.; q-rwg‘

 

IIUIUHJIl”Ill!lllllllllllflllllllllllllHllllllllll

23 01028 1933

LIBRARY
Mlchlgan State
Universlty

 

 

 

 

This is to certify that the

dissertation entitled

Processing of a Mother-Cell-Specific Sigma
Factor During Development of Bacillus Subtilis

presented by
Sijie Lu

has been accepted towards fulfillment
of the requirements for

Ph . D . degree in Biochemistry

if; 9—! k4; US

Major professor

Date 6/21/ ?§"—

MS U i: an Affirmative Action/Equal Opportunity Institution 0' 12771

 

 

PLACE N RETURN BOXto mmutbduckoutflun ywrrocud.
TO AVOID FINES Mum on or baton «to due.

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

MSU I. An Nflrmulm MINVEquaI Opportunlly lnetttwon
Wanna-m

m l.

 

PROCESSING OF A MOTHER-CELL-SPECIFIC SIGMA
FACTOR DURING DEVELOPMENT OF BACILLUS SUBTILIS

By

Sijie Lu

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Biochemistry

1994

ABSTRACT

PROCESSING OF A MOTHER-CELL-SPECIFIC SIGMA
FACTOR DURING DEVELOPMENT OF BACILLUS SUBTILIS

By

Sijie Lu

Upon starvation, the gram-positive bacterium Bacillus subtilis undergoes
sporulation, which results in the formation of a dormant cell, the Spore. The first easily
observed morphological change during sporulation is the formation of an asymmetric
septum that divides the cell into two compartments, the mother cell and the forespore.
Gene expression during the sporulation process is regulated, in part, through the sequential
synthesis and activation of a cascade of sigma factors, each of which confers on core RNA
polymerase the ability to transcribe a set of genes during a certain period and in a particular
location (i.e., the mother cell or the forespore).

ex is a mother-cell—specific sigma factor that directs transcription of genes encoding
proteins that are involved in the synthesis of the spore cortex and coat. 0K was found to be
made as an inactive precursor, pro- oK, beginning at 3 hours into sporulation. Pro-0K is
processed to the active form an hour later by removal of 20 amino acids from its N-

terminus. Interestingly, processing of pro-oK is coupled to forespore development.

To extend the search for genes that might be involved in pro—<1:K processing, pro-aK
was overproduced from a plasmid in mutants that normally fail to make pro-0K. spoIIID
was found to be required for efficient processing of pro-0K. Surprisingly, overproducing
pro-c3K in forespore mutants and spa! VF mutants partially restored oK—dependent gene
expression by allowing accumulation of a small amount of 0K. Hence, overproducing pro-
oK uncouples (xx-dependent, mother-cell gene expression from its normal dependence on
intercompartmental communication and on SpoIVF proteins.

SpoIVFB had been proposed to be either the protease that processes pro-aK or a
regulator of the processing event. To study the role of SpoIVFB in pro-oK processing,
SpoIVFB was coexpressed with sigK (encoding pro- d‘) in growing B. subtilis and E. coli
cells. SpoIVFB enhanced the accumulation of 0" from pro-<3K in the absence of other
sporulation-specific gene products.

The functions of the spolVF gene products are largely dispensable when pro-0K is
overproduced. Using chemical mutagenesis, suppressor mutants were isolated that restore
oK-dependent gene expression and sporulation in a spoIVF null mutant. Of the suppressor
mutants examined, all restored the accumulation of 01‘.

To further study the role of SpoIVFB in pro- oK processing, attempts were made to
express all or part of the SpoIVFB gene. The C—terminal 92 amino acids of SpoIVFB were
made as a fusion protein [SpoIVFB(C)] in E. coli and used to generate polyclonal
antibodies. Anti-SpoIVFB(C) antibodies failed to detect SpoIVFB in sporulating cells.
Attempts to enrich for SpoIVFB were made by isolating sporelets from sporulating B .
subtilis cells. However, the anti-SpoIVFB(C) antibodies failed to detect SpoIVFB in an

extract of isolated sporelets. These results suggest that SpoIVFB is a low-abundance

protein.

To

Mimi, for her endless love and support.
My parents, who let me pursue my dream in this land.

My parents-in-law, who have given me the greatest gift in the world.

ACKNOWLEDGMENTS

I am very grateful to my advisor Dr. Lee Kroos for offering me an
opportunity to work in his laboratory. Lee is truly a scholar and a
gentleman. He showed me how to be a good scientist and a responsible
family man. I really appreciate his patience and careful guidance during
the past 5 years. I am very thankful for his painstaking efforts to improve
my ability in scientific writing, from which I will benefit tremendously in
my future career. Mimi and I would like to thank Lee, Mary, their sons
Mark and David for their friendship as well as sharing similar tastes of
Chinese cuisines.

I am very fortunate to have met and married Mimi here at MSU.
During the past 3 years, we shared joy and frustration together. Our love
grows stronger and stronger each day. Without her support, I could not
have been able to finish the long joumey of the graduate school.

I would like to thank the present and the past members of the lab for
their friendship and all kinds of help during my stay at MSU. Richard

Halberg, who taught me how to drive 'defensively' and shared wonderful

times during various meetings and being a very helpful colleague in the
adventure of understanding how the 'bugs' sporulate; Makda Fisseha, who
is very kind and careful in dealing with people and taught me how to pour
a decent sequencing gel and how to speak several life-saving words in
Ethiopian; Hiroshi Ichikawa, who is always polite and is interested in
talking about Japanese cultures with me during Friday afternoons; Janine
Brandner, whose laughter makes me feel that doing science is always fun;
Bin Zhang, whom I can always 'practice' my native language with and
enjoy sharing views about the present and the future of China; Tong Hao,
for being another Chinese in the lab; Monica, who put my name on a
warning sign as a cell killer, while still let me at large; Jamie, for showing
me the bright future of an American straight A student.

I also would like to thank people in this department who had
generously offered their equipments, reagents, and ideas in the course of
this study.

Finally, I would like to thank members of my committee, Drs.
Laurie Kaguni, Steve Triezenberg, Zach Burton, Wendy Champness, and

Mike Thomashow, for their help and advice.

vi

Table of Contents

Page
List of tables ......................................................................... xi
List of figures ....................................................................... xii
List of abbreviations and symbols ........................................... xv
Introduction .......................................................................... 1
Chapter 1. Literature Review
Morphological changes during sporulation ....................... 5
Sporulation-specific sigma factors ................................. 7
Activation of sporulation-specific sigma factors
appears to be coupled to morphogenesis .......................... 14
Activation of transcription factors in other systems .............. 18
Summary .............................................................. 20
Chapter 2. Processing of the mother-cell sigma factor, 01‘,
may depend on events occurring in the forespore during
Bacillus subtilis development.
A bs t r a ct ....................................................................... 22
Introduction ................................................................. 22
Materials and Methods ................................................... 22
Results
Andbodiesmpro-d‘detectpro-oKandel‘in
sporulating B. subtilis ............................................... 23
Levels of pro-oK and 0“ are developmentally regulated ......... 23
Mutations in many sporulation genes
block accumulation of 0" ............................................ 23
Processing of pro-(rK to ex is required to produce an
active sigma factor and is developmentally regulated ............ 24

vii

Discussion ...................................................................
Acknowledgements .......................................................

References ...................................................................

Chapter 3. Overproducing the Bacillus sublilis mother-cell sigma
factor precursor, pro-0K, uncouples eK-dependent gene expression
from dependence on intercompartmental communication.

Abstract .......................................................................
Introduction .................................................................

Materials and Methods ...................................................

Results
Overproducing pro-<3K does not interfere with
spoulation of wild-type B. subtilis ..................................
Overproducing pro-6K uncouples pro-c:K processing
andcotD-lacZ expression from forespore control .................
Overproducing pro-<3K rescues
sporulation of spa] VF mutants ......................................
Production of active GE is critical for pro-eK processing ........
Effects of overproducing pro-<3K
on gerE and com expression ........................................
spoIIID is required for efficient pro-(rK processing
and bof mutations bypass this requirement .......................

Discussion ...................................................................
Acknowledgements .......................................................
Chapter 4. SpoIVFB enhances 0K accumulation from pro-0K in the
absence of other sporulation-specific gene products during growth
of B. subtilis or E. coli.
Abstract .......................................................................
Introduction .................................................................
Materials and Methods ...................................................
Results
Coexpressing SpoIVFB and sigK during growth of
B. subtilis enhances aK-dependent gene expression ............

Coexpressing sigK and SpoIVFB in E. coli
produces 0K activity ..................................................

viii

25
26
26

28
29
31

36

47
50

52
53
57

62
63
65

75
81

Discussion ....................................................................

85

Chapter 5. Isolation of suppressor mutants that bypass the requirement

for the spoIVF gene products in processing pro-0K.

A bst ra ct .......................................................................
Introduction .................................................................
Materials and Methods ...................................................
Results
Determination of the optimal nitrosoguanidine
concentration for mutagenesis ......................................
Isolation and initial charaterization of sop mutants ...............
Purification and further charaterization of the sap mutants ......
sop], sop2, and 50123 I appear not to be allelic to sigK ..........
D is c u s s i o n ....................................................................

Chapter 6. Studies on the role of SpoIVFB in pro-aK processing.

A bst ra ct ........................................................................
Introduction ..................................................................
Materials and Methods ....................................................
Results

Overproduction of the C-terminal 92 amino acids

of SpoIVFB in E. coli ...............................................

Characterization of antibodies made against SpoIVFB(C) .......

Isolation of sporelets to enrich for

forespore-associated proteins ........................................

The SpoIVFB(C) does not possess pro-oK

processing activity in vitro ..........................................
Discussion ....................................................................

Summary and Perspectives .......................................................

Appendix. A forespore checkpoint for mother cell gene expression
during development in B. subtilis.

Summary .......................................................................

Introduction ...................................................................

ix

90
91
92

96

103
106

108

112
113
116

123
125

128

129
129

132

137
137

Results
Mutations that bypass the dependence of
cotA-lacZ on spoIIIG ..................................................
Map locations of bof mutations .......................................
bof mutaions restore the expression of other members
of the COM regulon in spoil/G cells but not the
expression of a forespore gene .......................................
bof mutations advance the blockage
of spa!!! G cells to stage 5 .............................................
bof mutations bypass dependence on
other stage 3 and 4 genes ..............................................
bof mutations restore processing of pro—(rK
in spoil] G mutant cells ................................................
Deletion of DNA encoding the 0K pro-amino acid
sequence restores cotA-lacZ expression

in spollIG and spoIVF mutant cells .................................
Discussion .....................................................................
Experimental procedures ..................................................
Acknowledgments ...........................................................
References .....................................................................
Bibliography ...........................................................................

138
138
139
139
140
141

142
142
145
145
147
149

List of Tables

Table Page
3. l Bacillus subtilis strains ......................................................... 32
3 . 2 Ability of Bacillus subtilis strains to form heat-resistant spores
in the absence and presence of pro-oK overproduction ..................... 37
3 . 3 Summary of cotD-lacZ, gerE-lacZ, and cotA-lacZ expression
in strains overproducing pro-aK ............................................... 51
4. 1 Bacterial strains .................................................................. 66
4 . 2 oK-dependent gene expression of B. subtilis strains coexpressing
sigK and spoIVFB or the entire spoI VF operon ............................. 76
5 . 1 Ability of sop mutants to form heat-resistant spores ......................... 102

5 . 2 Cotransformation efficiency of spoIVCB, spoIIIC, or sop
mutations with aroD + ............................................................ 107

Appendix

Table 1. Effect of bofB8 and spoIVCBAI 9 on spore formation,
heat-resistance, and germination ........................................ 141

xi

List of Figures

Figure
l . l Morphological stages during B. subtilis sporulation ......................... 6
l . Sporulation-specific sigma factors .............................................. 8
1 . 3 Activation of OK involves multilevel regulation ................................ 13
2 . 1 Production of pro-0K in E. coli .................................................. 23
2 . 2 Characterization of the anti-pro—crK antiserum by Western blot analysis... 23
2 . 3 Pro-<3K and 0K in sporulating B. subtilis ........................................ 24
2 . 4 Pro-0K and 0K in B. subtilis sporulation mutants harvested 6 hr

after the the end of exponential growth in D8 medium ........................ 24
2 . 5 Effect of producing pro-cK from a plasmid during growth

and sporulation of B. subtilis ..................................................... 25
3 . l Overproduction of pro-0K does not interfere with OK accumulation

or cotD-lacZ expression in wild-type cells ...................................... 39
3 . 2 Overproductionof pro-ctK uncouples pro-<3K processing and

cotD-lacZ expression from forespore control ................................... 42
3 . 3 Levels of pro-<5K and 0K in mutants overproducin g pro-oK

during sporulation .................................................................. 45
3 . 4 Rescue of OK accumulation and cotD-lacZ expression in

spa! VF mutants overproducing pro-0K .......................................... 49
3 . 5 A bofA mutation bypasses the requirement for spoIlID

in pro-<3K processing ............................................................... 55
4 . 1 Structures of integrative plasmids in B. subtilis ................................ 71
4 . 2 Structure of pSL17, a multicopy plasmid that has both

spoIVFB and sigK fused to the PM”1c promoter ................................ 73

xii

 

Page

4 . 3 Coexpressing spoIVFB and sigK during growth of B. subtilis
enhances oK-dependent gerE-lacZ expression and production of
a polypeptide that comigrates with OK ........................................... 79

4 . 4 Coexpressing sigK and spoIVFB in E. coli generates GK activity.
(A) Levels of pro-oK and 0K in E. coli strains containing different
plasmids. (B) Run-off transcripts from templates containing
the cotD or the gerE promoter .................................................... 83

5 . 1 Cell killing by NTG. (A) Number of viable BSLSl (spoIVFAAB::cat)
cells versus the concentration of NTG. (B) Killing percentage versus
the dosage of NTG ................................................................ 98

5 . 2 sop mutants restore gerE-lacZ expression and 0K accumulation ............. 101

5 . 3 sop mutants generated by DNA transformation restore gerE-lacZ
expression and 0K accumulation ................................................. 105

6 . l (A) Dedeuced amino acid sequence of SpoIVFB and potential
membrane-spanning segments identified according to the
hydropathy analysis of Kyte and Doolittle using a window of 21 residues.
(B) T0pological model for the insertion of SpoIVFB into the outer
forespore membrane ............................................................... 115

6 . 2 Structure of the T7 RNA polymerase-dependent expression vector
pET16b. Nucleotide sequence of the cloning/expression region is shown. 117

6.3 Production of SpoIVFB(C) in E. coli ............................................ 124

6 . 4 Characterization of anti-SpoIVFB(C) antibodies. (A) The antibodies
sensitively detect gel-purified SpoIVFB(C). (B) Western blot analysis

SpoIVFB(C) after Factor Xa digestion ........................................... 127

Appendix
Figure 1. Effect of bof Mutations on cotA-lacZ

Expression in spa!!! G Mutant Cells .................................... 138
Figure 2. Mapping of bofA and bofB Mutations ................................. 139
Figure 3. Effect of bofA3 and bofB8 on Expression of cotD-lacZ and

gerE - la cZ ................................................................... 140
Figure 4. Effect of bofA3 and bofBS on the Expression of the

Forespore—specifc Gene sspB ............................................ 140
Figure 5. Electron Micrograph of a spoIIIG and a spollIG bofB8

Mutant Sporangium ........................................................ 141

xiii

Figure 6. Effect of bofA3 and bofB8 on com-Directed B-Galactosidase
Synthesis in Stage 3 and 4 Mutant Cells Suspendend
in SM Medium .............................................................. 142

Figure 7. Effect of bofA3 and bofBB on Pigment Formation and on

cotA-Directed B-Galactosidase Synthesis in Colonies of
Stage 3 and 4 Mutant Cells ................................................ 143

Figure 8. Immunoblot Analysis of Pro-oK and 0K in bof Mutants ............... 143
Figure 9. Effect of a Deletion of the Pro—Amino Acid Coding Sequence

of OK on com-Directed B-Galactosidase Synthesis in Mutant

and Wild-type Cells ........................................................ 144

Figure 10. A Model for the Coupling of Mother Cell to
Forespore Gene Expression .............................................. 144

xiv

BSA

List of Abbreviations

XV

Adenosine-5'-diphosphate
Adenosine-5'-triphosphate

basc pair

bypass of forespore

bovine serum albumin
cytosine-5'-triphosphate

dalton

deoxyribonucleic acid

Difco sporulation

dithiothreitol
(ethylenedinitriol)tetraacetic acid
hydrochloric acid
isopropyl-B-D-thiogalactopyranoside
kilobase pair

kilodalton

Luria-Bertani

lactate glutamate minimal agar
nanogram

optical density
O-nitrophenol-B—galactoside

PAGE
PMSF

SDS
sop

ug

X-gal

xvi

polyacrylamide gel electrophoresis
phenylrnethylsulfonyl fluoride
ribonucleic acid

sodium dodecylsulfate

suppressor of processing defect
rnicrogram

microliter

5-bromo-4-chloro-3-indoyl-B—D-
galactopyranoside

Introduction

Upon starvation, the gram-positive bacterium Bacillus subtilis undergoes
sporulation, which involves a series of morphological changes, and results in the formation
of a dormant cell, the spore. The first easily observed morphological change is the
formation of an asymmetric septum that divides the cell into two unequal compartments, the
larger mother cell and the smaller forespore. Each compartment receives a copy of the
genome after the last round of DNA replication, but each follows a different pathway of
development. Gene expression is regulated both temporally and spatially, in part, through
the activation of a cascade of sigma factors, each of which confers on core RNA
polymerase the ability to transcribe a set of genes during a certain period and in one of the
two compartments. One of the sigma factors in the cascade is the mother-cell-specific
sigma factor, 61‘. oK-containing RNA polymerase transcribes genes whose products are
involved in spore cortex and coat synthesis.

Chapter 2 describes a study which demonstrates that ex is first synthesized as an
inactive precursor (pro- cK) 3 hours into sporulation and processed to the active form (0")
an hour later. Processing of pro- oK to 0“ is a developmentally regulated event that couples
oK-dependent mother-cell gene expression to forespore development that is under the
control of a forespore-specific sigma factor, 09. This work was published in the
Proceedings of the National Academy of Science USA . In collaboration with Richard
Losick’s lab at Harvard University, we further demonstrate, as described in the Appendix,

that mutants which uncouple oK-dependent gene expression from oG-dependent forespore

morphogenesis restore pro-0K processing, and that the spoIVF gene products play an

2

intimate role in governing the processing of pro-0K. This work was published in the
journal Cell. I was responsible for performing Western blot analysis to detect the level of
pro-0K and 0K in different bof mutants.

To further search for genes that might be involved in pro- oK processing, pro-0K
was overproduced from a multicopy plasmid in sporulation mutants. Chapter 3 describes a
study which demonstrates that spoIIID is needed for efficient processing of pro- cK, and
bof mutations bypass this requirement. Overproducing pro-<3K also bypasses the
requirement for oG-dependent forespore development in (IX-dependent gene expression by
allowing the accumulation of a small amount of OK. Additionally, overproducing pro-0K in
spoIVF mutants, including a null mutant, not only restored oK-dependent gene expression
partially, but also greatly enhanced the ability of these mutants to form heat-resistant
spores, suggesting that functions of the spoIVF gene products are largely dispensable
when pro- 0" is overproduced, and that a spoIVF-independent mechanism is responsible
for part of the restored oK-dependent gene expression. This work will be published in the

Journal of Bacteriology in July of 1994.

Chapter 4 describes a study in which SpoIVFB, the promoter-distal gene of the
two-cistron spoIVF operon, and sigK, which encodes pro-0K, were coexpressed in
growing B. subtilis and E. coli cells. The results show that SpoIVFB is capable of
enhancing the accumulation of OK from pro-0K in the absence of other sporulation-specific
gene products. A revised version of this chapter will be submitted to the Journal of
Bacteriology in the near future.

Chapter 5 describes an effort to isolate suppressor mutants that bypass the

requirement for spoIVF in sporulation as well as in eK-dependent gene expression when
pro-0K is made at its normal level. A preliminary study of some of these mutants indicates

that processing of pro-oK is restored in the absence of the spoIVF gene products.

3

Chapter 6 describes attempts to overproduce all or part of the SpoIVFB protein in
E. coli. A polypeptide including the C-terminal 92 amino acids of SpoIVFB was produced
as a fusion protein in large quantities and was used to make polyclonal antibodies. These

antibodies were used in attempts to detect SpoIVFB in sporulating B. subtilis cells.

Chapter 1

Literature Review

5

How gene expression is regulated temporally and spatially during development of
an organism is a difficult yet fundamental question in biology. The sporulation process of
the gram-positive bacterium, Bacillus subtilis, offers a relatively simple but excellent
system to study this question. When starved, B. subtilis undergoes a series of
morphological changes that lead to the formation of a dormant cell, a spore, that is able to
resist harsh environmental conditions (Losick et al., 1986).

Morphological changes during sporulation. Vegetative cells are defined as
stage 0 with respect to the sporulation process (Ryter, 1965). The first easily observed
morphological change during sporulation is the formation of an asymmetrically positioned
septum (defined as stage II) that divides the cell into two unequal compartments; the larger
one is called the mother cell and the smaller one is called the forespore (Figure 1.1). Each
compartment receives a copy of the chromosome after the last round of vegetative DNA
replication. The septum then migrates around the forespore, engulfs it, and eventually
pinches it off as a free protoplast in the mother cell (defined as stage III). A modified form
of cell wall, known as the cortex (W arth & Strorninger, 1972), is synthesized between the
two membranes of the forespore (defined as stage IV). At about the time of cortex
formation, more than a dozen proteins are made in the mother-cell compartment and
deposited around the forespore to form a multi-layered protein shell called the spore coat
(defined as stage V). The final period of spore development, termed maturation (defined as
stage VI), happens with no dramatic change in morphology, but during this stage the
properties of resistance, dormancy, and germinability appear in sequence (Dion &
Mandelatam, 1980; Jenkinson et al., 1980). The sporulation process culminates with lysis
of the mother cell and release of the mature spore (defined as stage VII). When conditions
are favorable, the spore can germinate and resume the vegetative growth.

Classical genetic studies have implicated about 50 genetic loci, designated spo, that

are involved in sporulation but not growth (Pi ggot & Coote, 1976). Such spo loci were

 

 

septum

MOIDOC-CO"

 

forespore

 

 

 

l

 

 

 

0.

 

 

 

l

 

 

apore cortex

 

 

 

 

 

 

spore coat

 

 

 

 

 

stage n

asymmetric aeptum
formation

stage III

engultment

stage IV

cortex formation

stage V

coat formation

Figure 1.1 Morphological stages during B. subtilis sporulation (reprinted from Kroos,

L. 1991 with permission).

7

named according to the stage at which a mutation in the locus blocked sporulation (e.g., a
spoII mutation would block morphogenesis beyond stage II, the stage of asymmetric
septum formation). Loci containing mutations that confer similar phenotypes but map to
different positions on the chromosome are further distinguished by assigning different
capital letters (e.g., spoIIA, spoIlB, etc.).

Sporulation-specific sigma factors. The morphological changes that result
in the formation of a dormant spore are driven by a carefully regulated program of gene
expression. Genes are expressed at the proper time and level, and in one of the two
compartments. The temporal and spatial regulation of gene expression is achieved, in part,
through the sequential synthesis and activation of a cascade of sporulation sigma factors
(Stragier & Losick, 1990; Losick & Stragier, 1992). A sigma factor is a subunit of the
prokaryotic RNA polymerase holoenzyme, which contains five subunits (agflfl'o). The
sigma factor confers on core RNA polymerase (azflli') the ability to recognize specific
promoters, usually by interaction with short sequences located at about -10 and -35 relative
to the transcriptional start site (Helmann 8; Chamberlin, 1988). So far, five
sporulation-specific sigma factors have been identified. They are 01*, 0'”, GB, 60, and 0“
(Figure 1.2).

0“. 0H is the product of the spoOH gene (Dubnau et al., 1988). a" is the earliest
acting sporulation-specific a factor. spoOH is weakly transcribed from a oA-dependent
promoter during the exponential phase of growth (Weir et al., 1991). 0A is the major
vegetative a factor. a" level remains low until the onset of sporulation, when all-dependent
genes begin to be expressed. The increase in a“ level does not seem to be due to an
increase in spoOH transcription, but rather due to an increase in the stability and/or

translation of the spoOH message (Healy et al., 1991). An important sporulation-specific

operon transcribed by 0“ RNA polymerase is spoIIA, which encodes 0F.

forespore

G G K mother cell

Figure 1.2 Sporulation-specific sigma factors. Order of action of the sigma factors is
indicated by the arrows. The double line represents the septum separating the mother-cell
and forespore compartment. Location of activity for each sigma factor is also shown

(reprinted from Kroos, L. and S. Cutting. 1993 with permission).

9

01’. 01" is encoded in the three-cistron spoIIA operon (Piggot et al., 1984;
Errington et al., 1985; Fort & Errington, 1985; Stragier, 1986; Sun et al., 1989).
Transcription of spolIA starts about 1 hr after the initiation of sporulation and is carried out
by aH RNA polymerase with activation by SpoOA phosphate (Burbulys et al., 1991).
SpoOA phosphate is a transcription factor that plays a key role in the transition from
vegetative growth to sporulation. SpoOA phosphate negatively regulates the activity of
Aer, a repressor of many stationary phase genes (Perego et al., 1988; Strauch et al.,
1990), and positively regulates the expression of several sporulation-specific genes (Perego
et al., 1991; Satola et al., 1992; York et al., 1992). The timing of spoIIA transcription
suggests that 017 is synthesized before the sporulation septum is formed. Nevertheless, 0F
activity is confined to the forespore as evidenced by the forespore-localized expression of
(IF-dependent lacZ fusions detected by immunoelectron microscopy with antibodies against
B-galactosidase (Margolis et al., 1991). Activation of OP is believed to be controlled by the
other two products of the spoIIA operon, SpoIIAA and SpoIIAB (Schmidt et al., 1990;
Margolis et al., 1991; Partridge et al., 1991). OF RNA polymerase transcribes spoIIIG,
which encodes 00, another sporulation-specific sigma factor.

GE. GE is encoded in the two—cistron spoIlG operon (Stragier et al., 1984; Jonas et
al., 1988; Stragier et al., 1988). Transcription of spoIIG depends on 0* RNA polymerase
(Kenney et al., 1988; Kenney et al., 1989). However, transcription of spolIG does not
begin until the onset of sporulation and binding of SpoOA phosphate in the spollG
promoter region activates transcription (Satola et al., 1991; Satola et al., 1992). The
timing of spoIIG transcription suggests that 013, like OP, is made before formation of the
sporulation septum. Since immunoelectron microscopy showed that a oE-dependent lacZ
fusion is only active in the mother-cell compartment, it appears that 09 RNA polymerase
activity is partitioned into the mother cell (Driks & Losick, 1991). An interesting finding is

10

that GE is first made as an inactive precm'sor, pro-05, with an extra 29 amino acids at the N-
terrninus, and activation of GE requires proteolytic removal of the pro-amino acid sequence
(LaBell et al., 1987). Processing of pro-0F- to 03 depends on SpoIIGA, the product of the
promoter proximal gene of the spoIIG operon (Jonas et al., 1988). SpoIIGA has been
suggested to be the protease that processes pro— 05, based on the finding that coexpressing
spoil GA and spoil GB (encoding pro- 03) enhances (IE-dependent gene expression during
growth of B. subtilis (Stragier et al., 1988). In addition, analysis of the deduced amino
acid sequence of SpoIIGA revealed some features resembling aspartic or serine proteases
(Masuda et al., 1990). However, processing of pro-05 during sporulation also depends on
0F (Stragier et al., 1988; Jonas & Haldenwang, 1989), suggesting the existence of an
intercompartmental communication event. OE RNA polymerase transcribes genes whose
products are required for engulfment, as well as the gene encoding 0K.

00. 00 is encoded by the spoIIIG gene (Masuda et al., 1988; Karmazyn-Campelli
et al., 1989; Sun et al., 1989). 00 RNA polymerase is only active in the forespore
compartment and is responsible for transcribing a variety of forespore genes, including
genes encoding the small acid-soluble proteins (SASPs) which bind to forespore
chromosomal DNA and protect it from hazardous conditions, such as UV irradiation
(Setlow, 1989).

Transcription of spoIIIG involves multilevel regulation. Since the spoIIlG gene
lies immediately downstream of the spa]! G operon, readthrough transcription by a" RNA
polymerase from the spoil G promoter generates spoIIIG mRNA early during sporulation
(Masada et al., 1988; Karmazyn-Campelli et al., 1989). However, this early transcription
is likely to be non-productive since a putative stem-loop structure between spoIIG and
spoIIIG may prevent translation of the spoIIIG message. Once 0F is activated in the

forespore compartment after asymmetric septum formation, 0” RNA polymerase can

11

transcribe spoIIIG from a promoter just upstream of the spoIIIG gene (Partridge et al.,
1991; Sun et al., 1991). Although 00 containing RNA polymerase is produced, it fails to
activate oG-dependent gene expression until the completion of en gulfment about an hour
later. This observation has led to speculation that 00 may be held inactive until completion
of engulfment triggers relief of the inhibition (Stragier, 1989; Stragier, 1992). Once
engulfment is finished, 00 RNA polymerase begins to transcribe its target genes, including
its own gene, using the promoter used previously by 0F RNA polymerase (Karmazyn-
Campelli et al., 1989).

0K. ex is encoded by the sigK gene. 0" is a mother-cell-specific sigma factor that
directs transcription of genes encoding proteins that are involved in spore cortex and coat
synthesis (Kroos etal., 1989; Zheng & Losick, 1990; Cutting et al., 1991a; Kroos, 1991;
Zheng et al., 1992). Generation of active 0K involves multilevel regulation during
sporulation (Stragier et al., 1989; Cutting et al., 1990; Lu et al., 1990; Oke & Losick,

1993) (Figure 1.3). First, a chromosomal rearrangement occurs, exclusively in the mother

cell, at 3 hrs into sporulation, joining two truncated genes, spoIVCB (encoding the
N-temrinal half of 0") and spoIIIC (encoding the C-terminal half of 0") together through a
site-specific recombination (Stragier etal., 1989) to form the composite sigK gene. The .
recombination event requires spoIVCA, which encodes a putative recombinase (Kunkel et
al., 1990; Sato et al., 1990; Popham & Stragier, 1992) , and spoIIID, which encodes a
small, DNA-binding protein (Halberg & Kroos, unpublished results; Kunkel et al., 1989;
Stragier et al., 1989). The SpoIIID protein may participate in the rearrangement directly,
and/or indirectly since SpoIIID stimulates spoIVCA transcription in vitro by 0‘3 RNA
polymerase (Halberg & Kroos, unpublished results). A second level of regulation in the
production of 0" involves transcription of the sigK gene. SpoIIID is required for the initial

transcription of sigK by 05 RNA polymerase (Halberg & Kroos, unpublished results;

12

Figure 1.3 Activation of OK involves multilevel regulation (adapted from Kroos, L. 1991
with permission). 013 RNA polymerase transcribes spoIVCA in the presence of the
SpoIIID protein, resulting in the production the putative recombinase, SpoIVCA.
SpoIVCA catalyzes recombination between sites (presented as thick vertical bars) in the
spoIVCB and spoIIlC genes, excising the intervening DNA as a circle and generating the
sigK gene. sigK is first transcribed by GE RNA polymerase in the presence of SpoIIID.
The primary translation product of sigK is a proprotein, pro-0K. Production of active 0"
involves a proteolytic processing step that depends on not only mother-cell-specific genes

(bofA and spoIVF) but also forespore-specific genes (spoIII G and spoIVB).

 

13

spoIVCB SpoIVCA spomc
" + m 11 1 ~40 *0 r—‘m .

I —'

4-?
m

901110 I’ \

 

 

 

aE RNA polymerase

 

 

sigK

P+m

 

 

 

 

 

 

 

 

sigK

Forespore

‘ .polVF "mm SpoltlA

“‘“ -BtA SpolltE

m Spolth (0°)
SpolVB
com com core RNA polymerase”
..... ~““\1 a“ RNA polymerasel

 

C

V

cortex genes

14

Kunkel et al., 1988). SpoHID also greatly stimulates later transcription of sigK by ex
RNA polymerase (Kroos et al., 1989). A third level of regulation is post-translational.
LikeaB,oKismadeasaninactiveprecursor,inthiscasewith20extraaminoacidsatitsN—
terminus. Activation of 0" requires removal of the pro-amino acid sequence (Kroos et al.,
1989; Lu et al., 1990).

Activation of sporulation-specific sigma factors appears to be
coupled to morphogenesis. Each sporulation-specific sigma factor appears to be held
inactive initially by one of several different mechanisms. Activation of each sigma factor

seems to be tied up to the attainment of certain physiological or morphological stage during

sporulation.

Activation of 0H and initiation of sporulation. Upon induction of
sporulation, transcription of the spoOH gene (encoding a") does not increase dramatically.
Instead, the half-life of spoOH messenger RNA increases 4-fold and the synthesis of on
also increases about 5-fold (Healy et al., 1991). The increased level of (:11 induces
expression of oil-dependent sporulation-specific genes, including the spoIIA operon. It
has been proposed that post-transcriptional mechanisms govern the level of on to ensure
that ell-dependent sporulation-specific genes would not be turned on before the onset of
sporulation (Healy et al., 1991). Even though these mechanisms are not very well
characterized, the low level of a“ during growth can be considered to be inactive with
respect to stimulating oil-dependent, sporulation-specific gene expression. Thus, activation
of a“ (i.e., an increase in its level) is accomplished only after the cell attains a particular
physiological state induced by starvation during the initiation of sporulation.

Activation of J and septum formation. Activity of 01’ is controlled by
SpoIIAA and SpoIIAB, the products of the fust two cistrons of the spoIIA operon. 0" (the
product of the spoIlAC gene) is negatively regulated by SpoIIAB, which forms complexes

15

with 0F or SpoIIAA. SpoIIAA antagonizes SpoIIAB by forming a complex with SpoIIAB
(Schmidt et al., 1990; Margolis et al., 1991; Duncan & Losick, 1993). Since spoIIA is
expressed before the formation of the asymmetric septum, the three gene products
(SpoIIAA, SpoIIAB, and 01’) are expected to be present in both compartments after
septation. Since 0‘” activity is confined to the forespore (Margolis et al., 1991), one would
expect that in cells prior to septation. SpoIIAB is associated with (W, thus inhibiting the
activity of 01“. Upon septum formation, conditions in the forespore somehow favor the
association of SpoIIAA with SpoIIAB, thus relieving the inhibitory effect of SpoIIAB on
01’. Recently, Alper et a1. discovered that the concentrations of ATP (or its non-
hydrolyzable analogs) and ADP can influence whether SpoIIAB associates with 01“ or
SpoIIAA (Alper et al., 1994). ATP and its nonhydrolyzable analogs stimulate the
formation of the SpoIIAB-0F complex, while ADP stimulates the formation of the
SpoIIAB-SpoIIAA complex. Thus, it is proposed that forespore-specific activation of 0F
could be due to an increase in ADP levels, a decrease in ATP levels, or both. Conversely,
in the mother cell, a high level of ATP, a low level of ADP, or both, would prevent the
dissociation of SpoIIAB-0F, thus inhibiting the activity of 01“. Consistent with this model
is the finding that the level of ATP relative to other adenosine nucleotides is selectively and
dramatically decreased in the forespore while no such drop in the ratio of ATP to the other
adenosine nucleotides is observed in the mother cell (Singh et al., 1977). In addition to the
need for septum formation to activate 0F, the products of the three-cistron spoIIE operon
also play a role. spoIlE mutants appear to produce a thick layer of peptidoglycan in the
sporulation septum (Illing & Enington, 1991a), indicating the involvement of spoIIE
products in the synthesis and/or regulation of the thin peptidoglycan that normally appears
transiently in the sporulation septum. This finding has led to the suggestion that SpoIIE

proteins may mediate or facilitate intercompartrnental communication leading to GP

16

activation (Margolis et al., 1991).

Activation of 03 and septum formation. Unlike 0F, 03 is first synthesized as
an inactive precursor, pro-05, with an extra 29 amino acids at the N-terminus (LaBell et al.,
1987). Processing of pro—ul3 depends on SpoIIGA, the putative processing enzyme
(Stragier et al., 1988). However, expression of the spoIIG operon (encoding both
SpoIIGA and pro-0P3) is not sufficient for efficient processing during sporulation. One
additional requirement appears to be the presence of the sporulation septum, since cells
lacking FtsZ, a protein required to initiate septum formation, fail to accumlate 03, even
though pro-05 is synthesized normally (Beall et al., 1988). Additionally, mutants that fail
to make active 0F fail to produce (:3 (Stragier et al., 1988; Jonas & Haldenwang, 1989),
suggesting that processing of pro-OE also depends on 01’. How active 6“ leads to the
activation of 05 is not yet understood. One possibility is that active 0“ in the forespore may
direct the expression of one or more genes whose product or products directly or indirectly
act vectorially to allow 05 activation in the mother cell (Driks & Losick, 1991; Margolis et
al., 1991; Losick & Stragier, 1992).

Activation of 06 and engulfment. spoIIIG (encoding 00) is first transcribed
by GP containing RNA polymerase in the forespore (Sun et al., 1991). However, 00 RNA
polymerase remains unable to transcribe its target genes until engulfment of the forespore is
complete, which is an hour after the formation of the sporulation septum. The apparent
delay in oG-dependent gene expression and the coincidence of 06 activation with formation
of a 'protoplast' forespore lead to the suggestion that completion of engulfment serves as a
'morphological' cue for triggering (:0 activity (Losick & Stragier, 1992; Stragier, 1992).
Activation of 00 requires a number of genes, including two that are transcribed by 05 RNA
polymerase, spoIIIA and spolID. spoIlIA is a seven-cistron operon. Mutations in all of

the spoIIIA cistrons tested produce a block at the stage of engulfment (stage III), as does a

17

spoIIIG mutation. In addition, in spoIIIA mutants, 00 activity is abolished (Mason et al.,
1988; Rather & Moran, 1988; Karmazyn-Campelli et al., 1989; Cutting et al., 1991a).
The mechanism by which spoIIlA gene products (made in the mother-cell) influence the
activity of 00 in the forespore is not yet understood.

Another gene that is absolutely required for 00 activity is spoIID, which encodes a
37 kDa protein (Piggot & Coote, 1976; Stragier, 1992). In the absence of SpoIID protein,
engulfment of the forespore is incomplete (Illing & Errington, 1991a). SpoIID has
significant sequence similarity to a modifier of a cell wall hydrolytic enzyme (Kuroda et al.,
1992; Ianrevic et al., 1992), and it may be involved in the final release of the forespore
within the mother cell.

The dependence of 00 activation on (IE-transcribed gene products represents another
example of intercompartmental communication. The purpose of this communication may
be to couple a morphological landmark, the completion of engulfment, to the program of
gene expression.

Activation of ex and forespore morphogenesis. 6K, like GE, is first made
as an inactive precursor. Pro-<3K is thought to have with 20 amino acids at its N-terminus
that are not present in ex (Kroos etal., 1989; Stragier et al., 1989). Pro-0K is first made at
3 hours into sporulation, while active 0“ appears an hour later (Lu et al., 1990).
Processing of pro-0K not only depends on several mother-cell-specific genes, but also on
several forespore-specific genes, including spoIIlG, the gene that encodes the forespore-
specific sigma factor, 00 (Cutting et al., 1990; Lu et al., 1990). Thus, it has been
proposed that activation of OK in the mother cell is coupled to events controlled by 00 in the
forespore, representing another example of intercompartmental communication (Cutting et
al., 1990; Lu et al., 1990). A number of genes that play a direct role in pro-0K processing

have been identified. In the forespore, spolVB, which is transcribed by 00 RNA

18

polymerase, is involved in signalling the processing of pro-trK (Lu et al., 1990; Van Hoy &
Hoch, 1990, Cutting et al., 1991a). SpoIVB may play a direct role in activating processing
of pro-0K, possibly by interacting with the processing enzyme. Alternatively, SpoIVB may
play a structural or enzymatic role in serving as part of the processing signal from the
forespore. Mutations that bypass the requirement for 00 in the processing of pro-dc have
been isolated. These bof (bypass Qf forespore) mutations map to the spoIVF operon and
the bofA gene. spoIVF is a two-cistron operon that is transcribed by 05 RNA polymerase
(Cutting et al., 1991b). Genetic studies have suggested that SpoIVFB, the product of the
promoter distal gene of the spoIVF operon, may encode the pro- aK processing enzyme or,
alternatively, a regulator of the processing event (Cutting et al., 1990). SpoIVFA, the
product of the promoter proximal gene of the spoIVF operon, is suggested to play dual
roles in regulating the activity of SpoIVFB (Cutting et al., 1991b). In its positive-acting
role, SpoIVFA is required to stabilize SpoIVFB, which is suggested to be thermolabile. In
its negative-acting role SpoIVFA inhibits the activity of SpoIVFB until a signal(s) from the
forespore is received. BofA, the product of the oE-dependent bofA gene, also plays a
negative role in pro-0K processing until a signal from the forespore is received (Ricca et al.,
1992).

