 

PLACE ll RETURN BOXtoromovomthckouﬂomymncord.
TO AVOID FINES munmwhdmddoqlm.

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

MSU IDMMMWOMIW
W!

DEVELOPMENT AND CHARACTERIZATION OF A SUSTAINABLE CHICK CELL
LINE INFECTED WITH MAREK’S DISEASE VIRUS
By

Amin A. Abujoub

Submitted to
Michigan State University
in partial fulﬁllment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY
Department of Microbiology

1996

Professor Paul M. C oussens

ABSTRACT

DEVELOPMENT AND CHARACTERIZATION OF A SUSTAINABLE CHICK CELL
LINE INFECTED WITH MAREK’S DISEASE VIRUS

By

Amin A. Abujoub

Marek’s disease virus (MDV) is an oncogenic, highly infectious, cell-associated
avian herpesvirus. Fully productive MDV infections are restricted to feather follicle
epithelium of afﬂicted birds. In cell culture, MDV infection of primary chick and duck
ﬁbroblast cells is semi—productive. Passage of MDV and production of MDV vaccines
are limited to these primary cell systems. The limited life span of primary avian cell
cultures has hampered efforts to use positive selection in generation of recombinant MDV
and has complicated studies of temporal gene regulation.

We have developed a sustainable cell culture system (MDV OUZ) using the
nononcogenic, immortalized CHCC-OU2 chick cell line, which supports MDV
replication. Southern blot and PCR analyses demonstrated that these cell lines do harbor
MDV. MDV pp38 and pp14 expression was detected in sparse and conﬂuent MDV OUZ
cells by western blot analysis and HE A staining, but expression of MDV structural
glycoproteins (g8 and g1) were detected only in conﬂuent MDV OUZ cells. We also
demonstrate using RT-PCR that MDV latency associated transcripts (LATs) are

expressed at higher levels in sparse MDV OU2 cells than conﬂuent monolayers and LAT

Amin A. Abujoub
expression is down regulated in conﬂuent cells. MDV ICP4 expression was inversely
proportional to the level of MDV LAT expression. Presence of distinct plaques and
expression of glycoproteins in conﬂuent MDV OU2 cell monolayers is consistent with a
cytolytic infection. Whereas the pattern of MDV LAT/ICP4 expression, and lack of
glyc0protein expression in sparse MDV OU2 cells are consistent with a latent infection.
Data presented in this dissertation suggest that MDV OU2 cells are latent when
subconﬂuent and the virus is reactivated when cells become conﬂuent.

MDV OU2 cells are capable of transferring MDV infection to CEF in vitro and
can induce MD in vivo. PC R analysis and in vivo experiments also demonstrated that
MDV genomes are stabilized in this cell culture system. Unlike MDV passaged in CEF
cells, MDV OU2 cells are still oncogenic and can induce clinical symptoms of MD after

more than two and a half years in active continuous culture.

Copyright by
Amin A. Abujoub

l 996

To my Mother and Father for their love and support.

To my great wife Aida for her love and understanding.
and

to my great kids

Rawan, and Shadi.

ACKNOWLEDGMENTS

I would like to thank my mentor Dr. Paul M. Coussens, for his encouragement,
understanding, and ﬁnancial support. Special thanks to my guidance committee
members, Dr. Donald Jump, Dr. Richard Schwartz, Dr. Robert Silva, and Dr. Zachary
Burton, for their helpful comments and suggestions. I would also like to thank my lab
partners, it was fun working with you.

Last but not least, I would like to thank my wife Aida for her patience, love and

encouragement.

vi

TABLE OF CONTENTS

List of Tables ........................................................................................................................ x

List of Figures ..................................................................................................................... xi

List of Abbreviations .............................................................................................................. xii
Chapter 1.

Literature Review ......................................................................................................... 1

1 .1. Introduction ........................................................................................................... 2

1.2. History of Marek’s Disease ................................................................................... 3

1.3. Biology of Marek’s disease virus (MDV) ............................................................. 4

1.3.1. MDV classiﬁcation and virion structure ................................................ 4

1.3.2. MDV serotypes ....................................................................................... 5

1.3.3. MDV isolation ..................................................................................... 6

1.4. MDV vaccines ....................................................................................................... 6

1.5. Pathology and Pathogenesis .................................................................................. 7

1 .5.1. Virus-cell interaction .............................................................................. 7

1.5. l . 1 . Productive infection ................................................................. 8

1 .5. 1 .2.Non-productive infection ......................................................... 8

1 .5. l .2.1 . Latent infection ......................................................... 8

l .5.1 .2.2. Transforming infection ............................................. 9

1.5.2. Pathogenesis ........................................................................................... 9

1.6. Molecular biology of Marek’s disease virus ....................................................... 1 1

1.6.1. MDV genome structure ........................................................................ 1 1

1.6.2. MDV restriction maps .......................................................................... 13

1.6.3. MDV attenuation .................................................................................. 13

vii

1.7. MDV gene expression ......................................................................................... 16

l .7.1 . Immediate-early genes .......................................................................... 16
1.7.2. Early genes ........................................................................................... 17
1.7.3. Late genes ............................................................................................. 18
1.8. Status of Marek’s disease virus genomes ............................................................ 19
1.9. Latency ................................................................................................................ 20
1 .9.1 . Herpesvirus latency .............................................................................. 20
1.9.2. MDV latency ........................................................................................ 22
l .10. Objectives .......................................................................................................... 26
Chapter 2.
DEVELOPMENT OF A SUSTAINABLE CHICK CELL LINE
INFECTED WITH MAREK’S DISEASE VIRUS ................................................ 27
2.1. Abstract ............................................................................................................ 28
2.2. Introduction ......................................................................................................... 30
2.3. Materials and Methods ........................................................................................ 32
2.3.1. Cells and Virus ..................................................................................... 32
2.3.2. Preparation of cellular DNA, Southern blot analysis, and PCR ........... 33
2.3.3. Western immunoblot analysis .............................................................. 34
2.3.4. Inoculation of chickens with cells and virus ........................................ 35
2.4. Results ................................................................................................................. 36
2.4.1. Infection of CHCC-OU2 cells with Mdl 1p15 ..................................... 36
2.4.2. Detection of MDV DNA in infected CHCC-OU2 cells ....................... 37
2.4.3. Establishment of infected cell lines ...................................................... 38
2.4.4. Detection of viral proteins expressed in MDV OU2.2 cells ................. 39
2.4.5. MDV OU2.2 cells induce MD in susceptible chickens ........................ 40
2.5. Discussion ............................................................................................................ 42
2.6 .Acknowledgments ............................................................................................... 45
Chapter 3.

EVIDENCE THAT MAREK’S DISEASE VIRUS EXISTS IN
A LATENT STATE IN A SUSTAINABLE F IBROBLAST

viii

CELL LINE .............................................................................................................. 60

3.1. Abstract ................................................................................................................ 61
3.2. Introduction ......................................................................................................... 63
3.3. Materials and Methods ........................................................................................ 66
3.3.1. Cells and Virus ..................................................................................... 66
3.3.2. Preparation of Cellular DNA, and Polymerase chain reaction
(PCR) ..................................................................................................... 67
3 .3 .3. RNA isolation and Reverse Transcriptase PCR (RT-PCR) .................. 68
3.3.4. Inoculation of chickens with cells ands virus ....................................... 69
3.3.5. Indirect immunoﬂuorescence antibody (IIFA) staining ....................... 70
3.4. Results ................................................................................................................. 71
3.4.1. MDV is stably maintained in subconﬂuent MDV OU2 cells ............... 71
3.4.2. Detection of viral proteins by IIFA staining ......................................... 72
3.4.3. MDV LATs are expressed in sparse MDV OU2 cells ......................... 73
3.4.4. Serial in vitro passage does not cause attenuation of MDV
genomes in MDV OU2 cells ................................................................. 75
3.4.5. High passage MDV OU2 cells induce MD in susceptible
chickens ................................................................ 77
3.5. Discussion ............................................................................................................ 80
Chapter 4.
DISCUSSION .......................................................................................................... 103
4.1. Summary of results and conclusion ................................................................... 104
4.2. Future research .................................................................................................. 109
4.2. 1. Studying transcription patterns in sparse MDV OU2 cells ................ 109
4.2.2. Studying differential gene expression between sparse and
conﬂuent MDV OU2 cells ................................................................... 110
4.2.3. Studying the effect of 5-iodo-2-deoxyuridine and 5-azacytidine
on sparse MDV OU2 cells ................................................................... 1 10
4.2.4. Studying the status of viral genomes in MDV OU2 cells .................. 1 1 1
4.2.5. Studying cell cycle progression and expression of cells speciﬁc
proteins ................................................................................................. 112
REFERENCES ................................................................................................................... 1 15

ix

LIST OF TABLES

Table 2.1. Sequence of MDV-speciﬁc Oligonucleotide primers used in PCR
ampliﬁcation ..................................................................................................... 46

Table 3.1. Summery of IIFA and RT-PCR results ........ l ................................................... 86

LIST OF FIGURES

Figure 1.1. BamH I restriction endonuclease map ........................................................... 14
Figure 2.1. Monolayer of uninfected CHCC-OU2 cells .................................................. 48
Figure 2.2. PCR ampliﬁcation of MDV-speciﬁc sequences ............................................ 50
Figure 2.3. Detection of viral DNA in infected CHCC-OUZ cells .................................. 52
Figure 2.4. Western blot analysis for detection of speciﬁc MDV proteins ...................... 55
Figure 2.5. PCR ampliﬁcation of 850 bp pp38 gene segment ......................................... 57
Figure 2.6. Histological examination of kidney tissues ................................................... 59
Figure 3.1. Subconﬂuent and conﬂuent MDV OU2 cells ................................................ 88

Figure 3.2. IIFA staining with monoclonal antibody H19.47 speciﬁc for MDV pp38 ....90

Figure 3.3. IIFA staining with polyclonal antisera against MDV pp14 ........................... 92
Figure 3.4. IIF A staining with monoclonal antibody IAN 86 speciﬁc for MDV gB

homologue ....................................................................................................... 94
Figure 3.5. IIFA staining with polyclonal antisera against MDV gI homologue ............ 96
Figure 3.6. RT-PCR ampliﬁcation of a 335 bp fragment of MDV LATs and ICP4

gene ................................................................................................................. 98
Figure3.7. PCR ampliﬁcation of the 132-bp DR sequences .......................................... 100
Figure 3.8. PCR ampliﬁcation of an 850 bp of MDV pp38 gene .................................. 102

xi

ADOL

AGP

AVS
BHV
CEF
CHX
CKC
CPE
CS
DEF
DMSO
DR

E genes
EBV
EHV
FBS

FFE

LIST OF ABBREVIATIONS

Avian Diseases and Oncology Laboratory
Agar-gel precipitin

Avian leukosis virus
Avian sarcoma virus
Bovine herepsvirus
Chicken embryo ﬁbroblast
Cyclohexamide

Chicken kidney cells
Cytopathic effect

Calf serum

Duck embryo ﬁbroblast
Dimethyl sulfoxide

Direct repeat

Early genes

Epstein-Barr virus

Equine herpesvirus

Fetal bovine serum

Feather-follicle epithelium

xii

FITC

FPV
gB/C/D/E/I/K
HSV-l .

HVT

IE

IIFA

IRL

IudR
Kb
KDA

L genes
LATs
LM

MATSA

MDV
ND
Oct-1
PAGE

PBLs

Fluorescein-S'-isothiocyanate
Fowlpox virus

Glycoprotein B/C/D/E/I/K

Herpes simplex virus type 1
Herpesvirus of turkey

Immediate early

Indirect Immunoﬂuorescence antibody
Inverted repeat long

Inverted repeat short
5-iodo-2-deoxyuridine
Kilobasepairs

Kilo daltons

Late genes

Latenct associated transcripts
Leibovitz-LlS-McCoy 5A
Marek’s associated tumor surface antigen
Marek's disease

Marek's disease virus

Not determined

Octomer binding factor
Polyacrylamide gel electrophoresis

Peripheral blodd leukocytes

xiii

PCR
PE

PI

PI
ppl4/24/38
PRV
RT
SDS
TK
TPB
TRL
TRS
UL

US
USDA
VP16
vaDV

VZV

Polymerase chain reaction
R-phcoerythrin
Propidium iodide

Days post-infection
Phosphoprotein 14/24/38
Pseudorapis virus

Revesr Transcriptase
Sodium dodecyl-sulfate
Thymodine Kinase
Tryptose phosphate broth
Terminal repeat long
Terminal repeat short
Unique long

Unique short

Uinted State department of Agriculture
Virion protein 16

very virulent MDV

Varicella-zoster virus

xiv

Chapter 1

Literature Review

1.1 Introduction

Marek’s Disease (MD) is a highly contagious lymphoproliferative disease of
chickens, ﬁrst described in 1907 by a Hungarian scientist, Joseph Marek (Marek, 1907).
MD is oﬁen characterized by leg paralysis and lymphoid tumors (Payne, 1985). During
the early 1960's, it was discovered that MD was caused by an oncogenic cell-associated
herpesvirus, Marek’s disease virus (MDV), (Churchill and Biggs; 1967; Nazerian et al.,
1968; Solomon et al., 1968).

Prior to current vaccination practices, MD was responsible for tremendous losses
to the poultry industry. Since the 19705, MD has been effectively controlled by
vaccination with antigenically related, non-pathogenic, serotype 2 MDV strains, serotype
3 herpesvirus of turkeys (HVT), and attenuated serotype 1 MDV strains (Witter, 1982;
Witter and Lee 1984; Churchill et al., 1969; Powell, 1985). However, despite availability
of vaccines, signiﬁcant losses still occur. Frequent vaccine failures are attributed in part
to appearance of very virulent strains of MDV, presence of maternal antibodies, and poor
vaccination techniques. The continuous evolution of MDV strains and frequent vaccine
failures have promoted signiﬁcant interest in developing better methods for prevention
and control.

Like other herpesviruses, MDV has the ability to establish, maintain, and

reactivate from latency. This provides the virus with a unique ability to persist in its

3

natural host. MDV also offers a model for herpesvirus oncology in the natural host. MD
is the ﬁrst and only example of a naturally occurring malignant lymphomatous disease to
be effectively controlled by vaccination. However, despite being efﬁciently controlled by
vaccination, the molecular mechanisms of oncogenicity and vaccine-induced immunity
are still unclear.

Despite the tremendous importance of MDV in both economic terms and as an
excellent lymphoid tumor model in a natural host, characterization of MDV on the
molecular level has lagged behind other herpesviruses. However, recognition of MDV as
a model system for human herpesvirus induced neoplasia has promoted renewed interest

in this virus system.

1.2 History of Marek’s Disease

Marek’s disease (MD) ﬁrst described in 1907 (Marek, 1907), causes lymphomas
involving gonads, muscle, skin, and several visceral organs (Payne, 1982; Calnek and
Witter, 1991). The classical form of MD (characterized by impairment of neural function
and cytolytic infection (Payne 1985)) was reported sporadically from many countries
throughout the ﬁrst half of the 20th century. Early in the 1950's the ﬁrst acute case of
MD was reported in Delaware (Benton and Cover, 1957) and eventually spread
throughout the United States. The acute form of MD is marked by development of
lymphomas resulting in tumors, approximately four to six weeks post infection.
Production of live virus vaccines, in the early 1970's, resulted in a substantial decline in

the incidence of MD (Purchase, 1973). However, within the last 15 years, increased

4

disease outbreaks in vaccinated chickens has been noticed. These outbreaks are thought
to be due to either vaccine failure, appearance of very virulent strains of MDV, or poor

vaccination techniques (Witter et al., 1980; Schat et al., 1981).

1.3 Biology of Marek’s disease virus (MDV)

1.3.1 MDV classiﬁcation and virion structure

MDV has been designated Gallid herpesvirus 1 and provisionally placed in the
subfamily Gammaherpesvirinae of the family Herpesviridae (Matthews, 1979). The
nucleocapsid measures about 100 nm, has 162 capsomers arranged in icosahedral
symmetry (N azerian and Burmester, 1968), and is surrounded by an amorphus tegument.
MDV virions can be seen sometimes in the cytoplasm and, rarely, in the extracellular
space. The predominant form of MDV virions are naked capsids, usually found in nuclei
of infected cells. Only a subfraction of MDV virions are enveloped (Nazerian and
Burmester, 1968). However, MDV tumor cells and their cell line derivatives contain few
naked or enveloped virus particles. Enveloped virions are associated with the nuclear
membrane of MDV infected cells and are restricted to feather-follicle epithelium (FFE) of
infected chickens (Calnek et al., 1970). Enveloped virions are crucial for viral spread
under natural conditions. These enveloped virions are shed to the environment with
molted feathers or dander, and remain infectious for several months at 20 - 25 °C, thereby

passing the infection to other chickens.

1.3.2 MDV serotypes

MDV strains have been classiﬁed into three serotypes, based on agar gel
precipitation (AGP) and indirect immunoﬂuorescent antibody (IIFA) assays (Bulow and
Biggs 1975a and b; Schat and Calnek, 1978), virus neutralization tests (King etal., 1981),
and two dimensional polyacrylamide gel electrophoresis (PAGE) of viral polypeptides
(Van Zaane et al., 1982). Serotype classiﬁcation has been conﬁrmed by reactivity of viral
polypeptides with monoclonal antibodies (Lee et al., 1983), and by restriction enzyme
pattern analysis of viral genomes (Ross et al., 1983).

MDV serotype 1 consists of all oncogenic strains and their attenuated derivatives.
Serotype 1 MDV has been divided into very virulent (vaDV), virulent, and attenuated
strains based on their pathogenicity and oncogenicity in chickens. Md/5, Md/ 1 1, and
RBlB strains are all classiﬁed as vaDV and are responsible for causing many of the
outbreaks in vaccinated chickens (Witter, 1985). GA, and JM strains are classiﬁed as
virulent and can cause a high incidence of MD in unvaccinated chickens. Serial in vitro
passage of vaDV and virulent oncogenic MDV results in attenuation and loss of MDV
tumorigenicity (Churchill and Chubb, 1969). These attenuated strains can cause tumors
in only a few highly susceptible chickens (Schat, 1985). Serotype 2 consists of naturally
occurring, nononcogenic MDV strains, and serotype 3 consists of apathogenic (in turkeys

and in chickens), cell-associated, herpesvirus of turkeys (HVT).

1.3.3 MDV isolation

MDV replicates in a productive-restrictive manner in B-lymphocytes and cells
growing in tissue culture. Fully productive infections with MDV are restricted to feather
follicle epithelium where cell-free infectious virions may be readily isolated (Calnek et
al., 1970; Schat, 1985). Cell-associated MDV can be isolated from peripheral blood
leukocytes, spleen cells, kidney cells, and in the case of serotype 1, from lymphoma cells.
MDV can be propagated in monolayers of primary or secondary chicken and duck
embryo ﬁbroblast (CEF, and DEF, respectively), chick kidney cells (CKC) (Churchill
and Biggs, 1967), and CHCC-OU2 cells (Abujoub and Coussens, 1995). Cytopathic
effect (CPE), characterized by formation of spherical cells loosely attached to the
substratum and syncytia formation, occurs within 2-7 days post-infection. Due to the
strict cell-associated nature of the virus, no infectious cell-free virus can be recovered
from the tissue culture medium ( Calnek et al., 1970; Churchill and Biggs, 1967; Schat,

1985).

1.4 MDV vaccines
MDV is the ﬁrst example of a naturally occurring tumor virus that can be
effectively controlled by vaccination. Prior to development of vaccines against MDV,
20-30% mortality rates in commercial ﬂocks were common (Pattison, 1985). One of the
ﬁrst vaccines developed against MDV was an attenuated serotype 1 (Churchill et al.,
1969). However, the most widely used MDV vaccines in the United States are HV T

based vaccines (Purchase et al., 1971; Purchase et al., 1972; Okazaki et al., 1970). HV T

7

is particularly useful as a vaccine because vaccines can be made from either
cell-associated or cell-free preparation, and is apathogenic in chickens or turkeys (Payne,
1985). Serotype 2 MDV has also been used in vaccines against MDV ( Witter, 1992).
The predominant serotype 2 MDV currently in use is SB-l , which spreads readily by
contact and is protective against most virulent MDV strains (Bacon et al., 1989; Witter,
1985). 83-1 is commonly used in combination with HVT as a bivalent vaccine (Witter,
1992). The bivalent vaccine efﬁcacy exceeds that of HVT alone (Pruthi et al., 1989).
The pathogenicity of vaDV strains has promoted renewal efforts to develop more
efﬁcacious vaccines. One vaccine includes the attenuated very virulent serotype 1 strain
Md11/75c (Witter, 1982), and another attenuated virulent serotype 1 strain CV1 988
(Rispens et al., 1972). A trivalent vaccine containing HV T, 83-], and Md11/75c has

been shown to be 100% effective against challenge with vaDV (Witter and Lee, 1984).

1.5 Pathology and Pathogenesis

1.5.1 virus-cell interactions

MDV is contracted from the environment via the respiratory system (Payne,
1985). Once MDV enters a chicken, three virus-cell interactions are recognized: 1)
productive infection, 2) non-productive latent infection, and 3) non-productive
transforming infection (Schat, 1985; Calnek and Witter, 1991). These interactions may
produce two distinct pathological forms of MD: classical and acute. Classical MD
predominantly affects peripheral nerves and causes cytolytic infection. The acute form of

MD is marked by lymphoproliferation which results in tumor formation. The most

8

common clinical signs of MD are leg paralysis due to lymphocytic inﬁltration and nerve
demyelination. In addition, MDV can cause depigmentation of the iris, resulting in
blindness. Infected visceral organs, particularly the gonads, liver, and lungs, may have
diffuse or grayish-white lymphoid tumors (Calnek and Witter, 1991). In addition, severe
atrophy of the bursa of F abricius often occurs in infected chickens. The ﬁnal
pathogenesis of MDV infection is affected by many factors such as: virus strain and dose,

age, sex, genetic strain, and immune status of the host (Calnek and Witter, 1991).

1.5.1.1 Productive infection
Productive infections are cytolytic, and are characterized by viral DNA

replication, and viral antigen synthesis. Productive infection can be further divided into
productive-restrictive and fully-productive infection. A productive-restrictive infection
occurs mainly in B-lymphocytes, some epithelial cells, and in cultured cells. The virus
particles produced by these cells are naked nuclear virions, and infectivity remains
cell-associated (Calnek and Witter, 1991). Fully productive infection occurs only in
feather follicle epithelium, and results in production of a large number of enveloped cell-

free virions (Calnek et al., 1970).

