GENERATION, CHARACTERIZATION AND LEUKEMIA INHIBITORY FACTOR DEPENDENCY OF CANINE INDUCED PLURIPOTENT STEM CELL By Jiesi Luo A DISSERTATION Submitted to Michigan State University in partial fulfillments for the requirements for the degree of Animal Science — Doctor of Philosophy 2014 ABSTRACT GENERATION, CHARACTERIZATION AND LEUKEMIA INHIBITORY FACTOR DEPENDENCY OF CANINE INDUCED PLURIPOTENT STEM CELL By Jiesi Luo More than five decades of research in dogs has provided fundamental breakthroughs in human and veterinary medicine. Stem cell transplant has been put forward as one potential means of treating both human and canine injury; however, the use of therapeutic cellular transplantation in dogs has been hampered by a lack of knowledge of the characteristics of canine stem cells and difficulties in reproducibly isolating viable pluripotent cells of dog origin. To remedy this situation, I began a series of experiments aimed at producing induced pluripotent stem cells of canine origin (ciPSCs), comparing the properties of ciPSCs to pluripotent cell types of other species, determining the capacity of ciPSCs to give rise to multiple types of somatic tissue, and defining conditions for their continued growth. To begin, multiple primary fibroblast cell populations were derived from tissue samples taken from live adult donor dogs. After characterization of primary lines to select those with the best growth properties, fibroblasts were converted to ciPSCs by infection with high titers of recombinant retroviruses encoding the pluripotency-associated transcription factors OCT4, SOX2, cMYC, and KLF4. Infected cultures gave rise to colonies with the characteristics of pluripotent stem cell types within several weeks, and subcloned canine iPSCs lines were found to express genes and proteins characteristic of other mammalian pluripotent cells. Like iPSCs from other species, ciPSCs were also found to have silenced expression of the viral vectors used to induce pluripotency. Clonal ciPSC displayed normal karyotypes and DNA fingerprinting analysis confirmed that iPSCs were a match for the genome of donor dogs. After a shift to culture conditions favoring differentiation, ciPSCs were observed to give rise to cells of ectodermal, mesodermal, and endodermal identity. Unlike iPSCs from many species, however, it was found that ciPSCs required the continued presence of leukemia inhibitory factor (LIF) to survive in vitro. To further elucidate the role of LIF-specific signaling pathways in maintaining ciPSC viability, we performed a series of experiments that revealed that activation of the LIF-specific JAKSTAT3 pathway was critical for preventing ciPSC death. In summary, the project performed to complete this dissertation has produced an efficient method for the derivation of pluripotent stem cells from the dog and has defined many of the molecular pathways required for their derivation and continued maintenance in vitro. This work serves as the foundation for the development of cell-based therapies for disease and injury in dogs with tremendous potential to inform our understanding of similar treatments in future human patients. This dissertation is dedicated to my parents for their love, endless support and encouragement iv ACKNOWLEDGEMENTS I would like to thank: Dr. Jose Cibelli, for providing the support and resources for executing the experiments and for all the advice given throughout my program. My PhD committee members, Dr. Jason Knott, Dr. Gloria Perez, Dr. George Smith and Dr. Laura Nelson, for their assistance throughout the years and for invaluable lessons and advice. Dr. Steve Suhr, for all the assistance with molecular biology and for all of scientific and non-scientific discussions. Dr. Eun-Ah Chang, for teaching me the basic cell culture techniques and generous help for study and life. All the members of Cellular Reprogramming Laboratory, for their support and contributions on my way to becoming a scientist. Drs. Kai Wang and Ying Chen, for all the generous help at different times during my graduate study. Tak Ko and Gabriela Saldana, for their help with laboratory management. Dr. Vilma Yuzbasiyan-Gurkan, for her collaborative interaction and generous support of my career. v The Department of Animal Science, especially Kathy Tatro and Dr. Steve Bursian, for all their support during my PhD graduate study. The U.S Department of Agriculture, for sponsoring my graduate fellowship. The Morris Animal Foundation, for their generous support of our research. My parents, for their love, supports and encouragements to everything in my life. vi TABLE OF CONTENTS LIST OF TABLES ............................................................................................................ix LIST OF FIGURES .......................................................................................................... x KEY TO SYMBOLS OR ABBREVIATIONS.................................................................... xii CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW ........................................ 1 1.1 Regenerative Medicine .......................................................................................... 1 1.2 The Dog as a Model for Translational Medicine ..................................................... 2 1.3 Pluripotency and Stem Cells .................................................................................. 5 1.3.1 Mouse and Human Pluripotent Stem Cells ...................................................... 6 1.3.1.1 Induced Pluripotent Stem Cells ................................................................. 8 1.3.1.2 Characterization of iPSCs ....................................................................... 10 1.3.2 Canine Pluripotent Stem Cells ....................................................................... 11 1.3.3 Growth Factors and Associated Signaling Pathways in PSCs ....................... 12 1.3.4 Consequences of a Poor Understanding of Cell Survival in Canine PSCs .... 13 1.4 Rationale and Hypotheses ................................................................................... 16 CHAPTER 2: GENERATION OF LIF AND BFGF-DEPENDENT INDUCED PLURIPOTENT STEM CELLS FROM CANINE ADULT SOMATIC CELLS.................. 18 2.1 Abstract ................................................................................................................ 18 2.2 Introduction .......................................................................................................... 19 2.3 Material and Methods .......................................................................................... 21 2.3.1 Derivation of Canine Fibroblasts and Cell Culture ......................................... 21 2.3.2 Virus Construction and Production ................................................................ 22 2.3.3 Immunocytochemistry Assay ......................................................................... 22 2.3.4 RNA Extraction and Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) Analysis ................................................................................ 23 2.3.5 Bisulfite Genome Sequencing........................................................................ 23 2.3.6 Karyotyping Analysis ..................................................................................... 24 2.3.7 Microsatellite Assay ....................................................................................... 24 2.3.8 EB Formation ................................................................................................. 25 2.3.9 Terminal Deoxynucleotidyl Transferase dUTP Nick-end Labeling (TUNEL) Assay ...................................................................................................................... 26 2.3.10 5-Bromo-2-Deoxyuridine (BrdU) Incorporation Assay.................................. 26 2.4 Results ................................................................................................................. 32 2.4.1 Generation of ciPSCs .................................................................................... 32 2.4.2 Immunocytochemistry Assay ......................................................................... 39 2.4. 3 Pluripotency Gene Expression and Epigenetics ........................................... 42 2.4.4 Karyotype Analysis ........................................................................................ 48 2.4.5 Microsatellite Analysis ................................................................................... 50 vii 2.4.6 In vitro Differentiation ..................................................................................... 53 2.4.7 LIF and bFGF Dependency ........................................................................... 57 2.5 Discussion............................................................................................................ 61 CHAPTER 3: ROLE OF LEUKEMIA IHIBITORY FACTOR (LIF) DURING CULTURE OF CANINE INDUCED PLURIPOTENT STEM CELLS ...................................................... 66 3.1 Abstract ................................................................................................................ 66 3.2 Introduction .......................................................................................................... 67 3.3 Material and Methods .......................................................................................... 70 3.3.1 Cell Culture .................................................................................................... 70 3.3.2 Western Blotting Assay .................................................................................. 71 3.3.3 Terminal Deoxynucleotidyl Transferase dUTP Nick-end Labeling (TUNEL) Assay ...................................................................................................................... 72 3.3.4 Propidium Iodide Staining for Unfixed Cells ................................................... 72 3.3.5 Flow Cytometry Assay ................................................................................... 73 3.3.6 Statistical Analysis ......................................................................................... 73 3.4 Results ................................................................................................................. 76 3.4.1 Elucidate Signaling Transduction Pathways in ciPSCs Cultured in the Presence of LIF and/or bFGF. ................................................................................ 76 3.4.2 Functional Analysis of LIF-Responsive Pathways in ciPSCs. ........................ 78 3.5 Discussion............................................................................................................ 86 CHAPTER 4: CONCLUSIONS AND FUTURE DIRECTIONS ....................................... 91 4.1 Generation and Characterization of ciPSCs......................................................... 92 4.2 Elucidating the Roles of Growth Factors in ciPSC Maintenance .......................... 95 4.3 Reprogrammed Cells in Animal and Human Medicine ......................................... 97 APPENDICES ............................................................................................................... 98 APPENDIX A ............................................................................................................. 99 APPENDIX B ........................................................................................................... 101 BIBLIOGRAPHY ......................................................................................................... 103 viii LIST OF TABLES Table 2.1: Antibodies for immunocytochemistry assay.................................................. 27 Table 2.2: Primers designed for qRT-PCR .................................................................... 29 Table 2.3: Primers designed for canine NANOG and OCT4 promoter regions in bisulfite genomic sequencing ..................................................................................................... 31 Table 2.4: Genotypes for the iPSC cells using five canine tetranucleotide repeat microsatellites. .............................................................................................................. 51 Table 3.1: Antibodies used for western blotting assay .................................................. 74 ix LIST OF FIGURES Figure 2.1: Induction of ciPSCs from adult canine testicular fibroblasts ........................ 34 Figure 2.2: Lentiviral infected canine fibroblasts show YFP expression ........................ 35 Figure 2.3: Immunocytochemistry of human OCT4 and SOX2 after transduction ......... 36 Figure 2.4: LIF and bFGF dependency of ciPSCs ......................................................... 37 Figure 2.5: The ciPSCs derived from the second batch of donor fibroblasts ................. 38 Figure 2.6: Immunocytochemistry of ciPSCs................................................................. 39 Figure 2.7: Immunocytochemistry of DI-A1, DI-A2 and CTFs ....................................... 41 Figure 2.8: Gene expression of ciPSCs ........................................................................ 44 Figure 2.9: Validation of specificity of canine OCT4 primers for ciPSCs ....................... 46 Figure 2.10: Epigenetics analysis of ciPSCs ................................................................. 47 Figure 2.11: Karyotype analysis of ciPSCs ................................................................... 49 Figure 2.12: Differentiation of ciPSCs into ebs .............................................................. 54 Figure 2.13: Morphology and DNA staining of ciPSC-differentiated trophoblast cell-like cell ................................................................................................................................. 56 Figure 2.14: Role of LIF or bFGF in survival, proliferation, and pluripotency maintenance of ciPSCs ...................................................................................................................... 58 Figure 2.15: TUNEL assay for the DNAse-treated ciPSCs as the positive control ........ 60 Figure 3.1: Phosphorylation status of LIF-associated signaling pathways in ciPSCs maintained in the presence/absence of LIF/bFGF for three days .................................. 77 Figure 3.2: Effects of JAK, STAT3, AKT and ERK1/2 inhibitor (JAKi, STAT3i, AKTi and ERKi) on activities of different signaling transduction proteins in ciPSCs...................... 81 Figure 3.3: Morphological changes of ciPSCs treated with protein inhibitors ................ 82 Figure 3.4: Terminal deoxynucleotidyl transferase dutp nick end labeling (TNUEL) assay indicating the DNA damage of ciPSCs .......................................................................... 83 x Figure 3.5: Western blotting assays indicating the caspase-3/8 activation in ciPSCs ... 84 Figure 3.6: Propidium iodide (PI) staining assay in ciPSCs........................................... 85 Figure A1: Gene expression of differentiation markers in ciPSCs cultured in the presence or absence of LIF........................................................................................... 99 Figure A2: Comet assay indicating the extent of DNA damage in ciPSCs cultured under different conditions ...................................................................................................... 101 xi KEY TO SYMBOLS OR ABBREVIATIONS AFP alpha-fetoprotein bFGF basic fibroblast growth factor BrdU 5-bromo-2-deoxyuridine cESC canine embryonic stem cell ciPSC canine induced pluripotent stem cell CSF canine skin fibroblast CTF canine testicular fibroblast DMSO dimethyl sulfoxide EB embryoid body ECC embryonic carcinoma cell EGF epidermal growth factor EMA European Medicine Agency ESC embryonic stem cell FBS fetal bovine serum FDA Food and Drug Administration H2O2 hydrogen peroxide hESC human embryonic stem cell hiPSC human induced pluripotent stem cell HLA human leukocyte antigen ICM inner cell mass IGF insulin growth factor xii iPSC induced pluripotent stem cell JAK janus kinase LIF leukemia inhibitory factor LIFR receptor of leukemia inhibitory factor MEF mouse embryonic fibroblast mESC mouse embryonic stem cell miPSC mouse induced pluripotent stem cell MSC mesenchymal stem cell mTOR mammalian target of rapamycin NES nestin NIH National Institute of Health OKSIM OCT4, KLF4, SOX2, IRES and c-MYC OKSM OCT4, KLF4, SOX2 and c-MYC p38MAPK p38 mitogen-activated protein kinase PBS phosphate buffered saline PI propidium iodide PSC pluripotent stem cell qRT-PCR quantitative reverse transcription polymerase chain reaction SCI spinal cord injury SCNT somatic cell nuclear transfer SSEA stage-specific embryonic antigen STAT3 signal transducer and activator of transcription 3 TUNEL terminal deoxynucleotidyl transferase dUTP nick-end labeling xiii YFP yellow fluorescent protein xiv CHAPTER 1 INTRODUCTION AND LITERATURE REVIEW 1.1 Regenerative Medicine During the past decade we have witnessed the birth and exponential growth of the research field of regenerative medicine [1]. As described by the National Institutes of Health (NIH), the ultimate goal of regenerative medicine is to “replace, repair, and regenerate cells, tissues and organs in order to restore biological function that has been halted or compromised by injury or disease” [2]. A sine qua non requirement to achieve this goal is the availability of unlimited number cells of all types of the human body. Pluripotent stem cells (PSCs), having the capacity to self-renew and differentiate toward cell derivatives of the three-germ layers, are likely the most suitable for the task. The use of PSCs by multiple laboratories around the world over the last thirty years has facilitated the development of specific cell culture and differentiation techniques. The versatility of PSCs is such that they can develop into functional tissues and/or organs in vitro. This remarkable progress has brought the possibility of conducting preclinical experiments closer to reality. One of the most well-characterized PSCs are embryonic stem cells (ESCs). These cells, isolated from mouse and human preimplantation embryos, provide the basis upon which therapeutic strategies for diseases, previously thought to be incurable, are developed, however among the many hurdles that must be addressed before this type of therapy arrives to the clinic, is the problem of tissue immune-compatibility [3-7]. 1 Ideally, the cells should have identical human leukocyte antigen (HLA) types as the patient [8]. To address this issue, a variety of methods for generating autologous cells have been proposed, including somatic cell nuclear transfer (SCNT) into unfertilized oocytes and cell fusion. However, its low efficiency and generation of tetraploid cells respectively, have made their implementation problematic [9,10]. With the landmark discovery of induced pluripotent stem cell (iPSC) methodologies, mouse and human immuno-compatible cells can be produced in multiple laboratories using relatively simple protocols. An iPSC is a type of PSC generated by simply introducing a set of transcription factors, OCT-3/4, SOX2, KLF4 and c-MYC (OKSM or Yamanaka factors), into differentiated somatic cells [8]. iPSCs are morphologically similar to ESCs and share their differentiation potential as judged by teratoma formation and contribution to chimeric animals. To date, successful generation of iPSCs has been reported in species such as mouse, human, rat, rhesus monkey, cow and pig [8,11-14]. It is anticipated that within the next 5 to 10 years, new regenerative medicine treatments based on PSCs will reach the clinic, benefiting humans and animals alike. 