r.;4\..)..,
. «(I5

. .71. 3: (v. =§r.3...4.:
, 1 15'!!!) I: .«vtttztdnx ( a).
.)..p?v.:l ...I;J\
<.
.31 t1.
:. I 1)) 1 {Liv}:
Q. \

.5; /.,..~..!v1....!
.l I! 1...}!
111.. I;

25:11} . .

I 5.)
51,.)‘11: 5.110;:
.:...,}.r.:l‘a

/ x .

 

 

 

 

 

 

 

 

 

 

 

Jl"“IIIIIIIIIIIIIIL W”

THéSIS

This is to certify that the

dissertation entitled

THE MOLECULAR BASIS OF POST-TRANSCRIPTIONAL AND
POST-TRANSLATIONAL MODIFICATIONS OF GRAMINEAE LECTINS

presented by

Thea Ann Wilkins

has been accepted towards fulfillment
of the requirements for

Ph.D. degree in Botany

 

 

Major proéssor

flm @244?

Date 12/15/89

 

MSU is an Affirmative Action/Equal Opportunity Institution 0-12771

I LIBRARY I

Michigan State

University
k ,1

 

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.

DATE DUE DATE DUE DATE DUE II

___J u
I ll

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

II = =|| ____l
__Jl IL___
||___|l——

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

T—

I
MSU Is An Affirmative Action/Equal Opportunity Institution
czwmmunfln

 

 

 

 

 

THE MOLECULAR BASIS OF POST-TRANSCRIPTIONAL AND

POST-TRANSLATIONAL MODIFICATIONS OF GRAMINEAE LECTINS

By

Thea Ann Wilkins

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Botany and Plant Pathology

1 989

507%

I

5

OO

ABSTRACT

THE MOLECULAR MECHANISMS OF POST-TRANSCRIPTIONAL AND

POST-TRANSLATIONAL MODIFICATIONS OF GRAMINEAE LECTINS
By

Thea Ann Wilkins

The lectins of the Gramineae are dimeric vacuolar proteins which
specifically bind to oligomers of N-acetylglucosamine or chitin. The lectins of
wheat, barley and rice are highly related but exhibit discrete differences in
antigenicity, biochemical properties and distribution. CDNA clones encoding
wheat germ agglutinin (isolectin B) and rice lectin were isolated and used as
tools to investigate the expression of the Gramineae lectins at the cellular and
molecular levels.

The expression Of rice lectin in developing embryos is distinctive
relative to expression of lectins in wheat and barley. Rice lectin is
synthesized from two mRNA species derived from a single gene present in
one to two copies per haploid genome. The two mRNA species are
presumably generated by a mechanism of alternative polyadenylation site
selection during the post-transcriptional processing of the pre-mFiNA. The
differential expression and accumulation Of the individual rice lectin mRNA
species is also regulated at the post-transcriptional level during

embryogenesis. In situ localization Of rice lectin mRNA in root caps,

peripheral cell layers of the coleorhiza, radicie, scutellum and throughout all
cell layers of the coleoptiie.

The functional role of the N-linked glycan in the processing and
transport Of Gramineae lectins to vacuoles was investigated by introducing
CDNA clones encoding a wild-type or glycosylation-minus barley lectin
preproprotein into tobacco under the transcriptional control of the cauliflower
mosaic virus 35S promoter. The correct synthesis, assembly, processing and
transport Of active barley lectin to vacuoles in transgenic tobacco indicates
that monocots and dicots possess a similar mechanism for the processing
and transport Of these vacuolar proteins. Although the proprotein N-linked
glycan is not essential for targeting of barley lectin to vacuoles, the presence
of the glycan modulates the rate of post-translational processing and
transport of barley lectin proproteins. These results constitute the

demonstration Of a role for N-linked glycans in plants.

TO David and Natasha

 

ACKNOWLEDGEMENTS

Achievement of this degree has been a long and arduous journey and
no one is more deserving of my appreciation and gratitude than Natasha
Raikhel. Natasha’s contributions tO my success are immeasurable and will
continue to be a source Of inspiration to me. I would like to extend my
sincere appreciation to Natasha for providing a cheerful and stimulating
environment and the opportunity to Obtain my degree. I would also like to
thank Andrew Hanson for his advice and guidance in pursuit Of my career.

I would also like to express my gratitude to Dr. Elizabeth Weretilnyk
and Sebastian Bednarek for many helpful discussions, but mostly for their
encouragement, understanding and friendship. I would especially like to
acknowledge Sebastian for the difference he has made in my life. Finally, my
husband, David, is particularly deserving Of my appreciation for his patience
and understanding, but particularly for the sacrifices he made while I was

pursuing my degree.

TABLE OF CONTENTS

LIST OF TABLES

LIST OF FIGURES ...................................

CHAPTER 1 : Introduction

CHAPTER 2: isolation and characterization Of a CDNA clone
encoding wheat germ agglutinin

Abstract

.....................................

Introduction ...................................

Materials and Methods

...........................

Results ......................................

Discussion

References

CHAPTER 3: Expression of rice lectin is governed by two
temporally and spatially regulated mRNAs in
developing embryos

Abstract

Introduction ...................................
Materials and Methods

Results ......................................

vi

Page

viii

11

36
37

42

 

 

Discussion ...................................
References ...................................
CHAPTER 4: Role of propeptide glycan in post-translational
processing and transport Of barley lectin tO
vacuoles in transgenic tobacco
Abstract .....................................
Introduction ...................................
Materials and Methods ...........................
Results ......................................
Discussion ...................................
References ...................................

CHAPTER 5: Summary

isolation and Characterization Of CDNA Clones Encoding
Wheat Germ Agglutinin (WGA) and Rice Lectin ...........

Expression of WGA and Rice Lectin in Developing Embryos .

The Molecular Mechanisms of Post-translational Processing
of Rice Lectin and Barley Lectin .....................

Appendix A: Amino Acid Positions which Distinguish lsolectins
A, B and D of Wheat Germ Agglutinin (WGA) and
Rice Lectin ..............................
Appendix B: Acidic N-linked Glycosylated COOH-terminal
propeptide Domains Of the Gramineae Lectins and
fi-1,3-glucanase of Tobacco ...................

Amphipathic a-helices Of Gramineae Lectin
COOH-terminal Propeptlde Domains .............

Appendix C: Post—translational Processing of Rice Lectin

vii

71

74

83

126

128

129

133

135

IJST OF TABLES

Page
Table 2.1 Isolation and characterization
of a CDNA clone encoding wheat
germ agglutinin ........................... 21

Table 4.1 Relative enzyme activity (%) in
vacuoles prepared from transgenic
tobacco protoplasts ......................... 99

Table A1 Amino Acid Positions which Distinguish

lsolectins A, B and D Of Wheat Germ
Agglutinin (WGA) and Rice Lectin ............... 132

viii

Figure 2.1
Figure 2.2
Figure 2.3

Figure 2.4

Figure 2.5
Figure 3.1

Figure 3.2

Figure 3.3

Figure 3.4

Figure 3.5

UST OF FIGURES

Page
Restriction map and sequencing
strategy for WGA CDNA clone pNVR1 ............ 13
Nucleotide sequence of WGA CDNA
clone pNVR1 ............................ 15
Hydropathy plot of the protein encoded
by CDNA pNVR1 .......................... 18
RNA blot analysis Of WGA mRNA levels .......... 22
Amino-acid homology matrix of WGA
(x axis) and Chitinase from P.
vulgar/s (y axis) .......................... 24
Nucleotide sequence and deduced amino
acid Of two CDNA Clones, CRL852 and
CRL1035, encoding rice lectin ................. 43
Comparison of amino acid sequences
between rice lectin and isolectin B
Of wheat germ agglutinin (WGA-B) .............. 50
Northern blot of gene reconstruction
analysis of rice lectin ....................... 53
Localization Of rice lectin mRNAs in
a developing embryo ....................... 57
Differential expression of rice lectin
mRNA during embryo development ............. 60

Figure 4.1

Figure 4.2

Figure 4.3

Figure 4.4

Figure 4.5

Figure 4.6

Figure 4.7

Figure 4.8

Figure 4.9

Figure 8.1

Alteration of the N-Iinked glycosylation

site Of barley lectin by site-directed

mutagenesis and organization Of the

wild-type (wt) and mutant (g/y) barley

lectin CDNAs introduced into tobacco ............ 75

Gene reconstruction analysis and

accumulation Of steady-state RNA

levels of barley lectin in transgenic

tobacco ................................ 86

Immunoblot detection of mature barley
lectin in wt and g/y tobacco transformants ........ 90

Endo H digestion of radiolabeled
barley lectin isolated from transgenic
tobacco ................................ 94

Isolation Of vacuoles from tobacco
protoplasts expressing wt or g/y
barley lectin ............................. 97

lmmunodetection Of mature barley

lectin in protoplasts and vacuoles

isolated from wt and g/y transgenic

tobacco plants ........................... 101

Pulse-chase labeling experiments
Of tobacco protoplasts expressing
wt or g/y barley lectin ...................... 104

Inhibition Of proteolytic processing
Of barley lectin proproteins in the
presence Of monensin ...................... 107

Proposed Chain Of events involved
in the post-translational processing
of barley lectin ........................... 116

Acidic N-linked glycosylated COOH-terminal
propeptide domains of Gramineae lectins
and )6-1,3-glucanase Of tobacco ................ 133

Figure 0.1

Figure 0.1

Amphipathic a-helices of Gramineae lectin
COOH-terminal propeptide domains .............

Post-translational Processing of Rice Lectin ........

xi

135

137

Chapter 1

Introduction

Lectins are a class Of proteins of nonimmune origin that noncovalently
bind specific carbohydrates (Us and Sharon, 1986). Although lectins have
been found to be ubiquitous in nature, lectins have been primarily derived
from plant sources. In fact, plant lectins have been vital components in
biomedical research as a result of their abundance and diversity in
carbohydrate-binding specificity. The purification and molecular analysis Of
many plant lectins has contributed significantly to our knowledge regarding
their biosynthesis, expression, and distribution. For instance, studies on the
biosynthesis Of Concanavalin A led to the discovery Of a novel mechanism of
protein maturation (Bowles et al., 1986). Accumulating evidence (reviewed in
Sharon and Lis, 1989) indicates that lectins function as cell recognition
molecules in mediating cell-cell interactions. Such interactions would thereby
enable the lectins to regulate both normal cellular and pathological processes
as a consequence. Despite 100 years Of lectin research (Sharon and Lis,
1987), however, the endogenous function Of many lectins, especially plant
lectins, remains elusive.

Many species Of the Gramineae synthesize a lectin which specifically

binds oligomers of N-acetylglucosamine (,GICNAC) or Chitin. The Gramineae

2

lectins can be further subdivided into three subtypes based upon discrete
structural and antigenic differences (Peumans and Stinissen, 1983). The three
subtypes belong to two Gramineae subfamilies and include 1) the cereal
lectins, represented by wheat and barley, 2) Brachypodium lectins, and 3)
rice lectin. The immunologically-related lectins of the Gramineae are embryo-
specific vacuolar proteins, but do not function as storage proteins. Mature
Gramineae lectins are 36 kd dimers comprised of two identical 18 kd
subunits processed from 23 kd precursors (Peumans and Stinissen, 1983).
However, the lectin Of cultivated rice is unique in that approximately 90% of
the 18 kd subunit is endoproteolytically cleaved into two smaller polypeptides
(Stinissen et al., 1984).

The Gramineae lectins accumulate in specific cell-layers of embryonic
tissues (i.e. root caps, radicie, coleorhiza, coleoptiie. scutellum). Distribution
of the lectins in these embryonic tissues is species-specific. For instance,
wheat germ agglutinin (WGA) accumulates in the outer cell-layers Of the
coleoptile, rye lectin is localized to both the inner and outer layers, whereas
rice lectin is present throughout all cell-layers of the coleoptiie. Conversely,
barley lectin is not apparently expressed in the coleoptile (Mishkind et al.,
1983). The specific accumulation of the Gramineae lectins in tissues of
embryos which establish direct contact with the environment during
germination has long been interpreted as a defensive role against fungal

infections. Both Circumstantial and empirical evidence for the potential role of

3

the Gramineae lectins in plant defense is rapidly accumulating. The
Gramineae lectins exhibit extensive homology to other chitin-binding proteins
shown to be plant defense-related proteins (Broglie et al., 1986; Parsons et
al., 1989) or possess antifungal properties (Broekaert et al., 1989). Very
exciting is the recent demonstration that WGA possesses insecticidal activity
against the cowpea weevil in vitro (Murdock et al., 1989). The deleterious
effect on development of this insect by WGA is believed to be mediated by
the nonspecific binding of WGA to Chitin in the peritrophic membrane of the
insect midgut.

Altering the levels of expression, distribution and subcellular site of
accumulation Of the Gramineae lectins would facilitate the identification of the
endogenous functions of these lectins. This dissertation describes the
isolation Of CDNA clones encoding WGA (isolectin B) and rice lectin and their
utilization to characterize the expression of the Gramineae lectins at the
molecular and cellular levels in developing embryos and transgenic tobacco.
The results demonstrated that the expression of rice lectin at the post-
transcriptional and post-translational levels is distinctive and more complex
relative to WGA or barley lectin. The discovery of a COOH-terminal
propeptide which is post-translationally modified by the addition of an N-
linked high mannose glycan has provided the missing link to elucidating the
series Of events involved in the post-translational processing of modified

Gramineae lectin proproteins to mature subunits. Site-directed mutagenesis

4

of the COOH-terminal glycan of barley lectin has provided significant insight
into the molecular mechanism of protein targeting in plants. The N-linked
glycan of the barley lectin propeptide modulates the rate of post-translational
processing of transport of barley lectin, but is not essential for targeting of
barley lectin to vacuoles. The research summarized in this dissertation
provides the background for future endeavors to bioengineer the Gramineae

lectins for specific applications in plant resistance programs.

REFERENCES

Bowles, D.J., Marcus, S.E., Pappin, D.J.C., Findlay, J.B.C., Eliopoulos, E.,
Maycox, PR. and Burgess. (1986) J. Cell Biol. 102, 1284-1297.
Broekaert, W.F., Van Parijs, J., Leyns, F., Joos, H. and Peumans, W.J. (1989)

A chitin-binding lectin from stinging nettle rhizomes with antifungal
properties. Science 245. 1100-1102.
Broglie, K.E., Gaynor, J.J. and Broglie, RM. (1986) Ethylene-regulated gene
expression: Molecular cloning of the genes encoding an endochitinase
from Phaseo/us vulgaris. Proc. Natl. Acad. Sci. USA 83. 6820-6824.
Lis, H. and Sharon, N. (1986) Lectins as molecules and as tools. Ann. Rev.

Biochem. 55.35-67.

5

Mishkind, M.L., Palevitz, B.A., Raikhel, N.V., and Keegstra, K. (1983)
Localization of wheat germ agglutinin-like lectins in various species of
the Gramineae. Science 20. 1290-1292.

Murdock, L.L., Huesing, J.E., Nielsen, 85., Pratt, RC. and Shade, RE.
(1989) Biological effects of plant lectins on the cowpea weevil.
Phytochemistry, In press.

Parsons, T.J., Bradshaw, Jr., HD. and Gordon, MP. (1989) Systemic
accumulation of specific mRNAs in response to wounding in poplar
trees. Proc. Natl. Acad. Sci. USA 86. 7895-7899.

Peumans, W.J. and Stinissen, HM. (1983) Gramineae lectins: Occurrence,
molecular biology and physiological function. In Chemical Taxonomy,
Molecular Biology, and Function of Plant Lectins, I.J. Goldstein and
ME. Etzler, eds. (Alan R.Liss, Inc., New York), pp. 99-116.

Sharon, N. and Lis, H. (1987) A century of lectin research (1888-1988).
Trends Biochem. Sci. 12,488-491.

Sharon, N. and Lis, H. (1989) Lectins as cell recognition molecules.
Science 246, 227-246.

Stinissen, H.M., Peumans, W.J. and Chrispeels, M.J. (1984) Subcellular site

of lectin synthesis in developing rice embryos. EMBO J. 3, 1979-1985.

Chapter 2

Isolation and characteriza’a'on of a cDNA clone
encoding wheat germ agglufinin

ABSTRACT

Two sets of synthetic oligonucleotides coding for amino acids in the
amino- and carboxyl-terminal portions of wheat germ agglutinin were synthesized
and used as hybridization probes to screen CDNA libraries derived from
developing embryos of tetraploid wheat. The nucleotide sequence for a CDNA
clone recovered from the CDNA library was determined by dideoxynucleotide
chain-termination sequencing in vector M13. The amino acid sequence deduced
from the DNA sequence indicated that this CDNA clone (pNVR1) encodes
isolectin 3 of wheat germ agglutinin. Comparison of the deduced amino acid
sequence of clone pNVR1 with published sequences indicates isolectin 3 differs
from lsolectins 1 and 2 by 10 and 8 amino acid changes, respectively. In
addition, the protein encoded by pNVR1 extends 15 amino acids beyond the
carboxyl terminus of the published amino acid sequence for lsolectins 1 and 2
and includes a potential site for N-linked glycosylation. Utilizing the insert of
pNVR1 as a hybridization probe, we have demonstrated that the expression Of
genes for wheat germ agglutinin is modulated by exogenous abscisic acid.
Striking homology is Observed between wheat germ agglutinin and Chitinase,

both of which are proteins that bind chitin.

INTRODUCTION
Lectins, sugar-binding proteins derived mainly from plant sources, have been of
great value as specific probes for investigating the distribution and function of
carbohydrates on the surfaces of animal cells (Goldstein and Hayes, 1978; Us
and Sharon, 1981). In recent years, however, the notion has become widely
accepted that the ability of lectins to distinguish discrete sugars did not arise
fortuitously during evolution (Lis and Sharon, 1981), and as a result, there has
been increased interest in the synthesis and biochemistry Of this group of
proteins. Wheat germ agglutinin (WGA), the first cereal lectin characterized in
detail, binds specifically to the sugar N-acetylglucosamine and to chitin, a
polymer of N—acetylglucosamine residues (Allen, et al., 1973; Nagata and Burger,
1974). In the hexaploid wheat Triticum aestivum, WGA exists as three closely
related isolectins derived from the A, B, and D genomes (Rice and Etzler, 1975;
Peumans, et al., 1982). Comparison of the amino acid sequences for isolectin
1 (A genome) and isolectin 2 (D genome) indicates that these proteins differ at
four residues(Wright, et al., 1984; Wright and Olafsdottir, 1986). The amino acid
sequence for isolectin 3 (B genome), the least abundant form, is not yet
available. These three isolectins randomly associate into functional dimers in
vivo (Rice and Etzler, 1975) and are immunologically indistinguishable (Raikhel
and Pratt, 1987).

In wheat plants, WGA is found in the embryos and adventitious roots

(Raikhel and Pratt, 1987; Mishkind, et al., 1982; Raikhel, et al., 1984). During

8

embryogenesis, WGA expression is under temporal control (Raikhel and
Quatrano, 1986). Accumulation Of WGA is tissue-specific and cell-type specific
in various organs of the embryo (e.g., coleoptile, coleorhiza, and radicle)
(Raikhel and Pratt, 1987; Mishkind, et al., 1982). In other species of Gramineae,
a lectin immunologically related to WGA is synthesized during seed development
and in the roots of adult plants (Mishkind, et al., 1983; Stinissen, et al., 1985).
Furthermore, the accumulation of lectin is modulated by the hormone abscisic
acid (Raikhel and Quatrano, 1986; Triplett and Quatrano, 1982). Although
biochemical, immunological, and microscopic studies have helped to Characterize
the composition and distribution of WGA (Allen, et al., 1973; Nagata and Burger,
1974; Rice and Etzler, 1975; Peumans, et al., 1982; Wright, et al., 1984; Wright
and Olafsdottir, 1986; Mishkind, et al., 1982; Raikhel, et al., 1984), the genes for
WGA have not been isolated.

We are interested in investigating the molecular mechanisms that regulate
the developmental tissue-specific expression of WGA genes. To isolate clones
for WGA, CDNA libraries from developing grains of the tetraploid wheat Triticum
durum (AABB) were used. Here, we report the isolation and the nucleotide
sequence of a CDNA Clone that we presume to encode isolectin 3. Using this
clone as a hybridization probe, we present evidence that the expression Of WGA
genes is modulated by abscisic acid. Because of the common ability of WGA
and Chitinase to bind chitin, we searched for amino acid homology using the

recently published sequence for Chitinase from Phaseo/us vulgaris (Broglie, et

9
al., 1986). We found strong homology between the amino terminus of Chitinase

and four regions of WGA. The significance of this similarity is addressed.

