4 1’. r &uv.1-.

Ai)§!'

it;

.
v."
‘4
E
‘1

 

’ w H 1
~ ”3' ‘
.'. u"

,~

:T'J'fi k7

1".
gm.

- A . kn'l" -
w-nu’
rl- >' ‘ ‘ ‘

'0

if“ 131i L
‘ :j.:zfip.r\4

“’7. .
"-3.?

’1‘

l Eh"

fligfi'fi‘?‘

....A
.. _ .-
.. - .
., V--......
. ..
\x. .. 1 .1...
u...«....._}..

so

go

Lu;
an..-

. xxx;
1,?
A
...
..

“A
‘5». .

 

W
3-2:“

-

‘w-fi

; C
-

‘Jx‘é

.

. n .
,1 2.3.-

.
s:
.9

0‘

V‘
V;
'.
g.

.‘ -

~

J x. 913:;
:1“ 3r {éflrz‘
1

‘1
‘x

1);,

l

3.34%;
u' v
‘ t‘

1 33%?

.3
it?

,v

I
'

.1".
.v-

A

- a
‘ 33‘s
1 u;
:73 .1151}
:4: ‘

h

'.~ *
. 34a - .
f E

.. .
MmM' N .‘-‘L\

1.: .29. .

 

SITY UBRARIES

lllllllllllllllllllllllllllllllll ||llll|ll|

31293 01712

 

 

 

 

 

This is to certify that the

dissertation entitled

Extreme Frequencies of Homologous Genetic Exchange
Between Polyomavirus Chromatin in Mitotically Dividing

Cells
presented by

Houman Dehghani

has been accepted towards fulfillment
of the requirements for

Ph . D . degree in Microbiology

 

 

l\4‘ cub 3 LEI/“ix

Major professor

 

Date April 30, 1998

 

MSU is an Affirmative Action/Equal Opportunity Institution 0-12771

 

 

l
I

LIBRARY

Michigan State

University

 

 

PLACE IN RETURN Box
to remove this checkout from your record.
TO AVOID FINES return on or before date due.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1M WMpfiS—p.“

EXTREME FREQUENCIES OF HOMOLOGOUS GENETIC EXCHANGE BETWEEN
POLYOMAVIRUS CHROMATIN IN MIT OTICALLY DIVIDIN G CELLS

By

Houman Dehghani

A DISSERTATION
Submitted to
Michigan State University

in partial fulfillment of the requirements
for the degree of

DOCTOR OF PHILOSOPHY

Department of Microbiology
Cell and Molecular Biology Program

1998

Professor Michele M. Fluck

ABSTRACT

EXTREME FREQUENCIES OF HOMOLOGOUS GENETIC EXCHANGE
BETWEEN POLYOMAVIRUS CHROMATIN m MITOTICALLY DIVIDING
CELLS
By

Houman Dehghani

In this thesis, I have mapped recombination frequencies on the
polyomavirus chromatin. Two variants of polyomavirus, each containing four
novel unique restriction endonuclease sites, were designed and constructed in
the large T antigen temperature sensitive background. The viral genome was
thus divided into eight intervals that could be tested for recombination. Co-
infections of non-permissive Fisher rat fibroblast cells were carried out at
permissive and non-permissive temperatures. Transformed cell lines were
isolated and analyzed for recombination. The results show that 19% of the
transformants contain recombinant viral sequences. Crossovers occurred
throughout the polyomavirus genome. On average, there are 3.4 crossovers per
integrated viral sequence. The range of crossovers varied from a low of 2 to a
high of 7 per integrated sequences. Two intervals, one in the early region and
one in the late region, show higher than average number of crossovers.

Maintenance of cell populations at permissive or non-permissive temperatures

did not affect crossover frequencies. There was, however, a dramatic reduction
in the number of transfonnants and viral DNA replication at the non-permissive

temperature.

To My Parents

iv

ACKNOWLEDGMENTS

I would like to extend my appreciation to my advisor, Dr. Michele M. Fluck, for her
support. I also thank my committee members, Dr. W. Champness, Dr. S. Conrad, Dr. J.
Dodgson and Dr. L. Kaguni for their support and helpful discussions. In addition, I
would like to thank my lab co-workers for their friendship and assistance.

My deepest appreciation goes to my family, without whom none of this would have been

possible.

TABLE OF CONTENTS

List of tables ....................................................................................... vii

List of figures .................................................................................... viii

Chapter 1: Literature Review .................................................................. 1
List of References ............................................................... 28

Chapter 2: Extreme Frequencies of Homologous Genetic Exchange Between

Polyomavirus Chromatin in Mitotically Dividing Cells.

Abstract ........................................................................... 44
Introduction ....................................................................... 46
Materials and Methods .......................................................... 49
Results ............................................................................. 56
Discussion ........................................................................ 85
List of References ............................................................... 91

vi

Table 1.

Table 2.

Table 3.

Table 4.

Table 5.

LIST OF TABLES

Comparison of the new variants and wild type A2
Properties ......................................................................... 57

Summary of results from three independent
Experiments ...................................................................... 61

Summary of doulbe digestion analysis for all

Recombinant cell lines .......................................................... 68
Summary of recombinant intervals ............................................ 70
Summary of single digestion analysis ........................................ 75

vii

LIST OF FIGURES

Chapter 1
Figure l. Holliday structure-recombination intermediate ............................... 4
Figure 2. Two models of homologous recombination 6
Figure 3. Schematic representation of Chi site and

RecBCD enzyme ................................................................. 10
Figure 4. Physical map of the polyomavirus genome .................................. 16
Chapter 2
Figure 1. Maps of the newly designed Py variants ...................................... 50
Figure 2. Experimental design for isolation of

transformed cells ................................................................ 54
Figure 3. Analysis of the 4-hours post infection

DNA samples ..................................................................... 64
Figure 4. Recombination analysis for the

BsplO6I-SacII interval .......................................................... 66
Figure 5. BglII analysis of thirteen cell lines ............................................ 73
Figure 6. Maps of the integrated, recombinant viral

sequences ......................................................................... 77
Figure 7. Detailed analysis of cell line 1-9 ............................................... 80
Figure 8. Detailed analysis of cell line ll-III ............................................ 82

viii

Chapter 1

Genetic recombination is an important and ubiquitous process in the life of
all organisms. Through it new combinations of the genetic material are formed.
Recombination is crucial to the viability of organisms and plays an important role
in evolution. It can summarily be divided into four major categories. The first of
these is general recombination that occurs between homologous regions of DNA
and was first described in the fruit fly by Morgan (1). Homologous recombination
can be sub-divided into two categories, those which involve reciprocal exchanges
of DNA and conversion events which involve non-reciprocal transfer of genetic
material. This distinction, however, can only be made when both parental and
progeny products can be analyzed. Transpositional recombination refers to the
movement of transposable elements from one location on the DNA to another.
The re-arrangement of DNA in highly specific regions is referred to as site
specific recombination. Finally, there is illegitimate recombination which requires
neither sequence or site specificity nor defined genetic elements. Although this
classification is convenient, it is arbitrary in the sense that there are no clear
boundaries between the different kinds of recombination. Homology is not only

important for general recombination but also for site specific recombination.

Although there are site specific enzymes involved in catalysis of site specific
recombination reactions, the interaction of enzymes with specific DNA
sequences is also observed in other types of recombination. Hot spots of
recombination, for instance, are likely sites of action for specific nucleases;
additionally, transposable elements interact with site specific enzymes during
transposition to a new site.

There are two models for the initiation of homologous recombination.
These models are in agreement regarding the structure of DNA strands involved
in recombination. Holliday (2-5) has described how two homologous molecules
of DNA can interact in a structure known as the Holliday junction (Figure 1). This
structure is formed subsequent to the juxtaposition of two molecules of DNA and
a break in one of the molecules. Meselson and Radding (6, 7) have proposed
that the origin of such junctions is the formation of a single stranded break in one
of the parental DNA molecules involved in the recombination event. The
invasion of the double stranded molecule by the single-stranded DNA displaces
the resident homologous strand. The displaced strand is subsequently destroyed
and the gap is repaired by DNA synthesis. Szostak and colleagues (8-10),
however, propose that the origin of Holliday junctions is a double-stranded break
that may become a gap. This event is then followed by repair synthesis of the
gap using the homologue as a template (Figure 2).

Knowledge of the factors that may affect the probability and location of
recombination events among a given set of molecules can improve our grasp of

the molchlar mechanisms of homologous recombination. The study of

recombination hotspots has been used in this respect. These sites may exert
their effect on recombination at two points. One may be the initiation or
termination of the strand exchange process and the other may involve the
process through which parental molecules are brought in close proximity. The
effect of these special sites may also be indirect. They may be involved in
initiation of such processes as DNA replication or transcription which may
influence recombination frequencies. One of the most well studied hot spots of
recombination is mediated by the Chi sequence (11) in the lambda (A) phage and
Escherichia coli which stimulates recombination mediated by the E. coli RecBCD
pathway (12-15). Phage A contains a linear, double stranded molecule of DNA
which has single stranded, unique ends. When it is injected into the E. coli host
cell, the ends anneal and are covalently linked by the host DNA ligase. This
leads to the formation of the intact cohesive site (cos site). Theta replication
proceeds this step and results in the formation of monomeric circles that are poor
substrates for packaging. Replication switches to the rolling circle mode that
produces concatemeric DNA molecules suitable for packaging (16, 17). The E.
coli RecBCD enzyme blocks the switch from theta to rolling circle replication (18).
The A gam gene product, however, can bind and inactivate RecBCD (19, 20). If
an E. coli host cell which is RecBCD+ is infected with A Gam‘, the phage
replication is limited to production of non-packageable monomeric circles.
However, such infections do produce sufficient progeny to produce large
plaques. This is as a result of homologous recombination yielding concatemeric

DNA (21). The primary pathway of recombination is the RecBCD pathway that is

Figure 1. Holliday structure -recombination intermediate.

A structure proposed by Holliday (1964) for the strand exchange process. This

structure contains heteroduplex DNA. lts resolution results in recombinant

formation (1 ).

Figure 2. Two models of homologous recombination.

a. The Meselson-Radding model. A single stranded nick is formed followed by
strand invasion, gap formation and repair synthesis. The resulting Holliday
structure is resolved.

b. The double stranded break model. Recombination is initiated by a double
stranded break followed by limited degradation. Repair synthesis occurs
using the undamaged homologue as template. The resulting Holliday

structure is resolved.

 

 

 

 

 

 

 

8.8. nick (1.8. break
Enlargement
to gap

 

 

 

fi---- ....... F —l\ -----.
Repair synthesis. \Deoradauon R_:__Pilf

 

 

 

Formation of Holliday junctions

I: I f

Resolutions oi Holliday junctions (only non-crossover cases shown)

 

 

 

 

 

 

 

 

 

 

8.8. patch '65. DIICN

 

 

 

 

dependent upon the RecA protein and the RecBCD enzyme. Large plaque
forming mutants isolated from A Red‘ Gam' revealed four loci at which mutations
had occurred (11, 22). RecBCD mediated recombination along A was favored
near these mutation sites (22-24). These observations led to the designation of
these sites as Chi that were defined as enhancers of recombination. The
nucleotide sequence of various Chi sties with full activity were shown to be
identical. Some deviations from the 5'GCTGGTGG3' consensus sequence (25)
led to partially or fully inactive Chi sties (26). In E. coli Chi sites occur one in
every 5 kilobase pairs (Kbp) of DNA (27-29). It is believed that Chi sites reside in
recombination islands of about 400 base pairs (bp) on each side of Chi. It is
implicated that Chi evolved in regions with intrinsic hot spot activity and biased
nucleotide composition for G and T (30). Chi is a regulatory sequence that down
regulates the 3'->5' nuclease activity and activates the 5'—>3' nuclease activity of
RecBCD enzyme (31, 32). Subsequently, single stranded DNA which contains
Chi at its 3’ terminus is formed. This is a suitable substrate for the E. coli RecA
protein and the single-strand binding (883) protein (33-35). Homology search
and strand invasion is the subsequent step in the exchange process. Genetic
exchange stimulated by Chi occurs not at the Chi site but at a distance from the
5’ terminus of the sequence. The effect of Chi diminishes by a factor 2 every 2.2
Kbp (36-38). When restriction digest fragments of Acontaining Chi were
inverted, the hot spot activity was abolished. Re-inversion of the fragment
restored the activity of the Chi site (27). This orientation dependence of Chi

suggests that it acts in concert with another sequence. This sequence was

identified to be the cos site. The cos site provides a port of entry for the RecBCD
enzyme (39-42) (Figure 3).

High recombination frequencies have been observed in
Schizosaccharomyces pombe. This observation was made in one allele (M26)
out of 394 alleles in adeB gene (43, 44). The M26 allele recombines with other
ade6 alleles up to 21 times more frequently; moreover, the frequency of gene
conversion at M26 is 10 times higher than at other alleles (43, 45, 46). M26 is
created by a G—>T transversion that introduces a nonsense codon in the open
reading frame upstream of the ade6 gene (45, 47). This transversion at the
heptamer 5'-AIGACGT-3' creates a meiosis-specific increase of homologous
recombination frequencies (43). The ade6-M375 allele has a G —>T transversion
in the codon preceding the M26 allele (45, 47). This nonsense mutation,
however, has no hotspot activity (43) and is used as a negative control. it has
been proposed that M26 creates a site that directs an endonuclease to nick the
DNA of the homologous chromatid. This chromatid is then used as an
information donor for the chromatid containing the site. Alternatively, however,
the nick could be made in the chromatid containing the M26 site followed by
expansion of the nick to a gap by a nuclease. Subsequently, the homologue can
act as a donor for information to fill the gap (43, 48). The general features of the
M26 allele are similar to other meiotic hot spots of recombination. That is, in
addition to imposing a recipient status on the chromosome that contains it (43),
the conversion rates of markers located upstream of M26 increases as their

distance from M26 decreases (43, 49). The activity of M26 depends on the

Figure 3. Schematic representation of Chi site and RecBCD enzyme.

