(flier: ..., .. :
.Ehitmwru
.

2:.

 

1%. E a» g . V . . ‘ A . .
_ ‘ . ‘ . _ ”mafia“ .. .. . {i .
u. 3% gm: . , . “Ewan?

1.‘ Vt). ‘

THESIS

ICHK

«lime W

3 l

 

H M

W ”Hill

0 6362

=
d

 

 

 

 

w

 

LIBRARY

Michigan State
Unlverslty

 

 

 

This is to certify that the

dissertation entitled

STRUCTURE, FUNCTION, AND REGULATION OF THE EARLY
NODULIN GENE ENOD2 FROM LEGUME PLANTS

presented by

Rujin Chen

has been accepted towards fulfillment
of the requirements for

Ph.D. degree in WU

/

Major or

Date—LaLML

MS U is an Affirmative Action/Equal Opportunity Institution 0-12771

 

PLACE N RETURN BOX to remove this checkout from your record.
TO AVOID FINES Mum on or betore date due.

F——__———'——————————I'————-—1
ATE DUE DATE DUE DATE DUE

° l J

 

 

 

 

 

H

1.7

 

 

 

 

 

 

 

 

 

 

 

 

 

 

%
_L_=

 

 

 

 

 

 

 

 

 

l—T—‘l—j

MSU Ie An Affirmative Action/Equal Opponunlty lnetltuion

STRUCTURE, FUNCTION, AND REGULATION OF THE EARLY
NODULIN GENE EN ODZ FROM LEGUME PLANTS

By

Ruj in Chen

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements

for the degree of

DOCTORATE OF PHILOSOPHY

Department of Biochemistry

1996

ABSTRACT

STRUCTURE, FUNCTION, AND REGULATION OF THE EARLY
NODULIN GENE EN 0D2 FROM LEGUME PLANTS

By

Ruj in Chen

The early nodulin SrEnodZ gene of the tropical legume Sesbam'a rostrata
encodes a putative hydroxyproline-rich cell wall protein, and is expressed
exclusively in the parenchyma cells of both stem- and root-nodules. In
addition, the SrEnodZ gene can be specifically induced in roots by the plant
hormone cytokinin, and this induction occurs at a post-transcriptional level.
One focus of this dissertation research is to elucidate the molecular
mechanism that controls the nodule parenchyma-specific expression of the
SrEnodZ gene using both molecular genetic and biochemical approaches.

By analyzing chimeric reporter gene expression in transgenic Lotus
corniculatus plants, a detailed characterization of the 5’ and 3’ SrEnodZ
flanking sequences has been carried out. These analyses indicate that the
SrEnodZ 3’ untranslated region is both required and sufficient for gene
expression in nodule parenchyma cells. Another finding is that the 5’
flanking sequence does not appear to contain any significant cis-acting
elements for nodule parenchyma-specific expression. This observation is in

contrast with the report that the 5’ upstream region of the soybean En0d2

gene directs nodule parenchyma-specific expression, indicating different
mechanisms may be involved in regulation of the expression of these two
genes.

Using an in-vitro protein-RNA UV-cross linking approach, several
nodule-specific proteins have been identified to interact with the RNA
transcribed from the SrEnodZ 3 ’ untranalated region. Competition
experiments using both non-specific and specific competitors suggest that
the cis-acting elements responsible for nodule parenchyma-specific
expression co-localize with specific protein binding sequences.

Cytokinin up—regulation of the EnodZ gene expression is not a
common phenomenon among legume plants. To facilitate molecular and
genetic analyses of the cytokinin regulation of the EnodZ gene expression,
the En0d2 homologue was isolated from the model legume, L. japonicus.
Northern blot analyses indicate that the LjEnodZ gene is inducible in roots,
but not by cytokinin. Submergence of the L. japonicus roots in water for
several hours was sufficient to induce the LjEnodZ gene expression. Further
analyses demonstrate that ethylene is responsible for the LjEnodZ gene

expression in roots of L. japonicus.

To Yihong, June, Rong and my parents

iv

ACKNOWLEDGMENTS

I thank my thesis advisor, Dr. Frans J. de Bruijn, for advice, encouragement
and financial support during my dissertation research. I thank my committee
members, Drs. Zachary Burton; Frans J. de Bruijn; Pamela Green; Paul
Kindel; and Lee McIntosh, for their helpful discussions and advice in the
past five years. A special thank is due to Dr. Pamela Green for serving as
my major professor. I thank all the members past and present in the de
Bruijn’s laboratory for their help and input during my research. Particularly,
I thank Krzysztof Szczyglowski for useful discussions and advice, David
Silver for sharing information and collaborating on projects related to this
research, and Debbie Ganoff for her excellent technical assistance. I also
thank colleagues in laboratories of Drs. Pamela Green, Hans Kende, Lee
Macintosh, and Natasha Raikhel, for providing expertise and access to their
equipments when needed. I thank Drs. David Layzell and Stephen Hunt at
Queen’s University of Canada for collaborating on analysis of nitrogenase
activities with their non-invasive open-flow system. I thank Dr. David
Emerson at the Center for Microbial Ecology of Michigan State University
for collaborating on analysis of nodule oxygen with his oxygen
microelectrodes. Lastly, I thank my wife Yihong, daughter June and
mother-in-law Kong for their love and support. They made this possible and

meaningful.

TABLE OF CONTENTS

LIST OF FIGURES .................................................................................. viii
CHAPTER 1
INTRODUCTION ........................................................................................ 1
SECTION 1. Symbiotic Nitrogen Fixation and Nodule
‘ development ..................................................................... 2

SECTION 2. Involvement of mRNA 3’ Untranslated Region
(3’ UTR) 1n Control of Gene Expression and
Developmental Regulation .............................................. 18

CHAPTER 2
THE NODULE PARENCHYMA-SPECIFIC EXPRESSION OF THE
SESBANIA ROS TRA TA EARLY NODULIN GENE SrENODZ IS

NIEDIATED BY ITS 3’ UNTRANSLATED REGION (3 ’ UTR) ............. 46
Abstract ................................................................................................ 47
Introduction .......................................................................................... 48
Methods ................................................................................................ 52
Results .................................................................................................. 60
Discussion ............................................................................................ 90
List of References ................................................................................ 98

vi

CHAPTER 3
IDENTIFICATION OF CIS-ELEMENTS WITHIN THE
3 ’ UNTRANSLATED REGION OF THE SrENOD2 GENE

AND INTERACTING PROTEINS ......................................................... 108
Abstract ............................................................................................ 109
Introduction ...................................................................................... 1 10
Methods ............................................................................................ 1 1 1
Results .............................................................................................. 1 18
Discussion ........................................................................................ 133
List of References ............................................................................ 136

CHAPTER 4

THE LjENODZ GENE IS INDUCIBLE BY ETHYLENE

IN ROOTS OF LOTUS JAPONICUS ...................................................... 138
Abstract ............................................................................................ 139
Introduction ...................................................................................... 140
Methods ............................................................................................ 142
Results .............................................................................................. 145
Discussion ........................................................................................ 168
List of References ............................................................................ 171

CHAPTER 5

FUNCTION OF THE ENOD2 PROTEIN IN NODULES ...................... 175
Abstract ............................................................................................ 176
Introduction ...................................................................................... 177
Methods ............................................................................................ 179
Results .............................................................................................. 183
Discussion ........................................................................................ 198
List of References ............................................................................ 203

CHAPTER 6

CONCLUSIONS AND FUTURE PERSPECTIVES .............................. 206

vii

LIST OF FIGURES

FIGURE l-l. Schematic representation of nodule developmental
events and nodulin gene expression ..................................................... 17

FIGURE 2-1. In-situ localization of SrEnod2 gene expression .............. 61

FIGURE 2-2. Structure of gus fusion constructs and determination
of GUS activity in transgenic L. corniculatus plants ........................... 65

FIGURE 2-3. Microscopic analysis of the expression of reporter
gene constructs in transgenic L. comiculatus plants ............................ 68

FIGURE 2-4. Northern blot analysis of gus reporter gene
expression in transgenic nodules harboring the reporter gene
constructs 1-5 (Figure 2A) ................................................................... 73

FIGURE 2-5. Structure of gus fusion constructs and determination
of GUS activity in transgenic L. comiculatus plants .......................... 77

FIGURE 2-6. Microscopic analysis of the expression of gas fusion
constructs in transgenic L. corniculatus plants ..................................... 80

FIGURE 2-7. Structure of SrEnod2 5' deletion reporter gene
constructs and GUS activity in transgenic L. corniculatus plants ....... 83

FIGURE 2-8. Structure of SrEnod2 5' deletion reporter gene
constructs, enhancer fusions and GUS activity in transgenic
L. corniculatus plants ........................................................................... 86

FIGURE 2-9. Structure of SrEnod2 3' deletion reporter gene

constructs and determination of GUS activity in transgenic
L. comiculatus plants ........................................................................... 89

viii

FIGURE 3-1. S1 nuclease protection assay ............................................. 120
FIGURE 3-2. Sequence of the 3’ region of the SrEnod2 gene .............. 122

FIGURE 3-3. Structure of gas fusion constructs and GUS
expression in transgenic L. corniculatus .............................................. 125

FIGURE 3-4. RNA-protein UV-cross linking and competition
with non-specific competitors ............................................................... 129

FIGURE 3-5. RNA-protein UV-cross linking and competition
with specific competitors ...................................................................... 132

FIGURE 4-1. Genomic organization of the Enod2 gene in
L. japom'cus plants ................................................................................ 148

FIGURE 4-2. Nucleotide and the deduced amino acid
sequences of a partial LjEnodZ cDNA clone ........................................ 150

FIGURE 4-3. The LjEnodZ gene is expressed early during
nodule development .............................................................................. 152

FIGURE 4-4. LjEnodZ gene expression in roots of
L. japom'cus plants treated with cytokinin ............................................ 155

FIGURE 4-5. LjEnodZ gene expression in roots of
L. japonicus plant .................................................................................. 158

FIGURE 4-6. The LjEnodZ gene expression in roots of
L. japonicus plants upon ethylene treatment ........................................ 161

FIGURE 4-7. LjEnodZ gene expression in roots of

L. japom'cus plants treated with ethylene inhibitors ............................. 164
FIGURE 4-8. LjEnodZ gene expression in roots of L. japonicus

plants treated with the protein synthesis inhibitor cycloheximide ....... 167
FIGURE 5-1. Antiscnse Enod2 constructs .............................................. 185

ix

FIGURE 5-2. The Enod2 gene expression in
L. comiculatus plants ............................................................................ 189

FIGURE 5-3. Nodule fresh weight of transgenic L. corniculatus
plants harboring antisensc Enod2 constructs ........................................ 191

FIGURE 5-4. Oxygen microelectrode measurement of
02 concentrations across nodules of transgenic plants
expressing antisensc Enod2 transcripts ............................................... 194

FIGURE 5-5. Measurement of nitrogenase activity ............................... 197

FIGURE 5-6. Electron allocation and oxygen limitation
coefficients of nitrogenase ................................................................... 200

CHAPTER 1

INTRODUCTION

SECTION I. Symbiotic Nitrogen Fixation and Nodule Development

A. Symbiotic Nitrogen Fixation

Symbiotic nitrogen fixation takes place in the central infected cells of
nodules, new plant organs formed on roots of legume and several non-
legume plants after infection by soil bacteria of the genera Rhizobium,
Bradyrhizobium and Azorhizobium. The bacterial enzyme nitrogenase

catalyzes the following reaction:

N2 + 8H+ + 8c“ + 16Mg-ATP —) 2NH3 + H2 + l6Mg-ADP + 16Pi (1)

In this reaction, atmospheric dinitrogen is reduced to ammonium, which is
exported from the infected cells to adjacent non-infected cells and
assimilated as a nitrogen-source for the plant host. Plants, in turn, supply the
nitrogen-fixing bacteria with carbon sources to provide energy for the
nitrogenase-catalyzed reaction. Nitrogenase consists of two components, the
homodimeric Fe protein, encoded by the bacterial m‘fH gene, and the
tetrameric molybdenum-iron (MoFe) protein, encoded by the nifD and nifK
genes (Dixon et a1., 1977; Ruvkun, et a1., 1982). Since the MoFe protein is
irreversibly denatured by oxygen (Appleby, 1984), nitrogen fixation

requires low oxygen concentration in the infected cells of the nodule. On

the other hand, a large amount of energy (ATP) required for the nitrogen-
reducing reaction has to be provided via oxidative processes, since rhizobia
are generally aerobic bacteria. Thus, there is a high demand for oxygen
influx into nodules. Legume plants have developed different strategies to
cope with this “oxygen paradox”. A low oxygen concentration in the nodule
central nitrogen-fixing tissue is achieved by a combination of high
metabolic activities of the bacteroids and the formation of an oxygen
diffusion barrier in the periphery of the nodule (nodule parenchyma;
Tjepkema and Yocum, 1974; Witty, 1986). In addition, and possibly most
importantly, the oxygen carrier protein leghemoglobin provides oxygen
buffering activity by transporting oxygen to the actively nitrogen-fixing and
respiring bacteroids in the infected cells at a low intracellular free oxygen

concentration (< 10 nM; Appleby, 1984).

B. Nodule Development

Nodule formation initiates with the exchange and recognition of signal
molecules between the compatible symbiotic partners (Long et al., 1989;
Fisher and Long, 1992; Figure 1-1). Flavonoids and isoflavonoids are signal
molecules secreted by the roots of legume plants that serve as
chemoattractants as well as inducers of bacterial nodulation (nod) genes

(Peters et al., 1986; for a review, see Long, 1989). Expression of the nod

genes, in turn, results in the synthesis of lipochitooligosaccharides, known
as “Nod factors”, which can induce root hair deformation, cortical cell
division and nodule formation at extremely low concentrations (10"8-10"11
M; Lerouge et al., 1990; Truchet et al., 1991; Ardourel et al., 1994; Heidstra
et al., 1994; Yang et al., 1994). The structure of Nod factors was first
determined in R. meliloti, the microsymbiont of alfalfa (NodRm-l; Lerouge
et al., 1990). NodRm-l consists of a backbone of three to five [3-1,4-1inked
N-acetylglucosamines bearing a C16 unsaturated fatty acid chain on the
non-reducing sugar residue. The structure of Nod factors from many other
rhizobia has subsequently been determined (for reviews, see Vijn et al.,
1993; Denarie and Cullimore, 1993; Carlson et al., 1995). Now, it is clear
that Nod factors generally have a N-acylated chitin oligosaccharide
backbone and can have various substitutions on both the reducing and the
non-reducing sugar residues. These substitutions likely render Nod factors
specific for their host (Vijn et al., 1993; Denarie and Cullimore, 1993;
Carlson et al., 1995). 1

Upon Rhizobium infection, root hairs undergo curling and deformation,
and form characteristic structures called Shepherd crooks (Kijne, 1992).
Bacteria are entrapped in these structures. A local hydrolysis of the plant
cell wall and a subsequent plasma membrane invagination and deposition of
new plant cell wall material result in the formation of a tubular structure, the

so-called infection thread, by which the bacteria enter the plant (for reviews,

see Bauer, 1981; Newcomb, 1981; Brewin, 1991; Kijne, 1992). As the
infection threads form, root cortical cells are mitotically reactivated to form
the nodule primordium. Infection threads grow toward this primordium and
release bacteria into the cytoplasm of nodule primordium cells in a process
called endocytosis (V erma, 1992). Concomitant with the infection process,
a meristem is formed at the distal part of the primordium and the meristem
produces cells that differentiate into the nodule tissue (Nap and Bisseling,
1990; Kijne, 1992).

The site of first cortical cell divisions depends on the type of nodule
formed upon rhizobial infection. In general, temperate legumes, including
pea, alfalfa, clover, form indeterminate nodules, which have a persistent
meristem at the apex. As a result of continuous cell divisions, new cells are
added to the cortical and central tissues of emerging nodules. Consequently,
all tissues of these nodules are of a graded age from the apical meristem to
the root attachment point. The first cell divisions in roots of plants forming
indeterminate nodules occur in the inner cortical cells (Nap and Bisseling,
1990). The infection threads must traverse the outer cortex before they
reach these cells. Before infection thread penetration, the outer cortical cells
undergo morphological changes. The nuclei move to the center of the cells,
and the microtubules and the cytoplasm rearrange to form radially oriented

structures, the cytoplasmic bridges, or pre-infection threads (van Brussel et

a1; 1992). The infection threads traverse the outer cortical cells through
these radially aligned cytoplasmic bridges.

In contrast, tropical legumes, such as soybean, Lotus, and Sesbania,
form determinate nodules, whose meristems cease to divide shortly after
rhizobial infection (Newcomb, 1981). As a result, development of
determinate nodules largely depends on cell elongation and expansion.
Within a determinate nodule, cells are at approximately the same
developmental stage. In plants forming determinate nodules, first cell
divisions occur in the root outer cortex. Subsequently, cell divisions also
take place in the pericycle and inner cortex, several cell layers separated
from the initial cell divisions. Eventually, the two meristematically active

regions merge and give rise to the nodule tissues (Kijne, 1992).

C. Gene Expression During Nodule Development

During nodule development, a number of plant genes are induced or their
expression is differentially enhanced. They are termed nodulin genes
(Legocki and Verma, 1980; van Kammen, 1984; Verma and Delauney,
1988). Genes expressed during early stages of nodule development, well
before the onset of symbiotic nitrogen fixation, are collectively called early
nodulin genes (Enods). Those expressed around the onset of nitrogen

fixation are termed late nodulin genes. Although the function of many

nodulin genes identified to date remains to be determined, the sequential
expression of particular nodulin genes marks the different phases of nodule
development (Scheres et al., 1990b; for reviews, see Nap and Bisseling,
1990; Sanchez et al., 1991; Mylona et al., 1995). Additionally, the spatial
expression of nodulin genes in nodules clearly suggests their involvement in
particular morphological and biochemical aspects of nodule development.
Nodulins involved in initial root hair deformation upon rhizobial
infection, include RH-42 and RH—44, which were identified by in vitro
translation of mRNAs isolated from root hairs (Gloudemans et al., 1989);
and a lipid transfer-like protein (LTP), which was isolated from a cDNA
library constructed from mRNAs of root hairs infected with rhizobia
(Krause et al., 1994). The RH—42 gene is not expressed in root hairs of
uninoculated pea plants, but induced in root hairs after infection with R.
leguminosarum bv. viciae (Gloudemans et al., 1989). It is possible that the
RH—42 is involved in root hair curing. The expression of the pea gene RH-
44 is markedly stimulated in pea root hairs upon rhizobial infection,
although this gene is also expressed at a low level in root hairs of
uninoculated plants (Gloudemans et al., 1989). The mRNA encoding the
LTP is expressed in all tissues, except nodules. However, the transcript
level is induced in root hairs 24 hr after application of Nod factors, different

plant hormones, or rhizobia (Krause et al., 1994).

Two early nodulin genes of pea (Enod5 and Enod12) have been
identified that are involved in the infection process (Scheres et al., 1990a).
The expression of the Enod12 gene can be detected in root hairs, root
cortical cells and nodule cells containing growing infection threads (Scheres
et al., 1990a). Interestingly, this gene is expressed not only in cells
containing growing infection threads, but also in several cell layers located
in front of the infection thread tips, where the cells are preparing for
infection thread penetration (Scheres et al., 1990a). The spatial distribution
of the Enod5 mRNA in infected pea roots is strikingly different from that of
the Enod12 transcript. The Enod5 gene is expressed only in cells containing
the growing infection thread (Scheres et al., 1990b). In indeterminate pea
nodules, the Enod12 transcript is also detectable in cells adjacent to the
distal meristem in the invasion zone, while the En0d5 mRNA reaches a
maximum level in the early symbiotic zone (Scheres et al., 1990b).

Several nodulin genes are expressed during mitotic reactivation of root
cortical cells by rhizobia. They include Enod12 (Scheres et al., 1990a),
Gm93 (Kouchi and Hata, 1993), Enod40 (Kouchi and Hata, 1993; Yang et
al., 1993; Asad et al., 1994; Crespi et al., 1994; Matvienko et al., 1994), and
MtPRP4 (Wilson et al., 1994). These genes are expressed in all cells of the
developing nodule primordia. En0d40 gene is particularly interesting,
because it is also expressed at an early stage preceding the first cortical cell

division in the region of the pericycle opposite to the protoxylem poles

(Kouchi and Hata, 1993; Yang et al., 1993; Asad et al., 1994; Matvienko et
al., 1994).The Enod40 gene has been shown to be inducible by Nod factors
(V ijn et al., 1993; Yang et al., 1993). Expression of antisense Enod40 gene
in alfalfa arrests callus growth, while over-expression of the Enod40 gene in
alfalfa causes the formation of teratomas, a callus containing developing
shoots and short roots (Crespi et al., 1994). Since the Enod40 genes have no
significant open reading frame, and in vitro translation of the En0d40
transcripts does not yield any protein product, several groups of
investigators have proposed that the Enod40 genes play a role in plant
development by acting as RNA (riboregulators; Asad et al., 1994; Crespi et
al., 1994; Matvienko et al., 1994). Recently, van de Sande et a1. (1996) have
reported evidence to argue that an oligopeptide of about 10 amino acids
encoded by the Enod40 transcripts changes the plant cell response to auxin
in tobacco protoplasts. An Enod40 homologue was isolated from tobacco,
and when expressed in tobacco protoplasts, had an activity identical to the
legume Enod40, indicating that the peptides encoded by the Enod40 genes
may act as plant growth regulators (Crespi et al., 1996).

Several nodulin genes have also been identified during subsequent
nodule organogenesis. One of these genes, the Enod2 gene, was first
isolated from soybean and pea (Franssen et al., 1987; van de Wiel et al.,
1990a). The Enod2 gene encodes a protein with a putative N-terminal signal

peptide followed by a sequence containing repeating proline-rich

10

pentapeptide motifs (Franssen et al., 1987). Enod2 homologues have been
isolated fiom several other legumes, such as alfalfa (Dickstein et al., 1988),
vetch (Moerman etal., 1987), Sesbania (Strittmatter etal., 1989; Dehio and
de Bruijn, 1992), common bean (Sanchez et al., 1988), lupin (Szczyglowski
and Legocki, 1992), and Lotus japom'cus (R. Chen and R]. de Bruijn,
unpublished data). The Enod2 mRNA is present in the inner cortex (nodule
parenchyma) of determinate and indeterminate nodules (van de Wiel et al.,
1990a), and in similar tissues in empty nodules induced by certain
rhizobium strains (van de Wiel et al., 1990b). The exact function of the
Enod2 protein has not yet been elucidated. However, since the nodule
parenchyma appears to be a physical barrier limiting oxygen diffusion into
the infected cells of nodules and the Enod2 transcript (protein) is localized
in this tissue, it has been postulated that this putative cell wall protein may
contribute to the morphogenesis of the nodule parenchyma and therefore the
generation of the oxygen diffusion barrier (Nap and Bisseling, 1990; van de
Wiel et al., 1990a; Govers et al., 1990). One of the objectives of this
dissertation research was to test this hypothesis by attempting to down-
regulate Enod2 gene expression using an antisense approach (see Chapter
5).

Following Enod2 gene expression, the late nodulin genes are activated
and nitrogen fixation commences. Late nodulins include enzymes involved

in ammonia assimilation, such as glutamine synthetase and glutamate

11

synthase (GS, GOGAT, respectively; for reviews, see Atkins, 1987; Miflin
and Lea, 1980); carbon metabolism, such as phosphoenolpyruvate
carboxylase and sucrose synthase (PEP carboxylase, SS, respectively; for a
review, see Atkins, 1987); and amide and ureide biogenesis, such as
aspartate aminotransferase and uricase (AAT; uricase II; for a review, see
Schubert, 1986). They also include proteins present in the peribacteroid
membrane, such as Nodulin- 26 fiom soybean (Fortin et al., 1987; Miao and
Verma, 1993; Weaver et al., 1994), leghemoglobins (Lbs; Appleby, 1984),
and a putative plant transcription factor, NMH7 (Heard and Dunn, 1995). N-
26 is a nodule-specific ion transporter (Weaver et al., 1994).
Leghemoglobins (Lbs) function as oxygen carriers, facilitating Oz diffusion
to the nitrogen-fixing bacteroids (Appleby, 1984), and represent the most
abundant proteins within nodules. Leghemoglobins are encoded by a
multigene family, each member of which is induced at a slightly different
time during nodule formation, indicating developmental control of Lb gene
expression (Jensen et al., 1988). Different Lbs seem to have distinct
affinities for oxygen, that may be important for nodule nitrogen fixing
activity in subtle ways (Appleby, 1984; de Bruijn and Schell, 1992).

Late nodulin genes are the most well characterized nodule-specific
genes, in terms of regulation of gene expression. Nodule-specific expression
of the Lb genes, for example, has been studied in detail using reporter gene

expression in transgenic plants (de Bruijn et al., 1990; Szabados et al.,

12

1990). Using deletions and specific mutations, an organ-specific cis-acting
(OSE) element has been identified in the promoter region of a soybean
leghemoglobin,lbc3 gene (Stougaard et al., 1987; Ramlov et al., 1993).
Similarly, a nodule-infected-cell—specific (NICE) element, which contains
three nodule conserved cis-elements (AAAGAT; TTGTCTCTT; and
CACCCT), has been identified in the promoter region of a Sesbania
rostrata leghemoglobin gene (Srglb3; Szabados et al., 1990; Szczyglowski
et al., 1994).

D. Hormones as Secondary Messengers

As mentioned above, Nod factors stimulate multiple responses in legume
plants, including root hair curling and deformation, cortical cell division,
induction of nodulin gene expression and finally nodule formation. The
molecular basis of Nod factor action is not precisely known. Ehrhardt et a1.
(1992) have shown that root hair membranes depolarize rapidly after
addition of Nod factors. Allen et a1. (1991) have found that cytoskeletal
rearrangements, and changes in vacuole shape occur within root hair cells
soon after the addition of Nod factors. Using calcium-sensitive reporter
dyes, Ehrhardt et al., (1996) have shown that localized periodic spikes in

cytoplasmic calcium levels occur following the application of Nod factors.

13

In plants forming indeterminate nodules, cortical cell divisions occur
in the inner cortex, and Yang et a1. (1994) have shown that only narrow
rows of cortical cells located opposite protoxylem poles, are activated and
express a histone H4 gene. At the time of H4 gene induction, the infection
thread tips, the sites where Nod factors are released, are still in the
epidermis. This indicates that Nod factors act at distance. Nod factors may
directly activate the cortical cell division or indirectly affect them through
endogenous signal molecules.

Plant hormones have been implicated in nodule development since
Thimann (193 6) first hypothesized that the plant growth hormone auxin was
involved in pea root nodulation (for a recent review, see Hirsch, 1992).
Subsequently, the plant hormone cytokinin was found to induce cortical cell
divisions that resembled the initial response of roots to rhizobial infection
(Arora et al., 1959; Libbenga and Bogers, 1974). Libbenga et a1. (1973)
determined that inner cortical cells opposite the xylem poles were
stimulated to divide in devascularized explants after treatment with auxin
and cytokinin. Furthermore, they found that an ethanol extract from the
stele could replace cytokinin in promoting cell division. A substance
responsible for this activity, the so-called stele factor (uridine), has since
been isolated and is thought to be released from the protoxylem poles to
promote susceptibility to the cortical cells located opposite the protoxylem

poles (Smit et al., 1993; 1995).

14

More recently, both cytokinin (Cooper and Long, 1994) and
compounds that block polar auxin transport (Hirsch, et al., 1989) have been
shown to induce the formation of nodule-like structures in which several
early nodulin genes, including Enod2, are expressed. Additionally, the Nod
factor-inducible ENOD40 gene has been shown to have plant hormone-like
activity when expressed in alfalfa or tobacco (Crespi et al., 1994; van de
Sande, 1996). It is possible that ENOD40 expression in the pericycle of
legume roots causes a change in the cytokinin/auxin ratio in the cortical
cells that triggers the initiation of cell division (Mylona et al., 1995).

Support for the notion that plant hormones play a role in nodule
development also comes from studies which demonstrate that cytokinin can
specifically induce early nodulin Enod2 gene expression in the roots of S.
rostrata (SrEnod2; Dehio and de Bruijn, 1992; Silver et al., 1996), and in
roots of alfalfa (Hirsch et al., 1993). However, the mechanism by which
cytokinin regulates early nodulin gene expression and the exact role of early
nodulins in nodule development remain to be established.

One objective of this dissertation research was to understand how the
SrEnod2 gene expression is controlled developmentally and cell
specifically, and to identify cis-elements responsible for this type of
regulation. Chapter 2 presents the results of this research. The data
described in this chapter will be directly compared with those obtained in a

separate study in our laboratory on the cytokinin regulation of Enod2 gene

15

expression. One of the future goals will be to dissect the signal transduction
pathways leading to the developmental, cell-specific, and cytokinin
regulation of the Enod2 gene expression by isolating trans-acting factors
that interact with cis-elements identified here. Towards this goal, Chapter 3
describes some of the initial effort to identify putative protein factors
interacting with these cis-elements using in vitro RNA-protein UV-cross
linking strategies. To further our understanding of plant hormone regulation
of Enod2 gene expression, we also characterized the hormone response of
the Enod2 gene from L. japonicus (see Chapter 4). Surprisingly, we found
that ethylene, instead of cytokinin, induces the LjEnodZ gene expression,
indicating that Enod2 genes from different legume plants might be regulated
differentially. Lastly, we employed a genetic approach in an attempt to
down-regulate Enod2 gene expression for the purpose of understanding the
function of the Enod2 protein during nodule development (see Chapter 5).
Since the results presented in Chapter 2 strongly suggest that the 3’
untranslated region (3’ UTR) of the SrEnod2 gene mediates the
developmental and cell-specific expression of this gene, in the following
section, I will review the current literature on what is known about 3’

UTR’s in control of gene expression and developmental regulation.

16

LEGEND FOR FIGURE 1-1. Schematic representation of nodule
developmental events and nodulin gene expression.

The developmental stages are shown on the lefi and the corresponding
nodule development events are represented in the center. On the right,
expression of some early and late nodulin genes is listed sequentially.
Nodule types are represented in the middle (INDETERMINATE: M=
meristem; IZ= infection; ES= early symbiotic; LS= late symbiotic; and SZ=
senescing zones; VB= vascular bundle; NP= nodule parenchyma.
DETERMINATE: IC= infected; NC= uninfected cells; VB= vascular
bundle; NP= nodule parenchyma.) Major metabolic processes (bottom) are
schematically represented as linked pathways of carbon, nitrogen, and
oxygen metabolism. (Modified from Sandrez et al., 1991).

 

Developmental

Stages

Nodule
Development

Expression of
Nodulin Genes

 

Preinfection

 

it

 

Infection and Nodule Formation

 

Nodule Function and Maintainance

i

Q] Root Exudatcs

‘_

 

Nod Factors T 6:?

 

 

 

 

 

Initial Induction Early Nodulins l
Late Nodulins

 

 

 

 

 

Scncsccncc

 

 

 

 

Enhanced Exprcssion

 

 

RH-44
Rh-42

Enod12
Enod5
Enod40
Gm93

MtPRP4
Enod2

N-26
Lbs
NMH7

GS
Uricase

PEPcase

GOGAT

 

 

 

18

SECTION H. Involvement of mRNA 3' Untranslated Regions
(3' UTRs) in Control of Gene Expression and Developmental

Regulation

Eukaryotic mRNAs, once transcribed in the nucleus, are processed,
transported into the cytoplasm, bound by ribosomes, and translated. The
accumulation of a particular mRNA is determined by the cumulative effects
of its rates of synthesis and decay. Thus, post-transcriptional events such as
mRNA turnover contribute a great deal to the regulation of gene expression.
The time required for a mRNA to reach a new steady-state level, following
a change in its rate of synthesis, has been shown to be directly proportional
to its half-life (Hargrove and Schmidt, 1989). Therefore, the induction and
repression of genes encoding unstable mRNAs are more rapid than those of
genes encoding stable mRNAs. It has also been noted that protein and
mRNA turnover are often coordinately regulated (Hargrove and Schmidt,
1989). This allows rapid regulation of steady-state protein levels after
transcriptional activation of a particular gene. Control of mRNA turnover
has been extensively studied in mammalian cells (for recent reviews, see
Peltz et al., 1991; Ross, 1995, 1996; Decker and Parker, 1994), yeast (for a
review, see Caponigro and Parker, 1996), and in plants (Green, 1993;
Sullivan and Green, 1993; Abler and Green, 1996). Since in our studies, we

found that the 3’ UTR of the SrEnod2 gene is responsible for the nodule

l9

parenchyma-specific expression of this gene, this section will focus on 3'
UTRs and their involvement in the processes that control gene expression.
Of course, 3' UTRs are not the only sequences that are involved in the
control of gene expression, and therefore other sequences that are important

will also be briefly mentioned, wherever appropriate.

