i rho 1
a; .5. :53.
x z .1

saw
.. ..
$.33

8.... x a x
u

. .
z; .. 1.: . .
. fit...

V

31, .
I ‘1 3

«£515.! V
.,.zri}...,...

r23...» .
u.

I.

mug-

VII:

r. ‘
rim.“ .3. ‘t z u

\- .l .iflrl $.31. A
.1 , . 3. «II-I7 .

 

m». u .-...u..n..y
, . w... ..

g .. .. A:

 

{"5515

illlfllflll”lllWIlHUHlllllllHlllUlHil’HlHHIIUIW

31293 01561 116

 

LIBRARY

Michigan State
University

 

 

 

This is to certify that the

thesis entitled

BIOACTIVE CONSTITUENTS FROM NITROGEN-FIXING
STREPTOMYCES SPP.

presented by

Di Zhang

has been accepted towards fulfillment
of the requirements for

Master degree in Horticulture

  

 

 

// Major professor

Date g/ZLI/ 6 é

0-7639 MS U is an Affirmative Action/Equal Opportunity Institution

 

 

PLACE ll RETURN BOXto roman this chucked from your record.
To AVOID FINES Mum on or More data duo.

DATE DUE DATE DUE DATE DUE

     

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

BIOACTIVE CON STITU ENTS FROM NITROGEN -FIXIN G
ST KEPT 0M Y CES SPP.

By

Di Zhang

A THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE

Department of Horticulture

1996

ABSTRACT

BIOACTIVE CONSTITUENTS FROM NITROGEN-FIXING
STREPTOMYCES SPP.
By

Di Zhang

Streptomyces opp. are well known to produce antibiotics for pharmaceutical and
agricultural applications. However, after years of research for novel antibiotics it is evident
that isolation of additional novel compounds with biological activity has become more
dificult. We have investigated a unique culture collection of 48 nitrogen-fixing Streptomyces
mp. from China for the production of bioactive compounds.

To avoid replication of our screening effects, the 48 strains was evaluated using rep-
PCR, a high resolution genomic fingerprinting technique. The rep-PCR analysis showed
genomic diversity within the culture collection.

Preliminary bioassays indicated that one of the S. griseofilscus strains exhibited high
mosquitocidal activity. Hence, it was further investigated for the chemical characterization
of the compound. Bioassay-directed purification and identification of the active fraction fiom

S. gnlseofimrs afforded compound 1 which gave 100% mortality of mosquito larvae (Aedes

egwfir) at 20 ppm within 24 h. Also, it inhibited the growth of tobacco hornworm (Manduca

sexta), comear worn (Helicovarpa zea) and gypsy moth (Lymanm'a demar) at 100 ppm.

ACKNOWLEDGMENTS

I thank my major advisor, Dr. Muraleedharan Nair, for his advice and encouragement
throughout most of the project. He brought me into natural products and opened a wonderful
field to me. I thank Dr. Marcia Murry, who helped me come to this country and introduce
me to the world of molecular biology which I had never touched before. This research work
would not have been possible without her extremely patient help. I thank Dr. John Kelly for
his guidance during these two years.

I also thank Dr. Yu-chen Chang, Dr. Arnitabh Chandra and Dr. James Nitao who have
been extrunely helpful since the first day I came into the lab. Without their help, my research
would have taken longer than it did.

I am glad to have so many good friends, especially the members of the Bioactive
Natural Products Laboratory, Mark Kelm, Jennifer Miles, Geoff Roth, Haibo Wang and
Andrew Erickson. They not only gave me great help during my research work, they also
taught me English and American culture.

I would finally like to thank my parents, they are always there for me, I would not be

here to get my degree without their encouragement.

TABLE OF CONTENTS

LIST OF TABLES ....................................................................................................... VII
LIST OF FIGURES AND SCHEMES ........................................................................ VIII
LIST OF ABBREVIATIONS ........................................................................................ IX
LIST OF APPENDICES ................................................................................................. X
CHAPTER I - Literature review ..................................................................................... 1
Introduction ......................................................................................................... 1
Classification of Streptomyces spp ........................................................................ 2
Bioactive compounds from Streptomyces app ....................................................... 6
CHAPTER II - Phylogeny of Streptomyces spp. ............................................................ 25
Abstract .............................................................................................................. 25
Introduction ........................................................................................................ 26
Materials and methods ........................................................................................ 28
Results and discussion ........................................................................................ 32
CHAPTER III - Biological activities of crude extracts from Streptomyces spp .............. 37
Abstract .............................................................................................................. 37
Introduction ........................................................................................................ 38

V

Materials and methods ........................................................................................ 40

Results and discussion ........................................................................................ 44
Chapter IV - An insecticidal compound isolated fiom Streptomyces spp ....................... 52
Abstract ............................................................................................................. 52
Introduction ........................................................................................................ 53
Materials and methods ........................................................................................ 55
Results and discussion ........................................................................................ 66
Chapter V - Summary and Conclusions ........................................................................ 73
BIBIOGRAPHY ............................................................................................................ 75
APPENDICES ............................................................................................................... 86

Table 2.1

Table 3.1.

Table 3.2

Table 3.3

Table 3.4

Table 3.5

Table 3.6

Table 3.7

Table 4.1

LIST OF TABLES

The list of nitrogen fixing Str'eptonnrces mp. grown in YMG medium .......... 29
Topoisomerase sensitivity of yeast strains in the anticancer assay ................. 43
The results of preliminary anticancer assays measured as zone of inhibition in
mm ......................................................................................................... 48
The list of active extracts fi'om Streptomyces spp. grown in YMG or A9
medium at 250 ppm against Candida albicans .......................................... 48
The list of active extracts from Streptomyces spp. grown in YMG or A9
medium at 250 ppm against E. coli .......................................................... 48
The list of active extracts from Streptomyces spp. grown in YMG or A9
medium at 250 ppm against Gleosporum spp ........................................... 49
The list of active extracts fiom Streptomyces spp. grown in YMG medium
at 250 ppm against Streptococcus aureus and Staphylococcus
epidemidr‘s. .............................................................................................. 50
The list of active extracts produced by Streptomyces spp. that exhibited 100%
mortality against mosquito larvae (Aedes aegrptr) at 250 ppm ..................... 51

1H- and l3CNMR chemical shifis for compound 1 ..................................... 64

Figure 2.1
Figure 2.2
Scheme 3.1
Figure 4.1
Figure 4.2
Figure 4.3
Figure 4.4

Scheme 4.1

LIST OF FIGURES AND SCHEMES

Fingerprint of Streptomyces spp. Strain 001 to 022 ................................. 35
Fingerprint of Streptomyces spp. Strain 023 to 048 ................................. 36
Processing of fermentation broth from Streptomyces spp. .......................... 42
Compounds 1 and 2 ................................................................................... 63
The proton correlations in compound 1 from DQFCOSY spectrum .......... 68

Major fiagmentation observed in the MS spectra of compounds 1 and 2....70

Growth-inhibitory assays of comound 1 against insects ............................. 72
Isolation and purification of insecticidal compound 1 ................................. 61

ACN
BNPL
hp
CHCl,
CD
CDC],
DEPT
DMSO
DQFCOSY
dd
EIMS
FABMS
HPLC
HMQC
MeOH

m/z

LIST OF ABBREVIATIONS

Acetonitrile

Bioactive Natural Products Laboratory

Base pair

Chloroforrn

Circular dichroism

Deuterated chloroform

Distortionless Enhancement by Polarization Transfer
Dimethyl sulfoxide

Double quantum filtered correlated spectroscopy
Doublet of doublet

Electron impact ionization mass spectrometer
Fast atom bombardment mass spectroscopy
High performance liquid chromatography
Hetomuclear multiple quantum correlated
Methanol

Mass spectroscopy

Molecular weight

Mass-to-charge ratio

Nuclear magnetic resonance

Polymerase chain reaction

Potato dextrose agar

Thin layer chromatography

Proton nuclear magnetic resonance

13Carbon nuclear magnetic resonance

Yeast Potato Dextrose Agar

Chemical shifts

Coupling constant

APPENDIX I

APPENDIX II

APPENDIX III

APPENDIX IV

APPENDIX V

APPENDIX VI

APPENDIX VII

APPENDIX VIII

APPENDIX IX

APPENDIX X

LIST OF APPENDICES

lHNMR of compound 1 .................................................................... 86
”CNMR of compound 1 ............................................................... 87
DEPT of compound 1 ................................................................... 88
COSY of compound 1 .................................................................... 89
HMQC of compound 1 ................................................................ 9O
EIMS spectrum of compound 1 .................................................... 91
UV spectrum compound 1 ............................................................ 92
CD of compound 1 ....................................................................... 93
lI-INMR of compound 2 ............................................................... 94
EIMS spectrum of compound 2 .................................................... 95

 

 

(\

Prc

Cor

Chapter I

Literature review

Introduction

The use of plants and plant extracts in human medicine is recorded in the most ancient
archaeological finds. Even today, plant-derived compounds constitute a significant fraction
of the pharmaceuticals employed in human medicine. However, the exploration of
microorganisms as sources of therapeutically useful compounds has a much shorter history.

Many microorganisms are well known to produce bioactive primary and secondary
metabolites. Secondary metabolites are naturally produced substances which do not play an
explicit role in the internal energy mechanism of the organisms that produce them (Stone et
al., 1992). Secondary metabolites are biosynthesised by bacteria, algae, lower animals such
as corals, sponges and plants. It is proposed that the production of secondary metabolites
increases an organism’s fitness for survival by acting as an chemical defense mechanism.
These compounds are produced in nature and are implicated in competition between bacteria,
fungi and amoebae and between microorganisms and higher plants, insects or large animals
(Vining, 1990).

About 75% of the bioactive secondary metabolites reported from microorganisms are
produced by Streptomyces spp (Vining, 1990) . Early emphasis on screening had been on

compounds with antibiotic activity for the fight against bacterial and fungal infections.

 

 

Ont

heir.

Cont

2

Unquestionably, the antibiotics, which are secondary metabolites produced by
microorganism, have been the basis of major advances in the practice of medicine. However,
recent evidence indicates that the contribution of microbes will not be limited to antibiotic
production alone. Current studies suggest that microbial metabolites show potential as
therapeutic agents in a variety of human diseases (Monaghan et al., 1990).

After years of search for novel secondary metabolites from Streptomyces mp., it is
evident that isolation of additional novel metabolites fiom this genus. has become extremely
tedious. Genes that encode the biosynthesis of specific antibiotics can be found in several
Streptonryces mp. and the same compound can be “rediscovered” in new isolates. Therefore,
it is necessary to develop the methodologies to allow better taxonomic identification of new

isolates and to correlate the antibiotic production to specific type strains.

Classification of Streptomyces

Early classification and identification methods for Streptomyces were based on
phenotypic characteristics, such as the morphology of spores, color of aerial mycelium,
utilization of carbon sources, sensitivity to actinophages, serological reactions, biochemical
and other genetic traits (Kurylowica et al., 1975). The major limitations of these methods
are that many traits are influenced by environmental factors and that the tests derived from
one group of organisms were not always useful with other groups. To overcome these
limitations, genotypic methods for the identification and classification of strains are now
being used, because it is presumed that chromosomal DNA is unaffected by environmental

conditions. Furthermore, since nucleic acids are universal, they provide a standard

 

h:

in:

Stud
Other
the ac

genus .

3

molecule with which a wide range of organisms can be compared and classified. A variety
of molecular typing techniques have been developed, each with utility at different
taxonomic levels. For example, DNA-DNA hybridization methods are used to define
bacterial species (Brenner, 1973); sequence comparisons of 16S rRNA are used to assign
taxa at the genus level and above (Woese, 1987); rep-PCR fingerprinting is a facile and
very sensitive method with high resolution which can distinguish strains at the subspecies
level (de Bruijn, 1992).

Ribosomal RNAs are present in all living organisms and are essential elements in
protein synthesis. The RNA molecule shows a high degree of functional constancy and
has changed very little during evolution (Woese, 1987). Phylogenetic analyses based
comparisons of 16S rRNA nucleotide sequences have the advantage of providing
information for individual organisms that can be processed using estimates of similarity
and clustering algorithms (Priest et al., 1993). 168 sequences data from all taxa have been
accumulated into universal database (Priest et al., 1993). Before 1985, the 16S rRNA was
too large to sequence in its entirety, so a cataloguing approach was adopted (Priest et a1. ,
1993). Later studies involving complete 16S rRNA sequences showed that it did not
change the major conclusion of the cataloguing work. A phylogenetic tree for the bacteria
based on 168 rRNA nucleotide sequences data was published by Woese in 1992. These
studies divide the eubacteria into 11 major divisions with Streptomyces clustering with
other gram-positive bacteria. Fox et al.(1987) utilized l6S rRNA catalogues to analyze
the actinomycete branch of the gram-positive bacteria. Four species classified within the

genus Kitasatospora share many of the phenotypic characteristics typical of streptomycetes

 

811

Ch

of.

4
and hybridized with a 16S rRNA gene probe specific to Streptomyces spp. indicating a
close relationship between the two genera. The four species were renamed as members
of Streptomyces genus (Wellington et a1. , 1992).

DNA-DNA hybridization compares the similarity between DNA from two
organisms. One current definition of a bacterial species states that organisms with greater
than 70% DNA-DNA hybridization are considered to be members of the same species
(Wayne, 1987). There are two current methods to determine the similarity of organisms
based on DNA reassociation: the free solution assay, and the immobilized DNA assay
(Priest et al., 1993). Both methods use a large excess of single-stranded DNA sheared to
a constant molecular weight and a radio labeled single-stranded DNA from the reference
strain for hybridization. The advantage of the DNA reassociation method is that the
estimate of relatedness between organisms is based on the complete genotype rather than
a single component of the genome, such as the rRNA nucleotide sequence. The limitation
of this technique is that it is time consuming. Full similarity matrices with estimates of
DNA homology between each and every strain are seldom produced.

Labeda reported the DNA similarities among 15 Streptomyces strains, including
nine strains identified as S. violaceusniger, three as S. hygroscopicus, and one each as S.
endus,S. manogenes and S. melanosporofaciens. Reassociation kinetics showed that the
strains identified as S. violaceusniger were genetically heterogeneous. These strains
clustered into seven different DNA homology groups at a level of DNA relatedness of
>70% (Iabeda, 1991). In 1992, Labeda evaluated the DNA similarities among species

of S. cyaneus and S. lavendulae. A total of 18 strains from the S. cyaneus cluster

5

exhibited at least approximately 50% DNA relatedness to each other. Among the eight
strains of S. Iavendulae, four of them showed more than 80% DNA similarity, but the
other strains exhibited low similarity and, therefore, should be considered to be species
other than S. lavendulae. In 1993, Labeda further reported the DNA relatedness among
strains of S. lavendulae. He compared 10 strains of S. lavenduloe with 11 other species.
The results showed that the 21 studied strains segregated into 14 clusters when grouped at
>70% DNA relatedness, including 10 single-member clusters. Four strains were found
to be at >79% DNA relatedness and the others were considered to be valid species other
than S. Iavendulae. Witt et al.(1990) used both DNA-DNA hybridization and 16S rRNA
to evaluate 40 strains of genera Streptomyces and Streptovenicr’llium. The results indicated
that they can be classified into a single genus.

A rep—PCR (repetitive element sequence-based PCR) molecular fingerprinting
method is one of the most sensitive typing methods that differentiate strains at the
subspecies level. The term rep-PCR refers to the general methodology involving the use
of oligonucleotide primers complimentary to short repetitive sequence elements that are
dispersed throughout the prokaryotic kingdom (Tower et a1. , 1993) . Repetitive extragenic
palindromic (REP) (Stern et a1. , 1984), enterobacterial repetitive intergenic consensus
(ERIC) (Hulton et al., 1991) and BOX (Martin et al., 1992) elements are used to amplify
the DNA of the microorganisms by PCR and the products are separated by electrophoresis
to establish the fingerprint patterns. The distribution of repetitive elements is thought to
represent an intrinsic property of the structure of bacterial genomes (Martin et a1. , 1992).

The BOX element was the most recent identified analogous repetitive sequence, it can be

U!

in

 

N.

in

6
used to generate genomic fingerprints of both gram-positive and gram-negative bacteria
(Versalovic et al., 1994). Rep-PCR had been used to develop phylogenetic relationships
in Citrobacter diversus (Woods et al., 1992), Rhizobium meliloti (de Bruijn, 1992) and

other bacterial species including the actinomycete, Frankia (Murry et al. , 1995).

Bioactive compounds from Streptomyces spp.

Penicillin’s proven efficacy and its widespread use in the therapy of human
infectious diseases led to the discovery of several microbial secondary metabolites to fight
other infections in human. The use of these secondary metabolites have been extended to
agricultural, pharmaceutical and animal health applications.

Antimicrobial agents: During the discovery of many antibiotics, bioassays were
focused on use of fungi and bacteria as test species. Yazumycin was produced by
S. lavendulae and only had activity against gram-negative bacteria (Akasaki et al., 1968;
Neuss et al., 1970). Hygromycin B, flambamycin, A-130 and two salts were extracted
from S. hygroscopicus (Ninet et al., 1974; Kubota et al., 1975; Tsuji et al., 1976).
Flambamycin exhibited activity against both gram-positive and some gram-negative bacilli
(Ninet ct al., 1974). A-130 was reported to have gram-positive bactericidal and fungicidal
activities (Kubota et a1. , 1975). The organic salts, indentified as CanouNa and
CaH.,O,,Na were active against gram-positive bacteria only (Tsuji et a1. , 1976).

Another S. hygroscopicus yielded a polyether antibiotic, Ro 21-6150, that was
active against gram-positive bacteria including Mycobacterium phlei and showed modest

activity against fungi and yeast ( Liu etal., 1976).

 

11021-6150

The metabolite trichostatin was isolated from several strains of S. hygroscopicus.
It is an acidic compound with two nitrogens in its structure. This compound had activity
against trichophytons and some fungi. Also, it is a typical example illustrating that

hydroxamic acids can be used as excellent antibiotics against bacteria (Tsuji et a1. , 1976).

