. 0 NA- ..

 

 

x}. .- . W ._..

{-a'
'4"

u

 

NEW?"

gifiggiqi

o

 

2‘ -,
‘ t

:31!
gm}:

‘ 9
:E;EZ§,’:
‘yja
X ‘1

‘ A
§;:’:"£:""| ‘ g {11

in .. Hy
Ma‘w‘

3.x“,
'::::2:
mgr-:13:
M3
,L}!.l}
I

 

 

, J
‘ mi‘v
ji‘.

1‘; x
133:!

.. 11.x
u~ ‘4’.”
You

¢.¢
.x
t

.4

”'5! '4‘: m.

.~u«
run

!
31

€
=i

w-

~ -rr~a
u

..

algal: '
Ifii§¥§fi§nz."
chi! u'é'yzzxtl.
ts

$123303:

v
om..m.
utoaer.

~«w..”.

....v- _‘, ,,
.«waqmu.
n.0,.‘w

»~o ._

‘ I».
am...»
a .ump..-

no

a L». >
we; .

. 5:
$3353
. :63

v.
5"; I

’f-\‘ _

r" ,

:1' «WK 5;,
zihifi‘ #1? ’v

I
.

.43:
w-wv
w
>4

£15;
‘.

4.33.“ ' ." 1‘
7-}. a '5

33355:

$93:

 

"2233!:

“, his“; .u. »,'
ézgsaisziv a.
r 9,. ‘- is?"
fli‘, :4. '3 iii-:3
3?, - 33 5
‘23:; '5

 

     

1L

 

, .
:r
V

‘. ‘3 wt.
{55%}; ‘.i: L
. ”I

‘ 5.“;
Wifir

P“
9

uncmom sure UNIVE

m WIN/Him I“

 

 

 

 

 

 

 

 

7F“

III/mm

983

Ill/ll

I
293 01389

I [III

3

This is to certify that the

thesis entitled

CLONING AND EXPRESSION OF MODIFIED COAT PROTEIN GENES OF
ZUCCHINI YELLOW MOSAIC VIRUS TO STUDY THE MECHANISM OF
COAT PROTEIN MEDIATED RESISTANCE IN MELONS

presented by

GEETHANJALI AKULA

has been accepted towards fulfillment
of the requirements for

ms. degree in WING AND
GENETICS HORTICULTURE

 

4/

,, . 'y I u
-I / _ l f,» , .’ ’h
/ ‘ ‘
/C » "6.1 ’\.'/‘-t-. ,(

Major professor

Date OIL-ii" 5:4 (WI;

0-7639 MS U is an Affirmative Action/Equal Opportunity Institution

 

 

 

LIBRARY
Michigan State
University

 

 

 

PLACE ll RETURN BOX to romovo this ohookout from your noord.
TO AVOID FINES mum on or baton doto duo.

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

MSU is An Afiirmotivo Action/Equal Opportunity Institution
Wanna-9.1

CLONING AND EXPRESSION OF MODIFIED COAT PROTEIN GENES or
ZUCCHINI YELLOW MOSAIC VIRUS To STUDY THE MECHANISM OF
COAT PROTEIN MEDIATED RESISTANCE IN MELONS
By

Geethanjali Akula

A THESIS

submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE
Plant Breeding and Genetics Program
and Department of Horticulture

1996

ABSTRACT

CLONING AND EXPRESSION OF MODIFIED COAT PROTEIN GENES OF
ZUCCHINI YELLOW MOSAIC VIRUS TO STUDY THE MECHANISM OF COAT
PROTEIN MEDIATED RESISTANCE

By

Geethanjali Akula

To study the mechanism of coat protein (CP) mediated protection to zucchini yellow
mosaic virus (ZYMV), a sense defective version of ZYMV-Ct coat protein (CP-SD)
and the variable amino-terminal portion of the coat protein (CP-N'l') were engineered for
expression in plants. In vitro transcription and translation assays showed that CP-SD and
CP-NT are capable of producing a transcript but CP-SD is incapable of producing a
protein. Four versions of the ZYMV coat protein: full length, the conserved core portion
of the protein, CP-SD, and CP-NT genes were introduced into Nicotiana benthamiana
plants via Agrobacterium tumefaciens mediated transformation. The plants transformed
with FLCP, Core, CP-SD, CP-NT constructs produced the mRNAs from the respective
transgenes. FLCP and Core transgenics produced detectable amounts of protein. No
protein was detected in CP-SD transgenics as expected. Inheritance of the inserted NPT

II gene was verified by ELISA in the progeny of the self fertilized transgenic plants.

To

My Mother
Satyavathi Akula

iii

ACKNOWLEDGMENTS

I would like to thank my guidance committee, Drs. Rebecca Grumet, Richard Allison,
James F. Hancock for their support, helpful advice during the course of my study here at
Michigan state university, and for their efl‘orts in correcting and editing this dissertation. I
am especially grateful to Dr. Rebecca Grumet for her academic guidance, help and ideas
throughout this project. I thank Dr. Mike Thomashow and co-workers, for all the
valuable suggestions, and for allowing me to use some of their lab facilities. I thank Sue
Hammar, for her excellent assistance and technical support. I also wish to thank Dr. Sarah
Glimour for teaching the hybridization techniques. Thanks to Kathy Wilhelm for
reviewing the dissertation.

I would like to thank my parents Gopala Rao and Satyavathi, my brother 1R. Akula
for their encouragement and support. Special depth of gratitude to my brother and best
friend Dr. S.N. Akula for‘being there for me. Finally, I must thank my husband Murali

for his help, patience and understanding through out the course of this study.

iv

TABLE OF CONTENTS

LIST OF TABLES .................................................................................................................... vi
LIST OF FIGURES ................................................................................................................... vii
LIST OF ABBREVIATIONS ................................................................................................... viii

CHAPTER ONE: INTRODUCTION AND LITERATURE REVIEW

INTRODUCTION .................................................................................................................... 1
LITERATURE REVIEW ......................................................................................................... 3
LITERATURE CITED ............................................................................................................. 32

CHAPTER TWO: CLONING OF ALTERED COAT PROTEIN GENES OF
ZUCCHINI YELLOW MOSAIC VIRUS

INTRODUCTION .................................................................................................................... 44
MATERIALS AND METHODS ............................................................................................... 48
RESULTS ................................................................................................................................. 60
DISCUSSION ........................................................................................................................... 79
LITERATURE CITED .............................................................................................................. 87

CHAPTER THREE: VIRUS SUSCEPTIBILITY TESTS ON NICOTIANA BENTI-IAMIANA

INTRODUCTION ..................................................................................................................... 91
MATERIALS ANDMETHODS ................................................................................................ 93
RESULTS .................................................................................................................................. 96
DISCUSSION ............................................................................................................................ 100
LITERATURE CITED ............................................................................................................... 104

LIST OF TABLES

Table

1. Characterization of the putatively transgenic Ro individuals of
Mbenthamiana .................................................................................................. 66

2. Summary of the analyses performed on NPT-positive FL-CP
transformants .......................................................................................................... 69

3. Summary Of the analyses performed on NPT-positive Core
transformants ........................................................................................................... 7O

4. Summary of the analyses performed on NPT-positive CP-SD
transfonnants ........................................................................................................... 71

5. Summary Of the analyses performed on NPT-positive CP-NT
tmnsformants ............................................................................................................ 72

6. Segregation ratios for the expression of NPT II gene as detected
by NPT-ELISA in the R1 progeny of transgenic Mbenthamiana
plants ........................................................................................................................ 78

7 Response Of ZYMV isolates to transgenic melon expressing ZYMV-CF '
and their ability toinfect Mbenthamiana ................................................................... 98

LIST OF FIGURES

Figures
1. The cDNA sequence and predicted amino acid sequence

of the 3’ terminal 1546 nucleotide of ZYMV ............................................ 50
2. Genetic engineering of ZYMV CP-NT gene

for expression in plants ............................................................................... 51
3. Genetic engineering OfZYMV CP-SD gene

for expression in plants ............................................................................... 53
4. Three versions of ZYMV CP gene .............................................................. 61
5. In vitro transcription and translation ............................................................ 63
6. In vitro transcription and translation ............................................................ 64

7. PCR amplified ZYMV CP DNA fiagments from
transgenic plants .......................................................................................... 67

8. Accumulation of transcripts of ZYMV CP gene
constructs in transgenic plants ..................................................................... 73

9. Detection OfZYMV CP and Core and CP-SD
protein in transgenic plants .......................................................................... 76

vii

LIST OF ABBREVIATIONS

 

 

Name of the virus Abbreviation
Potyviruses

zucchiniyellow mosaic ZYMV
virus

watermelon mosaic virus WMV
watermelon strain of PRV-W
papaya ringspot virus

Tobacco etch virus TEV
Tobacco vein mottling TVMV
virus

Potato virus Y PVY
Plum pox virus PPV
Johnsongrass mosaic virus JGMV
Lettuce mosaic virus LMV
Papaya ringspot virus PRSV
Soybean mosaic virus SMV
Bean yellow mosaic virus BYMV
Clover yellow vein virus CYVV
Peanut stripe virus PstV
Pepper mottle virus PeMV
Pea mosaic virus PeaMV
Turnip mosaic virus TuMV
Other viruses

Tobacco mosic virus TMV
Alfalfa mosaic virus AlMV
Potato virus X PVX
Tobacco rattle virus TRV
Potato spindle tuber viroid PSTV
Cucumber mosaic virus CMV
Rice stripe virus RSV
Tomato spotted wilt virus TSWV
Potato leafroll virus PLRV
Potato acuba mosaic virus PAMV
Pea early browining virus PEBV
Tomato mosaic virus TOMV
Potato virus S PVS
Potato mop top virus PMT V

 

viii

CHAPTER ONE

INTRODUCTION AND LITERATURE REVIEW

INTRODUCTION

Viruses can cause serious losses of yield and quality in many crops grown in
agriculture, horticulture and forestry (Fraser, 1992). Over the past decade the tools of
molecular biology have permitted rapid advances in our understanding of plant viruses and
their replicative strategies. The discovery that expression of a viral coat protein gene (CP)
in transgenic plants could protect against virus infection, was rapidly followed by several
examples of genetically engineered virus resistance in various groups of viruses (Grumet,
1990, 1994, 1995; Beachy et al. 1990; Fitchen and Beachy, 1993; Wilson, 1993; Nelson et
al. 1990). However the mechanism of such protection is not clearly understood. It is likely
that mechanisms will be difl‘erent depending on the virus host combination in CP-mediated
protection (Lal and Lal, 1993).

Information about the molecular mechanisms is essential to predict the long-term
stability of coat protein mediated protection and the possible ecological and biological
effects of growing crops engineered to resist viruses (Chasan, 1994). Understanding the
mechanism of protection and multiple functions of coat protein may lead to designing of
second generation CP genes that improve resistance and extend its applicability to still
more viruses and crop plants (Beachy, 1993).

Coat protein mediated protection has been successfirlly demonstrated for zucchini

yellow mosaic virus in melons (Fang and Grumet 1993). It is not known, however which

molecule (CP or CP transcript) or domains of the coat protein are critical in conferring
protection. The goal of this study is to clone altered ZYMV CP genes, develop a
modelsystem to study the mechanism, and produce transgenic plants expressing altered
CPgenes,which can be used to address questions dealing with both homologous and

heterologous virus protection

LITERATURE REVIEW

Many crop plants are infected by viruses. Plant viruses have an enormous negative
impact on agricultural crop production through out the world (Scholthof et al. 1993). A
variety of methods have been used to try to control crop losses due to virus diseases (Hull
and Davies, 1992). When possible one of the most successful approaches is traditional
plant breeding for virus resistance (Kyle, 1993). In addition, standard techniques of plant
pathology, including quarantine, eradication, crop rotation, and certified virus free stock
have been important tools to control virus diseases, although each has disadvantages, such
as expense, questionable efi‘ectiveness, and lack of reliability from year to year (Scholthof
et al. 1993). As an additional strategy, cross-protection also has been used (Fulton, 1986).

More recently it has been possible to develop virus resistant genotypes via genetic
engineering using viral-derived genes as a source of resistance genes [selected reviews:
Beachy et al. (1990), Fitchen and Beachy (1993), Gadani et al. (1990), Grumet (1990,
1994), Hull and Davies (1992), Nelson et al. (1990), Scholtof et al. (1993), and Wilson
(1993)]. Of the different kinds of genes that have been used to genetically engineer
virus resistance, coat protein is the one used most widely (Grumet, 1995). “ Coat protein-
mediated resistance” is used to refer to the resistance caused by the expression of a virus
coat protein (CP) gene in transgenic plants (Beachy et al. 1990). Transgenic plants

expressing the CP gene fi'om a given virus are generally protected against infection by the

virus from which the CP gene was isolated (homologous virus). In many cases CP
mediated protection extends to strains or viruses that are closely related to the virus fiom
which the CP gene was obtained (heterologous virus) (Beachy et al. 1990; Gadani et al.
1990: Hull and Davis, 1992;ng et al. 1992; Grumet et al. 1995). This literature review
will focus on coat protein mediated resistance, possible mechanisms responsible for

conferring resistance and the biology of the coat protein.

2.1 Coat protein mediated resistance
The theoretical bases for the use of coat protein genes have come from two

directions: classical cross-protection and pathogen-derived resistance.

2.1.1 Cross-protm'gn
Cross-protection was first Observed by McKinney (1929) in tobacco: it is the ability of

a mild strain of a virus to protect an infected plant against subsequent infection by virulent
strains of the same or a closely related virus (Fulton, 1986). Cross-protection has been
used to reduce yield losses in some craps like citrus, tomatoes and potatoes, due to citrus
tristeza, tomato mosaic virus (TOMV) and potato spindle tuber viroid (PSTV)
respectively (Hamilton 1980). However this labor intensive type of protection is expensive
and it necessiates the use Of an infectious virus as a control measure (Scholthof et al.

1993).

Although a number of models have been proposed to explain cross~protection, the
exact mechanism responsible for cross-protection has not been elucidated. Proposed
models include (review, Beachy, 1988): 1. Inhibition of the replication of the challenging
virus due to the depletion of a component in the host cell by the inducing virus. 2.
Inhibition of the uncoating of the challenger virus by the inducing virus. 3. Sense or
antisense RNA of the inducing virus anneals with RNA Of the challenger virus, thereby
blocking replication of the challenger virus. 4. Capsid protein produced by the first
infection encapsidates the RNA of the challenger strain, thereby preventing its replication.
In some cases cross-protection can be overcome when challenge inoculum is viral nucleic
acid rather than virions (Dodds et al. 1985). From the results of various studies to define
the mechanism(s) responsible for cross protection, (review by Beachy, 1988) it appeared
that protection in at least some cases occurs prior to the firll release of viral RNA from the
virion. This led to the suggestion that capsid protein Of the protecting strain interferes with
the RNA of the challenger during the process of uncoating of the genome. Hamilton
(1980), predicted that cross-protection could be induced by introducing cDNAs to various

regions of the viral RNA genome into plants.

2.1.2 Pathogenfieg’ved resimce
The theory of pathogen-derived resistance (Sanford and Johnston, 1985) predicts that

a “normal” host-pathogen relationship can be disrupted if the host organism expresses

essential pathogen-derived genes. It has been proposed that host organisms expressing

pathogen gene products in excess amounts, at the inappropriate developmental stage or in
a dysfunctional form, may disrupt the normal replicative cycle of the pathogen and result
in an attenuated or aborted infection of the host. This approach is based upon the fact that
in any parasite-host interaction, there are certain parasite-encoded cellular firnctions which
are essential to the parasite but not to the host. If one of these functions is disrupted, the
parasitic process should be Stopped. In the most successful instances, such disruptions
would prevenf the replication and/or movement of the virus beyond the initially infected
cell. Even with less efi‘ective interference in the replicative cycle, pathogen-derived
resistance might modulate the disease symptoms and result in only a localized infection
(Scholthof et al. 1993).

Genetically engineered plant virus resistance using a pathogen derived gene was first
demonstrated by Powell-Abel et al. (1986). The coat protein (CP) gene from tobacco
mosaic virus (TMV) was inserted into tobacco and the resultant transgenic plants, which
constitutively produced viral coat protein, were more resistant to infection by TMV than
were control, non transgenic plants. These findings Opened new avenues for plant
protection in important agricultural crops. Since the initial demonstration, numerous
examples of resistance in plants transgenic for viral CP gene constructs have been reported
(see reviews by Beachy, 1993; Grumet, 1995). This coat protein mediated resistance
approach has broad applicability to a wide range of viruses. CP-mediated resistance has
been demonstrated in at least 23 plant viruses fiom 13 difi‘erent virus groups including the
potyvirus group (see reviews by Grumet, 1995, Beachy, 1990). In addition to coat

protein genes several other types of viral genes have conferred resistance, including

replicase genes, movement protein genes and protease genes (for reviews see Grumet

1995; Beachy et al. 1990; Wilson, 1993).

2.1.3 Ph 0 of t r tein-m 'a ro ion

The type of resistance that is observed varies among difi‘erent systems, and can also
vary among difi‘erent lines transformed with the same gene, and even among difi‘erent
individuals within or families derived fi'om the same line and possessing the same gene at
the same location in the genome (Grumet, 1994). There are several phenotypes associated
with CP-MP, (review by Beachy, 1993) some of which may be reflective of the cellular
and molecular mechanisms of resistance. These phenotypes may also vary depending on
the host and the environmental conditions of plant growth and testing, and replication and
disease strategies of the pathogen. Not all examples of CP-MP exhibit each of the
phenotypes listed. In each example Of coat protein-mediated resistance described to date,
resistance is manifested by several features (See reviews by Beachy et al. 1990 ; Grumet,
1995). 1. Fewer lesions, in general, upon infection with the virus fiom which the gene was
derived, the inoculated leaves of the transgenic plants Show fewer viral lesions (chlorotic,
necrotic) than do control plants. 2. Systemic spread of infection is prevented, delayed or
reduced. Vrrus accumulation is decreased in systemically infected leaves in spite of virus
accumulation in inoculated leaves. Severity of disease symptoms is reduced in plants that
do become infected. 3. Infection followed by recovery. The phenotypes of CP-MP are the

result of various types of molecular and cellular mechanisms that occur in the host as CP

molecules interact with the virion and/or the replication of its genome (Beachy, 1993) or
the host genome and the host cell response as proposed by Dougherty’s group (Smith et

al. 1994, 1995).

2.1.4 Br resi

Broad spectrum resistance could be of considerable agronomic benefit by enabling a
plant to be protected against many viruses using a limited number of different CP genes. It
would be especially usefirl for resistance to potyviruses as many hosts are infected by
several difi‘erent potyviruses (Hollings and Brunt, 1981) and they form the largest, most
widely distributed and economically important group of plant viruses. Although in general
the highest level of resistance was conferred against the homologous virus, there are many
examples where a given CP gene conferred protection against other viral strains and other
related viruses. Transgenic tobacco plants expressing coat protein of TMV have a low but
significant degree of protection against other tobamoviruses (Nejidat and Beachy, 1990;
Anderson et al. 1989). Transgenic tobacco expressing CP of cucumber mosaic virus-O
(CMV-O) showed significant level of protection to CMV-Y and to the serologically
unrelated chyrsanthemum mild mettle virus (CMMV) , a member of the cucumovirus
group (Nakajima et al. 1993). Other examples include resistance to strains of CMV
(Quemada et al. 1991), tobacco rattle virus (TRV) (van Dun and B01, 1989), TMV
(Nelson et al. 1988), potato virus-S (PVS) (Mackenzie et al. 1991), and tomato spotted

wilt virus (TSWV) (Pang et al. 1992).

In the case of CP-MP against members of the potyvirus group, there is evidence that
CP-MP can confer broad resistance. The CP gene of ZYMV-Ct conferred protection
against a variety of other ZYMV strains and the closely related potyvirus watermelon
mosaic virus (WMV), but not against the less closely related papaya ringspot virus (PRV)
(Grumet et al. 1994). Transgenic plants expressing WMV CP gene showed noticeable
protection against other potyviruses like bean yellow mosaic virus (BYMV), potato virus-
Y (PVY), pea mosaic virus (peaMV), clover yellow vein virus (CYVV), pepper mottle
virus (PeMV) and tobacco etch virus (TEV) (Namba et al. 1992). Tobacco plants
accumulating coat protein of the potyvirus soybean mosaic virus (SMV), a non pathogen
on tobacco, were partially protected fi'om infection by two serologically unrelated
potyviruses that are pathogens of tobacco, PVY and TEV (Stark and Beachy, 1989).
Similarly Ling et al. (1991) reported that plants that accumulated detectable levels of
PRV-CP showed a significant delay in symptom development and the symptoms were
attenuated when inoculated with TEV, PVY, and PeMV. Plants expressing the CP of
PVY strain N605 Showed good resistance to the related strain PVY-O803 (Malnoe et al.
1994).