1.2 The Dog as a Model for Translational Medicine Governmental regulatory agencies, such as the Food and Drug Administration (FDA) in the USA and the European Medicine Agency (EMA) in the European Union, have begun requiring more stringent preclinical testing for PSC-based therapies. It is anticipated that when iPSC-derived cells are contemplated for use in human patients, 2 other animal species – in addition to rodents-should be considered as models for cell transplantation. Lessons learned from canine medicine have extraordinary potential to inform our understanding of human diseases and uncover new therapeutic avenues for treatments. Compared to small animals such as rodents, dogs have a larger body size, a relatively long life span, organ relative positions, a diverse gene pool, and share many biochemical and pathological conditions with humans [15]. A large number of translational medicine studies have been performed in dogs quite successfully. More than five decades of research in dogs provided fundamental breakthroughs in human and veterinary medicine, particularly in the fields of bone marrow transplantation, metabolic diseases, neurological disorders, cancers and heart failure [15-17]. During the 1950’s Dr. Norman Shumway performed seminal studies in dogs that culminated with the development of heart transplantation techniques that are today’s’ standard surgery practice in human [18]. A point example is the dog’s heart ventricular physiology and pathology that reflects the human’s more accurately than rodents. The dog’s heart mirrors the human’s time course of irreversible myocardial injury following ischemia, and it has facilitated the development of rescue treatments such as thrombolytic reperfusion [19]. These studies — among many others — established the foundation for current cardiovascular treatment guidelines during acute coronary syndromes [19]. Another unique feature of canine breeds is their genetic diversity, a product of thousands of years of breeding with human intervention, with the concomitant 3 development of mutations, many of them having a human equivalent, providing a great model to study human genetic disorders. To date, over 400 types of genetic diseases have been identified in dogs, half of them presenting similarity to those in human including cardiomyopathies, muscular dystrophy and prostate cancer [20,21]. An example of specific canine breed model that offers advantages over the mouse is the dog model of spinal cord injury (SCI). Up to 2% of the dogs admitted to the hospital arrive with SCI, 77% of them due to intervertebral disc diseases [22,23]. Chondrodystrophic dogs are particularly susceptible, suffering from SCI following spinal hyperesthesia, non-ambulatory hind limb paraparesis, and complete hind limb paralysis [22-25]. Surgical palliative treatment is a standard therapeutic option in veterinary medicine and protocols for cell transplantation have already been developed. It is expected that this model of SCI in particular will facilitate the testing of more ambitious strategies to cure SCI with a variety of cell types, including iPSCs [24,26]. The application of stem cells to treat conditions in the dog for which there are few, if any effective therapies, and that would ordinarily lead to life-long disability, or a significant impact on quality of life, would not only tremendously benefit the animal recipient, but would also provide us with knowledge to develop parallel treatments in human patients. As such, our long-term objective is to establish the platform for generation, differentiation and transplantation of canine iPSCs (ciPSCs) that would eventually allow us to establish the safety and efficacy of autologous iPSCs in a nonrodent model of human disease. Our short-term goal is to determine the specific requirements for derivation and maintenance of ciPSCs. This particular section of our work has already been published and subsequently replicated by others [27-30]. We 4 should mention that before our publication on ciPSCs in 2011, there was only one report describing ciPSC generation by Shimada et al [31,32]. However, the briefness and lack of details in their description of ciPSC generation and characterization rendered their work almost irrelevant. We also performed an in depth characterization of the growth factor dependency of ciPSCs and concluded that leukemia inhibitory factor (LIF) and basic fibroblast growth factor (bFGF) are both required for maintaining the expression of pluripotency markers in ciPSCs. We also noticed that only LIF is essential for survival of ciPSCs [31]. This observation informed our subsequent experimental design. While our long-term goal remains unchanged, we realized that in order to succeed in differentiating ciPSCs for cell therapy purposes, LIF, the most important cell survival factor, must be removed from the media likely triggering cell death. In lieu of this unanticipated roadblock, we decided to carefully analyze the intracellular signaling pathways active in pluripotent ciPSCs in the presence or absence of growth factors, as well as the different mechanisms of cell death activated in ciPSCs. 1.3 Pluripotency and Stem Cells Pluripotency is defined as “the capacity of individual cells to initiate all lineages of the mature organism in response to signals from the embryo or cell culture environment” [33]. Studies on cellular self-renewal and pluripotency date back to the work of Dr. Hans Driesch in 1895 on sea urchin embryos [34]. During the 1960s, Pieces et al firstly reported the isolation of embryonic carcinoma cells (ECC) from a testicular teratocarcinoma isolated from a mouse of the 129 strain [35]. ECCs could be induced to 5 differentiate spontaneously into multiple somatic cell lineages in vitro, and when injected into a host embryo, contribute to several tissues in the chimeric pups. However, frequent karyotyping abnormalities, loss of differentiation capability, uneven distribution of differentiated ECCs, and occasional lethality to fetuses due to uncontrollable tumor formation were frequently observed and limited their practical applications [35-38]. Nonetheless, ECCs provided crucial experimental data that would later inform how to derive ESCs from preimplantation embryos. In 1981, two independent groups reported the isolation of mouse ESCs (mESCs) using mouse embryonic fibroblasts (MEFs) as feeder layers or ECC-conditioned medium [39,40]. These cells shared some of the characteristics of ECCs, such as colony morphology, self-renewal capability, expression of cell surface antigens, gene expression profiles and capacity to differentiate into somatic cell types derived from three-germ layers in vitro and in vivo. More importantly, ESCs had normal karyotypes and better contributed to chimeras, quickly becoming an ideal cellular model of cell differentiation [39]. Another seminal breakthrough took place in 1998 when human ESC lines were established for the first time from human blastocysts, providing another essential tool to study human development [4]. Almost in parallel, several groups began to explore the possibility of using human ESCs (hESCs) in the context of regenerative medicine [4,41]. 1.3.1 Mouse and Human Pluripotent Stem Cells In the mouse, ESCs are derived from the inner cell mass (ICM) of pre-implantation blastocysts [39]. Under in vitro culture conditions, a colony of mESCs will form a dome- 6 shaped 3-D structure, a characteristic that set them apart from mouse ECCs. In terms of cell surface markers, mESCs display a type of glycosphingolipids called Stage-Specific Embryonic Antigens-1 (SSEA-1), originally identified in mouse preimplantation embryos [42]. At the gene and protein expression levels, mESCs express essential core of transcription factors — OCT4, SOX2 and NANOG — that regulate and maintain pluripotency [43]. The leukemia inhibitory factor (LIF), is specifically required to sustain the expression of the core transcription factors [44]. Human ESC lines were first isolated using procedures similar to the mouse. However, they have unique characteristics that make them different from mESCs [4]. Morphologically, they resemble cells from the epiblast in post-implantation blastocysts, unlike the mouse that are more ICM-like cells. They grow in a tightly adherent, flattened monolayer, instead of the typical mouse ESC dome-shaped colony. Finally, they show poor resistance to trypsin cell-dissociation treatments [45]. Similar to mESCs, hESCs express the same core of pluripotency-associated transcription factors, OCT4, SOX2 and NANOG. However, at the global transcription level, hESCs share only (depending on the study) between 13% to 55% of the transcripts expressed in mESCs [46]. In terms of pluripotency markers, hESCs express SSEA-3, SSEA-4 and tumor rejection antigens including TRA-1-60 and TRA-1-81, but not SSEA-1 [47,48]. Perhaps the most striking difference between mouse and hESCs is that the later require basic fibroblast growth factor (bFGF) instead of LIF as the main growth factor for pluripotency maintenance [4]. 7 1.3.1.1 Induced Pluripotent Stem Cells Mouse iPSCs (miPSCs) were initially derived in 2006 by Shinya Yamanaka’s group by overexpressing exogenous Oct4, Sox2, Klf4 and c-Myc (OSKM) in embryonic and adult fibroblasts [8]. In humans, the first report was published in 2007 by the same group, almost at the same time as Dr. James Thomson’s group reported human iPSCs (hiPSCs)using different reprogramming factors, i.e. OCT4, SOX2, LIN28 and NANOG [49,50]. Since then, modifications have been introduced to the original protocol to avoid the risk of tumorigenesis. Specifically, the proto-oncogene c-Myc was first replaced with v-Myc and subsequently dropped from the cocktail altogether [51]. In subsequent protocols, Klf4 and Sox2 were proven dispensable, albeit requiring the use of a specific type of target cell and to the detriment of efficiency of cell conversion into iPSCs [51,52]. The technique is robust and simple, allowing multiple laboratories around the world to replicate the results. Since first reported, a vast body of literature has been published describing an array of new genes and delivery methods capable of reprogramming cells into iPSCs, including the use of retrovirus, lentivirus, adenovirus, transposons, episomal vectors, mRNAs, and microRNAs [8,49,50,53-66]. The addition of small molecule inhibitors has been proven efficacious in conjunction with other reprogramming protocols. In the mouse, these include inhibitors targeting certain pathways (MEK inhibitor PD0325901 or glycogen synthase kinase3 inhibitor CHIR99021) or epigenetic modifiers (DNA methytransferase inhibitor 5’-AZA, histone deacetylase inhibitor valproic acid or trichostatin A) [67-69]. The culture conditions and growth factor requirements for iPSCs, once the initial conversion into iPSC takes place, are the same as that for ESCs, i.e. LIF for mouse and 8 bFGF for human. In the human, however, when PD0325901, CHIR99021 and forskolin were used along with the Yamanaka factors, LIF-dependent naïve iPSCs that resemble miPSCs have been reported [70]. Perhaps the most promising methods developed thus far are those that call for the use of small molecules only, bypassing the need for any type of foreign recombinant DNA or RNA. A recent study shows that mouse fibroblasts can be reprogrammed into iPSCs by simply exposing the cells to a cocktail of small molecule inhibitors without overexpressing any exogenous transcription factors [71]. The core inhibitor in this methodology is DZNep, which blocks histone methyltransferase EZH2, significantly enhancing the expression of Oct4 in mouse fibroblasts. A variety of mouse and human somatic cells have been tested for the capacity to be reprogrammed, including embryonic and adult fibroblasts, neural stem cells, adipose-derived cells, cord blood cells, mesenchymal stem cells, B and T cells, and keratinocytes [8,49,50,52,61,72-75]. It appears that no somatic cell is incapable of reprogramming; however, some of them are more resistant to the process than others. For all practical purposes, dermal fibroblasts remain the main choice in both species. Despite this increase in the number of reprogramming strategies, at the time of this writing, the original protocols described by Yamanaka and Thomson’s groups using the culture conditions optimized for mESCs and hESCs continue to be the most reliable and the standard methods against which novel reprogramming schemes are tested. 9 1.3.1.2 Characterization of iPSCs Similar to ESCs, molecular markers, specific gene expression profiles and differentiation potential are used to characterize iPSCs. Karyotype analysis is of particular importance in iPSCs, since they divide rapidly and there is a tendency for abnormal duplication and distribution of chromosomes that may cause tumorigenesis and a loss of differentiation capability. Microsatellite genomic sequencing assays are commonly used to verify the identity of the iPSCs. Assessing the differentiation capability of iPSCs is as important as the presence of specific pluripotency-related markers. The most common in vitro method is embryoid body (EB) formation, in which iPSCs are cultured in non-adherent tissue culture plates in the absence of bFGF or LIF (human and mouse, respectively) for a short period, followed by two weeks of culture in tissue-cultured treated dishes in the presence of fetal bovine serum (FBS). Bona fide iPSCs should be capable of spontaneous differentiation and display markers representing the three germ layers, including ectoderm, mesoderm and endoderm [39]. The most common in vivo differentiation test is the teratoma formation assay. Initially used in mESC thirty years ago, the teratoma assay has become a routine test for human and mouse iPSCs [40]. Simply by injecting undifferentiated cells into immune compromised mice and allowing them to spontaneously grow and differentiate, 3-D structures representative of cells and tissues derived from the three germ layers can develop. The most informative differentiation test for miPSCs, though, is the chimera assay, in which undifferentiated cells are injected into a fertilized or, preferably, a tetraploid embryo, and further allowed to 10 develop to term in a surrogate female. The level of chimerism in the offspring is normally positively correlated with the pluripotency level of the injected cells [76-79]. 1.3.2 Canine Pluripotent Stem Cells The derivation of canine ESCs (cESCs) has been more difficult than previously thought, and only five groups have succeeded in establishing cESC or ESC-like cell lines from canine blastocysts. Some of the reported cell lines are no longer available [80-84]. All reports characterized canine ESC’s pluripotency using molecular markers and in vitro differentiation [80-84]. However, only one, by Vaags et al, showed convincing in vivo differentiation results [82]. In their study, cESCs displayed mixed cell morphology with 3-D dome-shape colonies and monolayer-like colonies. The cells expressed the core pluripotency markers, including OCT4, SOX2 and NANOG, and the surface markers SSEA-3, SSEA-4, and TRA-1-60 but without SSEA-1 expression, similar to the markers expressed by hESCs. The cESCs were capable of differentiation toward cell derivatives of the three-germ layers in vitro, and ,more importantly, they were able to differentiate in vivo when injected into the kidney capsule of immunedeficient mice. cESCs have also been efficiently differentiated into specific cell lineages, including endothelial cells, cardiac myocytes, hepatocytes, neural stem cells, and endodermal cells. A unique feature of cESCs that sets them apart from human and mESCs is the requirement of growth factors LIF and bFGF to maintain pluripotency. While the signaling pathways of LIF and bFGF in the mouse and human, respectively, have been characterized (see following section), little is known about the synergistic 11 functions of the two factors applied simultaneously to cells in vitro for pluripotency and survival maintenance. There has been a description of crosstalk between the survivalassociated signaling pathways regulated by LIF or bFGF: activation of both AKT and ERK1/2 can be triggered by LIF or bFGF. But in comparison, the activation of JAKSTAT3 signaling transduction axis is exclusively limited to the presence of LIF, not bFGF [85]. A more comprehensive characterization of LIF and bFGF pathways acting together in maintaining survival and pluripotency in ESCs/iPSCs is needed. 1.3.3 Growth Factors and Associated Signaling Pathways in PSCs In 1988, Austin Smith’s group reported that LIF was critical for maintenance of mouse ESC’s self-renewal [44]. LIF is a member of IL-6 family. Its LIF receptor is a heteromeric complex composed of two types of transmembrane proteins, the LIF receptor (LIFR) and the gp130. In the presence of these two components, LIF binds to LIFR. And the LIF receptor-associated tyrosine kinase, Janus kinase (JAK), phosphorylates Y765/812/904/914 of the intracellular domain of gp130 and Y976/996/1023 of LIFR, which further recruits and phosphorylates the signal transducer and activator of transcription 3 (STAT3) [85]. Phosphorylated STAT3 targets and promotes the expression of a variety of genes associated with pluripotency and survival, including c-Myc and Klf4. Besides maintenance of mESCs in a highly undifferentiated state in culture through STAT3, LIF can also activate the PI3 kinase/AKT pathway. Phosphorylation of AKT proteins can modulate the function of numerous substrates, including the mammalian target of rapamycin (mTOR), and elicit proliferation and 12 suppression of cell death [85]. LIF is also able to robustly activate the Ras/ERK1/2 canonical signaling cascade, triggering the phosphorylation of a series of early transcription factors, including c-Jun and c-Fos, which are critical for maintaining cell viability and proliferation [85,86]. Striking differences exist on signaling pathways involved in pluripotency maintenance between the mouse and human ESCs and iPSCs. Unlike mESCs, the activation of STAT3 is dispensable for hESCs’ pluripotency maintenance and survival, with bFGF required instead [87]. bFGF not only exerts its role on human PSCs directly, but indirectly through the feeder layer typically MEF, stimulating the release of activin-A (ActA) that in turn binds to the TGF-beta receptors in hESCs, triggering the activation of intracellular SMAD2/3 pathway. Phosphorylated SMAD2/3 positively modulates NANOG transcription, maintaining pluripotency [88]. In terms of cell survival, bFGF binds to its specific receptor and leads to the auto-phosphorylation and activation of PI3K/AKT and Ras/ERK1/2 signaling cascades, enhancing survival of hESCs [85,88]. The pro-survival role of bFGF via activating AKT and ERK1/2 pathways ubiquitously exists throughout all kinds of cell types [85]. 1.3.4 Consequences of a Poor Understanding of Cell Survival in Canine PSCs A fundamental aspect to consider when trying to understand survival of ESCs and iPSCs is whether these cells are undergoing any type of cell death that may be indicative of an inadequate in vitro culture system. 