In cells in which the need for pro-0K processing has been uncoupled from
dependence on a forespore signal(s), transcription of (xx-dependent gene is advanced by 1
hour. This decreases the sporulation efficiency by 10-fold and the spores produced are
germination defective (Cutting et al., 1990). In this case, coupling of 0" activation in the
mother cell to forespore morphogenesis is obviously of great biological importance.

Activation of transcription factors in other systems. Gene expression is
regulated temporally and spatially during development of B. subtilis through activation of

different sigma factors. Activation of each sigma factor depends on the one activated

19

previously in the cascade and in each case appears to be coupled to the establishment of a
morphological structure.

Mechanisms used in activating different sigma factors during B. subtilis sporulation
are not unique for this organism to regulate gene expression. In Salmonella typhimurium,
a gram-negative bacterium, assembly of the bacterial flagellum requires nearly 50 genes
(Iino et al., 1988; Macnab, 1990). These genes are categorized into early, middle, and late
operons according to the time of expression. The sequential transcription of the flagellar
operons is coupled with the assembly of flagellar structures, a process that proceeds, step
by step, from simpler to more complex structures (Suzuki, et al., 1978; Jones & Macnab,
1990). Transcription of the late flagellar operons is carried out by 028 RNA polymerase.
(:23 is the product of the gene fliA, which belongs to the flagellar middle operon (Ohnishi
et al., 1990). The presence of 028 does not immediately lead to the activation of later
operons. Instead, it is held as an inactive form by associating with another protein, FlgM,
which is also the product of a gene in the flagellar middle operons (Ohnishi et al., 1992).
Interestingly, activation of 028 involves secreting the FlgM protein into the growth medium
by the flagellar—specific export apparatus only in cells that have a functional hook-basal
body complex (Hughes et al., 1993). These results suggest that the integrity of the
flagellar hook-basal body complex serves as a morphogenetic cue to relieve the inhibiton of
023 by FlgM and activation of 023 will lead to expression of genes in late Operons whose
products are needed for the assembly of a complete flagellum (Losick & Shapiro, 1993).

NF-xB is a eukaryotic transcription factor that is activated in many different cell
types following a challenge with primary (viruses, bacteria, stress factors) or secondary
pathogenic stimuli (inflammatory cytokines). The active factor then leads to a rapid
induction of genes encoding defense and signalling molecules (Grimm et al., 1993).
Interestingly, one of the subunits of NF-xB, p50, is first synthesized as a precursor

protein, p110, that lacks DNA-binding ability (Gosh et al., 1990; Kieran et al., 1990)

20

The C-terminal part of p110 (IxB-y) seems to inhibit the activity of p50, which is the N-
terminal part of p110. Surprisingly, cleavage of the precursor is not sufficient to restore
the activity of p50 (Fan & Maniatis, 1991), suggesting that the dissociation of the C-
terminal cleavage product is required to relieve the inhibitory effect on p50. In this case,
both processing and dissociation of an inhibitor are required for the activation of a
transcription factor.

Activation of sterol regulatory element-binding protein 1 (SREBP-l) is another
example involving proteolytic processing. SREBP-l is a member of the basic-helix-loop-
helix-leucine zipper (bHLH-ZIP) family of transcription factors (Y okoyama et al., 1993;
Hua et al., 1993). SREBP-l is first synthesized as a 125 kDa precursor that is attached to
the nuclear envelope and endoplasmic reticulum (Wang et al., 1994). In sterol-depleted
cells, the membrane-bound precursor is cleaved to generate a soluble, 68 kDa, N-tenninal
fragment that translocates to the nucleus. The 68 kDa protein (containing bHLH-ZIP)
activates transcription of the genes for low density lipoprotein (LDL) receptor (Briggs et
al., 1993) and a regulated enzyme in cholesterol biosynthesis (Smith et al., 1988). Sterols
inhibit the cleavage of SREBP—l, and the 68 kDa protein is rapidly degraded, thereby
reducing transcription. In this case, a physiological state (i.e., the level of sterol in the cell)
controls the activation of a transcription factor via a mechanism involving proteolysis.

Summary. Study of a relatively simple developmental system, such as B.
subtilis, has revealed many interesting mechanisms with regard to temporal and spatial gene

regulation, which are also employed by other organisms.

Chapter 2

Processing of the mother-cell a factor, 0K, may depend
on events occurring in the forespore during
Bacillus subtilis development

(Reprinted with the permission of Richard Halberg and Lee Kroos)

21

Prat. Natl. Acad. Sci. USA
Vol. 87. PP. 9722-9726. December 1990
Genetics

22

Processing of the mother-cell a factor, a“, may depend on events
occurring in the forespore during Bacillus subtilis development

(gene ”Instant/RNA WIN/transcription)

Sme Lu. RICHARD HALBERG, AND Lee Kaoos‘

Department of Biochemistry. Michigan State University. East Lansing. MI 48824

Communicated by Dale Kaiser. September I7. I990

ABSTRACT During sporulation of the Gram-positive bac-
terium Bociflussuba‘lis, transcfiptlonofgenesencodingspore
coat proteins in the mother-cell compartment of the apo-
rangium is controlled by RNA polymerase containing the or
subunit called 0". Based on comparison of the N-terminal
amino acid sequence of a“ with the nucleotide sequence ofthe
gene encoding a“ (sigK), the primary product of sigK was
hferred to be a pro-protein (pro-0") with 20 extra amino acids
at the N terminus. Using antibodies generated against pro-r7".
we have detected 0" beginning at the third hour of
sporulation and a beginning about 1 hr later. Even when
pro-«"13 expressed artificially during growth and throughout
sporulation, 0" appears at the normal time and cxprmion of
a o‘controllcd gene occurs normaliy.1‘hesc results suggest
that pro-a“ is an inactive precursor that is proteolytically
processed to active 0" in a developmentally regulated fashion.
Mutations that block forespore gene expression block accumu-
lation of 0" but not accumulation of pro-a", suggesting that
pro-tr" processing is a regulatory device that couples the
programs of gene expromlon in the two compartments of the
sporangium. We propose that this regulatory device ensures
completionofforesporemorphogenesisprlortothesynthesisln
themothcr-cellofsporecoatprotelnsthatwlllencascthe
forespore.

 

Upon starvation the Gram-positive bacterium Bacillus sub-
u'lI‘s undergoes a series of morphological changes that result
in endospore formation (1). The first easily observed mor-
phological change is asymmetric septum formation. which
divides the cell into two compartments. the mother-cell and
the forespore. each receiving a copy of the genome. A
complex regulatory circuit ensures the correct temporal and
spatial pattern of gene expression during sporulation. Critical
to this regulatory circuit are the synthesis and activation of or
subunits of RNA polymerase that direct the enzyme to
transcribe different gene sets (2) Two 0 factors are compart-
ment—specific. 0° .the product of the spoIlIG gene. is pro~
duccd predominantly. if not exclusively. In the forespore and
controls the expression of forespore-speCIfic genes (3—5). The
counterpart to a6 in the mother-cell Is a ".(6) which controls
the expression of mother-ccll- specific genes such as ( 0M (7),
cot!) (8). and gerE (9) (referred to as the com regulon). The
com and (010 genes encode spore coat proteins that assem-
ble on the forespore surface (10). and gerE encodes a
regulator of spore coat synthesis (11).

" is encoded in a composite gene (sigK ) generated by a
mother-cclI-specific chromosomal rearrangement that joins
two loci. spoIVCB (encoding the N-tcrminal portion) and
spolllC (encoding the C-Ierminal portion) (12. 13). Transcrip—
tion of the sigK promoter is also confined to the mother-cell
(l4) and compartmentalization of both the DNA rearrange-

 

The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked "advertisement"
in accordance with 18 U.S.C. 51734 solely to indicate this fact.

9722

ment and sigK transcription appear to result from mother-
ccllospccific expression of spoIIlD (15). A third possible
regulatory mechanism for a“ was inferred from a comparison
of thc N-Icrminal amino acid sequence of o" and the nucle-
otide sequence of sigK (6, 12) and by analogy to 05. a
sporulation-specific B. subtilis a factor that is activated by
proteolytic processing (16-18). The primary product of sigK
was predicted to be a pro-protein (pro-<7") bearing 20 extra
amino acids at the N terminus. Here we present evidence that
o" is first made as an inactive precursor and is processed to
the active 0 factor in a developmentally regulated fashion.
Furthermore. mutations in forespore regulatory genes (e.g.,
spoIIIC, encoding the forcSpore a factor. a“) appear to block
processing of prov“ to 0". suggesting that the previously
noted dependence of mother-ccll-spccific gene expression on
forespore events (7-9. 14) is mediated at the level of prote-
oiytic activation of the mother-cell a factor.

MATERIALS AND METHODS

Bacterial Strains. Escherichia coli strain A0115 [araDI39.
Alma. feu)7697, Alec-X74. galU '. galK ‘. hsr‘. hsm‘. strA.
(F’. proAB. Iarl"Z::Tn5)] was obtained from A. Grossman.
B. subtilis strains were obtained from R. Losick. B. subtilis
cells were made competent (19) and transformants were
selected on Luria-Bertani (LB) agar (20) with kanamycin
sulfate at 5 pg/ml. Use of the specialized transducing phage
SPB::coID—la(-Z (obtained from L. Zheng and R. Losick) has
been described (8).

Construction of Plasmids. All plasmids were derived from
pSK5. which contains sigK (13). and from pDGl48 (18).
which permits isopropyl B-D-thiogalactopyranoside (1W0)-
induciblc expression of an inserted gene from the PM
promoter (21) in E. coli or B. subtilis. To fuse-sigK expression
to the PM promoter. a 1.4-kilobasc-pairlkbp) Ssp l-I-lindlll
fragment from pSK5 (including 141 bp upstream and 556 bp
downstream of the sigK open reading frame) was ligated to
Hindlll~digested pDGl48. the unligatcd end of the vector was
made blunt using the fill-in reaction of chnow enzyme. and
ligation was continued (20). Ampicillin-rcsistant E. coli trans-
formants were obtained (20) and the structure of pSLl. a
plasmid containing the insert in the proper orientation to fuse
sigK transcription to Pm... was verified by restriction map-
ping pSL2 and pSL4 were derived from pSLl and pDGl48.
respectively. by deletion of the EroRl fragment containing
the origin of replication and the kanamycin-resistance gene
that function In B. subtilis.

Production of Pro-0" and Preparation of Antibodies. To
produce pro-t7" in E. coli. strain ESLZ (strain A0115 con-
taining pSL2) was induced with 1 mM IPTG during the late
logarithmic phase of growth at 37‘C in LB medium (22). One
hour after the addition of IPTG. cells were harvested by

 

 

 

AbbreviationszlPTGJsopropyIB~c‘L v ' ‘ r, " .T..hour
II of sporulation.

'To whom reprint requests should be addressed.

Genetics: Lu er al.

centrift‘ation (6 min. 7500 x g). The cell pellet was resus-
pended in 0.05 volume of sample buffer (0.125 M Tris-HCI.
pH 6.8/2% SDS/5% 2-mercaptoethanol/ 10% glycerol/0.1%
bromophenol blue) and the sample was boiled for 5 min to
produce a whole-cell extract. From 0.5 ml of extract. - 100 pg
of pro-r7" was purified by preparative SDS/PAGE(10-15%
polyacrylamide gradient) and electroelution. Pro-a" (65 pg)
was precipitated with acetone. dissolved in phosphate-
buffered saline (23). emulsified with Freund‘s complete adju-
vant (BRL). and injected into or near the popliteal gland of a
New Zealand White rabbit. Three weeks later a booster
injection [30 pg of pro-0" emulsified with Freund‘s incom-
plete adjuvant (BRLH was given at the same site. The rabbit
was bled 1 week after the boost and serum was prepared (23).

Sporulatlon and Western Blot Analysis. Sporulation of B.
subtilis was initiated by nutrient exhaustion in Difco sporu-
iation (DS) medium (24) as described (7). Cells were har-
vested by centrifugation (5 min. 16.000 x g) and whole-cell
extracts were prepared (22). Extract protein was quantitated
by the Bradford method (25). After addition of 0.5 volume of
3X sample buffer. proteins were separated by 805/ 12.5%
PAGE and electroblotted to a poly(viny|idene difluoride)
membrane (26). The membrane was incubated in TBS (20
mM Tris-HCI. pH 7.5/0.5 M NaCl) with 2% nonfat dry milk
for 4 hr at room temperature with shaking to block nonspe-
cific antibody binding and then incubated overnight at room
temperature with shaking in polyclonal antiserum diluted
1:2000 into TBS/2% nonfat dry milk/0.05% Tween 20.
lmmunodetection using a goat anti-rabbit alkaline phospha-
tase conjugate was performed according to the manufacturo
er‘s instructions (Bio-Rad).

RESULTS

Antibodies to Pro-tr" Detect Pro-0" and 0" in Sporulating
B. subtilis. To purify pro-0" for the generation of a polyclonal
antiserum. the protein was expressed in E. coli. Transcription
of sigK (encoding pro-or") was fused to an lP'l‘G-inducible
promoter in plasmid pSL2. Whole-cell extracts of IPTG-
induced and uninduced E. coli containing pSL2 or a control
plasmid (pSL4. which does not contain sigK ) were analyzed
by gel electrophoresis (Fig. 1). A protein of the expected
mobility for pro-Ir" [~29 kDa. since pro-a" is predicted to
contain 20 amino acids at its N terminus that are absent from
tr". which migrates at 27 kDa (6)] increased upon lPTG
induction of cells containing pSL2. but not upon [PTO
induction of cells containing the control plasmid. This protein
was assumed to be pro-a". the predicted primary translation
product of sigK. since pSL2 contains no other 29-kDa-

1234

29 kDa-

ittth. l

 

Vin

FIG. 1. Production of pro-a" in E. coli. Proteins in whole-cell
extracts (10 pl) of lFl‘G-induced (lanes 2 and 4) and uninduced (lanes
1 and 3) E. coli were separated by SDS/PAGE (lo-15% polyacryl-
amide gradient) and visualized by Coomassie blue staining. Strains
ESL4 (lanes 1 and 2) and ESLZ (lanes 3 and 4) were constructed by
transformation of strain A0115 with the control plasmid ((381.4) and
the PwpsigK fusion plasmid (pSL2). respectively. Only the 35- to
25~kDa region of the gel is shown: the positions of a 29-kDa marker
protein (carbonic anhydrasc) and the protein assumed to be pro-I7"
are indicated.

23

Proc. Natl. Acad. Sci. USA 37 0990) 9723

protein-encoding open reading frames downstream of the
lP’TG-inducible promoter. -
Antibodies to gel-purified pro-a" were generated in a
rabbit and used in Western blot analyses. The antibodies
detected pro-r7" and one larger protein in a whole-cell extract
of [PTO-induced E. coli containing pSL2 (Fig. 2A. lane 2).
while only the larger protein was detected for cells containing
the control plasmid without sigK (lane 1). The antibodies.
referred to hereafter as “anti-prov" antibodies.“ easily
detected 15 ng of pro-aK gel-purified from E. coli (Fig. 28.
lane 1). The anti-pro-o" antibodies also recognized a" (6)
gel-purified from B. subtilis (Fig. 28. lane 2) and these
antibodies detected either pro-a" or a“ with similar sensi-
tivity. The antibodies detected proteins that comigrated with
" and a" in a whole-cell extract of sporulating B.
subtilis (Fig. 28. lane 3). while these proteins were not
detected in extracts of growing B. subtilis (lane 4) or in
extracts of sigK mutants (i.e.. spoIVCB or spollIC mutants:
see below). Thus. Western blot analysis using the anti-prov“
antibodies provides a sensitive assay for the level of pro-0"
and a“ in B. subtilis.
levelsofPro-a"anda"AreDevelopmentally Regtdated.
To examine the levels of pro-a" and a" in B. subtilis at
various times during sporulation. cells were harvested at
hourly intervals during growth and sporulation in D8 me-
dium. Under these conditions. the end of exponential growth
defines the initiation of sporulation (To). prespores that
appear gray in the phase-contrast microscope begin to appear
4 hr later (T.). and phase-bright free spores (released by
mother-cell lysis at the end of sporulation) begin to appear at
Tg. Whole-cell extracts were subjected to Western blot
analysis using the anti-pro-a" antibodies and the result for
the Spo’ strain PY79 (27) is shown in Fig. 3. A similar result
was obtained for the Spo‘ strain 8038 (28) (data not shown).
Pro-a“ was first observed at 3 hr into the sporulation process
(T 3). reached a maximum at T5. and then decreased to a
barely detectable level by T}. a“ was first observed at T. (1
hr later than pro-0"). increased to a maximum at T‘. and
decreased thereafter. These results demonstrate that the
levels of pro-0" and a" are regulated during sporulation.
Since the appearance of pro-aK precedes the appearance of
tr" and since the N terminus of 0" corresponds to codon 21
of sigK (6. 12). a" may be derived from pro-0" by proteolytic
processing.
MutationshrManySporulatioaGenesBlockAccuranlation
of a". Mutations at many different loci in the B. subtilis

A B
12 1234

._|

K v-sm

0'

FIG. 2. Characterization of the anti-prov“ antiserum by West-
ern blot analyses. (A) Whole-cell extracts (1 III of a 1:100 dilution)
from lPl‘G-induced E. coli strains ESLA (lane 1) and E812 (lane 2).
containing the control plasmid (pSL4) and the [QM—sigK fusion
plasmid (pSL2). respectively. were prepared as described for the
production of pro-tr" (see Materials and Methods). (B) Pro-o" (15
ng) from E. coli (lane 1) and a" (15 ng) from sporulating B. subtilis
(lane 2) were gel-purified. Whole-cell extracts (10 pg of protein) were
from B. subtilis harvested during growth (lane 4) and at 6 hr into
sporulation (lane 3) in 08 medium.

9724 Genetics: Lu er al.

7-1 To Tr Ta Ts Ta Ts Ta Tr Ta

1 2 3 4 5 6 7 8 9 10
Fro. 3. Pro-c"andc" in sporulating B. subtilis. Wild—type strain
W79 (27) was harvested at hourly intervals during growth and
sporulation in 08 medium. Whole-cell extracts (10 pg of protein)
were subjected to Western blot analysis using the anti-prov"
antibodies. Lanes 1-10. samples harvested at hourly intervals be-
ginning 1 hr before the end of exponential growth (T -g’ and ending
8 hr into sporulation ('l'.). Pro-c“ gel-purified from E. coli served as
a marker on the blot and the inferred position of tr" is indicated.

genome block or reduce expression of genes in the 0'"-
controlled com regulon (7—9). To further investigate these
effects. 16 mutants with altered mrA regulon expression were
examined for pro-a" and a“ by using the anti-pro—a" anti-
bodies in Western blot analyses. Samples collected at hourly
intervals from To through T1 in D8 medium were tested for
each mutant. but only the result at T... the time when both
pro-0" and a“ are abundant in the Spo’ strains (see above).
is shown in Fig‘. 4 for each mutant. Five mutants accumulated
neither pro-a nor 0" (lanes 3. 5. 6. 12. and 13). These
mutants have either a mutation in the sigK gene [spoIVCB
and spolIlC (12)] or a mutation in a gene whose product is
essential for the chromosomal rearrangement that generates
sigK [spollGB. spoIIID, and spoIVCA (12. 13)]. Nine mu-
tants accumulated pro-0" but not 0" (lanes 1. 2. 4. 7. 8. 11.
14. 15. and 16). interestingly. this group includes 4 strains
with mutations in genes required for forespore-specific gene
expression [spolllA. spolIlE. and spollIG (32. 33)] and/or in
genes expressed predominantly. if not exclusively. in the
forespore [spoIIlG (4. 5) and spoIVB (8. Cutting and R.
Losick. personal communication". suggesting that accumu-
lation of 0" in the mother-cell compartment of the spo-
rangium depends on events occurring in the forespore com-
partment. In addition. this group includes 2 mutants (spolIB
and spollD) blocked early in sporulation at the stage of
asymmetric septum formation and 3 strains with mutations in
the spa! VF locus. which is not required for expression of a

 

h .-
3.2”“

“_-~'v . >—

pro-tr"

‘. . 1' a". “
an}: ' 1‘ ' ‘ ‘1 V l".
Lac- -. ... -~——- r...- " ¢-—‘-

24

Proc. Natl. Acud. Sci. USA 87 (I990)

forespore-specific gene (32). Finally. 2 strains with mutations
in spoIVA accumulated a normal amount of pro-0" but
accumulated much less a" (lanes 9 and 10) than the wild-type
strain. The spoIVA mutants express the com regulon at a
reduced level. whereas all the other mutants examined in this
study fail to express the com regulon (7-9). Thus. for all the
mutants examined. the impaired com regulon expression
observed previously (7-9) may be due to impaired accumu-
lation of a“. If a" is derived from pro-a" by proteolytic
processing as suggested above. at least eight loci (spoIlB.
spollD. spolllA. spolllE. spolllG. spolVA. sle8. and
spa! VF) may be directly or indirectly involved in processing
pro-0" and/or stabilizing a“.
ProcessingofPro-c"toa"lskequlredtohoduceanActive
a Factor and Is Developmentally Regulated. In vim) and in
viva approaches were used to address whether pro-er" can
direct transcription of a"-controlled promoters. For the in
vim: approach. pro-<7" gel-purified from E. coli was tested
for its ability to direct transcription of the sigK [previously

1 called spoIVCB (6. 14)] and cow (8) promoters upon addition

to B. subtilis core RNA polymerase (6). As a positive control.
0'" (60 ng) partially purified from sporulating B. subtilis was
eluted from a gel. renatured (34). and added to core RNA
polymerase (60 ng). The reconstituted enzyme produced a
run-off transcript from the sigK promoter in the presence of
the SpoIIID protein (120 ng) and from the com promoter in
the absence of SpoIIID (data not shown). as shown previ-
ously (6). Under these conditions. pro-<7" (300 ng) failed to
direct transcription of the sigK promoter in the presence of
SpoIIID (120 ng) and also failed to direct transcription of the
(mo promoter in the absence of SpolllD (data not shown).
These results suggest that pro-tr" is inactive as a a factor.
To determine whether pro-0" could direct transcription of
a a"-controlled gene in vivo. we used a multicopy plasmid
bearing sigK fused to an [PTO-inducible promoter to express
pro-0" in B. subtilis during growth and sporulation and a
corD-lacZ fusion (8) to monitor the transcriptional activity of
a a"-controlled promoter. A sigK mutation prevented pro-
duction of pro-0" or a" from the chromosome in this exper-
iment. Production of pro-<7" from the plasmid was induced
with IPTG ~2 hr before the end of exponential growth. and
samples collected at hourly intervals were tested for fl-gao
lactosidase production from the corD-lacZ fusion and were
also subjected to Western blot analysis using the anti-prov"
antibodies (Fig. 5). Even though a large amount of pro-0"
was present 1 hr prior to the end of exponential growth (T -y)
and throughout the early stages of sporulation (Western blot.
Inset). corD-directed fi-galactosidase activity remained low

910111213141516

i

FIG. 4. Pro-0" and a“ in B. subtilis sporulation mutants harvested 6 hr alter the end of exponential growth in 08 medium. Whole-cell extracts
(10 pg of protein) were subjected to Western blot analysis using the anti-prov" antibodies. Arrows indicate the position of pro-0". which served
as a marker on the blots: the inferred position of a" is also indicated. Lanes: 1. strain 131.5 (spoIlBIJI. rrpCZ); 2. K8298 (spollDI:
Tn9l7flHU298): 3. K8440 (spollGfl ): 4. K813 (spollIA ::Tn9l7flHUI3): 5. 8K410 (spolllCW). 6. BK395 (spoIIIDSJ); 7. SC622 (spoIIIEJO);
8. 81038 (spalllGAI ): 9. K8194 (spoIVA ::Tn9l7flHUl94): 10. strain 67 (spa/K467. rrpC2): 11. 8K750 (.rpolVBtieth); 12. 81658
(leCA I33); 13. BK556 (.rpoIVCBZJ): l4. SC834 (spoIVFISZ): 15. K8301 (spoIVF::Tn9/7(1HU30I ): 16. K8179 (spoIVF :iTn917flHUI79).
These strains are isogenic to PY79 (27). except 131.5 and 67 are isogenic to 8638 (28). These strains have been described (7. 14. 15. 29). except
BK750 was constructed by transformation of DNA prepared from “112719 (30) into PY79 with selection for the erythromycinoresistance gene
(ermG) inserted in the spolVB gene (B. Kunkel and R. Losick. personal communication) and K8301 has Tn9l7 inserted in the spoIVF locus
(8. Cutting and R. Losick. personal communication). The Tn9l7 insertions HUI“ and HUI79 were thought to define new loci designated spon’
and spaVL. respectively (31). but are now assigned to the indicated loci (8).

Genetics: Lu er al.

1'... T. T. T. T. T. T. T. T,

3 < .n---—-..— Pro-0K

 

\UK
s.
09"“
3x
i

hit
33
uh

04

-2 0 2 4 6 8

Time. hr

FIG. 5. Effect of producing pro-Ir“ from It plasmid during growth
and sporulation of B. subtilis. Strain BK410 (sporucw: ref. 15) was
transformed with the PW -.\-igK fusion plasmid (pSLl) or the control
plasmid (pDGl48). and both resulting strains were lysogenized with
phage SPflirr-IIID-Jar-Z. resulting in strains BSL3 and 881.4. respec-
tively. The Spo‘ strain PY79 (27) was also lysogenized with
SszirnID-lar'l. resulting in strain BSLS. Cells were grown and
sporulated in 08 medium with the addition of 1 mM IPTG ~2 hr
before the end of exponential growth. Samples were harvested at
hourly intervals and p-galactosidase activity was determined (35)
using the substrate II-nitrophenol Bu-galactosidc. One unit of en-
zyme hydrolyzes 1 umol of substrate per min per 00m unit of initial
cell density. Background activity (ranging from 0.5 to 6 units) of
PY79 at each time point was subtracted from the values obtained for
strains containing the I-IIID—lm-Z fusion. I-IItD—directed fi-galacto-
sidase activity was determined for strains BSL3 (a). 881.4 to). and
881.5(0). (Inset) Western blot analysis of whole-cell extracts (10 pg
of protein) of strain BSL3. using the anti-prov“ antibodies.

until T. (a). Pro—a“ produced in B. subtilis appears to be
inactive as a a factor. unless the presence or absence of
another regulatory factor(s) prevents corD transcription dur-
ing growth and early in sporulation. Beginning at T4. and
more noticeably at T5. 0“ was observed by Western blot
analysis and coID-directed B-galactosidase activity increased
significantly compared to the level observed in a control
strain harboring a plasmid without sigK (Fig. 5. O). The
increase in cotD~directed B-galactosidase activity paralleled
that observed from Kthe curb-lacZ fusion in wild-type B.
subtilis (A) Thus. a“ was first detected at T. and increased
through T. In wild-type cells (Fig. 3) or in cells expressing

from a plasmid (Fig. 5). and in both cases the increase
in the a“ level coincided with the increase in coID-directed
B-galactosidase activity (Fig. 5). The finding that a“ accu-
mulated at the normal time in cells expressing pro-a “from a
plasmid during growth and early In sporulation demonstrates
that production of pro-a“ is not the limiting factor in the
production of a“. This suggests that if a“ is derived from
pro-o“ by proteolytic processing. the processing step itself
may be a developmentally regulated event that begins at
about Tg.

DISCUSSION

The primary product of sigK was inferred to be a pro-protein
(pro-a“) with 20 extra residues at the N terminus based on a
comparison of the N- terminal amino acid sequence of a“ (6)
with the nucleotide sequence of sigK (12). Using anti- -“pro-a

antibodies tn Western blot analyses of whole-cell extracts of
sporulating B. subtilis. we detected proteins that we believe
are pro-a“ and a“ for the following reasons: (I') the proteins
comigrated with gel-purified pro-o“ and a“ (Fig. 2). (ii) the
proteins were not observed in Western blot analyses of
whole-cell extracts prepared from growing wild-type cells

25

Proc. Natl. Acad. Sci. USA 87 (I990) 9725

(Fig 2) or from developing cells of fiveK strains that were
expected to be unable to produce pro-c“ and a“ due to a
mutation either tn the sigK structural gene or in a gene whose
product ts required to generate the composite sigK'gene (Fig.
4). and (iii) the protein that comigrated with pro-a was first
observed in Western blot analysis of wild type cells at T,
(Fig. 3). which Is consistent with the timing of sigK expres-
sion (14). while the protein that comigrated with a“ was first
observed at T.(Fig. 3). which Is consistent with the timingof
expression of the or“—controlled (‘tlfA regulon (7—9)
ProteolyticE processing has been shown to control the
activity of a (16.17).anothcr sporulation-specific a factor
in B. srrblilint By analogy to a Eand based on the finding that
the N terminus of 0 “corresponds to codon 21 of sigK. it was
proposed that pro-a“ may be an inactive precursor that is
proteolytically processed to active (7“ (6 12). Several of our
results are consistent with this model. First. the appearance
of pro-a“ preceded the appearance of a“ during sporulation
of wild-type B. subtilis (Fig. 3). and the timing of appearance
of ('OfD-dlI’CClCd B-galactosidasc activity (Fig. 5. A) coincided
with the appearance of a“. not pro-or“. Second. mutations in
eight sporulation loci (spollB. spoIlD. .rpollIA. spolllE.
spIIlllG. spol VA spol VB and spa! VF) blocked or reduced
accumulation of a“ .but not accumulation of pro-a “(Fig. 4).
and the impaired corA regulon expression in strains with
these mutations (7—9) correlates with the impaired accumu-
lation of a“. not with the level of pro-a“. which was normal
in all these mutants except the spollB mutant (see below).
Third. when pro-a“ was gel-purified from E. coli and rena-
tured under the same conditions that permit recovery of
activity of a“ gel-purified from B. subII'II's. it failed to promote
transcription of a “-controlled promoters in virm (data not
shown). Fourth. production of prooa“ from a plasmid In a B.
sIIhII'lIs sigK mutant resulted in production of a“ during
sporulation (Fig. 5 ln..rer) and. just as in wild—type cells. the
timing of appearance of corD-directcd B-galactosidase activ-
ity (Fig. 5 e) coincided with the appearance of or“ .not with
the level of pro-a“ . which was high during growth and
throughout sporulation. Our data do not rule out the inter-
pretation that a“ is produced by translational initiation at an
alternative site: however. this possibility is unlikely since no
apparent ribosomc-binding site or initiation codon exists at
the appropriate position in the sigK mRNA. Nevertheless. it
may be possible to use a pulse-chase experiment to demon-

. strate “directly a precursor-product relationship between

pro-a“ and a“ .as has been done in the case of GE and its
precursortl7). Proof that pro-a is an Inacttvc precursorthat
can be proteolytically processed to active 0 will require
reconstitution of the processing reaction in l'ffl'o.

The accumulation of a“ is a developmentally regulated
event that begins at about T. in wildotypc cells (Fig. 3) or in
sigK mutant cells expressing pro-a“ from a plasmid (Fig. 5).
This event directly or indirectly requires proper functioning
of the products of at least eight sporulation loci since. as
noted above. mutations in eight loci blocked or reduced
accumulation of a“ but not accumulation of pro-a“. If a“ is
derived from an inactive precursor by a developmentally
regulated proteolytic processing event. what purpose might
this regulatory device serve? 1n the case of as. processing
has been suggested to be a mechanism for coupling formation
of the sporulation septum to activation of aE'and the subse-
quent pattern of gene expression (17. 18). Our finding that
spoIIIA. span/5.5 sgolIIG. and spa! VB mutants accumulate
pro-Ir“. but not a and the results of Cutting er al. (29).
discussed below. suggest that pro-a“ processing may couple
activation of the mother-cell a factor to events occurring in
the forespore compartment.

A regulatory mechanism connecting mother-cell-specific
gene expression to forespore events was inferred (7—9. 14)
from the observation that mutations in spolllA . spollIE. and

9726 Genetics: Lu et al.

rpolllG that impair forespore-specific gene expression (32.
33) also impair mother-cell-Specific gene expression. Al-
though little is known about the functions of the spoIIIA and
spollIE gene products. spoIllG is expressed predominantly.
if not exclusively. in the forespore compartment and it
encodes a a factor. arc. that directs forespore-specific gene
expression (4. 5). Recently. spol VB (30) has been shown to
be expressed specifically in the forespore. yet mutations in
this gene impair mother-cell-specific gene expression (S.
Cutting and R. Losick. personal communication). Cutting et
al. (29) isolated mutants (called bof mutants for bypass of
forespore) that bypass the dependence of ('otA regulon
expression on spollIA. spolllE. .rpolllG. and spa] VB muta-
tions. Using the anti-prov“ antibodies described here. it was
shown that bof mutations restore production of a“ in spolllA
and spolllG mutant cells (29). Thus. bof mutations appear to
uncouple mother-ceIl-specific gene expression from fore-
spore events by permitting pro-a“ processing. Furthermore.
replacement of sigK with a deletion-mutated version lacking
codons 2-20 (so that the protein produced. 6“”. would
differ from a“ only by a methionine residue at its N terminus)
relieved the dependence of cotA regulon expression on the
spolIlG gene product (29). In this case the pr0posed coupling
between forespore events and pro-a“ processing appears to
be circumvented by producing the truncated. active 0“”
instead of pro-a“. A protein that was presumably 0“".
since it comigrated with a“ in Western blot analysis using the
anti-pro-a“ antibodies. was detected beginning at T, in a
spolllG mutant containing the deletion-mutated sigK gene
(data not shown). This finding suggests that the failure of the
spolllG mutant to accumulate a when it contains an intact
sigK gene (Fig. 4. lane 8) results from a failure to process
pro-o“ rather than from instability of 0“. unless 0““9 is
significantly more stable than a“ in the .rpolllG mutant. Cells
containing the deletion-mutated sigK gene also began ex-
pressing a cotA-lacZ fusion at T3. 1 hr earlier than normal
(29). as would be expected if 0““9 but not pro-a“ were able
to function as a a factor. The results presented here and the
results of Cutting et al. (29) strongly suggest that pro-a“
processing is a regulatory device that couples mother-cell
gene expression to forespore morphogenesis. The spolllA.
spolllE. .rpoIIIG. and spa! VB mutations are inferred to block
forespore morphogenesis at a stage that is incompatible with
pro-Ir“ processing.

Mutations in the .rpollB. spollD. and spoIVF loci also
blocked accumulation of a“. but not pro-a“ (Fig. 4). The
spollB mutant used in this study was shown previously to
express only 6% of the B-galactosidase activity normally
expressed from a sigK-lacZ fusion during sporulation (14).
This may explain the reduced amount of pro-a“ detected by
the anti-prov“ antibodies in this mutant (Fig. 4. lane 1).
Production of pro-Ir“ was unimpaired in the spollD mutant
(Fig. 4. lane 2). Since .rpollD mutations have been shown to
impair forespore-specific gene expression (5. 32.33). perhaps
these mutations also block forespore morphogenesis at a
stage that is incompatible with pro-a“ processing. The
spoIVF locus is the best candidate to encode a protein
directly involved in the pro-a“ processing reaction. Muta-
tions in spa! VF block expression of the «MA regulon (7-9)
and our results show that these mutants accumulate erK
but not a“ (Fig. 4. lanes 14-16). Like a spolllG mutant. a
spoIVF mutant engineered to produce truncated. active
aura expresses the MM gene (29). However. a spoIVF
mutation does not block the expression of a forespore-
specific gene (32). Furthermore. a bofA mutation does not
bypass the dependence of cotA expression on a spoIVF
mutation. and the 6013 mutations are alleles of the spa! VF
locus (29). These results have led to the proposal that the
spa! VF gene productts) governs processing of pro-e“ to a“
and that bofB mutations alter the spa! VF gene product(s) so

26

Proc. Natl. Acad. Sci. USA 87 (I990)

as to relieve its dependence on the products of spolIlA.
spolIlE. spolllG. and spot VB (29).

As far as we know. 0E (17. 18) and Ir“ are the only
transcription factors thought to be synthesized as inactive
precursor proteins and activated by specific proteolytic
cleavages. In both cases. proteolytic processing may couple
completion of a morphogenetic step to the subsequent. new
pattern of gene expression. but in each case the molecular
mechanism of the coupling remains to be elucidated.

We thank l. Healy. 8. Kunkel. 8. Cutting. L. Zheng. V. Oke. R.
Losick. P. Stragier. and A. Grossman for providing bacterial strains
and plasmids and for helpful advice. We thank R. Losick. S. Cutting.
and H. Douthit for critical reading of the manuscript. This research
was supported by the Michigan Agricultural Experiment Station and
by Grant GM43585 from the National Institutes of Health.

1. Smith. 1.. Slepecky. R. A. A Setlow. P. (1989) Regulation 4
Procaryotic Development (Am. Soc. Microbiol.. Washington. DC).

2. Moran. C. P. . It. (1989) in Regulation (JProcaryotic Development.
eds. Smith. l.. Slepecky. R. A. It. Setlow. P. (Am Soc. Microbiol..
Washington. DC). pp. 167-184.

3. Masuda. F... Anaguchi. H.. Yamada. K. B. Kobayashi. Y. (1W8)
Proc. Natl. Acad. Sci. USA 85. 7637-7641.

4. Sun. 0.. Stragier. P. & Setlow. P. (1989) Genes Dev. 3. 141-149.

5 Karmazyn-Campelli. C.. Bonamy. C.. Savelli. 8. & Stragier. P.
(1989) Genes Dev. 3. 150-157.

6. Kroos. L.. Kunkel. 8. & Losick. R. (1%9) Science 243. 526-528.

7. Sandman. K.. Kroos. 1... Cutting. 8.. Youngman. P. a Losick. R.
(1988) J. Mol. Biol. 2“. 461-473.

8. Zheng. L. & Losick. R. (1990) J. Mol. Biol. 212. 645-660.

9. Cutting. S.. Panzer. S. a Losick. R. (1989) J. Mol. Biol. 287.
393-404.

10. Donovan. W.. Zheng. L.. Sandman. K. & Losick. R. (1987”. Mol.
Biol. I96. 1-10.

11. Holland. S. K.. Cutting. S. a Mandelstam. l. (1987) J. Gen.
Alkrobnd.133.238l-239L

12. Stragier. P.. Kunkel. 8.. Kroos. L. & Losick. R. (1989) Science 243.
507-512.

13. Kunkel. 8.. Stragier. P. & Losick. R. (1990) Genes Dev. 4. 525-535.

14. Kunkel. 8.. Sandman. K.. Panzer. 8.. Youngman. P. a Losick. R.
(1988) J. Bacteriol. 170. 3513-3522.

15. Kunkel. 8.. Kroos. L.. Poth. H.. Youngman. P. & Losick. R. (1989)
Genes Dev. 3. 1735-1744.

16. Trempy. I. E.. Morrison-Hummer. l. & Haldenwang. W. G. (1985)
J. Bacteriol. 161. 340-346. '

17. LaBell. T. L.. Trempy. .l. E. & Haldenwang. W. G. (1987) Proc.
Natl. Acad. Sci. USA 84. 1784-1788.

18. Stragier. P.. Bonamy. C. & Karmazyn-Campelli. C. (1%8) Cell 52.
697-704.

19. Dubnau. D. & Davidolf-Abelson. R. (1971) J. Mol. Biol. 56.
209-221.

20. Maniatis. T.. Fritsch. E. F. St Sambr'oolt. l. (1982) Molecular
C liming: A Laboratory Manual (Cold Spring Harbor Lab.. Cold
Spring Harbor. NY).