The mechanism of this generalized virus resistance is unknown. It is not clear whether
the extent of heterologous protection is related to the sequence homology between the
challenge virus and the virus from which the CP gene was derived, though in some cases
there seems to be a correlation (Grumet et al. 1994; Narnba et al. 1992). It is also not
known whether the absolute homology in the amino acid sequence between the CPS is

important to Obtain broad protection or conservation of particular structural domains is

10

important. The CP gene of the potyvirus lettuce mosaic virus (LMV) conferred complete
protection against the heterologous virus PVY (66% amino acid homology to LMV), but
did not protect against TEV, which has a similar (60%) percent amino acid homology
(Dinant et al. 1993). In the case of TSWV, protection was Observed against various strains
and isolates of TSWV, but not against two related viruses with about 80% nucleotide
sequence identity to TSWV (de Han et al. 1992). In CMV the degree of amino acid
sequence identity between expressed and challenge viruses did not Show a direct
correlation with the observed level of protection (Quemada et al. 1991). In some lines
protection was greater against the heterologous strains than the homologous Strains. The
heterologous protection seen in CP-MP may also be influenced by the different sequence
motifs present in the N-terminal region of the coat protein of the difi‘erent viruses/strains
involved. In the case of classical cross-protection the unidirectional cross-protection
between some strains and negative cross-protection against others has been reported to be
correlated to difi‘erent sequence motifs present in the hypervariable coat protein N-
terminus Of the involved strains (Krstic et al. 1995). In fact the breadth of protection of

CP-MP may be related to a number of unknown variables (Beachy, 1993).

2.2 Site and mechanism(s) of coat protein mediated resistance
Normal virus replication requires a subtle blend of host-and virus-coded proteins,
present in critical relative concentrations and at specific times and places. An unregulated

superimposition of interfering protein or nucleic acid species can result in an apparently

ll

virus-resistant phenotype (Wilson, 1993). As reviewed by Grumet (1994), in the case of
coat proteins, which have many roles in the life cycle of the virus, it seems there are many
potential points of interference. Several possible mechanisms have been proposed
including : prevention of uncoating of the incoming virus, interference with viral
translation and /or replication, and interference with cell to cell or long distance
movement. Each of these is a potential interference point for the coat protein with the
incoming virus, and there is good evidence to indicate that the mechanism of protection is
not the same in every virus-CP host combination, because of the differences among viruses
and their modes of infection and replication. The resistance derived fi'om a single CP gene
in a single plant species may act by more titan one mechanism and may inhibit several
different stages in the infection or replication process (F itchen and Beachy, 1993). In spite
of the vast literature on coat protein-mediated protection, no unifying hypothesis has
been derived to explain the molecular mechanisms of CP-mediated protection.

One of the key features in elucidating the mechanism(s) of protection lies in identifying
the site of protection. AS reviewed by Nelson (1990), protection by CP expression appears
to involve more than one site. There is a decrease in lesion numbers on inoculated leaves
of CP expressing plants, thus one Site of protection is at the primary infection site. A
decrease in virus accumulation in systemically infected leaves in spite of virus
accumulation in inoculated leaves equal to that of controls [e.g.: Tobacco/TMV system
(Wisniewski et al. 1990)], indicates that a second site exists in CP(+) plants providing
protection against virus infection beyond the primary Site. Another key feature in

elucidating the mechanism(s) of protection lies in identifying the molecule(s) responsible

12

for the protection. Depending on the individual case, protection might have resulted due

to accumulation of coat protein coding sequences (mRN A) or coat protein per se

(Beachy,l988).

2.2.1 Protection mediated by coat protein per se

The majority of the studies on the mechanism(s) of CP-MP have been carried out with
TMV and TEV and they may or may not reflect the mechanisms Of protection in other
systems. In the case of TMV system, there is evidence that CP-MP is a result of a direct
protein efl'ect. Accumulation of only CP transcript did not protect the CP transgenic
tobacco against the infection Of TMV (Powell-Abel et al. 1990). Purified CP was shown
to be able to confer transient protection against infection by TMV, in tobacco protoplasts
(Register and Beachy, 1989). The efi‘ect of elevated temperatures on the accumulation of
CP in transgenics was used by Nejidat and Beachy (1989) to demonstrate the requirement
of CP accumulation for resistance. Based on studies with tobacco plants carrying the N
gene which reacts in a hypersensitive manner to TMV infection, it was concluded that
expression of the TMV CP gene in transgenic tobacco plants results in direct interference
of the CP with TMV infection rather than in triggering plant defense responses that lead to
resistance (Carr et al. 1989).

One manifestation of the CP-mediated protection by TMV CP against TMV infection
occurs early in the infection cycle and is overcome partially or firlly by inoculation with

TMV-RNA, and by TMV virions that were briefly treated at pH 8.0 (Nelson et al. 1987;

13

Register and Beachy, 1988). The decreased level of protection to infection by TMV-RNA
shows that CP-MP involves the inhibition of an event prior to the release of the viral RNA
fiom the virion. Treatment of TMV at pH 8.0 greatly enhances the translation of TMV in
vitro, but does not cause structural changes (Wilson l984a,b). It was postulated that the
treatment at pH 8.0 results in removal of small number of CP molecules fi'om the 5’ end of
the viral RNA exposing it to binding by ribosomes and subsequent co-translational
uncoating (Wilson, 1984). In in vitro translation assays, the addition of TMV CP reduced
the efficiency of translation of pH 8.0 treated virions (“Olson and Watkins, 1986); this
suggests that CP bound to the 5’ end of the viral RNA prevents ribosome binding. The
lack of resistance to infection by pH 8.0 treated TMV (Register and Beachy, 1988)
suggests that virion stabilization in the CP-expressing plants occurs by exchange of low
numbers of CP molecules (less than 20) fiom the virion rather than re-constitution of the
virions. Such translationally active complexes, called ‘striposomes’ were isolated from
infected leaf tissue (Shaw et al. 1986). Striposomes are characterized by the attachment of
80s ribosomes to an exposed 5’ portion of the viral genome, while the 3’ end remains
encapsidated (Wilson and Watkins, 1986). Wu et al. (1990) reported that the number of
striposomes in transgenic CP(+) protoplasts after electroporation with TMV was greatly
reduced compared to CP(-) protoplasts. It was suggested that the modification of TMV
that leads to co-translational virion disassembly is affected in CP accumulating transgenic
plants (Reimann-Philip and Beachy, 1993 a). Further evidence that whole plant resistance
is the result of inhibition of an early event of TMV infection was obtained by tissue

specific gene expression studies where it was shown that CP must accumulate in the

14

initially infected tissue in order to interfere with TMV infection (Reimann—Philip and
Beachy, 1993b).

Although the exact molecular mechanism of CP-MP is not clear, many studies in
TMV/tobacco system, as described above, indicate that inhibition of virion disassembly
plays a major role. The process which leads to the loss of CP molecules in the initial stage
of TMV infection is not yet known. The chemical environment in the cell might be
suficient to cause disassembly of CP fi'om RNA (Reimann-Philip and Beachy , 1993a).
Results of protoplast assays indicate that disassembled virions of TMV at pH 8.0 are not
reencapsidated, this indicates that protection can be due to inhibition of uncoating. There
are two current hypotheses to explain this. The first suggests that there are receptor sites
for uncoating that are blocked by the expressing coat protein. The second proposes that
local intracellular conditions which favor virus disassembly may be involved. TMV CP
present in transgenic cells could shifi these kinetics (TMV CP preferentially associates
with itself), causing a fully assembled virus structure to be maintained (Register and
Beachy 1988; review by Wilson, 1985). If this involved limited exchange of CP subunits
on the virion with endogenous CP in the transgenic cell, then the endogenous CP would
be required to be competent to assemble with CP subunits present on the virion (Clark et
al. 1995). Interestingly, the capacity of the CP to assemble into normal virion structures
was shown to be dispensible with respect to CP-MP in the TMV system (Clark et al.
1995).

The second stage of manifestation of CP-MP is during local and systemic spread of the

virus. Movement Of the TMV virus fi'om the infected leaves to the upper leaves of

15

infected CP+ plants is delayed, even when an equal number of infection Sites are present
on the inoculated leaves of transgenic and control plants (Wisniewski et al. 1990;
Anderson et al. 1989). This indicates that protection against systemic spread in CP+ plants
is caused by one or more mechanisms that, in correlation with protection against initial
infection upon infection, results in a phenotype of resistance to TMV (Wisniewski et al.
1990; Wu et al. 1990; Osbourn et al. 1989). However experiments with tissue specific
promoters (Reimann-Philip and Beachy, 1993 a) Show that a major component of sytemic
resistance is a reiteration of interference during the infection process.

In support of the inhibited-uncoating model, CP-MP is sensitive both to the level of
expression of the transgene and the concentration of the challenge virus (Powell-Abel et
al. 1986; Nejidat and Beachy, 1988). The idea that the protein and not its mRNA is
responsible for the resistant phenotype, was supported by observations that higher levels
of CP gene expression would lead to higher levels of resistance [e. g. AlMV (Loesch-
Fries. 1987; Hill et al. 1991); PVX (Hemenway et al. 1988; Hoemkema et al. 1989); TMV
(Powell Abel et al. 1990); rice stirpe virus (RSV) (Hayakawa et al. 1992) ]. Another
model proposed to explain the molecular mechanisms underlying this resistance suggests
that, the high levels of intracellular coat protein accumulating in the transgenic plants
disregulates transcription and replication of incoming viral RNA by altering the mode of
the viral polymerase (de Haan et al. 1992). For reasons that are not understood, the
accumulation of large amounts of coat protein is not always necessarily correlated with the
most effective protection. Protection is also Obtained in conjunction with very low

accumulation of coat protein in transgenic plants. For instance, protection against ZYMV

16

was not correlated with the level of protein expression (Fang and Grumet, 1993 ), and field
protection to PVY occurs in transgenic plants producing undetectable levels of PVY coat
protein (Kaniewski et al. 1990) [other examples potyviruses (Lawson et al. 1990; Narnba
et al. 1992; Regner et al. 1992; Ravelonandro et al. 1993; Fameilli and Malnoe 1993; van
der Vlugt et a1 1992); luteoviruses (Kawachuck et al. 1990); tospoviruses (Gielen et al.
1992 ; MacKenzie and Ellis, 1992; Pang et al. 1992)]. In the case of peanut stripe mosaic
virus (PstV) and tomato spotted wilt virus (TSWV) (Cassidy and Nelson, 1995; Pang et
al. 1994) higher levels of CP accumulation were associated with lower levels of resistance
Suggested explanations for the lack of correlation have included cell specific
accumulation, differential subcellular localization of the CP, or that RNA rather than CP
is responsible for conferring protection. Possibility of RNA-mediated protection will be
discussed in the following section (2.2.2).

While blockage of virus uncoating is also consistent with the characteristics of
engineered cross-protection against AlMV (van Dun et al. 1988; Turner et al. 1987;
Taschner et al. 1994; Loesch—Fries et al. 1987), it is not universal; transgenic plants
expressing the coat proteins of some potex—, carla-, and nepoviruses were protected
against infection even when inoculated with viral RNA (Hemenway et al. 1988;
MacKenzie and Tremaine, 1990; Bertioli et al. 1992; Brault et al. 1993). In the case
CMV, whole plants were protected against systemic infection by both virions and RNA,
but protoplasts were protected against virions and not against RNA (Okuno et al. 1992).
These observations Show that the incoming viral RNA is able to replicate in the primary

inoculated cells, but that subsequent spread is limited. However in some cases high levels

17

of CP might also interfere with the replication of viral RNA, since there was some
protection against TMV RNA in plants transgenic for the CP of the virus (Nelson et al.
1987; Register and Beachy, 1988)

Several hypotheses concerning the mechanism of CP action, such as interference with
uncoating, translation, or replication depend on interaction between the transgene
expressing CP and the viral RNA (Grumet 1994). There are some instances, however,
where the ability to interact with the RNA may not be suficient to confer resistance. In
potyviruses the conserved core portion of the coat protein contains information necessary
for polymerization, and is capable of forming virions of normal appearance (Dolja et al.
1994). However, expression of just the Core portion of the ZYMV CP in melons did not
give high levels of protection when compared to full length CP (Fang and Grumet, 1993).
In AlMV a mutant CP with a single nucleotide change was unable to ofi‘er CP-MP, even
though it was capable of binding to RNA in vitro (Turner et al. 1991). The CPS of two
strains of tobacco rattle virus (TRV) are capable of reciprocal encapsidation, but the CP’s
only confer protection against the homologous strain (van Dun and B01, 1988) and for
TMV, disruption of assembly functions did not eliminate CP-mediated protection (Clark et
al. 1995).

Some experiments suggest that the amino-terminal portion of the coat protein of
certain types of viruses is critical for CP-mediated protection, possibly via interaction with
a host factor. Deletion of the amino terminus OfZYMV CP reduced the levels of
protection conferred in melons when compared to fiill length CP (Grumet and Fang,

1993). Changing the second amino acid in the AlMV amino terminal portion, eliminated

18

the ability of CF to confer resistance to infection (Turner et al. 1991). Similarly, removal
of the amino-terminus of the CP of the potexvirus, potato acuba mosaic virus (PAMV)
eliminated the ability to confer protection against virus infection, while mutation in core
domain which is thought to be essential for assembly, Ofi‘ered the same amount of
resistance as observed with the hill length CP (Leclerc and AbouHaider, 1995). It was
hypothesized that a plant component interacts with the viral CP, and that the interaction
may be blocked by an expressed protein in transgenic plants containing the N terminus of
the viral CP leading to the attenuation of the viral infection (Leclerc and AbouHaider,
1995). When the inoculum concentration is increased, the virions compete for the
available sites, leading to a successful infection of such plants. However, the nature of

such a plant component is unknown.

2.2.2 Protection conferred by the accumulation of CP-transcript

In some cases it seems that the CP-transcript is involved in the protection observed in
the transgenic plants, because protection was Observed even when the coat protein was
not detected. The mRN A resistance was in some cases as efl‘ective as that conferred by
translationally competent constructs. In plants transformed with potato leaf roll virus
(PLRV) coat protein, titer of PLRV has been greatly reduced, however transgenic plants
accumulated PLRV coat protein transcripts, but the PLRV coat protein was not detected
(Kawchuck et al. 1991). Resistance to PLRV replication in the transgenic lines was

broadly related to the amount of PLRV CP transcript detected, protection seemed to be

19

based on interference with PLRV multiplication at the RNA level (Barker et al. 1993).
The non translatable RNA of the PVY CP was as eficient as the translatable construct in
protection against PVY. However the PVY CP could not be detected in the translatable
construct (van der Vlugt et al. 1992). Transgenic tobacco plants carrying a translationally
defective TSWV coat protein gene exhibited levels of resistance similar to those reported
in experiments with translationally competent gene constructs (de Haan et al., 1992).
Since the mRNA resistance in some cases is as efl‘ective as that conferred by
translationally competent constructs, the RNA may be the active entity, even when the
protein does accumulate (Kawachuck et al. 1991; de Haan et al. 1992; Gielen et al. 1991).
In fact, it has been suggested that transcript mediated protection may be preferable to
CPMP because this precludes the need for accumulation of a foreign protein in crop plants
(de Haan et al. 1992).

Various hypotheses that have been put forward to explain the transcript mediated
protection include: (1) The high levels of CP gene transcripts in the transgenic plants give
rise to antisense inhibition of viral replication, (2) The expressed coat protein mRN A may
bind to and compete for virus and / or host associated replicase proteins or otherwise shifi
transcriptional or replicative events so that virus multiplication is reduced, (Kawachuck et
al. 1991; Hemenway, 1990; Cuozzo et al. 1991; de Haan et al. 1992).

Lindbo and Dougherty (1992) postulated that protection sometimes results from coat
protein mRNA accumulation and is independent Of a requirement for coat protein
expression per se. They showed that the use Of non translated RNA and its antisense were

more efficient in protecting than 6.111 length or truncated versions of the TEV CP. It was

20

suggested that the resistance is mediated through a defective RNA species and not the
expected translation product. Their firrther investigation of their transgenic lines have led
to some interesting findings. Transgenic tobacco expressing the full length form of TEV
coat protein or a form truncated at the N-terminus of the coat protein were susceptible to
TEV infection initially, but 3 to 5 weeks after a TEV infection was established, transgenic
plants “recovered” from the TEV infection, and new stem and leaf tissue emerged
symptom and virus free (Lindbo et al. 1993). The recovered tissue also was not
susceptible to reinoculation. When transgenic tobacco plants expressing an untranslatable
version of TEV CP were analyzed for resistance to TEV infection, three difl‘erent
responses were noted: 1. some were highly resistant, no viral replication occurred, 2. some
were susceptible but able to recover from systemic TEV infection; and 3. some were
susceptible to TEV infection (Daugherty et al. 1994). Recovered tissue could not be
infected with TEV. Steady-state transgene mRNA levels in recovered tissue were lower
than those of unchallenged transgenic plants. Nuclear ninofl‘ assays suggested a post-
transcriptional reduction in specific RNA levels. An inverse correlation between transgene
transcript accumulation and virus resistance was observed. The resistance was virus
specific, and functional at the Single cell level. Similar results were noted in experiments
with homozygous double haploid tobacco plants (Smith et al. 1994) and in transgenic
potato plants expressing an untranslatable version of PVY coat protein. They suggest that
virus resistant phenotype is likely mediated by a host cell response and not fi'om the

transgene product competing with viral encoded product (Smith et al. 1995). The same

21

kind of recovery and immunity results were observed in case of potato spindle tuber
viroid (PstV), but only with a translatable sense CP (Cassidy and Nelson, 1995).

A working model has been proposed (Lindbo et al. 1993; Smith et al. 1994) to
explain the lack of correlation between degree of protection and Steady state levels of the
transgene transcript. It has been proposed that the molecular basis of the recovered
phenotype is a cytoplasmic event in which plant cells are able to (1) sense elevated or
aberrant RNA levels in a manner not understood, these specific RNA sequences are then
(2) targeted, and (3) inactivated by a cellular factor that may be a protein or nucleic acid.
The complex formed between the target RNA sequence (host and /or viral) and the
cellular factor will direct cellular enzymes to (4) degrade the RNA, resulting in its
elimination from the cytoplasm. Mechanistically, the model suggests that a protein or
nucleic acid factor binds to a specific RNA sequence, rendering this RNA functionally
inactive and targeting it for elimination. Stimulation of this system apparently results in a
highly resistant phenotype to TEV, because TEV RNA sequences are inactivated (Smith
et al. 1994; Lindbo et al. 1993).

To explain the occurrence of recovered phenotypes and variable responses in
transgenic lines, even those derived from a single transformation event of a common
haploid plant and isogenic for transgenes, Smith et al. (1994) suggested that plant cells
have an undefined “threshold” below which they can accommodate a specific RNA
species. Transcription of the transgene within the nucleus produces varying amounts of
RNA among the difl‘erent transgenic lines. Plants with high transcription rates generate

RNA levels that exceed a certain threshold level, which activates a cytoplasmic-based,

22

cellular process that specifically targets this RNA for elimination and results in low steady
state levels of the transgene mRNA Ifthe transgene shares nucleotide homology with a
plant virus, the plants are phenotypically resistant to the challenging virus. Alternatively,
in lines where transcription rates are lower and the threshold level is not exceeded, the
putative cytoplasmic degradation mechanism is not induced. Steady state levels of the
mRNA will be proportional to the transcription rate of the gene. The cytoplasmic
regulatory system is OE and a susceptible phenotype will be manifested. In the case of
“inducible” resistance, also referred to as recovery phenotype (as in TEV), the additive
level of transgene mRN A and the viral RNA containing the target sequence exceed the
threshold level, resulting in an activation of the cytoplasmic system, which is manifested as
a lowering of the transgene mRNA steady state levels and the concomitant establishment
of the resistant phenotype.

Different mechanisms seem to be operating in different plants. Translation product
may only be one of a number of components involved in establishing the virus-resistant
state (Silva-Rosales et al. 1994). In the case of TSWV, resistance against homologous
isolates and closely related isolates, seems to be RNA-mediated, in the presence of low
levels of transcript, while partial protection to homologous isolate and distantly related
isolate, is protein mediated, in the presence of high amounts of CP protein (V aira et al.

1995;ng et al. 1993; Pang et al. 1994).

23

2.3 Genetic engineering of potyvirus resistance

Of the 28 plant virus groups or families, the potyvirus group is the largest and
accounts for about 30% of all viruses known to infect plant species around the world
(Shukla and Ward 1989. Francki et al. 1985). Potato virus Y ( PVY) is the type member
of the potyvirus group. Most members of the potyvirus group are transmitted by aphids in
a non persistent, non circulative manner, which involves a viral encoded helper component
protein that is thought to mediate the binding of the virus to the aphid stylet (Thornbury
and Pirone, 1983; Berger and Pirone, 1986); transmission in seed or by mites, dodder, and
fungus has been also reported (Hollings and Brunt 1981; Ward and Shukla, 1991).
Potyviruses also can be mechanically transmitted.