A. Instability Elements Localized in 3' UTRs

The half-lives of specific eukaryotic mRNAs vary over a large range. The
basis for this difference is determined, to a large extent, by specific
sequences within each mRNA. A number of elements that affect mRNA
decay rates have been identified. One general class of elements consists of
sequences that destabilize mRNAs. These instability elements have been
identified in yeast, mammalian cells and plants. Instability elements have
also been found in the 3' UTRs of many unstable mRNAs. Examples
include the yeast WAZ (Muhlrad and Parker, 1992) mRNA; mammalian c-
fos (Chen et al., 1994), c-myc (Jones and Cole, 1987), and granulocyte-
macrophage colony-stimulating factor (GM-CSF; Shaw and Kamen, 1986)
transcripts; as well as the plant SAUR (Small-Auxin-Up-RNA) transcript
(Gil and Green, 1996).

The WAZ gene encodes the mating pheromone, a-factor, which needs

to be rapidly removed from the cell after mating-type switching a-Ierrick et

20

al., 1990). Extensive molecular genetic analyses indicate that the 3' UTR
contains sequences that specify rapid mRNA decay. Moreover, these
sequences within the 3’ UTR appear to be redundant, since various
deletions and point mutations do not affect decay rate dramatically whereas
double mutations or large deletions have a pronounced effect on slowing
transcript decay (Muhlrad et al., 1992). Two repeating motifs, Y6-8CAU
(where Y=C or U) and U(A/C)AUUUAUU, have been found to be involved
in stimulating rapid mRNA deadenylation and subsequent decay.

Similar instability elements have been identified in the 3’ UTRs of the
c-fos, c-myc and GM—CSF transcripts. The mechanism by which these
instability elements increase the rate of deadenylation and subsequent
mRNA degradation is not known. However, the fact that these instability
elements within 3' UTRs are often redundant and are located close to the
poly(A) tail suggests that these sequences may provide multiple binding
sites for factors that stimulate mRNA deadenylation, which is the first rate-
limiting step in mRNA degradation of many eukaryotic mRNAs. Instability
elements have also been identified in the coding regions of the c—fos, c-myc
and many other unstable transcripts (Ross, 1995, 1996; Decker and Parker,
1994).

Other types of instability determinants have also been identified. For
examples, the stem-loop structure at the 3’ end of a cell cycle-regulated

histone mRNA has been found to be necessary and sufficient for rapid

21

mRNA decay at the end of S phase (Pandey and Marzluff, 1987). The ion-
responsive-elements (IRES) at the 3’ UTR of the human transferrin receptor
(hTR) gene have been found to be responsible for the iron-dependent
feedback regulation of the transcript (Owen and Kfihn, 1987). A long range
stem-loop structure at the 3’ UTR of mammalian insulin-like grth factor
II (IGF-II) has been identified to be an endonuclease cleavage site and a
mRNA stability determinant (Nielsen and Christiansen, 1992).

In plant cells, several different instability elements have been shown to
affect half-life of transcripts. The first one is the highly conserved DST
element, derived from the 3' UTRs of the unstable SAUR transcripts of
soybean and other plants (McClure et al., 1989; Newman et al., 1993; for a
review, see Green, 1993). It has been shown that a dimer of the DST
sequences, when inserted into the 3' UTRs of two different reporter genes is
sufficient to promote rapid degradation of the reporter transcripts in stably
transformed tobacco cells, as well as in transgenic tobacco plants (Newman
etaL,l993)

The second instability element found to destabilize plant gene
transcripts is a synthetic sequence consisting of multiple copies of a
AUUUA element (Ohme-Takagi et al., 1993), that is a repeating sequence
found in the 3’ UTRs of many unstable mammalian transcripts, including o-

fos and GM-CSF (Peltz et al., 1991). Insertion of this sequence into the 3'

22

UTRs of reporter genes stimulates rapid degradation of the reporter

transcripts in stably transformed tobacco cells (Ohme-Takagi et al., 1993).

B. Stability Elements Localized in 3’ UTRs

It is known that mRNA instability elements are responsible for rapid decay
of unstable transcripts. However, it is unclear whether stable transcripts
contain stability determinants or are stable by default. Recently, the 3 ’ UTR
of the human a2-globin gene has been found to contain erythroid cell-
specific mRNA stability elements (Weiss and Liebhaber, 1995), indicating
that at least some stable transcripts contain stability elements. A base-pair
scanning mutagenesis in the 3’ UTR of the aZ-globin gene has revealed that
three C-rich regions are required for the longevity of the aZ-globin gene in
erythroid cells. Mutations that allow the translating ribosome to read
through into the aZ-globin 3’ untranslated region target the mutant mRNAs
for accelerated turnover in erythroid cells, but not in non-erythroid cells,
indicating a cell type-specific half-life regulation of this transcript (Weiss

and Liebhaber, 1994).

23

C. Messenger RNA Intracellular Localization Signals in 3’ UTRs

Although very little is known about intracellular localization of mRNAs in
plants, a lot of information is available for mammalian systems. It has been
proposed that intracellular localization of specific maternal mRNAs is a
general mechanism for protein targeting that probably occurs in all
polarized cell types (see St Johnston, 1995). Localization of mRNAs allows
specific proteins to be synthesized in the sub-cellular location where they
are required and prevents their expression in areas where they are not.

In Drosophila melanogaster oocytes, several mRNAs have been found
to be localized to different locations, and these transcripts play a variety of
roles in the specification of the embryonic body plan (see Ding and
Lipshitz, 1993). For examples, the oskar mRNA localizes to the posterior
pole and plays a role in defining anteroposterior polarity by determining
where the pole plasm forms (Ephrussi and Lehmann, 1992). Similarly,
gurken mRNA localizes to the dorsal anterior corner of the oocyte and
defines the dorsoventral axis of the embryo, by being translated to produce
a transforming growth factor on (TGFoc)-like protein (Neuman-Silberberg
and Schiipbach, 1993). On the other hand, bicoid and nanos mRNAs are
anchored at the anterior and posterior poles, respectively, and act as
localized sources of diffusible proteins that spread toward the center of the

embryo. The resulting opposite protein gradients specify the pattern and

24

polarity of the embryo (St Johnston and Nusslein-Volhard, 1992). In
Xenopus laevis oocytes, like in its Drosophila counterpart, maternal
messengers are also localized to different sites (Kloc et al., 1993).

A common feature of all the localized mRNAs identified so far is that
the cis-acting sequences required for localization reside in the 3' UTRs of
transcripts and are typically long. One of the best characterized localization
signal derives from the bicoid mRNA. It is 625 nt long and located within
the bicoid 3' UTR, of which a 53 base sequence, called the BLEl element, is
required and sufficient to direct localization of the bicoid mRNA to the
anterior of the oocyte (Macdonald et al., 1993). A 400 nt region overlapping
the BLEl elements is required for the anchoring of the mRNA in the
anterior cytoplasm, once released there. The latter step requires an
association of the 400 nt sequence with the staufen protein to prevent
diffusion of the RNA (Ferrandon et al., 1994). Therefore, the bicoid
localization signal contains at least two distinct, but overlapping, sequence
elements that mediate different steps in its localization.

Interestingly, the same staufen protein is also required for the
translocation of oskar mRNA from anterior to posterior of the oocyte. The
localization of the staufen protein switches from the posterior pole to the
anterior pole soon after fertilization, thus facilitating translocation of two
differently localized transcripts (Ferrandon et al., 1994). The Staufen

protein contains five copies of a dsRNA-binding motif and binds to dsRNA

25

in vitro (St Johnston et al., 1992). Since the binding is not sequence-specific
in vitro, it is possible that staufen recognizes the secondary structure of
bicoid and oskar RNAs, rather than their sequence (St Johnston et al.,
1992)

Several other mechanisms responsible for RNA localization within a
cell have been identified. One of them uses spatial control of mRNA
stability. This is a simple but inefficient way to localize RNA. The
localization of hsp83 RNA to the posterior pole of the Drosophila embryo
involves a localized protection from mRNA degradation in the posterior
pole plasm (Ding et al., 1993). On the other hand, the localization of
hunchback RNA in the anterior involves a localized destabilization in the
posterior due to a translational repression of the hunchbach RNA by nanos

(Curtis et al., 1995).

D. Messenger RNA 3’-End Formation

In eukaryotic cells, mRNA 3’-end formation is an important process in the
regulation of gene expression. This process includes cleavage of transcripts
and addition of a tract of poly(A). In general, polyadenylated RNAs are
more stable than their unpolyadenylated counterparts. The mechanism that

governs the 3’-end formation of mammalian mRNAs has been well

characterized (Proudfoot, 1991; Wahle et al., 1992). The hexanucleotide

26

AAUAAA, the highly conserved poly(A) signal, is located 10—30 nt
upstream of the poly(A) site. In addition to the poly(A) signal, a less
conserved downstream GU-rich sequence is also required for efficient 3 ’-
end formation. At least four protein complexes are involved in the 3’-end
processing. The cleavage polyadenylation-specific factor (CPSF) recognizes
the poly(A) signal, while the cleavage stimulation factor (CstF) recognizes
the downstream GU-rich sequence. The cooperative binding of these two
factors to the precursor mRNA brings in cleavage factors (Cfs) and poly(A)
polymerase (PAP) for the cleavage and polyadenylation of the precursor
mRNA, respectively.

The mechanism that controls the 3’-end formation of transcripts
encoded by plant nuclear genes has started to be elucidated (for reviews, see
Hunt, 1994; Wu et al., 1995). It is apparent that the poly(A) signal is not
conserved near poly(A) sites in many plant nuclear genes. A systematic
search for the AAUAAA signal near poly(A) sites indicates that about 1/3
of genes surveyed contain the AAUAAA sequence, about 1/2 of genes
contain 4-5 of 6 base pair matches for this sequence and about 15% of genes
do not have any AAUAAA-like sequence (Joshi, 1987). Additionally, the 3’
untranslated regions (3’UTRs) of most plant nuclear genes tend to contain
multiple AATAAA-like and GT-rich sequences.

Unlike their mammalian counterparts that require downstream GU-rich

sequence for efficient 3’-end processing, most plant mRNAs require less

27

conserved, upstream sequences (Hunt, 1994). Removal of these sequences
results in a drastic decrease in polyadenylation. In some plant mRNAs,
downstream regions are required for efficient polyadenylation. These
include rch and ocs mRNAs (Hunt and MacDonald, 1989; Macdonald et
al., 1991). Using a functional analysis, An et a1. (1989), have demonstrated
that the 3' flanking region of the potato wound-inducible proteinase
inhibitor 11 gene that contains the poly(A) signal and a downstream GT—rich

sequence is essential for wound-inducible reporter gene expression.

E. Polyadenylation and Translational Control of Gene Expression

Controlling gene expression by regulating translation allows a cell to
respond to environmental cues more quickly than de novo transcription
permits. Translation can be regulated by modulating several factors,
including translation initiation and the length of the poly(A) tail. Since
ribosomal binding is most sensitive to secondary structures in the 5' UTR,
the sequence of the 5' UTR determines the intrinsic rate of translation
initiation of an mRNA. However, in vivo and in vitro evidence support the
idea that the poly(A) tail stimulates the rate of translational initiation of a
mRNA. Recently a yeast poly(A) binding protein (Pablp)- poly(A) complex
has been found to recruit the 40S ribosomal subunit to the mRNA,

indicating that the 5' and 3' ends of a mRNA physically interact (Tarun and

28

Sachs, 1995). Recently, poly(A) tails of most mammalian mRNAs have
been found to be modulated in cytoplasm by cytoplasmic polyadenylation
machinery (Simon et al., 1992). Cytoplasmic polyadenylation requires two
sequence elements within 3' UTRs: a U-rich cytoplasmic polyadenylation
element (CPE) and the nuclear polyadenylation sequence AAUAAA
(Wormington, 1993). Precise spacing of a CPE element relative to the
AAUAAA sequence has been found to be important for developmental
control of polyadenylation (Simon et al., 1992). Other specific translational
regulatory sequences distant from the CPEs have been identified in the 3'
UTRs of a number of developmentally regulatory genes. One of them is the
10 random repeats of a pyrimidine-rich motif (R sequence) located in the 3'
UTR of the Lox gene, which encodes the 15-lipoxygenase enzyme required
for the breakdown of internal membranes in mature reticulocytes (Ostareck-
Lederer et al., 1994). A 48 KDa protein has been identified to specifically
bind to these repeats and this binding is necessary and sufficient for
translational repression of a heterologous mRNA containing the R

sequences in an in vitro assay (Ostareck-Lederer et al., 1994).

F. A Regulatory Role for 3' UTRs in Growth and Differentiation

Using a genetic complementation approach, three genes, troponin I,

.tropomyosin, and a-cardiac actin, have been identified that activate muscle-

29

specific promoters in a differentiation-deficient mutant (NMU 2) (Rastinej ad
and Blau, 1993). This activity was mapped to the 3' UTRs of these genes
and was found not to be limited to myogenic cells, since the 3' UTRs also
promoted differentiation of wild type muscle cells, and suppressed
proliferation of fibroblasts (Rastinejad and Blau, 1993). The mechanism by
which these 3' UTRs promote differentiation and inhibit growth is not
known. However, it is speculated that 3' UTRs of certain differentiation-
specific RNAs are trans-acting regulators that modulate cell division and
therefore differentiation. The phenomenon that 3' UTRs modulate growth
and differentiation has been further exemplified by the observation that the
3' UTR of tropomyosin can efficiently suppress mouse
rhabdomyosarcomas, induced by transplanting the NMU2 cell line into

muscle cells of adult mouse hindlimbs (Rastinejad et al., 1993).

G. SUMMARY

Symbiotic nitrogen fixation takes place in the infected cells of legume
nodules. This process requires a large input of energy and limitation of the
oxygen cOncentration, presenting the oxygen paradox. Legume nodules
have developed strategies, such as formation of diffusion barriers,
production of a large amount of the oxygen carrier (leghemoglobin), and

active respiration of bacteroids. A further detailed understanding of how

30

these various processes are coordinated during nitrogen fixation will be
necessary before one could even contemplate transferring the symbiotic
nitrogen-fixation system to non-nodulated agronomically important crop
plants, such as rice (dc Bruijn et al., 1995).

Nodule organogenesis is triggered by Nod factors. Nod factors are
hypothesized as plant growth regulators, since they cause root hair
deformation and stimulate cell divisions. Nodule organogenesis provides a
model to study signal molecules, their perception and action. Nodules
provide a rich source of specifically induced plant and bacterial genes to
study gene regulation. Some of these genes are regulated by Nod factors and
plant hormones. They may prove to serve as excellent tools to study the
corresponding signal transduction pathways and this, in turn, will help to
understand how nodule organogenesis utilizes and integrates these various
pathways.-

Regulation of gene expression occurs at different levels. Post-
transcriptional regulation is clearly very important for modulating gene
expression. It allows a cell to rapidly adjust gene expression to
accommodate developmental and environmental cues. This type of
regulation occurs both in the nucleus and cytoplasm. Steps involved include
5' capping and 3' polyadenylation in the nucleus, transport to cytoplasm,
poly(A) tail shortening and lengthening in the cytoplasm, degradation and

stabilization, intracellular localization, and translation. Each step involves

31

the recognition of cis-elements and their corresponding trans-acting factors.
Some of these steps are connected and coordinately regulated. 3'
untranslated regions of mRNAs have been implicated in various processes
of gene regulation and 3' UTRs of some structural genes have been found to
exert profound effects on grth and differentiation by acting as trans-
acting regulators (riboregulators). In this dissertation research (chapter 2), I
have identified the 3’ UTR of the early nodulin SrEnod2 gene as the
mediator for the tissue-specific expression. To our knowledge, this type of
regulation is the first example among plant nuclear genes clearly

demonstrating that the 3 ’ UTR regulates tissue-specific expression.

32
LIST OF REFERENCES

Abler, M.L., and Green, PJ. (1996). Control of mRNA stability in higher
plants. (in press)

Allen, T., Raja, S., and Dunn, K., (1991). Cells expressing Enod2 show
differential spatial organization during the development of alfalfa root
nodules. Mol. Plant-Microbe Interact. 2, 139-146.

An, G., Mitra, A., Choi, H.K., Costa, M.A., An, K., Thornburg, R.W.,
and Ryan, CA. (1989). Functional analysis of the 3’ control region of

the potato wound-inducible proteinase inhibitor II gene. Plant Cell 1,
1 1 5-122.

Appleby, CA. (1984). Leghemoglobin and Rhizobium respiration. Annu.
Rev. Plant Physiol. 35, 443-478.

Ardourel, M., Demont, N., Debelle, F., Maillet, F., dc Billy, F., Prome,
J.C., Denarie, J., and Truchet, G. (1994). Rhizobium meliloti
lipooligosaccharide nodulation factors: Different structural requirements
for bacteria entry into target root hair cells and induction of plant
symbiotic developmental responses. Plant Cell 6, 1357-1374.

Arora, N., Skoog, F., and Allen, O.N. (1959). Kinetin-induced
pseudonodules on tobacco roots. Am J. Bot. 46, 610-613.

Asad, S., Fang, Y., Wycofl', KL, and Hirsch, A.M. (1994). Isolation and
characterization of cDNA and genomic clones of MsENOD40:

Transcripts are detected in meristematic cells of alfalfa. Protoplasma 183,
10-23.

Atkins, GA. (1987). Metabolism and translocation of fixed nitrogen in the
nodulated legume. Plant Soil 100, 157- 1 69.

Bauer, W.D. (1981). Infection of legumes by rhizobia. Annu. Rev. Plant
Physiol. 32, 407-449.

33

Brewin, NJ. (1991). Development of the legume root nodule. Annu. Rev.
Cell Biol. 7, 191-226.

Caponigro, G., and Parker, R. (1996). Mechanisms and control of mRNA
turnover in Saccharomyces cerevisiae. Microbiol. Rev. 60, 233-249.

Carlson, R.W., Price, N.P.J., and Stacey, G. (1995). The biosynthesis of
rhizobial lipo-oligosaccharide nodulation signal molecules. Mol. Plant-
Microbe Interact. 7, 684-695.

Chen, C.-Y., Chen, T.-M., and Shyu, A.-B. (1994). Interplay of two
functionally and structurally distinct domains of the c-fos AU-rich
element specifies its mRNA-destabilizing function. Mol. Cell. Biol. 14,
4 1 6-426.

Cooper, J.B., and Long, SR. (1994). Morphogenetic rescue of Rhizobium
meliloti nodulation mutants by trans-zeatin secretion. Plant Cell 6, 215-
225.

Crespi, M.D., Jurkevitch, E., Poiret, M., d’Aubenton-Carafa, Y.,
Petrovics, G., Kondorosi, E., and Kondorosi, A. (1994). enod40, a
gene expressed during nodule organogenesis, codes for a non-translatable

RNA involved in plant growth. EMBO J. 13, 5099-5112.

Curtis, D., Apfeld, J., and Lehmann, R. (1995). Nanos is an
evolutionarily conserved organizer of anterior-posterior polarity.
Development 121, 1899-1910.

de Bruijn, F.J., Szabados, L., and Schell, J. (1990). Chimeric genes and
transgenic plants are used to study the regulation of genes involved in
symbiotic plant-microbe interactions. Dev. Genet. 11, 182-196.

de Bruijn, F.J., and Schell, J. (1992). Regulation of plant genes
specifically induced in developing and mature nitrogen-fixing nodules:
cis-Acting elements and trans-acting factors. In Control of Plant Gene
Expression, D.P.S. Verma, ed. (Boca Raton, FL: CRC Press), pp. 241-
258.

34

de Bruijn, F.J., Jing, Y, and Dazzo, EB. (1995). Potential and pitfalls of
trying to extend symbiotic interactions of nitrogen-fixing organisms to
presently non-nodulated plants, such as rice. Plant and Soil 174, 225-240.

Decker, C.J., and Parker, R. (1994). Mechanisms of mRNA degradation
in eukaryotes. Trends Biochem. Sci. 19, 336-340.

Dehio, C., and de Bruijn, FJ. (1992). The early nodulin gene SrEnod2
fi'om Sesbania rostrata is inducible by cytokinin. Plant J. 2, 117-128.

Denarie, J., and Cullimore, J. (1993). Lipo-oligosaccharide nodulation
factors: A minireview new class of signaling molecules mediating
recognition and morphogenesis. Cell 74, 951-954.

Dickstein, R.T., Bisseling, T., Reinhold, V.N. and Ausubel, EM. (1988).
Expression of nodule-specific genes in alfalfa root nodules blocked at an
early stage of nodule development. Genes Dev. 2, 677-678.

Ding, D., and Lipshitz, H.D. (1993). Localized RNAs and their functions.
Bioessays 15, 651-658.

Ding, D., Parkhurst, S.M., Halsell, SR, and Lipshitz, H.D. (1993).
Dynamic hsp83 RNA localization during Drosophila oogenesis and
embryogenesis. Mol. Cell. Biol. 13, 3773-3781.

Dixon, R., Kennedy, C., Kondorosi, A., Krishnapillai, V., and Merrick,
M. (1977). Complementation analysis of Klebsiella pneumoniae mutants
defective in nitrogen fixation. Mol. Gen. Genet. 157, 189-198.

Ehrhardt, D.W., Atkinson, E.M., and Long, SR. (1992). Depolarization
of alfalfa root hair membrane potential by Rhizobium meliloti Nod
factors. Science 256, 998-1000.

Ehrhardt, D.W., Wais, R., and Long, SR. (1996). Calcium spiking in
plant root hairs responding to Rhizobium nodulation signals. Cell 85,
673 -68 1 .

35

Ephrussi, A., and Lehmann, R. (1992). Induction of germ cell formation
by oskar. Nature 358, 387-392.

Ferrandon, D., Elphick, L., Nusslein-Volhard, C., and St Johnston, D.
(1994). Staufen protein associates with the 3' UTR of bicoid mRNA to

form particles that move in a microtubule-dependent manner. Cell 79,
122 1- 1 232.

Fisher, RE, and Long, SR. (1992). Rhizobium-plant signal exchange.
Nature 357, 655-660.

Fortin, M.G., Morrison, N.A., and Verma, D.P.S. (1987). Nodulin-26, a
peribacteroid membrane nodulin is expressed independently of the

development of peribacteroid compartment. Nucleic Acids Res. 15, 813-
824.

Franssen, H.J., Nap, J.-P., Gloudemans, T., Stickema, W., van Dam,
H., Govers, F., Louweres, J., van Kammen, A., and Bisseling, T.
(1987). Characterization of cDNA for nodulin-75 of soybean: a gene
product involved in early stages of root nodule development. Proc. Natl.
Acad. Sci. USA 84, 4495-4499.

Gil, P., and Green, P.J. (1996). Multiple regions of the Arabidopsis
SA UR- AC1 gene control transcript abundance: the 3’ untranslated region
functions as an mRNA instability determinant. EMBO J. 15, 1678-1686.

Gloudemans, T., and Bisseling, T. (1989). Plant gene expression in early
stages of Rhizobium-legume symbiosis. Plant Sci. 65, 1-4.

Govers, F., Franssen, H.J., Pieterse, C., Wilmer, J., and Bisseling, T.
(1990). Function and regulation of the early nodulin gene ENODZ. In
Genetic Engineering of Crop Plants, G.W. Lycett and D.W. Grierson,
eds (London: Butterworths), pp. 259-269.

Green, P.J. (1993). Control of mRNA stability in higher plants. Plant
Physiol. 102, 1065-1070.

36

Hargrove, J.L., and Schmidt, EH. (1989). The role of mRNA and protein
stability in gene expression. F ASEB J. 3, 2360-2370.

Heard, J., and Dunn, K. (1995). Symbiotic induction of a MADS-box
gene during development of alfalfa root nodules. Proc. Natl. Acad. Sci.
USA 92, 5273-5277.

Heidstra, R., Geurts, R., Franssen, H., Spanik, H.P., van Kammen, A.,
and Bisseling, T. (1994). Root hair deformation activity of nodulation
factors and their fate on Vicia sativa. Plant Physiol. 105, 787-797.

Herrick, D., Parker, R., and Jacobson, A. (1990). Identification and
comparison of stable and unstable mRNAs in Saccharomyces cerevisiae.
Mol. Cell. Biol. 10, 2269-2284.

Hirsch, A.M., Bhuvaneswari, T.V., Torrey, J .G., and Bisseling, T.
(1989). Early nodulin genes are induced in alfalfa root outgrowths
elicited by auxin transport inhibitors. Proc. Natl. Acad. Sci. USA 86,
1244-1248.

Hirsch, A.M. (1992). Developmental biology of legume nodulation. New
Phytol. 122, 211-237.

Hirsch, A.M., Assad, S., Fang, Y., Wycoff, K., and Loebler, M. (1993).
Molecular interactions during nodule development. In New Horizons in
Nitrogen Fixation, R. Palacios, J. Moira and WE. Newton, eds
(Dordrecht: Kluwer Academic Publishers), pp. 291-296.

Hunt, A.G., and MacDonald, M.H. (1989). Deletion analysis of the
polyadenylation signal for a pea ribulose- l ,5-bisphosphate carboxylase
small-subunit gene. Plant Mol. Biol. 13, 125-138.

Hunt, A.G. (1994). Messenger RNA 3’ end formation in plants. Annu. Rev.
Plant Physiol. Plant Mol. Biol. 45, 47-60.

Jensen, E.Q., Stougaard, J., Jorgensen, J.E., Sandal, N., and de Bruijn,
FJ. (1988). Regulation of nodule-specific plant genes. In Nitrogen

37

Fixation: Hundred Years After, H., Bothe, F.J., de Bruijn, and WE.
Newton, eds (Stuttgart: Gustav Fisher), pp. 605-609.

Jones, T.R., and Cole, MD. (1987). Rapid cytoplasmic turnover of c-myc

mRNA: requirement of the 3’ untranslated sequences. Mol. Cell. Biol. 7,
45 13-4521 .

Joshi, CF. (1987). Putative polyadenylation signals in nuclear genes of
higher plants: a compilation and analysis. Nucleic Acids Res. 15, 9627-
9640.

Kij ne, J .W. (1992). The Rhizobium infection process. In Biological
Nitrogen Fixation, G., Stacey, R.H., Burris, and H.J., Evans, eds (New
York: Chapman and Hall), pp. 349-398.

Kloc, M., Spohr, G., and Etkin, LB. (1993). Translocation of repetitive
RNA sequences with the germ plasm in Xenopus oocytes. Science 262,
1 712-1 714.

Kouchi, H., and Hata, S. (1993). Isolation and characterization of novel
cDNAs representing genes expressed at early stages of soybean nodule
development. Mol. Gen. Genet. 238, 106-1 19.

Krause, A., Sigrist, C.J., Dehning, 1., Sommer, H., and Broughton, W.J.
(1994). Accumulation of transcripts encoding a lipid transfer-like protein
during deformation of nodulation-competent Vigna unguiculata root
hairs.Mol. Plant Microbe Interact. 7, 41 1-418.

Legocki, RR, and Verma, D.P.S. (1980). Identification of “nodule-
specific” host proteins (nodulins) involved in the development of
rhizobium-legume symbiosis. Cell 20, 153-163.

Lerouge, P., Roche, P., Faucher, C., Maillet, F., Truchet, G., Prome,
J.C.,. and Denarie, J. (1990). Symbiotic host-specificity of Rhizobium
meliloti is determined by a sulfated and acylated glucosamine
oligosaccharide signal. Nature 344, 781-784.

38

Libbenga, K.R., Van Iren, F., Bogers, R.J., and Schraag-Lamers, M.F.
(1973).The role of hormones and gradients in the initiation of cortex

proliferation and nodule formation in Pisum sativum L. Planta 114, 29-
39.

Libbenga, K.R., and Bogers, RJ. (1974). Root-nodule morphogenesis. In
The Biology of Nitrogen Fixation, A., Quispel, ed (Amsterdam: North-
Holland Publishing Co.). pp. 430-472.

Long, SR. (1989). Rhizobium-legume nodulation. Life together in the
underground. Cell 56, 203-214.

MacDonald, M.H., Mogen, B.D., and Hunt, A.G. (1991).
Characterization of the polyadenylation signal from the T-DNA-encoded
octopine synthase gene. Nucleic Acids Res. 19, 5575-5581.]

Macdonald, P.M., Kerr, K., Smith, J.L., and Leask, A. (1993). RNA
regulatory element BLEl directs the early steps of bicoid mRNA

localization. Development 1 l 8, 1 23 3- 1 243.

Matvienko, M., van de Sande, K., Yang, W.C., van Kammen, A.,
Bisseling, T., Franssen, H. (1994). Comparison of soybean and pea
ENOD40 cDNA clones representing genes expressed during both early
and late stages of nodule development. Plant Mol. Biol. 26, 487-493.

McClure, B.A., Hagen, G., Brown, C.S., Gee, M.A., Guifoyle, T.J.
(1989). Transcription, organization, and sequence of an auxin-regulated
gene cluster in soybean. Plant Cell 1, 229-239.

Miao, G.-H., and Verma, D.P.S. (1993). Soybean nodulin-26 gene
encoding a channel protein is expressed only in the infected cells of
nodules and is regulated differently in roots of homologous and
heterologous plants. Plant Cell 5, 781-794.

Miflin, B.J., and Lea, P.J. (1980). Ammonia assimilation. In The
Biochemistry of Plants: A Comprehensive Treaties, Vol 5, B.J., Miflin,
ed (New York: Academic), pp. 169-202.

39

Moerman, M., Nap, J.P., Govers, F., Schilperoort, R., and van
Kammen, A. (1987). Rhizobium nod genes are involved in the induction

of two early nodulin genes in Vicia sativa root nodules. Plant Mol. Biol.
9, 1 71 - 1 79.

Muhlrad, D., and Parker, R. (1992). Mutations affecting stability and
deadenylation of the yeast WAZ transcript. Genes Dev. 6, 2100-2111.

Mylona, P., Pawlowski, K., and Bisseling, T. (1995). Symbiotic Nitrogen
Fixation. Plant Cell 7, 869-885.

Nielsen, F.C., and Christiansen, J. (1992). Endonucleolysis in the
turnover of insulin-like growth factor II mRNA. J. Biol. Chem. 267,
19404-19411.

Nap, J.-P., and Bisseling, T. (1990). Developmental biology of a plant-
prokaryote symbiosis: the legume root nodule. Science 250, 948-954.

Neuman-Silberberg, F., and Schiipbach, T. (1993). The Drosophila
dorsoventral patterning gene gurken produces a dorsally localized RNA
and encodes a TGFa-like protein. Cell 75, 165-174.

Newcomb, W. (1981). Nodule morphogenesis and differentiation. In
Biology of Rhizobiaceae, K.L., Giles and A.G., Atherly, eds (New York:
Academic Press), pp. 247-297.

Newman, T.C., Ohme-Takagi, M., Taylor, C.B., and Green, P.J. (1993).
DST sequences, highly conserved among plant SA UR genes, target
reporter transcripts for rapid degradation in tobacco. Plant Cell 5, 701-
714.

Ohme—Takagi, M., Taylor, C.B., Newman, T.C., and Green, P.J. (1993).
The effect of sequences with high AU content on mRNA stability in
tobacco. Proc. Natl. Acad. Sci. USA 90, 1181 1-1 1815.

Ostareck-Lederer, A., Ostareck, D.H., Standart, N., and Thiele, B.J.
(1994). Translation of 15-lipoxygenase mRNA is inhibited by a protein

40

that binds to a repeated sequences in the 3' untranslated region. EMBO J.
13, 1476-1481.

Owen, D., and Kiihn, LC. (1987). Noncoding 3’ sequences of the
transferrin receptor gene are required for mRNA regulation by iron.
EMBO J. 6, 1287-1293.

Pandey, N.B., and Marzluff, W.F. (1987). The stem-loop structure at the
3’ end of histone mRNA is necessary and sufficient for regulation of
histone mRNA stability. Mol. Cell. Biol. 7, 4557-4559.

