N
LIBRARY

MIchIgan State
UnIversIty

‘

 

 

PLACE IN RETURN BOX
to remove this checkout from your record.
TO AVOID FINES return on or before date due.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

”501125125306 0

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1/98 chIRC/DateDm.p65-p.14

CHARACTERIZATIONS OF BACULOVIRUS GENES INFLUENCING
INFECTIVITY IN INSECT CELL LINES AND LARVAE

By

Chi-Ju Chen

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Program in Genetics

1997

ABSTRACT

CHARACTERIZATIONS OF BACULOVIRUS GENES INFLUENCING
INFECTIVIT Y IN INSECT CELL LINES AND LARVAE

By
Chi-Ju Chen

Baculoviruses are invertebrate-specific pathogens that generally infect a single
species or a few closely related species. Autographa califomica nucleopolyhedrosis
virus (AcNPV) reportedly infects at least 33 species of lepidopteran larvae and over 25
different cell lines. Unusually broad host range of AcNPV makes it an idea virus to
study baculovirus host specificity. The primary objective of this project is to identify
and study the genes influencing baculovirus infectivity in insect cell lines and larvae.

A genetic approach was used to address AcNPV host—specificity determination.
A thymidine analog was used to mutate AcNPV. Mutants that had reduced infectivity in
one previously permissive cell line were selected as potential host-range mutants. Two
mutants, T295 and T297, which had reduced occluded virus (0V) production in SF—21
and SElc cells but had wild-type OV production in TN368, were isolated from TN368
cells. A fragment containing pk2, ORF247, lef- 7, and chitinase were deleted in both
mutants. To determine which gene was responsible for the mutant phenotype,
recombinant viruses were generated in which individual ORFs were disrupted. The
phenotypes of recombinant viruses vdel-AG in which all four ORFs were deleted, and
v1ef7-AG in which only lef-7 was deleted, were identical to the mutants. The
phenotypes of recombinant viruses with deletions of the other ORFs were
indistinguishable from wt AcNPV. This data indicated that lef-7 was a cell line specific
factor. We also demonstrated that lef-7 stimulates viral DNA replication in permissive
cell lines by dot blot analysis. To investigate the effects of lef-7 deletion on AcNPV
larval infectivity, bioassays using vlef7-AG were conducted on S. frugiperda and T. ni

larvae. For both species, the lethal concentration 50% (LC50) for v1ef7-AG was

i

approximately 50-fold higher than AcNPV, indicating that lef-7 was required for
optimum AcNPV larval infection in both species. vlef7-AG has reduced OV production
and viral DNA synthesis in another T. ni cell line BTI-TN5B1-4 (Hi5), which was
derived from different tissues. Different requirements of lef-7 for AcNPV replication in
two T. ni cell lines suggested that lef-7 may function as a tissue-specific factor.
Another baculovirus gene, host range factor-1 (hrf-I) from Lymantria dispar
NPV was also studied. hrf-I expands AcNPV infectivity for a nonpermissive cell line,
Ld652Y. In this study, we demonstrated that recombinant AcNPV bearing hIf-I
infected the nonpermissive larval host L. dispar . Electron microscopy studies and
polymerase chain reaction (PCR) analyses revealed that AcNPV enters and replicates in
L. dispar epithelium. This suggests that AcNPV is incapable of establishing a
secondary infection. LdNPV hrf-I may help AcNPV to overcome the barriers that

prevent AcNPV from spreading systematically.

To my parents Chen Wen-Song and Lai Mei—Chih
and

my brothers, Chi-Chu and Chi-Jen

 

ACKNOWLEDGMENTS

I would like to thank my advisor Dr. Suzanne Thiem for her constant
intellectual input, guidance and patience. I always admire her devotion and dedication to
the research. I thank my committee members Drs. Richard Allison, Will Kopachik, and
James Miller for their suggestions and discussions. I thank members from Dr. Thiem's
and Dr. Alex Raikhel’s labs, past and present, for their help and comradeship;
especially Dr. Martha Quentin, Hugh Smeltekop, and Steven Cassar for their friendship
and moral support. Above all, I would like to express my gratitude to my parents and

my brothers as well as my cat, Helix, for their love and support.

TABLE OF CONTENTS

LIST OF TABLES ........................................................................... ix
LIST OF FIGURES ......................................................................... x
CHAPTER 1
Introduction ................................................................................... 1
General introduction ................................................................ 2
Baculovirus infect process ......................................................... 3
Regulation of baculovirus gene expression ...................................... 5
Determinants of baculovirus ....................................................... 9
Baculovirus genes that influence host range ..................................... 10
Scope of the study .................................................................. 13
References .................................................................................... 15
CHAPTER 2
Differential infectivity of two Autographa califomica nucleopolyhedrovirus
mutants on three permissive cell lines is the result of lef-7 deletion .................... 23
Abstract ............................................................................... 24
Introduction .......................................................................... 25
Materials and Methods .............................................................. 27
Results
Characterizations of mutant viruses T295 and T297 ................... 31
Construction of recombinant viruses .................................... 36
Viral replication ............................................................. 39
Immunoblot analysis ....................................................... 42
Discussion ........................................................................... 47
Acknowledgments .................................................................. 50
References ........................................................................... 51
CHAPTER 3
lef-7 deletion reduces AcNPV infectivity in Trichoplusia ni larvae and cell line
BTI-TN5B1-4 ................................................................................ 55
Abstract ............................................................................... 56
Introduction .......................................................................... 57
vi

 

Materials and Methods .............................................................. 60

Results
lef-7 deletion reduced AcNPV larval infectivity ........................ 63
v1ef7-AG BV and 0V productions in Hi5 cells ......................... 63
lef-7 deletion reduced viral DNA replication in Hi5 cells .............. 65
Discussion ........................................................................... 70
References ........................................................................... 72
CHAPTER 4
An investigation of the possible functions of Autographa califomica
nucleopolyhedrovirus lef- 7. ................................................................ 75
Abstract ............................................................................... 76
Single stranded DNA binding assays ............................................. 77
Nitrocellulose filter binding assay ................................................. 80
Immunoprecipitation ................................................................ 83
References ........................................................................... 89
CHAPTER 5
Autographa califomica nucleopolyhedrovirus (AcNPV) ORF247 is nonessential
for AcNPV infectivity or DNA replication on three permissive insect cell lines ...... 91
Abstract ............................................................................... 92
ORF247 is a non-essential gene for AcNPV infection .......................... 93
Reference ............................................................................. 105
CHAPTER 6
Lymantria dispar nucleopolyhedrovirus hIf-I expands larval host range of
Autographa californica nucleopolyhedrovirus ............................................ 107
Abstract ............................................................................... 108
Introduction .......................................................................... 109
Materials and Methods .............................................................. 113
Results
hrf-I promotes AcNPV replication in L. dispar larvae ................ 117
AcNPV replicates in third instar L. dispar midguts ................... 126
hrf—I increase AcNPV infectivity for H. zea ............................ 129
Discussion ........................................................................... 133

vii

Acknowledgments .................................................................. 137

 

References ........................................................................... 138

APPENDIX A

Baculovirus host-range mutant screening in insect cell lines ........................... 143
Abstract ............................................................................... 144
Host—range mutant screening in insect cell lines 145
Acknowledgments .................................................................. 154
References ........................................................................... 155

APPENDIX B

Physical Map of Anagraphafalcifera Nuclear Polyhedrosis Virus (AfMNPV) ....... 156
Abstract ............................................................................... 157
Introduction .......................................................................... 158
Physical map of AfMNPV ......................................................... 160
Acknowledgments .................................................................. 169
References ........................................................................... 170

viii

Table 1.1.

Table 3.1

Table 6.1

Table 6.2

Table A.1

Table A2

Table B.1

LIST OF TABLES

Baculovirus genes that are involved in determination of host
range ......................................................................... 11

Dose response of Trichoplusia m' and Spodopterafrugiperda
neonates infected per 03 with wild type AcNPV or vlef7-AG, a
lef- 7-minus mutant ......................................................... 64

Dose response of L. dispar neonates infected per as with AcNPV,
vAchPD, or LdNPV ..................................................... 118

Dose response of Plutella xylostella, Spodoptera exigua and
Helicoverpa zea second instar infected per as with AcNPV,
vAchPD, or vAchPS ................................................... 131

Number of potential host-range mutants in initial screening of
plaques isolated from SF-21, TN368, and SElc cells ................. 150

Percentage of cells containing occluded virus (0V) in mutant-
infected SF—21, TN368, or SElc cells at 48 hours post infection... 151

AfMNPV DNA restriction endonuclease fragment sizes in kbp ...... 163

ix

Figure 2.1
Figure 2.2
Figure 2.3

Figure 2.4

Figure 2.5
Figure 2.6

Figure 3.1

Figure 3.2
Figure 4.1

Figure 4.2

Figure 4.3
Figure 4.4

Figure 5.1

Figure 5.2

Figure 5.3
Figure 5.4
Figure 6.1

LIST OF FIGURES

BV production and PIB production on different cell lines ............ 32

 

Restriction analysis of viral genomes 34

Identification of the deleted regions of mutant viruses and the
construction of recombinant Viruses 37

 

Budded virus production and percentage of cells with PBS in

cells infected with vlef7-AG or AcNPV ................................. 40
Viral DNA synthesis ....................................................... 43
LEF-7 expression in three cell lines infected with AcNPV ............ 45

Budded virus production and percentage of cells with. OVs in
cells infected with vlef7-AG or AcNPV ................................. 66

Viral DNA synthesis ....................................................... 68

A Coomassie blue staining SDS-PAGE gene of the single—
stranded DNA binding assay using MBP-LEF—7 fusion protein ..... 79

Single—stranded DNA binding assay using nuclear extract from

 

AcNPV-infected SF—21 cells .............................................. 81
Nitrocellulose filter binding assays 84
Immunoprecipitation assay ................................................ 87

An expanded map showing the distribution of major ORFs
between PstI sties at 76.3 and 78.4 m n 95

(a) Budded virus production and (b) percentage of cells with OV

 

in cells infected with AcNPV or vORF247-AG ........................ 97
Viral DNA synthesis ....................................................... 100
Northern blot analysis of ORF247 102
PstI restriction pattern comparison between AcNPV, vAchPD,

DNA isolated form OV that were isolated from

vAchPD-inoculated L. dispar neonates, and LdNPV ................ 120

Figure 6.2 Sequence comparison of the primer region within the polyhedrin
gene among baculovirmeq

 

Figure 6.3 PCR products amplified using primer pairs specific to AcNPV
polyhedrin gene ............................................................

Figure 6.4 Electron micrographs of AcNPV—infected third instar L. dispar
larvae midgut cells at 48 hr p i

 

Figure 6.5 PCR products amplified from L. dispar midgut tissues using
primer pair specific to AcNPV polyhedrin gene .....................

Figure A.1 Viral titers following BUdR treatment in AcNPV-infected SF-2l
cells ..........................................................................

Figure A.2 Host-range mutant screening on three insect cell lines ................
Figure B.1 Gel photograph and schematic representation of restriction

fragment profiles of AfMNPV and AcNPV DNA cleaved
with EcoRI, HindIII, PstI and Xhol

 

 

Figure B.2 Physical map of AfMNPV

122

124

127

130

147

148

161

. 166

 

Chapter 1

Introduction

General introduction

Alternative methods are needed to control insects especially as more and more
pests become resistant to chemical insecticides. Bioinsecticides developed from insect-
specific pathogens are one of the options. Baculoviruses have been considered for use
in pest management, and have been used to control forest pests (Podgwaite, 1985) and
agricultural pests, such as Anticarsia gemmatlis, a soybean pest (Moscardi, 1989;
Camer, 1977). The primary advantage of using baculoviruses to control pests is that
they discriminately kill specific pests and do not harm non-targeted species. Ironically,
their specific host range makes them less attractive from an economic point of view,
because different viruses may be needed to control several pests, and this may
ultimately cost farmers more than chemical insecticides. A disadvantage of using
baculoviruses for pest control is their slow speed of action. It often takes days to weeks
to kill infected-insects. However, researchers have developed baculoviruses that take
less time to stop their hosts from feeding by introducing foreign genes such as toxins
(Steward et al., 1991; Tomalski and Miller, 1991; Kunimi et al., 1996) and juvenile
hormone (JH) esterase which modifies J H (Hammock et al., 1990; Kunimi et al.,

1996), or deletion of ecdysteroid UDP-glucosyl transferase (egt) that inhibits insect
molting (O’Reilly and Miller, 1990, 1991; Flipsen et al., 1995a). Gaining knowledge
regarding host-specificity is essential to develop better genetically engineered
baculoviruses for pest control. The ultimate goal is to generate Viruses that would kill
mutiple pests and kill them in a shorter time than wild type, while remaining harmless
to non-targeted species.

Baculoviruses are invertebrate-specific pathogens. Infection by most
baculoviruses is restricted to a single or a few closely related species (Groner, 1986).
Reports of over 600 insect species infected by baculoviruses were cataloged by
Martignoni and Iwai (1986), but only a few of these viruses have been isolated or
characterized at the molecular level. Among all the baculoviruses, AcNPV, a

baculovirus prototype which has a 134 kb genome that potentially encodes 154 proteins

 

 

(Ayres et al., 1994), has been studied most extensively with respect to biological
pathological, and molecular aspects (for reviews, Faulkner, 1981; Granados and
Federici, 1986; Blissard and Rohrmann, 1990; Rohrmann, 1992; Ayres et al., 1994).
AcNPV reportedly infects at least 33 lepidopteran larvae (Groner, 1986) and 25 cell
lines (Hink 1970; Hink and Hall, 1989). The unusually broad host range of AcNPV
compared to other baculoviruses, which in most cases infect a single species or few
species in a family, makes it an ideal virus to study host range determinants. However,
although its genome has been completely sequenced (Ayres et al. , 1994) and many
genes have been chatacterized, relatively little is known about the genes that are
responsible for the ability of AcNPV to infect a broad range of insect species and cell

lines.

Baculovirus infection process

The family Baculoviridae comprises two genera, nucleopolyhedrovirus (NPV)
and granulovirus (GV). NPVs have single or multiple nucleocapsids containing virions
embedded in a polyhedrin protein matrix. GVs have a single virion with a nucleocapsid
surrounded with proteinaceous granule. Two morphological forms of viruses are
produced during the NPV infection cycle. Budded virus (BV), synthesized early in the
infection cycle, is released from the infected cells by budding from the cytoplasm
membrane and is responsible for cell to cell dissemination. Later in the infection cycle,
occluded virus (0V), also known as polyhedron inclusion bodies (PIBs), are
assembled in the cell nucleus. This form, which persists in the environment, is
responsible for spreading the virus among insect populations.

In nature, baculovirus-killed larvae typically lyse and release a massive amount
of 0V onto soil and foliage. Caterpillars, the larvae of butterflies and moths, become
infected after they ingest the food contaminated with OV. Baculovirus can also be

transmitted by cannibalism (Dhandapani et al., 1993; Evans, 1986), and infectious

 

 

.g-

 

4

NPV can be released on plants through feces and regurgitation Wasconcelos, 1996; Ali
et al., 1987). It remains controversial if larvae can acquire virus through vertical
transmission, also known as parent-to—offspring passage (Fuxa et al., 1994; Fuxa and
Richter, 1991; Shapiro and Robertson, 1987). Primary infection is initiated in midgut
epithelial cells when ingested polyhedra dissolve in the alkaline environment of the
midgut and embedded virions are released into the midgut lumen (Hanap and
Longworth, 1974). The virions enter midgut cells by receptor—mediated fusion with the
membrane of the microvilli (Granados and Lawler, 1981; Horton and Burrand, 1993).
After entering the epithelial columnar cells, released nucleocapsids are transported to the
nuclei where the progeny viruses are synthesized. Following virus replication, BV is
released and spreads the infection to other tissues (Keddie et al., 1989; Flipsen et al.,
1995b).

To initiate a systemic infection, baculoviruses have to efficiently spread from
primary sites and replicate in various tissues. However, it is controversial when and
how the viruses spread. In a study by Granados and Lawler (1981), parental AcNPV
virions were found to directly bud into the intercellular space and through basal lamina
into the hemocoel of T. m' larvae. The basal lamina is a thick layer of proteinaceous
matrix (Locke, 1985) that can exclude particles smaller than nucleocapsids (Reddy and
Locke, 1990), yet viral particles are found in the hemocoel. How viruses pass this
basal lamina is not clear. One possibility is that baculoviruses might express an enzyme
that damages this matrix to allow the viruses to pass. Yet, more recent studies on
AcNPV—infected T. ni (Keddie et al., 1989) and Spodoptera exigua (Flispen et al.,
1995b) reveals that secondary infection in diverse tissues only occurs after viral
replication in the primary infection site, midgut epithelium.

Studies in Pseudaletia unipuncta, T. ni, and S. exigua larvae by Ritter et al.
(1982), Engelhard et al. (1994), and Flipsen et al. (1995b), respectively, suggested that

viruses circumvent this barrier by spreading from the midgut via the tracheal system.

From the morphological point of view, spread through the tracheal system would be
efficient since tracheal cells are in close contact with various tissues and organs.
Although the virus can reach all tissues via tracheoles, it may exhibit tissue tropism
during the secondary infection. Using a reporter gene under the control of early, late or
very late baculovirus promoters, Knebel-Mb'rsdorf et al. (1996) demonstrated that
aborted infection occurs in certain tissues in AcNPV-infected S. exigua larvae. Early
promoter activity is detected in these tissues, demonstrating viral entry and initiation of

infection.

Regulation of baculovirus gene expression

Knowledge of viral genes that are necessary to support gene expression and
viral replication in a given host provides basic information for defining virus/host
interactions. Baculovirus gene expression, primarily regulated at the transcriptional
level (Friesen and Miller, 1986), can be divided into three phases - early, late and very
late. Each phase is regulated in an ordered cascade of events in which the successive
phase depends on the previous phase. Early genes, whose expression is independent of
viral DNA replication, are transcribed by an or—amanitin-sensitive host RNA polymerase
II (Grula et al., 1981; Huh and Weaver, 1990; Hoops and Rohrmann, 1991). Late and
very late genes, expressed after the onset of viral replication, are transcribed by a virus—
induced a—amanitin—resistant RNA polymerase activity (Fuchs et al., 1983; Grula et al.,
1981; Huh and Weaver, 1990; Beniya et al., 1996). It is likely that this novel
polymerase is encoded by the virus and viral genes that share sequence motifs with
RNA polymerases have been identified (Passarelli et al., 1994; Lu and Miller, 1994).
However, no enzyme activity has been demonstrated.

IE-l, the product of ie-I (immediate early-1), is an multifunctional trans-
regulator for early, late and very late gene expression (Guarino and Summers, 1987;

Passarelli and Miller, 1993c, Ribeiro et al., 1994), and plays a central role in the

regulation of viral gene expression. Omission of ie-I resulted in undetectable levels of
plasmid replication in plasmid replication assays (Lu and Miller, 1995a) and diminished
late and very late gene expression in transient assays using SF—21 (Spodoptera
frugiperda ) cells (Todd et al., 1995; Passarelli and Miller, 1993c). It is also possible
that IE] enhances activity of the AcNPV origins of replication (homologous regions,
hrs) (Pearson et al., 1992) by binding to these regions. IE-l also stimulates
transcription through cis-acting hrI to hr5 sequences (Guarino and Summers, 1986;
Nissen and Friesen, 1989; Theilmann and Stewart, 1991). Rabbit reticulocyte extract-
translated IE-l binds hr5 in the absence of insect cell factors (Choi and Guarino, 1995).
Another early gene product IE-2, also known as IE-N is down regulated by IE-l
(Carson et al., 1991b) and modulates both ie-I and its own expression (Carson er al.,
1991a; Kovacs et al., 1991; Theilman and Steward, 1992; Y00 and Guarino, 1994a).
In transient assays, IE-2 augments transcription from early, late and very late promoters
(Guarino and Summers, 1988). It was also shown that IE-2 activates other baculovirus
immediate early genes in viva. (Y00 and Guarino, 1994).

Eighteen late expression factors (lefs) were first identified from AcNPV using
transient expression assays based on the ability of individual clones from an AcNPV
overlapping library, representing the entire genome, to support expression of reporter
genes under the control of late (capsid (vp39) or p6.9 ), or very late (polyhedrin (polh)
or p10 ) viral promoters in SF-21 cells (Todd et al., 1995; Todd and Miller, 1996). The
lefs, ie-I, ie—2, lef-I through 11, p35 , p47, 39k , p143, and dnapol (Todd et al., 1995;
Passarelli and Miller, 1994a; 1994b; 1993a; 1993b; 1993c; Morris et al., 1994; Lu and
Miller, 1994; Li et al., 1993; Possee et al., 1991) are required for maximum AcNPV
late gene expression. It is likely that some of the lefs affect the transition of the RNA
polymerase activity, such as being parts of the multisubunit AcNPV RNA polymerase
complex that is associated with late gene expression. This is supported by the findings

that [cf-8 (Passarelli et al., 1994) and lef-9 (Lu and Miller, 1994) share conserved

motifs found in the two largest subunits of prokaryotic and eukaryotic RNA
polymerases. The controls of the switch of early to late gene exprssion are not clear. It
is possible that some of the lefs expressed as early genes are involved in this switch.
All lefs also affected the steady-state level of reporter gene RNA in RN ase protection
analysis (Lu and Miller, 1995a). The strong correlation between the levels of reporter
gene expression and the levels of transcripts, when individual lefs were omitted (Lu
and Miller, 1995a), suggested that none of the lefs acted at the level of translational
regulation.

A subset of lefs, including ie-I, lef-I, 2, 3 (Lu and Miller, 1995a; Kool et al.,
1994), p143, and p35 (Lu and Miller, 1995), are essential for viral DNA replication in
transient plasmid replication assays, while ie-2, lef-7, and dnapol had stimulatory
effects (Lu and Miller, 1995a). Using similar assays, Kool et al. (1994) reported that
dnapol is essential, p35 is stimulatory, and lef-7 was not identified to influence DNA
replication (Lu and Miller, 1995a). The different results between these two groups may
result from technical differences in their approaches, such as the reporter plasmids and
time points used. How these lefs are involved in viral DNA replication is not
completely understood. Because p35 can be functionally substituted by heterologous
apoptosis suppressors Cp-iap or Op-iap in plasmid in replication assay (Lu and Miller,
1995a), the role of p35 appears to be the inhibition of AcNPV-induced apoptosis and
prevention of DNA fragmentation in SE2] cells. p35 also suppresses apoptosis in
BmN-4 cells (Clem et al., 1991; Clem and Miller, 1993), S. frugiperda larvae (Clem
and Miller, 1993), nematodes (Sugimoto et al., 1996) and mammalian cells (Rabizadeh
et al., 1993). Like another large DNA virus, herpes simplex virus, AcNPV has genes,
dnapol (Lu and Miller, 1994; Tomalski et al., 1988), p143 (Lu and Carstens, 1991),
that are predicted to encode DNA polymerase and DNA helicase, respectively.
However, the enzyme activities of these genes were not verified. The product of lef-3 ,

which has conserved single-stranded DNA binding protein motifs, has the ability to

bind ssDNA (Hang et al., 1995). lef-7 stimulates viral DNA replication in insect cells
(Chen and Thiem, 1997). The functions of LEF-l and LEF-2 in replication in
unknown. A recent study shows that LEF-l has a primase-like motif (Evans et al.,
1997). Whether AcNPV LEF-l has primase activity remains to be determined. LEF—l
and LEF—2 interact with each other in two-hybrid assays. When this interaction was
absent, no significant levels of transient DNA replication was observed, suggesting that
this interaction is required for DNA replication (Evans et al., 1997). An additional
factor, very late expression factor 1 (vlf-I ) is essential for optimal expression from very
late gene promoters such as polh and p10 (McLachlin and Miller, 1994) but not late
gene promoters, p6.9 or vp39 (McLachlin and Miller, 1994; Todd and Miller, 1996).
The product of vlf-I, VLF-1 has an amino acid sequence similarity to bacterial and
yeast integrase/resolvases (McLachlin and Miller, 1994).

The remaining lefs, lef-4-6, lef-8-11, p4 7, and 39k that are not required for
plasmid replication in the transient assays, are likely to function in late promoter
recognition, stabilization of late mRNA, or be part of the virus-induced RNA
polymerase complex (Lu and Miller, 1995a). 39k, a gene encoding a phosphoprotein
(pp31), associates with the nuclear virogenic stroma (Guarino et al., 1992).

Together, some of these LEFs may function as components of the viral DNA
replication complex such as initiation or elongation factors, or be part of the enzyme
activity that may recognize viral DNA template preferentially. Other LEFs may regulate
gene expression as part of transcription machinery, or they may transactivate each
other. It is likely that the timing and level of expression of each of the lefs is critical to
the viral infection. For example, ie-I inflences p35 expression. Apoptosis was
observed in SF-21 cells when infected with an AcNPV temperature-sensitive mutant

which only partially expressed ie-I (Ribeiro et al., 1994).

Determinants of baculovirus host-range

Many factors, both cellular and viral, determine the host-specificity. For a
systemic infection, viruses must enter the host, establish primary replication, spread to
other tissues and organs, and initiate the secondary infection. At the cellular level,
viruses have to attach to and penetrate the cells, uncoat, transcribe, translate and
replicate their genes, and assemble into infectious progeny. Finally the progeny must be
released to initiate a secondary infection. During the infection cycle, viruses are
challenged with various physical and physiological barriers that must be surmounted to
initiate a productive infection.

Viruses enter the host cells, either via receptor-mediated endocytosis or through
membrane fusion. This step frequently determines the virus host specificity. For
example, influenza virus enters the cells through specific binding of a viral protein,
hemagglutinin, to the cellular receptors. Single amino acid substitution of
hemagglutinin altered influenza virus receptor binding specificity (Naeve et al., 1984;
Rogers, et al., 1983). Baculovirus BV, which is the form responsible for cell to cell
transmission, enters cells through receptor mediated endocytosis (Volkman and
Goldsmith, 1985; Wickham et al., 1992). However, entry does not appear to be the
major step for baculovirus host range determination. AcNPV is capable of entering
nonpermissive insect cell lines such as BmN-4 (silk worm, B. mori), Hzlb3
(cottonbollworm, Helicoverpa zea) and Dm (fruitfly, Drosophila melanogaster
Schneider 1), as well as mammalian cell lines, such as Huh 7 (human hepatocyte)
(Hofmann et al., 1995), HepG2 (human liver), 293 (hamster ovary), and PC12 (rat
adrenal) (Boyce and Bucher, 1996). This suggests that if specific receptors are used by
baculoviruses to enter cells, they are common to insect and mammalian cells. In non-
permissive insect cell lines, expression of reporter genes was observed from Rous
Sarcoma Virus (RSV) LTR (Carbonell and Miller, 1985), Drosophila hsp70 promoter

(Morris and Miller, 1992; 1993), and baculovirus early and late-promoters (Morris and

10

Miller, 1993), although expression from very late promoters is limited (Morris and
Miller, 1992; 1993). No expression of the reporter genes under the control of the
polyhedrin promoter was observed in mammalian cells, while expression from
promoters of two mammalian pathogens RSV and cytomegalovirus was detected in
recombinant AcNPV-inoculated mammalian cells (Bche and Bucher, 1996). This
suggests that the promoters used to drive expression of viral genes are important
determinants of infectivity for a given cell line.

In other cases baculovirus replication is blocked at the translational level.
AcNPV enters the non—permissive Ld652Y cells (gypsy moth, Lymantria dispar) and
viral DNA is replicated and mRNA from early, late, and very late genes are transcribed
(Guzo et al., 1992; Morris and Miller, 1992; Morris and Miller, 1993). However,
global protein synthesis arrest was observed and no progeny is produced (Guzo et al.,
1992; Du and Thiem, 1997). AcNPV infection also induces protein synthesis arrest in
BmN cells while early and late gene transcripts are made (Kamita and Maeda, 1993),
suggesting that AcNPV p143 may cause translational machinery dysfunction in infected
BmN.

Collectively, these studies indicate that viral DNA is delivered to nuclei and can
be recognized by host transcription machinery, but baculovirus replication is restricted
in the mammalian and insect nonpermissive cells. These studies also suggested that the
mechanisms that prevent productive infection among nonpermissive cells differ and no

common restriction point is evident (Morris and Miller, 1992, 1993).

Baculovirus genes that influence host range

Several genes, summarized in Table 1.1, affect baculovirus infectivity for
different insect cell lines or larvae. AcNPV p143 homologue inhibits BmNPV
replication in a permissive cell line BmN (Kamita and Maeda, 1993). Recombination

between a 79-nt sequence within BmNPV p143 of BmNPV with that of AcNPV

 

 

>09 £5.29 28 5Q “meta
0&2 :3 S 805% £355? £805 Ego—m SERVE >n~Zv4 749*
cog Emma £222 use :1— Loeofl =83»:me ocow 82 >LZo< TUa
>02 .EoEH mew EEO cosmozme <20 :23 $3385
wag :3 S $202 £88.. commmocmxo 25m 33 >mZo< may
“83%.”:
smog .552 can :4 Eeoumtomamb 5:253:58 >mZo< we.»
83 £252 Em 820
32 ram 820 £83830 see? E22 AR
#09 £3» SE80
Mme £36 «.832 2&2080: 88:0: <ZQ >mZEm .>mZo< min,
ooaocowom cocofii fimtO 28w 2: Lo oEmZ

 

.omafi won 98 :oumfificeaow E 3302: 8m 85 moeow 2:32:on HA 2an

 

12

resulted in hybrid AcNPV that could replicate in the Bombyx mori cell line, BmN
which does not normally support AcNPV replication (Croizier et al., 1994; Maeda et
al., 1993; Kondo and Maeda, 1991). B. mori larvae, which are not susceptible to
AcNPV infection, were also killed by injection of AcNPV bearing a BmNPV/AcNPV-
p143-hybrid gene (Croizier et al., 1994). The mechanisms by which p143 alters viral
host range are unclear. It is possible that cellular factors of B. mori that are critical for
viral DNA replication recognize BmNPV p143 but not AcNPV p143, therefore AcNPV
does not replicate, but AcNPV p143 hybrid replicates in BmN cells.

