‘ ill «.1 x .
x3...) mnfinflgfimwuwwre
. r «.6. van
.. w; :31.
. :i , raiweutrwquxsk
Z .33 .r; 4.

9-“. I»

g

t .43)»:
I :5 1119:9573. #4
Yr!!- . v 4 n I)...» 1 a

. )iivst;

V. .3 2.191)...
a 51: 1.4.1!!!-
) . l. I «I. <5]
1; a lid .r

1

. . (.313 {253.}... .
r2 . . 321W.)
2:13;. ..

 

”1.... .31..
an. {IF S.
.1)

, t; i 5‘. (V
I. If. 15;: It»);

 

LI .l;w;lfllurr..

 

“11.)“. .3,
. .4! .f; r 1....”

1 1.7 Itr .I1IVIII‘Lrlr.
x y S; :.:P.\. {.3 ..I: .I

 

 

THESIS
"7
L- SITY LIB

I|IIIIIIII|IIIIIIIIIIIIIIIIIIIIIIIIIIIIIII IIIIIIIIIIIIIIIII

31293 01686 2389

 

 

 

 

This is to certify that the

dissertation entitled

IDENTIFICATION AND CHARACTERIZATION
OF NUCLEAR PORE COMPLEX PROTEINS IN PLANTS

presented by
Antje Heese-Peck

has been accepted towards fulfillment
ofthe requirements for

Ph . D degree in Botany and
Plant Pathology

 

/ ’ ‘ I - 'h 7 _.
M {30(5 '4 fi"(/ [/16 ("i/

Major professor

 

Dam NOV. 4, 1997

 

MSU H un AHIrmutiw- Arman/Equal Opportunity Institution 0-12771

 

LIBRARY
Michigan State
University

 

 

 

PLACE IN RETURN BOX
to remove this checkout from your record.
TO AVOID FINES return on or before date due.

 

DATE DUE DATE DUE DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1/98 c:/CIHC/DateDm.p65-p.14

 

 

 

IDENTIFICATION AND CHARACTERIZATION
OF NUCLEAR PORE COMPLEX PROTEINS IN PLANTS

By

Antje Heese—Peck

A DISSERTATION
Submitted to
Michigan State University
in partial fulfillment of the requirements

for the degree of

DOCTOR OF PHILOSOPHY

Department of Botany and Plant Pathology

1997

ABSTRACT

IDENTIFICATION AND CHARACTERIZATION
OF NUCLEAR PORE COMPLEX PROTEINS IN PLANTS

By

Antje Heese—Peck

Nucleocytoplasmic transport of macromolecules occurs through nuclear pore
complexes (NPC), proteinaceous structures with an approximate mass of 125 MD. Only
approximately one third of more than 100 different NPC proteins have been identified
and characterized mainly in vertebrates and yeast, but no plant NPC protein has been
isolated so far. As an initial step to identify plant NPC proteins, we demonstrated that
NPC proteins from tobacco suspension—cultured cells are modified by N-
acetylglucosamine (GlcNAc). Using wheat germ agglutinin (WGA), a lectin that binds
to GlcNAc, specific labeling is found associated with or adjacent to NPCs as shown by
electron microscopy. To obtain more information about the sugar modification of the
nuclear glycoproteins, an in vino-labeling procedure using galactosyltransferase (GalTF)
was employed. This enzyme specifically transfers the 3H—galactose moiety of UDP—3H—
galactose to terminal, but not internal GlcNAc residues of glycoproteins. At least eight
proteins are specifically labeled in the presence of the GalTF. The radioactively labeled
sugars were bound to the nuclear proteins via an O-linkage. Interestingly, mass analysis
indicated that the labeled glycans of plant origin were different from the single 0—
GlcNAc of vertebrate NPC proteins; the plant glycans consist of oligosaccharides larger

in size than 5 GlcNAc.

The nuclear proteins modified with terminal GlcNAc, referred to as tGlcNAc-
proteins, were purified by Erythrina crystagalli agglutinin affinity chromatography.
Internal amino acid sequence information was obtained for three of the purified
tGlcNAc-proteins, designated gp33, gp40 and gp65. A combination of PCR—based
amplification, screening a cDNA library, and S’RACE were used to clone a gene
encoding gp40. All three gp40-peptides, identified by peptide sequencing of gp40, were
localized in the deduced amino acid sequence of the gene product confirming the
identity of the clone. No specific gene products have been obtained for gp33 and gp65
using similar approaches so far. Interestingly, the gene encoding gp4O has 28 to 34%
amino acid identity to aldose—l-epimerases from different bacteria. Aldose-l—epimerases
catalyze the interconversion of the oz and B configurations at the asymmetric Cl-atom
of aldoses. To date, no other gene encoding an aldose-l-epimerase has been isolated
from animals and plants, and the exact function of aldose—l-epimerases is unknown in
higher organisms. To determine the subcellular localization of gp40, monospecific
antibodies were produced to recombinant gp40. Organelle fractionation in combination
with protein blot analysis confirmed that gp40 was a nuclear protein. Consistent with
its isolation as a putative NPC protein, gp40 was mainly present at the nuclear rim as
shown by conventional light and confocal laser seaming immunofluorescence
microscopy. Future analysis of gp40 as an aldose-l-epimerase-like protein may give

new insights into the function of aldose-l—epimerases in eukaryotes.

iv

To Scott,
for his love and support

ACKNOWLEDGEMENTS

Where do I start to thank all the people that have helped in some way or another to
finish my Ph.D. thesis? I am very grateful to the members of my thesis committee,
Drs. Frans deBruijn, Pam Green, Ken Keegstra, and John Wang, for their interest and
helpful advice beyond the committee meetings, prelims and thesis defense. And of
course, I would like to thank Natasha to give me (at least most of the time) the freedom
to pursue my thesis project the way I felt was the "right" way. Over the past years,
Natasha has been a major influence on who I became as a person and what I believed
in. Thanks to all the past and present members of the Raikhel laboratory for many
protocols, discussions and "entertaining" lab meetings throughout the years. In
particular, I want to thank Rita and Susannah for their help and friendship during my
first years in the lab; Diane and Tony, not only for fun coffee breaks, but also for their
discussions and support during some rough times; and Glenn who has been a great
mentor during my first years in graduate school. I feel very lucky to have met several
special people in the PRL and in East Lansing; thanks to the members of Science
Theatre (in particular, Bill, Matt, Dave Batch, and the rest of the "From Stardust to
Life - A Cosmic Journey" group) for showing me that science can be very rewarding
outside of the lab; Hans Kende who changed the fate of my life by accepting me to the

PRL and of course, for introducing me to Scott; Ambro, Nikki, Tom, Beth, Pauline,

Linda, Esther, Eric, Christiane, Diane, Ronda, Joe, Susannah, Hilton, Christine,
Frank, Sharon (I hope I did not forget anybody...) for becoming good friends; Beth and
Esther for dragging me swimming (hhm, steam room!); Laura for making me laugh and
forget work when coming home from the lab; Gabi, Claudia and Klaus for showing me
that friendship can survive long distances; Tom for great game nights and keeping Scott
occupied while I was frantically finishing my thesis; and of course, Jenny for her
deep friendship!

I feel fortunate for having a very loving family who supported me during the past
years. Vielen Dank, Mama, Papa und Kerstin, fiir Eure liebevolle Unterstiitzung in all

meinen Entscheidungen wahrend der letzten Jahre.

No words, however, can describe my thanks to Scott who has always been there for me

with his love, support, and incredible patience.

vi

TABLE OF CONTENTS

LIST OF TABLES ................................................................ ix
LIST OF FIGURES .............................................................. x
CHAPTER 1
Introduction: The nuclear pore complex ....................................... 1
1. The structure of the nucleus ......................................... 2
2. The structure of the nuclear pore complex ...................... 3
3. Identification of nuclear pore complex proteins ................. 7
4. Functions of nuclear pore complex proteins ...................... 17
4.1. Nucleocytoplasmic transport in vertebrates and yeast ..... 17
4.2. Nucleocytoplasmic transport in plants ....................... 21
4.3. Functional domains of NPC proteins and their
significance on function ........................................ 23
4.4. Localization of NPC proteins and significance
on their function ................................................. 28
4.5. Functional in vivo and in vitro analyses of
NPC proteins ..................................................... 29
5. Statement of problem and attribution ............................. 32
References ................................................................ 33
CHAPTER 2
Plant nuclear pore complex proteins are modified by
novel oligosaccharides with terminal N—acetylglucosamine ................ 43
Abstract .................................................................... 44
Introduction ............................................................... 45
Methods .................................................................... 49

vii

Results ..................................................................... 56

Discussion ................................................................. 74
References ................................................................. 81
CHAPTER 3
Purification of nuclear glycoproteins modified with terminal
N—acetylglucosamine by lectin affinity chromatography .................... 87
Abstract .................................................................... 88
Introduction ............................................................... 89
Methods .................................................................... 91
Results ..................................................................... 96
Discussion ................................................................. 106
References ................................................................. 1 12
CHAPTER 4

gp40, a tobacco glycoprotein modified with terminal N-acetylglucosamine
and localized at the nuclear periphery, shows sequence similarity to

aldose—l-epimerases .............................................................. 1 14
Abstract .................................................................... 1 15
Introduction ............................................................... 1 16
Methods .................................................................... 1 18
Results ..................................................................... 125
Discussion ................................................................. 151
References ................................................................. 158

CHAPTER 5

Conclusions and future directions .............................................. 164
References ................................................................. 169

viii

LIST OF TABLES

Table 1.1 Functional domains, localization, and

proposed functions of vertebrate NPC proteins ........... 8
Table 1.2 Functional domains and other characteristics

of yeast NPC proteins .......................................... 13

ix

Figure 1.1

Figure 1.2

Figure 2.1

Figure 2.2

Figure 2.3

Figure 2.4

Figure 2.5

Figure 2.6

Figure 2.7

Figure 3.1

Figure 3 .2

Figure 3.3

LIST OF FIGURES

Schematic diagram of the nuclear pore complex ........ 4

Schematic diagram of the NLS-dependent
nuclear import machinery ..................................... l9

Ultrastructural localization of N PC proteins
modified by GlcNAc in isolated tobacco nuclei ........... 57

Detection of tobacco nuclear proteins modified
by GlcNAc ....................................................... 61

Biochemical characterization of tobacco nuclear
proteins modified by GlcNAc ................................ 63

Detection of salt extracted nuclear proteins
modified by terminal GlcNAc using in vitro GalTF
labeling assay .................................................... 65

Detection of salt extracted nuclear proteins
modified by terminal GlcNAc using GalTF labeling
assays and WGA blot assay ................................... 66

Characterization of carbohydrates with terminal GlcNAc
on salt extracted nuclear glycoproteins ..................... 70

Comparison of O-GlcN Ac from vertebrate NPC proteins
and O-linked oligosaccharides with terminal GlcNAc
from plant nuclear and NPC proteins ....................... 77

Detection of galactosylated tGlcNAc-proteins using
fluorography and ECA blot analysis ........................ 98

Purification of galactosylated tGlcNAc-proteins
by ECA affinity chromatography ............................ 100

Amino acid sequences of peptides obtained from
gp33, gp40, and gp65 ................................... 104

X

Figure 3.4

Figure 3 .5

Figure 4.1

Figure 4.2

Figure 4.3

Figure 4.4

Figure 4.5

Figure 4.6

Figure 4.7

Figure 4.8

Figure 4.9

Figure 4.10

Amino acid similarity between gp33—peptides
and known proteins ............................................. 107

Amino acid similarity between gp65-PT9O and
A6 from A. thaliana (At-A6) ................................. 110

The 5’end of the three specific PCR products,
PT64s/8, PT648/9, PT643/H ................................... 126

Nucleotide and deduced amino acid sequence of gp40
as derived from the 5’RACE product (RACE-7) and
the truncated cDNA clone (GP40—5e) ....................... 128

Comparison of amino acid sequences of gp40 and
bacterial aldose-l-epimerases ................................. 130

RNA gel blot analysis of gp40 mRNA levels from tobacco
suspension-cultured cells and different plant tissues ...... 133

Detection of galactosylated gp40 after isolation on
ECA affinity chromatography by a-rat

aldose-l-epimerase antibodies ................................ 134

Immunodetection of recombinant glutathione S-transferase
(GST)-gp40 fusion protein expressed in E. coli ........... 137

Cofractionation of gp40 with the nucleus .................. 140

Purification of galactosylated gp40 by ECA
affinity chromatography ....................................... 144

gp40 is located at the nuclear periphery of
tobacco protoplasts ............................................. 146

gp40 is located at the nuclear periphery of

tobacco protoplasts as shown by serial optical
sections using laser scanning confocal microscopy ....... 149

xi

Chapter 1

Introduction

The nuclear pore complex

1. Structure of the Nucleus

The eukaryotic cell is organized into functionally distinct compartments, called
organelles, that are separated from the cytoplasm by lipid bilayers. Though organelles
function independently, communication between the different compartments is essential
for the eukaryotic cell to operate properly. The nucleus is the central organelle of the
cell, in which the genetic material is stored in form of chromosomes. It is surrounded
by a double membrane, the nuclear envelope (NE) (for review, see Dingwall and
Laskey, 1992; Gerace and Foisner, 1994). The NE provides temporal and spatial
separation between the transcription and processing of mRN A in the nucleus, and the
translation of mRNA into proteins in the cytoplasm. The outer nuclear membrane
(ONM) is contiguous and also biochemically and functionally similar to the
endoplasmatic reticulum (ER) membrane. In contrast, the inner nuclear membrane
(INM) has a different protein composition than the ONM and ER membranes. The INM
is underlaid by the nuclear lamina, a filamentous network that is mainly composed of
intermediate filaments (IF), named lamins, and provides the structural framework of the
nucleus (for review, see Gerace and Foisner, 1994). The ONM and the INM are
connected by a specialized "pore membrane" that has been proposed to serve as an
attachment site for nuclear pore complexes (NPCs) via proteins present in the pore
membrane domain (for review, see Gerace and Foisner, 1994). The large proteinaceous
NPCs form aqueous channels and control communication between the nucleus and other
cellular compartments. Though some molecules move through the NPCs by passive
diffusion, nucleocytoplasmic transport of most proteins and different RNA species is

mediated by a highly selective active transport mechanism. Active transport is energy—

3

dependent and requires the presence of signal sequences within these molecules (for
review, see Gorlich and Mattaj, 1996; Gorlich, 1997). The NPCs, therefore, play a

major control point in the movement of molecules in and out of the nucleus.

2. The structure of the nuclear pore complex

The general structure of the NPC seems to be conserved among eukaryotes, and
the architecture and components of this complex have been investigated extensively in
amphibian cells using different electron microscopic techniques (for review, see Panté
and Aebi, 1993; Davis, 1995; Goldberg and Allen, 1995). Using transmission electron
microscopy (TEM) and quantitative seaming transmission electron microscopy (STEM),
two— and three dimensional maps of "intact" (i.e. without detergent treatment) and
detergent released NPCs have revealed its mass and basic framework (Reichelt et al.,
1990; Hinshaw et al., 1992; Akey and Rademacher, 1993). The NPC is a proteinaceous
supramolecular structure of about 125 MD that has an overall cylindrical shape with a
diameter of 120 nm and a height of about 70 nm. When viewed perpendicular to the
plane of the NE (i.e. tangential sections), the NPC shows an eightfold rotational
symmetry of eight identical units (Figure 1). In longitudinal sections, it appears as a
tripartite structure consisting of a cytoplasmic and a nucleoplasmic ring that are
connected to one another via two sets of eight spokes referred to as the spoke complex
(Figure 1). The spoke—ring complex forms a central channel with a functional diameter
of up to 26 nm and eight smaller channels, each with a diameter of about 9 nm. The
smaller channels are proposed to allow passive diffusion between the nucleus and

cytoplasm (Hinshaw et al., 1992).

   
  
    
  

Filament

Cytoplasm

Central transporter

Nuclear
envelope

 

Lamina Ring Spoke
Nucleoplasm ‘ , Basket
Figure 1.1

Schematic diagram of the nuclear pore complex.

5

Using non-detergent treated NPCs, other studies indicate that this part of the spoke
complex transverses the NE to attach the NPCs to the membrane. Thus, the lumenal
channels are partially masked by the membrane and may be too small to allow passive
diffusion of molecules with up to 9 mn-diameter (Akey and Rademacher, 1993;
Goldberg and Allen, 1996). The hour—glass shaped transporter described by some
investigators is found in the central channel complex (Akey, 1995; Akey and
Rademacher, 1993; Goldberg and Allen, 1996). This central transporter has been
proposed to be involved in the active transport of macromolecules in and out of the
nucleus.

Using surface imaging techniques such as field emission in-lens scanning
electron microscopy (FEISEM; Goldberg and Allen, 1993, 1996) and metal shadowing
in TEM (Jarnik and Aebi, 1991), peripheral structures of the NPCs have been
identified. These structures give the NPC an asymmetric appearance and may reflect
differences in substrate recognition. Eight cytoplasmic fibrils are attached to the
cytoplasmic ring and appear to serve as docking sites for import substrate (Jarnik and
Aebi, 1991; Pante’ and Aebi, 1996). From the outer periphery of the nucleoplasmic
ring, eight filaments extend into the nucleoplasm and terminate in a distal ring to form
the nuclear basket, and they may be involved in binding of export substrate (Goldberg
and Allen, 1993, 1996; Jarnik and Aebi, 1991). The peripheral NPC structures may
also connect nucleo— and cytoplasmic cytoskeletal elements to the NPC as suggested by
Davis (1995).

Recently, FEISEM studies have revealed other structures including a star ring

underlying the cytoplasmic ring and internal filaments in the cyto- and nucleoplasmic

6

rings (Goldberg and Allen, 1996). The same authors also describe a filamentous
structure of 8—10 mm, named the NE lattice, that is different from the nuclear lamina
and may connect the distal rings of the nucleoplasmic basket (Goldberg and Allen,
1992, 1996). The NPCs appear to attach to the lamina via the spoke ring complex, and
adjacent NPCs seem to be interconnected via small radial arms within the NE lumen
(Goldberg and Allen, 1996). Further analysis will be required to understand possible
functions of these structures.

Yeast NPCs have a similar morphology to amphibian NPCs, including an
eightfold symmetry, and appear to be composed of a similar spoke—ring structure, a
central transporter, and peripheral structures (Rout and Blobel, 1993, and see references
therein). Mass analysis of highly enriched yeast NPCs isolated by biochemical
fractionation suggest that yeast NPCs have a mass of about 66 MD indicating that they
are smaller than amphibian NPCs (Rout and Blobel, 1993). These highly enriched
NPCs, however, lack components that are detected in thin section TEM using whole
yeast cells. Thus, the smaller mass may be due to the loss of components during the
fractionation procedure.

To date, plant NPCs have been mainly investigated using thin section
transmission electron microscopy (TEM) and freeze-fracture TEM (for review, see
Jordon et al., 1980). Consistent with results from amphibians, NPCs from mono— and
dicotyledons plants show the typical eightfold symmetry (Franke, 1966; Roberts and
Northcote, 1970). They also appear to have the tripartite structure (Roberts and
Northcote, 1970), and peripheral components, such as the cytoplasmic fibrils and the

nucleoplasmic basket, have been described by many investigators (see references in

7

Jordan et al., 1980). When isolated nuclei are exposed to detergent, salt, or urea,
peripheral structures are released to yield a basic framework as described under similar
conditions for amphibian NPCs (Hicks and Raikhel, 1993; see above). The biochemical

isolation of plant NPCs has not been reported yet.

3. Identification of nuclear pore complex proteins

Based on quantitative scanning TEM, the amphibian NPC appears to consist of
at least 100 different proteins (Reichelt er al., 1990), while the yeast NPC may contain
about 80 different NPC proteins (Rout and Blobel, 1993). To date, the genes of
approximately one third of the NPC proteins have been cloned, including a dozen of
vertebrate and approximately twenty—five of yeast NPC proteins (Tables 1.1 and 1.2).
However, genes encoding plant NPC proteins have not yet been isolated. The known
NPC components have been identified using a variety of immunological, biochemical
and genetic approaches (for review, see Forbes, 1992; Rout and Wente, 1994; Davis,
1995; Doye and Hurt, 1997).

Vertebrate NPC proteins have been identified first by screening for antibodies
that reacted specifically with the NPC using monoclonal antibodies raised against
NPC/nuclear lamina fractions (for review, see Forbes, 1992; Table 1.1). These
antibodies have been useful for cloning several genes encoding vertebrates NPC
proteins, including gp210 (Wozniak et al., 1989; Greber et al., 1990) and p62
(D’Onofrio et al., 1988; Cordes et al., 1991, Carmo-Fonesca et al., 1991). p62 is a
member of a family of 8—12 NPC proteins that is also recogized by wheat germ

agglutinin (WGA), a lectin that binds to N—acetylglucosamine (Davis and Blobel, 1986;

:9 com .wcoumgouobm 3856? H8 $53858 rah: ”coumamoobm rfimamoobw ”mogoflam d<
@58on UmZ cannot? mo 328:3 “3393 can coumfifioofi .8888 120:8an

H A 2an

vasomooco on >mE
unomxm dzm +A4vkaom 0cm uHOQEfl cfiouonm

 

 

 

How UwHflSUoH HomSOE uSOIMoocx vasommGMHu mHHHQHw one AQM vamv
0.3 Mg EH oumnuwndm ~30me How ouflm mcflxoov mmufln oficmmamouho wmxm .ofiZonIO Zmu\wammdz
vmma
omz moomm HmcflEHmuIU omMmH ADM mwav
.GHMEOU oGMHQEwEmcmmu oco ocmunEmE ogom oflZonIO HNHEom
Lax mmav
moramdz umm¢> mo moHOEOQ Hmcofluocdm OAEmMHQomHUSC + IOuxo I mmamsz
umz £9.25 noflumfioommm How Umuflsvou ” .EnouIz
.unomEfl
afiopogm no uoommo on ”:5 35098 42m .mummcflw SN mmcnommho 52 mm:
A+GV>HOQ mxooan ”Goflmmoumxoho>o .EnouIU noxmmn anmmHmooaoSd Umxm .oflZoaUIO mmamsz
mama
UHOQEH.Hmmaosn.nflmmEH.GHmEov Homoesa.ouflfia moaodwom Hmnmfim
.noESH m2 SH HmcflEHouIz omHmH HMGHEHmuIZ Uo>moao AQx omav
,GHMEOU manQEoEmnmuu mno oGMMQEoE whom .Hhmooham Umxcwanz oammm
uuomxm dzm bum uHOQEH GaouOHm Mom UoHflSUoH
thz Unm m GHDHOQEH Ou mUGflQ onQEooImmm
.AKmHmEOUINmmv mmm bum wmm QUH3 memEOU HHOUIUmHHoo Amx va
cOHuH> EH HmEHUOEon ommnmuuou Show XoHQEoo mcfluuoxomm .Omxm co¢ZonIO mmm
ommH
unfluofi Ammmzv
munofifioo \ coauocdh coauoooa umz \mGOAumowwfivofi aflououm
Hook

£28on Umz 829029» Mo 328:3 2633 can “232132 .8328 182855 a; 2an

10

me.mo uodvoum Umoflamm o>flumcuouam mnhme
UHOQEH nflmuoum How Umufldvou
vmm cam mmm .Nmm suflz XonEoo wagon

uHOQEH Gfiwuonm How Umnwsvou
mwm one mmm .mmm nuflz KoHQEoo mEHow

mmfiz van & cfluuomefl nufls muomnmunfi
.Ehouuuv pHOQEfl cfiouonm How vouflsvou
mvm cam emu .Nmm nufiz onmEoo mEHOm

mHHmSZ ummm> mo mOHOEon m>flumu3m

uHOQEH

aflouonm EH GOHuoadm mnflumofivcfl .wnouomw
whommcmnu oHQdHom on mUGHQ "OHuH> Qfl
pHOQXm fiZdu cam

uHOQEw Gfimuoum Mow uoc usn .uHOQXo flzm mm
,flzmu .dZME cdzmcm How vowflsvmn uo>H> EH

mom can
xoamfioo Hoummoou uHOQEfl Mom mpfim mnflxooo

mvmmsz ammoh mo mOHoEon

Amowmcflx
fluflz GOHmSM oflcomoocov OHGomooCo on me

Hfloo Umafloo
XoHQEoo mQHH 020mm .mmxm co¢ZUHwIO
HHoo Uwafloo

onQEoo maflu oxomm ,Omxm .odZonIO

Hooo eoafloo

onQEOo mQHH mxomm .Umxm .odZUHOIO

dance mafioaflo-<zm
cwmqw co¢ZUHUIO

Hofluoumfl Hmmfiodc
.uoxmmn .HmooHUSG

cameoo oxfiH-¢ eflaflcmofioxo
GflmEoo QUHH 50A
mummcflw GN thuwmho m

maflunflw .HQOuxo mQHmEOU mcflocflnucmm w

azocxcd
GofiumNHHmooa omflooum Hommflw dog
mquEmHHw

.Hmooaosa no .Hmou>o HfiooIUoHfloo

8.288 m A ozah

on mwv
mam

on «my
vmm

Lax wmv
mmm

 

mmmH

Lox mmv
mmosz

Lox mmmv
mmmmsz

mmmH

Lox boav
boaoaz

Lox mmmv
momm:z\ome

11
Finlay et al. , 1987; Hanover et al., 1987; Holt et al., 1987; Park et al. , 1987; Snow

et al. , 1987). Further carbohydrate analyses have indicated that these NPC
glycoproteins are modified by single O-linked N—acetylglucosamine (O-GlcNAc)
residues (Holt et al., 1987). In general, the O-GlcNAc modification has served as an
excellent tool to isolate O-GlcNAc NPC proteins by WGA affinity chromatography for
subsequent peptide analysis and gene cloning of Nup98 (Powers et al., 1995; Radu et
al. , 1995b), Pom121 (Hallberg et al., 1993), Nup214/CAN (Kraemer et al., 1994) and
the related p58, p54, p45 (in complex with p62; Hu et al., 1996). Fractionation of
proteins extracted from the NPC/ nuclear lamina that did not bind to WGA columns has
led to the identification of Nup155 (Radu et al., 1993) and Nup107 (Radu et al., 1994).
In the future, biochemical procedures such as the isolation of annulate lamellae, a
cytoplasmic organelle consisting ofstacks of flattened membrane cistemae perforated by
numerous NPCs (Meier et al., 1995), and vertebrate NPCs (MJ Matunis, G Blobel,
Mol Biol Cell Abstr 1996, 7: 95a) may help to identify novel vertebrate NPC proteins.
Sequencing of vertebrate genomes may further reveal genes with similarity to those
encoding yeast NPC proteins.

In yeast, NPC proteins have been identified initially using antibodies raised
against vertebrate NPC proteins or yeast nuclear matrix enriched fractions (Table 1.2).
Among these proteins are Nsplp (Hurt, 1988), Nuplp (Davis and Fink, 1990), Nup2p
(Loeb et al., 1991) and the related Nup49p, NupIOOp, and Nup116p (Wente et al.,
1992). The isolation of yeast genes has allowed the design of genetic screens based on
synthetic lethality. Synthetic lethality screens are based on a loss of function as

described in the following. Although yeast strains with a mutation in a single NPC gene

12

are viable, the combination of this mutant gene with a second mutant component results
in cell death. The second component may have either overlapping function or physically
interacts with the product of the first mutant gene (for review, see Doye and Hurt,
1995). Synthetic lethality screens using temperature sensitive mutants led to the
identification of most of the known yeast NPC genes including NUP49, NUP5 7,
NUP82, NUP84, NUP85, NIC96, NUPII6, NUP133, NUP145, NUPI 70, and SRPI.
In addition, these screens have identified several proteins that function in
nucleocytoplasmic transport mechanisms and associate with the NPC but are not truly
part of the NPC (for review, see Doye and Hurt, 1997). Other genetic screens have
been based on specific transport functions such as poly(A)+ RNA export and nuclear
protein localization and have identified novel NPC genes as well as several NPC genes
that are also found by synthetic lethality screens (see Table 1.2; for review, see Doye
and Hurt, 1997). The isolation of highly—enriched yeast NPCs has provided peptide
sequence information and allowed the subsequent cloning of genes encoding Nup82p
(Hurwitz and Blobel, 1995), Nup120p (Aitchison et al., 1995), Nup159p (Kraemer et
al., 1995), Nup188p (Nehrbass et al., 1996). The isolation of yeast NPCs will further
contribute to the identification of NPC proteins. In addition, the sequencing of the
entire yeast genome will allow identification of novel NPC proteins based on sequence

similarity to known NPC proteins.

 

13

88283828 82 :8“ 8m
228on On Z 58% .8 85288228 850 28 38828 1828832

NA 2an

14

 

 

mcflocflnuqmm AQM wbv
wflxuocwam on vUH\Emm .magum Hmnm .Hmmc ,aQDG omxm QNQSZ
mama
omz Mo>o Hmom ocmHQEoE
boomxo azm no mooomoo flax mHHV
o>HuHmnom ouflumuomEou mmmmx mwamdc cooamdu ,Hmmc UmAU mmaamsz
mmwfim32+mwfiamsz
ou HMHHEflm
mcflocfln ezm Lax ooav
omxuonosm on maamds Umqw mooamdz
uuomxo fizm CH muommov
Amoum noflumoonGMHuv
uHomEH cflououm GA muoowov Hfioo voafloo flax mwv
Honooa ammoflz\memmsz\mammz mmamse .Hmmc omqw mmwnsz
mama
>uflmnmv omz EH mmmmuomv mmmdfi
Amouw maflxoovv ,vwmdc.mmamdccmmamdc
uHOQEH nflwuoum Gfl muomwmv mmwmdz mvamdccmaamdc.mmmdc HHOU wwafloo flax wwv
Hmnuoa .mmmoflz\m>mmsz\mmvosz .mmofie.>mmzc.memsn omxm mammz
unoEQOMumv m2
uhomxo 42% CA muoomoo
uHOQEfi aflouoym nfl muowmwv Hmym .OEHQDC flax MHHV
Hmnuoa monamsz .afimom .mmosc.mmsc wmxm mansz
ommH
eofiuomuounH sue: Hmsuoa Ammazv
omhuononm unmuaz HMOfimhnm ofluosunhm mwfiuoz Gwououm
and»

828on UAZ ammo» mo 85288228 8:8 28 88828 8:28:an NA 2an

15

mcfluoumdao umz
uhomxo 42% SH muoommo
Hmnuma

mmhuocmnm on

om%uoco£m 0c

uHOQXo fizm CH muoowov
Hwfluoa

Hanooa

maflnmumdao umz
unomxm dzm GA muoomov
o>fiufimnom oudumaomsou

mafiuoumSHo+cofiuMHcHo£ umz
uHOQXo ¢zm Ga muoomoo
UHOQEH aflououm a“ muoomov
Hmnuoa

omhuoconm on

>ufimnov ouom GH ommonomv

unomEfl aflwuoum CH muoomov
Hmnuoa

QHQSZ

mammz

mmmoflz\mmwmsz\mammz

memEoo mvmmzz

mmmamsz .mmmoflz

mmmamsz.mmmaeom
.QmeSZ\QmwQSZ\QHQmZ

omamsncmmmda
mmflmsc
cmmeQ.HmSG.0bHQSG

NmHEOQ.NQ5G.Hm5G
mmmsc,mmamsc.bmamsc

OSHQSG
nmamsc.amsc.ammn

Hams

mmmsc
.omamfic.mvmsacammc

madman

.ooamsc.mmmsc.fimmc

oeamsc.mmamsc.mmoflc

mmamsc.mmfleom.ammc

835.8 NA 283.

Omxm

Hooo ooafloo

Hooo ooafloo
omqo

mmaflm52+mooamsz

Ou HmHflEHm
mcfloofio-azm
wmqw

oGMHQEoE
Hmnmoucfl

Hfioo voafioo

Aux mmav
groom
\mmmamsz

Lox emav
nemamsz

flax oeav
mmoaz
\moeamsz

 

Lox smv
Qbmmdz

Lox mmav
mmumm
\mmmamsz

Aux maav
moaomm
\mmwamsz

Lox mmav
mmmHEOQ

 

vmma

Lox mmv
mmmoflz

16

coflomocoon mz

quESUMuoU mz
mcfluoumdao umz

uuomxo fizz Ga muoomov
o>fluflmnom oHSumummsou

mcfinoumSHo umz
unomxo flzm CH muommoo
o>fluflmsom musumummEou

mcfluoumnao umz
uuomxo 42m GA mpoomwo
o>flufimnom ousumoomEou

mmmfieom .mmmoflz

onmEoonm mvmmdz

onQEooQSm mvmmdz

onQEoonm mvmmdz

oeamsc
mmHEom.mmoHC.Hmmn

mmamsn.mmamsc
mwamsc.mmamdccammc

omamsscmwmsc.amma

mmamsacoramsc
NmHEOQ.mmHmdc.mmam5G

8.888 NA @358

Lox mmfiv
- mmmamsz

Aux may
mmomm
- \mmmmsz

Lox «my
- mammsz

mama
Lox omav

HommHN Dog mmumm
afloo owafloo \Qomamdz

17

4. Functions of nuclear pore complex proteins

Considering the structural complexity of the NPC, NPC proteins are likely to
play a role in a variety of different cellular mechanisms. Due to our limited knowledge
on the NPC, some of these may not be apparent at this point. On the other hand, NPC
proteins are likely to function in nucleocytoplasmic transport, NPC assembly and NPC
insertion into the NE. Because of the availability of assays, most research has focussed
on understanding the role of NPC proteins in transport. To understand this role, it is
necessary to summarize the current knowledge on the different transport mechanisms
and the soluble factors involved in these processes. Several excellent reviews have been
written and provide detailed information on this topic (Hicks and Raikhel, 1995;

Gdrlich and Mattaj, 1996; Gorlich, 1997; Nakielny and Dreyfuss, 1997).