Upon recognition of the Chi site by the RecBCD enzyme, its activity is attenuated

and also the 3' -> 5' exonuclease activity is switched to 5' —-) 3' exonuclease

activity.

ll

Downstream Upstream
Chi
a- I RecBCD

Top Strand -> 5' x '
=|==== 5. <3

Bottom Strand "> 3'

."3.
1

5° -
3.=~£':‘ “

\5.

5'» 3' exonuclease
activated at Chi

Top-strand, downstream
x-speclfic fragment
K ‘i
5‘ d ----------| 3'

+
3'-———50

Bottom-strand, upstream
x-speciiic fragment

12

chromosome context. If ade6-M26 is translocated to another part of the genome,
the hotspot activity of M26 is abolished (50, 51). Finally, M26 can enhance
recombination between a plasmid and the chromosome, but only if it is located
on the chromosome (50, 51 ). These features imply a role for chromatin structure
in the M26 mechanism of action. It has been shown that any base change in the
heptamer sequence abolishes hotspot activity (52). The heterodimeric protein
Mts1/Mt52, which was identified as a factor binding specifically to the heptamer
sequence residing on a DNA molecule (53), shows strict sequence specificity. It
is not yet clear why M26 imparts a meiosis specific elevation of homologous
recombination. The Mst1lMst2 heterodimer has been shown to be present and
active (in DNA binding) in both meiotic and mitotic cells (53). This ambiguity has
led to the hypothesis that assumes a meiosis specific chromatin structure that
contributes to M26 hotspot activity. Indeed it has been shown that the heptamer
sequence alters chromatin structure by altering nucleosome positioning (54).
The single base change resulting in the creating of M26 affects the phasing of
nucleosomes in the region surrounding the heptamer. Evidence for influence of
promoters on recombination in yeast has come from co-localization of hotspots of
recombination with promoter regions that are nuclease hypersensitive (55). It
has been postulated that M26 acts by enhancing an already existing site of
initiation of recombination in the promoter region of ade6 gene. Alternatively,
M26 may introduce a new site for initiation of recombination (49). When the
presumed promoter of ade6 gene was deleted, hotspot activity of M26 was

abolished (56). This lends support to the former hypothesis. The results,

13

however, are debated since it is possible that the deletion of the promoter may
have introduced an alteration in the chromatin structure. Evidence for similar
phenomena in other organisms has been obtained (57).

A eukaryotic mitotic, but not meiotic, recombination hot spot was identified
in Saccharomyces cerevisiae by Roeder and co-workers (58). This hot spot is
located in the ribosomal RNA (rRNA) gene cluster and stimulates both
interchromosomal and intrachromosomal mitotic recombination events and was
named HOT1. it acts on both parental sequences and thus must be present in
the same side of both sequences involved. Therefore, unlike Chi and other hot
spots discussed above, HOT1 is not dominant. The required sequences for
recombination hotspot activity include sequences that regulate transcription by
RNA polymerase I. In fact, transcription by RNA polymerase I, initiatediin the
rDNA region, is responsible for the stimulation of genetic recombination.
Insertion of a transcriptional terminator downstream of HOT1, and in the same
orientation, abolishes stimulation of recombination. Two models have been
proposed for the action of HOT1. First, HOT1 may act to stimulate the pairing of
homologous DNA molecules. RNA polymerase l action leads to a localized
unwinding of the helix and thus exposes single-stranded DNA (ssDNA). The
exposed ssDNA molecules may become involved in homologous pairing and
thus form the first step for recombination. Alternatively, HOT1 may influence not
the frequency of initiation of recombination, rather the nature of events that
occur. The latter is supported by the observation that HOT1 stimulates cross-

over events more than conversion events (59, 60).

l4

Homologous recombination in mitotic mammalian systems is a rare event.
it is estimated to be in the range of 10'6-10'5 events/cell/generation. This has
made the study of the system very difficult. The introduction of exogenous DNA
molecules in mammalian cells has been used to study recombination. This
system proved helpful since the frequencies of recombination observed were
higher than normal. The study presented here, aims to investigate homologous
recombination on the genome of polyomavirus (Py). Polyomavirus presents an
ideal model for the study of homologous recombination in mitotic eukaryotic cells
because of its reliance on cellular proteins for transcription and DNA replication,
and the presence of such regulatory regions as an origin of replication,
transcriptional enhancer and promoters.

Polyomavirus (Py) is a small DNA tumor virus that belongs to the
polyomavirus family (61). Its genome of about 5300 bps is packaged into
chromatin and contains 21 nucleosomes. Although histone H1 is not present in
the virion, it is believed that the viral DNA molecules in the host cell do contain
H1. It has been demonstrated that the histones of polyomavirus are
hyperacetylated and this phenomenon has been associated with the activity of
the viral early protein, middle tumor antigen (mT-Ag) (62). Polyomavirus
contains a non-coding, origin-enhancer region as well as two coding regions,
giving rise to early functional proteins and late structural proteins. The early
region is transcribed into a single precursor RNA which upon alternative splicing
gives rise to messenger RNAs (mRNA) coding for the viral proteins small, middle

and large tumor antigens (63). The late precursor RNA is differentially processed

15

to produce three mRNA molecules coding for the structural capsid proteins: VP1,
VP2 and VP3 (64). The non-coding region of the viral genome controls both viral
replication and transcription (Figure 4).

The outcome of Py infection of tissue culture cells depends upon the
pennissivity of the cells. In tissue culture systems derived from the natural hosts
of the polyomaviruses, a productive infection is produced with eventual death of
cells. In non-permissive (or semi-permissive) host cells little or no viral DNA
replication is observed, no virus is produced and the cells survive the infection
process. This appears to be dependent upon host factors that may include DNA
replication proteins which interact with the viral large tumor antigen (LT-Ag) (65-
67). In these cells LT-Ag and the DNA polymerase a/primase complex do not
interact efficiently (67, 68). Upon infection of non-permissive cells a small
fraction (0.05%-2%) of the cells become transformed (69). In these tissue culture
systems, stable transformation requires integration of the viral genome into the
host DNA to maintain the genome in the absence of viral DNA replication (70-
76). The integration of polyomavirus genome into the host sequences appears to
be through a non-homologous recombination mechanism. It is believed to be
random with respect to both host and viral sequences (70, 72, 74, 77). Although
patchy homology had been proposed as a model for integration of polyomavirus
(78-83), its role has been questioned and discounted (84). Large deletions of
host sequences accompany viral integration (79, 80, 85-88). The integrated
genome is in head-to-tail tandem copies. Recent studies have suggested that

integration occurs at a single site and post-integration amplification leads to

Figure 4. Physical map of the polyomavirus genome.

This schematic representation depicts the early and late coding regions of the
polyomavirus genome. Each region produces a single transcript that is
differentially spliced to produce three gene products. The viral T antigens, small
T, middle T and large T, are encoded by the early region. The late region

encodes the capsid proteins VP1, VP2 and VP3 (64).

17

 

  

ECORI
(1559)

     
   
   

BglI (87)

Semi-1101631)

l8

generation of the multiple band pattern previously taken as evidence for multiple
integration events (89). The majority of cells that do develop a transformed
phenotype do so transiently and revert to a normal phenotype. It has been
suggested that this abortive transformation phenotype (90) is due to the
expression of mT-Ag from the un-integrated genomes.

Large T antigen is a nuclear phosphoprotein of 758 amino acids. It is a
multi-functional protein involved in viral DNA replication, as well as integration,
transformation and transcriptional regulation. LT-Ag has an autoregulatory
function in regulation of early gene transcription. lts binding to sequences near
the early promoter prevents binding of RNA polymerase and thus down regulates
early gene expression (91-93). It also up regulates late gene expression in a
concentration dependent manner (94, 95). In normal cells the product of the
retinoblastoma gene, pRB, associates with E2F, a cellular transcription factor.
Binding of pRB to E2F is partially responsible for regulation of E2F activity (96).
Binding of LT-Ag to pRB dissociates EZF and leads to activation of E2F-
responsive cellular genes (97-100). This activity of LT-Ag is thought to be the
basis for its ability to alter the pattern of gene expression in the host at the 61/8
border and thus drive cells into S phase (101-104). The role of LT-Ag in viral
DNA replication is as an initiator. It has sequence-specific DNA binding as well
as helicase and ATPase activities (105, 106). Large T antigen binds the viral
origin of DNA replication as a double hexamer (107). This leads to localized
melting of the double strand (108). Following this event, LT-Ag recruits cellular

replication machinery to the site and acts as an ATP-dependent DNA helicase to

19

unwind the DNA in advance of the replication machinery (109-113). This
generates bidirectional DNA replication. In the absence of the replication
function of LT-Ag, the transformation frequency is reduced several fold. This
suggests that LT-Ag may play a role in the initiation of the transformed
phenotype (114) by promoting the integration of the viral DNA into the host
genome. Temperature sensitive mutants of LT-Ag were used in temperature
shift experiments. It was concluded that the presence of functional LT-Ag after
infection is important in transformation efficiency (115). It has also been shown
that LT-Ag temperature sensitive mutants and wild-type polyomavirus have the
same frequency of abortive transformation at non-permissive temperatures. It
was concluded that LT-Ag functioned in stabilization of the transformation
phenotype (116) which is now equated with integration of the viral genome. The
topology of the integrated viral genome is also affected by LT-Ag. That is, at
non-permissive temperatures less than one genome is integrated into the host
cell DNA (117).

Maintenance of the transformed phenotype is a function of the viral middle
T antigeni(mT-Ag) (117) which is the viral onco-protein (75, 118-120). Middle T
antigen is a 57 kilodalton, membrane associated phosphoprotein (120). In its C-
terminus there are 22 uncharged, hydrophobic amino acid residues which are
bounded on either side by basic residues, similar to other membrane-associated
proteins (120). Middle T antigen is believed to initiate a signal transduction
pathway similar to that induced by platelet derived growth factor (PDGF). Upon

complex formation, middle T antigen induces the tyrosine kinase activity of pp60°‘

20

3" (121, 122). Tyrosine phosphorylation of mT-Ag provides binding sites for
proteins with src homology domains (8H2), such as She (123). The mT-
associated pp60"""c phosphorylates Shc which then interacts with Grb2 (124).
Subsequently, She/Grb2 activates p21°”“ (125, 126) that functions to convert
inactive Ras—GDP to Ras-GTP (127-129). The signal is transferred to c-Raf-1
serinelthreonine kinase (130). Protein kinase C, which is activated by mT-Ag via
association of mT-pp60WC with phospholipase C gamma (PLCy) (131), can also
activate c-Raf-1 (130). Activated phospholipase Cy will lead to the hydrolysis of
phosphatidyl inositol-(4,5)bisphosphate (Ple) to yield diacyl glycerol (DAG) and
inositol 1,4,5-triphosphate (IP3) (130). DAG activates protein kinase C (132)
which eventually leads to the activation of such transcriptional activators as
AP1/PEA1 and c-etslPEA3 (133-135). 1P3 is a modulator of cytoplasmic calcium
concentration (136). These two pathways initiated by association of mT-Ag with
pp60°“’° merge at c-Raf-1. Activated c-Raf-1 will lead to activation of mitogen
activated protein (MAP) kinase kinase (137, 138) which in turn will activate MAP
kinase (139). The signal is then transduced to the nucleus by activation of
transcription factors such as c-jun (140, 141). The final result is the activation of
genes under the control of such transcription factors. The mT-pp60°""° also
associates with Pia-kinase (142-147). The down stream targets of this pathway
are not well characterized. However, it has been shown that mT-Ag mutants
deficient in Pl3—kinase activation have a decreased transformation capability
(147, 148). It has been observed that the mT mutant viral chromatins are less

acetylated than the wild type chromatin (62). This may be linked with the role of

21

mT-Ag in activation of the transcription factors that bind the viral enhancer.
These transcription factors may then recruit histone acetylases or de-acetylases
to the viral chromatin. It is important to keep this correlation in mind as chromatin
structure is an important factor in recombination processes.

Small T antigen is 196 amino acids long. Its role in transformation is not
clear. Small T antigen can increase transformation in cultured cells in
cooperation with mT—Ag (149). Its interaction with pp2A may modulate pp2A
activity. It has also been demonstrated that small T antigen can stimulate viral
DNA replication.

Both Polyomavirus and SV40 have been used extensively to study mitotic
recombination in eukaryotic systems. Most such studies took advantage of
transfection of an exogenous molecule of DNA into an appropriate cell line.
These studies contributed considerably to our understanding of homologous
recombination in mammalian systems. Few studies, however, have used
infection as a mode of introduction of viral DNA into the host cells. Such studies
are more relevant to the research presented in this thesis.

Kit and colleagues (150) first reported inter-viral recombination between
plaque morphology mutants of SV40. Large clear plaque-forming virus was
isolated during mixed infections of African green monkey kidney cells (CV-1) with
small clear plaque type and fuzzy plaque type mutants. The recombination
frequency was reported to be 2 x 10“. Recombination between polyomavirus
genomes was first reported by lshikawa and Di Mayorca (151). Two temperature

sensitive mutants of Py were used to infect mouse 3T3 cells. These crosses

22

yielded wild type Py at a calculated frequency of about 0.24%. Oligomeric forms
of SV40 DNA used in infections of CV-1 cells also resulted in isolation of large
clear plaque forming type SV40 (152).

