... fiasfififimugfi.fi . 2 . - .

I)! .....1 ($64.! 31‘... 11. A ,4

1 $1.( 1 I... L 11.. Lil.“ cola”)! gf.1f
-..}. . .. .... . ......3..m........u.. ..

       

...r 1’." ..

 

       

‘ “MT . .
VI AiA.‘
. u.» I WE: 8....
.914 ... ‘1. r7. HafiszL
11.7““ ...... .
- ...... {1.3.1.}. I
.13“ t.

           

 

  

E.h\ ' n .

rv- nHN't-‘un:i I!!!)
(I! 'lblllqtulutvu'l: “5!
(7.019;) .033. 11:00.. .
317.137?1. 6 ID”). 11.01.
. .AE. . Ihl'l
V . v. I... .I.. ...-130...]
..I 0). vt|if=luil '3'] .
fish. ‘1. {.151 Iluot.l..v0‘.i 9. ll!" 2
LA - ..lvll}. 30“ .

. 1' z .
.. . isllérouli §llx1.lnx .
. . SI .NhevujwflsUIsvgvlnlt J t v.
.u .. : unfillnl kl: vial-Igf‘rfli ail.
.. . .7...\

     
 

             

 

‘Q. .l.‘ .
Ottw-Ts ::
. ilrsfi‘VJ

          

.M 6t. OI . IDIIIvl-é

‘IoQIfT‘uOA J!) .l W‘Mfltlz’Y It... .7 ll
Io§|\\\t}l£0 ..VO It" ~.5..." nl
.nlzll.)§4l§$'\.).l§§ ll. 0 MN

 

     

. Hixu . .
.1. .122. ‘1‘.
. (\Pl, 0. ....l
‘r.InP.s.I
011$! 5 H

       

 

      

kl I-
... .‘ilp It‘ll-It 4

   

    

. 53‘»?! Gilt wits“: ... v. .
...olviiviltfifb)‘ 0.? All .I‘lll.~||‘!
. .b"3fillt§;l~i 5..- to.
.':L\..l.b§i 7». i: 4". .IDAII‘ .Illhfl...‘ ’ :0
«117.825,! (I‘si‘lll? 0"“... .l I‘I‘nb' \1
n 11‘333. 6935a 51" .f .f.qu||l|-Auu ‘1."
.¢}A.§lifl\£l\|rriavt.x.lnl . (3.10%... » .lv {( -(llivLSiI.
. c }.-j :0 I In. ‘fit‘bi’
.. i ulr “My . 1 a.x‘)\n:}uxl|;a
..b 1" 21 I‘V.V lf\lnb\.
.. b A .. : |.s\!.‘l
«rd

     

.. 0'? s n. ..
, .Iv‘: if... «Qt; v
Lida?“ li‘anllo?b\3. rillhlt
...r .....4’..:,l\ okib'.‘ 91.210111 r71:
V1inul'.t¥?ti .fisli $.O al-vualut I I ...-bill.
. .. . {3.1.1.1 I. if; 69. ‘1 .a.
3). . A “wot‘i‘dfill

 

      

Fr;

.2
g.
{I .

        

i‘; u“
I
- .%
£5
:5
i
E.

e‘:
%:
£2
. .92;
‘fi

              

5
m
7?.

III... A
tin-‘9...” 1.01,.
......l

  

n!\.|.l.a:l..t . I...) .. vvvvv
.. ll.t.‘ni.n.l*‘£-..)7$u(’ illfl‘ I
2 . ‘I. .3" «If

      

:’...I . .l..nr.\l’.s.,l lit!

lwrrith‘.‘ .ISV‘II»:b .nlll. . ..
37. 1.1 ...“: 7| too-xi! )\r. .. .. .

.. . . . .u‘l‘l\}|ltl|lulll.1l‘|.¥yl l.

. . . v‘rlvA'le.

 

 

      

 

LILA

 

       

.-. ... .
. . at. ......I. . 1 .
{xvii}. .- $7..-. I I!
. | . ..viv . .-. 1 13A)-..|.-1.sil2.

.....Aatn

 

 

13333.: . ugly}... (i-£.{w. i..|..(lilt.\.t9 .-.!{T1lit .
11‘}.-. . . .r-(...x:./Irl:li$r.rlifl.h..l, i .59.:‘13-’ .2 3...! \II
$0..\.~..!bnv....11.t»yu.x\ as! 4 Elvlarl .... 54h): 2§lu:l.!.tl)N||HU»vl!lE.||\I. ..
...? .v:v.l‘.l§>~..:‘5t. 12,. .Ff‘itt...on 3f..!&|l..r¥iv(llbl.ill|! .
. , . . 2 . . . . . . 132-..... .11.“: 15.12.16.315 ..Z\..l|...‘l

    

I

 

 

xivirrwfie ......ma ,1:

  

av ‘1‘ u

 

WESiS

Date

GAN ATE UNIVERSITY LIBRARIES

lllllmllllmlmm Will

3 1293 01575 0478

 

l

 

 

 

 

 

 

 

 

 

 

 

 

This is to certify that the

thesis entitled

DNA Science in the High School Classroom

has

presented by
Christopher P. Forbush

been accepted towards fulfillment
of the requirements for

 

 

MS Jegree in Interdepartmental
Biological Science
‘v V/
Major professor
6-June 1997

 

 

0-7639

MSU is an Ajfirmativo Action/Equal Opportunity Institution

 

 

LIBRARY

Mtchlgan State
University

 

 

PLACE IN RETURN Box
to remove this checkout from your record.
TO AVOID FINES return on or before date due.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1/93 WW.965—p.14

DNA SCIENCE lN THE HIGH SCHOOL CLASSROOM
By
Christopher P. Forbush

THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

MASTER OF SCIENCE
Department of Science Education
1997

ABSTRACT
DNA SCIENCE IN THE HIGH SCHOOL CLASSROOM
By
Christopher P. Forbush

As science technology becomes more of a focus in the high school
classroom, it was my intention to develop and implement a unit based on
DNA science and technology. This unit includes new and exciting
strategies that involve students working in groups on problem solving
skills, and scientific technical skills within the context of DNA science. I
have blended in several situations that the students can appreciate as
they take advantage of "real life" situations and problems concerning
Recombinant DNA. Assessment is through oral presentations and written

work.

Dedicated to Audrey, Samantha and Nicholas

ACKNOWLEDGMENTS

After taking the Cell Molecular Biology for Teachers course at
Michigan State University, my mind was made up. At that point in time i
realized how important it was for me to develop a unit on DNA science.
Taking on this endeavor, was a challenging and satisfying task. I received
constant support and motivation from many people.

First, Dr. Merle Heidemann was very supportive throughout the
entire process. She has been a constant resource in the classroom,
during my research and finally in writing this thesis. The staff at
Fowlerviile High School has provided me with constant guidance while I
worked to improve the unit and to utilize the computer in developing this
document. Finally I would like to express my genuine appreciation to my
family. My wife and my children provided me with unfailing support,
encouragement and patience. THANK YOU.

TABLE OF CONTENTS

LIST OF TABLES .............................................................................. vii
LIST OF FIGURES ............................................................................ viii
INTRODUCTION .............................................................................. 1
COURSE OUTLINE ........................................................................... 5
STUDENT CONCEPTS ..................................................................... 7
IMPLEMENTATION ........................................................................... 12
EVALUATION .................................................................................... 16
DISCUSSIONS AND CONCLUSIONS .............................................. 28
COURSE CONTENT
DISCUSSIONS AND CONCLUSIONS .............................................. 31
LOOKING TO THE FUTURE
APPENDIX l - SCIENCE BACKGROUND ......................................... 33
LECTURE MATERIAL
SECTION I - Structure of DNA .............................................. 33
SECTION II - Replication of DNA .......................................... 35
SECTION III - From DNA to Protein ...................................... 37
SECTION IV - Recombinant DNA Technology ...................... 40
SECTION V - DNA Sequencing, PCR and Gel
Electrophoresis .............................................. 42
SECTION VI - DNA Fingerprinting ........................................ 44

APPENDIX II - LABORATORY ACTIVITIES ..................................... 47
INCLUDES TEACHER SECTIONS

SECTION I: Basic DNA Stmcture Drawing ............................ 47
SECTION II: Basic DNA Replication Drawing ....................... 48
SECTION III: Isolation of DNA From Onion ........................... 49
SECTION IV: How Big is the Human Genome ...................... 54
SECTION V: How Genes Make Proteins ............................... 57
SECTION VI: Gel Electrophoresis using Dyes ...................... 64
SECTION VII: Palindromes - Backwards and Forwards ........ 71
SECTION VIII: Constructing 3 Restriction Enzyme Map ....... 75
SECTION IX: Making a Recombinant Plasmid ...................... 81
SECTION X: DNA Fingerprint Comparison ........................... 90
SECTION Xl: Cards for How Genes Make Proteins .............. 92
APPENDIX III - ASSESSMENT ......................................................... 99
SECTION I: DNA Science Questionnaire .............................. 99
SECTION II: DNA Pretest ...................................................... 100
SECTION III: DNA Postest .................................................... 102
SECTION IV: Teacher Unit Survey ....................................... 107
BIBLIOGRAPHY ................................................................................ 109

vi.

LIST OF TABLES

Table 1 - Percent Changed Of Topics Learned ................................. 21
Table 2 - Ranking The Percent Changed .......................................... 2

vii

LIST OF FIGURES

Figure 1 - Basic DNA Structure Drawing ........................................... 47
Figure 2 - Basic DNA Replication Drawing ........................................ 48
Figure 3 - Electrophoresis Chamber ................................................. 65
Figure 4 - DNA Fingerprint Comparison 1 ......................................... 90
Figure 5 - DNA Fingerprint Comparison 2 ........................................ 91
Figure 6 - DNA Protein Synthesis Card ............................................. 92
Figure 7 - DNA Protein Synthesis Card cont ..................................... 93
Figure 8 - mRNA Protein Synthesis Card .......................................... 94
Figure 9 - mRNA Protein Synthesis Card cont .................................. 95
Figure 10 - tRNA Protein Synthesis Card .......................................... 96
Figure 11 - tRNA Protein Synthesis Card cont .................................. 97
Figure 12 - Amino Acid Protein Synthesis Card ................................ 98

viii.

APPENDIX I

SCIENCE BACKGROUND
Lecture Material
SECTION I - Structure of DNA .............................................. 33
SECTION II - Replication of DNA .......................................... 35
SECTION III - From DNA to Protein ...................................... 37
SECTION IV - Recombinant DNA Technology ...................... 40
SECTION V - DNA Sequencing, PCR and Gel
Electrophoresis .............................................. 42
SECTION VI - DNA Fingerprinting ........................................ 44

ix

APPENDIX II

LABORATORY ACTIVITIES
Includes Teacher Section
SECTION I: Basic DNA Structure Drawing ............................ 47
SECTION II: Basic DNA Replication Drawing ................... 48
SECTION III: Isolation of DNA From Onion ........................... 49
SECTION IV: How Big is the Human Genome ...................... 54
SECTION V: How Genes Make Proteins ............................... 57
SECTION VI: Gel Electrophoresis using Dyes ...................... 64

SECTION VII: Palindromes - Backwards and Forwards ........ 71
SECTION VIII: Constructing a Restriction Enzyme Map ....... 75

SECTION IX: Making a Recombinant Plasmid ...................... 81
SECTION X: DNA Fingerprint Comparison ........................... 90
SECTION XI: Cards for How Genes Make Proteins .............. 92

APPENDIX III

ASSESSMENT
SECTION I: DNA Science Questionnaire .............................. 99
SECTION II: DNA Pretest ...................................................... 100
SECTION III: DNA Postest .................................................... 102
SECTION IV: Teacher Unit Survey ....................................... 107

xi

INTRODUCTION

It almost didn't happen. In 1951 a young and very shy biochemist,
a man who had the ambitions to isolate himself on a wildlife refuge, met
an English physicist, who fortunately was a very outgoing person. Within
minutes the two were in deep conversation about deoxyribonucleic acid.
James Watson, our 24 year old "shy guy" had just started a long term
relationship with the scientist Francis Crick. This scientific partnership
developed for more than two years as they carried out an intensive and
successful study of the DNA molecule at Cambridge University.

It almost didn't happen. Watson and Crick were very close to
missing quite possibly one of the world's greatest scientific discoveries.
With the help of Rosalind F ranklin, a genius of crystallography at King's
College in London, they developed a model of the DNA molecule. Many
scientists were working on the model at the same time but Watson and
Crick were published well before anyone else. I feel it was their diverse
personalities that allowed them to talk, exchange, and brainstorm their
ideas that finally led to their success. This free exchange of knowledge
and information is the very nature of science.

Being able to share and exchange ideas and viewpoints with
others is paramount in the field of science. Good communication is one of
the most important tools that can be used in this process of figuring out
puzzles. Watson and Crick had solved a puzzle that for years had
stymied scientists (Jaroff 56). By finally apprehending the double-helix
structure of deoxyribonucleic acid, the giant molecule of heredity, they

had paved the way to a leap forward in human understanding of the
processes of life (Jaroff 57).

The collaborative effort put forth by these two gentlemen has had
an incredible impact on the world. In 1973 the first technique for
recombining genes was patented, setting the stage for the biotechnology
revolution and the industry built on it.

Since then the field of biotechnology and recombinant DNA has
progressed by leaps and bounds. The birth of the first genetic
engineering company, Genentech, and the identification of the first cancer
causing gene both occurred in 1976. In 1977 a human hormone was
successfully produced in bacteria using recombinant DNA techniques.
The next year the gene for human insulin was cloned. Next "Genetic
F ingerprinting" was introduced and was being used for criminal
investigation in Britain during the year of 1985. Five years later the
National Center for Human Genome Research was created to lead the
US. effort in mapping and sequencing the entire set of human genes.
Moreover, from 1975 to the present, several genes have been identified
including the gene that causes Huntington's Disease.