4.1. Nucleocytoplasmic transport in vertebrates and yeast

Macromolecules such as proteins and RNA species move not only into, but also
out of the nucleus. These active processes require the presence of specific transport
signals. In general, active transport is energy dependent and saturable indicating a
receptor-mediated process. To date, most is known about the nuclear import machinery
of proteins that contain "classical" nuclear localization signals (NLSs) (for review, see
Gorlich and Mattaj, 1996; Gorlich, 1997). The NLSs consist of one or more clusters
of basic amino acids that are found within the nuclear protein (for review, see Garcia-
Bustos et al., 1991). This import process will be referred to as "NLS-dependent"
throughout this manuscript. The development of an animal in vitro import system, in

which the plasma membrane is selectively permeabilized by digitonin, has aided in the

18

identification and characterization of the requirements for NLS-dependent import (Adam
et al., 1990, 1992). Import of NLS-bearing proteins can be divided into two steps
(Figure 1.2). The first step is binding at the NPC, a process dependent on the presence
of cytosolic components. The second step is translocation through the NPC, a step that
requires energy in form of GTP and is blocked by cold treatment (4°C) or WGA. In
addition to several potential regulators, three soluble proteins are required for import,
namely importin oz, importin B, and the small nuclear GTPase Ran. Based on studies
by many different laboratories, the following model has emerged (for review, see Hicks
and Raikhel, 1995; Gorlich and Mattaj, 1996; Gorlich, 1997). The receptor complex,
consisting of importin oz and importin B, binds to import substrate in the cytoplasm and
forms a trimeric import complex. While importin oz provides the NLS-binding site,
importin B serves as an adaptor protein for docking of the complex at the NPC (Figure
1.2). Movement of the trimeric complex through the NPC requires GTP hydrolysis by
Ran and appears to be facilitated by the regulator nuclear transport factor 2. However,
the mechanism that drives the trimeric complex through the NPC is not fully
understood. Once the trimeric complex reaches the nucleoplasm, importin B is released
due to direct binding of Ran—GTP to importin B. Because importin oz alone has a lower
affinity to the NLS than the importin oz—B heterodimer, the import substrate is freed
from the complex. Both, importin oz and B are then recycled separately to the cytoplasm
to start a new round of protein import.

In yeast, the import mechanism is comparable to that described above, and in
general, similar requirements for NLS-dependent protein import have been reported for

this organism (Schlenstedt et al., 1993). Furthermore, the yeast proteins

19

 

  
  

   

cytoplasm

nucleoplasm

@‘fir‘

binding translocation

Figure 1.2

Schematic diagram of the NLS—dependent nuclear import machinery.

20

Srplp, Kap95p, and Gspl have been identified as homologs of importin oz, importin B
and Ran, respectively (for references, see Goerlich, 1997), indicating that at least the
basic mechanism is conserved between animals and yeast. It should be noted that WGA
does not block protein import into yeast nuclei (Kalinich and Douglas, 1989).

It seems likely that a variety of transport pathways exist to accommodate the
need to import diverse RNA and proteins into the nucleus. Much less, however, is
known about transport of molecules that do not contain classical NLSs. After assembly
in the cytoplasm, the import of small nuclear RNA—protein complexes requires the
presence of a signal that resides in the RNA as well as the protein portion of the
complex (Mattaj et al., 1993). Factors that facilitate this process have not been
identified so far. Furthermore, glycoproteins may be imported by a different
mechanism, because uptake of glycosylated proteins is not competed by NLS—containing
import substrates (Duverger er al., 1995). A subset of heterogeneous nuclear RNA-
binding proteins (hnRNPs) are imported into the nucleus due to a stretch of 38 amino
acids with no similarity to classical NLSs (Siomi and Dreyfuss, 1995). This amino acid
portion is called the M9 domain. While translocation of hnRNP is mediated by the
GTPase Ran, as found for the NLS—dependent pathway, the M9 domain is recognized
by a different import receptor called transportin (Pollard et al., 1996). Transportin is
distantly related to importin B, and the yeast protein Kap104p appears to be a homolog
of the vertebrate transportin (Aitchison et al., 1996) suggesting a conservation of this
mechanism in eukaryotes.

Though the above mentioned studies have shed some light on the different

nuclear import machineries, little is known about the molecular mechanism of

21

movement out of the nucleus. The recent identification of nuclear export signals (N ES)
that are present in shuttling proteins and of receptors that bind to NES and facilitate
export may provide insight into the different export pathways (reviewed by Nakielny
and Dreyfuss, 1997; Ullman et al., 1997). Several NBS-containing proteins associate
with different classes of RNA and facilitate export of these RNAs. Interestingly, RNA
viruses that replicate in the host nucleus (including HIV and influenza virus) appear to
make use of the cellular export machinery to move viral RNA out of the host nucleus
(Whittaker et al., 1996). Further analysis of the viral RNA export machinery may
provide important information on the molecular mechanism of cellular RNA export.
Evidence for a link between the import and export pathways come from a recent report,
in which importin oz is found to accompany the complex of uridine rich snRNA and
cap-binding proteins, that bind to the methylated cap at the 5’ end of the U snRNA,
during export from the nucleus. In the cytoplasm, importin oz is then released from the
complex by importin B, making it available for the NLS-dependent import pathway.
Furthermore, Ran has been recently implicated in the export of different classes of
RNA (Izaurralde et al., 1997), and therefore this small GTPase appears to be involved

in both, nuclear import and export.

4.2. Nucleocytoplasmic transport in plants

In plants, several endogenous proteins are imported into the plant nucleus by
virtue of "classical" NLSs that are similar to those identified in other organisms (for
reviews, see Raikhel, 1992; Hicks and Raikhel, 1995). Furthermore, pathogenic

bacteria and viruses seem to employ the plant NLS-dependent import machinery to

22

deliver their proteins or nucleic acids to the plant nucleus (for review, see Sheng and
Citovsky, 1996; Carrington et al. , 1996). So far, no other classes of plant import and
export signal have been reported. It is reasonable to assume that other transport
pathways may exist in plants, and some of these are likely to be similar to those
identified in other eukaryotes.

Because only the classical NLSs have been characterized in plants, research has
focussed on the NLS-dependent import machinery. Plant homolog to importin oz (Hicks
et al., 1996) and to Ran (Ach and Gruissem, 1994; Merkle et al., 1994) have been
isolated recently. Consistent with a role in NLS—dependent import, Arabidopsis importin
oz binds NLSs in vitro (Smith et al., 1997). Unlike vertebrate importin a, it is not only
found as a soluble protein in the cyto- and nucleoplasm, but shows tight interaction with
purified nuclei (Smith et al., 1997). The significance of this is observation, however,
not understood. A direct involvement of the plant Ran homologs in protein import has
not been reported. The plant Ran may play a role in this process because in vitro import
assays that have been recently developed in plants demonstrate that NLS-dependent
protein import requires energy in the form of GTP (Hicks et al., 1996; Merkle er al.,
1996; Zupan et al., 1996). Interestingly, plant protein import is slowed significantly at
4°C, but is not completely blocked, as frequently reported in animals (see above). This
observation may reflect the adaptation of plants to low temperatures at which they are
often exposed in nature. In plants, the lectin WGA does not inhibit protein import of
smaller substrates (100-150 kD; Hicks 61 al., 1996; Merkle et al., 1996), but blocks
transport of large import substrate such as an antigen-antibody complex (Harter et al.,

1994) or a proteins-single stranded complex of 5000 kD (Zupan et al., 1996). As

23

discussed in Chapter 2 in detail and proposed. for vertebrates, WGA may inhibit

transport by simply blocking the NPC, and, thus, its effect may be non-specific.
Taken together, NLS-containing proteins in plants appear to utilize a similar

import machinery as described in vertebrates and yeast (see above), but clearly

differences in the import process exist.

4.3. Functional domains of NPC proteins and their significance on function

As mentioned above, the genes of approximately one third of at least 100
different NPC proteins have been isolated, mainly in yeast and vertebrates. These
studies have permitted to compare the known sequences and to look for structural

features within these NPC proteins that may provide clues to their possible roles.

O-GlcNAc modification

A family of vertebrate NPC proteins are modified with single O-GlcNAc
residues (Table 1.1). Several studies have demonstrated that the O-GlcNAc NPC
proteins play an important role in transport. Both protein import and RNA export are
inhibited by agents that bind to these glycoproteins, such as WGA and antibodies made
against this protein family (Finlay et al., 1987; Dabauvalle et al., 1988; Featherstone
et al., 1988; Newmeyer and Forbes, 1988; Terms and Dahlberg, 1994). Furthermore,
reconstituted Xenopus oocyte nuclei depleted of O—GlcNAc proteins are not capable of
forming transport-competent nuclei and NPCs (Dabauvalle et al., 1990; Finlay and

Forbes, 1990; Finlay et al., 1991; Miller and Hanover, 1994). In particular, p62, p56,

24

p54, and p45 that form the p62 subcomplex are required for proteins import
(Dabauvalle et al., 1988; Hu et al. , 1996).

The exact role of the O-GlcNAc modification is not known (for reviews, see
Haltiwanger et al. , 1992; Hart, 1997). It has been shown, however, that the O-GlcNAc
residues do not function in nucleocytoplasmic transport or in NPC assembly (Miller and
Hanover, 1994), indicating that the protein portion rather than the glycosylation is
important for the transport mechanism. Thus, transport inhibition by WGA may be due
to blockage of the NPC by sterical hinderance. In addition, yeast nuclei are able to
transport substrates across the NPC, although yeast NPC proteins do not appear to be

modified by O-GlcNAc (Rout and Wente, 1994).

FXFG and GLFG repeat motifs

All known O-GlcNAc NPC proteins contain a short amino acid sequence motif,
called FXFG (i.e. single amino acid code, in which X represents any amino acid;
Tables 1.1). This motif is present repetitively within the same subdomain in which the
O-GlcNAc modification is also found (for reviews, see Wente and Rout, 1994; Davis,
1995). The FXFG motif is not exclusive to the O-GlcNAc NPC proteins, but is also
present in the vertebrate Nup358p and several yeast NPC proteins (Table 1.1 and 1.2).
Recent evidence in vertebrate and yeast indicate that this motif may play an important
role in transport. Antibodies specific to the FXFG domain block transport in vivo in
Xenopus oocytes (Finlay et al., 1987; Dabauvalle et al., 1988; Featherstone et al.,
1988; Newmeyer and Forbes, 1988; Terns and Dahlberg, 1994). Using in vitro blot

overlay assays, several FXFG-containing NPC proteins from vertebrate and yeast bind

25

to the importin B domain of the NLS-dependent import receptor complex (Moroianu et
al., 1995; Radu et al., 1995a; Radu et al., 1995b; Rexach and Blobel, 1995). The
authors conclude that these NPC proteins function as docking sites for the NLS-
dependent protein import machinery. Furthermore, considering the redundancy of
FXFG-containing proteins in the NPC, movement of NLS proteins may occur through
the NPC via repeated disassociation-reassociation steps of the receptor complex with
the FXFG-containing N PC proteins (Rexach and Blobel, 1995).

Another repeat motif, namely GLFG, is present in several yeast NPC proteins
and the vertebrate Nup98p (Table 1.2; for reviews, see Wente and Rout, 1994; Davis,
1995; Doye and Hurt, 1997). In yeast, this motif serves as binding site for Kap95p, the
yeast homolog of importin B (Iovine et al., 1995; Iovine and Wente, 1997). In contrast
to the proposed role of FXFG motifs in protein import, the GLFG-containing NPC
proteins appear to function in recycling Kap95p from the nucleus to the cytoplasm

(Iovine and Wente, 1997).

Ran binding sites

The small GT Pase Ran is part of the GTPase cycle that provides the energy for
transport through the NPC. In search for proteins that interact with Ran, Nup2p and
Nup358p have been identified by yeast two-hybrid, biochemical interaction, and
screening of cDNA expression library (Dingwall er al., 1995; Wu et al., 1995;
Yokoyama et al., 1995; Saitoh et al. , 1996). These NPC proteins contain domains that
are homologous to the Ran binding protein 1 domain (Table 1.1 and 1.2), and these

domains are known to mediate interaction with Ran. Nup358p and Nup2p also interact

26
with importin B (Radu et al., 1995a; 1995b) and importin oz (Belanger er al., 1994),

respectively, and thus, may function as central docking sites for the transport

machineries.

DNA and RNA binding sites

Based on sequence comparison, some yeast and vertebrate NPC proteins contain
domains that may allow interaction with DNA or RNA (Table 1.1 and 1.2). The
vertebrate Nup153p and Nup358p have several CysZ-Cys2 type Zinc fingers that are
proposed to bind DNA (Table 1.1). Nup153p can bind E. coli DNA in vitro and, thus,
may recognizes specific DNA sequences to organize the genome and to "gate " genes
being transcribed to the NPC (Sukegawa and Blobel, 1993). Recent in vivo studies also
indicate a role of Nup153p in RNA export (Bastos et al., 1996).

The yeast Nup100p, Nup116p, and Nup145p contain a domain that can bind
homopolymeric RNA, but not ssDNA or dsDNA in vitro (Fabre er al. , 1994). A similar
domain was observed in the vertebrate Nup98p (Powers 6! al., 1997). Consistent with
the presence of RNA binding domains, the yeast NPC proteins and Nup98p are in

involved in RNA export in vivo (see below).

Protein-protein interacting domains

Several NPC proteins contain helical coiled-coil domains (Table 1.1 and 1.2).
These domains may allow their arrangements into filamental structures similar to those
observed in the NPC. In support of this hypothesis, Buss et al. (1994) showed that

recombinant p62 self-assembles into stiff, rod-shaped structures of 35 nm length in

27

vitro. The coiled-coil domain of p62 also appears to facilitate binding to p54 (Buss and
Stewart, 1995) and most likely to other proteins in the p62 subcomplex. A complex
similar to the vertebrate p62 subcomplex appears to be present in yeast, and certain
coiled-coil regions of N splp appear to allow complex formation with Nup49p and
Nup57p in vitro (Schlaich et al., 1997).

The putative leucine zipper motifs present in Nup107p, Nup358p, and Nup120p
may also be involved in protein-protein interaction (Radu et al., 1994; Aitchison et al.,
1995; Wu et al., 1995). This interaction may mediate NPC assembly or function as

binding sites for transport substrate.

Transmembrane domains

Three known NPC proteins, gp210 (Greber et al., 1990; Wozniak et al. , 1989),
Pom121p (Hallberg et al., 1993; Soderqvist and Hallberg, 1994) and Pom152p
(Wozniak et al., 1994), are transmembrane proteins present at the pore membrane
(Table 1.1 and 1.2). It is conceivable that they facilitate anchoring of the NPC to the
NE. In addition, they may function in NPC biogenesis during interphase and after
mitosis. gp210 may also have some role in protein import into the nucleus, because
microinjection of mRN A encoding antibodies against the ER lumenal domain of gp210

causes reduction of protein import into the nucleus (Greber and Gerace, 1992).

28

4.4. Localization of NPC proteins and significance on their function

To understand their functional roles in the NPC as a whole, it is necessary to
determine the localization of the NPC proteins within the different NPC substructures.
While the localization sites of most vertebrate NPC proteins have been determined
(Table 1.1), relatively little is known about the localization of yeast NPC proteins. This
may be attributable to the general lack of good fixation procedures in yeast necessary
for EM studies.

In agreement with their proposed function as docking sites for the importin oz/B
receptor complex, the vertebrate Nup214p/CAN and Nup358p are located at the
cytoplasmic fibrils (Kraemer et al., 1994; Wilken et al., 1995; Wu et al., 1995;
Yokoyama er al., 1995) and the yeast Nup159p is found at the cytoplasmic side of the
yeast NPC (Kraemer et al., 1995).

The p62 subcomplex appears to be mainly associated with the cytoplasmic and
nucleoplasmic sides of the central spoke/transporter region (for a review, see Forbes,
1992; see Chapter 2 for more details). This is consistent with its proposed function in
translocation rather than in initial binding (Forbes, 1992). These findings are supported
by recent EM studies, in which nuclear import of an import substrate was followed
through the NPC (Panté and Aebi, 1996). Sequential binding was first observed to
cytoplasmic fibrils, and then to the cytoplasmic side of the central channel region.
Nup98p and Nup153p are constituents of the nucleoplasmic basket (Sukegawa and
Blobel, 1993; Powers er al., 1995), and their localization appears to be in agreement
with their proposed function in RNA export (Bastos et al., 1996; Powers et al., 1997).

Several GLFG NPC proteins from yeast have a role in transport of RNA out of the

29

nucleus and in recycling Kap95p from the nucleus into the cytoplasm (Iovine et al.,
1995, Iovine and Wente, 1997). Localization studies are consistent with these functions,
because oz-GLFG antibodies localizes this protein family to the nucleoplasmic side of
the NPC (W ente et al. , 1992). In particular, epitope tagged Nup49p is found in close
proximity to the nucleoplasmic face of the NPC (Wente et al., 1992). The yeast
Nup188p appears to be located at both the cytoplasmic and the nucleoplasmic side of
the NPC (Nehrbass et al., 1996). Based on its localization, it may be one of the core
components of the NPC and interacts with Pom152p (Nehrbass et al., 1996). The latter
is a transmembrane proteins and found at the pore membrane (Wozniak et al., 1994).
The vertebrate transmembrane NPC proteins, gp210 and Pom121p, are also located at
the pore membrane and may anchor the NPC to the NE (Gerace et al., 1982; Hallberg

et al. , 1993).

4.5. Functional in vivo and in vitro analyses of NPC proteins

Even though localization and sequence comparisons of NPC proteins may
provide insight into their possible roles, in vitro and in vivo assays are necessary to
conclusively demonstrate the function of these proteins (see Table 1.1 and 1.2).

Xenopus laevis reconstitution assays have been useful in studying the role of
vertebrate NPC proteins in nuclear import and NPC assembly (for review, see Forbes,
1992). After depletion of a subset of NPC proteins by WGA or specific antibodies,
nuclei can be reconstituted that contain NPCs lacking these NPC proteins, and nuclear
transport of import substrate is then examined. These assays showed that the presence

of the p62 subcomplex is required in the NPC for protein import, but not for NPC

30

assembly (for a review, see Forbes, 1992). When Nup98p, another protein modified
by O-GlcNAc, is immunodepleted, NPCs are formed in reconstituted nuclei that are
able to import proteins (Powers er al., 1995). Moreover, when oz—Nup98p antibodies
are microinjected into Xenapus oocyte nuclei, export of different RNA classes, but not
protein import, is inhibited (Powers et al., 1997; Table 1.1). In contrast, in vitra
overlay blot assays have shown that Nup98p binds to importin B, thus implicating
Nup98p in protein import (Radu et al., 1995b). Similar contradictory results have been
obtained for the vertebrate Nup153p. Overexpression of Nup153p in mammalian cell
culture leads to inhibition of RNA export, but no defect in proteins uptake is observed
(Bastos et al., 1996). In vitra overlay assays, however, suggest a role of Nup153p in
protein import. The localization of Nup98p and Nup153p to the nucleoplasmic
components of the NPC appear to be in agreement with a function of RNA export
rather than protein import (see above). Recently, a gene knock-out of Nup214p/Can in
transgenic mice revealed that this protein is required for protein import as well as
poly(A)+ RNA export (Van Deursen et al., 1996). This in viva approach may serve as
an alternative strategy to study vertebrate NPC proteins in the future. As it becomes
obvious from these studies, a combination of different assays may be used to
conclusively resolve the functions of NPC proteins.

Yeast genetics provide an excellent tool to investigate the function of NPC
proteins in viva (for review, see Doye and Hurt, 1995; 1997). Yeast strains carrying
mutations in or deletions of N PC proteins are examined for proper RNA export, protein

import, or perturbations of NPC and NE structures.

31

In situ hybridization with fluorescent labelled oligo(dT) demonstrate that
mutations in several yeast N PC genes led to accumulation in poly(A)+ RNA in the
nucleus (Table 1.2.). Strikingly, intranuclear RNA accumulation is often associated with
morphological changes in yeast NE and distribution of NPC. For example, mutations
in NUP49, NUP116 and NUPI45 lead to sealed and herniated NPCs that do not allow
export of RNA (Fabre et al., 1994; Wente and Blobel, 1994). In other cases, the RNA
export defect appears to coincide with NPC clustering. Several studies, however, have
demonstrated that these two defects can be separated under certain conditions. While
nup133/rat3 null mutants show clustering as well as inhibition of RNA export, a partial
deletion mutant strain shows clustering of NPCs, but is still capable of exporting RNA
(Doye et al. , 1994). Further, a rat7/nup159 mutant strain shifted to 37°C for one hour
allows the reversion of NPC clustering, while export of mRN A is still inhibited (Gorsch
et al. 1995). These aberrant NE and NPC structures may indicate a putative role of
these NPC proteins in anchoring the NPC to intranuclear structures or to NPC proteins
in the pore membrane.

Mutant strains of nspI, nup49, and nic96 accumulate NLS-containing import
substrate in the cytoplasm implying a role of these NPC proteins in protein import
(Nehrbass et al. , 1993; Doye et al., 1994; Grandi et al., 1995). The FXFG-containing
Nuplp and Nup2p may also function in protein import. Based on yeast two hybrid and
synthetic lethality screens, Nuplp and Nup2p interact with Srplp, the yeast homolog
of importin oz (Belanger et al., 1994), and in vitra assays further show that Nuplp and
Nup2p interact with Kap95p, the second component of the import receptor complex

(Rexach and Blobel, 1995). Thus, Nuplp and Nup2p may serve as docking sites for the

32

receptor complex. Taken together, studies on functional domains, localization and
functions using in viva and in vitra assays have given some insight into the roles of
NPC proteins. More information is needed to resolve the exact function of some NPC

proteins, and the development of new assays may be useful.

5. Statement of problem and attribution

The NPC is one of the largest proteinaceous macromolecules within the cell, and
only recently, we have started to gain a better understanding of its structure,
components, and functions.

When I started this project nearly five years ago, only seven genes encoding
NPC proteins had been isolated from vertebrates and yeast, and little was known about
their functions (Table 1.1. and 1.2.). In plants, our knowledge on the NPC was limited
to morphological and few biochemical studies (see above and Chapter 2). At that time
and during the following years, no plant homologs to known NPC proteins were
identified in the expressed sequence tags (EST) databases. Further, antibodies against
several vertebrate N PC proteins did not specifically crossreact with plant NPC proteins.
Thus, we had to consider other means to identify plant NPC proteins.

The O-GlcNAc modification of several vertebrate NPC proteins has provided
a useful tool to isolate these glycoproteins. Therefore, as an initial step to identify plant
NPC proteins, we were interested in whether plant NPC proteins are also modified by
GlcNAc. This sugar modification would enable us to purify the plant glycoproteins by
lectin affinity chromatography to obtain peptide sequence information and subsequently

to clone the corresponding genes.

33

References

Ach, R.A. and Gruissem, W. (1994). A small nuclear GTP-binding protein from
tomato suppresses a Schizasaccharamyces pambe cell-cycle mutant. Proc Natl Acad Sci
U S A 91, 5863-5867.

Adam, S.A., Sterne-Marr, R., and Gerace, L. (1990). Nuclear protein import in
permeabilized cells requires soluble cytoplasmic factors. J. Cell Biol. 111, 807—16.

Adam, S.A., Sterne-Marr, R., and Gerace, L. (1992). Nuclear protein import using-
digitonin-perrneabilized cells. Meth. Enzym. 219, 97-110.

Akey, C.W. (1995). Structural plasticity of the nuclear pore complex. J. Mol. Biol.
248, 273-293.

Akey, C.W. and Rademacher, M. (1993). Architecture of the Xenapus nuclear pore

complex revealed by three—dimensional cryo-electron microscopy. J. Cell Biol. 122, 1-
19.

Aitchison, J .D., Blobel, G., Rout, M.P. (1995). Nup120: a yeast nucleoporin required
for NPC distribution and mRNA export. J. Cell Biol. 131, 1659-1675.

Aitchison, J .D., Blobel, G., Rout, M.P. (1996). Kap104p: a karyopherin involved in
the nuclear transport of messenger RNA binding proteins. Science 274, 624-627.

Bastos, R., Lin, A., Enarson, M., Burke, B. (1996). Targeting and function in
mRNA export of nuclear pore complex protein Nup153. J. Cell Biol. 134, 1141-1156.

Belanger, K.D., Kenna, M.A., Wei, 8., and Davis, LL (1994). Genetic and physical
interaction between Srpl and nuclear pore complex proteins Nuplp and Nup2p. J . Cell.
Biol. 126, 619-630.

Buss, F., Kent, H., Stewart, M., Bailer, S.M., and Hanover, J .A. (1994). Role of
different domains in self—association of rat nucleoporin p62. J. Cell Sci. 107, 631-638.

Buss, F. and Stewart, M. (1995). Macromolecular interaction in the nucleoporin p62
complex of rat nuclear pores: binding of nucleoporin p54 to the rod domain of p62. J .
Cell Biol. 128, 251-261.

Carmo-Fonseca, M., Kern, H., and Hurt, EC. (1991). Human nucleoporin p62 and
essential yeast nuclear pore protein NSPl show sequence homology and a similar
domain organization. Eur. J. Cell Biol. 55, 17-30.

Carrington, J .C., Kasschau, K.D., Mahajan, S.K., and Schaad, M.C. (1996). Cell—
to-cell and long distance transport of viruses in plants. Plant Cell 8, 1669-1681.

34

Cordes, V.I., Waizenegger, I., and Krohne, G. (1991). Nuclear pore complex
glycoprotein p62 from Xenapus laevis and mouse: cDNA cloning and identification of
its glycosylation region. Eur. J. Cell Biol. 55, 31—47.

Dabauvalle, M.-C., Benevente, R., and Chaly, N. (1988). Monoclonal antibodies to
a Mr 68,000 pore complex glycoprotein interfere with nuclear protein uptake in Xenapus
oocytes. Chromosoma 97, 193-197.

Dabauvalle, M.-C., Loos, K., and Scheer, U. (1990). Identification of a soluble
precursor complex essential for nuclear pore assembly in vitro. Chromosoma 100, 56-
66.

Davis, L.I. (1995). The nuclear pore complex. Annu. Rev. Biochem. 64, 865-896.

Davis, LL, and Blobel, G. (1986). Identification and characterization of a nuclear
pore complex protein. Cell 45, 699-709.

Davis, LL, and Fink, G.R. (1990). The NUPl gene encodes an essential component
of the yeast nuclear pore complex. Cell 61, 965-978.

Dingwall, C. , Kandelslewis, S., and Seraphin, B. (1995). A family of Ran binding
proteins that includes nucleoporins. Proc. Natl. Acad. Sci. USA 92, 7525-7529.

Dingwall, C. and Laskey, R. (1992). The nuclear membrane. Science 258, 942—947.

D’Onofrio, M., Starr, C.M., Park, M.K., Holt, G.D., Haltiwanger, R.S., Hart
G.W. and Hanover, J .A. (1988). Partial cDNA sequence encoding a nuclear pore
protein modified by O-linked N -acetylglucosamine. Proc. Natl. Acad. Sci. U S A 85,
9595-9599.

Doye, V., and Hurt, EC. (1995) Genetic approaches to nuclear pore structure and
function. Trends in Genet. 11, 235-241.

Doye, V., and Hurt, E. (1997) From nucleoporins to nuclear pore complexes. Curr.
Opin. Cell Biol. 9, 401-411.

Doye, V., Wepf, R., and Hurt, EC. (1994). A novel nuclear pore protein Nup133p
with distinct roles in poly(A)+ RNA transport and nuclear pore distribution. EMBO J.
13, 6062-6075.

Duverger, E., Pellerin-Mendes, C., Mayer, R., Roche, A.-C., and Monsigny, M.
(1995). Nuclear import of glycoconjugates is distinct from the classical NLS pathway.
J. Cell Sci. 108, 1325-1332.

35

Fabre, E., Boelens, W.C., Wimmer, C., Mattaj, I.W., Hurt, EC. (1994). Nup145p
is required for nuclear export of mRNA and binds homopolymeric RNA in vitro via a
novel conserved motif. Cell 78, 275-289.

Featherstone, C., Darby, M.K., and Gerace, L. (1988). A monoclonal antibody
against the nuclear pore complex inhibits nucleocytoplasmic transport of protein and
RNA in vivo. J. Cell Biol. 107, 1289-1297.

Finlay, D.R., Newmeyer, D.D., Price, T.M., and Forbes, DJ. (1987). Inhibition
of in vitro nuclear transport by a lectin that binds to nuclear pores. J. Cell Biol. 104,
189-200.

Finlay, D.R., Meier, E., Bradley, P., Horecka, J., and Forbes, DJ. (1991). A
complex of nuclear pore proteins required for pore function. J. Cell Biol. 114, 169—183.

Finlay, D.R., and Forbes, DJ. (1990). Reconstitution of biochemically altered nuclear
pores: Transport can be eliminated and restored. Cell 60, 17-29.

Forbes, DJ. (1992). Structure and function of the nuclear pore complex. Annu. Rev.
Cell Biol. 8, 495-527.

Franke, W.W. (1966). Isolated nuclear membranes. J. Cell Biol. 31, 9—623.

Garcia-Bustos, J ., Heitman, J. and Hall, MN. (1991). Nuclear protein localization.
Biochem. Biophys. Acta 1071, 83-101.

Gerace, L. and Foisner, R. (1994). Integral membrane proteins and dynamic
organization of the nuclear envelope. Trends in Cell Biology 4, 127-131.

Gerace, L., Ottaviano, Y., and Kondor-Koch, C. (1982). Identification of a major
polypeptide of the nuclear pore complex. J. Cell Biol. 95, 826-837.

Goldberg, M.W., and Allen, T.D. (1992). High resolution scanning electron
microscopy of the nuclear envelope: demonstration of a new, regular, fibrous lattice

attached to the baskets of the nucleoplasmic face of the nuclear pores. J. Cell Biol. 119,
1429-1440.

Goldberg, M.W. and Allen, T.D. (1993).The nuclear pore complex: three-dimensional
surface structure revealed by field emission, in—lens scanning electron microscopy, with
underlying structure uncovered by proteolysis. J. Cell Sci. 106, 261-274.

Goldberg, M.W. and Allen, T. (1995). Structural and functional organization of the
nuclear envelope. Curr. Opin. Cell Biol. 7, 301-309.

36

Goldberg, M.W. and Allen, T.D. (1996). The nuclear pore complex and lamina:
three-dimensional structures and interaction determined by field emission in-lens
scanning electron microscopy. J. Mol. Biol. 257, 848-865.

Giirlich, D. (1997). Nuclear protein import. Curr. Opin. Cell Biol. 9, 412-419.

Gdrlich, D., Mattaj, I.W. (1996). Nucleocytoplasmic transport. Science 271, 1513-
1518.

Gorsch, L.C., Dockendorff, T.C., Cole, C.N. (1995). A conditional allele of the
novel-repeat-containing yeast nucleoporin RAT7/NUP159 causes both rapid cessation

of mRN A export and reversible clustering of nuclear pore complexes. J. Cell Biol. 129,
939-955.

Grandi, P., Schlaich, N., Tekotte, H., and Hurt, EC. (1995). Functional interaction
of N ic96p with a core nucleoporin complex consisting of Nsplp, Nup49p and a novel
protein Nup57p. EMBO J. 14, 76-87.

