no. A. ‘1.
.. .1... 5 1x.
. t: Aw

. ....u.. -. .. .yv-Vlv-

. n. q-"uq-nq—h

 

 

 

 

 

ulz}:$:x§ .3. . of .. wt. 5.. I. .V;l.£! -un; : 4 . .b7rn'rnal

 

 

THES98

um i‘iimiinmmniii

3 1293 70 7023

 

 

 

 

 

 

 

 

 

 

 

 

This is to certify that the

dissertation entitled

MOLECULAR GENETIC ANALYSES OF
GLOBAL ANTIBIOTIC REGULATION
IN STREPTOMYCES

presented by

BRENDA SUE PRICE

has been accepted towards fulfillment
of the requirements for

Ph . D . degree in Microb 101%)!

 

 

 

 

MS U is an Affirmative Action/Equal Opportunity Institution 0- 12771

 

LIBRARY

Mlchigan State
University

 

 

 

PLACE ll RETURN BOX to remove this chockom from your record.
TO AVOlD FINES Mum on or before date duo.

DATE PME DATE DUE DATE DUE

     
  

  
 

 

 

 

l’uuu ‘L 5 m0

(4.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

usu lsAn Miriam Action/Equal oppomnny Institution
WN‘DJ

MOLECULAR GENETIC ANALYSES OF GLOBAL ANTIBIOTIC REGULATION
IN STREHUMYCES

By

Brenda Sue Price

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Microbiology

1997

ABSTRACT

MOLECULAR GENETIC ANALYSES OF GLOBAL ANTIBIOTIC REGULATION
IN ST REPTOMYCES

By

Brenda Sue Price

Streptomyces coelicolor is a filamentous soil bacterium that is well known
for its ability to produce a vast repertoire of secondary metabolites, most
notable of which are the antibiotics. Many of these compounds have become
indispensable in human medicine and agriculture. While much is known
about the compounds themselves, relatively little is understood about how the
organism temporally and spatially regulates the production of antibiotics. A
more thorough understanding of antibiotic regulation could reveal ways in
which the organisms might be deliberately manipulated to enhance antibiotic
production.

This study focuses primarily on the characterization of the absB gene in
Streptomyces coelicolor which globally regulates the production of all four
antibiotics produced by that strain. Genetic and molecular approaches were
used to determine that the absB gene is a ribonuclease III (RNase III) analog.
In other bacterial systems, RNase III has been shown to regulate gene
expression by modulating the stability of select mRNA transcripts. Also,
characterization of the mia locus, which is able to inhibit global antibiotic
production when cloned in high copy in S. coelicolor, is described. Finally, an
attempt to elucidate a regulatory pathway for avermectin production in the

commercial producer Streptomyces avermitilis is presented.

DEDICATION

This dissertation is dedicated to the loving memory of

Dr. Tracy Anne Hammer DVM, Ph.D (1967 - 1996)

I was truly fortunate to have such a wonderful friend and classmate, who
also happened to be a remarkable scientist. We shared the trials and
tribulations of graduate school, and supported one another through the ebbs
and flows of our careers. She inspired me to design innovative approaches

to my research, and in that way she has left her mark on this body of work.

In mind and spirit ~ together always

iii

ACKNOWLEDGEMENTS

A student’s graduate education is only as good as his or her mentor. Dr.
Wendy Champness has given me the tools with whiCh I will continue to grow as
a scientist. Her professional and personal attention to the development of her
students is a distinction that I will always strive to emulate. I have also had
the benefit of a supportive graduate committee: Dr. Michael Bagdasarian, Dr.
Lee Kroos, Dr. Barbara Sears, Dr. Loren Snyder. Furthermore, the work
discussed in Chapter 4 was possible due to Dr. Kim Stutzman-Engwall’s
support of the Biotechnology Training Program concept. Thank you also to Dr.
Bill Wemau and the rest of the Bioprocess R&D team at Pfizer Inc. for allowing
me to experience industry research first-hand.

Many thanks to my classmates in the Microbiology Department, who
collectively believed in cooperation rather than competition with each other.
Our productivity as a group is a testament to the success of that philosophy.

Of course this work would not have been at all possible without the loving
support of my parents and brother. Their pride and enthusiasm for my
accomplishments has never waned, even after so many years of having to
explain why their daughter/ sister is still in school. They share in any and all
successes that I may ever have.

Finally, I would like to thank my husband, Hunter, for his loving support
during the preparation of this manuscript and throughout our marriage. His
commitment to my education helped me though periods of doubt and
frustration, and he was the glue that kept me together during the preparation

of this dissertation. Together, we can say “We Did It!”

iv

PREFACE

This dissertation is divided into four parts: a general introduction and
three chapters presenting the results of the doctoral work. The second chapter
is presented in manuscript form and will be submitted to Molecular
Microbiologr with coauthors Dr. Trifon Adamidis, Kelly Spencer, and Dr.
Wendy Champness. Dr. Adamidis’ contribution to this paper was the early

characterization of the absB mutants and the cloning of the absB locus to

generate pTA108 and pTA128. Ms. Spencer generated the E. coli pKS+ clone
pKJ 100 and assisted with the detailed restriction mapping of pTA108.

The third chapter describes work done in collaboration with Dr. Perry
Riggle and Dr. Gary Brown. Dr. Riggle’s contribution to this work was the
original isolation and subsequent subcloning of the mia sequence, and Dr.
Brown carried out further subcloning via PCR amplification. Portions of this
work will be submitted for publication with Dr. Brown, Dr. Riggle, and Dr.
Champness as co—authors.

The fourth chapter outlines research conducted in the laboratory of Dr.
Kim Stutzman-Engwall at Pfizer Inc. (Groton, CT) as fulfillment of requirements
for the Biotechnology Training Fellowship Program sponsored by NIH and MSU.
The participants undertake additional coursework related to biotechnology as
well as a nine month long internship in a biotechnology-related industry. The
chapter outlines the objectives of this internship and some preliminary results.
Final results, upon completion, will be submitted for publication at a later date,

with Dr. Kim Stutzman-Engwall as coauthor.

TABLE OF CONTENTS

LIST OF TABLES ................................................................................... vii
LIST OF FIGURES ................................................................................ viii
ABBREVIATIONS ................................................................................... ix
CHAPTER 1 Introduction and Literature Review ............................ 1
Streptomyces ............................................................ 2
Ribonuclease III ...................................................... 23
Literature Cited ...................................................... 50
CHAPTER 2 Genetic and Molecular Characterization of absB:
a Ribonuclease III Analog that Globally Regulates
Antibiotic Production in Streptomyces coelicolor ......... 62
Introduction ............................................................ 64
Experimental Procedures ......................................... 67
Results ................................................................... 74
Discussion ............................................................... 95
Literature Cited ..................................................... 100
CHAPTER 3 Characterization of the mia Locus, a Multicopy
Inhibitor of Antibiotic Production in Streptomyces
coelicolor ............................................................... 105
Introduction .......................................................... 107
Delimiting the mia Locus ....................................... 110
Features of the mia Locus ....................................... 115
Possible mechanisms for mia .................................. 116
Future Direction for the Characterization of mia ...... 119
Literature Cited ..................................................... 122
CHAPTER 4 Regulation of Doramectin Production in S. avermitilis:
A Biotechnology Training Program Internship .......... 124
Introduction .......................................................... 125
Project Goals ......................................................... 129
Results and Discussion .......................................... 132
Conclusions .......................................................... 136
Literature Cited ..................................................... 137

LIST OF TABLES

CHAPTER 1 Introduction and Literature Review
1.1 The rnc mutants ......................... ' ........................ 29
CHAPTER 2 Genetic and Molecular Characterization of absB, a
Ribonuclease III Analog that Globally Regulates Antibiotic

Production in Streptomyces coelicolor

2.1 Strains used in this study ................................... 68
2.2 Plasmids used in this study ................................ 69

vii

LIST OF FIGURES

CHAPTER 1 Introduction and Literature Review

1.1 Genetic map of S. coelicolor .............. . ........................ 4
1.2 Chemical structure of actinorhodin .......................... 6
1.3 Chemical structure of undecylprodigiosin ................. 8
1.4 Regulation of undecylprodigiosin gene cluster ............ 10
1.5 Chemical structure of methylenomycin ..................... 10
1.6 Genes involved in spore development ........................ 20
1.7 The rnc operon ......................................................... 27
1.8 Pathways of ribosomal RNA processing ...................... 31
1.9 Ribosomal RNA processing sites ................................ 32-33
1.10 Inhibition of gene expression via 5’ leader processing .. 36
1.1 1 Enhancement of gene expression through 5’ leader

processing ............................................................... 37-38
RNase III processing within the 3’ noncoding region 41-42
Enhancement of gene expression without transcript

processing .............................................................. 44-45

p—a
l—‘H
00M

CHAPTER 2 Genetic and Molecular Characterization of absB, a Ribonuclease
III Analog that Globally Regulates Antibiotic Biosynthesis in

Streptomyces coelicolor

2.1 The pTA108 restriction map ..................................... 76-77
2.2 Defining the absB gene ............................................ 79-80
2.3 DNA sequence of the absB locus ............................... 85-86
2.4 Amino acid alignment of AbsB and RNase III homologs 87-88
2.5 absB in other streptomycetes ................................... 91-92
2.6 rRNA processing by AbsB ......................................... 93-94

CHAPTER 3 Characterization of the mia Locus, a Multicopy Inhibitor of
Global Antibiotic Production in Streptomyces coelicolor

3.1 Features of the mia locus ......................................... 11 1-1 12
3.2 DNA sequence of the mia locus .................................. 113-114
3.3 Secondary structure on the mia locus ....................... 117

CHAPTER 4 Regulation of Doramectin Production in Streptomyces avermitilis:
A Biotechnology Training Program Internship

4.1 Structure of the avermectins ..................................... 126
4.2 Physical map of the avermectin gene cluster .............. 130-131
4.3 Schematic diagram of the aveR region ....................... 133-134

aa
Abs(*/ -)
Act

Aplr)

Avm
bp(S)
bsRNase III
CDA
Hygm

kb

kDa

7t

Mbp
nt(s)

PKS

Red

RN ase III
0

Spoh/ -)
Thiolr)

wt

ABBREVIATIONS

amino acid

synthesis of multiple (+) or no (-) antibiotics
actinorhodin '

ampicillin (resistance)

avermectin

basepair(s)

ribonuclease III of Bacillus subtilis
calcium-dependent antibiotic
hygromycin (resistance)
kilobase(s) or 1000 basepairs
kilodalton(s)

lambda phage

megabase(s) or 106 basepairs
nucleotide(s)

polyketide synthase
undecylprodigiosin

ribonuclease III of Escherichia coli
sigma factor

sporulation proficient (+) or deficient (-)
thiostrepton (resistance)
wild-type strain

CHAPTER 1

Introduction and Literature Review

2
Streptomyces: an Introduction

Streptomycetes (of the family actinomycetes) are Gram-positive soil
bacteria that resemble filamentous fungi in their mycelial growth patterns.
Developing colonies form a network of branching coenocy‘tic hyphae that
penetrate and degrade complex organic material by the secretion of
exoenzymes (18). In addition to their complex developmental life cycle,
streptomycetes are well-known for their ability to produce a vast array of
secondary metabolites, many of which have found uses in medicine or
agriculture. In addition to antibiotics, other classes of secondary metabolites
include the antiparasitics (i.e. avermectin), antifungals (i.e. polyoxin), (3-
lactamase inhibitors, (i.e. clavulanic acid), irnmunosuppressors (i.e.
rapamycin), and antitumor compounds (i.e. adriamycin).

The life cycle of the streptomycete begins with a single spore, which
under supportive environmental conditions germinates to form a germ tube (for
review, see (18)). Extension of the hyphal tips and branching of the hyphae
results in the development of a mycelial mat. The colony continues to multiply
and radiate outward during the vegetative state. At the point of transition into
stationary phase, a signal that is presumably triggered by nutrient depletion
initiates the regulatory cascade of differentiation. At this point, both
morphological and physiological differentiation are initiated. Aerial mycelia are
erected, giving the colony a fuzzy, velvety appearance. A gray spore pigment
develops after septation of the aerial mycelia into mature spore chains.
Concomitantly the production of secondary metabolites takes place. Partial

lysis of the substrate mycelium also occurs, presumably to provide nutrients

3
for the differentiation processes. This growth-dependent nature of secondary

metabolism and morphological development continues to be the subject of
intensive study.

Another notable characteristic of the streptomycetes is that the 8 Mbp,
72% G:C chromosome has recently been shown to be a linear molecule (73).
This suggests interesting processes for replication, recombination, and

partition of the chromosome as growth occurs.

Streptomyces coelicolor: a model streptomycete

S. coelicolor has been the model for studying the processes of secondary
metabolism and morphological differentiation in actinomycetes. S. coelicolor
was the first actinomycete for which a genetic linkage map was developed,
aided by methods for protoplast fusion and plasmid-mediated Conjugal transfer
(47). This ability to genetically manipulate the strain led to further
development of plasmid and phage vectors, shuttle vectors, reporter gene
fusion vectors, and some transposon mutagenesis schemes as well as methods
for their use (48). Recently a physical and genetic map of S. coelicolor was
compiled (60), and an ordered set of cosmid clones was used to generate a
library of wild type chromosomal DNA (96). An adaptation of the genetic map,

showing relevant genes discussed in this work, is shown in Figure 1.1.

E".
e %
I or
-o
\
$0 t0
063"
4442
£9413,
‘70 5/011
m: S. coelicolor A3 (2)
bide
(a
i 1'
‘5- d‘
\50 $39
‘0 .C 6; 233$-
§ 4519 N $51 9‘3
as Q.) a a. .. ..
o S) 3 Q 09,
‘5: *2.
\ m
é, U5

Figure 1.1 A genetic map of S. coelicolor. Genes relevant to secondary

metabolism are shown. Genes integral to the presented research are

highlighted in bold type. Adapted from (49, 60, 96).

5

S. coelicolor produces four known structurally diverse antibiotics (for
review, see (49)). The genes that direct the biosynthesis of each compound are
located at distinct locations on the chromosome (Fig. 1.1). Two of these
antibiotics are pigmented compounds, and the mature spores of S. coelicolor
produce a gray pigment; this permits the rapid visual screening for
developmental mutants. None of the four antibiotics produced by S. coelicolor
are commercially useful, thereby relieving any proprietary limitations on the

sharing of information between laboratories.

The Antibiotics of S. coelicolor: Chemistry and Genetics

Actinorhodin

Actinorhodin (Act) is an intensely blue aromatic polyketide that
historically served as the model for the genetic and molecular characterization
of antibiotic gene clusters. The Act biosynthetic pathway has been predicted
based on pathway intermediates and shunt products found in blocked mutants
(6, 23). Actinorhodin results from the condensation of 1 acetate and 7
malonate residues to form a 16-carbon acyl chain (Fig. 1.2) (49). The
mechanism of polyketide chain elongation is analogous to that of fatty acid
synthesis (98). The polyketide family of compounds are synthesized in

prokaryotic and eukaryotic systems and have vast biological activities (50).

 

 

 

Figure 1.2 Chemical Structure of Actinorhodin

Genetic analysis of the actinorhodin gene cluster began with the
isolation of seventy-six mutants blocked in various stages of Act production.
Using pairwise combinations of mutants, seven co-synthesis groups were
identified (104). Genetic mapping of a representative mutant from each group
revealed that the act genes were located in a cluster on the S. coelicolor
chromosome, which later proved to be a recurrent theme among actinomycetes
antibiotics (104). The cloning of the entire 25 kb act gene cluster allowed a
more detailed investigation into antibiotic production and regulation (74).
Actinorhodin production requires at least 23 genes expressed as at least 7
transcripts. In addition to biosynthetic enzymes, the act cluster contained
genes to confer host resistance, export, and regulation. Subsequent studies in
other systems have shown that this coordinate expression of relevant antibiotic
genes within a cluster has been conserved across species (17).

The actII-ORF4 gene located in the middle of the act gene cluster has

been identified as the positive regulator of Act production (34). actII-ORF4'
mutants are completely blocked in Act production and cannot be restored by

co-synthesis with any other mutant class (75, 104). When multiple copies of

7

actII-ORF4 are introduced, Act is produced early in exponential growth phase,
and at elevated levels, though the growth rate of the culture is unaffected (40).
Actinorhodin production, as well as other S. coelicolor antibiotics, is dependent
on the tRNALCU-encoding bldA gene, which recognizes the UUA codon (bldA
discussed in detail below). Sequence analysis revealed that the actII-ORF4
gene contains one UUA codon, suggesting translational regulation by the bldA
gene product (34, 70). When the UUA codon is mutated to a silent UUG codon,
bldA dependence is relieved and actinorhodin is produced in the bldA mutant

background (34). Multiple copies of actII-ORF4 are capable of bypassing the

bldA’ mutant under some culture conditions, presumably due to imprecise
translation (92).

The actII-ORF4 gene product shows amino acid homology to other
cluster-specific activators, namely RedD (see below) and Dan, which regulates
daunorubicin production in S. peucetius. RedD and ActlI-ORF4 cannot

complement one another, however Act production can be restored in an actII-

ORF4‘ mutant by the introduction of the 61an gene (113). To date amino acid
sequence analysis of these three proteins has not revealed a mechanism of

action nor are these proteins related to any others in the databases.

Undecylprodigiosin

Undecylprodigiosin (Red) is the major component of a mixture of closely
related tripyrolle compounds produced by S. coelicolor (120). It has
bacteriostatic / bacteriocidal activity against Gram-positive bacteria as well as

some antiparasitic activity (13, 45) though is considered too toxic for

8

therapeutic use. This compound is chemically similar to the prodigiosin
produced by Serratia marcescens and is believed to be produced from amino
acids and polyketides via a similar biosynthetic pathway (33, 128). Under
slightly acidic culture conditions, this antibiotic is a deep red pigment; at
slightly alkaline pH it appears yellow. Red remains cell associated and is

highly nonpolar (120).

. OCH,
l | | \ E l | | I
I; N I; <CH.)..CH.

Figure 1.3 Chemical Structure of Undecylprodigiosin

 

 

 

Early genetic studies grouped 37 Red‘ mutants into six groups based on
co-synthesis with one another (33, 76). Genetic mapping of the representatives
from each group (redA-P) revealed that the genes for Red biosynthesis were
clustered on the chromosome, as had been demonstrated for actinorhodin
(105). The Red cluster is located at 5 o’clock on the genetic map, distant from
other known antibiotic clusters (Fig. 1.1) (105). The entire gene cluster (37.5
kb) was isolated and characterized (76). To date, eighteen genes have been
implicated in the Red biosynthetic pathway (22).

redD was identified as a positive regulator of the Red biosynthetic genes
due to several criteria. Earliest characterization showed that redD“ mutants

could not co—synthesize Red with any other mutant class (32). In a redD‘

mutant background, transcript levels of biosynthetic genes redE and redBF

9

were reduced (84). The introduction of additional copies of the redD gene, in

either high or low copy vectors, caused an overproduction of Red in both the S.

coelicolor wild type and redD' background (84), and could stimulate Red
production in S. lividans as well (7 6). Lastly, RedD protein showed homology to
other cluster-specific activators: ActII-ORF4 of S. coelicolor (34) and Dan of S.
peucetius (113). Transcription analysis over a time course revealed that the
expression of redD increases dramatically at transition phase and continues
into stationary phase, just prior to the onset of Red production (115).

In contrast to the case for actII-ORF4, transcription of redD is strictly
dependent on bldA (84, 125). This suggested that there might be an additional
regulator of Red that is required by redD and is translationally dependent on
bldA. A search for mutants able to suppress the bldA mutation and produce
Red, but not Act or aerial mycelia, resulted in the pwb (pigmented v_vhile bald)
mutant class (reviewed in (125)). Genetic mapping placed . the suppressor
mutation near the right hand end of the Red cluster, approximately 4 to 5 kb

downstream of redD. Sequence analysis revealed an open reading frame that is

expected to be responsible for the wa+ phenotype. Named redZ, this gene
showed some homology to a response regulator family of proteins, including
the global antibiotic regulator absA2 (see below), yet lacks the functionally
significant and conserved phosphorylation regions (43). Deletion of the wild
type redZ gene results in complete abolition of Red production, while the
addition of multiple copies of redZ results in copious overproduction of Red
(125). Transcript analysis shows that redZ is transcribed weakly during

exponential growth, and increases at transition and stationary phase.

10

Mutational analysis indicates that while redZ is not dependent on redD, redD is
strictly dependent on redZ for transcription. RedZ also appears to negatively
autoregulate its own expression. redD transcription is bldA-dependent, but
redZ is not. The presence of a UUA codon in redZ suggests that it is dependent
on bldA for translation (125). Presence of multiple copies of redZ in a bldA
mutant restores Red production to the strain, while multicopy redD does not.
Taken together, these data suggest that bldA serves to translationally control
redZ, which then transcriptionally regulates redD. RedD then activates the

biosynthetic gene cluster to produce Red (Fig. 1.4) (125).

red
bldA —§ redZ (UUA) —> redD —-’ structural ——. Red
genes

Figure 1.4 Model for regulation of the undecylprodigiosin gene cluster in

S. coelicolor (125).

Methylenomycin
Methylenomycin (Mmy) is a structurally simple antibiotic (relative to
other known structures) that has antibacterial activity against both Gram-

positive and Gram-negative bacteria (44).

CH CH2
0

COOH
C 3

Figure 1.5 Chemical structure of methylenomycin.

11
Like Act and Red, Mmy is thought to be encoded by a set of genes

arranged in a cluster; however the mmy gene cluster is carried on the
conjugative plasmid SCPl (129). This linkage was discovered due to the co-
transfer of Mmy production and resistance with the fertility properties related

to SCPl (64). SCPl is a 350kb linear plasmid that can exist autonomously

(SCP1+) or integrated within the chromosome (historically termed an NF
strain). Integration of SCPl occurs at the 9 o’clock region of the chromosomal
map (Fig. 1.1). The Mmy cluster is thought to be between 17 and 28 kb in
length, but has not been as thoroughly characterized as Act or Red. Two genes
within the cluster have been characterized; a gene that confers host resistance
(mmr) and a putative repressor (mer) (19, 86). Transcription analysis of mmr
suggests that it is transcribed after biosynthetic genes, and may be induced by
methylenomycin or an intermediate precursor (46). mer, which lies at the
leftmost end of the cluster, appears to negatively regulate Mmy, as disruption

of the gene results in overproduction of Mmy (19).

Calcium-dependent antibiotic

Calcium-dependent antibiotic (CDA) is the least characterized antibiotic
produced by S. coelicolor. It requires calcium ions for its antibacterial activity
against Gram-positive organisms (68). To date the genes for CDA production

have not been cloned or characterized, nor has the structure of the antibiotic

been determined. Of fourteen CDA’ mutant strains isolated, none were able to
co-synthesize CDA with one another, but all were shown to be closely linked on
the chromosome and mapped to the 10 o’clock position of the genetic map (Fig.

1.1) (51).

12
Pleiotropic Regulation of Antibiotic Production

Several loci have been described which affect the production of more
than one antibiotic in Streptomyces. In most cases these genes are distinct
from the antibiotic clusters on the chromosome. They can be grouped into two
broad categories: those that affect antibiotic production and morphological

development, and those that appear to affect only antibiotic production.

The bid genes: early switches in antibiotic production

Wild type Streptomyces colonies on solid medium appear smooth and
beige during vegetative growth, but at the onset of stationary growth they
become “fuzzy” with the development of aerial mycelium and display pigment
due to antibiotic production. The first class of developmental mutants to be
identified and characterized never developed the fuzzy appearance of mature
colonies (nor the pigmentation) and were thus nicknamed “bald” mutants (82).
Since these mutants provided genetic evidence of coupling of antibiotic
production and sporulation, they were thought to involve genes required for
early switch to secondary metabolism. Nearly all Bld phenotypes are
conditional under certain growth conditions - aerial mycelia development can
in some cases be restored on particular carbon sources, or when grown next to
a wild type strain (15, 82). Antibiotic production is not generally affected by
differences in carbon source, which implies multiple levels of control in these
mutants. To date, eight major bld loci have been identified (A, B, C, D, G, H, I,
K) but few have been functionally characterized. Each locus maps to a distinct

location on the S. coelicolor chromosome (Fig. 1.1).

13

bldA is the best characterized bld locus. bldA mutants have been
characterized in S. coelicolor, as well as S. lividans and streptomycin-producer
S. griseus. Aerial mycelial development is blocked in bldA mutants grown on
glucose-containing media, but is restored on mannitol or maltose minimal
media. In addition, bldA mutants are globally blocked in the production of all
four antibiotics in S. coelicolor, and in S. griseus are deficient in streptomycin
production (Str').