Different cell lines require different lefs for AcNPV replication. For example,
ie-2, p35 and lef-7 are dispensable for late gene expression in transient assays in
TN368 cells, but are required in SF-21 cells (Lu and Miller, 1995b). AcNPV p35, an
apoptosis inhibitor (Clem et al., 1991), affects viral host range by overcoming a host
defense against infection in a cell line and species specific manner. The deletion of p35
from AcNPV results in reduced infectivity for SF-21 cell line (Clem et al., 1991; Clem
and Miller, 1993; Hershberger et al., 1992) and S. frugiperda larvae (Clem and Miller,
1993), but does not impair virus replication in TN368 (Trichoplusia ni) cells or T. ni
larvae. P35 was expressed but can not prevent AcNPV-induced apoptosis in FPMI-CF-
203 cells (C. fumiferana), but co-infection with CfNPV prevents apoptosis and
promotes AcNPV replication (Palli et al., 1997). This suggests that Cfl‘IPV has an
apoptosis inhibitor with different functions than P35. p35 does not preclude AcNPV
induced apoptosis in SL2 cells (S. littoralis) (Chejanovsky and Gershburg, 1995),
suggesting that p35 is either not expressed or not functional in this cell line. Disruption
of AcNPV lef-7 results in a virus with reduced BV and 0V productions on SF—21 and
SElc cells, but not on TN368 cells (Chen and Thiem, 1997).

A new lef gene, AcNPV host cell-specific factor-l (hcf-I ), was identified that
was essential for late gene expression in TN368 cells (Lu and Miller, 1995a; 1996).
AcNPV hcf-I null mutant has normal infectivity for SF—21 cells and S. frugiperda

13

larvae, while its replication is severely impaired in TN368 cells and it exhibits
decreased virulence for T. ni larvae (Lu and Miller, 1996). An intermediate phenotype
was observed for hcf-I mutant infection of BTI-TN5B1-4 (Hi5), another cell line
derived from T. ni (Lu and Miller, 1996). Besides these five genes, p143, p35, ie-2,
lef-7 and hcf-I , which are involved in AcNPV host range determination, a gene isolated
from L. dispar NPV (LdNPV), is capable of expanding the AcNPV host range.
LdNPV host range factor 1 (hrf-I) promotes AcNPV replication in a non-permissive L.
dispar cell line Ld652Y (Thiem et al., 1996). In cell culture, Inf-I prevents global
protein synthesis cessation, which is a common response against viral infection found
in vertebrates (Schneider and Shenk, 1987), and in the AcNPV infected Ld652Y cells
(Du and Thiem, 1997). A recombinant AcNPV bearing hrf-I has much lower LC50 for
L. dispar larvae compared with that of wild type AcNPV, indicating hrf-I also expands

AcNPV host range for insect larvae (Chapter 6).

Scope of the study

An effective way to study host specificity determinants is to characterize
mutants with altered host range. Two possible approaches can be used. One is to select
mutants with reduced host range caused by defective viral genomes, and second is to
study viruses with expanded host specificity resulting from heterogeneous genes
insertion to the viral genomes. The aim of this study was to investigate the viral genes
that influence baculovirus host range. Using the first approach, we mutated AcNPV
with a chemical mutagen and then screened for mutants that replicated more efficiently
in one permissive cell line than another as potential host range mutants (Appendix A).
By characterizing these mutants (Chapters 2 - 3) lef-7 was identified to influence
AcNPV infectivity in various insect cell line and larvae. Possible functions of lef-7
were investigated (Chapter 4). ORF247, which was deleted in the mutants with

reduced infectivity, was identified to be nonessential for AcNPV infection in several

14

permissive cell lines (Chapter 5). Using the second approach, Thiem et al. (1996)
showed that LdNPV host range factor-1(hrf-I) promotes AcNPV replication in a
nonpermissive cell line, Ld652Y. In this study, we further demonstrated that hrf-I
expands AcNPV larval host range by allowing AcNPV to initiate a systemic infection
(Chapter 6).

In these studies, a genetic approach was used to identify a gene, [cf-7, that
influences AcNPV host specificity. lef-7 functions as a cell line-specific factor, and
possibly a tissue-specific factor. In cultured cells, LEF-7 stimulates viral DNA
synthesis via an unknown mechanism. Deletion of lef-7 reduces AcNPV larval
infectivity. The mechanism by which lef-7 influences AcNPV larval infectivity remains
to be determined. In the hrf-I study, hrf-I helps AcNPV to overcome barriers that
prevent AcNPV productive infection in L. dispar cells or larvae. Studies of lef-7 and
hrf—I have contributed the knowledge regarding controls of the ability of AcNPV to
efficiently infect a given cell line or insect host, and what limits AcNPV infectivity, as

well as how we might be change that property.

15

References

Ali, M. I., S. Y. Young, and W. C. Yearian. (1987). Nuclear polyhedrosis
virus transmission by infected Heliothis zea (Boddie) (Lepidoptera: Noctuidae) prior
to death. J. Entomo. Sci. 22: 287-294.

Ayres, M. D., Howard, S. C., Kuzio, J ., Lopez-Ferver, M., and
Possee, R. D. (1994). The complete DNA sequence of Autographa californica
nuclear polyhedrosis virus. Virology 202: 586-605

Beniya, H., C. J. Funk, G. F. Rohrmann, and R. F. Weaver. (1996).
Purificaiton of a virus-induced RNA polymerase from Autographa califomica nuclear
polyhedrosis virus-infected Spodoptrea frugiperda cells that accurately initiates late
and very late transription in vitro. Virology 216: 12-19.

Blissard, G. W. and G. F. Rohrmann. (1990). Baculovirus diversity and
molecular biology. Annu. Rev. Entomol. 35: 127-155.

Boyce, F. M. and N. L. R. Bucher. (1996). Baculovirus-mediated gene transfer
into mammalian cells. Proc. Natl. Acad. Sci. (USA) 93: 2348-2352.

Carbonell, L. F., M. J. Klowden, adn L. K. Miller. (1985). Baculovirus-
mediated expression of bacterial genes in dipteran and mammalian cells. J. Virol. 56:
153-160.

Carner, G. R. and S. G. Turnipseed. (1977). Potential of a nuclear
polyhedrosis virus for control of trhe velvetbean caterpillar in soybean. J. Econ.
Entomol. 70: 608-610.

Carson, D. D., M. D. Summers, and L. A. Guarino. (1991a). Molecular
analysis of a baculovirus regulatory gene. Virology 182: 279-286.

Carson, .D. D., M. D. Summers, and L. A. Guarino. (1991b). Transient
expressmn of the Autographa califomica nuclear polyhedrosis immediate-early gene,
IE-N, is regulated by three viral elements. J. Virol. 65: 945-951.

Chen, C.-J. and S. M. Thiem. (1997). Differential infectivity of two Autographa
calzfomica nucleopolyhedrovirus mutants on three permissive cell lines is the result of
lef-7 deletion. Virology 227: 88-95.

Chejanovsky, N. and E. Gershburg(1995). The wild-type Autographa

califomica nuclear polyhedrosis virus induces apoptosis of Spodoptera littoralis cells.
Virology 209: 519-525.

Choi, J. and L. A. Guarino. (1995). The baculovirus transactivation IE-l binds to
Vll‘al enhancer elements in the absence of insect cell factors. J. Virol. 69: 4548-4551.

Clem, R. J. and L. K. Miller. (1993). Apoptosis reduces both the in vitro
replication and the in vivo infectivity of a baculovirus. J. Virol. 67: 3730-3738.

16

Clem, R. J., M. Fechheimer, and L. K. Miller. (1991). Prevention of
apoptosis by a baculovirus gene during infection of insect cells. Science 254: 1388-
1390.

Croizier, G., L. Croizier, O. Argaud, and D. Poudevigne. (1994).
Extension of Autographa califomica nuclear polyhedrosis virus host range by
interspecific replacement of a short DNA sequence in the p143 helicase gene. Proc.

Natl. Acad. Sci. (USA) 91: 48-52.

Dhandapani, N., S. Jayaraj, and R. J. Rabindra. (1993). Cannibalism on
nuclear polyhedrosis virus infected larvae by Heliothis armigera (Hubn.) and its
effect on viral infection. Insect Sci. Appl. 14: 427-430.

Du, X. and S. M. Thiem. (1997). Evidence for two independent responses of
Ld652Y cells to AcMNPV infection: protein synthesis shut down and apoptosis. J.
Virol. In press.

Engelhard, E‘. K., L. N. W. Kammorgan, J. O. Washburn, a nd L. E.
Volkman. (1994). The insect tracheal system - a conduit for the systemic spread of
Autographa californica M nuclear polyhedrosis virus. Proc. Natl. Acad. Sci.
(USA).91: 3224-3227.

Evans, H. F. 1986. Ecology and epizootiology of baculoviruses, p89-132. CRC
Press. Boca Raton, FL.

Faulkner, P. 1981. Baculovirus. p3-37. Allanheld, Osmun. Totowa, NJ.

Flipsen, J. T. M., R. M. W. Mans, A. W. F. Kleefsman, D.
Knebelmorsdorf, and J. M. Vlak. (1995a). Deletion of the baculovirus
ecdysteroid UDP-glucosyltransferase gene induces early degeneration of Malpighian
tubules in infected insectsi J. Virol., 69: 7380-7381.

Flipsen, J. T. M., J. W. M. Martens, M. M. Vanoers, J. M. Vlak, and
J. W. M. Vanlent. (1995b). Passage of Autographa californica nuclear

polyhedrosis virus through the midgut epithelium of Spodoptera exigua larvae.
Virology 208: 328-335.

Friesen P. D. and L. K. Miller. (1986). The regulation of baculovirus gene
expression. In W. Doerfler and P. Bohm (Eds), "The Molecular Biology of
Baculovirus" (pp31-49). Springer-Verlag. New York.

Fuchs, L. Y., M. S. Woods, and R. F. Weaver. (1983). Viral transcription
during Autographa califomica nuclear polyhedrosis virus infection: a novel RNA
polymerase induced in Spodopterafrugiperda cells. J. Virol. 48: 641—646.

Fuxa, J. R. and A. R. Richter. (1991). Selection for an increased rate of vertical
transmission of Spodoptera frugiperda (Lepidoptera: Noctuidae) nuclear polyhedrosis
virus. Environ. Entomol. 20: 603-609.

Fuxa, J .R., J. E. Maruniak, and A. R. Richter. (1994). Characterization of
the DNA of a nuclear polyhedrosis virus selected for an increased rate of vertical
transmission. J. Invertebr. Pathol. 64: 1-5.

l7

Granados, R. R. and B. A. Federici (Ed.). (1986). The Biology of
Baculoviruses. Vol 11. Practical Application for Insect Control. Boca Raton, CRC
Press. FL.

Granados, R. R. and K. A. Lawler. (1981). In vivo pathway of Autographa
califomica baculovirus invasion and infection. Virology 108: 297-308.

Griiner, A. (1986). Specificity and safety of baculoviruses. In R. R. Granados and
B. A. Federici (Eds.), "The Biology of Baculoviruses, Vol. 1, Biological
Properties and Molecular Biology" (pp. 177-202). CRC Press, Inc., Boca Raton,
FL.

Grula, M. A., P. L. Buller, and R. F. Weaver. (1981). Amanitin-resistant
viral RNA synthesis in nuclei isolated from nuclear polyhedrosis virus-infected
Heliothis zea larvae and Spodopterafrugiperda cells. J. Virol. 38: 916-921.

Guarino, L. A. and M. D. Summers. (1986). Interspersed homologous DNA of
Autographa califomica nuclear polyhedrosis virus enhances delayed-early gene
expression. J. Virol. 60: 215-223.

Guarino, L. A. and M. D. Summers. (1987). Nucleotide sequence and temporal
expression of a baculovirus regulatory gene. J. Virol. 61: 2091-2099.

Guarino, L. A. and M. D. Summers. (1988). Functional mapping of
Autographa califomica nuclear polyhedrosis virus genes required for late gene
expression. J. Virol. 62: 463-471.

Guarino, L. A., D. Wen, X. Bin, D. R. Broussard, R. W. Davis, and
D. L. Jarvis. (1992). Baculovirus phosphoprotein pp31 is associated with
virogenic stroma. J. Virol. 66: 7113-7120.

Guzo, D., H. Rathburn, K. Guthrie, and E. Daugherty. (1992). Viral and
host cellular transcription in Autographa califomica nuclear polyhedrosis virus-
infected gypsy moth cell lines. J. Virol. 66: 2966-2972.

Hammock, B. D., B. C. Bonning, R. D. Possee, T. N. Hanzlik, and S.
Maeda. (1990). Expression and effects of the juvenile hormone esterase in a
baculovirus vector. Nature (London) 344: 458-461.

Hang, X., W. Dong, and L. A. Guarino. (1995). The lef-3 gene of Autographa
califomica nuclear polyhedrosis virus encodes a single-stranded DNA binding
protein. J. Virol. 69: 3924-3928.

Harrap, K. A. and J. F. Longworth. (1974). An evaluation of purification
methods for baculovirus. J. Invertebr. Pathol. 24: 55-62.

Hershberger, P. A., D. J. Lacount, and P. D. Friesen. (1994). The
apoptotic suppressor p35 is required early during baculovirus replication and is
targeted to the cytosol of infected cells. J. Virol. 68: 3467-3477.

Hink, W. F. and R. L. Hall. (1989). Recently established invertebrate cell lines.
p269-293. CRC Press, Inc. Boca Raton, FL.

'18

Hink, W.F. (1970). Established insect cell line from the cabbage looper,
Trichoplusia ni. Nature (London) 226: 466—467.

Hofmann, C., V. Sandig, G. Jennings, M. Rudolph, P. Schlag, and M.
Strauss. (1995). Efficient gene transfer into human hepatocytes by baculovirus
vectors. Proc. Natl. Acad. Sci. (USA) 92: 10099-10103.

Hoopes, R. R. and G. F. Rohrmann. (1991). In vitro transcription of
baculovirus immediate early genes-accurate messenger RNA initiation by nuclear
extracts from both insect and human cells. Proc. Natl. Acad. Sci. (USA) 88: 4513—
4517.

Horton, H. M. and J. P. Burand. (1993). Saturable attachment sites for
polyhedron-derived baculovirus on insect cell and evidence for entry via direct
membrane fusion. J. Virol. 67: 1860-1868.

Huh, N. E. and R. F. Weaver. (1990). Identifying the RNA polymerases that
synthesize specific transcripts of the Autographa califomica nuclear polyhedrosis
virus. J. Gen. Virol. 71: 195-201.

Kamita, S. G. and S. Maeda. (1993). Inhibition of Bombyx mori nuclear
polyhedrosis virus (NPV) replication by the putative DNA helicase gene of
Autographa califomica NPV. J. Virol. 67: 6239-6245.

Kamita, S. G., K. Majima, and S. Maeda. (1993). Identification and
characterization of the p35-Gene of Bombyx—Mori nuclear polyhedrosis virus that
prevents Virus-Induced apoptosis. J. Virol. 67: 455—463.

Knebel-Morsdorf, D., J. T. M. Flispsen, J. Ronsarati, A. W. F.
Kleefsman, and J. M. Vlak. (1996). Baculovirus infection of Spodopt'era exigua
larvae: lacZ expression driven by promoters of early gene pe38 and me53 in larvae
tissue. J. Gen. Virol. 77: 815—824.

Kondo, A. and S. Maeda. (1991). Host range expansion by recombination of the
baculoviruses Bombyx mori nuclear polyhedrosis virus and Autographa califomica
nuclear polyhedrosis virus. J. Virol. 65: 3625—3632.

K001, M., C. H. Ahrens, R. W. Goldbach, G. F. Rohrmann, and J.
M.Vlak. (1994). Identification of genes involved in DNA replication of the
Autographa califomica baculovirus. Proc. Natl. Acad. Sci. (USA) 91: 11212-
11216.

Kovacs, G. R., L. A. Guarino, and M. D. Summers. (1991). Novel
Regulatory Properties of the [El and IEO Transactivators Encoded by the Baculovirus
Autographa califomica Multicapsid Nuclear Polyhedrosis Virus. J. Virol. 65 : 5281-
5288.

Kunimi, Y., J. R. Fuxa, and B. D. Hammock. (1996). Comparison of wild
type and genetically engineered nuclear polyhedrosis viruses of Autographa
califomica for mortality, virus replication and polyhedra production in Trichoplusia ni
larvae. Entomologia Experimentalis et Applicata 81: 251-257.

19

Li, Y., A. L. Passarelli, and L. K. Miller. (1993). Identification, sequence,
and transcriptional mapping of lef-3, a baculovirus gene involved in late and very late
gene expression. J. Virol. 67 : 5260—5268.

Locke, M. (1985). The structure of epidermal feet during their development. Tiss.
Cell 17: 901-921.

Lu, A. and E. B. Carstens. (1991). Nucleotide sequence of a gene essential for
viral DNA replication in the baculovirus Autographa califomica nuclear polyhedrosis
virus. Virology 181: 336-347.

Lu. A. and Mill, L. K. (1994). Identification of three late expression factor genes
within the 33.8- to 43 .4-map-unit region of autographa califomica nuclear
polyhedrosis virus. J. Virol. 10: 6710-6718.

Lu, A. and Miller, L. K. (1995a). The roles of eighteen baculovirus late
expression factor genes in transcription and DNA replication. J. Virol. 69: 975-982.

Lu, A. and Miller, L. K. (1995b). Differential requirements for baculovirus late
expression factor genes in two cell lines. J. Virol. 69: 6265-6272.

Lu, A. and L. K. Miller. (1996). Species—specific effects of the hcf-I gene on
baculovirus virulence. J. Virol. 70: 5123-5130.

Maeda, S., S. G. Kamita, and A. Kondo. (1993). Host range expansion of
Autographa califomica nuclear polyhedrosis virus (NPV) following recombination of
a 0.6—kilobase-pair DNA fragment originating from a Bombyx mori NPV. J. Virol.
67: 6234-6238.

McLachlin J. R. and L. K. Miller. Identification and characterization of vlf—l, a
baculovirus gene involved in very late gene expression. J. Virol. 68: 7746-7756.

Martignoni, M. E. and P. J. Iwai. (1986). A catalog of viral diseases of insects,
mites, and ticks. In "U. S. Department of Agriculture Forest Service, Gen. Tech.
Report, PNW 195". U. S. Dept. Agric. Washington D. C.

Mclachlin, J. R. and L. K. Miller. (1994). Identification and characterization of
vlf—l, a baculovirus gene involved in very late gene expression. J. Virol. 68: 7746-
7756.

Morris, T. D. and L. K. Miller. (1992). Promoter Influence on baculovirus-

mediated gene expression in permissive and non-permissive insect cell lines. J. Virol.
66: 7397-7405.

Morris, T. D. and L. K. Miller. (1993). Characterization of productive and non-
productive AcMNPV Infection in selected insect cell lines. Virology 197: 339-348.

Morris, T. D., J. W.Todd, B. Fisher, L. K. Miller. (1994). Identification of
lef-7 - a baculovirus gene affecting late gene expression. Virology 200: 360-369.

Moscardi, F. and B. S. C. Ferreira. (1985). Biological control of soybean
caterpillars. In R. Shibles (Ed.) "World Soybean Research Conference III:
proceedings". p703-711. Westview Press. Boulder, CO.

20

Naeve, C., V. Hinshaw, and R. Webster. (1984). Mutantions in the
hemagglutinin receptor-binding site can change the biological properites of an
influenza virus. J. Virol. 51: 567-569.

Nissen, M. S. and P. D. Friesen. (1989). Molecular analysis of the
transcriptional regulatory region of an early baculovirus gene. J. Virol. 63: 493-503.

O’Reilly, D. R. and L. K. Miller. (1990). Regulation of expression of a
baculovirus ecdysteroid UPD-glucosyl transferase gene. J. Virol. 64: 1321-1328.

O’Reilly, D. R. and L. K. Miller. (1991). Improvement of a baculovirus
pesticide by deletion of the egt gene. Bio/Technology 9: 1086-1089.

Ooi, B. G. and L. K. Miller. (1990). Transcription of the baculovirus polyhedrin
gene reduces the levels of an antisense transcript initiated downstream. J. Virol. 64:
3126-3 129.

Palli, S. R., G. F. Caputo, S. S. Sohi, A. J. Brownwright, T. R. Ladd,
B. J. Cook, M. Primavera, B. M. Arif, and A. Retnakaran (1996).
CfMNPV blocks AcMNPV—induced apoptosis in a continuous midgut cell line.
Virology 222: 201-213.

Passarelli, A. L. and L. K. Miller. (1993a). Identification of genes encoding late
expression factors located between 56.0 and 65.4 map units of the Autographa
califomica nuclear polyhedrosis genome. Virology 197: 704-714.

Passarelli, A. L. and L. K. Miller. (1993b). Identification and characterization

of lef-l, a baculovirus gene involved in late and very late gene expression. J. Virol.
67: 3481-3488.

Passarelli, A. L. and L. K. Miller. (1993c). Three baculovirus genes involved
in late and very late gene expression: ie-I, ie-n, and lef-2. J. Virol. 67: 2149-2158.

Passarelli, A. L. and L. K. Miller. (1994a). Identification and transcriptional
regulation of the baculovirus lef-6 gene. J. Virol. 68: 4458-4467.

Passarelli, A. L. and L. K. Miller. (1994b). In vivo and in vitro analyses of
recombinant baculoviruses lacking a functional cg30 gene. J. Virol. 68: 1186-1190.

Passarelli, A. L., J. W. Todd, and L. K. Miller. (1994). A baculovirus gene
involved in late gene expression predicts a large polypeptide with a conserved motif
of RNA polymerases. J. Virol. 68: 4673-4678.

Pearson, M., R. Bjornson, G. Pearson, and G. Rohrmann. (1992). The
Autographa califomica baculovirus genome - evidence for multiple replication
origins. Science 257: 1382-1384.

Podgwiate, J. D. 1985. Strategies for field use of baculoviruses. 774-797.
Academic press. New York.

Possee, R. D., T.-P. Sun, S. C. Howard, M. D. Ayres, M. Hill-
Perkins, and K. L. Gearing. (1991). Nucleotide sequence of the Autographa
califomica nuclear polyhedrosis 9.4 kbp EcoRI-I and -R (polyhedrin gene) region.
Virology. 185: 229-241.

21

Rabizadeh, S., D. J. LaCount, P. D. Friesen, and D. E. Bredesen.
(1993). Exprssion of the baculovirus p35 gene inhibits mammalian neural cell death.
J. Neurochem. 61: 2318-2321.

Reddy, J. T. and M. Locke. (1990). The size limited penetration of gold particles
through insect basal laminae. J. Insect Physiol. 36: 387-407.

Ribeiro, B. M., K. Hutchinson, and L. K. Miller. (1994). A mutant
baculovirus with a temperature-sensitive IE-l transregulatory protein. J. Virol. 68:
1075—1084.

Ritter, K. S., Y. Tanada, R. T. Hess, and E. M. Omi. (1982). Eclipse
period of baculovirus infection in larvae of the armyworm, Pseudaletia unipuncta. J.
Invertebr. Pathol. 39: 203-209.

Rogers, G. N., J. C. Paulson, R. S. Daniels, J. J. Skehel, I. A.
Wilson, and D. C. Wiley. (1983). Single amino acid substitutions in influenza
hemagglutinin change receptor binding specificity. Nature (London) 304: 76-78.

Rohrmann, G. F. (1992). Baculovirus structural proteins. J. Gen. Virol. 73: 749-
761.

Schneider, R. J. and T. Shenk. (1987). Impact of virus infectiononhost cell
protein synthesis. Ann. Rev. Biochem. 56: 317-332.

Shapiro, M. and J. L. Robertson. (1987). Yield and activity of gypsy moth
(Lepidoptera: Lymantriidae) nucleopolyhedrosis virus recovered from survivors of
viral challenge. J. Econ. Entomol. 80: 901-905.

Stewart, L. M. D., M. Hirst, M. L. Ferber, A. T. Merryweather, P. J.
Cayley, and R. D. Possee. (1991). Construction of an improved baculovirus
insecticide containing an insect-specific toxin gene. Nature (London) 352: 85-88.

Sugimoto, A., R. R. Hozak, T. Nakashima, T. Nishimoto, and J. H.
Rothman. (1995). dad-1, an endogenous programmed cell death suppressor in
Caenorhabditis elegans and vertebrates. EMBO J. 14: 4434-4441.

Theilmann, D. A. and S. Stewart. (1991). Identification and characterization of

the IE-l gene of Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus.
Virology 180: 492-508.

Thiem, S. M. and L. K. Miller. (1990). Differential gene expression mediated by
late, very late and hybrid baculovirus promoters. Gene 91: 87-94.

Todd, J. W., A. L. Passarelli, and L. K. Miller. (1995). Eighteen
baculovirus genes, including lef-I 1, p35, 39K and p47, support late gene
expression. J. Virol. 69: 968-974.

Tomalski, M. D., J. Wu., and L. K. Miller. (1988). The location, sequence,
transcription, and regulation of a baculovirus DNA polymerase gene. Virology. 167:
591-600.

22

Tomalski, M. D., and L. K. Miller. (1991). Insect paralysis by baculovirus-
mediated expression of a mite neurotoxin gene. Nature (London) 352: 82-85.

Vasconcelos, S. D. (1996). Alternative routes for the horizontal transmission of a
nucleopolyhedrovirus. J. Invertebr. Pathol. 68: 269-274.

Volkman, L. E. and P. A. Goldsmith. (1985). Mechanism of neutralization of
budded Autographa califomica nuclear polyhedrosis virus by a monoclonal antibody:
Inhibition of entry by adsorptive endocytosis. Virology 143: 185-195.

Wickham, T. J., M. L. Shuler, D. A. Hammer, R. R. Granados, and H.
A. Wood. (1992). Equilibrium and kinetic analysis of Autographa califomica

nuclear polyhedrosis virus attachment to different insect cell lines. J. Gen. Virol. 73:
3 185-3 194.

Yoo, S. H. and L. A. Guarino. (1994). The Autographa califomica nuclear
polyhedrosis virus ie-2 gene encodes a transcriptional regulator. Virology 202: 746-
753.

Chapter 2

Differential infectivity of two Autographa califomica
nucleopolyhedrovirus mutants on three permissive cell lines is the result

of lef-7 deletion

The contents of this chapter have been published as: Chen, C.-J. and S. M.
Thiem. (1997). Differential Infectivity of Two Autographa califomica
Nucleopolyhedrovirus Mutants on Three Permissive Cell Lines Is the Result of lef-7
Deletion. Virology 227: 88-95.

23

24

Abstract

We isolated two Autographa califomica nucleopolyhedrovirus (AcMNPV)
mutants that have similar infectivity as wild type (wt) AcMNPV in TN368 cells, but
reduced budded virus and polyhedral inclusion body production in IPLB-SF—21 and
SElc cells. Restriction endonuclease analysis and sequence analysis indicated that 3.2
kbp (77.0-79.4 mu) and 4.4 kbp (76.7-80.1 mu) regions, the location of four major
open reading frames (ORFs), pk2, ORF-247, lef- 7, and chitinase, were deleted in
mutant T295 and T297, respectively. Phenotypes of recombinant viruses vdel-AG, in
which all four ORFs were deleted, and vlef7-AG, in which only lef-7 was deleted,
were identical to the mutants. The phenotypes of recombinant viruses with deletions of
the other ORFs were indistinguishable from wt AcMNPV. This demonstrated that the
deletion of lef-7 was responsible for the mutant phenotypes. Viral DNA synthesis in
both mutant and vlef7-AG-infected SF-21 and SElc cells was reduced to less than 10%
of wt AcMNPV-infected cells. In TN368 cells, DNA synthesis in mutant- and vlef7-
AG-infected cells was delayed relative to wt—infected cells. Although lef-7 is not
essential for AcMNPV infection in TN368 cells, it is expressed in TN368, SF-21, and

SElc cells in a similar manner.

25

Introduction

Nuclear polyhedrosis viruses (NPV) are baculoviruses, invertebrate-specific
pathogens that have limited host ranges. Infection by most baculoviruses is restricted to
a single species or a few related species. Autographa califomica MNPV (AcMNPV) has
an unusually broad host range, reportedly infecting at least 33 species of Lepidoptera
larvae in 10 families (Groner, 1986) and over 25 different cell lines (Hink 1970; Hink
and Hall, 1989). AcMNPV has a 134 kbp genome potentially encoding 154 proteins
(Ayres et al., 1994). Among these genes, a few that are involved in host-range
determination have been identified. AcMNPV recombinant viruses in which a small
fragment of Bombyx mori nucleopolyhedrovirus p143, a homologue of a DNA helicase
gene (Lu and Carstens, 1991), has replaced the homologous region of AcMNPV p143
replicate in both Spodopterafrugiperda and B. mori cell lines (Croizier et al., 1994;
Maeda et al., 1993). The mechanism by which p143 alters AcMNPV host range is not
known. AcMNPV in which p35, an inhibitor of apoptosis, is deleted has reduced virus
replication in the SF—21 (S. frugiperda) cell line (Clem et al., 1991; Clem and Miller,
1993; Hershberger et al., 1992) and S. frugiperda larvae (Clem and Miller, 1993), but
not in the TN368 (T richoplusia ni) cell line or T. ni larvae. A gene isolated from
another baculovirus, Lymantria dispar MNPV (LdMNPV), is capable of expanding the
AcMNPV host range. LdMNPV host range factor 1 (hIf-l) promotes AcMNPV
replication in Ld652Y cells, a non-permissive cell line (Thiem et al., 1996).

During infection, AcMNPV genes are expressed in a highly regulated cascade in
which early gene expression and viral replication are essential for late and very late gene
expression (reviewed by Blissard and Rohrmann, 1990; O'Reilly et al., 1992). Early
baculovirus genes, whose expression is independent of viral DNA replication, have
promoters that are recognized by an a—amanitin-sensitive RNA polymerase II activity

(Huh and Weaver, 1990; Hoopes and Rohrmann, 1991). IE-l plays a central role in the

26

regulation of viral gene expression, and is essential for early, late, and very late gene
expression (Guarino and Summers, 1987; Passarelli and Miller, 1993). The product of
another immediate early gene ie-2 (ie-N), is down regulated by IE-l (Carson et al.,
1991b), and modulates both its own and ie-I expression (Carson et al., 1991a). In
transient assays, IE-2 augments transcription from early promoters , late promoters,
and very late promoters (Guarino and Summers, 1988; Passarelli and Miller, 1993).
Eighteen late expression factors (lefs) are required to support optimal expression of a
late promoter-controlled reporter gene, chloramphenicol acetyltransferase (CAT) in
IPLB-SF-21 (SF-21) cells in transient assays (Lu and Miller, 1995a; Todd et al.,
1995). Among these lefs, ie-I, ie-2, lef-I, lef-2, lef-3, lef-7, p143, pe38, dnapol, and
p35 are involved in viral DNA replication (Kool et al., 1994; Lu and Miller, 1995a).
However, different lefs may be required for virus replication in different cell types. For
example, ie-2 and lef-7 are not essential for late gene expression in transient assays in
TN368 cells (Lu and Miller, 1995b). Another factor, AcMNPV host cell-specific
factor-l (hcf-I) is needed to support optimal reporter gene expression in TN368 cells,
but is not required for expression in SF-21 cells (Lu and Miller, 1995b). hcf-I can not
functionally substitute for lef-7 in SF21 cells (Lu and Miller, 1995b).