The observed frequencies of recombination have been higher when
transfections were used as a method of introducing the recombination substrates
into the host cells. When two restriction endonuclease-generated fragments of
SV40, that shared homologous overlapping termini, were transfected into CV-1
cells, viable genome size SV40 was produced by recombination at a frequency of
0.1% (153). Wilson and colleagues (154) refined this system by designing
defined Oligomeric molecules of SV40. Head-to-tail partial dimers of two
temperature sensitive mutants of SV40 were created. Since these molecules
were not packageable due to their size, formation of packageable monomers was
assayed. The results from this line of work indicated that conversion from partial
dimers to packageable monomers occurred uniformly throughout the SV40
genome and that the mechanism involved was general homologous
recombination. A later study focused on recombination between endogenous
and introduced SV40 sequences (155). Linear enhancer-less SV40 DNA was
transfected into monkey cells that have either one or multiple copies of SV40
early region stably integrated, C081 and COS? cells respectively. The results
suggested that a double stranded break introduced into the transfected molecule
in the region of homology resulted in the production of wild type virus in up to
25% of the successfully transfected cells. The double strand break-repair model

was presented as an explanation; however, double crossover resulting in a

23

reciprocal exchange could not be excluded. In another study, a conditionally
replication defective mutant of SV40 was used to rescue large T antigen function
from COS cells (156). This mutant lacks the early coding region and thus can
only replicate in C08 cells which provide the large T function for replication in
trans. In CV-1 cells, however, this mutant cannot replicate. Recombination was
observed at a frequency of 1x106 as assayed by rescue of large T function and
therefore replication in CV-1 cells. Others have reported recombination between
integrated sequences of SV40 in monkey cells and temperature sensitive
mutants of SV40 (157-159). The transformed cells, however, contained SV40
sequences with an intact origin of DNA replication making it difficult to exclude
replication and excision of the resident viral sequences prior to recombination.
Other studies focused on the differences between recombination of circular and
linear molecules (160, 161).

One line of study of recombination using Py has focused on the possible
role of the viral replication protein, large T antigen (LT-Ag), in recombination. In
a detailed analysis, cell lines carrying two mutated copies of mT-Ag were
established. These mutations were positioned such that functional mT-Ag could
only be expressed as a result of recombination between the two sequences. The
normal spontaneous rate of recombination was determined to be 1x10”. When
exogenous LT-Ag was introduced, the recombination rate increased to between
1x10" to 1x10'2 (162). This effect required the replication function of LT-Ag and
a viral origin of replication. The model proposed involved a mechanism whereby

LT-Ag functions to unwind the DNA and thus make it more recombinogenic. This

24

is followed by single-stranded nicks, slipped-strand mispairing between the two
repeats and subsequent repair synthesis. Effects of LT-Ag mutants defective in
initiation of viral DNA synthesis on homologous recombination were analyzed in
an attempt to further address the role of the replication function of LT-Ag in this
process (163, 164). The results indicated that LT-Ag can promote recombination
independent of its replication function. The results of a later study showed that
the origin specific binding activity of LT-Ag is not sufficient to promote
homologous recombination. It was hypothesized that localized unwinding of the
double stranded DNA is required for the process of homologous recombination
promoted by LT-Ag. The elements of the Py origin of replication required for LT-
Ag induced homologous recombination were determined to be identical to those
required for DNA replication. Other replicative functions of LT-Ag, however, are
dispensable for recombination. This is in agreement with the model that the role
of LT-Ag in recombination may be localized destabilization of the double
stranded DNA at the viral origin of replication to create a suitable substrate for
recombination (165).

Another line of research has focused on the role of DNA sequences in the
recombination of polyomavirus. This study made use of a chimeric molecule of
DNA, derived from integrated Py sequences, containing Py and mouse
sequences with directly repeated viral sequences. This molecule arises in
permissive murine cells carrying a temperature sensitive Py virus genome that is
stably integrated at elevated temperature but is excised and replicated after

transfer to permissive temperatures and is called le (166). It is hypothesized

25

that a site-specific recombinase may be involved in excision of the le molecule.
Patchy homology and palindromic sequences have been found at the junctions of
this molecule with mouse DNA. Thus in the cell line repeatedly giving rise to le
the viral genome may be integrated in a region with clustering of repetitive DNA
elements (167). Such clustering has been associated with local genome
instability. le yields genome size Py molecules by homologous intramolecular
recombination. When the direct repeats (S repeats) of le were mutated such
that the homology is limited to 40-50 bps, non-homologous recombination
products were observed, unlike wild type Rm! (168). It was hypothesized
therefore that the initial steps in the mechanisms yielding homologous and non-
homologous products could be identical. Additionally, the S repeats may contain
sites that are active in recombination and are preferred crossover sites (169).
Later studies revealed that deletion of the early promoter or inversion of the late
promoter impaired viral DNA recombination (170, 171). This was observed
under conditions which allowed for unimpaired viral DNA replication. The
dependence of recombination on promoter activity and especially promoter
orientation suggested that recombination may require progression of transcription
through the site of crossover rather than a chromatin configuration due to
transcriptional activity. More recent studies have better defined the elements in
the S repeat that are responsible for enhancement of homologous recombination
(172). There are three binding sites for the transcription factor Yin Yang-1 (YY1)
on the polyomavirus genome (172-174). Two of these sites are on the late side

of the origin and the third is within the VP1 coding region. YY1 is a zinc finger

26

protein (175) that has differential gene context-dependent transcriptional
regulatory effects. It can initiate, enhance or repress transcription (176). The
effect of YY1 on transcription is believed to be primarily through its effect on
promoter structure. Mutations of the third binding site for YY1 that eliminate
binding were shown to impair intramolecular homologous recombination in le
(172). The model presented assumes that recombination occurs in a
transcriptionally active viral genome, attached to the nuclear matrix by YY1.

The possibility that neoplastic transformation may in itself result in higher
frequencies of recombination is of particular interest. It has been suggested that
elevated levels of c-fos increases the frequencies of homologous recombination
(177). However, no mechanistic and systematic studies are reported. This is
with the exception of a system that has questioned the role of p53 in
recombination. A study of the effect of p53 on homologous recombination used
two mutants of SV40, which could only replicate after intermolecular homologous
recombination (178). The results indicated a 10-fold increase in the rates of
homologous recombination among the chromatin-associated molecules of SV40.
It is hypothesized that the association of the SV40 LT-Ag with p53 relieves the
inhibitory effect of p53 on homologous recombination. This was confirmed by
using SV40 virions with a LT-Ag unable to bind p53 which did not increase the
rate of homologous interviral recombination. In a recent study human tumor cell
lines with a null mutation of p53 were used in an assay for recombination of
integrated plasmid sequences (179). These cells exhibited a 10‘ fold increase in

rates of homologous recombination when compared to primary cell lines. This

27

increase in recombination was greatest for homologous recombination. The rate
of non-homologous recombination increased only 2-10 fold (as measured by the
random integration of test plasmid). These studies have led to the postulation of
a role in genome maintenance for p53. That is, p53 functions in this regard by
inhibiting homologous recombination.

It is apparent from the body of work presented here that recombination is
a complex process which in some cases may be tied with other cellular
processes such as replication or transcription. The research presented in this
thesis has aimed to map recombination frequencies on the Polyomavirus
genome as an initial step in understanding the high frequencies of recombination

observed on the Polyomavirus genome.

28

List of References

Fishel, R. General genetic recombination. (1991).. In Modem Microbial
Genetics (Streips, U. N., and Yasbin, R. E., eds), pp.91-121, Wiley-Liss,
New York. .

Holliday, R. (1964). A mechanism for gene conversion in fungi. Genet.
Res., 5, 282-303.

Holliday, R. Genetic recombination in fungi. (1968). In Replication and
Recombination of Genetic material (W. Peacock and R. Brock, eds), p.
157, Australian Academy of Sciences, Canberra.

Holliday, R. (1974). Molecular aspects of genetic exchange and gene
conversion. Genetics, 78, 273-285.

Whitehouse, H. L. K. (1963). A theory of crossing-over by means of
hybrid deoxyribonucleic acid. Nature, 199, 1034-1040.

Meselson, M. S., and Radding, C. M. (1975). A general model for genetic
recombination. PNAS, USA, 72, 358-361.

Radding, C. M., Flory, J., Wu, A., Kahn, R., DasGupta, C., Gonda, D.,
Bianchi, M., and Tsang, S. S. (1983). Three phases in homologous
pairing: polymerization of recA protein on single-stranded DNA, synapsis,
and polar strand exchange. Cold Spring Harbor Symp. Quant. Biol, 47,
821-828.

Szostak, J. W., Orr-Weaver, T. L., Rothstein, R. J., and Stahl, F. W.
(1983). The double-strand-break repair model for recombination. Cell,
33, 25—35.

Nicolas, A., Treco, D., Schultes, N. P., and Szostak, J. W. (1989). An
initiation site for meiotic gene conversion in the yeast Sacchammyces
cereviciea. Nature, 338, 35-39.

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

29

Sun, H., Treco, D., Schultes, N. P., and Szostak, J. W. (1989). Double-
strand breaks at an initiation site for meiotic gene conversion. Nature,
338, 87—90.

Henderson, 0., and Weil, J. (1975). Recombination -deficient deletions
in bacteriophage A and their interaction with Chi mutations. Genetics, 79,

143-174.

Stahl, F. W. (1979). Special sites in generalized recombination. Annu.
Rev. Genet, 13, 7-24.

Smith, G. R. and Stahl, F. W. (1985). Homologous recombination
promoted by Chi sties and RecBC enzyme of Escherichia coli. BioEssays,
2, 244-249.

Smith, G. R., Amundsen, S. K., Chaudhurry, A. M., Cheng, K. C.,
Ponticelli, A. 8., Roberts, C. M., Schultz, D. W., and Taylor, A. F. (1984).
Roles of RecBC enzyme and Chi sites in homologous recombination.
Cold Spring Harbor Symp. Quant. Biol, 49, 485-495.

Smith, G. R. (1987). Mechanism and control of homologous
recombination in Escherichia coli. Ann. Rev. Genet, 21, 179-201.

Furth, M. E., and Wickner, S. H. (1983). Lambda DNA replication. In
Lambda II (Hendrix, R. W., Roberts, J. W., Stahl, F. W., and Weisberg, R.
A., eds), pp. 145-173. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.

Feiss, M., and Becker, A. (1983). DNA packaging and cutting. ln
Lambda II (Hendrix, R. W., Roberts, J. W., Stahl, F. W., and Weisberg, R.
A., eds), pp. 305-330. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.

Enquist, L. W. and Skalka, A. (1973). Replication of bacteriophage
lambda DNA dependent on the function of host and viral genes. l.
Integration of red, gem and rec. J. Mol. Biol, 75, 185-212.

Unger, R. C. and Clark, A. J. (1972). Interaction of the recombination
pathways of bacteriophage A and its host Escherichia coli K12: Effects on

exonuclease V activity. J. Mol Biol, 70, 539-548.

Karu, A. E., Sakaki, Y., Echols, H., and Linn, S. (1975). The y protein
specified by bacteriophage A, Structure and inhibitory activity for the
RecBC enzyme of Escherichia coli. J. Biol. Chem, 250, 7377-7387.

21.

22.

23.

24.

25.

26.

27.

28.

29.

30.

31.

3O

Zissler, J., Singer, E. R., and Schaefer, F. (1971). The role of
recombination in growth of bacteriophage lambda. l. The gamma gene.
In The Bacteriophage Lambda (Hershey, A. 0., ed.), pp 455-468. Cold
Spring Harbor Laboratory Press. Cold Spring Harbor, New York.

Stahl, F. W., and Stahl, M. M. (1975). Rec-mediated recombinational hot
spot activity in bacteriophage A. IV. Effect of heterology on Chi-
stimulated crossing-over. Mol. Gen. Genet. 140, 29-37.

Lam, S. T., Stahl, M. M., McMilin, K. D., and Stahl, F. W. (1974). Rec-
mediated recombinational hot spot activity in bacteriophage lambda. II. A
mutation which causes hot spot activity. Genetics, 77, 425-433.

Stahl, F. W., Crasemann, J. M., and Stahl, M. M. (1975). Rec-mediated
recombinational hot spot activity in bacteriophage lambda. Ill. Chi
mutations are site-mutations stimulating Rec-mediated recombination. J.
Mol. Biol, 94, 203-212.

Smith, G. R., Kunes, S. M., Schultz, d. W., Taylor, A., and Triman Smith,
G. R., Kunes, S. M., Schultz, D. W., Taylor, K. L. (1981). Structure of Chi
hotspots of generalized recombination. Cell, 24, 429-436.

Cheng, K. C., and Smith, G. R. (1984). Recombinational hotspot activity
of Chi-like sequences. J. Mol. Biol, 180, 371-377.

Fauld, D., Dower, N., Stahl, M. M., and Stahl, F. W. (1979). Orientation
dependent recombination hotspot activity in bacteriophage lambda. J.
Mol. Biol, 13, 681-695.

Malone, R. E., Chattoraj, D. K., Faulds, D. H., Stahl, M. M., and Stahl, F.
W. (1978). Hotspots for generalized recombination in the Escherichia coli
chromosome. J. Mol. Biol, 121, 473-491.

Smith, G. R. (1994). Hotspots of homologous recombination.
Experientia, 50, 234-241.

Tracy, R. 8., Frederic, C., and Kowalczykowski, S. C. (1997). The
recombination hot spot Chi is embedded with islands of preferred DNA
pairing sequence in the E. coli genome. Cell, 90, 205-206.

Anderson, D. G., and Kowalczykowski, S. C. (1997). The recombination
hot spot Chi is a regulatory element that switches the polarity of DNA
degradation by the RecBCD enzyme. Genes Dev., 11, 571-581.

32.

33.

34.

35.

36.

37.

38.

39.

40.

41.

42.

31

Dixon, D. A., and Kowalczykowski, S. C. (1991). Homologous pairing in
vitro stimulated by the recombination hotspot, Chi. Cell, 66, 361-371.

Dixon, D. A., and Kowalczykowski, S. C. (1995). Role of the Escherichia
coli recombination hotspot, Chi, in RecABCD-dependent homologous
pairing. J. Biol. Chem, 270, 16360-16370.

Tracy, R. 8., and Kowalczykowski, S. C. (1996). In vitro selection of
preferred DNA pairing sequences by the Escherichia coli RecA protein.
Genes Dev., 1 0, 1890-1903.

Anderson, D. G., and Kowalczykowski, S. C. (1997). The translocating
RecBCD enzyme stimulates recombination by directing RecA protein onto
ssDNA in a x-regulated manner. Cell, 90, 77-86.

Stahl, F. W., Stahl, M. M., Malone, R. E., and Crasemann, J. M. (1980).
Directionality and nonreciprocality of Chi-stimulated recombination in
phage lambda. Genetics, 94, 235-248.