The bldA gene was mapped to the 10 o’clock position on the S. coelicolor
map, and was subcloned by complementation of bldA‘ mutants (Fig. 1.1) (69).
Sequence analysis revealed that the bldA gene encodes a tRNA that is charged
with leucine and recognizes the UUA codon (69). This codon is extremely rare
in the high °/oG:C DNA of Streptomyces. Quite interesting was the fact that the
few UUA codons found within known open reading frames were in genes
relating to secondary metabolism (70). This brought up the possibility that the
bldA gene product might function in translational regulation of secondary
metabolism. A knockout of the lone bldA gene has no apparent effect on
vegetative growth, implying that UUA codons are not found in any essential
vegetative genes (71). In addition to acflI-ORF4, redZ, and actII-ORF2 (Act
export) in S. coelicolor, UUA codons have been found in known positive
regulatory genes for streptomycin (strR) in S. griseus and bialaphos (brpA) in S.
hygroscopicus, as well as in several antibiotic resistance genes (70). Detailed
transcript analysis of the bldA showed that the 5’ end of the tRNA is processed,

and that the processed form increases in concentration in late growth. This

14

regulation is atypical to most tRNAs, whose abundance generally wanes later in

the life cycle (72).

The absAI/AZ genes
In an attempt to isolate developmental mutants that were completely

blocked in the production of all four S. coelicolor antibiotics but not in
sporulation, UV mutagenesis survivors were visually scored for an Act' Red'

phenotype, then tested for CDA' and Mmy“. Of 800,000 mutants screened,
thirteen were confirmed to have this phenotype, named “Abs” for antibiotic
synthesis deficient (1). Genetic mapping studies concluded that the mutants
fell into two classes, absA and absB, based on their distinct locations at 10

o’clock and 5 o’clock respectively (Fig. 1.1) (14). The mutants were also

distinctive in several other respects. The Abs‘ phenotype appeared under
certain conditions to be conditional; absA mutants were slightly leaky for Act
on low phosphate medium, while absB mutants were slightly leaky for Act and
Red on the complex medium R2YE. Additionally, absA mutants were found at
a much lower frequency (106) and generated a significant number of
spontaneous suppressors (named sab, for suppressors of a_bsA).

The absA locus was cloned using a low copy plasmid library of wild type
chromosomal DNA (1). During the process of transformation, it was observed
that spontaneous suppressors were generated at a greater frequency than
complementing clones; therefore a scheme that utilized the conjugative
properties of the plasmid vector was used. Using this approach, the absA locus

was cloned and the minimal complementing fragment was sequenced (ll).

15

Database homology searches revealed that the absA locus contained a

hisitidine kinase protein homologous to the DegS/NarQ,X family of two-

component regulatory systems. All four of the original absA' mutations
appeared to be localized to this ORF. DNA sequence. from further downstream
revealed another open reading frame. This gene product showed homology to
the corresponding response regulators of the DegU/NarL,P family.

Subsequently named absAl/AQ, these genes were disrupted using an

integrative phage. Interestingly, although absA] UV mutants were Abs', the
null mutant AabsA 1/A2 and AabsA2 both resulted in hyperproduction of Act
and Red. (The parent strain J 1501 does not carry the SCPl plasmid, therefore
Mmy was not tested). The antibiotics were also produced earlier in the life
cycle, suggesting that the absA genes function in negative regulation of
antibiotic production, and influence temporal regulation. absA genes appear to
be conserved among several other streptomycetes (10), though the role of any

homologs in antibiotic production is as yet unknown.

The mia locus

During an attempt to clone the absA locus from a high copy plasmid
library, one sequence was independently isolated >40 times (99). This
fragment in high copy was able to inhibit the production of at least three of the
four antibiotics (named mia for multicopy inhibition of antibiotic synthesis), yet
sporulation appeared to be unaffected (the Abs' phenotype). The mia locus
mapped to the two o’clock region of the chromosome, distinct from any other

known antibiotic regulatory gene (Fig. 1.1) (99). A 1.2 kb fragment was

16

sequenced and subsequently trimmed to a 120 bp region that is sufficient for

the Abs“ phenotype (12, 99). This region contains a 20 amino acid ORF, but its
codon usage suggests that it may not be expressed. This region also contains a

19bp perfect inverted repeat that could be relevant in the regulation pathway.

The qfsQI/QZ system

The afsQl gene from S. coelicolor was identified by virtue of its ability to
stimulate overproduction of actinorhodin, undecylprodigiosin, and A-factor (a
putative cell signal molecule necessary for sporulation) in S. lividans when
introduced in low copy (56). This clone was able to restore Act production to
an absA mutant, but not an absB mutant. Sequence analysis of the afsQI
gene predicted a 225 amino acid protein that revealed homology to the
PhoB/OmpR family of response regulators in a two-component signal
transduction system. When an aspartate residue, the phosphorylation of
which has been shown to be functionally significant in other homologous
response regulators, was mutated in the afsQl gene, the protein lost its ability
to overstimulate actinorhodin production in S. lividans, suggesting that
phosphorylation at this residue is involved in this mechanism of antibiotic
regulation (91). As protein kinase-response regulators are commonly found in
pairs, adjacent DNA was sequenced and the afsQ2 gene was discovered. The
535 amino acid afsQZ sequence is translationally coupled with the afsQI open
reading frame, and sequence analysis predicts a histidine kinase gene
homologous to the PhoR/EnvZ subfamily. When afsQ2 was cloned into wild
type S. coelicolor, no stimulation of actinorhodin was achieved. The afsQl/QZ

locus mapped to 7 o’clock on the S. coelicolor genetic map near the act gene

17
cluster (Fig. 1.1) (56). Transcript analysis showed that afsQl/ Q2 message is

temporally controlled, occurring just before act gene expression. Interestingly,
gene disruption of the afsQI / Q2 locus resulted in no change in antibiotic
production or morphogenesis, indicating that afsQI/ Q2 is not essential in
antibiotic production. Southern hybridization showed that the afsQl and

afsQ2 sequences are conserved across many other actinomycete species.

The cutRS system in S. lividans

A two-component regulatory system that appears to negatively regulate
antibiotic production was isolated from S. lividans and was named cutRS (16,
121). The histidine kinase cutS showed greatest homology to the afsQ2 of S.
coelicolor, and the cut)? gene showed homology to afsQl response regulator
(121). Unlike afsQl/QZ, the cutRS system does appear to function in normal
regulation of antibiotic synthesis by the negatively regulating at least
actinorhodin production (16). As evidence, insertional inactivation of the cutRS
genes resulted in early and increased levels of actinorhodin, which is not
normally expressed in S. lividans. cutRS transcription is growth phase
dependent; transcript was detected at the transition to stationary phase prior

to actinorhodin biosynthesis (16).

The qst/asz/qstZ system

In an attempt to characterize a developmental mutant, “afsB”

(phenotype Act‘ Red' A-factor' Spo+), a plasmid library of S. coelicolor wild type

DNA was used to search for a complementing clone. As a result an interesting

18

bypass clone was isolated, and subsequently named ast. ast mapped to 7
o’clock on the genetic map (Fig. 1.1) (53). A low copy plasmid containing ast
introduced into wild type or the afsB mutant resulted in overproduction of Act
and Red. The ast gene product was determined to be 993 amino acids in
length, and portions of the protein were able to stimulate antibiotics to a lesser
degree than the entire sequence.

Further experiments determined that the Ast protein is phosphorylated
by a specific kinase, the product of the asz gene. Thus asz-ast comprise a
serine-threonine phosphoprotein signal transduction system in which Asz
phosphorylates Ast, which then regulates antibiotic production. Sequence
analysis determined that the N-terminus of the ast gene is homologous to the
cluster-specific activators actII-ORF4 and redD (52), but it is not yet understood
how these proteins interact in the antibiotic regulatory cascade. While ast in
multicopy results in an increase in actII-ORF4 and redD transcription,
disruption of the ast gene does not have any deleterious effect on transcript
levels (36). ast cannot substitute for actII-ORF4 or redD in antibiotic
production.

An additional gene, separate yet adjacent to ast, was recently reported
to also influence antibiotic production (123). Named ast2, this gene encodes
a 63 amino acid protein that stimulates Act and Red production when cloned in
high copy in S. lividans. An analogous gene, afsS, has been reported in S.
coelicolor that is nearly identical in sequence and appears to have the same
function (36, 123). The protein has no homologs in the protein databases that

might suggest a mode of function. ast2 in multicopy stimulates transcription

19
of the actII—ORF4 gene and the biosynthetic gene actIII; however the Ast2

protein is not required for the expression of either gene as the null mutant

(AastZ) is still able to produce Act (123).

The abaA gene

The abaA locus (named for antibiotic _biosynthesis activator) was
identified by its ability to stimulate overproduction of actinorhodin when cloned
in high copy into wild type S. coelicolor and the closely related S. lividans (S.
lividans has the act gene cluster intact yet produces no actinorhodin) (35). This
locus mapped to the 2 o’clock position on the genetic map, far removed from
the actinorhodin gene cluster. Disruption of abaA using integrative phage
resulted in abolition of actinorhodin production and reduction in Red and CDA
levels, yet Mmy levels and sporulation were unaffected (35). The abaA gene is
not able to bypass a bldA mutant, as seen for actII-ORF4, which suggests an
alternative pathway for actinorhodin activation (92). To date the abaA gene is
as yet uncharacterized, although hybridization studies have shown that the

locus is conserved among other Streptomyces species (35).

Regulation of sporulation - a morphological cascade

The whi genes
Sporulation in streptomycetes begins with the development of
multinucleoid aerial mycelium, which subsequently coil and septate to yield

chains of uninucleate spores. At full maturation the spores produce a gray

2O

pigment; thus sporulation mutants were named “whi” mutants for their white
appearance. Developmental mutants blocked at various stages of the

sporulation process have been identified (Fig. 1.6) and a few have been

 

 

 

characterized.
aerial
mycelium septa
development coiling formation
bld genes : : :
whiG whiA whiD
whiJ whiB whiE
whiH sigF
whiJ] , I2

Figure 1.6 Genes involved in spore development.

The bld genes control the earliest stages of sporulation with the
initiation of aerial mycelium formation. Beyond bld genes, morphological
differentiation control diverges from antibiotic production. One of the earliest
whi genes involved in spore development independent of antibiotic production
is whiG (81). To date the best characterized whi gene, whiG gene encodes a
sigma factor (owhiG) most similar to CD of B. subtilis and or“ of S. typhymurium
and P. aeruginosa (20). owhiG is found specifically in actinomycetes that
undergo sporulation, and appears to be in limited concentration in the cell
(110). Multiple copies of a B. subtilis (SD-dependent promoter introduced into
wild type S. coelicolor resulted in the Whi phenotype, presumably due to
sequestration of the whiG gene product (20). This result led to a strategy for
isolation of two owhiG-dependent promoters (119). Multiple copies of the whiG

gene induce sporulation in vegetative mycelium that would otherwise be fated

21

for lysis (20). whiG transcription appears to be constitutive, and is not
dependent on any other whi gene (58).

Characterization of other whi genes has revealed some initial findings.
whiJ shows homology to the abaA gene involved in antibiotic production (106).
whiB encodes a transcription factor-like peptide (17). th1/12 is a two
component regulatory system most closely homologous to absAI/A2, however
AwhiI2 has no apparent phenotypic affect on S. coelicolor (106). sigF is a sigma
factor gene expressed only during sporulation and is transcriptionally
dependent on all whi genes (58, 95). Finally, the whiE locus appears to encode
several genes for formation of the mature spore pigment (131). As further
characterization of each whi locus is completed, interactions between various

whi gene products will likely reveal a complex cascade of regulatory control.

The SapA and SapB proteins

Extracellular signal proteins have recently been identified which are
involved in aerial mycelium formation. Transcription of sapA, which encodes a
13kDa protein found associated with purified mature spores, coincides with
aerial mycelium development and is significantly blocked in certain bld and whi
mutants. A SapA-LuxAB fusion protein demonstrated a close spatial
correlation between developing aerial mycelium and PsapA-driven luciferase
expression (42).

The SapB protein has been shown to be required for aerial mycelium

formation. A11 bld mutant classes are deficient in SapB production, but whi

mutants are SapB+ (126). When purified SapB protein was added to bld

22

mutants, aerial mycelium formation was restored, though the inability to
produce antibiotics was not (127). Interestingly, when certain bld mutant
classes were grown near others, aerial mycelium production could be restored
to some degree. SapB protein is present in a zone around difierenfiafing
bacteria (126).

Further extracellular complementation studies suggested the possible
involvement of four or more as yet unidentified intercellular signals in the

formation of aerial mycelium ( 127).

Conclusions

While much work remains to be done to discover the functions of known
genes and how they interact, current understanding suggests a complex
network of genetic controls of secondary metabolism in Streptomyces spp. As
more genes involved in antibiotic production and sporulation are identified and
characterized, a complex regulatory cascade will undoubtedly emerge to reveal
how these organisms sense and adapt to changing environmental conditions.
Such information is also likely to be of great value as the streptomycetes
continue to be exploited for the production of commercially valuable secondary

metabolites.

23

Ribonuclease 111: an Introduction

Chapter 2 of this work characterizes the absB gene product of
Streptomyces coelicolor as a putative Ribonuclease III (RNase III) enzyme. While
this is the first known example of an RNase III in an actinomycete, this enzyme
has been characterized in other systems.

RNase III is an endoribonuclease that cleaves double-stranded RNA
molecules. First identified in E. coli, RNase III was shown to cleave perfect
duplex RNA in vitro (102). In the cell, the most common natural substrates for
the enzyme are the duplex regions of stem-loop structures formed by folded
RNA molecules. Cleavage by RN ase III was first implicated as the initial step in
the processing of 16S and 23S rRNA from the 308 precursor transcript (101).
Despite this important function, RNase III is not essential for survival of E. coli.
RNase III cleavage was also shown to be the method of processing of the
polycistronic T7 phage early gene transcript into single monoCistronic mRNAs
(31). This latter function was of considerable interest, as the processing event
allowed for translation initiation of each gene and thus directly influenced the
expression of the T7 genes. It has been estimated that expression levels of as
much as 10% of proteins detected in E. coli crude cell extracts are modulated
by the RNase III enzyme (39, 117). This ubiquitous nature of RNase 111 function
in the cell has generated much interest in recent years. Additional substrates
for RNase III processing in the cell continue to be elucidated, and together they
exhibit a complex system of post-transcriptional control of gene expression

through the processing of mRNA transcripts.

24
RNase III and its substrates

The E. coli RNase III enzyme is a homodimer composed of two 25 kDa
subunits. It was first purified as an endoribonucleolytic activity able to
solubilize high molecular weight double stranded RNA in vitro (102). The
cleavage resulted from two single strand breaks two nucleotides apart, and
occurred approximately every 15 bases (10-18 nt range) (101). The resulting
fragments had 5’ phosphoryl and 3’ hydroxyl ends, with no apparent nucleotide
specificity at either end (26, 102). Both poly(A)-poly(U) and poly(I)-poly(C) RNA
were suitable substrate, suggesting that no particular sequence was required
for recognition and cleavage. In addition to perfect duplex RNA, RNase III has
since been shown to process double-stranded regions in specific ribosomal and
messenger RNAs. These molecules fold to form stem-loop structures, with
RNase III cleavage sites located in the stem region. While most RNA molecules
have the ability to form stem loops, the vast majority are not recognized by this
enzyme (24). Double stranded stems containing RNase III recognition sites
often contain unpaired bases, which form internal loops or bulges. The
importance of this irregular pairing is questionable as deletions of internal loop
regions have shown no effect on RNase III processing in some signals (21).

Elements critical to signal specificity for RNase III processing continue to
elude precise definition, but are likely to incorporate sequence and structure-
dependent components (21, 66). An attempt to uncover a consensus sequence
for RNase III processing was conducted, but the 26bp sequence that resulted
was very loosely conserved in only some signals (66). Despite the lack of a well

defined consensus, RNase III signal sequences do often show notable symmetry

25

around the cleavage sites, compatible with the prediction that each cut is made
by one of the identical subunits of the enzyme (24). Another common
characteristic was the fact that bases immediately adjacent to the cut sites
were not at all conserved; this notion was also suggested in the discovery of
non-specific terminal nucleotides at cleavage sites (101) and the lack of effect of
directed mutations at the cleavage sites (21).

A minimal RNA molecule of a RNase III signal containing only sequence
forming the stem-loop was processed by RNase III in vitro, indicating that no
distant tertiary interactions with external sequences are likely to be required
(21, 87). Furthermore, deletion analysis in vivo suggested that sequence within
the stem loop is required for RNase III processing (25). Taken together, the
evidence indicates that the stem-loop structures are both necessary and

sufficient for recognition and cleavage by RNase III.

The mc operon

The first RNase III' mutant, named mc105, resulted from a screen of

nitrosoguanidine mutagenesis survivors (61). The RNase III' mutant
demonstrated that the enzyme is not essential for cell survival, however the
me] 05 mutation does generate a somewhat slower growth rate the extent of
which is variable depending on culture medium and genetic background (4, 61,
112). The mutation was mapped to the 55-min position on the E. coli
chromosome (4, 112). This discovery led to the cloning and characterization of

the wild type mc gene that encodes RNase III (124). The rnc gene was

26
sequenced, and the deduced peptide sequence predicted a 25 kDa protein

consistent with the size of the RNase III monomer (77, 85). A plasmid clone
carrying only the me gene was able to complement the me] 05 mutant (124).

Genetic analyses showed that mc is the first of three genes in the me
operon (Fig. 1.7) (118). The era and recO genes are located downstream of the
me gene. The Era protein was characterized as a GTP-binding protein with
GTPase activity. The era gene is essential for viability in E. coli, although the
function of the protein is unknown. The recO gene is involved in DNA repair
and is not essential for the cell. The operon was defined by polar mutations in
the me gene that inhibit the expression of the era and recO genes, and by polar
mutations in era that prevent expression of recO (1 l8).

Transcript analysis of the me operon revealed that the expression of the
me operon is autoregulated; processing of a stem-loop structure in the
untranslated leader region by RNase III reduces the level of rnc-era transcript in
the cell (5, 79). A recent detailed analysis of transcription was performed in
RNase III' mutants to avoid complications of autoregulation (79). The most
abundant mc transcript was unprocessed at the 5’ end and spanned the me
and era genes, confirming previous findings (Fig. 1.7) (5, 118). Unexpectedly,
the same study revealed that the me promoter (Prnc) can also drive
transcription through the recO gene to include downstream genes pde and
acpS (78). Previously thought to be independent of the me operon, pde is a
nonessential gene involved in pyroxidine biosynthesis, and acpS encodes holo-
acyl-carrier protein and is essential for cell survival (118). While the pde—acpS

operon can be transcribed independent of RNase 111 from the dex

27

 

 

 

 

 

 

 

 

Prnc dex
[flat-LE ‘ 1"
mp I era 1 mm?) w—l—
mc” { 9
mC' { (70%)
(30%)

G:C
CIG ‘—

..._J L....

Figure 1.7 The rnc operon. The boxes represent genes in the operon as
labeled. The promoters of me (Pmc) and pde (dex) operons are noted with
arrows, and terminator sites are noted with (t). Transcripts seen in wild type

and mc' mutants are noted; thinner lines indicate reduced RNA levels resulting

from negative autoregulation by the enzyme. In the me" background, the large
transcript is expressed to a lesser degree than the shorter mc-era transcript.
The stem loop in the 5’ leader region as the site for autoregulation is shown;

arrows denote RNase III cleavage sites (see also Fig. 1.10).

28

promoter, approximately 70% of pde transcript seen in RNase 111' cells is
driven from the me promoter (78).

In wild type E. coli, the mc—era transcript has been detected by primer-
extension analysis, which is processed at the 5’ end and is present in low
concentrations in the cell due to negative autoregulation (5, 78, 118). The
pde-acpS transcript is plentiful, confirming that transcription of the pde
operon from dexJ is independent of RNase III autoregulation. It may be the
case that any larger rnc-era-recO-pde-acpS transcript species may be in such
low quantities as not to be detectable in wild type strains (78).

Sequence analyses of the me wild type and mutant alleles have revealed
clues about the functional regions of the enzyme (Table 1.1). The original
mc105 mutant harbors a missense mutation that changes a glycine residue to
an aspartate at position 44 (85). Amino acid sequence comparison among
RNase III homologs revealed that this residue lies within a highly conserved
region of ten amino acids (Fig. 2.4). This mutation completely abolishes the
ability of the enzyme to bind and cleave RNase III substrate. Another
interesting mutant, named rnc70, contained a missense mutation at position
117 that changes a glutamate to an alanine (55). In this mutant, RNase III is
able to bind substrate, but has lost the ability to cleave duplex RNA (24).
Additionally, a motif search of the me gene revealed a double-stranded RNA
binding domain (dsRBD) homologous to more than forty other proteins that are
known to bind duplex RNA in a myriad of functions (59). This motif has the

form alBlB2BBCl2.

29

 

mc allele Description Genotype rRNA

 

mc+ wild type allele mc+era+recO+ 16,23,58

mcl4zzATn10 Tn insert in me; Tn-promoter- rnc‘era+ rec0+ 308
driven expression of era, recO '

mc105 Gly44—>Asp44; inhibition of mc’era+ recO+ 3OS
binding and cleavage of signals
mc70 Glu117—9Ala117; binds signal but rnc'era+recO+ 3OS

cannot cleave

Table 1.1 Description of mutant alleles of the rnc gene in E. coli. Compiled

from (24, 55, 85, 118).

RNase III in ribosomal RNA processing

The role of RNase III in the processing of ribosomal RNA has been well
established. The E. coli chromosome contains seven ribosomal RNA operons,
each of which is composed of the genes for the 168, 238, 5S, and spacer
tRNAs. Each operon is transcribed as one large 7000 nt long transcript, which
must be processed to yield individual rRNAs. The role of Ribonuclease III in
ribosomal RNA processing came to light when an E. coli strain lacking RNase III
activity was shown to accumulate a large rRNA species not seen in wild type
strain (30, 88). This rRNA was identified as the 308 precursor transcript of the
entire ribosomal RNA operon. In vitro experiments showed that this 308
precursor could be processed with the addition of purified RNase 111 protein. A
possible mechanism for RNase III processing was theorized when sequence

analysis revealed that the 16S and 238 rRNA sequences are each flanked by

30
inverted complementary sequences within the spacer RNA. The hybridization of

these regions would form a stem-loop structure to effectively “loop out” the 16S
and 23S rRNA, and provide a duplex RNA region for a possible RNase III

cleavage site (9). Analysis of 16S and 238 rRNA species in wild type and RNase

III‘ backgrounds proved that RNase III specifically binds to the duplex RNA of
each stem and cleaves on both sides, releasing the pre-16S and pre-23S rRNAs
as they are transcribed (Fig. 1.9) (38). Other ribonucleases then process the
168 and 238 rRNAs into the mature forms found within the 308 and 508
ribosomal subunits, respectively. E. coli cells lacking RNase 111 do not excise
the normal RNA precursors pre- 168 and pre-23 from nascent rRNA transcripts.
These cells produce instead multiple discreet precursor molecules, such as

178, 188, “p23” (different from mature 23S rRNA), 258 and 308 (Fig. 1.8) (38).

In the case of pre-16S transcript, other ribonucleases in the RNase 111' cell
eventually process the transcript to its mature form, although at a less efficient
rate (111). For 238 however, final maturation is never achieved in the absence
of RNase III (62). The 238 pre-rRNA accumulates unprocessed in the 508
ribosomal subunits and in polysomes and is still able to function; however it
has been speculated that this abnormality may influence translational
efficiency and may account in part for the reduced growth rate seen in RNase
III' mutants (109).

The initial cleavage by RNase III is thought to be the rate limiting step in
ribosomal RNA processing, after which processing occurs very rapidly (63). 308
rRNA precursors are not detectable in RNase 111+ strains, nor are any
processing intermediates or linked molecules such as 16S-spacer-23S, or 238-

SS molecules (37).

31

Wild type RNase 111+: Mutant RNase III“:
p308 p308

m16S m23S lEiS ‘ “p23” or 25S

17s '

*
m16S

. t .

3OS ribosomal 50$ ribosomal 308 ribosomal SOS ribosomal
subunit subunit subunit subunit

Figure 1.8 Predicted pathways for ribosomal RNA processing with or without

a ”

RNase III. Steps carried out by other ribonucleases are indicated by (*). m

indicates mature form, “p” indicates precursor.

Ribosomal RNA operons have been identified in many Streptomyces spp.
and several have been cloned. Most streptomycete genomes contain six rRNA
operons, though S. venezuela is reported to have seven (67). The streptomycete
rRNA genes are ordered 16S-23S-5S as in other eubacteria, however there are
no tRNA-like genes encoded in the spacer regions as seen in other systems (80,
114, 122). Secondary structure analysis determined that the spacer regions
surrounding the 16S and 238 genes do contain regions of complementary
sequence that are predicted to bind to form duplex regions. Though these
regions structurally resemble the 16S and 23S RNase III processing sites
reported for E. coli (Fig. 1.9), no actual processing site has been defined. There
is no obvious sequence similarity between the RNase III processing site of E.

coli and analogous sequence in Streptomyces spp.