Since 1952, when Rosalind Franklin first took X-ray diffraction
photographs of DNA, to the present, as we are now mapping genes,
scientists have made great strides in biotechnology and recombinant DNA
procedures. We have come a long way.

Or have we? Has everything been done to keep the ball rolling?
Science does not simply consist of doing research and publishing the
results. Inspiring and educating young people is the beginning of the

scientific process. If aspiring students are not exposed to current and
updated material then this process cannot proceed. As teachers we must
instill in our students the passion of finding answers to questions that
have not yet been answered.

Hopefully it doesn't just end with a student maturing and logically
testing to find answers. Ideally someone, possibly that same student, will
now take the responsibility to pass along the new information to another
young aspiring student to begin the process again. It is because of this
basic idea of trying to motivate students to gain an appreciable interest in
the DNA science that l have decided to develop and evaluate a unit on
biotechnology and recombinant DNA

In 1992, the Fowlerville Schools began the time consuming
process of becoming accredited by the North Central Association, an
organization recognized by universities, that sets curriculum standards in
order to improve the success of the students on their proficiency scores.
Six target groups were adopted as recommended by the staff to improve
areas in the curriculum. One of the groups' jobs was to coordinate a
schoolwide strategy to enhance and strengthen the outcome of higher
level thinking skills. Through observations made by the teachers, they felt
that this was an area that should be emphasized. These are skills that
must be used in order for the students to answer scientific questions that
they think have no answers.

Another group had the challenge of getting students to use reading
and writing strategies across the curriculum. The ability to read and

understand content area material is a problem our teachers are faced with

and had to be addressed. Being able to read for understanding and then
evaluate and draw conclusions is paramount.

Reading and writing as tools to develop higher level thinking skills
can be accompanied by another very helpful process- having students
work in groups. Cooperative Ieaming is a great way for all students to get
involved in the Ieaming process while they are brainstorming and
exchanging ideas. It is unfortunate that evidence shows that science
teachers still rely on presenting science by "lecture and answer“
techniques (Yager and Penick 51). That's not to say that these techniques
do not belong in the classroom, but they should not be the only source for
our students to gain an interest in science. A change is needed if we are
to keep the ball rolling - rolling in a direction that will inspire students to
become critical thinkers, problem solvers and successful scientists.

For all of these reasons: the addition of DNA related labs, an
introduction to DNA technology and the implementation of activities to
promote higher level thinking skills, my goal was to develop a unit based
on DNA science that reflects all of these ideas and strategies. This unit
can be used in any high school biology class as it easily fits in any life
science and technology curriculum. l implemented this unit in my tenth
grade biology class as I have the cooperation of all the other biology
teachers in the school. The unit, uses cooperative work and critical
thinking skills to introduce students to many facets of DNA science. The
science content includes the basic structure and function of DNA, history
of the discovery of the molecule, protein synthesis, and an introduction of

recombinant DNA and Biotechnology.

COURSE OUTLINE

I. Lecture Topics
A. DNA structure (Day 1)
1. chemistry
2. bonding
B. DNA replication (Day 2)
C. DNA Isolation Techniques (Days 3-5)
D. Protein synthesis (Days 6-8)
1. transcription
2. translation
E. Gel electrophoresis (Day 9-11)
F. Restriction enzyme maps (Day 13-14)
G. Recombinant DNA (Day 15-17)
H. PCR (Day18)
I. DNA Sequencing (Day 18)
J. DNA fingerprinting (Day 19)

ll. Labs and Activities
A. DNA molecule coloring activity (Day 1)
B. DNA replication coloring activity (Day 2)
C. Isolation of DNA from Onion Tissue Lab (Days 3-5)
D. The Size of the Human Genome Activity (Day 5)
E. How Genes Make Proteins Activity (Day 8)
F. Gel Electrophoresis Using Dyes Lab (Days 10 - 11)
G. Palindromes Activity (Day 12)
H. Restriction Enzymes Map Activity (Day 14)
l. Recombinant DNA Assimilation Activity (Day 17)

Ill. Audio - Visual (Day 20)
A. "The Geometry of Life" From the Infinite Voyage Series
by Glencoe ( Macmillan/McGraw-Hill)
IV. Evaluations (Day 22)
A. Quizzes

B. Post Test

STUDENT CONCEPTS OF
OF LAB ACTIVITIES

A. DNA Isolation
The students are expected to:

1. know that DNA can be removed from a cell with minimal
damage to the polymer

2. know that enzymes, even ones found on your hands,
have the ability to cut the long strand of DNA making

it difficult to get good results.
3. understand precipitate formation
4. discuss the importance of being able to isolate DNA

from cells.

B. How Genes Make Proteins
All students are expected to:
1. list at least five types of proteins.
2. list and describe two major processes of protein
synthesis.
3. tell where in the cell protein synthesis occurs.
4. discuss the roles of DNA, mRNA, tRNA, and rRNA
5. explain complementary base pairing.

C. Gel Electrophoresis
The students should be able to:
1. explain the electrophoresis apparatus
2. perform electrophoresis on a series of dyes and interpret
the results.
3. discuss the basic principles of the mechanics of gel

electrophoresis.

D. Making a Restriction Enzyme Map
All students are expected to:

1. reinforce their understanding of gel electrophoresis

2. explain what restriction enzymes are used for.

3. explain what plasmids are used for.

4. develop a connection between reading an electrophoresis
and applying that to where the enzymes made their
cleaves.

5. understanding the importance of a restriction enzyme

map.

E. Making a Recombinant DNA Plasmid
All students are expected to:
1. explain what restriction enzymes do.
2. explain what plasmids are and what they are used for.
3. understand that DNA is complementary 3' to 5' and 5' to
3'.

4. develop an understanding for the use of restriction
enzyme maps.

5. explain what recombinant DNA is and how it can be used.

STUDENT CONCEPTS
WITHOUT LABS

A. DNA Structure and Function
All students are expected to:
1. know the chemical structure of DNA including:
a. the positions of the sugars, phosphates and
bases.

b. knowledge of the four bases.

c. understanding of 5' to 3' and its complement
strand.

d. base pairing.

e. DNA bonding

2. understand the process of DNA replication.

B. Protein synthesis
All students are expected to:
1. understand there is a message contained within the
strand of DNA.
2. know the difference between DNA and RNA
3. understand the functions of mRNA, tRNA, and rRNA
4. have an understanding for the process of Transcription.

5. have an understanding for the process of Translation.

10

11

C. PCR - Polymerase Chain Reaction
Students should be able to:
1. define PCR and explain the basic outcome of the PCR
process.

2. discuss the possible uses of PCR.

D. DNA Sequencing
Students should be able to:
1. define DNA sequencing and explain the basic outcome of
DNA sequencing.
2. discuss the possible uses for DNA sequencing.

E. DNA Fingerprinting
All students should be able to:
1. Define DNA Fingerprinting and explain the process of
how a fingerprint is obtained.
2. read a DNA fingerprint to make a comparison between
individuals.

3. explain some of the uses for a DNA fingerprint.

IMPLEMENTATION OF THE UNIT

With the added emphasis in our curriculum to be hands on and
technology oriented, this unit had to be developed by me as most
textbooks do not feature biotechnology activities. Although there are
many activities that can be found that illustrate DNA biotechnology, a
teacher has to dig and search to find them. When they do find them, the
activities simply use too many expensive chemicals or require lab
equipment that is unavailable. My intention was to develop a unit that will
introduce the students to the DNA molecule and then take them a step
further by showing them the many things now being done with the
polymer, things that may someday have an impact on their lives in the
future, if not already.

Students are constantly being exposed to news from the media that
in someway may be connected to DNA biotechnology, such as gene
splicing, DNA fingerprinting or even cloning. They should have some
knowledge of this science as it makes them more qualified to make a
judgment one way or another. It is unfortunate when a person is asked to
make a decision on an issue that they are unfamiliar with what may very
well affect their life or possibly someone else's life.

Take for example the recent O.J. Simpson Murder Trial. The jury
had no knowledge of DNA, let alone DNA fingerprinting. When the
defense finished their case, many people believed that the jury was so
confused that they attributed no validity to DNA science and they simply

ignored very incriminating evidence. Or, as an analogy, in every

12

13

classroom there is a student that is a diabetic and as for the rest of the
class, they usually know someone who is. However, if you ask the class
where insulin comes from, they haven't a clue. This is by no means the
fault of the students, they have just never been exposed to concepts
about Recombinant DNA.

The labs and activities that I have incorporated into this unit
explain the previously described concepts about DNA and more. When a
student has successfully completed this unit they will be able to talk about
DNA biotechnology with accuracy and relate what they know with the
news they hear from the media and make sound connections.

Most of the labs that are in this unit are simulations that are quite
effective, yet they are affordable and easy for a teacher to prepare. Some
of the labs were pulled from various sources while others I wrote as a
result of watching a number of students struggle with these topics.

In addition to the labs and activities, I have incorporated some
lectures, films, role playing activities and some drawings that the student
can get involved with. The unit requires about 4 weeks to complete. For
the two years that I have taught the unit, I tried pretesting the students
before the unit and found that they had no prior knowledge of this material
as they simply left their pretests blank. Upon completion of the unit the
students were tested to assess the success of the unit. Also, I exercised
the option of interviewing some students before and alter the lessons
either verbally or in writing. The basic requirements for the unit consist of
a student generated folder, quizzes, labs and activities, attendance,

participation and a final test.

14

The point values I assign are listed below:

Attendance and participation 100 points
Folder 100 points
Quizzes 50 points
Labs and activities writeups 150 points
Post test 100 points

There are a total of 500 points that can be earned in the unit. As
can be seen the post test only counts for only one fifth of the total unit
points. I was more concerned that the student be exposed to as much
DNA biotechnology as possible without being burdened by simply
recalling facts. To begin, attendance was very important as the concepts
that are being taught are usually group driven. When the students were in
their groups after each lecture, they have to use a brainstorming process,
much as Watson and Crick used, to obtain a thorough understanding of
the concepts. Thus, it is imperative that students be present and actively
participating within their group. To facilitate this activity, the instructor can
simply walk around the room and monitor the groups and when they are
done, have a person in each group report on their progress or findings.

Next, the students were required to accumulate their work in a
folder that may be used at some later date. The labs, activities, quizzes
and tests will be an excellent source of information for them to use as they

finish the rest of the class and also when they move on to college.

15

The quizzes were used to reinforcement the lectures and lab

activities. A total of five quizzes were given.

A list of the quiz topics are below:

Quiz #1 DNA structure and isolation techniques
#2 Protein synthesis
#3 Gel electrophoresis
#4 Restriction enzyme maps
#5 Recombinant DNA

Lab activities are worth the most points as they demonstrate that
the students are brainstorming within their group. These groups prove to
be a good Ieaming process as they are Ieaming to work with others and
master a concept. The students were in their "teacher assigned" groups
whenever we did a lab. They consisted of two to three students per group.
When the lab or activity was finished, the students wrote a short synopsis
of what they accomplished to help reinforce what they have just Ieamed

along with practicing their writing skills.

EVALUATION

This unit that I prepared is currently being used at our high school
by all 4 of the biology teachers. It was my intention as well as that of the
other teachers to bring the students up to date on current issues in DNA
science and involve them in some activities that are actually being used in
biotechnology.

The material in this unit does lend itself to pre and post tests, but
this is actually the first time that most of the students were exposed to the
topic of DNA Therefore, a traditional pre test was not extremely useful.
As I indicated before, most of them knew very little about DNA science.
However, I did have them fill out a questionnaire that asked them to rank
their understandings of some topics in DNA science, but again they did
not rank their knowledge very high. The results to this questionnaire will
be discussed later in this section.

Next, I tried to develop the unit in a fashion that caught the
students' attention and maintained a high interest level. This is no easy
task as 10th graders seem to lose interest in a hurry. By using a
combination of labs, minimal lectures, cut and paste activities and lots of
enthusiasm, l was able to have an impact on the students' interest
throughout most of the unit. By listening to some of the comments made
by the students in the post interviews, such as "this was a fun and
interesting chapter", the students maintained an interest level that I

perceived as an improvement over most topics. There were many more

16

17

areas of the unit wherein the students expressed a great deal of interest
and enjoyment.

The atmosphere of the class was informal as most of the activities
were group oriented. Instructive lectures, which I tried to keep as short as
possible, were very structured and to the point. I never lectured for more
than 20 or 30 minutes at one time. Brainstorming was emphasized during
this time, as I felt it was important to involve them as much as possible in
the Ieaming process. After each lecture was complete, I always provided
them with an activity or a few short questions that pertained to the lecture.
For example, after the lecture on PCR, I had the students get into groups
of two or three and develop a definition and a list of some uses for PCR.

Although most of the students were quite interested in the topics
each day, a fair amount of structure was still required as the students
needed some deadlines for their activities. For example, if we did a lab on
Monday, I gave them a short prelab and they began the lab. I allowed
enough time to finish the lab, about one or two days, but immediately
following, they had to turn in a written summary of what they Ieamed
during the lab. This seemed to reinforce the concepts being taught in the
activity.

I do feel it is important to mention that the instructor should assign
the students in their particular groups while they are working on their lab
activities. I traditionally put an A student, a B student and a C student in
each, trying to maintain a range of abilities in each group and separating
"best friends". Each student in the group was required to turn in a lab

report and a summary. To emphasize the importance of a good summary,

18

I allowed the students to use them during their quizzes. However, they did
not use their own summary, but rather that of their lab partners. This
forced them to make sure everyone in the group understands the
concepts being Ieamed. I noticed a trend in the quiz grades, as they
steadily improved throughout the unit. The grades only improved slightly
(less than 5%) but the material did get more difficult as the unit moved on.
This slight increase may have been attributed to their summaries but one
thing was for sure: I definitely observed an appreciable change in attitude.
An attitude that reflected a concern for everyone in the group to provide a
good summary.