.011
N
\ H
N

|
Trichoatatin A

The antibiotic leuseramycin was produced by strain of S. hygroscopicus. It is
active against a wide range of gram-positive bacteria and certain phytopathogenic fungi,
but inactive against gram-negative bacteria (Mizutani et a1. , 1980). Another S.
hygroscopicru strain produced nigericin, elaiophylin and niphimycin, antibiotics with
activities against gram-positive bacteria and fungi (Grabley et a1. , 1990; Fiedler et a1. ,
1981). Both leuseramycin and nigericin are polyethers. Their activities against

phytopathogenic fungi demonstrated that polyether antibiotics have potential to combat

 

 

brm
inacr
A2 1!
inhibr'

Irhas

8
several agricultural pests. Elaiophylin, a macrodiolide with a polyether functionality,

exhibited very good antifungal activity.

IDOC

 

".0 031C CHI CH. rgc
cu,
"0°C 0 o o o 0 CH’
".0 HO 01.0"
Niguicin

 

A basic peptide antibiotic, lavendomycin, isolated from S. lavendulae subspp.
bmrilr’cru, was active against gram-positive bacteria in vitro and in viva. However, it was
inactive against gram-negative bacteria and fungi (Kamori et a1. , 1985). The antibiotic
A21978C, produced by S. roseospoms, is an acidic lipopeptide antibiotic complex that
inhibited the growth of gram-positive bacteria (Debono et al., 1987, Boeck et al., 1988).

A novel arninoglycoside antibiotic, boholrnycin, was produced by S. hygroscopicus.

It has a pseudotetrasaccharide structure composed of a heptose, two aminosugars and a

 

exl

inc

mr

dicarbamoyl-scyllo—inositol. Antibacterial activity of boholmycin was weak, but it

exhibited-broad spectrum activity against gram-positive and gram-negative bacteria,

including aminoglyciside-resistant bacterial strains (Saitoh et a1. , 1988).

"° 0 ocomr,
rr,u o
no crr,orr °"
o no ocean,
no 0
no
0
o
no rm

Beholmycin

Inosamycins A, B, C, D and E, an antibacterial complex with aminocyclitol

moieties, were produced by S. hygroscopicus. Inosamycins A to D contain three sugar

a,
I'D 0
new NH,
"OWE; ”M
now 0 H000 m
NH. 0 "°
0

orrou

Incl-mi! k Bruit, a,-ort 12,-}! 11,-ng
:2 2:13;: 3.3:: we :2“ was
n} arm, a,-orr a,-rr raj-gig?

moie

amon

thea

WCTC

s. r-

lO

moieties and E contain two (Tsunakawa et a1. , 1985). Inosamycin A is the most active
among the inosamycins against gram-positive, gram-negative and acid-fast bacteria. The
structure function relationship showed that the activities are proportional to the number of
the amino groups present and their orientation (Tsunakawa et al., 1985).

Clavamycins A-E were isolated from S. hygroscopicus strains. These antibiotics
were active against Candida spp. Clavamycin A and D are cyclic amino compounds and

are inhibitory to the yeast cell wall synthesis (King et al., 1986; Naegeli et al., 1986).

Mari rifr: mm (,de
Jig; “’NVY‘YOH “AIM. Half

MA MB (Javavarnyu'nC Clav-nyu'nD

The macrocyclic lactone rapamycin and demethoxyrapamycin were produced by

S. hygroscopicus and were active on Candida albicans, Microsporum gypseum and

 

Rap-nycin R- OCH,
AY~24.668 R- H

Trichop
antimicr
later s
(18me
at al., 1!

activitie

(7)5!th
inhibits
attive a

Compor

ll

Trichophyton granulosum (Vezina et al., 1975; Sehgal et al., 1975, 1983). The
antimicrobial activities of rapamycin were much higher than activities of its derivative.
Later studies exhibited that rapamycin showed activity against several tumors, but
dernethoxyrapamycin had only slight activity against P388 lymphocytic leukemia (Sehgal
et al., 1983). All these indieated that the methoxy group in rapamycin is important for its
activities.

Copoamycin and neocopoamycin were isolated from S. hygroscopicus var.
crystallogenes and were inactive against gram-positive and gram-negative bacteria, but
inhibited the growth of a wide range of fungi. Neocopoamycin A proved to be more
active against a number of fungi than copoamycin. The only difference between these two

compounds was the guanidine moiety (Arai et al., 1965 and 1984).

 

Neocepiareycin A R- H
Cepiamycin R- CH,

Two other guanidine antibiotics, guanidylfungin A and B, were extracted from the
mycelia of S. hygroscopicus. These antibiotics are 36-carbon polyhydroxyl macrocyclic
lactones with a guanidine and a monoester of malonic acid moieties. These compounds

were active against fungi and gram-negative bacteria (Takesako et a1. , 1984).

etal.

12

 

Guidylfimainh K'CHpRr'H
Mme Rfi'Ra'H

Anticancer agents: Further developments in mechamism of actor based bioassays
has led to the discovery and the application of novel secondary metabolites for use in
cancer therapy.

S. Iamrdulae is reported to produce mimosamycin and chlorocarcins A, B and C
(Arai et al., 1976; Mikami et al., 1976). Mimosamycin, a low molecular weight
compound, was active against mycobacteria, including streptomycin-sensitive and resistant
strains of human Tubercle bacilli and other gram-positive bacteria (Fukumi et al., 1978;
Kubo et al. , 1988). Among chlorocarcins, chlorocarcin A proved to be the most active
and inhibited the growth of a number of gram-positive bacteria. This compound was also
highly active on murine tumors such as Ehrlich carcinoma (Arai et al., 1976; Mikami et

al., 1976).

O
rgc o
01.0 CH
O

Milneaamycin

Saframycins are another class of antitumor agents produced by S. lavendulae (Ikeda

ct al., 1983). Their structures contain l,3'—dimeric isoquinoline moieties. Saframycin A

gave

SITUCI

P338

effecr

acfive

SYSter

13

gave the highest activity, B and C were less inhibitory to various experimental tumors.
The enhanced activity of saframycin A is probably due to the nitrile group present in its

structure (Arai et al., 1977, 1980; Cooper etal., 1985; Kubo et al., 1987 and 1988).

 

Saframyc’m A : RfH, RfCN
Safiunyc’m B :R,-R,=H
Safmnycin C : RfOCH, 11,-}!

Azinomycins A and B were extracted from S. griseofirscus (Nagaoka et a1. , 1986).
Azinomycin B was highly effective against intraperitoneally inoculated tumors such as
P338 leukemia, B—l6 melanoma and Ehrlich carcinoma. Azinomycin A was somewhat less
effective than azinomycin B. Both azinomycins were active against gram-positive and
gram-negative bacteria, but inactive against yeast and fungi (Ishizeki et al., 1987). The
active site of these compounds was proposed to be the 1-azabicyclo—[3. 1.0]-hexane ring

system (Yokoi et al., 1986).

C
0 “ii/H o
C 1 ‘ N/ X CH‘
HI 0 o a H \H/
: 0
H :
OCH.
H,C

Azinomyc'm A x-ICI'I2
B x=C-CHOH

  
 

mseos;

ct al.,
of cor

Aanr

S-met
than I
numb

(Tsug

1991;
03113;

1989,

14

A low-molecular-weight immunomodulator, conagenin, was produced by S.

mseospoms with inhibitory activity on the proliferation of rat splenic T cells (Y amashita

, x" H
“C ~. N .. coat
H H o It arm
Cm

et al., 1991). S. cyaneus yielded adipostatin A and B which were effective in prevention
of corpulence by inhibiting triglyceride accumulation (Tsuge et al., 1992). Adipostatin
A and B were identified as S-n-pentadecylresorcinol and 5-iso pentadecylresorcinol,
respectively. Comparison of the activities of adipostatins to those of 3-pentadecylphenol,
5-methy1resorcinol and stearic acid indicated that adipostatins were 10 times more active
than the test compounds. This suggested that the length of the alkyl side chain and the
number of hydroxy groups on the aromatic ring were important for their biological activity

(Tsuge et al., 1992).

An antimicrobial acidic protein, with a molecular weight of 15,000 (Otani et al.,
1991), was isolated from S. globispoms. It had potent cytotoxicity against KB carcinoma
cells in vitro. Also, it inhibited transplanted tumors in mice (Hu et al., 1988; Zhen et al.,
1989).

S. hygroscopicus afforded a novel antibiotic, eponemycin, and its analogues

antiu

activ

Shou
lymp

“Ilsa:

15

diacetyleponemycin, dihydroeponemycin and tetrahydroeponemycin, with specific in viva
antitumor activity against B16 melanoma. However, they did not exhibit inhibitory
activity against gram-positive and gram-negative bacteria or fungi up to 100 rig-ml".

Eponemycin, composed of isooctanoic acid, L-serine and an aminoepoxyketone, is more
active than its analogues. The diacetyl and dihydro derivatives were less active compared
to eponemycin, but the activity of a tetrahydro derivative without the epoxide in its
structure was much less active than the others. That indicated that an epoxide in the

structure is essential for antitumor activity (Sugawara et a1. , 1990).

”@193
0*. H O 0
MN
H.c j/‘Lg
O O (Ii
HO
Eponcmycin

Phospholine, an antitumor antibiotic, was isolated from S. hygroscopicus; it
showed strong activity against L1210,P388 murine leukemia cells and EL—4 murine
lymphocytic cells. The active sites of this antibiotic were considered to be a, B-

unsaturated b-lactone and phosphoric acid ester functional groups (Ozasa et a1. , 1989).

 

A1,A
whit
and hi
to itsr

-B2 3.1

dihyd
KB 1}
CHOU
dihyc
hydrc
388 t

16
Another strain of S. hygmscapicus produced several glutarimide antibiotics S-632-
A1, A2, B1 and 132. They had cytotoxic activity against KB tissue culture cells and also
activity against Sacchramyces spp. However, they are inactive against filamentous fungi
and bacteria. Glutarimide B1 was the most active among the isomers, and this may be due
to its epoxide functonality and spatial orientation. The diastereoisomers of S-632-B1 and

-B2 are still unknown (Otani etal., 1989).

0 o
a on" o "o
NH 0 NH
a a 0 o
S-632-AI R-H
S-632-A, R=CH, S-632-B, and B,

The benzoquinoid compounds ansamycin, herbimycin A and C and their
dihydroderivatives produced by S. hygroscopicus exhibited activity against the P-388 and
KB lymphocytic leukemia. Also, herbimycin A and C exhibited strong herbicidal and
cytotoxic activities, but there were no reported biological activity for the
dihydroderivatives (Lin et a1. , 1988). The replacement of the methoxy group with a
hydroxy group in herbimycin resulted in a decrease in the activity when tested against P-

388 and KB lymphocytic leukemia. Furthermore, the p-quinone type antibiotics had

mums Recoil.
I‘hbunyculB -H. Its-0H

and

Him:

melal

but it

17
higher activity than that of their corresponding dihydroderivatives in assays with P-388 and
KB lymphocytic leukemia (Lin et al., 1988).

A cyclohexadepsipeptide antibiotic, himastatin, isolated from S. hygroscopicus
contained valine, leucine, threonine, a-hydroxyisovaleric acid, 5-hydroxypoperazic acid
and a dimeric hexahydropyrroloindole in its structure (Leet, 1990; Mamber, 1994).
Himastatin prolonged the life span of mice inoculated with P388 leukemia and B16
melanoma cells. Also, it exhibited antimicrobial activity against gram-positive bacteria

but was inactive against gram-negative bacteria (Lam et a1. , 1990).

Jigs °" Ire :l/Nk
H
N'N O O O
"fa?“ ‘IifigM
Himastatin

Agricultural pest managing agents from Streptomyces spp-

Activity against plant pathogens: Ileumycin is an antifungal antibiotic isolated
from the culture broth of S. lavendulae. Ileumycin exhibited activity against Glamerella
cingulata, a pathogenic fungus of grapevines, but was inactive against other fungi, yeasts
and bacteria (Kawakarni et al., 1978). Validamycin and aabomycin A are produced by
different strains of S. hygroscopicus and were used to protect rice plants from fungal
infection (Uyeda ct al.,1988; Iwasa et al., 1970). Validamycin is an aminoglycoside

antibiotic that was effective in protecting rice plants against sheath blight disease caused

AabOl
Piricn

Yama.

actitir
actin'l
Freud.
activit
lacemr
activit
moieti
facemc

cal. ‘

, J

18

by Rhizactania salani (Uyeda et al.,1988; Iwasa et al., 1970; Aizawa et al., 1969).
Aabomycin A exhibited inhibitory activity against many fungi, especially against
Piricularia aryzae, the causative agent of the rice blast disease (Aizawa et al., 1969;
Yamaguchi et al., 1969; Seine et al., 1970).

Racemomycin-B, the main antibiotic from S. lavendulae. exhibited antimicrobial
activity against a variety of plant pathogenic microorganisms and root growth inhibitory
activities against Brassica rapa L. at 50 ppm. Also, it strongly inhibited the growth of
Pseudamanas syringae pv. tobaci IFO—3508 (MIC 0.4 pg'ml") and showed antifungal
activity against six Fusarium axysparum species (MIC 0.1-0.2 rig-ml"). However,
racemomycin-B was more active than racemomycin-A and C. Therefore, the biological
activities of racemomycin were proportional to the increase in the number of B-lysine
moieties in their molecule. Racemomycin-D has one more B-lysine moiety than
racemomycin B, but, the activities of racemomycin-D have not been reported yet (Inamori

et al., 1990). Curromycin A and B were extracted from S. hygroscopicus and had similar

II) (”CH,CI-ICI'I,CIi,(|!l-Ia H
l. .. -
R-CILOH
Momye'n—B n-3
Manual-C n-2

Marylin-A n-l
Recount-D n-4

antibacterial activity when tested against Bacillus subtilis. The difference between

currromycin A and B is the presence of a dimethyl ether in curromycin A rather than a

ZDC

aga
berl

geld;

and w:
00me

(lfpn'n

19
methyl group as in B (Ogura et al., 1985).

Herbicidal activities: The herbicide herbimycin was produced by S. hygroscopicus
and showed herbicidal activities against most mono- and di-cotyledonous plants, especially
against Cyperus micrairia Steud. However, Oryza sativa showed strong resistance to
herbimycin (Omura et al., 1979).

Geldanamycin and nigericin were produced by S. hygroscopicus and also inhibited
the radicle elongation of garden cress (Lepidium sarivum L.) (Heisey et al., 1986). Both

geldanarnycin and herbimycin B have structures similar to that of ansamycin.

H,CO

if... “C“
no oco
cu, CH, NH‘

Gena-mm
Insecticidal activities: Several macrotetrolides were isolated from S. glabisparus
and were identified as nonactin, dinactin and trinactin. The insecticidal activity of these
compounds were confirmed by the larval mortality of the Colorado potato beetle

(Leptinotarsa decemlineata) (Jizba et al., 1991). Milbemycins, a 16-numbered macrolide

 

added
(fakihy
milbem'
insectic
nematl'c

exhibit

aPPh'

3936

20
antibiotic from S. hygroscopicus exhibited activity against aphids and Lepidaptera larvae
(Taldhychi ct al., 1980,1983; Ono et al., 1983; Mishima et al., 1983). Several substituted
milbemycins UK-78,694, UK-80,694 and UK-80-695 also were reported to have excellent
insecticidal activity (Haxell et al., 1992). These compounds also exhibited potent in vitro
nernaticidal activity effect 95% mortality at 0.01 ppm against Caenarhabditis elegans and

exhibited 100% mortality at 1 mg against blowfly larva, Lucilia cuprina.

 

UK-78,624 rt,- OH, 11,- ll
UK-80,694 R,- OH, 11,- ococrrue,
[IX-80,695 rt,- rt,- ll

Veterinary use: Several reports indicate that polyether antibiotics have potential
applications in veterinary use (Ninet et al., 1976; Ohshima et al., 1976). Emericid

protected chickens and rabbits against ooocidiosis at 0.006002% levels in the diet. It also

 

had activity against gram-positive bacteria in vitro (Ninet et a1. , 1976). Septarnycin, DE-

3936 Na salt, emericid and earriomycin were produced by S. hygroscopicus. Steptamycin

21

rl,co

C
Heb “:°°H' 9“» OCH. H.C ea,
0 Wu.
“355‘? ° ° ° . ° -~...,
c H
H’llo , o H

“.0 '3‘" Scream-in

 

05-3936 Na uh

possessed antibacterial activity as well as excellent activity against Newcastle Disease and
herpes simplex viruses (Keller-Juslen et al., 1975). DE-3936 Na salt with a MP of
CuH-BouNa inhibited the growth of gram-positive bacteria, mycobacteria, mycoplasma
and protozoa, especially coccidia (Ohshima et al., 1976). Carriomycin was coccidiostatic,

with antimicrobial activities against several fungi, yeasts and bacteria (Imada et al., 1978).

 

End

exhil

It aff
met.
the s

incluc

Chain 1
moiety,

Jubitllk

 

22

Endusamycin isolated from S. aureus was effective against coccidia in poultry and
exhibited antibacterial activity against gram-positive and anaerobic bacteria (Oscarson et
a1. , 1989).

Another polyether antibiotic produced by S. hygroscopicus spp. was CP-80 219.
It afforded anticoccidial activity against Eimeria tenella in chickens between 30 and 120
mg-kg". It also exhibited good activity against a number of gram-positive bacteria and
the spirochete, Trepanema hyadysemeriae but not was not gram-negative aerobes,

including Escherichia cali. (Dirlam et al., 1990).

 

(LP-80,219

S. vialaceaniger sp. griseafitscus yielded pyridazomycin with an amino acid side
chain in its structure. It was the first naturally occurring antibiotic with a pyridazine
moiety. It had significant antifungal activity. Also, it was slightly active against Bacillus

subitlis (Grate et al., 1988).

000'
Y"

2‘2

H,N \
O

abar

usefl
isolat

The;

was i.
again:
Chrysc
antibir
Were 11
(Mons

Silrviva

 

23

Novel biological activities of known compounds: Most of the antibiotics known
today were discovered using antibacterial or antifungal assays. Throughout the
development of effective and safe antibiotics, countless useful bioactive compounds were
abandoned.

The rediscovery of known compounds with unknown activity has proven to be very
useful (Monaghan et al., 1990). For example, ascomycin was an antifungal antibiotic
isolated from the fungal body of a Streptamyces strain KK317 in 1963 (Arai et al., 1963).
The producer strain was closely related to S. hygroscopicus. Aseomycin lacked activity
against gram-positive and gram-negative bacteria except for Mycabacterium 607. Also, it
was inactive against yeast-like fungi including Candida albicans, but it was very active
against filamentous fungi Rhizapus nigricas, Aspergillus arizae and Penicillium
chrysagenran in later studies (Arai et a1. , 1962). Recent studies revealed that macrolide
antibiotics FR-900520 and FR-900523 isolated from S. hygroscopicus, with 23 carbons,
were novel immunosuppressants and FR-900520 was identical in structure to ascomycin
(Morisaki et al., 1992). These compounds were exhibited a prolonged skin allograft

survival in rats (Hatanaka et al., 1988).