32

Figure 1.9 Processing sites for RNase III in E. coli 168 (A) and 23S (B) rRNA
flanking sequences (63). RNase III cleavage releases each rRNA molecule to be

processed further by other ribonucleases.

33

23S

2700 nt

loop

mamm+mwmeAwAmp=e
_ _
CGAAUUGGAGUGUUG

RNase III-—__+

493.3.“ .__:_uuu.__U
_
nquAnU G.AxncuC

AG A U

RNase III

A

awaamw
GhureUnuPe

G

A

RNase III

AGUGCUCACACAGAUUGUCUGAUAGA

_
UCACGGGUGUGUCUAACAGACUAUUU

C

U

wanna
_
ACAAA

\

\.

RNase III

Rnase III

238 rRNA
flanking sequences

16S rRNA
flanking sequences

34
Control of gene expression by RNase III

mRNA decay is one of the principle means by which genes are regulated
in prokaryotes. Even under conditions of continuous gene expression, mRNA
decay exerts a profound effect on the level of gene expression, having a major
impact on the level of protein synthesis (7). The inherent instability of
messenger RNA molecules is crucial for rapid genetic response to a changing
cellular environment. In E. coli mRNA half lives can be as short as 20-30 sec.
or as long as 50 min., with average lifetimes between 2-4 min. (93). The rate of
decay can be modulated in response to environmental and developmental
signals by a few identified ribonucleases. Current research efforts focus on
understanding the impact these enzymes have on the genetic control of cellular
functions.

RNase III is one of three endoribonucleases known to influence gene
expression by modulating mRNA stability and enhancing translation of the
gene. A myriad of mechanisms have been described in which the RNase III
enzyme processes a mRNA to either up- or down-regulate gene expression.

Representative examples of these various mechanisms are given below.

Inhibition of gene expression by 5’ leader processing

As previously mentioned, the me operon is negatively autoregulated by
RNase III. The processing of a stem loop structure found in the 5’ noncoding
region of the me transcript results in reduced transcript levels and reduced
expression of RNase III and Era proteins (Fig. 1.10) (5, 97). RNase III

concentration in the cell is limited (0.01% of total protein synthesis) which is

35

on the same order as other regulatory proteins such as sigma factors (5).
Therefore, this autoregulatory mechanism may serve to coordinate RNase 111
levels in the cell; the presence of a RNase III substrate could titrate the limited
amount of protein away from its autoregulatory. function, which would
ultimately result in increased expression of RNase III (24).

The operon encoding the polynucleotide phosphorylase (PNPase) is also
regulated by RNase III in a similar fashion (Fig. l. 10) (94, 97, 117). PNPase is a

3’-5’ exonuclease that is required for the general degradation of mRNA in

cooperation with RNase II. In a RNase III‘ mutant strain, the amount of pnp
transcript and PNPase protein is increased, and the resulting transcript is
slightly longer than usual, indicating an absence of processing (94). The
mechanism by which RNase III cleavage within the 5’ leader reduces half-life of
the transcript has not been determined. Processing may expose the transcript
to another endonucleolytic enzyme, or an as yet unidentified 5’-3’ exonuclease
(97). Evidence for further degradative processing comes from the discovery of
RNA species containing 5’ ends within the coding sequence for both the me and
pnp operons (5, 24, 116). These intermediate species have been shown to be
RNase III dependent, suggesting that the enzyme initiates further subsequent

decay.

Activation of gene expression by 5’ leader processing

RNase III processing sites have been characterized in several phage
genes. In contrast to the me or pnp operons, cleavage of a RNase III processing
site in the 5’ noncoding region of the transcript for N gene of it phage enhances

the expression of the N protein (Fig. 1.11) (57). In this case however, transcript

P??$QO
CCOJ’OO

3,
3' > D
i???
()6)? Clfiffi
\\§// C)?

O
Cic>c
H II"
cz>

I ll
CZDCZJ’C20

:D'CIJI’CD'O

llll Illlll
OCOQCQCQOCCCQCO

RNaseIII

RNase III

nmmoynpnmyyynymn

5' A A 3'

me gene
5’ leader

36

AGA

0C:
0

’fi???’
comma

UUU UAG

C
G G
GAG GUU

’,,/'

RNase III

RNase III

OQOOO?C3’3’CO>
OOOOCQJ’CCJ’OC

GCAGAGGUUCG AGGAUGCGCAGAAG

pnp gene
5’ leader

Figure 1.10 Inhibition of gene expression via 5’ leader processing. RNase III

recognition signals for (A)

polynucleotide phosphorylase operon.

autoregulation of the me operon, and (B)

In both cases, cleavage by RNase III

initiates decay of the transcript by an as yet unidentified mechanism.

37

Figure 1.11 Enhancement of gene expression through 5’ leader processing.
RNase III processing signals for (A) XN gene and the (B) T7 0.3 gene. As a result
of processing, the ribosomal binding site (RBS; noted in bold type) is made

available for translation initiation.

38

c c
A u
U G
A c
G=C
U-A
G=C
U-A
G=C
U-A
RNase III G=C
\ G=C
A
G=C RNase III
G=C /
U-A
U-A
U-A
C=G
G=C
G U
A A
A A
G=C
A-U
C=G
AGCAUUCAAAG ACAGGAGAAUCCAGAUG
RBS
AN gene
5’ leader
c A
B c .
c=c
u c
A-U
u c
G=C
G=C
G=C
A—U
A-U
c u
u A
u
C G\
A A RNaseIII
A-U
U-A
A-U
c u
G=C
c A
G=C
A-U
U-A
c A
3' GUGCAUGA UAACUGCACGAGGUAACACAAGA_0_§ 5'
RES Gene 0.3
T7 0.3 gene

5’ leader

39
levels of the N gene are not affected by the RNase III processing. Rather,

cleavage of the stem-loop signal by RNase III opens up the ribosomal binding
site to translation initiation which increases the expression of the N protein
(57). N protein, in turn, positively regulates many phage development genes.
Therefore, RNase III cleavage opens an entire cascade of genes to permit A
phage development.

The 0.3 gene of T7 phage is activated in a similar manner through the
enhancement of translation efficiency. Cleavage occurs at only one side of the
stem-loop signal, which releases the ribosomal binding site for translation (Fig.
1.11). In support of this mechanism, the processed transcript has been shown

to bind ribosomes better than unprocessed transcript (29, 31).

Inhibition of gene expression by processing within 3’ noncoding regions
Examples of RNase III processing of phage genes within the 3’ noncoding
region demonstrate two different mechanisms by which RNase III processing
can inhibit gene expression. The lint protein, which encodes the integrase
enzyme, can be expressed from two different promoters, P1, and P1 (for
comprehensive review of int regulation, see (41)). Transcription from the P1
promoter terminates at terminator T1 and translation occurs normally.
However, transcription from the PL promoter, aided by the antiterminator N
protein, proceeds past T1 and transcribes the distal sib region (108). sib forms
an alternative stem loop structure that is recognized and cleaved by RNase 111
(Fig. 1.12). This processing of the sib stern loop leaves a 3’ end which is then
open to degradation by the 3’-5’ exoribonuclease polynucleotide phosphorylase

(PNPase). Thus transcription of the int gene from the PL promoter leads to

40

inhibition of gene expression through RNase III cleavage and subsequent
degradation of the transcript.

In T7 phage, the expression of early genes 1.1 and 1.2 is also inhibited
by RNase 111, but via a different mechanism. The 1.1 and 1.2 genes are part of
a polycistronic transcriptional unit that is processed within intergenic regions
by RNase III. The 1.1 and 1.2 genes are separated from the downstream 1.3
gene by a stem loop designated R5 (Fig. 1.12). Unlike other signals in the T7
transcript, RNase III can cleave the R5 stem loop on both the proximal side
(R5a) and the distal side (R5b) (100). Approximately 40% of the 1.1-1.2
transcripts are cut at R5a, and 60% are cut at R5b which results in a longer
transcript by an extra 29 nucleotides (107). The shorter R5a transcript
expresses the 1.1 and 1.2 genes efficiently, but the longer transcript has a
much reduced level of expression for both genes. This inefficient translation of
the R5b transcript results from the ability of the extra 29 nucleotides to bind to
a complementary region in the 5’ end of the 1.1 gene containing the ribosome
binding site (107). This pairing blocks translation initiation of 1.1 and 1.2,
since they are translationally coupled. Thus the particular cleavage product of
the RNase III enzyme determines the translational efficiency of these particular

genes.

Enhancing gene expression by processing within the 3’ noncoding region
The earliest example of mRNA processing by RNase III described the

processing of intergenic regions of the T7 early gene polycistronic message.

The resulting monocistronic messages are very stable, with half-lives up to 20

min. While the typical RNase III cleavage results in a double strand break,

41

Figure 1.12 RNase III processing within the 3’ noncoding region. (A) The sib
processing site of lint that forms upon transcription from the PL promoter.
Processing results in reduced mRNA stability due to 3’-5’ exonucleolytic
degradation. (B) The R5 processing site of T7 1.1 and 1.2 genes. Cleavage at
the R5b site (as opposed to the R5a site) allows binding of the 29+ nts to the 5’
leader region of gene 1.1 resulting in impaired translation initiation. (C) RNase
III processing enhances the stability of the T7 0.7 gene by leaving a stable
hairpin structure at the 3’ end of the mRNA. This hairpin structure, and
possibly the presence of the RNase III enzyme itself, blocks exonucleolytic

degradation of the transcript.

42

C
C
C‘.

>
m

U G U G
A-U C=G
G=C U-A
U U C=G
G U G U
G=C C=G
RNase III A-U U G
\ A-U G=C
C=G G=C
G=C A-U
C=G RNase III A-u
G=C ‘\\\\ (R5a) U-A
A-U U G
U-A RNase III C U
U-A G=C '\
A-U U-A RNase III
c U A-u (R5b)
G U A-U
A-U C U
G U A A
A-U G A
C=G G=C
A—U G=C
5' CUGUA CAUCA 3' A A
U-A
lint - Slb a:
3’ noncoding region 5' GGAAGULAUACGACUCAG GGAGAUAAACAUtagg
Gene 1.2 Gene 1.3
T71.1, 1,2 genes
G C 3’ R5 cleavage srte
C u G
C=G
U G
A-U
C=G
u G
G=C
G=C
A-U
C=G
A A
U A
U
U-A
C=G \
U G RNase III
A-u
U-A
U c
C=G
U-A
G U
A-U
U U
3' UGGGCIfl ACUAAGUGGAAGAGGCACUAAgJa 5'
Gene 0.7 RBS Gene 1
T7 0.7 gene

3’ noncoding region

43
most of the T7 early genes are cleaved by a single stranded break at the distal

side of the stem-loop region (29, 107). The RNase III signal for T7 0.7 gene is
shown in Figure 1.12 as an example. RNase III cleavage leaves a hairpin
structure at the 3’ end of the transcript that has been proposed to impart
stability by blocking the message from 3’-5’ exonucleolytic digestion (28).
Additionally it is possible that the RNase 111 may remain bound to the resulting

stem loop and may itself block exonucleolytic degradation.

Control of gene expression without processing

The expression of the cm gene of phage A is enhanced by the presence of
RNase Ill, yet the transcript is not cleaved at all (3). Rather, RNase III appears
to stabilize one favorable conformation by binding at the 5’ end of the transcript
to open up the ribosomal binding site thereby aiding in translation initiation
(Fig. 1.13). In the absence of RNase III, translation is inhibited and most
transcripts are found in the obstructive conformation “cm OFF” (2, 3).

As discussed previously, expression of the lint gene is inhibited by
RNase 111 when it is transcribed from the PL promoter through cleavage of the
sib site and subsequent exonucleolytic degradation. During later stages of A
development, int is transcribed from the P1 promoter and terminates at the
Rho-independent terminator, T; (Fig. 1.13). RNase 111 does not process the T1
stem loop, which is thought to protect the transcript from PNPase, the same

exoribonuclease that degrades the PL-int-sib transcript (41). However, in an

RNase III‘ mutant, int expression is reduced from the Print-T1 transcript. No
possible explanations exist for this dependence on RNase III for optimal

expression. First, RNase III negatively regulates PNPase, so that in an

44

Figure 1.13 Enhancement of gene expression without transcript processing.
(A) Two conformations of the CHI gene. In the presence of RNase III the
ribosomal binding site and the start codon (boldface) are not obscured by
secondary structure. (B) The T1 terminator formed when lint is transcribed
from the P1 promoter. (RNase III) signifies RNase III cleavage sites in vitro

under excess enzyme concentrations.

45

O
3’

IIIPIPI’CC
OOOCCDO
C1
0

5' AAAUAAGGAGCACACCAUG=

UCCG 3'

-e-—-————-

00>?CW
OOCCOC

-—-————-¢»
RNase III

C
QQOCQOOOC

II
I!

Oil)?
OOC.‘

OOOOCDQGIPZ’OOCCJ’

5' AAAU CCG 3'

cIH OFF

C".
C’.
C2

C2

OBISC:
OCC)

(3
C‘.

(RNase III)

\\A

n
CS’ID'GOOOQCCOC

‘K\

(RNase III)

K’CCD’OOCI'llOZ’IDOO

5' CUGUAACAGAGC UUUUU 3'

TI terminator of lint

46
RNase III‘ mutant, increased PNPase could accelerate degradation of the
transcript. Alternatively, the RNase 111 may be able to bind to the T1 terminator
without cutting it, thereby protecting it from PNPase attack. This possibility is
supported by the fact that RNase III, in excess concentrations, is capable of
cleaving T1 in vitro, indicating that binding to T1 is possible (108). While neither
model can be favored over the other, it is clear that RNase III is intimately

involved in the regulation of the int gene under a variety of conditions.

The role of RNase III in antisense RNA control

A typical example of antisense control involves a gene that is transcribed
from both the sense and antisense strands. Commonly the antisense RNA
inhibits translation of the sense RNA by forming a duplex at the ribosomal
binding site. In several cases, RNase III has been shown to participate in this
control through cleavage of the sensezantisense duplex. One example in E. coli
involves the RepA protein which is required for the replication of the R1
plasmid. An antisense RNA, copA, inhibits R1 replication by binding to copT,
the leader region of the repA transcript (8). This duplex is cleaved by RNase III,

which results in a marked decrease in repA expression compared to an RNase

III‘ mutant control. It has yet to be determined whether the reduced
expression is due to inefficient translation or mRNA decay.

In l phage, the CH gene is involved in the delicate balance between
lysogenic and lytic development. One level of control involves the antisense
RNA OOP, which is complementary to the 3’ end of the all coding region (65).

Formation of the duplex leads to RNase III cleavage and prevents complete

47

translation of the all gene. In a RNase III' mutant, the COP RNA has no effect
on cII expression, indicating that it is the cleavage event, and not the binding of
the antisense RNA, that affects the expression level of the protein. Thus RNase
III processing directly inactivates cII expression by a process that is dependent

on the presence of the COP antisense RNA (65).

Ribonuclease III in Other Systems

Recently, several RNase III homologs have been reported in other
bacteria and in the yeast Schizosacchromyces pombe. While only a few
homologs have been functionally characterized, it appears as though RNase III

has multiple functions in other systems as seen in E. coli.

Bacillus subtilis RNase III (bsRNase III)

Transcription analysis of the B. subtilis phage SP82 demonstrated that in
vivo transcripts of the early genes were considerably shorter than those
transcribed in vitro. This suggested the possibility that the transcripts were
being post-transcriptionally processed. Studies in uninfected strains proved
that the processing function was produced by the host and not the phage (27).
Protein extracts were purified for this processing function and the resulting
protein was characterized as a RNase III homolog (83, 89, 90). The B. subtilis
RNase III (bsRNase III) proved similar to RNase III of E. coli in many respects. It
was double strand RNA specific, and processed poly(l)-poly(C) and ribosomal

RNA. However, there were notable differences. The bsRNase III appeared to be

48

a monomer 27-29 kDa in size. The bsRNase III was not able to cleave poly(A)-
poly(U) RNA in vitro. Comparative studies of signal recognition revealed that
the E. coli RNase 111 could not process the SP82 phage transcript, but the
bsRNase III was able to cleave the T7 1.1 gene signal at the same site as RNase
III (83). Neither enzyme was able to process the rRNA signal of the other. The
bsRNase III gene was cloned and sequenced, and showed 36 % homology to the
E. coli enzyme. Residues and regions that had proved to be functionally
significant in E. coli through mutational analysis (see Table l) were strictly

conserved in the bsRNase III homolog.

RNase III in Coxiella burnetii (chNase III)

Although Coxiella does not produce a capsule as part of its pathogenic
life cycle, a genomic fragment was isolated which caused capsule synthesis
when cloned into E. coli resulting in a mucoid phenotype. In an effort to
identify genes that may suppress capsule synthesis in C. bumetii, a plasmid
clone was isolated that suppressed the mucoid phenotype in the E. coli mutant
(132). Sequence analysis of the cloned insert revealed homologous genes of the
rnc-era-recO operon of E. coli. Sequence identities between the genes of E. coli
and C. bumetii were me (49.3%), era (51.2%), and recO (37.4%), indicating a
high degree of conservation across the entire operon. When the E. coli mc gene
was expressed in high copy in the mucoid mutant, the mucoid phenotype was
suppressed, indicating that the me gene is involved in capsule synthesis. The

mucoid phenotype was not suppressed when either the Coxiella me or the

49

E. coli me were expressed in low copy. Deletion analysis showed that era and
recO were not involved in the suppressive function (132).

Additional functional comparisons showed that the chNase III was
capable of complementing E. coli mc‘ mutants. Also, chNase III was able to

stimulate lN gene expression, as seen for E. coli RNase 111.

An RNase III homolog in Schizosacchromyces pombe

A gene with homology to RNase III of E. coli was found to block
conjugation and sporulation when overexpressed in S. pombe (130). The gene,
named pacl, had no effect on vegetative growth in high copy, yet inhibited the
expression of certain genes related to mating and meiosis. Sequence analysis
revealed that the pad gene was 363 amino acids in length, and 230 amino
acids of the C-terminus showed homology to RNase III of E. coli (54). Unlike
me in E. coli, pacl is essential for survival of the yeast. The Pacl protein was
isolated and was able to degrade duplex RNA in vitro. A Site directed
mutagenesis revealed that the analogous residues found to be important to E.
coli RNase 111 function, the glycine44 of mc105 and glutamate117 of mc70 (Table

1.1) were also required for function in Pacl mating inhibition (103).

Other RNase III Homologs

Database searches revealed putative RNase III homologs in
Mycobacterium tuberculosis, Haemophilus influenzae, and Mycoplasma
genitalium. These genes are the result of total genome sequencing, and to date

no functional analysis of these genes has been reported.

10.

11.

50
Literature Cited

Adamidis, T., P. Riggle, and W. Champness. 1990. Mutations in a new
Streptomyces coelicolor locus which globally block antibiotic biosynthesis
but not sporulation. J Bacteriol. 172(6):2962-9._

Altuvia, S., D. Kornitzer, S. Kobi, and A. B. Oppenheim. 1991.
Functional and structural elements of the mRNA of the CHI gene of
bacteriophage lambda. J Mol Biol. 218(4):723-33.

Altuvia, S., H. Locker-Giladi, S. Koby, O. Ben-Nun, and A. B.
Oppenheim. 1987. RNase III stimulates the translation of the CHI gene of
bacteriophage lambda. Proc Natl Acad Sci U S A. 84(18):6511-5.

Apirion, D., and N. Watson. 1975. Mapping and characterization of a
mutation in Escherichia coli that reduces the level of ribonuclease III
specific for double-stranded ribonucleic acid. J Bacteriol. 124(1):317-24.

Bardwell, J. C., P. Regnier, S. M. Chen, Y. Nakamura, M. Grunberg-
Manago, and D. L. Court. 1989. Autoregulation of RNase III operon by
mRNA processing. Embo J. 8(11):3401-7.

Bartel, P. L., C. B. Zhu, J. S. Lampel, D. C. Dosch, N. C. Connors, W.
R. Strohl, J. M. Beale, Jr., and H. G. Floss. 1990. Biosynthesis of
anthraquinones by interspecies cloning of actinorhodin biosynthesis

genes in streptomycetes: clarification of actinorhodin gene functions. J
Bacteriol. 172(9):48l6-26.

Belasco, J. G. 1993. mRNA degradation in prokaryotic cells: an
overview, p. 3-12. In J. G. Belasco and G. Brawerman (ed.), Control of
messenger RNA stability. Academic Press, San Diego.

Blomberg, P., E. G. Wagner, and K. Nordstrom. 1990. Control of
replication of plasmid R1: the duplex between the antisense RNA, CopA,
and its target, CopT, is processed specifically in vivo and in vitro by
RNase III. Embo J. 9(7):233l-40.

Bram, R. J ., R. A. Young, and J. A. Steitz. 1980. The ribonuclease 111
site flanking 23S sequences in the 308 ribosomal precursor RNA of E.
coli. Cell. 19(2):393-401.

Brian, P., T. Anderson, and W. C. Champness. Unpublished results.

Brian, P., P. J. Riggle, R. A. Santos, and W. C. Champness. 1996.
Global negative regulation of Streptomyces coelicolor antibiotic synthesis

mediated by an absA-encoded putative signal transduction system. J
Bacteriol. 178(11):3221-31.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

51

Brown, G., B. Price, P. Riggle, and W. Champness. 1997. In
preparation..

Castro, A. J. 1967. Antimalarial activity of prodigiosin. Nature.
213(79):903-4.

Champness, W., P. Riggle, T. Adamidis, and P. Vandervere. 1992.
Identification of Streptomyces coelicolor genes involved in regulation of
antibiotic synthesis. Gene. 115(1-2):55-60.

Champness, W. C. 1988. New loci required for Streptomyces coelicolor
morphological and physiological differentiation. J Bacteriol.
170(3): 1 168-74.

Chang, H. M., M. Y. Chen, Y. T. Shieh, M. J. Bibb, and C. W. Chen.
1996. The cutRS signal transduction system of Streptomyces lividans

represses the biosynthesis of the polyketide antibiotic actinorhodin. Mol
Microbiol. 21(5): 1075-85.

Chater, K. F. 1992. Genetic regulation of secondary metabolic pathways
in Streptomyces. Ciba Found Symp. 171:144-56; discussion 156-62.

Chater, K. F. 1984. Morphological and Physiological Differentiation in
Streptomyces, p. 89-115. In R. Losick and L. Shapiro (ed.), Microbial
Development. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Chater, K. F., and C. J. Bruton. 1985. Resistance, regulatory and
production genes for the antibiotic methylenomycin are clustered. Embo
J. 4(7):1893-7.

Chater, K. F., C. J. Bruton, K. A. Plaskitt, M. J. Buttner, C. Mendez,
and J. D. Helmann. 1989. The developmental fate of S. coelicolor hyphae
depends upon a gene product homologous with the motility sigma factor
of B. subtilis. Cell. 59(1):l33-43.

Chelladurai, B. 8., H. Li, and A. W. Nicholson. 1991. A conserved
sequence element in ribonuclease III processing signals is not required
for accurate in vitro enzymatic cleavage. Nucleic Acids Res. 19(8):1759-
66.

Coco, E. A., K. E. Narva, and J. S. Feitelson. 1991. New classes of
Streptomyces coelicolor A3(2) mutants blocked in undecylprodigiosin
(Red) biosynthesis. Mol Gen Genet. 227(1):28-32.

Cole, 8. P., B. A. Rudd, D. A. I-Iopwood, C. J. Chang, and H. G. Floss.
1987. Biosynthesis of the antibiotic actinorhodin. Analysis of blocked
mutants of Streptomyces coelicolor. J Antibiot (Tokyo). 40(3):340-7.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

52

Court, D. 1993. RNA processing and degradation by RNase III, p. 71-
116. In J. G. Belasco and G. Brawerman (ed.), Control of messenger RNA
stability. Academic Press, San Diego.

Court, D., T. F. Huang, and A. B. Oppenheim. 1983. Deletion analysis
of the retroregulatory site for the lambda int gene. J Mol Biol.
166(2):233-40.

Crouch, R. J. 1974. Ribonuclease 3 does not degrade deoxyribonucleic
acid-ribonucleic acid hybrids. J Biol Chem. 249(4):1314-6.

Downard, J. 8., and H. R. Whiteley. 1981. Early RNAs in SP82- and
SP01-infected Bacillus subtilis may be processed. J Virol. 37(3):]075-8.

Dunn, J. J., and F. W. Studier. 1983. Complete nucleotide sequence of
bacteriophage T7 DNA and the locations of T7 genetic elements. J Mol
Biol. 166(4):477-535.

Dunn, J. J., and F. W. Studier. 197 5. Effect of RNase III, cleavage on
translation of bacteriophage T7 messenger RNAs. J Mol Biol. 99(3):487-
99.