21. Yansura. D. G. & Henna. D. l. (1984) Proc. Natl. Acad. Sci. USA
81.439-443. '

22. Healy. I. (1989) PhD. thesis (Harvard Univ.. Cambridge. MA).

23. Hadow. E. BI Lane. D. ( 1988)Antlbo¢lies (Cold Spring Harbor Lab..
Cold Spring Harbor. NY).

24. Youngman. P.. Perkins. I. B. & Losick. R.(1983) Proc. Natl. Acad.
Sci. USA 80. 2305-2309.

25. Bradford. M. (1976) Anal. Blot-hem. 72. 248-254.

26. Matsudaita. P. (1987) J. Biol. Chem. 262. 10035-10038. -

27 Youngman. P.. Perkins. .l. 8. a Losick. R. (1984) Plasmid 12. 1-9.

28 Errington. .l. & Mandelstam. l. (1986) J. Gen. Microbiol. 132.
2967-2976.

29. Cutting. S.. Oke. V.. Drilts. A.. Losick. R.. LII. S. & Kroos. L.
(1990) Cell 62. 239-250.

30. Van Hoy. 8. E. B. Hoch. I. A. (1990)]. Bacterial. I72. 1306-1311.

31. Sandman. K.. Losick. R. a Youngman. P. (1987) Genetics 117.

603-617.

32. Errington. J. & Mandelstam. l. “”61 J. Gen. Microbiol. 132.
2977-2985.

33. Mason. 1. M.. Hackett. R. H. & Setlow. P. (1988).]. Bacteriol. 170.
239-244.

34. Hager. D. A. & Burgess. R. R. (1980) Anal. Biochem. 109. 76-86.
35. Miller. I. H. (1972) Experiments in Molecular Genetics (Cold Spring
Harbor Lab.. Cold Spring Harbor. NY).

Chapter 3

Overproducing the Bacillus subtilis mother-cell sigma factor
precursor, pro-GK, uncouples (SK-dependent gene expression
from dependence on intercompartmental communication

(Reprinted with the permission of American Society for Microbiology)

27

28

Abstract

During sporulation of Bacillus subtilis, proteolytic activation of pro—0K and ensuing
(xx-dependent gene expression normally require the activity of many sporulation gene
products. We report here that overproducing pro—oK at the onset of sporulation
substantially uncouples (xx-dependent gene expression from its normal dependency.
Overproducing pro-0K in strains with a mutation in spoIlIG, spoIIIA, spoIIIE, or spoIVB
partially restored (SK-dependent gene expression in the mother cell and resulted in
accumulation of a small amount of polypeptide that comigrated with OK, but these mutants
still failed to form spores. In contrast, sporulation of spa] VF mutants was greatly
enhanced by pro- oK overproduction. The products of the spoIVF operon are made in the
mother cell and normally govern pro- oK processing, but overproduction of pro-0K appears
to allow accumulation of a small amount of 0", which is sufficient to partially restore
mother-cell gene expression and spore formation. This spoIVF-independent mechanism
for processing pro—oK depends on OE, an earlier-acting mother—cell-specific sigma factor.
The spoIIID gene, which encodes a mother-cell-specific DNA-binding protein that is
normally required for pro-oK production, was shown to be required for efficient pro-avK
processing as well. bof (bypass of forespore) mutations bypassed this requirement for
spoIIID, suggesting that SpoIIID is less directly involved in pro-oK processing than are
spoIVF gene products. However, bof spoIIID double mutants overproducing pro-0K still
failed to sporulate, indicating that SpoIIID serves another essential role(s) in sporulation in

addition to its multiple roles in the production of 0K.

29

Introduction

Bacillus subtilis is a gram-positive bacterium that undergoes sporulation in response
to nutrient deprivation. The fust morphological change observed during the sporulation
process is the synthesis of an asymmetrically-positioned septum that partitions the cell into
two unequal compartments, the mother cell and the forespore. After further morphogenesis
the process culminates with the lysis of the mother cell and the release of a dormant spore
that is highly resistant to harsh environmental conditions (Losick et al., 1986).
Accompanying the morphological changes during sporulation is a highly regulated program
of gene expression. This regulation is achieved, in part, by the ordered synthesis and
activation of a cascade of sigma factors, each of which confers on core RNA polymerase
the ability to transcribe a set of genes during a certain period and in a particular location
(i.e., the mother cell or the forespore) (Losick & Stragier, 1992).

One of the sigma factors involved in mother-cell-specific gene expression is 0". 0K
containing RNA polymerase transcribes genes encoding proteins required for the synthesis
of the spore cortex and coat during morphological stages IV and V, respectively (Kroos et
al., 1989; Zheng & Losick, 1990; Cutting et al., 1991a; Zheng et al., 1992). Production

of active 0" involves multiple levels of regulation. First, the gene that encodes 0K, sigK, is
generated via a mother-cell-specific chromosomal DNA rearrangement (Stragier et al.,
1989). This site-specific recombination event requires SpoIVCA, which encodes a putative
recombinase (Kunkel et al., 1990; Sato et al., 1990; Popham & Stragier, 1992), and
spoIIID, which encodes a small, DNA-binding protein (Halberg & Kroos, unpublished
results ; Kunkel et al., 1989; Stragier et al., 1989). The SpoIIID protein may participate in
the rearrangement directly, and/or indirectly since SpoIIID stimulates SpoIVCA

transcription in vitro by 05 RNA polymerase (Halberg & Kroos, unpublished results), a

30

form of RNA polymerase that is active in the mother cell during the early stages of
sporulation (Driks & Losick, 1991). A second level of regulation in the production of OK
involves transcription of the sigK gene. SpoIIID is required for the initial transcription of
sigK by (IE-containing RNA polymerase (Halberg & Kroos, unpublished results; Kunkel et
al., 1988). SpoIIID also greatly stimulates later transcription of sigK by oK-containing
RNA polymerase (Kroos et al., 1989). A third level of regulation in the synthesis of active
0" involves proteolytic processing. The primary translation product of sigK is an inactive
precursor, pro-0K, that is processed to active 0" by removing 20 amino acids from the
N-terminus (Kroos et al., 1989; Lu etal., 1990).

Several lines of evidence suggest that processing of pro-oK to ex is a
developmentally regulated event that couples mother-cell gene expression to forespore
development. First, mother-cell- specific gene expression is blocked in several mutants that
are defective in forespore-specific gene expression (e.g., spoIIIA, spoIIIE, spoIIIC, and
spoIVB mutants) (Kunkel et al., 1988; Sandman et al., 1988; Cutting et al., 1989; Zheng
& Losick, 1990) because processing of pro-oK is blocked in these mutants (Lu et al.,
1990). Second, deletion of the pro-amino acid coding sequence from the sigK gene
bypasses the requirement for spoIIIG (encoding the forespore-specific sigma factor, 00) in
mother-cell-specific gene expression (Cutting et al., 1990). Third, mutants that had been

isolated based on their ability to relieve the dependence of mother-cell gene expression on
forespore regulatory proteins show restoration of pro-(sK processing (Cutting et al., 1990).
These "bypass of forespore" (bof) mutations map to two loci, spoIVF and bofA (Cutting et
al., 1990; Cutting et al., 1991b; Ricca et al., 1992). The bof mutations that map to spoIVF

are special alleles of this locus because other mutations in spoIVF prevent pro-oK

processing (Cutting et al., 1990; Lu et al., 1990). Hence, the products of the mother-cell-

31

expressed spoIVF operon are thought to be intimately involved in processing of pro-oK
(Cutting et al., 1990; Cutting eta1., 1991b).

We showed previously that pro- 0K overproduced from a plasmid at the onset of

sporulation fails to activate oK-dependent genes until it is processed to active 0K at about the
fourth hour of development (Lu et al., 1990). We reasoned that this system should allow
us to determine whether spollID is required for pro-oK processing since the normal
requirements for SpoIIID in producing pro-0K would be circumvented by producing pro-oK
from a plasmid. As a control, we also tested a spoIlIG mutant, which is blocked for

pro-0K processing when pro-0K is produced at the normal level (Lu et al., 1990). To our

surprise we found that overproducin g pro-trK in a spoIIIG mutant appears to allow a small

amount of 0K to be produced, resulting in substantial expression of (IX-dependent genes.
This result prompted us to carefully examine the effects of overproducing pro-0K during
sporulation. We found that pro- oK overproduction bypasses the normal communication
between forespore and mother cell, including the normal requirement for spoIVF gene
products in governing pro-oK processing. We also show that spoIIID is required for

normal pro-6K processing and that bof mutations can alleviate this requirement for spoIIID.

Materials and Methods

Bacterial strains. E. coli strain A0115 [araDI39, A(ara,leu)7697, AlacX74,
galU-, galK-, hsr, hsm+, strA, (F', proAB, lacqu::Tn5)] was obtained from A. Grossman
(Massachusetts Institute of Technology) and served as the host for construction and

maintenance of plasmids. The B. subtilis strains used in this study are listed in Table 3.1.

32

Table 3.1 Bacillus subtilis strainst

 

 

Strain Genotype Source We:
PY79 spo+ (Y oungrnan et al., 1984)
AGSl4b AspaOA::cat, aer703, trpCZ, pheAI A.Grossman

A6665b spoOH::cat, thZ, pheAI (Jaacks et al., 1989)
A6185c spoIIACI , trpCZ A.Grossman

PEWb spolIGAAS, trpCZ, pheAl (Jonas et al., 1988)
EU8701b ArigE::erm, trpCZ, pheAI (Kenney & Moran, 1987)
SC615 spoIlIA53 (Cutting et al., 1990)
BK410 spoIIIC94 (Kunkel et al., 1988)
BK395 spoIIID83 (Kunkel et al., 1988)
BK541 spoIIIDAemz (Kunkel et al., 1989)
SC622 spoIllE36 (Cutting et al., 1989)
BK338 spoIIIGAI ' (Cutting et al., 1990)
BK754 spolVB165 (Cutting et al., 1991a)
BK558 spoIVCAI33 (Kunkel et al., 1989)
BK556 spoIVCB23 (Kunkel etal., 1989)
K8179 spoIVFAzzTn9I 79H U1 79 (Sandman et al., 1987)
SC834 spoIVFBISZ (Cutting et al., 1990)
K1834b bofA::Tn917Alac::pTV21A2, anZ, pheAI (Ireton & Grossman, 1992)
BSL011 AspaOA::cat This study

BSL021 spoOH::cat This study

BSLSO spoIIID83, bofA::Tn9I 7AlaczszV21A2 (cat) This study

SC 1044 spoIIID83, bofB8, chr: :Tn917QHU144 (Cutting et al., 1990)
BSLSl spoIVFAAB::cat This study

 

a All strains were derived from the wild—type strain PY79, unless noted

otherwise.

b Derived from JH642 (rrpC2, pheAI).
° Derived from 168 (trpCZ).

33

Competent B. subtilis cells were prepared and transformed as described (Dubnau &
Davidoff-Abelson, 1971). Transformants containing pSLl (Lu et al., 1990) were selected
on LB agar (Maniatis et al., 1982) containing kanamycin sulfate (5 ug/ml). The use of
specialized transducing phages SPB::cotA-lacZ, SPB::cotD-lacZ, and SPB::gerE-lacZ has
been described (Cutting et al., 1989; Cutting et al., 1990; Zheng & Losick, 1990).

Strains BSLOll and BSL021 were constructed by transforming competent
pSLl-containing PY79 cells with chromosomal DNA isolated from strains A6514 and
A6665, respectively. Transformants were selected on LB agar containing kanamycin
sulfate (5 pg/ml) and chloramphenicol (5 [Lg/ml).

Strain BSLSO was constructed by transforming competent BK395 cells with
chromosomal DNA isolated from strain K1834. Transformants were selected on LB agar
containing chloramphenicol (5 ug/ml). Chloramphenicol-resistant transformants were
transferred to Difco sporulation (DS) agar (Youngman et al., 1983) containing
chloramphenicol (5 ug/rnl). After 24 hours of incubation at 37 'C the plate was incubated
for 3 days at room temperature to allow sporulation. Two types of colonies were
observed. A small number of brown-pigmented (Pig+) colonies arose presumably due to
complementation of the spoIIID83 mutation in BK395 by congression. The brown
pigment is characteristic of colonies in which cells are undergoing sporulation and
expressing cotA (Sandman et al., 1988). Most of the colonies were Pig- presumably
because they retained the spoIIID83 mutation. One such transfonnant was isolated and
named BSLSO.

Strain BSL51 has the spoIVF operon replaced by a DNA fragment containing a cat
gene. To construct this strain, a derivative of pDGl48 (Stragier et al., 1988), pSL4,
which contains the isopropyl B-D-thiogalactopyranoside (lPTG)-inducible Pam promoter
but lacks the EcoRI fragment containing the origin of replication and kanamycin-resistance

gene that function in B. subtilis, was linearized with Sall and ligated to a 1.9 kbp

34

BglII-SaII fragment containing the entire spoIVF operon from pSC227, which is identical
to pSC224 (Cutting et al., 1991b) except it contains the bofBB mutation (Cutting, 8.
personal communication). The unligated ends were filled-in using the Klenow fragment of
DNA polymerase I and the blunt ends were ligated with T4 DNA ligase. The resulting
plasmid, pSL12, has the Pspac promoter fused to the spa! VF operon. A 2.1 kbp
EcoRV-Sall fragment containing the spoIVF operon was released from pSL12 and ligated
to pBR322 digested with EcoRI and Sall. The unligated ends were rendered blunt with the
Klenow fragment of DNA polymerase I and ligation was continued with T4 DNA ligase.
The resulting plasmid, pSL18, has a unique EcoRI site near the 3' end of spoIVFB.
pSL18 was linearized with EcoRI and then partially digested with SspI to release a 3.9 kbp
vector fragment that retained about 100 bp upstream of the -35 region of the spoIVF
promoter and 110 bp downstream of the EcoRI site near the 3' end of SpoIVFB. This
vector fragment was gel-purified and ligated to a 1.5 kbp SmaI-EcoRI fragment containing
the cat gene from lel 101 (Y oungrnan et al., 1984). The resulting plasmid, pSL19, has
the cat gene flanked by regions upstream and downstream of the spoIVF operon. pSL19
was linearized with Pqu, gel-purified, and used to transform competent PY79 cells.
Transformants were selected on LB agar containing chloramphenicol (5 ug/ml). Southern
blot analysis confirmed that one of the transformants, BSL51, has the spoIVF operon
replaced by the 1.5 kbp DNA fragment containing the cat gene (data not shown).
Sporulation. Sporulation of B. subtilis strains was induced by nutrient
exhaustion in Difco sporulation (DS) medium at 37'C (Sandman et al., 1988).
Overproduction of pro-0K during sporulation of pSLl-containing strains was induwd at the
onset of sporulation (T0) with 1 mM IPTG. Formation of heat-resistant spores was
assayed by collecting 1 ml of B. subtilis culture taken 24 hours after the initiation of
sporulation (1‘24), incubating at 80°C for 15 min, plating serial dilutions on LB agar, and

counting colonies after 24 hours of incubation at 37°C.

35

Western blot analysis. Samples (1 ml) were collected at hourly intervals
during sporulation. Whole-cell extracts were prepared as described (Lu et al., 1990) and
protein concentrations were determined by the method of Bradford (Bradford, 197 6).
Whole-cell extracts (10 pg of protein) were separated by SDS/ 12.5% PAGE and
electroblotted to a poly(vinylidene difluoride) membrane (Matsudaira, 1987). Immunoblot
analysis using polyclonal anti-pro-oK antibodies, which detect both pro-0K and a“, was
performed as described (Lu et al., 1990). Two different methods were used to detect the
primary anti-pro-oK antibodies on blots. Method 1 employed alkaline phosphatase
-conjugated secondary antibody (Bio-Rad) and a color reaction involving 5-
bromo-4-chloro-3-indolyl phosphate as substrate in the presence of nitroblue tetrazolium,
as instructed by the manufacturer (Bio-Rad). Method 2 employed horseradish peroxidase-
conjugated secondary antibody (Bio-Rad) and an enhanced chemiluminesence detection
system, which was used according to the manufacturer's instructions (Amersham).
Method 2 was about two-fold more sensitive for detecting 0" than method 1.

Measurement of B-galactosidase activity. Samples (1 ml) were harvested at
hourly intervals during sporulation, pelleted, and stored at -‘70’C prior to the assay. Cells
were permeabilized by treatment with toluene (Miller, 1972), except where noted cells were
pretreated with SDS followed by lysozyme treatment, or just treated with lysozyme (Mason
et al., 1988). The specific activity of B—galactosidase was determined according to Miller
(Miller, 1972), using o-nitrophenol-B-D-galactopyranoside as substrate. One unit of
enzyme hydrolyzes 1 mole of substrate per min per O.D595 unit of initial cell density.

36

Results

Overproducing pro-oK does not interfere with sporulation of
wild-type B. subtilis. To assess the effects of overproducing pro-oK in wild-type B .
subtilis cells, a multicopy plasmid, pSLl (Lu et al., 1990), which has the intact sigK gene
fused to an IPTG-inducible promoter (P,p.c), was introduced into the wild-type strain
PY79. As a control, the plasmid from which pSLl was derived, pDGl48, was also
introduced into PY79. These strains, and PY79 without plasmid, were then lysogenized
with an SPB phage bearing a (IX-dependent gene fusion, cotD-IacZ. Sporulation of these
strains was carried out in D8 medium and IPTG (1 mM) was added to induce pro-0K
synthesis at the onset of sporulation (T o)- The presence of either pSLl (Table 3.2) or
pDGl48 (data not shown) had no deleterious effect on formation of heat-resistant spores.

To measure the levels of pro—trK and 0K, whole-cell extracts were prepared at hourly
intervals during sporulation and subjected to Western blot analysis using anti-pro—oK
antibodies. The levels of pro-0K and 0K in the strain containing the control plasmid,
pDGl48 (Figure 3.1A), were comparable to the levels in the strain without plasmid,
reported previously (Lu et al., 1990). Pro-oK was first observed at 3 hours into the

sporulation process (T3) and reached a plateau at T4-T5. 0“ was first observed at T4 and
reached a maximum at T5. In the strain containing pSLl, pro-oK was present at T0, i.e., at
the time of addition of IPTG, and increased thereafter until T4. Western blot analysis of
serially diluted T4 cell extract indicated that this strain accumulated at least lO-fold more

pro-oK than did strains with the control plasmid or without plasmid (data not shown).

Even without the addition of IPTG, pro- OK was present at T0 in the strain containing pSLl

and about 5-fold more pro-0K was produced during sporulation than in strains with the

37

Table 3.2 Ability of Bacillus subtilis strains to form heat-resistant spores

in the absence and presence of pro-oK overproduction

 

 

Relevant genotype Sporulationa
No plasmid pSLl
spa+ 100 120
spoIVFAzzTnQI 70H U I 79 2x 10-1 25
spoIVFBI52 4x 10-2 41
spoIVFAAB::cat 2x 10-4 23

 

a The number of heat-resistant spores was determined as described in the Materials and
Methods and is expressed as a percentage of that observed for the wild-type spo+ strain
PY79, which produced about 3x108 spores/ml. The results listed are the average of at least

two independent experiments for each strain. The number of viable cells prior to heat

treatment was found to be similar for all cultures (data not shown).

38

Figure 3.1 Overproduction of pro-0K does not interfere with OK accumulation or
cotD-lacZ expression in wild-type cells. (A) Western blot analyses of whole-cell extracts
(10 ug of protein) prepared from sporulating wild-type strain PY79 containing the control
plasmid (pDGl48) or the plasmid that allows pro- oK overproduction (pSLl); performed as
described in the Materials and Methods using anti-pro-oK antibodies and detection method
1. Lane numbers correspond to the number of hours after the initiation of sporulation. The
positions of pro-GK and 0K are indicated. (B) cotD-directed B-galactosidase activity during
sporulation of PY79 (O), PY79 containing pDGl48 (Cl), and PY79 containing pSLl (A).
Each strain was lysogenized with phage SPB::cotD-lacZ. Points are the average of three

determinations and error bars indicate one standard deviation of the data.

39

A
Q1 234 5 6 7 8

(PDG148) ' . .w """" ,g-td—pKo G
0
WT

(pSLl)

 

:5

300 '

200 '

   

.—
O
Q

 

cotD-directed B-galactosidase
actrvrty (Miller units)

 

Time (hr)

40

control plasmid or without plasmid, suggesting that the Pspac promoter is not fully

repressed during growth or sporulation (data not shown). Even in the strain containing

pSLl, however, no UK was detected until T4 (Figure 3.1A), the time when 6K appeared in

strains with control plasmid (Figure 3.1A) or without plasmid (Lu et al., 1990). This
result is consistent with the idea that processing of pro-<3K is developmentally regulated
(Cutting et al., 1990; Lu et al., 1990). Furthermore, since overproducing pro-0K did not
substantially increase the amount of OK accumulated during sporulation, the availability of
pro-<3K does not appear to be the limiting factor for 0" accumulation.

Expression of a cotD-lacZ fusion requires active 0K RNA polymerase (Lu et al.,
1990; Zheng & Losick, 1990). Figure 3.1B shows that cotD-directed B—galactosidase
activity increased at T5 and reached a similar maximum level in the strain producing pro-0K
from pSLl and in strains with the control plasmid (pDGl48) or without plasmid. The
increase in cotD-directed B—galactosidase activity coincided with the appearance of 0“, not
pro-0K, consistent with the idea that pro-0K is inactive and must be processed to produce
active 0K (Lu et al., 1990).

Taken together, these results demonstrate that overproduction of pro-0K at or before
the onset of sporulation does not interfere with the production of active OK at the normal
developmental time or with the formation of heat-resistant spores in wild-type cells.

Overproducing pro-<3K uncouples pro-0K processing and cotD-lacZ
expression from forespore control. The product of the spoIIIG gene, 00, must be
active in the forespore compartment in order for pro- 0K to be converted to 0K in the mother
cell (Cutting et al., 1990; Lu et al., 1990). We therefore anticipated that overproduction of
pro-0K in a spoIIIG mutant would have no effect on sporulation or oK-dependent gene

expression. To our surprise, we found that a small amount of a polypeptide of the

41

Figure 3.2 Overproduction of pro-0K uncouples pro-0K processing and cotD-lacZ
expression from forespore control. (A) Levels of pro-<3K and 0K in a pSLl-containing
spoIIIGAI mutant during sporulation. Western blot analysis using anti-pro—crK antibodies
and detection method 2 was performed as described in the Materials and Methods except 15

ug of total protein was loaded in each lane. Lane numbers correspond to the number of

hours after the initiation of sporulation. The unmarked lane contained 5 ug of total protein
from wild-type PY79 cells harvested at T5 during sporulation, a time when both pro-0K and
0K are present and could serve as markers. (B) cotD-directed B—galctosidase activity during
sporulation of pSLl-containing PY79 (A; same data as shown in Figure 3.1), spoIIIA53
(O), spoIIIGAI (A), spoIVBI65 (O), and spoIIIE36 (I) strains. Points are the average
of three determinations and error bars indicate one standard deviation of the data. The

spoIIIGAI mutant containing pDGl48 (0) served as a negative control.

42

012345678

 

1
A
G
I
I
I

 

-
0
0
2

$25. .8533 558a
ommEmeH—oflmwé ceuoohcA—Heo

300 '

 

Time (hr)

43
expected size for ex was detected by Western blot analysis beginning at T4 during

sporulation of a pro-oK-overproducing spoil/GA] mutant (Figure 3.2A, the faint band
immediately below the dark pro-eK band). The level of this polypeptide remained about the
same at T4 through T3 of sporulation and we estimated the level to be between 10 and 20%
of the level observed in wild-type cells at T5 of sporulation (data not shown). About one
hour after the appearance of this polypeptide, cotD-lacZ expression began to increase and
reached about half the wild-type level by T3 (Figure 3.2B, closed triangles).
Overproduction of pro- 0" did not restore spore-forming ability to the spoIIIG mutant,
however, presumably because (IO-dependent, forespore-specific gene expression is
required for heat-resistant spore formation (data not shown).

We infer that the polypeptide comigrating with OK and detected by anti-pro-eK
antibodies has GK activity based on the correlation between its appearance and expression of
the oK—dependent cotD gene. The fact that the putative 0K appears with similar timing as 0K
in wild-type cells suggests that it is produced by a similar mechanism. However, we
cannot exclude the possibility that it is a closely related, but improperly processed,
polypeptide(s) with GK activity. The sensitive detection method used for the Western blot
shown in Figure 3.2A revealed several polypeptides smaller than 0“ that could be
breakdown products of pro-0K. However, neither these polypeptides nor pro-eK itself is
likely to account for the cotD-lacZ expression seen in the spoIIIG mutant since the small
polypeptides and pro-0K were present in other mutants (i.e., sigE, spoOH, spoIIAC, and
SpoIIGA mutants) overproducing pro-0K, yet these mutants failed to increase cotD-lacZ
expression above a low level (see below).

Other mutants that are defective in forespore-specific gene expression showed

similar responses to overproduction of pro-0K. Overproduction of pro-0K in spoIIlA53,

Figure 3.3 Levels of pro-eK and 0K in mutants overproducing pro-eK during
sporulation. Western blot analysis using anti-pro—eK antibodies and detection method 2
was performed as described in the Materials and Methods except 15 ug of total protein from
cells harvested at T5 during sporulation was loaded in each numbered lane. The
pSLl-containing mutants were spoIVFA::Tn9I 70H U1 79 (lane 1), spoIVFBISZ (lane 2),
spoIIIA53 (lane 3), spoIIIE36 (lane 4), spoIVBI65 (lane 5), spoOA::cat (lane 6),
AsigExerm (lane 7), and spoIIlDAerm (lane 8). Alternate lanes (without numbers)

contained 5 ug of total protein from wild-type PY79 cells harvested at T5 during

sporulation, a time when both pro-erK and 0K are present and could serve as markers.

 

46

spoIIIE36, and span/8165 mutants during sporulation resulted in accumulation of a low
level of a polypeptide that comigrates with 0“ (Figure 3.3, lanes 3 to 5). The timing and
level of cotD-lacZ expression in the spoIIlA and SpoIVB mutants was similar to that in the
spoIIIG mutant, and the level was somewhat lower in the spoIlIE mutant (Figure 3.28).
As for the spoIIIG mutant, overproduction of pro- oK did not enhance the ability of these
mutants to produce heat-resistant spores (data not shown).

Overproducin g pro-GK from pSLl appeared to uncouple cotD-lacZ expression in the
mother cell from dependence on forespore events. However, it was possible that cotD-lacZ

was being expressed in the forespore, since pro-0K was synthesized prior to the formation

of the asymmetric septum and pSLl was expected to be present in both compartments. As
measured by differential sensitivity to SDS (Cutting et al., 1991a) and release by lysozyme
treatment (Mason et al., 1988), however, cotD-IacZ expression occured predominantly, if
not exclusively, in the mother cell (data not shown).

We also considered the possibility that the apparent uncoupling resulted from a
titration effect of DNA present in the multicopy plasmid, pSLl, rather than from pro-oK
overproduction. For example, pSLl contains several binding sites for SpoIIID, a
DNA-binding protein that has been shown to repress transcription of cotD (Halberg &
Kroos, unpublished results; Kroos et al., 1989; Halberg, 1992). We constructed a
deletion derivative of pSLl, called pSLle, that retained the known SpoIIID binding sites,
including the promoter region and the first 40 codons of the sigK open reading frame, but
removed the rest of sigK and 556 bp of downstream B. subtilis DNA. A
pSLle-containing spollIGAI mutant did not increase cotD-IacZ expression above the
background level during sporulation (data not shown). The wild-type strain PY79 bearing
pSLle showed the same level and timing of cotD-lacZ expression (data not shown) as

wild-type without plasmid (Figure 3.1B). These results are inconsistent with the idea that

47
titration of SpoIIID is responsible for uncoupling cotD-IacZ expression from its normal
dependence on forespore events.

Overproducing pro-0K rescues sporulation of spa! VF mutants. The
partial rescue by overproduced pro- 0" of defects in forespore gene expression mutants
provoked us to examine the effects of overproducing pro-0K in spoIVF mutants. spoIVF is
a two-cistron operon whose products have been proposed to reside in the outer forespore
membrane and govern the processing of pro-oK in response to a signal from the forespore
(Cutting et al., 1990; Cutting et al., 1991b). A transposon insertion mutation in the A
cistron (spoIVFA : :Tn9I 79H U1 79) or a missense mutation in the B cistron (spoIVFBISZ)
(Coote, 1972; Sandman et al., 1987; Cutting et al., 1991b) block processing of pro-0K (Lu
et al., 1990) and expression of OK dependent genes (Kunkel et al., 1988; Sandman et al.,
.1988; Cutting et al., 1989; Zheng & Losick, 1990), yet both mutants exhibit an
oligosporogenous phenotype (Table 3.2). A null mutant (spoIVFAAB::cat), in which both
cistrons were deleted and replaced by a cat gene (see Materials and Methods), was also
tested. In comparison to the other two spoIVF mutants, the spoIVFAAB::cat mutant
exhibited a more severe sporulation defect (Table 3.2). Like the other spoIVF mutations,

the spoIVFAAB::cat mutation blocks processing of chromosomally encoded pro-6K as well
as (SK—directed gene expression when pro- 0" is produced at the normal level (data not

shown).

Table 3.2 shows that overproducing pro-0K from pSLl greatly enhanced the ability
of all three spoIVF mutants to form heat-resistant spores. This distinguishes the spoIVF
mutants from the mutants blocked in forespore-specific gene expression. The spoIVF

mutants, like the forespore gene expression mutants, produced a low level of a polypeptide

that comigrates with 0" during sporulation (Figure 3.3, lanes 1 and 2; Figure 3.4A) and

expressed cotD-lacZ (Figure 3.48). Overproducing pro-0K in the spoIVF mutants

48

Figure 3.4 Rescue of OK accumulation and cotD-lacZ expression in spoIVF mutants
overproducing pro-0K. (A) Levels of pro- 0“ and 0K in a pSLl-containing spoIVFAAB::cat
mutant during sporulation. Western blot analysis using anti-pro-oK antibodies and
detection method 2 was performed as described in the Materials and Methods except 15 ug
of total protein was loaded in each lane. Lane numbers correspond to the number of hours

after the initiation of sporulation. The unmarked lane contained 5 ug of total protein from
wild-type PY79 cells harvested at T6 during sporulation, a time when both pro-<1K and 0“
are present and could serve as markers. (B) cotD-directed B—galactosidase activity during
sporulation of pSLl-containing PY79 (A; same data as shown in Figure l),
spoIVFA::Tn91 701-! U1 79 (O), spoIVFBISZ (I), and spoIVFAAB::cat (A) strains.
Points are the average of three determinations and error bars indicate one standard deviation
of the data. The spoIVFAAB::cat mutant containing pDGl48 (CI) served as a negative

control.

49

012345678

K
a
m
D.
+

   

A-"‘-

  

t
a
m

m

A

A

F

V

I

" ‘- ' «up-“p- *-
Q

 

0

300 "
0

EB: 5:3 £23.“
omaEmSoEmwé 3326-98

 

Time (hr)

50

appeared to allow a small amount of OK to be made; an amount sufficient for substantial

sporulation and cotD-lacZ expression. These results were surprising given the critical role
proposed for spoIVF gene products in pro- OK processing (Cutting et al., 1990; Cutting et

al., 1991b) and suggest that there is a spoIVF-independent mechanism for converting

pm—oKtoaK.

Production of active 01‘? is critical for pro-oK processing. To explore the

requirements for spoIVF-independent pro-oK processing, we examined the effects of
overproducing pro-oK in earlier-blocked sporulation mutants. Mutants in this group all fail
to make pro-oK (Lu & Kroos, unpublished results; Lu et al., 1990). Of particular interest
was a sigE mutant since sigE encodes OE (Stragier et al., 1984; Trempy et al., 1985), a
sigma factor that directs early mother-cell gene expression (Driks & Losick, 1991). A sigE
mutant fails to express spoI VF (Cutting et al., 1991b) as well as many other
mother-cell-specific genes, so we wanted to determine whether spoIVF-independent pro-oK
processing would occur in this mutant. Overproducing pro-oK in the sigE mutant did not
result in accumulation of a polypeptide that comigrates with OK (Figure 3.3, lane 7; note
that enhanced accumulation of presumed pro-oK breakdown products makes it difficult to
see the 0" region in the photograph, but several different exposures of each of two separate
Western blots revealed no evidence for a polypeptide that comigrates with (K).
Furthermore, cotD-IacZ expression in the sigE mutant overproducing pro— oK increased to
less than half the already low level observed in the spoIVF null mutant (Table 3.3). These
results indicate that active 05 is critical for spoIVF-independent pro-oK processing. Not
surprisingly, overproduction of pro-oK did not enhance the ability of the sigE mutant to
form heat-resistant spores (data not shown).

Other mutants that fail to make active 05 showed similar results as the sigE mutant

51

Table 3.3 Summary of cotD-IacZ, gerE-lacZ, and cotA-lacZ

expression in strains overproducing pro-oK

 

W

 

spo+

spoIIIA53
spoIIIE36
spoIIlGAI
spoIVBI 65

spoIVFA : :Tn91 7011 U1 79
spoIVFBISZ
spoIVFAAB::cat

spoAOA::cat
spoOchat
spoIIACI
spoIIGAAS
AsigExenn

spoIIIDAerm
spoIIID83, bofA::cat

MID-WM
114 (100)ll 222 (100) 238 (100)
59 (52) 138 (62) 17(7)

20 (18) 52 (23) 16(7)
72 (63) 174 (78) 10 (4)
52 (46) 75 (34) 18 (8)
74 (65) 61 (27) 24 (10)
56 (49) 200 (90) 15(6)
18 (16) 46 (21) 3(1)

2 (2) 3 (1.4) ND:
6(5) 23 (10) ND

8 (7) 36 (16) 11 (5)
7 (6) 63 (28) ND
7(6) 39 (18) 3(1)
14(12) 104 (47) 17 (7)
93 (82) 174 (78) 128 (54)

 

t The values are the maximum B-galactosidase activity of the fusion in the indicated wild-
type or mutant pSLl-containing strain during an 8 hr time course of sporulation, expressed
as a percentage of the peak activity of the corresponding fusion in the wild-type strain
without plasmid. Average peak levels of B-galactosidase activity were 20, 190, and 120
Miller units for the COM, cotD, and gerE fusions, respectively. The values in parentheses

are normalized with respect to the corresponding fusion in the wild-type strain with pSLl.

b ND, "not determined".

52

when pro-oK was overproduced (Table 3.3 and data not shown). These included
spoOA::cat and spoOH::cat mutants, which are blocked very early in sporulation at the
initiation step (Hoch et al., 1978), and spoIIACI and spoIIGAAS mutants, which
accumulate pro-OE but fail to process it to active 05 (Jonas & Haldenwang, 1989). The
only differences we noted among this group of mutants were that the spoOA mutant
accumulated less of the presumed pro- 0" breakdown products (Figure 3, lane 6) and
expressed less cotD-directed B-galactosidase activity (Table 3.3). This finding suggests
that pro-oK breakdown products smaller than 0K may account for the residual corD-IacZ

expression observed in mutants (except the spoOA mutant) unable to make active 08.
Effects of overproducing pro-oK on gerE and MM expression. gerE

and COM, like cotD, are transcribed by oK-containing RNA polymerase (Sandman et al.,
1988; Cutting et al., 1989; Zheng et al., 1992). To determine the generality of our results,
we tested the effects of overproducing pro-oK on expression of gerE-lacZ and com-lacZ
fusions in wild-type and mutant strains.

Overproducin g pro- oK in wild-type cells resulted in gerE-directed B—galactosidase
activity beginning at T3, about 2 hours earlier than in wild-type cells without plasmid, and
reached a maximum level that was about 2-fold higher than in the strain without plasmid
(Table 3.3). com-directed B-galactosidase activity in the wild-type strain overproducing
pro-6K began at the same time as the wild-type strain without plasmid (T 4), but like
gerE-lacZ expression reached about twice the level observed for the strain without plasmid
(Table 3.3).

In general, results for the gerE-lacZ fusion were similar to those for cotD-lacZ,
showing that pro-oK overproduction substantially uncouples expression of both of these
oK-dependent genes from their normal dependence on forespore events and spoIVF

function. One difference was that gerE-lacZ expression was somewhat higher than cotD-

53

lacZ expression in spoOH, spoIlAC, SpoIIGA, and sigE mutants overproducing pro-6‘.

Perhaps the presumed pro-0K breakdown products observed in these mutants when pro—0K
is overproduced (Figure 3.3, lane 7; and data not shown) support a higher level of gerE

than cotD transcription. This interpretation could also explain the earlier induction of
gerE-lacZ expression in wild-type cells and all the mutants we tested when pro-oK was
overproduced (data not shown). Consistent with this idea is the observation that gerE
failed to be expressed in a spoOA mutant (Table 3.3), which accumulated less of the
presumed pro-0K breakdown products (Figure 3.3, lane 6). Uncoupling of cotA-lacZ
expression from dependence on forespore events and spoIVF function was not as apparent
in mutants overproducin g pro- oK. Perhaps the COM promoter requires a higher threshold
concentration of OK (or active pro— 0K breakdown products) than that required for c010 and
gerE transcription (Oke & Losick, 1993). In addition, production of GerE is expected to
repress cotA transcription (Sandman et al., 1988; Zheng et al., 1992).

spoIIID is required for efficient pro-oK processing and bof mutations
bypass this requirement. SpoIIID is a small, DNA-binding protein (Halberg &
Kroos, unpublished results; Kunkel et al., 1989) that is required for the DNA
rearrangement that generates sigK (Stragier et al., 1989) and is also needed for
transcription of sigK (Kunkel et al., 1988; Kroos et al., 1989). Therefore, a spoIIID
mutant fails to make pro-oK (Lu et al., 1990). The ability to overproduce pro- oK from a
plasmid enabled us to bypass the need for SpoIIID in making pro- oK, so that we could
examine the effect of a spoil/D mutation on pro-0K processing.

Overproduction of pro-oK in a spoIIIDAerm mutant did not enhance its ability to
make heat-resistant spores (data not shown). However, a low level of a polypeptide that

comigrates with 0K was detected during sporulation (Figure 3.3, lane 8) and expression of

54

Figure 3.5. A bofA mutation bypasses the requirement for SpoIIID in pro-oK
processing. (A) cotD -directed B-galactosidase activity during sporulation of
pSLl-containing PY79 (A; same data as shown in Figure 3.1), spoIIIDAerm (I), and
spoIIID83, bofA::cat (O) strains. Points are the average of three determinations and error
bars indicate one standard deviation of the data. The spoIIIDAerm mutant containing
pDGl48 (Cl) served as a negative control. (B) Levels of pro- oK and 0“ during sporulation
in a pSLl-containing spoIIID83, bofA::cat double mutant, as determined by Western blot
analysis performed as described in the Materials and Methods using anti-pro—crK antibodies

and detection method 1.

55

ll
1
I III
ll
1

4
Time (hr)

 

. . _ 0
0 0 0
0 0

2 1

EH: 35% 3E?
ommEmSoflmwé 382%..98

300 ‘

B

 

8
7
6
5
4
3
2
1
0 a
mm
mm
b

56

cotD-IacZ increased, to a small extent, late in sporulation (Figure 3.5A, Table 3.3);
expression of gerE-lacZ increased substantially (Table 3.3). These results show that
spoIIID is required for efficient processing of pro-0K, but suggest that a small amount of
0" can accumulate in the absence of spoIIID when pro-6K is overproduced.

Two factors might account for inefficient pro-0K processing in the spoIIID mutant.
First, the spoIVB gene is expressed at only 20% of its normal level in a spoIIID mutant,
presumably causing decreased production in the forespore of SpoIVB, a component of the
signal transduction pathway that activates pro-0K processing (Cutting et al., 1991a).
Second, a negative regulator of pro-oK processing, BofA, is overproduced at least 7-fold in
the SpoIIID mutant (Ireton & Grossman, 1992). Both of these effects could be eliminated
with a bofA null mutation because the negative regulator (BofA) would not be produced
and the need for a signal from the forespore would be bypassed (Cutting et al., 1990).
Therefore, we constructed a double mutant (spoIIID83 bofA.°:cat) in which both spot/ID
and bofA were inactivated (see Materials and Methods).

Overproducing pro-OK in the double mutant restored 0K accumulation (Figure 3.5B)

and cotD-lacZ expression (Figure 3.5A) to about the normal levels during sporulation. To
determine whether this effect is specific to bofA, we also tested a spoIIID83 bojB8 double
mutant. The bofB8 mutation lies near the 3' end of spoIVFA and appears to remove the
inhibitory effect of SpoIVFA on SpoIVFB, so that pro- oK processing 00cm in the absence
of a signal from the forespore (Cutting et al., 1991b). Overproducing pro-oK in the
spoIIID83 bofB8 double mutant resulted in normal processing of pro-oK (data not shown),
despite the fact that the negative regulator, BofA, should be overproduced in this double
mutant. Thus, bof mutations can bypass the requirement for spoIIID in pro-oK processing.
However, overproducin g pro—oK did not enhance the ability of either double mutant to form

heat-resistant spores (data not shown), suggesting that SpoIIID plays another role(s) in

57

sporulation in addition to its multiple roles in generating active 0".

