4.. WWW-"'3

H vi‘W‘kiql‘f

 

 

r
...,,:...‘.

.,..,...

 

n
7'..\ 1.17..“ “-.

 

 

. 1..
“3:1: gum Lu“;
,- 1.‘ W1ri“; -:

4‘»

A1:-
ibfi vii-é I$1E$fitga- ‘fzfifi b
~ 4g». refiifigfi “‘E‘nfig“
”11:9 ' 33% “LL «.5.-

-',.:_?Z

 

, ‘1
1E mgr;
_ l- '55." l . 1... 1:." "‘ 5!..1.
1.41.?) A..n...:.v.~x7:{ut.. u *5.” ' “if;
.Amr vw 15%: a xerxgwhi‘ 3:5. .._-
A ~ ....JL-*....$‘ ' Rsnxq'irt? £332"
ctr-ax ~ 2“},‘13... A q. - w
"x a fixiflnh-a-Mm
L’fliyfiu'
k

   

_ 3331" L 3,

1 ...~
knacacrf‘i‘w
1‘“ $1234

4‘1

 

 

T“;

11...! l

 

« :0 U
.EC-:f‘giei:€1‘;

t

05...}; >-
"c J' n J. Y” r. 1
an»? “at - _‘-—‘
]a

M:
..

 

,.,1 '5‘"
m- . an :r< J. “on

‘;-‘-‘:r'fn'-

W @333

IVERSITY LIBRARIES

llllllllllllllll|lll||l|llllllll I ll

3 1293 009085

lll

 

 

 

 

 

 

 

 

 

 

 

This is to certify that the

dissertation entitled

Molecular Study of Cold Acclimation in Wheat

presented by

Wei Wen Guo

has been accepted towards fulfillment
of the requirements for

Ph.D. degree in CSS/
Plant Breeding and Genetics Program

    

[Mafor professor

/ a
Date 39, //

MS U is an Affirmative Action/Equal Opportunity Institution

0-12771

I
l

LIBRARY Tl
Mtehigan State
L University

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINES return on or before date due.

II DATE DUE DATE DUE DATE DUE

L.__

EEi
. —l:

IT—
_—1

MSU Is An AIfirmative Action/Equal Opportunity Institution
ammo-9.!

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

MOLECULAR STUDY OF COLD ACCLIMATION IN WHEAT

By

Wei Wen Guo

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements

DOCTOR or PHILOSOPHY

Department of Crop and Soil Science/
Plant Breeding and Genetics Program

1991

“1

VVJL."

ABSTRACT
MOLECULAR STUDY OF COLD ACCLIMATION IN WHEAT
By

Wei Wen Guo

Previous studies have shown that changes in gene expression occur in wheat during cold
acclimation. Here, I show that at least some of these changes are at the RNA level. Further,
some of the cold-induced mRN As encode polypeptides which have the unusual property of
remaining soluble upon boiling, a property found in certain cold-induced polypeptides of
Arabidopsis. By cDNA cloning, and Southern and Northern analysis, I show that wheat has
a car (cold-regulated) gene, represented by cDNA clone pWGl, that is related to
Arabidopsis cor47, a cold-regulated gene that encodes COR47, a “boiling-stable”
polypeptide. Ialso present the DNA sequence of pWGl. The data indicate that the cor
gene represented by pWGl encodes a 39 kD hydrophilic polypeptide. The gene was
designated cor39 and the polypeptide COR39. The deduced amino acid sequence of
COR39 indicates that it contains a lysine-rich sequence that is repeated six times. This same
sequence is present in COR47 and Group II LEA proteins. In addition, COR39 has six
glycine-rich repeats which are related to the repeats found in the barely and maize
“dehydrins.” Like lea transcripts, cor39 transcripts accumulate in response to exogenous
application of ABA and drought stress. The similarities and differences between cor39,
Arabidopsis cor genes, and lea genes are discussed in terms of regulation of expression and

possible roles in freezing and drought tolerance.

This dissertation is dedicated
to my husband,
Jiasheng Zhou

with love

iii

ACKNOWLEDGEMENTS

I express my gratitude to my major professor, Dr. Mike Thomashow, for his guidance
and support throughout this program. I extend my personal thanks to Dr. Evert Everson
for providing me this opportunity to study this program. I greatly appreciate the help and
advice provided by the members of my committee, Dr. Rick Ward, Dr. Rebecca Grumet,
and Dr. Robert Olien. I also thank Chentao Lin, Dr. Sarah Gilmour, Dave Horvath, Todd
Carter, Dr. Ravindar Hajela for sharing advice and experience. Finally, special thanks go
to my husband J iasheng Zhou for providing me support and courage to finish this program.

iv

TABLE OF CONTENTS

LIST OF FIGURES

LIST OF TABLES

CHAPTER 1 Introduction
Introduction
List of References

CHAPTER 2 Comparison of Wheat and Arabidopsis cor Genes
and Polypeptides

Summary
Introduction
Materials and Methods

Results

Discussion

List of References

CHAPTER 3 Molecular Characterization of pWGl, a cDNA
Representing a Cold-Regulated Gene

Summary
Introduction

Materials and Methods

Results

Page

11

16
l6
17
21
33

36

38
38
39

41

Discussion

List of References

APPENDIX

vi

71

74

76

LIST OF TABLES

CHAPTER 3

Table l. Mole percent amino acid composition of COR39 polypeptide
sequence.

Table 2. Comparison of lysine-rich repeat of COR39, COR47 and LEA
proteins.

Table 3. Comparison of the glycine-rich repeat of Cor39, RAB21,
and barley dehydrin B17 and B18.

vii

Page

46

51

52

LIST OF FIGURES

CHAPTERZ

Figure 1. Effect of low temperature and period of cold acclimation on
freezing tolerance of winter wheat T. aestivum cv Winoka.

Figure 2. Two-dimensional electrophoretic analysis of in vitro
translation products of poly (A+) RNA isolated form
nonacclimated (A) or acclimated (B) (2' C three weeks)
T. acestivum cv Winoka.

Figure 3. SDS-PAGE analysis of in vitro translation products of poly (A+)
RNA isolated from cold acclimated and nonacclimated plants.

Figure 4. Northern analysis indicating the accumulation transcripts
hybridizing with pWGl in cold acclimated wheat.

Figure 5. Southern analysis indicating the homology between Arabidopsis
cor47 and the wheat gene represented by pWG 1.

CHAPTER 3
Figure 6. Nucleotide and deduced amino acid sequences of pWG 1.

Figure 7a.Two-dimensional electr0phoretic analysis of boiled in vitro
transcription/ translation products of pWGl cDNA insert.

Figure 7b.Two—dimensional electrophoretic analysis of boiled in vitro
translation products of poly (A+) RNA isolated from cold
acclimated plants.

Figure 8. Hydrophy profile of the deduced amino acid sequence for COR39.

Figure 9. The repeating units of cor39.

Figure 10. Time course of accumulation of cor39 transcripts in plants

treated with low temperature (2' C)

Figure 11.Time course of deaccumulation of cor39 mRNAs in plants
transferred back to normal growth temperature (deacclimated)

viii

Page

22

24

27

29

31

42

47
49

53

56

after treatment at 2" C for 3 days.

Figure 12. The effect of temperature treatment on accumulation of cor39
transcripts in plants.

Figure 13. Tissue specificity of cor39 transcripts accumulation in plants
cold acclimated at 2 ' C for 1 week.

Figure 14. Genomic Southern analysis of cor39.

Figure 15. Accumulation of cor39 transcripts by ABA treatment.

Figure 16. Accumulation of cor39 transcripts by drought stress treatment.

Figurel7. Northern analysis of cor39 transcripts in fresh dry seed and
seedlings of T. aestivum cv Augusta.

APPENDIX
Figure 18. SDS-PAGE analysis of boiled products of in vitro translation

of Poly (A+) RNA isolated from different varieties
acclimated at different temperature.

Figurel9. The effect of temperature treatment on accumulation of cor39
transcripts in different varieties.

58

6O

62

66

68

79

81

Chapter 1

Introduction

Plants are commonly subjected to a large number of environmental and biological
stresses. These adverse conditions may interfere with normal growth and development of
plants and can result in low quality and yield of crop plants. Low temperature is the single
most limiting factor to natural plant distribution, and freezing stress is a major cause of crop
loss (Burke et al., 1976). Improving freezing tolerance of crops such as wheat is an
important aspect of crop improvement. Understanding the principles of freezing injury and
the mechanisms of freezing tolerance are important steps towards improving freezing

tolerance of crops.
Plant Cold Acclimation

Some plant species increase in freezing tolerance during exposure to a period of low,
nonfreezing temperature (Mazur, 1969; Burke et al., 1976; Levitt, 1980 a). This process is
termed cold acclimation. Some nonacclimated woody species are injured by temperature of
about - 10' C, but after cold acclimation, they can survive at -l96' C (W eiser, 1970). Wheat
and other winter cereals can also cold acclimate; nonacclimated plants are killed at about
-5' C, while cold acclimated plants can survive to below -15 'C (Burke er al., 1976). The
freezing tolerance gained by plants during cold acclimation depends on the acclimation

conditions, species and varieties of crops.

Freezing Process and Injury

The nature of the freezing process and the injury that it causes has been the subject of
study for more than 100 years. There are many different reports and hypotheses
(Steponkus, 1984). Briefly, the freezing process involves redistribution of water. When
plant cells freeze, ice forms either intracellular or extracellular depending on the type of

tissue or the cooling rate. In nature, extracellular ice formation occurs more often than

2
1976; Levitt, 1980 a; Steponkus, 1984). Extracellular ice formation occurs in the vicinity

of the cell wall. The ice crystals in the extracellular free space are a water reservoir due to
their low vapor pressure. As the temperature drops, the vapor pressure of the extracellular
space is lower than that of the intracellular space. When the temperature drops slowly, plant
cells achieve equilibrium either by cell dehydration or intracellular ice formation. In either
case, the plasma membrane plays an important role in determining the manner of
equilibration. Ifthe plasma membrane is intact, the plasma membrane is an effective barrier
to extracellular ice and the intracellular contents remain supercooled due to lack of
effective ice nucleators (Steponkus, 1984). Because of the semipermeable characteristic of
the plasma membrane, water moves to the outside space from inside the cell to achieve
equilibrium. As water movement continues, the cell becomes dehydrated and injury can
occur. There are many hypotheses on the mechanism of freezing injury caused by cellular
dehydration including volumetric and area contraction, high salt concentration, pH change,
eutectic crystallization, removal of water of hydration of macromolecules, oxidation of
sulfhydryl groups and others (Mazur, 1969; Burke er al., 1976; Levitt, 1980 a; Williams,
1981; Steponkus, 1984). However, few of these hypotheses are supported by direct
evidences (Steponkus, 1984).

Ice adhesion can also cause freezing injury (Olien, 1974; Olien and Smith, 1981; Olien
and Lester, 1985). Adhesion stress develops when the interfaces of growing ice crystals and
hydrophilic substances of the cell wall or plasma membrane compete for interfacial liquid
water. This causes adhesion between ice and the cell wall or plasma membranes. This kind

of injury happens when the temperature is below -10' C.

Plants that lack the capacity to cold acclimate freeze intracellularly, as do plants which
are able to cold acclimate, but are nonacclimated. Intracellular ice formation causes injury.
The hypothesis for the mechanism of freezing injury caused by intracellular ice formation
is mechanical rupture of the cell and deleterious physical contact of the membrane by ice
(Mazur, 1969; Burke er al., 1976).

From direct cryomicroscopic observations of isolated rye protoplasts (Secale cereale L.
cv. Puma), Steponkus (1981) concludes that the primary site of freezing injury is the plasma
membrane. He summarizes four kinds of injury: (a) Expansion-Induced Lysis. This occurs

during warming and thawing, when water moves back into the protoplasts resulting in

3

expansion and lysis of the protoplasts. Injury results from an irreversible loss of membrane
material during plasmolysis. (b) Loss of Osmotic Responsiveness. Following cooling, the
plasma membrane losses its semipermeable characteristics. This is probably due to the
alterations in the bilayer structure of the plasma membrane and the loss of membrane
proteins. (c) Altered Osmotic Behavior During Warming. Although the protoplasts are
osmotically responsive, their volume after thawing is less than expected from the Boyle-
van’t Hoff relationship. This is probably due to either a prior transient loss of intracellular
solutes or leakiness of the plasma membrane. (d) Intracellular Ice Formation Under Rapid
Cooling Condition (3 ' C/min). Intracellular ice formation causes injury to the plasma
membrane.

Mechanism of Cold Acclimation

A number of physiological, biochemical, and molecular changes have been shown to
occur in plants during cold acclimation. Understanding the roles that these changes have in
freezing tolerance and low temperature survival should ultimately lead to new methods to
improve the freezing tolerance of important horticultural and crop plant species.

Physiological and Biochemical Changes

Photosynthesis and respiration are depressed by low temperature during cold
acclimation. It has been noted that the more freezing tolerant varieties of winter wheat have
much higher rates of photosynthesis than those of less freezing tolerant cultivars. The high
photosynthetic rate of plants during cold acclimation provides energy sources for freezing
tolerance (Barta and Hodges, 1970). In winter wheat, it is found that respiration occurs via
glycolysis and the‘Krebs cycle during initial cold acclimation at 7 ' C (the 50% survival
temperature after such cold acclimation is about -10'C), but shifts to the pentose
phosphate pathway during the second stage of cold acclimation at 2' C (the 50% survival
temperature after this stage of cold acclimation is about - 17' C). This shift is believed to aid
cold acclimated plants to maintain dormancy during brief warm winter weather (Olien and
Smith, 198 1).