 

Sire
addi
to d

Gott‘

ofte

Labor

Statel

new acl

 

 

24

Hypothesis: A wide range of bioactive compounds have been isolated from
Streptomyces spp. (Monaghan and Tkacz, 1990). However, there is great need for
additional novel bioactive compounds. Also, additional screening tools are available now
to discover active compounds or templates for pharmaceutical and agricultural use.
Gottlieb (1976) reported that l to 52% of isolates from soil inhibit microbial pathogens.
Also, the number of inhibitory compounds identified from soil increased with the number
of test organisms used (Maplestone et a1. , 1992). The Bioactive Natural Product
Laboratory in the Depatment of Horticulture and Pesticide Research Center at Michigan
State University acquired a culture collection of nitrogen-fixing Streptomyces from China
(Zhang, 1994). These organisms are unique among Streptomyces mp. In that they can fix
atmosphere nitrogen. Therefore, it is our hypothesis that many bioactive compounds could
be isolated from this Streptanryces culture collection using bioassay—directed isolation and
fractionations. Since it is unlikely that these strains have been screened before, these
cultures could be a potential source for novel active compounds or known compounds with

new activities.

Chapter II

High resolution rep-PCR genomic fingerprinting of Streptomyces strains

Abstract

To establish the genetic diversity of our nitrogen-fixing strain collection, rep-PCR was
used as a facile means to fingerprint the genome of each strain. All cultures were grown in
YMG medium. The DNA of these strains were extracted from the cells by thermocycling,
and the BOXAlR primer was used to amplify the DNA template in crude extracts using the
polymerase chain reaction (PCR). The PCR products were separated electrophoretically on
an agarose gel. The banding pattern is characteristic of each strain and provides an extremely
high-resolution fingerprint that can be used to discriminate among closely related isolates
within the same species. Genomic fingerprinting indicated that these strains are genetically

diverse, and only two of the S. griseafirscus strains seemed to be closely related.

25

Ta‘

SChr

5176')
char
phenr

condi

identil
of Spt
enzyn
00ples
01' mo:-
DNA

deoxyr
(an be r
“P to 94
40 - 55
Strands,

26

Introduction

Until recently, bacteria were classified largely according to their form and physiology.
Taxonomic changes were frequent, and researchers had their favorite characters or taxonomic
schemes. The history of Sa'eptanryces mp. classification is no exception (Embley et al.,1994).
In 1975, Kurylowicz et al. summarized the characteristics commonly used to classify the
Streptomyces mp. These included morphological, physiological, ecological and biochemical
characteristics, sensitivity to actinophages and serological reactions. These traits are
phenotypic rather than genotypic characteristics and can show variation with different grth
conditions.

Genotypic methods now are accepted tools in microbial systematics for strain
identification and estimation of phylogenetic relationships. The use of PCR for amplification
of specific nucleic acid sequences was first described by Saild et al. in 1985. It is an
enzymatic method employing a therrnostable polymerase enzyme to produce multiple
copies of specific nucleic acid regions quickly and exponentially allowing a million-fold
or more amplifications of the target DNA. The reaction is achieved with a heat-stable
DNA polymerase, a DNA template, oligonucleotide primers and the standard
deoxyribonucleotide triphosphates (ATP, CTP, GTP, TI‘P). The amplification process
can be divided in three steps which are repeated in cycles: first, the DNA sample is heated
up to 94°C to disassociate the template DNA duplex, then the temperature is decreased to
40 - 55°C to allow the primer to anneal to the complimentary sequences of the template
strands, and finally, the temperature is raised, typically to 72°C, for the extension

reaction.

27
Repetitive elcmmt sequence-based PCR (rep-PCR) refers to the general methodology

involving the use of oligonucleotide primers complimentary to short repetitive-sequence
elements which occur on the genome, these elements are highly conserved and are present
throughout the prokaryotic kingdom (Towner et al., 1993). Consensus sequence primers
were designed for two such repetitive elements, the repetitive extragenic palindromic (REP)
clement (Stern et al., 1984) and the repetitive intergenic consensus (ERIC) elements (Hulton
et al., 1991) and have been used extensively to fingerprint the genomes of taxonomically
diverse prokaryotes. Outwardly directed primer sets based on REP and ERIC consensus
sequences can be used to generate clearly resolvable DNA fiagments by PCR amplification
using template genomic DNA from species which contain these sequences (Woods et al.,
1992). The DNA fragments represent amplification of DNA between adjacent repetitive
elements (Woods et al., 1992). The differently sized fiagments generated in a reaction
produce a “fingerprint” pattern when separated electrophoretically. The specific banding
pattern is reproducible and characteristic of each strain (de Bruijn, 1992; Murry et al., 1995)
A third primer, the BOX element, first described in gram-positive bacteria, was introduced
by Martin et al. (1994) and has found utility in fingerprinting the genomes in all major
prokaryotic taxa The term rep-PCR refers to the application of any of these three repetitive
sequence primers to generate DNA fingerprints by the PCR reaction. The primer used in this
experiment is the prokaryotic-specific BOXAIR primer (V ersalovic et al., 1994).
A collection of soil Streptomyces mp. were isolated under diazotrophic conditions
from a variety of sites in China (Zhang, personnel communication). These strains reduce
acetylene under nitrogen-fixing culture conditions. This activity responds to ammonia

inhibitor. These results were confirmed using the ”N isotope assay for nitrogen activity

Swept

nilrog

ldend
auugr
chart
5. ’0‘8

level

Cuhu

Sampl
Sllpen
duudc
KHJN
CaSO,
34.2 g
57 d3!
mediul

tra11st

28

(Zhang, personal communication). To date, nitrogen-fixation has been reported only in a
Streptomyces thermaautatraphicus isolates (Gadkari, 1992). Thus, the capacity for
nitrogen fixation suggest these strains may be an unusual group of Streptomyces mp.
The strains of this collection were classified according to “The Manual of
Identification of Srreptamyces mp. "‘ (1975) by Dr. Zhang. These strains tentatively
assigned to Streptomyces glabimarus, S. raseamarus, S. lavendulae, S. glaucus, S.
cinereus, S. viridis, S. cyaneus, S. grisearubravialaceus, S. griseafirscus, S. aureus and
S. hygmscapiars. BOX-PCR was adapted to characterize this collection at the sub-species

level.

Material and Methods
Culture isolation: About 30 g of soil samples were collected in triplicate by Dr. Zhong-ze
Zlang (personal communication) at several locations in China (Table 2.1). Ten gram soil
samples from each site were stirred with 100 ml of sterile water for 20 min. The
supernatant (1 ml) was diluted with 9 ml of sterile water. Two drops from each of these
dilutions were transferred onto a nitrogen-free, defined solid media containing (1.09 g - L"
KH,PO,, 0.44 g-L‘l KI-IPO,, 0.0014 g-L‘l MgSOflHzO, 0.34 g°L" NaCl, 0.34 g -L"
CaSO,-2H¢O, 0.01 gL" FeSO,-7H20, 0.0027 g-L" NazMoOflHzo, 9.1 g ' L" sucrose,
34.2 g°L'l KOH, 18 g ~L" agar and 114 g 'L'1 H3P04). The plates were incubated for
5-7 days at 28'C. Individual colonies then were restreaked on plates containing this solid
medium to obtain pure cultures derived from a single spore. The pure cultures were then

transferred onto solid nitrogen-free medium slants and stored at 25 'C.

29

Table 2.1. List of nitrogen-fixing Streptomyces mp. grown in YMG medium

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

No. Identification No. Name Appearance

1 MSU/ZD/OOI S. glabimams yellow

2 MSU/ZD/002 S. glabimarus white

3 MSU/ZD/003 S. glabisparus yellow

4 MSU/ZD/004 S. raseamarw pink

5 MSU/ZD/OOS S. raseamarus white

6 MSU/ZD/006 S. glaucus white

7 MSU/ZD/007 S. glaucus white brown
8 MSU/ZD/008 S. glaucus white

9 MSU/ZD/OO9 S. glaucus white

10 MSU/ZD/OlO Silaucus white

11 MSU/ZD/Oll S. glaucus white brown
12 MSU/ZD/012 Sglaucus white&pink
13 MSU/ZD/013 S. cinereus white

14 MSU/ZD/014 S. cinereus white

15 MSU/ZD/OIS S. cinereus yellow

16 MSU/ZD/016 icinereus white

17 MSU/ZD/017 S. cinereus white

18 MSU/ZD/Ol8 S. cinereus yellow

19 MSU/ZD/019 S. viridis yellow

20 MSU/ZD/020 S. viridis yellow

21 MSU/ZD/021 S. viridis white brown
22 MSU/ZD/022 S. cyaneus white brown
23 MSU/ZD/023 S. grisearubravialaceus white green
24 MSU/ZD/024 S. grisearubravialaceus yellow

, 25 MSU/ZD/025 igrisearubravialgceus white

 

 

30

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

26 MSU/ZD/026 S. grisearubravialaceus yellow

27 MSU/ZD/027 S. grisearubravialaceus white

28 MSU/ZD/028 S. grisearubravialaceus yellow

29 MSU/ZD/029 S. grisearubravialaceus white

30 MSU/ZD/030 S. griseafirscus yellow

31 MSU/ZD/03l S. griseafirscus white

32 MSU/ZD/032 S. griseafirscus white slow
33 MSU/ZD/033 S. griseafitscus Eey brow
34 MSU/ZD/034 S. griseafirscus yellow brown
35 MSU/ZD/035 S. griseafirscus white black
36a MSU/ZD/036a S. griseafirscus white green
36b MSU/ZD/036b 54W white yellow
37 MSU/ZD/037 S. aureus white

38 MSU/ZD/038 S. aureus white

39 MSU/ZD/039 S. aureus yellow

40 MSU/ZD/040 S. aureus white

41 MSU/ZD/041 S. aureus yellow

42 MSU/ZD/042 S. aureus yellow

43 MSU/ZD/043 S. aureus yellow

44 MSU/ZD/044 S. aureus yellow

45 M§l_J_/_ZD/045 Marcus white

46 MSU/ZD/046 S. aureus yellow

47a MSU/ZD/047a S. aureus orange
47b MSU/ZD/047b S. aureus bale yellow
48 MSU/ZD/048 S. hygroscopicus white

 

 

Growl]

8 days.
liquid l

inocula

Isolatic
at 4°C)
pH 8.0]
overnig
mil (lt-
merca;

lflnpen

BOX-l
3H1 of
(5m

lilofr

 

DNA
1115 p]

1.25,

31

Growth medium: Strains were subcultured to YMG slants (yeast extract 4 g-L“, malt
extract 10 g1", glucose 4 gL" and agar l8 g-L") and incubated for 8 days at 26°C. After
8 days, a loop full of cells were transferred into a 20-ml test tube containing 5 ml of YMG
liquid media (yeast extract 4 g-L", malt extract 10 g-B and glucose 4 g‘L ). The

inoculated test tubes then were placed on a rotary shaker at 110 rpm at 26°C for 14 days.

Isolation of DNA: 1 ml aliquots of Streptomyces mp. cultures were centrifuged (10,000 rpm
at 4°C), and the cell pellet was washed twice with TE buffer (10 mM Tris-Cl, 1 mM EDTA,
pH 8.0). The pellet was resuspended in 0.1 ml of TE, and the suspension was frozen at -20°C
overnight. An aliquot (15 pl) of the cell suspension was diluted in 15 pl Gitschier buffer (83
mM (MH,)280,, 335 mM Tris HCI pH 8.8, 33.5 mM MgC12, 33.5 pm EDTA, 150 mM [3-
mercaptoethanol and 850 pl bovine serum albumin-ml"), and subjected to the following
temperature regime in a thennocycler: 95°C for 7 min, 7 cycles of 4°C for 7 min, 40°C for

7 min, and 80°C for 7 min (Frank Spooner, personal communication).

BOX-PCR: BOX-PCR reactions were carried out as described by Murry et al. (1995) using
3pl of the cell preparations for each 25 pl of the reaction mixture. The BOXAlR primer
(5'CTACGGCAAGGCGACGCTGACG3', Versalovic et al., 1994) was used at 15 ng per 25
pl of reaction mixture. The primers were synthesized by the Macromolecular Sructure,
Sequence, and Synthesis Facility at Michigan State University using an Applied Biosystcms
DNA synthesizer (Model 380B, Foster City, California). The PCR reactions were performed
in 5 pl Gitschier bufi‘er, 0.2 pl bovine serum albumin (20 mg-ml“), 2.5 pl DMSO (10%, vzv),

1.25 pl 25 mM dNTP-Mix (1:1:l:l), 1.25 pl (50 pmol) Box primer, 0.4 pl (2 units) Taq

polymt
PCR 31

Therm

15.1 rr

photo;

The c
huh
bronr
cell it

relies

32

polymerase (Perkin-Elmer, Cat # N808-0070) and H20 to adjust the final volume to 25 pl.
PCR amplifications were per-fanned in an automated DNA thermal cycler (Perkin-Elmer DNA
Thermal Cycler). 6 to 10 pl of PCR products were separated electrophoretically on 1.5%
agarose gels in 0.5X TAE buffer (50X TAE bufl‘er: Tris base 108 g-L' 1, 85% phosphoric acid
15.1 nil-L" and 1.5 M EDTA 40 ml-L") at 4.5-5V-cm“, stained with ethidium bromide and

photographed under UV light.

Results and Discussion

Strain classification of this culture collection was carried out by Dr. Zhang using the
criteria established in “The Manual for the Identification of Streptomyces mp. ” (Table 2.1).
The classification was based on cell morphology and culture characteristics such as color of
hyphae in specific medium and carbon utilization patterns. Figures 2. land 2.2 show ethidium-
bromide stained gels of the genomic fingerprints of Streptomyces mp. generated from crude
cell extracts of each strain using the BOX AIR primer. Box-PCR generated fingerprints
revealed considerable genomic diversity within strains classified earlier as members at the
same species. The fingerprint patterns characteristic of each strain were similar in the number
and size range of the DNA banding patterns to these patterns reported in earlier work which
utilized BOX-PCR to characterize Frankia (Actinomyces) strains (Murry et al., 1995)

S. glabimorus strains MSU/ZD/OOl and MSU/ZD/OO3 share a common DNA
fragment of 1,018 bp while the rest of the bands were different in these two strains. S.
globtmarus, strain MSU/ZD/OOZ, had a fingerprint pattern distinct fi'om these patterns seen
in strains 001 and 003. The two strains of S. raseamarus, MSU/ZD/OO4 and MSU/ZD/OOS,

shared a common band of 800 bp, but otherwise the overall pattern was different. S.

810515!
at 1,0l
Other 2
glauct

of the

S. cin

finger

of 1,2
MSU.

of S.

fragrr,

Simila
MSU
bands

’D’gro

belOn
PCR

89110

33

glabr'marus (MSU/ZD/003) and S. raseamarus (MSU/ZD/004) showed comigrating bands
at 1,018, 900, and 850 bp, which indicates that these two strains are closely related to each
other although they were not placed in the same group by the criteria used by Dr. Zhang. S.
glaucus, MSU/ZD/007 and MSU/ZD/009, had comigrating bands at 1,100 and 970 bp. Each
of the other strains grouped as S. glaucus showed unique patterns.

Among all strains in this culture collection, the BOX-PCR fingerprint patterns of two
S. cinereus strains, MSU/ZD/013 and MSU/ZD/014, were the only two with very high-
similarity to each other. Each of the other 4 strains grouped as S. cinereus showed a distinct
fingerprint pattern. Similarly, the three strains of S. viridis each gave a unique pattern. S.
griseambravialaceus, strains MSU/ZD/023 and MSU/ZD/OZS, shared one comigrating band
of 1,200 bp, two bands at 850 bp and one band at 550 bp. S. grisearubravialaceus, strains
MSU/ZD/026 and MSU/ZD/027, showed fingerprint patterns that were distinct from those
of S. grisearubravialaceus, strains MSU/ZD/023 and MSU/ZD/OZS, but shared common
fragments of 650 and 506 bp.

The fingerprint patterns of the seven strains of S. griseafirscus did not show any
similarity to each other nor to any of the other strains. The two of the S. aureus strains,
MSU/ZD/O37 and MSU/ZD/O38, exhibited a common fragment of 1,450 bp in size, two
bands at about 900 bp and one bands at 550 bp. S. cyaneus, strain MSU/ZD/022, and S.
hygroscopicus, strains MSU/ZD/048, also gave unique fingerprints.

In earlier work (Murry et al. 1995), strains of Frankia (Actinomycetales) known to
belong to the same genomic species (based on DNA-DNA hybridization) showed similar Box-
PCR fingerprint patterns with at least 2 prominent bands in common. Strains fi'om different

genomic species shared no common bands. Hence, strains MSU/ZD/013 and MSU/ZD/014,

Wil

the
ace

exp

resc
defir

conu

strait
quant

SPP- I

“>snt

 

34

which display nearly identical fingerprints, are clearly close related and probably belong to the
same genomic species. The occurrence of comigrating bands shared by some strains suggest
that they may be the members of the same genomic species. Thus, the strains grouped
according to phenotypic characteristics by Dr. Zhang appear to be heterogeneous than
expected and may represent more than one genomic species. For example, S. glabimorus,
strains 001 and 003 are probably members of the same genomic species while strain 002, also
classified as S. globimarus appears to more distantly related. These results in general indicate
that the genetic diversity within this culture collection is large. However, note that the high
resolution of the BOX-PCR technique does not by itself allow classification of strains into
defined species. Further analysis utilizing DNA-DNA hybridization or 16S rRNA sequence
comparisons will allow assignment of these strains to known genomic species.

Antibiotic production of Streptomyces is known to be strain-specific. However,
strains within the same species are known to produce different antibiotics or different
quantities of the same antibiotic, whereas strains currently classified as different Streptomyces
mp. may produce the same antibiotics (Loria et al., 1995). Thus, we have concluded that
because of the large degree of genetic variation among this culture collection, it was necessary

to screen each strain to test the potential biological activities of their secondary metabolites.