Many comments were made by my students during the Post-
interviews that reflected the strengths and weaknesses of the unit. Twelve
students, every tenth one in the alphabet, were interviewed. Their grades
ranged from A's to D's as I tried to get a random sample. The sample of
students were asked six questions that pertained to the unit. The

questions were as follows:

1. How would you compare this unit with other units regarding:
a. the content
b. the labs
c. usefulness

d. up to date material

19

2. Was the material in this unit:

a. too difficult to understand?
b. too easy to understand?
c. at about the right level?

3. What was the most interesting part of the unit?

The most repeated comment, regarding the content, labs and the
usefulness of the unit, made by almost one half of the students was
"everyone should have to learn about DNA science, even adults". This
comment intrigued me so I reinterviewed those students to see what they
meant. The majority of them were referring to the fact that adults form
ideas and make decisions about DNA science on juries, during paternity
suits, and even when talking to their doctor about someone's health,
including their own. It seems as if students didn't think that the adults had
much faith in DNA science. I also was intrigued to find that 11 of the 12
students said that the material was taught at the appropriate level.

Other comments included:

"I enjoyed this unit because it was very interesting."

"The labs were fun and interesting."

"This chapter was interesting because now I know about DNA and
how it is different and also the same in different people."

"I liked working in groups and doing the labs."

"I still can't believe how much information is in one cell. The "size

of the genome" lab was cool."

20

Before starting the unit I had the students complete a questionnaire
on several topics related to DNA science. I had all of my students take
part in this as I only had 105 tenth graders involved. I began by asking
them if they had any prior knowledge of ten different topics. When the unit
was over I gave them the same blank questionnaire and asked them
about their knowledge of these topics again. They rated their knowledge
on a scale of O - 5 with 0 meaning they had no knowledge of the subject
and 5 representing they knew a lot about the subject. The results are

provided on the next page:

TABLE 1 - Percent Change in Student Knowledge of Different

 

 

 

 

 

 

 

 

 

 

Unit Topics Learned
331m MA
2.03 DNA Structure 4.61 127
2.11 DNA Function 4.33 105
1.87 Relative Size OF DNA 3.83 104
0.84 Protein Synthesis 4.14 393
0.61 Electrophoresis 3.57 485
0.43 Restriction Enzyme Mg 2.81 553
0.84 Recombinant DNA 3.24 286
0.25 PCR 2.59 936
0.39 DNA Seguencflg 2.17 456
1.86 DNA Fingerprinting 3.88 108

 

 

 

 

 

 

This table demonstrates the students' knowledge of each topic
before and after being taught the unit. A scale of 0 - 5 was utilized
( 5 = great knowledge and 0 = no knowledge). Data was obtained from a
sample of 105 students in the Fall of 1995 and 1996.

21

TABLE 2 - Ranking The Percent Change From Table 1

 

 

 

 

 

 

 

 

 

 

 

 

Lew
PCR 936
Restriction Enzymes 553
Electrophoresis 485
DNA Sequencing 456
Protein Synthesis 393
Recombinant DNA 286
DNA Structure 127
DNA Fingerprinting 108
Realative Size of DNA 105
DNA Function 104

 

 

Table 2 ranks the percent change in knowledge of each topic after

teaching the unit in order of the most to least change.

22

23

From the information on this pre-unit questionnaire I assume that
the students have had some knowledge of DNA structure and function
and some exposure to DNA fingerprinting. Our 8th grade program does
teach about the cell and a little about DNA, but their introduction to
fingerprinting came through the media or other reading.

A Large percent change in self-reported knowledge of the other six
area shows that the students had hardly any prior exposure to these
particular subjects. PCR had the largest jump in knowledge gained as it
was over 900%. Restriction enzyme mapping, electrophoresis, and DNA
sequencing concepts also had a significant increase in knowledge as they
ranged from a 400 to a 500% gain.

After this questionnaire, students answered some written questions
from a pre test which was eventually followed by a post test. The pretest
can be found in appendix Ill. The purpose of the pretest was to have the
students write as much as possible about their knowledge of DNA without
the worry of the answers counting against them.

Six post-test questions were targeted to see how the students'
response changed after they had been taught the unit. The first question
was: "what is DNA's basic shape and where is it found?" For the first part
of the question more than 70% of the students answered: cells, genes,
and chromosomes. Only about 24% could actually say anything about
the fact that it is a long polymeric molecule that exists like a twisting
ladder. It seems as though they have not made the relationships between
DNA, the cell and genes. Although they received the highest score for this
question in their interview about DNA structure , I think it would be safe to

24

assume that they were not as knowledgeable about this question as I
thought.

In response to the second half of the question "where can DNA be
found", the most prevalent answer made by 48% of the students was "only
in the blood". This seems to make a reference that they are watching the
news and listening to stories that make references to DNA testing in
crimes.

The next question that I targeted was: "is it possible to remove
DNA from a cell without damaging the molecule"? The majority of the
students (53%) thought that this procedure was possible and 41%
believed that it could not be done. I thought this statistic was interesting,
because I posed another question: "is it possible for a scientist to
compare the DNA of one individual with another" and I found that 96%
said that this procedure is possible. It is interesting that they would think
that DNA could be compared but it could not be removed from a cell.

Another question I posed was:"is it possible for two people to have
the same copy of DNA"? The results were not surprising as 92% of the
105 surveyed said "no" but only 13 % went on to mention anything about
twins, triplets etc. I followed up this question with: "does your liver cell
have the same copy of DNA as one of your heart cells"? It was interesting
to see that only 43% said yes and 57% responded no.

The post test results were very positive as the students seem to
have grasped the material. To start, about 94% of the students knew the
chemical make up of DNA as they could explain the shape or draw the

molecule and 100% could tell you that it was found in the nucleus of all

25

cells. Continuing with the question: "is it possible to remove DNA from a
cell without damaging it", the results were very reassuring. The "DNA
isolation from onion tissue lab" must have made a strong impact as 94%
of them responded that it is possible. Also 99% of them Ieamed that
scientists can compare DNA from one individual to the next.

Turning to the question: "is it possible for two people to have the
same DNA", the results didn't change very much as they seem to be quite
knowledgeable before the unit, but they did respond more often about
twins. The "no" response increased from 92% to 94% but their inclusion
of twins went from 13% to 65%.

A significant increase in correct responses was found on the
question: "does your liver cell have the same copy of DNA as one of your
muscle cells". A "yes" response was increased from 43% on the pretest
to 92% on the post test.

I felt that the results of the post test were encouraging as all of the
target questions reported a significant increase in correct responses.
Obviously after teaching the unit, one should see an increase in correct
responses, however I feel these increases were significant because the
target questions were concept-oriented and not just recalling facts.

At my high school there are seven sections of biology, each class
averaging about 27 sophomores. Each year on average 3 instructors
teach these seven classes. Up to this point four teachers, including
myself, have had the opportunity to use the unit. Two of the teachers have

taught less than five years, while the other teacher is quite experienced

26

as he has taught for about 16 years. I informally surveyed these three
teachers after they used the DNA unit for one year.

The first question I asked was "in teaching this unit, was it a
Ieaming process for you as well as the students"? All of the teachers
responded with a resounding "yes". One teacher exclaimed,"The unit on
DNA biotechnology was a Ieaming process for me. Seven years ago, the
last time I taught biology, DNA technology was not a topic I covered in
class. This technology was just something I read about in journals. Now,
after teaching this unit, I have a greater understanding of the topic".

Another question posed was "do you think the unit was too
lengthy"? All of the teachers did think the unit was lengthy but still too
important to skip. They commented on how difficult it is to cover
everything in our curriculum, yet they still felt comfortable the time
required to teach this unit. In fact, most of them felt it should become part
of the curriculum.

When asked "do you feel that the labs and activities fostered
higher level thinking skills", all of the teachers praised at least two to
three activities or labs. The Plasmid Lab, Human Genome Activity and
Gel Electrophoresis Lab were mentioned the most. All three of the
teachers said that they will use the unit again next year as they thought it
was well worth their time.

The last question was, do they feel that it was important for
teachers to remain as current as possible in terms of teaching strategies

and content information. Obviously they all made it quite clear that it is

27

very important for us to keep updated on science issues but, it is time

consuming and difficult to do in the "information age" that we now live in.

DISCUSSIONS AND CONCLUSIONS
COURSE CONTENT

The unit has changed quite drastically in its development
over the past 6 years. To begin, I have replaced many of the labs and
activities with other labs that I perceived to be more effective. I started
adding these labs in the fall of 1991 after I took the "Cell Molecular
Biology" course. Some of these were generated by myself and the rest
were written by other teachers. For two years I was able to see what
worked and what didn't work in the classroom. When I did my research at
MSU in the summer of 1993, l was able to analyze, change and develop
more effective labs.

One of the labs I originally tried to use in 1992 was a DNA
Electrophoresis Lab. I eventually omitted this lab as we never seemed to
get results that the students could determine. In addition it was quite
costly, and the advanced students in Forensics and our A.P. biology also
do this lab. Further, we did get very good results from the electrophoresis
lab using dyes, so I felt that the students exposure to the concept of
electrophoresis was sufficient.

Other labs that were removed seemed redundant or
overemphasized the ideas being presented. Reinforcement is an effective
way to teach, but you have to know when enough is enough. For
example, if you are pressed for time, omitting one of the restriction
enzyme map labs will work even though they do seem to complement

each other.

28

29

There are several labs that I perceive as especially effective in
conveying a concept. To begin, the "isolation of DNA from onion tissue" is
an excellent lab that shows the students the relatively easy way DNA can
be removed from a cell without damaging the polymer: although some
students did see that it is possible to damage the polymer by producing a
fuzzy mass. This activity was prepared by trying to keep costs down and
the availability of equipment. Most labs like this use salmon sperm, but
this uses something that is easy and cheap to obtain: onions. You get just
as good results by producing ample amounts of DNA as long as the
students carefully follow directions.

Another lab that works well and is well worth the time is the gel
electrophoresis of dyes lab. Although you do need a power source for
running the gels, the results are excellent. The students learn all of the
principles used in electrophoresis and gain some insight in how
molecules can be separated by size. The lab is much cheaper than using
DNA and you don't have to use restriction enzymes, markers or dyes.
Although I feel it is important for students to run a DNA gel at some point
in time, they usually get that chance in a more advanced class as
upperclassmen.

In any event, students should be engaged in some type of
electrophoresis activity as this is a technique behind DNA science that is
usually ignored by most teachers. Although it is an important activity,
many classrooms simply do not have the resources. However, I perceive
this as a very effective lab. The students enjoyed it as they really feel like

they are being scientists by using sophisticated equipment and not just

30

scissors and paper. In addition to this, the students really appreciate
being given the opportunity to do something that is technically difficult and
usually only done by adults.

Along with completing the labs and activities, I found that it is well
worth the time to have the students summarize each activity when they
are done. They were instructed to write the summary in a way so that if
they were to give the summary to a person that did not do the lab, that
person would fully understand the procedures. The summary should
include procedures, conclusions and the concepts being taught. This
simple assignment reinforces the understanding of the lab. The students
don't like writing these summaries, but I feel that it is an extremely

beneficial exercise.

DISCUSSIONS AND CONCLUSIONS
LOOKING TO THE FUTURE

Developing this unit has inspired me to teach my students about
DNA science more than I ever imagined. It seems the more you learn
about a subject, the more you want others to learn. I never imagined that I
could offer extra labs after school for students that are interested in DNA
science and actually have a few show up, simply to run DNA gels after we
isolated it from onions. In fact, just this year the Michigan Science
Olympiad Competition has just added a competition on DNA science,
particularly recombinant DNA and DNA fingerprinting. This is exciting for
students when they say : "hey, we did this in my biology class",
particularly when they find that their competitors have no previous
background in this discipline.

Most of today's students are faced with many obstacles while they
are maturing. If we can be of any help to them, it is our duty to do so,
whether it happens to be teaching them about DNA or helping them adjust
to peer pressure. We must look to the future. We must teach current
issues and ask students what they think may happen in the future. The
problems facing all of us are ones that only those involved in schools can
fully appreciate. Teaching is very demanding. In truth, it is difficult to
remain current with new methods and concepts to teach our students.
Yet, this is exactly what we must do. We look at the students needs and
knowledge and develop the course of action accordingly. As teachers, we

cannot take the easy way out and simply teach facts. We need to get

31

32

students ready for the twenty-first century. To do this our plan of action
may include adopting specific attitudes and actions.

For example, students need to see the importance of the education
that they are receiving. If the students see the excitement in the activities,
and labs displayed by the instructor, they can adopt a positive attitude
toward lifelong Ieaming. Growth and change require an open mind. If we
can instill the idea that only through new Ieaming, they will see
opportunity. Therefore, we, as great teachers, must remain open minded
about new strategies and technologies and be ready to use them in class.

Remember, they won't be successful in the future unless we are.

SCIENCE BACKGROUND
LECTURE MATERIAL

Structure of DNA

Many techniques are utilized to educate students in DNA science.
Initially, the students need to become familiar with the molecule and its
discovery. All high school biology text books seem to adequately cover
that issue. Most texts address DNA replication and protein synthesis.
However, until recently, recombinant DNA and biotechnology were never
mentioned. As James Watson and Francis Crick described in March of
1953, the DNA molecule is a ladder of subunits that seems to twist like a
spiral, commonly referred to as double helix. The sides of the double
stranded polymer are alternating subunits of deoxyribose sugars
(pentose, a 5 carbon sugar) and a phosphate group. The subunits that
connect the two sides together, or the "rungs of the ladder", are
nitrogenous bases. These bases are responsible for genetic variability.
Although there are only four different bases, it is the exact order of those
bases that makes the difference between a cat and a dog. These
compounds are commonly referred to as adenine (A), guanine (G),
cytosine (C), and thymine (T). Adenine and guanine are double ring
bases named purines. Pyrimidines, thymine and cytosine, are smaller,
single ring bases.