Discussion

We have shown that overproducing pro- oK substantially uncouples oK—dependent,
mother-cell gene expression from dependence on a signal from the forespore. Futhermore,
spoIVF gene products, which are made in the mother cell and appear to transduce the
forespore signal normally governing pro-aK processing (Cutting et al., 1991b), become
largely dispensable for sporulation when pro-0K is overproduced. In spoIVF mutant cells
overproducing pro-0K, a small amount of 0K appears to accumulate beginning at T4 during
sporulation (Figure 3.4). This increase in the 0K level probably results from increased

processing of pro-oK rather than increased stability of OK, because 0" stably accumulates in
growing cells and cells in the early stages of sporulation when it is produced from a
truncated sigK gene fused to an IPTG-inducible promoter (Halberg, 1992; Oke & Losick,
1993; Halberg et al., unpublished results). Thus, sporulating cells appear to acquire the
ability to process pro- oK to 0K in a spoIVF-independent manner. The apparent temporal
regulation of spoIVF-independent processing during sporulation is probably due to its
dependence on OE. Presumably, (:3 RNA polymerase transcribes one or more genes whose
products are required for spoIVF-independent processing of max.

Does spoIVF-independent processing occur when pro-oK is made at its normal level
during sporulation? A spoIVF null mutant fails to produce a level of OK detectable in our
Western blot experiments (data not shown); however, the mutant (spoIVFAAB::cat; Table

3.2) forms heat-resistant spores about 30-fold more efficiently than a sigK null mutant

58

(spoIIIC94; data not shown). This observation suggests that a small amount of OK activity
is produced by a spoIVF-independent mechanism even when pro-0K is not overproduced

What is the relationship between the spoIVF-independent and spoIVF-dependent
mechanisms for pro-0K processing? The answer is likely to depend on how spoIVF gene
products normally function in processing. Previous genetic studies suggest that SpoIVFA
and BofA negatively regulate the activity of SpoIVFB, the product of the downstream gene
in the spoIVF operon, until a signal is received from the forespore (Cutting et al., 1990;
Cutting eta1., 1991b; Ricca et al., 1992). SpoIVFB has been proposed to be the protease
that processes pro- oK or a regulator of the processing reaction (Cutting et al., 1991b). If
SpoIVFB is a protease that processes pro-0K, spoIVF-independent processing probably
involves another protease(s) substituting weakly for SpoIVFB. Alternatively, if SpoIVFB
regulates processing (e.g., by stimulating a protease or interacting with pro-oK to make it a
better substrate for a protease), perhaps spoIVF-independent processing represents weak
activity of the protease normally responsible for pro-<3K processing. To explore the
mechanism of spoIVF-independent processing further, we. have isolated mutants that
suppress the sporulation defect of a spoIVF null mutant (see Chapter 5).

Several observations suggest that spoIVF gene products retain partial function in
some of the mutants we examined. The spoIVF null mutant (spoIVFAAB::cat) exhibited a
more severe sporulation defect than the spoIVFA::Tn917QHU179 and spoIVFBISZ
mutants (Table 3.2), suggesting that the latter mutants are not null mutants. Consistent
with this idea is the observation that these mutants expressed cart) at a higher level tlun the
null mutant when pro- 0K was overproduced (Figure 3.4B). The level of cotD expression
in spoIIIA, spoIIIC, and SpoIVB mutants overproducing pro-oK was similar to that in the
non-null spoIVF mutants, whereas cotD expression in a spoIIIE mutant was comparable to

that in the spoIVF null mutant (Table 3.3). Perhaps the spoIIIE mutant is capable only of

59

spoIVF-independent processing, while the other forespore regulatory gene mutants, in
addition, exhibit feeble, spoIVF-dependent processing of overproduced pro—0K.

A spollID mutation produces a severe pro-oK processing defect. A spoIIID mutant
overproducing pro-oK expressed c010 at a level comparable to the spoIVF null mutant
(Table 3.3), suggesting that only spoIVF-independent processing was Operative. bof
mutations bypassed the requirement for 31201110 for efficient processing of overproduced
WK (Figure 3.5B) and high-level expression of oK-dependent genes (Table 3.3). The
bof mutations restore pro-oK processing and oK-dependent gene expression in forespore
regulatory gene mutants (Cutting et al., 1990). Hence, the spoIIlD mutant behaves like a
forespore regulatory gene mutant with respect to its ability to be bypassed by bofA or bofB
mutations. This suggests that SpoIIID, like the products of the forespore regulatory genes,
is less directly involved in pro-oK processing than spoIVF gene products, since the
requirement for spoIVF is not bypassed by bofA mutations, and bofB mutations lie in
spoIVF (Cutting et al., 1990; Cutting et al., 1991b). Indeed, it has been shown that a
spoIIID mutation impairs expression of several forespore-specific genes, including
spoIVB, whose product lies on a signal transduction pathway governing pro-0K processing
(Cutting et al., 1991a). Thus, SpoIIID may affect spoIVF-dependent pro-oK processing
indirectly, due to its influence on forespore-specific gene expression. Alternatively or in
addition, SpoIIID may influence pro-oK processing directly or through an effect on mother-
cell gene expression, and bof mutations may render the processing reaction insensitive to
the loss of SpoIIID. In the mother cell, SpoIIID positively and negatively regulates
expression of both 05- and oK-transcribed genes (Kunkel et al., 1988; Errington et al.,
1989; Kroos et al., 1989; Kunkel et al., 1989; Illing & Errington, 1991b; Ireton &
Gossman, 1992). Defective mother-cell and/or forespore gene expression presumably

accounts for the failure of bof spolllD double mutants to sporulate even when pro- oK is

60

overproduced and 0“ production is restored. Clearly, SpoIIID must serve another essential
role(s) in sporulation in addition to its roles in generating the rearranged sigK gene
(Stragier et al., 1989), activating sigK transcription (Kunkel et al., 1988; Kroos et al.,

1989), and permitting efficient processing of pro—0K.

Acknowledgements

We thank R. Losick, A. Grossman, S. Cutting, W. Haldenwang, C. Moran, and
P. Setlow for providing bacterial strains. We thank V. Oke, R. Halberg, and J. Brandner,
and S. Triezenberg for helpful advice on the manuscript.

This research was supported by grant GM43585 from the National Institutes of
Health and by the Michigan Agricultural Experiment Station.

Chapter 4

SpoIVFB enhances 0K accumulation from pro-0K in
the absence of other sporulation-specific gene products
during growth of B. subtilis or E. coli

61

62

Abstract

During sporulation of the gram-positive bacterium, Bacillus subtilis, the mother-
cell-specific sigma factor, 0", directs transcription of genes whose products are involved in
spore cortex and coat synthesis. 0" is first made as an inactive precursor, pro-0K, at 3
hours into sporulation and is processed to the active form 1 hour later by removal of 20
amino acids from the N-terminus. Processing of pro-oK is a highly regulated event that
normally involves transducing a signal(s) from the forespore to activate the processing
machinery in the mother cell. One component of this signal tranduction pathway is
SpoIVFB, the product of the distal gene of the two-cistron spoIVF operon that is expressed
in the mother cell. Genetic studies suggest that SpoIVFB may encode the protease that
processes pro-oK or a regulator of the processing event. By coexpressing spoIVFB
(encoding SpoIVFB) and sigK (encoding pro-0K) in growing B. subtilis or E. coli, we
show here that SpoIVFB is able to enhance the accumulation of OK in the absence of other
sporulation-specific gene products. The implications for the role of SpoIVFB in prooK
processing are discussed.

63

Introduction

Sporulation of the gram-positive bacterium Bacillus subtilis involves both
physiological and morphological changes. The first easily observed morphological change
is the formation of an asymmetrically positioned septum that partitions the cell into two
parts, the mother cell and the forespore. Although both compartments receive a copy of the
genome after the last round of DNA replication, they follow different pathways of
differentiation. Eventually, the forespore becomes a dormant cell, a spore, that is highly
resistant to harsh environmental conditions, while the mother cell lyses after completing the
synthesis of the spore cortex that is deposited between the forespore membranes and the
synthesis of the spore coat proteins that encase the forespore (Losick et al., 1986). Gene
expression during these morphological changes is regulated both temporally and spatially,
in part, through the synthesis and activation of a cascade of sigma factors. Each sigma
factor confers on core RNA polymerase the ability to transcribe a set of genes at a certain
stage of development in one of the compartments (Losick & Stragier, 1992).

One of the sigma factors, ex, is a mother-cell-specific sigma factor that directs
transcription of genes coding proteins that are involved in spore cortex and coat synthesis
(Kroos et al., 1989; Zheng & Losick, 1990; Cutting et al., 1991a; Kroos, 1991; Zheng et
al., 1992). Generation of active 0K involves multilevel regulation during sporulation
(Stragier et al., 1989; Cutting et al., 1990; Lu et al., 1990; Oke & Losick, 1993). One
important level of regulation is post-translational. It has been demonstrated that 0" is that
made as an inactive precursor, pro-0K, at 3 hours into Marion and is processed to active
0" 1 hour later (Lu et al., 1990). Interestingly, processing of pro-oK is blocked in several
mutants that are defective in forespore-specific gene expression (Lu et al., 1990), such as a

spoIIIG mutant, which bears a mutation in the gene encoding the forespore-specific sigma

64

factor, 00 (Sun et al., 1989). Thus it has been proposed that processing of the mother-cell-
specific sigma factor 0“ is coupled to forespore events controlled by 0‘3 (Cutting et al.,
1990; Lu et al., 1990). However, the dependence of pro-oK processing on forespore gene
products can be relieved by suppressor mutations in bofA or spolVFA (Cutting et al.,
1990; Cutting et al., 1991b). Genetic studies suggest that the bofA gene product, BofA,
negatively regulates pro- 0K processing until a signal from the forespore is received (Ricca
et al., 1992), while SpoIVFA, the product of the first gene in the spoIVF operon, plays
dual roles in pro-oK processing (Cutting et al., 1991b). SpoIVFA appears to negatively
regulate processing until the forespore signal is received, but SpoIVFA also appears to
regulate processing positively by stabilizing SpoIVFB, another important protein normally
required for processing (Cutting et al., 1990; Cutting et al., 1991b).

SpoIVFB is the product of the distal gene of the spa! VF operon, whose
transcription relies on an earlier mother-cell sigma factor, 05, during sporulation (Cutting et
al., 1991b) . SpoIVFB is inferred to play an important role in pro-oK processing since a
missense mutation in spolVFB blocks processing (Lu et al., 1990) and because the
mutations in bofA and SpoIVFA that restore processing in forespore mutants fail to restore
processing in the spoIVFB mutant (Cutting et al., 1990). Hence, SpoIVFB appears to
play a more direct role in pro-oK processing than forespore gene products. Two additional
findings suggest that the only function of SpoIVFB during sporulation is in processing
pro-0K. First, deletion of the pro-amino acid coding sequence from the gene that normally
encodes pro-0K (sigK) bypasses the requirement for spoIVFB in oK-dependent mother-cell
gene expression (Cutting et al., 1990). Second, overproduction of pro-0K rescues
sporulation of a spa! VF null mutant, apparently by allowing a small amount of OK to

accumulate. While these studies demonstrate that the need for SpoIVFB can be

circumvented in various ways, it is clear that SpoIVFB normally plays an important role in

65

pro-oK processing during sporulation. Thus, SpoIVFB has been proposed to be either the
protease that processes pro- oK or a regulator of the processing event (Cutting et al., 1990;
Lu et al., 1990; Cutting et al., 1991b).

To further investigate the role of SpoIVFB in pro-oK processing, a B. subtilis strain
capable of coexpressing spoIVFB and sigK during growth was constructed. The strain
showed 2-fold more oK-dependent gerE-lacZ expression than a strain that only expressed
sigK. Coincident with the increase of gerE—lacZ expression, a polypeptide that comigrated
with ax was detected by Western blotting. Furthermore, coexpressing spoIVFB and sigK
in E. coli produced 0K capable of reconstituting with B. subtilis core RNA polymerase to

direct transcription from oK-specific promoters in vitro.

Materials and Methods

Bacterial strains. E. coli strains AG115 [araDI39, A(ara, leu)7697, AlacX74,
galU-, galK-, hsr-, hsm+, strA, (F‘proAB, laCIQZ::Tn5)] and JM103 [supE, hst4, thi,
A(lac-proAB), (F'traD36 proAB+ laclqlacZAM15)] were obtained from A. Grossman
(Massachusetts Institute of Technology) and G. Zeikus (Michigan State Unversity),
respectively, and served as hosts for construction and maintenance of plasmids. E. coli
and B. subtilis strains used in this study are listed in Table 4.1. Competent B. subtilis cells
were prepared and transformed as described (Dubnau & Davidoff-Abelson, 1971).
Transformants containing pSLl (Lu et al., 1990) were selected on LB agar containing
kanamycin sulfate (5 ug/ml). The use of specialized transducing phages SPB::cotA-lacZ,
SPB::cotD-lacZ, and SPBzzgerE—lacZ has been described (Cutting et al., 1989; Cutting et
al., 1990; Zheng & Losick, 1990).

 

twp—-

 

Table 4.1 Bacterial strains

 

 

m Genotype Source
E. coli

ESLla pSL1/JM103 This study
ESL16a pSL16/JM103 This study
ESL17a pSL17/JM103 This study
ESL27a pSL27/IM103 This study
B. subtilis

PY79 spo+ B. Kunkel
SC745 bofB8 spoil/GA] S. Cutting
BK338 spoIlIGAI B. Kunkel
BSL52 pSL1/SC745 This study
BSL53 pSL13/SC745 This study
BSL54 pSL14/SC745 This study
BSL54w pSL31/BK338 This study
BSL55 pSL25/SC745 Pig-I This study
BSL56 pSL25/SC745 Pig+II This study
BSL57 pSLllBSL53 This study
BSL58 pSLllBSL54 - This study
BSL58w pSLllBSL54w This study
BSL59 pSLllBSL55 This study
BSL6O pSLllBSL56 This study

 

a Pig+ and Pig- describe the pigmentation phenotype of the colonies sporulating on DS

agar. See Figure 4.1B for a representation of the DNA structure of these strains.

67

Plasmids. Plasmid pSL13 has the spoIVFB gene fused to an isopropyl B-D-
thiogalactopyranoside (IPTG)~inducib1e promoter, Paw-0° A 1.0 kbp HindIII-Sall fragment
containing the entire spoIVFB open reading frame as well as 80 bp of the 3' end of the
spoIVFA gene (including the 120138 mutation) was released from pSC227 (Lu & Kroos,
1994). This fragment was ligated to HindIII-Sall digested pSL4, a derivative of pDGl48

(Stragier et al., 1988) that contains the Pa,” promoter but lacks the EcoRI fragment

bearing the origin of replication and kanamycin resistant gene that function in B. subtilis.
The resulting plasmid, pSLl 1, has spoIVFB fused to the Pme promoter. pSLll was then
linearized with BamHI and ligated to a 1.5 kbp fragment containing the cat gene from
BamHI-digested pMIl 101(Youngman et al., 1984). The final construct, pSLl 3, is an
integrative plasmid in B. subtilis with chloramphenicol resistance as a selectable marker.
Plasmids pSL14 and pSL31 both have the entire spoIVF operon fused to the PM
promoter, except that spoIVF in pSL14 contains a bojB8 mutation. A 1.9 kbp BglII-Sall
fragment containing the spa] VF operon was released from pSC227(bofB8) or pSC224
(Cutting et al., 1991b). The fragments were ligated to Sall-linearized pSL4 in separate
reactions, the unligated ends were rendered blunt using the Klenow fragment of DNA
polymerase I, and ligation was continued using T4 DNA ligase. The resulting plasmids,
pSL12 (bofB8) and pSL8, have the spoIVF operon fused to Pspu. pSL14 (bofB8) and
pSL3] were constructed by ligating BamHI-linearized pSL12 (bofB8) and pSL8 with the
cat gene released from BamHI-digested lel 101. Thus pSL14 (bofB8) and pSL31 are
integrative plasmids in B. subtilis with chloramphenicol resistance as a selectable marker.
Plasmid pSL25 has an in-frame deletion in spolVFB fused to the Pspac promoter.
To construct the in-frame deletion, pSLll (see above) was digested with PvuII, which
cleaved once near the middle of spoIVFB and twice in the vector, generating three
fragments with sizes of 93 hp, 1.7 kbp, and 3.2 kbp. The 1.7 kbp fragment was gel-
ptuified and digested with EcoRI. This released from one end a 381 bp fragment encoding

68

amino acids 149 to 276 of SpoIVFB (Cutting et al., 1991b). The EcoRI site at one end of
the resulting 1.3 kbp fragment was blunt-ended using Klenow fragment of DNA
polymerase I and then ligated with the purified 3.2 kbp PvuII fragment using T4 DNA
ligase. The resulting plasmid, pSL20, has a spoIVFB fragment, encoding the first 148
amino acids and the last 11 amino acids of SpoIVFB, fused to the Pspnc promoter. pSL20
was digested with Hind III and Sall to release the in-frame-deleted spalVFB and ligated
with HindIII-Sall digested pSL4. The resulting plasmid, pSL24, was further linearized
with BamHI and ligated with the cat gene released from BamHI-digested pMI1101. The
resulting plasmid, pSL25, is an integrative plasmid in B. subtilis with chloramphenicol
resistance as a selectable marker.

pSLl6 is a multicopy plasmid that has the spoIVFB gene fused to the P8‘)“
promoter. Construction of this plasmid was similar to that of pSLll (see above), except
the vector is the B. subtilis/E. coli shuttle plasmid, pDGl48 (Stragier et al., 1988).

pSL17 is a multicopy plasmid that has both spoIVFB and sigK fused to the Pa,“

promoter. To construct pSL17, pSL16 was linearized with Sall, the ends were filled-in
using the Klenow fragment of DNA polymerase I, and the ends were dephosphorylated
using calf intestine alkaline phosphatase. This fragment was ligated to a 1.4 kbp SspI-
HindIII fragment from pSK5 containing the sigK gene (Kunkel et al., 1990), which was
rendered blunt-ended by filling-in the HindIII site. The resulting plasmid, pSL17, has

sigK inserted downstream of spoIVFB. In this construct, sigK was also fused to the P110
promoter located immediately downstream of the spoIVFB gene (Cutting et al., 1991b).
pSL27 is a multicopy plasmid similar to pSL17 except that spoIVFB was replaced

by an N-terminal deletion of SpoIVFB. Construction of pSL27 began with an EcoRI
partial digestion of HindIII-linearized pSLll, which has spoIVFB fused to the Pspac

promoter (see above). A 4.1 kbp HindIII-EcoRI fragment was gel-purified. This fragment
contained about 100 bp of DNA corresponding to the last 11 codons of spolVFB plus the

69

P130 promoter downstream of spoIVF B. The ends were rendered blunt with the Klenow

fragment and ligated with T4 DNA ligase. The resulting plasmid, pSL21, has the N-
terminal deletion of spoIVFB fused to Pam. pSL21 was linearized with Sall, rendered

blunt-ended using a filling-in reaction with the Klenow fragment of DNA polymerase I,
and ligated to the 1.4 kbp SspI-HindIII fragment from pSK5 containing sigK which was
rendered blunt-ended as described above. The resulting plasmid, pSL26, has the N-
terminal deletion of spa] VF B fused to P3,,” followed by the P130 promoter, then sigK.

pSL26 was linearized with EcoRI and ligated to an EcoRI fragment from pSLl (Lu et al.,
1990) that has the origin of replication and kanamycin-resistance gene that function in B.
subtilis. The resulting plasmid, pSL27, is a multicopy plasmid capable of replicating in
both E. coli and B. subtilis.

Construction of a B. subtilis strain capable of coexpressing sigK and
spoIVFB during growth. Strains BSL53 and BSL54 were constructed by
transforming pSL13 and pSL14, respectively, into the B. subtilis strain SC745 (Table
4.1), selecting for chloramphenicol-resistant transformants. Since both plasmids are
unable to replicate autonomously in B. subtilis, stable transformants arise from integration
of the plasmids into the B. subtilis chromosome by homologous recombination. The
outcome of pSL13 integration is shown in Figure 4.1A. Thus spoIVFB is fused to the
IPTG-inducible Pspine promoter in strain BSL53. Integration of pSL14 results in having the
entire spoIVF operon (with the bofB8 mutation in spa] VF A) fused to the Pme promoter
(not shown) in strain BSL54.

Strain BSL54w was constructed by transforming pSL3] into strain BK338 (Table
4.1), selecting for chloramphenicol-resistant transformants. Integration of pSL31 results in
having the entire spoIVF operon (wild-type) fused to the Pspuc promoter (not shown).

Strains BSL55 and BSL56 were constructed by transforming the plasmid, pSL25,
Which has Pspnc fused to an in-frame deletion of SpoIVFB, into strain SC745 (Table 4.1),

70

Figure 4.1 Structures of integrative plasmids in B. subtilis. (A) Plasmid pSL13 has an

intact spoIVFB gene fused to the IPTG-inducible promoter, Pspac, and integration of
pSL13 into the B. subtilis chromosome results in one copy of spoIVFB being fused to the
Pspac promoter. The lac repressor encoding gene, lac], was transcribed from a Bacillus
lichentformis penicillinase promoter Ppcn in the vector portion of the plasmid. * indicates

the bofBB mutation in SpoIVFA. R and P are EcoRI and Pqu sites used for construction
of the in-frame deletion of spoIVFB (spoIVFBAC) in pSL25 (see panel B). (B) Integration

of pSL25, which contains an in-frame deletion of spoIVFB fused to Pspm, results in two

types of integrants, depending on the site of recombination (see Materials and Methods).

71

 

   
    

 

 

 

 

 

 

 

PK ‘
spoIVFA spoIVFB "‘> "" + spoIVF B
spoIVFA spoIVFB
Pr; . Pspac . Prvr . Pspac .
> Wm.- v um
spoIVF/l spoIVFBAC spoIVFB spoIVFA spoIVF B spoIVFBAC

Pie- ' Pig+

72

selecting for chloramphenicol-resistant transformants. Depending on the site of
recombination, the integration could result in fusing either the intact spoIVFB gene
(BSL55) or the in-frame deletion of spoIVFB (BSL56) to the Pme promoter, as shown in
Figure 4.1B. Two types of colonies were observed after allowing the transformants to
sporulate on Difco sporulation (DS) agar (Youngman et al., 1984). A small number of
transformants were brown-pigmented (Pig +), indicating the production of CotA, a 0" RNA
polymerase-transcribed gene product (Sandman et al., 1988). These transformants were
likely to have the intact spoIVF operon fused to its own promoter, P ,polvp, and Pspac fused
to the in-frame deletion of spoIVFB, due to recombination between sequences downstream
of the deletion in pSL25 (Figure 4.1B, Pig+). Most of the transformants were Pig-, which
were likely to be due to recombination between sequences upstream of the deletion in

pSL25, resulting in fusion of the intact spoIVFB gene to the Pspw promoter and the in-
frame deletion of spoIVFB to the P spam: promoter (Figure 4.1B, Pig-). The predicted

DNA structures for strain BSL55 (Pig-) and BSL56 (Pig+) were confirmed by Southern
blot analysis (data not shown).

Strains BSL57, BSL58, BSL58w, and BSL59 resulted from tranforming pSLl (Lu
et al., 1990) into BSL53, BSL54, BSL54w, and BSL55, respectively. These strains are
capable of coexpressing sigK and either spoIVFB (BSL57 and BSL59) or the entire
spoIVF operon (BSL58 and BSL58w) upon IPTG addition. Strains BSL52 and BSL60
were constructed by transforming pSLl into SC745 and BSL56, respectively. These two
strains express only sigK (BSL52) or sigK plus an in-frame deletion of spoIVFB (BSL60)
upon IPTG addition.

Construction of an E. coli strain capable of coexpressing sigK and
spoIVFB. Strain ESLl7a was constructed by transforming pSL17, which has both
spoIVFB and sigK fused to Pmlc (Figure 4.2), into JM103 with selection for ampicillin

73

     
   
 
    
   
   

ori
(B. subtilis)

  

ori
(E. coli)

pSL17

sigK

  
 

spoIVFB

 

Figure 4.2 Structure of pSL17, a multicopy plasmid that has both spoIVFB and sigK

fused to the Pm promoter. Pug is a ribosomal protein promoter located downstream of

spoIVFB that may contribute to transcription of sigK.

74

resistance (35 ug/ml). Strains ESLla, ESL16a, and ESL27a were constructed by
transforming pSLl, pSL16, and pSL27 into JM103, respectively, with selection for
ampicillin resistance (50 ug/ml).

Cell growth. B. subtilis and E. coli strains were grown in 2 x YT medium
(Maniatis et al., 1982). Cultures (50 ml) of different strains were grown at 37°C to the
mid-log phase (50-60 Klett units). Each culture was then divided into two equal parts, one
of which was induced with 1 mM IPTG.

Measurement of B-galactosidase activity. Samples (1 ml) were harvested
every 0.5 hour after IPTG addition, pelleted, and stored at -70'C prior to the assay. Cells
were permeabilized by treatment with toluene and the specific activity of B-galactosidase
was determined as described (Miller, 1972), using o-nitrophenol-B-D-galactopyranoside
(ONPG) as the substrate. One unit of enzyme hydrolyzes 1 mol of substrate per minute
per O.D595 unit of initial cell density.

Western blot analysis. Samples (1 ml) were collected at 0.5 hr intervals during
growth after IPTG addition. B. subtilis whole-cell extracts were prepared as described (Lu
et al., 1990) and protein concentrations were determined by the method of Bradford
(Bradford, 1976). E. coli whole-cell extracts were prepared by resuspending 5x109 cells
per ml of sample buffer (0.125 M Tris-HCl, pH6.8/2% SDS/5% 2-mercaptoethanol/10%
glycerol/0.1% bromophenol blue) and boiling for 5 minutes. Proteins (10 ug) in B.
subtilis whole-cell extracts were separated by SDS-PAGE (IO-15% polyacrylamide
gradient). Proteins in equal volumes of E. coli whole-cell extracts were separated by
SDS-PAGE (12.5% acrylamide). Proteins were then electroblotted to a poly (vinylidene
difiuoride) membrane (Matsudaira, 1987). Immunoblot analysis using polyclonal
anti-pro-oK antibodies was performed as described (Lu et al., 1990). Two types of
detection systems were used to visualize the bound secondary antibody conjugates.

Alkaline phosphatase-conju gated goat-anti-rabbit antibodies were detected by a colorimetric

75

reaction as instructed by the manufacturer (Bio-Rad). Horseradish peroxidase- conjugated
goat-anti-rabbit antibodies were detected using enhanced chemiluminescence as instructed
by the manufacturer (Amersham).

In vitro transcription assays. Gel-purified, renatured (Hager & Burgess,
1980) 0" from 0" RNA polymerase partially purified from B. subtilis strain SC104 (anZ
gerE36 SPB::cotA-lacZ) (Kroos et al., 1989), or gel-purified, renatured polypeptides that
comigrated with pro-oK or 0" from different E. coli strains, were reconstituted with B.
subtilis core RNA polymerase and run-off transcription assays were performed using either
a cotD or a gerE template as described previously (Kroos et al., 1989; Zheng et al., 1992).
After the reactions were stopped, half of the reaction mixture (35 ul) was electrophoresed
on a 5% polyacrylamide-8 M urea gel. [a-32P] CTP was the labeled nucleotide and
transcripts were visualized by autoradiography.

Results

Coexpressing spoIVFB and sigK during growth of B. subtilis

enhances (SK-dependent gene expression. To test whether SpoIVFB could enhance

accumulation of OK from pro-oK in the absence of other sporulation-specific gene products,
the spoIVFB gene or the entire spoIVF operon was fused to an IPTG-inducible promoter,
Psrnc’ and integrated into the B. subtilis chromosome (see Figure 4.1A for an example). In
both cases, both the integrative plasmid and the B. subtilis chromosome carried the bofB8
mutation. This mutation prematurely truncates the spoil/FA open reading frame, relieving
the negative effect of SpoIVFA on SpoIVFB and eliminating the need for a signal from the
forespore in order to process pro-oK (Cutting et al., 1991b). We reasoned that the

76

Table 4.2 oK-dependent gene expression of B. subtilis strains coexpressing sigK and

spoIVFB or the entire spoIVF operona

 

 

Elm BSL57 defiW
gerE-lacZ dark blue light blue
cotD-lacZ light blue white

cotA -lacZ white white

 

! An equal numer of cells from each strain was grown on LB X-gal (80 pig/ml) plates
containing 1 mM IPTG at 37'C for 24 hrs and color of the colonies was qualitatively
estimated. None of the strains (BSL57 and BSL58 derivatives) showed any blue color on

LB X-gal (80 ug/ml) plates without IPTG (data not shown).

77

presence of the bojB8 mutation might facilitate observing SpoIVFB activity in growing
cells since the forespore would be absent. A multicopy Pm-sigK plasmid (pSLl) was
then transformed into these strains for the production of pro-0K during growth (Lu et al.,
1990; Lu & Kroos, 1994). To monitor production of active 0“, these strains were then
lysogenized with an SPB phage bearing one of the oK-dependent gene fusions, cotA-lacZ,
cotD- lacZ, or gerE-lacZ (Cutting et al., 1989; Cutting et al., 1990; Zheng & Losick,
1990). An equal number of exponentially growing cells from each strain was spotted onto
LB agar containing the chromogenic substrate 5-bromo-4-chloro-3-indoyl-B-D
-galactopyranoside (X-gal; 80 ug/ml) and the Pspuc inducer IPTG (1 mM). As shown in
Table 4.2, strains designed to coexpress sigK and spoIVFB (BSL57 derivatives) showed
more oK-dependent gene expression than strains designed to coexpress both sigK and the
entire spoIVF operon (BSL58 derivatives). The BSL58 derivatives exhibited a similar level
of oK-dependent gene expression as strains capable of expressing only sigK (BSL52
derivatives; data not shown). These results suggested that coexpressing sigK and
spoIVFB during growth enhanced (IX-dependent gene expression, as compared to
expressing only sigK. Puzzled by the lack of enhancement in BSL58 derivatives designed
to coexpresss sigK and the entire spoI VF operon (with the bofBB mutation), we
constructed a similar set of strains (BSL58w derivatives) except without the bofB8
mutation. Still we observed no enhancement of (IX-dependent gene expression above the
level seen for strains capable of expressing only sigK (data not shown; see Discussion for
possible explanations).

To quantify the apparent enhancement of oK-dependent gene expression by
SpoIVFB, gerE-directed B-galactosidase activity was measured in strains designed to
coexpress sigK and spoIVFB, or express only sigK (Figure 4.3A). The BSL57 derivative
designed to coexpress spoIVFB and sigK showed 2—fold more gerE-directed B-

78

Figure 4.3 Coexpressing spoIVFB and sigK during growth of B. subtilis enhances 0K-
dependent gerE-lacZ expression and production of a polypeptide that comigrates with 0".
(A) gerE-directed B-galactosidase activity in growing B. subtilis strains designed to
coexpress sigK and spa] VF B (O, BSL57 derivative; and A, BSL59 derivative) or
express sigK alone (0, BSL52 derivative) or express sigK with an in-frame deletion of
spoIVFB (A, BSL60 derivative). The level of gerE-lacZ expression without IPTG addition
is also shown for the BSL57 derivative (Cl) and was comparable for all other strains (data
not shown). Points are the average of three determinations and error bars indicate one
standard deviation of the data. (B) Western blot analysis of whole-cell extracts (10 ug of
protein) from growing B. subtilis strain BSL57 designed to coexpress sigK and spoIVFB
(lanes 1-7) and strain BSL52 that only expresses sigK (lane 9). Samples were collected at
the indicated times after IPTG-addition. Western blot analysis using anti-pro—oK antibodies
was performed with the enhanced chemiluminescence method of detection as described in
the Materials and Methods. A whole-cell extract (5 ug of protein) made from sporulating
wild-type (PY79) cells at T6 (lanes 8 and 10) served as a control to indicate the positions of

pro-(rK and 0K.

11>

01 Q
G O
. r . r

A
Q
. r

10'

 

gerE-directed B-galactosidase activity
(Miller units)
8

79

  
 
       

, . u u , :3
1.0 1.5 2.0 2.5 3.0 3.5

Hours after IPTG-induction

12345678910

pro-o K

- 4—61‘
“N -.

 

.5 l 1.5 2 2.5 3 3.5 3.5
Hours after IPTG-induction ‘

80

galactosidase activity than the BSL52 derivative capable of expressing only sigK. Neither
strain expressed B-galactosidase when the IPTG addition was omitted (Figure 4.3A, open
squares and data not shown). As for cotD-lacZ and cotA-lacZ expression, no B-
galactosidase activity was detected in the corresponding strains with or without IPTG
addition (data not shown).

To determine whether the 2-fold enhancement of gerE-lacZ expression was due to
SpoIVFB, an in-frame deletion of spoIVFB lacking amino acids 149 to 276 (nearly half of
the coding sequence) was fused to Pmc and integrated into the B. subtilis chromosome.
Depending on the site of the homologous recombination, two outcomes were possible
(Figure 4.1B). One has the full-length spoIVFB fused to Pspac (BSL55), which is similar
to the situation in the BSL57 derivatives. The other has the in-frame deletion of spoIVFB
fused to P,“Ic (BSL56). Figure 4.3A shows that a BSL55 derivative engineered to express
sigK (BSL59) had 2-fold more gerE-lacZ expression than a BSL56 derivative engineered
similarly (BSL60). These results indicate that the in-frame deletion of spoIVFB abolishes
its function and that functional SpoIVFB is required for the observed enhancement of 6'9
dependent gene expression during growth of B. subtilis.

To determine whether the SpoIVFB-dependent enhancement of gerE-lacZ
expression was due to increased accumulation of 0“, we performed Western blot analyses
using anti-pro-crK antibodies, which detect both pro—0K and 0" (Lu et_ al., 1990). As
shown in Figure 4.3B, a polypeptide comigrating with OK first appeared 1 hour after IPTG
addition to the strain designed to coexpress sigK and spoIVFB (BSL57), and increased
thereafter. Very little of such a polypeptide was made in the strain capable of expressing
only sigK (BSL52), even at 3.5 hour after IPTG addition (Figure 4.3B, lane 9).
Polypeptides smaller than 6“ were detected for both strains, perhaps accounting for a
portion of the gerE-lacZ expression. However, in several experiments, only the

polypeptide that comigrated with 0K was considerably more abundant in the strain designed

81
to coexpress sigK and spoIVFB, correlating with higher gerE-lacZ expression in this
strain. These observations suggest that SpoIVFB enhances accumulation of 6" from pro-

oK in growing B. subtilis cells.
Coexpressing sigK and spoIVFB in E. coli produces GK activity. In

the experiments presented thus far, the spoIVFB gene under Pspac control existed as a
single copy in the B. subtilis chromosome. We wondered whether increasing the copy
number of spoIVFB might further enhance the accumulation of 6‘ from pro-0K. The
spoIVFB gene was fused to P,1m in a multicopy plasmid (pSL16, see Materials and
Methods), then sigK was cloned downstream of spoIVFB (pSL17, Figure 4.2). Since no
known transcriptional terminator exists between sigK and spoIVFB in pSL17, the Pa,”
promoter is expected to transcribe both genes. In pSL17, sigK is also fused to PLzo, a
ribosomal protein promoter located immediately downstream of spoIVFB (Cutting et al.,
1991b). This promoter is expected to be transcribed by (M RNA polymerase constitutively
during growth. To control for the presence of P120 and simultaneously determine whether
the intact spoIVFB gene is responsible for phenotypes produced by pSL17, a control
plasmid was constructed that retains Pmc and P120 fused to sigK but lacks all except the
last 11 codons of spoIVFB (pSL27, see Materials and Methods). When we attempted to
transform pSL17 into B. subtilis, the kanamycin-resistant transformants grew poorly on
selective plates and could not be maintained stably. In contrast, pSL27 was maintained

stably and appeared to have no adverse effects on growth. These experiments were carried

out in the absence of IPTG, but it is likely that the P39” promoter in these multicopy
plasmids is not fully repressed under these conditions because a substantial amount of pro-
oK is produced from pSLl (a comparable plasmid containing Pspam fused to sigK) without

IPTG addition (Lu & Kroos, 1994). Thus, coexpression of sigK and spoIVFB from the
multicopy pSL17 appears to produce a factor that is toxic to B. subtilis. This factor is likely

82

Figure 4.4 Coexpressing sigK and spoIVFB in E. coli generates GK activity. (A) Levels
of pro-(rK and 0K in E. coli strains containing different plasmids. Cell growth and
preparation of whole-cell extracts is described in the Materials and Methods. Cells were
collected 2 hr after IPTG (1 mM) addition. Proteins in whole-cell extracts (1 pl of a 1:10
dilution) in sample buffer of strains containing pSLl (ESLla, lane 2), pSL17 (ESLl7a,
lane 3), pSL27 (ESL27a, lane 4), and pSll6 (ESL16a, lane 5), along with a whole-cell
extract (10 pg of protein) of sporulating (T4) wild-type (PY79) B. subtilis to provide
markers for pro-oK and 0" (lane 1), were separated by SDS-PAGE and subjected to
Western blot analysis as descried in the Materials and Methods. The positions of pro-c1K
and UK are indicated.

(B) Run-off transcripts from templates containing the cotD or the gerE promoter. Proteins
from E. coli whole—cell extracts were separated on a 10%-20% polyacrylamide gradient-
SDS gel beside partially purified oK RNA polymerase from B. subtilis. After rapid staining
with Coomassie blue and destaining, polypeptides comigrating with pro-oK and 0" were
eluted from the gel, renatured, and added to B. subtilis core RNA polymerase (I pmole) in
in vitro transcription assays using linearized cotD (0.5 pmole) or gerE (0.5 pmole) as
templates (see Materials and Methods). Run-off transcripts (denoted by arrowheads) of the
expected sizes (as judged using end-labeled pBR322/Mspl fragments as markers) were
produced from the cotD and gerE templates with partially purified B. subtilis 0" RNA
polymerase (lanes 1 and 7), other reactions contained core RNA polymerase alone (lanes 2
and 8) for with added polypeptides that comigrated with 0" from E. coli strains bearing
pSLl (lanes 3 and 9), pSL17 (lanes 4 and 10), pSL27 (lanes 5 and 11), and pSL16 (lanes
6 and 12). Unmarked lanes are reactions containing core RNA polymerase and
polypeptides that comigrated with pro-0K (in each case from the same E. coli strain as in the
next lane to the right).

83

12345

 

 

12 3 4 56 78 9 101112

 

cotD ’

84

to be all, since production of active 0K from a sigK gene with an N-terminal deletion
(which removes the pro-amino acid coding sequence) decreases cell growth and causes cell
lysis (Oke & Losick, 1993).

We found that pSL17 was maintained stably in E. coli. To determine whether 0“
was made, we performed Western blot analysis using anti-pro-oK antibodies (Figure
4.4A). A polypeptide that comigrated with 0" was observed in the extract of cells
containing pSLl7 (lane 3). Very little such polypeptide was detected in extracts of cells
containing pSL27 (lane 4) or pSLl (lane 2), which do not have an intact spoIVFB gene but
do have P,pac and P120 (pSL27) or just Pspam (pSLl) fused to the sigK gene. These results
suggest that SpoIVFB enhances accumulation of a polypeptide that comigrates with 0K
when sigK is expressed in the heterologous E. coli cells.

