot 42 

and other regulatory sRNAs on sugar utilization as E. amylovora infects the apple host and 3) to 

determine if sorbitol utilization is an additional factor in host specificity of the Rubus-infecting 

strains.  

 

 

 

15 

 

REFERENCES

 

16 

 

REFERENCES 

 
 
Aiba, H. (2007) Mechanism of RNA silencing by Hfq-binding small RNAs. Current Opinion in 

Microbiology, 10, 134-139. 

 
Asselin, J. E., Bonasera, J. M., Kim, J. F., Oh, C.-S., and Beer, S. V. (2011) Eop1 from a Rubus 

strain of Erwinia amylovora functions as a host-range limiting factor. Phytopathology, 
101, 935-944.  

 
Aldridge, P., Metzger, M. and Geider, K. (1997) Genetics of sorbitol metabolism in Erwinia 

amylovora and its influence on bacterial virulence. Molecular and General Genetics, 256, 
611-619. 

 
Bækkedal, C. and Haugen, P. (2015) The Spot 42 RNA: A regulatory small RNA with roles in 

the central metabolism. RNA Biology, 12, 1071-1077. 

 
Bayot, R.G., and Ries, S.M. (1987) Role of motility in apple blossom infection by Erwinia 

amylovora and studies of fire blight control with attractant and repellant compounds.  
Phytopathology, 76, 441-445. 

 
Beisel, C. L. and Storz, G. (2011) The base-pairing RNA spot 42 participates in a multioutput 

feedforward loop to help enact catabolite repression in Escherichia coli. Molecular Cell, 
41, 286-297. 

 
Bellemann, P. and Geider, K. (1992) Localization of transposon insertions in pathogenicity 

mutants of Erwinia amylovora and their biochemical characterization. Journal of General 
Microbiology, 138, 931-940. 

 
Bereswill, S., Jock, S., Bellemann, P. and Geider, K. (1998) Identification of Erwinia amylovora 

by growth morphology on agar containing copper sulfate and by capsule staining with 
lectin. Plant Disease, 82, 158-164. 

 
Bieleski, R.L. (1977) Accumulation of sorbitol and glucose by leaf slices of Rosaceae. Aust. J. 

Plant Physiology. 4, 11–24. 

 
Bonn, W. G. and Van der Zwet, T. (2000) Distribution and economic importance of fire blight. 

In: Fire blight: the disease and its causative agent, Erwinia amylovora. (Vanneste, J., 
ed.). New York: CABI Publishing, pp. 37-53. 

 
Braun, P. G. and Hildebrand, P. D. (2005) Infection, carbohydrate utilization, and protein 

profiles of apple, pear, and raspberry isolates of Erwinia amylovora. Canadian Journal of 
Plant Pathology, 27, 338-346. 

 
De Lay, N., Schu, D. J. and Gottesman, S. (2013) Bacterial small RNA-based negative 

regulation: Hfq and its accomplices. Journal of Biological Chemistry, 288, 7996-8003. 

 

17 

 

 
Eden-Green, S. J. and Billing, E. (1974) Fireblight. Review of Plant Pathology, 53, 353-365. 
Gottesman, S. (2005) Micros for microbes: Non-coding regulatory RNAs in bacteria. Trends in 

Genetics. 21, 399–404. 

 
Hatfull, G. F. and Joyce, C. M. (1986) Deletion of the spf (spot 42 RNA) gene of Escherichia 

coli. Journal of Bacteriology, 166, 746-750. 

 
Kawamoto, H., Koide, Y., Morita, T., and Aiba, H. (2006) Base-pairing requirement for RNA 

silencing by a bacterial small RNA and acceleration of duplex formation by Hfq. 
Molecular Microbiology. 61, 1013–1022. 

 
Koczan, J. M., Lenneman, B. R., McGrath, M. J. and Sundin, G. W. (2011) Cell surface 

attachment structures contribute to biofilm formation and xylem colonization by Erwinia 
amylovora. Applied and Environmental Microbiology, 77, 7031-7039. 

 
Koczan, J. M., McGrath, M. J., Zhao, Y. and Sundin, G. W. (2009) Contribution of Erwinia 

amylovora exopolysaccharides amylovoran and levan to biofilm formation: Implications 
in pathogenicity. Phytopathology, 99, 1237-1244. 

 
Link T.M., Valentin-Hansen P., Brennan R.G. (2009) Structure of Escherichia coli Hfq bound to 

polyriboadenylate RNA. Proceedings of the National Academy of Sciences USA, 106, 
19292–19297.  

 
Long, T. et al. (2009) Quantifying the integration of quorum-sensing signals with single-cell 

resolution. PLoS Biology, 7, 640649. 

 
Longstroth, M. (2001) The 2001 fire blight epidemic in southwest Michigan orchards. The 

Compact Fruit Tree, 31, 16-19. 

 
Maes, M., et al (2001) Influence of amylovoran production on virulence of Erwinia amylovora 

and a different amylovoran structure in E. amylovora isolates from Rubus. European 
Journal of Plant Pathology, 107, 839-844.  

 
Malnoy, M., et al. (2012) Fire blight: applied genomic insights of the pathogen and host. Annual 

Review of Phytopathology, 50, 475-494. 

 
Mann, R. A., Smits, T. H., Bühlmann, A., Blom, J., Goesmann, A., et al. (2013) Comparative 

genomics of 12 strains of Erwinia amylovora identifies a pan-genome with a large 
conserved core. PLoS ONE, doi:10.1371/journal.pone.0055644. 

 
Massé, E., Escorcia, F. E. and Gottesman, S. (2003) Coupled degradation of a small regulatory 
RNA and its mRNA targets in Escherichia coli. Genes & Development, 17, 2374-2383. 

 

 

18 

 

Momol M.T., Aldwinckle H.S. (2000) Genetic diversity and host range of Erwinia amylovora. 

In: Vanneste J.L., editor. Fire Blight: The Disease and its Causative Agent. Wallingford, 
UK: CAB International. 55–72. 

Myung, I. S., et al (2016) Fire blight of apple, caused by Erwinia amylovora, a new disease in 

Korea. Plant Disease, 100(8), 1774-1774. 

 
Nimtz, M., et al (1996) Structure of amylovoran, the capsular exopolysaccharide from the fire 

blight pathogen Erwinia amylovora. Carbohydrate Research, 287:59-76. 

 
Norelli, J. L., Jones, A. L. and Aldwinckle, H. S. (2003) Fire blight management in the twenty-

first century: using new technologies that enhance host resistance in apple. Plant Disease, 
87, 756-765. 

 
Oh, C. and Beer, S. V. (2005) Molecular genetics of Erwinia amylovora involved in the 

development of fire blight. FEMS Microbiology Letters, 253, 185-192. 

 
Papenfort, K. and Vogel, J. (2011) Sweet business: Spot42 RNA networks with CRP to modulate 

catabolite repression. Molecular Cell, 41, 245-246. 

 
Polayes, D. A., Rice, P. W., Garner, M. M. and Dahlberg, J. E. (1988) Cyclic AMP-cyclic AMP 

receptor protein as a repressor of transcription of the spf gene of Escherichia 
coli. Journal of bacteriology, 170, 3110-3114. 

 
Pusey, P. L. and Curry, E. A. (2004) Temperature and pomaceous flower age related to 

colonization by Erwinia amylovora and antagonists. Phytopathology, 94, 901-911. 

 
Pusey, P. L., Rudell, D. R., Curry, E. A. and Mattheis, J. P. (2008) Characterization of stigma 

exudates in aqueous extracts from apple and pear flowers. HortScience, 43, 1471-1478. 

 
Rappaport, F. and Henig, E. (1952) Media for the Isolation and Differentiation of Pathogenic 

Bacteria E. coli (Serotypes O 111 and O 55). Journal of Clinical Pathology, 5, 361. 

 
Raymundo, A.K., and Ries, S.M. (1981) Motility of Erwinia amylovora.  Phytopathology, 71, 

45-49. 

 
Ries, S. M. and Otterbacher, A. G. (1977) Occurrence of fire blight on thornless blackberry in 

Illinois. Plant Disease Report, 61, 232-235. 

 
Sahagan, B. G. and Dahlberg, J. E. (1979) A small, unstable RNA molecule of Escherichia coli: 

spot 42 RNA: Nucleotide sequence analysis. Journal of Molecular Biology, 131, 573-
592. 

 
Schroth, M. N., Thompson, S. V., Hildebrand, D. C., and Moller, W. J. (1974) Epidemiology and 

control of fire blight. Annual Review of Phytopathology, 12, 389-412. 

 

 

19 

 

Schumacher M.A., Pearson R.F., Muller T., Valentin-Hansen P., Brennan R.G. (2002) Structures 

of the pleiotropic translational regulator Hfq and an Hfq-RNA complex: a bacterial Sm-
like protein. EMBO J 21: 3546–3556. 

Sharma, C. M., Darfeuille, F., Plantinga, T. H., and Vogel, J. (2007) A small RNA regulates 

multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of 
ribosome-binding sites. Genes and Development. 21, 2804–2817. 

 
Sjulin, T. M. and Beer, S. V. (1978) Mechanism of wilt induction by amylovorin in cotoneaster 

shoots and its relation to wilting of shoots infected by Erwinia amylovora. 
Phytopathology, 68, 89-94. 

 
Slack, S. M., et al., (2017) Microbiological examination of Erwinia amylovora 

exopolysaccharide ooze. Phytopathology, 107, 403-411. 

 
Storz, G., Vogel, J. and Wassarman, K. M. (2011) Regulation by small RNAs in bacteria: 

expanding frontiers. Molecular Cell, 43, 880-891. 

 
Thomson, S. V. (2000) Epidemiology of Fire Blight In: Fire blight: the disease and its causative 

agent, Erwinia amylovora. (Vanneste, J., ed.). New York: CABI publishing, pp. 9 - 36. 

 
Triplett, L. R., Melotto, M. and Sundin, G. W. (2009) Functional Analysis of the N Terminus of 

the Erwinia amylovora Secreted Effector DspA/E Reveals Features Required for 
Secretion, Translocation, and Binding to the Chaperone DspB/F. Molecular Plant-
Microbe Interactions, 22, 1282-1292. 

 
Triplett, L. R., Zhao, Y., and Sundin, G. W. (2006) Genetic differences between blight-causing 

Erwinia species with differing host specificities, identified by suppression subtractive 
hybridization. Applied and Environmental Microbiology, 72, 7359-7364. 

 
Updegrove, T. B., Correia, J. J., Chen, Y., Terry, C. and Wartell, R. M. (2011) The stoichiometry 

of the Escherichia coli Hfq protein bound to RNA. RNA, 17, 489–500. 

 
Valentin-Hansen, P., Eriksen, M., and Udesen, C. (2004) The bacterial Sm-like protein Hfq: A 

key player in RNA transactions. Molecular Microbiology 51, 1525–1533. 

 
Vanneste, J. (2000) What is fire blight? Who is Erwinia amylovora? How to control it? In: Fire 
blight: the disease and its causative agent, Erwinia amylovora. (Vanneste, J., ed.). New 
York: CABI Publishing, pp. 1-6. 

 
Vogel J. and Luisi B.F. (2011) Hfq and its constellation of RNA. Nature Reviews Microbiology, 

9, 578–589. 

 
Wang D., Korban S.S., Zhao Y. (2009) The Rcs phosphorelay system is essential for 

pathogenicity in Erwinia amylovora. Molecular Plant Pathology, 10, 277–290. 

 
Waters, L. S. and Storz, G. (2009). Regulatory RNAs in bacteria. Cell, 136, 615-628. 

 

20 

 

 
Yamada, M. and Saier, M. H. (1987) Glucitol-specific enzymes of the phosphotransferase 

system in Escherichia coli. Nucleotide sequence of the gut operon. Journal of Biological 
Chemistry, 262, 5455-5463. 

 
Zeng, Q. and Sundin, G. W. (2014) Genome-wide identification of Hfq-regulated small RNAs in 

the fire blight pathogen Erwinia amylovora discovered small RNAs with virulence 
regulatory function. BMC Genomics, 15, 414. 

 
Zeng, Q. McNally, R. R., & Sundin, G. W. (2013) Global small RNA chaperone Hfq and 

regulatory small RNAs are important virulence regulators in Erwinia amylovora. Journal 
of Bacteriology, 195, 1706-1717. 

 
Zhao, Y., Blumer, S. E. and Sundin, G. W. (2005) Identification of Erwinia amylovora genes 
induced during infection of immature pear tissue. Journal of Bacteriology, 187, 8088-
8103. 

 
Zhao, Y., Sundin, G. W. and Wang, D. (2009) Construction and analysis of pathogenicity island 
deletion mutants of Erwinia amylovora. Canadian Journal of Microbiology, 55, 457-464. 