1.5.1.2 Non-productive infection
1.5.1.2.1 Latent infection
Latent infections are detected at the end of early cytolytic infection. Latent

infection is predominantly in T-lymphocytes (Shek et al., 1983), but has also been

9

detected in B-lymphocytes (Calnek et al., 1981b). During latent infections MDV
genomes persist in cells with limited expression of viral genes (Maray et al., 1988;
Sugaya et al. 1990; Silver et al., 1979; Schat et al., 1989). Latent infections can persist
for the entire life of the bird without the production of infectious virus progeny, unless

the virus is reactivated (Dunn and Nazerian, 1977).

1.5.1.2.2 Transforming infection

In transformed cells, viral genomes persist in cells with limited transcriptional
activity. To date, no viral antigens have been associated with transformed cells, but an
activated T-cell marker, Marek’s associated tumor surface antigen (MATSA) is expressed
at a higher level in transformed cells (McColl et al., 1987). Transforming infection seems
to only occur in T-cells, since all lymphoblastoid cell lines are comprised of transformed
T-lymphocytes (Calnek and Witter, 1991). The majority of these T-cells, are activated
T-helper CD4" CD81 However, some of the cell lines established from experimentally
induced lesions are CD8+ and CD4' CD8' T-cells (Schat et al., 1991). The relationship
between latency and transformation is not well understood, but current evidence suggests

that latent infection is a prerequisite for malignant transformation and neoplastic disease.

1.5.2 Pathogenesis
Pathogenesis has been well deﬁned in experiments with MDV infections of
susceptible chickens. MDV infection can be divided into four stages: 1) early cytolytic

infection, 2) latent infection, 3) late cytolytic infection or permanent immunosuppression,

10

and 4) transformation. MDV infections usually occurs via the respiratory tract, where
MDV is phagocytized by macrophages (Calnek, 1985) and then disseminated from the
lung via lymphoid cells (Calnek and Witter, 1991). Early cytolytic infection, starts 3 to 5
days post-inoculation, and affects primarily B-lymphocytes, and to a lesser degree
activated T-lymphocytes. The cytolytic infection results in macrophage and granulocyte
inﬁltration of speciﬁc organs, which leads to necrosis and an inﬂammatory response. A
consequence of these events is spleen degeneration and atrophy of the thymus and bursa
of Fabricious.

The next stage of infection occurs 5 to 7 days post-inoculation when the infection
changes from a cytolytic infection of primarily B-lymphocytes to a latent infection of
predominantly T-lymphocytes (Shek et al., 1983). This switch is associated with
immunosuppression of the host. Latently infected T-cells can persist for the life of the
chicken. However, latent infection is not restricted to lymphoid tissues, but also includes
nonmyelinating Schwann cells and satellite cells in spinal ganglia (Pepose et al., 1981).

At 2 to 3 weeks post-inoculation susceptible chickens enter into a late cytolytic
infection. Lymphocytes are the target of this infection, which leads to a permanent
immunosuppression involving both humoral and cell-mediated immunity. During this
time, cells of epithelial origin become infected, and feather follicle epithelium starts
producing cell-free infectious virus (Calnek et al., 1970). Focal necrosis and intranuclear
inclusions can occur in the kidney, pancreas, blood vessels, peripheral nerves, and central
nervous system (Payne, 1992).

The ﬁnal stage of MDV pathogenesis is malignant transformation and neoplastic

11
disease. Massive lymphomas involving almost all visceral organs, skin, muscles and
nerves develop 4 to 6 weeks post-inoculation and, occasionally as early as 2 weeks
post-inoculation (Calnek, 1985). The composition of lymphomas is complex since they
contain transformed T-cells, inﬂammatory cells, and immunologically active cells
(Calnek, 1985). MDV infection at this stage has also been associated with atherosclerosis

in the coronary arteries, aorta, and aortic branches (Fabricant et al., 1978).

1.6 Molecular biology of Marek’s disease virus
Molecular biological characterization of MDV has lagged behind other
herpesviruses. Understanding the molecular biology of MDV has been hindered for three
main reasons: 1) MDV is a highly cell-associated virus, 2) MDV DNA has a buoyant
density similar to that of chicken DNA (Lee et al., 1971), and 3) there has been no
sustainable continuous cell line identiﬁed which supports MDV replication.
Consequently, the isolation of cell-free virus particles and pure viral DNA is difﬁcult and

the ability to test gene function is limited.

1.6.1 MDV genome structure

The genome of MDV is a linear, double-stranded DNA of approximately 160-180
kilobase pairs (kb) which is similar in size to Epstein-Barr virus (EBV) DNA but larger
than herpes simplex virus (HSV) DNA (Lee et al., 1971). The molecular weight of MDV
DNA is approximately 120 x 106 Daltons, whereas that of HVT and serotype 2 MDV

DNA is 103 x 10‘5 Daltons or approximately 150 kb (Hirai et al., 1979). Differences in

12

sedimentation coefﬁcients between sucrose and alkaline gradients has implied the
presence of single strand gaps or nicks in MDV DNA similar to that of other
herpesviruses (Wilkie, 1973; Lee et al., 1971). The buoyant density of MDV DNA in
CsCl gradients was determined to be 1.705 g/cm3, which corresponds to a 46% G+C
content (Lee et al., 1971).

MDV was originally classiﬁed as a garnmaherpesvirus based on its biological
characteristics, and the lymphotrophic nature of MD, similar to EBV (RoizmarLet al.,
1981). However, the overall genomic structure of MDV and the colinearity and
relatedness of MDV genes to those of alphaherpesviruses (varicella—zoster virus, and
herpes simplex virus), have led to reclassiﬁcation of MDV as an alphaherpesvirus
(Cebrian et al., 1982; Roizrnan, 1992; Roizrnan and Sears, 1991). The genomic
structure of MDV consists of unique long (UL) and unique short (Us) regions, with each
unique region ﬂanked by terminal repeats (TRL, TRS) and internal inverted repeats (IRL,
IRS) (Cebrian et al., 1982; Fukuchi et al., 1984). MDV genomes also contain several sets
of direct repeats (DRl to DRS), scattered throughout the genome. These direct repeat
sequences are located mainly within the repeat regions (Hirai, 1988). One of these direct
repeats (DR) has been correlated with attenuation of serotype 1 MDV. DRl is a 132-bp
direct repeat sequence located within both TRL and IRL. This 132-bp direct repeat
sequence is ampliﬁed from 1-3 copies in virulent MDV to more than 20 copies during
serial in vitro passage, coincident with virus attenuation and loss of MDV tumorigenicity
(Calnek et al., 1981; Silva and Witter, 1985; Fukuchi et al., 1985; Chen and Velicer,

1991; Maotani et al., 1986). DR2 is located within the UL region and consists of a direct

13

repeat of 1.4 kb. DR3 is located within TRS and IRL and consists of 178 bp (Hayashi et
al., 1988). DR3 is ampliﬁed more than 50-fold during viral replication in both oncogenic
and non-oncogenic MDV strains. DR4 is located within TRS, and IRS and consists of
200-bp (Hirai et al., 1984). DR5 is a putative terminal direct repeat at the end of MDV

DNA molecules and may contain signals for cleavage of MDV replicative forms.

1.6.2 MDV restriction maps

Physical maps have been constructed for all three MDV serotypes using different
restriction enzymes (F ukuchi, et al., 1984; Igarashi et al., 1987; and Ono et al., 1992).
Although the three serotypes of MDV share strong antigenic similarities, their restriction
endonuclease patterns are different (Figure 1.1). Based on reassociation kinetics, 5%
homology was detected between serotype 1 and serotype 3 MDV DNA (Hirai et al.,
1979). Only the BamHI I fragment of HVT hybridized strongly to MDV DNA under
high stringency conditions (Hirai et al., 1984). However, up to 70% DNA homology was
observed under low stringency (Gibbs et al., 1984). Direct DNA sequencing of several
genes in both serotypes (Chen et al., 1992; Ono et al., 1994; Smith et al., 1995) has

substantiated the higher homology ﬁgures.

1.6.3 MDV attenuation
Serial in vitro passage of virulent oncogenic MDV results in loss of MDV
tumorigenicity (Churchill and Chubb, 1969). Attenuated MDV fails to induce early

cytolytic infection, has reduced ability to infect or replicate in lymphocytes, and no

14

amp. 1 MDV
m

 

q—
—0—
HI-
q—
—0—
-0—

 

ll 11 1
II II T I III

“I"
=
un-

Figure 1.1 BamHI restriction endonuclease maps of (A). Serotype 1 MDV, (B). Serotype

2 MDV, and (C). Serotype 3 MDV.

15

longer has the ability to spread by contact (Schat et al., 1985). Attenuated MDV grows
faster than wild type MDV in cell culture, contains an altered genomic structure and size,
and displays reduced expression of glycoprotein C (gC) when compared to oncogenic
strains (Schat et al., 1985; Nazerian, 1980; Wilson et al., 1994).

Attenuation of MDV has been strongly correlated with expansion in the BamHI H
and D fragments (present in MDV TRL and IRL regions, respectively) (Calnek et al.,
1981; Silva and Witter, 1985; Fukuchi et al., 1985; Chen and Velicer, 1991). It was latter
discovered that expansion was due to ampliﬁcation of a 132-bp DRl sequence (Maotani
et al., 1986). Tumor induction studies in susceptible birds suggested that cloned virus
populations which exhibit an ampliﬁcation of the 132 bp repeat region have decreased
tumorigenic capability. In contrast, viruses which do not contain ampliﬁed BamHI H or
D regions efﬁciently induced tumors in chickens (Fukuchi et al., 1985). Another
structural difference between oncogenic and attenuated MDV is a 200 bp deletion in the
BamHI L fragment, located in IRL and TRL (Wilson and Coussens, 1991). However, in
vivo studies indicated that the 200 bp deletion of attenuated Mdll did not contribute
directly to MDV oncogenicity.

Expression of MDV gC is greatly reduced after serial in vitro passage of MDV
(Bulow and Biggs, 1975; Churchill et al., 1969; Ikuta et al., 1983; Nazerian, 1980; Silva
and Lee 1984; Wilson et al., 1994). Coincident with reduced gC expression, MDV
serotypes 2 and 3 lose vaccine efﬁcacy and serotype 1 becomes attenuated with respect to
oncogenicity (Calnek and Witter, 1991; Churchill et al., 1969; Silva and Witter, 1985).

Reduced gC expression in attenuated strains is not associated with structural changes

16
within the MDV genome, but rather due to reduced transcriptional efﬁciency (Wilson et
al., 1994). The precise mechanism responsible for decreased transcription of the gC gene

in attenuated MDV is not clearly understood at this time.

1.7 MDV gene expression
As with other herpesviruses, MDV genes have been classiﬁed into three temporal
classes, immediate-early (IE or a), early (E or [3), or late (L or y) genes, based on
requirements for viral protein synthesis or DNA replication (Honess and Roizman, 1974;

Nazerian and Lee, 1974; Schat et al., 1989; Maray et al., 1988).

1.7.1 Immediate-early genes

The earliest viral genes expressed, IE genes, are expressed immediately after
infection and do not require de novo viral protein synthesis. IE gene products activate
viral transcription and their transcripts accumulate in the presence of cycloheximide
(CHX), a protein synthesis inhibitor. The expression of IE transcripts is affected by
enhancer elements. For example, in HSV-l and probably in MDV, IE gene expression is
mediated by a virion-associated transcriptional activator (V P16) ( Boussaha et al., 1996;
O’Hare and Goding, 1988). VP16 itself does not bind DNA directly, but interacts with a
cellular octamer binding factor (Oct-1) through its cognate recognition sequences, which
includes nucleotides found just 5' of a TAATGARAT (R is purine) element found in
HSV-l IE gene promoters (O’Hare and Goding, 1988).

MDV IE gene products have been detected in infected cells by CHX reversal

17

experiments. Four MDV-IE genes have been identiﬁed which are clustered primarily in
the repeat regions (Schat et al., 1989; Maray et al., 1988),. One such gene MDV-ICP4
has been identiﬁed (Anderson et al., 1992) and is a homolog of HSV-1 ICP4. MDV ICP4
is located within the BamHI A fragment.

An MDV speciﬁc 14 kDa phosphoprotein (ppl4) encoded by a 1.4 or 1.6 kb IE
transcript has also been reported (Hong and Coussens, 1994). This protein is MDV
serotype 1 speciﬁc, and is transcribed as a spliced transcript from BamHI H and I2
fragments. Two other MDV IE transcripts corresponding to gK and ICP27 genes have
been reported (Ren et al., 1994). The function and the activity associated with these four
IE proteins remains to be determined, but in other herpesviruses IE proteins are usually

required for transcription of early genes.

1.7.2 Early genes

Early genes become active at approximately 3 hours post-infection and require the
activity of IE genes products. Early proteins are required for nucleotide precursor
metabolism and viral DNA synthesis (Roizrnan and Sears, 1991). Some MDV early
genes, such as thymidine kinase, DNA polymerase, and DNA binding proteins have been
identiﬁed by homology to HSV genes (Buckrnaster et al., 1988; Sui et al., 1995).

Several MDV speciﬁc early genes have been identiﬁed in repeats. One such
MDV speciﬁc early gene product is a 38-kDa phosphoprotein (pp3 8) that is transcribed
from the BamHI H fragment in the leﬁward direction (Cui et al., 1991; Chen et al., 1992)

as a 1.9-kb unspliced transcript (Cui et al., 1991). Since BamHI H is partially located in

18

the IRL (Figure 1.1), another gene which encodes a 24 kDa phosphoprotein (pp24) (Zhu
et al., 1994) has been found to be transcribed in the rightward direction from the BamHI
D fragment (partially located in the TRL, Figure 1.1) (Becker, et al., 1994; Zhu et al.,
1994). A third MDV speciﬁc gene, meq, encodes a protein with high homology to the
fosZirm family of oncogenes and is transcribed from the BamHI I2 fragment (located in
IRL)(Jones et al., 1992). Appearance of early proteins signals onset of viral DNA

synthesis, and subsequently induces late gene expression.

1.7.3 Late genes

Late gene expression requires both viral protein synthesis and viral DNA
replication (Wagner, 1991). While early genes encode proteins required for viral DNA
replication, late genes encode structural proteins required for virion, capsid, tegument,
and envelop assembly (Roizrnan and Sears, 1991). In HSV, eight glycoproteins, gB, gC,
gD, gE, gG, gH, g1, and gJ have been identiﬁed. HSV glycoproteins are involved in virus
attachment, penetration and cell-to-cell fusion (Roizrnan and Sears, 1991).

MDV contains several homologs of these HSV glycoproteins; gB (B-antigen)
(Ross et al., 1989), gC (A-antigen) (Coussens and Velicer, 1988; Isfort, et al., 1987), gD
and g1 (U S6 and U87, respectively) (Ross et al., 1991; Brunovskis and Velicer, 1995), gE
(U S8) (Brunovskis and Velicer, 1995), gH (Scott et al., 1993), gK (Ren et al., 1994), and
gL (Yoshida et al., 1994). Among these glycoproteins, g3 and gC have been studied at
the antigenic level. The gene encoding MDV gB has been mapped to the BamHI K3 and

I3 regions and its gene product is processed into a family of proteins known as gp100,

19

gp60, and gp49 (Chen and Velicer, 1991; Ross et al., 1989). Antibodies against MDV gB
can neutralize MDV in cell culture and a recombinant fowl pox virus (FPV) expressing
the MDV gB homolog provides 100% protection against Marek’s disease in vaccinated

chickens (Nazerian et al., 1992).

1.8 Status of Marek’s disease virus genomes

The status of MDV genomes differ between productively and latently infected
cells. It has been reported that in latently infected cells episomal forms of viral DNA,
exist exclusively (Tanaka et al., 1978; Hirai et al., 1981). Whereas Hirai et al. (1986),
reported the coexistence of episomal and integrated copies. Wilson and Coussens, 1991,
using pulsed ﬁeld electrophoresis, reported that MDV genomes are mostly linear in CEF
productively infected with low and high passage Mdl 1. In contrast, recent evidence
suggests that MDV genomes in six MDV lymphoblastoid cell lines and MDV tumors are
integrated into cellular chromosomes, but episomal forms also existed (Delecluse and
Hammerschmidt, 1993; Delecluse etal., 1993). MDV integration sites appear random,
but telomeres of large and mid-sized chromosomes appear to be preferential targets
(Delecluse and Hammerschmidt, 1993). Based on these observations and the fact that
EBV integrates in a number of Burkitt’s lymphoma cell lines, MDV DNA integration has
been hypothesized to play a major role in cell transformation, presumably by altering
cellular gene expression at the site of integration.

The DNA of several oncogenic viruses are methylated in non-producer cell lines,

but not in productively infected cells (Doerﬂer, 1981). The MDV genomes present in

20

MSB-l and RP-l lymphoblastoid cell lines have been shown to be methylated at sites
within the repeat regions (Kanamori et al., 1987). This was the ﬁrst report describing
methylation of MDV genomes in MDV lymphoblastoid cell lines and presents a possible
explanation for the limited MDV gene expression in these cell lines. Hyperrnethylation
of MDV DNA during latent infection may be a mechanism by which MDV regulates
transcription. Treatment of MSB-l cells with 5-azacytidine resulted in hypomethylation
of viral DNA, and increased mRN A transcription from the BamHI H region of the
genome (Hayashi et al., 1994 and 1995). Therefore, in transformed cells the low level of

transcription may be due to the hypomethylation of the viral genomes.

1.9 Latency
One of the most distinguish properties of herpesviruses is their ability to establish
life-long latent infections in their natural hosts (Rock, 1993). Latency has been deﬁned
clinically as the persistence of a virus in a host in the absence of overt, productive viral
infection. This virus/host relationship was initially described in vivo in the presence of a
host’s immune response. For most herpesviruses, these interactions cannot be studied in

vitro, in the absence of a host’s systemic inﬂuence.

1.9.1 Herpesvirus latency
Members of the herpesvirus family can be classiﬁed either as neurotropic or
lymphotropic, depending on the tissue type in which the virus establishes a latent

infection (Garcia-Blanco and Cullen, 1991). The precise mechanism by which

21

herpesviruses establish, maintain, and reactivate from a latent state are not known. Alpha
herpesvirus latency occurs primarily in neurons. Because neurons are nondividing cells
these herpesviruses do not need to replicate in order to maintain a latent state (Baichwal
and Sugden, 198 8). Betaherpesvirus can establish a latent infection in kidney, secretory
glands, lymphoreticular cells, and other tissues. Whereas garnmaherpesvirus latency is
conﬁned to lymphoid tissues (Roizman, 1991). Latent viruses must guarantee that copies
of their genome are transferred to daughter cells of dividing lymphocytes, even though
their genomes may not be integrated into the host chromosome.

Studies of the replication cycles of various herpesviruses suggest that latent
infections may result from an absence of host factors critical for the expression of viral
early gene products. Therefore, activation of these host factors in response to
extracellular stimuli can induce expression of these viral proteins and lead to reactivation
of latent infection to a lytic infection (Garcia-Blanco and Cullen, 1991). Latent infection
in most herpesviruses results in the transcription of a very restricted portion of the viral
genome. HSV establishes latent infections in neurons of sensory ganglia. A family of
transcripts, latency associated transcripts (LATs), which map antisense to an IE gene
(ICPO) and accumulate during latency, have been identiﬁed in nerve ganglia (F eldman,
1991; Spivack and Fraster, 1987; Stevens et al., 1987). In pseudorabies virus, which
establishes latency in trigeminal ganglia of swine (Beran et al., 1980; Gutekust, 1979),

LATs which map antisense to the ICP4 homolog have been reported (Priola et al., 1990).

2 2
1.9.2 MDV latency

Although MDV genomic structure is similar to that of alpha herpesviruses, latent
infection of MDV occurs primarily in lymphocytes, which is similar to the
gammaherpesvinrses (Payne, 1985). As noted earlier, MDV infection switches from a
lytic infection of B-lymphocytes to a latent infection of T-lymphocytes at about one week
post-infection, and persists in the host for its lifetime.

MDV transformed lymphoblastoid cells are immortalized cell lines which are
latently infected with MDV. These cell lines are usually capable of transferring MDV to
CEF or DEF in vitro and to susceptible chickens in vivo (Schat et al., 1985). MDV
transformed cell lines are divided into producer and non-producer cell lines, based upon
virus recovery and viral antigen expression. Producer cell lines are further divided into
expression and non-expression cell lines, based on the proportion of cells which express
viral antigens. Expression cell lines, such as MSB-l , contain cells expressing antigens
which can be detected by immunoﬂuorescence antibody (IIFA) assays. However,
non-expression cell lines, such as MKT—l, contain no or few cells expressing viral
antigens. Treatment of producer cell lines with 5-iodo-2-deoxyuridine (IudR) induces a
higher level of viral antigen expression. Producer cell lines can transfer MDV infection
to CEF and DEF in vitro and to susceptible chickens in vivo. In non-producer cell lines,
such as RP-l , viral antigens are not detectable and virus can not be rescued by co-
cultivation.

In MDV lymphoblastoid cell lines, expression of a limited set of viral genes has

been detected (Maray et al., 1988; Sugaya et al., 1990). Transcriptional activity is limited

23

to approximately 20% of the MDV genome, primarily the repeat regions and adjacent
sequences. However, different numbers of transcripts have been reported by several
groups using different MDV lymphoblastoid cell lines. Maray et al. (1988) reported 29
transcripts in MSB-l cells (an expression cell line). Whereas, Schat et al., (1989)
reported 4 and 7 transcripts in HPl (non-producer cell line) and CU41 (non-expression
cell line), respectively. Most transcripts found in MDV lymphoblastoid cells are from IE
genes (Silver et al., 1979; Schat et al., 1989), suggesting that IE genes could have a
signiﬁcant role in the maintenance of latency.

Consistent with transcripts identiﬁed in Northern blot analysis, four gene products
have been recently identiﬁed in MDV lymphoblastoid cell lines. A 38 kDa
phosphoprotein (pp3 8) was ﬁrst identiﬁed as one of three viral proteins (40, 38, and 24
kDa) detected by monoclonal antibody against a Agtll fusion protein (Silva and Lee,
1984). The gene encoding pp38 is located in the BamHI H fragment and is transcribed in
a leftward direction (Cui et al., 1991; Chen et al., 1992). The pp38 gene was identiﬁed as
a 1.9-kb transcript, and found to be transcribed as an B gene (Chen et al., 1992). The
pp38 gene product is localized in the cytoplasm of serotype 1 (oncogenic and attenuated)
infected cells (Silva and Lee, 1984; Cui et al., 1991; Chen et al., 1992), MDV
lymphoblastoid cell lines prior to (Chen et al., 1992) and following IudR treatment
(Nakajima et al., 1987), MDV OU2 cell lines (Abujoub and Coussens, 1995), and tumor
lesions of MD affected chickens (Nakajima et al., 1987). Even though pp38 cannot be
detected in MDV serotype 2 (Nakajima et al., 1987) or serotype 3 (N akaj ima et al., 1987;

Chen et al., 1992) infected cells, a pp38 homolog has been identiﬁed in MDV serotype 2

2 4
(Ono et al., 1994) and 3 (Smith et al., 1995). It is possible that the transforming ability of
serotype 1 MDV, may be attributed to a difference between the three MDV serotype pp38
genes. Another gene which encodes a 24 kDa phosphoprotein (pp24) ( Zhu et al., 1994)
has been found to be transcribed in the leftward direction from BamHI D fragment
(located in the TRL). The N-terminal 65 amino acids of pp38 and pp24 were found to be
identical (Becker, et al., 1994; Zhu et al., 1994), but the function of these two genes has
not been determined.