In winter cereals, a large amount of fructan accumulates during cold acclimation (Olien
and Lester, 1985). Fructan is the energy source for early spring growth. Rye, barely and
wheat also undergo fructan conversion when cold acclimated seedlings are frozen for

4

twenty four hours at -3‘ C. Fructans decrease while intercellular fructose and sucrose
increase. The released fructose and sucrose are believed to have an important role in
adhesion stress; they are in solution at equilibrium with ice so they can form an effect
barrier to adhesion. Some arabinoxylan mucilages produced in the cell walls are believed
to be effective inhibitors of ice crystal formation in extracellular spaces (Olien and Smith,
1981). The structure of the arabinoxylans from wheat and rye has been studied (Kindel et
al.,1989). The rye arabinoxylans have different structures than the wheat arabinoxylans.
These differences might count for the fact that the rye polysaccharide is a better inhibitor

of ice formation than is that of wheat.

In winter wheat at 2’ C, starch-sugar metabolism shifts; starch disappears and sugars
accumulate (Olien and Smith, 1981). Other organic solutes and proline also accumulate
during cold acclimation. The accumulation of small molecules is believed to play an
important role in cyroprotection and freezing point depression (Levitt, 1980 a). However,
very high concentrations of these small molecules are needed in order for them to have
cyroprotective functions. In plants, it appears that these small molecules play

cryoprotective functions mainly on a colligative basis (V olger and Heber, 1975).

Soluble proteins also accumulate during cold acclimation (Levitt, 1980 a). In spinach and
cabbage, some of these soluble proteins have a high content of hydrophilic amino acids and
are heat-stable (Volger and Heber, 1975; Hincha, er al., 1989, 1990). In vitro cryoassay
experiments indicate that these hydrophilic heat-stable soluble proteins, with the same
concentration (ug/ml), these polypeptides were found to be greater than 15 times more
effective in protecting thylakoid membranes against mechanical freeze-thaw damage than
control protein such as BSA (bovine serum albumin). The concentration of these
cryoprotective proteins in the leaves of cold acclimated plants appears to be high enough
to contribute significantly to the freezing tolerance of plants. However, there is no direct

evidence that these proteins have important cryoprotective roles in planta.

Many changes in lipid membrane composition occur during cold acclimation (Y oshida
and Uemura, 1984; Lynch and Steponkus, 1987). Acclimated plants have significant
increases in free sterols and phospholipids. The level of di-unsaturated species of
phosphatidylcholine and phosphatidylethanolamine double in cold acclimated rye cells.
There is direct evidence that these changes have dramatic effects on the cryobehavior of rye

5

plant cells and that they contribute to the freezing tolerance of the plants (Steponkus, er al.,
1988). It also reported that the structure of chloroplast membranes is altered during cold
acclimation (V igh er al., 1985).

Changes in Gene Expression During Cold Acclimation

It has been reported that cycloheximide, a protein synthesis inhibitor, can prevent cold
acclimation in Brassica napus and wheat (Kacperska-Palacz et al., 1977; Trunova, 1982).
Thus, cold acclimation may require changes in gene expression. Many studies have been

carried out in this area.
a. Isozyme Composition

Temperature effects the structure and function of enzymes. Temperature affects the
hydrogen-bond and hydrophobic interactions that stabilize protein structure. Temperature
can also affect the Km and activation energies for enzymes. Therefore, during cold
acclimation, one might expect that certain enzymes would be modified, or that different
forms might be synthesized. Indeed, it has been reported that acclimated and nonacclimated
plants have different isozymes of ribulose bisphosphate carboxylase / oxygenase (Rubisco)
(Huner and Maedowall, 1976 ab; 1979 ab). The “acclimated enzyme” has twice the specific
activity of the nonacclimated enzyme. At 5' C, the acclimated enzyme has a lower Km and
higher affinity for 002 than does the “nonacclimated isozyme.” In contrast, at 25' C the
nonacclimated enzyme has the lower Km. The acclimated enzyme is also more stable than
the nonacclimated enzyme at -20' C. Some isozymes have different amino acid
compositions indicating that they are encoded by cold-regulated genes (Shomer-Ilan and
Waisel, 1975). It has been suggested that the acclimated enzymes might be better suited to
low temperature and thus help plants survive better in lower temperature environments
(Huner and Maedowall, 1979; Shomer-Ilan and Waisel,l975).

b. Protein Synthesis.

The soluble protein content of plants increases during cold acclimation. In wheat and
black locust, it is found that soluble protein levels in acclimated plants are about 300% and
50%, respectively, greater than that in nonacclimated plants (Sirninovitch et al., 1968;
Trunova, 1982). It has also been shown that changes in polypeptide composition occur

during cold acclimation. These include increases and decreases in polypeptide levels, as

6

well as novel changes. In alfalfa, cold treatment induces alterations in the membrane
protein profile; about 10 new polypeptides are synthesized (Mohapatra er al., 1987, 1989).
In barley, cold shock induces some proteins and represses others (Cattivelli and Bartels,
1989). Interestingly, the changes that occur are different between winter and spring barley
varieties. In spinach, exposure to 5‘ C induces the synthesis of three new proteins having
molecular weights of 160, 117 and 85 kD (Guy and Haskell, 1987). These proteins are
detected during the first day of cold acclimation and are synthesized for as long as the plants
are kept at 5 'C (14 days was the longest time tested). During deacclimation (when plants
are transferred back to the normal growth temperature), the synthesis of these three proteins
markedly decreases. The induction of these proteins and the “depressions” during cold
acclimation are highly correlated with the induction and loss of freezing tolerance. In
Arabidopsis, newly synthesized polypeptides of 160, 47, 24, 15 and 6.6 kD occur during
cold acclimation (Gilmour et al.,1988; Lin et al., 1990; Gilmour er al., in press), all of

which share the unusual biochemical property of remaining soluble upon boiling.

High molecular weight proteins also accumulate during cold acclimation of wheat
(Sarhan and Perras, 1987; Perras and Sarhan, 1989). It has been suggested that the most
important protein is a 200 kD polypeptide. This polypeptide accumulates at higher
concentration in a cold-tolerant cultivar (winter wheat) than in a cold-sensitive one (spring
wheat). Six other polypeptides, 64, 52, 48, 47, 42 and 32 kD, have been shown to increase
during cold acclimation. In vivo labeling experiments show that the 200 kD polypeptide
is present in roots, crowns and leaves; the 36 kD polypeptide is present in leaves, and that
the 52 and 64 kD polypeptides in roots; these proteins all expressed at a higher level in the

freezing tolerant cultivar than that in the sensitive one.

All of these results suggest that cold-induced proteins might play important roles in
freezing tolerance. Therefore, efforts are in progress to identify the genes encoding these
proteins, to study the functions of these proteins in freezing tolerance and to study the
regulation of their expression by low temperature.

c. mRNA Population Changes and Cold-regulated cDNA Clones

In vitro translation experiments have shown that changes in the concentrations of certain
mRNAs occur during cold acclimation (Guy and Haskell, 1985, 1987; Mohapatra et al.,
1987; Gilmour er al., 1988). By constructing and screening cDNA libraries prepared from

7

poly (A‘) RNA of cold-acclimated plants, cDNA clones of genes which are specifically
expressed during cold-acclimation have been isolated. In alfalfa, three such clones have
been identified (Mohapatra et al., 1989). Northern analysis shows the accumulation of
mRNAs corresponding to these cDNA clones is cold-acclimation specific; abscisic acid
(ABA), drought and wounding stress do not significantly influence their accumulation. A
positive correlation has been observed between the expression of these cloned sequences
and the degree of freezing-tolerance in four alfalfa cultivars. In Arabidopsis, cDNA clones
for fun car genes have been isolated (Hajela er al., 1990). These genes are responsive to
ABA and drought stress, but not to heat shock. Nuclear run-on transcription assays indicate
that the low temperature regulated expression of three of the cor genes is controlled
primarily at the posttranscriptional level, while the fourth is controlled at the transcriptional
level. The functions of these cold-regulated genes and the regulation of their expression are
being studied

(1. Effect of Abscisic Acid (ABA) on Cold Acclimation.

Endogenous levels of ABA have been shown to increase in some plants in response to
low temperature (Dale and Campbell, 1981; Kacperska-Palacz, 1978; Chen and Li, 1982).
Exogenous application of ABA at normal growth temperature can also improve freezing
tolerance of certain plants. The freezing tolerance of cell suspension culture of winter
wheat, winter rye and bromegrass increases in response to ABA (Chen and Gusta, 1983).
The degree of cold hardiness and the rate of hardening obtained by ABA treatment is
significantly higher than that caused by low temperature. It has been reported that
exogenously applied ABA can also enhance the freezing tolerance of Arabidopsis (Lang et
al., 1989). The freezing tolerance of plants treated with ABA at a normal growth
temperature (20' C) appeared to increase more rapidly than that of plants acclimated at low
temperature (4' C). In vivo labelling experiments indicate that cold acclimation and ABA
treatment can induce some of the same polypeptides. However, cold acclimation and ABA

induced specific polypeptides as well.
The Relationship of Drought and Freezing Tolerance.

As mentioned above, plant cells become dehydrated during a freeze-thaw cycle.
Therefore, freezing tolerance must include dehydration tolerance. Many studies have been

carried out on the correlation of freezing tolerance with drought tolerance. Studies on red

8

dog wood indicate that the freezing tolerance increases from -3 to -11° C after seven days
of water-stressed treatment (Chen and Li, 1977). Water stress and short day treatment
(woody species require short day to become cold acclimated) had a similar pattern of
biochemical changes, specifically decreases in protein, RNAs and starch, and increases in
soluble sugar. In winter wheat and rye, the same degree of freezing tolerance is acquired
following a four-week cold acclimation and a twenty-four-hour desiccation
stress(Cloutier,1983). These data suggest that there may be a common component in the
mechanism of freezing and drought tolerance. Interestingly, all four cold-regulated genes
that have been isolated from Arabidopsis are also induced by drought stress (Hejela et
al.,1990)

Mechanism of Drought Tolerance

Plant responses to drought stress have been extensively studied. Similar to freezing
stress, plants undergo numerous physiological and biochemical changes during acclimation
to drought stress (Levitt, 1980 b). Osmotic adjustment is one of the major responses.
Solutes such as proline, betaine, sucrose and fructans accumulate in plant cells in response
to a decrease in osmotic potential. These changes help cells compete for water with the
external physical environment. ABA also plays an important role in plant drought
tolerance. Under drought stress, large amounts of ABA accumulate in leaves leading the
closure of stomata to reduce the transpiration rate. At certain stages of plant development,
ABA is also elevated. Embryo maturation, prior to seed desiccation, is one such stage (Dure
et al., 1989). As the ABA content increases, a set of proteins named LEA (late
embryogenesis abundant) proteins are synthesized. These LEA proteins are probably
universal in plant seeds. These proteins and their mRNAs accumulate in the embryo tissues
of seeds as they approach maturity and begin to desiccate; they disappear when seeds are
germinating. The lea mRN As are not easily detected in leaves or roots of nonstressed
plants, however, they can be detected in water stressed, or ABA-treated leaves or roots
(Dure et al., 1989). Many cDNA clones or genomic clones of these lea genes have been
isolated, sequenced and characterized (Dure et al., 1989; Mundy and Chua, 1988, Litts et
al., 1987). The data indicate that LEA proteins can divide into three groups based on
sequence homology (Dure er al., 1989).

Group II LEA proteins are the most interesting ones in terms of the relationship between

9

drought and freezing tolerance, because the expression of RAB 21, a rice LEA Group 11
protein, is also regulated by low temperature and salt stress (Hahn and Walbot, 1989) and
the deduced amino acid sequence of COR47 in Arabidopsis, a boiling-stable polypeptide,
shares homology with Group II LEA proteins (Gilmour et al., in press). The Group II LEA
proteins all contain two lysine-rich repeats and a serine repeat located a few amino acids
upstream of the first lysine-rich repeat; the second lysine-rich repeat is always near the C-
terminus of the protein. These LEA proteins contain neither cysteine nor tryptophan
residues, but have high concentrations of glycine. The proteins are very hydrophilic and
“boiling-stable;” i.e., the proteins remain soluble upon boiling (Close er al., 1989; Dure er
al., 1989). These conserved features are believed to have important roles for the function
of these proteins (Godoy, et al., 1990).

Four cDN A clones of barley “dehydrins” and one cDN A a clone of a corn dehydrin have
been isolated from water-stressed seedlings (Close er al., 1990). The polypeptides deduced
from the sequences of these cDN A clones indicate that the dehydrins share all the common
structural features of Group II LEA proteins. The transcripts corresponding to each
dehydrin cDNA clone are abundant in dehydrating, but not in well-watered seedlings. All
of these dehydration-induced proteins are heat-stable.

Five ABA- and desiccation-responsive cDNA clones have been isolated from the
resurrection plant (Pirkoqaki er al., 1990). The sequences of two of cDNA clones indicated
that the transcripts encode proteins related to Group H LEA proteins, The other cDNA
clones represent gene that encode proteins that are unrelated to Group II LEA proteins. A
tomato cDNA clone representing a lea gene has also been isolated (Godoy, et al.,1990).
The expression of this gene is regulated by ABA and salt stress, but is not responsive to

cold or wounding.

Rationale and Objectives

Cold acclimation is a complex process that involves a variety of biochemical and
biophysical changes. The precise role that each of the changes has in cold acclimation,
however, is not certain. Some may contribute directly to the freezing tolerance of
acclimated cells. Others may contribute to the overall fitness of the plant for low

temperature survival, which in turn, could indirectly affect freezing tolerance.

