PLANT MUTATOR-LIKE TRANSPOSABLE ELEMENTS (MULES): THEIR
EVOLUTIONARY DYNAMICS, INTERACTION WITH GENES, AND
RECAPITULATION OF TRANSPOSITION ACTIVITY IN YEAST
By
Dongyan Zhao

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of
Plant Breeding, Genetics and Biotechnology - Horticulture - Doctor of Philosophy
2014

ABSTRACT
PLANT MUTATOR-LIKE TRANSPOSABLE ELEMENTS (MULES): THEIR
EVOLUTIONARY DYNAMICS, INTERACTION WITH GENES, AND
RECAPITULATION OF TRANSPOSITION ACTIVITY IN YEAST
By
Dongyan Zhao
Transposable elements (TEs) are genomic sequences that can move from one position to
another within a genome, where the movement is catalyzed by transposases. Mutator-like
transposable elements (MULEs) belong to a highly mutagenic and widespread TE
superfamily. This dissertation focuses on studying the evolution and biology of MULEs in
plants, specifically in three projects described below.
While the maize genome (2,500 Mb) is six times larger than the rice genome (380 Mb), it
contains fewer MULEs than the latter (12,900 vs. 32,000). The differential amplification of
MULEs in the two genomes prompted us to investigate the status of MULEs containing
transposase (coding-MULEs). The results indicate that they harbor similar amount of
candidate coding-MULEs; however, the majority of candidate coding-MULEs in maize are
defective. This is partly due to the higher amount of LTR retrotransposons that disrupt the
coding region of MULEs in maize. Additionally, the candidate coding-MULEs seem to be
subjected to higher indel rate in maize than that in rice, which accelerate the deterioration of
maize elements. Collectively, nested insertions and accumulation of indels may explain the
low abundance of MULEs in maize than that in rice.
To date, MULEs have been only shown to be active in their native hosts. In this study,
transposition of a rice MULE was recapitulated in yeast, representing the first report of
MULE transposition in a heterologous species. The wild-type transposase induced low
transposition frequency; however, it could be improved by a variety of transposase
modifications. Deletion of the N-terminal 129 amino acids led to enhanced activity as well as
altered cellular localization of the transposase. Mutational analysis revealed a critical region

of the transposase, where changes of the amino acid compositions resulted in either enhanced
or repressed activity. Additionally, fusion of a peptide to the N-terminal deleted transposase
also enhanced transposition frequency, which is the first report of transposition activity
enhancement by protein fusion. Taken together, the establishment of the MULE transposition
system in yeast laid the foundation for further studying MULE biology.
MULEs have the propensity to insert into genic regions, which influence the expression
of adjacent genes. To determine whether MULEs played any role in the Illinois Long-Term
Selection Experiment (ILTSE) maize strains, MULE insertions that are co-segregating with
either high or low protein maize strains were studied. Consistent with previous studies, most
insertions (~79%) were located in low-copy regions. Interestingly, compared with MULEs in
the B73 maize genome, co-segregating insertions are over-represented in exons and equally
represented in the 5′ and 3′ regions of genes, which is in contrast to the 5′ insertion preference
of MULEs reported in previous studies. Expression analysis revealed that out of 55 genes
with adjacent co-segregating insertions, over 1/4 exhibited altered expression levels and may
be associated with the selected trait. Further studies are needed to test whether there are
causal relationships between these co-segregating MULE insertions and kernel protein
content.

ACKNOWLEDGEMENTS
First and foremost, I would like to thank my advisor, Dr. Ning Jiang, who gave me the
chance to work in her lab, allowed and guided me to conduct different kinds of research, and
helped me with my writing. I have grown immensely over the past few years under her
guidance. Thanks to our frequent discussions, which spurred novel ideas for my projects,
allowed me to see the beauty of science and know how to be a good researcher. I also thank
members of my guidance committee, Dr. Cornellius Barry, Dr. Rebecca Grumet, Dr. ShinHan Shiu, and Dr. Dechun Wang, who provided constructive and insightful ideas for my
research.
I thank Dr. Steve Moose and Dr. Han Zhao (University of Illinois at Urbana-Champaign)
for kindly providing materials of the Illinois Long-Term Selection Experiment maize
populations; Dr. Sue Wessler and Dr. Nathan Hancock (University of Georgia) for providing
me the vectors and protocols for the yeast project. Special thanks go to Dr. Robin Buell for
her effort in organizing the Applied Bioinformatics Workshop, where I learned skills in
analyzing next-generation sequencing data. I also thank Robin for letting me be her teaching
assistant of the Plant Genomics course, which is a valuable experience. I thank Dr. Melinda
Frame for helping me with the confocal microscopy experiment. Thanks also go to all the
collaborators and friends for helping me with my research work, Dr. Guo-qing Song, Dr.
Zhulong Chan, Dr. Pingfang Yang, Dr. John Hamilton, Dr. Kevin Childs, Dr. Yuehua Cui, Dr.
Jiming Jiang (University of Wisconsin-Madison), Dr. Dave Douches, Dr. Miguel Flores, Dr.
Melissa Lehti-Shiu, and Dr. Gaurav Moghe.
Thanks go to the past and current members of the Jiang lab, Dongmei Yin, Ann Armenia
Ferguson, Veronica Vallejo, Stefan Cerbin, Dongying Gao, Jason Miller, Shujun, Ou, and

iv

Scott Funkhouser. I especially thank Dongmei, Ann, and Veronica for helping me adapt to
the new environment when I first joined the lab. I also thank Jason for providing me
protocols for the yeast project.
The joint-lab meeting of Department of Horticulture provided me chance to present my
work, which allowed me to improve my communication and presentation skills. I thank all
the labs participating this meeting and all the people for their comments and suggestions. I
also thank Bill Chase and Gary Winchell of the Horticulture Teaching and Research Centre
for helping me with my corn field work every summer.
Finally, I would like to thank my family for their support and understanding of me being
an “eternal” student (25 years) and being far away from them to pursue my study. Special
thanks to my husband, who is always there listening to my complaints (mostly through video
chat) and providing me moral support. Meeting and knowing him is a turning point of my life
and I appreciate him being part of my life.

v

TABLE OF CONTENTS

LIST OF TABLES .....................................................................................................................x
LIST OF FIGURES ................................................................................................................. xi
CHAPTER 1 ..............................................................................................................................1
Introduction and Literature Review ........................................................................................... 1
1.1 Transposable Elements and Their Classification ..................................................... 2
1.1.1 Class I RNA TEs .............................................................................................. 2
1.1.2 Class II DNA TEs ............................................................................................ 3
1.2 Abundance of TEs and Their Impact on Genome Size Variation ........................... 4
1.2.1 Abundance of TEs ............................................................................................ 4
1.2.2 Impact of TEs on Genome Size Variation ....................................................... 5
1.3 MULEs and Pack-MULEs ....................................................................................... 7
1.3.1 Widespread Distribution of MULEs ................................................................ 7
1.3.2 Insertion Preferences of MULEs ...................................................................... 8
1.3.3 MULEs as Tagging Agents .............................................................................. 9
1.3.4 Autonomous MULEs ..................................................................................... 10
1.3.5 Pack-MULEs .................................................................................................. 11
1.4 Structure of Transposases ...................................................................................... 12
1.4.1 The DDE Catalytic Domain ........................................................................... 12
1.4.2 The DNA-Binding Domain ............................................................................ 13
1.5 Regulatory Roles of TEs ........................................................................................ 15
1.5.1 TE Insertions Affect Gene Expression ........................................................... 15
1.5.2 TEs Serve as cis-elements of Protein-Coding Genes ..................................... 16
1.5.3 TEs Serves as Splicing Signals ...................................................................... 17
1.5.4 Novel Genes Derived from TEs ..................................................................... 18
1.5.5 TEs Induce Epigenetic Changes..................................................................... 19
1.6 TEs in Population, Adaptation and Artificial Selection of Plants ......................... 20
1.6.1 TE Activation by Stress ................................................................................. 20
1.6.2 TEs in Plant Adaptation ................................................................................. 21
1.6.3 TEs in Plant Domestication............................................................................ 21
1.7 Outline for This Dissertation ................................................................................. 22
REFERENCES ............................................................................................................ 24
CHAPTER 2 ............................................................................................................................37
Nested Insertions and Accumulation of Indels are Negatively Correlated with Abundance of
Mutator-Like Transposable Elements in Maize and Rice ....................................................... 37
2.1 Abstract .................................................................................................................. 38
2.2 Introduction ............................................................................................................ 39
2.3 Results .................................................................................................................... 42
2.3.1 Candidate MULEs Containing Transposase Sequences (Coding-MULEs) in
Maize and Rice........................................................................................................ 42
2.3.2 Nested Insertions within the Candidate Coding-MULEs............................... 45
vi

2.3.3 Coding Capacity of the Candidate Coding-MULEs ...................................... 49
2.3.4 Other Insertions and Deletions within the Candidate Coding-MULEs ......... 55
2.3.5 Expression Evidence of the Candidate Coding-MULEs in Maize and Rice . 57
2.4 Discussion .............................................................................................................. 61
2.4.1 Differential Amplification of MULEs Including Coding-MULEs in Maize
and Rice................................................................................................................... 61
2.4.2 Factors Involved in Degeneration of Coding-MULEs ................................... 62
2.4.3 Interaction between Different TEs ................................................................. 65
2.5 Materials and Methods ........................................................................................... 67
2.5.1 Genomic Sequences and TE Libraries ........................................................... 67
2.5.2 Identification of Candidate Coding-MULEs .................................................. 68
2.5.3 Detection of Nested TE Insertions in the Candidate Coding-MULEs and
Estimation of Ages of Nested LTR Retroelements ................................................. 70
2.5.4 Determination of the Coding Capacity of the Candidate Coding-MULEs .... 70
2.5.5 Determination of Indels in the Candidate Coding-MULEs ........................... 72
2.5.6 Phylogenetic Analysis .................................................................................... 73
2.5.7 Determination of the Expression Status of the Candidate Coding-MULEs .. 74
2.6 Acknowledgments.................................................................................................. 74
REFERENCES ............................................................................................................ 75
CHAPTER 3 ............................................................................................................................83
Transposition of a Rice Mutator-Like Element in the Yeast Saccharomyces cerevisiae ........ 83
3.1 Abstract .................................................................................................................. 84
3.2 Introduction ............................................................................................................ 84
3.3 Results .................................................................................................................... 87
3.3.1 The Os3378 Transposase ............................................................................... 87
3.3.2 Os3378-Z is Capable of Induction of Excision and Reinsertion with Low
Frequency in Yeast .................................................................................................. 90
3.3.3 Deletion of the N-Terminal Sequence of Os3378-Z Transposase Enhanced
Excision Frequency Which is Responsive to Galactose Concentrations ................ 92
3.3.4 Excision Frequency Altered by Substitutions of Amino Acids within 105 to
130 aa of Os3378-Z Transposase ............................................................................ 95
3.3.5 Cellular Localization of Os3378-Z Transposases with an N- or C-Terminal
EYFP Fusion as well as its Effect on Excision Frequency ..................................... 97
3.3.6 Protein Levels of Different Forms of Os3378-Z Transposase are not
Correlated with Excision Frequency ....................................................................... 99
3.3.7 Single Os3378 Terminus is Immobile ......................................................... 101
3.3.8 Reinsertion of Os3378NA ............................................................................ 102
3.4 Discussion ............................................................................................................ 105
3.4.1 The Low Copy Number of Os3378 in Rice and Its Relatives is Likely Due to
Its Low Transposition Activity of the Relevant Transposase ............................... 105
3.4.2 Transposition of Os3378 in a Heterologous Organism ................................ 106
3.4.3 A Single Transposase of Os3378 Catalyzes Both Excision and Reinsertion
Events .................................................................................................................... 107
3.4.4 Comparison of Target Specificity between Rice and Yeast......................... 108
3.4.5 A Critical Region for Modification of Transposition Activity through
Deletion and Substitutions .................................................................................... 109
vii

3.4.6 Protein Levels and Transposition Activity of Various Forms of Os3378-Z
Transposase ........................................................................................................... 112
3.4.7 The Effect of EYFP Fusion on Transposition Activity as well as Cellular
Localization ........................................................................................................... 113
3.4.8 Retention of Single TIR after Excision Suggests a Potential Mechanism for
Formation of Pack-MULEs ................................................................................... 115
3.5 Materials and Methods ......................................................................................... 117
3.5.1 Cloning of the Coding Sequence of Os3378 Transposase ........................... 117
3.5.2 Computational Characterization of Functional Domains of the Os3378-Z
Transposase ........................................................................................................... 117
3.5.3 Construction of Reporter and Expression Constructs .................................. 119
3.5.3.1 Reporter Constructs .............................................................................. 119
3.5.3.2 Expression Constructs of the Os3378-Z Transposase with N-terminal
EYFP Tag ......................................................................................................... 119
3.5.3.3 Expression Constructs of the Os3378-Z Transposase without EYFP Tag
.......................................................................................................................... 121
3.5.3.4 Expression Constructs of the Os3378-Z Transposase with C-terminal
EYFP Tag ......................................................................................................... 121
3.5.3.5 Expression Constructs Containing Amino Acid Substitutions in Os3378Z 105-129 ......................................................................................................... 122
3.5.3.6 Expression Constructs with C-terminal FLAG-His6 Dual Tag ............ 123
3.5.4 Transformation of Reporter and Expression Constructs into Yeast and
Selection for ADE2 Revertants ............................................................................. 123
3.5.5 Determination of the Sequences of the Donor Site Following Excisions .... 124
3.5.6 Extraction of Yeast Total Protein and Determination of Protein Levels of
Transposases ......................................................................................................... 124
3.5.7 Determination of the Cellular Localization of Os3378-Z Transposases ...... 125
3.5.8 Analysis of Reinsertions of Os3378NA Following Excisions ..................... 126
APPENDIX ................................................................................................................ 128
REFERENCES .......................................................................................................... 131
CHAPTER 4 ..........................................................................................................................139
Insertions of Mutator-Like Transposable Elements and their Impact on Gene Expression in
the Illinois Long-Term Selection Experiment Maize Strains ................................................ 139
4.1 Abstract ................................................................................................................ 140
4.2 Introduction .......................................................................................................... 141
4.3 Results .................................................................................................................. 146
4.3.1 MULE Insertions .......................................................................................... 146
4.3.1.1 MULE Insertions Segregating with Kernel Protein Content ............... 146
4.3.1.2 Comparison of Co-segregating MULE Insertions with MULEs in the
B73 Maize Genome .......................................................................................... 147
4.3.2 Expression of Genes with Co-segregating MULE Insertions ...................... 148
4.3.2.1 Expression in Immature Kernels .......................................................... 148
4.3.2.2 Expression in Young Leaves ................................................................ 155
4.4 Discussion and Future Work ................................................................................ 156
4.4.1 The Effect of Co-segregating MULE Insertions on Gene Expression ......... 156
4.4.2 The Distribution Pattern of Co-segregating MULE Insertions .................... 158
4.5 Materials and Methods ......................................................................................... 160
viii

4.5.1 Plant Materials and DNA Extraction ........................................................... 160
4.5.2 Detection of MULE Insertions ..................................................................... 161
4.5.3 Determination of Gene Expression Levels .................................................. 162
4.5.4 Detection of MULE Insertions in the B73 Maize Genome.......................... 163
REFERENCES .......................................................................................................... 164
CHAPTER 5 ..........................................................................................................................168
Conclusions and Perspectives ................................................................................................ 168
5.1 Differential Indel Rate between LTR Retrotransposons and Coding-MULEs in
Maize.......................................................................................................................... 169
5.2 Maintenance of Low Activity of Wild-Type Transposases May be a Tactic for TE
Persistence.................................................................................................................. 171
5.3 A System for Studying Transposition Mechanism of MULEs ............................ 172
5.4 The Evolutionary Origin of Co-segregating MULE Insertions Associated with
Altered Gene Expression ........................................................................................... 173
REFERENCES .......................................................................................................... 175

ix

LIST OF TABLES

Table 2.1 Number and average length of nested TE insertions based on TE classes in the
candidate coding-MULEs. ....................................................................................................... 47
Table 2.2 Insertion preference of candidate coding-MULEs (CMs). ...................................... 49
Table 2.3A Candidate coding-MULEs (CMs) with or without distinct defects in their coding
regions (redundant grouping). .................................................................................................. 51
Table 2.3B Candidate coding-MULEs (CMs) with or without distinct defects in their coding
regions (non-redundant grouping). .......................................................................................... 52
Table 2.4A Candidate coding-MULEs with expression evidence in maize and rice. ............. 59
Table 2.4B Summary of candidate coding-MULEs with expression evidence in maize and
rice............................................................................................................................................ 60
Table 2.5 MURA and MURA-related transposases used in the study. ................................... 69
Table 3.1 Reinsertion sites. .................................................................................................... 129
Table 3.2 Primers used in this study. ..................................................................................... 130
Table 4.1 Comparison of co-segregating MULE insertions in the Illinois protein maize strains
and MULEs in the B73 maize genome .................................................................................. 147
Table 4.2A Summary of expression of genes with co-segregating MULE insertions in their
vicinity. .................................................................................................................................. 148
Table 4.2B Summary of expression of genes with co-segregating MULE insertions in their
flanking regions and UTRs in immature kernels. .................................................................. 148
Table 4.3A Genes with altered expressions in immature kernels between maize lines with and
without MULE insertions. ..................................................................................................... 153
Table 4.3B Comparison of expression of genes in young leaves between maize lines with and
without MULE insertions. ..................................................................................................... 154
x

LIST OF FIGURES

Figure 1.1 Schematic representation of TE classes (from Feschotte et al., 2002) ..................... 3
Figure 2.1 Fraction of candidate coding-MULEs within different size ranges after removing
nested TE insertions. ................................................................................................................ 43
Figure 2.2 Phylogenetic analyses of the candidate coding-MULEs with a DDE domain. ...... 44
Figure 2.3 Fractions of candidate coding-MULEs containing different numbers (A) and types
(B) of nested TE insertions. ..................................................................................................... 46
Figure 2.4 Ages of intact LTR retrotransposons in the candidate coding-MULEs in maize and
rice............................................................................................................................................ 48
Figure 2.5 Fractions of candidate coding-MULEs containing putative intact transposases and
transposases with deletions. ..................................................................................................... 54
Figure 2.6 Average number of indels in maize and rice TEs.................................................. 57
Figure 3.1 Schematic structures of Os3378 and constructs used in this study. ....................... 89
Figure 3.2 Sequences of the donor site following excision of Os3378NA. ............................. 92
Figure 3.3 N-terminal deleted Os3378-Z transposases. ........................................................... 94
Figure 3.4 Os3378-Z-105 transposases with amino acid substitutions and their excision
frequency.................................................................................................................................. 96
Figure 3.5 Cellular localization and excision frequency of N- or C-terminal EYFP-tagged
transposases.............................................................................................................................. 98
Figure 3.6 Western blot analysis and excision frequency of transposases with and without Cterminal FLAG-His6 tag (CFH). ............................................................................................ 101
Figure 3.7 Reinsertions of Os3378NA. .................................................................................. 103

xi

Figure 3.8 Fractions of genomic sequence features of the yeast (S288C). ............................ 105
Figure 3.9 Schematic representation of a potential mechanism of Pack-MULE formation. . 116
Figure 3.10 Os3378-Z transposase. ....................................................................................... 118
Figure 4.1 Overview of selection procedures and characterization of MULE insertions in the
Illinois Long-Term Selection Experiment maize populations. .............................................. 145
Figure 4.2 Schematic representation (A) and expression levels of a guanine nucleotidebinding protein-like gene (GNUP-like) in immature kernels (B) and young leaves of the IHP
and ILP maize strains. ............................................................................................................ 150
Figure 4.3 Schematic representation (A) and expression levels of an SAM domain family
protein in immature kernels (B) and young leaves of the IHP and ILP maize strains. Items are
depicted similarly as that in Figure 4.2. ................................................................................. 150
Figure 4.4 Schematic representation (A) and expression levels of the chaperone protein dnaJ
in immature kernels (B) and young leaves of the IHP and ILP maize strains. Items are
depicted similarly as that in Figure 4.2. ................................................................................. 151
Figure 4.5 Schematic representation (A) and expression levels of a putative pentatricopeptide repeat-containing (PPR) protein in immature kernels (B) and young leaves of the
IHP and ILP maize strains. Items are depicted similarly as that in Figure 4.2. ..................... 152
Figure 4.6 Schematic representation (A) and expression levels of an AMP deaminase in
immature kernels (B) and young leaves of the IHP and ILP maize strains. Items are depicted
similarly as that in Figure 4.2. ............................................................................................... 152

xii

CHAPTER 1

Introduction and Literature Review

1

1.1 Transposable Elements and Their Classification
Transposable elements (TEs), also called transposons, are segments of DNA that can
move from one position to another within a genome and the process is referred to as
transposition. According to a variety of criteria, TEs are divided into different groups
(Wicker et al., 2007; Kapitonov and Jurka, 2008; Abrusan et al., 2009). Based on the mode of
transposition, they are categorized into two major classes. Class I TEs transpose via an RNA
intermediate using a “copy-and-paste” mechanism and class II TEs transpose via a DNA
intermediate through a “cut-and-paste” mechanism. Both TE classes consist of autonomous
and non-autonomous elements, where the former encode protein(s) responsible for catalyzing
transposition of themselves and their corresponding non-autonomous elements. In most cases,
non-autonomous TEs are usually deletion derivatives of the cognate autonomous elements.
Common to most TEs is that they duplicate a short stretch of nucleotides (2-11 bp) of the
genomic loci where they integrate into, which is called target site duplication (TSD).
1.1.1 Class I RNA TEs
Class I TEs, also called RNA TEs or retrotransposons, can be further divided into two
groups: long terminal repeat (LTR) retrotransposons and non-LTR retrotransposons, whereby
the latter consists of long interspersed nuclear elements (LINEs) and short interspersed
nuclear elements (SINEs) (Figure 1b, c). As indicated by the name, LTR retrotransposons are
characterized by the LTR sequences at their 5′ and 3′ ends, which flank sequences encoding
both structural and enzymatic proteins for their transposition. Typically, autonomous LTR
retrotransposons contain two genes, i.e., gag and pol, where the former encodes proteins that
form the virus-like particles in which the mRNAs of these elements are reverse-transcribed
into cDNA followed by integration into new genomic loci. This process is catalyzed by
proteins encoded by the pol gene, including a protease, RNase H, reverse transcriptase (RT),
2

and integrase (IN) (Havecker et al., 2004). Based on the organization of the proteins encoded
by the pol gene, LTR retrotransposons are further divided into two major subgroups: the
Ty1/Copia-like and Ty3/Gypsy-like elements.
Non-LTR retrotransposons harbor no LTR at their ends and are characterized with a poly
adenine tract at their 3′ termini. Autonomous (functional) non-LTR retrotransposons (LINEs)
usually contain two open reading frames (ORFs), encoding proteins necessary for the
transposition (a nucleic acid binding protein (gag), an endonuclease and a reverse
transcriptase). SINEs are shorter in size than LINEs. Sequences of the 3′ region of SINEs
show similarity to that of LINEs while their 5′ regions are more similar to tRNA genes or
7SL RNA genes (Schmidt, 1999). They do not encode reverse transcription machinery and
rely on those from related autonomous elements, e.g., LINEs.

Figure 1.1 Schematic representation of TE classes (from Feschotte et al., 2002)

1.1.2 Class II DNA TEs
The majority of class II TEs (DNA TEs) are flanked by terminal inverted repeats (TIRs)
(Figure. 1a). The length of TIRs varies among different DNA TE families and usually ranges
from several (e.g., hAT, Tc1/mariner elements) to hundreds of nucleotides (such as Mutator
elements (see below)). TIRs contain binding sites for the transposases, proteins encoded by
autonomous DNA TEs and are responsible for both excision and reintegration of DNA TEs
3

(Wicker et al., 2007). Meanwhile, TIRs of non-autonomous elements are also recognized by
transposase proteins encoded by the autonomous elements sharing similar TIR sequences.
Another feature of TIRs is that some of them harbor cis-acting elements, such as promoters,
which guide the expression of genes (including transposase) within the elements and
sometimes genes in close proximity of the elements if outward promoters are within the TIRs
(Barkan and Martienssen, 1991). Transposition of DNA TEs is usually non-duplicative and
the increase in their copy number usually occurs through repair of the original TE locus using
either sister chromatid (chromosome) or homologous sequences within the genome.
Besides DNA TEs with TIRs, there occurs another family, Helitrons, which contain no
TIRs and transpose through a rolling-circle mechanism. They are characterized by the
presence of a small hairpin structure at their 3′ end and the conserved “TC” and “CTRR”
nucleotides at their 5′ and 3′ termini, respectively (Kapitonov and Jurka, 2001).
Computational analysis based on these structural features revealed that Helitrons are
ubiquitous and are present in fungi, plants and animals (Poulter et al., 2003; Hood, 2005;
Yang and Bennetzen, 2009). Autonomous Helitron elements encode Rep/helicase-like and/or
replication protein A-like proteins, which are involved in the transposition process. Unlike
other TEs, they do not generate TSDs.
1.2 Abundance of TEs and Their Impact on Genome Size Variation
1.2.1 Abundance of TEs
Since the discovery of the first TEs (Activator/Dissociation) by Barbara McClintock in
1950s (Mcclintock, 1950), TEs are found to be abundant in a wide range of organisms. TEs
constitute large fractions of most eukaryotic genomes sequenced to date. For example, ~85%
of maize (Zea mays), ~61% of sorghum (Sorghum bicolor), and ~59% of soybean (Glycine
4

max) (Paterson et al., 2009; Schnable et al., 2009; Schmutz et al., 2010) are occupied by TEs.
Even in the very compact Arabidopsis thaliana genome, TEs still account for more than 10%
of the genome (Kaul et al., 2000). A myriad of studies suggest that amplification and loss of
certain TE families could be the most important source for genome size and structure
variations within and between different plant species (Ammiraju et al., 2007; Huang et al.,
2008; Tenaillon et al., 2011).
1.2.2 Impact of TEs on Genome Size Variation
Comparative studies on genome sequences revealed that LTR-retrotransposons were the
largest contributor to genome expansion in plants (Brunner et al., 2005; Piegu et al., 2006).
After diverging from a common ancestor about 15-20 million years ago (mya), the maize
genome size has increased at least 3 times compared with its close relative, sorghum
(SanMiguel et al., 1996). The dramatic difference is attributed to the presence of
retrotransposons in the intergenic regions in maize (Baucom et al., 2009). Through
comparative analysis of allelic chromosomal regions between the two maize inbred lines
Mo17 and B73, over 50% sequences could not align with one another, which indicate
polymorphisms between the sequences (Brunner et al., 2005). A detailed study on these
sequences suggested that the differences were mainly due to insertions of LTRretrotransposons, which are mostly full-length elements and carry target site duplication
(Brunner et al., 2005). Tenaillon et al. (2011) conducted a shot-gun sequencing of maize (Zea
mays ssp. mays. B73) and Zea luxurians. Their analysis revealed that 50% of the genome size
difference between B73 and Z. luxurians can be attributed to the composition of TEs (both
class I and class II TEs). Besides maize, investigation of an LTR retrotransposon family
(RWG: RIRE2, Wallabi, Gran3) in different Oryza species, including all the wild species and
the two domesticated species (O. sativa and O. glaberrima) indicated that the RWG family
5

contributes to the genomic variations across these Oryza lineages and accounts for almost 25%
of the genome enlargement of O. granulata compared to that of O. sativa (Ammiraju et al.,
2007). Another study on transposon insertion polymorphisms (TIPs) between two rice
subspecies, indica and japonica, discovered that more than half of the large insertions and
deletions in the rice genome are caused by TIPs (Huang et al., 2008). A total of 2041 TIPs
were found between 93-11 (an indica cultivar) and Nipponbare (a japonica cultivar), which
account for 14% of the genomic sequence variations between them.
Like maize, Gossypium has also undergone a three-fold increase in genome size.
Hawkins and colleagues inspected individual sequence types of transposable elements using
whole genome shotgun sequencing data from three diploid members of Gossypium and
Gossypioides kirkii, a phylogenetic out-group, and uncovered that the difference in genome
size is largely due to proliferation of one particular group of gypsy-like retrotransposon,
Gorge3 (Hawkins et al., 2006).
The fact that TEs contribute a tremendous amount of genomic variation was explained
partly by the burst amplification of certain TE families during a very short period (Ammiraju
et al., 2007; Tenaillon et al., 2011). In addition, due to their repetitiveness, they provide raw
materials for homologous and ectopic recombination between chromosomal regions with
similar TE sequences, which leads to the reduction of genome size and the increase of
genomic variation (Huang et al., 2008; Wang et al., 2008). Ma and colleagues conducted a
comprehensive structural analysis of a representative sample of LTR retrotransposons in rice
cultivar Nipponbare. In agreement with previous studies, unequal intra-strand homologous
recombination (UHR) and illegitimate recombination (IR) are the critical mechanisms that
led to the purging of these LTR-retrotransposons (Ma et al., 2004). One surprising result they
obtained is that more than 190 Mb of LTR-retrotransposon sequences have been removed
6

from the relatively compact rice genome. In looking for counterbalancing mechanisms to
genomic obesity, it was shown that IR is a major driving force for reducing the size of
Arabidopsis genome (Devos et al., 2002). Collectively, TEs play a double-edged role with
regard to genome size. One the one hand, activation and transposition of TEs can greatly
increase the genome size. On the other hand, their repetitiveness provides templates for
homologous recombination that leads to the reduction of genome size. As a result, genome
contraction may occur when transposition activity is relatively low.
1.3 MULEs and Pack-MULEs
In 1978, Donald Robertson reported the finding of a Mutator (Mu) system in maize y9
stock, which exhibited ~30-fold increase in the mutation rate compared with two other
standard maize inbred lines (M14/W22) (Robertson, 1978). One of his hypotheses is that this
Mu may be a controlling element system, such as Ac/Ds. Indeed, subsequent studies proved
this Mu belonged to a highly mutagenic TE family, which is comprised of an autonomous
(MuDR) and seven fully sequenced non-autonomous elements (Mu1, Mu2/Mu1.7, Mu3, Mu4,
Mu5, Mu7, Mu8) (Bennetzen et al., 1984; Freeling, 1984; Chen et al., 1987; Talbert et al.,
1989; Fleenor et al., 1990; Chomet et al., 1991; Hershberger et al., 1991; Qin et al., 1991). In
addition, at least four other non-autonomous elements were discovered and partially
sequenced. These are Mu10, Mu11, Mu12, and Mu13 (Dietrich et al., 2002; Tan et al., 2011).
All these Mu elements share high similarity of TIR sequences (~220 bp), but contain
heterologous internal sequences.
1.3.1 Widespread Distribution of MULEs
Since the discovery of the Mu element in maize, studies of the family have been
expanded to a wide variety of organisms, including other plant species, bacteria, fungi,
7

animals, and viruses, where these elements were generally referred to as Mutator-like
elements (MULEs) (Eisen et al., 1994; Yu et al., 2000; Chalvet et al., 2003; Rossi et al., 2004;
Neuveglise et al., 2005; Marquez and Pritham, 2010). Using Northern blot, PCR and database
search, it was found the MURA-like sequences (MURA: the transposase encoded by MuDR)
were present in majority of the grass genomes tested, such as barley, sorghum, rice, setaria,
and wheat (Lisch et al., 2001). In Arabidopsis thaliana, Yu et al. (2001) found MULEs with
similar structural characteristics to Mu elements in maize (MURA-like sequence, long TIRs
and ~9 bp TSD) and MULEs that lack the canonical long TIRs, which were named as nonTIR MULEs. Later on, non-TIR-MULEs have been discovered in other organisms, including
yeast (Yarrowia lipolytica), Lotus japonicus, maize (Zea mays) and rice (Oryza sativa)
(Neuveglise et al., 2005; Holligan et al., 2006; Wang and Dooner, 2006; Ferguson et al.,
2013). Besides plants, MULEs, designated Phantom, have also been discovered in a wide
range of animal genomes, providing evidence for the ubiquitous nature of the MULE family
(Marquez and Pritham, 2010).
1.3.2 Insertion Preferences of MULEs
Different TEs possess different preference for their insertion sites. Some TEs more
frequently integrate into chromosomally linked positions of the original site of the elements.
This phenomenon is called “local hopping”. For example, in Arabidopsis plants transformed
with Ac/Ds elements, 68% out of 111 transposed Ds elements were in tight linkage with the
Ds donor site (Bancroft and Dean, 1993), which is similar to the rate observed in maize (59%,
Dooner and Belachew, 1989). This phenomenon also applies to some TEs in animals and the
P element in Drosophila is a good example. It was shown that all new integration sites
recovered were within 128 kb from the starting site of the P elements (Tower and Kurapati,
1994). Unlike the TEs mentioned above, MULEs transpose into both genetically linked and
8

unlinked sites within the genome (Lisch et al., 1995), which makes them good candidates for
whole genome tagging/mutagenesis research (Raizada et al., 2001; McCarty et al., 2013).
When dissecting the insertion sites of MULEs more closely, it is apparent that they
exhibit preferences for genic and/or low copy regions in both naturally occurring and
artificially induced MULE transpositions (Cresse et al., 1995; Das and Martienssen, 1995;
Hanley et al., 2000; Raizada et al., 2001; Dietrich et al., 2002; Liu et al., 2009). In one study
on Mu transposons, ~965,000 Mu flanking sequences (MFSs) were obtained from crosses
between Mu active maize lines and various inbreds and hybrids (Liu et al., 2009). They found
that 365,600 MFSs were uniquely mapped to the B73 maize genome (RefGen_v1). Further
analysis of histone modifications in Mu insertion sites indicated that Mu prefers for open
chromatin regions. Within genes, there appear strong preferences for MULE insertions in the
5′ regions. In analyzing Mu-induced glossy8 mutant alleles, over 80% out of 75 confirmed
Mu insertions were located in the 5′ untranslated region (Dietrich et al., 2002). A similar
study revealed the preferential integration of Mu elements in the 5′ proximal regions of the
Mes1 locus in maize (Haun et al., 2009). Using high-throughput sequencing technology, Liu
et al. (2009) showed that 31,838 uniquely mapped Mu insertions were located within or in the
vicinity (500 bp flanking sequence of genes) of 32,477 annotated genes (B73 RefGen_v1),
where a strong preference was observed for insertions into sequences immediately upstream
of the transcription start site.
1.3.3 MULEs as Tagging Agents
Due to the high mutagenicity and non-specific integration sites (see above), MULEs have
been used as tagging tools for gene discovery and whole genome mutagenesis in maize. A
collection of gene knockout maize mutants generated by RescueMu, a modified Mu1 element
which contained part of a pBluescript plasmid in its internal region, represented an early
9

attempt on exploiting the transposition frequency of MULEs. The resulting mutants facilitate
the understanding of MULE transposition behavior and serve as materials for study of gene
function (Raizada et al., 2001; Fernandes et al., 2004). Another large mutant collection,
which is still ongoing, is the development of the UniformMu transposon insertion lines
(Settles et al., 2007; McCarty et al., 2013). The screening of mutant lines is based on the
excision of Mu1 transposon from a marker gene (Bz1) induced by active MuDR elements. As
of March 2011, there were a total of 12,127 high-confidence genes containing Mu insertions
and

5,952

lines

are

freely

available

for

researchers

(maizegdb.org/documentation/uniformmu/index.php)
1.3.4 Autonomous MULEs
As mentioned earlier, transposition of non-autonomous MULEs was observed in 1978;
however, the regulatory element that catalyzed the transpositions was not discovered until
more than 10 years later. In 1991, several groups independently reported the finding of the
autonomous Mutator element (MuR1 from Chomet et al., 1991; Mu9 from Hershberger et al.,
1991; MuA2 from Qin et al., 1991), which was renamed MuDR, in honor of Donald
Robertson who discovered the first Mutator element. MuDR encodes two genes, mudrA and
mudrB, which are transcribed in a convergent orientation directed by the cis-sequences in the
TIRs (Lisch, 2002). The protein product of mudrA, MURA exhibited homology to some
transposases of insertion sequences in bacteria, thus is considered the transposase for MuDR
(Eisen et al., 1994). MURB, product of mudrB, is suggested to be involved in element
reinsertion but its exact function still remains elusive (Lisch et al., 1999; Raizada and Walbot,
2000; Woodhouse et al., 2006). Homologous sequences of MURA have been found in a wide
range of organisms while the existence of MURB seems restricted to the Zea genus (Yu et al.,
2000; Lisch et al., 2001; Rossi et al., 2004).
10

Besides MuDR, several active autonomous MULEs have been discovered, including two
more elements in maize (Jittery and TED), Hop and Mutyl in fungi, AtMu1 in Arabidopsis,
and Os3378 in rice (Singer et al., 2001; Chalvet et al., 2003; Xu et al., 2004; Neuveglise et al.,
2005; Gao, 2012; Li et al., 2013). Except Mutyl, all other elements contain one open reading
frame (ORF), which was mostly efficient in catalyzing transposition. Mutyl contains two
ORFs, one is the transposase (1178 residues) while no homologous sequence was found for
the second ORF (459 residues) (Neuveglise et al., 2005). These autonomous elements
exhibited different characteristics in their transposition, suggesting the heterogeneity of
MULEs within and among species. For example, transposition of Mu transposons induced by
MuDR usually occurred in terminally differentiated somatic tissues. Furthermore, Mu
transpositions in germ lines rarely accompanied with recovery of the donor site (Lisch et al.,
1995; Raizada and Walbot, 2000). Similarly, germinal insertions occurred for AtMu1 without
losing the original copy in Arabidopsis ddm1 (Decrease in DNA Methylation) mutant plants
(Singer et al., 2001). In contrast to the generation of new copies, the Jittery element excised
but no integration was observed. This unusual behavior led the authors to hypothesize that
either the integration required a B function (like MURB in MuDR), which was missing for
Jittery, or the imperfect 5′ TIR sequence prevented the reintegration (Xu et al., 2004). More
recently, another autonomous MULE was discovered in maize, named TED (for Transposon
Ellen Dempsey), which retains low copy number and seems to be present only in grasses (Li
et al., 2013).
1.3.5 Pack-MULEs
Within the MULE family, a specific group, called Pack-Mutator-like transposable
elements (Pack-MULEs), is distinguished from other MULE elements by having gene or
gene fragments between the TIRs instead of the transposase (Jiang et al., 2004). In rice, there
11

are about 3000 copies of Pack-MULEs, which acquired sequences from over 1,500 non-TE
genes (parental genes). Detailed exploration of available expression datasets revealed that
~22% have expression evidence and 28 have direct evidence of translation (Hanada et al.,
2009). In addition, many Pack-MULEs were under purifying selection, implying functional
roles of these elements (Hanada et al., 2009; Jiang et al., 2011). Subsequent studies revealed a
unique impact of Pack-MULEs in affecting gene structure and genome composition in rice
and maize (Jiang et al., 2011). Specifically, Pack-MULEs preferentially acquired “GC”-rich
sequences and targeted their integration into 5′ regions of genes, therefore, resulted in
formation of genes with negative “GC” gradient (genes with decreasing “GC” content
towards their transcription termination sites).