35

12 3 4 5 6 7 8 9 10 111213141516 171819 2021222324

 

Figure 2.1: BOX-PCR fingerprint patterns of genomic DNA from Streptomyces mp. strains.
A Lanes: 1 ,13 and 24, le marker; 2, strain 001; 3, 002; 4, 003; 5, 004; 6, 005; 7, 006; 8,
007; 9, 008; 10, 009; 11, 010 ;12, 011; 14, 013; 15, 014; 16, 015; 17, 016; 18, 017; 19, 018;
20, 019; 21, 020; 22, 0211; 23, 022.

B. L,"
9. 03t
040'

1

 

 

36

l 2 3 4 5 6 7 8 9 10 111213141516 171819 202122 2324252627

 

Figure 2.2: BOX-PCR fingerprint patterns of genomic DNA fi'om Streptomyces mp. strains.
B. Lanes: 1 ,16 and 27, le marker; 2, 023; 3, 024; 4, 025; 5, 026; 6, 027; 7, 028; 8, 029;
9, 030; 10, 031; 11,032; 12,033; 13,034; 14,035; 15,036; 17, 037; 18; 038; 19, 039; 20,
040; 21, 041; 22, 043; 23, 044; 24, 045; 25, 046, 26, 048.

on cell

and lyc

andth

All an

Plates i

Strain

Staph

 

activi
comp
Crud;
aeg}

tOpis

Chapter III

Bioactive extracts from nitrogen-fixing Streptomyces spp.

Abstract

Preliminary antimicrobial , mosquitocidal and anti-cancer bioassays were carried out
on cell and cell-fiee culture extracts from 48 strains of Streptomyces mp. obtained from
China All cultures were grown in both A9 and YMG media. The solvent extracts of cells
and 1y0phi1ized cell-flee medium were bioassayed against several test strains of bacteria, firngi
and the mosquito larvae, Aedes egjpti. Anticancer bioassays were conducted on mutant
Sacclwamyces cerevisae strains to determine the presence of tap I or II inhibitory activities.
All antimicrobial bioassays were performed by spotting 250 pg of crude extracts on agar
plates inoallated with the appropriate test strain. The mosquitocidal bioassay was conducted
using 250 ppm in 1 ml of water. Crude extracts fiom both cell and cell-fiee medium of most
strains showed some activity against the gram-positive bacteria Streptococcus aureus and
Staphylococcus epidermidis. About half of the strains tested showed growth-inhibitory
activity against the fungal plant pathogen, Gleamarum mp. Also, some strains produced
compounds that are inhibitory to the growth of Escherichia caIr' and Candida albicans.
Crude extracts fi'om several strains showed significant mosquitocidal activity against Aedes
aegjpti larvae. Seven of the strains studied exhibited anticancer activity based on

topisomerase assays.

37

evidt

after

cult

C0”

micr

esse
devt
(MC
aga‘l
tram
(Vin
a wi.
r"1131c!
this E

 

38

Introduction

Centuries of human use of medicinal plants and herbs guided scientists to isolate and
purify multitudes of active principles for pharmacological use. Such historical data were not
evident for the use of microorganisms in human medicine. The researchers first focused their
attention on plants, because of the abundance of material and relative ease with which it could
be collected (Vining, 1990).

At the beginning of this century, natural product chemists began to investigate the
secondary metabolites fi'om microorganisms. The metabolites usually were isolated fi'om the
cultures which were easy to grow and also gave high yields of active compounds. Decades
ago, the study of secondary metabolites was focused primarily on the production of bioactive
components. Since the discovery of penicillin, secondary metabolites isolated from
microorganisms became another rich source for pharmaceutical and agricultural applications.

Secondary metabolites exhibit their antibiotic activity because of their ability to inhibit
essential metabolic processes of other microorganisms (Vining, 1990). Throughout the
development of effective and safe antiinfectives, countless antibiotics were abandoned
(Monaghan et al., 1990). One of the reasons is that many of the antibiotics were directed
against one of the universal primary metabolic pathway reactions, frequently involving energy
transduction or gene expression. Thus, they are toxic to animals and have to be discarded
(Vining, 1990). However, some of the antibiotics which show growth-inhibitory activity in
a wide range of organisms have found use as anticancer drugs, because of their toxicity to
rapidly proliferating cells (Vining, 1990). Anthracycline and bleomycin are the members of
this group of antibiotics (Tsukagoshi et al., 1986).

The insecticidal activity of some compounds produced by microorganisms has been

den

p01:

mic

V31"

(Gt
abt
me
bio

Her

H0

grou
from
in u

biota

39

demonstrated (Fabre et al., 1988). The existence of microbial epizootics among insect
populations accounts for fluctuations in agricultural pest infestation (Vining, 1990). Although
the causes of insect mortality are often complex, the formation of toxic agents by an invading
microorganism is sometimes a factor. Direct screening of microorganisms has uncovered a
variety of secondary metabolites with insecticidal activity such as milbemycins (T akiguchi et
al., 1980).

A high proportion of microorganisms isolated from soil showed various activities
(Gottlieb, 1976). Among the soil microorganisms, Streptomyces mp. is known to produce
about 75% of the antibiotics currently in use. Even today, many new active secondary
metabolites are isolated from Streptomyces mp. with novel biological activities. Most of the
bioactive secondary metabolites are discovered by using numerous screening methods.
Hence, novel biological activity may be found for known compounds.

As research progresses, the screening for antibiotics became more selective.
However, fermentation broths submitted for assays have remained largely fiom those of
randomly chosen cultures (Monaghan, 1990). The Bioactive Natural Product Laboratory
(BNPL) at Michigan State University recently has acquired a culture collection of nitrogen
fixing Streptomyces mp. from China (Zhang, 1994). The production of secondary
metabolites by these unique Streptomyces mp. have not been investigated until now. Since
the Sa'eptonryces mp. is a rich source for bioactive compounds, it is logical to investigate new
groups of Streptomyces mp. (Monaghan, 1990). The collection from China was isolated
from regions not yet extensively sampled and because these strains fix nitrogen, they present
an unique group among Streptomyces spp. Thus, this strains collection may produce novel

bioactive compounds.

Strep

were
(197
glam

cure.

Cult

8'1-

8'1-

solit

20

all

 

40

Material and Methods

Streptomyces mp bolatss: More than 68 strains of Streptomyces mp. were isolated from
soil samples at various locations in China (Zhang, 1994 personal communication). They
were classified according to "The Manual for the Identification of Streptomyces mp. "
(1975) and belong to Streptomyces glabimarus, S. raseamarus, S. lavendulae. S.
glauars, S. cinereus, S. viridis, S. cyaneus, S. grisearubravialaceus, S. griseafirscus, S.

aureus and S. hygroscopicus.

Culturlng the organism: The cultures were initially grown in an inorganic medium (1.09
g°L" KH,PO,, 0.44 g-L" KHPO,, 0.0014 g-L" MgSOflHzO, 0.34 g -L" NaCl, 0.34
g°L" CaSO,°2H,O, 0.01 g-L" FeSOflHZO, 0.0027 g-L" NazMoO,-2HZO, 9.1 g-L"
sucrose, 34.2 g-L" KOH, 18 g-L" agar and 114 g-L " H,PO,) and then transferred to
solid YMG (yeast extract 4 g - L", malt extract 10 g - L", glucose 4 g ° L" and agar 18 g
- L") medium. Twenty of the 68 cultures in the collection were unable to grow in YMG

medium (Table 2.1).

Production of bioactive metabolites: The cultures were grown on YMG slants and
incubated for 8 days at 26°C. After 8 days, the cells were transferred into 400 ml Erlenmeyer
flasks containing either 100 ml YMG or A9 (peptone 4 g-L", glucose 10 g-L" and molasses
20 g-L") liquid media, separately. The inoculated flasks then were placed on a rotary shaker

at 110 rpm at 26°C for 8 days.

41

The cells were harvested fi'om YMG and A9 media by centrifirgation at 10,000 rpm
and 4°C. The wet cells were homogenized and extractedwith 100 ml of MeOH (Crude I).
The cell-free media was lyophilized, and the residue was extracted with 15 ml of MeOH
(Scheme 3.1). The MeOH-soluble extract (Crude II) and the MeOH-insoluble portion (Crude
III) were dissolved in DMSO and distilled water, respectively, and bioassayed at 250 ppm

concentrations.

Antimicrobial bioassays: Cultures of Gleamarum mp. were grown on PDA medium (potato
dextrose agar 39 g°L"). Cultures of Candida albicans were grown on YMG medium, and
cultures of Staphylococcus epidermidis, Streptococcus aureus and Escherichia cali were
grown on Emmons medium (neopeptone 10 g-L", glucose 20 g-L" and agar 18 g'L"). The
test organisms were harvested after 8 days of growth by resuspending the fully grown culture
fiom growth plates in 10 ml of sterile saline solution. The cell suspension was adjusted to 103
colony forming units per milliliter (CFU/ml). Bioassay plates were made by spreading cell
suspensions (100 pl) of the test organisms on the surface of solid agar containing the
respective medium. The test sample (250 pg-20pl" of solvent, DMSO or H20) was spotted
on plates inoculated with the test organism. The plates were incubated at 28°C for 72 h
before the zone of inhibition, characterized by the absence of microorganism’s growth, was

measured. Pure solvent (20pl) served as controls.

Mosquitocidal assay: This bioassay was conducted on the fourth instar of the mosquito
larvae, Aedes aegjpti, reared from eggs (Courtesy of Dr. Alexander Raikhel, Department of

Entomology, Michigan State University) (Nair et al., 1989). Fifteen larvae (3-4 days old)

42

 

 

Whole Broth

 

 

 

Centrifugcd

 

l
Mycelia

 

 

 

 

Homogcnized with MeOH
Filtered

 

 

 

 

 

 

 

 

Cell-free Broth

 

 

Lyophilized at 5° C
Extracted with MeOH

 

 

 

 

Spent cell MeOH extract

 

 

 

 

 

 

Discarded

 

 

Crude extract I

 

 

 

Bioassayed

Evaporated in vacuo

MeOH extract

 

 

 

 

 

 

 

Crude extract III

 

Crude extract II

 

 

 

Bioassayed

Bioassayed

Scheme 3.1 Processing of fermentation broth fiom Streptomyces mp.

 

 

 

43

were placed in 980 pl of distilled water in a test tube and the crude extracts, 250 pg°20 p1"
of DMSO or H20, were added. Controls received 20 pl of pure solvent, either DMSO or
FLO. The test tubes were covered and kept at room temperature. The number of dead larvae

was recorded at 2, 4, 6 and 24 h intervals. Each treatment was repeated in triplicate.

Anticancer assay: Saccharamyces cerevisiae mutant cell cultures, JN3 94, JN3 94Ll and
IN394t2,, were used to test for anticancer activities (Nitiss et al., 1993). Strain JN394 is
hypersensitive to tapoisomerase I and II poisons due to the mutations that destroyed the
RAD52 repair pathway. Strain JN394t.l is isogeneic to JN3 94 except that the top I gene is
deleted. The deletion of top I gene results in the lack of response to topoisomerase I poisons.
JN394t,,, carries the tap 2-5 gene and is resistant to the topoisomerase II poisons but
responds to the tapoisomerase I poisons (Table 3.1).

Table 3.1. Topoisomerase sensitivity of yeast strains in the anticancer assay

 

 

S. cerevisae strain T op I T op II
JN394 + +
JN3 94t_l - +
JN394t2,, + -

 

The organisms were cultured for seven days on solid YPDA medium (yeast extract,
20 g-L"; peptone, 10 g-L"; dextrose, 20 g-L"; adenine sulfate, 2 ml-L" from 0.5% stock
solution and agar 17 g-L"). Ten ml of sterile saline solution was added to the surface of a
fully grown culture in a Petri dish to resuspend the cells, and then the cell concentration was

adjusted to 5X10° CPU/ml. Bioassay plates were made by spreading cell suspension (lOOpl)

44

on the surface of solid agar YPDA medium. The test samples (250 pg-20 pl‘1 of solvent)
were spotted directly on the surface of the plates inoculated with the respective organisms and
were incubated at 28°C. The zone of inhibition, characterized by the absence of microbial
growth, was measured in mm after 72 h. The extracts which did not show a zone of inhibition

wasrecordedas -.

Results and Discussion

The anticancer assays showed that 7 of the 48 strains were potential candidates for
the production of anticancer compounds (Table 3.2). One strain of S. viridis (MSU/ZD/02 1)
and three strains of S. aureus (MSU/ZD/O3 7, MSU/ZD/O43 and MSU/ZD/O44) showed
activities against JN394 and JN394t2,,. Strain 043 gave 20 and 30 mm of zones of inhibition
when the crude extracts were tested against JN394 and IN3 94t2,,, respectively. Strain 02]
gave more than a 30-mm zone of inhibition when it was tested against IN 3 94. These results
indicated that the test extracts were active against topoisomerase I poisons but were not
active against top II enzyme. Two strains of S. cinereus (MSU/ZD/Ol3 and MSU/ZD/Ol4)
and one strain of S. gnlseofiwcus (MSU/ZD/O32) exhibited similar activity against IN 3 94 and
JN394t.l . The crude extracts from these three strains gave excellent zones of inhibition and
are potential sources for top 11 poisons.

Four strains, S. raseamarus (MSU/ZD/OO4), S. glaucus (MSU/ZD/OO7), S. cinereus
(MSU/ZD/013) and S. Wficfis (MSU/ZD/Ol9) showed activity against C. albicans spp. (Table
3.3). The strain S. cinereus produced an intracellular secondary metabolite when it was
grown in YMG medium. The cell extract gave a 10 mm of zone of inhibition against C.

albioans. S. mamas, S. glaucus and S. viridis produced compounds that were inhibitory

45

to the growth of C. albicans. Also, S. roseospoms and S. viridis gave 24 and 6 mm of zones
of inhibition, respectively, when they were grown in A9 medium. These strains did not
produce active metabolites when fermented in YMG. S. glaucus produced active extract
from both A9 and YMG medium and gave 17 and 10 mm zones of inhibition against C.
albicans, respectively. TLC of these extracts showed that S. glaucus yielded identical
compounds.

There were only two strains, S. glaucus (MSU/ZD/OIZ) and S. cinereus
(MSU/ZD/Ol7), which exhibited activity against E. coli (Table 3.4). The activity was found
in the media but not cell extracts in both of these strains. The MeOH extract of the dried
YMG medium fi'om S. glaucus gave 6 mm of zones of inhibition against E. coli. The MeOH
extracts of dried cell-free YMG and A9 broth fi'om S. cinereus were active against E. coli and
showed 8 and 7 mm of zones of inhibition, respectively. In addition, strain 017 released
water-soluble secondary metabolites into the A9 growth medium and gave an ll-mm of zone
of inhibition against E. coli.

Antifimgal assays with Gleasporum .gop. showed that 15 strains had marginal activity.
All of the extracts gave of zones inhibition less than 10 mm. The cell extracts from S.
roseospoms (MSU/ZD/OOS), three strains of S. glaucus (MSU/ZD/OO6, MSU/ZD/008 and
MSU/ZD/012), S. viridis (MSU/ZD/OZI), S. cyaneus (MSU/ZD/022) and S.
grisembroviolaceus (MS/ZD/026) exhibited antifungal activity (Table 3.5). Two strains of
S. glabisporus (MS/ZD/002 and MSU/ZD/OO3), S. roseosporus (MS/ZD/OO4) and three S.
cinereus (MSU/ZD/Ol4, MSU/ZD/OIS and MSU/ZD/Ol6) released antifungal compounds

to their growth media and inhibited the growth of Gleosporum spp. Both cell and media

extracts of S. glaucus (MSU/ZD/007) and S. cinereus (MS/ZD/013) were active against

 

46
Gleosporum App.

Extracts fi'om a total of 20 strains showed activities against Streptococcus aureus and
Sttphylococcras epidermidis (Table 3.6). Most of these strains gave between 10 and 30 mm
of zones of inhibition. The activities were found in both cell and media extracts. S.
griseofuscus (MSU/ZD/O3 3) was the most active among these strains and the zones of
inhibition were 35 and 30 mm for S. aureus and S. epidemidis, respectively.

Crude extracts from strains of S. cinereus (MSU/ZD/Ol3), S. griseoubrovr‘olaceus
(MS/ZD/026), S. griseofuscus (MS/ZD/O32 and MSU/ZD/O3 3) and S. aureus
(MSU/ZD/O44), exhibited significant mosquitocidal activity (Table 3.7). These extracts gave
100% mortality at 24h when tested at 250 ppm concentration. When strains S.
gnlseoubroviolaceus and S. aureus (MSU/ZD/044) were grown in YMG medium, the extracts
fi'om these two strains gave 100% mortality at 6 and 4 h, respectively. However, the activity
decreased significatly when both strains were grown in A9 medium. The TLC of the cell
extract from S. griseoubroviolaceus showed that there were more compounds in YMG
extract than that of A9. Also, S. cinereus and S. aureus (MSU/ZD/O33) exhibited different
activity on mosquito larvae when they were grown in YMG or A9 media. The crude extract
from S cinereus grown in A9 medium gave 100% mortality at 4 h but the YMG extract was
active only at 24 h Similarly, the YMG and A9 extracts from the strain 033 produced 100%
mortality against mosquito larvae at 2 and 4 h, respectively. This result indicates that the
growth environment of these cultures had a significant effect on the synthesis of secondary
metabolites. However, comparison of the TLC of these crude extracts suggests that these
strains produce the same antibiotic under different fermentation conditions.

The bioassays showed that results suggest that the crude extracts from more than half

47

of the culture collection were active against gram-positive bacteria, and some of them
exhibited marginal activities against firngi and yeast. The mosquitocidal assay showed that
five strains produced active extracts against mosquito, especially S. griseofirscus
(MS/ZD/O33). Therefore, this strain was studied fiirther for the isolation and identification
of the mosquitocidal compound. Chapter IV of this thesis describes the insecticidal

compound 1 isolated from S. griseofuscus.

