. ;.

, .311:
...... .t: 1..
..;:..

:._::T.J
V 2

p...
3.1....
:1... . .. x4115...
J ...}..I.....
.3

._.L.:. .
....:,

..:....?
..._...

 

cf
.r...;...
L‘

. 1 , 4
1?

.. 11.71.
. 1 1.355.)! . 1
.

.L :3!)

5. . .u;r.:l:.
‘5. ‘1.
.1!

151)).
1;: Inn. :1 o
I...) B J 27!
I..._.....rn..>) .
‘ ,4. . .

 

 

. .1? a- ,.
lsf ‘ ,. 2 \
If, F 1..» xx

553.;
.3: . 4,

‘ v‘ “q..-““rx-‘N't ‘

‘ . ta ‘1:

41.11:) .1!

2:1 I.) f; (I v};

,1 3 (it:

uuv-sf‘,

I.Ln¢...51y...r4.cr:a
'3: J. .112: .

412.131...

 

 

 

THEfitfi-

tiiiiiitiitii\i"\V\\\\\\\\\\\\\\\\\\\\\\\\\\\\\\

This is to certify that the

dissertation entitled

I MOLECULAR STRUCTURE AND MATURATION 0F HEVEIN,
A CHITIN-BINDING PROTEIN IN RUBBER TREE LATEX

presented by

HYUNG-IL LEE

has been accepted towards fulfillment
of the requirements for

 

 

DOCTORAI degree in GENETICS

mm @2wa

Major professor

 

MM/flz

 

MSU is an Affirmative Action/Equal Opportunity Insu‘tution 0-12771

 

 

 

 

r I,
; LKBRARY i
; Michigan State
L University

 

 

PLACE IN RETURN BOX to remove this’checkout from your record.
TO AVOID FINES return on or before date due.

DATE DUE DATE DUE DATE DUE

 

 

 

r—m

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

MSU Is An Affirmative Action/Equal Opportunity Institution
cMmMpma-o.‘

 

 

MOLECULAR STRUCTURE AND MATURATION OF HEVEIN,
A CHITIN-BINDING PROTEIN IN RUBBER TREE LATEX

BY

Hyung-il Lee

A DISSERTATION

submitted to
Mlchigan State University
In partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Genetics Program
and
MSU-DOE Plant Research Laboratory

1992

ABSTRACT

MOLECULAR STRUCTURE AND MATURATION OF HEVEIN,
' A CHlTlN-BINDING PROTEIN IN RUBBER TREE LATEX

BY

Hyung-il Lee

A family of chitin-binding proteins has been isolated from a wide variety of plant
species. A common structural motif of these proteins is the chitin-binding domain
that consists of 30 to 43 amino acids and contains a high content of glycine and
cysteine residues at conserved positions. A chitin-binding domain is often referred
to as a "hevein" domain because hevein from the lutoid body (of vacuolar origin)
enriched fraction of rubber tree latex possesses only a single chitin-binding domain
of 43 amino acids. Although the exact physiological role of hevein in vivo is not
understood, it has been shown by in vitro experiments that this protein inhibits the
growth of several chitin-containing fungi.

To understand structure and expression of hevein, a hevein cDNA clone
(HEV1) was isolated and characterized. HEV1 encodes a putative signal sequence
of 17 amino acids followed by a polypeptide of 187 amino acids: an amino-terminal

domain corresponding to the 43 amino acids of mature hevein linked by a hinge

region of 6 amino acids to an extensive carboxyl-terminal domain of 138 amino
acids. The difference in polypeptide length between hevein and the HEV1-encoded
polypeptide indicates that the formation of mature hevein may result from two
proteolytic cleavages of the prohevein in vivo. To examine this possibility, domain-
specific antibodies were generated. Western blot analysis of the biosynthesis of
preprohevein both in vitro and in rubber tree latex has revealed that the signal
sequence is cotranslationally removed and that the resulting prohevein is cleaved
in a subsequent posttranslational processing step.

To further understand the posttranslational processing and targeting of
hevein, a cDNA construct was introduced into tomato plants. Northern and Western
blot analyses showed that the cDNA-encoded proteins were expressed in transgenic
tomato plants. Prohevein was posttranslationally processed in transgenic plants.
However, only the C-terminal polypeptide was identified as a cleavage product.
Intracellular localization of both proteins suggests that they are most likely localized
in vacuoles of tomato plants. It was also found that growth of Trichoderma

hamatum, a chitin-containing fungus, was retarded in transgenic tomato fruits.

To

My Parents

ACKNOWLEDGEMENTS

I would like to deeply thank my advisor, Dr. Natasha Raikhel for her guidance and
support. I extend my appreciation to the members of my guidance committee: Dr.
Thomas Friedman, Dr. Pamela Green, Dr. Alexander Raikhel and Dr. Jan Zeevaart
for their advice and suggestion. I also thank postdocs and graduate students in
Natasha’s lab for their help with ideas, techniques, and critical reading during
preparation of manuscript. I also express my gratitude to Dr. Willem Broekaert for
his helpful discussion, technical assistance and encouragement.

I am especially indebted to my wife, Yung Shin, and my children, Bowa and Jung

Yo, for their love, encouragement and patience.

TABLE OF CONTENTS

List of Tables ............................................... viii
List of Figures .............................................. ix
CHAPTER 1. INTRODUCTION: A Family of Chitin-Binding Proteins ........ 1

References ............................................ 12

CHAPTER 2: Wound-Induced Accumulation of mRNA Containing a Hevein

Sequence in Laticifers of Rubber Tree (Hevea brasiliensis) ......... 19
Abstract .............................................. 20
Introduction ........................................... 21
Materials and Methods ................................... 22
Results ............................................... 25
Discussion ............................................ 39
References ........................................... 43

CHAPTER 3: Co- and Post-Translational Processing of the Hevein Preprotein

of Latex of the Rubber Tree (Hevea brasi/iensis) ................ 48
Abstract .............................................. 49
Introduction ........................................... 50
Materials and Methods ................................... 51
Results ............................................... 56

vi

Discussion ............................................ 73

References ........................................... 77

CHAPTER 4: Posttranslational Processing of HEV1-Encoded Proteins

in Transgenic Tomato Plants ............................... 81
Abstract .............................................. 82
Introduction ........................................... 83
Materials and Methods ................................... 84
Results ............................................... 89
Discussion ........................................... 1 06
References .......................................... 1 10
CHAPTER 5: Summary and Prospects for Future Research . ............ 113
References ........................................... 1 18

vii

UST OF TABLES

Table 1.1 Summary of in vitro biocidal activities
of chitin-binding proteins ...........................

viii

Figure 1.1

Figure 1.2

Figure 2.1

Figure 2.2

Figure 2.3

Figure 2.4

Figure 2.5

Figure 3.1

Figure 3.2.
Figure 3.3

Figure 3.4

Figure 3.5

Figure 3.6

USTS OF FIGURES

Aligned amino acid sequences of the chitin-binding
domains of several chitin-binding proteins ...............

The primary structure of chitin-binding family
and related proteins ...............................

Complete amino acid sequence of mature hevein and
nucleotide sequences of the primers used in PCR .........

Nucleotide and deduced amino acid sequence
of hevein cDNA clone (HEV1) ........................

Northern blot analysis of total RNA
from rubber tree latex ..............................

Comparison of the amino acid sequences deduced
from the cDNAs of HEV1 and WIN2 ...................

Effect of stress treatments on the accumulation
of hevein transcripts ...............................

The construction of expression vectors encoding
domain-specific fusion proteins .......................

Expression of domain specific fusion proteins ..............
Processing of in vitro translation products .................

Immunoblot analysis of proteins in the lutoid body-enriched
fraction using domain-specific antibodies ...............

Chitin-binding properties of proteins
in the lutoid body-enriched fraction ....................

Affinity of the MBP-N fusion protein to chitin ................

3

5

26

29

32

37

57

62

65

69

71

Figure 4.1 Hevein cDNA construct and RNA gel blot analysis

of HEV1 transcript ................................ 90
Figure 4.2 Immunoblot analysis of HEV1-encoded proteins ............. 92
Figure 4.3 Two-D gel analysis of HEV1-encoded proteins .............. 95
Figure 4.4 Localization of HEV1-encoded proteins ................... 98
Figure 4.5 Chitin-binding properties of HEV1-encoded proteins ......... 101

Figure 4.6 Inhibitory effect on fungal growth
in transgenic tomato fruits ......................... 104

Figure 4.7 Comparison of the C-terminal amino acid sequences
of prohevein, win gene-encoded proteins,
PR-4a/b and PR-P2 proteins ........................ 108

CHAPTER 1

INTRODUCTION:
A Family of Chitin-Binding Proteins

2

Plants synthesize a wide array of proteins that are able to bind reversibly to affinity
matrices composed of chitin, a B—1,4-linked biopolymer of N-acetylglucosamine
(GlcNAc). All chitin-binding proteins for which the amino acid sequences are known
contain a common structural motif of 30 to 43 amino acids with several cysteines
and glycines at conserved positions (Figure 1). This polypeptide motif will
henceforth be referred to as the chitin-binding domain. Although the term "chitin-
binding proteins" is used to denote the family of proteins containing one or more
chitin-binding domains, it must be emphasized that the binding affinity of these
proteins is not restricted to chitin but may extend to various complex
glycoconjugates containing GlcNAc or N-acetyl-D-neuraminic acid (NeuNAc) as
building blocks. Since the natural ligand of chitin-binding proteins is not known with
certainty, we can only speculate about their exact physiological role in the plant.
Chitin-binding proteins can be divided into two groups: proteins containing
only chitin-binding domain(s) and proteins containing one or two chitin-binding
domains and an unrelated domain (Figure 2). The proteins that possess only chitin-
binding domains are resistant to heat and proteases. Within this group, the best
characterized protein is wheat germ agglutinin (WGA) which is composed of 36-kD
homerdimers with four chitin-binding domains per monomer. Although dimerization
is apparently required for formation of a functional saccharide binding pocket
(Wright, 1984), recent high-resolution X-ray diffraction data indicate that saccharide
binding can occur entirely within a single domain (Wright et al., 1991). Other
Gramineae lectins (36-kD) isolated from rye (Seca/e cerea/e: Peumans et al., 1982b),

barley (Hordeum vulgarer, Peumans et al., 1982b), rice (OIyza sativa, Tsuda, 1979),

 

Figure 1. Aligned amino acid sequences of the chitin-binding domains of several
chitin-binding proteins.
The one-domain proteins are aligned with domain A of the four—domain protein WGA
and the two-domain protein UDA is aligned with domain A and B of WGA. Only
those residues that differ from the sequence top line are shown, and sequence
identity is indicated by vertical line and conservative substitutions by two dots.
Gaps introduced for optimal alignment are represented by dashes. Abbreviations
and references: WGAA, WGAD, WGAB, wheat germ agglutinin isolectins (Ralkhel
and Wilkins, 1987; Smith and Raikhel, 1989); BARL, barley lectin (Lerner and
Raikhel, 1989); RICL, rice lectin (Wilkins and Raikhel, 1989); UDA, Unica dioica
agglutinin or stinging nettle lectin (Beintema and Peumans, 1992); POTL, tryptic
peptide from potato lectin (Broekaert, 1988); HEV, hevein (Walujono et al., 1975);
WIN1, WIN2. wound induced proteins from potato (Stanford et al., 1989), BEAC,
bean basic chitinase (Broglie et al., 1986), POTC, potato basic chitinase (Gaynor,
1988), TOBC, tobacco basic chitinase (Shinshi et al., 1987), POPC, poplar wound
induced chitinase (win 8) (Parson et al., 1989), ARAC, Arabidopsis thaliana basic
chitinase (Samac et al., 1990); RICC, rice basic chitinase (Zhu and Lamb, 1991);
BEAC-PR4, bean acidic PR4 chitinase (Margis-Pinheiro et al., 1991); MAIC, maize
seed chitinase A (Huynh et al., 1 992); Ac-AMP2, Amaranthus caudatus antimicrobial

peptide (Broekaert et al., 1992).

2QIIIII

WGA-A
WGA-D
WGA-B
BARL
RICL
UDA

POTL

_ll|i|N.Q IIIII P.:
lillanuaanunvG.lc.
IIG.la.SnaiI|:lmMPna
IISnuirA.Aill:I OTI
ruLeuL. TruV._. R
wfiA.Aannmm.AnnA .. G
nuccG.uavG.lavG ._ W
GnuacGnuaoG.uc.. _
mmmmmmmAmuuu
RfinpgR.lcuS“Kcu_ _"
mmmmmmmmmmmm
E.IIIE.Iqunnqu:Qnu
Aenv.
4
R 9.
4 D.
12CCCCCCCCM
VnunuAmInuP ncATL.
puITquOAunvmetpumnu
uuWHWnup.T“r Rnb A

Domain B

QlllIA
SIIooIoo
G IIIII
C IIIII
miller
nuB
Hekoao
coomxo
WuwnwnuRnu

Domain D

WGA-B

WGA-A
WGA-D
BARL
RICL

.Ammmr .6552; cam 5:20.; 59:00
805550 a 0:0 203 050800 050595550 05 .0555 _mcm_m 0 000080 «.200 562 05.0: @5055,

.50E00 0005550 0cm 005303
5:90 0 050500 809 .50 Lo “9055.. ”can: 40 50 0.30% 00005550 __ 0050 50 080: @5009 c050 och.

Axon 002082-898 50:50 0005550 0cm Axon 85052 c069 0955
050:? 0 .50E00 @50595550 0 6053000 .890 ”0.30350 5:50 0 00520 8me 5,300 ”mm? <0 20
05205 mev .._m “0 Echw 5me .50 50 569% 0000555 _ mwflo 50 cocoaqom 50m. 0580 0003000 0.:

.208 go so 555:: ”59 .6 Lo 5525 cacao .859
436900 0cm 8:033 .390 m 50 950000 4200 vim 000099. *0 005500 500 05Em 0003000 on?

505505 v6 050550 5.09 9 320:5;
,6 00500 :9: 950:0 8m? .50 Lo 0550qu 0800 Se. 9905 50 0053000 500 05Em 0003000 025

.685 so Lo 5285 6k: so Lo ocoaazc can .855ro goEoo
_m5E.2-_>xoa._mo m 0cm 590: 930E 50800 @50595550 0 605500 6:90 0 000005 <zoo 50>oI

.3539 00:55:55 £09605 .5 .>>v 050 5:558:92 02855 0 350000005 50800 55.5 0 0.5
50800 m52<0< 05me .mocosqow .0090 0 050500 <zoo N55.<-0< 50 005300 500 0580 0003000 05

5093 000.508 :9: 03:52 cm 0550500
305. .mEoNtocv 50:50 £559 0550505 56:38 _m5E§-_>x0€mo 0cm 3969 c058 m5mE00
9650-555 50% Axon 0:05 0053000 .956 w 50 5950 am? 50:59”. 0:0 £_Em 0cm mm? 5055mm
0cm m5x=>> now? 50,555 0:0 550.. Km? .m5v=_>> 0:0 65:05 8:02 00055.90 50 052050505 055

{05905 090.9 0cm 5E2 @50595550 5 0.302% >555 9:. .N 0.59”.

 

 

 
 

afi/eeezez 5 E 58...... 252

,, $§§Yfi§kk§\x \\\\1\\\Z _ 5 5
m.

o“. —O
r 1 4 1 1 drrrmr 4 4 4.1
.\\.\ \\\\\ \......\. x ............ 4.2.31.4... ..; ................... . ................... .A;.. mm“
~\\\\\\.\.\\ ..... \\ \\\\\\ \,.. ............. Xx.‘ Y... ../ ....................................... II...)-
.\«. \ ... . ........ . ... .....................................
r>>>A>\b\>\tt . KN. .\. \Ft>>\.\\\\ .\ xi .\ r.7xx\ V... . . .. . . . . . . . . . . . . a r

 

 

000 ...:o
. ......... . 414141.}, <.4WV..N1. .x- 4,... .1: ... ..4 . ....
.4. .<\\.u\\4\‘1\1\v\t . . \\~. ..... ..w.\\ ...... x ....... .... \.A;V.»»\e,...\/\..A./ ...r / . ...).n. .K.) \V . f. ........ ( . ; XIX. 1“,, t ., (Cm. . . .3... . (.../v... . ...... x mm“
\\\\\ .\\\.\ \,. \\\\\ \\\.t.\\\...\\.\\.\.\A.;\tnr,yl\/ , . . 1Y(....vm/ /\,. o..-.-r.\y ...:).. ..X\\.)-«.\/........1..... .
. x \f- .\k.k ,..\>\>\\ \ \ x \r.). \x\n\ \ . . .. t o a. .. \,. ...... . . ( . n. a n / .. . t h. Air/k .../P Weéhf V .7 .rXP-hrt.x: ./ x .. I I i\ u. n. a . ... . ..r ..... .1 . . . 1.,

 

 

 

 

 

.9 En— OOOGDOP

 

 

 

N : :5 Canon—

 

 

 

 

Eo>oI

 

B WWII N n52<.o<

 

 

5 5 555 5 5 m 5 5 5 H 5638;.

 

 

 

5 5 5 5 5 M 5 5 5 H 563 6.3m

 

 

 

5 5 5 5J M 5 5 hi <02,

0530.5 05305. 053055 ooooocm <Zno

 

7

couch grass (Agropyrum repens', Cammue et al., 1985), and false brome grass
(Brachypodium sylvaticum, Peumans et al., 1982a) are immunologically and
biochemically similar to WGA. In cultivated rice species, the majority of the 18—kD
monomer is proteolytically processed to form two subunits of 8-kD and 10-kD which
associate via intramolecular disulfide bridges (Stinissen et al., 1985; Figure 2). The
smallest chitin-binding proteins are antimicrobial peptides (Ac-AMPS) of 3-kD
isolated from the seeds of amaranth (Amaranthus caudatu‘s; Broekaert et al., 1992).
Since the Ac-AMPs are shorter than the canonic 43-residue chitin-binding domain
and contain three disulfide bridges instead of four, they appear to be a truncated
variant of the chitin—binding domain. In fact, the Ac-AMP sequences correspond to
the "inner conserved core region" of the consensus chitin-binding domain as defined
by Wright et al. (1991). It is also noteworthy that all residues of the WGA domains
that are implicated in saccharide binding are conserved in the Ac-AMPs. The
binding affinity of Ac-AMPs to chitin matrices supports the current view of Wright
(1992) and coworkers (Wright et al., 1991) that a single "inner core domain" is
responsible for ligand binding.