Greber, U.F. and Gerace, L. (1992). Nuclear protein import is inhibited by an

antibody to a lumenal epitope of a nuclear pore complex glycoprotein. J. Cell Biol.
116, 15-30.

Greber, U.F., Senior, A., and Gerace, L. (1990). A major glycoprotein of the
nuclear pore complex is a membrane-spanning polypeptide with a large lumenal domain
and a small cytoplasmic tail. EMBO J. 9, 1495-1502.

Hallberg, E., Wozniak, R.W., and Blobel, G. (1993). An integral membrane protein
of the pore membrane domain of the nuclear envelope contains a nucleoporin-like
region. J. Cell Biol. 122, 513-521.

Haltiwanger, R.S., Kelly, W.G., Roquemore, E.P., Blomberg, M.A., Dong, L.-
Y.D., Kreppel, L., Chou, T.-Y., and Hart, G.W. (1992). Glycosylation of nuclear

and cytoplasmic proteins is ubiquitous and dynamic. Biochem. Soc. Transaction 20:
264-69.

Hanover, J .A., Cohen, C.K., Willingham, M.C., and Park, M.K. (1987). O-linked
N—acetylglucosamine is attached to proteins of the nuclear pore. J. Biol. Chem. 262,-
9887-9894.

Hart, G.W. (1997). Dynamic O-linked glycosylation of nuclear and cytoskeletal
proteins. Annu. Rev. Biochem. 66, 315-335.

Harter, K., Kircher, S., Frohnmeyer, H., Krenz, M., Nagy, F., and Schafer, E.
(1994). Light-regulated modification and nuclear translocation of cytosolic G-box
binding factors in parsley. Plant Cell 6, 545-559.

37

Hicks, G.R. and Raikhel, N.V. (1993). Specific binding of nuclear localization
sequences to plant nuclei. Plant Cell 5, 983-994.

Hicks, G.R., and Raikhel, N.V. (1995). Protein import into the nucleus: An
integrated view. Annu. Rev. Cell Dev. Biol. 11, 155-188.

Hicks, G.R., Smith, H.M.S., Lobreaux, S., and Raikhel, N.V. (1996). Nuclear
import in permeabilized protoplasts from higher plants has unique features. Plant Cell
8, 1337-1352.

Hinshaw, J .E., Carragher, B.O., and Milligan, R.A. (1992). Architecture and design
of the nuclear pore complex. Cell 69, 1133-1141.

Holt, G.D., Snow, C.M., Senior, A., Haltiwanger, R.S., Gerace, L., and Hart,
G.W. (1987). Nuclear pore complex glycoproteins contain cytoplasmically disposed O-
linked N-acetylglucosamine. J. Cell Biol. 104, 1157-1164.

Hurwitz, ME. and Blobel, G. (1995). NUP82p is an essential yeast nucleoporin
required for poly(A)+ RNA export. J. Cell Biol. 130, 1275-1281.

Hu, T., Guan, T., Gerace, L. (1996). Molecular and functional characterization of
the p62 complex, an assembly of nuclear pore complex glycoproteins. J. Cell Biol. 134,
589-601.

Hurt, EC. (1988). A novel nucleoskeletal-like protein located at the nuclear periphery
is required for the life cycle of Saccharamyces cerevisiae. EMBO J. 7, 323-4334.

Hurwitz, ME. and Blobel G. (1995). NUP82 is an essential yeast nucleoporin
required for poly(A)+ RNA export. J. Cell Biol. 130, 1275-1281.

Iovine, M.K., Watkins, J .L., Wente, S.R. (1995). The GLFG repetitive region of
the nucleoporin Nup116p interacts with Kap95p, an essential yeast nuclear import
factor. J. Cell Biol. 131, 1699-1713.

Iovine, M.K. and Wente, S.R. (1997). A nuclear export signal in Kap95p is required
for both recycling the import factor and interaction with the nucleoporin GLFG repeat
regions of Nup116p and Nup100p. J. Cell Biol. 1374, 797-811.

Izaurralde, E., Kutay, U., Mattaj, I.W., and Garlich, D. (1997). The asymmetric
distribution of the constituents of the Ran system is essential for transport in and out
of the nucleus. EMBO J. , in press.

Jarnik, M. and Aebi, U. (1991). Towards a more complete 3D structure of the nuclear
pore complex. J. Struc. Biol. 107, 291-308.

38

Jordan, E.G., Timmis, J.N., and Trewavas, A.J. (1980). The plant nucleus. In
Tolbert,N .E. (ed.), The Biochemistry of Plants, Academic Press, Inc. , Vol. 1, pp. 490-
588.

Kalinich, J .F., and Douglas, M.G. (1989). In vitro translocation through the yeast
nuclear envelope: signal dependent transport requires ATP and calcium. J. Cell Biol.
264,-17979-17989.

Kraemer, D.C., Strambio-de—Castilla, C., Blobel, G., Rout, M.P. (1995). The
essential yeast nucleoporin NUP159 is located on the cytoplasmic side of the nuclear
pore complex and serves in karyopherin-mediated binding of transport substrates. J.

Biol. Chem. 270, 19017-19021.

Kraemer, D., Wozniak, R.W., Blobel, G., and Radu, A. (1994). The human CAN
protein, a putative oncogene product associated with myloid leukemogenesis, is a

nuclear pore complex protein that faces the cytoplasm. Proc. Natl. Acad. Sci. USA 91,
1519-1523.

Loeb, J.D., Davis, LI. and Fink, G.R. (1993). NUP2, a novel yeast nucleoporin,
has functional overlap with other proteins of the nuclear pore complex. Mol. Biol. Cell
4, 209-222.

Mattaj, I.W., Boelens, W., Izaurralde, E., Jarmolowski, A., and Kambach, C.
(1993). Nucleocytoplasmic transport and snRNP assembly. Mol. Biol. Reports 18, 79-
83.

Meier, E., Miller, B.R., Forbes, DJ. (1995). Nuclear pore complex assembly studied
with a biochemical assay for annulate lamellae formation. J. Cell Biol. 129, 1459—1472.

Merkle, T., Haizel, T., Matsumoto, T., Harter, K., Dallmann, G., and Nagy, F.
(1994). Phenotype of the fission yeast cell cycle regulatory mutant piml-46 is
suppressed by a tobacco cDNA encoding a small, Ran-like GTP-binding protein. Plant
J 6, 555-565.

Merkle, T., Leclerc, D., Marshallsay, C., and Nagy, F. (1996). A plant in vitro
system for the nuclear import of proteins. Plant J. 10, 1177-1186.

Miller, M.W., and Hanover, J .A. (1994). Functional nuclear pores reconstituted with
B-l,4 galactose—modified O-linked N—acetylglucosamine glycoproteins. J. Biol. Chem.
269, 9289-9297.

Moroianu, J ., Hijikata, M., Blobel, G., and Radu, A. (1995). Mammalian
karyopherin a 1 B and oz 2 B heterodimers: oz 1 or oz 2 subunit binds nuclear localization

signal and B subunit interacts with peptide repeat-containing nucleoporins. Proc. Natl.
Acad. Sci. USA 92, 6532-6536.

39

Nakielny S. and Dreyfuss, G. (1997). Nuclear export of proteins and RNAs. Curr.
Opin. Cell Biol. 9, 420-429.

Nehrbass. U., Fabre, E., Dihlman, S., Herth, W., and Hurt, EC. (1993). Analysis
of nucleo-cytoplasmic transport of a thermosensitive mutant of nuclear pore protein
Nsplp. Eur. J. Cell Biol. 62, 1-12.

Nehrbass, U., Rout, M.P., Maguire, S., Blobel, G., Wozniak, R.W. (1996). The
yeast nucleoporin Nup188p interacts genetically and physically with the core structures
of the nuclear pore complex. J. Cell Biol. 133, 1153-1162.

Newmeyer, D.D., and Forbes, DJ. (1988). Nuclear import can be separated into
distinct steps in vitro: Nuclear pore binding and translocation. Cell 52, 641-653.

Panté, N., and Aebi, U. (1993). The nuclear pore complex. J. Cell Biol. 122, 977-
984.

Panté, N., and Aebi, U. (1996). Sequential binding of import ligands to distinct
nucleopore regions during their nuclear import. Science 273, 1729-1732.

Park, M.K., D’Onofrio, M., Willingham, M.C., and Hanover, J.A. (1987). A
monoclonal antibody against a family of nuclear pore proteins (nucleoporins): O-linked
acetylglucosamine is part of the immunodeterminant. Proc. Natl. Acad. Sci. USA 84,
6462—6466.

Pollard, V.W., Michael, W.M., Naldalny, B., Slomi, M.C., Wang, P., Dreyfuss,
G. (1996). A novel receptor mediated nuclear protein import pathway. Cell 88, 985—
994.

Powers, M.A., Macaulay, C., Masiarz, F.R., and Forbes, D.F. (1995).
Reconstituted nuclei depleted of a vertebrate GLFG nuclear pore complex protein, p97,
import but are defective in nuclear growth and replication. J. Cell Biol. 128, 721-736.

Powers, M.A., Forbes, D.J., Dahlberg, J .E. Lund, E. (1997). The vertebrate GLFG
nucleoporin, Nup98, is an essential component of multiple RNA export pathway. J.
Cell Biol. 136, 241-250.

Radu, A., Blobel, G. and Wozniak, R.W. (1993). Nup155 is a novel nuclear pore
complex protein that contains neither repetitive sequence motifs nor reacts with WGA.
J. Cell Biol. 121, 1-9.

Radu, A., Blobel, G., and Wozniak, R.W. (1994). Nup107 is a novel nuclear pore
complex protein that contains a leucine zipper. J. Biol. Chem. 269, 17600-17605.

4O

Radu, A., Blobel, G., and Moore, M.S. (1995a). Identification of a protein complex
that is required for nuclear protein import and mediates docking of import substrate to
distinct nucleoporins. Proc. Natl. Acad. Sci. USA 92, 1769-1773.

Radu, A., Moore, M.S., and Blobel, G. (1995b). The peptide repeat domain of
nucleoporin Nup98 functions as a docking site in transport across the nuclear pore
complex. Cell 81, 215-222.

Raikhel, N .V. (1992). Nuclear targeting in plants. Plant Physiol. 100, 1627—1632.

Reichelt, R., Holzenburg, A., Buhle, E.L., Jarnik, M., Engel, A., and Aebi, U.
(1990). Correlation between structure and mass distribution of the nuclear pore
complex, and of distinct pore complex components. J. Cell Biol. 110, 883-894.

Rexach, M. and Blobel, G. (1995). Protein import into nuclei: association and
dissociation reactions involving transport substrate, transport factors, and nucleoporins.
Cell 83, 683-692.

Roberts, K., and Northcote, DH. (1970). Structure of the nuclear pore in higher
plants. Nature 228, 385—386.

Rout, M.P., and Blobel, G. (1993). Isolation of the yeast nuclear pore complex. J.
Cell Biol. 123, 771-783.

Rout, M.P., and Wente, S.R. (1994). Pores for thought: nuclear pore complex
proteins. TICB 4, 357-365.

Saitoh, H., Cooke, C.A., Burgess, W.H., Earnshaw, W.C., and Dasso, M. (1996).
Direct and indirect association of the small GTPase Ran with nuclear pore proteins and

soluble transport factors: studies in Xenapus laevis egg extract. Mol. Biol. Cell 7, 1319-
1334.

Schlaich, N.L., Haner, M., Lustig, A., Aebi, U. and Hurt, EC. (1997). In vitro
reconstitution of a heterotrimeric nucleoporin complex consisting of recombinant
Nsplp, Nup49p, and Nup57p. Mol. Biol. Cell 8, 33-46.

Schlenstedt, G., Hurt, E., Doye, V. and Silver, RA. (1993). Reconstitution of
nuclear protein transport with semi-intact yeast cells. J. Cell Biol. 123, 785-798.

Sheng, J. and Citovsky, V. (1996). Agrobacterium-plant cell DNA transport: have
virulence proteins, will travel. Plant Cell 8, 1699-1710.

Siomi, H. and Dreyfuss G. (1995). A nuclear localization domain in the hnRNP A1
protein. J. Cell Biol. 129, 551-560.

41

Smith, H.M.S., Hicks, G.R., and Raikhel, N.V. (1997). Importin oz from
Arabidapsis thaliana is a nuclear import receptor that recognizes three classes of import
signals. Plant Physiol. 114, 411-417.

Snow, C.M., Senior, A., and Gerace, L. (1987). Monoclonal antibodies identify a
group of nuclear pore complex glycoproteins. J. Cell Biol. 104, 1143-1156.

Soederqvist, H. and Hallberg, E. (1994). The large C-terminal region of the integral
pore membrane proteins, POM121, is facing the nuclear pore complex. Eur. J. Cell
Biol. 64, 184-191.

Sukegawa, J ., and Blobel, G. (1993). A nuclear pore complex protein that contains
zinc finger motifs, binds DNA, and faces the nucleoplasm. Cell 72, 29-38.

Terns, M.P. and Dahlberg, J .E. (1994). Retention and 5’ cap trimethylation of U3
snRNA in the nucleus. Science 264, 959-961.

Ullman, K.C., Powers, M.A., and Forbes, DJ. (1997). Nuclear export receptors:
from Importin to exportin. Cell 90, 967-970.

Van Deursen, J ., Boer, J. Kasper, L., Grosveld, G. (1996). G2 arrest and impaired
nucleocytoplasmic transport in mouse embryos lacking the proto-oncogene
CAN/Nup214. EMBO J. 15, 5574-5583.

Wente, S.R. and Blobel, G. (1994). NUP145 encodes a novel yeast glycine-leucine-
phenylalanine-glycine (GLFG) nucleoporin required for nuclear envelope structure. J.
Cell Biol. 125, 955-969.

Wente, S.R., Rout, M.P., Blobel, G. (1992). A new family of yeast nuclear pore
complex proteins. J. Cell Biol. 119, 705-723.

Whittaker, G., Bui, M., and Helenius A. (1996). Nuclear trafficking of influenza
virus ribonucleoproteins in heterokaryons. J. Virol. 70, 2743-2756.

Wilken, N., Seneca]. J .-L., Scheer, U., Dabauvalle, M.-C. (1995). Localization of
the Ran-GTP binding protein Ran-BP2 at the cytoplasmic side of the nuclear pore
complex. Eur. J. Cell Biol. 68, 211-219.

Wozniak, R.W., Bartnik, E., Blobel, G. (1989). Primary structure analysis of an
integral membrane glycoprotein of the nuclear pore. J. Cell Biol. 108, 2083-2092.

Wozniak, R.W., Blobel, G., and Rout, M.P. (1994). POM 152 is an integral protein
of the pore membrane domain of the yeast nuclear envelope. J. Cell Biol. 125, 31-42.

42

Wu, J., Matunis, M.J., Kraemer, D., Blobel, G., Coutavas, E. (1995). Nup358,
a cytoplasmically exposed nucleoporin with peptide repeats, Ran-GTP binding sites,
zinc fingers, a cyclophilin A homologous domain, and a leucine-rich region. J. Biol.
Chem. 270, 14209-14213.

Yokoyama, N., Hayashi, N., Seki, T., Panté, N., Ohba, T., Nishii, K., Kuma, K.,
Hayashida, T., Miyata, T., Aebi, U. et al. (1995). A giant nucleopore protein that
binds Ran/TC4. Nature 376, 184-188.

Zupan, J .R., Citovsky, V., and Zambryski P. (1996). Agrobacterium VirE2 protein
mediates nuclear uptake of single-stranded DNA in plant cells. Proc Natl Acad Sci U
S A 93, 2392-2397.

Chapter 2

Plant nuclear pore complex proteins are modified by

novel oligosaccharides with terminal N-acetylglucosamine

This chapter was originally published in:

Antje Heese-Peck, Robert N. Cole, Olga N. Borkhsenious,

Gerald W. Hart, Natasha V. Raikhel (1995). Plant Cell 7: 1459-1471

43

44
ABSTRACT

Only a small number of nuclear pore complex (NPC) proteins, mainly in
vertebrates and yeast but none in plants, have been well characterized. As an initial step
to identify plant NPC proteins, we examined whether NPC proteins from tobacco are
modified by N-acetylglucosamine (GlcNAc). Using wheat germ agglutinin (W GA), a
lectin that binds in plants specifically to GlcNAc, specific labeling was often found
associated with or adjacent to NPCs. Nuclear proteins containing GlcNAc can be
partially extracted by 0.5 M salt as shown by a WGA blot assay, and at least eight
extracted proteins are modified by terminal GlcNAc as determined by in vitra
galactosyltransferase assays. Sugar analysis indicates that the plant glycans with
terminal GlcNAc differ from the single O-GlcNAc of vertebrate NPC proteins in that
they consist of oligosaccharides that are larger in size than five GlcNAcs. Most of these
appear to be bound to proteins via a hydroxyl group. This novel oligosaccharide
modification may convey properties to the plant NPC that are different from those of

vertebrate NPCs.

45
INTRODUCTION

The nuclear pore complex (NPC) is the site for nucleocytoplasmic transport of
macromolecules such as proteins, T-DNA and different RNA species. The architecture
and the major components of this complex have been extensively investigated in
amphibians using different electron microscopic (EM) techniques (for review see Panté
and Aebi, 1993). The NPC is a supramolecular structure of about 124 mD (Reichelt er
al., 1990) and exhibits an eightfold rotational symmetry. It consists of a cytoplasmic
and a nucleoplasmic ring, and these rings are connected to the central channel complex
via sets of spokes. It is thought that the spokes form eight aqueous channels of
approximately 9 nm that allow passive diffusion of some ions and small molecules
(Hinshaw et al., 1992; Akey and Rademacher, 1993), whereas the central channel
complex with a functional diameter of up to 26 nm is proposed to be involved in the
specific transport of macromolecules (Feldherr et al. , 1984). Recently, other
morphological peripheral structures of the NPC have been observed such as cytoplasmic
fibrils that are attached to the cytoplasmic ring and the nuclear basket that extends from
the nucleoplasmic ring into the nucleoplasm (for reviews see Akey, 1992; Panté and
Aebi, 1993). In some species, the nuclear basket has been shown to be attached to a
fibrous lattice termed the nuclear envelope lattice (Goldberg and Allen, 1992).

Based on scanning transmission EM mass analysis, the NPC is proposed to
consist of at least 100 different proteins (Reichelt et al., 1990). To date, only a small
number of NPC proteins have been identified and characterized at the biochemical and
molecular level. These are mainly from vertebrates and yeast, and none have been

identified in plants. Little is known about the function of the NPC proteins in

46

nucleocytoplasmic transport, N PC organization, and assembly in any system studied
(for reviews see Forbes, 1992; Fabre and Hurt, 1994; Rout and Wente, 1994; Hicks
and Raikhel, 1995b). Of particular interest with respect to protein import is a family
of vertebrate NPC glycoproteins that are modified by the addition of single O-linked
N-acetylglucosamine (O-GlcNAc) residues (for reviews see Hart et al. , 1989; Forbes,
1992). This posttranslational modification is distinct from other protein sugar
modifications; the sugar is an unmodified monosaccharide moiety whose addition occurs
in the cytoplasm (for reviews see Hart et al., 1989; Haltiwanger et al., 1992). In
vertebrate nuclei, the O-GlcNAc NPC proteins have been identified by their ability to
bind to wheat germ agglutinin (W GA), a lectin that binds to GlcNAc and sialic acids
(Goldstein and Hayes, 1978), and by monoclonal antibodies raised against nuclear
fractions (Davis and Blobel, 1986; Finlay et al. , 1987; Hanover et al. , 1987; Holt et
al., 1987; Park et al., 1987; Schindler et al., 1987; Snow et al., 1987). The most
abundant O-GlcNAc bearing NPC protein, denoted p62, has been sequenced from
several vertebrate species and its glycosylation studied in detail (Starr et al., 1990;
Carmo—Fonseca et al., 1991; Cordes et al., 1991; Cordes and Krohne, 1993).
Several studies have demonstrated that the O-GlcN Ac NPC proteins are involved
in protein import. Agents that bind to these glycoproteins such as WGA, antibodies that
recognize this protein family and antibodies specific for p62 block nucleocytoplasmic
transport (Finlay et al., 1987; Yoneda et al., 1987; Dabauvalle er al., 1988;
Featherstone et al., 1988; Newmeyer and Forbes, 1988; Wolff et al., 1988). Moreover,
depletion of O—GlcNAc proteins from NPCs reconstituted in Xenapus extracts inhibits

transport in vitro by preventing the formation of transport-competent nuclei and NPCs

47
(Dabauvalle et al., 1990; Finlay and Forbes, 1990; Finlay et al., 1991; Miller and

Hanover, 1994). Studies by Sterne—Marr et al. (1992) suggest that a cytosolic factor
essential for nuclear import binds to Nup153p, a mammalian O-GlcNAc NPC protein.
The WGA binding protein, Nup98p, has also been implicated to function as a docking
protein for cytosol-mediated binding of import substrate in vitro (Radu et al., 1995a;
1995b). Although the family of O-GlcNAc proteins has been shown to be involved in
import, the exact role of the O-GlcNAc sugar modification in nuclear transport is not
fully understood (Miller and Hanover, 1994). Interestingly, the O-GlcNAc modification
has not yet been observed in any yeast NPC protein (Rout and Wente, 1994). In
addition, WGA has no effect on nuclear import in yeast (Kalinich and Douglas, 1989).
These observations indicate that differences exist in nuclear transport and NPCs of

different organisms.

In plants, little is known about the nuclear transport machinery (for review see
Raikhel, 1992; Hicks and Raikhel, 1995b) or about NPC proteins and their function in
nuclear transport. Although the plant NPC has been morphologically described for
several decades (Roberts and Northcote, 1970, for review see Jordan et al., 1980),
almost no further characterization of plant NPC components has been accomplished.
Scofield et al. (1992) reported that a 100 kD protein, identified using antibodies against
the yeast NPC protein Nsplp (Hurt, 1988), is enriched in nuclear matrix preparations
of carrot suspension-cultured cells and located at the plant NPC. Recently, binding of
nuclear localization signals (NLSs) was observed to a low affinity binding site that is

proteinaceous and firmly associated with the nuclear envelope (NE) and NPCs of

48
isolated dicot and monocot nuclei (Hicks and Raikhel, 1993; Hicks et al., 1995).

Crosslinking studies under conditions similar to those used for NLS binding identified
several polypeptides that bind specifically to functional NLSs. The affinities and the
biochemical properties of these polypeptides are similar to those of the N LS binding site
(Hicks and Raikhel, 1995a). These data indicate that in plants, components that
recognize functional NLSs may be located at the plant NPC. Using an
irnmunofluorescence in vitro nuclear import system, we have found that WGA does not

inhibit protein import into the plant nucleus, although the lectin binds to the nuclear

surface (Hicks and Raikhel, 1995b).

In the current study, we investigate the WGA binding sites at the nuclear surface
in plants and demonstrate that proteins at the N PC of tobacco suspension-cultured cells
are detected by WGA and therefore are modified by GlcNAc. The plant glycoproteins
have unusual oligosaccharide modifications that are discussed and compared to those

of vertebrate NPC proteins modified by a single O-GlcNAc.

 

49
METHODS

Materials

All chemicals were purchased from Sigma (St. Louis, MO) unless otherwise noted.

Cell culture and nuclear purification

Nicotiana tabacum suspension-cultured cells were maintained and subcultured, and
protoplasts were prepared from 6- to 7-day cell cultures essentially as described by
Bednarek et al. (1990). The purification of tobacco nuclei was based upon the methods
of Wilmitzer and Wagner (1981) and Saxena et al. (1985). Isolation of nuclei in the
presence of 0.01% Triton X-100 was performed as described by Hicks and Raikhel
(1993), and the isolation of nuclei in the presence of 0.6% Triton X—100 was performed
as follows: Protoplasts from two 250-mL cultures were pelleted at 50xg for 4 min at
room temperature. All subsequent steps were performed at 4°C. All buffers containing
Percoll were adjusted to a pH of 5.6. The following concentrations of protease
inhibitors were present during all steps: 5 Izg/mL pepstatin, 5 ng/mL leupeptin, 5
am/mL aprotinin, 5 pm/mL aminocaproic acid, 0.4 mM phenylmethylsulfonyl fluoride.
The pellet was resuspended in 50 mL of 0.01 % Triton X-100 (Boehringer Mannheim,
Indianapolis, IN) in nuclear isolation buffer (NIB; 10 mM 2(N-morpholino)-
ethanesulfonic acid-KOH, pH 5.6, 0.2 M sucrose, 10 mM NaCl, 10 mM KCl, 2.5 mM
EDTA, 2.5 mM DTT, 0.1 mM spermine, 0.5 mM spermidine) and placed on ice for
10 min. Protoplasts were ruptured by passage through a 21-gauge needle six times. The
lysate was centrifuged for 4 min onto a cushion of 67% Percoll in NIB at 1000xg, and

the interface material was diluted with 100 mL 0.6% Triton X-100 in NIB. The lysate

50

was incubated on ice for 20 min and filtered through a 20 pm nylon mesh, then divided
and layered onto 6 step gradients consisting of 1 mL of 67% Percoll in NIB and 5 mL
of 7.5% Percoll in NIB. The gradients were centrifuged at 1000xg for 4 min, and the
interfaces between the Percoll phases were combined, diluted with 100 mL 0.6% Triton
X-100 in NIB, and incubated on ice for 10 min. The step gradient was repeated, the
interfaces combined and diluted with 50 mL 0.6% Triton X-100 in NIB and loaded onto
another step gradient. The interfaces containing the purified nuclei were washed in
nuclear storage buffer (20% glycerol in NIB) and pelleted at 750xg for 5 min. After
another washing and pelleting step, the nuclei were quantitated as described in Hicks

and Raikhel (1993) and stored at —80°C. Yields were 4 to 6x108 nuclei.

Isolation and fractionation of nuclear proteins

Isolated nuclei were incubated with DNase I (Boehringer Mannheim, Indianapolis, IN)
at a concentration of 30 units/106 nuclei in the presence of 5 mM Tris-HCl, pH 7.5, 1
mM MgCl2 for 30 min at room temperature and pelleted at 12,000xg for 5 min. The
DNase I treated nuclear pellet was resuspended in SDS-sample buffer or subjected to
further extraction by incubation in a low salt + detergent buffer (LS/TR; 2% Triton
X-100, 10% sucrose, 20 mM Tris—ethanolamine, pH 7.4, 20 mM KCl, 5 mM MgCl,,
1 mM DTT) or in a high salt buffer (HS; 0.5 M NaCl, 5 mM MgC12, 20 mM Tris, pH
7.5) for 30 min on ice. Solubilized proteins were separated from the insoluble fraction
by a 15 min centrifugation step (12,000xg) at 4°C and were precipitated with 10% TCA
followed by an acetone wash. The samples were resuspended in SDS—sample buffer

(Laemmli, 1970).

51

Protein blot analysis using WGA probes

Proteins solubilized in SDS-sample buffer were electrophoresed through SDS-PAGE and
transferred to Immobilon-P membranes (Amersham, Arlington Heights, IL) according
to standard methods (Harlow and Lane, 1988). Unless otherwise noted, blots were
blocked overnight in 5% nonfat dry milk in Tris—buffered saline + 0.1% Tween 20
(TBST), incubated for 2-1/2 hrs with 1 pl/mL WGA-alkaline phosphatase (WGA-AP;
EY-Laboratories, San Mateo, CA) or lug/mL WGA-horseradish peroxidase (WGA-
HRP; EY-Laboratories, San Mateo, CA) in TBST, washed 2x in TBST and 2x in TBS
for 10 min each, and developed according to standard methods (Harlow and Lane,
1988). Control blots were treated identically except that 2 mM chitotriose or 250 mM
mannose were added during the incubation with the WGA probes. For increased
sensitivity, WGA-HRP in combination with the chemiluminescence kit (Boehringer
Mannheim, Indianapolis, IN) was used to detect proteins. In these experiments, blots
were blocked overnight in 3% BSA in TBST, incubated with 0.5 pg/mL WGA-HRP
in TBST, washed as described above, and developed according to the manufacturer’s
specifications. The monoclonal antibody mAb414 was a generous gift from Dr. L.I.
Davis (Dept. of Genetics, Box 3646, Duke Univ. Medical Center, Durham, NC 27710,

USA).

Electron microscopy
Purified tobacco nuclei (5x105) were diluted with binding buffer (50 mM Tris, pH 7.3,
25 mM KCl, 2.5 mM MgC12, 3 mM CaClz, 20% glycerol) to 105 nuclei and incubated

with WGA-conjugated colloidal gold particles (16 ng/mL; 10 nm diameter; EY—

52

Laboratories, San Mateo, CA) for 20 min at room temperature. Control samples
contained 5 mM chitotriose (BY-Laboratories, San Mateo, CA). The nuclei were briefly
pelleted, fixed in 2% paraformaldehyde, 1% glutaraldehyde, 50 mM sodium phosphate
buffer, pH 7.2, 500 mM sucrose for 1 hr at room temperature and then postfixed in 1%
0504 in 10 mM sodium phosphate buffer, pH 7.2, 50 mM sucrose for 1 hr at room
temperature. Sections were stained and visualized as described in Hicks and Raikhel

(1993).

Galactosyltransferase labeling assays

Bovine milk GlcNAc B-1,4 galactosyltransferase (GalTF) was purchased from Sigma
(St. Louis, MO) or Oxford GlycoSystem (Rosedale, NY). Prior to use, the GalTF from
Sigma was autogalactosylated (Roquemore et al., 1994) and stored at -20°C. The
GalTF from Oxford GlycoSystem was used as provided by the manufacturer.
Equivalent results were obtained with GalTFs from either source. DNase I treated
tobacco nuclei were incubated with 0.5 M N aCl, 50 mM Hepes, pH 6.8 for 1 hr on ice
and centrifuged at 12,000xg for 5 min at 4 °C. in vitro GalTF labeling of solubilized
proteins was essentially done as described by Roquemore et al. (1994) using 100 mU
of GalTF and 3 ”Ci UDP-PH]-galactose (1.0 mCi/mL; 17.3 Ci/mmol; Amersham,
Arlington Heights, IL) in a 100 ML reaction. After incubation at 37°C for 3 hrs,
aliquots were taken for protein size analysis on 7.5% SDS-PAGE. The gel was treated
with Fluoro-Hance (Research Products International Corp., Mt. Prospect, IL) according
to the manufacturer’s specification and dried. Labeled proteins were visualized by

fluorography using ReflectionA film (NEN Research Products, Boston, MA) at -80 °C.

53

The remaining samples were used for further carbohydrate analysis and separated from
unincorporated label by desalting over a Sephadex G-50 (3 mL) gel filtration column.
Radiolabeled proteins were pooled, lyophilized, resuspended in a small volume of
deionized water, aliquoted for further analysis, and precipitated with 8 volume acetone
for at least 6 hrs at -20°C.

For an blot GalTF labeling assay, proteins were solubilized as described for in vitro
GalTF labeling assay. To lower the salt concentration, the sample was diluted with 50
mM Hepes, pH 6.8, and concentrated by Centriprep 10 Concentrator (Amicon,
Beverly, MA) at 4 °C. SDS-PAGE sample buffer was added, and the sample was
treated as described for protein blot analysis. Blots were blocked overnight with 3%
BSA in TBS and equilibrated for 4x 10 min in labeling buffer (10 mM Hepes-NaOH,
pH 7.3, 10 mM galactose, 5 mM MnClz). After incubation with 50 mU GalTF and 10
,uCi UDP-FH]-galactose in labeling buffer (1 mL reaction) for 3 hrs at 37°C, blots
were rinsed for 5 min in 10 mM EDTA, 1% SDS, washed 4x 10 min in labeling
buffer, dried, sprayed with EN3HANCE (NEN Research Products, Boston, MA), and

dried. Radiolabeled proteins were visualized by fluorography as described above.

PNGase F treatment

PeptidezN-glycosidase F (PNGase F) treatment and Sephadex G-50 column
chromatography of salt extracted, [3H]galactose-labeled nuclear proteins and
[3H]galactose-labeled ovalbumin (used as a positive control) were performed as
described in Roquemore et al. (1994) with the addition of the following protease

inhibitors to the PNGase F reaction buffer: 0.2 mM phenylmethylsulfonyl fluoride,

54

2 pg/mL antipain, 10 U/mL aprotinin, 10 ug/mL benzamidine, 1 Izg/mL leupeptin, 1
jug/mL pepstatin. 0.5% of fractions from Sephadex G-50 column were assayed for
radioactivity by liquid scintillation counting. PNGase F resistant labeled peripheral
nuclear proteins in the void volume (Vo) were lyophilized, resuspended in < 300 IzL

ddeO and precipitated in 80% cold acetone.

