-‘q-L

"3 ’wn‘d ‘

6.922313 i

«o- 1’;

.3. .;

a u 1-1

, '1‘

    

a
I

 

 

4f

..::«;:‘F-;€§1“f:1“7

0:7.

.1.

_ _ _;_ 1, :~. ;.f§r‘.;§;
.4-v,-.n..=._.~2. .‘r. r4

..1 =45!

' S
'n.

 

7*"

5‘; I r
7"? 31".

'Icr’

awe. .3

. 4n .‘ .
11.23:?

was

.5”. {if}:

. 1‘
«I»
..

.

(v

m 4 ,1,“
.1 .'.-.'.- 2 . 2‘2"
1‘ L

‘
O

4%. $411311?" 11,5};T1114131‘; ' é - 411?? £1.“ 1\.
.1224 2 ’«2’2 , $2
1 t \ “‘5’ .3," I w" ‘1‘: l

>5

£5.

EIIIW

W: .4‘z11\°"‘-; 1
'11-" 371:4“.1’1:
$541441.

I

g:

rt‘ '12; : "fr-{Wop . 2:91,": 4
“.15 .

Va ‘
-.I
.-'

.1 11"“, “1.1311111“
11‘ 2144111 ‘1

I .‘ xiu
v2.11 "

fr“
’5. '3’ '44;
f’fi‘l!

mt»- 'TI’

3:19 .-
vaé‘fim‘“
L 2 . .
1425.21 ,I- 4:“ “1.
fax‘2111" 1111;111:451?"

15%.- “12.5le 01‘ .315” U“

1;! '1“me fir

1
,I

- i.
“14‘ “91:3";
‘J’fi‘h: ,3
\g‘w‘r'n‘ ‘ U
l :

I 1“

:11} at“ .gw" v] R

1a.“ «2.. v'T'fi; ”2‘4 '
17:1~ :L‘ 1 I.- ’

13-114. ‘1

:1

1 1 |
in2£1f1.21~1‘..4--.
V .

\‘i -
3.1% ‘5‘. k

1
"h"
4131:“.

1"‘4‘
‘\

_II
I

11'.“

4 I

"IV» “3:11,: k :gw, ‘.
5 """~“i" »«
..\ 15%th ‘

~11"? '

£15.“ I“ li"4:w I
,“ wUMIK ' 1
.122. 2 TI.- “W 1-24.9-
1:21! 1. 111‘ V11?!" } 13$. X12115»:- YRS “4'35 ‘

<ir‘"

3.x
lr'.tl.;‘u'

a.“ .-I
“NV-

 

CHIGAN

lllllllilllll

 

 

 

 

THESE
c a 3;. LIBRARY
Michigan State
University
This is to certify that the

dissertation entitled

P’O‘Mfiw W74 ché‘ond SM} of Maw M Polymerasefl
6W4 Transmpfion Path,» i2HP76‘
presented by
Bo 0M5 Wow]

has been accepted towards fulfillment
of the requirements for

P/LD- degree in BI‘WAQMI‘CO‘Z

Date l2'20-94

 

 

 

_ PLACE It RETURN BOX to remove thie checkout from your record.
TO AVOID FINES return on or bdore on. due.

DATE DUE DATE DUE DATE DUE

    

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

_II | |

MSU to An Affirmative Action/Equal Opportunity lnetiMion
. mm:

 

 

PRODUCTION AND FUNCTIONAL STUDY OF HUMAN RNA
POLYMERASE II GENERAL TRANSCRIPTION FACTOR RAP74

By

Bo Qing Wang

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Biochemistry

1994

ABSTRACT

PRODUCTION AND FUNCTIONAL STUDY OF HUMAN RNA
POLYMERASE II GENERAL TRANSCRIPTION FACTOR RAP74

By

Bo Qing Wang

RAP74 is the large subunit of RAP30fl4 (TFIIF, By), a general initiation and
elongation factor for transcription by RNA polymerase II. Recombinant human RAP74
was expressed in and pm'ified from E. coli. Attaching a 6 histidine tag at the 0an of
the protein allows the most successful purification of full-length RAP74 using a nickel-
chelate affinity resin. The expression level of RAP74 was initially low and there were
many RAP74 fragme *5 strongly associated with the full—length product. These difl’iculties
were primarily due .odons found in the human gene that are rarely used in E. coli. To
improve production, .. segment of the human RAP74 cDNA was receded using a preferred
set of codons for translation in E. coli. Recoding dramatically increased protein production
>10-fold and suppressed production of amino-terminal fragments. Using purified
recombinant proteins, native RAP30/7 4 complex was reconstituted in vitro. The known
functional properties of this complex are indistinguishable from human RAP30/74.

In order to understand the relationship between the structure and the function of
RAP74, - set of comprehensive deletion mutants of RAP74 were constructed with 6
histidine residues attached at their C-termini and purified on a Ni2+-affinity column.
RAP30 binding activity was tested by immobilizing histidine—tagged RAP74 mutants on
nickel-chelate resin and examining the ability of this affinity matrix to retain RAP30. The

results demonstrated that the first 172 amino acids in the most highly conserved N—terminal
domain of RAP74 are sufficient for RAP30 binding. The transcriptional activity of RAP74
mutants along with recombinant RAP30 were tested using RAP30/74 immune-depleted
HeLa nuclear extract. The results indicated that amino acids 1 to 205 of the N-terminal
region are minimally sufficient to stimulate accurate transcription, although C-tcrminal
sequences contribute to activity. RAP74 mutants were fin-ther tested for RNA polymerase
II binding activity using both a nickel binding assay and chromatography on a column
containing immobilized RNA polymerase II. The results revealed that RAP74 contains a
partially masked RNA polymerase II binding domain near its C-tcrminus within the region
from amino acids 363 to 444. Sequences at the N-terminus and within the central portion
of RAP74 regulate the accessibility of this domain. Extending this domain to 363-486
creates a protein that binds polymerase tightly and inhibits transcription initiation in vitro
from non-promoter DNA sites. This larger domain binds RNA polymerase II and DNA
and may regulate polymerase interaction with template both during initiation and elongation
of RNA chains. RAP74 is phosphorylated in vivo and can be phosphorylated in vitro by
casein kinase 11. Th central region of RAP74 from amino acid 205 to 358 is multiply
phosphorylated by t. . sin lcinase II. Human RAP74 and its Drosophila homolog factor 5a
can functionally replace each other in transcription, demonstrating that important aspects of
their structure is highly conserved, although these proteins are very different in their

primary structure.

To my father

iv

ACKNOWLEDGMENTS

I would like to begin by thanking my advisor Dr. Zachary Burton for his patience,
extraordinary generosity, encouragement, and for always being there when I needed him.
His contribution to this work has been invaluable. I have benefited tremendously from Dr.
Burton’s love of science, his perseverance, and his extraordinary kindness.

I also thank Drs. Jon Kaguni, Ronald Patterson, Steve Triezenberg, and John
Wang for their services as my committee members. Special thanks to Dr. John Wang for
his generous advice, help and encomgement. I also thank Dr. John Wilson for his
guidance during my rotation and his continuing concern thereafter.

The former and present members of Dr. Btu-ton's lab have helped me immeasurably
with their friendship and by making the lab a pleasant place in which to work. Special
thanks to Dr. Ann Finkelstein for taking the time to teach me my first lessons in molecular
biology experimental technique and for her friendship and help over the years. I thank
Shawn Chang for generously offering his crafty hands on numerous things such as taking
photos and making slides, and Shimin Fang for his patient help with computer sequence
analysis, for sharing his poems and essays, and for many hours of stimulating
conversations about literature, cinema, politics and recently, evolution. I thank my Chinese
friends in the department and Janek, Carla and Rich for their friendship and
encouragement.

I am grateful to the many people in the department who have assisted me in my
research by providing advice, reagents or loans of equipment. I thank Shawn Chang and
Stephan Reymez for providing specialized reagents as referred to in the text. I
acknowledge the contributions of my collaborators Corwin Kostrub, Dr. Ann Finkelstein,
Lei Lei, Dr. Daniel chhart and Dr. David Price (University of Iowa), Dr. Ross Chambers
and Dr. Michael Dahmus (University of California, Davis).

I thank the entire department staff for being so pleasant and helpful, and especially
thank Vicki for all of her help.

Finally, I thank my mether and my husband, Jay, for their love and faith in me.
Jay’s support and his painstaking efforts at improving and polishing my English have
helped to make this dissertation possible. In many ways, I owe my greatest debt to my
mother, for the many sacrifices she has made for me over the years.

TABLE OF CONTENTS

PAGE
LIST OF FIGURES ....................................................................... x
LIST OF ABBREVIATIONS ............................................................ xii
CHAPTER I: INTRODUCTION .............................................. 1
Literature Review .................................................................. 2
Eukaryotic Transcription ................................................. 2
Transcription Initiation by RNA Polymerase II ....................... 4
RNA Polymerase II ....................................................... 10
General Transcription Factors ........................................... ll
TFIID .............................................................. 11
TBP ................................................................ 11
TFIIB .............................................................. 12
TFIIA .............................................................. l3
TFIIJ ............................................................... l3
TFIIE ............................................................... l4
TFIIH ............................................................... 14
RAP30/74 (TFIIF) ......................................................... 15
Overview ............................................................................. 25
References ........................................................................... 29
CHAPTER II: PRODUCTION OF HUMAN RAP74 IN
BACTERIAL CELLS .......................................... 38
Abstract .............................................................................. 39
Introduction ......................................................................... 40
Materials and Methods ............................................................. 41
Construction of recombinant clones ..................................... 41
pETl ld/RAP74 ............................................................ 41
pETle/RAP‘M ............................................................ 41
pET23d/RAP74 ............................................................ 42
pET16b/23d/RAP74 ....................................................... 42
Production and Purification of RAP74-H6 ............................. 42
Purification of RAP74 with N-terminal histidine extensions ......... 43
Production and partial pmification of RAP74 .......................... 44

V1

Stimulation of accurate transcription .................................... 45

Production of anti-RAP30 and anti—RAP74 anti-serum. .............. 46
Western blotting ........................................................... 46
Results ............................................................................... 47
Recombinant constructs .................................................. 47
Expression clones for production of RAP74 ........................... 47
Purification of RAP74-H6 ............................................... 50
Purification of RAP74 with N ~terminal histidine extensions ........ 55
Transcription activities of recombinant RAP30 and RAP74 ......... 55
Discussion .......................................................................... 58
Acknowledgments ................................................................. 60
References .......................................................................... 61

CHAPTER III: IMPORTANCE OF CODON PREFERENCE
FOR PRODUCTION OF HUMAN RAP74
AND RECONSTITUTION OF

THE RAP30/74 COMPLEX ................................ 63
Abstract ............................................................................. 64
Introduction ........................................................................ 65
Materials and Methods ............................................................ 67
Expression vectors and strains .......................................... 67
Receding a segment of RAP74 .......................................... 67
Replacing the receded segment into pET23d/RAP'74 ................. 68
Removing the C-terminal histidine tag from the receded
pET23d/RAP74NspV vector ............................................ 69
Production and purification of RAP74-H6 and RAP74 .............. 69
Reconstitution of the RAP30/74 complex .............................. 70
Gel filtration analysis of the reconstituted complex ................... 71
Transcription assays ...................................................... 71
Results ............................................................................... 73
Receding a segment of the human RAP74 cDNA ..................... 73
Improved expression using the receded vector ........................ 73
Reconstitution of the RAP30/7 4 complex .............................. 83
Transcriptional activity of the RAP30/'74 complex .................... 87
Discussion ........................................................................... 91
Acknowledgments .................................................................. 92
References ........................................................................... 93

CHAPTER IV: DOMAIN MAPPING OF RAP74,
THE LARGE SUBUNIT OF HUMAN

GENERAL TRANSCRIPTION FACTOR TFIIF ..... 96
Abstract .............................................................................. 97
Introduction ......................................................................... 98
Materials and Methods ............................................................. 102

Oligonucleotides for constructing RAP74 deletion mutants .......... 102

Construction of RAP74 mutant proteins

with His6 at the C-terminus .............................................. 102

RAP30 binding assays .................................................... 105

Accurate transcription assays ............................................. 105

RNA polymerase II binding assays ...................................... 105

General transcription asSays .............................................. 106

DNA probe for gel mobility shift assays ................................ 107

Gel mobility shift assays .................................................. 107
Results ............................................................................... 108

RAP30 binding domain of RAP74 ...................................... 108

Stimulation of accurate transcriptional acfivity ......................... 111

A masked RNA polymerase II binding domain on RAP74 ........... 116

RAP74 fragments inhibit general transcription ......................... 120

Dynamic interactions between RNA polymerase II,

RAP74, and DNA ......................................................... 123
Discussion ........................................................................... 128
Acknowledgments .................................................................. 133
References ........................................................................... 134

APPENDICES

APPENDIX A: DROSOPHILA FACTOR 5A REPLACES RAP74
IN ACCURATE TRANSCRIPTION BY

HUMAN RNA POLYMERASE II ......................... 137
Introduction ......................................................................... 137
Materials and Methods ............................................................. 138
Results and discussion ............................................................. 138

APPENDIX B: CASEIN KINASE II PHOSPHORYLATES

THE CENTRAL REGION OF RAP74 ................... 142
Introduction ......................................................................... 142
Materials and Methods ............................................................. 143

Results and discussion ............................................................. 143

APPENDIX C: RAP74 C-TERMINAL DOMAIN STIMULATES

CTD PHOSPHATASE ACTIVITY ........................ 153

Introduction ......................................................................... 153
Materials and Methods ............................................................. 153
Results and discussion ............................................................. 153
FUTURE STUDIES ..................................................................... 157
References .................................................................................... 158

LIST OF FIGURES

PAGE
Chapter I
Figure 1. Assembly of the general transcription factors required
for the initiation of transcription by RNA polymerase II ............. 6
Figure 2. Alignment of the primary structtn'es of RAP74 fiem
human, Xenopus laevis, and Drosophila ............................... 22
Chapter 11
Figure l. RAP74 production clones ................................................ 48
Figure 2. Purification of RAP74~H5 by NY” afiinity
chromatography in 4 M urea ............................................. 51
Figure 3. SDS-PAGE of recombinant RAP74 .................................... 53
Figure 4. Stimulation of accurate transcription by recombinant
RAP30 and RAP74-H5 .................................................. 56
Chapter 111
Figure 1. Construction of improved RAP74 production vectors ............... 74
Figure 2. Production of RAP74-H5 is improved by receding .................. 76
Figure 3. Purification of RAP74-H5 ............................................... 79
Figure 4. Expression and purification of RAP74 with no histidine tag ........ 81
Figure 5 . Native molecular weights of RAP30, RAP74
and the RAP30/7 4 complex .............................................. 84
Figure 6. Recombinant RAP30/74 has similar activity to human
RAP30/74 for accurate transcription in vitro ........................... 88
Chapter IV
Figure 1. RAP74 deletion mutants .................................................. 109
Figure 2. The N-terminus of RAP74 is involved in RAP30 binding ........... 112
Figme 3. Accurate transcriptional activity of RAP74 mutants ................... 114
Figure 4. RAP74 has a masked RNA polymerase II binding domain
near its C-terminus ........................................................ 118

Figure 5 . RAP74 inhibits general transcription by RNA polymerase II ........ 121
Figure 6. Dynamic interactions between RAP74, RNA polymerase II

and DNA as indicated by a gel mobility shift assay ................... 124
Figure 7. Functional domains of human RAP74 .................................. 127
Figure 8. Alignment of human (h), Xenopus laevis (x), and Drosophila (d)
RAP74 sequences with E. coli 070 and S. cerevisiae Ssu71 ........ 130
APPENDIX A
Figure l. Drosophila F5a functions in accurate transcription by
human RNA polymerase II .............................................. 139
APPENDIX B
Figure 1. Potential casein kinase 11 sites in RAP74 .............................. 145
Figure 2. In vitro phosphorylatien of RAP74 and its deletion mutants ........ 147
Figure 3. Summary of the phosphorylatien of
RAP74 deletion mutants by CKII ...................................... 149
APPENDIX C
Rm 1. Summary efthe stirmrlatien efCI'D phosphatase activity
of RAP74 deletion mutants .............................................. 154

ATP

BSA

529335

EDTA

EGTA
FPLC
GTP
HCA
I-IEPES

LIST OF ABBREVIATIONS
absorbance at 280 nm
abserbancc at 600 nm
amino acid(s)
adenevirus major late promoter
adenesine triphesphate
base pairs
bovine serum albumin
casein kinase 11
counts per minute
cytosine triphosphate
Dalton
deexyribenucleic acid
dithiothreitel
ethylenediamine tetraacctic acid
ethyleneglycel-bis-(B—amineethyl ether) N,N,N‘,N‘-tetraacetic acid
fast protein liquid chromatography
guanine triphesphatc
hydrophobic cluster analysis
N—(2-hydrexyethyl)piperazine-N’-(2-ethanesulfenic acid)

iseprepyl-B-D-thielgalactopyranesidc
kilebase pairs

kiledaltens

Luria-Bertani

messenger RNA

nucleotides

nucleoside triphesphatc

xii

PAGE

pol II
PMSF

rRNA
SDS
TAF
TBP
TCA
TFII
tRNA

optical density

polyacrylamidc gel electrophoresis
polymerase chain reaction

RNA polymerase II
phenylmethanesulfenyl fluoride

RNA polymerase II associating proteins
ribonucleic acid

ribosomal RNA

sodium dodecyl sulfate

TBP associated factor

TATA box-binding protein
trichloroacetic acid

transcription factor of RNA polymerase II
transfer RNA

Single letter abbreviations for the amino acids: A, Ala; C, Cys; D, A ;
Gly; H, His; I, Be; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gln; R, Arg; 8, Ser; T,
Thr; V, Val; W, Trp; and Y, Tyr.

E, Glu; F, Phe; G,

CHAPTER I

INTRODUCTION

LITERATURE REVIEW

Eukaryotic Transcription

Cell growth and differentiation employ precise mechanisms to regulate the
transcription of various genes. Transcription in eukaryotic cells is divided into three
categories. Genes are classified by their promoters, and each class is transcribed by a
different RNA polymerase. Ribosomal RNA (rRNA) is transcribed from rDNA by RNA
polymerase I (pol I). Pre-messenger RNA (pre-mRNA) is transcribed from protein-
ceding, or class II, genes by RNA polymerase II (pol II). Transfer RNA (tRNA), SS
rRN A and some small nuclear and cytoplasmic RNAs are transcribed by RNA polymerase
III (pol III). This multiplicity of RNA polymerases, each containing 8 to 14 polypeptides,
contrasts with the single form of RNA polymerase that is responsible for all RNA synthesis
in prokaryetes.

In view of its pivotal role in gene expression, most studies have focused on pol II.
During differentiation and development, there are many steps in the pathway leading fiom
DNA to protein, and all of them can be regulated. Modulating the synthesis of mRNA
encoding a given protein, however, is one of the most crucial mechanisms by which a cell
controls the functional levels of that protein. The mRNA transcription cycle can be divided
into at least five stages: initiation, promoter escape, elongation, termination and recycling.
Each of these stages can be subject to regulation.

This review will focus on transcription initiation and elongation by pol II and the
function of RAP74 in these stage of the transcription cycle. In contrast to bacterial RNA
polymerase, pol II cannot specifically initiate transcription in the absence of accessory
factors. These factors can be divided into three classes (Matsui et a1. 1980; Davidson et al.

3
1983; Samuels et al. 1982). The first class consists of general transcription factors

(GTFs) or basal transcription factors, which are responsible for basal level transcription
initiation and are required for almost all class II promoters (Weil et al. 1979; Manley et al.
1980). The second class consists of sequence-specific transcription factors, which bind to
specific DNA elements to regulate the rate of transcription initiation by direct or indirect
interaction with the GTFs. The third and most recently identified class consists of
cofactors, also called mediators, which include positive cofactors, negative cofactors, and
coactivators. Cofactors mediate the interaction between G'I'Fs and specific factors and/or
often can by themselves either stimulate orrepress basal transcription (Dynlacht et al. 1991;
Tanese et al. 1991; Merino et al. 1993; Auble and Hahn 1993; Ge and Roeder 1994;
Kretzschmar et al. 1994).

Specific transcriptional activators typically contain two domains, a sequence-
specific DNA-binding domain and an activation domain. Activators have been roughly
classified into groups based on the properties of their activation domains. Several different
types of activation domains have been identified and classified as acidic, glutamine-rich and
proline-rich (reviewed by Mitchell and Tjian 1989; by Tjian and Maniatis 1994). Acidic
activators, such as yeast Gal4 and herpes simplex virion protein VP16, are rich in aspartatc
and glutamate residues within their activation domains, whereas the activation domains of
SP1 and CTF are rich in glutamine and proline residues, respectively. However,
mutagenesis studies suggest that the most important amino acids for activation are not
necessarily the predominant residues, such as the acidic amino acids or the glutamines
(Cress and Triezenberg 1991; Gill et al. 1994). Rather, bulky hydrophobic residues that
are interspersed with acidic residues or glutamines appear to be crucial for activation.
Nevertheless, the structural relationships and mechanisms by which these activators
stimulate transcription still remain unclear.

Recent studies on histone-mediated transcription repression indicate that formation

of active transcription complexes on a promoter is in direct competition with the assembly

4
of the DNA into nucleosomes (Workman et al. 1990; reviewed by Paranjape et al. 1994).

Activators are new thought to enhance transcription in two ways: by relieving chromatin-
mediated repression of transcription, a process referred to as antirepression (Croston et a1.
1991), and by facilitating formation of the transcription complex, which is referred to as
true activation (Laybom'n and Kadonaga 1992).

Recent studies have revealed potential targets of activators among basal
transcription factors (see below) including TBP (Stringer et al. 1990; Ingles et al. 1991),
TFIIB (Lin and Green 1991; Roberts et al. 1993; Kim and Roeder 1994), TFIIH (Xiao et
al. 1994), TFIIF (Zhu and Prywes 1994), the CTD of pol II (Allison and Ingles 1989), and
the pol II holoenzyme (Koleske and Young 1994). TBP and TFIIB have been shown to
interact with a variety of transcriptional activators (Xiao et al. 1994; and references therein).
Coactivator TAFs in the TFIID complex are required for transcriptional activation (Pugh
and Tjian 1990). Some TAFs can also interact with activators (Goodrich et al. 1993; Hoey
et al. 1993; Gill et al. 1994).

Although initiation appears to be the major target of activators and cofactors,
regulation of elongation, and possibly other phases of the transcription cycle, may be
important (Kato et al. 1992; Yankulov et al. 1994).

Transcription Initiation By Pol II

Much attention has been given to general factors because they are the presumed
targets for regulation by specific factors. A great deal of effort has been expended
identifying and purifying transcription factors that control synthesis of mRNA by pol II, as
well as cloning genes that encode them. To transcribe a gene, at least 30 distinct
polypeptides must be assembled at the promoter. It is now possible to reconstitute
transcription in vitro with highly purified and [or cloned factors. To date, seven GTFs (II
D, IIA, IIB, IIF (RAP30fl4), IIE, III-I, and 111) have been identified and extensively
purified, and genes encoding many of these factors have been isolated.

5
Transcription initiates from promoter sequences (Weil et al. 1979; Manley et al.

1980). Promoter elements act as signals that direct transcription factors and pol II to the
initiation site. These promoter elements can be divided into two functionally distinct
classes of elements that affect transcription, the core promoter elements and variable
regulatory elements. The TATA box, typically located 30 nucleotides upstream of the
transcription start site, and the initiator (Inr), consisting of 17 nucleotides encompassing the
transcription start site, constitute the core promoter elements (Corden et al. 1980; Smale
and Baltimore 1989; Nakatani et al. 1990). Either TATA or Inr motif alone can potentially
direct transcription initiation (Myers et al. 1986; Smale et al. 1990; Nakatani et al. 1990).
When present together, they can function cooperatively (Smale and Baltimore 1989;
Nakatani et al. 1990; Conaway et al. 1990a). Proximal sequence elements, such as
CCAAT and GC elements are located within a few hundred bases of the transcription start
site (McKnight and Kingbury 1982; Myers et al. 1986; Maniatis et al. 1987). Enhancers
are regulatory elements that may be located thousands of bases away from the start site
(reviewed by Khoury and Gruss 1983). Activators that bind to enhancers can interact with
the basal transcription apparatus via DNA looping (reviewed by Ptashne 1988; by Ptashne
and Gann 1990)

Pol II and the GTFs can assemble with the core promoter into a pre-initiation
complex in an ordered, stepwise fashion (Davidson. et al. 1983; Reinberg et al. 1987;
Buratowski et a1 1989; Conaway et al. 1991a; Flores et al. 1991). As shown in Figure 1,
first T'FIID, the only GTF so far shown to contain a sequence-specific DNA-binding
activity, binds selectively to the TATA box to provide a nucleation site for subsequent
complex assembly. TFIIA stabilizes the TFIID-DNA interaction and can remain associated
or dissociate at a subsequent step in the pathway. Next, TFIIB recognizes either the
TFIID-DNA complex or the DA-DNA complex, forming either the DB or DAB complex.
Assisted by TFIIF (RAP30/7 4), RNA pol II then binds stably to the DB complex to form
the DBPolF complex. Finally, T'FIIE and TFIIH enter the pre-initiation complex, where

Figure 1. Assembly of the general transcription factors required for the

initiation of transcription by RNA polymerase II.

 

 

 

 

 

 

 

 

 

 

Pie-initiation complex

Strand separation
C'I‘Dphosphorylation (TFIIH)

 

 

 

 

8
they promote productive binding of pol II to promoter sequences near the transcription start

site. TFIIJ might finally bind and complete assembly of the pro-initiation complex.
However, the requirement, identity and function of T'FIIJ are not clearly established.

Recent evidence suggests that TFIIF (RAP30/74), as well as TFIIB, TFIIE, and
TFIII-IcanalsoassemblewithpolllintheabsenceofDNAtoreconstituteamultifunctional
pol II “holoenzyme” that may be able to bind directly to TFIID at the promoter in a single
step (Serizawa et al. 1994). Indeed, pol n holoenzyme forms containing T'FIIB, TFIIF,
TFIIH and other polypeptides have been isolated from S. cerevisiae (Koleske and Young
1994; Kim, Y.-J. et al. 1994). These holoenzymes can respond appropriately to some
activators. Whether the stepwise or holoenzyme pathways, or both, are functional within
living cells remains to be determined.

Interestingly, under some circumstances a minimal complex can initiate
transcription in the absence of TFIIB and TFIIH (Parvin and Sharp 1993; Tyree et al.
1993). Even TFIIF is dispensible for initiation from one specific promoter. Negative
supercoiling of the template DNA appears to substitute for these factors. More
surprisingly, under some circumstance, TFIID can be substituted by YYI, a zinc finger
transcription factor whose DNA-binding motif exhibits the properties of an initiator
element. At least from one promoter, YYl, TFIIB and pol II are sufficient to direct basal
transcription from a supercoiled template (U sheva and Shenk 1994). It is suggested that
YYl can function like TBP, as a factor that binds to the core promoter and recruits
polymerase to the initiation complex.

Once assembled, the pre-initiation complex is converted to a transcriptionally active
conformation in a step requiring ATP hydrolysis (Bunick et al. 1982). This energy
requirement has been termed activation of the basal initiation complex. Although the
mechanism of this activation step has not been established, evidence suggests that ATP
serves as a substrate for a helicase activity that promotes conversion of the closed pre-

initiation complex to an open complex by unwinding a short stretch of promoter DNA

9
surrounding the transcription start site (Wang et al. 1992a). TFIIH has been shown to

include such a helicase activity (Feaver et al. 1993; Serizawa et al. 1993; Schaeffer et al.
1993)

In addition, it has been suggested that ATP serves as a substrate for a protein
kinase(s) that phosphorylates the C-terminal domain (CTD) of the largest subunit of pol 11
(see below). However, since GT'P can substitute for ATP for this purpose, a requirement
for Cl'D kinase activity cannot account for the ATP requirement in initiation. It has also
been suggested that CTD phosphorylatien disrupts interactions between polymerase and
TBP facilitating the transition from the initiation to the elongation stage (Dahmus and
Kedinger 1983; Laybourn and Dahmus 1989; Usheva et al. 1992).

Similar to prokaryotic RNA polymerase, pol 11 goes through an abortive phase of
transcription in which short transcripts are synthesized and released before a stable
elongation complex is formed (Linn and Luse 1991). Which factors remain bound at the
promoter after initiation and which factors remain associated with polymerase have not
been clearly determined. When pol II commences productive elongation, some GTFs such
as TBP may dissociate from pol 11, others such as TFIIB, TFIIF, and TFIIH may remain
associated with pol II. It has been shown recently that TFIIB, TFIIH, and ATP hydrolysis
are required for promoter escape (Goodrich and Tjian 1994). The RAP74 subunit of TFIIF
may also be required for promoter escape under certain conditions (Chang et al. 1993).

Interestingly, recent evidence has indicated that ATP is not required for
T'FIIE/l'FIIH-independent transcription on supercoiled templates (Timmers 1994; Goodrich
and Tjian 1994). Using a pro-melted linear template, a template already in the open
conformation, also obviates the requirement for ATP in transcription (Tantin and Carey
1994). Superhclical tension perhaps provides the energy for a stable open complex and [or
facilitates promoter escape, obviating the ATP requirement for open complex formation and
promoter escape.

10
It appears, therefore, that at least two energy-dependent steps require 3—? bond
hydrolysis of ATP prior to effective transcription elongation. One is open complex
formation (Wang et al. 1992a), the other is promoter escape (Goodrich and Tjian 1994).
So it is possible that these are the same event (Goodrich and Tjian 1994). Indeed, partial
DNA unwinding for abortive initiation does not require ATP hydrolysis (Goodrich and
Tjian 1994).

RNA polymerase II

Yeast pol II is composed of 11 polypetides with apparent molecular weights
ranging from 220 to 10 kDa (Young 1991). The genes encoding each subunit have been
cloned and shown to be essential for wild-type growth. Human pol II consists of 10
8 subunits ranging from 240 to 10 kDa (Young 1991). The largest subunit of pol II contains
a unique C-terminal domain (CTD) composed of multiple repeats of the consensus
sequence YSPTSPS, which does not exist in pol I, pol III, or bacterial RNA polymerase.
The heptapeptide consensus sequence is repeated 26 times in yeast, 44 times in Drosophila,
and 52 times in mammals (Sawadogo and Sentenac 1990; Young 1991). The CTD can be
highly phosphorylated at serine and threonine residues in the heptapeptide. In vivo, pol II
exists in two distinct forms: a “hypo”-phosphorylated or unphosphorylated form
designated [IA and a highly phosphorylated form designated IIO (Kim and Dahmus 1989;
Cadena and Dahmus 1987). A third form, IIB, lacks most of the CID due to proteolysis
dming enzyme pmification.

Although the CID is not essential for the catalytic activity of RNA polymerase II,
deletion of most or all of the CTD causes lethality (Nonet et al. 1987; Allison et al. 1988;
Zehring et al. 1988; Bartolomei et al. 1988). Genetic and biochemical evidence suggests
that the CTD plays a role in mediating transcription activation by upstream regulators such

as Gal4 (Allison and Ingles 1989; Usheva et al. 1992).

1 1
The HA form of pol II stably associates with the pie-initiation complex, whereas the

[[0 form associates with the actively elongating complex. Conversion of HA to 110
polymerase can occur prior to formation of the first phosphodiester bond (Laybourn and
Dahmus 1990). It has been proposed that the unphosphorylated IIA form stably associates
with the promoter-bound initiation complex by direct interaction with TBP and
phosphorylation potentiates the transition from transcription initiation to elongation by
weakening this interaction. However, transcription initiation in a pmified reconstituted
system can be uncoupled from CTD phosphorylatien using a protein kinase inhibitor.
Therefore, phosphorylation of the CTD may not be an essential step in basal transcription
or factors that establish the requirement for CTD phosphorylatien are missing inin vitra
reaction (Serizawa et al. 1993).