The second group of chitin-binding proteins includes proteins composed of
the chitin-binding domain and a number of functionally and structurally unrelated
domains. The class I chitinases from bean (Broglie at al., 1986), tobacco (Shinshi
et al., 1987), potato (Gaynor, 1988), poplar (Parsons et al., 1989), and rice (Zhu and
Lamb, 1991) contain an N-terminal chitin-binding domain of 39-42 amino acids fused
by a short hinge region to the catalytic domain (Shinshi et al., 1990; reviewed in

Meins et al., 1992), whereas class II chitinases contain only a catalytic domain

8

(Linthorst et al., 1990). Since the presence of the chitin-binding domain in class I
chitinases confers the binding affinity for chitin, only class I chitinases can be
classified as chitin-binding proteins. Hevein is a 43-amino acid chitin-binding protein
in the latex of rubber tree (Walujono et al., 1975). From the deduced amino acid
sequence of the hevein cDNA, as described in this dissertation (Chapter 2),
prohevein consists of mature hevein linked by a short hinge region to the C-terminal
domain. Prohevein is homologous to proproteins encoded by wound-induced (win)
genes of potato (Stanford et al., 1989; Figure 2). In addition, the C-terminal domain
of prohevein shares homology with the pathogenesis-related proteins from tobacco
(PR-4) and tomato (P2) (Friedrich et al., 1991; Linthorst et al., 1991; Figure 2). In
particular, unlike other chitin-binding proteins, prohevein is partially processed to
yield mature hevein and the C-terminal polypeptide (See Chapter 3). Stinging nettle
lectin (Urtica dioica agglutinin, UDA) consists of two chitin-binding domains. Like
hevein, a proUDA-encoding cDNA contains the C-terminal catalytic domain in
addition to N-terminal chitin-binding domains (Lerner and Raikhel, 1992). It is not
known, however, whether proUDA is stable or is just a transient precursor of UDA
in stinging nettle. Although little protein sequence data are available, Solanaceae
lectins from potato tubers (Allen et al., 1987), tomato fruits (Nachbar et al., 1978),
and thorn apple seeds (Broekaert et al., 1980) are chitin-binding proteins with a
highly glycosylated hydroxyproline-rich domain at their C-termini. These C-terminal

domains share homology with other hydroxyproline-rich glycoproteins (HRGPs).

9

Chitin, the most obvious natural ligand, has never been detected in higher
plants. Rather, it is an important structural component of the cell wall of fungi and
the exoskeleton of many invertebrates, such as insects and nematodes. This fact,
and other lines of circumstantial evidence discussed below, point to a role in host
defense, although this does not exclude additional functions (Chrispeels and
Raikhel, 1991). The locations of chitin-binding proteins in plants indicates that they
may interact with plant pathogens. The Gramineae lectins are expressed in
peripheral tissues which expand into new areas of soil as the embryo germinates
and the root system grows. The patterns of cell-specific localization in peripheral
tissues of plant organs have also been reported for class I chitinases in tobacco
leaves (Keefe et al., 1990; Mauch et al., 1992), thorn apple lectin in seeds (Broekaert
et al., 1988), and stinging nettle lectin in roots and rhizomes (Broekaert et al.,1989).
The preferential accumulation of these proteins in tissues that are in direct contact
with the stress source is consistent with their postulated function in defense. The
vacuolar localization of most chitin-binding lectins (except Solanaceae lectins)
indicates that these proteins act after the invasion of plant tissue and the release of
the cellular contents. Chitin-binding proteins such as chitinases, Gramineae lectins,
hevein and win proteins are induced by wounding, microbial infection, and the plant
’stress’ hormones. Moreover, all chitin-binding proteins examined in vitro have
demonstrated antifungal, insecticidal or a combination of these activities (T able 1).
Finally, an analysis of transgenic plants that overexpress class I chitinases or

Gramineae lectins indicates that these proteins can contribute to the protection of

10
Table 1. Summary of In vitro biocidal activities of chitin-binding proteins.

 

 

 

 

 

 

 

 

 

Funglcldal Insecticidal
Activity Ref Activity Ref

WGA _ a +. 9
Rice Lectin ND + h
Datura Lectin ND + I
Tomato Lectin _ b + I
UDA + c + k
Hevein + d ND

Ac-AMP + 9 ND

Class I Chitinases + f ND

 

 

 

 

 

 

 

+, activity ; -. no activity ; ND, not determined

a: Schlumbaum et al.,1986; Broekaert et al., 1989

b: Schlumbaum et al., 1986

c: Broekaert et al., 1989

d: Van Parijs et al., 1991

e: Broekaert et al., 1992

f: Broekaert at al., 1987; Huynh et al., 1992; Leah et al., 1991; Mauch et al.,1988;
Roberts and Selitrennikoff, 1988; Schlumbaum et al., 1986

g: Czapla and Lang,1991; Huesing et al., 1991a, Murdock et al.,1990

h: Huesing et al.,1991b

I and ]: L.L. Murdock and J.E. Huesing, personal communication

k: Huesing et al., 1991b

11

plants from fungal diseases (Broglie et al., 1991) or insect attack (Maddock et al.,
1991).

I am interested in understanding the structure of hevein and the
mechanism(s) involved in its maturation at the cellular and molecular levels. As a
first step, a hevein cDNA clone (HEV1) was isolated and characterized as described
in Chapter 2. In chapter 3, I describe the posttranslational processing events
involved in the formation of mature hevein. In Chapter 4, an analysis of transgenic
tomato plants, which served as a system to study posttranslational modification,
targeting and potential function of prohevein and its cleavage products, is

described.

1 2
REFERENCES

Allen, A.K.. Desal, N.N., Neuberger, A.. Creeth, J.M. (1978). Properties of potato
lectin and the nature of its glycoprotein linkages. Biochem. J. 171: 665-674
Belntema, J.J., Peumans, W.J. (1992). The primary structure of stinging nettle (Urtica
dioica) agglutinin: a two domain member of the hevein family. FEBS Lett. 299: 131 -
134

Broekaert, W.F. (1988). Chitinases and chitin-binding lectins in plants: A biochemical
and physiological study of their role in the natural protection of plants against fungi.
Ph.D. dissertation. Catholic University of Leuven, Belgium

Broekaert, W.F., Allen, A.K., Peumans, W.J. (1987). Separation and partial
characterization of isolectins with different subunit compositions from Datura
stramonium. FEBS Lett. 20: 116-120

Broekaert, W.F., Lee, H.-l., Kush, A., Chua, N.-H., Raikhel, NV. (1990). Wound-
induced accumulation of mRNA containing a hevein sequence in Iaticifers of rubber
tree (Hevea brasi/iensis). Proc. Natl. Acad. Sci, USA 87: 7633-7637

Broekaert, W.F., Marlon, W., Torres, F.R.G., De Bolle, M.F.C., Proost, P., Van
Damme, J., Dillon, L, Claeys, M., Rees, S.B., Vanderleyden, J., Cammue, EPA.
(1992). Antimicrobial peptides from Amaranthus caudatus seeds with sequence
homology to the cysteine/glycine-rich domain of chitin-binding proteins. Biochemistry
31: 4308-4314

Broekaert. W.F., Peumans, W.J. (1988). Fragments of polygalacturonic acid elicit

chitinase accumulation in tobacco (Nicotiana tabacum L.). Physiol. Plant. 74: 740-744

13
Broekaert, W.F., Van Parijs, J., Allen, A.K., Peumans, W.J. (1988). Comparison of

some molecular, enzymatic and antifungal properties of chitinases from thorn-apple,
tobacco and wheat. Physio]. Mol. Plant Pathol. 33: 319-331

Broekaert, W.F., Van Parijs, J., Leyns, F., Joos, H., Peumans, W.J. (1989). A chitin-
binding lectin from stinging nettle rhizomes with antifungal properties. Science 245:
1 100-1 102

Broglle, K.E., Biddle, P., Cressman, R., Broglle, R. (1989). Functional analysis of DNA
sequences responsible for ethylene regulation of a bean chitinase gene in
transgenic tobacco. Plant Cell 1: 599-607

Broglle, K., Chet, I., Holliday, M., Cressman, R., Biddle, P., Broglle, R. (1991).
Transgenic plants with enhanced resistance to the fungal pathogen Rhizoctonia
solani. Science 254: 1194-1197

Broglle, K.E., Gaynor, J.J., Broglle, RM. (1986). Ethylene-regulated gene expression:
molecular cloning of the genes encoding an endochitinase from Phaseolus vulgaris.
Proc. Natl. Acad. Sci, USA 83: 6820-6824

Cammue, B., Stinlssen, H.M., Peumans, W.J. (1985). A new type of cereal lectin from
a couch grass (Agropyrum repens). Eur. J. Biochem. 148: 315-322

Chrispeels, M.J., Raikhel, NV. (1991). Lectins, lectin genes, and their role in plant
defense. Plant Cell 3: 1-9

Czapla, T.H., Lang, BA (1991). Effect of plant lectins on the larval development of
European corn borer (Lepidoptera: Pyra/idae) and Southern corn rootworm
(Coleoptera: Chrysomelidae). J. Econ. Entomol. 83: 2480-2485

Friedrich, L, Moyer, M., Ward, E., Ryals, J. (1991). Pathogenesis-related protein 4

14

is structurally homologous to the carboxy-terminal domains of hevein, Win-1 and
Win-2. Mol. Gen. Genet. 230: 113-119

Gaynor, J.J. (1988). Primary structure of an endochitinase mRNA from Solanum
tuberosum.Nucl. Acids Res. 16: 5210

Huesing, J.E., Murdock, LL, Shade, R.E. (1991a). Effect of wheat germ isolectins
on development of cowpea weevils. Phytochemistry, 30: 785-788

Huesing, J.E., Murdock, LL, Shade, RE. (1 991 b). Rice and stinging nettle lectins:
insecticidal activity similar to wheat germ agglutinin. Phytochemistry 30: 3565-3568
Huynh, Q.K., Hironaka, C.M., Levine, E,B., Smith, C.E., Borgmeyer, J.R., Shah, OM.
(1992). Antifungal proteins from plants. Purification, molecular cloning, and antifungal
properties of chitinases from maize seed. J. Biol. Chem. 267: 6635-6640

Keefe, D.. HInz, U., Meins, F. Jr. (1990). The effect of ethylene on the cell-type
specific and intracellular localization of Beta-1, 3-glucanase and chitinase in tobacco
leaves. Planta 182: 43-51

Leah, R., Tommerup, H., Svendsen, l., Mundy, J. (1991). Biochemical and molecular
characterization of three barley seed proteins with antifungal properties. J. Biol.
Chem. 266: 1564-1573

Lee, H.-l., Broekaert, W.F., Raikhel, MN. (1991). 00- and post-translational
processing of the hevein preproprotein of latex of rubber tree (Hevea brasiliensis).
J. Biol. Chem. 266: 15944-15948

Lerner, D.R., Raikhel, NM (1989). Cloning and characterization of root-specific
barley lectin. Plant Physiol. 91: 124-129

Lemar, D.R., Raikhel, NV. (1992). The gene for stinging nettle lectin (Un‘ica dioica

15
agglutinin) encodes both a lectin and a chitinase. J. Biol. Chem. 267: 11085-11091

Unthorst, H.J.M., Danhash, N., Brederodo, F.T., Van Kan, J.A.L, De Wit, P.J.G.M.,
Bol, J.F. (1991). Tobacco and tomato PR proteins homologous to win and pro-
hevein lack the "hevein" domain. Mol. Plant-Micr. Interact. 4: 586-592

Unthorst, H.J.M., van Loon, LC., van Rossum, C.M.A., Mayor, A., Bol, J.F., von
Roekel, J.S.C., Meulenhoff, E.J.S., Comelissen, B.J.C. (1990). Analysis of acidic and
basic chitinases from tobacco and petunia and their constitutive expression in
transgenic tobacco. Moi. Plant-Micr. Interact. 3: 252-258

Maddock, S.E., Huffman, G., lsenhour, D.J., Roth, BA, Raikhel, N.V., Howard, JA,
Czapla, TH. (1991). Expression in maize plants of wheat germ agglutinin. Third
ISPMB, Tucson, Arizona, 372

Margie-Pinhelro, M., Metz-Boutigue, M.H., Awade, A., De Tapla, M., Ret, M.,
Burkard, G. (1991). Isolation of a complimentary DNA encoding the bean PR4
chitinase: an acidic enzyme with an amino-terminus cysteine-rich domain. Plant Mol.
Biol. 17: 243-253

Mauch, E. Mauch-Mani, B., Boiler, T. (1988). Antifungal hydrolases in pea tissue. ll.
inhibition of fungal growth by combinations of chitinase and B-1,3-glucanase. Plant
Physiol. 88: 936-942

Mauch, E, Meehl, J.E., Staehelln, LA. (1992). Ethylene-induced chitinase and Beta-
1, 3-glucanase accumulate specifically in the lower epidermis and along vascular
strands of been leaves. Planta 186: 367-375

Meins, F. Jr., Neuhaus, J.-M., Sperlsen, C., Ryals, J. (1992). The primary structure

of plant pathogenesis-related glucanohydrolases and their genes. In Genes

16

Involved in Plant Defense, ed. T. Boiler, F. Meins, Jr. Wien/New York: Springer-
Verlag. In press

Murdock, LL, Huesing, J.E., Nielsen, S.S., Pratt, R.C., Shade, RE. (1990). Biological
effects of plant lectins on the cowpea weevil. Phytochemistry 29: 85-89

Nachbar, M.S., Oppenhelm, J.D., Thomas, JD. (1980). Lectins in the US. diet.
Isolation and characterization of a lectin from tomato (Lycopersicon esculentum). J.
Biol. Chem. 225: 2056-2061

Parsons, T.J., Bradshaw, H.D. Jr., Gordon, MP. (1989). Systemic accumulation of
specific mRNAs in response to wounding in poplar trees. Proc. Natl. Acad. Sci, USA
86: 7895-7899

Payne, G., Ahl, P., Moyer, M., Harper, A., Beck, J., Meins, F., Jr., Ryals. J. (1990).
Isolation of complementary DNA clones encoding pathogenesis-related proteins P
and Q, two acidic chitinases from tobacco. Proc. Natl. Acad. Sci, USA 87: 98-102
Peumans, W.J., Spaepen, C., Stinlssen, H.M., Carller, AR. (1982a). Isolation and
partial characterization of a lectin from a false brome grass (Brachypodium
sylvaticum). Biochem. J. 205: 635-663

Peumans, W.J., Stlnlssen, H.M., Carller, A.R. (1982b). Isolation and partial
characterization of wheat-germ-agglutinin like lectins from rye (Seca/e cereals) and
barley (Hordeum vulgare) embryos. Biochem. J. 203: 239-243

Raikhel, N.V., Wilkins, TA (1987). Isolation and characterization of a cDNA clone
encoding wheat germ agglutinin. Proc. Natl. Acad. Sci, USA 84: 6745-6749
Roberts, W.K., Selitrennikoff, GP. (1988). Plant and bacterial chitinases differ in

antifungal activity. J. Gen. Microbiol. 134: 169-176

 

17
Samac, D.A., Hironaka, C.M., Yallaly, P.E., Shah, OM. (1990). Isolation and

characterization of the genes encoding basic and acidic chitinase in Arabidopsis
thaliana. Plant Physiol. 93: 907-914

Schlumbaum, A., Mauch, E, ngell, U., Boiler, T. (1986). Plant chitinases are potent
inhibitors of fungal growth. Nature 324: 365-367

Shinshl, H., Mohnon, D., Meins, F. Jr. (1987). Regulation of a plant pathogenesis-
related enzyme: Inhibition of chitinase and chitinase mRNA accumulation in cultured
tobacco tissues by auxin and cytokinin. Proc. Natl. Acad. Sci, USA 84: 89-93
Shinshl, H., Neuhaus, J.-M., Ryals, J., Meins, F. (1990). Structure of a tobacco
endochitinase gene: evidence that different chitinase genes can arise by
transposition of sequences encoding a cysteine-rich domain. Plant Mol. Biol. 14:
357-368

Smith, J.J., Raikhel, MN. (1989). Nucleotide sequences of cDNA clones encoding
wheat germ agglutinin isolectins A and D. Plant Mol. Biol. 13: 601-603

Stanford, A., Bevan, M., Northcote, D. (1989). Differential expression within a family
of novel wound-induced genes in potato. Mol. Gen. Genet. 215: 200-208
Stlnlssen, H.M., Chrlspeels, M.J., Peumans, W.J. (1985). Biosynthesis of lectin in
roots of germinating and adult cereal plants. Planta 164: 278-286

Tsuda, M. (1979). Purification and characterization of a lectin from rice bran. J.
Biochem. 86: 1451-1461

Van Parijs, J., Broekaert, W.F. Goldstein, I.J., Peumans, W.J. (1991). Hevein: an
antifungal protein from rubber-tree (Hevea brasiIiensis) latex. Planta 183: 258-264

Walulono, K., Scholma, RA, Belntema, J.J., Marlono, A., Hahn, AM. (1975). Amino

18
acid sequence of hevein. Proc. Int. Rubber Cont, Kuala Lumpur, Vol. 2, pp. 518-531

Wilkins, T.A., Raikhel, MN. (1989). Expression of rice lectin is governed by two
temporally and spatially regulated mRNAs in developing embryos. Plant Cell 1: 541 -
549

Wright, 0.8. (1992). Crystal structure of a Wheat Germ Agglutinin / Glycophorin-
Sialoglycopeptide receptor complex. J. Biol. Chem. 267: 14345-14352

Wright, H.T., Sandrasegaram, G., Wright, CS. (1991). Evolution of a family of N-
acetylglucosamine binding proteins containing the disulfide-rich domain of wheat
germ agglutinin. J. Mol. Evol. 33: 283-294

Zhu, 0.. Lamb, C.J. (1991). Isolation and characterization of a rice gene encoding

a basic chitinase. Mol. Gen. Genet. 26: 289-296

CHAPTER 2

Wound-Induced Accumulation of mRNA Containing a Hevein Sequence
In Laticifers of Rubber Tree (Hevea brasiIiensis)

This chapter was originally published in:
Willem Broekaert, Hyung-il Lee, Anil Kush, Nam-Hal Chua and Natasha Raikhel.