As a means for identifying AcMNPV genes that contribute to its broad host
range, we screened mutagenized AcMNPV stocks for isolates with differential
infectivity on susceptible cell lines. Two mutants, T295 and T297, that were isolated on
TN368 cells had dramatically reduced polyhedra production on SF21 and UCR-SEl
(SElc) cells as compared to TN368 cells. Here we describe the characterization of these
mutants and demonstrate that the mutant phenotype can be attributed solely to the

deletion of lef-7 in both mutants.

27

Materials and Methods

Cells and viruses

Spodopterafrugiperda IPLB-SF-21 (Vaughn et al., 1977); Trichoplusia ni
TN368 (Hink 1970); Spodoptera exigua UCR-SElc, a clonal cell line of UCR-SEl
‘(Gelemter and Federici, 1986) provided by B. A. Federici, U. CA. Riverside, were
maintained at 27°C in TC-100 medium (Life Technologies, Inc., Gaithersburg, MD)
supplemented with 10% fetal bovine serum (Life Technologies, Inc.) and 0.26%
tryptose broth. AcMNPV L—l variant (Lee and Miller, 1979) was propagated in
T richoplusia ni larvae and SF-2l cells. To generate mutants, AcMNPV-infected SF-2l
cells were incubated at 27°C in the presence of thymidine analog 5-bromo-2'-
deoxyuridine (BUdR) (Sigma, St. Louis, MO) (Lee and Miller, 1979). Mutant viruses
were selected by differential growth on three cell lines, SF—2l, TN368, and SElc by
plaque assay. Mutagenized viral stocks were titrated by plaque assay on each cell line.
Well isolated plaques were selected, amplified, and tested on all three cell lines. Cells
were scored for the presence of polyhedra by the fourth day post infection (p.i.).
Isolates with wild type (wt) levels of polyhedra on at least one cell line but reduced
polyhedra production on at least one other cell line were selected as possible host-range
mutants. Mutant viruses, T295 and T297 were isolated on TN368 cells and selected for
their low polyhedra production on SF-2l and SElc cells. Both viruses were plaque

purified and amplified on TN368 cells.

Characterization of mutant viruses

TN368, SF-21, and SElc were seeded onto 60 mm tissue culture plates at
5x105 cells per plate, and infected with either wt AcMNPV or mutant virus at a
multiplicity of infection (moi) of 10 pfu/cell. Infected cells were harvested at various

time post infection. Cells were incubated with virus for one hour and the zero time

28

point was defined as the time when the inoculum was removed. The percentage of cells
with polyhedron inclusion bodies (PBS) was determined by counting the number of
cells with PBS and total cell number using an improved-Neubauer hemocytometer and
a Nikon TMS inverted-microscope. Between 100—400 cells were counted for each time
point, and three independent experiments were conducted.

Budded virus production was determined by end-point dilution assay (O’Reilly
et al., 1992) on TN368 cells. Cells were scored for PIB formation on the fourth day
p.i. TCID50 was calculated and converted to pfu/ml according to O’Reilly et al. (1992).

Wt AcMNPV DNA for restriction analysis was prepared from virus released
from polyhedral inclusion bodies (PIBs), and mutant virus DNA was prepared from

budded virus harvested from infected TN 368 cells (O’Reilly et al., 1992).

DNA cloning and sequencing

AcMNPV PstI L and M fragments were cloned into pBluescript KS+
(Stratagene, La Jolla, CA) at the PstI site to generate plasmids pPstL and pPstM. PstI-
N’ and PstI-O’ (Figure 2.2) containing deletion junctions from T295 and T297,
respectively, were cloned into pBluescript KS+ to generate plasmids pPst-N’ and pPst-
O’. Clones were sequenced by the dideoxy-chain termination method (Sanger et al.,
1977) using Sequenase Uniter States Biochemical Corp., Cleveland, OH) using T3 or
T7 primers (Figure 2.3A).

Construction of recombinant virus.

To facilitate gene disruption, a reporter gene cassette that constitutively
expresses Escherichia coli B-glucuronidase (GUS) in insect cells was constructed. The
Bombyx mori actin promoter was first cleaved from pBBml/BmA.lacZ2 (Johnson et
al., 1992) with HindIII and subcloned into pBluescript KS+. gas was cleaved from
pBIl21 (Clonetech, Inc.) with BamHI and SstI and subcloned into pUC18. A clone

29

with the correct orientation of the actin promoter was selected based on the sizes of
restriction fragments following digestion with PstI. The actin promoter was then
cleaved from the pBluescript KS+ plasmid and inserted into the gus subclone in
pUC18 at the BamHI and Sail sites to generate an actin-GUS cassette. Multiple
restriction endonuclease sites between the promoter and gus were then removed by
limited digestion with mungbean nuclease and exonuclease 111 following cleavage with
SmaI and the plasmid was religated.

A 2.8k PvuII-EcoRI fragment containing the actin-GUS reporter cassette was
inserted into pPst-N’ fragment at NcoI and EcoRI sites to generate pdel-AG. pPst-L
was digested with Nsfl and SwaI and a 2.7 kbp PstI-PuvII fragment containing the
actin-GUS cassette was inserted to generate plef7-AG. Recombinant viruses, vdel-AG
and vlef7-AG were generated by calcium phosphate cotransfection of transfer plasmids
with AcMNPV DNA using standard methods (O’Reilly et al., 1992) and recombinants
were selected on TN368 cells. Disruption of ORFs was confirmed by the restriction

patterns, and Southern blot analysis using the reporter gene as a probe.

Quantification of virus replication

DNA was prepared for dot blot analysis by NaI treatment (Bresser and
Gillespie, 1983). PBS and BV were harvested by centrifugation of wt AcMNPV- or
mutant virus- infected SF-21, TN368 or SElc cells and their media for 15 minutes at
16 kg . Pellets were resuspended in 100ul water, then incubated with an equal volume
of 0.1M NaCO3 for 15 minutes at room temperature to ensure the disruption of PBS.
The mixture was then mixed with 811i] saturated NaI solution, and incubated at 100°C
for 30 minutes. The samples were blotted on to Zeta-probe nylon membrane by using a
dot blot apparatus (Bio-Rad Laboratories), and probed with nick-translated (Sambrook
et al., 1989) AcMNPV DNA. Hybridization was carried out in the hybridization
solution (50% forrnamide, 50 mM phosphate buffer, 5X SSC, 5X Denhardt’s

30

solution, 0.1% SDS, and 100 ug/ml salmon sperm DNA) at 42°C for 18 hours
(Sambrook et al., 1989). The blot was visualized by autoradiography and the bound

probe was quantified with a phosphorimager (Molecular Dynamics, Sunnyvale, CA.).

Western blot analysis

A SpeI-PstI (104423 bp -105163 bp, Aryes et al., 1994) fragment containing
90% of lef-7 was cloned into pMAL-c2 vector, which encodes maltose-binding protein
(MBP), (New England BioLabs, Beverly, MA), resulting in the expression of MBP-
LEF-7 fusion in transformed E. coli XL-l Blue strain (Bullock et al., 1987). The
fusion protein was purified by amylose resin affinity column chromatography (New
England BioLabs). Rabbits were injected subcutaneously with 50ug (0.5 ml) fusion
protein emulsified with 0.5 ml of Titer-Max (Vaxcel Inc., Norcross, GA) at 10 sites,
and the serum was collected 56 days post injection.

SF-21, TN368, and SElc cells were infected with AcMNPV as described
earlier and harvested at various times post infection. Mock-infected cells were harvested
at 48 h pi. Cells were lysed in 2X sample buffer (125mM Tris-HCl [pH 6.8], 4%
sodium dodecyl sulfate, 10% b-mercaptoethanol, 20% glycerol, 0.002% bromophenol
blue) containing protease inhibitors (lOOug/ml PMSF; lug/ml Pepstatin; 0.5ug/ml
Leupeptin; (Boehringer Mannheim». An amount of protein equivalent to approximately
1x105 cells was loaded per lane and run on a 10% SDS—polyacrylamide gel (Laemmli,
1970). Proteins were transferred (Towbin et al., 1979) to Hybond-ECL nitrocellulose
membranes. The membrane was incubated with anti-LEF—7 polyclonal antibody at a
1210,000 dilution and then with horseradish peroxidase-conjugated goat anti-rabbit
secondary antibody (Sigma) at a dilution of 1:12,500. The ECL Western blot detection

system (Amersham Life Science) was used for signal detection.

31

Results

Characterizations of mutant virus T295 and T297

AcMNPV mutant viruses, T295 and T 297, were selected on TN368 cells,
following infection with chemically-mutagenized virus stocks. Polyhedra production in
mutant-infected TN368 cells was similar to wt AcMNPV-infected cells, but was
reduced substantially on SF-21 and SElc cells. To determine BV production, medium
was collected from infected cells at various times pi. and titrated. In TN368 cells, both
mutants had 5-10 fold higher titers at 24-36 h pi. but were 2-fold higher than wt
AcMNPV at 48 h pi. (Figure 2.1A). BV production in both T295 and T297 infected
SF—21 and SElc cells was delayed and the titers decreased 3-6 fold compared to
AcMNPV at 48 h pi. (Figure 2.1B, C). PIB production was assessed by determining
the percentage cells containing polyhedra in mutant or wt AcMNPV infected cells.
Almost 100% of TN368, SF-21, and SElc cells infected with wt AcMNPV had
polyhedra at 48 h pi. (Figure 2.1D, E, F). The number of mutant-infected TN368 cells
producing PIBs was 50% less than wt-infected cells at 24 h pi. However, by 36 h pi.
PIB production reached wt levels (Figure 2.1D). In contrast, few cells with polyhedra
were observed in T295 or T297-infected SF-2l and SElc cells before 36 h p.i., and at
48 h p.i., less than 20% of SF-2l cells (Figure 2.1E) and 5% of SElc cells (Figure
2.1F) contained polyhedra.

A comparison of restriction patterns between wt and mutant virus DNAs
revealed altered restriction patterns in both mutant viruses. The EcoRI E fragment is
reduced from 9.6 kbp (Figure 2.2, lane 1, asterisk) to smaller fragments of 6.4 and 5.2
kbp in mutants T295 and T297 respectively (Figure 2.2, lane 2 and 3, arrows)
indicating a deletion occurred. In HindIII digests the 18.5 kbp B’ and 7.5 kbp H'
fragments disappeared (Figure 2.2, lane 4, asterisks) and larger restriction fragments

were observed, approximately 22 kbp and 21 kbp in T295 and T297, respectively,

32

Figure 2.1 Budded virus (BV) production (A—C) and polyhedral inclusion body (PIB)
production (D-F) on different cell lines. (A and D) TN368, (B and E) SF-2l, and (C
and F) SElc infected with wt AcMNPV, mutant T295, or T297. BV production and
percentage of cells with PBS were determined at 0, 12, 24, 36 and 48 h p.i. The titers
were determined by endpoint dilution and TCID50 was converted to pfu/ml. PIB
production is the percentage of cells containing PIBs at the fourth day p.i. The error
bars represent standard deviation from 3 independent experiments. pfu, plaque forming

unit.

33

55085 umoa muse: c2885 $8 $301 co_uom.._c_ “won 950:

 

 

 

 

 

 

 

 

 

wnrpaw lw/njd

we mm ¢N NF 0 we mm vm NF 0 we mm ¢~ NF 0
p . _ . _ p 1.. r #0 . 1.. . :1... O
% . ON % . 8
3 3
P . P .
cl. - ow 9. r 9,
m. . .M.. .
m... m...
M . om H - om
% u w .
1 ow . ow
I 00.. I oo—
”_ .m
c2535 “mom 8301 c2885 “men 8301 c0308.: “won 950:
we mm ¢N NF 0 we om vN NF o 3 mm N N_. o
_ t _ . r r . p T m _ . _ . _ L . . m _ . . . _ _ _ . m
u
d d .
m m m S
- w w
w w T
9
+ m m m. m
r w w 1
r m r m

 

 

 

 

$8Id qllM suao %

 

34

Figure 2.2 Restriction analysis of viral genomes. DNA of wt AcMNPV (lanes 1, 4, 7,
and 10), mutants T295 (lanes 2, 5, 8, and 11), and T297 (lanes 3, 6, 9, and 12)
digested with restriction endonucleases EcoRl, HindIII, XhoI and PstI, are shown.
The fragments labeled with asterisks are those found in wt AcMNPV only; the arrows
indicate the fragments existing in mutants only. 1 HindIII, fragments are indicated as the

size marker. kbp, kilo-base pair.

 

35

th Pen

Ifindm

EcoRI

 

 

_=U:¢*&

Z3

20

056

101112

7239

36

indicating the loss of a HindIII site at the junction of HindIII B’ and H’ in both mutants
(Figure 2.2, lanes 5 and 6, arrow). The XhoI-G fragment is reduced from 7.2 kbp
(Figure 2.2, lane 7, asterisk) to 4.0 and 2.8 kbp in mutants T295 and T297 respectively
(Figure 2.2, lane 8 and 9, arrows). PstI-L (2.9 kbp) and PstI—M (2.7 kbp) fragments
(Figure 2.2, lane 10, asterisks) are reduced to single fragments of 2.1 and 1.0 kbp in
T295 and T297 respectively (Figure 2.2, lane 11 and 12, arrows). The altered
restriction fragments indicate that a 3.2 kbp deletion in T295 and 4.4 kbp deletion in
T297 occurred between the PstI sites at 76.3 and 80.6 map units (Figure 2.3A). Four
major open reading frames pk2, ORF247, lef- 7, and chitinase are located in this region
(Ayres et al, 1994).

The deletion junctions were located by additional restriction analysis of mutant
virus DNA. In mutant T295, a SalI site (77.5 mu) is missing, but NcoI(76.8 mu),
EcoRI (80.2 mu), EcoRV(76.5 mu), and two other SalI sites (79.7 mu and 80.2 mu)
are present (Figure 2.3A). In mutant T297, NcoI, and two SalI sites (77.5 mu and 79.7
mu ) are deleted, but EcoRV, EcoRI and SalI (80.2 mu) sites are present (Figure
2.3A). Subclones pT295-PstI-Sall and pT297-EcoRV-PstI (Figure 2.3A) containing
the deletion junctions were sequenced and compared to wt AcMNPV sequence. lef-7
and ORE-247 were completely deleted in both mutants. pk2 was completely deleted in
T297 and one third, including the promoter region, was lost in T295. 52% and 98% of
the chitinase gene were deleted in T295 and T297 respectively (Figure 2.3A).
Cotransfection of SF21 cells with T295 or T297 DNA and the cloned AcMNPV XmaB
fragment (Passarelli and Miller, 1993), which spans the deleted region, restored
mutants to wt phenotype, supporting the hypothesis that the deletions were responsible

for the mutant phenotypes.

Construction of recombinant viruses

37

Figure 2.3 Identification of the deleted regions of mutant viruses and the construction
of recombinant viruses. An expanded map shows the distribution of ORFs between
PstI sites at 76.3 and 80.6 mu. (A) The deleted regions in T295 and T297 are indicated
by hatched boxes. Fragments, PstI-Sall and EcoRV-Pstl for T295 and T297,
respectively, containing the junction are shown. T3 and T7 primers used for
sequencing are indicated. (B) The actin—GUS cassette was inserted at Neal and EcoRI
sites in vdel-AG; at NsiI and SwaI sites in v1ef7—AG. Arrows, not drawn to scale,
indicate the orientation of the inserted actin-GUS cassette. Restriction endonucleases
used to subclone the deletion junctions and construct the recombinant viruses are

shown.

38

 

 

 

 

Em ER :2 3:.» ER
2E0: _ _ LIT. _ ._
5% 58m 362 :5
$12; _ _ ITIL
Em >-8m

:mm->MOom_-meH

 

Emeameofi .

 

 

 

www-mmo
035:5 WE U a
ma
_ v U
35. “U
Em Eeom as.» men new Em 5.2 :~&. 392 >-8m Em
— _ L _ _ _ _ __ _ _ b
1 + -
odw men
2.24% 4.3%

39

To confirm that the phenotypes of T295 and T297 were the result of the
deletions and determine which ORF was responsible, recombinant viruses with
specific deletions were constructed. A reporter cassette containing the B. mori actin
promoter driving the expression of the GUS gene was inserted at NcoI and EcoRI to
generate a recombinant virus, vdel-AG. vdel-AG has pk2, ORF247, lef- 7, and
chitinase gene disrupted (Figure 2.3B). lef-7 was disrupted by inserting the actin-GUS
cassette into the lef-7 coding region at SwaI and Nsil sites. The resulting recombinant
virus, vlef7-AG, has 30% of lef-7 deleted (Figure 2.3B). PstI restriction pattern and
Southern blot analysis confirmed the constructions (data not shown). Recombinant
viruses vpK2-AG, in which pk2 ORF is deleted, and vORF247-AG, in which
ORF247 is deleted, were constructed in a similar manner (data not shown). The
recombinant viruses were used to infect TN368, SF-21, and SElc cells, and budded
virus and PIB production were assessed. The phenotypes of both vdel-AG and vlef7-
AG resembled those of the mutants. Titers of vlef7-AG—infected SF—21 and SElc cells
reduced 46 fold compared to AcMNPV-infected cells at 48 h p.i. In TN368 cells,
titers of vlef7-AG were higher than wt AcMNPV 24-36 h p.i. (2 fold) and 48 h p.i.
(1.3 fold) (Figure 2.4A). In vlef7-AG-infected SF-21 and SElc cells less than 20%
cells contained PIBs, while more than 95% of vlef7-AG-infected TN368 cells
contained PIBs at 48 h p.i. (Figure 2.4B). BV and PIB production for cells infected
with either vpk2-AG or vORF247-AG were indistinguishable from wt AcMNPV (data
not shown). These data demonstrated that the deletion of lef-7 was responsible for the

phenotypes of T295 and T 297.

Viral replication
Because lef-7 is implicated in viral DNA replication, we examined viral DNA
synthesis in cells infected with viruses lacking lef- 7. DNA synthesis was evaluated

through the course of infection by dot blot analysis using AcMNPV genomic DNA as a

40

Figure 2.4 (A) Budded virus production and (B) percentage of cells with PBS in cells
infected with vlef7-AG or AcMNPV. Open markers represent the results of AcMNPV
infected cells, and solid markers represent the results of vlef7-AG infected cells. Cell

lines used are as indicated.

41

 

 

 

 

8-
E
:3
'6
Q)
E
E
a
a.
DD
2
4 r r r l
0 12 24 36 48
Hours post infection
RX)
80
m 60
E
3‘3
3
:2 40
E
g —A—— wt-TN368
5 20 —O— wt-SF21
—D— wt—SElc
+ vlef7-AG-TN368
+ vleW-AG-SF21

 

+ vleW-AG-SElc

0 12 24 36 48

Hours post infection

 

42

probe. Blots were quantified with a phosphorimager. DNA synthesis was delayed for
12-18 hours in mutant-, vdel-AG-, and vlef7-AG-infected TN368 cells, with 2-4 fold
reduction in viral DNA accumulation before 36 h p.i., however, viral DNA
accumulation reached that of wt-infected TN368 cells by 48 h p.i. (Figure 2.5A and
D). Viral DNA synthesis in T295-, T297-, vdel-AG—, and vlef7-AG-infected SF-21
and SElc cells was reduced to less than 5% as compared to wt AcMNPV-infected cells
up to 48 h p.i. (Figure 2.5B, C, E, and F). Thus lef-7 stimulates DNA synthesis and
the mutant phenotypes resulted from an inability of the virus to efficiently replicate its

DNA in SF21 and SElc cells.

Immunoblot analysis

Because lef-7 is dispensable for AcMNPV replication in TN 368 cells but
necessary in SF21 and SElc cells, we compared LEF-7 expression in wt AcMNPV-
infected SF-21, TN368, and SElc cells over time by western blot analysis. Polyclonal
antibodies were raised against a MBP-LEF-7 fusion protein, in which LEF-7 is
truncated by 23 amino acids at the N -terminus. The antibody against LEF-7 detected a
26 kDa protein in all three cell lines infected with AcMNPV (Figure 2.6), indicating
LEF-7 is translated in SF-2l, TN368, and SElc cells. LEF-7 was detected from 6 to
48 h p.i., but accumulations were reduced after 36 h p.i. in all three cell lines (Figure
2.6). It was not detected in cells infected with T297, which lacks lef- 7, or in mock-

infected cells.

 

43

Figure 2.5 Viral DNA synthesis. Dot blots of total DNA isolated at various time points
p.i. from TN368 (A), SF—21 (B), and SE—lc (C) cells infected with wt AcMNPV,
T295, T297, vdel-AG, or vlef7—AG were probed with labeled wt AcMNPV DNA. (D-
F) show graphic representations of the data from phosphorimager readings of each
blot. Counts are indicated in cpm. Known amounts of AcMNPV DNA as indicated

were used as standards.

cozowt: umoa 9501

ac mm VN m— o
o
3.5%? ill 000m
3...»? 114i
nmwh IIAUIII 0000?
m mm... i4.1
9; 0 000m,
oooo~
OOOmN
0000m

m: 00m
9. omm
m: 8
m: o—

AdNINOV

 

saunog

mv

c2885 uwoa muse:

mm

DV-AJQIA

em

DV-OHXA

NF

1.
Z
6
S

0

000m

0000 —

fiJ

08.: m
U

808 9.

000mm

oooom

 

c2882 uwoa 9:0:
w

m

v

N

N—

 

000m
0000 —
000m F

mg

808 w
ooomN

S

OOOOm
ooom m

 

45

Figure 2.6 LEF-7 expression in three cell lines infected with AcMNPV. Proteins with a
size of 26 kDa (arrow) were detected in SF-21 (lanes 1, 4, 7, 10, 13 and 16), TN368
(lanes 2, 5, 8, 11, 14 and 17), and SElc cells (lanes 3, 6, 9, 12, 15 and 18) from 6 h
p.i. to 48 h p.i. by a polyclonal antibody against LEF-7 fusion protein. This band is not
present in either mock-infected (lanes 19-21) nor mutant T297 infected cells (lanes 22-

24). Size marker is given in kDa.

46

il’IiI‘i .

 

vm mm mm 5 ON aw mr : or mr VF m_. N_. : or

EVNRmNH x002 E wv E mm E VN

mmnomvmm

EM: ENF Em

_.

ivbr

ll 9mm

II o.mv

may

47

Discussion

We identified two AcMNPV mutants, T295 and T297, that have reduced BV
and PIB production in SF—21 and SElc cells, but not in TN368 cells. The mutant
phenotypes were the result of 3.2 kbp (T295) and 4.4 kbp (T297) deletions between
76.5 and 80.2 mu. These mutants, most likely arose spontaneously during virus
passage (Kumar and Miller, 1987), since the mutagen used, BUdR, generates point
mutations. This suggests that additional host range mutants might be isolated by serially
passaging AcMNPV in different permissive cells lines.

The region deleted in both mutants spans four ORFs pk2, ORF247, lef— 7, and
chitinase. By constructing recombinant viruses in which individual ORFs were
disrupted, we determined that deletion of lef-7 alone was responsible for the observed
phenotype in mutant-infected cells and that pk2, and ORF247 were non-essential in all
three cell lines. These results support previous findings that pk2 is non-essential (Li
and Miller, 1995) and that in transient assays lef-7 is required for optimal late reporter
gene expression in SF-21 cells but does not contribute significantly to AcMNPV late
gene expression in TN368 cells (Lu and Miller, 1995b). Our data extend these findings
by demonstrating a differential requirement for lef-7 for AcMNPV replication in
infected TN368, SF-2l, and SElc cells. Interestingly, the deletion of lef-7 impairs
AcMNPV replication in SElc cells slightly more than in SF21 cells. Because Lu and
Miller (1996) noted differences in the ability of hcf-I null mutants to infect two
different T. ni cell lines, TN368 and BTI-TN5B1-4 (Hi5) (W ickham et al., 1992), we
infected Hi5 cells with vlef7-AG. At 48 h p.i. approximately 50% of the Hi5 cells
contained polyhedra compared to greater than 90% of the TN368 cells (data not
shown). The different phenotypes observed for viruses lacking lef-7 in different cell
lines indicate that lef-7 has a cell line-dependent effect on AcMNPV replication. It has

not yet been directly demonstrated that lef-7 affects host range at the organismal level,

48

however mutant T297 has reduced infectivity for S. frugiperda larvae when
administered orally (Chilcote and Thiem, unpublished data).

In previous studies the role of lef-7 in AcMNPV DNA replication was analyzed
by plasmid replication assays in transfected cells (Kool et al., 1994, Lu and Miller,
1995a). In this study we extend the previous work by directly demonstrating a role for
lef-7 in DNA replication virus-infected cells. Virus DNA replication was delayed for
12-18 hours in vlef7-AG—infected TN368 cells and dramatically reduced in vlef7-AG-
infected SF—21 and SElc cells. LEF-7 is not essential but stimulates DNA replication in
reporter plasmid assays in SF-9 and SF-21 cells (Kool et al., 1994; Lu and
Miller,1995a). The deletion of lef-7 results in a profound reduction in AcMNPV DNA
replication in both SF21 and SElc cells. However, the observation of limited virus
production and DNA replication in vlef7-AG—infected SF21 and SElc cells over time
indicates that DNA replication occurs in the absence of LEF-7 in these cells but is
greatly stimulated by LEF7. Although lef-7 was not essential for reporter gene
expression in TN368 cells in transient assays (Lu and Miller, 1995b), the delay in DNA
synthesis in vlef7-AG-infected as compared to wt AcMNPV—infected TN368 cells
demonstrated that lef-7 stimulated viral DNA replication in infected TN368 as well.

LEF-7 is expressed in TN368, SF21, and SElc cells at similar levels and in the
same temporal manner. Although lef-7 is dispensable in TN368 cells, its ability to
stimulate DNA replication in TN368, SElc, and SF21 cells suggests that LEF-7 may
augment cellular factors that have a similar function as LEF-7 which are present in
TN368 cells but are lacking, at low levels, or unable to efficiently interact with the viral
replication machinery in SF21 and SElc cells. The transcriptional activator ie-2 is also
required for optimal reporter gene expression in SF21 but not TN368 cells. Like lef- 7,
ie-2 functions to stimulate DNA replication (Lu and Miller, 1995a). ie-2 is transcribed
in TN 368 cells (Guzo et. al., 1992). It will be interesting to see if deletion of ie-2also

results in subtle alterations in AcMNPV replication in infected-TN368 cells.

49

In vlef7-AG—infected TN368 cells the number of cells containing PBS at 24 hr
p.i. was reduced (40%), although by 48 h p.i. the same number of cells contained PIBs
as wt infected cells, and less than 20% SF-21 and SElc cells contained PIBs by 48 hr
p.i. Budded virus titers are reduced in SF21 and SElc cells infected with viruses
lacking lef-7 , but increased in TN368 cells as compared to wt AcMNPV-infected
TN368 cells before 36 h p.i. (Figure 2.1A) although the appearance of PBS is delayed
for 12 hours (Figure 2.1D). The reason for this is unknown. One possibility is that
budded virus continues to be released because the switch from budded virus to
occluded virus production is delayed in TN368 cells infected with viruses lacking lef— 7.
Few polyhedra (FP) mutants also generate more budded virus during infection than wt
viruses (Fraser and Hink, 1982; Slavicek et al., 1992; Harrison and Summers, 1995),
however unlike cells infected with FP mutants, TN 368 cells infected with vlef7—AG

produce similar numbers of PBS as those infected with wt-AcMNPV.

50

Acknowledgments

We thank Kostas Iatrou for plasmid pBBml/BmA.lacZ2, Brian Federici for the
SElc cell line, and Lois Miller for AcMNPV clones. This work was supported in part
by Public Health Service Grant GM 48608 from the National Institute of General
Medical Sciences to S.M.T.

51

References

Ayres, M. D., S. C. Howard, J. Kuzio, M.Lopezferber, and R. D.
Possee. (1994). The complete DNA sequence of Autographa califomica nuclear
polyhedrosis virus. Virology 202: 586-605.

Blissard, G. W. and G. F. Rohrmann. (1990). Baculovirus diversity and
molecular biology. Annu. Rev. Entomol. 35: 127-155.

Bresser, J. and D. Gillespie (1983) Quantitative binding of covalently closed
circular DNA to nitrocellulose in NaI. Anal. Biochem. 129: 357-364.

Bullock, W. 0., J. M. Fernandez, and J. M. Short. (1987). XLl-Blue: A
high efficiency plasmid transforming recA Escherichia coli strain with beta-
galactosidase selection. Biotechniques 4: 376-379.

Carson, D. D., M. D. Summers, and L. A. Guarino. ( 1991a). Molecular
' analysis of a baculovirus regulatory gene. Virology 182: 279-286.

Carson, D. D., M. D. Summers, and L. A. Guarino. (1991b). Transient
expression of the Autographa califomica nuclear polyhedrosis immediate-early gene,
IE-N, is regulated by three viral elements. J. Virol. 65: 945-951.

Clem, R. J., M. Fechheimer, and L. K. Miller. (1991). Prevention of
apoptosis by a baculovirus gene during infection of insect cells. Science 254: 1388—
1390.

Clem, R. J. and L. K. Miller. (1993). Apoptosis reduces both the in vitro
replication and the in vivo infectivity of a baculovirus. J. Virol. 67 : 3730-3738.

Croizier, G., L. Croizier, , O.Argaud, and D. Poudevigne. (1994).
Extension of Autographa califomica nuclear polyhedrosis virus host range by

interspecific replacement of a short DNA sequence in the p143 helicase gene. Proc.
Natl. Acad. Sci. (USA) 91: 48-52.

Fraser, M. J. and W. F. Hink. (1982). The isolation and characterization of the
MP and PP plaque variants of Galleria mellonella polyhedrosis virus. Virology 117:
366-378.

Gelernter, W. D. and B. A. Federici. (1986). Continuous cell line from
Spodoptera exigua (Lepidoptera: noctuidae) that supports replication of nuclear

polyhedrosis viruses from Spodoptera exigua and Autographa califomica. J.
Invertebr. Pathol. 48: 199-207.

Griiner, A. (1986). Specificity and safety of baculoviruses. In R. R. Granados and
B. A. Federici (Eds.), "The Biology of Baculoviruses, Vol. 1, Biological Properties
and Molecular Biology" (pp. 177-202). CRC Press, Inc., Boca Raton, FL.

Guarino, L. A. and M. D. Summers. (1987). Nucleotide sequence and temporal
expression of a baculovirus regulatory gene. J. Virol. 61: 2091-2099.

52

Guarino, L. A. and M. D. Summers. (1988). Functional mapping of
Autographa califomica nuclear polyhedrosis virus genes required for late gene
expression. J. Virol. 62: 463-471.