13 When cultured under normal conditions, hESCs undergo spontaneous apoptosis at a rate of 30%. This rate increases to 40% when hESCs are allowed to spontaneously differentiate in normoxic conditions [89,90]. Moreover, and in contrast with differentiated cells, both mouse embryos and mESCs cultured in vitro display hypersensitivity to DNA damage [91,92]. These observations support the notion that pluripotent cells generally seem to have to have a low tolerance to cellular stress and ultimately undergo cell death. We have made the observation that ciPSCs seems to have an increased susceptibility to cell death when LIF is removed from the culture medium (described in Chapter 2). This observation, coupled with the fact that two major types of cell death — apoptosis and necrosis — were previously reported in pluripotent stem cells prompted us to investigate further the mechanisms involved, with the short term goal of increasing cell viability [93,94]. Apoptosis, also known as programmed cell death, is characterized by morphological changes such as cell shrinkage, membrane blebbing, chromatin condensation, and nuclear/DNA fragmentation [95]. Apoptosis can be triggered by a number of different stimuli, such as direct DNA damage, oxidative stress, upregulation of a death receptor, developmental programming (during embryonic development) or infection by a pathogen [95]. Depending on the stimuli and the molecular pathways involved, apoptosis can be mitochondrial- or receptor-mediated. In the mitochondrial pathway, the death stimulus induces the activity of the pro-apoptosis BCL-2 family proteins localized in the mitochondrial membrane, subsequently causing leakage of 14 cytochrome-C and activating the apoptosis effector caspase family of proteins. Caspase-9 is initially activated, and the cleavage of caspase-9 further triggers caspase3 cleavage [96]. Caspase-3 is responsible for inducing endonucleases, which ultimately cause DNA fragmentation [96]. In the receptor-mediated apoptotic pathway, a ‘death peptide’ such as CD95-ligand binds to its receptor and specifically triggers the activity of downstream caspase-8 by cleaving it. Activated caspase-8 also cleaves caspase-3 directly and transduces the signal to activate members of the BCL-2 family of proteins to cause cell death through the mitochondrial pathway [96]. Both pathways share caspase3 cleavage followed by DNA fragmentation. Caspase-8, however, is unique for the receptor-mediated apoptosis pathway. Another type of cell death is necrosis, also called or non-programmed cell death. Compared with apoptosis, necrosis is characterized by swelling of the dying cells, rupture of the plasma membrane, and release of the cytoplasmic content into the extracellular environment. Necrosis-like cell death is commonly observed in many pathological conditions such as stroke, ischemia, and several neurodegenerative diseases [95]. It occurs when cellular injury is associated with a loss of ion homeostasis and drastic decreases in ATP levels. An essential feature of the necrosis is the loss of the cell membrane integrity. More recently, a growing body of evidence indicates that necrosis can occur under normal physiological conditions during development by regulated mechanisms as well [97]. In Chapter 3 we focus on both types of cell death, apoptosis and necrosis, in ciPSCs. 15 1.4 Rationale and Hypotheses The clinical application of innovative, safe and efficient treatment options based on pluripotent stem cells depends upon the availability of reliable animal models. Autologous iPSCs generated and characterized in non-rodent models — more similar to human – can offer a better preclinical evaluation of safety and efficacy. The long-term goal of our study is to establish the platform for generation, maintenance, differentiation and transplantation of ciPSCs. Our short-term goal was to generate ciPSCs from canine somatic cells. We expected to harness the knowledge gained during the development of mouse and human ESCs and iPSCs and apply it towards our goal [8,50,82]. As we progressed toward these goals, we encountered roadblocks that challenged us to elaborate hypotheses to address such unknowns. First we hypothesized that the ciPSCs can be generated based the similar reprogramming system for generating human or mouse iPSCs. We successfully achieved our first goal of deriving ciPSCs and proceeded with the implementation of direct differentiation strategies (Chapter 2). Unbeknown to us was the fact that dog ciPSCs were bFGF and LIF dependent, which would make differentiation more difficult than expected. As such we hypothesize that inactivation of a LIF-dependent/bFGFindependent pathway is solely responsible for the cell death of ciPSCs. Subsequently, we undertook studies on the pro-survival effect of LIF on ciPSCs and determined the activation status of LIF-associated pathways in ciPSCs (Chapter 3). These works 16 provide the foundation for future experiments aimed at developing canine cell replacement therapies described in more detail in Chapter 4. 17 CHAPTER 2 GENERATION OF LIF AND BFGF-DEPENDENT INDUCED PLURIPOTENT STEM CELLS FROM CANINE ADULT SOMATIC CELLS 2.1 Abstract For more than fifty years, the dog has been used as a model for human diseases. Despite efforts made to develop canine embryonic stem cells, success has been elusive. Here, we report the generation of canine induced pluripotent stem cells (ciPSCs) from canine adult fibroblasts, which we accomplished by introducing human OCT4, SOX2, c-MYC, and KLF4. The resultant ciPSCs expressed critical pluripotency markers and showed evidence of silencing the viral vectors and normal karyotypes. Microsatellite analysis indicated that the ciPSCs had the same profile as the donor fibroblasts, but differed from cells taken from other dogs. Under culture conditions favoring differentiation, ciPSCs could form cell derivatives from the ectoderm, mesoderm, and endoderm. Further, ciPSCs required LIF and bFGF to survive, proliferate, and maintain pluripotency. Our results demonstrate an efficient method for deriving canine pluripotent stem cells, providing a powerful platform for the development of new models for regenerative medicine and for the study of the onset, progression, and treatment of human and canine genetic diseases. 18 2.2 Introduction Embryonic stem cells (ESCs) were first reported in mice, then in nonhuman primates, humans, rats, and dogs [4,40,82,98,99]. ESCs have the capacity to renew themselves and to differentiate into all cell types found in adult bodies. While ESC availability has made possible new kinds of developmental and regenerative medicine studies, tissue rejection and immune-compatibility after transplantation remain as obstacles to their clinical use. Researchers have proposed several alternative methods of reprogramming somatic cells to solve this problem, including somatic cell nuclear transfer (SCNT) into unfertilized oocytes and somatic cell fusion with ESCs to attain pluripotency [9,10]. However, a lack of reliable sources of oocytes and the generation of tetraploid cells, respectively, have made their implementation in humans problematic [100]. Success in deriving induced pluripotent stem cells (iPSCs) using a set of transcription factors — such as OCT3/4, SOX2, KLF4, and c-MYC (Yamanaka factors), or OCT4, SOX2, NANOG and LIN28 — into differentiated somatic cells may address the immune rejection problem [8,50]. iPSCs are similar to ESCs in morphology, proliferation, and pluripotency. Successful generation of iPSCs has been reported for mice, humans, rats, monkeys, and pigs [8,12,13,101]. While the use of iPSCs in basic research is moving forward, their use as a therapeutic tool remains a challenge, mostly due to the lack of appropriate animal models for testing their efficacy and safety. For more than thirty years, the dog has provided a valuable model for human diseases, particularly in the study and implementation of cell-based therapy protocols 19 [102]. Over 400 dog breeds show a high prevalence of more complex multigenic diseases [21,103]. Approximately 58% of dog genetic diseases resemble the specific human diseases caused by mutations in the same gene [20,21]. Also, dogs share a variety of biochemical and physiological characteristics with humans; their physiologies, disease presentations, and clinical responses often parallel those of humans better than do those of rodents [21,82]. This underscores the dog’s importance as a reliable preclinical model for testing the feasibility of regenerative medicine and tissue engineering approaches to treat its own diseases and those of man. The distinct reproductive physiology and embryonic development of dogs and the difficulty of deriving their ESCs has blocked the establishment of the canine model for further regenerative medicine studies. The lack of well-defined methods for maturing and fertilizing canine oocytes in vitro has narrowed the choices for harvesting ESCs from natural canine blastocysts [80,104,105]. Only one group has successfully established a bona fide canine ESC line. The scarcity of published data is likely due to poor understanding of canine preimplantation embryonic development and canine embryo culture conditions [80,81]. Recently, a report on the derivation of induced ESClike cells described the source of donor cells as embryonic fibroblasts. The evidence demonstrating complete reprogramming to pluripotency in such cells is succinct, making the results — while promising — incomplete [106]. We still need an efficient, safe and well-described method for generating canine iPSCs (ciPSCs). Here, we report the production of iPSCs from adult canine cells using a method like that described for human and mouse iPSCs [8,107,108]. We systematically showed 20 the degree of pluripotency of the generated lines, explored their capacity for stable maintenance, and assayed their ability to form embryoid bodies (EBs) and to differentiate into multiple cell lineages. We also noticed that the ciPSCs demonstrated dependency on both leukemia growth factor (LIF) and basic fibroblast growth factor (bFGF) to maintain self-renewal. The ciPSC lines described here reveal similarities and differences between canines and other species and reveal ciPSCs as a unique new tool for future application to, and understanding of, analogous conditions in humans. 2.3 Material and Methods 2.3.1 Derivation of Canine Fibroblasts and Cell Culture Fibroblasts (CTFs) were derived from the testicle of a seven-month-old German shorthair pointer undergoing routine castration at the Veterinary Medical Center at Michigan State University. The testis was minced and incubated in trypsin (Gibco, Carlsbad, CA) at 37ºC for one hour. Then, shredded tissues were centrifuged, minced again, and subsequently cultured with fibroblast medium (DMEM containing 10% fetal bovine serum (FBS)) at 37ºC with 5% CO2 [107]. We replaced the culture medium every 24 hours. All ciPSCs were generated from CTFs older than passage two. We maintained ciPSCs on the feeder layer of mitomycin-treated or irradiated mouse embryonic fibroblasts (MEFs) with ciPSC medium, which consisted of DMEM/F- 21 12 (Gibco, Carlsbad, CA) supplemented with 15% (v/v) knockout serum (Gibco, Carlsbad, CA), 0.1 mM MEM nonessential amino acid solution (Sigma, St. Louis, MO), 1 mM L-glutamine (Invitrogen, Carlsbad, CA), 0.075 mM β-mercaptoethanol, 4 ng/mL human bFGF (Invitrogen, Carlsbad, CA), and 10 ng/mL human LIF (Millipore, Billerica, MA). Colonies with compact ES-like cells were mechanically isolated and subcultured onto new MEFs every four to six days using glass Pasteur pipettes. 2.3.2 Virus Construction and Production We produced and concentrated recombinant OKSIM lentivirus, as previously described [107,108]. Canine fibroblasts were assessed for infection efficiency with recombinant lentivirus using a pSIN-EF1a-YFP reporter gene. We rated lentiviral infection by quantifying the percentage of yellow-fluorescent cells determined to be identical in infectivity to human fibroblasts. Concentrated OKSIM lentivirus was directly titered by infecting canine fibroblasts followed by immunostaining for OCT4 gene product at 72 hours. The OKSIM viral titer was approximately 3X105/mL, and 0. 5 mL (in triplicate) was used to infect 2.5X105 canine cells for iPSC production. 2.3.3 Immunocytochemistry Assay The immunocytochemistry assay protocol was mostly as described in previous reports [6,107,108]. Table 2.1 lists details about the primary and secondary antibodies 22 used for some proteins. After washing the cells with phosphate-buffered saline (PBS), we then stained the nuclei by rinsing the cells with PBS containing Hoechst 33342 (1µg/mL) for 15 minutes. 2.3.4 RNA Extraction and Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR) Analysis RNA was isolated and purified using the NucleoSpin RNA XS Total RNA Isolation Kit (Macherey-Nagle, Bethlehem, PA), following the manufacturer’s instructions. We performed the RT-PCRs as previously described [107,108]. Table 2.2 lists the primers used. 2.3.5 Bisulfite Genome Sequencing Approximately 20,000 cells from ciPSC colonies or CTFs were collected and kept at -80°C until needed. We extracted canine genomic DNA using the ReadyAmp Genomic Kit (Promega, Madison, WI) and conducted bisulfite mutagenesis using the EZ DNA Methylation Kit (Zymo Research, Irvine, CA) according to the manufacturers’ instructions. Bisulfited DNA was eluted in 20 µL elution buffer and subjected to two rounds of PCR (35 cycles each) with primer pairs for canine OCT4 and NANOG promoters. Primers were designed based on randomly chosen sequences localized at the OCT4 and NANOG promoters close to the initiators [109-111] (Table. 2.3). We 23 verified PCR products on a 2% agarose gel. We ligated PCR products into the pTOPO 10 Vector System (Invitrogen, Carlsbad, CA) and randomly chose more than ten clones from each cell line to sequence. 2.3.6 Karyotyping Analysis Twenty G-banded metaphase cells were subjected to cytogenetic analysis for each cell line. Cell Line Genetics (Madison, WI) performed standard G-banding karyotype analysis. 2.3.7 Microsatellite Assay We used the following tetranucleotide microsatellite markers, each located on a separate autosome, for genotype analysis: FH2054, FH2165, FH2233, FH2313, and FH2324. We obtained primer sequences for these markers from Mellersh et al. [112]; and the allele frequencies, derived from over 1000 dogs from 28 dog breeds, from Irion et al. [113]. Amplified fragments were fluorescently labeled with 6-FAM using chimeric primers and a labeled M13 primer [114]. We amplified all markers in 25 µL reactions under the following conditions: 50 mM KCl, 10 mM Tris (pH 8.3 at 20ºC), 1.5 mM MgCl2, 100 µM dNTPs, 0.1 µM M13 and reverse primers, 0.01 µM chimeric primer, 10– 100 ng DNA, and 0.5 U Taq DNA polymerase (Invitrogen, Carlsbad, CA). Reactions were cycled under the following conditions: 1 min, 94○C, 2 min 59○C, and 3 min 72○C, 24 for 50 cycles. Amplification was verified by imaging agarose gels on a Typhoon scanner (Amersham Biosciences, Piscataway, NJ), and performed high-resolution fragment analysis on an ABI PRISM 3130 Genetic Analyzer at the Michigan State University Research Technology Support Facility. We calculated the probability that the samples derived from an unrelated dog genome that, by chance, had identical allele sizes with the CTF-derived cell lines using the allele frequencies obtained from Irion et al. (taking into account the size of the M13 tail for the comparisons) [113]. To produce a conservative probability, we assumed that the allele size between our data and that of Irion et al. could be one repeat unit off, so we used the most frequent allele of the three possible alleles (the determined allele size, plus or minus one repeat unit) from Irion et al. for each calculation [113]. 2.3.8 EB Formation We isolated ciPSC colonies from the MEF and transferred them to ciPSC medium without bFGF or human LIF in 35x10 mm Petri dishes. After five days in suspension, we transferred the EBs to tissue culture dishes coated with 0.1% gelatin (Sigma, St. Louis, MO, St. Louis, MO), culturing them using the same medium without growth factors, with 5% FBS (Gemini, West Sacramento, CA) and 10% serum replacement. The culture medium for suspension and subsequent spontaneous differentiation was partially changed daily. We cultured the attached EBs in the differentiation media for at least three weeks. 25 2.3.9 Terminal Deoxynucleotidyl Transferase dUTP Nick-end Labeling (TUNEL) Assay We washed cells with PBS and fixed them in 4% paraformaldehyde for 15 minutes. We performed TUNEL assays using the In Situ Cell Death Detection Kit (Roche Applied Science, Indianapolis, IN) following manufacturer instructions. As positive control, cells were treated with RQ1 DNase (Promega, Madison, WI, 10 IU/mL). After washing in PBS, we counterstained all nuclei with Hoechst 33342 (1µg/mL) for ten minutes at room temperature. 2.3.10 5-Bromo-2-Deoxyuridine (BrdU) Incorporation Assay We cultured cells overnight with 30 µg/mL of BrdU before immunostaining. We described the BrdU incorporation assay protocol in a previously published report [6]. The nuclei were counterstained with Hoechst 33342 (1µg/mL) for five minutes at room temperature. 26 Table 2.1 Antibodies for immunocytochemistry assay. Antigen catalog# Isotype Manufactor Concentration OCT4 SC8628 Goat IgG Santa Cruz Biotechnology 1:300 SOX2 AB5603 Rabbit IgG Abcam 1:500 NANOG SC33759 Rabbit IgG Santa Cruz Biotechnology 1:500 LIN-28 67266 Santa Cruz Biotechnology 1:250 Rabbit IgG MC813SSEA-4 Mouse IgG Abcam 1:500 70 TRA-1-60 09-0009 Mouse IgG Stemgent 1:250 Fibronectin HFN7. 1 Mouse IgG Abcam 1:500 TUJ1 14545 Mouse IgG Abcam 1:7000 Vimentin AMF17B Mouse IgG Developmental Studies Hybridoma Bank 1:250 AFP SC8108 Goat IgG Santa Cruz Biotechnology 1:500 09-0038 N/A Stemgent 1:1000 Cy-3 Goat anti-Mouse IgG + IgM 27 Table 2.1 (cont’d) Alexa 488 Donkey antiA21207 N/A Invitrogen 1:1000 A11055 N/A Invitrogen 1:1000 mouse IgG Alexa 488 Donkey anti-goat IgG 28 Table 2.2 Primers designed for qRT-PCR. primers sequence forward GGAGAAGGCCAGAGTCATCACA reverse TTTGCCCTGATGCCAAAAAG forward ACGATCAAGCAGTGACTATTCG reverse GAGGGACTGAGGAGTAGAGCGT forward CTAGGGACCCTTCTCCAATGC reverse CATTGGCAAGGATGCAGGAT RPL13 OCT NANOG TTACAGAGCATAGGAATCAGACAACT forward C TERT reverse GGTGTCTCCTGACCTCTGCTTCT forward AACCCCAAGATGCACAACTC reverse CGGGGCCGGTATTTATAATC forward GGACGCGCAGAGGCTCTACC reverse GGTTTCCACTCTCCGGAGGAG forward CCACCCCAGCCCAAGAA reverse CAGTGGACACGAGGCTACCA forward CGAGAAGATCCCTCTGGTGTTG reverse TTTCTCGTAGGAGTCCAGGTG SOX2 c-MYC LIN-28 SOCS3 29 Table 2.2 (cont’d) forward AAGGCTGGCAATGCCAATT reverse TGACTTCTGATAGCGAACCTGC forward GCAGAGCCCGCAGAAGAAG reverse GGGAAGCGGTTGCTAATGAA forward TCTCCCATGCATTCAAACG reverse GTGGAGAAAGATGGGAGCAG forward AGCCCTACTTCCCTCTCCTT reverse CTGAAGTGTGGGCGGGATGGGG forward GGAAACTCTTGGAAGGTGAGGA reverse TAACCCACCATAGGCAGATCG forward CCTACAACAGCACCAGCCTTGT reverse CCGGAACATTTGATTTCTCCCT forward GCCACTGACCATGAAGAAGGAA reverse ACAGCTCCTCAAAGCACTCTGC forward ACTCCATGAAGGAACCCTGCTT reverse TGCCCACTATGCCAGTCAAGA forward CTGAAAACCCTCTTGAATGCCA reverse TTTCTGGAAGAGGCCACAGCT forward CCAAGTGAAAACCAGGACGAA reverse CGGATGGTGATGTAACGACTGT GBX2 FOXD3 O-K NESTIN NEFL CD34 GATA2 CXCR4 AFP CDX2 30 Table 2.3 Primers designed for canine NANOG and OCT4 promoter regions in bisulfite genomic sequencing. “out” or “in” stands for that the primers were designed for the amplification of the outer or inner region in nested genomic PCR. “F” or “R” stands for the forward or reverse primers. dNANOG1outF GTATTTTTGATTTTAAAGGATGGA dNANOG1outR AAAACCTCCACATATAAAAAATAAA dNANOG1in F TAGAAATATTTAATTGTGGGGTT dNANOG1in R CATATAAAAAATAAAAAAAAAACAAAAT dOCT41out F ATATAGGGAGGAGTGTTTAGGTTA dOCT41in F GAGGAGTGTTTAGGTTATTTTAT dOCT41in R CTCAACACCTCTCTCCCTCC dOCT41out R AAAAACTCTCCTAAAAACTACTCAA dOCT42out F AGGTTAGTGGGTGGGATTGG dOCT42in F AGGTGTTGAGTAGTTTTTAGGAGA dOCT42in R ACTCCCACCTAAAATCCACAATA dOCT42out R CCTTAAAACAACAACCCCACTC 31 2.4 Results 2.4.1 Generation of ciPSCs We derived CTFs from canine testicular tissue, as described (Figure 2.1A). The infection efficiency of recombinant lentivirus was initially examined in CTFs and canine skin fibroblasts (CSF) from an old (> ten passages) canine fibroblast line derived from another dog, using a yellow fluorescent protein (YFP) reporter vector. Infection efficiency, shown by YFP, was over 75% in both CTFs and CSFs (Figure 2.2). The CTFs and CSFs were then infected by lentivirus OKSIM which had been used previously to generate human iPSC lines [107]. We confirmed successful introduction of OKSIM 72 hours postinfection by immunostaining for OCT4 and SOX2 transgenes; 40% of the target cells carried the virus (Figure 2.3). To understand the best conditions for reprogramming, we added different concentrations of LIF (1 ng/mL or 10 ng/mL) or bFGF (0.4 ng/mL or 4 ng/mL). No ESC-like colonies were observed when using LIF or bFGF alone ten days postinfection (Figure 2.4). However, when both LIF and bFGF were supplied, we observed ESC-like colonies on day six to eight postinfection (Figure 2.1 B and Figure 2.5 F). From two independent infections, two (DI-A1 and DI-A2) and five (DI-B1, DI-B2, DI-B3, DI-B4, and DI-B5) cell lines were derived and passed to new MEFs (Figure 2.1 C-D). Three to four days after the first passage, the morphology of the colonies in all cell lines resembled human ESCs (Figure 2.1 D-F; Figure 2.5 A-E). All 32 seven cell lines proliferated at similar rates and required subculturing at 1:6 dilution ratios every five days. We chose the DI-B2 iPSC line to characterize growth rate. The ciPSC doubling time at passage five (P5) took 27 hours, compared with the CTFs at P5, which doubled in 43 hours. Beyond that ciPSCs require both LIF and bFGF, these results demonstrate that ciPSC can be generated and maintained using a protocol similar to the one used to derive human iPSCs. 