CP-mediated protection has been demonstrated for various potyviruses like PVY,
TEV, SMV, PRV, WMV, ZYMV, PPV etc. (review by Beachy 1993). In majority Of
potyviruses [e.g. PVY (Lawson et al. 1990), PPV (Regner et al. 1992), PRSV (Fitch et al.
1990) and ZYMV (Fang and Grumet 1993)] firll length potyviral CP genes were very
efi‘ective, whereas in case of TEV, truncated coat proteins, untranslated version and
antisense version Of CP were also effective (Lindbo and Dougherty, 1992). The reason(s)
for the difl‘erence between these experiments is unclear. Mechanism(s) of protection
appears to be difl‘erent even among the viruses within the same group.

CP-mediated resistance against potyviruses has several important features (review,
Beachy et al. 1990). First it is possible to produce plant lines that are highly resistant to

infection by mechanical or aphid inoculation. Second, a CP gene fiom a potyvirus that is

24

not a pathogen (SMV) can protect transgenic tobacco plants against pathogenic
potyviruses ( PVY and TEV). Third there is no correlation between the level of expression
and the level of resistance observed. There are some exceptions and other features in
addition to these characteristics. In case of TEV CP+ plants the resistance was not
conferred against infection by other potyvimses. Resistance to PPV infection in some
transgenic Mbenthamiana plants lines, does not depend on the concentration of the
challenge virus. This virus concentration independent resistance is a novel observation for
potyviruses (Ravelnandro et al. 1993). A similar Observation has been made in tetraploid
transgenic muskrnelon plants (Grumet, 1995; personal communication). Though coat
protein mediated protection has been successfully demonstrated in potyviruses, there is no
unifying hypothesis to explain the phenomena and varying responses in each case, it may

be that the mechanism of protection varies among virus-host combinations.

2.3.1 Potyvirus biology-Coat protein

To study the mechanisms responsible for coat protein mediated resistance,
knowledge of potyvirus biology is important, of particular relevance are structural
characteristics, immunological properties, and fimctional roles of the coat protein in the
virus life cycle. Information about coat protein structure and its role in virus host
interactions may reflect upon the various features associated with CP-MP.

All members of the potyvirus group Share common features. The virus particle has

a flexuous rod shape and is usually 680-900nm in length and 12-15nm in diameter (Shukla

25

et al. 1991). The potyvirus genome is single stranded, positive sense infectious RNA
molecule that is approximately 10,000 nucleotides in length (Allison et al. 1986; Domier et
al. 1986). Potyviral RNA contains a covalently linked protein (V pg) at the 5’ terminus
(Murphy et al. 1990) and is polyadenylated at the 3’ terminus (Hari et al. 1979). A single
Open reading We (ORF) codes for an approximately 350,000-Da (3 50-kDa)
polyprotein that is proteolytically processed into mature viral gene products (Dougherty
and Carrington 1988; Allison et al. 1985). The RNA is encapsidated by approximately
2,000 copies of a CP monomer to form a virion (Hong and Brunt 1981). The capsid
protein is encoded by the sequence present at the 3 ’ end of the large ORF (Allison et al.
1985). A tertiary structure proposed for potyvirus CP monomers (Shukla et al. 1988 ;
Shukla and Ward, 1989) is composed of seven helices and three loops with N and C
termini projecting towards the surface.

Distinct potyviruses exhibit coat protein sequence homologies Of38-71% with major
differences in the N-terminal portion of their coat proteins. The amino terminal region of
the coat protein of different potyviruses is highly variable in sequence and length (29-95
residues) and is virus specific (Allison et al. 1986 ; Shukla et al. 1988). In contrast, the C
terminal regions of the different coat proteins vary in length by only one or two amino acid
residues (Shukla et al. 1988) and there is high sequence homology (65%) in the C-terminal
three quarters of the CP (Shukla and Ward 1988). Strains of individual viruses exhibit
very high sequence homology (90-99%) throughout the full length CP (Shukla et al.

1988)

26

Epitopes thought to be group specific were located in the trypsin-resistant Care
protein region (Daugherty et al. 1985; Shukla et al. 1988). The N-terminus contains the
major virus-specific epitapes and constitutes the mast irnmunadaminant region in the
virus particle (Daugherty et al. 1985; Shukla et al. 1988), although the C-termini also can
include irnmunodaminant sites (Vuenta et al. 1993). In jahnsangrass mosaic virus (JGMV)
(Shukla et al. 1989) the epitapes recognized by virus-specific monoclonal antibodies and
palyclanal antibodies were shown to be linear sequences located in the N-terrninal region
of the coat protein.

The N and C termini of the potyviruses coat proteins are surface located and can be
removed from virions by mild protealysis (Allison et al. 1985; Daugherty et al. 1985).
Mild tiypsin treatment removes the N-terminal region (3 0-67 amino acids long, depending
on the virus) and 18-20 amino acids from the C terminus of the coat proteins, leaving a
firlly assembled virus particle composed of coat protein Cares consisting Of 216 or 218
anrina acid residues (Allison et al. 1985; Daugherty et al. 1985; review, Shukla et al.

1991 ). The enzyme Lysyl endapeptidase selectively removes the surface exposed N
terminus (Shukla et al. 1988, 1989). These Care particles were indistinguishable from
untreated native particles in an electron microscope and were still infectious (Shukla et al.
1988; Allison et al. 1985; Daugherty et al . 1985), suggesting that the N- and C- termini
are not required for particle assembly or for the infectivity during mechanical inoculation.
It has been shown that the Care proteins can be dissociated and reassociated into
potyvirus-like particles (Jagadish et al. 1993b) which indicates that all the necessary

information required for polymerization of coat protein is located within its Care region.

27

Recently it has been shown that a TEV mutant with a deletion in the N-terminal sequence,
is capable of farming virions with normal appearance at the electron microscope,
supporting previous biochemical analysis that amino terminal portion of CP plays no
essential role in maintaining proper virion architecture or infectivity (Dolja et al. 1994).
However Single and dual mutations in the Care region inhibited virion formation even in
the presence of wild-type CP supplied in trans (Dolja et al. 1994). Using a microbial
expression system (Jagadish et al. 1991) for potyvirus coat protein, in which the CP’S of
JGMV can be expressed and assembled into virus particles, the two charged residues R194
and D238 within the Care region of the protein were shown to be crucial for the assembly
processes (Jagadish et al. 1993a).

Apart fi'am virion assembly, potyvirus CP possesses distinct, separable activities
required for cell to cell movement and long distance transport (Dolja et al. 1994). It was
suggested that the Care domain of TEV CP provides a function essential during cell-ta-
cell movement and the variable N-and C-terrninal regions are necessary for long distance
movement (Dolja et al. 1995). N-terminal domain of the coat protein has also been shown
to mediate aphid transmission. Successful transmission of potyviruses by their aphid
vectors depends upon the interaction of two viral-encoded proteins, the coat protein and
the helper component (Pirone, 1991). Substitutions in the conserved DAG triplet in the
N-terminus of aphid trasrnissible potyviruses results in the loss Of the aphid transmissibility
in tobacco vein mottling virus (TVMV) (Atreya et al. 1990, 1991) and loss of aphid
transmissibility and antibody binding capacity in turnip mosaic virus (TuMV) (Kantrang et

al. 1995). In the non aphid transmissible strain of ZYMV, aphid transmissibility was

28

restored by a mutation fiam threanine to alanine, confirming the previous findings (Gal-
On et al. 1992). Based on a mutational analysis Atreya et al. (1995) suggested that
conserved DAG triplet and the other residues near N-terminus fiinction in same phase of

the TVMV life cycle, in addition to aphid transmission.

2.4 Genetic engineering of virus resistance for ZYMV in melons

The cucurbit family includes some important vegetable crops (e.g. melons, cucumbers,
squashes). Cucurbits are subjected to severe losses due to infection by at least three
potyviruses: the watermelon strain of papaya ring spot virus (PRV-W), watermelon
mosaic virus (WMV) and zucchini yellow mosaic virus (ZYMV) (Pravvidenti et al. 1984).
Among these, ZYMV is a relatively new but very aggressive member of the potyvirus
group. Severe outbreaks of this virus have been reported in many countries in the world
(Lisa et al. 1981; Davis and Mizuki, 1987). Muskrnelon (Cucumis melo L.) is a high value
and important crop throughout the world. It is subjected to severe losses by several
viruses (Nameth et al. 1985) and so genetic engineering was a primary goal for this crop
(Grumet and Fang 1990; Gonsalves et al. 1991).

Genetically engineered coat protein mediated protection against ZYMV in melons has
been demonstrated by Fang and Grumet (1993). The ZYMV coat protein gene has been
cloned, and the nucleic acid sequence has been determined (Grumet and Fang, 1990; Gal-
On et al. 1990; Quemada et al. 1990). The gene encodes a coat protein with 279 amino
acids and a calculated molecular mass of 3 1,214 Da. Sequence comparisons Show that

ZYMV shares an average of 50-60% amino acid homology in the CP with other potyviral

29

coat proteins. The majority of the conserved amino acids are located in the central-and
carboxyl-terminal region of the protein, known as trypsin resistant Core portion of
potyviral CP’s (Shukla et al. 1988).

In an effort to genetically engineer potyvirus resistance, to test for protection against
both homologous and heterologous viruses, and to gain insight into possible mechanisms
of protection, Fang and Grumet (1993) utilized three versions of the ZYMV CP gene: The
hill-length CP gene, a truncated Core portion of the CP gene, and an antisense version of
the CP gene. All the necessary information required for polymerization of coat protein is
located within Core region (Shukla et al. 1988; Daugherty et al. 1985; Jagadish et al.
1993b; Dolja et al. 1994). It has been hypothesized that for several systems CP-mediated
protection involves CP-RNA or CP-CP interaction (Beachy et al. 1990; Grumet, 1990;
Nelson et al. 1990). Based on this Fang and Grumet (1993) hypothesized that, if these
processes are critical for protection against potyvirus infection, then the Core portion of
the protein would be expected to confer resistance, since domains reponsible for CP-RN A
interaction and CP-CP interaction are located within Core. They further predicted that it
might be possible that plants expressing the conserved CP gene fiagment could be
protected fiam infection by more than one potyvirus. Therefore the truncated version of
the CP gene including the highly conserved central- and carboxy-terminal region (the Core
portion) was used to test the above said hypothesis.

The three ZYMV CP-derived constructs were engineered and introduced into melon
and tobacco plants and the effect of those constructs on increasing resistance to infection

by ZYMV and two heterologous potyviruses, TEV and PW was studied. Most of the

30

plants expressing full-length CP did not Show any disease symptoms for at least 90dpi.
Melon plants expressing ZYMV Core protein showed a 3- to lO-day delay in symptom
appearance. Eventually, however all care plants became infected although the symptoms
on the Core-protein expressing plants were milder than for control plants. The FL-CP
expressing plants that did not develop symptoms also did not accumulate measurable virus
levels. The virus titer in transgenic plants expressing the Core construct was intermediate
between the inoculated controls and FL-CP plants. Protection against ZYMV was not
correlated with the levels of protein expression.

When the transgenic tobacco plants expressing FL-CP and Core constructs were
challenged with heterologous potyviruses PVY and TEV, there was a few days delay in
symptom development. However there was no obvious difference among the difl‘erent
constructs. Transgenic plants expressing any of three forms of the ZYMV CP gene
performed similarly in time to symptom appearance and symptom severity in systemic
leaves. The disease symptoms in most plants were milder, and younger leaves often had no
symptoms. Virus accumulation was correlated with the degree of visual symptoms. The

results with TEV were similar to those with PVY.

2.5 Objective of this study
Although the Core protein was expressed at levels comparable to the FL-CP and did
confer some protection, the Core construct was not as effective as the FL-CP construct

that resulted in apparent immunity to ZYMV infection. Possibly the Core and amino-

3]

terminus of the protein interfere with virus infection at difl‘erent stages of the process, or
the full length CP may have higher aflinity for viral RNA or other CP molecules than does
the Care. In the case of protection against heterologous viruses TEV and PW, both the
FL-CP and Core constructs performed similarly. It may be that the firnction provided by
the Core portion or its RNA, which results delay in infection and reduction in virus titer, is
capable of acting on more than one potyvirus. In contrast, the effect of the amino
terminus, the sequence of which is virus specific, may be limited to the virus fiom which
the CP gene was derived (Fang and Grumet, 1993).

A key feature in elucidating the mechanism involves identifying the molecules
responsible for protection. The role of arrrino terminal portion, if any, is not known. It is
not understood whether the protection conferred by FL-CP is RNA mediated or protein
mediated, the mechanism underlying is not understood. In order to address these
questions three things are necessary: 1. Altered forms of CP clones 2. Transgenic plants
expressing these clones. 3. A model system where studies can be conducted, both with
homologous and heterologous viruses.

As an initial step towards the study of mechanism of protection, my project was to
make clones of altered ZYMV CP genes, (amino terminal portion alone and sense-
defective version of FL-CP) and produce transgenic N. benthamiana plants expressing the
modified CP genes and conduct preliminary analysis of transgenic plants. Virus protection
studies can be conducted on these transgenic plants and alternatively the cloned CP genes
can also be used to generate transgenic melon plants so that the mechanism of CP

mediated protection for ZYMV can be studied in melons.

32

LITERATURE CITED

Allison, RF, Daugherty, W.G., Parks, T.D., Wills, L., Johnston, RE, Kelly, ME. and
Armstrong, F .B. 1985. Biochemical analysis of the capsid protein gene and capsid protein
of tobacco etch virus: N-terminal anrino acids are located on the virion’s surface. Virology
147:309-316.

Allison, R.F., Sorenson, J.G., Kelly, M.E., Armstrong, F .B., and Daugherty, W.G., 1985. '
Sequence determination of the capsid protein gene and flanking regions of tobacco etch
virus: Evidence for the synthesis and processing of a polyprotein in potyvirus genome
expression. Proc. Natl. Acad. Sci. USA 82:3969-3972.

Allison, R., Johnston, RE. and Daugherty, WC. 1986. The nucleotide sequence of the
coding region of tobacco etch virus genomic RNA“ evidence for the synthesis of a single
polyprotein. Virology 154:9-20.

Anderson, E.J., Stark, D.M., Nelson, R.S., Powell, P.A., Turner, N.E., Beachy, RN.
1989. Transgenic plants that express the coat protein genes of tobacco mosaic virus or
alfalfa mosaic virus interfere with disease development of some non related viruses.
Phytopathology 79: 1284-1290.

Atreya, C.D., Raccah, B., and Pirone, TR 1990. A point mutation in the coat protein
abolishes aphid transmission of a potyvirus. Virology. 178: 161-165.

Atreya, P.L., Atreya, CD, and Pirone, TR 1991. Amino acid substitutions in the coat
protein result in loss of insect transnrissibility of a plant virus. Proc. Natl. Acad. Sci. USA
88: 7887-7891 .

Atreya, P.L., Lopez-Maya, J.J., Chu, M., Atreya, CD, and Pirone, TR 1995. Mutational
analysis of the coat protein N-terrninal amino acids involved in potyvirus transmission by
aphids. J. Gen. Virol. 76:265-270.

Barker, H., Reavy, B., Webster, K.D., Jolly, C.A., Kumar, A., and Maya, M.A 1993.
Relationship between transcript production and virus resistance in transgenic tobacco
expressing the potato leafroll virus coat protein gene. Plant Cell Reports 13:54-58.

Beachy, RN. 1988. Virus cross-protection in transgenic plants. Pages 313-331 in: Spacial
regulation of plant genes. Verrna, D.P.S. and Goldberg, RB, eds. Springer-Verlay.

33

Beachy, RN. 1993. Virus resistance through expression of coat protein genes. Pages 89-
104 in: Biotechnology in plant disease control. Ilan Chet, eds. Wiley-Liss, Inc. New York.

Beachy, RN, Loesch-Fries, S. and Turner, NE. 1990. Coat protein-mediated resistance
against virus infection. Annu. Rev. Phytopathol. 28:451-474.

Bertioli, D.J., Cooper, 1.1., Edwards, ML, and Hawes, W.S. 1992. Arabis mosaic
nepoviruS coat protein in transgenic tobacco lessens disease severity and virus replication.
Ann. Appl. Biol. 120:47-54.

Brault, V., Candresse, T., Le Gall, 0., Delbos, RP., Lanneau, M., and Dunez, J. 1993.
Genetically engineered resistance against grape vine chrome mosaic nepovirus. Plant Mol.
Biol. 21:89-97.

Carr, J .P., Beachy, R.N., Klessig, DC. 1989. Are the PR1 proteins of tobacco involved in
genetically engineered resistance to TMV? Virology 166:470-473.

Cassidy, B.G., and Nelson, RS. 1995. Differences in protection phenotypes in tobacco
plans expressing coat protein genes fi'om peanut stripe potyvirus with or without an
engineered ATG. Molec. Plant-Microbe Interact. 8:357-365.

Chasan, R. 1994. Making sense (suppression) of viral RNA-mediated resistance. The Plant
Cell 6: 1329-1331.

Clark, W.G., Fitchen, J .H., and Beachy, RN. 1995. Studies of coat protein-mediated
resistance to TMV. Virology 208:485-491.

Cuozzo, M. O’connel, K.M., Karriewski, W., Fang, R.X., Chua, N.H., Turner, NE. 1988.
Viral protection in transgenic tobacco plants expressing cucumber mosaic virus coat
protein or its antisense RNA. Bio/Technology 6:549-557.

Davis, RF. & Mizuki, M. K. (1987) Detection of cucurbit viruses in New Jersey. Plant
Disease 71: 40-44.

de Haan, P., Gielen J.J.L., Prins M., Wijkamp I.G., van Schepen A., Peters, D., Van
grinsvaen, M.Q.J.M., Goldbach, R 1992. Characterization of RNA-mediated resistance
to tomato spotted wilt virus in transgenic tobacco plants. Bio/Technology 10: 1133-1137.

Dinarit, S., Blaise, F., Kusailg C., Astier- manfacier, S., and Albouy, J. 1993.
Heterologous resistance to potato virus Y in transgenic tobacco plants expressing the coat
protein gene of lettuce mosaic potyvirus. Phytopathology 83:818-824.

Dodds, J.A., Lee, S.Q., and Tifl‘any, M. 1985. Cross-protection between strains of
cucumber mosaic virus: Efi‘ect of host and type of inoculum an accumulation of virions
and double-stranded RNA of the challenge strain: Virology 144: 301-309.

34

Dolja, V.V., Haldernan, R, Robertson, N.L., Daugherty, W.G. and Carrington, J .C. 1994.
Distinct firnctions of capsid protein in assembly and movement of tobacco etch potyvirus
in plants. The EMBO J. 13: 1482-1491.

Dolja, V.V., Haldeman-cahill, R, Montogomery, A.E., Vandenbosch, KA, and
Carrington, J.C. 1995. Capsid protein determinants involved in cell-to-cell and long
distance movement of tobacco etch virus. Virology 206: 1007-1016.

Domier, L.L., Franklein, K.M., Shahabuddin, M., Hellman, G.M., Overmeyer, J.H.,
Hiremath, S.T., Siame, M.E.E., Lamanofl’, G.P., Shaw, J.G., Rhoades, RE. 1986. The
nucleotide sequence of tobacco vein mottling virus. Nucleic Acids Research 18: 1 181-
1187.

Dougherty, W.G., Wills, L., and Johnston, RE. 1985. Topographic analysis of tobacco
etch virus capsid protein epitapes. Virology 144:66-72.

Daugherty, W. G., and Carrington, J. C. 1988. Expression and function of potyviral gene
products. Annu. Rev. Phytopathol. 26: 123-143.

Daugherty, W.G., Lindbo, J .A., Smith, H.A., Parks, T.D., Swaney, S., and Proebsting, M.
1994. RNA-mediated virus resistance in transgenic plants: Exploitation of a cellular
pathway possibly involved in RNA degradation. Mal. Plant-Microbe Interact. 7: 544-552

Fang, G. and Grumet, R 1993. Genetic engineering of potyvirus resistance using
constructs derived from zucchini yellow virus coat protein gene. Mal. Plant-Microbe
Interact. 6:358-367.

Fitch, M.M.M., Manshardt, RM., Gonsalves, D., Slightom, J .L., and Sanford, J .C. 1992.
Vuus resistant papaya plants derived fi'om tissue bombarded with the coat protein gene of
papaya ringspot vims. Bio/Technology 10: 1466-1472.

F itchen. J .H. and Beachy RN. 1993. Genetically engineered protection against viruses in
transgenic plants. Ann. Rev. Microbiol. 47: 739-63.

Fraser, R. S. S. 1992. The genetics of plant-virus interactions: implications for plant
breeding. Euphytica 63: 175-185.

Fulton, RW. 1986. Practices and precautions in the use of cross-protection for plant virus
disease control. Annu. Rev. Phytopathol. 24:67-81.

Gal-On, A., Antignus, Y., Rosner, A., and Raccah, B. 1990. Nucleotide sequence of
zucchini yellow mosaic vinrs capsid-encoding gene and its expression in Escherichia coli.
Gene 87:273-277.

35

Gal-On, A, Antignus, Y., Rosner, A, and Raccah, B. 1992. A zucchini yellow mosaic
virus coat protein mutation restores aphid transmissibility but has no efl‘ect on
multiplication. J.Gen.Vrrol. 73:2183-2187.