10

It is known that changes in gene expression occur during cold acclimation (Guy, 1990;
Thomashow, 1990). Current research efforts are directed at identifying and isolating cold-
regulated genes, determining the roles that these genes have in cold acclimation, and
determining the mechanisms responsible for their cold-regulation. At present, very little is
known about these genes. Do plants have related cor genes that are activated during the
cold acclimation process? Is the regulation of expression of these genes similar among

different plants? Are any of the polypeptides encoded by car genes related at a structural
or functional level. To begin to address these issues, I have chosen to compare cor gene

structure and expression in wheat with that in Arabidopsis. Ultimately, studies on this area
may lead to the development of new method to improve freezing tolerance in wheat.
Improving the freezing tolerance of wheat could have significant effects on the yields and

quality of this important world food source.

1 1
List of References

Barta AL, Hodges HF (1970) Characterization of photosynthesis in cold hardening winter
wheat. Crop Sci 10:535

Burke MJ, Gusta LV, Quamme HA, Weiser CJ, Li PH (1976) Freezing and injury in plants.
Ann Rev Plant Physiol 27:507-528

Cattivelli L, Bartels D (1989) Cold-induced mRNAs accumulate with different kinetics in
barley coleoptiles. Planta 178:184-188

Chen PM, Li PH (1977) Induction of frost hardiness in stem cortical tissues of Camus
stolantfera Michx. by water stress. 11. Biochemical changes. Plant Physiol 59:240-243

Chen HH, Li PH (1982) Potato cold acclimation. In Li PH. Sakai A. eds. Plant Cold
Hardiness and Freezing Stress. Vol 2. Academic Press. New York, pp 5-22

Chen TH, Gusta L ( 1983) Abscisic acid-induced freezing resistance in cultured plant cells.
Plant Physiol 73: 71-75

Cloutier Y (1983) Changes in the electrophoretic patterns of soluble proteins of winter
wheat and rye following cold acclimation and desiccation stress. Plant Physiol 71:400-403

Close TJ, Kortt AA, Chandler PM (1989) A cDNA-based comparison of dehydration-
induced proteins (dehydrins) in barley and corn. Plant Mol Biol 13:95- 108

Dale J, Campbell (1981) Response of tomato plants to stressful temperature: increase in
abscisic acid concentrations. Plant Physiol 67:26-29

Dure L III, Crouch M, Harada J, Ho THD, Mundy J, Quatrano R, Thomas T, Sung ZR
(1989) Common amino acid sequence domains among the LEA proteins of higher plants.
Plant Mol Biol 12: 475-486

Gaylord M, Olin CR, Everson EH ( 197 3) Evaluation of freezing hardiness in winter wheat.
Crop Sci 15:153-157

Gilmour SJ, Hajela RK, Thomashow MF (1988) Cold acclimation in Arabidopsis thaliana.
Plant Physiol 87:745-750

Gilmour SJ, Artus N, Thomashow MF (1991) cDNA sequence analysis and expression of
two cold-regulated genes of Arabidopsis thaliana. In press

Godoy JA, Pardo JM Pintor-Toro JA (1990) A tomato cDNA inducible by salt stress and
abscisic acid: nucleotide sequence and expression pattern. Plant Mol Biol 15:695-705

Guy CL, Haskell D (1987) Induction of freezing tolerance in spinach is associated with the
synthesis of cold acclimation induced proteins. Plant Physiol 84:872-878

12

Guy CL (1990) Cold acclimation and freezing stress tolerance: role of protein metabolism.
Annu Rev Plant Physiol Plant Mol Biol 41 : 187-223

Hahn M, Walbot V (1989) Effects of cold-treatment on protein synthesis and mRN A levels
in rice leaves. Plant Physiol 91 :930—938

Hajela RK, Horvath DP, Gilmour SJ, Thomashow MF (1990) Molecular cloning and
expression of car (cold-regulated) genes in Arabidopsis thaliana. Plant Physiol 93: 1246-
1252

I-Iincha DK, Heber U, Schmitt JM (1989) Freezing ruptures thylakoid membrane in leaves
and rupture can be prevented in vitra by cryoprotective proteins. Plant Physiol Biochem
27:795-801

Hincha DK, Heber U, Schmitt M (1990) Proteins from frost-hardy leaves protect
thylakoids against mechanical freeze-thaw damage in vitra. Planta 180:416-419

Huner NPA, Macdowall FDH (1976a) Chloroplastic proteins of what and rye grown at
warm and cold-hardening temperatures. Can J Biochem 54:848-853

Huner NPA, Macdowall FDH ( 1976b) Efiect of cold adaptation of Puma rye on properties
of RUDP carboxylase. Biochem Biophy Res Commun 73:411-420

Huner NPA, Macdowall FDH (1979) Change in the net charge and subunit properties of
ribulose bisphosphate carboxylase-oxygenase during cold hardening of Puma rye. Can J
Biochem 57: 155-164

Huner NPA, Macdowall FDH (1979) The effects of low temperature acclimation of winter
rye on catalytic properties of its ribulose bisphosphate carboxylase-oxygenase. Can J
Biochem 57: 1036- 1041

Johnson-Flanagn AM, Singh J (1987) Alteration of gene expression during the induction
of freezing tolerance in Brassica napus suspension cultures. Plant Physiol 85:699-705

Kindel PK, Liao S-Y, Liske R, Olien R (1989) Arabinoxylans from rye and wheat seed that
interact with ice. Carbohydrate Research l87;173-l85

Kacperska-Palacz A(1978)Mechanism of cold acclimation in herbaceous plants. in PH Li.
A Sakai, eds Plant Cold Hardiness and Freezing Stress. Academic Press, New York. pp 1 39-
152

Kacperska-Palacz A, Dlugokecka E, Breitenwald BW, Weislinska B (1977). Physiological
mechanisms of frost tolerance: possible role of protein in plant adaptation to cold. Biol
Plant 19:10-17

Lang V, Heino P, Palva ET (1989) Low temperature acclimation and treatment with
exogenous abscisic acid induce common polypeptides in Arabidopsis thaliana (L.) Heynh

1 3
Theor Appl Genet 77:729-734

Levitt J (1980a) Response of plant to environmental stress. Vol. 1: Chilling, freezing and
high temperature stresses. 2nd ed, Academic press, New York.

Levitt J (1980b) Response of plant to environmental stress. Vol.1]: Water, radiation, salt,
and other stress. 2nd ed, Academic press, New York. '

Lin CT, Guo WW, Everson E, Thomashow MF (1990) Cold acclimation in Arabidopsis and
wheat. Plant Physiol 94: 107 8- 1083

Litts J C, Colwell GW, Chakerian RL, Quatrano RS (1987) The nucleotide sequence of
cDNA clone encoding the wheat EM protein. Nucl Acids Res 15:3607-3618

Lynch DV and Steponkus PL (1987) Plasma membrane lipid alteration association with
cold acclimation of winter rye seedlings (Secale cereale L. cv Puma). Plant Physiol 83:
761-767

Mazur P (1969) Freezing injury in plants. Ann Rev Plant Physiol 20:419-48

Marmiroli N, Terzi V, Stanca MO, Lorenzoni C, Stanca AM (1986) Pr0teins synthesis
during cold shock in barley tissues. Theor Appl Genet 73: 190- 196

Mohapatra SS, Poole RJ, Dhindsa RS (1987) Changes in protein patterns and translatable
messenger RNA population during cold acclimation of alfalfa. Plant Physiol. 84: 1172-1 176

Mohapatra SS, Poole RJ, Dhindsa RS (1988) Alterations in Membranae protein profile
during cold treatment of alfalfa. Plant Physiol 86: 1005-1007

Mohapatra SS, Wolfraim L, Poole RJ, Dhindsa RS (1989) Molecular cloning and
relationship to freezing tolerance of cold-acclimation-specific genes of alfalfa. Plant
Physiol 89:375-380

Mundy J, Chua N-H (1988) Abscisic acid and water stress induce the expression of a novel
rice gene. EMBO J 7:2279-2286

Olien CR, Lester GE (1985) Freeze-induced change in soluble carbohydrate of rye. Crop
Sci 25:288-290

Olien CR (1974) Ice adhesions in relation to freeze stress. Plant Physiol 60:499-503

Olien CR, Smith MN (1981) Protective systems that have evolved in plants. In Olien CR,
Smith MN eds Analysis and improvement of plant cold hardiness. CRC Press. Inc. Boca
Raton, Florida 61-87.

Perras M, Sarhan F (1989) Synthesis of freezing tolerance proteins in leaves, crown, and
roots during cold acclimation of wheat. Plant Physiol 89:577-585

14

Pirkoqaki D, Schneider, K Salamini F, Bartels D (1990) Characterization of five abscisic
acid-responsive cDNA clones isolated from the desiccation-tolerant plant Creterastigma
plantagineum and their relationship to Other water-stress genes. Plant Physiol 94:1682-
1688

Poole RJ, Dhinsda RS (1988) Abscisic acid-regulated gene expression in relation to
freezing tolerance in alfalfa. Plant Physiol 87:468—473

Roberstson A, Lawrence V, Gusta MJ, Reaney T, Ishikawa M (1987) Protein synthesis in
bromegrass (Bramus inennis Leyss) cultured cells during the induction of frost tolerance
by abscisic acid or low temperature. Plant Physiol 84:1331-1336

Sarhan F, Perras M (1987) Accumulation of high molecular weight protein during cold
hardening of wheat (Triricun aestivum L.) Plant Cell Physiol 28: 1 173-1 179

Shearman LL, Olien CR, Marchetti BL, Everson E (1973) Characterization of freezing
inhibitors from winter wheat cultivars. Crop Sci 169: 1269-1278

Shomer-Ilan AE, Waisel Y (1975) Cold hardiness of plants: correlation with changes in
electrophoretic mobility, composition of amino acid and average hydrophobic of fraction-
l-protein. Physiol Plant 34:90-106

Siminovitch D, Cloitier Y (1983) Drought and freezing tolerance and adaptation in plants:
some evidence of near equivalences. Cryobiology 20:487-503

Steponkus PL (1984) Role of the plasma membrane in freezing injury on cold acclimation.
Ann Rev Plant Physiol 35:543-581

Steponkus PL, Uemura M, Balsamo R, Arvinte T, Lynch, V (1988) Transformation of the
cryobehavior of rye protoplasts by modification of the plasma membrane lipid
composition. Pro Natl Acad Sci USA 89:9026-9030 '

Thomashow MF, Gilmour SJ, Hejela R, Horvath D, Lin, C, Guo W (1990) Studies on cold
acclimation in Arabidopsis thaliana. Horticultural biotechnology, pp 305-314. Mley-Liss,
Inc.

Thomashow MF (1990) Molecular genetics of cold acclimation in higher plants. Adv Genet
28 :99- 13 1

Trunova TI (1982) Mechanism of winter wheat hardening at low temperature. In Plant cold
hardiness and freezing stress. Mechanisms and crop implication. Li PH eds. 2:41-45

Volger HG, Heber U (1975) Cryoprotective leaf proteins. Biochem et Biophy Acta
412(1975) 335-349

Vrgh L, Horvath I, van Hasselt PR, Kuiper PJC (1985) Effect of frost hardening on lipid
and fatty acid composition of chloroplast thylakoid membranes in two wheat varieties of

15
contrasting hardiness. Plant Physiol 79:756-759
Weiser CJ (1970) Cold resistance and injury in woody plants. Science 169:1269-1278

Williams RJ (1981) Frost desiccation: an osmotic model. In Olien CR, Smith MN eds
Analysis and improvement of plant cold hardiness. CRC Press. Inc. Boca Raton, Florida pp
61-87.

Yoshida S, Uemura M (1984) Protein and lipid composition of isolated plasma membranae
from orchard grass and changes during cold acclimation. Plant Physiol 75:31-37

Chapter 2

Comparison of Wheat and Arabidopsis cor Genes and Polypeptides

Summary

Previous studies have shown that changes in gene expression occur in wheat during cold
acclimation. Here, I show that at least some of these changes are at the mRN A level.
Further, some of the cold-induced mRNAs encode polypeptides which have the property
of remaining soluble upon boiling, a prOperty found in certain cold-induced polypeptides
of Arabidopsis. cDNA cloning, and Southern and Northern analysis indicate that wheat has
a car (cold-regulated) gene that is related to Arabidopsis car4 7, a cold-regulated gene that
encodes a “boiling-stable” polypeptide of 47 kD. The importance of the cold-regulated
boiling-stable polypeptides to cold acclimation and their possible role in freezing tolerance

are discussed.
Introduction

In many plant species, exposure to low nonfreezing temperature results in enhanced
freezing tolerance (Levitt, 1980). The process by which plants adjust to low temperature
and increase freezing tolerance is termed cold acclimation. Wheat is a plant that can cold

acclimate.

Cold acclimation is a complex process that involves biochemical and physical changes
including the accumulation of sugars and soluble proteins, and alterations in membrane
lipid composition (Levitt, 1980; Burke et al., 1976; Lynch and Steponkus, 1987). However
the roles that most of these changes have in cold acclimation and whether they contribute

significantly to freezing tolerance in planta is uncertain.