Ennis, D. G., Amundsen, S. K., and Smith, G. R. (1987). Genetic
functions promoting homologous recombination in Escherichia coli: A
study of inversions in phage lambda. Genetics, 115, 11-24.

Cheng, K. C., and Smith, G. R. (1989). Distribution of Chi-stimulated
recombinational exchanges and heteroduplex endpoints in phage lambda.
Genetics, 123, 5-17.

Kobayashi, l., Murialdo, H., Crasemann, J. M., and Stahl, F. W. (1982).
Orientation of cohesive end site cos determines the active orientation of x
sequence in stimulating recA-recBC-mediated recombination in phage A
lytic infections. PNAS, USA, 79, 5981-5985.

Kobayashi, l., Stahl, M. M., Leach, D., and Stahl, F. W. (1983). The
orientation of cos with Chi is separable from DNA packaging in recA—
recBC-mediated recombination of bacteriophage lambda. Genetics, 104,
549-570.

Kobayashi, |., Stahl, M. M., Fairfield, F. R., and Stahl, F. W. (1984).
Coupling with packaging explains apparent nonreciprocality of Chi-
stimulated recombination of bacteriophage lambda by RecA and RecBC
functions. Genetics, 108, 773-794.

Kobayashi, l., Stahl, M. M., and Stahl, F. W. (1984). The mechanism of
Chi-cos interaction in RecA-RecBC-mediated recombination in phage A.

Cold Spring Harbor Symp. Quant. Biol, 49, 497-506.

43.

45.

46.

47.

48.

49.

50.

51.

52.

53.

54.

32

Guntz, H. (1971). Site-specific induction of gene conversion in
Schizosaccharomyces pombe. Genetics, 69, 317-337.

Goldman, S. L. (1974). Studies on the mechanism of the induction of
site-specific recombination in the adeB locus of Schizosaccharomyces
pombe. Mol. Gen. Genet, 132, 347-361.

Ponticelli, A. S., Sena, E. P., and Smith, G. R. (1988). Genetic and
physical analysis of the M26 recombination hot spot of
Schizosaccharomyces pombe. Genetics, 119, 491-492.

Schuchert, P., and Kohli, J. (1988). The adeG-M26 mutation of
Schizosaccharomyces pombe increases the frequency of crossing over.
Genetics, 1 1 9, 507-51 5.

Szankas, P., Heyer, W. P., Schuchert, P., and Kohli, J. (1988). DNA
sequence analysis of the ade6 gene of Schizosaccharomyces pombe:

Wild-type and mutant alleles including the recombination hot spot allele
adeG-M26. J. Mol. Biol, 204, 917-925.

Markham, P., and Whitehouse, H. L. K. (1982). A hypothesis for initiation
of genetic recombination in eukaryotes. Nature, 295, 421-423.

Grimm, C., Bahler, J., and Kohli, J. (1994). M26 recombinational hotspot
and physical conversion tract analysis in the adeG gene of
Schizosaccharomyces pombe. Genetics, 136, 41-51.

Ponticelli, A. S., and Smith, G. R. (1992). Chromosomal context
dependence of a eukaryotic recombinational hot spot. PNAS, USA, 89,
227-231.

Virgin, J. B., Metzger, J., and Smith, G. R. (1995). Active and inactive
transplacement of the M26 recombination hot spot in
Schizosaccharomyces pombe. Genetics, 141, 33-48.

Schuchert, P., Langsford, M., Kaeslin, E., and Kohli, J. (1991). A specific
DNA sequence is required for high frequency of recombination in the ade6
gene of fission yeast. EMBO J., 10, 2157-2163.

Wahls, W. P., and Smith, G. R. (1994). A heteromeric protein that binds
to a meiotic homologous recombination hot spot: Correlation of binding
and hot spot activity. Genes Dev., 8, 1693-1702.

Mizuno, K., Yukihiro, E., Baur, M., Kohli, J., Ohta, K., and Shibata, T.
(1997). The meiotic recombination hot spot created by the single-base

55.

56.

57.

58.

59.

60.

61.

62.

63.

33

substitution ade6-M26 results in remodeling of chromatin structure in
fission yeast. Genes Dev., 11, 876-886.

Ohta, K., Shibata, T., and Nicolas, A. (1994). Changes in chromatin
structure at recombination initiation sites during yeast meiosis. EMBO J.,
13, 5754-5763.

Zahn-Zabal, M., Lehmann, E., and Kohli, J. (1995). Hot spots of
recombination in fission yeast: Inactivation of the M26 hot spot by deletion
of the ade6 promoter and the novel hotspot ura4-aim. Genetics, 140, 469-
478.

MacDonald, M. V., and Whitehouse, H. L. K. (1979). A but? spore colour
mutant in Sordaria brevicollis showing a high-frequency conversion. I.
Characteristics of the mutant. Genet. Res, 34, 87-119.

Keil, R. L., and Roeder, G. S. (1984). Cis-Acting, recombination-
stimulating activity in a fragment of ribosomal DNA of S. cereviciea. Cell,
39, 377-386.

Stewart, S. E., and Roeder, G. S. (1989). Transcription by RNA
polymerase I stimulates mitotic recombination in Saccharomyces
cereviciae. Mol. Cell. Biol, 9, 3464-3472,

Voelkel-Meiman, K., Keil, R. L., and Roeder, G. S. (1987).
Recombination-stimulating sequences in yeast ribosomal DNA correspond
to sequences regulating transcription by RNA polymerase I. Cell, 48,
1071-1079.

Tooze, J. DNA Tumor Viruses, 2"d ed. (1980). Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York.

Schaffhausen, B. S., and Benjamin, T. L. (1976). Deficiency in histone
acetylation in nontransforrning host range mutants of polyoma virus.
PNAS, USA, 73, 1092-1096.

Treisman, R., Cowie, A. C., Favaloro, J., Jat, P., and Kamen, R. (1981).
The structures of the spliced mRNAs encoding polyoma virus early region
proteins. J. Mol. Appl. Genet, 1, 83-92.

Soeda, E., Arrand, J. R., Smolar, N., Walsh, J. E., and Griffin, B. E.
(1980). Coding potential and regulatory signals of the polyoma virus
genome. Nature, 283, 445-453.

65.

66.

67.

68.

69.

70.

71.

72.

73.

74.

75.

34

Murakami, Y., Wobbe, C. R., Weissbach, L., Dean, F. B., and Hurwitz, J.
(1986). Role of DNA polymerase a and DNA primase in simian virus 40

DNA replication in vitro. PNAS, USA, 83, 2869-2873.

Murakami, Y., Eki, T., Yamad, M. —A., Prives, C., and Hurwitz, J. (1986).
Species-specific in vitro synthesis of DNA containing the polyoma virus
origin of replication. PNAS, USA, 83, 6347-6351.

Smale, S. T., and Tjian, R. (1986). T-antigen-DNA polymerase a

complex implicated in simian virus 40 DNA replication. Mol. Cell. Biol, 6,
4077-4087.

Hacker, D. L., and Fluck, M. M. (1989). Viral DNA synthesis in
nonpermissive rat F-111 cells and its role in neoplastic transformation by
polyomavirus. Mol. Cell. Biol, 9, 648-658.

Tooze, J. (1973). Transformation by polyoma and SV40. In The
Molecular Biology of Tumor Vimses, pp. 350-402. Cold Spring Harbor
Laboratory, Cold Spring Harbor, New York.

Birg, F., Dulbecco, R., Fried, M., and Kamen, R. (1979). State and
organization of polyoma virus sequences in transformed rat cell lines. J.
Virology, 29, 633-648. '

Basilico, C., Zouzias, D., Della-Valle, G., Gattoni, S., Colantouni, V.,
Fenton, R., and Dailey, L. (1980). Integration and excision of polyoma
virus genomes. Cold Spring Harbor Symp. Quant. Biol, 44, 611-620.

Basilico, C., Gattoni, S., Zouzias, D., and Della-Valle, G. (1979). Loss of
integrated viral DNA sequences in polyoma-transformed cells is
associated with active viral A function. Cell, 17, 645-659.

Gattoni, S., Colantouni, V., and Basilico, C. (1980). Relationship between
integrated and nonintegrated viral DNA in rat cells transformed by
polyoma virus. J. Virology, 34, 615-626.

Colantouni, V., Dailey, L., and Basilico, C. (1980). Amplification of
integrated viral DNA sequences in polyoma virus-transformed cells.
PNAS, USA, 77, 3850-3854.

Lania, L., Griffiths, M., Cooke, B., Ito, Y., and Fried, M. (1979).
Untransforrned rat cells containing free and integrated DNA of polyoma
nontransfonning Hr-t mutant. Cell, 18, 793-802.

76.

77.

78.

79.

80.

81.

82.

83.

84.

85.

86.

87.

35

Lania, L., Gandini-Attardi, D., Griffiths, M., Cooke, B., DeCicco, D., and
Fried, M. (1980). The polyoma virus 100 K large T-antigen is not required
for the maintenance in transformation. Virology, 101, 217-232.

Botchan, M., TopP. W., and Sambrook, J. (1976). The arrangement of
simian virus 40 seqeunces in the DNA of transformed cells. Cell, 9, 269-
287.

Stringer, J. (1981). Integrated simian virus 40 DNA: nucleotide
sequences at cell-virus recombinant junctions. J. Virology, 38, 671-679.

Heyday, A., Ruley, H. E., and Fried, M. (1982). Structural and biological
analysis of integrated polyoma virus DNA and its adjacent host sequences
cloned from transformed rat cells. J. Virology. 44, 67-77.

Stringer, J. (1982). DNA sequence homology and chromosomal déletion
at a site of SV40 DNA integration. Nature, 296, 363-366.

Ruley, H. E., and Fried, M. (1983). Clustered illegitimate recombination
events in mammalian cells involving very short sequence homologies.
Nature, 304, 181-184.

Maruyama, K., and Oda, K. (1984). Two types of deletion within
integrated viral sequences mediate reversion of SV40-transformed mouse
cells. J. Virology. 49, 479-489.

Bullock, P., Forrester, W., and Botchan, M. (1984). DNA sequence
studies of simian virus 40 chromosomal excision and integration in rat
cells. J. Mol. Biol, 174, 55-84.

Savageau, M. A., Metter, R., and Brockman, W. W. (1983). Statistical
significance of partial base-pairing potential: implications for recombination
of SV40 DNA in eukaryotic cells. Nucleic Acids Res, 11, 6559-6570.

Williams, T. J., and Fried, M. (1986). Inverted duplication-transposition
event in mammalian cells at an illegitimate recombination join. Mol. Cell.
Biol, 6, 2179-2184.

Allard, D., Debicchi, L., Bourgaux-Ramoisy, D., and Bourgaux, P. (1988).
Major rearrangement of cellular DNA in the vicinity of integrated
polyomavirus DNA. Virology, 102, 128-136.

Mounts, P., and Kelly, T. J. (1984). Rearrangements of host and viral
DNA in mouse cells transformed by simian virus 40. J. Mol. Biol, 177,
431-460.

88.

89.

90.

91.

92.

93.

94.

95.

96.

97.

98.

99.

36

Botchan, M., Stringer, J., Mitchison, T., and Sambrook, J. (1980).
Integration and excision of SV40 DNA from the chromosome of a
transformed cell. Cell, 20, 143-152.

Syu, L. —J., and Fluck, M. M. (1997). Site-specific in situ amplification of
the integrated polyomavirus genome: A case for context-specific over-
replication model of gene amplification. J. Mol. Biol, 271, 76-99.

Stoker, M. (1968). Abortive transformation by polyoma virus. Nature,
218, 234-238.

Farrnerie, W. G., and Folk, W. R. (1984). Regulation of polyoma virus
transcription by large tumor antigen. PNAS, USA, 81, 6919-6923.

Myers, r. M., Rio, D. C., Robbins, A. K., and Tjian, R. (1981). SV40 gene
expression is modulated by the cooperative binding of T antigen to DNA.
Cell, 25, 373-384.

Rio, 0., Robbins, A., Myers, R., and Tjian, R. (1980). Regulation of SV40
early transcription in vitro by a purified tumor antigen. PNAS, USA, 77,
5706-571 0.

Brady, J., and Khoury, G. ( 1985). Trans-activation of the simian virus 40
late transcription unit by T-antigen. Mol. Cell. Biol, 5, 1391-1399.

Keller, J. M., and Alwine, J. C. (1985). Analysis of an activatible
promoter: sequences in the simian virus 40 late promoter required for T-
antigen-mediated transactivation. Mol Cell. Biol, 5, 1854-1869.

Shirodkar, S., Ewen, M., DeCaprio, J. A., Morgan, J., Livingston, D. M.,
and Chittenden, T. (1992). The transcription factor E2F interacts with the
retinoblastoma product and a p107-cyclin A complex in a cell cycle-
regulated manner. Cell, 68, 157-166.

Chellappan, S., Hiebert, S., Mudryi. M., Horowitz, J. M., and Nevins, J. R.
(1991). The E2F transcription factor is a cellular target for the RB protein.
Cell, 65, 1053-1061.

Bagchi, S., Weinmann, R., and Raychauhuri, P. (1991). The
retinoblastoma protein co-purifies with E2F-1, an E1A-regulated inhibitor
of the transcription factor E2F. Cell, 65, 1063-1072.

Chittenden, T., Livingston, D. M., and Kaelin, W. G. (1991). The TIE1A-
binding domain of the retinoblastoma product can interact selectively with
a sequence-specific DNA-binding protein. Cell, 65, 1073-1082.

100.

101.

102.

103.

104.

105.

106.

107.

108.

109.

110.

37

Chellappan, S., Kraus, V. 8., Kroger, 8., Munger, K., Howley, P. M.,
phelps, W. C., and Nevins, J. R. (1992). Adenovirus E1A, simian virus 40
tumor antigen, and human papillomavirus E7 protein share the capacity to
disrupt the interaction between transcription factor E2F and the
retinoblastoma gene product. PNAS, USA, 89, 4549-4553.