33 Figure 2.1: Induction of ciPSC ciPSCs s from adult canine testicular fibroblasts. fibroblasts (A) Input CTFs; (B) a typical first-observed observed ciPSC colony on day 6 after lentiviral-mediated lentiviral transduction; (C) ciPSC colony on day 9 after viral transduction; (D) ciPSC colony (DIA2) after being passaged on the feeder layer of MEFs; (E) ciPSC colony on MEF with 10X objective; (F) ciPSCss with 40X objective objective. (Scale bar: 100 µm m for A and B; 250 µm for C, D and E; and 25 µm m for F F) 34 Figure 2.2: Lentiviral infected canine fibroblasts show YFP expression. expression (A-B): Uninfected CSFs, (C-D): ): infected CSFs, ((E-F): uninfected CTFs, (G-H): ): infected CTFs. CTFs (Scale bar: 100 µm) 35 Figure 2.3: Immunocytochemistry of human OCT4 and SOX2 after transduction. CTFs and CSFs on day 3 after viral-transduction partially express introduced genes (human OCT4 and SOX2), while the uninfected CTFs and CSFs remain negative after immunostaining. The DNA was labeled by DAPI staining. (Scale bar: 250 µm) 36 Figure 2.4: LIF and bFGF dependency of ciPSCs. Morphology of the canine donor cells on day 10 after viral infection based on different treatments of growth factors. factors The cells were cultured respectively with human LIF (LIF+) or bFGF (FGF+) in concentrations of 1X (10 ng/ ng/mL for human LIF and 4 ng/mL for bFGF) or 10X (100 ng/mL for human LIF and 40 ng/ ng/mL for bFGF. Scale bar: 250 µm) 37 Figure 2.5:The ciPSCs s derived from the second batch of donor fibroblasts. fibroblasts (A-E) The typical ciPSC colonies from cell line DI DI-B1 to DI-B5 B5 at P1; (F) The first colony of cell line DI-B2 B2 on day 9 post viral transduction transduction. (Scale bar: 100 µm) 38 2.4.2 Immunocytochemistry Assay The expression of pluripotency-associated transcription factors OCT4, SOX2, NANOG, and LIN28 was positively displayed in ciPSC colonies; they were also positive for carbohydrate antigens TRA-1-60 and SSEA-4 (Figure 2.6 A-D; Fig. 2.7). In contrast, the parental CTF cells expressed fibroblast markers, including fibronectin and vimentin, while pluripotency markers were not detected (Figure 2.6 E; Figure 2.7). 39 Figure 2.6: Immunocytochemistry of ciPSCs. (A–D) D) Showing immunofluorescent staining of pluripotent cell markers OCT4, SOX2 (line A), NANOG, and SSEA-4 SSEA (line B) in five cell lines cultured on MEFs (line A and line B, from left to right: DI-B1, DI DI-B2, DIB3, DI-B4 and DI-B5). Localizations of nuclei were visualized by staining with propidium iodide odide (lines A and C) and DAPI (lines B and D) D). Localizations of representative cells in lines C and D were chosen, respectively, from the frames in lines A and B. B (E) CTFs express fibroblast markers, including fibronectin (upper line) and vimentin (lower line). (Scale bar: 100 µm for A–D; D; 250 µm for E) 40 Figure 2.7: Immunocytochemistry of DI-A1, DI-A2 and CTFs. (A) Phase-contrast image of canine fibroblasts used for ciPSC generation at P3. (B) Phase-contrast image of ciPSCs at P7. (C-H) Immunocytochemistry of pluripotency markers in ciPSCs as labeled. The pluripotency markers include: (C) TRA-1-60, (D) NANOG, (E) SSEA-4, (F) OCT4, (G) SOX2, and (H) LIN-28. (I-J) Examples showing that pluripotency markers are 41 not expressed in input canine fibroblasts. DNA was labeled by DAPI staining and shown in blue. (Scale bar: 250 µm) 2.4. 3 Pluripotency Gene Expression and Epigenetics We examined the expression of pluripotency genes in ciPSCs by qRT-PCR assay. Canine-specific pluripotency genes (OCT4, NANOG, TERT, and FOXD3) were robustly expressed in all ciPSC lines, but not in CSFs or CTFs (P<0.05, Figure 2.8A). However, the levels of OCT4, TERT, and FOXD3 in DI-B1 to B5 were significantly higher than in DI-A1 and DI-A2. Also, the fold change of NANOG expression in DI-B1 was comparatively lower than in other ciPSC lines (P<0.05). To confirm the specificity of canine gene amplification, primers for canine OCT4 were used in qRT-PCR for human H9 ESCs; no PCR products were detected (Figure 2.9). To confirm the silence of viral vectors, we compared transgene expression in ciPSCs to CTFs harvested two days after viral transduction (Figure 2.8 B). Forward and reverse primers were designed for the intersection between viral OCT4 and KLF4 (O-K). The result indicated that DI-B1 to B5 expressed transgenes negligibly compared to infected CTFs, which displayed 13,000-fold higher transgene expression (P<0.05). DI-A1 and DI-A2 had higher transgene expression (4,000-fold and 100-fold, respectively) than DI-B1, suggesting that the vectors were not shut down in DI-A1 and DI-A2. We further evaluated the expression of other canine pluripotency genes, (including SOX2, c-MYC, LIN-28, 42 SOCS3, STAT3, and GBX2) in CTFs and in DI-B1, DI-B2, and DI-B3 cell lines. Except for LIN-28 and STAT3 in the DI-B1 cell line, we found significantly higher gene expressions in ciPSCs than in CTFs (Figure 2.8 C). We further investigated the CpG dinucleotide methylation status in one canine NANOG regulatory region and two OCT4 regulatory regions (regions 1 and 2) by bisulfite genomic sequencing. We selected ciPSCs DI-A1, DI-A2, DI-B1, and DI-B5 to compare with CTFs. Results showed demethylated NANOG promoters in DI-A2 and DIB5, while DI-A1 and DI-B1 maintained the same level as CTFs. However, OCT4 methylation status in ciPSCs maintained the same level as CTFs or even increased (Fig. 2.10). These results indicate that, at least for the residues investigated, the DNA methylation level for the OCT4 gene does not always correlate with the gene expression observed. 43 Figure 2.8: Gene expression of ciPSCs. (A) qRT-PCR PCR analysis of relative transcript amounts of pluripotency-associated associated genes in CSF, CTF, all seven ciPSC lines, and all five cell lines from EBs (OCT4 and NANOG only) only). Pluripotency-associated associated genes include canine OCT4, NANOG, TERT, and FOXD3 FOXD3. Values in the y axis represent fold changes relative to canine RPL13 expression expression. The gene expression in CTF and ciPSC 44 Figure 2.8 (cont’d) lines is relative to that in CSF (*: P<0.05), and the expression in EB cells is relative to their ciPSC lines respectively (#: P<0.05). (B) qRT-PCR analysis of relative transcript amounts of the transgene sequence in CSF, CTF, and all seven ciPSC lines. The transcripts of transgenes are represented by amplification of the intersection between hOCT4 and hKLF4 within the transgene. The y axis stands for fold changes relative to canine RPL13 expression. (C) qRT-PCR analysis of relative transcripts amount of pluripotency-associated genes in CTF, DI-B1, DI-B2 and DI-B3. Values in the y axis represent fold change relative to canine RPL13 expression (*: P<0.05). 45 Figure 2.9: Validation of specificity of canine OCT4 primers for ciPSCs. ciPSC qRT-PCR analysis of relative transcripts amount of canine RPL13 and OCT4 in human ESC H9. H9 The y axis represents the fold change (Log2) relative to RPL13 RPL13. ＊: p<0.05 0.05. 46 Figure 2.10: Epigenetics analysis of ciPSCs. Bisulfate genomic sequencing for DNA methylation in the promoter regions of canine NANOG and OCT4 within CTFs and ciPSC lines DI-A1, DI-A2, A2, DI DI-B1 and DI-B5. The percentages of methylation in four ciPSC lines are compared with that in CTF by proc GLM from SAS SAS. Error bars stand for the standard errors of each column column. ＊: P<0.05. 47 2.4.4 Karyotype Analysis We randomly chose DI-A1, DI-A2, DI-B2, and DI-B5 for karyotype analysis. Results indicated that all ciPSC lines had normal karyotypes (Fig. S8). Specifically, ciPSCs with normal karyotypes among all the G-banded ciPSCs had ratios of 17/17 (DI-A1, P4), 14/16 (DI-A2, P3), 8/10 (DI-B2, P4), and 9/10 (DI-B5, P5). Cells with abnormal karyotype were mostly considered a culture artifact. 48 Figure 2.11: Karyotype analysis of ciPSCs. G-banding chromosomes of DI-A1 (P4), DI-A2 (P3), DI-B2 (P4) and DI-B5 (P5) demonstrate the normal male karyotypes. 49 2.4.5 Microsatellite Analysis To confirm that ciPSC lines derived from the original fibroblast line, we examined five canine microsatellites. All ciPSC lines displayed the same alleles as parental CTFs but differed from CSFs with different origins, indicating that ciPSCs and CTFs were equal but different from CSFs in identity (Table 2.4). The probability that CTFs and derived cell lines were not from the same dog was less than 1.9x10-8. 50 Table 2.4 Genotypes for the iPSC cells using five canine tetranucleotide repeat microsatellites. The allele sizes of the microsatellite markers in canine skin fibroblasts (CSF), canine testicular fibroblasts (CTF), and all ciPSCs (DI-A1, A2, B1, B2, B3, B4 and B5) are listed. Sample CSF CTF DI-A1 DI-A2 DI-B1 DI-B2 DI-B3 DI-B4 DI-B5 150, 166a,b 150, 166 150, 166 150, 166 150, 165 N/A 150, 165 150, 166 FH2165 394 453, 470 453, 470 453, 470 453, 470 453, 470 453, 470 453, 470 453, 470 FH2233 359, 281, 351, 281, 351, 281, 351, 281, 351, 281, 351, 281, 351, 281, c 409 409 409 409 408 409 409 N/A 293, 307 293, 307 293, 307 292, 306 292, 306 292, 306 292, 306 292, 306 253, 257 253, 257 253, 257 253, 257 253, 257 253, 257 253, 257 253, 257 Markers 157, FH2054 162 386, 367 351, 269, FH2313 272 253, FH2324 262 51 Table 2.4 (cont’d) a. Allele sizes are shown without the M13 tail used to label the amplicons so that direct comparisons can be made with the allele frequency data contained in Irion et al [113]. b. Sizes are rounded to the nearest whole number. Single base differences among allele sizes are deemed to represent the same allele. c. This marker showed three alleles in all cell lines except CSF. The three alleles are caused by a duplication ("copy number polymorphism", or CNP) that contains the FH2233 marker [115]. 52 2.4.6 In vitro Differentiation To evaluate the capability of differentiation in vitro, we induced ciPSC lines to differentiate using the EB formation assay (Figure 2.12 A). Cells derived from plated EBs on day 20 post-differentiation were analyzed and found positive for the presence of cell derivatives from the three germ layers, including β-III neuron-specific tubulin (TUJ1) for the ectoderm, vimentin for the mesoderm, and alpha-fetoprotein (AFP) for the endoderm (Figure 2.12 B) [49,82]. Using qRT-PCR, we also found that differentiated ciPSCs silenced the canine OCT4 and NANOG (P<0.05, Figure 2.8 A). Differentiationrelated genes in EB cells derived from DI-B2, DI-B3, and DI-B5 ciPSCs — i.e. ectoderm (NESTIN and NEFL), mesoderm (CD34 and GATA2), and endoderm (CXCR4 and AFP) — were upregulated (P<0.05, Figure 2.12 C). Interestingly, we observed large multinuclear cells resembling giant cells from the trophectoderm in differentiated cells (Figure 2.13). We therefore evaluated the expression of trophoblast marker CDX2, which was highly expressed in EB cells but not in the original fibroblasts or undifferentiated ciPSCs (P<0.05, Figure 2.12 C). These results demonstrate that the vast majority of our ciPSC lines could differentiate into the three germ layers and express lineage-specific markers. 53 Figure 2.12: Differentiation of ciPSCs into EBs. (A) The morphology of floating and attached EBs. Pictures represent the EBs on days 2, 5, and 20 after isolation of ciPSC colonies for EB formation culture culture. (B) Ectoderm, mesoderm, and endoderm cell derivatives are respectively marked by TUJ1, vimentin, and AFP AFP. (C) qRT-PCR qRT analysis of relative transcriptt amounts of differentiation genes in CTF; the three ciPSC lines DI- 54 Figure 2.12 (cont’d) B2, DI-B3, and DI-B5; and the EBs from these three ciPSC lines. Differentiation genes include NESTIN and NEFL (representing ectoderm and CD34), and GATA2 (representing mesoderm and CXCR4), AFP (representing endoderm), and CDX2 (representing trophoblast cells). Values in the y axis represent fold changes relative to canine RPL13 expression. (Scale bar: 250 µm for A and B) 55 Figure 2.13: Morphology and DNA staining of ciPSC-differentiated trophoblast cell-like cell. (Scale bar: 100 µm) 56 2.4.7 LIF and bFGF Dependency We examined the dependency of growth factors during ciPSC maintenance and found that, when LIF or bFGF were independently withdrawn from the culture medium, ciPSCs did not maintain their undifferentiated morphology (Figure 2.14 A, Figure 2.15, P<0.05). To investigate the role of LIF and bFGF in maintaining self-renewal, we cultured ciPSC on Matrigel-coated plates (Invitrogen, Carlsbad, CA, Carlsbad, CA)with MEF-conditioned ciPSC media supplemented with only LIF (LIF+/FGF-) or bFGF (LIF/bFGF+) or both (LIF+/FGF+). TUNEL assays demonstrated that, while no difference existed in the percentage of apoptotic cells in the LIF+/FGF- and LIF+/FGF+ treatments, the percentage in the LIF-/bFGF+ cells was significantly higher (Figure 2.14B, P<0.05 Using BrdU incorporation assay we also determined that LIF+/FGF+ ciPSC exhibited the highest proliferation rates (Figure 2.14 C, P<0.05). To test the effects of LIF and bFGF on pluripotency maintenance — measured by NANOG expression levels — we cultured ciPSCs for seven days and immunostained them (Figure 2.14 D). Results indicated that removing either LIF or bFGF is sufficient to lose the pluripotency marker NANOG, suggesting that ciPSCs need both LIF and bFGF to maintain self-renewal. Our data indicate that withdrawing LIF also triggers signs of apoptosis, while bFGF is associated with proliferation of undifferentiated ciPSCs (Figure 2.14 E). 57 Figure 2.14: Role of LIF or bFGF in survival, proliferation, and pluripotency maintenance of ciPSCs. (A) Morphology of ciPSCs from line DI-B2, B2, DI-B3, DI and DI-B4 on day 6 without passaging when cultured with human LIF only (LIF+/FGF-), (LIF+/FGF bFGF only (LIF-/bFGF+), ), and both human LIF and bFGF (LIF+/FGF+) (LIF+/FGF+). (B) TUNEL assay in ciPSCs when cultured with LIF+/FGF LIF+/FGF-, LIF-/bFGF+, or LIF+/FGF+ for 4 days. Quantification results were analyzed by PROC GLM from SAS SAS. Values in y axis represent the percentage of apoptotic cells among the total cells cells. (C) BrdU incorporation assay for ciPSCss cultured with supplement of LIF+/FGF LIF+/FGF-, LIF-/bFGF+, or LIF+/FGF+ for 4 days. days BrdU+ cells were counted as the cells with de novo synthesized DNA DNA. The quantification results were analyzed by PROC GLM from SAS SAS. Values in y axis represent the percentage of BrdU+ cells among the total cells cells. (D) Immunofluorescent staining s of pluripotency marker NANOG and differentiation marker TUJ1 in ciPSCs s cultured for 7 days with LIF+/FGF-, LIF-/bFGF+ /bFGF+, or LIF+/FGF+. (E) The potential functions of LIF and 58 Figure 2.14 (cont’d) bFGF during pluripotency maintenance of ciPSCs. Withdrawal of either LIF or bFGF, which resembles mouse or human ESC culture conditions, causes spontaneous differentiation and cell death or slowdown of proliferation. Pluripotency of ciPSCs can be maintained with both LIF and bFGF present in the culture medium. (Scale bar: 250 µm) 59 Figure 2.15: TUNEL assay for the DNase DNase-treated ciPSCs s as the positive control. control Green cells represent the apoptotic cells cells. (Scale bar: 250µm) 60 2.5 Discussion This study demonstrated that canine somatic cells isolated from an adult animal can be dedifferentiated into pluripotent cells. Following the strategy described for humans, we successfully induced fibroblasts to become pluripotent cells by transduction of four transcription factors — OCT4, KLF4, SOX2, and c-MYC (OKSIM) [107,108]. We successfully expanded and characterized seven ciPSC lines: DI-A1, DI-A2, and DI-B1 to B5. Like human and mouse ESCs, the proliferation of ciPSCs required co-culturing with MEFs [8,50]. Surprisingly, the generation of ciPSCs required the presence of both LIF and bFGF. We also found that ciPSCs, like their human counterparts, expressed many pluripotency-associated factors — including OCT4, SOX2, NANOG, TRA-1-60, TERT, FOXD3, and SSEA-4 [4,82,116] — while silencing the OKSIM transgene in most ciPSC lines. The cell line used to derive our ciPSCs, CTF, was isolated from the testicle of an adult dog. Therefore, in an effort to rule out the possibility that the original cells were already pluripotent, we compared the gene expression profile of a set of pluripotencyassociated genes with that of another canine cell line isolated from the skin of a different animal (CSF). At the time of these experiments, the CSF line was more than ten passages old. Our qRT-PCR results showed that the expression of pluripotency genes in CTFs was negligible and as low as in CSFs. Further, the morphology of CTFs had all the characteristics of a typical fibroblast, consistent with the expression of the proteins fibronectin and vimentin. While we cannot completely rule out the possible presence of a germ-line-derived cell within the culture of CTFs, our results indicate that, at the time 61 of OKSIM infection, the cells were not pluripotent and were most likely stromal fibroblasts. We found that the DI-A1 and DI-A2 ciPSC lines expressed lower levels of NANOG than the other ciPSC lines. This could be due to the OKSIM transgene remaining expressed, indicating incomplete reprogramming [117]. We also considered failure to derive EBs in these two lines as evidence of incomplete reprogramming [118]. At present, there is no report on the methylation status of canine pluripotency genes. Our bisulfite genome sequencing showed that the NANOG promoter was demethylated in the DI-A2 and DI-B5 cell lines. However, the methylation status of OCT4 was similar in CTFs and ciPSCs — or even more methylated in ciPSCs. Interestingly, our results were similar to data recently published suggesting that murine iPSCs maintained methylation signature characteristics similar to their differentiated donor cells in OCT4 and NANOG regulatory regions [119]. Although a more comprehensive epigenetic analysis for ciPSCs and CTFs is needed, our results suggest that the epigenetic status of ciPSCs may be similar but not identical to the donor fibroblasts and that, while the epigenetic memory of donor fibroblasts remains intact in some residues, it may not alter the overall characteristics of the ciPSCs derived from them. Additional regulatory factors enhancing epigenetic reprogramming might be necessary to help optimize the current reprogramming system, such as the use of microRNAs and small molecules [68,120,121]. Differentiation potential is one feature critical to determining the utility of pluripotent stem cells for regenerative medicine. Immunocytochemical and qRT-PCR analyses of 62 EBs from the DI-B1 to B5 ciPSCs found significantly increased expressions of markers for cell derivatives of the three germ layers and significantly downregulated pluripotency gene expression. Also noteworthy, cells appeared that resembled trophectoderm cells, with upregulated expression of trophoblast marker CDX2, a feature similar to that reported in pig iPSCs [101]. Why porcine and canine pluripotent cells produce cells with features of extra-embryonic tissues while human and mouse cell do not, remains unresolved. To understand the requirement of growth factors, we attempted to culture ciPSCs with media used for mouse or human ESCs or iPSCs [8,50]. Unlike mouse or human ESCs, which required LIF or bFGF, respectively, for survival, removing LIF or bFGF caused, respectively, the loss of pluripotency markers and apoptosis or the loss of pluripotency markers and the slowdown of proliferation (Figure2.14E). The role of LIF in self-renewal maintenance was widely reported in the mouse ESCs [85]. In the presence of LIF receptors (LIFR), LIF supports pluripotency by activating the Janus kinase/signal transducer and activator of transcription 3 (JAK/STAT3) pathway [85]. In dogs, LIFR was reportedly expressed in kidney cells; these canine cells responded to human LIF by further activating the JAK/STAT3 pathway [82,85,122]. The requirement of LIF for ciPSC culture also agrees with the culture conditions reported for canine ESCs [80,82]. Interestingly, we noticed that absence of LIF triggers severe apoptosis. Previous reports have indicated an anti-apoptotic role for LIF when culturing primordial germ cells, oligodendrocytes, and cardiomyocytes, but the mechanism governing this was not yet understood [123-125]. Human ESCs, recognized as pluripotent cells in the epiblast stage, and mouse epiblast stem cells reportedly depend on bFGF but do not react with 63 LIF [70,88]. We speculate that bFGF may act in ciPSCs through similar signaling pathways, i.e. , stimulating MEFs to synthesize activin A — which, in turn, activates Smad2/3 and promotes NANOG expression — and activating the FGF/ERK pathway, thus promoting proliferation [85,88]. Naïve mouse ESCs are described as comparable to cells from the blastocyst inner cell mass (ICM) and are LIF/STAT3-pathwaydependent [85]. Since ciPSCs present dual-factor dependency, it will be necessary to determine the position of ciPSCs in the “pluripotency map” and to clarify their apparent ICM/epiblast concomitant state. A better understanding of ciPSC pluripotency regulation may enhance our understanding of the molecular mechanisms responsible for the transition from ICM to epiblast cells. The physiologies, anatomies, disease presentations, and clinical responses of dogs and humans are very similar, making the dog a very promising model for human disease research [102]. Among approximately 400 known hereditary canine diseases, over half have equivalent human diseases, including retinal diseases, epilepsy, narcolepsy, cardiomyopathies, muscular dystrophy, and such malignant tumors as prostate cancer [102,126]. In terms of stem cell kinetics — e. g. hematopoietic stem cells -and responsiveness to cytokines, the dogs are more biologically comparable with humans than mice, making the dog the most commonly used species for early transplantation research in human regenerative medicine [102]. However, until now, approaches that involve deriving natural canine pluripotent stem cells have been poorly explored. The successful establishment of a robust ciPSC derivation and culture system offers a novel template for human regenerative medicine studies. It will help us to understand and treat human diseases, including those of genetic origin. Our further 64 finding, about dual growth factor dependency in ciPSCs, provides a new opportunity to understand mechanisms of self-renewal maintenance. 