Guzo, D., H. Rathburn, K. Guthrie, and E. Daugherty. (1992). Viral and
host cellular transcription in Autographa califomica nuclear polyhedrosis virus-
infected gypsy moth cell lines. J. Virol. 66: 2966-2972.

Harrison, R. L. and M. D. Summers. (1995). Mutations in the Autographa
califomica multinucleocapsid nuclear polyhedrosis virus 25 kDa protein gene result in
reduced virion occlusion, altered intranuclear envelopment and enhanced virus
production. J. Virol. 76: 1451-1459.

Hershberger, P. A., J. A. Dickson, and P. D. Friesen. (1992). Site-specific
mutagenesis of the 35-Kilodalton protein gene encoded by Autographa califomica

nuclear polyhedrosis virus - cell line-specific effects on virus replication. J. Virol.
66: 5525-5533.

Hink, W. F. (1970). Established insect cell line from the cabbage looper,
Trichoplusia ni. Nature (London) 226: 466-467.

Hink, W. F. and R. L Hall. (1989). Recently established invertebrate cell lines.
In J. Mitsuhashi (Eds.), "Invertebrate cell system applications" (pp. 269-293). CRC
Press, Inc., Boca Raton, FL.

Hoopes, R. R. and G. F. Rohrmann. (1991). In vitro transcription of
baculovirus immediate early genes-accurate messenger RNA initiation by nuclear
extracts from both insect and human cells. Proc. Natl. Acad. Sci. (USA) 88: 4513-
45 17.

Huh, N. E. and R. F. Weaver. (1990). Identifying the RNA polymerases that
synthesize specific transcripts of the Autographa califomica nuclear polyhedrosis
virus. J. Gen. Virol. 71: 195-201.

Johnson, R., R. G. Meidinger, and K. Iatrou. (1992). A cellular promoter-
based expression cassette for generating recombinant baculoviruses directing rapid
expression of passenger genes in infected insects. Virology 190: 815—823.

K001, M., C. H. Ahrens, R. W. Goldbach, G. F. Rohrmann, and J.
M.Vlak. (1994). Identification of genes involved in DNA replication of the
Autographa califomica baculovirus. Proc. Natl. Acad. Sci. (USA) 91: 11212—
11216.

Kumar, S. andL. Miller. (1987). Effects of serial passage of Autographa
califomica nuclear polyhedrosis virus in cell culture. Virus Research 7: 335-349.

Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the
head of bacteria phage T4. Nature (London). 227 : 680-685.

Lee, H. H. and L. K. Miller. (1979). Isolation, complementation, and initial
characterization of temperature-sensitive mutants of the baculovirus Autographa
califomica nuclear polyhedrosis virus. J. Virol. 31: 240-252.

53

Li, Y. and L. K. Miller. (1995). Expression and functional analysis of a

baculovirus gene encoding a truncated protein kinase homolog. Virology 106:
412-423.

Lu, A. and E. B. Carstens. (1991). Nucleotide sequence of a gene essential for
viral DNA replication in the baculovirus Autographa califomica nuclear polyhedrosis
virus. Virology 181: 336-347.

Lu, A. and L. K. Miller. (1995a). The roles of eighteen baculovirus late
expression factor genes in transcription and DNA replication. J. Virol. 69: 975-982.

Lu, A. and L. K. Miller. (1995b). Differential requirements for baculovirus late
expression factor genes in two cell lines. J. Virol. 69: 6265-6272.

Lu, A. and Miller, L. K. (1996). Species-specific effects of the hcf-I gene on
baculovirus virulence. J. Virol. 70: 5123-5130.

Maeda, S., S. G. Kamita, and A. Kondo. (1993). Host range expansion of
Autographa califomica nuclear polyhedrosis virus (NPV) following recombination of
a 0.6-kilobase-pair DNA fragment originating from a Bombyx mori N PV. J. Virol.
67: 6234-6238.

Morris, T. D., J. W.Todd, B. Fisher, L. K. Miller. (1994). Identification of
lef-7 - a baculovirus gene affecting late gene expression. Virology 200: 360-369.

O’Reilly, D. R., L. K. Miller, and V. A. Luckow. (1992). "Baculovirus
Expression Vectors. A Laboratory Manual". W. H. Freeman, New York.

Passarelli, A. L. and L. K. Miller. (1993). Three baculovirus genes involved in
late and very late gene expression: ie-l, ie-n, and lef-2. J. Virol. 67: 2149-2158.

Sambrook, J., E. F. Fritsch, and T. Maniatis. (1989). in "Molecular
Cloning. A Laboratory Manual", 2nd ed. Cold Spring Harbor Laboratory, New
York.

Sanger, F., S. Nicklen, and A. Coulson. (1977). DNA sequencing with chain-
terminating inhibitors. Proc. Natl. Acad. Sci. (USA). 74: 5463-5467.

Slavicek, J. M., J. Podgewaite and C. Lanner-Herrera. (1992). Properties
of two Lymantra dispar nuclear polyhedrosis virus isolates obtained from the
microbial pesticide Gypchek. J. Invertebr. Pathol. 59: 142-148.

Summers, M. D. and G. E. Smith. (1987). "A Manual of Methods for
Baculovirus Vectors and Insect Culture Procedures". Texas Agricultural Experiment
Station, College Station Texas.

Thiem, S. M., X. Du, M. E. Quentin, and M. M. Berner. (1996).
Identification of a baculovirus gene that promotes Autographa califomica nuclear
polyhedrosis virus replication in a nonpermissive insect cell line. J. Virol. 70: 2221-
2229.

Todd, J. W., A. L. Passarelli, and L. K. Miller. (1995). Eighteen
baculovirus genes, including lef-I 1, p35, 39K and p47, support late gene
expression. J. Virol. 69: 968-974.

54

Towbin, H., T. Staehelin and J. Gordon. (1979). Electrophoretic transfer of
protein from polyacrylamide gels to nitrocellulose sheets: procedure and some
applications. Proc. Natl. Acad. Sci. (USA). 76: 4350- 4354.

Wickham, T. J ., T. T. Davis, R. R. Granados, M. L. Shuler, and H. A.
Wood. (1992). Screening insect cell-lines for the production of recombinant
proteins and infectious virus in the baculovirus expression system. Biotechnol. Prog.
8: 391-396.

Vaughn, J. L., R. H. Goodwin, G. J. Tompkins, and P. McCawley.
(1977). The establishment of two cell lines from the insect Spodopterafrugiperda
(Lepidoptera: noctuidae). In Vitro 13: 213-217.

Chapter 3

lef-7 deletion reduces AcNPV infectivity in Trichoplusia ni larvae and

cell line BTI-TN5B1-4

55

56

Abstract

Autographa califomica nucleopolyhedrovirus (AcNPV) late expression factor-7
(lef-7) is required for optimal infection of SF—21 , a cell line derived from Spodoptera
fi'ugiperda larvae, but not for the infection of TN368 cells, a cell line derived from
Trichoplusia ni (Chen, C.-J. and S. M. Thiem, Virology 227: 88-95, 1997). In this
study, we investigated if lef-7 deletion affects AcNPV larval infectivity. Bioassays
using vlef7-AG, a lef-7 disrupted mutant, and wild type AcNPV were conducted in T.
ni and S. frugiperda larvae by oral infection. Fifty percent lethal concentration (LC50)
of vlef7-AG for either T. ni or S. frugiperda was approximate 50-fold higher than that
of AcNPV, indicating lef-7 is required for AcNPV infection in both species. In vlef7-
AG-infected TN368 cells, viral DNA synthesis and production of viral progeny were
similar to those of wild type AcNPV. In contrast, in vlef7-AG—infected BTI-TN5B1-4
(Hi5) cells, another cell line derived from T. ni, budded virus and occluded virus
production, as well as viral DNA synthesis were reduced. The different requirements
for lef-7 for AcNPV infection of two T. ni cell lines combined with the bioassay data

suggested that lef-7 may function as a tissue-specific factor.

57

Introduction

Baculoviruses are invertebrate-specific pathogens that can be used as bio-
pesticides. Two forms of viruses are produced during bacuolovirus infection. Budded
virus (BV), synthesized early in the infection course, is responsible for cell to cell
transmission. This is the form of virus used in the studies that were conducted in
cultured cells. Occluded virus (OV), embedded in polyhedrin protein matrix and
persisting in the environment, is responsible for spreading the virus among insect
populations. This is the form of the virus that was used to infect insect larvae in
bioassays. Caterpillars become infected after they ingest the food contaminated with
OV. Polyhedra dissolve in the alkaline environment of the midgut and the viral particles
are released into the gut lumen (Harrap and Longworth, 1974). The primary infection is
initiated when virions enter midgut epithelium through the microvilli by membrane
fusion (Granados and Lawler, 1981; Horton and Burand, 1993). Nucleocapsids are
then transported to the nuclei where progeny viruses are produced. Following viral
replication, BV is released and spreads to other tissues to establish secondary infection
(Keddie et al., 1989; Flipsen et al., 1995).

The ability of a virus to enter, replicate, produce infectious progeny, and
establish secondary infection in a host determine their host specificity. The inability of
AcNPV to infect nonpermissive cell lines is not limited by the entry. For example,
AcNPV can enter nonpermissive insect cell lines such as BmN-4 (B. mori), CF-l
(Choristoneurafitmiferana), Dm (Drosophila melanogaster Schneider 1), and Hzlb3
(Helicoverpa zea) (Morris and Miller, 1993). In these non-permissive cells, genes are
expressed in a promoter-depend manner. For example, in non-permissive cells, a
reporter gene was not expressed when under the control of AcNPV polh promoter

(Morris and Miller, 1992), but was expressed when controlled by Rous Sarcoma Virus

58

LTR (Carbonell et al., 1992) or by AcNPV early promoter etl (Morris and Miller,
1992, 1993).

Several baculovirus genes, which are known to influence AcNPV infectivity in
specific cell lines, also affect larval host range. The deletion of p35, an apoptosis
inhibitor (Clem et al., 1991; Crook et al., 1993.) from AcNPV, results in reduced
infectivity in the SF-21 cell line (Clem et al., 1991; Clem and Miller, 1993;
Hershberger et al. , 1992) and Spodopterafrugiperda larvae, but does not impair virus
replication in TN368 (Trichoplusia ni) cells or T. ni larvae (Clem and Miller, 1993).
Thus, the ability of AcNPV to block a cellular apoptotic response increases its host
range. Recombination between the Bombyx mori NPV p143, a putative DNA helicase
gene Usu and Carstens, 1991), with p143 of AcNPV resulted in AcNPV recombinant
that could replicate in the non-permissive B. mori cell line, BmN-4 (Croizier et al.,
1994; Maeda et al., 1993). B. mori larvae which are not susceptible to AcNPV were
also killed by injection of this virus (Croizier et al., 1994).

Different cell lines may have different requirements for lefs for virus replication.
For example, ie-2, p35 and lef-7 are dispensable in TN368 cells but are required in SF-
21 cells in the transient assays (Lu and Miller, 1995b). AcNPV lef-7 mutant has
reduced BV and CV production in SF-21 and SElc cells, but not in TN368 cells (Chen
and Thiem, 1997). A new lef gene AcNPV host cell-specific factor-1 (hcf-I) is
essential for late gene expression in TN368 cells (Lu and Miller, 1995b; 1996). AcNPV
hcf-I null mutant has normal infectivity for SF-21 cells and S. frugiperda larvae, while
its replication is severely impaired in TN368 cells and it exhibits decreased virulence for
T. ni larvae (Lu and Miller, 1996). An intermediate phenotype was observed for hcf-I
mutant infection of another T. ni cell line, BTI-TN5B1-4.(Hi5) (Lu and Miller, 1996).
Lymantria dispar NPV hrf-I promotes AcNPV replication in a nonpermissive L. dispar

cell line by preventing global protein synthesis arrest in the AcNPV infected Ld652Y

59

cells (Du and Thiem, 1997). AcNPV bearing hrf-I become infectious to L. dispar
larvae (Chapter 6).

To investigate the effects of lef-7 deletion in AcNPV larval infectivity,
bioassays using wild type AcNPV and vlef7-AG, a lef-7 deletion mutant, were
conducted on T. ni and S. frugiperda larvae by oral infection. Lethal concentration 50%
(LC50) of the vlef7-AG was compared to AcNPV. To investigate lef-7 tissue tropism,
BV and CV production as well as viral DNA synthesis were evaluated on two T. ni cell

lines, TN368 and BTI-TN5B1-4 (Hi5), which were devived from different tissues.

 

60

Material and Methods

Cells and viruses

Trichoplusia ni TN368 (Hink 1970) and BTI-TN-5Bl-4 (also known as Hi5)
(W ickharn et al., 1992) were maintained at 27°C in TC-100 medium (Life
Technologies, Inc., Gaithersburg, MD) supplemented with 10% fetal bovine serum
(Life Technologies, Inc.) and 0.26% tryptose broth. AcMNPV was propagated in T. ni
larvae and SF—21 cells. AcNPV lef-7- disrupted virus vlef7-AG was isolated and
amplified on TN368 cells.

Bioassays

Larvae of T. ni and S. frugiperda were reared from eggs obtained from Forest
Pest Management Institute, Forestry Canada (Ste. Marie, Ont.) and Agricultural
Research Service, US. Department of Agriculture (Columbus, MO.), respectively. T.
ni neonates were reared on alfalfa and pinto bean diet (Treat and Halfhill, 1973) and S.
frugiperda on wheat germ diet (Burton, 1969) and held at 25°C with 14/ 10 h light/dark
cycle. The wild-type AcNPV variant L1 (Lee and Miller, 1978), and vlef7-AG (Chen
and Thiem, 1997) were used for bioassays. AcNPV polyhedra for inoculation of larvae
were isolated from ground carcasses of AcNPV-infected T. hi, and vlef7-AG polyhedra
were isolated from vlef7-AG-infected TN368 cells. Purified polyhedra were suspended
in sterile distilled water and counted using a Neubauer hemocytometer and phase-
contrast microscopy. The number of polyhedra per ml was based on an average of eight
counts.

LC50 of AcMNPV and vlef7-AG were determined by infecting T. ni and S.
frugiperda neonates per os. Insects (60) were infected with AcMNPV concentrations
ranging from 2x102 to 2x106 OV/ml, or with vlef7-AG at concentrations ranging from

2x 104 to 2x108 OV/ml-diet per dose per virus. Larvae were allowed to feed on diet

61

containing OV for 24 h, then transferred to fresh diet. Larval motility was monitored
daily, and experiments were terminated at the fourth day post infection. Data from two
replicates were pooled. LC5os for all the bioassays were determined by probit analysis
(Finney, 1971) using POLO-PC (LeOra Software, Berkeley, CA.). Significant

differences between LC5os were determined by non-over lapping confidence limits.

Virus replication studies

For time courses, TN368 and Hi5 cells were seeded onto 60 mm tissue culture
plates at 1x106 cells per plate, and infected with either AcMNPV or vlef7-AG at a
multiplicity of infection (moi) of 10 PFU/cell. Cells were incubated with virus for 1 h
and the zero time point was defined as the time when the inoculum was removed.
Infected cells were harvested at 0, 6, 12, 24, and 48 h post infection. The percentage of
cells with OVs was determined by counting total cell number and the number of cells
containing OVs using an improved-Neubauer hemocytometer under a Nikon TMS
inverted-microscope. Between 100-400 cells were counted for each time point in each
of two duplicate experiments. Budded virus production was determined by end-point
dilution assay (O’Reilly et al., 1992) on TN368 cells, and cells were scored for OV
formation on the fourth day p.i. TCIDSO was calculated and converted to pfu/ml
according to O’Reilly et al. (1992).

For viral DNA synthesis studies, DNA was prepared for dot blot analysis by
Nal treatment (Bresser and Gillespie, 1983). CV and BV were harvested, lysed, and
after the NaI treatment, blotted on to Zeta-probe nylon membrane as described
previously (Chen and Thiem, 1997). Samples were probed with nick-translated
(Sambrook et al., 1989) AcNPV DNA, and hybridization was carried out in the
hybridization solution (50% forrnamide, 50 mM phosphate buffer, 5x SSC, 5x
Denhardt’s solution, 0.1% SDS, and 100 jig/ml salmon sperm DNA) at 42°C for 18
hours (Sambrook et al., 1989). The blot was visualized by autoradiography and the

62

bound probe was quantified with a phosphorimager (Molecular Dynamics, Sunnyvale,

CA.).

63

Results

lef-7 deletion reduced AcNPV larval infectivity

lef-7 disruption has minor effects on the ability of AcNPV to infect a
Trichoplusia ni cell line, TN368, while the infectivity in SF—21, a Spodoptera
frugiperda cell line is dramatically reduced (Chen and Thiem, 1997). To determine if
lef—7 disruption would reduce AcNPV larval infectivity, bioassays were performed on
T. ni and S. frugiperda neonates using wild type AcNPV and lef7-AG, a lef-7 truncated
AcNPV by the oral route. Larvae (60 larvae/virus concentration) were allowed to feed
on artificial diet containing polyhedra for 24 h and transferred to fresh diet cups. The
mortality was examined daily. The data from two independent experiments were pooled
and analyzed by probit analysis (Finney, 1971). The LC50 of vlef7-AG was 50-fold
and 48-fold higher for T. ni andS. frugiperda, respectively, than that of AcNPV (Table
3.1). These results indicated that lef-7 deletion greatly reduced AcNPV infectivity for

both T. ni and S. frugiperda larvae.

vlef7-AG BV and CV productions in Hi5 cells

Although lef-7 is not required for AcNPV infection of TN368 cells (Chen and
Thiem, 1997; Lu and Miller, 1995), vlefl-AG was 50-fold less infectious than AcNPV
for T. ni larvae (Table 3.1). One possible reason is that different tissues or cell types in
T. ni larvae have different requirements of lef-7 for AcNPV infection. To address this
possibility, vlet7-AG was used to infect two T. ni cell lines, TN 368 and Hi5, that were
derived from different tissues. Budded virus and occluded virus production in these cell
lines were evaluated at various times p.i. To determine titers, medium was collected
from infected cells and titrated. OV production was assayed by determining the

percentage of cells containing polyhedra in infected cells. BV production of vler-AG

64

Table 3.1 Dose response of Trichoplusia .ni and Spodopterafrugiperda neonates

infected per 05 with wild type AcNPV or vlefl-AG, a lef- 7-minus mutant.

 

 

 

Species Virus LCso Upper Lower
(OV/ml) Fiducial limits (OV/ml)
Trichoplusia ni AcNPV 8.9x 103 1 .9x 104 4.3x 103
vlef7-AG 4.6x105 1.1x106 2.0x105
Spodoptera frugiperda AcNPV 4.9x 105 1 .3x 106 2.4x 105
Vlef7-AG 2.4X107 5.0X107 9.8X106

 

OV: occluded virus

65

infected Hi5 cells was slightly lower than vlef7-AG-infected TN368 cells, and was
reduced 7-fold compared to AcNPV-infected Hi5 cells (Figure 3.1A). OV production
was much reduced in vlef7-AG- compared to AcNPV-infected Hi5 cells from 12 h to
48 h p.i. (Figure 3.1B). By 48 h p.i. only about 40% of vlefl-AG-infected Hi5 cells
contained OV compared to 95% of infected TN368 cells (Figure 3.1B). Variability in
the numbers of polyhedra per cell was also observed in vlef7-AG infected Hi5 cells

(data not shown).

lef-7 deletion reduced viral DNA replication in Hi5 cells

Because baculovirus late and very late gene expression depends on viral DNA
production and lef-7 is implicated in viral DNA replication, we examined the amount of
viral DNA present in vlef7-AG- or AcNPV-infected TN368 and Hi5 cells at various
time points p.i. DNA synthesis was evaluated from 0 to 48 h p.i. by dot blot analysis
using labeled AcNPV genomic DNA as a probe. Isolated DNA was prepared by
modified NaI treatment (Chen and Thiem, 1997). The blot was visualized by
autoradiography (Figure 3.2A) and the bound probe was quantified with a
phosphorimager (Molecular Dynamics, Sunnyvale, CA.) (Figure 3.23). Viral DNA
synthesis in vlef7-AG-infected TN368 cells was slightly lower than in AcNPV-infected
TN368 cells before 36 h p.i., but it reached wild type levels by 48 h p.i. (Figure 3.2),
as previously shown (Chen and Thiem, 1997). In contrast, in vlef7-AG infected Hi5
cells, viral DNA replication was delayed and overall viral DNA levels. were reduced by

approximately 20% compared to AcNPV-infected Hi5 cells (Figure 3.2).

65

infected Hi5 cells was slightly lower than vlef7-AG-infected TN368 cells, and was
reduced 7-fold compared to AcNPV-infected Hi5 cells (Figure 3.1A). OV production
was much reduced in vlef7-AG- compared to AcNPV-infected Hi5 cells from 12 h to
48 h p.i. (Figure 3.1B). By 48 h p.i. only about 40% of vlefl-AG-infected Hi5 cells
contained OV compared to 95% of infected TN368 cells (Figure 3.1B). Variability in
the numbers of polyhedra per cell was also observed in vlef7—AG infected Hi5 cells

(data not shown).

lef-7 deletion reduced viral DNA replication in Hi5 cells

Because baculovirus late and very late gene expression depends on viral DNA
production and lef-7 is implicated in viral DNA replication, we examined the amount of
viral DNA present in vlef7-AG- or AcNPV-infected TN368 and Hi5 cells at various
time points p.i. DNA synthesis was evaluated from 0 to 48 h p.i. by dot blot analysis
using labeled AcNPV genomic DNA as a probe. Isolated DNA was prepared by
modified N aI treatment (Chen and Thiem, 1997). The blot was visualized by
autoradiography (Figure 3.2A) and the bound probe was quantified with a
phosphorimager (Molecular Dynamics, Sunnyvale, CA.) (Figure 3.2B). Viral DNA
synthesis in vlef7-AG-infected TN368 cells was slightly lower than in AcNPV-infected
TN368 cells before 36 h p.i., but it reached wild type levels by 48 h p.i. (Figure 3.2),
as previously shown (Chen and Thiem, 1997). In contrast, in vlef7—AG infected Hi5
cells, viral DNA replication was delayed and overall viral DNA levels were reduced by

approximately 20% compared to AcNPV-infected Hi5 cells (Figure 3.2).

 

66

Figure 3.1 (A) Budded virus production and (B) percentage of cells containing
occluded virus in TN368 (0) or Hi5 (A) when infected with AcNPV or vlef7-AG. Solid
markers represent the results of AcNPV-infected cells, and open markers represent the

results of vlef7—AG-infected cells.

67

 

Log pfu/ml medium

 

 

Hours post inffection

>

O

5

a

£3. AcNPV—TN368
E

0

5° AcNPV—HiS

v leW—AG—TN368

v lel7—AG-Hi5

 

 

 

Hours post infection

68

Figure 3.2 Viral DNA synthesis. (A) Dot blot analysis at various times p. i. of total
DNA isolated from TN368 and Hi5 cells infected with AcNPV or vlef7-AG. (B)
Graphic representation of the data from phosphorimager readings of the blot. Counts

are indicated in cpm.

69

m_I-O<-Eo_>
womZE-O<-E2>
mid/azure,
wOmZH->mZo<

corona: “mom mSoI

oo+m5

 

 

roam?»

r ho+m _

.. hO+mN

 

r 21mm

uiur/ndo

SlH‘DV‘UQIA

89ENI'DV'L191A

SlH‘AdNOV

89€NJJAdN3V

xv

70

Discussion

lef-7 was previously identified to be non-essential for AcNPV infection in
TN368 cells by transient assays (Lu and Miller, 1995) and in cells infected with a lef-7
deletion mutant (Chen and Thiem, 1997). In contrast, lef-7 was required for optimal
AcNPV replication in SF—21 cells (Chen and Thiem, 1997). However, bioassay data
did not reflect this apparent species-specific requirements of lef-7 for AcNVP infection.
v1ef7-AG was less virulent than AcNPV for both S. frugiperda and T. ni larvae when
CV was administered per os. Because BV was used to infect cultured cells and CV was
used to infect larvae in bioassays, it is possible that the form of the virus used to infect
larvae was the reason. However, this is unlikely since lef—7 is involved in DNA
replication (Chen and Thiem, 1997; Lu and Miller, 1995b). A more plausible
explanation would be a tissue-specific requirements for lef-7 during AcNPV infection.

vlef7-AG infected Hi5 cells exhibited reduced BV and OV production and viral
DNA synthesis compared to mutant-infected SF-21 cells. Virus production in vlef7-
AG-infected TN368 cells was similar to that of AcNPV-infected cells. The different
requirements for lef-7 for AcNPV infection in two T. ni cell lines as well as for SF-21
cells demonstrated that lef-7 is a cell line-specific factor. The different responses of
TN368 and Hi5 cells, cell lines that were derived from the same species, to v1ef7-AG-
infection may reflect tissue-specific differences in the requirements of lef- 7.

In studies of the hcf-I mutant phenotype, it was suggested that Hi5 cells may
have properties resembling T. ni midgut cells while TN368 cells are more similar to the
hemocytes (Lu and Miller, 1996). If this is true, it would support the hypothesis that
the reduced infectivity of vlef7-AG for both S. frugiperda and T. ni larvae is due to a
tissue specific requirement for lef— 7. Because midgut epithelial cells are the site of
primary infection, reduced viral replication in these cells would have a profound effect

on viral infectivity in larvae by preventing or severely limiting secondary infection.

71

Hemocoel injection of vlefl-AG BV, which would by pass primay infection, can be
used to determine if the reduced infectivity of vlef7-AG for T. ni larvae is due to
reduced virus replication in midgut cells. Similar LC50 for T. ni larvae injected with
AcNPV or vlef7-AG would support this hypothesis. Hemocoel injection studies of S.
frugierda larvae could help to determine if lef-7 functions in a species-specific manner.
The studies of lef-7 mutants in cultured cells shows that lef-7 is a cell-line
specific factor (Chen and Thiem, 1997). These studies suggests that lef-7 may also
function as a tissue-specific factor. There are several baculovirus genes identified to be
species-specific factors such as p35 (Clem and Miller, 1993; Hershberger et al., 1992),
p143 (Croizier et al. 1993, Maeda et al., 1993), and hcf-I (Lu and Miller, 1995a,
1996). No tissue-specific factors were identified so far. The present of such species- or
tissue-specific factors may be advantages for the viruses to distribute in nature.
Understanding the genes and the mechanisms that influence the tissue tropism will be

useful for designing a vector to deliver genes to specific targets.

72

References

Bresser, J. and, D. Gillespe. (1983). Quantitative binding of covalently closed
circular DNA to nitrocellulose in NaI. Anal. Biochem. 129: 357-364.

Burton, (1969). Mass rearing the corn earworrn in the laboratory. USDA ARS (Ser):
33-34.

Carbonell, L. F., M. J. Klowden, adn L. K. Miller. (1985). Baculovirus-
mediated expression of bacterial genes in dipteran and mammalian cells. J. Virol. 56:
153-160.

Chen, C.-J. and S. M. Thiem. (1997). Differential infectivity of two Autographa
califomica nucleopolyhedrovirus mutants on three permissive cell lines is the result of
lef-7 deletion. Virology 227: 88-95.

Clem, R. J., M. Fechheimer, and L. K. Miller, (1991). Prevention of
apoptosis by a baculovirus gene during infection of insect cells. Science 254: 1388-
1390.

Clem, R. J. and L. K. Miller, (1993). Apoptosis reduces both the in vitro
replication and the in vivo infectivity of a baculovirus. J. Virol. 67 : 3730-3738.

Croizier, G., L. Croizier, O. Argaud, and D. Poudevigne, (1994).
Extension of Autographa califomica nuclear polyhedrosis virus host range by

interspecific replacement of a short DNA sequence in the p143 helicase gene. Proc.
Natl. Acad. Sci. (USA) 91: 48-52.

Crook, N. E., R. J. Clem, and L. K. Miller, (1993). An apoptosis-inhibiting
baculovirus gene with a zinc finger-like motif. J. Virol. 67 : 2168-2174.

Du, X. and S. M. Thiem, (1997). Characterization of host range factor 1 (hrf-I)
expression in Lymantria dispar M nucleopolyhedrovirus- and recombinant
Autographa califomica M N ucleopolyhedrovirus-infected IPLB-Ld652Y cells.
Virology 227: 420-430.

Finney, D. J. (1952). Probit analysis, a statistical treatment of the sigmoid response
curve, 2nd ed. Cambridge University Press, Cambridge.

Flipsen, J. T. M., J. W. M. Martens, M. M. Vanoers, J. M. Vlak, and
J. W. M. Vanlent. (1995). Passage of Autographa califomica nuclear
polyhedrosis virus through the midgut epithelium of Spodoptera exigua larvae.
Virology 208: 328-335.

Granados, R. R., and K. A. Lawler. (1981). In vivo pathway of Autographa
califomica baculovirus invasion and infection. Virology 108: 297-308.

Harrap, K. A. and J. F. Longworth. (1974). An evaluation of purification
methods for baculovirus. J. Invertebr. Pathol. 24: 55-62.

73

Hershberger, P. A., J. A. Dickson, and P. D. Friesen, (1992). Site-specific
mutagenesis of the 35-Kilodalton protein gene encoded by Autographa califomica

nuclear polyhedrosis virus - cell line-specific effects on virus replication. J. Virol.
66: 5525-5533.

Hink, W. F. (1970). Established insect cell line from the cabbage looper,
Trichoplusia ni. Nature (London) 226: 466-467.

Horton, H. M. and J. P. Burand. (1993). Saturable attachment sites for
polyhedron-derived baculovirus on insect cells and evidence for entry via direct
membrane fusion. J. Virol. 67: 1860-1868.

Keddie, B. A., G. W. Aponte, and L. E. Volkman. (1989). The pathway of
infection of Autographa califomica nuclear polyhedrosis virus in an insect host.
Science 243: 1728-1730.

Lee, H. H. and L. K. Miller, (1978). Isolation of genotypic variants of
Autographa califomica nuclear polyhedrosis virus. J. Virol. 27: 754-767.

Lu, A. and E. B. Carstens, (1991). Nucleotide sequence of a gene essential for
viral DNA replication in the baculovirus Autographa califomica nuclear polyhedrosis
virus. Virology 181: 336-347.

Lu, A. and L. K. Miller. (1995a). Differential requirements for baculovirus late
expression factor genes in two cell lines. J. Virol. 69: 6265-6272.

Lu, A. and L. K. Miller. (1995b). The roles of eighteen baculovirus late
expression factor genes in transcription and DNA replication. J. Virol. 69: 975-982.

Lu, A. and L. K. Miller. (1996). Species-specific effects of the hcf-I gene on
baculovirus virulence. J. Virol. 70: 5123-5130.