MATERIALS AND METHODS

Plant material. Wheat T. aestivum L. (AABBDD) cv. Marshall was obtained from
the Minnesota Crop Improvement Association (St. Paul, MN). Plants were grown
as previously described (Raikhel, et al., 1984), and embryos were collected at
20 days after bloom (anthesis) according to Raikhel and Quatrano (Raikhel and
Quatrano, 1986). Abscisic acid treatment involved culturing isolated embryos in
the dark at 27°C for 3 days on filter paper containing growth medium (Triplett

and Quatrano, 1982) with and without 10" M abscisic acid (Sigma).

Materials. Two CDNA libraries, derived from mRNA isolated from developing
wheat grains of T. durum (AABB) cv. Mexicali at 3 and 4 weeks post-anthesis,
were provided by C. Brinegar (ARCO Plant Cell Research Institute, Dublin, CA).
Two sets of degenerate synthetic oligonucleotides were prepared for amino acid
regions in isolectin 1 (Wright and Olafsdottir, 1986): for the sequence Asn-Met-
GIu-Cys-Pro-Asn-Asn in the amino-terminal region (residues 9-15), probe 2, 'ITR
TAC CTY ACR GGN TTR Ti; and for the sequence Cys-Thr-Asn-Asn-Tyr-Cys-
Cys in the carboxyl terminal region (residues 141-147), probe 1, ACR TGN TTR

TTR ATR ACR AC. The oligonucleotide mixtures were synthesized on an

10
Applied Biosystems (Foster City, CA) 380 DNA synthesizer by a solid-phase
method (Matteucci and Caruthers, 1980) and separated by electrophoresis on
a 20% polyacrylamide gel containing 8 M urea in TBE, pH 8.3 (0.89 M Tris/0.089
M boric acid/2.7 mM EDTA). The oligonucleotides were eluted in 0.5 M
ammonium acetate/10 mM magnesium acetate/0.1% NaDodSO,, and then end-

labeled with 32P using T4 polynucleotide kinase (Maniatis, et al., 1982).

Isolation and screening of cDNA clones. The cDNA libraries, in Escherichia coli
strain DH5a (Hanahan, 1985), were plated directly onto nitrocellulose filters laid
on agar plates containing Luria broth medium with ampicillin at 50 ug/ml
(Hanahan and Meselson, 1983). After colonies were established, the bacteria
were lysed, and the filters were probed with oligonucleotide probes 1 and 2 as
follows. The temperature of hybridization (TH) for each oligonucleotide was
calculated using the formula TH = TD - 12°C, where TD = 2°C x (the number of
AT base pairs) plus 4°C x (the number of G-C base pairs). Replicate filters were
prehybridized in 6x SSC (0.9 M sodium Chloride and 0.09 M sodium citrate, pH
7.0) (1x SSC = 0.15 M sodium chloride/0.015 M sodium citrate, pH 7) plus
0.25% nonfat milk, and hybridized in the same buffer containing the labeled
oligonucleotide probes and 0.1% NaDodSO4 at 36°C (probe 1) or 38°C (probe
2). After hybridization, filters were washed three times in 6 x SSC/0.25% nonfat
milk/0.1% NaDodSO, at room temperature for 10 min, followed by a 2-min wash

at 46°C (probe 1) or at 48°C (probe 2). Filters were dried and

11
autoradiographed for 16-18 hr. Colonies that produced positive signals were

selected and rescreened using the same probes under the same conditions.

DNA sequence determination. Inserts from recombinant plasmids were purified
by electrophoresis in low-melting-point agarose. Excised cDNA inserts or
appropriate restriction fragments were then subcloned into M13mp18 or
M13mp19. Dideoxynucleotide chain-termination sequencing from single-Stranded
M13 templates was accomplished using a Bethesda Research Laboratories M13
sequencing kit with the exception that dGTP was replaced by 7-deaza-2’-deoxy-

guanosine triphosphate (Boehringer Mannheim).

FINA blot analysis. Total RNA was isolated as described (Williamson, et al.,
1985) and poly(A)+ RNA was purified by chromatography on oligo(dT)-cellulose
(Maniatis, et al., 1982). Poly(A)+ RNA was electrophoresed in adjacent lanes (1
ug per lane) on 2% agarose gels containing 6% formaldehyde and then
transferred to nitrocellulose (Thomas, 1980). Filters were hybridized with inserts
labeled by the random primer method of Feinberg and Vogelstein (1983) and

washed under stringent conditions as described in Thomas (1980).

RESULTS
Isolation of cDNA clones. Two synthetic oligonucleotides, each consisting of 20

nucleotides complementary to the 5’ and 3’ ends of the coding portion of

12
isolectin 1 mRNA (Wright and Olafsdottir, 1986), were used for isolation of cDNA
clones specific for WGA. These two sequences corresponded to amino acids
9-15 (probe 2) and 141-147 (probe 1). Because of the degeneracy of the
sequences involved, probe 2 was a mixture of 64 sequences, and probe 1 was
a mixture of 128 sequences. One cDNA clone, pNVR1 [1.0 kilobase (kb)], was
selected by hybridization to both probes on the assumption that this insert
contains sequences Spanning the coding region delimited by the oligonucleotide
probes. A second clone, pNVR2 (0.7 kb), was recognized by probe 1 only and
is presumably truncated at the 5’ end. The restriction map and partial sequence
Of pNVR2 indicate that it is a shorter version of pNVR1. When the insert from
Clone pNVR1 was labeled by the random primer method (Feinberg and
Vogelstein, 1983) and used as probe to rescreen the cDNA libraries, no

additional CDNA clones were retrieved.

Nucleotide sequence. The cDNA insert of pNVR1 was subcloned into M13mp18
and M13mp19 according to the strategy shown in Figure 1, and its nucleotide
sequence was determined as described. The nucleotide sequence of the CDNA
clone and the deduced amino acid sequence are shown in Figure 2. Clone
pNVR1 contains a 558-nucleotide open reading frame encoding a 186-amino
acid polypeptide rich in cysteine and glycine but lacking an ATG start codon at
the 5’ end. Protein sequence analysis indicates that the amino terminus of WGA

is blocked (Wright, et al., 1984; Wright and Olafsdottir, 1986) so that the first

13

Figure 1. Restriction map and sequencing strategy for WGA cDNA clone
pNVR1. Open bar, cloned CDNA; arrows, length and direction of the sequenced

restriction fragments. Scale of the map is in kb pairs.

14

I Isa
I eqx—«i
I MI

I Ed
I "IV
I. 2034

LH IJJBa—u

 

 

 

 

1.0

0.9

0.7

0.5

0.3

0.1

 

kbL

15

.8533 9: m>onm flop B 82865 9 mam co_§>moo>_m RESOO < .3533 3 83:98.6 9m <o>> LE
8533 8533 o5 Co BEES 3x098 or: oco>mc .838 65 Moon oEEm cootE .pofiofig 9m $5.52:
2963 .956 Cormacmomzoa 9:de m use 65:20:: 205$ mcopoo cosmEELE .50”. .AcozmofaEEoo
8:093 .EmEs .9 828m. coon m>mz 626th 3:. Cam A59 .5025 one chEmOQ um 30:92.6 88.8%
296391 $32888. .9:me pcm mEEmSE £3, 85583 9m mo can an 30:68 am. 8:6sz 9:
Cam 65:09.: 53> 85533 m_ on 8:68 um 9505 83.2.98 3 omumcgmmo 2m _. £8202 53> mmocmoao
RECECUm och .8539. 826th 9: m>opm mmpoo Eom 058m 9: B Cmficgmmp mum N £8202 .6 85:03
Eom oEEm 8533 9.: use mocmaoom Dom 058m .8268 9: cmmEmc 805526 9:. 229.; 33020:: 9:

m>onm Esocw 2m $859 20m oEEm omoapmp one .E>za oco_o <zoO <0>> S coco-.60» oouoofiaz .N 959“.

 

 

 

 

16

 

_I_.x_<_<<uuwPooh<h<opouwhu<ho<ou

 

 

 

 

 

 

 

 

 

.D _J<<U

hpu
4
l

uuu

auu

uu<

o<u

o<<

M

one

a

2.24.23. 3.3.335 .
(23...? 53855222853545:
:353.3.335:33535.3.33.: i II 3:32.: <3 <8 05
m < 4
I I I
hu< uu» u<< uu< uuu uh< uuo u<o uuo opp ope hue p<u uup own now uu< u<u uuh uuu <uo how our u<h uuu
h m z p < _ < m < m > u a u u u w a o u < o u > o
I I I I I I I I I I I < ONF 00F
hum op< one how ugh <uu ooh u<< uu< how our u<k u<< u<< hu< uuh who uo< uou uuu uuu u<u u<< uuu huh
o _ u u m u 3 x w u u > z z k u > a o o < n x a u
om? oer
4 a
u<< u<o uu< uu< ooh kuu uuo u<< u<u our 000 o<o can our app u<o our hum ohu can our u<h wow wow o<u
x a b w u < u z a u u w u u m w m u 4 u u > u 3 o
omw m omw u are m
our uoh Uhu u<< u<< uuu uuw uwu u<< new new 000 u<u uo< 000 um» u<< up< u<u uuu uou no» uuu uuu uuu
u u 4 z z a u 4 u o u < a m u u y ~ 9 < x u a u a
cow w co co
um» uoo uuu uuu um» u<h u<o ouu uuu Up» now uuh u<u uuo u<h u<u uu< uuw our u<u o<< u<< uuu our ou<
u u < u u > w < u m a u z o > a m u u z z z a u h
on a De I e
uuo uuo ouu u<u uo< ago how uuu o<< uo< uu< we» um» uou uuu u<< u<u oak uuu u<< uou no» u<h H<o owe
a u < a m u u x x m h 3 u < o z a u u x u u > a u
om ov a on
u»< com 00» u<~ uou u<h u<u uo< our uu» whu u<< u<< uuu Ugh u<o u~< uuu uu< uuu u<u o<u uuo our uu<
: u u > a > o m u u 4 z z A u w I u m u o w u u x
cm or z

r.
IA
K)

mMN

umw

17
residue (glutamine) of the published sequence may not be the amino terminus
of mature WGA. It is, therefore, presumably fortuitous that the cDNA clone
pNVR1 and the published amino acid sequence for WGA initiate with the same
amino acid. The hydropathy plot (Kyte and Doolittle, 1982) of the polypeptide
encoded by clone pNVR1 shows the polypeptide to be comprised mostly of
hydrophilic amino acids (Figure 3). The polypeptide encoded by pNVR1
extends 15 amino acids beyond the carboxyl terminus of the amino acid
sequence published for isolectins 1 and 2 (Figure 2, squares) (Wright, et al.,
1984; Wright and Olafsdottir, 1986). The carboxyl-terminal segment contains the
most hydrophobic portion of the entire protein (Figure 3). A potential site for
N—iinked glycosylation occurs at residues 180-182 (Asn-Ser-Thr) (Figure 2, dots
above squares). The 3’-untranslated region contains four in-frame termination
codons (TGA, TGA, TAA, and TAG, underlined in Figure 2) and a potential
polyadenylation signal (AATAAT, double-underlined in Fig.2), and terminates in

a poly(A) tail that begins 29 nucleotides downstream from that signal.

Comparison mth published sequences of isolectin 1 and 2. The amino acid
sequence deduced from the CDNA nucleotide sequence (Figure 2) was
compared with published protein sequence data. Re-evaluation of the
discrepancies at positions 134 and 150 (Figure 2, arrows) has indicated a low
yield of lysine in addition to glycine for residue 134 (C. Wright, personal

communication) and has confirmed the presence of tryptophan at residue 150

..-

Figure 3. Hydropathy plot of the protein encoded by cDNA pNVR1. Ordinate,
hydropathic index (Kyte and Doolittle, 1982); abscissa, amino acid position. The

additional 15 amino acids at the carboxyl terminus are right of the broken line.

19

00'
A

coEwOQ 20¢. OEE<
ONF ow
_

0v

 

NON

 

 

+
xepu|
quledOJPAH

18

Figure 3. Hydropathy plot of the protein encoded by cDNA pNVR1. Ordinate,
hydropathic index (Kyte and Doolittle, 1982); abscissa, amino acid position. The

additional 15 amino acids at the carboxyl terminus are right of the broken line.

 

 

 

o
-lI.o
..
o
—N
,.
_o
an
_o
v

NON

+ I

xepU|

ongdmpKH

Amino Acid Position

20
(Wright, 1987). The deduced amino acid sequence of pNVR1 was found to
differ from the published sequence of isolectin 1 (Wright and Olafsdottir, 1986)

at 10 positions and isolectin 2 at 8 positions (Wright, et al., 1984) (Table 1).

FINA blot analysis. Embryos isolated from hexaploid wheat at 20 days post-
anthesis were cultured in the presence and absence of abscisic acid (Figure 4).
Equal amounts of poly(A)+ RNA from the embryos were fractionated by agarose-
formaldehyde gel electrophoresis and transferred to nitrocellulose filters. A 1.1-
kb mRNA was detected (Figure 4) after hybridization with pNVR1 insert labeled
by the random primer method (Feinberg and Vogelstein, 1983). The
autoradiograph showed that the level of RNA in abscisic acid-treated embryos
was several times higher than the level in embryos cultured in the absence of

abscisic acid.

Nucleotide and amino acid homology between WGA and chitinase. The
deduced amino acid sequence of CDNA Clone pNVR1 was used to search for
homology with Chitinase, an enzyme that catalyzes the hydrolysis of 1.4-8
linkages of N-acetylglucosamine polymers in chitin. The amino acid homology
matrix between clone pNVR1 and Chitinase from P. vulgaris is shown in Figure
5. This matrix was generated using the analysis program of Pustell and Kafatos
(1984) with parameters set so that each letter within the matrix represents a

match of 50% or greater over a span of 21 amino acids. Extensive homology

21

Table 1. Amino acids at positions in which there are differences
between the residues of isolectins 1 and 2 and the protein
encoded by pNVR1

 

 

Amino acid Isolectin 1 Isolectin 2 pNVR1
56 Thr Pro Pro
59 Gln His His
66 Tyr His His
93 Ala Ser Ala

9 Asn Asn Gly
37 Asp Asp Asn
53 Ala Ala Lys

109 Set Ser Tyr
119 Gly Gly Glu
123 Ser Ser Asn

171 Ala Ala Gly

 

Figure 4. RNA blot analysis of WGA mRNA levels. Poly(A)+ RNA (1 ug),
isolated from embryos excised at 20-day post-anthesis and cultured in the
presence (lane 1) and absence (lane 2) of abscisic acid, was separated on a
2% agarose, 6% formaldehyde gel. After transferring the RNA to nitrocellulose,
the filter was hybridized to a 32P-iabeled DNA insert from pNVR1 under stringent
conditions. Positions of DNA M, markers were obtained from the ethidium

bromide-stained portion of the gel.

Kb
2.0'

 

0.5.

23

24

.<o>>
£3, 529:0; o: 950% £206 9: ,6 $3589 on“ 6963 9m omwczfo .O mEom oEEm ov “we 9: E
852080; 2:0 .fiom n N .....$mm u m .fioor n < 9oz; 5:9: 9: E E8 85 am 32080: $8859
225. comm .F n 8685,50 .8 n m:_m> EDEEE .mnd u 663 28w .2. n emcee “mamHmESma
9.36:2 on“ 05w: $8: E8505 mazmcm mucosdom woufimx Cam =9m3m or: £5, Cocoa 295 $2sz

82080: .Exm b MEIER I Eat ommczfo use Eve xv 525 S xEmE 322:0: u_om-oc_E< .m 239“.

 

25

00 on 01 On ON 0.

26

between the amino terminus of Chitinase and four regions of WGA is apparent.

DISCUSSION

In this paper we present the amino acid sequence of WGA as deduced
from a cDNA Clone designated pNVR1. That this clone encodes WGA has been
verified by comparison of the deduced amino acid sequence with the sequence
determined by direct amino acid sequencing of the purified protein (Wright, et
al., 1984; Wright and Olafsdottir, 1986). The length of the polypeptide derived
from the deduced amino acid sequence is 186 amino acids, and the calculated
M, is 18,754. Nevertheless, pNVR1 does not represent the complete coding
sequence for WGA. First, the initiating methionine codon is absent from the
CDNA. Second, because WGA is synthesized on and tranSIocated across the
rough endoplasmic membrane (Mansfield, et al., 1988) an amino-terminal signal
peptide would be expected (Chrispeels, 1984). Third, there may be one or
more amino acids at the amino terminus that have not been detected by peptide
sequencing because of blockage of the amino terminus (Wright, et al., 1984;
Wright and Olafsdottir, 1986). The size of the mRNA recognized by clone
pNVR1 predicts a full-length cDNA of 1.1 kb.

The DNA sequence of pNVR1 encodes a protein that extends 15 amino
acids beyond the carboxyl terminus of the published amino acid sequence and
includes a potential Site for N-linked glycosylation. Isolated WGA is not a

glycoprotein, but the precursor form is glycosylated (Mansfield, et al., 1988).

 

27

The site of glycosylation probably lies in the 15 amino acid carboxyl-terminal
sequence because the only possible site for glycosylation resides in this region.
The glycosylated precursor is known to be processed (Mansfield, et al., 1988)
and to accumulate in protein bodies or vacuoles (Mishkind, et al., 1982; Raikhel,
et al., 1984). The WGA precursor in the endoplasmic reticulum-associated
fraction is 5 kDa larger than the mature WGA (Mansfield, et al., 1988). The
difference in molecular mass between the precursor and mature WGA may be
a consequence of the extra 15 amino acids and glycosylation of the carboxyl
terminus. The hydropathy plot of the amino acid sequence derived from pNVR1
clearly indicates that the carboxyl terminus of the cloned WGA sequence
consists of hydrophobic amino acids, which is consistent with the possibility that
it is removed post-translationally. Removal of carboxyl-terminal residues was
seen during maturation of napin, a rapeseed storage protein (Ericson, et al.,
1986). It was recently shown that the lectin concanavalin A (Con A), which is
not a glycoprotein, is synthesized as a glycosylated precursor (Herman, et al.,
1985). Normal transport of this protein is dependent on the presence of the
glycan (Faye and Chrispeels, 1987). It is interesting that WGA precursor is a
biologically active lectin (Mansfield, et al., 1988), whereas precursor for Con A
does not have lectin activity (Herman, et al., 1985). In other words, the loss of
the pro-WGA carboxyl-terminal domain does not relate to its ability to bind N-
acetylglucosamine. Alternatively, cleavage of the carboxyl terminus may occur

during the purification of WGA such that the mature protein actually contains 186

28
amino acids in vivo.

Clone pNVR1 mRNA contains four termination codons and a 3’-
untranslated region. A potential polyadenylation signal (AAUAAU) is found in the
noncoding region followed by a poly(A) tail. Whereas the consensus sequence
for the polyadenylation signal is very highly conserved in animal systems
(AAUAAA), plant mRNAs frequently deviate from this theme (Dean, of al., 1986).
The deduced amino acid sequence confirms extensive interdomain homology.
The 7-amino acid sequence Gly-Cys-Gln-Asn-Gly-AIa-Cys is found at residues 34-
40 and again at residues 120-126. Short repeated stretches of Tyr-Cys-Gly, Ala-
Gly-Gly, Gly-Cys-Gln, Cys-Cys-Ser, or Cys-Gly-Gly are found throughout the
polypeptide.

Amino acid sequence studies on wheat isolectins 1 (A genome) and 2 (D

genome) (Rice and Etzler, 1975; Peumans, et al., 1982; Wright, et al., 1984;
Wright and Olafsdottir, 1986) indicated that they differ distinctly in their histidine
content: two histidines in isolectin 2 and no histidine in isolectin 1 (8). Because
Clone pNVR1 was isolated from a CDNA library derived from the tetraploid wheat
7'. durum (AABB), the CDNA clone cannot encode isolectin 2 derived from the
D genome. Furthermore, pNVR1 probably does not encode isolectin 1 from the
A genome. lsolectin 1 does not contain any histidine, whereas pNVR1 encodes
a protein containing two histidine residues. Thus, pNVR1 probably represents
isolectin 3 derived from the B genome. Although the amino acid compositions

of isolectins 2 and 3 are very similar, eight discrete differences were identified

29

between them. At least four of these differences (residues 9, 53, 93, and 119)
are authentic. The x—ray crystallographic data for these four positions in isolectin
2 are definitive, and there is no evidence for heterogeneity in peptide
preparations (Wright, et al., 1984). The discrepancies at the remaining four
positions (37, 109, 123, and 171) between the deduced amino acids and
isolectin 2 could be because of inaccuracies resulting from cross-contamination
of the isolectins during fractionation.