Dunn, J. J., and F. W. Studier. 1973. T7 early RNAs and Escherichia
coli ribosomal RNAs are cut from large precursor RNAs in vivo by
ribonuclease 3. Proc Natl Acad Sci U S A. 70(12):3296-3300.

Dunn, J. J., and F. W. Studier. 1973. T7 early RNAs are generated by
site-specific cleavages. Proc Natl Acad Sci U S A. 70(5):1559-63.

Feitelson, J. 8., and D. A. Hopwood. 1983. Cloning of a Streptomyces
gene for an O-methyltransferase involved in antibiotic biosynthesis. Mol
Gen Genet. 190(3):394-8.

Feitelson, J. 8., F. Malpartida, and D. A. Hopwood. 1985. Genetic and
biochemical characterization of the red gene cluster of Streptomyces
coelicolor A3(2). J Gen Microbiol. 131(Pt 9):2431-41.

Fernandez-Moreno, M. A., J. L. Caballero, D. A. Hopwood, and F.
Malpartida. 1991. The act cluster contains regulatory and antibiotic
export genes, direct targets for translational control by the bldA tRNA
gene of Streptomyces. Cell. 66(4):769-80.

Fernandez-Moreno, M. A., A. J. Martin-Triana, E. Martinez, J. Niemi,
H. M. Kieser, D. A. Hopwood, and F. Malpartida. 1992. abaA, a new
pleiotropic regulatory locus for antibiotic production in Streptomyces
coelicolor. J Bacteriol. 174(9):2958-67.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

53

Floriano, B., and M. Bibb. 1996. ast is a pleiotropic but conditionally
required regulatory gene for antibiotic production in Streptomyces
coelicolor A3(2). Mol Microbiol. 21(2):385-96.

Gegenheimer, P., and D. Apirion. 1981. Processing of procaryotic
ribonucleic acid. Microbiol Rev. 45(4):502-41.

Gegenheimer, P., N. Watson, and D. Apirion. .1977. Multiple pathways
for primary processing of ribosomal RNA in Escherichia coli. J Biol Chem.
252(9):3064-73.

Gitelman, D. R., and D. Apirion. 1980. The synthesis of some proteins

is affected in RNA processing mutants of Escherichia coli. Biochem
Biophys Res Commun. 96(3):1063-70.

Gramajo, H. C., E. Takano, and M. J. Bibb. 1993. Stationary-phase
production of the antibiotic actinorhodin in Streptomyces coelicolor A3(2)
is transcriptionally regulated. Mol Microbiol. 7 (6):837-45.

Guameros, G. 1988. Retroregulation of bacteriophage lambda int gene
expression, p. 1-19. In A. Clarke, R. W. Compas, M. Cooper, H. Eisen, H.
Goebel, F. Koprowski, M. Melchers, M. Oldstone, P. K. Vogt, H. Wagner,
and 1. Wilson (ed.), Current Topics in Microbiology. Springer-Verlag,
Berlin.

Guijarro, J., R. Santamaria, A. Schauer, and R. Losick. 1988.
Promoter determining the timing and spatial localization of transcription

of a cloned Streptomyces coelicolor gene encoding a spore- associated
polypeptide. J Bacteriol. 170(4):]895-901. .

Guthrie, E. P. Personal communication.

Haneishi, T., A. Terahara, K. Hamano, and M. Aral. 1974. New
antibiotics, methylenomycins A and B. 3. Chemical modifications of
methylenomycin A and structure-activity correlations in
methylenomycins. J Antibiot (Tokyo). 27 (6):400-7.

Harashima, K., T. Tsuchida, T. Tanaka, and J. Nagatsu. 1967 .
Prodigiosin-25C. Isolation and the chemical structure. Agric Biol Chem.
31:481-489.

Hobbs, G., A. I. Obanye, J. Petty, J. C. Mason, E. Barratt, D. C.
Gardner, F. Flett, C. P. Smith, P. Broda, and 8. G. Oliver. 1992. An
integrated approach to studying regulation of production of the
antibiotic methylenomycin by Streptomyces coelicolor A3(2). J Bacteriol.
174(5): 1487-94.

47.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

54

Hopwood, D. A. 1959. Linkage and the mechanism of recombination in
Streptomyces coelicolor. Ann N. Y. Acad Sci. 81:887-898.

Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton, H.
M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward, and H. Schrempf.
1985. Genetic Manipulation of Streptomyces: A Laboratory Manual, first
ed. The John Innes Foundation, Norwich, UK. .

Hopwood, D. A., K. F. Chater, and M. J. Bibb. 1995. Genetics of
Antibiotic Production in Streptomyces coelicolor A3(2), p. 65-102. In L. C.
Vining and C. Stuttard (ed.), Genetics and Biochemistry of Antibiotic
Production. Butterworth-Heinemann, Newton, MA.

Hopwood, D. A., and D. H. Sherman. 1990. Molecular genetics of
polyketides and its comparison to fatty acid biosynthesis. Annu Rev
Genet. 24:37-66.

Hopwood, D. A., and H. M. Wright. 1983. CDA is a new
chromosomally-determined antibiotic from Streptomyces coelicolor A3(2).
J Gen Microbiol. 129(Pt 12):3575-9.

Horinouchi, 8., and T. Beppu. 1992. Regulation of secondary
metabolism and cell differentiation in Streptomyces: A-factor as a
microbial hormone and the Ast protein as a component of a two-
component regulatory system. Gene. 115(1-2): 167-72.

Horinouchi, 8., M. Kito, M. Nishiyama, K. Furuya, 8. K. Hong, K.
Miyake, and T. Beppu. 1990. Primary structure of Ast, a global
regulatory protein for secondary metabolite formation in Streptomyces
coelicolor A3(2). Gene. 95(1):49-56.

Iino, Y., A. Sugimoto, and M. Yamamoto. 1991. S. pombe pac1+,
whose overexpression inhibits sexual development, encodes a
ribonuclease III-like RNase. Embo J. 10(1):221-6.

Inada, T., K. Kawakami, 8. M. Chen, H. E. Takiff, D. L. Court, and Y.
Nakamura. 1989. Temperature-sensitive lethal mutant of era, a G
protein in Escherichia coli. J Bacteriol. 171(9):5017-24.

Ishizuka, H., 8. Horinouchi, H. M. Kieser, D. A. Hopwood, and T.
Beppu. 1992. A putative two-component regulatory system involved in
secondary metabolism in Streptomyces spp. J Bacteriol. 174(23):7585-
94.

Kameyama, L., L. Fernandez, D. L. Court, and G. Guarneros. 1991.
RNaselll activation of bacteriophage lambda N synthesis. Mol Microbiol.
5(12):2953-63.

58.

59.

60.

61.

62.

63.

64.

65.

66.

67.

68.

55

Kelemen, G. H., G. L. Brown, J. Kormanec, L. Potuckova, K. F.
Chater, and M. J. Buttner. 1996. The positions of the sigma-factor
genes, whiG and sigF, in the hierarchy controlling the development of
spore chains in the aerial hyphae of Streptomyces coelicolor A3(2). Mol
Microbiol. 21(3):593-603.

Kharrat, A., M. J. Macias, T. J. Gibson, M. Nilges, and A. Pastore.
1995. Structure of the dsRNA binding domain of E. coli RNase III. Embo
J. 14(14):3572-84.

Kieser, H. M., T. Kieser, and D. A. Hopwood. 1992. A combined
genetic and physical map of the Streptomyces coelicolor A3(2)
chromosome. J Bacteriol. 174(17):5496-507.

Kindler, P., T. U. Keil, and P. H. Hofschneider. 1973. Isolation and
Characterization of a Ribonuclease III Deficient Mutant of Escherichia
coli. Molec. Gen. Genet. 126:53-69.

King, T. C., R. Sirdeshmukh, and D. 8chlessinger. 1984. RNase III
cleavage is obligate for maturation but not for function of Escherichia coli
pre-23S rRNA. Proc Natl Acad Sci U S A. 81(1):185-8.

King, T. C., R. Sirdeskmukh, and D. 8chlessinger. 1986. Nucleolytic
processing of ribonucleic acid transcripts in procaryotes. Microbiol Rev.
50(4):428-5 1.

Kirby, R. ., and D. A. Hopwood. 1977. Genetic determination of
methylenomycin synthesis by the SCPl plasmid of Streptomyces
coelicolor A3(2). J Gen Microbiol. 98(1): 239- 52.

Krinke, L., M. Mahoney, and D. L. Wulff. 1991. The role of the OOP
antisense RNA in coliphage lambda development. Mol Microbiol.
5(5):1265-72.

Krinke, L., and D. L. Wulff. 1990. The cleavage specificity of RNase III.
Nucleic Acids Res. 18(16):4809-15.

La Farina, M., 8. Stira, R. Mancuso, and C. Grisanti. 1996.
Characterization of Streptomyces venezuelae ATCC 10595 rRNA gene
clusters and cloning of rmA. J Bacteriol. 178(5):l480-3.

Lakey, J. H., E. J. Lea, B. A. Rudd, H. M. Wright, and D. A. Hopwood.
1983. A new channel-forming antibiotic from Streptomyces coelicolor
A3(2) which requires calcium for its activity. J Gen Microbiol. 129(Pt
12):3565-73.

69.

70.

71.

72.

73.

74.

75.

76.

77.

78.

79.

56

Lawlor, E. J ., H. A. Baylis, and K. F. Chater. 1987. Pleiotropic
morphological and antibiotic deficiencies result from mutations in a gene
encoding a tRNA-like product in Streptomyces coelicolor A3(2). Genes
Dev. 1(10):1305-10.

Leskiw, B. K., M. J. Bibb, and K. F. Chater. 1991. The use of a rare
codon specifically during development? Mol Microbiol. 5(12):2861-7.

Leskiw, B. K., E. J. Lawlor, J. M. Fernandez-Abalos, and K. F.
Chater. 1991. TTA codons in some genes prevent their expression in a

class of developmental, antibiotic-negative, Streptomyces mutants. Proc
Natl Acad Sci U S A. 88(6):2461-5.

Lcskiw, B. K., R. Mah, E. J. Lawlor, and K. F. Chater. 1993.
Accumulation of bldA-specified tRNA is temporally regulated in
Streptomyces coelicolor A3(2). J Bacteriol. 175(7): 1995-2005.

Lin, Y. 8., H. M. Kieser, D. A. Hopwood, and C. W. Chen. 1993. The
chromosomal DNA of Streptomyces lividans 66 is linear. Mol Microbiol.
10(5):923-33.

Malpartida, F., and D. A. Hopwood. 1984. Molecular cloning of the
whole biosynthetic pathway of a Streptomyces antibiotic and its
expression in a heterologous host. Nature. 309(5967):462-4.

Malpartida, F., and D. A. Hopwood. 1986. Physical and genetic
characterisation of the gene cluster for the antibiotic actinorhodin in
Streptomyces coelicolor A3(2). Mol Gen Genet. 205(1):66-73.

Malpartida, F., J. Niemi, R. Navarrete, and D. A. Hopwood. 1990.
Cloning and expression in a heterologous host of the complete set of
genes for biosynthesis of the Streptomyces coelicolor antibiotic
undecylprodigiosin. Gene. 93(1):91-9.

March, P. E., J. Ahnn, and M. Inouye. 1985. The DNA sequence of the
gene (rnc) encoding ribonuclease III of Escherichia coli. Nucleic Acids Res.
13(13):4677-85.

Matsunaga, J., M. Dyer, E. L. 8imons, and R. W. 8imons. 1996.
Expression and regulation of the me and pde operons of Escherichia
coli. Mol Microbiol. 22(5):977-89.

Matsunaga, J., E. L. 8imons. and R. W. 8imons. 1996. RNase III
autoregulation: structure and function of rncO, the posttranscriptional
”operator". Rna. 2(12): 1228-40.

80.

81.

82.

83.

84.

85.

86.

87.

88.

89.

90.

57

Mehling, A., U. F. Wehmeier, and W. Piepersberg. 1995. Nucleotide
sequences of streptomycete 16S ribosomal DNA: towards a specific
identification system for streptomycetes using PCR. Microbiology. 141(Pt
9):2139-47.

Mendez, C., and K. F. Chater. 1987 . Cloning of whiG, a gene critical for
sporulation of Streptomyces coelicolor A3(2). J Bacteriol. 169(12):5715-
20.

Merrick, M. J. 1976. A morphological and genetic mapping study of bald
colony mutants of Streptomyces coelicolor. J Gen Microbiol. 96(2):299-
3 1 5.

Mitra, 8., and D. H. Bechhofer. 1994. Substrate specificity of an RNase
III-like activity from Bacillus subtilis. J Biol Chem. 269(50):31450-6.

Narva, K. E., and J. 8. Feitelson. 1990. Nucleotide sequence and

transcriptional analysis of the redD locus of Streptomyces coelicolor
A3(2). J Bacteriol. I72(l):326-33.

Nashimoto, H., and H. Uchida. 1985. DNA sequencing of the
Escherichia coli ribonuclease III gene and its mutations. Mol Gen Genet.
201(1):25-9.

Neal, R. J., and K. F. Chater. 1991. Bidirectional promoter and
terminator regions bracket mmr, a resistance gene embedded in the

Streptomyces coelicolor A3(2) gene cluster encoding methylenomycin
production. Gene. 100:75-83.

Nicholson, A. W., K. R. Niebling, P. L. McOsker, and H. D. Robertson.
1988. Accurate in vitro cleavage by RNase III of phosphorothioate-
substituted RNA processing signals in bacteriophage T7 early mRNA.
Nucleic Acids Res. 16(4):1577-91.

Nikolaev, N., L. 8ilengo, and D. 8chlessinger. 1973. Synthesis of a
large precursor to ribosomal RNA in a mutant of Escherichia coli. Proc
Natl Acad Sci USA. 70(12):3361-3365.

Panganiban, A. T., and H. R. Whiteley. 1983. Bacillus subtilis RNAase
III cleavage sites in phage SP82 early mRNA. Cell. 33(3):907-13.

Panganiban, A. T., and H. R. Whiteley. 1983. Purification and
properties of a new Bacillus subtilis RNA processing enzyme. Cleavage of
phage SP82 mRNA and Bacillus subtilis precursor rRNA. J Biol Chem.
258(20): 12487 -93.

91.

92.

93.

94.

95.

96.

97.

98.

99.

100.

101.

102.

58

Parkinson, J. 8., and E. C. Kofoid. 1992. Communication modules in
bacterial signaling proteins. Annu Rev Genet. 26:71-112.

Passantino, R., A. M. Puglia, and K. F. Chater. 1991. Additional copies
of the actll regulatory gene induce actinorhodin production in pleiotropic
bld mutants of Streptomyces coelicolor A3(2). J Gen Microbial. 137:2059-
2064. .

Pedersen, 8., and S. Reeh. 1978. Functional mRNA half lives in E. coli.
Mol Gen Genet. 166(3):329-36.

Portier, C., L. Dondon, M. Grunberg-Manago, and P. Regnier. 1987 .
The first step in the functional inactivation of the Escherichia coli

polynucleotide phosphorylase messenger is a ribonuclease III processing
at the 5' end. Embo J. 6(7):2165-70.

Potuckova, L., G. H. Kelemen, K. C. Findlay, M. A. Lonetto, M. J.
Buttner, and J. Kormanec. 1995. A new RNA polymerase sigma factor,
sigma F, is required for the late stages of morphological differentiation in
Streptomyces spp. Mal Microbial. 17(1):37-48.

Redenbach, M., H. M. Kieser, D. Denapaite, A. Eichner, J. Cullum, H.
Kinashi, and D. A. Hopwood. 1996. A set of ordered casmids and a

detailed genetic and physical map for the 8 Mb Streptomyces coelicolor
A3(2) chromosome. Mol Microbiol. 21(1):77-96.

Regnier, P., and M. Grunberg-Manago. 1990. RNase III cleavages in
nan-coding leaders of Escherichia coli transcripts control mRNA stability
and genetic expression. Biachimie. 72(11):825-34.

Revill, W. P., M. J. Bibb, and D. A. Hopwood. 1996. Relationships
between fatty acid and polyketide synthases from Streptomyces coelicolor
A3(2): characterization of the fatty acid synthase acyl carrier protein. J
Bacteriol. 178(19):5660-7.

Riggle, P., G. Brown, B. 8. Price, and W. C. Champness. 1997.
Multicopy inhibition of global antibiotic production in Streptomyces
coelicolor by the mia locus. In preparation.

Robertson, H. D., E. Dickson, and J. J. Dunn. 1977. A nucleotide
sequence from a ribonuclease III processing site in bacteriophage T7
RNA. Proc Natl Acad Sci U S A. 74(3):822-6.

Robertson, H. D., and J. J. Dunn. 1975. Ribonucleic acid processing
activity of Escherichia coli ribonuclease 111. J Biol Chem. 250(8):3050-6.

Robertson, H. D., R. E. Webster, and N. D. Zinder. 1968. Purification
and properties of ribonuclease III from Escherichia coli. J Biol Chem.
243(1):82-9 1.

103.

104.

105.

106.

107.

108.

109.

110.

111.

112.

113.

114.

59

Rotondo, G., M. Gillespie, and D. Frcndewey. 1995. Rescue of the
fission yeast snRNA synthesis mutant snml by overexpression of the
double-strand-specific Pacl ribonuclease. Mol Gen Genet. 247(6):698-
708.

Rudd, B. A., and D. A. Hopwood. 1979. Genetics of actinorhodin
biosynthesis by Streptomyces coelicolor A3(2). J Gen Microbial.
114(1):35-43.

Rudd, B. A., and D. A. Hopwood. 1980. A pigmented mycelial antibiotic

in Streptomyces coelicolor. control by a chromosomal gene cluster. J Gen
Microbial. 119(Pt 2):333-40.

Ryding, J ., N. Hartley, C. Whatling, and K. Chater. 1996. Presented at
the Genetica and Molecular Biology of Industrial Microorganisms,
Bloomington, IL, October 20-24, 1996.

Saito, H., and C. C. Richardson. 1981. Processing of mRNA by
ribonuclease III regulates expression of gene 1.2 of bacteriophage T7.
Cell. 27(3 Pt 2):533-42.

Schmeissner, U., K. McKenney, M. Rosenberg, and D. Court. 1984.
Transcription terminator involved in the expression of the int gene of
phage lambda. Gene. 28(3):343-50.

Sirdeshmukh, R., and D. 8chlessinger. 1985. Ordered processing of
Escherichia coli 23S rRNA in vitro. Nucleic Acids Res. 13(14):5041-54.

Soliveri, J., E. Vijgenboom, C. Granozzi, K. A. Plaskitt, and K. F.
Chater. 1993. Functional and evolutionary implications of a survey of

various actinomycetes for homologues of two Streptomyces coelicolor
sporulation genes. J Gen Microbiol. 139(Pt 1 1):2569-7 8.

Srivastava, A. K., and D. 8chlessinger. 1989. Processing pathway of
Escherichia coli 16S precursor rRNA. Nucleic Acids Res. 17(4): 1649-63.

Studier, F. W. 1975. Genetic mapping of a mutation that causes
ribonucleases III deficiency in Escherichia coli. J Bacterial. 124(1):307-
16.

Stutzman-Engwall, K. J., 8. L. Otten, and C. R. Hutchinson. 1992.
Regulation of secondary metabolism in Streptomyces spp. and

overproduction of daunorubicin in Streptomyces peucetius. J Bacteriol.
174(1):144—54.

Suzuki, Y., Y. Ono, A. Nagata, and T. Yamada. 1988. Molecular cloning
and characterization of an rRNA operon in Streptomyces lividans TK21.
J Bacteriol. 170(4):]631-6.

115.

116.

117.

118.

119.

120.

121.

122.

123.

124.

125.

60

Takano, E., H. C. Gramajo, E. Strauch, N. Andres, J. White, and M. J.
Bibb. 1992. Transcriptional regulation of the redD transcriptional
activator gene accounts for growth-phase-dependent production of the

antibiotic undecylprodigiosin in Streptomyces coelicolor A3(2). Mol
Microbiol. 6(19):2797-804.

Takata, R., M. Izuhara, and K. Hori. 1989. Differential degradation of
the Escherichia coli polynucleotide phosphorylase mRNA. Nucleic Acids
Res. l7(18):7441-51.

Takata, R., T. Mukai, and K. Hori. 1987 . RNA processing by RNase III
is involved in the synthesis of Escherichia coli polynucleotide
phosphorylase. Mol Gen Genet. 209(1):28-32.

Takiff, H. E., 8. M. Chen, and D. L. Court. 1989. Genetic analysis of
the mo operon of Escherichia coli. J Bacteriol. 171(5):2581-90.

Tan, H., and K. F. Chater. 1993. Two developmentally controlled
promoters of Streptomyces coelicolor A3(2) that resemble the major class
of motility-related promoters in other bacteria. J Bacteriol. 175(4):933-
40.

Tsao, 8. W., B. A. Rudd, X. G. He, C. J. Chang, and H. G. Floss. 1985.
Identification of a red pigment from Streptomyces coelicolor A3(2) as a
mixture of prodigiosin derivatives. J Antibiot (Tokyo). 38(1):128-31.

Tseng, H. C., and C. W. Chen. 1991. A cloned ompR-like gene of
Streptomyces lividans 66 suppresses defective melC1,a putative copper-
transfer gene. Mol Microbiol. 5(5): 1187- 96.

van Wezel, G. P., E. Vijgenboom, and L. Bosch. 1991. A comparative
study of the ribosomal RNA operons of Streptomyces coelicolor A3(2) and
sequence analysis of rmA. Nucleic Acids Res. 19(16):4399-403.

Vogtli, M., P. C. Chang, and 8. N. Cohen. 1994. ast2: a previously
undetected gene encoding a 63-amino-acid protein that stimulates
antibiotic production in Streptomyces lividans. Mal Microbial. 14(4):643-
53.

Watson, N., and D. Apirion. 1985. Molecular cloning of the gene for the

RNA-processing enzyme RNase III of Escherichia coli. Proc Natl Acad Sci
U S A. 82(3):849-53.

White, J., and M. Bibb. 1997. bldA dependence of undecylprodigiosin
production in Streptomyces coelicolor A3(2) involves a pathway-specific
regulatory cascade. J Bacteriol. 179(3):627-33.

126.

127.

128.

129.

130.

131.

132.

61

Willey, J., R. Santamaria, J. Guijarro, M. Geistlich, and R. Losick.
1991. Extracellular complementation of a developmental mutation
implicates a small sporulation protein in aerial mycelium formation by S.
coelicolor. Cell. 65(4):64 1-50.

Willey, J ., J. Schwedock, and R. Losick. 1993. Multiple extracellular
signals govern the production of a morphogenetic protein involved in

aerial mycelium formation by Streptomyces coelicolor. Genes Dev.
7(5):895-903.

Williams, R. P., and S. M. H. Quadri. 1980. The pigment of Serratia, p.
31-75. In A. van Graevenitz and S. J. Rubin (ed.), The genus Serratia.
CRC Press, Boca Ratan.

Wright, L. F., and D. A. Hopwood. 1976. Identification of the antibiotic
determined by the SCPl plasmid of Streptomyces coelicolor A3(2). J Gen
Microbiol. 95(1):96-106.

Xu, H. P., M. Riggs, L. Rodgers, and M. Wigler. 1990. A gene from S.
pombe with homology to E. coli RNAse 111 blocks conjugation and

sporulation when overexpressed in wild type cells. Nucleic Acids Res.
18(17):5304.

Yu, T. W., and D. A. Hopwood. 1995. Ectopic expression of the
Streptomyces coelicolor whiE genes for polyketide spore pigment

synthesis and their interaction with the act genes for actinorhodin
biosynthesis. Microbiology. 141(Pt 11):2779-91.

Zuber, M., T. A. Hoover, B. 8. Powell, and D. L. Court. 1994. Analysis
of the mo locus of Coxiella bumetii. Mol Microbiol. 14(2):291-300.

CHAPTER 2

Genetic and Molecular Characterization of absB, a Ribonuclease III

Analog that Globally Regulates Antibiotic Synthesis in

Streptomyces coelicolor

62

63
Abstract

Streptomyces coelicolor absB mutants are developmentally blocked in the
production of all four of the antibiotics produced by that strain, yet undergo
normal morphological differentiation. To uncover mechanisms involved in
global antibiotic regulation, the absB locus was cloned using a low copy
plasmid library of wild type chromosomal DNA. Two plasmid clones, pTA108
and pTA128, were identified by their ability to restore global antibiotic
production specifically to the absB mutants. The absB locus was delimited to a
1.0 kb region shared by each clone. DNA sequence analysis within this region
revealed one open reading frame homologous to the Ribonuclease III (RNase III)
enzyme. The E. coli RNase III, the most functionally characterized, is a double-
strand RNA specific endoribonuclease which functions in the processing of an
rRNA precursor and has been shown to regulate gene expression by
modulating stability of select mRNA molecules. Sequence analysis of absB
mutant alleles revealed mutations within the RNase III gene that would predict
a truncated or functionally debilitated enzyme. Gene disruption mutants

generated by homologous recombination using an internal absB fragment also
exhibited the Abs‘ phenotype. Southern hybridization of other streptomycetes
demonstrates that the absB gene is highly conserved across species.
Preliminary evidence that rRNA processing may be affected in one absB‘
mutant suggests that AbsB may share functional similarity with RN ase III of E.

coli and other homologs.