 

 

 

21 

 

 

 

Chapter 2. Sorbitol utilization by E. amylovora 

 

22 

 

Abstract 

 

Fire blight, caused by the gram-negative bacterium Erwinia amylovora, is a destructive 

disease of apple and pear trees worldwide. A unique aspect of apple and pear physiology is the 

use of sorbitol rather than sucrose as the predominant translocation carbohydrate. Mutants of E. 

amylovora, with deletions of one or more of the sorbitol utilization (srl) genes, are unable to 

cause significant fire blight symptoms on apple shoots. It is unknown, however, whether sorbitol 

utilization influences the production of other virulence factors in E. amylovora such as 

amylovoran expolysaccharide (EPS) or other virulence traits such as biofilm formation. In this 

study, deletion mutants were generated of srlA, srlAEBDMR and srlMR in E. amylovora Ea1189, 

and the ability of each mutant to cause symptoms in apple shoots and immature pear fruit was 

examined; the ability of each mutant to produce amylovoran EPS and to form biofilms was also 

examined. The findings of this study indicate that the Ea1189ΔsrlA and Ea1189ΔsrlAEBDMR 

mutants are unable to obtain the energy base needed to infect apple shoots and immature pear 

fruit. Amylovoran production was reduced in the srl mutants, while biofilm formation was 

unaffected. The Ea1189ΔsrlMR mutant, which had lost regulation of the srl operon, could infect 

apple shoots and immature pear fruit, although virulence was reduced compared to the wild type. 

This intermediate phenotype was also observed in amylovoran production, with reduced 

amylovoran levels compared to the wild type. As with the other srl mutants, the Ea1189ΔsrlMR 

strain was unaffected in biofilm formation.  

 

 

 

23 

 

I. Introduction 

 

Erwinia amylovora, a gram-negative plant pathogenic bacterium, is the causal agent of 

fire blight in rosaceous species. The pathogen enters the host through flowers or natural openings 

in shoot tips and establishes systemic infections. Several pathogenicity and virulence factors of 

E. amylovora have been characterized, including amylovoran exopolysaccharide (EPS) 

production, biofilm formation, motility and type III secretion (Malnoy et al., 2012). Amylovoran 

EPS is a large component of ooze droplets, which protect bacterial cells against desiccation and 

are the primary mode of E. amylovora dispersal in orchards (Thomson, 2000). Additionally, 

amylovoran is required for the formation of biofilms, which physically block the movement of 

water in xylem vessels, leading to wilt symptoms (Sjulin & Beer, 1978). Motility, another 

virulence factor, facilitates flower infection by enabling migration down the floral stigma and 

into the nectarthodes, which serve as an entry point into the host. Another key pathogenicity 

determinant of E. amylovora is the type III secretion system, which is widespread in gram-

negative bacterial pathogens and consists of a needle-like apparatus that delivers effector 

proteins into the host cytoplasm (Oh & Beer, 2005). DspE is one such effector, and its secretion 

is required for fire blight symptom development (Triplett et al., 2009).  

 

 

Sorbitol utilization mutants of E. amylovora are unable to establish disease in 

apple shoots (Aldridge et al., 1997). In these mutants, symptom development is as equally 

hindered as in mutants of amylovoran EPS production, biofilm formation, motility and T3SS. 

Metabolism and carbohydrate utilization are not often considered virulence determinants; in rich 

medium, the sorbitol utilization operon is not essential. However, in nutrient-limited 

environments, such as found in apple shoots, sorbitol utilization is necessary for the survival and 

 

24 

 

spread of E. amylovora. In the host environment, sorbitol utilization can be considered a type of 

alternate virulence factor.  

In this study, I further explored the role of the sorbitol utilization genes to determine 

whether loss of sorbitol utilization affects other virulence factors. I constructed sorbitol 

utilization operon mutants and measured their ability to produce amylovoran, form biofilms, and 

infect immature pears and apple shoots. Direct measurements of motility and type III secretion 

were not deemed relevant to sorbitol utilization. I hypothesized that 1) mutants deficient in 

sorbitol utilization would not establish infection in immature pear and apple shoots 2) 

amylovoran production would be reduced in the srl mutants, and 3) biofilm formation would 

either be disrupted or reduced compared to the wild type.  

In addition, I conducted qRT-PCR analysis to measure expression levels of the sorbitol, 

sucrose and glucose uptake genes in minimal medium containing 1% sorbitol, 1% sucrose, or 

0.5% glucose + 0.5% sorbitol. I hypothesized that the sorbitol uptake gene srlA would be highly 

expressed in sorbitol medium but not in the 0.5% glucose + 0.5% sorbitol medium due to 

catabolite repression. Additionally, I hypothesized that the glucose uptake gene ptsG would be 

highly expressed in all conditions. 

 

 

 

25 

 

II. Materials and Methods 

 
Bacterial strains and growth conditions 
 
 

The bacterial strains and plasmids used in this study, and their relevant characteristics, 

are listed in Table 1.1. Unless otherwise noted, E. amylovora strain Ea1189 and sorbitol 

utilization mutants were grown in Luria-Bertani (LB) broth and plates at 28°C. Growth curves of 

relevant strains with sorbitol as the sole carbon source were conducted in 1% sorbitol minimal 

medium [per liter: 4.0 g L-Asparagine, 2.0 g K2HPO4, 0.2 g MgSO4-7H2O, 3.0 g NaCl, 0.2 g 

nicotinic acid, 0.2 g thiamin HCl, 10 g sorbitol] as previously described (Bereswill, 1998), and 

sorbitol fermentation analysis was conducted on MacConkey sorbitol indicator plates [per liter: 

20 g peptone, 10 g sorbitol, 5.0 g NaCl, 0.03 g phenol red] as previously described (Rappaport & 

Henig, 1952). Amylovoran quantification assays were performed in MBMA medium [per liter: 

0.03 g MgSO4, 0.5 g citric acid, 1 g (NH4)2SO4, 2 ml glycerol, 3 g KH2PO4,7g K2HPO4, 10 g 

sorbitol], and biofilm assays were conducted in 0.5xLB medium. Media were amended with 

chloramphenicol (Cm) at 20 µg/ml and ampicillin (Ap) at 50 µg/ml as needed. 

 

 

 

26 

 

Table 2.1. Bacterial strains, plasmids and primers used in Chapter 2 

Strain or 
plasmid 
 
Ea1189 

Characteristics 

Wild type 

Ea1189∆srlA 

srlA deletion mutant 

Ea1189∆srlM
R 
Ea1189∆srlA
EBDMR 
Ea1189∆scrK 

srlMR deletion mutant 

srlAEBDMR deletion mutant 

scrK deletion mutant 

Ea1189∆ams 

ams operon deletion mutant 

pKD3 

Contains Cm cassette and flanking FRT sites; CmR 

pTL18 

IPTG-inducible FLPase; TetR 

pKD46 

L-arabinose inducible lambda-red recombinase, ApR 

Primer 

Sequence 

 

 

srlA 
mutagenesis F 
srlA 
mutagenesis 
R 
srlMR 
mutagenesis F 

srlMR 
mutagenesis 
R 
srlAEBDMR 
mutagenesis F 

srlAEBDMR 
mutagenesis 
R 
scrK 
mutagenesis F 

 

 

5’ –ATGATTGAAGCTATCACA CATGGGGCCGAATGGTTTATCG 

GTCTTTTCCAGTGTAGGCTGGAG CTGCTTC - 3’ 

5’ – TTATAGATGC  ACTGATTTATCAAGTTTG 

ATGCCCATCTTTTTCTCAAAAACATATGAATATCCTCCTTA – 3’ 

5’ –ATGGATGCAACG AATACGCTGATATTGCTGGCCG 

TGACGGCCTGGGTAGGGTGTAGGCTGGAGCTGCTTC – 3’ 

 

5’ –TCAGTCCTCTCCTGCAGT GATGACGCTGATATTC 
ATCCCTGACAGCTGTTCATATGAATATCCTCCTTA – 3’ 

5’ –ATGATTGAAGCTATCA CACATGGGGCCGAATG 

GTTTATCGGTCTTTTCCAGTGTAGGCTGGAGCTGCTTC – 3’ 

 

5’ –TCAGTCCTCTCCTGCAGTGATGACGCTGATAT 

TCATCCCTGACAGCTGTTCATATGAATATCCTCCTTA - 3’ 

5’ –ATGAAAAAAAGAATCTG GGTGTTAGGTGATGCG 

GTGGTGGACTTGCTTCCGTGTAGGCTGGAGCTGCTTC – 3’ 

27 

Source 

(Burse et 
al., 2004) 
This 
study 
This 
study  
This 
study 
This 
study 
(Zhao et 
al., 2009) 
(Datsenk
o & 
Wanner, 
2000) 
(Long et 
al., 2009) 
(Datsenk
o & 
Wanner, 
2000) 
Source
 
This 
study 
This 
study 

This 
study 

This 
study 

This 
study 

This 
study 

This 
study 

 

This 
study 

This 
study 
This 
study 
This 
study 
This 
study  
This 
study 
This 
study 
This 
study 

This 
study 

 

Table 2.1. (cont’d) 

scrK 
mutagenesis 
R 

 

GGTCTTTAGCGTAAGGCAGGGCGGTCATAGCATATGAATATCC

5’ –CTACTGGCTGAAGCGGACGA 

TCCTTA - 3’ 

ptsG qPCR F 

5’ – TGGCATACGGGATTATGGTT – 3’ 

ptsG qPCR R 

5’ – GAAACGTTTACCCGCAAAAA – 3’ 

 

scrK qPCR F 

5’ – GAGCTGGCAGACATCATCAA – 3’ 

scrK qPCR R 

5’ – GGCACCGGTAGTATCCGTTA – 3’ 

 

srlA qPCR F 

5’ – CGGAGAAATACAAGCCAAGC – 3’ 

srlA qPCR R 

5’ – GTAGCTCACGGCAAGAGGTC – 3’ 

srlABEDMR 
complement
-ation F 
srlABEDMR 
complement
-ation R 

5’ –CCCGACTGGAAAGCGGGCA 

GTGGATTACGAATTTTGACAGGCTC – 3’ 

5’ -  GTTGCGTCGCGGTGCATGG 
GAGGATGCTGAGTAGCGCTG  - 3’ 

 

28 

 
 

 

 

Construction of chromosomal mutants 
 
 

Deletion mutants of scrK, srlA, srlMR and srlAEBDMR were constructed using the λ Red 

recombinase system (Datesenko & Wanner, 2000). In short, the 1.1-kb chloramphenicol 

resistance (CmR) cassette was amplified from plasmid pKD3 using primers homologous to both 

20 bp of the CmR cassette and to 50 bp upstream and downstream of the target gene. In pKD3, 

the CmR cassette is flanked by directly repeated flippase recognition target (FRT) sites, which 

facilitate site-directed recombination. The amplified regions were then purified and introduced 

into E. amylovora containing the pKD46 plasmid by electroporation. The pKD46 plasmid 

expresses the Red system (λ, ß, exo recombinase genes). Colonies were then selected on LB 

plates containing Cm and Ap, and mutants were confirmed by colony PCR using primers 

targeting regions 500 bp upstream and downstream of the mutation. To remove the Cm 

resistance cassette, the deletion mutants were transformed with the plasmid pTL18, which 

encodes an IPTG-inducible site-specific recombinase that prompts recombination between the 

FRT sites, leading to excision of the Cm resistance cassette. The loss of the cassette was tested 

via Cm sensitivity and colony PCR with the primers used to confirm the mutant. 

CPC-binding assay for quantification of amylovoran production 
 
 

Amylovoran production was quantified via a previously described method (Bellemann & 

Geider, 1992; Zhao et al., 2009). Briefly, a 3 ml overnight culture of E. amylovora was pelleted 

and washed with 0.5x PBS. The pellet was resuspended in 3 ml MBMA containing 1% sorbitol. 

The culture was incubated at 28°C for 48 hrs, after which 1 ml of the culture was removed and 

pelleted. A total of 800 µl of the supernatant was placed into a new tube, mixed with 40 µl of 50 

mg/ml cetylpyridinium chloride (CPC), and shaken at 25°C for 10 min. The amylovoran 

concentration was determined by measuring the OD600 of the suspension normalized to the OD600 

 

29 

 

of the original culture. The Ea1189∆ams strain, which is unable to produce amylovoran, was 

used as a negative control (Zhao et al., 2009). The experiment was repeated at least three times. 