General Transcription Factors

TFIID is the most extensively studied general initiation factor and is the only one
known to bind promoter DNA. TFIID is a multiprotein complex consisting of the TATA-
box-binding protein (TBP) and at least 8 tightly bound ceactivators termed TBP-associamd
factors (TAFs) (Pugh and Tjian 1990).

TBP is essential for accurate transcription by all three nuclear RNA polymerases
(Sharp 1992). Human TBP is 38 kDa in size. Comparison of the deduced amino acids of
TBPs from human, Drasaphila, Arabidapsir and yeast revealed that the C-terminal domain
of 180 amino acids is highly conserved and the N-terminal domain is highly divergent
across species (Zawel and Reinberg 1993).

Although the C-terminal domains of yeast and human TBP are highly conserved
and capable of substituting for each other in basal transcription in vitro, human TBP fails to
functionally. replace yeast TBP in viva (Cormack et a1. 1991; Gill and Tjian 1991).
Analysis of human-yeast hybrid TBPs indicates that the species specificity is due to
cumulative minor differences within the conserved C-terminal domain rather than to the

12
highly divergent N-terminal domain (Cormack et al. 1991; Gill and Tjian 1991).

Mutagenesis studies suggest that the conserved C-terminal domain is sufficient for binding
to the TATA box and basal transcription (Horikeshi et al. 1990, Hoey et al. 1990; Petersen
et al. 1990), whereas the divergent N-terminal domain may mediate interactions with
coactivators (Pugh and Tjian 1990; Zhou et al. 1991).

TBP binds DNA in a rather unique fashion as a protein monomer (Horikeshi et al.
1990) in the minor groove (Starr and Hawley 1991; Lee et al. 1991). TBP induces a 90°
bend in DNA (Horikeshi et al. 1992).

TAFs are important for activation of transcription yet are apparently dispensable for
basal transcription (Dynlacht et al. 1991; Tanese et al. 1991; Pugh and Tjian 1992). Genes
encoding most of the TAFs have been isolated (Dynlacht et al. 1993; Goodrich et al. 1993;
Hisatake et al. 1993; Hoey et al. 1993; Kokubo et al. 1993, 1994; Ruppcrt et al. 1993;
Weinzierl et al. 1993b; Yokomori et al. 1993a,b). Little is known about the functions of
individual TAFs. All activators that have been tested so far appear to require the TFIID
complex for activation both in vitra and in viva, suggesting that TAFs play a central role in
mediating activator functions (Pugh and Tjian 1990, Dynlacht et al. 1991; Hoey et a1. 1993;
Gill et al. 1994; Goodrich et al. 1993; Wang and Tjian 1994). It has been suggested that
difi‘ercnt classes of activators may interact directly with difl‘erent TAFs (reviewed by Tjian
and Maniatis 1994). However, individual TAFs are not necessary or stimulatory for basal
transcription and stable pro-initiation complexes are efficiently formed in the absence of
TAFs.

TFIIB is a single polypeptide of 33 kDa (Ha et al. 1991). TFIIB promotes
assemblyofpolIIwith TBPatthepromoterthroughdirectinteractionswith bothTBPand
pol II (Buratowski et al. 1989; Tschochner et al. 1992; Wampler and Kadonaga 1992).

Hampscy and coworkers proposed that TFIIB plays a role in selecting the
transcription start site, based on their genetic evidence that mutations in the S UA7 gene,

which encodes the yeast homolog of T'FIIB, cause alterations in the locations of

13
transcription start sites (Pinto et al. 1992). Since complexes including either TBP or YYl,

pol II, and TFIIB can be capable of accurate initiation, most likely pol II or TFIIB selects
the start site for transcription.

T'FIIB may also be critical to interactions between the initiation complex and
upstream activators. TFIIB association with the pro-initiation complex may be the rate-
limiting step in initiation and the synthetic acidic activator Gal4-AH has been suggested to
stimulate transcription by recruiting TFIIB to and maintaining it within the pro-initiation
complex (Lin et al. 1988, 1991).

T'FIIB has at least two basic functions in the initiation complex. It binds directly to
the T'BP-DN A complex and is required for the recruitment of RNA polymerase into the
initiation complex (Buratowski et al. 1989). Indeed, the protein has been characterized as
having two functional domains (Ha et a1, 1993; Buratowski et al. 1993). The N-terminus
contains a putative zinc finger domain that is essential for recruiting pol II, probably
mediated by interaction with the RAP30 subunit of T'FIIF. A proteolytically resistant C-
terminal domain is necessary and sufficient for interaction with the DA complex and may
also interact with pol 11. Similar to TBP, this domain has a duplicated amino acid
sequence, 76 a in length. The repeated sequence is required for TFIIB to bind to the DA
complex. Separating these two repeats is a region bearing weak similarity to bacterial
sigma factors (Ha et al. 1991).

Crude preparations of T'FIIA have been separated into two distinct activities:
TFIIA and TFIIJ (Cortes et al. 1992). TFIIJ was found to be essential for transcription
only when highly purified TFIID or recombinant TBP was used. Crude TFIID
preparations obviate the TFIIJ requirement due to contamination with T'FIIJ (Flores et al.
1992). In contrast to TFIIJ, T'FIIA could stimulate basal transcription when native TFIID
was used but had no effect when TBP was used. It is thought that TFIIA may function to
remove, through its interaction with TBP, negative components that associate with TFIID

(Cortes et al. 1992). Indeed, recent evidence has shown that activity of Dr;, a negative

14
regulator of basal transcription present in TFIID, is counteracted by TFIIA (Merino et al.

1993).

YeastTFIIAisaheterodimerof32and 13.5 kDa (Ranish andHahn1991). Human
T'FIIA is a heterotrimer consisting of 34, 19, and 14 kDa subunits (Ma et al. 1993; DeJong
and Roeder 1993). It has been shown that cloned TFIIA has no apparent role in basal
transcription but plays an important role in activation of transcription (Ma et al. 1993). The
composition and function of TFIIJ remain unknown.

TFIIE is a heterotetramcr composed of two 34- and 56-kDa subunits (Conaway et
al. 1991a; Ohkuma et al. 1990,; Inostroza et al. 1991). cDNA clones encoding each
subunit have been cloned (Petersen et a1. 1991; Sumimoto et al. 1991; Ohkuma et al.
1991). TFIIE incorporation during pro-initiation complex formation is necessary for
subsequent recruitment of TFIIH (Flores et al. 1992). T'FIIE and TFIIH stabilize each
other’s association with the pre—initiation complex (Conaway et al. 1992b). TFIIE can bind
stably to pol II in solution and can be purified as one of the RAPs fiom pol II affinity
column (Buratowski et a1. 1991; Flores et al. 1989).

How TFIIE and TFIIH promote formation of the completely assembled pre-
initiation complex is not clear. However, evidence indicated that assembly of a crude
TFIIE fraction into a pro-initiation complex extended the footprint on the promoter region
downstream to encompass the transcription start site (Buratowski et al. 1989). Recent
studies indicate that T'FIIE along with TFIIH and ATP are required for promoter escape
(Goodrich and Tjian 1994). TFIIE has also been found to negatively modulate the helicase
activity of T'FIIH through a direct interaction with the largest subunit of TFIIH (Drapkin et
al. 1994a).

TFIIH is the most complex of the GTFs and has two identified enzymatic
functions, CTD kinase and DNA helicase activities. To date, studies indicate that human
TFIIH consists of 8-10 subunits (Drapkin and Reinberg 1994c), its rat homolog 8 of 8

(Conaway and Conaway 1993), and its yeast homolog, factor b, of 5 (Feaver et al. 1993).

15
The multisubunit TFIIH complex associates with several activities: a kinase activity that is

capable of phosphorylating the CTD of pol II, a DNA-dependent ATPase and DNA
helicase activity, and finally, nucleotide excision repair of DNA (reviewed by Drapkin and
Reinberg 1994c).

Several subunits of TFIIH have been cloned in human, rat, and yeast (reviewed by
Drapkin et al. 1994b,c). The largest subunit of TFIIH, p89 in human, is identical to the
XPB/ERCC3 excision repair protein (Schaeffer et al. 1993). It contains ATP-dependent
DNA unwinding helicase activity (Feaver et al. 1993; Serizawa et al. 1993; Schaeffer et al.
1993), and is required for transcription by pol II (Qui et al. 1993; Drapkin et al. 1994a).
XPB/ERCC3 is a helicase implicated in the human DNA-repair disorders xeroderma
pigmentosum (XP) and Cockayne’s syndrome (Weeda et al. 1990). Thus, TFIIH can
directly function in both transcription and DNA repair. How transcription and DNA repair
are coupled in viva is yet unknown.

As discussed earlier TFIIH as well as TFIIE and ATP hydrolysis are required for
promoter escape (Goodrich and Tjian 1994). Recent evidence indicates that in addition to
phosphorylating the CTD, TFIIH also specifically phosphorylates three GTFs, i.e. TBP,
TFIIE-a and the RAP74 subunit of TFIIF (Ohkuma and Roeder 1994). The function of
the phophorylation is yet unclear.

RAP30/74 (TFIIF)

RAP30/74 was isolated in an attempt to identify RNA polymerase II-associated
proteins (RAPs) important for transcription by pol II. Calf thymus pol II was used as a
ligand for protein affinity chromatography and three RAPs were identified as: RAP30,
RAP74, and RAP38, the number indicating the apparent molecular weight in kDa. Each of
these are phosphoproteins. RAP30/74, also known as human TFIIF (Flores et al. 1988,
1990) and FC (Kitajima et al. 1990), rat By (Conaway et al. 1989), Drasaphila factor 5a
(Kephart et al. 1993), and S. cerevisiae factor g (Henry et al. 1992), is a heteromeric

16
general initiation and elongation factor. RAP38, also known as $11 or TFIIS (Bengal et al.

1991), is an elongation factor.

Antibody directed against RAP30 co—immunoprecipitates RAP74, indicating that
RAP30 and RAP74 are normally associated in a complex (Burton et al. 1988). Gel
filtration studies showed that the apparent molecular weight of the RAP30/7 4 complex was
220-280 kDa (Conaway and Conaway 1989; Flores et al. 1990; Kitajima et al. 1990)
suggesting a heteromuamer structure. Both subunits of RAP30/74 are required for accurate
transcription in both HeLa-cell nuclear exuact, from which RAP30/74 had been removed
by antibody against RAP30 (Burton et al. 1986, 1988), and systems reconstituted with
purified components (Flores et al. 1989). cDNAs encoding both RAP30 (Sopta et al.
1989) and RAP74 (Finkelstein et al. 1992; Ase et al. 1992) have been isolated through
reverse genetics.

A variety of evidence suggests that RAP30fl4 promotes transcription initiation by
pol 11 through a mechanism similar to that of bacterial sigma factors. Inspection of the
amino acid sequence of human RAP30 revealed that the greatest sequence homology
between RAP30 and E. cali 070 is located in region 2.1 of the 070 amino acid sequence
that is generally conserved among sigma factors (Helmann and Chamberlin 1988; Sopta et
al. 1989). This region of 070 is required for binding to E. cali core polymerase (Lesley
and Burgess 1989).

RAP30fl4 is thought to promote binding of pol II to its promoter. Like sigma
factors, RAP30/74 has been shown to bind stably to pol II in solution. Much as 670
prevents nonselective DNA binding of E. cali core polymerase to nonpromoter DNA,
RAP30/74 inhibits nonselective binding of pol II to free DNA (Conaway and Conaway
1990b; Killeen and Greenblatt 1992a). Therefore, RAP30/7 4 may promote selective
binding of pol II to the promoter at least partly by suppressing formation of nonproductive
binary complexes of pol II and DNA. How RAP30/74 controls nonselective binding of pol
II to DNA is not completely understood. It is the RAP30 subunit in RAP30/74 that has the

17
property of suppressing nonspecific DNA binding of pol II (Killeen and Greenblatt 1992a).

However, recombinant RAP30 (by itself cannot release pol II from an existing
nonproductive pol II-DNA complex, whereas partially pmified RAP30/74 can (Killeen and
Greenblatt 1992a). Therefore, it is possible that both RAP30 and RAP74 play crucial roles
in this process. Whether RAP74 itself can release pol II from the nonproductive pol II and
DNA complex is not known.

Several lines of evidence indicate that RAP30/‘74 binds to pal 11 through RAP30.
First, the yield of RAP30 in pol II affinity chromatography is higher than that of RAP74
(Sopta et al. 1985), suggesting that RAP30 binds to pol II in the absence of RAP74.
Moreover, pol II prevents phosphorylation of RAP30 by protein kinase A in the region
with homology to 670, (but has no effect on the phosphorylation of RAP74 by protein
kinase A) (McCracken and Greenblatt 1991). Finally, recombinant RAP30 binds to pol II
(Killeen and Greenblatt, 1992a), indicating that the RAP30 subunit directs binding of
RAP30fl4 to pol II. However, other studies using reconstituted in vitra transcription
(Garrett et al. 1992) and a gel mobility shift assay (Tyree et al. 1993) indicate that RAP74
participates in the interaction of RAP30fl4 with pol II , presumably either through direct
contacts with pol II or indirectly, by stabilizing either the interaction between RAP30 and
pol IIortheinteraction betweenpolIIandtemplate. Themolecularinteractionsunderlying
stable binding of RAP30n4 to pal II have not been elucidated.

AnadditionalRAP30region similartobacterialakhasbeenproposedandshown
to be required for transcription (Garrett et al. 1992). This region is in the sigma-homology
region 4, which is directly involved in recognition and binding of the -35 promoter by
bacterial core polymerase through a helix-turn-helix motif (I-Ielmann and Chamberlin
1988). Indeed, this region which resides in the C—terminus of RAP30 has been found to be
a cryptic DNA-binding domain (Tan et al. 19943).

18
Compared to RAP30, the function of RAP74 is less clear. RAP74 appears to play

roles in at least three stages of transcription, i.e. initiation, promoter escape, and
elongation. However, none of these RAP74 functions is completely understood

Though RAP30-dependent assembly of pol 11 into a pre-initiation complex at the
promoter can occur without RAP74 (Flores et al. 1991; Killeen et al. 1992b), RAP74 has
been shown recently to be required for positioning RAP30 close to the promoter within the
pro-initiation complex (Coulombe et al. 1994). RAP74 appears to be required for
initiation, at least under some circumstances, even though it may be dispensible for pre-
initiation complex formation (Burton et al. 1986; Flores et al. 1991; Tan et al. 1994b;
Chang and Burton, unpublished).

LikeT'FIIEandTFIIILwhichwere showntoberequiredinpromoterescapeby
pol II (Goodrich and Tjian 1994; Maxon et al. 1994), RAP74 has also been implicated as
being required for promoter escape under at least some conditions (Chang et al. 1993).
The requirement for RAP74 in promoter escape may be due to its function in late complex
assembly, since binding of RAP30/74 to pol II enhances binding of a helicase that may be
' TFIIH (Sopta et al. 1989; Schaeffer et al. 1993).

In addition to being essential for initiation and promoter escape, RAP30fl4 also
stimulates transcription elongation. Both T'FIIF (RAP30fl4) and TFIIS have been
indicated to enhance transcriptional elongation in vitra (Reinberg and Roeder 1987 ; Flores
et al. 1989; Reines et al. 1989; Bengal et al. 1991; Izban and Luse 1992). However, TFIIS
suppresses intrinsic pausing and helps pol II to elongate beyond pausing sites, whereas
TFIIF only suppresses pausing and increases elongation rate (Bengal et al. 1991).

Tat protein, the trans-activator of human immunodeficiency viruses HIV-1 and
HIV -2, not only stimulates transcription initiation but also, in combination with cellular
factors, facilitates efficient elongation (Cullen, 1990). Kato et al. (1992) observed that
TFIIF increased the basal level of elongation but not Tat-activated stimulation. In addition,
antiserum against the RAP74 subunit of TFIIF preferentially suppressed the activated level

19
of transcription exerted by Tat. The authors reasoned that Tat rmy have a subsidiary action

on T'FIIF through an interaction between Tat and the RAP74 subunit of TFIIF, or that Tat
may somehow mimic RAP74’s function.

Recently, Meier et al. (1994) have reporwd that Tat enhances the effect of TFIIF on
transcription elongation and suggested that stimulation of transcription elongation by Tat
occurs at least partly by recruitment of TFIIF to the elongating transcription complex. Tat is
incapable of substituting for either of the TFIIF subunits. Whether there is direct protein-
protein interaction between Tat and TFIIF is not known.

Pol II has been shown to be associated with a 3’=>5’ exonuclease activity (Wang
and Hawley 1993; reviewed by Reins 1994) that removes from single nucleotide,
dinucleotides to larger (7- to 14-) oligonuceotides from the 3’ end of the transcripts in
isolated ternary complexes. This activity is stimulated by elongation factor TFIIS, whereas
its competing pyrophosphorolysis reaction is stimulated by TFIIF (Wang and Hawley
1993). This reversal of the polymerization reaction may be important for polymerase to
elongate past pause sites or may be a mechanism for transcription proofreading.

Recently, Zhu et al. (1994) found that TFIIF plays an important role in serum
response factor (SRF) -activamd transcription in vitro. A low amount of T'FIIF was
sufficient for basal transcription, whereas higher amounts were specifically required for
SRF, as well as GAL4-VP16 activation. They also found that T'FIIF could relieve ‘
squelching by SRF in vitro, suggesting that SRF may directly bind TFIIF. Moreover, they
found that the RAP74 subunit of T'FIIF bound DNA in conjunction with SRF or GAL4—
VP16, but not alone. Neither SP1 nor the DNA binding domain of GAL4 enhanced
RAP74 binding to DNA. Therefore, they suggest that the mechanism of transcription
activation by SRF, and possibly some other activators as well, involves protein-protein

interaction with TFIIF.

20
In summary, RAP74 appears to function in initiation, promoter escape, elongation,

and interaction with transcriptional activators. However, the mechanisms and the
molecular basis of these functions are not yet clear.

Inspection of the RAP74 deduced amino acid sequence suggests that it can be
divided into a globular N-terminal domain (amino acids 1 to 179), a charged central domain
(residues 180 to 356), and a globular C-terminal domain (residues 357 to 517). RAP74 is
a highly charged protein which contains 38% charged amino acids (K+R+D+E). The
charge is concentrated in the central domain, which contains large clusters of DE residues
(35%) interspersed with small clusters of K+R residues (20%). The calculated molecular
mass of RAP74 based on its cDNA is 58.2 kDa, presumably the highly charged acidic
central domain causes the RAP74 molecule to bind less SDS and to migrate more slowly
than expected in SDS-PAGE. In addition to RAP74, some other transcription factors such
as TFIIAa and TFIIEa also carry multiple charge clusters and hyper charge runs, sequence
features occurring in < 4% of all eukaryotic proteins (Karlin 1994), implicating the
biological importance of these sequences.

There are no proteins highly homologous to RAP74 in a recent search of available
databases. However, encompassing the ending of the central domain and the beginning of
the C-terminal domain of RAP74 is a repeat sequence of unknown function. This repeat
contains the sequence DSSEES, which is repeated 3 times in the RAP74 sequence. It
might serve as a target for kinase(s) (Karlin 1994). Repeat sequences have also been
contained in other GTFs such as T'BP and TFIIB and have been shown to be important for
function (reviewed by Zawel and Reinberg 1993). The specific function of these RAP74
sequences is unlmown.

Recently, in addition to human, RAP74 homologs have been cloned from X enapus
(Gong et al. 1992), Drasaphila (factor 5a) (Kephart et al. 1993), and S. cerevisiae
(SSU71) (Sun and Hampscy, submitted). The deduced amino acid sequence of X enapus
RAP74 shows 76% identity and 86% similarity to the human sequence (Gong et al. 1993).

21
The deduced amino sequence of Drosophila factor 5a shows 43% identity and 65%

similarity to the human sequence (Kephart et al. 1993). Like their human counterpart, the
overall structure of Xenopus RAP74 and Drosophila factor 5a apparently consist of three
domains based on both conservation and continuity of amino acid sequence in comparison
to human RAP74. A sequence alignment among human, Xenopus, and Drosophila RAP74
is shown in Figure 2. The N-terminal domain is the most conserved (51% identity between
human and Drosophila). The C-terminal domain is also highly conserved (49% identity
between human and Drosophila). The highly charged central domain is less conserved
(28% identity between human and Drosophila). Interestingly, this domain contains a
sequence (aa 246 to 265 in human) that is highly conserved (80% identity among human,
Xenopus and Drosophila), suggesting its functional importance (See Chapter V).

Recently cloned S. cerevisiae RAP74 homolog, SS U 71 ITFGI , shows a more
distant relation with human RAP74 in both the length and the composition of its deduced
amino acid sequence. Ssu71p is 735 a long and has 21% identity and 45% similarity to
human RAP74 by bestfit sequence analysis. Moreover, S. cerevisiae TFIIF homolog,
factor g, is composed of three subunits instead of two (Henry et al. 1992), indicating more
divergence from other TFIIF counterparts identified to date. According to hydrophobic
cluster analysis (Lemesle-Varloot et al. 1990), there are two regions, approximately a 345-
395 and aa 668-694 in the C-terminal half of Ssu71p that form a similar hydrophobic
cluster pattern to human RAP74 in the regions a 95-146 and aa 458.484, respectively.
Based on hydrophobic cluster analysis and bestfit analysis, the hydrophobic amino acid
cluster pattern and sequences in these two regions are also highly conserved with Xenopus,
and Drosophila RAP74, suggesting their structural and functional importance (See Chapter
IV).

SSU 71 was isolated through its genetic interaction with yeast TFIIB homolog,
S UA7 (Sun and Hampscy, submitted). Mutations in Ssu71p suppress both a cold-
sensitive growth phenotype and the altered initiation pattern conferred by a TFIIB defect.

22

Figure 2. Alignment of the primary structures of RAP74 from human (h),
XenOpus laevis (x), and Drosophila (d). Gaps, indicated by dots, are introduced
to give better alignment. The numbers, not including gaps, correspond to the sequence of
human RAP74. Amino acids conserved among all three species are boldfaced. Amino
acids conserved between two species are underlined. Conserved amino acids are grouped

as followsz (I. L. M. V). (H. K. R). (D. E. N. Q). (A. G). (F. Y. W). (S. 1) (Icsley and
Burgess 1989).

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

hrap74
xrap74
drap74

23

1

........................... MAA,LGPS§QNYII YYVRVPKHII

.......... .......... .......MAS,LGISGQSVIE YYVRVPRNES
MSSASKSTPS AASGSSTSAR.AAAAASVAS§,SASSSANVOE FKIRVPKMR.

mm mm MN Ram.mu PfiGAGSElN
msmam anrsvnrsm W mama PEIiGAGSIYN
mam TLanrAQwa NVXLERGNNM rtaracmno rxrcacsm

RKLRIEAERK KYGIVLKEIR.EIDQPHLLRV'NGKSGRKFKG IKKGGVTENT
339333883! KYGIILREIK VDDQPUILRV’NGKAGRKYRG‘VKKGGVTENA
RDQRIIABRR RIGIIARKYR.£IAQPHILKV GGKIGKKFRG IREGGVGZNA

SIYIFIQQRD GAEIAIPVHN IYNIIILARH RILEAIEAII BIEBRNRVLN
SXPIIIQQAD GAEIAIPVBN’UYNIIPVBKE RILEAIEAEQ IIERRNKVBN
AIYVFTHARD GAIIAXPLII 'YNTQPIQRX RSLSAEEAEQ EFGRRKKVIN

HISIMQQRRL XDQDQDEDIE,IK ..... ERR G....BBKA§,ELRIHDLIDD
HITINDQRRL KDQVGDIDID,IEGGGKLEK§_GKGKKKIRKS DLKIBDLIDD
YFSLMLRKRL RGDEEIEQDP IE,.AKLIKA.AI....KKSK ILKITDMDIW

LIMSSDASDA SGEEGGBVP. ..... KAKKK AELAKGGBKK KKKKGSDDIA
LILSSIESIN SDIIGESBK, ..... KPQKK V255336KKK.KRK..§DDIA
ID.SEDESDS EDKEDKKKKE QEDSDDGKAR GKGKKGADKK KKKBDVDDIA

GQBVDYMSDG 3885933235 KAKAPQQEEG ... .......

GQIVD!M§DE,888DIILP.G KIKPAKIEEG ..........
GRENDY...D,TSS§IDE£QP EEKVDKDMKG VAEEDALRKL

EIDSDDGDFE
LIDSDDGDII
EIISDDGDEE

. .mnga assuage}; 295213552125 mm m ..... rt.
. .285th5. 3583383an ABEL @613. mm m ----- 3K
Lrsnaannna KKsnasnxlD mmx excavsxnxx mprxnnrtx

. 235335.083
512351225393
masseuse

EISDIDSBAB EAEE...MAK.XKIREK.... .RIRK.PSGG

EDSDEDG.AS SSLE...MQK 331223.... .KDKKGGSNS
TDFSSDfiIDS EDDLSNGPPR‘RKVVVKDKDK EMEHEKEQAA

888 .......
838 .......
SSKVIASSSN

mmrgz gsnsgxsrzg ”35mins: gnmv'r'zmv RRYLIRKBE
W QNTSQKSTBQ P08588128: 50191-va MIKE!!!
mam: ........ s'r'SL pransccxv enrcrrmv 211nm:

.msrrzc'rps EGGSTSSIL awn-ace KB. .SLEEMBA
.msaac'rps PMGNTSSII- WEI-39.5 £36m
ANKsrtsnn' LSIDASKRKII NSLPSDL'I‘Afi DTSNSPTfiTP

ram-mum MEI-33391 Wm mmmn ”111251-33
mm “T533391 Wm WM m
.ATILLTKIKN KIIPVBSDRL VITITKILKK INPVKBTIQGINIYLKIK.

Km 2

23

72

122

172

213

257

297

339

379

419

469

517

24
These phenomena suggest that Ssu71p (RAP74 for human) can interact with Sua7p (TFIIB

for human) directly or indirectly. Indeed, human TFIIB has been shown to interact directly
with RAP30 (Ha et al. 1993).

RAP74 and RAP30 can stably associate in solution. Their interaction is likely
hydrophobic since it is stable in high salt solution (Chapter III). Recent mutational studies
indicate that the N -terminal regions of both RAP30 and RAP74 are responsible for their
interactionandareessential fortranscriptionalactivity (Yonahaetal. 1993; Chapter IV).

Both RAP30 and RAP74 are phosphorylated and RAP74 is extensively
phosphorylated in viva (Sopta et a1. 1989). RAP74 can also be phophorylated in vitro by
casein kinase II, protein kinase A (Dahmus, unpublished) and TFIIH (Ohkuma and Roeder
1994). Neither the precise sites nor the role of the phosphorylation of RAP74 is known.

Using fluorescence in situ hybridization with the RAP74 genomic cosmid clone as
the probe, human RAP74 gene has been mapped to chromosome 19pl3.3 (Aso et a1.
1993).

OVERVIEW

To elucidate the process of transcription initiation by RNA polymerase II and the
function of each individual transcription factor, it is crucial to conduct research using
reconstituted basal transcription with purified, cloned factors. Significant efi'ort has been
expended to prnify individual general transcription factors and to isolate genes that encode
them (reviewed by Zawel and Reinberg 1993). After the cDNA encoding human RAP74
was cloned in our laboratory (Finkelstein et al. 1992), the expression and purification of
recombinant RAP74 posed some difficulties, and the lack of pure and active material
hampered functional studies. In Chapters II and III, I describe the production of human
RAP74 in bacterial cells. Production of RAP74 was problermtic, because a mixture offull
length RAP74 and RAP74 fragments was produced in E. coli. The expression level of full
length RAP74 was very low, and the RAP74 fragments bound tightly to full length protein.
Most RAP74 fragments were shortened by deletion of the C-terminus and probably
resulted from premature translation termination. Among the strategies explored for
ptnificafim,RAP74waspmifiedmostswcessfunybyauachmgashonpdymsddimmgm
the C-terminus of the protein to allow purification of full length RAP74 using a nickel-
chelate afiinity resin. Full length RAP74 carrying this polyhistidine tag was purified in a
single step by nickel affinity chromatography in 4 M urea. The yield of RAP74 was
approximately 3 mg from a 1-liter culture of cells. This work was published in PROTEIN
EXPRESSION AND PURIFICATION 4, 207-214 (1993).

In Chapter III, I describe the importance of cation usage for production of human
RAP74 and furthermore, the reconstitution and characterization of the RAP30fl4 complex.
Expression of human genes in bacteria may be complicated by protein instability or

inefficient mRNA translation. The difficulties associated with expression of RAP74 in E.

26
0011' were primarily attributed to codons found in the human gene that are rarely used in E.

coli. AGG and AGA arginine codons, which are common in eukaryotic genes but almost
never present in E. coli genes, cause inefficient translation (Zhang et a1. 1991; Brinkmann
et al. 1989; Chen and Inouye 1990; Spanjaard et al. 1990; Rosenberg et al. 1993). Tandem
repeats of AGG and AGA codons have been shown to result in translational frameshifting
and other translation errors (Brinkmann et a1. 1989; Chen and Inouye 1990, Spanjaard et
al. 1990; Rosenberg et al. 1993). In many cases, recoding of genes has improved
production. Strategies have been developed for synthesizing long nucleotides using the
polymerase chain reaction (PCR), so recoding of entire genes has become feasible (Abate et
a1. 1990; Dillon et a1. 1990, Ciccarelli et al. 1991; Jayaraman et a1. 1991; Sandhu et al.
1992). To improve production, a 125 amino acid segment of RAP74 that contains many
rare E. coli codons including four AGG and one AGA codon was recoded with an E. coli
preferred set of codons (Zhang et al 1991). Recoding improved protein production lO-fold
and suppressed production of N-terminal fragments.

Using purified recombinant proteins, I reconstituted the native RAP30/74 complex
in vitro. Gel filtration chromatography followed by SDS-PAGE densitometry analysis
indicates that recombinant RAP30fl4 complex exists as a heterotetramer, the same as
human RAP30/'74. This reconstituted complex has indistinguishable activity from human
RAP30/74 for accurate transcription in vitro. Since large amounts of purified functional
RAP30/74 are now available, X-ray crystallographic studies of RAP30/7 4 have been
initiated in collaboration with Peter Kosa in Dr. Paul Sigler’s lab at Yale University. The
work described in this chapter was published in PROTEIN EXPRESSION AND
PURIFICATION 5, 476-485 (1994).

In Chapter IV, I describe work to map functional domains of RAP74. I constructed
a comprehensive series of deletion mutants with H5-histidine tags attached at the C-termini.
These RAP74 mutants were purified on a nickel-chelate affinity column. I then developed
an assay to test these mutants for RAP30 binding activity by immobilizing histidine-tagged

27
RAP74 mutants on nickel-chelate resin and examining the ability of this afiinity matrix to

retain RAP30. The results demonstrated that the first 172 amino acids in the most highly
conserved N-terminal domain of RAP74 are sufficient for RAP30 binding. Using an
extract derived from human Hela cells from which RAP30/74 was depleted by
immunoprecipitation with anti-RAP30 and anti-RAP74 antibodies, I demonstrated that
amino acids 1 to 205 of the N-terminal region are required for RAP74’s ability to stimulate
transcription. The segment of the protein that is required for accurate transcription,
therefore, is only slightly larger than RAP30 binding domain. Using the RAP74 mutants
and the nickel binding assay, I found, to cm surprise, that the C-terminal region (amino
acids 363 to 444) can bind strongly to RNA polymerase 11, whereas the full length RAP74
binds only with moderate affinity, suggesting that this pol II binding region is masked by
N-terminal or/and central RAP74 sequences. The work described in this chapter is in
preparation for submission to the Jorn'nal of Biological Chemistry.