To determine whether the polypeptide comigrating with UK possessed GK activity,
proteins in whole-cell extracts were separated by SDS-PAGE and polypeptides comigrating
with pro—oK and 6K from each cell extract were recovered from the gel and renatured (Hager
& Burgess, 1980), then added to B. subtilis core RNA polymerase to test their ability to
stimulate transcription from oK-dependent promoters in vitro (Figure 4.4B). As a control,
0" RNA polymerase partially purified from sporulating B. subtilis was shown to transcribe
cotD and gerE strongly (lanes 1 and 7; Kroos et al., 1989; Zheng et al., 1992). Strikingly,
the polypeptide(s) comigratin g with OK in the extract of cells containing pSL17 (designed to
coexpress sigK and spoIVFB) stimulated transcription of c010 and gerE strongly (lanes 4
and 10). In contrast, polypeptide(s) comigrating with 0K in extracts of cells containing
pSL27 or pSLl (expressing only sigK) stimulated cotD and gerE transcription weakly
(lanes 3, 5, 9 and 11), while polypeptide(s) from cells containing pSL16 (expressing only
spoIVFB) did not stimulate transcription (lanes 6 and 12). Also, polypeptide(s)

comigrating with pro-oK did not stimulate transcription of either promoter (unmarked

85

lanes), consistent with the idea that pro-0K is inactive as a sigma factor (Lu et al., 1990).
These results suggest that SpoIVFB can enhance accumulation of active 0“ from pro-GK in

E. coli cells.

Discussion

In this report we showed that coexpressing spoIVFB and sigK in growing B.
subtilis enhanced oK-dependent gene expression, as compared to expressing only sigK.
Coexpressing spoIVFB and sigK in growing B. subtilis also increased the accumulation of
a polypeptide that comigrated with 01‘. Furthermore, coexpressing spoIVFB and sigK
from a multicopy plasmid in E. coli enhanced accumulation of a polypeptide that
comigrated with 0K and had 0" activity. These results suggest that SpoIVFB enhances 0K
accumulation from pro-0K in the absence of other sporulation-specific gene products. We
cannot exclude the possibility that the polypeptide comigrating with OK and detected by anti-
pro—oK antibodies in growing B. subtilis or E. coli cells is a closely related, but improperly
processed, polypeptide(s) with GK activity.

How might SpoIVFB enhance 0K accumulation? One possibility is that SpoIVFB
stabilize 0K produced by fortuitous proteolysis. However, we think this explanation is
unlikely because 0" accumulates in the absence of SpoIVFB when 0K is produced from a
truncated sigK gene in growing cells (leading to cell lysis; (Oke & Losick, 1993; Halberg,
Oke, and Kroos, unpublished results) or in cells during the early stages of sporulation
(Cutting et al., 1990; Halberg, 1992). It seems more likely that SpoIVFB increases the
processing of pro-oK to 0". Genetic studies suggest that SpoIVFB is intimately involved in

pro-0K processing and that this is its only role in sporulation (Cutting et al., 1990; Cutting

86

et al., 1991b; Lu & Kroos, 1994). Thus, SpoIVFB has been proposed to be either the
protease that processes pro-oK or a regulator of the processing reaction (Cutting et al.,
1990; Lu et al., 1990; Cutting et al., 1991b).

The idea that SpoIVFB is the protease that processes pro-oK provides a simple
explanation of our results. The observed enhancement of OK accumulation would be
attributed to processing by SpoIVFB. Consistent with this idea is the finding that a
segment of SpoIVFB [amino acids 42 to 46 (HELGH)] represents a motif (HEXXH)
characteristic of a bacterial Zn-containing metalloprotease family (Hase & Finkelstein,
1993). If SpoIVFB is the protease that processes pro-0K, why is the a“ level so low in
growing cells coexpressing spoIVFB and sigK? We estimated that the level of 0K in
growing B. subtilis cells at 3.5 hrs after IPTG addition is at least tenfold less than the level
of 0K in sporulating cells at 6 hrs into development (Figure 4.3B). One possible
explanation for the low 0" level was that the synthesis and/or stability of SpoIVFB in
growing cells did not allow it to accumulate sufficiently in order to process pro-0K
efficiently. Indeed, increasing the copy number of spoIVFB fused to the IPTG-inducible
Psp-c promoter resulted in a plasmid (pSL17; Figure 4.2) that appeared to produce a toxic
factor, possibly too much 0“ (Oke & Losick, 1993), in B. subtilis. This plasmid was
maintained stably in E. call, but the level of OK accumulated was still quite low (Figure
4.4A). Perhaps the synthesis and/or stability of SpoIVFB is less in E. coli than in B.
subtilis cells. Also, in both types of cells, the proper conditions for optimal SpoIVFB
activity may not be met during growth. Optimal activity may require that SpoIVFB insert
in the outer forespore membrane of sporulating cells and receive a signal from the forespore
(Cutting et al., 1990; Cutting et al., 1991b).

Our results do not exclude the possibilty that SpoIVFB functions as a regulator of

the processing reaction, rather than as the protease. For example, SpoIVFB might either

87

stimulate a protease or interact with pro— 0K to make it a better substrate for a protease. In
either case, in order to explain our data, a protease capable of processing pro-0K would
have to be present in growing B. subtilis and E. coli cells. The results we obtained by
expressing sigK alone suggest that such proteases do exist in growing cells. Though not
obvious in the Western blots shown in Figures 4.3 and 4.4, we consistently detected a very
small amount of a polypeptide that comigrated with OK in both B. subtilis and E. coli cells
expressing sigK but not expressing spoIVFB. Consistent with this observation, a low
level of 0" activity was recovered from E. coli cells expression only sigK (Figure 4.4), and
expression from a gerE-lacZ fusion was considerable in B. subtilis cells expressing only
sigK (Figure 4.3). These results suggest that proteases capable of producing a" activity
are present in growing B. subtilis and E. coli cells. Perhaps SpoIVFB enhances 0K
accumulation by interacting with pro-cK to make the processing site more accessible to
these proteases, or, somewhat less likely, by stimulating these proteases directly.

The enhancement of OK accumulation by SpoIVFB in growing B. subtilis cells
increased gerE-lacZ expression twofold (Figure 4.3) and appeared to increase cotD-lacZ
expression slightly (Table 4.2), but cotA-lacZ expression was not increased detectably.
These results are consistent with other in vivo studies which suggest that the gerE, cotD,
and COM promoters require successively higher threshold concentrations of ex for
transcription (Oke & Losick, 1993; Lu & Kroos, 1994).

No enhancement of OK accumulation was observed in growing B. subtilis cells
designed to coexpress the entire spoI VF operon (rather than just spoIVFB). Perhaps
spoIVFB is not expressed well when the entire spoIVF operon is fused to PM (e.g., due
to premature termination of transcription). We consider the possibility that the bofBB
mutation (which creates a premature translational stop codon in spoIVFA; (Cutting et al.,

1991b) hindered spoIVFB expression (e.g., due to a polar effect on transcription and/or

88

uncoupling of spoIVFB translation fiom that of SpoIVFA). However, a strain with a wild-
type spoIVF operon fused to Pspac still failed to exhibit enhanced oK-dependent gene
expression. In this strain, as well as in the strain with the bofB8 mutant spoIVF operon
fused to PM, perhaps SpoIVFA negatively regulates SpoIVFB activity, as appears to be
the case in sporulating cells until a signal from the forespore relieves the inhibition (Cutting
et al., 1991a; Cutting et al., 1991b). In sporulating cells, the bofBB mutation relieves the
negative effect of SpoIVFA on SpoIVFB, but this may not be the case in growing cells.

Chapter 5

Isolation of suppressor mutants that bypass the requirement
for the spa! VF gene products in pro-0K processing

89

90

Abstract

During B. subtilis sporulation, the mother-cell-specific sigma factor, 0", is first
made as an inactive precursor, pro-0K, at 3 hrs into sporulation and is processed to the
active form 1 hr later. Previous studies show that spoIVFA and spoIVFB, members of the
two-cistron spoIVF operon, are needed for the processing of pro-0K to 0“. Interestingly,
overproducing pro-0K from a multicopy plasmid in spoIVF mutants partially restored 0K-
dependent gene expression and heat-resistant spore production. 0" accumulation can be
detected in the spoIVF mutants overproducing pro-oK (Lu & Kroos, 1994). These results
suggest that functions of the spoIVF gene products are largely dispensible when pro-0K is
overproduced and there might exist a spoIVF-independent way to process pro-oK (Lu &
Kroos, 1994).

To determine whether activity of a spoIVF-independent processing mechanism

could be mutationally enhanced, we have mutagenized a spoIVF null mutant that lacks both

the A and B cistrons (spoIVFAAB::cat) and isolated suppressor mutants that restore
oK-dependent gene expression as well as production of heat-resistant spores.
Characterization of several suppressor mutants shows that pro-oK processing is restored.
A preliminary mapping study suggests that the suppressor mutations appear not to be in the

sigK gene which encodes pro-6K.

91

Introduction

During sporulation of the gram-positive bacterium, B. subtilis, the mother-cell-
specific sigma factor, 0", is first made as an inactive precursor, pro-0K, at 3 hours into
sporulation and is processed to the active form 1 hour later (Lu et al., 1990). Processing
of pro- oK depends not only on some mother-cell-specific genes but also on several
forespore-specific genes, including spoIlIG which encodes the forespore-specific sigma
factor, 06 (Sun et al., 1989), suggesting that processing of pro-oK in the mother cell is
coupled to the development of the forespore (Cutting et al., 1990; Lu et al., 1990).

SpoIVF is a two-cistron operon whose transcription depends on 03, another sigma
factor that is active in the mother-cell compartment prior to the activation of OK during
sporulation (Cutting et al., 1991b; Driks & Losick, 1991). Previous studies have shown
that a transposon insertion mutation in the promoter proximal spoI VF A gene and a
missense mutation in the promoter distal spoIVFB gene block processing of pro-0K,
suggesting that the products of both genes are involved in the processing event (Cutting et
al., 1990, Lu et al., 1990; Cutting et al., 1991b). Mutations that uncouple cK-dependent
mother-cell gene expression from forespore control have been isolated and pro-oK
processing is restored in these mutants (Cutting et al., 1990). These "bypass of forespore"
(bof) mutations map to two loci, bofA and SpoIVFA (Cutting et al., 1991b; Ricca et al.,
1992). Genetic studies suggest that BofA,the product of the bofA gene, and SpoIVFA,
the product of spoIVFA, negatively regulate the activity of SpoIVFB, the product of the
downstream gene in the spoIVF operon, until a signal is received from the forespore
(Cutting et al., 1991b; Ricca et al., 1992). Several lines of evidence suggest that SpoIVFB
is intimately involved in the processing of pro-6K: (1) a rrrissense mutation in spoIVFB

blocks processing of pro-csK (Lu et al., 1990); (2) bypass mutations (in bofA or SpoIVFA)

92

fail to restore oK-dependent gene expression in the spoIVFB mutant (Cutting et al., 1990);
(3) a strain engineered to make active 0K by deleting the pro-amino acid coding sequence of
sigK restores oK-dependent gene expression in the spoIVFB mutant (Cutting et al., 1990).
Based on these results, it has been proposed that SpoIVFB may encode either the protease
that processes pro—oK or a regulator of the processing event (Cutting et al., 1990).

Interestingly, overproducin g pro-0K during sporulation fiom a multicopy plasmid in
the spoIVFA or spoIVFB mutants, or in a third mutant (spoIVFAAB::cat) which has the
entire spol VF operon replaced by a cat gene, partially restores oK-dependent gene
expression and heat-resistant spore formation. A small amount of 0" can be detected in
these mutants correlating with the increase in oK—dependent gene expression (Lu & Kroos,
1994). These results suggest that both spoIVFA and spoIVFB are dispensible when pro—
oK is overproduced during sporulation, and a spa] VF -independent mechanism(s) is
responsible for the generation of active 0" (Lu & Kroos, 1994).

To determine whether the activity of a spoIVF-independent pro-0K processing
mechanism could be enhanced by mutation when pro- oK is made at its normal level during
sporulation, we used N-methyl-N'-nitro-N-nitrosoguanidine (NTG) to mutagenize the
spoIVFAAB::cat strain and searched for suppressor mutants able to form heat-resistant

spores and express oK-dependent genes.

Materials and Methods

Bacterial strains. The strain used for chemical mutagenesis is BSL51

(spoIVFAAB::cat), which has the spoIVF operon replaced by a cat gene (Lu & Kroos,
1994). B. subtilis strains PY79 (spo+), BK556 (spoIVCBZ3), BK410 (spoIIIC94), and

93

BK407 (a MD 120) were obtained from R. Losick (Harvard University).
BSL61(spoIVF AAB::cat aroDIZO) was constructed in this study (see below). The
mutagen N-methyl-N'-nitro-N-nitrosoguanidine (from Sigma Chemical Company) was
obtained from M. Sutton (Michigan State University).

General methods. B. subtilis competent cells were prepared and transformed by
a method described previously (Dubnau & Davidoff-Abelson, 1971). Specialized
transduction using phages SPflzzcotA-lacZ, SPB::cotD-lacZ, and SPB::gerE-lacZ was
described previously (Cutting et al., 1989; Cutting et al., 1990; Zheng & Losick, 1990).
Selection for chloramphenicol-resistant (CmR) colonies was made on LB (Maniatis et al.,
1982) or Difco sporulation (DS) (Youngman et al., 1983) agar plates containing 5 ug/ml
chloramphenicol (Cm). Selection for colonies resistant to erythromycin and lincomycin
(MLS), conferred by the SP8 phages, was on plates containing 1 rig/ml erythromycin and
25 ug/ml lincomycin.

Sporulation was induced by nutrient exhaustion in DS medium at 37'C or by
growing on DS agar plates. The number of heat-resistant spores was assayed by collecting
1 ml of culture 24 hours after the initiation of sporulation, incubating at 80‘C for 15 min ,
plating serial dilution on LB agar, and scoring colonies that grew at 24 hours at 37'C.

The specific activity of B-galactosidase was determined by the method of Miller
(Miller, 1972), using O-nitrophenyl-B-D-galactopyranoside (ONPG) as the substrate. One
unit of enzyme hydrolyzes l umole of substrate per min per O.D.595 unit of initial cell
density.

Western blot analysis using anti-pro-crK antibodies was carried out as described
previously (Lu et al., 1990).

Mutagenesis. A single colony of BSL51 (spoIVFAAB::cat) grown on an LB
Cm (5 ug/ml) plate was inoculated into 25 ml of PAB (Penassay broth) (Cutting & Vander
Horn, 1990) and incubated at 37°C with vigorous shaking. When the O.D.600 of the

94

culture reached about 1.0, 100 pl of the culture was taken to determine the number of
viable cells before mutagenesis by plating serial dilutions on LB Cm (5 ug/ml) plates and
scoring colonies after a 24 hour incubation at 37'C. The rest of the culture was centrifuged
(7,650 g, 6 min), washed once in 5 ml of prewarmed (37’C) SC (0.15 M NaCl, 0.01 M
sodium citrate pH 7.0), and centrifuged. The cell pellet was resuspended in prewarmed 10
ml SC and aliquoted into 5 tubes (2 ml each). Different amounts of nitrosoguanidine
(NTG) were added to the 5 tubes, making the final NTG concentrations 100 ug/ml, 50
ug/ml, 25 ug/ml, 10 rig/ml, and 5 rig/ml, respectively. Cultures were incubated at 37'C
with slow shaking for 30 nrin. Each aliquot of mutagenized cells was centrifuged (12,000
x g, 1 min), washed twice with prewarmed (37'C) PAB, and then resuspended in 5 ml
PAB solution, which is equivalent to the volume of the original culture before mutagenesis.
100 pl of culture was taken from each mutagenized culture and assayed for the number of
viable cells as described above. The rest of the culture was aliquoted (0.5 ml) and stored in
15% glycerol at ~70'C for further analysis.

Selection of suppressor mutants able to form heat-resistant spores.
To select for mutants that bypass the requirement for the spa] VF gene products in
sporulation, each aliquot (0.5 ml) of mutagenized cells that showed about 40% killing as
compared to unmutagenized cells was inoculated into 10 ml of DS medium and allowed to
sporulate for 24 hours. Cells were centrifuged (7,650 x g, 6 min), washed once in 5 ml
SC, and resuspended in 1 ml SC. Cultures were incubated at 80‘C for 15 min to select for
spores and 100 pl aliquots of the heat-treated culture were plated on DS agar containing Cm
(5 rig/ml). After a 2 day incubation at 37’C, the plates were incubated at room temperature
for another 3-5 days to promote sporulation. Among the heat-resistant colonies, brown-
pigmented ones (Pig+; indicating expression of the oK-dependent cotA gene; Sandman,
1988) were selected and transferred to a new DS agar plate containing 5 ug/ml Cm.

Thirty-eight Pig+, CmR colonies were isolated from about 4x104 heat-resistant colonies

95

screened in this way. These mutants were named sop (suppressor of processing defect)
mutants. Among the 38 isolates, 30 originated from one aliquot of the mutagenized cells
and were named sop] to sop30. Eight were from another aliquot and were named sop3l to
sop38. It is possible that mutants arising from the same aliquot of mutagenized cells are
siblings. Individual mutants could also have more than one mutation in the chromosome.

To purify some of the sap mutations, chromosomal DNA was isolated from sop] ,
sop2, and sop31 mutant strains (Cutting & Vander Horn, 1990). Each chromosomal DNA
(25 pg) was used to transform competent BSL51 (spoIVFAAB::cat) cells. After a 30-40
min incubation at 37'C, the transformation mixture was inoculated into 10 ml DS medium
and incubated at 37'C for 24 hours to permit sporulation. The culture was incubated at
80'C for 15 min and screened for heat-resistant, Pig+ survivors on DS agar plates
containing Cm (5 [lg/ml) as described above. Majority of the 5,000-6,000 heat-resistant
colonies obtained from each transformation turned light brown after a 3-4 day incubation at
room temperature. Twenty putative Pig+ colonies chosen randomly among the
5,000-6,000 heat-resistant colonies were transferred to a DS agar plate containing Cm (5
[lg/ml) and allowed to sporulate to confirm that both the Pig+ and CmR properties were
retained. One Pig+, CmR transformant was isolated and named BSL70 (sopI ),
BSL71(sop2), and BSL72 (sop31) respectively. The newly isolated sop mutants were
used for further studies.

Study of linkage between sop mutations and aroD. To construct a
spoIVFAAB::cat aroDIZO double mutant for use in linkage studies, chromosomal DNA (5
ug) isolated from strain BSL51 (spoIVFAAB::cat) (Lu & Kroos, 1994) was used to
transform competent BK407 (aroDIZO) cells, selecting for CmR transformants on LB Cm
(5 rig/ml) plates. To screen for retention of the aroDIZO mutation, the CmR transformants
were transferred to lactate/glutamate minimal agar (LGMA) plates (Cutting & Vander Horn,

1990). One transformant that was nonviable on LGMA was named BSL6l

96

(spoIVFAAB::cat aroDIZO) and used to study linkage between the sap mutations and aroD.
To determine the cotransformation frequency of spoIVCB or spoIIIC with aroD, 10 ng of
chromosomal DNA isolated from BK556 (spoIVCB23) or BK410 (spoIIIC94) was used
to transform competent BK407 (aroDIZO) (0.5 ml) with selection for Aro+ transformants
on LGMA (Outing & Horn, 1990) plates. Aro+ transformants were transferred to DS agar
plates to allow growth and sporulation. Pig+ and Pig- transformants were scored.
Similarly, 10 ng chromosomal DNA isolated from BSL70 (sopI), BSL7] (sopZ), or
BSL72 (sop31) mutant cells was used to transform competent BSL61 (spoIVFAAB::cat
aroDIZO). Aro+, CmR transformants were selected on LGMA plates. Pig+ and Pig-
transforrnants were scored after the transformants were allowed to grow and sporulate on

DS agar.

Results

Determination of the Optimal nitrosoguanidine concentration for
mutagenesis. The alkylating agent N—methyl-N'-nitro-N-nitrosoguanidine (NTG) is
probably one of the most potent bacterial mutagens. It induces mutations directly through
mispairing (G.C to A.T, one way transitions preferred) and also indirectly through error-
prone repair (causing frameshifts, deletions, transitions and transversions) (Cutting &
Vander Horn, 1990). When using NTG the aim is to obtain the maximum number of
mutations with the least cell killing. The lethal effect of NTG may vary from strain to
strain, so it is desirable to obtain a killing curve for each new strain and to use a
concentration that gives about 50% killing. Too large a dose of NTG may result in a high
percentage of auxotrophs, multiple mutations and killing (Cutting & Vander Horn, 1990).

97

Figure 5.1 Cell killing by NTG. (A) Number of viable BSL51 (spoIVFAAB::cat) cells
versus the concentration of NTG. (B) Killing percentage versus the dosage of NTG.
Mutagenesis and determination of the number of viable cells are described in Materials and
Methods. The number of viable cells before mutagenesis is 3x108 cells/ml, which is
arbitrarily designated as 100% survival. Killing percentage is calculated as [1- (Number of
viable cells after NTG treatment/ Number of viable cells before NTG treatment) x 100%].

98

 

60

NTG cone. (pg/ml)

 

 

4o

 

 

 
 

10"

m m.m

A $.93 3 5 £8 053.» no cone—dz

 

 

‘ ‘ 60 so 160
NTG cone. (pg/ml)

4o

 

 

 

mace—89.2— mam—=2

99

To determine the optimal concentration of NTG for mutagenesis of BSL51 (
spoIVFAAB::cat ), different amounts of NTG were used to mutagenize the strain and the
number of viable cells was determined before and after the mutagenesis. As shown in
Figure 5.1A, the number of viable cells decreased about 10-fold as the concentration of
NTG increased from 5 ug/ml to 25 ug/ml, and at 50 ug/ml, over 90% of the cells died due
to mutagenesis. The killing percentage versus the dosage of NTG is shown in Figure
5.1B. The concentration of NTG, estimated from the killing curve, that causes about 50%
cell death is 15 ug/ml, which would theoretically result in the best mutagenesis. Since 10
ug/ml NTG resulted in about 40% killing, cells mutagenized at this NTG concentration
were used in the screening process.

Isolation and initial characterization of sop mutants. To search for
mutations that suppress the defect in 0K production in spoIVFAAB::cat cells, two criteria
were used. One is a selection followed by a screen. First, we select for restoration of the
production of heat-resistant spores, since 0" is required for efficient sporulation. Second,
we screened for the ability to produce CotA protein, the product of the oK-dependent cotA
gene (Zheng & Losick, 1990) which results in brown pigmentation (Pig+) of a colony on
Difco sporulation (DS) plates (Sandman et al., 1988). As described in Materials and
Methods, 38 Pig+, CmR mutants were isolated from two aliquots of NTG mutagenized
cells. Among these sop (suppressor of processing defect) mutants, sop] to sop30
originated from one aliquot of mutagenized cells and sop31 to sop38 were from another
aliquot.

To test the effects of sop mutations on oK-dependent gene expression, the sap],
sop3, and sop5 mutants were transduced with an SPB phage bearing a oK-dependent gene
fusion, gerE-lacZ, and allowed to sporulate in DS medium. Figure 5.2A shows that in all

three sop mutant strains, gerE-lacZ expression increased starting at T5 and reached a level

similar to that of the wild-type (PY79) strain bearing the same fusion. To measure the

100

Figure 5.2 sop mutants restore gerE-lacZ expression and 0K accumulation. (A) gerE-
directed B-galactosidase activity in wild-type (O), sop] (O ), sop3 (D), and sop5 (A)
strains lysogenized with the phage SPB::gerE-IacZ. (B) Levels of pro-oK and 0K in the
sap] mutant. Whole-cell extracts (10 ug protein) from sop] collected at hourly intervals
during sporulation were separated by SDS-PAGE (12.5% polyacrylamide) and subjected to
Western blot analysis using anti-pro-oK antibodies (Lu et al., 1990). The unmarked lane
contained whole-cell extract (10 ug protein) from sporulating wild-type strain (PY79)
collected at T4.

101

>

140'

(Miller units)

 

gerE-directed B-galactosidase activity

 

 

10

Time (hr)

\ V .

    

T3 T4 T5 T6 T7 T8

pro-oK-p .
oK/ ‘ ' ‘ A

102

Table 5.1 Ability of sop mutants to form heat-resistant spores

 

 

S . l . a
570+ 100
sop! 120
sop3 176
sop5 220
BSL70 (sopl ) 1 15
BSL7] (sop2) 123
BSL72 (sop31) 130

 

a The number of heat-resistant spores was determined as described in Materials and
Methods and is expressed as a percentage of that observed in the wild-type spo+ strain
PY79, which produced about 3x108 spores/ml. The results are the average of two

independent experiments for each strain.

103

levels of pro-oK and 0K, whole-cell extracts were prepared from cultures collected at hourly
intervals during sporulation and subjected to Western blot analysis using anti-pro-oK
antibodies. Figure 5.2B shows that in the sap] mutant, pro-0K that appeared at 3 hours

into sporulation (T3) (lane 1). 0K was detected begining at T4 (lane 2) and the level

increased thereafter. The timing of appearance of ex is similar to that in wild-type (PY79)
cells (Lu et al., 1990). Similar results were obtained for the other two sop mutants, sop3
and sop5 (data not shown). The number of heat-resistant spores generated by the
individual sop mutants was measured and shown to be similar to, or perhaps even higher
than that of the wild-type strain (PY79) (I‘ able 5.1). These results indicate that the sap] ,
sop3, and sop5 mutations restore oK-dependent gene expression, 0" accumulation, and
sporulation in the absence of the spoIVF gene products.

Purification and further characterization of the sap mutants. To
determine whether the rescue of phenotypes in individual sop mutants is likely to be due to
a single mutation or well-separated multiple mutations, three sop mutation(s)sop1, sop2,
and sop3] were individually transformed into competent spoIVFAAB::cat cells that had not
been subjected to mutagenesis. In all three cases, heat-resistant, Pig+ transformants were
recovered, suggesting that the Sop phenotypes (heat-resistance, Pig+) are likely to be
conferred by either a single mutation or more than one closely linked mutations.

To examine quantitatively the Sop phenotypes of the sap mutants produced by
transformation, each was transduced with the SP8 phage containing the gerE-lacZ fusion
and induced to sporulate in DS medium. As shown in Figure 5.3A, all three sop mutants
expressed gerE-lacZ with similar timing and at similar level as the wild-type strain (PY79).
Figure 5.3B shows that in sporulating BSL70 (sopl) and BSL72 (sop3l), 0" appears at

T4, one hour after the appearance of pro-0K (T3), as seen for the wild-type cells (Lu et al.,

1990). In addition, all three sop mutants produced a similar number of heat-resistant

104

Figure 5.3 sop mutants generated by DNA transformation restore gerE-lacZ expression
and 0K accumulation. (A) gerE-directed B—galactosidase activity in wild-type (O), BSL70(
sopl) (O), BSL71 (sop2) (Cl), and BSL72 (sop31) (A) strains bearing SPflzzgerE-lacZ.
(B) Levels of pro- oK and 0K in BSL70 (sop!) and BSL72 (sop31) mutants, determined as

described in the Figure 5.2 legend.

105

 

120‘

W.

A .3338 omen

- q u q u u u

00

$2: .256
_m3§_awé cougheécow

 

0 m 0 0.0

10

 

Time (hr)

0 l. 2 3 ll 5 6 7

BSL70

BSL72

106

spores as the wild type cells (Table 5.1). Thus, the purified sop mutations also bypass the
requirement for spoIVF gene products in (xx—dependent gene expression, 0" accumulation,
and sporulation.

sop], sop2, and sop31 appear not to be allelic to the sigK gene. As a
first step to determine the nature of the sap mutations, we tested for linkage between sop] ,
sop2, or 301131 , and sigK. Since the sap mutations restore 0K accumulation in the absence
of the spoIVF products (Figure 5.33), one possibility was that the sap mutations may lie
in the sigK gene (encoding pro-0K), making the 'pro-oK' a better substrate for a spoIVF-
independent protease(s) to generate active 0". Since an auxotrophic marker aroDIZO is
90% cotransduced with sigK using phage PBSl-mediated transduction (Kunkel et al.,
1990), it seemed likely that the two genes would also be linked by cotransformation
(Cutting & Vander Horn, 1990). To test whether sigK and aroD could be cotransformed,
chromosomal DNAs isolated from spoIVCB (encoding the N-terminal half of OK) and
spoIIIC (encoding the C-terminal half of 0“) mutant cells were transformed into strain
BK407 (aroD120), selecting for Aro+ transformants. As shown in Table 5.2, 15% of Aro+
transformants obtained by transformation with spoIVCB mutant DNA were Pig- when
induced to sporulate on DS agar. The Pig- phenotype is expected upon cotransformation of
aroD+ and spoIVCB, since the spoIVCB mutation blocks 0“ production (Lu et al., 1990),
resulting in failure to express cot/1 (Sandman et al., 1988). Of the Aro+ transformants
obtained by transformation with the spoIlIC mutant DNA, 5% were Pig-. These results
demonstrate that both spoIVCB and spoIIIC can be cotransformed with aroD+, although at
a relatively low frequency as compared to that observed by cotransduction (Kunkel et al.,
1990)

To determine whether the sap], sop2, or sop31 mutation is linked to sigK,

chromosomal DNAs isolated from these sop mutants were used to transform a recipient

107

Table 5.2 Cotransformation efficiency of spoIVCB, spoIIIC, or sop mutations with
araD+

 

D Ell! B .. ll I E ‘ ll 1 EEE' .'

Aro Pig
spoIVCB23 aroDIZO + + 96

+ - 17 15
spoIIIC94 aroDIZO + + 87

+ - 5 5
sop] IVFAAB::cat lVFAAB::cat aroDIZO + + O

+ - 88 0
sop2 IVFAAB::cat IVFAAB::cat aroDIZO + + 0

+ - 85 0
sop31 IVFAAB::cat IVFAAB::cat aroDIZO + + 0

+ - 90 O

 

a Transformation was carried out as described in Materials and Methods. Aro+
transformants were selected on lactate/glutamate minimal agar (LGMA) plates.
Transformants on LGMA plates were transferred to DS agar plates to allow growth and
sporulation. Pig+ and Pig- colonies were scored.

b Cotransformation efficiency is expressed as the percentage of transformants that inherit
the donor DNA genotype (hence the phenotype) among the total Aro+ transformants

obtained in each transformation experiment.

108

strain BSL61 (spoIVFAAB::cat aroDIZO), selecting for Aro+ CmR transformants. As
shown in Table 5.2, the resulting Aro+ CmR transformants were all Pig -, indicating that the
sap mutations were not cotransformed with aroD+ marker. These preliminary results

suggest that sop] , sopZ, and sop31 are not sigK alleles.

Discussion

Using chemical mutagenesis, we have isolated mutants that restore oK-dependent
gene expression and production of heat-resistant spores in a B. subtilis strain lacking the
entire spol VF operon. The sop mutations examined so far also appear to restore
processing of pro-0K. Transformation experiments show that these sop mutations cannot
be cotransformed with aroD, an auxotrophic marker that is closely linked to the sigK gene
on the B. subtilis chromosome. Hence, these sop mutations appear not to be sigK alleles.

Previous studies suggest that oK-dependent mother-cell gene expression is coupled
to forespore morphogenesis at the level of processing pro-oK (Cutting et al., 1990; Lu et
al., 1990). Mutations that uncouple mother cell gene expression from forespore control
have been isolated. These bof (bypass of forespore) mutations restore mother-cell gene
expression, as well as ex accumulation in forespore mutants that block processing of pro-
cK (Cutting et al., 1990). Even though the isolated sop mutants (sopI, sop2, and sop31)
restore oK-dependent mother-cell gene expression (Figure 5.3A) and 0K accumulation
(Figure 5.3B), they are different from the bof mutants in several aspects. First, sop
mutants restore heat-resistant spore production to the wild-type level (Table 5.1). In
contrast, bof mutants make less than 10% the number of heat-resistant spores made in the

wild-type (PY79) strain (Cutting et al., 1990). Second, expression of the oK-dependent

109

gerE-lacZ fusion in sop mutants begins with similar timing as in wild-type cells (Figure
5.3A). Accordingly, 0" appears at 4 hours into sporulation in sop mutants and in wild-
type cells (Figure 5.3B; Lu et al., 1990). On the contrary, bof mutants advance 0"-
dependent gene expression by one hour and 0K also appears an hour earlier (T3) (Cutting et
al., 1990). Third, sop mutations bypass the requirement for spoIVF gene products in
sporulation while bof mutations fail to do so (Cutting et al., 1990). Taken together, the
sap mutations are clearly quite different from the previously isolated bof mutations.

What are the possible natures of the sap mutations? Since the sap mutations
examined so far appear to completely bypass the requirement for the spoIVF gene products
in sporulation, it is conceivable that these sop mutations somehow activate a gene(s) that
functions similarly as the spa] VF gene products. Previous genetic studies suggest that
SpoIVFA both positively and negatively regulates the activity of SpoIVFB, which has been
proposed to encode either the protease that processes pro-0K or a regulator of the
processing event (Cutting et al., 1990). If SpoIVFB is a protease that normally processes
pro—oK during sporulation, the sap mutations may activate another protease(s) capable of
(substituting for SpoIVFB. If SpoIVFB acts as a regulator of the processing event (e.g., by
activating a protease or interacting with pro-0K to make it a better substrate for a protease),
the sap mutations may directly or indirectly activate the protease that normally processes
pro-0K during sporulation, making its activity independent of the spoIVF gene products.
Normally, the spoIVF gene products appear to govern pro-oK processing in response to a
signal from the forespore (Cutting et al., 1990). As noted above, the sap mutations, unlike
bof mutations, appear to restore pro- oK processing at the normal time, suggesting that
processing of pro-oK remains coupled to forespore events in sop mutants. This can be
examined by introducing a mutation in a forespore regulatory gene (e.g., spoIIIG,

encoding 00) into the sap mutants.

1 10

Further analysis of the sap mutants will involve mapping the mutation(s) and
constructing a null mutation of the gene(s) in otherwise wild-type cells to test the effect on
processing of pro-0K. If pro-oK processing is normal in such a null mutant, it would
suggest that the sap mutation identified a redundant pathway (e.g., activated a fortuitous
protease capable of processing pro- oK to 0"). If such a null mutant does block processing
of pro-0K, it would suggest that the sap mutation identified a component normally involved
in processing (e. g., activated the protease that normally processes pro-oK during
sporulation). It may be desirable to isolate additional independent sop mutants to fully

explore the mechanism(s) of pro-oK processing.

Chapter 6

Studies on the role of SpoIVFB in pro-0K processing

111

112

Abstract

Evidence has been presented that SpoIVFB is capable of enhancing the
accumulation of 0" from pro-0K in the absence of other sporulation— specific gene products
during growth of B. subtilis or E. coli (Chapter 4). As a first step to determine whether
SpoIVFB can process pro-0K to 0K in vitro, efforts have been made to overproduce
SpoIVFB, or portions thereof. The C-terminal 92 amino acids of SpoIVFB was produced
as a histidine-tagged fusion protein, SpoIVFB(C), in E. coli. This polypeptide was unable
to process pro- 0K to 0K in vitro under the conditions tested. To detect SpoIVFB during
sporulation, polyclonal antibodies against SpoIVFB(C) were generated. The antibodies
sensitively detected SpoIVFB(C), or the C-temrinal SpoIVFB polypeptide after removal of
the histidine tag, but failed to detect SpoIVFB in extracts of sporulating wild-type cells.
Affinity-purified antibodies or antibodies preadsorbed with whole-cell extracts of a
sporulating spol VF null mutant were also unable to detect SpoIVFB in extracts of
sporulating cells. Because SpoIVFB might insert into the outer forespore membrane
during sporulation, attempts were made to enrich for SpoIVFB by isolating sporelets
(immature spores) from B. subtilis cells defective in spore cortex and coat synthesis.
However, the antibodies against SpoIVFB(C) did not detect SpoIVFB in extracts made
from purified sporelets.

113

Introduction

During sporulation of B. subtilis, the mother-cell-specific sigma factor, 0K, directs
transcription of genes encoding proteins that are involved in spore cortex and coat synthesis
(Kroos et al., 1989; Zheng & Losick, 1990; Cutting et al., 1991a; Kroos, 1991; Zheng et
al., 1992). oK-dependent mother cell gene expression is coupled to forespore development
at the level of processing the inactive precursor of 0“, pro-0K, to the active form (Cutting et
al., 1990; Lu et al., 1990). Processing of pro—c:K involves SpoIVB, a oG-dependent,
forespore-specific gene product, which is possibly located in the inner forespore membrane
and somehow transduces a signal(s) to activate the proooK processing machinery in the
mother cell (Cutting et al., 1991a). The processing reaction involves at least three proteins,
SpoIVFA, SpoIVFB, and BofA, which are oE-dependent mother-cell gene products
(Cutting et al., 1991b; Ricca et al., 1992). These three proteins have been suggested to
form a complex that may insert into the outer forespore membrane (Ricca et al., 1992).
Genetic studies suggest that both SpoIVFA and BofA negatively regulate pro-cK
processing until a signal(s) is received from the forespore that relieves the inhibitory effect
(Cutting et al., 1991b; Ricca et al., 1992). SpoIVFB, on the other hand, has been
suggested to play an intimate role in pro-oK processing, based on several lines of evidence.
First, a missense mutation in spoIVFB blocks pro-oK processing, indicating that SpoIVFB
is required for the processing event (Lu et al., 1990). Second, bypass mutations, which
are mutations in the bofA and SpoIVFA genes that uncouple oK—dependent mother-cell gene
expression from forespore control, fail to bypass the requirement for SpoIVFB in pro-oK
processing (Cutting et al., 1990). Third, deletion of the pro-amino acid coding sequence
from the gene that encodes pro-oK (sigK) allows expression of oK-dependent genes in

spoIVFB mutant cells, suggesting that the only function of SpoIVFB is to pemrit pro-0K

114

processing. Thus, it has been proposed that SpoIVFB may either be the protease that
processes pro-oK or a regulator of the processing event (Cutting et al., 1990; Lu et al.,
1990, Cutting et al., 1991b).

Although the requirement for SpoIVFB in pro-oK processing can be partially
bypassed by overproducing pro-oK (Lu & Kroos, 1994), or fully bypassed by mutation
(Chapter 5), SpoIVFB is able to enhance 0K accumulation from pro-0K during growth of
B. subtilis or E. coli (Chapter 4). It remains unclear whether SpoIVFB is the protease that
processes pro-oK or an activator of a protease. Another question is the location of
SpoIVFB during sporulation. Analysis of the deduced amino acid sequence of SpoIVFB
identifies several hydrophobic segments that could potentially be membrane-spanning
segments (Figure 6.1) (Cutting et al., 1991b), yet no evidence has been presented to
support the notion that SpoIVFB is localized in the outer forespore membrane.

One approach toward clarifying the role of SpoIVFB is to purify SpoIVFB and test
its ability to convert pro-cK to 0K in vitro. We were unable to produce full-length
SpoIVFB; however, using a T7 RNA polymerase-based expression system, we were able
to produce the C-terminal 92 amino acids of SpoIVFB as a fusion protein [SpoIVFB(C)] in
large quantities in E. coli. An initial test indicated that SpoIVFB(C) did not possess
processing activity when mixed with purified pro—oK in vitro. To determine the location of
SpoIVFB during sporulation, we generated polyclonal antibodies against SpoIVFB(C).
The antibodies sensitively detected gel-purified SpoIVFB(C), but failed to detect SpoIVFB
in sporulating wild-type cells, suggesting that the amount of SpoIVFB present during
sponrlation is too small to be detected. Based on the assumption that SpoIVFB may insert
into the forespore membrane, we tried to enrich for SpoIVFB by isolating sporelets from
B. subtilis mutants defective in spore cortex and coat synthesis. However, the antibodies

against SpoIVFB(C) failed to detect SpoIVFB in the extracts made from isolated sporelets.

115

m 82 33
+ - 4: ‘4» - ‘+ ++ - -- + +--'
m3! “Imp"! ImumWMInwmmsmmwmmmmAfl IWWMA too

84 85 86

—-r :_ 4 : 4 a :
- - - + + + + - +
mmmrmrnmmsmummmsmwnmrmwm zoo
r r r l r I r r r I

 

+ + 0+ ++--+ +--+ -++ -+ + .-- -++ -
mrmmmammmrrrmwmnmmsmamr 2“
I t I I l I t r

 

femur.
" _- o ..n..- ..o' . a . I a
.O "'l.. ' O ' P¢ '~.e'. . - h . . ‘ ..'. ' ..I " o .‘.. ." 0 v.
Q a. a . .0 O . 0’ I a O a . fl ‘
I n . ‘..o . ‘ ”.0... . O \ n' . ‘. o. .‘ a...” ..:.C . '
A.‘ .‘.'0.:'\:: .“ '£\’o'~ .' ..O O .O. . .' '0'...’ -. . o ‘00...°f
o'f‘.‘».... -\ ".“ "I‘ .' o. '0 .‘ 0 . .0. .c.‘o'.100' .....
.7. ‘f‘ o .a ..O'... - 0:3. ' . O. . f I .°~- ‘I ' .' .' “‘
‘5' . a. a O O O.
'0‘.".:‘. “.....0...0.‘- ‘C’ .: . :‘0 '0. .‘a. g 3 o" .n:.:.::..‘~¢. ~ .9 ‘
.. 0‘... :%0 ."'°. ' -. 0.. \" .. . .‘ . .. o . ’ .3. .-."‘ O ’.:.....‘
'0"‘-~— 0“..D'Q:‘...Ol.e ‘ . .0 :' '0 ...".. '.' '..0‘: ‘
e.:..':n . Jr 1. 0'...‘ ..‘C - .0... O. ' t . ‘ :.’ O.‘ ..'...| . .. r.
. . a. ‘ a. - 0"“..- “ , .f “ .9 .00....0 \ . a. .‘°. .00. 0". ‘ ‘.:¢'
4 .c \- 0".0 I ’ . x. I O "O S S .$~~ ..'. ‘ .1. '0. 0-0- .0. o
s ' 0.: | '.:..'° :I ‘ I ~o """ I“ 7 . ' ' . ° 0. . o .0 '
fl . . . ' ' -'- .”:n ' . ' - ..'¢.o: . ...: I.