A nucleotide is a combination of a sugar, phosphate group, and

any one of the four bases. The sugar molecule is the link between the

33

phosphate and the base. Whether the sugar is ribose as in ribonucleic
acid or deoxyribose, in purines the 9 nitrogen atom and in pyrimidines the
1 nitrogen atom are both bonded to the 1' carbon of the sugar. As these
nucleotides polymerize to make long strands of DNA, the hydroxyl group
or the 3' carbon of the sugar forms an ester bond to the phosphate group
of another nucleotide. The formation of the ester bond releases one water
molecule. The "tie" between the nucleotides are called phosphodiester
bonds.

The rungs of the ladder, the bases, have a sequence that is quite
different in every organism. However the bases pair up in a very
organized way. The purines always hydrogen bond with the pyrimidines
such that adenine (A) only pairs with thymine (T) and guanine (G) with
cytosine (C). C is linked to G with three hydrogen bonds and A to T using
only two bonds. Theoretically a purine like adenine could form a bond
with the pyrimidine cytosine but the helix would become distorted and
ultimately the polymer would break down.

Replication of DNA

There are many mechanisms involved in passing along genetic
information from one cell to the next. During somatic cell division this
mechanism is mitosis. Therefore, there must be a way of making duplicate
copies of DNA. The DNA nucleotide sequence in every organism was
obtained from its parents. This process of copying DNA is called
replication. Keep in mind, if a cell has a genome of approximately 3 billion
base pairs then the resultant new cell must have the same 3 billion base
pairs in the exact same order. Such duplication is an absolutely amazing
process. For something to be this fast and accurate is truly a wonder.

Remember that a DNA molecule is made of two strands, both
containing a sequence of nucleotides. Adenine always pairs with thymine
and cytosine with guanine. Therefore, if you know the order of the bases
on one strand, you can predict the order of the bases on the
complementary strand. DNA replication is accomplished in this manner.
To begin, the DNA molecule separates as enzymes break the hydrogen
bonds between the bases. At this point there are two free strands. Short
fragments of single stranded DNA called Okazaki fragments are now
being connected to the free strands from the 5' end to the 3' end. The 5'
and 3' terms are referring to the carbon atom found on the sugar ring.
This is the "leading strand". The other side of the "unzipped" DNA
molecule also fills in the missing nucleotides from the 5' to the 3' direction
but it is actually in the opposite direction as the first. This is known as the

"lagging strand". These free floating nucleotides are attached to the

35

sugars by using enzymes called DNA Iigases. The process continues until
the entire molecule has been replicated. As a result, both new strands are
an exact copy of the original.

At this point, all of the DNA has been replicated in the cell. When
there are two copies of the genome in the cell, the two polymers can be

separated and passed on to the new cell through mitosis.

From DNA to Protein

The message or "code" that is dictated by the nucleotide
sequences in a strand of DNA is ultimately responsible for the
characteristics found in all organisms. How does this code convey its
message to carry out these characteristics? The answer lies in the
proteins. Proteins are complex polymers of amino acids, that determine
structure and function of an organism. Some proteins are enzymes that
control chemical reactions and others build and repair cell structures.

Short sections of DNA, called genes, are codes for certain
proteins. A human cell may contain up to 100,000 genes. We have long
known that genes determine the sequence of amino acids to form a
protein for carrying out specific instructions. These instructions, through a
multitude of proteins, establish the traits found in all organisms. Thus, the
sequence of nucleotides in the DNA is responsible for building proteins.

Like DNA, ribonucleic acid (RNA) is a nucleic acid but it differs
from DNA in a few ways. To begin with, RNA is usually a single strand of
nucleotides as opposed to the double stranded DNA. Further, RNA also
contains four bases like DNA, but RNA has replaced thymine with a base
called uracil. Lastly, RNA has a different sugar. RNA contains a ribose
sugar and DNA bears a deoxyribose sugar. The reasons for mentioning
RNA will become quite apparent as we proceed. It should be made clear
at this point in time that there are three types of RNA which are

differentiated by their role in protein synthesis.

37

38

We know that RNA is the transmitter of information from the
nucleus out to the cytoplasm, specifically to the ribosome. To start the
process of protein synthesis, a template of RNA from DNA is needed to
carry the code out of the nucleus. This process is referred to as
transcription. In transcription, the DNA helix molecule unzips with the aid
of polymerase enzymes, much like replication, and a single stranded
polymer of RNA is made. Unlike the double stranded DNA, the single
stranded RNA has one base that is different. Uracil has replaced thymine.
The new RNA molecule is called messenger RNA (mRNA). It is
appropriately named because it transmits the code out of the cell.
Ultimately mRNA holds and carries the information to the ribosome for the
making of proteins.

Along with mRNA, the synthesis of proteins require two more types
of RNA, a supply of amino acids, a number of enzymes, and ATP as a
source of energy. Now that the mRNA has transported the information to
the ribosome, we address the ribosomes themselves. The ribosome is
about half RNA and half protein. The form of RNA the ribosome contains
is called ribosomal RNA (rRNA). Each ribosome is composed of two
subunits, each with its characteristic RNAs and proteins. Now that the
mRNA is in the cytoplasm it will attach to a ribosome. The mRNA fits
between the two protein subunits of the ribosome. The ribosome moves
along the mRNA molecule much like a railroad car moves on its tracks. As
the ribosome moves along, the codons of the mRNA are exposed at the

surface of the ribosome. Codons are a basic unit of the genetic code.

39

They are simply three adjacent nucleotides in the strand of the mRNA that
code for an amino acid.

As each codon is exposed, a molecule of transfer RNA with its
particular amino acid attached approaches. Transfer RNA (tRNA) is the
third type of RNA that is involved with translation. If proteins are to be
synthesized, amino acids must be carried to the ribosome. This process
of the tRNA moving the 20 different kinds of amino acids towards the
ribosome and then having them attach in the specific order as designated
by the mRNA is called translation. Translation is the actual process of
bonding amino acids in a specific sequence to form a protein. At this
point, each amino acid has an anticodon. The anticodon is a nucleotide
triplet that will match the codon. When the anticodons that are being
carried by the tRNA assemble on the surface of the ribosome, they will be
in a specific order. This stage in the biosynthesis of proteins , the
assembly of amino acids in a specific sequence, is translation. The
information transcribed from the nucleotide sequence of DNA to the
nucleotide sequence of mRNA has been translated into the amino acid

sequence of the protein.

Recombinant DNA Technology

Recently, DNA has been a very hot issue in the media. ( Take the
O.J. Simpson trial, for example). When DNA is mentioned, the media
assumes everyone knows its structure as they are talking about very new
and current issues and technologies, such as DNA fingerprinting, cloning,
and genetic engineering. To obtain a better understanding of these
advances, the viewer should be aware of some basic concepts about the
genetic material and related terminology. To begin, the gene is probably
the most visible term used. Since the discovery of genes, about 40 years
has past and we have a better understanding of how heredity works.
Genes, which are sections of DNA that code for a specific trait, can be
manipulated by using new techniques that are easy to understand. Keep
in mind that recombinant DNA is DNA made by connecting fragments of
DNA from different sources. Thus it is easy to see that DNA requires
some cutting or "cleaving". Restriction enzymes can be used for this
procedure. There are hundreds of these enzymes, all of which have the
ability to cleave DNA into short fragments at specific sites that it
recognizes. Recall that the nucleus contains abOut 3 billion base pairs.
With this much genetic material it makes it difficult to make cuts in the
DNA without getting millions of fragments of DNA. Using these restriction
enzymes, the researcher has the ability to make very specific cuts in the
DNA, that cleave with unbelievable accuracy. The enzymes recognize a
certain base pairs sequence and cut that one sequence throughout the

strand of DNA.

40

41

After the desired sections of DNA have been cleaved, they can be
removed from the cell and inserted into a new host cell. In order to
produce recombinant DNA, the cleaved fragment of DNA must recombine
with something else. That something else is a vector. A vector is a means
by which foreign DNA can be transferred into the host cell. In order to
insert this new strand of cleaved DNA carried by a vector, the recipient
cell needs to have those same cuts made in its DNA by the same
restriction enzymes. Sections of DNA are removed from its genome to
make room for the new sections of DNA. This procedure actually leaves
two ends to the DNA, commonly referred to as "sticky ends". The
nickname is very appropriate because the ends readily attach to the new
strands of DNA

The actual insertion of the new DNA plasmid into the bacteria is
done quite easily. Most often, the new DNA strands can just be mixed in
with millions of the host cells, usually bacteria, that are suspended in a
salt solution. Within a few minutes, several bacteria will take up the new
DNA contained in the vector plasmid. At this point, the bacteria, now
containing the vector, can be grown in large quantities. The technical term
for a large number of cells grown from a single cell is a clone. Therefore,

this technique is sometimes known as DNA cloning.

 

DNA sequencing, PCR and Gel Electrophoresis

Sequencing is determining the order of nucleotide bases along a
length of DNA. Only one of the two strands of the double helix is used.
However, many copies of this strand are required. Through the use of
PCR, polymerase chain reaction, many copies of a DNA strand of interest
can be made.

PCR is basically an in vitro DNA replication process. Starting with
the original strand of DNA, some primers, a heat resistant DNA
polymerase to extend the primers, and a series of heating and cooling
cycles, the original DNA segment can be amplified a millionfold in just
twelve hours. The procedure is extremely useful when trying to sequence
DNA when only very small samples are available. This is commonly used
in a murder case when the blood, the source of DNA is found in trace
amounts.

The many pieces of this single stranded DNA can be sequenced to
find the exact order of the nucleotide bases. There are several methods
that can be used. One of the easiest to understand is the Maxam-Gilbert
method. In this method, a radioactive label is attached to the 5' end of
each strand of DNA. The strands are put into four separate test tubes and
subjected to different chemical treatment. These chemicals selectively cut
the strand between one of the bases and the rest of the strand. For
example, one of the test tubes may contain a chemical that cuts after the

base guanine. Therefore, these strands are cut at varying lengths as all of

42

43

the cuts are after guanine and the rest of the strand. Some of the strands
will include the radioactive marker.

The DNA fragments can now be loaded into a properly prepared
gel and then subjected to an electric field. This process, gel
electrophoresis, is used to separate fragments of DNA according to their
size. The electrophoresis chamber is connected to a power source and
the fragments are attracted to either the anode or the cathode. As the
DNA fragments travel through the gel, they move at different speeds. The
smaller the fragments are, the faster they travel through the gel. After
awhile, the DNA radioactive markers show up in the gel. A pattern of
bands is revealed. The pattern of bands unveils the order of the bases in

the original strand.

DNA Fingerprinting

In 1983, a 15 year old girl was killed in Narborough England.
Lynda Mann's body was found raped and strangled on a dark lane near
the grounds of a mental hospital. Police scoured the villages for three
years without a lead. Then, on a path not far from where Lynda was killed,
15 year old Dawn Ashworth was found. She was also raped and
strangled. Within a week, a kitchen worker at the mental hospital
confessed to Dawn's murder. Investigators were anxious to find out if the
murders were related. Dr. Alex Jeffreys was called in to assist. Alex had
developed a test to reveal markers for inherited diseases that may
possibly lead to early treatment.

The kitchen worker's DNA from his blood was tested using a
technique that Jefferys developed and then compared with the semen
recovered from Lynda's and Dawn's bodies. The results were very
surprising. It was found that the semen from both bodies were the same,
but neither matched the worker from the mental hospital.

At this point, the police launched a huge effort to draw the blood of
more than 4,000 young men in the area. This voluntary blood sampling
went on for eight months when finally an arrest was made. Colin Pitchfork
ultimately confessed to both murders. DNA fingerprinting was the key in
this case solving the crime. In short DNA fingerprinting is the process of
extracting DNA from a biological sample such as blood semen etc, and
then is subjected by restriction enzymes that cut the DNA at specific

places. The fragments are then separated by gel electrophoresis and

44

 

45

blotted onto a membrane. Then a radioactive membrane is used to bind
and target the fragments. This creates a pattern of bands that are very
distinctive among individuals. Obviously it is not possible to check
everyone's DNA every time a murder is committed, but it does provide
investigators with a tool and a huge advantage in solving crimes.

How is DNA fingerprinting done? Is it a complicated procedure?
When Alex Jeffreys developed this method, he had no intentions of using
it for murder investigations. However since 1985, it has been used in over
2,000 cases. Jefferys knew that everyone's genome is different.
Therefore, it is possible to give everyone their own so called "fingerprint"
using a sample of their DNA. To begin, minute samples of DNA can be
obtained from blood, skin, hair, or semen. This sample of DNA can then
be amplified using PCR to make millions of copies of the original DNA
Next, the DNA can be cleaved using restriction enzymes.

It is important to mention that DNA fingerprinting takes advantage
of the fact that large portions of the genome is made up of "junk DNA".
Junk DNA is repeated sequences in the human genome that do not code
for proteins. Individuals have different numbers and amounts of junk DNA
between the DNA that actually codes for proteins. One person may have
4 repeats between two working genes and the next person may have 25
repeats between the same two genes. When these two samples are cut
by the restriction enzymes varying lengths of DNA result.

These fragments are then sorted according to their size by the
process of gel electrophoresis. Keep in mind that the short fragments

travel faster and farther in the gel than the longer ones. The DNA

46

fragments that contain repeats or "minisatellites" are detected by using
radioactive probes. The Southern blot analysis is an excellent method for
the addition of probes.

These probes are radioactively labeled pieces of DNA whose
bases are complementary to those of the repeats. The probes then match
with the repeats and stick to them. This method produces a very
distinguishing and original pattern of bands - the DNA fingerprint. An

example of a DNA fingerprint analysis can be found in the appendix.

Basic DNA Structure Drawing

 

 

 

 

 

 

 

ITIsI-I I I

 

 

 

ITT1 “I I [1

ti.

 

 

l

 

 

 

 

 

‘lllin

 

44H j

n .
l

l

47

DNA Replication Colorlng

 

 

 

 

 

 

48

 

The Isolation of DNA From Onion Tissue
Teacher Section

Introduction: Students are exposed to the concepts of DNA very early
on. With the media covering criminal trials and mentioning DNA forensics,
the public is being asked to understand DNA science as if it were
common knowledge. In school, many students finish their science
education without any exposure to biotechnology and recombinant DNA
strategies. This lab is merely an introduction to demonstrate the simple
methods in isolating DNA from an onion. The students will actually
prepare and handle DNA and learn the simple concepts of solubility and
precipitate formation.

