EQ IIHMIWUNNHIW“IRWIN“WINlhllmimil

   

THS_

IllllllllllllllllllllllNIHll‘lllllllllllllllllllllllllll

3 1293 01770 49

This is to certify that the
thesis entitled

OCCURRENCE, DISTRIBUTION AND MANAGEMENT OF
HETERODERA SCHACHTII IN MICHIGAN: WITH SPECIAL
REFERENCE TO PASTEURIA AS A BIOLOGICAL CONTROL AGENT

 

presented by

Angela M. Miller

has been accepted towards fulfillment
of the requirements for

M.S. Entomology/Nematology

degree in

 

 

Major professor

0-7639 MS U is an Affirmative Action/Equal Opportunity Institution

 

LIBRARY

Michigan State
University

 

 

 

 

PLACE IN REI‘URN BOX to remove this checkout from your record.
TO AVOID FINE-3 return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

ma comm-mu

OCCURRENCE, DISTRIBUTION AND MANAGEMENT OF HE IERODERA
SCHACH 771 IN MICHIGAN: WITH SPECIAL REFERENCE TO PAS 7E URIA AS A
BIOLOGICAL CONTROL AGENT.

By

Angela May Miller

A THESIS

Submitted to
Michigan State University
in partial fiilfillment of the requirements
for the degree of

MASTER OF SCIENCE

Department of Entomology

1 999

ABSTRACT

Heterodera schachtii Schmidt, 1871 (Nemata) is one of the most important plant-
parasitic nematodes affecting sugarbeet production in Michigan. It is responsible for
reducing both sugar content and crop yield. This Master of Science Degree thesis
consists of the following three components: 1) A survey for the detection of H. schachtii
in Michigan sugarbeet producing areas. The project was done in collaboration with
Monitor and Michigan Sugar Companies. The 1998 survey resulted in the confirmed
detection of H. schachtii in six Michigan counties. 2) A nematicide trial was used to
evaluate the efficacy of two non-fumigant, one fumigant, and one bio-nematicide for the
control of H. schachtii. The data suggest that there is a potential for DiTeraO, and
Vapam’ to provide effective control of H. schachtr‘i; however, with only one year of data,
it was not possible to add any new nematode management recommendations to those
currently used in Michigan sugarbeet production. 3) The bacterial parasite of plant-
parasitic nematodes, Pasteuria, was identified as a potential biological control agent.
Research was done to provide a genomic basis for the relationship of species designated
in the genus Pasteuria, and for comparison of Pasteuria to other genera of bacteria. The
genomic research was inconclusive. Additional work is needed to access the molecular

taxonomy of Pasteuria.

DEDICATION
With love and respect
and thanks for all her encouragement
I would like to dedicate
my thesis
to my mother and friend

Deborah I. Miller

111

ACKNOWLEDGEMENTS

I would like to acknowledge my guidance committee, Dr. Elder Paul, Dr. George
Garrity, and Dr. Haddish Melakeberhan for their time and interest in my education. I
express my gratitude to all the members of my committee for donating their expertise and
advice to help me fiirther my education in the field of science.

I would also like to thank Dr. Garrity and Dr. Denise Searles for their help in the
microbiology aspect of my project. I greatly appreciate all of the time and input they gave
me throughout my experience as a graduate student. I would especially like to thank Dr.
Searles for all of the time and effort she put into helping me with my project, and also for
the great deal of moral support.

I would also like to acknowledge Dr. D. W. Dickson, Jennifer Anderson, and Tom
Hewlett, from the University of Florida, Entomology/Nematology Department for the
cultures of Pasteuria and all of the useful information. Tom Hewlett was very helpful in
assisting me with any important information I needed.