48

Table 3.2. The results of preliminary anticancer assays measured as zone of inhibition in mm

 

 

 

Organism - Strain No. Saccharomyces cerevisae
JN394 JN394t_I JN394tM
S cinereus - 13 20 20 —
S. cinereus - 14 20 20 -
S. viridr’s -21 30 - 10
S griseafirscus - 32 20 10 —
S aureus - 37 10 - 10
S aureus - 43 20 — 30
S aureus . 44 10 — 20

 

Table 3.3. The list of active extracts from Streptomyces spp. grown in YMG or A9
medium at 250 ppm against Candida albicans

 

Organism - Strain No. Growth Medium Active portion Zone of inhibition (mm)

 

S. roseosporus - 4 A9 Cnide ll 24
S glaucus - 7 YMG Crude Ill 10
S glaucus - 7 A9 Crude II 17
S cinereus - 13 YMG Crude I , 10
S. viridr’s - 19 A9 Crude II 6

 

Table 3.4. The list of active extracts fiom Streptomyces spp. grown in YMG or A9
medium at 250 ppm against E. coli

 

Organism - Strain No. Growth Medium Active portion Zone of inhibition (mm)

 

S glaucus - 12 YMG Crude II 6
S cinereus - 12 YMG Crude II 8
S. cinereus - 17 A9 Crude II 7

S. cinereus - 17 A9 Crude III 11

 

49

Table 3.5. The list of active extracts from Streptomyces spp. grown in YMG or A9
medium at 250 ppm against Gleosporum spp

 

 

Organism - Growth Active Zone of inhibition
Strain No. Medium portion (m)
S globr'sporus - 2 A9 11 5
S. globr‘sporus - 3 Both II 7
S roseosporus - 4 A9 11 7
S. roseosporus - 5 A9 I 7
S glaucus - 6 YMG I 6
S glaucus - 7 A9 11 5
S glaucus - 7 Both I 6
S glaucus - 8 YMG I 5
S glaucus - 12 Both 11 6
S cinereus - 13 Both I 9
S cinemas - l3 YMG II 6
S cinereus - l4 YMG II 6
S cinereus - 15 Both 11 6
S cinereus - l6 YMG II 6
S vrfidis - 21 Both I 7
S cyaneus - 22 Both I 10
S. griseorubrovr‘olaceus - 26 A9 I 10

 

Both: YMG and A9

Table 3.6. The list of active extracts from Streptomyces spp. grown in YMG medium at
250 ppm against Streptococcus aureus and Staphylococcus epidermidis

 

 

Organism - Growth Active Zone of inhibition (mm)
Strain No. medium portion S. aureus S. epidermidis

S. roseosporus - 4 YMG I, II and III 21, 25, 0 0, 20, 13

S roseosporus - 5 YMG H and III 13, 13 15, 13

S. glaucus - 7 YMG I, II and III 24, 15, 12 24, 15, 11

S. glaucus - 7 A9 I, II and III 25, 12, 12 22, 12, 12

S glaucus - 8 YMG I, II and H1 16, 10, 0 0, 13, 10

S cinereus - 13 YMG I 32 30

S. cinereus - 13 A9 I 30 30

S cinereus - l7 YMG III 0 7

S. viridis-Zl YMG IandII 27, 13 17, 0

S. viridis-Zl A9 IandII 20, 10 17, 0

S cyaneus - 22 YMG I O 15

S cyaneus - 22 A9 I 0 12

S. griseorubroviolaceus - 24 YMG II 13 0

S griseorubroviolaceus - 25 YMG I 8 25

S griseorubroviolaceus - 25 A9 I 10 O

S griseorubroviolaceus - 26 YMG I and III 23, O 15, 17

S. griseorubroviolaceus - 26 A9 I 10 10

S griseofilcus - 30 A9 111 O 12

S griseofircus - 31 YMG II 0 10

S griseofilcus - 32 YMG I and II 26, 0 26, 10

S griseofucus - 33 YMG I and III 35, 0 30, 5

S griseofucus - 33 A9 I and II 30, 20 28, 12

S griseofucus - 34 YMG I, II and III 35, 35, 0 28, 20, 30

S griseofucus - 34 A9 I, II and III 30, 22, O 30, O, 10

S aureus - 38 A9 I 21 20

S aureus - 44 YMG I 15 23

S aureus - 45 YMG I 13 15

S aureus - 46 YMG I, II and III 20, 18, 14 18, ll, 14
imam-46 A9 InmlIII 15 17-15

 

 

51

Table 3.7. The list of the active extracts produced by Streptomyces spp. that exhibited
100% mortality against mosquito larvae Aedes aegmti at 250 ppm.

 

 

Organism - Strain No. Grth Media Time (h)
S cinereus - 13 YMG 24
S cinereus - 13 A9 4
S griseorubroviolaceus - 26 YMG 6
S. griseofirscus - 32 YMG 4
S griseofirscus - 32 A9 4
S griseofirscus - 33 YMG 2
S griseofuscus - 33 A9 4
S. aureus - 44 YMG 4

 

Chapter IV

An insecticidal metabolite from nitrogen fixing Streptomyces griseofuscus

Abstract

S gn’seofirscus, strain MSU/ZD/033, was grown in YMG media for 8 days at 26°C
on a shaker, the cells were harvested and extracted with MeOH:CHCl3 mixture. The
insecticidal compound 1 was purified from the crude cell extract by MPLC, TLC and finally
by a recycling preparative I-IPLC. The identification of this compound was achieved by
NMIL MS and UV spectral methods on the natural product and its methylated and acetylated
derivatives. It is identical to an antibacterial antibiotic, indanomycin, reported earlier. In our
tests, compound 1 showed bactericidal and insecticidal activities. In feeding trials using
artificial diet, compound 1 demonstrated a 50% weight reduction for gypsy moth (Lymantria
dispar) and tobacco homworrn (Manduca sexta) neonate larvae at 100 ppm concentration
at 6 days. Also, it reduced the weight of corn earworrn (Helicovarpa zea) at 100 ppm by
33% after six days. Compound 1 gave 100% mortality on 4 th instar mosquito larvae, Aedes

aegmti, at 20 ppm. This is the first report of insecticidal activity of compound 1.

52

53

Introduction

More than half of the worldwide expenditure on agrochemicals was devoted to
insecticides in an efi‘ort to defy the continuous onslaught of over half a million difl‘erent
herbivorous insect species (Ley et al., 1993). Despite this, 15% of the crops planted are lost
to feeding insects and other pests (Ley et al., 1990). The cost of this damage and its effect
on agriculture has increased the demand for more effective crop protection agents.

For many years, pest control has been based primarily on the utilization of synthetic
compounds (Fabre et al., 1988). Dichlorodiphenyltrichloroethane (DDT) was the first major
synthetic insecticide used widely, but it caused enormous environmental and human health
problems. Since then, numerous other insecticides have been developed for insect control.
Currently, the three groups of insecticides which show more environmentally acceptable
properties are organophosphates, carbamates and pyrethroids (Pickett, 1988). However,
these compounds are toxic toward a wide range of insects and, while effective against the
target pest, ofien kill other insect species including natural enemies of pests (Ley et al., 1990).
The continued use of these compounds has resulted in the development of resistance to these
compounds in pest populations, environmental pollution and hazard to humans (Munakata,
1975). Therefore, new insecticidal compounds with less environmental impact are sought to
manage insects. Natural products are considered to be an ideal source for these requirements
and several natural products have been developed as insecticidal agents (Fabre, 1988).

The use of plants or plant extracts against insects has been known for a long time.
Plants have evolved to produce chemical defenses against insect attack and thus, provide us
with a rich source of biologically active metabolites including repellents, attractants and insect

growth regulators (Ley et al., 1990). Plant-derived compounds such as alkaloids, terpenes,

54

fatty acids were the first shown to have insecticidal activity. The pyrethroids account for
about one third of the world’s insecticide use. They were developed by the structural
modification or total synthesis based on insecticides isolated from pyrethrum flowers.
(Pickett, 1988).

The microbially produced insecticidal metabolites are a relatively new discovery
compared to the plant derived insecticides because the early screening of microbial
metabolites was focused on antimicrobial activity alone. Since secondary metabolites from
microorganisms were found to be effective against human diseases, their use was explored
in agricultural pest control as well. About 75% of microbially produced antibiotics were
isolated from the actinomycete family, especially members of Streptomyces spp. Screening
of microorganisms for the production of antimicrobial activities resulted in the discovery of
many secondary metabolites with insecticidal activity, such as milbemycins (Mishima et al.,
1983) and prasinons (Box et al., 1973). Also, the use of additional novel bioassays facilitated
the discovery of several secondary metabolites from fermentation products with novel
biological activities.

The chapter III of this thesis describes the preliminary bioassays of extracts from a
variety of nitrogen-fixing Streptomyces spp. These assays indicated that S. griseofirscus
(MS/ZD/033) produced the most active metabolite against mosquito larvae Aedes aegwti.
Hence, mosquitocidal-assay-directed purification of the cell extract from S griseofirscus was
carried out to elucidate the structure of the active metabolite. This chapter describes the
fermentation, isolation, purification and structure elucidation of the mosquitocidal compound

1 (Fig. 4.1) fi’om S griseofirscus.

 

55

Materials and methods

General experimental methods: The media used in the fermentation or grth of organisms
were liquid YMG (yeast extract 4 g-L", malt extract 10 g-L'l and glucose 4 g-L‘l ); solid
YMG (yeast extract 4 g-L“, malt extract 10 g-L", glucose 4 g-L“ and agar 18 g-L“ ); A9
(peptone 4 g-L", glucose 10 g-L" and molasses 20 g-L"); PDA (potato dextrose agar 39
g-L") and Emmons (neopeptone 10 g-L", glucose 20 g-L'l and agar l8 g-L").

The ingredients of dry diet for insects were: for gypsy moth; 36 g wheat, 7.5 g casein,
2.4 g Wesson’s salt mix, 0.6 g sorbic acid, 0.3 g methylparaben (p-hydroxy-benzoic acid
methyl ester), 3.0 g Hofr‘rnan-LaRoche #26862 vitamin mix (Bell et al., 1981); for corn
earworm; 63.8% corn meal (gelatinized), 24.2% soy flour (defatted and toasted), 5% nonfat
dry milk, 5% soy oil (refined and stabilized), 2% vitamin-mineral premix (Burton, 1969); for
tobacco homworm; 100 g wheat germ (pre-ground), 45 g casein (purified), 40 g sucrose, 30
g torula yeast, 15 g salt mixture, 4 g ascorbic acid, 1.5 g sorbic acid, 1.0 g methyl-P-hydroxy
benzoate, 0.5 g cholesterol, 30 mg vitamins (Yanamoto, 1969). The insect diets were made
as follows. The agar solution (1.8% agar for gypsy moth, 1.4% agar for corn earworrn, 1.9%
agar for tobacco homworm) was held at 50°C and then added to the dry diet for gypsy moth
(845 mg) (Bell et al., 1981), corn earworrn (940 mg) (Joyner et al., 1985) and tobacco
hornworrn (950 mg) (Bell et al., 1976) until the total diet weighed 5 g. Compound 1,
dissolved in 25 pl of DMSO, was mixed with the diet. Controls received 25 pl of DMSO
alone.

The NMR spectra of compound 1 in DMSO solution were recorded at 45°C on
Varian VXRSOO MHz spectrometers at Max T. Rogers NMR facility in the Department of

Chemistry at Michigan State University. The spectra of methylated and acetylated derivatives

 

56

in CDCl3 solution were recorded on Varian VX1800 MHz spectrometers at the same facility.
The UV spectrum of compound 1 at 10 ppm in MeOH was recorded on a Shimadzu UV-260
spectrophotometer. CIMS and FABMS were obtained on JEOL JMS-AXSOS and JEOL
JMS-HXI 10 mass spectrometers at the MSU Mass Spectroscopy facility in the Department
of Biochemistry, which is supported in part by a grant (DRR-00480) from the Biotechnology
Research Technology Program, National Center for Research Resources, National Institutes
of Health. Circular Dichroism analysis was conducted using a 1 mgml" solution of
compound 1 in MeOH on a JASCO J-710 spectropolarimeter (J asco Incorporated, Japan).
The nitrogen gas (99.99%) was generated by a nitrogen gas generator model NG-ISO (Peak
Scientific) at a flow rate of 20 L-min“. The melting point was recorded on a Thomas Model
40 micro hot-stage apparatus and was not corrected.

Silica gel TLC plates with organic binder (250p) were used for purification
(Analtech). Final purification of compound 1 was performed on a recycling preparative
HPLC model LC-20 and connected with a fraction collector model AS-20 (Japan Analytical
Industry Co). The columns used were Shodex GS 3-10 2F (Asahi Chemical Industry Co.,
Ltd) and Jaigel-ODS S-343-15 (Japan Analytical Industry Co., Ltd). The GS 3-10 column
was 20 x 300 mm and its precolumn was 8 x 40 mm. The ODS column was 20 x 250 mm
and it’s precolumn was 8 X 40 mm. N-nitroso-N-methylurea, KOH, pyridine and acetic
anhydride used in the methylation and acetylation reaction of compound 1 were purchased
from Sigma Chemical Company, J .T.Baker Chemical Co., Mallinckrodt, Inc. and Columbus

Chemical Industries,Inc., respectively.

 

57

Fermentation of S. griseofuscus for the production of the insecticidal compound:
Cultures of S griseoflrscus stored on inorganic medium (1.09 g - L" KHZPO” 0.44 g 'L"
KI-IPO4, 0.0014 g 'L" MgSO.-7HZO, 0.34 g L" NaCl, 0.34 g-L" CaSO4-2HZO, 0.01
g°L" FeSO4-7HZO, 0.0027 g-L" NaQMoOflHzo, 9.1 g - L" sucrose , 34.2 g -L" KOH,
18 g - L" agar and 114 g - L" H3PO) were transferred onto YMG media slants and
incubated for eight days at 26°C. These cultures then were transferred into 400-ml seed
flasks containing 100 ml of YMG liquid medium. The inoculated flasks were kept on a rotary
shaker at 110 rpm at 26°C for eight days,-subcultured to 2 L seed flasks containing 400-ml

of A9 medium and were incubated on a rotary shaker at 110 rpm and 26°C for eight days.

Isolation and purification of the insecticidal compound 1: The fermentation broth of S.
griseoflrscus (6 L) was centrifuged at 4°C and 10‘ rpm for 10 min to separate the mycelia
fiom the broth (Scheme 4.1). The wet cell-pellet (400 g) was extracted with MeOH:CHCl3
(3:1, 800 ml) followed by 100% CI'ICl3 (500 ml). The residual cell mass was discarded. The
combined organic extracts were evaporated to dryness under vaccum and yielded a powdered
product (5.8 g). This product (5.8 g) was partitioned with MeOH:CHCl3 (1:10, 15 ml x 4)
and the soluble portion was evaporated to dryness (4.5 g). This product (4.5 g) was
extracted further with acetonitrile (3 ><15ml), and the soluble portion was evaported to dryness
to yield an amorphous powder (1.6 g).

The acetonitrile extract (1.6 g) was fractionated on a GS 3-10 column using
MeOHzH¢O (85:15) as a mobile phase at a flow rate of 5 ml-min" and detected at 228 nm.

The fraction with 42 min retention time (889 mg) was chromatographed firrther on silica

58
TLC plates with CHCl,:Benzene:MeOH (25: 15:3) as the mobile phase. The band at 0.75 Rf

was collected, eluted with MeOH (15 ml), yielding a pale yellow powder (533 mg). This
product was purified finally by preparative HPLC on an ODS column using MeOHszo
(95:5) as the mobile phase at a flow rate of 3 ml-min" and detected at 228 nm. The peak at
76 min was collected and evaporated to dryness. The resulting product was a white
crystalline powder, compound 1 (480 mg) (Scheme 4.1). The yield of compound 1 was 80

mg-L' ‘ of the fermentation broth.

Compound 1: A white crystalline solid, mp. 98-101°C; MP C,,H,3NO,; UV Am (MeOH):
243 (6: 36630) and 289 nm (6: 17847); EIMS, m/z (relative abundance): 55 (15), 67 (18),
94 (100), 119 (18), 135 (15), 157 (14), 187 (10), 212 (10), 238 (10), 251 (65), 281 (9), 334
(6), 399 (7), 420(5), 464 (80), 493 (19, M‘). lI-INMR and l3CNMR chemical shifl values
are shown in Table 4.1. Original spectra of compound 1 are presented in the Appendix. They
are: lI-INMR, Appendix I; ‘3 CNMR, Appendix II; DEPT (Distortionless enhancement by
polarization transfer), Appendix III; DQFCOSY (double quantum filtered correlated
spectroscopy), Appendix IV; HMQC (I-Ieteronuclear multiple quantum correlated), Appendix

V; EI mass spectrum, Appendix VI; UV, Appendix VII; CD, Appendix VIII.

Methylation of compound 1: The diazomethane, CHzNz, used for the methylation reaction
of compound 1 was prepared as follows: KOH (25 g) was dissolved in 75 ml of distilled
water and the solution was kept in an ice bath. Diethyl ether (75 ml) was poured into this
solution, and the mixture was maintained on the ice bath for another 15 min. N-nitroso-N-

methylurea (1.125 g) was added slowly to the above mixture and stirred until it was reacted

 

59

   

Compound 1

6O

completely. The yellow ether layer then was separated and washed with 100 ml of cold water
to remove any trace quantity of KOH. The CHZN2 solution in ether was kept over KOH
pellets until used.

Compound 1 (6.4 mg) was dissolved in ether (4 ml) and reacted with 6 ml of CHZN2
in ether. The reaction was maintained at room temperature for 45 min and evaporated to
dryness. The methylated product, compound 2 (6.32 mg), gave 1H NMR signals (Appendix.
IX): 5 3.65 (III, s, -COOCH3), 2.76 (1H, m, H-2), 3.70 (1H, m, H-3), 1.24 (1H, m, H-4),
1.70 (1H, m, H-4), 1.41 (1H, m, H-S), 1.63 (1H, m, H-4), 1.95 (1H, m, H-6), 4.10 (1H, m,
H-7), 5.82(1H, d, J=11.5 Hz H-9), 5.78 (1H, d, J=15 Hz, H-10), 5.40 (1H, dd, J=15.0, 9.0
Hz, H-1 1), 3.32 (ll-I, m, H-12), 5.49 (1H, d, J=9.5 Hz, H-l3), 5.95(11-I, d, J=10 Hz, H—14),
1.58 (1H, m, H—15), 1.48 (1H, m, H-16), 1.28 (1H, m, H-17), 1.84 (1H, m, H-17), 1.01 (1H,
m, H-18), 1.15 (1H, m, H-18), 1.93 (1H, m, H—19), 3.38 (1H, dd, J=6.5, 11 Hz, H-20), 6.86
(1H, m, H-23), 6.25 (1H, m, H-24), 7.00 (II-I, m, H-25), 1.23 (1H, m, H-26), 1.64 (1H, m,
H-26), 0.91 (3H, t, J=7.5 Hz, H-27), 1.73 (1H, m, H-28), 1.98 (ll-I, m, H—28), 0.76 (3H, t,
J=7.5 Hz, H—29), 0.81 (3H, d, J=6.5 Hz, H-30), 1.08 (3H, d, J=7.0 Hz, H—31), 9.58 (II-I, 3,
-NH). EIMS of this methylated product (Appendix. X) gave the molecular ion at m/z 507
with 20% relative abundance. The major fragments observed in the MS spectrum of
compound 2 were at m/z (relative abundance): 55 (33), 69 (18), 94 (100), 109 (22), 135
(20), 159 (17), 226 (20), 252 (12), 265 (100), 281 (10), 306 (4), 334(5), 359(5), 413 (9)

and 47s (10).