Background: Many genetic experiments and tests require the removal of
DNA from the cell. This procedure can be very simple or quite complex. It
depends entirely on the type of cell from which the DNA is extracted. The
process reported here is relatively simple as we are isolating the DNA
from an onion cell. The teacher should be able to prepare for this lab in
approximately 15 minutes as it is broken into 3 separate days. On day
one the students will need the last 15 minutes of the hour. Day 2 will need
the entire hour. On day 3 the last 20 minutes will be plenty of time to
precipitate.

Materials:
CbemicalstflomooenlzatiocMedium 1 liter
Liquid dish soap 30 ml
NaCl 8.8 g
NaCitrate 4.4 9
EDTA 0.3 g
Distilled Water 1 liter

The soap acts to lyse the cells; the NaCI and the
NaCitrate provide sufficient ionic strength to force
the DNA molecule into an insoluble conformation in
ethanol; the EDTA is needed to help inactivate the
enzymes that are always present and can be intro-
duced by the students hands. The ethanol is used to
precipitate the DNA.

49

50

Cold ethanol ( 90 - 100%)
Latex gloves

Blender

60° C water bath
Medium size onion
Cutting board and knife
2 - 250 ml beaker
Ruler

Ice

Cheese cloth

2 - 20 ml test tubes
Wooden applicator
Marking pens

For best results:

* The ethanol must be kept very cold ( 0 to 10 degrees C). If
possible the night before, loosen the cap and place the bottle in the
freezer overnight.

* Use a wooden applicator to spool the DNA as it seems to work
better than a glass rod.

* To make a simple ice bath, a cake pan with water can be
suspended over a bunsen burner. This gives the students
something to do for the 15 minute period of heat treating as they
can move the burner back and forth under the pan. If possible,
have ice on hand to help reduce the temperature of the water bath
if it gets too high.

 

Name
Hour

THE ISOLATION OF DNA FROM ONION TISSUE

Introduction:
In this lab you will extract DNA from an onion. After the lab you
will be able to see and appreciate a procedure for extracting DNA
from a living organism and than actually hold the extract in your
hand. The concept of solubility and precipitate formation must first
be understood. DNA is completely insoluble(not able to dissolve) in
90% ethanol as all of the other parts of the cell will completely
dissolve. Therefore when the cell contents are solution (or
completely dissolved) and then ethanol is added, the DNA will
precipitate or "appear".

 

It is important that you recall the role of enzymes again. DNA-
altering enzymes have the ability to cut the long strands of DNA to
the point that you will not be able to appreciate the length of the
molecule. So it is especially important that you do not introduce
them at any point of the experiment. These enzymes are always
present on our hands so it is essential that you practice a
technique of wearing rubber gloves throughout the lab even when
cleaning the glassware and cutting the onions.

This lab will take 3 days to complete. Each day you will outline the
materials needed and the procedures that must be followed in
order to isolate the DNA from the onion.

DAY 1
Materials:
Medium sized onion
Cutting board and knife
250 ml beaker
Rubber gloves

 

Procedures:

To prepare the onion for DNA isolation, put on your rubber gloves
and dice a 12 9 piece of onion into cubes that are no larger than
3 mm on each side. Place this onion into a 250 ml beaker, cover
and store it in a refrigerator overnight.

51

52

DAY 2
Materials:
Chopped onion in the 250 ml beaker
250 ml beaker
Homogenizing medium
60 C water bath
Ice bath
Blender

Procedures:

"Transfer the 12 g of diced onion to the clean, room temperature
250 ml beaker and add 50 ml of the homogenizing medium to the
onion. Incubate this mixture at 60 C for 15 minutes

( NO LONGER). This heat treatment softens the onion tissue and
allows the homogenizing medium to penetrate the cell and remove
the unwanted enzymes.

*Quickly cool the beaker in an ice bath ( a slush of ice and water)
for 6 minutes to prevent the DNA from breaking down.

"Next place the contents in a blender at high speed for 75 seconds
to lyse (break open) the cell and release its contents.

*Cover and store the beaker in a refrigerator overnight.

' .

DAY 3
Materials:
250 ml beaker containing preparation
Cheese cloth
90 -100% ethanol
2 - 25 ml test tubes
Wooden applicator and marking pens
250 ml beaker

Procedures:

*Filter the preparation through 4 thicknesses of cheese cloth into a
clean 250 ml beaker leaving the foam behind. This removes the
cell walls and other large unwanted cell parts.

*Cool this filtered solution in an ice bath for 10 minutes.

“While the solution is cooling , label 2 test tubes homogenate (H)
and the other ethanol (E). For the test tube that will contain the
homogenate, make a line 4 cm from the bottom. The tube
containing the ethanol will get a line 5 cm from the bottom.
*Obtain the cold ethanol and pour it in the test tube up to its
respective line. Do the same for the homogenization medium.

 

53

"Now slowly add the ethanol to the homogenate test tube. A visible
precipitate should appear. Using a wooden applicator, spin it in
one direction to spool out the precipitate (the DNA).

Questions:

1. If you did not wear rubber gloves during the lab, what could you
possibly introduce to the DNA? What would happen to the DNA?

2. What is the significance of adding cold ethanol to the homogenate?

3. Why is it important to rotate the rod in the same direction?

4. What could possibly happen if the onion tissue is heated too long?

5. In what ways could scientists possibly use this process? For example in
the fields of forensics or maybe law enforcement.

HOW BIG IS THE HUMAN GENOME
TEACHER SECTION

Introduction:

In this activity, students will understand the enormous amount of
information that lies in the nucleus of each human cell. Scientists have
calculated the approximate number of base pairs in each nucleus. This
astounding number is sometimes a hard concept to grasp. However, if it is
related to something that students are familiar with, it helps to visualize
this idea.

Imagine trying to type out the base pair sequences in one human
cell. How long would it take to type 3 billion letters? Performing this lab,
the student can calculate how many pages in a book it would take to type
out this information. To make this even easier to understand, the student
will use their own biology book to calculate this number.

To further this concept, have the students not only realize the
number of base pairs but imagine how small they must be in order to fit in
a cell. Further more, ask the students to imagine how many mistakes
they would make if they had to type out this code. Be sure to remind them
that the cell has to do this every time it divides without making a mistake.

Teaching Tips:

1. At first have the students guess how many pages from their book
it will take to type out the code. When they are finished, they will
find that it takes about 500 to 800 BOOKSII

2. Have students choose a page in their book that is primarily

writing.

3. This is a good exercise for using their math skills involving

scientific notation.

4. Instead of walking the students through the activity, allow them

some time to calculate the answers on their own. If they have

some problems then offer them some assistance.

54

.11

Name
Hour

HOW BIG IS THE HUMAN GENOME

All organisms require a substantial amount of DNA to carry out the
instructions necessary to live and reproduce. Because DNA is sub-
microscopic it is hard for us to imagine the size of the human genome.
This exercise will help us understand its actual size by comparing it with
something that we are familiar with, our Biology textbook. The human
genome is said to have about 3 billion base pairs. If we were to type these
base pairs on a page, how many pages would it take to type the entire
genome? Let's find out.

Follow these simple steps and we will soon see how many pages it
will take to type the entire genome.

1. Select a page in the book that is mostly printed (no pictures). Page #_

2. Choose 5 lines and carefully count the number of characters. Be sure
to count the spaces between the words. Now calculate the average
number of characters per line and call this C.

c:

3. Now count the number of lines on the page which we will call L.
Multiply the average number of characters on a line times the number of
lines on the page.

CxL=(G)

4. Now divide the total genome of a human cell ( 3 x 109) by the number
of characters on a full page in your biology textbook ( G ). This new
number will be called P

 

 

 

(3x109)IG=(P)

I =

55

5. At this time divide the number of pages needed for a human genome by
the number of pages in your textbook ( T ). This will tell you the number of
books ( N ) that you will need to record the information in the genome of
one human cell.

(P)dividedby(T)=(N)l
I __ =
N represents the total number of books it would take to write out
the entire human genome from just one cell.

WOW, the human genome is HUGE ..... or is It very, very small?

HOW GENES MAKE PROTEINS
"Transcription and Translation Simulation"
Teacher Section

Background Information:

In order for traits to be expressed, protein synthesis must take
place. Students need to realize for DNA to have instructions carried out, it
has to be transcribed into a substance (RNA) that has the ability to leave
the nucleus and ultimately translate its message to the cell. In this way,
proteins can help to carry out almost all of the processes of life.
Remember, DNA is carrying a message, that is a genetic code. That
genetic code is information to instruct the proteins to determine the
structure and function of organisms.

Protein synthesis takes several steps and can get quite confusing,
so it helps to use simulations to walk the students through the process. In
this activity the students will act out the steps of transcription and
translation to help clarify the sometimes confusing concepts of DNA
science. It actually helps them make sense of what processes occur
inside and outside of the nucleus, on the ribosome and what biochemicals
are involved.

Materials:

Photocopy four masters of the DNA, mRNA, tRNA and the amino
acids using colored papers. Try to use four different colors. The students
can cut them out. They are found in the figures section, figures 6 through
12 (pages 88 - 95).

57

 

58

Teaching Tips:
1. Have the students read the introduction and then discuss it with
them. Then continue to have them read the rest of the lab before starting.
2. It works best if the instructor helps them walk through the lab to

alleviate confusion.

Name
Hour

 

HOW GENES MAKE PROTEINS
"Transcription and Translation Simulation"

Objective:
Using the entire class, we will act out the entire process of protein
synthesis including transcription and translation.

Materials:
scissors
master cards

Introduction:

This simulation will help give you a better understanding of how the
order of the bases in a strand of DNA are translated into a sequence of
amino acids to form proteins. When you hear the statement that "DNA is
ultimately involved in expressing your traits", you have to wonder what is
directly responsible. The answer is proteins. Proteins provide the
structural and functional basis of life. They have a role in every possible
life function.

There are structural proteins that help make up cartilage and
tendons and others that make up our hair and eyes. Enzymes that
catalyze chemical reactions and hormones that regulate biochemical
messages are all examples of proteins. Other proteins such as
hemoglobin, antibodies, nutrient storers and waste transporters all have
important functions.

The process of making these proteins, known as protein synthesis,
is complicated but after you follow the steps in this activity it will become
clear that DNA is a template, used to mold or pattern the order of the
amino acids. Keep in mind, single stranded RNA makes a copy of the
desired genes and migrates from the nucleus to the ribosome where it
can dictate the sequence of the amino acids.

59

Procedure:

A. Setting the Scene:

1. The classroom is going to be our cell. Imagine the walls,
floor and the ceiling as the cell membrane.

2. The area of the room that has the chairs in a circle
represents the nucleus of the cell. This is where
transcription occurs. Remember, mRNA will have to
move in and out of this area.

3. The rest of the room is the .

4. The other area of the room designated ribosome is where
translation occurs.

 

B. Distribution of Materials:
1. The teacher will now distribute DNA sequences and their
complementary mRNA strands to two groups of students.
The cards each have three letters. Remember that the
bases must be in groups of three as they code for triplet
base units. The letters on the cards refer to the bases.
A is adenine and so on.

C. Transcription:

1. Now assume the DNA strand begins to unzip. The double
strand actually becomes two strands. Only one of the two
strands will be used. We call this the active strand, while
the other strand is the dummy strand.

2. All of the students with the DNA cards will now line up
inside of the nucleus. The "TAC" card will line up at the
left. This is the start code. And the "ATC", the stop
sequence will be in the right. The rest of the cards may
line up in any order.

3. Next, RNA polymerase helps to pair the exposed part

of the DNA's bases with the complementary RNA bases.
At this point, students with the mRNA cards should go into
the nucleus and pair with its complementary DNA base
triplet. This three base mRNA molecule is called a codon.
Remember: “RNA guanine pairs with DNA cytosine
“RNA uracil pairs with DNA adenine
“RNA cytosine pairs with DNA guanine
”RNA adenine pairs with DNA thymine

mRNA
IBNA

61

4. When the mRNA strand has been made and placed in
correct order, the students holding the DNA cards may be
seated. You have just acted out the process of
transcription. Notice what was just made, a strand of
mRNA that reflects the exact opposite of the DNA code.

D. Translation:

1. Notice that the tRNA cards are arranged in groups of
three letters. These three base sequences of tRNA are
called anticodons. Also these tRNA cards have a three
letter abbreviation contained in the arrow. This represents
one of the 20 amino acids. Now, distribute the tRNA
cards and the amino acid cards to the rest of the
students and randomly scatter the students throughout
room.

2. Have the students in the nucleus exit while staying in the
same order. Move to the part of the room designated
ribosome. At the same time, the students with the tRNA
cards need to find their corresponding amino acid. For
example the tRNA anticodon card "GCG" with the letters
PRO should find the amino acid Proline.

3. After the tRNA cards find their corresponding amino acid,
both students should migrate towards the area of
translation, the ribosome, and look for the mRNA card
that matches their tRNA card. Use the rules of
complementary base pairing:

”RNA adenine always pairs with RNA uracil
”RNA uracil always pairs with RNA adenine
“RNA cytosine always pairs with RNA guanine
“RNA guanine always pairs with RNA cytosine

4. Use the following table to check for the correct pairs.
Except for the start and stop cards, the following
sequences will probably not be in the same order.

AU_G__G_GC_UCC_CUA_GAG_GU_C_AAU_C_C_G_UAG
WADE

and amino met gly ser leu glu val asn pro stop

acid

62

5. As each tRNA anticodon finds its corresponding codon
on the mRNA strand, the tRNAs detatch from their amino
acids. All of the amino acids should remain intact,
especially their order. At this point in time the amino
acids will form a peptide bond between each one, thus
forming a polypeptide. Translation is now complete.
Remember, translation is when a sequence of mRNA
information translates into a polypeptide.