More recently, Ferguson et al. (2013)

demonstrated that besides the preference for high “GC” sequences, Pack-MULEs exhibited
biased acquisitions of genes with broad expression (genes expressed in more tissues and/or
under more conditions). Collectively, these data indicated that the impact of Pack-MULEs on
gene and genome evolution may be more significant and diversified than what is currently
known.
1.4 Structure of Transposases
1.4.1 The DDE Catalytic Domain
The transposition of class II TEs depends on the transposase protein encoded by
autonomous elements, which is also responsible for the movement of the corresponding nonautonomous elements. A recent analysis suggested that all eukaryotic class II transposases
contain similar catalytic domain structure, which is, in most cases, at the carboxyl-terminal
region (Yuan and Wessler, 2011). That is the conserved acidic amino acid triad consisting of
two aspartic acids and a glutamic acid or a third aspartic acid (“DDE/D”) in the catalytic core,
which features an RNase H-like fold. The three amino acids are brought in close proximity to
12

each other by the RNase H-like fold (Nesmelova and Hackett, 2010). Besides the amino acid
triad, other “signature strings” were found in the catalytic core among different class II TE
superfamilies, which led the authors propose new classification of these TE superfamilies
(Yuan and Wessler, 2011). A study of several transposases with available crystal structures
(e.g., transposases of Tn5, Hermes, bacteria phage Mu, and Mos1) revealed that the distance
between the first two residues (“D”) are more conserved than that between the second “D”
and last “D/E” (Nesmelova and Hackett, 2010) and there appear intervening sequences in the
latter with various lengths. For example, a stretch of ~90 amino acids was inserted in the
second “D” and last “D/E” in Tn5 transposase and for that of Hermes about 300 amino acids
were in that region. Despite the variability of the length of the RNase H-like fold, the
transposases form similar three dimensional structures during the catalytic process. The three
amino acids are critical for the activity, which was evidenced by complete loss of
transposition if they were mutated (Zhou et al., 2004; Lazarow et al., 2012). Without
exception, the MULE transposases also possess the “DDE” catalytic domain in the carboxyl
termini. For MURA, the transposase of MuDR, they are at amino acid positions 331 (the first
“D”), 393 (the second “D”), and 489 (the “E”). Between the first two “D”s, there also occurs
a conversed “DE” at positions 350 and 366, respectively, which can be found in many
MURA-like proteins (Hua-Van and Capy, 2008).
1.4.2 The DNA-Binding Domain
Besides the catalytic domain, a competent transposase also requires a DNA-binding
domain, which recognizes and binds to the TIRs of the transposon. The DNA-binding domain
usually features single or multiple helix-turn-helix motif(s) (HTH), which are often located
near the N-termini of the transposases (Izsvak et al., 2002; Nagy et al., 2004; Hennig and
Ziebuhr, 2010). Similar to the conserved catalytic domain, most class II transposases seem to
13

contain HTH motif(s) in the DNA-binding domain. However, the conservation is more at the
structural level of the proteins and very little conservation at the amino acid level. One of the
most active Tc1/mariner transposons, Sleeping Beauty, contains two consecutive HTH motifs
at its N-terminus, which were referred to as PAI and RED, respectively. Binding assays
showed that the PAI domain (the first N-terminal HTH) is the major structure that contacts
the TIR sequences of the element (Izsvak et al., 2002). Likewise, one bacterial insertion
sequence, IS30 also contains two HTH motifs (referred to as HTH1 and H-HTH2) at the Nterminus of its transposase (Nagy et al., 2004). Nevertheless, site-directed mutagenesis in
these two motifs revealed that the second N-terminal HTH (H-HTH2) played the major role
of binding to the terminal sequence of the element. The bacterial phage Mu transposase
(MuA) contains three HTH motifs at its N-terminus, where the first motif was suggested to
recognize the Mu enhancer and facilitate the assembly of the transposase and transposon
complex while the other two HTH motifs were involved in its DNA-binding activity (Watson
and Chaconas, 1996; Schumacher et al., 1997). In addition to these transposases containing
modular structures of the DNA binding domain, some transposases only contain one HTH
motif, such as that of Tn5 and Hermes (Nesmelova and Hackett, 2010). Hence, the
organization of the DNA-binding structures varies among transposases from different TE
superfamilies. Using gel-shifting assay, Benito and Walbot (1997) demonstrated that MURA
(MuDR transposase) was a DNA-binding protein, which recognized a 32-bp sequence in the
TIRs of the Mu transposons. The transposase of the most closely related bacterial insertion
sequence to the Mu transposons, IS256, was also proved to be a DNA-binding protein
(Hennig and Ziebuhr, 2010). Secondary structure analysis identified two HTH structures in
its N-terminal region, where the second HTH was responsible for the binding of the
transposase to the transposon ends.

14

Common to most class II TEs, transposition starts with binding of the transposase to the
terminal ends of the transposon followed by cleavage of the transposon and finishes by either
integration into new genomic loci or no integration (Munoz-Lopez and Garcia-Perez, 2010).
Hence, to determine whether a transposon has the potency of transposition activity, the
presence of both a catalytic domain and a DNA-binding domain is prerequisite.
1.5 Regulatory Roles of TEs
TEs play important roles in both plants and animals through regulating expression of
adjacent genes, which can be evidenced by large scale expression studies and small scale
investigation of individual genes with TE insertions (Feschotte, 2008; Naito et al., 2009;
Pereira et al., 2009). Using high-throughput sequencing and comparative microarray analysis,
Naito et al. (2009) discovered 1,664 mPing (a DNA transposon) insertion sites in a rice
variety. In this study, expression of the majority of the 710 neighboring genes were either upregulated or had no change, suggesting a modest or positive impact of mPing insertion on
gene transcription. In a broader evolutionary time scale, the effect of TE insertions on gene
expression was studied in mouse and rat (Pereira et al., 2009). It was estimated that ~20 % of
the expression profile divergence between mouse and rat may be due to TE insertions,
reinforcing the important role of TE insertions in regulating gene expression. Molecular
analysis of genes with TE insertions within or in their vicinity revealed the diverse effects of
the insertions on those genes.
1.5.1 TE Insertions Affect Gene Expression
McGinnis et al. (1983) studied a developmentally regulated gene, Sgs-4, in Drosophila,
and found that insertion of a DNA TE (named hobo) just upstream of the TATA box reduced
Sgs-4 expression 50- to 100-fold compared to the wild-type allele. Moreover, two additional
15

transcript splicing forms were produced that were initiated within the hobo element,
suggesting that the element provided transcription initiation signals for the gene (McGinnis et
al., 1983) (also see Section 1.5.2). In maize, a Mu1 insertion in the first intron of Adh1-S
(alcohol dehydrogenase-1) resulted in suppressed expression of alcohol dehydrogenase (40%
of the wild type level) and reduced enzyme activity (Bennetzen et al., 1984). The fact that TE
insertions cause null/reduced function of targeted genes have prompted generation of large
collections of TE-tagging mutants in both plants and animals (Keng et al., 2005; Kolkman et
al., 2005; Settles et al., 2007; Izsvak et al., 2010). These collections provided resources for
discovery of gene function. In addition, there are cases that TE insertions may enhance gene
expression. For example, investigation of the rice genome sequence revealed two copies of
ribosomal protein L6 gene (OsRpl6-1 and OsRpl6-2), where OsRpl6-1 showed higher
expression than that of OsRpl6-2. Sequence search established that OsRpl6-1 contained
sequence homologous to a PIF/Harbinger TE in its 5′ untranslated region, which may render
the higher expression of this copy (Kubo et al., 2008).
1.5.2 TEs Serve as cis-elements of Protein-Coding Genes
TEs can be exapted by the host genome as cis-regulatory elements for protein-coding
genes. A myriad of cases have been reported of TEs serving as promoters, enhancers, and
providing alternative transcription initiation and polyadenylation sites. A comprehensive
study of gene promoter regions (2 kb sequences upstream of the transcription initiation sites)
in human demonstrated that ~83% of 20,193 promoter regions harbor TE insertions. Further
analysis revealed that ~80% of the gene promoter regions contained TEs with regulatory
elements, suggesting that these genes may be subject to the regulation of these nested TEs
(Thornburg et al., 2006). In maize, there occurred many incidents that Mu transposons served
as cis-acting elements. One excellent example is the Mu insertion alleles of rf2a, which
16

encodes a mitochondrial aldehyde dehydrogenase and loss of function of the gene resulted in
male sterility in maize (Cui et al., 1996). Three rf2a alleles with Mu transposon insertions in
maize were studied, where two contained Mu transposon in the 5′ untranslated region (UTR)
and one in the 3′ UTR. In the absence of active MuDR, functional transcripts were produced
because Mu elements provided alternative initiation sites in the first two alleles and
alternative polyadenylation site in the latter case (Cui et al., 2003). However, when active
MuDR was introduced into these maize lines through crossing with Mu-active lines, various
frequencies of male-sterile progenies appeared from these crosses, suggesting the loss of
function of the rf2a gene. The emergence of mutant phenotype caused by Mu insertion in the
presence of active MuDR and loss of mutant phenotype in the absence of active MuDR has
been observed in other Mu-insertion mutants; the phenomenon was called Mu suppression
(Martienssen et al., 1989; Martienssen et al., 1990; Barkan and Martienssen, 1991; Lowe et
al., 1992; Girard and Freeling, 2000).
1.5.3 TEs Serves as Splicing Signals
TE insertions can also lead to alternative RNA splicing, resulting in production of
different forms of transcripts. Chen et al. (2012) found that a transposon insertion in the first
intron of the CAD2 gene (Cinnamyl alcohol dehydrogenase) resulted in a truncated protein,
which was over 300 amino acids shorter than the wild type product. The cause is that a
splicing site within the inserted transposon was used, which resulted in the incorporation of
part of the transposon in the transcripts and a stop codon within the incorporated sequence led
to the early maturation of the gene (Chen et al., 2012). Another example involves a CACTA
element (5.7 kb) which captured sequences from five host genes (Zabala and Vodkin, 2007).
Insertion of this element in the second intron of flavanone 3-hydroxylase gene resulted in
generation of 10 distinct forms of transcripts, including the wild-type transcript. This is
17

because the inserted CACTA element provided a number of splicing sites for the gene. More
recently, a comprehensive study revealed that MITEs contribute to 43 splicing sites in 40
protein coding genes in rice (Oki et al., 2008).
1.5.4 Novel Genes Derived from TEs
The importance of TEs in gene and genome evolution is evidenced by the abundance of
protein coding genes with the entire or partial sequences from TEs. Bioinformatics studies
discovered domesticated transposases in both plants and animals. In Arabidopsis, FAR1 and
FHY3 are involved in the phytochrome A signaling pathway. Sequence analysis revealed that
they were related to the MURA transposase of the MuDR element and their regulation of
target genes resembled the binding activity of the transposase to TIR sequence of the element
(Hudson et al., 2003). Recently, evidence was found that the core sequence (~600 amino
acids out of the total ~1040 residues) of the RAG1 gene, which functions in the V(D)J
recombination in jawed vertebrates, has emerged from a transposase protein of the Transib
superfamily (Kapitonov and Jurka, 2005).
Besides examples of single genes domesticated from TEs, large scale studies
demonstrated the extent that TEs can be exapted and became the integral parts of many
protein-coding genes. The exonization of TEs in human genome is one of the best examples.
The RNA TE, Alu elements (SINE) account for ~10% of the human genome and have been
identified in numerous mature mRNAs. The new exons (or portion of the exons) generated by
these elements are often alternatively spliced and contribute to ~5% of the human
transcriptome (Sorek et al., 2002). In plants, large amount of TE sequences were also found
to be components of many genes. In Arabidopsis, 7.8% of the expressed genes harboring TE
sequences and 1.2% have protein evidence of the exonization of TEs (Lockton and Gaut,
2009). One study in rice found that ~10% of the genes examined (n = 20,507) contained TEs
18

in their exonic regions (Sakai et al., 2007). A study specifically on MITEs revealed that they
are components of more than 300 protein-coding genes in rice (Oki et al., 2008). Eighteen
protein coding genes exapted MITE sequences as transcription initiation sites and 203 as
poly(A) sites.
1.5.5 TEs Induce Epigenetic Changes
Plant genomes have evolved ways to keep transposons inactive, one of which is
epigenetic silencing. This repression of transposon can be exerted at two levels;
transcriptional silencing through DNA methylation and post-transcriptional degradation of
transposon mRNA or inhibition of translation. TE insertions often accompany methylation of
DNA and/or modifications of histones with repressive marks. TE methylation is negatively
correlated with gene expression and methylated TEs close to genes are selected against, thus
resulting in a gradual loss (Hollister and Gaut, 2009).
In studying flower pigmentation associated with TE insertions in morning glory, Iida et
al. (2004) found that a MULE insertion (ItMULE1) in the promoter region of the DFR-B gene
(encoding dihydroflavonol 4-reductase in anthocyanin biosynthesis) resulted in flower
variegation. Interestingly, this variegation only occurred when the DNA methylation spread
from ItMULE1 to the adjacent sequences in the promoter (Iida et al., 2004). Although rare,
TE insertions would lead to enhanced gene expression. The tissue-specific pigmentation of
maize is mediated by the pericarp color1 gene (p1), where, in some maize lines, it occurred
as tandem repeated copies. A Mu insertion in the 5′ untranslated region of one copy resulted
in ectopic expression of one adjacent uninterrupted copy (Robbins et al., 2008). It was
suggested that the hypo-methylation of an enhancer upstream of the Mu insertion was
responsible for the enhanced expression of the uninterrupted p1 copy, which may lie close to
the enhancer.
19

1.6 TEs in Population, Adaptation and Artificial Selection of Plants
1.6.1 TE Activation by Stress
Activation of TEs is often mediated by stress (Wessler, 1996). In other words, TEs often
change from a silent state to active state under stress conditions. A comparative study showed
that in a marine diatom, expression of LTR retrotransposons were highly induced by some
stress conditions, including nitrate starvation and exposure to the toxic aldehydes
(metabolites produced by diatom). This is also supported by the hypomethylation of the LTR
retrotransposons, suggestive of active chromatin state (Maumus et al., 2009). Furthermore,
differential abundance of LTR retrotransposons was proposed to contribute to the
intraspecific genetic diversity among pennate diatom. Another example is the preferential
insertions of some TEs into promoters of RNA Pol II-transcribed genes which are stressinducible. Guo and Levin (2010) identified a total of 73,125 independent integration events
of Tf1 LTR retrotransposon in S. pombe, 76% of which were distributed in intergenic
sequences that contained 31% of the promoters. Gene ontology analysis of genes downstream
of 219 independent insertions revealed high percentage of the genes were stress responsive
(Guo and Levin, 2010). More recently, a genome-wide study of transcriptome of the rice
anther under cold condition (12 °C) revealed that expression of 9.6% of repeat sequences
(e.g., MITEs) increased at least 2-fold compared to rice grown under normal temperature
(Ishiguro et al., 2014). Collectively, activation of TEs under stress conditions may create new
mutations, some of which are likely beneficial for the host. Indeed, it has been suggested that
activation of TEs provides more regulatory sequences for the genome to work on (Jordan et
al., 2003; Chenais et al., 2012).

20

1.6.2 TEs in Plant Adaptation
The rich repertoire of TEs in various genomes combined with their activity upon stress
conditions is considered to be the largest contributors to genome diversity, which enables
environmental plasticity of the host organisms (Lisch, 2009). A study conducted in the
“Evolution Canyon” in Israel revealed significant positive correlations between the number
of BARE-1 retrotransposon in wild barley and the dryness of the microsites where the
samples were collected (Kalendar et al., 2000). They suggested that maintenance of high
copy number of complete BARE-1 in drier environments was a result of response to the
microclimatic changes, which contributed to the increased genome sizes of wild barleys
grown there. During the “Green revolution” in the 1940s to late 1960s, one of the major
research achievements was the adaptation of maize to diverse geographical regions with
differing day lengths and light intensity. Manipulation of flowering time facilitated the
adaptation of maize and a recent study identified a locus that seemed to control the vegetative
to reproductive transition of maize with microcolineality analyses revealing that a MITE
insertion is likely the cause of flowering time changes in the maize variety, Gaspe Flint, one
of the earliest flowering varieties (Salvi et al., 2007).
1.6.3 TEs in Plant Domestication
TEs have also been suggested to be involved in the domestication of several plants, such
as maize (Bhattacharyya et al., 1990; Studer et al., 2011). The cultivated maize is proposed to
be domesticated from the wild progenitor, teosinte, about 10,000 years ago (Matsuoka et al.,
2002). One of the largest phenotypic changes associated with the domestication process, from
multi-branched architecture to single-stalked, was suggested to result from the ectopic
expression of teosinte branched1 (tb1) (Doebley, 1992). Recent work showed that a TE
(Hopscotch) insertion in the tb1 regulatory region results in decreased expression of this gene
21

and increased apical dominance, leading to the repressed branching in maize (Studer et al.,
2011).
1.7 Outline for This Dissertation
My dissertation focused on the studies of Mutator-like transposable elements (MULEs)
in plants, specifically in maize and rice. As mentioned before, the amount of MULEs in
maize and rice is not proportional to the size of their genomes (maize with a genome size of
2,500 Mb and 12,900 MULEs; rice with a genome size of 400 Mb and 30,000 MULEs). I
hypothesize this is attributed to different number and coding capacity of coding-MULEs,
which have the potential to generate transposase required for transposition. Indeed, detailed
analysis suggested that nested TE insertions and accumulation of insertion and deletions in
coding-MULEs are negatively correlated with the abundance of MULEs in maize and rice.
Subsequently, transposition of a rice MULE (Os3378-Z) was recapitulated in yeast. Os3378Z transposase is able to catalyze excision and reinsertion, albeit, with low efficiency.
Manipulation of the transposase sequence, including N-terminal deletion, substitution of
some amino acids, and fusion of the enhanced yellow fluorescent protein, resulted in
increased transposition frequency. The enhanced activity is neither correlated with the levels
of transposase protein nor its cellular localization. Finally, the role of MULEs in the Illinois
Long-Term Selection Experiment maize population (ILTSE) was investigated. The ILTSE
has been selecting maize lines with extreme kernel protein and oil content and the Illinois
protein maize strains were used in the study. Specifically, MULE insertions co-segregating
with kernel protein content were analyzed and compared with those in the B73 maize genome.
This revealed that co-segregating insertions were equally abundant in the 5′ and 3′ regions of
genes in contrast to the pronounced preference for the 5′ regions observed for MULEs in the
B73 genome. Additionally, expression levels of genes with adjacent co-segregating MULE
22

insertions were determined in immature kernels and young leaves. Several genes exhibited
differential expression in immature kernels but not in young leave, suggesting their potential
involvement in artificial selection.

23

REFERENCES

24

REFERENCES

Abrusan G, Grundmann N, DeMester L, Makalowski W (2009) TEclass-a tool for
automated classification of unknown eukaryotic transposable elements.
Bioinformatics 25: 1329-1330
Ammiraju JSS, Zuccolo A, Yu Y, Song X, Piegu B, Chevalier F, Walling JG, Ma J,
Talag J, Brar DS, et al. (2007) Evolutionary dynamics of an ancient retrotransposon
family provides insights into evolution of genome size in the genus Oryza. Plant
Journal 52: 342-351
Bancroft I, Dean C (1993) Transposition pattern of the maize element Ds in Arabidopsis
thaliana. Genetics 134: 1221-1229
Barkan A, Martienssen RA (1991) Inactivation of maize transposon Mu suppresses a
mutant phenotype by activating an outward-reading promoter near the end of Mu1.
Proc. Natl. Acad. Sci. USA 88: 3502-3506
Baucom RS, Estill JC, Chaparro C, Upshaw N, Jogi A, Deragon JM, Westerman RP,
SanMiguel PJ, Bennetzen JL (2009) Exceptional diversity, non-random distribution,
and rapid evolution of retroelements in the B73 maize genome. PLoS Genetics 5:
e1000732 doi:10.1371/journal.pgen.1000732
Bennetzen JL, Swanson J, Taylor WC, Freeling M (1984) DNA insertion in the 1st intron
of maize Adh1 affects message levels: Cloning of progenitor and mutant Adh1 alleles.
Proc. Natl. Acad. Sci. USA 81: 4125-4128
Bhattacharyya MK, Smith AM, Ellis THN, Hedley C, Martin C (1990) The wrinkledseed character of pea described by Mendel is caused by a transposon-like insertion in
a gene encoding starch-branching enzyme. Cell 60: 115-122
Brunner S, Fengler K, Morgante M, Tingey S, Rafalski A (2005) Evolution of DNA
sequence nonhomologies among maize inbreds. Plant Cell 17: 343-360
Chalvet F, Grimaldi C, Kaper F, Langin T, Daboussi MJ (2003) Hop, an active Mutatorlike element in the genome of the fungus Fusarium oxysporum. Molecular Biology
and Evolution 20: 1362-1375
Chen CH, Oishi KK, Kloeckenergruissem B, Freeling M (1987) Organ-specific
expression of maize Adh1 is altered after a Mu transposon insertion. Genetics 116:
469-477
25

Chen W, VanOpdorp N, Fitzl D, Tewari J, Friedemann P, Greene T, Thompson S,
Kumpatla S, Zheng PZ (2012) Transposon insertion in a cinnamyl alcohol
dehydrogenase gene is responsible for a brown midrib1 mutation in maize. Plant
Molecular Biology 80: 289-297
Chenais B, Caruso A, Hiard S, Casse N (2012) The impact of transposable elements on
eukaryotic genomes: From genome size increase to genetic adaptation to stressful
environments. Gene 509: 7-15
Chomet P, Lisch D, Hardeman KJ, Chandler VL, Freeling M (1991) Identification of a
regulatory transposon that control the Mutator transposable element system in maize.
Genetics 129: 261-270
Cresse AD, Hulbert SH, Brown WE, Lucas JR, Bennetzen JL (1995) Mu1-related
transposable elements of maize preferentially insert into low copy number DNA.
Genetics 140: 315-324
Cui XQ, Hsia AP, Liu F, Ashlock DA, Wise RP, Schnable PS (2003) Alternative
transcription initiation sites and polyadenylation sites are recruited during Mu
suppression at the rf2a locus of maize. Genetics 163: 685-698
Cui XQ, Wise RP, Schnable PS (1996) The rf2 nuclear restorer gene of male-sterile Tcytoplasm maize. Science 272: 1334-1336
Das L, Martienssen R (1995) Site-selected transposon mutagenesis at the hcf106 locus in
maize. Plant Cell 7: 287-294
Devos KM, Brown JKM, Bennetzen JL (2002) Genome size reduction through illegitimate
recombination counteracts genome expansion in Arabidopsis. Genome Research 12:
1075-1079
Dietrich CR, Cui F, Packila ML, Li J, Ashlock DA, Nikolau BJ, Schnable PS (2002)
Maize Mu transposons are targeted to the 5 ' untranslated region of the gl8 gene and
sequences flanking Mu target-site duplications exhibit nonrandom nucleotide
composition throughout the genome. Genetics 160: 697-716
Doebley J (1992) Mapping the genes that made maize. Trends in Genetics 8: 302-307
Dooner HK, Belachew A (1989) Transposition pattern of the maize element Ac from the bzm2(Ac) allele. Genetics 122: 447-457

26

Eisen JA, Benito MI, Walbot V (1994) Sequence similarity of putative transposases links
the maize Mutator autonomous element and a group of bacterial insertion sequences.
Nucleic Acids Research 22: 2634-2636
Ferguson A, Zhao D, Jiang N (2013) Selective acquisition and retention of genomic
sequences by Pack-MULEs based on GC content and breadth of expression. Plant
Physiology 163: 1419-1432
Fernandes J, Dong QF, Schneider B, Morrow DJ, Nan GL, Brendel V, Walbot V (2004)
Genome-wide mutagenesis of Zea mays L. using RescueMu transposons. Genome
Biology 5: R82 doi:10.1186/gb-2004-5-10-r82
Feschotte C (2008) Transposable elements and the evolution of regulatory networks. Nature
Reviews Genetics 9: 397-405
Feschotte C, Jiang N, Wessler SR (2002) Plant transposable elements: Where genetics
meets genomics. Nature Reviews Genetics 3: 329-341
Fleenor D, Spell M, Robertson D, Wessler S (1990) Nucleotide sequence of the maize
Mutator element, Mu8. Nucleic Acids Research 18: 6725-6725
Freeling M (1984) Plant transposable elements and insertion sequences. Annual Review of
Plant Physiology and Plant Molecular Biology 35: 277-298
Gao DY (2012) Identification of an active Mutator-like element (MULE) in rice (Oryza
sativa). Molecular Genetics and Genomics 287: 261-271
Girard L, Freeling M (2000) Mutator-suppressible alleles of rough sheath1 and liguleless3
in maize reveal multiple mechanisms for suppression. Genetics 154: 437-446
Guo YB, Levin HL (2010) High-throughput sequencing of retrotransposon integration
provides a saturated profile of target activity in Schizosaccharomyces pombe. Genome
Research 20: 239-248
Hanada K, Vallejo V, Nobuta K, Slotkin RK, Lisch D, Meyers BC, Shiu SH, Jiang N
(2009) The functional role of Pack-MULEs in rice inferred from purifying selection
and expression profile. Plant Cell 21: 25-38
Hanley S, Edwards D, Stevenson D, Haines S, Hegarty M, Schuch W, Edwards KJ
(2000) Identification of transposon-tagged genes by the random sequencing of
Mutator-tagged DNA fragments from Zea mays. Plant Journal 23: 557-566
27

Haun WJ, Danilevskaya ON, Meeley RB, Springer NM (2009) Disruption of imprinting
by Mutator transposon insertions in the 5' proximal regions of the Zea mays Mez1
locus. Genetics 181: 1229-1237
Havecker ER, Gao X, Voytas DF (2004) The diversity of LTR retrotransposons. Genome
Biology 5: 225 doi:10.1186/gb-2004-5-6-225
Hawkins JS, Kim H, Nason JD, Wing RA, Wendel JF (2006) Differential lineage-specific
amplification of transposable elements is responsible for genome size variation in
Gossypium. Genome Research 16: 1252-1261
Hennig S, Ziebuhr W (2010) Characterization of the transposase encoded by IS256, the
prototype of a major family of bacterial insertion sequence elements. Journal of
Bacteriology 192: 4153-4163
Hershberger RJ, Warren CA, Walbot V (1991) Mutator activity in maize correlates with
the presence and expression of the Mu transposable element Mu9. Proc. Natl. Acad.
Sci. USA 88: 10198-10202
Holligan D, Zhang XY, Jiang N, Pritham EJ, Wessler SR (2006) The transposable
element landscape of the model legume Lotus japonicus. Genetics 174: 2215-2228
Hollister JD, Gaut BS (2009) Epigenetic silencing of transposable elements: A trade-off
between reduced transposition and deleterious effects on neighboring gene expression.
Genome Research 19: 1419-1428
Hood ME (2005) Repetitive DNA in the automictic fungus Microbotryum violaceum.
Genetica 124: 1-10
Hua-Van A, Capy P (2008) Analysis of the DDE motif in the Mutator superfamily. Journal
of Molecular Evolution 67: 670-681
Huang XH, Lu GJ, Zhao Q, Liu XH, Han B (2008) Genome-wide analysis of transposon
insertion polymorphisms reveals intraspecific variation in cultivated rice. Plant
Physiology 148: 25-40
Hudson ME, Lisch DR, Quail PH (2003) The FHY3 and FAR1 genes encode transposaserelated proteins involved in regulation of gene expression by the phytochrome Asignaling pathway. Plant Journal 34: 453-471

28

Iida S, Morita Y, Choi JD, Park KI, Hoshino A (2004) Genetics and epigenetics in flower
pigmentation associated with transposable elements in morning glories. Advances in
Biophysics 38: 141-159
Ishiguro S, Ogasawara K, Fujino K, Sato Y, Kishima Y (2014) Low temperatureresponsive changes in the anther transcriptome's repeat sequencesare indicative of
stress sensitivity and pollen sterility in rice strains. Plant Physiology 164: 671-682
Izsvak Z, Frohlich J, Grabundzija I, Shirley JR, Powell HM, Chapman KM, Ivics Z,
Hamra FK (2010) Generating knockout rats by transposon mutagenesis in
spermatogonial stem cells. Nature Methods 7: 443-445
Izsvak Z, Khare D, Behlke J, Heinemann U, Plasterk RH, Ivics Z (2002) Involvement of
a bifunctional, paired-like DNA-binding domain and a transpositional enhancer in
Sleeping Beauty transposition. Journal of Biological Chemistry 277: 34581-34588
Jiang N, Bao ZR, Zhang XY, Eddy SR, Wessler SR (2004) Pack-MULE transposable
elements mediate gene evolution in plants. Nature 431: 569-573
Jiang N, Ferguson AA, Slotkin RK, Lisch D (2011) Pack-Mutator-like transposable
elements (Pack-MULEs) induce directional modification of genes through biased
insertion and DNA acquisition. Proc. Natl. Acad. Sci. USA 108: 1537-1542
Jordan IK, Rogozin IB, Glazko GV, Koonin EV (2003) Origin of a substantial fraction of
human regulatory sequences from transposable elements. Trends in Genetics 19: 6872
Kalendar R, Tanskanen J, Immonen S, Nevo E, Schulman AH (2000) Genome evolution
of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon dynamics in
response to sharp microclimatic divergence. Proc. Natl. Acad. Sci. USA 97: 66036607
Kapitonov VV, Jurka J (2001) Rolling-circle transposons in eukaryotes. Proc. Natl. Acad.
Sci. USA 98: 8714-8719
Kapitonov VV, Jurka J (2005) RAG1 core and V(D)J recombination signal sequences were
derived
from
Transib
transposons.
PLoS
Biology
3:
e181
doi:10.1371/journal.pbio.0030181
Kapitonov VV, Jurka J (2008) A universal classification of eukaryotic transposable
elements implemented in Repbase. Nature Reviews Genetics 9: 411-412
29

Kaul S, Koo HL, Jenkins J, Rizzo M, Rooney T, Tallon LJ, Feldblyum T, Nierman W,
Benito MI, Lin XY, et al. (2000) Analysis of the genome sequence of the flowering
plant Arabidopsis thaliana. Nature 408: 796-815
Keng VW, Yae K, Hayakawa T, Mizuno S, Uno Y, Yusa K, Kokubu C, Kinoshita T,
Akagi K, Jenkins NA, et al. (2005) Region-specific saturation germline mutagenesis
in mice using the Sleeping Beauty transposon system. Nature Methods 2: 763-769
Kolkman JM, Conrad LJ, Farmer PR, Hardeman K, Ahern KR, Lewis PE, Sawers
RJH, Lebejko S, Chomet P, Brutnell TP (2005) Distribution of Activator (Ac)
throughout the maize genome for use in regional mutagenesis. Genetics 169: 981-995
Kubo N, Fujimoto M, Arimura S, Hirai M, Tsutsumi N (2008) Transfer of rice
mitochondrial ribosomal protein L6 gene to the nucleus: Acquisition of the 5'untranslated region via a transposable element. BMC Evolutionary Biology 8: 314
doi:10.1186/1471-2148-8-314
Lazarow K, Du ML, Weimer R, Kunze R (2012) A hyperactive transposase of the maize
transposable element Activator (Ac). Genetics 191: 747-756
Li YB, Harris L, Dooner HK (2013) TED, an autonomous and rare maize transposon of the
Mutator superfamily with a high gametophytic excision frequency. Plant Cell 25:
3251-3265
Lisch D (2002) Mutator transposons. Trends in Plant Science 7: 498-504
Lisch D (2009) Epigenetic regulation of transposable elements in plants. Annual Review of
Plant Biology 60: 43-66
Lisch D, Chomet P, Freeling M (1995) Genetic characterization of the Mutator system in
maize: Behavior and regulation of Mu transposons in a minimal line. Genetics 139:
1777-1796
Lisch D, Girard L, Donlin M, Freeling M (1999) Functional analysis of deletion
derivatives of the maize transposon MuDR delineates roles for the MURA and MURB
proteins. Genetics 151: 331-341
Lisch DR, Freeling M, Langham RJ, Choy MY (2001) Mutator transposase is widespread
in the grasses. Plant Physiology 125: 1293-1303

30

Liu SZ, Yeh CT, Ji TM, Ying K, Wu HY, Tang HM, Fu Y, Nettleton D, Schnable PS
(2009) Mu transposon insertion sites and meiotic recombination events co-localize
with epigenetic marks for open chromatin across the maize genome. PLoS Genetics 5:
e1000733 doi:10.1371/journal.pgen.1000733
Lockton S, Gaut BS (2009) The contribution of transposable elements to expressed coding
sequence in Arabidopsis thaliana. Journal of Molecular Evolution 68: 80-89
Lowe B, Mathern J, Hake S (1992) Active Mutator elements suppress the knotted
phenotype and increase recombination at the Kn1-O tandem duplication. Genetics 132:
813-822
Ma JX, Devos KM, Bennetzen JL (2004) Analyses of LTR-retrotransposon structures
reveal recent and rapid genomic DNA loss in rice. Genome Research 14: 860-869
Marquez CP, Pritham EJ (2010) Phantom, a new subclass of Mutator DNA transposons
found in insect viruses and widely distributed in animals. Genetics 185: 1507-1517
Martienssen R, Barkan A, Taylor WC, Freeling M (1990) Somatically heritable switches
in the DNA modification of Mu transposable elements monitored with a suppressible
mutant in maize. Genes & Development 4: 331-343
Martienssen RA, Barkan A, Freeling M, Taylor WC (1989) Molecular cloning of a maize
gene involved in photosynthetic membrane organization that is regulated by
Robertson's Mutator. EMBO Journal 8: 1633-1639
Matsuoka Y, Vigouroux Y, Goodman MM, Sanchez GJ, Buckler E, Doebley J (2002) A
single domestication for maize shown by multilocus microsatellite genotyping. Proc.
Natl. Acad. Sci. USA 99: 6080-6084
Maumus F, Allen AE, Mhiri C, Hu HH, Jabbari K, Vardi A, Grandbastien MA, Bowler
C (2009) Potential impact of stress activated retrotransposons on genome evolution in
a marine diatom. BMC Genomics 10: 624 doi:10.1186/1471-2164-10-624
McCarty DR, Suzuki M, Hunter C, Collins J, Avigne WT, Koch KE (2013) Genetic and
molecular analyses of UniformMu transposon insertion lines. Plant Transposable
Elements: Methods and Protocols 1057: 157-166
Mcclintock B (1950) The origin and behavior of mutable loci in maize. Proc. Natl. Acad. Sci.
USA 36: 344-355

31

McGinnis W, Shermoen AW, Beckendorf SK (1983) A transposable element inserted just
5' to a Drosophila glue protein gene alters gene expression and chromatin structure.
Cell 34: 75-84
Munoz-Lopez M, Garcia-Perez JL (2010) DNA transposons: Nature and applications in
genomics. Current Genomics 11: 115-128
Nagy Z, Szabo M, Chandler M, Olasz F (2004) Analysis of the N-terminal DNA binding
domain of the IS30 transposase. Molecular Microbiology 54: 478-488
Naito K, Zhang F, Tsukiyama T, Saito H, Hancock CN, Richardson AO, Okumoto Y,
Tanisaka T, Wessler SR (2009) Unexpected consequences of a sudden and massive
transposon amplification on rice gene expression. Nature 461: 1130-1134
Nesmelova IV, Hackett PB (2010) DDE transposases: Structural similarity and diversity.
Advanced Drug Delivery Reviews 62: 1187-1195
Neuveglise C, Chalvet F, Wincker P, Gaillardin C, Casaregola S (2005) Mutator-like
element in the yeast Yarrowia lipolytica displays multiple alternative splicings.
Eukaryotic Cell 4: 615-624
Oki N, Yano K, Okumoto Y, Tsukiyama T, Teraishi M, Tanisaka T (2008) A genomewide view of miniature inverted-repeat transposable elements (MITEs) in rice, Oryza
sativa ssp. japonica. Genes & Genetic Systems 83: 321-329
Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H,
Haberer G, Hellsten U, Mitros T, Poliakov A, et al. (2009) The Sorghum bicolor
genome and the diversification of grasses. Nature 457: 551-556
Pereira V, Enard D, Eyre-Walker A (2009) The effect of transposable element insertions
on gene expression evolution in rodents. PLoS ONE 4: e4321
doi:10.1371/journal.pone.0004321
Piegu B, Guyot R, Picault N, Roulin A, Saniyal A, Kim H, Collura K, Brar DS, Jackson
S, Wing RA, et al. (2006) Doubling genome size without polyploidization: Dynamics
of retrotransposition-driven genomic expansions in Oryza australiensis, a wild
relative of rice. Genome Research 16: 1262-1269
Poulter RTM, Goodwin TJD, Butler MI (2003) Vertebrate helentrons and other novel
Helitrons. Gene 313: 201-212