It is known that changes in gene expression occur during cold acclimation (Guy, 1990;
Thomashow, 1990). Research efforts are in progress to identify cold-regulated (car) genes,

to study their roles in cold acclimation and freezing, and to determine the mechanism of

16

17

regulation that controls expression of these genes. Many fundamental questions need to be
addressed. Do different plant species respond to low temperature in a similar way? Do
different plants have related car genes? Are cor genes products related at the structural and
functional level? In this chapter I begin to answer some of these questions. I have found
that although wheat is relatively unrelated to Arabidopsis, there are many similarities in the
changes of gene expression that occur during cold acclimation in these two plants: wheat
induces changes in mRN A populations; certain of the cold-induced wheat mRN As, like
Arabidopsis car transcripts, encode polypeptides that have the unusual property of
remaining soluble upon boiling; and wheat has at least one car gene that is related to an
Arabidopsis car gene. A cDNA, pWGl, representing this wheat car gene was isolated and

its expression examined.
Materials and Methods
Plant Material

Winter wheat Triticun aestivum L. cv winoka were grown in controlled environment
growth chambers. Temperature was maintained at 20° C (day and night) and the
photoperiod was a 14/ 10 hour day/night cycle with fluorescent light. Light intensity was
approximately 120u Em'zs'l . Plants were watered daily. Plants were grown under these
conditions for two weeks, then were either harvested or transferred to a growth chamber at

low temperature for various time periods for cold acclimation.
Freezing Test

Freezing toleraTrce of leaves was determined by the electrolyte leakage method of
Sukumaran and Weiser (1972). Fifteen leaf discs randomly selected from plants of different
pots were placed in stoppered culture tubes and incubated in a low temperature bath
(Masterline Model 2095, Forrna Scientific). The temperature in the bath was preset at -2°
C. Ice chips were added to each tube to initiate freezing. After an overnight equilibration
period, the temperature was lowered manually 1' C per hour. The samples were withdrawn
at each temperature point, placed on ice and thawed overnight in a cold room (2' C). Three
ml of distilled water was added to each tube and the tubes were shaken gently for 3 hours.
The conductivity of each sample was measured using a conductance meter (Y SI Model 35).

For 100% leakage, each sample was frozen at -80' C without any solution for one hour, then

18

the original solution was added back, the sample was shaken for another 3 hours, and the
conductivity was measured. A plot of temperature versus percent electrolyte leakage was
drawn. The LT50 (lethal temperature) was defined as the temperature that gave 50%
electrolyte leakage.

In vitra Translation

Poly (A+) RNA (1 ug) was translated in vitra in a 25 ul volume with rabbit reticulocyte
lysate (Promega Biotec) using the procedure suggested by the manufacturer (Promega
Technical Bulletin No.3). The in vitra translation products, radiolabeled with 35[S]
methionine, were either directly separated by SDS-PAGE (Laemmli, 1970) or on two-
dimensional polyacrylamide gels (2D-gels) (O’Farrell, 1975). For 2D- gels, the first
dimension was an equilibrium IEF gel with a pH range from approximately 4 to 8 and the
second dimension was a 10% SDS-PAGE gel. The gels were either dried directly or
soaked in Amplify (Amersharm) for 15 minutes prior to drying. Kodak X-Omat AR5 X-
ray film was used for both fluorography (exposed at -80' C) and autoradiography (exposed
at room temperature).

Boiling Treatment of in vitra Translation Products

The in vitra translation products were diluted with 5 volumes of 50 mM Tris-HCl
(pH7.5). The samples were boiled in a water bath for 10 minutes, then were centrifuged in
an Eppendorf microfuge two times for 15 minutes to remove the insoluble material.
Polypeptides that remained soluble were precipitated with 7 volumes of acetone and
pelleted in microfuge for 15 minutes. The pellet was suspended in loading buffer [10% (v/
v) glycerol, 0.01% (w/v) bromphenol blue, 2% (w/v) SDS, 60 mM Tris-HCl (pH 6.9), 100
mM dithiothreitol] and fractionated either by SDS-PAGE or 2D-gels as mentioned above.

RNA Extraction

Excised leaves were frozen in liquid nitrogen, pulverized using a mortar and pestle, and
stored at -80‘ C prior to extraction. Total RNA was isolated using a modified version of
method of Galau (1981). Frozen pulverized plant material was extracted in a buffer
containing 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, 50 mM EGTA, 1% (w/v) SDS,
10mM DTT, 6% (w/v) p-aminosalicylic acid (sodium salt), and 1% (w/v) tri—
isopropylnaphthalenesulfonic acid (sodium salt), then extracted with an equal volume of

19

buffer-saturated PCI [phenolz chloroform: isoamyl alcohol, 25:24: 1 (v/v/v)]. After
centrifugation, the aqueous (top) phase was extract once more with PCI, followed by
ethanol precipitation. The pellet was dissolved in water, then precipitated twice on ice with
2 M LiCl to purify RNA from DNA. The RNA was finally precipitated with ethanol,
dissolved in distilled water, and stored at -80' C.

Poly (AT) RNA was obtained using a poly (U) sepharose column (Sigma) based on the
method of Cashmore (1982). RNA was dissolved in an equal volume of 2X S buffer [1X 8
buffer is 0.5 M NaCl, 10 mM Tris-HCl (pH8.0), lmM EDTA, 0.1% (w/v) SDS], and heated
for 10 minutes at 65‘ C. The solution was to cooled on ice and applied to a poly (U)
sepharose column which was previously washed with 90% formamide followed by 1X 8
buffer. The flow-through was reheated and reapplied to the column. The column was
washed with TE [10 mM Tris-HCl (pH 8.0), lmM EDTA] and SDS [0.1% (w/v)] and the
poly (A+) RNA eluted with 90% formamide. The formamide fraction was ethanol
precipitated, and the pellet was dissolved in distilled water and stored at -80° C.

DNA Extraction

Large scale preparations of plasmid DNA were extracted from E. coli by alkaline lysis
and banded on isopycnic CsCl-ethidium bromide gradients according to standard method
of Maniatis (1982). Mini-preparations of plasmid DNA were extracted from E. call by the
boiling method (Holmes and Quigley, 1981). Overnight cultured cells (1.5 ml) were
pelleted and suspended in STEP buffer [8% (w/v) sucrose, 5% (v/v) triton X100, 50 mM
EDTA, 50 mM Tris-HCl (pH 8)], boiled for 50 seconds and then centrifuged in an
eppendorf microfuge for 10 minutes. The plasmid DNA in the top supernatant was
precipitated by adding an equal amount of isopropanol and centrifuging in a microfuge.
Then DNA pellet was dried and dissolved in TE buffer and stored at -20' C

Construction and Screening of a cDNA Library

Poly (A+) RNA isolated fiom the leaves of 3 week cold acclimated (2’ C) plants
(Winoka) was used to synthesize double-strand cDN A according to Gubler and Hoffman
(9183). The doubled-stranded cDNA was blunt-ended, and methylated with E. call
methylase. EcaRI linkers were ligated to the cDNAs and the fragments were cut with
EcoRI, purified and ligated to the EcoRI site of Lambda ZAP (Stratagene). There were

20

approximately 105 recombinants in the cDNA library. The library was amplified once and
stored in either SM buffer [100 mM NaCl, 8 mM MgSO4, 50 mM Tris-HCl (pH 7.5), 0.01 %
(w/V) gelatin] containing 0.05% chloroform at 4' C or in SM buffer with 7% (w/v) DMSO
frozen at -80' C.

For screening the library, plague lifts were made using Nitran membranes (Schleicher
and Scheull) according to standard methods (Maniatis et al.,1982). The filters were baked
at 80' C for one hour in a vacuum oven. Before hybridization, the filters were first washed
with 0.1x SSC (1X SSC is 0.15 M NaCl, 0.015M sodium citrate), 0.5% (w/v) SDS at 60'
C for 30 minutes. Plaques were probed with labeled cDN A inserts from pHH7.2, pHI-128,
pI-lI-129 and pLCTlO, which are all cold-induced Arabidopsis cDNA clones (Hajela er al.,
1990). The inserts were labeled with [32p] (:1? by the random priming method (Fienberg
et al., 1983). Hybridization conditions were 6X SSC, 0.5% (w/v) SDS, 0.25% (w/v) nonfat
dry milk at 60' C overnight (Johnson et al., 1984). The filters were washed three times with
2X SSC, 0.5% (w/v) SDS at room temperature, each time for 5 minutes, then washed two
times with 2X SSC, 0.5% (w/v) SDS at 60' C for 30 minutes. Plagues showing homology
were further purified and the recombinant cDN As were excised from the phage in
pBluescript SK‘ by biological rescue using the method provided by the manufacturer
(Stratagene).

Northern and Southern Analysis

Total or poly (A+) RNA was fractionated on denaturing formaldehyde agarose gels using
standard methods (Maniatis, 1982). One ul of ethidium bromide (400 ug/ml) was added to
the sample buffer before the sample was denatured at 65' C for 15 minutes (Rosen et al.,
1990). This allowed visualization of RNA in the gel using UV light. The RNA was
transferred to Nytran membranes (Schleicher and Schuell) with 10X SSPE buffer [1X
SSPE is 18 mM NaCl, 10 mM NaH2P04 (pH 7.7), 1 mM EDTA]. The blots were stained
with methylene blue [0.02% (w/v) methylene blue in 300 mM of NaOAC (pH 5.5)] to

check the efficiency of transfer. The blots were baked at 80' C in a vacuum oven for 1 hour.

Plasmid DNA was digested with restriction enzymes and fractionated on 1% agarose gels
using standard methods (Maniatis, 1982). DNA gels were denatured with 0.5 M N aOH in
1.5 M NaCl for 1 hour, and neutralized with 0.5 M Tris-HCl (pH 8.0) in 1.5 M NaCl. The
DNA was transferred to Nytran membranes using the same method as with RNA gels. The

21
blots were baked as described for the Northern blots.

Northern and Southern blots were prewashed with 0.1X SSPE, 0.5% (w/v) SDS at 60' C
for 30 minutes. Prehybridization and hybridization of the Southems were in 6X SSPE,
0.5% (w/V) SDS, 0.25% (w/v) nonfat milk at 60' C. The wash was in 0.1X SSPE, 0.5% (w/
v) SDS at 65' C. Northern blots were hybridized in 5X SSPE, 50% (v/v) formamide 42' C,
and washed in 0.1X SSPE, 0.5% (w/v) SDS, 55' C using standard methods (Maniatis,
1982). Gel purified cDNA inserts were radiolabeled with ”[13] C1? by the random priming
procedure (Fienberg er al., 1983). Kodak AR5 X-ray film and intesifyin g screens (Dupont)
were used for autoradiography. Films were exposed at -80' C for various times depending

on the amount of radioactivity
Results
Freezing Tolerance of Cold Acclimated Plants

The freezing tolerance of winter wheat Winoka increased upon treatment at low
temperature. The degree of freezing tolerance enhancement depended on the cold
acclimation conditions: the lower the temperature above 0' C and the longer the period of
cold acclimation, the greater the freezing tolerance (Figure 1). Specifically, the LT50 of
nonacclimated plants was -5' C, while the LT50 of plants that were acclimated at 2' C for
three weeks was -14' C. Plants which were acclimated at 2' C for only one week had an
LT50 of -8 ' C. The LT50 of plants acclimated at 12' C for three weeks was -10' C, while
the LT50 of plants acclimated at 7’ C was -11’ C.

Changes in Gene Expression During Cold Acclimation

In vitra translation of poly (A+) RNA isolated from cold acclimated and nonacclimated
plants showed that the translatable mRNA populations were different in the cold
acclimated and nonacclimated plants (Figure 2). Specifically, there were a marked
increases in the levels of ten polypeptides in the in vitra translated RNA from cold
acclimated plants. The largest among these ten polypeptides had a molecular weight 200
kD and pl of approximately 6.7. Another polypeptide with similar pI (about 6.8) was
smaller, 180 kD. There were five polypeptides, 80, 48, 47, 18, and 17 kD, with slightly
basic pIs ranging from 7.4-7.7. Three other acidic polypeptideshad molecular weights

22

Figure 1. Effect of low temperature and period of cold acclimation on
freezing tolerance of winter wheat T. aesn'vwn cv Winoka.
WL20: non acclimated plants. WL12: plants were acclimated at
12'C for three weeks. WL7: plants were acclimated at 7 ° C for
three weeks.WL2: plants were acclimated at 2' C for three weeks.
WL2-1: plants were acclimated at 2' C for one week.

 

 

Electrolyte leakage(%)

23

 

 

 

 

100 . . __ _
WI. 20' r f T
90- -
/ at. °C

u— -/. h. —l

'30 wr. 2°c-l/ r
/" o/ e .
70- fl ./ WL 12°C -
60r- / _. _/ _
/
x .O. .
50- r /. -
40.- x ./ -
y .. .f
/ -'

301- /_.; J-l _
20m __ / / -' ..

...... l H 0C
10.- ,’ r

1 __ ,_._/-"

0 ' 5 5 1
0 5 ' 0 - 15 - 20
Temperature (' C)

Figure l

24

Figure 2. Two-dimensional electrophoretic analysis of in vitro translation products
of poly (A+) RNA isolated form nonacclimated (A) or acclimated (B) (2° C
three weeks) T. acestivum cv Winoka. Circles indicate translation products
that increased in cold acclimation plants.

fl-
1‘].