Abscisic acid treatment of developing wheat embryos has been Shown to
affect temporal expression of WGA (Raikhel and Quatrano, 1986; Triplett and
Quatrano, 1982). Using clone pNVR1 as a hybridization probe, we found that
abscisic acid treatment of excised wheat embryos modulates mRNA levels for
WGA, which is consistent with known effects of abscisic acid on lectin levels
(T riplett and Quatrano, 1982). Similar results were reported by Williamson et al.
(Williamson, et al., 1985) for the abundant embryo storage protein. It is possible
that abscisic acid regulation is based upon changes in the rates of mRNA
transcription, turnover, or processing. It also needs to be mentioned that clone
pNVR1 may be hybridizing to the mRNAs for isolectins 1 and 2, as well as to
the mRNA for isolectin 3 on the RNA blot. Given the similarity of the isolectin
sequences, the high-stringency conditions used for hybridization may not have
prevented cross-hybridization with mRNAs from related isolectins.

WGA and Chitinase are two Chitin-binding proteins that are thought to

have antimicrobial activity (Mirelman, et al., 1975). Recently, however, evidence

 

30

was presented to show that antifungal activity of WGA can result from
contamination by Chitinase (Schlumbaum, et al., 1986). Comparison of amino
acid sequences demonstrated a striking homology between the amino terminus
of Chitinase (Broglie, et al., 1986) and four regions of the WGA molecule. The
amino acid residues of WGA directly involved in primary sugar-binding sites are
tyrosine-73, serine-62, and glutamic acid-115 (Wright, 1984). These three
residues are found in the regions of homology between Chitinase and WGA.
One may speculate that these regions of homology account for the similarity in
chitin-binding activity of these proteins and , subsequently, in copurification.

Additionally, the sequence homology between WGA and Chitinase may be of

functional significance.

REFERENCES

Allen, A.K., Neuberger, A. and Sharon, N. (1973) The purification, composition
and specificity of wheat-germ agglutinin. Biochem. J. 131, 155-162.
Broglie, K.E., Gaynor, J.J. and Broglie, RM. (1986) Ethylene-regulated gene

expression: Molecular cloning of the genes encoding an endochitinase

from Phaseo/us vulgaris. Proc. Natl. Acad. Sci. USA 83. 6820-6824.
Chrispeels, M.J. (1984) Biosynthesis, processing and transport of storage

proteins and lectins in cotyledons of developing legume seeds. Phi/cs.

Trans. R. Soc. London. Ser. B 304, 309-322.

31

Dean, D., Tamaki, S., Dunsmuir, P., Favreau, M., Katayama, C., Dooner, H. and
Bedbrook, J. (1986) mRNA transcripts of several plant genes are
polyadenylated at multiple sites in vivo. Nucleic Acids Res. 14. 2229-2240.

Ericson, M.L., Rodin, J., Lenman, M., Giimeiius, K., Josefson, LG. and Rask, L
(1986) Structure of the rapeseed 1.7S storage protein, napin, and its
precursor. J. Biol. Chem. 261. 14576-14581.

Faye, L. and Chrispeels, M.J. (1987) Transport and processing of the
glycosylated precursor of Concanavalin A in jack-bean. P/anta 170, 217-
224.

Feinberg, AP. and Vogelstein, B. (1983) A technique for radiolabeling DNA
restriction endonuclease fragments to high specific activity. Anal. Biochem.
132. 6-13.

Goldstein, l.J. and Hayes, CE. (1978) The lectins: Carbohydrate-binding
proteins Of plants and animals. Adv. Carbohydr. Chem. Biochem. 35. 127-
340.

Hanahan, D. (1985) Techniques for transformation of E. coli. In DNA Cloning, ed.
Glover, D.M. (IRL, Oxford), Vol. 1, pp. 109-135.

Hanahan, D. and Meselson, M. (1983) Plasmid screening at high colony density.
Methods Enzymol. 100, 333-342.

Herman, E.M., Shannon, L.M. and Chrispeels, M.J. (1985) Concanavalin A is

synthesized as a glycoprotein precursor. P/anta 165, 23-29.

32

Kyte, J. and Doolittle, RF. (1982) A simple method for displaying the hydropathic
character of a protein. J. Mol. Biol. 157, 105-132.

Lis, H. and Sharon, N. (1981) Lectins as molecules and tools. Annu. Rev.
Biochem. 55, 35-67.

Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A
Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor,
NY).

Mansfield, MA, Peumans, W.J. and Raikhel, NV. (1988) Wheat-germ agglutinin
is synthesized as a glycosylated precursor. Planta 173, 482-489.

Matteucci, MD. and Caruthers, M.H. (1980) Tetrahedron Lett. 21. 219-722.

Mirelman, D., Galun, E., Sharon, N. and Loyan, R. (1975) Inhibition Of fungal
growth by wheat germ agglutinin. Nature (London) 256, 414-416.

Mishkind, M.L., Palevitz, B.A., Raikhel, NV. and Keegstra, K. (1983) Localization
of wheat germ agglutinin-like lectins in various Species of the Gramineae.
Science 220, 1290-1292.

Mishkind, M.L., Raikhel, N.V., Palevitz, BA. and Keegstra, K. (1982)
Immunocytochemical localization of wheat germ agglutinin in wheat. J. Cell
Biol. 92, 753-764.

Nagata, Y. and Burger, MM. (1974) Wheat germ agglutinin. Molecular
characteristics and specificity for sugar binding. J. Biol. Chem. 10, 3116-

3122.

33
Peumans, W.J., Stinissen, HM. and Carlier, AR. (1982) A genetic basis for the

origin of six different isolectins in hexaploid wheat. Planta 154. 562-567.

Pustell, J. and Kafatos, PC. (1984) A convenient and adaptable package of
computer programs for DNA and protein sequence management, analysis
and homology determination. Nucleic Acids Res. 12, 643-655.

Raikhel, NV. and Pratt, L. (1987) Wheat germ accumulation in coleoptiles of
different genotypes of wheat. Localization by monoclonal antibodies. Plant
Cell Flep. 6, 146-149.

Raikhel, NV. and Quatrano, RS. (1986) Localization of wheat germ agglutinin
in developing wheat embryos and those cultured in abscisic acid. Planta
168. 433-440.

Raikhel, N.V., Mishkind, ML. and Palevitz, BA. (1984) Characterization of a
wheat germ agglutinin-like lectin from adult wheat plants. Planta 162. 55-
61.

Raikhel, N.V., Mishkind, M. and Palevitz, BA (1984) lmmunocytochemistry in
plants with colloidal gold conjugates. Protoplasma 121, 25-33.

Rice, RH. and Etzler, ME. (1975) Chemical Modification and hybridization of
wheat germ agglutinins. Biochemistry 14, 4093-4099.

Schlumbaum, A., Mauch, F., Vogeli, U. and Boiler, T. (1986) Plant chitinases are
potent inhibitors of fungal growth. Nature 324. 365-367.

Stinissen, H.M., Chrispeels, M.J. and Peumans, W.J. (1985) Biosynthesis of lectin

in roots of germinating and adult cereal plants. Planta 164. 278-286.

 

34
Thomas, PS. (1980) Hybridization of denatured RNA and small DNA fragments

transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77. 5201 -5205.

Triplett, BA. and Quatrano, RS. (1982) Timing, localization, and control of wheat
germ agglutinin synthesis in developing wheat embryos. Dev. Biol. 91,
491-496.

Williamson, J.D., Quatrano, RS. and Cuming, AC. (1985) E, polypeptide and
its messenger RNA levels are modulated by abscisic acid during
embryogenesis in wheat. Eur. J. Biochem. 152. 501-507.

Wright, CS. (1984) Structural comparison of the two distinct sugar binding Sites
in wheat germ agglutinin isolectin II. J. Mol. Biol. 178. 91-104.

Wright, CS. (1987) Refinement of the crystal structure of wheat germ agglutinin
isolectin 2 at 1.8 A resolution. J. Mol. Biol. 194. 501-529.

Wright, 0.8. and Olafsdottir, S. (1986) Structural differences in the two major
wheat germ agglutinin isolectins. J. Biol. Chem. 16. 7191-7195.

Wright, C.S., Gavilanes, F. and Peterson, D.L. (1984) Primary structure of wheat
germ agglutinin isolectin 2. Peptide order deduced from x-ray structure.

Biochemistry 23. 280-287.

 

Chapter 3
Expression of rice lectin is governed by two temporally and
spatially regulated mRNAs in developing embryos

ABSTRACT

Two cDNA clones encoding rice lectin have been isolated and
Characterized to investigate the expression of rice lectin at the molecular and
cellular levels. The two CDNA Clones code for an identical 23 kd protein which
is processed to the mature polypeptide of 18 kd by co-translational cleavage of
a 2.6 kd Signal sequence and selective removal of a 2.7 kd COOH-terminal
peptide which contains a potential N-Iinked glycosylation site. In addition, the
mature 18 kd lectin is post-translationally cleaved between residues 94 and 95
to yield polypeptides of 10 kd and 8 kd, corresponding to the NHz- and COOH-
terminal portions of the mature subunit, respectively. Northern blot analysis
established that rice lectin is encoded by two mRNA transcripts (0.9 kb and 1.1
kb). On Southern blots, the rice lectin cDNAs hybridize specifically to single
restriction fragments between 10 kb and 20 kb. In situ hybridization showed
localization of the 1.1 kb rice lectin mRNA in root caps and specific cell-layers
of the radicie, coleorhiza, scutellum, and coleoptiie. Northern blot analysis
demonstrated that both the 0.9 kb and 1.1 kb mRNAs are present in developing
rice embryos. The two lectin mRNAs are differentially expressed temporally such
that the 1.1 kb lectin mRNA accumulates to levels two-fold higher than the 0.9

kb mRNA.

35

 

36
INTRODUCTION

Plant lectins are a Class of proteins that bind and cross-link specific
carbohydrates. Because of their unique carbohydrate-binding properties, lectins
are widely used as tools in medical cell biology (Lis and Sharon, 1986).
Historically, plant lectin research has focused on the isolation and
characterization of new lectin species to broaden the spectrum of specific
carbohydrate-binding moieties. Although the function of lectins in plants remains
obscure, dissecting the regulation of expression of lectin genes at the molecular
level should facilitate elucidation of the protein function in vivo.

Many Of the Gramineae synthesize N-acetylglucosamine (GlcNAc)-binding
lectins with similar immunological properties (Peumans and Stinissen, 1983).
These lectins accumulate in a cell-type specific manner in various organs of
developing embryos and young seedlings. Rice lectin, initially purified and
characterized by Tsuda (1979) from rice bran, is a dimeric protein composed
of two glycine- and cysteine-rich 18 kd subunits that lack covalently-bound sugar
residues. in the cultivated rice species Oryza sativa L., the majority of the 18
kd subunits undergo a proteolytic cleavage event which yields two subunits of
8 kd and 10 kd (Stinissen et al., 1984). This lectin is synthesized as a 23 kd
monomeric precursor on the rough endoplasmic reticulum (RER) and is
subsequently assembled into dimers within the lumen of the RER (Stinissen et
al., 1984). Assembled dimers are only transiently associated with the RER

before being transported to and deposited in vacuoles/protein bodies (Stinissen

37

et al., 1984). Rice lectin accumulates in Specific cell-layers of the scutellum,
coleorhiza, radicie, root cap, and throughout cell-layers of the coleoptile of
embryos (Mishkind et al., 1983). We are interested in the molecular mechanisms
regulating cell-Specific expression of the Gramineae lectins. Two CDNA clones
encoding rice lectin have been isolated and used to examine the expression of
rice lectin in developing embryos. In this paper, we present evidence that the
two CDNA Clones represent two distinct mRNA transcripts. Each lectin mRNA
transcript exhibits a distinct pattern of temporal expression in developing
embryos. Moreover, the cell-type specific expression of rice lectin mRNAs is

developmentally and spatially regulated.

MATERIALS AND METHODS
Plant material. Developing rice (Oryza sativa L. cv. Lemont) embryos were
collected from spikes harvested at 5, 10, 20, 30, and 40 days post-anthesis
(DPA) from plants maintained under greenhouse conditions. Embryos used for
in situ hybridization experiments were processed immediately, while the bulk of
collected embryos (10, 30, 40 DPA) were quick frozen in liquid nitrogen and
stored at -80° C for RNA isolation.

Young seedlings of the rice cultivars Nato or lR36 were germinated and
grown in Baccto professional potting mix in a growth chamber with a 12-hr light
period at 27°C and a 12—hr dark period at 21°C, with the 70% humidity. Shoots

of 10—day Old seedlings were collected and frozen in liquid nitrogen for isolation

 

38
of total DNA.

Screening of a 19110 cDNA library for rice lectin. A igt10 cDNA library
constructed from poly(A)+ RNA isolated from spikes of rice Oryza sativa L. cv.
Nato was provided by Susan Wessler and Ron Okagaki (University of Georgia,
Athens, GA). Approximately 160,000 recombinant phage were grown on
Escherichia coli C600hf| at a density of 40,000 per 150-mm Petri plate and
replicated onto nitrocellulose filters as described in Maniatis et al. (1982). The
nitrocellulose filters were hybridized with 32P-random primer-labeled cDNA insert
(Feinberg and Vogelstein, 1983) from clone WGA-B (clone pNVR1 described in
Raikhel and Wilkins, 1987) for 18 hr in 6x SSC, 5x Denhardt’s solution, 0.2%
SDS, and sonicated salmon sperm DNA at 5 ug/ml. Post-hybridization washes
included three 15 min washes at room temperature and two 15 min washes at
60°C in 3x SSC,O.1% SDS. Positive phage were plaque-purified to homogeneity
(Maniatis et al., 1982) under high stringency screening conditions (Mansfield, et

al., 1989) using 32P-labeled insert from WGA-B (Raikhel and Wilkins, 1987).

DNA nucleotide sequence analysis. Inserts, designated cRL852 and cRL1035,
were purified from selected phage by electrophoresis in low-melting-point
agarose (Struhl, 1985) and cloned into pUC119 (Vieira and Messing, 1987) in

both orientations for subsequent DNA sequence determination. A sequential

39

series of overlapping deletions from both strands of the cDNA were generated
by T4 DNA Polymerase (Dale and Arrow, 1987) from full-length single-stranded
DNA templates (Vieira and Messing, 1987). Single-stranded deletion templates
were sequenced by the dideoxynucleotide chain termination method (Sanger et
al., 1977) using 35S-dATP and 7-deaza-dGTP instead of dGTP (Mizusawa et al.,
1986). Computer alignment of overlapping deletions, amino acid and sequence
analysis were performed using Microgenie software [Beckman].

A fortuitous deletion encompassing the terminal 165 bp of 3’-untranslated
region unique to CRL1035 was retrieved for use as a clone-specific probe. This
partial cDNA clone was maintained in pUC119 and given the designation

CRL165.

Amino acid sequence determination of NH;- and COOH-terrninal amino acid
residues of rice lectin. Rice lectin was purified from 10 g of mature rice
embryos (cv. lR36) via affinity Chromatography on immobilized N-
acetylglucosamine (Selectin 1, Pierce) according to the procedure detailed in
Mansfield et al. (1988). To enhance resolution of the rice lectin during SDS-
PAGE on a 15% polyacrylamide gel (Laemmli, 1970), the purified protein was 8-
carboxyamidated at 37°C for 30 min in the presence of 240 mM iodoacetimide
(Raikhel et al., 1984) prior to electrophoresis. individual subunits (8 kd and 10
kd) Of rice lectin were visualized by staining the gel briefly (10 min) in

Coomassie blue, followed by destaining in 30% methanol,7.5% acetic acid. The

4O

8 kd and 10 kd polypeptides were excised from the gel, electroeluted in
Laemmli (1970) buffer, and lyophilized. SDS was removed from protein by the
organic extraction method of Konigsberg and Henderson (1983). Removal of
salts from the protein was accomplished by dialysis against 15% acetic acid at
4°C in the dark for two days prior to lyophilization.

Amino acid sequence determinations were performed at the Protein
Chemistry Facility, University of California, Irvine. Approximately 200 picomoles
of gel-purified rice lectin was applied to a Model 477 Sequenator equipped with
a 120 on-line PTH-amino acid analyzer (Applied Biosystems, inc.) for
determination of NHz-terminal amino acid residues. The terminal amino acids of
the COOH-terminus were determined by carboxypeptidase Y digestion of 500
picomoles of rice lectin via the procedure of Hayashi (1977). The identification
and quantitation of free amino acids in digestion mixtures were accomplished

by HPLC analysis using precolumn derivatization with o-phthaldialdehyde.

Northem blot analysis. Total RNA was isolated from 50 to 150 mg of developing
rice embryos via the hot phenol method of Finkelstein and Crouch (1986) with
the addition of 1% 2-mercaptoethanol to the homogenization buffer. Northern
blots were prepared from 25 ug RNA for each developmental stage of embryos
and hybridized with random-primer-labeled cRL852 insert under stringent
conditiOns (Raikhel et al., 1988). Blots were exposed to Kodak XAR-S film with

intensifying screens at -80°C for 10 to 15 hours. Autoradiograms were scanned

41

with a Gilford densitometer.

Gene reconstruction analysis. Total DNA was isolated from 10-day old rice (cv.
lR36 or Nato) seedlings according to Shure et al. (1983) and restricted to
completion with EcoRI, Hinoill, Kpni-, Smal-, or Xbal. Two ug of digested DNA
(3.3 X 10° genome equivalents) and 0.5-, 1.0-, and 3.0-copy equivalents of the
CRL1035 CDNA clone were fractionated by agarose gel electrophoresis and
transferred to nitrocellulose (Maniatis et al., 1982). Gene copy reconstructions
were based upon a rice genome size of 5.47 X 105 kb per haploid genome
(Francis et al., 1985). Hybridization and post-hybridization washes of the
reconstruction blot were performed as described for Northern blots with the
exception that random-primer radiolabeled insert from cRL1035 was used as a

probe.

In situ hybridization. Inserts from the CDNA clones CRL852, CRL1035, and
cRL165 were subcloned into the EcoRI site of Bluescript (M13+) [Stratagene]
for in vitro transcription of RNA transcripts. Sense and antisense transcripts
labeled with “S-rUTP were synthesized from the T3 or T7 promoters, hydrolyzed
to approximately 100-300 bases, and prepared for in situ hybridization as
described in Raikhel et al. (1989). Frozen tissue sections (8 to 10 um) from
developing rice embryos were processed and hybridized with radiolabeled sense

or antisense RNA transcripts from cRL852 or CRL1035 as detailed in Raikhel et

42

al. (1989). In situ hybridization with clone CRL165 was performed identically as
with the full-length Clones as described above with the exception that

hybridization and post-hybridization washes were conducted at 42°C.

RESULTS

Two cDNA clones encodingn‘celectin diflerinthelengthoftheirfluntranslated
region. Relying upon molecular and immunological similarities to rice lectin
(Peumans and Stinissen, 1983), the cDNA clone WGA-B (Raikhel and Wilkins,
1987; Raikhel et al., 1988) encoding isolectin B of wheat germ agglutinin (WGA)
was used as a heterologous probe to isolate CDNA clones encoding rice lectin.
The complete nucleotide sequence and the deduced amino acids of two cDNA
Clones, designated cRL852 and cRL1035, are presented in Figure 1A. The two
CDNA Clones are identical at the nucleotide and amino acid levels with the
exception that CRL1035 contains an additional 183 bp of 3’-untranslated region
extending beyond the 3’-terminus of cRL852 (denoted by a closed arrowhead
in Figures 1A and 1B). The CDNA clone cRL1035 contains two putative
polyadenylation signals (underlined in Figure 1A), AATAAA and an extended
AATAAATAAA, located 86 and 150 nucleotides downstream from the coding
region, respectively. The polyadenylation signal located proximal to the coding
region (AATAAA), is common to both CDNA clones and is positioned 64
nucleotides upstream from the second polyadenylation signal. The

AATAAATAAA polyadenylation signal distal to the coding region is unique to

43

Figure 1. Nucleotide sequence and deduced amino acids of two cDNA clones.

cRL852 and cRL1035. encoding rice lectin.