Most importantly I would like to acknowledge all of the members of Dr. George
Bird’s laboratory, Fred Warner, Mike Bemey, Becky Gore, and John Davenport. I
worked for Dr. Bird for several years before starting my graduate program and learned a
great deal of valuable work experience that helped throughout my graduate career. I owe
a great deal of thanks to Fred Warner who got me started in the nematology field as a
student worker. Since that time he as been a good mentor and friend. He has taught me a
great deal about nematode diagnostics. I would also like to acknowledge John Davenport

for teaching me all I know about setting up field experiments. He has been a great

1v

colleague and friend who has always been there to help with many aspects of my research.
I would also like to thank Mike Berney for always answering my countless number of
questions dealing with everything from nematode identification to how to fix my

computer. Speaking of computers, very special thanks goes to Becky Gore for helping
me with all of my statistical analysis. Without her I would still be trying to analyze all of
my data. Finally, I would like to thank Dr. George Bird for all of his support and
encouragement throughout my graduate program. Dr. Bird has contributed a great deal of

time and knowledge to help me succeed as a Master of Science Degree candidate.

PREFACE

The original goal for my Master of Science Program was to obtain training in the
area of biological control with a thesis on Pasteurr'a, a bacterial parasite of nematodes.
The program quickly identified Dr. George Garrity’s Laboratory in the Department of
Microbiology as a place to obtain experience in microbiology. The research goal was to
develop a molecular probe for Pasteuria that could be used in survey work associated
with nematode biological control. After about 18 months of technique development and
preliminary experiments, it became evident that it would not be possible to complete this
goal as part of my M.S. thesis. After discussions with Dr. Bird, it was decided that I
should assume complete responsibility for two sugarbeet cyst nematode research projects
already in progress. This would allow me to have a complete original research experience
beginning with hypothesis development and literature review through data analysis and
thesis writing. Based on this decision, my M.S. thesis entitled “Occurrence, Distribution,
and Management of Heterodera schachtii in Michigan: With Special Reference to
Pasteuria as a Biological Control Agent” consists of the following three projects: 1) 1998
Michigan sugarbeet survey for the detection of H. schachtii, 2) 1998 Nematicide trial for
the evaluation of two non-fiunigant, one fimrigant and one bio-nematicide for the control
of H. schachtii, and 3) Sequencing the 16s rDNA of Pasteuria for phylogenetic analysis
Although it is not possible to integrate these three initiatives in a comprehensive manner

within this thesis, all three relate to specific aspects of my original M.S. program goal.

vi

TABLE OF CONTENTS

LIST OF TABLES ................................................................................................. viii

LIST OF FIGURES .................................................................................................... x

INTRODUCTION .................................................................................................... l

OCCURRENCE AND DISTRIBUTION OF HE TERODERA SCHACHTIY

IN MICHIGAN SUGARBEET PRODUCTION ............................................................ 6
Introduction .................................................................................................... 6
Materials and Methods ....................................................................................... 8
Results ................................................................................................... 10
Discussion .................................................................................................. l 1
Conclusion .................................................................................................. 12

CHEMICAL MANAGEMENT OF HE IERODERA SCHA CH 771

IN MICHIGAN SUGARBEET PRODUCTION .......................................................... 22
Introduction .................................................................................................. 22
Materials and Methods ..................................................................................... 23
Results ................................................................................................... 25
Discussion .................................................................................................. 27
Conclusions .................................................................................................. 27

PHYLOGENETIC ANALYSIS OF PAS TEURIA

BY SEQUENCING the 168 RDNA GENE .................................................................. 37
Introduction .................................................................................................. 37
Materials and Methods ..................................................................................... 39
Results .................................................................................................. 41
Discussion .................................................................................................. 41
Conclusion .................................................................................................. 42

LITERATURE CITED ................................................................................................ 46

APPENDICES
Appendix A. 1998 Survey Sample Form ......................................................... 51
Appendix B. 1998 Sugarbeet Cyst Nematode Survey Data .............................. 52
Appendix C. Preliminary Experiments and Techniques Developed
for Working with Pasteuria. .............................................................................. 59

vii

LIST OF TABLES

OCCURRENCE AND DISTRIBUTION OF HEIERODERA SCHACHTIY
1N MICHIGAN SUGARBEET PRODUCTION

Table 1. Number of Heterodera spp. positive samples from the 1998 sugarbeet
survey in Michigan for both stratified and random sampling methods. ......................... 13

Table 2. 1998 Heterodera spp. population densities associated with 214 Michigan
sugarbeet fields sampled using a stratified or random sampling method ........................ 14

Table 3. Nematode population density per county for Heterodera, Pratylenchus,
Paratflenchus, Helicotylenchus, Criconemella and T ylenchorhynchus spp. fi'om
1998 surgarbeet survey. ................................................................................................ 15