32

Qin M, Robertson DS, Ellingboe AH (1991) Cloning of the Mutator transposable element
MuA2, a putative regulator of somatic mutability of the a1-Mum2 allele in maize.
Genetics 129: 845-854
Raizada MN, Nan GL, Walbot V (2001) Somatic and germinal mobility of the RescueMu
transposon in transgenic maize. Plant Cell 13: 1587-1608
Raizada MN, Walbot V (2000) The late developmental pattern of Mu transposon excision is
conferred by a cauliflower mosaic virus 35S-driven MURA cDNA in transgenic
maize. Plant Cell 12: 5-21
Robbins ML, Sekhon RS, Meeley R, Chopra S (2008) A Mutator transposon insertion is
associated with ectopic expression of a tandemly repeated multicopy Myb gene
pericarp color1 of maize. Genetics 178: 1859-1874
Robertson DS (1978) Characterization of a mutator system in maize. Mutation Research 51:
21-28
Rossi M, Araujo PG, de Jesus EM, Varani AM, Van Sluys MA (2004) Comparative
analysis of Mutator-like transposases in sugarcane. Molecular Genetics and Genomics
272: 194-203
Sakai H, Tanaka T, Itoh T (2007) Birth and death of genes promoted by transposable
elements in Oryza sativa. Gene 392: 59-63
Salvi S, Sponza G, Morgante M, Tomes D, Niu X, Fengler KA, Meeley R, Ananiev EV,
Svitashev S, Bruggemann E, et al. (2007) Conserved noncoding genomic sequences
associated with a flowering-time quantitative trait locus m maize. Proc. Natl. Acad.
Sci. USA 104: 11376-11381
SanMiguel P, Tikhonov A, Jin YK, Motchoulskaia N, Zakharov D, MelakeBerhan A,
Springer PS, Edwards KJ, Lee M, Avramova Z, et al. (1996) Nested
retrotransposons in the intergenic regions of the maize genome. Science 274: 765-768
Schmidt T (1999) LINEs, SINEs and repetitive DNA: non-LTR retrotransposons in plant
genomes. Plant Molecular Biology 40: 903-910
Schmutz J, Cannon SB, Schlueter J, Ma JX, Mitros T, Nelson W, Hyten DL, Song QJ,
Thelen JJ, Cheng JL, et al. (2010) Genome sequence of the palaeopolyploid
soybean. Nature 463: 178-183

33

Schnable PS, Ware D, Fulton RS, Stein JC, Wei FS, Pasternak S, Liang CZ, Zhang JW,
Fulton L, Graves TA, et al. (2009) The B73 maize genome: Complexity, diversity,
and dynamics. Science 326: 1112-1115
Schumacher S, Clubb RT, Cai ML, Mizuuchi K, Clore GM, Gronenborn AM (1997)
Solution structure of the Mu end DNA-binding Iβ subdomain of phage Mu
transposase: Modular DNA recognition by two tethered domains. EMBO Journal 16:
7532-7541
Settles AM, Holding DR, Tan BC, Latshaw SP, Liu J, Suzuki M, Li L, O'Brien BA,
Fajardo DS, Wroclawska E, et al. (2007) Sequence-indexed mutations in maize
using the UniformMu transposon-tagging population. BMC Genomics 8: 116
doi:10.1186/1471-2164-8-116
Singer T, Yordan C, Martienssen RA (2001) Robertson's Mutator transposons in A.
thaliana are regulated by the chromatin-remodeling gene Decrease in DNA
Methylation (DDM1). Genes & Development 15: 591-602
Sorek R, Ast G, Graur D (2002) Alu-containing exons are alternatively spliced. Genome
Research 12: 1060-1067
Studer A, Zhao Q, Ross-Ibarra J, Doebley J (2011) Identification of a functional
transposon insertion in the maize domestication gene tb1. Nature Genetics 43: 11601163
Talbert LE, Patterson GI, Chandler VL (1989) Mu transposable elements are structurally
diverse and distributed throughout the genus Zea. Journal of Molecular Evolution 29:
28-39
Tan BC, Chen ZL, Shen Y, Zhang YF, Lai JS, Sun SSM (2011) Identification of an active
new Mutator transposable element in maize. G3: Genes Genomes Genetics 1: 293302
Tenaillon MI, Hufford MB, Gaut BS, Ross-Ibarra J (2011) Genome size and transposable
element content as determined by high-throughput sequencing in maize and Zea
luxurians. Genome Biology and Evolution 3: 219-229
Thornburg BG, Gotea V, Makalowski W (2006) Transposable elements as a significant
source of transcription regulating signals. Gene 365: 104-110

34

Tower J, Kurapati R (1994) Preferential transposition of a Drosophila P element to the
corresponding region of the homologous chromosome. Molecular & General Genetics
244: 484-490
Wang H, Xu Z, Yu HJ (2008) LTR retrotransposons reveal recent extensive inter-subspecies
nonreciprocal recombination in Asian cultivated rice. BMC Genomics 9: 205
doi:10.1186/1471-2164-9-565
Wang QH, Dooner HK (2006) Remarkable variation in maize genome structure inferred
from haplotype diversity at the bz locus. Proc. Natl. Acad. Sci. USA 103: 1764417649
Watson MA, Chaconas G (1996) Three-site synapsis during Mu DNA transposition: A
critical intermediate preceding engagement of the active site. Cell 85: 435-445
Wessler SR (1996) Plant retrotransposons: Turned on by stress. Current Biology 6: 959-961
Wicker T, Sabot F, Hua-Van A, Bennetzen JL, Capy P, Chalhoub B, Flavell A, Leroy P,
Morgante M, Panaud O, et al. (2007) A unified classification system for eukaryotic
transposable elements. Nature Reviews Genetics 8: 973-982
Woodhouse MR, Freeling M, Lisch D (2006) The mop1 (mediator of paramutation1)
mutant progressively reactivates one of the two genes encoded by the MuDR
transposon in maize. Genetics 172: 579-592
Xu ZN, Yan XH, Maurais S, Fu HH, O'Brien DG, Mottinger J, Dooner HK (2004)
Jittery, a Mutator distant relative with a paradoxical mobile behavior: Excision
without reinsertion. Plant Cell 16: 1105-1114
Yang LX, Bennetzen JL (2009) Structure-based discovery and description of plant and
animal Helitrons. Proc. Natl. Acad. Sci. USA 106: 12832-12837
Yu ZH, Wright SI, Bureau TE (2000) Mutator-like elements in Arabidopsis thaliana:
Structure, diversity and evolution. Genetics 156: 2019-2031
Yuan YW, Wessler SR (2011) The catalytic domain of all eukaryotic cut-and-paste
transposase superfamilies. Proc. Natl. Acad. Sci. USA 108: 7884-7889
Zabala G, Vodkin L (2007) Novel exon combinations generated by alternative splicing of
gene fragments mobilized by a CACTA transposon in Glycine max. BMC Plant
Biology 7: 38 doi:10.1186/1471-2229-7-38
35

Zhou LQ, Mitra R, Atkinson PW, Hickman AB, Dyda F, Craig NL (2004) Transposition
of hAT elements links transposable elements and V(D)J recombination. Nature 432:
995-1001

36

CHAPTER 2

Nested Insertions and Accumulation of Indels are Negatively Correlated with
Abundance of Mutator-Like Transposable Elements in Maize and Rice
(Zhao D, Jiang N (2014) Nested insertions and accumulation of indels are negatively
correlated with the abundance of Mutator-like transposable elements in maize and rice. PLoS
ONE 9(1): e87069. doi:10.1371/journal.pone.0087069)

37

2.1 Abstract
Mutator-like transposable elements (MULEs) are widespread in plants and were first
discovered in maize where there are a total of 12,900 MULEs. In comparison, rice, with a
much smaller genome, harbors over 30,000 MULEs. Since maize and rice are close relatives,
the differential amplification of MULEs raised an inquiry into the underlying mechanism. A
hypothesis was tested that the differential abundance may be partly attributed to the
differential copy number of autonomous MULEs with the potential to generate the
transposase that is required for transposition. To this end, the two genomes were analyzed,
which resulted in detection of 530 and 476 MULEs containing transposase sequences
(candidate coding-MULEs) in maize and rice, respectively. Over 1/3 of the candidate codingMULEs harbor nested insertions and the ratios are similar in the two genomes. Among the
maize elements with nested insertions, 24% have insertions in coding regions and over half of
them harbor two or more insertions. In contrast, only 12% of the rice elements harbor
insertions in coding regions and 19% have multiple insertions, suggesting that nested
insertions in maize are more disruptive. This is because most nested insertions in maize are
from LTR retrotransposons, which are large in size and are prevalent in the maize genome.
The results suggest that the amplification of retrotransposons may limit the amplification of
DNA transposons but not vice versa. In addition, more indels are detected among maize
elements than rice elements whereas defects caused by point mutations are comparable
between the two species. Taken together, more disruptive nested insertions combined with
higher frequency of indels resulted in few (6%) coding-MULEs that may encode functional
transposases in maize. In contrast, 35% of the coding-MULEs in rice retain putative intact
transposase. This is in addition to the higher expression frequency of rice coding-MULEs,
which may explain the higher occurrence of MULEs in rice than that in maize.

38

2.2 Introduction
Transposable elements (TEs) are genomic sequences that are capable of moving from
one position to another. Based on the transposition intermediate, TEs can be divided into two
classes. Class I, also called RNA or retrotransposons, transpose via an RNA intermediate.
Class II, DNA transposons, transpose via a DNA intermediate. TEs can also be grouped into
autonomous or non-autonomous elements, where the former encode proteins (transposase for
class II elements) responsible for the transposition of themselves as well as their
corresponding non-autonomous counterparts.
TEs constitute large fractions of most plant genomes sequenced to date, i.e., ~85% of
maize (Schnable et al., 2009), ~62% of soybean (Schmutz et al., 2010) and sorghum
(Paterson et al., 2009), ~63% of tomato (Sato et al., 2012), ~43% of papaya (Ming et al.,
2008), and ~35% of rice (Matsumoto et al., 2005) genomes. Comparative analysis reveals
that the abundance of different classes of TEs (e.g., RNA and DNA TEs) varies dramatically
in different plants. In rice, the genomic coverage of RNA TEs (20%) is 1.5-fold of that of
DNA TEs (13%) whereas in maize the difference is 8-fold between RNA (76%) and DNA
(9%) TEs (Matsumoto et al., 2005; Schnable et al., 2009). This difference is the greatest in
the papaya genome, which contains ~43% RNA TEs and very few DNA TEs (0.2%). In
general, the amount of retrotransposons is correlated with plant genome size whereas such
correlation is not found for DNA elements (Slotkin et al., 2012).
Mutator-like transposable elements (MULEs), first discovered in maize (Robertson, 1978;
Bennetzen et al., 1984), are widespread in plants (Yu et al., 2000; Rossi et al., 2004), fungi
(Chalvet et al., 2003; Neuveglise et al., 2005), and animals (Marquez and Pritham, 2010).
MULEs are one of the most complex TE families, with dramatic variation in structure,
sequence, size, and abundance within a genome and among different plant genomes (Yu et al.,
39

2000; Schnable et al., 2009; Ferguson and Jiang, 2012). Based on the similarity of their
terminal inverted repeats (TIRs), MULEs can be grouped into TIR-MULEs or non-TIRMULEs, where TIR-MULEs are characterized by long TIRs (100-500 bp) with high
sequence similarity and non-TIR-MULEs have relatively short TIRs with low sequence
similarity between their terminal sequences (Yu et al., 2000). Within the TIR-MULE group, a
special subgroup was discovered in several plants, which contains tandem TIRs (two
consecutive TIRs) flanking the internal sequence (Ferguson and Jiang, 2012). In addition,
some MULEs harbor gene and/or gene fragments, which are referred to as Pack-MULEs
(Jiang et al., 2004). Their high transposition frequency combined with the capability to
duplicate gene fragments suggest that MULEs play important roles in genome evolution
(Lisch, 2002, 2005). Individual genomes can contain all forms of MULEs, including TIRand tandem TIR-MULEs, non-TIR-MULEs, and Pack-MULEs, albeit with differential
abundance (Yu et al., 2000; Ferguson and Jiang, 2012). Rice by far contains the largest
amount of known MULEs (n=32,000, 5.5% of the genome) and Pack-MULEs (n=2,924)
(Ferguson and Jiang, 2012; Ferguson et al., 2013). As a close relative, maize contains 12,900
MULEs (1% of the genome) and 276 Pack-MULEs, which are relatively less abundant given
that its genome size is over 5 times larger than rice (2,066 Mb vs. 370 Mb) (Matsumoto et al.,
2005; Schnable et al., 2009). The papaya genome represents an extreme case, which is almost
void of DNA TEs including MULEs. Despite the prevalence and importance of MULEs, the
mechanism underlying the differential amplification of these elements or DNA elements in
general remains largely unknown.
The first autonomous Mutator element discovered is MuDR in maize. It encodes two
proteins, MURA, the major protein responsible for its transposition, and MURB, a helper
protein found only in the Zea genus and for which the function is still unclear (Lisch et al.,
40

1999; Lisch, 2002; Kim and Walbot, 2003). MULE transposases belong to the DDE
transposase family, which commonly consists of a helix-turn-helix (HTH) DNA-binding
domain at the amino terminus and a DDE catalytic domain at the carboxyl terminus (HuaVan and Capy, 2008; Yuan and Wessler, 2011). MURA-like transposase sequences have
been discovered in many other organisms, including plants, fungi, and animals (Lisch et al.,
2001; Singer et al., 2001; Xu et al., 2004). In addition to the differences in TIR length,
MURA-like transposase sequences are also divergent as demonstrated by distinct subfamilies
(Lisch et al., 2001; Rossi et al., 2004). Furthermore, some MULE transposase sequences,
such as FAR1 and MUSTANG, have been domesticated as cellular genes and are no longer
associated with any mobility (Hudson et al., 2003; Cowan et al., 2005).
The abundance of TEs is a result of the interplay between the amplification through
transposition, duplication, horizontal transfer and loss via excision, sequence erosion,
deletion etc. (Pritham, 2009). Since autonomous elements are responsible for the
transposition of both themselves and their corresponding non-autonomous counterparts, their
abundance and activity influence the speed of amplification, and therefore contribute to the
abundance of TEs in a genome. Maize and rice belong to the same family (Poaceae) with a
common ancestor occurring 50-70 million years ago (Wolfe et al., 1989). As the most
important crops worldwide, the genome of both maize and rice were sequenced through a
hierarchical method using bacterial artificial chromosome clones (BACs) accompanied by
high-density genetic maps (Matsumoto et al., 2005; Schnable et al., 2009). The availability of
high quality genomic sequence and well-annotated TEs allow a comparative study of TEs in
these two organisms. In this study, candidate coding-MULEs (MULEs containing transposase
sequences) were detected and analyzed in the maize and rice genomes. In addition, possible
factors involved in the loss of coding capacity of those elements were dissected, which
41

facilitates the understanding about the underlying mechanisms for differential abundance of
MULEs in the two genomes.
2.3 Results
2.3.1 Candidate MULEs Containing Transposase Sequences (Coding-MULEs) in Maize
and Rice
In this study, TIR-MULEs (see Section 2.2) containing MURA-related transposase
sequences (candidate coding-MULEs) were detected and analyzed in the maize and rice
genomes. Non-TIR MULEs (see Section 2.2) were not considered because of the difficulty in
defining the boundary of their termini and target site duplication (TSD; generated upon
integration of a TE into a genomic locus) with high confidence. To retrieve candidate codingMULEs, a collection of MURA-related transposase sequences from several organisms,
especially plants (Table 2.5), was used to search against the maize and rice genomic
sequences (NCBI TBLASTN, e<10-5). The following criteria (see Section 2.5 for more
details) were employed for defining a candidate coding-MULE. First, the element should
contain a pair of TIRs and the distance between the two TIRs should be 2 to 30 kb (including
nested TE insertions inside the element). Second, the sequence located within the TIRs
should have homology (NCBI TBLASTN, e<10-5) to known MULE transposase. Third, a
TSD should be immediately flanking the TIRs of a single element. With these criteria, a total
of 530 and 476 candidate coding-MULEs were detected in maize and rice, respectively. Due
to the presence of nested TE insertions in maize and rice (SanMiguel et al., 1996; Jiang and
Wessler, 2001; Kronmiller and Wise, 2008, 2009), the candidate coding-MULEs were first
masked using TE libraries and nested insertions were identified based on the output of
RepeatMasker. After removing nested TE insertions, most candidate coding-MULEs (>95%)
are between 2 to 10 kb in size in both maize and rice. However, the number of elements
42

within different size ranges exhibits different patterns in the two species. In maize, a
considerable portion of candidate coding-MULEs ranges from 2 to 3.5 kb (~20%) while only
9% of the rice elements fall into this category (χ2=25.7360, p<0.0001; Figure 2.1). The
minimum size of known autonomous MULEs in plants is around 3.5 kb (Table 2.5),
suggesting that elements smaller than 3.5 kb are unlikely to encode an intact transposase
(transposase containing both DNA-binding and catalytic domains and no other coding
defects). Most (71%) candidate coding-MULEs in rice are between 3.5 to 8 kb while only 58%
of the elements in maize are within this range. As a result, candidate coding-MULEs with
relatively small (2-3.5 kb) and large size (>8 kb) are more prevalent in maize (42%) than that
in rice (29%) (χ2=20.3473, p<0.0001).

Figure 2.1 Fraction of candidate coding-MULEs within different size ranges after
removing nested TE insertions.

43

Figure 2.2 Phylogenetic analyses of the candidate coding-MULEs with a DDE domain.
(A) All representative candidate coding-MULEs containing a DDE domain.
(B) Candidate coding-MULEs with putative intact transposases.
Candidate coding-MULEs in maize are denoted by green triangles; those in rice are denoted
by blue triangles; and known MULE transposases are denoted by red triangles, maize codingMULEs with nested LTR insertions are denoted with purple round dots (A).
44

To determine the phylogenetic relationship of these candidates, protein sequences
containing the catalytic (DDE) domain within the elements were used to construct a
phylogenetic tree. The phylogenetic analysis revealed that all elements belong to four distinct
phylogenetic clades (Figure 2.2A). Clade I is represented by MURA, the first known MULE
transposase (Robertson, 1978); and TEDA, a recently discovered MULE in maize (Li et al.,
2013). Clade II is represented by AtMu1, an active element in Arabidopsis (Singer et al., 2001)
and Os3378, an active MULE element in rice (Gao, 2012). The representative element for
clade III is TRAP, a MULE in maize (Comelli et al., 1999). The remainder of elements
comprises clade IV, which is represented by Jittery and FAR1. Jittery is another active
MULE from maize (Xu et al., 2004) and FAR1 is a gene domesticated from a MULE
transposase in Arabidopsis (Hudson et al., 2003). As shown in Figure 2.2A, clade I and IV
contain more maize elements (green triangles) while rice elements (blue triangles) are more
expanded in clade II and III.
2.3.2 Nested Insertions within the Candidate Coding-MULEs
As mentioned above, nested insertions of some TE families are very common in maize
and rice (SanMiguel et al., 1996; Jiang and Wessler, 2001; Kronmiller and Wise, 2008, 2009).
If a TE inserts into a coding-MULE, it may interrupt the transposase open reading frame
(ORF) and abolish its function. To test whether this is the case, all TEs located within the
candidate coding-MULEs were examined. The numbers of candidate coding-MULEs
containing nested insertions are largely comparable between maize (n=191, 36%) and rice
(n=195, 41%) (χ2=2.5761, p=0.1085). However, among the 195 rice elements with nested
insertions, 107 are highly similar to each other, where 40 contain an intact Os0548 (a Touristlike miniature inverted repeat transposable element (MITE) of 274 bp in length) and 67
contain a partial Os0548 at the same site. As a result, the 107 elements are likely copies
45

derived from a single insertion event where 40 copies are amplifications of the element with
the intact Os0548 and meanwhile one copy may have experienced partial deletion of Os0548
followed by proliferation to 67 copies. Apparently, the insertion of this element did not
abolish the capability for further transposition. In contrast, the 191 elements in maize all
harbor independent insertions. If the 107 elements containing Os0548 were excluded from
rice, the fraction of candidate coding-MULEs with nested insertions is much lower in rice
([195-107] / [476-107] * 100 ≈ 24%) than that in maize (36%) (χ2=15.1021, p<0.0001).
Moreover, the number and pattern of inserted TEs in individual candidate coding-MULE is
different between maize and rice. Among the elements with nested insertions, most (~81%)
contain only a single TE insertion in rice whereas that in maize is only less than 47%
(χ2=49.6349, p<0.0001; Figure 2.3A). The fact that candidate coding-MULEs in maize
contain more nested TEs than that in rice is also obvious when comparing the average
number of nested insertions per coding-MULE with nested TEs (2 nested insertions in maize
vs. 1 in rice).

Figure 2.3 Fractions of candidate coding-MULEs containing different numbers (A) and
types (B) of nested TE insertions.

46

Based on the class (see Section 2.2) of the inserted TEs, coding-MULEs with nested
insertions were divided into three categories, i.e., coding-MULEs with RNA-TE insertions
(all inserted TEs were RNA TEs), coding-MULEs with DNA-TE insertions (all inserted TEs
were DNA TEs), and those with RNA-DNA-TE insertions (with insertions from both RNA
and DNA TEs). It turned out that over 72% of the candidate coding-MULEs in maize
contained RNA-TE insertions compared with 29% of that in rice (χ2=71.4396, p<0.0001;
Figure 2.3B). In contrast, there are more candidate coding-MULEs contain DNA-TE
insertions in rice (65%) than that in maize (12%) (χ2=112.5264, p<0.0001). Furthermore, the
average size of the inserted TEs in maize is about 3-fold of that in rice for DNA-TE (708 bp
vs. 245 bp, p=0.0016, t-test) and 1.3-fold for RNA-TE (6818 bp vs. 5081 bp, p=0.0006, t-test)
(Table 2.1). Accordingly, maize candidate coding-MULEs contain more independent and
larger TE insertions, with the majority from LTR retrotransposons. Interestingly, most maize
MULEs grouping with TRAP (clade III) (10 out of 14 vs. 26% of genome average, elements
with purple dots in Figure 2.2A) are associated with nested insertions of LTR
retrotransposons while they are not particularly older or distribute differently than other
MULEs. This suggests there might be some structural features of these elements that attract
LTR elements.
Table 2.1 Number and average length of nested TE insertions based on TE classes in the
candidate coding-MULEs.
RNA-TE*

DNA-TE*

Total

Maize

329 (6818 a†)

74 (708 a)

403

Rice

99 (5081 b)

152 (245 b)

251

* Numbers in parenthesis represent the average length (bp) of nested TEs.
† Means in parenthesis in each column followed by different letters are significantly different
(p<0.005, t-test).

47

To date the insertion time of the nested TEs, all the intact LTR retrotransposons within
the candidate coding-MULEs were analyzed, which are characterized with long terminal
repeat (LTR) at both ends of the element. The LTRs of one element are identical when
inserted into a new location and become divergent over time. As a result, the identity between
the LTRs has been used to estimate the age of the insertion (SanMiguel et al., 1998). In light
of this, the approximate age was calculated for 133 and 25 intact LTR elements within the
candidate coding-MULEs in maize and rice, respectively (Figure 2.4). The largest fractions
were estimated to be inserted within 1 million years in both maize (~65%) and rice (~69%),
followed by insertions which have occurred 1 to 2 million years ago. Few LTR insertions
were older than 3 million years in both genomes. Therefore, the insertion of LTR elements
into the candidate coding-MULEs occurred within the same evolutionary time frame in both
genomes despite the fewer insertions observed in rice.

Figure 2.4 Ages of intact LTR retrotransposons in the candidate coding-MULEs in
maize and rice.

48

As a comparison, the occurrence of coding-MULEs inserted into other TEs was also
examined. It turned out that only 9% of the maize coding-MULEs and 7% of the rice
elements inserted into other TEs (Table 2.2). This is in contrast to the fact that over 1/3 of the
elements harbor insertions from other TEs, suggesting the coding-MULEs are more likely
serving as targets for other elements rather than targeting other TEs. In addition, more maize
candidate coding-MULEs (7%) inserted into RNA TEs than the rice elements (3%) (Table
2.2), which is consistent with the fact that there are many more RNA TEs in the maize
genome than that in rice (Matsumoto et al., 2005; Schnable et al., 2009).
Table 2.2 Insertion preference of candidate coding-MULEs (CMs).
Maize

Rice

Types of TEs

RNA-TE (% of
total CMs*)

DNA-TE (% of
total CMs*)

RNA-TE (% of
total CMs*)

DNA-TE (% of
total CMs*)

Nested TE insertion events
in coding-MULEs

329 (32%)

74 (10%)

99 (19%†)

46 (9%†)

Coding-MULE insertion
events in other TEs

35 (7%)

9 (2%)

15 (3%)

19 (4%)

*Note that individual coding-MULE may contain different number or types of nested TEs.
† In rice, 107 candidate coding-MULEs are copies of two elements resulting from one TE
insertion event (see results), which was corrected in both the number of DNA-TE insertion
events and the total candidate coding-MULEs (476-107+1=370).

2.3.3 Coding Capacity of the Candidate Coding-MULEs
Previous studies indicate that class II transposases, including MULE transposases,
consist of an N-terminal helix-turn-helix (HTH) DNA-binding domain and a C-terminal DDE
catalytic domain (Benito and Walbot, 1997; Babu et al., 2006; Hua-Van and Capy, 2008;
Yuan and Wessler, 2011). The DNA binding domain is responsible for binding to the
transposon DNA especially the TIR sequences and the catalytic domain is responsible for
excision and integration of the element (Hennig and Ziebuhr, 2010; Nesmelova and Hackett,
2010). To determine whether an individual candidate coding-MULE contains both domains,
49

the coding regions of these elements were extracted from the relevant gene annotation or
annotated manually. Subsequently, the presence of a DNA-binding domain was determined
using the Jpred3 program and that of the catalytic domain by examination of a multiple
sequence alignment containing the MURA protein as the reference (see Section 2.5). A
transposase containing both DNA-binding and catalytic domains and without other defects
(e.g., frameshift, premature stop codon) in its ORF is considered a potentially intact
transposase.
To obtain a better view, the candidate coding-MULEs were divided into six groups based
on their coding capacity. Group 1 includes coding-MULEs with putative intact transposase,
i.e., at least one HTH domain (some elements have more than one HTH domain, e.g., Mos1
(Nesmelova and Hackett, 2010)) close to the amino terminus and a DDE catalytic domain
close to the carboxyl terminus of the transposase protein. Group 2 is comprised of codingMULEs with mutation of either the translation start codon (ATG) or key amino acids (D, D,
E) in the catalytic domain. Group 3 and 4 include coding-MULE transposases containing
frameshift and premature stop codon, respectively. Those containing both frameshift and
premature stop codon were assigned to Group 5. Group 6 consists of coding-MULEs with
various forms of deletions in their transposases, including deletions of the DNA-binding
domain and/or the catalytic domain or other regions. Since many candidate coding-MULEs
contain several types of coding defects, one element may be assigned to more than one group
(Table 2.3A). Meanwhile, a more specific classification where each element is only assigned
to one sub-type is available in Table 2.3B.

50

Table 2.3A Candidate coding-MULEs (CMs) with or without distinct defects in their coding regions (redundant grouping).
Maize

Rice

With TE (% of
total CMs with
nested TEs)

Without TE (% of
total CMs without
nested TEs)

Total

With TE (% of
total CMs with
nested TEs)

Without TE (% of
total CMs without
nested TEs)

Total

ORF with putative intact transposase

2 (1.05%)

29 (8.55%)

31 (5.85%)

70 (35.90%)

98 (34.88%)

168 (35.29%)

Group 2

ORF with DDE or start codon mutation

19 (9.95%)

20 (5.90%)

39 (7.36%)

13 (6.67%)

14 (4.98%)

27 (5.67%)

Group 3

ORF with frameshift

36 (18.85%)

37 (10.91%)

73 (13.77%)

34 (17.44%)

45 (16.01%)

79 (16.60%)

Group 4

ORF with premature stop codon

82 (42.93%)

91 (26.84%)

173 (32.64%)

64 (32.82%)

95 (33.81%)

159 (33.40%)

Group 5

ORF with both frameshift and
premature stop codon

19 (9.95%)

12 (3.54%)

31 (5.85%)

18 (9.23%)

33 (11.74%)

51 (10.71%)

Group 6

ORF with deletions

187 (97.91%)

288 (84.96%)

475 (89.62%)

66 (32.85%)

129 (45.91%)

195 (40.97%)

Group

ORF status

Group 1

51

Table 2.3B Candidate coding-MULEs (CMs) with or without distinct defects in their coding regions (non-redundant grouping).
Maize

Rice

With TE (% of
total CMs with
nested TEs)

Without TE (% of
total CMs without
nested TEs)

Total

With TE (% of
total CMs with
nested TEs)

Without TE (% of
total CMs without
nested TEs)

Total

ORF with putative intact transposase

2 (1.05%)

29 (8.55%)

31 (5.85%)

70 (35.90%)

98 (34.88%)

168 (35.29%)

Group 2

ORF with DDE or start codon mutation

1 (0.52%)

4 (1.18%)

5 (0.94%)

3 (1.54%)

7 (2.49%)

10 (2.10%)

Group 3

ORF with frameshift

1 (0.52%)

9 (2.65%)

10 (1.89%)

10 (5.13%)

4 (1.42%)

14 (2.94%)

Group 4

ORF with premature stop codon

0 (0%)

8 (2.36%)

8 (1.51%)

37 (18.97%)

28 (9.96%)

65 (13.66%)

Group 5

ORF with both frameshift and
premature stop codon

0 (0%)

1 (0.29%)

1 (0.19%)

9 (4.62%)

15 (5.34%)

24 (5.04%)

deletion only

81 (42.41%)

185 (54.57%)

266 (50.19%)

37 (18.97%)

64 (22.78%)

101 (21.22%)

with DDE or start codon
mutation only

8 (4.19%)

5 (1.47%)

13 (2.45%)

5 (2.56%)

5 (1.78%)

10 (2.10%)

with frameshift

16 (8.38%)

16 (4.72%)

32 (6.04%)

6 (3.08%)

8 (2.85%)

14 (2.94%)

with premature stop codon

63 (32.98%)

71 (20.94%)

134 (25.28%)

9 (4.62%)

34 (12.10%)

43 (9.03%)

with both frameshift and
premature stop codon

19 (9.95%)

11 (3.24%)

30 (5.66%)

9 (4.62%)

18 (6.41%)

27 (5.67%)

191

339

530

195

281

476

Group

ORF status

Group 1

Group 6

ORF with
deletions

Total

52

Overall, rice contains many more candidate coding-MULEs with putative intact
transposase than maize (35.29% vs. 5.85%) (χ2=137.0185, p<0.0001; Table 2.3A), and
deletion is likely the most important factor contributing to the difference. Most of the
elements in maize (>89%) are associated with various deletions within the transposase
compared to only 41% of the elements with deletions in rice. The presence of premature stop
codon is the second most frequent defect, but the fractions are similar between maize
(32.64%) and rice (33.40%) (χ2=0.0658, p=0.7975; Table 2.3A). For elements with other
defects (mutation of DDE motif or start codon, frameshift, and presence of both frameshift
and premature stop codon), no dramatic difference was observed between the two species
(Table 2.3A). In addition, many more maize elements (~40%) contain more than one type of
defect than that in rice (< 25%) (χ2=25.1084, p<0.0001).
When classifying these elements based on whether they contain nested TE insertions or
not, it is clear that in maize there are more candidate coding-MULEs containing putative
intact transposase if there are no nested TEs (Figure 2.5). For example, only 2 out of 191
(1.05%) elements with nested insertions seem to have putative intact transposase, which is in
contrast to 29 out of 339 (8.55%) elements without nested insertions in maize (χ2=12.5035,
p=0.0004; Table 2.3A). In contrast, ratios of candidate coding-MULEs harboring putative
intact transposases for those with (35.90%) and without (34.88%) nested TE insertions
(χ2=0.0526, p=0.8185; Table 2.3A) are comparable in rice. Nevertheless, if the high copy
elements (those containing intact and partial Os0548) were excluded, only 12.5% candidate
coding-MULEs with nested insertions harbor putative intact transposase in rice, suggesting
the destructive effect of nested TE insertions in both species, or elements with nested
insertions are older than these without nested insertions so more mutations have accumulated.
A close examination indicated that more nested TEs (n=46) in maize directly disrupted
53

transposases than that in rice (n=23) (χ2=23.0278, p<0.0001), and most are LTR
retrotransposons. Again, this indicates that nested TEs are more deleterious to codingMULEs in maize than that in rice.

Figure 2.5 Fractions of candidate coding-MULEs containing putative intact
transposases and transposases with deletions.
The fractions were calculated within each category, e.g., fraction of candidate codingMULEs with TE insertions containing putative intact transposases is based on the total
number of elements with TE insertions.

A second phylogenetic tree was constructed based on the catalytic domain of the
elements with putative intact transposase (Figure 2.2B). Compared with Figure 2.2A, the
number of elements in all the four clades declines, which is not surprising. This decrease is
more obvious in maize, as revealed by the existence of only one clade (clade I) containing
more than 10 elements and the other clades having four or less elements left. In contrast, rice
(Nipponbare) still has more than 10 coding-MULEs in three clades (clade I, II, and III) and
54

clade III seems to be active or recently active as evidenced by the short branch lengths
(Figure 2.2B). In contrast, transposition activity in clades II to IV might be limited currently
or in the future in maize (B73). This is consistent with the fact that there are either few maize
elements (clades II and III) or many maize elements bear relatively long branches (clade IV)
in these clades (Figure 2.2A), which are the signatures for loss of transposition activity.
2.3.4 Other Insertions and Deletions within the Candidate Coding-MULEs
The analysis above indicated that deletions in coding regions are prevalent in maize
coding-MULEs, and this is possibly the most dominant factor for loss of coding capacity of
these elements. The abundance of elements with deletions in maize could be attributed to a
high deletion frequency in maize. Alternatively, the element with deletions may have an
advantage in transposition (for instance, because of small size), so they have achieved
relatively high copy numbers. To determine whether the frequency of insertion/deletion
within the candidate coding-MULEs is similar between maize and rice, pairwise comparison
was conducted using individual coding-MULEs and their most similar homologs. For
accuracy, only pairs bearing higher than 95% identity in both maize and rice were considered.
This portion of coding-MULE pairs were analyzed and the number and length of indels in
those pairs were calculated and normalized to the average number of indels per kb (NIK) and
the average length of indels per kb (LIK) (see Section 2.5). The results show that the number
of indels is significantly higher (p<0.05, t-test) in maize than that in rice in all the identity
ranges except 98-99% (Figure 2.6A). The number of indels is increasing when the codingMULE pair is less similar, with a ~4.5 fold increase when the similarity is 95-96% compared
to that of over 99% in both maize and rice. Meanwhile, the most significant difference
between maize and rice is observed with the group containing element pairs with 95-96%
identity. For this group, the NIK in maize is ~2.48 and that in rice is ~1.40, suggesting that
55

there is at least one more indel per kb per coding-MULE pair generated in maize than those
in rice. When comparing the LIK of coding-MULE pairs between maize and rice, no
significant difference was observed and the average LIK values are 87.36 bp ± 16.06 for
maize and 89.24 bp ± 11.21 for rice (p=0.9235, t-test). To ensure the nucleotide identity
reflected the divergence of homologous coding-MULE pairs, indel rates were calculated
based on synonymous substitution rates (Ks) between these pairs of elements in coding
regions, and a similar trend was observed (Figure 2.6B). Taken together, it seems that codingMULEs in maize experienced more indels than that in rice.
To determine whether the higher frequency of indels in maize is specific to codingMULEs or a generic feature for the entire genome, indel frequency in LTR sequences of
individual Copia-like LTR elements was analyzed in the two genomes. As was observed for
coding-MULEs, maize LTR sequences seem to have experienced more frequent indels than
that in rice. However, the difference is only evident when the nucleotide identity is within 9697% (p=0.0227, t-test). It should be noted that indel frequencies between LTRs and codingMULEs in rice are not significantly different within the same identity range. In contrast, the
average indel numbers in the maize coding-MULEs are about two-fold of those in LTRs
when the sequence identity ranges from 95% to 98% (Figure 2.6A). Collectively, these
results demonstrate that maize may be more prone to incidence of indels than rice at the
whole genome level. More importantly, within the maize genome, coding-MULEs seem to
have experienced more indels than LTRs if we assume point mutation rate is comparable
across different families of TEs.

56

Figure 2.6 Average number of indels in maize and rice TEs.
(A) Average number of indels in candidate coding-MULEs (maize-CMs and rice-CMs) and
Copia-like LTR elements using pairwise nucleotide identity as the grouping criterion.
(B) Average number of indels in candidate coding-MULEs using synonymous substitution
rate as the grouping criterion.

2.3.5 Expression Evidence of the Candidate Coding-MULEs in Maize and Rice
A functional transposase is only available for transposition if the element is expressed.
To determine how many candidate coding-MULEs are expressed, the publically available
57

EST and full-length cDNA (fl-cDNA) databases were searched for evidence of expression.
The completeness of these datasets was roughly assessed by determining the proportion of
non-TE genes that have at least one match in the database with 99.5% or higher identity over
the entire matched sequence. The results revealed that 36% of non-TE genes in maize and 45%
of that in rice have expression evidence, suggesting that the dataset for rice is 1.2-fold more
comprehensive than that of maize. Data from next generation sequencing, such as RNA-seq,
were not examined because most candidate coding-MULEs have highly similar copies in the
genome and the short reads of RNA-seq experiments do not allow us to determine which
specific element is expressed.