E. Questions:

1. List three different proteins and their functions
a.
b.

C.

2. Why do we say DNA is indirectly involved in determining
stmctural arrangement of proteins.

3. Suppose an individual has a nutrient deficiency due to a
poor diet and is missing a particular amino acid. Which
process of protein synthesis would be more affected
and why?

4a. Compare the active and the dummy strands of DNA

b. Would there be a problem if the dummy strand was used
to make proteins

63

5. Below are some tRNA anticodons/amino acid
relationships and a strand of imaginary DNA Please
fill in the missing boxes in the chart below by writing
the correct mRNA codons, tRNA anticodons and amino
acids.

Use the following tRNA/amino acid relationships:

GGC UUA CAG CUC GAU AGG CCG
pro asn val glu Ieu ser gly

 

 

 

 

 

 

 

 

DNA TAC GAT AGG GAT CAG TTA CTC GGC ATC
mRNA
tRNA
Amino met stop
Acid start
5. A new and exiting branch of biotechnology is protein
engineering. To make or engineer proteins, molecular
biologists work backward through a protein synthesis
process. They first determine the exact sequence of the
polypeptides they want and then create a DNA sequence
to produce. Fill in the rows for tRNA anticodons, mRNA
codons, and DNA
Use the following tRNNamIno acid relationships:
GCG UUA CAG CUC GAU AGG CCG
pro asn val glu Ieu ser gly
DNA
mRNA
tRNA
Amino met Ieu val pro gly asn ser glu glu pro val
Acid start stop

AGAROSE GEL ELECTROPHORESIS USING DYES
TEACHER SECTION

Introduction: This lab exercise is an excellent way to introduce the
techniques of gel electrophoresis. It demonstrates the simple ideas of
how molecules can be separated according to their size. Most of the
equipment has been generated by other teachers and graduate classes
through Michigan State University. Instead of using DNA fragments, the
students will be using a series of easily available dyes and running them
through a gel towards an electrode in an electric field. The results will
show that the dyes are various sizes and will travel towards the anode (+)
or the cathode H. An unknown dye mixture will also add a section to the
lab that will allow the students to make comparisons and differences
between the dyes. As you will see, the unknown mixture dye will separate
into three single dyes as the students can then try and estimate the
molecular weights of the dyes by comparing them to the known dyes.

Background: With the ongoing task of developing lab exercises that
challenge and appeal to students, it is difficult at times to keep the cost
down. This lab was deveIOped with this in mind. Most of the equipment
that is used is inexpensive. The power sources are probably the most
expensive item and usually the teacher can borrow these from the physics
department or their local college for a nominal fee. As for the chemicals,
they can all be purchased through any scientific company.

The ability to learn about biotechnology is paramount in the
classroom. Learning about the chemistry of DNA is not enough. The
students should be exposed to concepts and techniques that are current.
They hear about DNA fingerprinting on the news quite often. It is a shame
that they have to learn about these issues on TV instead of the
classroom. It is up to the teacher to make the commitment to keep their
teaching strategies up to date and not fall into a rut and omit important
labs because they are too expensive. Most labs can be recreated by
using simulations as this lab proves.

Although DNA is not used in the lab exercise, it shows the basic
principles of how DNA fragments can be separated according to size. The
gel chambers are modified Rubbermaid containers. The buffer can be
made in just minutes and the gels can be loaded by a beginner. Results
can be seen in about 30 minutes.

65

Materials: .

1. The electmpbotesiichambars can be made by purchasing a

10 inch x 5 inch Rubbermaid container. Cut a square in the top of the lid
about 6 cm square. Use carbon rods 1 cm in diameter and about 3 cm
long. Using a cork borer, poke 2 holes in the top of the lid on each end
and place the carbon rods in the holes. Next drill a hole in the ends of the
carbon rods that stick above the top of the container just big enough for a
nail to slide in about half way.

2. The Wall must be a DC power supply. Up to
four gels can usually be run on them.

3. Irisantatiflufffit (T BE) can be made by adding 10.8 g of Tris
base and 5.5 g of boric acid and 20 ml of 0.5 M EDTA to 1 liter of distilled
water.

4. A total of 2.99]: can be made by adding 0.5 g of agarose to 70
ml of buffer in an Erlenmeyer flask. Bring the flask to boil then set aside
for two minutes to cool.

5. The geljrays can be made using three pieces of plexiglass and
gluing them together to look like the picture below.

Theseus-meander;
but”
I-

T T
I '1-
, r'
m/ 71.... fl...

I——-7.2t:m——I
M

6. The dyejamples can be made by simply dissolving 0.5 g of dye
in 100 ml of distilled water. Next add 1 ml of glycerine to make the
solution dense enough to sink in the buffer when loading the gels.

 

For best results:
* A good stopping point is between steps 1 and 2. After pouring the
gels simply cover with saran wrap and place in the refrigerator
overnight.

* The recommended mixture for the unknown dyes is to combine
orange-G, bromophenol blue, pyronin-Y at a 1:1 :1 ratio

Name
Hour

AGAROSE GEL ELECTROPHORESIS USING DYES

OBJECTIVE:
To understand and use one of the most utilized techniques
in separating DNA fragments: Agarose Gel Electrophoresis.

BACKGROUND:
The agarose gel is a semi-solid solution that resembles
"Jello" and is allowed to solidify in the gel tray. Briefly, the
students will be loading 7 different dye samples into small
holes made in the gel. These holes will be referred to as
"wells". After the dyes are loaded into the walls a power
supply will be connected to the opposite ends of the gel.
The dyes will immediately begin migrating through the gel
towards a specific electrode. It is important that students
understand the principles involved with gel electrophoresis.
To put simply, the larger the molecule traveling through the
gel, the slower it will travel. This is exactly how DNA
fingerprinting is done. If a gene fragment is smaller than
another fragment, it will mn faster and farther through the
gel. In this manner one DNA fragment can be separated and
compared to another fragment.

Using the dyes of different molecular weights in place of the
gene fragments is an excellent way to show the same
principles. The movement of the dyes in an electric field can
be used to show that:

(1) the migration direction of the dyes can be used
to show its overall negative or positive charge.
For example, if the dye migrates towards the
positive electrode (called the anode) the overall
net charge of the dye molecule is negative.

(2) Some dye's molecular weight is more than others
by moving slower through the gel.

67

(3) Some dyes can be used as standards to calibrate
an agarose gel. Dyes such as xylene cyanol,
bromophenol blue, and orange-G are accurate
size markers for small DNA fragments.
Remember DNA fragments have an x-amount of
base pairs. The "Base Pair Equivalents" for these
marker dyes are as follows:

WEEKS

Orange-G 70
Bromophenol Blue 250
Xylene Cyanol 2800

Materials: Each team of three students will need:

-Electrophoresis chamber
—@50 amp power supply
-Gel tray
-Gel comb
-600-ml beaker
-100-ml graduated cylinder
-325 ml Tris-Borate-EDTA Buffer (TBE)
-300-ml Erlenmeyer Flask
-0.5 g Agarose (makes 2 gels)
-Heat Source (Bunsen Burner works fine)
-Micropipette and rubber bulb
-Dye Samples
#1 orange-G
#2 pyronin-Y
#3 phenol red
#4 bromophenol blue
#5 crystal violet
#6 xylene cyanol
#7 unknown dye mixture

68

Procedure:
1. Agarose preparation: Makes 2 gels

a. Tape the ends of the gel tray as described by the teacher.

b. Next tape the comb into place as described by the teacher. Be
sure to place the comb in the middle.

c. Place 0.5 9 agarose in the 300-ml Erlenmeyer flask and then
add 70 ml of TBE buffer.

d. Place the flask on the heat source and bring the solution to a
mild boil until all of the agarose has dissolved.

e. Allow the solution to cool for about 3-5 minutes.

f. Using a pasteur pipette, lay a thin bead of agarose where the
tape meets the tray and allow to cool and solidify.

9. Next pour the agarose into the tray to about 1-2 mm from the
top and allow to cool until the gel has solidified.

2. Loading the Electrophoresis Unit:

a. Carefully remove the comb from the gel. This will leave small

holes in the gel. These small holes are called "wells".

b. Remove the rest of the tape on the ends of the tray.

c. Place the gel tray in the electrophoresis box.

d. Fill the box just to the very top edge of the gel with TBE buffer.

9. Very carefully add the dyes using the micropipette to the wells.

Approximately 5 microliters of each will be sufficient. W
- . The order

 

from the materials list works great.
NOTE: The dyes are more dense than the buffer, so
they will sink to the bottom of the wells. Be sure
NOT to overflow the wells.

69

3. Running the Electrophoresis:

a. Carefully place the top on the box

b. Connect the power supply to the electrophoresis top. Be sure
not to turn on the power until all leads are connected. Attach

the positive electrode (red) to the side of the tray that has 2/3 of
the gel exposed. The negative lead should be attached to the side
of the tray that has only 1/3 of the gel. Turn on the power supply
and adjust it to about 30 volts.

c. Closely watch for the initial migration of the dyes to be sure all of
the connections are satisfactory. The colored dyes should move
out of the well and into the agarose gel.

d. Immediate observations can be made about the net overall
charge of the dyes but the power should be left on until the dye
mixture (#7) separates into 3 distinct colors.

Data and Analysis: Record your observations in the chart below.
' L I. II. H L IIII L 0 (.1 IA;
#1 orange-G
#2 bromophenol
blue
#3 pyronin-Y
#4 crystal violet
#5 phenol red

#6 xylene cyanol

#7 dye mixture

70

DISCUSSION AND QUESTIONS:

1. What dyes are positively charged and which electrode did they migrate
towards?

2. Compare the size of gene fragments in terms of the speed that they
might travel through the agarose gel.

3. What were the three unknown dyes in the dye mixture?

4. Of the three dyes that were used as standards, which one of them is
probably the biggest molecule and how can you tell by looking at your
gel?

5. Approximately how many base-pair equivalents would you guess
phenol red to be? (Hint: compare it with your standards).

PALINDROMES
BACKWARDS OR FORWARDS
Teacher Section
Introduction:

A group of words or letters that read the same forwards and
backwards are called palindromes. These palindromes can occur in DNA
sequences. This is precisely where most restriction enzymes make their
cuts: within the palindrome. These chemical scissors travel along the
DNA strand from the 5' end to the 3' and until they recognize a specific
restriction site. These restriction sites involve two specific bases within a
very specific palindrome. Each individual restriction enzyme cuts at
different palindromes.

For example, the restriction enzyme EcoRl cuts at the palindrome
G A T C, between the letters A and G. Since the DNA is double stranded,
you will notice that a staggered cut is made. Remember that DNA is
antiparallel so the enzyme reads the top strand from left to right and right
to left on the bottom strand. This staggered cut actually produces a place
for the host DNA to attach. Thus these attachment sites are called "sticky

ends". The name refers to the way the cut DNA readily attaches itself to
the vector.

Teacher Tips
1. Each student will need a copy of the lab.

2. Other restriction enzymes that can be used:
"Barn Hl - uses the site between G and G in the palindrome
5' G~GATCC 3'

”HIND Ill - uses the site between A and A in the palindrome
5' A~AGCTT 3'

”Hpa II - uses the site between C and C in the palindrome
5' C~CGG 3'

71

Name
Hour

PALINDROM ES
BACKWARDS OR FORWARDS"

Introduction:

Get ready! Genetic engineering is here: DNA technology at its
best. There is a lot of excitement in this growing field and it is having an
impact on all of us. What is this branch of biotechnology? To put it simply,
DNA sequences or genes are being removed from one organism and
placed into another.

But why would we want to do this? It's easy. To lower the costs and
increase the availability of a protein based product. For example,
everyone knows a diabetic person. Where do these diabetics obtain their
insulin? From products made by genetic engineering. To begin, we must
realize that there is a human gene responsible for instructing the cell to
make insulin. If we can remove that gene from a human cell and place it
in a host organism, it will make insulin for those individuals that can't.

For example, scientists have isolated the gene that codes for
insulin production. They can remove it from a human cell using restriction
enzymes acting like scissors. This enzyme removes the gene from the cell
to be placed in its new host cell. In this case, the host cell happens to be
a bacterial cell. Why a bacteria cell? Because bacteria are easy to obtain
and they reproduce very rapidly. The bacteria cell can divide, making
many new cells with the insulin gene in it. Ultimately the bacteria starts
making insulin as instructed by its new gene.

But how does the restriction enzyme know exactly where to find
this gene and then cut it out? To begin, we have to know what restriction
enzymes are. Normally, bacteria use these enzymes to prevent or stop
the invasion of foreign DNA into their cells. Basically these enzymes chop
up this DNA so it is ineffective in their cells. Scientists learned that these
enzymes cut up DNA in very specific places.

72

73

The sites where these enzymes cut the DNA are called restriction
sites. But how do the enzymes recognize these sites? The answer is the
notion of Palindromes. A palindrome is a phrase, word or sequence of
letters that reads the same forwards and backwards, like the words
radar, pop, or madam. Restriction enzymes only cut within a palindrome
in one direction. The direction is usually from the 5' end to the 3' end.

Use the palindrome: a man, a plan, a canal, Panama. Imagine that
the enzyme only cuts between the A and M reading from left to right. How
many pieces would your sentence be if you allowed the enzyme to do its
work? Write it out in the space below and find out. Palindromes can also
be found in DNA Since DNA is double stranded, this method works
perfectly. Look at the palindrome below

5' GGATCC 3'
3' CCTAGG 5'

The top strand reading left to right is the same as the bottom
strand reading right to left. One specific restriction enzyme cuts at this
palindrome between the G and G. This is what the cuts would look like:

5' AATCGCG~GATC CGCTTAA 3'
3' TTAGCGGCTAG~GCGAATT 5'

The restriction enzyme caused a staggered cut. This staggered cut
is referred to as "sticky ends". These sticky ends are what allow genetic
engineers to successfully cut and splice genes. All that is needed is to
make this same cut in the host cell and these sticky ends will fit right into
place.