Another MDV phosphoprotein, ppl4, was identiﬁed and mapped to the BamHI H
and I2 fragments, within the IRL region of MDV genome (Hong and Coussens, 1994).
pp14 is transcribed as 1.6 kb spliced transcripts with IE kinetics. Similar to pp3 8, ppl4 is
expressed in the MDV lymphoblastoid cell line, MSB-l, serotype 1 (oncogenic and
attenuated) infected cells (Hong and Coussens, 1994, Hong et al., 1995), and in MDV
OU2 cell lines (Abujoub and Coussens, I995). The ppl4 gene product is localized to the
cytoplasm, and appears to be serotype 1 speciﬁc (Hong et al., 1995). Detailed mapping
studies and sequence analysis has revealed that pp38 and ppl4 share a promoter-enhancer
region (Cui et al., 1991). Organization of this region suggests that pp38 and pp14 form a
divergent transcription unit (Hong and Coussens, 1994).

A fourth gene, designated meq, encodes a protein with high homology to the
fos/jun family of oncogenes and is transcribed from the BamHI-I2 and EcoRI Q fragments
(Jones et al., 1992). meq encodes a 362 amino acid polypeptide and contains a basic
region and a leucine zipper domain. Using antisera raised against a synthetic peptide

corresponding to the leucine zipper region of meq, a 40 kDa protein was detected in the

2 5

RP4 MDV lymphoblastoid cell line (Jones et al., 1992). Recently, Qian et al., (1995)
reported that meq behaves like a transcriptional activator when fused to the GAL4 DNA
binding domain.

As mentioned earlier, LATs which map antisense to IE genes have been described
for many herpesviruses. Recently, a series of mRNAs mapping antisense to the MDV
ICP4 gene (MDV LATs) have been detected in various MDV lymphoblastoid cell lines
(MSB-l, RPLl , and MKT—l cells) (Cantello et al., 1994; Li et al., 1994; Mckie et al.,
1995). LATs are a family of transcripts that may represent processing products of a
lO-kb RNA (Cantello et al., 1994). LAT transcripts appear to be expressed at higher
levels in lymphoblastoid cell lines (MSB-l and RPLI) and are down regulated in lytically
infected cells (Li et al., 1994). It has been postulated that antisense ICP4 transcripts may
regulate expression of MDV genes, and are therefore important for maintenance of the
latent state. MDV LAT expression in MSB-l and RPLl is relatively high compared with
ICP4 expression (Cantello et al., 1994; Li et al., 1994). However, upon virus reactivation
induced by adding IudR to MSB-l cells, steady state ICP4 RNA levels increased and
MDV LATs expression decreased (Cantello, et al., 1994). MDV LATs expression was
not detected early in lytic infection, but MDV LAT expression was relatively high at later
times during lytic infection (140 hours post-infection) when CEF cells were older and
possibly depleted of some necessary cellular factors required for lytic infection (Cantello
et al., 1994). Although it is possible that MDV LATs play a role in maintenance of

latency, deﬁnitive evidence is still lacking.

26

1.10 Objectives

Two major difﬁculties in working with MDV are the strongly cell associated
nature of the virus and lack of a sustainable cell culture system amenable to productive
(lytic) infections. Primary CEF and DEF cells are permissive for MDV replication.
However, these cultures have a ﬁnite life span (approximately 3 weeks), thus requiring
passage of infected primary cells onto an uninfected cell monolayer to propagate MDV
and to obtain sufﬁcient quantities of virus with which to work. Such conditions also
preclude establishment of one-step growth experiments for effective temporal gene
regulation studies. The ﬁnite life span of CEF and DEF also make positive selection in
mutagenesis studies difﬁcult. The main objective of this study is to develop a sustainable
chick cell line system, which supports MDV growth and replication. Development of a
continuous cell line which will support MDV replication would alleviate many of the

difﬁculties associated with MDV experimentation and vaccine production.

Chapter 2

Development of a sustainable chick cell line infected .with Marek's disease virus
Amin Abujoub' and Paul M. Coussens“2
Molecular Virology Laboratory, Departments of Microbiology',
and Animal Science2

Michigan State University, East Lansing, MI 48824

This work has been published in Virology 214:541-549 (1995).

27

2.1 Abstract

Marek's disease virus (MDV), is a highly infectious and cell associated avian
herpesvirus. Fully productive infections with MDV are restricted to feather follicle
epithelium of afﬂicted birds. In culture, MDV infection of primary chick and duck
embryo ﬁbroblast (CEF and DEF, respectively) cells is semi-productive. Passage of
MDV and production of MDV vaccines is limited to these primary cell-associated
systems. The ﬁnite life span of primary avian cell cultures has hampered efforts to use
positive selection in generation of recombinant MDV and complicates studies of temporal
gene regulation.

In this report, we describe continuous chick ﬁbroblast cell lines (MDV OU2.2 and
MDV OU2.1) which support MDV replication. Southern blot and PCR analyses
demonstrate that these cell lines harbor MDV DNA. Western blot analyses indicate that
MDV OU2.2 cells express at least a limited set of viral proteins, pp38 and ppl4, similar
to that seen in MDV lymphoblastoid cells. Presence of distinct plaques in conﬂuent
MDV OU2.2 cell monolayers is consistent with cytolytic semi-productive infection,
similar to that observed in primary CEF. MDV OU2.2 cells are capable of transferring
MDV infection to primary CEF cultures and inducing clinical signs of Marek's disease
(MD) in susceptible birds. MDV OU2.2 cells have maintained a MDV positive
phenotype for over 16 months of active culture. Southern blot hybridization of MDV

OU2.2 cell DNA reveals a distinct expansion of the MDV BamHI H fragment in a subset

28

29

of viral genomes following long-term cultivation.

2.2 INTRODUCTION

Marek's disease (MD) is a highly contagious lymphoproliferative disease of
chickens, characterized by lymphocytic inﬁltration in visceral organs, muscles, and
peripheral nerves. The etiological agent of MD, an avian herpesvirus called Marek's
disease virus (MDV), is highly infectious and cell associated (Calnek and Witter, 1991).
MDV replicates in a productive restrictive manner in B-lymphocytes and cells growing in
tissue culture. Production of fully enveloped virus is restricted to feather follicle
epithelium of infected birds (Witter et al., 1972; Calnek et al., 1970). MDV rapidly
establishes a latent infection in T-lymphocytes, ultimately leading to malignant
transformation and neoplastic disease (Shek et al., 1983). However, the precise
relationship between latency and transformation in MDV infected T-lymphocytes is
unknown. Akiyama et al. (1973) ﬁrst succeeded in establishing a T-lymphoblastoid cell
line from MD-infected chickens. Since then, more than 80 cell lines have been produced
from MD lymphomas (Akiyama et al., 1974; Powell et al., 1974; Calnek et al., 1978;
Payne et al., 1981; Nazarian and Witter, 1975). Although suitable for some studies, these
cell lines are many passages removed from the original event(s) leading to
transformation.

Evidence suggests that viral genomes in MD-lymphoblastoid cell lines are

predominately integrated into cellular chromosomes, but episomal forms also exist

(Delecluse and Hammerschmidt, 1993). Analysis of viral transcription in transformed

30

31

lymphoblastoid cell lines has revealed variable but limited transcriptional activity
conﬁned to approximately 20% of the viral genome (Maray et al., 1988). MDV-speciﬁc
transcripts in transformed lymphoblastoid cells are primarily derived from within long
and short region terminal repeats (TRL, and TRS, respectively) and internal repeats (IRL,
and IRS, respectively). Little transcriptional activity is detected within either the long
unique (UL) or short unique (Us) regions (Sugaya et al., 1990). MDV can be rescued
from some lymphoblastoid cell lines by co-cultivation with primary or secondary chicken
and duck embryo ﬁbroblasts (CEF and DEF, respectively), which support the lytic cycle
of MDV in vitro (Schat et al., 1989). In addition, some lymphoblastoid cell lines will
induce MD upon injection into susceptible birds (Akiyama et al., 1973; Nazarian et al.,
1977)

Two major difficulties in working with MDV are the strongly cell associated
nature of the virus and lack a sustainable cell culture system amenable to productive
(lytic) infections. Primary CEF and DEF are permissive for MDV replication. However,
these cultures have a ﬁnite life span (approximately 3 weeks), Thus necessitating passage
of infected primary cells onto an uninfected cell monolayer to propagate MDV and to
obtain sufﬁcient quantities of virus with which to work. Such conditions also preclude
establishment of one-step growth experiments for effective temporal gene regulation
studies. The ﬁnite life span of CEF and DEF also make positive selection in mutagenesis
studies difﬁcult. Development of a continuous cell line which will support MDV
replication would alleviate many of the difﬁculties associated with MDV experimentation

and vaccine production.

32

In this report, we detail establishment and characterization of continuous chick
ﬁbroblast cell lines (MDV OU2.1 and MDV OU2.2), stably infected with MDV strain
Mdll at passage level 15. MDV OU2.1 and MDV OU2.2 cells grow continuously in
culture and, once conﬂuent, display plaques characteristic of MDV infection. MDV
OU2.1 and MDV OU2.2 cells can be used to transfer infection to CEF, and produce
classic symptoms of MD in susceptible birds. MDV OU2.2 cells have remained viable
and continue to produce MDV after cryogenic storage and continuous culture for over 16

months.

2.3 Materials and Methods

2.3.1 Cells and Virus

Preparation, propagation, and infection of CEF cells with MDV were performed
as described previously (Glaubiger et al., 1983; Coussens et al., 1988). The very virulent
MDV strain Mdll was used in this study at cell culture passage level 15 (Md11p15).
CHCC-OU2 cells (Ogura and Fujiwara, 1987) were obtained from Dr. Donald Salter,
Avian Disease and Oncology Laboratories (ADOL), U.S. department of Agriculture
(USDA), East Lansing, Michigan, and were cultured in Leibovitz L15-McCoy 5A (LM)
media supplemented with 10% fetal bovine serum (FBS) and 2% tryptose phosphate
broth (TPB) at 37 °C in a humidiﬁed atmosphere containing 5% C02.

CHCC-OU2 cells were infected with MDV strain Mdl lp15 by combining
5.0X107 CHCC-OU2 cells with 2.0X107 Md11p15 infected CEF prior to plating on 150

mm culture dishes in LM medium supplemented with 4% calf serum (CS). Co-

33

cultivation of CHCC-OU2 cells with Mdll infected CEF cells was continued for four
passages. Cells from each of these passages have been preserved at -135 °C in freezing
media (LM media supplemented with 20% CS and 10 % dimethyl sulfoxide (DMSO). At
four passages post-infection, numerous plaques (approximately 100 plaques per 150mm
culture dish), characteristic of MDV infections in CEF cells, were observed. Two of
these plaques were isolated using sterile cloning cylinders. Cylinders were placed on top
of individual plaques, cells were trypsinized and aspirated from the cloning cylinders.
Aspirated cells were transferred to 35 mm culture dishes containing LM media
supplemented with 4% CS for expansion. During expansion, cells were not allowed to

become conﬂuent and media was changed every 48 to 72 hours. Expanded clones were

designated MDV OU2.1 and MDV OU2.2.

2.3.2 Preparation of cellular DNA, Southern blot analysis, and PCR

Total cellular DNA was extracted from uninfected and MDV-infected
CHCC-OU2 cells by standard methods (Sarnbrook et al., 1989). Restriction enzymes
(Boehringer Mannheim Biochemicals, Indianapolis, IN) were used according to the
manufacturers recommendation. DNA was digested, electrophoresed through 0.8%
agarose gels and transferred to Hybond-N or Zeta-probe nylon membranes (Amersham
Corp., Arlington Heights, IL. and Bio-Rad Corp., Hercules, CA, Respectively) by
Southern blotting (Southern, 1975). Probes were non-radioactively labeled
(Digoxigenin-l 1-dUTP) using a random primer labeling kit (Boehringer Mannheim

Biochemicals, Indianapolis, IN).

34

Total cellular DNA was also used as template for PCR ampliﬁcation of MDV
speciﬁc sequences. Primers used and expected fragment sizes are indicated in Table 1.
Brieﬂy, 300 ng of total cellular DNA was combined with 25 mM each dNTP (dATP,
dCTP, dGTP, and dTTP), 20 uM of each appropriate primer pair, 10 ul of 10X PCR
reaction buffer (Perkin Elmer Cetus, Norwalk, Connecticut), and 2.5 Units Taq
polymerase (Perkin Elmer Cetus, Norwalk, Connecticut). PCR reactions were performed
using a GeneAmp 9600 thermal cycler (Perkin Elmer Cetus, Norwalk, Connecticut) as
follows: 35 cycles of 95 °C for 20 sec, 56 °C for 20 sec., and 72 °C for 30 sec. Two
controls, one without DNA and one with uninfected CHCC-OU2 DNA were included in
each experiment. High molecular weight DNA isolated from uninfected CEF and CEF
infected with Md11p16 were used as controls for speciﬁc ampliﬁcation. PCR products
were puriﬁed using the Wizard PCR prep kit (Promega Inc., Madison, Wisconsin) as

recommended by the manufacturer) and analyzed on 1.2% agarose gels.

2.3.3 Western immunoblot analysis

Cultured cells were collected and sonicated using a Soniﬁer cell disrupter model
350 (Branson Ultrasonic Corporation, Danbury, Connecticut). Proteins (20 ug) from
each cell type were separated on 12.5% polyacrylamide/1% SDS gels. Separated proteins
were electrophoretically transferred to nitrocellulose membranes. Membranes were
blocked with 5% nonfat milk and probed with antibodies to MDV proteins: pp14 (Hong
and Coussens, 1994), and pp38 (Cui et al. 1991). Immune complexes were detected by

incubation with a donkey anti-mouse or anti-rabbit immunoglobulin conjugated with

3S

horseradish peroxidase. Detection was performed using an ECL Western blot kit
(Amersham Corp., Arlington Heights, IL) according to the manufacturer's
recommendations and exposed to X-ray ﬁlm. Protein sizes were estimated by
comparison to prestained protein molecular weight standards (Bio-Rad, Richmond, Ca.)

electrophoresed on the same gel.

2.3.4 Inoculation of chickens with cells and virus

In vivo experiments were performed using speciﬁc pathogen free chickens (line
1515 X 7,), obtained from the Avian Disease and Oncology Laboratory, US Department of
Agriculture, East Lansing, Michigan. Three groups of chicks each at one day of age,
were inoculated intraperitonealy with (1) uninfected CHCC-OU2 cells, (2)1000 plaque
forming units (PFU) of Mdl 1p16 in CEF, and (3) 1000 PFU of MDV infected OU2 cells
(MDV OU2.2). The ﬁrst and second groups served as controls (negative and positive,
respectively).

Birds were euthanized and necropsied upon signs of morbidity. Blood was
collected for isolation of peripheral blood lymphocytes and co-cultivation with CEF as an
assay for viable virus. Kidney, spleen, and liver were harvested for DNA isolation and
histological evaluation. For histological examination, kidney tissues were ﬁxed in 4%
paraforrnaldehyde and processed using a Fisher model 166 Histomatic Tissue Processor
(Fisher Scientiﬁc. Pittsburgh, PA). Five micron tissue sections were subsequently stained
with hematoxylin and eosin. Total tissue-speciﬁc DNA was isolated and used as

template for PCR ampliﬁcation of MDV sequences employing primer sets detailed in

36

Table l.

2.4 RESULTS

2.4.1 Infection of CHCC-OU2 cells with Md11p15
Although CHCC-OU2 cells are chemically immortalized, they are not

malignantly transformed, maintain contact inhibition, and exhibit many morphological
features of normal chick ﬁbroblasts. These properties led us to reason that CHCC-OU2
cells might be susceptible to infection by MDV. To test this hypothesis CHCC-OU2
cells were co-cultivated with Mdl lpl 5 infected CEF cells. Cytopathic effect (CPE),
characterized by formation of spherical cells loosely attached to the substratum, was ﬁrst
observed on co-cultivation cell monolayers at two weeks post-infection. The majority of
these regions were characterized as "microplaques", consisting of relatively small clusters
of rounded cells. CPE was slow in developing and expanding. Fully developed plaques
consisting of syncytia and extended regions of rounded, loosely attached, cells were not
visible until four weeks post-infection (Figure 2.1). By comparison, a typical CEF
monolayer infected with MDV strain Mdll will develop readily visible plaques in 5-7
days post-infection with complete destruction of the monolayer within 10-14 days. After
four weeks of co-cultivation, cells were cryogenically preserved at -135 °C for two
weeks. Cell cultures were re-established from frozen cells by combining infected
(Mdl 1p15/OU2) and uninfected CHCC-OU2 cells. Plaques consistent with MDV
infection were not observed until cells reached conﬂuence, approximately 14 days

post-plating.

37

2.4.2 Detection of MDV DNA in infected CHCC-OU2 cells

Polymerase chain reaction (PCR) was used as an initial assay for presence of
MDV DNA in infected CHCC-OU2 cells. Three hundred ng of total DNA from
Md11p15/OU2 and uninfected CHCC-OU2 cells was used as template for PCR
ampliﬁcation with several primer pairs corresponding to various MDV genes, as
described in Materials and Methods. Bands of appropriate sizes (Table 2.1) were
obtained in reactions with Mdl 1p15/OU2 DNA but not from uninfected OU2 DNA
templates (Figure 2.2). Reactions containing DNA isolated from uninfected CEF and
Mdll infected CEF were used as negative and positive controls, respectively (data not
shown).

Results of PCR analyses suggested that MDV DNA was present in infected
CHCC-OU2 cultures. Although unlikely, given our extended culture conditions, PCR
analysis could have detected MDV DNA from residual Md11p15 infected CEF cells. In
addition, PCR analyses do not provide critical information on integrity of MDV DNA in
Md11p15/0U2 cells. To address these concerns, MDV DNA in infected CHCC-OUZ
cells was analyzed by Southern blot hybridization using a cocktail of MDV BamHI
fragments (B, F, H, and 12) as a probe. Total genomic DNA isolated from Md11p16
infected CEF and Mdl 1p15/OU2 cells contained MDV speciﬁc fragments corresponding
to BamHI fragments B, F, H and 12. As expected, similar fragments were not detected in
DNA isolated from uninfected CEF or CHCC-OU2 cells (Figure 2.3 Panel A).

Continuous passage of oncogenic MDV strains in primary cell culture leads to

attenuation of the virus with a concomitant heterogeneous expansion of repeat regions

38

within BamHI ﬁagments H and D. To determine if expansion of BamHI-H and -D
occurred in MDV DNA isolated from highly passaged MDV OU2.2 cells, Southern blot
hybridization was performed on DNA isolated from OU2.2 cells which had been in
continuous culture for almost 16 months (passage 12). Using BamHI fragment H as
probe, both BamHI-H and -D fragments are clearly visible in DNA isolated from
Md11p16 infected CEF cells (Figure 2.3 Panel B). In high passage Md11p86 infected
cell DNA, BamHI fragment H is highly heterogenous, consistent with published reports
(Silva and Witter, 1985; Fukuchi et al., 1985 ). Expansion of BamH I D is also evident in
DNA isolated from CEF infected with high passage Md11(Figure 2.3 Panel B), although
expansion of BamH I D appears to be more homogeneous. DNA isolated from MDV
OU2.2 cells at passage 12 contained discrete BamHI-H and -D bands (Figure 2.3 Panel
B), similar to those observed in low passage (oncogenic) Md11p16. A distinct band at
5.8 kb, visible in DNA isolated from MDV OU2.2 cells, may be due)to speciﬁc
expansion of the BamH I H fragment (Figure 2.3 Panel B). No expansion of BamH] D is
evident in this sample. These results indicate that MDV DNA in MDV OU2.2 cells is

relatively stable, at least through passage 12 and over many months of continuous culture.

2.4.3 Establishment of infected cell lines

Although our culture conditions and freeze-thaw cycles should have eliminated
most of the original CEF cells used for establishing infection, it was possible that
residual CEF cells were contributing to MDV speciﬁc DNA detected in our

Md11p15/0U2 cultures. To address this concern, isolation and expansion of individual

39

plaques from infected CHCC-OU2 cultures was initiated. Two Mdl 1p15/OU2 cell lines
(MDV OU2.1 and MDV OU2.2) were established by plaque isolation and expansion as
described in Materials and Methods. Despite arising from distinct plaques, both cell lines
exhibited initial growth characteristics indistinguishable from uninfected CHCC-OU2
cells. Plaques characteristic of MDV infection were only observed in MDV OU2.1 and
MDV OU2.2 cell cultures after conﬂuence had been reached at 10 to 14 days post-
plating.

To conﬁrm infectious virus could be rescued from MDV OU2.1 and MDV OU2.2
cultures, cells from each isolate were used as inoculum to infect CEF cells by combining
1x106 MDV OU2.1 or MDV OU2.2 with 5x107 secondary CEF. Numerous (>103)
plaques, consistent with MDV infection of CEF cells were visible within 5 days post
co-cultivation. In contrast, no plaques were evident in control plates containing 1x106
uninfected CHCC-OU2 cells and 5x107 CEF cells (data not shown). In subsequent
studies, the yield of virus from MDV OU2.2 cells has remained at 103 to 10“ PFU/106

cells as determined by transfer to CEF monolayers.