Gadani, F., Manasky, L.M., Medici, R, Miller, WA. and Hull, J .H. 1990. Genetic
engineering of plants for virus resistance. Arch. Virol. 115: 1-21.

Gielen, J. J.L., de Haan, P., Kool, A.J., Peters, D., van Grinsven, M.Q.J.M., and
Goldbach, R 1991. Engineered resistance to tomato spotted wilt virus, a negative strand
RNA virus. Bio/Technology 9: 1363-1367.

Goldbach 1992. Characterization of RNA mediated resistance to tomato Spotted wilt virus
in transgenic tobacco plants. Bio/Technology 10: 1133-1138.

Gonsalves, D., Chee, P., Provvidenti., R, Seem, R, Slightom, J .L. 1992. Comparison of
coat protein-mediated and genetically-derived resistance in cucumbers to infection by
cucumber mosaic virus under field conditions with natural challenge inoculations by
vectors. Bio/Technology 10: 1562-1570.

Goodman, RM., McDonald, J .G., Horne, RW., and Bancrofi, J .B. 1976. Assembly of
flexous plant viruses and their proteins. Philosophical Transactions of the Royal Society B
276: 173-179.

Grumet, R. 1990. Genetically engineered plant virus resistance. HortScience 25:508-513.

Grumet, R 1994. Development of virus resistant plants via genetic engineering. Plant
Breeding Rev. 12:47-79.

Grumet, R. 1995. Genetic engineering for crop virus resistance. Hort science 30:449-456.

Grumet, R, and Fang, G.W. 1990. cDNA cloning and sequence analysis of the 3’ terminal
region of zucchini yellow mosaic virus RNA J. Gen. Virol. 71: 1619-1622.

Grumet, R, Yadav, RC., Akula, G., Hammar, S., Provvidenti, R 1995 b. Genetic
engineering of virus resistance in cucurbit crops. Proceedings of Cucurbitaceae’ 94.(In
preSS)

Hamilton, RI. 1980. Defenses triggered by previous invaders: viruses. Pages 279-303 in:
Plant disease: An advance Treatise vol. 5. Horsefall, J .G. and Cowling, E.B., eds.
Academic Press, NewYork,

Hari, V., Siegel, A, Rozek, C., and Timberlake, WE. 1979. The RNA of tobacco etch
virus contains poly (A). Virology 92:568-571.

36

Hayakawa, T., Y. Zhu, K. Itoh, Y.Kimura, T. Izawa, K. Shimamoto, and Toriyarna, S.
1992. Genetically engineered rice resistant to rice stripe virus, an insect- transmitted virus.
Proc. Natl. Acad. Sci. USA 89:9865-9869.

Hemenway, C., Fang, RX., Kaniewski, W.K., Chua, NH, and Tumor, NE. 1988.
Analysis of the mechanism of protection in transgenic plants expressing the potato virus
X coat protein or its antisense RNA. EMBO J. 7: 1273-1280.

Hill, K.K., Jarvis-Began, N., Halk, E.L., Krahn, K.J., Liao, L.W., Mathewson, RS.,
Merlo, D.J., Nelson, S.E., Rashka, K.E., and Loesch-Fries, LS. 1991. The development
of virus resistant alfalfa, Medicago sativa L. Bio/technology 92373-3 77.

Hoekema, A, Huisman, M.J., Molendijk, L., van den Elzen, P.J.M., and Comnelissen.
B.J.C. 1989. The genetic engineering of two commercial cultivars for resistance to potato
virus X. Bio/Technology 7:273-278.

Hollings, M., and Brunt, AA 1981. Potyviruses. pages 731-807 in: Handbook of Plant
Virus Infection and Comparative Diagnosis. E. Kurstak, ed. Elsevier/ North. Amsterdam,
Holland.

Hull, R and Davies, J.W. 1992. Approaches to nonconventional control of plant virus
diseases. Crit. Rev. Plant Sci. 11:17-33.

Jagadish, N.M., Ward, C.W., Gough, K.H., Tulloch, P.A, Whittaker, L. A, and Shukla,
DD. 1991. Expression of potyvirus coat protein in Escherichia coli and yeast and its
assembly into virus-like particles. J. Gen.Virol. 72: 1543-1550.

Jagadish, M.N., Huang, D., and Ward, CW. 1993a. Site directed mutagenesis of a
potyvirus coat protein and its assembly in Escherichia coli. J .Gen. Virol. 74:893-896.

Jagadish, M.N., Shukla, D.D., Grusovin, J., Whittaker, L. McPhee, DA, and Ward, C.W.
1993b. Assembly of a plant virus coat protein into rod-shaped virus-like particles in
Escherichia coli and development of a polyvalent antigen presenting system. Proceedings
of the International Conference on Virology in Tropics, Lucknow, India.

Kaniewski, W., Lawson, C., Sammons, B., Haley, L., Hart, 1, Delannay, X., and
Tumer., NE. 1990. Field resistance of transgenic Russet Burbank potato to effects of
infection by potato virus X and potato virus Y. Bio/Technology 82750-754.

Kantrong, S., Saunal, H, Briand, J.P., and Sako, N. 1995. A single anrino acid
substitution at N-ternrinal region of coat protein of turnip mosaic virus alters antigenicity
and aphid transmissibility. Arch. Virol. 140:453-467.

37

Kawchuck, L.M., Martin, RR, and McPherson, J. 1990. Resistance in transgenic potato
expressing the potato leafroll virus coat protein gene. Mol.Plant-Microbe Interact. 3:301-
307.

Kawchuk L. M., Martin, RR, Mc Pherson, J. 1991. Sense and antisense RNA-mediated
resistance to potato leaf roll virus in Russet Burbank potato plants. Mal. Plant-Microbe
Interact. 4:247-253.

Krstic, 8., Ford, RE., Shukla, DD, and Tosic, M. 1995. Cross-protection studies
between strains of sugarcane mosaic, maize dwarf mosaic, jahnsangrass mosaic, and
sorghum mosaic potyviruses. Plant Disease. 79:135-138.

Kyle, M. M. 1993. Resistance to viral diseases in vegetables : Genetics and breeding.
Kyle, MM. eds. Timber Press. Portland, Oregon.

Lal, R and Lal, S. 1993. Engineered resistance against plant virus diseases. Pages 117-
169 in : Genetic engineering of plants for crop improvement. CRC Press Inc. Boca Raton,
Florida.

Lawson, C., Kaniewski, W., Haley, L., Rozrnan, R, Newell, C., Sanders, P., and Turner,
NE. 1990. Engineering resistance to mixed virus infection in a commercial potato
cultivar: resistance to potato virus X and potato virus Y in transgenic Russet Burbank.
Bio/Technology 8: 127-134.

Leclerc, D., and AbouHaider, MG. 1995. Transgenic tobacco plants expressing a
truncated form of the PAMV capsid protein (CP) gene Show CP-mediated resistance to
potato acuba mosaic virus. Molecular Plant-Microbe Interact. 8: 58-65.

Lindbo, J .A., and Daugherty, W.G. 1992a. Pathogen-derived resistance to a potyvirus:
Immune and resistant phenotypes in transgenic tobacco expressing altered forms of a
potyvirus coat protein nucleotide sequence. Mal. Plant-Microbe Interact. 52144-153.

Lindbo, IA and Daugherty, W.G., 1992b. Untranslatable transcripts of the tobacco etch
virus coat protein gene sequence can interfere with tobacco etch virus replication in
transgenic plants and protoplasts. Virology 189:725-733.

Lindbo, J.A., Silva-Rosales, L., Proebsting, W.M., and Daugherty, W.G. 1993. Induction
of a highly specific anti viral State in transgenic plants: Implications for regulations of gene
expression and virus resistance. The plant Cell 5: 1749-1759.

Ling, K., Narnba, S., Gonsalves, C., Slightom, J.L., and Gonsalves, D. 1991. Protection
against detrimental effects of potyvirus infection in transgenic tobacco plants expressing
the papaya ring Spot virus coat protein gene. Bio/Technology 92752-758.

38

Lisa, V., Boccardo, G., D’Agostino, G., Dellavalle, G., and D’ Aquillo, M. (1981).
Characterization of a potyvirus that causes zucchini yellow mosaic. Phytopathology
57 1 :667-672.

Loesch-Fries, L.S., Halk, E., Merlo, D., Jarvis, N., Nelson, S. 1987. Expression of alfalfa
mosaic virus coat protein gene and antisense cDNA in transformed tobacco tissue.
EMBO J. 6: 1845-1851.

MacKenzie, D.J., and Ellis, P.J. 1992. Resistance to tomato spotted wilt virus infection in
transgenic tobacco expressing the viral nucleocapsid gene. Mal. Plant-Microbe Interact.
5:34-40.

MacKenzie, D.J., and Tremaine, DH. 1990. Transgenic Nicotiana debneyii expressing
viral coat protein are resistant to potato virus S infection. J. Gen. Virol. 71:2167—2170.

MacKenzie, D.J., and Tremaine, J .H., and Mc Pherson, J. 1991. Genetically engineered
resistance to potato virus S in potato cultivar Russet Burbank. Mal. plant-Microbe
Interact. 4295-102.

McKinney, H.H. 1929. Mosaic diseases in the canary islands, west Afiica and Gibralter. J.
Agricult. Res. 39:557-578.

Malnoe, P., Farinelli, L., Collet, GR, and Rest, W. 1994. Small-scale field tests with
transgenic potato, cv.Bintje, to test resistance to primary and secondary infections with
potato virus Y. Plant Mol. Biol. 25:963-975.

Murphy, L.F., Rhoades, RE., Hunt, AG, and Shaw, J .G. 1990. The Vpg of tobacco
etch virus RNA is the 49kDa proteinase or the N-terminal 24 kDa part of the proteinase.
Virology 178:285-288.

Nakajima, M., Hayakawa, T., Nakamura, 1., and Masahiko, S. 1993. Protection against
cucumber mosaic virus strains 0 and Y and chysanthemum mild mottle virus in transgenic
tobacco plants expressing CMV-O protein. J. Gen.Virol. 74:319-322.

Namba, S., Ling, K., Gonsalves, C., Slightom, J.L., and Gonsalves, D. 1992. Protection
of transgenic plants expressing the coat protein gene of watermelon mosaic virus 11 or
zucchini yellow mosaic virus against six potyviruses. Phytopathology 82:940-946.

Nameth, S.T., Dodds, J.A., Paulus, AG, and Laemmlen, PF. 1986. Cucurbit viruses of
California: An ever-changing problem. Plant Diseases 70:8-11.

Nejidat, A., and Beachy, RN. 1989. Decreased levels of TMV coat protein in transgenic
tobacco plants at elevated temperatures reduce resistance to TMV infection. Virology
173:531-538.

39

Nejidat, A and Beachy, RN. 1990. Transgenic tobacco plants expressing a coat protein
gene of tobacco mosaic virus are resistant to some other tobamoviruses. Mol. Plant-
Microbe Interact. 3:247-251.

Nelson, RS., Powell-Abel, P., Beachy, RN. 1987. Lesions and virus accumulation in
inoculated transgenic tobacco plants expressing the coat protein gene of tobacco mosaic
virus. Virology 1722370-373.

Nelson, RS., Mc Cormick, S.M., Delaney, X., Dube, P., Clayton, J ., Anderson, E.J.,
Kaniewski, M., Porsche, RK., Horsch, RB., Rogers, S.G., Fraley, RT., and Beachy,
RN. 1988. Virus tolerance, plant growth, and field performance of transgenic tomato
plants expressing coat protein from tobacco mosaic virus. Bio/Technology 62403-409.

Nelson, RS., Powell, PA, and Beachy, RN. 1990. Coat protien mediated protection
against virus infection. Pages 13-24 in: Genetic engineering of crop plants. Lycett, G.W.,
and Grieson, D., eds. Butterworth, Borough Green. Seven oaks, Kent, UK.

Okuno, T., Nakayarna, M., Yoshida, S., Furusawa, T., Komiya, T. 1992. Susceptibility to
infection with viruses and its RNA of transgenic tobacco plants and protoplasts expressing
the coat protein gene of cucumber mosaic virus. Virology.

Osbourn, J .K., Watts, J .W., Beachy, RN., Wilson, M.A 1989. Evidence that
nucleocapsid disassembly and a later step in virus replication are inhibited in transgenic
tobacco protoplasts expressing TMV coat protein. Virology 172: 370-3 73.

Pang, S.Z., Nagpala, P., Wang, M., Slightom, J.L. and Gonsalves, D. 1992. Resistance
to heterologous isolates of tomato spotted wilt virus in transgenic tobacco expressing its
nucleocapsid protein gene. Phytopathology 82: 1223-1229.

Pang, S.Z., Slightom, J .L., and Gonsalves, D. 1993. Difl‘erent mechanisms protect
transgenic tobacco against tomato spotted wilt and irnpatiens necrotic Spot tospoviruses.
Bio/1' echnology. 1 1 :819-824.

Pang, S.Z., Book, J .H., Gonsalves, C., Slightom, J .L. and Gonsalves, D. 1994. Resistance
of transgenic Nicotiana benthamiana plants to tomato Spotted wilt and irnpatiens necrotic
spot tospoviruses: Evidence of involvement of the N protein and N gene RNA in
resistance. Phytopathology. 842243 -249.

Pirone, P. 1991. Viral genes and gene products that determine insect transmissibility.
Semin. Viral. 2:81-87.

Powell Abel, R, Nelson, RS., Hoflinan, D.B.N., Rogers, S.G., Fraley, RT., and
Beachy, RN. 1986. Delay of disease development in transgenic plants that express the
tobacco mosaic virus coat protein gene. Science 232:73 8-743.

40 ,

Provvidenti, R, Gonsalves, D., Humaydan, HS. 1984. Occurrence of ZYMV in cucurbits
from Connecticut, New York, Florida and California. Plant diseases 68:443-446.

Quemada, H., Sieu, L.C., Siernieniak, D.R, Gonsalves, D., and Slightom, J.L. 1990.
Watermelon mosaic virus I] and zucchini yellow mosaic virus: Cloning of 3 ’ terminal
regions, nucleotides sequences, and phylogenetic comparisions. J. Gen. Virol. 71:1451-
1460.

Quemada, H.D., Gonsalves, D., Slightom, J .L. 1991. Expression of coat protein gene
from cucumber mosaic virus strain C in tobacco: protection against infections by CMV
strain transmitted mechanically or by aphids. Phytopathology 81:794-802.

Ravelonandro, M., Monison, M., Delbos, R, and Dunez, J. 1993. Variable resistance to
plum pox virus and potato virus Y infection in transgenic Nicoticma plants expressing
plum pox virus coat protein. Plant Science. 91: 157-169.

Register, J .C., Beachy, RN. 1988. Resistance to TMV in transgenic plants results fiom
interference with an early event in infection. Virology 166:524-532.

Reimann-Philip, U., and Beachy, RN. 1993a . Coat prtoein-mediated resistance in
transgneic tobacco expressing the tobacco mosaic virus coat portein from tissue-specific
promoters. Mal. Plant-Microbe Interact. 6:323 -330.

Reimann-Philip, U., and Beachy, RN. 1993b. The mechanism(s) of coat protein-mediated
resistance against tobacco mosaic virus. Semin. Viral. 4:349-3 56.

Sanford. J.C., and Johnston, SA. 1985. The concept of parasite derived resistance-
deriving resistance genes from parasite’s own genome. J. Theor. Biol. 113:395-405.

Scholthof, K.G.B., Scholthof, H.B., Jackson, A0. 1993. Control of plant virus diseases
by pathogen-derived resistance in transgenic plants. Plant Physiol. 102: 7-12.

Shaw, J.G., Plaskitt, K.A., Wilson, T.M.A. 1986. Evidence that tobacco mosaic virus
particles disassemble co-translationally in viva. Virology 148:326-336.

Sherwood, J.L. and Fulton, RW. 1982: The specific involvement of coat protein in
tobacco mosaic virus cross-protection. Virology 119: 150-158.

Shukla D.D., Strike. P.M., Tracy. S.L., Gough. RH and Ward. CW. 1988. The N and C
termini of the coat proteins of potyviruses are surface located and the N terminus contains
the major virus-specific epitapes. J. Gen. Virol. 69: 1497-1508.

Shukla, DD, and Ward, CW. 1988. Identification and classification of potyviruses on
the basis of coat protein sequence data and serology. Arch. of Viral. 106: 171-200.

41

Shukla, D.D., Tribbick., G., Mason, T.J., Hewish, D.R, Geysen, HM. & Ward, CW.
1989. Localization of virus-Specific and group-specific epitopes of plant potyviruses by
systematic irnmuno chemical analysis of overlapping peptide fragments. Proc. Natl. Acad.
Sci. USA. 86: 8192-8196.

Shukla, DD. and Ward, CW. 1989. Structure of potyvirus coat proteins and its
application in the taxonomy of the potyvirus group. Adv. Virus Res. 36:273-314.

Shukla, D.D., Frankel, M.J., Wasr, CW. 1991. Structure and firnction of the potyvirus
genome with special reference to the coat protein coding region. Plant Pathology 13: 17 8-
191.

Silva-Rosales, L., Lindbo, J.A., and Daugherty, W.G. 1994. Analysis of transgenic
tobacco plants expressing a truncated form of a potyvirus coat protein nucleotide
sequence. Plant Mol. Biol. 24:929-939.

Smith, HA, Powers, H., Swaney, S., Brown, C., and Daugherty, W. 1995. Transgenic
potato virus Y resistance in potato: Evidence fi'om RNA-mediated cellular response.
Phytopathology 85:864-870.

Smith, HA, Swaney, S.L., Parks, T.D., Wernsman, EA, and Daugherty, W.G. 1994.
Transgenic plant virus resistance mediated by untranslatable sense RNAs: Expression,
regulation, and fate of nonessential RNAs. The Plant Cell 6: 1441-1453.

Stark, D.M., and Beachy, RN. 1989. Protection against potyvirus infection in transgenic
plants: evidence for broad spectrum resistance. Bio/Technology 7: 1257-1262.

Taschner, P.E.M., Marle, G.V., Brederode, F.T., Turner, NE, and Bol, J.F. 1994. Plants
transformed with a mutant alfalfa mosaic coat protien gene are resistant to the mutant but
not to the wild type virus. Virology 203:269-276.

Thombury, D.W., and Pirone, TR 1983. Helper components of two potyviruses are
serologically distinct. Virology 125: 487-490.

Turner, N.E., O’Connell, K.M., Nelson, RS., Sanders, P.R., Beachy, R.N., Fraley, RT.,
and Shah, BM. 1987. Expression of alfalfa mosaic virus coat protein gene confers cross-
protection in transgenic tobacco and tomato plants. EMBO J. 6:1181-1188.

Turner, N.E., Kaniewski, W., Haley, L., Gehrke, L., Lodge, J .K., and Sanders, P. 1991.
The second amino acid of alfalfa mosaic virus coat protein is critical for coat protein-
mediated protection. Proc. Natl. Acad. Sci. USA 88:233 1-233 5.

Vaira, A.M., Semeria, L., Crespi, 8., Lisa, V., Allavena, A, and Accotto, GP. 1995.
Resistance to tospoviruses in Nicotiana benthamiana transformed with N gene of tomato

42

spotted wilt virus: Correlation between transgene expression and protection in primary
transformants. Mal. Plant-Microbe Interact. 8:66-73.

van der Vlugt, RAA, Ruiter, RK., and Goldbach, R 1992. Evidence for sense RNA-
mediated protection to PVY“ in tobacco plants transformed with the viral coat protein
cistron. Plant. Mol. Biol. 20:631-639.

van Dun, C.M.P., and JP. Bol. 1988. Transgenic tobacco plants accumulating tobacco
rattle virus coat protein resist infection with tobacco rattle virus and pea early browning
virus. Virology 167:649-652.

van de Vlugt, RAA, and Goldbach, RW. 1993. Tobacco plants transformed with the
potato virus Y-N coat protein gene are protected against different PVY isolates and
against aphid-mediated infection. Transgenic Research 2: 109-1 14.

van Dun, C.M.P., Bol, J .F., and Van Vloten-Doting, L. 1987. Expression of alfalfa mosaic
virus and tobacco rattle virus coat protein genes in transgenic tobacco plants. Virology
159:299-305.

van Dun, C.M.P., Overduin, B., Vloten-Doting, L.V., and Bol, J.F. 1988. Transgenic
tobacco expressing tobacco streak virus or mutated alfalfa mosaic virus coat protein does
not cross-protect against alfalfa mosaic virus infection. Virology. 164:383-389.

Vuento, M, Paananen, K., Vrhinen-Ratna, M., and Kurppa, A. 1993. Characterization of
antigenic epitopes of potato virus Y. Biochemica et Biophysica Acta 1162: 155-160.

Ward, C.W., and Shukla, DD. 1991. Taxonomy of potyviruses: Current problems and
some solutions. Intervirol. 32:269-296.

Wilson, T.M.A 1984a. Co-translational disassembly of tobacco mosaic virus in vitro.
Virology 137:255-265.