25

 

.—-[‘EF

B
Figure 2

26

around 18 kD with p18 of 4.7-4.9. The 48 and 47 kD polypeptides were the most strongly
induced of the ten cold-regulated polypeptides. In Figure 2, in order to show the strong
induction of these cold-induced polypeptides, the autoradiography of B is less exposure
than A. These changes of in vitro translation products were consistent, being observed in at
least four independent experiments in which the plants were cold treated at three different
temperatures, 12’C, 7' C and 2' C (data not shown). Similar changes were observed in

another winter wheat variety, Genesee (data not shown).
Cold Regulated mRNAs Encoding “Boiling-Stable” Polypeptides

Most proteins are denatured upon boiling, coagulate, and can be pelleted by
centrifugation. However, it has been shown in Arabidopsis that mRN As encoding “boiling-
stable” polypeptides accumulate during cold acclimation. This cold acclimation response
also occurs in wheat. Figure 3 shows the results of in vitro translation products of
transcripts isolated from control acclimation plants fractionated either directly by SDS-
PAGE (Total) or after boiling and centrifugation to remove insoluble material (Boiled).
The data indicates that most of proteins were removed by boiling. However, the 200, 180,
80, 48, and 47 kD polypeptides translated from cold acclimated mRNA remained soluble.
The other five polypeptides with molecular weights of around 18 and 17 kD were also
boiling stable, but cannot be seen in Figure 3 because they ran off the gel. The results of
2D-gels showed that all of the cold-regulated boiling-stable, polypeptides had the same
molecular weights and p18 as the cold-regulated polypeptides described in Figure 2 (data

not shown).
Isolation of a Wheat Gene Related to ArabidOpsis cor47

Transcripts encoding boiling-stable polypeptides of 160, 47, 24, 15, and 6.6 kD
accumulate in cold acclimated Arabidopsis (Lin et al., 1990; Gilmour and Thomashow,
unpublished results). cDNA clones corresponding to four of these COR polypeptides were
isolated (Hejela, et al., 1990; Lin et al., 1990; Gilmour and Thomashow, unpublished
results); cDNAs pill-128, pill-17.2, pLCT 10 and pHI-129 correspond to the 160, 47,15, and
6.6 kD polypeptides, respectively. It was of interest to know if wheat had cor genes related
to any of these Arabidopsis cor genes. Therefore, a cDNA library was constructed using
poly (A+) RNA isolated from cold acclimated (2' C, 3 weeks) Winoka and the library was
screened with the four different cold-induced cDNA clones from Arabidopsis. Wheat

27

Figure 3. SDS-PAGE analysis of in vitro translation products of poly (A+)
RNA isolated from cold acclimated and nonacclimated plants.
Total: in vitro translation products directly separated on SDS-PAGE.
Boiled: boiling-stable in vitro translation products separated on
SDS-PAGE. NA: nonacclimated. AC7: acclimated at 7' C for 3
weeks. AC2: acclimated at 2’C for 3 weeks.

28

w « o“
9' ‘5’ v" e" ‘5’ v kDa
—200
‘180

 

TOTAL BOILED

b

Figure 3

29

Figure 4. Northern analysis indicating the accumulation transcripts hybridizing
with pWGl in cold acclimated wheat. A: RNA was isolated
from cold acclimated plants(2' C, 3 weeks). B: RNA was
isolated for nonacclimated plants. 15 ug of total RNA was
fractionated on a formaldehyde agarose gel, transferred to a Nytran
membrane and hybridized with 3 P-labeled
pWGl insert.

30

 

Figure 4

31

Figure 5. Southern analysis indicating the homology between Arabidopsis
COM 7 and the wheat gene represent by pWGl. (a) Restriction fragments
of pHH7.2 were fractionated on an agarose gel. digests were: E, EcoRl;
B, EcoRI plus BamHI; K, EcoRI plus KpnI; X, EcoRI plus X bal.
(b) Southern blot of gel in (a) hybridized with pWGl cDNA insert.

(c) Restriction map of the pHI-I7 .2 cDNA insert. abbreviation are: E, EcoRI;
X, Xbal; K, KpnI; B, BamHI.

32

 

 

bp
X E B K x
E B K —2960
—1072
—587
-—246
246 587 700 1072
X K B E
C

Figure 5

33

clones that hybridized with pHI-I 7.2 were detected. These clones were purified and further
analyzed.

Northern analysis indicated that one of the clones that hybridized with pI-II-l7.2,
designated pWGl, represented a cold-regulated (cor) gene (Figure 4). Transcripts
homologous to pWGl were only present in cold-acclimated plants. The sizes of the

transcripts were 3.3, 1.5, 1.4, and 0.8 kb.

Southern analysis indicated that the DNA sequence homology shared by pWGl and
pHI-I7.2 mapped to the middle region of pHI-I7.2 (between the XbaI and Kpnl restriction
sites, Figure 5). DNA sequence analysis indicates that this region of pHI-I7.2 is within the
coding sequence of the COR47 polypeptide (Gilmour et al., in press).

The wheat cDNA library was also screened for clones related to pHH29, pHH28 and
pLCI‘ 10. No hybridization was detected with pLCT 10. For pHI-129, some clones showed
hybridization and were further purified and studied. However, it was found that the
homology was only to the 3’ untranslated region of pHHZ9. The homology was probably
due to the poly A tail (data not shown). For pHHZS, all clones showed a similar low degree
of hybridization. When the 3’ end of pHI-128 was digested with restriction enzymes to get
rid of the poly A tail, and the wash conditions for the hybridization were changed to higher
stringency [0.1x SSC, 0.5% (w/v) SDS at 65' C], similar results were obtained (data not

shown). The significance of this hybridization remains unknown.

Discussion

In vitro translation experiments indicate that cold acclimation in wheat is associated with
increased levels of transcripts encoding polypeptides of 200, 180, 80, 48, 47, 18, and 17
kD. The 200 and 180 kD polypeptides have similar pIs (about 6.8) as do the 48 and 47 kD
polypeptides (about 7.5). Perras and Sarhan (1989) reported in viva labeling experiments
indicating a 200 kD polypeptide with pI 6.8 is induced during cold acclimation. It seems
probable that this polypeptide is the same as the 200 kD polypeptide I found in my in vitro

translation experiments. If this is true, then this polypeptide is not being processed in vivo.

The data presented indicate that many of the wheat polypeptides encoded by cold-
regulated mRNAs share the unusual property of remaining soluble upon boiling. Similar
results have been obtained with Arabidopsis (Lin et al., 1990). Given the evolutionary

34

distance between wheat and Arabidopsis, it seems probable that the accumulation of
boiling-stable polypeptides will be found to be a common response of plants, at least among
those that cold acclimate. In addition, I found that wheat has at least one gene that is related
to an Arabidopsis cor gene that encodes a boiling-stable polypeptide, specifically COM 7,
and that this wheat gene is cold-regulated. These results suggest that the boiling stable-
polypeptides probably have an important role in cold acclimation; two distantly related
plants would not be expected to express genes that encode polypeptides with unusual
biochemical properties unless they have some important functions. What functions might
the boiling-stable COR polypeptides have? One possibility is that they might have
cryoprotective properties. It has been reported that leaf cryoprotective polypeptides are
synthesized in spinach and cabbage during cold acclimation (Hincha, et al., 1990). With the
same concentration (ug/ml), these polypeptides were found to be greater than 15 times
more effective in protecting thylakoid membranes against mechanical freeze-thaw damage
(in virro) than control protein like BSA. These polypeptides, like the boiling-stable
Arabidopsis and wheat COR polypeptides, are cold-regulated and remain soluble upon
boiling. Interestingly, preliminary in vitro cryoassays have been carried out with COR 15
(the 15 kD boiling-stable polypeptide encoded by Arabidopsis c0r15) that indicate that it
has potent effect in protecting lactate dehydrogenase against freeze inaCtivation (Lin and
Thomashow, unpublished data). However, these experiment were performed in vitro,
whether these cold-induced boiling-stable polypeptides have cry0pr0tective function in

viva remains unknown.

I used four Arabidopsis cDNA clones, corresponding to cor encoding boiling-stable
polypeptides of 160, 47, 15 and 6.6 kD, to screen the wheat cDNA library for related genes.
Only cor4 7 showed specific homology to a wheat gene. Immunoprecipitation experiments
indicated that an antibody against COR16O kD (Gilmour, unpublished data) did not
recognize any wheat polypeptides (data not shown). Thus, wheat does not appear to have
genes structural related to Arabidopsis genes cor160, cor15, and cor6.6. However,
Additional studies are needed to prove this because there is a possibility that the size of
Winoka cDNA library (10 5 recombinants) is not big enough, therefore, the level of clones

related to Arabidopsis cor genes is too low to detect.

Northern analysis indicated that there are many different sizes of cold-regulated
mRNAs that hybridize with pWGl. Do these different transcripts originate from the same

35

gene, representing different sites of transcript initiation or different processing events?
Alternatively, are they transcribed from related genes or different members of a gene

family? Additional experiment will be required to distinguish between these possibilities.

 

36
List of References

Burke MJ, Gusta LV, Quamme HA, Weiser CJ, Li PH (1976) Freezing and injury in plants.
Ann Rev Plant Physiol 27:507-528

Cashmore AR (1982) The isolation of poly A+messenger RNA from higher plants. In M
Edelman, RB Hallick, N-H Chua, eds, Methods in Chloroplast Molecular Biology.Elsevier,
Amsterdam, pp 387-392

Fienberg AP, Vogelstein B (1983) A technique for radiolabeling restriction endonuclease
fragments to high specific activity. Anal Biochem 132:6-13

Galau GA, Legocki AB, Greenway SC, Dure LS 111 (1981) Cotton messenger RNA
sequence exist in both polyadenylated and nonpolyadenylated forms. J Biol Chem
256:2551-2560

Gilmour SJ, Hajela RK, Thomashow MF (1988) Cold acclimation in Arabidopsis thaliana.
Plant Physiol 87:745-750

Gilmour SJ, Artus N, Thomashow MF ( 1991) cDNA sequence analysis and expression of
two cold-regulated genes of Arabidopsis thaliana. In press

Gubler U, Hoffman BJ (1983) A simple and very efficient method for generating cDNA
libraries. Gene 25:263-269

Guy CL (1990) Cold acclimation and freezing stress tolerance: role of protein metabolism.
Annu Rev Plant Physiol Plant Mol Biol 41 :187-223

Fienberg AP, Vogelstein B (1983) A technique for radiolabeling restriction endonuclease
fragments to high specific activity. Anal Biochem 132:6—13

Hajela RK, Horvath DP, Gilmour SJ, Thomashow MF (1990) Molecular cloning and
expression of cor (cold-regulated) genes in Arabidopsis thaliana. Plant Physiol 93:1246-
1252

Hincha K, Heber U, Schmitt J (1989) Freezing ruptures thylakoid membrane in leaves and
rupture can be prevented in vitro by cryoprotective proteins. Plant Physiol Biochem
27:795-801

Johnson DA, Gautsch JW, Sportsman JR, Elder JH (1984) Improve technique utilizing
nonfat dry milk for analysis of proteins and nucleic acids transferred to nitrocellulose. Gene
Anal Tech 1:3-8

Laemmli UK, (1970) Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature 227:680-685

Levitt J (1980) Response of plant to environmental stress. Chilling, freezing and high

37
temperature stresses. 2nd ed, Academic press, New York.

Lin CI‘, Guo WW, Everson E, Thomashow MF ( 1990) Cold acclimation in Arabidopsis and
wheat. Plant Physiol 94: 1078- 1083

Lynch DV, Steponkus PL (1987) Plasma membrane lipid alteration association with cold
acclimation of winter rye seedlings (Secale cereale L. cv Puma). Plant Physiol 83: 761-767

Maniatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning: A laboratory manual. Cold
Spring Harbor, NY

O’Farrell PH (1975) High resolution two-dimensional electrophoresis of proteins. J Biol
Chem 250:4007-4021

Perras M, Sarhan F (1989) Synthesis of freezing tolerance proteins in leaves, crown, and
roots during cold acclimation of wheat. Plant Physiol 89:577-585

Rezaian MA, Heraton LA, Pedersen K, Milner J], Jackson A0 (1983) Size and complexity
of polyadenylated RNAs induced in tobacco infected with sonchus yellow net virus.
Virology 131:221-229

Rosen KM, Villa-Komaroff L (1990) An alterative method for the visualization of RNA in
formaldehyde agarose gels. Focus 12:2-4

Sukumaran NP, Weiser CJ (1972) An excised leaflet test for evaluating potato frost
tolerance. HortScience 7:467-468

Thomashow MF (1990) Molecular genetics of cold acclimation in higher plants. Adv Genet
28299-131

Thomashow MF, Gilmour SJ, Hejela R, Horvath D, Lin, C, Guo W (1990) Studies on cold
acclimation in Arabidopsis thaliana. Horticultural biotechnology, pp 305-314. Wiley-Liss,
Inc. '

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning. A laboratory manual, Ed 2.
Cold Spring Harbor Laboratory, Cold Spring Harbor, New York

Volger HG, Heber U (1975) Cryoprotective leaf proteins. Biochemica et Biophysica Acta
412:335-349

Chapter 3

Molecular Characterization of pWGl, a cDNA Representing a Cold-
Regulated Gene

Summary

In the previous chapter, I showed that similar to Arabidopsis, certain wheat car (cold-
regulated) genes encode boiling-stable polypeptides. A cDNA clone, pWGl, for one of
these car genes was isolated. This gene is related to car4 7 of Arabidopsis gene. In this
chapter I present the DNA sequence of pWGl. The data indicate the car gene represented
by pWGl encodes a 39 kD hydrophilic polypeptide. The gene was designated cor39 and
the polypeptide it encodes COR39. The deduced amino acid sequence of COR39 indicates
that it contains a lysine-rich sequence that is repeated six times. Nearly identical lysine
repeats are present in COR47 and Group II LEA (late embryogenesis abundant) proteins.
In addition, COR39 has six glycine-rich repeats which are also related to repeats found in
barely and maize “dehydrins” proteins that are members of the Group II LEA proteins
family. Like lea transcripts, car39 transcripts accumulate in response to ABA treatment
and drought stress. The similarities and differences between car39, Arabidopsis car genes
and LEA proteins are discussed in terms of regulation of expression and possible roles in

freezing and drought tolerance.
Introduction

Changes in gene expression occur during cold acclimation (Guy, 1990; Thomashow,
1990). A major task now is to determine whether these cold-regulated genes play an
important role in freezing tolerance. A number of cold-regulated genes have been isolated
and are being characterized. In alfalfa, it has been shown that the levels of expression of
three cold-regulated genes correlate positively with the freezing tolerances of four different
cultivars (Mohapatra er al., 1989). In Arabidopsis, cDNA clones of four cold-regulated
(car) genes have been isolated and being characterized (Hajela et al 1990). The transcript

38

39

levels of these four car genes increase markedly upon cold treatment (between 1 to 4
hours), remain at elevated levels for as long as the plants are kept at low temperature, and
decrease rapidly to normal levels when the plants are deacclimated (transferred back to
normal growth temperature). The expression of these car genes is also regulated by ABA
and drought stress. DNA sequence analysis indicates that these four car genes encode
hydrophilic polypeptides (Gilmour er al., 1991; Lin and Thomashow, in preparation;
Thomashow et al., in preparation). Interestingly, the deduced amino acid sequence of
COR47, a boiling-stable polypeptide, shares homology with Group II LEA (late
embryogenesis abundant) proteins (Gilmour er al., in press). LEA proteins have been
hypothesized to have roles in drought tolerance (Dure er al., 1989). These proteins are
synthesized just prior to seed desiccation and are induced in water-stressed tissue or tissue
that has been treated with ABA. LEA proteins are also hydrophilic and boiling-stable.
Given the fact that freezing injury results in part from dehydration, plant freezing tolerance
should include dehydration tolerance. The result that COR47 sequence shares homology
with LEA proteins suggests that freezing and drought tolerance may involve related genetic

mechanisms.