Biofilm formation assay 
 
 

Biofilm formation of each strain was quantified via a previously described method 

(Koczan et al., 2009). Glass coverslips were cut to size and placed into each well of a 24-well 

polystyrene microtiter plate after which 2 ml of 0.5xLB medium was added to each well, and 

then 100 µl of equilibrated bacterial culture was added. The plates were incubated at 28°C for 48 

h, after which the glass coverslips were removed and stained with 10% crystal violet for 1 h. The 

stained coverslips were then washed three times with water and left to dry at 25°C for 1 h. The 

crystal violet stain was removed from the coverslip in a 200 µl 40% methanol/10% acetic acid 

mixture, and the OD595 of the resulting solution was measured. The experiment was repeated at 

least three times. 

Determination of virulence using immature pear and apple shoot infection assays 
 
 

Virulence assays on immature Bartlett pears were performed as described previously 

(Zhao et al., 2005). Briefly, immature pears were surface sterilized with 10% bleach, rinsed with 

distilled water and air dried. Bacterial cultures were normalized to 1 x 104 CFU/ml in 0.5 x PBS. 

Each pear was stab-inoculated with 3 µl of the bacterial culture, and the pears were incubated at 

28°C under high humidity. The resulting lesions were measured 3, 4, 5 and 6 days post 

inoculation (DPI). A total of 10 replicates were included in each assay, and the experiment was 

repeated at least three times.  

 

Apple shoot infection assays were conducted as previously described (Koczan et al., 

2011). In short, cultures were suspended in 0.5xPBS at 2x108 CFU/ml. Young apple shoots 

(Malus X domestica cv. Gala) were inoculated by dipping scissors in the bacterial suspension 

 

30 

 

and using the dipped scissors to make a diagonal cut between the leaf veins of the youngest leaf. 

Necrosis was measured from 4 DPI to 10 DPI. The experiment was repeated twice with at least 

four replicates per experiment. 

Growth in sorbitol-containing minimal medium 
 
 

Bacterial growth rates were measured via automatic OD600 measurements on a Tecan 

Spark® microplate reader (Mannedorf, CH). Cultures were normalized to an OD600 of 0.2 in LB 

or 1% sorbitol minimal medium, and 100 µl of this suspension was deposited into each well of a 

96-well plate. The microplate reader was set to measure the OD600 every 30 min, and the cultures 

were shaken prior to each reading. The temperature remained at approximately 25°C over the 

course of the experiment. Each experiment was repeated at least 3 times.  

Analysis of sorbitol fermentation ability using MacConkey medium 

 

 

MacConkey indicator plates with 1% sorbitol were used to qualitatively analyze 

the ability of the mutant strains to ferment sorbitol. This medium is commonly used for the 

identification of E. coli 0157:H7, which is unable to ferment sorbitol. Phenol Red in the medium 

serves as a pH indicator; sorbitol fermentation is signaled by color change from red (> ~7.5) to 

yellow (< ~6.8) with intermediate shades of orange. 

qRT-PCR 
 
 

cDNA was synthesized from 1 µg of purified RNA using TaqMan® reverse transcription 

reagents (Applied Biosystems, Foster City, CA). Quantitative PCR (qPCR) was performed using 

the StepOnePlus Real-Time PCR system with SYBR® green master mix (Applied Biosystems). 

Thermal cycling conditions were as follows: 95°C for 10 min, 40 cycles of 95°C for 15 sec, 60°C 

for 1 min, followed by a final melting curve analysis step. Gene expression levels were analyzed 

using the relative quantification ∆∆Ct method. Expression levels of srlA, scrK and ptsG were 

 

31 

 

determined in each of three conditions: minimal medium containing 1% sorbitol, 1% sucrose, or 

0.5% glucose + 0.5% sorbitol. All analyses were performed with strain E. amylovora Ea1189. 

Cultures were grown overnight in % sorbitol, 1% sucrose, or 0.5% glucose + 0.5% sorbitol 

medium. The following day, the cultures were diluted and grown to exponential phase before 

RNA was extracted. Expression of the recA gene in E. amylovora Ea1189 grown in glucose 

medium was used as the endogenous gene control. 

 

 

 

32 

 

III. Results 

 
Sorbitol utilization mutants are reduced in growth in sorbitol-containing minimal medium 

 

Growth curves of strains Ea1189, Ea1189∆srlA, Ea1189∆srlMR and 

Ea1189∆srlAEBDMR were conducted to determine how the deletion of key sorbitol-utilization 

(srl) genes influenced growth under sorbitol conditions. As expected, growth of Ea1189 was 

basically unaffected in the 1% sorbitol minimal medium, with cultures reaching an OD600 of 

approximately 0.8 after 40 h (Fig 2.1). Mutant strains Ea1189∆srlA, with a deletion of the 

sorbitol uptake gene, and Ea1189∆srlAEBDMR, with a deletion of the entire sorbitol operon, 

were significantly reduced in growth in 1% sorbitol minimal medium compared to Ea1189. 

Ea1189∆srlMR, which harbors a deletion of both regulatory genes of the sorbitol utilization 

operon, was also significantly reduced in growth compared to Ea1189, but to a lesser extent than 

Ea1189∆srlA and Ea1189∆srlAEBDMR (Fig. 2.1). 

On MacConkey medium amended with 1% sorbitol, growth of the WT strain Ea1189 

resulted in the medium surrounding the bacterial cells turning yellow (pH < ~6.8), signaling the 

occurrence of sorbitol fermentation (Fig. 2.2). Additionally, Ea1189 cells growing on this 

medium are mucoid. In contrast, the Ea1189∆srlA and Ea1189∆srlAEBDMR mutants displayed a 

non-mucoid phenotype, and the surrounding medium remained red (pH > ~7.5), indicating that 

sorbitol fermentation was not taking place. The Ea1189∆srlMR mutant turned the surrounding 

medium orange, a phenotype intermediate to the Ea1189WT and the Ea1189∆srlA and 

Ea1189∆srlAEBDMR mutants.  

 

 

33 

 

Figure 2.1. Growth of E. amylovora Ea1189 and Ea1189∆srl gene mutants at RT in minimal 
medium containing 1% sorbitol.  

Data represent three biological replicates for each strain, and error bars denote the standard error 
of the mean.  

)
0
0
6
D
O

(
 
y
t
i
s
n
e
d

 
l
l
e
C

0.9

0.8

0.7

0.6

0.5

0.4

0.3

0.2

0.1

0

 

 

 

0

5

10

15

20

25

30

35

40

Time (hours)

Ea1189
Ea1189 

∆srlA

∆srlMR

∆srlAEBDMR

 

 

34 

 

Figure 2.2. Growth of Ea1189 and Ea1189∆srl gene mutants on MacConkey indicator plates 
containing 1% sorbitol. 

Sorbitol fermentation is signaled by color change from red (> ~7.5) to yellow (< ~6.8) with 
intermediate shades of orange. 

 
 

 

 

 

35 

 

Biofilm formation is not affected in the sorbitol utilization mutants 

 

To further explore the role of the sorbitol utilization genes in E. amylovora, I compared 

biofilm formation in Ea1189 to that of strains Ea1189∆srlA, Ea1189∆srlMR and 

Ea1189∆srlAEBDMR. No significant differences were observed in biofilm formation of the 

sorbitol utilization mutants (Fig. 2.3). It is important to note, however, that biofilm formation 

was observed in 0.5 x LB medium. Although considered a nutrient-limiting environment, this 

medium likely exposes the sorbitol-utilization mutants to diverse carbohydrates, thereby 

reducing any effects of the srl gene mutations. 

 

 

 

36 

 

Figure 2.3. Biofilm formation by Ea1189 srl mutants in 0.5x LB medium. 

Biofilm development was measured via quantification of crystal violet (CV) binding. Error bars 
signify standard errors of the mean; presence of the same letters above the bars indicate no 
statistically-significant difference observed (P > 0.05 by Student’s t test). 

5
9
5
D
O

0.6

0.5

0.4

0.3

0.2

0.1

0

 

 

Ea1189
Ea1189 

∆srlA

∆srlMR

∆srlAEBDMR

 

 

37 

 

Sorbitol utilization mutants are reduced in virulence on immature pears and apple shoots 

 

To determine the impact of sorbitol utilization on the virulence of E. amylovora, I 

inoculated immature pears with Ea1189, Ea1189∆srlA, Ea1189∆srlMR, Ea1189∆srlAEBDMR 

and the sucrose uptake mutant Ea1189∆scrK. The latter mutant was included because sucrose 

concentrations are expected to be low in immature pear fruit. The resulting lesions produced by 

each strain were compared over the course of 6 DPI. In all strains, lesions began to form around 

the point of inoculation at 4 DPI (Fig. 2.4). As hypothesized, the Ea1189∆srlA and 

Ea1189∆srlAEBDMR mutants exhibited significantly-reduced lesion sizes as compared to the 

WT. The sorbitol operon regulation mutant Ea1189∆srlMR displayed an intermediate phenotype, 

producing larger lesions than the other srl mutants that were still reduced compared to the WT 

(Fig. 2.4). The sucrose uptake mutant, Ea1189∆scrK, produced lesions similar in size to those of 

WT.  

To determine if the sorbitol utilization mutants would be reduced in virulence on other 

tissues, I inoculated apple shoots with WT, Ea1189∆srlA, Ea1189∆srlMR and 

Ea1189∆srlAEBDMR, and tracked the spread of infection over the course of 10 days.  The 

results mirrored those of the immature pear assay, except the Ea1189∆srlA and 

Ea1189∆srlAEBDMR mutants produced no symptoms aside from a very small area of necrosis 

around the inoculation site (Fig. 2.5). In contrast, the WT displayed severe tissue necrosis and 

migration through the central vein of the leaf over the course of the experiment. Again, the 

Ea1189∆srlMR mutant displayed a phenotype intermediate to the WT and the other srl mutants. 

 

 

 

38 

 

Figure 2.4. Virulence of Ea1189 srl mutant strains on immature pears.  

Diameters of lesions on immature pears inoculated with the indicated strains. Measurements 
taken day 3 to day 6 post inoculation. Error bars represent the standard errors. Different letters 
above the bars indicate statistically significant differences between the strains (P <0.05 by 
Student’s t test). 

 

3

2.5

2

1.5

1

0.5

0

)

m
c
(
 
r
e
t
e
m
a
i
d

 

n
o
i
s
e
L

a
a
a
a
a

3

 

a
a

a

b
b

a
a
b
c
c

a
a

ab

b

b

4

5

6

Days post inoculation (DPI)

Ea1189
Ea1189 

∆srlA

∆srlMR

∆srlAEBDMR

∆scrK

 

 

39 

 

 
 

 

 

Figure 2.5. Virulence of Ea1189 srl mutant strains on apple shoots.  

Lesion development on apple shoots from 4 to 10 days post inoculation. Error bars represent 
standard error of the mean. 

 

)

m
c
(
 

h
t
g
n
e
l
 

n
o
i
s
e
L

90
80
70
60
50
40
30
20
10
0

 

 

4

5

6

7

8

9

10

Days post inoculation (DPI)

WT
Ea1189 

∆srlMR

∆srlA

∆srl operon

∆srlAEBDMR 

 

 

40 

 

Amylovoran production is reduced in the sorbitol utilization mutants 
 
 

The CPC-binding assay was used to determine whether sorbitol utilization played a role 

in amylovoran production. Compared to the WT, the sorbitol utilization mutants were 

significantly reduced in amylovoran production, although levels were not as low as in the 

Ea1189∆ams mutant, which was deficient in amylovoran production (Fig. 2.6). Ea1189∆srlMR 

amylovoran production was intermediate to that of Ea1189∆srA and Ea1189∆srlAEBDMR.  

 

 

 

41 

 

Figure 2.6. Amylovoran production in srl gene mutants of E. amylovora. 

Ea1189∆ams was used as a negative control. Data represents 3 biological replicates, and error 
bars indicate the standard error of the means. Letters above each bar indicate statistically 
significant differences of the means (P <0.05 by Student’s t test). 
 

a

0.8

0.7

0.6

0.5

0.4

0.3

0.2

0.1

0

b

c

c

d

Ea1189

∆srlMR 
∆srlMR

∆srlA 
∆srlA

∆srlAEBDMR

∆srlAEBDMR 

∆ams 
∆ams

 

 

42 

e
r
u
t
l
u
c

0
0
6

/

D
O
C
P
C
0
0
6

D
O

 

 

 

srlA is highly expressed in 1% sorbitol medium and 0.5% glucose + 0.5% sorbitol medium 
 
 

Gene expression levels of srlA, scrK and ptsG in Ea1189 were analyzed in each of three 

conditions: 1% sorbitol, 1% sucrose or 0.5% sorbitol + 0.5% glucose. As anticipated, the sorbitol 

uptake gene srlA was highly expressed in the 1% sorbitol medium with a 65-fold increase as 

compared to the reference condition (Fig. 2.7A). Likewise, the sucrose uptake gene scrK was 

upregulated approximately 11-fold in 1% sucrose medium (Fig. 2.7B). I hypothesized that srlA 

would not be highly expressed in the 0.5% glucose + 0.5% sorbitol medium due to catabolite 

repression; however, I observed an approximately 10-fold increase of srlA as compared to the 

reference condition (Fig. 2.7B). The glucose uptake gene ptsG was constitutively expressed 

across all three conditions. 