Wilson, T.M.A. 1984b. Co-translational disassembly increases the efficiency of expression
of TMV RNA in wheat germ cell free extracts. Virology 138:353-356.

Wilson, T.M.A. 1985. Nucleocapsid disassembly and early gene expression by positive
strand RNA viruses. J. Gen. Virol. 66: 1201-1207.

Wilson, T.M.A 1993. Strategies to protect crop plants against viruses: pathogen-derived
resistance blossoms. Proc. Natl. Acad. Sci. USA 90:3134-3141.

\Vilson, T.M.A, and Watkins, PAC. 1986. Influence of exogenous viral coat protein on
the co-translational disassembly of tobacco mosaic virus particles in vitro. Virology
149:132-135.

43

Wisniewski, L.A, Powell, P.A, Nelson, RS., and Beachy, RN. 1990. Local and systemic
Spread of tobacco mosaic virus in transgenic tobacco. Plant Cell 2:559-567.

CHAPTER TWO

CLONING OF ALTERED ZYMV COAT PROTEIN GENES FOR EXPRESSION IN

PLANTS AND ANALYSIS OF TRAN SGENIC PLANTS

INTRODUCTION

Coat protein mediated protection is one of the most widely used genetic engineering
approaches to viral resistance. In this approach, the gene encoding the coat protein is
isolated Earn the virus in question and inserted into the chromosomes of the susceptible
plant. Coat protein mediated resistance has been demonstrated in various virus groups
successfully, but so far there is no unifying hypothesis to explain the mechanism of such
protection.

Zucchini yellow mosaic virus (ZYMV) is a very aggressive potyvirus, it causes major
losses in cucurbit crops. In an efl‘ort to genetically engineer potyvirus resistance, to test
for protection against both homologous and heterologous viruses, and to gain insight into
possible mechanisms of protection, Fang and Grumet (1993) utilized three versions of the
ZYMV CP gene: The hill-length CP gene, a truncated Core portion of the CP gene, and
an antisense version of the CP gene. All the necessary information required for
polymerization of coat protein is located within Core region (Shukla et al. 1988;
Daugherty et al. 1985; Jagadish et al. 1993b; Dolja et al. 1994). It has been hypothesized
that for several systems CP-mediated protection involves CP-RNA or CP-CP interaction

(Beachy et al. 1990; Grumet, 1990; Nelson et al. 1990). Based on this Fang and Grumet

45

(1993) hypothesized that, if these processes are critical for protection against
potyvirus infection, then the Core portion of the protein would be expected to confer
resistance, since domains responsible for CP-RNA interaction and CP-CP interaction are
located within Core. They further predicted that it might be possible that plants expressing
the conserved CP gene fragment would be protected fiam infection by more than one
potyvirus. Therefore, the truncated version of the CP gene including the highly conserved
central- and carboxy-terminal region (the Core portion) was used to test the above said
hypothesis.

The three ZYMV CP-derived constructs were engineered and introduced into melon
and tobacco plants and the efl‘ect of those constructs was studied on increasing resistance
to infection by ZYMV and two heterologous potyviruses, TEV and PW. Most of the
plants expressing hill-length CP did not Show any disease symptoms for at least 90dpi.
Melon plants expressing ZYMV Core protein Showed a 3- to lO-day delay in symptom
appearance. The symptoms on the Core-protein expressing plants were milder than for
control plants. The FL-CP expressing plants that did not develop symptoms also did not
accumulate measurable virus levels. The virus titer in transgenic plants expressing the
Core construct was intermediate between the inoculated controls and FL-CP plants.
Protection against ZYMV did not correlate with the levels of protein expression.

When the transgenic tobacco plants expressing FL-CP and Core constructs were
challenged with heterologous viruses potyviruses PVY and TEV, there was no obvious

difl‘erence between transgenic plants expressing any of three forms of the ZYMV CP gene

46

in time to symptom appearance, or symptom severity in systemic leaves. However, there
was a few days delay in symptom development and the disease symptoms in most plants
were milder, and younger leaves often had no symptoms. Vuus accumulation was
correlated with the degree of visual symptoms. The results with TEV were similar to those
with PVY.

Although the Core protein was expressed at levels comparable to the FL-CP and did
confer some protection, the Core construct was not as efi‘ective as the FL-CP construct
that resulted in apparent immunity to ZYMV infection. Possibly the Core and arnino-
terminus of the protein interfere with virus infection at different stages of the process, or
the hill length CP may have higher affinity for viral RNA or other CP molecules than does
the Care. In case of protection against heterologous viruses TEV and PW, both the FL-
CP and Core constructs performed similarly. It may be that the function provided by the
Core portion or its RNA, which results delay in infection and reduction in virus titer, is
capable of acting on more than one potyvirus. In contrast, the effect of the amino
terminus, the sequence of which is virus specific, may be limited to the virus from which
the CP gene was derived (Fang and Grumet, 1993).

A key feature in elucidating the mechanism involves identifying the molecules
responsible for protection. The role of amino terminal portion, if any, is not known. It is
not understood whether the protection conferred by FL-CP is RNA mediated or protein
mediated, the mechanism underlying is not understood.

As an initial step towards the study of the mechanism of protection, my project was

to make clones of altered ZYMV CP genes, (amino terminal portion alone and sense-

47

defective version of FL-CP) and produce transgenic N. benthamiana plants expressing the
modified CP genes and conduct preliminary analysis of transgenic plants. Virus protection
studies can be conducted on these transgenic plants and alternatively the cloned CP genes
can also be used to generate transgenic melon plants so that the mechanism of CP
mediated protection for ZYMV can be studied in melons. In this chapter, the construction
of two versions of ZYMV CP genes and expression of these genes in transgenic

Mbenthamiana, and analysis of transgenic plants are described.

48

MATERIALS AND NIETIIODS

Plgmids and recombinant DNA manipulations:
The plasmid pTL37 which contains the TEV 5’ nontranslated lead sequence (NTR) was

obtained from Dr. W. Daugherty (Oregon State University). The plasmid pGA643, which
contains the CaMV 358 promoter, T-DNA borders, neomycin phosphotransferase gene
(NPTII gene) and tetracycline resistance gene, was used as the T-DNA vector (An et al.
1988). The full-length coat protein sequence (CP) (Fig. 1) of ZYMV was cloned into
plasmid pTL37 by Fang and Grumet (1993). All recombinant DNA and bacterial
manipulations were carried out using standard methods (Sambrook et al. 1989), unless
otherwise indicated. Restriction enzymes were purchased from Boeringher Manheirn and
were used according to supplier’s instructions. In vitro transcription and translation were
performed using the Promega riboprobe and rabbit reticulocyte lysate systems
respectively. The polymerase chain reaction (PCR) was carried out using the Gene Amp
PCR Reagent kit fiom Perkin Elmer Cetus following the protocol provided by the
manufacturer. The random primed labeling kit was purchased from United States Biochem

Inc. and was used according to suppliers instructions.

Cloning of the m‘ gterminal mrtion of the coat protein gene (CP-NT):
The cloning of the amino terminal portion OfZYMV-CF gene is summarized in Figure 2.

The full length coat protein sequence (CP) of ZYMV in plasmid pTL37 (Fang and

Grumet 1993) was used as a template for PCR amplification of the 279 base pair

49

fiagment which includes 150 bases of the TEV S’NTR and 129 bases of the anrino
terminal portion of the full-length coat protein (FLCP); just upstream of KDVKD motif
(see Fig. 1). Primers were designed to match the sequences at the 5’end of TEV S’NTR
(RG 6 :5’ AGATC TAAAT AACAA ATCTC AACAC AACA 3’) and the 3’ end of the
amino terminal portion of the hill length coat protein sequence (RG22: 5’CTTGA
GCTCC GTGAC AGCTG CTAG 3’) and to introduce a Sacl Site at the 3’ end of the
amino terminus of the FLCP. The amplified fragment of TEV 5’ NTR+N-term was
digested with Neal and Sad to release the amino terminal portion of the FLCP gene
(129 bases), corresponding to positions 498 to 627 of the cDNA sequence of the terminal
3’ 1546 nucleotides of ZYMV (numbering as published by Grumet and Fang, 1990; See
Fig.1). which was ligated into Neol-Sacl digested pTL37 to form pTL3 7+NT.

The 3 ’ nontranslated region of ZYMV was amplified from pTL3 7+FLCP using
primers designed to match the 3’end of the coat protein (RG7: 5’AGATCTCTGCA
GCCCTTTTTTTTT 3’) and to introduce a Sad site upstream of the 3’N'I'R (RGZ3:5’
GGTGAGCTCACAATGCAGTAAAGG 3’) via PCR (see fig. 1). The 3’NTR clone
(250 bases) includes 15 base pairs fi'om the 3’end of the coat protein corresponding to
positions 1318-1332 (See fig. 1, Grumet and Fang 1990). The 3’NTR fi'agment was
digested with SacI and PstI and ligated into SacI, PstI- cut pTL37+NT to form
pTL3 7+NT+3’NTR ( Fig 2 ). As a result of addition of same sequence fi'om the 3’ end of
the FLCP 5 amino acids, namely valine—>glutamic acid, aspargine—>leucine, threanine,

methionine, glutarnine and a stop codon are added to the 3 ’NTR. Introduction of the

50

weturmrmmrmuacmucrmrwrsrurc rm .
strtsvssssssttsssss

In ""MIMTWYIAIQIIUIMHWIW I“
SFCILOLIYO'IIIIIEII

“I“WaiflflflcmifluflIHTWAIGIACAIICMM WI
OLUIIIIOAILVOCIYIPI

CICOWMGMYNITIW"CIMTWIMWWMG as
LIIIIIVSILIUOISKIII

ucccuuusscumscscrcccrmrtmrmumc as
IIIIAICAAIIIAUOIIIL

ITWIWYYTTMMWTWTWMIW 3‘3
LOIII‘PYLH'VIKIIVII

YIGWCTWflCflHflIWWflCflWflAYM 3”
LAALCKAP'IAIIALIKL'

AGQWIMWWWMGICGIOA 6“
IO‘OAIESILAIILOALII

wrurcmmmnwmmrmm at:
orrrssssrvstmsrsrr

GTGTWYKIWGCTWWWIQWW 57°
VSDAOAIIIOIIOOIOKII

61661 YAWWWTWWBIW
DVIBSOSIIKIJAAVI‘KOI

arermrmmtcrurmnmmanmrm ‘I‘
OVIACSICIIVPILSIII‘
W761CAIIGCUCGCEIWTGTGTKICBYAHGTUWKTO 741
KISL'IVIIIVILOIOILL
GMIAIWCCGEAICAMITGAEIIAIAIWWEIGCAIWC 79.
ILKPOOIILYIIIASIIO'

CCCICIYGETTMCAGEITMUGWIMUIIIGMWIM “5
ASUIIOVIIIYOLIIOOIO

mcrurwrmnurwnarmnmrmrmn m
vvsssruvvcrsssrsrsr
urcmrmcsmmrmtmn warmrmu m
ICVUVIIOOIIOVIY'LI'
mrmccmccrmmrsummnwrsu ms
sssrrrrrsruusrsos
cccuacwmuuwmtMimics-caesium toss
AIAYIIIIIAIAPYIPIYC

i i 687 ICMHWIWTYMIMCWIWTWCYAIW 1 1‘0
LLlILIDIILAIYA'O'YI

CICMIYCTMGIWGIIfiMTW 11,7
VISII'IIAIIAVAOIKAA

GC‘ICITAOUAIGIWCTTWIGI‘NCKUTGMWW‘IWWW 13‘
ALIIVSSILIGLOGIVAII

ARWWTWWGOCSIUI GITMIWIWCIIA 131 1
SIOIIIIIAIOVIIIIIIL

C7165?”“AIf”!yIWIMQaTACCYAafllnGflTm In.
L 5 V I I

“A6"
I V

IGL'CGACGIAAIICYMIAHTACCKYIYA"YUIAYC‘IYHUITTWTG 1‘25
6261’GUQTIngflAMflflflifllflnfl WKWABTC I“!

rrtcammststuscrcmcwsctccrmucactccsrrrc mo
figw

Fig1.1hecDNAaemrocemdprefiaedlnhoaddsqr-roeoflhetamhal3'1546nuc1eraid-ot‘ZYMVJheprwosdponmue-
ontpruehprucaaeansheismdcl'nodndm'kedwihaalam.T'hepruehpruaseans'aeisrnddmodndmkodwnhaslflr.
MMJMWWmMEWMaWWWMWmW
Fign'efioln: Gum-3417130990).

51

'17 TEV CP-gene

s tmOtef 5,N1R
pm pm

1 PCR amplificationl

of -NT & 3’NTR
TEV -NT
5’NTR 3’NTR
Digestion Digestion
withNooI&SacI withSacI&PstI

   

 

 

 

T7 TEV NT ZYMV
promoter 5’NTR 3’NTR

pang-:1"-
PCRamplifieation
1 tointroduceXbaI&BglIIsites

TEV NT
5’NTR

-:

Xbal BglII
35S promoter, NOS terminator
& NPT added

Lborder CaMV3SS TEV NTZYMV NOS NPTII Rborder
promoter 5’N'I'R 3’NTR terminator gene

------- I — - - I
pGA643 Triparental mating

A. tumefaci ens
Figure 2. The genetic engineering of ZYMV CP-NT gene for expression in plants.

52

Sad site resulted in a change of two of the amino acids in the CP sequence that was

added to the 3’NTR, 1. valine to glutamic acid 2. asparagine to leucine.

Cloning pfthe mdefective CP construct (CP-SD):
A fiameshifi mutation was introduced into the CP sequence to make the CP gene

untranslatable. The CP sequence in pTL37 was modified to introduce an AvaI site after
the 10th base pair by introducing a single guanine residue using the primer R625 ( 5’
GCTCCATGGCAGGCACTCGAGCCAACTGTG 3’). RG25 and RG7 were used to
amplify the sense-defective version of the FLCP. Sequence analyses were performed
using the DNASIS program (Hitachi software Engineering) to check the consequences of
the introduced frame shifi mutation. The initial stop codon at position 10 was followed by
several other stop codons throughout the CP sequence. The amplified fi'agment was
digested with Neo 1 and PstI and ligated into the plasmid pTL37 which had been digested

with Neal and PstI (Fig 3 ).

In vitro transcription and translation:
Functionality of the TEV 5’ NTR- ZYMV sense-defective CP gene construct and the

arnino- terminal portion of the CP gene was verified by in vitro transcription fiom the T7
promoter followed by in vitro translation. Tritium labeled leucine was used to label the
sense defective CP. The translational product derived from approximately 0.5-1.0

micrograms of transcript was run on a SDS polyacrylarnide gel and visualized by

53

T7 TEV CP- ZYMV
Promoter 5’NTR gene 3’NTR

pm pm

1 PCR amplification introducing an
Aval site
CP-SD gene

 

TEV 5’added
T7 TEV ZYMV
promoter 5’NTR CP-SD gene 3’NTR

P“”—I:_:— ”“37

A
1 PCR amplification

introducing Xba I and Bgi 11 sites
TEV CP-SD ZYMV
5’N'1'R gene 3’NTR
Xbal BgiII
I 35S promoter, Nos terminator &
NPT added
L CaMV35 S TEV CP-SD ZYMV NOS NPTII R border
border promoter 5’N'I'R gene 3’NTR terminator
pGA643
Aval
l Triparental mating

A. tumefaci ens

Figure 3. The genetic engineering of ZYMV CP-5ense defective gene for expression in plants

54

autoradiography. Due to the small size and absence of leucines, the pTL3 7+NT product
was labeled with tritium-labeled lysine. There are thirteen lysines in FL-CP, seven of
which are located within the amino-terminal portion. The expected relative sensitivity for
CP-NT was 50%, when compared to lysine labelled FL-CP . Ari amino acid mix consisting
of all amino acids except lysine was prepared at a concentration of lmM of each amino
acid. The entire translation product was run on a 10% tricine SDS-PAGE gel according
to the protocol of Schagger and Van J agow (1987). In another experiment, the
translation product was run on the gel and was transferred to 0.1micrometer
nitrocellulose. After western blotting the nitrocellulose membrane was exposed to X-ray

film.

Cloning the genes into a T-DNA vector:
The FLCP, FLCP sense-defective, and CP-NT fiagments were amplified through 20

cycles of the PCR using the primers (R626 & RG27) designed to introduce a XbaI site at
the 5’ end ofthe TEV S’NTR and a Bng site at the 3’ end ofthe 3’ NTR. Amplified
fi'agments were digested with XbaI and Bng and ligated into XbaI and BglII-cut
pGA643, adjacent to the plant-selectable marker for kanarnycin resistance, the NPTII
gene. Resulting clones were analyzed by restriction enzyme digestions to verify the
orientation of the inserts with respect to the CaMV 35S promoter and terminator. Three
constructs were generated: ZYMV-FLCP, which contains the FL-CP gene sequence in
the sense orientation; ZYMV-SD, which contains sense-defective version of FL-CP gene;

and ZYMV-NT, which contains the amino-terminal portion of CP. All three constructs

55
contain the CaMV 35S promoter, TEV 5’ NTR, ZYMV 3’ NTR and NOS terminator.

The ZYMV gene constructs and NPTII gene were located within left and right A.

nanefaciens T-DNA borders.

Agzobacterium Msfprmatipn:

pGA643-derived binary vectors containing the ZYMV CP gene constructs namely, CP-
SD and CP-NT, were mobilized from E. coli into the disarmed A. tumefaciens strain
LBA4404 (Hoekema et al. 1983) by tii-parental mating, using the helper plasmid
pRK2013 (Comai et al. 1983) in E. coli HBlOl. pGA643 was maintained on plates with
tetracyline at a concentration of 10mg/l. Antibiotics in YEB plates used for screening
colonies after triparental mating were as listed: tetracycline 6mg/ml, kanamycin lOmg/ml,
and rifarnpicin 35mg/l. Agrobacterium transformants were verified by restriction enzyme
digestions. Plasmid was extracted fiam putative Agrobacterium transformants according
to the alkaline lysis procedure (Bimboirn and Doly 1979). About 100 nanograrns of the
extracted plasmid was used to back-transform competent cells of DHSor. DHSor
transformants were grown and plasmid was extracted by the alkaline lysis procedure
(Bimboim and Doly 1979). Restriction analysis was performed on the extracted plasmid to

verify the transformants.

Plant transfomtion:

Nicotiana benthamiana plants were transformed individually with pGA643 +CP-SD,
pGA643+CP-NT, pCIBlO+FLCP, pCIBlO+Core, and vector pCIBlO using the protocol

of An et al. (1988). Shoots were regenerated on medium consisting of Murashige and

56
Skoog (1962) salts, sucrose (30 g/l), benzyladenine (1mg/l) napthalene acetic acid

(0.1mg/l), kanamycin (100mg/l) and carbenicillin (300 mg/l). Transformed shoots were
subsequently rooted on phytohormone-free medium containing 100 mg/l of kanamycin
prior to transferring to soil. The tissue culture grth room conditions were 25-26° C
with a 16hr phatoperiod provided by cool white fluorescent lamps (ca. 2500 lux).
Agrobacterium cultures were grown and maintained on YEB medium with 50mg/l
kanamycin. Regenerated plantlets were transplanted to sterile soil mix as soon as roots
appeared and transferred to the growth chamber. The pots were covered with plastic bags
and plants were hardened by gradually exposing them to firll light and heat. The interval
from explant to rooting stage was about 4-5 weeks and from explant to seed set was 14-

15 weeks.

Ems-linked immunpsomept assay (ELISA):

Samples of leaf tissue from kanamycin-resistant regenerated plants were initially screened
for expression of NPT 11 protein using double-antibody sandwich ELISA. The NPTII
assay kit was purchased fi'om 5 prime->3 prime, Inc.(Boulder, CO), and the assay was

performed following the instructions supplied by the manufacturer.

DNA analjpis pf transgenic plants:

Genomic DNA was extracted from young leaf tissue of putatively transformed plants
according to a modified protocol developed from the procedure of Dellaporta et al.
(1985). Instead of grinding the leaf samples in liquid nitrogen, the leaf sap was extracted

by pressing the leaves in a pasta maker. About 0.5-1gm of fresh leaf tissue was added to

57

750 microliters of extraction bufl‘er in a plastic bag and the bag was rolled in a pasta
maker. The extracted leaf sap was placed into an eppendorf tube, 50 III of 20% SDS was
added and the mixture was incubated for 10 minutes at 65° C. 250 pl of 5M potassium
acetate was added and the mixture was chilled on ice for 5 minutes, followed by
centrifugation for 10 minutes. The supernatant was precipitated with 0.7 vol. isoproponal
and 0.1 vol. 3M sodium acetate. The precipitate was resuspended in 500 pl of 50 mM
Tris, 10 mM EDTA (pH 8.0) and purified by a phenol chloroform extraction. The
extracted DNA was treated with RNase A. The presence of the inserted ZYMV CP
fi'agments was verified by PCR using the primers specific for the 5’ end of the TEV non-
translated lead sequence and the and 3’ end OfZYMV 3’ NTR i.e., RG26 and RG27 for
CP-SD, CP—NT., RG6 and RG7 for FLCP and core. About 50ng of total plant DNA was
used with 40 cycles of PCR Cycle conditions were as follows, 94°C 1 min., 58°C 1min,
72°C 2 min. Concentrations were : magnesium sulphate (MgSo.)-1.5mM, dNTP’s-
200mM, primers-150 nanograms, Taq polymerase-2 units. Samples were preheated for 5

minutes at 94° C before starting the amplification.