(1990). Proc. Natl. Acad. Sci USA 87: 7633-7637

19

20
ABSTRACT

Hevein is a chitin-binding protein which is present in Iaticifers of the rubber tree
(Hevea brasiIiensis). A cDNA clone (HEV1) encoding hevein was isolated by
polymerase chain reaction using mixed oligonucleotides corresponding to two
regions of hevein as primers and a Hevea latex cDNA library as a template. HEV1
is 1018 bp long and includes an open reading frame of 204 amino acids. The
deduced amino acid sequence contains a putative signal sequence of 17 amino
acid residues followed by a 187 amino acid polypeptide. This polypeptide has two
striking features. The amino-terminal region (43 amino acids) is identical to hevein
and shows homology to several chitin-binding proteins and to the amino-termini of
wound-inducible proteins in potato and poplar. The carboxyl-terminal portion of the
polypeptide (144 amino acids) is 74-79% similar to the carboxyl-terminal region of
wound-inducible genes of potato. Wounding, as well as application of the plant
hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts

in leaves, stems and latex, but not in roots.

21
INTRODUCTION

Latex of the rubber tree (Hevea brasiIiensis) is produced by highly specialized cells
known as Iaticifers (de Fay and Jacob, 1989). The contiguous end walls of adjacent
Iaticifer cells are perforated, thus forming an anastomosing system. Upon
wounding, the cytoplasmic content of these cells is expelled in the form of latex.
Sealing of wound sites occurs by coagulation of the outflowing latex. This process
involves bursting of the lutoid bodies (organelles of vacuolar origin) and subsequent
interaction of the released cationic proteins with the negatively charged rubber
particles (d ’Auzac and Jacob, 1989). Wound plugging may be important in
preventing entry of pathogens into the phloem.

One of the major proteins in the lutoid bodies of rubber tree latex is hevein
(Archer et al., 1969). Hevein is a small, single chain protein of 43 amino acids
unusually rich in cysteine and glycine (Walujono et al., 1975). Recently, hevein has
been shown to bind chitin and to inhibit the growth of several chitin-containing fungi
(Van Parijs et al., 1991). It has therefore been suggested that hevein plays a role
in the protection of wound sites from fungal attack (Van Parijs et al., 1991).

Various classes of chitin-binding proteins have been reported to contain
polypeptide domains homologous to the hevein sequence. The lectins from the
monocotyledonous species wheat, barley and rice are composed of four repetitive
hevein-like domains (Wright et al., 1984; Raikhel and Wilkins, 1987; Lerner and
Raikhel, 1989; Wilkins and Raikhel, 1989), whereas a related lectin from the

dicotyledonous Urtica dioica is thought to be composed of two such domains

22

arranged in tandem (Chapot et al., 1986). Basic chitinases from bean (Broglie et
al., 1986; Lucus et al., 1985), tobacco (Shinshi et al., 1987) and poplar (Parsons et
al., 1989) have a single hevein-like domain located at the amino-terminus which is
fused to an unrelated carboxyl portion. Likewise, two wound-induced genes from
potato encode proteins with a hevein-like domain located at the amino-terminus and
a carboxyl-terminal extension that differs from the chitinase carboxyl-terminus
(Stanford et al., 1989).

Here we describe the isolation and sequence analysis of a cDNA clone
encoding hevein. However, the cDNA clone (HEV1) encodes a protein with an
extensive carboxyl-terminal portion not present in the mature hevein. We also
present data on the accumulation of hevein mRNA in response to wounding and

hormonal treatment.
MATERIALS AND METHODS

Plant Material

Latex for construction of the cDNA library was obtained from rubber trees twenty
years of age (H. brasiIiensis RRIM600). These trees were regularly tapped for latex
and were treated with 0.1% ethephon (2-chloroethylphosphonic acid) two weeks
prior to tapping, a procedure which enhances latex production (Coupe and
Chrestin, 1989). For studying the regulation of hevein gene expression by Northern
blot analysis, seedlings four months of age of H. brasiIiensis RRIM600, grown in a

growth chamber, were used.

23
RNA Isolation and Construction of Latex-specific cDNA Ubrary

Total RNA from the latex was extracted as described by Kush et al. (1990) and
poly(A)+ RNA was purified by oligo-dT cellulose affinity chromatography using the
method of Silflow et al. (1979). Double-stranded cDNAs were prepared from 10 ug
of poly(A)+ RNA according to Gubler and Hoffman (1983) with the cDNA Synthesis
System (Amersham, Arlington Heights, IL). The cDNA was ligated into lambda gt10
(Stratagene, San Diego, CA) with EcoRI linkers (New England Biolabs, Beverly, MA)
and packaged in vitro using Gigapack Gold (Stratagene). The host strain used for
screening plaques was E. coli C600hfl. (The cDNA library was constructed by Dr.

Anil Kush.)

Polymerase Chain Reaction (PCR)

The oligonucleotide mixtures were synthesized by the Macromolecular Structure,
Sequencing and Synthesis Facility at Michigan State University. DNA amplification
was carried out on a Perkin-Elmer thermal cycler, in a 100 pl vol containing 50 mM
KCI, 10 mM Tris-HCI (pH 8.3), 1.5 mM MgCl2, 0.01% gelatin, 1 uM of each primer
(Fig. 1), 200 uM each dNTP, 2.5 units of Thermus aquaticus polymerase (Cetus),
and 1 ug of lambda gt10 cDNA library. Twenty five cycles of amplification were
performed (96°C for 1 min, 47°C for 2 min, 72°C for 3 min with a final polymerase
extension step at 72°C for 7 min) and 10% of the product was analyzed on a 1%
agarose (SeaKem; FMC) gel. The product was excised from the gel and
reamplified. The reamplified band was isolated as above, digested with EcoRI and

BamHI, and ligated into pUC119 (Vieira and Messing, 1987).

 

24
lsolatlon of the HEV1 Clone and DNA Sequencing

The amplified PCR fragment was labeled with [32deATP by the random primer
technique (Feinberg and Vogelstein, 1985). Approximately 200,000 plaque forming
units of the lambda gt10 cDNA library were screened with the [PH-labeled PCR
product as the probe by in situ plaque hybridization at high stringency conditions
(Raikhel et al., 1988). Plaques producing positive signals were selected and
rescreened using the same probes under the same conditions. Inserts from purified
plaques were subcloned into the EcoRI site of pUC119 and sequenced by the
dideoxynucleotide chain termination method (Sanger et al., 1977) using [a-“Sj-dATP
and 7-deaza-dGTP in place of dGTP (Mizusawa et al., 1986). The complete
sequence of the clones was obtained by sequencing overlapping deletions
generated by T4 DNA polymerase (Dale and Arrow, 1987). Sequence analysis was
performed by Editbase software (courtesy of N. Nielsen, Purdue University, West

Lafayette, IN).

Northern blot analysis

Total RNA from the various parts of four-month old seedlings was prepared by the
method of IGrk and lGrk (1985) using aurincarboxylic acid. Microtapping was done
to collect the latex, by making an incision on the stem and collecting the drops of
exuded latex. Total RNA was separated in 2% agarose gels containing 6%
formaldehyde and blotted onto Hybond-N membrane (Amersham). The conditions
of blotting, prehybridization and hybridization were as recommended by the

manufacturer. Blots were hybridized with the cDNA HEV1 labeled by the random

 

25
primer method of Feinberg and Vogelstein (1985).

Wounding of Hevea Stems, Ethephon and ABA Applications

For wounding, a spiral out about 0.5 cm deep was made on the stem of seedlings
and RNA was extracted from stem, leaf and latex 24 hours later. Ethephon 0.1%
(v/v) was sprayed on young seedlings and RNA was isolated from stem, leaf and
latex after 24 hours. ABA (50 uM) dissolved in sterile water containing 0.01%
ethanol was sprayed on the plant and RNA was extracted from stems, leaf and latex
after 24 hours as described above. Control plants were sprayed with water/ethanol
solution alone. Autoradiograms were scanned with a Gilford (Oberlin, Oh., USA)

densitometer.

RESULTS

Isolation and Sequence of a Full-Length cDNA Clone

The primary structure of the hevein protein has been previously reported (Fig. 1A;
Walujono et al., 1975). We synthesized three sets of oligonucleotide primers
corresponding to the amino-terminal, carboxyl-terminal and internal regions of the
hevein protein (Fig. 1A; Walujono et al., 1975). Each primer was a degenerate
mixture of oligonucleotides encoding the shaded amino acids (Fig. 1). The amino-
terminal and carboxyl-terminal primers were used in the PCR. The template for the

PCR was phage DNA prepared from a Hevea brasiIiensis lambda gt10 cDNA

26

Fig. 1. Complete amino acid sequence of mature hevein and

nucleotide sequences of the primers used in PCR.
A) Amino acids of hevein are depicted as single letter codes. Peptide sequences
corresponding to the PCR primers are indicated by the shaded boxes. 8) The
nucleotide sequences of the PCR primers are represented by the following codes:
M, either A or C; N, A, G, C, or T; R, either A or G; 8, either C or G; W, either A or
T; Y, either T or C. The orientation relative to hevein mRNA is sense for the amino-
terminal primer, and antisense for the internal and carboxyl-terminal primers.

Restriction enzyme sites are underlined (Hindlll) or double underlined (BamHl).

 

 

 

27

 

 

A)

10 20 30
QCGRQAGGKLCPNNLccsowcwccsroEv
N-terminal Internal

40
CSPDHNCQSNCKD
C-terminal
B)
PCR Primer Primer Sequence Compl
the Primer
N-lermlnal: 5' AAQQTTGARCARTGYGGNMGNCARGC 3' 512
IntemaI: 5' CCRCACCANCCCCAYTG 3' 16

C-termlnal: 5' fifiATQQCARTTNSWYTGRCART—TRTG 3' 512

 

 

28

library. The amplified DNA fragment was identified by agarose gel electrophoresis
as a band of the expected size of 140 base pairs. To confirm that the amplified
DNA was derived from a portion of the hevein cDNA, the 140 base pair fragment
was gel-purified and reamplified with the amino-terminal and Internal primers. The
predicted size of the reamplified PCR product was 80 base pairs. To rescue the
140 base pair fragment, DNA from the entire PCR reaction was digested with
appropriate restriction enzymes (recognition sites for Hindlll and BamHI were
included at the 5’ end of the amino-terminal and carboxyl-terminal primers,
respectively, Fig. 1B) and cloned into the plasmid PUC119 between the BamHI and
Hindlll sites. Recombinant clones were propagated in Eco/i and several isolates
containing inserts of the appropriate molecular size were chosen. Sequencing of
the inserts demonstrated that each contained an open reading frame corresponding
to the hevein sequence.

For isolating the full-length hevein cDNA clone, a lambda gt10 cDNA library
was synthesized from p0ly(A)+ RNA isolated from the latex of Hevea brasiIiensis.
Approximately 200,000 primary recombinant phages were screened with the 140-
base pair PCR product. Eight positive clones were identified that contained inserts
ranging from 1 to 1.2 kbp. Dideoxy sequencing of the longest cDNA (HEV1)
showed that this clone was 1018 nucleotides long and contained an open reading
frame of 204 amino acids including 17 amino acids at the amino terminus that are
not present in the mature protein (Fig. 2). These residues comprised a predicted
signal sequence structure (von Heijne, 1985) and the cleavage site between the -1

and +1 amino acid matches the amino terminus found by protein sequence analysis

29

Fig. 2. Nucleotide and deduced amino acid sequence of hevein cDNA clone (HEV1).
The deduced amino acid sequence is numbered on the right. Numbers on the left
refer to the nucleotide sequence. The open box indicates the mature hevein
domain. The two stop codons at the end of the coding region are marked with

asterisks. The potential polyadenylation signal is underlined.

67

30

I F I V V L L
”F“ TTATAGTTGTTTTATTATGTTTAACAGGTGTTGCAATTGCTGAGCAA

 

C G R Q A G G K L C P N N L C C S Q W G W C
lblbblLbbLAAGCAGGTGGCAAULILIULLLLAATAALLIALULLl'ml

 

G Y C S P D H N C Q S N C K D S G E
GGCTCCACTGATGAATATTGTTCACCTGATCATAACTGCCAAAGCAATTGCAAAGACAGCGGCGAA

 

G V G G G S A S N V L A T Y H L Y N S Q D H
GGTGTTGGTGGTGGAAGTGCTTCCAACGTTCTTGCGACGTACCATTTGTATAATTCACAGGATCAT

 

 

 

 

G W D L N A A S A Y C S T W D A N K P Y S W
GGATGGGACTTPAAIttI x ..-. “caarrramamTCATGG
R S Y G W T A F C G P V G A H G Q S S C G
Prrnrre‘ mrrAbmrrnmmnmrrrrmnonrmrvrnrrnvnrrrnnnamnnmnnmrmrrn
K C L S V T N T G T G A K T T V R I V D Q C
AAGTGCTTGAGTFTCACAAATAC' T ' m ‘TTTAAAACFAC‘"T"‘ iutuuntCAGTGT
S N G G L D L D V N V F R Q L D T D G K G Y
AGTAATGGAGGACTAGATTTFPAPFTFR TTTPPFTPAAPTFFAFAt‘ -m *xnnrnmnm

 

E R G H I T V N Y Q F V D C G D S F N P L F
GAACGAGGTCATATTACAGTGAACTACCAATTTGTTGATTGTGGAGATTCCTTCAATCCTCTATTC
S V M K S S V I

TCCGTTATGAAATCATCAGTAATTAATTAATAACATTGGATTGGATGTATGTTTAAGTCCAATCGT

AGTAACTAAGCTTCTCAAGCAATAAGCAACAACAAGGCCAATTAATACTTCGTTGGCCACTATAAG

 

AACTTGTG7M IHLUHULIUI “‘T‘ 1LULLUL ‘“m“"""-IILunuCCAGCT

CTGTAAGGTATTGGTGAAGATTATTGGGAAGATCGGCTATCTCTTTAGTGAGATATCCATTGGTTT

lLLLLlLLlLLLILLLflAUILUUULULALIIUAULAHLUHL Libfl

m
1'1
F]
3!

\‘Ufll LULU

AGTTCAAGGT”"‘ -iut "” ""“A‘T‘TTTAATGTTTATATTTTTTTTTTATAT

AATAAAAGTTTTGTTTGCAAAAAAAAAA

2

134

156

178

31

(Walujono et al., 1975). The deduced amino acid sequence of the region following
the putative signal peptide (Fig. 2) is identical to the known 43 amino acid sequence
of hevein (open box in Fig. 2). In addition to the putative signal sequence and the
known hevein protein, the cDNA clone encoded a protein with an additional 144
amino acids (Fig. 2) extending beyond the hevein sequence.

The 3’-untranslated region contained two consecutive in-frame termination
codons (TAA, TAA, Fig. 2, stars) and a 316 nucleotide untranslated region. A
potential polyadenylation signal (AATAAA, underlined in Fig. 2) began at position

991 and was followed 11 nucleotides downstream by a short po|y(A) tail.

Northern blot analysis

To confirm the identity of the HEV1 cDNA clone, total RNA extracted from Hevea
brasiIiensis latex was fractionated by agarose-formaldehyde gel electrophoresis and
transferred to a nitrocellulose filter. A 1.0-kb mRNA was detected (Fig. 3, lane 1) by
hybridization with the nucleotide fragment that was specific for the amino-terminus
sequence of hevein. The same blot was reprobed with the C-terminal region of the

HEV1 cDNA clone which hybridized to the same 1.0-kb mRNA species (lane 2).

HEV1 is Similar to Wound-Inducible Genes In Potato
A comparison of the primary structure of the HEV1 encoded protein with the wound-
induced genes WIN1 and WIAQ of potato (Stanford etai,1989) demonstrated a high

degree of homology in both the amino-terminal and carboxyl-terminal portions (Fig.

32

 

Fig. 3. Northern blot analysis of total RNA from rubber tree latex.

Lane 1: the blot was probed with a 32P-labelled DNA fragment corresponding to the
amino-terminal region of HEV1 (nucleotides 61-182, see Fig. 2). Lane 2: the same
blot was stripped and reprobed with a 32P-labelled DNA fragment Including the

carboxyl-terminal portion of Hev1 (nucleotides 239-610, see Fig. 2).

33

1.0— .- H

34
4). The overall sequence identity between the HEV1 and the WIN deduced amino

acid sequences was as high as 65% (HEV1/WIN1) and 68% (HEV1/WIN2). No

sequence conservation could be observed in the putative signal-peptide region.

Organ-specific Expression of Hevein mRNA

The expression of hevein mRNA was examined by Northern blot analysis. RNA was
isolated from intact leaves, stems, roots and latex from four young seedlings of
Hevea brasiIiensis. Hevein mRNA accumulates in leaves, stems and latex (Fig. 5

A-C). However, no hevein mRNA was detected in roots (data not shown).

Accumulation of Hevein mRNA upon Wounding, ABA and Ethylene Treatments

To investigate the extent that hevein mRNA is induced by wounding and hormone
treatment, young rubber tree seedlings were locally wounded by applying a spiral
out along their stem. After 24 h the RNA was extracted from leaves, stem and latex
of both intact and wounded plants. Northern blot analysis (Fig. 5A) showed that in
intact plants, hevein was expressed in all three tissues, reaching the highest
expression levels in the latex. However, in leaves, stems and latex of wounded
plants the steady-state amounts of hevein mRNA transcripts increased 2 to 5-fold
relative to the levels in tissues isolated from control plants (Fig. 5A). A similar
increase in hevein mRNA in leaves, stems and latex was observed 24 h after
spraying rubber tree seedlings with either 0.1% ethephon (Fig. 5B) to produce
ethylene, or 50 uM ABA (Fig. 5C). As a control for the specificity of the observed

responses, each blot was reprobed with a probe for beta ATPase (Bounty and

35

030:0 552, 030005000 05m 505... 053085 50:50 505E5205Em
05 50 0500 0580 “mm. 05 0:0 65..., 0.: 85055060 >0 0900505 050 50:50
0300050Eoc 50 5055550 505 00030055 .506 .900 05 5 9505555093
028202500 0% $55 5005:? >0 09550.6 050 m0500 05Em 50055005

N25; 0:0 Sm: 5 «(zoo 05
50: 0003000 80538 0500 0550 05 5 coat—5&8 6.05".