 

 

 

43 

 

Figure 2.7. Expression of sorbitol, sucrose and glucose transporter genes (srlA, scrK and ptsG, 
respectively) of Ea1189 grown in sorbitol (A), sucrose (B) or 50% glucose, 50% sorbitol (C) 
medium. 

Cultures were grown overnight in 1% sorbitol, 1% sucrose or 0.5% sorbitol + 0.5% glucose 
medium at 28C and then were diluted in fresh medium. RNA was extracted at exponential phase. 
Expression data were normalized to recA in glucose medium. Error bars denote standard 
deviation of the mean, and results represent two biological replicates. 
 

 
 
 

A 
 

B 
 

n
o
i
s
s
e
r
p
x
e
 
e
n
e
g

 
e
v
i
t
a
l
e
R

80

70

60

50

40

30

20

10

0

n
o
i
s
s
e
r
p
x
e
 
e
n
e
g

 
e
v
i
t
a
l
e
R

16

14

12

10

8

6

4

2

0

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

srlA

scrK

ptsG

srlA

scrK

ptsG

44 

 

srlA

scrK

ptsG

 

12

10

4

2

0

8

6

 
e
v
i
t
a
l
e
R

C 
 

n
o
i
s
s
e
r
p
x
e
 
e
n
e
g

Figure 2.7. (cont’d) 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

45 

 

IV. Discussion 

 

The in vitro and in planta analyses demonstrated that the sorbitol utilization genes allow 

E. amylovora to obtain the energy base needed for infection most likely through enabling the 

synthesis of amylovoran, a critical pathogenicity factor that is required for infection. 

Ea1189∆srlA, the deletion mutant of the sorbitol uptake gene and Ea1189∆srlAEBDMR, the 

deletion of the entire sorbitol utilization operon and regulatory genes, exhibited dramatically 

reduced growth in minimal medium with sorbitol as the sole carbohydrate source. These mutants 

also displayed a “non-fermenting” phenotype on MacConkey sorbitol indicator plates, and 

bacterial growth of these strains was distinctly non-mucoid compared to the WT. The in vitro 

results were mirrored in vivo, where the Ea1189∆srlA and Ea1189∆srlAEBDMR mutants were 

severely reduced in virulence on immature pear fruit and apple shoots. Since sorbitol 

predominates in both plant tissues, the results suggest that the mutants cannot obtain the energy 

required for further infection. The mutant of the sorbitol operon regulatory genes, 

Ea1189∆srlMR, displayed an intermediate phenotype in both in vitro and in vivo tests. This 

indicates that loss of regulation of the operon interferes with the pathogen’s ability to respond to 

available sorbitol through activation of the sorbitol utilization genes.  

Both amylovoran production and biofilm formation are key virulence determinants in E. 

amylovora (Malnoy et al., 2012). The Ea1189∆srlA and Ea1189∆srlAEBDMR mutants exhibited 

significantly-reduced amylovoran production compared to the WT, while the Ea1189∆srlMR 

strain produced amylovoran levels intermediate to the WT and other mutants. 

Biofilm formation, however, was not significantly different in the WT and srl mutants. 

However, the half-strength LB medium used for the biofilm assay likely serves as an adequate 

source of nutrients, minimizing the negative effects of the defective sorbitol utilization operon. It 

is possible that biofilm formation by E. amylovora srl mutants would not be affected in leaf 

 

46 

 

xylem; however, since the Ea1189∆srlA and Ea1189∆srlAEBDMR mutants were essentially 

nonpathogenic after inoculation into apple leaves, the biofilm formation phenotype would 

become irrelevant. 

The sorbitol uptake gene srlA was highly expressed both in 1% sorbitol medium and in 

0.5% glucose + 0.5% sorbitol medium.  Because srlA gene activation is not inhibited by the 

presence of glucose, it is possible that sorbitol uptake in E. amylovora is not under catabolite 

repression. Glucose utilization does, however, seem to be critical for E. amylovora, because ptsG 

is constitutively expressed in all three media conditions. Future research could further explore 

the possibility that catabolite repression is absent in E. amylovora through additional qPCR 

studies evaluating conditions such as 0.5% glucose + 0.5% sucrose medium, or 0.5% sucrose + 

0.5% sorbitol medium.  

 

In conclusion, the type III secretion system and amylovoran production are known 

pathogenicity determinants, and motility and biofilm formation are known virulence 

determinants of E. amylovora. In the predominantly sorbitol-containing environment of the apple 

tree, the srl genes are necessary for full virulence and are thus an additional virulence factor. In 

this study, the Ea1189∆srlA and Ea1189∆srlAEBDMR mutants were growth-inhibited in 

sorbitol-containing minimal medium and significantly decreased in virulence on apple shoots 

and immature pear fruit. Loss of sorbitol utilization in a sorbitol environment was also found to 

reduce amylovoran formation. Although biofilm formation was not impaired in the srl mutants, it 

is likely that the 0.5 x LB medium used in the assay is not an accurate representation of the 

nutrient content of apple shoots. Future studies of biofilm formation in the srl mutants should 

amend the assay to mimic the high-sorbitol environment of the apple shoot.  

 

 

47 

 

REFERENCES

 

48 

 

REFERENCES 

 
 
Aldridge, P., Metzger, M. and Geider, K. (1997) Genetics of sorbitol metabolism in Erwinia 

amylovora and its influence on bacterial virulence. Molecular and General Genetics, 256, 
611-619. 

 
Bereswill, S., Jock, S., Bellemann, P. and Geider, K. (1998) Identification of Erwinia amylovora 

by growth morphology on agar containing copper sulfate and by capsule staining with 
lectin. Plant Disease, 82, 158-164. 

 
Datsenko, K. A. and Wanner, B. L. (2000) One-step inactivation of chromosomal genes in 

Escherichia coli K-12 using PCR products. Proceedings of the National Academy of 
Sciences USA, 97, 6640-6645. 

 
Koczan, J. M., Lenneman, B. R., McGrath, M. J. and Sundin, G. W. (2011) Cell surface 

attachment structures contribute to biofilm formation and xylem colonization by Erwinia 
amylovora. Applied and Environmental Microbiology, 77, 7031-7039. 

 
Koczan, J. M., McGrath, M. J., Zhao, Y. and Sundin, G. W. (2009) Contribution of Erwinia 

amylovora exopolysaccharides amylovoran and levan to biofilm formation: Implications 
in pathogenicity. Phytopathology, 99, 1237-1244. 

 
Malnoy, M., et al. (2012) Fire blight: applied genomic insights of the pathogen and host. Annual 

Review of Phytopathology, 50, 475-494. 

 
Oh, C. and Beer, S. V. (2005) Molecular genetics of Erwinia amylovora involved in the 

development of fire blight. FEMS Microbiology Letters, 253, 185-192. 

 
Rappaport, F. and Henig, E. (1952) Media for the Isolation and Differentiation of Pathogenic 

Bacteria E. coli (Serotypes O 111 and O 55). Journal of Clinical Pathology, 5, 361. 

 
Sjulin, T. M. and Beer, S. V. (1978) Mechanism of wilt induction by amylovorin in cotoneaster 

shoots and its relation to wilting of shoots infected by Erwinia amylovora. 
Phytopathology, 68, 89-94. 

 
Thomson, S. V. (2000) Epidemiology of Fire Blight In: Fire blight: the disease and its causative 

agent, Erwinia amylovora. (Vanneste, J., ed.). New York: CABI publishing, pp. 9 - 36. 

 
Triplett, L. R., Melotto, M. and Sundin, G. W. (2009) Functional Analysis of the N Terminus of 

the Erwinia amylovora Secreted Effector DspA/E Reveals Features Required for 
Secretion, Translocation, and Binding to the Chaperone DspB/F. Molecular Plant-
Microbe Interactions, 22, 1282-1292. 

 

 

49 

 

Zhao, Y., Blumer, S. E. and Sundin, G. W. (2005) Identification of Erwinia amylovora genes 
induced during infection of immature pear tissue. Journal of Bacteriology, 187, 8088-
8103. 

 
Zhao, Y., Sundin, G. W. and Wang, D. (2009) Construction and analysis of pathogenicity island 
deletion mutants of Erwinia amylovora. Canadian Journal of Microbiology, 55, 457-464. 

 
 

 

 

50 

 

Chapter 3. The role of sorbitol in host specificity of E. amylovora Rubus isolates 

 

51 

 
 

 

 

Abstract 

 

Erwinia amylovora, causal agent of fire blight, is divided into two host-specific 

groupings: Spiraeoideae-infecting strains, which infect apple, pear, and related species, and 

Rubus-infecting strains, which infect raspberry and blackberry. These two groups of plants differ 

in their carbohydrate content, with sorbitol the main translocation carbohydrate of Spiraeoideae 

plants, and sucrose predominating in Rubus plants. Spiraeoideae-infecting isolates of E. 

amylovora are capable of infecting Rubus plants, while Rubus-infecting isolates can only infect 

Rubus species and are avirulent in Spiraeoideae plants. The type III effector-encoding gene eop1 

has been determined to be an avirulence gene in Rubus-infecting isolates. Deletion of eop1 

enabled a Rubus-infecting isolate to infect immature pear fruit; this strain, however, was not an 

effective pathogen of apple shoots. In this study, strain MR1∆eop1/srlAEBDMR was constructed, 

which is the Rubus-infecting isolate MR1 with both deletion of eop1 and complemented with the 

sorbitol-utilization operon (srlAEBDMR) of the apple-infecting strain Ea1189. The ability of this 

complemented strain to grow in sorbitol, produce amylovoran and infect apple shoots was 

examined. The findings of this study indicate that the MR1∆eop1/srlAEBDMR strain exhibits 

significantly increased amylovoran production and a minor increase in virulence in apple shoots 

compared to MR1∆eop1. This strain, however, did not attain the virulence level of the apple-

infecting isolate Ea1189 on apple shoots, indicating that additional host-specificity factors 

remain to be identified. 

 

 

 

52 

 

I. Introduction 

 

At least two distinct groups of the fire blight pathogen Erwinia amylovora exist in nature.  

These groups are separated by host range into strains that infect the sub-family Spiraeoideae, 

including apple and pear, and strains that infect plants in the genus Rubus, including raspberry 

and blackberry (Mann et al., 2013). Rubus strains of E. amylovora cause fire blight on raspberry, 

with symptoms identical to those that occur on apple, including wilted, necrotic shoots forming a 

"shepherd's crook", and the production of bacterial ooze (Braun et al., 2004). Interestingly, the 

raspberry-infecting strains only infect plants in the genus Rubus, while the Spiraeoideae-

infecting strains can infect both apple and raspberry plants (Braun & Hildebrand, 2005; Ries & 

Otterbacher, 2005). 

Previous researchers have identified differences in RNA expression, amylovoran 

structure and serological properties between the Rubus and apple-infecting E. amylovora strains 

(Braun & Hildebrand, 2005; Maes et al., 2001; Mizuno et al., 2002; Triplett et al., 2006). In 

addition, there are distinct differences in genome sequence among Spiraeoideae and Rubus 

strains, as well as easily differentiable CRISPR genomic patterns that can be used for rapid strain 

discrimination (McGhee & Sundin, 2012; Mann et al., 2013). The structure of the 

exopolysaccharide amylovoran from Rubus strains is different from that of Spiraeoideae strains, 

as it lacks a glucose on residue F in the repeating subunit. In addition, there are subtle genetic 

differences in Rubus expolysaccharide and transporter genes, and antigens on the 

lipopolysaccharide (LPS) of Rubus isolates are distinct from antigens on Spiraeoideae LPS. It is 

not known whether any of these differences affect the host specificity of Rubus isolates.  

However, a host specificity determinant between the two strain groups was found in the 

hrp pathogenicity island, a region encoding the type III secretion system, effectors and 

 

53 

 

regulatory components. The gene eop1, which encodes a type III effector protein, is divergent in 

the Rubus-infecting strains (Asselin et al., 2011). The Eop1 protein is conserved in Rubus strains 

and was determined to be the host-range-limiting factor, as an eop1 deletion in the raspberry-

infecting strain exhibited a gain-of-virulence phenotype in immature pear fruit (Asselin et al., 

2011). The eop1 deletion mutant, however, did not change the Rubus strain into an aggressive 

pathogen of apple shoots, leading the authors to suggest that other host specificity factors may be 

at play.  