Maeda, S., S. G. Kamita, and A. Kondo. (1993). Host range expansion of
Autographa califomica nuclear polyhedrosis virus (NPV) following recombination of
a 0.6-kilobase-pair DNA fragment originating from a Bombyx mori NPV. J. Virol.
67: 6234-6238.

Morris, T. D. and L. K. Miller, (1992). Promoter Influence on baculovirus-

mediated gene expression in permissive and non—permissive insect cell lines. J. Virol.
66: 7397-7405.

Morris, T. D. and L. K. Miller, (1993). Characterization of productive and non-
productive AcMNPV Infection in selected insect cell lines. Virology 197: 339-348.

O’Reilly, D. R., L. K. Miller, and V. A. Luckow, (1992). Baculovirus
expression vectors. A laboratory manual 347. W. H. Freeman and Company. New
York.

Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning: A
laboratory manual. Cold Spring Harbor Laboratory. New York.

Treat, T. L. and J. E. Halfhill, (1973). Rearing alfalfa loopers and celery
loopers on an artificial diet. J. Econ. Ent. 66: 569-570.

74

Wickham, T. J., T. T. Davis, R. R. Granados, M. L. Shuler, and H. A.
Wood, (1992). Screening insect cell-lines for the production of recombinant proteins
and infectious virus in the baculovirus expression system. Biotechnol. Prog. 8: 391-
396.

 

Chapter 4

An investigation of possible functions of AcNPV LEF-7

75

 

76

Abstract

Previously, we demonstrated that Autographa califomica nucleopolyhedrovirus
(AcNPV) late expression factor (lef-7) stimulates viral DNA replication in insect cell
lines (Chen, C-J and S. M. Thiem, Virology 227-88-95, 1997), suggesting LEF-7
plays a role of viral replication machinery. It was proposed that lef-7 encodes a single-
strand DNA (ssDNA) binding protein (SSB) because of its sequence similarity to a
motif conserved in SSB (Lu and Miller, 1995). In this study, we investigated the
possible SSB function of LEF-7 by using ssDNA agarose. We also studied the ability
of LEF-7 to bind to late gene promoters and homologous regions (hrs) by nitrocellulose
filter binding assays. In addition we sought potential complexes formed with LEF-7 by
immunoprecipitation using antibodies against LEF-7. N o conclusive results suggested
that LEF-7 binds to ssDNA, late gene promoters or homologous regions. Additionally,
there was no evidence that LEF-7 formed a protein complex with other elements under

the experimental conditions used.

 

77

Single-stranded DNA binding assay

Autographa califomica nucleopolyhedrovirus (AcNPV) late expression factor
(lef-7) stimulates viral DNA replication in transient assays (Lu and Miller, 1995) and in
AcNPV-infected insect cell lines (Chen and Thiem, 1997). LEF-7 has a sequence with
21% identity over 227 amino acids of the herpes simplex virus UL29 (ICP8) gene
product, which binds preferentially to single-stranded DNA (ssDN A) with no sequence
specificity (Knipe et al., 1982; Conley et al., 1981). A ssDNA binding protein (SSB)
motif conserved in prokaryotic and eukaryotic organisms repeats twice within LEF—7,
suggesting a possible SSB function for LEF-7 (Lu and Miller, 1995). However,
noticeable differences were found comparing LEF-7 to UL29. First, UL29 is an
essential gene for viral DNA synthesis (Lee and Knipe, 1983; Weller et al., 1983)
while LEF-7 stimulates DNA synthesis. Second, the sequence of UL29 gene predicts a
protein of 1196 amino acid residues (Quinn and McGeoch, 1985), while lef-7 encodes
a 226 residues product.

Among 18 AcNPV late expression factors identified, six of them, ie-I, lef-I,
lef-Z, lef-3, p143, and p35, are essential for plasmid DNA replication (Lu and Miller,
1995; Kool et al., 1994), while ie-2, lef- 7, and dnapol stimulate plasmid DNA
replication (Lu and Miller, 1995). A viral encoded SSB was purified using ssDNA
agarose chromatography from AcNPV-infected Spodoptera frugiperda cells and was
strongly suggested to be the product of lef-3 (Hang et al., 1995). However the ability
of LEF-3 binding to ssDNA was not directed demonstrated in the same study. In this
study, we investigate the potential SSB ability of LEF-7 by using the ssDNA agarose
chromatography.

A fragment containing 90% of lef-7 was cloned into pMAL-c2 vector, resulting
in the expression of MBP-LEF-7 fusion in transformed E coli XL-l Blue strain
(Bullock et al, 1987). The fusion protein was purified by amylose resin affinity column

chromatography (New England BioLabs, Beverly, MA). ssDNA agarose (GIBCO

 

78

BRL, Gaithersburg, MD) was packed into a 1 ml syringe to 0.5 ml in volume, and
equilibrated with 5 ml buffer A (20 mM HEPES (pH 7.5), 5 mM KCl, 1.5 mM
MgC12, 1.0 mM dithiothreitol, 10% glycerol, 0.1 M N aCl and 10 mM EDTA). The
eluted MBP-LEF-7 fusion protein, pre-adjusted to the same conditions as buffer A,
was passed through the ssDNA agrose column. The column was washed with 5 ml of
buffer A and then eluted incrementally with 0.3 ml of buffer A containing 0.2 M to 1.0
M NaCl in 0.2 M increments. Eluted proteins from each fraction were analyzed by
sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by
Coomassie blue staining (Figure 4.1). A 64 kD protein corresponding to the size of
MBP-LEF—7 fusion protein was primarily presented in the flow-through fraction or in
the fractions containing 0.2 M NaCl. N o detectable protein was eluted with buffer
containing more than 0.4 M NaCl, suggesting that MBP-LEF-7 did not bind to ssDNA
with high affinity. Because LEF-7 comprised only 37% of the MBP-LEF-7, it was
possible that the fusion protein did not fold properly to allow LEF-7 to bind to ssDNA
agrose. To address this possibility, factor Xa protease (New England BioLab) was
used to digest MBP-LEF-7 fusion protein at a factor Xa recognition site I-E-G-R within
MBP. The digested products were resolved by SDS-PAGE. The 25 kD fragment
corresponding to the size of LEF-7 was excised and protein was eluted using an
electroelutor. The collected protein was adjusted to the conditions of buffer A and
passed through ssDNA agarose column prepared as previously described. The column
was eluted with buffer A containing various NaCl concentrations, and collected
fractions were subjected to SDS-PAGE. All the protein presented in the flow-through
or the low salt fraction (data not shown). This indicated that LEF-7 did not appear to
bind to ssDNA. These results may reflect that LEF-7 cleaved from the fusion protein
expressed in bacteria either did not fold correctly, or that a post translational
modification was required for its ssDNA binding ability. Alternatively, LEF-7 did not

fold properly after eluted from SDS-PAGE gel so that it lost the ability to bind ssDNA.

79

Size marker

3

0.2 0.4 0.6 0.8 1.0

641(1) _Wm---

44kD —"'i

Figure 4.1 A Coomassie blue stained SDS—PAGE gel of the single—stranded DNA
binding assay using MBP—LEF-7 fusion protein. Fractions are indicated above as FT,
flow—through, or numbers indicating NaCl concentrations (M). An arrow indicates a 64

kD protein corresponding to the size of MBP—LEF—7 (lanes 1 and 2). Size markers were

indicated in kilo—dalton (kD).

80

It is also possible that the 10% of N -terminal was essential for LEF-7 to bind ssDNA.
To address the possibility that the bacterially expressed LEF-7 might not be
functional, a nuclear extract was used in binding assays. Nuclear extract was prepared
from AcNPV-infected Spodopterafrugiperda cells SF—21 (1 x 108 cells) according to
the method described in Hang et al. (1995). The extract was passed through a ssDNA
agrose column, and then eluted as previously described. Proteins from each fraction
were resolved by SDS-PAGE (Figure 4.2A) and transferred to Hybond-ECL
nitrocellulose membranes (T owbin et al., 1979) . The membrane was incubated with
anti-LEF-7 polyclonal antibody (Chen and Thiem, 1997) at a 1210,000 dilution and
then with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody
(Sigma) at a dilution of 1:10,000. The ECL Western blot detection system (Amersham
Life Science) was used for signal detection. A protein with an approximate size of 60
kD was detected from all the fractions, which may represent a cellular SSB (Figure
4.2B). No protein with a size (25 kD) corresponding to LEF-7 was detected in the
fraction containing salt (Figure 4.2B, lanes 2-6), suggesting LEF-7 was not a SSB. A
25 kD fragment which was detected in the flow-through fraction may represent LEF-7

(Figure 4.2 B, lane 1, asterisk).

Nitrocellulose filter binding assay

lef-7 stimulates viral replication in infected-insect cell lines (Chen and Thiem,
1997) and in the plasmid replication assay (Lu and Miller, 1995). Homologous regions
(hrs) were known to function of replication origins (Cochran and Faulkner, 1983; Kool
et al., 1993; Pearson et al., 1993). In the transient assays, lef-7 was required for
maximum late gene (capsid) expression (Morris et al., 1994; Todd et al., 1995). It is
possible that LEF-7 functions as an activator in viral DNA replication and binds to hrs,

or it may bind to promoters to regulate the late gene transcription.

 

81

Figure 4.2 Single-stranded DNA binding assay using nuclear extract from AcNPV-
infected SF-21 cells. Fractions are indicated above as FT, flow-through, or numbers
indicating NaCl concentrations (M). (A) A Coomassie blue stained SDS-PAGE gel. (B)
Western blot analysis using the antibody against LEF-7. A 25 kD protein with the
corresponding size of LEF-7 is indicated with a asterisk and a 60 kD protein is

indicated with a arrow. Size markers were indicated in kilo-dalton (kD).

82

0.6 0.8 1.0

0.4

0.2

 

1.0

0.8

0.6

0.4

0.2

 

83

In this experiment, LEF-7 was tested for its ability to bind to the AcNPV capsid
promoter (pcap), polyhedrin promoter (ppolh), hr2, and hr5. pCAPCAT (Thiem and
Miller, 1989) was digested with Bng and EcoRV, or HindIII and BamHI, andresulted
0.46 kb and 0.24 kb fragments containing pcap and hr5, respectively. pSynXIV VI+
(Wang et al., 1991) was digested with NaeI and EcoRV, and resulted a 0.49 kb
fragment containing ppolh. The AcNPV PstI J fragment was cloned into pBluescript
and then digested with HindIII, and resulted a 2.6 kb fragment containing hr2.
Digested fragments were end-labelled with 32P yATP by T4 kinase. LEF-7 obtained
from bacterium expressed MBP-LEF-7, or MBP-LEF-7 cleaved with factor Xa
protease were incubated with labelled DNA fragments. Binding reactions were
performed with a method adapted from Hennighausen and Fleckenstein (1986). In each
reaction, approximately 1 pg of protein was used. After incubation the reaction mixture
was filtered through a nitrocellulose filter (0.45 urn, Millipore HA) and DNA was
extracted from the filter (Hennighausen and Fleckenstein, 1986). No signals were
detected from either MBP-LEF-7 (Figure 4.3 , lanes 2, 5, 8, and 11) or LEF-7 non-
fusion (Figure 4.3, lanes 3, 6, 9, and 12) binding to the late gene promoters (Figure
4.3, lanes 2, 3, 11, and 12) or hr (Figure 4.3, lanes 5, 6, 8, and 9). The results
suggested that LEF-7 itself did not bind to pcap, ppolh, hr2, or hr5. Several fragments
resulted from the incubation with MBP-LEF-7 were presented in lane 2, 5, and 8
(arrows). However none of these fragments contained predicted LEF-7 binding
sequence (asterisks). These signals may be the results of non-specific binding to MBP-

LEF-7.

Immunoprecipitation
To identify any possible protein complex forming with LEF-7,
immunoprecipitation using a polyclonal antibody against LEF-7 (Chen and Thiem,

1997) was conducted. 1x107 SF-21 cells were infected with AcNPV or vlef7-AG, a

 

84

Figure 4.3 Nitrocellulose filter binding assays. Restriction fragments from pCAPCAT
(lane 1 and 4), ppstI-J (lane 7) and pSynXIV VI+ (lane 10) were incubated with either
MBP-LEF-7 or LEF-7 non-fusion. Fragments containing the potential binding
sequences, capsid promoter (lane 1), hr5 (lane 4), hr2 (lane 7), and polyhedrin
promoter (lane 10), are indicated by asterisks. Lanes (2, 5, 8, and 11) or lanes (3, 6, 9,
and 12) are the results from restriction fragments incubated with MBP-LEF-7 or LEF-7

non-fusion, respectively. Size markers are given in kilo-base (kb).

85

pcap hr5 hr2 ppolh
kb I | I I I fl I I

 

23.0—
9.6 —
4.4—

2.3 _
2.0 —

0.56— * w.

 

123456789101112

84

Figure 4.3 Nitrocellulose filter binding assays. Restriction fragments from pCAPCAT
(lane 1 and 4), ppstI-J (lane 7) and pSynXIV VI+ (lane 10) were incubated with either
MBP-LEF-7 or LEF-7 non-fusion. Fragments containing the potential binding
sequences, capsid promoter (lane 1), hr5 (lane 4), hr2 (lane 7), and polyhedrin
promoter (lane 10), are indicated by asterisks. Lanes (2, 5, 8, and 11) or lanes (3, 6, 9,
and 12) are the results from restriction fragments incubated with MBP-LEF-7 or LEF-7

non-fusion, respectively. Size markers are given in kilo-base (kb).

85

 

kb WII II II I

23.0 —
9.6 _
4.4 —

2.3 _
2.0 _

0.56— * .1...

*H

 

123456789101112

86

AcNPV lef-7 deletion mutant (Chen and Thiem, 1997) at an MOI of 10 using standard
methods (O’Reilly et al., 1992). Infected cells were labelled with 35S-methionine from
24-27 h post infection. Labelled cells were collected and suspended in 1 ml lysis buffer
(150 mM N aCl, 1.0% NP-40, 50 mM Tris (pH 8.0) containing protease inhibitors
(100ug/ml PMSF; lug/ml Pepstatin; 0.5 jig/ml Leupeptin; (Boehringer Mannheim».
After 30 min incubation on ice cell suspension was spun at 10,000g for 10 min, and
cell lysate was removed to a fresh tube. To reduce the non-specific binding, the cell
lysate was pre-absorbed with pre-immune serum (Harlow and Lane, 1988).

Pre-immune serum (Figure 4.4 lanes 1-3) or polyclonal antibody against LEF-7
(Figure 4.4, lanes 4-6) was added to cell lysates collected from mock (Figure 4.4, lanes
1 and 4), AcNPV-infected (Figure 4.4 lanes 2 and 5), or vlef7-AG— (Figure 4.4, lanes
3 and 6) infected TN368 cells, and incubated at 4°C over night. The immune complexes
were collected on fixed S. aureus Cowan I (SAC) (Sigma) by a method (Harlow and
Lane, 1988) adapted from Kessler (1975, 1981). SAC was prepared and pre-washed
as described in Firestone and Winguth (1990). Immune complexes were resolved on by
SDS-PAGE. The gel was dried and exposed to x-ray film. No protein was precipitated
by either pre-immune serum or LEF-7 antibody from mock infection (Figure 4.4.,
lanes 1 and 4). Some signals were detected in AcNPV or vlef7-AG infection (Figure
4.4, lanes 2, 3, 5, and 6). Although some signals were unique in AcNPV infected cell
lysate in comparison to vlef7-AG infected lysate, these signals were also present in
lysate treated with pre-immune serum, suggesting these were not complexes forming
with LEF-7.

The results in this study did not support the hypothesis that LEF—7 functions as
a SSB, or that LEF-7 binds to late gene promoters or hr sequences. No conclusive
evidence was obtained showing that LEF-7 formed protein complexes under the
experimental conditions used. It is possible that LEF-7 does have the ability to bind to

DNA or form complexes with other factors in cells. Other approaches will be needed to

Pre-immune Ab or LEF-7
s E s s E ii
kDa E :2 L; 2 2 i;
67 -
44 —
25 - 4“. in 4.5:. Aug
1 2 3 4 5 6

Figure 4.4 Immunoprecipitation assay. Immunocomplexes from mock (lane 1 and 3),
AcNPV (lane 2 and 4), or vlef7-AG infected TN368 cell lysates incubated with

preimmune serum (lanes 1—3) or antibody against LEF-7 (lanes 4-6).

88

determine the role of LEF-7 in stimulating DNA replication. For example, the yeast

hybrid system can be use to study the interaction of LEF-7 with other proteins.

89

References

Bullock, W. 0., J. M. Fernandez, and J. M. Short. (1987). XLl-Blue: A
high efficiency plasmid transforming recA Escherichia coli strain with beta-
galactosidase selection. Biotechniques 4: 376-379.

Chen, C.-J. and S. M. Thiem. (1997). Differential infectivity of two Autographa
califomica nucleopolyhedrovirus mutants on three permissive cell lines is the result of
lef-7 deletion. Virology 227: 88-95.

Cochran, M. A., and P. Faulkner. (1983). Location of homologous DNA
sequences interspersed at five regions in the baculovirus Autographa califomica
nuclear polyhedrosis virus genome. J. Virol. 45: 961-970.

Conley, A. J ., D. M. Knipe, P. C. Jones, and B. Roizman. (1981).
Molecular genetics of herpes simplex virus. VII. Characterization of a temperature
sensitive mutant produced by in vitro mutagenesis and defective in DNA synthesis
and accumulation of y polypeptides. J. Virol. 37: 191.

Firestone, G. L., and S. D. Winguth. (1990). Immunoprecipitation of proteins.
Methods Enzymol. 182: 688-700.

Hang, X., W. Dong, and L. A. Guarino. (1995). The lef—3 gene of Autographa
califomica nuclear polyhedrosis virus encodes a single-stranded DNA binding
protein. J. Virol. 69: 3924-3928.

Harlow, E., and D. Lane. 1988. Antibodies, a laboratory manual. Cold Spring
Harbor. Cold Spring Harbor, New York.

Hennighausen, L., and B. Fleckenstein. (1986). Nuclear factor 1 interacts with
five DNA elements in the promoter region of the human cytomegalovirus major
immediate early gene. EMBO J. 5: 1367-1371.

Kessler, S. E. (1981). Use of protein A-bearing staphylococci for the
immunoprecipitation and isolation of antigens from cells. Methods Enzymol. 73:
442-458.

kessler, S. W. (1975). Rapid isolation of antigens from cells with a staphylococcal
protein A-antibody adsorbent: Parameters of the interaction of antibody-antigen
complexes with protein A. J. Immunol. 115: 1617-1623.

Knipe, D. M., M. P. Quinlan, and A. E. Spang. ( 1982). Characterization of
two conformational forms of the major DNA-binding protein encoded by herpes
simplex virus 1. J. Virol. 44: 736.

K00], M., C. H. Ahrens, R. W. Goldbach, G. F. Rohrmann, and J. M.
Vlak. (1994). Identification of genes involved in DNA replication of the Autographa
califomica baculovirus. Proc. Natl. Acad. Sci. (USA) 91: 11212-11216.

90

Lee, C. K., and D. M. Knipe. (1983). Therrnolabile in vivo DNA binding
activity associated with a protein encoded by mutants of herpes simplex virus type 1.
J. Virol. 46: 909-914.

Lu, A., and L. K. Miller. (1995). The roles of eighteen baculovirus late
expression factor genes in transcription and DNA replication. J. Virol. 69: 975-982.

Morris, T. D., J. W. Todd, B. Fisher, and L. K. Miller. (1994).
Identification of lef-7 — a baculovirus gene affecting late gene expression. Virology
200: 360—369.

O’Reilly, D. R., L. K. Miller, and V. A. Luckow. (1992). "Baculovirus
Expression Vectors. A Laboratory Manual". W. H. Freeman, New York.

Pearson, M. N ., R. M. Bjornson, C. Ahrens, and G. Rohrmann. (1993).
Identification and characterization of a putative origin of DNA replication in the
genome of a baculovirus pathogenic for Orgyia pseudotsugata. Virology 197: 715-
725.

Quinn, J. P., and D. J. McGeoch. (1985). DNA sequence of the region of the
genome of herpes simplex virus type 1 containing the genes of DNA polymerase and
the major DNA-binding protein. Nucleic Acids Res. 13: 814—820.

Thiem, S. M., and L. K. Miller. (1989). Identification, sequence, and
transcriptional mapping of the major capsid protein gene of the baculovirus
Autographa califomica nuclear polyhedrosis virus. J. Virol. 63: 2008-2018.

Todd, J. W., A. L. Passarelli, and L. K. Miller. (1995). Eighteen
baculovirus genes, including lef—l 1, p35, 39K and p47, support late gene
expression. J. Virol. 69: 968-974.

Towbin, H., T. Staehelin, and J. Gordon. (1979). Electrophoretic transfer of
protein from polyacrylamide gels to nitrocellulose sheets: procedure and some
applications. Proc. Natl. Acad. Sci. (USA) 76: 4350- 4354.

Wang, Y., and J. D. Hall. (1990). Characterization of a major DNA-binding
domain in the herpes simplex virus type I DNA—binding protein. Virology 64: 2082-
2089.

Wang, X., B. G. Ooi, and L. K. Miller. (1991). Baculovirus vectors for
multiple gene expression and for occluded virus production. Gene 100: 131-137.

Weller, S. K., K. J. Lee, D. J. Sabourin, and P. A. Schaffer. (1983).
Genetic analysis of temperature sensitive mutants which define the gene for the major
herpes simplex virus type 1 DNA-binding protein. J. Virol. 45: 354-.

Chapter 5
Autographa califomica nucleopolyhedrovirus (AcNPV) ORF247 is

nonessential for AcNPV infectivity and DNA replication on three

permissive insect cell lines

91

92

Abstract

Previously, we identified two AcNPV mutants with deletions containing pk2,
ORF247, lef-7, and chitinase genes within 77.0 - 80.1 m.u. (Chen, C.-J. and S. M.
Thiem, Virology 227: 88-95, 1997). We demonstrated that the differential infectivity of
these two mutants on SF-21, TN368, and SElc cells is the result of lef-7 deletion
(Chen and Thiem, 1997). To examine the possible functions of ORF247, an AcNPV
recombinant was constructed in which 83% of ORF247 was deleted. Budded virus,
occluded virus production, and viral DNA synthesis of vORF247-AG, were compared
to those of AcNPV in SF-2l, TN368, and SElc cells. No noticeable differences were
observed between cells infected with AcNPV or vORF247-AG, indicating that ORF247
is not required for AcNPV infectivity or DNA replication in those cell lines. Northern
blot analysis demonstrated that ORF247 is transcribed as a late gene in all three insect

cell lines.

93

ORF247 is a non-essential gene for AcNPV infection

Baculoviruses are double stranded DNA viruses that only infect invertebrates.
AcNPV, a well studied baculovirus, hasa 134-kb genome potentially encoding 154
proteins (Ayres et al., 1994). Among these genes, a few, such as p35 (Clem et al.,
1991; Clem and Miller, 1993; Hershberger et al., 1992), hcf-I (Lu and Miller, 1995a;
Lu and Miller, 1996), and lef-7 (Lu and Miller, 1995b ; Chen and Thiem, 1997), that
influence host specificity have been identified. p35, an apoptosis inhibitor is essential
for AcNPV replication in SF—21 cells (Clem et al., 1991; Clem and Miller, 1993;
Hershberger et al., 1992) and Spodopterafrugiperda larvae (Clem and Miller, 1993),
but not in Trichoplusia ni cell line TN368 or T. ni larvae. hcf-I supports optimal
reporter gene expression in TN368 cells, but is not required for expression in SF-21
cells (Lu and Miller, 1995b). lef-7 is not essential for AcNPV infection in TN368 cells,
but is needed for optimal infection in SE2] and SElc (S. exigua) cells (Chen and
Thiem, 1997). Homologous recombination between the AcNPV genome and a 572 bp
DNA fragment from the putative DNA helicase gene (p143) of Bombyx mori
NPVresulted in a recombinant virus that infects both S. frugiperda and B. mori cell
lines (Maeda et al., 1993). A 79 bp region within the 572 bp fragment was identified to
be responsable for the AcNPV host range expansion (Croizier et al., 1994). Besides
p35, p143 and lef-7, ie-2 is required for optimal virus origin-specific plasmid DNA
replication or stability in SF-21 cells, but it has little influence in TN368 cells (Lu and
Miller, 1995b). Another host-ragen gene, hrf-I , which was isolated from Lymantria
dispar NPV (LdNPV), is capable of expanding the AcNPV host range to the
nonpermissive cell line Ld652Y (Thiem et al., 1996) and insect host L. dispar (Chapter
6).

As a means for identifying AcNPV genes that determine its host range, we
screened chemically mutagenized AcNPV, and isolated two mutants, T295 and T297,

that had reduced infectivity on SF—21 and SElc cells but not on TN368 (Chen and

94

Thiem, 1997). These two mutants had 3.2-kb (77.0 - 79.4 m. u.) and 4.4-kb (76.7 -
80.1 m. u.) deletions, respectively, which deleted the pk2, ORF247, lef-7, and
chitinase genes. The phenotypes of these two mutants could be attributed to the
deletion of lef-7 (Chen and Thiem, 1997). In this study, we demonstrated that the
deletion of ORF247 does not affect AcNPV in vitro infectivity or viral DNA

replication, yet it is transcribed as a late gene in all three cell lines.

AcNPV ORF247 is 744 nucleotides (nt) (Ayres et al., 1994), corresponding to
a predicted protein of 247 amino acids with a molecular weight of 28.5 kDa. A
comparison of the nucleotide sequence and predicted polypeptide with those in
databases revealed no obvious homology to any other sequences. To examine the effect
of ORF247 on AcNPV infectivity, we disrupted ORF247. AcNPV PstI-L containing
ORF247 was cloned into pBluescript KS+ (Stratagene, La J olla, CA) to generate
pPstI-L. A 2.7 Kb reporter gene (actin-GUS) bearing Escherichia coli B-glucuronidase
(GUS) under the control of B. mori actin promoter that is constitutively expressed in
insect cells (Johnson et al., 1992; Chen and Thiem, 1997) was inserted into pPstI-L at
Bst1107I and SpeI sites (Figure 5.1). The resulting plasmid pORF247-AG was
cotransfected with AcNPV DNA in to SF-21 cell to generate a recombinant virus
vORF247-AG using standard methods (O’Reilly et al., 1992). We confirmed the
disruption of ORF247 by its restriction patterns and Southern blot analysis (data not
shown). Virus production was evaluated through the infection course in SF-21,
TN368, and SElc cells infected with AcNPV or vORF247-AG at an MOI of 10. BV
and CV production in cells infected with vORF247-AG were indistinguishable from
those infected with wt AcNPV (Figure 5.2A and 2B), suggesting that ORF247 deletion
does not influence the AcNPV infectivity for these three cell lines.

Because mutants T295 and T297 are defected in viral DNA replication (Chen
and Thiem, 1997), we compared viral DNA synthesis in SF—21, TN368 and SElc cells

95

Figure 5.1 An expanded map shows the distribution of major ORFs between PstI sites
at 76.3 and 78.4 m.u. AcNPV PstI-L was cloned into pBluescript KS+ and a Pqu-
XbaI fragment containing the actin-GUS cassette was inserted at Bstl 1071 and SpeI
sites . Resulted plasimid pORF247-AG was cotransfected with AcNPV DNA and
resulted in a recombinant virus, vORF247-AG with 83% ORF247 deleted (dash line).
Solid arrow indicates the riboprobe used in Northern blot analysisRestriction sites

used in cloning and generating ORF247 specific probe are indicated.

 

fink :>
ll 80 A range ___l_.q

 

96

 

 

t.
3.2% I
E 3 -_

766w. 2mm Team. KS 2mm
Ill"

@4364
r is V V we V

 

 

 

 

 

97

Figure 5.2. (a) Budded virus production and (b) percentage of cells with OV in cells
infected with AcNPV or vORF247-AG. Open markers represent the results of AcNPV
infected cells, and solid markers represent the results of vORF247-AG infected cells.

Cell lines used are as indicated.

Log OV/mml

% cells with OV

 

 

100—

75—

25—

 

 

 

 

HI
12 24 36

Hours post infection

wt AcNPV
vORF247-AG

wt AcNPV
vORF247-AG

wt AcNPV
vORF247-AG

99

infected with vORF247-AG to those infected with AcNPV. DNA was prepared by NaI
treatment (Bresser and Gillespie, 1983) with modification described elsewhere (Chen
and Thiem, 1997). DNA synthesis was evaluated from 0 h to 48 h p.i. by dot blot
analysis using nick-translated (Sambrook et al., 1989) AcNPV genomic DNA labelled
with 32P-dCTP as a probe. Hybridization was carried out in the hybridization solution
containing 50% formamide at 42°C (Sambrook et al., 1989). The blot was visualized
by autoradiography and the bound probe was quantitated with a phosphorimager
(Molecular Dynamics, Sunnyvale, CA.). Viral DNA synthesis was identical in cells
infected with either vORF247-AG or AcNPV in SF-2l, TN 368, or SElc (Figure 5.3),
indicating that ORF247 did not contribute to the reduction in viral DNA synthesis

observed in T295- and T297- infected cells.

Since deletion of ORF247 does not affect AcNPV infectivity in any of cell lines
tested, it may not be transcribed. We examined if ORF247 was transcribed in all three
cell lines using ORF247 specific probes. To generate ORF247 specific probe, pPst-L
was digested with Spel and re-ligated. The resulting plasmids were linearized at
Bst1107lsite (Figure 5.1), and transcribed in the presence of 32P—CTP with T7 RNA
polymerase (Promega, Madison, WI). SF-2l, TN368, and SElc cellswere infected
with AcNPV at an MOI of 10 and were harvested at 6, 12, 18, 24, 36, and 48 h p.i.
Cycloheximide- or aphidicolin-treated cells were also infected with AcNPV and
harvested at 12 h p.i. Total RNA, isolated by the guanidinium isothiocyanate method
(Chomzynski and Sacchi, 1987), was separated by electrophoresis on a 1.2%
formaldehyde agarose gel, and transferred to Zeta-probe nylon membrane. The blots
were hybridized to ORF247 specific riboprobe in 50% formamide hybridization buffer
at 55°C (Promega). Two transcripts with estimated sizes of 0.76 kb and 0.67 kb
hybridized to the probe (Figure 5.4). The 0.7 6 kb transcript, corresponding to the
length of ORF247, was detected from 12 h p.i. to 48 h p.i. in SF—21, TN368, and

 

100

Figure 5.3. Viral DNA synthesis. (A) A dot blot of total DNA isolated at various times
p.i. from SF-21, TN 368, and SE-lc cells infected with wt AcNPV or vORF247-AG
were probed with 32P—labelled wt AcNPV DNA. (B) A graph represents the data from
phosphorimager readings of the dot blot. Counts are indicated in cpm. Known amounts

of AcNPV DNA as indicated were used as standards.