(A)

The deduced amino acid sequence for the rice lectin preproprotein is
depicted as single letter codes positioned above the nucleotide sequence.
Nucleotides are numbered on the left. The first amino acid (methionine)
of the preproprotein is indicated by -28. The respective NH2- and COOH-
terminal residues of the mature lectin are indicated by arrows positioned
above residues 0+1 and G173. An open triangle represents the
endoproteolytic cleavage site between residues N94 and G95 of the
mature 18 kd subunit of rice lectin. The 26 amino acids which extend
beyond the COOH-terminus of the mature protein are depicted by the
boxed residues. The potential N-Iinked glycosylation Site at residue N183
is denoted by an asterisk. The final nucleotide of CRL852 is indicated by
the solid arrowhead at position 852. Nucleotides beyond position 852
represent 3’-untranslated region unique to cRL1035. Underlined AT-rich
sequences at positions 825 and 889 indicate presumptive polyadenylation
signals. The extended polyadenylation signal at position 889 apparently

represents two overlapping polyadenylation consensus sequences.

97

193

289

385

481

577

673

769

865

961

44

-28 -20
N T N T S T T T K A N A N
CCTACATTTTGCTAACTATCCAGTACCAAGAACGGAGCTCCAAGGAifAGACGTACGATCACCATGACGTCCACGACGACGAAGGCCATGGCGATG
'10 -1 10
A A A V L A A A A V A A T N A 0 T C G K O N D C N I C P N N L C
GCCCCGGCGGTCCTCGCCGCCGCCGCCGTCGCGGCCACGAACGCGCAGACGTCCGGGAAGCACAACGACGGCATGATCTGCCCGCACAACCTGTGC
20 30 40

C S O F G Y C G L G R D Y C G T G C O S C A C C S S O R C C S O
TGCAGCCAGTTCGGGTACTGCGGCCTCGGCCCCGACTACTGCGGCACGGGGTGCCAGAGCGGCGCCTGCTGCTCCAGCCAGCGCTGCGGCAGCCAG
50 60 70 80

G G C A T C S N N 0 C C S O Y C Y C G F G S E Y C G S C C O N C
GCCGGCGGCGCCACCTGCTCCAACAACCAGTGCTGCAGCCAGTACCGCTACTGCCGCTTCGGCTCCGAGTACTGCCCCTCCGGGTGCCAGAACGGG

90 ‘7 100 110
P C R A D I K C G R N A N C E L C P N N N C C S O N G Y C G L G
CCGTGCCGCGCCGACATCAACTGCGGCCGCAACGCCAACGGCGAGCTCTGCCCCAACAACATGTGCTGCAGCCAGTCGGGATACTGCGGCCTCGGC
120 130 140
S E F C G N G C 0 S G A C C P E K R C G K 0 A G G D K C P N N F
AGCGAGTTCTGCGGCAACGGATGCCAGAGCGGCGCGTGCTGCCCGGAGAAGCGGT6C6GCAAGCAGGCCGGCGGGGACAAGTGCCCCAACAACTTC
150 160 170
C C S A G G Y C G L G G N Y C G S G C O S G G C Y K 6 GI D G N A
TGCTCCAGTGCCGGCGGCTACTGCGGCCTCGGCGGCAACTACTGCGGCTCCGCCTGCCAGAGCGGCGGCTGCTACAACGGTGGCGACGCCATGGCG
180 * 190 199

A i L A N N O S V S F E G I I E S V A E L V]
GCCATCCTGGCTAACAACCAGAGCGTCTCTTTCGAAGGGATCATCGAGTCAGTGGCTGAGCTTGTGTAGATCGATGAGTCGATCCTCGCCATGAGC

V
GTTTTCTGCTTTGTATGCCTCTCGGCGTACAGGGCTTTTCAGCTTAGCTGCCTTTCAATAAAATCACTGATCATGGCGATCGACATCCAGAGCACT

 

GTTGTGTACGTAGTTGCTCATCTCAATAAATAAAGGGGCTGAGCCTGAGCTGCTGCCTAGCTCGCACCAACAGAGTCCGGCCGGGAGGAGTTGTAG

TTTCTGAAGGTGAGCTAGCTAGCTTTGGGATCGATGTATGGATCAGCAATGTAACAATGTCTTGTGGAAGCCCGTAAAAAAAA

45

Figure 1. Nucleotide sequence and deduced amino acids of two cDNA clones,

cRL852 and cRL1035. encoding rice lectin.

(3)

Organization of the cDNA clones CRL852, CRL1035, and CRL1035-specific
Clone CRL165. The Clone-specific cDNA CRL165 corresponds to
nucleotides 878 to 1043 of CRL1035 3’-untranslated regions are also
indicated on the map. The solid box represents the coding region while
the hatched and stippled boxes refer to the signal sequence and the
COOH-terminal extension peptide, respectively. Arrows demarcate the
NHZ- and COOH-terminal of mature rice lectin, respectively. The asterisk
denoted the potential N-linked glycosylation site contained within the

COOH-terminal domain.

46

 

 

<
B 5
< ’-
2 3
5' cRL1035 5 E 3'
.L w * -T F :(A)8
i afiIIAlw
cRL852 H———HA)8

47

CRL1035 and represents an apparent fusion of two overlapping polyadenylation
signal consensus motifs (AATAAA). Both clones, CRL852 and cRL1035, contain
57 nucleotides of 5’-untranslated region preceding an ATG initiation codon,
which is followed by an open reading frame of 681 bases with a translation
termination codon (TAG) at position 739. The protein encoded by the open
reading frame of both clones encompasses 27 amino acid residues with
calculated Mr 22,798. Comparison of partial amino acid sequence data (Chapot
et al., 1986) with the deduced amino acid sequence from the two CDNA clones
confirms that the clones encode rice lectin. Moreover, in vitro translation
products synthesized from RNA transcripts generated for each Clone are
immunoprecipitable with polyclonal antiserum raised against WGA (data not
shown).

The polypeptide encoded by the two lectin cDNA clones contains an alanine-
rich array Of 28 amino acid residues (M, 2,643) at the NHZ-terminus (hatched
box, Figure 18) exhibiting the predicted tripartite organization of eukaryotic signal
sequences (von Heijne, 1983). Predicated upon the organization, the proteolytic
processing of the signal sequence presumably occurs in rice lectin between an
alanine (A-1) and glutamine residue (0+1, arrow in Figure 1A,B) of the deduced
amino acid sequence. NH2-terminal amino acid analysis of mature rice lectin
indicated that the terminus is blocked. These data are congruent with earlier
reports predicting that the NHz-terminal residue of rice lectin is a glutamine which

is presumably modified by cyclization to pyrrolidone carboxylic acid (Chapot et

48

al., 1986), a residue which is resistant to Edman degradation. initiating with
glutamine 0+1, the cDNAs encode a protein comprised of 199 amino acids with
calculated Mr 20,172. However, amino acid sequence analysis of the COOH-
terminal amino acids indicates that mature rice lectin terminates at the glycine
residue G173 (arrow in Figure 1A,1B). Thus, determination of terminal amino
acid residues revealed that the mature polypeptide Of rice lectin is comprised
of 173 amino acids with Mr 17,512 (demarcated by arrows in Figure 1A,B and
a solid box in Figure 1B). The amino acid composition indicates that the mature
subunit of rice lectin is a glycine- and cysteine-rich polypeptide. Cysteine (23%)
and glycine (19.7%) together account for almost 43% of the mature polypeptide
amino acid composition.

In addition to the signal sequence and the mature rice lectin subunit, the
cDNAs encode proteins with an additional 26 amino acids (Mr 2,678) extending
beyond the COOH-terminus of mature rice lectin (boxed residues in Figure 1A,
stippled box in Figure 1B). This COOH-terminal extension is a relatively
hydrophobic domain and contains a potential N-linked glycosylation site at
asparagine residue N179 (asterisk in Figures 1A,B). Rice lectin is therefore
synthesized as a preproprotein that requires the proteolytic removal Of the signal
sequence and post-translational processing of a COOH-terminal domain to yield
the mature polypeptide. In vacuoles, the mature 18 kd subunit polypeptide
undergoes additional post-translational processing to yield two smaller

polypeptides of approximately 10 kd and 8 kd (Stinissen et al., 1984). To

49

resolve the relationship between these polypeptides and the protein encoded by
the cDNAs, both polypeptides were purified and subjected to MHz-terminal and
COOH-terminal amino acid sequence analyses. Results from these analyses
indicate that the mature subunit of rice lectin is proteolytically cleaved between
amino acids residues 94 and 95 as deduced from the cDNA clones (open
arrowhead, Figure 1). The resultant 10 kd and 8 kd polypeptides correspond
to the NH2- and COOH-terminal portions of the mature 18 kd protein,
respectively.

A comparison of amino acids from rice lectin and isolectin B of wheat germ
agglutinin (WGA-B) is presented in Figure 2. Rice lectin exhibits 73% identity
with WGA-B (boxed amino acids in Figure 2) within the coding region of the
mature subunits spanning from glutamine Q+1 to glycine G171 in WGA-B or
glycine G173 in rice lectin. The overall homology between the two lectins
increases to 79.5% when conserved amino acid changes (asterisks in Figure 2)
are included in the comparison. Both rice lectin and WGA-B require the post-
translational processing of COOH-terminal domains to produce the mature 18
kd subunit. Alignment of the 26 amino acid COOH-terminal domain from the
proprotein of rice lectin and the 15 amino acid COOH-terminal domain from pro-
WGA-B for maximal homology shows a 46.7% overall amino acid conservation,
indicating that this region is less conserved than the coding region of the mature

protein.

50

65:98 3 88:8
mam 958. 05 m5 cmmEmn mmmcmzo Que oEEm omammcoo memos; 8:982 Umxoo E 8858 Be moon
oEEm .mozcwC. .fimmr .mc_x__>> Ccm 65:me m-<o>> Lo 853% com oEEm m_nm__m>m m5 9 329:0:
.mE_me .9 omega mm; snow. CO: Co 8533 now 058m 802me 92950 on... A955 5556?

Emu «was; .6 m anemia new 582 me: 5953 89.253 Eon oEEw .6 somewano .N 959“.

51

 

1 Q
h m

> I A

> H m < > w m H H U

P m B H 4 m < h >
c
w 0 z A H < d I U o
D U U U U 0 U U 1 U U a U m H U U m 3 M m U U r F U > K O I U U m

l e a
U K V U U U m G U U m U U a 2 U H U U i U 4 m U U h a U K D O I U U m

  

 

 

 

 

OOH OvH
o H m z N U U m N m U A U U a U 3 O m U U A z z a U a M U 0 m
c c I
H A U w 2 U U h N m U A U U N U B O m U U I z z A U A N z z m
ONH OOH
Q d m U A U U 0 U U t U U > N 1 U L U U I U N O m U U = m U E x < O m U U m K
c a
D d m U A U 2 O U U m U U a N m U L U U r U > 0 m U U 0 m U B t U 0 m U U m 0
on ow
B I U fl U 2 M U U N O U I U U N U N O m U U A z z A U H I U m U H U U m
i i e
m U U d U m B U U N D m A U U > U h 0 m U U A z I m U H I U O z I U U 8
cc ON H+

< 2 E < < > d < < < A > < < < I < t < x F F B U B I B I

ml<U3

NUHK

MI<U3

8
E

mltUB

mltUI

NUHZ

mUHm

52

Rice lectin is encoded by two different mRIWIs. To explore the relationship
between the two CDNA clones encoding rice lectin, a Northern blot containing
total RNA from developing rice embryos (10 to 20 days post-anthesis (DPA))
was probed with 32P-labeled insert from cRL852 or CRL1035. Two mRNA
species of approximately 1.1 kb and 0.9 kb were identified (Figure 3A).
Therefore, the two cDNA Clones correspond to the two mRNAs and did not arise
from cloning artifacts. To discriminate expression due solely to the 1.1 kb
mRNA species, a clone-specific probe (cRL165) encompassing 165 bp of the
3’-untranslated region unique to CRL1035 was constructed (see Figure 1B). The
specificity of CRL165 as a clone-specific probe for the CDNA CRL1035 and the
1.1 kb lectin mRNA transcript was confirmed by Southern and Northern blot
analysis, respectively (data not shown).

To determine the number of rice lectin genes responsible for the two
mRNAs, Southern blots containing restricted genomic DNA were hybridized with
32P-labeled inserts from cDNA clones cRL852, cRL1035, or cRL165. Figure 3B
shows a representative Southern blot depicting single restriction fragments of 11
kb and 15 kb detected in EcoRI- and HindlIl—digested genomic DNA (cv. lR36),
respectively, probed with radiolabeled insert from cRL1035. Single restriction
fragments between 10 kb and 20 kb were also detected in EcoRl-, Hinoill,
Kpn|-, Smai- and XbaI-restricted genomic DNA from the rice cultivars lR36 or
Nato (data not shown). The identification of single restriction fragments by both

the full-length and the clone-specific cDNAs suggests that rice lectin is

53

Figure 3. Northern blot and gene reconstruction analysis of rice lech'n.

(A)

(3)

Northern blot containing 25 ug total RNA isolated from developing rice
embryos (cv. lR36) and hybridized with radiolabeled insert from cRL852.

The size Of the lectin mRNAs in kb are indicated to the left of the blot.

Southern blot containing 3.3 X 10° genome equivalents of rice genomic
DNA (cv. lR36) restricted with EcoRI of Hinolll and probed with
radiolabeled cRL1035. Reconstruction lanes represent 05-, 1.0-, and 3.0-
gene copy equivalents of CRL1035 per haploid genome. Approximate

Sizes in kb are positioned to the right.

54

3

1

opies/lN

5
c -
HHHUGHE
HMOUN

d2“

-15
-1

3
lift ililiiilililillil i.
.9. vile.
Ir. .5 .
.3? £4.95...
A
_ .
1 9
D .

 

55
encoded by a single gene.

Gene reconstruction experiments (Figure 38) were performed with restricted
rice genomic DNA and purified insert from cRL1035 to ascertain the number of
copies of the rice lectin gene present in the genome. Comparison of relative
intensities of cDNA cRL1035 titered at 0.5-, 1-, and 3-copies per haploid genome
and the intensity of genomic DNA restriction fragments from cv. lR36 (Figure 38)
demonstrated that the gene for rice lectin is present in 1 to 2 copies per haploid
genome. In summary, Northern and Southern analyses indicate that the
expression of rice lectin is determined by two mRNAs possibly derived from a
single gene present in low copies in the genome of the diploid rice species

Oryza sativa L.

The difl‘erentia/ expression of the two n'ce lectin mRNAs are temporal/y and
spatially regulated Using in situ hybridization in conjunction with Northern blot
analysis, the cDNA clones encoding rice lectin were employed to investigate
the expression of rice lectin during embryo development. In situ hybridization
experiments were specifically performed to determine if the cell-specific
accumulation of rice lectin in the diverse tissue types of developing embryos (i.e.
radicle versus coleoptile) results from the spatial regulation of the two rice lectin
mRNAs. Tissue sections of developing embryos harvested at 5, 10, 20 and 30
DPA were hybridized with 35S-labeled antisense RNA transcripts generated from

cRL852 to localize both the 0.9 kb and 1.1 kb lectin mRNAs in situ. As

56

illustrated in Figure 4, rice lectin mRNAs localized by cRL852 antisense
transcripts in embryos 20 DPA are confined to root caps, several cell-layers at
the periphery of the coleorhiza and radicie, and in all cell-layers of the coleoptile.
Not shown is the presence of lectin mRNA in the peripheral cell-layers of the
scutellum. Moreover, the tissue-specific accumulation of lectin mRNA in the
diverse tissue-types of the embryos is discernible as early as 5 DPA and
persists throughout embryogenesis and seed maturation (data not shown).
Sense RNA transcripts were used as controls to ascertain backgrounds levels
due to the non-specific binding of probes to tissue sections. No hybridization
was observed in control sections probed with sense RNA transcripts (data not
shown).

In situ hybridization was performed in parallel using radiolabeled antisense
RNA transcripts synthesized from the clone-specific cDNA, cRL165, to detect the
specific accumulation of the 1.1 kb lectin mRNA during embryo development.
The results revealed that the 1.1 kb mRNA shows the same tissue-specific
distribution of lectin mRNA localized by cRL852 antisense RNA transcripts in all
developmental stages examined (data not shown). Thus, the 1.1 kb lectin
mRNA accumulates in specific cell-layers of the root caps, coleorhiza, scutellum,
radicie, and coleoptile of mature and developing embryos as early as 5 DPA.

Northern blot analysis was employed to resolve both the 0.9 kb and 1.1 kb
lectin mRNA species and to ascertain what fraction of lectin mRNA can be

attributed to each mRNA during embryogenesis. Northern blots prepared from

57

Figure 4. Localization of rice lectin mRNAs in a developing embryo. In situ
hybridization of embryo sections harvested at 20 DPA and hybridized with 3"’8-
labeled antisense transcript generated from the rice lectin cDNA clone cRL852

as described in Methods.

(A) Bright field photomicrograph detailing the cellular organization of a
developing rice embryo. C, R, Co, refer to the coleoptile, radicle, and

coleorhiza, respectively.

(B) Dark field photomicrograph depicting the tissue-specific distribution of
rice lectin mRNA in a developing rice embryo. The white grains represent

formation of RNA/RNA hybrids. Bar=50 um.

 

 

58

 

59
total RNA isolated from embryos harvested at 10, 30 and 40 DPA were
hybridized with radiolabeled insert from cRL852 and are depicted in Figure 5.
Both lectin mRNAs are present at high levels in developing embryos harvested
at 10 DPA (Figure 5, lane 2). Lane 1 of Figure 5 contains one-half of the total
RNA contained in lane 2 to enhance resolution of the two lectin mRNAs.
Concomitant with the onset of desiccation and seed maturation at around 20
DPA, relative levels of lectin mRNA present in total RNA decreased to low levels
(Figure 5, lanes 3 and 4). The dramatic decline in lectin mRNA levels between
10 and 30 DPA embryos is accompanied by a temporal change in the relative
levels of the individual mRNA species. In embryos at 10 DPA, the 0.9 kb and
1.1 kb lectin mRNA transcripts are present at similar levels. By 30 DPA,
however, the 1.1 kb lectin mRNA accumulates to levels approximately two-fold
higher than the 0.9 kb mRNA. Thus, both mRNAs are expressed and

differentially regulated in the radicles and coleoptiles of developing embryos.

DISCUSSION

Two cDNA clones encoding the embryo-specific lectin of rice were isolated
and used to characterize the expression of rice lectin in developing embryos at
the molecular and cellular levels. The results from these studies have resolved
the relationship between the different molecular forms of rice lectin. Previous
studies demonstrated that the 23 kd precursor of rice lectin synthesized on the

RER is post-translationally processed to an 18 kd polypeptide (Stinissen et al.,

60

Figure 5. Differential expression of rice lectin mRNA during embryo
development. A Northern blot of total RNA from developing embryos was
hybridized with 32P-labeled insert from cDNA clone cRL852. Lane 1 contains
12.5 ug of total RNA from embryos harvested at 10 DPA. Lanes 2, 3, and 4
contain 25 ug of total RNA from embryos collected at 10, 30, and 40 DPA,

respectively. Sizes (kb) of each lectin mRNA are indicated to the right.

61

dmn o¢

de om

4&0 OH

19
10

62

1984). However, the nature of these processing events which result in the
conversion of the 23 kd protein to the 18 kd form remained unidentified.
Characterization of two cDNAs, which encode identical 23 kd preproproteins,
indicates that processing of both NH2- and COOH-terminal sequences are
required to generate the 18 kd rice lectin subunit. As predicted for proteins
destined for entry into the endomembrane system of the secretory pathway, the
deduced amino acid sequence of both rice lectin cDNA clones contain a 2.6 kd
signal sequence which is co-translationally cleaved by an endopeptidase within
the lumen of the RER. Mapping of COOH-terminal amino acid residues also
implicates the selective removal of a COOH-terminal domain of 2.7 kd containing
a potential N-linked glycosylation site to yield the 18 kd polypeptide. Similar
COOH-terminal N-glycopeptides have been described for isolectin B of WGA
(Raikhel and Wilkins, 1987; Mansfield et al., 1988) and tobacco fi-1,3-glucanase
(Shinshi et al., 1988). The primary sequence of the COOH-terminal domains of
WGA-B, rice lectin, and ,6-1,3—glucanase are not conserved. Interestingly,
however, secondary structure predictions of these COOH-terminal domains
revealed that these domains are amphipathic a-helices. The possible functional
role of the COOH-terminal domains of WGA-B and rice lectin in the targeting of
these proteins to vacuoles is currently under investigation.