Table 4. Frequency, density, and prominence values for plant-parasitic nematodes
collected from Bay County as part of the 1998 sugarbeet survey (n=51). ...................... 16

Table 5. Frequency, density, and prominence values for plant-parasitic nematodes
collected from Gratiot County as part of the 1998 sugarbeet survey (n=20). ................. 16

Table 6. Frequency, density, and prominence values for plant-parasitic nematodes
collected fiom Huron County as part of the 1998 sugarbeet survey (n=30). .................. 17

Table 7. Frequency, density, and prominence values for plant-parasitic nematodes
collected fi'om Saginaw County as part of the 1998 sugarbeet survey (n=23). ............... 17

Table 8. Frequency, density, and prominence values for plant-parasitic nematodes
collected from Sanilac County as part of the 1998 sugarbeet survey (n=29). ................. 18

Table 9. Frequency, density, and prominence values for plant-parasitic nematodes
collected fiom Tuscola County as part of the 1998 sugarbeet survey (n=35). ................ 18

Table 10. Frequency, density, and prominence values for plant-parasitic nematodes
for all the stratified samples collected fi'om the 1998 sugarbeet survey. ....................... 19

Table 11. Frequency, density, and prominence values for plant-parasitic
nematodes for all the random samples collected from the 1998 sugarbeet survey. ......... 19

Table 12. Number of years in sugarbeet out of the last 14 growing seasons
(not including present year). ......................................................................................... 20

viii

CHEMICAL MANAGEMENT OF HE IERODERA SCHA CH 771
IN MICHIGAN SUGARBEET PRODUCTION

Table 1. Nematicides and application procedures used in a 1998 sugarbeet cyst
nematode trial in Bay City, Michigan. .......................................................................... 29

Table 2. At-plant sugarbeet cyst nematode population densities associated with nine
treatments in a 1998 trial in Bay City, Michigan (soil sampling date: May 5, 1998). 30

Table 3. Mid-season sugarbeet cyst nematode population densities associated with nine
treatments in a 1998 trial in Bay City, Michigan (soil and root sampling date:
July 31, 1998). ............................................................................................................. 30

Table 4. At harvest sugarbeet cyst nematode population densities associated with nine
treatments in a 1998 trial in Bay City, Michigan (soil sampling date:
November 3, 1998). ..................................................................................................... 31

Table 5. Sugarbeet yields from a 1998 nematicide trial in Bay City, Michigan. ........... 31

Table 6. Portion of second-stage juveniles of Heterodera schachtii
recovered from midseason root samples for the nine different treatments
from the 1998 nematicide trial in Bay City, Michigan ................................................... 32

Table 7. Simple linear regression models that explain variability in yield
(tons per acre) for the 1998 sugarbeet nematicide trial in Bay City, Michigan ............... 33

Table 8. Simple linear regression models that explain variability in yield,

number of cysts, and portion of nematode population in roots for the 1998

sugarbeet nematicide trial in Bay City, Michigan for the control and

DiTera 0 treatments only ............................................................................................... 33

Table 9. Simple linear regression models that explain variability in yields,

cyst populations and portion of nematodes in root for the 1998 sugarbeet
nematicide trial in Bay City, Michigan for the control and Vapam treatments only ..... 33

ix

LIST OF FIGURES

INTRODUCTION

Figure 1. Total acres of sugarbeet harvested in Michigan each year from
1992 to 1998 (Michigan Agricultural Statistics). ............................................................ 4

Figure 2. Tons/acre of sugarbeet produced each year fi'om 1972 to 1998 (Michigan
Agricultural Statistics) ................................................................................................... 5

OCCURRENCE AND DISTRIBUTION OF HEIERODERA SCHACHm
IN MICHIGAN SUGARBEET PRODUCTION

Figure 1. Detection of Heterodera schachtii in a 1998 survey of Michigan
sugarbeet production .................................................................................................. 21

CHEMICAL MANAGEMENT OF HE IERODERA SCHACH 771
IN MICHIGAN SUGARBEET PRODUCTION

Figure 1. At plant horizontal distribution of Heterodera schachtii cysts per 100 cm3
of soil. ............................................................................................................... 34