101

05$

wmmzem

$.an

wv

_
94-385 ill.
>a20< IIDII

O<A¢NHEO iLsIII
>n_Zu< i411

94-5.35 IIOII
>a20< Iloi

mm VN N— o

930

\u . m 95.,

 

in
VNC] AdNov
DV-AdeHOA
AdNOV

[
[

3mm

DV‘ZVdeOA
/\dN3V

momZH

 

mi .
30 O .OOOQOE

DV'AVZjHOA
AdNQV

[

mem

102

Figure 5.4. Northern blot analysis of ORF247. Transcripts were prepared from
AcNPV infected SF-21, TN368, and SElc cells. Two major transcripts, with
approximate sizes of 0.77 kb and 0.67 kb (arrows) were observed. Lane A contains
RNAs isolated from aphidicolin—treated cells at 12 h p.i. while lane C contains RNAs
from cycloheximide-treated cells at 12 h p.i. Ribosomal RNA, cross-hybridized to the
probe, were detected in either mock-infected or viral-infected cells. Probe used is

indicated in Figure 5.1. Size markers are given in kilobases at the left.

103

_2 .w¢ mm VN wF UNF<NP N— m 2 34 mm ¢N mp UNF<NF N— m

o Em wmmZP

  

.2 w¢ mm ¢N wF UNF<NF N—

Fmiw

mm._.

BmN

0.1.
$1.
med
m 38
beta—2

104

SElc cells. This transcript was not present in the cells treated with either aphidicolin or
cycloheximide, indicating it is a late transcript. A potential initiation site TAAG, a
characteristic sequence of baculovirus late gene initiation site, was found 8 nt upstream
of the putative start code (Ayres et al., 1994). No polyadenylation signal (AAUAAA)
was found immediate downstream of the potential stop codon. The 0.67 kb transcript,
detected predominately at 12 h p.i. in SF-21, SElc cells, and TN368-treated with
cycloheximide. Because no smaller ORFs were found within or overlapping ORF247,
it might be a cellular transcript that cross—hybridized to the probe. Alternatively, it may
be the degraded 0.76 kb transcript. Although ORF247 was transcribed, it remains to be

determine if it is translated.

AcNPV has a 134 kb DNA genome which potentially encodes 154 proteins
(Ayres et al., 1994). It is possible that some of these genes had been functionally
substituted by others, subsequently these genes became evolutionary vestiges. For
example, although pk2 is translated, pk2 disruption has no phenotypic effects, such as
infectivity or virulence, on AcNPV (Li and Miller, 1995). Disruption of ORF247 has
no noticeable effects on AcNPV infectivity or DNA replication in the cell lines tested,
suggesting that ORF247 either plays an insignificant role in AcNPV infection, or it has
a redundant function. Another possibility is that ORF247 is only required for the
infection in other cell lines that have not been tested, or it may be required for AcNPV

to infect insect larvae.

105

References

Ayres, M. D., S. C. Howard, J. Kuzio, M. Lopezferber, and R. D.
Possee. (1994). The complete DNA sequence of Autographa califomica nuclear
polyhedrosis virus. Virology 202: 586-605.

Bresser, J. and D. Gillespie (1983) Quantitative binding of covalently closed
circular DNA to nitrocellulose in NaI. Anal. Biochem. 129: 357-364.

Chen, C.-J. and S. M. Thiem. (1997). Differential infectivity of two Autographa
califomica nucleopolyhedrovirus mutants on three permissive cell lines is the result of
lef-7 deletion. Virology 227: 88-95.

Chomczynski, P., and N. Sacchi. (1987). Single-step method of RNA isolation
by acid guanidium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162:
156-159.

Clem, R. J. and L. K. Miller. (1993). Apoptosis reduces both the in vitro
replication and the in vivo infectivity of a baculovirus. J. Virol. 67 : 3730-3738.

Clem, R. J., M. F echheimer, and L. K. Miller. (1991). Prevention of
apoptosis by a baculovirus gene during infection of insect cells. Science 254: 1388-
1390. '

Croizier, G., L. Croizier, Argaud, 0., and Poudevigne, D. (1994).
Extension of Autographa califomica nuclear polyhedrosis virus host range by

interspecific replacement of a short DNA sequence in the p143 helicase gene. Proc
Natl Acad Sci (USA) 91: 48-52.

Hershberger, P. A., J. A. Dickson, and P. D. Friesen. (1992). Site-specific
mutagenesis of the 35-Kilodalton protein gene encoded by Autographa califomica

nuclear polyhedrosis virus - cell line-specific effects on virus replication. J. Virol.
66: 5525-5533.

Johnson, R., R. G. Meidinger, and K. Iatrou. (1992). A cellular Promoter-
Based expression cassette for generating recombinant baculoviruses directing rapid
expression of passenger genes in infected insects. Virology 190: 815-823.

Li, H. and L. K. Miller. (1995). Expression and functional analysis of a
baculovirus gene enconding a truncated protein kinase homolog. Virology 206: 314-
323.

Lu, A. and L. K. Miller. (1995a). Differential requirements for baculovirus late
expression factor genes in two cell lines. J. Virol. 69: 6265-6272.

Lu, A. and L. K. Miller. (1995b). The roles of eighteen baculovirus late
expression factor genes in transcription and DNA replication. J. Virol. 69: 975-982.

Lu, A. and L. K. Miller. (1996). Species-specific effects of the hcf-I gene on
baculovirus virulence. J. Virol. 70: 5123-5130.

 

 

 

106

Maeda, S., S. G. Kamita, and, A. Kondo. (1993). Host range expansion of
Autographa califomica nuclear polyhedrosis virus (NPV) following recombination of
a 0.6-kilobase-pair DNA fragment originating from a Bombyx mori NPV. J. Virol.
67: 6234—6238.

O’Reilly, D. R., L. K. Miller, and V. A. Luckow. (1992).Baculovirus
expression vectors. A laboratory manual. New York: W. H. Freeman and Company.

Sambrook, J., E. F. Fritsch, and T. Maniatis. (1989). in "Molecular
Cloning. A Laboratory Manual", 2nd ed. Cold Spring Harbor Laboratory, New
York.

Thiem, S. M., X. Du, E. M. Quentin, and M. M. Berner. (1996).
Identificaiton of a baculovirus gene that promotes Autographa califomica nuclear
polyhedrosis viruse replicaiton in a nonpermissive insect cell line. J. Virol. 70:
2221-2229.

 

Chapter 6

Lymantria dispar nucleopolyhedrovirus hrf-I expands the larval host

range of Autographa califomica nucleopolyhedrovirus

Contents of this chapter have been submitted to Journal of Virology for publication as:
Chen, C.-J., M. E. Quentin, L. A. Brennan, C. Kukel, and S. M. Thiem
1997. Lymantria dispar nucleopolyhedrovirus hrf-I expands the larval host range of

Autographa califomica nucleopolyhedrovirus.

107

108

Abstract

The gypsy moth (Lymantria dispar) is non-permissive for Autographa califomica
nucleopolyhedrovirus (AcNPV) infection. We previously isolated a gene, host range
factor 1 (hrf-I), from L. dispar nuclear polyhedrosis virus (LdNPV) that promotes
AcNPV replication in Ld652Y cells, a non-permissive L. dispar cell line (S. M. Thiem,
X. Du, M. E. Quentin, and M. M. Bemer, J. Virol. 70:2221-2229, 1996). In this study
we investigated the ability of hrf-I to alter the larval host range of AcNPV. Bioassays
using recombinant AcNPV bearing hrf—I were conducted on insect larvae by oral
infection. AcNPV bearing hrf-I was infectious for neonate L. dispar larvae with a lethal
concentration 50% (LC50) of 1.2x105 occluded viruses (OV)/ml diet, which is similar to
that of wt AcNPV for permissive hosts. In comparison, wt AcNPV was able to kill L.
dispar neonates at high virus concentration (LC50: 2.2x108 OV/ml), although it was
unable to infect all challenged larvae. AcNPV can kill neonate L. dispar larvae at high
doses but it does not kill third instars. However, electron microscopy studies of
AcNPV-inoculated third instar larvae revealed virus replication in the midgut cells. PCR
analyses indicated that the virus was AcNPV. These results suggest that the block to
AcNPV infection of L. dispar larvae is its inability to spread systematically from primary
infection sites in the midgut epithelium, and that this barrier is leaky in neonates. hrf-I
allows AcNPV to overcome this barrier. AcNPV recombinants bearing hrf-I were also
assayed on Helicoverpa zea and Plutella xylostella, resistant species, and Spodoptera
exigua, a permissive species for AcNPV infection. LC5os were significantly reduced for
H. zea. No significant changes in infectivity for AcNPV against P. xylostella or S.
exigua were observed, suggesting that hrf-I functions in only certain insect species or

that the block for AcNPV infection of L. dispar and H. zea larvae may be similar.

 

109

Introduction

Baculoviruses, nucleopolyhedroviruses (NPV) and granuloviruses (GV), are
large double-stranded DNA viruses that infect invertebrates, primarily insects. Because
they do not infect vertebrates or plants, baculoviruses are considered excellent
prospects for development as highly specific insecticides. Although baculoviruses are
registered for use on both agricultural and forest pests, they have several limitations as
insecticides. A major disadvantage of baculoviruses for controlling agricultural pests is
that they kill relatively slowly which may result in considerable crop damage before
infected insects stop feeding. Another problem is that the host range of most
baculoviruses is restricted to a single or a few related species. While limited host
specificity is advantageous from a safety perspective, it is problematic economically
since different baculoviruses will be required to control different pest insects. In recent
years, researchers have reduced the time required for a baculovirus to kill its host by
inserting genes encoding insect specific toxins (Steward et al., 1991; Tomalski and
Miller, 1991), an insect antidiuretic hormone (Maeda, 1989), or a hormone modifying
enzyme, juvenile hormone esterase, (Hammock et al., 1990) into the virus genome, or
by deleting the gene for a virus-encoded hormone modifying enzyme, ecdysteroid
UDP-glucosyl transferase (egt) from the virus (O’Reilly and Miller, 1989, 1991). In
order to modify baculovirus host range to target specific pest species and to insure that
the host specificity of genetically engineered viruses for non-target species is not
altered, it is neccessary to understand the genetic and molecular basis of host
specificity.

Virus host range is a function of the ability of a virus to enter, replicate, and produce
infectious progeny in a host organism. The successful completion of all these stages
results in a productive infection. NPVsproduce two morphological forms that play

different roles in the infection cycle. Occluded viruses (OV), also known as polyhedra

 

 

 

110

or polyhedral inclusion bodies (PIBs), are embedded in a protein matrix that stabilizes
virions in the environment and spreads the virus between insect hosts. Budded viruses
(BV), which are responsible for spreading the virus within an insect host, lack an
external protein matrix. Primary infection is initiated in midgut epithelial cells when OV
are ingested by a susceptible insect. The occlusion matrix dissolves in the alkaline
midgut lumen, releasing enveloped virions which enter midgut epithilial cells by
membrane fusion (Kawanishi et al., 1972; Granados and Lawler, 1981, Horton and
Burrand, 1993). Following virus replication in the midgut epithelial cells, BV spreads
the virus to other tissues (Keddie et al., 1989, Flipsen et al., 1995).

The ability of viruses to efficiently spread from primary infection sites and to replicate
in diverse tissues is essential to initiate a systemic infection. Electron microscopy
studies coupled with titration of virus in insect hemolymph indicated that Autographa
califomica NPV (AcNPV) nucleocapsids budded through the midgut basal lamina into
the hemocoel of Trichoplusia ni larvae within 0.5 h of ingestion (Granados and Lawler,
1981). In contrast, more recent studies employing immunocytochemistry in T. ni
(Keddie et al., 1989) or infection of Spodoptera exigua larvae with AcNPV carrying
reporter genes under different temporal control (Flipsen et al., 1995) showed that
columnar and regenerative cells were the sites of primary infection, and secondary
infections outside of the midgut were initiated only after virus replication in midgut
cells. Studies on the permeability of midgut basal lamina suggest that it may present a
formidable barrier to virus passage. Although the hemolymph protein arylphorin,
which is approximately 10 nm in the smallest dimension, can cross the basal lamina
from the midgut into the hemocoel (Palli and Locke, 1987), colloidal gold particles >15
mm diameter are excluded (Reddy and Locke, 1990). Based on size alone, 35-50 nm in
the smallest dimension (Hughes, 1972; Beaton and Filshie, 1976), baculovirus
nucleocapsids should be effectively excluded, yet they are able to cross the basal lamina

to the hemocoel. In Tni larvae AcNPV circumvents this barrier by spreading from the

111

midgut via the tracheal system which spans the basal lamina (Engelhard et al., 1994).
Virus replication may also be constrained in a tissue specific manner within the insect.
Although reporter genes controlled by early baculovirus promoters were expressed in
most tissues in AcNPV-infected S. exigua larvae, reporter gene activity from very late
promoters was not observed in rrridgut goblet cells, salivary glands, and Malpighian
tubules indicating an aborted infection (Knebel-Morsdorf et al., 1996).

Investigation of NPV infection in cell culture has proved a valuable tool for
identifying genes that influence baculovirus host range. The effects of several genes,
such as p35, p143, and host cell-specific factor 1 (hcf-I) that were initially identified as
influencing baculovirus host specificity in cell culture are generally reflected in the
insect hosts. For example, compared to wild type (wt) AcNPV, mutants lacking the
anti-apoptosis gene p35 do not produce CV and have reduced BV production in SF—21
but not TN368 cells (Clem and Miller, 1993). These mutants also have decreased
infectivity for S. frugiperda but not T. ni larvae when infected per os (Clem et al.,
1994). Recombination between the p143 gene of BmNPV with that of AcNPV resulted
in hybrid AcNPV that could replicate in the Bombyx mori cell line, BmN (Croizier et
al., 1994; Maeda et al., 1993) which does not normally support AcNPV replication. B.
mori larvae that are resistant to AcNPV were also killed by injection of AcNPV bearing
a BmNPV/AcNPV-pl43-hybrid gene (Croizier et al., 1994). AcNPV hcf-I was
required for productive infection in TN368 cells, but not SF-2l cells (Lu and Miller,
1995). The infectivity of AcNPV mutants lacking hcf—I is reduced for T. ni but not S.
frugiperda larvae when BV was injected reflecting the observations in cultured cells,
but was similar to that of wild type AcNPV in T. ni larvae when OV was administered
per os (Lu and Miller, 1996).

Although AcNPV has a relatively broad host range, compared to most
baculoviruses (Groner, 1986) it does not infect the gypsy moth (Lymantria dispar). A

few cell lines derived from L. dispar , such as the embryonic cell lines LdEG and LdEI,

112

support AcNPV replication (Lynn et al., 1988). Others, such as LdFB (Lynn et al.,
1988) and Ld652Y (Goodwin et al., 1978), derived from L. dispar fat body and ovary
respectively, are non—permissive for AcNPV infection, suggesting that AcNPV
replication in L. dispar may be restricted in a tissue specific manner. In AcNPV-infected
Ld652Y cells a cytopathic effect is observed and no progeny viruses are produced
(McClintock et al., 1986). Global arrest of protein synthesis is observed by
approximately 16 h p.i. (Guzo et al., 1992), yet viral DNA is replicated and mRNA
from early, late, and very late genes are transcribed (Guzo et al., 1992; Morris and
Miller, 1992; Morris and Miller, 1993). We previously identified a gene from LdNPV,
L. dispar host range factor 1 (hrf-I) that relieves the block for protein synthesis and
promotes AcNPV replication in Ld652Y cells (Thiem et al., 1996). Recombinant
AcNPV bearing hrf-I replicate normally in Ld652Y cells and produce both BV and 0V
progeny (Du and Thiem, 1997).

In this study, our objective was to determine if hrf-I expanded the host range of
AcNPV for larval insects by oral infection. We performed bioassays on L. dispar
neonates and compared the LC50 of vAchPD, a recombinant virus bearing hrf-I (Du
and Thiem, 1997), to those of AcNPV and LdNPV. We also examined the effect of
hrf—I on the infectivity of AcNPV for Plutella xylostella, Spodoptera exigua, and
Helicoverpa zea. To determine if AcNPV initiates a primary infection in L. dispar

midgut cells, we employed electron microscopy and PCR analysis.

113

Materials and Methods

Virus and insects.

L. dispar eggs were obtained from a colony maintained at the USDA-APHIS,
Otis Methods Development Laboratory, Otis, MA. Trichoplusia ni eggs were obtained
from Forestry Canada Forest Pest Management Institute, Sault Ste. Marie, Ont.,
Canada. L. dispar larvae were reared on high wheat germ diet (ODell et al., 1985) and
T. ni on alfafa and pinto bean diet (Treat and Halflrill, 1973) at 25°C with 14/10 hours
light/dark cycle. LdNPV A21-MNPV isolate (Slavicek et al., 1996) was propagated in
L. dispar larvae. AcNPV variant L1 (Lee and Miller, 1978), and hrf-I bearing AcNPV,
vAchPD (Du and Thiem, 1997) and vAchPS (Thiem et al., 1996), were propagated
in T. ni larvae. Polyhedra were isolated from ground carcasses of infected larvae,
suspended in sterile distilled water, and counted using a Neubauer hemocytometer and
phase-contrast microscopy. The number of polyhedra per ml was based on an average
of eight counts. The polyhedra were stored at 4 °C until use. Polyhedra from AcNPV
variant V8 was prepared in a similar manner and suspended in 0.01% sodium dodecyl

sulfate (SDS).

B i 0 as s a y s .

For bioassays of L. dispar larvae, polyhedra were incorporated into artificial
diet at concentrations ranging from 2x104 to 2X108 OV/ml-diet for AcNPV or
vAchPD and 2x102 to 2x 106 OV/ml-diet for LdNPV. L. dispar neonates (60 insects
per dose) were allowed to feed on the diet containing CV for 48 h, then transferred to
fresh diet. Larvae were maintained as described above and checked daily for mortality.
Experiments were terminated when all larvae infected with highest dose of virus had

died (15 day post infection (p.i.) for AcNPV and vAchPD; 5 days p.i. for LdNPV).

114

Data from two independent experiments were pooled. LCsos were determined by probit
analysis (Finney, 1971) using POLO-PC (LeOra Software, Berkeley, CA.).

Bioassays of H. zea, P. xylostella, and S. exigua, were performed on second
instar larvae. AcNPV (V8), vAchPD, or vAchPS were serially diluted in 0.01%
SDS and virus suspensions (0.4 ml) were applied to 16 cm2 arena containing artificial
Stoneville diet (King and ) (Southland Products Incorporated, Lake Village, AR).
Doses ranging from 1x105 to 1x107 OV/ml were used for bioassays of H. zea , and
1x102 to 1x104 OV/ml were used for S. exigua, and P. xylostella. Larvae were allowed
to feed on the contaminated diet for the duration of the test. Data from three replicates,
each containing 32 larvae per treatment, were collected and analyzed by probit analysis

(Finney, 1971).

Inoculation and dissection of larvae.

To examine AcNPV infection of L.dispar midguts, early third-instar larvae of
uniform size were starved for 12 h and divided into a virus—treated group and a control
group. Inoculation with AcNPV was accomplished by exposing individual larvae to a
surface-contaminated artificial diet plug containing 1.15 x 106 polyhedra. The
procedure was repeated for the control group but using sterile distilled water instead of
the virus. Larvae were observed continuously and only those consuming the whole diet
plug within 20 min were used. Following treatment larvae were transferred to fresh,
uncontaminated diet for rearing. Midguts were removed at 24, 48, and 72 h p.i. for
electron microscopy, and at 6, 12, 24, 48, and 60 h p.i. for DNA isolation. Peritrophic

membranes and enclosed food contents were removed and midgut tissues were rinsed
thoroughly with phosphate-buffered saline (PBS), pH 6.2 (1 mM NazHPO4'7H20,
10.5 mM KH2PO4, 140 mM NaCl).

Electron microscopy.

115

Larval midguts were fixed in 2.5% gluteraldehyde in 0.1 M phosphate buffer
(0.1 M Na2HPO4 7H20 and 0.1 M KH204, pH 7.2) overnight at 4°C, rinsed in
phosphate buffer (pH 7.2) for 15 min (4x), and postfixed in 1% osmium tetroxide (in
0.1M phosphate buffer) for 1 h. The specimens were dehydrated in an ethanol series of
50, 70, 95, and 100% (4x) for 15 min at each step, rinsed in 1:1 100% ethanol: 100%
propylene oxide for 5 min, and 100 % propylene oxide for 5 min (2x). They were
infiltrated in 1:1 propylene oxide: Poly/Bed 812 (51.13 g poly bed, 27.02 g
dodecenylsuccinic anhydride, 21.85 g nadic methylanhydride, Polysciences,
Warrington, PA) for 1-2 h, and in fresh Poly/Bed 812 overnight before embedding in
Poly/Bed 812 containing 2% DMP30 (Polysciences) and polymerizing at 60°C for 3
days. Thick sections of polymerized specimens were processed and mounted on glass
slides for observations under a light microscope. Ultrathin sections were prepared,
mounted on copper grids, stained for 30 min with saturated aqueous uranyl acetate and
5 min with lead citrate, and then examined with a model JOEL 100CX H TEMSCAN

transmission electron microscope.

DNA isolation and PCR amplification.

Carcasses of L. dispar neonates that died from AcNPV infection in bioassays
were collected and stored at -20°C for occluded virus (OV) isolation. DNA was
prepared from OV isolated from AcNPV-infected L. dispar neonates using standard
protocols (O'Reilly et al., 1992). Total DNA was also isolated from AcNPV—inoculated
L. dispar third instar midguts. The collected midguts were minced and centrifuged at 16
kg for 20 minutes. DNA was isolated essentially as described by Meinkoth and Wahl
(1984).

For PCR analysis, the following primers, homologous to 5’ and 3’ ends
respectively of AcNPV polyhedrin, were used:

F (5'-AGAACGCTAAGCGCAAGAAGCA-3') and

116

xR (5'—GGCTTGTAGAAGTTCTCCCA—3'). These primers map to nucleotides 4603-
4625 and 5136-51 17 of the AcNPV genome, respectively (Ayres et al., 1994). Vent
ex0' polymerase (New England BioLab, Beverly, MA) was used with the reaction
buffer provided by manufacturer. Thirty cycles were performed using following
cycling parameters: denaturing at 95°C for 30 sec, annealing at 55°C for 1 min, and
extending at 72°C for 45 sec. For analysis of neonate infection DNA was isolated from
purified OV from 30 pooled carcasses and 1/30 was used as a template for PCR
amplification. For analysis of AcNPV infected-third instar L. dispar, DNA equivalent
to that of 0.5 midgut was used as a template for PCR amplification. One tenth of the

first PCR-amplified products were subjected to secondary PCR amplification.

117

Results

hrf-I promotes AcNPV replication in L. dispar larvae.

LdNPV hrf-I promotes AcNPV infection of a non-permissive L. dispar cell line
(Thiem et al. , 1996). Ld652Y cells infected with vAchPD, a recombinant AcNPV
bearing hrf-I, produce high titers of BV and polyhedra are observed in 100% of the
cells (Du and Thiem, 1997). To determine if hrf—I would enable AcNPV to infect L
dispar larvae by the normal oral route, bioassays were performed on L. dispar neonates
using vAchPD, AcNPV, or LdNPV. L. dispar neonates (60 larvae/virus
concentration) were allowed to feed on artificial diet containing various concentrations
of polyhedra for 48 h, transferred to fresh diet cups, and observed daily for mortality.
Two independent experiments were done for each virus. The data were pooled and
subjected to probit analysis (Table 6.1). Because L. dispar larvae are very resistant to
infection by AcNPV, it was neccesary to incorporate highly concentrated AcNPV OV
into the diet in order to determine an LC50, the concentration of virus required to kill
50% of the larvae. Although L. dispar neonates can be infected with AcNPV, only 57%
(34/60) mortality was achieved with the highest dose (2x108 OV/ml). Consequently the

LC50 for AcNPV-infected larvae could not be determined with greater than 90%

confidence. vAchPD was significantly (1800 fold) more infectious for L. dispar
larvae than AcNPV (Table 6.1). The LC50 for vAchPD for L. dispar larvae was
similar to that of AcNPV infection for permissive hosts, Spodoptera frugiperda
(1.0x106 OV/ml diet) and Trichoplusia ni. (1 .8x105 OV/ml diet) (Lu and Miller, 1996).
However, vAchPD was significantly less infectious than LdNPV (Table 6.1) and
killed L. dispar larvae much slower, 15 days vs 5 days to kill all larvae at the highest
dose of virus (data not shown). These results demonstrated that although hrf-I expands

AcNPV host range to include L. dispar larvae it is less infectious and less virulent than

LdNPV.

118

Table 6.1. Dose response of L. dispar neonates infected per os with AcNPV,

vAchPD, or LdNPV.

 

 

 

Virus LCSO Upper Lower
(OV1/ml) Fiducial limits (CV/ml)2
vAchPD 1.2x105 a ' 2.7x105 3.6x104
AcNPV 2.2X108 b 9.2x108 1.4X108
LdNPV 1.1X104C 3.1X104 3.5X103

 

1 OV, occluded virus.
2 90% confidence interval for AcNPV; 95% for vAchPD and LdNPV.

Significant differences of LC50.are indicated with different letters.

119

Neonates inoculated with vAchPD demonstrated typical symptoms of N PV infection
such as larval melting. Microscopic examination of dead larvae revealed abundant
polyhedra in infected cells and hemolymph. To confirm that mortality was due to
vAchPD infection, DNA was isolated from polyhedra collected from vAchPD-
infected larvae and compared with DNA isolated from AcNPV, LdNPV, and vAchPD
by restriction analysis (Figure 6.1). DNA isolated from larvae and vAchPD had
identical PstI restriction patterns including a diagnostic 3 kbp PstI fragment for
vAchPD that is not present in AcNPV (Figure 6.1, arrow). In contrast to those
infected with vAchPD, dying larvae infected with AcNPV did not liquify, but had a
shriveled appearance and few polyhedra were observed in microscopic examination of
dead larvae. Because of the atypical symptoms, we were concerned that the death
observed for AcNPV-infected larvae may not have been due to AcNPV infection. One
possibility is that feeding large doses of AcNPV may have induced a latent virus. A
latent NPV in a laboratory colony of Mamestra brassicae was activated when larvae
were challenged with other viruses (Hughes et al., 1993). Alternatively, if AcNPV has
restricted tissue tropism in L. dispar larvae, the larvae may have been killed by
extensive AcNPV replication in some tissues but remained intact due to a
preponderance of uninfected tissues.

To address these possibilities we used a PCR approach. Because the polyhedrin
(polh) gene is highly conserved and its sequence known for a large number of NPVs,
we designed primer pairs that would be able to amplify polh sequences from divergent
N PVs. The primers were homologous to AcNPV sequence and corresponded to
conserved regions from known polh sequences (Figure 6.2). They were used
successfully to amplify polh sequences from AcNPV, S. exigua NPV, and LdNPV
which is the most divergent of the known polh sequences (Zanatto et al., 1993, Cowen
et al., 1994) (Figure 6.3). A 0.53 kbp DNA was amplified from AcNPV DNA (Figure
6.3, lane 1) and from DNA isolated from purified polyhedra from AcNPV-infected L.

 

120

Figure 6.1 Comparisons of PstI restriction patterns of AcNPV (lane 1), vAchPD (lane
2), DNA isolated from OV from mortibund vAchPD-inoculated L. dispar larvae (lane
3), and LdNPV (lane 4). A 3.0 kbp fragment unique to vAchPD is indicated by an

arrowhead. Size markers are given in kbp.

121

>QZU4

mats :5: >0

Ombmo<>

>mzo<

Exam:

 

 

 

120

Figure 6.1 Comparisons of PstI restriction patterns of AcNPV (lane 1), vAchPD (lane
2), DNA isolated from OV from mortibund vAchPD-inoculated L. dispar larvae (lane
3), and LdNPV (lane 4). A 3.0 kbp fragment unique to vAchPD is indicated by an

arrowhead. Size markers are given in kbp.

121

>QZU4

$32 :5: >0

Ombqo<>

>mZo<

$me

 

 

122

Figure 6.2. Sequence comparisons of various baculovirus polyhedrin gene sequences
in the region used for PCR primers and restriction analysis. Primer pairs are based on
AcNPV sequence. Locations of diagnositic HindIII and Baml-II sites and sizes of
predicted PCR product and restriction fragments are indicated. (For polh sequence

references see Zanatto et al, 1993, Cowan et al., 1994).

123

>mzuq
>m2um
>mzum
>mzwm
>m2um
>mznz
>mzao
>mzm¢
>mzsm
>mzo<

>mzo4

O .0 O O
O O O 0
O O I O

.00...

N umeflum

0

§

OO¢OOOOO

OOOOOOOOOOOOOOOOOOOO

00044049088044040608

.U...... 0.....

...4..
O.....
0.....
O..4..
U.....
U.....
4.8...
BBUU44

.00.

..o.
..o.
..u.
..u.

.4
.4
.4
.4
.4
.4
.4

008400

HHHUQHE Hmfimm

an 444
Y

 

iii

an 4mm
an 4mm

@

004.000.00.00

.00.
00..

OBO¢OOUO
00000.0.
OOOGOOUO

O... 000000 0....
OfiOO¢O

O 0

00000.40
OOOOOU.
0.00.0.

.0004...
OBOO¢OOB
08......

0d...
.m...
.m...
0.009

OOOOOOUOOOOOmOO.
00440440000448000440440

H Hmeflum

%

 

IYIIIIII
an om

1‘
an omfi

Y

'1

 

124

Figure 6.3. PCR products amplified using primer pairs specific to AcNPV polyhedrin
gene. AcNPV DNA (lane 1), DNA isolated from OV from mortibund AcNPV-
inoculated L. dispar larvae (lane 2), LdNPV DNA (Lane 3), and SeNPV DNA (lane 4).
The amplified products from lane 1 to 4 were digested with Hind 1]] (lane 5 to 8,
respectively). Predicted amplification and digestion products are indicated by arrows to

the right of the panel. Size markers are given in kbp.

125

D.
b
4
3
5

>m220m

>m2204

HMdm

$22 :5: >0

>mzzo<

>m220m

>QZEUJ

323 :5: >0

>mZEo<

44—
2.4—-
056

+354 bp

+180bp

 

126

dispar larvae (Figure 6.3, lane 2). All amplified products could be digested with
HindIII, resulting in two fragments with sizes 354 bp and 180 bp (Figure 6.3, lane 5
and 6) and with BamHI, resulting in 90 and 444 bp fragments (Data not shown) which
are diagnostic for AcNPV (Figure 6.2). In contrast the amplified products from LdNPV
and SeNPV DNA were not digested (Figure 6.3, lanes 7 and 8). To rule out the
possibility of vAchPD cross-contarnination, a primer pair specific to vAchPD (Du
and Thiem, 1997) was used for PCR analysis of the DNA samples. No products were
amplified from DNA isolated from AcNPV or from OV collected from infected larvae

(data not shown).