The carbohydrate contents of apple and raspberry are different, with sucrose the primary 

photosynthate of raspberry and sorbitol the primary photosynthate of apple, except for the 

sucrose-containing flower nectar (Bieleski, 1977; Aldridge, 1997). Bogs and Geider (2000) 

presented correlational evidence that carbohydrate use is a host specificity factor in E. 

amylovora. Braun and Hildebrand (2005), however, rejected this hypothesis on the basis that 

Rubus strains are not able to infect the sucrose-rich nectary of apple flowers. Their study, 

however, predated the Eop1 findings by Asselin et al. (2011), so the authors were not able to 

take into consideration the role of this avirulence protein.  

I hypothesized that differences in the sorbitol utilization operon, in addition to differences 

in eop1, limit infection of apple shoots by Rubus strains of E. amylovora. In this study, I deleted 

eop1 in the Rubus-infecting strain E. amylovora MR1 and further complemented this mutant 

strain with the sorbitol-utilization genes srlAEBDMR from a Spiraeoideae-infecting E. 

amylovora strain. The MR1∆eop1/srlAEBDMR strain was then inoculated into apple shoots to 

determine if Ea1189-level virulence was restored. 

 

 

 

54 

 

II. Materials and Methods 

 
Bacterial strains and growth conditions 
 
 

The bacterial strains and plasmids used in this study, and their relevant characteristics, 

are listed in Table 2.1. Unless otherwise noted, E. amylovora strain Spiraeoideae-infecting strain 

Ea1189 and E. amylovora Rubus strains were grown in Luria-Bertani (LB) broth and plates at 

28°C. Growth curves under sorbitol conditions were conducted in 1% sorbitol minimal medium 

[per liter 4.0 g L-Asparagine, 2.0 g K2HPO4, 0.2 g MgSO4-7H2O, 3.0 g NaCl, 0.2 g nicotinic 

acid, 0.2 g thiamin HCl, 10 g sorbitol] as previously described (Bereswill, 1998), and sorbitol 

fermentation analysis was conducted on MacConkey sorbitol indicator plates [per liter 20 g 

peptone, 10 g sorbitol, 5.0 g NaCl, 0.03 g phenol red] as previously described (Rappaport & 

Henig, 1952). Media were amended as needed with chloramphenicol (Cm) at 20 µg/ml, 

kanamycin (Km) at 30 µg/ml, rifampicin (Rif) at 50 µg/ml and ampicillin (Ap) at 50 µg/ml. 

 

 

 

55 

 

Table 3.1. Bacterial strains, plasmids and primers used in Chapter 3 

 

 

 

Strain or plasmid 
Ea1189 

Characteristics 
Wild type Spirioidiae-infecting strain of Erwinia 
amylovora; ApR 

Ea1189∆ams 

ams operon deletion mutant; ApR 

MR1 

MR1∆eop1 

E. coli TG1 

E.coli DH5α 
(pRK2013) 
pKD3 

pTL18 

pKD46 

pES1 

MR1∆eop1/pES1 

Primer 
eop1 mutagenesis F 

Rubus-infecting isolate of Erwinia amylovora; 
Ea574 
Deletion mutant of eop1, CmR 

Fast-growing E. coli with high transformation 
efficiency 
Contains helper plasmid pRK2013 for mobilization 
of non-self-transmissible plasmids; KmR 
Contains Cm cassette and flanking FRT sites; CmR 

IPTG-inducible FLPase; TetR 

L-arabinose inducible lambda-red recombinase, ApR 

pBBR1 containing sorbitol-utilization operon 
(srlAEBDMR) of Ea1189; KanR 
MR1∆eop1 complemented with pES1; KmR and 
CmR 
Sequence 

5’ – ATGAATATATCTGGTCTGAGAGGC 

GGGTACAAAAGCCAGGCACAGCAGGCGTGTAGG 

CTGGAGCTGCTTC – 3’ 

Source 
(Burse et al., 
2004) 

(Zhao et al., 
2009) 

Michigan, USA 

(Asselin et al., 
2011) 
Lucigen Corp. 

Clontech Corp. 

(Datsenko & 
Wanner, 2000) 
(Long et al., 
2009) 
(Datsenko & 
Wanner, 2000) 
This study 

This study 

Source 
This study 

eop1 mutagenesis R 

5’ – CTAACTTTTGCGATTTTGCGCGGA 

This study 

srlABEDMR 
complementation F 
 srlABEDMR 
complementation R 

CAGAAACGCACCCGCACGCTGAATTT – 3’ 

5’ –CCCGACTGGAAAGCGGGCA 

This study 

GTGGATTACGAATTTTGACAGGCTC – 3’ 

5’ -  GTTGCGTCGCGGTGCATGG 
GAGGATGCTGAGTAGCGCTG  - 3’ 

This study 

 

56 

 

Construction of chromosomal mutants 
 
 

A deletion mutant of eop1 was constructed via the λ Red recombinase system (Datesenko 

& Wanner, 2000). In short, the 1.1 kb chloramphenicol resistance (CmR) cassette was amplified 

from plasmid pKD3 using primers homologous to both 20 bp of the CmR cassette and to 50 bp 

upstream and downstream of the target gene. In pKD3, the CmR cassette is flanked by directly 

repeated flippase recognition target (FRT) sites, which facilitate site-directed recombination. The 

amplified regions were then purified and electroporated into E. amylovora MR1 containing the 

pKD46 plasmid, which expresses the Red system (λ, ß, exo recombinase genes) (Datsenko & 

Wanner, 2000). Colonies were then selected on LB plates containing Cm and Ap, and mutants 

were confirmed by colony PCR using primers targeting regions 500 bp upstream and 

downstream of the mutation. To remove the CmR cassette, the deletion mutants were transformed 

with the plasmid pTL18, which encodes an IPTG-inducible site-specific recombinase that 

prompts recombination between the FRT sites, leading to excision of the Cm resistance cassette. 

The loss of the cassette was tested via Cm sensitivity, and colony PCR with the primers used to 

confirm the mutant. 

Transfer of the sorbitol-utilization genes into E. amylovora MR1 
 

Plasmid pES1 was constructed by cloning srlAEBDMR into pBBR1 via the FastCloning 

method (Li et al., 2011). pES1 was transferred to MR1∆eop1 through triparental mating, and the 

resulting strain was named MR1∆eop1/pES1, or MR1∆eop1/srlAEBDMR. The triparental mating 

was conducted as follows: Escherichia coli TG1 carrying pES1 (KmR) was combined with 

helper strain E.coli/pRK2013 and recipient strain MR1∆eop1 (RfR and ApR) in a ratio of 8:1:1. 

This mixture was plated overnight onto LB medium and incubated at 28◦C. The following day, 

the cells were scraped off and plated onto LB amended with rifampicin, ampicillin and 

 

57 

 

kanamycin to select for E. amylovora MR1∆eop1/srlAEBDMR. pES1 was determined to be 

stable without antibiotics in E. amylovora MR1 for 10 days (data not shown). 

Determination of virulence using immature pears 
 
 

Virulence assays on immature Bartlett pears were performed as described previously 

(Zhao et al., 2005). Briefly, immature pears were surface sterilized with 10% bleach, rinsed with 

distilled water and air dried. Bacterial cultures were normalized to 1 x 104 CFU/ml in 0.5 x PBS. 

Each pear was stab-inoculated with 3 µl of the bacterial culture, and the pears were incubated at 

28°C under high humidity. The resulting lesions were measured 3, 4, 5 and 6 days post 

inoculation (DPI). Ten replicates were included in each assay, and the experiment was repeated 

at least 3 times.  

Apple shoot infection assay 
 
 

Apple shoot infection assays were conducted as previously described (Koczan et al., 

2011). In short, cultures were suspended in 0.5xPBS at 2x108 CFU/ml. Young actively-growing 

apple shoots (Malus X domestica cv. Gala) were inoculated by dipping scissors in bacterial 

suspension and making a diagonal cut between the leaf veins of the youngest leaf. Necrosis was 

measured from 4 dpi to 10 dpi. The experiment was repeated twice with at least four replicates 

per experiment. 

Analysis of sorbitol fermentation ability using MacConkey medium 
 
 

To analyze the ability of the mutant strains to use sorbitol, MacConkey indicator plates 

with 1% sorbitol were used. This medium is commonly used for the identification of E. coli 

0157:H7, which is unable to ferment sorbitol. Phenol Red in this medium serves as a pH 

indicator; sorbitol fermentation is signaled by color change from red (> ~7.5) to yellow (< ~6.8) 

with intermediate shades of orange sometimes observed. 

 

 

58 

 

III. Results 

 

Rubus strain E. amylovora MR1∆eop1 is virulent on immature pear fruit  
 
 

Virulence of the Rubus strains E. amylovora MR1 and MR1∆eop1 and Spiraeoideae 

strain E. amylovora Ea1189 was tested by measuring lesion development on immature pears over 

the course of 6 days the apple strain E. amylovora Ea1189 developed visible lesions at 3 DPI, 

before lesions developed with either of the Rubus strains. Differences between the three strains 

were apparent at 4 DPI and remained until 6 DPI, with E. amylovora Ea1189 lesions averaging 

~25 mm in diameter, while lesions produced by E. amylovora MR1∆eop1 were ~20 mm in 

diameter and MR1 lesions were only ~3 mm in diameter (Fig. 3.1). 

 

 

 

59 

 

Figure 3.1. Virulence of E. amylovora strains Ea1189 (apple-infecting), MR1 (Rubus-infecting), 
and MR1∆eop1 on immature pear fruit 

Diameters of lesions were measured on immature pears inoculated with the indicated strains. 
Measurements were taken day 3 to day 6 post inoculation. Error bars represent the standard error 
of the mean.  

)

m
m

(
 
r
e
t
e
m
a
i
d

 

n
o
i
s
e
L

30

25

20

15

10

5

0

 

 

 

0

3

4

5

6

Days Post Inoculation

Ea1189

MR1

∆eop1MR1∆eop1

 050

L

 

 

60 

 

Erwinia amylovora MR1∆eop1/srlAEBDMR exhibited improved growth in sorbitol medium 
and was more mucoid than MR1∆eop1 
 

Growth of strains E. amylovora Ea1189, MR1 and MR1∆eop1 /srlAEBDMR was 

analyzed in 1% sorbitol minimal medium. In this medium, growth of sorbitol utilization (srl) 

gene mutants is significantly reduced as compared to wild type Ea1189 (data not shown). Since 

the Rubus strains do not infect sorbitol-containing apple shoots, I hypothesized that the MR1 

strain would not grow well in the sorbitol medium, and that the MR1∆eop1/srlAEBDMR strain 

would have improved growth with sorbitol as the sole carbon source. As expected, growth of the 

Rubus-infecting strain MR1∆eop1 was reduced as compared to the Spiraeoideae-infecting strain 

Ea1189 (Fig. 3.1). After 15 h, the OD600 of the Ea1189 culture reached ~1.4, while the OD600 of 

the MR1 culture was only ~0.5. Growth of MR1/srlAEBDMR, which is complemented with the 

apple-infecting srl operon, was improved compared to the MR1 strain, to an OD600 of ~0.8 after 

15 h.  

Strains were streaked onto MacConkey medium amended with 1% sorbitol to determine 

whether sorbitol fermentation is occurring in the Rubus strains and srl complement. On this 

medium, growth of the Spiraeoideae-infecting strain Ea1189 is typically mucoid and turns the 

surrounding medium from the original red color to yellow or orange, indicating sorbitol 

fermentation (Fig. 3.2b). An srl mutant is non-mucoid on this medium, and the surrounding color 

remains red (data not shown). On the MacConkey medium, the Rubus-infecting strain 

MR1∆eop1 was non-mucoid, and the surrounding medium remained red in color (Fig. 3.2a). In 

the srl complement MR1∆eop1 /srlAEBDMR, however, bacterial growth was visibly mucoid, 

and the surrounding medium turned orange, although the color change was not as drastic as by 

Ea1189. 

 

 

 

61 

 

Figure 3.2. Growth of E. amylovora Ea1189 (Spiraeoideae-infecting), MR1∆eop1 (Rubus-
infecting) and MR1∆eop1 /srlAEBDMR (Rubus-infecting strain complemented with apple-
infecting srl operon) in minimal medium containing 1% sorbitol. 

Growth trend observed 3 times. 