 

 

36

W**MO*>>mQHm>Z>ZQOUZ>mONZ>HQEOOOZU>OQBQHOOM>ZHQAQAUOZmUOQ>HM>BBO4UB¢BZB>MH

zH>mmM2>mmqm*ZMWQOUQ>hOMZ>BHmOMmMOMOQBQAOMW>Z>QAQAOOZmUOQ>HM>BBM4OBOBZB>WA

UMOUmGmwmm0>m00h4830MMmM3¢MMMZ¢QZBm0M4m>¢ZQDZO>ZOmZNHmwfi4m>zaflm0000m0m

_____ .u.___.........__u_._.._._____....... ...u.__._______
5.... . __.__.__._._.__....._...___.._.._. _________.____

UMOUmm00m<0>m00hdfizwwmmMZmNMMZ¢QSBmUMflWflflZHQSOEQOmZMAENBGHDZm¢m00*0>0fl

OMUBUOmOUUOmmmUMmmBmOUSOMOmUUAZZOmA400MOMUUOO¢z¢>MBHmHUH>HGHHHNUUWQM>S

OmQMUZmOUzQOmUNWQBmUUSUSOmUOHZZNUQMOOflOmOUOMGH¢>OBH**UQ*H>>Hh****HZ*2

e e

NZHB

N>mm

NZHZ

H>mm

NZHB

H>mm

 

 

 

 

37

Fig.5. Effect of stress treatments on the accumulation of hevein transcripts.

Total RNA (15 ug per lane) was isolated from leaves (LF), stems (ST) and latex (LT)
of either untreated (-) or treated (+) rubber tree plants. (A) Treatment: wounding.
Probe: coding region of HEV1. (B) Treatment: ethephon (0.1%). Probe: coding
region of HEV1. (C) Treatment: 50 uM ABA. Probe: coding region of HEV1. (D)
Treatment: 50 uM ABA. Probe: beta-ATPase cDNA. (These experiments were

performed by Dr. Anil Kush.)

38

A Wounding
LF ST LT
l- +l I— +1 I— +l

1.0- a- ..g.‘ .

B Ethephon

LF ST LT
l— +Il— +IF— +l

1o-.."'

C ALBA

LF sr LT
l— +IF +IF +]

 

1.0- u...

D ABA
LF sr LT
l— +IF +II— +l

2.1- .‘---.-

 

 

39

Chua, 1985) which is known to be constitutively expressed in plants (Kush et al.,
1990). None of the treatments affected the level of beta ATPase mRNA in any tissue
(Fig SD). No hevein mRNA could be detected in roots from intact, wounded or

hormone treated plants (data not shown).

DISCUSSION

In this chapter, we present the amino acid sequence deduced from a hevein cDNA
clone designated HEV1. The first 43 deduced amino acids are identical to the
known hevein sequence as determined by direct amino acid sequencing (Walujono
et al., 1975). However, the protein deduced from the HEV1 cDNA clone has a
striking feature. The DNA sequence of HEV1 encodes a protein that extends 144
amino acids beyond the carboxyl terminus of the hevein protein. Northern blot
analysis using the amino-terminal and carboxyl-terminal portions of the HEV1 cDNA
clone as probes indicated that they hybridize to the same mRNA species. The
results of the Northern analysis and the fact that amino acids deduced from the
amino-terminal portion of HEV1 cDNA clone are identical to the known hevein

sequence strongly indicate that the HEV1 cDNA clone encodes the hevein protein.

The difference in polypeptide length between purified hevein and the hevein
deduced from the cDNA clone may be the consequence of a post-translational

modification. Thus, cleavage of the 187 amino acid pro-protein may lead to the

40

formation of a mature 43 amino acid hevein and a 144 amino acid carboxyl-terminal
polypeptide. Alternatively, cleavage of the carboxyl-terminal portion may occur
during the purification of hevein and the mature protein may actually contain the full
coding region of the HEV1 clone.

The amino-terminus of the protein encoded by HEV1 cDNA shows extensive
homology to the N-acetyl glucosamine-oligomer-specific lectins from wheat (Raikhel
and Wilkins, 1987), barley (Lerner and Raikhel, 1989), rice (Wilkins and Raikhel,
1989), and Urtica dioica (Chapot et al., 1986), to the amino-termini of basic
chitinases (Broglie et al., 1986; Lucas at al., 1985; Shinshi et al., 1987) and
polypeptides encoded by wound-induced genes (WIN1 and WIN2) of potato
(Stanford et al., 1989). The carboxyl-terminal portion of the HEV1 encoded protein
shows homology to the carboxyl-termini of proteins deduced from WIN1 and WIN2
genes, but not to those of chitinases nor to chitin-binding lectins. The carboxyl-
terminus of HEV1 shows 74% similarity to the deduced amino acid sequences from
the WIN1 gene and 79% to the WIN2 gene. The amino terminus (minus the putative
signal sequence) has 72% and 74% similarity to WIN1 and WIN2, respectively.
These levels of homology indicate that the carboxyl-terminal portion of these
proteins serves a function as important as that of the amino terminus. The study
of the role of both HEV1 domains and the relevance of the presumed post-
translational cleavage is in progress in transgenic tobacco plants.

Wheat germ agglutinin has been demonstrated to act as an anti-nutrient
factor for insect larvae (Murdock et al., 1989). In addition, mature hevein (Van Parijs

et al., 1990) as well as the stinging nettle lectin (Broekaert et al., 1989) and

 

41

chitinases (Schlumbaum et al., 1986; Broekaert et al., 1988) are known inhibitors of
fungal growth in vitro. Hence, it appears that in a broad sense this class of related
chitin-binding proteins may serve to protect plants from attack by a wide range of
potential pathogens. For hevein, however, it remains to be demonstrated that the
presumed post-translational cleavage between amino acids +43 and +44 occurs
in vivo, and that the released amino-terminal hevein portion exerts antifungal activity
in vivo. It is interesting to note that thionins, a group of hydrophobic defense-related
proteins with antifungal properties are also synthesized as large precursors of which
the amino-terminal portions correspond to mature thionins (Bohlmann et al., 1988).

Our results indicate that wounding, or exogenous application of the stress-
related hormones ABA and ethylene, lead to increased steady-state levels of hevein
mRNA in leaves, stems and latex from tapped stems, although not in roots. We do
not know at present whether the accumulation of hevein transcripts in leaves and
stems is confined to the Iaticifers or whether other tissues are involved as well. The
observed response may be systemic since transcripts accumulate in unwounded
leaves upon wounding of the stems. Both wounding and exogenous application of
ethylene have been shown to cause accumulation of mRNAs of defense-related
proteins such as chitinases in beans (Broglie et al., 1986; Hedtick et al., 1988) and
hydroxyproline-rich glycoproteins in carrots (Ecker and Davis, 1987). Recently, ABA
has been implicated in the wound-induced response of protease inhibitor II in potato
and tomato (Pena-Cortes et al., 1989). In our experiments, both ethylene and ABA
mimicked the wound-induced accumulation of hevein mRNAs in different rubber tree

tissues. These data support the hypothesis that several separate signal

 

42

transduction pathways can lead to the activation of wound-induced and/or defense

related genes in plants (Ecker and Davis, 1987; Henstrand and Handa, 1990).

ACKNOWLEDGEMENTS

This research was supported by grants from the National Science Foundation and
the United State Department of Energy to N.V.R. and Rockefeller Foundation to

N.H.C. W.F.B. is a Senior Research Assistant of the Belgian National Fund for

Scientific Research.

43
REFERENCES

Archer, BL (1960). The proteins of Hevea brasiIiensis latex: Isolation and
characterization of crystalline hevein. Biochem. J. 75: 236-240

Bohlmann, H., Clausen, S., Behnke, 8., Glass, H., HIIIer, C., Relmann-Phlllpp, U.,
Schrader, G., Barkholt, V., Apel, K. (1988). Leaf-specific thionins of barley: a novel
class of cell wall proteins toxic to plant-pathogenic fungi and possibly involved in the
defence mechanism of plants. EMBO J. 7: 1559-1565

Boutry, M., Chua, N.-H. (1985). A nuclear gene encoding the beta subunit of the
mitochondrial ATP synthase in Nicotiana plumbaginifolia EMBO J. 4: 2159-2165
Broekaert, W.F., Van Parijs, J., Allen, A.K., Peumans, W.J. (1988). Comparison of
some molecular, enzymatic and antifungal properties of chitinases from thorn-apple,
tobacco and wheat. Physiol. Mol. Plant Pathol. 33: 319-331

Broekaert, W.F., Van Parijs, J., Leyns, F., Joos, H., Peumans, W.J. (1989). A chitin-
binding lectin from stinging nettle rhizomes with antifungal properties. Science 245:
1 100-1 102

Broglle, K.E., Gaynor, J.J., Broglle, RM. (1986). Ethylene-regulated gene expression:
molecular cloning of the genes encoding an endochitinase from Phaseolus vulgaris.
Proc. Natl. Acad. Sci USA 83: 6820-6824

Chapot, M.P., Peumans, W.J., Strosberg, AD. (1986). Extensive homologies
between lectins from non-leguminous plants. FEBS Lett 195: 231-234

Coupe, M., Chrestin, H. (1989). Physico-chemical and biochemical mechanisms of

hormonal (ethylene) stimulation. In Physiology of Rubber Tree Latex, eds. d ’Auzac,

 

44
J., Jacob, J. L. and Chrestin, H. (CRC Press Inc., Florida), pp. 295-319

Dale, R.M.K., Arrow, A. (1987). A rapid single-stranded cloning, sequencing,
insertion, and deletion strategy. Methods Enzymol. 155: 204-214

d'Auzac, J., Jacob, J.L (1989). The composition of latex from Hevea brasiIiensis as
a laticiferous cytoplasm. In Physiology of Rubber Tree Latex, eds. d’Auzac, J.,
Jacob, J.L. and Chrestin, H.(CRC, Boca Raton, FL), pp 59-88

de Fay, E., Jacob, J.L (1989). Anatomical organization of the laticiferous system
in the bark. In Physiology of Rubber Tree Latex, eds. d’Auzac, J., Jacob, J. L. and
Chrestin, H.(CRC, Boca Raton, FL), pp. 3-29

Ecker, J.R., Davis, R.W. (1987). Plant defense genes are regulated by ethylene.
Proc. Natl. Acad. Sci USA 84: 5202-5206

Feinberg, A.P., Vogelstein, B. (1985). A technique for radiolabeling DNA restriction
endonuclease fragments to high specific activity. Anal. Biochem. 137: 266-267
Gubler, U., Hoffman, B.J. (1983). A simple and very efficient method for generating
cDNA libraries Gene 25: 263-269

Hedrick, S.A., Bel, J.N., Boiler, T., Lamb, C.J. (1988). Chitinase cDNA cloning and
mRNA induction by fungal elicitor, wounding, and Infection. Plant Physiol. 86: 182-
186

Henstrand, J.M., Handa, AK. (1990). Effect of ethylene action inhibitors upon
wound-induced gene expression in tomato pericarp. Plant Physiol. 91: 157-162
Kirk, M.M., Ifirk, LB. (1985). Translational regulation of protein synthesis, in
response to light, at a critical stage of Volvox development. Cell 41: 419-428

Kush, A, Goyvaerts, E., Chye, M.L, Chua, N.-H. (1990). Laticifer-specific gene

45
expression in Hevea brasiIiensis Proc. Natl. Acad. Sci. USA 87: 1787-1790

Lemar, D.R., Raikhel, NM. (1989). Cloning and characterization of root-specific
barley lectin. Plant Physiol. 91: 124-129

Lucas, J., Henschen, A., Lottspeich, F., Vogeli, U., Boiler, T. (1985). Amino-terminal
sequence of ethylene-induced bean leaf chitinase reveals similarities to sugar-
binding domains of wheat germ agglutinin. FEBS Lett. 193: 208-210

Mizusawa, S., Nishimura, 8., Seela, F. (1986). Improvement of the dideoxy chain
termination method of DNA sequencing by use of deoxy-7-dazaguanosine
triphosphate in place of dGTP. Nucl. Acids Res. 14: 1319-1324

Murdock, LL, Huesing, J.E., Nielsen, S.S., Pratt, R.C., Shade, RE. (1990). Biological
effects of plant lectins on the cowpea weevil. Phytochemistry 29: 85-89

Parsons, T.J., Bradshaw, H.D. Jr., Gordon, MP. (1989). Systemic accumulation of
specific mRNAs in response to wounding in poplar trees. Proc. Natl. Acad. Sci. USA
86: 7895-7899

Pena-Cortes, H., Sanchez-Serrano, J.J., Martens, R., Willmltzer, L, Prat, S. (1989).
Abscisic acid is involved in the wound-induced expression of the proteinase inhibitor
II gene in potato and tomato. Proc. Natl. Acad. Sci, USA 86: 9851 -9855

Raikhel, N.V., Bednarek, S.Y., Wilkins, TA (1988). Cell-type-specific expression of
a wheat-germ agglutinin gene in embryos and young seedlings of Triticum aestivum.
Planta 176: 406-414

Raikhel, N.V., Wilkins, TA (1987). Isolation and characterization of a cDNA clone
encoding wheat germ agglutinin. Proc. Natl. Acad. Sci. USA 84: 6745-6749

Sanger, F., Nicklen, S., and Coulson, AR. (1977). DNA sequencing with chain-

46
terminating inhibitors. Proc. Natl. Acad. Sci USA 74: 5463-5467

Schlumbaum, A., Mauch, E, ngell, U., and Boiler, T. (1986). Plant chitinases are
potent inhibitors of fungal growth. Nature 324: 365-367

Shinshi, H., Mohnen, D., and Meins, F. Jr. (1987). Regulation of a plant
pathogenesis-related enzyme: Inhibition of chitinase and chitinase mRNA
accumulation in cultured tobacco tissues by auxin and cytokinin. Proc. Natl. Acad.
Sci, USA 84: 89-93

Silflow, C.D., Hammett, J.R., Key, J.L (1979). Sequence complexity of
polyadenylated ribonucleic acid from soybean suspension cultured cells.
Biochemistry 18: 725-731

Stanford, A., Bevan, M., Northcote, D. (1989). Differential expression within a family
of novel wound-induced genes in potato. Mol. Gen. Genet. 215: 200-208

Van Parijs, J., Broekaert, W.F., Goldstein, I.J., and Peumans, W.J. (1991). Hevein:
an antifungal protein from rubber-tree (Hevea brasiIiensis) latex. Planta, 183: 258-264
Vielra, J., Messing, J. (1987). Production of single-stranded plasmid DNA. Methods
Enzymol. 153: 3-11

von Heijne, G. (1985). Signal sequences: The limits of variation. J. Mol. Biol. 184: 99-
105

Walujuno, K., Scholma, RA, Beintema, J.J., Marlono, A., Hahn, AM. (1975). Amino
acid sequence of hevein. In Proc. Int. Rubber Conf. pp. 518-531

Wilkins, T.A., Raikhel, NM (1989). Expression of rice lectin is governed by two
temporally and spatially regulated mRNAs in developing embryos. Plant Cell 1:

541 -549

47
Wright. 0.8., Gavilanes. E. Peterson. D.L (1984). Primary structure of wheat germ

agglutinin isolectin 2. Peptide order deduced from X-ray Structure. Biochemistry 23:

280-287

CHAPTER 3

Co- and Post-Translational Processing
of the Hevein Preproprotein
of Latex of the Rubber Tree (Hevea brasiIiensis)

This chapter was originally published in:
Hyung-il Lee, Willem F. Broekaert and Natasha V. Raikhel (1991).

J. Biol. Chem. 24: 15944-15948

48

49
ABSTRACT

Hevein is a chitin-binding protein of 43 amino acids found in the lutoid body-
enriched fraction of rubber tree latex. A hevein cDNA clone (HEV1) [Broekaert, W.,
Lee, H.-l., Kush, A., Nam, C.-H., and Raikhel, N. (1990) Proc. Natl. Acad. Sci. USA
87, 7633-7637] encodes a putative signal sequence of 17 amino acids followed by
a polypeptide of 187 amino acids. Interestingly, this polypeptide has two distinct
domains: an amino-terminal domain of 43 amino acids corresponding to mature
hevein and a carboxyl-terminal domain of 144 amino acids. To investigate the
mechanisms involved in processing of the protein encoded by HEV1, three domain-
specific antisera were raised against fusion proteins harboring the amino-terminal
domain (N domain), carboxyl-terminal domain (C domain) and both domains (NC
domain). Translocation experiments using an in vitro translation system show that
the first 17 amino acid sequence encoded by the cDNA functions as a signal
peptide. Immunoblot analysis of proteins extracted from lutoid bodies demonstrates
that a 5-kDa protein comigrated with purified mature hevein and crossreacted with
N domain and NC domain-specific antibodies. A 14-kDa protein was recognized
by C domain and NC domain-specific antibodies. A 20ckDa protein was cross-
reactive with all three antibodies. Microsequencing data further suggest that the 5-
kDa (amino-terminal domain) and 14-kDa (carboxyl-terminal domain) proteins are
posttranslational cleavage products of the 20-kDa polypeptide (both domains) which
corresponds to the proprotein encoded by HEV1. In addition, it was found that the
amino-terminal domain could provide chitin-binding properties to a fusion protein

bearing it either amino-terminally or carboxyl-terminally.