2.4.4 Detection of viral proteins expressed in MDV OU2.2 cells

To verify that MDV OU2.2 cells indeed supported replication and growth of
MDV, detection of MDV proteins was initiated. Monoclonal antibody H19.47 (Cui, et
al., 1990) against MDV pp38 (generous gift from Dr. Lucy Lee, USDA-ADOL, East
Lansing, Michigan), speciﬁcally recognized polypeptides of approximately 24, 38, and 41

kDa in extracts from CEF cells infected with Mdl 1p15, consistent with previous reports

40

(Cui et al., 1990; Zhu et al., 1994 ). A 38 kDa protein was also identiﬁed in extracts
from MDV OU2.2 cells (Figure 2.4 Panel A). Although proteins of 24 and 41 kDa were
not detected in MDV OU2.2 cell extracts, a protein with an apparent size of 84 kDa was
speciﬁcally recognized by monoclonal antibody H19.47 in these extracts (Figure 2.4
Panel A). The origin of this larger protein is, at present, unknown. Polyclonal antisera
to ppl4, an MDV-speciﬁc immediate-early phosphoprotein (Hong and Coussens, 1994)
also reacted with an appropriately sized polypeptide in extracts from conﬂuent MDV
OU2.2 cells and Md11p16 infected CEF cells but not in uninfected cell extracts (Figure
2.4 Panel B). A polyclonal antisera to B-actin was used to ensure similar amounts of
protein were analyzed in each lane (Figure 2.4 Panel C). Taken together, results of PCR
ampliﬁcation, Southern hybridization, and Western blot analysis indicated that MDV
OU2.2 cells represent a continuous anchorage dependent cell line which harbors MDV

and is permissive for semi-productive infection.

2.4.5 MDV 0U2.2 cells induce MD in susceptible chickens

Marek's disease may be experimentally induced by injection of MDV infected
cells into susceptible birds. MDV lymphoblastoid cell lines such as MSB-l are also able
to induce MD in susceptible birds following intraperitoneal injection. To determine if
MDV OU2.2 cells could be used in a similar manner, line 1515 X 71 chickens were
inoculated with uninfected CHCC-OU2 cells, MDV OU2.2 cells, or Md11p16 infected
CEF cells at one day of age. Chickens injected with either Md11p16 infected CEF or

with MDV OU2.2 cells developed classical signs of MD (reduced growth and paralysis of

4 1
neck, wings, and legs) and had to be euthanized at 10 days post-infection. In contrast,
negative control chickens injected with uninfected CHCC-OU2 cells showed no clinical
signs of MD, even at 12 weeks of age.

To conﬁrm presence of MDV in infected birds, peripheral blood lymphocytes
(PBLs) were isolated from blood collected at various times post-inoculation and seeded
onto secondary CEF. Plaques consistent with MDV infection were observed on CEF
monolayers at 4 days post-culture on plates seeded with PBLs isolated from birds injected
with Md11p16 infected CEF or MDV OU2.2 cells. No plaques were observed on plates
of CEF cells mixed with PBLs obtained from control birds injected with uninfected
CHCC-OU2 cells.

To further conﬁrm replication of MDV in infected birds, total cellular DNA
isolated ﬁom infected bird kidneys was used as template for PCR ampliﬁcation using
primers speciﬁc for the MDV pp38 gene. Consistent with the presence of MDV DNA an
850 bp fragment was ampliﬁed using DNA isolated from kidneys of birds injected with
Md11p16 infected CEF or MDV OU2.2 cells. In contrast, similar bands were not
detected when DNA from birds injected with CHCC-OU2 cells was used as template
(Figure 2.5).

Histological evaluation revealed lymphocytic inﬁltration and early, active
lymphomas in various tissues, including kidney, from birds injected with CEF/Md11p16
and MDV OU2.2 (Figures 2.6 Panel C B, respectively), whereas CHCC-OU2 inoculated
birds showed no signs of MD at the microscopic level (Figure 2.6 Panel A). Taken

together, these results clearly demonstrate that MDV OU2.2 cells contain MDV and that

42

the virus may be transferred to birds via intraperitoneal injection.

2.5 Discussion

One of the major difﬁculties in working with MDV is lack of a sustainable cell
culture system for virus growth and selection. Although primary CEF and DEF are
permissive for MDV replication, primary cultures are characterized by slow growth and
limited life span. These factors necessitate continual passage of infected cells onto
uninfected cells in order to obtain sufﬁcient quantities of virus with which to work. In
addition, CEF and DEF must be prepared on a regular basis from 10 or 11 day old chick
embryos, adding signiﬁcantly to the expense and difﬁculty of culturing MDV. These
same factors add signiﬁcantly to the expense of producing MDV vaccines.

The CHCC-OU2 cell line is an immortalized ﬁbroblastic cell line derived from
chick embryo cells (Ogura and Fujiwara, 1987). CHCC-OU2 are not oncogenic, based
on the fact that CHCC-OU2 cells failed to produce tumors when injected into syngeneic
chickens (Ogura and Fujiwara, 1987). In addition CHCC-OU2 are virus free and
susceptible to avian retrovirus infection (avian sarcoma viruses of subgroups A, B, and
C). Newcastle disease virus also replicates well in CHCC-OU2 cell cultures (Ogura and
Fujiwara, 1987).

In this report, we provide evidence that CHCC-OU2 cells may be suitable as a
sustainable cell culture System for replication and study of MDV. The initial phase of
CHCC-OU2 infection with MDV, strain Mdl 1p15, was slow and characterized by a low

number of visible plaques. Fully developed plaques were ﬁrst observed in conﬂuent

43

cultures at four weeks post-infection. At this time, plaques were clearly visible and quite
abundant (approximately 100 plaques/150 mm tissue culture plate). In subsequent
passages, plaques were visible every 10-14 days in culture. Following long-term
cultivation of clonal MDV infected CHCC-OU2 cells (MDV OU2.2), virus yield has
remained constant at 103 to 104 PFU/10‘5 cells, as determined by transfer to CEF
monolayers.

Southern blot and PCR analyses conﬁrmed that clonal cell lines, MDV OU2.1 and
MDV OU2.2, indeed harbor MDV DNA. Fragments detected by Southern blot
hybridization in DNA from MDV OU2.2 cells were similar in size to those detected in
Md11p15 infected CEF, indicating that no gross structural rearrangements had occurred
during initial infection. In addition, fragments detected in MDV OU2.2 cell DNA
represent diverse regions of the MDV genome, including the unique long (BamHI B and
F), terminal repeat long (BamHI D), and internal repeat long (BamHI H and 12) segments.
Intensity of these fragments suggests that MDV OU2.2 cells allow MDV DNA
replication, as it is highly unlikely the observed amount of DNA would arise from
residual CEF cells used to establish initial infections. Subsequent Southern blot
hybridization using an MDV BamI-H H fragment speciﬁc probe indicated that, while no
expansion of BamI-II ﬁagment D had occurred, a speciﬁc expansion of BamI-II H had
occurred in highly passaged MDV OU2.2 cells (passage 12, 16 months in culture). The
nature of this expansion is, at present unknown, but may represent three copies of a
previously characterized 132 bp region within BamHI H (Maotani et al., 1986) .

Western blot analyses demonstrated that MDV OU2.2 cells express at least a

44
limited set of viral proteins, pp38 and pp14. Proteins related to pp38 (pp24 and pp4l),
which are readily detected by monoclonal antibody H19.47 in extracts from Mdl 1p15
infected CEF, were not observed in extracts from MDV OU2.2 cells. A larger
polypeptide of 84 kDa was, however, speciﬁcally recognized by monoclonal antibody
H19.47 in MDV OU2.2 cell extracts. The origin of this protein is, at present, unknown.

Despite numerous attempts, we were unable to detect MDV glycoproteins gC, gB,
gE, and g1 by western blot analyses. Each of the particular antisera employed was able to
detect the respective protein in Mdl 1p15 infected CEF cell extracts. Thus, results of
western blot analyses are consistent with MDV existing in MDV OU2.2 cells as a latent
infection, similar to that seen in MDV lymphoblastoid cells. However, presence of
distinct plaques in MDV OU2.2 cell monolayers is not consistent with latent infection as
this would imply cytolytic activity related to MDV infection. Additional experiments
designed to further characterize the state of MDV in MDV OU2.2 cells are currently in
progress.

In viva experiments clearly demonstrate that MDV OU2.2 cells are capable of
transferring MDV infection to CEF monolayer cultures and inducing clinical signs of MD
in susceptible birds. Birds injected with either MDV OU2.2 or Md11p16 infected CEF
developed clinical signs of MD, characterized by a marked decrease in growth rate and
paralysis of legs, wings, and neck. There was little or no difference in virulence observed
in groups inoculated with Md11p15 infected CEF or MDV OU2.2 cells. PCR analysis of
tissues, including kidney and spleen, demonstrated that MDV was present in remote

tissues of birds injected with MDV OU2.2 cells. In addition, PBLs isolated from birds

45

injected with MDV OU2.2 cells were able to transfer infection to CEF monolayers. In
contrast, no evidence of tumor formation or viremia was observed in birds inoculated
with uninfected CHCC-OU2 cells.

Although adding little to our characterization of the state of MDV in MDV OU2.2
cells, results of in viva experiments clearly demonstrate that MDV OU2 cells may be
used to establish infections in susceptible birds, a quality of considerable importance for
MDV vaccine development and production of MDV mutants by positive selection.
Importantly, we have recently succeeded in developing cell lines harboring a turkey
herpesvirus (HVT strain FC126) and serotype 2 MDV (strain SBl) (Reilly J. D., Abujoub
A.A., and Coussens P.M., unpublished observations). Characterization of these important

cell lines is currently in progress.

2.6 Acknowledgments

We thank Ron Southwick and Jean Robertson for excellent technical assistance
and assistance with computer graphics. We also thank Dr. L.F. Lee for monoclonal
antibody H19.47, Donald Salter for providing CHCC-OU2 cells, and Sheila Abner for
assistance with histological examination of kidney sections. This work is supported by
Research Excellence Funds from the State of Michigan, by grants 94-3 7204-0935 and
95-37204-2118 awarded to PM Coussens under the Competitive Research Grant program
administered by US. Department of Agriculture, and by the Michigan Agriculture

Experiment Station.

46

Table 2.1 Sequence of MDV-speciﬁc Oligonucleotide primers used in PCR ampliﬁcation.

 

 

 

 

 

 

 

 

 

 

CGGGGTCGACTAAGGCAAATAGGCACGC

 

 

Primer Sequences“ Locus Expected
Size (kb)

GTAGTGAAATCTATACCTGGG gC gene 0.3
GTGTCTAGAGAGGGAAGATATGTAGAGGGTI‘AC promoter
ATGGAATTCGAAGCAGAACAC pp38 gene 0.85
CTCCAGATTCCACCTCCCCAGA
TGCTAATTGTGGCTCC ICP4 gene 0.9
GGTGCTTCCATCTCGGC
GATCTAGACGTTTCTGCCTCCGGAGTC US3 gene 0.6
GCAAGCTTCAACATC'ITCAAATAGCCGCAC promoter
GTCTAGACGCGATAGCGAGTTGTTGGACC ICP4 gene 1.1
GGAAGCTI‘TATTAAGGGAGATTCTACCC promoter
GTGAAAGAGTGAACGGGAAG BamHI L 1.20
CGTCAAAGCGATAATAGGC fragment
CCGGGGATCCCGAAATGTCGTTAGAACATC UL54 gene 1.1

 

* Primer sequences are written as 5' to 3', left to right. In each case, the upper primer

represents the upstream sequence while the lower primer represents the downstream

sequence.

 

47

 

Figure 2.1 Monolayer of uninfected CHCC-OU2 cells display a cobblestone appearance,
similar to that seen with primary CEF and DEF (Panel A). At four weeks post-infection
(by co-cultivation as described in Materials and Methods), numerous plaques consistent
with MDV infection were observed on monolayers of Mdl 1p15/OU2 cells (Panel B).

 

49

Figure 2.2 PCR ampliﬁcation of MDV-speciﬁc sequences. PCR ampliﬁcation was
carried out on DNA isolated from Mdll infected CHCC-OU2 cells (lanes 2-6).
MDV-speciﬁc Oligonucleotide primers (Table 1) were used to amplify particular MDV
sequences, as detailed in Table 1. Negative control (lane 1), ICP4 gene promoter
sequences (lane 2), 900 bp region of ICP4 coding sequence (lane 3), 1200 bp of BamHI L
fragment (lane 4), gC gene promoter sequences (lane 5), US3 gene promoter sequences
(lane 6), and UL54 gene sequences (lane 7). Positions of selected bands from a lkb
ladder marker (Life Technologies, Inc., Gaithersburg, Md.) are indicated on the left.

50

1234567

1.64>

0.51 >

 

51

Figure 2.3 Detection of viral DNA in infected CHCC-OU2 cells. DNA was extracted
from cells, digested with BamHI, electrophoresed on 0.8% agarose gels, transferred to
Hybond-N or Zeta-Probe Nylon membranes, hybridized to non-radioactive probes under
high stringency conditions, and autoradiographed as described in Materials and Methods.
Panel A: DNA was extracted from MDV infected CHCC-OU2 cells at passage level
four. Cloned MDV DNA BamHI fragments B, D, F, H, and 12 (Fukuchi et al., 1984)
were used as probe. Locations of each fragment were determined by comparison to a
DNA size standard (lambda DNA digested with HindIII) and are indicated by an
arrowhead to the leﬁ. Panel B: DNA was isolated from MDV OU2.2 cells following 16
months of continuous cultivation. Expansion of direct repeat units within terminal
repeats and internal repeats ﬂanking the MDV unique long region was examined in
highly passaged MDV OU2.2 cells using a MDV BamHI H fragment probe. Locations of
each fragment were determined by comparison to a DNA size standard (1 kb ladder, Life
Technologies, Gaithersburg, MD). Fragment sizes are indicated to the right.

NDOQUEO
NNDO >Q2

ma SS:
HS

A

 

B>
D>

F>
ii:

53

4115
1%?

09:82 .-
Nam.~.:o >34
mamaaeea
30-85
Emu

—-
--

54

Figure 2.4 Western blot analysis for detection of speciﬁc MDV proteins. Cell lysates
from uninfected CEF (CEF), Md11p15 infected CEF (Mdl 1p15), uninfected CHCC-OU2
cells (CHCC-OUZ), and MDV OU2.2 cells (MDV OU2.2) were resolved on 12.5%
SDS-polyacrylamide gels and transferred to nitrocellulose membranes, followed by
immunodetection using speciﬁc antisera as described in Materials and Methods. In each
Panel, positions of molecular size markers (in Kilodaltons), are indicated. Panel A:
detection of MDV-speciﬁc protein pp38 using a monoclonal antibody (generously
provided by Dr. Lucy Lee, USDA-ADOL, East Lansing, MI). Panel B: Detection of
MDV-speciﬁc protein pp14 using polyclonal antisera generated against ppl4 fusion
proteins (Hong and Coussens, 1991). Panel C: Protein loading in each lane was veriﬁed
by detection of B-actin using a commercial antisera (Santa Cruz Biotechnology, Santa
Cruz, CA).

 

NNDO >34
NDOOUIU

ma 5.:
Eu

N.NDO >92
80.005

ma :34
Emu

m

4112
4 53
4 35

112>

53>

._

35>

<21

21>

OUZ

ach

N.NDO >34

$0.85
an EU:
mmo

ﬂed

56

Figure 2.5 PCR ampliﬁcation of 850 bp pp38 gene segment. PCR ampliﬁcation was
carried out on DNA isolated from kidneys of birds injected with CHCC-OU2 (lanes 2 and
3), MDV OU2.2 (lanes 4-6), and Md11p16 infected CEF (lanes 7 and 8). Negative
control (lane 1) included all reaction components except template DNA. Additional
controls included DNA isolated from uninfected CEF (lane 9), and DNA isolated from
Md11p16 infected CEF as positive control (lane 10). In each case (except negative
control), 300 ng DNA was used as template for PCR ampliﬁcation using pp38 speciﬁc
primers (Table 1). PCR products were analyzed on 1.2% agarose gels containing
10ug/ml ethidium bromide. Fragment Sizes were determined relative to DNA size
standards (1 Kb Ladder, Life Technologies, Gaithersburg MD).

 

5'?

12345678910

 

58

Figure 2.6 Histological examination of kidney tissues. Tissues were prepared as
described in Materials and Methods. Examination of tissues from birds inoculated with
MDV OU2.2 cells (Panel B), and Mdl 1p15 infected CEF cells (Panel C) by light
microscopy revealed lymphocytic inﬁltration (representative lymphocytes are indicated
by arrows) characteristic of early MDV-induced lymphoma development. In contrast,
little or no inﬁltration of lymphocytes was observed in tissue sections from control birds
inoculated with uninfected CHCC-OU2 cells (Panel A).

  
  
 

a; .
o ‘\ V’AI
I A D Q

Q.-
o
6

 

9.4 a“

am
if

I“

   

b.

(a
at:
:3. I.

. ’..:"b

a: “gag;
t~ .‘3 '
J‘

t i.

 

Chapter 3

Evidence that Marek’s disease virus exists in a latent state in a sustainable
fibroblast cell line
Amin A. Abujoub' and Paul M. Coussens"2
Molecular Virology Laboratory, Departments of Microbiology‘,
and Animal Sciencez,

Michigan State University, East Lansing, MI 48824

This work has been submitted for publication in virology (May 21, 1996)

60

3.1 Abstract

Previously, we reported the development of two ﬁbroblastic cell lines (MDV
OU2.1 and OU2.2) infected with Marek’s disease virus (MDV). The two cell lines, in
non-conﬂuent continuous cultures, displayed characteristics consistent with MDV
existing in a latent state. However, presence of distinct plaques in conﬂuent cell
monolayers and the ability to transfer cytolytic infection to susceptible birds and primary
chick embryo ﬁbroblasts, suggest that, if latent, the virus is easily reactivated from MDV
OU2 cell lines.

In this report, we present evidence which supports the hypothesis that MDV
genomes in MDV OU2 cells are latent. PCR analyses and in viva experiments
demonstrate that CHCC-OU2 cells stabilize MDV so that serial in vitra passage does not
attenuate the virus. Following more than two years of active culture, MDV genomes in
MDV OU2 cells are still oncogenic, similar to that seen in MDV-lymphoblastoid cell
lines. Expansion of the 132 bp repeat within MDV BamHI fragments H and D, typical
of highly passaged serotype 1 MDV has not been observed beyond two copies in MDV
OU2 cells. Indirect immunoﬂuorescence assays clearly demonstrate that MDV OU2 cells
do not express glycoproteins B and I when sparse. However, upon reaching conﬂuence
these proteins are expressed in readily detectable amounts. Using RT-PCR we also
demonstrate that MDV latency associated transcripts (LATs), which are antisense to ICP4

transcripts and have been associated with latent MDV infection, are expressed in sparse

61

62

MDV OU2 cells. MDV LAT expression is down regulated when MDV OU2 cells

become conﬂuent.

3.2 Introduction

Marek’s disease (MD) is a lymphoproliferative disease of chickens caused by
Marek’s disease virus (MDV). MDV is an avian herpesvirus, which is highly infectious
and cell associated (Calnek and Witter, 1991). In infected birds, a lytic cycle of MDV
replication takes place in differentiating epithelial cells and bursal lymphocytes.
Infectious viruses are produced only in feather follicle epithelium and are shed with
feather dander and dust (Witter et al., 1972; Calnek et al., 1970). Following an initial
burst of lytic infection, T-lymphocytes become latently infected with MDV.
Subsequently, chickens infected with virulent, oncogenic (serotype 1) strains of MDV
develop aggressive T-cell lymphomas (Calnek and Witter, 1991). Evidence accumulated
to date suggests that latent infection of T-lymphocytes is a prerequisite to malignant
transformation and neoplastic disease (Shek et al., 1983).

Although MDV cannot produce fully infectious particles (enveloped virus) in
tissue culture, cytopathic infections can be produced in monolayers of primary or
secondary chicken and duck embryo ﬁbroblasts (CEF and DEF, respectively) as well as
chick kidney cells (CKC). CEF, CKC and DEF support the lytic cycle of MDV in vitra
(Schat et al., 1989). In addition, more than 90 lymphoblastoid cell lines have been
isolated and established from MD tumors (Schat et al., 1991; Akiyama and Kata, 1974;
Powell et al., 1974; Calnek et al., 1978; Payne et al., 1981; Nazarian and Witter, 1975).

MDV transformed lymphoblastoid cells are immortalized cell lines which are latently

63

64

infected with MDV and usually capable of transferring MDV to CEF or DEF in vitra and
to susceptible chickens in viva.

In MDV lymphoblastoid cell lines a limited set of viral genes have been found to
be transcribed (Maray et al., 1988; Sugaya et al., 1990). Transcriptional activity is
limited to approximately 20% of the MDV genome, primarily in repeat regions and
adjacent sequences. Most transcripts found in MDV lymphoblastoid cells are derived
from immediate early (IE) genes (Silver et al., 1979; Schat et al., 1989), suggesting that
IE genes could have a signiﬁcant role in maintenance of latency. Latency associated
transcripts (LATs) which map antisense to IE genes have been described for many
herpesviruses. Transcripts antisense to ICP4 have been reported for pseudorabies virus
and have been postulated to be involved in latency (Priola, et al., 1990). In the case of
herpes simplex virus, LATs map antisense to the ICPO gene (Feldman, 1991). In MDV,
LATs which map antisense to ICP4 have been detected (Li et al., 1994, Cantello et al.,
1994, Mckie et al., 1995). These LAT transcripts appear to be expressed at higher levels
in lymphoblastoid cell lines (MSB-l and RPLl) and are down regulated in lytically
infected cells (Li et al., 1994). Although it is possible that MDV LATs play a role in
maintenance of latency, deﬁnitive evidence is still lacking.

MDV can be rescued from some lymphoblastoid cell lines by co-cultivation with
primary or secondary CEF and DEF (Schat et al., 1989). In addition, some
lymphoblastoid cell lines will induce MD upon injection into susceptible birds (Akiyama
et al., 1973, Nazarian et al., 1977). Reactivation of cytolytic infection, however, varies

with each cell line. MDV lymphoblastoid cells contain multiple copies of MDV genomes

65

(Akiyama and Kata, 1974; Ross et al., 1981; Rziha and Bauer, 1982; Schat et al., 1989).
Recent evidence suggests that some MDV genomes, in MDV lymphoblastoid cell lines,
are integrated into cellular chromosomes, but episomal forms also exist (Delecluse and
Hammerschmidt, 1993; Delecluse et al., 1993).

Serial in vitra passage of virulent oncogenic MDV results in loss of MDV
tumorigenicity (Churchill and Chubb, 1969). Attenuation of MDV was strongly
correlated with an expansion in two regions (BamHI-H and -D), present in MDV long
terminal repeat (TRL) and long inverted repeat (IRL) regions, respectively (Silva and
Witter, 1985; Fukuchi et al., 1985; Chen and Velicer, 1991). It was latter discovered that
expansion was due to ampliﬁcation of a 132-hp direct repeat (DR) sequence found within
MDV BamHI-H and -D fragments, (Maotani et al., 1986). Tumor induction studies in
susceptible birds suggest that cloned virus populations which exhibit an ampliﬁcation of
the 132 bp repeat region have decreased tumorigenic capability. In contrast, viruses
which do not contain ampliﬁed BamHI -H or -D regions efﬁciently induce tumors in
chickens (Fukuchi et al., 1985).