Peltz, S.W., Brewer, G., Bernstein, P., Hart, P.A., and Ross, J. (1991).
Regulation of mRNA turnover in eukaryotic cells. Crit. Rev. Euk. Gene
Exp. 1, 99-126.

Peters, N .K., Frost, J.W., and Long, S.R. (1986). A plant flavone,
luteolin, induces expression of Rhizobium meliloti nodulation genes.
Science 233, 977-980.

Proudfoot, NJ. (1991). Poly(A) signals. Cell 64, 671-674.

Ramlov, K.R., Laursen, N.B., Stougaard, J., and Marcker, K.A. (1993).
Site-directed mutagenesis of the organ-specific element in the soybean

leghemoglobin le3 gene promoter. Plant J. 4, 577-580.

Rastinejad, F., and Blau, H.M. (1993). Genetic complementation reveals a

novel regulatory role for 3' untranslated regions in growth and
differentiation. Cell 72, 903-917.

Rastinejad, F., Conboy, M.J., Rando, T.A., and Blau, H.M. (1993).
Tumor suppression by RNA from the 3 ’ untranslated region of alpha-
tropomyosin. Cell 75, 1 107-1 1 17.

Ross, J. (1995). mRNA stability in mammalian cells. Microbiol. Rev. 59,
423-450.

Ross, J. (1996). Control of messenger RNA stability in higher eukaryotes.
TIG 12,171-175.

41

Ruvkun, G.B., Sundaresan, V., and Ausubel, EM. (1982). Directed
transposon Tn5 mutagenesis and complementation analysis of Rhizobium
meliloti symbiotic nitrogen fixation genes. Cell 29, 551-559.

Sanchez, F., Quinto, C., Vazquez, M., De las Penas, A., Cevallos, M.A.
(1988). The symbiotic association between Phaseolus vulgaris and
Rhizobium phaseoli. In Molecular Genetics of Plant-Microbe
Interactions, R., Palacios, and D.P.S. Verma, eds (St. Paul, MN: APS
Press), pp. 370-375.

Sanchez, F., Padilla, J.E., Perez, H., and Lara, M. (1991). Control of
nodulin genes in root-nodule development and metabolism. Annu. Rev.
Plant Physiol. Plant Mol. Biol. 42, 507-528.

Shaw, G., and Kamen, R. (1986). A conserved AU sequence from the 3'
untranslated region of GM-CSF mRNA mediates selective mRNA
degradation. Cell 46, 659-667.

Scheres, B., van de Wiel, C., Zalensky, a., Horvath, b., Spaink, H.P.,
van Eck, H., Zwartkruis, F., Walters, Aa.-M., Gloudemans, T., van
kammen, A., and Bisseling, T. (1990a). The ENODIZ gene product is

involved in the infection process during pea—Rhizobium interaction. Cell
60, 281-294.

Scheres, B., van Engelen, F., van der Knaap, E., van de Wiel, C., van
kammen, A., and Bisseling, T. (1990b). Sequential induction of nodulin
gene expression in the developing pea nodule. Plant Cell 2, 687-7 00.

Schubert, KR. (1986). Products of biological nitrogen fixation in higher
plants: Synthesis, transport, and metabolism. Annu. Rev. Plant Physiol.
37, 539-574.

Silver, D., Pinaev, A., Chen, R, and de Bruijn, FJ. (1996). Post-
transcriptional regulation of the Sesbanz'a rostrata early nodulin gene
SrEnod2 by cytokinin. Plant Physiol. 112, 559-567.

42

Simon, R., Tassan, J.-P., and Richter, J.D. (1992). Translational control
by poly(A) elongation in Xenopus development: differential repression

and enhancement by a novel cytoplasmic polyadenylation element.
Genes Dev. 6, 2580-2591.

Smit, G., van Brussel, T.A.N., and Kijne, J.W. (1993). Inactivation of a
root factor by ineffective Rhizobium: A molecular key to autoregulation
of nodulation in Pisum sativum. In New Horizons in Nitrogen Fixation,
R. Palacios, J. Mora, and WE. Newton, eds (Dordrecht: Kluwer
Academic Publishers), p. 371.

Smit, G., de Koster, C.C., Schripsema, J., Spaink, H.P., van Brussel,
A.A., and Kijne, J.W. (1995). Uridine, a cell division factor in pea roots.
Plant Mol. Biol. 29, 869-873.

St Johnston, D., Brown, N.H., Gall, J.G., and Jantsch, M. (1992). A
conserved double-stranded RNA-binding domain. Proc. Natl. Acad. Sci.
USA 89, 10979-10983.

St Johnston, D., and N usslein-Volhard, C. (1992). The origin of pattern
and polarity in the Drosophila embryo. Cell 68, 201-219.

St Johnston, D. (1995). The intracellular localization of messenger RNAs.
Cell 81, 161-170.

Stougaard, J., Sandal, N.N., Gron, A., Kiihle, A., and Marcker, K.A.
(1987). 5’-Analysis of the soybean leghemoglobin lbc3 gene: Regulatory

elements required for promoter activity and organ specificity. EMBO J. 6,
3565-3569.

Strittmatter, g., Chia, T.-F., Trinh, T.H., Katagiri, F., Kuhlemeier, C.,
and Chua, NH. (1989). Characterization of nodule-specific cDNA
clones from Sesbania rostrata and expression of the corresponding genes

during initial stages of stem nodules and root nodules formation. Mol.
Plant-Microbe Interact. 2, 122-127.

43

Sullivan, M.L., and Green, P.J. (1993). Post-transcriptional regulation of
nuclear-encoded genes in higher plants: the roles of mRNA stability and
translation. Plant Mol. Biol. 23, 1091-1104.

Szabados, L., Ratet, P., Grunenberg, B., and de Bruijn, FJ. (1990).
Functional analysis of the Sesbania rostrata leghemoglobin glb3 gene 5'-

upstream region in transgenic Lotus corniculatus and Nicotiana tobacum
plants. Plant Cell 2, 973-986.

Szczyglowski, K., and Legocki, A.B. (1990). Isolation and nucleotide

sequence of cDNA clone encoding nodule-specific (hydroxy) proline-
rich protein LEnodZ from yellow lupin. Plant Mol. Biol. 15, 361-363.

Szczyglowski, K., Szabados, L., Fujimoto, S.F., Silver, D., and de
Bruijn, FJ. (1994). Site-specific mutagenesis of the nodule-infected cell
expression (NICE) element and the AT-rich element ATRE-BSZ* of the
Sesbania rostrata leghemoglobin glb3 promoter. Plant Cell 6, 317-332.

Tarun, S.Z., and Sachs, A.B. (1995). A common function for mRNA 5'
and 3' ends in translation initiation in yeast. Genes Dev. 9, 2997-3007.

Thimann, K.V. (1936). On the physiology of the formation of nodules on
legume roots. Proc. Natl. Acad. Sci. USA 22, 511-515.

Tjepkema, J.D., and Yocum, GS. (1974). Measurement of oxygen partial
pressure within soybean nodules by oxygen microelectrodes. Planta 119,
3 5 1-3 60.

Truchet, G., Roche, P., Lerouge, P., Vasse, J., Camut, S., de Billy, F.,
Prome, J.C. and Denaire, J. (1991). Sulphated lipooligosaccharide
signals from Rhizobium meliloti elicit root nodule organogenesis in

alfalfa. Nature 351, 670-673.

van Brussel, A.A.N., Bakhuizen, R., van Spronsen, F.C., Spaink, H.P.,
Tak, T., Lugtenberg, B.J.J., and Kijne, J.W. (1992). Induction of pre-
infection thread structures in the leguminous host plant by mitogenic
lipo-oligosaccharides of Rhizobium. Science 257, 70-72.

44

van de Sande, K., Pawlowski, K., Czaja. 1., Wieneke, U., Schell, J.,
Schmidt, J., Walden, R., Matvienko, M., Wellink, J., van Kammen,
A., Franssen, H., and Bisseling, T. (1996). Modification of
phytohormone response by a peptide encoded by Enod40 of legumes and
a nonlegume. Science 273, 370-373.

van de Wiel, C., Scheres, B., Franssen, H., van Lierop, M.J., van
Lammeren, A., van Kammen, A., and Bisseling, T. (1990a). The early
nodulin transcript ENODZ is located in the nodule parenchyma (inner
cortex) of pea and soybean root nodules. EMBO J. 9, 1-7.

van de Wiel, C., Norris, H.J., Bochenek, B., Dickstein, R., Bisseling, T.,
and Hirsch, M.A. (1990b). Nodulin gene expression and ENOD2

localization in effective, nitrogen-fixing and ineffective, bacteria-free
nodules of alfalfa. Plant Cell 2, 1009-1017.

van Kammen, A. (1984). Suggested nomenclature for plant genes involved
in nodulation and symbiosis. Plant Mol. Biol. Rep. 2, 43-45.

Verma, D.P.S. and Delauney, AJ. (1988). Root nodule symbiosis:
nodulins and nodulin genes. In Temporal and Spatial Regulation of Plant
Genes, R.B., Goldberg, and D.P.S., Verma, eds (New York: Springer-
Verlag), pp. 169-199.

Verma, D.P.S. (1992). Signals in root nodule organogenesis and
endocytosis of Rhizobium. Plant Cell 4, 373-3 82.

Vijn, I., das Neves, L., van Kammen, A., Franssen, H., and Bisseling, T.
(1993). Nod factors and nodulation in plants. Science 260, 1764-1765.

Wahle, E., Keller, W. (1992). The biochemistry of 3’-end cleavage and
polyadenylation of messenger RNA precursors. Annu. Rev. Biochem. 61,
419-440.

Weaver, C.B., Shower, N.H., Louis, CE, and Roberts, D.M. (1994).
Nodulin-26, a nodule specific symbiosome membrane protein from
soybean, is an ion channel. J. Biol. Chem. 269, 17858-17862.

45

Weiss, I.M., and Liebhaber, S.A. (1995). Erythroid cell-specific mRNA
stability elements in the a2-globin 3’ nontranslated region. Mol. Cell.
Biol. 15, 2457-2465.

Wilson, R.C., Long, F., Maruoka, E.M., and Cooper, J.B. (1994). A
new proline-rich early nodulin from Medicago truncatula is highly
expressed in nodule meristematic cells. Plant Cell 6, 1265-1275.

Witty, J.F., Minchin, F.R., Skot, L., and Sheehy, J.E. (1986). Nitrogen
fixation and oxygen in legume nodules. Oxford Surv. Plant Mol. Cell
Biol. 3, 275-314.

Wormington, M. (1993). Poly(A) and translation: development control.
Curr. Opin. Cell Biol. 5, 950-954.

Wu, L., Ueda, T., and Messing, J. (1995). The formation of mRNA 3 ’-
ends in plants. Plant J. 8, 323-329.

Yang, W.-C., de Blank, C., Meskiene, 1., Hirt, H., Bakker, J., van
Kammen, A., Franssen, H., and Bisseling, T. (1994). Rhizobium Nod
factors reactivate the cell cycle during infection and nodule primordium

formation, but the cycle is only completed in primordium formation.
Plant Cell 6, 1415-1426.

CHAPTER 2

THE NODULE PARENCHYMA-SPECIFIC EXPRESSION OF THE
SESBANIA ROST RA TA EARLY NODULIN GENE SrENODZ IS
MEDIATED BY ITS 3' UNTRANSLATED REGION (3’UTR)

This section has been submitted to the Plant Cell for publication.

Reference: Chen, R., Silver, D., and de Bruijn, F .J . (1996). The nodule
parenchyma-specific expression of the Sesbania rostrata early nodulin gene
A SrEnod2 is mediated by its 3' untranslated region (3’UTR).

46

47

ABSTRACT

The early nodulin Enod2 gene encodes a putative hydroxyproline-rich cell
wall protein, and is expressed exclusively in the nodule parenchyma cell
layer. The latter suggests that the Enod2 protein may contribute to the
special morphological features of the nodule parenchyma and to the creation
of an oxygen diffusion barrier (Nap and Bisseling, 1990, Science 250, 948-
954). We have shown that the Enod2 gene of the stem-nodulating legume
Sesbania rostrata (SrEnod2) can be specifically induced in roots by the
plant hormone cytokinin (Dehio and de Bruijn, 1992, Plant J. 2, 117-128),
and that this induction occurs at a posttranscriptional level (Silver et al.,
1996, Plant Physiol. 112, 559-567). Here, we have characterized cis-
determinant(s) in the SrEnod2 locus responsible for nodule parenchyma-
specific expression and report that the 3 ’ untranslated region (3' UTR) of the
SrEnod2 gene is both required and sufficient for directing chimeric reporter
gene expression in the nodule parenchyma of transgenic Lotus corniculatus
plants. By carrying out a detailed deletion analysis of the 5’ and 3’ SrEnod2
regions, we delimited the minimal promoter of the SrEnod2 gene and
revealed that the 5’ flanking sequences do not appear to be essential for
nodule parenchyma-specific expression. This finding contrasts with the
report that the 5’ upstream region of the soybean Enod2 gene directs nodule

. parenchyma-specific expression (Lauridsen et al., 1993, Plant J. 3, 483-

48

492), indicating different mechanisms may be involved in regulation of the
expression of these two genes. To our knowledge, this is also the first
demonstration that cis-element(s) specific for tissue-specific expression are

located within the 3 ’ UTR of a plant nuclear gene.

INTRODUCTION

The Enod2 gene is an early nodulin gene that was first identified by
differential screening of a soybean root nodule cDNA library (F ranssen et
al., 1987). Isolation of Enod2 homologues from other legumes, and
subsequent DNA sequence comparisons, have shown that the Enod2 gene is
highly conserved among leguminous plants (Franssen et al., 1987; Dickstein
et al., 1988; Govers et al., 1990; van de Wiel et al., 1990a; Szczyglowski
and Legocki, 1990; Dehio and dc Bruijn, 1992). The amino acid sequence
derived from the soybean Enod2 cDNA clone revealed that the Enod2
protein is very proline-rich and is mainly composed of two repeating
pentapeptides, ProProI-IisGluLys and ProProGluTyrGln (Franssen et al.,
1987; van de Wiel et al., 1990a). The Enod2 proteins of other legumes
appear to be composed of the same or similar repeating pentapeptides
(Dickstein et al., 1988; van de Wiel et al., 1990a; Szczyglowski and
Legocki, 1990; Dehio and de Bruijn 1992). A putative signal peptide is

present at the N-terminus of all of the Enod2 proteins identified thus far,

49

and the amino acid sequences of both pea and soybean Enod2 proteins
highly resemble a hydroxyproline-rich cell-wall protein identified in
soybean seed cell walls (Averyhart—Fullard et al., 1988; van de Wiel, et al.,
1990a). Therefore, it has been proposed that the Enod2 protein is a cell wall
protein (van de Wiel et al., 1990a).

The Enod2 gene is expressed during early stages of nodule
organogenesis (Franssen et al., 1987 ; van de Wiel et al., 1990a; Dehio and
de Bruijn 1992). It has been shown that this early nodulin gene is also
expressed in empty nodules induced by certain Rhizobium strains on the
roots of soybean and alfalfa (Finan et al., 1985; Franssen et al., 1987;
Dickstein et al., 1988). These empty nodules contain neither infection
threads nor intracellular bacteroids. Expression of the Enod2 gene has also
been demonstrated in “pseudo-nodules” induced by auxin transport
inhibitors (Hirsch et al., 1989; van de Wiel et al., 1990b) or by Rhizobium
nodulation-deficient (N od‘) mutants secreting the cytokinin trans-zeatin
(Cooper and Long, 1994). The expression of the Enod2 gene in these
empty/pseudo-nodules strongly suggests that the Enod2 protein is not
involved in the infection process per se, but may play a role in nodule
ontogeny.

The finding that the Enod2 gene is expressed in alfalfa pseudo-nodules
induced by auxin transport inhibitors (Hirsch et al., 1989) extends the

observations made several decades ago suggesting that plant hormones are

50

involved in the induction of nodules on plant roots (Thimann, 1936; Arora
et al., 1959; Libbenga et al., 1973; reviewed by Hirsch, 1992; Verma, 1992).
In fact, plant hormones clearly appear to be involved in the expression of
the Enod2 gene; Dehio and de Bruijn (1992) first demonstrated that the
expression of the Enod2 gene of Sesbania rostrata is specifically up-
regulated in roots after the application of cytokinin. Similar results have
been reported for the alfalfa Enod2 gene (Hirsch et al., 1993), although the
size of the cytokinin-enhanced Enod2 transcript in roots is larger than that
observed in alfalfa nodules.

In-situ hybridization studies have demonstrated that the soybean
Enod2 gene is expressed in the nodule parenchyma and in the nodule tissue
surrounding the vascular bundle that connects the nodule to the root central
cylinder (van de Wiel et al., 1990a). Low levels of the Enod2 transcript have
also been found in the nodule endodermis and the nodule outer-cortical cells
directly adjacent to the endodermis (van de Wiel et al., 1990a). The nodule
parenchyma is composed of several layers of cells, with fewer and smaller
intercellular spaces than most other cortical cells (van de Wiel et al., 1990a).
The compact structure of these cell layers has suggested to various
investigators that they may be involved in forming an oxygen diffusion
barrier (Tjepkema and Yocum, 1974; Witty et al., 1986; Nap and Bisseling,
1990; van de Wiel et al., 1990a). Since the Enod2 protein is localized in the

same cell layers, it has been hypothesized to contribute to the special

51

morphology of the nodule parenchyma and therefore to the formation of the
oxygen barrier (Nap and Bisseling, 1990; van de Wiel et al., 1990a).
However, no experimental evidence supporting this hypothesis exists.
Recently, considerable efforts have been made to understand how
Enod2 gene expression is controlled in developing soybean and S. rostrata
nodules and in roots of S. rostrata plants after cytokinin treatment
(Lauridsen et al., 1993; de Bruijn et al., 1994; Silver et al., 1996). We have
shown that the cytokinin-mediated up-regulation of the SrEnod2 gene in
uninfected roots of S. rostrata occurs mainly in cytoplasm at the post-
transcriptional level, requires protein synthesis, and appears to involve
protein phosphorylation (Silver et al., 1996). We have also reported that a 3-
kb 5’ upstream region of the SrEnod2 gene failed to consistently direct the
expression of the uidA reporter gene (gus; Jefferson et al., 1987) in the
nodule parenchyma of transgenic Lotus corniculatus plants (de Bruijn et al.,
1994). In contrast, a 3-kb 5’ region of the soybean Enod2(B) gene
[GmEnod2(B)] has been shown to direct reporter gene expression in the
nodule parenchyma of transgenic L. corniculatus plants (Lauridsen et al.,
1993). Here, we describe the detailed analysis of DNA sequence
determinants in the SrEnod2 locus responsible for tissue-specific expression
in nodules. We conclude from this analysis that, although the 5' proximal
region of the SrEnod2 gene is required for gene expression, the 3’

untranslated region (3 ’ UTR) of the SrEnod2 gene contains DNA sequence

52

determinants responsible and sufficient for nodule parenchyma-specific

gene expression.

METHODS

Plant growth and nodulation

Sesbania rostrata seeds were surface-sterilized and germinated on petri
dishes in the dark at 28°C for one day, as described by Pawlowski et al.,
(1991). Seedlings were grown for three weeks in autoclaved soil mix
(MetroMixzsand; 2:1) in growth chambers with an 18-hr light (28°C) and
6-hr dark (22°C) cycle. Plants were inoculated with a two-day-old culture
of Azorhizobium caulinodans ORSS71 (Dreyfus and Dommergues, 1981)
either in pots for root nodulation or on stems for stem nodulation. Six-day-
old root nodules and stem nodules were collected and processed (see
below).

Lotus corniculatus transgenic plants were grown for one week in
autoclaved soil mix (vermiculitezsandzmetromix; 10:10:1) in growth
chambers with a 16-hr light (24°C) and 8-hr dark (18°C) cycle. Plants were
inoculated with a three-day-old culture of Rhizobium lotz' NZP2037
(Pankhurst, 1983) and grown for 21 days. Plant tissues (nodules, infected

roots, and leaves plus stems) were collected and stored in liquid nitrogen.

53

In-situ RNA localization

In-situ RNA localization studies were carried out essentially as described by
Cox and Goldberg (1988) and Van de Wiel et al. (1990a), except that a non-
radioactive approach was used according to De Block and Debrouwer
(1993). Stern and root nodules were fixed in a 10 mM sodium phosphate
buffer (pH 6.8) containing 4% paraformaldehyde, 0.25% glutaraldehyde,
and 100 mM NaCl at room temperature, dehydrated in a graded ethanol and
xylene series, and embedded in paraplast X-tra (Fisher Scientific, F air
Lawn, NJ). Nodule sections (7 um thick) were cut and attached to
superfrost/plus microscopic slides (Fisher Scientific, Pittsburgh, PA). After
removal of the paraplast with xylene and rehydration through an ethanol
series, sections were treated with proteinase K (5 ug/ml) in 100 mM Tris-
HCl (pH 7.5); 50 mM EDTA for 30 min at 37°C and with 0.25% acetic
anhydride in 100 mM triethanolamine (pH 8.0) for 10 min at room
temperature. Slides were subsequently dehydrated through an ethanol series
and dried and hybridized with digoxigenin-labeled sense and antisense
RNA probes generated by transcribing the coding region of the SrEnod2
gene (Dehio and de Bruijn, 1992) with T3 and T7 RNA polymerase,
according to the manufacturer's instructions (Boehringer Mannheim GmbH,

Mannheim, Germany).

54

Hybridization and washing were essentially carried out according to
Cox and Goldberg (1988) and De Block and Debrouwer (1993). Sections
were dehydrated via an ethanol series and mounted with poly-mount
(Polysciences Inc, Warrington, PA). Sections were photographed using an

Axiophot microscope (Zeiss, Oberkochen, Germany).

Isolation of total RNA and poly(A)+ RNA

Total RNA was isolated according to the hot phenol method of Verwoerd et
al., (1989), with the following modifications. Briefly, plant material (up to
1 gm) was ground in liquid nitrogen to a fine powder and then transferred
into a 15-ml tube containing 4 ml of preheated (65°C) RNA isolation buffer
(Hall et al., 1978), and 4 ml of preheated (65°C) phenol. Samples were
vortexed vigorously for 5 min, 4 ml of chloroform was added, the mixture
was vortexed again for 15 min and centrifuged at 10,000 rpm for 20 min.
The supernatant was extracted once with an equal volume of chloroform
and centrifuged again. RNA in the supernatant was precipitated at 10,000
rpm for 30 min after adding 1/4 volume of 8 M LiCl and 1/10 volume of 1.6
M KCl and an overnight incubation on ice. The RNA pellet was
resuspended in 400 pl of DEPC-treated water and extracted with an equal

volume of chloroform until a clear interface was formed. RNA was then

55

precipitated and resuspended in DEPC-HzO. The RNA concentration was
determined photometrically.

Poly(A)+ RNA was prepared by passing total RNA through oligo—dT
columns according to the manufacturer's instructions (5 prime—>3 prime,
Boulder, CO). Northern analysis was performed according to standard
procedures (Maniatis et al., 1982). Briefly, Poly(A)+ RNA was loaded on a
1% formaldehyde agarose gel and separated at 4°C. The gel was soaked in
10x SSC for 30 min, to remove formaldehyde, and subsequently blotted to a
0.22 um nitrocellulose membrane (NitroPlus, Micron Separation Inc,
Westborough, MA). The membrane was rinsed briefly in DEPC-HzO and
baked at 80°C for 2 hr under vacuum. Prehybridization was carried out at
51°C overnight in a solution containing 5x SSC, 10x Denhardt's solution,
0.1% SDS, 0.1M KPO4, pH 6.8, and 100 ug/ml salmon sperm (ss) DNA.
Hybridization reactions were carried out at 65°C for 18 hr in a solution
containing 1x SSC, 10x Denhardt's solution, 0.1M KPO4 (pH 6.8),
100ug/ml ssDNA, 10% dextran sulphate, 50% formamide. After
hybridization, the membrane was washed at 65°C in 2x SSC and 1x SSC for
20 min each and finally in 0.2x SSC for 40 min. Blots were exposed to X-

ray film at -75°C.

56

Chimeric reporter gene construction

A 5.3-kb EcoRI fragment, which contains a 1.9-kb 5' region, a l-kb coding
region, and a 2.4-kb 3' downstream region of the SrEnod2 gene was
subcloned from the genomic clone ICDl (Dehio and de Bruijn, 1992) into
the pBluescript KS- vector (Stratagene, La Jolla, CA). Restriction sites
(BamHI and SalI) were introduced at the translational initiation codon and
at the 3' end of the putative signal peptide sequence of the SrEnod2 gene,
using site-directed mutagenesis as described by Kunkel et a1. (1985). The
oligonucleotide primers used for introducing the BamI-II and SalI sites were
(5')GAGTAGTGTAGAGAQGATCCTTCTATCTAT(3') and (5')GGCTCA
TAGTAATI‘AGTCGAQACTGGAGO'), respectively. The underlined
nucleotide sequences correspond to the restriction endonuclease recognition
sites and the highlighted nucleotides correspond to the mutations
introduced. A 1.9-kb EcoRI-BamHI fragment, which contains the entire 5'
untranslated region and upstream region of the SrEnod2 gene, was inserted
in front of the gus coding region carried on plasmid pB1101.1 (Clontech
Laboratories, Palo Alto, CA). The EcoRI end of the fragment was filled in
by Klenow before cloning. The resulting binary vector was used to generate
constructs 1 and 2 (Figure 2-2A). Similarly, a 1.98-kb EcoRI-Sall fragment,
which contains the 75-bp signal peptide sequences in addition to the 5'

sequences of the SrEnod2 gene, was inserted in front of the gus coding

57

region of plasmid pBIlOl.2, and the resulting vector was used to generate
construct 5. To construct a transcriptional fusion between the 1.98-kb 5’
sequences of the SrEnod2 gene and the gus coding region, a second-round
mutagenesis was performed on the 5.3-kb EcoRI fragment containing the
introduced SalI site with an oligonucleotide carrying a mutation in the
translational initiation codon (ATG to GGA). The resulting 1.98-kb EcoRI-
(BamHI)-SalI fragment was excised and inserted in front of the gus coding
region carried on plasmid pBIlOl.1 This vector was used to generate
constructs 3 and 4 (Figure 2-2A).

A restriction site (SacI) was introduced immediately downstream of
the translational stop codon (TAA) of the SrEnod2 gene using the
oligonucleotide primer (5')GTAGTGGTAGTGGTTGGAGQTCTTAATTT
TI'ITTGG(3'). A 2.4-kb SacI-EcoRI fragment, containing the entire 3'
untranslated and downstream region of the SrEnod2 gene, was inserted into
pBIlOl.1 to generate constructs 1, 3, and 5 (Figure 2-2A).

Constructs 6 and 7 were generated by inserting a 3.4-kb HindIII-Sacl
fragment of plasmid pLPl4 (Szczyglowski et al., 1994), containing a 1.4-kb
5’ sequence of the Srglb3 gene and the gus coding region, into pBIlOl.1
and pBIlOl-3'SrEnod2, respectively. Constructs 8, 9, 10, and 11 were
generated in a similar fashion by inserting a 2.1-kb BamHI-SacI fragment
of pLP70 containing the 96-bp minimal CaMV35S promoter (-90 bp to +6
bp) and the gus coding region; a 2.15-kb BamHI-Sacl fragment of pLP62,

58

containing the 150-bp minimal nopaline synthase promoter (-150 bp to +1
bp) and the gus coding region, into the BamHI-Sacl sites of pBIlOl.1 and
pBI 101-3'SrEnod2, respectively.

Several 5’ deletion fragments were generated by restriction enzyme
digestion of the 1.9—kb EcoRI-BamHI fragment. XbaI, Sau3A, RsaI,
EcoRV, DraI, MspI Hinfl, AluI, SspI and Tsp were used to generate
deletions ending at positions -1628, -1180, -854, -684, -464, -384, -306,
-191, -115, and -50 bp, relative to the transcriptional start point. Several 3’
deletion fragments were generated by nested deletions using the Erase-a-
Base kit (Promega, Madison, W1). A XhoI linker was inserted into the
EcoRI site at the end of the 3’ sequences of the SrEnod2 gene in construct
1. The 3’ deletion fragments were then inserted into the SacI-XhoI sites of

the modified construct 1.

Regeneration of transgenic Lotus comiculatus plants

Transgenic Lotus corniculatus cv Rodeo plants were generated according to
Szabados et al. (1990). Binary vectors were conjugally transferred into the
Agrobacterium rhizogenes strain A4 (Tempe and Casse-Delbart, 1989).
Regenerated plants were transferred to a growth chamber (Conviron,

Asheville, NC) and nodulated as described (Szabados et al., 1990).

59

Quantification of GUS enzymatic activity

GUS enzymatic activity was quantified according to Jefferson et a1. (1987).
The units of GUS activity used were picomoles of 4-methylumbelliferone
(MU) produced per minute per milligram of protein. The concentration of
protein in the extract was determined by the Bradford assay (Bradford,
1976). Fluorometric assays were performed using a fluorescence

spectrophotometer (Model F-2000; Hitachi, Tokyo, Japan).

Histochemical staining of GUS enzymatic activity

GUS enzymatic activity was analyzed histochemically according to the
procedure described by Jefferson (1987), with the following modifications.
Hand-cut nodule sections were incubated at 37° in a solution containing
50 mM Na2PO4 and NaHPO4, pH 7, 1 mM ferri-lferro-cyanide and 20%
methanol and 1 mM X-Gluc (5-bromo-4-chloro-3-indolyl B-D—glucuronide;
Gold Biotechnology Inc., St. Louis, MO). Stained sections were then
embedded in historesin (Reichert-Jung; Cambridge Instruments, Heidelberg,
Germany), as described by De Block and DeBrouwer (1992), or in paraplast
X—Tra, as described by Cox and Goldberg (1988). Sections of 10 um-thick
were generated and examined by dark— and light-field microscopy using an

Axiophot microscope.

60

RESULTS

Localization of the SrEnod2 transcript in the parenchyma of S. rostrata

stern and root nodules

The tropical legume S. rostrata forms nodules on both roots and stems after
infection with Azorhizobium caulinodans ORSS71 (Dreyfus and
Dommergues, 1981; de Bruijn, 1989). The formation of stem nodules is
induced following a crack-entry mediated infection of A. caulinodans
ORSS71 at the base of dormant root primordia, which are present in rows
along the stem (Tsien et al., 1983; de Bruijn, 1989). Root nodule
organogenesis in S. rostrata appears to be intermediate between the
indeterminate and determinate processes of nodule formation (Ndoye et al.,
1994). These observations suggest that nodule formation in S. rostrata, as in
many other tropical legumes, represents a primitive type of nodule
organogenesis (Ndoye et al., 1994), and prompted us to study the tissue-
specific expression of the SrEnod2 gene in S. rostrata stem and root
nodules. The results, presented in Figure 2-1, show that the SrEnod2 gene
is expressed in the nodule parenchyma cells of both stem and root nodules
(Figure 2-1A and B). In both types of nodules, hybridization signals are also
observed in cells immediately adjacent to the nodule vascular tissue (Figure

2-1C and D). Moreover, in stem nodules, hybridization signals are also

61

LEGEND FOR FIGURE 2-1. In-situ localization of SrEnod2 gene
expression.

Sections (7-um) of S. rostrata root and stem nodules harvested 6 days after
inoculation with A. coulinodans ORSS71, were hybridized to a digoxigenin-
labeled antisense RNA probe derived from the SrEnod2 coding region. Pink
and black colors indicate hybridization signals. No signals were observed in
neighboring sections hybridized with the sense probe (data not shown).

(A) Section of a root nodule.
(B) Section of a stem nodule.
(C) Magnification of the section shown in (A).
(D) Magnification of the section shown in (B).

CT, central tissue; NP, nodule parenchyma; VB, vascular bundle. The
arrowhead indicates expression in the nodule endodermis.