64
Introduction

The streptomycetes are Gram-positive caenocytic soil organisms that
undergo true cellular differentiation in a multicellular developmental life cycle
(for review, see (15)). This life cycle begins with the germination of spores which
then extend filamentous vegetative (substrate) mycelia that grow on and into the
agar medium. In response to unknown stimuli, certain hyphae difierentiate and
grow into the air as aerial mycelia, which give the colony a fuzzy white
appearance. The aerial hyphae then septate and develop into mature haploid
spores with a characteristic gray pigment. Portions of the substrate mycelium
are lysed and provide nutrients to the developing aerial hyphae.

The production of secondary metabolites is temporally coupled to the
morphological differentiation of aerial hyphae (16). While most widely known for
the variety of antimicrobial compounds they produce, streptomycetes also
produce various antiviral, antitumor, antiparasitic, and immunosuppresive
compounds which have found uses in human medicine and agriculture (for
review, see (28)). This fact has made Streptomyces invaluable to the
pharmaceutical industry. Currently, however, the commercial processes of
strain improvement for the development of overproducers is devoid of a
comprehensive understanding of the regulatory controls of secondary metabolite
production. A better understanding of the regulation of antibiotic production
could increase the efficiency of antibiotic isolation and commercial production
(7).

Streptomyces coelicolor, the best characterized and most genetically

manipulatable species, continues to be the model species of choice for the

65

study of secondary metabolism regulation for many reasons. A complete
physical and genetic map has been defined, and a cosmid library of the entire
S. coelicolor genome is available (33, 49). A broad range of plasmid and phage
vectors has been developed, as well as reliable procedures for their use (27).
S. coelicolor produces four known antibiotics; actinorhodin (Act),
undecylprodigiosin (Red), methylenomycin (Mmy) and calcium-dependent
antibiotic (CDA). Two antibiotics, Act and Red, are pigmented compounds
which facilitates the visual identification of developmental mutants.

The majority of studies of secondary metabolites in Streptomyces have
focused on the large gene clusters which encode the compound’s biosynthetic
enzymes, host-resistance genes, and cluster-specific regulators. By
comparison, little is as yet understood about the mechanisms of regulation of
secondary metabolism by these bacteria at the onset of stationary phase. Clues
about the mechanisms involved in the switch to antibiotic synthesis have
begun to surface, due to studies on a few defined loci. Evidence for concerted
regulation of secondary metabolic pathways in S. coelicolor comes from the
isolation of “bald” mutants, which are inhibited in aerial mycelium development
as well as antibiotic synthesis (42). A second family of developmental mutants,
named whi, are blocked in various stages of spare formation, resulting in white
coloration indicative of immature spore chains, while antibiotic production
appears unaffected (17). In an effort to identify global regulation pathways
specific to antibiotic production and independent of sporulation, our laboratory
has isolated a third class of developmental mutants which are named abs for

antibiotic §ynthesis deficient. These mutants are blocked in the production of

66

all four antibiotics in S. coelicolor, yet sporulate normally. Two distinct loci
have been identified, absA and absB (13).

Characterization of the absA locus revealed a two component signal
transduction system that consists of a histidine kinase (absAI) and a response
regulator (absA2)(11). Current studies seek to determine the mechanism by
which these proteins function in the antibiotic regulation cascade.
Interestingly, the absA null mutant results in copious overproduction of Act
and Red, indicating that absA functions as a global negative regulator of
antibiotic production at some level. This result underscores the potential that
a greater understanding of antibiotic regulation might have on production
levels of antibiotic.

Current models of antibiotic regulation mechanisms focus on
transcription initiation (absAl/A2 (11), afsQl/QZ (29), asz/R (40)) and
translation (bldA, (37)) as points of control of gene expression. In this report we
provide evidence for a new level of antibiotic gene regulation. We will show that
the absB locus encodes an analog of Ribonuclease III, which has been shown in
other systems to regulate gene expression by modulating mRNA stability.
RNase III was first shown to initiate the processing of the 308 ribosomal RNA
precursor into the 16S and 238 components (10, 58). Interestingly, RNase III is
not essential for growth, as this processing still takes place by a redundant
mechanism (24). More recent studies have focused on the ability of RNase III to
process certain mRNA transcripts and either up- or down-regulate gene
expression as the result of double-stranded RNA processing by this enzyme
(18). The possible involvement of a Ribonuclease III enzyme in antibiotic

production will be discussed.

67
Experimental Procedures

Bacterial strains, plasmids, and growth conditions. The bacterial strains and
plasmids used in this study are listed in Tables 2.1 and 2.2. Streptomyces
cultures were propagated on R2YE agar or in YEME broth (27) unless
otherwise indicated. Thiostrepton (10ug/ m1 final cone.) or hygromycin
(100ug/ ml final conc.) were added as needed. Conditions for growth of cultures
and preparation of spare stocks were as described in (27 ). E. coil cultures were
grown on LB medium (51) supplemented with ampicillin (100ug/ ml final conc.)

as required to maintain plasmids.

Genetic techniques and DNA manipulations. Streptomyces protoplasts were
generated and transformed as described previously (27). Transformants were
regenerated on R2YE and thiostrepton was applied (lOug/ ml final
concentration) at 18-20h. High copy Streptomyces plasmid DNA was isolated
either manually (8) or by using QIAgen Midi Plasmid Columns (QIAgen Inc.,
USA). Low capy plasmid (pIJ922) derivatives were isolated using the procedure
for SCP2* derivatives (27). Chromosomal DNA used for PCR and Southern
hybridizations was isolated as described in (27). E. coli cultures were
transformed as described in (51). E. coli plasmid DNA was isolated by the
alkaline lysis procedure (51) or by QIAprep spin columns (QIAgen, Inc.) when

used in automated sequencing. All E. coli plasmids were passed through dam“

dcm' E. coli strains ET12567 (39) or DM-l (Gibco BRL) to generate

unmethylated DNA suitable for introduction into Streptomyces.

68

 

 

Strain Genotype Reference
Streptomyces
Strains
S. coelicolor A3(2) hisAI uraAl strAl scpr- SCP2‘ pgl' - (27)
J1501
M124 cysD18praA1 argAl SCPl' SCP2' (27)
M145 Prototroph, SCPl‘, scp2- (27)
0120 absBl20 hisAl uraAl strAl 3031- saw pgl‘ (3)
0170 absBl70 hisAl uraAl strAl SCPl‘ scpz- pgl‘ (3)
0175 absBl75 hisAl uraAI strAl SCPl' SCP2' pgl‘ (3)
0120-310 absB]20::pBK310 hisAI uraAI strAl SCPl' This study
SCP2' pgl'
€542 absA542 hisAl uraAI strAI SCPl‘ SCP2‘ pgl‘ (4)
C301 bld/1301 his/11 uraAl strAl scp1- scpz- pgl' (14)
0112 bldB112 hisAI uraAI strA1 SCPl‘ scp2- pgl‘ (14)
C109 bldH109 hisAI uraA1 strAI SCPI‘ SCP2' pgl' (14)
S. albus
S. ambofaciens
S. avermitilis
S. cinnamonium
S. griseus
S. halstedii J M8
S. lincolnensis
s. lividans TK64
E. coli Strains
DHSa Gibco BRL
ET12567 dam- dcm- (39)
DM-l dam- dcm- Gibco BRL

 

Table 2.1 Strains used in this study

69

 

 

Plasmid Construction / Distinguishing Characteristics Reference
Streptomyces
Plasmids
pTA108 pIJ922 + 11.0kb Sau3A fragment (2)
pIJ922 low copy SCP2* derivative (27)
pBK600 1.4kb Bng fragment from pBK412 in pIJ922 This study
pBK601 1.0kb Bng fragment from pBK651 in pIJ922/BamI-H This study
pBK602 1.0kb Bng fragment from pBK652 in pIJ922/BamHI This study
pBK603 1.0kb BgIH fragment from pBK653 in pIJ922/BamHI This study
pIJ 702 high copy pIJ 101 derivative, Thior (27)
pBK650 1.4kb Bglll fragment from pBK412 in pIJ 702 This study
pBK651 1.0kb PCR-generated Bng fragment (Primers A and D) This study
from J 1501in pIJ 702 / Bng
pBK652 1.0kb PCR-generated BgllI fragment (Primers A and D) This study
from C120 in pIJ702/BglII
pBK653 1.0kb PCR-generated BgllI fragment (Primers A and D) This study
from C175 in pIJ702/Bng
E. coli
plasmids
pKS+Bluescript, Ampr, lacZ insertional inactivation KpnI-Sacl MCS Stratagene
pSK+Bluescript (PK3+) 01' Sad-Kim! MCS (PSKU
PKJ 100 8.3 kb BglII fragment from pTA108 in pKS+ This study
PBK200 3.3 kb PstI fragment from pTA108 in sz+ This study
PBKle 2.6 kb PstI fragment from pTA108 in pKS+ This study
PBK212 1.4 kb PstI-Apal fragment from pBK210 in sz+ This study
PBK213 1.2 kb ApaI-PstI fragment from pBK210 in pKS+ This study
PBK802 1.0 kb Bng fragment from pBK651 in pSK+ This study
PBK803 1.0 kb BgllI fragment from pBK652 (absBl20) in pSK+ This study
PBK804 1.0 kb Bng fragment from pBK653 (absBl75) in pSK+ This study
pIJ963 pIJ2925 derivative with Hygr (38)
pBK300 3.3 kb BamHI/Kpnl fragment from pBK200 in pIJ963 This study
pBK310 2.6 kb BamHI/KpnI fragment from pBK210 in pIJ963 This study
pBK312 1.4 kb BamHI/Kpn] fragment from pBK212 in pIJ963 This study
pBK313 1.2 kb BamHI/Kpnl fragment from pBK213 in pIJ963 This study
pBK3l4 460 bp PCR-generated Bng fragment (Primers B and This study
IF) from J 1501 in pIJ963
le2925 pUC19 derivative with modified multiple cloning site (30)
pBK412 1.4kb BamHI/Kpnl fragment from pBK212 in pIJ 2925 This study

 

Table 2.2 Plasmids used in this study

70
For PCR amplification, Deep Vent polymerase was used (New England

Biolabs) and reactions were carried out essentially as recommended by the
manufacturer, with the addition of glycerol to 10% final concentration per
reaction. Cycling conditions were as follows: holdat 95°C 5 min; denature
96°C/45 sec, anneal 70°C/45 sec, extend 72°C/ 1 min for 35 cycles. Primer
sequences (heterologous tails containing BgIH sites underlined) were:

Primer A - 5’CCAGATCTGCAGCACATCGCGTGCCCG3’;

Primer B - 5’GCAGATCTCGGCCTCGTCGTCACGGACACG3’;

Primer IF - 5’GCAGATCTGCCGTACGAGACGCCTCCGACG3’;

Primer D - 5 ’CGAGATCT CG ACCT CT ACCTCGGGCAACT CGGG3 ’.

Cloning the absB locus. The isolation of the absB-encoding DNA was carried
out using a low copy pIJ922 plasmid library (2). The library contained 10-30 kb
fragments of Sau3A partially-digested J 1501 chromosomal DNA (11). The

cloning scheme took advantage of the self-transmissible nature of pIJ922.

M124 protoplasts were transformed with the pIJ922 plasmid library. Thior
resistant transformants were replicated onto lawns of the absB mutant C120
on R2YE medium. After sporulation, the mating plates were replicated onto
medium selective for C120 recipients and nonpermissive for the M124 host
strain (i.e. glucose minimal medium containing uracil, histidine, thiostrepton
and streptomycin). The transconjugants were visually screened for Act+ Red+
phenotype, and subsequently tested for CDA+ and Mmy+ (the Abs+ phenotype)
(2). Assays for actinorhodin, undecylprodigiosin, methylenomycin and

calcium-dependent antibiotic have been described previously (4).

71

Physical mapping of the absB locus. The absB locus was localized on the S.
coelicolor physical map (33, 49) as follows. AseI-digested J 1501 chromosomal
DNA was separated by pulsed-field gel electrophoresis and blotted on

nitrocellulose membrane (51). The 3.3kb PstI fragment from absB

complementing clone pTA108 was labeled with ATPa32P for hybridization to
the membrane. High stringency conditions were used (65°C; 2xSSC, 0.5xSSC
washes), and the annealed probe was detected by film exposure for 24 h. at

-70°C.

Functional analysis of the absB locus through recombinational rescue and

complementation. Subfragrnents of the 11.0 kb insert of pTA108 were cloned

into the E. coli vector pKS+Bluescript (Stratagene). In recombinational rescue

experiments, fragments were then ligated into the E. coli vector pIJ963 (38),
which carries a Hygr gene suitable for selection in Streptomyces. Unmethylated

pIJ963 derivatives were used to transform absB mutant strains. Hygr
recombinants were isolated (indicating the occurrence of a single crossover
event via homologous recombination within the insert) and scored for an Abs+
phenotype 3-4 days after transformation. In initial complementation studies,
pTA108 fragments were cloned into pIJ2925, which has Bng sites flanking the
multiple cloning site. Following passage through ET12567, clones were
digested with Bng to yield unmethylated fragments which were ligated into
both the high copy pIJ702 and the low copy pIJ922 (27). In subsequent
experiments, the PCR generated absB gene was amplified using primers with

heterologous BglII sites designed at the ends for cloning directly into pIJ702. In

72

either case, ligation mixtures were used to transform absB mutant C120, and
Thior transformants were scored for the Abs+ phenotype. Complementing

clones from Abs+ transformants were isolated and the constructs confirmed by
restriction mapping and Southern hybridization. complementing clones were
then used to retransform C120 and to transform other absB mutant strains as
well as wild type J 1501. PCR-generated absB mutant alleles were similarly
cloned and introduced back into their respective absB mutant backgrounds as

a negative control for complementation.

DNA sequencing and analysis. Automated sequencing of the absB locus from
wild type and absB mutant strains was performed at the Iowa State University
and the Michigan State University sequencing facilities. Nested deletion clones
from pBK210 and PCR-generated fragments were used as sequencing
templates. PCR primers A and D (Figure 2.3) were used to generate templates
of the absB gene from wild type and mutant strains; these were then

functionally characterized by complementation (see above) and then cloned into

pSK+Bluescript for sequencing using standard universal and reverse primers
and Primer B (Figure 2.3). All sequencing templates were purified using
QIAprep Spin Columns and were resuspended in water to a concentration 2200
ng/ul. When necessary, 10% glycerol or 10% DMSO was added to the cycling
reactions to aid sequencing through regions of complex secondary structure.
Sequence data was compiled and analyzed using the Wisconsin Package

Version 9, GCG, Madison, WI.

73
Identifying absB homologs in other streptomycetes. Chromosomal DNA was

isolated from various Streptomyces strains (27) and digested with Bng, BamI-II
or PstI. Normalized amounts of digested DNA (50ug/ lane) were electrophoresed
on a 0.7% agarose gel. Southern blotting was performed as described
previously (51). A 1.0kb PstI fragment from E. coli clone pBK802 containing the
wild type absB gene was gel purified (QIAquick) and labeled with Dig-UTP.
Probe preparation, non-radioactive hybridization and colormetric detection was
performed using the Genius Kit (Boeringer Mannheim) under high stringency

conditions according to manufacturer’s instructions.

Identification of 30S precursor rRNA. RNA samples isolated over a 65 hour
timecourse from J 1501, C120 (absB), and C120-310 (absBC120::pBK310) were
kindly provided by D. Aceti (l). 50 pg of each RNA sample was run on 1%
agarose at 25V for 16 h. The gel was stained with ethidium bromide and

photographed.

74
Results

Cloning the absB locus

Six absB mutants had been isolated previously, and genetic analysis
suggested that a single mutant locus was responsible for the Abs" (Act'Red‘

Mmy’CDA‘) phenotype of the strains (3). To isolate the wild-type absB locus, a
low copy plasmid library of Sau3A partially-digested J 1501 chromosomal DNA
was employed (see Experimental Procedures). Two clones were isolated,
pTA108 and pTA128, which were capable of restoring the production of all four
antibiotics to the absB mutants. In contrast no Act, Red, or CDA production
resulted when the plasmids were transformed into other developmental
mutants such as C542 (absA), C301 (bldA), C112 (bldB), and C109 (bldH) (4,
14). Preliminary restriction mapping and Southern hybridization indicated that
the inserts in pTA108 (12.0 kb) and pTA128 (13.0 kb) shared at least two
internal PstI fragments (2). Therefore, we hypothesized that the two plasmid
clones carried the absB locus, and that its location was within the shared

region of DNA.

Detailed Restriction Analysis of the pTA108 complementing clone.
Preliminary restriction data had previously been generated (2), but more
detailed information was necessary to facilitate subcloning into various plasmid

vectors. An 8.3 kb Bng fragment containing nearly the entire insert from

pTA108 was subcloned into pKSTBluescript and named pKJlOO. A detailed

restriction map was generated using this clone as well as pTA108 itself (Figure

75
2.1). The insert within pTA108 was actually shown to be an 11.0 kb fragment,

and not 12.0 kb as initially estimated (2).

Physical mapping of the absB locus

Recently a physical map of ordered AseI and DraI fragments from the S.
coelicolor A3(2) chromosome has been reported and correlated with the genetic
map (33). To determine the location of the absB locus, a 3.3 kb PstI fragment
common to both complementing clones pTA108 and pTA128 was radioactively
labeled and hybridized to AseI-digested chromosomal DNA of S. coelicolor that
had been separated by pulsed-field gel electrophoresis. AseI digestion
generates 17 fragments from chromosomal DNA, designated A - Q. Upon
exposure to film, the probe hybridized to fragment B, which is located at 5
o’clock relative to the genetic map (Figure 1.1). This result was consistent with
previous genetic mapping results, which localized the absB mutation to the

same region, between the cysD and mthB auxotrophic markers (2, 3).

Localization of the absB locus within a 1.4 kb fragment

To delimit the putative absB locus within the 11.0 kb insert of
complementing clone pTA108, the shared PstI fragments (3.3 kb and 2.6 kb in
Figure 2.2) were independently isolated and tested for the ability to restore the

wild type phenotype (Abs"') to the absB mutants. Each was ligated into

pKSTBluescript to assist in further cloning and restriction mapping to yield

pBK200 and pBK210, respectively. From these vectors, PstI fragments were

76

Figure 2.1 A detailed restriction map of pTA108. absB complementing clone
pTA108 (constructed by T. Adamidis, (2)) containing the 11.0 kb fragment from
Sau3A partially-digested S. coelicolor J1501 chromosomal DNA. Vector DNA

(pIJ922 (27)) is indicated by arrows. Approximate fragment sizes (in kilobases)

are noted.

11138
Ista / vsnss

11138
Iudx

113d ..
Bids _

IPdV"

118d _

1°98 ._

IHWBEI _

IHOOEI

118d _

qus

11138

vsnss / Ista
mesa

—

_

l

 

77

M

1.8

1.26

1.4 0.46 0.74

0.6

1.1

1.0 0.55 1.05

0.6 0.23

6

o'

pIJ922

pIJ922

1.0 kb

78

then cloned into pIJ963, an E. coli plasmid canying the Hygr cassette suitable

for selection in Streptomyces (38) to yield pBK300 and pBK310. Since pIJ963
cannot replicate in Streptomyces, Hygr colonies arise following homologous
recombination within the cloned insert. Hygr colonies of the absB mutant

C120 are expected to display the Abs+ phenotype only if the cloned insert
contains at least one end of the absB gene and includes the region spanning
the absB mutation. Using such an approach, homologous recombination
between the absB mutant locus and a clone containing the entire absB gene
would result in phenotypic rescue of nearly 100% of recombinants, while a
clone containing only a portion of the absB gene might result in a mixture of
Abs+ and Abs' recombinants with the proportion dependent on the location of

the crossover.

When pBK300 was introduced into absB mutant C120, all Hygr
recombinants remained Abs“. However 100% (n=2l) of the Hygr pBK310
recombinants were Abs+ (Figure 2.2). This result suggested that the region of
DNA responsible for rescuing the absB mutation was located within the 2.6 kb
PstI subfragment from pTA108. Transformation of either pBK300 or pBK310
into the Abs+ parent strain J1501 had no effect an antibiotic production by

that strain.

A convenient ApaI restriction site located within the 2.6 kb fragment was

used to further delimit the absB locus. The 1.4 kb and 1.2 kb PstI-ApaI

fragments from pBK210 were subcloned into pKS+Bluescript to yield pBK212

79

Figure 2.2 Defining the absB gene. Wild type J1501 DNA fragments from
pTA108 used in cloning schemes outlined in the text are diagrammed. Those
fragments capable of restoring the wild type Abs+ phenotype to the absB
mutants are shaded. Plasmid clones used in rescue experiments (pIJ963
derivatives) are designated pBK3xx, while complementation clone derivatives
from pIJ922 and pIJ702 are named pBK60x and pBK65x, respectively. The
absB mutant alleles cloned into pIJ922 and le702 that were unable to
complement the absB mutants are designated by a hatched box. Open reading
frames determined by sequence analysis are shown as arrows. Relevant

restriction sites are noted.

8O

 

an

838qu
$.80qu

88qu ._ 8st

205a

88:3 .88qu .2 Gig
205a

805a

81

and pBK213 respectively. Each insert was recovered as a KpnI-BamHI fragment
and ligated into pIJ963 to yield pBK312 (1.4 kb) and pBK313 (1.2 kb) (Figure
2.2). Following transformation of C120, none of the resulting recombinants
from pBK313 were Abs+, yet all of the pBK312 recombinants were Abs+ (n=47).
These results suggested that the absB gene was contained entirely within the
1.4 kb PstI-ApaI fragment.

To determine whether the 1.4 kb PstI-Apa] fragment had the ability to
complement the absB mutations in trans, the autonomously replicating
Streptomyces plasmids pIJ702 (high copy) and pIJ922 (single copy) were used
(27). The 1.4kb PstI-ApaI fragment was cloned into unmethylated pIJ2925, an
E. coli plasmid with Bng sites flanking the multiple cloning site (30). This
allowed the fragment to be recovered as a BgLU fragment suitable for cloning
into both le702 and pIJ922. The ligation mixture was transformed into
C120, and several Thior Abs+ transformants were obtained. Plasmid was
recovered from both Abs+ and Abs’ transformants and the presence of the 1.4
kb fragment was determined by restriction digestion and Southern
hybridization; the 1.4 kb fragment was found in only the Abs+ clones (n=6).
Plasmid DNA extracted from Abs+ colonies was then used to retransform C120
with the result that 100% of transformants were Abs+. Hence both the low
copy pIJ922 clone (named pBK600) and the high copy pIJ702 clone (pBK650)
were able to complement the absB mutant C120 in trans. Transformation of

two other absB mutants, C170 and C175, with pBK600 and pBK650 also

resulted in 100% Abs+ transformants. This result established that the 1.4 kb

82

PstI-ApaI fragment carried all information necessary and sufficient for the

restoration of the Abs+ phenotype to the absB mutants.

DNA sequence analysis of the absB locus

One strand of the 2.6 kb PstI fragment was sequenced. DNA sequence
analysis of the region revealed three open reading frames using CODON
PREFERENCE (Figure 2.2). The 3’ end of the 2.6 kb fragment contained a 306
bp ORF, designated oer, that showed no homology to any sequences in the
protein databases. A second open reading frame spanning the ApaI site
showed homology (57.5-31.6%) to several formamidopyrimidine DNA
glycosylase (fpg) genes in the databases. The Fpg protein is a DNA repair
enzyme that excises the irnidizole ring-opened form of N7 -methylguanine from
damaged DNA (9, 26, 46, 57). We have similarly designated this ORF fpg.

A third gene was found to be entirely within the 1.4 kb PstI-Apal fragment
(Fig. 2.3). Because this fragment was able to rescue and complement absB
mutants, the third gene presented a strong candidate for the absB gene. This
276 amino acid open reading frame showed a high degree of identity to
Ribonuclease III, which had been shown in E. coli to regulate gene expression
by modulating mRNA stability. Six other RNase III homologs were also found in
the databases; amino acid alignments of these homologs are shown in Figure
2.4. All of the functionally significant residues defined for the E. coli RNase III
homolog are strictly conserved in the Streptomyces sequence, as is the double-

stranded RNA binding domain.