Figure 2. Mid-season horizontal distribution of Heterodera schachtii cyst populations in
100 cm3 of soil ............................................................................................................ 35

Figure 3. At harvest horizontal distribution of Heterodera schachtii cyst populations
per 100 cm3 of soil ........................................................................................................ 36

PHYLOGENETIC ANALYSIS OF PAS 7E URIA
BY SEQUENCING the 16S RDNA GENE

Figure 1. Partial 16s rDNA sequences fiom Pastereuria penetrans using primers
27F and 1385K ................................................................................................... 43

INTRODUCTION

The sugarbeet, Beta vulgaris saccharifera, was developed by selecting fiom white
strains of fodder beet, originating from the Mediterranean wild beet, Beta maritima
(W eischer and Steudel 1972). German chemist Andreas Margraff first demonstrated the
similar identity of beet-sugar and cane sugar, and in 1747, F. C. Achard started sugar
production from beets. Today, around 37% of the world’s sugar is produced from beet.
In addition to sugar production, sugarbeet is very important as a forage, since not only the
crown leaves but also beet pulp are used to feed cattle in many countries (W eischer and
Steudal 1972).

In 1997, Michigan ranked fourth in US. sugarbeet production. Growers harvested
174,000 acres in 1998, producing 2,871,000 tons, representing 8.9% of the total US.
production (Anon. 1998). Since 1972, Michigan has had an increase in the number of
sugarbeet acres harvested (Figure 1). Michigan sugarbeet yield in tons per acre, however,
has decreased over the last 25 years (Figure 2). This decline may be due, in part, to the
presence of the sugarbeet cyst nematode (SBCN) Heterodera schachtii Schmidt, 1871
(Nemata).

Schacht, first reported H. schachtii, in 1859 in Germany (Schacht 1859a,b). The
sugarbeet cyst nematode was the first nematode pathogen of sugarbeet to be recognized
and has remained one of the crop’s most damaging pests, occurring in all major beet-
growing areas (Cooke 1993). This nematode reduces both sugar content and total crop
yields (Knobloch and Bird 1981). H. schachtii was known in western United States as

early as 1905, and the first Michigan survey for this nematode was conducted in 1920

(Steele 1984; Knobloch and Bird 1981). This nematode, however was not detected in
Michigan until 1948 (Bockstaller 1950). It was subsequently shown to be a major pest
under Michigan growing conditions (Knobloch and Bird 1981).

H. schachtii is a sedentary endoparasite. Raski (1949) completed a classical
description of the life cycle of this nematode. Upon hatching, the nematode will penetrate
the root system of a suitable host and migrate through the cortex to permanent feeding
sites adjacent to the vascular cylinder (Cooke 1993). The first indication of an infestation
of H. schachtir’ in fields of sugarbeet is usually the appearance of one or more well-defined
circular to oval areas of reduced grth or poor stands (Steele 1984). Other symptoms
may include wilting or yellowing. H. schachtii has a rather wide host range that includes
weeds, cultivated vegetables, field crops, and ornamentals occurring in 23 plant families
(Steele 1965). Sugarbeet is the only major field crop grown in Michigan that is a host for
this nematode.

Successful management of H. schachtii was achieved for many years through a
very strict system of crop rotation (Bemey and Bird 1998). More recently the sugarbeet
industry has undergone several changes which include an increase in acres planted to
sugarbeet and a decrease in crop rotation schemes.

Alternative management strategies, in addition to crop rotation, include; cultural
practices, such as sanitation and planting of trap crops; biological control and chemical
control. Sanitation is extremely important, especially when dealing with equipment and
tare soil. Planting trap crops can stimulate hatching of H. schachtii juveniles, which then
invade the roots and initiate the formation of syncytia at permanent feeding sites. The

syncytia soon break down and prevent most of the nematodes from completing their life

cycles (Wyss et a1. 1984). Biological control of H. schachrii may be possible in the future
through the use of nematode parasitic bacteria and fungi. The genus Pasteuria forms a
group of endospore-forming bacteria that may have potential to be developed into
biological control agents of plant-parasitic nematodes (Stirling 1991). Current research is
being done on this group of bacteria to determine its potential for use as a biological
control agent against many economically important plant-parasitic nematodes. Pesticides
such as soil fumigants and non-fumigant nematicides (carbamates and phosphates) can be
used to control not only H. schachtii, but also other nematode and arthropod pests
(Roberts and Thomason 1981).