 

 

50
INTRODUCTION

Latex of the rubber tree (Hevea brasiIiensis) is composed of the cytoplasmic fluid
of specialized tube-like cells, called Iaticifers. These Iaticifer cells are known to form
an anastomosing system in H. brasiIiensis. Upon wounding, damaged sites are
sealed by coagulation of the outflowing latex. This coagulation process involves
bursting of the lutoid bodies (vacuolar origin), followed by interaction of the released
cationic proteins with the negatively charged rubber particles (d ’Auzac and Jacob,
1989)

Hevein is one of the major proteins from the lutoid body-enriched fraction,
which can be separated by ultracentrifugation (Archer et al., 1960). It is a small,
single chain protein of 43 amino acids (Walujono at al., 1975) and is classified as
a chitin-binding protein (Van Parijs et al., 1991). Although the exact physiological
role of hevein in vivo is not understood, it has been shown by in vitro experiments
that this protein inhibits the growth of several chitin containing fungi (Van Parijs et
al., 1991). Recently, we have isolated and characterized a cDNA clone encoding
hevein, designated HEV1 (Broekaert et al., 1990). From the deduced amino acid
sequence, it appears that HEV1 encodes a polypeptide of 187 amino acids
including a putative signal sequence of 17 amino acids. This polypeptide
possesses two distinct domains: an amino-terminal domain corresponding to the
43 amino acids of mature hevein and an extensive carboxyl-terminal domain of 144
amino acids. The difference in polypeptide length between hevein and the HEV1-

encoded polypeptide suggests that the formation of mature hevein may result from

51

two proteolytic cleavages of the hevein precursor in viva. The first cleavage would
involve removal of the signal peptide, which is necessary for cotranslational
translocation into the lumen of the rough endoplasmic reticulum (RER). A
subsequent posttranslational processing could give rise to the formation of the
amino-terminal portion (hevein) and carboxyl-terminal portion. Alternatively,
cleavage of the carboxyl-terminal extension may occur as an artifact during the
purification of hevein.

We are intereSted in understanding the mechanisms and the role of the post-
translational modifications that occur during hevein biosynthesis. One approach to
address these questions is to make use of domain-specific antibodies. In this
report, we describe the production of domain-specific antibodies and present
immunological evidence to show that the hevein signal sequence can be cleaved
in vitro and posttranslational cleavage of the 187 amino acid polypeptide in vivo
yields the hevein and carboxyl-terminal peptides. Moreover, we demonstrate that
the amino-terminal domain can confer chitin-binding properties on polypeptides to

which it is fused.

MATERIALS AND METHODS

Source Materials
Freeze-dried bottom fraction of latex (lutoid body-enriched fraction) was a gift of Dr.

Anil Kush from National Institute of Singapore, Kent Ridge, Singapore. Alternatively,

52

lutoid body-enriched factions were also prepared by a single step of
ultracentrifugation (50,0009, 1h, 4° C) of latex (Moir, 1959; Martin, 1991) which was
obtained from 2—3 year old H. brasiIiensis, grown in a greenhouse at Michigan State
University. HPLC-purified hevein was kindly provided by Dr. J. J. Beintema,
Rijksuniversiteit, Groningen, The Netherlands. Chitin was prepared by reacetylation

of chitosan (Sigma, St. Louis, MD) as described by Molano et al. (1977).

Site-directed Mutagenesls, Plasmid Construction, and Preparation of Fusion Proteins
and Polyclonal Antibodies

To facilitate subcloning of the amino-terminal (N), carboxyl-terminal (C) and both
(NC) domains of HEV1, restriction enzyme sites and stop codons were introduced
into desired DNA sequences of the wild type HEV1 clone by site-directed
mutagenesis according to Kunkel et al. (1987). Two synthetic oligonucleotides,
NR26 and NR27, were designed for mutagenesis. The NR26 (43mer) is 5’CuAG
GTGTTGCAATTGCTWGG,AGCAATGTGGTCG743’ (underline: EcoRI
and Smal sites) and delimits the 5’ end of the N domain. The NR27 (61 mer) is
5 ”G,7°CCAAAGCAATTGCAAAGAC,asTQATGAAQATCTAAGCTTGAflA,mGCG
GCGAAGGTGTTGGZOG3’ (underline: stop codons, Bglll, Hinolll and EcoFil sites) and
was used to mutagenize the junction between the N and C domains. Since the wild
type HEV1 sequence has a Hindi" site located downstream of the natural stop
codon, the 3’ end of the C domain was not altered. HEV1-containing pUC119
(pHEV1) was used to produce a single stranded uracil-containing DNA template in

Escherichia coli strain CJ236 (dut, ung). Two mutant constructs were derived from

53
this template: HEVm1 contained both mutations introduced by NR26 and NR27,

whereas HEVm2 only had the NR26 defined mutation. To confirm the identity of the
mutagenized sequences, both constructs were sequenced by the dideoxy chain
termination method (Sanger et al., 1977) using single stranded DNA obtained from
phagemids in the E. coli strain MV1193. The DNA fragments encoding different
domains were isolated as EcoRl-Hindlll fragments either from HEVm1 (for the N
domain, 170 bp, and the C domain, 480 bp) or from HEVm2 (for the NC domain,
610 bp), and subsequently subcloned in frame into corresponding restriction sites
of the E. coli expression vector le821 (New England Biolabs, Beverly, MA). This
expression vector carries the MaIE gene lacking its signal sequence (Guan et al.,
1987). Fusion proteins were expressed in E. coli strain MV1193 and were purified
on a crosslinked amylose affinity column (New England Biolabs, Beverly, MA)
according to manufacturer’s protocol. To produce polyclonal antibodies against
specific domains, purified fusion proteins (100 pg per immunization) were injected

into New Zealand white rabbits.

In Vitro Transcription, In Vitrc Translation and Translocation

For preparation of the hevein transcript, the Ecch-Hindlll DNA fragment from HEV1
cDNA was subcloned into pBS SK' (Stratagene, La Jolla, CA). RNA transcripts were
generated from the p88 SK' construct using T3 polymerasezaccording to the
manufacturer’s protocol. In vitro translation was performed with a wheat germ
extract cell-free system (Promega, Madison, WI) according to the manufacturer's

instructions. [”8] cysteine (1,200 mCi/mmol; NEN, Boston, MA) at the final

54

concentration of 0.5 mCi/ml was added into the reaction mixture because of high
cysteine contents (fifteen residues) but low methionine contents (two residues at the
position -17 and 181) in the HEV1-encoded protein (Broekaert et al., 1990). For
cotranslational translocation experiments, the translation reaction mixture was
supplemented with either canine pancreatic microsomes (Amersham, Arlington
Heights, IL) or maize microsomes that were kindly provided by Dr. Jan Miernyk
(USDA, Peoria, IL). For protease protection assays, Proteinase K (0.5 mg/ml) and
1% (v/v) Triton X-100 were added into the translation reaction mixture and were
incubated on ice for 1 hour. After 1 hour incubation, 5 mM phenylmethylsulfonyl

fluoride (PMSF) was added to inhibit further proteinase K activity.

SDS-PAGE, Fluorography and lmmunoblotting

In vitro translation products were immunoprecipitated with NC domain-specific
antibodies (Anderson and Blobel, 1983) and were fractionated by sodium dodecyl
sulfate polyacrylamide electrophoresis (SDS-PAGE), followed by fluorography
(Mansfield et al., 1988). SDS-PAGE was performed on 12 to 17.5% (w/v)
polyacrylamide gels using the discontinuous buffer system of Laemmli (1970).
Control experiments were conducted with pre-immune serum or maltose binding
protein (MBP) antiserum. For immunoblotting analysis, proteins from the lutoid
body-enriched fraction were separated by SDS-PAGE and were transferred on
lmmobilon P (Millipore, Bedford, MA) using a semidry electroblotting apparatus
(Millipore, Bedford, MA). The blots were probed with N, C or NC domain-specific

antibodies and cross-reactive bands were visualized with alkaline

55

phosphatase-conjugated secondary antibodies (iGrkegaard and Perry Laboratories

Inc., Gaithersburg, MD) as described by Black et al.(1984).

N-terrnlnal Microsequencing

Proteins from the lutoid body-enriched fraction were separated by SDS-PAGE and
were electroblotted on lmmobilon P membranes according to Towbin et al. (1979)
with the following modifications. The transblotting buffer was composed of 10mM
CAPS and 10% methanol (pH11). Transfer proceeded for 60 min, Le, 15 min at
each of the following settings: 50 mA, 100 mA, 150 mA and 200 mA. The desired
protein bands were excised after visualization with Ponceau S. Alternatively,
proteins from the lutoid body-enriched fraction were separated by two-dimensional
PAGE as described elsewhere (0 'Farrell, 1975), transferred on to lmmobilon P
membranes and then stained with Coomassie blue. After destaining, the desired
spot was excised. Protein samples were analyzed on a 477A protein sequencer
with an on-line model 120 PTH AA analyzer (Applied Biosystems, Foster City, CA)
by the Macromolecular Structure, Sequencing and Synthesis Facility at Michigan

State University.

Chitin Binding Assay

Samples were dissolved in either 50 mM sodium acetate buffer (pH 4, for fusion
proteins) or 1X phosphate buffered saline (PBS, for lutoid body proteins) and
loaded on a chitin micro-column (2.5 x 6 mm) equilibrated with either sodium

acetate buffer or 1X PBS, respectively. The samples were recycled through the

56

column three times and the flow-through fractions were collected. After extensive
washing with 1X PBS, the chitin binding proteins were eluted with 6 M Guanidine-
HCI+ 0.1 M NaOH. Flow-through and elution fractions were dialyzed against double
distilled water and lyophilized. The proteins were separated by SDS-PAGE and
analyzed either directly by Coomassie blue staining or indirectly by immunoblotting

as described above.

RESULTS

Expression of Domain-specific Polypeptides and Production of Domain-specific
Antibodies

To produce polyclonal antibodies specifically directed against the N domain, C
domain and NC domain of the protein encoded by HEV1, the corresponding
domain-specific polypeptides were expressed in E. coli. For this purpose, the wild
type HEV1 cDNA was engineered by site-directed mutagenesis to create restriction
sites and stop codons to delimit the different domains. The DNA fragments
encoding each domain were subcloned into the E. coli expression vector le 821
so that their coding sequences were fused to the 3’ ends of the Ma/E gene coding
for the maltose-binding protein (MBP) (Fig. 1). E. coli carrying each construct
produced fusion proteins consisting of either N, C or NC domain fused at the
carboxyl-terminal of MBP. The fusion proteins allowed for purification by amylose

affinity chromatography and were used for immunization of rabbits. As shown by

57

.amxa gamma 9: co 858$ <20 9: memos; 9: 9.25

9:. ._>wI So 869 0992935 9: 9:39am: we: 55 9: 5.52888.

.I can u 9 885.com 9m v.95 EDS: ocm .moom .8on 859%

3 omEmm9o9 2 new 5905 0:659 30sz m5 moooocm MES 85905

coma ozims. ocm Dims. .zde .2 9.68 59%. So 90:95:00 Am

.859 968 gm: 92¢ 33 o__>> So coszEmQO 2

.FNmIE .909 86856 9.: 95 cocooosm :9: 995

90:96:00 8589855 9t .mEmEoo oz can 0 .z €58 9 98595:.

8696.96 3 5m: BE 8089:: 99> mcoooo now new 8% co_8_=mmm
.3205 coma

oEooawcfiEoo 0:685 9209 c289on B 5:03.650 9.: .F 939".

58

 

 

 

 

 

 

 

k!

 

 

59
SDS-PAGE analysis (Fig. 2), the fusion proteins had the expected molecular weights

of 45-kDa for MBP-N domain (lane 2), 55-kDa for MBP-C domain (lane 3) and 60-
kDa for MBP-NC domain (lane 4). The endogenous 40-kDa maltose-binding
proteins from E. coli were copurified in all cases along with the MBP-fusion proteins
(Fig. 2, lanes 2-4). To assess the specificity of the domain-specific antibodies,
HPLC-purified mature hevein (which corresponds to the N domain of HEV1) was
used in immunoblotting experiments. The purified hevein cross-reacted with both
the N domain and NC domain-specific antibodies, but not with the C domain-

specific antibodies (data not shown).

Processing of the HEV1 Signal Peptide upon In Wtro Translation

An in vitro translation system was used to investigate whether the putative 17-
residue peptide present in the HEV1 encoded protein can effectively function as an
ER translocation signal. RNA corresponding to the HEV1 clone was transcribed in
vitro using the T3-T7 polymerase promoter system and subsequently translated in
vitro in a wheat germ extract cell-free system. As shown in Figure 3 (lane 1), two

translation products of approximately 20.5- and 22-kDa were obtained. The 22-kDa
product has the expected size of the primary HEV1 translation product (204 amino
acids). The smaller protein probably is a degradation product of the 22-kDa protein.
Both polypeptides were specifically immunoprecipitated by antibodies raised against
the NC domain (Fig. 3, lane 2). Moreover, none of the translation products could
be immunoprecipitated using either preimmune serum or MBP specific antibodies

(data not shown). Upon addition of either canine pancreatic microsomes (Figure

60

Figure 2. Expresslon of domain specific fusion proteins.

Fusion proteins were over-expressed in E. coli strain MV1193. purified by affinity
chromatography on an amylose column and separated on an SDS gel. MBP-N
(lane 2), MBP-C (lane 3) and MBP-NC (lane 4) proteins were visualized by
Coommassie blue staining. Maltose binding protein (lane 1) was used as control.
Endogenous maltose binding proteins are also seen in lanes 24. (Fusion proteins

were prepared by Dr. Willem Broekaret.)

kDa

97.4—
66.0—
45.0—

29.0—

21 .0—
1 4.04'

61

1234

 

62

$390903: new 99$-me >2 oo~>_mcm 9®>>
98.85 55339.? .5855 050QO 59:8 02 53> o9m:a_o9oocaEE_
9¢>> 51w. mmcmc 853E 5589 on.» .3 mam: 09* :93... So
8585 m5 5 x ommc_99o Co .? mam; v. 0559.05 53> 8695 9¢>> 933E
8589 So 86:96 Baum 525655 05.3 S .93 .Amé mocmc mmEomofiE
2590ch 9:58 So 8:305 90 AN ocm F 3:3 083% 95 c_ 55990
meL mc_c_mEoo 8936 E50 “mos; 53> 39.239553 S 83 Etomcg _.>wI

.floaooa comm—meg o5: S 8 058805 .m 9:9".

 

63

 

 

va
I 5
Iwm
\mv

Io O
lino

an:

 

64

3, lanes 3-5) or maize microsomes (results not shown) to the in vitro translation
system, most of the 22-kDa primary translation product was processed to a 20-kDa
polypeptide (Fig. 3, lane 3). This processing event is consistent with the cleavage
of the 17 amino acid signal sequence by a signal peptidase present in the
microsomal membranes. The degradation product was also observed in Figure 3
(lane 3), which is slightly higher than the processing product of 20-kDa. Proteinase
K digestion of the microsome translation mixture, followed by immunoprecipitation,
confirmed that the 20-kDa polypeptide was located in the microsomes (Fig. 3, lane
4). Lysis of the microsomes by Triton X-100 in the presence of proteinase K
resulted in complete proteinase-mediated degradation of the translocation products

(Fig. 3, lane 5).

Identification of Post-translationally Processed Products In Vrvo

To identify whether the HEV1 encoded polypeptide is specifically cleaved in vivo to
yield an amino-terminal (hevein) and a carboxyl-terminal polypeptide, proteins from
a lutoid body-enriched fraction of latex were analyzed by immunoblotting using the
domain-specific antibodies. From the lutoid body-enriched fraction, at least seven
distinct bands were identified on SDS-PAGE stained with Coomassie blue (Fig. 4,
lane 1). The HPLC-purified hevein migrated as a 5-kDa protein and was
immunoreactive with the N domain (Fig. 4, lane 2) and NC domain-specific
antibodies (data not shown). As shown in Figure 4 (lane 3), the N domain-specific
antibody recognized two bands which migrated as 5— and 20-kDa proteins. C

domain-specific antibody crossreacted with a 14- and a 20-kDa protein, but not with

65

..N

000: 500550 050000-50E00 z 53> 0050_ooc:EE_ 00>> c_0>0c 00559040.:

55:00 0 0< .EmEoo Am 0:0: 02 .0 Av 0cm: 0 .8 0:0: 2 05 .9 050000

00500500 53> o0:o_ooc:EE_ .0 C 0:0: 020 0_000EEooo 53> 00590 .050

90>> 0590.0 >000 .092 00905005020 .05. .w0<n_-wow >0 090.0000

00>> 00500... 00:03:00,000 992 So... 0590.0 _99 .0 a: or >_90E_xo.00<
0200055 0500000200 9.0:

8.80.. 85:55.8 22:. 05 s 9.20.0 .o 09.05 85052.... .4 050.1.

66

Imv

00x

67
the 5-kDa protein (Fig. 4, lane 4). In addition, the NC domain-specific antibody

detected all three proteins of 5-, 14- and 20-kDa (Fig. 4, lane 5). These data
suggest that the 5-, 14- and 20-kDa bands correspond to mature hevein (amino-
terminal domain), to the carboxyl-terminal domain, and to the proprotein containing
both domains, respectively. To confirm the identity of the 14— and 20-kDa
polypeptides, the primary amino acid sequence of the amino-terminus of each
polypeptide was analyzed by microsequencing. The nine N-terminal amino acids
of the 20-kDa protein are E-Q-X-G-R-Q-A-G-G (X: unidentified amino acid residue).
These sequences are exactly matched to amino acids at position 1 through 9,
deduced from HEV1 (Broekaert, 1990), except for the cysteine residue at position
3 which can not be determined by Edmann degradation. The N-terminal amino acid
sequence of the 14-kDa polypeptide is G-G-S—A-S-N-MM-L—A-T—Y which
corresponds to amino acids 50 (G) to 60 (Y) of the HEV1-encoded protein with the
exception of the methionine residue at position 56. This methionine residue is most
likely due to isoforms which were observed by two-dimensional gel electrophoresis.
The N-terminal sequence analysis of the 14-kDa polypeptide indicates that post-
translational cleavage in vivo occurs between amino acids 43 and 50 of the HEV1-
encoded protein and that six amino acids, 44 to 49 (S-G-E-G-V-G), are lost during

maturation.