65 CHAPTER 3 ROLE OF LEUKEMIA INHIBITORY FACTOR (LIF) DURING CULTURE OF CANINE INDUCED PLURIPOTENT STEM CELLS 3.1 Abstract Our previous work presented evidence that canine induced pluripotent cells (ciPSCs) are simultaneously dependent on both basic fibroblast growth factor (bFGF) and leukemia inhibitory factor (LIF), and that in the absence of LIF ciPSC colonies do poorly. LIF is required for survival of ciPSCs during the early stages of differentiation. Considering that LIF function is also required to maintain pluripotency, the efficiency of ciPSCs in vitro differentiation, when compared to species such as mouse and human, is diminished. Here we report the pathways activated by LIF that promote cell survival in ciPSCs. We found that JAK-STAT3 is the pathway exclusively activated by LIF but not bFGF in ciPSCs. Downregulation of JAK-STAT3 by removal of LIF from the culture triggers apoptosis and DNA fragmentation in a caspase-3-dependent manner. Elucidation of the pathways involved during culture of undifferentiated ciPSCs, will help develop novel cell differentiation strategies leading to a more efficient derivation of cells for preclinical studies in regenerative medicine. 66 3.2 Introduction The dog is a valuable large animal model for human preclinical studies, in particular for cell therapy related-studies that require in-depth monitoring of transplanted cells for safety and efficacy [102]. Progress towards the implementation of cell therapies using pluripotent stem cells (PSCs) has been slow, in part due to the lack of adequate animal models. Two recent reports described the derivation and characterization of canine ESCs (cESCs) capable of differentiation into cell derivatives of the three-germ layers [80-82]. Subsequently, a number of different groups, including ours, successfully generated and characterized canine iPSCs (ciPSCs) from adult fibroblasts and adipose tissue-derived cells [30,32,127]. These cells require both leukemia inhibitory factor (LIF) and basic fibroblast growth factor (bFGF) to proliferate and maintain their pluripotent state [30,32,127]. We have also shown that LIF, but not bFGF, withdrawal from ciPSC culture induces apoptosis [31]. Our long-term research goal is to establish a robust platform for ciPSC generation, differentiation and transplantation. This, in turn, will allow us to evaluate the safety and efficacy of autologous iPSCs in the canine model. Establishing detailed protocols for ciPSC differentiation is critical for achieving our goal. Differentiation of PSCs toward a specific somatic cell lineage requires the removal of specific growth factors that support pluripotency from the culture medium. In the case of ciPSCs these include LIF and bFGF. We showed that LIF is capable of not only preventing differentiation of ciPSC, but maintaining cell viability as well. Attempts to differentiate ciPSCs for two weeks by removing bFGF-only failed to robustly upregulate gene 67 expression of differentiation-related genes (see Appendix A). Specifically, the expression of alpha-fetoprotein (AFP, an early hepatocyte differentiation marker) and nestin (NES, a marker of early neural differentiation) were unaffected or significantly downregulated when compared to the undifferentiated ciPSCs on day 0. In agreement with our previous results and the results of others, LIF must be removed from ciPSC culture medium to allow spontaneous differentiation to proceed [30,32,127]; however, the abrupt removal of LIF triggers cell death, decreasing the final yield of differentiated cells. The purpose of this work is to uncover the molecular pathways involved in ciPSC death after LIF removal. Studies performed in mouse ESCs (mESCs) have demonstrated that LIF is required to maintain cell pluripotency, survival and proliferation. LIF binds to the cell membrane LIF receptor which then activates the tyrosine kinase Janus kinase (JAK) enzyme, activating three branches of signal transduction pathways associated with survival: STAT3, AKT, and ERK1/2 signaling cascades. Activated JAK phosphorylates the receptor of LIF to recruit and phosphorylate the Signal Transducers and Activators of Transcription 3 (STAT3) [85]. Activated STAT3 targets and promotes the expression a list of genes that are critical for pluripotency and survival. Activation of the canonical AKT and ERK1/2 signaling cascades by LIF also supports pluripotency, proliferation, and survival [88]. Unlike mESCs, human ESCs are dependent on bFGF for pluripotency maintenance by activating SMAD2/3 and eventually stimulating NANOG expression in the presence of the feeder cells [88]. However, bFGF also activates ERK1/2andAKT 68 pathways to promote self-renewal [88]. Therefore, JAK-STAT3 pathway is specifically activated by LIF, but not bFGF. Critical for understanding cell death in ciPSCs is determining which pathway is the primary mechanism responsible for the demise of the cells. Two major types of cell death, apoptosis and necrosis, have been reported in pluripotent stem cells [93,94]. Cells dying by apoptosis activate caspase-3 that in turn activates endonucleases that fragment the DNA [95,96]. Apoptosis can be mitochondrial- and receptor-mediated apoptosis. Caspase-8 cleavage is a unique marker of the receptor-mediated pathway [96]. Necrosis is identified by morphological changes such as swelling of the dying cell, rupture of the plasma membrane, and release of the cytoplasmic content into the extracellular environment, as well as a loss of the cell membrane integrity [95,97]. Considering the signaling transduction activated by LIF and the fact that ciPSC cell death is specifically caused by withdrawal of LIF, we hypothesize that inactivation of a LIF-dependent/bFGF-independent pathway is solely responsible for the cell death of ciPSCs. To test this hypothesis, we first determined the effect of LIF on the activation status of LIF-associated pathways in ciPSCs cultured in the presence of LIF and/or bFGF. Subsequently, we determined the effect of inactivation of LIF-dependent pathway on cell viability. We assessed both apoptosis and necrosis in ciPSCs cultured in the presence of LIF and bFGF. Our results revealed that LIF withdrawal causes inactivation of JAK-STAT3 pathway and induces death by apoptosis. 69 3.3 Material and Methods 3.3.1 Cell Culture Mouse embryonic fibroblasts (MEFs) were used as feeder layers to maintain ciPSCs as previously reported [127]. MEFs were expanded with fibroblast medium (DMEM containing 10% fetal bovine serum (FBS)) at 37ºC with 5% CO2. Culture medium was replaced every 24 hours. MEFs were mitotically inactivated using fibroblast culture medium containing 10 µg/mL mitomycin C (Sigma, St. Louis, MO) for 4 hours and then seeded in density of 2x104 cells/cm2 prior to the co-culture with ciPSCs. Once ciPSC colonies were isolated, they were re-seeded on top of MEFs with iPSC medium i.e. DMEM/F-12 (Gibco, Carlsbad, CA) supplemented with 15% (v/v) knockout serum (Gibco, Carlsbad, CA), 0.1 mM MEM nonessential amino acid solution (Sigma, St. Louis, MO), 1 mM L-glutamine (Invitrogen, Carlsbad, CA), 0. 075 mM βmercaptoethanol, 4 ng/mL human bFGF (Invitrogen, Carlsbad, CA), and/or 10 ng/mL human LIF (Millipore, Billerica, MA) [127]. Colonies with compact ES cell-like morphology were manually isolated and passaged onto new MEFs every five days using glass Pasteur pipettes. 70 3.3.2 Western Blotting Assay ciPSCs were cultured in different media or treated with different small molecule inhibitors and further harvested as indicated in the experimental design in the Results section. All ciPSCs for western blotting assays were cultured on Matrigel-coated plates and maintained in culture medium that was previously conditioned by the feeder cells for 24 hours. Cell samples were collected using the Corning Costar cell scraper (Sigma, St. Louis, MO) without trypsin. Cells were lysed in RIPA buffer and kept at –80°C until use. Protein concentration was determined by BCA assay according to the manufacturer’s instruction from BCA assay kit (Thermo scientific, Rockford, IL). Thawed samples were boiled for 5 minutes and loaded into 10% SDS-PAGE for protein electrophoresis, and resolved polypeptides were transferred onto PVDF membranes (Millipore, Billerica, MA). Membranes were blocked in 5% nonfat dry milk in phosphate buffered saline (PBS, Sigma Aldrich, St. Louis, MO)–0. 1% Tween (Sigma, St. Louis, MO) for 30 minutes at room temperature and incubated overnight at 4°C with primary antibody. On the second day, the membranes were incubated for one hour with a horseradish peroxidase–labeled secondary antibody. Immunoreactivity was detected by Amersham ECL western blotting detection system according to manufacturer's instructions (GE Healthcare, Buckinghamshire, UK) and developed using Amersham HyperfilmTM MP (GE Healthcare, Buchinghamshire, UK). Three biological replicates were done per each protein analyzed. See Table 3. 1for the complete lists of antibodies used. 71 3.3.3 Terminal Deoxynucleotidyl Transferase dUTP Nick-end Labeling (TUNEL) Assay ciPSCs were cultured and harvested as indicated in the experiment designs in the Results section. To collect each sample, ciPSCs were dissociated in to single cells by trypsin treatment, pelleted, washed with PBS and fixed in 4% paraformaldehyde for 15 minutes. TUNEL assays were performed according to the In Situ Cell Death Detection Kit (Roche Applied Science, Indianapolis, IN) following manufacturer instructions. As positive control, cells were treated with DNase (Promega, Madison) as recommended in the TUNEL kit instructions. After washing in PBS, we counterstained all nuclei with propidium iodide (PI) (50 µg/mL) for 30 minutes at 37ºC. The stained cells were stored in 4oC until subjected to flow cytometry assay to quantify the percentage of TUNEL positive cells. Three biological replicates have been done for each treatment. 3.3.4 Propidium Iodide Staining for Unfixed Cells ciPSCs were cultured and further stained by PI, as indicated in the experimental design in the Results section. To stain the samples, ciPSCs in culture were treated with 4 mg/mL of PI for 5 minutes. Then the cells were immediately washed once with PBS, trypsinized, and washed again with PBS and immediately subjected to flow cytometry assay to calculate the percentage of PI-positive cells. As control we used cells exposed to 5mM of hydroxyl peroxide (H2O2) for 24 hours. Three biological replicates were 72 completed for each treatment. Stained cells were immediately subjected to flow cytometry assay to count PI positive cells. Three biological replicates were done for each treatment. 3.3.5 Flow Cytometry Assay All cells were trypsinized and transferred to flow buffer consisting of PBS. All assays were performed using LSRII Flow cytometer (BD Biosciences, San Jose, California) and analyzed using Diva v. 6 (BD Biosciences, San Jose, California) with the assistance of Dr. Louis King at the flow cytometry core of Michigan State University. 3.3.6 Statistical Analysis SAS software (SAS Institute, Cary, NC) was used to analyze the data. We performed ANOVA using PROC GLM, considering treatment as an independent variable and using Tukey’s adjustment as a post hoc test to compare means. Probability values (P) <0.05 were considered significant. 73 Table 3.1 –Antibodies used for western blotting assay Isotype Manufactor Concentration Antigen catalog# Phosphorylated STAT3 (tyr705) #9131 Rabbit IgG Cell signaling technology 1:1000 STAT3 (k-15) sc-483 Rabbit IgG 1:1000 Phosphorylated AKT (ser437) #9271 Rabbit IgG Cell signaling technology 1:1000 AKT #9272 Rabbit IgG Cell signaling technology 1:1000 Phosphorylated ERK1/2 (thy202/204) #4370 Rabbit IgG Cell signaling technology 1:1000 ERK1/2 (137F5) #4695 Rabbit IgG Cell signaling technology 1:1000 Caspase-3 (H-277) sc-7148 Rabbit IgG 1:1000 Cleaved caspase-3 (Asp175) #9664 Caspase-8 (S-19) sc-6135 Cleaved caspase-8 (Asp387) #8529P Rabbit IgG Cell signaling technology 1:1000 Beta-actin #3700 Mouse IgG Cell signaling technology 1:1000 Goat anti-rabbit IgG-HRP sc-2004 Santa Cruz Santa Cruz Rabbit IgG Cell signaling technology Goat IgG N/A 74 Santa Cruz Santa Cruz 1:1000 1:1000 1:3000 Table 3.1 (cont’d) Goat anti-mouse IgG-HRP sc-2005 N/A Santa Cruz 1:3000 Donkey anti-goat IgG-HRP sc-2020 N/A Santa Cruz 1:3000 75 3.4 Results 3.4.1 Elucidate Signaling Transduction Pathways in ciPSCs Cultured in the Presence of LIF and/or bFGF. As indicated above, LIF initiates a cascade controlling three signal transduction pathways associated with survival: STAT3, AKT, and ERK1/2 [85]. Of note, the JAKSTAT3 signaling axis is exclusively activated by LIF whereas the AKT, and ERK1/2 pathways are activated by both LIF and bFGF as well as other growth factors present in the culture medium [85]. Therefore, we hypothesized that like mESCs, following the removal of LIF from the culture medium but maintaining bFGF, would inactivate JAKSTAT3 pathway in ciPSCs, while the JAK-AKT or JAK-ERK1/2 pathways would remain active. To test our hypothesis we evaluated the phosphorylation status of STAT3, AKT, and ERK1/2. ciPSCs were cultured in media containing different growth factor combinations (LIF+/bFGF+, LIF+/bFGF-, LIF-/bFGF+ and LIF-/bFGF-) for three days. Cells were harvested and proteins were isolated for western blotting assays (Fig. 3.1). Compared to the sample of ciPSCs cultured with both growth factors (LIF+/bFGF+), only the removal of LIF (LIF-/bFGF+ and LIF-/bFGF-) reduced the phosphorylation of STAT3. Phosphorylation of either AKT or ERK1/2 was consistently maintained in all groups and was not affected by the presence or absence of any growth factor. This data indicates that LIF removal only inactivates the JAK-STAT3 pathway, but not AKT or ERK1/2 in ciPSCs. 76 Figure 3.1: Phosphorylation status of LIF LIF-associated associated signaling pathways in ciPSCs s maintained in the presence/absence of LIF/bFGF for three days. days Protein candidates for analysis are listed on the left, including p p-STAT3, STAT3, STAT3, p-AKT, p AKT, pERK1/2, ERK1/2. β-actin actin was used as control control. The“+” and “-”” on the top indicate the presence and absence of LIF or bFGF bFGF. 77 3.4.2 Functional Analysis of LIF-Responsive Pathways in ciPSCs. To further elucidate the role of individual LIF-responsive pathways on ciPSCs survival, we compared the effects of drugs known to specifically inhibit phosphorylation of STAT3, AKT, or ERK1/2. To test the JAK-STAT3 pathway, we used JAK inhibitor I (JAKi) to inactivate JAK activity and NSC74859 (STAT3i) to inhibit STAT3 activation directly and MK2206 (AKTi) and PD184352 (ERKi) to inhibit AKT and ERK1/2 phosphorylation respectively. Prior to applying the inhibitors and evaluating cell death, we sought to determine the minimum concentration of each small molecule inhibitor that was sufficient to inactivate the target protein without affecting the other pathways analyzed. The minimum effective concentration of each inhibitor was first determined by culturing ciPSCs in LIF+bFGF with each inhibitor (or dimethyl sulfoxide (DMSO) vehicle alone) at different concentrations for 24 hours. After treatment, proteins were extracted and subjected to western blotting to evaluate the phosphorylation of target proteins. As indicated in Fig. 3.2, JAKi was tested at concentrations ranging from 10 nM to 10 µM. One micromolar was the lowest concentration for JAKi to block the phosphorylation of the STAT3 protein with no apparent effect on the phosphorylation of AKT and ERK1/2. Using the same process, the optimal concentration determined for STAT3i was 500 µM, for AKTi, 10 µM, and ERKi, 1 µM. To determine the effect of the individual pathways on cell survival, ciPSCs were cultured in LIF+bFGF in the presence of each of the inhibitors or vehicle alone for 24 hours and assayed at the end of this time. These cultures were compared to parallel cultures of ciPSCs grown in each of the growth factor combinations (LIF+/bFGF+, 78 LIF+/bFGF-, LIF-/bFGF+, LIF-/bFGF) for 3 days and assayed on day 0, day 1, day 2 and day 3. All groups of cells were evaluated for survival and the mechanism of cell death (i.e. apoptosis or necrosis). Apoptosis was assessed by morphological changes, DNA damage (TUNEL assay and comet assay) and caspase-3/8 cleavage using western blot. Necrosis was assessed by morphological examinations and measure of cell membrane integrity using propidium iodide staining of unfixed cells. As predicted by earlier experiments using different growth factor combinations, only cells cultured in the absence of LIF (LIF-/bFGF+ and LIF-/bFGF-) displayed morphological signs of cell death as indicated by a loss of colony compactness and the emergence of phase-bright pyknotic cells. In the inhibitor groups, only treatment of JAKi or STAT3i resulted in cells with morphological indicators of cells death essentially identical to LIF-withdrawn cells. Vehicle controls or AKTi or ERKi cells showed no morphological indicators of cell death (Fig. 3.3). These results using morphological indicators alone reinforce the idea that the blocking the JAK-STAT3 pathway triggers cell death in ciPSCs. Cell death by apoptosis was further evaluated in all groups by assessing DNA damage by TUNEL assay. For the growth factor supplement groups, results demonstrated that LIF withdrawal (LIF-/bFGF+ and LIF-/bFGF-) significantly increased the percentage of TUNEL-positive cells from day 0 to day 3 (Fig. 3.4). In agreement with morphological indicators, in the inhibitor treatment groups, only the JAKi and STAT3i cultures displayed a significant increase of TUNEL-positive cells. We observed that the 79 TUNEL-positive cell rate in ciPSCs treated with JAKi was significantly lower than that in STAT3i treated group, the source of this difference remains to be elucidated. We then evaluated caspase-3 and caspase-8 cleavage in these cells (Fig. 3.5). In agreement with the TUNEL results, only the absence of LIF in the growth factor supplement groups or the JAKi or STAT3i cultures in the inhibitor treatment groups induced caspase-3 cleavage. Moreover, the level of caspase-3 cleavage in JAKi treated group was lower than that in STAT3i treated group, as indicated by the less intense band. We did not observe caspase-8 cleavage under any culture condition or treatment, suggesting that although LIF removal or direct JAK-STAT3 inhibition induced caspase-3 activation, the caspase-8 pathway remained inactive. Finally, to evaluate necrosis, unfixed ciPSCs were maintained in the same conditions or treatments as described above and subjected to propidium iodide staining to evaluate cell membrane integrity. The absence of either growth factor or the treatment of any inhibitor did not induce a significant increase of propidium iodidepositive cell numbers (Fig. 3.6). These results that necrosis is not a primary or "acute" cause of cell death in the transition of ciPSCs to differentiated cells. 