Management strategies for H. schachtii will ultimately depend on an integrated
approach that will include some of the tactics that have been described above. This thesis
focuses on three aspects: 1) a Michigan survey designed to determine the extent of H.
schachtr'i infestation, 2) a nematicide trial in a field with a low initial population density of
H. schachtr'r’, and 3) research designed to sequence the 16s rDNA of Pasteuria, a potential

biological control agent for H. schachtii.

53.5 BEBE 525% 8e. 2 «3. secs: 58 e322: 5 83.22 3.983 .e 3.8 .38. .. 23E

8cm no? 89. mag 08—. one.

 

 

o8... . 3.23 .33 t u. .3?a~..83o + 8.6234 _- .. >

 

 

 

 

 

 

 

 

 

 

 

 

 

defiance 3.38:? 895.5: 82 2 «B. 22. a: 58 .8080: .8933 co 283:3 .m 2:9“.

mar 82 map 002 may one

 

 

Sod u 8.9:. Stone 5.5806 - .3.me n a

 

 

 

 

 

 

 

VI

OCCURRENCE AND DISTRIBUTION OF HE T ERODERA SCHA CHTII IN

MICHIGAN SUGARBEET PRODUCTION
IN TRODUCI'ION

Sugarbeet, Beta vulgaris saccharifera, is grown in the United States under a wide
range of soils and climatic conditions (Griffin 1981). The sugarbeet cyst nematode
(SBCN), Heterodera schachtii Schmidt 1871 (Nemata), is the most important plant-
parasitic nematode and one of the most significant plant pathogens afi‘ecting sugarbeet
(Grifiin 1981). As a pathogen, it reduces both sugar content and total crop yields
(Knobloch and Bird 1981). H. schachtii was the first nematode pathogen of sugarbeet to
be recognized (Schacht 1859) and has remained one of the crop’s most damaging pests,
occuning in all major beet-growing areas (Cooke 1993).

Schacht first reported H. schachtii in 1859 in Germany. Schmidt subsequently
described the causal agent in 1871. It has been found in at least 40 countries within North
and South America, Europe, Afiica, and in the Middle East (Steele 1984). It is not known
how this nematode gained entry into the United States; however, it may have been
introduced with imported sugarbeet seed contaminated with nematode-infested soil (Shaw
1915; and Trifiit 1935). Damage to sugarbeet by H. schachtir‘ was first observed in the
United States in 1895 (Steele 1984). The causal agent, however, was not identified until
1905. The first detection of H. schachtii in Michigan was in 1948. It was subsequently
reported from Macomb, Saginaw, and Bay Counties through samples submitted to the

Michigan State University Nematode Diagnostic Laboratory (Knobloch and Bird 1981).

It may have been present or spread to several other counties in Michigan due to
agronomic practices associated with recent increases in sugarbeet production.

In 1996, Michigan ranked 5th in US. surgarbeet production. By 1997, Michigan
increased its production to become the 4th largest producer of sugarbeet. Growers
planted 160,000 acres and produced 3,040,000 tons, representing 10.2% of the total US.
production (Anon. 1997). This increase in the amount of sugarbeet production can lead to
a greater risk in the spread of H. schachtii within the state.

Second-stage juveniles of H. schachtii invade the root system of a sugarbeet plant
and feed at sites adjacent to the vascular cylinder, interfering with nutrient uptake (Cooke
1993). Nematode damage is most severe during the seedling stage, resulting in either a
lack of or delay in seedling emergence (Steele 1984). Nematode-infected plants may
exhibit symptoms of wilting or stunting in the field. Populations of H. schachtii
overwinter in the soil as eggs retained in a protective lemon-shaped cyst formed fi'om the
body wall of the dead female. Each cyst contains up to 600 eggs. Some may remain
unhatched for many years if a suitable host is unavailable (Cooke 1993).