Chitin-binding Properties of Hevein and Hevein-containing Polypeptides
Since hevein (N domain) is known to have chitin-binding properties (Van Parijs et

al.,1990), we investigated whether the proprotein (NC domain) also had the ability

 

68

to bind chitin. The lutoid body-enriched fraction was subjected to affinity
chromatography on chitin. The fraction was eluted with 6 M Guanidine-HCI
containing 0.1 M NaOH and was subsequently analyzed by immunoblotting using
NC domain-specific antibodies. In the chitin-unbound fraction, the 14—kDa protein
(C domain) was recovered but both the 5-kDa protein (N domain) and the 20-kDa
protein (NC domain) were almost completely depleted (Fig. 5, lane 2). After elution
with 6 M Guanidine-HCI containing 0.1 M NaOH, both the 5- and the 20—kDa protein
but not the 14-kDa protein were eluted from the chitin column as shown in Figure
5 (lane 3). Thus, it appears that the C domain polypeptide of 14-kDa, which has no
affinity toward chitin, acquires chitin-binding properties when it is linked carboxyl-
terminally to the hevein domain. It is interesting to note that the proportion of the
5-kDa to 20-kDa protein in chitin-bound fraction (Fig. 5, lane 3) is much higher than
that in the lutoid body-enriched fraction (Fig. 4, lane 5). These results may reflect
that hevein (5-kDa) has higher affinity to chitin than the 20-kDa protein. In order to
investigate whether the hevein domain can also confer chitin-binding properties
when it is linked at the carboxyl-terminus of an unrelated polypeptide, we analyzed
the chitin-binding activity of the MBP-N domain fusion protein. Figure 6 (lane 2)
shows that the amylose—purified MBP-N domain preparation contains the fusion
protein as well as the MBP protein itself. Upon passage over the chitin column, the
unbound preparation is relatively enriched in MBP and depleted in the MBP—N
domain fusion protein (Fig. 6, lane 3). The MBP-N domain fusion protein could be
desorbed from the column by 6 M guanidine-HCI containing 0.1 M NaOH (Fig. 6,

lane 4).

69

Figure 5. Chitin-binding properties of proteins in the lutoid body-enriched
fraction.

Lutoid body proteins were passed through a chitin column. The flow-through

fraction and fraction eluted with 6M guanidine-HCI+0.1N NaOH were analyzed by

SDS-PAGE. The lutoid body proteins (lane 1) and the flow-through fraction (lane

2) were stained with Coomassie blue. The elution fraction was immunoblotted with

NC domain-specific antibodies (lane 3).

 

 

 

kDa

66—'

45/
31—
21—
14—

70

——--—'~-

.——.’.

‘0. .-

71

Figure 6. Affinity of the MBP-N fusion protein to chitin.

Amylose-purified fusion protein (lane 2) was subjected to chitin affinity
chromatography. Flow-through fraction (lane 3) and elution fraction (lane 4) were
separated on an SDS gel and stained with Coomassie blue. Pure maltose-binding
protein is shown in lane 1. (This experiment was performed by Dr. Willem

Broekaert.)

 

kDa
97.4—

66.0— '

45.0—

29.0-

21 .O-x.
14.0-'

72

Olsw

If.

73
DISCUSSION

In this chapter, we have examined the processing events that are involved in the
formation of mature hevein. In vitro translocation experiments, in the presence of
either canine pancreatic microsomes or maize microsomes, indicate that the
preproprotein form of hevein is cotranslationally processed and translocated into the
RER. This implies that the HEV1-encoded protein is one of the proteins that
traverse the secretory pathway. After cleavage of the signal peptide, this protein
(187 amino acids) undergoes further post-translational processing in vivo.
Immunoblot analysis of proteins from the lutoid body fraction demonstrates that

three distinct bands from this fraction crossreact with the domain-specific antibodies:
a 5-kDa protein is detected by both the N domain and NC domain-specific
antibodies, a 14-kDa protein crossreacts with C domain and NC domain-specific
antibodies, and a 20-kDa protein is immunoreactive with all three types of
antibodies. These results strongly suggest that the 5-, 14- and 20-kDa proteins are
equivalent to the N domain, C domain and NC domain, respectively, of the protein
deduced from HEV1. Also, the apparent molecular mass of each of the three
immunoreactive proteins is in agreement with that predicted from the deduced
amino acid sequence of N, C, or NC domains of HEV1. The identity of all three
proteins was further confirmed by several lines of evidence. The 5-kDa protein
comigrates upon SDS-PAGE with HPLC-purified hevein and has affinity to chitin as
described for mature hevein (Van Parijs et al., 1991). The N-terminal amino acids

of the 14-kDa protein correspond to the HEV1 amino acid sequence at position 50

 

74

to 60, which belongs to the C domain. The 20-kDa protein possesses chitin-binding
ability and its eight N-terminal amino acids are identical to those of the N domain.
Collectively, the data presented here demonstrate the identity of the 5-kDa protein
as the N domain, the 14-kDa protein as the C domain and the 20-kDa protein as the
proprotein (NC domain).

The occurrence of N, C and NC domain proteins in the lutoid body fraction
suggests that the 5- and 14-kDa proteins are proteolytic cleavage products of the
20-kDa protein. This cleavage may be either (incomplete) posttranslational
processing or reflect an artifactual proteolysis during the isolation of the lutoid body
fraction. The latter hypothesis, however, is not favored because preparation of the
lutoid body only involves a single centrifugation step starting from freshly tapped
latex. Moreover, lutoid bodies immediately dissolved and boiled in an SDS
containing buffer produced the same SDS-PAGE pattern as lutoid bodies that had
been dissolved in 1X phosphate buffered saline or 50mM MES buffer and incubated
at 280 for 24 hr (data not shown). Surprisingly, In vivc cleavage occurs between
amino acids at position 43 and 50, but not between amino acids at position 43 and
44 which are border sequences of hevein and the C domain. This result suggests
that six amino acids between 44 to 49 of HEV1 may be cleaved off either at the
same time during formation of hevein and the C domain polypeptide or by
exopeptidases after cleavage either between amino acids 49 and 50 or between
amino acids 43 and 44 of HEV1.

A conserved 43 amino acid domain (chitin-binding domain) has been found

in a variety of chitin-binding proteins including hevein, cereal lectins and several

75

basic chitinases (Chrispeels and Raikhel, 1991). Interestingly, the post-translational
processing which occurs during hevein (chitin-binding domain) formation is unique
in comparison to that of other chitin-binding proteins. The lectins from wheat
(Raikhel and Wilkins, 1987), barley (Lerner and Raikhel, 1989), rice (Wilkins and
Raikhel, 1989), which contain repetitive hevein-like domains, undergo
posttranslational cleavage of the short glycosylated C-terminal portion. The nature
of a short C-terminal portion (< 20 amino acids) seems to be distinguished from
that of the long unglycosylated C domain (144 amino acids) encoded by HEV1.
Basic chitinases (Broglie eta/., 1986; Laflamme and Roxby, 1989; Lucas at al., 1985;
Parsons et al., 1989; Shinshi et al., 1987), another class of chitin-binding proteins,
encode a single hevein-like domain at the N-terminus fused to an unrelated C-
terminal domain. These proteins accumulate in vacuoles, but do not undergo post-
translational processing to N- and C-termlnal polypeptides. Proteins highly
homologous to HEV1 are encoded by the win genes in potato (Stanford et al.,
1989). However, it has not been examined whether posttranslational processing
occurs in the potato win gene-encoded proteins. Interestingly, a processing event
similar but not identical to that found for HEV1 has been described for thionins, a
Class of small 5—kDa cysteine-rich proteins with antifungal properties (Bohlmann et
al., 1988). The thionin genes code for 15-kDa preproproteins that are co- and post-
translationally processed to produce N-terminal portions corresponding to mature
thionins and carboxyl-terminal polypeptides of 62 or 63 amino acids with unknown
function (Bohlmann and Apel, 1987; Gausing, 1987). Similarly, the function and

significance of the C-terminal domain of HEV1 is unknown. The 14—kDa C domain

76

protein does not bind chitin and may fulfill a function different from that of the N
domain protein.

It has been shown that hevein (the N domain protein) has chitin-binding
properties. We have also found that the affinity to chitin is retained in the proprotein
encoded by HEV1 as well as an MBP-fusion protein carrying the hevein domain at
the C-terminus. These observations suggest that the hevein domain can provide
chitin-binding properties when fused to either the N- or C-terminus of an unrelated
polypeptide. Evolutionarily, this supports the idea that chitin-binding proteins, such
as basic chitinases and proteins encoded by the potato win genes and HEV1, have
evolved from fusion of a chitin-binding domain (hevein-like domain) with structurally
and functionally unrelated polypeptides (Chrispeels and Raikhel, 1991). The
resulting fusion proteins may adopt new properties such as the ability to bind chitin

containing structures of fungi, insects or nematodes.

ACKNOWLEDGEMENTS

This research was supported by grants from the United States Department of
Energy (Contract No. DE-ACO2—76ERO-1338) and Research Excellence Fund at
Michigan State University to N.V.R. and by a grant (# 880056) from the North
Atlantic Treaty Organization for collaboration between N.V.R. and W. F.B. W.F.B.

is a senior research assistant of the Belgium National Fund for Scientific Research.

REFERENCES

Anderson, D.J., Blobel, G. (1983). Immunoprecipitation of proteins from cell-free
translations. Methods Enzymol. 96: 111-120

Archer, BL (1960). The proteins of Hevea brasiIiensis latex: Isolation and
characterization of crystalline hevein. Biochem. J. 75: 236-240

d’Auzac, J., Jacob, J.L (1989). The composition of latex from Hevea brasiIiensis as
a laticiferous cytoplasm. In Physiology of Rubber Tree Latex, eds. d’Auzac, J.,
Jacob, J.L. and Chrestin, H.(CRC, Boca Raton, FL), pp. 59-88

Black, M.S., Johnston, K.H., Russell-Jones, G.J., Gotshlich, EC. (1984). A rapid,
sensitive method for detection of alkaline phosphatase-conjugated anti-antibody on
Western blots. Anal. Biochem. 136: 175-179

Bohlmann, H., Apel, K. (1987). Isolation and characterization of cDNAs coding for
leaf-specific thionins closely related to the endosperm-specific hordothionin of barley
(Hordeun rulgare L). Mol. Gen. Genet. 207: 446-454

Bohlmann, H., Clausen, S., Behnke, S.. Glese, H., HIIIer, C., Relmann-Phllipp, U.,
Sohrader,G., Barkholt, V., Apel, K. (1988). Leaf-specific thionins of barley: a novel
class of cell wall proteins toxic to plant-pathogenic fungi and possibly involved in the
defence mechanism of plants. EMBO J. 7: 1559-1565

Broekaert, W., Lee, H.-I., Kush, A., Chua, N.-H.. Raikhel, N. (1990). Wound-induced
accumulation of mRNA containing a hevein sequence in Iaticifers of rubber tree
(Hevea brasiIiensis). Proc. Natl. Acad. Sci. USA 87: 7633-7637

Broglle, K.E., Gaynor, J.J., Broglle, RM. (1986). Ethylene-regulated gene expression:

78

molecular cloning of the genes encoding an endochitinase from Phaseolus vulgaris.
Proc. Natl. Acad. Sci. USA 83: 6820-6824

Chrlspeels, M.J., Raikhel, N.V. (1991). Lectins, lectin genes, and their role in plant
defense. Plant Cell 3: 1-9

Gausing, K. (1987) Thionin genes specifically expressed in barley leaves. Planta
171: 241-246

Guan, 0., Li, R, Riggs, P.D., lnouye, H. (1988). Vectors that facilitate the expression
and purification of foreign peptides in Escherichia coli by fusion to maltose-binding
protein. Gene 67: 21-30

Kunkel, T.A., Roberts, J.D., Zakour, RA (1987). Rapid and efficient site-specific
mutagenesis without phenotypic selection. Methods Enzymcl. 154: 367-382
Laflamme, D., Roxby, R. (1989). Isolation and nucleotide sequence of cDNA clones
encoding potato chitinase genes. Plant Mol. Biol. 13: 249-250

Laemmli, U.K. (1970). Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 277: 680-685

Lerner, D.R., Raikhel, N.V. (1989). Cloning and characterization of root-specific
barley lectin. Plant Physiol. 91: 124-129

Lucas, J., Henschen, A., Lottspeich, F., Vogeli, U., Boiler, T. (1985). Amino-terminal
sequence of ethylene-induced bean leaf chitinase reveals similarities to sugar-
binding domains of wheat germ agglutinin. FEBS Lett. 193: 208-210

Martin, MN. (1991). The latex of Hevea brasiIiensis contains high levels of both
chitinases and chitinases/lysozymes. Plant Physiol. 95: 469-476

Mansfield, MA, Peumans, W.J., Raikhel, N.V. (1988). Wheat-germ agglutinin is

79
synthesized as a glycosylated precursor. Planta 173: 482-489

Moir, G.F.J. (1959). Ultracentrifugation and staining of Hevea latex. Nature 184:
1626-1628

Molano, J., Duran, A., Cablb, E. (1977). A rapid and sensitive assay for chitinase
using tritiated chitin Anal. Biochem. 83: 648-656

O'Farrell, PM. (1975). High resolution two-dimensional electrophoresis of proteins.
J. Biol. Chem. 250: 4007-4021

Parsons, T.J., Bradshaw, H.D., Jr., Gordon, MP. (1989). Systemic accumulation of
specific mRNAs in response to wounding in poplar trees. Proc. Natl. Acad. Sci. USA
86: 7895-7899

Raikhel, N.V., Wilkins, TA. (1987). Isolation and characterization of a cDNA clone
encoding wheat germ agglutinin. Proc. Natl. Acad. Sci. USA 84: 6745-6749
Sanger, F., Nicklen, 8., Coulson, AR. (1977). DNA sequencing with chain-
terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467

Shinshi, H., Mohnen, D., Meins, F. Jr. (1987). Regulation of a plant pathogenesis-
related enzyme: Inhibition of chitinase and chitinase mRNA accumulation in cultured
tobacco tissues by auxin and cytokinin. Proc. Natl. Acad. Sci, USA 84: 89-93
Stanford, A., Bevan, M., Northoote, D. (1989). Differential expression within a family
of novel wound-induced genes in potato. Mol. Gen. Genet. 215: 200—208

Towbin, H., Staehelln, T., Gordon, J. (1979). Electrophoretic transfer of proteins from
polyacrylamide gels to nitrocellulose sheets: Procedure and some applications.
Proc. Natl. Acad. Sci USA 76: 4350-4354

Van Parijs, J., Broekaert, W.F., Goldstein, I.J., Peumans, W.J. (1991). Hevein: an

80

antifungal protein from rubber-tree (Hevea brasiIiensis) latex. Planta, 183: 258-264
Walujuno, K., Scholma, R.A., Beintema, J.J., Marlono A., Hahn, AM. (1975). Amino

acid sequence of hevein. In Proc. Int. Rubber Cont, Vol. 2, pp. 518-531

CHAPTER 4

Posttranslational Processing of Hevein cDNA-Encoded Proteins

In Transgenic Tomato Plants

81

82
ABSTRACT

In latex of rubber tree (Hevea brasiIiensis), prohevein, homologous to potato win
gene-encoded proteins, is incompletely processed to yield mature hevein composed
of one chitin-binding domain and the C-terminal polypeptide homologous to
pathogenesis-related proteins such as tobacco PR-4 and tomato P2 proteins. To
investigate the processing mechanism and the sorting of prohevein, transgenic
tomato plants were used as an experimental system. Immunoblot analysis showed
that prohevein was partially cleaved to form the C-terminal polypeptide in these
plants. However, mature hevein, the N-terminal cleavage form, was not found. Both
prohevein and the C-terminal polypeptide were localized intracellularly in transgenic
tomato plants. Prohevein retained affinity for chitin in these plants. Growth of
Trichoderma hamatum was delayed in transgenic tomatoes constitutively expressing

HEV1-encoded proteins.

83
INTRODUCTION

Plants synthesize proteins de novo in response to wounding or invasion by
pathogens. In particular, a group of these proteins can be classified as chitin-
binding proteins by their affinity for chitin, a polymer of N-acetyl-D-glucosamine that
is present in fungi, insects and nematodes, but is lacking in plants. A family of
chitin-binding proteins has been found in monocot and dicot plants. The chitin-
binding proteins studied possess the chitin-binding domains of 30-43 amino acids
that are enriched in glycines and cysteines at conserved positions. The deduced
amino acid sequences of all isolated cDNA clones contain a putative signal
sequence, and most proteins studied in this family have been shown to be localized
in the vacuole, indicating that chitin-binding proteins are secretory proteins.
Hevein is a major protein in the lutoid body-enriched fraction from rubber tree
latex (Archer et al., 1960). It is a small, monomeric polypeptide of 43 amino acids
(Walujono et al., 1975) that possesses chitin-binding affinity. Thus, a chitin-binding
domain is sometimes referred to as a hevein domain. This protein has been shown
to inhibit the growth of several chitin-containing fungi in in vitro experiments (Van
Parijs et al., 1991), suggesting the involvement of this protein in plant defense. A
cDNA clone encoding hevein (HEV1) was isolated and characterized (Broekaert et
al., 1990). From the deduced amino acid sequence, HEV1 encodes a putative
signal sequence of 17 amino acids followed by a polypeptide of 187 amino acids.
This polypeptide possesses two distinct domains: an amino-terminal domain

corresponding to the 43 amino acids of mature hevein and an extensive carboxyl

 

34

terminal domain of 144 amino acids. The difference in polypeptide length between
hevein and the HEV1-encoded polypeptide suggests that the formation of mature
hevein may result from two proteolytic cleavages of the hevein precursor in vivo.
In vitro translocation experiments showed that the first cleavage involves
cotranslational removal of the signal peptide. Immunoblot analysis of proteins in the
lutoid body-enriched fraction further demonstrated that subsequent posttranslational
processing yields two cleavage products: mature hevein (5-kD) and the C-terminal
polypeptide (14-kD) (Lee et al., 1991).