0
0
6
D
O

1.6
1.4
1.2
1
0.8
0.6
0.4
0.2
0

 

 

 

0

1

3

5

7

9

11

13

15

Time (hrs)

WT

Ea1189 

MR1∆eop1 
MR-1

MR-1/srlAEBDMR

MR1∆eop1/srlAEBDMR 

 

 

62 

 

Figure 3.3. Growth of Rubus-infecting strains E. amylovora MR1∆eop1 and MR1∆eop1 
/srlAEBDMR (complemented with srlAEBDMR from the Spiraeoideae-infecting strain Ea1189) 
on MacConkey indicator plates containing 1% sorbitol. 

Sorbitol fermentation is signaled by color change from red (> ~7.5) to yellow (< ~6.8) with 
intermediate shades of orange. Mucoid appearance results from increased exopolysaccharide 
production. 

A 

B 

 

 
 
 
 
 
 
 
 
 
 
 
 

 

MR1∆eop1 

MR1∆eop1 
/srlAEBDMR 

 

Ea1189 
Ea1189 

 

63 

 

Erwinia amylovora MR1∆eop1/srlAEBDMR exhibits increased amylovoran production  
 
 

The E. amylovora MR1∆eop1/srlAEBDMR strain was visibly mucoid on sorbitol 

medium, and so I used the CPC-binding assay to quantify amylovoran production of this strain as 

compared to E. amylovora Ea1189 and MR1∆eop1. The amylovoran-deficient Ea1189∆ams 

mutant was used as a control. Compared to Ea1189, the Rubus-infecting strain MR1∆eop1 

mutant had low amylovoran yields, with levels comparable to those produced by the 

amylovoran-deficient ∆ams mutant (Fig. 3.3). The complemented strain 

MR1∆eop1/srlAEBDMR, however, has significantly increased amylovoran production as 

compared to MR1∆eop1. 

 

 

 

64 

 

Figure 3.4. Amylovoran production of E. amylovora Spiraeoideae-infecting strain Ea1189, 
Rubus-infecting strain MR1∆eop1 and MR1∆eop1 complemented with srlAEBDMR from 
Ea1189 (MR1∆eop1/srlAEBDMR). 

Ea1189∆ams was used as a negative control. Data represents 3 biological replicates, and error 
bars indicate the standard error of the means.  
 

B 

D
O
 
e
r
u
t
l
u
c
/
D
O
n
a
r
o
v
o
l
y
m
A

 

0.6

0.5

0.4

0.3

0.2

0.1

0

A 

C 

D 

Ea1189 
Ea1189

Ea1189∆ams 

∆ams

MR1∆eop1 
MR-1

MR1∆eop1/srlAEBDMR 

MR-1/srlAEBDMR

 

 

65 

 

 

 

Erwinia amylovora MR1∆eop1/srlAEBDMR is slightly more virulent on apple shoots than 
MR1∆eop1 
 
 

Apple shoots were inoculated with strains E. amylovora Ea1189, MR1∆eop1 and 

MR1∆eop1/srlAEBDMR, and the spread of infection was tracked over the course of 10 days. As 

expected, strain MR1∆eop1 produced no symptoms in apple shoots at 10 dpi, while Ea1189 

displayed severe necrosis, wilting and emergence of ooze (Fig. 3.5). Strain 

MR1∆eop1/srlAEBDMR developed a small necrotic lesion that halted at the main vein of the leaf 

and did not spread into the shoot. Interestingly, the inoculated leaves curled over in both Ea1189 

and MR1∆eop1/srlAEBDMR infections, while leaves infected with MR1 remained flat.  

 

 

 

66 

 

Figure 3.5. Virulence of E. amylovora Spiraeoideae-infecting strain Ea1189, Rubus-infecting 
strain MR1∆eop1 and MR1∆eop1 complemented with srlAEBDMR from Ea1189 (MR1∆eop1/ 
srlAEBDMR). 

Symptom development on apple shoots at 10 DPI is shown.  
 

Ea1189 

MR1∆eop1 

 
MR1∆eop1/srlAEBDMR 

 

67 

 
 
 
 

 

 

 
 

The effector Eop1 from Rubus-infecting isolates functions as a host specificity 

IV. Discussion 

determinant in E. amylovora, as Rubus strains harboring a wild type copy of eop1 are avirulent 

when inoculated into immature pear fruit or apple shoots (Asselin et al., 2011). Deletion of eop1 

in a Rubus isolate, however, does not create a virulent pathogen of apple shoots, and so the 

question remains as to which other determinants are involved in limiting host range. The 

potential involvement of sorbitol in affecting host range was hypothesized by Bogs and Geider 

(2000), but this hypothesis was not supported by Braun and Hildebrand (2005), who noted that 

Rubus isolates cannot infect the sucrose-containing flowers of apple. Because the latter were not 

aware of the involvement of Eop1 in host specificity, I hypothesized that sorbitol utilization, in 

conjunction with Eop1, both contribute to host range in E. amylovora.  

 

To test this hypothesis, I created strain MR1∆eop1/srlAEBDMR with deletion of the host 

specificity factor Eop1 and addition of sorbitol utilization genes from Spiraeoideae isolate 

Ea1189. I examined growth of this strain on 1% sorbitol MacConkey plates to determine whether 

addition of srlAEBDMR from Spiraeoideae allows the Rubus isolate to ferment sorbitol. 

MR1∆eop1/srlAEBDMR did not display a strong “fermenting” phenotype like Ea1189; however, 

the strain was visibly mucoid compared to MR1∆eop1. The CPC-binding assay confirmed that 

MR1∆eop1/srlAEBDMR has significantly increased amylovoran production, on average greater 

quantities than Ea1189.  Because amylovoran protects the bacteria from host defenses and is 

required for biofilm formation (Koczan et al., 2009), I hypothesized that the ability to partially 

utilize sorbitol and to produce increased amounts of amylovoran would convert strain 

MR1∆eop1/srlAEBDMR into a virulent pathogen of apple. 

When inoculated into apple shoots, MR1∆eop1/srlAEBDMR developed small necrotic 

lesions that stopped at the main vein of each leaf. Thus, strain MR1∆eop1/srlAEBDMR was able 

 

68 

 

to cause initial infection, but could not proceed into the next stage of pathogenesis in the xylem. I 

hypothesized that MR1∆eop1/srlAEBDMR bacteria used type III secretion to initiate infection 

and amylovoran to evade host detection, but that cells were unable to establish biofilms in the 

xylem. There are several possible reasons why MR1∆eop1/srlAEBDMR could not produce a 

biofilm, including differences in apple and raspberry plant xylem structure, differences in 

amylovoran structure between Rubus and Spiraeoideae isolates, and differences in cyclic-di-

GMP synthesizing enzymes. The next steps to understanding the MR1∆eop1/srlAEBDMR 

phenotype are to conduct an analysis of biofilm formation in vitro and to quantify bacterial 

populations in the apple shoot. Additionally, further studies of amylovoran structure could 

explore whether differences between Rubus and Spiraeoideae amylovoran affect biofilms. 

Compared to amylovoran in Spiraeoideae, amylovoran in Rubus strains is missing residue F 

((16)-β-D-glucopyranosyl) (Maes et al., 2001), but it is unknown whether this affects the 

overall function of amylovoran from E. amylovora Rubus strains or is involved in host 

specificity. Previous research has shown that the ability to synthesize amylovoran can be 

transferred between Erwinia species by cosmid clones carrying the ams gene cluster (Bernhard et 

al., 1996). Cross-complementation of the ams gene cluster between Spiraeoideae and Rubus 

strains could provide insight into the relevance of amylovoran structure to biofilm formation and 

host specificity. 

Levan EPS is another major component of E. amylovora biofilms, and lsc mutants are 

weak pathogens of apple shoots (Nimtz et al., 1996; Zhang & Geider, 1999; Koczan et al., 

2009). A recent study by Borruso et al. (2017), has determined that rlsA, a regulator of levan 

production, is absent in the Rubus isolate MR1. Future studies could introduce Spiraeoideae lsc 

 

69 

 

into MR1∆eop1/srlAEBDMR to determine if infection by the double-complemented strain can 

progress further in apple shoots. 

 

 Additional host specificity determinants remain, and an investigation of the protein 

profiles of Rubus and apple strains has identified potential targets (Braun & Hildebrand, 2005). 

Differences in outer membrane protein OmpA, flagellin proteins, heat-shock protein Hsp70, and 

a periplasmic ABC transporter were found between the two host groupings. Investigation of 

these proteins, in conjunction with Eop1, srlAEBDMR, amylovoran, and levan production may 

yield greater insight into the host divide of E. amylovora. 

 

 

70 

 

REFERENCES

 

71 

 

REFERENCES 

 

 
Aldridge, P., Metzger, M. and Geider, K. (1997) Genetics of sorbitol metabolism in Erwinia 

amylovora and its influence on bacterial virulence. Molecular and General Genetics, 256, 
611-619. 

 
Asselin, J. E., Bonasera, J. M., Kim, J. F., Oh, C.-S., and Beer, S. V. (2011) Eop1 from a Rubus 

strain of Erwinia amylovora functions as a host-range limiting factor. Phytopathology, 
101, 935-944.  

 
Bereswill, S., Jock, S., Bellemann, P. and Geider, K. (1998) Identification of Erwinia amylovora 

by growth morphology on agar containing copper sulfate and by capsule staining with 
lectin. Plant Disease, 82, 158-164. 

 
Bieleski, R.L. (1977) Accumulation of sorbitol and glucose by leaf slices of Rosaceae. Aust. J. 

Plant Physiology. 4, 11–24. 

 
Datsenko, K. A. and Wanner, B. L. (2000) One-step inactivation of chromosomal genes in 

Escherichia coli K-12 using PCR products. Proceedings of the National Academy of 
Sciences USA, 97, 6640-6645. 

 
Koczan, J. M., Lenneman, B. R., McGrath, M. J. and Sundin, G. W. (2011) Cell surface 

attachment structures contribute to biofilm formation and xylem colonization by Erwinia 
amylovora. Applied and Environmental Microbiology, 77, 7031-7039. 

 
Maes, M., et al (2001) Influence of amylovoran production on virulence of Erwinia amylovora 

and a different amylovoran structure in E. amylovora isolates from Rubus. European 
Journal of Plant Pathology, 107, 839-844.  

 
Mann, R. et al (2013) Comparative genomics of 12 strains of Erwinia amylovora identifies a 

pan-genome with a large conserved core. PLoS ONE, 8, e55644. 

 
McGhee, G. C., & Sundin, G. W. (2012) Erwinia amylovora CRISPR elements provide new 
tools for evaluating strain diversity and for microbial source tracking. PLoS ONE, 7, 
e41706. 

 
Mizuno, A. (2002). Serological differences among Erwinia amylovora biovars. Journal of 

General Plant Pathology,68, 350-355.  

 
Ries, S. M. and Otterbacher, A. G. (1977) Occurrence of fire blight on thornless blackberry in 

Illinois. Plant Disease Reporter, 61, 232-235. 

 
Triplett, L. R., Zhao, Y., and Sundin, G. W. (2006) Genetic differences between blight-causing 

Erwinia species with differing host specificities, identified by suppression subtractive 
hybridization. Applied and Environmental. Microbiology 72, 7359-7364. 

 

72 

 

Chapter 4. sRNA regulation of carbohydrate utilization in Erwinia amylovora 

 

 

 

73 

 

Abstract 

 

Fire blight, caused by the gram-negative bacterium Erwinia amylovora, is a destructive 

disease of apple and pear trees worldwide. A unique aspect of flower infection by E. amylovora 

is the progression of the organism through three different carbohydrate zones: from the glucose-

containing stigma surface, to the high sucrose environment of the nectary, then to leaves and 

shoots where sorbitol is most abundant. It is not yet known how the sugar-utilization genes of E. 

amylovora are regulated in response to these host changes. However, in Escherichia coli, small 

RNAs (sRNAs) dependent upon the chaperone protein Hfq for stability and function, have been 

implicated in the metabolic regulation of uptake and utilization of non-preferred sugars such as 

sucrose and sorbitol. These sRNAs act by base-pairing with target mRNAs to affect translation 

or stability. One such sRNA is called Spot 42 and is known to target a sorbitol uptake gene (srlA) 

in E. coli; this sRNA has recently been identified in E. amylovora. In this study, it was 

hypothesized that the Spot 42 sRNA is involved in regulating E. amylovora carbohydrate 

utilization. To test this hypothesis, knock-out mutants of hfq and the Spot 42 gene spf were 

generated. Using these strains, a translational fusion was constructed of Gfp to srlA. Significantly 

increased SrlA translation was found in the ∆hfq mutant; however, it was determined that Spot 

42 is not the sRNA involved in sorbitol regulation in E. amylovora. Here, the hypothesis is 

presented that E. amylovora has evolved to evade Spot 42 regulation in order to adapt to the 

high-sorbitol content of apple and pear hosts.  