In Chapter V, firstly, I describe work done in collaboration with Dan Kephart in
Dr. David Price’s lab at University of Iowa. In this work, I demonstrated that human
RAP74 and its Drosophila counterpart factor 5a can functionally replace each other in
transcription, indicating their structure and function are highly conserved. This work was
published in J. Biol. Chem. 269, 13536-13543. (1994). Secondly, I describe the work in
which I mapped the region of RAP74 phosphorylated by casein kinase II (CKII) to the
central region of amino acids 205 to 296 using RAP74 deletion mutants. The precise sites
of phosphorylation are currently being determined by mass spectrometry in collaboration
with Paochi Liao and Dr. Doug Gage at Michigan State University (Liao et al. 1994). I
frn'ther discuss the possible directions of the work on phosphorylation of RAP74. Thirdly,
I discuss the crn'rent work in collaboration with Ross Chambers in Dr. Michael Dahmus’
lab at University of California, Davis. In this work, RAP74 deletion mutants were used to
test their ability to stimulate a CI'D phosphatase thought to be important for polymerase

28
recycling. Finally, I discuss potential uses of the comprehensive RAP74 deletion mutants

and possible directions for future study.

29
REFERENCES

Abate, C., Luk, D., Gentz, R., Rauscher, F.J. III and Curran, T. (1990). Proc. Natl.
Acad. Sci. USA 87, 1032—1036.

Allison, L. A., Wong, J. K., Fitzpatrick, V. D., Moyle, M. and Ingles, C. J. (1988).
Mol. Cell. Biol. 8, 321-329.

Allison, L. A. and Ingles, C. J. (1989). Proc. Natl. Acad. Sci. USA 86, 2794—2798.

Aso, T., Vasavada, H. A., Kawaguchi, T., Germino, F. J., Gangelly, S., Kitajima, S.,
Weissman, S. M. and Yasukochi, Y. (1992). Nature 355, 461-464.

Aso, T., Tsai, P., Kawaguchi, T., Menninger, J. C., Kitajima, S., Yasukochi, Y., Ward,
D. C. and Weissman, S. M. (1993). Genomics 16, 252-253.

Auble, D. T. and Hahn, s. (1993). Genes Dev: 7, 844-856.

Bartolomei, M. S., Halden, N. F., Cullen, C. R. and Corden, J. L. (1988). Mol. Cell.
Biol. 8, 330-339.

Bengal, 8., Flores, 0., Krauskopf, A., Reinberg, D. and Aloni, Y. (1991). Mol. Cell.
Biol. 11, 1195-1206.

Brinlanann, U., Mattes, RE. and Buckel, P. (1989). Gene 85, 109-114.
Bunick, D., Zandomeni, R., Ackerman, S. and Weinmann, R. (1982). Cell 29, 877-886.
Burton, Z. P., Ortolan, L. G. and Greenblatt, J. (1986). EMBO J. 5, 2923-2930.

Burton, 2. P., Killeen, M., Sopta, M., Ortolan, L. G. and Greenblatt, J. (1988). Mol.
Cell. Biol. 8, 1602-1613.

Buratowski, S., Hahn, S., Guarente, L. and Sharp, P. A. (1989). Cell 56, 549-561.

Brn'atowski, S., Sopta, M., Greenblatt, J. and Sharp, RA. (1991). Proc. Natl. Acad. Sci.
USA 88, 7509-7513.

Buratowski, s. and Zhou, H. (1993). Proc. Natl. Acad. Sci. 90, 5633-5637.
Buratowski, s. (1994). Cell 77, 1-3.

Cadena, D. L. and Dahmus, M. E. (1987). J. Biol. Chem. 262, 12468-12474.

Chang, 0., Kostrub, c. F. and Burton, 2. F. (1993). J. Biol. Chem. 268, 20482-20489.
Chen, G.-F. T. and Inouye, M. (1990). Nucleic Acids Res. 18, 1465-1473.

Ciccarelli, R.B., Gunyuzlu, P., Huang, J., Scott, C. and Cakes, RT. (1991). Nucleic
Acids Res. 19, 6007-6013.

Conaway, J .W. and Conaway, R. C. (1989). J. Biol. Chem. 264, 2357-2362.

30

Coggway, J. W., Travis, E. and Conaway, R. C. (1990a). J. Biol. Chem. 265, 7564-
75 .

Conaway, J. W. and Conaway, R. C. (1990b). Science 248, 1550-1553.

Conaway, J. W., Hanley, J. P., Garrett, K. P. Conaway, R. C. (1991a). J. Biol. Chem.
266, 7804-7811.

Conaway, R. C. Garrett,K. P, Hanley,J. P. and Conaway,J. W. (1991b). Proc. Natl.
Acad. Sci. USA 8,8 6205-6209.

Conaway, J. W., Bradsher, J. N. and Conaway, R. C. (1992a). J. Biol. Chem. 267,
8464-8467.

Conaway, J. W., Bradsher, J. N. and Conaway, R. C. (1992b). J. Biol. Chem. 267,
10142-10148.

Conaway, R. C. and Conaway, J. W. (1993). Annu. Rev. Biochem. 62, 161-190.

Corden, J ., Wasylyk, B., Buchwalder, A., Sassone-Corsi, P., Kedinger, C. and
Chambon, P. (1980). Science 209, 1405-1414.

Cormack, B. P., Str'ubin, M., Ponticelli, A. S. and Str'uhl, K. (1991). Cell 65, 341-348.
Cortes, P., Flores, O. and Reinberg, D. (1992). Mol. Cell. Biol. 12, 413-421.
Coulombe, B., Li, J. and Greenblatt, J. (1994). J. Biol. Chem. 269, 19962-19967.
Cress, W. D. and Triezenberg, S. J. (1991). Science 251, 87-90.

Croston, G. B., Kerrigan, L. A., Lira, L. M., Marshak, D. R. and Kadonaga, J. T.
(1991). Science 251, 643-649.

Cullen, B. R. (1990). Cell 63, 655-657.
Dahmus, M. E. and Kedinger, C. (1983). J. Biol. Chem. 258, 2303-2307.

Davidson, B. L., Egly, J. -M., Mulvihill, E. R. and Chambon, P. (1983). Nature 301,
680-686.

DeJong, J. and Roeder, R. G. (1993). Genes Dev. 7, 2220-2234.
Dillon, RI. and Rosen, CA. (1990). BioTechniques 9, 298-299.

Drapkin, R., Reardon, J., Ansari, A., Huang, J.-C., Zawel, L., Ahn, K., Sancar, A. and
Reinberg, D. (1994a). Nature 368, 769-772.

Drapkin, R., Sancar, A. and Reinberg, D. (1994b). Cell 77, 9-12.
Drapkin, R. and Reinberg, D. (1994c). Nature 369, 523-524.
Dynlacht, B. D., Hoey, T., and Tjian, R. (1991). Cell 66, 563-576.

31
Dynlacht, B. D., Weinzierl, R., Admon, A. and Tjian, R. (1993). Nature 363, 176-179.

Feaver, W. J., Svejstrup, J. Q., Bardwell, L., Bardwell, J., Buratowski, S., Gulyas, K.
D., Donahue, T. P., Friedberg, E. C. and Kornberg, R. D. (1993). Cell 75, 1379-1387.

Finkelstein A., Kostrub, C. P., Li, J., Chavez, D., Wang, B. Q., Fang, S. M.,
Greenblatt, J. and Bln'ton, Z. F. (1992). Nature 355, 464-467.

Flores, 0., Maldonado, E. Burton, Z.F., Greenblatt, J. and Reinberg. D. (1988). J. Biol.
Chem. 263, 10812-10816.

Flores, 0., Maldonado, E. and Reinberg, D. (1989). J. Biol. Chem. 264, 8913-8921.
Flores, 0., Ha, I., and Reinberg, D. (1990). J. Biol. Chem. 265, 5629-5634

Flores, 0., Lu, H., Killeen, M. T., Greenblatt, J., Bln'ton, 2. F. and Reinberg, D. (1991)
Proc. Natl. Acad. Sci. USA 88, 9999-10003.

Flores, 0., Lu, H. and Reinberg, D. (1992). J. Biol. Chem. 267, 2786- .

Garrett, K. P., Serizawa, H., Hanley, J. P., Bradsher, J. N., Tsuboi, A., Arai N.,
Yokota, T., Arai, K., Conaway, R. C. and Conaway, J. W. (1992). J. Biol. Chem. 267,
23942-23949.

Ge, H. and Roeder, R. G. (1994). Cell 78, 513-523.

Gill, G. and Tjian, R. (1991). Cell 65, 333-340.

Gill, G., Pascal, B., Tseng, Z. and Tjian, R. (1994). Proc. Natl. Acad. Sci. USA 91,
192-196.

Gong, D. W., I-Iasegawa, S., Wada, K., Roeder, R. G., Nakatani, Y. and Horikoshi, M.
(1992). Nucleic Acids Res. 20, 6736.

Goodrich, J. A., Hoey, T., Thut, A., Admon, A. and Tjian, R. (1993). Cell 75, 519-530.
Goodrich, J. A. and Tjian, R. (1994). Cell 77, 145-156.

Greenblatt, J. (1991). Trends Biochem. Sci. 16, 408-411.

Gribskov, M. and Btn'gess, R. R. (1986). Nucleic Acids Res.14, 6745-6763.

Ha, 1., Lane, W. S. and Reinberg, D. (1991). Nature 352, 689-695.

Ha, L, Roberts, 8., Maldonado, B., Sun, X., Kim, L. U., Green, M. and Reinberg, D.
(1993). Genes Dev. 7, 1021-1032.

Helmann, J. D. and Chamberlin, M. J. (1988). Annu. Rev. Biochem. 57, 839-872.

Henry, N. L., Sayre, M. H. and Kornberg, R. D. (1992). J. Biol. Chem 267, 23388-
23392.

Hisatake, K., Hasekawa, S., Takada, R., Nakatani, Y., Horikoshi, M. and Roeder, R. G.
(1993). Nature 362, 179-181.

32

Hoey, T., Weinzierl, R. O. J., Gill, G., Chen, J., Dynlacht, B. D. and Tjian, R. (1993).
Cell 72, 247-260.

Horikoshi, M., Wang, C. K., Fuji, H., Cromlish, J. A., Weil, P. A. and Roeder, R. G.
(1989). Nature 341, 299-303.

glorikosili, {8718’ Yamamoto, T., Ohkuma, Y., Weil, RA. and Roeder, R. G. (1990). Cell,
1, 117 -1 . '

Horikoshi, M., Bertuccioli, C., Takada, R., Wang, J., Yamamoto, T. and Roeder, R. G.
(1992). Proc. Natl. Acad. Sci. USA 89, 1060-1064.

Ingles, C. J., Shales, M., Cress, W. D., Triezenberg, S. J. and Greenblatt, J. (1991).
Nature 351, 588-590.

Inostroza, J., Flores, O. and Reinberg, D. (1991). J. Biol. Chem. 266, 9304-9308.
Izban, MG. and Luse, D. S. (1992). J. Biol. Chem. 267, 13647-13655.
Jaehning, J. A. (1991). Science, 253, 859.

Jayaraman, K., Fingar, S.A., Shah, J. and Fyles, J. (1991). Proc. Natl. Acad. Sci. USA
88, 4084-4088.

Karlin, S. (1993). Proc. Natl. Acad. Sci. 90, 5593-5597

Kato, H., Sumimoto, H., Pognonec, P., Chen, C., Rosen, C. A. and Roeder, R. G.
(1992). Genes Dev. 6: 655-666.

Kephart, D. D., Price, M. P., Burton, Z.F., Finkelstein, A., Greenblatt, J. and Price, D.
H. (1993). Nucleic Acids Res. 21, 1319.

Kephart, D. D., Wang, B. Q., Burton, 2. F. and Price, D. H. (1994). J. Biol. Chem.
269, 13536-13543.

Khoury, G. and Gruss, P. (1983). Cell 33, 313-314.

Killeen, M. and Greenblatt, J. (1992a). Molec. Cell. Biol. 12, 30-37.

Killeen, M., Coulombe, B. and Greenblatt, J. (1992b). J. Biol. Chem. 267, 9463-9466.
Kim, T. K. and Roeder, R. G. (1994). Proc. Natl. Acad. Sci. USA 91, 4170-4174.
Kim, W. Y. and Dahmus, M. E. (1989). J. Biol. Chem. 264, 3169-3176.

Kim Y.8-J., Bjorklund, S., Li, Y., Sayre, M. H. and Kornberg, R. D. (1994). Cell 77,
599-60 .

Kitajima, S., Tanaka, Y., Kawaguchi, T., Nagaoka, T., Weissman, S. and Yasukochi, Y.
(1990). Nucleic Acids Res. 18, 4843-4849.

Kokubo, T., Gong, D.-W., Yamashita, S., Horikoshi, M., Roeder, R. G. and Nakatani,
Y. (1993). Genes Dev. 7, 1033-1046.

33

Kokubo, T., Gong, D.-W., Wootton, J. C., Horikoshi, M., Roeder, R. G. and Nakatani,
Y. (1994). Nature 367, 484-487.

Koleske, A. J., and Young, R. A. (1994). Nature 368, 466-469.

Kretzschmar, M., Kaise, K., Lottspeich, F. and Meisteremst, M. (1994). Cell 78, 525-
534.

Laybourn, P. J. and Dahmus, M. E. (1989). J. Biol. Chem. 264, 6693-6698.
Laybourn, P. J. and Dahmus, M. E. (1990). J. Biol. Chem. 265, 13165-13173.
Laybourn, P. J. and Kadonaga, J. T. (1992). Science 257, 1682-1685.

Lee, D. K., Horikoshi, M. and Roeder, R. G. (1991). Cell 67, 1241-1250.

Lemesle-Varloot, L., Henrissat, B., Gaboriaud. C., Bissery, V., Morgat, A. and Mornon,
J. P. (1990). Biochimie 72, 555-574.

Lesley, S. and Burgess, R. R. (1989). Biochemistry 28, 7728-7734.

Liao, P.-C., Leykam, J., Andrew, P. C., Gage, D. A. and Allison, J. (1994). Analytical
Biochem. 219, 9-20.

Lin, Y. 8., Carey, M. F., Ptashne, M. and Green, M. R. (1988). Cell 54, 659- .
Lin, Y. S. and Green, M. R. (1991). Cell 64, 971-981.
Linn, S. C. and use, D. S. (1991). Mol. Cell. Biol. 11, 1508-1522.

Ma, D., Watanabe, H., Mermelstein., Admon, A., Oguri, K., Sun, X., Wada, T., Imai,
T., Shiroya, T., Reinberg, D. and Handa, H. (1993). Genes Dev. 7, 2246-2257.

Maniatis, T., Goodbourn, S. and Fischer, J. A. (1987). Science 236, 1237-1244.

Manley, J. L., Fire, A., Cano, A., Sharp, P. A. and Gefter, M. (1980). Proc. Natl. Acad.
Sci. 77, 3855-3859.

Matsui, T., Segall, J., Weil, A. P. and Roeder, R. G. (1980). J. Biol. Chem. 255,
11992-11996.

Maxon, M. F... Goodrich, J. A. and Tjian, R. (1994). Genes Dev. 8, 515-524.
McCracken, S. and Greenblatt, J. (1991). Science 253, 900-902.
McKnight, S. L. and Kingbury, R. (1982). Science 217, 616-624.

Meier, T. I., Keene, R. G., DeVit, M. J., Wang, D. and Landick, R. (1994). J. Cell.
Biochem. Supplement 18C, Wiley-Liss, Inc., New York. pp 63.

Merino, A., Madden, K. R., Lane, W. S., Champoux, J. J. and Reinberg, D. (1993).
Nature 365, 227-232.

34
Mitchell, P. J. and Tjian, R. (1989). Science 245, 371-378.

Myers, R. M., Tilly, K. and Maniatis, T. (1986). Science 232, 613-618.

Nakatani, Y., Horikoshi, M., Brenner, M., Yamamoto, T., Besnard, F., Roeder, R. G.
and Freese, E. (1990). Nature 348, 86-88.

Nonet, M., Sweetser, D. and Young, R. A. (1987). Cell 50, 909-915.

Ohkuma, Y., Sumimoto, H., Horikoshi, M. and Roeder, R. G. (1990). Proc. Natl. Acad.
Sci. USA 87, 9163-9167.

Ohkuma, Y. and Roeder R. G. (1994). Nature 368, 160-163.

Paranjape, S. M., Kamakaka, R. T. and Kadonaga, J. T. (1994). Annu. Rev. Biochem.
63, 265-297.

Parvin, J. D. and Sharp, P. A. (1993). Cell 73, 533-540.

Payng, J. M., Laybourn, P. J. and Dahmus, M. E. (1989). J. Biol. Chem. 264, 19621-
1962 .

Peterson, M. G., Inostroza, J., Maxon, M. B., Flores, 0., Admon, A., Reinberg, D. and
Tjian, R. (1991). Name 354, 369-373.

Pinto, 1., Ware, D. E. and Hampsey, M. (1992). Cell 68, 977-988.

Ptashne, M. (1988). Nature 335, 683-689.

Ptashne, M. and A. A. F. Gann. (1990). Nature 346, 329-331.

Pugh, B. F. and Tjian, R. (1990). Cell 61, 1187-1197.

Pugh, B. F. and Tjian, R. (1992). J. Biol. Chem. 267, 679-682.

Qiu, H., Park, B., Prakash, L. and Prakash, S. (1993). Genes Dev. 7, 2161-2171.
Ranish, J. A. and Hahn, S. (1991). J. Biol. Chem. 266, 19320-19327.

Reinberg, D., Horikoshi, M. and Roeder, R. G. (1987). J. Biol. Chem. 262, 3322-3330.
Reinberg, D. and Roeder, R. G. (1987). J. Biol. Chem. 262, 3331-3337.

Reines, D., Camberlin, M. J. and Kane, C. M. (1989). J. Biol. Chem. 264, 10799-
10809.

Reins, D. (1994). Transcription: Mechanisms and Regulation. edited by R. C. Conaway
and J. W. Conaway. Raven Press, Ltd., New York. pp 263-278. '

Roberts, S. 6., Ha, 1., Maldonado, B., Reinberg, D. and Green, M. R. (1993). Nature
363, 741-744.

Rosenberg, A.H., Goldman, B., Dunn, J.J., Studier, F.W. and Zubay, G. (1993). J.
Bacteriol. 175, 716-722.

35

Rum S., Wang, E. D. and Tjian, R. (1993). Nature 362, 175-179.

Samuels, M. A., Fire, A. and Sharp, P. A. (1982). J. Biol. Chem. 257, 14419-14427.
Sandhu, G.S., Aleff, RA. and Kline, B.C. (1992). BioTechniques 12, 14—16.
Sawadogo, M. and Sentenac, A. (1990). Annu. Rev. Biochem. 56, 711-754.

Serizawa, H., Conaway, J. W. and Conaway, R. C. (1993). Nature 363, 371-374.
Serizawa, H., Conaway, J. W. and Conaway, R. C. (1994). In: Transcription:
Mechanisms and Regulation. edited by R. C. Conaway and J. W. Conaway. (Raven
Press, Ltd., New York). PP 27-43.

Schaeffer, L., Roy, R., Humbert, S., Moncollin, V., Vermeulin, W., Hoeijimaker, J. H.
J., Chambon, P. and Egly, J.-M. (1993). Science 260, 58-63.

Sharp, P. A. (1992). Cell 68, 819-821.
Smale, S. T. and Baltimore, D. (1989). Cell 57, 103-113.

Smale, S. T., Schmidt, M. C., Berk, A. J. and Baltimore, D. (1990). Proc. Natl. Acad.
Sci. USA 87, 5268-5272.

Sopta, M., Car-thew, R. W. and Greenblatt, J. (1985). J. Biol. Chem. 260, 10353-10361.
Sopta, M., Burton, Z.F. and Greenblatt, J. (1989). Nature 341, 410-414.

Spanjaard, R.A., Chen, K., Walker, LR. and van Duin, J. (1990). Nucleic Acids Res.
18, 5031-5036.

Starr, D. B. and Hawley, D. K. (1991). Cell 67, 1231-1240.
Stringer, K. P., Ingles, C. J. and Greenblatt, J. (1990). Nature 345, 783-786.

Sumimoto, H., Ohkuma, Y., Sinn, B., Kato, H., Shimasaki, S., Horikoshi, M. and
Roeder, R. G. (1991). Nature 354, 398-401.

Sun, Z.-W. and Hampscy, M. (1994). Submitted to Nature.

Tan, 8., Garrett, K. P., Conaway, R. C. and Conaway, J. W. (1994a). Proc. Natl. Acad.
Sci. USA 91, 9808-9812.

Tan, 8., Aso, T., Conaway, R. C. and Conaway, J. W. (1994b). J. Biol. Chem. 269,
25684-25691.

Tanese, N., Pugh, B. F. and Tjian, R. (1991). Genes Dev. 5, 2212-2224.
Tantin, D. and Carey, M. (in press). J. Biol. Chem.

Timmers, T. Th. M. (1994). EMBO J. 13, 391-399.

Tjian, R. and Maniatis, T. (1994). Cell 77, 5-8.

36

Tschochner, H., Sayre, M. H., Flanagan, P. M., Feaver, W. J. and Kornberg, R. D.
(1992). Proc. Natl. Acad. Sci. USA 89, 11292-11296.

Tyree, C. M., Geoge, C. P., Lira-DeVito, L. M., Wampler, S. L., Dahmus, M. B.,
Zawel, L. and Kadonaga, J. T. (1993). Genes Dev. 7, 1254-1265.

Usheva, A., Maldonado, E., Goldring, A., Lu, H., Houbavi, C., Reinberg, D. and Aloni,
Y. (1992). Cell 69, 871-881.

Usheva, A. and Shenk, T. (1994). Cell 76, 1115-1121.
Wampler, S. L. and Kadonaga, J. T. (1992). Genes Dev. 6, 1542-1552.

Wang, B. Q., Kostr'ub, C. F., Finkelstein, A. and Burton, Z. F. (1993). Protein Expr.
Purif. 4, 207-214.

Wang, B. Q., Lei, L. and Burton, Z. F. (1994). Protein Expr. Purif. 5, 476-485.
Wang, D. and Hawley, D. K. (1993). Proc. Natl. Acad. Sci. 90, 843-847.
Wang, E. H. and Tjian, R. (1994). Science 263, 811-814.

Wang, W., Carey, M. and Gralla, J. D. (1992a). Science 255, 450-453.

Wang, W., Gralla, J. D. and Carey, M. (1992b). Genes Dev. 6, 1716-1727.

Weeda, G., Ham, R. C. A., Vermeulen, W., Bootsma, D., van der Eb, A. J. and
Hoejimaker, J. H. J. (1990). Cell 62. 777-791.

Weil, P. A., Luse, D. S., Segall, J. and Roeder, R. G. (1979). Cell 18, 469-484.
Weinzierl, R. O. J., Dynlacm, B. D. and Tjian, R. (1993a). Cell 362, 511-517.

Weinzierl, R. O. J., Ruppcrt, S., Dynlacht, B. D., Tanese, N. and Tjian, R. (1993b).
EMBO J. 12, 5303-5309.

Workman, J. L., Roeder, R. G. and Kingston R. E. (1990). EMBO J. 9, 1299-1308.
Xiao, H., Pearson, A., Coulombe, B., Truant, R., Zhang, S., Regier, J., Triezenberg, S.
J., Reinberg, D., Flores, 0., Ingles, C. J. and Greenblatt, J. (1994). Mol. Cell. Biol. 14,
7013-7024.

Yankulove, K., Blau, J., Purton, T., Roberts, S. and Bentley, D. L. (1994). Cell 77,
749-759.

Yokomori, K., Admon, A., Goodrich, J. A., Chen, J.-L. and Tjian, R. (1993a). Genes
Dev. 7, 2235-2245.

Yokomori, K., Chen, J., Admon, A., Zhou, S. and Tjian, R. (1993b). Genes Dev. 7,
2587-2597.

Yonaha, M., Aso, T., Kobayashi, Y., Vasavada, H., Yasukochi, Y., Weissman, S. M.
and Kitagima, S. (1993). Nucleic Acids Res. 21, 273-279.

37

Young, R. A. (1991). Annu. Rev. Biochem. 60, 689-715.
Zawel, L. and Reinberg, D. (1993). Prog. Nucl. Acids Res. 44, 67-108.

Zehring, W. A., Lee, J. M., Weeks, J. R., Jokerst, R. S. and Greenleaf, A. L. (1988).
Proc. Natl. Acad. Sci. USA 85, 3698-3702.

Zhang, S., Zubay, G. and Goldman, E. (1991). Gene 105, 61-72.
Zhu, H., Joliot, V. and Prywes, R. (1994). J. Biol. Chem. 269, 3489-3497.

CHAPTER II

PRODUCTION OF HUMAN RAP74
IN BACTERIAL CELLS

38

39
ABSTRACT

RAP74 is the large subunit of RAP30/'74 (T'FIIF), a general initiation and
elongation factor for transcription by RNA polymerase II. Complementary DNA (cDNA)
clones have previously been reported encoding human RAP74. Here I report expression of
the RAP74 cDNA using a T7 RNA polymerase system in Escherichia coli. Production of
RAP74 was problematic, because a mixture of full length RAP74 and RAP74 fragments
was produced in E. coli. Most RAP74 fragments were shortened by deletion of the
COOH-terminus of the protein and probably resulted from premature translation
termination. RAP74 was most successfuny produced using a pET23d construct, in which
the RAP74 peptide was fused to a short poly histidine stretch at its COOH-terminus.
Addition of the poly histidine sequence allowed pmification using a Ni” affinity resin.
Full length RAP74 carrying this poly histidine extension was pmified in a single step by
Ni‘H' affinity chromatography in 4 M urea; the yield of RAP74 was approximately 3 mg
from a 1 liter culture of cells. RAP74 derivitized with a poly histidine stretch at its NH2-
terminus, on the other hand, remained contaminated with RAP74 fragments after Ni++
affinity chromatography. These fragments were dissociated from RAP74 in 4 M urea and
separated by Mono Q and Mono S chromatography; approximately 800 ug pure, intact and
active RAP74wasobtainedfrom a 1 litercultureofcells using this procedure.

INTRODUCTION

RNA polymerase II-associating proteins (RAPS) were initially isolated on columns
containing covalently immobilized RNA polymerase II (Sopta et al. 1985). RAP30/74 is
the same transcription factor as TFIIF (Flores et al. 1988, 1991) and FC (Katajima et al.
1990), and homologous to By (rat) (Conaway and Conaway 1989) and Factor 5
(Drosophila) (Kephart et al. 1993), isolated by others. Gel filtration studies indicate that
RAP30/74 is a heterotetramer in solution (Kitajima et a1. 1990; Conaway and Conaway
1989; Flores et al. 1990). The RAP30 subunit binds directly to RNA polymerase II
through a protein domain that is homologous to the RNA polymerase binding domain of
the major E. 0011' sigma factor, 670 (McCracken and Greenblatt 1991). Binding of RAP30
suppresses non-specific DNA binding by RNA polymerase II (Killeen and Greenblatt
1992; Conaway and Conaway 1990), and polymerase must first bind RAP30fl 4 to stably
assemble into a pro-initiation complex (Flores et al. 1991; Buratowski et al. 1991;
Conaway et al. 1991). Consistent with this role in bringing RNA polymerase II to the pre-
initiation complex, RAP30/74 is necessary for initiation of transcription (Conaway and
Conaway 1989; Burton et al. 1988). RAP30/74 also stimulates the elongation rate of RNA
polymerase II (Bengal et a1 1991; Izban and Luse 1992).

Accurate initiation fiom a promoter by RNA polymerase 11 requires a number of
accessory factors including TBP, T'FIIB, TFIIF (RAP30/74), T'FIIE, TFIIH and TFIIJ
(reviewed by Zawel and Reinberg 1993). An important goal for the transcription field is to
assemble an in vitro transcription system based entirely on highly purified and
biochemically defined components. cDNA clone encoding human RAP74 has been
isolated (Finkelstein et al. 1992; Aso et al. 1992), and here we use this cDNA to produce
active human RAP74 using a bacterial expression system based on T7 RNA polymerase.

41
MATERIALS AND METHODS

Construction of recombinant clones. The pET vectors used in these
constructions were pm'chased from N ovagen (Madison, WI). These plasmids and the
BL21(DE3) expression host E. coli strain were developed by Studier and colleagues
(Studier et a1. 1990). Construction of pET16b and pET23d was by Novagen. A vector
similar to pET16b has previously been described (Hofi'mann and Roeder 1991). The pET
series of plasmids have a ColEl replication origin and confer ampicillin resistance. Cloned
genes are expressed under control of a bacteriophage T7 promoter. The BL21(DE3)
expression strain supplies '17 RNA polymerase from a defective A. lysogen, upon induction
with IPTG (isopropyl-B-D-thiogalactoside). The relevant cloning sites and control regions
of the plasmid constructs described in this paper are shown in Figure 1.

pETlld/RAP74. Isolation of cDNAs encoding human RAP74 has been
described (Finkelstein et al.1992; Aso et al. 1992). The RAP74 cDNA has an NcoI site
(C/CATGG) located at the initiation ATG. This cDNA was subcloned as an NcoI to EcoRI
(the EcoRI site was converted to a blunt end with Klenow DNA polymerase I and
deoxynucleoside triphosphates: sites treated in this way are refered to as "blunt") fragment
into pETl 1d digested with NcoI and BamI-II (blunt) (Figtn'e 1A). The EcoRI and BamI-II
sites were destroyed in the construction. Cloning into NcoI positions the RAP74 initiator
ATG at the appropriate spacing flour a strong ribosome attachment sequence (AGGA),
downstream from aT7 promoter (Figrne 1A).

pETl6b/RAP74. The RAP74 cDNA was subcloned as an NcoI (blunt) to
EcoRI (blunt) fragment into the XhoI (blunt) site of the vector. The NcoI, EcoRI and XhoI
sites were destroyed in this construction. The orientation of inserts was tested by
restriction endonuclease mapping. The desired orientation fused the RAP74 cDNA in

frame to produce RAP74 with a short peptide extension at the N-terminus:

42
MGHHI-IHIHIHI-IHHSSGHIEGRI—MD (Hm-RAP74). This sequence contains a stretch

of 10 histidines and a blood coagulation factor Xa cleavage sequence (IEGRI) (Figure 1B).

pET23d/RAP74. Polymerase chain reaction was used to modify the 3' end-of
the RAP74 cDNA. A RAP 74 subclone was amplified. using the upstream primer
CCCAAGAGAGAGCGGAAGCC (coordinates 1179-1198; kaelstein et a1. 1992) and
the downstream primer AACTCGAGCTCCTT'GAGAGAGAAGTGCA. The
downstream primer generated an XhoI site (bold type) that was convenient for insertion
into the vector to fuse the RAP74 sequence in frame to a sequence encoding a stretch of 6
histidines. The amplified DNA was digested with XhoI and PstI, and the Xhol to PstI
fragment was isolated from an agarose gel. An NcoI to PstI fragment of the RAP74 cDNA
was mixed with this fragment, and these two DNA pieces were ligated between the NcoI
and XhoI sites of the vector. The resulting subclone produces RAP74 protein with the C-
terminal extension LEHI-IHHHH (RAP74-H5) (Figure 1C). This construct is the most
useful for purification of RAP74.

pETl6b/23d/RAP74. The pET16b/RAP74 and pET23d/RAP74 modifications
were combined by subcloning an NcoI to HindIII fragment from pETl 6bIRAP74 between
the NcoI and HindIII sites of pET23d/RAP74 . The resulting subclone produces H10-
RAP74-H6 with the NHz- and COOH-extensions described above (Figure 1D).