58

Table 2.4A Candidate coding-MULEs with expression evidence in maize and rice.
Species

Maize

Rice

CodingMULE
CM-Zm373
CM-Zm391
CM-Zm138
CM-Zm216

With
nested TE
Yes
Yes
Yes
Yes

EST/fl-cDNA*

ORF status

BT069140
gi|211046304|gb|FK977962.1|FK977962
gi|211501343|gb|FL022227.1|FL022227
gi|211515319|gb|FL470580.1|FL470580

CM-Zm352

Yes

gi|211161841|gb|FK974923.1|FK974923

CM-Zm418
CM-Zm091
CM-Zm369
CM-Zm137
CM-Os180
CM-Os087
CM-Os392
CM-Os222
CM-Os464

No
No
No
No
Yes
Yes
Yes
Yes
Yes

BT041283
BT070085
gi|211378400|gb|FL229430.1|FL229430
gi|211249173|gb|FL479070.1|FL479070
AK066496
gi|87004716|gb|CI306800.1|CI306800
gi|88668382|gb|CI721944.1|CI721944
gi|88692462|gb|CI736037.1|CI736037
gi|88846512|gb|CI373280.1|CI373280

CM-Os133

Yes

AK072808

CM-Os028

Yes

AK288956

CM-Os046

Yes

AK120202

CM-Os181
CM-Os252
CM-Os388
CM-Os364
CM-Os446
CM-Os006
CM-Os083
CM-Os089
CM-Os422
CM-Os209
CM-Os317
CM-Os217
CM-Os370
CM-Os350

Yes
Yes
Yes
Yes
No
No
No
No
No
No
No
No
No
No

AK067920
gi|88718219|gb|CI741729.1|CI741729
gi|88695069|gb|CI739107.1|CI739107
gi|88695796|gb|CI737373.1|CI737373
AK073736
gi|58687855|gb|CK076542.1|CK076542
gi|86437298|gb|CI119020.1|CI119020
gi|86827995|gb|CI274907.1|CI274907
gi|87030711|gb|CI361925.1|CI361925
gi|88276743|gb|CI397545.1|CI397545
gi|88727053|gb|CI750708.1|CI750708
AK066465
gi|88846132|gb|CI372900.1|CI372900
gi|88297974|gb|CI555989.1|CI555989

CM-Os302

No

gi|29629482|gb|CB634491.1|CB634491

CM-Os018
CM-Os395
CM-Os200
CM-Os044
CM-Os352

No
No
No
No
No

gi|88730292|gb|CI753906.1|CI753906
gi|88279043|gb|CI400043.1|CI400043
gi|5701669|gb|C28952.2|C28952
AK100632
gi|29632126|gb|CB637135.1|CB637135

deletion only
deletion only
deletion only
deletion only
deletion & premature
stop codon & frameshift
deletion only
deletion only
deletion only
putative intact
deletion only
deletion only
deletion only
deletion only
deletion only
deletion & premature
stop codon & frameshift
deletion & premature
stop codon & frameshift
frameshift & premature
stop codon
premature stop codon
putative intact
putative intact
putative intact
deletion only
deletion only
deletion only
deletion only
deletion only
deletion only
deletion only
deletion & frameshift
deletion & frameshift
frameshift
frameshift & premature
stop codon
premature stop codon
putative intact
putative intact
putative intact
putative intact

*EST/fl-cDNA: expressed sequence tag/full length cDNA

59

Table 2.4B Summary of candidate coding-MULEs with expression evidence in maize
and rice.
Coding-MULEs with putative intact transposase

Maize
Rice

Coding-MULEs with defects in transposase

With
expression
evidence

Without
expression
evidence

Total

With
expression
evidence

Without
expression
evidence

Total

1 (3.13%)
7 (3.95%)

31 (96.88%)
170 (96.05%)

32
177

8 (1.61%)
21 (7.02%)

490 (98.39%)
278 (92.98%)

498
299

An element was considered to be expressed if it matches an fl-cDNA or EST sequence
with at least 99.5% identity over the entire matched sequence (at least 300 bp). The results
revealed that there were more coding-MULEs with either EST or fl-cDNA evidence in rice
(n=28) than that in maize (n=9) (χ2=12.3933, p=0.0004; Table 2.4A). Even if the 1.2-fold
enrichment of expression evidence in rice than maize were taken into account, rice still
contains more elements (n=23) (χ2=7.9969, p=0.0047) with expression evidence. In both
genomes, elements with expression evidence include coding-MULEs with and without nested
insertions. In rice, expression evidence was detected for 4% (n=7) of elements with putative
intact transposase and 7% (n=21) of elements with defects in transposases whereas those in
maize are only 3% (n=1) and 1.6% (n=8), respectively (Table 2.4B). In either case, it does
not appear that elements with putative intact transposases are more frequently transcribed.
Interestingly, among the 7 elements containing putative intact transposases that are expressed
in rice, three have a MITE insertion (among the 107 elements containing the Os0548) in the
C-terminal region of the relevant coding-MULEs (~2.5 kb downstream of the stop codon of
the transposase ORF), which does not seem to affect the expression of the elements, at least
at the transcription level (Table 2.4A). Overall, only a small subset of candidate codingMULEs are expressed, yet rice has many more expressed elements than maize does, which
may explain why the rice genome harbor many more MULEs. However, we must be cautious
about interpreting this difference because it is known that expression of TEs is often induced
60

under stress and the higher number of coding-MULEs expressed in rice may be due to the
overrepresentation of stress conditions in the rice dataset.
2.4 Discussion
2.4.1 Differential Amplification of MULEs Including Coding-MULEs in Maize and Rice
The first active MULE element, Mutator, was found in maize due to the high mutation
frequency it caused (Robertson, 1978). With the availability of a myriad of genome
sequences, analysis of TEs has been carried out at the whole genome level, resulting in the
discovery of the prevalence of MULEs in most living organisms (Yu et al., 2000; Lisch et al.,
2001; Chalvet et al., 2003; Rossi et al., 2004; Neuveglise et al., 2005; Marquez and Pritham,
2010). Being members of the grass family, both maize and rice contain thousands of MULEs
(Schnable et al., 2009; Ferguson and Jiang, 2012). However, compared with rice (~370 Mb
available sequence), maize (~2.1 Gb available sequence) contains less MULEs per unit
genomic sequence (~84 per Mb in rice vs. ~8 per Mb in maize) as well as per unit coding
sequence of non-TE genes (~770/Mb in rice vs. ~318/Mb in maize, based on maize genome
annotation v2 and MSU rice annotation version 7). The persistence of TEs is an interaction
between amplification through transposition, duplication of genomic sequences, and loss of
TEs by excision and sequence erosion. Transposase, the protein encoded by autonomous
elements, catalyzes transpositions, and is therefore responsible for increasing the copy
number of the elements. In this study, comparable numbers (530 vs. 476) of candidate
coding-MULEs were detected in maize and rice. Since all the candidate elements contain
partial or complete transposases, they should have been derived from putative autonomous
elements at a certain evolutionary stage. This implies that the resource for generating
transposases was comparable between maize and rice in the traceable past, and the loss of

61

such resource has been accelerated in maize in the recent past, which led to the reduced
abundance of MULEs.
Maize and rice share an ancestor about 50-70 million years ago (Wolfe et al., 1989) and
should have inherited largely the same set of transposable elements including MULEs. From
this point of view, it is surprising that the phylogenetic composition of coding-MULEs is
different between maize and rice, in addition to the difference in the total copy numbers. The
maize elements are abundant in clade I and IV, while the rice elements are amplified in clade
II and III (Figure 2.2A). This suggests that either the amplification of TEs is a rather
fortuitous process or different genome environments may favor the survival of distinct
elements.
2.4.2 Factors Involved in Degeneration of Coding-MULEs
In this study, various factors that may lead to the loss of coding capacity of MULE
transposases were dissected. Apparently, for both maize and rice, deletion is the most
devastating factor (Table 2.3A), which causes loss of the coding sequence or frameshift.
Deletion of sequence is much more prevalent in maize than that in rice (90% vs. 40% of the
coding-MULEs in maize and rice, respectively). Point mutation is the second most important
factor, which resulted in the mutation of the DDE motif, the loss of the start codon, and the
formation of premature stop codon. Nevertheless, the frequency of this type of mutation
(~40%; Table 2.3A; coding-MULEs containing ORFs with DDE or start codon mutations,
and those with premature stop codons) is comparable between maize and rice and therefore
does not explain the differential amplification of MULEs between the two species. In
addition, it is likely that point mutations within regions other than the DDE motif and the
start codon may also lead to dysfunctional transposase. As a result, the number of functional
transposases might be overestimated in this study. The third important factor is the insertion
62

by other TEs, which may interrupt the ORF of the transposases or interrupt the cis-elements
that are required for further transposition. Again, the number of elements that harbor nested
insertions is comparable between maize and rice. However, the nested insertions in maize are
more harmful than that in rice for a variety of reasons (see below). Thus, among the three
major factors that demolish the coding capacity of MULEs, two are significantly enforced in
maize.
Based on pairwise comparison of homologous elements, indels occur more frequently in
maize than in rice. Certainly, this is based on the assumption that the point mutation rate is
comparable in the two species. Given the fact that the number of elements with defects
caused by point mutation is similar in maize and rice (see above), this is likely the case. In
addition, our analysis using synonymous substitution rate led to similar results, further
suggesting that functional constraint on nucleotide substitution is similar in the two species.
Our analyses confirmed previous studies of the low stability of the maize genome (Vitte and
Bennetzen, 2006). By comparing an orthologous region of maize, sorghum, and rice, Ilic and
colleagues found that the maize genome experienced more sequence deletions than rice,
leading to the conclusion that the maize genome is less stable compared with the rice genome
(Ilic et al., 2003). The instability was partly attributed to the polyploidization event of maize.
Several studies suggest that genome rearrangement was more frequent in species that
experienced a polyploid event (reviewed in Wendel, 2000). Unequal homologous
recombination and illegitimate recombination are the two most proposed mechanisms
responsible for DNA removal (Bennetzen et al., 2005). It was also suggested that genes were
preferentially deleted from one of the two maize homeologs possibly through a similar
illegitimate recombination, which is also the primary source for TE removal in the maize
genome (Woodhouse et al., 2010).
63

The comparison of indel frequency between Copia-like LTR elements and codingMULEs shed new light on this issue. If we assume the frequency of point mutation is
comparable across the two genomes, it is obvious that both types of elements demonstrate
elevated indel frequency in maize, suggesting that in general indels occur more often in
maize than that in rice. However, what is somehow unexpected is that coding-MULEs in
maize seem to be subject to higher indel frequency than that of LTR elements and therefore
contributes to their degeneration. Such difference could be attributed to the fact that they are
located in different regions of the genome and the indel rate is influenced by the
recombination rate of the regions because it is known that TEs in different chromosomal
domains evolve differently (Tian et al., 2009). Alternatively, indels occur during
transposition, so it could be due to the different transposition mechanism of different families
of TEs as well. No matter what the underlying mechanism is, the difference in indel
frequency explains, at least to some degree, why LTR elements are more successful than
DNA TEs in maize.
In addition to the lower abundance of elements with putative intact transposase, the
number of expressed candidate coding-MULEs in maize is only 1/3 of that in rice. The fewer
expressed elements in maize is consistent with the low activity of MULEs in the genome,
which is in contrast with the recent burst of amplification of LTR retrotransposons. It is well
established that enormous variation of TE activities and compositions exist among different
organisms (reviewed by Feschotte and Pritham, 2007; Huang et al., 2012). Some plant
species, such as moss (Physcomitrella patens) and maize (Zea mays), exhibited relatively
high LTR retrotransposon activity and low DNA TE activity while some animal species, e.g.,
nematode (Caenorhabditis elegans) and brown bat (Myotis lucifugus), are more active in
DNA TEs and less in LTR elements (Huang et al., 2012). This suggests that genomes may
64

have distinct mechanisms for silencing different types of elements that led to differential
amplification of distinct TE families (Feschotte and Pritham, 2007). In fact, LTR elements,
especially gypsy-like LTRs, express more frequently than DNA TEs in maize as revealed by
more expressed sequence tags (ESTs) mapped to LTR retrotransposons than that to DNA TEs
(Vicient, 2010). So far, it is unclear whether the lack of expression may further accelerate the
degeneration of coding-MULEs in maize. For normal genes, those that are not expressed
evolve more rapidly than genes that are highly expressed (Hastings, 1996; Duret and
Mouchiroud, 1999, 2000; Davidson et al., 2012), and there is a correlation between
expression level, Ka/Ks, and pseudogenization (Frith et al., 2006; Zou et al., 2009). As a
result, it would not be surprising if the low expression frequency of the maize elements
contributes to the loss of coding capacity of MULEs.
2.4.3 Interaction between Different TEs
Plant genomes harbor many distinct superfamilies of TEs and it is not known whether the
amplification of some TEs impacts the amplification/survival of other TEs. Based on the
genome-wide analyses of TEs, the rice genome harbors a total of 166,700 TEs (Jiang and
Panaud, 2013) while that for maize is 1,283,000 (Schnable et al., 2009). If this is translated to
TE insertions per unit sequence, the density of TEs in maize is 1.4-fold of that in rice (613
TEs/Mb sequence in maize vs. 439 TEs/Mb sequence in rice). From this point of view, the
total number of nested TE insertions found in the candidate coding-MULEs (403 in maize vs.
251 in rice) is largely comparable to the genomic average and to each other in rice and maize.
Nevertheless, nested TE insertions are more detrimental to the candidate coding-MULEs in
maize than that in rice due to the following facts. First, the majority (~88%) of the candidate
coding-MULEs with TE insertions in maize contains RNA or retrotransposons (RNA-TE and
DNA-RNA-TE), which are usually larger than DNA-TEs and are more disruptive (Figure
65

2.3B). Second, more candidate coding-MULEs in maize harbor two or more TE insertions
(53%) compared with the majority of elements in rice that contain only one TE insertion
(81%) (Figure 2.3A). This further increases the chance to abolish the functionality of the
coding-MULEs, which is consistent with the fact that in maize, the proportion of elements
with their transposases interrupted by nested TEs is twice of that in rice. Collectively, these
nested TE insertions impaired a large fraction of coding-MULEs in maize, which is reflected
by the presence of only two elements (~1%) with potentially intact transposases among all
the coding-MULEs containing nested insertions (Table 2.3A). On the other hand, few
candidate coding-MULEs have inserted into other TEs including retrotransposons. This is
likely because MULEs preferentially insert into low copy or genic sequences (Liu et al.,
2009). Such target specificity confers certain evolutionary advantages. For instance, the
elements in genic regions are more likely to be expressed. Nevertheless, it may also bring
about vulnerability to these elements when other elements such as retrotransposons are
actively transposing. This is because retrotransposons tend to insert into other repetitive
sequences so their activity is deleterious to other elements while the amplification of MULEs
or other DNA transposons rarely interrupt retrotransposons. This is consistent with the results
from a previous study where it was shown that the incidents of insertions of other TEs
(including LTR elements) into miniature inverted repeat transposable elements (MITEs) were
65 times more often than that of MITEs into LTR and other DNA elements (Jiang and
Wessler, 2001). This indicates that MITEs are similar to coding-MULEs in terms of serving
as targets for other elements rather than targeting other TEs.
Both theoretical modeling and empirical results demonstrated that mating systems play
potential roles in shaping the abundance and diversity of transposable element within a
genome (Wright and Schoen, 1999; Wright and Finnegan, 2001; Lockton and Gaut, 2010;
66

Boutin et al., 2012). A recent study showed that mode of reproduction contributed to the
different transposon profiles in self-fertilizing Arabidopsis thaliana and its outcrossing
relative Arabidopsis lyrata (Lockton and Gaut, 2010). This and other studies led to the
conclusion that a reduced efficacy of natural selection against TE insertions in selfing
populations (Wright et al., 2001; Tam et al., 2007; Dolgin et al., 2008). Such reduced
pressure against TE insertions provides more advantage for DNA TEs than RNA TEs
because the insertion of DNA TEs are more likely to be in genic regions which are subject to
more intensive selection. Our comparison between rice (a selfing plant) and maize (an
outcrossing plant) provides additional understanding about the possible influence of mating
system on the dynamics of TEs. This is because outcrossing offers continuous opportunity for
stochastic introduction of novel autonomous elements that may initialize new transposition
activity. If a new retrotransposon is introduced, it is conceivable that the increased
amplification of retrotransposons gradually abolishes the activity of MULEs or other DNA
TEs through insertion into them. In contrast, the introduction of DNA TEs is not as harmful
for retrotransposons. Taken together, the genomes of outcrossing plants are less favorable to
DNA TEs due to the elevated efficacy of natural selection as well as the increased chances
being attacked by retrotransposons. From this point of view, plants experiencing significant
outcrossing are less likely to contain abundant DNA TEs and papaya is an excellent example.
2.5 Materials and Methods
2.5.1 Genomic Sequences and TE Libraries
The B73 maize genomic sequence RefGen v2 was downloaded from the
MaizesSquence.org (http://www.maizesequence.org/) and the Nipponbare rice genomic
sequence Release 7 was downloaded from the Rice Genome Annotation Project at Michigan
State University (http://rice.plantbiology.msu.edu/index.shtml). TE library for rice and
67

MULE TIR libraries (MULE TIR) for both maize and rice were constructed and curated by
the Jiang Lab. The TE library for maize was downloaded from the Maize Transposable
Element Database (http://maizetedb.org/~maize/) in August 2011.
2.5.2 Identification of Candidate Coding-MULEs
To maximize the possibility of detecting coding-MULEs, all the transpositionally active
MURA-related transposases (e.g. MURA and those of Hop, Jittery, Os3378, AtMu1)
(Robertson, 1978; Bennetzen et al., 1984; Singer et al., 2001; Chalvet et al., 2003; Xu et al.,
2004; Gao, 2012) and some MURA-related transposases with conceptual translations were
collected and used in the NCBI TBLASTN search (e<10-5, http//www.ncbi.nlm.nih.vov/blast/)
against the maize and rice genomes, respectively. Detailed information about the MULEs
used as queries is provided in Table 2.5. Sequences producing significant alignments (e<10 -5)
were retained and their 50 kb flanking sequences were retrieved. The resulting sequences
were masked by the MULE TIR libraries of maize and rice, respectively, using the
RepeatMasker program (www.repeatmasker.org). A candidate coding-MULE must satisfy
the following criteria. First, the pairwise identity between its two TIRs should be higher than
75% and in an inverted orientation with the TIR-ends facing outwards. Second, sequence
homologous to transposases (NCBI BLASTX, e<10-5) must be located within the two TIRs.
Lastly, a TSD (8-11 bp) immediately flanking the TIRs must be present. For TSDs of 8 bp,
one mismatch or indel (one nucleotide) is allowed and for those equal or larger than 9 bp, a
maximum of 2 mismatches (or one mismatch plus one indel) is allowed.

68

Table 2.5 MURA and MURA-related transposases used in the study.
Element

GenBank GI
/Accession

Species

Jittery

7673677/AAF66982

Zea mays

Size of
putative
transposase
(amino acids)
709

MuDR

540581/AAA21566

Zea mays

823

4942

TRAP

5690095/CAB51950

Zea mays

863

6393

AtMu1

2565011/AAB81881

Arabidopsis
thaliana

761

3645

Singer et al., 2001

Os3378

52353379/AAU43947

Oryza sativa

866

4394/43
95

Gao, 2012

FAR1

240255849/ NP
567455

827*

4079*

Hop

30421204/AAP31248

836

3299

Mutyl

50553866/XP 504344

Arabidopsis
thaliana
Fusarium
oxysporum
Yarrowia
lipolytica

1178

7413

Neuveglise et al.,
2005

RMUA
MURA-like
MURA-like

156723167/BAF79582
194689672/ACF78920
223950329/ACN29248

707
601
751

4374
N/A
N/A

N/A†
N/A
N/A

MURA-like

12322384/AAG51216

826

N/A

N/A

MURA-like

5734742/AAD50007

622

N/A

N/A

MURA-like

7523705/AAF63144

726

N/A

N/A

MURA-like

17380908/AAL36266

749

N/A

N/A

MURA-like
MURA-like
MURA-like
MURA-like
MURA-like
Hypothetical
protein
Predicted
protein
Hypothetical
protein

41469647/AAS07370
22094356/AAM91883
15209152/AAK91885
29788811/AAP03357
51477400/AAU04773
242096428/XP
002438704
224122824/XP
002318925
225432189/XP
002268620

Oryza sativa
Zea mays
Zea mays
Arabidopsis
thaliana
Arabidopsis
thaliana
Arabidopsis
thaliana
Arabidopsis
thaliana
Oryza sativa
Oryza sativa
Oryza sativa
Oryza sativa
Cucumis melo

747
896
959
907
807

N/A
N/A
N/A
N/A
N/A

N/A
N/A
N/A
N/A
N/A

Sorghum bicolor

720

N/A

N/A

Populus
trichocarpa

580

N/A

N/A

Vitis vinifera

746

N/A

N/A

Element
size (bp)
3916

Reference
Xu et al., 2004
Hershberger et
al., 1991
Comelli et al.,
1999

Hudson et al.,
2003
Chalvet et al.,
2003

* FAR1 has no identifiable terminal inverted repeats (TIRs), the length of putative
transposase refers to the protein sequence of the gene and element size is the gene length.
† MURA-related transpsases with only NCBI depository and no detailed study are denoted as
N/A for the element size and reference.

69

2.5.3 Detection of Nested TE Insertions in the Candidate Coding-MULEs and
Estimation of Ages of Nested LTR Retroelements
The candidate coding-MULEs were masked using the maize and rice TE libraries,
respectively, using the RepeatMasker program (www.repeatmasker.org) and the resulting
output file was used to determine the number and type of nested TEs in the candidate codingMULEs. The coordinates of the coding regions (as defined in the following section) and the
inserted TEs were compared in order to determine whether the inserted TEs interrupt the
open reading frame of the candidate coding-MULEs. If the coordinates of the inserted TE are
within the coordinates of the coding region, the TE is considered to be inserted in the coding
region of the candidate coding-MULE.
Estimation of the insertion time of intact long terminal repeat (LTR) retrotransposons
was based on the divergence of the two LTRs. Sequences of the two LTRs of one element
were aligned using the MUSCLE program (Edgar, 2004) and the number of substitutions per
site between the two LTRs was obtained using MEGA 5.2.2. Nucleotide substitution rate 1.3
x 10-8 per site per year was used to calculate the approximate age of the LTR elements (Ma et
al., 2004).
2.5.4 Determination of the Coding Capacity of the Candidate Coding-MULEs
To determine the coding region of the candidate coding-MULEs, nested insertions were
first masked using the maize and rice TE libraries (without MULE sequences), respectively,
using the RepeatMasker program (www.repeatmasker.org). The masked sequences were used
to search (NCBI BLASTX with e<10-5) against the total protein datasets of maize and rice,
which contain annotated TE proteins and were downloaded from the MaizeSequence.org
(http://www.maizesequence.org/)

and

the

Rice
70

Genome

Annotation

Project

(http://rice.plantbiology.msu.edu/index.shtml), respectively. To ensure that the annotated
proteins producing significant alignments (smallest e-value) with the candidate codingMULEs were indeed MULE transposase, these protein sequences were used to search against
the above mentioned MURA and MURA-related transposase sequences using the NCBI
BLASTP (e<10-5) program. If the annotated proteins had significant alignments (e<10-5) with
MURA or MURA-related sequences, the coding region was defined according to the
annotated protein. For the annotated proteins without any significant alignment with known
transposases, it suggested that the transposase sequence was not annotated in an ORF because
of some defects (e.g., frameshift, premature stop codon, or large deletions). In this case, the
nucleotide sequences of the elements were used to search (NCBI BLASTX with e<10-5)
against the MURA and MURA-related transposase sequences directly and the regions with
significant alignments with those transposase sequences were defined as the coding region.
For each candidate coding-MULE, the alignment profiles were manually examined and
custom python scripts were used to retrieve the sequences encoding transposases of the
candidate coding-MULEs. After obtaining the transposase coding sequences of the candidate
coding-MULEs, their coding capacity was evaluated for the presence of DNA binding and
catalytic domains. The HTH DNA binding domain was determined using the Jpred3 program
(http://www.compbio.dundee.ac.uk/www-jpred/), which was capable of detecting all the
experimentally defined HTH domains of some well-annotated transposases (e.g., those of
Hermes, Tc3, Mos1, Phage Mu) (Nesmelova and Hackett, 2010). To locate the DDE domain,
a multiple sequence alignment was conducted using the transposase coding sequences of the
candidate coding-MULEs in maize and rice separately, with the MURA protein sequence as a
reference. The conserved catalytic domain was established by comparing candidate codingMULEs with that of MURA and positions of the DDE amino acids in the transposases were
recorded. Specifically, if the three amino acids (DDE) are all present, and the length from the
71

first “D” to the “E” is longer than 100 amino acids, without premature stop codon(s) and
frameshift(s), the element was considered to contain a catalytic domain.
2.5.5 Determination of Indels in the Candidate Coding-MULEs
The number and length of indels between two homologous coding-MULEs were
determined using the following procedure. First, sequences of the candidate coding-MULEs
(after removing nested TEs) were used to conduct an all vs. all search using the NCBI
BLASTN program (e<10-10). Second, after the self-match was excluded, the element that
produced the most significant alignment (the two sequences with the longest alignment) was
retained to form a pair with the query coding-MULE, for which pairwise alignment was
conducted using the “gap” program available from the GCG package (version 11.0, Accelrys
Inc., San Diego, CA). Lastly, the number and length of indels were normalized based on the
total length of the two elements to make them comparable between maize and rice. That is,
the number of indels was divided by the total length of the two elements, giving a value of
the average number of indels per kb (NIK). Similarly, the normalized length of indels is the
average length of indels per kb (LIK). Grouping of different coding-MULE pairs was based
on two parameters, i.e., pairwise nucleotide identities and synonymous substitution rates (Ks),
respectively. To calculate the Ks values, coding sequences (as defined in the previous section)
of these element pairs were aligned based on amino acid codons, premature stop codons and
frameshifts were removed to achieve correct coding frame. The resulting aligned sequences
in fasta format were changed to .axt format using a custom Python script and Ks values were
determined using the KaKs Calculator program (Zhang et al., 2006). Comparison of NIK and
LIK of coding-MULE pairs with similar identity or Ks between maize and rice was
conducted using the SAS9.3 program at the High Performance Computing Centre of

72

Michigan State University. Nested insertions and one copy of the TSD were excluded upon
alignment.
In addition, the indel numbers in the LTR sequences of the Copia-like LTR
retrotransposon in the two genomes were calculated. The sequences of LTRs in rice and
maize were from the rice and maize TE libraries mentioned above. The LTR sequences were
used to search against the maize and rice genomes using the RepeatMasker program
(www.repeatmasker.org). Custom Python scripts were used to extract the coordinates of
intact LTRs and retrieve their sequences. Pairwise sequence identity and determination of
average indel numbers were similar to that conducted for coding-MULEs.
2.5.6 Phylogenetic Analysis
Amino acid sequences of the catalytic region (corresponding to 331-489 amino acids of
MURA) of the candidate coding-MULEs were used to conduct the phylogenetic analysis in
MEGA 5.2.2 (Tamura et al., 2011). Frameshifts were corrected and premature stop codons
were excluded to ensure appropriate alignment. Figure 2.2A contains known MULEs and
representative elements with catalytic domains in the two genomes. The representatives were
chosen as following: if two elements shared 80% identity in 80% of the element region, only
one element was retained. In this way, 211 rice MULEs and 195 maize MULEs with catalytic
regions were excluded. Figure 2.2B contains known MULEs in Figure 2.2A and all MULEs
with putative intact transposases, with the exception of one element family in rice. This
element family contains 108 members and 59 of them contain putative intact transposases,
and only four representative elements were chosen to be included in Figure 2.2B (clade III) in
order to attain a manageable size. The Maximum Likelihood method was used to infer the
evolutionary history and the tree with the highest log likelihood value is shown. A discrete
Gamma distribution was used to model evolutionary rate differences among sites (5
73

categories (+G, parameter = 4.0540)). All positions with higher than 95% site coverage were
used in the analysis and only bootstrap (500 replicates) values equal or higher than 50% were
shown.
2.5.7 Determination of the Expression Status of the Candidate Coding-MULEs
Expression Sequence Tags (ESTs) for maize (516,425 ESTs) and rice (1,253,557 ESTs)
were

downloaded

from

the

NCBI

dbEST

database

(http://www.ncbi.nlm.nih.gov/dbEST/index.html) on January 4th, 2013. The full-length
cDNA (flcDNA) library for maize (27,455) was downloaded from the Maize Full Length
cDNA Project (http://www.maizecdna.org/) on February 2nd, 2013 and that for rice (37,139)
was

from

the

Knowledge-based

Oryza

Molecular

Biological

Encyclopedia

(http://cdna01.dna.affrc.go.jp/cDNA/) on Oct 1st, 2008. The EST and flcDNA libraries were
concatenated into one file (EST-flcDNA) for both maize and rice, respectively. The candidate
coding-MULE sequences were searched against the EST-flcDNA library using the NCBI
BLASTN program (e<10-5). A coding-MULE is considered to have expression evidence if
the identity of matched sequence between the coding-MULE and EST/flcDNA is higher than
99.5% over the entire length of the EST/flcDNA.
2.6 Acknowledgments
We thank Ann Ferguson and Stefan Cerbin (Michigan State University) for critical
reading of the manuscript.

74

REFERENCES

75

REFERENCES

Babu MM, Iyer LM, Balaji S, Aravind L (2006) The natural history of the WRKY-GCM1
zinc fingers and the relationship between transcription factors and transposons.
Nucleic Acids Research 34: 6505-6520
Benito MI, Walbot V (1997) Characterization of the maize Mutator transposable element
MURA transposase as a DNA-binding protein. Molecular and Cellular Biology 17:
5165-5175
Bennetzen JL, Ma JX, Devos K (2005) Mechanisms of recent genome size variation in
flowering plants. Annals of Botany 95: 127-132
Bennetzen JL, Swanson J, Taylor WC, Freeling M (1984) DNA insertion in the first intron
of maize Adh1 affects message levels: cloning of progenitor and mutant Adh1 alleles.
Proc Natl Acad Sci U S A 81: 4125-4128
Boutin TS, Le Rouzic A, Capy P (2012) How does selfing affect the dynamics of selfish
transposable elements? Mobile DNA 3
Chalvet F, Grimaldi C, Kaper F, Langin T, Daboussi MJ (2003) Hop, an active Mutatorlike element in the genome of the fungus Fusarium oxysporum. Molecular Biology
and Evolution 20: 1362-1375
Comelli P, Konig J, Werr W (1999) Alternative splicing of two leading exons partitions
promoter activity between the coding regions of the maize homeobox gene Zmhox1a
and Trap (transposon-associated protein). Plant Molecular Biology 41: 615-625
Cowan RK, Hoen DR, Schoen DJ, Bureau TE (2005) MUSTANG is a novel family of
domesticated transposase genes found in diverse angiosperms. Molecular Biology and
Evolution 22: 2084-2089
Davidson RM, Gowda M, Moghe G, Lin HN, Vaillancourt B, Shiu SH, Jiang N, Buell
CR (2012) Comparative transcriptomics of three Poaceae species reveals patterns of
gene expression evolution. Plant Journal 71: 492-502
Dolgin ES, Charlesworth B, Cutter AD (2008) Population frequencies of transposable
elements in selfing and outcrossing Caenorhabditis nematodes. Genet Res 90: 317329

76

Duret L, Mouchiroud D (1999) Expression pattern and, surprisingly, gene length shape
codon usage in Caenorhabditis, Drosophila, Arabidopsis. Proc. Natl. Acad. Sci. USA
96: 4482-4487
Duret L, Mouchiroud D (2000) Determinants of substitution rates in mammalian genes:
Expression pattern affects selection intensity but not mutation rate. Molecular Biology
and Evolution 17: 68-74
Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high
throughput. Nucleic Acids Research 32: 1792-1797
Ferguson A, Zhao D, Jiang N (2013) Selective acquisition and retention of genomic
sequences by Pack-MULEs based on GC content and breadth of expression. Plant
Physiology 163: 1419-1432
Ferguson AA, Jiang N (2012) Mutator-like elements with multiple long terminal inverted
repeats in plants. Comparative and Functional Genomics 2012: 695827
doi:10.1155/2012/695827
Feschotte C, Pritham EJ (2007) DNA transposons and the evolution of eukaryotic genomes.
Annual Review of Genetics 41: 331-368
Frith MC, Wilming LG, Forrest A, Kawaji H, Tan SL, Wahlestedt C, Bajic VB, Kai C,
Kawai J, Carninci P, et al. (2006) Pseudo-messenger RNA: Phantoms of the
transcriptome. PLoS Genetics 2: 504-514
Gao DY (2012) Identification of an active Mutator-like element (MULE) in rice (Oryza
sativa). Molecular Genetics and Genomics 287: 261-271
Hastings KEM (1996) Strong evolutionary conservation of broadly expressed protein
isoforms in the troponin I gene family and other vertebrate gene families. Journal of
Molecular Evolution 42: 631-640
Hennig S, Ziebuhr W (2010) Characterization of the transposase encoded by IS256, the
prototype of a major family of bacterial insertion sequence elements. Journal of
Bacteriology 192: 4153-4163
Hershberger RJ, Warren CA, Walbot V (1991) Mutator activity in maize correlates with
the presence and expression of the Mu transposable element Mu9. Proc. Natl. Acad.
Sci. USA 88: 10198-10202

77

Hua-Van A, Capy P (2008) Analysis of the DDE motif in the Mutator superfamily. Journal
of Molecular Evolution 67: 670-681
Huang CRL, Burns KH, Boeke JD (2012) Active transposition in genomes. Annual Review
of Genetics 46: 651-675
Hudson ME, Lisch DR, Quail PH (2003) The FHY3 and FAR1 genes encode transposaserelated proteins involved in regulation of gene expression by the phytochrome Asignaling pathway. Plant Journal 34: 453-471
Ilic K, SanMiguel PJ, Bennetzen JL (2003) A complex history of rearrangement in an
orthologous region of the maize, sorghum, and rice genomes. Proc. Natl. Acad. Sci.
USA 100: 12265-12270
Jiang N, Bao ZR, Zhang XY, Eddy SR, Wessler SR (2004) Pack-MULE transposable
elements mediate gene evolution in plants. Nature 431: 569-573
Jiang N, Panaud O (2013) Transposable element dynamics in rice and its wild relatives. In
Zhang Q,Wing RA, eds, Genetics and Genomics of Rice, Plant Genetics and
Genomics: Crops and Models. Springer Science+Business Media New York
Jiang N, Wessler SR (2001) Insertion preference of maize and rice miniature inverted repeat
transposable elements as revealed by the analysis of nested elements. Plant Cell 13:
2553-2564
Kim SH, Walbot V (2003) Deletion derivatives of the MuDR regulatory transposon of maize
encode antisense transcripts but are not dominant-negative regulators of Mutator
activities. Plant Cell 15: 2430-2447
Kronmiller BA, Wise RP (2008) TEnest: automated chronological annotation and
visualization of nested plant transposable elements. Plant Physiology 146: 45-59
Kronmiller BA, Wise RP (2009) Computational finishing of large sequence contigs reveals
interspersed nested repeats and gene islands in the rf1-associated region of maize.
Plant Physiology 151: 483-495
Li YB, Harris L, Dooner HK (2013) TED, an autonomous and rare maize transposon of the
Mutator superfamily with a high gametophytic excision frequency. Plant Cell 25:
3251-3265
Lisch D (2002) Mutator transposons. Trends in Plant Science 7: 498-504
78

Lisch D (2005) Pack-MULEs: theft on a massive scale. Bioessays 27: 353-355
Lisch D, Girard L, Donlin M, Freeling M (1999) Functional analysis of deletion
derivatives of the maize transposon MuDR delineates roles for the MURA and MURB
proteins. Genetics 151: 331-341
Lisch DR, Freeling M, Langham RJ, Choy MY (2001) Mutator transposase is widespread
in the grasses. Plant Physiology 125: 1293-1303
Liu SZ, Yeh CT, Ji TM, Ying K, Wu HY, Tang HM, Fu Y, Nettleton D, Schnable PS
(2009) Mu transposon insertion sites and meiotic recombination events co-localize
with epigenetic marks for open chromatin across the maize genome. PLoS Genetics 5:
e1000733 doi:10.1371/journal.pgen.1000733
Lockton S, Gaut BS (2010) The evolution of transposable elements in natural populations of
self-fertilizing Arabidopsis thaliana and its outcrossing relative Arabidopsis lyrata.
BMC Evolutionary Biology 10
Ma JX, Devos KM, Bennetzen JL (2004) Analyses of LTR-retrotransposon structures
reveal recent and rapid genomic DNA loss in rice. Genome Research 14: 860-869
Marquez CP, Pritham EJ (2010) Phantom, a new subclass of Mutator DNA transposons
found in insect viruses and widely distributed in animals. Genetics 185: 1507-1517
Matsumoto T, Wu JZ, Kanamori H, Katayose Y, Fujisawa M, Namiki N, Mizuno H,
Yamamoto K, Antonio BA, Baba T, et al. (2005) The map-based sequence of the
rice genome. Nature 436: 793-800
Ming R, Hou SB, Feng Y, Yu QY, Dionne-Laporte A, Saw JH, Senin P, Wang W, Ly
BV, Lewis KLT, et al. (2008) The draft genome of the transgenic tropical fruit tree
papaya (Carica papaya Linnaeus). Nature 452: 991-996
Nesmelova IV, Hackett PB (2010) DDE transposases: Structural similarity and diversity.
Advanced Drug Delivery Reviews 62: 1187-1195
Neuveglise C, Chalvet F, Wincker P, Gaillardin C, Casaregola S (2005) Mutator-like
element in the yeast Yarrowia lipolytica displays multiple alternative splicings.
Eukaryotic Cell 4: 615-624