B-elimination of PNGase F resistant nuclear proteins

Acetone precipitated PNGase F resistant [3H]galactose-labeled nuclear proteins were
subjected to alkaline borohydride for 48 hrs and fractionated over a Sephadex G-50
column as described by Roquemore et al. (1994). One percent of the fractions from the
Sephadex G-50 column were assayed for radioactivity by liquid scintillation counting.
Released [’H]galactose-labeled saccharides in the inclusion volume (Vi) were
lyophilized and resuspended in 1 mL distilled H20. The SDS in the resuspended
samples was precipitated by adding 300 IzL of 20% KCl, incubating on ice for 15 min
and centrifuging at 10,000xg for 15 min at 4 °C. The resulting supernatant was
fractionated on a 1.5x 200 cm Toyopearl HW 40 (TosoHaas, Philadelphia, PA) column
equilibrated with 200 mM ammonium acetate and 10% ethanol at 55°C. One percent
dextran (40K) and 1% galactose were added to the samples for internal standards. The
V0 (dextran) and the Vi (galactose) were determined by phenol-sulfuric acid assay
(Dubois et al., 1956). The Toyopearl HM 40 column was calibrated with PH]galactose-
(GlcNAc)n-GlcNAcitol oligosaccharides, where n=0-3. Five percent of fractions from
the Toyopearl column were assayed for radioactivity by liquid scintillation.

The [3H]galactose-labeled oligosaccharides released by B—elimination were analyzed for

55

the presence of peptide fragments or single amino acids. The labeled oligosaccharides
were concentrated by lyophilization, passed over a Sep-Pak C18 column (Waters,
Milford, MA), equilibrated with 0.1% trifluoroacetic acid (TFA) and eluted with 60%
acetonitrile in 0.1% TFA. Both, the oligosaccharides that passed freely through the Sep-
Pak column and those that were eluted with acetonitrile, were treated with pronase
according to Fukuda (1989) and re-fractionated on the 1.5 x 200 cm Toyopearl HW 40
column. These two groups of oligosaccharides were also dansylated to detect primary
amines according to Tapuhi et al. (1981), and the products were analyzed by reverse
phase HPLC on a Microsorb-MV C18 column (Rainin Instrument Comp, Worbum,

MA) according to Kaneda et al. (1982).

56
RESULTS

Proteins at the NPC are modified by GlcNAc

Nuclei were purified from tobacco suspension-cultured cells in the presence of
either 0.01% or 0.6% Triton X-100 by multiple Percoll gradients. As shown by EM,
the structural integrity of the purified nuclei was preserved (Figure 2.1B). Nuclei
treated with 0.01% detergent were surrounded by two distinct membranes, the outer
and inner membrane of the NE (Figure 2.1A to 1D; longitudinal sections). In
longitudinal sections, the NPCs were visible as channels embedded in the NE (Figure
2.1A, C, and D). The typical cylindrical shape of the NPCs was apparent in tangential
sections (Figure 1E and F), and the central transporter was present as a dark central
granule in some NPCs. Since some other organelles were present in the nuclear fraction
isolated with 0.01% detergent, 0.6% Triton X-100 was included in the nuclei isolation
buffer. As previously reported by Willmitzer and Wagner (1981), the addition of high
detergent concentration eliminates contaminating organelles by lysis. Since the nuclear
integrity does not rely on the NE, nuclei stay intact under these conditions (Aaronson
and Blobel, 1974). Based on light microscopy and EM, the nuclear preparation treated
with 0.6% Triton X-100 appeared to be free of contaminating organelles such as
vesicles, chloroplasts and mitochondria and were of equivalent purity as reported in
other studies (Wilmitzer and Wagner, 1981; Saxena et al., 1985). Treatment with 0.6%
detergent did not appear to change the ultrastructure of the nuclei (Figure 2.1G to U).
As expected, most of the outer and inner NE were removed by the detergent (Figure
2.1G and H). The absence of the NE made it difficult to observe the NPCs in

longitudinal sections (Figure 2.1G and H).

57

Figure 2.1

Ultrastructural localization of NPC proteins modified by GlcNAc in isolated tobacco
nuclei. Nuclei were isolated in the presence of either 0.01% (A to F) or 0.6% Triton
X-100 (G to J). Prior to fixation, purified nuclei were incubated with WGA-conjugated
colloidal gold particles in the absence (A, B, C, E, G, I) and in the presence of
chitotriose (D, F, H, J). (A to D, G and F) longitudinal sections, (E, F, I, J) tangential
sections. Arrowheads indicate NPCs. im, inner membrane; om, outer membrane; n,
nucleus; no, nucleolus; bars: A to H, 0.1 pm; I and J, 0.5 Izm.

58

 

59

However, the NPCs were visible in tangential sections (Figure 2.11 and J), and their
overall morphology was preserved. This confirms observations from studies that
examined animal nuclei isolated in the presence of high detergent (Aaronson and
Blobel, 1974; Reichelt et al., 1990). It is possible, however, that some peripheral

components of the NPC may be lost during this isolation procedure.

To examine the WGA binding sites, purified nuclei were incubated with a WGA
probe. In contrast to animals, plants do not appear to contain sialic acid moieties
(Corfield and Schauer, 1982). Therefore, in plants, the WGA probe is specific for
GlcNAc and its oligomers such as chitotriose. The tobacco nuclei were incubated with
WGA-conjugated colloidal gold particles, fixed, and examined by EM (Figure 2.1).
Most of the WGA labeling was associated with the periphery of nuclei treated with low
or high detergent (Figure 2.1A, C, and G; longitudinal sections). Little binding of
WGA was observed to internal nuclear structures. As specifically apparent in nuclei
surrounded by the NE, WGA binding was often found at or adjacent to NPCs (Figure
2.1C), and an enlarged NPC labeled by WGA is shown in Figure 2.1A. In particular.
the rings and the central regions of the NPCs appeared to be labeled by WGA using
either nuclear preparation (Figure 2.1E and I; tangential sections). Individual NPCs
were often labeled by several gold particles suggesting multiple binding sites at each
NPC. Association of WGA to the nuclear periphery and in particular, to the NPCs
seemed to be higher in nuclei treated with 0.6% Triton X-100 (Figure 2.1G and 1).
Higher concentration of detergent may have solubilized some components of the NPC

and thereby exposed proteins modified by GlcNAc that were not accessible to the probe

 

60

following low detergent isolation. The WGA binding was specific, because it was
reduced in the presence of chitotriose, a specific competitor of WGA binding (Figure
2.1D, F, H and J). These results indicate that proteins modified by GlcNAc are present
at the periphery of the tobacco nucleus, and some of these glycoproteins are
components of the NPC. (Electron microscopy was done with the technical help of Dr.

Olga N. Borkhsenious).

Nuclear proteins modified by GlcNAc are extracted by salt

Nuclei isolated in the presence of 0.6% Triton X-100 were used as material for
all biochemical studies for two reasons. As shown by EM, these nuclei were devoid of
contaminating organelles. In addition, their NPCs appeared structurally preserved and
contained proteins modified by GlcNAc. To gain more information about these
glyc0proteins, nuclei were treated with DNase I, and proteins were subjected to protein
blot analysis (Figure 2.2). Proteins of similar mass were detected by two different
WGA probes: WGA-alkaline phosphatase (W GA-AP; Figure 2.2, lane 1) and WGA-
horseradish peroxidase (WGA-HRP, Figure 2.2, lane 3). The WGA binding was greatly
reduced in the presence of 2 mM chitotriose (Figure 2.2, lanes 2 and 4), but it was
unaffected by 250 mM mannose (data not shown), indicating that binding was specific.

These results demonstrate that several nuclear proteins are modified by GlcNAc.

61

WGA-

 

   
  

Chitotr.
200.0 ‘—

 

kD 1 2 3 4

Figure 2.2

Detection of tobacco nuclear proteins modified by GlcNAc.

Nuclear proteins were treated with DNase I and subjected to proteins blot analysis using
WGA—AP and WGA-HRP. Equal amounts of nuclei (1.5 x 10°) were loaded in each
lane. (1) WGA—AP, (2) WGA-AP plus chitotriose, (3) WGA-HRP, (4) WGA-HRP plus
chitotriose. Mass standards (kD) are as indicated.

62

The nuclear glycoproteins were further characterized by the following treatment.
Nuclear proteins were solubilized by either a low salt/ Triton X-100 buffer (LS/ TR; 0.02
M KCl, 2% Triton X-100) or a high salt buffer (HS; 0.5 M NaCl) and separated into
soluble and insoluble fractions by centrifugation. The protein equivalent of 5x10° nuclei
per treatment were analyzed by protein blot analysis using WGA-AP as a probe (Figure
2.3). Seven of eight detected proteins were partially extracted by the HS buffer (Figure
2.3, lane 3), although the majority of the proteins with lower apparent mass
(approximately 20 to 30 kD) were still associated with the insoluble fraction (Figure
2.3, lane 4). None of the proteins were extracted by the LS/TR buffer (Figure 2.3, lane
1). These fractionation data show that exposure to salt destabilized the interaction of
these glycoproteins with other nuclear components, whereas the exposure to high
nonionic detergent had no effect. A similar HS buffer containing 0.5 M salt is used to
extract the O-GlcNAc NPC proteins from vertebrates. These O—GlcNAc proteins are
also only partially solubilized under these conditions (Davis and Blobel, 1986; Snow
et al., 1987) with a similar efficiency as the nuclear glycoproteins from plants. The
basis of this extraction is not understood (Davis and Blobel, 1986), and a higher salt
concentration does not seem to solubilize a much higher percentage NPC glycoproteins
(Davis and Blobel, 1986; Snow et al., 1987). Overall, the results obtained by extraction
and EM indicate that at least some of the plant nuclear proteins modified by GlcNAc

are located at the NPC.

63

 

LS/TR I HS

3 P | s P
200.0—
116.3-
97.4-
66.2~— W.M.,... “W
45.0— _

 

kD 1 2 3 4

Figure 2.3

Biochemical characterization of tobacco nuclear proteins modified by GlcNAc.
Nuclear proteins treated with DNase I were solubilized in either a 0.02 M KCl/2%
Triton X—100 (LS/TR) or a 0.5 M NaCl (HS) buffer and separated into a soluble (S)
and an insoluble (P) fraction. The equivalent of 5 x 10° nuclei per treatment were
subjected to protein blot analysis using WGA—AP. (1 + 2) LS/TR treatment, (3 + 4)
HS treatment.

Proteins were resolved by 10% SDS—PAGE. Mass standards (kD) are as indicated.

64

Nuclear proteins are modified by terminal GlcN Ac

Since WGA can bind to terminal as well as internal GlcNAcs (Ebisu et al.,
1977), a different approach was used to gain more information about the sugar
modification. We employed an in vitro labeling procedure using galactosyltransferase
(GalTF; Roquemore et al. , 1994). This enzyme specifically transfers the [3H]galactose
moiety of UDP-[3H]galactose to terminal GlcNAc residues of glycoproteins (W hiteheart
er al. , 1989; Roquemore et al., 1994). Nuclear proteins were extracted by the HS
buffer and labeled in vitro with [3H]galactose by GalTF (+) (Figure 2.4, lanes 2 and
4). A control reaction in the absence of GalTF (-) was performed to show that labeling
was specific to GalTF, and not to endogenous GalTF activity associated with the nuclei
(Figure 2.4, lanes 1 and 3). The radiolabeled proteins were visualized by fluorography,
and at least eight proteins were specifically labeled by the GalTF (Figure 2.4, lane 4).
In particular, two proteins having apparent masses of 60 kD and 90 kD (after
[3H]galactose incorporation) did not appear to be highly abundant proteins by
Coomassie Blue-stained protein profile (Figure 2.4, lane 2) suggesting the presence of
multiple terminal GlcNAc moieties on these proteins.

Due to the incorporation of FH]galactose, the mobility of proteins decreases on
SDS-PAGE after in vitro GalTF labeling (Snow et al., 1987; Miller and Hanover,
1994). Hence, it was not possible to directly align glycoproteins detected by the in vitro
GalTF labeling assay with proteins detected by WGA blot analysis. We therefore
established an an blot GalTF labeling assay in which proteins immobilized on
membranes were incubated with UDP—[3H]galactose and GalTF under conditions that

were similar to those used in the in vitro GalTF labeling assay (Figure 2.5).

65

C.b. Fluoro-
staining graphy

 

 

Figure 2.4

Detection of salt extracted nuclear proteins modified by terminal GlcNAc using in vitro
GalTF labeling assay.

Nuclear proteins were treated with DNase I and solubilized with 0.5 M NaCl. Equal
amounts of solubilized proteins (30 pg) were incubated in the presence or absence of
GalTF with UDP—FH]galactose. Radiolabeled proteins were visualized by fluorography
for 12 hrs. Labeling in the absence of the GalTF: (1) Coomassie-Blue stained gel, (3)
fluorography. Labeling in the presence of the GalTF: (2) Coomassie-Blue stained gel,
(4) fluorography. Mass standards are indicated in kilodalton (kD).

66

Figure 2.5

Detection of salt extracted nuclear proteins modified by terminal GlcNAc using GalTF
labeling assays and WGA blot assay.

Nuclear proteins were solubilized as described in (A) and treated as follows.

(1) Proteins were subjected to in vitro GalTF labeling assay (as in 1.4).

(2) 0n blot GalTF labeling assay on protein mass standards. Proteins were immobilized
on Immobilon—P membranes. One half of the lane was subjected to an blot GalTF
labeling assay in the presence of GalTF and then visualized by fluorography for 43
hours. The other half of the lane was subjected to an blot GalT F labeling assay in the
absence of GalTF; no labeling of ovalbumin was observed (data not shown).
Ovalbumin (which runs as a doublet on SDS-PAGE; positive control), 45 kD; bovine
serum albumin (negative control), 66.2 kD.

(3) 0n blot GalTF labeling assay on salt extracted nuclear proteins. Solubilized proteins
of 2 x 10° nuclei were treated as described in (2). The entire lane was subjected to the
an blot GalTF labeling assay in the presence of GalTF and visualized as in (2).

(4) WGA blot analysis of salt extracted nuclear proteins. Solubilized proteins [equal
amount as in (3)] were subjected to protein blot analysis and detected by WGA-HRP
using chemiluminescence.

Arrowheads indicate proteins detected by both, an blot GalTF labeling assay and WGA
blot analysis. Proteins were resolved by 7.5% SDS-PAGE. Mass standards (kD) are
as indicated.

67

 

 

 

inflfloonmm WGA
GalTF GalTF -HRP
s IMI s s
200.0— <

 

A M“

A

A

68

Under these conditions, [3H]galactose was incorporated after immobilization of proteins
on the blot, thus the apparent mass of the radiolabeled proteins did not change. Proteins
present in the mass standards served as positive and negative controls for the an blot
GalTF labeling assay (Figure 2.5, lane 2). Ovalbumin is a 45 kD protein modified by
N-linked terminal GlcNAc moieties and functioned as a positive control (see also Holt
and Hart, 1986, Hanover et al., 1987). Bovine serum albumin (BSA; 66.2 kD) is not
modified by terminal GlcNAc and served as a negative control. The pattern of the
galactosylation products using the an blot GalTF labeling assay (Figure 2.5, lane 3) was
similar to that of the in vitro GalTF labeling assay (Figure 2.5, lane 1). These results
demonstrate that the an blot GalTF labeling assay is an easy and fast method to detect
proteins modified by terminal GlcNAc. More importantly, it allowed a direct
comparison of proteins containing terminal GlcNAc (Figure 2.5, lanes 3) with the
glycoproteins detected by the WGA blot analysis (Figure 2.5, lane 4). The majority of
the proteins were detected by both methods but with different intensities (marked with
arrows). The glycoproteins with a lower apparent mass (approximately 20 to 30 kD)
and detected by the WGA probes were also labeled in the an blot GalTF assay,
although some with low intensity (data not shown). These correlative studies indicate
that the majority of the nuclear proteins detected by WGA are modified by terminal
GlcNAc, and some of these proteins with terminal GlcNAc are likely to be NPC

proteins .

69

Salt extracted nuclear proteins are modified by oligosaccharides with
terminal GlcNAc

The terminal GlcNAc detected on the nuclear proteins could be attached via the
hydroxyl group of a serine, threonine, tyrosine, or hydroxyproline (O-linked) or via the
amido group of an asparagine (N-linked). To examine these alternatives, nuclear
proteins extracted with the HS buffer were used for the subsequent sugar analysis
because of the following reasons. Seven of eight glycoproteins were present in the
solubilized fraction, even though their extraction was not complete. In addition, the
protein sample has to be fully solubilized and of an ionic strength of less than 0.2 M
as an requirement for subsequent in vitro GalTF labeling assay (Roquemore et al.,
1994). The extracted proteins were radiolabeled in the in vitro GalTF labeling assay,
and the protein sample was divided into equal aliquots and subjected to the following
treatments. One aliquot was digested with peptidezN-glycosidase F (PNGase F; Figure
2.6A; filled squares), an enzyme that releases the common classes of N-linked glycans
(Tarentino et al., 1985). The second aliquot was treated similarly except without
PNGase F (Figure 2.6A; open squares) to control for proteolysis during the PNGase
F experiment. The elution profile of these samples over a Sephadex G-50 column were
identical indicating that virtually no radioactivity associated with the proteins was
removed by the PNGase F (Figure 2.6A). Parallel experiments using [3H]galactose-
labeled ovalbumin, a protein containing N -linked terminal GlcNAc, were performed as
a positive control for PNGase F activity. The PNGase F removed 75% of the

radioactivity associated with PH]galactose-labeled ovalbumin (data not shown).

70

Figure 2.6

Characterization of carbohydrates with terminal GlcNAc on salt extracted nuclear
glycoproteins.

(A) Carbohydrate linkages were resistant to PNGase F. Salt extracted, [3H]galactose—
labeled nuclear proteins (5 x 105 DPM) were incubated with (filled squares) or without
(open squares) PNGase F and fractionated over a Sephadex G-50 column. 0.5% of
fractions were assayed for radioactivity by liquid scintillation counting.

(B) Plant protein samples did not inhibit PNGase F activity. A 1:1 ratio (by
radioactivity) of [3H]galactose-labeled ovalbumin and [3H]galactose-labeled nuclear
proteins was incubated with (filled squares) or without (open squares) PNGase F , and
the products were analyzed as in (A).

(C) B-elimination released saccharides from PNGase F resistant glycoproteins. PNGase
F resistant labeled nuclear proteins [fractions 8-13 from (A)] were pooled and
subjected to alkaline induced B-elimination. Products were fractionated over a
Sephadex G-50 column. One percent of fractions were assayed for radioactivity.

(D) Saccharides released from glycoproteins by B-elimination were larger than five
GlcNAc residues. Released labeled saccharides [fractions 14-23 from (D)] were pooled
and fractionated on a Toyopearl HW 40 column. Five percent of fractions were
assayed for radioactivity.

Numbers above solid triangles represent migration positions of oligosaccharide
standards: 2=Gal—GlcNAcitol, 3=Gal-(GlcNAc)-GlcNAcitol, 4=Gal-(GlcNAc)2-
GlcNAcitol, 5 = Gal-(GlcNAc)3-GlcNAcitol.

Vo, void volume; Vi, inclusion volume; DPM, disintegration per minute; Kav, volume
fraction (Ve-Vo/Vi-Vo); Ve, elution volume.

71

 

 

        

 

 

 

 

 

 

 

 

 

 

 

     

 

 

Vo V'
1000- v v'
750‘ j
E .
250‘ I
. _ 0.. .l-II!I.=I:=:=-.-I
051015202530 051015202530
Fraction (ml) Fraction (ml)
400
Vol Vi
400- V v
300-
300-
E E
“a" 200- B 200'
100- 100-
0 . . . . o .
0 5 10 15 20 25 30 0 0.2 0.4 0.6 0.8 1.0

Fraction (ml) Kav

72

Furthermore, PNGase F activity was not inhibited by any component in the plant
sample because the enzyme released 32% of radioactivity associated with a 50:50
mixture (by radioactivity) of [’Iflgalactose-labeled ovalbumin and salt extracted nuclear
proteins (4B; filled squares). This value was consistent with a 64% cleavage of the
ovalbumin glycans in this control group.

O-glycosidic linkages are sensitive to alkaline induced B-elimination (Spiro,
1972). Radiolabeled proteins resistant to PNGase F treatment (Figure 2.6A) were
subjected to alkaline borohydride to release O—linked sugars from the proteins (Figure
2.6C). Approximately 80% of the [3H]galactose-labeled sugars were released from the
nuclear proteins as judged by Sephadex G-50 chromatography (Figure 2.6C, fractions
14-23). Twenty percent of the radioactivity remained in the void volume (Figure 2.6C;
Vo), indicating that these labeled sugars were on large polysaccharides or still
associated with the proteins. These labeled sugars may belong to a small group of plant
N -glycans that appear to be resistant to PNGaseF treatment (Tretter et al., 1991). The
same profile of B-eliminated sugars was observed, whether the samples were subjected
to B-elimination with or without prior digestion with PNGase F. These results indicate
that at least 80% of the [3H]galactose—labeled sugars are attached to the salt extractable
proteins via an O-linkage.

To determine the size of these labeled glycans, B-eliminated sugars (Figure
2.6C, fractions 14-23) were fractionated on a Toyopearl HW 40 size exclusion column
(Figure 2.6D). Oligosaccharide standards composed of Gal-GlcNAc“, were used as an
assessment of size (but not as an indication of structure). The radiolabeled sugars

migrated at a position larger than five saccharides consisting of Gal-GlcNAc,-

73

GlcNAcitol. None of the radioactivity comigrated with the disaccharide Gal-GlcNAcitol
as would be expected, if the sugars were a single O—GlcNAc modification typical of
vertebrate NPC proteins. The elution profile appeared to consist of more than one peak,
suggesting the presence of multiple size populations of PH]galactose-labeled
oligosaccharides. Forty percent of these labeled oligosaccharides adsorbed to a Sep—Pak
(C18) cartridge indicating the presence of a hydrophobic group (data not shown). The
remaining 60% were not retained on the column and were resistant to pronase digestion
and dansylation indicating the absence of peptides or primary amines (data not shown).
These results are consistent with these labeled oligosaccharides being associated to the
nuclear glycoproteins via an O-linkage. (The carbohydrate linkage and size analyses
were performed in collaboration with Dr. Robert N. Cole in laboratory of Dr. Gerald

W. Hart, University of Alabama at Brimingham, AL).

Overall, these studies indicate that the proteins extracted by high salt from
tobacco nuclei are modified by oligosaccharides larger in size than five GlcNAcs
including the terminal GlcNAc. Most of these are bound to the proteins via an O-
linkage. Fractionation and EM data indicate that at least some of these glycoproteins

are located at the NPC.

74
DISCUSSION

We have identified and characterized a subset of nuclear proteins from tobacco
suspension-cultured cells that contain novel carbohydrate modifications. Probing isolated
nuclei with WGA revealed the presence of GlcNAc-containing proteins that are
associated with the rings or central structures of plant NPCs. Seven of eight
glycoproteins detected by WGA are partially extracted by 0.5 M salt, and the majority
of these glycoproteins are modified by terminal GlcNAc(s) as shown in GalTF labeling
assays. Carbohydrate analysis demonstrates that the glycans with terminal GlcNAc
consist of sugars that are larger in size than five GlcNAcs, and most of these

oligosaccharides appear to be attached to the proteins via an O-linkage.

Proteins modified by GlcNAc are located at the NPC

In vertebrates, WGA is a potent inhibitor of protein import into the nucleus
(Finlay et al. , 1987; for review see Forbes, 1992). This lectin binds to the single 0-
GlcNAc present on several NPC proteins and was successfully used to identify and
purify some of these NPC glycoproteins (Finlay et al., 1991; Hallberg et al., 1993;
Sukegawa and Blobel, 1993; Kita et al., 1993; Powers et al., 1995; Radu et al.,
1995b). Interestingly, WGA does not appear to bind to yeast NPCs (Davis and Fink,
1990; Carmo—Fonseca et al., 1991; Rout and Blobel, 1993) and so far, none of the
identified NPC proteins in yeast have been shown to be modified by O—GlcNAc. In
plants, the nature of sugar modification on NPC proteins is unknown.

Using isolated nuclei from tobacco cells, several nuclear proteins were detected

by WGA. At least some of these nuclear glycoproteins are probably NPC proteins by

75

the following criteria: a) the WGA labeling was associated with or adjacent to the N PC
with little binding to other structural components of the nucleus, b) the proteins detected
by WGA were enriched in the nuclear fraction, but were not detectable in the
cytoplasmic fraction (A. Heese-Peck, N.V. Raikhel; unpublished results), and c) the
plant nuclear glycoproteins were solubilized under the same salt conditions and with a
similar efficiency as the O-GlcNAc NPC proteins from vertebrate nuclei (Davis and
Blobel, 1986; Snow et al., 1987).

Based on EM using WGA as a probe, the plant NPC glycoproteins were mainly
found at the rings and the center of the NPCs. As apparent in longitudinal sections,
these glycoproteins appeared tobe present at the cytoplasmic and, though in lower
amounts, the nucleoplasmic side of the NPCs. Using a similar embedding/thin
sectioning preparation, WGA labels the cytoplasmic and the nucleoplasmic center of rat
NPCs (Hanover et al., 1987) and almost exclusively the cytoplasmic center of Xenapus
oocyte NPCs (Finlay et al. , 1991). Quick freezing/ freeze drying/rotary metal shadowing
of Xenapus oocyte nuclei showed WGA labeling at the terminal ring of the nuclear
baskets as well as the center and inner annulus of the cytoplasmic face (Panté et al.,
1994). Two O-GlcNAc proteins, Nup153p and Nup98p, are constituents of
nucleoplasmic filaments and the terminal ring of the nucleoplasmic baskets (Cordes et
al., 1993; Panté et al., 1994). Further, a putative O-GlcNAc protein, p250, has been
localized to the cytoplasmic filaments of the NPC using a polyclonal antibody (Panté
et al., 1994) and may correspond to the rat Nup214p/CAN protein (Kraemer et al.,
1994). It is possible that several of the plant glycoproteins are homologs of these

vertebrate NPC proteins, although the apparent mass of the plant proteins are different

76
from these O-GlcNAc NPC proteins. The mass of the 55 kD plant GlcNAc-protein (60

kD after [3H]galactose incorporation) raises the possibility that it may be the plant
homolog of the vertebrate p62. The p62 is found in multiple copies on the cyto- and/ or
the nucleoplasmic faces of the central NPC regions (Davis and Blobel, 1986;
Dabauvalle et al., 1990; Cordes et al., 1991; Wilken et al., 1993). However, a
monoclonal antibody against the rat p62 (mAb414; Davis and Blobel, 1986) did not
detect plant NPC proteins of similar mass (A. Heese-Peck, N .V. Raikhel; unpublished
results). In fact, mAb414 recognized an antigen associated with tobacco chromatin, but
not with the NPC (A. Heese-Peck, O.N. Borkhsenious, N.V. Raikhel; unpublished
results). This monoclonal antibody has also been shown to detect NPC as well as non—
NPC proteins in yeast (Aris and Blobel, 1989; Davis and Fink, 1990). A study in
higher plants reported the detection of a 100 kD protein by mAb414 in nuclear matrix
fractions of carrot suspension-cultured cells after extensive extraction with 1 M salt
(Scofield et al., 1992), however, no EM data using mAb414 were provided. We
investigated whether other antibodies against known NPC proteins recognized plant
nuclear proteins and specifically the nuclear proteins modified by terminal GlcNAc.
However, no specific labeling of the tobacco NPC was observed on EM level (A.

Heese-Peck, O.N. Borkhsenious, N.V. Raikhel; unpublished results).

Vertebrate
NPC-Proteins

”Ser M Ser~

0 O
| I
GlcNAc GlcNAc
b O-linkage

> monosaccharide
> terminal GlcNAc

Figure 2.7

Plant
NPC-Proteins

w ? M ? ~

I l
o o
I |
X55) X55)

GlcNAc GlcNAc

b O-linkage

> oligosaccharide
(larger than 5 GlcNAcs)

b terminal GlcNAc

Comparison of O-GlcNAc from vertebrate NPC proteins and O-linked oligosaccharides
with terminal GlcNAc from plant nuclear and NPC proteins.
?, unknown amino acid (probably serine, threonine or hydroxyproline); X, unknown

saccharides (in size 2 5 GlcNAcs).

7 8
Oligosaccharides with terminal GlcN Ac

We demonstrated that the 0.5 M salt extracted nuclear proteins from tobacco
contain a novel sugar modification that is different from the O-GlcNAc modification
found on vertebrate NPC proteins (Figure 2.7). The vertebrate NPC proteins are
solubilized under similar salt conditions and are modified by single O-GlcNAc(s)
attached to the proteins via an O-linkage (Holt et al. , 1987; Hanover et al., 1987).
Sugar analysis indicates that the salt extractable plant nuclear proteins are modified by
oligosaccharides consisting of saccharides larger in size than five GlcNAcs, and most
of these oligosaccharides are also attached to the proteins via an O-linkage. At least two
size populations of oligosaccharides possessing terminal GlcNAc were attached to the
nuclear proteins. At present, it is not known whether these oligosaccharides share a
common core structure. To perform such detailed carbohydrate analysis, the purification
of individual proteins in large quantities are required and will be pursued in the future.
Thus, probing plant nuclear proteins with the GalTF indicates that the single O-GlcN Ac
modification present on vertebrate NPC proteins is not found on salt extracted nuclear
proteins from plants.

We can only speculate about the function of the oligosaccharides on plant NPC
proteins. The O-linked oligosaccharides may have similar function(s) as proposed for
the O-GlcNAc found in vertebrate NPC proteins. These include the assembly of
multimeric protein complexes, resistance to proteolysis, and regulation of protein
function (Hart et al., 1989; Haltiwanger et al., 1992). In addition, the O-GlcNAc
modification of vertebrate NPC proteins has been proposed to function in

nucleocytoplasmic transport because WGA inhibits transport of protein and RNA by

79
binding to O-GlcNAc (Finlay et al., 1987; Yoneda et al., 1987; Dabauvalle et al.,

1988; Featherstone et al., 1988; Newmeyer and Forbes, 1988; Wolff et al., 1988).
Interestingly, Miller and Hanover (1994) have shown in reconstitution assays that NPC
proteins that are altered by the addition of galactose to O-GlcN Ac residues are still able
to form NPCs. These NPCs are morphologically normal and are competent to import
proteins into the nucleus. Thus, it has been suggested that a specific recognition of the
GlcNAc moiety may not play a direct role in nuclear protein import and in NPC
assembly. This implies that the protein portion rather than the carbohydrate moiety of
these glycoproteins may function in nuclear import. Furthermore, yeast nuclei are able
to import proteins, although the NPC proteins do not appear to be modified by O—
GlcNAc. In plants, Harter et al. (1994) reported that the nuclear import of endogenous
G-box binding factors (GBFs) is inhibited in the presence of WGA in permeabilized
parsley cells. In these studies, imported GBFs are detected by an antibody
cotranslocation assay that is indirect and is based on the detection of protease resistant
GBF antibody which is associated with the nuclei. An in vitro import system was
developed in our laboratory in which the accumulation of import substrate is visualized
by immunofluorescence. Using this import assay, WGA (0.7 mg/mL) does not block
nuclear import in vitro (Hicks and Raikhel, 1995b; G.R. Hicks, S. Lobreaux, N.V.
Raikhel; unpublished results). However, as demonstrated in the current study proteins
at the plant NPC were modified by GlcNAc. These NPC proteins appeared to be
modified by carbohydrates that are larger than the single O-GlcN Ac of vertebrate NPC
proteins. The larger carbohydrate moieties may extend further away from the NPC

center, so that the binding of WGA to the GlcNAc does not hinder protein import into

80

the plant nucleus, though import of larger substrate such as immunoglobin (Harter et
al. , 1994) could be affected. Although the carbohydrates with terminal GlcNAc do not
appear to be involved in nuclear import, it cannot be excluded that the proteins
themselves may play a role in the import process. At this point, the significance of the
GlcNAc modification is not understood in any system studied. However, this
modification has been proven to be a useful tool to identify and isolate NPC proteins
that are involved in nucleocytoplasmic transport.