Production and purification of RAP74-H6, Because the primary
contaminants of RAP74 produced in E. coli are N-terminal fragments (see Figure 3),
RAP74-H5 is the most easily purified recombinant RAP74 protein. A 1 liter culture ofE.
coli BL21(DE3) containing pET23d/RAP74 was grown at 37 0C in LB medium containing
50 ug/ml ampicillin. (Growth at 25 or 30 0C did not affect the yield or solubility of
recombinant RAP74.) When the optical density at it = 600 nm reached 0.6, IPTG was
added to 0.4 mM to induce synthesis of T7 RNA polymerase. After 3 hr induction, cells
were harvested by centrifugation at 4 k rpm for 10 min in a Sorvall RC3B centifuge at 4
°C. The method for preparing the cell extract and for pruification on Ni‘H-NTA-Agarose

43
(Qiagen) was adapted from information provided by the manufacturer. Cell lysis and

removal of cell debris was done at 4 oC. Cells were resuspended in 20 ml Lysis Buffer
(50 mM Na-phosphate pH 8.0, 3(1) mM NaCl and 10 mM B-mercaptoethanol) containing 1
mg/ml lysozyme. Cells were lysed by sonication (Ultrasonics Model 220-F; 5 x 30 s with
30 5 rest at a setting of 5 with a microtip). The cell extract was cleared by
ultracentrifugation at 30 k rpm for 45 min in a Beckrnan Ti70 rotor. Urea was added to a
final concentration of 4 M. An 8 ml (2.5 x 1.7 cm) Ni++-NTA-Agarose column was
prepared according to manufactmer's instructions and equilibrated with Lysis Buffer
containing 4 M urea. This column was run at room temperature. It was loaded with
sample and then washed with 150 ml Lysis Buffer containing 4 M urea. The column was
eluted with a 100 ml linear gradient from pH 8.0 to pH 5.0. RAP74-H5 eluted in a
distinct peak at approximately pH 5. RAP74-H5 was then dialyzed against Storage
Buffer (SB) (20 mM Hepes pH = 7.9, 20 % glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.2
mM EGTA and 2 mM dithiothreitol (DT'I')) containing 0.5 M KCl.

Both recombinant RAP30 (Wang et al. 1993) and RAP74 have a tendency to
aggregate at low salt concentrations. This may be a consequence of exposed protein
domains that are normally sequestered from solution by formation of the RAP30/74
complex.

For transcription assays, the purified RAP74 was diluted to an appropriate KCl
concentration just before addition. RAP74-H5 prepared in this way is suitable for in vitro
transcription assays in our extract system. RAP74 concentration after purification was
estimated using a 230 m = 34340.

Purification of RAP74 with N-tenninal histidine extensions. The
protocol described here was developed for H10-RAP74-H6. Presumably, H10-RAP74
could be isolated by a similar procedure. Growth of cells and Ni++ affinity
chromatography were done as described above for RAP74-H5. After elution from the

NT” column, RAP74 N-terminal fragments were separated from intact protein by high

44
performance liquid chromatography using a Waters Advanced Protein Purification System

650E at room temperature. The sample was diluted to SB containing 4 M urea and 0.1 M
KCl and loaded on a Mono Q column (Pharmacia HR 5/5) equilibrated in SB containing 4
M urea and 0.1 M KCl. The column was run at a flow rate of 0.5 ml/min. The column
was washed at 0.1M KCl and then eluted with a 60 min linear gradient to 1.0 M KCl.
H10-RAP74-H5 eluted from Mono Q at approximately 0.71 M KCl; fragments of H10-
RAP74-H5 eluted at 0.69 and 0.66 M KCl). Determination of the peak fiaction containing
H10-RAP74-H5 was done by polyacrylamide gel electrophoresis in the presence of sodium
dodecyl sulfate (SDS-PAGE). The fraction containing H10—RAP74-H5 was then diluted
into SB containing 4 M urea to a final KCl concentration of 0.1 M. This solution was
loaded into a Mono S column (Pharmacia HR 5/5). The flow rate was 0.5 ml/min. The
column was loaded and washed with SB containing 4 M urea at 0.1 M KCl. The column
was eluted with a linear 60 min gradient from 0.1 to 1.0 M KCl. H10-RAP74-H5 eluted
from this column at approximately 1.0 M KCl. This fraction was dialyzed against 3
changes SB containing 0.5 M KCl to remove urea. For assay purposes H10-RAP74-H5
was diluted to an appropriate salt concentration just before use. Prolonged incubation of
recombinant RAP74 in low salt solutions (i.e. 0.1 M KCl) leads to precipitation.
Production and partial purification of RAP74. A 1 liter culture of E. coli
BL21(DE3) containing pETl 1d/RAP74 was grown, induced and harvested as described
above. Cells were resuspended in 20 ml buffer containing 20 mM Hepes pH 7.9, 100 mM
NaCl, 50 mM EDTA and 10 mM EGTA. 80 mg lysozyme was added, cells were lysed by
sonication, and cell debris was removed by centrifugation. 0.398 g/ml pulverized
ammonium sulfate was added to the cleared supernatant, and the solution was stirred for 1
hr at 4 °C. The ammonium sulfate precipitate was collected by centrifugation. The pellet
was resuspended in 20 ml SB without KCl, and the resulting solution was dialyzed 2 times
against SB with 0.1 M KCl. Insoluble material was removed by centrifugation. and the
cleared supernatant was loaded on a 20 ml phosphocellulose column (Whatman P-l 1; 2.5 x

45
5 cm) . The column was pre—equilibrated with SB containing 0.1 M KCl and 200 ug/ml

BSA. The column was washed with SB containing 0.1 M KCl and then with SB
containing 0.4 M KCl. The column was step eluted with SB containing 1.0 M KCl. The
protein peak was collected and concentrated by centrifugation through a Centricon-30
(Amicon) microconcentrator. RAP74 prepared in this way remained contaminated with
some E. coli proteins and with RAP74 fragments (Figm'e 3A).

Stimulation of accurate transcription. The template for runoff transcription
was the Adenovirus major late promoter (AdMLP) subcloned as an XhoI to HindIII
fiagment (promoter coordinates -256 to +196) into pBluescript 11 KS (+) (Stratagene)
between the XhoI sites and HindIII sites of the vector. Template DNA was digested with
SmaI endonuclease, which cuts in the plasmid polylinker just downstream of HindIII. The
runoff transcript from the AMP is 217 nucleotides in length. A RAP30/74-depleted
extract was made by immunoprecipitation with anti-RAP30 antibodies (Finkelstein et al.
1992). RAP30/74—depleted extract, recombinant RAP30 and recombinant RAP74-H5 (as
indicated in Figure 5) were combined with AdMLP DNA (144 ug/ml) and preincubated for
60 min. The pie-incubation reaction volume was 20 ul; reactions were incubated at 30 °C.
Transcription buffer contained 12 mM Hepes pH 7 .9, 12 % glycerol, 60 mM KCl, 8 mM
MgC12, 3.12 mM EGTA, 0.12 mM EDTA and 1.2 mM DTT. 600 M ATP, CI'P, UTP
and 25 M GTP (5 uCi/reaction a-32P GT'P) were added in 5 al. and transcription
elongation continued for 30 min. Reactions were stopped, phenol-chloroform extracted,
ethanol precipitated and electrophoresed as previously described (Burton et al. 1988).
Accurate transcription was quantitated using a Molecular Dynamics Phosphorimager. A
square area containing the 217 nucleotide runoff transcript was counted and an area of the
same dimensions, immediately above or below the 217 nucleotide transcript band, was
subtracted as a background estimate. Standard amounts of radioisotope were spotted and

quantitated with accurate transcript bands to relate integrated values to quantities of (a-

32P)-GTP.

45
Production of anti-RAP30 and anti-RAP74 antiserum. Antisera against

RAP30 and RAP74 have been produced in rabbits. Titer Max (Cthx) was used as
adjuvant in the initial injection (day l) but omitted for boosts (days 22 and 36). For
RAP30,5 mgprotein wasusedforinitialinjectionandngforboosts. ForRAP74, 250
ug H10—RAP74 was used for initial injection and 150 pg for boosts. Rabbits were bled on
days 43 and 50. Both anti-RAP30 and anti-RAP74 antisera prepared in this manner were
suitable for immunoprecipitation of the human RAP30/74 complex from extracts of HeLa
cells and for use in Western blots (data not shown).

Western blotting. For the experiment shown in Figure 2B, anti-RAP74
antibodies were a whole immunoglobulin fiaction isolated from chicken serum, diluted to
9.4 [lg/ml total immunoglobulin. The second antibody was rabbit anti-chicken IgG
conjugated to alkaline phosphatase (Jackson Laboratories). Color development was with
standard reagents (Bio Rad).

47
RESULTS

Recombinant constructs

Expression plasmids for producing RAP74 are shown in Figure 1 and described in
detail in Materials and Methods. The RAP74 gene was engineered to fuse RAP74 protein
to short poly histidine tracts at its N- and/or C-terminus to facilitate pmification (Figure 1B-
D). These modifications do not appear to affect the activity of RAP74 in accurate
transcription assays. The pET23d/RAP74 construct produced the most easily purified
RAP74 with minimal modification.

Expression clones for production of RAP74

Production of the large subunit of RAP30/7 4 has been problematic. RAP74 is
produced as a mixture of full length protein and N-terminal fragments in bacterial cells,
and these fragments are not easily dissociated from intact protein. Here we report four
constructs for production of RAP74: l) pETl ld/RAP74 which produces RAP74 fiom its
native ATG to its native stop codon; 2) pET16b/RAP74 which produces H10—RAP74 with
the added sequence MGI-II-IHIII-IHHI-II-IHSSGI-IIEGRI-MD at the N-terminus of the
protein; 3) pET23d/RAP74 which produces RAP74-H5 with the added sequence
LEI-II-IHHHH at the C-terminus of the protein; and 4) pEI'l6b/23dIRAP74 which produces
H10—RAP74-H5 with the above extensions at both ends. The N-terminal extension can be
cleaved using blood coagulation factor Xa protease, which cleaves after the sequence
IEGR, leaving I-IMLD attached to the initiator methionine of RAP74. The C-terminal
extension may be selectively sensitive to carboxypeptidase digestion, although we have not
tested this.

48

Figure l. RAP74 production clones. A) pETl 1d/RAP74; B) pET16b/RAP74; this
clone encodes H10-RAP74; C) pET23d/RAP74; this clone encodes RAP74-H5; and D)
pET16b/23d/RAP74; this clone encodes H10-RAP74-H5. Dark lines indicate human
DNA. N- and C-terminal extensions are indicated using the standard one letter amino acid
code. AGGA is a ribosome attachment sequence; * indicates a stop codon.

A.

pETlld/RAP74

B.

NEHEM&UW4

C.

pET23d/RAP74

D.

49

 

 

 

 

 

 

 

 

 

Phdi Hmam: Ififl
'T7=> r 1 ! Eamflmuflfl
r___l A [ RAP74 J
AGGA
PstI
l EcoRI/Xhol
| l
Ncol HindIII Pstl XhoI mammar-
'T7=> I I l I
r__1 [ RAP74 |
AGGA
meuXa
Nan I
MGHHHHHHHHHHSSGHIEGRHMLD
XhoI/Ncol HindIII PstI Xhol LEHHHI-IHH‘
I
2) r
T7 I | RAP74

 

 

pETledeRAPu mi

AGGA

meml

50
Purification of RAP74-H6

When the human RAP74 cDNA was expressed in E. coli, a combination of RAP74
fragments and full length RAP74 was produced (see Figures 2 and 3). Most of these
fragments are N-terminal fragments, as indicated by the data in Figures 2 and 3B. RAP74-
H5 was produced and pmified from E. coli BL21(DE3) containing pET23d/RAP74. The
purification was analyzed by SDS-PAGE (Figure 2A) and western blotting with anti-
RAP74 antibodies (Figtne 2B). RAP74-H6 was separated from E. coli proteins by NY”
affinity chromatography in 4 M urea. Only RAP74 peptides that include the C-terminal
poly histidine extension can bind to the NY” resin in urea. The most abundant RAP74
fragments identified by western blotting (Figure 2; lanes 1 and 2; fragments "c", "d" and
"e") flow through the Ni“ column, indicating that these fragments lack the poly histidine
extension. Fragments "c", "d" and "e” most likely arise by premature translation
termination. When RAP74-H5 was passed through a NY” column in the absence of area
(Figure 3B), fragments "c", "d” and "e" were not dissociated, indicating that these
fragments form multimers with intact RAP74—H5 Minor RAP74 fragments that bind to the
Ni‘H' column (fragments "a” and "b") most likely arise from initiation of translation at
internal start codons. Fragment "a" may initiate at M62 (methionine 62:
CAAGAGGAGGAGAHG), which is flanked by a sequence that could function as a
ribosome attachment sequence in E. coli. Fragment "b" may intiate at M216
(GAGGACGACCUGGAGAHG), which is flanked by a consensus ribosome attachment
sequence.

After chromatography, urea was removed by dialysis into SB containing 0.5 M
KCl. Purified RAP74»H5 is shown in Figure 2, lane 3. This material remains Slightly
contaminated with RAP74 fragments "a" and "b" described above, but was separated fiom
most E. coli proteins by this single-step procedure. Based on our experience, this method
is the most straightforward for preparing RAP74 in this bacterial expression system. The
final yield of RAP74-H5 was 3 mg from a 1 liter culture of cells.

51

Figure 2. Purification of RAP74-H6 by Ni++ affinity chromatography in 4
M urea. A) SDS-PAGE; B) western blot developed with anti-RAP74 antibodies. M)
low molecular weight size standards (sizes are in kilodaltons; 2 pg each protein); 1) whole
cell extract; 2) Ni” column flow through fraction; and 3) Ni‘H' column eluate (RAP74—
H6). 14 rtl of each fraction was loaded for Coomassie blue staining, 3 ul of each fraction

was loaded for the western blot.

52

 

 

 

 

 

Figure 2

 

_RAP74-H6
‘8

"b
‘C

<d

<e

 

53

Figure 3. SDS-PAGE of recombinant RAP74. A) RAP74 partially purified by
phosphocellulose chromatography (approximately 2 and 10 ug intact RAP74). B) NT”
column purified RAP74-H5 (lane 1) and H10-RAP74-H5 (lane 2). For this experiment,
Ni++ column chromatography was done in the absence of urea. After Ni‘l’ 4'
chromatography, most remaining contaminants were N-terminal, incomplete translation
products. C) RAP74-H5 (lanes 1 and 2; 2 and 10 rig) and H10—RAP74-H5 (lanes 3 and 4;
2 and 10 ug). aftcrpurification on MonoQandMonoS columnsin4 Mmea. M) high and
low molecular weight standards (sizes are in kilodaltons; 2 ug each protein).

54

A. B.

 

 

   

 

 

 

 

 

2 10 ug .. _ _
' “ 200 —
200 —
116 _ 116 —
97_ 97 — _H10-RAP74-H6
- Q —
—RAP74 66 _ - RAP74-H6
66—
45— 45 —
31— 31 — -
| — -
1 2 22 _——— —“
1 2 , _
C RAP74-H6 H10-RAP74-H6
O
2 10 2 10 pg
200—9 1
116 —
97— p —
.. -
66— - - -

31—

 

 

 

B
-
45—. -
E
M

l 2 M 3 4
Figure3

55
Purification of RAP74 with N-terminal histidine extensions

H10-RAP74-H5 was purified to near homogeneity using the methods described in
Materials and Methods (Figure 3C). After affinity purification on a Ni'H’-NTA-Agarose
column, a mixture of intact H10-RAP74-H5 and RAP74 fragments was obtained (Figlne
3B). Chromatography on Mono Q and Mono S columns in the presence of 4 M urea
dissociated and separated most of these fragments from intact RAP74, producing a nearly
homogeneous product (Figure 3C). After dialysis into SB containing 0.5 M KCl, H10-

RAP74—H5 was soluble and active in transcription assays.

Transcriptional activities of recombinant RAP30 and RAP74

Transcriptional activities of recombinant RAP30 (Wang et al. 1993) and RAP74 are
shown in Figure 4. Assays were done in a HeLa cell extract from which RAP30/74 was
depleted by immunoprecipitation with anti-RAP30 antibody (Btn'ton et al. 1988; Finkelstein
et al. 1992). Accurate transcriptional activity was not detectable if RAP30 was omitted
from the reconstitution assay, and RAP30 strongly stimulated accurate transcription in the
presence of RAP74 (Figure 4A). In the presence of RAP30, RAP74-H5 stimulated
transcription up to 30-fold in this assay (Figlne 4B). When RAP30 was added to the assay
but RAP74 was omitted, accurate transcription was weakly detectable (Figure 4B). The
low efiiciency of transcript production (mole transcript per mole RAP30fl4) observed in
Figure 4 is characteristic of accurate transcription experiments in HeLa extracts (Shapiro et
a1. 1988).

Recombinant RAP30 and RAP74 appear to stimulate accurate transcription to a
similar level to that observed in an extract that had not been depleted of RAP30f74 (data not
shown). Recombinant RAP30 and RAP74 also stimulated transcription in the RAP30/7 4
depleted extract to as high a level as partially purified human RAP30/7 4 (data not shown).

56

Figure 4. Stimulation of accurate transcription by recombinant RAP30 and
RAP74-H6. A) RAP30/74 depleted extract, 100 ng RAP74, and 0, 10, 20, 40 or 80 ng
RAP30 were combined and assayed for accurate transcription from the Adenovirus major
late promoter (see Materials and Methods). B) RAP30/74 depleted extract, 50 ng RAP30,
and 0, 10, 20, 40, 80 or 160 ng RAP74 were combined and assayed for accurate

transcription. Insets Show the gels used for quantitation.

ACCURATE TRANSCRIPTION (fmol)

57

0.2

 

 

 

 

 

 

 

 

0.2

 

0.1-

  
 

 

0 10204080160n
fr?" -

 

 

217— an Q Q Q

0 ' 100 v 200
RAP74 (ng)

 

 

 

Figure 4

58
DISCUSSION

Methods are presented for pmification of human RAP30 and RAP74 produced in
bacterial cells. Production of RAP30 was very successful. RAP74 production has posed
some difficulties; however, using genetic engineering and NT” affinity chromatography,
pure and intact RAP74 has been obtained. W4 prepared in this way is suitable for the
study of RAP30/74 function in vitro.

The RAP74 mRNA appears to be inefficiently translated in E. coli (Figure 2).
Potentially, RAP74 fragments could be produced by premature translation termination or
by proteolysis. Translation termination produces primarily N-terminal fragments, while
proteolysis will produce both N- and C-terminal fragments. Most RAP74-H5 fragments
dissociate from full length RAP74-H6 using Ni‘H‘ affinity chromatography in the presence
of 4M urea (Figrne 2),'indicating that these shorter peptides lack the poly histidine stretch at
the C-terminus. Premature translation termination of human genes expressed in E. coli has
beenconelateduddrthepresenceofcodonsindremRNAthatmeveryrareinE. coligenes
(Chen and Inouye 1990). Apparently, E. coli cannot easily supply the appropriate tRNA,
causing translation to stall or to proceed in an alternate reading frame, resulting in
premature termination. The RAP74 cDNA contains many rare E. coli codons (Finkelstein
et al. 1992; Aso et al. 1992). Recoding of the RAP74 cDNA using a preferred set of E.
coli codons, therefore, should enhance expression of RAP74 in E. coli.

RAP30fl4hasbeenproposedtobealwterotetramerCKitajimaetal 1990; Conaway
and Conaway 1989; Flores et al. 1990). Since RAP74 fragments dissociated in 4 M mea
(Figures 2 and 3), intact RAP74 and fragments are likely associated non-covalently.
Dissociation of fragments was not observed with 0, 1 or 2 M urea (data not shown). We
conclude that RAP74 must exist as a multimer in solution. Since small N-terminal
fragments of RAP74 such as fragment "e" (~23 kd; compare Figures 2 and 3B), associated
with RAP74-H5 in the absence of urea, the multimerization domain likely resides in the N-

59
terminal domain of RAP74 (the first ~23 kd). Yonaha et al. (1993) have mapped the

multimerization domain of RAP74 to amino acids 73-205, consistent with this conclusion
(Yonaha et a1. 1993).

Wearecurrentlyattemptingtodetermine whetherRAP30andRAP74aredimeric in
solution. We are also attempting to reconstitute the RAP30/7 4 heterotetramer in solution,
using recombinant proteins. Preliminary experiments indicate that mixing RAP30 and
RAP74 together in buffer containing 4M urea and then dialyzing out the urea is an efficient
method for reconstituting the RAP30/74 complex (Chapter III). Recombinant RAP30 and
RAP74 described in this report are active in accurate transcription using an extract system.
In an extract, recombinant proteins could be modified covalently or conformationally from
an inactive to an active form. It is not clear from the present work, therefore, what role
modification of RAP30 or RAP74 may have in the transcriptional activities of these
proteins. Both RAP30 and RAP74 are phosphorylated in vivo (1), a modification which
does not occur during bacterial production. RAP30 and RAP74 also appear to be N-
terminal blocked when isolated fi'om human cells, so bacterial and human proteins are
likely to differ subtly at their N-terminus. Since attachment of a short poly histidine
extension to the N-terminus of RAP74 does not appear to affect transcriptional activity,
this modification may not affect RAP74 frmction.

ItwfllbeimpomnttotestwhedrerrecombinantRABOandRAN4udnfuncdonin
a more highly pmified transcription system. One important goal for the transcription field
is the development of a system of completely defined components that will accmately
transcribe from promoters. The most highly purified systems reported consist of TBP,
TFIIB, T'FIIF (RAP30fl4), TFIIE (34 and 56 kd subunits), T'FIIH (65 kd subunit;
multiple other subunits; ATPase; and CTD kinase activities), TFIIJ (undefined subunit
structure) and RNA polymerase II (10-12 subunits). Since not all components of TFIIH
and TFIIJ have been identified, cloning and expression of additional cDNAs must precede
a completely defined system (see review by Zawel and Reinberg for references). Our

60
laboratory has not yet established a more purified system to test RAP30 and RAP74

activities. It is our hope that cloning and expression of RAP30 and RAP74 cDNAs is a
contribution to this effort. Until all of the factors that participate in accurate transcription
are identified and their functions understood, however, comparison of activities in extracts

and more purified systems will be important to understand transcriptional control.

ACKNOWLEDGEMENTS

We thank R. Mierendorf (Novagen) for his help and advice in using the pET
vectors. Z.B. is a member of the Michigan State University Agricultrnal Experiment
Station. This research was supported by a grant from the National Institutes of Health
(GM40708).

61
REFERENCES

Aso, T., Vasavada, H.A., Kawaguchi, T., Germino, F.J., Ganguly, 8., Kitajima, S.,
Weissman, SM. and Yasukochi, Y. (1992) Characterization of cDNA for the large subunit
of the transcription initiation factor TFIIF. Natme 355, 461-464.

Bengal, B., Flores, 0., Krauskopf, A., Reinberg, D. and Aloni, Y. (1991) Role of the
mammalian transcription factors 11F, IIS and IIX during elongation by RNA polymerase 11.
Mol. Cell. BioL 11, 1195-1206.

Buratowski, S., Sopta, M., Greenblatt, J. and Sharp, RA. (1991) RNA polymerase 11-
associated proteins are required for a DNA conformation change in the transcription
initiation complex. Proc. Natl. Acad. Sci. USA 88, 7509-7513.

Burton, Z.F., Killeen, M., Sopta, M., Ortolan, L.G. and Greenblatt, J. (1988) RAP30/74:
a general initiation factor that binds to RNA polymerase II. Molec. Cell. Biol. 8, 1602-
1613.

Chen, G. T. and Inouye, M. (1990) Suppression of the negative effect of minor arginine
codons on gene expression; preferential usage of minor codons within the first 25 codons
of the E. coli genes. Nucleic Acids Res. 18, 1465-1473.

Conaway, J.W. and Conaway, R. C. (1989) A multisubunit transcription factor essential
for accurate initiation by RNA polymerase II. J. Biol. Chem. 264, 2357-2362.

Conaway, J. W. and Conaway, R. C. (1990) An RNA polymerase II transcription factor
shares functional properties with Escherichia coli 070. Science 248, 15504552.

Conaway, R. C., Garrett, P., Hanley, J .P. and Conaway, J .W. (1991) Mechanism of
promoter selection by RNA polymerase II: mammalian transcription factors a and By

te 622% of polymerase into the preinitiation complex. Proc. Natl. Acad. Sci. USA
88’ 6205' .

Finkelstein, A., Kostrub, C.F., Li, J., Chavez, D. P., Wang, B.Q., Fang, S.M.,
Greenblatt, J. and Burton, Z.F. (1992) A cDNA encoding RAP74, a general initiation
factor for transcription by RNA polymerase 11. Nature 355, 464—467.

Flores, 0., Maldonado, E. Burton, Z.F., Greenblatt, J. and Reinberg. D. (1988) RNA
polymerase II-associating protein 30 is an essential component of transcription factor IIF.
J. Biol. Chem. 263, 10812-10816.

F'lores, 0., Lu, H., Killeen, M., Greenblatt, J., Burton, Z.F. and Reinberg, D. (1991)
The small subunit of transcription factor IIF recruits RNA polymerase II into the
preinitiation complex. Proc. Natl. Acad. Sci. USA 88, 9999-10003.

Flores, 0., Ha, 1., and Reinberg, D. (1990) Purification and subunit composition of
transcription factor IIF. J. Biol. Chem. 265, 5629-5634.

Hoffmann, A. and Roeder, R.G. (1991) Purification of his-tagged proteins in non-
denaturing conditions suggests a convenient method for protein interaction studies.
Nucleic Acids Res. 19, 6337-6338.

62

Izban, MG. and Luse, D. S. (1992) Factor-stimulated RNA polymerase II transcribes at
ggysipgo‘arfi 3%; on naked DNA but very poorly on chromatin templates. J. Biol. Chem

Kephart, D. D., Price, M. P., Burton, Z.F., Finkelstein, A., Greenblatt, J. and Price, D.
H. (1993) Cloning of a Drosophila cDNA with sequence similarity to htnnan transcription
factor RAP74. Nucleic Acids Res. (in press).

Killeen, M. and Greenblatt, J. (1992) The general transcription factor RAP30 binds to
RNA polymerase II and prevents it from binding nonspecifically to DNA. Molec. Cell.
Biol. 12, 30-37.

Kitajima, S., Tanaka, Y., Kawaguchi, T., Nagaoka, T., Weissman, S. and Yasukochi, Y.
(1990) A heteromeric transcription factor required for RNA polymerase II. Nucleic Acids
Res. 18, 4843-4849.

McCracken, S. and Greenblatt, J. (1991) Related RNA polymerase-binding regions in
human RAP30/74 and Escherichia coli o70. Science 253, 900902.

Shapiro, D.J., Sharp, P.A., Wahli, W.W. and Keller, M.J. (1988) A high-efficiency
HeLa cell nuclear transcription extract. DNA 7, 47-55.

Sopta, M., Carthew, R. W. and Greenblatt, J. (1985) Isolation of three proteins that bind
to RNA polymerase II. J. Biol. Chem. 260, 10353-10361.

ta, M., Burton, Z.F. and Greenblatt, J. (1989) Structure and associated DNA-helicase
gc4tlfiz gial‘gteneral transcription initiation factor that binds to RNA polymerase 11. Nature

Studier, F. W., Rosenberg, A. H., Dunn, J. J. and Dubendorff, J. W. (1990) Use of T7
RNA polymerase to direct expression of cloned genes. 'Methods in Enzymol. 185, 60-89.

Yonaha, M., Aso, T., Kobayashi, Y., Vasavada, H., Yasukochi, Y., Weissman, S. M.
and Kitagima, S. (1993) Domain structure of a human general transcription initiation
factor, TFIIF. Nucleic Acids Res. 21, 273-279.

Wang, B. Q., Kostrub, C. F., Finkelstein, A. and Burton, 2. F. (1993) Production of
human RAP30 and RAP74 in bacterial cells. Protein Expression and Purification 4, 207-
214.

Zawel, L. and Reinberg, D. (1993) Initiation of transcription by RNA polymerase II: a
multi-step process. Prog. Nucleic Acids Res. Mol. Biol. 45, 67-108.

CHAPTER III

IMPORTANCE OF CODON PREFERENCE

FOR PRODUCTION OF HUMAN RAP74 AND
RECONSTITUTION OF THE RAP30/74 COMPLEX

63

ABSTRACT

RAP30 and RAP74 are subunits of RAP30/74 (TFIIF, By), a general initiation and
elongation factor for transcription by RNA polymerase 11. Methods were previously
published for production of human RAP30 and RAP74 in bacterial cells, using a
bacteriophage T7 promoter expression system (Wang, B.Q., Kostrub, C.F., Finkelstein,
A., and Burton, Z.F. [1993] Protein Expression and Purification 4, 207-214). The vectors
described for production of RAP74 were not very efficient and produced significant
quantities of RAP74 amino terminal fragments. To improve these vectors, a segment of the
human RAP74 cDNA was recoded using a preferred set of codons for translation in E.
coli. Recoding dramatically improved protein production and suppressed production of
amino terminal fragments. Improved vectors are reported that produce RAP74 with an
LEHHHHHH carboxy terminal extension (RAP74-H5), for purification on a NiH-affinity
column, and also with the native carboxy terminus (RAP74). Methods for purification of
RAP74-H5 and RAP74 are reported. Using these improved vectors, approximately 30 mg
ofsoluble andactive RAP74-H5orRAP74canbeproducedandplnifiedfrom 1 literofE.
coli culture, representing a 10-fold improvement in protein production. Methods have also
been developed for reconstitution of native RAP30/74 complex using recombinant proteins.
This complex has indistinguishable activity from human RAP30/'74 for accurate
transcription in vitro.

65
INTRODUCTION

RAPS are RNA polymerase II-associating proteins that were first isolated by
afiinity chromatography on a column containing covalently immobilized RNA polymerase
II (Sopta et al.1985). RAP30/74 (TFIIF, fly) is a heteromeric complex of subunits RAP30
and RAP74 that stimulates both initiation and elongation of RNA chains (Bm'ton et al.1988;
Flores et al. 1988, 1990, 1991; Conaway and Conaway 1989; Conaway et a1. 1991;
Kitajima et al. 1990; Bengal et al. 1991; Izban et al. 1992). The RAP30 subunit binds
directly to RNA polymerase H and helps bring polymerase into a pre-initiation complex
containing TFIID (Transcription Eactor, RNA polymerase II, Factor 11), TFIIB and
promoter DNA that contains a TATA box (Flores et al. 1991; Conaway et al. 1991).
RAP30 interacts with T'FIIB, and this contact may be important in complex assembly (Ha
et al. 1993). Accurate initiation requires fmther association of factors TFIIE, T'FIIH and
TFIIJ. ATP is hydrolyzed and nucleotides are utilized for phosphodiester bond formation
(reviewed by Zawel and Reinberg 1993). In most systems, the RAP30 subunit is required
for accrnate initiation (Chang et a1. 1993), although some exceptions have been noted
(Parvin and Sharp 1993). RAP74 has been found to be dispensible for initiation in several
cases (Chang et al. 1993; Parvin and Sharp 1993; Tyree et al. 1993), and RAP74 has been
shown to be required during early elongation for polymerase to escape from the major late
promoter of human Adenovirus (AdMLP) (Chang et al. 1993). RAP30/74 accelerates
elongation and stimulates transcription past nucleosomes in vitro (Bengal et al. 1991; Izban
et al. 1992). Much work remains to be done to elucidate the precise functions of RAP30
and RAP74 in initiation and elongation, and how these and other general factors interact
with transcriptional effectors to regulate gene expression, both before initiation, and timing
promoter escape and elongation.