Matter, J. M., Tiercy, J. M., and Well, R. (1983). Sequential stimulation of
cellular RNA synthesis in polyoma-infected mouse kidney cell cultures.
Nucleic Acids Res, 11, 6612-6629.

Zullo, J., Stiles, C. D., and Garcea, R. L. (1987). Regulation of c-myc
and c-fos mRNA levels by polyomavirus: distinct roles for the capsid
protein VP1 and the viral early proteins. PNAS, USA, 84, 1210-1214.

Glenn, G. M., and Eckhart, W. (1990). Transcriptional regulation of early-
response genes during polyomavirus infection. J. Virology, 64, 2193-
2201.

Griffin, 8. E., and Dilworth, S. M. (1983). Polyomavirus: an overview of its
unique properties. Adv. Cancer Res, 39, 183-268.

Stahl, H., Droge, P., and Knippers, R. (1986). DNA helicase activity of
SV40 large tumor antigen. EMBO J., 5, 1939-1944.

Dean, F. 8., Bullock, P., Murakami, Y., Wobbe, C. R., Weissbach, L., and
Hurwitz, J. (1987). Simian virus 40 (SV40) DNA replication: SV40 large T
antigen unwinds DNA containing the SV40 origin of replication. PNAS,
USA, 84, 16-20.

Parsons, R. E., Stenger, J. E., Ray, 8., Welker, R., Anderson, M. E., and
Tegtmeyer, P. (1991). Cooperative assembly of simian virus 40 T-
antigen hexamers on functional halves of the replication origin. J.
Virology, 65, 2798-2806.

Borowiec, J. A., Dean, F. 8., Bullock, P. A., and Hurwitz, J. (1990).
Binding and unwinding - How T antigen engages the SV40 origin of DNA
replication. Cell, 60, 181-184.

Fairman, M. P., and Stillman, 8. (1988). Cellular factors required for
multiple stages of SV40 DNA replication in vitro. EMBO J., 7, 1211-1218.

Wold, M. S., Weinberg, D. H., Virshup, D. M., Li, J. J., and Kelly, T. J.
(1989). Identification of cellular proteins required for simian virus 40 DNA
replication. J. Biol. Chem, 264, 2801-2809.

111.

112.

113.

114.

115.

116.

117.

118.

119.

120.

121.

122.

38

Bullock, P. A., Sec, Y. S., and Hurwitz, J. (1989). Initiation of simian virus
40 replication in vitro: pulse-chase experiments identify the first labeled
species as topologically unwound. PNAS, USA, 86, 3944-3948.

Kenny, M. K., Lee, S., and Hurwitz, J. (1989). Multiple functions of
human single-stranded DNA binding protein in simian virus 40 DNA
replication: single-strand stabilization and stimulation of DNA polymerases
alpha and delta. PNAS, USA, 86, 9757-9761.

Domreiter, l., Erdile, L. F., Gilbert, I. U., Von Winkler, D., Kelly, T. J., and
Fanning, E. (1992). Interaction of DNA polymerase a-primase with
cellular replication protein A and SV40 T antigen. EMBO J., 1 1, 769-776.

F luck, M. M., and Benjamin, T. L. (1979). Comparisons of two early gene
functions essential for transformation in polyoma virus and SV40.
Virology, 96, 205-228.

FRIED 65

Stoker, M., and Dulbecco, R. (1969). Abortive transformation by the ts-a
mutant of polyoma virus. Nature, 223, 397-398.

Della-Valle, G., Fenton, R. G., and Basilico, C. (1981). Polyoma large T
antigen regulates the integration of viral DNA sequences into the genome
of transformed cells. Cell, 23, 347-355.

Treisman, R., Novak, U., Favaloro, J., and Kamen, R. (1981).
Transformation of rat cells by an altered polyoma virus genome
expressing only the middle-T protein. Nature, 292, 595-600.

Ito, Y., Spurr, N., and Griffin, 8. E. (1980). Middle T antigen as primary
inducer of full expression of the phenotype of transformation by
polyomavirus. J. Virology. 35, 219-232.

Schaffhausen, 8. S. (1982). Transforming genes and gene products of
polyoma and SV40. CRC Crit. Rev. Biochem, 13, 215-269.

Bolen, S. 8., Thiele, C. J., Israel, M. A., Yonemoto, W., Lipsich, L. A., and
Brugge, J. S. (1984). Enhancement of cellular src gene product
associated tyrosine kinase activity following polyoma virus infection and
transformation. Cell, 38, 767-777.

Courneidge, S. A. (1985). Activation of the pp60°"’° kinase by middle T
antigen binding or by dephosphorylation. EMBO J., 4, 1471-1477.

123.

124.

125.

126.

127.

128.

129.

130.

131.

132.

133.

39

Pelicci, G., Lanfrancone, L., Grgnani, F., McGlade, J., Cavallo, F., Forni,
G., Nicoletti, l., Pawson, T., and Pelicci, P. G. (1992). A novel
transforming protein (Shc) with an SH2 domain is implicated in mitogenic
signal transduction. Cell, 70, 93-104.

Dilworth, S. M., Brewster, C. E. P., Jones, M. D., Lanfrancone, L., Pelicci,
G., and Pelicci, P. G. (1994). Transformation by polyoma virus middle T

antigen involves the binding and tyrosine phosphorylation of She. Nature,
367, 87-90.

Rozakis-Adcock, M., Fernley, R., Wade, J., Pawson, T., and Bowtell, D.
(1993). The SH2 and 8H3 domains of mammalian Grb2 couple the EGF
receptor to the Ras activator mSos1. Nature, 363, 83-85.

Bunday, L., and Downward, J. (1993). Epidermal growth factor regulates
p21"as through the formation of a complex of receptor, Grb2, adapter
protein, and $05 nucleotide exchange factor. Cell, 73, 611-620.

Li, N., Batzer, A., Daly, R., Yajnik, V., Skolnik, E., Chardin, P., Barsagi, D.,
Margolis, 8., and Schlessinger, J. (1993). Guanine-nucleotide-releasing
factor hSos1 binds to Grb2 and links receptor tyrosine kinases to Ras
signaling. Nature, 363, 85-87.

Broach, J. R. (1991). RAS genes in Saccharomyces cerevisiae: signal
transduction in search of a pathway. Trends Genet, 7, 28-33.

Jones, 8., Vignais, M. L., and Broach, J. R. (1991). The CD025 protein
of Saccharomyces cereviciea promotes exchange of guanine nucleotide
bound to res. Mol. Cell. Biol, 11, 2641-2646.

Morrison, D. K., Kaplan, D. R., Rapp, U., and Roberts, T. M. (1988).
Signal transduction from membrane to cytoplasm: growth factors and
membrane-bound oncogene products increase c-raf phosphorylation and
associated protein kinase activity. PNAS, USA, 85, 8855-8859.

Gorga, F. R., Riney, C. E., and Benjamin, T. L. (1990). lnositol
trlsphosphate levels in cells expressing wild-type and mutant polyomavirus
middle T antigens: evidence for activation of phospholipase C via
activation of pp60°""". J. Virology, 64, 105-112.

Nishizuka, Y. (1984). The role of protein kinase C in surface signal
transduction and tumor promotion. Nature, 308, 693-698.

Wasylyk, C., lmler, J. L., and Wasylyk, 8. (1988). Transforming but not
immortalizing oncogenes activate the transcription factor PEA1. EMBO J.,
7, 2475-2483.

134.

135.

136.

137.

138.

139.

140.

141.

142.

143.

144.

145.

40

Wasylyk, C., Flores, P., Gutman, A., and Wasylyk, B. (1989). PEA3 is a
nuclear target for transcription activation by non-nuclear oncogenes.
EMBO J., 8, 3371-3378.

Schonthal, A., Srinivas, S., and Eckhart, W. (1992). Induction of c-jun
protooncogene expression and transcription factor AP-1 activity by the
polyoma virus middle-sized tumor antigen. PNAS, USA, 89, 4972-4976.

Irvine, R. F., Moor, R. M., Pollock, W. K., Smith, P. M., and Wreggett, K.
A. (1988). lnositol phosphates: proliferation, metabolism and function.
Philos. Trans. R. Soc. London 8., 320, 281-298.

Hughes, D. A., Ashworth, A., and Marshall, C. (1993). Complementation
of byr1 in fission yeast by mammalian MAP kinase kinase requires
coexpression of Raf kinase. Nature, 364, 349-352.

Crews, C. M., Alessandrini, A., and Erikson, R. L. (1992). The primary
structure of MEK, a protein kinase that phosphorylates the ERK gene
product. Science, 258, 478-480.

Errede, 8., and Levin, D. E. (1993). A conserved kinase cascade for
MAP kinase activation in yeast. Curr. Opin. Cell. Biol, 5, 254-260.

Gutman, A., and Wasylyk, B. (1991). Nuclear targets for transcription
regulation by oncogenes. Trends Genet, 7, 49-54.

Hunter, T., and Karin, M. (1992). The regulation of transcription by
phosphorylation. Cell, 70, 375-387.

Whitman, M., Kaplan, D. R., Schaffhausen, 8. S., Cantly, L., and Roberts,
T. M. (1985). Association of phosphatidylinositol kinase activity with
polyoma middle-T competent for transformation. Nature, 315, 239-242.

Kaplan, D. R., Whitman, M., Schaffhausen, 8. S., Raptis, L., Garcea, D.,
Pallas, T. M., and Cantly, L. (1986). Phosphatidylinositol metabolism and
polyoma-mediated transformation. PNAS, USA, 83, 3624-3628.

Courtneidge, S. A., and Heber, A. (1987). An 81 kd protein complexed
with middle T-antigen and pp60°“’°: a possible phosphatidylinositol kinase.
Cell, 50, 1031-1037.

Pallas, D. C., Cherington, V., Morgan, W., DeAnda, J., Kaplan, 8.,
Schaffhausen, 8. S., and Roberts, T. M. (1988). Cellular proteins that
associate with the middle and small T antigens of polyomavirus. J.
Virology, 62, 3934-3940.

146.

147.

148.

149.

150.

151.

152.

153.

154.

155.

156.

41

Talmage, D. A., Freund, R., Young, A. T., Dahl, J., Dawe, C. J., and
Benjamin, T. L. (1989). Phosphorylation of middle T by pp60°“": a switch
for binding of phosphatidylinositol 3-kinase and optimal tumorigenesis.
Cell, 59, 55-65.

Ulung, E. T., Hawkins, P. T., Hanley, M. R., and Courtneidge, S. A.
(1990). Phosphatidylinositol metabolism in cells transformed by
polyomavirus middle T antigen. J. Virology. 64, 3895-3904.

Ling, L. E., Druker, B. J., Cantley, L. C., and Roberts, T. M. (1992).
Transfomiation-defective mutants of polyomavirus middle T antigen
associate with phosphatidylinositol 3-kinase (Pl 3-kinase) but are unable
to maintain wild-type levels of PI 3-kinase products in intact cells. J.
Virology, 66, 1702-1708.

Noda, T., Satake, M., Yamaguchi, Y., and Ito, Y. (1987). Cooperation of
middle and small T antigens of polyomavirus in transformation of
established cell lines. J. Virology. 61, 2253-2263.

Dubbs, D. R., Rachmeler, M., and Kit, S. (1974). Recombination between
temperature-sensitive mutants of simian virus 40. Virology, 57, 161-174.

lshikawa, l., and Di Mayorca, G. (1971). Recombination between two
temperature-sensitive mutants of polyoma virus.

Wake, C., and \MIson, J. H. (1979). Simian virus 40 recombinants are
produced at high frequency during infection with genetically mixed
oligomeric DNA. PNAS, USA, 76, 2876-2880.

Upcroft, P., Carter, 8., and Kidson, C. (1980). Analysis of recombination
in mammalian cells using SV40 genome segments having homologous
overlapping termini. Nucleic Acid Res, 8, 2725-2736.

Wake, C. T., and Wilson, J. H. (1980). Defined oligomeric SV40 DNA: a
sensitive probe of general recombination in somatic cells. Cell, 21, 141-
148.

Jasin, M., de \filliers, J., Weber, F., and Schaffer, W. (1985). High
frequency of homologous recombination in mammalian cells between
endogenous and introduced SV40 genomes. Cell, 43, 695-703.

Shaul, Y., Laub, 0., Walker, M. D., and Rutter, W. J. (1985).
Homologous recombination between a defective virus and a chromosomal
sequence in mammalian cells. PNAS, USA, 82, 3781-3784.

157.

158.

159.

160.

161.

162.

163.

164.

165.

166.

167.

42

Gluzman, Y., Kuff, E. L., and Winocour, E. (1977). Recombination
between endogenous and exogenous simian virus 40 genes. 1. Rescue
of a simian virus 40 temperature-sensitive mutant by passage in
permissive transformed monkey lines. J. Virology, 24, 534-540.

Vogel, T., Gluzman, Y., and Winocour, E. (1977). Recombination
between endogenous and exogenous simian virus 40 genes. ll.
Biochemical evidence for genetic exchange. J. Virology, 24, 541-550.

Vogel, T. (1980). Recombination between endogenous and exogenous
simian virus 40 genes. Ill. Rescue of SV40 tsA and tsBC mutants by
passage in permissive transformed monkey lines. Virology, 104, 73-83.

Dorsett, D., Deichaite, I., and Winocour, E. (1985). Circular and linear
simian virus 40 DNAs differ in recombination. Mol. Cell. Biol, 5, 869-
880. =

Rommerskirch, W., Graeber, I., Grassmann, M., and Grassmann, A.
(1988). Homologous recombination of SV40 DNA in 0087 cells occurs
with frequency in a gene dose independent fashion. Nucleic Acid Res,
16, 941-952.

St-Onge, L., Bouchard, L., Laurent, 8., and Bastin, M. (1990).
Intrachromosomal recombination mediated by papovavirus large T
antigens. J. Vim/091’. 64, 2958-2966.

St-Onge, L., and Bastin, M. (1993). Amplification mediated by
polyomavirus large T antigen defective in replication. J. VirologY. 67,
5025-5029.