62

 

 

63

detected in cell layers corresponding to the nodule endodermis (Figure
2-1D, arrowhead). Expression of the SrEnod2 gene was not observed in
other nodule cells. Therefore, the expression pattern of the SrEnod2 gene in
the parenchyma cells of S. rostrata stem and root nodules appears to be
similar to that of the Enod2 genes of other legumes (van de Wiel et al.,

1990a)

The 3' flanking region of the SrEnod2 gene is required for gene

expression in the nodule parenchyma

To identify DNA sequence determinants responsible for nodule
parenchyma-specific expression of the SrEnod2 gene, a chimeric reporter
gene fusion (gus; Jefferson, 1987; Jefferson et al., 1987) was constructed, in
which the 5' and 3' flanking regions of the SrEnod2 gene were connected to
the coding region of the gus reporter gene (5'SrEnod2-gus-3'SrEnod2;
Figure 2-2A, construct 1). A construct containing the 3’ terminator region of
the nopaline synthase gene (3’nos) was used as a control (5'SrEnod2-gus-
3'nos; Figure 2-2A, construct 2). These two constructs were introduced into
L. corniculatus plants by, Agrobacterium rhizogenes-mediated plant
transformation (Szabados et al., 1990), and their presence in transgenic

plants was verified by Southern blotting (data not shown). Expression of the

64

LEGEND FOR FIGURE 2-2. Structure of gus fusion constructs and
determination of GUS activity in transgenic L. corniculatus plants.

(A) Structure of gus fusion constructs. The construct numbers are listed.
The boxes in black and white represent gus, SrEnod2 and nos gene
sequences, respectively. The thin open box represents a 75-bp putative
signal peptide sequence. The vertical lines and wavy arrows represent the
transcriptional start site of the SrEnod2 gene. The vertical bars attached to
the boxes represent the translational start of the corresponding genes. + and
- designate positive and negative staining results, respectively.

(B) Quantification of GUS activity in transgenic L. corniculatus plants. The
data shown represent mean values in units of pmol 4-methylumbelliferone
(MU) per minute per mg protein. The error bar represents the standard
deviation of the mean. The number of transgenic plants tested is indicated
with an n.

GUS ACTIVITY (STAININ G)

 

 

 

 

 

 

    
 
 
   
 

 

 

 

 

 

 

 

 

 

 

 

B
1
1 :munnmnnmmnmnu- I no d u le
2 m root
3 ——l
4 2 1
5 n=31
0 50 100 150 200 250 300 350

GUS activity (pmol MU/min/mg protein)

66

gus reporter gene was histochemically and quantitatively determined in
tissues of transgenic plants 21 days after Rhizobium inoculation.
Histochemical staining revealed that gas reporter gene expression was
visible as a ring-like pattern in cross sections of mature nodules expressing
the 5'SrEnod2-gus-3'SrEnod2 construct (Figure 2-3B). No gus reporter gene
expression could be detected in leaves, stems, or uninfected roots of the
transgenic plants (Figure 2-2A). However, weak reporter gene expression
could be detected in regions near the root tips of some transgenic plants, but
only after Rhizobium infection (Figure 2-3B). When the 3’nos region was
present instead of the SrEnod2 3’ region, no reporter gene expression could
be detected in any tissues of the transgenic plants (Figures 2-2; and 2-3A).
Dark-field microscopy revealed that the expression of the S'SrEnodZ-
gus-3'SrEnod2 was localized in the nodule parenchyma and vascular tissues
(Figure 2-3D). A low level of GUS activity was also detected in the outer
cortex of the nodule. The histochemical staining pattern of the reporter gene
expression correlates well with the in-situ Enod2 mRNA hybridization
pattern found in S. rostrata nodules (Figure 2-1) and those observed for
other legume plants (van de Wiel, 1990a). The only exception to this
correlation is that our reporter gene construct was also expressed in the

nodule vascular tissue. Dark-field microscopy confirmed that no GUS

67

LEGEND FOR FIGURE 2-3. Microscopic analysis of the expression of
reporter gene constructs in transgenic L. corniculatus plants.

(A) Hand-cut sections of transgenic nodules harboring 5’SrEnod2-gus-
3’nos construct (Figure 2-2A, construct 2).

(B) Hand-cut sections of transgenic nodules harboring the 5’SrEnod2-gus-
3’SrEnod2 construct (Figure 2A, construct 1). GUS activity (blue color) can
be seen in the nodule parenchyma and in regions near the root tip of
selected infected roots.

(C) Dark-field microscopy of a IO-um section of one of the transgenic
nodules shown in (A).

(D) Dark-field microscopy of a IO-um section of one of the transgenic
nodules shown in (B). GUS activity (red color) can be seen in the nodule
parenchyma, Vascular, and outer cortical tissues.

CT, central tissue; E, endodermis; NP, nodule parenchyma; OC, outer
cortex; and VB, vascular tissue.

I 7’

‘.

'7'

 

J

68

 

69

activity was detectable in nodules of transgenic plants harboring the
5'SrEnod2-gus-3'nos construct (Figure 2-3C).

The histochemical staining analysis revealed limited variations in the
expression of the reporter gene. Although 12 out of 17 transgenic plants
harboring 5'SrEnod2-gus-3'SrEnod2 (Figure 2-2A, construct 1) had
significant reporter gene expression in nodules and 5 plants were inactive,
one plant had a high level of reporter gene expression in both nodules and
infected roots (data not shown). A variation in reporter gene expression
pattern was also observed in one out of 18 transgenic plants harboring the
5'SrEnod2-gus-3'nos construct, which had a low level of gus expression in
the nodule vascular tissue (data not shown). It is likely that these variations
are due to "position effects" (Odell et al., 1985; Sanders et al., 1987; Benfey
et al., 1989), and were therefore excluded from further analysis.

GUS enzymatic activity in nodules and infected roots of transgenic
plants was quantified using a fluorometric assay. As shown in Figure 2-2B,
GUS activity was detected only in nodules of transgenic plants harboring
the 5'SrEnod2-gus-3'SrEnod2 construct. No GUS activity was detected in
nodules of transgenic plants harboring the 5'SrEnod2-gus-3'nos construct,
confirming the results of the histochemical staining analysis. These results
strongly suggest that the 3' region of the SrEnod2 gene is required for

tissue-specific reporter gene expression in transgenic plants.

70

In previous studies examining the interaction of DNA-binding proteins
(trans-acting factors) with the SrEnod2 locus, a specific protein-DNA
interaction with sequences encoding the putative SrEnod2 leader peptide
was identified (A. Goel and F.J. de Bruijn, unpublished observation).
Therefore, we also examined the role of the SrEnod2 putative signal peptide
sequence in modulating gus reporter gene expression. A 75-bp nucleotide
sequence encoding the N-terminal putative signal peptide of 25 amino acids
(Dehio and de Bruijn, 1992) was fused to the truncated SrEnod2 5’ flanking
region previously used (Figure 2-2A, constructs 1 and 2). Both in-frame
translational and transcriptional fusions to the gas coding region were
constructed (see Methods). The transcriptional fusions (Figure 2-2A,
constructs 3 and 4) displayed a pattern and level of reporter gene expression
similar to the original truncated constructs, lacking the leader sequence
(Figure 2-2). The putative signal peptide sequence, therefore, does not
appear to influence the expression of the reporter gene, when fused to it in a
transcriptional configuration. In transgenic plants harboring the in-frame
translational fusion (Figure 2-2A, construct 5), however, the gus reporter
gene was not expressed (Figure 2-2B). Since the reporter gene transcript
could be detected in nodules of transgenic plants harboring this gene fusion,
albeit at a lower level than that observed with the transcriptional fusion (see
below), the lack of GUS activity may be due to poor accumulation of GUS

protein or to protein inactivation due to N-linked glycosylation in the

71

glycosylation in the endoplasmic reticulum during secretion, because of the

presence of the putative leader sequence (Farrell and Beachy, 1990).

Gus reporter gene activities correlate with steady state gus mRNA

levels in transgenic nodules

Northern blot analysis was performed to determine whether the gus reporter
gene activities observed correlate with the accumulation levels of the
reporter gene transcript. As shown in Figure 2-4, nodule poly(A)+ RNA
isolated from a pool of three independent transgenic plants harboring
constructs containing the SrEnod2 3’ region, strongly hybridized to the
riboprobe prepared from the gus coding region (Figure 2-4, lanes 1, 3, and
5). The message detected was approximately 2.3 kb in length, as expected
(Dehio and de Bruijn, 1992; R. Chen and F. J. de Bruijn, unpublished data).
In contrast, nodule poly(A)+ RNA isolated from a pool of three independent
transgenic plants harboring constructs containing the 3’ nos terminator did
not hybridize to the gus probe (Figure 2-4, lanes 2 and 4). The same blot
was stripped and reprobed with an eIF 4A gene probe (Taylor et al., 1993) to
standardize loading.

The signal peptide sequence of the SrEnod2 gene did not influence the
accumulation of the reporter gene transcript when fused in a transcriptional

configuration to the gus coding region (Figure 2-4, lanes 1 and 3). The gus

72

LEGEND FOR FIGURE 2-4. Northern blot analysis of gus reporter gene
expression in transgenic nodules harboring the reporter gene constructs 1-5
(Figure 2A).

The lane numbers correspond to the construct numbers. Two micrograms of

poly(A)+ RNA were loaded in each lane and hybridized with a 32P-1abe1ed
riboprobe derived from the gus coding region. The same blot was stripped

and rehybridized with a 32P-labeled eIF 4A probe (Taylor et al., 1993) as a
loading control.

73

 

 

 

 

 

74

reporter gene transcript also accumulated in nodules harboring the
translational gene fusion (Figure 2-2A, construct 5), although the level of
gus mRNA accumulation was reduced to approximately 50% of that of the
transcriptional gene fusion (Figure 2-4, lanes 3 and 5).

These data clearly show that the accumulation of the reporter gene
transcript correlates well with the gus reporter activity detected in
transgenic plants. Additionally, they reveal that the reporter gene transcript
accumulates in transgenic plants harboring the constructs containing the

SrEnod2 3 ’ region, but not the 3' nos terminator.

The 3' region of the SrEnod2 gene contains sequence determinants

sufficient for expression in the nodule parenchyma

To further examine the role of the SrEnod2 3' region in directing nodule
parenchyma-specific expression, additional chimeric reporter gene fusions
were constructed containing heterologous promoters, e. g. the
leghemoglobin (Srglb3) promoter from S. rostrata (Szabados et al., 1990;
Szczyglowski et al., 1994), the nopaline synthase minimal promoter (-150
bp to +1 bp; Depicker et al., 1982; Ebert et al., 1987), and the CaMV3SS
minimal promoter (-90 bp to +6 bp; domain A; Franck et al., 1980; Pietrzak
et al., 1986; Benfey et al., 1989). The resulting constructs (see Figure 2-5A)

75

were introduced into L. corniculatus, and the expression of the gus gene
was determined histochemically and quantitatively.

It has previously been shown that a 5'Srglb3-gus-3'nos construct
(Figure 2-5A, construct 6) is expressed exclusively in the infected cells of
transgenic nodules (Szabados et al., 1990; Szczyglowski et al., 1994; see
also Figure 2-6A). However, when the 3’ nos terminator was replaced by
the SrEnod2 3’ region (Figure 2-5A, construct 7), GUS activity was
detected not only in the infected cells of transgenic nodules, but also in the
nodule parenchyma cells, the vascular tissue, and the outer cortex (Figures
2-6B and D). Dark-field microscopy revealed that GUS expression directed
by the 5'Srglb3-gus-3'SrEnod2 construct could also be detected in the
central uninfected (interstitial) cells of transgenic nodules (Figure 2-6D),
but could not be detected in transgenic stem, leaf, and root tissues (Figure 2-
5). This expression pattern suggests an additive effect of the leghemoglobin
promoter and the SrEnod2 3 ’ region. In addition, the average expression
level of the 5'Srglb3-gus-3'SrEnod2 construct was consistently higher than
the 5'Srglb3-gus-3'nos construct (Figure 2-5B).

The 5'CaMV35S(-90/+6)-gus-3'nos construct (Figure 2-5A, construct
8) did not direct detectable levels of gus expression in either nodules or
roots of transgenic plants (Figures 2-5, and 2-6E). However, when the 3’nos
terminator was replaced by the 3’ SrEnod2 region (Figure 2-5A, construct

9), gus expression was detected in the nodule parenchyma, vascular

76

LEGEND FOR FIGURE 2-5. Structure of gus fusion constructs and
determination of GUS activity in transgenic L. corniculatus plants.

(A) Structure of gus fusion constructs. The construct numbers are listed on
the left. The open box with angled lines represents the S. rostrata
leghemoglobin gene promoter (5’Srglb3; 1.4 kb). The open box with
horizontal lines represents the CaMV35S minimal promoter (CaMV35S; -
90 to +6 bp). The open box with vertical lines represents the nopaline
synthase minimal promoter (Pnos; -150 to +1 bp). For other symbols used
see the legend of Figure 2A.

(B) Quantification of GUS activity in transgenic L. corniculatus plants. The
data represent the mean values. The error bars represent the standard
deviation of the mean. The construct numbers are listed at the bottom.

77

      
   
   
 

 

 
   

A GUS ACTIVITY (STAINING)
Nodule
........... is? ,an
CONSERUCTS on... "mg“ cortex ""°‘
6 -l400bp m + - - -
7 -ltomip 4+ + + -
s CaMV35S(-90/+6bp) - - - -
9 CaMV35S(—90/+6bp) : - + - +
10 Pnos(-l50/+lbp) I - _ - +
11 Pnos(-l50/+Ibp) I - + + +1-
B 4000 80
E 3500 70 .71 3:22? J I,
'0 L .mdule
5 3000 mi , 17* ’ ,,
L:
g 3 2500 so -.
.2 E
§ E 2000 40 -
U) E 1500 30 _
D
O 1000 20 _
g 500 10-
5’ 0 0 -

 

 

 

 

 

78

bundles, and tissues surrounding the vascular bundle connecting the nodule
to the root central cylinder (Figures 2-6F and G). gus expression was also
detected in root vascular tissues, but not in stems or leaves of transgenic
plants (data not shown). Fluorometric measurements confirmed this
observation (Figure 2-5B).

The 5'nos(-150/+1)-gus-3'nos construct (Figure 2-5A, Construct 10)
did not direct detectable levels of gus expression in nodules, but was weakly
expressed in the root tissues of transgenic plants (Figure 2-SB). Again,
when the 3’ nos terminator was replaced by the 3’ SrEnod2 region (Figure
2-5A, construct 11), gus expression could be readily detected in the nodule
parenchyma, vascular bundles, and outer cortex, as well as in root vascular
tissues and cortical cells (Figures 2-6H and I). No staining was found in
stems or leaves (data not shown). GUS activity measurements confirmed
these observations (Figure 2-5B).

These data reveal that the 3' region of the SrEnod2 gene can extend the
expression of the gus reporter gene to the parenchyma and vascular tissues
of transgenic plants, when fused to heterologous promoters, indicating that
the SrEnod2 3' region contains sequence determinants necessary and
sufficient for directing reporter gene expression in the nodule parenchyma
and vascular tissues. Moreover, these data reveal that the SrEnod2 3' region
neither inhibits reporter gene expression in those tissues where the

respective 5' (promoter) regions are normally expressed, nor extends

79

LEGEND FOR FIGURE 2-6. Microscopic analysis of the expression of gus
fusion constructs in transgenic L. corniculatus plants. Staining for GUS activity
was carried out overnight, or for 1 hr as indicated.

(A) Hand-cut section of a transgenic nodule harboring the 5’Srglb3-gus-3 ’nos
construct (Figure 2-5A, construct 6). GUS activity (blue color) can be seen in the
nodule central tissue (CT). Staining was carried out for 1 hr.

(B) Hand-cut section of a transgenic nodule harboring the 5’Srglb3-gus-3 ’SrEnod2
construct (Figure 2-5A, construct 7). GUS activity (blue color) can be seen in the
nodule central tissue, as well as in surrounding tissues. Staining was carried out for
1 hr.

(C) Dark-field microscopy of the nodule section shown in (A). GUS activity (blue
color) can be seen in the infected cells of the nodule central tissue.

(D) Dark-field microscopy of the nodule section shown in (B). GUS activity (blue
and red colors) can be seen in the nodule central tissue (CT), as well as in the
nodule parenchyma (NP), vascular bundles (VB), and outer cortical tissue (0C).
(E) Dark-field microscopy of a transgenic nodule section harboring the
5’CaMV35S(-90/+6)-gus-3’nos construct (Figure 2-5A, construct 8).

(F) and (G) Dark-field microscopy of a proximal and a distal view of a transgenic
nodule section, harboring the 5’CaMV3SS(-90/+6)-gus-3’SrEnodZ construct
(Figure 2-5A, construct 9). GUS activity can be seen in the nodule parenchyma
(NP), vascular tissue bundles (VB) and the root central cylinder (CC). No GUS
activity is observed in the root cortex.

(H) and (I) Dark-field microscopy of a proximal and a distal view of a transgenic
nodule section harboring the 5’nos(-150/+1)-gus-3’SrEnod2 construct (Figure 2-
5A, construct 11). GUS activity can be seen in the nodule parenchyma (NP),
vascular bundles (VB) and outer cortical tissue (OC), as well as in the root central
cylinder (CC) and in the root cortex (RC).

(J) Dark-field microscopy of a transgenic nodule section harboring the CaMV35S
(-150/-90)-5'SrEnod2(-115/+23)-gus-3'SrEnod2 construct (Figure 2-8, construct
22). GUS activity can be seen in the nodule parenchyma (NP), the nodule vascular
bundles (VB) and the nodule central tissue (CT).

(K) and (L) Dark-field microscopy of nodule and root-sections harboring the
CaMV35S(-150/-90)-5 'SrEnod2(-50/+23)-gus-3'SrEnod2 construct (Figure 2-8,
construct 23). GUS activity can be seen in the nodule parenchyma (NP), vascular
bundles (VB) and central tissue (CT), as well as in the root central cylinder (CC)
and cortex (RC). Staining was carried out for 1 hr.

80

 

 

 

 

 

 

 

81

reporter gene expression to tissues where the 5’ (promoter) regions used are
not expressed. Rather, the SrEnod2 3' region appears to enhance reporter
gene expression in those tissues to which the 5’ regions direct expression. It
is possible that the same regulatory element in the SrEnod2 3' region is
responsible for both nodule parenchyma-specific expression and general
enhancement of gene expression. Alternatively, separate mechanisms (cis-
elements) may be responsible for the observed alterations in gene

expression.

Delimitation of sequences in the 5’ proximal region of the SrEnod2 gene

required for detectable levels of gene expression

A series of 5’93’ unidirectional deletions in the 5' SrEnod2 region was
constructed and fused to the gus coding region, as well as to the 3' region of
the SrEnod2 gene (Figure 2-7A). The resulting constructs were introduced
into L. corniculatus plants and reporter gene expression was analyzed
histochemically and quantitatively. GUS activity measurement revealed that
constructs with deletions up to position -191, relative to the transcriptional
start site, directed reporter gene expression in the same fashion as the full
5'SrEnod2-gus-3'SrEnod2 construct (Figure 2-2A, construct 1), namely to
the nodule parenchyma and vascular tissues (Figure 2-7A and B). Only the

level of GUS enzymatic activity varied slightly (Figure 2-7B). These data

82

LEGEND FOR FIGURE 2-7. Structure of SrEnod2 5' deletion reporter
gene constructs and GUS activity in transgenic L. corniculatus plants.

(A) Structure of gus fusion constructs. The construct numbers are listed on
the left. The base pair (bp) numbers indicate the end point of the 5' deletion
relative to the start of transcription. The vertical bars attached to the boxes
represent the translational start of the corresponding genes. The interrupted
lines downstream of the gus reporter gene represent the 2.4-kb 3' flanking
sequences of the SrEnod2 gene. + and - represent positive and negative
GUS staining activity, respectively. For other designations, see the legend
of Figure 2A.

(B) Quantification of GUS activity in transgenic L. corniculatus plants. The
data represent the mean values. The error bar represents the standard
deviation of the mean. The number of transgenic plants tested is indicated
with an n.

83

 

 

 

 

 

 

 

 

 

 

 

 

  
 

 

 

 

 

 

 

 

A GUS ACTIVITY (STAINING)
........ @14— ads “3% was.
CONSERUCT S dunes m tissues
1 - + - -
12 - + - -
13 - + - -
14 - + - -
15 - + - -
l6 - + - -
17 - + - -
18 - + - -
19 .. + .. -
20 - + - -
B
T .noduic
-—-t .root
4 Dstcm
15 $0111" ".9
,6 _—I,—._—-- 3
l7 __— — r20
— i— .. ——‘
19 .“ “_ n=12
20 _ — "=9
r 50 100 150 200 250 300

GUS activity (pmol MU/min/mg protein)

84

suggest that sequences up to position -191 are not required for nodule
parenchyma-specific reporter gene expression. A deletion down to position
-115 (Figure 2-7A, construct 20), was found to lead to a significant
reduction of reporter gene expression in nodules (Figure 2-7B), although a
limited degree of nodule enhanced expression was maintained.
Histochemical GUS staining revealed that this construct retained gus gene
expression in the nodule parenchyma and vascular tissues (Figure 2-7A;
data not shown). Therefore, we suggest that the sequences down to position
-115 may not be absolutely necessary for nodule parenchyma-specific
expression.

A construct with a deletion up to position -50 in the 5’ SrEnod2 region
was found to be inactive in transgenic plants (Figure 2-8). To test whether
the lack of reporter gene expression was due to a deletion of tissue-specific
cis-element(s) or to a deletion of proximal promoter element(s), the
transcriptional enhancer from the CaMV3SS promoter (-150 to -90 bp, part
of domain B; Benfey et al., 1989) was firsed in cis to the -50 bp fiagment
(Figure 2-8, construct 23). GUS activity measurement in transgenic plants
harboring this construct revealed that the reporter gene was strongly
expressed in nodule, root, and stem tissues (Figure 2-8). Within nodules, the
reporter gene was highly expressed in the nodule parenchyma and vascular
tissues, and to a lower level in the infected tissue (Figure 2-6K). Within

roots, the gus gene was expressed in the central cylinder and cortical

85

LEGEND FOR FIGURE 2-8. Structure of SrEnod2 5' deletion reporter
gene constructs, enhancer fusions and GUS activity in transgenic L.
corniculatus plants.

The construct numbers are listed on the left. The base pair (bp) numbers
indicate the end point of the 5' deletion, relative to the start of transcription.
The interrupted open box represents the 2.4-kb 3' flanking region of the
SrEnod2 gene. The open box represents the transcriptional enhancer of the
CaMV35S promoter (-150 to -90 bp). For other designations, see the legend
of Figure 2A.

86

GUS ACTIVITY (STAINING)

Nodule
1:333: parenchyma Root Stem

CONSTRUCTS tissues and vascular tissues tissues
# tissues

mRNA
20%—1%:22
mRNA
21 ....1"”:’ua_.7@ - - - .-
mRNA
22 D—wfil + + + +
mRNA
aim-Ea 4+ 4+ 4+ ++

23

 

87

tissues (Figure 2-6L). When the same transcriptional enhancer was fused to
the -115 bp deletion fragment of the 5’ SrEnod2 gene (Figure 2-8, construct
22), an identical GUS activity staining pattern was observed as with
construct 23 (Figures 2-6J, and 2-8), although the GUS activity was much
lower than plants harboring construct 23 (Figure 2-8; and data not shown).
These data suggest that sequences between positions -115 and -50 in the 5’
SrEnod2 region are necessary for reporter gene expression. However, they

may not contain any tissue-specific cis-elements.

The 3’ untranslated region (3’ UTR) of the SrEnod2 gene constitutes the

minimum determinant for nodule parenchyma-specific gene expression

To delineate the sequence determinants in the 3' region of the SrEnod2 gene
responsible for nodule parenchyma-specific expression, a series of 3’——)5’
unidirectional deletions in the 3' region of the SrEnod2 gene were
constructed (Figure 2-9A). The 3' deletion derivatives were fused to the gus
coding region, flanked by the full-length 5' SrEnod2 region. The resulting
constructs were introduced into L. corniculatus, and reporter gene
expression was determined. As shown in Figure 2-9, deletions in the 3’
region up to position +400 bp relative to the stop codon, did not affect
tissue-specific expression of the reporter gene (Figure 2-9, construct 30).

The level of gene expression was greatly reduced when the 3' flanking

88

LEGEND FOR FIGURE 2-9. Structure of SrEnod2 3' deletion reporter
gene constructs and determination of GUS activity in transgenic L.
corniculatus plants.

(A) Structure of gas fusion constructs. The construct numbers are listed to
the left. The base pair (bp) numbers indicate the end point of the 3' deletion,
relative to the stop codon of the SrEnod2 gene. The vertical bars attached to
the boxes represent the translational start of the corresponding genes. The
vertical arrow indicates the position of the polyadenylation site of the
SrEnod2 gene. The interrupted lines at the 5' end represent the 1.9-kb 5'
SrEnod2 region.

(B) Quantification of GUS activity in transgenic L. corniculatus plants. The
data represent the mean values. The error bar represents the standard
deviation of the mean. The number of transgenic plants tested is indicated
with an n.

89

A
GUS ACTIVITY (STAINING)

 

"l
E
3

S
CONSTRUCTS central Pmnchym £3; “5’1?“

and vascular
# tissues tissues tissues

I

~
N
0..

I

Hire 5 i3}

 

24
25

 

26

27 —1
28
29

may -

  

l:
~
‘
I

11001.. ..

30

 

I
++++++++

I

I

-
m
I

map -

‘1:

31

 

 

1

I nodule
I root
[:1 ste m

25

 

 

 

27

 

28

29

 

 

 

 

 

 

 

0 100 200 300 400 500 600
GUS activity (pmol MU/min/mg protein)

90

sequences were further limited to position +241 bp, although the nodule
parenchyma-specific expression pattern appeared to be maintained (Figure
2-9, construct 31; data not shown). Therefore, the 241-bp fragment
immediately downstream of the stop codon of the SrEnod2 gene, containing
most of the SrEnod2 3’ untranslated sequence (Dehio and de Bruijn, 1992;
R. Chen and F. J. de Bruijn, unpublished data), appears to be sufficient to

direct gene expression to the nodule parenchyma and vascular tissues.

DISCUSSION

The 3' UTR of SrEnod2 confers nodule parenchyma-specific expression

The Enod2 genes of several legumes have been shown to be expressed in
the nodule parenchyma cell layer (van de Wiel et al., 1990a, 1990b; Allen et
al., 1991; Figure 2-1). Here we show that in the case of the tropical legume
S. rostrata, the (primary) determinant of this cell-specific expression pattern
is located in the 3' UTR of the SrEnod2 gene. The following lines of
evidence support this conclusion: a) Chimeric gus reporter constructs
flanked by both 5' and 3' regions of the SrEnod2 gene are expressed in the
parenchyma of transgenic L. corniculatus nodules, while constructs
containing a heterologous 3' region (e.g. 3' nos) are not (Figures 2-2, and 2-

.3); b) The presence of the SrEnod2 3' region is necessary for the

91

accumulation of the gus mRNA in transgenic nodules (Figure 2-4); and c)
The addition of the SrEnod2 3' region to chimeric reporter gene constructs
containing heterologous promoters (e. g., Srglb3 promoter, CaMV35S
minimal promoter, nopaline synthase minimal promoter) extends the
expression pattern normally observed with the promoters to the nodule
parenchyma (Figure 2-5).

One interesting observation during our analysis of gus reporter gene
expression was that all the gus constructs containing the SrEnod2 3' region
directed gus expression also to the vascular bundles of transgenic L.
corniculatus nodules. This observation contrasts with our in-situ
hybridization results (Figure 2-1), which did not reveal SrEnod2 mRNA
accumulation in the vascular bundles. It also contrasts with previous results
on soybean Enod2 gene/promoter expression, which did not reveal reporter
gene expression in the vascular tissues either (Lauridsen et al., 1993). This
observation suggests that the gus expression assay is more sensitive than in-
situ hybridization, because of the stability of GUS protein (Jefferson et al.,
1987), and that the expression pattern of the S. rostrata Enod2 gene differs
in this respect from the soybean homologue. The latter is quite plausible,
since the S. rostrata Enod2 gene is inducible by cytokinin (Dehio and de
Bruijn, 1992; Silver et al., 1996), whereas the soybean Enod2 gene is not.
Moreover, in the case of the soybean Enod2 gene, nodule parenchyma-

specific expression has been reported to be controlled by elements far

92

upstream in the 5' region of the gene (Lauridsen et al., 1993; also see
below).

Another interesting observation was made with the chimeric 5'Srglb3-
gus-3'SrEnod2 construct. This construct was found to direct gus expression
not only in the nodule parenchyma, vascular bundles, and infected cells of
the central tissue, suggesting an additive effect of cell specificity mediated
by the SrEnod2 3' region and the Srglb3 promoter (Szczyglowski et al.,
1994), but also in the uninfected cells of the central tissue (Figure 2-6D).
This unexpected expression pattern may be due to an unusual interaction of
the cis-acting elements in these 5' and 3' regions. Alternatively, since the
results shown in Figure 2-6 suggest that the SrEnod2 3' region appears to
confer both (a) tissue specific, as well as (an) enhancer function(s), it may
reflect an enhancement of Srglb3 promoter activity in the uninfected cells to
a previously undetectable level (Szczyglowski et al., 1994).

Our SrEnod2 3' deletion analysis revealed that the DNA sequences
downstream of position +400 bp, relative to the SrEnod2 stop codon, can be
omitted without affecting the expression pattern of chimeric reporter gene
constructs (Figure 2-9). In fact, even a deletion construct lacking DNA
sequences 3' to position +241 directs expression to the nodule parenchyma,
while expression in roots and stems/leaves is virtually non-detectable
(Figure 2-9). This suggests that sequences between the SrEnod2 stop codon

- and position +241, upstream of the poly A addition site (around position

93

+258, Dehio and de Bruijn, 1992; R. Chen and F. J. de Bruijn, unpublished
result), are capable of directing cell-specific expression in transgenic
nodules, albeit at a low level. It is possible that the enhancer-like activity of
the SrEnod2 3' region is mediated by sequences located between positions
+241 and +400, whereas the cell-specificity determinant(s) lie(s) in the 3'
UTR Further analysis will be required to support this hypothesis.

DNA elements in the 3' region of plant genes have previously been
implicated in regulation of gene expression. Examples include the potato
proteinase inhibitor 11 (PI-II) gene (Thomburg et al., 1987; An et al., 1989),
the petunia ribulose bisphosphate carboxylase small subunit gene (Dean et
al., 1989), the oilseed rape AX92 gene (Dietrich et al., 1992), the
Arabidopsis GLABROUSI (GL1) (Larkin et al., 1993), and the potato
sucrose synthase (Sus4; Sus3) gene (Fu et al., 1995a and b). Multiple
examples have also been reported in mammalian systems. Examples include
the chicken adult ,B-globin gene (Choi et al., 1986), the chicken histone H5
gene (Trainor et al., 1987), the human A7 globin gene (Bodine and Ley,
1987), the mammalian ribonucleotide reductase R1 gene (Chen et al., 1993),
and the human transferrin receptor (77R) gene (Owen and Kuhn 1987;
Binder et al., 1994). In these cases, the 3’ sequences act either as
transcriptional enhancers or sequence determinants modulating gene
expression post-transcriptionally. Cis-element(s) acting as transcriptional

enhancers are generally located downstream of poly(A) addition site(s) and

94

often act as tissue-specific and/or developmental regulatory elements (e.g.,
Arabidopsis GL1 gene; chicken adult B-globin gene; chicken histone H5
gene; human A 7 globin gene). In those cases where post-transcriptional
regulation is involved, the 3’ sequences modulate mRNA stability (petunia
rbcs genes; human T fR gene), or efficacy of mRNA 3’ end formation and
processing (potato PI-II gene). Additionally, different 3' end regions have
also been found to influence the level of gene expression in plant cells
(Ingelbrecht et al., 1989).

However, our finding that (a) cis-element(s) responsible for cell-
specific expression is located within the 3' UTR appears to be a unique
example amongst plant nuclear genes. The mechanism by which the
SrEnod2 3' UTR mediates nodule parenchyma-specific expression remains
to be elucidated. In a separate but related study, we have shown that
cytokinin-mediated enhancement of SrEnod2 gene expression in S. rostrata
roots, in the absence of rhizobial infection, appears to occur at a post-
transcriptional level (Silver et al., 1996). This aspect of SrEnod2 regulation
also involves the 3' UTR of the gene (D. Silver, R. Chen, and F .J . de Brujin,
unpublished observations). Whether nodule parenchyma-specific expression
and cytokinin up-regulation of the SrEnod2 gene share common regulatory
elements is currently unknown; however, our data favor the hypothesis that
both processes involve post-transcriptional regulation. Recently, cell-

- specific mRNA stability elements have been identified in the 3' UTR of the

95

a2-globin gene (Weiss and Liebhaber, 1995). It is possible that the SrEnod2
3' UTR directs nodule parenchyma-specific expression in a similar way as
the 3' UTR of the a2-globin gene. Alternatively, the SrEnod2 3' UTR may
act as a tissue-specific transcriptional enhancer. Experiments are in progress
to address these possibilities and to further delimit the responsible cis-

elements.