Expression of human genes in bacterial systems may be complicated by protein

instability or inefficient mRNA translation in the heterologous system. Production of

66
human RAP74 in E. coli was found to be inefficient (Wang et al. 1993), and difficulties

with the system were primarily attributed to codons found in the human gene that are rarely
used in E. coli . AGG and AGA arginine codons, which are common in eukaryotic genes
but almost never present in E. coli genes, can cause inefficient translation in E. coli (Zhang
et a1. 1991; Brinkrnann et a1. 1989; Chen and Inouye 1990; Spanjaard et al. 1990;
Rosenberg et al. 1993). Tandem repeats of AGG and AGA codons have been shown to
result in translational frameshifting and other translation errors (Brinkmann et al. 1989;
Chen and Inouye 1990; Spanjaard et al. 1990; Rosenberg et al. 1993). In many cases,
recoding of genes has been shown to improve bacterial production, and several strategies
have been developed for synthesizing long nucleotides using the polymerase chain reaction
(PCR) (Abate et al. 1990; Dillon and Rosen 1990; Ciccarelli et a1. 1991; Jayaraman et al.
1991; Sandhu et al. 1992). A segment of RAP74 that contains many rare E. coli codons
including 4 AGG codons and one AGA codon was synthesized with an altered set of
codons selected to be more compatible with efficient translation in E. coli (Zhang et al.
1991). Replacement of this recoded segment into RAP74 expression plasmids dramatically
improved protein production. Methods have also been developed for reconstitution of the
RAP30/74 complex using recombinant human RAP30 and RAP74.

67
MATERIALS AND METHODS

Expression vectors and strains. T7 expression plasmids pETl 1d and
pET23d and expression strain BL21(DE3) were purchased from Novagen. Use of the
bacteriophage T7 system and the pET series of vectors is described in detail in reference 27
and in Novagen product information. We have previously reported construction of
pETl 1d/RAP30, pETl ld/RAP74 and pET23d/RAP74 (Wang et a1. 1993). In this paper,
cDNA names are indicated in upper case italics (i.e. RAP74); proteins are indicated in
upper case (i.e. RAP74).

Recoding a segment of RAM. The RAP 74 cDNA was synthesized
between codons 135 and 259 using the polymerase chain reaction (PCR), as shown in
Figure 1. This region of the gene was chosen for recoding because it contains 4 AGG
codons (Rl66, R167, R200 and R245 [arginine codon 245]), one AGA codon (R230),
otherrareE. colicodons, andaninternalribosome attachment siteassociatedwithanATG
translation initiation codon. This sequence also contains runs of synonymous codons such
as the KKKKKK tract (246 to 251). To minimize ribosome slippage on this sequence it
was synthesized with a mixed assortment of lysine codons as 5'-
AAGAAGAAAAAGAAAAAA-3' (Studier et al. 1990; Parker 1989). No strong secondary
snucnrresweteintroduced intothe syntheticgene asaresultofrecoding.

The method used for synthesizing long nucleotides with PCR is described in detail
in reference (Dillon and Rosen 1990). Briefly, 4 partially overlapping DNA primers (93,
116, 116, and 116 bases in length; complementary overlaps were 20 base pairs) were
synthesized (Macromolecular Structure and Synthesis Facility, Michigan State University).
Long primers were mixed in a PCR reaction and DNA was amplified for 7 cycles. 11.11 of
this PCR reaction was transferred to a fresh PCR reaction containing an excess of short
flanking primers covering the two engineered NspV sites (5'-

AAGGCWGGCCCCGTCCGGACACTGG-T and 5'-

68
GCCIICGAAGACAGCGATGATGGTGACTTCG-T; NspV sites are underlined) and

amplification was continued for 25 cycles. The 381 base pair PCR product was size
selected and eluted from an agarose gel (QIAEX; Qiagen). The synthetic DNA was then
subcloned using the TA cloning vector kit (Invitrogen), and the insert was sequenced (U SB
Sequenase kit) to be srne that no base changes had been introduced dming amplification.
Several isolates of the recoded segment were recovered that had the desired sequence. The
recoded sequence is shown at the bottom of Figure 1. It is flanked by NspV restriction
sites that were subsequently used to replace this DNA into the RAP74 expression plasmid.
In addition to recoding, one internal translation start was suppressed by altering a ribosome
attachment sequence associawd with the ATG encoding M216.

Replacing the recoded segment into pET23d/RAPZA, The human
RAP74 gene contains no NspV sites, so in order to subclone the recoded fragment into
pET23d/RAP74 (Wang et al. 1993), an NspV site was created by construction of
pET23d/RAP74NspV(A136-258). The N-terminal encoding portion of RAP74 was
synthesized by PCR amplification from the NcoI site at the initiator methionine codon to an
engineered NspV site at codon 135. This amplified DNA was digested with Neal and
NspV and the 405 base pair fragment was isolated from an agarose gel. The C-terminal
encoding portion of RAP74 was synthesized by PCR amplification from an engineered
NspV site at codon 259 to beyond the SalI site. DNA was then digested with NspV and
SalI, and the 532 base pair DNA fragment was isolated from an agarose gel.
pET23d/RAP 74 was digested with NcoI and Sell and then treated with alkaline
phosphatase. The vector was then combined with the NcoI to NspV (405 bp) and NspV to
SalI (532 bp) fragments and the mixture was ligated. The recoded vector,
pET23leAP74NspV, was constructed by digesting the TA plasmid carrying the recoded
cassette and isolating the 369 bp NspV to NspV fragment from an agarose gel. The
recoded fragment was then subcloned into the NspV site of pET23d/RAP74NspV(A136-

258).

69
Removing the C-terminal histidine tag from the recoded

pET23d/Wspv vector. To produce RAP74 without a C-terminal histidine tag,
pETl 1d/RAP74NspV was constructed. pETl 1d/RAP74 (Wang et al. 1993) was digested
with NcoI and Sal I and then treated with alkaline phosphatase. pET23d/RAP74NspV was
digested with NcoI and SalI and the 1306 base pair NcoI to SalI fragment was eluted from
an agarose gel. This fragment was subcloned between the NcoI and SalI sites of
pETl ld/RAP74 to create the recoded vector pETl 1d/RAP74NspV.

Production and purification of RAP74-H6 and RAP74. Plasmids were
grown in the E. coli expression strain BL21(DE3) to ODaoo m = 0.6 and induced by
addition of 400 M IPTG (isopropyl-B-D-tbiogalactoside). For protein production the time
of induction was 3 hr. For purification of RAP74-H6 the protocol was the same as that
previously published (Wang et al. 1993). For purification of RAP74 without the histidine
tag, a 1 liter culttue of BL21(DE3) transformed with pETl 1d/RAP74NspV was grown,
induced 3 hr with IPTG, and cells were harvested by centrifugation at 4000 rpm in a
Sorvall RC-3B centrifuge (H6000A rotor). The cell pellet was resuspended in 20 ml buffer
containing 20 mM Hepes pH = 7.9, 100 mM KCl, 50 mM EDTA, 10 mM EGTA, 2 mM
ditlriothreitol, 1 mM PMSF (phenyl-methane-sulphonyl-fluoride), and 4 mg/ml lysozyme.
The cell suspension was incubated 20 min on ice. Urea (ultraprne; Boelninger—Mannheim)
powderwasaddedwith stirringto-afinalconcentrationof4M Themixturewas sonicated
(Ultrasonics Model 220-F; 6 x 30 s at setting 5 with a microtip) and centrifuged at 15,000
rpm in a Sorvall SS-34 rotorifor 10 min. The supernatant was re-centrifuged at 30,000
rpm for 45 min using a Beckman Ti45 rotor. The cleared supernatant was loaded on a
phosphocellulose column (P-ll; Whatrnan; 2.5 x 5 cm) equilibrated with storage buffer (20
mM Hepes pH = 7.9 [unless otherwise specified], 20 % glycerol, 0.2 mM EDTA, 0.2 mM
EGTA, and 2 mM DTT) containing 0.1 M KCl and 4 M urea at room temperature. The
column was washed with 100 ml of this same buffer and then eluted with a linear 200 ml
gradient from 0.1 to 2 M KCl. Monitoring absorbance at 280 nm, a single large peak was

70
detected eluting at approximately 0.45 M KCl. The preparation was continued with 1/3 of

the pooled phosphocellulose eluate. This solution was dialyzed into storage buffer at pH =
6.89 containing 0.1 M KCl and 4 M urea. Subsequent chromatography was done using a
Waters 6505 Advanced Protein Purification System at room temperature. The sample was
loaded on a Mono S column (Pharmacia; HR 5/5) in storage buffer pH = 6.89 containing
0.1MKC1and4Mureaataflowrateof0.5 ml/min. Afterwashing the column with the
same bufi'er, RAP74 was eluted with a linear 90 min gradient fiom 0.1 to 1.5 M KCl. A
- heterogeneous peak containing RAP74 and RAP74 fragment c eluted at 0.48 M KCl. This
fraction was pooled and dialyzed into storage buffer pH = 8.37 containing 0.1 M KCl and
4 M urea. This sample was then loaded onto a Mono Q column (Pharmacia; HR 5/5) in the
dialysis buffer at a flow rate of 0.5 mllmin. The column was washed and then eluted with
a linear 90 min gradient from 0.1M to 1.5 M KCl. RAP74 fragment c eluted at 0.32 M
KCl; full length RAP74 eluted as a homogeneous peak at 0.4 M KCl. The RAP74 sample
was dialyzed against storage buffer pH = 7.9 containing 0.5 M KCl and stored at -20 ° C.
Protein concentration was estimated using 8230 m, = 34,340. The yield of RAP74 was
126mgfroma 1/‘3rdportionofa l litercultureofcells.

Reconstitution of the RAP30/74 complex. Equimolar quantities of
recombinant RAP30 and RAP74 or RAP74—H5 were combined in storage buffer pH = 7.9
containing 0.5 M KCl and 4 M urea. This solution was maintained for 1 hr at room
temperatme with periodic gentle shaking. This solution was dialyzed 4 times against
storage buffer containing 0.5 M KCl at 4 °C to remove urea. For storage pmposes,
RAP30/'74 was dialyzed into storage buffer containing 0.1 M KCl. Most of the free
RAP30 and RAP74 subunits precipitate from solution upon dialysis into 0.1 M KCl, but
RAP30/74 remains in solution. Insoluble subunits were removed by centrifugation. This
reconstitution procedure has been done with subunit concentrations up to 0.01 mM, so it is
suitable for reconstituting mg amounts of the complex in a relatively small volume.

RAP30/74 has been further purified by Mono Q (Pharmacia; HR 5/5) cinematography.

71
The column was run at a flow rate of 0.5 ml/min. The sample was loaded in storage buffer

containing 0.1 M KCl, washed in the same bufi‘er, and eluted with a linear 40 min gradient
from 0.1 to 1 M KCl. RAP30/74 eluted at approximately 0.63 M KCl. RAP30fl4 was
dialyzed into storage buffer containing 0.1 M KCl. The concentration of reconstituted
RAP30/7 4 was estimated using 8230 m = 64,270 for the heterodimer unit (aB).

Gel Filtration analysis of the reconstituted complex. For the experiment
shown in Figure 5, samples were re-natrned from buffer containing 4 M urea and dialyzed
into storage buffer containing 0.5 M KCl, as described above. The gel filtration column
(Waters; 300 SW) was equilibrated with storage buffer containing 0.5 M KCl and was run
at a flow rate of 0.5 ml/min. Samples were injected in 150 pl. Peaks from elution profiles
were collected for SDS-PAGE (polyacrylamide gel electrophoresis in the presence of
sodium dodecyl sulfate). SDS-PAGE samples were precipitated with 125 [lg/ml Na-
deoxycholate and 6 % w/v trichloro-acetic acid for 1 hr on ice. Pellets were collected with
a 2 min centrifugation in a microfuge, washed twice with 80 % acetone (in H20), and dried
under vacuum. Pellets were resuspended in SDS-PAGE sample buffer and
electrophoresed. The gel was stained with Coomassie blue and dried between porous
plastic sheets. Protein bands were quantitated by densitometry and compared to RAP30
andRAP74standardsrunonthesamegel.

Transcription assays. Accurate transcription assays were done as previously
described (Wang et al. 1993). An extract derived from human HeLa cells was depleted of
RAP74 and RAP30 by immunoprecipitation with anti-RAP74 and anti-RAP30 antibodies
(Burton et al. 1988; Wang et a1. 1993). Reactions were reconstituted with recombinant
RAP30 and RAP74 as described in the legend to Figure 6. The template for runoff
transcription was the AdMLP (-256 to +196) subcloned into pBluescript II KS (+) and
linearized at the polylinker SmaI site at +217 relative to the AdMLP cap site. The template
concentration was 30 rig/m1, and MgC12 concentration was 12 mM for these assays. 20 [ll

samples were pre-incubated for 60 min at 30 °C. Nucleoside triphosphates (final

72
concentrations: 600 M ATP, CI? and UTP, and 25-uM a 32P-GTP [5 her per reaction])
were added in 5 |.l.l, and elongation continued for 30 min. Transcripts were visualized by
electrophoresis in a 6% polyacrylamide gel containing 50% (w/v) urea, followed by
autoradiography. Accurate transcription was quantitated directly from the dried gel using a
Molecular Dynamics Phosphorimager (Wang et al. 1993).

73
RESULTS

Recoding a segment of the human RAP74 cDNA

To improve production of RAP74 in bacterial cells, part of the RAP74 gene was
synthesized, changing human codons to codons consistent with high expression in E. coli.
The scheme for synthesis and subcloning of this fragment is shown in Figure 1. The re-
coded segment was synthesized by PCR as an NspV cassette. A modified RAP74
expression vector (pET‘23d/RAP74NspV(Al36-258)) was created containing an NspV site
into which the recoded cassette could be subcloned. The details of this construction are
explained in MATERIALS AND METHODS and shown in Figtne 1. The nucleotide
sequence of the recoded segment is shown at the bottom of the figure in frame. 5'-
TT/CGAA-3' is the recognition site for NspV encoding FE in the amino acid sequence of
RAP74. Many nucleotide sequence changes were introduced in recoding, but the amino
acid sequence of RAP74 has not been altered.

Improved expression using the recoded vector

A comparison of RAP74-H5 production using the original and recoded vectors is
shown in Figure 2. The top panel of the figure is an SDS-PAGE gel stained with
Coomassie blue dye, and the bottom panel is a Western blot of the same samples.
Production of RAP74 was monitored 0, 1.5 and 3 hr after induction with IPTG. At 1.5
and 3 hr after induction, a 76 kDa protein was strongly induced in cells containing the re-
coded vector (lanes 4 and 6) but not the original vector (lanes 3 and 5). This 76 kDa
protein reacts strongly with anti-RAP74 antibody (Figure 2B; lanes 4 and 6), indicating it is
full-length RAP74-H6.

A number of fragments of RAP74-H6 are still produced using the partially re-coded
vector (Figure 2A and 2B; lanes 4 and 6). In addition to fragments a-e previously
identified using the original vector, two new fragments are identified (f and g). Fragments

74

Figure 1. Construction of improved RAP74 production vectors. At the top of
the figme, pET23d/RAP74 is shown (Wang et al. 1993). The bacteriophage T7 promoter,
ribosome attachment sequence (AGGA), AGG codons R81, R108, R166, R167, R200,
R245, R338 and R382 (R), and internal translation starts M62 and M216 (M) are
indicated. Construction of pET23d/RAP74NspV(Al36-258) is described in detail in the
text. A re-coded cassette (hatched box) flanked by NspV sites was synthesized by PCR
and subcloned into the NspV site of this modified vector, creating pET23d/RAP74NspV,
which produces RAP74-H5. The sequence of the recoded cassette is shown at the bottom
of the figure. To construct an improved production vector for RAP74 lacking a C-terminal
histidine tag, the NcoI to SalI (1306 base pair) fragment from pE'l‘23d/RAP74NspV,
carrying the recoded region, was subcloned between the NcoI and SalI sites of
pETl 1d/RAP74 (Wang et al. 1993).

75

 

pERBdmAHM Na“ Nhfl’ Sdl ummflugnno
T7=> ‘I L’ I
AGGA MR R1 I! RM R R R "
Nqfll
panndmamunmwnnasam)
Nun nun! Nqfil SflI rannnmmant

 
    

  
 

 

17:2

 

n»

 

 

 

 

—=——:— PCR syndrw’s of recoded cassette
"
Nqfil Nu“?
EEBQRAENN VI
1’ ‘1’ Ned NspV thv s." mum-I
T7=> I I
AGGA
pETlld/W4Nspv Ned New New 8.“
T7=> l l
AGGA

TTCGAAGCTTTCCCGGTTCACAACTGGTACAACTTCACCCCGCTGGCTCGTCACCGTACC
CTGACCGCTGAAGAAGCTGAAGAGGAATGGGAACGTCGTAACAAAGTTCTTAACCACTTC
TCCATCATGCAGCAGCGTCGTCTGAAAGACCAGGACCAGGACGAAGACGAAGAAGAGAAA
GAAAAACGTGGTCGTCGTAAAGCTTCCGAACTGCGTATCCACGACCTTGAAGACGACCTG
GAAATGTCCTCCGACGCGTCCGACGCTTCCGGTGAAGAAGGTGGTCGTATTCCGAAAGCT
AAAAAGAAAGCTCCGCTGGCTAAAGGTGGTCGTAAGAAGAAAAAGAAAAAAGGTTCCGAT
GACGAAGCTTTCGAA

Figure 1

76

Figure 2. Production of RAP74-H6 is improved by recoding. The original
expression vector pET23d/RAP74 is compared to the improved version
pET23d/RAP74NspV, containing the recoded NspV cassette. A) SDS-PAGE (12 %
polyacrylamide) stained with Coomassie blue dye (0.2 OD500 m each sample). B)
Western blot of the same samples (0.02 OD500 m each sample). Samples were taken 0,
1.5 and 3 hr after addition of IPTG as indicated. Protein production fiom the original
(pET23d/RAP74) and recoded (pET23d/RAP74NspV) vectors is shown. The antibody

that was used for this Western analysis shows significant cross-reactivity with E. coli

proteins. Proteins that respond to IPTG induction are likely to be RAP74-H5 or fragments
of RAP74-H6.

77

 

 

i d d 1.5 hr 3 hr

un n uce induction induction
3. i '3
N
3' S. '5' as" 8'
e. a E 3 a

97—

66—

45"

31—

 

 

22—
106—
80- 2 p a! I I'
-—. ~ — = -
50- =
-

 

Figure 2

 

—RAP74-H6
<3

al.

‘8

 

78
a and b are C-terminal fragments that arise from translation initiation at internal methionines

(M62 and M216) (Figure 1). The increase in RAP74 fragments of similar size to fragment
a does not result from an increase in internal translation initiation at M62. Since these
fragments do not co-pmify with RAP74-H5 on the Nr'H' column (Figure 3), they do not
contain the C-terminal histidine tag. M216 is within the re-coded sequence (135-259), so
the sequence just upstream of the ATG codon encoding M216 was altered to weaken the
ribosome attachment site without changing the amino acid sequence
(GAGGACGACCUGGAGAUG was changed to GAAGACGACCUGGAAAUG).
Alteration of this ribosome attachment sequence was partially successful to suppress
internal translation initiation. The higher overall yield of fiagment b using the new vector
can be attributed to improved expression due to recoding.

Fragments c, d, and e are N-terminal fiagrnents. As judged by size, fragments c
and d should lie within the recoded segment. Consistent with this prediction, fragment d is
eliminated by recoding. Surprisingly, fragment c is enhanced by recoding. One possible
explanation for this observation is that fiagment c arises by proteolysis of longer proteins.
Further recoding of the NcoI-NspV (codons 1-135) segment of the gene should suppress
production of fragment e . Because of the cost and time involved in recoding, this has not
been done. The improved RAP74 production vectors described here should be suitable for
most applications.

RAP74-H5 was purified by Ni'H' affinity chromatography, using methods
previously described (Figure 3). The resulting protein is quite homogeneous, and the yield
was 30 mg RAP74-H5 from a 1 liter culture. ‘

A histidine tag facilitates pmification but may also influence activity. One reason
for concern in modifying the C-terminus of RAP74 is that the Drosophila homolog (Factor
5A) is. similar to the human protein in this region (Finkelstein et al. 1992; Aso et al. 1992;
Kephart et al. 1993). Evolutionary conservation may indicate an important function for the

C-terminus, although this has not been noted using transcription assays (see below).

79

Figure 3. Purification of RAP74-H6. A) SDS-PAGE (12% polyacrylamide)
stained with Coomassie blue dye. B) Western blot of the same samples. Lane 1) whole
cell extract (soluble fraction); lane 2) NY” column flow through; and lane 3) Ni” column
eluate. 5 pl of each sample was used for Coomassie blue stained samples and 0.5 111 for
Western blots. Each fraction was approximately 25 ml.

80

 

 

 

 

 

97—1- M
_RAP74-H6
.._.. ! --..
., db
45- «I.
...
. , a «c
1— :
3 - § 4
22—fl ‘e
1 2 3

 

106-W RAP74-H
sir-re . I ...:a 6

_,;-'- --‘
so-i‘siii FE? b

is «c

33-
28—
19";-

 

 

 

Figure 3

81

Figure 4. Expression and purification of RAP74 with no histidine tag. A)
SDS-PAGE (12 % polyacrylamide) comparing the original (pETl ld/RAP74) to the
recoded (pETlld/RAP74NspV) RAP74 production vector (0.2 ODgoo m each sample).
B) SDS-PAGE (12 % polyacrylamide) showing the pmification of RAP74 using the
recoded vector. Lane 1) whole cell extract (soluble fraction in 4 M urea) (5 ul of a 27 m1
fraction); lane 2) P-11 phosphocellulose column eluate (5 pl of a 40 ml fraction); lane 3)
Mono S column eluate (1 ill of a 2 ml fraction from 1/3rd of the P-11 eluate); and lane 4)
Mono Q column eluate (1 pl of a 2 ml fiaction fiom 1/3rd of the P-11 eluate).

82

 

 

 

v

u'

9'

E'

a'

iii

Q S
o o
n n l
0 0 J.
M M P

 

Extract

4 ennui

   

 

 

 

 

 

v m N ~ 2
U ' _
U v
U V
a I
a I
3.2:
‘
w m w m
d .m d .m
m be m .we
m .... m .a
__

5.83:: .— n cacao—...:-

83
Because of the improvement in expression that results from recoding, the histidine tag

might not be required for isolation. The C-terminal encoding portion of the gene was
replaced, therefore, with the native C-terminus encoding sequence, removing the histidine
tag (see Materials and Methods). The resulting vector produced large quantities of RAP74,
and this protein was isolated to near homogeneity (Figure 4). The yield of protein was
approximately 30 mg RAP74 isolated from 1 liter of culture.

Reconstitution of the RAP30/74 complex

The RAP30/74 complex was renamed by mixing RAP30 and RAP74 together in
buffer containing 4 M urea and 0.5 M KCl, dialyzing against buffer containing 0.5 M KCl
but no urea, and then dialyzing into buffer containing 0.1 M KCl and no urea. Simply
mixing recombinant RAP30 and RAP74 in the absence of urea does not reconstitute the
complex, probably because reconstitution is blocked by inappropriate self-association of
one or both subunits in the absence of denatmant. Analysis of recombinant RAP30/74
complex, RAP74 and RAP30 by gel filtration is shown in Figure 5 (Figures 5A, 5B and
5C, respectively). This experiment was done with the histidine-tagged version (RAP74-
H5), although reconstitution was equally successful with untagged RAP74. Fractions
from the gel filtration column were ftn'ther analyzed by SDS-PAGE (Figure 5D).

The RAP30/74 complex eluwd at 14 min 13 s, consistent with a native molecular
weight of 280 kDa (Figures 5A and 5B). This determination is consistent with
measmements made by other investigators (Conaway and Conaway 1989; Kitajima et a1.
1990; Flores et a1. 1990). This result indicates that RAP30/74 is a heterotetramer (a2B2)
or heterohexamer. Since mobility in a gel filtration column is influenced by protein shape,
280 kDa is an apparent native molecular weight. Sedimentation equilibrium would be the
most appropriate method for determining the native molecular weight of RAP30fl4, but the
specialized equipment required for this determination was not available for this study.
From sequence, RAP74 appears to have basic N- and C-terminal domains and a highly

84

Figure 5. Native molecular weights of RAP30, RAP74 and the RAP30/74
complex. Gel filtration analysis was done using a Waters 300 SW column. A) 28 ug
recombinant RAP30 and 50 1.1g recombinant RAP74—H5 were mixed in 4 M urea and
renatured in 150 111 volume. After dialysis into storage buffer containing 0.5 M KCl this
sample was injected into the gel filtration column. B) 50 pg RAP74-H6 was subjected to
the same procedure as described in "A" above. C) 28 pg recombinant RAP30 was
subjected to the same procedure as described in "A" above. D) SDS-PAGE (10 %
polyacrylamide) of some of the peak fractions indicated in "A", "B" and ”C" above.
Densitometry of this gel was used to estimate the stoichiometric relationship of RAP30 and
RAP7 4 subunits in the RAP30/74 complex. B) Estimation of the native molecular weight
of the RAP30/74 complex by comparison with native protein size standards (ovalbumin,
bovine serum albumin [BSA], E. coli DNA topoisomerase I, aldolase, ferritin and
thyroglobulin). Kav was calculated as Kav = (Vc - V0) / (Vt - V0), where V: a: sample

elution volume, V0 = column void volume, and Vt = total column volume. V0 was the -

elution volume of blue dextran dye.

ABSOIBANCB AT 2” III (RELATIVE SCALE)

3 menu. II' [3“)

 

 

85

A

Rammed RAP30!“

Rm 5

 

1.6

 

LI 1..

 

2.1 u
117ng

  

 

 

86
charged and acidic central domain (Finkelstein et al. 1992; Aso et al. 1992). Because of

this unusual domain structure, RAP74 may have an elongated shape that would cause it to
migrate more slowly than expected based simply on its molecular mass. In the absence of
RAP30, RAP74 eluted at 12 min 59 s (Figure 5B), consistent with a molecular weight of
470kDa. RAP74may formatetramerorhexamerinthe absenceofRAP30.

RAP30, freshly reconstituted from mea, is a dimer (18 min 32 s), but upon storage
forms high molecular weight aggregates. Some of these aggregates are indicated by peak 6
(Figure 5C). Formation of higher order aggregates of RAP30 and RAP74 may block re-
association of subunits to form the RAP30/74 complex unless urea is added to the
reconstitution bufier. ‘

Densitometric analysis of RAP30/74 subunits within the complex (Figure 5D; lane
5; peak 3), compared to RAP74 and RAP30 standards, gave a calculated mass ratio of
RAP74 : RAP30 of 2.1 : 1.0. Taking into consideration the molecular masses of RAP74-
H5 (59,319) and RAP30 (28,380), the stoichiometric ratio of these proteins in the complex
is 1.0: 1.0, most consistent with a molar ratio of 1 : 1 in the complex. This observation is
consistent with the expected <1sz structme. RAP74 was originally named for its apparent
molecular weight as indicated by SDS-PAGE. As inferred from DNA sequence, the
protein is much smaller than originally anticipated. The slow mobility of RAP74 can be
attributed to its highly charged amino acid composition and long acidic and basic tracts
(Finkelstein et al. 1992; Aso et al. 1992).

The RAP30/74 complex remains soluble when dialyzed into buffer containing 0.1
MKCl,butmuchofthefreeRAP30andessentiallyallofthefreeRAP74precipitatefrom
solution (Wang et al. 1993; data not shown). As a result, the reconstitution procedrne
described here also results in purification of the complex from free subunits. The complex
canbefm'therpmifiedon aMono Qcolumn.

87
Transcriptional activity of the RAP30/74 complex

A comparison was made between the transcriptional activity of human RAP30fl4,
recombinant RAP30/74 complex, and free recombinant subunits (Figure 6). An extract
derived from HeLa cell nuclei was depleted of RAP30 and RAP74 by immunoprecipitation
with anti-RAP30 and anti-RAP74 antibodies. This extract was completely inactive without
addition of RAP30 (lanes 13 and 15) and only weakly active without addition of RAP74
(lane 14). Other extracts made by this procedure have been completely dependent on
addition of both RAP30 and RAP74 to stimulate accm'ate transcription, so this particular
extract may not be completely depleted of RAP74. Alternatively, Since RAP74 has been
shown to be required for early elongation of transcription, rather than for initiation, the
small amount of RAP74—independent transcription observed may result from relaxed
control of early elongation (promoter escape) mediated by other transcription factors
(promoter escape factors) (Chang et al. 1993). The template for runoff transcription is the
AM promoter linearized with restriction endonuclease Smal at the +217 position relative
to the site of transcription initiation. -

Human RAPS (lanes 1-4), the recombinant RAP30/‘74 complex (lanes 5-8) and
separate RAP30 and RAP74 subunits (lanes 9-12) all stimulated accurate transcription
strongly. The human RAP fraction used in this assay was a mixture of factors including
RAP30/74, prepared as previously described (Sopta et al. 1985). An extract derived from
human HeLa cells was passed through a column containing covalently immobilized calf
thymus RNA polymerase II. After washing the column with bufi'er containing 0.1 M KCl,
the RAP fraction was eluted using buffer containing 0.5 M KCl (Sopta et al. 1985). The
concentration of RAP30/'7 4 complex in the human RAP fraction was estimated by
comparison to recombinant RAP30 and RAP74 standards on a silver-stained protein gel.
So far as can be determined, recombinant RAP30/74 complex is as active as human
RAP30fl4 using this assay. Since the human RAP fraction contains transcription factors in

addition to RAP30/74, both inhibitory and stimulatory factors could be added to the

88

Figure 6. Recombinant RAP30/74 has similar activity to human RAP30/74
for accurate transcription in vitro. A) 6 % polyacrylamide gel containing 50 %
(w/v) urea for analysis of +217 nucleotide runoff transcripts from the AdML promoter. B)
Quantitation of the data shown in "A". Lanes 1-15 contain an extract derived from HeLa
cells from which RAP30 and RAP74 were depleted by immunoprecipitation. Preparations
of RAP30 and RAP74 were added to this depleted extract to reconstitute the system. Lanes
1-4) a human RAP fraction estimated to contain 0.2, 0.4, 0.7 and 1.4 pmol human
RAP30/74 dimer (aB unit). Lanes 5-8) reconstituted RAP30/74 complex (0.6, 1.2, 2.5,
and 4.9 pmol RAP30/74 dimer). Lanes 9-12) RAP30 and RAP74 added separately (0.5,
1.0, 1.9, and 3.1 pmol each subunit). Lane 13) depleted extract with no additions. Lane
14) RAP30 (3.3 pmol). Lane 15) RAP74 (3.0 pmol). Lane 16) HeLa extract before
immunodepletiorr, normalized to the depleted extract by protein concentration.

89

WJVH
vulva
EIN

217 nt-

 

 

 

3

l 2345678910111213141516

 

 

100.4

 

um
i

50.