Transcriptional analysis of transformants:

The transcripts of ZYMV FLCP, FLCP-SD, CP-NT were examined by northern analysis.
Total RNA was isolated from NPT-positive R1 transgenic plants essentially as described
by Nagy et al. (1988). The RNA was separated by electrophoresis in a 1.8% agarose gel
containing formaldehyde and MOPS buffer (Sambrook et al. 1989) and transferred to MSI

magna nylon transfer membrane (Fisher Scientific) for northern analysis. The RNA on the

58

nylon membrane was fixed by UV-cross linking (Sambrook et al. 1989). To prepare the
probe, the ZYMV-CP fiagment was isolated from the plasmid pTL3 7+CP by digesting
with NcoI and PstI and electroeluting the CP fiagment from the agarose gel. The CP
fragment was 32P-labelled using a random primer DNA labelling kit (United States
Biochemical, Corp., Cleveland, OH) and unincorporated nucleotides were removed using
a Spun column (Sambrook et al. 1989) of 1m] G-50 sephadex in TBS was used (20mM
Tris, 20mM NaCl, 2mM EDTA, pH 8). The column was washed twice with 100
nricroliters of TES. Afier adding the sample it was spun in a clinical centrifuge (#4) for 5

minutes and the sample was collected in an eppendorf tube.

Protein analysis pf transgenic plants:

Total soluble protein was extracted fi'om 0. 1 gm leaf tissue of R0 transgenic plants
according to the protocol of Lin and Thomashow (1991), and the concentration was
determined by the method of Bradford (1976). F or FL-CP and Core protein, analysis was
performed on R, plants, whereas in CP-NT and CP-SD, analysis was performed an R0
plants. FL-CP, Core, and CP-SD, protein was separated using a 10% SDS-PAGE gel.
CP-NT protein was separated on a 10% tricine SDS gel . Electrophoresed proteins were
transferred to 0.1micrometer pore size nitrocellulose using an electroblotter. The ZYMV
CP gene fiagment was detected by rabbit anti-ZYMV CP polyclonal antibodies (Harnmar
and Grumet, unpublished) and alkaline phosphatase-conjugated goat-anti rabbit secondary

antibodies (Sigma, St. Louis, MO).

59
@gig analysis:
To test for the inheritance of the introduced NPT II gene, transformed Mbenthamiana

plants were allowed to self-pallinate in the grth chamber. The progeny were examined

for the expression of NPT gene by ELISA as described above.

RESULTS

Comrctipn pf two vgsipns of ZYMV CP gene.

Two versions OfZYMV CP, a sense defective construct (CP-SD) and a construct
comprised of the amino- terrninal portion of the CP (CP-NT) have been constructed (see
Fig. 4). The sense defective construct has the hill length coat protein sequence of ZYMV
but it was rendered untranslatable by introducing a frame shift mutation early in the
sequence. As a result of the flame shift mutation, several stop codons have been
introduced. The initial stop codon at amino acid position 10 was followed by several other
stop codons throughout the CP sequence. The amino-terminal construct has the 100
amino-terminal bases of ZYMV CP generated by PCR using the ZYMV FL-CP construct
as the template and cloned in such a way that it has 150 base pairs of 5’ NTR (of TEV)
on the 5’ end and 250 base pairs of 3’NTR (OfZYMV) on the 3’ end. This process led to
the addition of five amino acids and a stop codon, fi'om the 3’ end of the coat protein to
the 5’ end of the 3 ’ NTR, namely valine-)glutamic acid, aspargine—Meucine, threanine,
methionine and glutarnine. The FL-CP, CP-SD and CP-NT genes were ligated individually
into the binary vector pGA643 adjacent to the transferable plant selectable marker for
kanamycin resistance, the NOS/NPTII chimeric gene. Both the ZYMV gene construct and
NPT II gene were located within left and right A.tumefaciens T-DNA borders.

FL-CP and Core (Fang and Grumet, 1993) which had been cloned previously were
used for comparisions. All the constructs have 5’ NTR (of TEV) at the 5’ end and 3’

NTR (of ZYMV) at the 3’ end. The constructs CP-SD and CP-NT, which were cloned

61

CaMV35S TEV ZYMV CP- ZYMV Transcriptional
PROMOTER 5’NTR Coding 3’NTR terminator

-—- —» —- - J—- m

 

 

 

 

CP-NT

 

 

 

CP-SD

Figure 4. Zucchini yellow mosaic virus coat protein ( ZYMV-CP) constructs. Each CP-
derived construct contains the Agrobacterium tumefaciens T-DNA left and right border
sequences, the cauliflower mosaic virus 35S promoter and either 358 or NOS terminator,
the tobacco etch virus (TEV) S’nontranslated region (NTR), all or a portion of the
ZYMV-CP coding sequence, the ZYMV 3’NTR, and the selectable marker gene for
kanamycin resistance, neomycin phosphotransferase (NPT II). The fiill length-coat protein
(FL-CP) construct includes the fill] length ZYMV-CP coding sequences. The CP-NT
construct contains only the 100 amino-terminal amino acids of the ZYMV CP gene. The
sense defective (CP-SD) construct includes same the components as the FL-CP construct,
except that the ZYMV-CP coding sequence is an untranslatable version.

62
into the T-DNA vector pGA643, have the CaMV 358 promoter and N08 terminator,
whereas FL-CP and Core, which were cloned into a difi'erent T-DNA vector, pCIB 1 0,
have the CaMV 35S promoter and terniinator (Fang and Grumet, 1993). The CP-SD
construct was generated to identify whether the coat protein or its mRN A is required to
00an protection against homologous or heterologous viruses. The CP-NT construct was
generated to study the role of the amino-terminal portion of the ZYMV coat protein in
conferring coat protein mediated protection.

To determine whether the CP-SD and CP-NT constructs were translationally
functional, the protein products of in vitro transcription and translation were examined for
presence and correct size by SDS-PAGE and visualized by autoradiography. The FL-CP
construct and the template from the kit were used as positive controls. The expected 60
kDa protein with kit positive control and 30 kDa CP protein was visible within 3 days of
exposure (Fig. 5). Nothing was detected in the negative control, which had all the
reagents except the template. No protein was detected in the sense defective construct
even after 4 weeks of exposure (Fig. 6), however the expected size transcript was
detected after in vitro transcription, indicating that the construct was transcriptionally
functional but translationally defective. In similar assays the CP-NT peptide also was not
detected (results not shown), but the transcript levels were comparable to controls.
Western blotting on in vitro translation products of CP and CP-NT was unsuccessful.
Possible explanations for the result with NT construct are the NT peptide is not stable or

the amount produced was at a level below the detection limits of the assay used.

63

 

Figure 5. In vitro transcription and translation of the ZYMV CP and CP-SD genes after 3
days of exposure. ZYMV CP and ZYMV CP-SD cDNA in plasmid pTL37 were used as
the templates for in vitro transcription, and then translated in vitro using rabbit
reticulocyte lysate (Promega). The protein products were labelled with 3 H-leucine. Lane
A, translation product using the positive control template provided in the kit, expected
size is 60kD; Lane B, translational product when ZYMV FL-CP RNA was used as
template, expected product is 30kD; lane C, the protein product using ZYMV CP-SD
RNA as template; lane D, negative control has reagents but no template.

 

Figure 6. In vitro transcription and translation of the ZYMV CP and CP-SD genes after 4
weeks of exposure. ZYMV CP and ZYMV CP-SD cDNA in plasmid pTL37 were used as
the templates for in vitro transcription, and then translated in vitro using rabbit
reticulocyte lysate (Promega). The protein products were labelled with 3 H-leucine. Lane
A, translation product using the positive control template provided in the kit, expected
size is 60kD; Lane B, translational product when ZYMV FL-CP RNA was used as
template, expected product is 30kD; lane C, the protein product using ZYMV CP—SD as
template; lane D, negative control, reagents but no template.

65

Plant transformation

The A. tumefaciens binary transformation system was used to introduce ZYMV CP
constructs into N. benthamiana. Kanamycin resistant plants were initially screened for
expression of NPT II protein by ELISA Of the N. benthamiana regenerants, about one
third of the Core (43 out of 113 samples tested), pCIBlO (29 out of 88) and CP-SD (26
out of 75), and approximately one quarter of the FL-CP (19 out of 88 samples), and CP-
NT (17 out of 64) were NPT 11 positive (see Table. 1)

The presence of the inserted ZYMV CP gene sequences in the regenerated, NPT-
positive RoMbenthamiana plants was tested by PCR amplification (see Table. 1) fi'om
plant genomic DNA. The expected size of fragment in FL-CP, CP-SD, Core, CP-NT were
1200, 1200, 1000, 500 base pairs respectively. At least three individual regenerants in each
construct, amplified the expected size fiagments (see Fig. 7). The full length coat protein
construct in E. coli was used as a positive control. DNA from a non-transgenic plant was
used as a negative control. The positive control generated the expected 1200 base pair
fiagment, and no amplification was seen in the negative control. Summaries of the data
collected for each of the putatively transgenic lines is presented in Tables 2 to 5. Most of
the regenerated plants were healthy, morphologically normal, and produced typical
flowers. All plants transformed with CP, Core, pCIBlO produced normal seed. In plants
transformed with CP-SD, one out of 20 lines one was sterile (SD 9A). There was no seed
set in spite of flowering. For plants transformed with CP-NT, only five plants out of 13
plants produced seed, although all the plants flowered normally. In one line (NT 4B), in

addition to sterility, some morphological abnormalities were noticed on leaves (undulations,

Table 1. Characterization of the putatively transgenic R0 individuals of N. benthamiana.

 

 

 

 

 

 

 

Construct Number of Number of ELISA positive Number of PCR positive/
regenerants regenerants / Number of plants Number of ELISA positive

tested plants tested

No. % No. %
pCIBlO+FLCP 170 19 / 88 22 3 / 3 ’ 100
pCIBlO+Core 113 43/113 38 3 I6 50
pGA643+SD 75 26 / 75 35 6 l 8 75
pGA643+NT 64 17/64 27 8/13 62
pCIBlO 88 29 / 88 33 -

 

 

 

 

 

67

2.3 Kb

1.2Kb
1.0Kb

 

0.5 Kb

 

Figure 7. PCR amplified ZYMV CP DNA fragments from transgenic Mbenthamiana
plants. The samples fi'om left to right lane A, larnba standard; lane B and C, FL-CP
transformed Nbenthamiana plants (CP 6A and CP 10F respectively); lanes D and E,
CP-SD transformed Nbenthamiana plants (SD 3D and SD 81-1 repectively); lanes F
and G, Core transformed Mbenthainiana plants (Core 3F and Core 3G respectively);
lane 1, lambda standard (Hind III cut); lanes J K and L, CP-NT transformed
Nbenthwniana plants (NT 5C, NT 5E and NT 13 respectively) ; lanes H and M are
the negative control lanes. The primers used in the PCR were RG-26 and RG-27. The
ZYMV FL CP and CP-SD fragments were approximately 1200 base pairs, the ZYMV
Care was about 1kb and CP-NT was about 0.5 kb

68

mosaic like symptoms and increase in the size of the leaf), even though this particular line
tested positive by PCR. Of the eight sterile individuals of the NT construct, four of them
amplified the expected 500 base pair fiagment when they were tested by PCR. In the
second batch of plants transformed with NT sterility was observed to a lesser extent and
only three plants out of 33 regenerants were sterile. It is not clear whether this sterility is
associated with some factor in the tissue culture process or the construct, since sterility was

relatively more when compared to individuals transformed with other constructs.

Trggriptional analysis of transfomapts

The transcripts of ZYMV CP constructs were examined by northern analysis in R1
transgenics. Representative results are shown in Fig. 8. Hybridization with a labelled
ZYMV CP fragment revealed strongly hybridizing bands in transgenic N. benthamiana
plants which were individually transformed with one of the four versions of the ZYMV
CP gene. The control, non-transforrned plants, did not give any signal. Two lines of FL-
CP were tested, of which one line (CP 10F) produced detectable levels of transcript. In the
other line (CPI) transcript was below detection levels. In the case of the Core transgenic,
the two lines tested (Core 3G and Core 8D) produced detectable levels of transcript.
Three lines of CP-SD (SD 2H, SD 3D, SD 8H) were tested, all of which produced a
detectable amount of transcript, although the level of transcript produced varied between

lines. In the case of the NT transgenics, four lines were tested for transcript (NT 4C, NT

69

Table 2. Summary of the analyses performed on NPT-positive FL-CP transformants

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

PCR Northern western seed produced segregation ratio

“Hines (R0) (R1) (R1) NPT“): (')
CP 1 + - - yes 50 : 76*
CP 10F + + + yes 29 : 10ns
CP 6A + n.t - yes 8 : 68*
CP ID IL 1 n t n.t yes n.t.
CP 1H IL I n. t at. yes n.t.
CP 2 ILL n.t. rLt. yes n.t

CP 2A n.t n. t at yes n.t.
CP 2H n.t. n.t. n.t. yes n.t.

CP 2F n.t. n.t. rLt. yes n.t.

CP 3 n.t. rLL n.t. yes n.t.

CP 4 n. t n. t n.t yes n.t.

CP 5 n. t IL t n.t yes n.t.
CP 56 nt. n.t. n.t. yes n.t
CP 6F n.t. n.t. n.t. yes n.t.
CP 7F n.t. n.t. rLt. yes n.t.
CP 7H at. at n.t. yes n.t
CP 8D n. t n. t at yes n.t.
CP 8H 11. t n.t n.t yes n.t.
CP 9C at. at. n.t. yes n.t.

n.t.- not tested, ~

ns-ratio not significantly different fi'om the predicted ratios by X2 analysis at P2 0.05 (3:1).
"‘ Ratios significantly different from the predicted ratios by X2 analysis at P2 0.05 (3 : 1).
(+) detectable message or protein respectively.

(-) no detectable message or protein respectively.

 

 

Ill.

ail

70

Table 3. Summary of the analyses performed on NPT-positive Core transgenics

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

NPT (+) lines PCR Northern Western Seed produced Segregation ratio
(R0) (R1 I (RI ) NPT(+)3NPT(')

Core 2A + n.t. - yes 2 : 66*

Core 3F + at + yes 20 : 0ns(1m

Core 36 + + - yes 80 : 54*

Core 4D n.t. n.t. n.t. yes (L) 84 : 18ns

Core 5F n.t at at. yes 3 : 101‘

Core 8D n.t. - + yes 19 : 35*

Care 96 nt n.t. n.t. yes (L) 0 : 20

n.t.-not tested.

ns-ratio not significantly different fi'orn the predicted ratios by X2 analysis

at P2 0.05 (3 :1).

* Ratios significantly difl‘erent from the predicted ratios by X2 analysis at P2 0.05 (3 : 1).
L-comparitively less seed produced.

(+) detectable message or protein respectively.

(-) no detectable message or protein respectively.

71

Table 4. Summary of the analyses performed on NPT-positive sense defective CP

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

transgenics

Total NPT (+) PCR Northern western Seed produced Segregation ratio
fin“ (Ro ) (RI ) (R0 ) NPT(+)INV1"(-)
SD 3D + + - yes 39 : l3ns

SD 2H + + - yes 39 : 18ns

SD 8H + - rLt. yes 118 : 6ns “5‘”
SD 3E + n.t. - yes (L) n.t.

SD 11H + n.t. - yes 70 : 125‘

SD 11C + n..t. - yes 96 : 65"I

SD 12F - rLt. - yes in.

SD 2C - n.t. - yes n.t.

SD 3A n.t. n.t n.t. yes n.t.

SD 12 A n.t. n.t n.t. yes n.t.

SD 3F n.t. n.t. rLt. yes n.t

SD 1H n.t. rLL n.t. yes n.t.

SD 2D n.t. n.t. rLt. yes n.t.

SD 11F n.t. n.t. rLt. yes n.t.

SD 10C in. n.t n.t. yes n.t.

SD 5B at. at. n.t. yes M.

SD 9A n.t. n.t. n.t. sterile n.t.

n.t.- not tested.

ns- ratio not Significantly different fi'om the predicted ratios by X2 analysis at

P2 0.05 (3 : lor 15:1).

L- a relatively low amount of seed was produced.

* Ratios significantly different from the predicted ratios by X2 analysis at P2 0.05
(+) detectable message or protein respectively.

(-) no detectable message or protein respectively

72

Table 5. Summary of the analyses performed on NPT-positive NT transgenics.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

NPT ( + ) lines PCR Northern Western Seed produced segregation ratio
( Ro) ( R1 ) (Ro) NPT(+):NP'I‘(-)

NT 2C - n.t n.L no at.

NT 2E - n.L n.t. no n.t.

NT 3C - n.L - yes 41 : 25ns

NT 4A + - - yes 40 : 6ns

NT 78 + + ILL yes 51 : 12ns

NT 4C + + - yes 129: 18*

NT 36 - + - yes 143: 23"

NT 5C + at. n.t. no at

NT SB + n.t. at. no n.t.

NT 13 + n.t. n.L no n.L

NT 2B + n.L ILL no rLL

NT 48 + n.t. ILL no at.

NT 7C + n.t. at no n.L

 

 

 

 

 

 

 

n.t.-not tested

ns- ratio not significantly different fi'om the predicted ratios by X2 analysis

at P2 0.05 (3 : 1).

* Ratios Significantly different from the predicted ratios by X2 analysis at P2 0.05
(+) detectable message or protein respectively.

(-) no detectable message or protein respectively

73

1.28 kb

0.78 kb

 

0.53 kb

Figure 8. Accumulation of transcripts of CP gene constructs in transgenic plants. The
northern blot was loaded with 10 ug of total RNA isolated from leaves of transgenic
Nbenthamiana plants. Lane land 2 FL- CP transformed Mbenthamiana line CP 10F;
lane 3 and 4 Core transformed Nbenihamiana line Core 3G; lanes 5 and 6 CP-NT
transformed lines NT 4C and NT 36; Lanes 7, 8, 10 and 11 CP-SD transformed
Mbenthamiana lines SD 2H, SD 2H, SD 8H, and SD 3D respectively; lane 9- negative
control. The blot was hybridized to P32-labelled cDNA corresponding to ZYMV CP gene.
Sizes of the bands were estimated by running RNA standards (0.155 to 1.770 Kb)
(Gibco-BRL) along the side of the samples.

74

4A, NT 3G, NT 7B). Lines NT 4C and NT 3G produced a detectable amount of
transcript of the expected size. NT 7B transcript was detected but it ran higher than
expected.

The estimated size (based on markers) of the specific transcripts produced by plants
transformed by the ZYMV CP gene (both sense and sense defective) was 1200 bases (Fig.
8). This compares well with the size of the RNA that was expected, which is composed of
150 bases of TEV 5’ NTR, 840 bases of ZYMV FL-CP sequence and 226 bases of
ZYMV 3’ NTR. The ZYMV CP-NT transformed plants showed the expected bands of
500 bases (Fig. 8), which should be composed of 150 bases of TEV NTR, 100 bases of
ZYMV FL-CP and 226 bases of ZYMV 3’NTR The expected size of the Core construct
is 1000 bases (Fig. 8), but it appears to be running little high. Similar observation has been
made elsewhere as well. Lindbo and Daugherty (1992) observed that the transcript of
their sense defective version of the coat protein was running Slightly higher than expected,
possibly due to termination at an alternately selected site and /or a longer poly-A tail on

the transcript.

Expression of ZYMV coat prptein in transformed plants
A total of 18 NPTII-positive Nbenthamiana plants of which 16 were tested positive in

PCRwere tested by western analysis using palyclanal antisera to ZYMV CP (Table 2-5).
A ZYMV infected zucchini plant was used as a positive control. Vector-transfonned and
non-transformed N. benthamiana were used as negative controls. Detectable amounts of

viral protein of expected sizes were found in plants transformed with fiill length CP and

75
Care fi'agments (Fig. 9). Three lines of FL-CP R1 plants (CP 10F, CP 6A & CPI) were
tested for the presence of ZYMV CP protein. Lines CP 10F and CP6A produced
detectable amounts of protein, although the level of expression in CP 6A was less than
that of CP 10F (Fig 9). Protein in line CP 1 was below detectable levels. In the case of
the Core transgenics (RI plants), four lines (Core 8D, Core 3F, Core 2A and Core 3G)
were tested for the expression of the protein. Both Core 8D and Core 3F expressed the
protein at detectable levels, but the level of expression in Core 3F was much lower than
Core 8D (Fig 9). The expression of protein in lines Core 2A and Core 36 was below the
detectable level. In the case of SD transgenics (R0 plants), four lines (SD 2H, SD 11H,
SD 3E & SD 3D) , were tested for the expression of protein and no protein was detected
in any of the SD lines (Fig 8). In the case of NT transgenics (R0 plants), four lines (NT
4A, NT 4C, NT3C & NT 3G) were screened for expression of protein. The positive and
negative controls worked, but there was no detectable amount of protein from NT
transgenics. The experiment was repeated with a ten-fold increase in the
concentration of antibody, but still no protein was detected in the western blot. The
quantity of total plant protein fi'om CP-NT transgenic lines loaded on the Tricine SDS-
PAGE was increased by four times and the antibody concentration by ten times in another

experiment and again detectable amounts of NT protein were not observed.