79

Paterson AH, Bowers JE, Bruggmann R, Dubchak I, Grimwood J, Gundlach H,
Haberer G, Hellsten U, Mitros T, Poliakov A, et al. (2009) The Sorghum bicolor
genome and the diversification of grasses. Nature 457: 551-556
Pritham EJ (2009) Transposable elements and factors influencing their success in
eukaryotes. Journal of Heredity 100: 648-655
Robertson DS (1978) Characterization of a mutator system in maize. Mutation Research 51:
21-28
Rossi M, Araujo PG, de Jesus EM, Varani AM, Van Sluys MA (2004) Comparative
analysis of Mutator-like transposases in sugarcane. Molecular Genetics and Genomics
272: 194-203
SanMiguel P, Gaut B, Tikhonov A, Nakajima Y, Bennetzen J (1998) The paleontology of
intergene retrotransposons of maize. Nature 20: 43-45
SanMiguel P, Tikhonov A, Jin YK, Motchoulskaia N, Zakharov D, MelakeBerhan A,
Springer PS, Edwards KJ, Lee M, Avramova Z, et al. (1996) Nested
retrotransposons in the intergenic regions of the maize genome. Science 274: 765-768
Sato S, Tabata S, Hirakawa H, Asamizu E, Shirasawa K, Isobe S, Kaneko T, Nakamura
Y, Shibata D, Aoki K, et al. (2012) The tomato genome sequence provides insights
into fleshy fruit evolution. Nature 485: 635-641
Schmutz J, Cannon SB, Schlueter J, Ma JX, Mitros T, Nelson W, Hyten DL, Song QJ,
Thelen JJ, Cheng JL, et al. (2010) Genome sequence of the palaeopolyploid
soybean. Nature 463: 178-183
Schnable PS, Ware D, Fulton RS, Stein JC, Wei FS, Pasternak S, Liang CZ, Zhang JW,
Fulton L, Graves TA, et al. (2009) The B73 maize genome: Complexity, diversity,
and dynamics. Science 326: 1112-1115
Singer T, Yordan C, Martienssen RA (2001) Robertson's Mutator transposons in A.
thaliana are regulated by the chromatin-remodeling gene Decrease in DNA
Methylation (DDM1). Genes & Development 15: 591-602
Slotkin RK, Nuthikattu S, Jiang N (2012) The evolutionary impact of transposable
elements on gene and genome regulation. In Greilhuber J,Wendel J, eds, Molecular
Biology and Evolution of the Plant Genome. Springer Press, pp 35-58

80

Tam SM, Causse M, Garchery C, Burck H, Mhiri C, Grandbastien MA (2007) The
distribution of Copia-type retrotransposons and the evolutionary history of tomato and
related wild species. Journal of Evolutionary Biology 20: 1056-1072
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5:
molecular evolutionary genetics analysis using Maximum Likelihood, Evolutionary
Distance, and Maximum Parsimony methods. Molecular Biology and Evolution 28:
2731-2739
Tian ZX, Rizzon C, Du JC, Zhu LC, Bennetzen JL, Jackson SA, Gaut BS, Ma JX (2009)
Do genetic recombination and gene density shape the pattern of DNA elimination in
rice long terminal repeat retrotransposons? Genome Research 19: 2221-2230
Vicient CM (2010) Transcriptional activity of transposable elements in maize. BMC
Genomics 11: 601 doi:10.1186/1471-2164-11-601
Vitte C, Bennetzen JL (2006) Analysis of retrotransposon structural diversity uncovers
properties and propensities in angiosperm genome evolution. Proc. Natl. Acad. Sci.
USA 103: 17638-17643
Wendel JF (2000) Genome evolution in polyploids. Plant Molecular Biology 42: 225-249
Wolfe KH, Gouy ML, Yang YW, Sharp PM, Li WH (1989) Date of the monocot-dicot
divergence estimated from chloroplast DNA sequence data. Proc. Natl. Acad. Sci.
USA 86: 6201-6205
Woodhouse MR, Schnable JC, Pedersen BS, Lyons E, Lisch D, Subramaniam S,
Freeling M (2010) Following tetraploidy in maize, a short deletion mechanism
removed genes preferentially from one of the two homeologs. PLoS Biology 8:
e1000409 doi:10.1371/journal.pbio.1000409
Wright S, Finnegan D (2001) Genome evolution: Sex and the transposable element. Current
Biology 11: R296-R299
Wright SI, Quang HL, Schoen DJ, Bureau TE (2001) Population dynamics of an Ac-like
transposable element in self- and cross-pollinating Arabidopsis. Genetics 158: 12791288
Wright SI, Schoen DJ (1999) Transposon dynamics and the breeding system. Genetica 107:
139-148

81

Xu ZN, Yan XH, Maurais S, Fu HH, O'Brien DG, Mottinger J, Dooner HK (2004)
Jittery, a Mutator distant relative with a paradoxical mobile behavior: excision
without reinsertion. Plant Cell 16: 1105-1114
Yu ZH, Wright SI, Bureau TE (2000) Mutator-like elements in Arabidopsis thaliana:
structure, diversity and evolution. Genetics 156: 2019-2031
Yuan YW, Wessler SR (2011) The catalytic domain of all eukaryotic cut-and-paste
transposase superfamilies. Proc. Natl. Acad. Sci. USA 108: 7884-7889
Zhang Z, Li J, Zhao XQ, Wang J, Wong GK, Yu J (2006) KaKs_Calculator: calculating
Ka and Ks through model selection and model averaging. Genomics Proteomics
Bioinformatics 4: 259-263
Zou C, Lehti-Shiu MD, Thibaud-Nissen F, Prakash T, Buell CR, Shiu SH (2009)
Evolutionary and expression signatures of pseudogenes in Arabidopsis and rice. Plant
Physiology 151: 3-15

82

CHAPTER 3

Transposition of a Rice Mutator-Like Element in the Yeast Saccharomyces cerevisiae

83

3.1 Abstract
Mutator-like transposable elements (MULEs) are wide-spread in plants and are present
in animals and fungi. MULEs are well known for their high transposition activity as well as
their capability to duplicate and amplify genomic sequences including gene fragments; thus
they play important roles in genome evolution. Despite their abundance and importance, few
MULEs have been shown to be currently active. Moreover, there is no report about MULE
activity in non-native hosts and it has been suggested that host factors are involved in the
transposition of Mutator elements in maize. In this study, the transposition activity of a rice
MULE, Os3378, was tested in yeast. The fact that Os3378 is capable of excising and
reinserting into the yeast genome suggests that yeast harbors all the host factors for
transposition of MULEs. The transposition activity induced by the wild-type transposase is
low; nevertheless, it can be altered through modification of the transposase sequences
including deletion, fusion and substitution. N-terminal deletion altered excision frequency,
expression level, and cellular localization of the transposase. The finding that fusion of a
fluorescent protein to a transposase significantly enhanced the transposition activity
represents the first report of enhancement of transposition activity through protein fusion.
Furthermore, the establishment of a MULE transposition system in yeast provides the
foundation for further studying the transposition mechanism of MULEs as well as how they
duplicate and acquire genomic sequences.
3.2 Introduction
Transposable elements (TEs) are genomic sequences that can move from one position to
another within a genome. With their repetitive nature, TEs usually constitute large fractions
of plant genomes. Based on the intermediate of transposition, TEs are divided into two major
classes. Class I TEs or retrotransposons transpose via an RNA intermediate, where the
84

genomic copy is transcribed into mRNA followed by reverse transcription of mRNA into
cDNA and integration into a new genomic location. Class II or DNA TEs transpose via a
DNA intermediate, where the TE excises directly from its original position and integrates in
another position. Both TE classes consist of autonomous and non-autonomous elements,
where the former encode proteins (transposases) that are responsible for the transposition of
themselves and their corresponding non-autonomous elements.
Mutator (Mu)-like transposable elements (MULEs) are class II TEs, for which the initial
discovery in maize was attributed to their high mutagenicity (Robertson, 1978). The founder
elements include the autonomous element, MuDR and the non-autonomous elements (Mu1Mu8, Mu10-Mu13), where the former generates the transposition machinery for movement of
all these elements (Bennetzen et al., 1984; Freeling, 1984; Chen et al., 1987; Talbert et al.,
1989; Fleenor et al., 1990; Chomet et al., 1991; Hershberger et al., 1991; Qin et al., 1991;
Lisch et al., 1995; Dietrich et al., 2002; Tan et al., 2011). All Mu elements share high
sequence similarity in their terminal inverted repeats (TIRs, ~220 bp) but containing distinct
internal sequences. Upon integration into a new position, they usually generate a 9-bp
duplication of the target site sequence, which is called target site duplication (TSD).
The founder elements of MULEs, MuDR/Mu, possess several characteristics that make
them excellent candidates for genome-wide mutagenesis studies in maize. First, their
insertions occur in both genetically linked and unlinked sites (Lisch et al., 1995), which
entails the possibility of genome-wide mutagenesis. Second, they preferentially integrate into
low-copy genomic regions, especially 5′ regions of genes (Cresse et al., 1995; Liu et al.,
2009). Third, insertions occur in late germinal cells, which can be transmitted to the progeny.
Taking advantage of Mu-active maize lines, large collections of transposon-insertion lines
have been developed by several research groups, providing materials for reverse genetics
85

studies (Raizada et al., 2001; Fernandes et al., 2004; Settles et al., 2007; McCarty et al., 2013).
In addition to Mu elements in maize, MULEs have been found in a wide range of organisms,
including other plants, fungi, and animals (Yu et al., 2000; Lisch et al., 2001; Singer et al.,
2001; Chalvet et al., 2003; Rossi et al., 2004; Neuveglise et al., 2005; Marquez and Pritham,
2010). In organisms where TEs have been examined at the whole genome level, MULEs can
reach thousands of copies. The two important food crops, rice and maize contain 30,475 and
12,900 MULEs, respectively (Schnable et al., 2009; Ferguson and Jiang, 2012). The fleshy
fruit crop, tomato, contains 28,041 MULEs (Ferguson and Jiang, 2012). Among the MULEs,
there occur a special group of elements that capture gene and/or gene fragments, which are
known as Pack-MULEs (Jiang et al., 2004). They are best studied in rice, where 2,924 PackMULEs were discovered (Ferguson et al., 2013). They are considered to be one of the
sources for genome evolution in terms of formation of new genes and regulation of related
sequences through the siRNA silencing pathway (Hanada et al., 2009). Although important,
elucidation of the mechanism for their formation is hindered partly because of the lack of a
MULE transposition system (or a species) that can be readily manipulated.
Despite their abundance in plants, only a few active MULE elements have been
discovered and little is known about the transposition mechanism. MuDR, which was the first
active autonomous MULE element discovered, encodes two proteins, MURA and MURB.
Transcription of MURA and MURB is initiated within their adjacent TIRs (Lisch, 2002).
MURA is the transposase protein that is responsible for catalyzing excision of Mu elements
from the original locations (donor sites) accompanied with or without reintegration into new
genomic loci (reinsertion sites). In contrast, the function of MURB remains unclear (Lisch,
2002). Subsequent to the discovery of MuDR, a number of active MULEs were reported in
several species, such as Jittery in maize (Xu et al., 2004), Os3378 in rice (Gao, 2012), and
86

AtMu1 in Arabidopsis (Singer et al., 2001), which are all distantly related to MuDR. More
recently, another active MULE (TED) was discovered in maize, which is relatively close to
MuDR based on their transposase sequences (Li et al., 2013). In all cases, transposition of
MULEs has only been observed in their native hosts. As such, mechanistic studies are
hindered and it is unclear whether any host factors are required for their transposition.
Establishment of a transposition system in a maneuverable organism would facilitate studies
of MULEs, especially the acquisition mechanism of Pack-MULEs. Yeast is an ideal species
for this purpose because of its small size, short generation cycles, and successful
recapitulation of transpositions of other TEs (Yang et al., 2006; Hancock et al., 2010).
In this study, a rice MULE, Os3378, successfully transposed in yeast. The transposition
activity induced by the wild type transposase is rather low, but can be improved through a
variety of approaches, including deletion of an N-terminal region and fusion with an
enhanced yellow fluorescent protein. This study provides new insights about the function of
transposase and regulation of transposition activity as well as the mechanism underlying
formation of Pack-MULEs.
3.3 Results
3.3.1 The Os3378 Transposase
The Os3378 element has 4 copies with over 98% similarity at the nucleotide level in
Nipponbare, the sequenced japonica rice cultivar. All of the four copies are annotated as
transposon proteins (LOC_Os04g28290, LOC_Os04g28350, LOC_Os05g31510, and
LOC_Os11g44180) in MSU version 7 rice pseudomolecules. Three of the Os3378 copies are
associated with a terminal inverted repeat (TIR) of 196-bp in length. One of them
(LOC_Os11g44180) is only associated with one terminal sequence, yet the coding region of
87

this element seems to be intact (Gao, 2012). To verify the gene structure, total RNA was
extracted from a japonica somaclonal line called Z418, where the expression of Os3378 was
previously detected (Gao, 2012). The amplified cDNA sequence of Os3378 from Z418
(called Os3378-Z) differs from that of LOC_Os5g31510 (computer annotation) at the
splicing sites of intron 2 and 3 (Figure 3.1A and Figure 3.8A). Exon 2 of Os3378-Z is 288
nucleotides (nt) longer than that of LOC_Os5g31510, while exon 4 is 6-nt shorter than that of
LOC_Os5g31510. The total length of Os3378-Z coding region is 886 amino acids (aa), which
is 90 aa longer than that of LOC_Os05g31510. Except this difference, the rest of the
sequences are the same between Os3378-Z and LOC_Os5g31510. The Os3378-Z transposase
protein is also longer than that of three known active MULE elements in maize, MURA of
MuDR (823 aa), JITA of Jittery (709 aa), and TEDA of TED (785 aa) (Chomet et al., 1991;
Feldmar and Kunze, 1991; Hershberger et al., 1991; Xu et al., 2004; Li et al., 2013).
A functional transposase protein usually consists of a DNA binding domain (for binding
transposon DNA) and a catalytic domain (for element excision and reinsertion). Through
comparison to known DNA transposases (encoded by IS256 and Hermes) (Hennig and
Ziebuhr, 2010; Nesmelova and Hackett, 2010) and locating helix-turn-helix motifs, a putative
DNA binding domain was identified between 300 and 400 aa of Os3378-Z, and a catalytic
domain was located between 440 to 610 aa (Figure 3.1B; 445D-510D-610E). In addition, one
nuclear export signal (NES) was predicted to be within the catalytic domain. Three nuclear
localization signals (NLS) were predicted, with one located upstream of DNA binding
domain and two located at the C-terminus of the protein. Interestingly, one of the NLSs at the
C-terminal region is encoded by the additional sequence of exon 2 in Os3378-Z (compared to
LOC_Os5g31510).

88

Figure 3.1 Schematic structures of Os3378 and constructs used in this study.
(A) Structural comparison between the annotated transposase (LOC_Os05g31510) and
Os3378-Z at the nucleotide level. Black triangles: terminal inverted repeat (TIR); empty
boxes: exons; lines linking empty boxes: introns; arrows: transcription start sites and
orientation; dashed lines indicate splicing site variations between LOC_Os05g31510 and
Os3378-Z.
(B) Structural comparison between LOC_Os5g31510 and Os3378-Z at the amino acid level.
NLS: nuclear localization signal; NES: nuclear export signal. Shaded regions are in common
between these two proteins.
(C) The expression vector with Os3378-Z transposase fused downstream of the GAL1
promoter.
(D and E) Os3378-Z and the artificial non-autonomous Os3378 (Os3378NA) which includes
the 5′ and 3′ TIRs and partial sub-terminal sequence. Symbols are the same as in (A).
(F and G) The reporter vector with Os3378NA inserted in the coding sequence and the
promoter region of the ADE2 gene.

89

3.3.2 Os3378-Z is Capable of Induction of Excision and Reinsertion with Low
Frequency in Yeast
The transposition assay consisted of two vectors, i.e., an expression vector containing the
Os3378-Z transposase coding sequence downstream of the GAL1 promoter, and a reporter
vector with an artificial non-autonomous Os3378 element (Os3378NA) inserted into either
the

coding

region

(pWL89aOs3378NAHpaI)

or

the

promoter

region

(pWL89aOs3378NAXhoI) of the ADE2 gene (Figure 3.1C-G). Os3378NA is comprised of
the 5′ and 3′ TIRs of Os3378 with a short linker sequence (~30 bp) between them. The
Os3378NA in the coding region of ADE2 is flanked by a TSD (TTAATTTAA), while the one
in the promoter region is not.
Excision of Os3378NA and recovery of a functional ADE2 gene allows growth of yeast
on culture medium lacking adenine. In general, the excision frequency was rather low
(~0.055 event/10-6 cells on 2% galactose). The excision events were further characterized by
amplifying the donor site following excisions using primers in the flanking region of
Os3378NA insertion sites and sequencing the amplicons. For the reporter vector with
Os3378NA inserted in the coding region of ADE2 (pWL89aOs3378NAHpaI), five colonies
were tested and all of them exhibited recovery of the original ADE2 sequence, suggesting the
selective pressure for ADE2 function. When the reporter vector pWL89aOs3378NAXhoI
(with Os3378NA in the promoter region) was used, variation of sequences at the donor site
following excisions was observed, which were classified into three types (Figure 3.2). Type I
includes those that restored the original ADE2 promoter sequence. Type II sequences consist
of deletions of one or both flanking regions of the donor site, while type III sequences
retained one terminal sequence on one side accompanied with or without small deletions on
the other side of the donor site (Figure 3.2). Out of 14 cases studied, type III is the most
90

frequent, accounting for 7 cases (50%). The length of the retained terminal sequence is
between 122-188 bp, which contained more than 62% sequence of an entire Os3378 terminus
(196 bp). Surprisingly, 6 out of the total 7 cases showed a preference for retention of the
terminal sequence at the 3′ end, suggesting such orientation may favor the expression of the
ADE2 gene. In addition, five type III events contained exactly the same sequences at the
donor site, which is featured by retention of 122 bp of the 3′ terminal sequence and 34 bp
deletion of the upstream flanking sequence of the Os3378NA. This is unlikely contamination
among different yeast ADE2 revertant colonies because they were either from different
sectors (one plate was divided into several sectors) or plates. Furthermore, one of the five
events was detected in one experiment while the other four were from another experiment.
Nevertheless, for the four events from the same experiment, the possibility of an early
excision event cannot be excluded, which may have occurred before cells were plated on the
medium lacking adenine. As a result, the 7 cases were at least derived from 3 independent
excision events, suggesting that retention of a single terminal sequence after excision was not
a rare event. However, search of the Nipponbare genomic sequence did not recover any
single terminus of Os3378 and no additional copy was detected in Z418 as well (Gao, 2012).

91

Figure 3.2 Sequences of the donor site following excision of Os3378NA.
The original donor site sequence (promoter region of the ADE2 gene) prior to the
incorporation of Os3378NA is shown on the top followed by the donor site sequence with
Os3378NA. Nucleotides underlined are the restriction site (XhoI) used to insert Os3378NA.
Black triangles denote the TIR of Os3378. Nucleotides flanking Os3378NA in the rectangle
are sequences from the cloning vector between the XhoI and EcoRV restriction sites (see
Section 3.5.3). Numbers in parenthesis are yeast revertant colonies containing that type of
sequences at the donor site following excisions.

Using the transposon display technique, reinsertions of Os3378NA after its excision from
the coding region of the ADE2 gene were identified. Cloning of two reinsertion sites
indicated that both inserted into 35S rRNA genes, but within different locations. One element
inserted into the internal transcribed spacer region (ITS1-1) and the other inserted into the
18S rRNA sequence (RDN18-1). Both insertions were associated with a 9-bp TSD
(AAAATTTAA; TTGAAAAAA) immediately flanking the element ends. Thus, Os3378-Z is
capable of inducing both excision and reinsertion of Os3378NA in yeast, albeit the frequency
is low.
3.3.3 Deletion of the N-Terminal Sequence of Os3378-Z Transposase Enhanced Excision
Frequency Which is Responsive to Galactose Concentrations
Previous studies showed that deletion of the N-terminal region of Ac (Kunze et al., 1995)
and phage Mu (MuA) transpoases (Kim and Morrison, 2009) resulted in increased
92

transposition activity. Comparison of their amino acid compositions revealed no common
sequence feature. However, when comparing their secondary structures, a helix-turn-helix
domain was detected in the deleted regions of both transposases (Ac transposase: 10-50 aa;
MuA: 1-77 aa). Analysis of Os3378-Z transposase sequence suggested that it also contains a
helix-turn-helix domain at the N-terminus (40-100 aa). The structural similarity of the Nterminal regions of all three transposases prompted us to test whether deletion of the Nterminal region would enhance the excision frequency of Os3378-Z. To this end, five
truncated transposases were constructed: Os3378-Z-80, Os3378-Z-105, Os3378-Z-130,
Os3378-Z-161, and Os3378-Z-168, which contain deletions of the N-terminal 79, 104, 129,
160, and 167 aa, respectively (Figure 3.3A). In the following studies, reporter vector with
Os3378NA integrated in the coding region of ADE2 gene was used to test the transposition
activity of different forms of Os3378-Z transposase.
As mentioned above, the Os3378-Z transposase is under the control of the GAL1
promoter, which is induced by galactose. Therefore, culture media with various galactose
concentrations (0.05%, 0.1%, 0.5%, 1%, 2%) were used to modulate the expression levels of
the transposase and Western blot analysis using the His antibody was conducted to determine
the protein levels. Not surprisingly, increasing galactose concentrations led to increased
protein levels as evidenced by both Os3378-Z and Os3378-Z-130 (Figure 3.3C, D), although
it seems that the wild-type Os3378-Z is more responsive to high galactose concentrations.

93

Figure 3.3 N-terminal deleted Os3378-Z transposases.
(A) Schematic representation of full-length and N-terminal deleted Os3378-Z transposases
(B) Relative excision frequency of full-length and N-terminal deleted Os3378-Z transposases
in response to various galactose concentrations. The highest excision frequency (i.e., Os3378Z-130 at 2% galactose concentration) was set as 100%.
(C) Protein levels of Os3378-ZCFH under various galactose concentrations. CFH: C-terminal
FLAG-His6 tag. A partial image of the total protein is shown at the bottom (see Section 3.5.3).
(D) Protein levels of Os3378-Z-130CFH under various galactose concentrations. A partial
image of the total protein is shown at the bottom.

The excision frequency increased with elevated galactose concentrations for both wild
type and truncated transposases, where the trend for Os3378-Z-130 is the most prominent
(Figure 3.3B). For Os3378-Z, Os3378-Z-80, Os3378-Z-105, Os3378-Z-161, and Os3378-Z168, few excision events were observed at low galactose concentrations (0.05% and 0.1%).
Even at the highest galactose level (2%), the excision frequency is still low. In contrast, the
excision frequency induced by Os3378-Z-130 is significantly enhanced (p<0.0001, t-test) at
higher galactose concentrations (≥0.5%) compared with lower concentrations (0.05% and
0.1%). Moreover, Os3378-Z-130 resulted in higher excision frequency than the other five
94

transposases, especially at 1% and 2% galactose levels (p<0.0001, t-test). With 2% galactose,
the excision frequency with Os3378-Z-130 is about 20-fold higher than that with the wildtype transposase (~1.2 vs. 0.055 events per 106 cells). As such, deletion of the N-terminal 129
aa of the Os3378-Z transposase significantly increased the excision frequency if galactose
concentration is 0.5% or higher.
3.3.4 Excision Frequency Altered by Substitutions of Amino Acids within 105 to 130 aa
of Os3378-Z Transposase
The differential excision frequency caused by Os3378-Z-130 and Os3378-Z-105
prompted us to study the amino acid composition between 105-130 aa region, which is the
only sequence/structural difference between the two truncated transposases. Multiple
sequence alignment revealed that this region was not conserved among different known
MULE transposases, including MURA, TEDA, and JITA. Analysis of the amino acid
composition indicated that it contains 35% (9 out of 26 aa) acidic residues and only two basic
residues, and the entire region is very hydrophilic based on the hydropathy analysis (Kyte and
Doolittle, 1982). To determine whether the amino acid composition of 105-129 aa affected
the excision activity, some amino acids in this region were mutated and four mutant
transposases were constructed (Figure 3.4A). In Os3378-Z-105Ala, most of the acidic
residues were substituted by alanine; in Os3378-Z-105Neutral, all the acidic residues were
substituted by their corresponding neutral amino acids; in Os3378-Z-105Basic, all the acidic
residues were substituted by basic amino acids with similar molecular weight, and in Os3378Z-105Hydrophobic, 9 hydrophilic residues were replaced by hydrophobic ones (see Section
3.5.3). Excision assay showed that both Os3378-Z-105Ala and Os3378-Z-105Neutral
resulted in much higher activity than the original Os3378-Z-105 (p<0.01, t-test) and the
excision frequency was comparable to that by Os3378-Z-130 (p>0.81, t-test) (Figure 3.4B).
95

However, Os3378-Z-105Basic exhibited no obvious difference from the original Os3378-Z105 (p=0.3204, t-test) and mutation of hydrophilic amino acids to hydrophobic ones
completely abolished the activity at all galactose concentrations (Figure 3.4B), suggesting
chemical and physical properties of amino acids in this region (105-130 aa) are critical to the
activity of the Os3378-Z transposase.

Figure 3.4 Os3378-Z-105 transposases with amino acid substitutions and their excision
frequency.
(A) Amino acid substitutions between 105-130 aa of Os3378-Z-105
(B) Relative excision frequency of Os3378-Z-105 and its mutant forms under various
galactose concentrations. The highest excision frequency (i.e., Os3378-Z-130 at 2% galactose
concentration) was set as 100%.
96

3.3.5 Cellular Localization of Os3378-Z Transposases with an N- or C-Terminal EYFP
Fusion as well as its Effect on Excision Frequency
To determine whether the increased excision rate of Os3378-Z-130 was due to its cellular
localization, an EYFP-tag (enhanced yellow fluorescent protein) was fused to the N- or Cterminus of these transposases (Figure 3.10B). Since the size of the EYFP is relatively large
(~260 aa and ~29 kD), whether the fusion would affect the excision frequency was assessed
at 2% galactose concentration. For the wild-type Os3378-Z transposase, the EYFP fusion at
the N-terminus exhibited no obvious effect while no excision event was observed if the
fusion is at the C-terminus (Figure 3.5B). However, this should be interpreted cautiously
because the basal excision frequency is low for Os3378-Z. Interestingly, addition of the
EYFP exerted different effects on the N-terminal truncated transposases with regard to the
fusion positions. For Os3378-Z-105, fusion of EYFP at its N-terminus enhanced its activity
whereas C-terminal fusion of EYFP suppressed its activity (Figure 3.5B). For Os3378-Z-130,
both N- and C-terminal fusions led to reduced activity. Since the N-terminal fusion of EYFP
on Os3378-Z-105 demonstrated positive effect on transposition, the amino acid sequence that
was introduced through fusion, which is directly attached to the transposase, was examined.
The 25 amino acid peptide upstream of the transposase (C-terminal sequence of the EYFP) is
hydrophobic, containing 4 basic amino acids with no acidic amino acids. In contrast, the
sequence upstream of 105 aa (80-104 aa) in Os3378-Z contain 6 acidic and only 1 basic
amino acids.

97

Figure 3.5 Cellular localization and excision frequency of N- or C-terminal EYFPtagged transposases.
(A) Cellular localization of full-length and N-terminal deleted transposases with EYFP tag at
the N-termini (left panel) and C-termini (right panel). DAPI (4', 6-diamidino-2-phenylindole)
is a fluorescent stain that binds to DNA.
(B) Relative excision frequency of different transposases at 2% galactose concentration.
(C) Cellular localization of EYFP with and without the Os3378-Z 105-130 protein sequence.

98

Confocal microscopy examination indicated that transposases with N- and C-terminal
EYFP fusions had different cellular localizations. When the fusion was at the N-terminus,
both EYFPOs3378-Z and EYFPOs3378-Z-105 were concentrated in the nucleus as revealed
by the co-localization of the DAPI-stained nuclear DNA and the EYFP-tagged transposases
(Figure 3.5A). In contrast, EYFPOs3378-Z-130 protein was almost evenly distributed in the
nucleus and cytoplasm (Figure 3.5A). When the fusion was at the C-terminus, all fusion
proteins formed aggregates in the cytoplasm (Figure 3.5A). This may explain the reduced
activity of both Os3378-Z-130 and Os3378-Z-105 upon fusion with EYFP at their C-termini.
The distinct cellular localization between EYFPOs3378-Z-105 and EYFPOs3378-Z-130
(with EYFP at the N-termini) raised the question whether the 105-130 aa region contains a
cryptic nuclear localization signal. To this end, this region was fused downstream of an EYFP
tag and its cellular localization was observed using confocal microscopy. As shown in Figure
3.5C, the resulting EYFP fusion protein was present over the entire cells, suggesting that this
region alone does not act as a nuclear localization signal. This finding was further confirmed
by the nuclear localization of EYFPOs3378-Z-105Ala, which contains 7 amino acid
substitutions between 105-130 aa (Figure 3.5A) with a similar cellular localization to
EYFPOs3378-Z-105. Similar to other transposases (Os3378-Z, Os3378-Z-105, and Os3378Z-130), C-terminal fusion of EYFP resulted in aggregation of Os3378-Z-105Ala (Figure
3.5A).
3.3.6 Protein Levels of Different Forms of Os3378-Z Transposase are not Correlated
with Excision Frequency
To determine whether excision frequency of full-length and N-terminal deleted
transposases is associated with protein levels in yeast cells, Western blot analysis was
conducted. For such analysis, a FLAG-His6 dual-tag (Zanetti et al., 2005) was fused to the C99

termini of the transposases (CFH), which were referred to as Os3378-ZCFH, Os3378-Z105CFH, Os3378-Z-105AlaCFH, and Os3378-Z-130CFH. Unlike EYFP, CFH-tag is short in
length (25 aa including spacer residues) and has small molecular weight (~2 kD), which
theoretically would not affect the activity of the transposases as much as EYFP. Indeed,
analysis of the excision frequency revealed no significant difference between the CFH-tagged
and control transposases (e.g., Os3378-Z-130 vs. Os3378-Z-130CFH; p=0.9535, t-test)
(Figure 3.6A). Western blot analysis indicated that protein levels of Os3378-ZCFH and
Os3378-Z-105AlaCFH were higher than that of Os3378-Z-105CFH and Os3378-Z-130CFH
under the same galactose concentration (2%) (Figure 3.6B). In general, no correlation was
observed between protein levels and excision frequency among different forms of Os3378-Z
transposase (p=0.7183; Figure 3.6C).

100

Figure 3.6 Western blot analysis and excision frequency of transposases with and
without C-terminal FLAG-His6 tag (CFH).
(A) Relative excision frequency of transposases with and without CFH tag at 2% galactose
concentration.
(B) Protein levels of transposases at 2% galactose concentrations. Numbers on the top are
molecular weight of full-length and N-terminal deleted Os3378-Z transposases with CFH tag.
(C) Relative excision frequency (B) as a function of protein levels (C) (relative density) of
various forms of Os3378-Z transposase with CFH tag.

3.3.7 Single Os3378 Terminus is Immobile
In 1988, Talbert and Chandler proposed that the presence of genes inside Mu elements
could be caused by the mobility of Mu termini (Talbert and Chandler, 1988). If two
independent Mu terminus from the same family encompass a gene, a Pack-MULE is formed.
To determine whether Os3378 terminus was capable of excision, a reporter construct
containing only the 5′ terminal sequence of Os3378 in the coding region of the ADE2 gene
101

was transformed into yeast along with the expression construct containing Os3378-Z-130.
Out of 30 replicates, no ADE2 revertants were observed on culture medium without adenine,
suggesting no excisions were induced by the transposase. This indicates that single Os3378
terminus is unlikely to be mobile.
3.3.8 Reinsertion of Os3378NA
To determine whether the factors influencing excision frequency also affect the
reinsertion frequency, Southern blot experiment was conducted using total DNA extracted
from the ADE2 revertant yeast colonies. In Figure 3.7A, the hybridization signals shared by
all samples represent the Os3378NA that is in the reporter vector and other signals correspond
to reinserted Os3378NA elements. Similar number of colonies with reinsertions were
observed between EYFPOs3378-Z-105 and EYFPOs3378-Z-130 at 1% (7 vs. 8, χ2=0.1101,
p=0.74) and 2% (8 vs. 10, χ2=0.4222, p=0.5158) galactose. Different numbers of reinsertions
were observed at 0.1% (9 vs. 5, χ2=1.8095, p=0.1786) and 0.5% (6 vs.11, χ2=2.6611,
p=0.1028) galactose concentrations. However, the differences were not statistically
significant (Figure 7A). Given the fact that the total number of colonies with reinsertions is
comparable between these two forms of transposase (30 vs. 34), it is likely the reinsertion
frequency remains unchanged. Overall, 38-49% of the excision events are accompanied with
reinsertion events. Since EYFPOs3378-Z transposase did not induce many excision events,
the ADE2 revertant colonies from all the galactose concentrations were tested in a single blot,
and the result revealed that 6 (32%) out of 19 yeast colonies were associated with reinsertions
(Data not shown), which is largely comparable to that from other transposases
(EYFPOs3378-Z-105 and EYFPOs3378-Z-130).

102

Figure 3.7 Reinsertions of Os3378NA.
(A) Southern blot analysis of reinsertions of Os3378NA.
(B) Distribution of reinsertion sites of Os3378NA with regard to genomic sequence features.
(C) Ratios of observed distribution of reinsertion sites to that of fraction of each genomic
feature in the yeast genome (S288C).
5′ region: reinsertions located at the upstream region of transcription start site (TSS) of
protein coding genes on both sides of reinsertion site; 3′ region: Os3378NA insertions
downstream of the transcription termination site (TTS) of protein coding genes on both sides
of reinsertion site; 5′ and 3′ regions: reinsertions located at the upstream region of the TSS of
one gene and the downstream region of the TTS of another; ARS: autonomously replicating
sequence; intergenic: including insertions in both 5′ and 3′ regions of genes.

103

To determine the location of new insertions, forty-four reinsertion sites were cloned and
sequenced, where five (11%) of them had no match to either the yeast genome (S288C) or
vector sequences. This is likely due to the sequence polymorphisms between the two yeast
strains (S288C vs. DG2523). Thirty-nine sequences have significant alignments with the
yeast genomic sequence (Appendix Table 3.1). The majority of insertions (62%) are located
in gene-rich regions where equal numbers (n=7) of insertions are located in the 5′ and 3′
regions of protein-coding genes (Figure 3.7B, see Section 3.5.8). Additionally, ten insertions
are located in the 5′ region of one gene and 3′ region of another (see Section 3.5.8).
Compared with the genomic fraction of intergenic sequence (~24%), reinsertions in these
regions are ~2-fold higher than expected if the insertion is random in the genome (Figures
3.7C and 3.8). On the contrary, insertions within gene bodies are only one fourth of that
expected based on the fraction of genes in the genome. This is likely because of the more
deleterious effect of insertions inside genes. Hence, reinsertions in genes are likely higher
than what was observed. In addition, five insertions are located in rRNAs genes, which is 68fold of the genomic fraction of rRNA genes. The overrepresentation of insertions in rRNA
genes is likely due to the functional redundancy but not the “TA” content because the average
“TA” content of rRNA genes is similar to that of the entire genome (61.56% vs. 61.85%).
Reinsertions were also detected in autonomously replicating sequences (ARS; n=2) and the
telomere (n=1). However, no insertion was found in LTR retrotransposons although they
occupy twice more genomic space than both ARS and the telomeres of yeast (Figures 3.7C
and 3.8). For those mapped reinsertion sites, the 9-bp sequences immediately flanking
Os3378NA are highly “TA”-rich, with an average “TA” content of 87%, which is much
higher than the genomic average (62%) of yeast. This target site preference is similar to what
was observed for Os3378 in rice (~86%) (Gao, 2012).

104

Figure 3.8 Fractions of genomic sequence features of the yeast (S288C).

3.4 Discussion
In this study, transposition of a rice MULE, Os3378, was recapitulated in yeast. To our
knowledge, this is the first report of MULE transposition in a heterologous species. It should
be noted that the actual excision frequency should be higher than that was shown in the
results because the data only represent yeast colonies that experienced excision and recovery
of a functional ADE2 gene through the repair system of yeast. Those with excisions but
without correct repair of the ADE2 gene would not survive on the medium lacking adenine.
3.4.1 The Low Copy Number of Os3378 in Rice and Its Relatives is Likely Due to Its
Low Transposition Activity of the Relevant Transposase
In a previous study, it was shown that Os3378 is present in most rice cultivars tested as
well as wild relatives with AA genomes (Gao, 2012). However, Os3378 remains low copy
number (less than 10) in all the species tested. The transcripts of Os3378 were readily
detectable in the reproductive tissues of Z418 (Gao, 2012). Nevertheless, additional new
105

insertions of Os3378 were never detected in Z418 populations (Gao, 2012; Ferguson and
Jiang, unpublished). The reasonable expression level and lack of amplification or new
transposition seems to be puzzling.