 

 

 

0 l 2 3 4 5
RAP30 and/or RAP74 (pmol)

ACCURATE TRANSCRIPTION (100%)

Figure 6

90
reaction in lanes 1-4, complicating the comparison. The simplest interpretation of this data,

however, is that reconstituted recombinant RAP30/7 4 complex is as active as human
RAP30” 4, and that immunodepletion of RAP30 and RAP74 does not efficiently remove
an additional required transcription factor(s). Separated RAP30 and RAP7 4 subunits are
not as active as reconstituted complex or human RAPS, probably because of aggregation
and precipitation of free subunits. Association with other transcription factors (i.e. RNA
polymerase 11) must enable active association of RAP30 and RAP74 when subunits are
added separately to the reaction, since RAP30 and RAP74 do not form the RAP30/7 4
complex when mixed by themselves in solution under non-denaturing conditions.

RAP74 and RAP74-H5 have indistinguishable activity for reconstitution of the
depleted extract (data not shown), indicating that the C-terminal histidine tag does not
interfere with transcription in vitro. Evolutionary conservation of the C-terminus of
RAP74, however, indicates that this sequence may have some function not detected using

this assay system.

91
DISCUSSION

Improved vectors have been constructed for production of human RAP74 in
bacterial cells. Since improvement was accomplished by substituting preferred E. coli
codons for human codons, this work demonstrates the importance of codon preference for
expression of human genes in E. coli. Additional improvement in these vectors could be
achieved by recoding other segments of the RAP 74 gene (Figure l), but such
improvements are unlikely to be cost effective. The vectors described here should be
suitable for high level RAP74 production for many biochemical uses, including
crystallographic analysis of RAP74 and the RAP30fl 4 complex.

Recoding can be a useful method to improve expression of a particular gene, but a
general approach to solve the codon incompatibility problem might improve the expression
of many eukaryotic genes in bacterial systems. For instance, an E. coli strain could be
constructed to overproduce the appropriate tRNAs to enhance translation of eukaryotic
mRNAs. BothAGAandAGGcodonscanberecognizedbytheargU(dnaY)geneproduct
of E. coli (anticodon UCU) (Brinkmann et al. 1989; Chen and Inouye 1990; Spanjaard et
aL 1990; Rosenberg et al. 1993; Garcia et al. 1986; Kiesewetter et a1. 1987), although
AGG is recognized by an additional tRNAArs (anticodon CCU) (Kiesewetter et al. 1987).
The wobble position of tRN AU is modified to enhance the specificity of A=U"' base
pairing, so it may be the un-modified form of tRNAU that reads AGG codons, and
overproduction of this tRNA may be necessary for it to efficiently read AGG (Brinkmann
et al. 1989; Spanjaard et al. 1990; Kiesewetter et al. 1987). Indeed, expression of some
eukaryotic genes is improved in E. coli strains containing a pACY C (ColEl origin
compatible) plasmid carrying the argU gene (Brinkmann et al. 1989). Whether
overproduction of the appropriate E. coli arginine tRNAs would have been successful to
improve RAP74 expression is not clear, since many sequence alterations in addition to

AGG and AGA codons were made in the recoded segment of the gene.

92
Denaturing conditions were employed during isolation of recombinant RAP30

(Wang et al. 1993), RAP74, and during reconstitution of the RAP30/74 complex. The
question ariSes, therefore, whether the preparations described here represent fully native
and functional conformations of these proteins. In accurate transcription assays,
reconstituted RAP30/‘74 functions similarly to human RAP30/'74 (Figure 6). The
reconstituted complex also has similar mobility to human RAP30/74 in gel filtration (Figure
5, references 3-5). Although separated RAP30 and RAP74 subunits aggregate and
precipitate at 0.1 M KCl, reconstituted RAP30/74 remains soluble as does human
RAP30/74.

The functional confOrmation of RAP30/74 is likely to be determined by protein-
protein contacts between subunits and also between subunits and other transcription
factors. Dming assembly of the pre-initiation complex, for instance, RAP30/74 must
contact RNA polymerase II (Sopta et al. 1985), TFIIB (Ha et a1. 1993) and other
transcription factors. During elongation, RAP30/74 must make specific protein-protein
contacts, and some transcriptional effectors may regulate transcription by interacting with
RAP30/74. Data presented in this paper is consistent with the view that interaction with
other transcription factors facilitates assembly of the active RAP30/74 complex in HeLa
extracts (Figrne 6). Binding RAP30 to RNA polymerase II, for instance, could facilitate
RAP74 binding to RAP30. The availability of large quantities of RAP30fl4 complex and
recombinant subunits should help to elucidate the structrne, function and important protein-
proteirr contacts of this transcription factor.

ACKNOWLEDGEMENTS

We thank C.-h. Chang for RAP30/74-depleted extracts. We thank J. De Rocher
for advice on primer design and gene synthesis.

93
REFERENCES

Abate, C., Luk, D., Gentz, R., Rauscher, E]. III and Curran, T. (1990) Expression and
pmification of the leucine zipper and DNA-binding domains of Fos and Jun: both Fos and
Jun contact DNA directly. Proc. Natl. Acad. Sci. USA 87, 1032-1036.

Aso, T., Vasavada, H.A., Kawaguchi, T., Germino, F.J., Ganguly, S., Kitajima, S.,
Weissman, SM. and Yasukochi, Y. (1992) Characterization of cDNA for the large subunit
of the transcription initiation factor TFIIF. Nature 355, 461-464.

Atkins, J.F., Weiss, RB. and Gesteland, RP. (1990) Ribosome gymnastics-degree of
difficulty 9.5, style 10.0. Cell 62, 413-423.

Bengal, E. Flores, 0., Krauskopf, A., Reinberg, D. and Aloni, Y. (1991) Role of the
mammalian transcription factors HF, [18 and IIX timing elongation by RNA polymerase 11.
Mol. Cell. Biol. 11,1195-1206.

Brinkmann, U., Mattes, RE. and Buckel, P. (1989) High-level expression of recombinant
genes in E. coli is dependent on the availability of the dnaY gene product. Gene 85, 109-
1 14.

Burton, Z.F., Killeen, M., Sopta, M., Ortolan, L.G. and Greenblatt, J. (1988) RAP30fl4:
a 6general initiation factor that binds to RNA polymerase II. Molec. Cell. Biol. 8, 1602-
1 13.

Chang, C.-h., Kostrub, CF. and Burton, Z.F. (1993) RAP30/74 (Transcription Factor
IIF) igrequired for promoter escape by RNA polymerase II. J. Biol. Chem. 268, 20482-
2048 .

Chen, G. -F. T. and Inouye, M. (1990) Suppression of the negative effect of minor
argininecodonson geneexpression; preferential usageofminorcodonswithinthefirst25
codons of the Escherichia coli genes. Nucleic Acids Res. 18, 1465-1473.

Ciccarelli, R.B., Gunyuzlu, P., Huang, J., Scott, C. and Cakes, ET. (1991) Construction
ofsynthetic genes usingPCRafterautomatedDNA synthesis oftheirentiretop andbottom
strands. Nucleic Acids Res. 19, 6007-6013.

Conaway, J.W. and Conaway, R. C. (1989) A multisubunit transcription factor essential
for accurate initiation by RNA polymerase II. J. Biol. Chem. 264, 2357-2362.

Conaway, R. C., Garrett, P., Hanley, LP. and Conaway, J.W. (1991) Mechanism of
promoter selection by RNA polymerase II: mammalian transcription factors a and By
promote entry of polymerase into the preinitiation complex. Proc. Natl. Acad. Sci. USA
88, 6205-6209.

Dillon, RI. and Rosen, CA. (1990) A rapid method for the construction of synthetic
genes using the polymerase chain reaction. BioTechniques 9, 298-299.

Finkelstein, A., Kostrub, C.F., Li, J., Chavez, D. P., Wang, B.Q., Fang, S.M.,
Greenblatt, J. and Burton, Z.F. (1992) A cDNA encoding RAP74, a general initiation
factor for transcription by RNA polymerase 11. Nature 355, 464—467.

94

Flores, 0., Maldonado, E. Burton, Z.F., Greenblatt, J. and Reinberg. D. (1988) Factors

involved in specific transcription by mammalian RNA polymerase 11: RNA polymerase II-

gsésgrcraotisng prgtseilél 30 rs an essential component of transcription factor IIF. J. Biol. Chem.
1 12-1 1

Flores, 0., Ha, 1., and Reinberg, D. (1990) Factors involved in specific transcription by
RNA polymerase II: purification and subunit composition of transcription factor IIF. J.
Biol. Chem. 265, 5629-5634.

Flores, 0., Lu, H., Killeen, M., Greenblatt, J., Burton, Z.F. and Reinberg, D. (1991)
The small subunit of transcription factor IIF recruits RNA polymerase 11 into the
preinitiation complex. Proc. Natl. Acad. Sci. USA 88, 9999-10003.

Garcia, G.M., Mar, P.K., Mullin, D.A., Walker, JR. and Prather, NE. (1986) The E
coli dnal’ gene encodes an arginine transfer RNA. Cell 45, 453-459.

Ha, L, Roberts, 8., Maldonado, E., Sun, X., Kim, L.-U., Green, M. and Reinberg, D.
(1993) Multiple functional domains of human transcription factor 11B: distinct interactions
with two general transcription factors and RNA polymerase II. Genes and Development 7,
1021-1032.

Izban, MG. and Luse, D. S. (1992) Factor-stimulated RNA polymerase II transcribes at
physiological rates on naked DNA but very poorly on chromatin templates. J. Biol. Chem.
267, 13647-13655.

Jayaraman, K., Finger, S.A., Shah, J. and Fyles, J. (1991). Polymerase chain reaction-
mediated gene synthesis: synthesis of a gene coding for isozyme c of horseradish
peroxidase. Proc. Natl. Acad. Sci. USA 88, 4084-4088.

Kephart, D. D., Price, M. P., Burton, Z.F., F'mkelstein, A., Greenblatt, J. and Price, D.
H. (1993) Cloning of a Drosophila cDNA with sequence similarity to human transcription
factor RAP74. Nucleic Acids Res. 21, 1319.

Kiesewetter, S., Fisher, w. and Sprinzl, M. (1987) Sequences of three minor tRNAsArs
fiom E. coli. Nucleic Acids Res. 15, 3184.

Kitajima, S., Tanaka, Y., Kawaguchi, T., Nagaoka, T., Weissman, S. and Yasukochi, Y.
(1990) A heteromeric transcription factor required for RNA polymerase II. Nucleic Acids
Res. 18, 4843-4849.

Parker, J. (1989) Errors and alternatives in reading the universal genetic code. Microbiol.
Rev. 53, 273-298.

Parvin, JD. and Sharp, RA. (1993) DNA topology and a minimal set of basal factors for
transcription by RNA polymerase 11. Cell 73, 533-540.

Rosenberg, A.H., Goldman, E., Dunn, J.J., Studier, F.W. and Zubay, G. (1993) Effects
of consecutive AGG codons on translation in E. coli, demonstrated with a versatile codon
test system. J. Bacteriol. 175, 716-722.

Sandhu, G.S., Aleff, R.A. and Kline, B.C. (1992) Dual asymmetric PCR: one-step
construction of synthetic genes. BioTechniques 12, 14-16.

95

Sopta, M., Carthew, R. W. and Greenblatt, J. (1985) Isolation of three proteins that bind
to mammalian RNA polymerase II. J. Biol. Chem. 260, 10353-10361.

Spanjaard, R.A., Chen, K., Walker, LR. and van Duin, J. (1990) Frameshift suppression
at tandem AGA and AGG codons by cloned tRNA genes: assigning a codon to argU tRNA
and T4 tRNAArs. Nucleic Acids Res. 18, 5031-5036.

Studier, F.W., Rosenberg, A.H., Dunn, J.J. and Dubendorff, J.W. (1990) Use of T7
RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60-89.

Tyree, C.M., George, C.P., Lira-DeVito, L.M., Wampler, S.L., Dahmus, M.E., Zawel,
L. and Kadonaga, J .T. (1993) Identification of a minimal set of proteins that is sufficient
for accurate initiation of transcription by RNA polymerase II. Genes and Development 7,
1254-1265.

Wang, B.Q., Kostrub, C.F., Finkelstein, A. and Btn'ton, Z.F. (1993) Production of
human RAP30 and RAP74 in bacterial cells. Protein Expression and Pmification 4, 207-
214.

Zawel, L. and Reinberg, D. (1993) Initiation of transcription by RNA polymerase II: a
multi-step process. Prog. Nucleic Acids Res. Mol. Biol. 44, 67-108.

Zhang, S., Zubay, G. and Goldman, E. (1991) Low-usage codons in E. coli, yeast, fruit
fly and primates. Gene 105, 61-72. .

CHAPTER IV
FUNCTIONAL DOMAINS OF HUMAN RAP74
INCLUDING A MASKED RNA POLYMERASE BINDING SITE

96

97
ABSTRACT

RAP74, the large subunit of human transcription factor IIF (TFIIF), has been
analyzed by deletion mutagenesis and in vitro assays to map functional domains. Tight
binding to the RAP30 subunit involves amino acids between positions 1-17 2. Amino acids
1-205 are minimally sufiicient to stimulate accurate initiation from the Adenovirus major
late promoter in vitro, although C-terminal sequences connibute to activity. A partially
masked RNA polymerase II binding domain has been mapped to the C-terminal region of
the protein (amino acids 363-444). Sequences at the N-terminus and within the central
portion of RAP74 regulate the accessibility of this domain. Extending this domain to 363-
486 creates a protein that binds polymerase tightly and inhibits transcription initiation in
vitro from non-promoter DNA sites. This larger domain binds RNA polymerase II and
DNA and may regulate polymerase interaction with template both during initiation and
elongation of RNA chains.

98
INTRODUCTION

Human transcription factor IIF (TFIIF) (RNA polymerase II-associatin g protein
(RAP) 30/74, FC, By in rat, Factor 5 in Drosophila, and factor g in yeast) is a general
factor with functions in both initiation and elongation of RNA chains (Sopta et a1. 1985;
Flores et al. 1988, 1990; Kitajima et al. 1990; Conaway et al. 1989; Kephart et al. 1993;
Henry et al. 1992; reviewed by Zawel and Reinberg 1993; by Conaway and Conaway
1993). The functions of the general factors will be understood based on their interactions
with template, transcript, and other protein factors, including RNA polymerase II, other
general factors, and regulatory factors.

TFIIF is structurally and functionally related to bacterial sigma factors. TFIIF is a
heteromeric factor comprised of 28 kD (RAP30) and 58 kD (RAP74) subunits that binds
directly to RNA polymerase II. The RAP30 subunit binds through a domain that is similar
in sequence to the polymerase binding domain of bacterial sigma factors. A masked DNA
binding domain in the C-terminal region of RAP30 shows additional structural similarity to
a DNA binding site of sigma factors involved in contacting the -35 region of bacterial
promoters, although the corresponding RAP30 domain is not known to confer promoter
recognition capability to RNA polymerase II (Ganett et al. 1992; Tan et al. 1994a).

Whether the RAP74 subunit can also bind directly to RNA polymerase II has not
been clearly established, although several observations in the literature indicate such a
possibility. RAP74 induces a gel mobility shift in a complex containing promoter DNA,
TBP, TFIIB, and RNA polymerase II in the absence of RAP30 (Tyree et al. 1993).
RAP74 can also stimulate transcription elongation by RNA polymerase II in a reaction on
3'-dC-tailed DNA templates in the absence of other factors (Kephart et al. 1994). At least

in the presence of template, therefore, RAP74 interacts with transcription complexes,

presumably by binding polymerase.

99
Binding of RAP30 to RNA polymerase 11 blocks association between polymerase

and non-specific DNA sites, a function also seen or originally observed in bacterial sigma
factors (Conaway and Conaway 1990; Killen and Greenblatt 1992a; Jaehning 1991;
Helmann and Chamberlin 1988). The RAP30/74 complex also dissociates polymerase
from DNA sites to which it was previously bound (Killeen and Greenblatt et al. 1992a),
and this is an additional similarity of this eukaryotic factor to prokaryotic sigma factors.
The RAP30 subunit by itself does not have this additional capability (Killeen and
Greenblatt et al. 1992a). Dissociation of polymerase from non-specific DNA sites
promotes association with promoters. In most in vitro systems, RAP30/74 must be present
to promote stable association of polymerase with the pie-initiation complex. The RAP30
subunit has partial function in polymerase entry (Flores et al. 1991, Killeen et al. 1992b),
although the RAP74 subunit stabilizes assembly and modifies interaction of RAP30 with
template in the pre-initiation complex (Coulombe et a1 1994).

I Several laboratories have reported minimal in vitro systems in which some of the
general factors become dispensible for accurate initiation from a promoter. Parvin and
Sharp (1993) reported that T'BP, T'FIIB and RNA polymerase II were sufficient for
accurate transcription from the Adenovirus major late promoter, using a supercoiled
template. Similarly, Usheva and Shenk (1994) denronstrated that initiator binding protein
YY1, TFIIB, and RNA polymerase II were sufficient for initiation from the P5 promoter of
Adenovirus-Associated Virus, using a supercoiled template. Tyree et al. (1993) detected
accurate initiation from several promoters in vitro using TBP, TFIIB, RAP30, RNA
polymerase II, and supercoiled templates. Supercoiling obviates the requirement of an
ATP-dependent step that involves TFIIE and T'FIIH (Goodrich and Tjian 1994; Timmers
1994; Maxon et al. 1994). TFIIH includes an ATP-dependent DNA helicase activity that
may function to separate DNA template strands dming promoter escape by RNA
polymerase II. Initiation from linear promoter DNA additionally requires TFIIF, TFIIE,
TFIIH, and hydrolysis of ATP (Wang et al. 1992).

100
The physiological meaning of these minimal systems is not obvious, but it is clear

that accm‘ate initiation can occur in the absence of some general factors and by slightly
difi‘erent mechanisms, depending on the factors present in the complex and the state of the
template DNA. In several systems the RAP30 subunit of TFIIF demonstrates initiation
functions independent of RAP74, particularly in assembly of the preinitiation complex,
although RAP74 can contribute to assembly (Flores et al. 1991; Killeen et al. 1992b).
RAP74, on the other hand, has been shown to have some elongation functions in the
absence of RAP30, although RAP30 also stimulates elongation in conjunction with RAP74
(Kephart et al. 1994). RAP30 has not been shown to stimulate elongation in the absence of
RAP74. In an extract system depleted of TFIIF by immunoprecipitation with anti-RAP30
antibodies, RAP30 was required for accurate initiation (unpublished observation). RAP74
did not stimulate initiation but was required for very early elongation of the transcript
(Chang et al. 1993). Not all extract systems that we have rmde behave in the same manner
in this respect. Other depleted extracts show a strong dependence on both RAP30 and
RAP74 for initiation (C.-h. Chang and 2. Burton, unpublished data). In extracts in which
RAP74 is required for initiation, the requirement for RAP74 forpromoter escape cannot be
demonstrated, because the factor must be added to the reaction before the promoter
clearance step. Although we have not been able to determine why extracts depleted of
RAP30audRAP74donotallfunctioninthesamemanner,thedataintheinitialreportis
clear. In the context of these assays, RAP74 was required for promoter escape by RNA
polymerase II. It is om' View that RAP30 and RAP74 have at least partially separable
functions in initiation and elongation of RNA chains. These separate functions are likely
influenced by interactions with other general factors and transcriptional regulators. Since
more defined systems lack both positive and negative regulators, extract systems will
continue to be of importance in identifying functions for the general transcription factors.
TFIIF interacts with TFIIB, and together these general factors cooperate to bring

polymerase into the pre-initiation complex (Flores et al. 1991; Conaway et al. 1991;

101
Buratowski et al. 1991; Ha et al. 1993; Buratowski and Zhou 1993; Sun and Hampsey

submitted). The RAP30 subunit interacts directly with TFIIB (Ha et al. 1993). TFIIB has
been implicated in transcriptional start site selection (Pinto et al. 1992). As discussed
above, RNA polymerase II, TFIIB, and either TBP or YYl can be sufficient for accurate
intiation from promoters in vitro (Pavin and Sharp 1993; Usheva and Shenk 1994). The
M7 mutant in the gene encoding yeast TFIIB is altered for selection of transcriptional start
sites (Pinto et al. 1992). Interestingly, the ssu71 mutant, in the gene encoding a yeast
RAP74 homolog, reverts normal start site selection in the sua7ssu7l double mutant (Sun
and Hampsey submitted). Thus, the small subunit of TFIIF interacts physically, and the
large subunit interacts genetically, with TFIIB. We have not been able to demonstrate a
direct interaction between human RAP74 and TFIIB using recombinant proteins (B.Q.
Wang and Z. Btu-ton, unpublished data). Based on these observations, there may be
significant coupling of TFIIF and TFIIB function in transcription. TFIIF has functions in
both initiation and elongation of RNA chains. TFIIB has known functions in initiation but
may have tmrecognized functions in elongation as well.

.In this report, we have used deletion mutagenesis to map functional domains of
human RAP74. We confirm the previous mapping ofthe RAP30-binding domain (Yonaha
et al. 1993). The regions of RAP74 that are required for accurate initiation in a depleted
extract system are strikingly different from those required in a more defined system
(Y onaha et al. 1993), and indicate interaction of RAP74 with both positive and negative
factorsintheextract. ApartiallymaskedRNApolymeraseIIbindingdomainhasbeen
identified on RAP74 by deletion of N-terminal sequences. This domain appears to have
additional functions in template binding and release of polymerase from non-specific DNA

sites.

102
MATERIALS AND METHODS

M oterr’als---01igonucleotidcs for constructing RAP74 mutants.
Oligonucleotides were as follows: NcoI-87, AAGTACGCCATGGTCCTCAA; NcoI-
363, CAGCCCI’CTCCATGGCGAA; I-IindIII-SIO, GAGAAGTGAAGCTTGTCGT;
HindIII-486, TCACTGTAAG CTTGCTGCTC; HindIII-452,
ATCCI‘CAGTAAGC’I‘TCACG; HindIII-444, GTPCGGTGTAAGCTI‘GCCTG; XhoI-
517, AACTCGAGCTCCTTGAGAGAGAAGTGCA (Wang et al 1993); and oligo-XhoI-
409 CCCAAGAGAGAGCGGAAGCC (coordinates 1179-1198 nt; Wang et a1 1993)

Construction of RAP74 mutant proteins with His6 at the C-terminus.
All of the mutants were constructed using pE'I‘23d vector to generate proteins containing a
six histidine extension at the C-terminus availing the purification using Ni-affinity
chromatography in the presence of 4 M urea as has been reported for wild type RAP74
(Wang et a1 1993). All of the mutants can react with polyclonal anti-RAP74 antiserum
except RAP74 (1236-258), RAP74 (258-356), and RAP74 (363-409), presumably due to
the absence of epitope. RAP74 (407-517) was constructed using an upstream primer
oligo-XhoI-409 (Wang et a1 1993), which is upstream of the XhoI-409 site, and a
downstream primer XhoI-S 17. The PCR product was digested with XhoI and gel purified
(QIAEX; Qiagen) to generate a DNA fragment encoding RAP74 (407-517). The purified
DNA fragment was then ligated into the XhoI site of the pE'I‘23d vector. RAP74 (87-517)
was constructed by PCR amplification using an upstream primer Neal-87 containing an
engineered NcoI site at amino acid 86 and a downstream primer XhoI-517 beyond the Sall
site of RAP74. The PCR product was digested with N001 and Sall and gel purified. This
RAP74 fragment was subcloned between the same sites on full-length pET23d/RAP74
containing a NcoI site at the start codon to generate pBDBd/RAP74(87~517). RAP74
(363-517) was constructed by PCR in the same way as (87-517) except using NcoI-363 as
upstream primer. RAP74 (363-510), (363-486), (363-452), and (363-444) were

103
constructed by PCR using Neal-363 as upstream primer and using I-IindHI-SIO, HindIII-

486, I-IindIII-452, HindIII-444 as downstream primers, respectively. The PCR products
were digested with NcoI and I-IindlII and gel pmified. These fragments were subcloned
between the same sites on the pET‘23d vector. RAP74 (363-409) was constructed by PCR
using Neal-363 as upstream primer and Xhol-517 as downstream primer. The NcoI and
Xhol digestion of the PCR product produces the DNA fragment encoding RAP74 (363-
409) since RAP74 contains an Xhol site at the amino acid 409 position. The generated
fragment was then subcloned between NcoI and Xhol sites on the pET23d vector. RAP74
(A136-258) was generated by PCR as described previously (Wang et a1 1994). All the
PCR amplifications were done using pET23d/RAP74 (Wang et a1 1993, 1994) containing
full-length RAP74 DNA as template. Other mutants were constructed using restriction sites
within the RAP74 sequence and corresponding sites within the polylinker of the pET23d
vector to generate in-frame fusions. To construct RAP7 4 (1409), a NcoI-Xhol DNA
fragment encoding RAP74 amino acids 1409 was inserted into the same restriction sites on
the pET23d vector. To construct RAP74 (1-356), recoded RAP74 expression vector
pET23d/RAP74NspV (Wang et a1 1994) was digested with StuI and Xhol and DNA ends
were filled in using Klenow DNA polymerase and all four deoxynucleoside triphosphates
(DNAendstreatedinthismannerarereferredtoas "filledin"). Thegelptnifiedvectorwas
then re-ligated to generate pET23d RAP74 (1-356). To construct RAP74 (1-296),
pET23d/RAP74 was digested with ApaI and Xhol and DNA ends were filled in. The gel
purified vector was then re-ligated to generate pET23dIRAP7 4 (1—296). To construct
RAP74 (1-205) and RAP74 (1-172), a NcoI-Fspl and a NcoI-anI DNA fragment
encoding RAP74 amino acids 1-205 and 1-172, respectively, were ligated into pET23d
vector prepared by digestion with NcoI and Xhol (filled in). RAP74 (1-136) was
constructed in the same way as RAP74 (1-356) except using pET23d/RAP74 instead of
recoded pET23d/RAP74NspV. RAP74 (1-75) was constructed by insert a NcoI-HindIII
DNA fragment encoding RAP74 amino acids 1-75 into the same sites on pET23d. To

104
construct RAP74 (74-517), pET23d/RAP74 was cut with HindIII and NaeI and was

Klenow blunted. This HindIII-NaeI fragment which contains DNA encoding RAP74
amino acids 74-517 and part of the vector DNA was inserted into Klenow blunted Sall-
NaeI sites on pET23d vector. To construct RAP74 (207-517) and RAP74 (358-517), a
FspI-Nael and a StuI-NaeI fragment of pET23d/RAP74 were inserted into Klenow blunted
I-IindIII-Nael sites on pET23d, respectively. RAP74 (A137-356) was constructed by
digesting pET23d/RAP74 with StuI and then re-ligating the gel purified vector. To
construct RAP74 (136-258), a PCR amplified recoded DNA fragment encoding RAP74
(1236-258) (Wang et a1 1994) was digested with NspV, Klenow blunted and inserted into
Klenow blunted NotI-Xhol of pET23d. To construct RAP74 (258-356), a StuI DNA
fragment encoding RAP74 amino acids 258-356 was inserted into Klenow blunted I-IindIlI
and Xhol of pET‘23d. In addition to the six histidine extension at the C-terminus of each
RAP74 mutant there are various other amino acid extension at one or borh terminus due to
the polylinker on pET23d vector. RAP74(l-409) and (363-409) have only an I-IHHHHH
tag at their C-termini. RAP74(1-356) and RAP74(1-296) have VEHHHI-lI-IH at their C-
terminus. RAP74(1-205), RAP74(1-172), RAP74(1-136) and the internal deletion mutants
RAP74(A136-258) and RAP74(A137-356) contain LEHHHHHH at the C-terminus the
same as that of the wild type. RAP74 (1-75) has AAALEHHHHHH at the C-terminus. All
of the N-terminal deletion mutants have the same C-terminal extension as wild type i.e.
LEI-IHHHHH, whereas their N-terminal extension varies slightly. RAP74(407-517) has
MASMTGGQQMGRIRINSSSVDKLAAA at the N-terminus; RAP74(358-517) has
MASMTGGQQMGRIRIRAPSTSS at the N -terminus; RAP74(207-517) has
MASMTGGQQMGRIRIRAPSTSC at the N-terminus; RAP74(87-517) has only one
amino acid M extended at the N-terminus. The internal fragments RAP74(136-258) and
RAP74(258-356) both have VEHHHHHH at their C-terminus and
MASMTGGQQMGRIRIRAPSTSLRP and MASMTGGQQMGRIRIRAPSTSS at their N-
terminus, respectively. RAP74 (363-510) and RAP74 (363-444) have

/ 105
LAAALEHHHHHH at their C—termini. RAP74 (363-486) and RAP74 (363-452) have

W at their C-termini.

RAP30 binding assays. RAP74 and the deletion mutants were tested for
their interaction with RAP30 using a nickel-chelate resin binding assay, in which RAP74
andmutantswitha6Histagwasimmobilizedontheresintotesttheabilityofthisaffinity
matrix to retain the un-tagged RAP30 (Wang et a1. 1993). About 24 ug of RAP74 or
mutants and 12 ug of RAP30 were mixed in 0.5 ml storage buffer (SB, contains 20 mM
HEPES, 2 mM DTT, 0.2 mM EDTA, 0.2 mM EGTA, 20% glycerol, and 0.1 M KCl.)
containing 4 M urea at room temperature for an hour and then renatured by dialyzing into
0.5 M KCl SB overnight. Next, each dialyzed mixture was combined with 20 ul of Ni-
NTA slurry (Qiagen) that was previously blocked with 0.5 ml SB containing 0.2% BSA.
The mixture was rocked for an hour at 4 0C and was subsequently washed with 1 ml SB
containing 0.5 M KCl for 3 times. The resin was eluted with 40 ul SDS sample bufi'er.
About 30 ul and 1.5 ul of eluate were loaded on SDS-PAGE for Coommassie blue staining
and western blot with anti-RAP30 antibody, respecfively. The efficiency of retention of
RAP30 on the nickel resin through binding to full-length RAP74 is about 35%. Simply
mixing RAP74-H6 mutants and RAP30 without denatming and renaturing together gives
the same results but with less strong binding between RAP30 and RAP74.

Accurate transcription assays. The method and system for in vitro
transcription used here are the same as previously described (Wang et al. 1993). About 5
pmol RAP30 was used in the assay. Increasing amount of RAP74 mutants, typically 0,
1.25, 2.5 and 5 pmol, were used.

RNA polymerase II binding assays. Nickel-chelate binding assays were
done similar to that described for RAP30 binding. About 12 ug RAP74 or mutants and 27
ug of calf thymus RNA polymerase II were mixed in 0.5 ml SB containing 0.2% BSA and
rocked at 4 0C for an hour. The mixtrnes were then combined with 20 ul of Ni-NTA

slurry that was previously blocked with 0.5 ml SB containing 0.2% BSA and was rocked

106
foranhourat4°C. Themixtures were thenwashedwith 1 ml SB for5 times. The resin

was finally eluted with 30 ul SDS sample buffer and loaded onto 16% SDS-PAGE. The
gels were stained with Coomassie blue. The efiiciency of retention of RNA polymerase II
on the nickel resin through binding to RAP74 (358-517) is about 25%. Immobilized
polymerase binding assays were done using immobilized calf thymus RNA polymerase II
affi-gel resin. Blank afi‘i-gel resin was used as control. 50 ul resin used for each binding
reaction was blocked with 0.5 ml SB containing 0.2% BSA by rocking at 4 0C for an
hour. About 500 pmol RAP74 or mutants were then mixed with the resin and rocked for
another hour at 4 °C. The mixtures were then washed with 1 ml SB for 5 times. The resin
was finally eluted with 40 ul SB containing 0.5 M KCl and loaded onto 16% SDS-PAGE.
The gels were silver stained.