80 Figure 3.2: Effects of JAK, STAT3, AKT and ERK1/2 inhibitor (JAKi, STAT3i, AKTi and ERKi) on activities of different signaling transduction proteins in ciPSCs. Western blotting assays of protein factors of LIF and/or bFGF associated signaling pathways within ciPSCss collected after 24 hour hour-treatment treatment of inhibitor with concentration gradients. The protein factors include phosphorylated (p (p-)) STAT3, STAT3, p-AKT, AKT, p-ERK1/2, and ERK1/2. β-actin actin was applied as reference protein protein. The concentrations for each inhibitor are labeled on the top top. 81 A B Figure 3.3: Morphological changes of ciPSCs treated with protein inhibitors. inhibitors ciPSCss were maintained under culture conditions with different growth factor supplements on day 0, day 1, day 2 and day 3 (panel A), or treated with specific inhibitors, JAKi, STAT3i, AKTi, or ERKi for 24 hours (Panel B) DMSO was used as control. The supplement of growth factors are llabeled abeled on the top in panel A and “+” and “-”” indicate the presence and absence of LIF or bFGF bFGF. 82 Figure 3.4: Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay indicating the DNA damage of ciPSCs. x-axis axis indicates the ciPSCs maintained in LIF+/bFGF+ medium, LIF+/bFGF LIF+/bFGF- medium, LIF-/bFGF+ /bFGF+ medium and LIFLIF /bFGF- medium collected on day 0, day 1, day 2 and day 3, as well as the ciPSCs maintained in LIF+/bFGF+ medium treated with DMSO, JAK inhibitor (JAKi,1 µM), STAT3 inhibitor (STAT3i, AT3i, 500 µM), AKT inhibitor (AKTi, 10 µM), M), and ERK1/2 inhibitor (ERKi, 1 µM) for 24 hours. The “+” and ““-”” indicate the presence and absence of LIF or bFGF. The y-axis axis indicates the percentage of TUNEL positive cells cells. And different colors are used in columns mns to indicate the ciPSCs collected on different times.. Different letters (a, b, and c) indicate P < 0.05 0.05. 83 Figure 3.5: Western blotting assays indicating the caspase caspase-3/8 3/8 activation in ciPSCs. ciPSCss maintained in LIF+/bFGF+ medium, LIF+/bFGF LIF+/bFGF- medium, LIF-/bFGF+ LIF medium and LIF-/bFGF- medium collected on day 0, day 1, day 2 and day 3, as well as the ciPSC maintained in LIF+/bFGF+ medium treated with DMSO, JAK inhibitor (JAKi,1 µM), M), STAT3 inhibitor (STAT3i, 500 µM), AKT inhibitor (AKTi, 10 µM), and an ERK1/2 inhibitor (ERKi, 1 µM) M) for 24 hours hours. Protein candidates for analysis are listed on the left, including procaspase-3, 3, cleaved caspase caspase-3 (activated caspase-3), 3), procaspase-8, procaspase and cleaved caspase-8 8 (activated caspase caspase-8, 8, including two subunits p43 and p18). β-actin was used as control. The “+” and ““-”” indicate the presence and absence of LIF or bFGF. bFGF 84 Figure 3.6: Propidium iodide (PI) staining assay in ciPSCs. x-axis axis indicates the ciPSCs maintained in medium that contained LIF+/bFGF+, LIF+/bFGF--,LIF-/bFGF+ or LIF-/bFGF-. Cells were collected for analysis on day0, 1, 2 and 3, as well as ciPSCs maintained in LIF+/bFGF+ medium treated with DMSO, JAK inhibitor (JAKi,1 µM), STAT3 inhibitor (STAT3i, 500 µM), AKT inhibitor (AKTi, 10 µM), or ERK1/2 ER inhibitor (ERKi, 1 µM) for 24 hours.. An extra group of H2O2 treatment was included as the positive control that is listed on the right of the xx-axis. The “+” and “-” “ indicate the presence and absence of LIF or bFGF bFGF. The y-axis axis indicates the percentage of PI positive cells. Different ifferent colors are used in columns to indicate the ciPSCs ciPSC collected at different times. Different ifferent letters (a and b) indicate P < 0.05. 85 3.5 Discussion The development of novel animal models for regenerative medicine experiments that require the use of stem cells are highly needed. The canine offers the opportunity to expand our knowledge beyond rodent models, and has been used as a template for human medicine for almost five decades [128]. We have recently reported the derivation of canine iPSCs that in combination with canine homologs of human disease could significantly inform our understanding of the disease pathogenesis and the potential of new treatments. ciPSCs have some unique features that make them different from those of mouse and human. The most striking is that they require both LIF and bFGF to maintain pluripotency and proliferate, implying that there are different signaling pathways involved with pluripotency regulation [28,30,32,82,127]. We found that the removal of LIF triggered cell death in ciPSCs and therefore we focused on determining the mechanism by which LIF regulates the survival of ciPSCs. LIF plays a key role in mouse PSC cultures as described in the introduction to this chapter. Unlike the mouse, human PSCs are dependent of bFGF, not LIF. The activation of ERK1/2 and AKT pathways by bFGF supports cell proliferation and survival as well [88]. Therefore, among the three signaling transduction pathways activated by LIF, only LIF-JAK-STAT3 is exclusively activated by the presence of LIF in mESCs. Our results confirmed the exclusivity of this pathway with regard to LIF responsiveness in canine cells. Using western (protein blot) analysis, we observed that 86 only in the absence of LIF (LIF-/bFGF+ and LIF-/bFGF-) was there a loss in phosphorylation of STAT3 without affecting the phosphorylation of AKT or ERK1/2 in ciPSCs, providing strong evidence that the activation of STAT3 pathway in ciPSCs is dependent on the presence of LIF. Notably, AKT and ERK1/2 phosphorylation appeared unchanging in any growth factor combination. AKT and ERK1/2 pathways have been shown to be activated by factors produced by feeder cells such as insulin growth factor 1 (IGF-1), epidermal growth factor (EGF) and activin-A supporting pluripotency and survival of PSCs via AKT and ERK1/2 signaling cascades, but feeder cells were present in all treatments and therefore neither pathway appeared directly responsive to either LIF or bFGF, the phosphorylation of these proteins did not change and do not directly impact survival after growth factor withdrawal [85,129-131]. We should point out that it remains possible that indirect effects of growth factors acting on, and produced by, feeder cells, could mask a small direct effect of LIF on the ciPSC ERK1/2 and AKT pathways. Small molecule inhibitors were used to block the activity of the specific LIFassociated pathways to evaluate their roles in cell survival. Drug-inhibited cultures were compared to ciPSCs cultured in different growth factor combinations to determine the extent and "type" of cell death induced. As predicted, only cultures with either LIF removed for 3 days or cultures with drug-based inhibition of the JAK-STAT3 pathway for 1 day displayed cytotoxicity. PI uptake indicative of cell membrane compromise and necrotic cell death were not observed under any condition, however, in cultures displaying cells with morphological indications of cell death, several features of apoptosis (DNA fragmentation as indicated by TUNEL assay and caspase-3 cleavage 87 revealed by western blot) were observed. Interestingly, we noted that JAKi treatment induced lower TUNEL-positive cell rate (9.27% in average) than the STAT3i treatment (29.67% in average), which reflects a lower apoptosis rate when treated by JAKi. The same pattern was repeated in the caspase-3 cleavage assay, as indicated by a band of cleaved caspase-3 protein with lower intensity in ciPSCs treated with the JAKi. It was previously reported that inactivation of JAK enhances NANOG expression through epigenetic regulation in mESCs and in ESCs, escalation of NANOG expression results in the inhibition of differentiation and an increase in cell survival via escalation the HSPA1A expression, a NANOG target [132,133]. It is possible that the increase of NANOG expression caused by the inhibition of JAK activity represses to certain extent, apoptosis in ciPSC. We also noted that no significant change was observed in caspase-8 cleavage and or cell membrane integrity under any treatment conditions. This result revealed that the cell death triggered by LIF withdrawal or inhibition of the JAK-STAT3 signaling pathway is not activated through a death receptor pathway. When LIF is removed from the culture media, apoptosis appears to be the overwhelming mechanism of cell death in ciPSC making their transition from a pluripotent to a differentiated state. The importance of STAT3 in the survival of pluripotent stem cell has been previously reported. One explanation of this effect is the activation of p38 mitogenactivated protein kinase (p38MAPK) [134,135]. LIF withdrawal during mESC culture may induce the inactivation of STAT3, which subsequently fails to inhibit the activity of the p38MAPK protein. If the expression of anti-apoptosis factor BCL-2 cannot be up- 88 regulated in time, p38MAPK protein can trigger cell death in mESCs [135]. Furthermore, our results of caspase-8 activation and PI staining show no difference among all the groups in ciPSCs reinforcing the idea that cell death in ciPSCs is not due to receptormediated apoptosis or necrosis. It is reasonable to speculate that the requirement for LIF to maintain survival is mainly due to a culture system for ciPSCs that still requires optimization to remove stressful stimuli. LIF and the subsequent activation of JAKSTAT3 pathway compensates for these chronic stressors, permitting survival and growth. Apoptosis is a typical cellular stress response during in vitro cell culture. It has been reported that embryonic stem cells are hypersensitive to apoptosis triggered by DNA damage due to mismatch repair, as a mechanism that may contribute to reduction of the mutational load in the progenitor population [92]. We also evaluated the survival of ciPSCs based on comet assay, a more sensitive assay to evaluate DNA fragmentation based on the DNA electrophoresis of live cells (see Appendix B). We observed that compared to the healthy canine fibroblast control, ciPSCs cultured in the presence or absence of either growth factor or by the treatment by either inhibitor demonstrated some indications of DNA damage. This data implies that the ciPSCs cultured even under conditions that we currently consider "optimal", may be accumulating stress and DNA damage. Removal of LIF lowers the cells’ ability to respond to these accumulated stressors, further accelerating DNA fragmentation, and ultimately triggering apoptosis. The existence of stressors in the ciPSC culture environment is not certain, but previous reports have revealed sources of culture stress for other cell types. Osmolarity of the culture media is an important parameter to consider with dog cells. When flushing 89 canine blastocysts from the uterus using regular flushing media with an osmolarity of 270-310 mOsmol/L (which has a similar osmolarity of our current ciPSC culture medium) significant shrinkage the embryos is observed, whereas the use of a buffer with lower osmolarity corrected this problem [136]. This suggests that our current culture medium may be a source of hyperosmotic stress to ciPSCs. Another possible explanation is the potential negative effect from β-mercaptoethanol since it was originally added to the recipe for mouse ECCs due to its positive effect on cell-cloning efficiency, and it was subsequently applied to mouse and human ESC cultures [137]. Interestingly, a recent study on chemically defined medium for human ESC culture has demonstrated that β-mercaptoethanol is toxic for human ESCs. It was apparently added to reduce the variability generated by albumin that was also part of the original recipe. By removing albumin and β-mercaptoethanol from the media, human ESC cultures performed much better. More work must be done to optimize the culture conditions and test this hypothesis among many others. In summary, this study demonstrates that LIF is critical for ciPSC survival and that the action of LIF is overwhelmingly through the JAK-STAT3 pathway. This information was instrumental to an improved characterization and differentiation of ciPSCs and moved us closer to practical solutions for their application to veterinary medicine. 90 CHAPTER 4 CONCLUSIONS AND FUTURE DIRECTIONS The canine model stands out as a valuable pre-clinical model because of its similarity to humans in terms of pathology, physiology, biochemistry, body size, life span, genetic diversity, and anatomy [15]. Stem cells, especially pluripotent stem cells (PSCs), are one of the most important components of future regenerative medicine strategies. iPSCs in particular are the ideal source of cells for autologous tissue replacement. Multiple differentiation protocols have demonstrated that functional cells of many phenotypes can be produced in vitro from iPSCs, and experiments in rodents have shown compelling data arguing in favor of using iPSC-derived cells and tissues. However, there is limited knowledge on the use of iPSCs for therapeutic transplantation in larger animals such as dogs. The therapeutic use of stem cells in dogs is currently being explored; particularly the use of mesenchymal stromal cells (MSCs). Pluripotent stem cells such as iPSCs could especially benefit dogs suffering from diseases lacking effective therapies or causing life-long disability, impacting quality of life. These treatments could also promote the development of parallel treatments in human. For many conditions, treatment of dogs with reprogrammed autologous stem cells may be critical to eventually implementing such therapies in humans [82]. 91 Our understanding of PSCs from dogs (and most non-rodent species) and the molecular foundation of their self-renewal were far from complete when my studies on ciPSCs started in 2009. My research project was initiated with the long-term objective of producing and characterizing induced pluripotent stem cells from canine somatic cells for future application in the treatment of injury or disease in dogs. This work will contribute to a better understanding of cellular reprogramming and stem cell biology and will help to address human and animal health issues in a non-rodent system. 4.1 Generation and Characterization of ciPSCs To accomplish this ambitious goal, it was necessary to first develop a method for reprogramming canine somatic cells to pluripotency and to characterize such ciPSCs. Since iPSC technologies were in their relative infancy when the project began, the success at obtaining high-quality ciPSC lines was not trivial. Nonetheless, ciPSC lines that had normal phenotype and karyotype, and displayed conventional pluripotency markers were successfully derived. In addition, ciPSCs could be differentiated in vitro into cell derivatives of the three-germ layers. The main challenge was the significant loss of cells when attempting to differentiate ciPSCs, as discussed further below. While the feasibility of reprogramming canine somatic cells to cells with essential characteristics of pluripotency was validated, like iPSCs from most domesticated species, ciPSCs could not produce teratomas following introduction into immunecompromised mice. The causes of this phenomenon still remain to be elucidated. 92 For most domestic and companion species, iPSC and ESC derivation remains an expensive and labor-intensive process and as a consequence, there are only a handful of published studies. A literature search for iPSCs from felids produced a single report of iPSCs from the snow leopard, Panthera uncia [138]. A similar search for cow- and horse-derived cells likewise yielded two reports from the same group for the cow and two from independent groups for the horse [139-142]. Canine iPSCs have been reported more often although one recurring theme of all of these reports is that canine pluripotent cells tended to form either poor teratomas or none at all [12,28,29,31,32,143,144]. For canine ESCs specifically, only one study reported teratomas, and the resulting tumors were small and of poor quality [82]. The data published in Stem Cells and Development (data in Chapter 2) and presented in this thesis agrees with the literature, in which canine cells, with apparently all of the properties of pluripotency, had difficulty forming teratomas in immune-compromised mice [27,31,32]. The only domesticated species that has repeatedly shown high-quality teratomas from ESCs or iPSCs is the pig [11,145-153]. Must be noted though that sustained expression of viral transgenes is required for maintenance of the pluripotent phenotype, suggesting that porcine iPSCs may also differ from mouse and human iPSCs [145]. Scarcity of reports does not necessarily means that there is low interest on developing iPSCs from domesticated and companion species. It is possible that multiple attempts at iPSC production may have been performed in different laboratories around the world, only to be halted at a later stage, because of poorly developed in vitro culture conditions and/or failure to demonstrate teratoma formation. We speculate that the 93 absence of teratomas from iPSCs of most domestic species most likely arises from some fundamental incompatibility in physiology of the mouse that prevents the proliferation of non-mouse cells. These incompatibilities could be at the level of growth factors, cell adhesion and extracellular matrices, neo-vascularization, sub-clinical pathogens, or even something as ordinary as body temperature. In short, caution must be exercised when assuming that because rodent and primate cells can grow in the body of a mouse, cells from other species will do as well. It is often mentioned that because a given line of reprogrammed cells, displaying all of the hallmarks of pluripotency, are incapable of forming teratomas, therefore they do not fit the current definition of "pluripotent cells", and they have little intrinsic value in either basic research or translational medicine. The data presented in this thesis and the results of experiments still in progress suggest that this is not the case. Despite not forming teratomas in mice, the ciPSCs are capable of giving rise to a number of stable cell lineages, critical for the development of novel therapies, with tremendous potential value to veterinary and human medicine. It has been uncovered by us that one characteristic of ciPSCs which differ from human or mouse PSCs in that they are dependent on the presence of two exogenous growth factors — LIF and bFGF — to maintain pluripotency and survival. It was found that LIF is critical for maintaining both survival and pluripotency, while bFGF appeared to be required only to maintain pluripotency. As indicated above, the removal of LIF from the culture medium triggered substantial cell death and presented a significant obstacle for the eventual use of ciPSCs as a source of differentiated cell types for 94 therapeutic applications. As a consequence, a better understanding of the molecular mechanisms of both growth factors in the transition from pluripotency to differentiated state became a major focus of my research as described in Chapter 3. 