83
Secondary structure analysis of the 3’ end of the putative RNase III gene

as well as the 3’ noncoding region using RNAFOLD revealed two large stem
loops (Figure 2.3). One stem loop lies just within the coding region of the
putative RNase Ill gene, and the other, a 21 bp perfect inverted repeat with a 6
bp loop, lies within the noncoding region. This structure may function as a

transcriptional terminator, and / or as an autoregulatory site (see discussion).

Identification of the absB gene

Because the 1.4 kb fragment used in rescue and complementation studies
also contained the 5’ end of the fpg gene, we sought to isolate the RNase III
ORF and repeat the complementation experiments to confirm that the putative
RNase III gene was responsible for complementation of absB. PCR primers A
and D (Figure 2.3) were used to generated a 1046 bp fragment containing the
RNase III ORF and the noncoding regions on either side of the gene from wild
type J1501. The Bng digested fragment was ligated with high copy plasmid
pIJ702. The ligation mixture was used to transform C120 and several Abs+
colonies were recovered. Plasmid was isolated from several transformants and
the constructs were confirmed by restriction analysis. A representative
plasmid was named pBK651. Upon retransformation into C120, pBK651 gave
100% Abs+ colonies (n=264). Subsequent transformation into absB mutants
C175 and C170 gave similar results. The Bng fragment was recovered from
pBK651 and cloned into low copy pIJ922 and used to transform each of the

absB mutants. The resulting clone, pIJ601, was also able to restore the Abs+

phenotype.

84

Upon observation of complementation of the absB mutants, the PCR-
generated fragment in pBK651 was recovered and cloned into pSK+Bluescript
to yield pBK802. DNA sequencing of the insert, using vector priming sites, was
performed in both directions three times to directly. correlate the phenotypic
results with the sequence data. DNA sequence obtained from pBK802 was
identical to preliminary sequence data obtained from the 2.6kb PstI fragment,
indicating that the PCR product ligated into complementation clones was
identical to the fragment carried on pTA108 and encoded the RNase III-like

sequence.

Sequencing the absB mutant alleles

Two absB mutants, C120 and C175, were chosen for detailed sequence
analysis. Primers A and D (Figure 2.3) were used to amplify the mutant alleles
from absB mutant strains. Each reaction generated a fragment the same size

as the J1501 1.0 kb fragment, indicating that no major deletions of the locus

were responsible for the Abs' phenotype. PCR fragments were cloned into
pIJ702 for complementation testing. Unlike the wild type gene, neither mutant
allele was able to complement the absB mutant phenotype (C120, n=137;
C175, n=88). These clones were named pBK652 (absBl20) and pBK653

(absBl75). To correlate DNA sequence with phenotypic results, the insert from

each non-complementing plasmid was cloned into pSKTBluescript for
sequencing. The inserts were sequenced in both directions at least two times.
Sequence comparisons showed that each mutant contained a mutation that

could predictably disrupt the production or function of an RNase

85

Figure 2.3 Sequence of the absB locus. Nucleotide and protein sequence of
the absB gene and the 5’ end of the fpg gene is shown. PCR primer annealing
sites are highlighted in bold text. Putative ribosomal binding sites (rbs?) and
possible GTG start sites for AbsB and Fpg are underlined. The point mutations
identified in absB mutants C120 and C175 are noted, as are the resulting
amino acid changes. The highly conserved 10 amino acid region common to all
Ribonuclease III homologs is underlined. The double-stranded RNA binding
domain as defined in E. coli is underlined. Stem-loop structures predicted by

RNAFOLD are marked with (>><<).

1

61

121

181

241

301

361

421

481

541

601

661

721

781

841

901

961

1021

86

PstI Primer A :3 rbs?
CTGCAGCACATCGCGTGCCCGGCTTGCGGCACTTACAACAAGCGCCAGGTCCTCGAGGTC 6O
GACGTCGTGTAGCGCACGGGCCGAACGCCGTGAATGTTGTTCGCGGTCCAGGAGCTCCAG

rbs? GT (C175)
TGAGCGGCTGGTGAGAGGCACTGTGTCAGTCCCQAAGAAGGCGGAAGACGCCAAGGCGGA 120
ACTCGCCGAC Start of AbsB P *

V R G T V S V P K K A E .D A K A D -

CCCACCCGCCAAGAAGAAGGCGGACACCCAGGCCTCGTCCCACACGCTTCTGGAAGGGCG 180
P P A K K K A D T Q A S S H T L L E G R -

GCTCGGCTATCAGCTCGAGTCCGCCCTTCTGGTGCGTGCACTGACCCACCGTTCCTACGC 240
L G Y Q L E S A L L V R A L T H R S Y A -

GTACGAGAACGGCGGTCTGCCGACGAACGAGCGGCTGGAGTTCCTCGGGGACTCCGTGCT 300
Y E N G G L P T N E R L E F L G D S V L -

Primer B :9
CGGCCTCGTCGTCACGGACACGCTGTACCGCACCCACCCCGACCTGCCCGAAGGCCAGCT 360
G L V V T D T L Y R T H P D L P E G Q L -

 

GGCCAAGTTGCGGGCCGCGGTGGTCAACTCGCGTGCGCTGGCGGAGGTGGGCCGCGGGCT 420
A K L R A A V V N S R A L A E V G R G L -

CGAACTCGGCTCCTTCATCCGGCTCGGCCGCGGTGAAGAGGGCACGGGCGGCCGGGACAA 480
E L G S F I R L G R G E E G T G G R D K -

GGCGTCCATCCTCGCCGACACCCTCGAAGCGGTGATCGGCGCGGTCTATCTCGACCAGGG 540
A S I L A D T L E A V I G A V Y L D Q G -

CCTCGACGCGGCCTCCGAACTGGTGCACCGCCTGTTCGACCCGCTGATCGAGAAGTCCTC 600
L D A A S E L V H R L F D P L I E K S S -

C (C120)
CAACCTCGGTGCCGGCCTGGACTGGAAGACCAGCCTCCAGGAACTCACCGCGACCGAAGG 660
N L G A G L D W K T S L Q E L T A T E G -

P
GCTCGGCGTCCCCGAGTACCTGGTCACGGAGACCGGCCCGGACCACGAGAAGACCTTCAC 720
L G V P E Y L V T E T G P D H E K T F T -

C: Primer IF
TGCTGCCGCCCGCGTCGGAGGCGTCTCGTACGGCACCGGCACCGGCCGCAGCAAGAAGGA 780
A A A R V G G V S Y G T G T G R S K K E —

GGCGGAGCAGCAGGCCGCGGAATCCGCGTGGCGGTCCATCCGGGCCGCGGCGGACGAGCG 840
A E Q Q A A E S A W R S I R A A A D E R -

CGCCAAGGCGACGGCCGACGCCGTCGACGCGGACCCCGACGAGGCGTCCGCCTCCGCCTG 900
>>>>>>>>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<<<<
A K A T A D A V D A D P D E A S A S A * -
End of AbsB
ACCCGTCCACCGCACGGTCCGAACGCCCGCCCCGGCAAAGGGGCGGGCGTTCGGACCGTC 960
GGGCAGGTGGCGTGCCAGGCTTGCGGGCGGGGCCGTTTCCCCGCCCGCAAGCCTGGCAG
>>>>>>>>>>>>>>>>>>>>>> <<<<<<<<<<<<<<<<<<<<<
rbs?
GCTCATCCACCGGCCCAGACCGCCGGGCCGGCCCGCCCGAGGGGAAGCCAIECCCGAGTT 1020
CGAGTAGGTGGCCGGGTCTGGCGGCCCGGCCGGGCGGGCTCCCCTTCGG Start of Fpg
<< M P E L -

C: Primer D
GCCCGAGGTAGAGGTCGTACGGCGCGGCCTGGAGCGCTGGGCCGCCCACCGAACGGTCGC 1080
P E V E V V R R G L E R W A A H R T V A -

87

Figure 2.4 Amino acid alignment of absB and Ribonuclease III homologs.
Homologs are listed in the order of highest identity to absB (Mycobacterium
tuberculosis 62.2%, Bacillus subtilis 40.9%, Escherichia coli 40.9%, Coxiella
burnetii 39.7%, Haemophilus influenzae 38.6%, Mycoplasma genitalium 35.0%,
S. pombe 27.3%). Amino acid numbering is based on the absB sequence (first
100 amino acids of S. pombe paclare not shown). Compiled using PILEUP of
the U. Wisconsin GCG Group Package, V9. The consensus is noted for amino
acids conserved in 2 5 homologs. Residues shown to be important for function
in E. coli are shown with (*). The double-stranded RNA binding domain
(dsRBD) as defined for E. coli (ai-Br-Bz-Ba-az; (32)) is noted, where a-helices and

B-sheets are highlighted with arrows.

ssssssss assesses assesses

P 5 F P P P F 9

9 3 a n m m 2 m

coelicolor absB
tuberculosis rnc

subtilis rnc

coli rnc

burnetii rnc

influenzae rnc
genitalium rnc

pombe pacl

(101)

Consensus

coelicolor absB
tuberculosis rnc

subtilis rnc

coli rnc

burnetii rnc

influenzae rnc
genitalium rnc

pombe pacl

CORBODSUB

coelicolor absB
tuberculosis rnc

subtilis rnc

coli rnc

burnetii rnc

influenzae rnc
genitalium rnc

pombe pacl

Consensus

coelicolor absB
tuberculosis rnc

subtilis rnc

coli rnc

burnetii rnc

influenzae rnc
genitalium rnc

pombe pacl

Consensus

coelicolor absB
tuberculosis rnc

subtilis rnc

coli rnc

burnetii rnc

influenzae rnc
genitalium rnc

pombe pacl

1
vrgtvsvpkk

aedakadppa

8&3

kkkadtqass

~~~~~~~~~~

~~~~~~~~~~

vieepsshpk

~mskhshykd

~~~mknkvlk
nqknqennep

kkkfykkveq

lknnkifdkk
tseefeegey

htlLegrLGy
rquldaLGv
fkefqerisv
ianquLGy
lnkLmerLGh
lererkiGy
latflknLdi

ppprplrse
L

———————————————————————————————————— LG-

60

ngglp..t..

ngglp..t..
hrkkpyed..

h...edvses
snpnelldih

116

gL...eLGsf
rLcaegLth
eL...stdl
ef...eLGec
kL...giney
qf...eLGdy
eL...kLGdf
...lygfdkt
-L----LG-—

173

iekssnlgag
ldaaptlgag
ind.gafphv
ldeispgqu
vddlsklspk
laeikpgdnq
tfseilkydf
iani.tvqrp

230

..GtGrSkke
..GvGrSkke
.anGrSkke
vathSrrk
..Gvnttrrr
fvastSrrk
vlehnamasf
ganqkdagsr

Consensus --G-a:§-:_

B37 V

*

NERLEFLGDS
NERLEFLGDa
NERLEFLGDa
NERLEFLGDS
NERLEFLGDS
NERLEFLGDS
ydRLEFLGDa
NERLEFLGDS
NRRLEFLGDS

irLGrGEegt
vlLGrGEant
vlLGkGEemt
lrLGpGElks
quGvGEqks
msLGsGElkn
vkLsnGaelt
lesysaekd
-_LG_GE__-

lDwKtsLQEl
lDwKtsLQEl
mequLQEy
kDpKtrLQEy
kDaKleQEw
kDaKtrLQEy
fslfqeqklp
kalaksklf
—D-K--LQE-
a

AEQqAAesaw
AEQkAAaaaw
AEQhAAqeal
AEQaAAeqal
AEQiAAkrfl
AEQaAAeqil
tsflksskgs
Aaqulevla

a2

nglvvtdtL
ngltItdaL
vLeltIsrfL
iLsvaanaL
ngfiIaseL
iLnftIaeaL
lidfvvakkL
ffnlfttrii
-L---I---L

GGrdkaSILA
GGadksSILA
GGrkrpalLA
GGfrreSILA
GGkrrrSILA
GGfrreSILA
..... entvg
qlrksquiA
GG----SILA

tatengvPe
taarngaPs
vqrdgkgsle
lqgthplPt
IqarerlPt
lqgkthlPt
eprvrvslts
hkystLghie
--___L__P-

yrtthlpEG
fhthdrsEG
fpkyPamsEG
yhrfPrvdEG
yqrquarEG
thfPranG
felyPkynEG
fskaqdeG
----P---EG

i

DtlEAviGAv
ngEsllGAi
vaEAfiGAl
DtvEAliva
DalEtivGAi
DCVEAiiGAm
DleAlvGAi
thEAylGAl
D--EA--GA-

Ylvte.tGpd
Y1vts.tGpd
Ykisnekaa
Ylquerea
Ye.VkitGea
YevVnquea
nanISIiel
erVdgaG.g
Y--V---G--

T

rsiraaader
kaLevldnam
akLekhhtkq

akatadavda
pgktsa~~~~

lnppydsggf

qles.aLLvr
dlpd.eLle
hfqnekLLyq
tfnhqeLqu
qfnnleLLki
rfndiaLqu
fpnnweffek
klkeqvfmhi
...... u.--

qLaklRAavV
dLaklRAsvv
stklRAaiV
dmsrmRAth
dLsrmRAsmV
eLsrmRAth
lLtrtkieiV
sLsklRAka
-L---RA--V

YLDqudaas
YthGmekar
YLDquepve
fLDsdiqtve
YiDaGletcr
sLDquavtt
YeDmekkat
iLngeetaf
YLD-G -----

HektPTaaar
HdkeFTavvv
HnreFeaivs
queFTihcq
HathTvncy
chiFTvkck
dgdiiwsqai
saegyviaci
H---FT----

<——B§———9

276
dpdeasasa*