St-Onge, L., Bouchard, L., and Bastin, M. (1993). High-frequency
recombination mediated by polyomavirus large T antigen defective in
replication. J. Virology. 67, 1788-1795.

Laurent, 8., and Bastin, M. (1995). Elements of the polyomavirus
replication origin required for homologous recombination mediated by
large T antigen. J. Virology. 69, 7304-7308.

Sylla, B. S., Huberdeau, D., Bourgaux-Ramoisy, D., and Bourgaux, P.
(1984). Site-specific excision of integrated polyoma DNA. Cell, 37, 661-
667.

Sylla, B. S., Allard, D., Roy, 6., Bourgaux-Ramoisy, D., and Bourgaux, P.
(1984). A mouse DNA sequence that mediates integration and excision of
polyoma virus DNA. Gene, 29, 343-350.

168.

169.

170.

171.

172.

173.

174.

175.

176.

177.

178.

43

Frappier, D., Gendrom, D., Bourgaux-Ramoisy, D., and Bourgaux, P.
( 1990). Alternative homologous and nonhomologous products arising
from intramolecular recombination. J. Virology. 64, 5058-5065.

Bourgaux, P., Gendrom, D., and Bourgaux-Ramoisy, D. (1990).
Preferred crossover sites on polyomavirus DNA. J. Virology, 64, 2327-
2336.

Bourgaux-Ramoisy, D., Gendron, D., and Bourgaux, P. (1995). A hotspot
for promoter-dependent recombination in polyomavirus DNA. J. Mol. Biol,
248, 220-224.

Nault, C., Veilleux, S., Delbecchi, L., Bourgaux-Ramoisy, D., and
Bourgaux, P. (1994). Intramolecular recombination in polyomavirus DNA
is controlled by promoter elements. Nucleic Acid Res, 22, 485-491.

Gendron, D., Delbecchi, L., Bourgaux-Ramoisy, D., and Bourgaux, P.
(1996). An enhancer of recombination in polyomavirus DNA. J. Virology,
70, 4748-4760.

Martelli, F., lacobini, C., Caruso, M., and Felsani, A. (1996).
Characterization of two novel YY1 binding sites in the polyomavirus late
promoter. J. Virology, 70, 1433-1438.

Hirano, T., and Iwakura, Y. (1990). A novel transcriptional regulatory
factor that binds to the polyoma virus enhancer in a developmental stage-
specific manner. Biochimie, 72, 327-336.

Shi, Y., Seto, Cheng, L-S., and Shenk, T. (1991). Transcriptional
repression by YY1, a human GLl-KruppeI-related protein, and relief of
repression by adenovirus E1A protein. Cell, 67, 377-388.

Shrivastava, A., and Calame, K. (1994). An analysis of genes regulated
by the multi-functional transcriptional regulator Yin Yang-1. Nucleic Acid
Res, 22, 5151-5155.

Wiesmuller, L., Cammenga, J., and Deppert, W. W. (1996). In vivo assay
of p53 function in homologous recombination between simian virus 40
chromosomes. J. Virology, 70, 737-744.

Mekeel, K. L., Tang, W., Kachnic, L. A., Luo, C-M., DeFrank, J. S., and
Powell, S. N. (1997). Inactivation of p53 results in high rates of
homologous recombination. Oncogene, 14, 1847-1857.

Chapter 2

Extreme frequencies of homologous genetic exchange between
polyomavirus chromatin in mitotically dividing cells

Abstract

In an attempt to map the frequencies of homologous recombination on the
polyomavirus genome, two variants containing novel, unique restriction
endonuclease sites were constructed in a temperature sensitive large T antigen
background. The viral genome was divided into eight intervals that could be
tested for homologous genetic exchange. Transformed cell lines from three
experiments were isolated and analyzed for recombination. The results show
that on the average there are 3.4 crossovers per integrated genome, with a low
of 2 and a high of 7 crossovers. We have confirmed that a high percentage of
transformants (19%) contain recombinant viral sequences. Although
maintenance of cells at the non-permissive temperatures dramatically reduced
the transformation frequency and viral DNA replication, the frequency of
recombination was not affected. Analysis of interviral recombination in free viral
genomes detected no recombinants. We conclude that the polyomavirus

chromatin undergoes numerous crossovers in allintervals. However, two

44

45

intervals, one in the early region and one in the late region, seem to have higher

numbers of crossovers.

46

Introduction

Because of its small size, defined chromatin structure, and almost total
reliance on the host cell machinery for gene expression and DNA replication,
polyomavirus (Py) has been used to study many cellular processes. Previous
work from this laboratory has investigated homologous recombination on the
polyomavirus genome during the process of integration of the viral genome and
neoplastic transformation of non-permissive rat cells. Integration is required for
the stable transformation of tissue culture cells and frequently the integrated
genome is in a head-to-tail tandem arrangement. Integration is a rare event and
appears to be the rate-limiting step for the process of transformation. Integration
seems to be random with respect to both viral and host sequences and occurs
through non-homologous recombination with the host sequences because the
junction sequences are not homologous. The current understanding implicates
LT-Ag in the initiation of the transformation phenotype. It is believed that LT-Ag's
role as a replication protein plays a role in initiation of integration (1).

Hacker and Fluck (2) have shown that a large fraction of transformants
(38%), isolated from co-infections of Fischer rat cells (FR3T3) by two
polyomavirus mutants contained recombinant viral genomes. In contrast to the

high level of recombination in integrated genomes, no recombination was

47

detected among the un-integrated viral genomes isolated from the same cells
that gave rise to recombinant transformants. In these and further studies by
Chen and Fluck (3) recombination frequencies along the polyomavirus genome
were analyzed. The fragment of the genome studied spanned from BamHI site
in the late region (nucleotide 4634) to nucleotide 1387 in the early region. These
experiments revealed a gradient of recombination in the region analyzed. The
recombination frequency per base pair increased forty-fold in an interval between
the enhancer-origin region and nucleotide 1387 in the early region. These
studies, however, were carried out using polyomavirus mutants that were not
isogenic and contained mutations that might have affected or selected for
recombination. Additionally, only about 40% of the genome was analyzed for
recombination.

The current study has sought to systematically analyze frequencies of
recombination on the polyomavirus genome by introducing unique, novel
restriction endonuclease sites. The genome has been divided into eight intervals
and recombination in all intervals was studied in a single cross. These variants
of polyomavirus were synthesized in the LT-Ag temperature sensitive (ts-a)
background. This has allowed for the test of a role'in recombination for the
replication function of LT-Ag.

The results show that there are on the average 3.4 crossovers per
integrated genome, from a low of 2 to a high of 7. This demonstrates that the
frequency of recombination is high in all intervals. Crossovers occur more

frequently in an interval in the early region and another in the late region. In

48

fourteen of the seventy-five (19%) transformed cell lines analyzed the viral
sequences contained recombinant intervals. This confirms previous results that
a large percentage of the transformed cell lines are recombinant. No
recombinants were detected among free viral genomes derived from the same
experiments. Because no differences in frequency of recombination were
observed between the permissive and non-permissive temperatures, it is
concluded that recombination was not contingent upon the replication function of

LT-Ag.

49

Material and Methods
Cell lines and cell culture

The non-permissive rat fibroblast cell line, FR3T3 (4), and the perinissive
mouse fibroblast cell line, NIH3T3 (5), were used. These cell lines were
maintained in 5% C02 at 37C in Dulbecco's modified Eagle's medium
supplemented with 10% (vlv) calf serum and penicillin-streptomycin. Cells were

passed every three days.
Viruses

Two new variants of polyomavirus wild-type A2 (WI'A2) (6) were created
using in vitro site-directed mutagenesis. Each was designed to have four novel
restriction endonuclease sites as well as the ts-a (temperature sensitive mutant
of LT-Ag) point mutation (Figure 1). For this purpose, the WTA2 genome was
scanned for sequences in which one point mutation would lead to creation of
novel restriction endonuclease sites. Only silent mutations were chosen.
Oligonucleotide primers encompassing the point mutations for the novel

restriction endonuclease sites and the ts-a mutation were incorporated with

50

Figure 1. Maps of the newly designed Py variants.

Panel A depicts the circular maps of each variant. The position of each unique
restriction endonuclease is indicated.

Panel 8 shows the oligonucleotides used for introduction of the unique restriction
endonuclease sites in each parent. The silent point mutations leading to the
introduction of new sites are highlighted. The ts-a mutation was introduced in

both parent 1 and parent 2.

 

0/5291
469

    

660’ g
, . ”thi ‘ \ ,

(1/5291
’1" 2 ‘

NruI/I
[X
g x 2800

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

B. Parent 1 Parent 2
Primer 1 Base Change Codon Change Nucleotide no. New RE
; 5'CCTTTGGTGCTCATACTACCAGC3' A+ C AGA + CGA 458 +481 BsplOéI
Z
a 5'GACAGGCCTAGCGGCCGCGC3' A" G GCA + GCG 229l+2315 Nod
33 5'CATCTGTCACTAGTCCCTGG3' A+T CTA —> CTT 3536+3555 SpeI
5'CCGTAAGGGTCGACACTTCAGC3' A"> C TCT -> TCC 4938+4959 SalI
Primer Base Change Codon Change Nucleotide no. New RE
2 5'GGAACACCAACTCGAGATGTGC3' C+ T ACC '> ACT 649 +670 XhoI
Z
gal 5'GTAACCGCGGCACCATTTCAG3' A-> G GCA -> GCG 1721 +1741 SacII
SE 5'CATCTGTCACTAGTCCCTGG3' T+C CGT + CGC 2791 *2811 NruI
5'CCTAGCTAGCCCATCCAGGAATG3' G-> C GGC ‘> GGG 4429 *4451 NheI
Parent 1 and Parent 2 2182 + 2205
S'CCAGTGTCTTTTAAAGGACTTTCC3' G +A ts—a mutation

 

 

 

 

 

 

51

 

52

WTA2 cloned into p8R322 at the EcoRI site as template. The Transformer Site-
Directed Mutagenesis kit (Clontech) was used. The presence of new restriction
sites was confirmed by restriction digestion analysis. Subsequently, the
recombinant plasmid was digested with EcoRI and electrophoresed to separate
the Py genome from p8R322. The fragment corresponding to Py was cut and
purified using Promega Wizard Prep Kits. The purified DNA was ligated and
transfected into NIH3T3 cells using a DEAE-Dextran transfection method. The
transfection lysates were used to grow large stocks of each variant. The stocks
were quantitated using plaque assays. Incorporation of the ts-a mutation was
confirmed by sequence analysis. Four clones of the recombinant plasmids,
derived from independent synthesis reactions were sequenced over a 500bp
region encompassing the ts-a mutation. No sequence variations were observed

over the total 2000 bps sequenced.

Infection and Isolation of transformed cells

FR3T3 cells were arrested in Go by growth to confluency and serum
deprivation for 48 hours. Cells were released from Go and were plated at a
density of 4x105 per 60-mm culture dish in media supplemented with 10% calf
serum (7). Cells were infected with a mixture of both parents at a ratio of 1:1.
The multiplicity of infection for each parent was 25 PFU per cell (total moi of 50
PFU per cell). Infections were carried out at 37°C for 45 min. Subsequently,

cells were fed with Dulbecco's modified Eagle medium supplemented with 5%

53

calf serum and penicillin-streptomycin. After the adsorption period, infected cells
were incubated at 39°C or 33°C. As indicated in the results section, to verify
equal input of each parent, total DNA was harvested 4 hours post infection. The
33°C populations were shifted to 39°C upon detection of microscopic transformed
foci to prevent post integration amplification of the viral genome. Transformed
cells which overgrew the monolayer were isolated and grown in 5% calf serum
supplemented Dulbecco's modified Eagle medium. Each cell line was passed as

necessary when confluency was reached (Figure 2).

Preparation and analysis of DNAs

For recombination analysis, approximately 4x107 cells were Iysed with
0.2% sodium dodecyl sulfate, 10 mM Tris hydrochloride (pH 7.5), and 10 mM
EDTA (2 ml per 100-mm culture dish). Total cellular DNA was extracted. For
recombination and mapping analysis, 10 ug of total DNA was digested with
diagnostic restriction endonucleases, used singly or in combination, that would
test all eight intervals. Digested DNAs were electrophoresed on agarose gels
(1%, w/v in Tris-borate/EDTA buffer). The DNA was denatured in gel in 0.5M
NaOH, 1.5M NaCI and transferred to Hybond-nylon membranes. Hybridization
was carried out in 5xSSPE (0.75 M NaCI, 50 mM NaHzPO4.H20, 5 mM EDTA),
5x Denhardt's solution, 0.5% (wlv) SDS at 65C for 48 hours, using labeled Py
genomic probes. The probes were labeled using a random multiprime DNA

labeling kit (Amersham Corp.) with [or-32 P]dCTP (3000 Cilmmol). The specific

54

Figure 2. Experimental design for isolation of transformed cells.

Two strategies were followed post infection. One set of infected cells was
maintained at 33°C, to allow for normal integration of the viral genome, and
shifted to 39°C when foci were observed. This prevented further amplification of
the integrated viral sequences as well as helped resolve previously amplified
sequences. Alternatively, cells were maintained at 39°C immediately post

infection in order to abolish large T replication function.

55

FR3T3 CELLS

l

CO-INFECT WITH PARENT1 AND PARENTZ

I l
INCUBATE AT INCUBATE AT
33°C 39°C
I
SHIFT TO 39°C
1

ISOLATE TRANSFORMED CELL LINES, EXPAND CLONAL POPULATIONS
AND HARVEST DNA FOR RECOMBINATION ANALYSIS

v56

activity of probes was in the range of 3x109 to 6x109 cpm/ug. Following
hybridization, the membranes were washed under stringent conditions and
autoradiographed and when appropriate quantitated using a beta-scanner

(Ambis).