The 5' region of SrEnod2 does not appear to harbor significant tissue-

specific cis-elements

Our deletion analysis of the SrEnod2 5’ region revealed that sequences
upstream of position -l91, relative to the transcriptional start site, are not
required for nodule parenchyma-specific expression. A deletion up to the -
50 bp position abolishes reporter gene expression in nodules, but fusing a
transcriptional enhancer (CaMVBSS -150 bp to -90 bp; see Szabados et al.,
1990) to the -50 bp fragment restores reporter gene expression to the nodule
parenchyma/vascular tissue, to stem and root tissues, and to a limited extent
to the nodule central tissue (Figure 2-6K). This pattern of reporter gene
expression was found to be similar to the pattern directed by a fusion of the
same transcriptional enhancer to the -115 bp fragment of the SrEnod2 5’
region (Figure 2-6J). These data suggest that sequences between positions -

- 115 and -50 are required for a significant level of reporter gene expression

96

in nodules. However, these sequences are not likely to contain (a) nodule
tissue-specific cis-element(s).

The latter conclusion is very intriguing in light of the fact that, in the
case of the soybean Enod2 (B) gene, Lauridsen et a1. (1993), have reported
that the 3-kb promoter region directed reporter gene expression to the
parenchyma of L. corniculatus and Trifolium repens transgenic hairy root
nodules. The 3' nos terminator was used in their study. Two critical tissue-
specific cis-elements were identified in regions located between positions -
1792 and -1582, and between -380 and -53, relative to the transcriptional
start site. When the upstream tissue-specific cis-element was fused to the
promoter region of a leghemoglobin gene (lb), the resulting gene fusion was
found to direct a low level of reporter gene expression in a scattered pattern
in the nodule central area. These data appear to be contradictory to the data
presented in this paper, and/or suggest fisrther that there are profound
differences in the mechanisms regulating SrEnod2 and the soybean
Enod2(B) gene expression (also see discussion above). Further support for
this idea is the finding that DNA sequences in the promoter regions of the
SrEnod2 and the soybean Enod2(B) genes share remarkably little homology
(de Bruijn et al., 1994), in contrast to the late nodulin leghemoglobin (lb)
promoters, which are highly similar (de Bruijn et al., 1990; de Bruijn and
Schell, 1992; Szabados et al., 1990; Szczyglowski et al., 1994; Stougaard et

‘ al., 1990; Ramlov et al., 1993). Perhaps this discrepancy can be explained

97

once the nucleotide sequences of the cis-element(s) responsible for the
nodule parenchyma-specific gene expression are identified and directly
compared.

In any case, the apparent involvement of the 3' region of the SrEnod2
gene, rather than its promoter (5') region, in nodule parenchyma-specific
expression is unique in a variety of ways and opens up a whole new area of
investigations on the mechanisms of plant gene expression in response to

rhizobial infection.

98
LIST OF REFERENCES

Allen, T., Raja, S., and Dunn, K., (1991). Cells expressing Enod2 show
differential spatial organization during the development of alfalfa root
nodules. Mol. Plant-Microbe Interact. 2, 139-146.

An, G., Mitra, A., Choi, H.K., Costa, M.A., An, K., Thornburg, R.W.,
and Ryan, GA. (1989). Functional analysis of the 3’ control region of

the potato wound-inducible proteinase inhibitor 11 gene. Plant Cell 1,
l 1 5-122.

Arora, N., Skoog, F., and Allen, O.N. (1959). Kinetin-induced
pseudonodules on tobacco roots. Am. J. Bot. 46, 610-613.

Averyhart-Fullard, V., Datta, K., and Marcus, A. (1988). A
hydroxyproline-rich protein in the soybean cell wall. Proc. Natl. Acad.
Sci. USA 85, 1082-1085.

Benfey, P.N., Ren, L., and Chua, N.-H. (1989). The CaMV35S enhancer
contains at least two domains which can confer developmental and tissue
specific expression patterns. EMBO J. 8, 2195-2202.

Binder, R., Horowitz, J.A., Basilion, J.P., Koeller, D.M., Klausner,
R.D., and Harford, J.B. (1994). Evidence that the pathway of transferrin
receptor mRNA degradation involves an endonucleolytic cleavage within
the 3' UTR and does not involve poly(A) tail shortening. EMBO J. 13,
1969-1980.

Bodine, D.M., and Ley, T.J. (1987). An enhancer element lies 3 ’ to the
humane A7 globin gene. EMBO J. 6, 2997-3004.

Bradford, M.M. (1976). A rapid and sensitive method for the quantitation
of microgram quantities of protein utilizing the principle of protein-dye-
binding. Anal. Biochem. 72, 248-254.

Chen, F.Y., Amara F.M., and Wright J.A. (1993). Mammalian
ribonucleotide reductase R1 mRNA stability under normal and phorbol

99

ester stimulating conditions: involvement of a cis-trans interaction at the
3' untranslated region. EMBO J. 12, 3977-3986.

Choi, O.-R., and Engel, J.D. (1986). A 3' enhancer is required for
temporal and tissue-specific transcriptional activation of the chicken
adult B-globin gene. Nature 323, 731-734.

Cooper, J.B., and Long, S.R. (1994). Morphogenetic rescue of Rhizobium
meliloti nodulation mutants by trans-zeatin secretion. Plant Cell 6, 215-
225.

Cox, K.H., and Goldberg, RB. (1988). Analysis of plant gene expression,
In Plant Molecular Biology: A Practical Approach, Show, C.H. ed.
(Oxford: IRL press), pp. 1-34.

Dean, C., Favreau, M., Bond-Nutter, D., Bedhrook, J., and Dunsmuir,
P. (1989). Sequences are required to activate a gene expressed in the root
cortex of embryos and seedlings. Plant Cell 1, 201-208.

De Block, M., and DeBrouwer, D. (1992). In-situ enzyme histochemistry
on plastic embedded plant material: The development of an artifact-free
B-glucuronidase assay. Plant J. 2, 261-266.

De Block, M., and DeBrouwer, D. (1993). RNA-RNA in-situ
hybridization using digoxigenin labeled probes: the use of high molecular
weight polyvinylalcohol in the alkaline phosphatase indoxyl-nitroblue-
tetrazolium reaction. Anal. Biochem. 215, 86-89.

de Bruijn, F.J. (1989). The unusual symbiosis between the diazotrophic
stem-nodulating bacterium Azorhizobium caulinodans ORS571 and its
host, the tropical legume Sesbania rostrata. In Plant-Microbe

Interactions, Molecular and Genetic Perspectives. Volume 111, T. Kosuge
and E. Nester eds. (New York: McGraw Hill), pp. 457-504.

de Bruijn, F.J., Szabados, L., and Schell, J. (1990). Chimeric genes and
transgenic plants are used to study the regulation of genes involved in
symbiotic plant-microbe interactions. Dev. Genet. 11, 182-196.

100

de Bruijn, F.J., and Schell, J. (1992). Regulation of plant genes
specifically induced in developing and mature nitrogen-fixing nodules:
cis-Acting elements and trans-acting factors. In Control of Plant Gene
Expression, D.P.S. Verma, ed. (Boca Raton, FL: CRC Press), pp. 241-
258.

de Bruijn, F.J., Chen, R.C., Fujimoto, S.Y., Pinaev, A., Silver, D., and
Szczyglowski, K. (1994). Regulation of nodulin gene expression. Plant
and Soil 161, 59-68.

Dehio, C., and de Bruijn, F.J. (1992). The early nodulin gene SrEnod2
fi'om Sesbania rostrata is inducible by cytokinin. Plant J. 2, 117-128.

Depicker, A., Stachel, S., Dhaese, P., Zambryski, P., and Goodman,
H.M. (1982). Nopaline synthase: transcript mapping and DNA sequence.
J. Mol. Appl. Genet. 1, 561-573.

Dickstein, R.T., Bisseling, T., Reinhold, V.N. and Ausubel, EM. (1988).
Expression of nodule-specific genes in alfalfa root nodules blocked at an
early stage of development. Genes Dev. 2, 677-678.

Dietrich, R.A., Radke, S.E., and Harada, JJ. (1992). Downstream DNA
sequences are required to activate a gene expressed in the root cortex of
embryos and seedlings. Plant Cell 4, 1371-1382.

Dreyfus, B.L., and Dommergues, Y.R. (1981). Nitrogen-fixing nodules
induced by Rhizobium on the stem of the tropical legume Sesbania
rostrata. FEMS Microbiol. Lett. 10, 3 13-3 17.

Ebert, P., Ha, S.B., and An, G. (1987). Identification of an essential
upstream element in the nopaline synthase promoter by stable and
transient assays. Proc. Natl. Acad. Sci. USA 84, 5745-5749.

Farrell, L.B., and Beachy, RN. (1990). Manipulation of beta-
glucuronidase for use as a reporter in vacuolar targeting studies. Plant
Mol. Biol. 15, 821-825.

lOl

Finan, T.M., Hirsch, A.M., Leigh, J.A., Johansen, E., Kuldau, G.A.,
Deegan, S., Walker, G.C., and Signer, ER. (1985). Symbiotic mutants

of Rhizobium meliloti that uncouple plant from bacterial differentiation.
Cell 40, 869—877.

Fisher, RE, and Long, S.R. (1992). Rhizobium-plant signal exchange.
Nature 357, 655- 660.

Franck, A., Guilley, H., Jonard, G., Richards, K., and Birth, L. (1980).
Nucleotide sequence of cauliflower mosaic virus DNA. Cell 21, 285-294.

Franssen, H.J., Nap, J.-P., Gloudemans, T., Stickema, W., van Dam,
H., Govers, F., Louwerse, J., van Kammen, A., and Bisseling, T.
(1987). Characterization of cDNA for nodulin-75 of soybean: a gene
product involved in early stages of root nodule development. Proc. Natl.
Acad. Sci. USA 84, 4495-4499.

Fu, H., Kim, S.Y., and Park, W.D. (1995a). High-level tuber expression
and sucrose inducibility of a potato Sus4 sucrose synthase gene requires
5' and 3' flanking sequences and the leader intron. Plant Cell 7, 1387-
1 394.

Fu, H., Kim, S.Y., and Park, W.D. (1995b). A potato Sus3 sucrose
synthase gene contains a context-dependent 3' element and a leader intron

with both positive and negative tissue-specific effects. Plant Cell 7, 1395-
1403.

Gloudemans, T., and Bisseling, T. (1989). Plant gene expression in early
stages of Rhizobium-legume symbiosis. Plant Sci. 65, 1-4.

Govers, F., Franssen, H.J., Pieterse, C., Wilmer, J., and Bisseling, T.
(1990). Function and regulation of the early nodulin gene ENOD2. In
Genetic Engineering of Crop Plants, G.W. Lycett and D.W. Grierson, eds
(London: Butterworths), pp. 259-269.

Hall, T.C., Ma, Y., Buchbinder, B.U., Pyne, J.W., Sun, S.M., and Bliss,
F.A. (1978). Messenger RNA for G1 protein of French bean seeds: cell-

102

free translation and product characterization. Proc. Natl. Acad. Sci. USA
75, 3196-3200.

Hirsch, A.M., Bhuvaneswari, T.V., Torrey, J.G., and Bisseling, T.
(1989). Early nodulin genes are induced in alfalfa root outgrowths
elicited by auxin transport inhibitors. Proc. Natl. Acad. Sci. USA 86,
1244-1248.

Hirsch, A.M. (1992). Developmental biology of legume nodulation. New
Phytol. 122, 211-237.

Hirsch, A.M., Assad, S., Fang, Y., Wycoff, K., and Loebler, M. (1993).
Molecular interactions during nodule development. In New Horizons in
Nitrogen Fixation, R. Palacios, J. Moira and WE. Newton, eds
(Dordrecht: Kluwer Academic Publishers). pp. 291-296.

Ingelbrecht, I.L.W., Herman, L.M.F., Dekeyser, R.A., Van Montagu,
M.C., and Depicker, A.G. (1989). Different 3’ end regions strongly

influence the level of gene expression in plant cells. Plant Cell 1, 671-
680.

Jefferson, RA. (1987). Assaying chimeric genes in plants: The GUS gene
fusion system. Plant Mol. Biol. Rep. 5, 387-405.

Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUS fusions:
B-glucuronidase as sensitive and versatile gene fusion marker in higher
plants. EMBO J. 6, 3901-3907.

Kijne, J.W. (1992). The Rhizobium infection process. In Biological
Nitrogen Fixation, G. Stacey, R.H. Burris, and H]. Evans, eds (New
York: Chapman and Hall), pp. 349-398.

Kunkel, T.A. (1985). Rapid and efficient site-specific mutagenesis without
phenotypic selection. Proc. Natl. Acad. Sci. USA 82, 488-498.

Larkin, J.C., Oppenheimer, D.G., Pollock, S., and Marks, M.D. (1993).
Arabidopsis GLABROUSI gene requires downstream sequences for
function. Plant Cell 5, 1739-1748.

103

Lauridsen, P., Franssen, H., Stougaard, J., Bisseling, T., and Marker,
K.A. (1993). Conserved regulation of the soybean early nodulin ENOD2
gene promoter in determinate and indeterminate transgenic root nodules.
Plant J. 3, 483-492.

Lerouge, P., Roche, P., Faucher, C., Maillet, F., Truchet, G., Prome,
J.C. and Denarie, J. (1990). Symbiotic host-specificity of Rhizobium
meliloti is determined by a sulfated and acylated glucosamine
oligosaccharide signal. Nature 344, 781-784.

Libbenga, K.R., Van Iren, F., Bogers, R.J., and Schraag-Lamers, M.F.
(1973). The role of hormones and gradients in the initiation of cortex
proliferation and nodule formation in Pisum sativum L. Planta 114, 29-

39.

Long, S.R. (1989). Rhizobium-legume nodulation. Life together in the
underground. Cell 56, 203-214.

Maniatis, T., Fritsch, E.F., and Sambrook, J. (1989). Molecular Cloning:
A Laboratory Manual, 2nd ed. (Cold Spring Harbor, NY, USA: Cold
Spring Harbor Laboratory Press).

Mylona, P., Pawlowski, K., and Bisseling, T. (1995). Symbiotic nitrogen
fixation. Plant Cell 7, 869-885.

Nap, J.-P., and Bisseling, T. (1990). Developmental biology of a plant-
prokaryote symbiosis: the legume root nodule. Science 250, 948-954.

Ndoye, 1., de Billy, F., Vasse, J., Dreyfus, B., and Truchet, G. (1994).
Root nodulation of Sesbania rostrata. J. Bacteriol. 176, 1060-1068.

Odell, J.T., Nagy, F., and Chua, N.-H. (1985). Identification of DNA
sequences required for activity of the cauliflower mosaic virus 35S

promoter. Nature 313, 810-812.

104

Owen, D., and Kuhn, LC. (1987). Noncoding 3’ sequences of the
transferrin receptor gene are required for mRNA regulation by iron.
EMBO J. 6, 1287-1293.

Pankhurst, C.E., Broughton, W.J., and Wieneke, U. (1983). Transfer of
an indigenous plasmid of Rhizobium loti to other rhizobia and
Agrobacterium tumefaciens. J. Gen. Microbiol. 129, 2535-2543.

Pawlowski, K., Klosse, U., and de Bruijn, F.J. (1991). Characterization of
a novel Azorhizobium caulinodans ORS571 two-component regulatory

system, NtrY/NtrX, involved in nitrogen fixation and metabolism. Mol. '
Gen. Genet. 231, 124-138.

Pietrzak, M., Shillito, R.D., Hohn, T., and Potrykus, I. (1986).
Expression in plants of two bacterial antibiotic resistance genes after

protoplast transformation with a new plant expression vector. Nucleic
Acids Res. 14, 5857-5868

Ramlov, K.B., Laursen, N.B., Stougaard, J., and Marcker, K.A. (1993).
Site-directed mutagenesis of the organ-specific element in the soybean
leghemoglobin lbc3 gene promoter. Plant J. 4, 577-5 80.

Sanders, P.R., Winter, J.A., Barnason, A.R., Rogers, S.G., and Fraley,
RT. (1987). Comparison of cauliflower mosaic virus 35S and nopaline

synthase promoters in transgenic plants. Nucleic Acids Res. 15, 1543-
1558.

Silver, D., Pinaev, A., Chen, R, and de Bruijn, F.J. (1996). Post-
transcriptional regulation of the Sesbania rostrata early nodulin gene
SrEnod2 by cytokinin. Plant Physiol. 112, 559-567.

Stougaard, J., Sandal, N.N., Gron, A., Kiihle, A., and Marcker, K.A.
(1987). 5’-Analysis of the soybean leghemoglobin lbc3 gene: Regulatory

elements required for promoter activity and organ specificity. EMBO J. 6,
3565-3569.

Szabados, L., Ratet, P., Grunenberg, B., and de Bruijn, F.J. (1990).
Functional analysis of the Sesbania rostrata leghemoglobin glb3 gene

105

5'-upstream region in transgenic Lotus corniculatus and Nicotiana
tabacum plants. Plant Cell 2, 973-986.

Szczyglowski, K., and Legocki, A.B. (1990). Isolation and nucleotide
sequence of a cDNA clone encoding nodule-specific (hydroxy) proline-
rich protein LEnodZ from yellow lupin. Plant Mol. Biol. 15, 361-363.

Szczyglowski, K., Szabados, L., Fujimoto, S.F., Silver, D., and de
Bruijn, F.J. (1994). Site-specific mutagenesis of the nodule-infected cell
expression (NICE) element and the AT-rich element ATRE-BS2* of the
Sesbania rostrata leghemoglobin glb3 promoter. Plant Cell 6, 317-332.

Taylor, C.B., Bariola P.A., Del Cardayre S.B., Raines R.T., and Green
P.J. (1993). RN82: A senescence-associated RNase of Arabidopsis that
diverged fiom the S-RNases before speciation. Proc. Natl. Acad. Sci.

USA 90: 5118-5122.

Tempe, J., and Casse-Delbart, F. (1989). Plant gene vectors and genetic
transformation: Agrobacterium Ri plasmids. In Cell Culture and Somatic
Cell Genetics of Plants, Vol. 6, J. Schell and I.K. Vasil, eds. (San Diego,
CA: Academic Press), pp. 25-49.

Thimann, K.V. (193 6). On the physiology of the formation of nodules on
legume roots. Proc. Natl. Acad. Sci. USA 22, 511-515.

Thornburg, R.W., An, G., Cleveland, T.E., Johnson, R., and Ryan, CA.
(1987). Wound-inducible expression of a potato inhibitor 11-

chloramphenicol acetyltransferase gene fusion in transgenic tobacco
plants. Proc. Natl. Acad. Sci. USA 84, 744-748.

Tjepkema, J.D., and Yocum, CS. (1974). Measurement of oxygen partial
pressure within soybean nodules by oxygen microelectrodes. Planta 119,
3 5 1-3 60.

Trainor, C.D., Stamler, SJ., and Engel, J.D. (1987). Erythroid-specific
transcription of the chicken histone H5 gene is directed by a 3 ’ enhancer.
Nature 328, 827-830.

106

Truchet, G., Roche, P., Lerouge, P., Vasse, J., Camut, S., de Billy, F.,
Prome, J.C. and Denarie, J. (1991). Sulphated lipooligosaccharide

signals from Rhizobium meliloti elicit root nodule organogenesis in
alfalfa. Nature 351, 670-673.

Tsien, H.C., Dreyfus, B.L., and Schmidt, EL. (1983). Initial stages in the
morphogenesis of nitrogen-fixing stem nodules of Sesbania rostrata. J.
Bacteriol. 156, 888-897.

van de Wiel, C., Scheres, B., Franssen, H., van Lierop, M.J., van
Lammeren, A., van Kammen, A., and Bisseling, T. (1990a). The early
nodulin transcript ENOD2 is located in the nodule parenchyma (inner
cortex) of pea and soybean root nodules. EMBO J. 9, 1-7.

van de Wiel, C., Norris, H.J., Bochenek, B., Dickstein, R., Bisseling, T.,
and Hirsch, M.A. (1990b). Nodulin gene expression and ENODZ
localization in effective, nitrogen-fixing and ineffective, bacteria-free

nodules of alfalfa. Plant Cell 2, 1009- 1017.

van Kammen, A. (1984). Suggested nomenclature for plant genes involved
in nodulation and symbiosis. Plant Mol. Biol. Rep. 2, 43-45.

Verma, D.P.S. and Delauney, AJ. (1988). Root nodule symbiosis:
nodulins and nodulin genes. In Temporal and Spatial Regulation of Plant
Genes, R.B. Goldberg, and D.P.S. Verma, eds (New York: Springer-
Verlag), pp. 169-199.

Verma, D.P.S. (1992). Signals in root nodule organogenesis and
endocytosis of Rhizobium. Plant Cell 4, 373-3 82.

Verwoerd, T.C., Dekker, B.M.M., and Hoekema, A. (1989). A small-
scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Res.
17, 2362.

Vijn, I., das Neves, L., van Kammen, A., Franssen, H., and Bisseling, T.
(1993). Nod factors and nodulation in plants. Science 260, 1764-1765.

107

Weiss, I.M., and Liebhaber, S.A. (1995). Erythroid cell-specific mRNA
stability elements in the a2-globin 3' nontranslated region. Mol. Cell.
Biol. 15, 2457-2465.

Witty, J.F., Minchin, F.R., Skot, L., and Sheehy, J.E. (1986). Nitrogen
fixation and oxygen in legume nodules. Oxford Surv. Plant Mol. Cell
Biol. 3, 275-314.

Yang, W.-C., de Blank, C., Meskiene, 1., Hirt, H., Bakker, J., van
Kammen, A., Franssen, H., and Bisseling, T. (1994). Rhizobium Nod
factors reactivate the cell cycle during infection and nodule primordium

formation, but the cycle is only completed in primordium formation.
Plant Cell 6, 1415-1426.

CHAPTER 3

IDENTIFICATION OF CIS-ELEMENTS WITHIN THE 3'

UNTRANSLATED REGION OF THE SrENODZ GENE AND
INTERACTING PROTEINS

108

109

ABSTRACT

Unlike some other plant nuclear genes, whose transcripts are
polyadenylated at multiple sites yielding highly heterogeneous 3'-ends,
SrEnod2 transcripts terminate at three consecutive nucleotide positions.
Previously, we have shown that the 3' UTR of the SrEnod2 gene contains
cis-elements responsible for nodule parenchyma-specific expression. Using
deletions and truncations within the 3' UTR that are fused to the gus
reporter gene in transgenic plants, we have delineated sequence motifs
within the SrEnod2 3' UTR, deletion of which affects tissue-specific
expression. Using a protein-RNA UV-cross linking approach, we have
identified several nodule-specific proteins that interact with the RNA
transcribed from the SrEnod2 3' UTR. Competition experiments have
revealed that sequences between positions +1 and +163 nt downstream of
the stop codon are efficient to compete out the observed protein-RNA
interactions, suggesting that the cis-acting elements responsible for nodule
parenchyma-specific expression co-localize with specific protein binding

sequences.

110

INTRODUCTION

The S. rostrata SrEnod2 gene, encoding a putative cell wall protein (Dehio
and de Bruijn, 1992), and is expressed in the nodule parenchyma during
early stages of both stem and root nodule development (Chen et al., 1996;
Chapter 2), as well as in roots after cytokinin treatment (Dehio and de
Bruijn, 1992; Silver et al., 1996). By examining gus reporter gene
expression in transgenic L. corniculatus plants, cis-elements responsible for
the nodule parenchyma-specific expression have been delimited to the 3'
untranslated region (3' UTR) of the SrEnod2 gene (Chen et al., 1996). The
same 3' UTR appears to confer cytokinin enhancement of the gus reporter
gene expression in transgenic Arabidopsis (D. Silver, R. Chen, and F.J. de
Bruijn, unpublished data). The presence of the SrEnod2 3' UTR is required
for accumulation of the gus reporter transcript in nodules of transgenic
plants, indicating that a post-transcriptional mechanism may be responsible
for the observed nodule parenchyma-specific expression.

Cytokinin up-regulation of SrEnod2 gene expression has been further
characterized using nuclear run-off experiments and application of
transcriptional and translational inhibitors. It has been shown that cytokinin
up-regulation takes place in the cytoplasm, and occurs at a post-
transcriptional level (Silver et al., 1996). This process requires concurrent

protein synthesis, and appears to involve protein phosphorylation as well

111

(Silver et al., 1996). These data suggest that trans-acting protein factor(s)
may be involved in both tissue-specific and cytokinin induced expression of
the SrEnod2 gene by interacting with RNA sequences encoded by the
SrEnod2 3' UTR.

To test this hypothesis, we carried out RNA-protein UV-cross linking
experiments which identified nodule-specific proteins that interact with
RNA sequences encoded by the SrEnod2 3' UTR. Additionally, the effect of
various deletions in and truncations of the 3' UTR of the SrEnod2 gene was
examined in RNA-protein competition experiments, as well as in transgenic
L. corniculatus plants. These analyses revealed that the cis-acting elements
required for nodule parenchyma-specific expression co-localize with protein
binding sites in the RNA sequences derived from the 3’ UTR of the

SrEnod2 gene.

METHODS

Plant growth and nodulation

Sesbania rostrata seeds were surface-sterilized and germinated on petri
dishes in the dark at 28°C for one day, as described by Pawlowski et al.,
(1991). Seedlings were grown for three weeks in autoclaved soil mix

(MetroMixzsand; 2: 1) in grth chambers with an 18-hr light (28°C) and

112

6-hr dark (22°C) cycle. Plants were inoculated with a two-day-old culture
of Azorhizobium caulinodans ORSS71 (Dreyfus and Dommergues, 1981)
on the stems for stem nodulation. Stem tissues and ten-day-old stem nodules
were collected and processed (see below).

Lotus corniculatus transgenic plants were grown for one week in
autoclaved soil mix (VenniculitezsandzMetroMix; 10:10:1) in growth
chambers with a 16-hr light (24°C) and 8-hr dark (18°C) cycle. Plants were
inoculated with a three-day-old culture of Rhizobium loti NZP2037
(Pankhurst, 1983) and grown for 21 days. Plant tissues (nodules, infected
roots, and leaves plus stems) were collected and assayed for GUS activity

(see below).

End-labeling and S1 nuclease protection assay

The 2.4 Kb SacI-EcoRI fragment of the SrEnod2 3’ region was previously
generated using a site-directed mutagenesis approach (see Methods of
Chapter 2). The resulting plasmid was linearized by SacI digestion and the
resulting fragment was end-labeled by T4 DNA polymerase, and Klenow in
the presence of dCTP, dGTP, dTTP and a32P-dATP. The reaction was
controlled in such a way that about 30 nucleotides at each end were labeled
(Maniatis et al., 1989). The labeled fiagment was digested with HindIII, and

the 2 kb SacI end-labeled fragment was purified and used as the S1 probe.

113

S] nuclease protection analysis was performed according to Binder et a1.
(1994). Total RNA was isolated from ten-day-old stem nodules and ethanol
precipitated together with 1x105 cpm (2x106 cpm/pmol) of the prepared S1
probe. Samples were resuspended in 40 ul of 80 % deionized forrnamide,
0.4 M NaCl, 0.04 M PIPES (pH 6.4) and 0.005 M EDTA, heated at 85°C
for 10 min and annealed at 30°C overnight. Samples were diluted with 9
volumes of 0.4 M NaCl, 0.03 M sodium acetate (pH 4.8), 0.001 M ZnClz,
10 ug/ml of sonicated and denatured salmon sperm DNA and S1 nuclease
(1000 units/ml; BRL), and incubated at 370C for 1 hr. The reaction was
terminated by adding of EDTA to a final concentration of 0.015 M,
extracted with phenol-chloroform and ethanol precipitated. Alkaline
hydrolysis was performed by dissolving dried samples in 100 111 of 0.2 N
NaOH and incubation at 42°C for 1 hr. Samples were neutralized with 20 ul
of 1 M Tris-HCl (pH 7.4) and 0.2 N HCl, and ethanol precipitated with 10 u
g of carrier yeast tRNA. Samples were washed in 70% ethanol and air dried.
Samples were resuspended in 4 ul of loading dye, loaded on 6%

polyacrylamide sequencing gels and autoradiographed.
Mapping of 3’-ends of SrEnod2 mRNA by 3' RACE

Mapping of the 3’-ends was carried out by the 3’ RACE (random
amplification of cDNA ends) method described by Frohman et a1. (1988)

114

and Frohman (1990). Total RNA was reverse transcribed in 20 [.11 solution
containing 50 mM Tris-HCl (pH 8.15), 6 mM MgC12, 40 mM KCl, 1 mM
DTT, 1 mM dNTP, 0.5 ug of dT17-adapter primer (5'GACTCGAGTCGAC
ATCGATI73'), 10 units of RNasin, 10 units of AMV reverse transcriptase,
at 42°C for 1 hr. An aliquot of this reaction was used to PCR amplify the 3'
ends of the SrEnod2 transcripts. The PCR reaction was carried out in a
solution, containing 70 mM Tris-HCl (pH 8), 7 mM MgC12, 20 mM
(NH4)2SO4, 10% DMSO, 1.5 mM dNTPs, 25 pmol adapter primer (5'GACT
CGAGTCGACATCG3'), 25 pmol gene-specific primer (5'GAGCTCCAAC
CACTACC3'), 1 ul of reverse transcription reaction mixture and 2.5 units of

Taq polymerase.

Construction of chimeric reporter gene fusion

The 1.9-kb EcoRI-BamHI fragment, which contains the entire 5'
untranslated upstream region of the SrEnod2 gene (see Methods of Chapter
2), was inserted in fi'ont of the gus coding region carried on plasmid
pBIlOl.1 (Clontech Laboratories, Palo Alto, CA) to generate the pBIlOl.1-
S’SrEnodZ vector. The EcoRI end of the fragment was filled in by Klenow
before cloning. The 400 bp and the 241 bp deletions in the SrEnod2 3’
region were generated previously (see Methods of Chapter 2). To generate

construct 32, the 400 bp deletion fragment (SacI-XhoI) was digested with

115

NheI. The resulting 163 bp-long SacI-Nhel fragment was inserted into the
SacI-XbaI sites of pBluescript KS- vector (Stratagene, La Jolla, CA). A
SacI-EcoRI fragment was excised from the resulting plasmid and inserted
into the SacI-EcoRI sites of the pBIlOl.1-5’SrEnod2 vector. To generate
construct 33, the 400 bp deletion fragment was digested with MboI. The
resulting 360 bp MboI-Xhol fragment was inserted into the BamI-II-Xhol
sites of pBS KS- vector. The resulting plasmid was digested with BstXI and
SpeI, Klenow filled-in and religated to remove the polylinker sequence
between the Sacl and BamHI sites. A SacI-Xhol fragment was then excised
and inserted into the SacI-XhoI sites of pBIlOl.1-5’SrEnod2 vector. To
generate construct 34, the 400 bp fragment was digested with Nhel, and the
resulting 237 bp NheI-XhoI fragment was inserted into the XbaI-Xhol sites
of pBS KS- vector. A SacI-Xhol fiagrnent was excised from the resulting
plasmid and inserted into the SacI-Xhol sites of the pBIlOl.1-5’SrEnod2
vector. To generate construct 35, a 40 bp SacI-MboI subfragment of the 400
bp fragment was first inserted into the SacI-BamI-II sites of pBS KS- vector,
a 237 bp NheI (blunt-ended by Klenow fill-in)-Xhol subfragment was
subsequently inserted at the SmaI-Xhol sites of the resulting plasmid. A
SacI-Xhol fragment was then excised and inserted into the SacI-XhoI sites

of the pBI 1 01 . 1-5 ’SrEnodZ vector.

116

Regeneration of Transgenic Lotus corniculatus Plants

Transgenic Lotus corniculatus cv Rodeo plants were generated according
Szabados et a1. (1990). Binary vectors were conjugally transferred into the
Agrobacterium rhizogenes strain A4 (Tempe and Casse-Delbart, 1989).
Re generated plants were transferred to growth chambers (Conviron,

Asheville, NC) and nodulated as described (Szabados et al., 1990).
Histochemical Staining of GUS Enzymatic Activity

GUS enzymatic activity was histochemically analyzed according to the
procedure described by Jefferson (1987) with the following modifications.
Hand-cut nodule sections were incubated at 37°C in a solution containing
50 mM NazPO4 and NaHPO4, pH 7, 1 mM ferri- ferro-cyanide and 20%
methanol, and 1 mM X-Gluc (5-bromo-4-chloro-3-indolyl B-D—glucuronide;
Gold Biotechnology Inc., St. Louis, MO). Stained sections were cleared
through an ethanol and ethylene series and analyzed under a dissection

microscope (Wild MPS52, Heerburgg, Switzerland).