~~~~~~~~~~

qucrli~~~

eldegkgdg

iterdq~~~~

~~~~~~~~~~

.

hffsdlkeki

enqkmckkla

ikpkkn~~~~

kdyskfar ~~~~~~~~~~~~~~~~~~~~~~
AEQ-AA ------ L ---------------------------

A
a

59
ALTHrSYaye
ALTHrSYaye
AfTHsSYvne
ALTHrSassk
ALTHchgad
ALTHrSaatq
AfiHaSYine
srayetinq
ALTH-SY---

115
nsraLAeng
ntqaLAdvAR
cepvaslAh
rgntLAelAR
ngdeLAqmst
reptLAilAR
kgenLnrigm
gnesadkaR
----LA--AR

172
elvhrlfdpl
evilrlfgpl
sflkvyvfpk
klilnqutr
rcvlnwyger
qvirnquql
efvekyifer
qusrllqpk

229
VgGvsygt..
deseygs..
lkGeplg...
VsG...lsep
VkGlphkte.
Vksaekidrt
pnnknyddks
fnervaraw

v-G -------
‘—

89

172
to a

III-like protein. C120 contained a C—>T transition that changes Leu
proline residue. This amino acid lies within the first alpha helix of the double-
stranded RNA binding domain (dsRBD) (32). The presence of a proline residue,
which is reputed to disrupt the structural integrity .of an a-helix (19), could
structurally distort the dsRBD and inactivate the enzyme’s ability to bind to its
target. The C175 allele revealed a two base pair change, the second of which

results in a nonsense mutation at Lys8 to yield a severely truncated protein.

absB is conserved in other streptomycetes

To determine if the absB gene is conserved across species, a 1.0 kb PstI
fragment from sequencing clone pBK802 containing the entire absB ORF was
used to probe the chromosomal DNA of various streptomycetes (Figure 2.5). A
PstI digest of prototrophic strain S. coelicolor M600, as well as PstI and Bng
digests of the parent strain J1501 were used as positive controls and bands
were visible at 2.6 kb and 8.1 kb respectively, as expected from the pTA108
restriction map (Fig. 2.1). In other streptomycete species, a single BamHI
fragment hybridized to the probe under high stringency conditions. Fragments
from S. albus (2.4 kb), S. ambofaciens 2035 (6.5 kb), S. avermitilis (9.1 kb), S.
cinnamonium (8.8 kb), S. griseus (2.7 kb), S. halstedii JM8 (2.7 kb), and S.
linclonensis (1.6 kb) were detected. The BamHI digest of S. lividans was
incomplete, with the absB probe hybridizing to the single high molecular
weight band. The hybridization conditions used (0.5x SSC, 0.1% SDS at 65°C)

predictably exclude probe binding when less than 90% homology exists,

90

according to the manufacturer. Since the identity between the absB gene and
the actinomycete Mycobacterium tuberculosis rnc gene is 62.2%, it is not
surprising that like genes of the streptomycetes would have greater degrees of
homology. This data, in conjunction with computer-assisted homology
searches, indicates that the putative Ribonuclease III gene is highly conserved

across a wide variety of bacteria and lower eukaryotes.

Preliminary evidence for the 308 rRNA precursor in an absB mutant strain

One distinguishing characteristic of an E. coli RNase III' mutant is the

presence of the 30S precursor rRNA in total RNA preparations (22). This

precursor accumulates only in RNase Ill' mutants, due to the inefficient
processing in the absence of the enzyme. To determine if an rRNA processing

deficiency is present in absB mutants, RNA isolated at various time points from

J1501, C120, and the Abs" pBK310 recombinant Cl20-310 Was run on a 1%
agarose gel. At each time point, an additional rRNA band can be seen in the
absB mutant, but not in either the wild type or recombinant strain (Fig. 2.6).
The migration of the fragment is consistent with 308 rRNA, though its identity
has not been confirmed. This result provides preliminary evidence that the
putative Streptomyces RNase III analog has retained the rRNA processing
function defined in other RNase III enzymes and that this function is inhibited

in the absB mutant strain C120.

91

Figure 2.5 Hybridization of the absB gene to other Streptomyces species. A
1.0 kb PstI fragment from pBK802 was used to probe digested chromosomal
DNA from eight streptomycetes. Digested DNA was run on a 0.7% agarose gel
(left) and Southern blotted onto nylon membrane. Probe hybridization was
detected using non-radioactive Genius Kit (right). Molecular weight marker

(HindflI-digested l DNA) fragment sizes are noted.

92

[HWPH / SUEPI/‘H ’S

 

IHUJEQ / SlSUOLflODU” ‘S
mums / upswlsq 's
[Humg /snos133 ‘s
[Hmeg / sgsueuoureuuro ‘3
males / sumuusAs '8
males! / susissioqws 's
[Hume / 511418 's

11138 / [OS If

Ilsd/ IOSII

115d / 009W

IHUJBEI / SWPIAII 'S
[Hung / sisusurooun 'S
IHWG / IIPQISIPTI 'S
{Hung / snasrrfi 's

[Hweg / sisuauomeuuio ‘S

[Hung / sueyoegoqum 's

mums / 5'1ng 's

w.-<.m.-Wum--—ma whi-1r -.- .

Inga/1091:
11sa/ Iosu

119d / 009W

 

93

Figure 2.6 Ribosomal RNA processing in the absB mutant. Normalized
concentrations of RNA from wild type strain J1501, absB mutant C120, and
C120 rescued to the wild type phenotype with pBK310 (C120-310) were

isolated from four time points and run on a 0.7% agarose gel at low voltage for

16 hours, then stained with ethidium bromide. 238 and 16S rRNAs are noted,

as well as the putative 308 rRNA that is seen in the C120 (absB') mutant.

94

mo Vm mv mm

awn-:20

no em ms mm

:20

 

mo Vm ms om

Em:

A m8
A mm

A mom

95

Discussion

In the study we have presented evidence that the S. coelicolor absB gene,
which is involved in the global regulation of antibiotic synthesis, encodes an
analogue of Ribonuclease III. Through recombinational rescue and

complementation experiments we have shown that three NTG-induced absB

mutants can be restored to the wild type Abs+ phenotype by the introduction of
the putative RNase III gene. Sequence analysis of two mutant alleles shows
that each absB mutant harbors a mutation in the putative RNase III gene. One
mutation is predicted to prematurely halt translation, and the second would
likely alter the secondary structure of the dsRBD. The absB gene is highly
conserved across species of Streptomyces. Finally, preliminary evidence

suggests that absB mutant C120 is deficient in ribosomal RNA processing as

seen for E. coli and B. subtilis RNase 111' strains, and that this processing ability
appears to be restored in the rescued clone C120-310.

Ribonuclease III is a double-stranded RNA specific endoribonuclease that
has been best characterized in E. coli. RNase III was first identified by its
ability to degrade long duplex RNA and to initiate the processing of the 30S
rRNA precursor into the mature 16S and 23S subunits (22, 44). The 308 rRNA
precursor is only seen in strains devoid of RNase III activity, as the processing
occurs very rapidly in wild type strains (22, 45). Surprisingly, me, the gene

that encodes RNase III in E. coli, is not essential for cell growth; the mature 16S

rRNA is formed, albeit less efficiently, by a redundant mechanism in me"

strains (35, 53). In a mutant lacking RNase III, mature 238 rRNA never forms,

96

but the 508 ribosomes containing immature pre-23S rRNA are competent for
translation (36, 52). E. coli rnc’ mutants have been shown to grow at a

somewhat slower growth rate than rnc+ strains. The effect of the mutation on
growth rate is variable depending on culture medium and genetic background
(5, 34, 54).

A more recent focus of interest is the ability of RNase III to control the
regulation of gene expression by processing specific mRNA transcripts. It has
been estimated that the abundance of as many as 10% of E. coli proteins
detectable by gel analysis are either under- or overproduced in the well-
characterized mc105 mutant (25, 56). Through endonucleolytic cleavage of
stem-loop structures within the 5’ or 3’ noncoding regions of select mRNAs,
RNase III is able to up- or down-regulate the expression of the gene(s) post-
transcriptionally. In phage l, RNase III has been shown to cleave a signal stem-
loop in the leader RNA of the N protein transcript and in the 3’ end of the int
gene transcript. However, in lN this processing enhances lN' gene expression
by opening up the Shine-Delgarno sequence to translation initiation (31); in
contrast, processing at the 3’ end of the lint gene inhibits gene expression by
exposing the transcript to exonucleolytic degradation (48). The T7 phage early
and late gene transcripts have RNase III processing signals in intercistronic
regions; their specific cleavage yields mature mRNAs that have increased
translational activity and stability (20-22). Yet the messages of the E. coli
polynucleotide phosphorylase, and the mo transcript itself are destabilized
upon RNase III processing and are thus negatively regulated by this enzyme (6,

55).

97

To date, many RNase III processing signals have been identified in E. coli
and other systems, yet the specific structural and sequence determinants
required for RNase III-dependent cleavage have eluded definition. Although
stem-loop structures are found in almost all RNA molecules, the vast majority
are not processed by RNase III (18).

It has yet to be determined whether RNase III in Streptomyces coelicolor
actively regulates antibiotic production by specific mRNA processing, or
whether the antibiotic production defect of the absB mutants is the result of a
less direct biological influence. The ability of the absB mutants to sporulate
normally indicates the lack of any gross disruption in normal cellular
difierentiation. We have not seen any discernible growth rate difference
between the absB mutants and the wild type J 1501, however more quantitative
growth rate experiments under varying culture conditions would determine
whether RNase Ill mutation has any appreciable affect on growth as is seen in
the E. coli system.

If RNase 111 does specifically regulate the stability of antibiotic-specific
mRNAs, then the targets for such an enzyme would be interesting to study. We
have several candidates for potential RNase III targets. One of the most
intriguing is the mia sequence. mia, named for multicopy inhibition of
antibiotic production, is defined by a 120 bp fragment that when cloned in a
high copy vector and introduced into wild type S. coelicolor produces the Abs’
phenotype (50). DNA sequence analysis of this fragment predicts a small open
reading frame that is unlikely to be translated, but does contain a 19bp perfect
inverted repeat, with a ten basepair loop. Preliminary transcription analysis

using an inducible pTipA promoter indicates that the region must be

98
transcribed to produce the phenotype (12). It is tempting to speculate that an

RNA stem-loop structure such a mia, expressed in high copy, might sequester
the AbsB protein and interfere with its intended function in antibiotic
regulation.

We have not excluded the possibility of a direct interaction between AbsB
and the activators for antibiotic gene clusters. 81 nuclease protection assays
have shown that in the absB mutant C120 there are notable decreases in the
levels of transcripts encoding the actinorhodin gene cluster activator, actII-
ORF4, and the undecylprodigiosin activator, redD, transcripts (1), which could
represent instability of those transcripts in the absence of AbsB. Both actII-
ORF4 and redD have been shown to bypass the absB mutants when introduced
in high copy. One could speculate that AbsB might be needed for stabilization
of these transcripts, perhaps to reach a certain threshold after which antibiotic
production can occur. Both of these gene transcripts have substantial stem-
loop structures reported in noncoding regions (23, 43). A 25bp perfect inverted
repeat has been reported within the 3’ noncoding region between actII-ORF4
and actIII; in vitro studies of this sequence and purified AbsB could determine
if any interaction exists.

The presence of a 22bp perfect inverted repeat in the 3’ noncoding region
of absB poses the possibility that this region could function as an
autoregulatory site. In E. coli, RNase III processes a signal in its own transcript
to negatively autoregulate its own expression (6, 41). While the autoregulatory
signal for E. coli me is located in the 5’ end of the operon, in other RNase III-
regulated genes the processing signals have been located in the 3’ end of

transcripts. Northern and Western analysis of the absB gene product in wild

99

type and absB mutant strain C120 could discern whether the gene is
autoregulated.

Preliminary functional characterization of the putative RNase III in
Streptomyces coelicolor comes from analysis of preparations of ribosomal RNA
from the wild type J 1501 and absB mutant strains. A large RNA corresponding
in size with the 308 rRNA precursor can be seen in the absB mutant C120, but

not in the wild type J 1501 or in C120(absB) recombinationally rescued to the

Abs+ phenotype with pBK310 (C120-310). This result suggests that the absB
gene has retained the function of 308 precursor rRNA processing in addition to
any possible function in antibiotic production. Upon isolation of the AbsB
protein, this presumed 30S ribosomal RNA processing can be specifically
investigated in vitro.

If future experiments show the direct involvement between the putative
RNase III and antibiotic-specific transcripts, this would represent the first
evidence of regulation of antibiotic production through mRNA stability. To date
many types of genes in E. coli, coliphage, and B. subtilis and its phage have
been shown to be processed by RNase 111, though no streptomycete genes
related to antibiotic production have been shown to be post-transcriptionally

regulated in this way.

10.

11.

100
Literature Cited

Aceti, D. J., and W. C. Champness. 1997. Global transcriptional
regulation of Streptomyces coelicolor antibiotic genes by the absA and
absB loci. In preparation. »

Adamidis, A. 1994. Ph.D. Dissertation. Michigan State University, East
Lansing, MI.

Adamidis, T., and W. Champness. 1992. Genetic analysis of absB, a
Streptomyces coelicolor locus involved in global antibiotic regulation. J
Bacteriol. 174(14):4622-8.

Adamidis, T., P. Riggle, and W. Champness. 1990. Mutations in a new
Streptomyces coelicolor locus which globally block antibiotic biosynthesis
but not sporulation. J Bacteriol. 172(6):2962-9.

Apirion, D., and N. Watson. 1975. Mapping and characterization of a
mutation in Escherichia coli that reduces the level of ribonuclease III
specific for double-stranded ribonucleic acid. J Bacteriol. 124(1):317-24.

Bardwell, J. C., P. Regnier, 8. M. Chen, Y. Nakamura, M. Grunberg-
Manago, and D. L. Court. 1989. Autoregulation of RNase III operon by
mRNA processing. Embo J. 8(11):3401-7.

Bibb, M. 1996. 1995 Colworth Prize Lecture. The regulation of antibiotic
production in Streptomyces coelicolor A3(2). Microbiology. 142(Pt 6):l335-
44.

Birnboim, H. C., and J. Doly. 1979. A rapid alkaline extraction
procedure for screening recombinant plasmid DNA. Nucleic Acids Res.
7(6):1513-23.

Boiteux, 8., E. Gajewski, J. Laval, and M. Dizdaroglu. 1992. Substrate
specificity of the Escherichia coli Fpg protein (formamidopyrimidine-DNA
glycosylase): excision of purine lesions in DNA produced by ionizing
radiation or photosensitization. Biochemistry. 31(1):106-10.

Bram, R. J., R. A. Young, and J. A. Steitz. 1980. The ribonuclease lII
site flanking 23S sequences in the 308 ribosomal precursor RNA of E. coli.
Cell. 19(2):393-401.

Brian, P., P. J. Riggle, R. A. Santos, and W. C. Champness. 1996.
Global negative regulation of Streptomyces coelicolor antibiotic synthesis

mediated by an absA-encoded putative signal transduction system. J
Bacteriol. 178(11):3221-31.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

23.

101
Brown, G., and W. C. Champness. 1997. Unpublished results.

Champness, W., P. Riggle, T. Adamidis, and P. Vandervere. 1992.
Identification of Streptomyces coelicolor genes involved in regulation of
antibiotic synthesis. Gene. 115(1-2):55-60.

Champness, W. C. 1988. New loci required ‘ for Streptomyces coelicolor
morphological and physiological difierenfiafion. J Bacteriol. 170(3):1168-
74.

Champness, W. C., and K. F. Chater. 1994. Regulation and integration
of antibiotic production and morphological differentiation in Streptomyces
spp., p. 61-93. In P. J. Piggot, J. Moran, OR, and P. Youngrnan (ed.),
Regulation of Bacterial Difierentiation. American Society for Microbiology,
Washington DC.

Chater, K. F. 1992. Genetic regulation of secondary metabolic pathways
in Streptomyces. Ciba Found Symp. 171:144-56; discussion 156-62.

Chater, K. F. 1984. Morphological and Physiological Differentiation in
Streptomyces, p. 89-115. In R. Losick and L. Shapiro (ed.), Microbial
Development. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.

Court, D. 1993. RNA processing and degradation by RNase III, p. 71-116.
In J. G. Belasco and G. Brawerman (ed.), Control of messenger RNA
stability. Academic Press, San Diego.

Creighton, T. 1994. Proteins. Structures and Molecular Properties. W. H.
Freeman and Co., N .Y. ‘

Dunn, J. J., and F. W. Studier. 1983. Complete nucleotide sequence of
bacteriophage T7 DNA and the locations of T7 genetic elements. J Mol
Biol. 166(4):477-535.

Dunn, J. J., and F. W. Studier. 1975. Effect of RNase III, cleavage on
translation of bacteriophage T7 messenger RNAs. J Mol Biol. 99(3):487-
99.

Dunn, J. J ., and F. W. Studier. 1973. T7 early RNAs and Escherichia coli
ribosomal RNAs are cut from large precursor RNAs in vivo by ribonuclease
3. Proc Natl Acad Sci U S A. 70(12):3296-3300.

Fernandez-Moreno, M. A., J. L. Caballero, D. A. Hopwood, and F.
Malpartida. 1991. The act cluster contains regulatory and antibiotic
export genes, direct targets for translational control by the bldA tRNA
gene of Streptomyces. Cell. 66(4):769-80.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

34.

35.

102

Gegenheimer, P., and D. Apirion. 1980. Precursors to 16S and 23S
ribosomal RNA from a ribonuclear III-strain of Escherichia coli contain
intact RNase III processing sites. Nucleic Acids Res. 8(8):l873-91.

GiteIman, D. R., and D. Apirion. 1980. The synthesis of some proteins is

afiected in RNA processing mutants of Escherichia coli. Biochem Biophys
Res Commun. 96(3):1063-70. ‘

Graves, R., J. Laval, and A. E. Pegg. 1992. Sequence specificity of DNA
repair by Escherichia coli Fpg protein. Carcinogenesis. 13(8):1455-9.

Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J. Bruton, H.
M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward, and H. Schrempf.

1985. Genetic Manipulation of Streptomyces: A Laboratory Manual, first
ed. The John Innes Foundation, Norwich, UK.

Hutchinson, C. R. 1987. The impact of genetic engineering on the
commercial production of antibiotics by Streptomyces and related
bacteria. Appl Biochem Biotechnol. 16:169-90.

Ishizuka, H., S. Horinouchi, H. M. Kieser, D. A. Hopwood, and T.
Beppu. 1992. A putative two-component regulatory system involved in
secondary metabolism in Streptomyces spp. J Bacteriol. 174(23):7585-94.

Janssen, G. R., and M. J. Bibb. 1993. Derivatives of pUC18 that have
Bglll sites flanking a modified multiple cloning site and that retain the
ability to identify recombinant clones by visual screening of Escherichia
coli colonies. Gene. 124(1): 133-4.

Kameyama, L., L. Fernandez, D. L. Court, and G. Guarneros. 1991.
RNaselll activation of bacteriophage lambda N synthesis. Mol Microbiol.
5(12):2953-63.

Kharrat, A., M. J. Macias, T. J. Gibson, M. Nilges, and A. Pastore.
1995. Structure of the dsRNA binding domain of E. coli RNase III. Embo J.
14(14):3572-84.

Kieser, H. M., T. Kieser, and D. A. Hopwood. 1992. A combined genetic
and physical map of the Streptomyces coelicolor A3(2) chromosome. J
Bacteriol. 174(17):5496-507.

Kindler, P., T. U. Keil, and P. H. Hofschneider. 1973. Isolation and
Characterization of a Ribonuclease III Deficient Mutant of Escherichia coli.
Molec. Gen. Genet. 126:53-69.

King, T. C., and D. 8chlessinger. 1983. SI nuclease mapping analysis of
ribosomal RNA processing in wild type and processing deficient
Escherichia coli. J Biol Chem. 258(19):l2034-42.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

103

King, T. C., R. Sirdeshmukh, and D. 8chlessinger. 1984. RNase III
cleavage is obligate for maturation but not for function of Escherichia coli
pre-23S rRNA. Proc Natl Acad Sci U S A. 81(1):185-8.

Lawlor, E. J ., H. A. Baylis, and K. F. Chater. 1987. Pleiotropic
morphological and antibiotic deficiencies result from mutations in a gene

encoding a tRNA-like product in Streptomycescoelicolor A3(2). Genes Dev.
1(10):1305-10.

Lydiate, D. J ., F. Malpartida, and D. A. Hopwood. 1985. The
Streptomyces plasmid SCP2*: its functional analysis and development into
useful cloning vectors. Gene. 35(3):223-35.

MacNeil, D. J., K. M. Gewain, C. L. Ruby, G. Dezeny, P. H. Gibbons,
and T. MacNeil. 1992. Analysis of Streptomyces avermitilis genes required

for avermectin biosynthesis utilizing a novel integration vector. Gene.
111(1):61-8.

Matsumoto, A., 8. K. Hang, H. Ishizuka, S. Horinouchi, and T. Beppu.
1994. Phosphorylation of the Ast protein involved in secondary

metabolism in Streptomyces species by a eukaryotic-type protein kinase.
Gene. 146(1):47-56.

Matsunaga, J., E. L. Simons, and R. W. 8imons. 1996. RNase Ill
autoregulation: structure and function of ch, the posttranscriptional
"operator". Rna. 2( 12): 1228-40.

Merrick, M. J. 1976. A morphological and genetic mapping study of bald
colony mutants of Streptomyces coelicolor. J Gen Microbiol. 96(2):299-315.

Narva, K. E., and J. S. Feitelson. 1990. Nucleotide sequence and
transcriptional analysis of the redD locus of Streptomyces coelicolor A3(2).
J Bacteriol. I72(l):326-33.

Nikolaev, N., L. Silengo, and D. 8chlessinger. 1973. A role for
ribonuclease 3 in processing of ribosomal ribonucleic acid and messenger
ribonucleic acid precursors in Escherichia coli. J Biol Chem.
248(22):7967-7969.

Nikolaev, N., L. Silengo, and D. 8chlessinger. 197 3. Synthesis of a large
precursor to ribosomal RNA in a mutant of Escherichia coli. Proc Natl Acad
Sci USA. 70(12):3361-3365.

O. Connor, T., S. Boiteux, and J. Laval. 1989. Repair of imidazole ring-
opened purines in DNA: overproduction of the formamidopyrirnidine-DNA
glycosylase of Escherichia coli using plasmids containing the fpg+ gene.
Ann Ist Super Sanita. 25(1):27-31.

47.

48.

49.

50.

51.

52.

53.

54.

55.

56.

57.

58.

104

Oh, S. H., and K. F. Chater. 1997. Denaturation of circular or linear DNA
facilitates targeted integrative transformation of Streptomyces coelicolor
A3(2): possible relevance to other organisms. J Bacteriol. 179(1):122-7.

Panayotatos, N., and K. Truong. 1985. Cleavage within an RNase 111 site
can control mRNA stability and protein synthesis in viva. Nucleic Acids
Res. 13(7):2227-40. '

Redenbach, M., H. M. Kieser, D. Denapaite, A. Eichner, J. Cullum, H.
Kinashi, and D. A. Hopwood. 1996. A set of ordered cosmids and a

detailed genetic and physical map for the 8 Mb Streptomyces coelicolor
A3(2) chromosome. Mol Microbiol. 21(1):77-96.

Riggle, P., G. Brown, B. S. Price, and W. C. Champness. 1997.
Multicopy inhibition of global antibiotic production in Streptomyces
coelicolor by the mia locus. In preparation.

Sambrook, J ., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual, 2 ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY.

Sirdeshmukh, R., and D. 8chlessinger. 1985. Ordered processing of
Escherichia coli 23S rRNA in vitro. Nucleic Acids Res. 13(14):5041-54.

Srivastava, A. K., and D. 8chlessinger. 1989. Processing pathway of
Escherichia coli l6S precursor rRNA. Nucleic Acids Res. 17(4):1649-63.

Studier, F. W. 1975. Genetic mapping of a mutation that causes
ribonucleases III deficiency in Escherichia coli. J Bacteriol. 124(1):307-16.

Takata, R., M. Izuhara, and K. Hori. 1989. Differential degradation of
the Escherichia coli polynucleotide phosphorylase mRNA. Nucleic Acids
Res. 17(18):?441-51.

Takata, R., T. Mukai, and K. Hori. 1987. RNA processing by RNase III is
involved in the synthesis of Escherichia coli polynucleotide phosphorylase.
Mol Gen Genet. 209(1):28-32.

Tchou, J ., V. Bodepudi, S. Shibutani, I. Antoshechkin, J. Miller, A. P.
Grailman, and F. Johnson. 1994. Substrate specificity of Fpg protein.
Recognition and cleavage of oxidatively damaged DNA. J Biol Chem.
269(21):15318-24.

Young, R. A., and J. A. Steitz. 1978. Complementary sequences 1700
nucleotides apart form a ribonuclease III cleavage site in Escherichia coli
ribosomal precursor RNA. Proc Natl Acad Sci U S A. 75(8):3593-7.

CHAPTER 3

Characterization of the mia Locus, a Multicopy Inhibitor of

Global Antibiotic Production in Streptomyces coelicolor

105

1 06
Abstract

The goal of this collaborative project is to determine the mechanism by
which an antibiotic regulatory locus, named mia, causes multicopy inhibition of
global antibiotic synthesis. This genetic element inhibits the synthesis of at
least three of the four antibiotics produced by Streptomyces coelicolor when
cloned into a high copy vector and introduced into that strain; this phenotype
has been designated Abs“. Emphasis has been placed on determining whether
mia sequesters a regulatory element, exhibits a gene dosage effect, or expresses

a regulatory RNA that is exerting an effect on the global regulation of these

antibiotics. Elucidating this mechanism could contribute to a better

understanding of the regulation of secondary metabolites in Streptomyces.

1 07
Introduction

Antibiotic production by Streptomyces spp. has been the subject of

intensive investigation for several decades. Driven by commercial and
academic interest, a wealth of information about the mechanisms by which this
genus synthesizes a vast arsenal of antibiotics and other secondary metabolites
has been documented. With this knowledge, researchers strive to understand
and possibly manipulate the genetics of antibiotic producing strains to enhance
yield and perhaps develop new antibiotic derivatives through genetic
engineering (1 1).

Efforts to commercially exploit antibiotic production by Streptomyces has
provided an abundance of information about growth and nutritional conditions
required for optimal antibiotic production. Trial and error mutagenesis
screenings have yielded strains that produce antibiotics in hundreds or even
thousands times greater quantities than the original soil isolates. Despite this,
production strains still regulate the production of antibiotics to occur late in
the life cycle at the onset of stationary phase. The mechanisms by which
streptomycetes regulate antibiotic production remain a relative mystery, but
understanding them may provide a new approach to the rational design of
overproducing strains (10).

Most of the current understanding of secondary metabolism regulation
comes from the study of developmental mutants in Streptomyces coelicolor
which are blocked at various stages of antibiotic production pathway. One

class of mutants thought to represent the very earliest stages of secondary

metabolism are the “bald” mutants. These mutants are blocked in the

108

production of all four S. coelicolor antibiotics and in morphological

differentiation (sporulation) (13). Under certain growth conditions
morphological differentiation in these mutants can sometimes be restored,
however antibiotic production is not typically affected. This suggested that
there might be another level of control that affects antibiotic production
exclusively.

The work by the Champness laboratory has focused mainly on a class of
developmental mutants named abs for "antibiotic aynthesis deficient". These

mutants are able to sporulate, but are not able to produce antibiotics (9). A

screen of 800,000 mutagenesis survivors led to the identification of two distinct
abs mutant types, absA and absB (1, 2). These mutations were physically and

genetically mapped to two distinct loci on the chromosome (Fig. 1.1). Each
locus has been cloned and elucidation of the mechanisms by which they

regulate antibiotic synthesis is currently being conducted ((4); see Chapter 2).
While the absB mutants were isolated at a frequencyof 10-4, the absA
mutants appeared to be relatively rare because they were found at a frequency
of 5 x 10-6 (2). This rarity raised the possibility that the absA mutant alleles
could be dominant. Thus one attempt to clone the absA locus involved
constructing a Bng library of absA mutant DNA, introducing it into an Abs:
recipient, and screening for the Abs- phenotype. Although no absA“ clones
resulted from this approach, a 2 kb Bng fragment was isolated (> 40

independent times) that conferred the Abs- phenotype in S. coelicolor when
cloned into the high copy vector le702 (15). When this 2 kb fragment was

cloned into the low copy vector pIJ922, no Abs- clones resulted. A homologous

fragment was also isolated from wild type S. coelicolor which exhibited the Abs“

109
phenotype in high copy, thus the absA' background was irrelevant to the

phenotypic effect. The element was therefore named mia for multicopy
inhibition of antibiotic synthesis. This fragment was physically and genetically
mapped to the 2 o'clock position on the genome, distinct from both the absA

and absB loci (Fig. 1.1). To insure that all elements responsible for the Abs:

phenotype were contained within the 2 kb fragment, mia was cloned into a high

copy vector with terminators flanking the cloning site. This construct also

conveyed an Abs- phenotype to wild type J1501. Therefore no read-through
vector transcription is required for the phenotypic efiect of the 2 kb mia
fragment.

The Abs: phenotype conferred by mia was not a strain-specific effect.
The mia fragment in multicopy induced the Abs" phenotype in each of four S.

coelicolor strains tested. The mia fragment was also put into a high copy
transmissible vector and mated into the host, and the phenotype was shown to

be the same regardless of the method by which mia was introduced. To
determine whether antibiotic production in other Streptomyces species could be
similarly affected, mia was introduced into S. peucetius. This species also
produces multiple antibiotics, including daunorubicin, which has an activator
(dan) that is homologous to the actlI'ORF4 activator of the S. coelicolor
antibiotic actinorhodin. With mia in high copy, S. peucetius also demonstrated

an Abs“ phenotype. The results of a Staphylococcus aureus killing assay

suggested that in addition to daunorubicin, at least one other polyether