We are interested in elucidating the mechanism of posttranslational
processing that occurs during hevein maturation, and understanding the targeting
and possible function of the HEV1-encoded proteins. To approach these questions,
a hevein cDNA construct was introduced into tomato plants, a biological system that
is more convenient for experimentation than rubber tree. In this study, three distinct
objectives were pursued: i) the analysis of posttranslational proteolytic processing
of the hevein cDNA-encoded proteins in transgenic tomato plants; ii) their
localization in transgenic tomato plants; iii) their plausible activity in transgenic

tomato plants.

Materials and Methods

Plant Material

Lycopersicon esculentum cv. UC82 (commercial tomato) plants and transgenic

 

85

tomato plants were grown in a growth chamber providing an 18 hour day at 26°C

and an 8 hour night at 22° C.

Site-directed Mutagenesls and Plasmid Construction

For subcloning, a Bglll restriction enzyme site was introduced into the 3’
untranslated region of a hevein cDNA clone (HEV1) by site-directed mutagenesis
as described (Kunkel et al., 1987). The Ecch/Hinolll fragment of the mutagenized
cDNA was subcloned into pBluescript 8K to facilitate the introduction of a Xbal site

from the polylinker region of the plasmid. The Xbal/Bglll fragment was subcloned

into the plant expression vector pGA 643.

Plant Transformation

L ycopersicon esculentum cv. U082 cotyledons were used for transformation. Seeds
of the tomato cultivar UC82 were surface-sterilized for 10 min in a 0.05% Sodium
hypochlorite solution (commercial bleach), washed 3-4 times with sterile dd H20 and
plated on medium containing Murashige and Skoog (MS) salt mix and 0.8%
Bactoagar. Cotyledons grown for 7-10 days were cut and the middle section was
preincubated with feeder plates for 24 hr at 25° C. Cotyledon sections were
immersed for 30 min in 5 ml of a broth of Agrobacterium tumefaciens strain LB4404
containing the HEV1 construct, blotted, and replaced onto the feeder plates. After
a 2 day co-incubation, cotyledon segments were transferred to shoot regeneration
medium (Shahin, 1985). Regenerated shoots were excised and transferred to MS

rooting media (Horsch et al., 1988).

86

RNA Gel Blot Analysis

Total RNA was isolated from leaves of untransformed and transgenic tomato plants
according to Nagy eta/.(1988). Total RNA (40 pg) was separated on a 2% agarose
gel containing 6% formaldehyde, transferred to nitrocellulose, and hybridized to
hevein cDNA (HEV1; Broekaert et al. 1990) labeled with a-aeP-ATP by the random-
primer method (Feinberg and Vogelstein, 1983) as described by Raikhel and Wilkins
(1987). Filters were exposed to Kodak X-OMAT AR film at -70°C with intensifying

screens.

Protein Extraction and Preparation of Apoplastic Fluid
Tomato leaves or fruits were homogenized with 50 mM MES buffer (pH 5.0)
containing 1% polyvinyl pyrrolidone 40 (PVP-40). The extract was centrifuged at
5.0009 for 20 min to remove cellular debris and insoluble material. The supernatant
was precipitated with ammonium sulfate and pelleted at 10,0009 for 10 min. Pellets
were dissolved in 1x phosphate-buffered saline (PBS), dialyzed overnight, dried, and
dissolved in 1x PBS (1/10 of original volume of plant extracts). Total protein in crude
extracts was determined by the Bradford method (1976).

Apoplastic fluid (extracellular fluid; ECF) was prepared by the method of De
Wit and Spikman (1982) with the following modifications. Entire leaves were
infiltrated with 50 mM MES buffer containing 10 mM NaCl solution in vacuo.
Surface-dried leaves were centrifuged for 10 min at 3.0009. Extruded ECF was

collected and the cell extract (intracellular fluid; ICF) from the ECF-depleted leaves

87

was prepared as described above.

Marker Enzyme Assay

Glucose-6—phosphate dehydrogenase was assayed by method described (Simcox
et al., 1977). For the peroxidase assay, samples were incubated with 300 pl of 10%
H202 and 1 ml of 4 mM 2,2-azino bis (3-ethy benzthiazoline sulfonic acid)
diammonium salt (ABST). After 10 min, reactions were stopped with 1 ml of stop
solution (0.04% Na4EDTA/ 0.06 N NaOH/ 1.7% HF). Peroxidase activity was

measured at 410 nm.

Chitin-binding Assay

Chitin was prepared by reacetylation of chitosan (Sigma) as described by Molano
at al. (1977). Protein samples in 1x PBS were applied to a chitin microcolumn. After
an incubation of 15-30 min with gentle shaking, flow-through fractions containing
unbound proteins were collected. The column was washed with 1x PBS and bound
proteins were eluted with 6 M Guanidine-HCl/O.1 N NaOH. The fractions were
dialyzed against double-distilled water and lyophilized. The samples were analyzed

by immunoblotting as described below.

SDS-PAGE, Two-D PAGE and lmmunoblotting

Protein samples were separated on 15% polyacrylamide gels according to Laemmli
(1970) or by two-dimensional PAGE as earlier described (0 ’Farrell, 1975). Proteins

were transferred to lm’mobilon P (Millipore, Bedford, MA), and the blots were

88
blocked for 2 hr with TBS (5 mM Tris-HCl, pH 7.4, 136 mM NaCl and 26 mM KCI)

containing 5% non-fat dry milk. The blots were probed with "domain-specific"
antibodies (Lee et al., 1991) or potato chitinase antisera kindly provided by Dr. Erich
Kombrink (Max-PIanck-lnstitutfijr Ziichtungsforschung, Cologne, Germany). Protein
bands were visualized with alkaline phosphatase-conjugated secondary antibodies

as described elsewhere (Black et al., 1984).

Spore Preparation and Inoculation of Trichoderma hamatum

7'. hamatum was kindly provided by Ing. A. Vanachter (Laboratorium voor
Plantenbescherming, Katholieke Universiteit Leuven, Belgium) and was maintained
on potato dextrose agar (Merck, Darmstadt, F.R.G.). Spores were collected from
8-day old potato dextrose agar culture by washing the agar surface with sterile
dde. The suspension was filtered and filtrates were centrifuged at 10,0009 for
30 min. Pellets were resuspended in sterile ddHZO. For inoculation of fungal
spores, tomato fruits were sliced in a sterile hood and each slice was transferred
onto a separate petri dish (100mmx15mm). Aliquots of the appropriate density of

fungal spores were spread on sliced tomatoes.

89
RESULTS

Construction of pLHEV5 and its Expression in Transgenic Tomato Plants

Tomato plants were used as a heterologous transgenic system to express the
hevein cDNA. The hevein cDNA (HEV1) was inserted into the plant expression
vector pGA643 under the control of the 358 Cauliflower Mosaic Virus promoter, and
the resulting plasmid was designated pLHV5 (Figure 1A). Tomato plants were
transformed by co-cultivating cotyledons of tomato plants with Agrobacterium
strains harboring the pLHV5. Eighteen kanamycin-resistant plants were
regenerated. Transgenic plants expressing hevein mRNA were examined by RNA
gel blot analysis. Examination of nine individual kanamycin-resistant plants (Figure
1B, lanes 1 to 4) revealed similar levels of hevein mRNA accumulation. No
hybridization was observed in mRNA isolated from untransformed control plants

(Figure 1B, lane 5).

Identification of Hevein Proprotein and its Cleavage Product in Transgenic Tomato
Plants

In rubber tree latex, the 20-kD hevein proprotein is posttranslationally processed to
the 5-kD hevein and the 14-kD C-terminal polypeptide (Lee et al., 1991).
Immunoblot analysis using the antibody against prohevein domain (Figure 2)
revealed that leaves (lanes 2, 3, 4 and 5) and fruits (lane 7) from transgenic plants
contain a 20—kD protein that comigrates with the 20-kD hevein proprotein from

rubber tree lutoid bodies (lane 1 ). This protein was not detected in leaves and fruits

90

.02 05 S 09805
0.0 0.00000. 0.00090 0.50 005 d; 0000c 9050 900.9 5090_w0.-0_0>0.000x
000 Am 000; 0030:; 0.0.0 <20 _99 00 01 ow 059000 000. 000m. 8

20500000. .0960
005_ 59005.00 000 0000 5 02,000 0.0 050E00 _05E.9-o 000 5050
93000-2 00.- 060 000050 .5 090505 0_ 00003000 009m .000 <00 .900>
05009000 5050 00 050 £03.00? 05 95 00020030 00>> <200 50>00 05. 2

.0599 $0: .0 0.9.05 85 00 <20 20 02.98 <28 :05: .5 0.300

 

 

m

1.0.. I. I .l IE.

 

 

I03
m 30 0* 0* :0 e.
U
m 300.0
I 2052. 503000; a m
.0380...
:5: 0mm

hww 3‘ F

 

92

Figure 2. Immunoblot analysis of HEV1-encoded proteins.
Proteins were prepared from lutoid body-enriched fractions (lane 1), leaves of wild-
type (lane 6) or transgenic (lanes 2-5) plants, and fruit of wild-type (lane 8) or

transgenic (lane 7) plants. After SDS-PAGE, protein bands were immunoblotted with

antibodies against prohevein domain (Lee et al., 1991).

93

 

 

 

5‘ Leaves Fruits
B _. _
0 transgenic tomato g E
.5 S E
koa§#1#2#3#4o48
46_ . .. . . a
30— j _"- ' _ “‘
fi -' - -

19\-&' Fi'- ‘-
15’-~--» —

12345678

94

from an untransformed plant (lanes 6 and 8). In addition to the 20-kD band,
transgenic plants (lanes 2, 3, 4, 5 and 7) also contain a 14-kD polypeptide that is
identical in size to the 14-kD carboxyl-terminal cleavage product of the hevein
proprotein from lutoid bodies (lane 1). However, the relative abundance of the 14-
kD polypeptide in fruits (lane 7) is much lower than in leaves (lanes 2, 3, 4 and 5).
Again, no corresponding protein was found in leaves and fruits of untransformed
plants (lanes 6 and 8). Mature hevein (the 5-kD polypeptide), however, could not
be detected on the immunoblots. It is possible that this protein is unstable in
tomato plants. Endogenous cross-reactive bands were detected in transformed and
untransformed plants, specifically in the leaves (lanes 2 to 6), but not in the fruits

(lanes 7 and 8).

Two-D Gel Analysis of Hevein-encoded Proteins in Transgenic Tomato Plants

To determine whether HEV1-encoded proteins are modified in transgenic tomato
plants, we investigated the correlation between protein isoelectric point (pl) profiles
of prohevein and the C-terminal polypeptide in rubber tree and transgenic tomato
plants. Lutoid body proteins from rubber tree and leaf extracts from transgenic and
untransformed tomato plants were separated by two-dimensional gel electrophoresis
and were subsequently immunoblotted using carboxyl domain-specific antibody
(Figure 3). The 20-kD hevein proprotein in transgenic tomato plants (Figure 38,
large arrow) is apparently identical in size and pi to that found in lutoid bodies
(Figure 3C, large arrow). Based upon pi and molecular mass, the 14-kD C-terminal

cleavage product detected in transgenic tomato plants (Figure SB, small arrow)

 

95

Figure 3. Two-D gel analysis of HEV1-encoded proteins.

Protein extracts from lutoid body (C) and leaves of wild-type (A) and transgenic
plants (B) were separated by two-D gel electrophoresis. After transfer, blots were
probed with a domain-specific antibody against the C-terminus of prohevein (Lee

et al., 1991). Large arrows indicate the 20-kD prohevein polypeptides. The 14-kD

C-terminal polypeptides are indicated by small arrows.

 

 

96

0 0 4 3 0 0. 4 3 O O 4 3
w m m M m m m M m m m M
5 - _ .
7 I
. . x‘ \
.
m.
‘0 ‘O
0
4.- A B c
0028; 000 0900; 000 2.8 was;

20Eo._. .9080 9005... 5009000... E05 000... 000030

97

corresponds to one of multiple 14-kD immunoreactive spots in rubber tree (Figure
30, small arrow). These results indicate that both prohevein and the C-terminal
cleavage polypeptides in transgenic tomato plants and in rubber trees are likely to

be structurally similar.

Localization of Prohevein and the C-terminal Polypeptide in Transgenic Tomato
Plants

Hevein was isolated from the lutoid body-enriched fraction of rubber tree latex.
Since the lutoid bodies are believed to be derived from vacuoles, hevein gene
products might be localized in vacuoles of transgenic tomato plants. To identify
their location, proteins were prepared from apoplastic fluid (extracellular fluid; ECF)
and ECF-depleted leaf extracts (intracellular fluid; ICF) from transgenic tomato
plants. Purity of the ECF and ICF was monitored by measurement of glucose-6-
phosphate dehydrogenase activity and peroxidase activity, and by immunoblot
analysis using potato chitinase antiserum (Figure 4, lanes 1 to 4). Thus, glucose-6-
phosphate dehydrogenase was used as a cytoplasmic marker, basic chitinase as
a vacuolar marker, and peroxidase served as an extracellular marker. Less than 5%
of glucose-6-phosphate dehydrogenase activity (nmol/min/mg protein) was detected
in the ECF. In addition, the potato chitinase antisera reacted with protein bands cf
the same molecular weight isolated from the ICF (lane 3) and total leaf extracts (lane
2) of transgenic tomato plants. Similar results were obtained from untransformed
control plants (lane 1). Furthermore, greater than 95% of peroxidase activity (units

/ug protein) was detected in the ECF. These data indicated that the ECF was

98

06:08 00 000: 000; 6 000 N 0000; 9003 5020000: Lo Am 000 F 0000: 09$
0:; So: EH ”60008 06: 0800.5 0020 000_ 0_oz>> 3-0 0000: 050050.00
050000005000 50>009a Lo al. 0000; 05000000 0005500 9060 0 53>
0002000385 000 mo<m-wow >0 000000000 0002, 00>00_ 90009 2000000:
E0: E 000 m 0000_ £0; 080008 :00 0o 8 000 v 0000. ”mom: 0:00.003.

05205 8085.30... 0 8005.83 .0 2:00

 

99

A»...
“. AON

 

 

first
. «0..
mom ".0. .m.._. 0
m
30Eo.r ......
2000000.... W

0.08% oz. 0< £25:

‘-'Aom

 

,, «0..
wow ".0. .m.._. 3
m
oaanh 0..
2000000.... w.

m< 00003.00 203.“.

100

essentially uncontaminated with the ICF. Immunoblot analysis revealed that the
hevein proprotein was detected in the ICF (lane 7) and total leaf extracts (lane 6),
but not in the ECF (lane 8) and total untransformed leaf extracts (lane 5). These
data demonstrated that the 20-kD and 14-kD hevein-derived proteins were localized
intracellularly in tomato plants, presumably in vacuoles. These results are in
agreement with localization of the 20-kD proprotein, 14—kD C-terminal polypeptide

and 5—kD mature hevein in lutoid bodies of rubber trees.

Chitin-binding Affinity of HEV1-encoded Proteins in Transgenic Tomato Plants

It has been shown that mature hevein (5-kD) and prohevein (20-kD) of rubber tree
have the ability to bind chitin (Lee et al., 1991). To determine whether or not HEV1-
encoded proteins in transgenic tomato plants were also capable of binding

to chitin. The C-terminal cleavage product (14-kD) was detected in the flow-through
fraction containing unbound proteins from a chitin affinity column (Figure 5, lane 2).
The prohevein (20-kD) was found in the fraction containing bound proteins after
elution with 6 M guanidine-HCI/ 0.1 N NaOH (lane 4). This result was consistent
with the chitin—binding ability of prohevein in rubber tree. Again, neither prohevein
nor the C-terminal polypeptide was detected in flow-through (lane 1) and eluted
(lane 3) fractions of untransformed plants. In addition, one of the endogenous
immuno-reactive proteins (28-kD) was found only in the flow-through fractions (lanes
1 and 2). The other one (40-kD) was detected exclusively in the elution fractions

(lanes 3 and 4).

101

Figure 5. Chitin-binding property of HEV1-encoded proteins.

Proteins from untransformed (lanes 1 and 3) and transgenic (lanes 2 and 4) tomato
plants were subjected to chitin column chromatography. Flow-through (lanes 1 and
2) and elution (lanes 3 and 4) fractions were separated by SDS-PAGE and

immunoblotted with NC domain-specific antibody.

 

102

00250.".
.8020
00250.".

00:25-25."—

kDa

 

43.0 \

29.5 — '

H

19.5 ’

/

14.5

103
Activity of HEV1-encoded Polypeptides in Transgenic Tomato

It has been reported that hevein (5-kD) and barley proteins homologous to the C-
terminal polypeptide (14-kD) have an inhibitory effect on growth of several chitin-
containing fungi in vitro Olan Parijs et al., 1991; Hejgaard et al., 1992). We also
found that 5-kD (hevein) and 20-kD (proprotein) polypeptides have an ability to bind
chitin (Lee et al., 1991). These data suggest that the HEV1-encoded polypeptides
are possibly involved in the plant defense response. This possibility was examined
by monitoring whether transgenic tomatoes expressing the HEV1-encoded
polypeptides enhanced resistance to certain type(s) of chitin-containing fungi. Since
our transgenic tomato plants express the HEV1-encoded polypeptides constitutively
under the control of 358 promoter, it is possible to inoculate fungi on different types
of tissues (Figure 6) at any stages. We chose Trichoderma hamatum, a saprophytic
fungus. We tested tomato fruits rather than leaves, because tomato fruit (Figure 3,
lanes 7 and 8) has no immuno-reactive bands (HEV1-related proteins) that were
found in leaves (Figure 3, lanes 2 to 6). Approximately 105 spores of T. hamatum
were inoculated on slices of transgenic and untransformed control tomatoes. After
3-4 days, fungal growth on transgenic tomatoes was reduced (Figure 6, D and F),
compared to that on control tomato (Figure 6E). Wild-type and transgenic tomatoes
treated with ddHZO (A, B and C) were not contaminated by other microorganisms.
This result suggests that function of the HEV1-encoded polypeptides may relate to

plant defense.