 

 

 

 

 

I'm-«n

Figure 6.1 (A) Deduced amino acid sequence of SpoIVFB and potential membrane-
spanning segments identified according to the hydropathy analysis of Kyte and Doolittle
(1982) using a window of 21 residues. (B) Topological model for the insertion of
SpoIVFB into the outer forespore membrane.

116

Materials and Methods

Bacterial strains. E.coli strain JM109 [recAI, end/11, gyrA96, thi, hstI7,
supE44, MIA], 2:, A (lac-proAB) (F' traD36 proAB lacquAM15)] was obtained from S.
Triezenberg (Michigan State University). BL21 (F- ompT rB- mg) was purchased from
Novagen. Both strains served as hosts for construction and maintenance of plasmids.
BL21 (XDE3) (Novagen) was used for expression of recombinant proteins. Selection of
transformants was on LB (Maniatis et al., 1982) agar containing ampicillin (50 ug/ml). B.
subtilis strains PY79 (spo+) and BK401 (spoIIIC94) were obtained from R. Losick
(Harvard University). BSL51 (spoIVFAAB::cat) was constructed as described previously
(Chapter 3).

Plasmids. pSL28 has the DNA encoding the last 92 amino acids of SpoIVFB
fused to a T7 promoter in pET16b (Figure 6.2). To construct pSL28, DNA encoding the
last 92 amino acids of SpoIVFB was amplified by the polymerase chain reaction (PCR)
using a 1.0 kb HindIH-Sall fragment of pSC224 (Cutting et al., 1991b), which contains
the entire spoIVFB gene, as the template. Two oligonucleotides, P2 (5'-GGQAIA]§
GAGGAATATCGGCAAAGG-3'), which matches the coding sequence of amino acids
197 to 202 of SpoIVFB plus a unique Ndel site (underlined, including an ATG codon),
and P3 (5'-GCWAGTAGGGCAGAAGCAGT‘TCCTC—T), which matches the
non-coding sequence corresponding to amino acids 282 to 288 of SpoIVFB plus the stop
codon (FAA) and an additional BamHI site (underlined), served as PCR primers. PCR
was carried out using the GeneAmp PCR System 9600 (Perkin-Elmer Cetus). The
following procedure was used for the amplification reactions: 5 min at 94’C for the
denaturation of template and primer DNAs; 5 cycles of amplification using 30 sec at 94'C
(denaturation), 30 sec at 45'C (annealing), and 30 sec at 72'C (elongation); followed by 25

cycles of amplification as 30 sec at 94'C, 30 sec at 50'C, and 30 sec at 72'C. Reactions

117

Bull" ‘01.!)

 

 

- A . ' ‘ ‘0‘ , '
. N T7tggfig§er ' ke' raux , .
AGATCTCGATCCCGCGAAATTAAIACGACTCACTATAGGCGAATTGTGAGCGGATAACAATTCCCCICIAGAAATAAtTItcTTTA

.NcrLL Mt
ACTTTAAGAAGGAGATATACCATGGGCCATCATCATCATCATCATCATCATCATCACAGCAGCGGCCATATCGAAGGTCGTCAT
HetGlyHlaHlaHlaHleHlaNtafltcfllaHIaHIaSerSerGlyHlsllecluclerarta
.mmw M“ x‘

ATGCTCGAGGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACCC
fletLeuGluAapProAlaAlcAsnLyaAloArgLyaGluAlaGIuLeuAlaAloAleIhrAlaGluGlnEnd

Ecofitl
CTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGCAACTATATCCGGATAIC

pET-16tr ClonlngIExpresslon Regton

Figure 6.2 Structure of the T7 RNA polymerase-dependent expression vector pET'16b.

Nucleotide sequence of the cloning/expression region is shown.

118

were further incubated at 72’C for 10 min. Final PCR products were stored at 4’C. The
292 bp PCR product was gel-purified and digested with NdeI and BamHI. This DNA
fragment was ethanol precipitated and ligated with NdeI-BamHI-digested pETl6b. The
resulting plasmid, pSL28, has DNA encoding the C-terminal 92 amino acids of SpoIVFB
fused in-frame downstream of 22 amino acids encoded by the vector, including a stretch of
10 histidines to facilitate purification of the fusion protein [SpoIVFB(C)] and a Factor Xa
cleavage site that can be used to remove the histidine tag from the fusion protein (Figure
6.2).

pSL29 has the DNA encoding all of SpoIVFB except the first 29 amino acids fused
to the T7 promoter in pETl6b. To construct pSL29, the entire spoIVFB gene was
amplified by PCR using synthetic oligonucleotides P1 (S'GGQA'LAJQAATAAATGGCI‘
CGAC), which matches the coding sequence of the first 6 amino acids of SpoIVFB plus an
NdeI site (underlined), and P3 (see above), as primers. The 1.0 kbp HindIII-Sall fiagment
of pSC224 was used as the PCR template. A 0.9 kbp PCR product was gel-purified and
digested with BamHI and NdeI completely. A 780 bp fragment resulting from cleavage by
NdeI at a site in spoIVF B (corresponding to amino acid 29 of SpoIVFB) and cleavage by
BamHI at a site in the downstream primer (P3) was gel-purified and inserted into NdeI-
BamHI digested pETl6b. thus fusing the DNA encoding an N-terminal truncated SpoIVFB
(amino acids 30 to 288) to the T7 promoter.

pSL30 has the DNA encoding all of SpoIVFB protein fused to the T7 promoter in
pETl6b. To construct pSL30, the 0.9 kbp PCR product described above was digested
with BamHI and gel-purified. This fragment was digested partially with Ndel and the 0.9
kbp fragment resulting from cleavage in the upstream primer (P1) was gel-purified and
ligated with NdeI-BamHI digested pETl6b. The full-length spoIVFB insert in pSL30 was
verified by restriction mapping.

Nucleotide sequencing. To determine whether the insert in pSL28 (a PCR

119

product encoding the C-terminal 92 amino acids of SpoIVFB) contained any mutations, the
plasmid was subjected to double-stranded DNA sequencing using the dideoxy chain
termination method of Sanger (Sanger et al., 1977). P2 and P3 were used as primers for
the sequencing. A kit (Sequenase version 2.0; United States Biochemical Corp.) was used
for the sequencing reactions.

Production of the SpoIVFB(C) and preparation of antibodies. pSL28
and the parental plasmid, pETl6b, were separately transformed into E. coli strain BL21
(1DE3) (Novagen). Cells containing pSL28 or pET16b were inoculated into 5 ml LB
medium containing ampicillin (50 ug/ml) and grown at 37'C until the O.D.goo reached
0.8-1.0. The cultures were then stored overnight at 4'C. A 2 ml aliquot of the overnight
cultrne was centrifuged (12,000 x g), resuspended in 2 ml of fresh LB, and inoculated into
50 ml of LB for growth at 37'C with ampicillin selection (50 [lg/ml). When the O.D.600

reached about 1.0, each culture was induced with 1 mM IPTG. Samples (2 x 1 ml) were
collected at hourly intervals until 3 hours after the induction, centrifuged (12,000 x g), and
the cell pellet was stored at -70'C.

Whole-cell extracts of the IPTG-induced cells were prepared as follows. The cell
pellet was resuspended in 100 [.11 of 10 mM Tris-HCl, pH 8.0, mixed with 50 [.11 of 3x
sample buffer [0.375 M Tris-HCl pH 6.8, 6% SDS, 15% B-mercaptoethanol (WV), 30%
glycerol (v/v), 0.3% bromophenol blue], and incubated at 70'C for 5 min.

Soluble and insoluble fractions of the IPTG-induced cells were prepared as
follows. The cell pellet was resuspended in 100 ul of 50 mM Tris-HCI pH 8.0, 2 mM
EDTA, 0.1mg/ml lysozyme, and 0.1% Triton X-100, then incubated at 30'C for 15 min.
Cells were lysed by sonication (Sonicator W-225; microtip maximum power setting at 6;
Heat System-Ultrasonics, Inc.) twice for 10 sec. The lysate was centrifuged at 12,000 x g
for 15 min at 4’C. The supernatant, which is the soluble fraction, was transferred to

another tube and mixed with 50 1.1.1 of 3x sample buffer (0.375 M Tris-HCl pH 6.8, 6%

120

SDS, 15% B-mercaptoethanol, 30% glycerol, 0.3% bromophenol blue). The pellet, which
is the insoluble fraction, was resuspended in 100 pl of 1x sample buffer (0.125 M
Tris-HCl pH 6.8, 2% SDS, 5% B-mercaptoethanol, 10% glycerol, 0.1% bromophenol
blue). Both fractions were incubated at 70'C for 5 min.

Proteins in each fraction (whole-cell, soluble, and insoluble) were separated by
SDS-PAGE (18.5% polyacrylamide). Since most of the SpoIVFB(C) was in the insoluble
fraction and there were not many other proteins present in this fraction (see Figure 6.3), the
fusion protein (about 150 pg) was gel-purified from the insoluble fraction by electroelution
from gel slices. Gel—purified SpoIVFB(C) (80 pg) was precipitated with acetone,
dissolved in phosphate-buffered saline (Harlow & Lane, 1988), mixed with Freund's
complete adjuvant (BRL). and injected subcutaneously into a rabbit. 4 weeks later a
booster injection (40 pg of the fusion protein mixed with Freund's incomplete adjuvant)
was performed. The rabbit was bled 1 week after the boost and the serum was prepared
(hereafter called anti-SpoIVFB(C) antibodies; Harlow et al., 1988).

Purification of antibodies. Affinity purification of the antibodies (Olmsted,
1981) was performed as follows: 60 pg of gel-purified SpoIVFB(C) was electrophoresed
on an 18.5% polyacrylamide-SDS gel and the protein was transferred to a poly (vinylidene
difluoride) (PVDF) membrane. The region of the membrane with bound SpoIVFB(C) was
excised and incubated with TBST (20 mM Tris-HCl, pH 7.5; 0.5 M NaCl; 0.05% Tween
20) containing 2% BSA for 3 hrs to block non-specific binding of the antibodies.
Anti-SpoIVFB(C) antibodies (100 pl) were incubated with the membrane in 5 ml of TBST
containing 2% BSA overnight at 4’C. The membrane was washed 3 times with TBST. To
elute antibodies bound to the membrane, 400 pl of 0.2 M glycine pH 2.3 was added to the
membrane in a 1.5 ml tube and the tube was rotated for 2 min at 4'C. The mixture was
centrifuged at 12,000 x g for 20 sec and the supernatant was transferred to another tube and
immediately neutralized by adding 400 pl of 100 mM Tris-base. The above described

121

elution steps were repeated twice and neutralized supematants were combined. The affinity
purified antibodies (2.4 ml) were finally stored in neutralized solution supplemented with
150 mM NaCl, 0.5% Tween 20, and 1% BSA at 4’C.

Preadsorption of the anti-SpoIVFB(C) antibodies with cell extracts made fiom a
spoIVF null mutant (spoIVFAAB::cat) was carried out as follows. Samples (1 ml)
collected at hourly intervals during sporulating in Difco sporulation medium of B. subtilis
strain BSL51 (spoIVFAAB::cat) were combined, centrifuged (12,000 x g, 5 min), and
resuspended in 5 ml of TBS (20 mM Tris-HCl, pH 7.5; 0.5 M NaCl) containing 0.3 mg/ml
PMSF. Cells were lysed by passing through a French pressure chamber at 16,000-18,000
lb/in2 three times. The lysate was boiled for 5 min and the protein concentration was
determined by the method of Bradford (Bradford, 1976). Lysate (100 pg of protein) was
mixed with 50 pl of the anti-SpoIVFB(C) antibodies in 500 pl of TBST and incubated at
4'C overnight with rotation. The mixture was centriguged (12,000 x g, 1 min) and the
supernatant served as preadsorbed anti-SpoIVFB(C) antibodies.

Western blot analysis. Western blot analysis was performed as described (Lu
et al., 1990) except the affinity purified or preadsorbed anti-SpoIVFB(C) antibodies were
diluted 1: 500.

Factor Xa digestion. Gel-purified, renatured (Hager & Burgess, 1980)
C-terminal SpoIVFB fusion protein (2 pg) was incubated with 5 pg of Factor Xa (New
England Biolabs) in dilution buffer (50 mM Tris-HCl pH 8.0, 0.1 mM EDTA, 1 mM DTT,
0.1 mg/ml BSA, 150 mM NaCl, 20% glycerol) containing 2 mM CaClz at 30'C for 14 hrs.

As controls, 2 pg of renatured C-terminal SpoIVFB fusion protein and 5 pg of Factor Xa
were incubated separately at 30'C for 14 hrs. One-fifth of each sample was
electrophoresed on an 18.5% polyacrylamide-SDS gel. Proteins were transferred to a
PVDF membrane and subjected to Western blot analysis using anti-SpoIVFB(C)
antibodies. Proteins in the rest of each sample were separated by SDS-PAGE (18.5%

122

polyacrylamide) and stained by Coomassie blue (Maniatis, 1982).

In vitro processing of pro-c:K using gel-purified, renatured pro-(rK
and SpoIVFB(C). Samples containing 200 ng of gel-purified, renatured pro-trK
prepared as described previously (Lu et al., 1990) and 1 pg of gel-purified, renatured
SpoIVFB(C) were incubated in dilution buffer at either 37‘C or 30'C for 30, 60, 90, or
120 min. A control reaction containing 200 ng of pro-oK alone was incubated for 120 min
at 37'C or 30'C. To each sample, 0.5 volume of 3x sample buffer was added and the
mixture was boiled for 1 min. Proteins were separated by SDS-PAGE (12.5%
polyacrylamide). The levels of pro-oK and 0“ were detected by Western blot analysis using
anti-pro-oK antibodies as described previously (Lu et al., 1990).

Isolation of sporelets. B. subtilis strains BK410 (spoIIIC94) and BSL51
(spoIVFAAB :.°cat) were induced to sporulate by growth and nutrient exhaustion in D8
medium (100 ml cultures). Cells were harvested at T5 by centrifugation (7 ,650 x g, 6 min)
and the pellets were stored at -70'C. The following steps were performed at 4'C. The cell
pellet was washed in 1 M KCl (5 ml) and resuspended in TEP buffer (50 mM Tris-HCl pH
7.2, 10 mM EDTA, 2 mM PMSF) at a final concentration of 15 mg of cells per ml. To
release sporelets from the sporangia, the suspension was passed through a French pressure
chamber at 14,000-16,0001b/1n2 twice. The suspension was then diluted twofold in TEP
buffer and subjected to low speed centrifugation (2,000 x g) for 5 min. The supernatant,
which contains mainly sporelets, was transferred to another tube and stored on ice. The
pellet was resuspended in 30 ml of TEP and centrifuged at 2,000 x g for 5 min. The
supernatant was combined with the previous one. Sporelets in the supernatant were
pelleted by centrifugation at 12,000 x g for 10 min. The pellets were washed twice in TEP
buffer and resuspended in 2 ml of 5% Renografin (Squibb). The suspension was gently
layered over 10 ml of 30% Renografin in a 15 ml glass Corex centrifuge tube and

centrifuged at 11,000 rpm for 30 min in a Sorvall SS-34 rotor. The supernatant was

123

discarded and pellet at the bottom of the tube consisted of over 90% sporelets. The
sporelets were washed twice in TEP buffer, lysed as described previously (Healy, 1989),
and the protein concentration was determined by the method of Bradford (Bradford, 1976).

Ram“

Overproduction of the C-terminal 92 amino acids of SpoIVFB in E.
coli. Using PCR we amplified the DNA encoding the last 92 amino acids of SpoIVFB.
The DNA was cloned into a T7 RNA polymerase-dependent expression vector, pETl6b
(Figure 6.2), such that a 114 amino acid fusion protein [SpoIVFB(C)] with a histidine tag
at the N-terminus would be produced. The histidine tag is designed to be used for affinity
purification of the protein, and the tag can be removed by Factor Xa proteolysis. The
recombinant plasmid, pSL28, was transformed into E. coli strain BL21 (xDE3), which
contains the gene encoding T7 RNA polymerase under the control of an IPTG-inducible
lacUV5 promoter. The strain was grown in LB medium and induced with 1 mM IPTG at
the mid-log phase of growth. Cells were harvested at different times after the induction and
proteins in different cell fractions (whole-cell, soluble, and insoluble) were separated by
SDS-PAGE (18.5% acrylamide). As shown in Figure 6.3, a polypeptide of approximately
14 kDa in size was enriched in cells containing pSL28 (lane 3) as compared to IPTG-
induced cells containing the parental plasmid, pETl6b (lane 1), or uninduced cells
containing pSL28 (lane 2). This polypeptide is likely to be SpoIVFB(C). A sonic extract
of IPTG-induced cells containing pSL28 was fractionated into soluble and insoluble parts,
and the majority of SpoIVFB(C) was found in the insoluble fraction (lane 5), possibly due
to the formation of inclusion bodies. The amount of SpoIVFB(C) was estimated to be

about 300 pg per ml of induced cells.

124

 

Figure 6.3 Production of SpoIVFB(C) in E. coli. Whole-cell extracts (5 pl) of strain
BL21 (kDE3) containing pET16b (lane 1) or pSL28 at 3 hours after IPTG (1 mM)
induction (lane 3), or BSL21 (ADE3) containing pSL28 without IPTG induction (lane 2).
Soluble (lane 4) and insoluble (lane 5) fractions (5 pl) of the strain containing pSL28 at 3

hours after IPTG induction.

125

Characterization of antibodies made against SpoIVFB(C). Since the
majority of SpoIVFB(C) was in the insoluble fraction of IPTG-induced cells containing
pSL28, and not many other proteins were present in this fraction (Figure 6.3, lane 5), the
fusion protein was purified from the gel and used to raise polyclonal antibodies in a rabbit.
The anti-SpoIVFB(C) antibodies detected as little as 5 ng of gel-purified SpoIVFB(C)
(Figure 6.4A, lane 1), while the preimmune serum did not cross-react with the gel-purified
SpoIVFB(C) (Figure 6.4A, lane 4).

To determine whether the anti-SpoIVFB(C) antibodies recognize the C-terminal 92
amino acids of SpoIVFB, gel-purified, renatured SpoIVFB(C) was digested with Factor
Xa, which was expected to remove the first 20 amino acids of the fusion protein and result
in the production of a polypeptide containing the C-terminal 92 anrino acids of SpoIVFB
plus two extra amino acids (His and Met) at the N-terminus (Figure 6.2). As shown in
Figure 6.43, Western blot analysis of the Factor Xa digestion products, using the anti-
SpoIVFB(C) antibodies, detected two polypeptides. One corrrigrated with undigested
SpoIVFB(C) (lanes 1 and 2, denoted by an arrow) and the other (denoted by an
arrowhead) migrated faster than the fusion protein. The smaller polypeptide was not
present in reactions containing only SpoIVFB(C) (lane 2) or Factor Xa (lane 3), suggesting
that the smaller polypeptide was neither a degradation product of SpoIVFB(C) nor a
degradation product of Factor Xa. Since there is only one Factor Xa cleavage site in
SpoIVFB(C) and since the smaller polypeptide is approximately the expected size for
cleavage at that site, the smaller polypeptide is likey to be the C—terminal 92 amino acids of
SpoIVFB (with His and Met at the N-terminus). Thus, it appears that the anti-
SpoIVFB(C) antibodies are capable of recognizing the C-terrninal 92 amino acids of
SpoIVFB. Coomassie blue staining of the Factor Xa digestion products separated by
SDS-PAGE indicated that cleavage was incomplete (data not shown), which is consistent

with the Western blot result (Figure 6.4B). Furthermore, the amount of cleavage product

126

Figure 6.4 Characterization of anti-SpoIVFB(C) antibodies. (A) The antibodies
sensitively detect gel-purified SpoIVFB(C). Gel-purified SpoIVFB(C) (5, 10, and 15 ng
in lanes 1, 2, and 3, respectively) was electrophoresed on 3 polyacrylamide (18.5%)—SDS
gel and subjected to Western blot analysis as described in Materials and Methods using
anti-SpoIVFB(C) antibodies (1:2,500 dilution). Lane 4 contains 20 ng of gel-purified
SpoIVFB(C) and probed with the preimmune serum (1:2,500 dilution). (B) Western blot
analysis of SpoIVFB(C) after Factor Xa digestion. SpoIVFB(C) (400 ng) with (lane 1) or
without (lane 2) the addition of Factor Xa (1 pg) and incubated at 30'C for 14 hrs. Lane 3
contains 1 pg of Factor Xa alone, also incubated at 30'C for 14 hr.

127

4 3 2 1

+1. -

128

versus substrate observed by Coomassie staining was comparable to the signal difference
observed by Western blot analysis, suggesting that the anti-SpoIVFB(C) antibodies detect
both polypeptides with similar sensitivity.

The anti-SpoIVFB(C) antibodies were used in attempts to detect SpoIVFB in
sporulating B. subtilis wild-type (PY79) cells. Extracts of a spa] VF null mutant
(spoIVFAAB::cat) served as a negative control. lrnmunoblots failed to reveal a
polypeptide of the expected size for SpoIVFB (34 kDa) that was present in wild-type cells
but not in the spoIVF null mutant (data not shown). Several polypeptides were observed
for both cell types. To eliminate the possibility of a cross-reacting polypeptide that happens
to comigrate with SpoIVFB, the antibodies were either affinity purified using the
SpoIVFB(C) or preadsorbed with extracts from the spoIVF null mutant (see Materials and
Methods). In both cases, the purified antibodies could recognize as little as 10 ng of gel-
purified SpoIVFB (C) (data not shown). However, despite greatly reducing the detection
of cross-reacting species in both cases, neither preparation of antibodies detected a
polypeptide that consistently appeared to be more abundant in wild-type cells than in the
spa! VF null mutant (data not shown). These results suggested that the amount of
SpoIVFB in sporulating cells was too small to be detected (i.e., < 0.1% of total protein).

Isolation of sporelets to enrich for forespore-associated proteins.
Because SpoIVFB had been predicted to be located in the outer forespore membrane
(Cutting et al., 1991b), we attempted to enrich for SpoIVFB by isolating immature spores
called "sporelets". Both sigK and spoIVF mutants fail to make the spore cortex and coat
(Kroos et al., 1989; Cutting et al., 1990; Cutting et al., 1991b). However, these mutants
do produce phase gray (under the phase contrast microscope) sporelets. SpoIVFB is
expected to accumulate normally in sigK mutant cells beacuse SpoIVFB normally governs
processing of the sigK gene product (pro-0K) and a spoIVF-lacZ transcriptional fusion is
expressed normally in sigK mutant cells (Cutting et al., 1991b). Sporelets were isolated

129

from both sigK and the spoIVF null mutants as described in Materials and Methods.
Proteins in sporelet lysates were separated by SDS-PAGE (18.5% polyacrylamide),
transferred to a PVDF membrane, and probed with the anti-SpoIVFB(C) antibodies. No
polypeptide was detected that appeared to be more abundant in the sigK sporelet lysate than
in the spoIVF sporelet lysate (data not shown).

SpoIVFB(C) does not possess pro-0K processing activity in vitro. To
test whether SpoIVFB(C) could convert pro-0K to 6K, gel-purified, renatured pro-0K was
incubated with gel-purified, renatured SpoIVFB(C) at either 37'C or 30'C for various
periods of time and the samples were subjected to Western blot analysis to detect using
anti-pro-oK antibodies. No 0K was observed, suggesting that SpoIVFB(C) does not

possess processing activity under the conditions used in virro.

Discussion

To test whether SpoIVFB protein could process pro-0K in virro, we tried to express
the protein in E. coli using a T7 RNA polymerase-based expression system. We were able
to produce the C-terminal 92 amino acids as a histidine-tagged fusion protein in large
quantities in E. coli. A preliminary test indicated that this fusion protein did not exhibit
processing activity under our experimental conditons. Polyclonal antibodies were
generated against the fusion protein in hopes of determining the location of SpoIVFB in
sporulating cells. However, the antibodies failed to detect SpoIVFB in whole-cell extracts
or in extracts made from isolated sporelets. We estimate that intact SpoIVFB comprises <
0.1% of the total protein in these extracts, based on the sensitivity with which the
antibodies detect either the fusion protein or a Factor Xa cleavage product of the fusion

protein presumably lacking the histidine tag.

130

Based on the deduced amino acid sequence, SpoIVFB was predicted to have five
transmembrane segments in the N-terminal domain that may insert into the outer forespore
membrane, and a hydrophilic C-terminal domain that presumably faces the cytoplasm of the
mother-cell compartment (Cutting et al., 1991b). We reasoned that perhaps the N-terminal
domain, in additon to inserting into the outer forespore membrane, might transmit a signal
from the forespore (Cutting et al., 1991a), while the C-terminal domain might process pro-
oK (if it acts as a protease) or stimulate the processing reaction (if it acts as a regulator).

SpoIVFB(C) encompasses the putative C-terminal domain, yet it failed to process pro-oK
under the conditons we employed. Perhaps different reaction conditions would permit
activity in vitro. Alternatively, the predicted membrane t0pology and domain structure of
SpoIVFB may be incorrect. Our discovery of a motif (HEXXH) characteristic of a
bacterial Zn-containing metalloprotease family (Hase & Finkelstein, 1993) in the
N-terminal region of SpoIVFB (arrrino acids 43 to 47; HELGH) actually suggests that the
N-terminal domain may contain protease activity.

We were unable to detect production of full-length or N-terminally truncated
(lacking the first 29 amino acids) SpoIVFB fusion proteins in E. coli using the T7 RNA
polymerase-based expression system (see Materials and Methods for a description of
plasmids constructed) even when cell extracts were subjected to Western blot analysis
using the anti-SpoIVFB(C) antibodies (data not shown). Translation of these fusion
proteins should be efficient since the vector provides a strong ribosomal binding site and
optimally spaced ATG start codon (Figure 6.2). It seemed possible that the fusion proteins
were not stable at 37°C, which was the incubation temperature used initially, since it had
been suggested that SpoIVFB is therrnolabile in the absence of SpoIVFA in B. subtilis
(Cutting et al., 1991b). To test this possibility, we grew the E. coli cells at 30°C and
induced the expression of the recombinant protein. Full-length SpoIVFB was not observed

even 4 hours after IPTG induction when whole—cell extracts were examined by Commassie

131

blue staining or Western blot analysis using anti-SpoIVFB(C) antibodies (data not shown).
To test whether SpoIVFB might be enriched in a membrane fraction, cells were grown at
30°C and induced with IPTG (1 mM), the membrane and cytosolic fractions were prepared
[Bibi, 1993 #647]. Neither Coomassie staining nor Western blotting using the anti-
SpoIVFB(C) antibodies revealed a protein of the expected sizes for one of the fusion
proteins (i.e., full-length or N-teminally truncated SpoIVFB) that was enriched in
membrane fractions (data not shown). Thus, these fusion proteins may not be produced
using this expression system. Difficulties are often encountered in producing integral
membrane proteins, and both the fusion proteins that failed to be produced contain several
putative transmembrane segments (Cutting et al., 1991b).

We were also unable to detect SpoIVFB in whole-cell extracts of sporulating wild-
type cells using the anti-SpoIVFB(C) antibodies. Apparently, the amount of SpoIVFB in
whole-cell extracts was too small to be detected by the antibodies. Efforts to enrich for
SpoIVFB by isolating sporelets from sigK and spa! VF null mutants were made.
However, the anti-SpoIVFB (C) antibodies still failed to detect SpoIVFB in whole-sporelet
extracts. Perhaps isolation of a membrane fiaction from sporelets would permit detection
of SpoIVFB. Alternatively, perhaps SpoIVFB is not inserted into the forespore
membrane, or it lacks the C-terminal domain (e.g., it is possible that the C-terminal domain
of SpoIVFB has to be removed in order to activate the N-terminal domain). Other

possibilities are that SpoIVFB is no longer present at the time of harvesting sporelets (T5 in

our case) or that SpoIVFB was degraded during the sporelet isolation procedure. Clearly,
additional studies will be required to develop an antibody probe for SpoIVFB, to determine

its cellular location, and, ultimately, to determine its role in pro-oK processing.

Summary and Perspectives

132

133

Activation of the B. subtilis mother-cell-specific sigma factor, 0K, involves
multilevel regulation. One important level of regulation is post-translational. This thesis
presents evidence demonstrating that 0K is that made as an inactive precursor, pro-0K, and
is processed to the active form in a developmentally regulated fashion.

Using antibodies against the putative pro- oK, pro-0K was first detected at 3 hours
into sporulation while 0K was detected an hour later. Based on the order of appearance of
pro-oK and 0", we conclude that 0" is the processed product of pro-0K, which is initially
inactive as judged by the inability of pro-oK to activate transcription of a cK-dependent gene
fusion in a B. subtilis strain capable of producing pro- oK earlier than its normal appearance
during sporulation. To further demonstrate the precursor-product relationship between
pro-oK and 0“ using the conventional ‘pulse-chase’ experiment, I first attempted to
immunoprecipitate pro— 0K and/or 0K from sporulating B. subtilis whole-cell extracts using
the antibodies against pro- oK. Neither pro-0K nor UK was irnmunoprecipitated, suggesting
that the antibodies, which was made against the denatured pro-0K, may not recognize native
pro-oK and 0K. Further attempt could be focused on generating antibodies against the
native pro-0K or 0K. Alternatively, B. subtilis whole-cell extracts containing pro-oK and/or
0“ could be subjected to a mild heat-treatment (60°C, 10 min) to partly denature the target
proteins (i.e., pro-0K and 0K) such that they may be recognized by the antibodies against
the denatured pro-(rK and immunoprecipitated.

Overproducing pro-oK partially bypassed the requirement for forespore regulatory
genes in oK-dependent mother-cell gene expression and processing of pro-0K is also
partially restored. Similarly, functions of the spoIVF gene products in pro-oK processing
become largely dispensable when pro-oK is overproduced. These observations prompted
us to isolate suppressor mutants that bypass the requirement for spoIVF in sporultaion and

cK-dependent gene expression when pro-0K is produced at the normal level.

134

Characterization of several isolated mutants (sop) shows that pro-oK processing is restored.
Study of these sop mutants may provide novel information with regard to the mechanism of
pro-0K processing. Future research may involve isolating more mutants from independent
mutational events, mapping the isolated sop mutation(s). Ensuing steps may involve
cloning and sequencing the putative region harboring the sap mutation(s) using available
cloning and sequencing techniques for B. subtilis (Harward & Cutting, 1990).

When spoIVFB is coexpressed with sigK (encoding pro-0K) in the absence of other
sporulation-specific gene products, it is found that SpoIVFB is capable of enhancing the
accumulation of OK, which is consistent with the suggested positive role of SpoIVFB in
pro-oK processing (Cutting, et al. 1991b). Attempts were made to produce all or part of
SpoIVFB in E. coli. The C-terminal 92 amino acids of SpoIVFB were produced as a
histidine-tagged fusion protein [SpoIVFB(C)] and was used to make polyclonal antibodies.
Gel-purified, renatured SpoIVFB(C) showed no pro-cK processing activity when mixed
with gel-purified, renatured pro-oK in vitro, suggesting that either the C-terminal 92 amino
acids of SpoIVFB do not possess the protease activity to cleave pro-0K or that additional
conditions may be required for SpoIVFB (C) to gain the processing activity. Further study
of SpoIVFB(C) in pro-oK processing may involve testing the ability of a crude extract
containing SpoIVFB(C) to process pro-0K in vitro [e.g., an extract made from E. coli cells
capable of overproducing SpoIVFB(C)]. Alternatively, purifying native SpoIVFB(C)
using chromatographic techniques (e. g., Ni-column chromatography) may be necessary as
a first step to test its ability to process pro-(rK in virro.

Attempts to express the full-length SpoIVFB using T‘7-RNA polymerase based
expression system or the PM-dependent expression system were not successful. Since
SpoIVFB is suggested to be a membrane protein (Cutting et al., 1991b), the described

expression systems may not be suitable for producing a putative membrane protein, like

135

SpoIVFB. Further attempts to express the full—length SpoIVFB may involve using an in
vitro translation system in the presence of artificial membranes (for example, phospholipid
vesicles), which may increase the level of expression of membrane associated proteins

(Cao et al., 1991).

APPENDIX

Appendix

A forespore checkpoint for mother cell gene expression
during development in B. subtilis

(Reprinted with the permission of Cell Press)

136

MWQM.MZLMWOWMC¢IM

137

A Forespore Checkpoint for Mother Cell Gene
Expression during Development in B. subtilis

Simon Cutting,‘ Valerie Olre.‘ Adam Driks:
Richard Losick,“ Stile Lu.l and Lee Kroosl

' Department of Cellular and Developmental Biology
The Biological Laboratories

Michigan State University
East Lansing, Michigan 48824

Summary

‘Gene expression in the mother cell compartment of
sporulating cells of B. subtilis is partly governed by
the mother cell RNA polymerase sigma factor or".
Paredoxlcally, chlreeted gene expression also de-

, pendeon o“, the productotthetoresporecompert-
ment regulatory gene spelllG. and on other iorespore
regulatory proteins. We new identity mutations In the
genes from and beta that relieve the dependence of
mother cell gene expression on iorespore regulatory
proteins but not on a“. We establish that the depen-
dence of mother cell gene expression on the iorespore
regulatory proteins is mediated at the level at the con-
version of pro-o“ to its mature, active form. We pro-
pose that the be“ and/or bofB proteins govern this
conversion in response to a signal generated by the
iorespore. Activation of pro-o“ could be a checkpoint

- for coordinating gene expression between the mother
celiendloresporecompartmentsofthedeveloping
sporangium.

Introduction

The metamorphwis oi cells oi the gram-positive bactec
rium Bacillus subtilis into the dormant cell type of the en-
dospore takes place in a sporangium that consists oi two
cellular compartments known as the iorespore and the
Mer cell (Losick et al.. 1988; Piggot and Coote, 1976).
The iorespore is a germline cell that ultimately becomes
the (endo)spore and gives rise to subsequent progeny.
The mother cell is a terminally dillerentiating cell that per-
ticipeteeinthelormatlonolthesporebutisdiscardedby
lysis when maturation of the spore ls complete. Gene ex-
pression in the m compartments is regulated differen-
tially. with certain genes being expressed in the iorespore
and others in the mother cell. This differential gene err-
preseion Is controlled. in part. by compartment-specific
sigma factors. 0° (Sun et al., 1999) and 0" (Kroos et al..
1989).o°dlredegeneexproeeionlntheloresporeandis
encoded by the iorespore regulatory gene spoIllG (Kar-
mazyn-Campelli et al., 1989). o“ governs mother cell
geneexpression (Krooeetal..1989)endistheproductol
merrrodtercell regulanrygeneeng.acompositeoltwo
truncdedgenescdledepolVCBandepoIIlCthatbecome

joined by a chromosomal rearrangement in the mother
cell (Stragier et al.. 1989).

oK directs the transcription of genes called cotA, cotD.
andgerE.whichareinvolvedinthesynthesisolthepro-
tein coat that encases the mature spore. cotA and cow
are structural genes lor coat proteins (Donovan et al..
1987), whereas god! is a regulatory gene (Hdland et al..
1987) whose product is required for the expression of addi-
tional coat protein genes (Zheng and Losick, 1990). The
com. cotD. and gerE genes constitute a coordinately regu-
lated gene set called the will regulon (Cutting et al., 1989:
Sandman et al.. 1988; Zheng and Losick. 1990). Expres-
sion of the will regulon requires the products of mother
cell regulatory genes (spoIIIC, spoIIID, spoIVCA. and spo-
IVCB) that are responsible for creating and transcribing
the composite structural gene (sigK) lor rrK (Kunkel et al..
1988. 1989. 1990: Sate et al.. 1990; Stragier et al., 1989).
Paradoxically. however. expression at the cotA gene set
additionally requires the products at the iorespore regula-
tory gene spoIIIG and other genes. such as spoillA and
spoIIIE. which are also needed lor iorespore gene expres-
sion (Errington and Mandelstam. 1986; Karmazyn-Cem-
pelli et al., 1989; Mason et al., 1988). As the products of
spoIIIA, spoIIIE. and spoIIIG are not required tor the crea-
tion of sigK or its transcription (Kunkel et al.. 1988. 1990;
Stragier et al.. 1989). we inter the existence of an addi-
tional level of regulation of sigK that somehow couples
all-directed gene expression to events occurring in the
iorespore.

To investigate the dependence of undirected gene ex-
pression on iorespore regulatory genes, we isolated muta«
tions in loci called bolA and bofB that bypass the depen-
dence oi the expression oi cotA, onto. and gerE on the
product oi the iorespore gene spoIIIG. bol'A does not cor-
respond to a known gene, but bofB is allelic to the sporula-
tion operon spoIVF. The products of MA andlor bofB
(spoIVF) could mediate the coupling of mother cell to iore-
spore gene expression.

Aclue astohowthecouplingoimothercelltolorespore
gene expression is controlled was the discovery that the
deduced primary product at the gene encoding o" Is a
pro-protein, bearing an NH; -terminal extension of 20
amino acids (Kroos et al.. 1989). Recently. S Lu. 8. Hal-
berg. and L. Kroos (unpublished data) demonstrated bio-
chemically the existence oi a precursor of o" and showed
that spoIIIA. spell/E. and spoIIlG cells accumulate the pro-
protein but tail to process it to mature a“. By analogy with
the ease of the sigma precursor to the sporulation sigma
factor oE (Labell et al.. 1987). we hypothesize that pro-(rK
lsinsdiveandthetthedependenceoto'fidirectedgene
eurpression on iorespore regulatory genes is controlled at
tlrelevelottheconversionotpro-o“toitsectivelorrn.As
prool of this hypothesis, we show that the hem and bofB
mutationsdonotrelievethedependenceotmotherceli
geneexpressionono“.butinsteadtheyreetoreproceee
ing of pro-oK in spoIlIA and epolllG mutant cells. Further-

$2

138

Figuret. EttsdotbdlhrtatlonsoncotA-hcz
ExpressioninMMutantCels

 

 

fl-Goloctcsidose activity (Miler units)

80 A 8 FC
60
40
20
i

246824682468

Time (hours after resuspension)

msubstitutionotsngwlthsdeletion-mutatedgenein
which thepro-amino acid coding sequence(that is. the
codingsequence lorthe MHz-terminal extension) was re-
moved relieves thedependenceot mother cell geneex-
pressionon iorespore regulatory genes. Weproposethst
theboMandIorbafB(spoIVF)geneprcductsgovernthe
corwersienctpro-el‘tomature e" in responsetoasignal
producedbytheloresporeandthstthecouplingotpro-
0" processing to iorespore development is a checkpoint
(Hartwell and Welnert. 1989) lor coordinating gene ex-
pression between the two cell types of the developing
Wm-

Results

MutationsthatBypaestheDependenceot
cotA-iecZonspomG
‘bkmtgatethedependenceclniotherceflgeneexpres-
sbnonbresporedeveloprnentweidentilied mutations
thatbypassedthedependenceotcotAexpressiononthe
lorespcregenespoIIIGbyuseolacotA-iathusion.Wfld-
type(spc‘)'cellsbearingthecotA-lac2tusionproduce
bluecoloniesonagarpiatescontaining Dilcosporulstion
(DS)mediumandthechromogenic B—gaisctosldasesub-
strateX-gal.whereaslusion-bearlngcellsolaspolll6de-
lation mutant (aoolllGAl) produce colonies thatarepaie
bluecrwhlte.Accordingly.thecotA-lac2lusionwasintro-
ducedbyspeclallaed transductionintomutagenizedspo-
IIIGcells.andtheresultinglysogenswerepiatedonto
solidDS medium containing X-gal. Among approximately
100.000 colonies. lour mutants were identified that were
salveiy expressing cotA—iacz as Judged by their blue
colorryaacfiphenotypeAsalurtherindicationolcctA
expression. these mutants produced dark-brown (pig-
Mccionieswhengrownonsolidmedlumiacldng
X-ollzthebrowncoionycolorphenotypewigfilsdieg;
nosticolthesynthesisolCotAprotelMDonovanetaL.
WSandmanetel..1988).Phase-contrastmicreecopy
showed that the W mutants were blocked inst
thantheoriginalstageamutant.produclngphase-gray
presporeawhlcharechsractsrlstlcotstageitsndaWe
lnlerthateschLactPig‘mutsntcontainsamutatiorxs)

 

 

246810

cotAdlrected a-galactcsldue eyrttttesls w.
measuredattheindicuedtimesstterreeus-
pertslonlnSMmediutheurainsexamlned
wereSPllzzcrxA-iechysogsnsolthelollowhg
bolnxrtants: (A) scam (spoIIIGM bolAl; open
bisngles). 80080 (bow; open squares); (B)
mmmmmmscm
Wopensquares);(C)SC773(apoIIIGM
boIBS;closedtrlangles).80772(boi'85;cloeed
squussi:(DiSCI77(apeIlIoarboI80:ctosed
triangles).SCne(bol80:closedsquares).Aa
comets. each panel straws the patents oi
o-galactoeidaee synthesis in SPpmotA-hcz
mammmmw
ciesiandSCMWtzepenclrdee).