In the previous chapter I showed that similar to Arabidopsis, certain car genes of wheat
encode polypeptides that are boiling-stable. I also showed that the wheat car gene
represented by the cDNA clone pWGl is related to the car4 7 gene of Arabidopsis. In this
chapter I report the DNA sequence of pWGl. The data indicate that this cDNA represents

a wheat car gene, designated car39, that encodes a hydrophilic, boiling-stable polypeptide
of 39 kD. Further, the data indicate that COR39 is related to Group II LEA proteins. Gene
expression studies indicated that car39 is regulated similarly to Arabidopsis car genes. The

possible roles of these car genes in freezing and drought tolerance are discussed.

Materials and Methods
Plant Materials

Winter wheat Trticum aestivum L. cv Winoka grown in a controlled environment growth
chamber for two weeks as described in Chapter II. The plants were then either harvested or
given different treatments:

Temmm Treagent, Plants were placed in the growth chambers preset to various

40
desired temperatures for different time periods.

Drought Sass Treatment. Plants were placed in growth chambers under normal growth
conditions. Drought stress was induced by withholding water until plants became visibly
wilted (1-2 weeks).

ABA Treatment. Plants were sprayed to runoff with 100 um ABA (mixed isomers, Sigma)
in 0.02% (v/v) polyethylene sorbitan monolaurate 20 (Tween-20). The pots were covered
with Saran Wrap to slow evaporation and placed in a chamber under normal growth
conditions for various times. Control plants were sprayed with a solution of 0.02% (v/v)
Tween-20.

RNA and DNA Extraction

RNA was extracted from leave tissue and plasmid DNA was prepared as described in
Chapter II. Genomic DNA from wheat was prepared from the supernatant left after LiCl
precipitation of RNA during RNA extraction (Hejela et al., 1990). The supernatant was
diluted to 0.5 M LiCl with distilled H20 and the DNA was precipitated with ethanol. The
pellet was resuspended in TE [10 mM Tris-HCI (pH 8.0), 1 mM EDTA]. The resulting
solution was extracted twice with PCI (as described in Chapter II Material and Methods),
then precipitated with ethanol. The DNA was dissolved in TE and stored at 4' C.

Northern and Southern Analysis

Northern analysis was carried out as described in Chapter II. For Southern analysis,
genomic DNA from wheat (about 20 u g) was digested with various restriction enzymes and
fractionated on an agarose gel. Blots were prepared and hybridized as described in Chapter
II except that the gel was treated with 0.25 M HCl for 15 minutes before it was denatured
in alkaline solution.

Construction of pWG2

pWGl was digested with EcoRI, the mixture ligated with T4 DNA ligase and the
preparation transformed into E. caIi. A clone having the pWGl insert in reverse orientation
was isolated and designated pWGZ.

Int

min
usir
wcr
was

(1651

DN

41

In vitra Transcription lTranslation Experiments

pWGl and pWGZ were linearized by digestion with HindlII and the inserts were
transcribed in vitra with T3 RNA polymerase (Stratagene) at room temperature for 2 hours
using the T3 promoter on the pBluescript KS' vector. The in vitra transcription products
were treated with DNase I at 37 'C for 15 minutes and then extracted with PCI. The solution
was precipitated with ethanol, the pellet resuspended in TE and uanslated in vitra as
described in Chapter II.

DNA Sequence Analysis

The DNA sequence of the cDN A insert in pWGl was determined on both strands. 5 ’ and
3’deletions were generated by digestion with exonuclease III and mung been nuclease
based on the method of Henikoff (1987). DNA sequencing was carried out on either single
or double stranded DNA templates by the dideoxy chain termination reaction using

ill-kl“ _. _h__ _ _,_~
I
I

sequenase (US Biochemical Corp) according to the supplier. Premature termination, which
was a significant problem, was minimized by performing the termination reaction at 50' C
and using Tagtrack sequencing system (Pomega). Single stranded plasmid DNA was
prepared from E. cali strain MV1190 using the helper phage M13K07 (Vieira and Messing
1987). Double stranded DNA for sequencing was prepared according to Zhan g et a1.
(1988).

Programs of the University of Wisconsin Genetic Computer Group were used for nucleic
acid and protein sequence analysis. HIBio DNAsis and HIBio Prosis programs from
Hitachi Engineering Co. Ltd. were also used Hydropathy plots were conducted using a
window of 9 amino acid residues according to Kyte and Doolittle (1982). TFASTA
(Pearson and Lipman 1988) and WORD SEARCH (Wilbur and Lipman 1983) program

were used for amino acid and nucleotide sequence comparisons.
Results
DNA Sequence Analysis

The DNA sequence of pWGl is presented in Figure 6. The cDNA insert contains one
. long open reading frame of l 174 nucleotides that would encode a polypeptide of 391 amino
acids. The calculated molecular weight of this polypeptide is 39.1 kD and its isoelecuic
point (pI) is 7.48. In vitra uanscription/translation of the pWGl insert in the “correct” 5 ’>3 ’

42

Figure 6. Nucleotide and deduced amino acid sequences of pWGl. The single
letter amino acid code is shown above the first nucleotide of each
codon. Single underlining indicates the lysine-rich repeat (KR);
double underlining indicates the glycine-rich repeats (GR); dash line
indicates overlapping regions of repeats.

43

GTAAACACATCAGCACTAGTAGATTTCACGAGTCAGAAGCTCAGCGCAAGATGGAGAACC
M E N

AGGCACACATCGCCGGCGAGAAGAAGGGCATCATGGAGAAGATCAAGGAGAAGCTCCCCG
Q A H I A G a K K G r M E K I K EL_K L 42
:31
GCGGCCACGGCGACCACAAGGAGACCGCTGGTACCCACGGGCACGCCGCCACGGCGACGC
§__§__n G D H K a r A G r a G a A A r A r

ATGGTGCCCCGGCCACCGGTGGTGCCTACGGGCAGCAGGGTCACGCTGGAACCACCGGCA

CGGGGTTGCATGGCGCCCACGCCGGCGAGAAGAAGGGCGTGATGGAGAACATCAAGGACA

T G L H G A H A G E K K G V H, E N I K D
K32

AGCTCCCTGGTGGCCACGAGGACCACCAGCAGACCGGTGGCCACTACGGGCAGCAGGGAC

KLLL, P G G H E D H Q Q T Q 9 H x g Q Q Q

ACGCCGGCACGGCGACGCATGGCACCCCGGCTACCGCTGGCACCTATGGG]CAACAGGGGC

 

arncceccacccccacccarcccaccccacccaccccrcccaccrnrccccaccacccnc
a r c r A r g g r P A r .§__§__2__x_ G a Q G

3
ACACCGGAGTGACCGGCACGGGGACGCACGGCACCGGCGAGAAGAAGGGCCTCATGGAGA
H T G V T G T G T H G T G E K K G L M .EL

ACATCAAGGAGAAGCTCCCTGGTGGCCATGGTGACCACCAGCAGACCGCTGGCACCTACG
H I, K E K L P G G H G D H Q Q T A g z 2
H33

GGCAGCAGGGACACGTCGGCACGGGGACACATGGCGCCCCGGCTACCGGCGGGGCCTACG

G R P G Y R R G Y

GR‘

GGCAGCATGAACACGCCGGAGTGGCCGGCGCGGGAACATACGGCACCGGCGAGAAGAAGG
G Q H E H A G V A G A G T Y G T G E K K

GCGTCATGGAGAACATCAAGGACAAGCTCCCTGGCGGCCACGGCGACCACCAGCAGACCG
G y H E E I K D K L P G G H G D H O QL;T
‘34
GTGGCACCTACGGGCAGCAGGGACACACCGGCACGGCGACGCATGGCACCCCGGCCGGCG
T A T H g T P A G
----- GR;
GCGGCACCTATGAGCAGCACGGACACACCGGGATGACCGGCACGGGGACACACGGCACCG
3 LI

GCGAGAAGAAGGGCGTCATGGAGAACATCAAGGAGAAGCTCCCCGGTGGCCACGGCGACC

G E K K G V M ELAflggz K, E KL L, P G G H G LDL
H35

ACCAGCAGACCGGTGGAGCCTACGGGCAGCAGGGACACACCGGCACGGCGACGCATGGCA

 

 

CTCCGGCTGGCGGCGGCACCTACGGGCAGCATGCACACACTGGAATGACCGGCACGGAGA
H A H, T

CGCACGGCACCACGGCCACCGGCGGCACCCATGGGCAGCACGGACACGCCGGAACGACTG
T H G T T A T G G T H G Q H G H A G T T

GCACTGGGACACACGGCACCGACGGGGTGGGCGAGAAGAAGAGCCTCATGGACAAGATCA

G r c r a G r o G v 5 a g x s L M D K I
83:

AGGACAAGCTGCCTGGACAGCACTGAGCCCGGTGTGCCGACGG

K, n. x L p G 0 Ln

Figure 6

120

180
43

240
63

300
83

360
103

440
123

520
143

580
163

640
183

700
203

780
223

840
243

900
263

960
283

1020
303

1080
323

1140
343

1200
363

1260
383

1303
391

Figure 7a.Two-dimensional electrophoretic analysis of boiled in vitra transcription/
translation products of pWGl cDNA insert. A, boiled in vitra
transcription! translation products of pWGl cDNA insert was
separated on a 2-D gel; szoiled in vitra translation
products of poly (A+) RNA isolated from cold-acclimated plant was
fractionated on SDS-PAGE.

Figure 7b.Two-dimensional electrophoretic analysis of boiled in vitra translation
products of poly (A*) RNA isolated form cold acclimated plants.
A, boiled products fractionated on a 2-D gel; B, boiled products
ractionated directly on SDS-PAGE.

 

45

pll 4

pH4

Figure 7

6 [BF

-200
480

-80

' 48
© .47

~18
-l7

‘-

46

Table 1. Mole percent amino acid composition of
COR polypeptide sequence

 

 

Amino Acid Mol%
Gly G 26.85
Ala A 7.67
Val V 1.79
Leu L 2.30
Ile I 2.05
Ser 3 0.26
Thr T 15.86
Cys C 0.00
Met M 2.30
Asp D 2.56
Asn N 1.28
Glu E 5.37
Gln Q 6.91
Arg R 0.77
Lys K 6.91
His H 11.00
Phe F 0.00
Tyr Y 3.07
Trp W 0.00
Pro P 3.07

 

47

Figure 8. Hydrophy profile of the deduced amino acid sequence for COR39.
The plots are according to Kyte and Doolittle (1978) using a window
of nine amino acid. Negative values indicated hydrophilicity.

48

u r...- «J
v

............ «any ........... in“

II!-

 

L-.. -...l.4..
34.4%....1... 3....-. -..murl-firun<wi...: LB
- - . .

XWDZ— U_=.—.<m0~—Q >1

AMINO ACID RESIDUE NUMBER

Figure 8

49

Figure 9. The repeating units of car39. KR: lysine-rich repeat ([111]).
GR: glycine-rich repeat (1]). The lysine-rich and glycine-rich reats
are numbered as in Fig.6.

50

 

 

FlflIHB—lllll—::iflfllflflflfl[ llllllllllllllll-lllllllllllllll‘ —W

KRI GRI KR2 GR2 GR3 KR3 GR4 KR4 GRS KR5 6R6 KR6

 

 

 

 

 

Lysine-rich Repeat

KRl AGEKKGIMEKIKEKLPGGH

KRZ AGEKKGVMENIKDKLPGGH

KR3 TGEKKGLMENIKEKLPGGHGDHQQTAG

KR4 GTGEKKGVMENIKDKLPGGHGDHQQTGG

KRS GTGEKKGVMENIKEKLPGGHGDHQQTGG

KR6 GEKKSLMDKIKDKLPGQH

Glycine-rich Repeat

GRl GGAYGQQGHAG

GR2 GGHYGQQGHAGTATHGTPATAGTY

GR3 GTYGQQGHTGTATHGTPATGGTY

GR4 GTYGQQGHVGTGTH

GRS GGTYGQQGHTGTATHGTPAGGGTYEQHGHTGMTGTGT
GGAYGQQGHTGTATHGTPAGGGTYGQHATGMTGTET

GR6

Figure 9

 

51

Table 2. Comparison of lysine-rich repeat of COR39,
COR47 and Lea proteins.