Recently we reported development of ﬁbroblastic cell lines (MDV OU2.1 and
OU2.2) infected with serotype 1 MDV, strain Mdll (Abujoub and Coussens, 1995).
MDV OU2 cell lines are similar to certain lymphoblastoid cell lines that MDV infection
can be transferred to primary and secondary CEF monolayer culture and MD induced in
susceptible birds (Abujoub and Coussens, 1995). However, MDV OU2 cell lines, unlike
lymphoblastoid cell lines, are not intrinsically tumorigenic.

Latency in many viruses results from lack of host factors critical for the

66

expression of viral IE gene products (Garcia-Blanca and Cullen, 1991). Reactivation of
these viruses from the latent state is not completely understood, but could be due to
activation of speciﬁc cellular factors in response to an external stimuli. Stimulation will
activate viral regulatory proteins and lead to a state of lytic infection. The exact
mechanism involved in the switch from latent to lytic infection is not clearly understood
for many herpes viruses, including MDV. The MDV OU2 cell system may represent an
ideal in vitra system to study factors involved in the switch between lytic and latent
herpesvirus infections.

As a ﬁrst step in examining the status of MDV in the MDV OU2 cell lines, we
report here that MDV exists in a continuous latent state in MDV OU2 cell lines and virus
lytic cycle is activated upon conﬂuence. Virus produced from MDV OU2 cells remained
virulent and oncogenic after more than 30 in vitra passages. MDV cultivated in
CHCC-OU2 cells appears to be stabilized unlike MDV cultivated on CEF cells. After
more than two years of continuous culture, only a minor expansion of an unstable 132 bp

DR sequence (het region) was detected in MDV OU2 cells.

3.3 Materials and methods
3.3.1 Cells and Virus
Preparation, propagation, and infection of CEF cells with MDV were performed
as described previously (Glaubiger et al., 1983; Coussens and Velicer, 1988). The very
virulent MDV strain Mdll was used at cell culture passage levels 15, 28, 35, 48 and 86

(Md11p15, Md11p28, Mdl 1 p35, Md11p48, and Md11p86 respectively). CHCC-OUZ

67

cells (Ogura and Fujiwara, 1987), MDV OU2.2, and MDV OU2.1 cells were maintained
as described previously (Abujoub and Coussens, 1995). MDV OU2 cells were used at
cell culture passages 12 to 34 (MDV OU2.1p12 to p34 and MDV OU2.2p12 to p34) for
PCR, and RT-PCR analyses . MDV OU2.1 and OU2.2 cells are passaged every 1-2

weeks prior to formation of conﬂuent monolayers.

3.3.2 Preparation of cellular DNA, and Polymerase chain reaction (PCR)

Total cellular DNA was extracted from CEF, CEF/Mdl l, MSB-l, CHCC-OU2,
and MDV OU2 cells by standard methods (Sambrook et al., 1989). Total cellular DNA
was used as a template for PCR ampliﬁcation of the 132-bp DR sequences. The upstream
primer (5'-TGCGATGAAAGTGCTATGGAGG-3’) anneals 3 bp 5' to the 132-bp DR
sequences, while the downstream primer (5'-GAGAATCCCTATGAGAAAGCGC-3')
anneals 6 bp from the 3' end of the 132-bp DR sequences. PCR using these two primers
ampliﬁes a 317 bp fragment when two copies of the DR sequence are present (Silva,
1992). PCR conditions were slightly modiﬁed from those suggested by Silva, (1992).
Brieﬂy, 200 nanogram of total cellular DNA was mixed with 20 mM of each dNTP , 20
[TM of each Oligonucleotide primer pair, 10 pl 10 X PCR reaction buffer (GIBCO BRL,
Gaithersburg, MD), 1.5 mM MgC12, and 1.0 U Taq polymerase (GIBCO BRL). PCR
reactions were performed using a GeneAmp 9600 thermal cycler (Perkin Elmer Cetus,
Norwalk, CT). Following an initial denaturing step at 95 °C for 5 minutes, DNA was
ampliﬁed during 25 cycles of 95 °C for 30 seconds, 67 °C for 30 seconds, and 72 °C for

30 seconds. PCR reactions were completed by a ﬁnal elongation step at 72 °C for 10

68

minutes. A negative control with CHCC-OU2 DNA was included in each PCR reaction.
Ampliﬁcation of an 850 bp fragment of the pp38 gene was performed as previously
described (Abujoub and Coussens, 1995). PCR products were analyzed on 6%
polyacrylamide gels, stained with ethidium bromide, and photographed under ultraviolet
light. Sizes of ampliﬁed fragments were determined by comparison to a 1 kb DNA

ladder marker (GIBCO BRL).

3.3.3 RNA isolation and Reverse Transcriptase PCR (RT-PCR)

Total RNA was isolated from CHCC-OU2, MDV OU2.2p31, Mdl 1 p35, and
MSB-l cells, using the Trizole reagent (GIBCO BRL) according to the manufacturer’s
recommendation. Prior to use, RNA was treated with 10 units RNase—free RQl DNAase
(Promega, Madison, WI) for 30 min at 37 °C. Coupled cDNA synthesis and PCR
ampliﬁcation of extracted RNAs was carried out in two steps. First, cDNA synthesis was
performed in 250 mM Tris-HCI (pH 8.3), 375 mM KCL, 15 mM MgC12, 100 mM
dithiothreitol, and 10 mM each dATP, dCTP, dGTP, and dTTP. First strand synthesis
mixture also contained 0.5 U RNasin (Promega), 200 U Superscript II Reverse
Transcriptase (GIBCO BRL), 1 um of Oligonucleotide corresponding to nt 411-435
(complementary) of M49 cDNA clone of MDV (Li et al., 1994) (5'-
CGTCGGACATGTTTCCAGATCGCC-3'), and 15 ug of total cellular RNA. Reactions
were incubated at 42 °C for 60 min, followed by enzyme inactivation for 15 min at 70 °C.
Second, the cDNA synthesized in the ﬁrst step was used as a template for PCR reaction

as follows: 10% of the ﬁrst strand reaction was ampliﬁed in 2.0 mM Tris-HCI (pH 8.4),

69

5.0 mM KCL , 1.5 mM (ﬁnal concentration) , 20 mM of each dNTP, and 10 um each of
Oligonucleotide corresponding to nt 98-122 of M49 cDNA clone of MDV (5'-
CGTTGGACGGCTCGGCGGAC'ITGGG-3') and nt 411-435 (complementary) (Li et al.,
1994). PCR reactions were performed using a GeneAmp 2400 thermal cycler (Perkin
Elmer Cetus). Following an initial denaturing step at 95 °C for 5 min, DNA was
ampliﬁed during 30 cycles of 95 °C for 45 seconds, 62 °C for 45 seconds, and 72 °C for
45 seconds. PCR reactions were completed by a ﬁnal elongation step at 72 °C for 15
minutes. A negative control without template and a positive control with Md11p35 DNA

was included in each RT-PCR reaction.

3.3.4 Inoculation of chickens with cells and virus

In viva experiments were performed using speciﬁc pathogen-free chickens (SPF),
obtained from SPAF AS (Chicago, IL). Chicks were divided into three groups of 5 chicks
per group at 1 day of age, and groups inoculated intraperitoneally with either: (A) 2.0x106
uninfected CHCC-OU2 cells, (B) 2000 plaque forming units (PFU) of MDV OU2.2p8
cells, or (C)2000 PFU of MDV OU2.2p23.

Birds were euthanized and necropsied upon severe signs of morbidity. Blood was
collected, peripheral blood leukocytes (PBLs) were isolated as described (Tardef and
McQueen, 1993) and co-cultivated with secondary CEF cells as an assay for production
of viable virus. Various tissues, including heart, liver, kidney, and spleen were frozen for
subsequent DNA isolation. Total tissue-speciﬁc (Kidney) DNA was isolated and used as

template for PCR ampliﬁcation of the 132 bp DR sequence, and for an 850 bp region of

70

MDV pp38 gene sequences.

3.3.5 Indirect immunofluorescence antibody (IIFA) staining

Uninfected CEF, CEF infected with Mdl 1p15, CHCC-OU2, and MDV OU2.2
cells, grown on glass cover slips in 35 mm tissue culture plates, were used for indirect
immunoﬂuorescence labeling according to standard protocols ( Harlow and Lane, 1988;
Hong et al., 1995). CEF and CHCC-OU2 cells were processed three days post-plating on
cover slips. CEF infected with Md11p15 were processed one day after displaying
plaques characteristic of MDV infection. MDV OU2.2 were processed either when they
were 60-80% conﬂuent (sparse) or ﬁve days after forming a conﬂuent monolayer
(conﬂuent). Cells were washed with cold PBS, ﬁxed and perrneablized with 2 ml of ice
cold acetonezmethanol (1:1) for 3 minutes at room temperature with gentle agitation.
Following three washes with cold PBS, cells were preincubated with 3% BSA in PBS for
one hour at room temperature. H19.47 anti-pp38 (Cui et al., 1990) and IAN86
anti-MDV/gB (Silva, and Lee, 1984) monoclonal antibodies ( generously provided by Dr.
Lucy Lee, USDA-ADOL) were added to the cells at a 1:40 dilution in PBS and incubated
for one hour at room temperature. Anti-ppl4 (Hong and Coussens, 1994) and
anti-MDV/gl polyclonal antibodies (generously provided by Dr. Lee Velicer, Department
of Microbiology, Michigan State University) were added to cells in a 1:20 dilution in
PBS and incubated for one hour at room temperature. After extensive washing with PBS,
sheep anti-mouse IgG (whole molecule) conjugated with ﬂuorescein-S'-isothiocyanate

(FITC) (Sigma) was used as secondary antibody for cells incubated with either anti-pp38

71

or anti-MDV/gB as primary antibodies. Goat anti-rabbit IgG ([H+L] afﬁnity puriﬁed)
conjugated with R-phycoerythrin (PE) (Vector Laboratories Inc., Burlingame, CA) was
used as a secondary antibody for cells incubated with anti-ppl4 antibody. Goat
anti-rabbit IgG (whole molecule) conjugated with F ITC (Sigma, St. Louis, MO) was used
as a secondary antibody for cells incubated with anti-MDV/gl as a primary antibody. All
secondary antibodies were diluted 1:20 in PBS. After extensive washing with PBS,
Slow-Fade (Molecular Probes, Eugene, OR) was added prior to mounting to glass slides
to minimize quenching of ﬂuorescence. Cells were photographed on an Olympus BH-2

ﬂuorescence microscope.

3.4 Results

3.4.1 MDV is stably maintained in subconfluent MDV OU2 cells

Recently we reported development of two ﬁbroblastic cell lines (MDV OU2.2 and
OU2.1) capable of supporting replication and growth of MDV (Abujoub and Coussens,
1995). MDV OU2 cells cannot be visibly distinguished from uninfected parental
CHCC-OU2 cells when grown at a subconﬂuent level ( Figure 3.1, panels A, and B).
Subconﬂuent MDV OU2.2 cells, do not display any signs of lytic MDV infection and
exhibit a doubling time only slightly shorter than parental cells. Within 5 days of
becoming conﬂuent, monolayers of MDV OU2 cells display plaques similar in
appearance to those observed in MDV infected primary or secondary CEF cells (Figure
3.1, panel C, and D). Thus MDV OU2 cells have been viable in cell culture for more

than two years and display plaques only when allowed to reach conﬂuence.

72

Within MDV OU2 cells, MDV may exist in a latent state and is reactivated when
cells become conﬂuent. Alternatively, cytolytic infection of CHCC-OU2 cells by MDV
may be offset by cellular growth in sparse cultures. In this case, plaques become visible
only when contact inhibition decreases cellular growth. To distinguish between these

possibilities, the nature of MDV infection in MDV OU2 cells was examined.

3.4.2 Detection of viral proteins by IIFA staining

MDV OU2 cells express pp38 and pp14 in quantities sufficient to be detected by
western blot analysis (Abujoub and Coussens, 1995). However, expression of other
MDV antigens, particularly those of structural glycoproteins, was not detectable by
western blot analysis (Abujoub and Coussens, 1995). These results are consistent with
MDV existing in MDV OU2 cells in a latent state, similar to MDV lymphoblastoid cells.
Rapid and widespread plaque formation in conﬂuent cultures, however, is consistent with
a fully lytic MDV infection. Therefore, we compared MDV antigen expression by IIFA
staining of sparse and conﬂuent MDV OU2 cells. Consistent with previous results,
monoclonal antibody H19.47 (Cui et al., 1990) against MDV pp38 (generous gift from
Dr. Lucy Lee, USDA-ADOL) detected an abundant cytoplasmic protein (pp3 8) in
Mdl 1p15/CEF, sparse MDV OU2.2p16 (Figure 3.2 panels B, and D respectively), and
conﬂuent MDV OU2.2pl6 cells (data not shown). Also consistent with previous results,
polyclonal antisera to pp14 (Hong and Coussens, 1994) identiﬁed a cytoplasmic protein
(ppl4) in Mdl 1p15/CEF, sparse MDV OU2.2p16 (Figure 3.3 panels B, and D

respectiveIY), and conﬂuent MDV OU2.2p16 cells (data not shown). Uninfected CEF

73

and CHCC-OU2 cells were used as negative controls (panels A and C in Figures 3.2, and
3.3). In contrast, anti-MDV/gB (Silva and Lee, 1984) monoclonal antibody IAN 86 (
generously provided by Dr. Lucy Lee, USDA-ADOL) detected a protein consistent with
MDV gB in conﬂuent MDV OU2.2p16, but not in sparse MDV OU2.2p16 cells (Figure
3.4 panels D, and B respectively). Similarly anti-MDV/gl (Brunovskis, and Velicer,
1995) polyclonal antibodies detected a protein consistent with MDV gI in conﬂuent
MDV OU2.2p16, but not in sparse cells (Figure 3.5 panels, D and B respectively). A
similar protein was not detected in either sparse or conﬂuent CHCC-OU2 cells (panels A,
and C in Fig. 4, and 5). Uninfected CEF and Mdl 1p15/CEF cells were used as negative
and positive controls, respectively (data not shown). Together, results of IIFA staining,
western blot analysis (Abujoub and Coussens, 1995), and MDV OU2 cell grth
characteristics suggest that fully lytic growth of MDV and corresponding expression of

late proteins is initiated only after MDV OU2 cells form a conﬂuent monolayer.

3.4.3 MDV LATs are expressed in sparse MDV OU2 cells

The pattern of MDV gene expression in sparse MDV OU2 cell lines is similar to
that observed in MDV transformed lymphoblastoid cell lines. Restricted expression of
MDV genomes in these cells has led to the conclusion that MDV exists in a latent state in
most lymphoblastoid cells isolated from MDV tumors. Recently, a series of mRNA’s
mapping antisense to the MDV ICP4 gene (MDV LATs) has been detected in various
MDV lymphoblastoid cell lines (MSB-l, RPLI, and MKT-l cells) (Cantello et al., 1994;

Li et al., 1994; Mckie et al., 1995). It is postulated that antisense ICP4 transcripts may

74

regulate expression of MDV genes and are therefore important for maintenance of the
latent state. We used RT-PCR to determine if antisense ICP4 mRNA’s could be detected
in MDV OU2 cell lines under sparse and conﬂuent conditions. Total cellular RNA
isolated from CHCC-OU2 cells, MDV-OU2 cells (sparse and conﬂuent), MSB-l cells,
and Mdl lp35/CEF cultures was used for RT-PCR to detect expression of MDV LATs.
A 335 bp fragment corresponding to the 5' end of M49 cDNA which maps antisense to
the MDV ICP4 gene (Li et al., 1994) was detected in RNA isolated from sparse MDV
OU2 cells, MSB-l cells, and occasionally in conﬂuent MDV OU2 cells, but was not
detected in RNA isolated from lytically infected Mdl 1p3 S/CEF or uninfected
CHCC-OU2 cells (Figure 3.6 panel A). A fragment of approximately 230 bp ampliﬁed
during RT-PCR of MSB-l cells RNA may represent an alternatively spliced variant of
MDV LATs (Figure 3.6 panel A, lane 6).

To verify that products ampliﬁed in RT-PCR reactions were indeed antisense to
the MDV ICP4 homolog gene, PCR products were transferred to a Zeta-probe membrane
and probed with DNA corresponding to the MDV ICP4 gene. Hybridization of
radioactively labeled MDV ICP4 probes to RT-PCR products from reaction with MDV
OU2 and MSB-l RNA conﬁrmed that these products were located within the ICP4 gene.
No hybridization was detected in lanes containing RT-PCR reactions with CHCC-OU2 or
Md11p35 RNA (data not shown). As a control for DNA contamination, no hybridization
was detected when RNA templates were used for PCR without prior addition of
Superscript II Reverse Transcriptase (data not shown). There was no hybridization of

ICP4-speciﬁc probe to the 230 bp band in LAT-speciﬁc or ICP4-speciﬁc RT-PCR

75

reactions with MSB-l RNA(Figure 3.6 panel A, lane 6), or to the 175 bp band in
Md11p35/CEF and MSB-l (Figure 3.6 panel B, lanes 5 and 8), suggesting these bands
represented non-speciﬁc ampliﬁcation products. Expression of MDV LATs in MDV
OU2 cells combined with MDV protein expression patterns strongly suggest that MDV is
in a latent state in these cells. Down regulation of MDV LATs in conﬂuent MDV OU2
cells is associated with an increase in ICP4 gene expression as deduced from RT-PCR
results (Figure 3.6 panel B, compare lanes 6 and 7). MDV ICP4 gene expression in
sparse MDV OU2 cells was very low compared to expression in Md11p35 infected CEF
cells and conﬂuent MDV OU2 cells (Figure 3.6 panel B lanes 5 and 6). These results are
consistent with previous evidence that ICP4 transcripts are predominantly expressed in
lytically infected cells and antisense transcripts are predominantly produced in latently
infected cells (Cantello et al., 1994; Li etal., 1994).
3.4.4 Serial in vitro passage does not cause attenuation of MDV genomes in MDV
OU2 cells

Serial in vitro passage of serotype 1 MDV in CEF or CKC cells is usually
associated with an increase in copy number of a 132-bp direct repeat (DR) within the
BamHI H and D fragments (Maotani et al., 1986). Expansion of the 132-bp DR region is
correlated with attenuation and loss of oncogenicity (Fukuchi etal., 1985). However,
expansion is limited in latently infected MDV lymphoblastoid cells and oncogenicity is
preserved through extended in vitro cultivation. Therefore, we examined MDV genomes
from MDV OU2 cells at different passage levels for expansion of the 132-bp DR region.

A PCR assay developed by Silva (1992) was used to estimate the number of

76

132-bp DR sequences present in MDV genomes following serial in vitro passage of
MDV OU2 cells and various control infections. Total DNA from CHCC-OU2,
Md11p15/CEF, Md11p28/CEF, Md11p48/CEF, Md11p86/CEF, MDV OU2.2p12, MDV
OU2.2p23, and MDV OU2.2p28 cells was used as template for PCR ampliﬁcation with a
primer set ﬂanking the 132-bp DR sequence (het region). In all reactions, except the
CHCC-OU2 negative control, it was possible to detect a 185-bp ampliﬁed fragment
corresponding to one copy of the 132-bp DR (Figure 3.7 panel A). A 317-bp fragment
corresponding to two copies of the 132-bp DR was predominant in reactions containing
pathogenic Mdl 1p15/CEF DNA as well as in DNA isolated from MDV OU2.2p12 and
p23 (Figure 3.7 panel A lanes 3, 4, and 5). Although the 317-bp fragment was present in
DNA ampliﬁed from cells infected with Mdl 1p86, the predominant PCR products were
distributed over a range of bands representing between four and seven copies of the
132-bp DR sequence (Figure 3.7 panel A lane 6).

Results of PCR analyses indicated that the 132-bp DR sequence in MDV DNA
was not signiﬁcantly expanded following extended serial in vitro passage in MDV OU2
cells. In contrast, and as expected, the 132-bp DR region was expanded following serial
in vitro passage in secondary CEF cells. Therefore similar to lymphoblastoid cell lines,
MDV OU2 cells appear to stabilize MDV DNA. Despite many years in culture,
lymphoblastoid cell lines are still capable of inducing MD in susceptible birds. Upon
PCR analysis, 3-5 copies of the 132-hp DR sequences (data not shown) were detected in
MDV genomes from MSB-l cells. To further verify stabilization of MDV het region

DNA in MDV OU2 cells, an equal passage variant of Mdll was generated in CEF cells.

77

Due to a switch in passage numbering upon transfer to the CHCC-OU2 culture system,
Md11p48/CEF represents an equal number of passages as MDV OU2.2p28 cells. A
comparison of equal passage MDV in MDV OU2 cells (MDV OU2.2p28) and CEF cells
(Md11p48) (Figure 3.7 panel B lanes 3 and 2, respectively) clearly demonstrated that the
132-bp DR sequence is stabilized within MDV OU2 cells (Figure 3.7B lane 3) relative to
an equal passage counterpart cultivated on CEF cells (Figure 3.7 panel B lane 2). More
than seven copies of the 132-bp DR were detected in PCR ampliﬁcation (Figure 3.7 panel
A lane 6, and panel B lane 2) of DNA from CEF cells infected with Md11p86, and

Md11p48 respectively.

3.4.5 High passage MDV OU2 cells induce MD in susceptible chickens

Early passages of MDV OU2.2 cells can induce MD in susceptible birds within
3-5 weeks following intraperitoneal injection (Abujoub and Coussens, 1995).
Stabilization of het region DNA in MDV OU2 cells suggested that, as with MDV
lymphoblastoid cells, MDV pathogenicity should also be preserved in long term cultures
of MDV OU2 cells. To conﬁrm that the MDV genomes were not attenuated after
extended serial in vitro culture in MDV OU2 cells, SPF chickens were inoculated with
either MDV OU2.2p8 (low passage) or p23 (high passage) cells at one day of age. As a
negative control, chickens were injected with parental CHCC-OU2 cells. Consistent with
previous results, chickens injected with MDV OU2.2p8 cells developed classical signs of
MD by the end of the fourth week post-inoculation and either died or had to be

euthanized by the end of the ﬁfth week due to widespread paralysis. Necropsy revealed

78

complete bursal atrophy and splenomegaly in all birds inoculated with MDV OU2.2p8.
Chickens inoculated with MDV OU2.2 p23 also displayed signs of MD within 3-5 weeks
post-inoculation. In addition to severe paralysis, birds inoculated with MDV OU2.2p23
cells displayed severe weight loss when compared to CHCC-OU2 and MDV OU2.2p8
injected birds (data not shown). All birds in this group were euthanized by the end of the
ﬁfth week due to signs of severe illness. Upon necropsy, complete bursal atrophy and
early signs of tumor formation were observed in livers of dissected birds. In contrast,
chickens inoculated with parental CHCC-OU2 cells showed no clinical signs of MD.
Control birds inoculated with CHCC-OU2 cells were euthanized at 16 weeks post
inoculation. Necropsy revealed no signs of bursal atrophy, splenomegaly, or tumor
formation.