antibiotic was inhibited as well. Therefore, the global regulatory mechanism of

mia may be a common phenomenon across different streptomycetes.

1 10
Delimiting the mia locus

The 2 kb Bng fragment was reduced to a 1.2 kb Bng-SacI fragment

which also gave rise to the AbS“ phenotype in high copy. This DNA fragment
was sequenced (Lark Technologies) and the sequence analyzed using Wisconsin

Package Version 9, GCG, Madison, WI to construct further directed deletions.
The 1.2 kb mia sequence contained a 819 nucleotide partial open reading frame

(ORFY) truncated at the 3' end (Fig. 3.1, 3.2). However this ORF was shown to

be unessential for the phenotype after a deletion clone that contained 367 bp of

mia upstream of ORFY and a clone in which this ORF was disrupted by an out-

of-frame deletion each still conveyed the Abs“ phenotype.

Plasmid clones containing the 367 bp Sau3A fragment upstream of the
ORF and the 242 bp Sau3A-SmaI fragment each generated the Abs“ phenotype

in high copy, while the 125 bp SmaI-Sau3A did not give the Abs“ phenotype
(Fig. 3.1). The results of these cloning experiments defined the minimal
sequence shown to give the Abs' phenotype as the 242 bp BgLH-SmaI fragment.

Sequence analysis of this region revealed several features. A small 18 or 20
amino acid ORF was predicted using CODONPREFERENCE, but the codon
usage is such that it is probably not translated. Also the fragment contained
the 3’ end of another gene, designated ORFA. This truncated gene showed a
high degree of homology to a-galactosidase in the protein databases (6).

Finally, structural analysis revealed a 48 bp region containing a 19 bp perfect
inverted repeat. This stem loop structure was positioned 17 bp downstream of
the ORFA stop codon and may possibly function as a rho-independent

terminator for the ORFA gene although this has not been demonstrated.

111

Figure 3.1 Features of the mia locus. Relevant restriction sites within the mia
locus are noted relative to predicted open reading frames (arrows). ORFY
contains three possible GTG start sites (*). The relative location of the 48 bp
perfect inverted repeat region is shown. Fragments cloned into high copy
vector pIJ702 to evaluate the mia phenotype (Abs‘) are shown. The first three
clones were generated by restriction digestion (P. Riggle), and the lower four
were generated by PCR amplification using primers 1-5 (G. Brown). Primer
sites are noted with arrowheads
(" ). Preliminary promotor activity analysis is noted:

a Promoter activity evaluated in xylE vector; promoter activity in the

leftward orientation only.

b Promoter activity evaluated in xylE vector; orientation unknown.

s Promoter activity evaluated in promoterless Neor vector, orientation

unknown.

112

 

 

Oz I
5+ +
oz +
Q2 . +
Al I
9+ +
a + +
.0333 cabana—La
5588a 5.2:

 

 

 

 

 

Ram

VA AA
Vm N—

am Ewm

QM MOE
EN mom
.82 Mom

Q _ mom

amaam 3 m2
Assam S as

seam P Gm

 

855 s
pace—o Seaman.“

113

Figure 3.2 Nucleotide and amino acid sequence of the mia locus (5, 16). The

Bglll - Sac! region including the minimal mia sequence is shown. Primer
sequences used in cloning are highlighted in boldface. Start sites for ORF20
and ORFY are underlined. The location of the 19 bp perfect inverted repeats

are denoted (>> <<).

114

BglII/Sau3AI Primer 1 -+ PstI
1 AGATCTGGCAGCTGTGCGACGACATGGTCCGGGCTCACGGGGACCGGCTGCAGCCGGGGC 6O

61

121

181

241

301

361

421

481

541

601

661

721

781

841

901

961

1021

1081

1141

1201

I W Q L C D D M V R A H G D R L Q P G L

Primer 2 -+

TGCGGGGCGTACTCGCCCCCTGAGCCGCCGCCCGGCCGTGCTGGTGCGGCCCCGCGTACG
R G V L A P * Start ORF20 V L V R P R V R
End ORFA >>>>>>>>>>>>>>>>>>>
Primer 3 -+ ’ 4- Primer 4

120

GGGGAGAACGCGGGGCCGCACCAGCAAGCTATCGGAGTAATCGGCCGCCTGCCAGACCCG 180

G R T R G R T S K L S E * AGCCGGCGGACGGTCTGGGC
<<<<<<<<<<<<<<<<<<< End ORF20

SmaI

GCGCGTCCCCCGGCCGGTACGAGCCCCCCGTACCCGGCCGTCACCGGCGGGCTCCGCCCC
CGCGCAGGGGGCCGGCCATGCTCGGGGGGCATGGGCCGGCAGTGGCCGCCCGAGGCGGGG

+— Primer 5
GGGCTCGCACCGGGTGCCGTCACCCGGCCGGCGGACAGGAGCGTCGCCGGGAGCGGGAAG
CCCGAGCGTGGCCCACGGCAGTGGGCCGGCCGCCTGTCCTCGCAGCGGCCCTCGCCCTTC

CGCGGCGACGGCGCGCGCTGCGGGGCGGGCCGTGCGGCAACACACTGGGGTCATGGTTTG
GCGCCGCTGCCGCGCGCGACGCCCCGCCCGGCACGCCGTTGTGTGACCCCAGTACCAAAC

Sau3AI
CCCCGATCGCCGGCGGCGGTGTCACGGCGTTTCCCCGACGGGCCGGCAAGCGCGGCGGCG
GGGGCTAGCGGCCGCCGC Start ORFY

V S R R F P D G P A S A A A

 

GCCCGCCGGTTCGTGCGCACCGCGCTGGACGGTGCCGCCCGTGACCTGGTGGACACGGCC
A R R F V R T A L D G A A R D L V D T A

CAGCTCCTGGTCAGCGAGCTGGTCACCAACGCGGTGCTGCACGCGCGCACCGAGGTCGAG
Q L L V S E L V T N A V L H A R T E V E

GTGAGCGTTGCGCGTCTGGAGGGCCGGGTGCGCGTAGGGGTCGGGGACCGGCGGCCGGGC
V S V A R L E G R V R V G V G D R R P G

CGCGGCCTCGTACCGCAGCGCTGCTCGCCGTACGCCGGTACGGGGCAGGGTCTCGTACTG
R G L V P Q R C S P Y A G T G Q G L: V L

GTGGAGCAGCTGGCCTCGCCTTTCGGGGCGGACGGCGGCGACGGGGGCAAGACGGTGTGG
V E Q L A S P F G A D G G D G G K T V W

TTCGAGCTGTGGCACGACGGTCCGGCGCCGCCGTCCGCCGGGTGGGAGACCGCCGTGCCG
F E L W H D G P A P P S A G W E T A V P

CCGCGGCCCGCCGAACGGACCGTGACGCTGGTCGACATGCCGACCGCCCTGGAGTCCGCG
P R P A E R T V T L V D M P T A L E S A

TTCCGGCAGCACCGGCACGCGGTGCTGCGCGAGCTGACCCTCGCCGCGTCCGCGGGAGAC
F R Q H R H A V L R E L T L A A S A G D

Sau3AI
CTCCTCGGGGTGCCGCCCGAGGACCTCGTCGCGGCCAACGACGTCAACAACGTGATCAGC
L L G V P P E D L V A A N D V N N V I S

GCCGGTGTGTCGGCCGCGCCGGCGGGACCTGCCTCCGAGTCCGGTCTGCGCACCCTGCCC
A G V S A A P A G P A S E S G L R T L P

CTCCCGCTGTCGGCCGACGCCCTGCCGGCGGTGCGGGCGCTGCGCCGCGTACTGGACCTG
L P L S A D A L P A V R A L R R V L D L
SmaI
GCCGAGGCCCGGGCCGGGGAGGAACGGCTGCTCACGCTTCCGGCCCTGCCCCGCGGCCGG
A E A R A G E E R L L T L P A L P R G R
Sau3AI
GCCTTCCAGAACTGGCTCTTCGACGAGATCGCCGGGCAGCTGGCCGGGGACCGGCCCACC
A F Q N W L F D E I A G Q L A G D R P T
SacI
GCGTGGACCGTGGTCCCCCGCGCGCCCGAGGTCAGCTCCGCCGAGCTC 1248
A W T V V P R A P E V S S A E L '

240

300

360

420

480
540
goo
geo
320
280
§4o
900
960
3020
1080
i140

1200

l 1 5
In an attempt to further delimit the mia locus, PCR generated fragments

were cloned into pIJ702 (15). The smallest fragment able to convey the Abs'
phenotype in multicopy was amplified from primers 2 and 4, to yield a 120 bp
insert (Fig. 3.1). This fragment retained the ORF20 and the 48 bp inverted

repeat region, but eliminated all but the last four amino acids of ORFA.

Features of the mia locus

Promoter probing of the mia locus.

The 367bp BamHI-Sau3A mia fragment was cloned into xylE reporter
vector pXE4 in each direction to determine whether the fragment contained any
promoter activity. The fragment showed promoter activity by producing yellow
pigment in the presence of catechol only when cloned in the leftward
orientation (see Fig. 3.1). Thus there appears to be a promoter directing
transcription away from ORF20 and ORFY. Because this assay was qualitative,
the possibility of promoter activity directing transcription towards the ORFs
cannot be ruled out. Alternatively, the ORFY promoter may be contained
between the Sau3A site and any of the three possible GTG start sites (between
15-104 bps).

The 242 bp and 125 bp fragments were also tested for promoter activity
(Fig. 3.1). The 242 bp fragment was shown to contain promoter activity when
cloned in front of the promoterless xylE gene, while the 125 bp fragment did
not. In this preliminary experiment the orientation of the fragments was not

determined (16).

1 16
Additionally, the 120 bp PCR-generated fragment (2 / 4) was cloned into a

plasmid vector, pIJ487, in front of a promoterless neomycin resistance gene.

This fragment was able to drive the expression of the Neor gene to permit
growth on the antibiotic, but the orientation of the fragment has not yet been
determined (Fig. 3.1; (5)).

While more detailed characterization of promoter activity is required,

these preliminary experiments indicate that the small mia fragment is a

complex sequence.

Secondary structure of the mia sequence.

Secondary structure analysis of the small 120bp minimal mia sequence

reveals a complex predicted structure centered around the 19 bp inverted
repeat. The RNAFOLD (Wisconsin Package Version 9, GCG, Madison, WI)

predicted secondary structure is pictured in Figure 3.3.

Possible mechanisms for mia

The phenomenon of multicopy inhibition of the antibiotic synthesis by
the mia locus suggested three possible mechanisms. First, the mia locus could
encode a gene whose product, when overexpressed on a multicopy vector,
exerts an inhibitory effect. Examples of a similar outcome include the spoOF
gene product of Bacillus subtilis which was shown to inhibit sporulation when
cloned in multicopy (12), and nif gene expression in Klebsiella pneumoniae

was shown to be inhibited by the overexpression of the

117

 

 

 

 

 

 

 

 

 

Figure 3.3 Secondary structure prediction of the 120 bp minimal mia
sequence. RNAFOLD of the Wisconsin Package Version 9, GCG, Madison, WI

was used to compute the structure, which has a AG of -57 .3.

1 l8
NifL protein from a multicopy clone (7). However, results to date suggest that

this is not a likely mechanism for mia. The ORF20 located within the minimal
mia sequence contains several rare codons that are not likely to be translated
in Streptomyces. In a second possible mechanism, the mia DNA sequence
could contain a binding site which, in high copy, titrates out a positive
regulatory factor, as was shown for spoVG of B. subtilis (3) and for the nitrogen

fixation genes nifH and nifU of K. pneumoniae (8). This mechanism also allowed

for the isolation of the oWhiG ' dependent promoters in S. coelicolor by titrating
out the oWhiG RNA polymerase holoenzyme when cloned in high copy to give a
"white" phenotype (20). Preliminary evidence suggests however that
transcription of the mia locus is required for the Abs' phenotype. When the
mia sequence was cloned downstream of the thiostrepton-inducible pTipA

promoter, the Abs' phenotype was seen only in the presence of thiostrepton,

which induces transcription of the locus (6). This would suggest that a
transcript is required for the mia effect. In a third possible mechanism for mia,
the inhibition could be the result of an overexpressed regulatory RNA. Through
multicopy inhibition, the micF gene of Escherichia coli was shown to produce an
antisense RNA that bound to the translational start region of the ompF mRNA
to inhibit its translation. This system, in wild-type E. coli, is thought to
represent a translational control mechanism for osmoregulation (14). A similar
antisense RNA mechanism was discovered for 1810 of transposon TnlO,
through multicopy inhibition (19). A regulatory RNA has been isolated from S.
fradiae which activates the production of actinorhodin when cloned in high

copy in S. lividans (18). Although the S. lividans genome does encode the

actinorhodin gene cluster, Act is not normally produced by that strain. This

1 19
132 nt RNA has been predicted to function as an antisense RNA. An analogous

gene, encoding an 86 nt transcript, has been isolated from S. lividans and

similarly induces Act production in high copy in that strain (17). While the
phenomenon of multicopy inhibition has proven to be a useful tool in the
isolation of novel genes, an understanding of the mechanism could lead to the

discovery of new regulatory pathways. Furthermore, the fact that this
antibiotic inhibition by mia is global, affecting distantly located gene clusters,

makes the mechanism of mia all the more intriguing.

Future directions for the characterization of mia

Future experiments will focus on deciphering which of the above

mechanisms is integral to mia. To discern whether a gene product (either an

RNA or a protein) is needed for the mia effect, further characterization of the
fragment downstream of the pTipA inducible promoter will be performed. If the

minimal mia fragment, cloned downstream of the chromosomally-integrated

pTipA, is able to induce the Abs' phenotype in one orientation only, then either

a regulatory RNA structure or the ORF20 product could be required. However,

the ability of the fragment to induce the Abs" phenotype in both orientations
would suggest involvement of the stem loop, as the structure would not be
affected by the orientation of the cloned insert. Additionally, site-directed
mutagenesis could eliminate the ORF20 while maintaining the structural

integrity of the stem loop formed by the 19 bp inverted repeat, since a single

base change within the loop region (A125 —-)T125, Fig. 3.2) would create a stop

120
codon within ORF20 while maintaining the stem loop structure. If this

sequence is still capable of conveying the Abs- phenotype, then the stem loop
structure is more likely to be the crucial element involved in the mia effect.

If the results of the above experiments suggest the involvement of the

stem loop structure in the Abs' phenotype, then the possibility of interaction
between the absB gene product and mia will be investigated. The absB gene,
when mutated, results in global blockage of antibiotic production. The absB
gene encodes a putative Ribonuclease III homolog (see Chapter 2). RNase III,
as it has been characterized in E. coli and B. subtilis, is an endoribonuclease
that cleaves duplex RNA. It functions in the processing of rRNA precursor into
the 16S and 238 subunits, and also processes certain mRNA transcripts to
regulate gene expression by modulating mRNA stability. The substrate for this
enzyme in vivo is the stem region of particular stem loop structures. While
most RNA molecules form stem loops, only a small fraction are recognized by
RNase III. Yet the specific features required for enzyme recognition have eluded
definition. It appears that sequence and structural components are important.
It is tempting to speculate that the mia stem loop could be a substrate

for the AbsB protein. If AbsB is required for antibiotic regulation, the mia stem

loop in high copy might titrate out the protein resulting in the Abs' phenotype.
Several experiments could determine if mia and the AbsB protein interact.

Cloning the absB gene in multicopy into the intergrated pTipA-mia construct
may determine whether the mia stem loop sequesters the AbsB protein. If mia
titrates limited concentrations of AbsB in the cell, then overexpression of the
AbsB protein in the mia clones might relieve the mia effect. Also, in the absB

mutant C120, rRNA processing appears to be adversely affected. As is seen for

121

RNase III mutants in other systems, the 308 rRNA precursor molecule is seen
in the absB mutant indicative of inefficient rRNA processing. While additional
experiments need to precisely define this rRNA processing deficiency, it would
be of interest to determine whether rRNA processing is aflected in wild type S.
coelicolor carrying mia in high copy. If mia titrates the AbsB protein from a
presumed function in antibiotic production, it might also sequester AbsB from

rRNA processing function.

10.

11.

12.

1 2 2
Literature Cited

Adamidis, T., and W. Champness. 1992. Genetic analysis of absB, a
Streptomyces coelicolor locus involved in global antibiotic regulation. J
Bacteriol. 174(14):4622-8.

Adamidis, T., P. Riggle, and W. Champness. 1990. Mutations in a new
Streptomyces coelicolor locus which globally block antibiotic biosynthesis
but not sporulation. J Bacteriol. 172(6):2962-9.

Banner, C. D., C. P. Moran, Jr., and R. Losick. 1983. Deletion analysis
of a complex promoter for a developmentally regulated gene from
Bacillus subtilis. J Mol Biol. 168(2):351-65.

Brian, P., P. J. Riggle, R. A. Santos, and W. C. Champness. 1996.
Global negative regulation of Streptomyces coelicolor antibiotic synthesis
mediated by an absA-encoded putative signal transduction system. J
Bacteriol. 178(11):3221-31.

Brown, G., and W. C. Champness. 1997. Unpublished results.

Brown, G., B. Price, P. Riggle, and W. Champness. 1997. In
preparation..

Buchanan-Wallaston, V., M. C. Cannon, and F. C. Cannon. 1981. The
use of cloned nif (nitrogen fixation) DNA to investigate transcriptional
regulation of nif expression in Klebsiella pneumoniae. Mol Gen Genet.
184(1):102—6.

Buck, M., S. Miller, M. Drummond, and R. Dixon. 1986. Upstream
activator sequences are present in the promotors of nitrogen fixation
genes. Nature. 320:374-378.

Champness, W., P. Riggle, T. Adamidis, and P. Vandervere. 1992.
Identification of Streptomyces coelicolor genes involved in regulation of
antibiotic synthesis. Gene. 115(1-2):55-60.

Chater, K. F. 1990. The improving prospects for yield increase by
genetic engineering in antibiotic-producing Streptomycetes.
Biotechnology (N Y). 8(2): 1 15-21.

Hutchinson, C. R. 1987. The impact of genetic engineering on the
commercial production of antibiotics by Streptomyces and related
bacteria. Appl Biochem Biotechnol. 16: 169-90.

Lewandoski, M., E. Dubnau, and I. Smith. 1986. Transcriptional
regulation of the spoOF gene of Bacillus subtilis. J Bacteriol. 168(2):870-
7.

13.

14.

15.

16.

17.

18.

19.

20.

123

Merrick, M. J. 1976. A morphological and genetic mapping study of bald
colony mutants of Streptomyces coelicolor. J Gen Microbiol. 96(2):299-
3 15.

Mizuno, T., M. Y. Chou, and M. Inouye. 1984. A unique mechanism
regulating gene expression: translational inhibition by a complementary
RNA transcript (micRNA). Proc Natl Acad Sci U S A. 81(7):l966-70.

Riggle, P., G. Brown, B. S. Price, and W. C. Champness. 1997.
Multicopy inhibition of global antibiotic production in Streptomyces
coelicolor by the mia locus. In preparation.

Riggle, P., and W. C. Champness. Unpublished results.

Romero, N. M., and R. P. Mellado. 1995. Activation of the actinorhodin
biosynthetic pathway in Streptomyces lividans. FEMS Microbiol Lett.
127(1-2):79-84.

Romero, N. M., V. Parro, F. Malpartida, and R. P. Mellado. 1992.
Heterologous activation of the actinorhodin biosynthetic pathway in
Streptomyces lividans. Nucleic Acids Res. 20(11):2767-72.

Simons, R. W., and N. Kleckner. 1983. Translational control of 1810
transposition. Cell. 34(2):683-91.

Tan, H., and K. F. Chater. 1993. Two developmentally controlled
promoters of Streptomyces coelicolor A3(2) that resemble the major class
of motility-related promoters in other bacteria. J Bacteriol. 175(4):933-
40.

CHAPTER 4

The Regulation of Doramectin Production in Streptomyces avermitilis:

A Biotechnology Training Program Internship

124

1 2 5
INTRODUCTION

The Biotechnology Training Program at Michigan State University enrolls
students who have a career interest in biotechnolOgy within a wide range of
fields. The program, partially funded by the National Institutes of Health, offers
students the opportunity to explore the specific problems of biotechnology that
have current industrial relevance. To do this, students take biotechnology-
related coursework and participate in a biotechnological research internship for
two semesters. This internship is arranged by the student, his / her mentor,
and an industry researcher. Research performed during the internship is
preferably directly-related to the student’s thesis program, though not a
necessity.

This manuscript describes research conducted as a requirement for the
Biotechnology Training Program in the laboratory of Dr. Kim Stutzman-Engwall
at Pfizer Inc, in Groton CT. Pfizer Inc. is one of the worlds leading
pharmaceutical companies in human and animal health. Dr. Stutzman-
Engwall’s research focuses on the genetics of secondary metabolites produced
by Streptomyces avermitilis that are used in the animal health industry.

S. avermitilis was shown in 1979 to produce a family of eight closely
related compounds with anthelmintic properties called the avermectins (Fig.
4.1) (1). Each compound differs in composition at positions C5, C22-23, and

C26 according to the following designations: “A” or “B” denote -CH3 or -H at R1

126

 

4‘ 0°“:
9‘ t'
--o
vac o \,
f a
me O
H.6’
I. I. M!

 

Am Ma CH, CAI, aka:
Alb Oi, O4, Cit-OI
A2- in cm, ore-cruel!)
A1) a GI, mom
II. C") C38; (Tl-CH
3" 0': a": 01-0:

 

I2: H cm, cumom
la a 01, cumom
hmlla H cm, 01,01,
in. u 01, 01:06;

 

Figure 4.1 The general structure of the avermectin family. Variations in the

structure of each compound is noted. Adapted from (3).

127
respectively; “1” or “2” denote -CH=CH- or -CH2-CHOH at X-Y; and “a” or “b”

denote -CH2CH3 or -CH3 at R2. They also undergo a glycosylation step that
adds the disaccharide oleandrose to the C13 position. Characterization of
these compounds has revealed a broad spectrum} of activity against various
nematode and arthropod parasites, thus increasing the commercial importance
of these compounds.

Doramectin, commercially marketed as DectomaxTM, is one derivative of
the avermectins that has exhibited expansive market growth since its US.
launch in June, 1996. Currently marketed in an injectable form for the
eradication of parasites in cattle, DectomaxTM sales in the first quarter of 1997
increased 125% to $27 million over fourth quarter 1996 earnings. According to
the Pfizer 1996 Annual Report, the projected market for this product is $1.6
billion dollars worldwide. Currently under regulatory review are injectable
forms for sheep and swine, and topical (“pourable”) applications for cattle. The
introduction of these products will insure Dectomax’s position as the keystone
product for the Animal Health Care Division earnings.

The avermectins (Avm) are produced by a type I polyketide synthase
(PKS) which is a large multifunctional protein complex and is thought to
function analogously to type I fatty acid synthase (FAS) (2). The avermectins
are produced by the stepwise addition and condensation of 12 acyl units (5
proprionates and 7 acetates) to a starter unit of isobutyl or 5-methyl butyryl,

followed by cyclization of the 16 membered ring (4).

128
The gene cluster for Avm biosynthesis is 95kb in length, and has a

highly organized structure (Fig. 4.2) (4). Each of the two PKS subunits contain
6 modules; these modules specify the condensation and modification of each
acyl unit addition. Flanking the PKS subunits are the genes for the
glycosylation of the avermectins, and the C5 O-methyl transferase.

While the biosynthesis of the avermectins has been the subject of
intensive investigation, relatively little is known about how the PKS gene
cluster is regulated in S. avermitilis. Like other streptomycete secondary
metabolites, the production of avermectin is regulated to the onset of stationary
phase. In 1993, MacNeil et. a1. published a paper in which they made a host of
gene cluster replacements throughout the avermectin locus to functionally map
the region (5). Three of the clones containing deletions to the left of the PKS
gene completely inhibited avermectin production and were not able to be
complemented by the addition of any avermectin intermediates. They
concluded that this region might contain a pleiotropic regulator for avermectin
production. The minimum deletion giving this phenotype was 7.8 kb. In 1995,
Ikeda et.al. published a similar finding, in which a 10 kb deletion upstream of
the PKS (overlapping the 7.8 kb fragment of (5)) was not able to be
complemented (3). They noted that mutants with this deletion could not
methylate or glycosylate avermectin substrates even though these genes were
intact in the clone. They therefore concluded that a positive regulator may

reside here. Thus two researchers independently identified an 8 kb region

129

upstream of the PKS cluster as a putative regulatory region based on the fact
that clones with deletions in this region had no PKS, OMT, ring formation, or
glycosylation activity and could not be rescued by the addition of any

intermediate substrates. This region was named aveR.

Project Goals

Characterization of the and! region.

In an attempt to identify any regulatory elements of PKS, the aveR region
was studied further. A multi-pronged approach was designed to study PKS
regulation during the internship. The first strategy was to construct and
sequence various plasmid clones containing subfragments of the aveR region.
Sequence analysis of the aveR DNA would identify any putative regulatory
genes for targeting in subsequent deletion clone construction.

In lieu of DNA sequence data, detailed restriction mapping of the aveR
region revealed potential sites for the construction of deletion subclones. Gene
replacement with the erythromycin cassette, ermE was planned to generate
various knockout mutants within this region.

One final project involved developing a tool for studying any

perturbations of PKS regulation. The avermectins, unlike Act and Red for

130

Figure 4.2 Physical map of the gene cluster for avermectin biosynthesis in
Streptomyces avermitilis. Arrows denote transcripts of genes needed for
avermectin biosynthesis: aveAl and aueA2 encode PKS. Each PKS transcript
contains six modules (boxes) and each module encodes functions as noted (AT,
acyltransferase; ACP, acyl carrier protein; KS, B-ketosynthase; KR, B-
ketoreductase; DH, dehydratase; TE, terminal thioesterasease). Adapted from

(3.5)

131

 

 

 

Bk.
~U< fiU< 90¢ LU< QU< hU< I!
QU< I! II a I! la- EU< 39¢ EU< I! h<
a h0< HO 2 :9 =9 :9 a h: I! :6 ml
.5 .5 5 5 5 5 .5 r5 .5 .5 5 a5
ml 3 m8 n8 g ml “I W! W8 W! n! 52
e. 3 3.. 3 3 3 3 3 a: 3 an 3 3
Illllll nunaununnunnnunuunnnu nHHUHHHHHHHHHHHHHHHU
n9. or a. a a 2 = 2 o a v n a _
Alllllll .0:
v .11
TJ a) 41 qldJifia a a aqlfi 41,44 a.J1 (J 14 iI1I4JqJII4‘J
was... SB: 325 to).
coasiuouxa ooze»- og 306:». 033»:
w .095 k .026 ecu-3?:
eon-etc. act csSu c0326!
cos-.133.” cue-$62..

 

 

 

132

S. coelicolor, are not pigmented compounds. Assays for the presence of the
avermectins require a three week long fermentation followed by several
intensive days of product isolation, and finally, characterization by HPLC. In
an attempt to simplify a method for determining PKS expression, a method for

generating a xylE fusion to the PKS was designed.

Results and Discussion

Of the above approaches, the sequencing project proved to be the most
successful. Five plasmid subclones containing various fragments of the aveR
region were submitted for sequencing, carrying a total of 11.5 kb of insert DNA.
Results were compiled with previously determined sequence, to yield 12.9 kb of
continuous DNA sequence inclusive of the aveR region. This DNA sequence
was analyzed for putative open reading frames using the Wisconsin Package, v.
9, GCG Group. Seven Open reading frames were predicted, as shown in Figure
4.3. (Details of the sequence have been withheld pending publication of the
final results.) When compared to deletion clones reported previously (3, 5), the
Regl ORF probably lies outside the boundary of the PKS locus, as deletions in
this region were reported to have no effect on Avm production. Therefore the
six remaining ORFs had potential involvement in Avm production. Computer-

assisted homology searches were carried out for each ORF to attempt to gain

133

Figure 4.3 Schematic diagram of the aveR region. Open reading frames
predicted by CODONPREFERENCE are indicated with arrows. Previously
characterized genes are shown as hatched arrows and are labeled: PKS,

polyketide synthase; OMT, O-methyl transferase; KR ketoreductase.

134

va

e:

E0 my.

33.

Sam

Bum

 

135

clues about their possible functions. Four of the seven genes showed homology
to proteins in the protein databases that were reportedly involved in secondary
metabolism in other systems. The contribution of each of these genes to Avm
production is under current investigation. The remaining three ORFs had no

homologs in the databases.

xylE - PKS reporter fusion

To generate a xylE-PKS fusion strain, a xylE cassette and the PKS
Module 1 were sequenced. This provided the information needed to design an
in frame insertion of the xylE cassette within the PKS transcript. One caveat to
this project was the fact that recombination within the PKS region is extremely
low, presumably a necessity given the extensive homologies between each
module in the PKS locus (Fig. 4.2). This fact made insertion of the xylE
cassette within this coding region technically more difficult. Though not
completed during the internship, this project has been continued by another
researcher. The construction of this reporter gene fusion would simplify the
assay for PKS expression from a costly four week procedure down to five days

required for growth of the strain.

136

Conclusions

The goal of this internship was to experience scientific research from a
market-driven viewpoint. The opportunities to participate in strategy sessions,
quarterly report meetings, and budget planning sessions afforded me that
opportunity.

In addition, I was given the opportunity to apply my knowledge of
secondary metabolite regulation in Streptomyces to a commercial strain that
generates millions of dollars each year in company revenues. While the
preliminary results of this work are awaiting completion to be submitted for
publication, it will be interesting to see if perturbations of any of the genes
discovered will affect avermectin production levels, or have any effect on the

final product.

137
Literature Cited

Burg, R. W., B. M. Miller, E. E. Baker, J. Birnbaum, S. A. Currie, R.
Hartman, Y. L. Kong, R. L. Monaghan, G. Olson, I. Putter, J. B.
Tunac, H. Wallick, E. O. Stapley, R. Oiwa, and S. Omura. 1979.
Avermectins, new family of potent anthelmintic agents: producing
organism and fermentation. Antimicrob Agents Chemother. 15(3):361-7.

Hopwood, D. A., and D. H. Sherman. 1990. Molecular genetics of
polyketides and its comparison to fatty acid biosynthesis. Annu Rev
Genet. 24:37-66.

Ikeda, H., and S. Omura. 1995. Control of avermectin biosynthesis in
Streptomyces avermitilis for the selective production of a useful
component. J Antibiot (Tokyo). 48(7):549-62.

MacNeil, D. J., J. L. Occi, K. M. Gewain, T. MacNeil, P. H. Gibbons,
C. L. Ruby, and S. J. Danis. 1992. Complex organization of the
Streptomyces avermitilis genes encoding the avermectin polyketide
synthase. Gene. 115(1-2):119-25.

MacNeil, T., K. M. Gewain, and D. J. MacNeil. 1993. Deletion analysis
of the avermectin biosynthetic genes of Streptomyces avermitilis by gene
cluster displacement. J Bacteriol. 175(9):2552-63.

"IIIIIIIIIIIIIII“