General transcription assays. The general transcription assays were
performed according to Killeen and Greenblatt (1992a) with some modifications. The
template was adenovirus major late promoter (AdMLP) subcloned as an Xhol to HindIII
fragment (~256 to +196) into pBluescript 11 KS (+) (Stratagene) between the Xhol sites and
HindIII sites of the vector. However similar results were observed with template
containing no AdMLP. The reaction mixtures (20 ul) contained 16 mM I-IEPES (pH 7 .9),
3 mM MnClz, 0.16 mM EDTA, 16% glycerol, 0.7 mM DTT, 80 to 130 mM KCl, 250 uM
ATP, 250 uM CI'P, 250 uM GTP, 25 uM (5,5341) UTP (10 W1, 1 mCi/ml, 0.5 uCi
per reaction), 20 ug/ml template DNA, 50 pmol RAP74 protein and 5 pmol of calf thymus
RNA polymerase II. The reaction mixtures were incubated at 37 0C for an hour and
spotted on DE-81 filters (Whatman), which were then washed with 0.5 M NazI-IPO4 and
Scintillation counted (Sopta et al.). The results shown in Figure 4 are averages from
duplicate experiments and the errors are typically below 10% with the highest at 15%. To
test whether RAP74 has effect on initiation or elongation of RNA polymerase II,

polymerase was first mixed with reaction buffer at 37 0C for 15 minutes without RAP74

107
and four nucleotides. The foru' nucleotides were then added to the reaction mixttne and

RAP74 was added at indicated time.

DNA probe for Gel mobility shift assays. Oligonucleotide
CCT CGAGCGGTGT'TCCGCGGTCCTCCT CG harboring position -262 to -234 of
AdMLP as upstream primer and Oligonucleotide GCCCTCGCAGACAGCGA harboring
position +14 to +30 of AdMLP as downstream primer were used to amplify the DNA
fragment containing -262 to +30 of AdMLP by PCR. The pBSKS+lMLP was used as
template. The PCR product was gel purified by QIAEX kit from Qiagen and 5 pmol (960
ng) purified DNAwas labeled with (7-32P)-ATP by T4 polynucleotide ldnase. The 5'-
labeled DNA was then digested with resuiction enzyme HaeIlI to produce 72 bp 5'-1abeled
DNA probe containing -262 to - 191 fragment of AdMLP. The HaeIII digested DNA
mixturesweredirectlyusedasprobeforgelmobilityshiftassays.

Gel mobility shift assays. Gel mobility shift assays were performed
according to Conaway and Conaway (1990) and Killeen and Greenblatt (1992a) with some
modifications. The reaction mixtures (10 ul) contained 20 mM Tris HCl (pH 8.0), 24 mM
I-IEPES (pH 7.9), 2.4 mM DTT, 40 mM KCl, 11% glycerol, 0.5 mg/ml BSA, 25 fmol
labeled DNA probe, 0.09 pmol calf thymus RNA polymerase II and indicated amount of
RAP74. The reaction mixtures were incubated at 28 0C for 20 minutes and immediately
loaded onto 4% polyacrylamide gels containing 0.09% bisacrylamide, 2.5 % glycerol and
0.5x TBE. Electrophoresis was carried out in 0.5x T'BE at 30 mA for 2 hours. The dried
gelswere exposedtoKodakXARS film.

108
RESULTS

A comprehensive set of RAP74 deletion mutants was constructed and analyzed in
binding and functional assays (Figure 1). Wild type human RAP74 is a 58 kD protein
composed of 517 amino acids. For the most part, mutants are named according to the
amino acids remaining in the deleted structtue. For instance, RAP74 (87-517) extends
from amino acid 87 to 517 of the wild type protein. Some mutants have been constructed
with internal deletions, and these have been named according to the amino acids removed
from the sequence. For instance, RAP74 (A137-356) includes amino acids 1-136 fused to
amino acids 357-517 of the wild type protein. Mutant proteins were constructed with a C-
terminal histidine tag to facilitate purification and binding assays. In addition, some mutant
proteins have N-terminal extensions. The precise amino acid sequences of mutants are

given in Materials and Methods.

RAP30 binding domain of RAP74 .
The RAP30 binding domain of human RAP74 was previously mapped to amino
acids 62-172 by Yonaha et al., using a two-hybrid genetic system (Y onaha et al. 1993). In
the experiment shown in Figure 2, we confirm their result using a direct binding assay.
Deletion mutants of RAP74 with C-terminal histidine affinity tags were combined with full
length RAP30 in bufi‘er containing 4 M urea. Samples were dialyzed into bufi‘er containing
0.5 M KCl and no urea. Previous work in our laboratory had shown that this method was
efficient for reconstitution of the RAP30fl 4 complex (Wang et a1. 1994). This reaction
was mixed with Ni2+-ehe1ate resin to bind the affinity tag on RAP74 mutants. After
washing, proteins were eluted with SDS-PAGE sample buffer. Since RAP30 does not
carry the affinity tag, in order to bind to the resin, RAP30 must bind to a RAP74 fragment.

109

Figure 1. RAP74 deletion mutants. Amino acid sequences included in mutants are
indicated by white bars. Mutants were assayed for the following functions: 1) stimulation
of accurate transcription from the Adenovirus major late promoter, 2) binding to RAP30; 3)
binding to RNA polymerase II; 4) inhibition of general transcription by RNA polymerase
II; and 5) inhibition of polymerase binding to non-specific DNA. (+) indicates high
activity; (+/-) indicates weakly detected activity; (-) indicates no observable activity; (n.d.)
indicates that no determination was made for a particular mutant; (tx.) indicates

transcription; (bind) indicates binding; (Pol 11) indicates RNA polymerase II.

110

+3
+3

6.:
+3
+3

+
+3

6.:
6.:
+3
+3
+3
+3
+

.5 .326»
5:33:—

33 6.: 6.:
+ ...... ....e

+ 6.: 6.:
+ .2 e...
+ .véh i.e.:
+ 6.: 6.:
+3 - .
+3 +3 .
+3 +3 .
+3 +3 .
+3 +3 .
+3 . .
+ . .
+3 . -
- +3 .

o + t
+3 + +
+3 + +
+3 + +
+3 + +
+ + +
6:... 6:3 .5

= .eh ens—(~— 8a.:89<

 

 

 

 

 

 

 

_ oSwE

 

 

enmtncn

anthem
emntamu

anaem—

 

: 39594

 

a amnénflu

 

: 5min.

 

 

 

 

_ 53.5
53.5"
“Antwan
63.5..
n“ we.“

 

J emu.— .

 

N3.—

L

 

J mg.“

 

_ aut—

 

|_ 63%

 

_ $9.—

 

5m

4 5m.—

1 1 l
Eluted proteins were analyzed by SDS-PAGE and Coomassie blue staining (Figure 2A) or

by Western blot developed with anti-RAP30 antibodies (Figure 2B).

By this analysis, amino acids between 1-172 of RAP74 are important for RAP30
binding (lanes 2-7). Up to about 35% of the total RAP30 in the reaction was retained by
RAP74 mutants that bind RAP30 tightly (data not shown). Further deletion to amino acid
136 abolishes strong RAP30 binding (lane 8). Mutants 74—517 (lane 9) and 87-517 (lane
10) have very weak interaction with RAP30, indicating that sequences between 1-74 and
between 87-172 contribute to binding. Somewhat surprisingly, A136-356 also showed
very weak interaction with RAP30 (lane 16), confirming that at least part of the binding
domain is included between amino acids 137 and 172. The histidine affinity tag on RAP74
mutants was necessary for retention of RAP30 on the column, because RAP74 without the

tagdidnotretainRAP30(lane1).

Stimulation of accurate transcriptional activity

Acctn'ate runoff transcription initiated from the Adenovirus major late promoter was
assayed in vitro in an extract system depleted of RAP30fl 4 by immunOprecipitation with
anti-RAP30 and anti-RAP74 antibodies (Wang et al. 1993) (Figure 3). This system is
completely dependent on addition of RAP30 and RAP74 to reconstitute accurate
transcription. Depleted exuact, RAP30, and template DNA were mixed in the presence of
RAP74 or RAP74 deletion mutants. In this assay system, RAP74 stimulates both initiation
and elongation of the RNA chain, but the primary effect is on initiation (our unpublished
data). The accurate runoff transcript was quantitated using a phosphorimager. Since these
reactions are done in an extract system, factors that stimulate and inhibit transcription are
expected to be present that are not part of more pmified and defined systems. As a result,
domains of RAP74 may be dispensible in the extract system that are required for
transcription in more defined systems. One explanation for such an observation is that an

additional factor in the extract complements or replaces the function of an otherwise

112

Figure 2. The N-terminus of RAP74 is involved in RAP30 binding. ‘
I-Iistidine-tagged RAP74 (RAP74-H6) (lane 2) and RAP74 mutants (lanes 3-18) were
reconstituted with recombinant RAP30 in vitro, by dialysis from buffer containing 4 M
urea (Wang et al. 1994). The resulting complexes were selected on Ni2+ amnity columns,
which bind the histidine tag. Protein was eluted from the N12+ column with buffer
containing 1 % SDS. A) Polyacrylamide gel electrophoresis in the presence of sodium
dodecyl sulfate stained with Coomassie brilliant blue dye. B) Western blot developed with
anti-RAP30 antibodies. Recombinant RAP74 without a histidine tag was used in the

reaction shown in lane 1.

 

113

a seam

 

 

 

 

 

la—
..l t||.. "l'llll “fight;—
Inn
I3.
low
” IS.
an ha 0— mm v— n— N— = 0— a Q h 0 n v n N u S m
'
’
O
t. t. -
<mm --..S.--

 

9SE'851
892'90
95$ LCIV
857’” IV
LI S'LO'
LI S'QSC

 

 

114

Figure 3. Accurate transcriptional activity of RAP74 mutants. An extract
transcription system was depleted of TFIIF by immunoprecipitation with anti-RAP30 and
anti-RAP74 antibodies (Wang et al. 1994). Transcriptional activity was reconstituted by
addition of recombinant RAP30 and RAP74 or RAP74 mutants. The template contained
the Adenovirus major late promoter digested at position +217 relative to transcription
initiation. The 217 nucleotide runoff transcript was quantitated using a phosphorimager,
and accurate transcription reported as percent of the highest value determined in the
experiment. No accurate transcription was detected in the absence of added RAP74 (data

not shown).

115

3,”..me
”mafia—
wmnthn—fl
wmuén~<
:92.
and.”
53.38
59me
53.56
meta
emu.—
New.“
3N.—
wan.—
awn.—
36A
an;

H

l

++++iHHHH

 

m 95mm

:25: +532

 

 

1:3

 

 

ca

(%) NOLLJIHDSNVHJ. ELLVHDODV

1 16
necessary RAP74 domain. Similarly, sequences that are required for function in the extract

may be dispensible in more defined systems, for instance, because an inhibitory factor
present in the extract requires a RAP74 domain to counteract its effect. If this inhibitor is
missing from the more defined system, this domain may become dispensible for
transcription.

Full length RAP74 (1-517) appears to have higher activity than any of the deletion
mutants, although mutants 1-409, 1-356, and 1-296 also strongly stimulated transcription.
Further deletion to 1-205 caused a decrease in stimulation, and deletion to 1-172 abolished
stimulation. Apparently, sequences beyond the minimum RAP30 binding domain of amino
acids 1-172 are required for accurate transcriptional activity. That more than half the
molecule can be removed without full loss of activity is startling. A different conclusion
was reached with a more defined transcription system in which a 1-356 mutant was inactive
for accurate transcription (Y onaha et al.1993). Apparently, the extract system is more
tolerant of C-terminal deletions than the defined system, perhaps because a factor(s) in the
extract can complement the function of the RAP74 C-terminal domain.

In contrast, the extract system is very sensitive to N-terminal deletions. The 74-517
deletion is completely inactive in reconstituting the depleted extract system. Interestingly, a
similar mutant (73-517) was active in a more defined transcription system (Yonaha et
al.1993). indicating that a factor(s) in the extract establishes a requirement for the RAP74
N-terminus. Internal deletion mutants A136-258 and A137-356 are also inactive for
transcription, presumably because of deletion of required sequences between amino acids
172 and 205 and deletion of a portion of the RAP30 binding domain between amino acids
136-172.

A masked RNA polymerase II binding domain on RAP74
The RAP30 subunit of RAP30/7 4 (TFIIF) includes a polymerase binding domain
(S0pta et al. 1989; McCracken and Greenblatt 1991). RAP74 may itself be able to interact

117
with polymerase in the absence of the small TFIIF subunit. Two observations in the

literature led us to consider this idea. Tyree et al. (1993) observed that RAP74 could bind
to a complex of promoter DNA, T'BP, and TFIIB in the absence of RAP30. Kephart et al.
(1994) observed that RAP74 stimulated transcriptional elongation in the presence of only
RNA polymerase II and 3’-dC-tai1ed template DNA. To test for RAP74 interaction with
polymerase, in the absence of template and other factors, two binding assays were
employed. RNA polymerase II was combined with histidine-tagged RAP74 mutants and
tested for retention on a Ni2+ column (Figtu'e 4A). Results from these experiments were
confirmed by binding RAP74 mutants to affinity columns on which RNA polymerase II
was covalently immobilized (Figure 4B).

Full length RAP74 binds to RNA polymerase II, but not as tightly as some mutants
from which N -terminal sequences have been removed. In the binding data shown in
Figure 4A, polymerase binding is most easily scored by detection of the 180, 145, 36, 25
and 18.5 kD polymerase subunits (Hodo and Blatti 1977). Interestingly, two
polypeptides, 28 and 30 kD, co-purify with RAP74 mutants and polymerase, indicating
that these are polymerase-associated proteins. A polypeptide of 44 KD is likely actin
(Hodo and Blatti 197 7). Contaminants of the polymerase preparation are removed by
affinity-selection of the polymerase on immobilized RAP74. The mutants that bind
' polymerase most tightly are 358-517, 363-517, 363-510, 363-486, 363-452, and 363-444.
Ftn'ther deletion to 363-409 abolishes binding. Sequences between amino acids 363-444,
therefore, appear to be the most important for polymerase binding. A 407-517 mutant has
slightly reduced binding, and a 1-409 mutant has weak binding, indicating that portions of
theintelaction sitecanbefoundbothN-terminaltoaminoacid409andC-terminaltoamino
acid 407.

Accessibility of this C-terminal domain appears to be negatively regulated by
sequences within the central region and positively regulated by the N-terminus. The most
significant masking of polymerase binding is seen with RAP74 (87-517) and (207-517).

118

Figure 4. RAP74 has a masked RNA polymerase II binding domain near its
C-terminus. A) Polyacrylamide gel electrophoresis in the presence of sodium dodecyl
sulfate stained with Coomassie brilliant blue dye. 25 pg Calf thymus RNA polymerase II,
was mixed with 12 pg histidine-tagged RAP74 or RAP74 mutant, and complexes were
selected by Ni2+ affinity chromatography. Proteins retained on the Ni2+resin were eluted
with buffer containing 1 % sodium dodecyl sulfate. RNA polymerase 1] subunits retained
on the column are identified along the left side of the figure. B) Polyacrylamide gel
electrophoresis in the presence of sodium dodecyl sulfate stained with silver nitrate.
RAP74 and RAP74 mutants were tested for binding to a resin on which calf thymus RNA
polymerase II was covalently immobilized (upper panels) or a negative control column that
contained no protein ligand (bottom panels). HM) High molecular weight protein size
standards. LM) Low molecular weight size standards.

 

     

IJMISIGI‘IIII’LM

 

119

 

Figure 4

 

120
RAP74 (1-517), on the other hand, binds relatively tightly to polymerase. Since RAP74

(358-517) binds tightly to polymerase, sequences between 207 and 358 appear to be
responsible for masking polymerase binding by the C-terminal domain.

RAP74 fragments inhibit general transcription

Since RAP74 interacts with polymerase, binding might stimulate or inhibit
transcription. For these assays calf thymus polymerase was mixed with a supercoiled
plasmid template in the presence of all four nucleoside triphosphates. In the absence of a
full complement of accessory factors, polymerase initiates at many sites on the template.
Transcription was measured by incorporation of 3H-UMP into RNA, which was recovered
on DEAE filters and washed free of unincorporated 3H-UTP. RAP74 or RAP74 mutants
were added to the reaction and tested for their effect on polymerase activity.

Full length RAP74 and some RAP74 fragments were found to inhibit polymerase
activity 90-95 % (Figlu-e 5A). Some RAP74 mutants confer moderate inhibition on
polymerase (20-70 % inhibition), and others do not inhibit polymerase at all. Of the
RAP74 C-terminal fragments that bind polymerase tightly, 358-517, 363-517, 363-510.
and 363-486 inhibit general transcription strongly (> 75 %). Mutants 363-452 and 363-
444, that bind strongly, did not substantially reduce polymerase activity, indicating that
sequences from 452—486 are important for inhibition. Mutants 87-517 and 207-517, which
are reduced for polymerase binding but include the tight binding site, moderately inhibit
polymerase. Mutants 13136-258 and 'A137-356, which include the polymerase binding
region but from which internal sequences are removed that may regulate polymerase
binding, inhibited polymerase activity substantially (> 75 %).

Moderate inhibition was also seen with mutants 1-409, 1-356, 1-296, 1-205, and
136-258, none of which includes the proposed polymerase binding domain from 363-444.

In binding assays, however, each of these mutants was observed to interact weakly with

121

Figure 5. RAP74 inhibits general transcription by RNA polymerase II. A)
Calf thymus RNA polymerase II was mixed with supercoiled plasmid DNA in the presence
or absence of RAP74 or RAP74 deletion mutants. ATP, CTP, GTP and 3H-UT'P were
added and transcription continued for 1 hr. Incorporation of 3H-UMP into RNA was
quantitated on DIE-81 filters as described in Materials and Methods. Transcription initiation
is expected to occur from many sites on the DNA template in this experiment. a-Amanitin
was added at 1 rig/ml in a reaction otherwise identical to that shown in column 2. B)
RAP74 inhibits initiation of RNA chains. Calf thymus RNA polymerase II was added to
supercoiled plasmid DNA and incubated for 15 min (addition at t = -15 min). ATP, CI'P,
GTP and 3H-UTP were then added (t = 0 min) and RNA synthesis was continued for 1 hr.
RAP74 was added to reactions at t = -15, 0, 0.5, or 1 min. Once initiation occurs,
complexes become resistant to inhibition by RAP74. Values are reported as the average of
duplicate determinations. The variation between duplicates observed in these experiments
was typically less than 10 % and always less than 15%.

122

omnémm
wmuém—
wanna—4‘
wmn.en_<
mm;
men.—
can.—
own.—
2:..—
in.—
Eméev
3.19%
9318*”
«mvéom
owvtnen
e—méem
298m
:m.wmm
.2 WEN
53.5
3.9:.“ e:

 

5:52.576

 

2
1

A

. . . . u u q
M 0 o 0 0
oo 6 4 2

$3 sax—285:. 3.550

4|:
0

1 2 3 4 5 6 7 8 91.1133141516172021222324

 

+1

+0.5

-15

tion

           

 

 

o u I u q u q u —
0 0 0 0 0

2

l m 8 6 4 2

33 :etntomeafi. .2250

B

RAP74 Addition Time (min)

Figure 5

123
RNA polymerase 11 (Figure 4 and data not shown), indicating that a second polymerase

interaction domain may be located in the region between amino acids 136-258.

RAP74 appears to inhibit initiation in the general transcription assay. This is
indicated in the experiment in Figure 5B, in which polymerase was incubated with template
DNA for 15 min before addition of nucleoside triphosphates (NT'Ps), and transcription was
allowed to continue for 1 hr. RAP74 was added at the beginning of the pie-incubation (-15
min), coincident with NTPs (0 min), 30 s after NTPs, or 1 min after NTPs, as indicated in
the figme. Since RAP74 gives the greatest inhibition when added before NTPs, inhibition
is most likely exerted at the level of chain initiation. When RAP74 is added 1 min after
NTPs during a 1 hr elongation, no inhibition was observed, indicating that elongation was
not inhibited.

One possible mechanism for inhibition is that RAP74 prevents association of
polymerase with DNA. Killeen and Greenblatt (1992a) previously showed that
recombinant RAP30 can inhibit general transcription by RNA polymerase II, presumably
by preventing polymerase binding to template. RAP30 blocks polymerase binding to non-
specific DNA sites, and the RAP30/74 complex has the additional capability of releasing
polymerase from sites to which it was previously bound (Killeen and Greenblatt
1992a).'lhe RAP74 subunit, therefore, appears to have some functions that RAP30 does
not in blocking non-specific polymerase-template interactions. Perhaps, the polymerase
binding domain of RAP74 is involved in limiting such interactions. To test this idea,
RAP74 fragments were tested for their ability to inhibit non-specific DNA binding by
polymerase in a gel mobility shift assay.

Dynamic interactions between RNA polymerase II, RAP74, and DNA

Calf thymus RNA polymerase II can bind DNA non-specifically in a gel mobility
shift assay (Killeen and Greenblatt 1992a). In the experiment shown in Figure 6, the effect
of RAP74 on polymerase binding to DNA was tested. In Figure 6A, increasing amounts

124

Figure 6. Dynamic interactions between RAP74, RNA polymerase II and
DNA as indicated by a gel mobility shift assay. The DNA probe includes
sequences upstream from the Adenovirus major late promoter from coordinates -262 to
-191 (72 bp), 5'-end-labe1ed at position -262. A) RNA polymerase II (pol II; 0.09 pmol),
RAP74 (1-517) (0.17 to 1 pmol) and probe DNA were combined and electrophmesed, as
indicated. B) RAP74 (358-517) (0.12 to 1.4 pmol) or RAP74 (1-75) (0.25 to 2 pmol)
were added to similar reactions, as indicated.

 

125

 

pol II
R “'74

.17).” ..H .34 .SI .SI .68 . .85 .85 I l

RAP74/DNA

vlll'l).\‘,\— I .

p' . . . RAP74/DNA
l

 

B tzitssvsstourzuu
poll

R v\l’741358-5l7)
RAP'Htl-‘lSl

 

 

 

pom/mm- . . . . . . . . ._

 

 

 

Km 6

126
of RAP74 was added into a polymerase-DNA binding reaction. In the absence of

polymerase, RAP74 bound weakly to DNA (lanes 11 and 13), but in a reaction containing
both polymerase and RAP74, essentially all of the DNA probe was shifted in mobility
(lanes 8, 10, 12, and 14). Since the shift is dependent on borh RNA polymerase II and
RAP74, both of these proteins must influence the affinity of the other for DNA. An
expectation that we had in doing this experiment was that RAP74 might dissociate
polymerase fi'om DNA (Killeen and Greenblatt 1992a). In this experiment, however, it is
difficult to determine whether this has accrued Some of the shifted material appears to co-
migrate with DNA shifted by RAP74 alone (compare lanes 11 and 13 with lanes 12 and
14), indicating that polymerase may have been released from these complexes after
enhancing the affinity of RAP74 for the DNA. To clearly demonstrate this point would
require a specific antibody against polymerase for use in a supershift experiment, and this
reagent has not been so far available for this study.

Using one of the RAP74 mutants (358-517) that binds tightly to RNA polymerase
II, a slightly different result was obtained. In this case, much of the probe appears to be
supershifted in the presence of DNA, RAP74 (358-517), and polymerase (lane 12). The
RAP74 (358-517) mutant binds DNA strongly in the absence of polymerase, but shifts the
mobility only slightly. In the presence of polymerase, these complexes are shifted to a
slower mobility, but at least one of these complexes has a faster mobility than the shift
caused by polymerase in the absence of RAP74 (lane 2). It may be that polymerase has
been released from some of these complexes as well. When these experiments were done
with a mutant (1-75) that does not bind polymerase, as expected, no change in the mobility
shift caused by RNA polymerase II was observed.

127

 

t\\\\\\\\\\\\\\\\\\\\ '

 

I//////////////////l

 

1 172 205 353 363 M} 444486 517
- RAP30 binding

accurate transcription

phosphorylation by CKII

- RNA polymerase II binding

RNA polymerase II general transcription inhibition

Figure 7. Functional domains of human RAP74. See the text for details.

128
DISCUSSION '

The functional domains of human RAP74 are summarized in Figure 7. Amino
acids 1-172 are required for interactions with RAP30, and extending this domain to 1-205
creates a domain that is minimally sumcient to stimulate accurate transcription in an extract
system in vitro (Figtne 3). A different conclusion was reached by other investigators using
a more purified transcription system. In those experiments, amino acids 73-435 were
minimally required for transcription, indicating that the N-terminus of RAP74 is required
for transcription in extract systems but not in a more purified system, and a factor(s) in the
extractcan replace the function ofthe RAP74 C-terminal domain in transcription.

From data not shown in this report, we have located at least two casein kinase II
phosphorylation sites within the central domain of RAP74. This region has the appearance
of a regulatory hinge separating the N- and C-terminal domains, and perhaps
phosphorylation is important in regulating the function of these domains. RAP74 is known
to be highly phosphorylated in viva (Sopta et al. 1985).

A masked RNA polymerase II binding domain has been located between amino
acids 363-444 on human RAP74 (Figure 4). Extending this domain to 363-486 makes it a
potent inhibitor of the general transcriptional activity of RNA polymerase II in vitro (Figure
5A). This domain binds to DNA in a gel mobility shift assay and influences the affinity of
polymerase for DNA (Figm'e 6B). It is possible that this domain is involved in releasing
polymerase from non-specific DNA sites, although our data are not yet sufficient to
demonstrate this point clearly. Another potential function of this domain could be to
regulate polymerase contacts with template dming elongation of transcription. RAP74 can
stimulate elongation by RNA polymerase II in the absence of other transcription factors
(Kephart et al. 1994). Potentially the C-terminal domain of RAP74 could be involved in
both polymerase release from non-specific DNA and in stimulating polymerization, since

minimizing template contacts might accelerate elongation. Experiments are in progress to

129
test whether RAP74 mutants that contain the C-terminal domain stimulate elongation by

RNA polymerase II in the absence of other factors. Phosphorylation of the central domain
has not been observed to influence the accessibility of the C-terminal domain for
polymerase binding (data not shown). It will also be important in the future to determine
the sequences in the C-terminal region that are involved in making DNA contacts.

The amino acid sequence between positions 363-486 are conserved between human
RAP74, Xenopus RAP74, and to a lesser extent Drosophila Factor 5a (Finkelstein et al.
1992; A50 et al. 1992; Gong et a1. 1992; Kephart et al. 1993; Chapter I). This evolutionary
preservation of structure may indicate an important function for this protein domain, as is
also indicated by our data showing polymerase and DNA contacts are made by this region.
RAP74 (1-517) has a higher transcriptional activity than RAP74 (1409) (Figure 3),
indicating that this C-terminal domain influences accurate transcription in our extract
system, although this is a minor effect. Yonaha et al. (1993) showed that RAP74 (1-435)
had decreased activity compared to RAP74 (1-517), indicating that sequences between 435-
517 contribute to accurate transcriptional activity in the more highly pmified transcription
system (Yonaha et al. 1993). Further deletion to RAP74 (1-356) abolished activity in those
studies, demonstrating the importance of the sequence between 356—435 in the purified
system. This sequence includes most or all of the RNA polymerase II binding domain, but
is missing sequences required for inhibition of general transcription (Figures 4, 5, and 7).

Inspection of the sequence in this region of human RAP74 has not revealed obvious
clues as to which amino acids are most important for polymerase or DNA binding functions
(Figure 8). No obvious sequence similarities with other eukaryotic or prokaryotic
transcription factors, for instance, have been identified within this sequence. However, the
C-terminal amino acids 400-425 of RAP74 are weakly homologous to region 4.2 of E. coli
o70 as shown Figure 8A (Yonaha et al. 1993). This region of o70 is responsible for its
binding to the -35 promoter region (Helmann and Chamberlin 1988; Dombroski et al.
1992). Overlapped with amino acids 400-425 of RAP74 is another region containing

130

Figure 8. Alignment of human (h), Xenopus laevis (x), and Drosophila (d)
RAP74 sequences with E. coli 070 and S. cerevisiae Ssu71. Gaps, indicated
by dots, are introduced to give better alignment. Amino acids conserved among all species
compared are boldfaced. Amino acids conserved among two or more species are
underlined. Conserved amino acids are grouped as follows: (I, L, M, V), (H, K, R), (D,
E, N, Q), (A, G), (F, Y, W), (S, T) (Lesley and Burgess 1989). A) Alignment of RAP74
sequences with 070. B) Alignment of RAP74 sequences with Ssu7l based on
Hydrophobic Cluster Analysis (HCA) in C). C) HCA indicates two regions that are
conserved among hRAP74, xRAP74, dRAP74 and Ssu7]. Proline is symbolized by k ,
glycineby O ,serinebyE] ,andthreonineby D . Clustersofhydrophobicaminoacids
are boxed and hydrophobic alanines are circled. See DISCUSSION for details.

131

woe—am"— emc HzgaeHEHHn—mmauamfiammume 8c 2:3

m vm agenda—949% m H m 655%

ti 36 553% new 635:.
g ( g g
.31 “Wow/9 z; .339 9: «Ram:
m 9. no <u <9
m n n z .
e s... .nww. . . a H33 Se .2: wuaaaaouzo 2.. Penn
. WT; . In an: egg «on +25%
a 29.. a“... e2 26 gauging m: 22:."
_ _ _ SH 86 ESQ.“ m: 6552
8. 8.
e mme amgzmgm omcflqzmxnd 3:52xe nga: man henna
a w( 8m wag. .. ..mmoumque unconfined 322% SH 1:56
defuse 7.x e: ”5.9sz 23% nausea gamma 0: Ease.
“awe ea. . v: Huang... ..mmmmuuue 35553 quay-2.92% o: 3:52
seam

/m ..an . .. e :26 mmm $258on 3.52632 9.2969, 392.62%: «mm 2:3
an e . c3 gazed? mania“. gaugega e3 «$426
m2 «Hagen—«u dauuuauazu Huang.” :3 :35?
m2 magma can"??? gauge 2: 4252

Hmm Ewhflmmmn v—vzzudafl Gym—.3423 Eggmdxw «Hm :rsnm
wNH Mamas—.... Inga gnaw dag ma 3.”..ch

>7. 7.3.2 mm usudd 2%" gonna gamma cm :55?
Wwow: a“ an era: :33qu Sugars... egg 8 Enema
0 m Dm
awémw as: w. a Emmmx m
m a a .
“gammy TN came“ .0
_ _ _ can Hmu>g.z¢m>nm men 2b
... a. 5 m3 ..Huzxmmmemawe 3+ Emcee
+2. @5552 Zn 425:.
537“. ..t so. 59% c: 2.2%
a
Woody“ a N6 commoub
as .. abe. 3m geofia..§agmufi «5 2o
wow. u a... . e :32: m2. zxmgmawammzmaogaamflg m2. ".556
Guam: . ome gogfi m2. erase.
.__ "u muv gimaodugfin :3 +352
86 8'

 

O <

132
amino acids 416-429 that is weakly homologous to region 2.1 of 070 (Figure 8A). This

region of 070 is responsible for its binding to E. coli core polymerase (Lesley and Burgess
1989). Surprisingly, human RAP74 (363-444) binds tightly to E. coli core RNA
polymerase (data not shown). Based on this observation, we expect that a bacterial
initiation or elongation factor should share some structural similarity with RAP74, but so
far we have not been able to identify such a protein from E. coli. RAP74 functions are
reminiscent of bacterial Nus prorein function, for instance, but none of the known Nus
proteins appears to be very similar in structure to human RAP74.