The oligosaccharides with terminal GlcN Ac may also aid in purification of the
plant NPC glyc0proteins. Preliminary results indicate that several of the plant
glycoproteins can be purified by lectin affinity chromatography. The purification of the
glycoproteins will enable us to produce specific antibodies and to localize the
glycoproteins in situ. We will also investigate whether any of the plant NLS-binding
proteins that may be localized to the plant NPC (Hicks and Raikhel, 1993; 1995a)

correspond to one of the glycoproteins identified in this study.

8 1
REFERENCES

Aaronson,R.P. and Blobel,G. (1974) The attachment of the nuclear pore complex. J.
Cell Biol. 62, 746-754.

Akey,C.W. (1992). The nuclear pore complex. Curr. Opin. Struct. Biol. 2, 258-263.

Akey,C.W., and Rademacher,M. (1993). Architecture of the Xenapus nuclear pore

complex revealed by three-dimensional cryo-electron microscopy. J. Cell Biol. 122, 1-
19.

Aris,J.P., and Blobel,G. (1989). Yeast nuclear envelope proteins cross react with an
antibody against mammalian pore complex proteins. J. Cell Biol. 108, 2059—2067.

Bednarek,S.Y., Wilkins,T.A., Dombrowski,J.E., and Raikhel,N.V. (1990). A
carboxyl-terminal propeptide is necessary for proper sorting of barley lectin to vacuoles
of tobacco. Plant Cell 2, 1145-1155.

Carmo-Fonseca,M., Kern,H., and Hurt,E.C. (1991). Human nucleoporin p62 and
essential yeast nuclear pore protein NSPl show sequence homology and a similar
domain organization. Eur. J. Cell Biol. 55, 17-30.

Cordes,V.I., and Krohne,G. (1993). Sequential O-glycosylation of nuclear pore
complex protein p62 in vitro. Eur. J. Cell Biol. 60, 185-195.

Cordes,V., Reidenbach,S., Kiihler,A., Stuurmann,N., van Driel,R., and
Franke,W.W. (1993). Intranuclear filaments containing a nuclear pore complex
protein. J. Cell Biol. 123, 1333-1344.

Cordes,V.I., Waizenegger,l., and Krohne,G. (1991). Nuclear pore complex
glycoprotein p62 from Xenapus laevis and mouse: cDN A cloning and identification of
its glycosylation region. Eur. J. Cell Biol. 55, 31-47.

Corfield,A.P., and Schauer,R. (1982). Occurrence of sialic acids. In Schauer,R. (ed.)
Sialic acid: Chemistry, Metabolism and Function, Springer-Verlag, New York, Vol. 10,
pp. 1-50.

Dabauvalle,M.-C., Benevente,R., and Chaly,N. (1988). Monoclonal antibodies to a
Mr 68,000 pore complex glycoprotein interfere with nuclear protein uptake in Xenapus
oocytes. Chromosoma 97 , 193—197.

Dabauvalle,M.-C., Loos,K., and Scheer,U. (1990). Identification of a soluble
precursor complex essential for nuclear pore assembly in vitro. Chromosoma 100, 56-
66.

 

82

Davis,L.I., and Blobel,G. (1986). Identification and characterization of a nuclear pore
complex protein. Cell 45, 699-709.

Davis,L.I., and Fink,G.R. (1990). The NUPl gene encodes an essential component
of the yeast nuclear pore complex. Cell 61, 965-978.

Dubois,M., Gilles,K.A., Hamilton,J.K., Rebers,P.A., and Smith,F. (1956).
Colorimetric method for determination of sugars and related substances. Anal. Chem.
28, 350-356.

Ebisu,S., Lonngren,J., and Goldstein,I.J. (1977). Interaction of pneumococcal S 14
polysaccharides with lectins from Ricinus communis, T riticum vulgares, and Bandeiraea
simplicifalia. Carbohydrate Res. 58, 187-191.

Fabre,E., and Hurt,E.C. (1994). Nuclear transport. Curr. Opin. Cell Biol. 6, 335-
342.

Featherstone,C., Darby,M.K., and Gerace,L. (1988). A monoclonal antibody against
the nuclear pore complex inhibits nucleocytoplasmic transport of protein and RNA in
vivo. J. Cell Biol. 107, 1289-1297.

Feldherr,C.M., Kallenbach,E., and Schultz,N. (1984). Movement of a karyOphilic
protein through the nuclear pores of oocytes. J. Cell Biol. 99, 2216-2222.

Finlay,D.R., Newmeyer,D.D., Price,T.M., and Forbes,D.J. (1987). Inhibition of in
vitro nuclear transport by a lectin that binds to nuclear pores. J. Cell Biol. 104, 189-
200.

Finlay,D.R., Meier,E., Bradley,P., Horecka,J., and Forbes,D.J. (1991). A complex
of nuclear pore proteins required for pore function. J. Cell Biol. 114, 169-183.

Finlay,D.R., and Forbes,D.J. (1990). Reconstitution of biochemically altered nuclear
pores: Transport can be eliminated and restored. Cell 60, 17-29.

Forbes,D.J. (1992). Structure and function of the nuclear pore complex. Annu. Rev.
Cell Biol. 8, 495-527.

Fukuda,M. (1989). Characterization of O-linked saccharides from cell surface
glycoproteins. Methods in Enzymology 179, 17-29.

Goldberg,M.W., and Allen,T.D. (1992). High resolution scanning electron
microscopy of the nuclear envelope: demonstration of a new, regular, fibrous lattice

attached to the baskets of the nucleoplasmic face of the nuclear pores. J. Cell Biol. 119,
1429-1440.

83

Goldstein,I.J., and Hayes,C.E. (1978). The lectins: Carbohydrate-binding proteins of
plants and animals. Adv. Carbohydr. Chem. Biochem. 35, 120-340.

Hallberg,E., Wozniak,R.W., and Blobel,G. (1993). An integral membrane protein
of the pore membrane domain of the nuclear envelope contains a nucleoporin-like
region. J. Cell Biol. 122, 513-521.

Haltiwanger,R.S. , Kelly,W.G., Roquemore,E.P. , Blomberg,M.A., Dong,L.-Y.D. ,

Kreppel,L., Chou,T.-Y., and Hart,G.W. (1992). Glycosylation of nuclear and
cytoplasmic proteins is ubiquitous and dynamic. Biochem. Soc. Transaction 20: 264-69.

Hanover,J.A., Cohen,C.K., Willingham,M.C., and Park,M.K. (1987). 0-linked N-
acetylglucosamine is attached to proteins of the nuclear pore. J. Biol. Chem. 262, 9887-
9894.

Harlow,E., and Lane,D. (1988). Antibodies: A Laboratory Manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.

Hart,G.W., Haltiwanger,R.S., Holt,G.D., and Kelly,W.G. (1989). Glycosylation
in the nucleus and cytoplasm. Annu. Rev. Biochem. 58, 841-874.

Harter,K., Kircher,S., Frohnmeyer,H., Krenz,M., Nagy,F., and Schiifer,E.
(1994). Light-regulated modification and nuclear translocation of cytosolic G-box
binding factors in parsley. Plant Cell 6, 545—559.

Hicks,G.R., and Raikhel,N.V. (1993). Specific binding of nuclear localization
sequences to plant nuclei. Plant Cell 5, 983-994.

Hicks,G.R., and Raikhel,N.V. (1995a). Nuclear localization signal binding proteins
in higher plant nuclei. Proc. Natl. Acad. Sci. USA 92, 734-738.

Hicks,G.R., and Raikhel,N.V. (1995b). Protein import into the nucleus: an integrated
view. Annu. Rev. Cell Biol. 11, in press.

Hicks,G.R., Smith,H.M.S., Shieh,M., and Raikhel,N.V. (1995). Three classes of
nuclear import signals bind to plant nuclei. Plant Physiol., 107, 1055-1058.

Hinshaw,J.E., Carragher,B.O., and Milligan,R.A. (1992). Architecture and design
of the nuclear pore complex. Cell 69, 1133-1141.

Holt,G.D., and Hart,G.W. (1986). The subcellular distribution of terminal N-
acetylglucosamine moieties. J. Cell Biol. 261, 8049-8057.

84

Holt,G.D., Snow,C.M., Senior,A., Haltiwanger,R.S., Gerace,L., and Hart,G.W.
(1987). Nuclear pore complex glycoproteins contain cytoplasmically disposed O-linked
N-acetylglucosamine. J. Cell Biol. 104, 1157-1164.

Hurt,E.C. (1988). A novel nucleoskeletal-like protein located at the nuclear periphery
is required for the life cycle of Saccharamyces cerevisiae. EMBO J. 7, 323-4334.

Jordan,E.G., Timmis,J.N., and Trewavas,A.J. (1980). The plant nucleus. In
Tolbert,N.E. (ed.), The Biochemistry of Plants, Acad.Press, Inc., Vol. 1, 490-588.

Kalinich,J.F., and Douglas,M.G. (1989). in vitro translocation through the yeast
nuclear envelope: signal dependent transport requires ATP and calcium. J. Cell Biol.
264, 17979-17989.

Kaneda,N., Sato,M., and Yagi,K. (1982). Analysis of danyl amino acids by reverse-
phase high performance liquid chromatography. Anal. Biochem. 127, 49-54.

Kita,K., Omata,S., and Horigome,T. (1993). Purification and characterization of a
nuclear pore glycoprotein complex containing p62. J. Biochem. 113, 377-382.

Kraemer,D., Wozniak,R.W., Blobel,G., and Radu,A. (1994). The human CAN
protein, a putative oncogene product associated with myloid leukemogenesis, is a

nuclear pore complex protein that faces the cytoplasm. Proc. Natl. Acad. Sci. USA 91,
1519-1523.

Laemmli,U.K. (1970). Cleavage of structural proteins during assembly of the head of
bacteriophage T4. Nature (Land) 227, 680-685.

Miller,M.W., and Hanover,J.A. (1994). Functional nuclear pores reconstituted with
B-1,4 galactose-modified 0-linked N-acetylglucosamine glycoproteins. J. Biol. Chem.
269, 9289-9297.

Newmeyer,D.D., and Forbes,D.J. (1988). Nuclear import can be separated into
distinct steps in vitro: Nuclear pore binding and translocation. Cell 52, 641-653.

Panté,N., and Aebi,U. (1993). The nuclear pore complex. J. Cell Biol. 122, 977-984.

Panté,N., Bastos,R., McMorrow,l., Burke,B., and Aebi,U. (1994). Interactions and
three-dimensional localization of a group of nuclear pore complex proteins. J. Cell Biol.
126, 603-617.

Park,M.K., D’Onofrio,M., Willingham,M.C., and Hanover,J.A. (1987). A
monoclonal antibody against a family of nuclear pore proteins (nucleoporins): O-linked
acetylglucosamine is part of the immunodeterminant. Proc. Natl. Acad. Sci. USA 84,
462-6466.

 

85

Powers,M.A., Macaulay,C., Masiarz,F.R., and Forbes,D.F. (1995). Reconstituted
nuclei depleted of a vertebrate GLFG nuclear pore complex protein, p97, import but
are defective in nuclear growth and replication. J. Cell Biol. 128, 721-736.

Radu,A., Blobel,G., and Moore,M.S. (1995a). Identification of a protein complex
that is required for nuclear protein import and mediates docking of import substrate to
distinct nucleoporins. Proc. Natl. Acad. Sci. USA 92, 1769-1773.

Radu,A., Moore,M.S., and Blobel,G. (1995b). The peptide repeat domain of
nucleoporin Nup98 functions as a docking site in transport across the nuclear pore
complex. Cell 81, 215-222.

Raikhel,N.V. (1992). Nuclear targeting in plants. Plant Physiol. 100, 1627-1632.

Reichelt,R., Holzenburg,A., Buhle,E.L., Jarnik,M., Engel,A., and Aebi,U. (1990).
Correlation between structure and mass distribution of the nuclear pore complex, and
of distinct pore complex components. J. Cell Biol. 110, 883-894.

Roberts,K., and Northcote,D.H. (1970). Structure of the nuclear pore in higher
plants. Nature 228, 385-386.

Roquemore,E.P., Chou,T.-Y., and Hart,G.W. (1994). Detection of O-linked N-
acetylglucosamine (O-GlcNAc) on cytoplasmic and nuclear proteins. Methods in
Enzymology 230, 443-460.

Rout,M.P., and Blobel,G. (1993). Isolation of the yeast nuclear pore complex. J. Cell
Biol. 123, 771-783.

Rout,M.P., and Wente,S.R. (1994). Pores for thought: nuclear pore complex proteins.
TICB 4, 357-365.

Saxena,P.K., Fowke,L.C., and King,J. (1985). An efficient procedure for isolation
of nuclei from plant protoplasts. Protoplasma 128, 184-189.

Schindler,M., Hogan,M., Miller,M., and DeGaetan0,D. (1987). A nuclear specific
glycoprotein representative of a unique pattern of glycosylation. J. Biol. Chem. 262,
254-1260.

Scofield,G.N., Beven,A.F., Shaw,P.J., and Doonan,J.H. (1992). Identification and
localization of a nucleoporin-like protein component of the plant nuclear matrix. Planta
187, 414-420.

Snow,C.M., Senior,A., and Gerace,L. (1987). Monoclonal antibodies identify a group
of nuclear pore complex glycoproteins. J. Cell Biol. 104, 1143-1156.

86

Spiro,R.G. (1972). Study of the carbohydrates of glycoproteins. Methods in
Enzymology 28, 3-43.

Starr,C.M., D’Onofrio,M., Park,M.K., and Hanover,J.A. (1990). Glycosylation of
nuclear pore protein p62. J. Biol. Chem. 265, 6868-6873.

Sterne-Marr,R., Blevitt,J.M., and Gerace,L. (1992). O-linked glycoproteins of the
nuclear pore complex interact with a cytosolic factor required for nuclear protein
import. J. Cell Biol. 116, 271-280.

Sukegawa,J. , and Blobel,G. (1993). A nuclear pore complex protein that contains zinc
finger motifs, binds DNA, and faces the nucleoplasm. Cell 72, 29-38.

Tapuhi,Y., Schmidt,D.E., Lindner,W., and Karger,B.L. (1981). Dansylation of
amino acids for high-performance liquid chromatography analysis. Anal. Biochem. 115,
123-129.

Tarentino,A.L., G6mez,C.M., and Plummer Jr.,T.H. (1985). Deglycosylation of
asparagine-linked glycans by peptide:N-Glycosidase F. Biochem. 24, 4665-4671.

Tretter,V., Altmann,F., and Marz,L. (1991). Peptide-N 4-(N-acetyl-B-glucosaminyl)
asparagine amidase F cannot release glycans attached to oz1-3 to the asparagine—linked
N—acetylglucosamine residue. Eur. J. Biochem. 199, 647-652.

Whiteheart,S.W., Passaniti,A., Reichner,J.S., Holt,G.D., Haltiwanger,R.S., and
Hart,G.W. (1989). Glycosyltransferase probes. Methods in Enzymology 179, 82-95.

Wilken,N., Kossner,U., Senécal,J.-L., Scheer,U., and Dabauvalle,M.-C. (1993).
Nup180, a novel nuclear pore complex protein localizing to the cytoplasmic ring and
associated fibrils. J. Cell Biol. 123, 1345-1354.

Willmitzer,L., and Wagner,K.G. (1981). The isolation of nuclei from tissue-cultured
plant cells. Exp. Cell Res. 135, 69-77.

Wolff,B., Willingham,M.C., and Hanover,J.A. (1988). Nuclear protein import:
Specificity for transport across the nuclear pore. Exp. Cell Res. 178, 318-334.

Yoneda,Y., Imamoto-Sonobe,N., Yamaizumi,M., and Uchida,T. (1987). Reversible
inhibition of protein import into the nucleus by wheat germ agglutinin injected into
cultured cells. Exp. Cell Res. 173, 586-595.

Chapter 3

Purification of nuclear glycoproteins modified with

terminal N—acetylglucosamine by lectin affinity chromatography

87

88
ABSTRACT

The nuclear pore complex (NPC) is the site of transport of macromolecules in
and out of the nucleus. It has been previously demonstrated that several glycoproteins
are present at the NPC of tobacco suspension—cultured cells that are modified with
terminal N—acetylglucosamine (GlcNAc) residues. In the current studies, we designed
a purification scheme to isolate these glycoproteins on the basis of their sugar
modification. In vitro galactosylation of the glycoproteins generated proteins with
terminal galactosyl—Bl ,4-GlcNAc, thus permitting their isolation by Erythrina crystagalli
agglutinin affinity chromatography. Peptide sequence information was obtained from
three of these GlcNAc-proteins with apparent molecular masses of ~33 kD, ~40 kD,

and ~65 kD, named gp33, gp40, and gp65, respectively.

 

89
INTRODUCTION

Molecules, such as proteins, different RNA species, T-DNA and ions, move in
and out of the nucleus through nuclear pore complexes (NPCs) that form aqueous
channels across the N E (Davis, 1995). The overall morphology of NPCs appears to be
highly conserved in different organisms, and its architecture has been extensively
investigated in amphibian cells using electron microscopy (Panté and Aebi, 1993;
Goldberg and Allen, 1995; see Chapter 1).

The little information we have on plant NPCs has come from microscopic and
biochemical analyses (for a review, see Jordan et al., 1980; Chapter 1 and 2). Using
wheat germ agglutinin (WGA), a lectin that binds specifically to N—acetylglucosamine
(GlcNAc), as a probe, proteins modified by GlcNAc have been found at the plant
nuclear periphery (Heese-Peck et al., 1995; Hicks 61‘ al., 1996; Merkle et al., 1996).
As shown by electron microscopy (EM) and biochemical analyses, at least some of
these glycoproteins are located at the NPC of tobacco suspension-cultured cells and are
modified by terminal GlcNAc (Chapter 2; Heese-Peck et al., 1995). Most glycans with
terminal GlcNAc are attached to the proteins via an O-linkage and are larger in size
than five GlcNAc residues (Chapter 2; Heese—Peck et al., 1995). Thus, this plant sugar
modification is different from the single O-linked GlcNAc (O-GlcNAc) found in
vertebrate NPC proteins (for review, see Hicks and Raikhel, 1995; Hart, 1997).

Although the function of the O-GlcNAc modification is not fully understood
(Miller and Hanover, 1994), the glycosylation has provided a useful tool in purifying
vertebrate NPC proteins and studying their function in nucleocytoplasmic transport and

NPC assembly (for reviews, see Forbes, 1992; Davis, 1995; Hicks and Raikhel, 1995).

90

We were interested in isolating tobacco NPC proteins modified by O-linked
oligosaccharides with terminal GlcNAc, which will be referred to as tGlcNAc-proteins
throughout this manuscript. In the current studies, a purification scheme was established
to obtain large quantities of the tGlcNAc-proteins by lectin affinity chromatography.
Tryptic digestion and subsequent internal amino acid analysis generated peptide
sequence information for three tGlcNAc-proteins with apparent molecular masses of
~33 kD, ~40 kD, and ~65 kD, named gp33, gp40, and gp65, respectively. Peptide

sequence similarity to known proteins are discussed.

 

9 1
NIETHODS

Nuclear Protein Isolation

Nuclei were isolated in the presence of 0.6% Triton X-100 from 6-7-day Nicotiana
tabacum suspension-cultured cells, as described in Chapter 2 (Heese-Peck et al. , 1995)
with the following modifications. Protoplasts were incubated in nuclear isolation buffer
(NIB) plus 0.01% Triton X-100 (Boehringer Mannheim) for 10 min, lysed and
centrifuged for 5 min onto a cushion of 50% Percoll in NIB at 1000xg. The dense
yellow—brown band on top of the Percoll cushion was designated the crude nuclear
fraction and the clear yellowish fraction overlaying the band was designated the cytosol
I fraction. Crude nuclei were incubated with NIB plus 0.6% Triton X-100 for 20 min
and filtered twice through 20 pm nylon mesh. The filtrate was then loaded onto percoll
gradients consisting of 1 mL of 50% Percoll in NIB and 7 mL 10% Percoll in NIB. A
centrifugation step (1000xg, 10 min) yielded a yellow-gray band directly on top of the
50% percoll cushion (purified nuclear fraction) that was overlaid by a clear light yellow
cytosolic fraction II. In general, 4-6 x 108 nuclei were obtained. Aliquots of each cell
fraction were immediately frozen in liquid N2 and stored at -80°C. For further nuclear
protein isolation, purified nuclei (N) were incubated with DNase I (Boehringer
Mannheim), separated into a soluble (S1) and insoluble (P1) fraction, and P1 was then
incubated in 0.5 M NaCl, 50 mM Hepes, pH 6.8 (2 ML per 10° nuclei) followed by a
centrifugation step to yield a soluble (S2) and insoluble (P2) fraction (Heese-Peck et al.,
1995). Protein concentrations were determined using Bradford Protein Assay (BioRad).
In general, 3-3.5 pg protein/IIL were found to be present in S2. Proteinase inhibitors

were present during all steps (Heese-Peck et al., 1995).

92
Protein Blot Analysis

Proteins were separated on SDS-polyacrylamide gels, transferred to Immobilon-P
membranes (Millipore), blocked overnight in 3% BSA in Tris-buffered saline (TBS)
plus 0.1% Tween 20 (TBST), and further processed according to standard procedures
(Harlow and Lane, 1988). Where indicated, lnL/mL Erythrina cristagalli agglutinin-
alkaline phosphatase (ECA-AP; EY Laboratories, San Mateo, CA) was used as a probe

and processed according to standard procedures (Harlow and Lane, 1988).

Galactosyltransferase labeling assays

In vitro GalTF labeling of salt extracted proteins (S2) was performed essentially as
described by Roquemore et al. (1994), using 100 milliunits of GalTF and either 4 IiCi
of UDP-3H-galactose (1.0 mCi/mL; 17.3 Ci/mmol; Amersham) or 500 IzM of UDP-
galactose (Sigma) in a 100-IzL reaction. After incubation at 37°C for 2-3 hrs, samples
were cleared from precipitated proteins by a centrifugation step at 12,000xg for 5 min
at room temperature into a soluble (S3) and an insoluble (P3) fraction. Proteins were
separated on 9% SDS-polyacrylamide gels, stained by Coomassie blue-G or transferred
to Immobilon-P membranes (Amersham) according to standard methods (Harlow and
Lane, 1988; see above). Blots containing 3H-galactose labeled proteins were dried,
sprayed with EN3HANCE (New England Research Products, Boston, MA), and then
dried. Radiolabeled proteins were visualized by fluorography using ReflectionA film
(New England Research Products) at -80°C. Blots containing proteins labeled with non-

radioactive galactose were probed with ECA-AP and processed as described above.

93

Erythrina cristagalli agglutinin (ECA) aff'mity chromatography

Salt extracted nuclear proteins (S2; ~ 500 pg) were galactosylated in vitro in the
presence of non-radioactive UDP-galactose and GalTF as described above. In a control
reaction, proteins were incubated with non—radioactive UDP-galactose but in the absence
of the GalTF. ECA affinity chromatography was based on Miller and Hanover (1994)
with the following modifications. Prior to loading onto the lectin columns, cleared
supernatants were diluted 1:3 with 20 mM Hepes-KOH, pH 7.3, 5 mM MgC12, 2 mM
B-mercapthoethanol to lower the salt concentration in the samples. The following steps
were performed at 4°C. All buffers contained a proteinase inhibitor mix as described
for nuclear protein isolation. Diluted protein samples were batch-bound for 1-2 hr to
0.5 mL ECA-agarose columns (EY-Laboratories, San Mateo, CA) which were first
equilibrated with 10 bed volumes of column wash buffer (CWB; 20 mM Hepes—KOH,
pH 7.3, 5 mM MgC12, 100 mM NaCl, 2 mM B—mercapthoethanol). After unbound
proteins were collected, the columns were washed extensively with CWB (15-20 bed
volumes) followed by two batch washes with CWB containing 0.1 M mannose (2 bed
volumes) for 20 min each. Bound proteins were batch-eluted twice with elution buffer
(0.05 M lactose in CWB; 2 bed volumes) followed by batch-elution with 20 mM Hepes-
KOH, pH 7.3, l M NaCl (2 bed volumes) for 30 min each. Proteins from different
column fractions were precipitated with 10% trichloroacetic acid followed by an acetone
wash and analyzed by protein blot analysis as described. In some cases, protein blots

were incubated with diluted Coomassie Brilliant Blue-R250 stain.

94

Peptide sequence analysis

For peptide sequencing, proteins were extracted from 3.5 x 109 nuclei, galactosylated
in vitro in the presence of non—radioactive UDP-galactose, and galactosylated proteins
were isolated by ECA affinity chromatography using 16 columns (1 mL bed volume
each) as described above. Proteins eluted in the presence of lactose and 1 M NaCl were
separated on 7.5 - 15% SDS-polyacrylamide gels and transferred to Immobilon PSQ
membranes (Millipore) in 25 mM Tris base, 192 mM glycine, 0.01% SDS, 10%
methanol by stepwise electroblotting (0.6 mA/cmz, 1 mA/cmz, 2 mA/cmz, 15 min each)
and using a semi-dry protein electroblotting apparatus (Model 6000, E&K Scientific
Products, Saratoga, CA). Blots were washed in ddeO, and proteins were detected in
0.1% Amido black (Sigma), 45% methanol, 2.5% acetic acid. Horizontal strips
corresponding to gp33, gp40, and gp65 were excised and washed extensively in ddeO.
The following procedure was performed by Dr. William S. Lane and personnel of the
Harvard Microchemistry Facility for HPLC, mass spectrometry and peptide sequencing
(Harvard University, MA). Strips containing proteins were subjected to in situ digestion
with trypsin (Fernandez et al. , 1994). The resulting peptide mixture was separated by
microbore high performance liquid chromatography using a Zorbax C18 1.0 x 150 mm
reverse-phase column on a Hewlett-Packard 1090 HPLC/1040 diode array detector.
Optimum fractions from the chromatogram were chosen based on differential UV
absorbance at 205 nm, 277 nm and 292 nm, peak symmetry and resolution. Peaks were
further screened for length and homogeneity by matrix-assisted laser desorption time-to—
flight mass spectroscopy (MALDI-MS) on a Finnigan Laserrnat 2000 (Hemel England).

Selected fractions were submitted to automated Edman degradation on an Applied

95
Biosystems 494A, 477A (Foster City CA) or Hewlett Packard G1005A (Palo Alto CA).

Details of strategies for the selection of peptide fractions and their microsequencing

have been previously described (Lane et al., 1991).

96
RESULTS

As an initial step to identify plant N PC proteins, we have previously
demonstrated that glycoproteins modified by GlcNAc are present at the NPC of
Nicatiana tabacum suspension-cultured cells. Most of these glycoproteins are partially
extracted with 0.5 M salt and thus display similar properties as described for vertebrate
NPC proteins. As determined by in vitro galactosyltransferase (GalTF) assays, the
majority of these glycoproteins are modified by O-linked oligosaccharides with terminal
GlcN Ac (Chapter 2; Heese-Peck et al., 1995). In the in vitro GalTF assays, the enzyme
GalTF adds galactose (Gal) specifically to terminal, but not internal GlcNAc residues
to generate glycoproteins with terminal galactosyl-Bl ,4-N—acetylglucosamines (Gal-B1 ,4-
GlcNAc; Roquemore, et al., 1994). This assay is therefore specific for detection of
proteins with terminal GlcNAc residues and was used to purify tGlcNAc-proteins
present at the tobacco NPC.

Nuclei were isolated from tobacco suspension-cultured cells in the presence of
0.6% Triton X-100 by Percoll gradients. High-detergent concentration leads to the lysis
of contaminating organelles including plastids, mitochondria and vesicles (Willmitzer
and Wagner, 1981; Heese-Peck et al., 1995). Under these conditions, the endoplasmic
reticulum (ER) and the NE are also removed. Nevertheless, the nuclei stay intact
because the nuclear integrity does not rely on the NE (Heese-Peck, et al., 1995;
Masuda et al., 1997). Purified nuclei were treated with DNase I and then incubated
with 0.5 M salt buffer to extract tGlcNAc-proteins as described by Heese-Peck et al.
(1995). This solubilized fraction containing unmodified tGlcNAc-proteins (Figure 3.1;

Lanes 1 and 5) was incubated with radiolabeled UDP-3H-Gal in the presence of GalTF

97

(Figure 3.1, Lanes 2 and 6). As previously shown, after separation of the proteins on
SDS-polyacrylamide gels and subsequent transfer to membranes, at least eight tGlcNAc-
proteins were labeled with 3H-Gal and detected by fluorography (Figure 3.1, Lane 6;
Heese-Peck et al. , 1995). The in vitro GalTF labeling assay was performed at 37°C,
at which some proteins precipitated out of solution. The precipitated proteins (Figure
3.1, Lanes 3 and 7) were separated from the soluble proteins (Figure 3.1, Lanes 4 and
8) by centrifugation, and nearly all tGlcNAc-proteins were found in the soluble fraction
(Figure 3.1; Lane 8). Thus, incubation at 37°C provided a convenient step to enrich
for tGlcNAc-proteins, as it was particularly obvious when the insoluble (containing the
precipitated proteins) and soluble protein pattern were compared using Coomassie
Brilliant Blue R 250 staining (Figure 3.1; Lanes 3 and 4, respectively).
Galactosylation of the tGlcNAc-proteins with radiolabeled 3H-Gal was not
practical for large scale protein purification. Therefore, the tGlcNAc-proteins were
labeled with non—radioactive Gal as previously described by Miller and Hanover (1994).
We then examined whether the galactosylated tGlcNAc-proteins could be detected by
Erythrina crystagalli agglutinin (ECA), a lectin shown to be specific for Gal-31,4-
GlcNAc (Lis et al., 1985). Galactosylated tGlcNAc-proteins were visualized using ECA
coupled to alkaline phosphatase (ECA-AP; Figure 3.1, Lanes 9-12), and proteins with
similar apparent molecular mass to those visualized by fluorography were detected by
the ECA-probe (Figure 3.1; compare Lanes 6 and 10 as well as 8 and 12, respectively).
One additional glycoprotein with an apparent molecular mass of 35 kD was only
detected by the ECA-probe (Figure 3.1, Lanes 9-12). Because this protein was also

detected by ECA-AP prior to in vitro GalTF labeling (Figure 3.1, Lane 9; see below),

98

C.b. staining Fluorography ECA-AP

 

GalTF- + + + - + + + _ + + +
12|3|45 6]7|8 910|11|12

 

 

 

 

 

 

   
   

Rang r» tau-1:. zap

Figure 3. 1

Detection of galactosylated tGlcNAc—proteins using fluorography and ECA blot
analysis.

tGlcNAc—proteins were extracted with 0.5 M salt from DNase I treated tobacco nuclei.
Extracted proteins were either not further modified (GalTF -; Lanes 1, 5, and 9) or
subjected to GalTF assays in the presence of UDP—3H-galactose (GalTF +; Lanes 2-4,
6—8) and non—radioactive UDP-galactose (GalTF +; Lanes 10—12). Following GalTF
assay, total proteins (Lanes 2, 6, 10) were separated into an insoluble (Lanes 3, 7, 11)
and a soluble (Lanes 4, 8, 12) fraction by centrifugation. After separation on SDS—
polyacrylamide gels, total proteins were detected by Coomassie-blue (Lanes 1-4), or
transferred to Immobilon-P (Lanes 5-12), and galactosylated tGlcNAc—proteins were
visualized by fluorography (Lanes 5-8) or by protein blot analysis using ECA—AP
(Lanes 9—12). Molecular mass standards are indicated at left in kilodaltons (kD). C.b.,
Coomassie blue; GalTF, galactosyltransferase.

99

it was not considered a tGlcNAc-protein. As defined above (see Introduction),
tGlcNAc-proteins required the addition of galactose in the in vitro GalTF assay for
subsequent detection with ECA—AP. Taken together, these results indicated that labeling
of tGlcNAc-proteins with non-radioactive Gal and subsequent detection with ECA-AP
provided an excellent alternative method for the detection of glycoproteins with terminal

GlcNAc.

Isolation of nuclear glycoproteins with terminal GlcNAc by ECA affinity
chromatography

The ability of ECA to bind to the galactosylated tGlcNAc—proteins was used to
purify these glycoproteins by lectin affinity chromatography. Salt-extracted proteins
were galactosylated with non-radiolabeled Gal in the presence of GalTF (+GalTF), and
soluble proteins were loaded onto ECA-agarose columns (Figure 3.2A; Lane 1).
Different column fractions were collected, and the presence of the tGlcNAc-proteins
was determined by protein gel blot analysis using ECA-AP as a probe (Figure 3.2A).
With the exception of a 35-kD glycoprotein (Figure 3.2A; astrix; see below), the
tGlcNAc-proteins bound to the ECA—agarose columns and only small portions of the
tGlcNAc-proteins were found in the eluate (Figure 3.2A, Lane 2). The tGlcNAc-
proteins were eluted with the specific sugar lactose (Gal-Bl,4-Glu; Figure 3.2A; Lane
4), a disaccharide closely related to Gal-Bl,4-GlcNAc and shown to be a competitor
ofGal-B1,4-GlcNAc binding (Lis et al., 1985). These glycoproteins were not eluted with
the unrelated sugar mannose (Man; Figure 3.2A; Lane 3) demonstrating the specific

interaction of the galactosylated tGlcNAc-proteins with the ECA-agarose.