4.2 Elucidating the Roles of Growth Factors in ciPSC Maintenance Experiments aiming at understanding the role of LIF in maintaining the survival of ciPSCs and elucidating the LIF-dependent signaling pathways critical to ciPSC maintenance were my first priority. Using drugs known to inhibit specific components of the LIF-associated signaling cascades, it was found that the withdrawal of LIF led to inactivation of a critical signaling pathway known as the JAK-STAT3 pathway, but had negligible impact on two other known LIF-associated signaling pathways, the JAK-AKT and JAK-ERK1/2 pathways. In addition, as with ciPSCs maintained without LIF, inhibition of the LIF-JAK-STAT3 pathway in ciPSCs triggered caspase-3 activation, DNA damage, and eventual cell death by apoptosis. As indicated in the discussion section in Chapter 3, there are a number of publications showing that the JAK-STAT3 pathway is protective against multiple cell stressors, suggesting that inactivation of JAK-STAT3 in the presence of some unknown stressful components of the ciPSC culture environment was responsible for the rapid cell loss [154]. From this it is hypothesized first, that inhibiting the activity of the stress-induced pro-apoptosis effector such as the p38 mitogen-activated protein kinase, or optimizing the current ciPSC culture condition could prevent the ciPSCs from death in the absence of LIF; and second a very slow withdrawal of LIF coupled with the simultaneous and gradual addition of components 95 predicted to lower cell stress could improve the efficiency of differentiation. Although outside of the scope of my thesis, the later of the two were evaluated. Beside the studies on LIF, a second set of experiments must be done focusing on the role of bFGF in the maintenance of pluripotency in ciPSCs. It was found that both LIF and bFGF were required to maintain the expression of pluripotency markers such as NANOG in ciPSCs. Dual-growth factor dependency is not necessary for human or mouse PSCs and it is also distinctive from other recently-defined classifications of PSC lines such as LIF-dependent, ICM-derived "naïve" ES cells or bFGF-dependent, epiblast-derived "primed" ESCs. Naïve and primed ESCs present distinct regulatory mechanisms for maintaining pluripotency and inhibiting differentiation [33]. ciPSCs displayed a monolayer morphology and the canine NANOG promoter contained a SMAD2/3 consensus binding sequence that would appear to indicate that they are closer to "primed" PSCs which is dependent on bFGF related signaling transduction; however, ciPSCs do not appear to fit perfectly into either category [155]. By describing the molecular regulatory pathways maintaining pluripotency in ciPSC, it will be able to determine where these cells lay in the pluripotency map, which will eventually facilitate the development of the efficient protocols for ciPSC derivation, maintenance and differentiation toward the desired somatic cell type of choice. 96 4.3 Reprogrammed Cells in Animal and Human Medicine It is hoped that the project initiated in pursuit of my doctorate will eventually lead to the development of new treatment options for a variety of diseases and injuries, such as spinal cord injury. Chondrodystrophic canine breeds such as Dachshunds have particular susceptibility to spinal cord injury and represent just one of the potential beneficiaries of this type of research as described above. It was able to produce neuronal spheres from ciPSCs by spontaneous or directed differentiation. Can the development of reliable protocols for the further differentiation of ciPSC-derived neurons to CNS subtypes such as motor neurons and oligodendrocytes be far behind? Will ciPSC-derived MSCs delivered to the affected tissues reduce inflammation and promote the regeneration of local neuronal progenitor cells, leading to the repair the injured spinal cord? The results of my research are the foundation upon which new and more challenging questions like these could be answered in the context of pathological conditions afflicting real patients, dogs and human alike. The results presented suggest that because iPSCs from different species are likely to display their own unique set of properties — such as a dependency on specific levels and combinations of growth factors — it is likely that the derivation and use of reprogrammed cells in the veterinary clinic will be more complex than previously thought. Despite these obstacles, the potential benefits to be realized by the use of these cell types to treat injury and disease in dogs, and thereby provide valuable lessons for the future use of cellular reprogramming to treat human patients, will more than justify the labor-intensive nature of the research described in this thesis. 97 APPENDICES 98 APPENDIX A Figure A1: Gene expression of differentiation markers in ciPSCs cultured in the presence or absence of LIF. qRT-PCR analysis of relative transcript amounts for germ layer-specific genes in ciPSCs (DI-B3) differentiated in the presence of LIF (LIF+/bFGF) or without the presence of LIF (LIF-/bFGF-) for 14 days. Differentiation genes include canine nestin (NES) and NEFL for ectoderm, CD34 and GATA2 for mesoderm, CXCR4 and AFP for endoderm, and CDX2 for trophectoderm. The primers for amplifying the 99 Figure A1 (cont’d) genes above were listed in Table 2.2 in Chapter 2. Values in the y axis represent fold change of gene expression in differentiated ciPSCs relative to that in undifferentiated ciPSCs on day 0, and the gene expression is relative to canine GAPDH. * indicates significant difference (P<0.05) of gene expression level in differentiated ciPSCs on day 14 compared to the undifferentiated ciPSCs on day 0. 100 APPENDIX B A B Figure A2: Comet assay indicating the extent of DNA damage in ciPSCs ciPSC cultured under different conditions conditions. A. ciPSCs s maintained in LIF+/bFGF+ medium, 101 Figure A2 (cont’d) LIF+/bFGF- medium, LIF-/bFGF+ medium and LIF-/bFGF-medium collected on day0, day 1, day 2 and day 3, as well as the ciPSC maintained in LIF+/bFGF+ medium treated with DMSO, JAK inhibitor (JAKi,1 µM), STAT3 inhibitor (STAT3i, 500 µM), AKT inhibitor (AKTi, 10 µM), and ERK1/2 inhibitor (ERKi, 1 µM) for 24 hours. Canine testicular fibroblasts (CTF) were applied as control. The y-axis on the left and right panels indicates the comet scores. Different letters (a, b, c, d and e) indicate P<0.05. B. The typical representatives of ciPSCs with different comet scores generated by program Comet Assay IV. The numbers (0, 20, 40, and 60) indicate the comet scores of the cell representative displayed in each picture. 102 BIBLIOGRAPHY 103 BIBLIOGRAPHY 1. Tabar V and L Studer. (2014). Pluripotent stem cells in regenerative medicine: challenges and recent progress. Nat Rev Genet 15:82-92. 2. Daar AS and HL Greenwood. (2007). A proposed definition of regenerative medicine. J Tissue Eng Regen Med 1:179-84. 3. Martin GR, LM Silver, HS Fox and AL Joyner. (1987). Establishment of embryonic stem cell lines from preimplantation mouse embryos homozygous for lethal mutations in the t-complex. Dev Biol 121:20-8. 4. Thomson JA, J Itskovitz-Eldor, SS Shapiro, MA Waknitz, JJ Swiergiel, VS Marshall and JM Jones. (1998). Embryonic stem cell lines derived from human blastocysts. Science 282:1145-7. 5. Hu BY and SC Zhang. (2010). Directed differentiation of neural-stem cells and subtype-specific neurons from hESCs. Methods Mol Biol 636:123-37. 6. Chang EA, Z Beyhan, MS Yoo, K Siripattarapravat, T Ko, KJ Lookingland, BV Madhukar and JB Cibelli. (2010). Increased cellular turnover in response to fluoxetine in neuronal precursors derived from human embryonic stem cells. Int J Dev Biol 54:707-15. 7. Chambers SM, CA Fasano, EP Papapetrou, M Tomishima, M Sadelain and L Studer. (2009). Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat Biotechnol 27:275-80. 8. Takahashi K and S Yamanaka. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:66376. 9. Wilmut I, AE Schnieke, J McWhir, AJ Kind and KH Campbell. (1997). Viable offspring derived from fetal and adult mammalian cells. Nature 385:810-3. 10. Tada M, Y Takahama, K Abe, N Nakatsuji and T Tada. (2001). Nuclear reprogramming of somatic cells by in vitro hybridization with ES cells. Curr Biol 11:1553-8. 11. Ezashi T, BP Telugu, AP Alexenko, S Sachdev, S Sinha and RM Roberts. (2009). Derivation of induced pluripotent stem cells from pig somatic cells. Proc Natl Acad Sci U S A 106:10993-8. 104 12. Liao J, C Cui, S Chen, J Ren, J Chen, Y Gao, H Li, N Jia, L Cheng, H Xiao and L Xiao. (2009). Generation of induced pluripotent stem cell lines from adult rat cells. Cell Stem Cell 4:11-5. 13. Liu H, F Zhu, J Yong, P Zhang, P Hou, H Li, W Jiang, J Cai, M Liu, K Cui, X Qu, T Xiang, D Lu, X Chi, G Gao, W Ji, M Ding and H Deng. (2008). Generation of induced pluripotent stem cells from adult rhesus monkey fibroblasts. Cell Stem Cell 3:587-90. 14. Cao H, P Yang, Y Pu, X Sun, H Yin, Y Zhang, Y Li, Y Liu, F Fang, Z Zhang, Y Tao and X Zhang. (2012). Characterization of bovine induced pluripotent stem cells by lentiviral transduction of reprogramming factor fusion proteins. Int J Biol Sci 8:498-511. 15. Lupu M and R Storb. (2007). Five decades of progress in haematopoietic cell transplantation based on the preclinical canine model. Vet Comp Oncol 5:14-30. 16. Power JM and AM Tonkin. (1999). Large animal models of heart failure. Aust N Z J Med 29:395-402. 17. Rowell JL, DO McCarthy and CE Alvarez. (2011). Dog models of naturally occurring cancer. Trends Mol Med 17:380-8. 18. Silbergleit A. (2006). Norman E. Shumway and the early heart transplants. Tex Heart Inst J 33:274-5; author reply 275. 19. Dixon JA and FG Spinale. (2009). Large animal models of heart failure: a critical link in the translation of basic science to clinical practice. Circ Heart Fail 2:262-71. 20. Ostrander EA, F Galibert and DF Patterson. (2000). Canine genetics comes of age. Trends Genet 16:117-24. 21. Garibal J, E Hollville, AI Bell, GL Kelly, B Renouf, Y Kawaguchi, AB Rickinson and J Wiels. (2007). Truncated form of the Epstein-Barr virus protein EBNA-LP protects against caspase-dependent apoptosis by inhibiting protein phosphatase 2A. J Virol 81:7598-607. 22. Webb AA, ND Jeffery, NJ Olby and GD Muir. (2004). Behavioural analysis of the efficacy of treatments for injuries to the spinal cord in animals. Vet Rec 155:22530. 23. Blight AR, JP Toombs, MS Bauer and WR Widmer. (1991). The effects of 4aminopyridine on neurological deficits in chronic cases of traumatic spinal cord injury in dogs: a phase I clinical trial. J Neurotrauma 8:103-19. 24. Jeffery ND, PM Smith, A Lakatos, C Ibanez, D Ito and RJ Franklin. (2006). Clinical canine spinal cord injury provides an opportunity to examine the issues in translating laboratory techniques into practical therapy. Spinal Cord 44:584-93. 105 25. Levine JM, GJ Levine, BF Porter, K Topp and LJ Noble-Haeusslein. (2011). Naturally occurring disk herniation in dogs: an opportunity for pre-clinical spinal cord injury research. J Neurotrauma 28:675-88. 26. Jung DI, J Ha, BT Kang, JW Kim, FS Quan, JH Lee, EJ Woo and HM Park. (2009). A comparison of autologous and allogenic bone marrow-derived mesenchymal stem cell transplantation in canine spinal cord injury. J Neurol Sci 285:67-77. 27. Nishimura T, S Hatoya, R Kanegi, K Sugiura, V Wijewardana, M Kuwamura, M Tanaka, J Yamate, T Izawa, M Takahashi, N Kawate, H Tamada, H Imai and T Inaba. (2013). Generation of functional platelets from canine induced pluripotent stem cells. Stem Cells Dev 22:2026-35. 28. Koh S, R Thomas, S Tsai, S Bischoff, JH Lim, M Breen, NJ Olby and JA Piedrahita. (2013). Growth requirements and chromosomal instability of induced pluripotent stem cells generated from adult canine fibroblasts. Stem Cells Dev 22:951-63. 29. Whitworth DJ, DA Ovchinnikov and EJ Wolvetang. (2012). Generation and characterization of LIF-dependent canine induced pluripotent stem cells from adult dermal fibroblasts. Stem Cells Dev 21:2288-97. 30. Lee AS, D Xu, JR Plews, PK Nguyen, D Nag, JK Lyons, L Han, S Hu, F Lan, J Liu, M Huang, KH Narsinh, CT Long, PE de Almeida, B Levi, N Kooreman, C Bangs, C Pacharinsak, F Ikeno, AC Yeung, SS Gambhir, RC Robbins, MT Longaker and JC Wu. (2011). Preclinical derivation and imaging of autologously transplanted canine induced pluripotent stem cells. J Biol Chem 286:32697-704. 31. Luo J, ST Suhr, EA Chang, K Wang, PJ Ross, LL Nelson, PJ Venta, JG Knott and JB Cibelli. (2011). Generation of leukemia inhibitory factor and basic fibroblast growth factor-dependent induced pluripotent stem cells from canine adult somatic cells. Stem Cells Dev 20:1669-78. 32. Shimada H, A Nakada, Y Hashimoto, K Shigeno, Y Shionoya and T Nakamura. (2010). Generation of canine induced pluripotent stem cells by retroviral transduction and chemical inhibitors. Mol Reprod Dev 77:2. 33. Wray J, T Kalkan and AG Smith. (2010). The ground state of pluripotency. Biochem Soc Trans 38:1027-32. 34. Maienschein J. (1981). Shifting assumptions in American biology: embryology, 1890-1910. J Hist Biol 14:89-113. 35. Kleinsmith LJ and GB Pierce, Jr. (1964). Multipotentiality of Single Embryonal Carcinoma Cells. Cancer Res 24:1544-51. 106 36. Jakob H, T Boon, J Gaillard, J Nicolas and F Jacob. (1973). [Teratocarcinoma of the mouse: isolation, culture and properties of pluripotential cells]. Ann Microbiol (Paris) 124:269-82. 37. Evans MJ. (1972). The isolation and properties of a clonal tissue culture strain of pluripotent mouse teratoma cells. J Embryol Exp Morphol 28:163-76. 38. Brinster RL. (1974). The effect of cells transferred into the mouse blastocyst on subsequent development. J Exp Med 140:1049-56. 39. Evans MJ and MH Kaufman. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature 292:154-6. 40. Martin GR. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc Natl Acad Sci U S A 78:7634-8. 41. Moon SY, YB Park, DS Kim, SK Oh and DW Kim. (2006). Generation, culture, and differentiation of human embryonic stem cells for therapeutic applications. Mol Ther 13:5-14. 42. Solter D, L Shevinsky, BB Knowles and S Strickland. (1979). The induction of antigenic changes in a teratocarcinoma stem cell line (F9) by retinoic acid. Dev Biol 70:515-21. 43. Chambers I and SR Tomlinson. (2009). The transcriptional foundation of pluripotency. Development 136:2311-22. 44. Niwa H, T Burdon, I Chambers and A Smith. (1998). Self-renewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev 12:204860. 45. Xu Y, X Zhu, HS Hahm, W Wei, E Hao, A Hayek and S Ding. (2010). Revealing a core signaling regulatory mechanism for pluripotent stem cell survival and selfrenewal by small molecules. Proc Natl Acad Sci U S A 107:8129-34. 46. Eckfeldt CE, EM Mendenhall and CM Verfaillie. (2005). The molecular repertoire of the 'almighty' stem cell. Nat Rev Mol Cell Biol 6:726-37. 47. Zhao W, X Ji, F Zhang, L Li and L Ma. (2012). Embryonic stem cell markers. Molecules 17:6196-236. 48. Pruszak J, KC Sonntag, MH Aung, R Sanchez-Pernaute and O Isacson. (2007). Markers and methods for cell sorting of human embryonic stem cell-derived neural cell populations. Stem Cells 25:2257-68. 107 49. Takahashi K, K Tanabe, M Ohnuki, M Narita, T Ichisaka, K Tomoda and S Yamanaka. (2007). Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861-72. 50. Yu J, MA Vodyanik, K Smuga-Otto, J Antosiewicz-Bourget, JL Frane, S Tian, J Nie, GA Jonsdottir, V Ruotti, R Stewart, Slukvin, II and JA Thomson. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318:1917-20. 51. Nakagawa M, M Koyanagi, K Tanabe, K Takahashi, T Ichisaka, T Aoi, K Okita, Y Mochiduki, N Takizawa and S Yamanaka. (2008). Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Biotechnol 26:101-6. 52. Kim JB, V Sebastiano, G Wu, MJ Arauzo-Bravo, P Sasse, L Gentile, K Ko, D Ruau, M Ehrich, D van den Boom, J Meyer, K Hubner, C Bernemann, C Ortmeier, M Zenke, BK Fleischmann, H Zaehres and HR Scholer. (2009). Oct4-induced pluripotency in adult neural stem cells. Cell 136:411-9. 53. Blelloch R, M Venere, J Yen and M Ramalho-Santos. (2007). Generation of induced pluripotent stem cells in the absence of drug selection. Cell Stem Cell 1:245-7. 54. Hanna J, M Wernig, S Markoulaki, CW Sun, A Meissner, JP Cassady, C Beard, T Brambrink, LC Wu, TM Townes and R Jaenisch. (2007). Treatment of sickle cell anemia mouse model with iPS cells generated from autologous skin. Science 318:1920-3. 55. Hotta A, AY Cheung, N Farra, K Garcha, WY Chang, P Pasceri, WL Stanford and J Ellis. (2009). EOS lentiviral vector selection system for human induced pluripotent stem cells. Nat Protoc 4:1828-44. 56. Okita K, M Nakagawa, H Hyenjong, T Ichisaka and S Yamanaka. (2008). Generation of mouse induced pluripotent stem cells without viral vectors. Science 322:949-53. 57. Gonzalez F, S Boue and JC Izpisua Belmonte. (2011). Methods for making induced pluripotent stem cells: reprogramming a la carte. Nat Rev Genet 12:23142. 58. Woltjen K, IP Michael, P Mohseni, R Desai, M Mileikovsky, R Hamalainen, R Cowling, W Wang, P Liu, M Gertsenstein, K Kaji, HK Sung and A Nagy. (2009). piggyBac transposition reprograms fibroblasts to induced pluripotent stem cells. Nature 458:766-70. 59. Zhou W and CR Freed. (2009). Adenoviral gene delivery can reprogram human fibroblasts to induced pluripotent stem cells. Stem Cells 27:2667-74. 108 60. Yu J, K Hu, K Smuga-Otto, S Tian, R Stewart, Slukvin, II and JA Thomson. (2009). Human induced pluripotent stem cells free of vector and transgene sequences. Science 324:797-801. 61. Warren L, PD Manos, T Ahfeldt, YH Loh, H Li, F Lau, W Ebina, PK Mandal, ZD Smith, A Meissner, GQ Daley, AS Brack, JJ Collins, C Cowan, TM Schlaeger and DJ Rossi. (2010). Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 7:618-30. 62. Anokye-Danso F, CM Trivedi, D Juhr, M Gupta, Z Cui, Y Tian, Y Zhang, W Yang, PJ Gruber, JA Epstein and EE Morrisey. (2011). Highly efficient miRNA-mediated reprogramming of mouse and human somatic cells to pluripotency. Cell Stem Cell 8:376-88. 63. Kim D, CH Kim, JI Moon, YG Chung, MY Chang, BS Han, S Ko, E Yang, KY Cha, R Lanza and KS Kim. (2009). Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell 4:472-6. 64. Ji Z and B Tian. (2009). Reprogramming of 3' untranslated regions of mRNAs by alternative polyadenylation in generation of pluripotent stem cells from different cell types. PLoS One 4:e8419. 65. Zhou H, S Wu, JY Joo, S Zhu, DW Han, T Lin, S Trauger, G Bien, S Yao, Y Zhu, G Siuzdak, HR Scholer, L Duan and S Ding. (2009). Generation of induced pluripotent stem cells using recombinant proteins. Cell Stem Cell 4:381-4. 66. Tang X, PQ Cai, YQ Lin, M Oudega, B Blits, L Xu, YK Yang and TH Zhou. (2006). Genetic engineering neural stem cell modified by lentivirus for repair of spinal cord injury in rats. Chin Med Sci J 21:120-4. 67. Ying QL, J Wray, J Nichols, L Batlle-Morera, B Doble, J Woodgett, P Cohen and A Smith. (2008). The ground state of embryonic stem cell self-renewal. Nature 453:519-23. 68. Huangfu D, R Maehr, W Guo, A Eijkelenboom, M Snitow, AE Chen and DA Melton. (2008). Induction of pluripotent stem cells by defined factors is greatly improved by small-molecule compounds. Nat Biotechnol 26:795-7. 69. Mikkelsen TS, J Hanna, X Zhang, M Ku, M Wernig, P Schorderet, BE Bernstein, R Jaenisch, ES Lander and A Meissner. (2008). Dissecting direct reprogramming through integrative genomic analysis. Nature 454:49-55. 70. Hanna J, AW Cheng, K Saha, J Kim, CJ Lengner, F Soldner, JP Cassady, J Muffat, BW Carey and R Jaenisch. (2010). Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proc Natl Acad Sci U S A 107:9222-7. 109 71. Hou P, Y Li, X Zhang, C Liu, J Guan, H Li, T Zhao, J Ye, W Yang, K Liu, J Ge, J Xu, Q Zhang, Y Zhao and H Deng. (2013). Pluripotent stem cells induced from mouse somatic cells by small-molecule compounds. Science 341:651-4. 72. Giorgetti A, N Montserrat, T Aasen, F Gonzalez, I Rodriguez-Piza, R Vassena, A Raya, S Boue, MJ Barrero, BA Corbella, M Torrabadella, A Veiga and JC Izpisua Belmonte. (2009). Generation of induced pluripotent stem cells from human cord blood using OCT4 and SOX2. Cell Stem Cell 5:353-7. 73. Sun N, NJ Panetta, DM Gupta, KD Wilson, A Lee, F Jia, S Hu, AM Cherry, RC Robbins, MT Longaker and JC Wu. (2009). Feeder-free derivation of induced pluripotent stem cells from adult human adipose stem cells. Proc Natl Acad Sci U S A 106:15720-5. 74. Giuliani M, N Oudrhiri, ZM Noman, A Vernochet, S Chouaib, B Azzarone, A Durrbach and A Bennaceur-Griscelli. (2011). Human mesenchymal stem cells derived from induced pluripotent stem cells down-regulate NK-cell cytolytic machinery. Blood 118:3254-62. 