 

 

 

74 

 

I. Introduction 

 

Flower infection by Erwinia amylovora progresses from the stigma to the nectary and 

finally into the pedicel. In these three stages of flower infection, the bacteria encounter glucose, 

sucrose and sorbitol, respectively (Pusey et al., 2008; Aldridge et al., 1997). In flower stigma 

exudates, glucose and fructose predominate, and E. amylovora cells can quickly consume these 

monosaccharides to facilitate high population growth before spreading into the floral nectary. 

Sucrose is the major component of nectar while largely absent in stigma exudates. As the 

bacteria migrate through the nectarthodes and into the vascular system of the tree, sucrose is 

replaced by sorbitol as the predominant carbohydrate (Aldridge et al., 1997). It is unknown how 

E. amylovora regulates the transition between these different sugar environments. 

Small regulatory RNAs (sRNAs) are used by many gram-negative bacteria to quickly 

adjust to environmental changes, including changes in nutrient availability. sRNAs are non-

coding RNAs, approximately 50-350 nt, that base pair with mRNAs at the ribosome binding site 

(RBS) to control translation and stability of the mRNA (Sharma et al., 2007). In E. coli, all trans-

encoded sRNAs require the chaperone protein Hfq to regulate the target mRNA, and these 

sRNAs lose regulation of their target mRNAs in the absence of Hfq (Vogel & Luisi, 2011). 

Approximately 40 Hfq-dependent sRNAs have been identified in E. amylovora, several of which 

are regulators of pathogenicity and virulence traits such as type III secretion, biofilm production, 

and motility (Zeng et al., 2013). 

In E. amylovora, the sRNA Spot 42 comprises approximately 10% of the total sRNA 

profile expressed at 12 hrs in Hrp-inducing minimal medium (Zeng & Sundin, 2014). This sRNA 

is known in E. coli to regulate carbohydrate metabolism as part of a feedforward loop with the 

catabolite repressor protein (CRP) (Hatfull & Joyce, 1986). When E. coli is exposed to glucose, 

an energetically efficient monosaccharide, Spot 42 accelerates the repression of secondary 

 

75 

 

carbohydrate utilization genes. Spot 42 also reduces the leaky expression of certain secondary 

sugar utilization genes, which diverts metabolic energy and resources towards glucose 

consumption. Notably, the gene responsible for sorbitol uptake, srlA, is a known target of Spot 

42 in E. coli (Beisel & Storz, 2011). 

I hypothesized that the Spot 42 sRNA in E. amylovora negatively regulates the sorbitol 

utilization gene srlA. Regulation of this gene would ensure that the bacteria first consume the 

energetically efficient glucose on the stigma, thereby establishing significant populations for 

successful infection. Preliminary microarray analyses have found that srlA transcripts are 

significantly increased in the ∆hfq strain (Quan Zeng, unpublished). To further investigate this 

result, I measured SrlA translation in Ea1189, Ea1189∆hfq and Ea1189∆spf (Spot 42 gene 

mutant) through a translational fusion of srlA to green fluorescent protein (Gfp). Additional 

screening of the Ea1189∆hfq strain was completed on media with various carbohydrates to 

discover if sRNAs regulate use of other sugars. 

 

 

 

76 

 

II. Materials and Methods 

 
Bacterial strains and growth conditions 
 
 

The bacterial strains and plasmids used in this study, and their relevant characteristics, 

are listed in Table 3.1. Minimal medium with 1% or 2.5% added carbohydrate [per liter 4.0 g L-

Asparagine, 2.0 g K2HPO4, 0.2 g MgSO4-7H2O, 3.0 g NaCl, 0.2 g nicotinic acid, 0.2 g thiamin 

HCl, 10 g or 25 g carbohydrate] was made as previously described (Bereswill, 1998). Bacterial 

growth rates were measured via OD600 measurements using a Tecan Spark® microplate reader 

(Mannedorf, CH). Cultures were normalized to an OD600 of 0.2, and 100 µl of this suspension 

was deposited into each well of a 96-well plate. The microplate reader measured the OD600 every 

30 minutes, and the cultures were shaken prior to each reading. The growth temperature 

remained at approximately 25◦C over the course of the experiment. Each experiment was 

repeated at least 3 times.  

 

 

 

77 

 

Table 4.1. Bacterial strains and plasmids used in Chapter 4  

 

 

 

Strain or plasmid 
Ea1189 

Ea1189∆ams 

Ea1189∆hfq 

Ea1189∆spf 

pXG-20 

pXG::srlA-GFP 

pKD3 

pTL18 
pKD46 

Primer 
srlA translational fusion F 

srlA translational fusion R 

 

Characteristics 
Wild type Spirioidiae-
infecting strain of Erwinia 
amylovora 
ams operon deletion mutant 

Source 
(Burse et al., 2004) 

(Zhao et al., 2009) 

hfq deletion mutant, ApR 

(Zeng et al, 2013) 

spf deletion mutant, CmR and 
ApR 
Contains constitutive promoter 
pLtet; transcription starts at 
the mapped +1 sight 
Includes the 5’ UTR of srlA (-
720 nt from the srlA start 
codon), the first 40 amino 
acids of srlA and green 
fluorescent protein (GFP) 
Contains Cm cassette and 
flanking FRT sites; CmR 
IPTG-inducible FLPase; TcR 
L-arabinose inducible lambda-
red recombinase, ApR 
Sequence 

5’ –GAGATTGACATC 

CCTATCAGTGATAGAGAT 

ACTGAGCACA 

GCTACCTGTTAGTTAAGGGC 

GGC – 3’ 

 

5’ – AGTTCTTCTC 

CTTTGCTCATGAATT 

CGCCA GAACCGGTCACCAT 

CCCGACAAAAAC - 3’ 

(Zeng et al, 2013) 

(Urban & Vogel, 2007) 

This study. 

(Datsenko & Wanner, 2000) 

(Long et al., 2009) 
(Datsenko & Wanner, 2000) 

Source 
This study 

This study 

78 

 

Construction of translational fusion and fluorescence readings 
 
 

A translational fusion was constructed in pXG-20, which contains the constitutive 

promoter PLtet, using the FastCloning method (Li et al., 2011). The construct includes the 5’ 

UTR of srlA (-720 nt from the srlA start codon), the first 40 amino acids of srlA and green 

fluorescent protein (GFP). Fluorescence was measured on the Tecan Spark® microplate reader 

(Mannedorf, CH) using an excitation wavelength of 480 nm and an emission wavelength of 520 

nm. All fluorescence readings were normalized relative to fluorescence of Ea1189 + pXG:20-

srlA-GFP. 

 

 

 

79 

 

III. Results 

 

Ea1189∆spf does not exhibit improved growth in sorbitol minimal medium 
 
 

Strains Ea1189 and Ea1189∆spf were grown overnight in 1% glucose minimal medium 

and then transferred to either 1% sorbitol, 1% sucrose or 1% glucose minimal medium. The 

OD600 of each culture was measured over the course of 48 hrs. I hypothesized that in the 

Ea1189∆spf mutant, which lacks the Spot 42 sRNA, binding to srlA would not occur, and 

therefore growth in sorbitol would be improved compared to the wild type Ea1189. I 

hypothesized that growth of the Ea1189∆spf mutant would be similar to Ea1189 in sucrose and 

glucose. Growth of the Ea1189∆hfq strain was not compared in this study, as this mutant is 

already growth impaired due to absence of several key sRNAs. 

 

The results indicated that strain Ea1189∆spf was not improved in growth in sorbitol 

medium compared to Ea1189. At 48 h, the OD600 of Ea1189 was 1.54 (Fig. 4.1a), whereas the 

OD600 of Ea1189∆spf was not significantly different at 1.57 (Fig. 4.2b). In addition, no growth 

differences were observed between the strains grown in sucrose or glucose medium.  

 

 

 

80 

 

Figure 4.1. Growth comparison of strains Ea1189 (A) and Ea1189∆spf (B) in 1% glucose, 1% 
sucrose and 1% sorbitol minimal medium. 

Growth analyses repeated 3 times. 

1.8

1.6

1.4

1.2

1.0

0.8

0.6

0.4

0.2

0.0

1.8
1.6
1.4
1.2
1.0
0.8
0.6
0.4
0.2
0.0

 
 

 

Ea1189 

1% sucrose

1% glucose

1% sorbitol

 

 

 

Ea1189∆spf

1% sucrose

1% glucose

1% sorbitol

81 

 

SrlA translation is increased in Ea1189∆hfq but not in Ea1189∆spf.  
 
 

I constructed a translational fusion of SrlA to GFP, and electroporated this construct into 

E. amylovora Ea1189, Ea1189∆hfq and Ea1189∆spf to determine if SrlA translation is increased 

in the mutants compared to the wild type. Previous microarray data showed a significant increase 

in srlA transcription in Ea1189∆hfq compared to Ea1189 (Quan Zeng, unpublished), which 

indicates that in wild type conditions, a sRNA is binding to the srlA mRNA. I hypothesized that 

SrlA translation would be significantly increased in the Ea1189∆hfq strain compared to Ea1189. 

Because Spot 42 binds to srlA in E. coli, I hypothesized that the Ea1189∆spf mutant, which does 

not produce Spot 42, would have increased SrlA translation. 

 

 GFP fluorescence was 11-fold greater in the Ea1189∆hfq mutant compared to Ea1189 

(Fig. 4.2). This implies that a sRNA is repressing srlA, and that deletion of the sRNA chaperone 

removes this regulation. However, I did not observe an increase in SrlA translation in 

Ea1189∆spf, which indicates that an alternate sRNA must be repressing srlA. I also tested SrlA 

translation in a strain lacking the sRNA ArcZ, which regulates many virulence traits in E. 

amylovora (Zeng & Sundin, 2014).  However, increased SrlA translation was not observed. 

 

 

 

82 

 

Figure 4.2. Translation of SrlA in Ea1189, Ea1189∆spf, Ea1189∆hfq and Ea1189∆arcZ in 2.5% 
sorbitol minimal medium. 

GFP fluorescence relative to Ea1189 (set at 1). Excitation wavelength 480 nm and emission 
wavelength 520 nm. 
 

e
c
n
e
c
s
e
r
o
u
l
f
 
e
v
i
t
a
l
e
R

14

12

10

8

6

4

2

0

 

 

Ea1189 TF

Ea1189 

∆hfq 

∆hfq TF

∆spf 

∆spf TF

∆arcZ 

∆arcZ TF

 

 

83 

 

Spot 42-srlA binding site sequences are only 40% similar in E. amylovora and E. coli 
 
 

The evidence presented above indicates that Spot 42 in E. amylovora does not repress 

SrlA translation as it does in E. coli, although the sequence of Spot 42 is identical in both 

pathogens. I sought to determine whether the Spot 42 binding site in the 5’-untranslated region of 

srlA is different in E. coli and E. amylovora, and whether other Spot42-mRNA binding sites are 

different or the same in the two pathogens. 

 

I performed a nucleotide BLAST comparing five different Spot 42 binding sites in target 

genes that are present in both pathogens. These binding sites were previously identified using the 

folding algorithm NUPACK and site-directed mutations in Spot 42 (Beisel & Storz, 2011). 

Interestingly, the Spot 42-srlA binding site was only 40% similar between E. coli and E. 

amylovora, while the four additional binding sites compared, located in galK, sucC, sthA and 

gltA, exhibited between 54 – 100% sequence similarity (Fig. 4.3). 

 

 

 

84 

 

Figure 4.3. Comparison of five Spot 42-mRNA binding sites in E. coli and E. amylovora. 

Nucleotide comparison performed using NCBI Basic Local Alignment Search Tool (BLAST). 
 
 

 

 

85 

 Sorbitol-specific enzyme II (srlA):    Galactokinase (galK):  Succinyl-CoA synthetase (sucC):    Pyridine nucleotide transhydrogenase (sthA):      Citrate synthase (gltA):    40% similar 54% similar 67% similar 88% similar 100% similar  

sRNAs regulate glucose utilization in E. amylovora 
 

To determine if sRNA regulation affects the utilization of other sugars in E. amylovora, I 

screened the Ea1189∆hfq strain on 1% glucose, 1% sorbitol, 1% sucrose or 1% fructose-

containing minimal medium and searched for variable growth phenotypes. Compared to Ea1189, 

Ea1189∆hfq was significantly growth-impaired on glucose medium (Fig. 4.4A). To determine 

which specific sRNA is activating glucose utilization in wild type condition, I screened 

approximately 40 sRNAs for reduced ability to grow on glucose. The sRNA mutant 

Ea1189∆arcZ was found to be equally growth-impaired in glucose liquid (Fig. 4.4A) and solid 

(Fig. 4.4B) medium, indicating that it is the Hfq-dependent sRNA that is responsible for reduced 

glucose utilization phenotype of Ea1189∆hfq.  