To conﬁrm that injected birds harbor MDV genomes, total cellular DNA isolated
from kidneys was used as template for PCR ampliﬁcation using a primer set speciﬁc for
the 132-bp DR sequence (Silva, 1992) and for ampliﬁcation of an 850 bp segment of the
pp38 gene (Abujoub and Coussens, 1995). No PCR products were detected when DNA
isolated from two separate control bird kidneys was used as template (Figure 3.8 panel A
lanes 2 and 3). In contrast, ampliﬁcation products consistent with MDV sequences
containing two to four copies of the 132-hp DR sequence were ampliﬁed from MDV
OU2.2p8 inoculated bird kidneys (Figure 3.8 panel A lanes 4 and 5). PCR reactions
using DNA isolated from MDV OU2.2p23 injected birds resulted in ampliﬁcation of
products consistent with two to ﬁve copies of the 132-bp DR sequence (Figure 3.8 panel

A lanes 6 and 7). Mdl 1p15/CEF DNA was used as a positive control for PCR reactions

79

(Figure 3.8 panel A lane 8). PCR reactions primed with a primer set speciﬁc for pp38
gene sequences ampliﬁed an 850 bp fragment in reactions containing DNA isolated from
kidneys of birds inoculated with MDV OU2.2p8 (Figure 3.8 panel B lanes 4 and 5), or
MDV OU2.2p23 (Figure 3.8 panel B lanes 6 and 7). No detectable MDV products were
ampliﬁed in reactions containing DNA from kidneys of birds inoculated with
CHCC-OU2 (Figure 3.8 panels A and B, lanes 2 and 3). The presence of MDV speciﬁc
PCR products indicated that both MDV OU2.2p8 and MDV OU2.2p23 cells were
capable of transferring MDV to susceptible birds.

As an additional test for disseminated viremia in infected birds, blood was
collected at the time of euthanization, and peripheral blood leukocytes (PBLs) were
isolated from whole blood, washed with PBS, and co-cultivated with secondary CEF
cells. CEF monolayers co-cultivated with PBLs from MDV OU2.2p8 and p23 injected
birds displayed plaques consistent with MDV infection 3-5 days post-cultivation. In
contrast and, as expected, no plaques were observed on CEF monolayers co-cultivated
with PBLs from chickens injected with CHCC-OU2 cells. The disseminated viremia is
an indication that MDV OU2 cells induced a systematic MDV infection in the inoculated
birds and the virus was not localized to the site of inoculation (intraperitoneal cavity).

Results of in viva experiments strongly support our ﬁndings that MDV is
stabilized in MDV OU2 cells. After more than two years of continuous culture, virus

harbored in MDV OU2 cells is still capable of inducing MD in susceptible birds.

80

3.5 Discussion

The MDV strain Mdll infected ﬁbroblastic cell lines MDV OU2.1 and OU2.2
(Abujoub, and Coussens, 1995), are permissive for MDV replication. In contrast with
primary CEF and DEF, these cell lines have an unlimited life span, and have been in
continuous culture for more than two years under conditions similar to that used for
primary ﬁbroblasts. Growth characteristics and appearance of MDV OU2 cells are
indistinguishable from the parental CHCC-OU2 immortalized ﬁbroblastic cell line
(Ogura and Fujiwara, 1987). MDV OU2 cells display characteristics consistent with
MDV genomes existing in a latent state, similar to that observed in MD-lymphoblastoid
cell lines. However, the appearance of distinct plaques in conﬂuent cell monolayers is
more consistent with a lytic infection (Abujoub, and Coussens, 1995). Thus, MDV OU2
cells appear to “switch” from a latent to lytic infection, co-incident with cells reaching
conﬂuence. Both MDV OU2 cell lines are capable of transferring MDV infection to CEF
in culture and inducing clinical signs of MD in susceptible birds. Virus yields from these
cell lines is comparable to or greater than yields produced by CEF cultures. Thus,
CHCC-OU2 and MDV infected derivatives provide an excellent system for cultivation of
MDV vaccine viruses, production of MDV mutants (with coordinated expression of
essential genes), and a model for herpesvirus latency/reactivation.

The overall aims of this study were to determine the status of MDV genomes in
MDV OU2 cells and to examine the effect of in vitro passage on stability of MDV
genomes and virus pathogenesis within MDV OU2 cells. To achieve our ﬁrst goal, we

used IIFA staining and RT-PCR to examine differential gene expression in sparse versus

81

conﬂuent MDV OU2 cells. Our results, summarized in Table 3.1, support the hypothesis
that MDV is in a latent state in MDV OU2 cells, similar to MDV lymphoblastoid cell
lines. MDV ppl4 (the product of an IE gene) and pp38 (the product of an early gene) are
expressed in both lytically and latently infected cells, whereas glycoproteins (encoded by
late genes) are expressed mainly in lytically infected cells. IIFA staining data clearly
demonstrate that both pp14 and pp38 are expressed in both sparse and conﬂuent MDV
OU2 cells, whereas expression of structural glyc0proteins (glycoproteins B and 1), occurs
only in conﬂuent cell monolayers. This pattern of protein expression is consistent with
MDV genomes existing in a latent state in sparse MDV OU2 cells. MDV. appears to be
reactivated and a full cycle of lytic infection initiated after cells reach conﬂuence.
Cantello et al.,(1994) and Li et al., (1994), separately reported the identiﬁcation of
transcripts (MDV LATs) that map antisense to the ICP4 homolog gene of MDV. MDV
LATs are expressed at a signiﬁcantly higher level in lymphoblastoid cell lines (MSB-l
and RPLl) than in lytically infected cells. Based on these ﬁndings, it was speculated that
MDV LATs may play a role in maintenance of latency by negatively regulating MDV
ICP4 expression (Cantello et al., 1994; Li et al., 1994). Using RT-PCR, we examined the
level of expression of MDV LATs in MDV OU2 cells from sparse cultures versus
conﬂuent cultures. Expression of MDV LATs in sparse MDV OU2 cells was comparable
to that observed in MSB-l cells. MDV LAT expression is down regulated when cells
become conﬂuent and was not detected or detected at a very low levels when cells were
allowed to display plaques characteristic of lytic MDV infection. When the level of

MDV ICP4 expression was examined, the level of ICP4 expression was inversely

82

proportional to the level of MDV LAT expression. The similarity between MDV
LAT/ICP4 expression patterns in sparse MDV OU2 cells to MSB-l cells strongly
supports our hypothesis that MDV exists in a latent state in MDV OU2 cells in sparse
cultures. In addition, our results conﬁrm the hypothesis of Cantello et al., (1994) and Li
et al., (1994) that MDV LATs may serve to down regulate expression of MDV ICP4.

The factors responsible for the switch from a latent state in sparse cultures to a
lytic infection in conﬂuent monolayers is not understood. Generally, factors important in
determining latent or lytic infection cycles in many herpes viruses are cellular activators
or repressors which in turn activate or repress viral gene products responsible for
determining the pathway of viral infection (Garcia-Blanca and Cullen, 1991). MDV OU2
cells are similar to their parental CHCC-OU2 cells in being contact inhibited. It is
possible that changes in cell growth associated with conﬂuence and contact inhibition act
to trigger reactivation of MDV leading to expression of the full complement of MDV
genes and lytic replication. It is tempting to speculate that such a trigger may be a
regulator (repressor) of MDV LAT expression. As in CEF cells, lytic replication of
MDV in conﬂuent MDV OU2 cell cultures appears to be of the productive restrictive
class with no infectious virions released into the culture ﬂuid (Abujoub and Coussens,
unpublished observations)

Serial in vitro passage of virulent MDV strains on CEF cells results in attenuation
and loss of oncogenicity which is correlated with het region expansion. In this report, we
provide evidence that a highly variable MDV genome region is stabilized in MDV OU2

cells, and after over two years of continuous in vitro culture MDV from MDV OU2 cells

83

is still oncogenic. PCR analyses showed that the number of 132-bp DR sequences did
not change signiﬁcantly in MDV genomes after more than 30 in vitro passages. Whereas,
Mdll passed in CEF culture for the same number of passages (Md11p48/CEF) exhibited
signiﬁcant expansion of the 132 bp DR region. The number of 132-bp DR sequences in
oncogenic MDV strains is typically between 2-5 copies, whereas the average number in
strains attenuated by in vitro cultivation on CEF cells is 3 to greater than seven copies.
These results suggest that, as with MDV lymphoblastoid cell lines MDV OU2 cell lines
tend to stabilize the MDV genome. However, CHCC-OU2 cells are non-tumorigenic and
thus may offer an attractive alternative for production of recombinant MDV which may
be unstable in CEF cultures.

Marek’s disease can be induced by injection of MDV infected cells into
susceptible birds. Tumor incidence can reach 100%, but is dependent on various natural
and experimental conditions and factors, for example virus strain and dose, site of
injection, age at primary exposure, and the genetic background of the birds (Calnek, and
Witter, 1991). Oncogenic serotype 1 MDV infected CEF, DEF, and CKC cells as well as
some producer MD-lymphoblastoid cell lines such as MSB-l, CU36, and CU41 are able
to induce MD in susceptible birds. Similarly, MDV OU2 cells are capable of inducing
MD in susceptible birds. With serial in vitro passage, in CEF, DEF, and CKC cells
oncogenic MDV strains are rapidly attenuated. Non-oncogenic MDV strains tend to lose
potency as vaccines with continuous in vitro cultivation. Propagation in lymphoblastoid
cells can stabilize viral genomes and preserve the initial character of resident MDV

strains. However, Lymphoblastoid cells are oncogenic and have not been found to harbor

84

common vaccine strains of MDV.

Since, PCR analyses showed that the 132-bp DR region of MDV was stabilized
during prolonged cultivation in MDV OU2 cells. It was important to determine if
prolonged cultivation of MDV in CHCC-OU2 cells could preserve oncogenicity.
Susceptible birds inoculated with MDV OU2.2p23 developed signs of MD including
severe weight loss and paralysis similar to those inoculated with MDV OU2.2p8. PCR
ampliﬁcation of DNA isolated from kidneys of infected birds demonstrated systemic
presence of MDV and indicated that infectious virions contained between 2-5 copies of
the MDV 132-bp DR sequences. Our PCR and in vivo data indicates that MDV genomes
are stabilized within MDV OU2 cell lines, similar to that seen in lymphoblastoid cell
lines. However, unlike lymphoblastoid cell lines, the parental CHCC-OU2 cells are
non-oncogenic (Abujoub and Coussens, 1995; Ogura and Fujiwara, 1987). No evidence
of tumor formation or any illness in birds inoculated with CHCC-OU2 parental cells up
to 16 weeks post-inoculation has been found.

This report shows, for the ﬁrst time, the presence of latent MDV genomes in a
sustainable ﬁbroblast cell line. Establishment and characterization of these cell lines will
reduce many of the difﬁculties associated with MDV experimentation and vaccine
production. For example, studying differential gene expression between sparse and
conﬂuent MDV OU2 cells will help in the search for key switches in MDV latency. A
key difference noted in the present report between latent and lytic MDV OU2 infections
is down regulation of MDV LAT expression coincident with culture conﬂuence.

Regulation of these transcripts in sparse and conﬂuent MDV OU2 cells is currently under

85

investigation. Stabilization of MDV genomes within MDV OU2 cell lines will make this
system ideal for generation of mutants and recombinant viruses. In addition, propagation
of MDV vaccine strains on CHCC-OU2 cells, unlike on CEF, offers the possibility that

continuous passage will not offset efﬁcacy of MDV vaccines.

86

Table 3.1 Summary of IIFA and RT-PCR results.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Expressed gene pp38 pp14 gB gI ICP4 LATs
Cell Type
MSB-l ND ND ND ND + ++
Mdl l/CEF ++ ++ ++ ++ ++ -
Sparse MDV OU2 ++ ++ - - +/- ++
Conﬂuent MDV OU2 4+ ++ ++ ++ ++ +/-
CHCC-OU2 - - - - - -

ND not determined.

+/— low level of expression.

+ Normal level of expression

++ high level of expression.

not detected.

 

87

Figure 3.1 Subconﬂuent MDV OU2.2p23 and MDV OU2.1p23 cells display a
cobblestone appearance, similar to that seen with uninfected parental CHCC-OU2 cells
(Panels A and B respectively). At 5-7 days after cells became conﬂuent, numerous
plaques consistent with MDV lytic infection are observed on cultures of MDV OU2.2p23
and MDV OU2.1p23 cells (Panels C and D respectively).

 

 

89

Figure 3.2 IIF A staining with monoclonal antibody H19.47 speciﬁc for MDV pp38.
Uninfected CEF, Md11p15, CHCC-OU2, and sparse MDV OU2.2 cells were grown on
glass cover slips. Cells were ﬁxed and stained as described in Materials and Methods.
Sheep anti-mouse IgG conjugated with FITC (Sigma) was used as a secondary antibody.
Cells were photographed on an Olympus BH-2 ﬂuorescence microscope with a 40X
objective and 3.3X photo eyepiece. Panel A: uninfected CEF cells. Panel B:

Mdl 1p15/CEF cells. Panel C: CHCC-OU2 cells. Panel D: Sparse MDV OU2.2p16
cells.

 

 

90

 

91

Figure 3.3 IIFA staining with polyclonal antisera against MDV pp14. Uninfected CEF,
Md11p15, CHCC-OU2, and sparse MDV OU2.2 cells were grown on glass cover slips.
Cells were ﬁxed and stained as described in Materials and Methods. Goat anti-rabbit IgG
conjugated with PE (Vector Laboratories Inc., Burlingame, CA) was used as a secondary
antibody. Cells were photographed on an Olympus BH-2 ﬂuorescence microscope with a
40X objective and 3.3X photo eyepiece. Panel A: uninfected CEF cells. Panel B:

Mdl 1p15/CEF cells. Panel C: CHCC-OU2 cells. Panel D: Sparse MDV OU2.2p16
cells.

92

 

93

Figure 3.4 IIFA staining with monoclonal antibody IAN 86 speciﬁc for MDV gB
homologue. Sparse CHCC-OU2, sparse MDV OU2.2, conﬂuent CHCC-OU2, and
conﬂuent MDV OU2.2 cells were grown on glass cover slips. Cells were ﬁxed and
stained as described in Materials and Methods. Sheep anti-mouse IgG conjugated with
FITC (Sigma) was used as a secondary antibody. Cells were photographed on an
Olympus BH-2 ﬂuorescence microscope with a 40X objective and 3.3X photo eyepiece.
Panel A: Sparse CHCC-OU2 cells. Panel B: Sparse MDV OU2.2 cells. Panel C:
Conﬂuent CHCC-OU2 cells. Panel D: Conﬂuent MDV OU2.2 cells.

 

 

94

 

95

Figure 3.5 IIFA staining with polyclonal antisera against MDV g1 homologue. Sparse
CHCC-OU2, sparse MDV OU2.2, conﬂuent CHCC-OU2, and conﬂuent MDV OU2.2
cells were grown on glass cover slips. Cells were ﬁxed and stained as described in
Materials and Methods. Sheep anti-rabbit IgG conjugated with FITC (Sigma) was used
as a secondary antibody. Cells were photographed on an Olympus BH-2 ﬂuorescence
microscope with a 40X objective and 3.3X photo eyepiece. Panel A: Sparse CHCC-OU2
cells. Panel B: Sparse MDV OU2.2 cells. Panel C: Conﬂuent CHCC-OU2 cells. Panel
D: Conﬂuent MDV OU2.2 cells.

 

97

Figure 3.6 RT-PCR ampliﬁcation of a 335 bp fragment of MDV LATs and ICP4 gene.
Panel A) LAT speciﬁc primers were used to amplify a 335 bp fragment using total RNA
isolated from CHCC-OU2 (lane 2), Md11p35/CEF (lane 3), conﬂuent MDV OU2.2p31
(lane 4), sparse MDV OU2.2p31 (lane 5), MSB-l cells (lane 6). Lanes 7 and 8 are PCR
negative and positive control respectively. Panel B) Primers speciﬁc for the MDV ICP4
transcript were used for RT-PCR ampliﬁcation of a 300 bp fragment using RNA isolated
from CHCC-OU2 (lane 4), Md11p35/CEF (lane 5), conﬂuent MDV OU2.2p31(lane 6),
sparse MDV OU2.2p31 (lane 7), MSB-l cells (lane 8). Lanes 2 and 3, represent PCR
negative and positive controls, respectively. A 1 kb DNA ladder marker (GIBCO BRL)
(lane 1) was used for size comparison. Numbers at the left indicate approximate sizes of
ampliﬁed fragments. Smaller size fragments are due to non-speciﬁc ampliﬁcation and
were not detected using Southern blot analysis (data not shown)

[I

l 2 13 1115 63 7 8

 

b

mmmwm

l 2 £3 11.5 65 7 8

 

b

mmmwm

99

Figure 3.7 PCR ampliﬁcation of the 132-bp DR sequence. Panel A) DNA isolated from
CHCC-OU2 (lane 2), Mdl 1p15/CEF (lane 3), MDV OU2.2p12 (lane 4), MDV
OU2.2p23 (lane 5), and Mdl 1p86/CEF (lane 6) was used as template for PCR
ampliﬁcation. A 1 KB ladder marker (GIBCO BRL) (lane 1) was used for size
comparison. DNA isolated from CHCC-OU2 cells (lane 2) served as negative control.
Panel B) DNA isolated from Mdl 1p15/CEF (lane 1), Mdl 1p48/CEF (lane 2), and MDV
OU2.2p28 (lane 3) was used as template for PCR ampliﬁcation of DR sequences.
Numbered arrows at the right indicate number of copies of the 132-bp DR sequence.
Arrows at the left represent positions of selected bands from the 1 KB ladder marker
(GIBCO BRL).

100

l 2 3.44 55 6

8432 1
i4 4

 

.psr’.’..
wmmwmmmm

543' 1

i<<

 

mama mmm

517

101

Figure 3.8 PCR ampliﬁcation of an 850 bp of MDV pp38 gene. Panel A) DNA isolated
from Kidneys of birds inoculated with CHCC-OU2 (lanes 2 and 3), MDV OU2.2p8
(lanes 4 and 5), and MDV OU2.2p23 (lanes 6 and 7) was used as template for PCR
ampliﬁcation of the 132 bp DR region as described in Materials and Methods. DNA
isolated ﬁom Md11p15 and p28/CEF (lanes 8 and 9) served as positive controls for
DNA isolation and PCR reaction. Panel B) DNA isolated from Kidneys of birds
inoculated with CHCC-OU2 (lanes 2 and 3), MDV OU2.2p8 (lanes 4 and 5), and MDV
OU2.2p23 (lanes 6 and 7) was used as template for PCR ampliﬁcation of 850 bp as
described in Material and Methods. DNA isolated from Md11p15 and p28/CEF (lanes 8
and 9) served as positive controls for DNA isolation and PCR reaction. A 1 Kb ladder
marker (GIBCO BRL) (lane 1) was used for size comparisons.

102

A
123456789

8

2'.
A AA“
dream:

E

ii §§¥§§
vw ww

 

123456789

2036 p
rose >
1013 >

22.2,:

 

Chapter 4

DISCUSSION

103

4.1 SUMMARY OF RESULTS AND CONCLUSION

The two major difﬁculties confronting MDV research are, 1) the cell associated
nature of the virus, and 2) the lack of a continuous cell line for virus growth and
selection. Although primary CEF and DEF cells are permissive for MDV replication,
primary cultures are characterized by slow growth and a limited life span. These factors
require continual passage of MDV infected cells onto uninfected cells in order to obtain
sufficient quantities of MDV for research and vaccine production. In addition, CEF and
DEF primary cells must be prepared on a regular basis from 10 or 11 day old chick
embryos, adding signiﬁcantly to the expense and difﬁculty of studying MDV, and to the
expense of producing MDV vaccines.

In this dissertation we have taken the immortalized, virus free, CHCC-OU2 cells
and established a sustainable cell culture system for study of MDV. The CHCC-OU2 cell
line we used is a ﬁbroblastic cell line that was derived from chemically mutagenized
chick embryo cells (Ogura and Fujiwara, 1987). When the CHCC-OU2 cells were
infected with Mdl 1p15/CEF, plaques characteristic of MDV infection were observed on
the monolayer 3-4 weeks post infection. The plaques were isolated and expanded in order
to obtain pure monoclonal cell lines (MDV OU2.1 and MDV OU2.2). To conﬁrm that
these clonal cell lines did harbor MDV, DNA was isolated and used for PCR and

Southern blot analyses. The results of these analyses clearly demonstrated the presence

104

1 0 5
of MDV genomes within each MDV OU2 cell line.

To verify that MDV OU2 cells support the replication of MDV, western blot
analysis and IIFA staining were used to detect MDV proteins. Western blot analysis
clearly demonstrated that a subset of viral proteins (pp38 and pp14) were expressed at a
detectable level in the MDV OU2 cell lines, however we were not able to detect
expression of structural glycoproteins. These glycoproteins are only expressed in
productively (lytically) infected cells, but not in latently infected cells. pp38 and pp14
are expressed in both lytically and latently infected cells (Chen et al., 1992; Hong and
Coussens, 1994). The western blot results suggested that MDV persisted in a latent state
in MDV OU2 cells. However, the presence of distinct plaques in conﬂuent MDV OU2
cells monolayers implied cytolytic activity associated with MDV infection. Based on
these preliminary results we hypothesized that MDV may exists in a latent state within
sparse MDV OU2 cells and is reactivated when cells become conﬂuent.

To answer this question, we further analyzed the pattern of protein expression in
MDV OU2 cell lines, IIFA staining was used to study differential gene expression in
sparse versus conﬂuent MDV OU2 cells. Consistent with the western blot results, MDV
pp14 and pp38, were detected as abundant cytoplasmic proteins in both sparse and
conﬂuent MDV OU2 cells. In contrast, MDV gB and g1, structural glycoproteins were
not detected in sparse MDV OU2 cells, however were abundant in conﬂuent cells. The
western blot results, the IIF A staining results, and MDV OU2 cell growth characteristics
suggested that productive MDV infection and corresponding expression of late proteins is

initiated only after MDV OU2 cells become conﬂuent.