Unlike cereal lectins, the majority of the 18 kd mature subunit of rice lectin
is post-translationally processed to two smaller polypeptides of 10 kd and 8 kd

(Stinissen et al., 1984). Determination of the NHz-terminal and COOH-terminal

63
residues of these two polypeptides established the internal cleavage of the 18
kd subunit occurs between asparagine N94 and glycine G95. Moreover, the
data show that the 10 kd and 8 kd polypeptides correspond to the NH2- and
COOH-terminal portions of the 18 kd subunit, respectively.

DNA sequence and Northern blot analyses established that the two rice
lectin cDNA clones, which differ solely in the length of their 3’-untranslated
regions, represent two mRNAs which code for the same polypeptide. The
occurrence of two transcripts displaying heterogeneous 3’-untranslated regions
but encode identical polypeptides is not unprecedented in plants (Messing et
al., 1983; Dean et al., 1986; Shinshi et al., 1988). However, these observations
have been limited to analysis of genomic sequences or the isolation of multiple
related cDNAs exhibiting 3’ heterogeneity. Unlike animal systems (Breitbart et
al., 1987), a possible correlation between multiple mRNA transcripts and tissue-
specific or developmentally regulated genes has not been established in plants.
In situ hybridization experiments were therefore performed to determine if the
cell-specific expression of rice lectin in particular tissues of developing embryos
is due to the spatial regulation of the two rice lectin mRNAs. The 1.1 kb lectin
mRNA was specifically localized to root caps, peripheral cell-layers of the radicie,
coleorhiza and scutellum, and throughout the cell-layers of the coleoptile of
developing embryos. In the absence of a probe specific for the 0.9 kb lectin
mRNA, however, in situ hybridization experiments were unable to localize the

expression of this mRNA species to specific embryonic tissues. Furthermore,

64
sensitivity limits encountered with in situ hybridizations mask potential quantitative
changes in the temporal expression of the two lectin mRNAs.

Northern blot hybridizations demonstrate conclusively that both lectin
mRNAs are temporally and spatially regulated in developing rice embryos. Both
lectin mRNAs are actively expressed and accumulate in a cell-specific manner
commensurate with the deposition of the protein in developing embryos
(Mishkind et al., 1983). The expression of rice lectin in specific cell-layers of
embryonic tissues represents the net expression of both the 0.9 kb and 1.1 kb
mRNAs. The differential expression of the individual lectin mRNAs is regulated
by more than one mechanism. On one level, the expression of rice lectin is
developmentally regulated such that both lectin mRNAs are present at high
levels during early embryogenesis but decline to low levels during the maturation
of the embryo. In addition to the developmental regulation of rice lectin, the two
mRNAs are differentially expressed and accumulate to different levels. Although
both lectin mRNAs are expressed to the same levels during the rapid synthesis
and accumulation of rice lectin at around 10 DPA (Peumans and Stinissen,
1983), the 1.1 kb lectin mRNA is the more prevalent species during the latter
stages of embryo development.

Hybridization of the lectin cDNA clones to single restriction fragments on
Southern blots suggests that rice lectin is encoded by a single gene. However,
this analysis does not preclude the possibility that several genes are involved

in the expression of the two rice lectin mRNA transcripts. Operating on the

65
premise that rice lectin is encoded by a single gene, the two lectin mRNAs may
result from alternative polyadenylation site selection during post-transcriptional
processing of the pre—mRNA. The temporal regulation of the two rice lectin
mRNAs observed during embryogenesis may be the consequence of preferential
polyadenylation site selection, differential stability, or selective export of the
transcripts from the nucleus.

The lectins of the Gramineae exhibit differential localization in specific cell-
layers of the embryo (Mishkind et al., 1983). The most limited distribution of the
Gramineae lectins is observed in barley (2n=2x=14) embryos, where the lectin
accumulates only in root tissues. In wheat (2n=6x=42), WGA is present not
only in embryonic root tissues, but is also localized in the outermost cell layer
of the coleoptile. At least three isolectins are responsible for this expression of
WGA in hexaploid wheat embryos. Rice (2n=2x=24) embryos exhibit the
broadest distribution of lectin with expression in root tissues and throughout the
cell-layers of the coleoptile. Thus, the net tissue-specific expression of rice
lectin is distinctive from the other lectins of the Gramineae. These results have
extended our understanding of the regulation of rice lectin and have facilitated
our studies to elucidate the molecular mechanisms regulating the cell-layer

specific expression of Gramineae lectins in embryonic tissues.

 

 

66
REFERENCES

Breitbart, R.E., Andreadis, A., and Nadal-Ginard, B. (1987) Alternative splicing:
A ubiquitous mechanism for the generation of multiple protein isoforms
from single genes. Ann. Rev. Biochem. 56, 467-495.

Chapot, M.-P., Peumans, W.J., and Strosberg, AD. (1986) Extensive homologies
between lectins from non-leguminous plants. FEBS Lett 195, 231-234.

Dale, R.M.K., and Arrow, A. (1987) A rapid single-stranded cloning, sequencing,
insertion, and deletion strategy. Meth. Enzymol. 155. 204-231.

Dean, 0., Tamaki, S., Dunsmuir, P., Favreau, M., Katayama, C., Dooner, H., and
Bedbrook, J. (1986) mRNA transcripts of several plant genes are
polyadenylated at multiple sites in viva. Nuc. Acids Res. 14. 2229-2240.

Feinberg, AR, and Vogelstein, B. (1983) A technique for radiolabeling DNA
restriction endonuclease fragments to high specific activity. Anal. Biochem.
132. 6-13.

Finkelstein, R.R., Crouch, ML. (1986) Rapeseed embryo development in culture
on high osmoticum is similar to that in seeds. Plant Physiol. 81. 907-912.

Francis, 0., Ndd, AD, and Bennett, MD. (1985) DNA replication in relation to
DNA 0 values. In The Cell Division Cycle in Plants, J.A. Bryant and D.
Frances, eds (Cambridge: Cambridge University Press), pp. 61-82.

Hayashi, R. (1977) Carboxypeptidase Y in sequence determination of peptides.

Methods Enzymol. 47. 84-93.

67

Konigsberg, WM, and Henderson, L. (1983) Removal of sodium dodecyl sulfate
from proteins by ion-pair extraction. Meth. Enzymol. 91, 254-259.

Laemmli, UK (1970) Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227, 680-685.

Lis, H., and Sharon, N. (1986) Lectins as molecules and as tools. Ann. Rev.
Biochem. 55, 35-67.

Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982) Molecular Cloning. A
Laboratory Manual. (Cold Spring Harbor, New York: Cold Spring Harbor
Laboratory Press).

Mansfield, MA, Peumans, W.J., and Raikhel, NV. (1988) Wheat-germ agglutinin
is synthesized as a glycosylated precursor. Planta 173. 482-489.
Messing, J., Geraghty, D., Heidecker, G., Hu, N.—T., Kridl, J., and Rubenstein, l.
(1983) Plant gene structure. In Basic Life Sciences, Vol. 26, Genetic
Engineering of Plants: An Agricultural Perspective, T. Kosuge, C.P.
Meredith and A. Hollaender, eds (New York: Plenum Press), pp. 211-227.

Mishkind, M.L., Palevitz, B.A., Raikhel, N.V., and Keegstra, K. (1983) Localization
of wheat germ agglutinin-like lectins in various species of the Gramineae.
Science 220. 1290-1292.

Mizusawa, S., Nishimura, S., and Seela, F. (1986) Improvement of the dideoxy
chain termination method of DNA sequencing by use of deoxy-7-
deazaguanosine triphosphate in place of dGTP. Nuc. Acids Res. 14, 1319-

1 324.

68

Peumans, W.J., and Stinissen, HM. (1983) Gramineae lectins: Occurrence,
molecular biology and physiological function. In Chemical Taxonomy,
Molecular Biology, and Function of Plant Lectins, l.J. Goldstein and ME.
Etzler, eds (New York: Alan R. Liss, Inc.), pp. 99-116.

Raikhel, N.V., Mishkind,M.L., and Palevitz, BA. (1984) Characterization of a
wheat germ agglutinin-like lectin from adult wheat plants. Planta 162. 55-
61.

Raikhel, N.V., Bednarek, S.Y., and Lerner, DR. (1989) In situ RNA hybridization
in plant tissues. In Plant Molecular Biology Manual, 8.8. Gelvin and RA.
Schilperoort, eds (Boston: Kluwer Academic Publishers), B 9, 1-32.

Raikhel, N.V., Bednarek, S.Y., and Wilkins, TA. (1988) Cell-type specific
expression of a wheat-germ agglutinin gene in embryos and young
seedlings of Triticum aestivum. Planta 126, 406-414.

Raikhel, N.V., and Wilkins, TA. (1987) Isolation and characterization of a cDNA
clone encoding wheat germ agglutinin. Proc. Natl. Acad. Sci. USA 64,
6745-6749.

Sanger, F., Nicklen, 8., and Coulsen, AR. (1977) DNA sequencing with chain-
terminating inhibitors. Proc. Natl. Acad. Sci. USA 56, 5463-5467.

Shinshi, H., Wenzler, H., Neuhaus, J-M., Felix, G., Hofsteenge, J., and
Meins, F. Jr. (1988) Evidence for N- and C-terminal processing of
a plant defense-related enzyme: Primary structure of tobacco

prepro-fl-1,3—glucanase. Proc. Natl. Acad. Sci. USA 85. 5541-5545.

69

Shure, M., Wessler, S., and Fedoroff, N. (1983) Molecular identification and
isolation of the waxy locus in maize. Cell 35, 225-233.

Stinissen, H.M., Peumans, W.J., and Chrispeels, M.J. (1984) Subcellular site of
lectin synthesis in developing rice embryos. EMBO J. 3. 1979-1985.

Struhl, K. (1985) A rapid method for creating recombinant DNA molecules.
Bio Techniques 3. 452-453.

Tsuda, M. (1979) Purification and characterization of a lectin from rice
bran. J. Biochem. 86, 1451-1461.

Vieira, J., and Messing, J. (1987) Production of single-stranded plasmid DNA.
Meth. Enzymol. 153, 3-11.

von Heijne, G. (1982) Patterns of amino acids near signal-sequence

cleavage sites. Eur. J. Biochem. 133. 17-21.

Chapter 4
Role of propepfide glycan in post-translational processing and
transport of barley lectin to vacuoles in transgenic tobacco

ABSTRACT

Mature barley lectin is a dimeric protein comprised of two identical 18 kd
polypeptides. The subunits of barley lectin are initially synthesized as
glycosylated proproteins which are post-translationally processed to the mature
protein preceding or concomitant with deposition of barley lectin in vacuoles.
To investigate the functional role of the glycan in processing and intracellular
transport of barley lectin to vacuoles, the sole N-Iinked glycosylation site residing
within the COOH-terminal propeptide of barley lectin was altered by site-directed
mutagenesis. cDNA clones encoding wild-type (wt) or glycosylation-minus
(g/y) barley lectin preproproteins were placed under the transcriptional control
of the cauliflower mosaic virus 35$ promoter and introduced into Nicotiana
tabacum cv. Wisconsin 38. Barley lectin synthesized from both the wt or g/y
constructs is processed and correctly targeted to vacuoles of tobacco leaves.
Localization of barley lectin in vacuoles processed from the nonglycosylated gly
proprotein indicates that the high mannose glycan of the barley lectin proprotein
is not essential for targeting barley lectin to vacuoles. However, pulse-chase
labeling and monensin experiments demonstrated that the glycosylated wt
proprotein and the nonglycosylated gly proprotein are differentially processed

to the mature protein and transported from the Golgi complex with distinctive

70

71
and characteristic kinetics. These results implicate an indirect functional role for
the glycan in post-translational processing and transport of barley lectin to

vacuoles.

INTRODUCTION

Many proteins entering the endomembrane system of the secretory
pathway are modified in the lumen of the rough endoplasmic reticulum (RER)
by the covalent attachment of high-mannose oligosaccharide sidechains
(glycans) to selected asparagine (N) residues. The N-Iinked high—mannose
glycans may be subsequently modified to complex glycans as the glycoprotein
traverses through the Golgi complex. Inhibition of glycosylation by site-directed
mutagenesis or the drug tunicamycin apparently does not affect the synthesis,
intracellular transport, or function of some glycoproteins (reviewed in Olden et
al., 1985). However, the N-linked glycans of other glycoproteins have been
shown to influence protein folding (Machamer and Rose, 1988; Matzuk and
Boime, 1988), oligomerization (Matzuk and Boime, 1988), stability (reviewed in
Olden et al., 1985), and protein targeting (Kornfeld, 1986).

Studies exploring the functional role of N-Iinked oligosaccharides in plants
have been limited. Proteins modified by N-linked glycosylation may be localized
within a subcellular compartment or in the cell wall. The glycans of the vacuolar
protein phytohemagglutinin (PHA) and the secreted a-amylase of rice, however,

are not required for transport and targeting of these proteins to their respective

72

compartments (Bollini, et al., 1985; Voelker, et al., 1989; Akazawa and Hara-
Nishimura, 1985). In fact, many vacuolar and secretory proteins are not
glycoproteins, suggesting that N-Iinked oligosaccharide side-chains do not
generally function as sorting signals. A functional role for the glycan of the
vacuolar protein concanavalin A (ConA), however, has been implicated in the
intracellular processing and transport of this protein (Faye and Chrispeels, 1987).
Mature ConA is not a glycoprotein, although it is synthesized as a glycosylated
precursor (proConA) (Herman, et al., 1985). The mature ConA polypeptide is
generated by the excision of an internal glycopeptide from proConA and
subsequent ligation of the two resultant polypeptides (Bowles, et al., 1986).
Inhibition of N-linked glycosylation with the inhibitor tunicamycin significantly
impedes transport of proConA from the ER/Golgi compartment to vacuoles
(Faye and Chrispeels, 1987).

The post-translational processing of Gramineae lectins, which are soluble
vacuolar proteins, is distinctive from PHA and ConA. The mature lectins of
wheat, barley, and rice are 36 kd dimers assembled from two identical 18 kd
subunits (Rice and Etzler, 1974; Peumans, et al., 1982a; Peumans, et al., 1983).
Similar to ConA, mature Gramineae lectins are not glycoproteins. However, the
lectin subunits are initially synthesized as glycosylated proproteins in wheat
(Mansfield, et al., 1988), barley (Lerner and Raikhel, 1989) and rice (Wilkins and
Raikhel, 1989; unpublished results). The sole N-Iinked glycosylation site (Asn-

X-Ser/T hr) resides within the propeptide located at the COOH-terminal of these

73
proproteins. Endo-fi-N-acetylglucosaminidase H (Endo H) studies have
demonstrated that the oligosaccharide side-chain of these proproteins is a high
mannose glycan with a molecular weight of approximately 2 kd (Lerner and
Raikhel, 1989; Smith and Raikhel, 1989; Wilkins and Raikhel, unpublished
results). The COOH-terminal N-glycopeptide of the proprotein is post-
translationally removed prior to or concomitant with deposition of the mature
protein in vacuoles. The transient glycosylation of the Gramineae lectin
proproteins provides a unique opportunity to investigate the molecular
mechanisms which mediate the maturation and targeting of mature lectins to
vacuoles. In this study, we have examined the synthesis, assembly, processing,
and subcellular localization of barley lectin in transgenic tobacco. In addition,
the functional role of the barley lectin propeptide glycan was assessed by
introducing a mutant barley lectin cDNA into tobacco. The N-linked glycosylation
site within the COOH-terminal propeptide in the mutant barley lectin cDNA was
modified by site-directed mutagenesis to prevent the co-translational N-
glycosylation of the barley lectin proprotein. The results establish that both the
wild-type and mutant barley lectin are expressed, correctly processed, and
transported to vacuoles of tobacco leaves. However, the kinetics of post-
translational processing through the RER/Golgi complex is distinctive for the wild-
type or mutant barley lectin proproteins. Moreover, expression of wild-type and

mutant barley lectin in the presence of the inhibitor monensin has provided

74
additional insight into the post-translational processing and sorting of barley

lectin to vacuoles.

MATERIALS AND METHODS

Modification of barley lectin cDNA flanking regions. The EcoRl sites flanking the
972 bp cDNA clone (pBLc3) encoding barley lectin (Lerner and Raikhel, 1989)
were blunt-ended using DNA Polymerase l Klenow fragment as described in
Maniatis, et al., 1982. Following the addition of Xbal phosphorylated linkers
(Maniatis et al., 1982), the cDNA was purified from low-melting point agarose
and subcloned (Struhl, 1985) into pUC118 (Vieira and Messing, 1987).
Restriction mapping of the cDNA revealed that the EcoRI sites originally flanking

the barley lectin cDNA were restored by the addition of Xbal linkers.

Site-directed mutagenesis. The N-linked glycosylation site at Asnm-Ser-Thr182 in
the COOH-terminal propeptide of the barley lectin proprotein (Lerner and
Raikhel, 1989) was altered by converting the Asn180 (AAC) to a Gly,,,0 (GGC)
residue by the site-directed mutagenesis method of Kunkel, et al. (1987) (see
Figure 1A). Site-directed mutagenesis of the barley lectin propeptide was
performed using Bio-Rad’s Muta-Gene phagemid in vitro mutagenesis kit with
a mutagenic 16-base synthetic oligonucleotide spanning amino acids Alan,3 to
Thr,” (Lerner and Raikhel, 1989) and uracil-containing single-strand DNA

prepared in the dutung E. coli strain CJ236. Mutants encoding the altered

75

Figure 1. Alteration of the N-Iinked glycosylation site of barley lectin by site-
directed mutagenesis and organization of the wild-type (wo and mutant (eg)

barley lectin cDNAs introduced into tobacco.

(A) The 15 amino acid COOH-terminal propeptide of barley lectin (aa 172
through aa 186) and the corresponding nucleotide sequence (nt 607 to
651). The N-Iinked glycosylation site (Asnm-Ser-Thrm) is depicted by
attachment of a high mannose glycan tree to Asn (N) residue 180. The
N-linked glycosylation site at N,,,o (shaded codon) was converted to a Gly
residue (GGC) by site-directed mutagenesis to generate a barley lectin

mutant which cannot be glycosylated.

(B) The structure of wt and gly barley lectin cDNA clones subcloned into

the plant expression vector pGA643 (An, et al., 1988).

76

 

 

 

 

 

 

a) aa172 180 186
II F A E A I A A N s T I. II A E
GTcTTCGCCGAGGGGATGGCCGCWTBCAGTOTIGTGGGAGAA

nt607 sec 651

b) l—m V/[zl—l wt

I—W WWI—I gly-
aa —26 1 172 186
l I I I 4! l
fiT I I I I
Signal Mature Pro-

sequence polypeptide peptide

77
tripeptide GIy,,,,,-Ser-Thr182 were identified and selected by 35S-dideoxy sequencing
(Sanger et al., 1977) of single-strand DNA prepared from phagemids in the

dut‘ungt E. coli strain MV1193.

Plant transformation. Both mutated (g/y) and wild-type (wt) barley lectin cDNAs
were excised from pUC118 with Xbal and subcloned (Struhl, 1985) into the
binary plant expression vector pGA643 (An, et al., 1988). These binary vector
constructs were mobilized from the E. coli strain DH5a into Agrobacterium
tumefaciens LBA4404 by triparental mating (Hooykaas, 1988) using the E. coli
strain HB101 harboring the wide-host range mobilizing plasmid pRK2013.
Transconjugates were selected on minimal nutrient plates (An, et al., 1988)
containing streptomycin (200 ug/ml), kanamycin (25 ug/ml) and tetracycline (5
ug/ml).

Agrobacteria cells containing the wt and g/y barley lectin cDNAs were
introduced into tobacco plants (Nicotiana tabacum cv. Wisconsin 38) by the leaf
disc transformation method of Horsch, et al. (1988). The leaf discs were
cocultivated with the Agrobacteria for 48 hrs on M8104 plates prior to transfer
to MS selection media (Horsch, et al., 1988). After several weeks, shoots were
transferred to MS rooting media (Horsch, et al., 1988). At least three
independent transformants, maintained as axenic cultures, were subsequently

analyzed for each construct.