 

 

Polypeptide Lysine-rich Repeat

COR39 KRl ' AGEKKGIMEKIKEKLPGGH
KR; AGEKKGVMENIKDKLPGGH
KR3 TGEKKGLMENIKEKLPGGHGDHQQTAG
KR4 GTGEKKGVMENIKDKLPGGHGDHQQTGG
KR5 GTGEKKGVMENIKEKLPGGHGDHQQTGG
KR6 GEKKSLMDKIKDKLPGQH

COR47 EDKKGLVEKIKEKLPGHHD

Bl7 RRKKGLKDKIKEKLPGGHGD

318 RRKKGIKEKIKEKLPGGHGD

RABZl RRKKGIKEKIKEKLPGGNK

Conserved Cons nsus
Sequence KKGB-XZIKXKLPGGH

 

*nonstandard abbreviations: B,I/L/V; X,E/D; Z,K/N.

52

Talbe 3. Comparison of the glycine-rich repeat of COR39,
RABZl, and barley dehydrin B17 and 818.

 

Polypeptide Glycine-rich Repeat

 

COR39 GRl GGAYGQQGHAG
GRZ GGHYGQQGHAGTATHGTPATAGTY
GR3 GTYGQQGHTGTATHGTPATGGTY
GR4 GTYGQQGHVGTGTH
GR5 GGTYGQQGHTGTATHGTPAGGGTYEQHGHTGMTGTGT
GR5 GGAYGQQGHTGTATHGTPAGGGTYGQHATGMTGTET
B17 GGTYGQHGHTGMTGTG
GGTYGQQGHTGMTGT
B18 GYGQQGTGMAGT
GGTYGQQGHTGMTGMGA
GTYGQQGHTGMAGTGA
GGTYGQQGHTGMTGTGM
GGTYGQQGHTGMTGTGM
RABZl GGAYGQQGHGTGMTTGT

Conserved Consensus G-YGQQGH--
Sequence

 

53

Figure 10.Time course of accumulation of car39 transcripts in plants treated with
low temperature (2' C): A, 0 hour, B, 2 hours; C, 4 hours; D, 6 hours;
E, 8 hours; F, 10 hours; G, 12 hours; H, 24 hours. 15 ug of total RNA
was fractionated on a formaldehyde agarose gel, transferred to a
Nytran membrane and hybridized with 32P-labeled pWGl insert.

 

 

 

 

 

 

 

-—~u"’

ABCDEFGH

“.mr—we wand-”M'- 4-”..-- ..._.-.... ___. ’_. --. ._.. . . - - —- - 1 .

 

Figure 10

55

orientation (pWGl) yielded major polypeptides of about 48 and 47 kD that were boiling-
stable and had p15 of approximately 7.5 (Figure 7a). In vitra transcription/translation of
pWG2 did not yield any translation products (data not shown). In vitra translation of poly
(A+) RNA isolated from cold acclimated plants also result in the synthesis of 48 and 47 kD
boiling-stable polypeptides with pIs of about 7.5 (Figure 7b). Presumably these are the
same polypeptides detected in the in vitra transcription/translation reaction of pWG 1. Thus,
it would appear that pWGl has the entire open reading frame for the gene it represents. This
gene was designated car39 and the polypeptide it encodes, COR39.

Analysis of COR39

The COR39 polypeptide is glycine-rich (27%), and contains a high proportion of '
threonine (16%) and histidine (11%). but neither cystine nor tryptophan (Table l). The
hydropathy profile of the polypeptide indicates it is hydrophilic (Figure 8), the mean
hydropathic index of the polypeptide is -1.1. The majority of COR39 is composed of two
repeating sequences (Figure 6 and 9). The first is a lysine-rich sequence designated KR, that
occurs six times. The repeat is imperfect with variation in amino acid composition and
number. Nearly identical lysine-rich repeats occur in COR 47 (Gilmour et al., 1991) and
the group II family of LEA proteins (Dure et al., 1989). In Table 2, the lysine-rich repeat
of COR39, COR47, the RAB21 LEA protein of rice (Mundy and Chua, 1988) and the B 17
and B18 dehydrins of barley (Close er al., 1989) are presented. A comparison of the
sequence indicates a conserved consensus sequence of KKG(I/LV)-(E/D)(K/N)IK(E/
D)KLPGGH.

The second amino acid repeat in COR39, designated GR, is glycine-rich (Figure 6 and
9). It too is an imperfect repeat, varying in sequence length and composition. Closely
related glycine-rich repeats occur in the barley dehydrins and LEA protein RAB21 (Table

3). A comparison of these sequences indicates a conserved consensus sequence of G-

YGQQGH.

A TFASTA search of the GenBank/EMBL database (release 68.0 June, 1991 ), resulted
in barley dehydrin B17 having the highest score for sequence similarities with COR39
while the barley dehydrin B 18 comes in second. Other LEA proteins were also on the list.
No proteins other than LEA proteins were found to have significant sequence similarity
with COR39. '

56

Figure 11.Time course of deaccumulation of car39 uanscripts in plants transferred
back to normal growth temperature (deacclimated) after treatment at 2° C
for 3 days. A, plants treated at 2° C for 3 days; B, deacclimated for 2 hours;
C, deacclimated for 4 hours; D, deacclimated 6 hours; B, deacclimated for
8 hours; F, deacclimated 10 hours; G, deacclimated 12 hours; H,
deacclimated for 1 day; Ideacclimated for 1 week. 15 ug-of total RNA
was fractionated on a formaldehyde agarose gel, uansferred to
a Nytran membrane and hybridized with 32P-labeled pWGl insert.

57

ABCDEFGHI

 

Figure 11

58

Figure 12. The effect of temperature treatment on accumulation of car39 transcripts
in plants. A, Plants were grown at 20' C for two weeks; B-F, plants were
treated at 18, 16, 14, 12 and 2' C, respectively, for one week. 15 ug of total
RNA was fractionated on a formaldehyde agarose gel, transferred to
a Nytran membrane and hybridized with 32P-labeled pWGl insert.

59

ABCDEF

 

Figure 12

Figure 13. Tissue specificity of car39 transcripts accumulation in plants
cold acclimated at 2 ' C for 1 week. A and B, cold acclimated roots
(two independent experiments); C, nonacclimated roots; D and E,
cold acclimated crowns (two independent experiments); F, non-acclimated
crowns; G and H, cold-acclimated leaves (two independent experiments);
I, nonacclimated leaves. 15 ug of total RNA was fractionated on
a formaldehyde a arose gel, transferred to a N ytran membranes and
hybridized with -labeled pWGl insert.

61

ABCDEFGHI

   

Figure 13

62

Figure 14. Genomic Southem analysis of car39. A, genomic DNA was
digested with EcoRI; B, Genomic DNA was digested with BamHI.
20 ug of genomic DNA fractionated on a 1% agarose gel, transferred
to a Nytran membranes and hybridized with 32P-labeled pWGl insert.

 

63

Figure 14

 

.103

Figure 15. Accumulation of car39 transcripts by ABA treatment. A, plants
cold-acclimated at 2' for 3 days; B, control plants; C, plants treated with
ABA for 2 hours; D, plants treat with ABA for 4 hours; B, plants treated
with ABA for 6 hours; F, Plants treated with ABA for 8 hours. 15 ug of
total RNA was fractionated on a formaldeh de agarose gel, transferred to
a Nytran membrane and hybridized with 3 P-labeled pWGl insert.

65

ABCDEF

 

Figure 15

66

Figure 16. Accumulation of car39 transcripts by drought stress treatment.
A, control plants (relative water content 93%); B, water-Stressed plants
(relative water content 55%); C, plants cold-acclimated at 2°C for 3 days.
15 ug of total RNA was fractionated on a formaldehyde agarose gel,
transferred to a N ytran membrane and hybridized with 32P-labeled pWGl
insert.

67

 

Figure 16

68

Figurel7. Northern analysis of car39 transcripts in fresh dry seed and seedlings of
T. acesrivum cv Augusta. A, fresh dry seed: B, seedlings after 3 day
germination; C, acclimated leaves of Winoka (2' C, one week). 15 ug of
total RNA was fractionated on a forrnaldeh de agarose gel, transferred to
a Nytran membrane and hybridized with 3 P-labeled pWGl insert.

69

 

Figure 17

Expression of car39 in Response toyiow Temperature

Northern analysis (Figure 10) indicated that car39 transcripts started to accumulate after
wheat plants had been treated with low temperature (2 ' C) for 2 hours, and that they
continued to increase in concentration up to about 12 hours. The car39 transcripts remained
at high levels for as long as the plants were kept at low temperature (up to three weeks,
Figure 3). When cold acclimated plants were transferred back to normal growth
temperature for 2 hours, the level of the car3 9 transcripts markedly decreased and by about
4 hours they returned to that of nonacclimated plants (Figure 11). The threshold
temperature at which car39 transcripts markedly increased was 12° C (Figure 12). cor39

transcripts were detected in roots, crowns and leaves of acclimated plants (Figure 13).
Southern Analysis

Hybridization of the pWGl insert with a Southern blot of total genomic wheat DNA
resulted in the detection of multiple bands (Figure 14). These data indicated that either

car39 or related genes were present at multiple copies in the wheat genome.
Expression of car39 Gene in Response to ABA and Water Stress

It has been reported that exogenous application of ABA at normal growth temperature
can result in increased freezing tolerance in many plants including wheat and rye (Chen and
Gusta, 1983; Cloutier, 1983; Lang et al., 1989). Therefore, it was of interest to determine
whether the expression of car39 responded to ABA. The data indicate that it did (Figure
15): car39 mRNAs accumulated in plants sprayed with 100 uM of ABA solution for two
hours and remained at the some level of accumulation after 8 hours after the spray, even the
levels of accumulation decreased after 6 hours treatment. The level of car39 transcripts in
the ABA treated plants, however, was much lower than that in cold acclimated plants

(Figure 15). Four independent experiments were conducted with similar results.

The expression of car39 was also responsive to drought stress (Figure 16). When the
relative water content of plants fell to about 55%, the level of car39 mRNAs increased
dramatically.

71

car39 Transcripts in Fresh Dry Seed

Transcripts of lea genes accumulate to a high level in late embryo development and
remain at high levels in fresh dry seeds (Dure et al., 1989). Therefore, it was of interest to
determine if car39 transcripts were also present at high level in fresh dry seeds. Because I
did not have fresh dry seed for winter wheat Winoka, I isolated total RNA from fresh dry
Seeds (about one month after harvest) of Augusta, another winter wheat variety. In addition,
RNA was isolated from the seedlings of these seeds after germination for three days. The
result of Northern analyses indicate that cor39 transcripts that accumulated upon cold
acclimation were not present at high level in fresh dry seed, but that transcripts of about 1.3

kb werepresent. The transcriptsdecreaseddramatical lyafterthreedaysof germination.

Discussion

The amino acid sequence of COR39 was deduced from the nucleotide sequence of the
car39 cDNA clone pWGl. The sequence data indicate that COR39 is related to Group II
LEA proteins, and like LEA proteins, COR39 is hydrophilic and boiling-stable. COR39 has
the lysine rich repeats that the Group II LEA proteins have (Dure et al.,1989). In addition,
COR39 has the glycine-rich semi-conserved repeats which the barley dehydrins 818 and
B 17 have (Close et al., 1989). Also, COR39, like the LEA proteins and dehydrins, is
responsive to both ABA and droughts stress. However, COR39 has features which are
different from LEA proteins and dehydrins. First, it does not have a seven residue serine
cluster which all the Group II LEA proteins have. It is reported that the serine cluster is the
site for protein phosphorylation of LEA protein RAB 17 (Vilaardell et al., 1990). Second,
COR39 has six lysine-rich repeats while all the LEA proteins including the dehydrins from
barley and maize, and the salt-stress related polypeptides TAS 14 of tomato (Godoy et al.
1990) have only two lysine-rich repeats. Interestingly, COR47, the cold-regulated
polypeptide from Arabidopsis, has at least three lysine repeats (Gilmour er al, in press).

Given the common features that COR39 shares with LEA proteins, the question is raised
whether COR39 has the same function as LEA proteins and dehydrins. The role of LEA
proteins is unknown, but they are hypothesized to help cells tolerant water stress (Close et
al., 1989; Dure et al., 1989). Interestingly, it is known that extracellular ice formation

causes cell dehydration. Thus, freezing tolerance must include water-suess tolerance.

 

72

Indeed, it has been reported that water stress can increase the freezing tolerance of certain
plants including wheat and rye (Cloutier,1983). It therefore seems reasonable to
hypothesize that freezing and drought tolerance might involve related genetic mechanisms
and gene products. These gene products, which are very hydrophilic polypeptides, all might
have the general function of protecting cells from water stress, no mater whether the water
stress is from freezing or drought stress. The expression of these genes may be regulated
by a common signal warning of water stress. This signal could be ABA, since ABA
increases in water-stressed plants (Close et al., 1989; Dure et al., 1989) and it has been
reported that ABA can increase the tolerance of plants to both drought and freezing su'ess
(Chen and Gusta, 1983; Cloutier, 1983; Lang et al., 1989). Further, ABA can induce the
expression of these water-stress or cold-regulated genes. However, the car and lea gene
products may also have specific role in freezing tolerance or desiccation stress such as that
occurs during embryogenesis. More studies about the function and regulation of the COR

and LEA polypeptides are required in order to better understand their relationship.

The 1.3 kb transcript, which is present in the fresh dry seeds but not in the cold acclimated
plant, can originate from car39, representing different sites of transcript initiation or
different processing events. Alternatively, they can be also transcribed from gene related to

car39. Additional experiment will be required to distinguish between these possibilities.