100

Figure 3.2

Purification of galactosylated tGlcNAc-proteins by ECA affinity chromatography.
Salt extracted nuclear proteins were subjected to nonradioactive GalTF assay in the
presence (A, B) or absence (C, D) of GalTF and separated into insoluble and soluble
fractions. The soluble fractions (Lane 1) were loaded onto ECA agarose columns, and
column fractions were collected as Lane 2, eluate; Lane 3, 0.1 M mannose wash;
Lane 4, 0.05 M lactose eluate; Lane 5, 1 M NaCl eluate. All fractions were subjected
to protein gel blot analysis using ECA—AP (A, C). After detection with ECA-AP, the
total proteins were visualized by immersing the blots in Coomassie blue (B, D).
Molecular mass standards are indicated in kilodaltons (kD). GalTF,
galactosyltransferase.

101

kD 1
200-
116-
97-

66- WW 2 -

2 3 4 5 1

45-

In...“ W.,...”
* M “WW

31-

 

+ GalTF

kD 1
200-

116-
97-

66- ‘ iii

2 3 4 5 1 2

45-
31- ;%wrflfi

' Ga'TF - GalTF

102

Tight interaction between glycoproteins and the lectin was further disrupted by 1 M
salt. As shown in Figure 3.2A (Lane 5), one GlcNAc-protein with an apparent
molecular mass of ~40 kD, designated gp40, was not only present in the lactose but
also in the l M salt eluate indicating that gp40 bound tightly to the ECA-agarose
(Figure 3.2A; Lane 5). The same blot was subsequently stained with Coomassie
Brilliant Blue R 250 to visualize all proteins in each column fractions (Figure 3 .2B) and
confirmed that ECA affinity chromatography served as an efficient means to purify
tGlcNAc-proteins (Figure 3.2B, Lanes 4 and 5).

In control experiments, proteins were treated as described, except that GalTF
was omitted (~GalTF; Figure 3.2C and D). No proteins were present in the lactose and
1 M salt eluted fractions (Figure 3.2C and D; Lanes 4 and 5, respectively). These
results further demonstrated that the binding of galactosylated tGlcNAc-proteins to the
ECA-agarose columns was specific. Only one protein with an apparent molecular mass
of 35 kD was detected in the protein fraction loaded onto the ECA agarose column by
ECA-AP (Figure 3.2C; Lane 1; astrix), but it did not bind to the column (Figure 3.2C;
Lane 2). This glycoprotein is most likely the 35 kD-protein that was detected by ECA-
AP prior to GalTF labeling assays (Figure 3.1; Lane 9 and Figure 3.2A; Lanes 1 and

2; see astrix) and was not further pursued.

Large scale purification of tGlcNAc-proteins for internal amino acid analysis
To obtain sufficient material for internal amino acid sequence analysis, large
scale purification of tGlcNAc-proteins was performed using ECA-affinity column

chromatography. A total of 3.5 x 109 isolated nuclei were used as starting material.

103

DNase I treated nuclei were incubated with 0.5 M salt buffer to extract tGlcNAc-
proteins. The solubilized fraction was then subjected to non-radioactive in vitro GalTF
assay followed by ECA affinity chromatography as described above. Proteins eluted in
the presence of lactose as well as 1 M salt were separated on 7.5-15% gradient SDS-

polyacrylamide gels, transferred to membranes, and visualized by amido-black staining.

Peptide sequences of gp33, gp40 and gp65

For internal amino acid analysis, sufficient material was recovered from three
tGlcNAc-proteins with apparent molecular masses of ~ 33 kD, ~40 kD, and ~ 65 kD,
referred to as gp33, gp40, and gp65, respectively. More specifically, gp33 and gp65
were isolated from the lactose eluate, and gp40 from the 1 M salt eluate. The
subsequent tryptic digestion and peptide analysis were performed by Dr. William Lane
and personnel at the Harvard Microchemistry Facility.

For each of these tGlcNAc-protein, amino acid sequence information was
obtained from three peptides as shown in Figure 3.3. The peptides were compared to
sequences of known proteins and expressed sequence tags from eukaryotes and
prokaryotes present in available databases. Initial database searches did not reveal
convincing information on the identity of the tGlcNAc-proteins (see below). Therefore,
we employed polymerase chain reaction (PCR) to obtain clones encoding these proteins.
Degenerate oligonucleotide primers were designed to the different peptide sequences in

either sense or antisense directions (data not shown; for gp40—peptides, see Chapter 4).

104

protein peptide amino acid segpence
gp33 PT35 TTGTVASFETR
PT84 TRPLPAD
PT118 VPPAAVVAAFNSQLPGTQSIAT

gp4o PT48 IGGAQFTL—GTH[Y]
PT64 NTPYDFLK[P][R]
p'r72 IGDVVLGYID](T)
gp65 PT56 T s L (S/D) E Y E P[L][P]/(D) R
PT63 VDLINGLK
p’r90 TNVVPFYPDTMIR
Figure3.3

Amino acid sequences of peptides obtained from gp33, gp40, and gp65.

All amino acids were determined with high confidence except those indicated by the
following symbols: -, no amino acid determination; [], probable/reasonable confidence;
( ) possible/low confidence; /, relative assignment to major or minor residue was not
feasible.

105

The primers were then used in all possible permutations to amplify specific PCR—
fragments using a cDNA library made from poly(A)+ RNA of tobacco suspension-
-cultured cells (Facchini and Chappell, 1992) as template. The PCR approach did not
lead to the isolation of specific PCR-fragments encoding gp33 and gp65 (data not
shown). As described in detail in Chapter 4, this approach was successful in identifying

a specific PCR fragment encoding a portion of gp40.

106
DISCUSSION

In the present studies, we successfully developed a purification scheme to isolate
nuclear glycoproteins modified with terminal GlcNAc. Labeling these tGlcNAc-proteins
with Gal in vitro yielded glycoproteins with terminal Gal-B1,4-GlcNAc. Due to the
specific affinity of ECA to Gal-B1,4-GlcNAc, lectin affinity chromatography provided
an efficient means to purify the modified tGlcNAc-proteins in large enough quantities
and to obtain amino acid sequence information. Thus, this procedure may be employed
in the isolation of other tGlcNAc—proteins in the future. Amino acid sequence
information allowed us to compare the peptide sequences to known proteins and ESTs
in available databases and to design experiments to isolate genes encoding the tGlcNAc-

proteins.

gp33

Two peptides obtained from gp33, designated gp33-PT35 and gp33-PT84, were
100% identical to regions of Erythrina caralladendran lectin (ECorL), a protein closely
related to ECA (Arango et al., 1990; Figure 3.4A). This lectin has a similar apparent
molecular mass (36 kD) to gp33. It is likely that ECA may have not been properly
linked to the ECA agarose (obtained from EY-Laboratory) and contaminated the
isolated gp33 fraction.

The third peptide, gp33-PT118, did not show any sequence similarity to the
deduced amino acid sequence of ECorL, demonstrating the presence of a second protein
(gp33) other than ECorL. Initial analysis of gp33-PT118 revealed only low sequence

similarity to a variety of different proteins (data not shown).

107

A.
gp33-PT35 1 T T G T v A s F E T R 11
***********
ECorL 89 T T G T v A s F E T R 99
gp33-PT84 1 T R p L p A D 7
*******
ECorL 109 T R p L p A D 115
B.
gp33—PT118 1 v P A A v v A A F N s Q L p G T Q s I A T 21
**++*+*************
germin—like prot. 148 K p A s v I s A F N s Q L p G T Q s I A A 167
(U95036)
Figure3.4

A. Amino acid similarity between gp33-PT35 and gp33-PT84 peptides and Erythrina
caralladendran lectin (ECorL).

B. Amino acid similarity between gp33-PT118 and one of the germin-like protein from
A. thaliana (Accession number: U95036).

* and + , identical and conserved amino acids, respectively.

108

Searches of the Arabidapsis database performed in the past year showed that 16 of 21
amino acids were identical to a region in germin—like proteins from Arabidapsis (Figure
3.4B). In general, germin-like proteins are found in a variety of different plant species
and have an apparent molecular mass of 25-30 kD (Ono et al., 1996, and references
within). As the name indicates, germin-like proteins show sequence similarity to
germins, proteins originally identified during seed germination in cereals (Lane, 1994).
So far, the function of germin—like proteins is unknown. Examining different organisms,
these proteins do not share common expression pattern (Berna and Bernier, 1996 and
references within). Some are expressed during germination, others in roots, leaves, or
embryos. While some germin—like proteins are produced in response to auxin, osmotic
stress, or pathogen invasion, others are regulated during the circadian cycle. In future
experiments, genes encoding germin—like proteins and antibodies against oz-germin-like
protein can be used as heterologous probes to determine whether gp33 is indeed a

germin—like protein.

gp40

The three peptide fragments (gp40-PT48, gp40-PT64, gp40-PT72) obtained from
gp40 had no similarity to any known protein in the database indicating that gp40 may
be a novel protein. The isolation of the gene encoding gp40 and further characterization

of this protein will be described in Chapter 4.

109
gp65

As shown in Figure 3.5, eight of 13 amino acids of gp65-PT90 were identical
to a region in the A6 gene from B. napus and A. thaliana (Hird et al., 1993). The A6
gene encodes a protein with a predicted mass of 53 kD that is specifically expressed in
anthers. The function of this protein is unknown, but it appears to have low sequence
similarity to B-1,3-exoglucanases. These exoglucanases have a much smaller apparent
molecular mass (36 kD), and so far, no glucanase activity has been observed for A6
(Hird et al., 1993). gp65-PT9O showed low similarity to B-1,3-exoglucanases (20-25 %,
data not shown). Whether gp65 is indeed a A6-protein remains to be determined
because the other peptides, gp65-PT56 and gp65-PT63, did not show any similarity to
the A6 gene. Further, no sequence similarity of these peptides was observed to other

known sequences in the databases.

110

gp65—PT9O 1 T N v v P F Y P D T M I R 13

**++*+** '* **
AtA6 116 TNILPYYPQTQIR128
Figure3.5

Amino acid similarity between gp65-PT90 and A6 from A. thaliana (At A6). The
corresponding sequence of A6 from B. napus is identical to that shown for At A6.
* and + , identical and conserved amino acids, respectively.

111

Since initial database searches did not allow us to obtain convincing information
on the tGlcNAc-proteins, we employed polymerase chain reaction (PCR) amplification
approaches to obtain genes encoding these proteins. The isolation of a specific PCR
fragment encoding gp40 (see Chapter 4) demonstrated the validity of this approach.
During the course the cDNA library screening (see Chapter 4), we discovered that the
cDNA library was biased towards inserts smaller than 1 kb. Thus, it was likely that this
library did not contain the complete genome of tobacco suspension-cultured cells. This
observation may explain why we were not able to obtain specific PCR-fragments
encoding gp33 and gp65 (data not shown). It should be mentioned, however, that this
library was the only cDNA library made from tobacco suspension-cultured cells
available to us. The construction of a new tobacco cDNA libraries may be necessary
to isolate genes encoding gp33 and gp65. In addition, 5’ rapid amplification of cDNA

ends may provide another way to identify these genes.

112

References

Arango, R., Rozenblatt, S., and Sharon, N. (1990). Cloning and sequence analysis
of the Erythn'na caralladendran lectin cDNA. FEBS 264, 109-111.

Bednarek, S.Y., Wilkins, T.A., Dombrowski, J.E., and Raikhel, N.V. (1990). A
carboxyl-terminal propeptide is necessary for proper sorting of barley lectin to vacuoles
of tobacco. Plant Cell 2, 1145-1155.

Berna, A., and Bernier, F. (1997). Regulated expression of a wheat germin gene in
tobacco: oxalate oxidase activity and apoplastic localization of the heterologous protein.
Plant Mol. Biol. 33, 417-429.

Davis, L. (1995). The nuclear pore complex. Annu. Rev. Biochem. 64, 865-896.

Fernandez, J ., Andrews L., and Mische, SM. (1994). An improved procedure for
enzymatic digestion of polyvinylidiene difluoride-bound proteins for internal sequence
analysis. Anal. Biochem. 218, 113-117.

Forbes, DJ. (1992). Structure and function of the nuclear pore complex. Annu. Rev.
Cell Biol. 8, 495-527.

Goldberg, M.W., and Allen, T.D. (1995). Structural and functional organization of
the nuclear envelope. Curr. Opin. Cell Biol. 7, 301-309.

Harlow, E., and Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.

Hart, G.W. (1997). Dynamic O-linked glycolsylation of nuclear and cytoskeletal
proteins. Annu. Rev. Biochem. 66, 315-335.

Heese-Peck, A., Cole, R.N., Borkhsenious, O.N., Hart, G.H., and Raikhel, N.V.
(1995). Plant nuclear pore complex proteins are modified by novel oligosaccharides
with terminal N-acetylglucosamine. Plant Cell 7, 1459-1471.

Hicks, G.R., and Raikhel, N.V. (1995). Protein import into the nucleus: An
integrated view. Annu. Rev. Cell Dev. Biol. 11, 155-188.

Hicks, G.R., Smith, H.M.S., Lobreaux, 8., and Raikhel, N.V. (1996). Nuclear
import in permeabilized protoplasts from higher plants has unique features. Plant Cell
8, 1337-1352.

Hird, D.L., Worrall, D., Hodge, R., Smartt, 8., Paul, W., and Scott, R. (1993)
The anther—specific protein encoded by the Brassica napus and Arabidapsis thaliana A6
gene displays similarity to b-1,3-glucanases. Plant J. 4, 1023-1033.

113

Jordan, E.G., Timmis, J.N., and Trewavas, A.J. (1980). The plant nucleus. In
Talbert, N.E. (ed.), The Biochemistry of Plants, Academic Press, Inc., Vol. 1, pp.
490-588.

Lane, B.G. (1994). Oxalate, germin, and the extracellular matrix of higher plants.
FASEB J. 8, 294-301.

Lane, W.S., Galat, A., Harding, M.W., and Schreiber, S.L. (1991). Complete
amino acid sequence of the FK506 and rapamycin binding protein, FKBP, isolated from
calf thymus. J. Prot. Chem. 10, 151—160.

Lis, H., Joubert, F.J., Sharon, N. (1985). Isolation and properties of N-
acetyllactosamine-specific lectins from nine Erythrina species. Phytochemistry 624,
2803-2809.

Masuda, K., Xu, Z.—J., Takahashi, S., Ito, A., Ono, M., Nomura, K. and Inoue,
M. (1997). Peripheral framework of carrot cell nucleus contains a novel protein
predicted to exhibit a long alpha-helical domain. Exp. Cell Res. 232, 173-181.

Merkle, T., Leclerc, D., Marshallsay, C., and Nagy, F. (1996). A plant in vitro
system for the nuclear import of proteins. Plant J. 10, 1177-1186.

Miller, M.W., and Hanover, J .A. (1994). Functional nuclear pores reconstituted with
B-1,4 galactose-modified 0-linked N—acetylglucosamine glycoproteins. J. Biol. Chem.
269, 9289-9297.

Ono, M., Sage-Ono, K., Inoue, H. and Harada, H. (1996). Transient increase in the
level of mRNA for a germin-like protein in leaves of the short-day plant Pharbitis nil
during the photoperiodic induction of flowering. Plant Cell Physiol. 37, 855-861.

Panté, N., and Aebi, U. (1993). The nuclear pore complex. J. Cell Biol. 122, 977-
984.

Roquemore, E.P., Chou, T.-Y., and Hart, G.W. (1994). Detection of O-linked N-
acetylglucosamine (O-GlcNAc) on cytoplasmic and nuclear proteins. Methods in
Enzymology 230, 443-460.

Willmitzer, L., and Wagner, K.G. (1981). The isolation of nuclei from tissue-
cultured plant cells. Exp. Cell Res. 135, 69-77.

Chapter 4

gp40, a tobacco glycoprotein modified with terminal
N-acetylglucosamine and localized to the nuclear periphery,

shows sequence similarity to aldose-l-epimerases

114

1 15
ABSTRACT

Macromolecules, such as proteins and different RNA species, move in and out
of the nucleus through nuclear pore complexes (NPCs). Several glycoproteins are
present at the NPC of tobacco suspension—cultured cells that are modified by O-linked
oligosaccharides with terminal N—acetylglucosamine (GlcNAc). Some of these
glycoproteins, referred to as tGlcNAc-protein, have been previously purified using in
vitro GalTF assays and subsequent Erythrina crystagalli agglutinin affinity
chromatography. Peptide sequence information was derived from one tGlcNAc-protein
with an apparent molecular mass of ~40 kD, named gp40. In the current studies, we
isolated the gene encoding gp40 and investigated the cellular localization of the protein
produced. Interestingly, gp40 has 28 to 34% amino acid identity to aldose-l—epimerases
from bacteria. No gene encoding an aldose—l—epimerase has been previously isolated
from higher organisms. Polyclonal antibodies were generated against recombinant gp40.
Consistent with its purification as a putative NPC protein, gp40 was associated with the
nuclear periphery as shown by biochemical fractionation and immunofluorescent

microscopy studies.

1 15
ABSTRACT

Macromolecules, such as proteins and different RNA species, move in and out
of the nucleus through nuclear pore complexes (NPCs). Several glycoproteins are
present at the NPC of tobacco suspension-cultured cells that are modified by O-linked
oligosaccharides with terminal N—acetylglucosamine (GlcNAc). Some of these
glycoproteins, referred to as tGlcNAc-protein, have been previously purified using in
vitro GalTF assays and subsequent Erythrina crystagalli agglutinin affinity
chromatography. Peptide sequence information was derived from one tGlcNAc—protein
with an apparent molecular mass of ~40 kD, named gp40. In the current studies, we
isolated the gene encoding gp40 and investigated the cellular localization of the protein
produced. Interestingly, gp40 has 28 to 34% amino acid identity to aldose-l-epimerases
from bacteria. No gene encoding an aldose-l-epimerase has been previously isolated
from higher organisms. Polyclonal antibodies were generated against recombinant gp40.
Consistent with its purification as a putative N PC protein, gp40 was associated with the
nuclear periphery as shown by biochemical fractionation and immunofluorescent

microscopy studies.

 

1 16
INTRODUCTION

The nuclear pore complex (N PC) is a proteinaceous supramolecular structure of
~ 125 MD. It controls the movement of macromolecules such as proteins and different
RNA species in and out of the nucleus (Davis, 1995; Garlich and Mattaj, 1996).
Overall, little is known about the structure and composition of plant NPCs, most of
which has been obtained from microscopic and biochemical studies. The morphology
of plant NPC appears to be similar as those described for amphibian NPCs (Chapter 1
and 2; for review, see Jordon et al., 1980; Panté and Aebi, 1993; Goldberg and Allen,
1995). Further, using an antibody raised against the yeast NPC protein N splp (Hurt,
1988), a 100-kD protein is recognized in enriched nuclear matrix preparation of carrot-
suspension cultured cells and is located at the NPC (Scofield et al., 1992). Studies by
Hicks and Raikhel (1993; 1995a) show that proteins are present at the NE and NPCs
from isolated monocot and dicot nuclei that can bind to nuclear localization signals
(NLSs) in vitro. Consistent with these results, the plant homolog of the NLS-receptor
complex protein importin oz (Impoz), is not only found in the nucleo- and cytoplasm, but

also accumulates at the NE (Smith et al., 1997).

Using wheat germ agglutinin (WGA), a lectin that binds specifically to N-
acetylglucosamine (GlcNAc) as a probe, glycoproteins modified by GlcNAc are found
at the plant nuclear periphery (Chapter 2; Heese-Peck et al., 1995; Hicks et al. , 1996;
Merkle et al., 1996). As shown by EM and biochemical analyses, at least some of these
glycoproteins are located at the NPC of tobacco suspension-cultured cells and are

modified by terminal GlcNAc (Chapter 2; Heese—Peck et al., 1995). Most glycans with

117

terminal GlcN Ac are attached to the proteins via an O-linkage and are larger in size
than five GlcNAc residues (Chapter 2; Heese-Peck et al. , 1995). Thus, this sugar
modification is different from the single O-linked GlcNAc (O-GlcNAc) found on

vertebrate NPC proteins (for review, see Forbes, 1992; Hicks and Raikhel, 1995b).

Using lectin affinity chromatography, we have previously purified several
tGlcNAc-proteins and have obtained internal amino acid sequence information for three
tGlcNAc-proteins, named gp33, gp40, and gp65 (Chapter 3). Here, we report the
cloning of the gene encoding gp40 and the investigation of its subcellular localization.
This tGlcNAc-protein showed significant sequence similarity to aldose-l-epimerases,

and its possible function are discussed.

1 18
METHODS

Cloning and sequencing of gp40

Unless otherwise stated, all general molecular biology methods were performed as in
Sambrook et al. (1989). A degenerate oligonucleotide primer (5 ’-CCATCGATAAYAC
NCCNTAYGAYTT—3’; with N representing A, C, G, T, and Y representing C and T),
designated pt64s and based in part on the gp40-PT64 peptide sequence (NTPYDF), was
synthesized containing a ClaI restriction site (shown in bold) at the 5’-end. The primers
pt64$ and a T7 promotor specific primer (Boehringer Mannheim), designated T7, were
used for a polymerase chain reaction (PCR)-based amplification from a pcDNAII cDNA
library (Invitrogen, San Diego) made from poly(A)+ RNA from 4-h-elicitor-treated
tobacco cells (Facchini and Chappel, 1992). Thermocycling was performed at 94°C for
1 min, 45°C for 1 min, 72°C for 2 min, for 30 cycles using 150 ng of cDNA template,
50 nM of pt64s, and 5 nM T7. One p.L of the PCR reaction was then used as the
template for a reamplification reaction under the same conditions described. The
products were separated by agarose gel electrophoresis, recovered by electrophoresis
onto N A-45 paper (Schleicher & Schiiler), digested with C101 and XbaI and ligated into
pBluescript SK“ (pBS-SK‘). Sequencing was performed according to manufacture’s
specification (Promega). Three of five independent clones, designated p64s/8, p64s/9,
p648/H, were identified that contained an ~ 600-bp fragment and encoded the entire

peptide gp40-PT64.

119

Complementary DNA library screening and 5’-rapid amplification of cDNA ends
A ClaI-Xbal fragment isolated from p64S/ 8 was 32P-labeled by the random primer
method of Feinberg and Vogelstein (1985) and used as a probe to screen the pcDNAII
cDNA library under high stringency conditions. Final wash conditions were done using
0.1 x SSC, 0.5% SDS at 65°C. Eight independent clones were isolated, partially
sequenced, and sequence information of the clone pGP40-5e was used for further
studies. To obtain the full length 5’end of the gene encoding gp40, 5’-rapid
amplification of cDNA ends (RACE) was performed. Two non-degenerate
oligonucleotide primers, designated Gla (5’-GGTGATGTGTGATCCAA-3’) and G2a
(5’-CCATCGATCACCAATGTTCCAGTAA-3’; containing a ClaI site at the 5’ end
shown in bold), were synthesized based on the nucleotide sequence of pGP40-5e
encoding the amino acid sequence 220-FGSHIT and 200-YWNIG, respectively. 5’-
RACE was performed according to manufacture’s specifications (GIBCO-BRL). First
strand cDNA was synthesized from total RNA isolated from 3-d N. tabacum
suspension-cultured cells (Puissant and Houdeline, 1990) using Gla (400 nM) and
SuperScriptTMII (GIBCO-BRL). PCR amplification was performed using 5 ,uL of the
dC—tailed cDNA, 200 IIM dNTPs, 2 units Pwal DNA Polymerase (Boehringer
Mannheim), 0.5 units T aq DNA Polymerase (GIBCO-BRL), 400 nM nested primer G2a
and 400 nM Abridged Anchor Primer (AAP; supplied by GIBCO-BRL). Thermocycling
was done at 94°C for 30 sec, 43°C for 30 sec, 72°C for 2 min for 35 cycles followed
by 72°C for 7 min. The products were ligated directly into the SmaI site of pBS—SK‘.
Six independent clones, designated pRACE-3 to pRACE-8, were selected for

sequencing.

120
Northern blot analysis

Total RNA was isolated from young leaves, old leaves, roots, and stems of 2 month-
old Nicatiana tabacum cv Wisconsin 38 plants and from 2 to 8 d-old Nicatina tabacum
suspension-cultured cells as described by Puissant and Houdeline (1990). For all RNA
blots, 20 pg of total RNA was separated on a 1.2% agarose-formaldehyde gel.
Ethidium bromide staining of the ribosomal bands was used to confirm equal loading
of lanes. Gels were transferred to Hybond-N nylon membranes (Amersham, II), and the
RNA was crosslinked to the membrane using the UV Stratalinker 1800 (Stratagene)
according to the manufacturer’s specification. The 600-bp ClaI-XbaI fragment isolated
from p64s/ 8 was 32P-labeled by the random primer method (Feinberg and Vogelstein,
1985) and used as probe for Northern blot analysis. Final washes were done using 0.25
x SSC, 0.5% SDS at 60°C. Autoradiography was performed using Reflection NEF

(DuPont) with amplification screens at -80°C.

Construction of the full length gp40 and gp40-GST fusion

Based on the sequence identity of the 5’RACE product present in pRACE-7 to the
fragment in pGP40-5e in the overlapping region, the fragment of pRACE-7 was
selected to be combined with the fragment of pGP40-5e to create pGP40-7/5e as
follows. The approximately 900 bp XbaI and HindIII fragment was isolated from
pGP40-5e and ligated into pBS-SK', designated p5e/SK‘. pSe/SK‘ and pRACE-7 were
digested with anI yielding each the following size fragments, 1.0 and 2.8 kb for
p5e/SK’, and 2.2 and 1.5 kb for pRACE-7. The 2.8 kb fragment of p5e/SK’ and the 1.5

kb of pRACE-7 were isolated and ligated to give pGP40-7/5e containing the complete

121

ORF of gp40. Correct ligation of the two fragments was confirmed by sequencing
across the anI site of pGP40—7/5e. Further, both DNA strands of the combined insert
were sequenced in the W.M. Keck facility (Yale University) using Taq FS DNA
polymerase and fluorescent-dideoxy terminators in a cycle sequencing method. The
resultant DNA fragments were electrophoresed and analyzed using an automated
Applied Biosystems 373A Stretch DNA sequencer. PCR-based mutagenesis was used
to introduce a XhaI site in frame upstream of the ATG (Met) of the open reading frame
(ORF) of gp40-7/5e. Thermocycling was done for using 10 ng of template plasmid
DNA (pGP40-7/5e), 400 nM dNTPs, 400 nM reverse primer (BMB), 400 nM 7pchs
primer (5’-ATACACTCGAGTTGACTATG-3’; with XhaI site shown in bold and
mismatched nucleotide in italics), and 2.5 units PwaI DNA polymerase (BMB) at 94°C
for 45 sec, 45°C for 45 sec, 72°C for 3 min for 25 cycles followed by an extension
reaction at 72°C for 7 min. A PCR product of 1.25 kb (encoding the full length gp40-
7/5e) was isolated, digested with XhoI, and ligated into the XhoI site of pGEX-SX-l
(Pharmacia Biotech). In frame fusion of the gp40 ORF to glutathion—S-transferase
(GST) was confirmed by sequence analysis. One clone, designated pGEX-D, was

selected for overexpression of GST-gp40 fusion protein in E. cali.

Production of antibody against GST-gp40 fusion protein

E. coli strain BL21 (DE3) was transformed with pGEX-D (GST-gp40). Transformed
cells were grown in 500 mL LB media to OD600 = 0.5—0.7 at 37°C, and proteins were
induced with 0.2 mM isopropylthio-B-D-galactose for 3 hrs. Cells were collected, lysed,

and separated into soluble and insoluble fractions by centrifugation according to

122
Bar-Peled and Raikhel (1996). The insoluble fraction (containing GST—gp40 in inclusion

bodies) was washed three times in 50 mM Hepes-KOH, pH 7.5, 10 mM MgC12, 25%
sucrose, 1% Triton X-100, and by three washes in ddeO. Each wash step was
followed by a centrifugation step at 15,000xg for 20 min at 4°C. After the final wash,
the insoluble fraction containing the inclusion bodies was stored at —80°C. Proteins in
inclusion bodies were separated by 10% SDS-polyacrylamide gels, stained in 0.05%
Coomassie Blue-G in ddeO, and washed in ddeO. Horizontal gel strips containing
GST-gp40 were excised, cut into small pieces, and stored at -80°C overnight. The
fusion protein was eluted from the gel pieces by electroelution (Electro-Eluter Model
422, BioRad) using 25 mM Tris base, 192 mM glycine, 0.1% SDS at 10 mA/ glass tube
for 8 hr with one change of buffer. Solutions containing the eluted fusion protein were
combined, lyophilized, and resuspended in less than 1 mL of ddeO. Protein
concentration was approximated by comparison to a known amount of Broad Molecular
Weight Standards (BioRad). Fusion protein (500—750 pg) was mixed with TiterMax
(Cthx Corporation, Norcross, GA) and injected into a New Zealand White rabbit
according to standard procedures (Harlow and Lane, 1988). Antibodies were made
monospecific to gp40 by first depleting them of anti-GST antibodies as described by
Bar-Peled and Raikhel (1996) and then by strip-purifying the depleted antibody against

GST-gp40 fusion protein bound to Immobilon—P membranes (Harlow and Lane; 1988).

Nuclear Protein Isolation
Nicatiana tabacum suspension-cultured cells were maintained and subcultured, and

nuclei were isolated in the presence of 0.6% Triton X—100 as in Chapter 3.

123
Protein Blot Analysis

Proteins were separated on SDS-polyacrylamide gels, transferred to Immobilon—P
membranes (Amersham), blocked overnight in 3% BSA in Tris-buffered saline (TBS)
plus 0.1% Tween 20 (TBST), and further processed according to standard procedures
(Harlow and Lane, 1988). Where indicated, 1pL/mL Erythrina cristagalli agglutinin-
alkaline phosphatase (ECA-AP; EY Laboratories, San Mateo, CA) was used as a probe.
oz-atIMPoz (1:2,000 dilution; Smith et al., 1997), oz—GST (1:1000 dilution; M. Bar-
Peled, unpublished), a-rat aldose-l-epimerase (1:500 dilution; Toyoda et al., .1983),
and oz-gp40 (1 :500 dilution; see below) were used as the primary antibodies. oz-atIMPoz
and oz-GST treated blots were incubated with goat-oz-rabbit IgG-alkaline phosphatase
(AP; 1:5000 dilution) and developed by standard procedures (Harlow and Lane, 1988).
a-rat aldose-l-epimerase and oz-gp40 treated blots were incubated with Protein A-horse
radish peroxidase (HRP; Sigma; 1:7,500 dilution), and proteins were then visualized
using a chemiluminescence kit according to the manufacturer’s specification (Pierce;
SuperSignal). Where specified, after detection by chemiluminescence, the protein blots
were stripped as described in the manufacturer’s protocol (Pierce) and reprobed with
ECA-AP. The primary antibodies oz-atIMPoz were kindly provided by H.S.M. Smith,

the oz-rat aldose-l-epimerase by Dr. Y. Toyoda, and oz-GST by Dr. M. Bar-Peled.

Erythrina cristagalli agglutinin (ECA) affinity chromatography
Salt extracted nuclear proteins (S2; ~ 500 pg) were galactosylated in vitro with non—
radioactive UDP-galactose, subjected to ECA affinity chromatography and protein blot

analyses as described in Chapter 3. For analyses of ECA column fractions using oz-rat

124

aldose-l-epimerase, twice the amount of proteins were loaded in the Lanes 1 (S3;

column load) and 2 (unbound proteins).