78

Nucleic acid analysis. Total DNA was isolated from leaf tissue of untransformed
and transgenic tobacco plants according to Shure et al. (1983). DNA (12 ug)
was restricted with Hindlll and fractionated on 1.0% agarose gels prior to
transfer to nitrocellulose (Maniatis, et al., 1982). Nitrocellulose filters were
hybridized with 32P random-primer-labeled (Feinberg and Vogelstein, 1983) BLc3
barley lectin cDNA (Lerner and Raikhel, 1989) as described previously (Raikhel,
et al., 1988). For gene reconstruction experiments, tobacco genomic DNA was
restricted with EcoRI and BLc3 titered at 0.5-, 1.0-, 3.0-, and 5.0—copy
equivalents per tobacco (N. tabacum) genome (4.8 X 109 bp per haploid
genome; Zimmerman and Goldberg, 1977). Gene reconstruction blots were
hybridized with a Hindlll-Sail restriction fragment from a pGA643 construct
containing BLc3 radiolabeled by the random-primer method (Feinberg and
Vogelstein, 1983). Filters were exposed to Kodak X-OMAT AR film at -70°C with
intensifying screens.

Total RNA was isolated from leaves of untransformed and transgenic
tobacco plants as described previously (Wilkins and Raikhel, 1989). Total RNA
(25 ug) from each construct was resolved in a 2% agarose/6% formaldehyde
gel, transferred to nitrocellulose, and hybridized with the BLc3 cDNA labeled with

”P as described above.

Protein extraction, affinity chromatography, immunoblots, and EUSA. Barley

lectin was purified from acid-soluble protein extracts by affinity chromatography

79

on immobilized N-acetylglucosamine columns from transgenic tobacco leaves
(500 mg) essentially as described in Mansfield et al. (1988) with the exception
that the homogenization buffer consisted of 50 mM HCI containing 1 mM
phenylmethylsulfonyl fluoride (PMSF). The affinity-purified lectin was
carboxyamidated (Raikhel, et al., 1984), fractionated by SDS-PAGE (Mansfield,
et al., 1988), and electroblotted onto nitrocellulose (T owbin, et al., 1979). Barley
lectin was detected using anti-WGA polyclonal antiserum (Mansfield, et al., 1988)
and protein A-alkaline phosphatase as described in Blake, et al. (1984) using
nitroblue tetrazolium as the substrate.

Extracts of acid soluble proteins were assayed using double-bind ELISA
(Raikhel, et al., 1984) to quantitate the amount of barley lectin in transgenic
tobacco leaves. Crude extracts were prepared by homogenization of tobacco
leaves (1.0 g) in 2 ml 50 mM Tris-acetate, pH 5.0, 100 mM NaCl, 1 mM PMSF.
The extracts were clarified by centrifugation at 10 krpm for 10 min to remove
cellular debris and insoluble material. Barley lectin was detected in crude
extracts using guinea pig anti-WGA antiserum and rabbit anti-WGA IgGs
conjugated to alkaline phosphatase (Raikhel, et al., 1984). A standard curve,
constructed from affinity-purified WGA (E-Y Labs), was used to estimate the level
of barley lectin in tobacco leaves. Total protein in the crude extracts was

determined by the method of Bradford (1976).

80

Vacuole isolation and enzyme assays. Protoplasts for vacuole isolation were
prepared from leaves of axenic cultured plants. Leaves were digested overnight
in an enzyme medium composed of 0.5 M mannitol and 3 mM MES, pH 5.7
containing the same enzymes as described below. Vacuoles were isolated from
tobacco protoplasts by ultracentrifugation as described in Guy at al. (1979) with
the exception that the isolation buffer was 0.5 M sorbitol and 10 mM HEPES, pH
7.2 and the Ficoll step gradient consisted of 10% and 5% Ficoll. Vacuoles
stained with neutral red were collected from the 0%/5% interface and adjusted
to 10% Ficoll and subjected to further purification on a second Ficoll gradient.
Vacuoles were collected from the 0%/5% Ficoll interface on a second gradient
by flotation of the vacuoles during centrifugation. The vacuoles recovered were
counted in a hemocytometer, frozen in liquid nitrogen, and stored at -80°C for
biochemical analysis.

Vacuolar-specific enzyme activities of a-mannosidase (Boiler and Kende,
1979) and acid phosphatase (Shimomura, et al., 1988) were assayed in
protoplast and vacuole fractions by monitoring the release of p-nitrophenol
spectrophotometrically from the appropriate substrates. Catalase activity (Aebi,
1974) was measured in protoplast and vacuole fractions as an extravacuolar

enzyme marker.

81
lmmunocytochemistry. Leaf tissue from axenic tobacco plants was excised and
trimmed into 2 mm2 pieces. Fixation and immunocytochemistry was performed

essentially as described in Mansfield et al. (1988).

Radiolabeling of tobacco protoplasts, Endo H digestion, and monensin.
Protoplasts for labeling were prepared from fully expanded leaves of axenically
cultured tobacco plants. Leaves were digested overnight in an enzyme mixture
comprised of 0.5% cellulase (Onozuka R10), 0.25% macerozyme R10, and 0.1%
BSA in MSA media (An, et al., 1988) supplemented with 0.5 M mannitol. The
yield of protoplasts was quantitated using a hemocytometer counting chamber.

For pulse-labeling experiments, 1 X 105 leaf protoplasts (per well) were
incubated in a 24-well Falcon tissue culture plate in 500 ul MSA media in 0.5 M
mannitol supplemented with 48 uCi of 35S-Trans label (ICN 35S E. coli hydrolysate
labeling reagent containing 2 70% L-methionine and g 15% L-cysteine; 1000-
1200 Ci/mmole). The culture plates were incubated in the dark at room
temperature with gentle shaking. Two wells or a total of 200,000 protoplasts
were labeled for each experiment. Pulse-chase experiments were performed by
supplementing the media with 1 mM L-methionine and 0.5 mM L-cysteine 8 to
10 hr after pulse-labeling protoplasts as described above. Following labeling,
protoplasts were pooled and collected by centrifugation at '2 krpm for 15 sec at
4°C. The resulting protoplast pellet was suspended in 100 ul of 50 mM Tris-

acetate, pH 5.0, 100 mM NaCl and lysed at room temperature for 10 min with

82
gentle agitation following the addition of 100 ul of 1.2 mM dithiothreitol and 1.2%
(v/v) Triton X-100 in Tris-acetate/NaCl. Samples were frozen in liquid N2 and
stored at -70°C.

Endo-fi-N-acetlyglucosaminidase H (Endo H) digestion of radiolabeled
barley lectin was performed at 37°C for 23 hr in 50 mM Tris-acetate, pH 5.5,
100 mM NaCl, 1 mM PMSF with 4 mU Endo H immediately following affinity-
purification of barley lectin from protoplasts pulse-labeled for 12 hr as described
above.

For monensin experiments, 500 mM monensin in absolute ethanol was
added directly to each well containing tobacco protoplasts to a final
concentration of 50 uM monensin, 0.1% ethanol. Absolute ethanol was added
to a final concentration of 0.1% in controls. A total of 800,000 wt or gly
protoplasts were pretreated in the presence of ethanol or monensin for 1 hr
prior to the addition of 35S-trans label and pulse-labeled for 12 hr. A fraction of
the pulse-labeled protoplasts (200,000) were processed as described above.
The remaining 600,000 protoplasts were pooled and gently homogenized in 150
ul of 100 mM Tris pH 7.8, 1 mM EDTA, 12% sucrose (w/w) and separated into
soluble and organelle fractions on Sepharose 4B columns (8.0 cm X 1.0 cm)
according to Stinissen et al. (1985). The Sepharose 4B elution profile of total
radioactivity associated with organelles and soluble proteins concurred with
previous studies (Stinissen, et al., 1984; Stinissen, et al., 1985; Mansfield, et al.,

1988). In addition, NADH cytochrome C reductase activity (Lord, 1983) was

83
primarily associated with the organelle fractions. The samples were adjusted to
0.5% Triton X-100 and stored at -70°C. Following collection of protoplasts by
centrifugation (see above), the culture media was recovered from a total of
800,000 protoplasts and contaminating intact protoplasts removed by gravity
filtration through a lsolab quick-sep column fitted with a paper filter and a
Whatman GF/C glass fiber filter (1.2 um exclusion). Proteins contained in the
culture media were precipitated with ammonium sulfate at 60% saturation at 4°C
for at least 2 hr. Precipitated proteins were collected by centrifugation for 10
min at 15 krpm. The protein pellet was resuspended in 200 ul of 50 mM Tris-
acetate, pH 5.0, 100 mM NaCI and stored at -70°C. 35S-labeled barley lectin
was purified by affinity chromatography, carboxyamidated and analyzed by SDS-
PAGE as described above. The SDS-PAGE gels were treated for fluorography

as detailed in Mansfield, et al. (1988).

RESULTS

Inactivation of N-linked glycosylation site of barley lectin proprotein by site-
directed mutagenesis. The cDNA clone pBLcS (Lerner and Raikhel, 1989)
encodes the 23 kd preproprotein of barley lectin. The preproprotein is
comprised of a 2.5 kd signal sequence, the 18 kd mature protein, and a 1.5 kd
COOH-terminal propeptide (Figure 1A). In barley embryos, the proprotein is
modified by the addition of a 2 kd high-mannose oligosaccharide sidechain to

the sole N-Ilnked glycosylation site located within the COOH-terminal propeptide

84

at Asn,.o-Ser-Thr,,,2 (Figure 1B). To further investigate the assembly, post-
translational processing and transport of barley lectin to vacuoles, the cDNA
encoding barley lectin was introduced into tobacco and the post-translational
processing of monocot barley lectin examined in this heterologous dicot system.
The barley lectin cDNA was subcloned into the binary plant expression vector
pGA643 (An, et al., 1988) under the transcriptional control of the cauliflower
mosaic virus (CaMV) 358 promoter. Agrobacteria-mediated transformation of
tobacco (Nicotiana tabacum cv. Wisconsin 38) was accomplished via the leaf
disc method of Horsch, et al. (1988). Both the constructs and kanamycin-
resistant tobacco transformants containing the barley lectin cDNA are designated
by the code wt (Figure 1B).

The glycosylated COOH-terminal propeptide is transiently associated with
barley lectin proprotein but not with the nonglycosylated mature protein localized
in vacuoles. Mature barley lectin is generated by the cleavage of the N-linked
glycosylated propeptide from the proprotein preceding or concomitant with the
deposition of barley lectin in vacuoles. To assess the functional role of the N-
linked high mannose glycan in the assembly, processing, and targeting of barley
lectin to vacuoles, site-directed mutagenesis was performed to alter the N-linked
glycosylation site within the COOH-terminal propeptide. The N-Iinked
glycosylation site was altered by converting Asn100 (AAC) to a Gly“,o (GGC)
residue using a 16-base mutagenic synthetic oligonucleotide spanning the

glycosylation site at Asnm-Ser-Thr182 (Figure 1A). The mutant barley lectin cDNA

85

was subcloned into pGA643 and transformed into tobacco. Constructs and
kanamycin-resistant tobacco plants containing the mutant barley lectin are

designated as g/y (Figure 1B).

Detection of barley lectin cDNA and mRNA in transgenic tobacco. The structure
and stable integration of wt and gly barley lectin cDNA into the tobacco genome
was examined in independent transformants by Southern blot analysis. A
radiolabeled restriction fragment containing a portion of the barley lectin cDNA
and the T-DNA left border of pGA643 was used to probe tobacco genomic DNA
restricted with Hindlll. Three Hindlll-restriction fragments (5 kbp to 9.0 kbp) and
five fragments (18 kbp and 2.8 kbp to 4.0 kbp) were detected in tobacco
genomic DNA isolated from wt and gly transformants, respectively (data not
shown). Gene reconstruction experiments (Figure 2A) were performed with
EcoRI-restricted tobacco DNA and purified BLc3 insert titered at 0.5-, 1.0-,

3.0-, and 5-copy equivalents per tobacco genome. Hybridization of gene
reconstruction experiments with radiolabeled BLc3 indicate the presence of 3-
copies of wt and 5-copies of gly barley lectin cDNA integrated into the tobacco
genome of the individual transformants presented in Figure 2A. No hybridization
was observed between barley lectin and tobacco DNA in untransformed plants
(W38, Figure 2A) or in transgenic plants containing only the vector pGA643

(data not shown).

 

 

86

Figure 2. Gene reconstruction analysis and accumulation of steady-state RNA

levels of barley lectin in transgenic tobacco.

(A)

(3)

Southern blot containing 12 ug of tobacco genomic DNA restricted with
EcoRI and probed with radiolabeled barley lectin pBLc3 cDNA insert
(Lerner and Raikhel, 1989). Reconstruction lanes represent 05-, 1.0-,
3.0-, and 5.0—gene copy equivalents of barley lectin pBLc3 cDNA insert
per haploid genome of tobacco. Tobacco DNA was isolated from
untransformed tobacco (cv. W38) and transgenic tobacco plants
containing cDNAs encoding wild-type (wt) or mutant (g/y) barley lectin
preproproteins. Approximate size of fragments in kbp are positioned to

the right.

Northern blot contiaining 25 ug of total RNA isolated from developing
barley embryos (lane 1), untransformed tobacco (cv. W38) (lane 2) and
transgenic tobacco plants containing wt (lane 3) or gly (lane 4) barley
lectin cDNA constructs. The size of barley lectin mRNA species is

indicated in kb to the right of the blot.

copies/1 N

88

The relative levels of mRNA encoding wt or gly barley lectin in transgenic
tobacco was investigated by Northern blot analysis. The Northern blot in Figure
23 represents the accumulation of wt and gly barley lectin steady-state mRNA
in total RNA isolated from transgenic tobacco leaves detected by 32P-Iabeled
barley lectin cDNA (BLc3). Two mRNA species of 1.2 kb and 1.0 kb were
observed in tobacco transformants containing either the wt or gly barley lectin
(Lanes 3 and 4, respectively, Figure 2B). The 1.0 kb barley lectin mRNA in
tobacco transformants (Lanes 3 and 4, Figure 2B) corresponds in length to the
1.0 kb barley lectin mRNA in developing barley embryos (Lane 1, Figure 28;
Lerner and Raikhel, 1989). The 1.2 kb mRNA species is unique to transgenic
tobacco plants and presumably represents utilization of an alternate
polyadenylation site contained within the termination sequences of the plant
expression vector pGA643 (An et al., 1988). Examination of individual
transformants revealed the differential accumulation of the 1.2 kb and 1.0 kb
lectin mRNAs in both wt and gly plants (Lanes 3 and 4, Figure 28; data not
shown). However, densitometer scanning of the autoradiograph indicated that
the overall accumulation of steady-state wt and gly barley lectin mRNAs are
very similar. No hybridization was observed in total RNA isolated from
transgenic plants containing only the vector pGA643 (data not shown) or in

untransformed tobacco (Lane 2, Figure 23) probed with barley lectin cDNA.

89

Expression and assembly of active badey lectin in tobacco. Gramineae lectins
possess the ability to specifically bind oligomers of the carbohydrate N-
acetylglucosamine (GlcNAc). Since the carbohydrate binding site of WGA is
comprised of amino acids contributed by both monomeric subunits (Wright,
1980), the assembly of active WGA is therefore contingent upon the formation
of the dimer. Barley lectin shares 95% amino acid homology with WGA,
including conservation of amino acids involved in carbohydrate binding (Lerner
and Raikhel, 1989). This conservation is exemplified by the ability to form active
heterodimers in vitro from monomeric subunits of WGA and barley lectin
(Peumans, et al., 1982b). Hence, the mechanism of dimerization and
carbohydrate binding of WGA and barley lectin are presumably identical.

In order to determine if barley lectin is synthesized and assembled into
an active lectin in transgenic tobacco plants, crude protein extracts prepared
from wt or gly tobacco transformants were fractionated on an immobilized
GIcNAc affinity matrix. The affinity-purified fractions were separated by SDS-
PAGE and analyzed by immunoblotting (Figure 3). Since barley lectin and WGA
are antigenically indistinguishable (Stinissen, et al., 1983), polyclonal anti-WGA
antiserum was used to detect barley lectin on immunoblots. The 18 kd mature
subunit of barley lectin was readily discernible in wt or gly transgenic tobacco
leaves (Lanes 3 and 4, respectively, Figure 3). Detection of mature 18 kd
polypeptides on immunoblots following affinity chromatography (Figure 3)

indicates that barley lectin is synthesized and assembled as an active

90

Figure 3. Immunoblot detection of mature barley lectin in wt and gly tobacco
transformants. Acid soluble protein extracts from wt (lane 3) and gly (lane 4)
transformed and untransformed (lane 2) tobacco leaves were concentrated by
ammonium sulfate precipitation. Barley lectin was affinity purified as described
in Materials and Methods, separated on SDS-PAGE, and electroblotted onto
nitrocellulose. lmmunodetection of barley lectin was performed with polyclonal
anti-WGA antiserum and protein A-conjugated alkaline phosphatase. Lane 1 is
a control lane containing 1 ug of purified WGA. The molecular mass of mature

WGA and barley lectin subunits in kd is shown on the left.

18" -

92
GIcNAc-binding lectin in both wt and gly tobacco transformants. Anti-WGA
antiserum does not cross-react with any polypeptide in untransformed tobacco
(Lane 2, Figure 3). Similar results were obtained on immunoblots prepared from
roots of wt and gly transgenic tobacco plants (results not shown).

The accumulation of barley lectin in wt and gly tobacco plants was
quantitated in total acid soluble protein extracts from transgenic tobacco leaves
using double-bind ELISA. A range of 800 ng to 2 ug of affinity-purified barley
lectin per 1 g/fw leaf tissue can be recovered from wt and gly tobacco
transformants. The accumulation of barley lectin in tobacco leaves corresponds

to 0.2% to 0.5% of total acid-soluble leaf proteins.

Synthesis of wild-type (wt) and mutant (gly) barley lectin proproteins in tobacco
protoplasts. In barley embryos, barley lectin is initially synthesized as a 23 kd
glycosylated proprotein (Stinissen, et al., 1985; Lerner and Raikhel, 1989). To
ensure that barley lectin is synthesized and processed by similar mechanisms
in tobacco, the post-translational modifications of radiolabeled barley lectin
precursors in transgenic tobacco were examined. Tobacco protoplasts were
prepared from axenic cultures and pulse-labeled for 12 hr in the presence of
35S-Trans label. Radiolabeled barley lectin was recovered from tobacco
protoplasts by affinity chromotography on immobilized GIcNAc columns.
Following affinity chromatography, eluant fractions were treated with Endo H, an

enzyme which specifically cleaves high mannose oligosaccharide side-chains

93
between the GIcNAc residues of the glycan core. Radiolabeled proteins
incubated in the presence or absence of Endo H were analyzed following
separation by SDS-PAGE and fluorography (Figure 4). In addition to the mature
18 kd subunit, a 23 kd polypeptide was also evident in pulse-labeled wttobacco
protoplasts (Lane 1, Figure 4). The majority of the 23 kd polypeptide is
converted to a 21 kd protein following treatment with Endo H (Lane 2, Figure
4), indicating that the 23 kd polypeptide contains a 2 kd high mannose glycan.
These results infer that the signal sequence has been cleaved and that the
synthesis and processing of barley lectin precursors in tobacco is analogous
to processing mechanisms in barley. As expected, the gly barley lectin is
synthesized as a 21 kd proprotein (Lane 3, Figure 4) which is resistant to Endo
H (Lane 4, Figure 4). Comparison of the wt and gly 21 kd polypeptides (Lanes
2 and 4, respectively, Figure 4) shows a slight disparity in migration of these
two proproteins. The slower migration of the M21 kd polypeptide is due to the
presence of a GIcNAc residue (Mr 221.2), which remains attached to Asn180 of
the propeptide after enzymatic deglycosylation with Endo H. Thus, both the wt
and gly barley lectins are synthesized as the predicted glycosylated 23 kd and
nonglycosylated 21 kd proproteins, respectively, and processed to 18 kd mature

polypeptides similarly in transgenic tobacco and barley.