This study shows that the wild-type Os3378-Z

transposase is not highly competent in inducing transposition events in a heterologous system,
and such low competency cannot be significantly altered through its expression level. This
may explain why the copy number of Os3378 is uniformly low among a wide range of
species and cultivars surveyed (Gao, 2012).
Prior to this study, it was already demonstrated that several wild-type transposases were
not the forms optimal for transposition activity (Kunze et al., 1995; Zayed et al., 2004;
Pledger and Coates, 2005; Lazarow et al., 2012). For example, mutation of three different
amino acids in the transposase of Himar1 (a Mariner-like transposon) from horn fly led to a 4
to 50-fold increase in transposition activity (Lampe et al., 1999). Given those instances, it is
conceivable that high transposition activity might have been selected against because
transposon insertions are more often linked to deleterious effects than favorable effects. As a
result, low transposition activity and low copy numbers, as were demonstrated by Os3378,
might be one of the strategies for long-term success. On the other hand, the transposition
activity could be significantly enhanced by a variety of mutations, such as point mutations or
truncations. Nevertheless, the fact that Os3378 is not amplified in any cultivar or any species
tested suggested either such mutations are rare or are selected against.
3.4.2 Transposition of Os3378 in a Heterologous Organism
To date, transposition in non-host organisms other than their natural hosts has been
proved for a number of TEs (Kunze et al., 1995; Plasterk et al., 1999; Weil and Kunze, 2000;
Yang et al., 2006; Yang et al., 2007). In animals, the Tc1/mariner family is widespread and
many elements have been shown to be able to transpose in other organisms (Plasterk et al.,
106

1999). One of the most promising TEs for gene therapy is the Sleeping Beauty transposon
(SB). It was originally from fish genomes and was capable of transposition in human cells,
mouse and rat (Ivics et al., 1997; Fischer et al., 2001; Keng et al., 2005). In plants, several
TEs belonging to different families (e.g., hAT, Tc1/mariner, PIF/Harbinger) have been tested
for transposition in heterologous species. The maize Ac/Ds elements transposed in transgenic
Arabidopsis, rice, tobacco, potato, yeast, and zebrafish (Knapp et al., 1988; Grevelding et al.,
1992; Kunze et al., 1995; Enoki et al., 1999; Weil and Kunze, 2000; Emelyanov et al., 2006).
Osmar5, a rice Tc1/mariner-like element transposed in yeast (Yang et al., 2006). A
PIF/Harbinger element (mPing) transposed in both Arabidopsis (Yang et al., 2007) and yeast
(Hancock et al., 2010). The within and trans-kingdom transposition of these TEs indicated
that they do not require host-specific factors or these factors are conserved across the wide
range of species. Unlike the TEs above, some elements seem to require host factors for
transposition or optimal activity. Integration host factor (IHF) and Dam methylase affect the
transposition frequencies of IS50 and Tn5, where IHF is required for high activity in Damcells (Makris et al., 1990). It was also shown that the TIR sequence of a MULE, Mu1 in
maize contains binding sites for nuclear proteins, suggesting host factors may be involved in
its transposition process (Zhao and Sundaresan, 1991). In this study, the recapitulation of
transposition in yeast suggests that Os3378 either does not require host specific factors or
these factors are conserved between rice and yeast, despite the fact that the yeast genome
only harbors retrotransposons (Kim et al., 1998).
3.4.3 A Single Transposase of Os3378 Catalyzes Both Excision and Reinsertion Events
Among known autonomous MULE elements, Os3378 transposase is more closely related
to AtMu1, an element from Arabidopsis, than to MuDR, Jittery, and TED from maize (Zhao
and Jiang, 2014). In maize, MuDR encodes two proteins, with MURA as the transposase and
107

being sufficient to induce excision. The role of MURB remains enigmatic and it was
suggested that it may be involved in element insertions (Lisch et al., 1999; Raizada and
Walbot, 2000; Woodhouse et al., 2006). Homologous sequences of MURA have been found
in a wide range of species; however, no MURB sequences have been found in any species
other than those in the Zea genus (Lisch, 2002). In contrast, Jittery, AtMu1, TED and Os3378
all encode a single protein. Except Jittery, whose reinsertion was not observed, both AtMu1
and TED can induce excision and reinsertion even though no MURB-related sequence was
found (Singer et al., 2001; Li et al., 2013). Similarly, Os3378 is also capable of both excision
and reinsertion without a MURB-like protein. From a maximum parsimonious point of view,
it is likely that the requirement of MURB for reinsertion was derived later for the Mu system
in maize and the ancient MULE only encodes a single transposase.
3.4.4 Comparison of Target Specificity between Rice and Yeast
For the target site duplication, the average “TA” content for that of Os3378 in rice is
about 86%, which is similar to that of AtMu1 in Arabidopsis (89%, Singer et al., 2001). This
preference also retains for Os3378 in yeast, where the average “TA” content of the 9-bp
flanking sequences of reinsertion sites is 87%. Considering the genome-wide average “TA”
content (rice: ~56%; yeast: 62%), this “TA” preference becomes more evident, suggesting
that Os3378 is highly specific in targeting “TA”-rich sequences.
It is not surprising that the majority (~62%) of the recovered reinsertions occurred in
intergenic regions since those insertions usually do not cause complete loss of function of the
genes in their vicinity. About 13% of the reinsertions are in rRNA genes (genomic fraction of
0.19%), likely because these rRNAs have multiple copies in tandem so there is significant
functional redundancy. In addition, less reinsertion occurred in repetitive regions, including
telomere, LTR retrotransposons, which is in agreement with the target specificity of MULEs
108

in other studies (Raizada et al., 2001; Liu et al., 2009). Previous studies showed that MULEs
prefer to insert into the 5′ region of genes with decreasing frequencies towards the 3′ region
(Dietrich et al., 2002; Liu et al., 2009; Jiang et al., 2011). Among the four copies of Os3378
in Nipponbare, only one of them is located in proximity to a gene and it is located at the 5′
region (Gao, 2012), which is insufficient to determine whether it has the same preference as
other MULEs. In this study, equal number of Os3378NA insertions was found at the 5′ and 3′
regions of genes. As a result, it is unclear whether Os3378 has a preference for 5′ region of
genes or whether such preference is not recapitulated in yeast.
3.4.5 A Critical Region for Modification of Transposition Activity through Deletion and
Substitutions
Previous studies have shown that deletion of selected regions of transposases can
enhance their transposition activity. For example, deletion of the first 102 amino acids of the
maize Ac transposase (a total of 807 aa) led to an increase of excision activity, while further
deletion (up to 188 aa) aborted the transposase activity (Kunze et al., 1993). This is because
Ac transposase has a basic DNA binding domain around 200 aa, and deletion of the first 188
aa lead to the loss of DNA binding activity (Feldmar and Kunze, 1991). In addition, a 10-fold
“PQ” (Pro-Gln or Pro-Glu) repeat is present in 109-128 aa, which is essential for transposase
activity (Kunze et al., 1993). In addition, deletion of C-terminal sequences (53 and 98 aa) of
the Ac transposase abrogated excision activity, suggesting the C-terminus is essential for
transposition. Beside Ac transposase, deletion of the first 77 aa of the MuA (transposase of
phage Mu) also resulted enhanced transposition activity (MuA, 663 aa in length) (Kim and
Morrison, 2009). However, unlike the Ac transposase, deletion of part of the C-terminal
sequence of MuA also led to the enhancement of transposition activity, albeit to a less degree
compared to that derived from N-terminal deletion. The MuA transposase with deletion of
109

both termini, on the other hand, is only associated with a minor improvement of transposition
activity which is inferior to that from deletion of either end.
Since N-terminal deletion led to higher transposition activity for both Ac and phage Mu
transposases, a similar strategy was employed to enhance the transposition activity of wildtype transposase of Os3378-Z. The consequence of deletion resembles that for Ac transposase,
i.e., the effective region for deletion is located in 105-130 aa. No significant alteration on
transposition frequency was observed if the deletion is too short (79 aa or 104 aa) or too long
(160 aa). As a result, it is likely that a short deletion does not significantly change the
property of the transposase while a long deletion may lead to the loss of essential components
for the transposition machinery.
Since the deletion of first 129 aa does not abort the transcription activity, it is intriguing
what role of this portion of transposase plays. Obviously, this portion is not essential for
transposition. Within this region, a 25 aa peptide (105-129 aa) seems to be critical for both
transposition activity and the cellular localization of the transposase. With this peptide, the
transposase is located in the nucleus (EYFPOs3378-Z, EYFPOs3378-Z-105, EYFPOs3378Z-105Ala), whereas the transposase is located in both nucleus and cytoplasm when this
peptide was removed (EYFPOs3378-Z-130). Since this peptide alone fails to direct the EYFP
protein to nucleus, it is clear that this peptide does not serve as a nuclear localization signal
itself (Figure 3.5C). In this case, the likelihood is that the absence of this peptide influences
the conformation of the remainder of the transposase so that the nuclear export signal (NES)
is exposed. Alternatively, the change in conformation buried the NLSs so they are less
effective in the transport process.

110

In addition to the impact on cellular localization, the conformation change due to the
deletion or replacement of the short peptide may lead to the structural change in the DNA
binding domain or catalytic domain of transposase so that the transposase is more efficient.
This is consistent with the fact that replacement of the amino acids in 105-129 aa with
different physical properties significantly altered the excision activity. The original 105-129
aa peptide contains 36% acidic aa, 56% neutral aa, and 8% basic aa, which results in an
overall acidic and hydrophilic status. During protein folding, hydrophobic peptides tend to
form internal regions while hydrophilic region are often at the surface of the protein (Kyte
and Doolittle, 1982). This implies that, at physiological conditions, this peptide is negatively
charged and likely located in external regions of the protein molecule. As a result, either the
negative charges carried by the peptide interfere with the function (for example, the
interaction between transposase and transposon ends) or the presence of this peptide at the
surface of the protein prevents the exposure of the reaction center. Substitution of some
(Os3378-Z-105Ala) or all (Os3378-Z-105Neutral) of the acidic residues with neutral ones
resulted in enhanced excision frequency whereas substitution of acidic residues to basic
residues did not bring any benefit. This suggests the presence of any significant net charge in
this region might be detrimental to transposition activity. Meanwhile, barely any excision
event was observed for Os3378-Z-105Hydrophobic, which has similar amount of neutral
residues in this peptide as that of Os3378-Z-105Ala, but very high level of hydrophobicity. It
is possible that the introduction of high level of hydrophobicity led to gross structural
alteration which abolishes the function of the transposase. Overall, neutrality and low
hydropathy of this peptide seem to be critical for the transposition activity, although the
underlying mechanism is not well understood (also see below).

111

3.4.6 Protein Levels and Transposition Activity of Various Forms of Os3378-Z
Transposase
Apparently, different forms of Os3378-Z transposase are associated with different levels
of proteins at 2% galactose concentration (Figure 3.6B). This suggests that the N-terminal
sequence is likely to play a role in the expression or stability of the transposase, in addition to
its role in transposition. Specifically, deletion of N-terminal sequence resulted in reduced
level of protein, so the presence of the N-terminal sequence either promotes expression
(transcription and/or translation) or enhances the stability of the transcripts or proteins.
Nevertheless, it is clear that the enhancement of transposition activity through deletion and
mutation is unlikely due to the change in protein level since both Os3378-Z-105CFH and
Os3378-Z-130CFH are associated with low (and comparable) levels of proteins but with
Os3378-Z-130CFH induced significantly more excisions than Os3378-Z-105CFH at 1% and
2% galactose concentrations (Figure 3.6). Instead, the protein property or structure may play
a major role. On the other hand, the protein level of Os3378-Z-105AlaCFH (with high
activity) was much higher than that of Os3378-Z-105CFH, again suggesting the amino acid
composition at the N-terminus affects expression efficiency or transcript/protein stability.
However, it is unclear whether the enhanced activity of Os3378-Z-105AlaCFH is due to
protein level or structural/chemical properties. In other words, the high excision activity
achieved by different forms of transposases in this study could be due to distinct mechanisms.

112

3.4.7 The Effect of EYFP Fusion on Transposition Activity as well as Cellular
Localization
Fluorescent proteins, including EYFP have been widely used to characterize protein
trafficking, lipid metabolism, protein-protein interaction, and so forth. Adverse effects of the
fluorescent protein on target proteins were reported, such as change of cellular localization
and formation of dysfunctional protein. This study demonstrated that fusion of a protein
(EYFP) to the transposase may significantly improve or inhibit the transposition activity. As
was observed with deletions of Os3378-Z, the effect of the fusion depends on the location of
the fusion because fusion to the wild-type transposase resulted in little difference. This might
be because the fusion location is too distant to the functional domains (such as DNA binding
domain or catalytic domain). Again the region around 105-129 aa is very critical in terms of
alteration of transposase activity through fusion of an additional protein. Fusion of EYFP to
the N terminus of Os3378-Z-130 largely offset the positive effect on transposition activity
through deletion. As discussed above, significant net charge around 105-129 aa seems to be
detrimental to transposition activity. When EYFP is fused to Os3378-Z-105, the introduction
of 4 additional basic amino acids, together with 2 basic amino acids originally present in 105129 aa may render this region a neutral state at physiological pH which may be the cause for
the enhanced transposition activity. In contrast, when EYFP is fused to Os3378-Z-130, it
introduces net charge to this region through the basic amino acids, which may inhibit the
transposition activity. As a result, it is possible that the fusion of EYFP accidentally changes
electronic dynamics in this region thereby altered the transposition activity of the resulting
fusion protein.
Unlike N-terminal EYFP-tagged transposases, fusion of EYFP to the C-termini of all
forms (wild-type, N-terminal deleted, and those with amino acid substitutions) of
113

transposases resulted in reduced excision frequency, which is likely due to aggregation of the
fusion proteins in the cytoplasm. EYFP protein alone did not form aggregates as indicated by
the even distribution of EYFP in the entire yeast cells (Figure 3.5A), so it is likely the fusion
at C-termini causes structural changes of the proteins which triggers aggregation. It was
reported that a conserved domain at the C-terminus of the maize Ac transposase may be
involved in dimerization of transposases during transposition (Essers et al., 2000). Meanwhile,
when overexpressed, this domain was also involved in the formation of aggregates, resulting
in inactive transposase. However, mutations in the most conserved amino acids did not
abolish the dimerization property but those less conserved residues did. Comparison of the Cterminal sequences of Os3378-Z and Ac transposases did not reveal any common features.
Nevertheless, it cannot be ruled out the conservation is at structural level not sequence level.
Further investigation is needed in order to elucidate the mechanism underlying the
aggregation of C-terminal tagged Os3378-Z transposases.
As shown in Figure 3.5A, the majority of C-terminal EYFP-tagged transposases was
located in the cytoplasm. Since Os3378-Z-130 is still associated with a considerable level of
excision activity when the C-terminus is tagged, it is obvious that the fusion did not fully
abolish the function of NLS (Figure 3.5A, B). Given this fact, the location of the C-terminal
EYFP-tagged proteins is more likely due to the aggregation, which prevents the
transportation into nucleus, or the aggregation blocks the exposure of NLS or promotes the
exposure of NES. Although the underlying mechanism remains unclear, this and other studies
suggest there are multiple ways to induce aggregation of transposases that could readily
trigger the suppression of their activity (Heinlein et al., 1994; Essers et al., 2000). This may
be attributed to post-translational control of transposon activity.

114

3.4.8 Retention of Single TIR after Excision Suggests a Potential Mechanism for
Formation of Pack-MULEs
The mechanism underlying sequence acquisition by Pack-MULEs or other DNA TEs
remains an enigma. Talbert and Chandler (1988) proposed that Mu termini may function
independently of their internal sequences. Specifically, a single Mu terminus may transpose
alone and two separate but similar Mu termini may fortuitously insert into adjacent genic
regions. If the two termini are close enough and in the right orientation, the entire sequence
(two termini and the genes inside) could be moved together thus a Pack-MULE is formed. If
this is the case, no direct repeats (TSD) would be generated in the flanking sequence of the
initial Pack-MULE element (Figure 3.9). In this study, no mobility was observed for the
single terminus of Os3378. However, analysis of the sequences at the donor site of
Os3378NA revealed that retention of a single terminus after excisions is not rare for Os3378
in yeast. A similar phenomenon has been observed in maize (Raizada et al., 2001). Seven out
of 45 donor sites following excision of RescueMu, a modified Mu1 element, contained
terminal sequences with various lengths (41 to 211 bp out of 215 bp TIR), which was
proposed to result from interrupted homology-dependent gap repair. Hence, retention of
single terminal sequence following excisions is not restricted to yeast, and it is more likely a
common phenomenon. The reason that no single terminus of Os3378 was detected in rice is
possibly due to its low activity, where barely any double-stranded breaks are available for
this to happen. This prompted us to propose a “retention of single terminus mechanism” for
Pack-MULE formation, which starts with the excision of a MULE element followed by
formation of a single terminus at the donor site and in the meantime the same phenomenon
happens to another MULE which shares similar terminal sequence. If the two elements are
close to each other with single terminus in the appropriate orientation, and there is a gene
between them, then a new Pack-MULE can be formed (Figure 3.9). The difference between
115

the “single terminus movement mechanism” and the “retention of single terminus mechanism”
is that movement of single terminus is a requisite for new element formation for the former,
which seems unlikely as evidenced from no excision of single terminus of Os3378. On the
other hand, interrupted gap repair following excision of TEs seems relatively common, which
renders the formation of single terminus with high possibility (Raizada et al., 2001). However,
more analyses are needed to evaluate this mechanism.

Figure 3.9 Schematic representation of a potential mechanism of Pack-MULE
formation.
116

3.5 Materials and Methods
3.5.1 Cloning of the Coding Sequence of Os3378 Transposase
Expression of Os3378 was detected in a rice somaclonal mutant, Z418 (Gao, 2012).
These rice plants were grown in growth chamber with temperature set at 28 °C/24 °C
(day/night) and a photoperiod of 14 h/10 h (light/dark). Two pairs of primers (Appendix
Table 3.2) were used to amplify the coding sequence of Os3378. Total RNA was extracted
from Z418 young panicles using TRIzol reagent (Invitrogen, Grand Island, NY, USA)
followed by DNase treatment (RNase-free DNase set, Qiagen, Hilden, Germany) and purified
using the RNeasy Mini Kit (Qiagen). RNA (4 µg) was reverse transcribed into cDNA using
the GoScript Reverse Transcription system (Progema, Madison, WI, USA). The cDNA was
used as template for amplification of the Os3378 transcripts using the Platinum Taq DNA
Polymerase High Fidelity kit (Invitrogen, Grand Island, NY, USA). PCR was performed with
an initial denature step at 95 °C for 2 min, followed by 30 cycles of 94 °C 30 s, 58 °C 30 s,
and 68 °C 1 min, and a final elongation step at 68 °C for 5 min. The resulting amplicons were
sequenced at the Research Technology Support Facility (RTSF) of Michigan State University.
The sequences of the two PCR products were concatenated to obtain the entire coding
sequence of Os3378, which was referred to as Os3378-Z.
3.5.2 Computational Characterization of Functional Domains of the Os3378-Z
Transposase
The coding-sequence of Os3378-Z transposase was translated into protein sequence
using the ExPASy translation tool (http://web.expasy.org/translate/). Nuclear localization
signal

(NLS)

was

predicted

using

the

PSORT

II

Prediction

program

(http://psort.hgc.jp/form2.html), which gave 4-residue and 7-residue NLS and the latter was
presented in Figure 3.1B. DNA binding domain was defined through a combination of
117

secondary structure analysis (Jpred3, http://www.compbio.dundee.ac.uk/www-jpred/) and
software prediction for helix-turn-helix DNA-binding motif (http://npsa-pbil.ibcp.fr/cgibin/npsa_automat.pl?page=/NPSA/npsa_hth.html). To locate the catalytic domain, multiple
sequence alignment was performed on MURA-related transposases (i.e., MURA, JITA,
Os3378-Z) and the conserved triad amino acids was obtained through comparison to the
defined “DDE” in the known proteins. Nuclear export signal (NES) was identified by
manually checking Os3378-Z transposase for the conserved pattern of sequence (L–x(2,3)–
[LIVFM]–x(2,3)–L–x–[LI]) (Bogerd et al., 1996).

Figure 3.10 Os3378-Z transposase.
(A) The size (bps) of exons and introns of Os3378-Z and its most similar annotated locus in
rice (Nipponbare).
(B) Schematic representation of full-length and N-terminal deleted Os3378-Z transposases
with either N- or C-terminal EYFP tag.
(C) Schematic representation of restriction sites used in this study. XmaI is 5-bp upstream of
the translation start site (TSS) of EYFP; SacII is 14-bp upstream of the TSS of Os3378-Z
transposase; SphI is at 504-509 bp within Os3378-Z transposase; EcoRV is at 2469-2474 bp
within Os3378-Z transposase; AscI is 7-bp downstream of the translation termination site of
Os3378-Z transposase.

118

3.5.3 Construction of Reporter and Expression Constructs
All the restriction sites used in this study were shown in Figure 3.10C. Sequences of all
the constructs were verified by sequencing at the RTSF of Michigan State University.
3.5.3.1 Reporter Constructs
The reporter vector, pWL89a, was kindly provided by Nathan Hancock (University of
Georgia). The non-autonomous Os3378 (Os3378NA) was obtained by ligating two PCR
fragments of the 5′ (213 bp) and 3′ (236 bp) TIR and sub-terminal sequences of the Os3378
copy on chromosome 5 in Nipponbare (Gao, 2012) using Z418 genomic DNA as template.
Two forms of reporter constructs were built, which differed in the insertion sites of
Os3378NA. For one form, the Os3378NA was integrated into the promoter region of ADE2
through an XhoI restriction site, resulting in pWL89aOs3378NAXhoI. For the other form, the
Os3378NA was integrated into the coding region of ADE2 through an HpaI restriction site,
resulting in pWL89aOs3378NAHpaI. To construct the reporter vector with a single terminus
of Os3378, the 5′ terminal sequence was amplified with a pair of primers with HpaI
restriction sites in them. The resulting amplicons and pWL89a were digested with HpaI and
ligated together to form pWL89aOs3378singleTIRHpaI.
3.5.3.2 Expression Constructs of the Os3378-Z Transposase with N-terminal EYFP Tag
Gateway vector, pAG423GAL-EYFP-ccdB (Addgene plasmid 14341, EYFP: enhanced
yellow fluorescent protein), was used to build the expression constructs. The coding sequence
of the transposase obtained above was synthesized by Genscript (Piscataway, NJ, USA) and
transferred to an entry vector (pENTR-D-TOPO, Invitrogen, Grand Island, NY, USA)
through BR recombination reaction using the Gateway® BP Clonase™ Enzyme Mixes
(Invitrogen, Grand Island, NY, USA). The final transfer of the transposase from the entry
119

vector to the expression vector was accomplished through LR recombination reaction using
the Gateway® LR Clonase™ Enzyme Mixes (Invitrogen, Grand Island, NY, USA). The
resulting construct was referred to as pAG423EYFPOs3378-Z. In this construct, the EYFP
and Os3378-Z formed a fusion protein, whereby its transcription was controlled by the GAL1
promoter.
The constructs with N-terminal deleted Os3378-Z transposase were obtained by
modifying pAG423EYFPOs3378-Z. The construct was digested using SacII and SphI, where
SacII recognizes a site between the EYFP and the transposase, and SphI makes a single cut at
508 bp (170 aa) within the transposase (Figure 3.10C). The larger fragment consisting of the
vector backbone and the partial transposase sequence (~170-886 residues) was purified.
Primers containing SacII and SphI restriction sites and “ATG” start codon were designed to
amplify 80-170 amino acids (aa) for Os3378-Z-80, 105 to 170 aa for Os3378-Z-105, 130-170
aa for Os3378-Z-130, and 161-170 aa for Os3378-Z-161 (Appendix Table 3.2). The
amplicons were digested with SacII and SphI before ligating to the purified expression vector
pre-digested by SacII and SphI. The resulting constructs, pAG423EYFPOs3378-Z-80,
pAG423EYFPOs3378-Z-105, pAG423EYFPOs3378-Z-130, and pAG423EYFPOs3378-Z161, lack the N-terminal 79, 104, 129, and 160 residues, respectively.
To prepare a construct containing EYFP with Os3378-Z-105-130 peptide (25 aa),
pAG423EYFPOs3378-Z was digested with SacII (between EYFP and Os3378-Z) and AscI
(7-bp downstream of the Os3378-Z stop codon) restriction enzymes to remove Os3378-Z
transposase. The vector backbone was purified. Primers containing restriction sites (SacII in
forward primer and AscI in reverse primer) were used to amplify the Os3378-Z 105-130
peptide and amplicons was digested with SacII and AscI followed by ligating to the purified
vector fragment.
120

3.5.3.3 Expression Constructs of the Os3378-Z Transposase without EYFP Tag
Expression constructs without the EYFP-tag was obtained by removing the EYFP tag in
the constructs prepared above. First, the constructs were digested with XmaI (5-bp upstream
of the transcription start codon of EYFP) and SacII (between EYFP and Os3378-Z) to release
the EYFP tag (Figure 3.10C). Second, the sticky ends of the vectors were repaired using the
Quick Blunting Kit (New England Biolabs, Ipswich, MA, USA) and a self-ligation reaction
was incubated at 4 °C overnight. Standard bacteria (DH5α) transformation was conducted
and positive clones were identified through restriction enzyme digestion. The resulting
constructs were referred to as pAG423Os3378-Z, pAG423Os3378-Z-80, pAG423Os3378-Z105, pAG423Os3378-Z-130, and pAG423Os3378-Z-161.
3.5.3.4 Expression Constructs of the Os3378-Z Transposase with C-terminal EYFP Tag
Os3378-Z transposase with C-terminal EYFP tag was obtained by transferring the EYFP
sequence from the N-terminus to the C-terminus of the transposase in each construct. The
construction of pAG423Os3378-ZEYFP (wild-type transposase with C-terminal EYFP) was
used as an example to explain the detailed procedures. To initialize the construction,
pAG423EYFPOs3378-Z was digested using XmaI and SacII to separate the EYFP sequence
and the rest of the construct. A filler DNA was used to seal the staggered ends of the
construct and prevent the recovery of the XmaI site (Appendix Table 3.2). The vector DNA
was self-ligated which resulted in pAG423Os3378NoXmaI. The original stop codon at the
end of transposase was removed and new XmaI and SacII sites were created downstream of
the transposase by amplifying a segment of the transposase (2471-2658 bp) using a forward
primer specific to 2471-2505 bp with an EcoRV site and a reverse primer complementary to
the last 27 bp of the transposase (no stop codon, with an additional linker containing XmaI,
SacII, and AscI sites). The resulting PCR product and pAG423Os3378NoXmaI were digested
121

using EcoRV and AscI followed by ligating them together. The resulting sequence was then
digested by XmaI and SacII followed by ligating the EYFP sequence into it (pAG423Os3378ZEYFP).

Other

C-terminal

EYFP

constructs

(e.g.,

pAG423Os3378-Z-105EYFP,

pAG423Os3378-Z-130EYFP), were prepared in the same way.
3.5.3.5 Expression Constructs Containing Amino Acid Substitutions in Os3378-Z 105129
Amino acid substitutions in the 105-129 peptide were made so that the peptide, as a
whole piece, had different chemical and physiological properties (Figure 3.4A). These are
Os3378-Z-105Ala with five acidic and two hydrophobic residues mutated to alanine,
Os3378-Z-105Neutral with nine acidic residues changed to neutral aa, Os3378-Z-105Basic
with nine acidic residues changed to basic aa, and Os3378-Z-105Hydrophobic with certain
hydrophilic residues changed to hydrophobic (Figure 3.4A). Codons for these amino acids
were chosen according to their corresponding usage frequency in the wild type Os3378-Z
transposase. For each construct, a pair of primers was used to amplify 105-170 amino acid
segment. The forward primer (~110 nt) contained a start codon (“ATG”), an alanine residue,
mutated amino acids, and a SacII restriction site while the reverse primer contains a SphI
restriction site (Appendix Table 3.2). pAG423Os3378-Z was used as the template for PCR
amplification and amplicons were digested with SacII and SphI. Meanwhile, the expression
constructs without EYFP tag were digested using the same restriction enzymes. The digested
expression constructs and the amplicons were ligated, which resulted in four constructs,
pAG423Os3378-Z-105Ala, pAG423Os3378-Z-105Neutral, pAG423Os3378-Z-105Basic, and
pAG423Os3378-Z-105Hydrophobic.

122

3.5.3.6 Expression Constructs with C-terminal FLAG-His6 Dual Tag
Expression constructs (without tag) generated above were digested using EcoRV and
AscI (Figure 3.10C), which cut off part of the C-terminal sequence of the transposases. This
sequence was amplified using a pair of primers (Zanetti et al., 2005), where the forward
primer contained an EcoRV restriction site and the reverse primer contains the FLAG-His6
sequence and an AscI site (Appendix Table 3.2). The resulting amplicons were digested with
EcoRV and AscI to generate corresponding ends, which was ligated to the pre-digested (with
EcoRV and AscI) expression constructs.
3.5.4 Transformation of Reporter and Expression Constructs into Yeast and Selection
for ADE2 Revertants
The reporter construct was first transformed into the yeast haploid strain, DG2523
(MATalpha ura3-167 trp 1-hisG leu2-hisG his3-del200 ade2-hisG) (provided by Nathan
Hancock and Sue Wessler). Yeast colonies growing on synthetic defined medium without
uracil (SD/-Ura) were verified for the presence of the reporter vector by PCR. Competent
cells of the confirmed yeast transformants were prepared using the Frozen-EZ Yeast
Transformation II kit (Zymo Research Corporation, Irvine, CA) followed by transforming the
expression constructs. As a control, the empty expression vector was also transformed into
the yeast cells at the same time.
Transformed yeast cells were grown on SD plates lack uracil and histidine with 3%
raffinose as the carbon source. After recovery for 6 to 7 days, colonies were plated on SD
medium without uracil, histidine and adenine (SD/-Ura-His-Ade), and supplied with 3%
raffinose and various amount of galactose (0.05%, 0.1%, 0.5%, 1%, 2%) to induce expression
of the transposase. To measure the excision frequency, yeast colonies were suspended in 50
123

µL sterile dH2O, where 49 µL was plated on SD/-Ura-His-Ade medium and 1 µL was diluted
to 106-fold and 49 µL was plated on YPD plates to obtain the total number of viable cells in
each colony. Excision of Os3378NA and restoration of a functional ADE2 gene allowed the
growth of yeast cells on the SD/-Ura-His-Ade medium; the surviving colonies were called
ADE2 revertants.
3.5.5 Determination of the Sequences of the Donor Site Following Excisions
PCR primers flanking the insertion sites of Os3378NA in ADE2 were used to amplify the
sequences of the donor site following excisions. All PCR products were cloned into the
pCR2.1-TOPO vector (Invitrogen, Grand Island, NY, USA) and sequenced.
3.5.6 Extraction of Yeast Total Protein and Determination of Protein Levels of
Transposases
Yeast colonies containing both expression (those with FLAG-His6 tag) and reporter
constructs were streaked on SD/-Ura-His plates supplied with various galactose
concentrations. After growing for 5 days, the cells were collected and lysed using extraction
buffer (200 mM Tris pH8.0, 150 mM ammonium sulfate, 10% glyceol, 1 mM EDTA, 0.2
mM dithiothreitol, 10 mM phenylmethanesulfonyl fluoride, and 1X Yeast/Fungal Protease
Arrest, BD Biosciences, San Jose, CA, USA). Glass beads were added into the mixture
followed by vigorous vortexing to break the cells. Centrifugation was used precipitate cell
debris and the supernatant contained the total crude proteins. For transposases whose
transcription was induced by various galactose concentrations, 2.5 μg total protein extract for
Os3378-Z and 5 μg for Os3378-Z-130 was used. For all forms of transposes under 2%
galactose level, 2.5 ug crude protein extract were used. To ensure the usage of similar amount
of total protein, these protein extracts were separated on a 4-10% SDS-PAGE gel (Invitrogen,
124

Grand Island, NY, USA) and developed using the Pierce Silver Stain Kit (Thermo Scientific,
Waltham, MA, USA). For Western blot analysis, these protein extracts were separated on 410% SDS-PAGE gel followed by protein transfer to PVDF transfer membrane (Millipore,
Billerica, MA, USA). The membrane was first probed using the first antibody, THE His tag
antibody (Mouse) (Genscript, Piscataway, NJ, USA) and then second antibody, anti-mouse
IgG, horseradish peroxidase-conjugated (Cell Signaling Technology, Danvers, MA). Signal
detection was performed using the SuperSignal West Pico Chemiluminesent Substrate
(Thermo Scientific, Waltham, MA, USA) and exposed to a film. Relative protein levels
(relative density) of various forms of transposases were quantified using the ImageJ software
(http://imagej.nih.gov/ij/).
3.5.7 Determination of the Cellular Localization of Os3378-Z Transposases

The cellular localization of the transposases was determined using confocal microscopy
in the Centre for Advanced Microscopy at Michigan State University. Yeast cells containing
both expression (those with EYFP tag) and reporter constructs were cultured in SD/-Ura-His
medium containing 1% galactose at 30 °C and 250 rpm shaking overnight. The culture was
diluted to ~0.4 OD600 units and incubated at 30 °C at 250 rpm for 3 h before collecting the
cells by centrifugation (3000 rpm). Cells were washed using 1X PBS buffer (137 mM NaCl,
2.7 mM KCl, 10 mM Na2HPO4, 2 mM KH2PO4) and pelleted before treating cells with 1X
PBS containing 1 µg/mL-1 DAPI (4',6-Diamidino-2-Phenylindole, Dihydrochloride), a
fluorescent stain for the nucleus. Confocal images were acquired using an Olympus
FluoView FV1000 Laser Scanning Confocal Microscope (Center Valley, PA) configured on
an automated IX81 inverted microscope with a 100X UPLSAPO (NA 1.4) oil
objective. EYFP fluorescence was excited with the 515nm Argon laser line, while emission
was collected with a 535-565 nm band pass filter. Nuclei were counterstained blue with
125

DAPI excited with a 405nm diode laser while emission was collected with a 430-470 nm
band pass filter.
3.5.8 Analysis of Reinsertions of Os3378NA Following Excisions
DNA blot assay was conducted to determine reinsertions of Os3378NA after excisions.
For EYFPOs3378-Z-105 and EYFPOs3378-Z-130, nineteen yeast colonies for each galactose
concentration were tested except 0.05% at which few excision events occurred. Genomic
DNA of ADE2 revertant yeast colonies were extracted using Zymolase digestion of yeast cell
wall, PCIAA (phenol: chloroform: isoamyl alcohol) and isopropanol precipitation method.
Genomic DNA (200 ng) was digested with BamHI and XhoI, where the latter recognizes a
sequence within Os3378NA. The digested DNA was resolved on 1% agarose gel for 3 h,
followed by transfer of DNA from the gel to positively charged nylon membrane (GE
Healthcare, Pittsburgh, PA, USA) using capillary flow overnight. The digoxigenin-labeled
probe specific to the 5′ TIR of Os3378 was used to bind to the fragments of Os3378NA,
which was detected by anti-Digoxigenin-AP, Fab fragments (Roche Applied Science,
Indianapolis, IN, USA).
To determine the reinsertion locations, transposon display (a modified AFLP method)
was conducted. Specifically, genomic DNA of ADE2 revertant yeast colonies were digested
using HinP1I restriction enzyme and adapters were ligated to these genomic fragments.
Nested PCRs were conducted using one primer specific to the TIR sequence of Os3378 and
another to the adapter sequence, which resulted in amplicons consisting of part of the TIR
and flanking sequences of the reinsertion sites. The resulting products were resolved on a
polyacrylamide gel and polymorphic fragments were recovered by PCR and sequenced. The
flanking sequences were mapped to the yeast genome (S288C, release R64-1-1,
http://yeastgenome.org/) and the reinsertion locations were determined with regard to the
126

closest genomic features (such as genes, rRNAs based on the file containing genomic
sequence features, coordinates and annotations, which was downloaded in February, 2011
from http://yeastgenome.org/). Insertions that are within 1 kb from genes were considered to
be in flanking regions. If the insertion are between two genes which were in the opposite
transcription orientations (“head-to-head” or “tail-to-tail”), the insertions were considered to
be in either the 5′ or 3′ regions. Otherwise, they were assigned to the group of “5′ and 3′
regions” (“head-to-tail” or “tail-to-head”).