Results

Comparison of the new variants and wild-type A2 properties

The point mutations used to introduce the new restriction sites were
designed to be silent mutations and were expected to have no phenotype. To
test this hypothesis, the newly constructed mutants were compared to wild type
A2 in a number of tests, at both 33°C and 39°C. In these tests, emphasis was
placed on the transformation ability of each virus. The ability to overgrow the
monolayer as well as growth in suspension media was tested. Virus production
and DNA replication assays were also performed. In all of the above

parameters, the mutants performed comparable to wild type A2 (Table 1).

Strategy for integration analysis

This analysis is composed of three parts. First digestion with Bglll

restriction endonuclease is performed. This enzyme does not recognize Py

sequences and is used to enumerate integration sites as well as the extent of

57

Table 1. Comparison of the new variants and wild type A2 properties.

The new variants were tested along with the wild type A2 to insure that they did
not exhibit different biological properties. Emphasis was placed on the
transformation ability of each variant compared to the wild type. Experiments
were performed in duplicate at the permissive temperature.

Panel A. The ability of each virus to transform cells was assayed as measured
by the number of foci which overgrew the monolayer.

Panel B. The ability of each virus to transform cells was assayed as measured
by the number of cells able to grow in suspension media.

Panel C. The potential to produce live virus particles was tested for each virus in

a plaque assay.

58

Focus Transformation Assay:

 

Polyoma Strain

Number of Foci (duplicate
plates)

 

 

 

 

Parent 1 18/15
Parent 2 12/16
M A2 20/19

 

 

Agar Transformation Assay:

 

Polyoma Strain

Number of Colonies (duplicate

 

 

 

 

 

plates)
Parent 1 30/35
Parent 2 37/40
M A2 45l47

 

Virus Replication Assay:

 

Polyoma Strain

Number of Plaques (duplicate

 

 

 

 

 

Plates)
Parent 1 4/8
Parent 2 3/8
WT A2 3/2

 

 

 

 

59

viral DNA amplification. A ladder pattern is often observed in the analysis of Bglll
digests. This regular banding pattern has been shown by Syu and Fluck (8) to
be the result of in situ amplification of the integrated genome at a single site
followed by resolution through recombination to yield tandem repeats. The
intensity of the ladder pattern indicates the degree of amplification and it is
believed to be dependent on the chromosomal context and reiteration of viral
sequences. The size of the smallest base band is used to determine the upper
limit of the size of the integrated Py sequences. The second step in this strategy
is single digestion with all eight of the new restriction endonucleases. This set of
digestions allows us to determine which parent has contributed the fragment
encompassing the restriction site. If the site is present only once, then the
integrated genome will be cut into two fragments representing the host-virus
joints. If there is reiteration of the viral sequences around those sites, then a
linear 5.3 Kbp fragment will be generated as well as host-virus joints. This
fragment, however, may also be generated when free circular viral DNA is
present. Finally the presence of recombinant intervals must be tested. This part
of the analysis involves double digestions with pair-wise combinations of the new
restriction endonucleases defining the recombinant intervals. If the integrated
viral genome is not a recombinant, and it has tandem repeats, it is expected that
a double digestion will yield a linear fragment of 5.3 Kbp and two fragments
representing the host-virus joints. If the integrated viral genome does not have a
reiteration encompassing the recognition sites of restriction endonuclease used

in the double digestion, then the expected pattern would be that of two host-virus

60

joints. If, however, a recombinant genome is integrated, a double digestion is
expected to yield two diagnostic fragments defined by the restriction
endonucleases used. If the integrated genome has tandem repeats, then a 5.3

Kbp fragment would also be generated.

Diagnostic tests for recombination

Transformants derived from the co-infection of FR3T3 cells with Py
variants were isolated and analyzed. Two strategies were followed. Cells were
maintained at 33°C until foci were detected, to allow normal integration of the
viral genome, and then shifted to 39°C to prevent further amplification and help
resolve previous amplification of the integrated viral genome (8). Alternatively,
cells were incubated at non-permissive conditions immediately following
infection. As stated later, inactivation of LT-Ag at the non-permissive
temperatures led to a profound decrease in the amount of viral DNA at 72-hours
post infection. Three separate experiments were performed (Table 2). In each
experiment a 4-hour post infection DNA sample was collected to ensure equal
input of both parents. This analysis involved double digestion with one of the
newly introduced restriction endonuclease enzymes and a wild-type single cutter.
Double digestion with NheI and Xbal was performed. Xbal linearizes both
parents whereas NheI only cuts parent 2. In parallel, Xbal and Bsp106l double
digestion was also performed. In this case parent 1 is cut with Bsp106l and

Xbal, whereas parent 2 is only cut with Xbal. When these samples are

61

Table 2. Summary of results from three independent crosses.

Three independent experiments were performed. In each experiment
transformed cell lines were isolated. The results are summarized in this table.
The number of transformants containing recombinant viral sequences is given

relative to the total number of transformants isolated in each experiment.

62

 

 

 

 

 

EXPERIMENT 33°C 39°C TOTAL
1 0/23 0/1 0 0/33
2 3/13 4/1 3 7/26
3 ND 7/16 7/16

 

 

 

 

 

63

electrophoresed side by side, direct quantitation of linear genome-sized parents
can be performed (Figure 3).

The diagnostic test for recombination in the transformed cell line used
double digests with restriction enzymes that define the eight intervals. This
tested for acquisition of a restriction site by either parent 1 or parent 2. Because
the restriction sites defining the Sall-Bsp106l or Xhol-Sacll reside on the same
parent, a combination of double digestions was used to define the events in the
above intervals. In ordér to test for recombination between Xhol and Sacll, the
following double digestions were performed: Bsp106l + Sacll, Xhol + Notl, Sacll
+ Notl. To test for recombination in the Sall-Bsp106l interval, NheI + Bsp106l,
Sall + Xhol and NheI + SaII double digestions were used. An example of a
double digestion analysis for 26 cell lines is shown in figure 4. This figure shows
the results for the test for recombination in the Bsp106l-Sacll interval. The
recombinant fragments are 4031 bp and 1260 bp and are marked by arrows. In
all cell lines a 5.3 Kbp band is also present suggesting the presence of additional
parental genomes. The variable intensity between different cell lines does not
reflect unequal loading (as confirmed by ethidium bromide staining). Table 3
presents the results of the double digestion analyses, which are further
summarized in table 4. It should be noted that this represents an under-
estimation of the recombination events, as only acquisitions of new sites were
tested. It is likely that the reciprocal events that lead to the loss of both restriction

sites are also occurring.

Figure 3. Analysis of the 4-hour post infection DNA samples

To insure equal ratio of each parent for the recombination crosses, 4-hour post
infection total DNA samples were harvested and analyzed in duplicate. Samples
were in duplicates for the three temperatures. Lane 1 represents undigested
DNA, lane 2 is the Xbal + NheI (a combination which linearizes parent 1 to 5.3
Kb) digest, and lane 3 is the Xbal + Bsp106l digest (a combination which

linearizes parent 2). The 5.3 Kb bands are compared.

65

 

66

Figure 4. Recombination analysis for the Bsp106l-Sacll interval.

The analyses for 26 cell lines are presented here. The cell lines were obtained
from the second experiment. For each cell line 10 pg of DNA was digested with
Bsp106l + Sacll under conditions specified by the manufacturer. The
recombinant bands of 4 Kb and 1.2 Kb are marked by arrows. Cell lines

containing these fragments are marked by "*."

 

—3 Cell Lines —9 Cell Lines

12 3 5 e 7 1017 18222325263 4 s 7 6 8‘ 91041525272829

5.3 Kb >

4Kb>

1.2 Kb >

 

67

 

 

 

68

Table 3. Summary of the double digestion analyses for all recombinant cell

lines.

The data for the double digestion with the diagnostic restriction endonucleases is
summarized in this table. "+I+" signs indicate the presence of the large or the

small intervals defined by the novel restriction endonucleases, respectively.

 

Fragment Xhol/BsplO6I Bsp106l/Sacll Sacll/Noll NotI/Nrul NTuI/Spel SpeI/Nhel NheI/Sell NheI/Bsp106l XhoI/NOLI SalI/XhoI

 

Size(bp) 5097bp/l94bp 403lbp/1260bp 4712bp/579bp 4799bp/492bp 4545bpf746bp 4399bp/829bp 4781bp/510bp 3969bp/1322bp 3646bp/1645bp 4285bp/1006bp

Cell line
10‘3 +/+
18-3
25-3
1-9

8-9

 

69

 

 

70

Table 4. Summary of recombinant intervals.

The number of transformants containing at least one crossover in a particular
recombinant interval relative to the total number of recombinant transformants is

summarized in this table.

7]

 

 

 

 

 

 

 

 

 

 

 

 

Interval Size (bp) No. of Events
Bsp1 06lthoI 1 94 0/14
Xhol/Sacll 1066 13/14
Sacl l/Notl 579 4/14
Notl/Nrul 492 1/14
Nrul/Spel 746 4/14
Spel/Nhel 892 2/14
NheI/Sell 510 7/14
Sell/Bsp106l 812 6/14

 

 

72

Further mapping analysis of recombinant genomes

To inquire whether recombination events all occurred within a Py genome
integrated at a single site, a restriction endonuclease that does not cut Py was
used. When Bglll digest is electrophoresed on high-resolution agarose gels
(0.4% in Tris-acetate EDTA buffer) the number integration sites can be
determined (Figure 5). From the pattern of Bglll digests it is concluded that all of
the recombinant cell lines analyzed in this study contain a single integration site.
The Bglll patterns also confirm the variability in the degree of in situ amplification
of the resident viral genome. This is deduced from the intensity of the ladder
pattern and the free circular genome band.

To further map the integrated genome, single digestions with all eight
unique enzymes were carried out. This analysis determined what restriction sites
were present in the integrated genome as well as the extent of genome

contribution from each parent. These results are summarized in table 5.
Construction of maps of the recombinant genomes

A single solution that satisfies the data from the above-described analyses
was found for each recombinant genome. These are presented as maps of the
integrated recombinant genomes (Figure 6). Statistical analysis of the number of
crossovers per interval was performed using the G-square statistics (9).

Assuming that the observed numbers of crossovers are not significantly different

73

Figure 5. Bglll analysis of thirteen cell lines.

Bglll analysis of thirteen cell lines derived from the second experiment is
presented. The position of the relaxed circular viral genome (form II) is indicated.
This analysis determines the upper limit for the size of the viral sequences in
each cell line. No variation in the Bglll patterns were observed among

recombinant or non-recombinant cell lines.

 

 

 

 

75

Table 5. Summary of the single digestion analysis.

The results for the single digestions with all eight unique restriction
endonucleases are presented here. The generation of a genome-sized 5.3 Kb

band is monitored.

76

 

+

+

+

+

E; _

 

+

+

+

+

Era

 

Ere

 

Ere

 

+++++

++++

+++

+++++

arm

 

+++

+++

+++

+++

arm

 

EA

 

mrnm

 

+

++

mic _

 

 

+++++

a;

 

++++++

++++++

mrmm

 

+++

Mrfi

 

+

+

++++++

+

++++++

+++

++++++++

mic—

 

85
=8

 

 

=mm

 

3:2

 

 

H32

 

:02

 

zoom

 

BAX

 

83mm

 

 

 

77

Figure 6. Maps of the integrated, recombinant viral sequences.

The maps of all cell line are aligned. The parental genomes are depicted on the
top. The sequence contribution for each parent is estimated and depicted. The
table summarizes the number of crossovers in each interval and a relative

number (normalized to unit length) is also given for each interval.

 

OI‘I Bsp106l Noll Spcl Sall Ori Bsp1061

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Parent] + e , 9
Parent 2 -I- ----- Ak-llglu-S-‘lSi-l-u 1211“] V 1811619 1 -
Number ofevents IO] 17 I 7 i 2 1 5 1 4 l 6 1 7 1
Frequency H 16 112 I 4 I 6.7 I 4.5 111.8] 8.6 |
‘1. 4
10—3 7 p 1 A i i I
a. . I “‘
18-3 7 ' ' '
4' .l
11. l '0‘.
25—3 ' E ' . i i i
19 ‘“ ' T I“
_ m % l 4: | i : : : 1
8—9 if 4', fi' ‘
m I. l IP WW I
109 ' r i ,
f l 4 1
$1. 'Hv
27-9 , r 1 4
i. i A I
11. 'Ku
III-l i i 1' '
k. If L W” I
III—2 k f ' a. 1
III—3 ' I i 1' l i J 1
f 4% I I
III-9 ”i i : r j . J
I. ‘ I I
11. I 'H-
III—ll i ' i '1 1
11‘ r 1K- I
III-6 * . i F J
“a If I #4” J
III—4 7 1 . b H
I I l 1,“

 

 

 

 

79

with respect to the mean and each other, the probability of what is observed is
0.056. In other words, the observed number of crossovers per interval are
significant with respect to the mean. This is especially true for the Xhol-Sacll
interval.

Detailed analyses for two cell lines are presented here as illustrations
(Figures 7 and 8). The cell line 1-9 was obtained from the second experiment
and was maintained at 39°C immediately post infection. The cell line 11-lIl was
obtained from the third experiment and also maintained at 39°C. The size of the
integrated viral sequence in the 1-9 cell line was determined to be less than 10
Kbp. The level of free circular viral DNA was moderate as determined by the
pattern of Bglll digest. Double digestion with Bsp106l + Sacll, Sacll + Notl, Notl +
Nrul, Nrul + Spel, Spel + NheI, NheI + SaII, NheI + Bsp106l, and Sell + Xhol
resulted in the generation of recombinant sized fragments. It was therefore
concluded that in this cell line recombination had occurred in the following
intervals: Bsp1061-Sacll, Sacll-Noll, Natl-Nrul, Nrul-Spel, Spel-NheI, NheI-Sail,
and Sail-Bsp106l. The integrated viral sequence in the 11-lll cell line was
estimated to be less than 11 Kbp. The level of free circular viral genomes was
moderate. The cell line 11-Ill recombination analysis showed recombinant
fragments only in double digestions with NheI + Sail, NheI + Bsp106l, and Sell +
Xhol. These results showed that Bsp106l-Sacll, NheI-Sail, and Sail-Bsp106l
intervals contained crossovers. The results of the single digestions confirmed

the above results. Maps of the integrated viral sequences were drawn using the

80

Figure 7. Detailed analysis of cell line 1-9.