117

RNA-protein UV-cross linking experiments

Cellular protein extracts were prepared as following. Plant materials were
grinded to a fine powder in liquid nitrogen and resuspended in an equal
volume of 2x NP-40 extraction buffer (20 mM HEPES, pH 7.9; 80 mM
KC]; 6 mM MgC12; 2 mM DTT; 10 % glycerol; 0.4 % NP-40; 16 ug/ml
Aprotinin; 4 ug/ml Leupeptin; and 1 mM PMSF). After mixing, an equal
volume of 1x NP-40 extraction buffer was added. The mixture was
centrifuged at 14,000 rpm for 2 min. The supernatant was collected, and
protein concentrations were determined according to Bradford (1976).
Crude extracts were aliquotted and stored at -70°C until use.

Plasmid pBS KS- DNA, containing the 241 bp 3’ UTR fragment was
linearized at the X1101 or Sacl sites and used as template to produce sense or
antisense RNA in in vitro transcription reactions using T7 or T3 RNA
polymerase, respectively, according to the manufacturer’s instructions.
Labeled RNA transcripts were produced by adding a32P-UTP (800
Ci/mmol) in the reaction, and the resulting transcripts had a specific activity
of approximately 3x 107 cpm/11g. Cold RNAs were prepared essentially the
same way except that cold UTP was used in the reactions. Poly(A), poly(C),
poly(G), and poly(U) (Sigma, St. Louis, M0) were resuspended in 1x

binding buffer and stored at -70°C until use.

118

Cellular protein extracts (10 ug) were incubated at room temperature
for 30 min with 125,000 cpm 32P-labeled RNA in 1x buffer containing 40
mM KCl, 10 mM HEPES (pH 7.9), 3 mM MgC12, 1 mM dithiothreitol, and
5 % glycerol. The volume of each reaction was 20 ul. RNase-T1 (20 units;
Boehringer Mannheim, Mannheim, Germany) was added to cleave unbound
RNA, and Heperan sulfate (0.1 mg; Sigma) was added to reduce nonspecific
binding. The reaction mixtures were UV-cross linked using 254 nm UV
radiation (250 mJ/cmz) with a Stratagene UV cross-linking apparatus
(Stratagene, La Jolla, CA) and then separated by electrophoresis on 10 %
SDS-polyacrylamide gels under reducing conditions. Gels were dried and

exposed to x-ray films at -70°C.
RESULTS
Polyadenylation sites of the SrEnod2 transcript

Sequence analysis of SrEnod2 cDNA clones revealed that the SrEnod2
transcript was polyadenylated at the T residue at position +258 nt
downstream of the TAA stop codon (Strittmatter, et al., 1989; Dehio and de
Bruijn, 1992). Since multiple AATAAA-like sequences were present in the
SrEnod2 3' UTR (Figure 3-2), we tested whether multiple polyadenylation

events occurred using both 81 nuclease protection and 3' RACE (rapid

119

LEGEND FOR FIGURE 3-1. S1 nuclease protection assay.

Total RNA of 10-day-old stem nodules of S. rostrata was mixed at the

concentration indicated on top of each lane with 1x 105 cpm Sl probe
prepared from the SrEnod2 3’ region. A single band of 255 nt was protected
after S1 nuclease digestion. Bands of higher molecular weights were
derived fi'om the double-stranded S1 probe.

120

0 10 20 50 150 ugRNA

  

< 255 nt

   

   

 

 

121

amplification of cDNA ends; Frohman et al., 1988). For S1 nuclease
protection assays, total RNA isolated from 10 day-old stem nodules of S.
rostrata plants, hybridized with a 2 kb SacI-HindIII fragment of the
SrEnod2 3' flanking region labeled at the SacI site. As shown in Figure 3-1,
a single protected band of about 255 nt was detected after 81 nuclease
digestion. Since poly(A) signal sequences are normally located 10 to 30 nt
upstream of the poly(A) sites (Hunt, 1994), a single protected band suggests
that the AATAAA-like sequences located between 20 and 30 nt upstream of
the poly(A) site are likely to be the functional poly(A) signals (Figure 3-2).
The polyadenylation sites were further analyzed using 3' RACE and found
to correspond to the A or T at positions +256 and +257. Together with the T
residue found at position +258, these three polyadenylation sites are very
close to each other, indicating that they may be generated by the same

polyadenylation process.

Sequence motifs in the SrEnod2 3' UTR

As shown previously (Chen et al., 1996; Chapter 2), the 241 bp fragment
downstream of the SrEnod2 stop codon contains the minimal cis-element(s)
responsible for nodule parenchyma-specific expression. To delineate
sequence motifs within the SrEnod2 3' UTR that are important for nodule

parenchyma-specific expression, motif deletions and truncations within the

122

CCGGGATACAATCCACCACCATATGGCCACTATCCACCGTCCAAAAAAAATTAA
P G Y N P P P Y G H Y P P S K K N *

CAACCACTACCACTACACGTGGCATGCATATTTTGGTGAICTAATAAATGTCAA
GATTAGTTGTTTGTCATAGTAAAGTTTTTGTTTTCTCCCTCCTTCCCTTTAATI
AATTACCACTTTTAAGATGCATGTGAACTAGCIAGCTACAATGTTCTCCTTCAA
AATAAGGGCTCTATGCATGCCCCTCTCTCTGTAACCTTTGCTTTGCATTTCCCT

tit
TTATCTTGTAATATCAATCAATAAGEACTTTCTCGTTTTATTATCTATGCCTAC

 

CATACAATTACATTCTTTATCATACTTACAAATTAATGATAAGCTAAACGGAAA

ATCTAAACATACATAACACACAGTAGATACAATAATTGTAACACTGTTATGTTA

GTACCAAAAAAAAAAGAGAGAT

FIGURE 3-2. Sequence of the 3’ region of the SrEnod2 gene. A short

54
108
162
216
270
324

378

stretch of C-terminal amino acid sequences is shown. * indicates the stop

codon. The underlined nucleotide sequences represent AATAAA-like
sequences. Nucleotides in bold represent sequences recognized by the

MboI, Nhel, and RsaI enzymes, from the 5’ to 3’direction, respectively.

Arrows indicate the polyadenylation sites identified by using 3 ’ RACE and

cDNA sequencing.

123

3’ UTR were generated. The resulting fragments were fused to the gus
reporter gene and the full-length SrEnod2 5' flanking region (Figure 3-3).
The chimeric reporter gene fusions were introduced into L. corniculatus
plants and their GUS expression was histochemically analyzed.

As summarized in Figure 3-3, a deletion from position +241 to
position +163 maintains nodule parenchyma-specific expression (Construct
32), indicating that sequences between positions +1 and +163 are sufficient
for tissue-specific expression. It should be noted that the potential poly(A)
signal sequences between position +235 and +240 are deleted in this
construct. However, other AATAAA-like sequences are present within this
fragment. For examples, a canonical poly(A) signal sequence AATAAA is
located at position +42, and two additional AATAAA-like sequences are
present at positions +105 and +109, respectively (see Figure 3-2). It is likely
that they may be recognized as alternative poly(A) signal sequences in order
to form the 3'-end of the transcript.

A construct with a deletion in the SrEnod2 3' region fi'om positions +1
to +38 still directed tissue-specific expression of the gus reporter gene
(Figure 3-3, Construct 33). A construct with a deletion from +1 to +163 also
directed nodule parenchyma-specific expression, but GUS activity could
also be detected in the nodule-infected-tissues of some transgenic plants,
indicating a less stringent tissue-specific control of gene expression (Figure

3-3, Construct 34). This data seems to be in contrast with the observation

124

LEGEND FOR FIGURE 3-3. Structure of gus fusion constructs and GUS
expression in transgenic L. corniculatus.

The gas reporter gene was flanked by the SrEnod2 5’ region and various 3’
deletion and truncation fragments. The nucleotide numbers indicate the end-
points of the deletion and truncation fragments, relative to the stop codon.
The arrows represent the poly(A) sites. + and - indicate positive and
negative GUS activity staining, respectively. Constructs 30 and 31 were
previously analyzed (Chen et al., 1996; Chapter 2).

125

5'SrEnod2 3'SrEnod2

‘65—“—

 

 

 

 

 

GUS ACTIVITY STAININ G
CONSTRUCTS

# \ Infected Nodule Root Other

tissue parenchyma tissues
30 ' +400 I I. u n
31 +241 - + . .
32 +163 I + I I
33 +38 v +400 - -l- - .
34 +163 V +400 U- + . ..
35 __-_t-38 +163 V +400 * I. _ _

 

126

that sequences between positions +1 and +163 are sufficient for tissue-
specific expression (see above). However, it is possible that redundant cis-
elements may exist in the SrEnod2 3’ UTR, and that deletion of some
elements resulted in a slightly altered tissue-specific control. Support for
this hypothesis came from the analysis of the expression pattern of a
construct with a deletion of sequences between positions +38 and +163
(Figure 3-3, Construct 35), which was found to direct a similar reporter
gene expression, namely in the nodule parenchyma, and in nodule central
area of some transgenic plants. In constructs 33, 34 and 35, the potential
poly(A) signals remain intact, suggesting that a normal polyadenylation
process may take place. These results taken together suggest that sequences
between positions +38 and +163 may be important for tissue-specific gene
expression, and sequences between positions +163 and +400 may contain

redundant cis-elements.

Proteins from nodule extracts interact with the RNA encoded by the 3'

UTR of the SrEnod2 gene

The SrEnod2 gene is rapidly induced during early nodule development
(Dehio and de Bruijn, 1992). To test whether proteins from nodule extracts

could interact with the RNA encoded by the SrEnod2 3’ UTR, total soluble

proteins prepared from stem cortical tissues and 10-day old stem nodule

127

tissues, were UV-cross linked to 32P-labeled sense and antisense RNAs
generated by transcribing the 241 bp SrEnod2 3’ UTR (see Methods). As
shown in Figure 3-4, several protein bands fi'om stern nodule extracts were
found to be UV-cross linked to the sense RNA of the SrEnod2 3’ UTR (lane
2). Some of the protein bands could also be detected in the UV-cross linking
reaction with proteins from stem cortical tissues in a prolonged exposure,
however, the intensity of labeling was extremely low (lane 1). In UV-cross
linking experiments using the antisense RNA probe, proteins from both
stem and stem-nodule tissues were cross-linked to the RNA, and the
labeling was found to be profuse and identical in stem- and stem-nodule
extracts, indicating a non-specific interactions between the antisense RNA
and proteins from these tissues (data not shown).

Competition experiments using nonspecific competitors were carried
out. As shown in Figure 3-4, UV-cross linking between stem-nodule
proteins and the sense RNA probe was not affected by a 1000-fold excess of
nonspecific competitors: poly(A) and poly(C) (lanes 3-5, and 6-8,
respectively). The cross-linking was totally inhibited by a 1000-fold excess
of poly(G) (Figure 3-4, lanes 9-11). Surprisingly, pre-incubation of the
nodule protein extracts with small amounts of poly(G) shifted the UV-cross
linked bands upwards, although a similar pattern was maintained (Figure 3-

4, lanes 9-11). Pre-incubation of nodule protein extracts with poly(U)

128

LEGEND FOR FIGURE 3-4. RNA-protein UV-cross linking and
competition with non-specific competitors.

Protein extracts (10 1.1g protein) of stem and 10-day-old stem nodule tissues

were incubated with 125,000 cpm 32P-labeled RNA derived from the 241 nt-
long SrEnod2 3’ UTR. Labeled proteins were visualized by
autoradiography. Competition was performed by pre-incubation with 10-,
100-, and 1000-fold (w/w) non-specific competitors: poly(A), poly(C),
poly(G), and poly(U), as indicated. S: stem; SN: stem nodule.

 

129

234567891011121314 LANE

1
S SN SN SN SN SN SN SN SN SN SN SN SN SN PROTEIN
++++++++++++++32P-3’UTR

- .. I POLYIAI I I POLYEI I I POLYIGI I I POLYIUI I COMPETITOR

 

MW(kDa)
— 200
— 116
97.4

—66

—45

—31

 

 

130

inhibited the cross-linking reactions, but to a lesser extent (Figure 3-4, lanes
12-14).

Competition experiments using specific competitors were also carried
out. As shown in Figure 3-5, the 241-nt RNA derived from the SrEnod2 3’
UTR inhibited the cross-linking reactions (lanes 3-4; see Figure 3-3,
Construct 31). The RNA transcribed from a fragment containing sequences
between positions +38 and +400 of the SrEnod2 3’ region inhibited the
cross-linking (lanes 5-6; see Figure 3-3, Construct 33). The RNA
transcribed from the +163 to +400 fragment was found to be less efficient
in the competition experiments (lanes 7-8; see Figure 3-3, Construct 34).
RNA transcribed from the SrEnod2 3’ region (+1 to +400 bp) with a
deletion of sequences between positions +38 and +163, or with a deletion of
sequences between positions +163 to +400, inhibited the cross-linking
reactions as well (lanes 7-8, and 9-10, respectively; see Figure 3-3,
Constructs 35 and 32). These data suggest that the cross-linking between
nodule proteins and the RNA derived from the SrEnod2 3’ UTR are
mediated by sequences located between positions +1 and +163, since
deletion of these sequences results in a RNA that is inefficient in
competition. Furthermore, the presence of multiple labeled bands also
suggests that multiple proteins may interact with the RNA transcribed from

the 3’ UTR of the SrEnod2 gene.

131

LEGEND FOR FIGURE 3-5. RNA-protein UV-cross linking and
competition with specific competitors.

Protein extracts (10 ug protein) of stem and 10-day-old stem nodule tissues

were incubated with 125,000 cpm 32P-labeled RNA derived from the 241 nt-
long SrEnod2 3’ UTR. Labeled proteins were visualized by
autoradiography. Competition was performed by pre-incubation with 10-,
100-fold (w/w) RNAs derived fi'om the deletion and truncation fragments of
the SrEnod2 3 ’ UTR shown in Figure 3-3. S: stem; SN: stem nodule.

132

1 2 3 4 5 6 7 8 9 10 11 12 LANE
S SN SN SN SN SN SN SN SN SN SN SN PROTEIN
+ + + + + + + + + + + + 32P-3’ UTR

- - II] CE [233:] Ill 22:! COMPETITOR
/l/l/I44

MW(kDa)

— 200
— 116
97.4

,—66

 

—45

 

—31

 

 

133

DISCUSSION

SrEnod2 mRNA 3’-end formation

S1 nuclease protection, 3’ RACE and cDNA sequencing experiments reveal
that SrEnod2 transcripts appear to be polyadenylated at three closely-
positioned sites. Three potential poly(A) signal sequences could be
identified and located 20, 24, and 30 nt upstream of position +256,
respectively. Several other AATAAA-like sequences were also found
dispersed throughout the 3’ UTR region. During nodule development, these
upstream AATAAA-like sequences may not be recognized as poly(A)
signals, as evidenced by the lack of detection of poly(A) addition near these
sites (Figure 3-1). However, a reporter gene construct with a deletion of
these potential poly(A) signal sequences still directed reporter gene
expression to the nodule parenchyma (Figure 3-3, Construct 32), suggesting
that some upstream poly(A) signal sequences may be alternatively used in

the absence of these potential signal sequences.

Analysis of sequence motifs within the SrEnod2 3’ UTR

Analysis of chimeric SrEnod2-gus reporter gene expression in transgenic

plants indicates that sequences between positions +1 and +163 could direct

134

the gus reporter gene expression in the nodule parenchyma, suggesting that
this sequence is sufficient to confer tissue-specific expression. This
observation is supported by an altered reporter gene expression directed by
constructs deleted of this sequence (Figure 3-3, Constructs 34 and 35). In
these cases, reporter gene expression was found in nodule parenchyma and
in the infected tissue of some transgenic plants. The reporter gene
expression in the nodule central tissue is particularly interesting, because
this suggests that the SrEnod2 5’ region may have an extremely weak
nodule-specific activity. The presence of the nodule parenchyma-specific
cis-elements within the 3’ UTR inhibits this weak activity in the infected
tissue, and stimulates nodule parenchyma expression.

Another interesting observation is that nodule parenchyma expression
remains observable in transgenic plants expressing constructs deleted of
sequences between positions +1 and +163. This suggests that either
redundant cis-elements exist in regions 3’ to the position +163, or
sequences between position +163 and +400 is a part of a large cis-element,

which after truncation, is still able to direct nodule parenchyma expression.

Proteins that interact with the RNA encoded by the SrEnod2 3' UTR

Using in vitro protein-RNA UV-cross linking experiments, several proteins

of different molecular weights interacting with the RNA transcribed from

135

the SrEnod2 3' UTR have been detected in nodule extracts. These
interactions seem to be specific, since they can not be competed out by
adding a 1000-fold excess of poly(A) and poly(C) homopolymers (Figure 3-
4), but can be competed out by adding a 1000-fold excess of poly(G), and to
a less extent poly(U), indicating that the sequences that interact with these
proteins are GU-rich. Pre-incubation of nodule protein extracts with poly(G)
polymers shifted cross-linking bands upwards. The reason for that is not
clear. Furthermore, presence of multiple proteins interacting with the RNA
derived fiom the SrEnod2 3’ UTR suggests that they may interact with cis-
elements within the SrEnod2 3’ UTR to form a complex. Competition
experiments with specific competitor RNAs derived from the SrEnod2 3 ’
UTR suggests that sequences between positions +1 and +163 interact with
nodule proteins. Thus, these in vitro data correlate nicely with the in vivo
reporter gene expression patterns, suggesting that the sequences between
positions +1 and +163, important for the nodule parenchyma expression,
co-localize with the specific protein-binding activity. The significance of
these interactions remains to be elucidated, but these findings open up
possibilities for the isolation of tissue-specific trans-acting factors by
screening cDNA expression libraries using riboprobes (For example, see
Schumacher et al., 1995), or by using the yeast three—hybrid system
developed by SenGupta et a1. (1996).

l 36
LIST OF REFERENCES

Binder, T., Horowitz, J., Basilion, J.P., Koeller, D.M., Klausner, R.D.,
and Harford, J.B. (1994). Evidence that the pathway of transferrin
receptor mRNA degradation involves an endonucleolytic cleavage
within the 3' UTR and does not involve poly(A) tail shortening. EMBO J.
13, 1969-1980.

Bradford, M.M. (1976). A rapid and sensitive method for the quantitation
of microgram quantities of protein utilizing the principle of protein-dye-
binding. Anal. Biochem. 72, 248-254.

Chen, R., Silver, D., and de Bruijn, F.J. The nodule parenchyma-specific
expression of the Sesbania rostrata early nodulin gene SrEnod2 is
mediated by its 3’ untranslated region (3’ UTR). (manuscript is
submitted).

Dreyfus, B.L., and Dommergues, Y.R. (1981). Nitrogen-fixing nodules
induced by Rhizobium on the stem of the tropical legume Sesbania
rostrata. FEMS Microbiol. Lett. 10, 313-317.

Frohman, M.A. (1990). Race: rapid amplification of cDNA ends. In PCR
Protocols: A guide to methods and applications. M.A. Innis, D.H.,
Gelfand, J .J ., Sninsky, and T.J. White, eds (Academic Press, Inc.), pp.
28-38.

Forhman, M.A., Dush, M.K., and Martin, GR. (1988). Rapid production
of full-length cDNAs from rare transcripts: amplification using a single

gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85,
8998-9002.

Hunt, A.G. (1994). Messenger RNA 3’ end formation in plants. Ann. Rev.
Plant Physiol. Plant Mol. Biol. 45, 47-60.

Jefferson, RA. (1987). Assaying chimeric genes in plants: The GUS gene
fusion system. Plant Mol. Biol. Rep. 5, 387-405.

137

Pankhurst, C.E., Broughton, W.J., and Wienek, U. (1983). Transfer of
an plasmid of Rhizobium loti to other rhizobia and Agrobacterium
tumefaciens. J. Gen. Microbiol. 129, 2535-2543.

Pawlowski, K., Klosse, U., and de Bruijn, F.J. (1991). Characterization of
a novel Azorhizobium caulinodans ORS571 two-component regulatory

system, NtrY/NtrX, involved in nitrogen fixation and metabolism. Mol.
Gen. Genet. 231, 124-138.

Schumacher, J.M., Lee, K., Edelhoff, S., and Braun, RE. (1995). Spnr,
a murine RNA-binding protein that is localized to cytoplasmic
microtubules. J. Cell Biol. 129, 1023-1032.

SenGupta, D.J., Zhang, B., Kraemer, B., Pochart, P., Fields, S., and
Wickens, M. (1996). A three-hybrid system to detect RNA-protein
interactions in vivo. Proc. Natl. Acad. Sci. USA 93, 8496-8501.

Silver, D., Pinaev, A., Chen, R, and de Bruijn, F.J. (1996). Post-
transcriptional regulation of the Sesbania rostrata early nodulin gene
SrEnod2 by cytokinin. Plant Physiol. 112, 559-567.

Szabados, L., Ratet, P., Grunenberg, B., and de Bruijn, F.J. (1990).
Functional analysis of the Sesbania rostrata leghemoglobin glb3 gene 5'-
upstream region in transgenic Lotus corniculatus and Nicotiana tabacum

plants. Plant Cell 2, 973-986.

Tempe, J., and Casse-Delbart, F. (1989). Plant gene vectors and genetic
transformation: Agrobacterium Ri plasmids. In Cell Culture and Somatic
Cell Genetics of Plants, Vol. 6, J. Schell and I.K. Vasil, eds. (San Diego,
CA: Academic Press), pp. 25-49.

CHAPTER 4

THE LjENOD2 GENE IS INDUCIBLE BY ETHYLENE IN ROOTS
OF LOTUS JAPONIC US

138

139

ABSTRACT

The SrEnod2 gene of Sesbania rostrata is induced during early nodule
development, and also in S. rostrata roots treated with the plant hormone
cytokinin in the absence of rhizobial infection. However, since S. rostrata is
not amenable for molecular genetic analysis, we decided to study cytokinin
regulation of nodulin gene expression and its involvement in Lotus
japom'cus, an emerging model legume. The LjEnodZ gene was isolated and
found to be inducible in roots of L. japonicus, but not by cytokinin.
Submergence of the roots in water for several hours was sufficient to induce
Enod2 gene expression. Further analysis revealed that ethylene was the
primary inducer. Application of ethylene inhibitors reduced the Enod2 gene
expression in roots. Pretreatment with the protein synthesis inhibitor
cycloheximide abolished ethylene induction of Enod2 gene expression,

indicating that this process requires concurrent protein synthesis.

140

INTRODUCTION

The Enod2 gene is an early nodulin gene, first isolated from soybean
(Franssen et al., 1987). Its homologues have been isolated from other
legumes, such as pea (van de Wiel et al., 1990a); alfalfa (van de Wiel et al.,
1990b); lupine (Szczyglowski et al., 1992) and Sesbania rostrata (Dehio
and de Bruijn, 1992). Expression of the Enod2 gene in “empty-nodules”
induced on alfalfa roots by Rhizobium nodulation-deficient mutant strains
(Nod’, van de Wiel et al., 1990b), as well as by strains deficient in
exopolysaccharide synthesis (Exo'; Dickstein et al., 1988), indicates that the
Enod2 gene product is not involved in the infection process per se, but
rather in nodule morphogenesis.

The Enod2 gene has also been found to be expressed in “pseudo-
nodules” elicited by auxin transport inhibitors G-Iirsch et al., 1989), or by a
Rhizobium nodulation deficient (Nod') strain carrying a cytokinin
biosynthetic gene tzs (Cooper and Long, 1994) on alfalfa roots. Plant
hormones, therefore, seem to be involved in early nodule development
(Cooper and Long, 1994; for a review, see Hirsch, 1992), as well as in early
nodulin gene expression. Indeed, Dehio and de Bruijn (1992) found that the
Enod2 gene of Sesbania rostrata is induced specifically in roots after

cytokinin treatment. Similar results were reported for alfalfa, although the

141

size of the cytokinin regulated transcript is larger than the corresponding
transcript in nodules (Hirsch, et al., 1993).

Although the cytokinin up-regulation of Enod2 gene expression in
roots is not a common phenomenon in legume plants, the observation that
the SrEnod2 gene is specifically induced in roots of S. rostrata by
cytokinins does provide a model for studying the mechanism of cytokinin
regulated gene expression, as well as cytokinin involvement in nodule
development. We have recently shown that the cytokinin up-regulation of
the SrEnod2 gene expression in roots of S. rostrata occurs at a post-
transcriptional level, takes place mainly in the cytoplasm, requires protein
synthesis, and appears to involve protein phosphorylation and
dephosphorylation (Silver et al., 1996).

To study the developmental and tissue-specific regulation of Enod2
gene expression, we have identified the 3' untranslated region of the
SrEnod2 gene as the minimal DNA sequence determinant responsible for
nodule parenchyma-specific expression (Chen et al., 1996; Chapter 2).
Therefore, we were interested in determining whether the same DNA
sequence was responsible for the cytokinin up-regulation of SrEnod2 gene
expression. Unfortunately, we found that the Enod2 genes of L.
corniculatus, the plant used for our previous reporter gene expression

studies, were not induced by cytokinin treatment. Therefore, the cytokinin

142

effects on Enod2 gene expression could not be studied in L. corniculatus
plants in parallel with the tissue-specific expression.

In a search for other transformable legumes where the Enod2 gene was
regulated in a developmental/tissue—specific manner, as well as by hormone
treatment, we found L. japonicus. The LjEnodZ gene of L. japonicus was
isolated and found to be induced early during nodule development, and to
be induced in roots in the absence of rhizobial infection, but not by
cytokinin treatment. Rather, we found that incubating of roots in water was
sufficient to induce LjEnodZ gene expression. Here, we present
experimental evidence in support of the notion that in L. japonicus roots,

ethylene can induce the expression of the Enod2 gene.

METHODS

Plant growth and treatment

Lotus japonicus Gifu B-129 seeds were surface sterilized and germinated
according to Hansberg and Stougaard (1992). One-week-old seedlings were
transferred into soil (vermiculite:sand, 6:1) and watered with B+D nutrient
solution (Broughton and Dilworth, 1971) containing 0.5 mM KNO3. Plants
were grown in a growth cabinet (Conviron, Asheville, NC) at a 18 hr light
22°C and 6 hr dark 18 °C cycle, with alight intensity of 250 J.J.E/sec/m2 and

143

70 % RH. Two to three weeks old seedlings were gently washed free of soil
and incubated in distilled water, containing the appropriate chemicals
(Sigma, St. Louis, MO). 6-benzylaminopurine, aminoethoxyvinylglycine,
silver thiosulfate, and cycloheximide were used at concentrations of 2, 100,
200, and 100 nM, respectively. To prepare silver thiosulfate, equal volumes
of 0.2 mM silver nitrate and 1.6 mM sodium thiosulfate were mixed before
use, according to Veen (1979). For ethylene treatments, seedlings were
directly removed fiom soil, placed between water-soaked Whatrnann papers
(Schleicher & Schull, Keene, NH) and sealed in jars filled with either air or
20 ppm C2H4.

Isolation of cDNA clones and DNA sequence analysis

A nodule cDNA library of L. japonicus constructed using a oligo-dT primer
in Lambda ZAPII vector (Stratagene Inc, La Jolla, CA), was kindly
provided by Dr. Jens Stougaards, Aarhus, Denmark. Screening of cDNA
clones was carried out according to standard procedures (Maniatis et al.,
1989) and manufacturer’s instructions. DNA sequences were determined by

using the Sequenase 2.0 kit (United States Biochemical Inc., Cleveland,

OH).

144

Southern blot analysis

Genomic DNA was isolated from leaves of L. japonicus using a CsCl
ultracentrifugation protocol (Maniatis et al., 1989). 10 pg of DNA was
digested with the BamHI, EcoRI, HindIII, SalI, XbaI, XhoI (Boehringer
Mannheim, Mannheim, Germany), respectively, electrophorized in 0.8 %
agarose gel. Gels were denatured and renatured according to standard
methods (Maniatis et al., 1989) and blotted onto a Nylon membrane with a
0.45 um pore size (Hybond-N; Amersharn Life Science Inc., Arlington
Heights, IL). Membranes were pre-hybridized and hybridized in 0.5 M
phosphate buffer, pH 7.2, containing 7 % SDS and 1% BSA (Sigma) at
65°C, according to Church and Gilbert (1984). An or 32P-dATP-labeled
DNA fragment containing the SrEnod2 coding region was generated by
random priming (Boehringer Mannheim) and used as a probe. Filters were
washed at 65°C in 2x ssc, 0.1 % SDS for 20 min; and 0.5x SSC, 0.1 %

SDS for 20 min. Filters were exposed to X-ray films at -70°C overnight.
Isolation of total RNA and northern blot analysis
Total RNA was isolated according the hot phenol method of Verwoerd et

al., (1989), with minor modifications (Chen et al., 1996; Chapter 2). Ten

. micrograms of total RNA were electrophorized in 1 % (w/v) agarose gels in

145

1x MOPS buffer (20 mM MOPS, 1 mM EDTA, 5 mM sodium acetate, pH
7) containing 7% (v/v) formaldehyde. Gels were soaked in 10x SSC
solution for 30 min and blotted onto 0.22 um nitrocellulose membranes
(Nitro/Plus; MSI, Westborough, MA). Membranes were probed with an a
32P-dATP-labeled LjEnod2 cDNA fragment, generated by random priming
(Boehringer Mannheim). Filters were re-probed with an HSP70 probe from
Arabidopsis (Wu et al., 1988), an 18S rRNA DNA probe from rice
(Takaiwa et al., 1984), or an ubiquitin probe from S. rostrata (kindly
provided by M. Holsters, University of Gent, Belgium) as loading controls.
All filters were washed at 65°C in 2x SSC, 0.1% SDS for 20 min; 0.5x SSC,
0.1% SDS for 20 min; and 0.2x SSC, 0.1% SDS for 20 min. The signals
were quantified using Phosphorimager analysis (Model 400B, Molecular

Dynamics, Sunnyvale, CA).

RESULTS

cDNA isolation and DNA sequence analysis

The genomic organization of the Enod2 genes in L. japonicus was analyzed
by Southern blotting, using a 32P-labeled DNA fragment containing the
SrEnod2 coding region (Dehio and de Bruijn, 1992). As shown in Figure 4-
' l, a single hybridizing band was found to be present in the BamI-II, HindIII,

146

SalI and XbaI-digested genomic DNA, and two bands in the EcoRI-digested
genomic DNA, suggesting that L. japonicus contains a single Enod2 gene.
To isolate a LjEnodZ cDNA, a nodule cDNA library of L. japonicus was
screened using the SrEnod2 probe. A plasmid with a 1 kb insert was
isolated and its DNA sequence was determined. The deduced amino acid
sequence from this partial cDNA was found to contain proline-rich motifs
(Figure 4-2), resembling those present in the Enod2 proteins of other
legumes (Franssen et al., 1987; van de Wiel et al., 1990a; Dehio and de
Bruijn, 1992; Szczyglowski and Legocki, 1992). Northern blot analysis
revealed that the size of the Enod2 transcript in L. japonicus nodules was

about 4 kb (see below).

Expression of the LjEnod2 gene occurs at an early stage of nodule

development

To examine the temporal expression of the LjEnodZ gene during L.
japonicus nodule development, root and nodule tissues were harvested at
different time after rhizobial infection. Total RNA was isolated and
subjected to northern blot analysis, using the 32P-labeled partial LjEnodZ
cDNA as a probe. As shown in Figure 4-3, expression of the LjEnodZ gene
was induced between 7 and 10 days after infection, when nodule primordia

' were becoming visible on the roots. The expression was further enhanced to

147

LEGEND FOR FIGURE 4-1. Genomic organization of the Enod2 gene in
Lotus japonicus plants.

Genomic DNA of L. japonicus plants (10 ug/lane) was digested with
BamI-II, EcoRI, I-IindIII, SalI, Xbal, and X1101, respectively, and separated
by electrophoresis in a 0.8 % agarose gel. The blot was hybridized with a

3”'P-labeled DNA fragment containing the SrEnod2 coding region. A single
hybridizing band was detected in digestions with all enzymes, except
EcoRI, which gave two hybridizing bands. Molecular markers are
indicated.