127

APPENDIX

128

APPENDIX

Table 3.1 Reinsertion sites.
Coordinate of insert site

Coordinates of adjacent
genomic feature (A)

chrXII_NC_001144: 502262
chrXIII_NC_001145: 56408
chrXVI_NC_001148: 539082
chrVII_NC_001139: 433848
chrXIII_NC_001145: 307476
chrXV_NC_001147: 710335
chrI_NC_001133: 71592
chrII_NC_001134: 414051
chrIII_NC_001135: 130688
chrV_NC_001137: 295069
chrV_NC_001137: 339527
chrV_NC_001137: 79571
chrXIV_NC_001146: 352777
chrIII_NC_001135: 125623
chrIII_NC_001135: 172874
chrXII_NC_001144: 143042
chrXIII_NC_001145: 819953
chrXIV_NC_001146: 37497
chrXIV_NC_001146: 731134
chrVII_NC_001139: 982227
chrXI_NC_001143: 557534
chrIV_NC_001136: 1422659
chrIV_NC_001136: 431604
chrV_NC_001137: 347619
chrVII_NC_001139: 203990
chrXI_NC_001143: 196257
chrI_NC_001133: 149952
chrV_NC_001137: 246198
chrVI_NC_001138: 135910
chrVIII_NC_001140: 349931
chrX_NC_001142: 566066
chrXV_NC_001147: 297465
chrIV_NC_001136: 216460
chrXII_NC_001144: 456483
chrXII_NC_001144: 457514
chrXII_NC_001144: 457574
chrXII_NC_001144: 458146
chrXII_NC_001144: 458212
chrXII_NC_001144: 288

chrXII_501260_502162
chrXIII_55265_56269
chrXVI_535820_538936
chrVII_433214_433579
chrXIII_307489_308682
chrXV_710446_711576
chrI_71786_73288
chrII_411054_413981
chrIII_130745_131542
chrV_295301_295732
chrV_337949_339472
chrV_79636_79977
chrXIV_352820_355042
chrIII_126011_126730
chrIII_172950_173440
chrXII_141073_142923
chrXIII_818827_819948
chrXIV_34696_37422
chrXIV_731618_733303
chrVII_979765_982068
chrXI_557677_558954
chrIV_1422763_1424688
chrIV_431108_431517
chrV_343320_347612
chrVII_203914_204155
chrXI_196042_196287
chrI_147594_151166
chrV_243810_246503
chrVI_134521_137157
chrVIII_349574_352453
chrX_559416_566828
chrXV_297078_298838
chrIV_216158_216489
chrXII_455933_457732
chrXII_455933_457732
chrXII_455933_457732
chrXII_457733_458432
chrXII_457733_458432
chrXII_76_5661

Insert
position
(A)
5′ region
5′ region
5′ region
5′ region
5′ region
5′ region
5′ region
3′ region
3′ region
3′ region
3′ region
3′ region
3′ region
3′ region
3′ region
3′ region
3′ region
3′ region
3′ region
5′ region
5′ region
5′ region
5′ region
5′ region
ARS
ARS
gene
gene
gene
gene
gene
gene
gene
rRNA
rRNA
rRNA
rRNA
rRNA
telomere

129

Coordinates of adjacent
genomic feature (B)
chrXII_502421_504247
chrXIII_56773_57453
chrXVI_539385_541970
chrVII_435625_436351
chrXIII_303236_305593
chrXV_710201_710272
chrI_70257_70489
chrII_414186_415261
chrIII_128470_130281
chrV_293050_294813
chrV_339864_342167
chrV_78053_79456
chrXIV_352414_352530
chrIII_124134_124465
chrIII_170886_172424
chrXII_143201_146041
chrXIII_820256_822454
chrXIV_37700_38554
chrXIV_728426_730186
chrVII_982482_984272
chrXI_556518_557342
chrIV_1421157_1422485
chrIV_432308_432631
chrV_347912_348400
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA

Insert
position
(B)
5′ region
5′ region
5′ region
5′ region
5′ region
3′ region
NA
3′ region
3′ region
3′ region
3′ region
3′ region
3′ region
NA
5′ region
5′ region
5′ region
5′ region
5′ region
3′ region
3′ region
3′ region
3′ region
3′ region
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA
NA

Table 3.2 Primers used in this study.
Primers for amplifying Os3378-Z coding sequence (5’-3’)
Os3378ORF-F
CACCATGGATAATTTGGATGTACTTTG
Os3378Exon1R
GAGGATCAATATTCAGATCTTTTTGAAG
Os3378Exon2-4F
TGAATATTGATCCTCATGGAGCTG
Os3378ORF-R
TCACTTCTTTGTTGTGTTTGTTCTTG
Primers for cloning the artificial non-autonomous Os3378 (Os3378NA) (5’-3’)
Os3378AHpaIF
CAGTTAACTTAATTTAAGGAAAAAGTCAGTTTTACTCC
Os3378AR
AATCTCCCAGGTTCTCTTTCTCCACG
Os3378BF
CCTCATCACCTGGCAAGTAAAACCTG
Os3378BHpaIR
GTGTTAACTTAAATTAAGGAAAAAGTCCGTTTTACTCC
Os3378AXhoIF
GTTAACGGAAAAAGTCAGTTTTACTCCCCTCAAGTATG
Os3378BXhoIR
GTTAACGGAAAAAGTCAGTTTTACTCCCCTCAAGTATG
Primers for amplifying the donor site following excision of Os3378NA (sequences were obtained from Yang
et al., 2006) (5’-3’)
ADE2XhoI-F
CTGACAAATGACTCTTGTTGCAGGGCTACGAAC
ADE2XhoI-R
TGGAAAAGGAGCCATTAACGTGGTCATTGGAG
ADE2HpaI-F
CTTTGTACGCCGAAAAATGG
ADE2HpaI-R
CGCATAACATAAGTCACAAAT
Primers for cloning partial N-terminal sequence of the Os3378-Z transposase (5’-3’)
Os3378A80F
ATAATACCCGGGATGCTATCAGATGATAAGGAATGC
Os3378A105F
TCGTCACCGCGGCAATGGCTATACTCAAGCACAACGAAG
Os3378A130F
TCGTCACCGCGGCAATGGCTATTGAGGAAGAATATGAC
Os3378AANterR
CTTGTTGGCATGCTCTCTATTTTCTTGTGCTTCCTC
Os3378A168linkerF
GGCCGCCCCCTTCACCATGGAGCATG
Os3378A168linkerR
CTCCATGGTGAAGGGGGCGGCCGC
Primers for mutating some amino acids between Os3378-Z 105-130 region(5’-3’)
ATAATACCCGGGATGGCTATAGCCAAGCACAACGAAGCCGCCAATGTTGCACTTAGCA
A105-130AlaF
ATGGAGTCAGTGATGCAAGTGATGTTGCCGCCGACATTGAGGAAGAATATGAC
ATAATACCCGGGATGATACTCAAGCACAACCAAAATAACAATGTTGTGCTTAGCAATG
A105-130NeutralF
GAGTCAGTAATAACAGTAATGTTCAAAACAATATTGAGGAAGAATATGACAGTC
ATAATACCCGGGATGATACTCAAGCACAACCGCAAGAAAAATGTTGTGCTTAGCAATG
A105-130BasicF
GAGTCAGTAAGAAAAGTAAGGTTCGCAAGAAAATTGAGGAAGAATATGACAGTC
ATAATACCCGGGATGATACTCATCTTCCTCGAAGATGATCTGGTTGTGCTTAGCATCGG
A105-130HydrophobicF
AGTCGTGGATCTCGTAGATGTTGAAATCGACATTGAGGAAGAATATGACAGTC
Primers used to clone Os3378-Z transposase with C-terminal EYFP tag (5’-3’)
XmaISacIIfillF
CCGGACAAAGGTGAAGC
XmaISacIIfillR
TTCACCTTTGT
2471EcoRV-F
GACCTAGATATCAGTACAAGAGAGAGCAAGAGAGGTTCAGG
TGGGTCGGCGCGCCTCATGCCGCGGATCCTCATTTTCTCACCGCCCTACCATTGCTCTT
3378C-XSacIIR
TGTCCCGGGCCTTCTTTGTTGTGTTTGTTCTTGCAAC
Primers used to clone Os3378-Z transpoase with C-terminal FLAG-His6 tag (5’-3’)
2471EcoRV-F
GACCTAGATATCAGTACAAGAGAGAGCAAGAGAGGTTCAGG
TGGGTCGGCGCGCCTCAATGGTGATGATGGTGATGACCTCCACCCTTATCATCATCAT
HF-CtermR
CCTTATAATCTCCACCTCCACCTCCACCTCCCATCTTCTTTGTTGTGTTTGTTCTTGCAAC

130

REFERENCES

131

REFERENCES

Bennetzen JL, Swanson J, Taylor WC, Freeling M (1984) DNA insertion in the 1st intron
of maize Adh1 affects message levels: Cloning of progenitor and mutant Adh1 alleles.
Proc. Natl. Acad. Sci. USA 81: 4125-4128
Bogerd HP, Fridell RA, Benson RE, Hua J, Cullen BR (1996) Protein sequence
requirements for function of the human T-cell leukemia virus type 1 Rex nuclear
export signal delineated by a novel in vivo randomization-selection assay. Molecular
and Cellular Biology 16: 4207-4214
Chalvet F, Grimaldi C, Kaper F, Langin T, Daboussi MJ (2003) Hop, an active Mutatorlike element in the genome of the fungus Fusarium oxysporum. Molecular Biology
and Evolution 20: 1362-1375
Chen CH, Oishi KK, Kloeckenergruissem B, Freeling M (1987) Organ-specific
expression of maize Adh1 is altered after a Mu transposon insertion. Genetics 116:
469-477
Chomet P, Lisch D, Hardeman KJ, Chandler VL, Freeling M (1991) Identification of a
regulatory transposon that control the Mutator transposable element system in maize.
Genetics 129: 261-270
Cresse AD, Hulbert SH, Brown WE, Lucas JR, Bennetzen JL (1995) Mu1-related
transposable elements of maize preferentially insert into low copy number DNA.
Genetics 140: 315-324
Dietrich CR, Cui F, Packila ML, Li J, Ashlock DA, Nikolau BJ, Schnable PS (2002)
Maize Mu transposons are targeted to the 5 ' untranslated region of the gl8 gene and
sequences flanking Mu target-site duplications exhibit nonrandom nucleotide
composition throughout the genome. Genetics 160: 697-716
Emelyanov A, Gao Y, Naqvi NI, Parinov S (2006) Trans-kingdom transposition of the
maize Dissociation element. Genetics 174: 1095-1104
Enoki H, Izawa T, Kawahara M, Komatsu M, Koh S, Kyozuka J, Shimamoto K (1999)
Ac as a tool for the functional genomics of rice. Plant Journal 19: 605-613
Essers L, Adolphs RH, Kunze R (2000) A highly conserved domain of the maize Activator
transposase is involved in dimerization. Plant Cell 12: 211-223
132

Feldmar S, Kunze R (1991) The ORFa protein, the putative transposase of maize
transposable element Ac, has a basic DNA-binding domain. EMBO Journal 10: 40034010
Ferguson A, Zhao D, Jiang N (2013) Selective acquisition and retention of genomic
sequences by Pack-MULEs based on GC content and breadth of expression. Plant
Physiology 163: 1419-1432
Ferguson AA, Jiang N (2012) Mutator-like elements with multiple long terminal inverted
repeats in plants. Comparative and Functional Genomics 2012: 695827
doi:10.1155/|2012/695827
Fernandes J, Dong QF, Schneider B, Morrow DJ, Nan GL, Brendel V, Walbot V (2004)
Genome-wide mutagenesis of Zea mays L. using RescueMu transposons. Genome
Biology 5
Fischer SEJ, Wienholds E, Plasterk RHA (2001) Regulated transposition of a fish
transposon in the mouse germ line. Proc. Natl. Acad. Sci. USA 98: 6759-6764
Fleenor D, Spell M, Robertson D, Wessler S (1990) Nucleotide sequence of the maize
Mutator element, Mu8. Nucleic Acids Research 18: 6725-6725
Freeling M (1984) Plant Transposable Elements and Insertion Sequences. Annual Review of
Plant Physiology and Plant Molecular Biology 35: 277-298
Gao DY (2012) Identification of an active Mutator-like element (MULE) in rice (Oryza
sativa). Molecular Genetics and Genomics 287: 261-271
Grevelding C, Becker D, Kunze R, Vonmenges A, Fantes V, Schell J, Masterson R (1992)
High-rates of Ac/Ds germinal transposition in Arabidopsis suitable for gene isolation
by insertional mutagenesis. Proc. Natl. Acad. Sci. USA 89: 6085-6089
Hanada K, Vallejo V, Nobuta K, Slotkin RK, Lisch D, Meyers BC, Shiu SH, Jiang N
(2009) The functional role of Pack-MULEs in rice inferred from purifying selection
and expression profile. Plant Cell 21: 25-38
Hancock CN, Zhang F, Wessler SR (2010) Transposition of the Tourist-MITE mPing in
yeast: An assay that retains key features of catalysis by the class 2 PIF/Harbinger
superfamily. Mobile DNA 1: 5 doi:10.1186/1759-8753-1-5

133

Heinlein M, Brattig T, Kunze R (1994) In vivo aggregation of maize Activator (Ac)
transposase in nuclei of maize endosperm and Petunia protoplasts. Plant Journal 5:
705-714
Hennig S, Ziebuhr W (2010) Characterization of the transposase encoded by IS256, the
prototype of a major family of bacterial insertion sequence elements. Journal of
Bacteriology 192: 4153-4163
Hershberger RJ, Warren CA, Walbot V (1991) Mutator activity in maize correlates with
the presence and expression of the Mu transposable element Mu9. Proc. Natl. Acad.
Sci. USA 88: 10198-10202
Ivics Z, Hackett PB, Plasterk RH, Izsvak Z (1997) Molecular reconstruction of Sleeping
beauty, a Tc1-like transposon from fish, and its transposition in human cells. Cell 91:
501-510
Jiang N, Bao ZR, Zhang XY, Eddy SR, Wessler SR (2004) Pack-MULE transposable
elements mediate gene evolution in plants. Nature 431: 569-573
Jiang N, Ferguson AA, Slotkin RK, Lisch D (2011) Pack-Mutator-like transposable
elements (Pack-MULEs) induce directional modification of genes through biased
insertion and DNA acquisition. Proc. Natl. Acad. Sci. USA 108: 1537-1542
Keng VW, Yae K, Hayakawa T, Mizuno S, Uno Y, Yusa K, Kokubu C, Kinoshita T,
Akagi K, Jenkins NA, et al. (2005) Region-specific saturation germline mutagenesis
in mice using the Sleeping Beauty transposon system. Nature Methods 2: 763-769
Kim JM, Vanguri S, Boeke JD, Gabriel A, Voytas DF (1998) Transposable elements and
genome organization: A comprehensive survey of retrotransposons revealed by the
complete Saccharomyces cerevisiae genome sequence. Genome Research 8: 464-478
Kim YC, Morrison SL (2009) N-terminal domain-deleted Mu transposase exhibits increased
transposition activity with low target site preference in modified buffers. Journal of
Molecular Microbiology and Biotechnology 17: 30-40
Knapp S, Coupland G, Uhrig H, Starlinger P, Salamini F (1988) Transposition of the
maize transposable element Ac in Solanum tuberosum. Molecular & General Genetics
213: 285-290
Kunze R, Behrens U, Couragefranzkowiak U, Feldmar S, Kuhn S, Lutticke R (1993)
Dominant transposition-deficient mutants of maize Activator (Ac) transposase. Proc.
Natl. Acad. Sci. USA 90: 7094-7098
134

Kunze R, Kuhn S, Jones JDG, Scofield SR (1995) Somatic and germinal activities of maize
Activator (Ac) transposase mutants in transgenic tobacco. Plant Journal 8: 45-54
Kyte J, Doolittle RF (1982) A simple method for displaying the hydropathic character of a
protein. Journal of Molecular Biology 157: 105-132
Lampe DJ, Akerley BJ, Rubin EJ, Mekalanos JJ, Robertson HM (1999) Hyperactive
transposase mutants of the Himar1 mariner transposon. Proc. Natl. Acad. Sci. USA 96:
11428-11433
Lazarow K, Du ML, Weimer R, Kunze R (2012) A hyperactive transposase of the maize
transposable element Activator (Ac). Genetics 191: 747-756
Li YB, Harris L, Dooner HK (2013) TED, an autonomous and rare maize transposon of the
Mutator superfamily with a high gametophytic excision frequency. Plant Cell 25:
3251-3265
Lisch D (2002) Mutator transposons. Trends in Plant Science 7: 498-504
Lisch D, Chomet P, Freeling M (1995) Genetic characterization of the Mutator system in
maize: Behavior and regulation of Mu transposons in a minimal line. Genetics 139:
1777-1796
Lisch D, Girard L, Donlin M, Freeling M (1999) Functional analysis of deletion
derivatives of the maize transposon MuDR delineates roles for the MURA and MURB
proteins. Genetics 151: 331-341
Lisch DR, Freeling M, Langham RJ, Choy MY (2001) Mutator transposase is widespread
in the grasses. Plant Physiology 125: 1293-1303
Liu SZ, Yeh CT, Ji TM, Ying K, Wu HY, Tang HM, Fu Y, Nettleton D, Schnable PS
(2009) Mu transposon insertion sites and meiotic recombination events co-localize
with epigenetic marks for open chromatin across the maize genome. PLoS Genetics 5:
e1000733 doi:10.1371/journal.pgen.1000733
Makris JC, Nordmann PL, Reznikoff WS (1990) Integration host factor plays a role in
IS50 and Tn5 transposition. Journal of Bacteriology 172: 1368-1373
Marquez CP, Pritham EJ (2010) Phantom, a new subclass of Mutator DNA transposons
found in insect viruses and widely distributed in animals. Genetics 185: 1507-1517
135

McCarty DR, Suzuki M, Hunter C, Collins J, Avigne WT, Koch KE (2013) Genetic and
molecular analyses of UniformMu transposon insertion lines. Plant Transposable
Elements: Methods and Protocols 1057: 157-166
Nesmelova IV, Hackett PB (2010) DDE transposases: Structural similarity and diversity.
Advanced Drug Delivery Reviews 62: 1187-1195
Neuveglise C, Chalvet F, Wincker P, Gaillardin C, Casaregola S (2005) Mutator-like
element in the yeast Yarrowia lipolytica displays multiple alternative splicings.
Eukaryotic Cell 4: 615-624
Plasterk RHA, Izsvak Z, Ivics Z (1999) Resident aliens: The Tc1/mariner superfamily of
transposable elements. Trends in Genetics 15: 326-332
Pledger DW, Coates CJ (2005) Mutant Mos1 mariner transposons are hyperactive in Aedes
aegypti. Insect Biochemistry and Molecular Biology 35: 1199-1207
Qin M, Robertson DS, Ellingboe AH (1991) Cloning of the Mutator transposable element
MuA2, a putative regulator of somatic mutability of the a1-Mum2 allele in maize.
Genetics 129: 845-854
Raizada MN, Nan GL, Walbot V (2001) Somatic and germinal mobility of the RescueMu
transposon in transgenic maize. Plant Cell 13: 1587-1608
Raizada MN, Walbot V (2000) The late developmental pattern of Mu transposon excision is
conferred by a cauliflower mosaic virus 35S-driven MURA cDNA in transgenic
maize. Plant Cell 12: 5-21
Robertson DS (1978) Characterization of a mutator system in maize. Mutation Research 51:
21-28
Rossi M, Araujo PG, de Jesus EM, Varani AM, Van Sluys MA (2004) Comparative
analysis of Mutator-like transposases in sugarcane. Molecular Genetics and Genomics
272: 194-203
Schnable PS, Ware D, Fulton RS, Stein JC, Wei FS, Pasternak S, Liang CZ, Zhang JW,
Fulton L, Graves TA, et al. (2009) The B73 maize genome: Complexity, diversity,
and dynamics. Science 326: 1112-1115
Settles AM, Holding DR, Tan BC, Latshaw SP, Liu J, Suzuki M, Li L, O'Brien BA,
Fajardo DS, Wroclawska E, et al. (2007) Sequence-indexed mutations in maize
136

using the UniformMu transposon-tagging population. BMC Genomics 8: 116
doi:10.1186/1471-2164-8-116
Singer T, Yordan C, Martienssen RA (2001) Robertson's Mutator transposons in A.
thaliana are regulated by the chromatin-remodeling gene Decrease in DNA
Methylation (DDM1). Genes & Development 15: 591-602
Talbert LE, Chandler VL (1988) Characterization of a highly conserved sequence related to
Mutator transposable elements in maize. Molecular Biology and Evolution 5: 519529
Talbert LE, Patterson GI, Chandler VL (1989) Mu transposable elements are structurally
diverse and distributed throughout the genus Zea. Journal of Molecular Evolution 29:
28-39
Tan BC, Chen ZL, Shen Y, Zhang YF, Lai JS, Sun SSM (2011) Identification of an active
new Mutator transposable element in maize. G3: Genes Genomes Genetics 1: 293302
Weil CF, Kunze R (2000) Transposition of maize Ac/Ds transposable elements in the yeast
Saccharomyces cerevisiae. Nature Genetics 26: 187-190
Woodhouse MR, Freeling M, Lisch D (2006) The mop1 (mediator of paramutation1)
mutant progressively reactivates one of the two genes encoded by the MuDR
transposon in maize. Genetics 172: 579-592
Xu ZN, Yan XH, Maurais S, Fu HH, O'Brien DG, Mottinger J, Dooner HK (2004)
Jittery, a Mutator distant relative with a paradoxical mobile behavior: Excision
without reinsertion. Plant Cell 16: 1105-1114
Yang GJ, Weil CF, Wessler SR (2006) A rice Tc1/mariner-like element transposes in yeast.
Plant Cell 18: 2469-2478
Yang GJ, Zhang F, Hancock CN, Wessler SR (2007) Transposition of the rice miniature
inverted repeat transposable element mPing in Arabidopsis thaliana. Proc. Natl. Acad.
Sci. USA 104: 10962-10967
Yu ZH, Wright SI, Bureau TE (2000) Mutator-like elements in Arabidopsis thaliana:
Structure, diversity and evolution. Genetics 156: 2019-2031

137

Zanetti ME, Chang IF, Gong FC, Galbraith DW, Bailey-Serres J (2005)
Immunopurification of polyribosomal complexes of Arabidopsis for global analysis of
gene expression. Plant Physiology 138: 624-635
Zayed H, Izsvak Z, Walisko O, Ivics Z (2004) Development of hyperactive Sleeping Beauty
transposon vectors by mutational analysis. Molecular Therapy 9: 292-304
Zhao DY, Jiang N (2014) Nested insertions and accumulation of indels are negatively
correlated with abundance of Mutator-like transposable elements in maize and rice.
PLoS ONE 9: e87069 doi:10.1371/journal.pone.0087069
Zhao ZY, Sundaresan V (1991) Binding-sites for maize nuclear proteins in the terminal
inverted repeats of the Mu1 transposable element. Molecular & General Genetics 229:
17-26

138

CHAPTER 4

Insertions of Mutator-Like Transposable Elements and their Impact on Gene
Expression in the Illinois Long-Term Selection Experiment Maize Strains

139

4.1 Abstract
Mutator-like elements (MULEs) belong to a highly mutagenic and active DNA
transposon family. MULEs have the propensity to insert into low copy and genic regions,
which may influence the expression of adjacent genes as well as the relevant developmental
processes. The Illinois Long-Term Selection Experiment (ILTSE) maize strains are elite
experimental materials for a variety of studies, especially studies on the effects of selection
on the kernel chemical composition (oil or protein). However, little is known about the
molecular mechanism underlying the selection. Particularly, it is not clear whether
transposons have played any role in the artificial selection. To this end, MULE insertions that
are co-segregating with either high or low protein maize strains (IHP and ILP) were studied.
Out of 200 co-segregating insertions detected, 191 produced significant alignments with the
B73 maize genomic sequence. Consistent with previous findings, ~79% of the 191 insertions
were located in low-copy genomic regions. Interestingly, similar numbers of co-segregating
insertions were located at the 5′ and 3′ regions of protein-coding genes, which is in contrast to
the 5′ region preference of MULEs reported in previous studies. Compared with that in the
B73 genome, the fraction of co-segregating MULE insertions in exons is over one fold higher,
suggesting exonic insertions may be involved in the selection. Additionally, expression levels
of genes with adjacent co-segregating MULE insertions in immature kernels and leaves were
compared between the IHP and ILP maize strains. In immature kernels, ten out of 55 genes
(~18%) associated with MULE insertions showed reduced expression levels and five (~9%)
showed enhanced expression levels compared to the alleles without MULE insertions. Eight
of the differentially expressed genes were further tested in young leave, where half exhibited
similar expression pattern as that in immature kernels but the alteration associated with
MULE insertions was not observed with the other half of the genes, suggesting they might be
involved in the selected trait.
140

4.2 Introduction
Transposable elements (TEs), also called transposons, are genomic sequences that can
move from one place to another within a genome. Based on the transposition intermediate,
TEs can be divided into two classes; class I (RNA elements) or retrotransposons which
transpose via RNA intermediates and class II or DNA transposons which transpose via DNA
intermediates. The availability of sequenced genomes and bioinformatics analyses reinforce
the concept that TEs not only contribute to genome size variations, but also have functions in
many biological processes in both plants and animals (Feschotte and Pritham, 2007;
Feschotte, 2008; Martinez and Slotkin, 2012).
Mutator elements, which belong to the DNA transposons, represent a highly mutagenic
transposon system. They are characterized by the long terminal inverted repeats (TIRs) and 911 bp duplication of the target site sequence (TSD) (Lisch, 2002). They were first discovered
in a maize stock which exhibited higher mutation frequency than spontaneous mutation
(Robertson, 1978). Subsequently, similar elements were found to be widespread in other
plant species, including both monocots and dicots, where they were referred to as Mutatorlike transposable elements (MULEs) (Lisch and Jiang, 2009). Lisch and colleagues
demonstrated that the autonomous MULEs were widespread in grasses by using DNA-blot
hybridization and PCR amplification and these elements are under purifying selection which
suggests potential activity (Lisch et al., 2001). Pack-MULEs are MULEs carrying gene(s) or
gene fragments. In rice, about 3,000 Pack-MULEs were discovered (Jiang et al., 2004) and
some were suggested to have functions in regulation of gene expression (Hanada et al., 2009).
In maize, there are a total of 262 Pack-MULEs among 12,900 MULEs in the B73 genome
(Schnable et al., 2009).

141

TEs can regulate gene expression in many ways, at both the transcriptional and posttranscriptional levels (Feschotte, 2008). At the transcriptional level, TEs can introduce new
cis-regulatory

elements

(e.g.,

promoters,

alternative

transcription

start

sites

or

polyadenylation sites), disrupt existing cis-regulatory elements, interfere with gene
expression by antisense transcription of the inserted TEs and induce heterochromatin
formation. At the post-transcriptional level, TEs can serve as binding sites for miRNA or
RNA binding proteins, and so forth. Increasing evidence indicates that a large number of
class II TEs, including MULEs, are transcribed and their position and transcription can also
influence the expression of other genes (Diao and Lisch, 2006; Jiao and Deng, 2007; Naito et
al., 2009). The massive amplification of mPing, the first active miniature inverted
transposable element (MITE) to be discovered, led to unexpected consequences on gene
expression in the rice strain EG4 (Naito et al., 2009). The vast majority of mPing insertions
either led to up-regulation or no detectable changes on the expression of near-by genes. In
contrast, a study of 4606 TEs (including both RNA and DNA TEs) in Arabidopsis
demonstrated that genes close to TE insertions were less expressed compared with the
genome-wide pattern of gene expression (Hollister and Gaut, 2009), suggesting the effect of
TEs on gene expression could be either positive or negative. Like other TEs, MULEs can
regulate transcription of adjacent genes through the mechanisms mentioned above. For
example, Bennetzen and colleagues detected reduced expression level of the mutant allele of
alcohol dehydrogenase-1 which had a Mu1 insertion in its first intron compared to that of the
wild type allele (Bennetzen et al., 1984). Moreover, in some maize mutagenesis projects
targeting specific metabolic pathways by using Mu as the mutagen, it is evident that the
insertion(s) of this element greatly altered, and can even diminish the expression of related
genes and disrupt respective metabolic pathways (Blauth et al., 2001; Blauth et al., 2002;
Cossegal et al., 2008).
142

The Illinois Long-Term Selection Experiment (ILTSE) was initiated in 1896, in which
kernel protein and oil content were selected (Moose et al., 2004; Dudley, 2007). The selection
procedure and criteria varied throughout the 100-year experiment. However, the main
strategy was similar, which involved cross-pollination within populations with a similar trait
(see Figure 4.1A) and selection for the target trait from within the population (i.e., protein or
oil). As shown in Figure 4.1A, the experiment was initialized with 163 ears (organ in which
maize seeds develop) from the open-pollinated (which allows self-pollination and crosspollination) variety, Burr’s white. The ears with the highest protein content (if protein was the
target trait) served as the starting material for the high protein population (IHP) and the ears
with the lowest protein content served as the starting material for the low protein population
(ILP). During the first 9 cycles, plants within the same population were grown together and
seeds were derived from open-pollination. Subsequently, cross-pollination was enforced by
de-tasseling (removing the male flower) plants in alternate rows within the same population
and seeds were harvested only from the de-tasseled plants. After each harvest, ears with the
highest protein content from IHP block and ears with the lowest protein content from ILP
block were used for next cycle of experiment and selection. As a result, genetic variability
was mainly introduced from different individual lines within the same population.
Nevertheless, due to the fact that maize is an out-crossing plant, and that the populations were
not grown in absolute isolation, occasional gene introgression from other populations or
varieties during the selection process cannot be ruled out.
Over 100 years of selection has created four major maize populations with extreme
kernel protein and oil content, i.e., Illinois High Protein (IHP), Illinois Low Protein (ILP),
Illinois High Oil (IHO) and Illinois Low Oil (ILO), which have been a major source for elite
experimental materials in plant breeding and genetics research (Moose et al., 2004). The long
143

term divergent selection for kernel protein content increased the mean protein content from
10.93% to 30.92% in the IHP population while that in the ILP population decreased from
10.93% to 4.26% (Moose et al., 2004). The continual gain of selection in these maize
populations suggests that a large amount of genetic variability exists, providing a unique set
of germplasm to understand the underlying mechanisms for continued variability and
selection potential.
Previous studies focused on identifying molecular markers and quantitative trait loci
(QTLs) in these populations by using crosses of IHP × ILP or random-mated lines (Goldman
et al., 1993; Dudley et al., 2004; Wassom et al., 2008). However, different results were
obtained with the different methods and locations used in the research. In one study, 6 loci
accounted for over 60% of the total kernel protein content variation in the Illinois protein
populations (Goldman et al., 1993). In another study, ~173 loci were suggested to be
responsible for the variation in protein content in IHP versus ILP at cycle 90 (Dudley and
Lambert, 1992). Long-term selection would increase coupling phase linkage and lead to high
local linkage disequilibrium of genomic regions that contribute to the selected trait (Moose et
al., 2004). To break the linkage blocks and improve QTL studies in these maize populations,
random mating between IHP and ILP was used, which yielded at least 40 QTLs with small
effects for protein, starch, oil, and kernel weight separately, which is consistent with the
“Infinitesimal Model”, i.e., a large number of QTLs contributing to the trait with each
constituting a marginal effect (Dudley, 2007).
Despite many years of classic genetic studies on the ILTSE maize strains, little research
on possible influence of transposable elements on these strains has been reported. To date,
there is only one report studying an insertion of a DNA TE called ILS_1 in the ILTSE maize
strains (Alrefai et al., 1994). The ILS-1 element inserted in the 13th intron of the Shrunken2
144

gene in the ILP maize. Nevertheless, there is no evidence showing whether the insertion is
related to the selected trait. The abundance of TEs in the maize genome (>85%) and the
regulatory and evolutionary roles that TEs play in several model organisms (reviewed by
Feschotte, 2008) prompted us to study the effect of TEs, especially MULEs, on the Illinois
Long-Term Selection Experiment maize strains.

Figure 4.1 Overview of selection procedures and characterization of MULE insertions
in the Illinois Long-Term Selection Experiment maize populations.
(A) Diagram of forward selection procedures of the Illinois High Protein (IHP) and Low
Protein (ILP) maize populations.
(B) Image of transposon display with a maize MULE in the IHP and ILP maize populations.
Four individual plants from the IHP65 and ILP65 were examined. Black arrows point to
MULE insertions co-segregating with kernel protein content; red arrows point to MULE
insertion that does not co-segregate with protein content.

145

4.3 Results
4.3.1 MULE Insertions
4.3.1.1 MULE Insertions Segregating with Kernel Protein Content
To determine whether MULE insertions are involved in the artificial selection, insertions
that co-segregate with the selected trait (i.e., kernel protein content) were identified. A cosegregating MULE insertion refers to a MULE insertion only present in the IHP population
but not in the ILP maize strains, or vice versa (see Figure 4.1B). To this end, ten IHP maize
lines (from IHP cycle 65 and 105; IHP65 and IHP105) and ten ILP maize lines (from ILP
cycle 65 and 95; ILP65 and ILP95) were used to identify co-segregating MULE insertions
through transposon display, a modified AFLP method (Van den Broeck et al., 1998). This
method uses nested PCR to amplify MULE flanking sequences with primers specific to the
MULE terminal inverted repeat (TIR) and adaptor primers followed by separation of the PCR
products using polyacrylamide gel electrophoresis (see Section 4.5.2).
Over 200 co-segregating MULE insertions were detected in these maize lines and
flanking sequences of 191 insertions produced significant alignments in the B73 genome. The
10 unmapped insertions may be due to sequence polymorphisms between the Illinois maize
and the B73 maize or they represent unsequenced portion of the maize genome. Out of the
191 co-segregating insertions, 57% were from the IHP maize strains, which was significantly
higher than that from the ILP maize strains (χ2=7.6335, p=0.0057). Furthermore, analysis of
the mapped flanking sequences indicated that ~79% are located in low-copy genomic regions
(only one or two matches from B73 RefGen_v2, BLASTN, e<10-5) and ~42% are within 1 kb
of an annotated gene (Table 4.1). Not surprisingly, few insertions (n=12; 6.28%) were
detected in exons of protein-coding genes and most of which (n=11) were in the untranslated
regions (UTR). There were slightly more insertions in introns than exons of genes, however,
146

the difference was not statistically significant (10.47% vs. 6.28%; χ2=2.1829, p=0.1396).
Consistent with previous studies, many insertions (~26%) were within 1 kb flanking
sequences of genes. However, no significant difference was observed when comparing
insertions in the 5′ and 3′ regions of genes (14.14% vs. 11.52%; χ2=0.5853, p=0.4443), which
is in contrast to the previous reports that MULEs preferentially insert into 5′ regions (Liu et
al., 2009; Jiang et al., 2011).
Table 4.1 Comparison of co-segregating MULE insertions in the Illinois protein maize
strains and MULEs in the B73 maize genome
Genic regions
5′ region*

exon

Other regions

intron 3′ region†

sub-total

Co-segregating
MULE insertions

81
27
12
20
22
(42.41%)¶
(14.14%) (6.28%) (10.47%) (11.52%)

MULEs in the B73
maize genome

2605
559
1914
(13.11%) (2.81%) (9.64%)

1727
(8.69%)

6805
(34.26%)¶

intergenic repetitive
region‡
region§
41
69
(21.47%)
(36.13%)
13058
(65.74%)

total
191
19863

*5′ region: ≤1000 bp upstream of transcription start site
†3′ region: ≤1000 bp downstream of transcription termination site
‡intergenic region: MULE insertions are not within 1000 bp flanking sequences of any nonTE genes
§repetitive region: sequences producing >2 hits (BLASTN, e<10-5)
¶fractions in this column are significantly different (χ2=5.5715, p=0.0183)

4.3.1.2 Comparison of Co-segregating MULE Insertions with MULEs in the B73 Maize
Genome
If the co-segregating MULE insertions are associated with the selected trait, their
distribution with regard to different genomic sequence features is likely different from that of
other maize MULEs. To test this hypothesis, the distribution of MULEs in the B73 genome
was analyzed and compared with that of the co-segregating MULEs in the Illinois protein
maize strains (Table 4.1). First of all, among the co-segregating MULEs, there are more in
genic regions (genes plus one kb flanking sequences) than that in B73 (42.41% vs. 34.26%,
χ2=5.5715, p=0.0183). Nevertheless, the over-representation is not even in different regions
147

of genes. The fraction of the co-segregating MULEs located in exons is over twice of that is
observed in the B73 genome (6.28% vs. 2.81%; χ2=8.2273, p=0.0041). In contrast, the
percent of insertions in introns is comparable between the co-segregating MULEs and that of
the B73 genome (10.47% vs. 9.64%; χ2=0.1514, p=0.6972). Another difference is the ratios
of MULE insertions in the 5′ and 3′ regions of genes, where no significant difference was
observed for the co-segregating MULEs in the Illinois protein maize strains in contrast to the
significant difference observed in the B73 genome (13.11% vs. 8.69%; χ2=199.7311,
p<0.0001).
Table 4.2A Summary of expression of genes with co-segregating MULE insertions in
their vicinity.
Decreased
expression

Increased
expression

No
difference

Genes
tested

Immature kernels

10

5

40

55

Young leaves

4

0

4

8

Table 4.2B Summary of expression of genes with co-segregating MULE insertions in
their flanking regions and UTRs in immature kernels.
Decreased
expression

Increased
expression

No
difference

Genes
tested

5′ region and 5′ UTR

6

2

14

22

3′ region and 3′ UTR

1

1

11

13

4.3.2 Expression of Genes with Co-segregating MULE Insertions
4.3.2.1 Expression in Immature Kernels
To determine whether the co-segregating MULE insertions affected gene expression,
reverse-transcription polymerase chain reaction (RT-PCR) was conducted on genes adjacent
to MULE insertions in immature kernels (16 days after pollination). A total of 55 genes were
tested for their expression levels in the Illinois protein maize strain (Table 4.2A), where ten
exhibited decreased expression levels from the alleles harboring adjacent MULE insertions
148

compared with the alleles without the MULE insertion (Tables 4.2, 4.3). Among these genes,
five MULE insertions were specifically in the IHP maize strains and five were in the ILP
maize strains. Not surprisingly, six out of these ten genes harbor MULE insertions in the
upstream regions of translation start site (5′ regions and 5′ UTRs), where the promoter or
other cis-acting elements often reside (Table 4.2B). For example, the allele of a guanine
nucleotide-binding protein-like gene (GNUP-like) with a MULE insertion 43 bp upstream of
the transcription start site showed no detectable expression in contrast to the allele without
the insertion (Figures 4.2A, B). Similarly, for a gene encoding a sterile alpha motif (SAM)
domain family protein, weak expression was detected in the ILP cycles 65 and 95, in which
the allele contains a MULE insertion 116 bp upstream of its transcription start site compared
with the high expression levels from the allele without MULE insertion in the IHP cycles 105
and 65 (Figures 4.3A, B). In addition, reduced expression levels were also observed for three
genes containing MULE insertions in introns and one in the 3′ UTR (Table 4.3A). For
instance, the allele of the chaperone protein dnaJ with a MULE insertion in its 3′ UTR
exhibited reduced expression levels compared with the allele without the insertion (Figures
4.4A, B). However, the reduction seems not as dramatic as genes containing MULE
insertions in the upstream regions of genes (Figures 4.2B, 4.3B).

149

Figure 4.2 Schematic representation (A) and expression levels of a guanine nucleotidebinding protein-like gene (GNUP-like) in immature kernels (B) and young leaves of the
IHP and ILP maize strains.
Blue triangles denote the MULE element; red rectangles denote exons and lines connecting
them are introns; the dashed line indicates the 5′ region of the gene; black arrows indicate the
positions of primers used in RT-PCR. The ILP maize strains (pointed by blue triangles)
contain an insertion of Zm00266 at 43 bp upstream of the transcription start site of the gene
while the IHP maize strains do not (B and C). Expression of the actin gene serves as internal
control for the total input RNA. The numbers next to the gene name or actin indicate the
number of cycles of amplification in RT-PCR.

Figure 4.3 Schematic representation (A) and expression levels of an SAM domain family
protein in immature kernels (B) and young leaves of the IHP and ILP maize strains.
Items are depicted similarly as that in Figure 4.2.

150

Figure 4.4 Schematic representation (A) and expression levels of the chaperone protein
dnaJ in immature kernels (B) and young leaves of the IHP and ILP maize strains. Items
are depicted similarly as that in Figure 4.2.