Scientists have discovered many restriction enzymes. The above
enzyme is called BamHl, referring to the bacteria that it was isolated from.

74

Examples

Be sure to read all the steps before starting. Use a separate sheet of
paper for the answers.

1. The palindrome for EcoRl is GAATTC. It cuts between G and A inside
of the palindrome. Write out the palindrome (recognition site) as a double
strand of DNA

2. Make up a sequence of 15 bases using T-A-G-C in any order. Vtfithin
this sequence, add the recognition site of EcoRl in two different places.

3. Now cut the DNA sequences by using an arrow. Be sure you have
"sticky ends".

Questions

1. Why are palindromes important to genetic engineers?

2. Where do restriction enzymes come from?

3. Compare and contrast DNA and genes.

4. Write a description of a "sticky and" and explain why it is important to
have this type of end when doing genetic engineering.

5. What kinds of solutions to problems in disease fighting do you think
can be solved through genetic engineering?

6. What kinds of problems do you think genetic engineering might cause
in the future?

CONSTRUCTING A RESTRICTION ENZYME MAP
Teacher Section

Introduction: Recombinant DNA technology is a growing field of science,
growing so fast that many teachers can't keep up with the new
techniques. Recombinant DNA is DNA that is made by connecting
fragments of DNA from different sources. Restriction enzymes are used to
cut DNA at specific locations which then can be removed from the cell.
Once any kind of recombinant DNA has been cut and removed, it can be
inserted into another organism as that organism can now use the foreign
DNA as if it were its own. Insulin production from bacterial cells is a good
example.

Background: This lab activity will demonstrate two main principles: the
first being that restriction enzymes cut or "cleave" DNA at very specific
recognition sites and the next being that these resulting strands of DNA
are different lengths. Therefore they travel at different speeds in agarose
gel during electrophoresis.

Students will find out that there are many restriction enzymes that may
make one or more cuts in a strand of DNA The cuts are given on a chart
based on how many base pairs that particular strand possesses. The
main idea is that the more the base pairs in a DNA segment the slower it
travels through a gel.

For best results:

* The pop-it-beads can be purchased beforehand from almost any
science catalog.

* This lab activity takes about a 50 minute period.

75

Name
Hour
Date—

CONSTRUCTING A RESTRICTION ENZYME MAP

Objective: Students will construct a restriction enzyme map using
materials provided. Using the data, the students will know where
restriction enzymes have cut or "cleaved" plasmid DNA.

Materials: paper
pencil
pop-it-beads
17 cm diameter cylinder (poster board works great)
colored pencils
calculator

Procedures:
Part A

1. Table 1 represents the molecular weight standards for a
plasmid. This plasmid has a total of 1000 base pairs. Using gel
electrophoresis, it has been determined that a segment of DNA of
900 base pairs travels 0.80cm on the gel.

a. Since a molecule with 400 base pairs is smaller than one
with 900 base pairs, it can travel farther and faster on the
gel. How far did 500 base pairs travel?

 

b. How far did 100 base pairs travel?

 

2. Table 2 shows what happens when each restriction enzyme is
placed alone with the plasmid and allowed to cut it at it's restriction
site.

a. How many cuts did enzyme A make?

Enzyme B , Enzyme C

 

76

77

3. Using yellow pop-it-beads, construct a model of the plasmid.
Each_bead_wilLLepresenL20_base_naiLs. Ignore the cuts in the

plasmid.
a. How many total base pairs does the plasmid have?

b. If each bead represents 20 base pairs, how many beads
do you need for this plasmid?

c. At this point, fill in tables 2 and 3.

4. Starting with enzyme B, notice that it only makes one cut. This
fragment represents the total length of the plasmid. Now using your
plasmid that you constructed in procedure 3, remove 2 yellow
beads and insert a pair of blue beads to represent the cut made by
restriction enzyme B. This is plasmid #2. Does it matter where you
put the blue beads?

5. Construct a second plasmid using green beads to represent the
cleavage site for enzyme C. This is plasmid #3.

6. Construct a third plasmid (actually plasmid #1), this time using
red beads to represent the cuts made by enzyme A. Remember

We. The red beads should be placed so
that they are separating the plasmid into 2 separate sections.

a. How long is the first segment?

b. How long is the second segment?
7. Table 3 shows the results of mixing two of the restriction
enzymes together and allowing them to cut the plasmid.

a. How many cuts did enzymes A and B make?

AandC , BandC

You may now take apart the 3 plasmids you just made. Save
the beads for the next section.

78

8. The next 3 plasmids that you will construct will have several cuts
caused by two enzymes. Build plasmid 4 that has been cleaved by
enzymes A and B from table 3 after answering these questions.

a. How many cuts did enzyme A and B make?

b. Which of these cuts are still the same from enzyme
A?

c. Which enzyme A base pair was cut?

d. When making plasmid 4 how many base pairs long will
each section be?

9. Now construct plasmid 5 where A and C made 3 cuts.

a. Which of those cuts is still the same from enzyme
A?

b. Which enzyme A base pair was cut?

c. When making plasmid 5 how many base pairs long will
each section be?

10. Now construct plasmid 6, where enzyme 8 and C made cuts.

a. How many cuts are made?

Part B

1. If you have reached this point successfully, GREAT JOB I Now
notice you have 3 plasmids. Do not lose track of which plasmid is
which. Remember that plasmid 4,5 and 6 have been cut by 2
enzymes so they should have 2 or 3 restriction (cut) sites. Now
stack each of these plasmids on the ring. Rotate the three plasmids
until all of the beads of the same color (except yellow) are directly
above each other. ( HINT: You may have to remove a plasmid and
flip it over to make a perfect match)

2. "THE SUPER PLASMID" Now construct the final plasmid that
shows the restriction sites for all of the enzymes that you used.
This plasmid represents a complete restriction map for your

plasmid. Using your colored pencils, please transfer this plasmid
on to figure 1.

 

79

80

Iablelzlldoleculauueiobtflandards
Base Pairs (bp) Centimeters
900 0.80
800 1.80
700 1.30
600 1.60
500 1.85
400 2.30
300 2.80
200 3.50
100 4.80
30 7.00
17 8.00
RESTRICTION ENZYME CLEAVAGE POINTS
Enzyme A Enzyme B Enzyme C
(Plasmid 1) (Plasmid 2) (Plasmid 3)
Beads bp cm Beads bp cm Beads bp cm
600 1.60 1000 0.60 1000 0.60
400 2.30
W
EnzymeA&B EnzymeA&C EnzymeB&C
(Plasmid 4) (Plasmid 5) (Plasmid 6)
Beads bp cm Beads bp cm Beads bp cm
280 2.90 340 2.70 540 1.70
120 4.45 260 3.05 460 2.00

600 1.60 400 2.30

MAKING A RECOMBINANT PLASMID
TEACHER SECTION

Introduction:

As teachers, we are constantly being asked to bring technology
into the classroom. And for good reason. Students need to be updated on
current issues in biotechnology as the field is growing at great speeds. It
is not acceptable to know only the structure and function of DNA
Students also need to know about the techniques used by scientists to
alter or reconstruct DNA.

In this lab, the students will learn about one such technique.
Recombinant DNA techniques are being developed at an astounding rate
and the students need to be aware of such basic methods. Recombinant
DNA usually involves a specific strand of DNA that is producing a
desirable trait or biochemical product and then removed from its host.
This process of removing the desired gene is done with a chemical pair of
scissors called restriction enzymes. These enzymes can cut the genes
from the original strand of DNA with precise accuracy. Next the gene can
be placed in a host, usually bacteria. Using the same restriction enzymes,
the new DNA becomes incorporated into the host's DNA. As the host
reproduces, each new cell has a copy of the introduced gene. At this point
the new gene instructs the host to produce the desired product. When the
students are finished with this lab, they will discover that:

1. desired DNA sequences can be removed from a cell.

2. the sequences are "cut out" by enzymes.

3. these enzymes are very specific as to where they make their
cuts.

4. the desired gene can be placed into a host vector ( sometimes
called a plasmid).

5. the vector infects a host cell which incorporates new DNA into its
own DNA

6. the host cell is now ordered to carry out the instruction of the

gene.

81

82

Materials: For each group of two students

1 blue sheet (plasmid)
1 green sheet (cell DNA)
1 yellow sheet (restriction enzymes)

Teaching Tips:

1. remind students that the enzymes read from 5' to 3'

2. When making copies of the colored cards, enlarge them just big
enough where they can fit on a sheet of paper.

3. Use a large piece of paper when drawing the plasmid.

Name
Hour

MAKING A RECOMBINANT PLASMID

Introduction:

Making intelligent and responsible choices is something that we
are asked to do everyday. Becoming educated about the world around us
is paramount in helping us make these decisions. This activity will
introduce us to an issue that has made a huge impact on our society.
Learning about the pros and cons of biotechnology, can supplement our
knowledge about many areas of science.

Recombinant DNA technology, an area of biotechnology, is a
growing field of science. This technology uses living organisms to
produce substances of interest: combining biology with chemistry and
science with industry.

How does recombinant DNA technology work? Recombinant DNA
technology involves using enzymes called restriction enzymes to cut out
pieces of DNA from one organism. The same enzyme is then used to cut
a circular piece of bacteria DNA called a plasmid. The DNA from the first
organism is then mixed with the plasmid DNA. The two pieces fit together
by another enzyme called a Iigase. The resulting plasmid now has the
DNA from a different organism. The plasmid is then placed into the
bacteria and allowed to reproduce. These resulting new cells are clones
of the cell that contains the new DNA.

Today, this is how human insulin is made. The DNA for making
human insulin is cut out and inserted into a plasmid. The plasmid is then
replaced back into the bacterial cell and allowed to reproduce. Each new
daughter cell now has the ability to make insulin. In this way insulin is
able to be produced simply, safely and cheaply. This process sounds
confusing but it is actually quite easy. This exercise will illustrate the
process.

Materials:

scissors

plasmid sheet (blue)
cell DNA sheet (green)
enzyme sheet (yellow)
scotch tape

83

Procedures:
Part A

1.The strips on the plasmid sheet are written with the DNA 3' to 5'
from the top to bottom on the left - hand side of the strip and from
the 5' to the 3' from the top to the bottom on the right - hand side.
Cut out the plasmid strips along the dotted lines. Do not throw
away the key at the bottom of the page.

2. Tape the strips together and to end in any order. Then tape the
two ends together to give you a circular plasmid.

Part B

Locate the restriction sites on your plasmid according to the steps
below. The enzyme sheet shows how 8 different restriction
enzymes will cut base pairs.

1. Cut the enzyme sheet cards

2. Compare the sequences of the base pairs on the cards with
what you have on your plasmid. Mark a starting point on your
plasmid and work your way around, marking the restriction sites as
you find them. Include how it cuts and the name of the restriction
enzyme.

3. Using your starting point as a reference, divide the circle in
fourths by folding it in half, and then in half again. This will help
place your restriction sites, and replication origin in relative
distance to each other.

4. Draw a circular map of your plasmid. Marking the restriction sites
and replication origin in relative distance to each other. This is
called a restriction map.

85

Part C

1. Keeping the numbers attached, cut out the strips on the cell
DNA sheet. This contains the gene you will transfer to the plasmid.
Do not throw away the key at the bottom.

2. Assemble the strips in the order one through six as indicated on
your handout. You should end up with a long, flat strip. The
numbers should not be visible.

3. The gene is in triplet code on the 5' to 3' strand and starts with
methionine and ends with a stop codon.

4. Determine which restriction sites are near the gene on your cell
DNA Pick the restriction enzyme that will cut the DNA both above
and below the gene.

5. Using the same restriction enzyme, see where it cuts the
plasmid. As long as you do not cut the replication origin, you may
use the enzyme.

6. Mark your cell DNA to show how the restriction enzyme will cut
it.

7. Cut both plasmid and cell DNA following the cutting patterns on
the appropriate restriction enzyme cards.

8. Match up the sticky ends of the gene with those of the plasmid
and tape the ends together. WAALAAI! RECOMBINANT DNAII

What would scientists do next?

1. The recombinant DNA would be inserted into a and be
allowed to divide.

2. The bacterial cells are then screened for the inserted gene.

3. Those that possess the inserted gene are grown and the gene product
is collected. For example, insulin.

86

QUESTIONS:

1. What restriction enzyme did you use?

2. What does the Iigase card allow you to do?

3. What do restriction enzymes do?

4. Why must you use the same restriction enzyme for both the cell DNA
and the plasmid?

5. This new plasmid is called a recombinant plasmid. What does this
mean?
(Hint: think of the word "recombinant")

6. How do you determine which restriction enzyme to use?

PLASMID

[I'll {I'll

 

_ATTCGGCATCCAAGCTTCAGG_
TAAGCCGTAGGTTCGAACTCC

 

IH'Illl‘_
ll IIIIIIIIIIIIIII
III-III

ACCAC GlTTCCAATATGA

 

 

lGClTCAmAT CCGGG
CGAGTTA GGCCC
l IIII .l IE

 

 

 

ATCCGGGGGAAAAATCCCTGA_

00000000000000
00000000000000

TAGGCCCCCTTTTTAWCWGGACT

00000000000000
OOOOOOOOOOOOOO

 

 

TGGTG CAAGGTTATACT_

 

 

 

 

 

TCTTTTACACACAGCTCATCC
 AGAAAAWPTGTGTCCAGTACC_

 

 

 

 

 

 

lllllll"|L
II!
II llllll I III]

CGCGTCTCAAAGAlATTCCAGA
GCC...CAGAGT_TTCTTAAGGTCT

 

kanamycin resistance
plasmid replication

= tetracycline resistance @

= ampicillin resistance

-Cne

 

 

IIIIIII I ' I'lllliiill'll|L

87

CELL DNA

 

AAGCTTGCCCCGGGATCCTGG
TTCGAACGGGGCCCTAGGACC

 

‘

C T&ATAAGGAGGAATTCTTA
CLA.IAITCCTCCTTAAGAAT

 

 

: r
A i T. l e.