 

 

 

86 

 

Figure 4.4. Growth of Ea1189, Ea1189∆arcZ and Ea1189∆hfq on 1% glucose liquid (A) and 
solid (B) minimal medium. 

Growth trend in minimal medium observed 3 times. 
 

A

 

 

0
0
6
D
O

1.4

1.2

1

0.8

0.6

0.4

0.2

0

B

 

 
 

 

0

1

3

5

7
Time (hrs)

9

11

WT
Ea1189 

∆hfq
∆hfq

∆arcZ
∆arcZ

 

 

 

 

Ea1189 

∆arcZ 

87 

 Ea1189  Ea1189  Ea1189  Ea1189  

IV. Discussion 

 

 

In this study, I determined that Ea1189∆hfq, a mutant of the sRNA chaperone Hfq, has an 

11-fold increase in SrlA translation as compared to Ea1189. This signifies that an sRNA is 

repressing srlA translation in the wild type strain. Because of the role of Spot 42 in E. coli, and 

the known presence of this sRNA in E. amylovora, I hypothesized that Spot 42 was the specific 

sRNA involved in suppressing srlA translation. In E. coli, the Spot 42 sRNA binds to srlA and 

blocks its translation when glucose is present. This reinforces catabolite repression and prevents 

leaky expression of srlA when glucose utilization is prioritized. 

 

The results indicate that in E. amylovora, the Spot 42 mutant is neither improved in 

growth on sorbitol medium, nor does it have increased translation of SrlA. Interestingly, the Spot 

42-srlA binding sites are only 40% similar between E. amylovora and E. coli. As the Spot 42 

sRNA sequences are identical in the two organisms, I wanted to know whether its binding sites 

to other genes were also changed in E. amylovora. The binding site sequences of four other 

genes in E. amylovora were compared, and they ranged 54-100% similarity to E. coli. I 

hypothesized that Spot 42 is no longer a regulator of sorbitol utilization in E. amylovora, because 

srlA repression could be a hindrance in the high-sorbitol environment of the apple host. Because 

SrlA translation is significantly increased in the Ea1189∆hfq mutant, I can conclude that an 

sRNA other than Spot 42 has co-opted sorbitol regulation. I hypothesize that this unknown 

sRNA evolved to be a more targeted regulator of sorbitol-utilization, needed to fine-tune the 

response of E. amylovora to the rapidly changing sugar sources of the apple tree.  

 

In the glucose, sucrose and sorbitol growth analyses, I observed that Ea1189 growth in 

sorbitol is typically improved compared to growth in the other sugars. This trend has been 

observed in multiple independent growth assays. Additionally, the sorbitol-utilization (srl) genes 

 

88 

 

are still highly expressed under 0.5% glucose + 0.5% sorbitol medium (Fig. 2.7 in Chapter 2). 

Because sorbitol seems to be favored over glucose, and srl gene expression is not inhibited in the 

presence of glucose, I hypothesize that E. amylovora may not undergo catabolite repression in 

the same way as E. coli. This hypothesis is consistent with the mutation of the Spot 42-srlA 

binding site in E. amylovora and implies that E. amylovora has adapted to take advantage of the 

high-sorbitol environment of apple and pear trees. 

 

To find the sRNA involved in sorbitol utilization, future research should screen sRNA 

mutants in E. amylovora with the pXG::srlA-GFP translational fusion plasmid. Ea1189∆hfq 

levels of fluorescence in sorbitol medium would indicate that the sRNA under wild type 

conditions is repressing SrlA translation.  

 

Additional analyses of Ea1189∆hfq on various carbohydrate sources found that the strain 

is significantly reduced in growth on glucose as compared to Ea1189. Screening of 

approximately 30 sRNA mutants identified Ea1189∆arcZ as the sRNA responsible for the 

Ea1189∆hfq phenotype on glucose. I hypothesize that when E. amylovora cells land on the 

stigma surface, ArcZ activates glucose utilization. ArcZ is an important regulator of virulence 

traits in E. amylovora, such as type III secretion, biofilm formation, amylovoran EPS production 

and motility (Zeng & Sundin, 2014). The bacterial cells typically emerge as bacterial ooze from 

cankers in stem tissue, a high-sorbitol environment, prior to landing on the stigma, so glucose 

activation could provide an advantage. Future studies could focus on identifying the glucose-

related mRNA target that ArcZ appears to activate. Several possibilities include genes of the 

glucose phosphotransferase system (PTS) and catabolite repressor protein (CRP).  

 

My understanding of carbohydrate gene regulation in flower infection is beginning to 

take shape, although many questions remain. As flies and pollinators transfer E. amylovora cells 

 

89 

 

to the flower stigma, the bacteria must rapidly adjust to a new environment high in glucose and 

fructose. Here I hypothesize that the sRNA ArcZ is activating glucose utilization, while a sRNA 

is blocking SrlA translation to focus metabolic efforts on glucose consumption. As the bacteria 

progress down into the nectary, I suspect that sRNAs are involved in the regulation of sucrose 

utilization. As the cells enter the pedicel and shoots of the tree, sRNA repression of srlA is likely 

lifted so that sorbitol utilization can commence.  

 

 

90 

 

REFERENCES

 

91 

 

REFERENCES 

 

 
Aldridge, P., Metzger, M. and Geider, K. (1997) Genetics of sorbitol metabolism in Erwinia 

amylovora and its influence on bacterial virulence. Molecular and General Genetics, 256, 
611-619. 

 
Beisel, C. L. and Storz, G. (2011) The base-pairing RNA spot 42 participates in a multioutput 

feedforward loop to help enact catabolite repression in Escherichia coli. Molecular Cell, 
41, 286-297. 

 
Datsenko, K. A. and Wanner, B. L. (2000) One-step inactivation of chromosomal genes in 

Escherichia coli K-12 using PCR products. Proceedings of the National Academy of 
Sciences USA, 97, 6640-6645. 

 
Hatfull, G. F. and Joyce, C. M. (1986) Deletion of the spf (spot 42 RNA) gene of Escherichia 

coli. Journal of Bacteriology, 166, 746-750. 

 
Li, C., et al (2011) FastCloning: a highly simplified, purification-free, sequence-and ligation-

independent PCR cloning method. BMC Biotechnology, 11, 92.  

 
Pusey, P. L., Rudell, D. R., Curry, E. A. and Mattheis, J. P. (2008) Characterization of stigma 

exudates in aqueous extracts from apple and pear flowers. HortScience, 43, 1471-1478. 

 
Sharma, C. M., Darfeuille, F., Plantinga, T. H., and Vogel, J. (2007) A small RNA regulates 

multiple ABC transporter mRNAs by targeting C/A-rich elements inside and upstream of 
ribosome-binding sites. Genes & Development. 21, 2804–2817. 

 
Urban, J. H., & Vogel, J. (2007) Translational control and target recognition by Escherichia coli 

small RNAs in vivo. Nucleic Acids Research, 35, 1018-1037. 

 
Zeng, Q. and Sundin, G. W. (2014) Genome-wide identification of Hfq-regulated small RNAs in 

the fire blight pathogen Erwinia amylovora discovered small RNAs with virulence 
regulatory function. BMC Genomics, 15, 41 

 

 

 

92 

 

Chapter 5. Conclusions and Future Directions 

 

93 

 
 

 

 

 

I. Summary of Work 

During host infection, E. amylovora cells encounter sorbitol in the leaves and shoots, 

glucose on the flower stigma surface and sucrose in the flower nectary. The cells must finely 

tune the expression of carbohydrate utilization genes to adjust to these changing nutrient 

environments. However, it has not been determined how these genes are regulated, and it is 

unknown how carbohydrate utilization genes, in particular sorbitol utilization genes, impact 

virulence. This Master’s thesis explored carbohydrate utilization in relation to virulence, 

regulatory small RNAs (sRNAs), other virulence factors and host specificity. ` 

Previous research determined that in apple shoots, mutants of E. amylovora, with 

deletions of one or more of the sorbitol utilization (srl) genes, are unable to cause significant fire 

blight symptoms. The aim of Chapter 2 was to determine whether absence of the srl genes 

affects virulence factors such as amylovoran EPS production and biofilm formation, and ability 

to infect apple shoots and immature pear fruit. The results suggest that the srl mutants are 

amylovoran-deficient, and they are unable to obtain the energy base needed to infect apple 

shoots and immature pear fruits. Thus, the sorbitol utilization genes are necessary for full 

virulence of E. amylovora in the apple host. 

 

In Chapter 3, I explored whether the srl genes are a host specificity factor for apple-

infecting isolates of E. amylovora. I hypothesized that the ability to partially utilize sorbitol and 

produce increased levels of amylovoran would convert raspberry-infecting strain 

MR1∆eop1/srlAEBDMR into a virulent pathogen of apple. MR1∆eop1/srlAEBDMR developed 

small necrotic lesions when inoculated into apple shoots, but these lesions stopped at the main 

vein of each leaf. Thus, the strain was able to initiate infection, but was not able to continue 

infection into the xylem. I hypothesized that that MR1∆eop1/srlAEBDMR bacteria used type III 

 

94 

 

secretion to establish infection and amylovoran to evade host detection, but that cells were 

unable to form biofilms in the xylem. 

 

Previous research has characterized the involvement of the Spot 42 sRNA in suppressing 

srlA in E. coli. In Chapter 4, I hypothesized that Spot 42 in E. amylovora would likewise 

suppress srlA. To test this hypothesis, I measured translation of SrlA in Ea1189, Ea1189∆hfq and 

Ea1189∆spf mutant backgrounds. In the Ea1189∆hfq mutant, I observed significantly increased 

SrlA translation compared to Ea1189; the Ea1189∆spf mutant, however, did not have increased 

translation of SrlA In addition, I found that the Spot42-srlA binding sites are only 40% similar in 

E. amylovora and E. coli. From these results, I hypothesized that Spot 42 is no longer a regulator 

of sorbitol utilization in E. amylovora. It is possible that repression of srlA could be a hindrance 

to the pathogen in the high-sorbitol environment of the apple host. The high SrlA translation of 

Ea1189∆hfq indicates that an unknown sRNA may have evolved to be a more targeted regulator 

of sorbitol utilization.  

 

 

 

95 

 

 

II. Future Directions 

This thesis begins to investigate various roles of carbohydrate utilization in E. amylovora; 

however, additional questions remain. In Chapter 2, the srl gene mutants were found to have 

decreased amylovoran production, but biofilm formation was not successfully measured in these 

mutants. Future efforts should repeat the biofilm assay in a growth medium that better mimics 

the nutrient content of the xylem. This will help to determine if E. amylovora cells that lack srl 

genes can produce biofilms in host tissues where sorbitol predominates. 

 

In Chapter 3, the Rubus-infecting mutant MR1∆eop1/srlAEBDMR was able to initiate 

apple shoot infection but could not proceed into the next stage of pathogenesis in the xylem. I 

hypothesize that this strain is unable to construct biofilms, and continued research could 

determine what factors are missing for biofilm production. Further investigation could begin by 

conducting an analysis of biofilm formation in vitro to quantify bacterial populations in the apple 

shoots. Additionally, cross-complementation of the ams gene cluster between the Spiraeoidiae 

and Rubus strains could determine whether differences in amylovoran lead to abnormal biofilm 

formation. Recent research has found that rlsA, a regulator of levan production, is absent in the 

Rubus isolate MR1. Future studies could introduce Spiraeoideae lsc into 

MR1∆eop1/srlAEBDMR to determine if levan production is a host specificity factor.  

 

With the translational fusion constructed in Chapter 4, I found that Spot 42 does not 

suppress srlA in E. amylovora as it does in E. coli. However, significant SrlA translation was 

found to occur in the Ea1189∆hfq mutant, indicating that an sRNA is indeed involved in 

regulating srlA under wild-type conditions. Continued screenings of sRNA mutants with the 

pXG::srlA-GFP translational fusion plasmid could identify the sRNA involved in srlA regulation.  

 

In addition to differences in SrlA translation, the Ea1189∆hfq mutant was found to be 

significantly reduced in growth on glucose. This implies that an sRNA, under wild-type 

 

96 

 

conditions, is activating glucose utilization. The sRNA ArcZ was determined to be this sRNA, as 

Ea1189∆arcZ mirrored the phenotype of Ea1189∆hfq. Future studies could focus on identifying 

the glucose-related mRNA target that ArcZ appears to activate.  

 

 

97