Acetylation of compound 2: Compound 2 (6.32 mg) was dissolved in pyridine (3 ml) and

mixed with acetic anhydride (3 ml). The reaction mixture was kept in the dark at room

 

61

 

 

Whole Broth

 

 

 

Centrifuged at 4°C and 10‘ rpm

 

 

 

 

Mycelia

 

 

 

Homogenized with
MeOI-I/CHCl,

1

 

 

Cell-free broth

 

 

No biological activity, discarded

 

 

 

 

 

 

MeOI-I/CHCl3 extract

 

 

Spentcefl

 

 

 

 

Discarded

Stirred with ACN

 

 

 

 

ACN extraction

 

 

 

HPLC GS 3-10 column
MeOI-LH,O (85:15)

 

 

Residue

 

 

 

Discarded

 

 

Fraction 1 24-40 min

 

 

ot active

 

 

Fraction 2

40-55 min

 

 

 

Active

 

 

 

 

 

 

 

Fraction 3

 

55-61 min

 

 

Not active

 

 

Silica gel plate chromatography
CHC1,:C‘H‘:MeOH (25:1513)

The band at 0.75 Rf

HPLC 003 column
MeOH:H,O (95:5)

 

 

25-35min

47-53 min

 

 

 

 

Fractions I

 

 

 

II

 

 

65-75 min

 

75.82 min

 

 

 

 

111 Active fraction

 

 

 

 

82-90 min

 

 

V

 

 

 

 

 

Compound 1

 

 

Scheme 4.1. Isolation and purification of insecticidal compound 1

62

temperature for 12 h and evaporated to dryness. The crude mixture was purified by TLC
using the mobile phase CHCl,:benzene:MeOH (2521513) on silica gel plates and yielded 6.2
mg of the product. The ‘H NMR of the resulting product gave the signals as follows: 6 3.65
(1H, s, -COOCH3), 2.76 (1H, m, H-2), 3.70 (1H, m, H-3), 1.24 (1H, m, H-4), 1.70 (1H, n1,
H-4), 1.41(1H, m, H-5), 1.63 (1H, m, H-4), 1.95 (1H, m, H-6), 4.10 (1H, m, H-7), 5.82 (II-I,
d, J=11.5 Hz H-9), 5.78 (II-I, d, J=15 Hz, H-lO), 5.40 (1H, dd, J=15.0, 9.0 Hz, H-1 1), 3.32
(II-I, m, H—12), 5.49 (1H, d, J=9.5 Hz, H-13), 5.95 (1H, d, J=10 Hz, H-l4), 1.58 (1H, m, H-
15),1.48(1H, m, H-16),1.28(1H, m, H-17), 1.84 (1H, n1, H-17), 1.01(1H, m, H-18), 1.15
(II-I, m, H—18), 1.93 (1H, m, H-l9), 3.38 (II-I, dd, J=6.5, 11 Hz, H—20), 6.86 (II-I, m, H-23),
6.25 (1H, m, H-24), 7.00 (1H, m, H-25), 1.23 (1H, m, H-26), 1.64 (1H, m, H-26), 0.91 (3H,
t, J=7.5 Hz, H-27), 1.73 (1H, m, H-28), 1.98 (II-I, m, H-28), 0.76 (3H, t, J=7.5 Hz, H-29),
0.81 (3H, d, J=6.5 Hz, H—30), 1.08 (3H, d, J=7.0 Hz, H-31), 9.58 (III, s, -NI-I). Thess results
showed that the acetylation of compound 2 did not occur and indicated that hydroxy groups

were absent in compound 1.

Circular Dichroism (CD) of compound 1: Pure compound 1 was dissolved in MeOH (1
mg'ml") and the CD was determined under the following conditions: scan mode: wavelength;
scan range: 200-500 nm, sensitivity 500 mdeg, response 64 msec, scan speed 500 um'min",
band width 1 nm, accumulation 0.2 nm-data". Compound 1 exhibited an absorbance at 328.7

nm, and the CD value was A6 = - 58.883 mdeg (Appendix. VIII).

Antimicrobial activities of compound 1: Cultures of GIeosporum 51). on PDA medium,

Candida albicans on YMG medium, cultures of Staphylococcus epidermides, Streptococcus

63

 

Figure. 4.1 Compound 1 R=H
Compound 2 R = CH3

 

 

 

 

 

- E .V S... :2 2.. e E: on. o.
n: o... e E c a... .... «.3 E E: 8.. m.
3. n... .v o. e 2... cm 2.: o... .c E: a.“ 2
..N. n... . E c 93 a as. 2 .2 6 E: 2% n.
B: s E a z... .2... ”N 2... E E: can N.
2. 2. . E c K... 2 .22 as 5.... a. E: a.“ ..
«.8 E E a n... .3. ON o8. 3. .U E: 8.“ c.
3.2 2 .U E: as n 0.2. n... .. E: S.“ o
4.8. 3 . E: 2e 5 2... - - - m
on: 3 n a... was 8 3.. a E: a. ... ..
3n. - - - a «.2 E E: a. e
we: - - - .N on e E c F. .2... m
...n o... .3 2. E: 2... 2 ...N 5 Ed 2... ..o.~ ..
2:. E E: o... a. .S E E: S... n
3“ s E a 8... .2 .. m. 2: 3.2.. s E: 23 N
.Q a E c e... .3. t 3: - E: 24m :08 .
See U: N: a... E...— Z. 62 sees can 0: N: a... .55 I. 62 .6930
._ 2.2388 .8 $33 .8555 5.420: E... -I. ._.v 033.

65

aureus and Escherichia coli on Emmons medium were grown prior to the assays. The test
organisms were harvested by suspending them in 10 ml of sterile saline solution. Cell
suspension was adjusted to 103 colony forming units per milliliter (CFU/ml). Bioassay plates
were made by spreading cell suspension (100 pl) on the surface of the respective medium.
Compound 1 (1, 25, 50 and 100 ppm in DMSO) was spotted on plates lawned with the test
organism and were incubated at 28°C for 72 h. The zone of inhibition, characterized by the
absence of the microorganism’s growth, was measured. Compound 1 was active against S
aureus and S epidermidis at 1 ppm concentration as indicated by 3.3- and 2.9-cm zones of
inhibition, respectively. There was no activity against fungi, yeast or other test bacteria when

tested at 100 ppm.

Mosquitocidal activity of compound 1: The mosquitocidal assay was conducted on the
fourth instar mosquito larvae, Aedes aegypti, reared fi'om eggs (Courtesy of Dr. Alexander
Raikhel, Department of Entomology, MSU) (Nair et al., 1989). Fifteen larvae (3-4 days old)
were placed in 980p] of distilled water in a test tube. Serial dilutions of compound 1 (l, 10,
20, 30, 40, 50 anle pg-20pl" in DMSO) were added to these test tubes containing
mosquito larvae. Controls received 20 pl of pure DMSO. The test tubes were covered and
maintained at room temperature. The number of dead larvae was recorded at 24 h. Each
treatment was repeated in triplicates. Compound 1 was mosquitocidal at 20 ppm and resulted

in 100% mortality.

Insecticidal assays: Gypsy moth eggs were obtained fi'om The Forest Pest Management

Institute, Sault Ste. Marie, Ontario, Canada. Corn earworrn and tobacco hornworrn eggs

66

were purchased from the insect rearing facility in the Department of Entomology, North
Carolina State University, Raleigh, North Carolina. Compound 1 was dissolved in 25 pl of
DMSO and mixed with diet mixtures. The diet was dispensed into 3.5 ml polystyrene vials
(Sarstedt) and one larvae was placed in each vial. Gypsy moth larvae were used at two to
three days of age, corn earwonn and tobacco homwonn larvae were neonates. Each
treatment had fifteen replicates. The larvae were weighed at six days. Dunnet’s Test was
used to determine the significance of weight reduction in these assays. The results (Fig. 4.4)
indicate that compound 1 showed significant weight reduction at 100 ppm for tobacco
hornworrn and gypsy moth, but had only slight activity against comear worm at this

concentration.

Results and Discussion:

On YMG solid medium, S gn'seofirscus grew as grey colonies. It produced antibiotic
in both YMG and A9 media. The grth of the organism was rapid and yielded about 66 g
of wet cells per liter after 8 days of fermentation.

The wet cells were extracted with CHC132MeOH solvent mixture which extracted the
active metabolite eficiently. The dried crude extract was fractionated with CHCl, and ACN
to remove most of the insoluble material. A preliminary mosquitocidal assay and TLC proved
that all of the active compound present in the extract was in the ACN-soluble portion. The
ACN extract was purified further on a G8 3-10 polyvinyl alcohol column by preperative
HPLC. The polyvinyl alcohol adsorbent separates the compounds by their molecular size and
adsorption to the column matrix. Compounds with high molecular weight will not flow

through the packing material pores and will have lower retention times. In order to obtain

 

67

pure compound 1, the active fi'action from GS 3-10 HPLC purification was chromatographed
on silica gel TLC, followed by preperative HPLC.

The lHNMR spectrum of compound 1 showed four methyl groups, two triplets at
0.77 and 0.90 ppm and two doublets at 0.70 and 0.94 ppm, respectively. This indicated that
compound 1 contained two CH3CH2- and two CH3CH- functionalities. The peaks at 2.92,
3.36, 3.43, 3.82 and 4.19 ppm were assigned to methine protons that are influenced by
electrons withdrawing O or N fiinctionalities. The peaks at a 5.33, 5.46, 5.69, 5.90, 5.92
and 6.16 were indicative of vinylic protons. The assignment of H-10 and H-ll protons as
trans to each other was derived fi'om the 15 Hz coupling constant. Similarly, H-13 and H-14
protons were assigned as cis. Also, the signals at 6 6.16, 6.98 and 6.99 were indicative of
vinylic protons. The broad peak, exchanged with DZO at 11.63 ppm suggested that
compound 1 contained a carboxylic acid or an amino moiety in the molecule.

The peaks in the l3CNMR spectrum at 75.1 and 72.6 ppm were typical of oxygenated
carbons. Also, 10 carbons appearing between 100 and 170 ppm were assigned to 8 vinylic
and 2 quaternary carbons. The signals at 175.9 and 189.6 ppm were representative of a
carboxylic and an a, B-unsaturated carbonyl, respectively. The DEPT spectrum of compound
1 confirmed a total of 31 carbons.

The HMQC spectrum of compound 1 provided the proton-carbon correlations and
was very helpful in elucidating the structure of compound 1. The COSY of compound 1
showed the connectivities of Hn-H” , H31-H2-H3, Hm-Hs-H7, H, - H10 - Hu - Hn-I-I13-Hu,
Hfl-Hx-Hw, Hu-HWHn-Hu-HWH a, and Hfl-Hfl-Hz, (Fig. 4.2). However, the correlation
for Hu-H”, IrI.-H,-I-I6 and Hm-H20 was not detected in the spectrum.

The presence of carboxylic acid and amino groups in compound 1 were also

 

68

   

Compound 1

Figure 4.2 The proton correlations in compound 1 fiom DQFCOSY spectrum

69

confirmed by methylation and acetylation reactions. The ‘HNMR of the methylated product,
compound 2, showed a sharp singlet at 3.65 ppm and integrated for three protons. Also,
there was a broad peak at 9.58 ppm which exchanged with D20. This suggested that an
amino group was present in compound 1 in addition to a -COOH group. lHNMR of the
acetylated product from compound 2 did not show any change and confirmed the presence
of a secondary NH group in the molecule. Also, it confirmed that both C-3 and C-7,
appeared at 75.1 and 72.6ppm, respectively, had alkyl substituents.

MS data of compound 1 and its methyl ester supported the proposed structure for
compound 1. The MS of compound 1 and 2 gave molecular ions at m/z 493 and 507,
respectively. The m/z peak at 94 was present in both compounds 1 and 2 and it indicated as
fragment I (Fig. 4.3). The peak at m/z 251 in compound 1 and the peak at m/z 265 in
compound 2 were due to fi'agment 11 (Fig. 4.3). The molecular formula of compound 1
suggested the presence of 11 double-bond equivalents (DBE). The MS fiagments at m/z 94
and 251 accounted for 8 DBE and fragment III for 3 DBE (Fig. 4.3). The UV spectrum of
compound 1 gave A" at 244 and 289 nm, respectively and was in agreement with NMR and
MS assignments for compound 1.

The CD for an organic compound results from the difference in‘absorption of right
and lefi circularly polarized light (Crabbe, 1972). CD techniques can be applied to any
optically active compound with a chromophore (light absorbing group) including inherently
dissymmetn'c chromophores such as nonplanar aromatic substances, coupled oscillators
formed by two nonconjugated chromophores such as homoconjugated dienes, and perturbed
symmetrical chromophores, like double bonds and carbonyl groups. The CD of compound

1 exhibited a strong negative absorption at 328.7 nm (Appendix VIII). The absorbance

 

70

 

Compound 1 R = H
Compound 2 R = CH3

   

m/z 94 (100) R=H m/z 251(65) “”2 ‘48
R=CH, m/z 265 (100)

Figuer 4. 3. Major fragments observed in the MS spectra of compound 1 and 2.

 

71
A6 = AL - AR, where AL is left-polarized light and AR is right-polarized light. The negative
result indicated that compound 1 absorbs more of the right-polarized light. Based on all the
spectral data and chemical methods, the structure of compound 1 is proposed in Figure 4.1.

Compound 1 is identical to an antibacterial antibiotic, indanomycin, reported earlier
(Beloeil et al., 1984; Liu et al. 1979; Westley et al. 1979).

Compound 1 resulted in 100% mortality of mosquito larvae at 20 ppm in 24 h and was
active against gram-positve bacteria Streptococcus aureus and Staphylococcus epidemidis.
Also, it showed 50% weight reduction for gypsy moth, tobacco hornworrn and 33% for corn
earworrn (Fig. 4.4) at 100 ppm after six days of feeding. The mosquitocidal activity of
compound 1 is probably not comparable to commercial insecticides. Therefore, the potential
for compound 1 as a commercial product is slim, mainly because of its low eflicacy.
However, this compound might serve as a template for the synthesis of mosquitocidal and
insecticidal compounds. This is the first report of the insecticidal activity for compounds of

this nature.

 

72

|
. \\\\\\\\\\\\§§

 

_C t 1
V////2 Compound 1

 

as,

 

 

 

 

807

70
6O “’
50 —

(5w) jqfigaM

 

Figure 4.4 Growth inhibitory assays of compound 1 against insects

 

Chapter V

Summary and Conclusions

Cultures of more than 68 strains of Streptomyces mp. isolated from soil samples
collected fi'om various location in China by Dr Zhang were grown initially in an nitrogen-flee
inorganic media. Only 48 strains were able to grow on YMG medium and were studied
futher. To establish the genetic diversity of these cultures, rep-PCR was used as a facile
means to fingerprint the genome of each strain. After the cultures were grown in YMG
medium for fourteen days, the DNA of each strain was extracted fiom the cells by
thermocycling, and the BOXAlR primer was used to amplify the DNA template in crude
extracts using polymerase chain reaction. The products were separated electrophoretically
on agarose gel. The banding pattern provided an extremely high resolution fingerprint.
Genomic fingerprinting of this culture collection indicated that these strains are genetically
diverse, and only two of the strains seemed to be closely related.

Preliminary antibacterial, antifirngal, mosquitocidal and anti-cancer bioassays were
performed on cell and cell-free broth extracts from 48 strains of Streptomyces spp. at 250
ppm. All cultures were grown in A9 and YMG media, separately. Anti-cancer bioassays
were evaluated by using mutant S cerevisae strains, seven strains showed zones of inhibition.
The crude extracts of five strains were active against mosquito larvae, Aedes aegmti. Most

of the extracts fiom both cell and cell-free broth exhibited activity against the gram-positive

73

 

74

bacteria Streptococcus aureus and Staphylococcus epiderimidis. About half of the strains
tested showed growth-inhibitory activity against the plant pathogen, GIeomorum mp. Also,
some strains produced compounds that were inhibitory to the growth of Escherichia coli and
Candida albicans. However, none of the crude extracts of this culture collection showed any
activities when tested on BotIytis mp., Amerillus mp., F usarium oxymorum, F. monilrfomre
and Rhizoctonia mp.

Bioassay-directed fractionation of the crude extract afforded a mosquitocidal
compound 1 fi'om S. griseoflrscus, strain MSU/ZD/033. Structure of compound 1 was
determined by lI-INMR, 13CNMIL COSY, HMQC spectra and firrther confirmed by MS,
methylation and acetylation reactions. Insecticidal and antibacterial activities were evaluated
for compound 1. Compound 1 resulted in 100% mortality of mosquito larvae at 20 ppm in
24 h. It also reduced 50% of the weight of gypsy moth and tobacco hornworm, 33% of the
weight of corn earworn at 100 ppm. In addition, compound 1 was active against gram-
positive bacteria Streptococcus aureus and Staphylococcus epidermidis,as shown by 3 .3- and
2.9-cm zones of inhibitions, respectively. There was no activity against fimgi, yeast and other
test bacteria when tested at 100 ppm.

The experiments reported in this thesis yielded a known compound with new
biological activities. Compound 1 was reported previously with antibacterial activities. This

is the first report of its insecticidal activities.

 

BIBLIOGRAPHY

BIBLIOGRAPHY

Aizawa, 8., Nakamura Y., Shirato, S., Taguchi, R., Y
amaguchi, 1., Misato, T. (1969) Aabomycin A, a new antibiotic. 1. Production, isolation
and properties of aabomycin A. J. Antibiot. 22 (10), 457-462.