 

 

 

 

 

 

 

 

 

 

 

.uu A4 Arv ntv.nfl nhv it tum 1L . rt pry pm .3“ AA .Ln
C

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

L

T T F 3 I; C A T [u . G C C T T T A A a .
p
n

AAGCTTCCA -../“TAT C LAGAC
TTCGAAGG .: Ar... A . p C

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

CTCTAAGAATTCAGTTCGTCC
GAGATTCTTAAGTCAAGCAGC

 

 

ACfiCGGATCCGTGTCCCGGGC

7.

 

TGGGCCTAGGCACAGGGCCCG

 

protein gene

@

88

RESTRICTION ENZYMES

 

 

 

 

 

 

 

 

 

 

 

 

 

 

_ m m ........ fill... ......... m
__ m . O . _
. .. .. m m
_QCAT£C“GAATTC“ u “
-QCTAGGACTTAAGm m
_ -------- m Allin , ..... h .......... m
__ 1m m W m m m
_ w n H m X m
“AACCITm CKEG "CCClCE"
TTCGAA" QGCC mGEGCCCm
_ .......... m ........ .m ..... h. ..........
x a " 1WD “ arm

“GCMKC "ACATCTuGAGCTE
LCCTGGMICTAGAMCTOGAG

89

DNA Fingerprint Comparison 1

ANALYSIS OF DNA FINGEBPRINTS IN FORENSIC TESTING

S

 

 

 

.'.-.-.--.. fry. ........

....................

lllI i ll

l

 

 

 

m
5 0 6‘5 0 A e
... I O O

. .. . . . C .
. ' C. . ' ' . '
’0 '0 so .0

(D

 

 

 

 

.........................

 

 

 

 

 

90

Answer:

NO MATCH

_ Answer:

MATCH

 

LEGEND
V = Victim
E = Evidence
5

= Suspect

 

 

L J

 

 

DNA Fingerprint Comparison 2

Analysis of DNA Fingerprints in Paternity Testing

M C F M C F

 

 

 

 

 

 

 

r 1 CW 1
—eee.— .W .W
W W —Oee.—
...-......- ...-...... Remaining bands -—_"°"—
—°"'-— in child must ”W W" Answer: YES
m... m... come from . —--->— Paternity established
— W he father W
_ ..W I MW, —
_eoe._ .-zwm -W
W _
L #J L J
Identify maternal bands Do paternal bands in child

in child derive from father?

 

 

f 1 ' F1 1
_- . o. — W awr‘w‘w _
. W — o . e 9
_ enemas-m ................ .39., —
... . .. _ . . “-
_ e o p 9
‘Wm —
. . . W” “ OIEWK‘W-K'A“: .-$M’;Of.~2’.r€~tw
:‘:g:i;‘.1:§:f‘.f‘3:§:=.’i - A n SWOT: N O
. w“. u . \ as; ”as .v — . . . ? . .
...-......- Paternrty disproved
— 75.14:" -—
_ ”mm”
— ._ ,,,,
. ... 5v... A #...‘(‘C.‘M... ‘mom
---s "
u-A .-
L #J L _J

 

 

 

 

 

91

 

 

 

 

 

 

 

 

 

 

 

 

C TC

 

 

F iiiii

 

 

 

 

 

 

 

 

 

 

 

"C G

 

 

 

 

 

 

 

 

 

GGC

 

 

 

UCC

W
UA

 

 

 

 

RRRRRRRRR

 

 

 

 

 

 

 

 

 

 

 

GLU

 

 

 

 

 

 

 

Figure 11
tRNA CARDS

WW_
AGG CCG

UW

 

 

 

 

 

 

 

 

 

97

Figure 12
AMINO ACID CARDS

' PROLINE‘ ASPAHAGIN
__/\ '

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

GLUTAMIC
VALINE ACID
,___/\ /\
LEUCINE SERINE .
___./\ N
GLYCINE '

 

 

__/\___

98

Name
Hour

DNA SCIENCE QUESTIONNAIRE
Please answer the following survey using your knowledge of each
subject.

Using the scale 0 - 5 rate each subject on how well you know the material.
0 = no knowledge and 5 means great knowledge.

Ban Sum

The structure of DNA

The function of DNA

Relative size of the DNA molecule

Protein Synthesis (the process of building proteins)
Gel Electrophoresis

Making or reading Restriction Enzyme Maps
Recombinant DNA

PCR (polymerase chain reaction)

DNA Sequencing

DNA Fingerprinting

99

Biology I Name
Hour

DNA Pretest

Please answer the questions to the best of your ability. Don't worry about
writing a wrong answer, but please do not leave any blank.

1. As you look around the room, you see a variety of hair color. Why do
you see predominantly dark hair though?

2. What is DNA's shape and where can it be found?

3. What is the function of DNA?

4. Is it possible to remove DNA from a cell without damaging it?

5. Can DNA be seen under a microscope?

6. Is it possible for two people to have the same copy of DNA?

7. Does your liver cell have the same copy of DNA as your heart cell?

8. Does a heart cell contain the information about an individuals hair
color?

100

101

9. Is it possible for a scientist to compare the DNA of one individual with
another?

10. Look around the room and see the different characteristics people
possess. Different sexes, hair color, height, eye color, skin color and so
on. Yet all of us have two arms, two eyes, one mouth, ten fingers etc. Can
you begin to explain why this is possible?

11. Who are Watson and Crick?

12. DNA is responsible for generating specific traits. Explain the process
by which DNA actually aids the cells in consequently producing the trait.

Name
Hour

Recombinant DNA Post Test
Define the following words:

1. Recombinant DNA-

2. PCR (polymerase chain reaction)-

3. Restriction Enzymes-

4. Plasmid-

5. Human Genome-

Short Answer:

6. What is the general shape of DNA and specifically where can it be

found?

7. Please compare and contrast DNA and genes.
8. How does RNA and DNA differ? ( be sure to mention bases, whether it

is double or single stranded and possible places it can be found)

9. What end result is made possible by the process of DNA replication?

102

103

True and False

10. Is it possible to remove DNA from a cell without damaging the
molecule?

11. Insulin is a valuable product made from recombinant DNA
12. Palindromes are "chemical scissors" used for cutting desired
sections of sequences from a DNA strand.

13. It is still not possible for a scientist to compare the DNA of
one individual with another.

14. A liver cell has the same copy DNA within the nucleus as a
heart cell.

In The space below, Please draw a short section of DNA while labeling
the following structures: Bases, Phoshate groups, Deoxyribose sugars,
adenine, thymine, guanine and cytosine.

104

MATCHING:

_1. Vector ____8. clones

__2. Plasmid _9. DNA fingerprinting
_3. Restriction Site _10. PCR

_4. Human Genome _11. Palindrome
___5. Transgenic Organism _12. DNA sequencing
_6. Gene Splicing __13. Restriction Enzyme
__7. Electrophoresis _14. Insulin

A a process of making more copies of a DNA strand.
8. a circular piece of DNA in a bacterium

C. a process to sort DNA fragments.

D. used to transfer DNA from one organism to another.
E. Madam I'm Adam

F. used to figure out the order of base pairs in a gene.
G. the exact place where DNA is cut by enzymes.

H. the rejoining of cut DNA sequences

l. a valuable product made from recombinant DNA.

J. Identical cells descending from one original cell

K a bacterium possessing the insulin gene.

L. the total sum of all the genes in one human cell

M. a process used to separate DNA fragments creating patterns used to
compare organisms of the same species.

N. "chemical scissors"

105

GEL ELECTROPHORESIS LAB
Multiple Choice: Choose the best answer

1. In order to make a gel, the solution was brought to a boil and
then cooled slightly before pouring it into the gel tray. What
apparatus was used to form the shape of the gel?

a. electrodes and a comb b. a comb and tape

c. micropipette and buffer d. buffer and electrodes

2. What was used to add the dyes to the wells?
a. a comb b. an Erlenmeyer flask

c. a micropipette d. a beaker

3. If a dye travels towards the cathode, the dye is said to be:

a. positive b. negative

4. Which dye is molecularly bigger?
a. orange G b. bromophenol blue

c. phenol red d. xylene cyanol

5. Which dye is positively charged?
a. pyronin Y b. phenol red

c. orange G d. xylene cyanol

6. Which dye was NOT included as an unknown:
a. orange G b. phenol red

c. pyronin Y d. bromophenol blue

7. If orange G travels through the dye at a faster speed than
crystal violet, then orange G is :

a. wetter than crystal violet b. bigger than crystal violet

c. more colorful than crystal violetd. smaller than crystal violet

106

APPLYING DNA FINGERPRINTING

l. Msjmamldfledinanaumiobfleaaident. Fi 7
Mamfidfiendfiledapewnity gurc-
mitehimingthathJonesmthefadterof _
hachiumddtmshemenddedtodae
manhesamxeepinginminddmindividmls simpler”! 5"?“ 5"“? W“ f‘mPkl ;
reoeivehalf their DNA from their motherand

Mffi'omcbeirfadter,whidtsampleofDNA
wouldhavembefiomMrJonesifhemdie
chfld’sfidlerHSeel-‘tgureufixphinm

answer.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

IOWMUON>

 

 

 

 

2. Aboyrnoveemanodiercomuyuolivewithhis Figm'e3
{edict-.Yarshteameboydeddesmnm
heckmlivewithdtewonnnwhomredhim.
Immigration 056:]: suspected that the boy I 2 3
was the woman's nephew, not her son. and thus 5.51:; washer) Wm)

not legally entitled to residency. Based on the
gen-prints. is itpossible thetsheiscbe
boy‘s mother? (See Figure 3.) Explain your

DNA fin

 

 

 

 

ammonia»

 

Bdowisadnwingofahypotheticalgellndudedonthegdisthelnndingpamofthemomer
and {atherofwo children. mewhatdtepemofbandsfcrachofdtechflflm mightlook
like. Indicate the possible parental source usingd‘ for the male (Ether) and 9 for the female
(mather).

Standard
Markers MOther
\ Father I Child Child
‘ Y Y ‘1' ‘IL W" ' ' ' t'
E E E E/ er fortnjectmg DNA

 

 

manna»
Illlllli‘
I

'11

 

DNA UNIT TEACHER SURVEY

Dear Fellow Biology Teachers,
I would greatly appreciate your help if you could fill out this survey
regarding the unit on DNA biotechnology that you are currently using in
your biology class. Please take a few minutes to jot down some
comments. These will be very helpful in the presentation of my thesis. If

you have any questions, please don't hesitate to ask.

1. To begin, was using this unit a Ieaming process for you as well as the

students? Please comment.

2. Do you feel that the unit is at the appropriate level for the students?

3. Is the unit too lengthy: do you feel it is taking away too much time from

our curriculum?

4. What labs (if any) do you think worked especially well or maybe didn't
work at all. Keep in mind the concept of the lab: did the student gain an

idea or concept from the lab or activity?

107

108

5. Will you use this unit again next year?

6. What things could you do to improve the unit?

7. Do you think any of the lab activities caused students to use their

critical or higher thinking skills?

8. Do you feel it is important for a teacher to remain as current as possible

in terms of teaching strategies and content information?

Thank You Very Muchll

Chris Forbush

WORKS CITED

Beardsly, Tim. "Pointing Fingers". Scientific American. Mar, 1992. 26-27.

Back, Isabel. "Reading and Reasoning". The Reading Teacher. May
1 989. 76-82.

Brown, William. "DNA Fingerprinting Back in the Dock". New Scientist.
Mar. 1993. 18-24.

Culver, Kenneth W. "Splice of Life". Sciences. Feb. 1993. 18-24.

Darnell, James. Harvey Lodish, David Baltimore. (1990). Molecular Cell
Biology Second Edition New York. Scientific American.

Ezzell, Carol. "Closing in on the Lou Gehrigs Disease Gene". Science
News. Jan. 2, 1993.

Franklin-Barbjosa, Cassandra. "DNA Profiling: The New Science of
Identity". National Geographies. May, 1992. 112-124.

Jaroff, Leon. "Happy Birthday, Double Helix". Time. March,1993. 56-59

Klug, William, Michael Cummings. (1983). Concepts of Genetics. Ohio.
Merrill.

Macklem, George, Karen Pawloski, Sarah Lintemuth, Andrea VonTom,
Laurie Kaguni. "Especially for Teachers Section: Now that we have the
DNA, what do we do with it"? Natural Science. Michigan State University.
East Lansing, Michigan. Vol VI, No.1, 1992.

Micklos, David, Greg F reyer. (1990). DNA Science: A first Gnome in
Recombinant DNA Iecbnolocv. Carolina Biological Supply.

Miller, G Tyler. (1992). Living in the Environment. California. Wadsworth
Inc.

Pawloski, Karen. (1996). Forensic Science in the High School Classroom.
Michigan State University. East Lansing, Michigan.

Rasmussen, Alison, Robert Matheson III. A Wk 91 Biotechnology
Aot'mities. 1990. Expert Graphics. Virginia.

109

 

 

110

Rasmussen, Trudy, Chris Forbush. "Especially For Teachers Section:
The Isolation of DNA from Onion Tissue". Natural Science. Michigan
State University. East Lansing, Mishigan. Vol V, No 2. l991-1992.

Roberts, Leslie. "DNA Fingerprinting Back in the Dock". New Scientist.
Mar. 6 1993. 14-15.

Science Kit and Boreal Laboratories. "DNA Fingerprinting". New York.
Science Teacher. "Making a Recombinant Plasmid". I987. 44-48.

Stroh, Michael. "DNA Solves AIDS Epidemiological Whodunit". Science
News. May 23, 1992.

Sulfian, Jane. "Forensic Use of DNA Tests". British Medical Journal.
July 6, 1991.

United States. The National Commission on Excellence. A Nation at Risk:
InelmmratixefcrEducatianetcrm. April 1993.

University of Michigan. "North Central Association of Colleges and
Schools". 1993.

Yager, Robert and John Penick. "Resolving the Crisis in Science
Education: Understanding Before Resolution". Science Education
Jan.1987.