AcNPV replicates in third instar L. dispar midguts.

Second and third instar L. dispar larvae were susceptible to vAchPD but not to
AcNPV infection. Third instar L. dispar larvae that ingested 1.15x106 AcNPV
polyhedra sucessfully completed their lifecycles (data not shown). To determine if
AcNPV entered or replicated in the midgut epithelium, midgut tissue from AcNPV-
inoculated third instar L. dispar were examined by transmission electron microscopy.
Third instar L. dispar larvae were fed AcNPV on diet plugs and maintained on artificial
diet at 25°C until examination or pupation. At different times post inoculation, midguts
were harvested and prepared for microscopy. Replicating virus was observed in the
midgut epithelial cells of AcNPV-infected L. dispar . Virogenic stroma surrounded by
nucleocapsids and empty capsid sheaths were observed in cell nuclei (Figure 6.4A) and
nucleocapsids were seen budding through the nuclear membrane into the cytoplasm
(Figure 6.4B).

To exclude the possibility that the observed virus replication was due to the
activation of latent virus, it was necessary to verify the presence of AcNPV. Because
we were unable to detect AcNPV by dot blot analysis, we employed a more sensitive

PCR analysis using the polh primers previously described. DNA was prepared from

 

127

Figure 6.4. Electron micrographs of AcNPV-infected third instar L. dispar larvae
midgut cells at 48 hr p.i. (A) Nucleocapsids assembling around virogenic stroma in cell
nucleus (19,000x). Bar represents 0.76 um. (B) A nucleocapsid budding through the
nuclear membrane (36,000x). Bar represents 0.4 mm. C, cytoplasm; CS, capsid sheath;
NE, nuclear envelope; NC, nucleocapsid; NM, nuclear membrane; Nu, nucleus; VS,

virogenic stroma.

128

 

129

midgut tissues collected at 6, 12, 24, 48, and 60 h p.i. from AcNPV-inoculated third
instar L. dispar larvae. To minimize the possiblity of AcNPV contamination from the
gut lumen, peritrophic membranes containing gut contents were carefully removed and
the tissues were extensively washed in PBS prior to DNA isolation. Two rounds of
PCR were conducted. A 534 bp amplification product was obtained using DNA
isolated from AcNPV-infected midgut tissues (Figure 6.5A, lanes 1-5) or AcNPV DNA
(Figure 6.5A, lane 6). No products were amplified from DNA isolated from mock
infected larval midgut tissue (Figure 6.5A, lane 7). Fragments with sizes of 354 bp and
180 bp were observed following HindIII digestion of PCR products from AcNPV and
AcNPV-infected midguts, confirming the presence of AcNPV (Figure 6.5B). While
these analyses can not rule out the presence of a baculovirus that is lacking polh
sequences or one that has a more divergent polh sequence than the currently known
sequences, taken together with the PCR analysis of DNA from PIBs isolated from
AcNPV-infected neonates they strongly suggest that AcNPV replicates in the midgut

epithelia of L. dispar larvae.

hrf-I increase AcNPV infectivity for H. zea.

To determine if hrf-I increased AcNPV infectivity for other species, bioassays
were conducted on two resistant species, H. zea and P. xylostella, and one susceptible
species, S. exigua. AcNPV, vAchPD, and vAchPS, an AcNPV recombinant
containing hif—I and fusolin (Thiem et al., 1996, Du and Thiem, 1997) were assayed
on second instar larvae. Larvae were allowed to feed on insect diet that was surface
contaminated with different amounts of OV. Three sets of data were pooled and
subjected to probit analysis (Table 6.2). The infectivity of vAchPD and vAchPS was
significantly greater than AcNPV for H. zea , 5.8-fold and 10-fold, respectively. No

significant differences in infectivity were found against P. xylostella or S. exigua

 

130

612244860ACM 660Ac

560 bp— +534 bp

128 bp—

   

1234567

Figure 6.5 (A) PCR products amplified using the AcNPV polh primer pair from DNA
isolated from third instar L. dispar midgut tissues or AcNPV DNA as template;
AcNPV-infected larvae at various time p.i. as indicated (lanes 1-5), AcNPV DNA (lane
6), or mock-infected larvae (lane 7). (B) Amplified product from 6 h and 60 h p.i. was
digested with Hind III (lanes 1 and 2, respectively) and compared to HindIII digested
amplification product from AcNPV DNA (lane 3). The predicted 354 bp and 180 bp

restriction fragments are indicated with arrows. Size markers are given in bp.

131

$0032 “GP—0:6 £33 UOHNEUE v.5 mDfiVOQm .0 CF35» OWUIH MO moocohotzu Hgocaw_m *

 

 

 

 

 

02 xwwd 00?N0.~. a 02 7.2: $0404.,

moifiwé 00:60; a we x9 .5 9:53?

mofixmo; 09x36. a motébw >mzo< SEEN? S333
mofixofio mofifimq a «0.0020; 0%404,»

m9 xmvd «Saved a mod i may 9:505,

mofixwoé mofithfl a ~03“ch >mzo< 3%.?» 56343540
mofixme; mofixmoc a mod xomd $304.,

mofixeafi 00:30; a we xmvw Dawn—04>

003mb; 003.86 a 00“ x5 .m >mzo< :8. 3488054

006 N80 02>OV ES: 1226: 83 some web 03/00
$304 5&3 a. omuq 9:5 86on

 

$0304., do .Qauqods, $0204

E3 8 SQ 8635 SEE 958m :8 amasseczmt YE $0.30 Saigon? 622.4301. SEER .6 8:88.. 800 .m.0 05.2.

132

(Table 6.2). These data indicated that the ability of hrf-I to increase AcNPV infectivity
for different species is limited.

hrf-I alone and expressed at low levels from its own promoter was sufficient to
increase AcNPV infectivity for H. zea. No significant differences of infectivity were
observed between vAchPD and vAchPS (Table 6.2). vAchPS differs from
vAchPD in that hrf—I transcription is controlled by a strong synthetic late promoter
and it bears a second LdNPV gene, fusolin (Thiem et al., 1996; Du and Thiem, 1997),
a gene with unknown function found in several baculovirus (Wu and Miller, 1989;
Gross et al., 1993; Cassar and Thiem, unpublished) and entomopoxviruses (Yuen et
al., 1990; Dall et al., 1993; Gauthier et al., 1995). These results demonstrated that
neither overexpression of hrf-I nor the presence of fusolin contribute to the increased

infectivity of AcNPV for H. zea larvae.

133

Discussion

We demonstrated that the LdNPV hrf-I gene, previously shown to expand
AcNPV host range for the L. dispar cell line, Ld652Y (Thiem et al. , 1996, Du and
Thiem, 1997), also expands the host range of AcNPV for insect larvae. LdNPV hrf-I
dramatically increased AcNPV infectivity for L. dispar. It also increased the infectivity
of AcNPV for H. zea, but had no obvious effects on either P. xylostella or S. exigua.
The ability of hrf-I to increase AcNPV infectivity for H. zea suggested that the
mechanisms that precluded efficient AcNPV replication in L. dispar and H. zea may be
similar. The increase in AcNPV-infectivity afforded by hrf—I for H. zea was small
compared to that for L. dispar, 5.8 vs. 1,800-fold reduction in LC50 compared to wt
AcNPV. This is not surprising considering hif-I was isolated from L. dispar. If the
block for AcNPV infection of these larvae is similar, it suggests that H. zea NPV
(HzNPV) may carry a hrf-I homolog, or a gene with a similar function. Alternatively,
there may be additional mechanisms that prevent AcNPV infection in H. zea that were
not overcome by hrf-I . A recent study suggested that resistance to AcNPV infection in
H. zea was due to an insect immune response in which infected cells were encapsulated
by hemocytes and infected midgut cells were sloughed off into the midgut lumen
(W ashbum et al., 1996). This raises the possibility that hrf-I enables AcNPV to evade
or counteract an insect immune response.

Approximately half of L. dispar neonates were killed by the highest dose of
AcNPV (Table 6.1), while later L. dispar instars were resistant to AcNPV infection.
This could be explained as developmental resistance, a term used to describe a well
known but poorly understood phenomena whereby insect larvae become increasingly
resistant to baculovirus infection as they proceed through development. In older larvae
we observed virus replication in the midgut epithelium, but saw no evidence for

systemic spread, suggesting that a physical or physiological barrier prevented virus

134

infection from spreading beyond the midgut. Gene activity was observed when L.
dispar larvae were injected with AcNPV bearing reporter genes but not when virus was
administered orally, supporting this hypothesis (Huang et al., 1997). The midgut basal
lamina most likely presents a physical barrier for virus passage. This barrier may be
more effective in older instars than in neonates and thus occasionally breached when the
neonates were exposed to high doses of AcNPV. If virus spread is prevented by an
insect immune response, iMunity in neonates may not be fully competent. Virus
spread might be prevented simply by the inability of AcNPV to replicate efficiently in
tissues outside of the midgut. Thus, a possible explanation for neonate susceptibility at
high AcNPV dosage is that midgut epithelial cells may be infected to such a great extent
in neonates that the larvae can not feed effectively and die from starvation. Older larvae
which are larger and have more extensive energy reserves are likely to have relatively
fewer infected cells or be better able to survive until infected midgut cells can be
replaced with healthy cells. The shriveled appearance, lack of larval melting, and low
number of PIBs observed for neonate L. dispar larvae that died following infection with
high doses of AcNPV are consistant with this hypothesis.

AcNPV bearing hIf-I was able to overcome the barrier for systemic spread in
L. dispar larvae. Recombinants were dramatically more infectious than wt AcNPV and
recombinant-infected L. dispar exhibited classical symptoms of NPV infection
including larval melting. How did hrf-I increase infectivity and promote systemic
spread of AcNPV in L. dispar larvae? It is known that AcNPV infects some L. dispar
cell lines but not others (Lynn et al., 1988; McClintock et al., 1986) suggesting that
AcNPV replication in L. dispar larvae is restricted in a cell or tissue specific manner.
From our previous studies in cell culture we know that hrf-I functions to preclude
global protein synthesis arrest in Ld652Y cells (Thiem et al, 1996, Du and Thiem,
1997, Du and Thiem, submitted). Thus, if AcNPV replication is prevented as the result

of proteins synthesis shutoff in specific tissues systemic spread would be curtailed. For

135

example, if AcNPV spreads via the trachael system in L. dispar and replication in
trachael cells were prevented, AcNPV would be unable to traverse the midgut basal
lamina. If BV production by haemocytes is critical for virus spread and virus replication
were prevented in these cells, systemic spread could be prevented. Protein synthesis
arrest is an effective anti-viral defense in both plants (Ready et al., 1986, Bonness et al,
1994) and vertebrate cells (Samuel, 1991, Schneider and Shenk, 1987). Whether the
global protein synthesis arrest observed in Ld652Y cells represents an anti-viral defense
remains to be determined.

In our studies, AcNPV DNA was detected in L. dispar midguts from 6 h to 60
h p.i. by PCR analyses. DNA amplification at 6 h p.i. could be from AcNPV that had
entered midgut cells or from PBS in the inoculum. Although our PCR results are not
quantitative, the persistance of AcNPV genomic DNA in midguts from 6 to 60 h p.i.
along with electron micrographs showing replicating virus indicated that L. dispar
midgut tissues were permissive for AcNPV replication. Furthermore, our data do not
support the hypothesis that a latent virus was activated, althought they do not
completely rule it out. To investigate the progression of AcNPV infection and study the
function of hrf—I in L. dispar larvae, more direct and SOphisticate approaches are
planned. To study pathogenesis we plan to use viruses bearing reporter genes to follow
the infection course of wt AcNPV carrying a reporter gene and AcNPV carrying both
hrf—I and a reporter gene (Engelhard et al., 1994; Flipsen, et al., 1995; Washburn, et
al., 1996). In situ hybridization or immunocytochemistry using antibody against I-IRF-
1 can be used to characterize hrf-I expression in infected insects. Studies are currently
in progress to determine how hif-I counteracts protein synthesis arrest in Ld652Y cells
which should provide clues to understanding its function in vivo. To determine if hrf-I
counters a cellular mechanism for preventing N PV-infection in nonpermissive hosts, it
would be interesting to see if hrf-I can expand the host specificity of other

baculoviruses for Ld652Y cells or L. dispar larvae. Although hrf-I enabled AcNPV to

136

infect L. dispar larvae, recombinants were less virulent than LdNPV, suggesting that
AcNPV requires additional virulence factors to effectively infect L. dispar larvae. To
employ hrf—I for generating NPVs with improved insecticidal properties, it will be

important to identify these virulence factors.

137

Acknowledgments

We thank Bob McCron at Forest Pest Management Institute, Forestry Canada,
Sault Ste. Marie, Ont. for providing T. ni'eggs and Gary Bemon at Otis Methods
Development Laboratory, USDA-APHIS, Otis, MA for providing L. dispar eggs. This
work was supported by USDA NRI Grant 93—37302-9573 and Public Health Service
Grant GM48608 from the National Institute of General Medical Sciences to S.M.T.

138

References

Ayres, M. D., S. C. Howard, J. Kuzio, M. Lopezferber, and R. D.
Possee. (1994). The complete DNA sequence of Autographa califomica nuclear
polyhedrosis virus. Virology 202: 586-605.

Beaton, C. D. and B. K. Filshie. (1976). Comparative ultrastructural studies of
insect granulosis and nuclear polyhedrosis viruses. J. Gen. Virol. 31:151-161.

Bonness, M. S., M. P. Ready, J. D. Irvin, and T. J. Mabry. (1994).
Pokeweed antiviral protein inactivates pokeweed ribosomes; implications for the

antiviral mechanism. Plant J. 5: 173-183.
Cassar, S. S. and Thiem. unpublished.

Clem, R. J. and L. K. Miller. (1993). Apoptosis reduces both the in vitro
replication and the in vivo infectivity of a baculovirus. J. Virol. 67 : 3730-3738.

Clem, R. J., M. Robson, and L. K. Miller. (1994). Influence of infection
route on the infectivity of baculovirus mutant lacking the apoptosis-inhibiting gene
p35 and the adjacent gene p94. J. Virol. 1994: 6759—6762.

Cowan, P., D. Bulach, K. Goodge, A. Robertson, and D. E. Tribe.
(1994). Nucleotide sequence of the polyhedrin gene region of Helicoverpa zea single
nucleocapsid nuclear polyhedrosis virus: placement of the virus in lepidopteran
nuclear polyhedrosis virus group H. J. Gen. Virol. 75: 3211-3218.

Croizier, G., L. Croizier, O. Argaud, and D. Poudevigne. (1994).
Extension of Autographa califomica nuclear polyhedrosis virus host range by

interspecific replacement of a short DNA sequence in the p143 helicase gene.Proc.
Natl. Acad. Sci. (USA).91: 48-52.

Dall, D., A. Sriskantha, A. Vera, J. Lai-Fook, and T. Symonds. (1993).
A gene encoding a highly expressed spindle body protein of Heliothis armigera
entomopoxvirus. J. Gen. Virol.74: 1811-1818.

Du, X. and S. M. Thiem. (1997). Characterization of host range factor 1 (hif-I)
expression in Lymantria dispar M nucleopolyhedrovirus- and recombinant
Autogarpha califomica M Nucleopolyhedrovirus-infected IPLB-Ld652Y cells.
Virology 227: 420-430.

Du, X. and S. M. Thiem. Responses of insect cells to baculovirus infection:
protein synthesis shut down and apoptosis. submitted

Engelhard, E. K., L. N. W. Kammorgan, J. O. Washburn, and L. E.
Volkman. (1994). The insect tracheal system - a conduit for the systemic spread of

Autographa califomica M nuclear polyhedrosis virus. Proc. Natl. Acad. Sci.
(USA).91: 3224—3227.

Flipsen, J. T. M., J. W. M. Martens, M. M. van Oers, J. M. Vlak, and
J. W. M. van Lent. (1995). Passage of Autographa califomica nuclear

139

polyhedrosis virus through the midgut epithelium of Spodoptera exigua larvae.
Virology 208: 328-335.

Finney, D. J. (1952). Probit analysis, a statistical treatment of the sigmoid response
curve, 2nd ed. Cambridge University Press, Cambridge.

Gauthier, L., F. Cousserans, J. C. Veyrunes, and M. Bergoin. (1995 ).
The Melolontha melolontha enotomopoxvirus (MmEPV) fusolin is related to the
fusolins of lepidopteran EPVs and to the 37K baculovirus glycoprotein.
Virology208: 427-436.

Goodwin, R. H., G. J. Tompkins, and P. McCawley. (1978). Gypsy moth
cell lines divergent in viral susceptibility. In Vitro 14: 485-494.

Granados, R. R., and K. A. Lawler. (1981). In vivo pathway of Autographa
califomica baculovirus invasion and infection. Virology 108: 297-308.

Griiner, A. (1986). Specificity and safety of baculoviruses, pl77-202. In R. R.
Granados and B. A. Federici (ed.), The biology of baculoviruses, vol. 1: Biological
properties and molecular biology. CRC Press, Inc., Boca Raton, Fla.

Grass, C. H., G. M. Wolgamot, R. L. Q. Russell, M. N. Pearson, and
G. F. Rohrmann. (1993). A 37-Kilodalton glycoprotein from a baculovirus of
Orgyia pseudotsugata is localized to cytoplasmic inclusion bodies. J. Virol. 67: 469
475.

Guza, D., H. Rathburn, K. Guthrie, and E. Daugherty. (1992). Viral and
host cellular transcription in Autographa califomica nuclear polyhedrosis virus-
infected gypsy moth cell lines. J. Virol. 66: 2966-2972.

Hammock, B. D., B. C. Banning, R. D. Possee, T. N. Hanzlik, and S.
Maeda. (1990) Expression and effects of the juvenile hormone esterase in a
baculovirus vector. Nature (London) 344: 458-461.

Horton, H. M. and J. P. Burand. (1993). Saturable attachment sites for

polyhedron-derived baculovirus on insect cells and evidence for entry via direct
membrane fusion. J. Virol. 67: 1860-1868.

Huang, X-P., T. R. Davis, P. Hughes, and A. Wood. (1997). Potential

replication of recombinant baculoviruses in non—target insect species: reporter gene
products as indicators of infection. J. Invertebr. Pathol. 69: 234-245.

Hughes, D. S., R. D. Possee and L. A. King (1993). Activation and detection
of a latent baculovirus resembling Mamestra brassicae nuclear polyhedrosis virus in
M. brassicae insects. Virology 194, 608-615.

Hughes, K. M. (1972). Fine structure and development of two polyhedrosis
viruses. J. Invertebr. Pathol. 19: 198-207.

Kawanishi, C. Y., M. D. Summers, D. B. Staltz, and H. J. Arnatt.
(1972). Entry of an insect virus in vivo by fusion of viral envelope and microvillus
membrane. J. Invertebr. Pathol. 20: 104-108.

140

Keddie, B. A., G. W. Aponte, and L. E. Volkman. (1989). The pathway of
infection of Autographa califomica nuclear polyhedrosis virus in an insect host.
Science 243: 1728—1730.

King, E. G. and G. G. Hartley. (1985). Heliothis virescens, p. 323-328. In P.
Singh and R. F. Moore (ed.), Handbook of Insect Rearing, Vol. II, Elsevier Science
Publishers, New York.

Knebel-Miirsdarf, D., J. T. M. Flipsen, J. Ronsarati, A. W. F.
Kleefsman, and J. M. Vlak. (1996). Baculovirus infection of Spodoptera exigua
larvae: lacZ expression driven by promoters of early gene pe38 and me53 in larvae
tissue. J. Gen. Virol. 77: 815—824.

Lee, H. H., and L. K. Miller. (1978). Isolation of genotypic variants of
Autographa califomica nuclear polyhedrosis virus. J. Virol. 27: 754-767.

Lu, A., and L. K. Miller. (1995). Differential requirements for baculovirus late
expression factor genes in two cell lines. J. Virol. 69: 6265-6272.

Lu, A. and L. K. Miller. (1996) Species—specific effects of the hcf-I gene on
baculovirus virulence. J. Virol. 70: 5123—5130.

Lynn, D. E., E. M. Daugherty, J. T. McClintock, and M. Laeb. (1988).
Development of cell lines from various tissues of Lepidoptera, p39-242. In Y.
Kuroda, E. Kurstak, and K. Maramorsch (ed.), Invertebrate and fish tissue culture.
Springer-Verlag. New York.

Maeda, S. (1989). Increased insecticidal effect by a recombinant baculovirus carrying
a synthetic diuretic hormone gene. Biochem. Biophys. Res. Comm. 165: 1177—
1 183.

Maeda, S., S. G. Kamita, and A. Kondo. (1993). Host range expansion of
Autographa califomica nuclear polyhedrosis virus (NPV) following recombination of
a 0.6-kilobase-pair DNA fragment originating from a Bombyx mori NPV. J. Virol.
67: 6234-6238.

McClintock, J. T., E. M. Daugherty, and R. M. Weiner. (1986).
Semipermissive replication of a nuclear polyhedrosis virus of Autographa califomica
in a gypsy moth cell line. J. Virol. 57: 197-204.

Meinkoth, J., and G. Wahl. (1984)Hybridization of nucleic acids immobilized on
solid supports. Anal. Biochem. 138: 267-284.

Morris, T. D., and L. K. Miller. (1992). Promoter influence on baculovirus—
mediated gene expression in permissive and non-permissive insect cell lines. J. Virol.
66: 7397-7405.

Morris, T. D., and L. K. Miller. (1993). Characterization of productive and non-
productive AcMNPV infection in selected insect cell lines. Virology 197: 339-348.

ODell, T. M., C. A. Butt, and A. W. Bridgeforth. (1985). Lymantria dispar.
p. 355-367. In P. Singh and R. F. Moore (ed.), Handbook of Insect Rearing,
Elsevier. New York.

141

O’Reilly, D. R., L. K. and Miller. (1989). A baculovirus blocks insect molting
by producing ecdysteroid UDP—glucosyl transferase. Science 245: 1110-1112.

O’Reilly, D. R., and L. K. Miller. (1991). Improvement of a baculovirus
pesticide by the deletion of the egt gene. Bio/1‘ echnology 9: 1086-1089.

O’Reilly, D. R., L. K. Miller, and V. A. Luckow. (1992). Baculovirus
expression vectors: A laboratory manual. W. H. Freeman and Company. New York.

Palli, S. R. and M. Locke. (1987). The synthesis of hemolymph proteins by the
larval midgut of an insect Calpodes ethlius (Lepidoptera: Hespen'idae). Insect
Biochem. 17: 561-572.

Reddy, J. T., and M. Locke. (1990). The size limited penetration of gold
particles through insect basal laminae. J. Insect Physiol. 36, 387-407.

Ready, M. P., D. T. Brown, and J. D. Rabertus. (1986). Extracellular
localization of pokeweed antiviral protein. Proc. Natl. Acad. Sci. (USA). 83: 5053-
5056.

Samuel, C. E. (1991). Antiviral actions of interferon. Interferon-regulated cellular
proteins and their surprisingly selective antiviral activities. Virology 183: 1-11.

Schneider, R. J. and T. Shenk. (1987). Impact of virus infection on host cell
protein synthesis. Ann. Rev. Biochem. 56: 317-332.

Slavicek, J. M., J. Podgewaite, and C. Lanner-Herrera. (1992). Fraperties
of two Lymantria dispar nuclear polyhedrosis virus isolates obtained from the
microbial pesticide Gypchek. J. Invertebr. Pathol. 59: 142—148.

Stewart, L. M. D., M. Hirst, M. L. Ferber, A. T. Merryweather, P. J.
Cayley, and R. D. Possee. (1991). Construction of an improved baculovirus
insecticide containing an insect-specific toxin gene. Nature (London) 352: 85-88.

Thiem, S. M., X. Du , M. E. Quentin, and M. M. Berner. (1996).
Identification of a baculovirus gene that promotes Autographa califomica nuclear

polyhedrosis virus replication in a nonpermissive insect cell line. J. Virol. 70: 2221-
2229.

Treat, T. L., and J. E. Halfhill. (1973). Rearing alfalfa loopers and celery
loopers on an artificial diet. J. Econ. Ent. 66: 569-570.

Tomalski, M. D., and L. K. Miller. (1991). Insect paralysis by baculovirus-
mediated expression of a mite neurotoxin gene. Nature (London) 352: 82-85.

Washburn, J., B. A. Kirkpatrick, and L. E. Volkman. (1996). Insect
protection against viruses. Nature (London) 383: 767.

Wu, J ., and L. K. Miller. (1989). Sequence, transcription and translation of a late
gene of the Autographa califomica nuclear polyhedrosis virus encoding a 34.8K
polypeptide. J. Gen. Virol. 70: 2449-2459.

142

Yuen, L., J. Dianne, B. Arif, and C. Richardson. (1990). Identification and
sequencing of the spheroidin gene of Choristoneura biennis entomopoxvirus.
Virology.l75: 427-433.

Zanatto, P. M. D., M. J. A. Sampaia, D. W. Johnson, T. L. Rocha,
and J. E. Maruniak. (1992). The Anticarsia gemmatalis nuclear polyhedrosis

virus polyhedron gene region: sequence analysis, gene product and structural
comparisons. J. Gen. Virol. 73: 1049-1056.

Appendices

 

 

Appendix A

Appendix A

Baculovirus hast-range mutant screening in insect cell lines

143

144

Abstract

Characterizing mutants with altered phenotypes is a powerful way to investigate
gene functions. Our strategy was to screen mutagenized mutants in cell culture system.
We used a classical genetic approach of mutagenesis, mutagenizing Autographa
califomica nucleopolyhedrovirus (AcNPV) with 5-bromo-2'-deoxyuridine (BUdR), to
attempt to identify genes that contribute to the broad host-range of AcNPV. 1544
plaque isolates from permissive cell lines SF-2l, TN368, and SElc cells were screened
for altered occluded virus production in alternate cell lines. Twelve isolates were

confnmed to have reduced growth on at least one cell line.

145

Host-range mutant screening in insect cell lines

Baculoviruses are invertebrate-specific pathogens that infect a single or at most
a few closely related species (Graner, 1986). Two genera, nucleopolyhedrovirus and
granulovirus, constitute the family baculoviridae. Two morphological forms of the
viruses are produced in the infection cycles; budded virus (BV) released from the
infected cell by budding from the cytoplasm membrane is responsible for the cell to cell
infection. Occluded virus (OV), embedded in a polyhedrin matrix is responsible for the
dissemination of infection in the insect population. Autographa califomica
nucleopolyhedrovirus (AcNPV) reportedly infects at least 33 species of Lepidoptera
larvae in 10 families (Grbner, 1986) and over 25 different cell lines (Hink 1970; Hink
and Hall, 1989). The unusual broad host range makes it an idea virus to study

baculovirus host specificity determinants.

Studying mutants with distinct phenotypes is an effective way to identify gene
functions. Several possible approaches can be used to investigate host range
determination of a virus. Among them, one is to select mutants with altered host range
caused by defective viral genomes. Another is to study viruses with modified host
specificity resulted from heterogeneous genes insertion to the viral genomes. By
characterizing vAcAnh, a mutant AcNPV has reduced host range, resulting from a 738
nucleotides deletion in EcoRI-S region, Clem et al. (1991) demonstrated that p35 was
essential for infection in SF-21 but not TN368 cells. Kondo and Maeda (1991), using
the other approach, isolated viruses with expanded host-specificity resulted from
recombination of AcNPV and Bombyx mori NPV (BmNPV). They further determined
that BmNPV p143, a putative DNA helicase gene, is responsible for the AcNPV host-

range expansion.

146

In this study, the cell lines used were Spodopterafrugiperda IPLB—SF21(SF—
21) (Vaughn, et al., 1977); Trichoplusia ni TN-368 (Hink, 1970); and Spodoptera
exigua UCR-SElc (SElc) (Gelemter and Federici, 1986), a clonal cell line of UCR-
SEl. All the cells were maintained at 27°C in TC-100 medium (GIBCO BRL,
Gaithersburg, MD) supplemented with 10% fetal bovine serum (GIBCO BRL) and
0.25% tryptose broth (Difco, Detroit, MI). Wild type AcNPV stocks were prepared
from a plaque purified isolate of the L—l variant (Lee and Miller, 1978) following
passage in Trichoplusia ni larvae. Mutated virus was generated by incubating AcNPV-
infected SF—21 cells at 27°C for 48 h in the presence of thymidine analog 5-bromo-2'—
deoxyuridine (BUdR) (Sigma, ST. Louis, M0) at concentrations of 10-40 ug/ml in 5
ug/ml intervals as described by Lee and Miller (1979). BV producted by infected cells
in the presence of different concentrations of BUdR was measured by plaque assay
(O’Reilly et al., 1992) and compared with those of untreated AcNPV-infected cells.
The BV titers were plotted against BUdR concentrations (Figure A. 1), and were used
as a measurement of the mutagen effectiveness. The titer reduction ranged from 99%
(35—40 jig/ml BUdR treatment) to 84% (5 ug/ml BUdR treatment) relative to untreated
AcNPV-infected cells. In cells treated with BUdR concentrations of 30 ug/ml or
greater, we observed more unusual polyhedrin morphologies as well as reduced
number of 0V per cell (data not shown). The mutagenized virus stocks were diluted to
yield approximately 10 plaques per 60 mm culture dish and plated out on SF-21,
TN368, and SElc cell monolayers. Infected cell monolayers were then overlayed with
TC-100 medium supplemented with 0.5% Seakem ME agarose (FMC, Bio Products,
Rockland, MA). After 4-5 days of incubation at 25°C, well isolated plaques were
randomly picked from SF-21, TN368 and SElc cells (Figure A2). 1544 plaques were
picked, 657 from SF-21, 419 from TN368, and 468 from SElc (Table A.l). Plaque

isolates were dispersed in 0.5 ml of cell culture medium for further uses.

147

 

 

lOO-<
‘03 80—
C:
.2
5
{=3 60—
2
O.
E
.5 40_
’O
Q)
'U
‘3
m 20—
0 ' I ' I ' I ' I
0 I0 20 3o 40

BUdR concentration (pg/ml)

Figure A.l Viral titers following BUdR treatment in AcNPV—infected SF-21 cells.
Budded virus production is expressed as a percentage of the EV production achieved in

untreated $13-21 cells.

 

 

 

148

Figure A.2 Host-range mutant screening on three insect cell lines. (A) BUdR
mutagenized AcNPV was used to inoculate SF-21, TN368, and SElc cells. Well
isolated plaques were picked and suspended in cell culture medium. (B) Viral isolates
were amplified in the homologous cell line in 96-well rnicrotiter plates. (C) Scaled-up
viruses from (B) were used to inoculate all three cell lines. Putative host range mutants

were selected for their differential infectivity on SF-21, TN368, or SElc cells.