106

MDV LATs expression is associated with MDV latency, and was examined in
sparse versus conﬂuent MDV OU2 cells. Expression of MDV LATs in sparse MDV
OU2 cells was comparable to that observed in latently infected MDV lymphoblastoid cell
lines (MSB-l, RPLl, and MKT-l). Down regulation of MDV LAT expression when
MDV OU2 cells became conﬂuent was associated with an increase in MDV ICP4
expression. Conversely, MDV ICP4 expression was very low in sparse MDV OU2 cells
when compared to expression in conﬂuent cells. The correlation between expression of
MDV ICP4 and LATs in sparse versus conﬂuent MDV OU2 cells strongly supported our
hypothesis that MDV exists in a latent state in MDV OU2 cells in sparse cultures, with
similar LAT/ICP4 ratio to that seen in MDV lymphoblastoid cell lines.

MDV lymphoblastoid cell lines are immortalized cell lines, which are
considered to be latently infected with MDV, and can transfer MDV to CEF or DEF in
vitro and to susceptible birds in viva (Schat et al., 1985). Similar to MDV
lymphoblastoid cell lines, MDV OU2 cells were capable of transferring MDV infection
to CEF monolayer cultures in vitro and induced clinical signs of MD in viva which was
characterized by a marked decrease in growth rates, blindness, and paralysis of legs,
wings, and neck. Necropsy revealed bursal atrophy, splenomegaly, nerve demyelination,
and signs of early tumor inﬁltration of the liver, kidney and spleen. There was no
difference in virulence observed in groups inoculated with MDV OU2 cells or
Mdl 1p15/CEF. In contrast, birds inoculated with parental CHCC-OU2 showed no
clinical signs of illness, no evidence of tumor formation, or viremia for more than 16

weeks after inoculation. PCR analysis of DNA isolated from kidney tissues demonstrated

107

that MDV was present in remote tissues of birds injected with MDV OU2 cells. As an
additional test for disseminated viremia in MDV OU2 infected birds, peripheral blood
leukocytes were collected and co-cultivated with secondary CEF cells. CEF monolayers
displayed plaques consistent with MDV infection 3-5 days post-cultivation.

Serial in vitro passage of serotype 1 MDV in CEF cells is usually associated with
an ampliﬁcation in copy ntunber of the 132-bp DR within the BamHI H and D fragments.
Expansion of the 132-bp DR region has been correlated with attenuation and loss of
oncogenicity. However, this expansion is limited in latently infected MDV
lymphoblastoid cell lines and oncogenicity is preserved through extended in vitro
cultivation.

A PCR method developed by Silva (1992) to distinguish attenuated from wild
type MDV, was used to estimate the copy number of the 132 bp DR. PCR results
indicated that the 132 bp DR in MDV OU2 cells was not signiﬁcantly expanded after
extensive serial in vitro passage. Three to ﬁve copies of the 132-bp DR were detected in
MDV genomes from MDV OU2 cells. Whereas MDV of the same passage number in
CEF cells, exhibited signiﬁcant expansion in the 132-bp DR. Thus, similar to
lymphoblastoid cell lines, MDV DNA appears to be stabilized in MDV OU2 cells. To
conﬁrm that MDV in high passage MDV OU2 cells was still oncogenic and could induce
MD, susceptible chickens were inoculated with MDV OU2 cells, which had been in
continuous culture for more than two years. These chickens developed signs of MD
similar to those injected with low passage MDV OU2 cells. PCR ampliﬁcation of DNA

isolated from kidneys of the infected birds demonstrated both the systemic presence of

1 0 8

MDV and that MDV contained only 3-5 copies of the 132 bp DR. Our In viva data
demonstrated that MDV oncogenicity was preserved in MDV OU2 cells after prolonged
in vitro cultivation.

These MDV OU2 cell lines are the ﬁrst ﬁbroblastic cell lines that can support
MDV replication and does not attenuate MDV. We have also presented evidence that
MDV in sparse MDV OU2 cells appear to be latent and that at conﬂuence the MDV
infection becomes productive with the appearance of distinct plaques, expression of late
structural proteins, down regulation of LATs, and up regulation of ICP4 expression.
Therefore, MDV appears to switch from a latent state in sparse MDV OU2 cells to a lytic
“productive” infection when conﬂuence is reached.

Establishment and characterization of these cell lines has the potential to
eliminate many difﬁculties associated with MDV experimentation. MDV OU2 cells can
now be used for the production of MDV mutants by positive selection. Also a continuous
cell line expressing essential MDV genes can be used in knockout experiments. The cell
line may also serve as a model for MDV latency and reactivation. In addition, the MDV
infected derivatives of CHCC-OU2 provide an excellent system for cultivation of MDV
for vaccine use. The same approach described in this dissertation has been successful in
developing cell lines that harbor MDV vaccine strains, such as herpesvirus of turkeys
(HVT strain FC126), serotype 2 MDV (strain SB-l), and an attenuated serotype 1 MDV

(Md11p83).

109

4.2 FUTURE RESEARCH

Development of a sustainable cell culture system for replication and study of
MDV provides many new opportunities for MDV research, and is especially useful for
MDV vaccine development. These cell lines may be an excellent in vitro model to
understand maintenance of latency and reactivation for all alphaherpesviruses. However,
many questions remain to be answered and future research should focus on studying: 1)
transcription patterns in sparse MDV OU2 cells 2) differential gene expression between
sparse and conﬂuent MDV OU2 cells, 3) the effect of 5-iodo-2-deoxyuridine and 5-
azacytidine on latent cells, 4) the status of viral genomes in MDV OU2 cells, and 5) cell
cycle progression and expression of cell speciﬁc proteins in sparse versus conﬂuent MDV

OU2 cells.

4.2.1 Studying transcription patterns in sparse MDV OU2 cells

A limited set of viral genes are usually expressed in latent cells, and the number of
transcripts varies between different lymphoblastoid cell lines. In MSB-l cells (an
expression cell line) 29 transcripts have been reported. In CU41 cells (a non-expression
cell line), only 7 transcripts have been detected, and in HP] cells (a non-producer cell
line), only 4 transcripts were detected. Evidence presented in this dissertation suggests
that MDV OU2 cells are similar to MSB-l cells. Therefore, it would be important to
compare transcription activity in sparse MDV OU2 cells with that in MSB-l cells. Since
transcriptional activity in MSB-l cells is limited to the repeat regions of MDV genome,

northern blot analysis (using DNA probes corresponding to the repeat regions of MDV

110

genomes), should yield signiﬁcant information about the transcriptional activity in sparse

MDV OU2 cells.

4.2.2 Studying differential gene expression between sparse and conﬂuent MDV OU2
cells

A key difference noted between latent and lytic MDV OU2 infections, is down
regulation of MDV LAT expression when the cells become conﬂuent. Cellular and/or
viral transactivators may play a major role in maintenance and reactivation from latency.
The differential display technique (Liang and Pardee, 1992) could be a way to compare
mRNAs from CHCC-OU2, sparse MDV OU2 and, conﬂuent MDV OU2 cells. This
technique would identify transcripts that have been up regulated or down regulated when
the MDV OU2 cells switch from a latent to lytic state. Cloning and identifying these
transcripts would help understand the MDV-host interactions that lead to latency and the

interactions necessary for reactivation.

4.2.3 Studying the effect of 5-iodo-2-deoxyuridine and 5-Azacytidine on sparse MDV
OU2 cells

MDV DNA methylation may play a role during latency (Fynan et al., 1993).
MDV genomes within MSB-l and RPL-l lymphoblastoid cell lines, have been found to
be methylated at various sites within the repeat regions (Kanamori et al., 1987). Also,
MDV genomes within an avian leukosis virus (ALV) transformed B-cell lines was found

to be methylated, and less than 2% of these cells expressed MDV antigens (Fynan et al.,

111

1993). However when DNA methylation was prevented by 5-azacytidine, MDV
replication increased. Similarly, 5-azacytidine treatment of MSB-l cells resulted in
hypomethylation and increased mRNA transcription from the repeat region (Hayashi et
al., 1994 and 1995). Since our evidence suggests that MDV is latent in sparse MDV OU2
cells, and lytic in conﬂuent cells, it would be important to compare the methylation of
MDV DNA from latent and lytic MDV OU2 cells.

To compare MDV DNA from sparse and conﬂuent MDV OU2 cells, MDV DNA
would be digested with HpaII or Mspl, and then analyzed by Southern blot hybridization
using the BamHI H (transcriptionally active region) and B fragments (transcriptionally in
active region) as probes (Hayashi et al., 1994). Both HpaII and Mspl recognize and
cleave the sequence 5'-CCGG-3'. However, when the internal cytosine is methylated, this
site can be cleaved only by Mspl but not by HpaII. Thus, the cleavage patterns generated
will differentiate methylated 5'-CCGG-3' sites from unmethylated ones. On the other
hand, treatment of MDV lymphoblastoid cell lines with IudR induces viral antigen
expression but does not affect viral DNA replication (Silver et al., 1979). Would IudR
have an effect on sparse MDV OU2 cells? IudR can be added directly to sparse cells and
protein expression can be examined by IIFA staining before and after the addition of

IudR.

4.2.4 Studying the state of viral genomes in MDV OU2 cells
MDV genomes in MDV lymphoblastoid cell lines appear to be primarily

integrated into cellular chromosomes (Delecluse and Hammerschmidt, 1993; Delecluse et

112

al., 1993). MDV DNA in MDV OU2 cells could be linear, episomal or integrated. Many
different approachescan be taken to distinguish between these possibilities. The Gardella
gel technique (Gardella et al., 1984) allows differentiation between linear and episomal
forms of viral DNA, and can be used to indirectly detect MDV integration into cellular
chromosomes. However, a more conclusive and direct method is exonuclease V
digestion. Exonuclease V digests linear double-stranded DNA but does not cut circular
DNA. In addition it also does not digest DNA contains nicks or gaps. Therefore treating
MDV DNA from MDV OU2 cells with exonuclease V, followed by Southern
hybridization will provide information regarding the state of MDV DNA in MDV OU2

cell lines.

4.2.5 Studying cell cycle progression and expression of cell specific proteins

In culture, ﬁbroblasts can be arrested from further cell proliferation and enter a
quiescent state. The cells are usually arrested in the G0 phase of the cell cycle, either by
contact inhibition or by serum starvation. These cells can resume the cell cycle when the
conditions blocking growth are removed. Molecular characterization of the mechanisms
regulating cell transition from the quiescent to the growing state, in human ﬁbroblasts,
resulted in identiﬁcation of statin (Wang, 1985). Statin, a 57,000-Dalton nuclear
phosphoprotein, is associated with the nuclear envelop, and is only present in
nonproliferating ﬁbroblasts (Wang, 1985, Lee et al., 1992). Statin was found to be
associated with a 45,000-Dalton serine/threonine kinase (p45 kinase), which was found to

be only active in nonproliferating ﬁbroblasts (Lee et al., 1992). When these cells re-

113

entered the cell cycle, statin rapidly declined and was removed from the nuclear matrix
prior to initiation of DNA synthesis (Wang and Lin, 1986), while expression of another
nuclear protein, cycline (PCNA), a protein found only in replicating cells, increased in

parallel with DNA synthesis (MacDonald-Bravo and Bravo, 1985).

A 57,000-Dalton protein similar to statin was puriﬁed from terminally
differentiated rat liver hepatocytes (Rlp57) (Sester et al., 1990). Another antigenically
related protein, a 49,000-Dalton (pSl) was identiﬁed by screening a rat brain Agtll
expression library with a monoclonal statin antibody (Ann et al., 1991). The p81 mRN A
was found to be most abundant in G0 phase of 3T3 mouse ﬁbroblasts, but become
signiﬁcantly reduced in GI and S phase cells (Ann et al., 1991). All these reports have
identiﬁed a group of genes that are expressed speciﬁcally in nonproliferating cells.

To determine the phase of the cell cycle, where MDV OU2 cells and their parental
counter parts are arrested as a results of contact inhibition. Cell cycle phase distribution
can be measured by quantitation of DNA by propidium iodide (PI) staining. At the same
time, IIF A staining using a monoclonal antibody , S-30, against human ﬁbroblast statin
(Wang, 1985), or the polyclonal antibody, raised against Rlp57 (Sester et al., 1990), can
be used to search for a statin homolog in the CHCC-OU2 cells and their MDV
derivatives. The association between statin and p45 kinase in nonproliferating human
ﬁbroblasts, suggests that a similar system may play a role in MDV reactivation from
latency by phosphorylating a protein (MDV or cellular encoded) critical for the switch
from latent to lytic infection. Identifying and cloning a gene encoding an avian statin

homolog, and examining the effect of its expression on MDV gene expression and on

114

MDV replication on sparse MDV OU2 cells would enable investigation of the role
cellular factors has on establishing MDV latency and reactivation. These identiﬁed avian
genes (statin homolog gene) can be cloned downstream of an inducible promoter and the
recombinant transfected into MDV OU2 cells. The effect of the statin homolog on
expression of viral antigens and viral replication in conﬂuent versus sparse MDV OU2
cells can be monitored by IIF A staining against late viral proteins and by light
microscopy (plaque formation).

Further characterization of the MDV OU2 cell lines will have a major impact on

MDV research and speciﬁcally on MDV latency and reactivation .

LIST OF REFERENCES

REFERENCES

Abujoub, A., and P. M. Coussens. (1995). Development of a sustainable chick cell line
infected with Marek’s disease virus. Virol. 214:541-549.

Akiyama, Y., S. Kato, and N. Iwata. (1973). Continuous cell culture from lymphoma of
Marek's disease. Biken J. 16:177-179.

Akiyama, Y., and S. Kato. (1974). Two cell lines from lymphomas of Marek's disease.
Biken J. 17:105-116.

Anderson, A. S., A. Francesconi, and R. W. Morgan. (1992). Complete nucleotide
sequence of the Marek’s disease virus ICP4 gene. Virol. 1892657-667.

Ann, D. K., I. K. Moutsatsos, T. Nakamura, H. H. Lin, P-L. Mao, M-J. Lee, S. Chin,
R. K. H. Liem, and E. Wang. (1991). Isolation and characterization of the rat

chromosomal gene for a polypeptide (pSl) antigenically related to statin. J. Biol. Chem.
266:10429-10437.

Bacon, L. D., R. L. Witter, and A. M. Fadly. (1989). Augmentation of
retrovirus-induced lymphoid leukosis by Marek’s disease herpesvirus in white leghom
chickens. J. Virol. 63:504-512.

Baichwal, V. R., and B. Sugden. (1988). Latency comes of age of herpesviruses. Cell
52:787-789.

Becker, Y., Y. Asher, E. Tabor, 1. Davidson, and M. Malkinson. (1994). Open
reading frames in a 4556 nucleotide sequence within MDV-1 BamHI D fragment:

evidence for splicing of mRNA from a new viral glyc0protein gene. Virus genes.
8.1 :55-69.

Benton, W. J., and M. S. Cover. (1957). The increased incidence of visceral
lymphomatosis in broiler and replacement birds. Avian Disease 1:320-327.

Beran, G. W., E. B. Davies, P. V. Arambuto, C. A. Will, H. T. Hill, and D. L. Rock.

(1980). Persistence of pseudorabies virus in infected swine. J. Am. Vet. Med. Assoc.
176:998-1000.

115

116

Boussaha, M., W. Sun, R. Pichyaugura, S. J. Triezenberg, and P. M. Coussens.
(1996). Marek’s disease virus VP16 contains two potential activation domains and is
able to transactivate IE gene products. (Submitted for publication).

Brunovskis, P., and L. F. Velicer. (1995). The Marek’s disease virus (MDV) unique
short region: alpha herpesvirus-homologous, fowlpox virus-homologous, and
MDV-speciﬁc genes. Virol. 206:324-338.

Buckmaster, A. E., S. D. Scott, M. J. Sanderson, M. E-G. Boursnell, L. J. N. Ross,
and M. M. Binns. (1988). Gene sequence and mapping data from Marek’s disease virus
and herpesvirus of turkeys: implication for herpesvirus classiﬁcation. J. Gen. Virol. 69,
2133-2042.

Calnek, B. W. (1985). Marek’s disease virus and lymphoma. In F. Rapp (ed.),
Oncogenic Herpesviruses, vol. 1: 103-143.

Calnek, B. W., H. K. Adlinger, and D. E. Kahn. (1970). Feather follicle epithelium: A
source of enveloped and infectious cell-free herpesvirus from Marek’s disease. Avian
Disease 14, 219-233.

Calnek, B. W., K. K. Murthy, and K. A. Schat. (1978). Establishment of Marek's
disease lymphoblastoid cell lines from transplantable versus primary lymphomas. Int. J.
Cancer 21: 100-107.

Calnek, B. W., and R. L. Witter. (1991). In "Diseases of Poultry: Marek's Disease" (B. W.
Calnek, H. J. Barnes, C. W. Beard, W. M. Reid, and H. W. Yoder, Jr., Eds), pp. 342-385.
Iowa State University press, Ames, IA.

Calnek, B. W., W. R. Shek, and K. A. Schat. (1981a). Latent infection with Marek’s
disease virus and turkey herpesvirus. J. Natl. Cancer. Inst. 66:585-590.

Calnek, B. W., W. R. Shek, and K. A. Schat. (1981b). Spontaneous and induced
herpesvirus genome expression in Marek’s disease tumor cell lines. Infection and Immunity,
34:483-491.

Cantello, J. L., A. S. Anderson, and R. W. Morgan. (1994). Identiﬁcation of
latency-associated transcripts that map anitsense to the ICP4 homolog gene of Marek’s
disease virus. J. Virol. 68:6280-6290.

Cebrian, J., C. Kaschka-Dierich, N. Berthelot, and P. Scheldrick. (1982). Inverted repeat
nucleotide sequences in the genome of Marek’s disease virus and the herpes virus of the
turkey. Proc. Natl. Acad. Sci. USA 79:555-558.

117

Chen, X., and L. F. Velicer. (1991). Multiple bidirectional initiations and terminations of
transcription in Marek’s disease virus long repeat regions. J. Virol. 65:2445-2451.

Chen, X., P. J. A. Sondermeijer, and L . F. Velicer. (1992). Identiﬁcation of a unique
Marek's disease virus gene which encodes a 38-Kilodalton phosphoprotein and is expressed
in both lytically infected and latently infected lymphoblastoid tumor cells. J. Virol. 66:85-94.

Churchill, A. E., L N. Payne, and R. C. Chubb. (1969). Immunization against Marek’s
disease using live attenuated virus. Nature 221:744-747.

Churchill, A. E., And P. M. Biggs. (1967). Agent of Marek’s disease in tissue culture.
Nature 215:528-530.

Churchill, A. E., and R. C. Chubb. (1969). The attenuation, with loss of oncogenicity, of
the herpes-type virus of Marek’s disease (strain HPRS-16) on passage in cell culture. J. Gen.
Virol. 4:557-564.

Coussens, P. M., and L. F. Velicer. (1988). Structure and complete nucleotide sequence
of the Marek's disease herpesvirus gp 57-65 gene. J. Virol. 62:2373-2379.

Cui, Z., D. Yan, and L. F. Lee. (1990). Marek's disease virus gene clones encoding
virus-speciﬁc phosphorylated polypeptides and serological characterization of fusion
proteins. Virus Genes. 4:309—22.

Cui, Z., L. F. Lee, J. - L. Liu, and H. -J. Kung. (1991). Structural analysis and
transcriptional mapping of the Marek's disease virus gene encoding pp38, an antigen
associated with transformed cells. J. Virol. 65:6509-6515.

Delecluse, H.-J., S. Schuller, and W. Hammerschmidt. (1993). Latent Marek’s disease
virus can be activated from its chromosomally integrated state in herpesvirus transformed
lymphoma cells. EMBO 12:3277-3286.

Delecluse, H.-J., and W. Hammerschmidt. (1993). Status of Marek's disease virus in
established lymphoma cell lines: Herpesvirus integration is common. J. Virol. 67:82-92.

Doerfler, W. (1981). DNA methylation- a regulatory signal in eukaryotic gene expression.
J. Gen. Virol. 57:1-20.

Dunn, K. And K. Nazerian. (1977). Induction of Marek’s disease virus antigens by IduR
in a chicken lymphoblastoid cell line. J. Gen. Virol. 34:413-419.

Fabricant, C. G., J. Fabricant, M. M. Litrenta, and C. R. Minick. (1987). Virus-induced
atherosclerosis. J. Exp. Med. 148:335-340.

118

Feldman, L. T. (1991). The molecular biology of herpes simplex virus latency, in E. K.
Wagner (ed.), Herpesvirus transcription and its regulation, CRC Press Inc, Boca Raton,
Florida. p 233-243.

Fukuchi, K., A. Tanaka, L. W. Schierman, R. L. Witter, and M. Nonoyama. (1985).
The structure of Marek disease virus DNA: the presence of a unique expansion in
non-pathogenic viral DNA. Proc. Natl. Acad. Sci. USA 82:751-754.

Fukuchi, K., M. Sudo, Y-S. Lee, A. Tanaka, and M. Nonoyama. (1984). Structure of
Marek's disease virus DNA: detailed restriction enzyme map. J. Virol. 51:102-109.

Fynan, E. F., D. L. Ewert, and T. M. Block. (1993). Latency and reactivation of Marek’s
disease virus in lymphocytes transformed by avian leukosis virus. J. Gen. Virol.
74:2163-2170.

Garcia-Blanco, M.A., and B. R. Cullen. (1991). Molecular basis of latency in pathogenic
human viruses. Science 254:815-820.

Gardella, T., P. Medveczky, T. Sairenji, and C. Mulder. (1984). Detection of circular and
linear herpesviruses DNA molecules in mammalian cells by gel electrophoresis. J. Viral.
50:248-254.

Gibbs, C. P., K. Nazerian, L. F. Velicer, and H. -J. Kung. (1984). Extensive homology
exists between Marek’s disease herpesvirus and its vaccine virus, herpesvirus of turkeys.
Proc. Natl. Acad. Sci. USA. 81:3365-3369.

Glaubiger, C., K. Nazerian, and L. F. Velicer. (1983). Marek's disease herpesvirus. IV.
Molecular characterization of Marek's disease herpesvirus A antigen. J. Virol. 45: 1228-1234.

Gutekunst, D. E. (1979). Latent pseudorabies virus infection in swine detected by
RNA-DNA hybridization. Am. J. Vet. Res. 40:1568-1572.

Harlow, E., and D. Lane. (1988). “Antibodies, a Laboratory Manual.” Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY. pp. 359-420.

Hayashi, M., K. Io, T. Furuchi, S. Ren, E. Isogai, T. Watanabe, and S. Namioka. (1995).
Changes in the nucleosomal structure of the Marek’s disease virus genome in lymphoblastoid
cell line MDCC-MSBI induced by 5-azacytidine. J. Vet. Med. Sci. 57:157-160.

Hayashi, M., J. Jessip, K. Fukuchi, M. Smith, A. Tanaka, and M. Nonoyama. (1988).
The structure of Marek’s disease virus DNA: ampliﬁcation of repeat sequences in IRS and
TRS. Microbial Immunol. 32:265-274.