 

104

0030000009 Eco. 00 0.000 0.0 02 00000305 0002, 005.0 9089 00.? .m. 000 m.
d. E20080: H 5.; 090.3005 0.0; 00 6 000 m .3 00:00 5.2, 000000 0003
0530 90009 A”. 000 o .0 .<. 50000000 000 m. 000 m. 0000900000: .o 005%

.0530 90.02 50000000 5 5390 .0002 00 8000 09.0.00. .0 0.59".

 

.-

Control

Transgenic

Transgenic
Tomato #1

Tomato (#2

Tomato

105

03H pp
uuM tuetuteell

 

#002021. '1
mm uonoeiUI

106

Discussion

In this chapter, transgenic tomato plants have been used to develop an
experimental system to study posttranslational processing, targeting and possible
function of the HEV1-encoded proteins. Immunoblot analysis showed that all of the
kanamycin—resistant plants expressed HEV1-encoded proteins at a comparable
level. These results are consistent with RNA blot data showing that similar levels of
hevein mRNA are detected in all transgenic plants. Together, these data suggested
that the low level of protein expression observed is due to a positional effect of the
hevein construct rather than to other control mechanisms such as
posttranscriptional control. In transgenic tomato plants, prohevein is
posttranslationally cleaved by processing mechanisms similar to those found in
rubber tree, suggesting that the processing machinery is conserved among different
plant species. The major difference between the two systems, however, is the
absence of mature hevein in tomato which implies that a chitin-binding domain
(mature hevein) alone is unstable after cleavage of prohevein. instability of one or
more chitin—binding domains was also observed in a tobacco system expressing
stinging nettle lectin (B. lseli and N. Raikhel, unpublished results).

The chitin-binding proteins studied have been shown to be secretory proteins
(Raikhel et al., 1993); most of them are vacuolar. ln rubber tree, hevein was also
found in the lutoid body (of vacuolar origin). Moreover, localization of prohevein
and the C-terminal polypeptide in the lutoid body was determined immunologically

(Lee at al., 1991). To investigate the subcellular location of these proteins in

107

transgenic plants, immunohistochemistry and organellar fractionation studies were
attempted but failed, presumably because of low abundance of these proteins in
transgenic plants. However, immunoblot analysis of ICF and ECF proteins showed
that the location of prohevein and the C-terminal polypeptide in transgenic tomato
plants were intracellular (Figure 4). These results and localization of hevein-derived
proteins in lutoid bodies of rubber tree suggest that prohevein and the C-terminal
cleavage product are probably in the vacuoles of transgenic tomato plants.
Vacuolar proteins possess special amino acid sequences for vacuolar
localization. These amino acid sequences are not conserved and are located at
different positions within the vacuolar proteins studied. The C-terminal propeptide
(CTPP) of barley lectin has been shown to be necessary and sufficient for vacuolar
targeting (Bednarek et al., 1990). The C-terminal extension of tobacco vacuolar
chitinase is also required for localization to the vacuole, while an extracellular
chitinase lacks a C-terminal extension. In the case of hevein and its related proteins,
a sequence comparison (Figure 7) shows that the hevein proprotein and win2-
encoded protein contain a C-terminal extension of >10 amino acids. The same
sequence is not found in the C-terminal homologous proteins such as tobacco PR-4
and tomato P2, which are extracellular (Friedrich et al., 1991; Linthorst et al., 1991).
As described above, a similar relationship was also found in vacuolar chitinase and
its extracellular counterpart. It is interesting to note that two chitin-binding proteins,
barley lectin and tobacco basic chitinase, possess vacuolar targeting signals at the
C-terminal ends (Bednarek and Raikhel, 1991; Neuhaus et al., 1991). Based upon

these data, we propose that the C—terminal extension sequence of prohevein is

108

location
PROHEVEIN VNYQFVDCGDSFN-PLFSVM-KSSVIN (lutoid body)
WIN2 llllllNlllNVlVIILllVDlE (unknown)
w1N1 |ll||l||||N (unknown)
PR-4a/b |||E||N|N| (extracellular)
PR-PZ |||E||N| (extracellular)

Figure 7. Comparison of the C-terminal amino acid sequences of prohevein. win
gene-encoded proteins, PFl—4a/b and PR-P2 proteins.

Amino acids identical to prohevein are denoted with a vertical line. Gaps in the
aligned sequences are indicated by a dash. Partial amino acid sequences were
derived from prohevein, residues 180-204 (Broekaert et al., 1990); winQ, residues
189-211, mm 190-200 (Stanford et al.,1989); PR-4a/b, residues 113—122, PR-P2,

residues 113-120 (Friedrich et al., 1991; Linthorst et al.,1991).

109

involved in sorting to the vacuole.

Our growth inhibition studies showed that transgenic plants expressing
HEV1-encoded proteins exhibit enhanced resistance to 7'. hamatum, a chitin-
containing fungus. It is unknown whether growth of T. hamatum was inhibited by
HEV1-encoded proteins alone. We also tested other chitin-containing fungi, Botrytis
cinerea and Rhizoctonia so/ani. However, no inhibitory effect on growth of these
fungi was observed in transgenic tomato fruits. It is possible that the amount of
HEV1-encoded proteins expressed in transgenic tomato plants is not sufficient to
inhibit growth of these fungi. In a broad sense, these results reflect the idea that
individual pathogenesis-related proteins may possess differential inhibitory effects
on growth of different fungi. Together, our studies have raised the possibility that
the overexpression of HEV1-encoded proteins in transgenic plants may contribute

to enhancing resistance to particular fungal pathogens.

1 10
REFERENCES

Archer, B.L (1960). The proteins of Hevea brasiIiensis latex: Isolation and
characterization of crystalline hevein. Biochem. J. 75: 236-240

Bednarek, S.Y., Raikhel. N.V. (1991). The barley lectin carboxyl-terminal propeptide
is a vacuolar protein sorting determinant in plants. Plant Cell 3: 1195-1206
Bednarek. S.Y., Wilkins, T.W.. Dombrowskl, J.E., Raikhel. N.V. (1990). A carboxyl-
terminal propeptide is necessary for proper sorting of barley lectin to vacuoles of
tobacco. Plant Cell 2: 1 145-1 155

Black, M.S., Johnston, K.H., Russell-Jones. G.J., Gotshllch, EC. (1984). A rapid,
sensitive method for detection of alkaline phosphatase-conjugated anti-antibody on
Western blots. Anal. Biochem. 136: 175-179

Bradford, M. (1976). A rapid and sensitive method for the quantitation of microgram
quantities of proteins utilizing the principle of protein dye binding. Anal. Biochem.
72: 248-250

Broekaert, W., Lee, H.-l., Kush, A., Chua, N.-H., Raikhel. N. (1990). Wound-induced
accumulation of mRNA containing a hevein sequence in Iaticifers of rubber tree
(Hevea brasiIiensis). Proc. Natl. Acad. Sci. USA 87: 7633-7637

De Wit, P.J.G.M., Spikman, G. (1982). Evidence for the occurrence of race and
cultivar-specific elicitors of necrosis in intercellular fluids of compatible interactions
of Cladosporium fulvum and tomato. Physiol. Plant Pathol. 21: 1-11

Feinberg, A.P., Vogelstein, B. (1983). A technique for radiolabeling DNA restriction

endonuclease fragments to high specific activity. Anal. Biochem. 132: 6-13

111
Friedrich, L, Moyer, M., Ward, E., Ryals, J. (1991). Pathogenesis-related protein 4

is structurally homologous to the carboxy-terminal domains of hevein, Win-1 and
Win-2. Mol. Gen. Genet. 2302 113-119

Hejgaard. J., Jacobsen, S., Bjorn, S.E., Kragh. KM. (1992). Antifungal activity of
Chitin-binding PR-4 type proteins grain barley grain and stressed leaf. FEBS Lett.
307: 389-392

Horsch, R.B., Fry, J., Hoffman, N., Neidermeyer, J., Rogers, S.G., Fraley, RT. (1988).
Leaf disc transformation. Plant Molec. Biol. Manual A5: 1-9

Kunkel, T.A., Roberts, J.D., Zakour, RA. (1987). Rapid and efficient site-specific
mutagenesis without phenotypic selection. Methods Enzymol. 154: 367-382
Laflamme, D., Roxby, R. (1989). isolation and nucleotide sequence of cDNA clones
encoding potato chitinase genes. Plant Mol. Biol. 13: 249-250

Lee, H.-l., Broekaert, W.F., Raikhel. N.V. (1991). 00- and post-translational
processing of the hevein preproprotein of latex of rubber tree (Hevea brasiIiensis).
J. Biol. Chem. 266: 15944-15948

Unthorst, H.J.M., Danhash, N., Brederode, F.T., Van Kan, J.A.L, De Wit, P.J.G.M.,
Bol, J.F. (1991). Tobacco and tomato PR proteins homologous to win and pro-
hevein lack the "hevein" domain. Mol. P/ant-Micr. Interact. 4: 586-592

Molano, J., Duran, A., Cabib, E. (1977). A rapid and sensitive assay for chitinase
using tritiated chitin. Anal. Biochem. 83: 648-656

Nagy, F., Kay. SA, Chua, N.-H. (1988). Analysis of gene expression on transgenic
plants. Plant Mol. Biol. Manual B4: 129

Neuhaus, J.M., Sticher, L, Meins, F. Jr., Boiler, T. (1991). A short C-terminal

112

sequence is necessary and sufficient for the targeting of chitinases to the plant
vacuole. Proc. Natl. Acad. Sci. USA 88: 10362-10366

O'Farrell, PM. (1975). High resolution two-dimensional electrophoresis of proteins.
J. Biol. Chem. 250: 4007-4021

Raikhel, N.V., Broekaert, W.F., Lee, H.-l. (1993). Structure and function of chitin-
binding proteins. Annu. Rev. Plant Physiol. Plant Mol. Biol. 44: In Press

Raikhel, N.V., Wilkins, TA (1987). Isolation and characterization of a cDNA clone
encoding wheat germ agglutinin. Proc. Natl. Acad. Sci. USA 84: 6745-6749
Saalbach, G., Jung, R., Kunze, G.. Saalbach, l.. Adler, K., Mflntz, K (1991). Different
legumin protein domains act as vacuolar targeting signals. Plant cell 3: 695-708
Shahin, EA (1985). Totipotency of tomato protoplasts. 777eor. Appl. Gen. 69: 235-
240

Simcox, P.D., Reud, E.E., Canvln, D.T., Dennis, D.T. (1977). Enzymes of the
glycolytic and pentose phosphate pathways in proplastids from the developing
endosperm of Fticinus communis L. Plant Physiol. 59: 1128-1132

Tague, B.W., Chrlspeels, M.J. (1987). The plant vacuolar protein,
phytohemagglutinin, is transported to the vacuole of transgenic yeast. J. Cell Biol.
105: 1971-1979

Van Parijs, J., Broekaert, W.F., Goldstein, I.J., Peumans, W.J. (1991). Hevein: an
antifungal protein from rubber-tree (Hevea brasiIiensis) latex. Planta 183: 258-264
Walujuno, K., Scholma, RA, Beintema, J.J., Marlono A., Hahn, AM. (1975). Amino

acid sequence of hevein. In Proc. Int. Rubber Conf. Vol. 2, pp. 518-531

 

CHAPTER 5

SUMMARY AND PROSPECTS FOR FUTURE RESEARCH

113

 

114

The data presented in this dissertation have demonstrated how mature hevein is
formed through the secretory pathway. In vitro translocation experiments showed
that the hevein signal peptide is cotranslationally removed. Immunoblot analysis
indicated that prohevein and cleavage products (hevein and the C-terminal
polypeptide) are present in the lutoid body; and in transgenic tomato plants,
prohevein and the C-terminal polypeptide are localized intracellularly. Based upon
these data, we can predict the fate of these proteins in Iaticifer cells of rubber tree
and in transgenic tomato plants at the cellular level. Preprohevein (22-kD) is
synthesized on rough endoplasmic reticulum (RER). cotranslationally processed,
and translocated into the lumen of ER. Then, prohevein (20-kD) is passed through
the Golgi apparatus. After or during translocation of prohevein to the lutoid bodies,
this protein is partially processed to form mature hevein and a C-terminal
polypeptide lacking a hinge region of 6 amino acids in the lutoid bodies.
Alternatively, when targeted to the vacuole, prohevein is partially processed to yield
only the C-terminal polypeptide. The incomplete processing involved in hevein
formation is unique among the known posttranslational modifications occurring in
other chitin-binding proteins (Raikhel eta/., 1993). First, this ’partial’ processing has
not been identified in other chitin-binding proteins. Second, the precursor form
(prohevein) as well as the cleavage products may have their own biological
activities, as discussed below. This raises the question as to what mechanism
regulates this posttranslational processing. One approach will be to isolate and
characterize the respective protease genes involved in hevein biosynthesis. Initially,

proteases can be purified from the fraction containing protease activity by

 

115

conventional chromatography. Oligonucleotide probes or PCR primers designed
from partial peptide sequence of purified protease then can be used to screen a
cDNA or genomic library derived from rubber tree latex.

Most chitin-binding proteins are localized in the vacuole or a vacuole-like
organelle such as the lutoid body. Studies of sorting signals in barley lectin and
tobacco class I chitinase indicate that a C-terminal extension sequence (15 or 7
amino acids, respectively) is necessary and sufficient for vacuolar targeting
(Bednarek et al., 1990; Neuhaus et al., 1991). These studies demonstrated that the
vacuolar sorting signals in chitin-binding proteins are located at the end of their C-
termini. Amino acid comparisons between prohevein and PR-4/P2 (Friedrich at al.,
1991; Linthorst et al., 1991) revealed a 17 amino acid extension at the C-terminus
of prohevein, suggesting that these sequences are required for vacuolar targeting.
Analysis of transgenic plants expressing a hevein construct in the presence or
absence of this sequence will answer this question.

It has been proposed that hevein is involved in plant defense, since hevein
displays the property of chitin-binding and exhibits in vitro antifungal activity (Van
Parijs et al., 1991). The data presented here and others’ studies (Friedrich et al.,
1991; Linthorst et al., 1991; Hejgaard et al., 1992) not only support this hypothesis,
but also suggest that prohevein and two cleavage products, mature hevein and the
C-terminal polypeptide, are biologically active in vivo. First, hevein mRNA was
induced by wounding and plant stress hormones such as ABA and ethylene.
Second, homology between the C-terminus of prohevein and the pathogenesis-

related proteins (PR) such as PR-4 and PFl-P2 (Friedrich eta/., 1991; Linthorst et al.,

 

116
1991) suggests that the C-terminal polypeptide has its own biological activity.

Microsequencing showed that the ’mature form’ of the C-terminal polypeptide lacks
a 6 amino acid hinge region as well as a chitin-binding domain (hevein), indicating
that the structure of the C-terminal polypeptide is similar to those of PR-4 and P2
proteins. Most importantly, in vitro antifungal activity was demonstrated for the PR
proteins from barley whose partial peptide sequences shared the homology with the
proteins homologous to the C-terminal domain of prohevein (Hejgaard et al., 1992).
Third, not only hevein but also prohevein retained chitin-binding affinity.
Furthermore, in a family of chitin-binding proteins, the presence of proteins
containing the chitin-binding domain and a number of structurally unrelated domains
shows that these fusion proteins acquire novel properties. In this respect, it is
interesting to note that class I chitinases from tobacco have higher specific
chitinolytic activities than their class II counterparts (Legrand et al., 1987). The
presence of the combination of prohevein, hevein and the C-terminal polypeptide
may provide stronger protection of plants against pathogens, assuming that all
forms are active.

As discussed above, class I chitinase, a natural fusion protein, has been
proven to have higher chitolytic activity than class ll chitinase that contains only a
chitolytic domain. I have also shown that an artificial fusion protein consisting of the
43-residue hevein domain and a bacterial maltose-binding protein exhibits affinity
toward chitin, but not toward the maltose-binding protein itself. In addition, both
fusion proteins and the maltose-binding protein alone retained the ability to bind

maltose. These observations raise the possibility that crop protection against

117

specific pathogens can be achieved by the design and manipulation of artificial
proteins that combine one or more chitin-binding domains with a protein of novel

activity.

1 18
REFERENCES

Bednarek, S.Y., Wilkins, T.A., Dombrowskl, J.E., Raikhel, N.V. (1990). A carboxyl-
terminal propeptide is necessary for proper sorting of barley lectin to vacuoles of
tobacco. Plant Cell 2: 1145-1155

Friedrich. L, Moyer, M., Ward, E., Ryals, J. (1991). Pathogenesis-related protein 4
is structurally homologous to the carboxy-terminal domains of hevein, Win-1 and
Win-2. Mol. Gen. Genet. 230: 113-119

Hejgaard, J., Jacobsen, S., Bjorn, S.E., Kragh. KM. (1992). Antifungal activity of
Chitin-binding PFi-4 type proteins grain barley grain and stressed leaf. FEBS Lett.
307: 389-392

Legrand, M., Kauffman, S., Geoffroy, F., Fritlg, B. (1987). Biological function of
pathogenesis-related proteins: four tobacco pathogenesis-related proteins are
chitinases. Proc. Natl. Acad. Sci. USA 84: 6750-6754

Unthorst, H.J.M., Danhash, N.. Brederode, F.T., Van Kan, J.A.L, De Wit, P.J. G.M..
Bol, J.F. (1991). Tobacco and tomato PR proteins homologous to win and pro-
hevein lack the "hevein" domain. Mol. PIant-Micr. Interact. 4: 586-592

Neuhaus. J.M., Sticher, L, Meins. F. Jr., Boller. T. (1991). A short C-terminal
sequence is necessary and sufficient for the targeting of chitinases to the plant
vacuole. Proc. Natl. Acad. Sci. USA 88: 10362-10366

Raikhel, N.V., Broekaert, W.F., Lee, H.-l. (1993). Structure and function of chitin-
binding proteins. Annu. Rev. Plant Physiol. Plant Mol. Biol. 44: In Press

Van Parijs, J., Broekaert, W.F. Goldstein, I.J., Peumans, W.J. (1991). Hevein: an

119

antifungal protein from rubber-tree (Hevea brasiIiensis) latex. Planta183: 258-264

 

- . , / lllllllllllllJill/lllllllilllllllllllllllll