Additionally, five genes exhibited enhanced expression levels from the alleles near the
MULE insertion in comparison with the alleles without the MULE insertion (Table 4.2A),
and four of them are associated with high protein populations. These include two genes with
MULE insertions in the 5′ upstream regions, two in introns and one in the 3′ UTR. For
example, in IHP cycles 65 and 105, the allele of a gene encoding a putative pentatricopeptide (PPR) repeat-containing protein harbors a MULE insertion in its 5′ UTR and its
expression was higher compared to the allele without the insertion in the ILP cycles 65 and
95 (Figures 4.5A, B). Another example is a gene encoding AMP deaminase, where the allele
in the IHP maize strains harbors a MULE insertion in the 8th intron and exhibited enhanced
expression levels compared with that in the ILP maize strains which do not contain the
insertion (Figures 4.6A, B). Given the fact that the Mutator elements have been used as
powerful agents to knock-out genes, it is intriguing to observe that the incidents with
enhanced expression was not rare in the Illinois protein maize strains.

151

Figure 4.5 Schematic representation (A) and expression levels of a putative pentatricopeptide repeat-containing (PPR) protein in immature kernels (B) and young leaves
of the IHP and ILP maize strains. Items are depicted similarly as that in Figure 4.2.

Figure 4.6 Schematic representation (A) and expression levels of an AMP deaminase in
immature kernels (B) and young leaves of the IHP and ILP maize strains. Items are
depicted similarly as that in Figure 4.2.

152

Table 4.3A Genes with altered expressions in immature kernels between maize lines with and without MULE insertions.

Reduced
expression

MULE insertion

Insertion

Zm00754BMspI_H1
Zm00754HinP1I_L3

Low
average†
680710

-6.52

<.0001

-116 bp

222324

114627

13.72

<0.0001

-43 bp

592539

269829

8.64

<0.0001

5′ UTR

107689

124347

-4.01

0.0025

5′ UTR

4219806

3702855

3.01

0.0132

5′ UTR

529654

228653

3.97

0.0027

st

Insert site

high protein maize

phosphatase 2C

low protein maize

SAM-domain protein

Zm00266BHinP1I_L1

low protein maize

Zm00257HinP1ITA_H

high protein maize

Zm00754MspI_L2

low protein maize

guanine_nucleotide-binding_protein-like
10-deacetylbaccatin III 10-Oacetyltransferase
isochorismatase_hydrolase_family_protein

Zm17242HinP1I_L

low protein maize

Late embryogenesis abundant protein

t-value‡

p-value

Zm00266BHinP1I_H1

high protein maize

protein_farnesyltransferase

1 intron

162474

171962

-2.73

0.0213

Zm00851HinP1I_H2

high protein maize

glycolipid_transporter

2nd intron

314879

406086

-4.48

0.0012

Zm00460AMspI_H2§

high protein maize

Hypothetical protein

3nd intron

1982507

3573824

-3.72

0.004

Zm00754HinP1I_L2

low protein maize

Chaperon protein dnaJ

3′ UTR

187933

166229

2.91

0.0156

Zm00851MseI_H2

high protein maize

putative_ferulate_5-hydroxylase

-297 bp

70683

45527

4.14

0.0025

§

high protein maize

pentatricopeptide repeat-containing protein

5′ UTR

258474

166992

4.8

0.0007

Zm01654_L1

low protein maize

Unknown protein

1st intron

707398

1364408

-4.45

0.0012

Zm00460A_H1§

high protein maize

AMP deaminase

8th intron

787802

468204

5.08

0.0005

Zm00851HinP1I_H1§

high protein maize

Mitochondrial transcription termination
factor-related

3′ UTR

6477647

4615584

2.23

0.0497

Zm754AMseI_HI
Increased
expression

-1720 bp

High
average*
295039

Adjacent gene

*High average: the average PCR band intensity of six high protein maize lines (see Section 4.5)
†Low average: the average PCR band intensity of six low protein maize lines (see Section 4.5)
‡t-value: the value calculated through the formula for the t-test, which is related to the size of the difference between the “high average” and
“low average” for each gene
§No expression difference was detected in the young leaves (see Table 4.3B)

153

Table 4.3B Comparison of expression of genes in young leaves between maize lines with and without MULE insertions.

Reduced
expression

No
difference

MULE insertion

Insertion

Adjacent gene

Zm00754BMspI_H1

high protein maize

phosphatase 2C

Zm00754HinP1I_L3
Zm00257HinP1ITA_H
Zm00754HinP1I_L2

low protein maize
high protein maize
low protein maize

SAM-domain protein
10-deacetylbaccatin III 10-O-acetyltransferase
Chaperon protein dnaJ

Zm754AMseI_HI

high protein maize

Penta-tricopeptide repeat-containing protein

Zm00460AMspI_H2

high protein maize

Zm00460A_H1

high protein maize

Zm00851HinP1I_H1

high protein maize

Hypothetical protein
AMP deaminase
Mitochondrial transcription termination
factor-related

154

High
average

Low
average

t-value

p-value

-1720 bp

319285

369094

-6.03

0.0001

-116 bp
5′ UTR
3′ UTR

507129
560774
530117

382592
661795
312552

8.55
-2.92
5.38

<0.0001
0.0153
0.0003

5′ UTR

375394

430769

-1.32

0.2155

nd

482201

440403

1.78

0.106

th

8 intron

370620

400951

-1

0.3417

3′ UTR

789877

1030583

-2.05

0.0674

3 intron

Among the genes exhibiting differential expression levels between IHP and ILP maize
strains, eight out of fifteen harbor co-segregating MULE insertions in either the 5′ regions or
5′ UTRs, and only two contain insertions in the 3′ UTRs (Tables 4.2A, B). This suggests that
MULE insertions upstream of translation start codon may alter gene expression levels more
often than insertions downstream of genes. To test this hypothesis, all the genes tested for
expression levels (n=55) were analyzed. As shown in Table 4.2B, 8 out of 22 genes (36.36%)
containing MULE insertions upstream of translation start codon exhibited altered expression
levels while only 2 out of 13 (15.38%) containing insertions downstream of translation stop
codon of genes showed altered expression levels (Table 4.2B). However, the difference is not
significant (χ2=1.7622, p=0.1843), which is likely due to the small sample size.
4.3.2.2 Expression in Young Leaves
Differential expression levels of genes with adjacent MULE insertions in the immature
kernels implied that MULE insertions may exert effects on these genes. If these genes were
indeed involved in kernel protein content and the alteration correlated with MULE insertion
has been selected for the trait, we may expect that differential expression occurs more
significantly in the kernels. To test this hypothesis, expression levels of eight genes showing
differential expression in the immature kernels were determined in the young leaves. Indeed,
the difference of expression levels between allele with or without MULE insertion was not
detectable in young leaves for three genes showing enhanced expression levels and one gene
showing reduced expression in immature kernels (Tables 4.3A, B). For example, in young
leaves, for the gene encoding a putative penta-tricopeptide repeat-containing (PPR) protein,
the IHP maize strains harboring a MULE insertion in the 5′ UTR exhibited similar expression
levels to the ILP maize strains which do not have the insertion (Tables 4.3A, B; Figure 4.5C).
Similarly, no enhanced expression was observed in young leaves for the allele containing a
155

MULE insertion in the 8th intron of the gene encoding an AMP deaminase in contrast to that
in immature kernels (Tables 4.3A, B; Figure 4.6C). Besides genes showing no differential
expression, four genes exhibited similar expression patterns in young leaves to that in
immature kernels (Table 4.3B; Figures 4.2C, 4.3C, and 4.4C). Taken together, it seems that
the enhancement associated with MULEs is kernel specific, while the suppression is more
consistent between the two tissues.
4.4 Discussion and Future Work
The ultimate source for evolution is mutation. Transposons can cause a wide range of
mutations, some of which possess unique features that cannot be reproduced by other
mutations, such as point mutations, deletions, and segmental duplications. For example,
transposon insertion may cause epigenetic modification of the chromatin they insert into,
which is unlikely to be mimicked by other mutations in the genome. From this point of view,
TEs are a driving force for evolution and provide raw materials for natural selection and
diversification. This is consistent with the fact that TEs are widespread and abundant in plant
genomes. Nevertheless, artificial selection is different from natural selection in that it does
not select for fitness. Instead, it selects for a particular trait which is often quantitative. As a
result, it is unclear whether TEs play any role in this process. Whereas this study did not
provide an unambiguous answer for this question, it resulted in several interesting
observations and provided a good foundation for future studies.
4.4.1 The Effect of Co-segregating MULE Insertions on Gene Expression
In this study, a total of 15 (out of 55 tested, 27%) co-segregating MULE insertions are
correlated with significant difference of expression levels of genes in immature kernels. This
ratio is very high compared with the number of differential expressed genes among different
156

maize varieties. In a previous study, 13,495 maize genes were surveyed and the differential
expressed genes between different varieties ranged from 326 (2.4%) to 1,144 (8.5%) (Stupar
et al., 2008). This suggests that co-segregating MULE insertions are frequently associated
with differential gene expression. While both suppression and enhancement were observed, it
is apparent that suppression was more frequent. Interestingly, most of the cases of
enhancement were associated with insertions in high protein maize lines and that expression
is specifically elevated in kernels. Furthermore, insertions in 5′ regions are more likely
associated with differential expression than that in 3′ regions.
One of the key questions is whether the correlation between MULE insertions and the
differential expression reflects a causal relationship or the MULE insertions only serve as
“markers” for other underlying mutations that are responsible for differential gene expression.
If such relationship is simply an association, it would be very difficult to explain the bias
mentioned above. For example, if the MULE insertions did not directly alter gene expression,
it is difficult to explain why the frequency of altered expression would vary with their
insertion positions (5′ region or 3′ region). Given those facts, it is likely that at least some of
the co-segregating MULE insertions caused the differential expression between the IHP and
ILP lines.
It should be noted that the altered expression levels of genes with adjacent MULE
insertions were simply associated with those maize strains and may not be the cause of the
selected trait. Nevertheless, the fact that some of the differential expression was only detected
in immature kernel but not leaf seem to suggest the involvement of these genes in the selected
trait. To further determine whether the co-segregating MULE insertions contribute to the
kernel protein content, more experiments need to be conducted. First, the ILTSE maize
population consists of reverse protein maize strains, which were formed by selecting for low
157

protein content in IHP strains (RHP) at cycle 48 and selecting for high protein content in ILP
strains (RLP) at cycle 48 (Moose et al., 2004). If the MULE insertions are involved in the
protein content, we may observe some insertions co-segregating with the IHP maize strains
were also present in the RLP strains, suggesting the recurrent acquisition of the relevant
insertions during the selection. Indeed, such incidence was observed in the preliminary test
(Data not shown). More systematic examination using more reverse maize lines is necessary
in order to obtain more conclusive results. Another approach is to use Arabidopsis T-DNA
plants which contain insertion mutations in the orthologous genes of those exhibiting
differential expression levels between maize line with and without MULE insertions. The
availability of Arabidopsis mutant libraries (www.arabidopsis.org) would make this analysis
possible. Finally, maize tagging lines containing mutations in relevant genes can be used to
test the role of these genes in kernel protein content.
4.4.2 The Distribution Pattern of Co-segregating MULE Insertions
The co-segregating MULE insertions may be derived from three sources: 1) existing
insertion polymorphisms or heterozygosity that were present prior to the selection; 2)
additional insertions from other maize varieties that were introduced to the population due to
cross-pollination during the selection; 3) new transpositions occurred during the selection.
Obviously, new insertions generated during selection are of very recent origin. The presence
of the polymorphic insertions in 1) and 2) could be due to the insertions generated after the
divergence of individuals or cultivars, or they represent insertions that don’t provide great
fitness benefit so they failed to spread across the population. For these reasons, the cosegregating MULE insertions should be younger than other MULEs in the genome as a group.
Among the co-segregating MULEs, more insertions were detected in IHP lines than in
the ILP (57% vs. 43%) lines. At first glance this seems to be puzzling because one would
158

assume the reduction of protein content could be achieved through disruptive effects such as
knock-out or knock-down mutations. Given the fact that MULE insertions are associated with
more suppressive effects on gene expression, it would predict that the ILP lines are associated
with more insertions than the IHP lines. This was not observed because disruptive effect
could be saturated rather rapidly. For example, if a key enzyme in the pathway of protein
synthesis or nitrogen transportation is knocked out, any additional disruptive mutation may
not further reduce the protein content and would not be selected for. Moreover, the selection
would be terminated when the protein content was too low to support the fitness of the seed.
In contrast, there could be numerous ways to increase protein content. These include both
“constructive” mutations, such as increasing protein synthesis or uptake of nitrogen to kernels,
and “disruptive” mutations, such as reduction of starch synthesis so that the relative content
of protein is elevated. As a result, selection for high protein content could be more
progressive, and require more constructive mutations. This is in agreement with the
observation that the reduction of protein content largely plateaued in ILP lines after cycle 65
while the protein content has been steadily increased in IHP lines (Dudley and Lambert, 1992;
Moose et al., 2004). This is also consistent with the fact that most of the enhancement of gene
expression was observed in IHP. Thus the presence of more co-segregating MULEs may
actually reflect the more intensive selection in these lines and imply that they are selected for.
Compared with the distribution of MULEs in B73, the co-segregating MULE insertions
seem to be overrepresented in genic region especially exons of protein-coding genes. This
suggests that either the exonic insertions are related to the trait or that the co-segregating
MULE insertions are relatively young and have not been subjected to sufficient natural
selection for elimination. A third possibility is that the unique population structure of the

159

ILTSE has favored the retention of MULE insertions in exons. These hypotheses are not
mutually exclusive.
In addition to the enrichment of exonic insertions among co-segregating MULEs, it is
worth mentioning that the insertion in 3′ region of genes is enriched compared to that in B73
(11.52% vs. 8.69%) even though the difference is not significant. An alternative description
of this phenomenon is that the well-known preference for insertion into 5′ region of genes
was not observed for co-segregating MULEs. Such discrepancy cannot be explained by the
younger age because the preference was observed for both new and existing MULE
insertions (Liu et al., 2009; Jiang et al., 2011). As discussed above, the selection for
disruptive effects should be more rapidly saturated than the constructive effects in this
specific population. If that is the case, insertions in 5′ regions should be selected against
among co-segregating MULEs because in general they are more likely associated with
suppression of gene expression. This explains why among the co-segregating MULE
insertions the preference for 5′ region is not observed and provides another piece of evidence
that some of the co-segregating MULE insertions have been selected for. Further studies
involving other MULE insertions in the Illinois maize strains are needed to elucidate this
phenomenon.
4.5 Materials and Methods
4.5.1 Plant Materials and DNA Extraction
Seeds of the Illinois High Protein maize strains at cycles 105 and 65 (IHP105 and IHP65),
the Illinois Low Protein maize strains at cycles 95 and 65 (ILP95 and ILP65) were kindly
provided by Dr. Moose (University of Illinois at Urbana-Champaign). Plants were grown in
the field at the Horticulture Teaching and Research Centre of Michigan State University from
160

early May to late October, 2009-2013. Leaf tissues were collected from two-week old
seedlings. Emerging ears (before the emergence of silks) were covered with envelops and
hand pollinated using pollens from the same plant. Immature kernels were collected 16 days
after pollination (DAP). The Cetyltrimethyl Ammonium Bromide (CTAB) DNA extraction
protocol (Clarke, 2002) was used to extract genomic DNA from young leaves followed by
RNase treatment.
4.5.2 Detection of MULE Insertions
MULE insertions in maize genome were detected using transposon display, a modified
AFLP method (Van den Broeck et al., 1998). Genomic DNAs from maize plants were
digested using restriction enzymes (BfaI, MseI, MspI and HinP1I) separately so that different
digestion patterns can be obtained to increase the chance of covering as many loci as possible
in these genomes. After digestion, a double-stranded adapter was ligated to the digested
genomic fragments, this serves as the annealing site for one of the PCR primers (adapter
primer). By using this adapter primer and another primer specific to MULE TIRs, genomic
fragments containing part of the MULE TIR and a portion of MULE flanking sequence are
amplified. Nested PCRs were used to increase the specificity of amplicons, which were
resolved on 6% acrylamide gel. To recover desired insertions, DNA fragments were excised
from the acrylamide gels and placed in 15 µl distilled water over night at 4 ºC and 7 µl
resulting solution was used for PCR amplification with a total volume of 20 µl PCR cocktail.
After purification of the PCR products using the Wizard® SV Gel and PCR Clean-Up
System (Promega, Madison, WI, USA), fragments were cloned using TA-cloning vector and
sequenced at the Research and Technology Sequencing Facility (RTSF) of Michigan State
University. BLAST analysis against the B73 genomic sequence revealed the locations of the

161

MULE insertion sites. B73 RefGen_v2 filtered gene database (www.maizegdb.org) is
examined to determine whether MULE insertion sites are within or close to genes.
4.5.3 Determination of Gene Expression Levels
Plant tissues were collected in the field and immediately placed in liquid nitrogen.
Thereafter the tissues were stored in -80 ºC freezer prior to RNA extraction. Total RNA was
extracted from immature maize kernels and young leaves using the TRIzol Reagent (Life
Technologies, Carlsbad, CA, USA). Specifically, tissues were ground in liquid nitrogen and
transferred to RNase-free tubes containing 1 mL TRIzol Reagent. After incubating the
homogenized sample for 5 minutes at room temperature, 0.2 mL of chloroform was added to
each sample. The mixture was centrifuged at 14,000 rpm for 15 minutes at 4 °C and the
colorless upper aqueous phase was transferred to a new tube, to which 0.5 mL isopropanol
was added to precipitate the RNA. Centrifugation was conducted to pellet the RNA followed
by washing with 75% ethanol. The RNA samples were treated with RNase-free DNase
(Qiagen, Hilden, Germany) and run on a 1% agarose gel to monitor the integrity.
Complementary DNA (cDNA) was synthesized using the GoScript Reverse Transcription
System (Promega, Madison, WI, USA). The expression of the actin gene was used to
standardize the input volume of synthesized cDNA for all the samples. Products of the actin
and target genes were amplified through an initial denaturing step at 94 °C for 2 min,
followed by different cycles (based on different genes) of 94 °C for 30 sec, 58 °C for 30 sec,
and 72 °C for 30 sec. Equal volume of PCR products were run on 1% agarose gel. To
compare the expression levels, intensity values of the amplified fragments on the agarose gel
were measured using the Image Lab software for the Gel Doc EZ Imager (Bio-Rad
Laboratories, Hercules, CA USA) and were evaluated using the student t-test. If the

162

difference of expression level between the two alleles (with or without MULE insertion) is
significant (p<0.05), it was considered the gene expression is enhanced or suppressed.
4.5.4 Detection of MULE Insertions in the B73 Maize Genome
The maize MULE library was constructed and maintained by the Jiang lab at Michigan
State University. The left-most 300 nucleotides (nt) of each MULE element (individual
length >300 bp) and the entire sequence of those elements with smaller size (≤300 nt) were
used to mask the B73 maize genome (RefGen_v2, www.maizegdb.org) using the
RepeatMasker program (www.repeatmasker.org). Masked regions with less than 50 nt
truncations at the external ends of MULE TIRs were retained for further analysis. The
coordinates of genomic features (genes, exons, introns) were based on the RefGen_v2
annotation of the filtered gene set of the B73 genome (www.maizegdb.org). For genes with
multiple transcript isoforms, only the first one of each was used in the analysis. If there was
overlap between the coordinates of the terminal sequences of MULE TIRs and exons, the
MULE element was considered to be inserted in the exon. Two TIRs were considered as one
insertion event if they satisfied the following criteria: 1) the distance between two TIRs was
less than 5 kb; 2) two TIRs were in inverted orientation with external ends outwards, as that
in a normal element; 3) they shared at least 75% identity over their TIR sequences. TIRs that
did not meet these criteria were considered as independent insertion event for each TIR.
Similar analysis was done for MULE insertions in the introns and 1 kb flanking sequences of
genes.

163

REFERENCES

164

REFERENCES

Alrefai R, Orozco B, Rocheford T (1994) Detection and sequencing of the transposable
element ILS-1 in the Illinois Long-Term Selection maize strains. Plant Physiology 106:
803-804
Bennetzen JL, Swanson J, Taylor WC, Freeling M (1984) DNA insertion in the 1st intron
of maize Adh1 affects message levels: Cloning of progenitor and mutant Adh1 alleles.
Proc. Natl. Acad. Sci. USA 81: 4125-4128
Blauth SL, Kim KN, Klucinec J, Shannon JC, Thompson D, Guiltinan M (2002)
Identification of Mutator insertional mutants of starch-branching enzyme 1 (sbe1) in
Zea mays L. Plant Molecular Biology 48: 287-297
Blauth SL, Yao Y, Klucinec JD, Shannon JC, Thompson DB, Guilitinan MJ (2001)
Identification of Mutator insertional mutants of starch-branching enzyme 2a in corn.
Plant Physiology 125: 1396-1405
Cossegal M, Chambrier P, Mbelo S, Balzergue S, Martin-Magniette ML, Moing A,
Deborde C, Guyon V, Perez P, Rogowsky P (2008) Transcriptional and metabolic
adjustments in ADP-glucose pyrophosphorylase-deficient bt2 maize kernels. Plant
Physiology 146: 1553-1570
Diao XM, Lisch D (2006) Mutator transposon in maize and MULEs in the plant genome.
Acta Genetica Sinica 33: 477-487
Dudley JW (2007) From means to QTL: The Illinois long-term selection experiment as a
case study in quantitative genetics. Crop Science 47: S20-S31
Dudley JW, Dijkhuizen A, Paul C, Coates ST, Rocheford TR (2004) Effects of random
mating on marker-QTL associations in the cross of the Illinois High Protein x Illinois
Low Protein maize strains. Crop Science 44: 1419-1428
Dudley JW, Lambert RJ (1992) 90-generations of selection for oil and protein in maize.
Maydica 37: 81-87
Feschotte C (2008) Transposable elements and the evolution of regulatory networks. Nature
Reviews Genetics 9: 397-405

165

Feschotte C, Pritham EJ (2007) DNA transposons and the evolution of eukaryotic genomes.
Annual Review of Genetics 41: 331-368
Goldman IL, Rocheford TR, Dudley JW (1993) Quantitative trait loci influencing protein
and starch concentration in the Illinois Long-Term Selection maize strains.
Theoretical and Applied Genetics 87: 217-224
Hanada K, Vallejo V, Nobuta K, Slotkin RK, Lisch D, Meyers BC, Shiu SH, Jiang N
(2009) The functional role of Pack-MULEs in rice inferred from purifying selection
and expression profile. Plant Cell 21: 25-38
Hollister JD, Gaut BS (2009) Epigenetic silencing of transposable elements: A trade-off
between reduced transposition and deleterious effects on neighboring gene expression.
Genome Research 19: 1419-1428
Jiang N, Bao ZR, Zhang XY, Eddy SR, Wessler SR (2004) Pack-MULE transposable
elements mediate gene evolution in plants. Nature 431: 569-573
Jiang N, Ferguson AA, Slotkin RK, Lisch D (2011) Pack-Mutator-like transposable
elements (Pack-MULEs) induce directional modification of genes through biased
insertion and DNA acquisition. Proc. Natl. Acad. Sci. USA 108: 1537-1542
Jiao YL, Deng XW (2007) A genome-wide transcriptional activity survey of rice
transposable element-related genes. Genome Biology 8: R28 doi:10.1186/gb-2007-82-r28
Lisch D (2002) Mutator transposons. Trends in Plant Science 7: 498-504
Lisch D, Jiang N (2009) Mutator and MULE transposons. In Bennetzen JL,Hake S, eds,
Mazie Handbook, Vol II. Springer Science + Business Media LLC, pp 277-306
Lisch DR, Freeling M, Langham RJ, Choy MY (2001) Mutator transposase is widespread
in the grasses. Plant Physiology 125: 1293-1303
Liu SZ, Yeh CT, Ji TM, Ying K, Wu HY, Tang HM, Fu Y, Nettleton D, Schnable PS
(2009) Mu transposon insertion sites and meiotic recombination events co-localize
with epigenetic marks for open chromatin across the maize genome. PLoS Genetics 5:
e1000733 doi:10.1371/journal.pgen.1000733
Martinez G, Slotkin RK (2012) Developmental relaxation of transposable element silencing
in plants: Functional or byproduct? Current Opinion in Plant Biology 15: 496-502
166

Moose SP, Dudley JW, Rocheford TR (2004) Maize selection passes the century mark: A
unique resource for 21st century genomics. Trends in Plant Science 9: 358-364
Naito K, Zhang F, Tsukiyama T, Saito H, Hancock CN, Richardson AO, Okumoto Y,
Tanisaka T, Wessler SR (2009) Unexpected consequences of a sudden and massive
transposon amplification on rice gene expression. Nature 461: 1130-1134
Robertson DS (1978) Characterization of a mutator system in maize. Mutation Research 51:
21-28
Schnable PS, Ware D, Fulton RS, Stein JC, Wei FS, Pasternak S, Liang CZ, Zhang JW,
Fulton L, Graves TA, et al. (2009) The B73 maize genome: Complexity, diversity,
and dynamics. Science 326: 1112-1115
Stupar RM, Gardiner JM, Oldre AG, Haun WJ, Chandler VL, Springer NM (2008)
Gene expression analyses in maize inbreds and hybrids with varying levels of
heterosis. BMC Plant Biology 8: 33 doi:10.1186/1471-2229-8-33
Van den Broeck D, Maes T, Sauer M, Zethof J, De Keukeleire P, D'Hauw M, Van
Montagu M, Gerats T (1998) Transposon display identifies individual transposable
elements in high copy number lines. Plant Journal 13: 121-129
Wassom JJ, Wong JC, Martinez E, King JJ, DeBaene J, Hotchkiss JR, Mikkilineni V,
Bohn MO, Rocheford TR (2008) QTL associated with maize kernel oil, protein, and
starch concentrations; kernel mass; and grain yield in Illinois high oil x B73
backcross-derived lines. Crop Science 48: 243-252

167

CHAPTER 5

Conclusions and Perspectives

168

For most organisms, TEs are an integral part of the genome; as a consequence, the
activity of TEs not only contributes to the success of themselves, but also the evolution of the
host genome. In this dissertation, I studied the amplification of MULEs and their interaction
with their genomes. My study covers the intrinsic features that control the amplification of
TEs – the activity of transposase (and the modification of such activity) as well as external
factors that determine the retention of TEs. These factors include how the host genome limits
the abundance of MULEs through deletion and mutation, how MULEs interact with other
TEs, and how MULE insertions are selected by humans. The findings described in this
dissertation facilitate the understanding of MULE evolution, and the transposition system
established provides the foundation for further studies of MULE transposition mechanisms as
well as how they acquire gene and/or gene fragments.
5.1 Differential Indel Rate between LTR Retrotransposons and Coding-MULEs in
Maize
In Chapter 2, mechanisms underlying differential abundance of MULEs in maize and
rice were investigated, where one mechanism is the accelerated indel rate in maize.
Interestingly, MULEs seem to be subjected to more frequent indels than LTR
retrotransposons (specifically Copia-like LTR retrotransposons) in maize. This may be due to
the differences in target site preference between LTR retrotransposons and MULEs. It is well
known that LTR retrotransposons are mostly located in pericentromeric heterochromatin.
Although some Copia-like elements were found to prefer gene-rich regions, they actually
inserted into the heterochromatic regions near genes in maize (Liu et al., 2007). In contrast,
MULEs preferentially target low-copy euchromatic regions, especially sequences in close
proximity of genes, which has been demonstrated by previous studies as well as the findings
in this dissertation (Dietrich et al., 2002; Liu et al., 2009; Jiang et al., 2011). Hence, the
169

different properties associated with heterochromatic and euchromatic regions, such as lower
recombination rate of heterochromatic regions, may contribute to the lower indel rate of LTR
retrotransposons compared with that of MULEs in maize.
Another possibility is the different activities between LTR retrotransposons and MULEs
in maize. Successful amplification of retrotransposons makes them the largest mass of the
B73 genome (>75%) (Schnable et al., 2009). Detailed sequence analysis of LTR
retrotransposons in gene-free regions revealed two peaks of amplifications, around 1.5-2
million year ago (mya) and within the last 500,000 years (Liu et al., 2007). In addition,
expression analysis based on EST databases revealed higher transcriptional activity of LTR
retrotransposons compared to other TE families (Vicient, 2010). Another global gene
expression analysis in maize found that some retrotransposon ESTs were up-regulated more
than 10-fold in the shoot apical meristem relative to that in seedlings (Ohtsu et al., 2007).
Previous studies showed accelerated evolution of genes with no transcriptional activity
(Hastings, 1996; Zou et al., 2009). Hence, the recent amplification and transcriptional activity
of LTR retrotransposons may contribute to the low indel rate compared to that of codingMULEs, which only have few elements with expression evidence.
The third possibility is the different transposition strategies between LTR
retrotransposons and MULEs. As mentioned before, LTR retrotransposons transpose through
an RNA intermediate, which is reverse transcribed into cDNA and becomes integrated at a
new genomic locus. This mode of transposition will not result in double strand breaks at the
locus of the original copy because the element does not excise. In contrast, DNA transposons,
including MULEs, transpose through a “cut-and-paste” mechanism, which requires the
excision of the elements and generates double strand breaks at the original loci. Previous
studies revealed that transcription slippage during the gap repair process of the double strand
170

breaks contributed to the instability of repeat tracts (e.g., deletions) in yeast (Jankowski et al.,
2000). This phenomenon was also observed in maize by the presence of deletion derivatives
of MuDR (Lisch et al., 1999). Hence, it is conceivable that MULEs contain more indels
because of the inefficient repair of the double strand breaks created following their excision.
In contrast, LTR retrotranspons do not excise, therefore, are void of defects generated during
double strand gap repair.
Of course, the above hypotheses are not mutually exclusive. The genomic niche where
diverse TE families co-exist is not static. Hence, to further elucidate this phenomenon,
analysis of other TE families may be helpful.
5.2 Maintenance of Low Activity of Wild-Type Transposases May be a Tactic for TE
Persistence
In this dissertation, the wild-type transposase of the rice MULE Os3378 only exhibited
limited activity in yeast. Sequence and structural modifications of the transposase resulted in
enhanced activity, suggesting the potential of the element to be highly active and
maintenance of low activity of the wild type may be beneficial for its survival in the rice
genome. A similar phenomenon has been seen for transposases from other TEs, where minor
manipulations of the transposase sequence resulted in increased activity. For example,
mutation of the serine at position 129 to alanine of the Drosophila P-element transposase led
to two-fold elevation of activity compared with the wild-type transposase (Beall et al., 2002).
In an attempt to generate hyperactive transposase for mammalian applications, Yusa et al.
(2011) conducted site-directed mutagenesis of the piggyBac transposase and found 18
mutants exhibited enhanced activity (Yusa et al., 2011). These 18 mutants are comprised of
one or two amino acid substitutions in an individual transposase protein. It is known that
most TEs are under epigenetic control of the host. When copy number increases through
171

active transposition of a TE, it likely triggers the host defense system, which will result in
tight control of the TE. Thus, maintenance of low activity may render the TE less pressure
from host surveillance system, such as RNA interference.
5.3 A System for Studying Transposition Mechanism of MULEs
The successful transposition of the rice MULE (Os3378) in yeast provides the possibility
of studying MULE transposition in a system that is easy to handle. As shown by previous
studies, the MULEs are a very diverse family, which consists of elements with varied
sequence compositions (Yu et al., 2000; Lisch and Jiang, 2009; Ferguson and Jiang, 2012).
The canonical elements contain one pair of long TIRs (100-500 bp) at the ends of elements,
which is one of the features (such as TSDs and transposase) that distinguish MULEs from
other TE families. Subsequent studies discovered MULEs whose terminal sequences did not
share high similarity, which were referred to as non-TIR MULEs (Yu et al., 2000). In
addition, Ferguson and Jiang (2012) found a special group of MULEs with multiple long
TIRs in several plant species. It is known that TIRs contain sequences that transposases
recognize and bind to during the transposition process. Nevertheless, it is not known how
MULE transposases deal with such diverse terminal structures/sequences. Hence, it will be
interesting to test whether non-TIR MULEs can be mobilized and whether MULEs with
multiple TIRs are more competent in transposition than MULEs with one pair of TIRs.
Additionally, the mechanisms of sequence acquisition by Pack-MULEs may be
investigated using the yeast system. The finding that retention of single terminal sequence
occurred after the excision of the Os3378 element already showed a potential way for the
formation of Pack-MULEs (see Chapter 3). Again, it is not known whether the long TIRs or
multiple TIRs play any role in the acquisition process. In rice, the average copy number of
Pack-MULEs is three while the one Pack-MULE family with tandem TIRs in tomato has 13
172

copies, suggesting that the tandem TIRs may render the element more competent in
amplification (Jiang et al., 2004; Ferguson and Jiang, 2012). While testing the formation of
Pack-MULEs using MULEs with one pair of TIRs, it would also be interesting to use
MULEs with multiple TIRs.
5.4 The Evolutionary Origin of Co-segregating MULE Insertions Associated with
Altered Gene Expression
As determined from RT-PCR analysis, 15 out of 55 genes exhibited differential
expression levels between alleles with and without adjacent co-segregating MULE insertions,
implying they may be involved in the changes of kernel protein content. Since this selection
occurred during the past 100 years, it is interesting to know when these MULE insertions
were selected into the high or low protein maize strains. The co-segregating MULE insertions
may be derived from three sources: 1) existing insertion polymorphisms or heterozygosity
that were present prior to the selection; 2) additional insertions from other maize varieties that
were introduced to the population during selection due to cross-pollination; 3) new
transpositions that occurred during selection. If an insertion is derived from a new
transposition, it should only be present in this population. If it is from other varieties, it
should be present in other maize cultivars. Indeed, some but not all of the co-segregating
MULE insertions are indeed observed in the B73 maize genome, suggesting they either
represent ancient polymorphisms or were derived from cross-hybridization. For this study, a
wide collection of maize varieties, such as the 25 inbred parents used in generating the
Nested Association Mapping (NAM) population (McMullen et al., 2009), may be used to
determine the relative insertion time frame based on the presence and absence information. In
the case that some MULE insertions may be lost during the domestication process, it will
informative to include some teosinte species/subspecies that are closely related to
173

domesticated maize, i.e., Z. mays ssp. mexicana, Z. mays ssp. huehuetenangensis, and Z.
mays ssp. parviglumis.

174

REFERENCES

175

REFERENCES

Beall EL, Mahoney MB, Rio DC (2002) Identification and analysis of a hyperactive mutant
form of Drosophila P-element transposase. Genetics 162: 217-227
Dietrich CR, Cui F, Packila ML, Li J, Ashlock DA, Nikolau BJ, Schnable PS (2002)
Maize Mu transposons are targeted to the 5 ' untranslated region of the gl8 gene and
sequences flanking Mu target-site duplications exhibit nonrandom nucleotide
composition throughout the genome. Genetics 160: 697-716
Ferguson AA, Jiang N (2012) Mutator-like elements with multiple long terminal inverted
repeats in plants. Comparative and Functional Genomics 2012: 695827
doi:10.1155/2012/695827
Hastings KEM (1996) Strong evolutionary conservation of broadly expressed protein
isoforms in the troponin I gene family and other vertebrate gene families. Journal of
Molecular Evolution 42: 631-640
Jankowski C, Nasar F, Nag DK (2000) Meiotic instability of CAG repeat tracts occurs by
double-strand break repair in yeast. Proc. Natl. Acad. Sci. USA 97: 2134-2139
Jiang N, Bao ZR, Zhang XY, Eddy SR, Wessler SR (2004) Pack-MULE transposable
elements mediate gene evolution in plants. Nature 431: 569-573
Jiang N, Ferguson AA, Slotkin RK, Lisch D (2011) Pack-Mutator-like transposable
elements (Pack-MULEs) induce directional modification of genes through biased
insertion and DNA acquisition. Proc. Natl. Acad. Sci. USA 108: 1537-1542
Lisch D, Girard L, Donlin M, Freeling M (1999) Functional analysis of deletion
derivatives of the maize transposon MuDR delineates roles for the MURA and MURB
proteins. Genetics 151: 331-341
Lisch D, Jiang N (2009) Mutator and MULE transposons. In Bennetzen JL,Hake S, eds,
Mazie Handbook, Vol II. Springer Science + Business Media LLC, pp 277-306
Liu RY, Vitte C, Ma JX, Mahama AA, Dhliwayo T, Lee M, Bennetzen JL (2007) A
GeneTrek analysis of the maize genome. Proc. Natl. Acad. Sci. USA 104: 1184411849

176

Liu SZ, Yeh CT, Ji TM, Ying K, Wu HY, Tang HM, Fu Y, Nettleton D, Schnable PS
(2009) Mu transposon insertion sites and meiotic recombination events co-localize
with epigenetic marks for open chromatin across the maize genome. PLoS Genetics 5:
e1000733 doi:10.1371/journal.pgen.1000733
McMullen MD, Kresovich S, Villeda HS, Bradbury P, Li HH, Sun Q, Flint-Garcia S,
Thornsberry J, Acharya C, Bottoms C, et al. (2009) Genetic properties of the
maize nested association mapping population. Science 325: 737-740
Ohtsu K, Smith MB, Emrich SJ, Borsuk LA, Zhou RL, Chen TL, Zhang XL,
Timmermans MCP, Beck J, Buckner B, et al. (2007) Global gene expression
analysis of the shoot apical meristem of maize (Zea mays L.). Plant Journal 52: 391404
Schnable PS, Ware D, Fulton RS, Stein JC, Wei FS, Pasternak S, Liang CZ, Zhang JW,
Fulton L, Graves TA, et al. (2009) The B73 maize genome: Complexity, diversity,
and dynamics. Science 326: 1112-1115
Vicient CM (2010) Transcriptional activity of transposable elements in maize. BMC
Genomics 11: 601 doi:10.1186/1471-2164-11-601
Yu ZH, Wright SI, Bureau TE (2000) Mutator-like elements in Arabidopsis thaliana:
Structure, diversity and evolution. Genetics 156: 2019-2031
Yusa K, Zhou LQ, Li MA, Bradley A, Craig NL (2011) A hyperactive piggyBac
transposase for mammalian applications. Proc. Natl. Acad. Sci. USA 108: 1531-1536
Zou C, Lehti-Shiu MD, Thibaud-Nissen F, Prakash T, Buell CR, Shiu SH (2009)
Evolutionary and expression signatures of pseudogenes in Arabidopsis and rice. Plant
Physiology 151: 3-15

177