76

45kD

’29 kD

20kD

 

Figure 9. Detection OfZYMV CP, Core, CP-SD proteins in transgenic Mbenthamiana
plants. Total soluble protein was isolated from leaf samples of transgenic plants. 50ug
total protein isolated from plants transformed with CP, Core, CP-SD was separated on
10% SDS polyacrylamide gel, transferred to nitrocellulose, and treated with rabbit
antibody against ZYMV CP, followed by alkaline phosphatase-conjugated goat anti-rabbit
secondary antibody. Lane 1 contains protein flour a non transformed plant; lane 2 contains
protein from vector (pCIBlO) transformed plants; lane 3 contains protein standards; lane4
contains protein fi'om Core trasnformed plant (core 3F); lane 5 and 6 contain protein from
SD (SD 2H, SD 3D) transformed plants; lane 7 contains protein fi'om CP (CP 10F)
transformed plant; lane 8 contains protein from ZYMV infected sap as a positive control.
The estimated sizes of FL-CP is approximately 30kd, the Care protein is about 26kd. No
protein was detected in CP-SD transformed plants and in negative control. Estimation of
sizes is based on sigma wide range (6.5 - 205kDa) color markers.

77

Spgzegg'on analysis of the inserted genes in the progeny of transgenic plants

To study the inheritance of the inserted genes in transgenic plants, progeny of self-
fertilized transgenic N. benthamiana were analyzed for the presence of the NPT II gene by
ELISA. The results of progeny analysis are shown in Table 6. Progeny from plants CP-
10F, Core 4D, Core 3F, SD 3D, SD 211, NT 7B, NT 4A and NT 3C segregated with a
ratio approximating 3 : l (NPT + : NPT -), suggesting that the NPT genes were inserted
at a single locus. The segregation ratio of progeny from plants SD 8H and Core 3F
approximated 15 : 1 (NPT + : NPT -), suggesting that the NPT II gene was inserted at
two loci. The reason(s) for the aberrant ratios (which did not fit the 3 : 1 expression
model), in the progeny fi'om plants CP 1, CP 6A, Core 2A, Core 36, Core 5F, Core 8D,

Core 9G, SD 111-1, SD 11C, NT 4C and NT 3G are unknown.

78

Table 6. Segregation ratios for the expression of NPT II gene as detected

by NPT-ELISA in the R1 progeny of transgenic Mbenthamiana plants

 

TotalNo. NPT(+) NT(-) +l-ratio x22

 

‘Piam

line

CP 10F 39 29 10 3 : 1 0.034 311s
CP 1 126 50 76 829*
CP 6A 76 8 68 167*
Core 4D 102 84 18 3 : 1 3.15ns
Core 3F 20 20 o 15 : 1 3.60ns
Core so 134 80 54 1633*
Core 2A 68 2 66 186*
Core SF 104 3 101 286*
Core 8D 54 19 35 446*
Core 96 20 0 20 581*
SD 3D 52 39 13 3 : 1 0.03ns
SD2H 57 39 18 3: 1 1.2ns
SD 8H 124 118 6 15 : l .80ns
SD 11H 195 70 125 157*
SD 11C 161 96 65 199*
NT 78 63 51 12 3 : 1 1.4ns
NT 4A 46 40 6 3 : 1 3.3ns
NT 3C 66 41 25 3 : 1 55*
NT 4C 147 129 18 133*
NT so 168 143 23 112*

 

' Plants labelled as CP are transformed with the hill length CP construct; Core, construct
with truncated portion of the gene; SD- construct with sense defective version of the hill
length CP; NT-construct of amino-terminal portion of the CP.

2 X2 values calculated as X2 = £[( Io - eI- 1/2)2/ 1e] using the Yate’s correction factor.
3 ns Ratios not significantly different fiom the predicted ratios by

x2 analysis at P20.05(3: 1).
Ratios significantly different fi'om the predicted ratios by X2 analysis at P2 0.05 (3 : 1).

79

DISCUSSION

Two versions of the ZYMV CP gene, a sense defective construct (CP-SD), and the
amino-terminal portion of the CP (CP-NT), were constructed. The FL-CP, Core, CP-SD
and CP-NT fiagments were cloned into the T-DNA vector, pGA643, and successfully
expressed in Nbenthamiana plants. ZYMV CP, Core, CP-SD and CP-NT fragments
were detected in more than 50% of the NPT positive plants by PCR amplification of
the CP gene. The FL-CP and Core constructs were in the transformation vector
pCIB710 and then transferred into the T-DNA vector pCIBlO (Fang and Grumet 1993),
CP-SD and CP-NT, were carried by vector pGA643. All the constructs have the 5’ NTR
of TEV and the 3’ NTR OfZYMV. It has been shown that the TEV 5’ NTR region can
function as an enhancer of translation (Carrington and Freed, 1990). The 3’ NTR confers
polyadenylation (PolyA) signals to the transcripts (Hari, 1995). Based on the preliminary
analysis of transgenics, there was no significant difference in the percentage of regenerants
that were positive for NPT 11 between the constructs, whether vectored in pCIB 10 or
pGA643 (see Table 1). In the case of constructs in pCIBlO, the percentage ranged fi'om
22% to 39%. In the case of constructs in pGA643 the number of NPT II positives in the
regenerants ranged hour 27% to 35%. It is not possible to compare the PCR data at this
time, since only a few lines of FL-CP and Core constructs have been tested.

Northern blot analysis indicated that the ZYMV CP genes were being transcribed

and maintained at detectable steady state levels. The level of mRNA produced by

80

difl‘erent FL-CP, Core, CP-SD and CP-NT transgenic lines varied. Some plants produced
a higher level of message ( Fig. 7), while other plants produced either no RNA, or
amounts that were below the detection level (data not shown). Overall the RNA levels in
SD lines appear lower than those in FL-CP and Core (Fig. 7). This might be due to the
fact that SD is untranslatable, as untranslatable sequences are usually more unstable. The
plant to plant variability for the expression level may be caused by positional efl‘ects due to
insertion in differently expressed chromosomal locations. Reduced levels of RNA could
also be due to the cellular surveillance mechanism (Lindbo et al. 1993), according to
which plant cells are able to sense elevated or aberrant RNA levels and then target and
inactivate them by a cellular factor which degrades the RNA that has accumulated to a
critical threshold level. In lines in which critical threshold is not reached, the response
system would not be activated (Smith et al. 1995).

The northern and western results verified that the engineered ZYMV CP gene
constructs were functional for expression in plants with the exception of the amino-
terrninal construct. The western blots for coat protein products revealed the presence of
the 30 kD FL ZYMV CP polypeptide and the 26 kD Core protein product in transgenic
plants transformed with FL-CP or Core constructs, respectively but did not detect any
similar protein in SD expressing plants. In the plants expressing the CP-NT gene a 3kD
protein was expected but could not be detected in western blotting despite a high level of
transcription. There could be several reasons for this. The amount of protein may be
below the detection limit or the polypeptide might be unstable when separated fi'om the

rest of the protein. Alternatively, the polypeptide might be present but the CP palyclanal

81

antibody may fail to recognize in due to a conformational change, i.e., when the CP-NT
is seperated from the rest of the CP it may not be folding in the proper conformation to be
recognized by the CP antibody. Though the amino-ternrinal portion of the FL-CP is highly
antigenic (Daugherty et al. 1985; Shukla et al 1989), it is not known whether the arnino-
terminal portion alone retains its antigenic recognition sites. It would be interesting to
know if the amino-terminus, after being removed by trypsin treatment, would retain its
conformation. Doing a western blot on just the amino-terminus after has been separated
fiam coat protein might give some information on the antigenictiy of the isolated amino-
terrninus. Similar to these results, Silva-Rosales et al. (1994) observed that there was no
detectable level of C-terrninal truncated TEV coat protein in transgenic plants. It has been
proposed that perhaps truncated proteins which cannot fold and adopt native
conformation are rapidly cleared from the cell (Silva-Rosales et al. 1994). However, more
lines need to be screened before a conclusion can be reached in this case. In the case of
NT construct, owing to the high level of sterility in the first batch of NT transgenics, only
four lines have been tested for the presence of the NT protein. Even if the protein levels
are below the detection levels, these lines might be still be valuable. There are many
examples in the literature where no correlation exists between the protein expression and
the degree of genetically engineered virus resistance (review , Grumet 1995).

The segregation studies of the progeny of transgenic N. benthamiana plants indicated
that the introduced genes were transmitted to the next generation. In some lines, the
segregation ratios of the progeny were consistent with a 3:1 (NPT positive: NPT negative)

ratio suggesting the incorporation of a single gene. In some lines the ratio approximated

82

15 : 1 (NPT + : NPT -) suggesting insertion at two loci. Aberrant ratios in some lines are
unexplained. Lines with Single locus / gene insertions have been utilized extensively, but
lines with multiple insertions and aberrant ratios have also been reported fi'equently
(review, Grumet 1994; Powell -Abel et al. 1986; Turner et al. 1987).

It is not possible to use Nbenthamiana plants as a model system as planned
to study the mechanism of CPMP. Of all the isolates tested, only ZYMV-NAT and
ZYMV-Ca could systemically infect N. benthamicma, but these isolates also were able to
overcome the CPMP in melons expressing the coat protein gene fi'om ZYMV-Ct (Grumet
et al. 1994). It is not understood whether the ability to infect N. benthamiana systemically
is in any way related to the ability to overcome coat protein mediated protection in
melons. Thus, to study the mechanism of homologous protection it would be necessary to
express the CP-SD and CP-NT gene in melon plants.

However, it will be possible to study the heterologous protection against TEV and
PW, using the lines derived fiam the N. benthamiana transgenic plants expressing CP,
Care, CP-SD, and CP-NT. When transgenic tobacco plants expressing the full length coat
protein of ZYMV were challenge inoculated with TEV and PW, limited protection was
observed (Fang and Grumet, 1993). It would be interesting to compare the response of
transgenic N. benthamiana plants expressing the untranslatable sense construct of ZYMV
CP, to those expressing translatable sense CP in N. benthamiana when challenged with
heterologous potyviruses. If the resistance observed between the plants expressing
translatable and non translatable coat protein sequences is comparable, then it would

suggest that the partial protection observed does not require the presence of coat protein

83

per se or that either RNA or protein could confer partial protection. If even the partial
protection is not observed in plants expressing the non-translatable construct, then it
would suggest that coat protein per se is required even for partial protection against
heterologous potyviruses viruses. It is also possible that the plants expressing CP-SD
would be better protected than those expressing FL-CP.

In earlier studies, transgenic tobacco expressing the Core construct gave limited
protection against the heterologous potyviruses TEV and PW (Fang and Grumet, 1993).
The presence or absence of the amino-terminal domain did not cause any difference with
regard to heterologous protection. Among potyviruses, the most variable region is the
amino-terminal domain. It has been suggested that the N-terminal domain is most likely
involved in classical cross protection (Shukla et al. 1991) and also that the negative cross
protection between some strains is the result of difi‘erent sequence motifs in the N-terminal
domain (Krstic et al. 1995) (negative cross-protection is the inability of two closely
related strains of a virus to cross-protect). The amino-terminal domain has already been
shown to mediate aphid transmission (Atreya et al. 1990), long distance movement (Dolja
et al. 1994), and possibly the host range of potyviruses (Xiao et al. 1991). It would be
interesting to study the effect of the amino-terminal domain, which has been implicated in
many roles, on conferring heterologous protection.

The cloned genes can also be used to transform muskmelon plants (Cucumis melo),
and virus testing can be initiated using the homologous virus i.e., ZYMV, so that
important questions about the mechanism of CP-mediated protection can be addressed.

When CP-SD is expressed in transgenic melons and tested for virus resistance, there are

84

at least three possible outcomes. 1. It could ofi‘er no or very low protection, which would
suggest that expression of coat protein is essential for conferring CPMP. 2. It could ofl‘er
a higher level of protection than plants expressing translatable CP, which would suggest
that the CP mRN A confers protection. 3. It could ofl‘er levels of protection similar to the
lines expressing translatable coat protein. This would suggest that CP RNA is the active
molecule playing a role in CPMP or that the RNA is an active molecule even when CP is
being expressed and that both are playing a role. CP mRN A may exhibit an antisense
activity, blocking virus replication by RNA: RN A interactions. The transcripts may
alternatively, or in addition, compete for viral- and or /host-encoded replication factors (de
Han et al. 1992). There are many examples in potyviruses, where the sense-defective CP
conferred protection, but at varying levels depending on the case. In TEV, untranslatable
CP mRNA provided a higher level of resistance in tobacco when compared to translatable
sense CP (Lindbo and Daugherty, 1992). Similarly plants highly resistant to PVY infection
were generated by expressing sense-defective version of PVY CP gene (Smith et al.
1995). In another case, the non translatable RNA of the PVY CP was shown to be as
efficient as the translatable construct in protection against PVY (van der Vlugt et al.
1992). Tobacco plants transformed with a sense defective version of PVY° 605 CP gene
provided only partial protection against PVY“ 605 (F arinelli and Malnoe, 1993).

Similarly, when CP-NT transgenic melon are tested for virus resistance, assuming
that NT is being produced and is stable, there are several different possible outcomes. 1.
They could show no significant amount of protection, which would suggest that NT by

itself cannot interfere in viral life cycle and confer CPMP. 2. They could show partial

85

protection, which would indicate that Core and NT are interfering at different stages of
viral life cycle, and the presence of both is required to obtain good protection. 3. They
could show significant protection, which would indicate that the NT is playing a key role
in interfering with the viral life cycle or in causing CPMP. This kind of response is possible
because of various roles attributed to the amino-terminal domain of the coat protein. It has
been suggested (Ward and Shukla. 1991) that the N-terminal region of potyviral CP is
involved in virus-specific functions or host-vector-virus interactions due to the high
variability observed in this region. It has also been suggested that variable N- and C-
terrninal regions are necessary for long distance movement (Dolja et al. 1995). In the case
of AlMV the amino-terminus of the CP has been shown to play an important role in
CPMP, since a mutation in the amino-terminal domain made the plants expressing CP
susceptible to viral infection (Turner et al. 1991). Further, in potexviruses viruses
Specifically PAMV, (Abouhaider and Lecrelc, 1995), removal of the N terminal domain
abolished the CPMP, indicating that the amino-terminus of the PAMV CP is the active
domain of the protein which is involved in CPMP. Ifthe exposed amino-terminus

interacts with same plant component in the virus life cycle, then constitutive expression of
NT in plants could possibly interfere in vinis infection. However, in ZYMV, removal of
the amino-terminus lowered but did not abolish CPMP (Fang and Grumet , 1993), so it is
possible that the NT and Core are both involved in conferring protection. It would be
interesting to see if the reduction in the amount of protection offered in Core transgenic
melon can be restored to the levels of FL-CP transgenics by crossing with NT transgenics.

Removal or mutation of the amino-tenninal domain has been shown to afl‘ect CPMP, but

86
the efl‘ect of expressing just the amino-terminal domain is not known. Hence the studies
that would be conducted with the amino-terminal transgenics may lead to some important
information about the mechanism of CPMP. Identifying the molecule (CP or CP mRN A)
and/or the particular domain responsible for conferring the protection would enable us to
gain some insight into the mechanism and help us to design future experiments to elucidate
the exact molecular mechanism involved in coat protein mediated protection.

In summary, CP-SD and CP-NT genes of ZYMV have been successfully
cloned. FL-CP, Core, SD, NT genes have been transformed into Nbenthamiana plants.
The transgenic lines have been verified for the expression of transcript and protein. Lines
have been analyzed for the segregation analysis of the inserted genes in the progeny of
transgenic plants. Based on the analysis, the inserted genes have been found to be
expressed in at least some lines. In each construct, at least one line has been identified
which expresses the transgenic transcript and protein, if expected, with the exception of

CP-NT, where protein was not detectable.

87

LITERATURE CITED

An, 6., Ebert, P.R, Mitra, A, Ha, SB. 1988. Binary vectors. Plant Molecular Biology
manual A3: 1-19.

Atreya, C.D., Raccah, B., and Pirone, TR 1990. A point mutation in the coat protein
abolishes aphid transmissibility of a potyvirus. Virology 178:161-165.

Beachy, RN., Loesch-Fries, S. and Tumer, NE. 1990. Coat protein-mediated resistance
against virus infection. Annu. Rev. Phytopathol. 28:451-474.

Birnboirn, H.C., Doly, J. 1979. A rapid alkaline extraction procedure for screening
recombinant plasmid DNA. Nucleic Acids. Res. 7: 1513-1523.

Bradford, MM. 1976. A rapid and sensitive method for the quantitation of microgram
quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72:248-
254.

Carrington, J .C., and Freed, DD. 1990. Cap-independent enhancement of translation by a
plant potyvirus 5’ non translated region. J. of Virol. 64: 1590-1597.

Comai, L., Schilling-Cordavo, C.C., Mergia, A, and Houck, CM. 1983. A new technique
for genetic engineering ongrobacteriurn Ti plasmid. Plasmid 10:21-30.

Dellaporta, S.L., Wood, J., Hicks, J .B. 1985. Maize DNA mini prep. In Molecular
Biology of Plants. Malmberg, Messing, Sussex (eds) p. 36-37.

Dolja, V.V., Haldeman, R, Robertson, N.L., Daugherty, W.G., and Carrington, J.C.
1994. Distinct functions of capsid protein in assembly and movement of tobacco etch
potyvirus in plants. EMBO J. 13: 1482-1491.

Daugherty, W.G., Wills, L., and Johnston, RE. 1985. Topographic analysis of
tobaccoetch virus capsid protein epitapes. Virology 144266-72.

Fang, G. W., and Grumet, R. 1990. Agrobacrerium mmefaciens mediated transformation
and regeneration of muskmelon plants. Plant Cell Rep. 9: 160-164.

88

Fang, G., and Grumet, R 1993. Genetic engineering of potyvirus resistance using
constructs derived from zucchini yellow mosaic virus coat protein gene. Mol. Plant-
Microbe Interact. 6:358-367.

Grumet, R, and Fang, G.W. 1990. cDNA cloning and sequence analysis of the 3’-terminal
region of zucchini yellow mosaic virus RNA. 1. Gen. Virol. 71: 1619-1622.

Grumet, R. 1995. Genetic engineering for crop virus resistance. HortScience. 30:449-456.

Hari, V. 1995. The potyviiidae. Pages 1-18 in : Pathogenesis and host specificity in plant
diseases Vol.III. Singh, RP., Singh, S.S., Kohmoto, K., eds. Pergamon, Tarrytown, New
York.

Hoekema, A, Hirsch, P.R, Hooky’s, P.J.J., and Schilperoof, RA. 1983. A binary strategy
based on separation of vir and T-region of the Agrobacterium turnefaciens Ti plasmid.
Nature 303: 179-190.

Hahn, T., Richards, K., and Lebeurier, G. 1982. Cauliflower mosaic virus on its way to
becoming a usefiil plant vector. Curr. Topics Microbial. Irnmunol. 96: 193-236.

Jagadish, M.N., Shukla, D.D., Grusovin, J., Whittaker, L. McPhee, DA, and Ward, C.W.
1993b. Assembly of a plant virus coat protein into rod-shaped virus-like particles in
Escherichia coli and development of a polyvalent antigen presenting system. Proceedings
of the International Conference on Virology in Tropics, Lucknow, India.

Krstic, R, Ford, RE, Shukla, DD, and Tosic, M. 1995. Cross-protection studies
between strains of sugarcane mosaic, maize dwarf mosaic, jahnsangrass mosaic, and
sorghum mosaic potyviruses. Plant Disease 79: 135-138.

Lin, C and Thomashow, MP. 1991. DNA sequence analysis of a complementary DNA
for cold-regulated Arabidopsis gene cor15 and characterization of the COR15
polypeptide. Plant Physiol. 99: 519-525.

Lindbo, J .A, and Daugherty, W.G. 1992. Pathogen-derived resistance to a potyvirus:
Immune and resistant phenotypes in transgenic tobacco expressing altered forms of a
potyvirus coat protein nucleotide sequence. Mal. Plant-Microbe Interact. 5:144-153.

Lindbo, J. A, Silva-Rosales, L. ,Proebsting, W. M., and Daugherty, W. G. 1993. Induction
of a highly specific antiviral state in transgenic plants: Implications for regulation of gene
expression and virus resistance. Tthe Plant Cell. 521749-1759.

Murashige T. and Skoog, F. 1962. A revised medium for rapid growth and bioassay with
tobacco tissue culture. Physiol. Plant 15:473-498.