The results of single and double digestions with the diagnostic restriction
endonucleases are presented. A linear map of the integrated viral sequences is

drawn and the recombinant intervals are shown.

81

 

 

 

 

 

 

 

 

 

 

 

 

 

8» :8
a; 32

8% Loam

a; 282

8.» Eez

new :26

new seam

new Ex

8x3 885 s35 swam

2x am 22 8m

I..__ ..... IiT|_r ...........

 

 

eoz

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

8> 82:22

mew Eagem

a; scammzeez

mew __em:eez

ES oezseem

a; Emzaz

a; 32:62

a; 82:38

8> 582838

oz ceases?

HEEDEOOOM “magn— QESOQ
0mm

cam Qmm
_ .._ ..... _ u I
to >

.2

82

Figure 8. Detailed analysis of cell line 11-Ill

The results of single and double digestions with the diagnostic restriction
endonucleases are presented. A linear map of the integrated viral sequences is

depicted and the recombinant intervals are marked.

83

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

oz 87592

a; 3533

a; Law new 62993?

new 32 we, EBB?

oz 3% oz 32:25

8> 32 oz ace—32

ez wez oz 32:62

we, seem oz 82508

8> seem. a; zcemzeoamm

8> E? oz Goings?

@326 30:5 mama BwEW EwaEEoooM Hmowa ofisoa
cam

Ex Em eez _ _ 82 8m _ am .
_ _
J rrrrrrrrrrrrrrrrrrrrrrr i ................................................... _ 1
.2
co .3

84

available data and keeping in mind that an integrated genome in a transformed

cell line must include a complete enhancer through early coding region.

Analysis of interviral recombination among unintegrated genomes

Recombinants could be formed prior to integration, at the same time as
integration or post integration. In the first case un-integrated recombinant
genomes may be detectable. To answer this question total DNA from FR3T3
cells coinfected with the parental Py variants, at permissive and non-permissive
temperatures, was isolated and analyzed for recombination. This was obtained
from the same experiments that led to high frequencies of recombination among
the transformed cell lines. At 72-hour post infection the level of viral genomes in
the 39°C samples were 1% of those of the 33°C samples. This was due to the
temperature sensitive mutation of LT-Ag, ts-a. The double digests with the
diagnostic restriction endonucleases showed no recombinant. This is, however,
limited by the level of detection of this system. In order to determine the level of
sensitivity of the hybridization technique, a reconstruction experiment was
performed. The limit of detection of a recombinant band of about 4000 bps was
established at 1% of the total DNA. An attempt to increase the detection
sensitivity using a PCR assay was thwarted by the artifactual generation of
recombinant fragments during the assay.

The level of recombination in total population samples was also analyzed.

This analysis was also negative for the presence of recombinant intervals. This

85

may be in part due to the variability in focus growth. That is, different
transformed foci appear at different times and therefore contribute differentially to
the total number of cells on a plate. Additionally, at 33°C the replication of input
parental genomes may have masked the presence of the recombinant genomes.
Analysis of recombination in permissive NIH3T3 cells at 33°C and 39°C.

did not show any recombination within our detection level.

Discussion

The genome of polyomavirus provides a useful substrate to study
homologous recombination in mitotically dividing cells. This is an ideal system
because the viral genome is packaged into chromatin and encodes a single
protein, large T antigen, that could potentially affect recombination. In this report
we have examined interviral recombination among the integrated genomes of
polyomavirus in transformants derived from mixed infections of nonpermissive
Fischer rat fibroblasts. The findings derived from the experiments are: (i) a high
percentage of transformants isolated contained recombinant viral sequences
(called recombinant transformants), (ii) the number of crossovers at each
integration site was high averaging 3.4 crossovers, (iii) number of crossover
events and the frequency of recombinant transformants did not depend on the

replication function of large T antigen, and (iv) no recombination was observed in

86

the pool of un-integrated viral genomes. These results confirm and extend
previous results which showed high frequencies of recombinant transformants.

In order to examine the role of large T antigen, temperature sensitive
mutants of large T antigen were used in our experiments. Co-infections were
carried out at both permissive and nonpermissive temperatures. The results
suggests that the dramatic decrease in the replication function of large T antigen
and transformation frequencies, at permissive and nonpermissive temperatures,
did not change the frequency with which recombinant transformants were
obtained or the frequency of crossover events in the integrated viral sequences.
These experiments do not eliminate the involvement of large T antigen in
recombination because residual functions of large T, other than its replication
function, may be important. It is conceivable that although the large T antigen
temperature sensitive mutant used in our experiments is incapable of supporting
significant viral DNA replication, it can bind at the origin and induce localized
melting of the double strand, thus providing a suitable substrate for homologous
recombination. Other reports have implicated functions of large T antigen, other
than its replication function, in homologous recombination (10-12).

Our experiments make a point about the generation of tandem repeats of
the integrated viral sequences. We have noted that most of the recombinant cell
lines contained tandem repeats of the viral sequences, from 1.2 genomes to
about 1.8 genomes. This has been observed in the integration patterns of both
SV40 and polyomavirus and was attributed to large T antigen mediated

replication of the viral sequences (13, 14). The integrated sequences in some of

87

the recombinant cell lines analyzed encompass large pieces of each parent.
These composites may have arisen from a reciprocal exchange between two
monomeric parents to yield a dimeric molecule which is subsequently integrated.
This suggests that homologous recombination, perhaps in addition to large T
mediated replication, plays a role in the formation of tandem repeats during
integration of polyomavirus genome. This conclusion is also supported by the
fact that such integrants arise both in the presence and absence of large T
replication function.

Recombination between the viral sequences could occur before,
concomitant with, or after integration. To address this question, pools of un-
integrated viral genomes were tested for the presence of recombinant intervals.
No recombinants were detected. Such results are consistent with the hypothesis
that recombination occurs either in concert with integration or post integration.
However, it should be noted that the limit of recombination may be below the
detection limit of our experiments. If the transformation frequency is at best 1%
of the total cells, recombination occurs, on the average, in 20% of these cells,
thus there is a maximum of 0.2% of cells supporting recombination events
between the viral sequences. This falls short of the established detection limits
of our experiments.

Integration of polyomavirus into pre-integrated viral sequences has been
shown (3). An interesting observation in this regard has been that those
recombinant cell lines with extensive amplification of the viral sequences did not

undergo higher than average crossovers. This suggests that once a final

recombinant pattern is established in each cell line, no further recombination
occurred within the time frame of the experiments.

The high frequency with which recombinant transformants were isolated
may be explained using two hypotheses. First is the possibility that the
experimental design of isolation of transformants selects for a subset of cells
which are recombination proficient. To the best of our knowledge such
phenomenon has not been documented. Furthermore, similar results have been
obtained with synchronized and non-synchronized cells (2, 3). This reduces the
probability that a fraction of cells in a particular phase of the cell cycle are more
recombination proficient. Alternatively, it is possible that recombination and
integration are interconnected. A recombination intermediate may provide a
more suitable substrate for integration. Furthermore, integration of the viral
sequences may occur preferentially in areas of the host genome which are more
prone to recombination activity.

We can envisage two models for the interaction of viral sequences leading
to genetic exchange. First, multiple crossover events between two parental viral
DNA molecules followed by resolution of these structures may have resulted in
the generation of the recombinant genomes. Second, the interaction may be
between more than two viral DNA molecules. This final point can be tested
experimentally in tri-parental crosses. It should be noted that these models are
not mutually exclusive in that multiple pathways may be involved in generation of

recombinant sequences.

89

We have noted a disparity in the percentage of recombinant transformants
obtained in the three experiments performed. This observation was also made
by Hacker and Fluck and Chen and Fluck. At the present time the factors that
may contribute to such disparity are not clear. We hypothesize that variations in
the multiplicity of infection among the experiments may account for some of the
observed differences. If, indeed, recombination occurs through interactions
between more than two parents, then it is conceivable that small variations in the
multiplicities of infection can change recombination frequencies. Expeiiments
are underway to test the dependence of both frequencies of recombination and
the number of genetic exchanges upon multiplicity of infection.

The most intriguing result of this study is the extremely high number of
crossovers in the integrated sequences of polyomavirus as well as the high
frequency of recombinant transformants. The significance of these results
become more apparent when compared to the reported rates of homologous
recombination In mitotically dividing cells which have been estimated to be
between 10‘8-10'°. We attribute the high number of exchanges to some property
of the viral genome or a viral protein. This may be either a specific sequence or
the chromatin structure of the viral genome or both. Interestingly, the
polyomavirus enhancer has been shown to induce chromatin accessibility, in a
cis-acting manner, when placed in the HPRT gene (15). This feature of the
enhancer may make the viral sequences more accessible to recombination
enzymes thus allowing for such high frequencies of recombination. It is also

noteworthy that the histories associated with the polyomavirus chromatin are

90

hyperacetylated relative to cellular histories (16). Acetylation of histones is an
important modulator of chromatin accessibility. In yeast, regions of chromatin
that are transcriptionally silent are hypoacetylated and also have lower
frequencies of homologous recombination (17). The potential for role of the viral
oncogene, middle T antigen, in recombination arises from observations that
frequencies of homologous recombination are higher than normal in transformed
cells. Inactivation of p53 (18, 19) and overexpression of fos (20) have been
implicated in such instances. Interestingly, middle T antigen has been implicated
in acetylation of the viral histories on the polyomavirus chromatin (16). in
addition there may be a classical hot spot of recombination on the polyomavirus
genome. Our experiments were designed to test this hypothesis. The viral
genome was divided into eight intervals and recombination in each interval was
tested. The eight intervals had variable crossover events and this variability was
determined to be statistically significant. The total number of crossovers in the
Xhol-Sacll interval was significant with respect to both the average number of
crossovers and the observed number of crossovers for each interval. This
interval may indeed be a hot spot for initiation of recombination events. That is, a
single event in this interval followed by the formation of a long heteroduplex
molecule and subsequent resolution and mismatch repair, or gene conversion,
can also result in generation of multiple crossover events. These hypotheses are
not mutually exclusive and can indeed work in concert and result in the high

frequencies of genetic exchange observed.

10.

91

List of References

Hassell, J. and Brinton, B. T. (1996). SV40 and polyomavirus DNA
replication. In DNA Replication in Eukaryotic Cells (de Paumphilis, M.,
ed). pp. 639-677, Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York.

Hacker, D., and Fluck, M. M. (1989). High-level recombination specific to
polyomavirus genomes targeted to the integration-transfonnation pathway.
Mol. Cell. Biol, 9, 995-1004.

Chen, H. -H., and Fluck, M. M. Unpublished data.

Seif, R., and Cuzin, F. (1977). Temperature-sensitive growth regulation
in one type of transformed rat cells induced by the tea mutant of polyoma
virus. J. Virology. 24, 721-728.

Jainchill, J. L., Aaronson, S. A., and Todaro, G. J. (1969). Murine
sarcoma and leukemia viruses: assay using clonal lines of contact-
inhibited mouse cells. J. Virology, 4, 549-553.

Griffin, 8. E., Fried, M. and Cowie, A. (1974). Polyoma DNA: a physical
map. PNAS, USA, 71, 2077-2081.

Chen, H. —H., and Fluck, M. M. (1993). Cell cycle control of
polyomavirus-induced transformation. J. Virology, 67, 1996-2005.

Syu, L. —J., and Fluck, M. M. (1997). Site-specific in situ amplification of
the integrated polyomavirus genome: a case for context-specific over-
replication model of gene amplification. J. Mol. Biol, 271, 76-99.

Wilks, S. S. (1938). The large-sample distribution of the likelihood ratio
for testing composite hypotheses. Ann. Math. Statist. 9, 60-62.

St-Onge, L., Bouchard, L., Laurent, 8., and Bastin, M. (1990).
Intrachromosomal recombination mediated by papovavirus large T
antigens. J. Virology, 64, 2958-2966.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

92

St-Onge, L., and Bastin, M. (1993). Amplification mediated by
polyomavirus large T antigen defective in replication. J. Virology, 67,
5025-5029.

St-Onge, L., Bouchard, L., and Bastin, M. (1993). High-frequency
recombination mediated by polyomavirus large T antigen defective in
replication. J. Virology, 67, 1788-1795.

Campo, M. 8., Cameron, l. R., and Rogers, M. E. (1978). Tandem
integration of complete and defective SV40 genomes in mouse-human
somatic cell hybrids. Cell, 15, 1411-1426.

Chia, W. C., and .Rigby, P. W. J. (1981). Fate of viral DNA in
nonpermissive cells infected with simian virus 40. PNAS, USA, 11, 6638-
6642.

Pikaart, M., Feng, J., and \filleponteau, B. (1992). The polyomavirus
enhancer activates chromatin accessibility on integration into the HPRT
gene. Mol. Cell. Biol, 12, 5785-5792.

Schaffhausen, B. S., and Benjamin, T. L. (1976). Deficiency in histone
acetylation in nontransforrning host range mutants of polyoma virus.‘
PNAS, USA, 73, 1092-1096.

Braunstein, M., Sobel, R. E., Allis, C. D., Turner, 8. M., and Breach, J. R.
(1996). Efficient transcriptional silencing in Saccharomyces cerevisiae
requires a heterochromatin histone acetylation pattern. Mol. Cell. Biol,
16, 4349-4356.

Wiesmuller, L., Cammenga, J., and Deppert, W. W. (1996). In vivo assay
of p53 function in homologous recombination between simian virus 40
chromosomes. J. Virology, 70, 737-744.

Mekeel, K. L., Tang, W., Kachnic, L. A., Luo, C-M., DeFrank, J. S., and
Powell, S. N. (1997). Inactivation of p53 results in high rates of
homologous recombination. Oncogene, 14, 1847-1857.

Van den Berg, 8., Rahmsdorf, H. J., Herrlich, P., and Kaina, B. (1993).
Overexpression of c-fos increases recombination frequency in human
osteosarcoma cells. Carcinogenesis, 14, 925-928.