Subcellular localization of wt and gly barley lectin in vacuoles. Barley lectin is

localized in vacuoles in the peripheral cell-layers of embryonic and adult root

94

Figure 4. Endo H digestion of radiolabeled bar1ey lectin isolated from transgenic
tobacco. Radiolabeled barley lectin was affinity purified from wt (lanes 1 and 2)
and gly (lanes 3 and 4) tobacco protoplasts pulse-labeled for 12 hr. Duplicate
samples were incubated at 37 C for 23 hr in the absence (lanes 1 and 3) or
presence (lanes 2 and 4) of Endo H. Samples were lyophilized and separated
by SDS-PAGE. The position and molecular mass (kd) of barley lectin wtand gly
proproteins (23 and 21 kd, respectively) and mature barley lectin (18 kd) are

indicated to the left.

 

 

12 34

23- MM” . — , a.

96

caps of barley (Mishkind, et al., 1983; Lerner and Raikhel, 1989). The
subcellular location of wt and gly barley lectin in transgenic tobacco was
ascertained by a combination of organelle fractionation, immunoblot analysis and
EM immunocytochemistry. Protoplasts were prepared from both wt and gly
transgenic tobacco plants (Figure 5A). Vacuoles were released from
protoplasts (Figure 5B) and purified by centrifugation on a discontinuous ficoll
gradient system. The purity of the vacuole preparation was evaluated by
determining the enzymatic activity of two vacuolar-specific enzymes (acid
phosphatase and a-mannosidase) and a peroxisomal enzyme (catalase) in
vacuoles and protoplasts. Catalase was employed as an extravacuolar enzyme
marker for two reasons. One, peroxisomes are very fragile and consequently
lyse during preparation of vacuoles, thereby liberating catalase into the cell
lysate. Secondly, the high specific activity of catalase is readily detectable at
very low concentrations in cell lysates. As shown in Table 1, the relative
enzymatic activity of the vacuolar enzyme markers in vacuoles isolated from wt
or gly protoplasts approaches 100%. Less than 2% of catalase activity is
associated with the vacuoles, indicating that the vacuoles (Figure 5B) are
essentially free of contaminating cytosol and unbroken protoplasts.

Protoplast and vacuole fractions from wt and gly tobacco plants were
examined for the presence of barley lectin by immunoblot analysis. Barley lectin
was purified by affinity chromatography from a protein lysate representing an

equivalent number of wt or gly protoplasts and vacuoles and analyzed on

97

.E: 0:".0m 0.0.00.0 00:0 .60.... Sozaxom 000000 0 co 00:.50 0:0 80:90.

.60.”. $0000 00: E0: 00:00:00 0.02. 00.0:00> 000.05 000.006 00:0 =02“. $02.00 00000.:00006
0 :0 00.:0m::_._:c00 >0 0:00.0990 000000: E0: 000.00. 0.03 00. 0:30: 0:.3 00c_0:0 00.0:00> Amy

.E: oTIL0m .0:c0_0 0.000000: 00.3.30

2.00.0000 E0: 00:00:00 00>00. 000000: :0 00.0090 0.:0E>~c0 >0 00000.0 002, 000.0205 :5

.0200. 6.00 SE :0 E 00.00296 0:00.0290 000000: E0: 00.0:00> :0 5.060. .m 050.“.

98

 

 

99

 

 

 

 

Table 1. Relative enzyme activity (%) in vacuoles
prepared from transgenic tobacco protoplasts
wt gly'

Vacuole-specific enzymes

a-mannosidase 106.8 1 8.1 102.5 i 1.5

acid phosphatase 85.6 i 6.8 98.6 i 10.3
Extravacuolar enzyme

catalase < 2.0 < 2.0

 

 

 

 

Enzyme activities of two vacuole-specific enzyme markers and an
extravacuolar enzyme were determined in protoplast and vacuole fractions
prepared from transgenic tobacco plants expressing wt or gly barley lectin.
Enzyme activity in vacuoles is expressed as a per cent (%) of the activity
determined in the same number of protoplasts. Results represent the mean
i SD calculated from three individual experiments.

100
immunoblots (Figure 6) with polyclonal anti-WGA antiserum. The 18 kd mature
subunit of barley lectin is readily discernible in protoplasts isolated from wt or
gly tobacco plants (Lanes 2 and 4, Figure 6). Immunoblot analysis also
revealed the presence of mature barley lectin in both wt and gly vacuoles
(Lanes 3 and 5, Figure 6). These results indicate that barley lectin is correctly
targeted to vacuoles in tobacco. Moreover, the absence of the propeptide
glycan does not apparently preclude the targeting of barley lectin to tobacco
vacuoles. The vacuolar distribution of barley lectin in wt and gly transgenic
tobacco leaves was also confirmed by EM immunocytochemistry (results not
shown). No immunoreactive component was observed in the cytoplasm of

transgenic tobacco plants (data not shown).

IGnetics of intracellular processing of wt and gly barley lectin in transgenic
tobacco. Pulse-chase experiments were performed to assess the influence of
the high-mannose glycan contained within the propeptide of the barley lectin
proprotein on the rate of post-translational processing and accumulation of
mature barley lectin in tobacco vacuoles. Both wt and gly tobacco protoplasts
were pulse-labeled for 10 hr in the presence of 35S-Trans label and chased with
unlabeled methionine and cysteine for an additional 10 hrs. At specified
intervals during the chase period, radiolabeled barley lectin was recovered from
lysed protoplasts by affinity chromatography and analyzed by SDS-PAGE and

fluorography (Figure 7). The 23 kd wt proprotein and the 21 kd gly proprotein

101

.9. 0. :0. 00: 00 00:0000 0. 0.:00.
0:00 000 <®>> 05:0E :0 000E 00.000.0E 00H .<0>> 00::0E 00:.50 3.0.:0 0. : 000.. .9.0>_:000000
.m 000 m 0000.. 0:00. .6000 30 00 302000000 .0 000 N 0000.. 0:00. 0.000 E 00.000090 :00.0 000000:
0 E0: 00000000 00.0000> 000 000.0990 0. 00:00:00 0.00. 6.000 05:05. 0000.0 000000: 0.0000000:

AB 000 :2 E0: 00:0.00. 00.0:00> 000 000.0990 0. 0:00. 6:00 00::0E :0 0000800003EE_ d 0.50.“.

0 v 00:

103
as well as the 18 kd mature barley lectin polypeptide were present in pulse-
labeled protoplasts (Lane 1, Figure 7A and 7B). During the chase period, both
the wt and gly radiolabeled proproteins gradually disappear over time (Figure
7A and 7B, respectively). The disappearance of the barley lectin proproteins is
accompanied by a corresponding increase in the level of the 18 kd mature
protein. The kinetics at which either the wt or gly proproteins are processed
to mature polypeptides were determined by scanning densitometry. Half-life (tm)
determinations of 'the wt or gly barley lectin proproteins indicates that the gly
21 kd proprotein (tm = 1.0 hr) is processed to the mature protein at least 2-
fold faster than the wt 23 kd proprotein (tw = 2.0 hr). These results indicate
that wt and gly barley lectin proproteins are processed at different kinetics

during transport through the endomembrane system of the secretory pathway.

Effect of monensin on the post-translational processing of barley lectin in
transgenic tobacco. Processing of the proprotein to mature barley lectin
involves the selective removal of the COOH-terminal glycopeptide from the
proprotein. To address the events involved in the post-translational processing
of the proprotein of barley lectin, wt and gly tobacco protoplasts were pulse-
labeled in the presence of the inhibitor monensin. Monensin is an ionophore
that primarily disrupts transport vesicles and protein sorting from the trans-

cisternae of the Golgi complex (T artakoff, 1983; Chrispeels, 1983). Following a

104

0:0. 0...: 00 00:0000 000 00.:000200
05:0E 00. m: 00: 000 00.20.0000 0.:00. 0.000 :00. rm. 0.00 000 :00. mm. 3 00: :0 000E 00.000_0E
000 00.:.000 00h 5000000000.: 000 $000-QO 0: 00:00:04.0 0:00.00 00: 000 000.0990 0002 E0:
00:.50 3.0::0 002, 0.:00_ .0000 000006000 .8... 0000.. E 0: 000 .0 .0 .v .0 .N .: .o ._0: 000000 000
00 0: .0: 00.000.00.00 000; 0.:00. 0.000 E .0000. :0. 00 3 .0000. :2 00.000090 0:00.00:0._0 000000 H

0.60. .6000 AB 00 E 00.000096 0:00.00800 000000: :0 0:00E000xo 00.000. 000000030 N 050.0

0

al.-'11".-- ”mm:

m

""': 9.3 '5 I”—.
t a. 9.3.... 9...! 3 1mm

whomwmmw

106

1 hr preincubation in the presence of monensin, both wt and gly tobacco
protoplasts were subsequently pulse-labeled for 12 hr. Radiolabeled barley
lectin was affinity purified from lysed protoplasts and analyzed by SDS-PAGE
and fluorography. The effect of monensin on the post-translational processing
of wt and gly barley lectin proproteins in tobacco is presented in Figure 8. In
the absence of monensin, both the 18 kd mature protein and the wt or gly
proproteins are evident in pulse-labeled protoplasts (Lanes 1 and 3, respectively,
Figure 8). However, the preponderance of barley lectin radiolabeled in the
presence of monensin are the 23 kd wt or 21 kd gly proproteins (Lanes 2 and
4, respectively, Figure 8) indicating that monensin effectively inhibits processing
of the proproteins to the mature polypeptide. Densitometer scanning of trace
levels of 18 kd mature protein observed in both wt and gly protoplasts (Lanes
2 and 4, Figure 8) established that less than 4% of the proproteins are
converted to the mature protein in the presence of monensin.

To establish that monensin disrupts processing of wt or gly proproteins
within the Golgi complex, protoplasts pulse-labeled in the presence or absence
of monensin were gently lysed and separated into soluble (cytosol + vacuolar
contents) and organelle (enriched ER/Golgi) fractions. The molecular forms of
radiolabeled barley lectin affinity-purified from soluble (S) or organelle (0)
fractions isolated from wt or gly protoplasts pulse-labeled in the presence (+)
or absence (-) of monensin are presented in Figure 8. Both proproteins and

mature barley lectins are present in the soluble fraction of wt or gly protoplasts

107

.::0. 00: 0: 00:00.00. 00 00.:000>.00 05:0E
000 00.20.0000 0.:00. >0000 :0 :05 000E 00.000.0E 000 00.:.000 00H 2.0000902: .0: 00:00: 000 m0<0
-mow >0 8000.00: 000 00:50 >:.0.::0 0002, 0:00.09000 000000: 00.000.0030 :0 000.09: 00.200000
0. 0.:00. >0000 020006.000 .>000000:0E0000 0000000003 >0 00000000 0003 0:00.00:000 00.0.0E00
00: E0: 00.80: :0: 0.000000 000 Am. 0.00.0w 5.00.0902: 000 ”1.60.0-QO >0 00~>_000 000 200.0990
00: :0 00.000 0 E0: 00.:000 >:.0.::0 002, 0.80. >0000 00.000.2000 .Ai .0000:0 $00 .0.00000E .2: on
00 3 .0000:0 $00 0. 00 0.. .0: 00.000.00.30 000; 0.:00. >0000 30 00 E 00.000006 0:00.00:0._0 000000 0.

.0.00000E :0 00000000 00: 0. 00.08.0000 560. >200 :0 00.000020 0.50080 :0 00.00.00. .0 0.50.0

108

 

_N—.—.—.O—.m mm m m .melNP
45m _ ts _l>.:m_ ts

 

 

 

 

i\w_.
I- II 9 a..- 91:0
.‘i‘l‘. ")
._ 0N
:+ +... l_+ :1 i + i.+ J

 

 

 

109

incubated in the absence or presence of monensin (Lanes 5,7 and 9,11,
respectively, Figure 8). However, only the proproteins are readily discernible in
organelle fractions isolated from wt or gly protoplasts treated with or without
monensin (Lanes 6,8 and 10,12, respectively, Figure 8). These results
demonstrate that wt or gly proproteins are associated with ER/Golgi
compartments. The lower levels of gly proprotein evident in soluble and
particularly organelle fractions is congruent with a shorter half-life for gly
proproteins (Figure 7). Although monensin is efficacious in preventing the
processing of proproteins to mature barley lectin (see above), significant levels
of mature 18 kd barley lectin can be observed in soluble fractions isolated from
protoplasts (especially wt) treated with monensin (Lane 7, Figure 8). The
appearance of mature barley lectin in monensin treated soluble fractions is
presumably due to in vitro processing of proproteins by proteases during
isolation of subcellular fractions.

Levels of radiolabeled barley lectin recovered from soluble and organelle
fractions isolated from protoplasts incubated with monensin differ significantly in
wt and gly tobacco transformants (Figure 8). Densitometer scanning
demonstrated that the overall levels of the wt 23 kd proprotein in soluble and
organelle fractions isolated from protoplasts incubated with (Lanes 5 and 6,
Figure 8) or without (Lanes 7 and 8, Figure 8) monensin are very similar,
although there is a discernible increase of the proprotein in the presence of

monensin. However, the gly 21 kd proprotein is barely dectectable in

110

subcellular fractions of gly protoplasts treated with monensin (Lanes 11 and 12,
Figure 8), especially in the organelle fraction (Lane 12, Figure 8). The monensin
results suggest that the glycosylated 23 kd wt proprotein and the unglycosylated
21 kd gly proprotein are differentially transported from the Golgi complex.

Monensin primarily disrupts intracellular vesicular transport and
consequently results in extracellular secretion of Iysosomal proteins (T artakoff,
1983). Pea vicilin (Craig and Goodchild, 1984) and ConA (Bowles, et al., 1986)
accumulate at the cell surface and in the periplasmic space between the cell
wall and the plasma membrane in cotyledons treated with monensin. Thus,
the presence and relative abundance of radiolabeled barley lectin was examined
in the culture media of pulse-labeled wt and gly tobacco protoplasts incubated
in the presence or absence of monensin. Radiolabeled barley lectin was
isolated from the culture media by affinity chromatography and subsequently
analyzed by SDS-PAGE and fluorography. Radiolabeled barley lectin is not
discernible in the culture media of either wt or gly protoplasts pulse-labeled in

the presence or absence of monensin (data not shown).

DISCUSSION

Barley lectin is a member of a class of vacuolar proteins which are initially
synthesized as glycosylated precursors and subsequently processed to mature
nonglycosylated proteins by the post-translational cleavage of a COOH-terminal

glycopeptide. This class of vacuolar proteins includes the Gramineae lectins

111
and a plant defense-related ,B-1,3-glucanase of tobacco (Shinshi, et al., 1988).
The transient association of an N-linked oligosaccharide side-chain with the
proprotein provides a unique opportunity to investigate the functional significance
of the N-Iinked glycan in the post-translational processing and transport of these

vacuolar proteins.

Barley lectin is correctly assembled and targeted to vacuoles in transgenic
tobacco. The feasibility of expressing a monocot vacuolar protein in a
heterologous dicot system was examined by introducing cDNAs encoding the
wt barley lectin preproprotein under the transcriptional control of the constitutive
CaMV 358 promoter into tobacco by Agrobacteria-mediated transformation.
Analysis of transgenic plants established that the wt barley lectin is synthesized
as the appropriate 23 kd proprotein in tobacco. The 23 kd wt proprotein is
correctly modified by the covalent attachment of a 2 kd high mannose
oligosaccharide side-chain, post-translationally processed to the mature 18 kd
subunit and transported to vacuoles in tobacco analogous to barley embryos
(Lerner and Raikhel, 1989). Synthesis of the correct glycosylated barley lectin
proprotein in transgenic tobacco plants is indicative that the signal sequence of
this monocot protein is recognized and cleaved by an ER signal peptidase in
dicots. Correct utilization of NHz-terminal signal sequences in heterologous
systems have been documented for the vacuolar protein PHA (Sturm, et al.,

1988) and a chimeric construct employing the signal sequence of the vacuolar

112
storage protein patatin (Iturriaga, et al., 1989). Predicated on the ability to
isolate mature barley lectin by affinity chromatography on immobilized GIcNAc,
the wt proproteins are assembled into the correct dimeric conformation required
of an active lectin. In summary, the correct synthesis, assembly, processing
and transport of barley lectin to vacuoles in tobacco indicates the existence of
a common mechanism for post-translational processing and targeting of proteins
to vacuoles in monocots and dicots. A number of storage proteins and lectins
have been correctly expressed in seeds of heterologous systems (Beachy, et al.,
1985; Sengupta—Gopalan, et al., 1985; Okamuro, et al., 1986; Hoffman, et al.,
1987; Sturm, et al., 1988). However, only patatin has been shown to be
correctly processed in vegetative tissues of tobacco (Sonnewald, et al., 1989).
The present study is the first report to demonstrate the correct processing and
stable accumulation of a embryo-specific monocot vacuolar protein in tobacco

leaves and roots.

Propeptlde glycan is not required for correct assembly and transport of barley
lectin in transgenic tobacco. The myriad of functions associated with the N-
linked oligosaccharides of many mammalian glycoproteins (Olden, et al.. 1985)
indicate that there is no universal role for N-Iinked glycans. The influence of the
barley lectin proprotein glycan on assembly, processing and transport of this
protein was investigated by examining the expression of a mutant gly barley

lectin in transgenic tobacco. The 21 kd nonglycosylated proprotein is correctly

113

synthesized, assembled as an active lectin, transported to vacuoles, and
processed to the mature polypeptide analogous to wt barley lectin in transgenic
tobacco and barley embryos. Although the absence of the propeptide glycan
in tobacco plants expressing the gly proprotein of barley lectin apparently does
not impede the formation of active lectin dimers, it is unknown whether the
presence of the glycan or the glycopeptide may influence the rate of assembly
of active lectin dimers. Active dimers can actually be assembled from mature
nonglycosylated subunits in vitro (Peumans, et al., 1982b).

Localization of mature barley lectin derived from the gly proprotein in
vacuoles of tobacco also demonstrates that the high mannose glycan covalently
attached to the COOH-terminal propeptide is not an absolute requirement for
the targeting of barley lectin to vacuoles. Similar results have been observed
for the glycoprotein PHA (Bollini, et al., 1985; Voelker, et al., 1989) even though
barley lectin is only glycosylated as a precursor and unlike PHA, it is not a
glycoprotein in its mature form. The glycans of the barley lectin proprotein and
PHA are not essential for processing and targeting of these proteins to vacuoles.
Conversely, the glycan of proConA apparently plays a direct role in processing

and transport of ConA to vacuoles (Faye and Chrispeels, 1987).

Propeptlde g/ymn affects rate of post-translational processing and transport of
barley lectin in transgenic tobacco. To assess the possibility that the N-linked

glycan plays an indirect role in intracellular processing and transport of barley

114

lectin, pulse-chase labeling and monensin experiments were performed with
tobacco protoplasts expressing the wt or gly barley lectin proproteins. Pulse-
chase experiments demonstrated that the glycosylated and unglycosylated
proproteins are differentially processed to the mature protein with characteristic
kinetics. The nonglycosylated (gly) 21 kd proprotein is processed to the mature
18 kd protein at a rate at least 2-fold faster than the glycosylated (wt) 23 kd
proprotein. Fractionation of subcellular components established that the
proproteins are associated with the Golgi compartment and indicates that the
gly proprotein is also transported from the Golgi complex faster than the wt
proprotein.

Monensin effectively inhibits the post-translational processing of both the
wt and gly barley lectin proproteins to the mature subunit in tobacco
protoplasts. However, monensin exerts a differential effect on the transport of
these proproteins from the Golgi complex. In the presence of monensin, the
wt glycosylated proprotein remains lodged within the Golgi complex or is
transported from this compartment very slowly. The protracted rate of
processing and transport of the wt proprotein relative to the gly proprotein
implies that the N-linked glycan of the propeptide modulates the processing and
transport of barley lectin to vacuoles. We propose that the deglycosylation of
the propeptide precedes processing and transport and is the rate-limiting step
of these processes. The post-translational removal of an internal glycopeptide

from proConA is also believed to commence with a deglycosylation step

115
(Bowles, et al., 1986). In contrast to the present study, monensin purportedly
has limited effect on the processing of the rice lectin proprotein to the mature
protein in developing embryos (Stinissen, et al., 1985). However, similar
inhibitory effects by monensin have been observed on the processing of
proConA (Bowles, et al., 1986) and pea vicilin proproteins (Craig and Goodchild,

1 984).