75. Aasen T, A Raya, MJ Barrero, E Garreta, A Consiglio, F Gonzalez, R Vassena, J Bilic, V Pekarik, G Tiscornia, M Edel, S Boue and JC Izpisua Belmonte. (2008). Efficient and rapid generation of induced pluripotent stem cells from human keratinocytes. Nat Biotechnol 26:1276-84. 76. Labosky PA, DP Barlow and BL Hogan. (1994). Mouse embryonic germ (EG) cell lines: transmission through the germline and differences in the methylation imprint of insulin-like growth factor 2 receptor (Igf2r) gene compared with embryonic stem (ES) cell lines. Development 120:3197-204. 77. Labosky PA, DP Barlow and BL Hogan. (1994). Embryonic germ cell lines and their derivation from mouse primordial germ cells. Ciba Found Symp 182:157-68; discussion 168-78. 78. Kang L, T Wu, Y Tao, Y Yuan, J He, Y Zhang, T Luo, Z Kou and S Gao. (2011). Viable mice produced from three-factor induced pluripotent stem (iPS) cells through tetraploid complementation. Cell Res 21:546-9. 79. Zhao XY, Z Lv, W Li, F Zeng and Q Zhou. (2010). Production of mice using iPS cells and tetraploid complementation. Nat Protoc 5:963-71. 80. Hayes B, SR Fagerlie, A Ramakrishnan, S Baran, M Harkey, L Graf, M Bar, A Bendoraite, M Tewari and B Torok-Storb. (2008). Derivation, characterization, and in vitro differentiation of canine embryonic stem cells. Stem Cells 26:465-73. 81. Schneider MR, E Wolf, J Braun, HJ Kolb and H Adler. (2009). Canine embryonic stem cells: State of the art. Theriogenology. 110 82. Vaags AK, S Rosic-Kablar, CJ Gartley, YZ Zheng, A Chesney, DA Villagomez, SA Kruth and MR Hough. (2009). Derivation and characterization of canine embryonic stem cell lines with in vitro and in vivo differentiation potential. Stem Cells 27:329-40. 83. Hatoya S, R Torii, Y Kondo, T Okuno, K Kobayashi, V Wijewardana, N Kawate, H Tamada, T Sawada, D Kumagai, K Sugiura and T Inaba. (2006). Isolation and characterization of embryonic stem-like cells from canine blastocysts. Mol Reprod Dev 73:298-305. 84. Wilcox JT, E Semple, C Gartley, BA Brisson, SD Perrault, DA Villagomez, C Tayade, S Becker, R Lanza and DH Betts. (2009). Characterization of canine embryonic stem cell lines derived from different niche microenvironments. Stem Cells Dev 18:1167-78. 85. Okita K and S Yamanaka. (2006). Intracellular signaling pathways regulating pluripotency of embryonic stem cells. Curr Stem Cell Res Ther 1:103-11. 86. Matsuda T, T Nakamura, K Nakao, T Arai, M Katsuki, T Heike and T Yokota. (1999). STAT3 activation is sufficient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J 18:4261-9. 87. Wei CL, T Miura, P Robson, SK Lim, XQ Xu, MY Lee, S Gupta, L Stanton, Y Luo, J Schmitt, S Thies, W Wang, I Khrebtukova, D Zhou, ET Liu, YJ Ruan, M Rao and B Lim. (2005). Transcriptome profiling of human and murine ESCs identifies divergent paths required to maintain the stem cell state. Stem Cells 23:166-85. 88. Greber B, G Wu, C Bernemann, JY Joo, DW Han, K Ko, N Tapia, D Sabour, J Sterneckert, P Tesar and HR Scholer. Conserved and divergent roles of FGF signaling in mouse epiblast stem cells and human embryonic stem cells. Cell Stem Cell 6:215-26. 89. Ezashi T, P Das and RM Roberts. (2005). Low O2 tensions and the prevention of differentiation of hES cells. Proc Natl Acad Sci U S A 102:4783-8. 90. Dravid G, Z Ye, H Hammond, G Chen, A Pyle, P Donovan, X Yu and L Cheng. (2005). Defining the role of Wnt/beta-catenin signaling in the survival, proliferation, and self-renewal of human embryonic stem cells. Stem Cells 23:1489-501. 91. Heyer BS, A MacAuley, O Behrendtsen and Z Werb. (2000). Hypersensitivity to DNA damage leads to increased apoptosis during early mouse development. Genes Dev 14:2072-84. 92. Roos WP, M Christmann, ST Fraser and B Kaina. (2007). Mouse embryonic stem cells are hypersensitive to apoptosis triggered by the DNA damage O(6)methylguanine due to high E2F1 regulated mismatch repair. Cell Death Differ 14:1422-32. 111 93. Don CW and CE Murry. (2013). Improving survival and efficacy of pluripotent stem cell-derived cardiac grafts. J Cell Mol Med 17:1355-62. 94. Ohgushi M, M Matsumura, M Eiraku, K Murakami, T Aramaki, A Nishiyama, K Muguruma, T Nakano, H Suga, M Ueno, T Ishizaki, H Suemori, S Narumiya, H Niwa and Y Sasai. (2010). Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell 7:225-39. 95. Hetz C. (2008). Apoptosis, necrosis and autophagy: from mechanisms to biomedical applications. Curr Mol Med 8:76-7. 96. Elmore S. (2007). Apoptosis: a review of programmed cell death. Toxicol Pathol 35:495-516. 97. Proskuryakov SY, AG Konoplyannikov and VL Gabai. (2003). Necrosis: a specific form of programmed cell death? Exp Cell Res 283:1-16. 98. Thomson JA, J Kalishman, TG Golos, M Durning, CP Harris, RA Becker and JP Hearn. (1995). Isolation of a primate embryonic stem cell line. Proc Natl Acad Sci U S A 92:7844-8. 99. Iannaccone PM, GU Taborn, RL Garton, MD Caplice and DR Brenin. (1994). Pluripotent embryonic stem cells from the rat are capable of producing chimeras. Dev Biol 163:288-92. 100. Hall VJ, P Stojkovic and M Stojkovic. (2006). Using therapeutic cloning to fight human disease: a conundrum or reality? Stem Cells 24:1628-37. 101. Ezashi T, BP Telugu, AP Alexenko, S Sachdev, S Sinha and RM Roberts. (2009). Derivation of induced pluripotent stem cells from pig somatic cells. Proc Natl Acad Sci U S A. 102. Schneider MR, E Wolf, J Braun, HJ Kolb and H Adler. (2008). Canine embryoderived stem cells and models for human diseases. Hum Mol Genet 17:R42-7. 103. Lindblad-Toh K and CM Wade and TS Mikkelsen and EK Karlsson and DB Jaffe and M Kamal and M Clamp and JL Chang and EJ Kulbokas, 3rd and MC Zody and E Mauceli and X Xie and M Breen and RK Wayne and EA Ostrander and CP Ponting and F Galibert and DR Smith and PJ DeJong and E Kirkness and P Alvarez and T Biagi and W Brockman and J Butler and CW Chin and A Cook and J Cuff and MJ Daly and D DeCaprio and S Gnerre and M Grabherr and M Kellis and M Kleber and C Bardeleben and L Goodstadt and A Heger and C Hitte and L Kim and KP Koepfli and HG Parker and JP Pollinger and SM Searle and NB Sutter and R Thomas and C Webber and J Baldwin and A Abebe and A Abouelleil and L Aftuck and M Ait-Zahra and T Aldredge and N Allen and P An and S Anderson and C Antoine and H Arachchi and A Aslam and L Ayotte and P Bachantsang and A Barry and T Bayul and M Benamara and A Berlin and D 112 Bessette and B Blitshteyn and T Bloom and J Blye and L Boguslavskiy and C Bonnet and B Boukhgalter and A Brown and P Cahill and N Calixte and J Camarata and Y Cheshatsang and J Chu and M Citroen and A Collymore and P Cooke and T Dawoe and R Daza and K Decktor and S DeGray and N Dhargay and K Dooley and P Dorje and K Dorjee and L Dorris and N Duffey and A Dupes and O Egbiremolen and R Elong and J Falk and A Farina and S Faro and D Ferguson and P Ferreira and S Fisher and M FitzGerald and K Foley and C Foley and A Franke and D Friedrich and D Gage and M Garber and G Gearin and G Giannoukos and T Goode and A Goyette and J Graham and E Grandbois and K Gyaltsen and N Hafez and D Hagopian and B Hagos and J Hall and C Healy and R Hegarty and T Honan and A Horn and N Houde and L Hughes and L Hunnicutt and M Husby and B Jester and C Jones and A Kamat and B Kanga and C Kells and D Khazanovich and AC Kieu and P Kisner and M Kumar and K Lance and T Landers and M Lara and W Lee and JP Leger and N Lennon and L Leuper and S LeVine and J Liu and X Liu and Y Lokyitsang and T Lokyitsang and A Lui and J Macdonald and J Major and R Marabella and K Maru and C Matthews and S McDonough and T Mehta and J Meldrim and A Melnikov and L Meneus and A Mihalev and T Mihova and K Miller and R Mittelman and V Mlenga and L Mulrain and G Munson and A Navidi and J Naylor and T Nguyen and N Nguyen and C Nguyen and R Nicol and N Norbu and C Norbu and N Novod and T Nyima and P Olandt and B O'Neill and K O'Neill and S Osman and L Oyono and C Patti and D Perrin and P Phunkhang and F Pierre and M Priest and A Rachupka and S Raghuraman and R Rameau and V Ray and C Raymond and F Rege and C Rise and J Rogers and P Rogov and J Sahalie and S Settipalli and T Sharpe and T Shea and M Sheehan and N Sherpa and J Shi and D Shih and J Sloan and C Smith and T Sparrow and J Stalker and N StangeThomann and S Stavropoulos and C Stone and S Stone and S Sykes and P Tchuinga and P Tenzing and S Tesfaye and D Thoulutsang and Y Thoulutsang and K Topham and I Topping and T Tsamla and H Vassiliev and V Venkataraman and A Vo and T Wangchuk and T Wangdi and M Weiand and J Wilkinson and A Wilson and S Yadav and S Yang and X Yang and G Young and Q Yu and J Zainoun and L Zembek and A Zimmer and ES Lander. (2005). Genome sequence, comparative analysis and haplotype structure of the domestic dog. Nature 438:803-19. 104. Yamada S, Y Shimazu, Y Kawano, M Nakazawa, K Naito and Y Toyoda. (1993). In vitro maturation and fertilization of preovulatory dog oocytes. J Reprod Fertil Suppl 47:227-9. 105. Yamada S, Y Shimazu, H Kawaji, M Nakazawa, K Naito and Y Toyoda. (1992). Maturation, fertilization, and development of dog oocytes in vitro. Biol Reprod 46:853-8. 106. Shimada H, A Nakada, Y Hashimoto, K Shigeno, Y Shionoya and T Nakamura. Generation of canine induced pluripotent stem cells by retroviral transduction and chemical inhibitors. Mol Reprod Dev 77:2. 113 107. Ross PJ, S Suhr, RM Rodriguez, EA Chang, K Wang, K Siripattarapravat, T Ko and JB Cibelli. (2009). Human Induced Pluripotent Stem Cells Produced Under Xeno-Free Conditions. Stem Cells Dev. 108. Suhr ST, EA Chang, RM Rodriguez, K Wang, PJ Ross, Z Beyhan, S Murthy and JB Cibelli. (2009). Telomere dynamics in human cells reprogrammed to pluripotency. PLoS One 4:e8124. 109. Wang K, Y Chen, EA Chang, JG Knott and JB Cibelli. (2009). Dynamic epigenetic regulation of the Oct4 and Nanog regulatory regions during neural differentiation in rhesus nuclear transfer embryonic stem cells. Cloning Stem Cells 11:483-96. 110. Shiota K. (2004). DNA methylation profiles of CpG islands for cellular differentiation and development in mammals. Cytogenet Genome Res 105:32534. 111. Jaenisch R and A Bird. (2003). Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nat Genet 33 Suppl:245-54. 112. Mellersh CS, AA Langston, GM Acland, MA Fleming, K Ray, NA Wiegand, LV Francisco, M Gibbs, GD Aguirre and EA Ostrander. (1997). A linkage map of the canine genome. Genomics 46:326-36. 113. Irion DN, AL Schaffer, TR Famula, ML Eggleston, SS Hughes and NC Pedersen. (2003). Analysis of genetic variation in 28 dog breed populations with 100 microsatellite markers. J Hered 94:81-7. 114. Neilan BA, AN Wilton and D Jacobs. (1997). A universal procedure for primer labelling of amplicons. Nucleic Acids Res 25:2938-9. 115. Onogi A, M Nurimoto, Y Sato and M Morita. (2008). A chromosomal duplication that includes the canine microsatellite INRA21 in Labrador Retrievers. Anim Genet 39:241-8. 116. Ginis I, Y Luo, T Miura, S Thies, R Brandenberger, S Gerecht-Nir, M Amit, A Hoke, MK Carpenter, J Itskovitz-Eldor and MS Rao. (2004). Differences between human and mouse embryonic stem cells. Dev Biol 269:360-80. 117. Chan EM, S Ratanasirintrawoot, IH Park, PD Manos, YH Loh, H Huo, JD Miller, O Hartung, J Rho, TA Ince, GQ Daley and TM Schlaeger. (2009). Live cell imaging distinguishes bona fide human iPS cells from partially reprogrammed cells. Nat Biotechnol 27:1033-7. 118. Sommer CA, AG Sommer, TA Longmire, C Christodoulou, DD Thomas, M Gostissa, FW Alt, GJ Murphy, DN Kotton and G Mostoslavsky. Excision of 114 reprogramming transgenes improves the differentiation potential of iPS cells generated with a single excisable vector. Stem Cells 28:64-74. 119. Kim K, A Doi, B Wen, K Ng, R Zhao, P Cahan, J Kim, MJ Aryee, H Ji, LI Ehrlich, A Yabuuchi, A Takeuchi, KC Cunniff, H Hongguang, S McKinney-Freeman, O Naveiras, TJ Yoon, RA Irizarry, N Jung, J Seita, J Hanna, P Murakami, R Jaenisch, R Weissleder, SH Orkin, IL Weissman, AP Feinberg and GQ Daley. Epigenetic memory in induced pluripotent stem cells. Nature 467:285-90. 120. Ieda M, JD Fu, P Delgado-Olguin, V Vedantham, Y Hayashi, BG Bruneau and D Srivastava. Direct reprogramming of fibroblasts into functional cardiomyocytes by defined factors. Cell 142:375-86. 121. Huangfu D, K Osafune, R Maehr, W Guo, A Eijkelenboom, S Chen, W Muhlestein and DA Melton. (2008). Induction of pluripotent stem cells from primary human fibroblasts with only Oct4 and Sox2. Nat Biotechnol 26:1269-75. 122. Buk DM, M Waibel, C Braig, AS Martens, PC Heinrich and L Graeve. (2004). Polarity and lipid raft association of the components of the ciliary neurotrophic factor receptor complex in Madin-Darby canine kidney cells. J Cell Sci 117:206375. 123. Zou Y, H Takano, M Mizukami, H Akazawa, Y Qin, H Toko, M Sakamoto, T Minamino, T Nagai and I Komuro. (2003). Leukemia inhibitory factor enhances survival of cardiomyocytes and induces regeneration of myocardium after myocardial infarction. Circulation 108:748-53. 124. Kerr BJ and PH Patterson. (2005). Leukemia inhibitory factor promotes oligodendrocyte survival after spinal cord injury. Glia 51:73-9. 125. Pesce M, MG Farrace, M Piacentini, S Dolci and M De Felici. (1993). Stem cell factor and leukemia inhibitory factor promote primordial germ cell survival by suppressing programmed cell death (apoptosis). Development 118:1089-94. 126. Starkey MP, TJ Scase, CS Mellersh and S Murphy. (2005). Dogs really are man's best friend--canine genomics has applications in veterinary and human medicine! Brief Funct Genomic Proteomic 4:112-28. 127. Luo J, ST Suhr, EA Chang, K Wang, PJ Ross, LL Nelson, PJ Venta, JG Knott and JB Cibelli. (2011). Generation of Leukemia Inhibitory Factor and Basic Fibroblast Growth Factor-Dependent Induced Pluripotent Stem Cells from Canine Adult Somatic Cells. Stem Cells and Development 20:1669-1678. 128. Schneider MR, E Wolf, J Braun, HJ Kolb and H Adler. (2010). Canine embryonic stem cells: state of the art. Theriogenology 74:492-7. 115 129. Eiselleova L, I Peterkova, J Neradil, I Slaninova, A Hampl and P Dvorak. (2008). Comparative study of mouse and human feeder cells for human embryonic stem cells. Int J Dev Biol 52:353-63. 130. Wang L, TC Schulz, ES Sherrer, DS Dauphin, S Shin, AM Nelson, CB Ware, M Zhan, CZ Song, X Chen, SN Brimble, A McLean, MJ Galeano, EW Uhl, KA D'Amour, JD Chesnut, MS Rao, CA Blau and AJ Robins. (2007). Self-renewal of human embryonic stem cells requires insulin-like growth factor-1 receptor and ERBB2 receptor signaling. Blood 110:4111-9. 131. Chen YG, Z Li and XF Wang. (2012). Where PI3K/Akt meets Smads: the crosstalk determines human embryonic stem cell fate. Cell Stem Cell 10:231-2. 132. Griffiths DS, J Li, MA Dawson, MW Trotter, YH Cheng, AM Smith, W Mansfield, P Liu, T Kouzarides, J Nichols, AJ Bannister, AR Green and B Gottgens. (2011). LIF-independent JAK signalling to chromatin in embryonic stem cells uncovered from an adult stem cell disease. Nat Cell Biol 13:13-21. 133. Darr H, Y Mayshar and N Benvenisty. (2006). Overexpression of NANOG in human ES cells enables feeder-free growth while inducing primitive ectoderm features. Development 133:1193-201. 134. Trouillas M, C Saucourt, D Duval, X Gauthereau, C Thibault, D Dembele, O Feraud, J Menager, M Rallu, L Pradier and H Boeuf. (2008). Bcl2, a transcriptional target of p38alpha, is critical for neuronal commitment of mouse embryonic stem cells. Cell Death Differ 15:1450-9. 135. Duval D, M Malaise, B Reinhardt, C Kedinger and H Boeuf. (2004). A p38 inhibitor allows to dissociate differentiation and apoptotic processes triggered upon LIF withdrawal in mouse embryonic stem cells. Cell Death Differ 11:331-41. 136. Renton JP, JS Boyd, PD Eckersall, JM Ferguson, MJ Harvey, J Mullaney and B Perry. (1991). Ovulation, fertilization and early embryonic development in the bitch (Canis familiaris). J Reprod Fertil 93:221-31. 137. Chen G, DR Gulbranson, Z Hou, JM Bolin, V Ruotti, MD Probasco, K SmugaOtto, SE Howden, NR Diol, NE Propson, R Wagner, GO Lee, J AntosiewiczBourget, JM Teng and JA Thomson. (2011). Chemically defined conditions for human iPSC derivation and culture. Nat Methods 8:424-9. 138. Verma R, MK Holland, P Temple-Smith and PJ Verma. (2012). Inducing pluripotency in somatic cells from the snow leopard (Panthera uncia), an endangered felid. Theriogenology 77:220-8, 228 e1-2. 139. Cao H, P Yang, Y Pu, X Sun, H Yin, Y Zhang, Y Zhang, Y Li, Y Liu, F Fang, Z Zhang, Y Tao and X Zhang. (2012). Characterization of bovine induced pluripotent stem cells by lentiviral transduction of reprogramming factor fusion proteins. Int J Biol Sci 8:498-511. 116 140. Han X, J Han, F Ding, S Cao, SS Lim, Y Dai, R Zhang, Y Zhang, B Lim and N Li. (2011). Generation of induced pluripotent stem cells from bovine embryonic fibroblast cells. Cell Res 21:1509-12. 141. Breton A, R Sharma, AC Diaz, AG Parham, A Graham, C Neil, CB Whitelaw, E Milne and FX Donadeu. (2013). Derivation and characterization of induced pluripotent stem cells from equine fibroblasts. Stem Cells Dev 22:611-21. 142. Nagy K, HK Sung, P Zhang, S Laflamme, P Vincent, S Agha-Mohammadi, K Woltjen, C Monetti, IP Michael, LC Smith and A Nagy. (2011). Induced pluripotent stem cell lines derived from equine fibroblasts. Stem Cell Rev 7:693702. 143. Hamanaka S, T Yamaguchi, T Kobayashi, M Kato-Itoh, S Yamazaki, H Sato, A Umino, Y Wakiyama, M Arai, M Sanbo, M Hirabayashi and H Nakauchi. (2011). Generation of germline-competent rat induced pluripotent stem cells. PLoS One 6:e22008. 144. Liskovykh M, I Chuykin, A Ranjan, D Safina, E Popova, E Tolkunova, V Mosienko, JM Minina, NS Zhdanova, JJ Mullins, M Bader, N Alenina and A Tomilin. (2011). Derivation, characterization, and stable transfection of induced pluripotent stem cells from Fischer344 rats. PLoS One 6:e27345. 145. Esteban MA, J Xu, J Yang, M Peng, D Qin, W Li, Z Jiang, J Chen, K Deng, M Zhong, J Cai, L Lai and D Pei. (2009). Generation of induced pluripotent stem cell lines from Tibetan miniature pig. J Biol Chem 284:17634-40. 146. Ezashi T, BP Telugu and RM Roberts. (2012). Induced pluripotent stem cells from pigs and other ungulate species: an alternative to embryonic stem cells? Reprod Domest Anim 47 Suppl 4:92-7. 147. Fan N, J Chen, Z Shang, H Dou, G Ji, Q Zou, L Wu, L He, F Wang, K Liu, N Liu, J Han, Q Zhou, D Pan, D Yang, B Zhao, Z Ouyang, Z Liu, Y Zhao, L Lin, C Zhong, Q Wang, S Wang, Y Xu, J Luan, Y Liang, Z Yang, J Li, C Lu, G Vajta, Z Li, H Ouyang, H Wang, Y Wang, Y Yang, Z Liu, H Wei, Z Luan, MA Esteban, H Deng, H Yang, D Pei, N Li, G Pei, L Liu, Y Du, L Xiao and L Lai. (2013). Piglets cloned from induced pluripotent stem cells. Cell Res 23:162-6. 148. Kwon DJ, H Jeon, KB Oh, SA Ock, GS Im, SS Lee, SK Im, JW Lee, SJ Oh, JK Park and S Hwang. (2013). Generation of leukemia inhibitory factor-dependent induced pluripotent stem cells from the massachusetts general hospital miniature pig. Biomed Res Int 2013:140639. 149. Liu Y, JY Yang, Y Lu, P Yu, CR Dove, JM Hutcheson, JL Mumaw, SL Stice and FD West. (2013). alpha-1,3-Galactosyltransferase knockout pig induced pluripotent stem cells: a cell source for the production of xenotransplant pigs. Cell Reprogram 15:107-16. 117 150. Montserrat N, EG Bahima, L Batlle, S Hafner, AM Rodrigues, F Gonzalez and JC Izpisua Belmonte. (2011). Generation of pig iPS cells: a model for cell therapy. J Cardiovasc Transl Res 4:121-30. 151. Montserrat N, L de Onate, E Garreta, F Gonzalez, A Adamo, C Eguizabal, S Hafner, R Vassena and JC Izpisua Belmonte. (2012). Generation of feeder-free pig induced pluripotent stem cells without Pou5f1. Cell Transplant 21:815-25. 152. Rajarajan K, MC Engels and SM Wu. (2012). Reprogramming of mouse, rat, pig, and human fibroblasts into iPS cells. Curr Protoc Mol Biol Chapter 23:Unit 23 15. 153. Wu Z, J Chen, J Ren, L Bao, J Liao, C Cui, L Rao, H Li, Y Gu, H Dai, H Zhu, X Teng, L Cheng and L Xiao. (2009). Generation of pig induced pluripotent stem cells with a drug-inducible system. J Mol Cell Biol 1:46-54. 154. Dudley AC, D Thomas, J Best and A Jenkins. (2004). The STATs in cell stresstype responses. Cell Commun Signal 2:8. 155. Vallier L, S Mendjan, S Brown, Z Chng, A Teo, LE Smithers, MW Trotter, CH Cho, A Martinez, P Rugg-Gunn, G Brons and RA Pedersen. (2009). Activin/Nodal signalling maintains pluripotency by controlling Nanog expression. Development 136:1339-49. 118