89

Nagy, F., Kay, SA, and Chua, NH. 1988. Analysis of gene expression in transgenic
plants in: Plant Molecular Biology Manual. S.B.Gelvin and Schilperoort, RA, eds.
Kluwer Academic Publishers, Dordrecht, the Netherlands.

Nelson, R. S., Powell, PA, and Beachy, RN. 1990. Coat protien mediated protection
against virus infection. Pages 13-24 in: Genetic engineering of crop plants. Lycett, G.W.,
and Grieson, D., eds. Butterworth, Borough Green. Seven oaks, Kent, UK.

Odell J .T., Nagy, F., and Chua, NH. 1985. Identification of DNA sequences required for
activity of the CaMV 358 promoter. Nature. 313: 810-812.Sambroalg J., Fritsch, BF,
and Maniatis, T. 1989. Molecular cloning: A laboratory manual (2nd ed.). Cold Spring
Harbor Laboratory Press, Plainview, NY.

Rothstein, S.J., Lahners, K.N., Lotstein, RL., Carozzi, N.B., Jayne, S.M., and Rice, DA.
1987. Promoter cassettes, antibiotic genes, and vectors for plant transformation. Gene
53:153-161.

Schagger, H and J agow, G.V. 1987 . Tricine-sodium dodecyl sulfate-polyacrylamide gel
electrophoresis for the separation of proteins in the range from 1 to 100 kDA Analytical
Biochem. 166: 368-379.

Shukla D.D., Strike. P.M., Tracy. S.L., Gough. K.H and Ward. CW. 1988. The N and C
termini of the coat proteins of potyviruses are surface located and the N terminus contains
the major virus-specific epitapes. J. Gen. Virol. 69: 1497-1508.

Shukla, D.D., Tribbick, 6., Mason, T.J., Hewish, D.R, Geysen, H.M., Ward, CW. 1989.
Localization of virus-specific and group-specific epitopes of plant potyvirus by systematic
immunochemical analysis of overlapping peptide fi'agments. Proc. Natl. Acad. Sci. USA.
86:8192-8196.

Shukla, D.D., Frenkel, M.J., and Ward, CW. 1991. Structure and firnction of the
potyvirus genome with special reference to the coat protein coding region. Can. J. Plant
Pathol. 13:178-191. ‘

Silva-Rosales, L., Lindbo, J.A., and Daugherty, W.G. 1994. Analysis of transgenic
tobacco plants expressing a truncated form of a potyvirus coat protein nucleotide
sequence. Plant Mol. Biol. 24:929-939.

Smith, HA, Powers, H., Swaney, S., Brown, C., and Daugherty, W. 1995. transgenic
potato virus Y resistance in potatozEvidence from RNA-mediated cellular response.
Phytopathology 85:864-870.

Smith, H. A, Swaney, S.L., Parks, T.D., Wernsman, EA, and Daugherty, W.G. 1994.
Transgenic plant virus resistance mediated by untranslatable sense RNAs: expression,
regulation, and fate of non essential RNAS. the Plant Cell. 6: 1441-1453.

Van der Vlugt, RAA, Ruiter, RK., and Goldbach, R 1992. Evidence for sense RNA-
mediated protection to PVY“ in tobacco plants transformed with the viral coat protein
cistron. Plant. Mol. Biol. 20:631-639.

van Dun, C.M.P., and B01, J .F. 1988. Transgenic tobacco plants accumulating tobacco
rattle virus coat protein resist infection with tobacco rattle virus and pea early browning
virus. Virology 167:649-652.

Ward, C .W., and Shukla, DD. 1991. Taxonomy of potyviruses: curent problems and
some solutions. Intervirology 322269-296.

CHAPTER THREE

ZYMV SUSCEP’ITBHITY STUDIES ON N. benthamiana

INTRODUCTION

In many cases, limitations of gene transfer and plant regeneration technologies have
necessitated the use of plant hosts (often Nicotiana species) that are model systems. The
goal of this study was to make clones encoding altered versions of the CP gene of ZYMV-
Ct and produce transgenic plants so that the mechanism of coat protein mediated
protection could be studied. Transformation and regeneration of muskmelon plants using
Agrobacterium tumefaciens and a leaf disk procedure has been successfully demonstrated
by Fang and Grumet (1990). However, the eficiency of transformation and regeneration
was 3-7% (calculated from initial explant to transgenic plant). Time fi'om initiation of
experiment to plants in the green house was approximately six months. Due to the
limitations of time and efficiency, it was decided to develop a model system to study the
mechanism of CP-MP against ZYMV.

Nicotiana bentharniana Domin. was selected to study the CP-MP protection for
ZYMV, because of its ease of transformation, regeneration at a much higher eficiency
than melon, and its relatively Short life cycle. Also N. benthamiana has a large virus
range. More than fifty viruses (Christie and Crawford, 1978; Quacquarelli and Avgelis,
1975) belonging to a wide range of groups, can infect N. benthamiana, most of them are

mechanically transmissible and cause systemic infection, including many potyviruses like,

91

92
SMV, WMV II, PVY, TEV, BYMV, PeaMV, CYW, PeMV etc.(Namba et al. 1992).

This species has been recommended as suitable host plant for maintaining and /or purifying
several plant viruses (Quacquarelli and Avgelis, 1975) and has been widely used as a
model system in many virus studies. As far as susceptibility to ZYMV is concerned, there
were contradictory reports in the literature. Although Provvidenti and Gonsalves (1984)
reported that Nbenthamiana iS not susceptible to ZYMV infection, Wang et al. (1992)
reported symptomless infection on inoculated leaves with ZYMV-Ct on N. benthamiana
and Lecoq et al. (1993) reported that a non aphid transmissible strain of ZYMV (ZYMV-
NAT) (Antignus et al. 1989) systenrically infects Mbenthamiana. Based on this
information, prospects for the use of N. benthamiana as a model system seemed promising
and would allow a study of CPMP against homologous and heterologous viruses in a
single Species. It was hoped that even if ZYMV does not cause systemic infection in

N. benthamiana, it might still be possible to work with inoculated leaves, or if it causes
symptomless infection, to assay for virus infection by inoculation of indicator hosts or by
ELISA. Studies were initiated to further characterize its susceptibility to viruses and

strains of interest to this study and to optimize a system for studying ZYMV infection.

93

MATERIALS AND METHODS

IMion of N. benthamiana with ZYMV-Ct

ZYMV-Ct was maintained on zucchini (Cucurbita pepo ‘Black Jack’). Inoculum was
prepared by grinding 1 gm of flesh leaf tissue from ZYMV-infected zucchini with lml of
20mM potassium phosphate bufl‘er, pH 7.0. N. benthamiana plants which were at the 4-8
leaf stage were used for inoculations. 400-mesh carborundum was dusted on the top 3-4
leaves and rub inoculated. A total of 42 plants were used in 6 rows. One row of plants
was not inoculated and another row was mock inoculated with just the bufl‘er to serve as
controls. The local infection was tested by ELISA. 2-3 punches were taken from each leaf
and pooled in one well of an ELISA plate. Data was collected for local infection 4,7,10,
14, 21 days post inoculation. Data for systemic infection was collected 2, 3, and 6 weeks
post inoculation using the two youngest leaves on each plant to take samples to conduct
ELISA. The procedure was based on Romaine et al. (1981). The antibody was anti-
ZYMV antibody raised against ZYMV virions (Ct strain, S.Hammar and RGrumet,
unpublished), Leaf disk samples were placed in a microtiter plates, fi'ozen (at -80° C),
thawed, and incubated in coating buffer at 4° C for 16 hr. Samples were reacted with
121,000 dilutions of antibodies for 2 hr at 37° C, followed by incubation with alkaline
phosphatase-goat anti-rabbit conjugate (Sigma, St. Louis, M0) for 2 hr at 37° C. p-
Nitrophenyl phosphate substrate was added and samples were read for absorbance using a

Datatech plate reader at 405nm. Infection on Nbenthamiana was further checked by back

94

inoculating one week old zucchini plants with leaf tissue fiom inoculated N. benthamiana
plants at 4,7,10, 14, 21 days after inoculations. The experiment was repeated many times
changing several factors: source of ZYMV inoculum, source of N. benthamiana seed,
growing conditions (growth chamber vs green house), age of the plant at the time of

inoculation etc.

Infection of N. benthamiana with ZYMV-NAT and ZYMV-CA strains

ZYMV-NAT strains were obtained from Dr.B Raccah (Volcani institute, Israel. referred
to as ZYMV-NAT-l) and Dr.T. Pirone (University of Kentucky, referred to as NAT-2).
They were denoted separately to keep the identity of the source. The strains were
maintained on zucchini plants. Symptoms caused by these two strains were different.
NAT-1 showed reduced leaf lamina and shoe string distortion, with very dark green color
around veins, while NAT-2 Showed mosaic symptoms initially and reduction in leaf lamina
at later stages. ZYMV-CA was obtained fi'om Dr. R. Provvidenti (Cornell University).
Nbenthamiana plants at the 4-8 leaf stage were rub inoculated with ZYMV strains. The
top four leaves were dusted with 400-mesh carborundum and rub inoculated. One gram of
Ca-strain infected zucchini leaf tissue tissue was ground in lml of 20mM potassium
phosphate buffer, pH7.0. Symptoms were noted at regular intervals. Leaf punches were
taken from the young leaves and ELISA was performed. Infected leaves of N.
benthamiana were used to back inoculate one week old zucchini plants to observe the

virus symptoms.

95
Challggrp' g CP-transgenic melon with ZYMV-NAT strains

Transgenic CP-expressing plants (line 401 R2 tetraploid ) and control melon plants were
tested for response to inoculation by ZYMV isolates NAT-1, NAT-2 and Ct at the true
leaf stage in three treatments. Five transgenic and 7 control plants were inoculated with
each virus. Negative controls were mock inoculated. Symptoms were observed starting 5

days post inoculation and continuing up to 8 weeks.

RESULTS

Infectipn pf N. benthamiana with ZYMV-Ct There was no detectable virus infection in
the ZYMV Ct- inoculated N. benthamiana plants. There was no local or systemic
symptom development and nno measurable virus as determined by ELI SA Back
inoculation onto zucchini did not show any virus infection as verified by symptoms and
ELISA. There were, however, some rare high readings in the ELISA for the punches
taken fi'om inoculated leaves of N. benthamiana, which could not be repeated on the
punches taken from other parts of the same leaves. It appears that ZYMV-Ct failed to
establish infection in Nbenthamiana. Random high readings in ELISA could be due to

the presence of the virus in the inoculated cells.

Infection of N. benthamiana with ZYMV-NAT

Within 1-2 weeks, mosaic, puckering, and greening symptoms appeared on the new
leaves of N. benthamiana plants inoculated with ZYMV-NAT-l (Table 1). ELISA
readings showed the presence of virus in all collected samples (data not shown). When
ZYMV-NAT-l infected N. benthamiana leaves were used to back inoculate zucchini,
typical symptoms were observed on zucchini plants. It can be concluded that ZYMV-

NAT-l successfully infects N. benthamiana. Interestingly no symptoms were seen on the

’97

plants inoculated with NAT-2 and no virus infection could be seen when the leaf tissue

fi'om NAT-2-inoculated plants were used to back-inoculate zucchini.

Challengm' g CP-trmgenics with ZYMV-NAT
Plants inoculated with ZYMV-Ct did not Show any symptoms of infection, as was
observed by Fang and Grumet (1993) nor did the plants inoculated with ZYMV-NAT-Z.

Moreover transgenic melons expressing CP were not protected against ZYMV-NAT-l.

Symptoms started appearing 7 days post

98

Table 7. Response of ZYMV isolates to transgenic melon expressing ZYMV-CP and
their ability to infect N. benthamiana

 

 

 

 

 

 

Viral strain Infection in Mbenthamiana Disease response in transgenic
melon

ZYMV-Ct No infection Resistant

ZYMV- No infection Resistant

NAT-2

ZYMV- Systemic infection Susceptible

NAT-l

ZYMV-Ca Systemic infection Susceptible

 

 

 

 

99

inoculation. Thus the NAT-2 strain which failed to establish systemic infection in

N. benthamiana, could not infect transgenic melon whereas the NAT-1 strain that could
infect N. benthamiana also could overcome the ZYMV CP-mediated protection. Similar
results were obtained when the experiment was repeated several times (Grumet, 1995.
unpublished). Ct- and both NAT strains showed very Strong symptoms on all non
transgenic melon plants, which started appearing 6 days post-inoculation. No symptoms
were noticed on negative controls. Both ZYMV-NAT strains caused systemic infection

comparable to Ct- Strain.

Infgp'on of N. benthamiana by ZYMV-Ca

The results with NAT-1 prompted an examination of other ZYMV isolates. Among
several tested (Grumet et al. 1994) only one other, ZYMV-Ca could overcome the CP-
mediated protection. When ZYMV-Ca was tested for ability to infect N. benthamiana
mosaic symptoms were observed 1-2 weeks post inoculation. ELISA readings showed the
presence of virus infection (data not shown). Back inoculated zucchini plants showed
typical symptoms of ZYMV-Ca. Based on these results it was concluded that Ca-strain

causes systemic infection in N. benthamiana.

100

DISCUSSION

Initial studies were focused on developing N. benthamiana as a model system for
studying CP-MP against ZYMV in melons. ZYMV-Ct failed to infect Mbenthamiana
systemically, or locally, as verified by syrnptomology, ELISA, and back inoculation on to
zucchini. Even after repeated attempts, ZYMV-Ct did not establish infection in
Nbenthamiana. Wang et al. (1992) also reported negative reaction in ELISA tests for
systemic leaves, but demonstrated local symptomless infection by ELISA for ZYMV-Ct.
Even this did not happen in our case, since ELISA readings were very low.

When it wasn’t possible to establish infection with the homologous strains, other
Strains of ZYMV were investigated. Different ZYMV strains have different host ranges
(Grumet et al. 1994). ZYMV-NAT was reported to be causing systemic infection in
Nbenthamiana (Lecoq et al. 1993), so studies were initiated using this strain. ZYMV-
NAT-l caused systemic infection in Nbenrhamiana, as verified by symptomology, back
inoculation to zucchini, and by ELISA, which is consistent with the reports of Lecoq et al.
(1993). Surprisingly, NAT-2 strain failed to establish an infection in Mbenthamiana. In
order to utilize ZYMV-NAT strains to study the coat protein mediated protection using

Mbenthamiana as model system, one important criterion to be met is that coat protein

101

expressing plants be protected. In addition to conferring complete protection against the
Ct-strain from which the CP gene was derived, the full-length CP expressing melons were
also completely protected against infection by several other North American, middle
eastern, and Asian strains (Grumet et al. 1994). However, when NAT strains were tested
against transgenic melon expressing the coat protein of ZYMV-Ct, ZYMV -NAT-1
overcame the coat protein mediated protection in melons. This strain seemed to be a
resistance breaking strain. Interestingly, the transgenic melons expressing ZYMV-Ct coat
protein were protected against NAT-2 strain, which failed to establish infection in

N. benthamiana (Table 7). Based on these results it was not possible to use NAT strains
to study the CP-MP in Nbenthamiana using a homologous virus.

The results with NAT strains led to the question as to whether there is a
relationship between the ability to systemically infect a species that is not generally a host
for this virus, and the ability to overcome the CP-mediated resistance. In order to
investigate this question, studies were conducted on the Ca-strain, it is a mild strain of
ZYMV which also overcomes CP-MP (Grumet et al. 1994). When Ca-strain was
inoculated onto N. benthwniana, it was able to establish systemic infection as verified by
symptoms, ELISA and back inoculation to zucchini. Ca- was also able to systematically
infect Phaseolus vulgaris cv. Black Turtle 2, unlike other strains (Grumet et al. 1994).
Comparisons among predicted amino acid sequences suggest that the ZYMV-CF
resistance-breaking property is not due to mutations in the CP gene itself (Grumet et al.
1995). It appears that the ability to overcome ZYMV CP mediated resistance in melons is

associated with altered host range (Grumet et al. 1995).

102

In general ZYMV systemic infection is seen only in cucurbits and some legumes ( Lisa
et al. 1981), but it appears that some strains of ZYMV could cause systemic infection in
Nbenthamiana. In addition to the NAT strain, some French isolates can cause systemic
infection (Lecoq, H. 1994. personel communication). ZYMV-TW (Taiwan strain) and
ZYMV-Ct strains have been reported to cause symptomless local infection in
N. benthamiana, whereas the Florida strain and French mild strain could not cause an
infection (Wang et al. 1991). Namba et al. (1992) reported that with Fl- strain vinis was
detectable in the inoculated leaf.

Although we found a strain that could systemically infect N. benthamiana under our
conditions it also overcame the ZYMV CP-mediated resistance. Currently it is not
possible to use Nbenthamiana to study the CP-MP against homologous virus. The
cloned genes have to be transformed into melon to address the questions of mechanism of
CP-MP. However, heterologous protection studies can still be conducted with the
Mbenthamiana transgenics expressing altered coat protein genes even though it is not a
host for ZYMV. Stark and Beachy (1989) reported that tobacco plants expressing the
SMV CP gene are resistant to two potyviruses that are not closely related to SMV,
namely TEV and PVY. This resistance was conferred despite the fact that tobacco is not a
host of SMV. Similarly tobacco plants expressing the CP gene of PRV, another potyvirus
that does not infect tobacco, were highly tolerant of infection by TEV, PVY, and
PeMV(Ling et al. 1991). Tobacco plants expressing the CP genes of ZYMV, which does
not infect tobacco, conferred partial protection against other potyviruses like PVY and

TEV (Fang and Grumet, 1993). The transgenic N. benthamiana plants expressing different

103

forms of coat protein genes can be used to gain insight and gather additional information

regarding heterologous protection offered by ZYMV CP and altered CP genes.

104

LITERATURE CITED

Antignus, Y. B., Gal-On, A, and Cohen, S. 1988. Biological and serological
characterization of zucchini yellow mosaic and watermelon mosaic virus-2 isolates in
Israel. Phytoparasitica 172289-29.

Christie, SR, and Crawford, W.E. 1978. Plant virus range of Nicotiana benthamiana.
Plant Dis. Reptr. 62:20-22.

Fang, G., and Grumet, R. 1993. Genetic engineering of potyvirus ressitance using
constructs derived fi'om zucchini yellow virus coat protein gene. Mal. Plant-Microbe
Interact. 6:358-367.

Grumet, R, Yadav, RC., Akula, G., Hammar, S., Provvidenti, R 1995. Genetic
engineering of virus resistance in cucurbit crops. Proceedings of Cucurbitaceae 94.(In
press).

Grumet, R, Akula, G., Kabelka, E., Yadav, RC., and Provvidenti, R 1995. Ability to
overcome zucchini yellow mosaic virus coat protein mediated resistance in melons is
associated with altered host range. Proceedings of American Phytopathological Society
95.( In press)

Lecoq, H., Ravelonandro, M., Wipf-Schiebel, C., Monison, M., Raccah, B., and Dunez, J.
1993. Aphid transmission of a non-aphid-transmissible strain of zucchini yellow mosaic
potyvirus from transgenic plants expressing the capsid protein of plum pox potyvirus.
Molec. Plant- Microbe Interact. 6:403-406.

Ling, K., Namba, S., Gonsalves, C., Slightom, J .L., and Gonsalves, D. 1991. Protection
against detrimental effects of potyvirus infections in transgenic tobacco plants expressing
the papaya ringspot virus coat protein gene. Bio/Technology 9:7 52-7 58.

Lisa, V., Boccardo, G., D’Agostino, G, Dellavalle,G., and d’Aquillo, M. 1981.
Characterization of a potyvirus that causes zucchini yellow mosaic. Phytopathology
7 1 2667-672.

Namba, S., Ling, K., Gonsalves, C., Slightom, J.L., and Gonsalves, D. 1992. Protection of
transgenic plants expressing the coat protein gene of watermelon mosaic virus or zucchini
yellow mosaic virus against six potyviruses. Phytopathology 822940-946.

105

Provvidenti, R and Gonsalves, D. 1984. Occurrence of zucchini yellow mosaic virus in
cucurbits from Connecticut, New York, Florida, and California. Plant Diseases 68: 443-
446.

Quacquerelli, A, and Avgelis, A. 197 5. Nicotiana benthamiana Donrin. as host for plant
viruses. Phytopath. medit. 14:36-39.

Romaine, C.P., Newhart, SR, and Anzola, D. 1981. Enzyrne-linked irnmunosorbent assay
for plant viruses in intact leaf tissue disks. Phtytopathology 71:308-312.

Stark, D.M., and Beachy, RN. 1989. Protection against potyvirus infection in transgenic
plants: Evidence for broad Spectrum resistance. Bio/Technology 7: 1257-1262.

Wang, H, L., Gonsalves, D., and Provvidenti, R 1992. Comparative biological and
serological properties of four strains of zucchini yellow mosaic virus. Plant Diseases.
76: 530-535.

nrcurcoN STATE UNIV. LIBRARIES
lllllllllllllllll"llllllllllllllllllllllllllllllll
31293013892983