148

 

 

149

LEGEND FOR FIGURE 4-2. Nucleotide and the deduced amino acid
sequences of a partial LjEnodZ cDNA clone.

Number 1 is given to the first nucleotide at the 5’ end of the insert. A star
(*) indicates the stop codon. The poly(A) tail is in bold. A single letter
designation is given to each amino acid deduced.

61

121

181

241

301

361

421

481

541

601

661

721

781

841

901

150

GGCACGAGCCAACCTCCACCGTATGAGAACCCCCCACCAGTGCATCCGCCTCCTACACAT

G T 8449 P P P Y E N P P P ‘V H P P P T H
CAGAAGCCATCACCAGGATACCAACCGCCTCATGTGAAACCACCACATATTGCGCCACCA

9 K P 8 P G Y Q P P H V’ K P P H I .A P P
CATGAAAAAACACCACCCAAATACCAACCACCTCATGAGAAGCCACCCTTTGAGAAGCCA

H E K T P P K Y Q P P H E K P P F E K P
CCACTTGAGAAACCACCCCATGAAAAGCCACCACCAGAGTACCAACCTCCTCATAAGAAG

P L E K P P H E K P P P E Y Q P P H K K
CCACCATCACAGTACCAACCACCACCAGAGTACGAACCTCCTCAGGAAAAACCACCACCT

P P S 2 Y Q P P P E Y E P P Q E K P P P
GTGTACCTACCCCCATATTGGAAACCACCACCTGCGTATCCACCTCCATATGAGAAACCA

‘V Y L P P Y ‘W’ K P P P A. Y P P P Y E K P
CCACCAGAGTATGAACCGCCTCAAGAAAAACCACCACCAGTGTATTCGCCTCCATATGAA

P P E Y E P P Q E K P P P ‘V Y 8 P P Y E
AGGCCACCCACAGGGCATCCGACTCCTTACCCACCATTTTATCACCTACCACCTGTGTAT

R P P T G H P T P Y P P F Y H L P P ‘V Y
CACCCCCCTTACGAGAAGCCGCCACCACTATACCAACCTCCTCATGAGAAACCACCCATT

H P P Y E K P P P L Y Q_ P P H E K P P E
TACGAACCTCCCCATGAGAAACCACCCATTTATGAACCTCCTCACGAGAAACCACCACTT

Y E P P H E K P P I Y E P P H E K P P L
TATGAACCACCTCCAGGATACAACCCTCCACCATATGGTCACTATCCACCGTCTAAAAAT

Y E P P H E K P P I Y E P P H E K P P L

TAATGACAACTACTAGTGAAGAACGTGGCAATGTGGCATGCATGTTTTGGTTAACCAAAA
* *

GCAAGAGCAGTTCGTTTGTCACATAAATTTTCACTTTGTTTTTAATTTGATTCATGTTTA
GGAAGCACTTTTAAGATGGGGAGTACAATACTCCACTTCTGCAATGGTTTGTAAAAATAA
GGGCTCTCAATGCCTCTGTGTGTAATAATACCTTTCATTTCCGTTTCAAAAAAAAAAAAA

AAAAA

60

120

180

240

300

360

420

480

540

600

660

720

780

840

900

151

LEGEND FOR FIGURE 4-3. The LjEnodZ gene is expressed early during
nodule development.

Total RNAs were isolated from roots and nodules of L. japonicus at
different times after rhizobial infection, as indicated by the numbers on top
of the lanes. Total RNA was also isolated from roots submerged in water for
8 hr (lane labeled “R”). Ten micrograms of RNA were loaded in each lane

and the blot was hybridized with a 32P-labeled DNA probe prepared from
the insert of the partial LjEnodZ cDNA clone. The same blot was stripped

and re-hybridized with a 32P-labeled constitutively-expressed Hsp70 DNA
probe to calibrate sample loading.

152

7 10 14 22 30 R Days

 

<- LjEnod2

 

 

 

 

kw” “7.x“ Arte-ab 3!"?5553

4- Hsp 70

153

reach a plateau at day 14, when mature nodules had developed. The
LjEnodZ transcript level remained the same up to 30 days after infection.
Thus, the temporal expression pattern of the LjEnodZ gene in root-nodules
of L. japonicus is similar to that of the S. rostrata SrEnod2 gene during
stem-nodule development, and different from the SrEnod2 gene expression

during root-nodule development, where it is expressed in a transient

fashion (Dehio and de Bruijn, 1992).

The LjEnodZ gene is induced in water-submerged roots of L. japonicus

Since the Enod2 gene from S. rostrata had been reported to be induced in
roots treated with cytokinin (Dehio and de Bruijn, 1992; Silver et al., 1996),
we examined whether the LjEnodZ gene could also be induced in roots by
cytokinin application. Two-week-old seedlings, with roots submerged in
water containing 2 M of benzylaminopurine (BAP) or lacking this
hormone, were grown for 8 hr. Total root RNA was isolated and subjected
to northern blot analysis. The result is shown in Figure 4-4. The LjEnodZ
transcript level was found to be greatly enhanced after 8 hr submergence in
water (lanes 1 and 2). The LjEnodZ transcript level in roots submerged in 2
1.1M BAP solution was also enhanced, but to a lower level (Figure 4-4, lane
3). These data indicate that submergence in water alone is sufficient to

' activate LjEnodZ gene expression in roots of L. japonicus. This finding

154

LEGEND FOR FIGURE 4-4. LjEnod2 gene expression in roots of L.
japonicus plants treated with cytokinin.

(A) Northern blot analysis. Roots of two-weeks old seedlings were
submerged in water solution containing 0 (lane 2) or 2 uM
benzylaminopurine (BAP; lane 3) for 8 hr. Total RNAs were isolated and

subjected to northern blot analysis with a 32P-labeled LjEnod2 probe. The
primary LjEnod2 transcript is indicated with an arrowhead. The same blot

was re-hybridized with a 32P-labeled DNA probe encoding for the 188
rRNA to calibrate sample loading. The position of the ribosomal RNAs is
also indicated.

(B) LjEnod2 transcript levels relative to the 18S rRNA level. Relative
LjEnod2 transcript levels were calibrated with the 18S rRNA levels using
Phosphorimager analysis. The RNA level in the root sample at time 0 was
arbitrarily assigned the value 1.

155

a
m
m
4

4 18S rRNA

0000000
654321

SAME mwgmtomgb NESMQ

 

 

 

 

 

 

 

 

156

contrasts with the observation made with the SrEnod2 gene, which has been
shown to be specifically induced by cytokinin and not by submergence of
roots in water (Dehio and de Bruijn, 1992). In fact, cytokinin does not only
fail to induce the LjEnod2 gene expression, but has a slightly negative effect
on the level of the expression induced by water treatment (Figure 4-4, lanes
2 and 3).

To test whether the Enod2 gene expression in roots was specific to
submergence in water or to other side effects, such as wounding resulting
from removing plants from soil, we tested the Enod2 gene expression in
seedlings grown undisturbed in pots. Additionally, to test whether the
induction of the Enod2 gene expression in roots required whole seedlings,
we tested the Enod2 gene expression in excised roots. As shown in Figure
4-5, the LjEnod2 transcript in roots of undisturbed plants could be induced
by water flooding (lanes 1, 4 and 7), indicating that water treatment alone
sufficiently induced the LjEnod2 gene expression. However, the induction
was found to be smaller than the corresponding induction after submerging
roots of plants removed from soil (compare lanes 3 and 4; 6 and 7),
suggesting that other effects, such as wounding could enhance this
induction. The LjEnod2 transcript was also found to be induced in roots
excised from the plants, indicating that the induction did not need whole

seedlings (lanes 1, 2 and 5)

157

LEGEND FOR FIGURE 4-5. LjEnod2 gene expression in roots of L.
japonicus plants.

(A) Northern blot analysis. Three-weeks old seedlings were subjected to
various treatments, such as excision of roots (R), removal fiom soil (S),
before roots were submerged in water, or undisturbed in soil and pots being
submerged (S*), for various time, as indicated at the bottom of panel B.

Total RNA was isolated and subjected to northern blot analysis with a 32P-

labeled LjEnod2 probe. The same blot was re-hybridized with a 32P-labeled
DNA probe encoding the 18S rRNA to calibrate sample loading. The
position of the ribosomal RNAs is also indicated.

(B) LjEnod2 transcript levels relative to the 18S rRNA level. Relative
LjEnod2 transcript levels were calibrated with the 188 rRNA levels using
phosphorimager analysis. The RNA level in the root sample at time 0 was
arbitrarily assigned the value 1.

158

a
m
m

4

 

 

 

 

25$—
18S—

< 18S rRNA

 

 

B

  

0, 5 0 5 0 5 0
3 2 2 1 1
<2”: £3888: mpeema

treatment

 

S*

 

 

 

 

 

 

 

 

 

 

159

The LjEnod2 gene is induced by ethylene in roots of L. japonicus

It has been observed that over-watering of L. japonicus plants causes
accumulation of anthocyanines in the stems, indicating a stress response. It
is also known that ethylene production in plants is induced by a variety of
environmental factors, including wounding, anaerobiosis, chilling and water
stress (Yang and Hoffman 1984; Abeles et al., 1992). To test whether
ethylene was involved in the response of LjEnod2 gene expression to water
treatment, we determined LjEnod2 transcript levels after the application of
ethylene. Three-weeks old seedlings were removed from soil and placed
between two layers of wet Whatmann paper and incubated in sealed jars
containing air or ethylene (20 ppm) for 8 hr. Total RNA was isolated and
subjected to northern analysis. As shown in Figure 4-6, the ethylene
treatment induced the LjEnod2 transcript level to approximately 3.5- and
29-fold, as compared to the control treatment and the initial level,
respectively (compare lanes 3 and 4, and 1 and 4). In the control treatment,
the LjEnod2 transcript level was increased from the initial level to
approximately 8-fold (Figure 4-6, lanes 1 and 3). In the same experiment,
the LjEnod2 transcript level was found to be induced from the initial level
to approximately 36-fold by water submergence (Figure 4-6, lanes 1 and 2).
Since wounding induces ethylene production (Yang and Hoffman 1984;

Abeles et al., 1992), it is likely that the 8-fold induction in control samples

160

LEGEND FOR FIGURE 4-6. The LjEnod2 gene expression in roots of L.
japonicus plants upon ethylene treatment.

(A) Northern blot analysis. Three-weeks old seedlings were gently removed
from soil and sealed in jars filled with either air or 20 ppm ethylene for 8 hr,
as indicated at the bottom of panel B. Total RNAs were isolated and
subjected to northern blot analysis with a 32P-labeled LjEnod2 probe. The

same blot was re-hybridized with a 32P-labeled DNA probe encoding an
ubiquitin mRNA to calibrate sample loading.

(B) LjEnod2 transcript levels relative to the ubiquitin mRNA level. Relative
LjEnod2 transcript levels were calibrated with the ubiquitin RNA levels
using phosphorimager analysis. The RNA level in the root sample at time 0
was arbitrarily assigned the value 1.

161

LjEnod2

 
 

 

iquitin
mRNA

m
. ... ‘

 

 

 

 

 

 

B

   

wwmm flag gm 3%.: «#4 %

   

0505050
433221150

aromas Easemeeemfi

hr

treatment

 

 

air C2H4

 

 

 

 

 

 

162

(air) is due to the action of ethylene produced in response to wounding.
Taking this consideration into account, the ethylene treatment appears to
induce the LjEnod2 gene expression in roots of L. japonicus to a similar

level as the water submergence treatment (Figure 4-6, lanes 2 and 4).

Inhibitors of ethylene biosynthesis and action reduce the induction of

the LjEnod2 transcript level

Since it appeared that ethylene could induce the LjEnod2 gene expression in
roots of L. japonicus, we examined whether application of inhibitors for
ethylene biosynthesis and action could reduce the ethylene mediated
induction of LjEnod2 gene expression. Three-week old seedlings were
incubated in water containing 100 pM aminoethoxyvinylglycine (AVG) and
0.2 mM silver thiosulfate (Ag2S203), respectively. AVG is an inhibitor of
ethylene biosynthesis, since it inhibits specifically ACC synthase, a rate-
limiting enzyme for ethylene synthesis (Yu and Yang, 1979). Silver ion is
an inhibitor of ethylene action (Beyer, 1976; 1979).Total RNA was isolated
and subjected to northern blot analysis. As shown in Figure 4-7, the
LjEnod2 transcript level remained the same after 4 hr treatment with either
AVG or Ag28203 (compare lanes 2, 3, and 4), although the ethylene
production was inhibited by these treatments (data not shown). However,

' after 8 hr treatment with the inhibitors, the level of the LjEnod2 transcript

163

LEGEND FOR FIGURE 4-7. LjEnod2 gene expression in roots of L.
japonicus plants treated with ethylene inhibitors.

(A) Northern blot analysis. Three-weeks old seedlings were treated with 100
M AVG or 200 M silver thiosulfate for various time, as indicated at the
bottom of panel B. Total RNAs were isolated and subjected to northern blot

analysis with a 32P-labeled LjEnod2 probe. The same blot was re-hybridized

with a 32P-labeled DNA probe encoding an ubiquitin mRNA to calibrate
sample loading. The position of the ribosomal RNAs is also indicated.

(B) LjEnod2 transcript levels relative to the ubiquitin mRNA level. Relative
LjEnod2 transcript levels were calibrated with the ubiquitin RNA levels
using phosphorimager analysis. The RNA level in the root sample at time 0
was arbitrarily assigned the value 1.

 

transcript

tin

1qu1

LjEnod2/ub

164

 

 

 

 

 

 

 

AVG Ag+

 

 

 

VG

 

 

 

4 LjEnod2

4 Ubiquitin
mRNA

hr
treatment

165

was reduced to 76 % and 52 % by the AVG and Ag+ treatment, respectively
(compare lanes 5, 6, and 7). Silver ion treatment was found to be more

effective than the AVG treatment, consistent with their mode of actions.

Cycloheximide inhibits the LjEnod2 gene expression in roots

To test whether ethylene could enhance the LjEnod2 transcript
accumulation in the absence of translation, we monitored the LjEnod2
transcript levels in roots after a pretreatment with a translational inhibitor
cycloheximide. Three-week-old seedlings were pretreated for 1 hr with

100 M cycloheximide, a concentration known to be effective for several
plants (Silver et al., 1996). The seedlings were then washed extensively and
incubated in water for 3 and 7 hr, respectively. Messenger RNA levels were
determined by northern blot analysis. As shown in Figure 4-8, pretreatment
with cycloheximide inhibited the accumulation of the LjEnod2 transcript
after subsequent incubation in water up to 7 hr (lanes 4 and 5), suggesting
that de novo protein synthesis may be involved in the ethylene stimulation

of the LjEnod2 transcript accumulation.

166

LEGEND FOR FIGURE 4-8. LjEnod2 gene expression in roots of L.
japonicus plants treated with the protein synthesis inhibitor cycloheximide

(A) Northern blot analysis. Three-weeks old seedlings were pretreated with
100 uM CHX for 1 hr, and roots were submerged in water for additional 3
and 7 hr, as indicated as 4 and 8 hr CHX, respectively, at the bottom of
panel B. Total RNAs were isolated and subjected to northern blot analysis

with a 32P-labeled LjEnod2 probe. The same blot was re-hybridized with a

32P—labeled DNA probe encoding an ubiquitin mRNA to calibrate sample
loading. The position of the ribosomal RNAs is also indicated.

(B) LjEnod2 transcript levels relative to the ubiquitin mRNA level. Relative
LjEnod2 transcript levels were calibrated with the ubiquitin RNA levels
using phosphorimager analysis. The RNA level in the root sample at time 0
was arbitrarily assigned the value 1.

167

= 4 LjEnod2

 

 

 

 

4 Ubiquitin
mRNA

   

 

18S

B

 

505050
2211

£888 Easemeeemb

CHX

 

+

 

+

 

 

 

 

 

 

 

168

DISCUSSION

The LjEnod2 gene is highly conserved and expressed early during

nodule development

Our analysis of the partial LjEnod2 cDNA confirms that the coding region
of Enod2 genes is highly conserved among legume plants. However, the
length of Enod2 transcripts varies significantly. The LjEnod2 gene encodes
a transcript of about 4 kb; whereas for example, the SrEnod2 transcript is
about 1.4 kb. This is consistent with the notion that the nature of the
repeating amino acid motifs, encoded by Enod2 genes, are functionally
more important than their length (van de Wiel et al., 1990a). Like the Enod2
genes isolated from other legume plants, the LjEnod2 gene is induced at an
early stage of nodule development. Unlike the SrEnod2 gene expression in
root nodules of S. rostrata, which has been shown to be expressed in a
transient fashion, the LjEnod2 transcript level reaches a plateau at 14 days

after nodulation, and remains at the same level up to 30 days.

The LjEnod2 gene is induced by ethylene in roots

That ethylene appears to induce LjEnod2 gene expression is surprising, but

interesting. Ethylene has previously been implicated in nodulation, since

169

certain nodulation mutant phenotypes can be restored to wild-type by
adding inhibitors of ethylene biosynthesis and action. For example, when
the sym5 pea mutant which nodulates poorly at 20°C, is treated with AVG
and Ag, the number of nodules formed is increased (F earn and LaRue,
1991). It is also known that nitrate inhibits nodulation. This process may
involve ethylene as well, since application of AVG releases nitrate
inhibition of nodulation (Ligero et al., 1991). Moreover, the “thick and short
roots” (Tsr) phenotype of Vicia sativa subsp. nigra, induced by its
microsymbiont Rhizobium leguminosarum bv Viciae, can be suppressed by
the ethylene inhibitor AVG (Zaat et al., 1989). Unlike other hormones, such
as auxin and cytokinin, which have stimulating effects on nodulation,
ethylene generally appears to have negative effects on early stages of
nodule development (Lee and LaRue, 1992).

Even though the mechanism and significance of LjEnod2 gene
induction by ethylene remains to be elucidated. It is not known at present
why the expression of Enod2 genes from S. rostrata, L. japonicus, and other
legumes such as soybean are regulated differently in roots, one by cytokinin
and one by ethylene, while many others are not induced by these hormones.
Clearly certain cytokinin effects on plant development can be coupled to
ethylene responses. For examples, the observed cytokinin inhibition of root
and hypocotyl elongation in dark-grown Arabidopsis seedlings mimics the

plant response to ethylene (Cary et al., 1995). Application of the ethylene

170

inhibitor AVG partially releases the cytokinin inhibition (Cary et al., 1995).
Furthermore, the coupling between cytokinin and ethylene mediated
responses is evident in the cytokinin-resistant mutant ckrI, which is
resistant to ethylene, and is allelic to the ethylene-resistant mutant ein2
(Cary et al., 1995). Specific induction of Enod2 genes by cytokinin versus
ethylene may not involve a direct coupling between cytokinin and ethylene
action. However, the two signal transduction pathways underlying their
mode of action may overlap. The observation that the induction of LjEnod2
gene expression by ethylene is inhibited by pretreatment with the protein
synthesis inhibitor cycloheximide, suggests that de novo protein synthesis
may be required for the ethylene mediated induction. In this respect,
LjEnod2 induction by ethylene is similar to the cytokinin up-regulation of
the SrEnod2 gene expression (Silver et al., 1996).

The LjEnod2 gene is the first nodulin gene that has been shown to be
ethylene-inducible. This may provide a tool to study ethylene involvement
in nodule development and a tool to study regulation of other nodulin genes

by ethylene.

1 7 1
LIST OF REFERENCES

Abeles, F.B, Morgan, P.W., and Saltveit, Jr. ME. (1992). Ethylene in
plant biology. Academic Press, New York.

Beyer, J r., EM. (1976). A potent inhibitor of ethylene action in plants.
Plant Physiol. 58, 268-271.

Beyer, J r., EM. (1979). Effect of silver ion, carbon dioxide, and oxygen on
ethylene action and metabolism. Plant Physiol. 63, 169-173.

Broughton, W.J., and Dilworth, M.Y. (1971). Control of leghemoglobin
synthesis in snake beans. Biochem. J. 125, 1075-1080.

Cary, AJ., Liu, W., and Howell, SH. (1995). Cytokinin action is coupled
to ethylene in its effects on the inhibition of root and hypocotyl

elongation in Arabidopsis thaliana seedlings. Plant Physiol. 107, 1075-
1082.

Chen, R., Silver, D., and de Bruijn, F.J. The nodule parenchyma-specific
expression of the Sesbania rostrata early nodulin gene SrEnod2 is
mediated by its 3’ untranslated region (3’ UTR). (manuscript is
submitted).

Church, G.M., and Gilbert, W. (1984). Genomic sequencing. Proc. Natl.
Acad. Sci. USA 81, 1991-1995.

Cooper, J.B., and Long, S.R. (1994). Morphogenetic rescue of Rhizobium

meliloti nodulation mutants by trans-zeatin secretion. Plant Cell 6, 215-
225.

Dehio, C., and de Bruijn, F.J. (1992). The early nodulin gene SrEnod2
fi'om Sesbania rostrata is inducible by cytokinin. Plant J. 2, 117-128.

Dickstein, R.T., Bisseling, T., Reinhold, V.N. and Ausubel, RM. (1988).
Expression of nodule-specific genes in alfalfa root nodules blocked at an
early stage of development. Genes Dev. 2, 677-67 8.

172

Fearn, J.C., and LaRue, T.A. (1991). Ethylene inhibitors restore
nodulation to sym5 mutants of Pisum sativum L. cv Sparkle. Plant
Physiol. 96, 239-244.

Franssen, H.J., Nap, J.-P., Goudemans, T., Stiekema, W., van Dam, H.,
Govers, F., Louweres, J., van Kammen, A., and Bisseling, T. (1987).
Characterization of cDNA for nodulin-75 of soybean: a gene product

involved in early stages of root nodule development. Proc. Natl. Acad.
Sci. USA 84, 4495-4499. '

Hansberg, K., and Stougaard, J. (1992). Lotus japonicus, an autogamous,
diploid legume species for calssical and molecular genetics. Plant J. 2,
487-496.

Hirsch, A.M., Bhuvaneswari, T.V., Torrey, J.G., and Bisseling, T.
(1989). Early nodulin genes are induced in alfalfa root outgrowths
elicited by auxin transport inhibitors. Proc. Natl. Acad. Sci. USA 86,
1244-1248.

Hirsch, A.M. (1992). Developmental biology of legume nodulation. New
Phytol. 122, 211-237.

Hirsch, A.M., Assad, S., Fang, Y., Wycoff, K., and Loebler, M. (1993).
Molecular interactions during nodule development. In New Horizons in
Nitrogen Fixation, R. Palacios, J. Moira and WE. Newton, eds. (Kluwer
Academic Publishers, Dordrecht). pp. 291-296.

Lee, K.H., and LaRue, T.A. (1992). Exogenous ethylene inhibits
nodulation of Pisum sativum L. cv Sparkle. Plant Physiol. 100, 1759-
1763.

Ligero, F., Caba J.M., Lluch, C., and Olivares, J.(1991). Nitrate
inhibition of nodulation can be overcome by the ethylene inhibitor
aminoethoxyvinylglycine. Plant Physiol. 97, 1221-1225.

173

Maniatis, T., Fritsch, E.F., and Sambrook, J. (1989). Molecular Cloning:
A Laboratory Manual, 2nd ed. (Cold Spring Harbor, NY, USA: Cold
Spring Harbor Laboratory Press).

Silver, D., Pinaev, A., Chen, R, and de Bruijn, F.J. (1996). Post-
transcriptional regulation of the Sesbania rostrata early nodulin gene
SrEnod2 by cytokinin. Plant Physiol. in press.

Szczyglowski, K., and Legocki, A.B. (1990). Isolation and nucleotide
sequence of cDNA clone encoding nodule-specific (hydroxy) proline-rich
protein LEnodZ from yellow lupin. Plant Mol. Biol. 15, 361-363.

Takaiwa, F., Oono, K., and Sugiura, M. (1984). The complete nucleotide
sequence of a rice 17S rRNA gene. Nucleic Acids Res. 12, 5441-5448.

van de Wiel, C., Scheres, B., Franssen, H., van Lierop, M.J., van
Lammeren, A., van Kammen, A., and Bisseling, T. (1990a). The early
nodulin transcript ENOD2 is located in the nodule parenchyma (inner
cortex) of pea and soybean root nodules. EMBO J. 9, 1-7.

van de Wiel, C., Norris, H.J., Bochenek, B., Dickstein, R., Bisseling, T.,
and Hirsch, M.A. (1990b). Nodulin gene expression and ENOD2

localization in effective, nitrogen-fixing and ineffective, bacteria-free
nodules of alfalfa. Plant Cell 2, 1009-1017.

Veen, H. (1979). Effects of silver on ethylene synthesis and action in cut
carnations. Planta 145, 467-470.

Verwoerd, T.C., Dekker, B.M.M., and Hoekema, A. (1989). A small-
scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Res.
17, 2362.

Wu, C.H., Caspar, T., Browse, J., Lindquist, S., and Somerville, C.
(1988). Characterization of an HSP70 cognate gene family in
Arabidopsis. Plant Physiol. 88, 731-740.

Yang, S.F. and Hoffman, N.E. (1984). Ethylene biosynthesis and its
regulation in higher plants. Annu. Rev. Plant Physiol. 35, 155-189.

174

Yu, Y.B., and Yang, S.F. (1979). Auxin-induced ethylene production and
its inhibition by aminoethoxyvinylglycine and cobalt ion. Plant Physiol.
64, 1074-1077.

Zaat, S.A.J., van Brussel, A.A.N., Tak, T., Lugtenberg, B.J.J., and
Kijne, J .W. (1989). The ethylene-inhibitor aminoethoxyvinylglycine
restores normal nodulation by Rhizobium Ieguminosarum biovar. Vicia
on Vicia sativa subsp. nigro by suppressing the ‘thick and short roots’

phenotype. Planta 177, 141-150.

CHAPTER 5

FUNCTION OF THE ENOD2 PROTEIN IN NODULES

175

176

ABSTRACT

The Enod2 gene encodes a putative cell wall protein, and Enod2 transcripts
are localized in the nodule parenchyma, which has been hypothesized to
function as a barrier for oxygen diffusion. To examine the proposed role of
nodulin Enod2 in the formation of this oxygen barrier, we attempted to
down-regulate Enod2 gene expression in transgenic Lotus corniculatus
plants by expressing antisensc Enod2 constructs. In transgenic plants, the
endogenous Enod2 transcript levels were found to be altered, but not
completely abolished. Expressing the antisense Enod2 constructs did not
affect plant growth and nodulation, and nodules were found to be able to
reduce acetylene, indicating the presence of a functional nitrogenase
enzyme. However, nodules formed on several transgenic antisense plants
appeared to be smaller than those on control plants, indicating an alteration
in nodule morphogenesis. Oxygen microelectrode measurements revealed

that the oxygen diffusion profile of some transgenic plants may be altered.

177

INTRODUCTION

Oxygen plays an important role in symbiotic nitrogen fixation. On the one
hand, the nitrogenase activity requires high energy (ATP) input, which has
to be generated by bacterial oxidative phosphorylation in the nodule
infected cells. On the other hand, the nitrogenase complex is irreversibly
and rapidly inactivated by oxygen (Robson and Postgate, 1980). This
apparent oxygen paradox is reconciled by the creation of a microaerobic
environment inside of nodules. Direct measurements of nodule internal
oxygen concentration (Oi) have provided evidence for the presence of
physical, as well as variable oxygen diffusion barriers in nodules, to allow a
continuous flow of oxygen to the infected cells of the nodule, while
maintaining the Oi at a low level to prevent nitrogenase from inactivation.
Using oxygen microelectrodes, Tjepkema and Yocum (1974) were
able to measure the free oxygen concentration in nodules of soybean
(Glycine max Merr.). They found that the 02 concentration decreased
sharply across the nodule cortex and was below the detection level in
central tissues. These data suggested that the resistance to O2 diffusion into
the nodule primarily occurred within the cortex. Subsequently, Witty et a1.
(1987) confirmed this observation in nodules of pea (Pisum sativum) and
French bean (Phaseolus vulgaris). Detailed microscopic examination of the

nodule anatomy revealed that the inner cortex (named nodule parenchyma

178

thereafter) has compact and small cells, with fewer intercellular spaces than
in other nodule tissues (van de Wiel et al., 1990). Since oxygen diffusion is
approximately four orders of magnitude slower in solution than in air, the
nodule parenchyma, therefore has been hypothesized to be the site of
resistance to oxygen diffusion in nodules (van de Wiel et al., 1990).

A nodule variable resistant barrier to oxygen has been identified in
experiments, in which the nitrogenase was found to be active in nodules
exposed to higher rhizosphere 02 concentration (Sheehy et al., 1983; for a
review, see Hunt and Layzell, 1993) The change in resistance to 02 has been
linked to inhibition of nitrogenase activity by a number of environmental
and physiological factors (for a review, see Hunt and Layzell, 1993).
However, the site of the variable barrier and its relationship to the physical
barrier are currently not well understood.

The expression of the Enod2 gene has been localized to the nodule
parenchyma (Nap and Bisseling, 1990; van de Wiel et al., 1990). Since it is
a putative cell wall protein, the Enod2 protein has, therefore, been
postulated to contribute to the special morphology of the nodule
parenchyma, and the formation of the oxygen diffusion barrier (van de Wiel
et al., 1990). To test this hypothesis, we have used a genetic approach to
down-regulate Enod2 gene expression in transgenic L. corniculatus plants,
by expressing antisensc Enod2 transcripts. We have generated antisensc

expressing constructs using both a strong constitutive promoter and a

179

nodule parenchyma-specific promoter. Here, we report the phenotypic and

physiological analysis of these transgenic plants.

METHODS

Plant transformation and growth

L. corniculatus plants were grown in soil mix (V ermiculitezsandzMetroMix,
5:3:1) in pots maintained in a controlled environment cabinet (Conviron,
Asheville, NC) at 24°C during the day and 20°C at night, with a 16 hr
photoperiod (250 pE/sec/m2). For nitrogenase activity measurements, six
cuttings of each plant to be analyzed were generated and grown for one
week to regenerate roots. These plants were inoculated with a two-day-old
culture of Rhizobium loti NZP 2037 (Pankhurst, 1983) and grown for two
weeks. Plants were subsequently repotted into silica sand, in sealable pots,
and grown for two weeks. During this grth period, plants were watered
with B+D nutrient solution (Broughton and Dilworth, 1971), containing 0.5

mM KNO3.

180

Isolation of total RNA and northern blot analysis

Total RNA was isolated following the hot phenol method of Verwoerd et
al., (1989), with modifications described previously (Chen et al., 1996;
Chapter 2). Northern blot analysis was carried out following standard
procedures (Maniatis et al., 1989). A a32P-dATP-labeled DNA fragment

containing the SrEnod2 coding region was used as a probe.
Antisense Enod2 constructs preparation

A 1.3 kb MspI fiagment, containing the 5’ UTR and most of the SrEnod2
coding region (Dehio and de Bruijn, 1992), was cloned into the Ach site of
pUC18 (GIBCO BRL, Gaitherburg, MD) to generate plasmid pCD21
(Dehio and de Bruijn, 1992). To generate the antisense Enod2 construct
containing coding sequences (Figure 5-1, Construct 37), a 900-bp BamI-II-
SpeI fragment was excised and inserted into the BamHI-SpeI sites of the
binary vector pROK2275 (Szabados et al., 1990), harboring a modified
polylinker between the CaMV3SS promoter and the gas coding region
(Ach-BamHI-SalI-SmaI-Spel). To generate the antisense Enod2 construct
containing primarily 5’ sequences (Figure 5-1, Construct 36), a 400-bp
SpeI-PstI fragment was excised from pCD21 and inserted into the XbaI-PstI

sites of pUC18. The resulting plasmid was digested with PstI and blunt-

181

ended with T4 DNA polymerase (Maniatis et al., 1989). The linearized
plasmid was digested with BamHI, and the 400 bp resulting fragment was
purified and inserted into the BamHI and the blunt-ended SalI sites of the
modified binary vector pROK2275. To generate the antisense Enod2
construct containing primarily 3’ sequences (Figure 5-1, Construct 38), a
280-bp BamHI-Kpnl fragment was excised fiom pCD22A (Dehio and de
Bruijn, 1992), and cloned into the BamHI-Kpnl sites of pROK2275. To
generate the antisense Enod2 constructs without the gus gene, the 1.3 kb
BamHI and blunt-ended HindIII fragment of pCD21 was cloned into the
BamHI and blunt-ended SacI sites of the binary vector pB1121 (Clontech
Laboratories, Palo Alto, CA) (Figure 5-1, Construct 39), or the binary
vector 5 ’SrEnod2-gus-3 ’SrEnodZ (Figure 5-1, Construct 40; see Chapter 2).