Akasaki, K, Abe, H., Seino, A., Shirato, S. (1968) Yazumycin, a new antibiotic produced
by Streptomyces lavendulae. J. Antibiot. 21 (2), 98-105.

Arai, T., Kuroda, S., Ohara, H., Katoh, Y., Kaji, H. (1965) Copiamycin, a new antifirngal
antibiotic derived fi'om S. hygroscopicus var. chrystallogenes. J. Antibiot. 18 (2), 63 -67.

Arai, T., Loyama, Y., Suenaga, T., Honda, H. (1962) Aseomycin, an antifiingal antibiotic.
J. Antibiot. 15, 231-232.

Arai, T., Takahashi, K., Kubo, A. (1977) New antibiotics, saframycins A, B, C, D and E.
J. Antibiot. 30 (11), 1015-1018.

Arai, T., Takahashi, K., nakahara, S, Kubo, A. (1980) The structure of a novel antitumor
antibiotic, afiamycin A. Experimentia. 36, 1025-1027.

Arai, T., Uno, J., Horimi, I., Fukushima, K. (1984) Isolation of neocopiamycin from
Streptomyces hygroscopicus var. Crystallogenes, the copiamycin source. J. Antibiot. 37 (2),
103-109.

Arai, T., Yazawa, K., Mikami, Y., Kubo, A., Takahashi, K. (1976) Isolation and
characterization of satellite antibiotics, mimosamycin and chlorocarcins from Steptamyces
lavendulae, Streptothricin source. J. Antibiot. 29(4), 398-407.

Bell, RA, Joachim, PG. (1976) Technique for rearing laboratory colonies of tabacco hom-
worms and pink bollworms. Ann. Entomol. Soc. Amer. 69, 365-373.

Bell, RA, Owens, C.D., Shapiro, M., Tardif, JR. (1981) Development of mass-rearing
technology. The gypsy moth: research toward integrated pest management and development
program. Forest Service and Education Agency, Animal and Plant Health Inmection
Bulletin, 1584. USDA, Washington DC. 599-655.

75

 

76

Beloeil, J.C., Delsuc, M.A, Lallemand, J.Y., Dauphin, G., Jeminet, G. (1984) Application
of the homonuclear and heteronuclear two-dimensional chemical-shift correlation NMR

spectroscopy to the complete assignment of 1H and ‘3 C NMR spectra of ionophorous
antibiotic X.14547 A. J. Org. Chem. 49, 1797-1800.

Boeck, L. D., Fukuda, D. 8., Abbott, B. J., Debono, M. (1988) Deacylation of A21978C,
an acidic lipopeptide antibiotic complex, by Actinaplanes Utahensis. J. Antibiot. 41 (8),
1085-1092.

Box, S.J., Cole, M., Yeoman, GB. (1973) Prasinons A and B: potent insecticides from
Streptomyces prasinus. Appl. microbial. 26, 699-704.

Brenner, DJ. (1973) Deoxyribonucleic acid reassociation in the taxonomy of enteric
bacteria. Int. Syst. Bacteriol. 23, 298-301.

Burton, RL. (1970) A low-cost artificial diet for the corn earworm. J. Econ. Entomol. 63
(6), 1969-1970.

Crabbe, P. (1972) ORD and CD in chemistry and biochemistry. Chapter 1, 7-8.

Cooper, R, Unger, S. (1985) Structure of the quinone antibiotic EM-5519 and the behavior
of quinones in Fast Atom Bombardment Mass Spectrometry. J. Antibiot. 38 (1), 24-30.

De Bruijn, F.J. (1992) Use of repetitive (repetitive extragenic palindromic and
enterobacterial repetitive intergeneric consensus) sequences and the polymerase chain reaction
to fingerprint the genomes of Rhizobium meliloti isolates and other soil bacteria. Appl.
environ. Microbiol. 58, 2180-2187.

Debono, M, Bamhart, M., Carrell, C. B., Hoffrnann, J. A., Occolowitz, J. L., Abbott, B. J.,
Fukuda, D. S, Hamill, R. L., Biemann, K., Herlihy, W. C. (1987) A21978C, a complex of
new acidic peptide antibiotics: isolation, chemistry, and mass spectral structure elucidation.
J. Antibiot. 40(6), 761-777.

Dirlam, J. P., Presseau-Linabury, L., Koss, D. A (1990) The structure of CP-80,219, a new
polyether antibiotic related to dianemycin. J. Antibiot. 43 (6), 727-730.

Embley, T.M., Stackenbrandt, E. (1994) The molecular phylogeny and systematics of the
actinomyces. Annu. Rev. Microbial. 48, 257-289.

Fabre, B., Arrnau, E., Etienne, G., Legendre, F., Tiraby, G. (1988) A simple screening
method for insecticidal substances from actinomycetes. J. Antibiot. 41, 212-219.

Fiedler, H. P., Warner, W., Zahaner, H. Kaiser, H. P., Keller-Schierlein, W., Muller, A.
(1981) Metabolic products of microorganisms. 200. Isolation and characterization of
niphithricins A, B, and elaiophylin, antibiotics produced. J. Antibiot. 34 (9), 1107-1118.

77

Fox, G.E., Stackebrandt, E. (1987) The application of 16S rRNA cataloguing and 5S rRNA
sequencing in bacterial systematics. Methods in Microbiology. 19, 405-458.

Fukumi, H., Maruyama, F., Yoshida, K., Arai, M. (1978) Production, isolation and
characterization of mimosamycin. J. Antibiot. 31 (9), 847-849.

Gadkari, D., Morsdorf, G., Meyer, 0. (1992) Chemolithoautotrophic assimilation of
dinitrogen by Streptomyces thennoautotraphicus UBTl: identification of an unusual Nz-fixing
system. J. Bacter. 174 (21), 6840-6843.

Gottlieb, D. (1976) The production and role of antibiotics in soil. J. Antibiot. 29 (10), 987-
1000.

Grabley, S., Harnmann, P., Raether, W., ka, J. (1990) Secondary metabolites by chemical
screening. 11. Amucins A and B, two novel miphimycin analogs isolated from a high
producer strain of elaiophylin and nigericin. J. Antibiot. 43 (6), 639-647.

Grote, R., Chen, Y,, Zeeck, A., Chen, 2., Zahner, H. (1988) Metabolic products of
microorganisms. 243. Pyridazomycin, a new antifungal antibiotic produced by Streptomyces
vialaceoniger. J. Antibiot. 41 (5), 595-601.

Hatanaka, H., Iwwami, M., Kino, T., Goto, T., Okuhara, M. (1988) FR-900520 and FR-
900523, novel immunosuppressants isolated from a Streptomyces. I. Taxonomy of the
producing strain. J. Antibiot. 41 (11), 1586-1591.

Hatanaka, H., Kino, T., Myata, S., Inamura, N., Kurida, A., Goto, T., Tanaka, H., Okuhara,
M. (1988) FR-900520 and FR-900523, novel immunosuppressants isolated from a
Streptomyces II. Fermentation, isolation and physico-chemical and biological characteristics.
J. Antibiot. 41 (11), 1592-1601.

Haxell, M., Bishop, B. F ., Bryce, P., Gration, K. A. F., Kara, H., Monday, R. A., Pacey, M.
S., Perry, D. A., Huang, L. H. (1992) C-13B-acyloxymilbemycins, a new family of
macrolides. Discovery, structural determination and biological properties. J. Antibiot. 45
(5), 659-670.

Heisey, R. M. , Putnam, A. R. (1986) Herbicidal effects of geldanamycin and nigericin,
antibiotics fi'om Streptomyces hygroscopicus. J. Nat. Prod. 49(5), 859-865.

Hu, J., Xue, Y. C., Xie, M. Y., Zhang, R., Otani, T., Minami, Y., Yamada Y., Marunaka, T.
(1988) A new macromolecular antitumor antibiotic, C-1027 1. Discovery, taxonomy of
producing organism, fermentation and biological activity. J. Antibiot. 41 (11), 1575-1579.

Hulton, C.S., Higgins, C.F., Sharp, PM. (1991) ERIC sequences: a novel family of
repetitive elements in the genomes of Escherichia coli, Salmonella whimurium and other
enterobacteria. MaIMicrobiol. 5, 825-834.

 

78

Ikeda, Y., Matsuki, H., Ogawa,T., Munakata, T. (1983) Safi'acins, new antitumor antibiotics
II. Physicochernical properties and chemical structures. J. Antibiot. 36 (10), 1284-1289.

Imada, A., Nozaki, Y., Hasegawa, T., Mizuta, E., Igarasi, S., Yoneda, M. (1978)
Carriomycin, a new polyether antibiotic produced by Streptomyces hygroscopicus. J.
Antibiot. 31 (1), 7-14.

Inarnori, Y., Amino, H, Tsuboi, M., Yamaguchi, S., Tsujibo, H. (1990) Biological activities
of racemomycin-B, B-Lysine rich streptothricin antibiotic, the main component of
Streptomyces lavendulae OP-2. Chem. Pharm. Bull. 39 (8), 2296-2298.

Ishizeki, S., Ohtsuka, M., Irinoda, K., Kukita, K, Nagaoka K., nakashima, T. (1987)
Azinomycins A and B, new antitumor antibiotics. III. Antitumor activity. J. Antibiot. 40
(1), 60-65.

Iwasa, T., Yamamoto, H., Shibata, M. (1970) Studies on validamycins, new antibiotics. I.
Streptomyces hygroscopicus var. limoneus nov. var., validamycin-producing organism. J.
Antibiot. 23 (12), 595-602.

Jizba, J., Sedmera, P., Zima, J., Beran, M., Blumauerova, M., Kandybin, N.V., Samoukina,
G.V. (1991) Macrotetrolide antibiotics produced by Streptomyces globimorus. Folia.
Microbiol. 36(5), 437-443.

Joyner, K., Gould, F. (1985) Developmental consequences of cannibalism in Helicoverpa
zea (Lepidoptera: Noctuidae). Ann. Entomol. Soc. Amer. 78, 24-28.

Kamori, Y., Ezaki, M., Kino, E., Kohsaka, M., Aoki, H., Imanaka,H. (1985) Lavendomycin,
a new antibiotic. I. Taxonomy, isolation and characterization. J. Antibiot. 38 (6), 691-698.

Kawakami, Y., Matsuwaka, S., Otano, Y., Kondo, H., Nakamura, S. (1978) Ileumycin, a
new antibiotic against Glomerella cingulata. J. Antibiot. 31 (2), 112-116.

Keller-Juslen, C., King, H. D., Kis, Z. L., Wartburg, A. V. (1975) Septamycin, a polyether
antibiotic, taxonomy, fermentation, isolation and characterization. J. Antibiot. 28 (11), 854-
859.

King, R D. Langharig, J ., Sanglier, J. J. (1986) Clavamycins, new clavam antibiotics fi'om
two variants of Streptomyces hygroscopicus. I. Taxonomy of the producing organisms,
fermentation, and biological activities. J. Antibiot. 39(4), 510-515.

Kubo, A., Kitahara, Y., Nakahara, S., Iwata, R, Numata, R. (1988) Synthesis of mimocin,
an isoquinolinequinone antibiotic from Streptomyces lavendulae, and its congeners. Chem.
Pharm. Bull. 36 (11). 14355-14363.

Kubo, A., Saito, N., Kitahara, Y., Takahashi, K., Yazawa, K., Arai, Tadashi. (1987)

79

Structure of saframycin D, a new dimeric isoquinolinequinone antibiotic. Chem. Pharm. Bull.
35 (1), 440-442.

Kubota T., Hinoh, H, Mayama, M., Motokawa, K, Yasuda, Y. (1975) Antibiotic A-130,
isolation and characterization. J. Antibiot. 28 (12), 931-943.

Kurylowicz, W., Paszkiewicz, A., Woznicka, W., Kurzatkowski, W. (1975) Numerical
taxonomy of Streptomycetes. Chapter I, 10-11.

Labeda, D. P. (1992) DNA-DNA hybridization in the systematics of Streptomyces. Gene.
115, 249-253.

Labeda, D. P. (1993) DNA relatedness among strains of the Streptomyces lavendulae
phenotypic cluster group. Int. Syst. Bacterial. 43, 822-825.

Labeda, D. P., Lyons, A J. (1991) Deoxyribomycleic acid relatedness among species of the
Streptomyces cyaneus cluster. Syst. Appl. Microbiol. 14, 158-164.

Lam, K. S., Hesler. G.A., Mattei, J. M., Mamger, S. W., Forenza, S., Tornita, K. (1990)
Himastatin, a new antitumor antibiotic from Streptomyces hygroscopicus. I. Taxonomy of
producing organism, fermentation and biological activity. J. Antibiot. 43 (8), 956- 960.

Leet, J. E., Schroeder, D. R., Krishnan, B., Matson, IA. (1990) Himastatin, a new
antitumor antibiotic from Streptomyces hygroscopicus. II. Isolation and characterization.
J. Antibiot. 43 (8).

Ley, S.V., Denholm, A.A., Wood, A. (1993) The chemistry of azadirachtin. Natural
Product reports. 10(2), 109-157.

Ley, S.V., Toogood, PL. (1990) Insect antifeedants. Chem. Bri. 26, 31-35.

Lin, L. 2., Blasko, G., cordell, G. A. (1988) lH-NMR analysis of herbimycins and dihydro-
herbimycins. J. Nat. Prod. 51 (6), 1161-1165.

Liu, C.M., Hermann, T.E., Liu, M., Bull, D.N., Palleroni, N.J., Prosser, B.L., Westley, J .W.,
Miller, RA. (1979) X-14547 A, a new ionophorous antibiotic produced by Streptomyces
antibioticus NRRL 8167. Discovery, fermentation, biological properties and taxonomy of
the producing culture. J. Antibiot. 32 (2), 95-99.

Liu, M., Evans, R.Jr., Fern, L., Hermann, T., Jenkins, E., Liu, M., Palleroni, N. J ., Prosser,
B. L., Sello, L. H., Stempel, A., Tabenkin, B., Westley, J. W., Miller, P. A. (1976) Studies
on a new polyether antibiotic, Ro 21-6150. J. Antibiot. 29 (1), 21-28.

Loria, R, Bukhalid, R.A., Creath, R.A., Leiner, R.H., Olivier, M., Stefens, J.C. (1995)
Differential production of thaxtornins by pathogenic Streptomyces species in vitro. 85 (5).

80

537-541.

Mamber, S. W., Brookshire, K. W., Dean, B. J., Firestone, R. A., Leet. J. E., Matson, J .A.,
Forenza, S. (1994) Inhibition of antibacterial activity of himastatin, a new antitumor

antibiotic fiom Streptomyces hygroscopicus by fatty acid sodium salts. Antimicrob. Agents.
Chemother. 38 (l 1), 2633-2642.

Maplestone, B.A, Stone, M.J., Williams, DH. (1992) The evolutionary role of secondary
metabolites - a review. Gene. 115, 151-157.

Martin, B., Humbert, O., Camara, M., Guenzi, E., Walker, J., Mitchell, T., Andrew, P.,
Prudhomme, M., Alloing G., Hakenbeclg R, Morrison, D.A., Boulnois, G.J., Claverys, J-P.
(1992) A highly conserved repeated DNA element located in the chromosome of
Streptococcus, pneumoniae. Nucleic Acids Res. 20, 3479-3483.

Mikami, Y., Yokoyama, K., Omi, A,, Arai, T. (1976) Identification of producer and
biological activities of new antibiotics, mimosamycin and chlorscarcins. J. Antibiot. 29 (4),
408-414.

Mishima, H., Ide, J., Muramatsu, S., Ono, M. (1983) Milbemycins, a new family of
macrolide antibiotics structure determination of milbemycins D, E, F, G, H, J and K. J.
'Antibiot. 36(8), 980-990.

Mizutani, T., Yamagishi, M., Hara, H,, Kawashima, A., Omura, S., Ozeki, M. (1980)
Studies on the ionophorous antibiotics. XXIV, leuseramycin, a new polyether antibiotic
produced by Streptomyces hygroscopicus. J. Antibiot. 33 (2), 137-143.

Monaghan, RL., Tkacz J .S. ( 1990) Bioactive microbial products: Focus upon mechanism
of action. Microbia. 44, 271-301.

Morisaki, M, Arai, T. (1992) Identity of immunosuppressant FR-900520 with ascomycin.
J. Antibiot. 45(1), 126-128.

Munakata, K (1975) Insect antifeeding substances in plant leaves. Pure Appl. Chem. 42,
57-66.

Murry, MA, Zhang, D., Schneider, M., De Bruijn, RI. (1995) Use of repetitive sequences
and the polymerase chain reaction (rep-PCR) to fingerprint the genomes of Frankia isolates.
Symbiosis. 19, 223-240.

Naegeli, H U., Loosli, II R, Nussbaumer, A. (1986) Clavamycins, new clavam antibiotics
fiom two variants of Streptomyces hygroscopicus, II. Isolation and structures of Clavamycins
A, B and C from Streptomyces hygroscopicus NRRL 15846, and of Clavamycins D, E and F
from Streptomyces hygroscopicus NRRL 15879. J. Antibiot. 39 (4), 516-524.

 

81

Nagaoka, K., Matsumoto, M., Oono, J., Yokoi, K, Ishizeki, S., Nakashima, T. (1986)
Azinomycins A and B, new antitumor antibiotics I. Producing organism, fermentation,
isolation, and characterization. J. Antibiot. 39 (11), 1527-1532.

Nair, MG, Putam, A.R., Mishra, S.K., Mulks, W.H., Tafi, W.H., Keller, J.E., Miller, J.R,
Zhu, P-P., Meinhart, J.D., Lynn, DC. (1989) Faeriefungin: a newbroad-spectrum antibiotic
from Streptomyces griseus var. autotrophicus. J. Nat. Prod. 52 (4), 797-809.

Neuss, N., Kock, K. F., Molloy, B. B., Day, W., Huckstep, L. L., Dorrnan, D. E., Roberts,
J. D. (1970) 275. Structure of hygromycin B, an antibiotic from Stroptomyces
ln/grascopicus, the use of CMR spectra in structure determination,I. Helv. Chim. Acta. 53
(8), 2314-23 19.

Ninet, B., Benazet, F., Depaire, H., Florent, J ., Lunel, J., Mancy, D., Abraham, A., Cartier,
J.R, De Chezelles, N., Godard, C., Moreau, M., Tissier, R., Lallemand, J.Y. (1976)
Emericid, a new polyether antibiotic from Streptomyces hygroscopicus (DS 24 367).
Experientia. 15 (3), 319-321.