The levels of car39 transcripts decrease after 6 hours ABA treatment compared to the 2
hours ABA treatment. The possible explanation is ABA level in plant decreases after 6
hours treatment, because ABA is easy to be metabolized in plants.

car39 transcripts were found to accumulate when plants were treated at 12° C for three
weeks, but the level of accumulation was much lower than in plants treated at 2° C (Figure
12). Interestingly, plants gained some freezing tolerance when they were treated at 12 ° C
(Figure 1), but the freezing tolerance was much weaker when compared to that of plants
treated at 2° C. These results suggest the possible positive correlation of the level of
acclimation of car39 transcripts with level of freezing tolerance. However, there is no such
correlation in the early stage of cold acclimation. It should be noted that the accumulation
of car39 transcripts starts after the plants have been treated with low temperature for four
hours and that accumulation reaches a peak after one day (Figure 10). At this early stage

the accumulation of these transcripts is not correlated to freezing tolerance; the freezing

73

tolerance increases only from -5°C to -8° C after one week of 2‘ C treatment, while three
weeks of treatment increases the freezing tolerance from -5° C to - 14° C. One possible
explanation could be that although the transcripts are accumulating with hours of cold
treatment, the gene products might take days to accumulate. We do not know if COR39 is
synthesized in viva with similar kinetics to its transcripts. We also do not know if there is
any translational or posttranslational control of these genes. Further, cold acclimation is a
very complex process, involving molecular, biochemical, and physiological changes. The
COR proteins may play critical roles in freezing tolerance, but other biochemical and
physiological changes, that develope slowly, might also be required for attain maximum
freezing tolerance. Studies directed toward determining the exact function of the COR

proteins and their relationship to low temperature survival are needed.

The COR39 open reading frame encodes a polypeptide of molecular weight 39.1 kD,
pI=7.48. Thus, there is an 8 kD difference between the molecular weight deduced from the
pWGl sequence and that predicted from its mobility in SDS-PAGE. It has also been
reported in other LEA proteins that there is a difference between the molecular weight data
deduced from DNA sequence and that predicted from the mobility in SDS-PAGE. For
RAB21, the predicted molecular weight from SDS-PAGE is 21 kD, while the deduced
molecular weight is 16.5 kD (Mundy and Chua 1988). For RAB 17, the apparent molecular
weight is 23 kD, while the deduced molecular weight is 16.5 kD. TAS 14 is a cDNA clone
isolated from tomato that represent a gene that responds to salt stress and ABA but not low
temperature (Godoy et al., 1990). Its deduced polypeptide sequence indicates it is related
to Group II LEA protein. Its apparent molecular weight in SDS-PAGE is 16 kD while its
deduced molecular weight is 13.9 kD. In all of these cases, the proteins are very
hydrophilic. Perhaps this biophysical feature explains why they all have a difference
between the deduced molecular weight and predicted molecular weight on SDS-PAGE.

74
List of References

Chen PM, Li PH (1977) Induction of frost hardiness in stem cortical tissues of Camus
stalanifera Michx. by water stress H. Biochemical changes. Plant Physiol 59:240-243

Chen HH, Li PH (1982) Potato cold acclimation. In Li PH. Sakai A.eds. Plant Cold
Hardiness and Freezing Stress. Vol 2. Academic Press. New York, pp 5-22

Chen TH, Gusta L (1983) Abscisic acid-induced freezing resistance in cultured plant cells.
Plant Physiol 73:71-75 '

Close TJ, Kortt AA, Chandler PM (1989) A cDNA-based comparison of dehydration-
induced proteins (dehydrins) in barley and corn. Plant Mol Biol 13:95-108

Cloutier Y (1983) Changes in the electrophoretic patterns of soluble proteins of winter
wheat and rye following cold acclimation and desiccation stress. Plant Physiol 71:400-403

Dure L III, Crouch M, Harada J, Ho THD, Mundy J, Quatrano R, Thomas T, Sung ZR
(1989) Common amino acid sequence domains among the LEA proteins of higher plants.
Plant Mol Biol 12:475-486

Kyte J, Doolittle RF (1982) A simple method for displaying the hydropathic character of
protein. J Mol Biol 157:105-132

Gilmour SJ, Hajela RK, Thomashow MF (1988) Cold acclimation in Arabidopsis thaliana.
Plant Physiol 87:745-750

Gilmour SJ, Artus N, Thomashow MF (1991) cDN A sequence analysis and expression of
two cold-regulated genes of Arabidopsis thaliana. In press

Godoy JA, Pardo JM, Pintor-Toro JA (1990) A tomato cDNA inducible by salt stress and
abscisic acid: nucleotide sequence and expression pattern. Plant Mol Biol 15:695-705

Guy CL (1990) Cold acclimation and freezing stress tolerance: role of protein metabolism.
Annu Rev Plant Physiol Plant Mol Biol 41: 187-223

Hahn M, Walbot V (1989) Effects of cold-treatrnent on protein synthesis and mRN A levels
in rice leaves. Plant Physiol 912930-938

Hajela RK, Horvath DP, Gilmour SJ, Thomashow MF (1990) Molecular cloning and
expression of car (cold-regulated) genes in Arabidopsis thaliana. Plant Physiol 93:1246-
1252

Lang V, Heino P, Palva ET (1989) Low temperature acclimation and treatment with
exogenous abscisic acid induce common polypeptides in Arabidopsis thaliana (L.) Heynh
Theor Appl Genet 77:729-734

Lin CT, Guo WW, Everson E, Thomashow MF (1990) Cold acclimation in Arabidopsis and

p 75
wheat. Plant Physiol 94:1078-1083

Levitt J (1980) Response of plants to environmental stress. Chilling, freezing and high
temperature stresses. 2nd ed, Academic press, New York.

Mohapatra SS, Wolfraim L, Poole RJ, Dhindsa RS (1989) Molecular cloning and
relationship to freezing tolerance of cold-acclimation-specific genes of alfalfa. Plant
Physiol 89:375-380

Mundy J, Chua N-H (1988) Abscisic acid and water stress induce the expression of a novel
rice gene. EMBO J 7:2279-2286

Pearson WR, Lipman DJ (1988) Improved tools for biological sequence comparison. Proc
Natl Acad Sci USA 85:2444-2448

Pirkoqaki D, Schneider, K Salamini F, Bartels D (1990) Characterization of five abscisic
acid-responsive c DNA clones isolated from the desiccation-tolerant plant Creterastigma
plantagineum and their relationship to other water-stress genes. Plant Physiol. 94:1682-
1688 '

Poole RJ, Dhinsda RS (1988) Abscisic acid-regulated gene expression in relation to
freezing tolerance in alfalfa. Plant Physiol. 87:468-473

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating
inhibitors. Proc Natl Acad Sci USA 74:5463-5467

Sambrook J, Fritsch EF, Maniatis T(l989) Molecular Cloning. A laboratory manual, Ed 2.
Cold Spring Harbor Laboratory, Cold Spring Harbor, Mew York

Siminovitch D, Cloitier Y (1983) Drought and freezing tolerance and adaptation in plants:
Some evidence of near equivalences. Cryobiology 20:487-503

Thomashow MF, Gilmour SJ, Hejela R, Horvath D, Lin, C, Guo W (1990) Studies on cold
acclimation in Arabidopsis thaliana. Horticultural biotechnology, pp 305-314. Mley-Liss,
Inc.

Thomashow MF (1990) Molecular genetics of cold acclimation in higher plants. Adv Genet
28:99-131

Vieira J, Messing J ( 1987) Production of single-stranded plasmid DNA. Meth Enzymol
15323-1 l
Vilaardell J, Groday A, Freire MA, Torrent M, Martine ZC, Torne JM, Pages M (1990)

Gene sequence, developmental expression, and protein phosphorylation of RAB- 17 in
maize. Plant Mol Biol 14:423-432

“Wilbur WJ, Lipman DJ (1983) Rapid similarity searches of nucleic acid and protein data
banks. Proc Natl Acad Sci USA 80:727-730

Appendix

teem“?!

Appendix
Correlation of Wheat Freezing Tolerance with Expression of Cold-

Regulated (car) Genes.

In order to determine whether there was a relationship between freezing tolerance and
the expression of cold-regulated (car) genes, I exam car39 expression in another winter

wheat variety, Genesee, and two spring wheat varieties. All the experiments were

 

conducted in the same way as described as Chapter II. The following are some preliminary

results:

1. Comparison of Freezing Tolerance of Different Varieties:

 

 

 

LT50
Variety ----------
20' Cl 12°C2 2° C3
Winoka -5° C -10° C -l4° C
Genesee -5° C -7° C -11°C
Spring wheatl (SI) ~ ~ ~
Spring wheatz (S2) -5°C ~ -9° C

 

“~” did not test. 1, nonacclimated plants; 2, plants were cold-acclimated at 12° C for 3

weeks; 3, plants were cold acclimated at 2° C for three weeks.

Among the three varieties I tested, Winoka was the most freezing tolerant, Genesee was

next, and Spring wheatz was third.

76

77
2. Changes in Gene Expression Associated with Cold Acclimation.

Experiments were performed to determine whether the transcripts encoding boiling-
stable polypeptides accumulated during cold acclimation. The data indicate that they do
(Figure 18). However, at 12' C, the accumulation of these polypeptides were stronger in
Winoka than in Genesee (Figure 18, Lanes A and C). At 12' C, the levels of these boiling-
stable polypeptides were not markedly increased in Spring wheat}. At 2°C, the levels of
these boiling-stable proteins in Winoka were higher than that in Genesee and Spring
wheat1(Figure l8, Lanes B, D, F, H, J). At both 12 and 2' C, in both Genesee and Spring

wheat, there was no, or very low, accumulation of the 180 kD cold-induced boiling-stable
polypeptide.
3. Northern Analysis

Similar to the cold-induced boiling-stable polypeptides, at 12°C, the levels of car39
transcripts were much higher in Winoka than that in Genesee (Figure 20, Lanes G and I).
For Spring wheat], there was very low accumulation of car39 transcripts (Figure 20, Lane
C). At 2° C, the levels of car39 transcripts in winoka was much higher than that of Genesee,
Spring wheatl and Spring wheatz (Figure 20, Lanes B, D, F, H, J). Comparing Winoka and
the other three varieties, the major difference in the pattern of accumulation of can? 9
transcripts was the upper band (about 3.3 kb). The levels of the upper band of car3 9

transcripts were much lower than that of Winoka.
4. Discussion

Winoka is the most freezing tolerant variety among the three varieties tested, Genesee
is next and Spring wheatz is third; I did not test Spring wheat]. The data above indicate that
there is a possible positive correlation of accumulation of boiling-stable polypeptides,
accumulation of car39 transcripts and freezing tolerance. The major difference in the
pattern of accumulation of boiling-stable polypeptides between Winoka and the other three
varieties is the 180 kD polypeptide.The major difference in the pattern of accumulation of
car39 transcripts is in the upper band. The relationship of this upper band and the 180 kD
boiling-stable polypeptide is not known. It appears from these preliminary data that there
is a possible positive correlation between the freezing tolerance and the accumulation of

car39 transcripts, especially the upper bands. However, I did not collect these data

 

 

78

quantitatively. Therefore, more studies are needed in order to prove these correlations
Other Wheat car cDNA Clones Related to pWGl

I have used pWGl to screen the wheat cDNA library to isolate genes related to car39.
Five clones showed homology to pWGl. These clones were purified and analyzed further.

l.pG1:

The insert is about 0.8-1 kb The gene represented by this insert is cold-regulated. One
EcaRl site is lost in the polylinker of the plasmid; the insert can be cut out by EcaRI plus
BamHI.The two ends of this clone have been sequenced for 100-200 bp. The sequence data
showed that pWGl and p01 are not identical. .

2. pG2:

This clone contained three inserts, about 0.8, 0.7 and 0.6 kb. The gene represented by the
0.6 kb insert is cold-regulated, but not the other two inserts. The two ends of this clone were
sequenced for about 100 bp. The data showed that pWGl and pG2 are not identical.

3. pG4

DNA sequencing of the ends of pG4 and restriction analysis indicate that it is identical
to pWGl .

4. pGS and pG6

Both p05 and pG6 had two inserts of about 0.6 and 0.7 kb. The two inserts had some
common restriction sites. Probably p05 and pG6 are identical. The genes represented by
the two inserts in pG6 are cold -regulated. The inserts in p65 were not tested to see if they
represented cold-regulated genes.

Non of the experiments mentioned above were repeated.

79

Figure 18. SDS-PAGE analysis boiled products of in vitra translation products of
Poly (A+) RNA isolated from different varieties acclimated at
different temperatures. A, Genesee acclimated at 12°C for 3 weeks;
B, Genesee acclimated at 2° C for three weeks; C, Winoka acclimated at
12°C for 3 weeks; D, Winoka acclimated at 2' C for 3 weeks;
E, Spring wheat lacclimated at 12°C for 3 weeks; F, Spring wheat]
acclimated at 2°C for 3 weeks; G, Winoka grown at 20 ° C for 2 weeks
H, Winoka acclimated at 2°C for 3 weeks; 1, Spring wheat] grown at 20' C
for 2 week; I, Spring wheatl acclimated at 2°C for 3 weeks;

ABCD

80

EFGHIJ

kD

-200
-180

-48
-47

 

Figure 18

81

Figure 19. The effect of temperature treaunent on accumulation of car39 transcripts
in different varieties. A, Spring wheat grown at 20° C for 2 weeks;
B, Spring wheat 2 acclimated at 2°C for 3 weeks; C, Spring wheat 1
acclimated at 12°C for 3 weeks; D, Spring wheat lacclimated at 2°C for
3 weeks; E, Spring wheatl grown at 20° C for 2 week.; F, Spring wheat]
acclimated at 2°C for 3 weeks; G, Winoka acclimated at 12°C for 3 weeks;
H, winoka acclimated at 2° C for three weeks; I, Genesee acclimated at
12°C for 3 weeks; J.Gensee acclimated at 2° C for three weeks.

 

82

ABCDEFGHIJ

   

Figure 19

"11111111111111“