Immunofluorescence Microscopy

N. tabacum cell suspension-cultured cells were protoplasted for 30 to 40 min, collected,
spun onto lysine-coated slides (Shannon), and fixed in 3% paraformaldehyde (Smith et
al. , 1997). About 2.5 x 10° protoplasts were used per slide to obtain relatively even
distribution. For indirect immunofluorescent microscopy, labeling was performed
according to Smith et al. (1997) with some modifications. The material was blocked in
PBS, 0.05% Tween 20, 3% BSA for 30 min prior to the incubation with the primary
antibody. Incubation of primary (oz-gp40, 1:50 dilution; oz-atIMPoz; 1:12 dilution) and
secondary antibodies (goat-a rabbit IgG-CY3; 1:20 dilution; Jackson) were done in the
same blocking solution. After incubation with the secondary antibody, protoplasts were
incubated with a DAPI/glycerol solution (Hicks et al., 1996) and then washed
extensively. Samples were examined with epifluorescent optics (Axiphot; Zeiss) using
a 490-nm longpass filter for immunofluorescent labeling and a 365-nm bandpass filter
for DAPI staining. Pictures were taken with p3200 TMAX fihn (Kodak). The same
samples were then viewed by laser scanning microscopy as described by Smith et al.
(1997). Images were digitized and prepared in Adobe Photoshop after removing

scratches using the "dust and scratches" filter.

125
RESULTS

Cloning of the gene encoding gp40

The tGlcNAc—protein gp40 was purified by ECA affinity chromatography in
large quantities for subsequent tryptic digestion (see Chapter 3). Internal amino acid
sequence analysis yielded sequence information for three peptides, designated gp40—
PT48, —PT64, and —PT72 (Chapter 3; Figure 3.3). These peptides were compared to
sequences of known proteins and expressed sequence tags (ESTs) from eukaryotes and
prokaryotes present in available databases; however, no sequence similarity was found.
Therefore, polymerase chain reaction (PCR) amplification was employed to clone the
gene encoding gp40 using degenerate oligonucleotide primers based on the information
obtained from the gp40—peptides. Using a cDNA library made from poly(A)+ RNA
from N. tabacum suspension—cultured cells (Facchini and Chappell, 1992) as a template,
a specific 600—bp PCR fragment was amplified using a pt64s primer (Fig. 4.1) and a
T7 promotor specific primer present in the pcDNAII plasmid. After subcloning, three
independent clones, designated p64s/8, p64s/9, and p64s/H, were isolated, and
sequence analysis revealed that they were identical (data not shown). The PCR
fragments also contained the nucleotide sequence encoding the entire peptide fragment
gp40-PT64 confirming the identity of the PCR fragments (Figure 4.1); however, the
remaining peptides gp40—PT48 and gp40—PT72 were not contained in this PCR
fragment.

Screening of the tobacco cDN A library with the PCR fragment p64s/ 8 generated
only partial clones with a size of about 0.75 to 0.95 kb (data not shown). Therefore,

5’-rapid amplification of cDNA ends (5’RACE) was employed to obtain the missing

126

gp40-PT64 N T P Y D F L K P R
AAY ACN CCN TAY GAY TTY YTN AAR CCN MGN

N T P Y D F L K P R

p64s/8 AAT AGG GGA TAG GAG TTG TTG AAA GGG GGT

p64s/9 AAT AGG CCG TAG GAG TTG TTG AAA GGG GGT

p64s/h AAG AGG GGG TAT GAG TTG TTG AAA GGG GGT
Figure 4.1

The 5’end of the three specific PCR products, pt64s/ 8, pt64s/9, pt64s/H, were aligned
with the degenerate nucleotide sequence of the peptide gp40-PT64 to confirm their
identity. The nucleotide sequence of the primer pt64s used for PCR-based amplification
is underlined. The nucleotide sequences are represented by the following codes: M =
AorC; N = A, C, G, orT;R = AorG; Y = TorC.‘

127

5’end of the clone. Due to its proof-reading ability, PwaI DNA polymerase
(supplemented with a low amount of T aq DNA polymerase) was used in the
amplification reaction using nested oligonucleotide primers and total RNA isolated from
3-d old tobacco suspension-cultured cells as template. To confirm the sequence identity,
nested primers were designed such that the 5’RACE product would have an 183-bp
overlap with the 5’end of one of the truncated cDNA clones, GP40-5e (Figure 4.2;
underlined; see Methods). A 750-bp fragment was amplified by 5’RACE, isolated, and
subcloned for sequence analysis. The nucleotide and deduced amino acid sequences of
three independent inserts (including RACE—7) were identical to the overlapping
sequences of GP40-5e with the exception of a single nucleotide change (T for C at nt
169) that did not alter the deduced amino acid sequence (Figure 4.2). Significantly, the
two peptides gp40-PT48 and gp40-PT72 were present in the deduced amino acid
sequence of the 5’RACE product (Figure 4.2, marked in grey), confirming that the
isolated gene indeed encodes gp40. The deduced amino acid sequence of the 5’RACE
products differed from the peptide sequence of gp40-PT48 in one amino acid (1104T;
see Figures 4.1 and 4.2), which may be due to an error during amino acid sequencing.
It could not, however, be ruled out that gp40-PT48 was derived from another, very
closely related protein with similar properties as gp40.

For further studies, the fragments RACE-7 and GP40-5e were combined using
a an I site to yield the full length clone GP40 (GenBank accession number:
AF032386). The size of the combined fragment (1.25 kb) was consistent with the gp40

transcript size (see below; Figure 4.4).

128

AAAAAGTCTAAAATACACTAGAGTTGACTATGTCTTTAAAGATTAATTTGTTGGTCTGTTTGTTCATTTT 70
M S L K I N L L C L F I F

TCATCTGTTGGTTGCCGCTAGTGTTAGAGGGCACAAGATAGGGATCTATGAGATCAAGAAAGGAGATTTC 140
L V S V R G H K I G I Y E I K K G D F

TGTGTTAAGATGAccAATTATGGTAGGTGAATcAT GTGTGTTGTTGTTGGTGATAAGGATGGAAAAATAG 2 1 o
SVKITNYGTSIISVLLPDKHGK-

GTGATGTTGTTGTTGGATATGACACTATGGAGGAATAGAAGAATGATACAAGTTATTTTGGAGGCAGACT 2 8 0
G??- TEIIEEYKNDTSYFGATL

 

TGGAAGAGTTGGTAAGGGGATTGGTGGTGCTGAATTTAGTTTGAATGGAATGGATTATAAGGTTGTGGGG 350
G R v A N R IG . E L. N G TH Y K L v P

   

AATGAAGGCAAAAACATGTTGCATGGTGGCCCTAAAGGATTTAGCAAAGTTGTCTGGAAAGTAAGCAAGT 420
N G M L H G G P K G F S K V V W K V S K

ACGTGAAAGATGGTCCGTGTCCTTACATAACTCTAACCTACTACAGTGCTGATGGTGAAGAAGGATTTCC 490
Y V K D G P C P Y I T L T Y Y S A D G E E G F P

TGGTGCTGTTCTTGCCTCTGTTACCTACACATTGAAAGATTCTTACAAACTTAGCGTGGTATTTAGGGCA 560
G A V L A S V T Y T L K D S Y K L S V V F R A

 

AAAGCACTGAACAAGGCCACTCCAATTAACCTGTCTCACCACCCTTACTGGAACATTGGTGGTCACGACA 630
K A L N K A T P I N L S H H P Y W N I G G H D

 

GTGGCGACGTCTTGTCCCAAGTTCTTCAAATTTTTGGATCACACATCACCCTAGTAGATAAACAGCTCAT 700
S G D V L S Q V L Q I F G S H I T L V D K Q L I

TCCCACAGGCGAAATTGCCCCCATCAAGAACACGCCATATGATTTCTTGAAACCCCGTAAAGTTGGGAGC 770
T G E I A I K ‘N T ,P -D F L . :R. K G S

   

AGGATCAATAAACTCAAAAATGGATATGACATCAACTATGTACTTGACAGCACTGAAAAAATGAAACCAG 840
R I N K L K N G Y D I N Y V L D S T E K M K P

TGGGAATAGTGTATGATAAGAAATCAGGAAGAGTTATGGATGTACAAGCATCTTCACCTGGTGTCCAATT 910
V G I V Y D K K S G R V M D V Q A S S P G V Q F

CTACACTGCAAATTTTGTTAATAATACAAAAGGGAAAGGTGGATTTGTGTATCAACCTCATTCAGCATTG 980
Y T A N F V N N T K G K G G F V Y Q P H S A L

TCTTTGGAGACTCTAGTGTTCCCTGACGCTGTGAATCACCCTAATTTCCCGTCGACAATTGTAAATCCGG 1050
S L E T L V F P D A V N H P N F P S T I V N P

GAGAGAAATACGTCCACTCTGTGTTGTATACGTTCTCCATAAAAAAATAGAAGTACTAGAATGCTTATAT 1120
G E K Y V H S V L Y T F S I K K

TTTTTTTATTTCCATTATCCTTGTGGTATTTGTATCTTCTGCATAAATTGATGTTTCTGTCAAGGTTGTA 1190
TGTTCTTCGTGACTAATAAAACACCTGACATTCAAAATAAAAAAAAAAAAAAAAAAAAAA 1250

Figure 4.2

Nucleotide and deduced amino acid sequence of gp40 as derived from the 5’RACE
product (RACE-7) and the truncated cDNA clone (GP40-Se; see Methods). Peptide
sequences obtained from internal amino acid sequencing are marked in gray, and the
primers used for 5’RACE are underlined. The stop codon is indicated by a period. The
cleavage site of a putative signal sequence is marked by an astrix, and the putative NLS
is marked in bold. The GenBank accession number of gp40 is AFO32386.

129

The sequence of GP40 contains an open reading frame encoding 357 amino acids whose
predicted molecular weight of 39.3 kD was in good agreement with the apparent
molecular mass of gp40. gp40 contains ~10% lysine residues, and consistent with it
being glycosylated by O-linked oligosaccharides, gp40 is rich in serine and threonine
(~13 %). The sequence of gp40 contains at least one putative NLS (Figure 4.2; marked
in bold; Raikhel, 1992), and a putative signal sequence with a cleavage site between
amino acids 20 and 21 is found at the N-terminus (Figure 3C; see astrix; von Heijne,
1986). It is unclear whether the putative NLS or signal sequence are actually utilized

for subcellular localization of gp40 (see Discussion).

Interestingly, the deduced amino acid sequence of gp40 showed 28-34% amino
acid sequence identity and 45-51% amino acid sequence similarity over the whole
protein to bacterial aldose—l-epimerases (Figure 4.3). These enzymes, also referred to
as mutarotases, catalyze the interconversion of the anomeric forms (oz and B) of the
carbon 1 of aldose sugars. Enzyme activity has been reported from bacteria, animals
and plants (Bailey et al., 1967; Mulhern et al., 1973; Bouffard et al., 1994 and
references within). To date, no gene encoding an aldose-l-epimerase has been identified
from higher organisms, although apparent Arabidapsis (Z25633), rice (D22462), and

human (U11036) homologs exist in EST databases (data not shown).

130

Figure 4.3

Comparison of amino acid sequences of gp40 and bacterial aldose-l—epimerases.

The deduced amino acid sequence of gp40 was aligned with the sequences of aldose-1-
epimerases from Acinetabacter calcaaceticus (database accession number: X03893),
Escherichia cali (U13636), Haemaphilus influenza (U32764), Actinabacillus
pleurapneumaniae (U63731), and Streptococcus thermaphilus (M38175). Amino acids
marked in black and grey boxes indicate sequence identity and similarity, respectively.

a.

131

 

momZmfioonmwz>mm no
any oomuaq

Ho--ofl
---mmma mHnmxwm .
----Mm mazowumo <Mo GUMZOE
a
a

 

-deHmo m ammwm m momma !
-M0>omufi> >mzwaoz z mamII
-MMHmman>mm>wM

oumz>¢omaafl<mzaaammmxezx mom¢mezomHnnz mH>qozm2mmH Hoooflmuo

mGOZAmommmmmmq¢>oaw exam mu---z a on: no 4anu>--

momZAHnmqooaqunwmm exam 2%---H «mu m maooam-
a

Z> HmII

 

mom2mmomqmuwmoaqoox <>mmaou---m won a x onumo<-
zo>mmma a azamumumo
mo>ommm¢o oz>xom

   

2mmz>¢QMh>ABmAmA¢mmmO>>m

ammzmmommmoamqma<o<omwn>mz¢--o>Hz Samoa
mu-

ofi---oszz>mE¢

 

--zzEMHmmqqumemowzumo

   
    

   

H oomwa>oo-¢ow--qqzmu4mzamoq oo-§¢H mmch>-muoz
new >om-an¢zwq2muHmzaqzq< om- USUGSMHx>mmooH

 

o
o
oomo>maumnmflHoqu ..;
mzooa>QHmo¢zHo>>m q>oamz=odoqumummzeqz>> mo
aoxo>anmmomHoq>omn>oo--mfimoonswmmmmazH

I >8 MNHHWHM Q B
I 8% MNWHMMW O m

gumoqmqmwomwaoqmmmmaoo--Mn--qumu>:zemam> mmy>pmMmmqnaamBzzz
4Ezq<x xm>>mquwm M

>QUthQ>mmMAMKH MHM>NQIDZAZH>NZ

nmua>>¢>>mofluoomon<mHmm x>¢----omonom4
mam o>m----Zmoumon
mqa q>o----mn202>u
eqmqm<x>amoumfiqmu>

waaanwmumoomewxm>u

     

   

om q>zzmhamaonmoa>moHmouauqzauwfi----oflmommflfl>quq4EHm=m>qmm
ea M02qoam¢z¢Hmz¢wmum1¢om><afizoi ..... zmamas>q>mmmo-xmmx>>u
quqmozommo<z<Hmz<wmo maoqamouam> ..... zn>xooqq>mmqy-oz>m>xo
qa> mo Bummz<Hmz¢wxoHmaoqm¢¢0oo>---Iommmaooqqmmm>m omamHm<
qz mo gammaonmzewmoquomxHomuaoa>maouqoomog>szox oooquHo
ax NHozqemoaooHmz¢>moqa¢omwmaozufi---IMEHaouoq>Eoon mxomaq>m

oqeeokaaawn>>ozzzufifiuxm§n-flmn>MWHHmomHuz ....................

Gannon maxi ....................................
539463
enemas

quwmmonA42mfi
HHmauuzaHx>mmoo-MMHmaHo

       

wwm>m¢%>#flmhihqv>qAZHMAMZ IIIIIIIIII

 

 

HHHr-IHl-l

amofiuonu.
amouaoam.
uncufimqw.
wHoo.
ouoouamo.
ova

amofluonu.
amounoam.
naoaauna.
HHou.

nmofiuonu.
amoufloam.
Naoflaunw.
«Hon
wouOUHoo.
own

Amofiuonu.
amouaoam.
unoaaunw.
«H00.
oomOUHuu.
ova

nmofiuonu.
unannoan.
udodauna.
wHoo.
ounceaou.
ov

a

amofiuonu.
amousoam
neonauda.
flHoo.
oumooano
ova

m4mm4m

amofiucnu.
amouuoam.
unabaudfl.
“Hon.
oomouaoo.
own

aumam

m

m
d
m
N

mdmm<m

mammdm

m

132

As shown by RNA gel blot analysis, it ~ 1.3 kb transcript was detected in all
examined tobacco tissue indicating that the gene encoding gp40 was expressed (Figure
4.4). The gp40 transcript was present in RNA isolated from 2 to 8 d—old tobacco
suspension-cultured cells (Figure 4.4, Lanes 1—7) and from young leaves, old leaves,
stems and roots of N. tabacum cv Wisconsin 38 plants (Figure 4.4, Lanes 8-11,
respectively). (The isolation of RNA and the subsequent RNA gel blot analyses were

done by Robyn Perrin during her rotation in Dr. Raikhel’s laboratory).

gp40 is antigenically related to aldose-l-epimerases from rat

Sequence comparison indicated that gp40 has sequence similarity with bacterial
aldose—l-epimerases. Even though aldose-1 —epimerases have been purified from different
animal tissues, no gene encoding an animal aldose—l—epimerase has been cloned. To
investigate whether gp40 was related to the rat enzyme, we used polyclonal antibodies
made against an aldose—l—epimerase purified from rat kidney (Toyoda et al., 1983) for
protein gel blot analysis. The oz—rat epimerase antibodies were not able to detect any
plant protein in tobacco protoplasts or enriched nuclear fractions such as the 0.5 M salt
extracted fraction from purified nuclei (data not shown). For further enrichment of
gp40, nuclear proteins extracted by 0.5 M salt were subjected to in vitro GalTF assays
followed by ECA affinity chromatography. As previously described in Chapter 3,
proteins that remained soluble during the in vitro GalTF assay were loaded onto ECA
agarose columns. Column fractions were collected and analyzed by protein blot analysis

using oz—rat aldose—l—epimerase antibodies (Figure 4.5).

 

133

BY-2 cells plant tissue
kb1234567 891011

 

Figure 4.4

RNA gel blot analysis of gp40 mRN A levels from tobacco suspension—cultured cells and
different plant tissues.

Total RNA was isolated from 2 to 8 d-old tobacco suspension—cultured cells (Lanes 1—7)
and from young leaves, old leaves, stems, and roots of Wisconsin cv 38 tobacco plants
(Lanes 8—11, respectively). Equal amounts of total RNA (20 pg) were separated on a
formaldehyde agarose gel, immobilized to membrane, and hybridized with 32P—labeled
643/8 fragment.

Molecular size is indicated to the left in kb (kilobase).

134

 

oc-rat
epimerase
RD 1 2 3 4 5
200-" .
i._ ’V' ': fly"... .‘
a: we .- 9.
66 - -'
45 - .*
31 - ‘ , a “*6. “a“?

Figure 4.5

Detection of galactosylated gp40 after isolation on ECA affinity chromatography by oz-
rat aldose-l—epimerase antibodies.

Salt extracted nuclear proteins were subjected to nonradioactive in vitro GalTF assay
in the presence of GalTF and separated into insoluble and soluble fractions by
centrifugation. The soluble fraction (Lane 1) were loaded onto ECA agarose columns,
and column fractions were collected as Lane 2, eluate; Lane 3, 0.1 M mannose wash;
Lane 4, 0.05 M lactose elute; Lane 5, 1 M NaCl elute. All fractions were subjected to
protein gel blot analysis using oz-rat aldose-l-epimerase followed by incubation with
Protein A-HRP.

Molecular mass standards are indicated at left in kilodaltons (kD).

 

135

A protein with a similar apparent molecular mass as the galactosylated gp40 was
detected in the fraction loaded onto the ECA column. As found for gp40, this antigen
bound to ECA and was eluted by the specific sugar lactose (Figure 4.5, Lanes 4), but
not by the nonspecific sugar mannose (Figure 4.5, Lane 3). Further, it interacted
strongly with ECA, because some antigen was present in the 1 M salt eluate (Figure
4.5, Lane 5), and thus showed very similar ECA binding properties as gp40 (Chapter
3, Figure 3.2, and see below). These results indicated that gp40 was at least
antigenically related to rat aldose-l—epimerase. The oz-rat epimerase antibodies were,
however, not useful for more detailed biochemical analyses and intracellular localization
of gp40, because they did not detect gp40 in more crude tobacco fractions (data not

shown) .

gp40 is a nuclear protein

To investigate the intracellular localization of gp40, polyclonal antibodies were
prepared to recombinant gp40. A plasmid (pGEX-D) was constructed encoding the
entire ORF of gp40 fused in frame to the C-terminus of glutathione S-transferase
(GST). Escherichia cali cells were transformed with pGEX-D, and expression of GST-
gp40 was induced by isopropylthio-B-D-galactose. Proteins of uninduced and induced
cells were collected, separated on SDS—polyacrylamide gels and visualized by
Coomassie Brilliant Blue R 250 (Figure 4.6A). A protein with an apparent molecular
mass of 64 kD was found in the induced (Figure 4.6A, Lane 2), but not in the
uninduced cells (Figure 4.6A, Lane 1). The expressed protein had a lower apparent

molecular mass than the expected ~ 70 kD. Therefore, proteins were subjected to

136

protein blot analysis using oz-GST and oz-rat aldose-l-epimerase antibodies (Figures
4.6B and C, respectively). Both antibodies detected a 64-kD protein in the induced
(Lane 2), but not the uninduced cells (Lane 1), confirming the identity of the expressed
fusion protein. After lysis of induced cells, soluble proteins were separated from the
insoluble proteins by centrifugation. As shown by Coomassie Brilliant Blue R 250 and
protein blot analyses, the GST-gp40 was expressed as an insoluble protein, most likely
present in inclusion bodies (Figure 4.6, Lane 3). No fusion protein was detected in the
soluble fraction (Figure 4.6, Lane 4).

Insoluble proteins were separated on SDS-polyacrylamide gels, and the
expressed GST-gp40 was excised and eluted from the gel for antibody production.
Isolation of GST-gp40 was confirmed by protein blot analysis (Figure 4.6B and C, Lane
5), and its quantity was approximated by comparing it to a known amount of BSA
(Figure 4.6A, Lane 5; data not shown). Polyclonal antibodies made in rabbits were
depleted of oz-GST-antibodies as described by Bar-Peled and Raikhel (1996). To obtain
monospecific antibodies against the recombinant gp40, the GST-depleted antibodies
were further affinity purified against recombinant GST—gp40 that was immobilized onto
membranes.

To examine the subcellular localization of gp40, protoplasts were isolated from
tobacco suspension-cultured cells for subsequent nuclear isolation and biochemical
fractionation. Equal amounts of protein were separated by SDS-polyacrylamide gel
electrophoresis and visualized by Coomassie Brilliant Blue R 250 staining (Figure 4.7A)

or analyzed by protein gel blot analysis (Figures 4.7B and 4.7C).

137

Figure 4.6

Immunodetection of recombinant glutathione S—transferase (GST)-gp40 fusion protein
expressed in E. cali.

E. cali cells were transformed with pGEX-D (GST-gp40; uninduced, Lane 1), and
expression of GST—gp40 was induced (induced, Lane 2). After lysis of induced cells,
insoluble (containing inclusion bodies; Lanes 3) and soluble proteins (Lanes 4) were
separated by centrifugation. GST—gp40 was isolated from the insoluble protein fraction
by elution out of SDS-PAGE polyacrylamide gels (Lane 5). All lanes contained
proteins from equal amount of cells (7.5x107). Protein were separated by SDS-
polyacrylamide gel electrophoresis and visualized by Coomassie Brilliant Blue R 250
(A) or transferred to membrane for protein gel blot analysis. The GST-gp40 fusion
proteins were detected using oz—GST antibodies (B) or oz—rat aldose—l-epimerase (C).
Molecular mass standards are indicated at left in kilodaltons (kD).

kD 1
200 -

66-
45-

31-

138

 

139

Using oz-gp40 antibodies, a single protein with an apparent molecular mass similar to
that of gp40, was detected in total protoplasts (Figure 4.7B, Lane 1). As expected for
gp40, the antigen copurified with nuclei, as it was present in the crude nuclear (Figure
4.7B, Lane 3) and the purified nuclear fractions (Figure 4.7B, Lane 5). It was not
detected in the soluble fraction of 0.01% Triton X-100 treated protoplasts (Figure 4.7B,
Lane 2) indicating that it was not a cytosolic protein. Furthermore, it was neither
associated with membranes nor present in the ER lumen, because it was not released
upon exposure of crude nuclei to 0.6% Triton X-100 (Figure 4.7, Lane 4). The 40-kD
protein was partially solubilized when purified nuclei were incubated with DNase I
buffer (Figure 4.7, Lane 6). Furthermore, exposure of DNase I treated nuclei to 0.5
M salt led to the extraction of most of the remaining antigen (Figure 4.7, Lane 8).
These fractionation studies indicated that the 40-kD protein was associated with
peripheral structures of the nucleus. In addition, the results were in good correlation
with our previous extraction studies, in which we have identified gp40 as a tGlcNAc-
protein that was extracted from nuclei with 0.5 M salt (Chapter 2 and. 3; Heese-Peck
et al., 1995).

Based on its apparent molecular mass and biochemical properties, we concluded
that this antigen is most likely gp40. Upon enrichment in nuclear fractions, a second
protein with a slightly larger apparent molecular mass than gp40 was also detected by
the same antibody (Figure 4.7, Lanes 6 and 8). This protein may either represent gp40
with additional post translational modifications or an antigenically closely related

nuclear protein with similar biochemical properties as gp40.

140

Figure 4.7

Cofractionation of gp40 with the nucleus.

Proteins were fractionated and extracted from tobacco suspension—cultured cells under
the following conditions. Protoplasts (Lane 1) were broken in the presence of 0.01%
Triton X—100 and separated into cytoplasm I (Lane 2) and crude nuclei (Lane 3) by
centrifugation on a Percoll cushion. Crude nuclei were then incubated with 0.6%
Triton X-100 and separated into cytosol II/released membrane proteins (Lane 4) and
purified nuclei (Lane 5) by centrifugation on a Percoll gradient. Purified nuclei were
treated with DNase I and separated into soluble (Lane 6) and insoluble (Lane 7)
fractions by centrifugation. The insoluble fraction was then incubated with a 0.5 M
NaCl buffer and separated into soluble (Lane 8) and insoluble (Lane 9) fractions by
centrifugation. Equal amounts of proteins (20 pg) were loaded in each lane, separated
by SDS—polyacrylamide gel electrophoresis and either stained by Coomassie blue (A)
or transferred to lmmobilon—P membranes for protein blot analysis (B, C). Antibody—
reactive proteins were visualized using oz—gp40 antibodies followed by incubation with
Protein A—HRP (B) or oz—IMPoz antibodies followed by oz—IgG—AP (C).

Molecular mass standards are indicated in kilodaltons (kD). 0.01, 0.01% Triton X-
100; 0.6%, 0.6% Triton X—100; DNase, DNase I; NaCl, 0.5 M NaCl.

141

0.01% 0.6% DNase NaCl

kD

200 -

116 -
97 -
66 -

45-

31-'

 

0.01% 0.6% DNase NaCl

kD123456789
200-

116-

97-

66-

45- .

31 - ‘

0.01% 0.6% DNase NaCI
kD 1 2 3 4 5 6 7 8 9
200-
116-
97-
66-

45-

31-

142

In control experiments, it was observed that N T-IMPoz, the protein that binds to NLSs
(Smith et al., 1997), possessed a different subcellular localization than gp40 (Figure
4.7C). In agreement with its proposed function as a nuclear/cytoplasmic shuttle protein
and with irnmunofluorescence studies by Smith et al. (1997), NT-IMPoz was found in
cytoplasmic and nuclear fractions (Figure 4.7C, Lanes 1 to 5). The nuclear associated
form of NT-IMPoz behaved in part similar to gp40; it was partially extracted by DNase
I and 0.5 M salt (Figure 4.7C, Lanes 6 and 8). Consistent with results described by
Smith et al. (1997), NT-IMPoz appeared to be much tighter associated with the nucleus
than gp40, and a significant portion of the protein was still present in the insoluble 0.5

M salt fraction (Figure 4.7, Lane 6) .

To conclusively show that gp40 is indeed the 40—kD antigen detected by the oz—
gp40 antibodies, salt extracted nuclear proteins were subjected to nonradioactive in vitro
GalTF labeling assays followed by ECA column affinity chromatography. Column
fractions were collected as described above and analyzed by protein gel blot analysis
using oz-gp40 antibodies (Figure 4.8, Lanes 1 to 5). As expected, the antibodies
recognized a protein with a slightly higher apparent molecular mass than that of the
non-galactosylated 40—kD antigen due to the addition of Gal (Figure 4.8, Lane 1; data
not shown). Most of the protein bound to the ECA agarose and was eluted with lactose
and 1 M salt (Figure 4.8, Lanes 4 and 5), and it therefore displayed similar binding
properties as gp40 (Figure 2A and B). When blots were stripped and reprobed with
ECA-AP, this protein is also recognized by ECA-AP (Figure 4.8, Lane 7) further

demonstrating that it was a tGlcNAc-protein.

143

In addition to the galactosylated gp40, two proteins with a slightly larger apparent
molecular mass (43-45 kD) were detected in the lactose elute by the antibody (Figure
4.8, Lanes 4). These proteins are also tGlcNAc-proteins because they were detected by
ECA (Figure 4.8, Lane 6), and as discussed above, these proteins may be closely
related to gp40 or posttranslationally modified gp40.

Taken together, biochemical fractionation and ECA affinity chromatography
showed that the protein detected by the oz-gp40 antibodies was indeed gp40; it had the
same apparent molecular mass, similar biochemical prOperties and elution profile as
gp40, and it was also a tGlcNAc-protein. Further, these studies indicated that gp40 was
a nuclear tGlcNAc-protein with similar biochemical properties as peripheral NPC
proteins from vertebrates (Davis and Blobel, 1986; Kita et al., 1993; Radu et al.,

1994).

 

144

 

at-gp40 ECA-AP
kD 1 2 3 4 5 6 7
200-
116-

e
66-

45'. ~~

’3!"

31-

Figure 4.8

Purification of galactosylated gp40 by ECA affinity chromatography.

Salt extracted nuclear proteins were subjected to nonradioactive in vitro GalTF assay
in the presence of GalTF and separated into insoluble and soluble fractions by
centrifugation. The soluble fraction (Lane 1) was loaded onto ECA agarose columns,
and column fractions were collected as Lane 2, eluate; Lane 3, 0.1 M mannose wash;
Lane 4, 0.05 M lactose eluate; Lane 5, 1 M NaCl eluate. All fractions were subjected
to protein gel blot analysis using oz—gp40 antibodies followed by incubation with protein
A-HRP (Lanes 1-5). The blot containing Lanes 4 and 5 was then stripped of the probes
and reprobed with ECA-AP to visualize galactosylated tGlcNAc-proteins (Lanes 6 and
7, respectively). Molecular mass standards are indicated in kilodaltons (kD).

145

gp40 is a nuclear rim/NPC associated protein

Immunofluorescent microscopy was used to confirm the nuclear localization and
to further investigate the subnuclear localization of gp40. In general, tobacco
suspension-cultured cells were incubated with protoplasting enzymes for a short time
(less than 30 min) to ensure cell preservation during the fixation and labeling
procedures as confirmed by Nomarski optics (Figure 4.9C). The lightly protoplasted
cells were then fixed and incubated with oz—gp40 antibodies, followed by CY3-labeled
secondary antibodies. Consistent with the biochemical fractionation studies (Figure
4.7B), immunofluorescent labeling was primarily detected around the nuclear rim using
conventional light microscopy (Figure 4.9A).This labeling pattern was similar to that
of NPC proteins from other organisms, in particular for yeast NPC proteins (Wirmner
et al., 1992; Grandi et al., 1993; Siniossoglou et al., 1996). Immunofluorescent
labeling around the nuclear rim was further supported by staining protoplasts with
diaminophenylindole (DAPI; Figure 4.9B). The dye DAPI binds to DNA and is
commonly used to indicate the position and outline of the nucleus within a cell (Hicks
et al., 1996). We also observed in some cells low immunofluorescence labeling at the
cell’s periphery that was reminiscent of cell wall labeling (Figure 4.9A). At this point,
we do not know whether this labeling may be significant or represent non-specific
interaction of the antibody. If cells were protoplasted for a longer time (30 to 60 min),
we could only detect immunofluorescent labeling at the nuclear rim (Figure 4.9D);

these cells however, were not as well preserved.

146

Figure 4.9

gp40 is located at the nuclear periphery of tobacco protoplasts.

Tobacco suspension—cultured cells were protoplasted for less than 30 min (A—C, E, and
F) or for 30—60 min (D). Protoplasted cells were fixed and incubated with oz-gp40 (A-
E) or oz—IMPoz (F) antibodies followed by CY3-labeled secondary antibodies. The cells
were visualized by epifluorescent (A and D) or confocal laser scanning microscopy (E
and F). Cells in (C) were visualized by Nomarski optics, and DAPI staining was
visualized by epifluorescence (B).

Bar in (A) = 30 pM for (A)—(F).

k—

147

 

148

Labeling with CY3-labeled secondary antibody gave only low level of background
labeling within the entire cell (data not shown) indicating that primary antibody labeling
was specific. After locating gp40 by conventional light microscopy,
immunofluorescently labeled protoplasts were viewed in optical sections by confocal
laser scanning microscopy which confirmed that gp40 was primarily present at the
nuclear rim with little labeling within the nucleus (Figure 4.9B). In control experiments,
NT-IMPoz was localized to the cytoplasm, the nucleus and the nuclear rim (Figure
4.9F). These results are consistent with those previously obtained by Smith et al. (1997)
and with the biochemical fractionation studies (Figure 4.7C). Further, they confirmed
that the protoplast used in these studies were properly fixed and processed for
immunofluorescence.