 

 

 

 

 

TN—368

1

49

AcNPV stock

.1
i BUdR mutagenized

 

 

 

 

 

 

 

 

 

 

CED...”
CM.

 

 

 

TN—368

 

 

 

 

 

”W9
SF-2l SE—lc
”OM
SE—lc
hr mutants

Plaque picking

Virus
amplification

Mutant screening

150

Table A. 1. Number of potential host-range mutants in initial screening of plaques
isolated from SF—21, TN368, andSElc cells. Infection was scored visually by the

presence of polyhedral inclusion body at 4 days post infection.

 

 

 

Cell line BUdR (pg/ml) No. of plaques No. of putative host-
screened ran ge mutants
SF-21 10 18 O
15 127 2
20 127 2
25 159 1
3O 1 18 1
35 l 0
40 107 0
Subtotal 657 6
TN368 10 O O
15 O 0
2O 69 O
25 200 1
30 150 4
35 O O
40 O 0
Subtotal 419 5
SElc 10 O O
15 0 O
20 164 1
25 1 16 0
30 176 3
35 12 O
40 O 0
Subtotal 468 4

Total 1544

p—A
UI

151

Table A2. Percentage of cells containing occluded virus (0V) in mutant-infected SF-

21, TN368, or SElc cell at 48 hours post infection.

 

 

 

Cell Line
Mutant SF —2 1 TN—368 SE- 1c
wt AcMNPV 98 99 98
15$F22* 99 80 95
15$F54 98 9O 85
208F124 98 99 98
208F154 5 5 10
258F187 98 99 98
308F409 98 99 98
30TN295 3O 99 5
30TN297 15 98 3
25TN362 25 35 15
30TN422 1 30 5
30TN496 32 75 45
308E261 10 99 50
308E494 85 50 50
308E503 3 <1 5
208E528 50 99 50

 

* First and second numbers of each mutant (1 esignation represent the concentration
(pg/ml) of BUdR treatment and the sequence of plaque picked from a cell line,

respectively. The cell line from which they were picked from was also indicated.

152

To facilitate screening, 96-well microtiter plates were used. Plaque-isolated
Virus was first amplified in triplicate in the cell line used initially for selecting plaques.
Plates were seeded with 4x104 cells/well in 200 pl tissue culture medium and
inoculated with 100 111 media containing dispersed plaques. After 6-7 days of
incubation at 25°C, amplified viruses were examined for infectivities in the cells they
were isolated from by the observation of occluded virus (0V). To identify potential
host range mutants, 25 ul amplified viral isolates were used to inoculate SF—2l,
TN368, and SElc cells seeded in 96—well microtiter plates. Infectivity was scored for
the percentage cells containing 0V on the fourth day post infection (p.i.); high: 70% -
100%, medium: 40% - 69%, low: 1% - 39%, or none. Mutants that could replicate in
at least one cell line but not in at least one alternative cell line were selected (Figure
A2). 15 isolates were initially classified as potential host-range mutants (Table A. 1).
All of these isolated were picked from 15-30 ug/ml BUdR treated cells. Each putative
mutant virus was plaque purified twice from the original plaque, and then amplified in

its original cell line.

Scaled-up viral stock of each putative host—range mutant isolate was validated
for their differential BV and 0V productions on SF-21, TN368, and SElc cells at the
various time intervals from 0-48 hours p.i. Twelve were confirmed to have differential
infectivity on three cell lines (Table A2). All of the mutants that we identified were
"leaky"; infectivity of these mutants was never completely abolished in any cell line.
This may be due to the genetic instability of insect cell lines (Ennis and Sohi, 1976).
Heterogeneous cell types were observed in all cell lines used, including the clonal cell
line SElc. Mutant isolates may not have the same infectivity for all the cell types in a
cell line. Several mutants, such as SE261 and SE528 (Table A2), grew better in a cell
line other than the one that they were originally picked from. Several mutants, such as

SF154, TN422, and SE503 grew poorly in all three cell lines (Table A2). The results

153

from initial screening did not reflect the real phenotypes of the isolates in some cases,
for example, isolates SF124, SF187, and SF409 were determined to have wt
phenotype upon further characterization. This was most likely due to technical errors

during the initial screening.

154

Acknowledgemants

We would like to thank Hugh Smeltekop and Martha Quentin for their help

during mutant screening.

155

References

Clem, R. J., M. Fechheimer, and L. K. Miller. (1991). Prevention of
apoptosis by a baculovirus gene during infection of insect cells. Science 254: 1388-
1390.

Ennis, T. J., and S. S. Sohi. (1976). Chromosomal characterization of five
lepidopteran cell lines of Malacosoma disstria (Lasiocampidae) and Christoneura
fitmiferana (Tortricidae). Canadian J. Genetics and Cytol. 18: 471-477.

Gelernter, W. D. and B. A. Federici. (1986). Continuous cell line form
Spodoptera exigua (Lepidoptera: noctuidae) that supports replication of nuclear
polyhedrosis viruses from Spodoptera exigua and Autographa califomica. J.
Invertebr. Pathol. 48: 19—207.

Groner, A. (1986). Specificity and safety of baculoviruses. p177-202. CRC Press,
Inc. Boca Raton, FL.

Hink, W. F ., and R. L. Hall. (1989). Recently established invertebrate cell lines.
p269-293. CRC Press, Inc. Boca Raton, FL.

Hink, W.F. (1970). Established insect cell line from the cabbage looper,
Trichoplusia ni. Nature (London) 226: 466-467.

Kondo, A., and S. Maeda. (1991). Host range expansion by recombination of the
baculoviruses Bombyx mori nuclear polyhedrosis virus and Autographa califomica
nuclear polyhedrosis virus. J. Virol. 65: 3625-3632.

Lee, H. H. and L. K. Miller. (1979). Isolation, complementation, and initial
characterization of temperature-sensitive mutants of the baculovirus Autographa
califomica nuclear polyhedrosis virus. J. Virol. 31: 240-252.

O’Reilly, D. R., L. K. Miller, and V. A. Luckow. (1992). Baculovirus
expression vectors: a laboratory manual. W. H. Freeman and Company, New York.

Vaughn, J. L., R. H. Goodwin, G. J. Tompkins, and P. McCawley.
(1977). The establishment of two cell lines from the insect Spodopterafrugiperda
(Lepidoptera: noctuidae). In Vitro 13: 213-217.

Appendix B

Appendix B

Physical map of Anagrapha falcifera nuclear polyhedrosis virus

(AfMNPV)

The contents of this appendix have been published as: Chen, C-J, D. J. Leisy,
and S. M. Thiem. (1996). Physical Map of Anagrapha falcifera nuclear
polyhedrosis virus (AfMNPV). J. Gen. Virol. 77: 167-171.

156

157

Abstract

A physical map of Anagrapha falcifera nuclear polyhedrosis virus (AfMNPV)
DNA was constructed for restriction endonucleases EcoRI, HindIII, PstI, and XhoI.
The genome size was estimated to be 130 kbp. The ordering of the restriction fragments
was accomplished by cross-blot hybridization, double digestion, and DNA-DNA
hybridization. The polyhedrin gene and homologous repeat (hr) regions were located
by hybridization to the AcMNPV polyhedrin gene and hr4 respectively. Restriction
pattern comparison and Southern blot analysis suggest that AfMNPV is closely related
to AcMNPV.

158

Introduciton

Baculoviruses are invertebrate specific pathogens that are potential biological
agents for controlling insects. Most baculovirus infections are limited to a single host
species or at most a few closely related species (Groner, 1986). Autographa califomica
M nuclear polyhedrosis virus (AcMNPV), the best studied baculovirus, reportedly
infects 33 species from 10 families of Lepidoptera (Groner, 1986). Among these,
Agrotis segetum, Helicoverpa zea (Heliothis zea), and Mamestra brassicae were more
recently classified as non-permissive species for AcMNPV (Bishop et al., 1988). The
reason for this discrepancy is unknown. It could be due to differences between
geographic strains of insects. However, because the Groner (1986) report is a
compilation of early studies, many conducted before sensitive techniques for
unambiguous virus identification were available or widely used, the more recent study
most likely reflects the true AcMNPV host range. Anagraphafalcifera nuclear
polyhedrosis virus (AfMNPV), originally isolated from the celery looper, A. falcifera ,
is also reported to be infectious to a wide range of economically important insect pests
(Hostetter and Puttler, 1991). More than 31 species from ten families of Lepidoptera
were susceptible to AfMNPV (Hostetter and Puttler, 1991). Four of these species,
Peridroma saucia, Pieris rapae, Manduca sexta, and Plutella xylostella, are not
susceptible to AcMNPV (Bishop et al., 1988). Dose-mortality comparisons of
AfMNPV with AcMNPV, demonstrate that AfMNPV has 30-fold lower LC50 against
H. zea (Hostetter and Puttler, 1991), a major pest of corn and cotton that has
developed resistance to many chemical insecticides (Abd-Elghafar et al., 1993). Thus
AfMNPV is a potential microbial insecticide for H. zea. AfMNPV also infects the navel
orange worm, Amyelois transitella, a major pest of almonds (Hostetter and Puttler,
1991; Vail et al., 1993). It is the first baculovirus patented by the US. Government

Patent and Trademark office (Hostetter and Puttler, 1991).

159

Reports of over 600 insect species infected by baculoviruses were cataloged by
Martignoni and Iwai (1986), but few of these viruses have been isolated or
characterized. Although some baculoviruses have been studied at the molecular level
(reviewed by O’Reilly et al., 1992), relatively little is known about the mechanisms that
determine baculovirus host range. A 572 bp region of the DNA helicase gene from
Bombyx mori NPV (BmNPV), with only 29 nucleotides differences from the
AcMNPV helicase gene, enables a hybrid AcMNPV to replicate in a B. mori cell line
(Maeda et al., 1993). p35, an AcMNPV gene responsible for blocking the apoptotic
response (Clem et al., 1991), is also involved in host-range determination. The
infectivity of p35 deletion mutants is reduced in S. frugiperda but not Trichoplusia ni
larvae when budded virus is injected (Clem and Miller, 1993) or when occluded virus
is administered per os (Clem et al., 1994).

By comparing AfMNPV with other baculoviruses it may be possible to identify
additional genes or regions of genes that confer the ability to infect a wide range of
insects or specific host species such as H. zea. Construction of a physical map of
AfMNPV is the first step in characterizing this recently isolated baculovirus. In this
study a physical map of the AfMNPV genome was constructed by cross-blot
hybridization, double digestion, and Southern blot analysis. We used the polyhedrin

gene from AcMNPV to define the zero point of the AfMNPV map.

160

Physical map of AfMNPV

AfMNPV was propagated in third instar T. ni larvae. Hemolymph was collected
and used to inoculate SF—21 cells. A plaque representing the most prevalent restriction
endonuclease pattern was used to make a working stock. Viral DNA was purified from
the budded virus (O’Reilly et al., 1992), digested with endonucleases EcoRI, HindIII,
PstI, or XhoI (Boehringer Mannheim, Indianapolis, IN), and separated by
electrophoresis on a 0.7% agarose gel (Figure B.1). The sizes were estimated
according to the migration distances on the gels compared with the known sizes of l
HindIII fragments and various restriction fragments of AcMNPV used as size
standards. For fragments with sizes larger than 15 kbp a second enzyme was used to
generate smaller fragments, providing a better estimate. The enzymes EcoRI, HindIII,
PstI, and XhoI, cleaved the genome into 22, 21, 13 , and 14 fragments respectively
with sizes ranging from 31 kbp to 0.5 kbp (Table B.1). These numbers represent the
minimal number of cleavage sites for each of these four enzymes, since fragments
smaller than 0.5 kbp are not detected. The total genome size of AfMNPV was estimated

to be 130 kbp.

To detect colinearity between different restriction fragments, the cross—blot
hybridization technique was used (Potter and Dressler, 1986). For the "hot blot",
AfMNPV HindIII fragments were 32F end—labeled ([g-32P] ATP (3000Ci/mmol,
DuPont NEN, Wilmington, DE) using T4 kinase (Sambrook et al., 1989). Cold blots
comprised EcoRI, HindIII, PstI, and XhoI restriction fragments. Restriction fragments
were resolved on agarose gels and transferred to GeneScreen nylon membranes
(Biotechnology Systems, Boston, MA). Hybridization was at 42°C overnight. By
determining the colinearities between fragments generated by different restriction

endonucleases, a preliminary AfMNPV physical map was developed.

161

Figure B. 1. (A) Photograph (B) Schematic representation of restriction fragment
profiles of AfMNPV (At) and AcMNPV (Ac) DNA cleaved with EcoRI, HindIII, PstI,
and Xhol. Restriction fragment designations are indicated by letters to the left, for
AflVINPV, or to the right, for AcMNPV, of the schematic drawings of individual
restriction endonuclease profiles. Arrows on the schematic diagram indicate co-
migrating AfMNPV and AcMNPV restriction fragments. The asterisk marking the Af
EcoRI F fragment indicates uncertainty with regard to comigration with Ac EcoRI F
fragment due to the Ac triplet comprised of the F, G, and H fragmets. The sizes of it.

restriction fragments size standards are shown in kbp.

162

El IZZAI

ollnA.

.1:
{Sin
>l
El IPA:
lm
ml in A.
ml Id
all in
o 1 lo“.
4| '2
xi “a
ix
_.l
_l IaAi
Ii 1.
ll:
le l
U H 0
m in
ul H
El Imw
<l l< Al
N _
EEEE

xi
>>l l>
1.3
l emé
>1
:1
kl lb
mml Im
OI. in An
ml 1 ON
ol la .
21 in l m N
.10
EAHIZIAI
1 van
xi 14

.1. "GI
zomflla Al | 9a
u | WmoAi
<H H<m
I. QMN
a:
N _
HMSM =55: ..\

3V

N
EN

N A
might

 

N fl
HMSN EEEE

161

Figure B.1. (A) Photograph (B) Schematic representation of restriction fragment
profiles of AfMNPV (Af) and AcMNPV (Ac) DNA cleaved with EcoRI, HindIII, PstI,
and Xhol. Restriction fragment designations are indicated by letters to the left, for
AfMNPV, or to the right, for AcMNPV, of the schematic drawings of individual
restriction endonuclease profiles. Arrows on the schematic diagram indicate co-
migrating AfMNPV and AcMNPV restriction fragments. The asterisk marking the Af
EcoRI F fragment indicates uncertainty with regard to comigration with Ac EcoRI F
fragment due to the Ac triplet comprised of the F, G, and H fragmets. The sizes of it.

restriction fragments size standards are shown in kbp.

162

Si iZZAI

r_ii._AI
xiixAi

oliai

ix

oliai

i:
xgi
>i
Bi i»i
lm
ml ix A.
xi id
dai in
o 1 lo“
i_i i2
xi “w...
ix
_.i
_i ll.
:i i.
I:
Hi i
o H o
u in
oi i
El low
(i |< A:
N fl
EmvEm

xi
3| |>
I:
i omé
>i
:i
Fl ie
9.1 | m
0i in
a! A. l 3
ol lo .
zl I.. I m N
lo
ZJHIZIAI
i v.v
xi i4
4| Merl | o w
_i "0:
EMU Hon l 90
o<” m<m
i o.mN
a:
N _

33$ :65: ,.\

Q:

N fl
SHEEN

 

N m
336% =5:me

163

Table B. 1. AfMNPV DNA restriction endonuclease fragment sizes in kilo-base pair
(kbp)-

 

 

 

Fragment EcoRI HindIII PstI X hoI
A 14.5 20.5 26.9 29.7
B 13.4 15.1 23.2 23.2
C 12.4 14.0 17.0 15.1
D 10.8 12.0 12.9 14.2
E 10.4 11.1 10.0 10.5
F 8.8 9.3 7.3 7.5
G 7.6 7.6 6.9 6.9
H 7.5 6.6 6.5 6.5
I 6.6 5.6 5.6 5.9
J 6.5 5.1 5.2 2.9
K 6.4 3.4 5.1 2.4
L 5.4 3.0 1.7 2.2
M 3.7 2.8 0.8 1.3
N 3.7 2.6 1.3
O 2.7 2.3
P 2.5 2.2
Q 2.2 2.0
R 2.0 1.7
S 1.5 1.3
T 1.3 1.1
U 0.5 0.7
V 0.5

Total 130.9 130.0 129.1 129.6

 

 

164

Partially digested AfMNPV HindIII fragments were cloned into a cosmid,
pVK102 (Knauf and Nester, 1982), to generate an overlapping genomic library. The
locations of fragments whose positions were uncertain were established by' double
digestion experiments and Southern blot analysis using cloned fragments from the
AflVINPV library as probes. Fragments were 32P-labeled ([a—32P]dCTP, 3000Ci/mmol,
DuPont NEN, Wilmington, DE) by nick translation (Sambrook et al., 1989).
Hybridizations were in 50% formamide hybridization buffer at 42°C (Sambrook et al.,
1989). Double digestions were performed with the reciprocal enzyme pairs of EcoRI,

HindIII, PstI, and XhoI.

A linear physical map of AfMNPV is shown in Figure B.2. To define the zero
point of the AfMNPV map (V lak and Smith, 1982), Southern blots of AfMNPV
restriction fragments were probed with the AcMNPV polyhedrin gene. The probe was
an EcoRV-Dral fragment (4427-5424 kbp) (Ayres et al., 1995) of AcMNPV DNA. The
probe hybridized to EcoRI G, HindIII Q, PstI E, and Xho I C. These fragments were
located to the left of the map and the left end of the the smallest fragment, HindIII Q
was assigned as "0" map unit (Vlak and Smith, 1982). The map orientation was based
on colinearity with the AcMNPV physical map. All of the co—migrating restriction
fragments (Figure B. 1) except for the HindIII P fragments, from each virus, cross-
hybridized. AfMNPV EcoRI D, F, J, M, and R, HindIH A, J, O, R, and T, PstI F, I,
J, and L, and XhoI A, B, E, F, K, L, and M fragments cross-hybridize with AcMNPV
EcoRI D, G, J, M, and Q, HindIII A, I, O, S, and U, PstI G, H, I, and O, and XhoI
A, B, E, F, K, L, and M respectively (data not shown). These cross—hybridizing
restriction fragments are distributed in the same order across both the AfMNPV and
AcMNPV physical maps demonstrating the colinearity of the virus genomes.

Homologous regions (hr) in AcMNPV function as enhancers of early mRNA

transcription in transient assays (Guarino and Summers, 1986) and as origins of viral

165

DNA replication (Kool et al., 1993; Leisy and Rohrmann, 1993). Eight hrs were
located in AcMNPV; these regions have two to eight reiterations of an imperfect
palindromic sequence containing an EcoRI site at the center of each palindrome (Ayres
et al., 1994). The AcMNPV EcoRI Q fragment, containing the hr4L region, was 32P
labeled by random priming (Sambrook et al., 1989) and used for Southern blot
analysis. This fragment hybridized to AfMNPV HindIII C, H, D, E, and M, PstI F, G,
A, C, and B, and XhoI C, I, A, B, and K fragments, but only to one EcoRI fragment,
EcoRI R, indicating that there are EcoRI site-containing hr regions in AfMNPV. Based
on the overlapping regions and the corresponding EcoRI sites, we located a minimum
of five hrs with homology to AcMNPV hr4, one each at the left sides of EcoRI J, F,
and N, and on either the right or left sides, or both sides, of the EcoRI Q and R
restriction fragments of AfMNPV (Figure B.2, panel A). These hr regions are in
similar positions as hr regions in AcMNPV (Figure B.2, panel B).

A comparison of the physical maps of AfMNPV and AcMNPV indicates that
the arrangement of restriction fragments of these two viruses is similar, especially for
XhoI. Although they have different numbers of XhoI restriction fragments (14 for
AfMNPV and 13 for AcMNPV), seven co-migrate (Figure B], panel B). All co-
migrating restriction fragments are in similar positions in both viruses and five of them,
XhoI E, L, M, A, and B, form a contiguous array (Figure B.2, panel B). Although the
other three AfMNPV restriction patterns examined are different from those of
AcMNPV, we note a number of similarities. For each of the other restriction enzymes,
all of the co-migrating restriction fragments, except HindIII P, are located in same
positions in each virus. Several also comprise contiguous arrays. These include
AfMNPV EcoRI F, D, and R, HindHI O, T, J, and A, and PstI F, L, and J and their
corresponding AcMNPV restriction fragments (EcoRI G, D, and Q, HindIII O, U, I,
and A, and PstI G. O, and I). These arrays of restriction fragments, that are the same

in both AcMNPV and AfMNPV, overlap and span the AfMNPV physical map between

166

Figure B2. (A) Physical map of AfMNPV. Restriction enzymes are indicated to the
right of the map. Vertical lines indicate cleavage sites, and the numbers below each
restriction site indicates the distance in kbp from the left end. The HindIII Q fragment is
the smallest restriction fragment to hybridize with the AcMNPV polyhedrin gene and,
by convention, is designated as the left end of the linearized, circular genome.
Homologous regions (hrs) are shown as bold lines. hrl and hr4, marked with
asterisks, could be on either the right or left sides, or both sides of the EcoRI Q and R,
respectively. A scale indicating map units (mu) and Kbp is shown at the bottom of the
figure. EcoRI U, V, and HindIII U fragments are not indicated on the map. (B)
Comparison of XhoI restriction fragment maps of AfMNPV and AcMNPV. The

location of polyhedrin (polh) genes are indiated by bars below the maps.

 

hr5

hr4*

hr3

hr2

hr‘i*
G 0Q H

LTMP E

J

EcoRI

_ 8'921

LL;

_i 8'56
- 6'88

p 6'98

4 r91

-19z9

‘ 8'29

- 17'217
- 6'62
- 2'98
‘7 6'178

- S'62
II 0'82

- 17'91

 

F OT

NPHU

C

ifindHI

l

1

l

 

l

l

0'0‘51

6'1711
9'811
9'011
8'101

2'001
8'96

1'S8
0'178

#81

17'99

6'91?
8'017
1'68
V18

V!-
N”
NN

9'81
0'91

- 0'2

 

Psfl

1L
MI—

 

via;
NN
FH—

1'101

9'176

9'11

1'OS

i'Si7

2'28
1'12

167

LM

.Llin.

”15C?

Xhol

1

1821

'16'811.
—S'llt

l

9'1701
— 1'101

— 1'01

N65!—
mmd'

- 0'12

49st

 

' L L l 1 map units
20 30 40 50 60 70 80 90 i 00

10

 

kbp

120

110

l
100

90

50

30

 

LM

AfMNPV

 

polh

AcMNPV

L

 

#

polh

 

166

Figure B2. (A) Physical map of AfMNPV. Restriction enzymes are indicated to the
right of the map. Vertical lines indicate cleavage sites, and the numbers below each
restriction site indicates the distance in kbp from the left end. The HindIII Q fragment is
the smallest restriction fragment to hybridize with the AcMNPV polyhedrin gene and,
by convention, is designated as the left end of the linearized, circular genome.
Homologous regions (hrs) are shown as bold lines. hrl and hr4, marked with
asterisks, could be on either the right or left sides, or both sides of the EcoRI Q and R,
respectively. A scale indicating map units (mu) and Kbp is shown at the bottom of the
figure. EcoRI U, V, and HindIII U fragments are not indicated on the map. (B)
Comparison of XhoI restriction fragment maps of AfMNPV and AcMNPV. The

location of polyhedrin (polh) genes are indiated by bars below the maps.

 

hr5

hr4*

hr3

hr1 *

 

E

8

Lu

_ 2'921
a:

- 6’211
Z

I 2601
W — 2101
Q

~ £‘SG
¥

. 6‘88
a:

— 6'98
Q

3 1'9;
LL

- 219
<1:

— 8'29
Lu

— v21:
0.

— 6'62
2 .

- 2 9E
'“ - 6175
_i

— 5'62

- 0‘22

- 17'91
I

_ 6'8
‘7 - [9
° 0'17
(3
<

S

ML

OT

NPHUF

C

HindIII

J

0'081

61711
9811
9'011
8'101
2'001
8'96

1'58
0178

i781

0'2

 

Psti

I i

 

1'101

1'05

1'Si7

167

LM

Xhol

— 1'821

-6'Eli
—S'11|.

‘9'1701
—1'101

‘ 6'86

moir-
MM?

 

map units
100

90

60

50

40

20

10

 

kbp

 

20 30 40 SO 60 70 80 90 100 110 120

10

H

LM

AfMNPV

l

 

-
polh

AcMNPV

 

#

polh

168

6 and 94.2 kbp. The remainder of the AfMNPV physical map differs more from the
AcMNPV physical map. Only one restriction fragment that co-migrates with an
AcMNPV fragment, Xhol K, is located in this region (Figure B.2, B). While they do
not co-migrate on gels, the AfMNPV restriction fragments within this region hybridize
to AcMNPV restriction fragments located in similar positions of the AcMNPV physical
map (Data not shown). Co-linear physical maps, similar Xhol restriction patterns,
identical arrays of contiguous restriction fragments for each restriction map, EcoRI-
containing hr regions, and equivalent genome size, as well as the broad larval host
range and in vitro infectivity (Hostetter and Puttler, 1991; McIntosh, 1991; Vail et al. ,
1993) suggest that AfMNPV and AcMNPV are related viruses.

Despite the similarities between the AfMNPV and AcMNPV physical maps their
larval host ranges differ. AfMNPV infects some insects that are not susceptible to
AcMNPV, such as A. transitella. Although both viruses can infect some of the same
hosts their infectivity varies. For example, AfMNPV is more infectious for H. zea than
AcMNPV. Comparative studies of these viruses may help to determine the underlying

mechanisms for these differences in their infectivity.

169

Acknowledgements

We thank Dr. Pat Vail, Horticultural Crops Research Laboratory, USDA-ARS,
Fresno, CA for providing AfMNPV and Bob McCron, Forestry Canada for providing
T. ni. eggs. This work was supported by funding from The Michigan State University

Biotechnology Research Center.

170

References

Abd-Eighafar, S. F., C. O. Knowles, and M. L. Wall. (1993). Pyrethroid
resistance in two field strains of Helicoverpa zea (Lepidoptera: Noctuidae). J.
Economic Entomol. 86: 1651-1655.

Ayres, M. D., S. C. Howard, J. Kuzio, M. Lopez-Ferber, and R. D.
Possee. (1994). The complete DNA sequence of Autographa califomica nuclear
polyhedrosis virus. Virology 202: 586-605.

Bishop, D. H. L. , P. F. Entwistle, I. R. Cameron, C. J. Allen, and R.
D. Possee. (1988). Field trials of genetically-enginnered baculovirus insecticides.
In Release of genetically-enginnered micro-organisms, pp143-179. Edited by M.
Sussman, C. H. Collins, F. A. Skinner, and D. E. Stewart-Tull. New York:
Academic Press.

Clem, R. J. and L. K. Miller. (1993). Apoptosis reduces both the in vitro
replication and the in vivo infectivity of a baculovirus. J. Virol. 67 : 3730-3738.

Clem, R. J., M. Fechheimer, L. K. and Miller. (1991). Prevention of
apoptosis by a baculovirus gene during infection of insect cells. Science 254: 1388-
1390.

Clem, R. J., M. Robson, and L. K. Miller. (1994). Influence of infection
route on the infectivity of baculovirus mutants lacking the apoptosis-inhibiting gene
p35 and the adjacent gene p94. J. Virol. 68: 6759—6762.

Griiner, A. (1986). Specificity and safety of baculoviruses. In The biology of
baculoviruses, Vol. I, Biological Properities and Moleculaar Biology, pp. 177-202.
Edited by R. R. Granados and B. A. Federici. Boca Raton: CRC Press.

Guarino, L. A. and M. D. Summers. (1986). Interspersed homologous DNA of
Autographa califomica nuclear polyhedrosis virus enhances delayed-early gene
expression. J. Virol. 60: 215-223.

Hostetter, D. L. and B. Puttler. (1991). A new broad host spectrum nuclear
polyhedrosis virus isolated from a celery looper, Anagraphafalcifera (Kirby),
(Lepidoptera: Noctuidae). Enviro. Entomol.20: 1480—1488.

Knauf, V. C. and E. W. Nester. (1982) Wide host range cloning vectors: a
cosmid clone bank of an Agrobacterium Ti plasmid. Plasmid 8, 45—54.

Koo], M., J. T. M.Voeten, R. W. Goldbach, J. Tramper, and J. M.
Vlak. (1993). Identification of seven putative origins of Autographa califomica

multiple nucleocapsid nuclear polyhedrosis virus DNA replication. J. Gen. Virol. 74:
2661-2668.

Leisy, D. J. and G. F. Rohrmann. (1993). Characterization of the replication of
plasmids containing hr sequences in baculovirus-infected Spodopterafrugiperda
cells. Virology 196: 722-730.

Maeda, S., S. C. Kamita, and A. Kondo. (1993). Host range expansion of

171

Autographa califomica nuclear polyhedrosis virus (NPV) following recombination of
a 0.6-kilobase-pair DNA fragment originating from Bombyx mori N PV. J. Virol.
67 : 6234—6238.

Martignoni, M. E. and P. J. Iwai. (1986). A catalog of viral diseases of insects,
mites, and ticks. US. Department of Agriculture Forest Service, Gen. Tech. Report,
PNW 195. Washington, DC.

McIntosh, A. H. (1991). In vitro infectivity of a clonal isolate of Syngrapha falcifera
(celery looper) multiple nuclear polyhedrosis virus. J. Inverteb. Pathol. 57: 441-

O’Reilly, D. R., L. K. Miller, and V. A. Luckow. (1992). Baculovirus
expression vectors: A laboratory manual. New York: W. H. Freeman and Company.

Potter, H. and D. Dressler. (1986). A ‘Southern Cross’ method for the analysis
of genome organization and the localization of transcription units. Gene 48: 229-
239.

Sambrook, J., E. F. Fritsch, and T. Maniatis. (1989). In Molecular cloinng.
A laboratory manual, 2nd ed. New York: Cold Spring Harbor Laboratory.

Vail, P. V., D. F. Hoffmann, D. A. Streett, J. S. Manning, and J. S.
Tebbets. (1993). Infectivity of a nuclear polyhedrosis virus isolated from
Anagraphafalcifera (Lepidoptera: Noctuidae) against production and postharvest
pests and homologous cell lines. Enviro. Entomol. 22: 1140-1145.

Vlak, J. M. and G. E. Smith. (1982). Orientation of the genome of Autographa
califomica nuclear polyhedrosis virus: a proposal. J. Virol. 41: 1118-1121.

 

iliiiiiiiiiiiiiiiiiiiliiiiliililiii