 

thstbypasssstl'iedependenceotcotAexpressiononthe
spoIIIGgeneproduct.Thesemutations.andaliithonecb-
talnedbysditlerentmethod(seeExperimentalPrcce-
dures).arecailedbcfl.bof3.bd5.bd6.andbd8lcr1iy~
passollorespore.’
Thebofmutationswereindividuallymovedbytranstor-
mationintocotA—lacZ-bearingspolllecellsthathadnot
beensubiectedtomutagenesianallcasesthenewlyln-
troduced mutations conierred both the Lac‘ and Pig‘
phenotypesontherecipientcellsandadvancedthestage
olblcclragetostage4and5.Thus.sllthreephenotypes
aretheresultoleitheraslngleortwoormoreciosely
liniod mutations.
birmstigatetheellectolbdmutstionsontheievelot
cotAexpressionquantltahreiymemeasuredcoM-direaed
B-galactosidase synthesis in spoIIIG cells that had been

. suspended in Sterlinl-Mandelstam (SM) sporulation me-

dium. Very little cotA-directed B-galactcsidase synthesis
wasdetected in spolIiG cells lacking abolmutation (open
circles in Figure 1). However. inthe presenceoibofl (Fig-
ure 1A). bola (Figure 18). bars (Figure 1C). and bofB (Fig-
ure 10). the level oi p-galactosidase synthesis (triangles)
wasrestoredtom.20%.36%.and56%.respectlvely.
at that observed in wild-type (spolIlG‘) cells (tilled cir-
cles). interestingly. the be! mutations also significantly in-
fluenced the level at coal-directed B-galactosidase syn-
thesis in spolllet cells, with boll. bars. and bars (squares
in Figures tA-lC) decreasing and bore (squares in Figure
10) ktcreasing the level of com-lacZ expression relative
b thd observed in be!’ sperm?+ cells

MapLocatloneotborMutstlons

‘blocmethebdrnutationscntl'techromoeome.wecar-
risdoutphage-mediatedtransductionandDNA-medl‘ed
trertslormationexperiments.bcflandbcf3werelocatsdat
2°enthemapotilennerandHoch(l990).whereasbol'5.
bdd.andbof8werelocatedat242° (Figure2). Theeernap
pcsltionsaretheAandBloci.respecthreiy.andthemuta-
tions are hencelorth called bol'Al. Dom. bares. m0.
endbal'BaJheAlocusdoesnotcorrespondbaprevi.
ouslylmowngene. butBisalleiicbthesporulationcp-
eronmolVF(PlggotandCoote.197B). becauselnother

:Feresporeatecitpeintinasubulis
41

139

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

37

 

6‘
70

 

work (S Cutting. S Reels. and R. Losick. unpublished
data)inwhichspolVFwasclonedandsequenced.theB
nurtstionswerecorrectedbytranstcrmationwlthcloned
DNAinternaltospoIVF.

bolilutstieneRestorethe Expressionot Other
Isndtersettheceu ReguionlnspolllGCellsbut
Notthe Expresalenota Forespore Gene
Telrwestigatewhetherthebolmutationswouldrestorethe
expressionotothercotA regulon genes in spolIleacte-
Mweintroducedcew-iacZandgerE-iachusionsinte
mollIGcellsbearing bdAaerbeIBa. Figureashowsthat
mandbdsarelievedthe inhibitory eltect ctspelliGAt
cncotD-lecZandgerE—iecl expression. in addition.”
BaelevatsdcetD-andgerE-directsd p—galactesidasesyn-
theeis(inthepresenceorabeenceolthespolIIGmuts-
tion)teievelsneticeablyhigherthanthesecbservedln
wId-typecelis.
Althoughthebdmutatiensreiievedthedependenceol
cotAregulonexpresslononmdilGJhesemutatiensdid
notbypasstherequirementlorspollIG in the transcription
cttiwtoresporeexpressedgenesspQwhichisknownte
beunderttiedirectcorttrelote°(Masonetsl..1988;Sun

.9 Figurez MappingolbouandbolBMutations
A {i ,1? Thebdnxrtationewerernappedbothbyphage
it? 1‘ S PBSt-mediatedtransductionandbyDNm
.3? ,3 ‘ q‘ thmlumationexperimentsbeeExperi—
as V‘ C e‘ V5 as" 5" V‘ ‘5 mental Procedures). Linksgesareexpreseed
( 3 4’ ,3 ,9 ‘6‘ 0: 6' ¢ as 100 minuspercentcotranslormatienorco-
4 [:4 .1 . t 4 1 transduaion(0).Mutstronsinbracketswere
: 1? ET] . E 1 z E mmmrmnmmw.wem5c
! i : 4‘ n Y i ‘g E mapolthepmt—owtregionolthechromo-
: 5 : ir—fi" -f——‘;——‘: : eorne(B)GeneticmapoltheleuB-dreflre-
5 1 FE "' t f 1 s gionolthechromoeome.
-r-——§— ss‘—-§——-f L 47' 3 : s 4:
E 6" 41 t4 5 5 E-M-i
9’06 —"-—-+- es 1' .1
I r , ' I
5—00 —+—-—-1--o- ~ as —~f———-t
E Esra-i ro ——:
3 5'" +~§ :
E §——————12 —q'
' s9 —#
B .9
§ 3
Q s
\‘ c
3 vi a
K «K g
R
e“ e we i s
r iiei #8
I [I l l 11 l 1 --
i 1, : :iI : :
1 r ' t ‘5 ‘1 :
z 93 L4. ; as i: :
t r r i i l
r ’0 .é‘ =4, 62 #4 l
5: 33’ #1:; 'p—— as __...' :
i . r
L—‘0.—4—w—-" I ' ' , i-r-r:
'* rLJI so 4
I

etal.. 1989). in spoIIIG cells containing an sspB-lacZ lu-
sicn. littieornosspB-directedB-gaiactesidasesynthesis
wssdetsctsdinthepresenceorabsenceolbdmutations

(Figure 4).

WMutatienstencetheBleclragect
spelilGCeilsteStsges
Mweinvestigatedtheeilectetthebypassmutations
onthemerphcgenesisolspellIGmutantcelis.Asnetsd
above. spelllG be! double mutants produce phase-gray
presperes The electron micrograph ol Figure 5 shows
tha. whereas the sporangium ot a speIlIG mutant was
blocltad just after engulfment (stage 3). the sporanng ot
a spolIlG balsa double mutant had a well-defined coat
andacortsx.leaturesdiagnosticelstage5Asalurther
demonstrationeladvancedmerphogenesis.incubationol
thespollleofaamutantsperangialedtothereleaseet
immature (phase-gray) spores. which were purified by
ditlerential centrifugation. Examination oi the protein
compositienoithesperesreveaiedaluilsetolcoatpely-
peptides(datanotshown).
Finaliy.wesxsminedtheetiectolbol58alene(thatis.
inepolllG‘ceiis)onapcruIation.ba!BB-bearingceiispro-

£2

 

120L

80-

40-

140 i-

200

(50

80 - 100

fl-Goloctosidcse octivrty (Miller units)

40 - 50

 

 

 

 

l
2468101246810

Time (hours after resuspensien)

Figures. Eiteaetbol'uandbelaaonExpreesionolcotD-isczand
aflHu:

Warp-WW wasmee-
siled‘dteindicdsdtimesatterresuspensioninSMmediuthe
“reunitedwereSPazzcotD-iadlysogensuandmor
St’azyerE-lacZiysogensmandojolthelollowingstralnszscm
(mo‘;ctoeedcirctes).SCil0(spellIGM;opencircles).SCTn (bow
molllGM;epentrtsngles).SC770(bdAtepensquares).SCTn
M0 spoillOAt; closed ulangtes). and 80770 (was: closed
amtarea).For(A)and(B)thedataobtainedlorcoO-directedp-ga-
lacteeidaaesyntheslslnspo‘celiswerecollectedlnperaleiwldtboth
mmwmwmmmmmmu
coD-bclupreesionlnmo’cslsaredtowninbothpaneis

ducedspores(albeitwithrnoderateiyimpairedetticiency)
thatwerephasebrightand hedreeistantflbble t). The
mutarrtsporeswerehmnottceablydetectlveinger-
mtnation(‘lhblet).

botttutstionsbypassoependenceon Other
Stageaend seenee

Expreuienoi cotA regulon genesisdependenton sew
erdstage3and4genesinadditlontespellle.lncluding
spoiIlA. spoIIIC, spoIIID. spoIIlE. spoIVB. spoIVCB. and
spoIVF (Cutting et al.. 1989; Sandman at al.. 1988; Zheng
andLosick. t990).‘lblrrvestigetswhetherbolmutations
weuldrellevethedependenceotcotA—laclexpressienon
anyotthese genes. we introduced boots and bofaalnte
anlsegenicsetotstageaandtmutantsWethenmonl-
bredcotAexpressieninthebel—centainingmutsntstralns
bytheappearanceotbmnpigmenudiagncstlcolCotA
synthesis) in colonies produced on solid 08 medium. by
thehydrolyslsotX-gallncelcniesetcotA—isclcontsining
cellsgrowneneelidDSmedium.andbymeasursmentot

140

 

800
600 '-
400L

200 r-

,6- Golcctosidose activity (Miller units)

 

 

2 4 6 8
Time (hours after resuspension)

Figures. EitectetbdA‘iandbethontheExpreesioneltheFore-
sporeSpecilicGenesspB
ems-directedpgaiactesldasesyntheslsw-meastxedinw-
containingderivstivesetuwthetolowlngsuainsattsrresuspsnsion
inSMmedium:PY79(me’;ciosedcirctesandcleeedequares).
smooupolliGAhepensquares). SC719(epoIIIGAt m; opentri-
anues).andSC'Iz2(moliK3a1 mazclosedtrlsnues). Theassays
werecarriedoutbyrendenngthecelisperrnesbleteONPGbytred-
rnentwlthtoluene(cleeedcircles; Miller. 1972). Because toluenetred-
mmwmdmwwhmm
Wthtdtypecstlflspellleutardcellsaredetediveh

sccsesibletoONPG.sspB-directedenayme
eyrettesishtheWN(me‘)bacterlswssaleodetermlnedbyUed-
maxetdreoelswithlysozyme(cloeedequeres;2m;taesonet
al.,“).whididsruptsbothmeeporsngialcslwalandthetore-
spore.

cotA-iecZ-dlrectsdngaiactesidase incettssus-
pendedinSMsperulationmedlum.iheSMmediumex-
perimentotFrgureeshowsthatbothbolmutationsper-
tiallyrestoredcotA-directed B-galactesldase synthesisin
ttiespelllAandspoIVBmutantsbutnotintheethermu-
tents Experiments to monitor cotA expression on solid
mediumalsoshewedthatbemaandbdaaresteredcotk
directed B-galactosidase synthesis in the spoIIlA (Figure
7) and spoIVB(datsnot shown) mutants. but. as judged
bybrowncolenycoiorandX-galhydrolysis.bethbefnxrta-
tions allowed substantial cotA expression in the acoIIIE
mutant(Figure 7). This discrepancyisduetetheditterent
mediausedinthetwoexperiments.becausebolmuta—
tions do restore com-directed B—galactesidase synthesis
inspelIIEcellsinliquld culturswhenDS medium isused
(data not shown). Thus. 00M and bofB mutations over-
come the dependence oi cotA expression on menu.
apolIlG.andepolVBandonepolllehenDSmedlumis
used.
Littleisknownabetrturetunctionetspelvabutspoilu
andspoIIlEareOlirsspollIG)lnterredbplayaroleintore-
sporegeneexpreuionfirrtngtenandMandelstam. 1900;

Q‘Seresporeatectoointinesubtit‘rs

 

Feuiger and Errington. 1989; Karmazyn-Campelli et al..
1989; Mason et al..1988). On the other hand. all at the
genes (eg spoIIIC, spoIIID, spoIVCB. and spoIVF) whose

1 'qu-rvl‘

 

Tabte1.EtleaotboIBesndspeIl/C6419m Spore Formation.
Heat Resistance.and0ermination

 

Genotype‘ SporsFormstion‘ l-lealResistsnce‘ Glenninatien‘I

 

epo‘ 96 as normal
(>0le 7 84 detective
spoNCBA 19 8 80 detective

 

'Thestrsinsweret’YTIhao‘). 50mm. andVOtsape-
9).

11...”: , "‘

tngle'ClortOrnin. Vduasareexprs'eesdssthspercentageot

1. x...

- r. ‘ ' rsesjmr

mtmmwumumummwmn

utdarsttteaverageelthreeemerlmsnts.
; r” - '

ageetmosxperiments.
"Raw—«E . ' .

mam
etMio-tymgumlnatingmores.whereeslttiecctorchutgebseen

'- J...

activatedmoresatler inllstinggerminstionwithtOmML-elsrvne
(.iurtasandedelstam.1995)Germination—detecdvesporeshave

 

141

Figures. EisarchicrographolamolllGand

aspelliGbotBGMutantSpor-ngiun

Asperangiurnote a1 m(m

mammrnjmmaorsmomou
dew.

.xu l ... A): .

the mother cell. but not in the iorespore. Moreover. since
spoIIIC and spoIVCB are the coding elements tor a". the
bofmutations do not circumvent the need tor e" in mother
cell gene expression.

be! Mutations Restore Processing 01 Proo" in
spoIIIG Mutant Cells

The structural gene ter a“. sigK. is known to be regulated
by a chromosomal rearrangement (Kunkel et al.. 1990;
Sate et al.. 1990; Stragier et al.. 1989). by transcription
(Kunkel et al.. 1988. 1989). and by proteolytic processing
ottheprimarypreductolthesigngne. pro-e"(Krooeet
al.. 1989: S. Lu. R. Halberg. and L. Kroos. unpublished
data). Neither the rearrangement nor transcription is the
basis tor the dependence on spoIIIG cl eK-direcled ex-
pression of the cou regulon. because the joining ct
spoIVCB to spoIIIC and the salvation ol the sigK (spe-
MJB) promoter owur in spoIIIG (as well as in spoIIIA.
spot/IE and spa/VB) cells (Kunkel et al..1988. 1990; Stra-
gieretal. 1999). Ontheotherhand. theconversionetpro-
o"toitsmaturetermlspreventedlnspomeecteria(s
Lu. R Halberg. andL Kroos. unpublisheddata). 'ibinves-
tigate the possibility that the dependence at e'fidireaed

o“ precassing. we examined the alter: ct be! mutations
on the appearance ct mature a" by irnmuncblet analysis
using antibodies to ‘pro-e" (Figure 8). Lane 2 shows that

...... .,,...
sporulating cells. in contrast. pro-o“. butm little or no ma-
ture oK . "
lanes 6—9 show. however. that mature e" was readily de-

 

£8

 

N
O
YYIVYVI

rrvrvrry

1

  
  
    

40
30
20
t0

V'IYI

4 'Tj—ffl'rl

A'fv

L60
Lao
~20

 

 

 

fi-Golactcsidose activity (Miller units)

 

so 0 it
so
20
tO

2468 2468

Time
(hours otter resuspension)

Flgued EtteaotbolAfisnddedcncotA-Directedp-Galactosidsse
SynthesisinStageaandtMutantCelisSuspendedlnSMMedium
ThebdA10rbd88aueiesweretnrtstenedireeacoiiecticnolwsge
3N4 sporulation mutants. which were lysogenized with Sszzcat-
A—chasdescribedinExperimentalPrecedureaThepatternolcotA-
directedp-gaiactosidsaesyrxhesisineachetthelysogenswssdeter-
minedatterresuspensien'mSMmedium.Eachpanelshowsthe
Moth-galactosidasehstageSandsmutantscentainingboIA‘i
(opentriangles)erbol88(closedtrlangtes).AisoshownlscotA-racz
weesioninmo’cels(doeedcircles)andinceliscontsiningthe
“Westone(epencircles;la.wlthoutbomerbolaa;eeeEx-
perlrnentai Procedures). ThemutstienswerespelIIASMA). sperm
(3). spoIIIC94 (C). spollloda (D). spelllfao (E). ape/val” (F). epo-
NCB23(G).andspolVF752(l-l). NotsthatbecausebolBisatthe
Whamabofedmelvnszdoubiemutarxcoudnotbecen-
nucledsndhencewaanetusedhtheexpenmerxoul-iilnhvocases.
thoesel(B)and(E)andoi(D)snd(G).thedstaebtainedtertusion-
drectedB-galsctosldasesynthesisinthespo‘cellswerecclectsdin
paralelwtthandusedasacontrollcrtsodltterentmenwtantsln
theeecaeesthesarnsdststorcotA-bclexpressionintheepo‘ceiis
werereptottedinbothgrspha

tsctsdindoublemutantsharboringthespellleutation
asenlasbdAabafBadeaordearespectlvely. Fi-
nally. ianes3and5shewthatbotAtresteredprocessing
dpro-e‘teepeIIlAceils.

DeledonetDNAEncodingdredPro-AminoAcid
SequenceRestorescetA—tecZExpressionln
spoillG and spoIVF Mutant Cells
Asadlrecttestelthehypothesisthatthedependenceot
cotA-IecZomressiononmoIltGismediatedattheievel

142

otpro-e‘processing.weconstnrctedamutantetthe
spoIVCB gene (encoding the MHz-terminal portion oi
e“) in which cedons 2 through 20 (encoding the pro-
amino acid sequence) were deleted by oligonucleotide
site-directed mutagenesis (spoIVCBAlQ). We introduced
the in vitre constructed. deletion-mutated gene into spo-
IIIG cells and identified strains in which plasmid integra-
tionrenderedeitherthetruncatedspoIVCBgeneorthe
wild-typespelVCBgenecapabieotgeneratingsngbythe
chromosomal rearrangement that normally occurs during
sperulation.When(andcnlywhen)sngwasgenerued
trom the truncated spoIVCB gene (bearing the spoIVCB-
A19 mutation). expression at will was restored in speIlIG
mutantceils.asjudgedbybrowncoionyceior(Pig*)and
blue colony color (Last in cells with cotA—lacZ) on solid
sporulation medium (data not shown) and by quantitative
measurements at cool-directed p-galactosidase synthesis
in cells suspended in SM sporulation medium (Figure 9A).
interestingly. the time at induction ot cotA-iacZexpression
in the presence at the truncated spelVCBgene was about
1 hr earlier than normal.

BecausespolVFisthesiteotmutations(boIB)thatre-
storedpro-errocessingtespeIIIGcellawemndered
whemer the spoIVCBAiQ deletion mutation would also re-
lieve the requirement tor the spoIVF gene preduct(s) in
cotA regulon gene expression. To investigate this possibil-
ity. we examined the ettect on cetA-lacz expression at in-
troducing the spell/CBA 19 mutation into cells of a spoIVF
mutant. Figure 9B showsthatthetruncatedspolvcagene
(present in a configuration in which it could generate sigK)
substantially relieved the requirement tor the spoIVF gene
preduct(s) in com-directed B-gaiactosidase synthesis. al-
though. once again. the time ol cetA-iacZ induction was
advanced by about 1 hr.

Finally.teexaminethephenotypicettectso(spoIVCB-
Alliaiene.we intreducedthetruncatedepoliCBgene into
spot bacteria. spoIVCBAlO caused a moderate impair-
ment in sporulation (Table 1). The resulting spores were
phase-brightandheatresistant. but. likethcseproduced
bybofBO-containing bacteria (above). speIiCBA 19 spores
were noticeably detective in germination (Table 1). Also.
Flgure9BshewsthatthepresenceotspoliCBA19inthe
otherwise wild-type bacteria caused premature induction
oi cotA-iacZ induction.

Discussion

Garemeesiensubeequerxblheeepwcnstsgectsper-
ulatienisregulatedspatiaily:certaingenesareswitched
cninthetoresporechamberotthesporangium.whereas
ottrergenesarewreuedinflmothercellfierespere
geneexpressienandmothercetlgeneexpressionarenet.
however. independent at each other: oKdirected gene
expressiondependsnotonlyontheproductsetknown
mother cell regulatory genes (spoIIIC. spoIIID. spoIVCA.
andspeliCB)butalsoontheproductsoigenes(spelllA.
spoIIIE. and spellIG) required tortorespore gene entree-
sion(Cuttingetai..1909;Sandman etal..1908;Zheng
andLoeick.1990). ‘
Asevidencetortheexiuenceotacontrolrnechanlsm

ggoreqroreChecttpolntinBJrMilis

apo’

XIII
XIII

2110

IIID

 

that links o'Ldirected gene expression to the action at

leiic to the sporulatioh operon spoIVFfbelA and bofB mu-

123456789

pro-ux

—.=‘——‘

‘Ii’
1
I

Figured. mmmiyelsolPro-e'utde‘inbduutants

 

 

d
IhlwhllfliLu. R. HlloqylndL.KAI-.u1NUhhlddlfl. LII

celsengineeredteswressmfiu. RMNLMW
, acm
rmmlmmmarmnzmam
wrearnuan;ms.sc1nwnoarm.mm
- ' "- can-norm

tr l- -

 

 

 

maths- ‘ ’
daplasmidlnlegretlonvederlnthevictnityolthespodlgana

 

143

boll Fhml7 Eflufltlbnulamibdfllanfifir

“um
wihednhthnnhnoiSfloeSand

(bemewpeeranceotblueoetorryceloron
mph-MWEMMIM
cotAgeneeeamonbred

coloniesintheuppermmcornersotw
and(B)isspo‘botBa.

tents still require a“ tor mother cell gene expression.

 

lants (l.e.. spelllc or spoIVCB mutants). Thus. the bofmu-
tations do not appear to create an alternative mechanism

 

sis at a substitute sigma (actor). Nor do the bot mutations
remereterespore gene expression. instead. the botmuta-
tions uncouple o"-directed gene expression lrom the ac-
tion at iorespore regulatory proteins The wild-type prod-

IMMM‘ ‘ r

pression. r '
Ourevidence and thatot 8. Lu. R. Halberg. and L. Kroos

(unpublished data) show that the dependence ct ck

 

ismsdiatedattheiovelolthecormnionolpro—o‘bils
mature term. First. pro-e“ processing (S Lu. R. Halberg.
and L Kroos. unpublished data) is prevented in spot/IA.
spoIIIE. and spoil/G mutants. Second. as shown here.

 

ing or pro-o“ in spoIIIA and spoIIIG mutant cells. Third.
the dependence or alt-directed gene expression on the

ing sequence lcr Sim. atruncatitdgenelackingthe
pro-amino acid coding sequence.

99110990068. Labeilm et- al (1987) (live shown that the pri-

MHz-tanninalextensienol29emino ”simm—
sicnclpre-o‘tetheaalveslgmais governedbythe
productolsporulationgenespoIIGA. whichprobabiyen-
codesthepre-o‘processingenzymeotenneyanndr
an.1987:Stragieretai..1998).Since mutationsinseveral
genesflnadditicntespollGA)whceeproduasarere-

 

oEprooessing. Stragieret'ai. 11mm label'etal new)
proposedthatthecenversloncl pre-tematuresigmais
acontrolpointtorcoupllngo‘eontroiiedgenemee

 

at
O

.
O

 

N
O

as
0

6°60th octiwiy' (Millsr' must
0‘
O

 

 

 

 

2468

2 4 6 8
Tuneihousoltarrcaspensionl

Figures. EltsctolaDslstionolthsPro-ArnlnoAcldCodlngSsqusncs
ddeWWhmamm
hecti-

eetA-dlrsctsdp-gslaaosldos wasmusursdatthslnd-
mmmmmsum.mmmwm
Wtysogsnsotmupo‘; closed circles). V024 (Ware
W1;opsndlamonds).and\i028(apoiilGAt;opsnciclss).suain
memmnamdm (sssEmsrimsntalPrecs-
mmmschromosomssoastogsnsrstsahill-isngthcopyoi
Whammawdsistionmtationandaninoompiatsoopy
olthsgsnszvoallisthsrssultoiawm intsgrationsvsntthatgensr-
IsdaM-lsrrgthcopyotwlid4ypeapolWBandanirroornpistscopy
olessMgttrsAthslstionnuflatlonThestrainshMm
corA-hcztysogsnsotPWNmo’wlossdclrMMWAfi:
dosed diamonds). V051 Wars W52: opsn W).
mmwwopsncirciss).

siontosporuiationssptumlonnation.lnanalogywith
thsssidsae.pro-o"processlngcouldbeacontrolpoint
iorcouplingiatemotl'ierceilgenesxprsssiontolorsspore
development.
Whatistl'iebasisiorthersquirementiortorssporersg-
Moenepr'oteinsinthsprocessingotpre-oWspofllE
isavegetativsly eupreseed gene (Fouiger and Erringbn.
1989).andatieastsomsspomA expression occurs inthe
motherceil(N. iiiigandJ. Errington.pereonai communi-
cation). but spoIllG is principally. it not occlusivsly. ax-
prssssd in the iorespore (Karmazyn-Campelii et al.. 1909:
RSetlow.personalcommunication).ltso.thentheds-
psndsnceotokdirectedgenesxpressiononthespollle
product must be an indirect effect. reflecting interaction
(communication)betwsentheloresporeandmothercsll
charnbsrsoitheaporangiumJtcannotbssmludsdmow
ammuasrnailamountotoGisproducsdinthsmothsr
oslwhersitsomeimcontmistheprecsssingotpro-o".
Wsiavorthsviewthatthsprocsssingolpro-oflnths
mothsrcsliisaometmcontmilsdbficoupiedtonvsnts
occurring in the iorespore. Ws suppose that a signal
srnsndlrtglremwithinthsiorssporsstimuiatssthsactiv.
hyotdnpro-o‘pmcssshtgsrtzynnltthspmcsssingsn-

144

zymeoraprotslnthatcontreisitsactivltyisiocatedinthe
ertguilrnsntmsrnbranethatsncassstheiorssporspro-
WMWMMNWW
directlymoduiatsthsactlvityolthsprocessingsnzyme
(Figure 10).

A candidate lor the pro-o“ procsasing enzyme or a
rsguiabroithesynthssisoractiviyotthsprocsssingsn-
zyrnsistheproducls)olthespoIVFoperon.First.the
preduct(s)olspoNFisrequired(as)udgedbytheussol
anulirnuhnMorcotAregulongeneexpressioMCutting
et al.. 1909; Sandman st al..1988;2hsng and Losick.
Mandiortheprocessingotpro-ofls. Lu. Rital-
berg. and L Kroos. unpublished data). Second. the re-
quirernentiortheapolVFgeneprodudanoKdirsctsd
gsnssxpressionisreiievedbythepresencsotatruncatsd
c"gene lacking the coding sequence lorthepro-amino
acidsequence (Figure 98).Thus.thespoM-'geneprod-
uct(a) has no function in oKdirected gene expression
othsrthanintheconversionoipro-o‘toitsmatureionn.
Third.therequirementlorthespoIVF gene product(s)in
NWgeneupmssbnbndmiiwedbthm
once at a MA mutation (Figure 6H). This finding suggests
thatthespoIVFgeneproduwsHsmoreimmediatslyin-
volvedinpro-o"pmcsuingthanaretheproductsoi
other spa genes (spoIIlA. spomE. spoIIIG. and spoNB)
thatarebypassedbybolA.Finaliy.spolVFisitseltthssits
olthssecondciassotmutations(bof8)thatbypassthsre-
quirement tor the spatial. spoIIIE. spomG. and apolVB
productsln undirected gene expression.Welniertrom
thisrssultancombinationwiththsresuitthataspoIVFnuii
mutation blocks the conversion oi the pro-protein to ma-
ture o") that the spoIVF gene preduct(s) is intimately
irwoivedinttteprocessingoipro-oKandthatbomeuo
tatlons are changed-lunction mutations that alter the
spoNFgeneproducqunsuchawayastorelieveltsde-
pendsnce on the products at spomA. spoIIIE. spolllG. and
spoil/a

 

 

 

 

#

Figureto. AModsllorIrchwllngotMothsrCsltoForssporsGsns
Expression

'nmmmummmwm

W“-
claiyasdhyaprotsasaElhsrthsprotsssslsslloraregUatorotIts
protssssrssidsshdtsmsmbranslaysrsoflhssngdisdlorsoorsfl
memmammmm
muamumeammum

agorsspors Gtscttpornt in 8. mm

thisd'ienatureoltheloresporesignalthatgovems
meadivltyotthsproosssingenzymeflnadditiontoby-
passingthsdependencsoio'fidirectedgeneemrsesion
onttreprodrrctsdtheiorupomreguistorygenesspollfl.
moms. andspomG. bofmutations alsooveroome thsde-
pendenceolcotAregulonexpressionontheproductol
thestagesgenespoIVB.Sinceotherwork(VanHoyand
Hoch. 1990; S. Cutting. unpublished data) shows that
moIVBenmrsssiondependsonspomA. spoIIlE. andspo-
Mprotelnsthetunctionolthetoresporereguiatorypro-
teinsinpro-e"processingmaybetoswitchontheea-
pression oi spoIVB. whose product. in turn. stimulates
pro-o‘processing.Asimpie possibilitylorhowthlsstim-
daionoccursisthattheapoIVBgeneproductislocatsd
inthsloresporeprotopiastmembranewhereittouches
(andtherebyactivates)thespoIVF gene preduct(s). which
weapeculats islocated intheenguliment membrane. (In
proposingthatthespolVBgeneproductstimulatestheac-
tlvityolthespoIVFgeneproduct(s)weemiudethepossi-
bilitytttatitdoessoattheieveiotspoIl/Ftranscription.»
caussotherworkls Cuttingandfl. losick. unpublished
dataldemonstratesthatapoIVf-‘expreesionisnotbioclrsd
in spolIlA. spoIIIE. spolIlG. and apolVB mutants.)

Mistismepurposeolthecoupiingotmothercelito
ioresporegene expression? A possible clue isprovided
bythsobservationthatcoM-iaclexpressionisinduced
Mthreariierthannormalincellsbearingadeletlon
mutationthatremovestheo" pro-amino acid codingse-
quence. Thus. the iorespore-dependent conversion oi
pro-e“toactiveo‘meybeadevelopmentslclockthatde—
taysthetimingotcoatgeneenrpression.Correcttimingot
ooatgsneeupressioninthemothercellrelativetodevel-
opmentintheioresporecouldbeimportanttorsporuia-
tion; cells bearing the o" pro-amino acid deletion muta-
tion sporulate with somewhat impaired efficiency and
producesberrantsporesthataredeisctlvsingennination.
Thus. the control mechanism that couples mother cell
gsneeurprsmnloresporedevelopmentcanbethought
oiasachecitpointthatdetennineswhen the appropriate
cortdltions(deveioprnentoitheiorespore)havebeenprop-
srlysatisfledtoallowthesyntheaisotthecosttoprocsed.

Hartwell and Weinert (1989) have previously employed
thetenn'checkpoint'toretertocontroi mechanisms that
sniorcethsdependenceotcertaineventslatsinthecsli
cydaolsuluryoticcellsoneanycsilqcieevenuForex-
arnple.mitosisinseveralkindsotcelisisdependenton
thecompietionotaroundotchromosome replication.as
demonstratedbytheobservatlon that under conditionsin
whichDNAsynthesisisarrestedmitosisisprevented.The
dspendsncsolmitosisonDNAreplicatloncanmowsr.
berelievedbymutationsintheredageneincslisotSsc-
charomycss cerevisiae; thus when DNA synthesis is ar-
rssbd.ceilshavingsrsdligenedelectproceedpastmito-
sisandenterthensxtcellcyclaAusehiianalogycanbs
drawnbstweenthecsilcyclecheckpointolfiosrevisias
andtheloresporecheckpointotasubtllisinbotheys-
tsmsthecheckpointcoupiestwootherwlseindependsnt
developmentalprocesses(mitosissndchromosomerepli-
oationinS.osrevisiae;mothsroeiiandioresporedevelop-
mentinasubtills).Moreover.inbothsystsmstheslimina-

145

tionolthecheclrpointdoesnotpreventmorphologicai
developmentbutinstsadcausessubtledeleteriousel-
lects.‘l'hus.rad9mutantsotyeastareviabie and proceed
through the cell cycle relatively normally. but exhibit a high
ratsolchromosomsiossanddiemorerapidlythando
wild-type cells under conditions in which DNA synthesis
is temporarily arrested; similarly. bot mutants at B. subtilis
procsedthroughthetenninal stagesotsporulation(albeit
withimpairedetticienq).butthesporestheyproduceare
detective in germination.

WW

weir-iris

‘l'hsspomistion nmrssussdinthissaadywsrsisogenlcwhhtha
8po°wainPYNMtglnsnstai..tee4).Strains30620(spolllA59).
BK410 (mum. 60095 (winds). $0622 (sodium. BK556 (mo-
AOB23).andK$1N(spoNF:m Hummtaeenrsportedpre-
viously(0uttingetal.. tOOO;Kmioistai.. 1988. 1989;8andmanstal..
M. (The spoIVFfll'ntith‘t Hum mutation oi strain K3179 was origi-
nflyatoughttodslinsanswiocuscsilsdspoi/HSandmanstal..tee7|
bruisnowknowntobsatspoIVF:S.Ctntingands.Rosls.unpubiishsd
data.) Strains $0615 (spoiliAszi). scsoo (spolIlGAl). and 8033‘
Misawsrsconstmasdinthisstudybymeansolthscongres-
slonprocsdureotSandmanetal.(1tiee)uslngPYn.adn'osrtvatlve
«menu(apaveres)mmwoyam.mm
mmmmmmmmwum
mammmmmmawdim.

Osnsrelflsthods
Cornpstsrlcsilswsprsparsdandtranstormdbythsmsthodoi
MtauandOavidoti-AbsisonnOfi).PhagsP3819snsralissdtrarts-

tivssolphagsSPpwersasdsscribsdpreviouslybySandmanstal.
(1m).StrainscoraainingSszzcotA4achct-rsdoltherssidsra
prophagsbygrowingceiisovernightatsa'Conpiatssoontainingno
mmmmmmommmm

“mumm‘ooloniesmisoiatedandchschsdlorreais-
tltosbchbramphenicdmmfiortosrythromycinandiinoomycin
MMtMLS'aMCm‘arsconismdbytheSPp phage).

SeleaionlorCm'wasmadsonagarptatssoontairwtgsttgtnl
ctlorsmphenicoi;ssisctionbrMLs“wasonpiatsscontalningsryth-
WOWWWMuM-

SpondationwasinducsdonsolidmediumuaingDSag-andhlq-
uidbyrssuspsnsionolgrmnngcshsinsumsdiunbylhsmsthodd
mammogram.

fliespecihcactivlyolpgalactosidasswasdetsrminsdasdsscrbsd
byMIsrnMwlththssubstratsO “ r‘ , ::
sldstONPG).

OertstmcttonetsPnncetA-led

ger—thorcotO—lsclgsnehaslonucmgstat. Mlltsngand
M1990). SPp::cotA-thoontainsda425prcoilragrnaracar-
mmwwszmotmmemwma
UtahclgensolEschsrichia coll.

bolatbnetprssaqutlens

‘lbisoistsbypassmtnationaanssponsnualygrowhgmeotwah
sceooupolllcanwestreatsdiereominwithN-mathyi-N-nim-
Wrosoguanidins (~1oo ugh'nl). washed. and than “sued wu'i
mucoM-thJntsctsdcsllswsrepistsdormOSagupldssosn-
UnlngchioramphsnicolbsslsaiorlysogsnsThschromogsnlcstb-
mummhmum.mmwmu
msdiumtoidsntllycslsthataynthsslssdp-gaiscnsidassmh
Lac'). mmmumtmwmmmm
mmwammm: :cotA-thprophagsay
hsatindttction). oniytoubscamsuc‘Msatrutsthdremalnsd
Lac'mostiilusiyoontainsdamutationinthslstulscryptichc

mmmmmfibshowtluthsooM-Isdgsnshi-
mmmm:wmmmmmm
cslsotdiscuredtac‘strainsandoonflrrnedthatcousxpression
waersuoredaav).‘bdstenninsthsPigohsnotyps.nwtamwere
irtctbatsdlor3-4dayson05aw.Atterthispsriodooioriiesolcsls
ayrdhesizmgCotAsrspigrnuitsdbrmn(Pig’).Tocordirmthatihsss
nanniestiicoraakieddnuigirialapolIIGAtallsuweusedchro-
mosorndDNApreparediromeachnnrtanttotranslormstrainPYn
werithseieaionlorGin‘andoonhrmsdthatineachcaea.
manewmmmmyw.
“BALUslngaprocedureanalogoustothsonsabmonsbypaae
mastsoiatsdthatrsstoredeupressionotcoutocslsoiths
molVBmutanthlNKStaisacomplsxstrainwhichwasorio'nslybs-
ilevedtobsaapolllAinsertiondmutantlSandmanetai..t9fl|.but
hnowknowntocorrtairrnurhipisTnOflirrsertioruhcludingonsthd
hprobabiyhspolVBlRStr-agisrmnpublishedddal).

To purity these mutations. we transisrrsd thsrn into an isogenic
denvative(sceea)otstrainPYNcorIainingSPB:zcotA—Isc2andms
urinationsmstBSapoIilGAtbyDNMnediatedtranstonnationandss-
lsctlonlorMet’prototrophallansiormsntsthatwereuc’Pig‘Mst‘
wereidentilisdloreechmutsnt.Thsssstrains(eachlyeogsnicior
SPBxcotA—Iscl) are csied scorn (bow spoIIIGAT). scmroaw
mar). $0720 (bolas spoIIlGM). 50721 was apolilGAt). and
scmrboreupomoar).

‘bgsnsratsasstotieogsnicmutantsoontainingonlythsbd
rriutation. we cured the above strains oi SsztcotA—iacz and then
transiormedthemwithDNApreparsdtromstrsinMOdTSfiStregisr.
unpublishsddsts)witnsslsctioniorCm“.MOWScontainsaphsno-
typicalyslientcstirnsrtionfipo‘)vsryciosstospollle(apprud-
matslyeoee-eoeecotransiormation).lnsschoross.teokindsoi0m"
transtorrnantcouldbsgsneratsdtadoubiemutantcontainingbdw
molllGMandonecontainingthsbolmtnationalonsduetocorrsction
olmoIIIGAt.0nsmutantotsachclaaswasidentiliedbyitsphsnotyps
(sssResuhs)andbyvsritying(byDNA-rnsdiatedtranslormation)ths
pressncsorabssnceotapoilflAtJhsssCm‘UtrainswsreSOM
masons (botAlspoliIGM).SC710(bolA3).SC77i (humano-
MGM). 80772 (M85). 86773 (bolas spoIiIGAI). $0774 (odes).
SW75 (odes spoiliGAr). 80776 (bored). and $0777 (bolas mo-
monAparaiieicrosswasmadsusingscsooupolnGADasrecipi-
erabgsnsratsthsCm'stralnsm(Spo’)andSC7Be(spolllGAl).