119

Hayashi, M., T. Furuichi, S. Ren, E. Isogai, M. Nonoyama, and S., Namioka. (1994).
Enhancement of mRN A synthesis from Marek’s disease virus genome in lymphoblastoid cell
line, MDCC-MSBI , by 5-azacytidine. J. Vet Med. Sci. 56:287-291.

Hirai, K. (1988). Molecular biology of Marek’s disease virus. In Advances in Marek’s
disease research, (S. Kato, T. Horiuchi, T. Mikami, and K. Hirai eds), Osaka, Japan.

Hirai, K., K. Ikuta, N. Kitamoto, and S. Kato. (1981). Latency of herpesvirus of turkey
and Marek’s disease virus genomes in chicken T-lymphoblastoid cell lines. J. Gen. Virol.
53:133-143.

Hirai, K., K. Ikuta, K. Maotani, and S. Kato. (1984). Evaluation of DNA homology of
Marek’s disease virus, herpesvirus of turkeys and Epstein-Barr virus under varied stringent
hybridization conditions. J. Biochem. 95: 121 5-121 8.

Hirai, K., K. Ikuat, and S. Kato. (1979). Comparative studies on Marek’s disease virus
and herpesvirus of turkey DNAs. J. Gen. Virol. 45:119-131.

Honess, R. W., and B. Roizman. (1974). Regulation of herpes virus macromolecular
synthesis. 1. Cascade regulation of the synthesis of three groups of viral proteins. J. Virol.
14:8-19.

Hong, Y., M. Frame, and P. M. Coussens. (1995). A 14-kDa immediate-early
phosphoprotein is speciﬁcally expressed in cells infected with oncogenic Marek’s disease
virus strains and their attenuated derivatives. Virol. 206:695-700.

Hong, Y., and P. M. Coussens. (1994). Identiﬁcation of an immediate-early gene in the
Marek's disease virus long internal repeat region which encodes a unique 14-Kilodalton
polypeptide. J. Virol. 68:3593-3603.

Igarashi, T., M. Takahashi, J. Donovan, J. Jessip, M. Smith, K. Hirai, A. Tanaka, and
M. Nonoyama. (1987). Restriction enzyme map of herpesvirus of turkey DNA and it’s
collinear relationship with Marek’s disease virus DNA. Virol. 157 :351-3 58.

Ikuta, K. S., S. Ueda, S. Kato, and K, Hirai. (1983). Monoclonal antibodies reactive with
the surface and secreted glycoproteins of Marek’s disease virus and herpesvirus of turkeys.
J. Gen. Virol. 64:2597-2610.

Isfort, R. J., H. Kung, and L. F. Velicer. (1987). Identiﬁcation of the gene encoding
Marek’s disease herpesvirus A antigen. J. Viral. 61:2614-2620.

Jones, D., L. Lee, J. -L. Liu, H. -J. Kung, and J. K. Tillotson. (1992). Marek’s disease
virus encodes a basic-leucine zipper gene resembling the fos/jun oncogenes that is highly
expressed in lymphoblastoid tumors. Biochemistry, 89:4042-4046.

120

Kanamori, A., K. Ikuta, S. Ueda, S. Kato, and K. Hirai. (1987). Methylation of Marek’s
disease virus DNA in chicken T-lymphoblastoid cell lines. J. Gen. Virol. 68:1485-1490.

King, D., D. Page, K. A. Schat, and B. W. Calnek. (1981). Difference between inﬂuences
of homologous and heterologous maternal antibodies on response to serotype-2 and
serotype-3 Marek’s disease vaccines. Avian Diseases 25:74-81.

Kishi, M., G. Bradley, J. Jessip, A. Tanaka, and M. Nonoyama. (1991). Inverted repeat
of Marek’s disease virus DNA possess a structure similar to that of the a sequence of herpes
simplex virus DNA and contain host cell telomere sequences. J. Virol. 65:2791-2797.

Lee, L. F., E. D. Bachenheimer, B. Roizman, P. G. Spear, B. R. Burmester, and K.
Nazerian. (1971). Size and composition of Marek’s disease virus deoxynucleic acid. J.
Virol. 7 :289—294.

Lee. L. F., Y. Liu, and R. L. Witter. (1983). Monoclonal antibodies with speciﬁcity for
three different serotypes of Marek’s disease viruses in chickens. J. Immunol. 130: 1003-1006.

Lee, M-J., M. Sandig, and E. Wang. (1992). Statin, a protein present in nonproliferating
cells, is a phosphoprotein and forms a complex with a 45-Kilodalton serine/threonine kinase.
J. Biol. Chem. 267:21773-21781.

Li, D. S., J. Pastorek, V. Zelnik, G. Smith, and L. J. N. Ross. (1994). Identiﬁcation of
novel transcripts complementary to the Marek’s disease virus homologue of the ICP4 gene
of herpes simplex virus. J. Gen. Virol. 75:1713-1722.

Liang, P., and A. Pardee. (1992). Differential display of eukaryotic messenger RNA by
means of the polymerase chain reaction. Science 257 :967-971.

Machonald-Bravo, R., And R. Bravo. (1985). Induction of the nuclear protein cyclin in
serum-stimulated quiescent 3T3 cells is independent of DNA synthesis. Exp. Cell res.
156:455-461.

Maotani, K., K. Kanamori, S. Ueda, and K. Hirai. (1986). Ampliﬁcation of a tandem
direct repeat within inverted repeats of Marek's disease virus DNA during serial in vitro
passage. J. Virol. 58:657-659.

Maray, T., M. Malkinson, and Y. Becker. (1988). RNA transcripts of Marek's disease
virus (MDV) serotype-1 in infected and transformed cells. Virus Genes 2:49-68.

Marek, J. (1907). Multiple Nervenentzﬁndung bei Hilhnen, Dtsch. T ieraerztl. Wachenschr.
15 :41 7.

121

Matthews, R. E. F. (1979). Classiﬁcation and nomenclature of viruses. Intervirology
12:133-139.

McColl, K. A., B. W. Calnek, W. V. Harris, K. A. Schat, And L. E. Lee. (1987).
Expression of a tumor-associated surface antigen on normal versus Marek’s disease
virus-transformed lymphocytes. J. Natl. Cancer Inst. 792991-1000.

Mckie, E. A., E. Ubukata, S. Hasegawa, S. Zhang, M. Nonoyama, and A. Tanaka.
(1995). The transcripts from the sequences ﬂanking the short component of Marek’s disease
virus during latent infection from a unique family of 3'—coterminal RNAs. J. Virol.

69:1310-1314.

Nakajima, K., K. Ikuta, M. Naito, S. Kato, and K. Hirai. (1987). Analysis of Marek’s
disease virus serotype-l-speciﬁc phosphorylated polypeptides in virus-infected cells and
Marek’s disease lymphoblastoid cells. J. Gen. Virol. 68: 1379-1389.

Nazerian, K. (1980). Viral oncology: Marek’s disease: A herpesvirus induced malignant
lymphoma of chicken (G. Kein, ed.), Raven Press. New York, NY. p 665-682.

Nazerian, K., and B. R. Burmester. (1968). Electron microscopy of a Herpesvirus
associated with the agent of Marek’s disease in cell culture. Cancer Research 28:2454-2462.

Nazerian, K., E. A. Stephens, J. M. Sharma, L. F. Lee, M. Galitis, and R. L. Witter.
(1977). A nonproducer T lymphoblastoid cell line from Marek's disease transplantable tumor
(JMV). Avian Diseases 21:69-76.

Nazarian, K., and L. F. Lee. (1976). Selective inhibition by phosphonacetic acid of MDV
DNA replication in a lymphoblastoid cell line. Virol. 74:188-193.

Nazerian, K., R. L. Solomon, R. L. Witter, and B. R. Burmester. (1968). Studies on the
etiology of Marek’s Disease. 11. Finding of a herpesvirus in cell culture. (32650). Proc. Soc.
Exptl. Biol. Med. 127: 177-1 82.

Nazerian, K., and R. L. Witter. (1975). Properties of a chicken lymphoblastoid cell line
from Marek's disease tumor. J. Natl. Cancer Inst. 54:435-458.

O'Hare, P., and R. Goding. (1988). Herpes simplex virus regulatory elements and
immunoglobulin octamer domain bind a common factor and are both targets for virion

transactivation. Cell 52:435-445.

Ogura, H., and T. Fujiwara. (1987). Establishment and characterization of a virus-free
chick cell line. Acta Med. Okayama 41: 141-143.

Okazaki, W., H. G. Purchase, and B. R. Burmester. (1970). Protection against Marek’s

122

disease by vaccination with a herpesvirus of turkeys. Avian Disease 14:413-429.

Ono, M., R. Katsuragi-Iwanaga, T. Kituzawa, N. Kamiya, T. Horimoto, M. N.iikura,
C. Kai, K. Hirai, and T. Mikami. (1992). The restriction endonuclease map of Marek’s
disease virus (MDV) serotype 2 and collinear relationship among three serotypes of MDV.
Virol. 1912459-463.

Ono, M., Y. Kawaguchi, K.,Maeda, N. Kamiya, Y. Tohya, C. Kai, M. Niikura, and T.
Mikami. (1994). Nucleotide sequence analysis of Marek’s disease virus (MDV) serotype

2 homolog of MDV serotype 1 pp38, an antigen associated with transformed cell. Virol.
201:142-146.

Pattison, M. (1985). Control of Marek’s disease by the poultry industry: Practical
considerations. In L. N. Payne (ed.), Marek’s disease: Scientiﬁc Basis and Methods of
Control, Martinus Nijhoff Publishing, Boston, MA.

Payne, L. N. (1982). Biology of Marek’s disease virus and the herpesvirus of turkeys. In
“the Herpesviruses” (B. Roizman, ed.), Plenum, NY. Vol. 1, pp 347-431.

Payne, L. N. (1985). Historical review. In L. N. Payne (ed.), Marek’s disease: Scientiﬁc
Basis and Methods of Control, Martinus Nijhoff Publishing, Boston, MA. pp 1-16 and 43-67.

Payne, L. N., K. Howes, M. Rennie, J. M. Bumstead, and W. Kidd. (1981). Use of an
agar culture technique for establishing lymphoid cell lines from Marek's disease lymphoma.
Int. J. Cancer 28:757-766.

Pepose, J. S., J. G. Stevens, M. L. Cook, and P. W. Lampert. (9181). Marek’s disease as
a model for the Landry-Guillain-Barré syndrome. Am. J. Pathol. 103:309-320.

Powell, P. C. (1985). Immunity. In L. N. Payne (ed.), Marek’s disease: Scientiﬁc Basis and
Methods of Control, Martinus Nijhoff Publishing, Boston, MA. pp 177-193.

Powell, P. C., L. N. Payne, J. M. Frazier, and M. Rennie. (1974). T lymphoblastoid cell
lines from Marek's disease lymphomas. Nature 251:79-80.

Priola, S. A., D. P. Gustafson, E. K. Wagner, and J. G. Stevens. (1990). A major portion

of the latent pseudorabies virus genome is transcribed in terminal ganglia of pigs. J. Virol.
64:4755-4760.

Pruthi, A. K., R. K. Gupta, and J. R. Sadana. (1989). Studies on the pathology of
Marek’s disease following challenge in chicks vaccinated with three different vaccines. J.

Comp. Pathol. 101:295-305.

Purchase, H. G. (1973). Control of Marek’s disease by vaccination. World’s Poultry Sci.

123
J. 29:238-250.

Purchase, H. G., W. Okazaki, and B. R. Burmester. (1971). Filed trials with herpesvirus
of turkeys (HV T) strain Fcl26 as vaccine against Marek’s disease. Poult. Sci. 50:775-783.

Purchase, H. G., W. Okazaki, and B. R. Burmester. (1972). Long term ﬁeld trials with
the herpesvirus of turkeys vaccine against Marek’s disease. Avian Diseases 16:57-71.

Ren, D., L. F. Lee, and P. M. Coussens. (1994). Identiﬁcation of Marek’s disease virus
genes homologus to ICP27 and glycoprotein K of herpes simplex virus-1. Viral.
204:242-250.

Rispens, B. H., H. Van Vloten, N. Mastenbroek, H. J. Maas, and J. C. Hendrick. (1972).
Control of Marek’s disease virus strain (CV1 998) and its use in laboratory vaccination trial.
Avian Disease 16:126-138.

Rock, D. L. (1993). The molecular basis of latent infections by alpha herpesviruses. In
seminars in Virology Vol. 4: 157-165.

Roizman, B. (1992). The family Herpesviridae: An update. Arch. Virol. 123:425-449.

Roizman, B., and A. E. Sears. (1991). Herpes simplex viruses and their replication. In:
Fundamental Virology, Third Edition, B. Fields and D. M. Knipe (eds), Raven Press, New
York, NY.

Roizman, B., L. E. Carmichael, F. Deinhardt, G. DE-The, A. J. Nahmius, W. Plowright,
F. Rapp, P. Sheldrick, M. Takashi, and K. Wolf. (1981). Herpesviridae: Deﬁnition,
provisional nomenclature, and taxonomy. Intervirology 16:201-217.

Ross, L. J. N., B. Milne, and P. M. Biggs. (1983). Restriction endonuclease analysis of
Marek’s disease virus DNA homology between strains. J. Gen Virol. 64:2785-2790.

Ross, L. J. N., M. M. Binns, and J. Pastorek. (1991). DNA sequence and organization of
genes in a 5.5 kbp EcoRI fragment mapping in the unique short segment of Marek’s disease
virus (strain RBIB). J. Gen. Virol. 72:949-954.

Ross, L. J. N., M. Sanderson, S. D. Scott, M. M. Binns, T. Doel, and B. Milne. (1989).
Nucleotide sequence and characterization of the Marek’s disease virus homologue of
glycoprotein B of herpes simplex virus, J. Gen. Virol. 70: 1789-1804.

Ross, N. L. J., W. Delorbe, H. E. Varmus, J. M. Bishop, M. Brahic, and A. Haase.
(1981). Persistence and expression of Marek’s disease virus DNA in tumor cells and
peripheral nerves studied by in situ hybridization. J. Gen. Virol. 57:285-296.

124

Rziha, H. J., and B. Bauer. (1982). Circular forms of viral DNA in Marek’s disease virus
transformed lymphoblastoid cells. Archives Virol. 72:211-216.

Sambrook, J., E. F. Fritsch, and T. Maniatis. (1989). Molecular cloning a laboratory
manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Schat, K. L. (1985). Characteristics of the virus. In L. N. Payne (ed.), Marek’s disease:
Scientiﬁc Basis and Methods of Control, Martinus Nijhoff Publishing, Boston, MA.

Schat, K. A., A. Buckmaster, and L. N. J. Ross. (1989). Partial transcription map of
Marek's disease herpesvirus in lytically infected cells and lymphoblastoid cell lines. Int. J.
Cancer 44:101-109.

Schat, K. A., and B. W. Calnek. (1978). Characterization of an apparently non-oncogenic
Marek’s disease virus. J. Natl. Cancer Inst. 60:1075-1082.

Schat, K. A., B. W. Calnek, and J. Fabricant. (1981). Inﬂuence of oncogenicity of
Marek’s disease virus on evaluation of genetic resistance. Poult. Sci. 60:2559-2566.

Schat, K. A., B. W. Calnek, J. Fabricant, and D. L. Grahm. (1985). Pathogenesis of
infection with attenuated Marek’s disease virus strains. Avian Pathol. 14:127-146.

Schat, K. A., C. -L. H. Chen, B. W. Calnek, and D. Char. (1991). Transformation of
T-lymphocytes subsets by Marek’s disease herpesvirus. J. Virol. 65: 1408-1413.

Scott, S. D., G. D. Smith, N. L. J. Ross, and M. M. Binns. (1993). Identiﬁcation and
sequence analysis of the homologues of the herpes simplex virus type 1 glycoprotein H in
Marek’s disease virus and the herpesvirus of turkeys. J. Gen. Virol. 74:1185-1190.

Sester, U., M. Sawada, and E. Wang. (1990). Puriﬁcation and biochemical
characterization of statin, a nonproliferating speciﬁc protein from Rat liver. J. Biol. Chem.
265: 19966-1 9972.

Shek, W. R., B. W. Calnek, K. A. Schat, and C. H. Chen. (1983). Characterization of
Marek's disease virus-infected lymphocytes: discrimination between cytolytically and
latently infected cells. J. Natl. Cancer Inst. 70:485-491.

' Silva, R. F. (1992). Differentiation of pathogenic and non-pathogenic serotype 1 Marek’s
disease virus (MDV) by the polymerase chain reaction ampliﬁcation of a tandem direct
repeats within the MDV genome. Avian Diseases 36:521-528.

Silva, R. F., L .F. and Lee. (1984). Monoclonal antibody-mediated immunoprecipitation
of proteins from cells infected with Marek’s disease virus or turkey herpesvirus. Virol.
136:307-320.

125

Silva, R. F. and R. L. Witter. (1985). Genomic expansion of Marek's disease virus DNA
is associated with serial in vitro passage. J. Virol. 54:690-696.

Silver, 8., A. Tanaka, and M. Nonoyama. (1979). Transcription of the Marek’s disease
virus genome in a nonproductive chicken lymphoblastoid cell line. Virol. 93:127-133.

Smith, G. D., V. Zelnik, and L. J. N. Ross. (1995). Gene organization in herpesvirus of
turkeys: Identiﬁcation of a novel open reading frame in the unique long region and a
truncated homologue of pp38 in the internal repeat. Viral. 207 :205-216.

Solomon, J. J., R. L. Witter, K. Nazerian, and B. R. Burmester. (1968). Studies on the
etiology of Marek’s Disease. 1. Propagation of the agent in cell culture. (32649). Proc. Soc.
Exptl. Biol. Med. 127 :173-177.

Spivack, J. G., and N. W. Fraser. (1987). Detection of herpes simplex virus type 1
transcripts during latent infection in mice. J. Virol. 61 :3841 -3 847.

Stevens, J. G., E. K. Wagner, G. B. Devi-Rao, M. L. Cook, and L. T. Feldman. (1987).
RNA complementary to a herpesvirus alpha gene mRNA is prominent in latently infected
neurons. Science 235: 1056-1059.

Sugaya, K., G. Bradley, M. Nonoyama, and A. Tanaka. (1990). Latent transcripts of

Marek's disease virus are clustered in the short and long repeat regions. J. Virol.
64:5773-5782.

Sui, D., P. Wu, J. -J. Kung, and L. F. Lee. (1995). Identiﬁcation and characterization of
a Marek’s disease virus gene encoding DNA polymerase. Virus Research 36:269-278.

Tanaks, A., S. Silver, and M. Nonoyama. (1978). Biochemical evidence of the
nonintegrated status of Marek’s disease virus DNA in virus transformed lymphoblastoid cells
of chicken. Virol. 88:19-24.

Tardef, G. N., and J. .M McQueen. (1993). South Eastern Organ Procurement Foundation
(Seopf) Manual. 3rd edition. Richmond, VA. Section B. 14 p 1-25.

Van Zaane, D., J. M. A. Brinkhof, and A. C. J. Gielkens. (1982). Molecular biological
characterization of Marek’s disease virus. II. Differentiation of various MDV and HVT
strains. Virol. 121:133-146.

Von Bulow, V., and P. M. Biggs. (1975a). Precipitating antigens associated with Marek’s
disease virus and herpesvirus of turkeys. Avian Pathol. 4: 147-162.

Von Bulow, V., and P. M. Biggs. (1975b). Differentiation between strains of Marek’s
disease virus and turkey herpesvirus by immunoﬂuorescence assays. Avian Pathol.

126
4:133-146.

Wagner, E. K. (1991). Herpesvirus transcription; general aspects. In Herpesvirus
transcription and its regulation. (E. K. Wagner, ed.), CRC Press, Inc., Florida

Wang, E. (1985). A 57,000-mol-wt protein uniquely present in nonproliferating cells and
senescent human ﬁbroblasts. J. Cell Biol. 100:545-551.

Wang, E., and S. L. Lin. (1986). Disappearance of statin, a protein marker for
non-proliferating and senescent cells, following serum-stimulated cell cycle entry. Exp. Cell
Res. 167:135-143.

Wilkie, N. M. (1973). The synthesis and substructure of herpesvirus DNA: The distribution
of alkali-labile single strand interruptions in HSV-1 DNA. J. Gen. Virol. 21:453-457.

Wilson, M. R., and P. M. Coussens. (1991). Puriﬁcation and characterization of infectious
Marek’s disease virus genome using pulsed ﬁeld electrophoresis. Virol. 185:673-680.

Wilson, M. R., R. A. Southwick, J. T. Pulaski, V. L. Tieber, Y. Hong, and P. M.
Coussens. (1994). Molecular analysis of the glycoprotein C-negative phenotype of
attenuated Marek’s disease virus. Virol. 199:393-402.

Witter, R. L. (1982). Protection by attenuated and polyvalent vaccines against highly
virulent strains of Marek’s disease virus. Avian Pathol. 11:49-62.

Witter, R. L. (1985). Principles of vaccinations. In L. N. Payne (ed.), Marek’s disease:
Scientiﬁc Basis and Methods of Control, Martinus Nijhoﬁ‘ Publishing, Boston, MA.

Witter, R. L. (1992). Inﬂuence of serotype and virus strain on synergism between Marek’s
disease vaccine viruses. Avian Pathol. 21 :601-614.

Witter, R. L., K. Nazerian, and J. J. Solmon. (1972). Studies on the in vivo replication of
turkey herpesvirus. J. Natl. Cancer Inst. 49:1121-1130.

Witter, R. L., and L. F. Lee. (1984). Polyvalent Marek’s disease vaccines: safety, efficacy
and protective synergism in chickens with maternal antibodies. Avian Pathol. 13:75-92.

Witter, R. L., J. M. Sharma, and A. M. Fadly. (1980). Pathogenicity of variants Marek’s
disease isolates in vaccinated and unvaccinated chickens. Avian Diseases 24:210-232.

Yoshida, S. L. F. Lee, N. Yanagida, and K. Nazerian. (1994). Identiﬁcation and
characterization of a Marek’s disease virus homologus to glycoprotein L of herpes simplex
virus. Virol. 204:414-419.

127

Zhu, G.S., A. Iwata, M. Gong, S. Ueda, and K. Hirai. (1994). Marek's disease virus type
l-speciﬁc phosphorylated proteins pp38 and pp24 with common amino acid termini are
encoded from the opposite junction regions between the long unique and inverted repeat
sequences of viral genome. Virolo. 2002816-820.

Qian, Z., P. Brunovskis, F. Rauscher 111, L. F. Lee, and H. -J. Kung. (1995).
Transactivation activity of meq, a Marek’s disease herpesvirus bZIP protein persistently

expressed in latently infected transformed T cells. J. Virol. 69:403 7-4044.

"1111111IIIIIII“