A model for the role of the glymn in the post-translational processing of barley
lectin. The pulse-chase and monensin experiments indicate that the N-linked
high mannose glycan of the barley lectin propeptide modulates the rate of
processing and transport of the barley lectin proprotein from the Golgi complex
to the vacuoles. Moreover, the modulation of these processes by the glycan is
rate-limiting. The glycan therefore presumably plays an indirect or negative role
in the regulation of processing and transport of barley lectin to vacuoles. We
propose that the molecular mechanism by which the glycan regulates these
processes relys upon a sequential two-step processing of the proprotein COOH-
terminal glycopeptide (Figure 9). Concomitant with the formation of an active
lectin dimer, the proprotein assumes a conformation in which the high mannose
glycan sequesters the propeptide from the aqueous environment, thereby
masking the availability of the propeptide for processing (Figure 9A). This

predicted protein configuration is predicated on the conformation of the protein

116

Figure 9. Proposed chain of events involved in the post-translational processing
of barley lectin. The processing model schematically depicts one subunit of a
barley lectin dimer adapted from the structure of WGA (Wright, 1987). Each of
the highly homologous domains of barley lectin is represented by a circle. A
high mannose glycan tree is attached to the sole N-Iinked glycosylation site

(Asn-Ser-Thr) residing within the COOH-terminal propeptide of barley lectin.

118
(Wright, 1987), the amphipathic characteristic of the propeptide and the
hydrophilic nature of the glycan. In the trans-cisternae of the Golgi complex,
the glycan is removed post-translationally in a regulated manner from the
proprotein. As a consequence, deglycosylation exposes the propeptide to
proteases and thereby facilitates further processing and transport of the
proprotein (Figure 9B). The contribution of the glycan in the processing and
transport of this plant vacuolar protein is congruous with the involvement of N-
linked glycans in the proteolytic processing and stabilization of many mammalian

glycoproteins (Olden, et al., 1985).

REFERENCES

Aebi, H. (1974) Catalase. In Bergermeyer, H.U. (ed.), Methods of Enzymatic
Analysis Vol. II. Academic Press, NY, pp. 673-678.

Akazawa, T. and Hara-Nishimura, l. (1985) Topographic aspects of biosynthesis,
extracellular, and intracellular storage of proteins in plant cells. Ann. Rev.
Plant Physiol. 36, 441-472.

An, G., Ebert, P.R., Mitra, A. and Ha, SB. (1988) Binary vectors. Plant Mo/ec.
Biol. Manual A3, 1-19.

Beachy, R.N., Chen, Z.-L., Horsch, R.B., Rogers, S.G., Hoffman, NJ. and Fraley,
RT. (1985) Accumulation and assembly of soybean fl-conglycinin in seeds

of transformed petunia plants. EMBO J. 4. 3047-3053.

119

Blake, M.S., Johnston, K.H., Russel-Jones, G.J. and Gotschlich, EC. (1984) A
rapid, sensitive method for detection of alkaline phosphatase-conjugated
anti-antibody on Western blots. Anal. Biochem. 136, 175-179.

Boller, T. and Kende, H. (1979) Hydrolytic enzymes in the central vacuole of
plant cells. Plant Physiol. 63, 1123-1132.

Bollini, R., Ceriotti, A., Daminati, MG. and Vitale, A. (1985) Glycosylation is not
needed for the intracellular transport of phytohemagglutinin in developing
Phaseo/us vulgaris cotyledons and for the maintenance of its biological
activities. Physiol. Plant. 65, 15-22.

Bowles, D.J., Marcus, S.E., Pappin, D.J.C., Findlay, J.B.C., Eliopoulos, E.,
Maycox, PR. and Burgess, J. (1986) Posttranslatlonal processing of
Concanavalin A precursors in jackbean cotyledons. J. Cell Biol. 102, 1284-
1297.

Bradford, M. (1976) A rapid and sensitive method for the quantitation of
microgram quantities of protein utilizing the principle of protein dye
binding. Anal. Biochem. 72, 248-254.

Chrispeels, M.J. (1983) The Golgi apparatus mediates the transport of
phytohemagglutinin to the protein bodies in bean cotyledons. P/anta158.
140-151.

Craig, S. and Goodchild, DJ. (1984) Golgi-mediated vicilin accumulation in pea
cotyledon cells is re-directed by monensin and nigericin. Protoplasma122,

91 -97.

120

Faye, L. and Chrispeels, M.J. (1987) Transport and processing of the
glycosylated precursor of Concanavalin A in jack-bean. Planta 170, 217-
224.

Feinberg, AP. and Vogelstein, B. (1983) A technique for radiolabeling DNA
restriction endonuclease fragments to high specific activity. Anal. Biochem.
132. 6-13.

Guy, M., Reinhold, L. and Michaeli, D. (1979) Direct evidence for a sugar
transport mechanism in isolated vacuoles. Plant Physiol. 64, 61 -64.
Herman, E.M., Shannon, L.M. and Chrispeels, M.J. (1985) Concanavalin A is

synthesized as a glycosylated precursor. Planta 165, 23-29.

Hoffman, L.M., Donaldson, D.D., Bookland, R., Rashka, K. and Herman, EM.
(1987) Synthesis and protein body deposition of maize 15-kd zein in
transgenic tobacco seeds. EMBO J. 6, 3213-3221.

Horsch, R.B., Fry, J., Hoffman, N., Neidermeyer, J., Rogers, 8G. and Fraley,
RT. (1988) Leaf disc transformation. Plant Molec. Biol. Manual A5. 1-9.

Hooykaas, P.J.J. (1988) Agrobacterium molecular genetics. Plant Molec. Biol.
Manual A4, 1-13.

lturriaga, G., Jefferson, RA. and Bevan, MW. (1989) Endoplasmic reticulum
targeting and glycosylation of hybrid proteins in transgenic tobacco. The

Plant Cell 1, 381 -390.

121

Kobata, A. (1984) The carbohydrates of glycoproteins. In Ginsburg, V. and
Robbins, P.W. (eds.), Biology of Carbohydrates Vol. 2. John Wiley &
Sons, NY, pp. 87-161.

Kornfeld, S. (1986) Trafficking of lysosomal enzymes in normal and disease
states. J. Clin. Invest. 77, 1-6.

Kunkel, T.A., Roberts, JD. and Zakour, RA. (1987) Rapid and efficient site-
specific mutagenesis without phenotypic selection. Methods Enzymol. 154.
367-382.

Lerner, DR. and Raikhel, NV. (1989) Cloning and characterization of root-
specific barley lectin. Plant Physiol. 91. 124-129.

Lord, J.M. (1983) in Hall, J.L. and Moore, A.L. (eds), Isolation of Membranes
and Organe/les from Plant Cells. Academic Press, NY, pp. 119-134.

Machamer, CE. and Rose, J.K. (1988) Vesicular Stomatitis virus G proteins with
altered glycosylation sites display temperature-sensitive intracellular
transport and are subject to aberrant intermolecular disulfide bonding. J.
Biol. Chem. 263. 5955-5960.

Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.

Mansfield, MA, Peumans, W.J. and Raikhel, NV. (1988) Wheat-germ agglutinin

is synthesized as a glycosylated precursor. Planta 173, 482-489.

122

Matzuk, MM. and Boime, l. (1988) Site-specific mutagenesis defines the
intracellular role of the asparagine-linked oligosaccharides of chorionic
gonadotropin )6 subunit. J. Biol. Chem. 263, 17106-17111.

Mishkind, M.L., Palevitz, B.A., Raikhel, NV. and Keegstra, K. (1983) Localization
of wheat germ agglutinin-like lectins in various species of the Gramineae.
Science 220, 1290-1292.

Okamuro, J.K., Jofuku, K.D. and Goldberg, RB. (1986) Soybean seed lectin
gene and flanking nonseed protein genes are developmentally regulated
in transformed tobacco plants. Proc. Natl. Acad. Sci. USA 83. 8240-8244.

Olden, K., Bernard, B.A., Humphries, M.J., Yeo, T.-K., Yeo, K.-T., White, S.L.,
Newton, S.A., Bauer, HO. and Parent, J.B. (1985) Function of glycoprotein
glycans. Trends Biochem Sci. 10, 78-82.

Peumans, W.J., Stinissen, HM. and Carlier, A.R. (1982a) Isolation and partial
characterization of wheat-germ-agglutinin-like lectins from rye (Seca/e
cereale) and barley (Hordeum vulgare) embryos. Biochem J. 203. 239-
243.

Peumans, W.J., Stinissen, HM. and Carlier, A.R. (1982b) A genetic basis for the
origin of six different isolectins in hexaploid wheat. Planta 154. 568-572.

Peumans, W.J., Stinissen, HM. and Carlier, AR. (1983) The rice lectin and its
relationship to cereal lectins. Biochem. Physiol. Pf/anzen. 178. 423-

431.

123

Raikhel, NV. and Vlfilkins, TA. (1987) Isolation and characterization of a cDNA
clone encoding wheat germ agglutinin. Proc. Natl. Acad. Sci. USA 84.
6745-6749.

Raikhel, N.V., Mishkind, ML. and Palevitz, BA. (1984) Characterization of a
wheat germ agglutinin-like lectin from adult wheat plants. Planta 162. 55-
61.

Raikhel, N.V., Bednarek, S.Y. and Wilkins, TA. (1988) Cell-type specific
expression of a wheat-germ aggutinin gene in embryos and young
seedlings of Triticum aestivum. Planta 126, 406-414.

Rice, RH. and Etzler, ME. (1974) Chemical modification and hybridization of
wheat germ agglutinins. Biochem. Biophys. Res. Commun. 59, 414-419.

Sanger, F., Nicklen, S. and Coulsen, AR. (1977) DNA sequencing with chain-
terminating inhibitors. Proc. Natl. Acad. Sci. USA 56. 5463-5467.

Sengupta-Gopalan, C., Reichert, N.A., Barker, R.F., Hall, TC. and Kemp, JD.
(1985) Developmentally regulated expression of the bean ,B-phaseolin gene
in tobacco seed. Proc. Natl. Acad. Sci. USA 82, 3320-3324.

Shimomura, 8., Inohara, N., Fukui, T. and Futai, M. (1988) Different properties
of two types of auxin-binding sites in membranes from maize coleoptiles.
Planta 175, 558-566.

Shinshi, H., Wenzler, H., Neuhaus, J.-M., Felix, G., Hofsteenge, J. and Meins, Jr.,

F. (1988) Evidence for N- and C-terminal processing of a plant defense-

 

 

124
related enzyme: Primary structure of tobacco prepro-fi-1, 3-glucanase.
Proc. Natl. Acad. Sci. USA 85. 5541—5545.

Shure, M., Wessler, S. and Federoff, N. (1983) Molecular identification and
isolation of the waxy locus in maize. Cell 35. 225-233.

Smith, J.J. and Raikhel, NV. (1989) Production of an antibody specific for the
propeptide of wheat germ agglutinin. Plant Physiol. 91, 473-476.
Sonnewald, U., Sturm, A., Chrispeels, M.J. and Willmitzer, L. (1989) Targeting
and glycosylation of patatin the major potato tuber protein in leaves of

transgenic tobacco. Planta 179, 171-180.

Stinissen, H.M., Peumans, W.J. and Carlier, AR. (1983) Occurrence and
immunological relationships of lectins in gramineous species. Planta 159,
105-111.

Stinissen, H.M. Peumans, W.J. and Chrispeels, M.J. (1984) Subcellular site of
lectin synthesis in developing rice embryos. EMBO J. 3, 1979—1985.

Stinissen, H., Peumans, W.J. and Chrispeels, M.J. (1985) Posttranslatlonal
processing of proteins in vacuoles and protein bodies is inhibited by
monensin. Plant Physiol. 77, 495-498.

Struhl, K. (1985) A rapid method for creating recombinant DNA molecules.
Biotechn/ques 3, 452-453.

Sturm, A., Voelker, T.A., Herman, EM. and Chrispeels, M.J. (1988) Correct
glycosylation, Golgi-processing, and targeting to protein bodies of the

vacuolar protein phytohemagglutinin. Planta 175, 170-183.

 

 

 

125

Tartakoff, AM. (1983) Perturbation of vesicular traffic with the carboxylic
ionophore monensin. Cell 32, 1026-1028.

Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic transfer of
proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and
some applications. Proc. Natl. Acad. Sci. USA 76, 4350-4354.

Vieira, J. and Messing, J. (1987) Production of single-stranded plasmid DNA.
Methods Enzymol. 153. 3-11.

Voelker, T.A., Herman, EM. and Chrispeels, M.J. (1989) In vitro mutated
phytohemagglutinin genes expressed in tobacco seeds: Role of glycans
in protein targeting and stability. The Plant Cell 1. 95—104.

Wilkins, TA. and Raikhel, NV. (1989) Expression of rice lectin is governed by
two temporally and spatially regulated mRNAs in developing embryos. The
Plant Cell 1, 541-549.

Wright, 08. (1980) Crystallographic elucidation of the saccharide binding mode
in wheat germ agglutinin and its biological significance. J. Mol. Biol. 141,
267-291.

Wright, 0.8. (1987) Refinement of the crystal structure of wheat germ agglutinin
isolectin 2 at 1.8 A resolution. J. Mol. Biol. 194, 501-529.

Zimmerman, J.L. and Goldberg, RB. (1977) DNA sequence organization in the

genome of Nicotiana tabacum. Chromosoma 59, 227-252.

 

Chapter 5
Summary

The isolation and characterization of cDNA clones encoding the lectins
from wheat and rice has contributed significantly to our studies to elucidate
the molecular mechanisms regulating the post-transcriptional and post-
translational processing of the Gramineae lectins. The major conclusions
obtained from the research described in this dissertation are summarized

below.

A Isolation and Characterization of cDNA Clones Encoding Wheat Germ

Agglutinin (WGA) and Rice Lectin:

1. A truncated cDNA clone encoding the proprotein of WGA
(isolectin B) was isolated from a cDNA library constructed from
developing wheat embryos using synthetic oligonucleotides.

2. Two full-length cDNA clones (cRL852 and cRL1035) encoding
the preproprotein of rice lectin were isolated from a cDNA library
constructed from developing rice spikelets using the WGA-B

cDNA clone as a heterologous probe.

126

 

127

a. The two cDNA clones differ solely in the length of

their 3’-untranslated region and represent two

mRNA species encoding identical polypeptides.
b. The cDNA clone cRL1035 contains two putative

polyadenylation sites; one of the sites is common

to both cDNA clones.
The mature proteins of WGA-B and rice lectin exhibit 73%
identity at the amino acid level of the mature subunit.
Rice lectin is more closely related to isolectin A of WGA
(Appendix A).
The cDNA clones encoding WGA-B and rice lectin were
discovered to encode COOH-terminal propeptides of 15 amino
acids and 26 amino acids, respectively. The propeptide
domains of WGA-B and rice lectin are less than 47%
homologous at the amino acid level, thereby exhibiting a
significantly lower degree of conservation than in the mature
protein.
The NHz-terminal domain of chitinase, a plant defense-related
protein from Phaseo/us vulgaris, exhibits high homology (48% to

60%) to all four domains of WGA, rice and barley lectin.

 

128
Expression of WGA and Rice Lectin in Developing Embryos:

Levels of steady-state mRNA encoding WGA-B in developing
embryos is enhanced several-fold by the addition of exogenous
abscisic acid.

Rice lectin is encoded by two mRNA species derived from a

single gene gene present at 1 to 2 copies per haploid genome.

The two mRNA species of rice lectin are presumably derived

from alternative polyadenylation site selection during the post-

transcrlptional processing of the pre-mRNA.

The mRNA of rice lectin accumulates in root caps, peripheral

cell-layers of the radicie, coleorhiza, scutellum and in all cell-

Iayers of the coleoptile.

The expression of rice lectin is regulated at two molecular levels

in developing embryos.

a. The temporal expression of the rice lectin mRNAs is
presumably regulated at the transcriptional and/or
post-transcriptional levels.

b. The differential accumulation of the two rice lectin

mRNAs is controlled at the post-transcriptional level.

 

 

 

129

The Molecular Mechanisms of Post-Translational Processing of Rice

and Barley Lectin:

Properties of COOH-terminal propeptides of Gramineae lectins:

a.

The sole N-Iinked glycosylation site within the COOH-terminal
propeptide is modified by the addition of a high mannose
oligosaccharide side-chain.

The primary amino acid sequence of Gramineae lectin COOH-
terminal propeptides is not conserved (Appendix B).

The COOH-terminal glycopeptides are hydrophobic, acidic
domains (Appendix B).

Secondary structure predictions indicate that the COOH-terminal
propeptide domains of the Gramineae lectins form amphipathic
a-helices (Appendix B).

A COOH-terminal propeptide of tobacco )6-1,3-glucanase shares

properties described above (a to c) with the Gramineae lectins.

The maturation of rice lectin involves the following series of post-

translational processing events (Appendix C):

a.

Rice lectin is initially synthesized as a 23 kd

preproprotein on the rough endoplasmic reticulum.

 

130

b. Concomitant with the cleavage of the signal
sequence, the COOH-terminal propeptide is
glycosylated with a 2 kd high mannose glycan to
generate a 25 kd glycosylated proprotein.

c. The COOH-terminal glycopeptide is post-
translationally processed to yield the mature 18 kd
subunit of rice lectin. The post-translational removal
of the COOH-terminal glycopeptide is hypothesized
to occur by a two-step process, commencing with
the deglycosylation of the propeptide.

d. The 18 kd subunit is processed further by an
endoproteolytic cleavage to produce 10 kd and 8
kd polypeptides. Several amino acids are
processed from the COOH-termlnus of the 10 kd
polypeptide following cleavage from the 18 kd subunit.

Barley lectin is correctly synthesized, assembled, post-

translationally processed and transported to vacuoles in

transgenic tobacco. These results demonstrate the first correct
processing and stable accumulation of an embryo-specific
monocot protein in vegetative tissues of a dicot.

The molecular mechanisms involved in the post-translational

processing of barley lectin are similar in monocots and dicots.

131

The high mannose N-linked glycan of the COOH-terminal
propeptide is not required for targeting of barley lectin to
vacuoles in transgenic tobacco.

The glycan of the barley lectin proprotein modulates the rate of
post-translational processing and transport through the
endoplasmic reticulum and Golgi complex to the vacuole.

The post-translational processing of the COOH-terminal
glycopeptide is proposed to occur via a two-step process,

commencing with the deglycosylation of the propeptide.

Appendix A

Appendix A

 

 

Table 1. Amino acid positions which distinguish isolectins
A, B, and D of wheat germ agglutinin (WGA) and
rice lectin

 

 

Amino Acid WGA-A WGA-B WGA-D Rice

9 N G N G
37 N N N S
53 A K A A
56 T P P S
59 Q H H Q
66 Y H H Y
93 A A S A
109 F Y F Y
119 G E G N
123 S N S S
171 A G A G

 

Relatedness of rice lectin to the isolectins of wheat:
WGA-A 77.8% WGA-B 44.4% WGA-D 33.3%

 

132

 

Appendix B

133

 

Figure B.1 Acidic N-linked Glycosylated COOH-terminal Propeptlde Domains

of Gramineae Lectins and fi-1,3—glucanase of Tobacco

Appendix B

 

EHHQm > A m < B < z BflHQ> m mflHQZ > U U m >

> AHHgd > mgHQH H Ufiflgh m > m U z z < A H 4 d E 0%“;
flg¢.> H B m z 4 < H.¢—fl4~m >

fiHH< A H B m 2 B d H 4%“;4 m >

 

000:005HUIM.HIQ

0:000H 0000

cwuowa h0Hu0m

134

 

 

135

Figure 8.2 Amphipathic a-helices of Gramineae Lectin COOH—terminal

Propeptlde Domains

Appendix B

AMPHIPATHIC CHARACTER
OF GRAMINEAE LECTIN PROPEPTIDES

 

Val Phe A9" Leu Phe Asn

 

Barley Lectin WGA-B Rice Lectin

136

Appendix C

137

00>.0Em 00.02060 0. 0.800 00.0 :0 00.000090 0000000003000 :6 0.50.0

Appendix C

:::=0=0
000000000

::0:0=0
00::00

0:0:000000

0:0:000000

00:0_>moo>:0

0:0:000000000

m0 .3

00 o:

 

.E.

 

—

 

 

 

<

§

138

 

. . . ‘ y '- 1 I l l‘ ' I
.E-L-ll-innntnmwuhuiismhtuimn! v'irwiHW'W' I. "1”.” “""3 J" I” w, H,

 

RN STRITE U‘NIV. LI BRR

ll lllll