Thessstrsinswsrsussdtcmsssurssithercoth cow-.orger-
directsdpgalsciosidassaaivhybyflecthgosflswithsitherPflxcot-
A—lscz. SP8: :.cotD-isc2 orSPp: :.gsr£-hcz

Gsrtsticlhpung
‘bmapthebdmutstionawsinitiallyussdPBSHnsdiUsdgsnsraiissd
“reductiontodstermlnelnlragsoldisbdnwtstionsbatnwophlc
gsnsticmadrsrsTodothisweussdssatoininsfldt’Msachcon-
hirirgonsormorsmutationsinanatnotrophicgsnsmedondsretd..
m.mmscszoapczeuerspnur.mmmm
MtzcdmomMOMKarmazynCunpeilietat. MandSPflxoa-
A—hclintothsss strains P881 transducing lysates were prepared
hornstrainscornsiningbodithsbdnarflionmdmolllamforsach
cross. Aux' aansductantswsre seisasdandthsn scrssrisd iorce-
eansdualon oi the dot phenotype (Lac‘ Pig'). Having established
MboflnnrtationswersootransduosdwlthprMsndquJndde
muutiortswllilsuearidphan.weussdsoomblnstlonottwo-iacnr
wrddrreHsctortranstorrndlonandtransductioncrosssstomapths
bdalsisaWsalsoussd‘lhOflinaertionsthdwersiocatsdlnthsss
chromosornalregions(sssFigure2). lnthiscasswsmadsstransduc-
hglysatsorchromosomsl DNA preparationoiths Thsficontaining
mandmsdittoimroducsMLS'ireorecipismcslscomalningths
bdmutationandmolmmwts‘lsoontsnedbythssrmgsnsln
TM!7).Atisrsslsction.rsoornbinantswerstsstsdloriinkageby
screeninglorcolonypigmenuiononOSagarpinaCorreaioaotths
MmtonMreurtthaepolln'phsnotypssothsreeon-binac
tionlreousncyooudbsdstsrminsdbyoountingltsmanbsrolfig‘l
Pig‘coionisa

mm
Oslshanefidatmzohrdterstmsnsioninsumonruion
msrlunwemiisedwthandosrmumbythsmsthodot

146

flossnbiuhetal.(tset).wlththssacsptionsduslwashssweredons
whhwnflphoaphatsbdlsrwesnndthsosmiunwasbuttsrsd
wlhmucaccdyiate(pflu).mrflntion.thscsllsmsuspsndsd
hagsracoordingtohlenbsrgsretai.(1972).dehydretedmm
wwwmmm.mnu¢mmwmem
tinitsonaFleichertUitractnEmicrotornaStainingwasccrisdoutas
dssabsdinFrancssconistai. (1988).Elsctronrnicrosoopywascc-
risdouonaPhlIiipsEm INN.

mamssuurumowmm

‘b iraroduoe the be! mutations into other sperm nartarrts. we
ussdthehimiiniugeotbouandboratothesiiemWWinssrtions.
ohrtfl'nsiml-itltw and chanOWDHUtu (see Figure 2). A P881
transducinglyeatewasmadelrornastrainmsnooruiningm
spoIIIGAlandchnanOimHUteesndusedtotransducseadtmom
tarttwithselectioniorMLs“.AstheTn917insertionwasmm
cotransducsdwithbdA‘l.ordyslswaansductantswsreputhsdand
discltsdbdstsnninewhsthsrtheynowcontainsdthsmdelsmy
baclrcroesing into a spoIIIGM strain by Duhrnsdlatsd translorrna-
tion).Simitarly.aPBStiysatsolatrainsce$6bolBespolmudrzh-
mmHmuwasusedtotranslsrdeeintothsmomuslng
oolinlragswitthmNe/Oses cotransduced). SPltzzcotA—bczwasiraro-
ducsdinhthssestrainsbyspecialissdharmion.andp~gdao-
hritsdiatoontainsdthesileraTnOWinssNionbuthadnotrecelvsdlis
bdmutation were used as isogenic control strains

ConsuuctlonotaOelstlon-Mutatsd spolvcacsns
LectdngthsPro-AmlnoAcIdCodingSsquencsoto"
APstl—SacttragmentolmbpcontainimtheS'sndoltheW
gsnswasclonedinphageutampte. Todsistecodorlzmfl
oihreopenmadinghamsinfie-strandstNAlromlhshybridphqs
wesannsalsdwlththsiollowingsynthaticoligerardsotids:

stratoonoarommargWW-m

Thisoiigonucisotidsernsndsd lObaessupstreamolaislastbaas
(afgdnisspolvcairiitiationcodonand tsbasesdownstreamotths
MMQAC)O€M21“W.UMMWGW
otidedirectedinvhrommagenesissystemwsionadhsoiigomdso-
tldswasextendedtogensrstsadoublsdrandsdcirciesubatttuting
dCTP-oSiorchintheONApolymeraseresction.Thspsrentd
strendwasthsndsstroysdbynickingitwithlicittolowsdbydigsaion
withsrronucisaseiii. Folowingreeynthssisolihsparerltdmnd.“
dslstrorimtatsdDNAswsreussdtotransbrmE. coli. Hybridphags
piaqhornussresutdnghornthstranslsctionweresrbisctsdtonudso-
sdsssousncsanalysistooontirmthspressncsolminmwsdon
oioodonsz-ZO.Wecalthsdsistionnnnationmolvcaats.ONAbsw-
ingthsdsistionmutationwasreieassdlrornonssuchhybridphags
bycutungrepiicativelormDNAatEcoBIandHindtiidtesinpoiyiimer
mmkmgrmwvcemn.umgorwnm.mscom-
Hindlllhagmentwasdonsdknothschrornosornaikaegmiondvector
pBGMU2(FortandErrington.tOBS).whichoontsinaacm“gsns.b
credsWOt.
nmmmmmawumm
cshsoisapoiIIGMmutamwsrstranstormsdwithpithlthssisction
brCnt'auubrmmWseirpsctsdthatpVOteoUdirasgrlsm
tlnclvonrosornsbysirrgleredprocaltCarnpbsQrscornbinatlonbe-
twesnmolicassqusnossinthspiasmidandoorrsspondinghomolo-
gomssqrrsncssinthechromosomaTwociassssoitr-anstorrnaras
wsrsanticipatsddspsndlngonwhsthsrthsrecornbindionsvsrsoo-
cunedupstresmordoumstrsarnotmsdsistionfiscombinauoninsis
irasrval(230bp)updrsarnoithsshsotthssremutationwasw
bregsnsratsahiI-isnuhoopyotthszd-typsmgsnsandan
incornplstsmoltcagsnsbsanngmsdsimnnurtationfiorweresty.
recornbinationinthslrthrvsi(eebp)donmwesrnollhsdslelionwss
arpsctsdtogsnsratsalul-lsngthoopyoithsdslstionmm
NCOgsnssndanincomplsteoopyoletthoutthsMOM
tion.inagresmentwhhmssseiqisctations.somsoittntranstorm
(“ImmeneratedPig‘coionissonDSagarpiatsaThscflh
thsssooionisswerebiocbdateisahgsmchareasriuicoimom
mmmmmmmmtt

£40m Gtieoirpoint in B. subtilis

WMMWMMPUWWW

V025andVO24conllm1sdtl-tthshrll-isngthcopyolspolvcainthe
Plg‘strainwaswiidtypsandthatthshrl—lsngthoopyoimomln
InPig‘strairicorttainsdthsdeistionmutation.Trar\slsrotthespo-
noeanmmmwrrcmmmoymmumorm
mmmnarmuommmmsmm
hrOnr'conlirmdedisPig’phsnotypswaslnsspsrablslrarnths

IanalmalVqutantcslsmtanded-typscslsMJe-
osctiveiy.wlhchromasarndDNA1rornetraan024andeeisctian
tarCrn“.

W

MMWMeianeonlorinsauctionhmineectioningandPSm-
derbrvehablsarggssfiaummsmaumisworkwaswp-
wwwwammwrmentw
WULK.

Tlncoaboipubiicationolthisarticisweredsirayedlnpartbyths
peynisraoi page charges. This article mud thereiore be hereby
ntanred'adetlesnrsrrt'irtsccardaricswithteus.CSsctiont734
ealsiybindicatediisiarx

Receivsdhprla1m:reviesdttay14.tsso.
letsrencss

mamnduandsietarnnuweeimsmcieotidsesqusncsand
tlisaartscrlptionduringsporuiationotthsgsrfgeneolaecflmsub-
fie. J. Gen. Microbiol. 132. 3013-3024.
Cuttlng.S..Panzsr.s.andLasick.R.(1959).Reguiatorystudisson
titsprornasdoragsnsgcverningeynthssisandasssmblyoithsspore
caatlnBecluseubtiIis.J.Moi.Bioi.207.m-404.

Osdandsr. Fl. A. Lspesant. J. A. Lepssant-Keizisrova. J.. Biliauit. A.
WM..andKunst.F.(1071).Constmctionoiakitoireisrencs
IrainsiarrapidgeneticmapplnginascluseubflstbaApplinviron.
Microbloi.33.950-m

Donovan. w., Zheng. L. Sandman. K..andi.oeick. R. monomer
encodingsparecoatpoiypsptidssiromaacluaeubaliaJ.Mai.Bioi.
rear-1o

‘ Dwnau.D..andDavidofl«Abslson.R.(1M).FatsottranstormingDNA
Wuptalrebycornpeientaswm.J.Mai.aioi.5d.2m-221.
Errington.J..andMandsistam.J.(1fl5).Ussolsthhrsiontodshr-
mlristltsdspsndsncspsttsrnandthssporecampartmsntsrtpression
oldisaporuationopsronspatflinspomutantsotsacflmewtflsd
Gsn.lnicrobiai.132.2w7-2985
Enington.J..andVogt.c.H.(1990).lsolationandchsracterizstionot
Whitisgsneencadinganindigsnousp-galactosidsesinas-
mammmmmuemunses—«a
Forte.andErrington.J.(1965).Nucisotidessqusncsandcorn~
pisrnsralbnanalysisotapolycistroriiceporuiationapsronapwmh
Bea-us M. J. Gen. Microbiol. 131. 1001-1105.
ForlgsnO..andErringtan.J.(1969).Thsrolsalthsspanddiangsns
MEindisreguiationoithepreaporeepeciflcgsnssrmressianh
Bursar“. Moi. Microbioi.3. 1247-1255

Francssooni.s.c.. MscAlietsr.T.J.. Setlow.a.and5stiow.P.(1fle).
MonmicroscopiciocaiiutionotemalJcId-soiubisapore
mhmmmumwuw. 170.5083-
5057

Hartwell.LH..andWsinsrt.tA(1~).Ohsclrpointe:oararoisthat
mmsadwolcslcydsevermsasncsmw.
Hsrursr.D.J..andHoch.J.A.(1500).ThsMrserchromo-
sonnMicrobloi.Rsv.44.57-e2.
man.c«m.s.wmm.4.nesnmom
blndingnatraeoithsregdataryproteinesncaaedbymommgsrf.
hvohrsdineparuldionoiaewrseubfls.J.Gen.Microbiol. 133.
2551-2301.

147

Jarnas.W..uthandststam.J.(1905).epowc.snswepandationlocus
inaachrsswfisdtsctingsparecoatagsminlionandthsmot
W. J. Gen. Microbiol. 131. 2400-24111
mn.arid0ross.J.DL(1m).isaiatlonandgsnsticanaiyslsol
mmwaammmmw
“Natasha“. 101277-237.
Karrnuyn-Carnpsli.G.Bawny.c..8aveifl.B..andSb-aglsr.fim.
'landemgsnessnoading e-iactorsiorcansscutivslspsoldsveiop-
msrainBaclusewtflaaenssOevJJso—m.

Keasnbsrgsr. E.. Sechaud. J.. and Biondsl. a (1572). Electron necros-
oopyolONAeantslningpiaemsUitraIrud.Hss.JO.5“-wl
Kemsy.TJ..andMoran.c.P..k.(1957).OrganintlonandreguUian
olanopsmnthatencadssaspomlation-esaemiaisigmataaorhascl-
hisarrbrilis. J. Bacterial. reams-seas
KrooaL..Kunhsi.&.mdesick.H.(1959).Swla=hprotsinahsrsmsd-
lichyotRNApotymsraesoantainingaoompartmer-spsciticsimta
tactor.$cisncs243.528-521

millet. 8.. Sandman. K.. Panzer. s. Vbungrnan. P..-idlosicit. ll.
(twatThsprornoterlarasporuiationgsneinthsmolVCiacusoiBe-
mmweanditsmsinetudiesottemporalandapatialoantroiot
gsnssrrpression. J. Bacterioi. 170. 3513-5522.

Kunloi. a. Kroos. L.. Path. H.. \bungrnan. P.. and Losick. Fl. (tees).
Tsmporaiandspatiaicarnroioithemothercslmguabrygsnsmamo
otaeclussubtfls. Genes Dev. 3. 1735-1744.
m.&.tosick.fl..and8tragisr.fii1m).Ths8aclrsswflsgsns
brtlisdsveioprrientaih'anscriptiontactoro‘hgsnsrahdbyocieion
oladispensabisDNAeismentoantainingasporuationrecambinass
gene Genes Dev. 4. 525-535

L“. T. L.. Trempy. J. E.. and Haidsmreng. w.o. (1957). Spande-
WWI”.O’.UWWUWM
aprecursorprotein. P31. Prac Natl. Acad. sausner. 1154-17”.

Losick. P.. Kroos. L. Errington. J.. and \bungman. P. (1955). Patter-ye
oldsvsiopmsntaly regulatedgsns sapresslonhaadueswfls. In
GsneticsolBactsrialDiverslty.D.HopwoodandK.E.Chatsr.sda
(New M: Academic Press). pp. 221-2‘2.

MasorLJM..Hacitett.R.H..andSstlow.P.(1m.nguiatianol¢o
pressionoigsnsscadngiorsmallmcid-solubisprotsineoiaaclrs
subtifisapores:studiseusingichgsnshrsionsJ.Bacterioi. 170.
239-244.

Milsr.J.(1972).Aseaydp-gdactosldaes.hEmerhnsnteinMolscuu
Gsnetics.J.Milsr.sd.(CoidSpnngHarbor.Nsw\brk:Coid8prtng
Harbor Laborabry). pp. 552-555
Piggat.RJ..andCoats.J.G.(197e).Gsnstlcmsctsolbactsrialsndo-
spareiormation. Bacterial. Rev. roman-ass

Ftaeenbiuh.A.Bamsr.c.n.LosiclLR..andFlz-Jarnss.flc.(net).
ldsntllicstionoianewdeveiopmsntallacushasdrsswdsbycon-
uroctianotadeistian mutationinsclonsagsnsundsraporuiatlon
carttroi. J. Bacterial. 148. 341-351.

Sandrnan.K..Losick.R..snd\bmgman.P(1MGsnsticanalyels
ammmmmwmmm-
tionalmutagsnssiaGsnstics macs-en

Sandman. K.. Kroos. L. Cutting. 8. \bungrnlt. R. and Losldt. H.
(105).identiiicationoithepromoterloraeporeoo¢proteingsnsin
Merlot-sandmrdissonthereguiationolltsinductianualue
stegsolsporuiation. J. Moi. Biol. 200. 451471

800. ‘l’.. Samari. Y.. and Kobayaehi. Y. (1990). ONArsarrangsmsradur-
ingeporuiationinaaclusswtls. J. Bacteriol. 172. 1092-10“

Mil. J. M..andMandslstam.J.(tOO).ComnltmsrabepandIion
Inaaclhrsswthandltsrsiationshiptodevsiopmsntotactinomycln
residence. Biachsm. J. 113. M.

Stragisr.R.eonuny.C..andKermazyn-carnpsli.c.mee).Procses-
hgoiasporuiationsigrnaiactorhaedlusswtlis:howmarphaiaglcd
druaurscouidoontroigsnssspreesian.0sl52.U1-704.

m2.mnlol.&.xroos.L.andLoslcit.H.m.Ctvomasornai

rearrangsmsrsgsnsratingacamposhegsnelaradsvsiopmsmalu'an-
scriptian rector. Science 243. 507-512.

M

MO..Straglsr.P.and8stiow.P(1m.idsntincationotansw
e-hucriwolvedincarmartrmrnliaedgsnsarpressianduringsporw
UsnolBecArssubtflsGenssDevJ. 141-149.
MinnaE..andHoch.J.A(1990).CharacterizationolthsspoNB
andrecNiocioiBsceussrws. J. Bacterial. 172. 1305-1311.
W.P.J..Psrkine. J. &.andl.osick.fl.(1984).Anoveimsthod
ummmsmmwdamwm
Mariacsratofns17htsertiorauoi.6en.6snst. 195. 424-433.
Zheng.L..andLoeick.R.(1ssO).Caecaderegutationoisporeaoat
gsnssmressianhBaclusersJ. Moi. Biol. 211645-600.

148

BIBLIOGRAPHY

Bibliography

Alper, 8., Duncan. L. & Losick, R. (1994). An adenosine nucleotide switch controlling
the activity of a cell type-specific transcription factor in B. subtilis. Cell, ‘77, 195-205.

Beall, B., Lowe, M. & Lutkenhaus, J. (1988). Cloning and characterization of Bacillus
zigbtilis homologs of Escherichia coli cell division genes ftsZ and ftsA. J. Bacteriol. 170,
55-4864.

Bibi, E., Gros, P. & Kaback, H. R. (1993). Functional expression of mouse mdrl in
Escherichia coli. Proc. Natl. Acad. Sci. USA, 90, 9209-9213.

Bradford, M. (1976). A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem, 72,
248-254.

Briggs, M.R., Yokoyama, C., Wang, X., Brown, M.S. & Goldstein, J.L. (1993).
Nuclear protein that binds sterol regulatory element of LDL receptor promoter.

Identification of the protein and delineation of its target nucleotide sequence. J. Biol.
Chem. 268, 14490-14496.

Burbulys, D., Trach, K. A. & Hoch, J. A. (1991). Initiation of sporulation in B. subtilis
is conu'olled by a multicomponent phosphorelay. Cell, 64, 545-552.

Cao, J., Revzin, A. & Ferguson-Miller, S. (1991). Conversion of a mitochondrial gene
for mammalian cytochrome c oxidase subunit H into its universal codon equivalent and
expression in vivo and in vitro. Biochemistry, 30, 2642-2650.

Coote, J. G. (1972). Sporulation in Bacillus subtilis. Characterization of oligosporogenous
mutants and comparison of their phenotypes with those of asporogenous mutants. J. Gen.
Microbiol., 71, 1-15.

Cutting, S., Driks. A., Schmidt, R., Kunkel, B. & Losick, R. (1991a). Forespore-

specific transcription of a gene in the signal transduction pathway that governs pro-oK
processing in Bacillus subtilis. Genes & Dev., 5. 456-466.

Cutting, S. & Vander Horn, P. B. (1990). Genetic Analysis. In M l 1 Bi 1 °
W (C. R. Harwood and Simon Cutting), John Wiley & Sons, New
York, NY.

Cutting, 8., Oke. V., Driks, A., Losick, R., Lu. 8. & Kroos, L. (1990). A forespore

checkpoint for mother-cell gene expression during development in Bacillus subtilis. Cell,
62, 239-250.

149

150

Cutting, S., Panzer, S. & Losick, R. (1989). Regulatory studies on the promoter for a
gene governing synthesis and assembly of the spore coat in Bacillus subtilis. J. Mol.
Biol., 207, 393-404.

Cutting, S., Roels, S. & Losick, R. (1991b). Sporulation operon spoIVF and the
characterization of mutations that uncouple mother—cell from forespore gene expression in
Bacillus subtilis. J. Mol. Biol., 221, 1237-1256.

Dion, P. & Mandelstam, J. (1980). Germination properties as marker events
characterizing later stages of Bacillus subtilis Spore formation. J. Bacteriol., 141, 786-
792.

Driks, A. & Losick, R. (1991). Compartmentalized expression of a gene under the

control of sporulation transcription factor 05 in Bacillus subtilis. Proc. Natl. Acad. Sci.
USA, 88, 9934-9938.

Dubnau, D. & Davidoff-Abelson, R. (1971). Fate of transforming DNA following uptake
by competent B. subtilis. J. Mol. Biol., 56, 209-221.

Dubnau, 13., Weir, J., Nair, G., H. L. Carter III, C. P. Moran Jr. & Smith, I. (1988).
Bacillus sporulation gene spoOH codes for 030 (on). J. Bacteriol, 170, 1054-1062

Duncan, L. & Losick, R. (1993). SpoIIAB is an anti-o factor that binds to and inhibits
gsnszcgigtigg by regulatory protein 0" from Bacillus subtilis. Proc. Natl. Acad. Sci. USA,
, 5- 29.

Errington, J ., Fort, P. & Mandelstam, J. (1985). Duplicated sporulation genes in bacteria:
implication for simple developmental systems. F EBS Lett., 188, 184-188.

Errington, J., Wootten, L., Dunkerley, J. C. & Foulger, D. (1989). Differential gene
expression during sporulation in Bacillus subtilis: regulation of the spoVJ gene. Mol.
Microbiol., 3, 1053-1060.

Fan, C.-M. & Maniatis, T. (1991). Generation of p50 subunit of NF-KB by processing of
p105 through an ATP-dependent pathway. Nature (London) 359, 339-342.

Fort, P. & Errington, J. (1985). Nucleotide sequence and complementation analysis of a
polycistronic sporulation operon, spoVA, in Bacillus subtilis. J. Gen. Microbiol., 131,
1091-1 105.

Ghosh, S. & Baltimore, D. (1990). Activation in vitro of NF-xB by phosphorylation of
its inhibitor IxB. Nature (London) 344, 678-682.

Grimm, S. & Baeuerle, RA. (1993). The inducible transcription factor NF-xB: structure-
function relationship of its protein subunits. Biochem. J ., 290, 297-308.

Hager, D. & Burgess, R. (1980). Elution of proteins from SDS polyacrylamide gels,
removal of SDS, and renaturation of enzymatic activity: results with sigma subunit of E.
coli RNA polymerase, wheat-germ topoisomerase, and other enzymes. Anal. Biochem.,
109, 76-86.

151

Halberg, R. & Kroos, L. (1992). Fate of the SpoIIID switch protein during Bacillus

subtilis sporulation depends on the Mother-cell sigma factor, a“. J. Mol. Biol., 228, 840-
849.

Harlow, E. & Lane, D. (1988). In ADMES Cold Spring Harbor Lab., Cold Spring
Harbor, New York, NY.

Hase, C. C. & Finkelstein, R. A. (1993). Bacterial extracellular Zinc-containing
metalloproteases. Microbiological Review, 57, 823-837.

Healy, J. (1989). Ph.D Thesis (Harvard University, Cambridge, MA.).

Healy, J., Weir, J., Smith, I. & Losick, R. (1991). Post-transcriptional control of a
sporulation regulatory gene encoding transcription factor a" in Bacillus subtilis. Mal.
Microbial., 5, 477-487.

Helmann, J. D. & Chamberlin, M. J. (1988). Structure and function of bacterial sigma
factors. Ann. Rev. Biochem., 57, 839-872.

Hoch, J. A, Shiflett, M. A., Trowsdale, J. & Chen, S. M., Ed. (1978). W
W. Spores. Washington, DC, Am. Soc. Microbiol.

Hua, X., Yokoyama, C., Wu, J., Briggs, M.R., Brown, M.S., Goldstein, J.L. & Wang,
X. (1993). SREBP-2, a second basic-helix-loop-helix-leucine zipper protein that

stimulates transcription by binding to a sterol regulatory element. Proc. Natl. Acad. Sci.
USA 90, 11603-11607.

Hughes, K. T., Gillen, K. L., Semon, M. J. & Karlinsey, J. E. (1993). Sensing
structure intermediates in bacterial flagellar assembly by export of a negative regulator.
Science 262, 1277-1280.

Iino, T., Komeda, Y., Kutsukake, K., Macnab, R.M., Matsumura, P., Parkinson, 18.,
Simon, M.I., & Yamaguchi, S. (1988). New unified nomenclature for the flagellar genes
of Escherichia coli and Salmonella typhimurium. Microbial Rev., 52, 533-535.

Illing, N. &. Errington, J. (1991a). Genetic regulation of morphogenesis in Bacillus
subtilis: roles of (IE and «F in prespore engulfment. J. Bacterial, 173, 3159-3169.

Illing, N. & Errington, J. (1991b). The spoIIIA operon of Bacillus subtilis defines a new
temporal class of mother-cell-specific sporulation genes under the control of the a": form of
RNA polymerase. Mal. Microbial., 5, 1927-1940.

Ireton, K. & Grossman, A. (1992). Interaction among mutations that cause altered tinting
of gene expression during sporulation in Bacillus subtilis. J. Bacteriol, 174, 3185-3195.

Jaacks, K. J., Healy, J., Losick, R. & Grossman, A. D. (1989). Identification and
characterization of genes controlled by the sporulation regulatory gene spaOH in Bacillus
subtilis. J. Bacterial, 171, 4121-4129.

152

Jenkinson, H. F., Kay, D. & Mandelstam, J. (1980). Temporal dissociation of late
events in Bacillus subtilis sporulation from expression of genes that determine them. J.
Bacterial, 141, 793-805.

Jonas, R. M. & Haldenwang, W. G. (1989). Influence of spa mutations on OE synthesis
in Bacillus subtilis. J. Bacterial, 171, 5226-5228.

Jonas, R. M., Weaver, E. A., Kenney, T. J., Moran, C. P., Jr. & Haldenwang, W. G.

(1988). The Bacillus subtilis spoIlG operon encodes both 05 and a gene necessary for 05
activation. J. Bacteriol, 170, 507-511.

Jones, C]. & Macnab, RM. (1990). Flagellar assembly in Salmonella typhimurium:
analysis with temperature-sensitive mutants. J. Bacteriol, 172,1327-1339.

Karmazyn-Campelli, C., Bonamy, C., Savelli, B. & Stragier, P. (1989). Tandem genes
encoding o-factors for consecutive steps of development in Bacillus subtilis. Genes &
Dev., 3, 150-157.

Kenney, T. J., Kirchman, P. A. & Moran, C. P.. Jr. (1988). Gene encoding a": is
transcribed from a oA-like promoter in Bacillus subtilis. J. Bacteriol, 170, 3058-3064.

Kenney, T. J. & Moran, C. P., Jr. (1987). Organization and regulation of an operon that
gncodes a sporulation-essential sigma factor in Bacillus subtilis. J. Bacterial, 169, 3329-
339.

Kenney, T. J., York, K., Youngman, P. & C.P. Moran, J. (1989). Genetic evidence that
RNA polymerase associated with 04 uses a sporulation-specific promoter in Bacillus
subtilis. Proc. Nat. Acad. Sci. USA, 86, 9109-9113.

Kieran, M., Blank, V., Logeat, F., Vanderckhove, J ., Lottspeich, F., Le Bail, 0., Urban,
M.B., Kourilisky, P., Baeuerle, P.A. & Israel, A. (1990). The DNA binding subunit of
NF-xB is identical to factor KBF 1 and homologous to the rel oncogene product. Cell, 62,
1007-1018.

Kroos, L. (1991). Gene regulation in the mother-cell compartment of sporulating Bacillus
subtilis. Sem. Dev. Biol., 2, 63-71.

Kroos, L., Kunkel, B. & Losick, R. (1989). Switch protein alters specificity of RNA
polymerase containing a compartment-specific sigma factor. Science, 243, 526-529.

Kunkel, B., Kroos, L., Poth, H., Youngman, P. & Losick, R. (1989). Temporal and
spatial control of the mother-cell regulatory gene spoIIlD of Bacillus subtilis. Genes &
Dev., 3, 1735-1744.

Kunkel, B., Losick, R. & Stragier, P. (1990). The Bacillus subtilis gene for the
developmental transcription factor ex is generated by excision of a dispensable DNA
element containing a sporulation recombinase gene. Genes & Dev., 4, 525-535.

Kunkel, B., Sandman, K., Panzer, S., Youngman, P. & Losick, R. (1988). The
promoter for a sporulation gene in the spaIVC locus of Bacillus subtilis and its use in
studies of temporal and spatial control of gene expression. J. Bacterial, 170, 3513-3522.

153

Kuroda, A., Rashid, M. H. & Sekiguchi, J. (1992). Molecular cloning and sequencing of
the upstream region of the major Bacillus subtilis autolysin gene: a modifier protein
exhibiting sequence homology to the major autolysin and the spalID product. J. Gen.
Microbial., 138, 1067-1076.

LaBell, T. L., Trempy, J. E. & Haldenwang, W. G. (1987). Sporulation-specific sigma
factor, 029, of Bacillus subtilis is synthesized from a precursor protein, P31. Proc. Nat.
Acad. Sci. USA, 84, 1784-1788.

Lazarevic, V., Margot, P.. Soldo, B. & Karamata, D. (1992). Sequencing and analysis
of the B. subtilis lthABC divergon: a regulatory unit encompassing the structural genes
of the N-acetylmuramoyl-L-alanine amidase and its modifier. J. Gen. Microbial., 138,
1949-1961.

Losick, R. & Shapiro, L. (1993). Checkpoints that couple gene expression to
morphogenesis. Science, 262, 1227-1228.

Losick, R. & Stragier, P. (1992). Crisscross regulation of cell-type-specific gene
expression during development in B. subtilis. Nature (London), 355, 601-604.

Losick, R., Youngman, P. & Piggot, P. J. (1986). Genetics of endospore formation in
Bacillus subtilis. Ann. Rev. Genet., 20, 625-669.

Lu, 8., Halberg, R. & Kroos, L. (1990). Processing of the mother-cell a factor, 0", may
depend on events occurring in the forespore during Bacillus subtilis development . Proc.
Natl. Acad. Sci. USA, 87, 9722-9726.

Lu, S. & Kroos, L. (1994). Overproducing the B. subtilis mother-cell sigma factor

precursor, pro-0K, uncouples oK-dependent gene expression from dependence on
intercompartmental communication. J. Bacterial, 176 (in press).

Macnab, RM. (1990). Genetics, structure, and assembly of the bacterial flagellum.
Symp. Soc. Gen. Microbial., 46, 77-106.

Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). In M l l l nin 1
manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, NY.

Margolis, P.. Driks, A. & Losick, R. (1991). Establishment of cell type by
compartmentalized activation of a u'anscription factor. Science, 254, 562-565.

Mason, J. M., Hackett, R. H. & Setlow, P. (1988). Regulation of expression of genes
coding for small, acid-soluble proteins of Bacillus subtilis spores: studies using lacZ gene
fusions. J. Bacteriol, 170, 239-244.

Masuda, E. S., Anaguchi, H., Sato, T., Takeuchi, M. & Kobayashi, Y. (1990).
Nucleotide sequence of the sporulation gene spallGA from Bacillus subtilis . Nuc. Acids
Res., 18, 657.

Masuda, E. S., Anaguchi, H., Yamada, K. & Kobayashi, Y. (1988). Two developmental
genes encoding sigma factor homologs are arranged in tandem in Bacillus subtilis. Proc.
Nat. Acad. Sci. USA, 85, 7637-7641.

154

Matsudaira, P. (1987 ). Sequence from picomole quantities of proteins electroblotted onto
polyvinylidene difluoride membranes. J. Biol. Chem., 262, 10035-10038.

Miller. J. (1972). In W Cold Spring Harbor
Laboratory, NY.

Ohnishi, K., K. Kutsukake, H. Suzuki, & Iino, T. (1990). Gene fliA encodes an
alternative sigma factor specific for flagellar operons in Salmonella typhimurium. Mol.
Gen. Genet., 221, 139-147.

Ohnishi, K., K. Kutsukake, H. Suzuki & Iino, T. (1992). A novel transcription
regulation mechanism in the flagellar regulon of Salmonella typhimurium: an anti-sigma
factor inhibits the activity of the flagellum-specific sigma factor, 0?. Mol. Microbial., 6,
3149-3157.

Oke, V. & Losick, R. (1993). Studies on multi-level regulation of the sporulation
transcription factor, 01‘. J. Bacteriol, 175, 7341-7347.

Olmsted, J. (1981). Affinity purification of antibodies from diazotized paper blots of
heterogeneous protein samples. J. Biol. Chem., 256, 11955-11957.

Partridge, S. R., Foulger, D. & Errington, J. (1991). The role of GP in prespore-specific
transcription in Bacillus subtilis. Mal. Microbial., 5, 757-767.

Perego, M., J.-J. Wu, G.B. Spiegelman, a. & Hoch, J. A. (1991). Mutational
dissociation of the positive and negative regulatory properties of the SpoOA sporulation
transcriptional factor of Bacillus subtilis. Gene, 100, 207-212.

Perego, M., Spiegelman, G. B. & Hoch, J. A. (1988). Structure of the gene for the
transition state regulator aer: regulator synthesis is controlled by the spaOA sporulation
gene in Bacillus subtilis. Malec. Microbial., 2, 689-699.

Piggot, P. J. & Coote, J. G. (1976). Genetic aspects of bacterial endospore formation.
Bacterial. Rev., 40, 908-962.

Piggot, P. J., Curtis, C. A. & DeLancastre, H. (1984). Use of integrational plasmid
vectors to demonstrate the polycistronic nature of a transcription unit (spoIIA) required for
sporulation. J. Gen. Microbial., 130, 2123-2126.

Popham, D. L. & Stragier, P. (1992). Binding of the Bacillus subtilis spoIVCA product
to the recombination sites of the element interrupting the (SK-encoding gene. Proc. Natl.
Acad. Sci. USA, 89, 5991-5995.

Rather, P. N. & Moran, C. P.. Jr. (1988). Compartment-specific transcription in Bacillus
subtilis: identification of the promoter for gdh. J. Bacterial, 170, 5086-5092.

Ricca, E., Cutting, S. & Losick, R. (1992). Characterization of bofA, a gene involved rn
intercompartmental regulation of pro-oK processing during sporulation rn Bacillus subtilis.
J. Bacterial, 174, 3177- 3184.

Ryter, A. (1965). Etude morphologique de la sporulation de Bacillus subtilis. Ann. Inst.
Pasteur (Paris), 108, 40-60.

155

Sandman, K., Kroos, L., Cutting, S., Youngman, P. & Losick, R. (1988). Identification
of the promoter for a spore coat protein gene in Bacillus subtilis and studies on the
regulation of its induction at a late stage of sporulation. J. Mol. Biol., 200, 461-473.

Sandman, K., Losick, R. & Youngman, P. (1987). Genetic analysis of Bacillus subtilis
spa mutations generated by Tn 91 7-mediated insertional mutagenesis. Genetics, 117, 603-
617.

Sanger, F., Nicklen, S. & Coulson, A. R. (1977). DNA sequencing with chain
terminating inhibitors. Proc. Nat. Acad. Sci. USA, 74, 5463-5467.

Sato, T., Samori, Y. & Kobayashi, Y. (1990). The cisA cistron of Bacillus subtilis
sporulation gene spoIVC encodes a protein homologous to a site-specific recombinase. J.
Bacteriol, 172, 1092-1098.

Satola, S., Kirchman, P. A. & Moran, C. P.. Jr. (1991). SpoOA binds to a promoter
used by 0A RNA polymerase during sporulation in Bacillus subtilis. Proc. Natl. Acad.
Sci. USA. 88, 4533-4537.

Satola, S. W., Baldus, J. M. & Moran, C. P.. Jr. (1992). Binding of SpoOA stimulates
spallG promoter activity in Bacillus subtilis. J. Bacterial, 174, 1448-1453.

Schmidt, R., Margolis, P., Duncan, L., Coppolecchia, R., Jr., C. P. M. & Losick, R.
(1990). Control of developmental transcription factor 0F by sporulation regulatory proteins
SpoIIAA and SpoIIAB in Bacillus subtilis. Proc. Natl. Acad. Sci. USA, 87, 9221-9225.

Setlow. P.. Ed. (1989). WWW
Won. Regulation of procaryotic development. Washington, DC,
American Society for Microbiology.

Singh, R. P., Setlow, B. & Setlow, P. (1977). Levels of small molecules and enzymes in
the mother cell compartment and the forespore of sporulating Bacillus megaterium. J.
Bacterial, 130, 1130-1138.

Smith, J.R., Osborne, T.F., Brown, M.S. & Goldstein, J.L. (1992). Multiple sterol
regulatory elements in promoter for hamster 3-hydroxy-3-methylglutaryl coenzyme A
synthase. J. Biol. Chem. 263, 18480-18487.

Stragier, P. (1986). Comment on "Duplicated sporulation genes in bacteria". FEBS Lett.,
95, 9-1 1.

Stragier P (1989) In W
W (Smith, I., Slepecky, R. A.& Setlow, P.,) 243- 254, American Society for
Microbiology, Washington, D. C.

Stragier, P. (1992). Establishment of forespore-specific gene expression during
sporulation of Bacillus subtilis. in
W (Stragier, P.) Soc. Gen. Microbiol, Cambridge University Press.

Stragier, P.. Bonamy, C. & Karmazyn-Campelli, C. (1988). Processing of a sporulation
sigma factor in Bacillus subtilis: How morphological structure could control gene
expression. Cell, 52, 697-704.

156

Stragier, P., Bouvier, J ., Bonamy, C. & Szulmajster, J. (1984). A developmental gene
product of Bacillus subtilis homologous to the sigma factor of Escherichia coli. Nature
(London), 312, 376-378.

Stragier, P.. Kunkel, B., Kroos, L. & Losick, R. (1989). Chromosomal rearrangement
generating a composite gene for a developmental transcription factor. Science, 243, 507-
512.

Stragier, P. & Losick, R. (1990). Cascades of sigma factors revisited. Molec.
Microbial., 4, 1801-1806.

Strauch, M., Webb, V., Spiegelman, G. & Hoch, J. A. (1990). The SpoOA protein of
Bacillus subtilis is a repressor of the aer gene. Proc. Natl. Acad. Sci. USA, 87 , 1801-
1805.

Sun, D., Cabrera-Martinez, R. M. & Setlow, P. (1991). Control of transcription of the
Bacillus subtilis spoIIIG gene, which codes for the forespore specfic transcription factor
00. J. Bacterial, 173, 2977-2984.

Sun, D., Stragier, P. & Setlow, P. (1989). Identification of a new o-factor involved in
compartmentalized gene expression during sporulation of Bacillus subtilis. Genes & Dev.,
3, 141- 149.

Sun, D. & Takahashi, I. (1984). A catabolite resistance mutation is localized in the moD
operon of Bacillus subtilis. Canad. J. Micrbial., 31, 429-435.

Suzuki, T., lino, T., Horiguchi, T. & Yamaguchi, S. (1978). Incomplete flagellar
structures in nonfiagellar mutants of Salmonella typhimurium. J. Bacteriol, 133, 904-
915.

Trempy, J. B., Bonamy, C., Szulmajster, J. & Haldenwang, W. G. (1985). Bacillus
subtilis sigma factor, 029, is the product of the sporulation-essential gene spalIG. Proc.
Nat. Acad.. Sci. USA, 82, 4189-4192.

 

‘U

Van Hoy, B. E. & Hoch, J. A. (1990). Characterization of the spalVB and recN loci
of Bacillus subtilis. J. Bacteriol, 172, 1306-1311.

Wang, X., Sato, R., Brown, M.S., Hua, X., & Goldstein, J. (1994). SEREBP—l, a
membrane-bound transcription factor released by sterol-regulated proteolysis. Cell, 77,
53-62.

Warth, A. D. & Strominger, J. L. (1972). Structure of the peptidoglycan from spores of
Bacillus subtilis. Biochemistry, 11, 1389-1396.

Weir, J ., Predich, M., Dubnau, B., Nair, G. & Smith, I. (1991). Regulation of spaOH, a
gene coding for the Bacillus subtilis a" factor. J. Bacteriol, 173, 521-529.

Yokoyama, C., Wang, X., Briggs, M.R., Admon, A., Wu, J., Hua, X., Goldstein, J.L.
& Brown, M.S. (1993). SREBP-l, a basic-helix-loop-helix-leucine zipper protein that
controls transcription of the LDL receptor gene. Cell 75,187-197.

157

York, K., T. J. Kenney, S. Satola, C. P. Moran, J., H. Poth & Youngman, P. (1992).
SpoOA control the oA-dependent activation of Bacillus subtilis sporulation-specific
transcription unit spoIIE. J. Bacteriol, 174, 2648-2658.

Youngman, P., Perkins, J. B. & Losick, R. ( 1984). Construction of a cloning site near
one end of Tn91? into which foreign DNA may be inserted without affecting transposition
in Bacillus subtilis or expression of the transposon-borne erm gene. Plasmid, 12, 1-9.

Youngman, P. Y., Perkins, J. B. & Losick, R. (1983). Genetic transposition and
insertional mutagenesis in Bacillus subtilis with the Streptococcus faecalis transposon
Tn917. Proc. Nat. Acad. Sci. USA, 80, 2305-2309.

Zheng, L., Halberg, R., Roels, S., Ichikawa, H., Kroos, L. & Losick, R. (1992).
Sporulation regulatory protein GerE from Bacillus subtilis binds to and can activate or
repress transcription from promoters for mother-cell-specific genes. J. Mol. Biol., 226,
1037-1050.

Zheng, L. & Losick, R. (1990). Cascade regulation of spare coat gene expression in
Bacillus subtilis. J. Mol. Biol., 212, 645-660.

"llllllllllllllll