Ninet, I., Genazet, F. 1974. Flambamyin, a new antibiotic from Streptomyces hygroscopicus
DS 23 230. Emerientia. 30 (1 1), 1270-1272.

Nitiss, J ., Liu, Y-X, Hsiung, Y. (1993) A temperature sensitive topoisomerase Iiallele
confers temperature dependent drug resistance on arnsacrine and etpopside: a genetic system
for deterrning the targets of topoisomerase II inhibitors. Cancer Research. 53, 89-93.

Nitiss, J ., Wang, J .C. (1993) DNA topoisomerase—targeting antitumor drugs can be studied
in yeast. Proc. Natl. Acad Sci. USA. 85, 7501-7505.

Ogura, M., Nakayama, H., Furihata, K., Shimazu, A., Seto, H., Otake, N. (1985) Isolation
and structural determination of a new antibiotic curromycin B. Agric. Biol. Chem. 49 (6),
1909-1910.

Ogura, M., Nakayama, H., Furihata, K., Shimazu, A., Seto, H., Otake, N. ( 1985) Structure
of a new antibiotic curromycin a produced by a genetically modified strain of Streptomyces
hygroscopicus, a polyether antibiotic producing organism. J. Antibiot. 38 (5), 669-673.

Ohshima, M., Ishizaki, N., Abe, K., Ukawa, M., Marumoto, Y., Nakatsuka, K., Horiuchi, T.
Tonoola, Y., Yoshino, S., Kanda, N. (1976) Antibiotic DE-3936, a polyether antibiotic
identical with ionomycin, taxonomy, fermentation, isolation and characterization. J. Antibiot.
29(4), 354-365.

Omura, S., Iwai, Y., Takahashi, Y., sadakane, N., Nakagawa, A., Oiwa, H., Hasegawa, Y.,
Ikai, T. (1979) Herbimycin, a new antibiotic produced by a strain of Streptomyces. J.
Antibiot. 32(4), 255-261.

 

82

Ono, M., Mishima, H., Takiguchi, Y., Terao, M. (1983) Milbemycins, a new family of
macrolide antibiotics, fermentation, isolation, physico-chemical properties and bioconversion
of milbemycins J and K. J. Antibiot. 36 (5), 509-515.

Oscarson, J. R, Bordner, J., Celmer, W. D., Cullen, W. P., Huang, L. H., Maeda, H.,
Moshier, P. M, Nishiyama, 8., Presseau, L., Shibakawa, R, Tone, J. (1989) Endusamycin,
a novel polycyclic ether antibiotic produced by a strain of Streptomyces endus subsp. aureus.
J. Antibiot. 42(1), 37-48.

Otani, T., Minami, Y., Matsumoto, H., Marunaka, T. (1989) New glutarimide antibiotics,
S-632-B1 and B2. II. Isolation, physico-chemical properties and chemical structure. J.
Antibiot. 42(5), 654-661.

Otani, T., Minami, Y., Sakawa, K., Yoshida, K. (1991) Isolation and characterization of
non-protein chromophore and its degradation product fi'om antibiotic C-1027. J. Antibiot.
44(5), 564-568.

Otani, T., Sasaki, T., Mnami, Y., Manmaka, r. (1939) New glutarimide antibiotecs, S-632-
B1 and B2. 1. Taxonomy of producing strain, fermentation and biological properties. J.
Antibiot. 42(5), 647-653.

Otani, T., Yasuhara, T., Minami, Y., Shirnazy, T., Zhang, R, Xie, M. Y. (1991) Purification
and primary structure of C-1027-AG, a selective antagonist of antitumor antibiotic C-1027,
fi’om Streptomyces globimorus. Agric. Biol. Chem. 55(2), 407-417.

Ozasa, T., Sumki, K., Sasamata, M., Tanaka, K., Kobori, M., Kadota, S., Nagai, K., Saito,
T. (1989) Novel antitumor antibiotic phospholine. 1. Production, isolation and
characterization. .I. Antibiot. 42 (9), 1331-1338.

Ozasa, T., Tanaka, K., Sasamata, M., Kaniwa, H., Shimizu, M., Matsumoto, H., Iwanami,
M. (1989) Novel antitumor antibiotic phospholine. 2. Structure determination. J. Antibiot.
42(9), 1339-1343.

Pickett, J.A (1988) Chemical pest control - the new philosophy. Chem. Bri. 24, 137-140.
Priest, F. and Austin, B. (1993) Modern Bacterial Taxonomy. Chapter 3. 50-94.

Saild, R K., Scharf, S., Faloona, F. (1985) Enzymatic amplification of betaglobin genomic
sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1530-
1534.

Saitoh, K., Tsunakawa, M., Tomita, K., Miyaki, T., Konishi, M., Kawaguchi, H. (1988)

Boholmycin, a new aminoglycoside antibiotic. 1. Production, isolation and properties. J.
Antibiot. 41 (7), 855-861.

 

83

Sehgal, S. N., Baker, H., Eng, C. P. Shngh, K, Vezina, C. (1983) Demethoxyrapamycin
(AY-24,668), a new antifungal antibiotic. J. Antibiot. 36 (40), 35 1-3 54.

Sehgal, S. N., Baker, H., Vezina, C. (1975) Rapamycin (AY-22,989), a new antifungal
antibiotic, II. Fermentation, isolation and characterization. J. Antibiot. 28 910), 727-732.

Seino, A, Sugawara, H., Shirato, S., Misato, T. (1970). Aabomycin A, a new antibiotic.
III. Taxonomic studies on the aabomycin producing strain, Streptomyces hygroscopicus
subsp. aabomyceticus seino subsp. nov. J. Antibiot. 23 (4), 204-209.

Spooner, F. Personal communication. Department of Botany and Plant Pathology. Michigan
State University.

Stern, M.J., Arnes, G.G-L., Smith, N.H., Robinson, E.C., Higgins, CF. (1984) Repetitive
extragenic palindromic sequences: a major component of the bacterial genome. Cell. 37,
1015-1025.

Stone, M.J., Williams, DH. (1992) On the evolution of functional secondary metabolites.
Molecular Microbiology. 6(1), 29-34.

Sugawara, K, Hatori, M., Nishiyama, Y., Tomita, K, Kamei, H., Konkshi, M., Oki, T.
(1990) Eponemycin, a new antibiotic active against B16 melanoma. 1. Production, isolation,
structure and biological activity. J. Antibiot. 43 (1), 8-18.

Takesako, K, Beppu, T. (1984) Studies on new antifungal antibiotics, guanidylfungins A
and B. I. Taxonomy, fermentation, isolation and characterization. J. Antibot. 37(10), 1161-
1 169.

Takiguchi, Y., Mishima, H., Okuda, M., Terao, M., Aoki, A., Fukuda, R. (1980)
Milbemycins, a new family of macrolide antibiotics: fermentation, isolation and physico-
chemical properties. J. Antibiot. 33 (10), 1120-1127.

Takiguchi, Y., Ono, M., Muramatsu, S., Ide, J., Mishima, H., Terao, M. (1983)
Milbemycins, a new family of macrolide antibiotics, fermentation, isolation and physico-
chemical properties of milbemycins D, E, F, G and H. J. Antibiot. 36 (5), 502-508.

Takesako, K, Beppu, T. (1984) Studies on new antifirngal antibiotics, guanidylfungins A
and B. II. Stmcture elucidation and biosynthesis. J. Antibiot. 37 (10), 1170-1186.

Tower, K. J ., Cockayne, A. (1993) Molecular methods for microbial identification and
typing. Chapter 4. 93-105.

Tsuge, N., Mizokami, M, Imai, S., Shimazu, A, Seto, H. (1992) Adipostatins A and B, new
inhibitors of glycerol-3-phosphate dehydrogenase. J. Antibiot. 45 (6), 886-891.

 

84

Tsuji, N., Kobauashi, M., Nagashima, K, Wakisaka, Y., Koixumi, K. (1976) A new
antifungal antibiotic, trichostatin. J. Antibiot. 29(1), 1-6.

Tsuji, N., Nagashima, K, Kobayashi, M., Wakisaka, Y., Kawarnura, Y., Kozuki, S., Mayama,
M (1976) Two new antibiotics, A-218 and K-41 isolation and characterization. J. Antibiot.
29 (1), 10-14.

Tsukagoshi, S., Takeuchi, t., Umezawa, H. (1986) Antitumor substances. Biotechnology,
Vol. 4. Microbial products 11. 509-530.

Tsunakawa, M., Hanada, M., Tsukiura, H., Tomita, K, Tomatsu, K, Hoshiya, T., Miyaki,
T., Kinishi, M., Kawaguchi, H. (1985) Inosamycin, a complex of new aminoglycoside
antibiotics, 1. Production, isolation and properties. J. Antibiot. 38 (10), 1302-1312.

Tsunakawa, M., Hanada, M., Tsukiura H., Konishi, M., Kawaguch, H. (1985) Inosamycin,
a complex of new aminoglycoside antibiotics. II. Structure determination. J. Antibiot. 38
(10), 1313-1321.

Uyeda, M., Suxuki, K, Tsuruta, H., Shibata, M. (1988) Effects of validamycin of glucan
synthesis by cell-fi'ee extracts from Rhizoctonia solani. Agric. Bio. Chem. 52 (10), 2607-
2608.

Versalovic, J ., Schneider, M. (1994) Genomic fingerprinting of bacteria using repetitive
sequence-based polymerase chain reaction. Meth. Molec. And Cell. Biol. 14, 1-16.

Vezina, C., Kudelski, A., Sehgal, S. N. (1975) Rapamycin (AY-22,989), a new antifimgal
antibiotic. I. Taxonomy of the producing streptomycetes and isolation of the active principle.
J. Antibiot. 28 (10), 721-726.

Vining, LC. (1990) Function of secondary metabolites. Annu. Rev. Microbiol. 44, 395-
427.

Wayne, L.G., Brenner, D.J., Colwell, RR, Grimont, P.A.D., Kandler, O., Krchevsky, M.I.,
Moore, L.H., Moore, W.E.C., Murray, R.G.E., Stackebrandt, E., Starr, MP. and Truper,
H. G. (1987) Report of the ad hoc committee on reconciliation of approaches to bacterial
systematics. Int. J. Syst. Bacteriol. 37, 463-464.

Wellington, E.M.H., Stackebrandt, E., Sanders, D., Wolstrup, J. (1992) Taxonomic status
of Kitasatamoria, and proposed unification with Streptomyces on the basis of phenotypic and
16S rRNA analysis and emendation of Streptomyces waksman and henrici 1943, 339. Int. J.
Syst. Bacterial. 42 (1), 156-160.

Westley, J.W., Evans, RH., Sello, L.H., Troupe, N., Liu, C.M., Blount, J. 1979. Isolation
and characterization of antibiotic X-14547A, a novel monocarboxylic acid ionophore
produced by Streptomyces antibioticus NRRL 8167. J. Antibiot. 32 (2), 100-107.

 

85

Witt, D., Stackebrandt, E. (1990) Phylogenetic- and phenotypic similarities between
members of the genera Streptomyces and Streptoverticillium support the unification of the
two genera. Syst. Appl. Microbiol. 13, 361-366.

Woese, CR (1987) Bacterial evolution. Microbiology Reviews. 51, 221-271.

Woods, CR, Versalovic, J., Kieuth, T., Lupski, JR (1992) Analysis of relationships among
isolates of Citrobacter diversus by using DNA fingerprints generated by repetitive sequence-
based primers in the polymerase chain reaction. J. Clin. Microbiol. 30 (11), 2921-2929.

Yamamoto, RT. (1969) Mass rearing of the tobacco hornworrn. II. Larval rearing and
pupation. J. Econ. Entomol. 62(6), 1427-1431.

Yamashita, T., Iijirna, M., Nakamura, H., Isshiki, K, Naganawa, H., Hattori, S., Hamada, M.,
Ishizuka, M., Takeuchi, T., Iitaka, Y. (1991) Conagenin, a low molecular weight
irnmunomodulation produced by Streptomyces reseomarus. J. Antibiot. 44 (5), 557-559.

Yamaguchi, I., Taguchi, R, Huang, K. T., Misato, T. (1969) Aabomycin A, a new
antibiotic. II. Biological studies on aabomycin A. J. Antibiot. 22 (10), 463-466.

Yokoi, K, Nagaoka, K, Nakashima, T. (1986) Azinomycins A and B, new antitumor
antibiotics. II. Chemical structures. Chem. Pharm. Bull. 34, 4554-4561.

Zhang, zhongze. (1994) Personal communication. Institute of Applied Ecology, Academia
Sinica, Shenyang. China.

Zhen,Y., Ming X. Y., Yu, B., Otani, T., Saito, H., Yamada, Y. (1989) A new
macromolecular antitumor antibiotic, C-1027. III. Antitumor activity. J. Antibiot. 42(8),
1294-1298.

APPENDICES

 

86

APPENDIX I
lHNMR of compound 1

 

10

 

 

 

87

APPENDIX II
”CNMR of compound 1

 

 

 

w

 

 

 

.L

 

 

 

 

 

 

 

 

 

 

1.|IIIIIIIIIIIIIIIIIIWIIIII.III'ljlI]lllllllll[lllllilrlllfillllTrllIlI]lllllIIIIIIIIIIIIIIIIIVIIIllll

160 140 120 100 80 BO 40 30 'ppm

180

88

III

APPENDIX

DEPT of compound 1

Eng cm on 3 on 8 2. 2. o... 2:
P—pnpp—npnhhp-np—prh—bhph—Ppbp—b—pp—-bp—-—-—-

built; ,1: i i I ill is» l ibihp flirt-Drill} it, Lil ll)- ? ID Lvli I Di, l
4

OH." ONH on."

p p — n n p p — b n p p — b b p

-

 

 

 

 

Di fill it I

9.2.30 33:30:. =<

.E stir [it [If L i Dori III 1} bill Pill PI I'll) iP vb
id“ 1 — ‘ A #1 r 1‘ I 4144 i414 11 I 1141 It I Ill" I 14 4444‘ ifi —1{l‘ —— ‘ l! I ‘11!

 

i i 1111}

 

.. .4 .___._ ,

sea .6.

 

 

 

8&8 «mo-

tiii E II I F I} .- lbs?)- I itiihi” DIP? [It s I'll 7 I! D II it'll»! tile in Pp. It 3 Phi I DID Dnubr ill-ill {hi I? Ilsa 't lilil. but l I FDIP
‘2‘!“- 1 [.441 Iiir‘l! 1‘ ‘4 '1‘“ 1| {11‘111 ‘1! 1 I ‘4 11 {I 1 S I I 1 :11 111 1‘ 11111441!!! I I1 114 11 I 1‘4‘41 Illa! ‘ I I: i ‘I ‘11‘I4‘1 I I ‘¥

con—BU «EU-

89

APPENDIX IV
COSY of compound 1

 

 

   

.1. _ .4,
o 1"“ I“. .' '5': - .
o o . . ‘ “5",: '5, 3;”
- ' r -r _
° '0 O .-
.l t - -
' - 0° ' o .
9' I '- " I .‘
‘ ~ I
III!'TIIIUUU‘IIII'IUI'I1"'I""""'
6 5 4 3 2
F1 (99”)

.Ie.
' k

 

 

 

 

(psi-lei
2
3..
4
5
6
7

‘F2

 

 

MUM“ 1'

 

90

APPENDIX V
HMQC of compound 1

.5mm. an

0N ov cm co co." ONA ova on." on."

L-tLphLP-ppphpp—pppp—p»-—»-p-—pppp—.-.—-.-—p--—..pb—--—-.bP-Lp-.pP—pp-nb»-_»~..-F~LP

 

 

4 .1 L.
.01 r
a .u e .0 I.“
0 o I
1n
...n C I... a U . . .0... I -- § I n I o . I......O.t ' C .. I .I .l. O ..' I . . 0 ll. 0. . . a
. Iv
o
s o W
6 Wm
. . _ H . . . . . . .1
co ofidao.p. «”6on .. .0 . . .. v.99... .- .9. 0.. o... o... . 00.. o: .b. . L.HN
l6 4¢¢ O Q I . O a I" a H
Snatms-l. 26.3.2- 3......» .- .1... 171+ ..a¢-mm&.«.ru.3m.718.434.363.1q2324.32:5..." . .3. 13“
DOINZI. 7’1. .. ‘OQTI. .0?! U‘ I. on. .v .. Ono. ' 1&0. 0O..oso'lo.. I! .406’0J 19‘ 01'”... or 1....D'1Ioo .l .0";

 

 

 

 

E: - .

 

91

APPENDIX VI

EIMS spectrum of compound 1

 

N\z
awm . saw 0.8m 0%N mm: 1
i iii»: 0 1L . .- 11 a . .3... q... . 4.... .. _ $34.: .3 .— __ 1:... -.2— __ =2. _=_m=~fi._= .. 1. 1i
vwv swvmhm 3mm. MM“. _ mfimfimwb~ mm Nb~ __ pg: : {1m _ .
. m .- ....-. m . Show
n .9... .
. [12,...» .
. .av
- .Pm mom
9 v
. .Qm
Pm

 

 

 

 

 

C33C'DGCUU

C‘JU-ca-—)u

a. - DI.
||||'-
_ -1

1'1 '1'”; l
1' ”I ' 1'1 1‘1 -

 

l-lHl’ ' 21113

92

APPENDIX VII
UV spectrum of compound 1

Hilfiz'

I'

,-. g a
|'.‘ o .
O - O o

'| ”Hi i

If: ‘ ITI If: :2:-

 

e r

93
CD of compound 1

APPENDIX VIII

F 3:33:80

 

Essa-.2262, .
com oov can now
. _ . _ . Own

 

19..

00

I om-

 

 

 

 

 

o_.

94

APPENDIX 1x
1HNMR of compound 2

 

 

 

T l I I I I 1 I I I I I I I T I I U I U I I I
I

 

10

11

 

95

APPENDIX X
EIMS spectrum of compound 2

 

 

 

 

 

In
in
N
N
m
H
in
H
0‘0
H
.3—
0‘0
{’3
In
10
TI' '1‘ 'r'**fi-"m
ED 0 D
8 (DD ID V N
Fl

120—64-9-d>o CEJZ'JC‘DGCOO

588

488

288

188

 

nIlflililflllflifliillflflifllflifllfiflifllgs