The sequence between positions 458 and 481 includes a mixture of hydrophobic,
aromatic, and basic residues. Such a sequence might be important for interactions with
nucleic acids. Recently cloned S. cerevisiae RAP74 homolog, SS U 71 ITFGI , shows a
more distant relation.with human RAP74 in both the length and the composition of its
deduced amino acid sequence. Ssu7lp is 735 a long and has 21% identity and 45%
similarity to human RAP74 by bestfit sequence analysis. Moreover, S. cerevisiae TFIIF
homolog, factor g, is composed of three subunits instead of two (Henry et al. 1992),
indicating more divergence from other TFIIF counterparts identified to date. According to
hydrophobic cluster analysis (HCA) (Lemesle-Varloot et al. 1990), there are two regions,
approximately a 345-395 and aa 668-694 in the C-terminal half of Ssu7lp that form a
similar hydrophobic cluster pattern to human RAP74 in the regions a 95-146 and aa 458-
484, respectively (Figure SB and 8C). Based on hydrophobic cluster analysis and bestfit
analysis, the hydrophobic amino acid cluster pattern and sequences in these two regions are
also highly conserved with Xenopus, and Drosophila RAP74 (Figure 8B and 8C),
suggesting their structural and functional importance. According to our deletion
mutagenesis data, the first homology region (a 95-146 of RAP74) may be involved in
RAP30 binding, whereas the second homology region (a 458-484) may be involved in
nucleic acid binding.

133
ACKNOWLEDGEMENTS

We thank C.-h. Chang for RAP30/74-depleted extracts and Stephan Reymez for
calf thymus RNA polymerase II.

134
REFERENCES

Aso, T., Vasavada, H. A., Kawaguchi, T., Germino, F. J ., Gangelly, S., Kitajima, S.,
Weissman, S. M. and Yasukochi, Y. (1992). Nature 355, 461-464.

Burton, 2. F., Ortolan, L. G. and Greenblatt, J. (1986). EMBO J. 5, 2923-2930.

Burton, 2. F., Killeen, M., Sopta, M., Ortolan, L. G. and Greenblatt, J. (1988). Mol.
Cell. Biol. 8, 1602-1613.

Buratowski, 8., Sopta, M., Greenblatt, J. and Sharp, RA. (1991). Proc. Natl. Acad. Sci.
USA 88, 7509-7513.

Buratowski, S. and Zhou, H. (1993). Proc. Natl. Acad. Sci. 90, 5633-5637.
Chang, C., Kostrub, C. F. and Burton, 2. F. (1993). J. Biol. Chem. 268, 20482-20489.
Conaway, J. W. and Conaway, R. C. (1990). Science 248, 1550-1553.

Conaway, R. C., Garrett, K. P., Hanley, J. P. and Conaway, J. W. (1991). Proc. Natl.
Acad. Sci. USA 88, 6205-6209.

Conaway, R. C. and Conaway, J. W. (1993). Annu. Rev. Biochem. 62, 161-190.
Coulombe, B., Li, J. and Greenblatt, J. (1994). J. Biol. Chem. 269, 19962- 19967.

Dombroski A. J., Walter, W. A., Record, M. T., Siegele, D. A. and Gross, C. A. (1992).
Cell 70, 501-512.

Finkelstein A., Kostrub, C. F., Li, J., Chavez, D., Wang, B. Q., Fang, S. M.,
Greenblatt, J. and Btu-ton, Z. P. (1992). Nature 355, 464-467.

Flores, O., Maldonado, E. Burton, Z.F., Greenblatt, J. and Reinberg. D. (1988). J. Biol.
Chem. 263, 10812-10816.

Flores, 0., Lu, H., Killeen, M. T., Greenblatt, J., Btuton, 2. F. and Reinberg, D. (1991)
Proc. Natl. Acad. Sci. USA 88, 9999-10003.

Garrett, K. P., Serizawa, H., Hanley, J. P., Bradsher, J. N., Tsuboi, A., Arai N.,
Yokota, T., Arai, K., Conaway, R. C. and Conaway, J. W. (1992). J. Biol. Chem. 267,
23942-23949.

Gong, D. W., Hasegawa, S., Wada, K., Roeder, R. G., Nakatani, Y. and Horikoshi, M.
(1992). Nucleic Acids Res. 20, 6736.

Goodrich, J. A. and Tjian, R. (1994). Cell 77, 145-156.
Greenblatt, J. (1991). Trends Biochem. Sci. 16, 408-411.

Ha, L, Roberts, 8., Maldonado, 13., Sun, X., Kim, L. U., Green, M. and Reinberg, D.
(1993). Genes Dev. 7, 1021-1032. .

135
Helmann, J. D. and Chamberlin, M. J. (1988). Annu. Rev. Biochem. 57, 839-872.

51331;? N. L., Sayre, M. H. and Kornberg, R. D. (1992). J. Biol. Chem. 267, 23388-

Hodo, H. G. and Blatti, S. P. (1977) Biochemistry 16, 2334-2343.
Jaehning, J. A. (1991). Science, 253, 859.

Kephart, D. D., Price, M. P., Burton, Z.F., Finkelstein, A., Greenblatt, J. and Price, D.
H. (1993). Nucleic Acids Res. 21, 1319.

Kephart, D. D., Wang, B. Q., Burton, Z. F. and Price, D. H. (1994). J. Biol. Chem.
269, 13536-13543.

Killeen, M. and Greenblatt, J. (1992a). Molec. Cell. Biol. 12, 30-37.
Killeen, M., Coulombe, B. and Greenblatt, J. (1992b). J. Biol. Chem. 267, 9463-9466.

Lemesle-Varloot, L., Henrissat, B., Gaboriaud, C., Bissery, V., Morgat, A. and Mornon,
J. P. (1990). Biochimie 72, 555-574.

Lesley, S. and Burgess, R. R. (1989). Biochemistry 28, 7728-7734.

Maxon, M. B., Goodrich, J. A. and Tjian, R. (1994). Genes Dev. 8, 515-524.
McCracken, S. and Greenblatt, J. (1991). Science 253, 900-902.

Parvin, J. D. and Sharp, P. A. (1993). Cell 73, 533-540.

Pinto, I., Ware, D. E. and Hampscy, M. (1992). Cell 68, 977-988.

Schaeffer, L., Roy, R., Humbert, S., Moncollin, V., Vermeulin, W., Hoeijimaker, J. H.
J., Chambon, P. and Egly, J.-M. (1993). Science 260, 58-63.

Sopta, M., Carthew, R. W. and Greenblatt, J. (1985). J. Biol. Chem. 260, 10353-10361.
Sun, Z.-W. and Hampscy, M. (1994). Submitted to Nature.

Tan, 8., Garrett, K. P., Conaway, R. C. and Conaway, J. W. (1994a). Proc. Natl. Acad.
Sci. USA 91. 9808-9812.

Tan, 8., Aso, T., Conaway, R. C. and Conaway, J. W. (1994b). J. Biol. Chem. 269,
25684-25691.

Timmers, T. Th. M. (1994). EMBO J. 13, 391-399.

Tyree, C. M., Geoge, C. P., Lira-DeVito, L. M., Wampler, S. L., Dahmus, M. B.,
Zawel, L. and Kadonaga, J. T. (1993). Genes Dev. 7, 1254-1265.

Usheva, A. and Shenk, T. (1994). Cell 76, 1115-1121.

Wang, B. Q., Kostrub, C. F., Finkelstein, A. and Burton, Z. F. (1993). Protein Expr.
Purif. 4, 207-214.

136

Wang, B. Q., Lei, L. and Btnton, Z. F. (1994). Protein Expr. Purif. 5, 476-485.
Wang, W., Carey, M. and Gralla, J. D. (1992). Science 255, 450-453.

Yonaha, M., Aso, T., Kobayashi, Y., Vasavada, H., Yasukochi, Y., Weissman, S. M.
and Kitagima, S. (1993). Nucleic Acids Res. 21, 273-279.

Zawel, L. and Reinberg, D. (1993). Prog. Nucl. Acids Res. 44, 67-108.

APPENDICES

137
APPENDIX A

DROSOPHILA FACTOR 5A REPLACES RAP74 IN
ACCURATE TRANSCRIPTION BY HUMAN RNA POLYMERASE II

INTRODUCTION

Factor 5a, the RAP74 counterpart in Drosophila has been cloned and shown to be
very similar in its overall protein sequence to RAP74 (43% identity) (Kephart et al. 1993).
Like RAP74, F5a is also thought to consist of three domains: globular N- and C-terminal
regions, separated by a highly charged central region. The N-terminal region is the most
highly conserved area between the two proteins (51% identity). The C-terminal region also
has high sequence similarity between the two proteins (49% identity). To further our
understanding of the relationship between the structure and function of RAP74, we have
collaborated with Dr. David Price’s lab to test the ability of a chimeric factor consisting of
recombinant human RAP30 and recombinant Drosophila F5a to replace RAP30fl4 in 0m in
vitro transcription assay. In addition, a set of F5a deletion mutants (constructed in Dr.
Price’s lab) were tested to determine the structlnal features of the protein that are required
for accurate transcription by human pol II (Kephart et al. 1994).

MATERIALS AND METHODS

- Bacterial expression and purification of recombinant F5 a and deletion
mutant proteins. This was described by Kephart et a1 (1994).

Stimulation of accurate transcription by human RNA polymerase II.

The assay is essentially the same as described previously (Wang et al. 1993). The template

138
for runoff transcription was the adenovirus major late promoter (AdMLP) subcloned as an

Xhol to HindIII fragment (-256 to +196) into pBluescript H KS (+) (Stratagene) between
the Xhol sites and I-IindIII sites of the vector. This DNA was digested with Smal
endonuclease, which digests plasmid DNA within the polylinker just downstream of
HindIII. The runoff transcript is 217 nucleotides. A RAP30/74edepleted extract was
prepared as described in Finkelstein et al. (1992) except that,in this case, both anti-RAP30
and anti-RAP74 anti-sera were used for immunoprecipitation. RAP30/74wdepleted extract,
recombinant RAP30 and recombinant RAP74 or recombinant F5a (full-length or truncated,
as indicated in Figme 1) were combined with AdMLP DNA (30ug/ml) and preincubated
for 60 min. The pre-incubation reaction volume was 20 [11; reactions were incubated at 30

°C. Transcription buffer contained 12 mM Hepes pH 7 .9, 12 % glycerol, 60 mM KCl, 12
mM MgC12, 3.12 mM EGTA, 0.12 mM EDTA and 1.2 mM DTT. 600 M ATP, CTP,

UT'P and 25 M GTP (s trot/reaction (or-32p) GT'P) were added in 5 al. and transcription
elongation continued for 30 min. Reactions were stopped, phenol-chloroform extracted,
ethanol precipitated and electrophoresed as previously described by Burton et al. (1988).
Accurate transcription in Figme 1 was quantitated by scanning the gel using a Molecular
Dynamics Phosphorimager. A box containing the 217 nucleotide runoff transcript was
counted and a background box of the same area, immediately above or below the band,
was subtracted as a background estimate. The saturated accurate transcription achieved
with recombinant RAP74 was defined as 100%.

RESULTS AND DISCUSSION

In Figure 1, at the highest concentration of F5a analyzed (2.2 pmol), the
Drosophila protein was able to support accurate transcription at approximately 75% of the
level exhibited by RAP74 in the presence of RAP30. F5a (1-416) supported accurate
transcription at about 40% of the level of RAP74. F5a (1-291), F5a (1-148), and

139

Figure l. Drosophila F5a functions in accurate transcription by human
RNA polymerase II. The assay is described in Materials and Methods. 5 pmol of
RAP30 and increasing amounts of F5a or F5a deletion mutants were added to the reaction
as indicated. The highest activity observed with human RAP74 was defined as 100%.
(See details in Results and Discussion).

140

Gummav am."—
szrd ama—
Gaard am."—
Guvrd am...—
Amumruv amh

95¢;—

_ £de

3::—

3 m ¢

rem

.. 2:

 

 

 

(%) NOILJIHDSNVHJ. HLVHIIODV

141
F5a (85-575) supported accurate transcription at less than 10% of the level supported by

RAP74. These results indicate that F5a can substitute for RAP74 during transcription by
human pol II, and that the N-terminal region of F5a is critical for this function, which is
consistent with the results of the deletion analysis of RAP74 (Y onaha et al. 1993; Chapter
IV). RAP30/74 and RAP30/F5a can both stimulate transcription by Drosophila RNA
polymerase II (Kephart et al. 1994) indicating that this factor can function across species.
These results indicate that although F5a and RAP74 only share 43% arrrino acid sequence
identity overall, the structural information required for productive interaction with RAP30,
pol II, and other transcription factors has been highly conserved during evolution.

142
APPENDIX B

CASEIN KINASE II PHOSPHORYLATES THE
CENTRAL REGION OF RAP74

INTRODUCTION

RAP74 is highly phosphorylated in viva (Sopta et al. 1985). The role of its
phosphorylation is not known. Phosphorylation of protein has been shown to play an
important role in transcription and other biological processes. In order to better understand
phosphorylation of RAP74 and its effects, we mapped the phosphorylation region of
RAP74 by phosphorylating RAP74 deletion mutants in virra with casein kinase II (CKII).
CKII is a protein serine/threonine kinase found in all eukaryotic cells. Many substrates
have been identified for CKII in vitra and in viva, although the physiological relevance of
' the phosphorylation is not clear (Marshak and Carroll; Ge and Roeder 1994a and 1994b in
press; Kretzschmar et al. 1994). These substrates include many DNA replication proteins,
transcription factors, translation factors, oncoproteins and anti-oncoproteins.
Phosphorylation of these proteins has been found to either increase or decrease their
activities in vitro. The consensus phosphorylation sites of CKII are S‘fF‘XXE/DX .
Many of them contain a serine or threonine, followed by a cluster of at least three acidic
amino acids. A phosphorylated serine will substitute for an acidic amino acid in CKII
recognition, so phosphorylation of one site can porentially create a new CKII
phosphorylation site (Marshak and Carroll 1991). There appear to be 9 potential primary
and 8 secondary and tertiary CKII sites clustered in the highly charged central domain of
RAP74 between a 215-360 as shown in Figure 1A. Potential CKII sites also clustered
within similar region in Drosophila F5a and Xenapus RAP74. To map its phosphorylation

143
region, RAP74 and a series of deletion mutants have been tested for in vitro

phosphorylation by CKII and by human RAP fraction which was partially purified from
HeLa nuclear extract by calf thymus RNA polymerase II affinity chromatography.

MATERIALS AND METHODS
Construction of RAP74 deletion mutants. This was described in Chapter

Human RAPs. Human RAP fraction was purified from HeLa nuclear extract
using affinity column immobilized with calf thymus RNA polymerase 11 followed by an
cation exchanger, BioRex70 as previously described (Sopta et al. 1985).

In vitro phosphorylation assays. The reaction mixture (20 ul) contains 20
mM Mes (pH 6.9), 0.13 mM KCl, 10 mM MgC12., 4 mM DTT, 20 pmol 1 uCi [y-P32]
ATP, and 0.1 mU CKII (Boehringer Mannheim) or aim of human RAP fraction. The
reaction was incubated at 30 0C for twenty minutes and was stopped with SDS sample
buffer containing 100 uM cold ATP. The samples were then subjected to SDS-PAGE
followed by silver staining. The gel was dried and exposed to XAR 5 film for 20 minutes
without an intensifying screen. The autoradiographs of the SDS-PAGE are shown in
Figure 2A and ZB. Quantitation of this gel using a Molecular Dynamics Phosphorimager is
shown in Figme 2C. The phosphorylation achieved with full length RAP74 was defined
as 100% (i.e.approximately 2 moles Pi / mole RAP74).

RESULTS AND DISCUSSION
Figures 2A and 2C show that full length RAP74(1-517), RAP74(l-409),

RAP74(1-356), RAP74(1-296) can be intensely phosphorylated by CKII while RAP74(1-
205), RAP74(1-l72), RAP74(1-136), RAP74(l-75) cannot, consistent with our prediction

144
since these regions do not contain the predicted CKII sites. Figures 2A and 2C also show

that the C-ta'minal fragment RAP74(87-517) was more intensely phosphorylated than wild
type (200% of full length RAP74 phosphorylation), whereas RAP74(407-517) and
RAP74(356-517) cannot be phosphorylated. RAP74(A136-258) and RAP74(207-517)
still have strong but less intense phosphorylation compared to wild type. RAP74(A137-
356), in which the major portion of the predicted CKII cluster region has been deleted,
cannot be strongly phosphorylated. The internal fragments RAP74(136-258) and
RAP74(258-356), both of which contain part of the predicted CKII cluster region, retain
significant phosphorylation (22% and 33% of wild type, Figure 2C). RAP74(258-356)
has laddered bands of phosphorylation probably due to multiple phosphorylation patterns
and the reason is not clear.

CKII phosphorylation sites lie between amino acids 205-358 of RAP74, and a
phosphorylation site(s) lies N -terminal to aa 258 and another site(s) lies C-terminal to this
position (summarized in Figme 3). Although up to 17 potential CKII sites were predicted
for RAP74 (Figure 1), only two sites appear to be phosphorylated by CKII in vitro.
Quantitation of our SDS-PAGE gels indicates that two phosphates were incorporated per
RAP74 molecule. This is consistent with the observation that the mobility of
phosphorylated RAP74 is similar to the unphosphorylated form on SDS-PAGE. Since
RAP74(136-258), which contains sequence upstream of 258, and RAP74(258-356) and
RAP74(A136-258), which contain sequence downstream of 258, were only partially
phosphorylated, it seems likely that there is at least one phosphorylation site upstream of
258 and at least one site downstream. Serine-253 and serine-261 are likely candidates for
two CKII phosphorylation sites on RAP74 (Figure 1B). The region (a 246-265)
harboring these two sites is highly conserved with 80% identity among human, Xenapus
and Drosophila although the central domain of RAP74 is the least conserved region of this
protein (Figme lB; Kephart et al. 1993; Gong et al. 1993).

145

Figure 1. Potential casein kinase H sites in RAP74. A, human RAP74 protein
sequence. B, a highly conserved region in human (b), X enapus laevis (x), and Drosophila
(d) RAP74. Bold underlined serine residues repesent potential primary CKH sites.
Underlined serine residues represent potential secondary or tertiary CKH sites. See text for
details.

51
101
151
201
251
301
351
401
451

501

B

MAALGPSSQN
LSNKKIYQEE
RVNGKSGRKF
RHRTLTAEEA
KASELRIHDL
KGfiDDEAFED
VDEQSDSSEE
fiDIDSEASSA
LRAAASKLEQ
DVQVTEDAVR

NPERKMINDK

VTEYVVRVPK
EMPESGAGSE
KGIKKGGVTE
EEEWERRNKV
EDDLEMSSDA
SDDGDFEGQE
SBEEKPPEED
FFMAKKKTPP
GKRVSEMPAA
RYLTRKPMTT

MHFSLKE

146

NTTKKYNIMA FNAADKVNFA TWNQARLERD
FNRKLREEAR RKKYGIVLKE FRPEDQPWLL
NTSYYIFTQC PDGAFEAFPV HNWYNFTPLA
LNHFSIMQQR RLKDQDQDED EEEKEKRGRR
SDASGEEGGR VPKAKKKAPL AKGGRKKKKK
VDYMSDGSSfi,§QEEPESKAK APQQBEGPKG
KEEEEEKKAP TPQEKKRRKD SSBESDSSBE
KRERKPSGGS SRGNSRPGTP SAEGGSTSST
KRLRLDTGPQ SLSGKSTPQP PSGKTTPNSG

KDLLKKFQTK KTGLSSEQTV NVLAQILKRL

hrap74 246 xxxxxxespnaaraospncn 265

xrap74

254 KKKRK..8DDEALED§DDGD 271

drap74 281 KKKKKRDVDDEAFEESDDGD 300

Ffipnel

147

Figure 2. In vitro phosphorylation of RAP74 and its deletion mutants. A ,
phosphorylation by CK H. 5 pmol of different RAP74 proteins, 20 pmol luCi (7-32P)
ATP and 0.1 mU CK H are used. B, phosphorylation by the human RAP fraction. The
reaction condition is the same as in A except that 0.5 ul of RAP fraction was used in place
of CKH. C, quantitation of the gels in A and B. Activity achieved with full length RAP74
was defined as 100% which is approximately 2 moles Pi / mole RAP74. See Materials and
Methods for more details.

148

03%
5.3..—

Caren:
gin—«4
2 mtg

2 m.§
:mrnmn
:95

ms.—
0:.—
«2..
men.—
06".—
3n.-

8!.

2m.—

 

 

 

 

ll 12 13 I4 15 16

10

9

 

I CK II
I RAP!

 

 

 

 

:3 cots—feces...—

12 J 4 5 6 7 8 9|0|Il213l4|5|6

Figure 2

149

Figure 3. Summary of the phosphorylation of RAP74 deletion mutants by
CKH . Amino acid sequences included in mutants are indicated by white bars. (+-H»)
indicates 100% or higher than 100% activity; (++) indicates higher than 50% activity; (+)
indicates higher than 20% activity; (-) indicates less than 10% or no observable activity;
(n.d.) indicates that no determination was made for a particular mutant; and activity
achieved with full length RAP74 was defined as 100% which is approximately 2 moles Pi
/ mole RAP74.

150

6.:
+1.

58 B
zeta—.2332“—

magma

 

 

 

 

 

onmtwnm
anatom—

 

 

_ on???

 

 

 

 

 

 

_ ”harem—4V

EVE.
53.5
63.58
Smrwnn
53-86

H”. mm;

 

_ emu—t—

 

. NB-—

 

_ WONA

 

. com..—

 

own;

 

 

86.—

 

Sm

__aL_ L “-

Sn..—

151
Figures 2B and 2C show that human RAP fraction (Sopta et al. 1985)

phosphorylates RAP74 in the same region as CKII, implying that the human RAP fraction
containseitherCKHorakinasewith similarspecificity.

The result also indicates that the N-terminal region may negatively affect the
phosphorylation because deletion of as 1-86 (lane 12 in Figure 2) or binding of the N-
terminal region of RAP74 to RAP30 (data not shown) significantly increases
phosphorylation of RAP74.

The precise sites of in vitro phosphorylation of RAP74 by CKH are currently
being determined by mass spectrometry in collaboration with Paochi Liao and Dr. Doug
Gage at Michigan State University. Phosphorylated RAP74 is first digested with a
specific protease. Peptides are separated by HPLC and their mass determined.
Phosphopeptides are initially identified by mass shifts of 80 Da per phosphate from sizes
predicted from sequence. Treatment of phosphorylated peptides with alkaline phosphatase
gives a -80 Da mass shift (Liao et al. 1994). In future study, in viva phosphorylation
sitesofRAP74canbedeterminedandcomparedtosites labeledinvitrawith CKH. Ifthe
same sites are labeled in viva that are labeled in vitro, this will indicate the physiological
importance of a CKH-like kinase in regulating RAP74 function in living cells.

Recently, PC4, a human positive cofactor that functions cooperatively with TAFs
and mediates functional interactions between upstream activators and the general
transcription machinery has been cloned and characterized (Ge and Roeder 1994a;
Kretzschmar et al. 1994). PC4 can be phosphorylated by CKH both in vitro and in viva
through analysis by deletion mutagenesis and mass spectrometry (Ge and Roeder 1994b
in press; Kretzschmar et al. 1994) and phosphorylation inactivates the transcriptional
activity of PC4 in vitro. Now the availability of CKH phosphorylated RAP74 can allow
us to study the effect of phosphorylation on the activity of RAP74 in vitro. However,
phosphorylation of RAP74 with CKII does not appear to have significant effect on its
RNA polymerase binding activity or its CID phosphatase stimulating activity (see below).

152 '
Once a defined in vitro transcription system reconstituted with purified components is

available, the effect of CKH phosphorylation on the transcriptional activity of RAP74 can
be investigated.

The central domain of RAP74 has the appearance of a flexible hinge between
functional N -terminal and C—terminal domains. Phosphorylation of this "hinge" region
may influence the activity of N- and/or C-terminal domains.

153
APPENDIX C

C-TERMINAL DOMAIN or RAP74 STIMULATES '
CTD PHOSPHATASE ACTIVITY

INTRODUCTION

In this section, I discuss ongoing work in collaboration with Dr. Ross Chambers in
Dr. Michael Dahmus’ lab at University of California, Davis. In this work, a series of
RAP74deletionmutants describedinchapterIVwereusedtotesttheircapacityto stimulate
a CTD (C-terminal domain of the largest subunit of RNA polymerase H; Chapter I)
phosphatase activity ( Chambers and Dahmus 1994).

MATERIALS AND METHODS

Preparation of RAP74 deletion mutants. This was described in Chapter IV.
Preparation of CTD phosphatase. CI'D phosphatase was purified from HeLa cells
and was described by Chambers and Dahmus (1994).

CTD phosphatase assay. This was described by Chambers and Dahmus (1994) and
is explained below.

RESULTS AND DISCUSSION
The CID phosphatase assay was based on the electrophoretic difference between

the phosphorylated and unphosphorylated largest subunit of RNA polymerase H
(Chambers and Dahmus 1994; Chapter I). The phosphorylated largest subunit (IIO)

154

Figure 1. Summary of the stimulation of CTD phosphatase activity of
RAP74 deletion mutants. Amino acid sequences included in mutants are indicated by
white bars. (i-H) indicates 20 fold stimulation; (+) indicates 2.5 to 5 fold stimulation; (-)

indicates no observable stimulation.

155

+++

+++

+++

massage—... as
we seam—=53

_ use:

 

 

 

 

 

 

J

 

 

 

 

 

 

 

 

 

 

 

 

 

"F‘

in

wnmtwmm
aware»:

ommrhm~<
wnmémz

EVE.
Shrew
EVEN
S nrwnm
2 Whoa
2.-—
c2-—
NS-—

_ mom-—
com..—
0mm;
36A
Sn;

156
migrates with an apparent molecular weight of 240k, whereas the unphosphorylated largest

subunit (HA) migrates with an apparent molecular weight of 214k. The substrate (HO)
was prepared from purified calf thymus pol HA. It was first phosphorylated with casein
kinase H and 32p at a single serine residue five residues from the end of the largest subunit
for visualization on an autoradiogram. Subsequently, using a pam'ally purified CI'D kinase
from Hela cells, the CID repeats were phosphorylated in the presence of unlabeled ATP.
This shifts the SDS-PAGE mobility of pol H to the HO position. HO polymerase was
purified on a D1352 column to remove the CTD kinase and ATP. To assay CI'D
phosphatase activity, 32P-1abe1ed HO polymerase, CI‘D phosphatase, and RAP74 or
RAP74 mutants were combined in a final volume of 20 111 and incubated for 30 min at 30
°C. The reaction is stopped by adding SDS-PAGE sample buffer and run on 5% SDS-
PAGE. The gel was exposed on a phosphorimager and the HA subunit generated by CI'D
phosphatase was quantitated. Full length RAP74 (1-517) gives about 20-fold stimulation
of CPD phosphatase activity. RAP74(358-517) gives 5-fold, RAP74 (87-517) gives 2.6-
fold, RAP74 (74-517) gives 20-fold, RAP74 (A137-356) gives 20-fold stimulation. All
others were inactive. The results are summarized in Figure 1. RAP74 fragments that
stimulated CID-phosphatase activity contained the region 358-517. RAP74 (207-517) and
RAP74 (11136-258), however, contain this region but were inactive. Both of these
proteins contain portions of the central highly charged region 258-356. It seems that if this
central region is present then the N-terminal region 74-258 is also required to stimulate
CID phosphatase activity. CKH phosphorylation of RAP74 did not enhance stimulation of
CTD phosphatase activity.

157
FUTURE STUDIES

Since large amounts of purified, functional recombinant RAP30/'74 are now
available (Chapter HI), X-ray crystallographic studies to resolve the three-dimensional
structure of RAP30/74 have been initiated in collaboration with Peter Kosa in Dr. Paul
Sigler’s lab at Yale University.

Availability of CKH phosphorylated RAP74 (Appendix B) may allow us to study
the effect of phosphorylation on activities of RAP74 in vitro. The precise sites of in vitro
phosphorylation of RAP74 by CKH, as well as those of in viva phosphorylation will be
determined by mass spectrometry in collaboration with Paochi Liao and Dr. Doug Gage at
Michigan State University.

Construction of a comprehensive deletion set of mutants has given us some insight
into RAP74 functional domains (Chapter IV). These reagents should be useful to map
interactions between RAP74 and other components of the transcription machinery. Our
collaboration with Ross Chambers in Dr. Michael Dahmus' laboratory to study the effect of
RAP74 mutants on the activity of a CI‘D phosphatase is an example of this approach
(Appendix C). Recently, RAP74 has been shown to interact with serum response factor
(SRF) specifically and play an important role in SRF-activated transcription (Zhu et a1.
1994). RAP74 deletion mutants potentiallycould be usedtoanalyze this interaction. The 6
histidine tag attached at the C-terminus of all RAP74 mutants can facilitate binding assays
between RAP74 and other transcription factors using nickel-chelate resin. With the
comprehensive deletion mutagenesis data and RAP74 sequences from other species

available, more detailed mutagenic studies can now be contemplated.

158
REFERENCES

Btn'ton, Z. F., Killeen, M., Sopta, M., Ortolan, L. G., and Greenblatt, J. (1988) Mol.
Cell. Biol. 8, 1602-1613.

Chambers, R. S. and Dahmus, M. E. (1994) J. Biol. Chem. 269, 26243-26248.

Finkelstein A., Kostrub, C. F., Li, J., Chavez, D., Wang, B. Q., Fang, S. M.,
Greenblatt, J. and Burton, Z. F. (1992). Nature 355, 464-467.

Ge, H. and Roeder, R. G. (1994a). Cell 78, 513-523.
Ge, H. and Roeder, R. G. (1994b). Proc. Natl. Acad. Sci. USA in press.

Gong, D. W., Hasegawa, S., Wada, K., Roeder, R. G., Nakatani, Y. and Horikoshi,
M. (1992). Nucleic Acids Res. 20, 6736.

Kephart, D. D., Price, M. P., Burton, Z.F., F'mkelstein, A., Greenblatt, J. and Price,
D. H. (1993). Nucleic Acids Res. 21, 1319.

Kephart, D. D., Wang, B. Q., Bmton, Z. F. and Price, D. H. (1994). J. Biol. Chem.
269, 13536-13543.

Kretzschmar, M., Kaise, K., Lottspeich, F. and Meisteremst, M. (1994). Cell 78,
525-534.

Liao, P.-C., Leykam, J., Andrew, P. C., Gage, D. A. and Allison, J. (1994).
Analytical Biochem. 219, 9-20.

Marshak D. R. and Carroll D. (1991). Methods in Enzymology 200, 134-156.

831333, M., Carthew, R. W. and Greenblatt, J. (1985). J. Biol. Chem. 260, 10353-
1 1.

Wang, B. Q., Kostrub, C. F., Finkelstein, A. and Burton, Z. F. (1993). Protein Expr.
Purif. 4, 207-214.

Yonaha, M., Aso, T., Kobayashi, Y., Vasavada, H., Yasukochi, Y., Weissman, S. M.
and Kitagima, S. (1993). Nucleic Acids Res. 21, 273-279.

Zhu, H., Joliot, V. and Prywes, R. (1994). J. Biol. Chem. 269, 3489-3497.

HIC

141an Star: UNIV. LIBRRRIES
I ll W1 W III! ”I “1" II" "II W "I "NW 111 "I“ ll
31293014099133