Oxygen microelectrode measurement of nodule oxygen tensions

Oxygen microelectrode measurements were carried out essentially as
described by Tjepkema and Yocum (1974) with the following
modifications. Briefly, nodules were detached from roots 21-28 days after
nodulation and embedded in 0.5 % agarose positioned on top of a layer of

solidified 1 % agarose in a 1 cm3

chamber. Nodules were positioned in such
a way that the apical region points to the side of the chamber and that the

nodules were 1 to 1.5 cm under the surface. An oxygen electrode (ca. 10 pm

182

in tip width; kindly provided by Dr. David Emerson, Michigan State

University, MI) was used to monitor the oxygen tension.

Measurement of nitrogenase activity using an open-flow gas exchange

system

The open-flow gas exchange system developed by Hunt et al., (1989) was
utilized to measure nitrogenase activity. Briefly, nodulated plants were
grown in silica sand for two weeks and the pots were sealed one day before
gas exchange. A computer-controlled mixture of gases was passed through
the pots and both H2 and CO2 evolution in the efflux was measured using a
112 analyzer (Model H-lSO, Morgen Instruments, Andover, MA) and an
infi'ared CO2 analyzer (Model 225, Mark III, Analytical Development
Corporation, Hoddesdon, U.K.). Apparent nitrogenase activity (ANA) was
defined as the level of 1-12 evolution in air. Total nitrogenase activity (TNA)
was defined as the level of 112 evolution in ArzOz. Potential nitrogenase
activity (PNA) was defined as the maximum rate of H2 evolution in ArzOz,
during a linear increase in p02 from 20 to 100 % in a 30-min period (Diaz
del Castillo et al., 1992). For dry weight measurement, nodules were first

dehydrated in a 80°C baking oven for two days and then weighed.

183

RESULTS
Generation of antisense Enod2 constructs

Three antisensc Enod2 constructs were generated using fragments covering
the 5', internal and 3' portions of the SrEnod2 genomic locus (Figure 5-1,
Constructs 36, 37, and 38; Dehio and de Bruijn, 1992). To facilitate the
detection of expression of these antisensc constructs, these fragments were
fused, in an antisense orientation, to a bacterial gus reporter gene (Jefferson,
1987). A strong promoter from CaMVBSS (Benfey et al., 1989) was
employed to generate antisensc transcripts. The constructs were introduced
into L. corniculatus plants by A. rhizogenes-mediated plant transformation
(Szabados, et al., 1990). The expression of the antisense transcripts was
monitored in roots of transgenic plants by GUS activity staining, and found
to be positive in 12 out 30, 7 out of 23, and none out of 16 plants, harboring
the antisense constructs containing the 5’, 3’ and the coding sequences,
respectively (data not shown). The other two antisensc constructs (Figure 5-
1, Constructs 39 and 40) were constructed such that a DNA fragment
containing the 5’ and internal portions of the SrEnod2 gene was fused in an
antisense orientation to either the CaMV35S promoter or the SrEnod2 5 ’

and 3’ sequences responsible for directing expression to the nodule

184

LEGEND FOR FIGURE 5-1. Antisense Enod2 constructs.

(A) The SrEnod2 gene locus. The black box represents the SrEnod2 coding
region. Open boxes at each end of the black box represents the 5’ and 3’
untranslated regions of the SrEnod2 gene.

(B) Subfi'agments of the SrEnod2 gene. 5’-, internal-, and 3’- indicate
subfragments corresponding to the 5’, internal, and 3’ portions of the
SrEnod2 gene, respectively.

(C) The binary vector used to generate the 5’-, Intemal-, and 3’- antisensc
Enod2 constructs. The insertion site and orientation are indicated by an
arrow. The construct numbers and description are provided.

(D) A antisensc Enod2 construct. The fragment containing the 5’ and
internal portions of the SrEnod2 gene was inserted between the CaMV35S
promoter and the 3’ nos terminator. The construct number and description
are provided.

(E) A antisensc Enod2 construct. The fragment containing the 5’ and
internal portions of the SrEnod2 gene was inserted between the SrEnod2 5’
and 3’ flanking sequences (Chen et al., 1996; see Chapter 2). The construct
number and description are provided.

 

 

185

 

 

 

 

 

 

 

 

 

 

 

5'- Internal-

‘\ ’1 /
._ ,x/’/

 

 

 

 

Cansss _ 3'nos

 

 

Construct 36: 5'-Antisense

Construct 37: Intemal-Antisense
Construct 38: 3'-Antisense

 

 

 

cwzsm 3'nos

Construct 39: 35S-Antisense

 

 

 

 

 

 

s mm m s W !

Construct 40: SrEnod2-Antisense

 

I

 

 

 

 

 

186

parenchyma (Chen et al., 1996; see Chapter 2). 40 and 80 transgenic plants '

harboring these two antisensc constructs, respectively, were generated.

Phenotype of antisense Enod2-expressing transgenic plants

The majority of the 69 transgenic L. corniculatus plants harboring the
antisense constructs 36, 37, and 38, as well as 8 plants transformed with the
control construct, 5'Srglb3-gus-3 'nos (designated as pLP32; Szabados, et al.,
1990), appeared to be normal as compared to wild type plants. However, a
couple of plants harboring the 5'-antisense Enod2 construct (Figure 5-1,
Construct 36), showed severely altered phenotypes (reduced intemode
length and early senescence of leaves). The reason for that is not clear. One
possibility is that the expression of rolABC genes (White et al., 1985) from
the A grobacterium rhizogenes strain used to transform L. corniculatus
plants in these experiments caused the observed plant grth phenotypes,
since tobacco plants expressing these genes showed similar phenotypes
(Sinkar et al., 1988; Estruch et al., 1991a; b). However, the possibility that
the expression of the 5’-antisense Enod2 transcript caused the phenotype
can not be completely ruled out.

Transgenic plants were also tested for their nodulation characteristics.
All plants, including those plants showing severe phenotypes, could be

effectively nodulated. Nodules were pink, indicating that they were able to

187

fix nitrogen. This was confirmed by monitoring nitrogenase activity using
the acetylene reduction assay (data not shown). When transgenic plants with
altered endogenous Enod2 transcripts levels (see below) were chosen to
measure their nodule fresh weight and number, nodules formed on several
of these plants were found to be smaller than those formed on the wild type

and control plants (Figure 5-3).

Endogenous Enod2 mRNA levels in transgenic antisensc plants

Endogenous Enod2 mRNA levels in nodules of transgenic antisense plants
were examined by Northern blot analysis. Two major Enod2 transcripts
were found in wild type nodules (Figure 5-2, Panel A). Transgenic antisense
plants were found to contain various levels of these two transcripts (Figure
5-3, Panel B). A total disappearance of the two endogenous Enod2
transcripts was not observed in 69 individual transgenic plants harboring the
three different antisensc constructs (Figure 5-1, Constructs 36, 37, and 38;
data not shown). Similar results were obtained after analyzing 120
transgenic plants transformed with the other two constructs (Figure 5-1,
Constructs 39 and 40; data not shown).

Accumulation of the antisense transcripts was also examined in the
transgenic plants, and the antisense transcripts could not be detected. Since

the activity of the GUS fusion protein had been detected in transgenic

188

LEGEND FOR FIGURE 5-2. The Enod2 gene expression in L.
corniculatus plants.

(A) Northern blot analysis. The Enod2 gene expression during nodule
development of wild type L. corniculatus plants is shown. Two major
transcripts were detected 14 days after rhizobial infection.

(B) Northern blot analysis. The endogenous Enod2 gene expression in
transgenic plants harboring the 5’- and Intemal- antisensc Enod2 constructs
is shown. The position of ribosomal RNAs is indicated.

 

 

189

21 28 Days

14

 

 

m2..—
5.:
I:
3%
E. .m

cudm

 

190

LEGEND FOR FIGURE 5-3. Nodule fresh weight of transgenic L.
corniculatus plants harboring antisense Enod2 constructs.

Nodules formed between 4 and 5 weeks after rhizobial infection were
collected and weighed. Six replicates for each transgenic line were assayed.
The solid black boxes represent average values, and the error bars represent
the standard deviation.

 

 

 

 

 

191

 

< bra:

< Ymmmq
< E

< \- Tm

< cmfi

< warm

< m TEH
< v.2:

u

< w-m

.1.

A
”.5

<v1m

32.85 sure are 23:2

192

plants, it is possible that the antisense transcripts were not stable, or the

level of expression was low in these transgenic plants.

Oxygen microelectrode measurements of nodule Oz tension

The nodule oxygen profiles were determined by advancing an oxygen
microelectrode (10 pm in diameter) into a nodule embedded in agarose.
Measurements were made every 100 um within the agarose and every

50 um after reaching the surface of the nodule.

In case of wild type nodules, the oxygen concentration was found to
decrease gradually within the agarose and to drop sharply afier advancing
50 to 100 um into the nodules (Figure 5-4A, Panel A). The decrease in 02
concentration within the agarose may be due to bacterial or plant
respiration, since no significant decrease in 02 concentration in the agarose
was observed in the absence of nodules. The drop in the 02 concentration
inside nodules may be due to the presence of the O2 barrier, as reported by
Tjepkema and Yocum (1974). We observed that the 02 concentration on the
surface of nodules remained relatively constant for nodules derived from the
same plant, this phenomenon may reflect a balance between nodule
respiration and oxygen diffusion capacity. The O2 concentration on the
surface of wild type nodules was found to be 135.7 +/- 11.4 uM (Figure 5-

4B), while the 02 concentration on the surface of nodules derived from

193

LEGEND FOR FIGURE 5-4. Oxygen microelectrode measurement of 02

concentrations across nodules of transgenic plants expressing antisensc
Enod2 transcripts.

Nodules three- to four-weeks of age were excised from both wild type
plants and transgenic plants harboring the 5’- antisense construct (Figure 5-
1, Construct 36), and embedded in 0.5 % agarose. Oxygen concentration
within the agarose and across the nodule were measured in a step-wise
fashion. Measurements were made from 1 to 6 nodules. For each nodule,
three to four measurements were made.

(A) The p02 profiles of nodules. The oxygen profiles of a representative
nodule of the wild type (Panel A), a control plant harboring the pLP32
construct (Panel B), and two transgenic plants (Panel C: 5’-24, Panel D:
5’-20) were shown. The Y axis represents oxygen concentration in M, and
the X axis represents the distance (cm) from the nodule surface, as indicated
by the cross-point of the Y and X axis.

(B) The 02 concentration on the nodule surface. The 02 concentration on
the surface of nodules of transgenic plants expressing the 5’- Antisense
transcript was shown. The solid black boxes represent average values, and
the error bars represent the standard deviation.

 

194

 

5hr .

we; .

.t?

in

a
v.

0.00 1.00

-l.00

-2.00

4
..
a

 

1.00

-1.00 0.00

-2.00

 

 

" 7'. r.
”via/11, .

.tt

 

1.

.00 0.00

-1

-2.00

 

. 1......

.

 

1.00

-1.00 0.00

-2.00

 

 

B

 

mmwmmo

1

A23 8:66:

omr<.m
e H -<.m
omr<.m
vm-<.m
WSW

wm-<.m

 

NMrmrH
C w I<.W

me 3:25. :6 5:338:69 NC

 

"F'
r

 

 

 

 

 

195

several transgenic plants was found to be much lower than that of wild type
(Figure 5-4B). Additionally, the 02 concentration inside nodules of these
particular transgenic plants appeared to drop much more gradually (Figure
5-4A, Panels C and D). However, the 02 concentration on the surface of
nodules of a control plant harboring the pLP32 construct was found to be
lower than that of wild type nodules (93.79 +/- 17.17 M; Figure 5-4B).
The reason for this observation is not clear. Still, the 02 concentrations
appeared to drop sharply across the nodule surface in this plant (Figure 5-
4A, Panel B).

Nitrogenase activity in nodules of transgenic antisensc plants

To assess the effect of expressing antisensc Enod2 transcripts on
nitrogenase activity, we measured the nodule nitrogenase activity using a
non-invasive open gas exchange system (Hunt et al., 1989). Nodulated
transgenic plants were grown in silica sand in pots, which were sealed for
gas exchange analysis (see Methods). Six replicates for each plant were
analyzed. Apparent nitrogenase activity (ANA, 112 production in air); total
nitrogenase activity (TNA, H2 production in Ar:Oz); and potential
nitrogenase activity (PNA, maximum [-12 production in Ar:O2 as p02 is
increased from 20 % to 100 %) were measured simultaneously. Based on

the resulting data, the electron allocation coefficient (EAC=1-ANA/TNA;

196

LEGEND FOR FIGURE 5-5. Measurement of nitrogenase activity.

Apparent nitrogenase activity (ANA), total nitrogenase activity (TNA), and
potential nitrogenase activity (PNA) were measured in an open-flow gas
exchange system (Hunt et al., 1989). Plants 4 to 5 weeks after rhizobial
infection were analyzed and six replicates for each transgenic line were
tested. The black, gray, and white columns represent the average values.
The Error bars represent the standard deviation.

Nitrogenase Activity (umol H2/g DW/h)

197

 

198

proportion of electrons allocated to N2 fixation) and the oxygen limitation
coefficient of nitrogenase (OLCn=TNA/PNA; index of degree to which 02
supply limits nitrogenase activity) were calculated. On a nodule dry weight
basis, the nitrogenase activities appeared to be qualitatively the same in
nodules of transgenic antisense-expressing plants versus control plants
(Figure 5-5). Differences in the EAC and OLCn in transgenic antisense-
expressing plants and control plants were also found to be statistically
insignificant (Figure 5-6), indicating that plants transformed with these

antisensc Enod2 constructs have a normal nitrogen-fixing activity.
DISCUSSION

Transgenic L. Corniculatus plants expressing antisensc Enod2

transcripts form small nodules

The majority of transgenic plants harboring antisensc Enod2 constructs
grew normally and could be efficiently nodulated. However, several
antisensc transgenic plants formed nodules smaller than the wild type
(Figure 5-3), indicating an alteration in nodule morphogenesis in these
transgenic plants. The molecular mechanism underlying the small nodule
phenotype is not known. However, it has been reported that nodule

' morphogenesis can be modified by exposure to different levels of ambient

199

LEGEND FOR FIGURE 5-6. Electron allocation and oxygen limitation
coefficients of nitrogenase.

The electron allocation coefficient of nitrogenase was calculated based on
the equation (EAC=l-ANA/TNA). The oxygen limitation coefficient of
nitrogenase was calculated based on the equation (OLCn=TNA/PNA). The
black and white columns represent the average values of six independent
measurements. The error bars represent the standard deviation.

200

gum
emum
w-.m
#1er
gum
«1%

m Th7:

5.2

mm»:

 

8
.7
6
5
4
3
2
l
0

9 .
0

0

0 0 0 0 0 0 0
emanoweaxz .«e ~535er

558:8: aowhxo “Ea 2.29580 5532?. :93qu

201

oxygen concentration. For example, nodules of cowpea were able to adapt
through morphological and structural changes to function under sub- and
supra-ambient oxygen pressures (Dakora and Atkins, 1990). When cowpea
plants were grown in 1% oxygen, nodules appeared to be smaller with small
but round parenchyma cells. When plants were grown in 20 % and 80 %
oxygen, nodules appeared to be 2- and 4- fold bigger, respectively, with
long and compact parenchyma cells. The interpretation of these data was
that the O2 resistance barrier could be morphologically and structurally
modified. At low 02 tensions, a large surface area, relative to the infected
cells, and a less compact cell structure could be sufficient to provide
resistance to 02. At high 02 tensions, a small surface area and a compact

cell structure would be required.

Measurement of p02 in nodules

The monitoring of p02 across the different cell layers of nodules of
transgenic plants expressing antisensc Enod2 transcripts, suggests that the
p02 across nodules of several transgenic plants dropped gradually, as
opposed to sharply, as observed in control nodules (Figure 5-4A). Although,
a detailed microscopic study would be necessary to correlate the cell

structures of these transgenic nodules with the altered profile of p02, the

202

alteration in the p02 profile, nevertheless, suggests that resistance to 02 in

nodules of these transgenic plants may be modified.

Nitrogenase activity in nodules of transgenic plants expressing

antisensc Enod2 transcripts

The nitrogenase activity (ANA; TNA; and PNA) measurements revealed
that there were no significant differences between transgenic antisense
plants and control plants. These studies are consistent with previous
observations that legume plants can modify their nodule structures to adapt
different rhizosphere pO2 environments (Dakora and Atkins, 1990).
Additionally, the presence of a physical diffusion barrier may not be the
only mechanism that was evolved in nodules of legume plants to prevent
nitrogenase fi'om inactivation. For examples, several proline-rich proteins
have been identified in the extracellular space of nodule cortex (Sherrier and
VandenBosch, 1994), and a glycoprotein has been found to be localized in
the cortex‘ of nodules, whose transcript level seems to be elevated upon
increasing the ambient oxygen pressure (James et al., 1991). Therefore,
multiple cell wall proteins may be involved in the oxygen regulation of
nodule nitrogen fixation. Down-regulation of Enod2 gene expression alone

may not be sufficient to negatively influence nitrogenase activity.

203
LIST OF REFERENCES

Benfey, P.N., Ren, L., and Chua, N.-H. (1989). The CaMV35S enhancer
contains at least two domains which can confer developmental and tissue
specific expression patterns. EMBO J. 8, 2195-2202.

Broughton, W.J., and Dilworth, M.Y. (1971). Control of leghemoglobin
synthesis in snake beans. Biochem. J. 125, 1075-1080.

Chen, R., Silver, D., and de Bruijn, F.J. The nodule parenchyma-specific
expression of the Sesbania rostrata early nodulin gene SrEnod2 is
mediated by its 3 ’ untranslated region (3’ UTR). (manuscript is
submitted).

Dakora, F. D. and Atkins C. A. (1990). Morphological and structural
adaptation of nodules of cowpea to functioning under sub- and supra-
ambient oxygen pressure. Planta 182, 572-582.

Dehio, C. and de Bruijn, F., J. (1992). The early nodulin gene SrEnod2
from Sesbania rostrata is inducible by cytokinin. Plant J. 2, 117.

Diaz del Castillo L., Hunt 8., Layzell DB. (1992). 02 regulation and 02-
limitation of nitrogenase activity in root nodules of pea and lupin.
Physiol. Plant. 86, 269-278.

Estruch, J.J., Chriqui, D., Grossmann, K., Schell, J., and Spena, A.
(1991a). The plant oncogene rolC is responsible for the release of
cytokinins from glucoside conjugates. EMBO J. 10, 2889-2895.

Estruch, J.J., Schell, J., and Spena, A. (1991b). The protein encoded by
the rolB plant oncogene hydrolyses indole glucosides. EMBO J. 10,
3 125-3 128.

Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUS fitsions:
B-glucuronidase as sensitive and versatile gene fusion marker in higher
plants. EMBO J. 6, 3901-3907.

204

Hunt, 8., King, B.J., and Layzell, D.B. (1989). Effects of gradual increase
in 02 concentration on nodule activity in soybean. Plant Physiol. 91,
3 15-321 .

Hunt, S. and Layzell D.B. (1993) Gas exchange of legume nodules and the
regulation of nitrogenase activity. Annu. Rev. Plant Physiol. Plant Mol.
Biol. 44, 483-511.

James, E. K., Sprent, J. I., Minchin, F. R. and Brewin, N. J. (1991)
Intercellular location of glycoprotein in soybean nodules: effect of altered
rhizosphere oxygen concentration. Plant, Cell and Env. 14, 467-476.

Maniatis, T., Fritsch, E.F., and Sambrook, J. (1989). Molecular Cloning:
A Laboratory Manual, 2nd ed. (Cold Spring Harbor, NY, USA: Cold
Spring Harbor Laboratory Press).

Nap. J-P. and T. Bisseling (1990) Developmental biology of a Plant-
prokaryote symbiosis: The legume root nodule. Science 250, 948-954.

Pankhurst, C.E., Broughton, W.J., and Wienek, U. (1983). Transfer of
an plasmid of Rhizobium loti to other rhizobia and Agrobacterium
tumefaciens. J. Gen. Microbiol. 129, 2535-2543.

Robson, R.L., and Postgate, J.R. (1980). Oxygen and hydrogen in
biological nitrogen fixation. Annual Rev. Microbiol. 34, 183-207.

Sheehy, J.E., Minchin, ER, and Witty, J.F. (1983). Biological control of
the resistance to oxygen flux in nodules. Ann. Bot. 52, 565-571.

Sherrier, D.J., and VandenBosch, K.A. (1994). Localization of repetitive
proline-rich proteins in the extracellular matrix of pea root nodules.
Protoplasma 183, 148-161.

Sinkar, V.P., Pythoud, F., White, F.F., Nester, E.W., and Gordon, M.P.
(1988). MIA locus of the Ri plasmid directs developmental abnormalities
in transgenic tobacco plants. Genes Dev. 2, 688-697.

205

Szabados, L., Ratet, P., Grunenberg, B., and de Bruijn, F.J. (1990).
Functional analysis of the Sesbania rostrata leghemoglobin glb3 gene 5'-

upstream region in transgenic Lotus corniculatus and Nicotiana tabacum
plants. Plant Cell 2, 973-986.

Tjepkema, J., D. and Yocum, C., S. (1974) Measurement of oxygen
partial pressure within soybean nodules by oxygen microelectrodes.
Planta 119, 351-360.

Van de Wiel, C., Scheres, B., Franssen, H., van Lierop, M-J., van
Lammeren, A., van Kamen, A. and T. Bisseling (1990) The early
nodulin transcript Enod2 is located in the nodule parenchyma (inner
cortex) of pea and soybean root nodules. EMBO J. 9, 1-7.

Verwoerd, T.C., Dekker, B.M.M., and Hoekema, A. (1989). A small-
scale procedure for the rapid isolation of plant RNAs. Nucleic Acids Res.
17, 23 62.

White, F.F., Taylor, B.H., Huffman, G.A., Gordon, M.P., and Nester,
E.W. (1985). Molecular and genetic analysis of the transferred DNA

regions of the root-inducing plasmid of Agrobacterium rhizogenes. J.
Bacteriol. 164, 33-44.

Witty, J.F., Skot, L., and Revsbech, N.P. (1987). Direct evidence for
changes in the resistance of legume root nodules to O2 diffusion. J. Exp.
Bot. 38, 1129-1140.

CHAPTER 6

CONCLUSIONS AND FUTURE PERSPECTIVES

206

207

Nodule Parenchyma Expression of the SrEnod2 Gene

Nodulin genes are a group of plant nuclear genes induced in a spatio-
temporal fashion during nodule development (Nap and Bisseling, 1990;
Mylona et al., 1995). Their expression is believed to be mediated by the
interaction between cis-acting DNA elements and trans-acting protein
factors (de Bruijn and Schell, 1992). The dissection of the signal
transduction pathways controlling nodulin gene expression is crucial for our
understanding of how legume plants evolved to coordinate nodulin gene
expression and for our future efforts to extend the beneficial Rhizobium-
legume interaction to other agriculturally important crop plants such as the
cereals.

The Enod2 gene is one of the best characterized early nodulin genes,
whose expression is localized in nodule parenchyma (van de Wiel et al.,
1990). The SrEnod2 gene isolated fiom the stem-nodulating legume S.
rostrata is particularly interesting, because it is not only expressed during
nodule development, but also in roots with the plant hormone cytokinin.
Chapter 2 of this dissertation focuses on the developmental and tissue
specific regulation of SrEnod2 gene expression and shows that, unlike many
other nodulin genes whose expression is controlled by their promoters (de
Bruijn and Schell, 1992), the 3' untranslated region of the SrEnod2 gene

' mediates nodule parenchyma-specific expression. In a separate study, the

208

same 3' UTR has been shown to be responsible for the cytokinin up-
regulation of gene expression, which occurs post-transcriptionally in
cytoplasm (D. Silver, Ph.D. dissertation research, Michigan State
University, MI). It is plausible that the nodule developmental regulation and
the cytokinin up-regulation of the SrEnod2 gene expression involve the
same mechanism. Regardless, these findings provide direct evidence for the
first time that a 3’ UTR confers cell-specific expression and that the
cytokinin signal transduction pathway may be involved in nodule
development.

There are several explanations for the observation that the 3 ’ UTR
mediates tissue-specific expression of the SrEnod2 gene (see Chapter 2).
One favored hypothesis is that the SrEnod2 3’ UTR contains tissue-specific
mRNA stabilization element(s) that are responsible for gene expression in
the nodule parenchyma. Post-transcriptional regulation mechanisms clearly
play important roles in the regulation of gene expression. Obviously, it is
beneficial for a cell to use a post-transcriptional mechanism to maintain
needed transcript levels.

Future experiments will focus on the isolation of trans-acting protein
factors that interact with cis-elements located within the SrEnod2 3 ’ UTR
that may be responsible for tissue-specific expression. Chapter 3 describes
the results of initial efforts to address this question. Using in vitro RNA-

protein UV-cross linking assays, multiple proteins were found to interact

209

with cis-elements within the 3’ UTR, but the fimctional significance of
these findings will depend on the isolation of these RNA-binding proteins
and the examination of their function in vivo. Techniques, such as the yeast
three-hybrid system (SenGupta et al., 1996), and direct screening of cDNA
expression libraries using riboprobes (Schumacher et al., 1995), may be
useful for the isolation of RNA-binding proteins. One possible disadvantage
of these techniques is that the selection procedure relies only on the
physical, and not the biological properties of RNA. However, the tissue-
specificity of putative RNA-binding proteins can be directly examined in
nodules by northern analysis and by RNA in-situ hybridization. Thus, non-
specific interacting proteins may be eliminated.

Other techniques to isolate trans-acting proteins that interact with the
3 ’ UTR include genetic approaches using Arabidopsis thaliana. It has been
shown that the gus reporter gene directed by the 5 ’SrEnod2-gus-3 ’SrEnodZ
construct (Figure 2-2A, Construct l), is specifically induced by cytokinins
in the roots of transgenic Arabidopsis plants (D. Silver, Ph.D. dissertation
research). Therefore, Arabidopsis plants harboring both the 5’SrEnod2-gus-
3’SrEnod2 and the 5’SrEnod2-codA-3’SrEnod2 constructs could be
mutagenized and the M2 population screened for survival on medium
containing 5-fluorocytosine (Perera et al., 1993; Stougaard, 1993). Mutant

lines can be further examined for lack of the gas gene expression to make

210

sure that the mutations occurred in trans, and the corresponding genes could

be isolated using positional cloning (Gibson and Somerville, 1992).

Ethylene Induction of the LjEnod2 Gene

The finding that the Enod2 gene from L. japonicus (LjEnod2) is inducible in
roots by the plant hormone ethylene is interesting, because this suggests
that ethylene may be involved in nodule development. Further support for
this hypothesis could come fi'om a direct comparison of the mechanisms of
ethylene action and the developmental regulation of the LjEnod2 gene.
Ethylene responsible elements (EREs) have been identified in the promoter
regions of several ethylene-inducible genes (Ohme-Takagi and Shinshi,
1995; Shinshi et al., 1995; Sessa et al., 1995; Nicholass et al., 1995; and
Sato et al., 1996). It is quite possible that the promoter region of the
LjEnod2 gene contains such EREs. However, this raises several interesting
questions about the finding that Enod2 genes from different legumes are
regulated differently. Are there any links between cytokinin and ethylene
actions in Enod2 gene expression? How are these different signaling

pathways incorporated into the nodule organogenesis process?.

 

211

The Role of Enod2 Protein in Nodule Development

The Enod2 protein has been speculated to be involved in formation of an 02
diffusion barrier in nodules (Nap and Bisseling, 1990; van de Wiel et al.,
1990). Transgenic L. corniculatus plants transformed with antisense Enod2
constructs form small nodules as compared to wild type plants, suggesting
an alteration in nodule morphogenesis. Furthermore, the 02 profile of
several of these transgenic antisensc plants appears to be different from wild
type plants, suggesting an alteration in resistance to Oz diffusion. However,
these analyses have been complicated by the observation that the
endogenous Enod2 transcript levels were altered, but not abolished.
Generation of a null mutant line might eventually prove the hypothesis that
Enod2 protein contributes to the formation of the 02 diffusion barrier in
nodules. The model legume plant, L. japonicus, which contains a single
Enod2 gene, may prove to be the best system to study Enod2 function.
Additionally, alternative vehicles to express antisensc RNAs, such as rRNA
which is successfully used in T etrahymena thermophila (Sweeney et al.,
1996), may be exploited for a high level of expression of antisense Enod2
transcripts and for efficient gene silencing. These will be the future projects

in our lab.

 

2 12
LIST OF REFERENCES

de Bruijn, F.J., and Schell, J. (1992). Regulation of plant genes
specifically induced in developing and mature nitrogen-fixing nodules:
cis-Acting elements and trans-acting factors. In Control of Plant Gene
Expression, D.P.S. Verma, ed. (Boca Raton, FL: CRC Press), pp. 241-
258.

Gibson, 8., and Somerville, C. (1992). Chromosomal walking in
Arabidopsis thaliana using yeast artificial chromosomes. In Methods in
Arabidopsis Research, C., Koncz, N.-H., Chua, and J ., Schell, eds (World
Scientific Publishing Co.), pp. 119-143.

Mylona, P., Pawlowski, K., and Bisseling, T. (1995). Symbiotic nitrogen
fixation. Plant Cell 7, 869-885.

Nap, J.-P., and Bisseling, T. (1990). Developmental biology of a plant-
prokaryote symbiosis: the legume root nodule. Science 250, 948-954.

Nicholass, F., Smith, C.J.S., Schuch, W., Bird, GR, and Grierson, D.
(1995). High levels of ripening-specific reporter gene expression directed

by tomato fi'uit polygalacturonase gene-flanking regions. Plant Mol. Biol.
28, 423-435.

Ohme—Takagi, M., and Shinshi, H. (1995). Ethylene-inducible DNA
binding proteins that interact with an ethylene-responsive element. Plant
Cell 7, 173-182.

Perera, R.J., Linard, C.G., and Signer, ER. (1993). Cytosine deaminase
as a negative selection marker for Arabidopsis. Plant Mol. Biol. 23, 793-
799.

Sato, F., Kitajima, S., Koyama, T., and Yamada, Y. (1996). Ethylene-
induced gene expression of osmotin-like protein, a neutral isoform of
tobacco PR-5, is mediated by the AGCCGCC cis-sequence. Plant Cell
Physiol. 37, 249-255.

213

Schumacher, J.M., Lee, K., Edelhoff, S., and Braun, RE. (1995). Spnr,
a murine RNA-binding protein that is localized to cytoplasmic
microtubules. J. Cell Biol. 129, 1023-1032.

SenGupta, D.J., Zhang, B., Kraemer, B., Pochart, P., Fields, S., and
Wickens, M. (1996). A three-hybrid system to detect RNA-protein
interactions in vivo. Proc. Natl. Acad. Sci. USA 93, 8496-8501.

Sessa, G., Meller, Yael., and Fluhr, R. (1995). A GCC element and a G-
box motif participate in ethylene-induced expression of the PRB-I b gene.
Plant Mol. Biol. 28, 145-153.

Shinshi, H., Usami S., and Ohme-Takagi, M. (1995). Identification of an
ethylene-responsive region in the promoter of a tobacco class I chitinase
gene. Plant Mol. Biol. 27, 923-932.

Stougaard, J. (1993) Substrate-dependent negative selection in plants using
a bacterial cytosine deaminase gene. Plant J. 3, 75 5-761.

Sweeney, R., Fan, Q., and Yao, M.-C. (1996). Antisense ribosomes:
rRNA as a vehicle for antisensc RNAs. Proc. Natl. Acad. Sci. USA 93,
85 l 8-8523 .

van de Wiel, C., Scheres, B., Franssen, H., van Lierop, M.J., van
Lammeren, A., van Kammen, A., and Bisseling, T. (1990). The early
nodulin transcript ENOD2 is located in the nodule parenchyma (inner
cortex) of pea and soybean root nodules. EMBO J. 9, 1-7.

"11111111111000