To confirm that gp40 was localized at the nuclear rim, nine serial confocal
sections were taken in 1pm intervals through a series of planes from below to near the
top of particular nuclei (Figure 4.10, arrow). Importantly, the gp40-specific staining
was found to be associated with the nuclear rim in all sections. The results obtained
from the microscopy studies (Figures 4.9 and 4.10), taken together with the
biochemical fractionation studies (Figures 4.7B and 4.8), clearly indicated that gp40

was a tGlcNAc-protein associated with the nuclear rim.

149

Figure 4.10

gp40 is localized at the nuclear rim as shown in serial optical sections obtained from
laser scanning confocal microscopy.

Tobacco suspension-cultured cells were treated as in Figure 4.9E and observed in nine
successive optical sections (ZOl-Z09, 1pm intervals) using laser scanning confocal
microscopy).

Bar in (201) = 30pm for (201)—(209).

150

.k

.k

mam.mzmva.

g

www.mxmva.

mam . Nxmvm

.mmm.mzavm

NQN . Nxmvn...

va . Nxm—i

 

nmN.NIa—i

15 1
DISCUSSION

In the present studies, a combination of PCR-based amplification, cDN A library
screening, and 5’RACE were used to clone the gene encoding gp40. This tGlcNAc-
protein showed significant amino acid sequence similarity to aldose-l-epimerases from
bacteria. Using monospecific antibodies made against recombinant gp40, we confirmed
that gp40 was a nuclear tGlcNAc-protein with similar biochemical properties as
vertebrate NPC proteins. Consistent with its biochemical isolation, conventional light
and laser scanning immunofluorescent microscopy indicated that gp40 was primarily

found at the nuclear periphery of tobacco protoplasts.

gp40 is associated with structures at the nuclear periphery

As discussed in Chapter 3, the in vitro GalTF assay has served as an excellent
tool to identify and purify nuclear tGlcNAc-proteins including gp40. The production of
antibodies made against gp40 allowed a more detailed biochemical and microsc0pic
analysis of gp40. In agreement with our initial purification scheme, fractionation studies
showed that gp40 was a nuclear protein. Based on its extraction by 0.5 M salt, but not
by detergent treatment, gp40 appeared to be peripherally associated with nuclear
structures. In vertebrates, exposure of isolated nuclei to 0.5 M salt releases NPC
proteins that are present at the periphery of this large proteinaceous complex (Davis and
Blobel, 1986; Kita et al., 1993; Radu et al., 1994). Harsher conditions are usually
required to extract proteins that are located to the NPC core structures as well as to the
nuclear lamina/ matrix, a filamentous structure found throughout the nucleus (Dwyer and

Blobel, 1976; Davis and Blobel, 1986; Masuda et al., 1997). At this point, we do not

 

152

fully understand the release of gp40 by DNase I treatment. Based on immunofluorescent
microscopy, gp40 was found at the nuclear periphery, and only little labeling within the
nucleus. Therefore, we do not believe that this low amount could account for the
amount of gp40 released by DNAse I. It should be noted that the DNase I buffer used
in the present studies contained Mg“, a divalent ion shown to be involved in the
disassembly and reassembly of the nucleoplasmic basket in amphibian cells (J arnick and
Aebi, 1991). Our previous EM studies have demonstrated that proteins modified by
GlcNAc are mainly located at or adjacent to tobacco NPC as shown by EM (Heese-
Peck et al. , 1995). Consistent with these results, gp40 was primarily found at the
nuclear periphery using immunofluorescent microscopy pointing towards a possible
localization of gp40 to the NPC. Further, the labeling pattern was comparable to that
of NPC proteins from other organisms, in particular for yeast NPC proteins (W immer
et al., 1992; Grandi et al., 1993; Siniossoglou et al., 1996).

As mentioned above, gp40 has a putative signal sequence as well as at least one
putative NLS; However, we do not know whether they are used for gp40 localization.
It has been shown for several growth hormone peptides and the rat prostatic protein
probasin, that the presence of these two signals is not mutually exclusive, and both
signal can be functional and localized for dual protein localization (Maher et al., 1989;
Spence et al. , 1989; Kimura, 1993; Kiefer et al. , 1994). If hte putative signal sequence
is utilized for gp40 localization, it is possible that gp40 may associate with peripheral
nuclear structures after translocation into the ER lumen. For example, the vertebrate
NPC proteins, gp210 and Pom121, have functional signal sequences and appear to

provide contact sites for NPC proteins in the cytoplasm as well as in the ER lumen

 

153
(Wozniak et al., 1989; Greber et al., 1990; Hallberg et al., 1993). It should be,

however, pointed out that gp40 is modified by O-linked oligosaccharides with terminal
GlcNAc (Heese—Peck et al., 1995; N .V. Raikhel, A. Heese-Peck, A. Bacic;
unpublished). Although little is known about O-linked glycosylation in plants, it has not
been reported to occur in the ER, but rather in the Golgi apparatus as found also for
other higher organisms (Driouich et al., 1993). Further in vertebrates, the O-GlcNAc
is added in the cytoplasm by the O-linked GlcNAc transferase (for review, see Hart,
1997). The SPINDLY gene from A. thaliana, involved in gibberellin signal transduction
(J acobsen et al. , 1996), shows extensive sequence identity to genes encoding vertebrate
transferase (Lubas et al., 1997; Kreppel et al., 1997) indicating that O-linked

glycosylation may also occur in the cytoplasm in plants.

Sequence similarity of gp40 to aldose-l-epimerases

Interestingly, gp40 shares significant sequence identity (28-34%) to aldose-1-
epimerases from several bacteria, with the highest to that of A. calcaaceticus (34%
identity and 51% similarity). In addition, gp40 has a similar apparent molecular mass
as the bacterial enzymes (Poolman et al., 1990; Mollet and Pilloud, 1991; Maskell et
al., 1992; Bouffard et al., 1994). Considering the evolutionary distance of bacteria to
plants, it is noteworthy that bacterial aldose-l-epimerases have a similar percentage of
sequence identity (~ 30%) with gp40 as with each other (Poolman et al. , 1990; Mollet
and Pilloud, 1991; Maskell et al. , 1992; Bouffard et al. , 1994). Alignment of gp40 and
bacterial sequences show several well conserved blocks suggesting structural and maybe

even functional similarities. Based on early biochemical studies of purified aldose-1-

154

epimerases from different organisms, histidine, tyrosine, and tryptophan residues have
been proposed to be components of the active site (Wallensfeld et al. , 1965; Hucho and
Wallensfeld, 1971; Fishman et al., 1973). In the sequence alignment, one tryptophan
(W121), two histidine (H115, H192), and two tyrosine residues (Y163, Y194) are
conserved between all bacterial aldose—l—epimerases as well as gp40. To date, no
definitive amino acid residue has been assigned for aldose-l-epimerase function.
Bacterial enzymes and gp40 also shared considerable, but lower sequence identity
(~20%) to the carboxy-terminal portion of the fungal GallOp from S. cerevisiae and
P. tannaphilus, but the fungal proteins have a predicted mass of about twice the size
as gp40 and bacterial aldose-l-epimerases (Citron and Donelson; 1984; Skrzypek and
Maleszka, 1994).

Even though aldose-l-epimerases have been purified and its enzyme activity
characterized from different vertebrate tissues, no gene encoding an animal aldose-1-
epimerase has been cloned. Interestingly, immunohistochemical studies indicate that
aldose-l-epimerases in different rat tissues are nuclear proteins (Baba et al., 1979;
Toyoda et al., 1983). However, no further biochemical fractionation and subnuclear
localization have been reported. The polyclonal antibodies against rat kidney aldose-1-
epimerase (Toyoda et al. , 1983) recognized gp40 that was isolated by ECA-affinity
chromatography further supporting that gp40 was antigenically related to rat aldose-1-

epimerase.

155

Possible functions of gp40

In bacteria, aldose-l—epimerase functions in carbohydrate metabolism (Bouffard
et al., 1994); however, its exact function is unknown in higher organisms. Bailey et al.
(1967; 1970) argue against the involvement of the enzyme in metabolic sugar
breakdown in higher organisms, because its distribution in mammalian tissue is not
consistent with glycolytic capacity. In addition, a lack of any anomeric specificity for
enzymes that phosphorylate or dephosphorylate glucose (including hexokinase,
glucokinase, and pyrophosphate-glucose phosphotransferase) indicates a putative
function of aldose—l-epimerases in sugar utilization rather than sugar metabolism. Based
on inhibitor studies, the active site of aldose-l—epimerase has a similar structural
organization as the glucose carrier from erythrocytes indicating a possible function in
sugar binding and transport (Diedrich and Stringham, 1970a; 1970b). Due to its
sequence similarity to bacterial aldose-l-epimerases, gp40 may also be functionally
related to aldose—l—epimerases, but to date, we do not know whether gp40 possesses
enzyme activity. To address possible activity, we expressed gp40 in fusion to GST (see
above) or His-tag (data not shown) in E. call. The recombinant fusion proteins were
present in the insoluble fractions as inclusion bodies and, thus, could not be used for
activity assays (data not shown). It should be considered that proper glycosylation may
be required for enzyme activity. Expression in heterologous systems such as E. cali
may not be desirable, because gp40 will not be properly glycosylated. Thus,
purification of gp40 from plant tissue may be necessary that should exclude the use of

the in vitro GalTF assay to avoid additional modification of gp40.

156

The antibodies made against gp40 may be helpful to design a new purification scheme
and to directly isolate properly glycosylated gp40.

If gp40 proves to be an aldose-l-epimerase, gp40 may act on nucleosides and
nucleotide-containing substrates including UDP-sugars, DNA and RNA. One should,
however, keep in mind that the hydroxyl group at the C1 carbon of these molecules
provide the link to the attached base. Thus, these molecules may not serve as substrate,
because aldose-l-epimerases appear to require a free hydroxyl group at this particular
carbon (Feingold, 1982).

gp40 is modified by O-linked oligosaccharides with terminal GlcNAc (Chapter
2; Heese-Peck et al., 1995; N.V. Raikhel, A. Heese-Peck, T. Bacic, unpublished).
Because in vertebrate O—GlcNAc proteins, the glycosylation is proposed to function in
assembly and disassembly of multimeric protein complexes (for review, see Hart,
1997), the carbohydrate modification of gp40 may have a similar role in plants (see
Chapter 2 for detailed discussion).

The localization of gp40 at the nuclear periphery allows new speculation about
putative functions of aldose-l-epimerase-like proteins. A possible role of gp40 in
nuclear import of glycoproteins comes from studies from Duverger et al. (1995). The
authors report that glycosylated BSA is imported into the nucleus of permeabilized
HeLa cells in a sugar-specific manner. The nuclear import of these glycoproteins shares
some common features with the nuclear uptake of NLS-bearing proteins. Because
import of glycoproteins, however, is not competed by NLS-bearing proteins, a different
uptake mechanism has been proposed that may involve the presence of sugar-binding

proteins at the NPC (Duverger et al., 1995). It can be speculated that gp40 may serve

 

157

a similar role because it was not only located at the nuclear periphery, but also shared
sequence similarity with aldose-l-epimerases, enzymes that need to bind sugars to
accomplish their enzymatic function. The identification of gp40 may give new insights
into the function of aldose—l—epimerases in eukaryotes, and future experiments will be

designed to investigate possible roles of gp40 (Chapter 5).

158

References

Baba, S., Arimoto, Y., Yoshikawa, D., Toyoda, Y., Miwa, I., and Okuda, J.
(1979). The localization of mutarotase in rat kidney. Experienta 35, 1094-1097.

Bar-Peled, M., and Raikhel, N .V. (1996). A method for isolation and purification of
specific antibodies to a protein fused to the GST. Anal. Biochem. 241, 140-142.

Bailey, J .M., Fishman, P.H., and Pentchev, P.G. (1967). Studies on mutarotases.
1. Purification and properties of a mutarotase from higher plants. J. Biol. Chem. 242,-
4263-4269.

Bailey, J .M., Fishman, P.H., and Pentchev, P.G. (1970). Studies on mutarotases.
VI. Enzyme level and sugar reabsorption in developing rat kidney and intestine. J. Biol.
Chem. 245, 559-563.

Bouffard, G.G., Rudd, K.E., and Adhya, S.L. (1994). Dependence of lactose
metabolism upon mutarotase encoded in the gal operon in Escherichia cali. J. Mol.
Biol. 244, 269-278.

Citron, B.A. and Donelson, J .E. (1984). Sequence of the Saccharamyces GAL region
and its transcription in viva. J. Bacteriol. 158, 269-278.

Davis, L. (1995). The nuclear pore complex. Annu. Rev. Biochem. 64, 865-896.

Davis, L.I., and Blobel, G. (1986). Identification and characterization of a nuclear
pore complex protein. Cell 45, 699-709.

Diedrich, D.F., and Stringham, C.H. (1970a). Mutarotase: Still candidate for the role
of membrane carrier? Arch. Biochem. Biophys. 138, 493-498.

Diedrich, D.F., and Stringham, C.H. (1970b). Active site comparison of mutarotase
with the glucose carrier in human erythrocytes. Arch. Biochem. Biophys. 138, 499-505.

Doye, V. and Hurt, EC. (1997). From nucleoporins to nuclear pore complex. Curr.
Opin. Cell Biol. 9, 401-411.

Driouich, A., Faye, L. and Staehelin, LA. (1993). The plant Golgi apparatus: a

factory for complex polysaccharides and glycoproteins. Trends Biochem. Sci. 18,
210-214.

Duverger, E., Pellerin-Mendes, C., Mayer, R., Roche, A.-C., and Monsigny, M.
(1995). Nuclear import of glycoconjugates is distinct from the classical N LS pathway.
J. Cell Sci. 108, 1325-1332.

 

 

159

Dwyer, N. and Blobel, G. (1976). A modified procedure for the isolation of a pore
complex—lamina fraction from rat liver nuclei. J. Cell Biol. 70, 581-591.

Ebisu, S., Lonngren, J ., and Goldstein, I.J. (1977). Interaction of pneumococcal S
14 polysaccharides with lectins from Ricinus communis, T riticum vulgares, and
Bandeiraea simplicifolia. Carbohydrate Res. 58, 187-191.

Facchini, P.J., and Chappell, J. (1992). Gene family for an elicitor—induced
sesquiterpene cyclase in tobacco. Proc. Natl. Acad. Sci. USA 89, 11088-11092.

Feinberg, A.P., and Vogelstein, B. (1983). A technique for radiolabeling DNA
restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13.

Feingold, D.S. (1982). Aldo (and keto) hexoses and uronic acids. In Loewus, FA. and
Tanner, W. (ed.), Plant Carbohydrates I in Encyclopedia of Plant Physiology, Springer—
Verlag, Vol. 13A, 30—37.

Fishman, P.H., Kusiak, J.W., and Bailey, J.M. (1973). Studies on mutarotase:
Photooxidation reactions and nature of the enzyme catalysis. Biochem. 12, 2540—2544.

Forbes, DJ. (1992). Structure and function of the nuclear pore complex. Annu. Rev.
Cell Biol. 8, 495—527.

Gatz, C., Altschmied, J ., Hillen, W. (1986). Cloning and expression of the
Acinetabacter calcaaceticus mutarotase gene in Escherichia cali. J. Bacteriol. 168, 31-
39.

Goldberg, M.W., and Allen, T.D. (1995). Structural and functional organization of
the nuclear envelope. Curr. Opin. Cell Biol. 7, 301—309.

Giirlich, D., Mattaj, I.W. (1996). Nucleocytoplasmic transport. Science 271, 1513—
1518.

Grandi, P., Doye, V., and Hurt, EC. (1993). Purification of NSPl reveals complex
formation with ’GLFG’ nucleoporins and a novel nucleoporin NIC96. EMBO J. 12,
3061-3071.

Greber, U.F., Senior, A., and Gerace, L. (1990). A major glycoprotein of the
nuclear pore complex is a membrane-spanning polypeptide with a large lumenal domain
and a small cytoplasmic tail. EMBO J. 9, 1495-1502.

Hallberg, E., Wozniak, R.W., and Blobel, G. (1993). An integral membrane protein
of the pore membrane domain of the nuclear envelope contains a nucleoporin-like
region. J. Cell Biol. 122, 513-521.

160

Harlow, E., and Lane, D. (1988). Antibodies: A Laboratory Manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, N .Y.

Hart, G.W. (1997). Dynamic O-linked glycolsylation of nuclear and cytoskeletal
proteins. Annu. Rev. Biochem. 66, 315-335.

Heese-Peck, A., Cole, R.N., Borkhsenious, C.N., Hart, G.H., and Raikhel, N.V.
(1995). Plant nuclear pore complex proteins are modified by novel oligosaccharides
with terminal N—acetylglucosamine. Plant Cell 7, 1459-1471.

Hicks, G.R., and Raikhel, N.V. (1993). Specific binding of nuclear localization
sequences to plant nuclei. Plant Cell 5, 983-994.

Hicks, G.R., and Raikhel, N .V. (1995a). Nuclear localization signal binding proteins
in higher plant nuclei. Proc. Natl. Acad. Sci. USA 92, 734-738.

Hicks, G.R., and Raikhel, N.V. (1995b). Protein import into the nucleus: An
integrated view. Annu. Rev. Cell Dev. Biol. 11, 155-188.

Hicks, G.R., Smith, H.M.S., Lobreaux, S., and Raikhel, N.V. (1996). Nuclear
import in permeabilized protoplasts from higher plants has unique features. Plant Cell
8, 1337-1352.

Hucho, F., and Wallenfels, K. (1971). The enzymatically catalyzed mutarotation: The

mechanism of action of mutarotase (aldose-l-epimerase) from Escherichia cali. Eur.
J. Biochem. 23, 489-496.

Hurt, EC. (1988). A novel nucleoskeletal-like protein located at the nuclear periphery
is required for the life cycle of Saccharamyces cerevisiae. EMBO J. 7, 323-4334.

Jacobsen, S.E., Binkowski, K.A., and Olszewski, NE. (1996). SPINDLY, a
tetratricopeptide repeat protein involved in gibberellin signal transduction in
Arabidapsis. Proc. Natl. Acad. Sci. USA 93, 9292-9296.

Jarnik, M. and Aebi, U. (1991). Towards a more complete 3D structure of the nuclear
pore complex. J. Struc. Biol. 107, 291-308.

Jordan, E.G., Timmis, J.N., and Trewavas, A.J. (1980). The plant nucleus. In
Tolbert,N.E. (ed.), The Biochemistry of Plants, Academic Press, Inc. , Vol. 1, pp. 490-
588.

Kiefer, P., Acland, P., Pappin, D., Peters, G., and Dickson, C. (1994). Competition
between nuclear localization and secretory signals determines the subcellular fate of a
single CUG-initiated form of FGF3. EMBO J. 13, 4126-4136.

161

Kimura, H. (1993). Schwannoma-derived growth factor must be transported into the
nucleus to exert its mitogenic activity. Proc. Natl. Acad. Sci. 90, 2165-2169.

Kita, K., Omata, S., and Horigome, T. (1993). Purification and characterization of
a nuclear pore glycoprotein complex containing p62. J. Biochem. 113, 377-382.

Kreppel, L.K., Blomberg, M.A., and Hart, G.W. (1997). Dynamic glycolsylation
fo nuclear and cytosolic proteins. Cloning and characterization of a unique O-GlcNAc
transferase with multiple tetratricopeptide repeats. J. Biol. Chem. 272, 9308-9315.

Lane, W.S., Galat, A., Harding, M.W., and Schreiber, S.L. (1991). Complete
amino acid sequence of the FK506 and rapamycin binding protein, FKBP, isolated from
calf thymus. J. Prot. Chem. 10, 151-160.

Lis, H., Joubert, F.J., Sharon, N. (1985). Isolation and properties of N-
acetyllactosamine-specific lectins from nine Erythrina species. Phytochemistry 624,
2803—2809.

Lubas, W.S., Frank, D.W., Krause, M., and Hanover, J.A. (1997). O-linked
GlcNAc transferase is a conserved nucleocytoplasmic protein containing
tetratricopeptide repeats. J. Biol. Chem. 272, 9316-9324.

Maskell, D.J., Szabo, M.J., Deadman, M.E., and Moxon, ER. (1992). The gal
locus from Haemaphilus influenzae: cloning, sequencing and the use of gal mutants to
study lipopolysaccharide. Mol. Microbiol. 6, 3051-3063.

Maher, D.W., Lee, B.A, Donoghue, DJ. (1989). The alternatively spliced exon of
the platelet-derived growth factor A chain encodes a nuclear targeting signal. Mol. Cell
Biol. 9, 2251-2253.

Masuda, K., Xu, Z.-J., Takahashi, S., Ito, A., Ono, M., Nomura, K. and Inoue,
M. (1997). Peripheral framework of carrot cell nucleus contains a novel protein
predicted to exhibit a long alpha-helical domain. Exp. Cell Res. 232, 173-181.

Merkle, T., Leclerc, D., Marshallsay, C., and Nagy, F. (1996). A plant in vitro
system for the nuclear import of proteins. Plant J. 10, 1177-1186.

Miller, M.W., and Hanover, J .A. (1994). Functional nuclear pores reconstituted with
B-1,4 galactose-modified 0—linked N-acetylglucosamine glycoproteins. J. Biol. Chem.
269, 9289-9297.

Mollet, B., and Pilloud, N. (1991). Galactose utilization in Lactabacillus helveticus:
isolation and characterization of the galactokinase (galK) and galactose-l-phosphate
uridyl transferase (galT) genes. J. Bacteriol. 173, 4464-4473.

 

162

Mulhern, S.A., Fishman, P.H., Kusiak, J.W., and Bailey, J.M. (1973). Physical
characteristics and chemi-osmotic transformations of mutarotases from various species.
J. Biol. Chem. 248, 4163-4173.

Panté, N., and Aebi, U. (1993). The nuclear pore complex. J. Cell Biol. 122, 977-
984.

Poolman, B., Royer, T.J., Mainzer, SE, and Schmidt, BR (1990). Carbohydrate
utilization in Streptococcus thermaphilus: characterization of the genes for aldose-1-
epimerase (mutarotase) and UDPglucose 4-epimerase. J. Bacteriol. 172, 4037-4047.

Puissant, C., Houdeline, L.-M. (1990). An improvement of the single-step method of
RNA isolation by guanidinium thiocyanate-phenol-chloroform extraction. Biotechniques
9, 148-149.

Radu, A., Blobel, G., and Wozniak, R.W. (1994). Nup107 is a novel nuclear pore
complex protein that contains a leucine zipper. J. Biol. Chem. 269, 17600-17605.

Raikhel, N .V. (1992). Nuclear targeting in plants. Plant Physiol. 100, 1627-1632.

Roquemore, E.P., Chou, T.-Y., and Hart, G.W. (1994). Detection of O-linked N-
acetylglucosamine (O-GlcNAc) on cytoplasmic and nuclear proteins. Methods in
Enzymology 230, 443-460.

Rout, M.P., and Wente, S.R. (1994). Pores for thought: nuclear pore complex
proteins. TICB 4, 357-365.

Sambrook, J ., Fritsch, E.F., Maniatis, T. (1989). Molecular cloning: A laboratory
manual. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press).

Scofield, G.N., Beven, A.F., Shaw, P.J., and Doonan, J .H. (1992). Identification
and localization of a nucleoporin-like protein component of the plant nuclear matrix.
Planta 187, 414-420.

Siniossoglou, S., Wimmer, C., Rieger, M., Doye, V., Tekotte, H., Wiese, C.,
Emig, S., Segref, A., and Hurt, EC. (1996). A novel complex of nucleoporinswhich
includes Sec13p and a Seclp homologue is essential for normal nuclear pores. Cell 84,
265-275.

Skrzypek, M. and Maleszka, R. (1994). A gene homologous to that encoding UDP-
galactose-4-epimerase is inducible by xylose in the yeast Pachysalen tannaphilus. Gene
140, 127-129.

 

163

Smith, H.M.S., Hicks, G.R., and Raikhel, N.V. (1997). Importin oz from
Arabidapsis thaliana is a nuclear import receptor that recognizes three classes of import
signals. Plant Physiol. 114, 411-41.

Spence, A.M., Sheppard., P.C., Davie, J .R., Matuo, N ., McKeehan, W.L., Dodd,
J .G., and Matusik, R.J. (1989). Regulation of a bifunctional mRNA results in the
synthesis of secreted and nuclear probasin. Proc. Natl. Acad. Sci. 86, 7843-7847.

Toyoda, Y., Miwa, I., and Okuda, J. (1983). Multiple forms of mutarotases from the
kidney, liver, and small intestine of rats: Purification, properties, subcellular
localization and developmental changes. J. Biochem. 94, 421-431.

von Heijne, G. (1986). A new method for predicting signal sequence cleavage sites.
Nucleic Acids Res 14, 4683-4690.

Wimmer, C., Doye, V., Grandi, P., Nehrbass, U., and Hurt, EC. (1993). A new
subclass of nucleoporins that functionally interacts with nuclear pore protein NSPl.
EMBO J. 11, 5051-5061.

Wozniak, R.W., Bartnik, E., and Blobel, G. (1989). Primay structure analysis of an
integral membrane glycoprotein of the nuclear pore. J. Cell Biol. 108, 2083-2092.

 

Chapter 5

Conclusions and future directions

164

 

165

The N PC regulates communication between the nucleus and the cytoplasm by
controlling the movement of macromolecules, such as proteins and RNA species, in and
out of the nucleus. The identification of NPC proteins is crucial in elucidating the
molecular mechanism that underlies the continuous transport of such diverse molecules.

When we started this project nearly five years ago, only seven genes encoding
NPC proteins had been isolated from vertebrates and yeast (Chapter 1; Forbes, 1992).
At that time and during the following years, no plant homologs to known N PC proteins
were available in the EST databases. As determined by EM, antibodies against several
vertebrate NPC proteins that were made available to us did not specifically crossreact
with plant NPC proteins (A. Heese-Peck, O.N. Borkhsenious, N.V. Raikhel,

unpublished). Thus, we had to consider other means to identify plant NPC proteins.

In vertebrates, some NPC proteins are posttranslationally modified by single 0-
GlcN Ac residues (Davis, 1995; Hart, 1997). Because the lectin WGA binds specifically
to GlcNAc, this sugar modification has served as an useful tool for identifying and
purifying these glycoproteins (Forbes, 1992; Davis, 1995). As an initial step to identify
plant NPC proteins, we demonstrated that NPC proteins from tobacco suspension-
cultured cells were also modified by GlcNAc residues. As shown by EM using WGA
as a probe, specific labeling was often found associated with or adjacent to NPCs
(Chapter 2; Heese-Peck et al., 1995). These glycoproteins possessed similar
biochemical properties as described for vertebrate NPC proteins associated with

peripheral N PC structures (Chapter 2).

 

166

Further sugar analysis showed that most of theses tobacco glycoproteins were
modified by O-linked glycans with terminal GlcNAc residues. Interestingly, the plant
carbohydrate modification appeared to be more complex than the single O-GlcNAc
found on vertebrate NPC proteins. The plant glycans were composed of
oligosaccharides larger in size than five GlcNAcs (Chapter 2; Heese-Peck et al. , 1995).
It is noteworthy that yeast NPC proteins do not seem to contain any type of GlcNAc
modification (Rout and Wente, 1994). Thus, the glycan complexity is different in the
various kingdoms. Moreover, the function of any of the sugar modifications is not
understood. The gene encoding O-GlcNAc transferase, the enzyme specific for the
attachment of O-GlcNAc to proteins, has been recently isolated from vertebrates
(Kreppel et al. , 1997; Lubas et al., 1997). It shows extensive sequence similarity to the
SPINDLY gene from Arabidapsis identified Dr. N. Olszewski laboratory (Univ. of
Minnesota; Jacobsen et al., 1996). The SPINDLY gene was originally isolated from a
gibberellin responsive mutant indicating a possible involvement of this proteins in GA
signal transduction. Further analysis of SPINDLY may help to gain a better
understanding in the function of GlcNAc modifications in plants and animals. An initial
step is the identification of target substrates, and the nuclear tGlcN Ac proteins identified
in Chapter 2, 3, and 4 may be candidates. In addition, Dr. Olszewski’s laboratory is
currently using the purification scheme developed in these studies (Chapter 3) to isolate
other putative target proteins modified by terminal GlcNAc.

A more detailed characterization of the carbohydrate composition may further
help to understand the possible functions of O-linked sugar modifications. These

analyses are being pursued in collaboration with Dr. Bacic’s laboratory (Univ. of

167

Melbourne, Australia). Although the lack of a purification scheme compatible with the
methods used for sugar analysis hampered our initial attempts to elucidate the sugar
composition of these unusual plant glycans (N.V. Raikhel, A. Heese-Peck, A. Bacic;
unpublished), antibodies against gp40 (Chapter 4) may serve as a useful tool in
designing a new protein purification scheme.

Galactosylation of tGlcNAc-proteins enabled us to purify these glycoproteins by
ECA affinity chromatography (Chapter 3). This purification scheme was efficient in
obtaining amino acid sequence information of three tGlcNAc-proteins, namely gp33,
gp40, and gp65, with similar properties as described for vertebrate NPC proteins. The
peptide sequence information obtained from gp40 led to the subsequent isolation of the
gene encoding gp40 (Chapter 4). Consistent with its isolation as a putative NPC
protein, gp40 was found at the periphery of the nucleus using immunofluorescent
microscopy. The precise localization of gp40 will require EM immunocytochemistry.
These experiments will be done with the help of Dr. V. Kovaleva, an EM specialist
joining the Raikhel laboratory at the beginning of 1998.

As described in Chapter 4, gp40 may have a role in nuclear import. To address
this, purified gp40 as well as a-gp40—antibodies may be used in the in vitro nuclear
import system developed in our laboratory (Hicks et al., 1996). Based on the selective
permeabilization of the plasma membrane, this assay will provide an excellent means
to study the function of gp40 in nuclear import of glycoproteins and NLS-containing

proteins .

 

168

Sequence analysis indicated that gp40 was similar to aldose-l-epimerases. To
date, we do not know whether gp40 also has aldose—l-epimerase activity. To address
possible enzyme activity, we expressed gp40 in E. cali. The recombinant protein was
insoluble and, thus, could not be used for activity assays (Chapter 4). It is possible that
proper glycosylation of gp40 may be required for enzyme activity. Purification of gp40
from plant tissue may therefore be favored over expression in heterologous systems
such as E. cali or yeast that do not provide proper glycosylation of gp40. Further,
purification from plant tissue should exclude the use of in vitro GalTF assays, in which
gp40 is modified by additional galactose. The antibodies made against gp40 (Chapter
4) may provide an useful tool to directly isolate properly modified gp40.

In general, the function of aldose-l-epimerases is not known in higher
organisms. Thus, analysis of gp40 may provide new insight into the function of aldose-

1-epimerases in eukaryotes.

169

References
Davis, L. (1995). The nuclear pore complex. Annu. Rev. Biochem. 64, 865—896.

Forbes, DJ. (1992). Structure and function of the nuclear pore complex. Annu. Rev.
Cell Biol. 8, 495-527.

Hart, G.W. (1997). Dynamic O-linked glycosylation of nuclear and cytoskeletal
proteins. Annu. Rev. Biochem. 66, 315—335.

Heese-Peck, A., Cole, R.N., Borkhsenious, O.N., Hart, G.H., and Raikhel, N.V.
(1995). Plant nuclear pore complex proteins are modified by novel oligosaccharides
with terminal N-acetylglucosamine. Plant Cell 7, 1459-1471.

Hicks, G.R., Smith, H.M.S., Lobreaux, S., and Raikhel, N.V. (1996). Nuclear
import in permeabilized protoplasts from higher plants has unique features. Plant Cell
8, 1337—1352.

Jacobsen, S.E., Binkowski, K.A., and Olszewski, NE. (1996). SPINDLY, a
tetratricopeptide repeat protein involved in gibberellin signal transduction in
Arabidapsis. Proc. Natl. Acad. Sci. USA 93, 9292—9296.

Kreppel, L.K., Blomberg, M.A., and Hart, G.W. (1997). Dynamic glycosylation
of nuclear and cytosolic proteins. Cloning and characterization of a unique O-GlcNAc
transferase with multiple tetratricopeptide repeats. J. Biol. Chem. 272, 9308—9315.

Lubas, W.S., Frank, D.W., Krause, M., and Hanover, J.A. (1997). O-linked
GlcNAc transferase is a conserved nucleocytoplasmic protein containing
tetratricopeptide repeats. J. Biol. Chem. 272, 9316—9324.

Rout, M.P., and Wente, S.R. (1994). Pores for thought: nuclear pore complex
proteins. TICB 4, 357—365.

 

 

“IIIIIIIIIIIIIIIIIIII