Currently, there is insufficient information available on the occurrence, distribution,
and impact of H. schachtir‘ in Michigan. The primary objectives of this project were to
determine 1) the geographical distribution of this nematode in the Michigan, 2) nematode
population density levels, 3) its prominence in fields infested, 4) how infestation is related
to cropping history, and 5) how infestation is related to plant symptomology. A secondary
objective was to examine populations of H. schachtii for the presence of Pasteuria spp., a
bacterial parasite, that could possibly be used as a biological control agent of this

nematode.

MATERIALS AND METHODS

A cooperative research project with Monitor and Michigan Sugar Companies was
initiated in 1998. The objective was to conduct a detection survey for Heterodera
schachtii throughout 13 Michigan sugarbeet-producing counties. Each of the professional
fieldmen from each company collected ten root-soil samples for nematode analysis from
10 different sugarbeet fields. Five of the samples were taken at random from fields not
exhibiting shoot system symptoms associated with low sugarbeet yields. The remaining
five samples were taken using a stratified sampling method from fields exhibiting
symptoms of suspected sugarbeet cyst nematode damage. In this survey, stratified
sampling is defined as a method of sampling based on the knowledge of an organisms
specific location and behavioral patterns. A total of 214 samples were collected and
submitted with a sample form providing information from the grower (Appendix A).
Michigan Sugar fieldmen submitted 122 samples, and 92 were submitted by Monitor
Sugar fieldmen.

A single bulk sample was prepared by the fieldmen for each of the 10 different
sampling sites. Samples taken at random were a composite of nine root-soil cores from
the plant-soil rhizosphere. Stratified samples were taken by collecting three different root-
soil cores each from three locations in the field exhibiting symptoms. These samples were
collected from the plant-soil rhizosphere near the margins of the locations exhibiting
symptoms. Soil samples were stored at 5 C° until processed.

Soil fiom each sample was shaken through a large mesh screen to separate root
and soil material. Nematodes were extracted from the root tissue using the flask-shaker

method (Bird 1971). Nematodes were extracted from 100 cm3 of soil taken from each of

the collected samples with a modified centrifugal flotation procedure (625 g of sugar per
1.0 liter of water) with nested sieves with 710 um and 37 um openings (Jenkins 1964).
Nematodes in both soil and root samples were identified to genus (Mai et al. 1996) and
counted using an inverted microscope at 100x magnification. The samples were also
examined at this time for the presence of the bacterial nematode parasite, Pasteurr’a. Cysts
and juveniles found in the samples were examined microscopically for the detection of
Pasteuria spores.

Heterodera schachtii and H. glycine: (soybean cyst nematode) have similar
taxonomic characteristics. To distinguish between H. schachtii and H. glycines in samples
submitted from Lenawee and Gratiot Counties, bioassays were done on selected samples
under greenhouse conditions to verify the identity of the nematodes recovered from the
extraction procedures. Samples were selected for bioassays based on the results from the
root and soil nematode extractions. Soil was taken fi'om the specified sample and planted
to cabbage, a suitable host for H. schachtii, and to soybean, a host for H. glycines.
Cabbage and soybean plants were harvested after 40 days. The entire contents of each pot
was placed in a plastic pail and washed with tap water. Nematodes were extracted from
this material contained in the pail using the modified centrifiigal flotation method with
nested sieves with 710 um and 37 um openings (Jenkins 1964). Nematodes were
identified to species (Mulvey 1985) and counted using a stereoscope microscope at 40x
magnification.

Nematode frequency, density and prominence were determined using the
procedure fiom Norton (Norton 1978). Relative and absolute density, relative and

absolute fi'equency, and prominence values were calculated on the data from the samples

collected fi'om counties with a sample population equal to or greater than 20. Prominence

value is used to provide a joint indication of both fi'equency and density.

RESULTS

Michigan and Monitor Sugar Companies submitted a total of 214 samples from 13
counties. There were 105 samples taken from sites exhibiting symptoms and 109 samples
from sites without symptoms. Bioassays for Heterodera spp. determination for Lenawee
and Gratiot Counties are not complete at this time; therefore, all nematodes were
identified to genus only. Samples were confirmed as positive for H. schachtii if second-
stage juveniles were found in both the root and soil samples. Heterodera spp. (cyst
nematodes) were recovered fi'om 115 of the samples or 54% of the total sites sampled
(Table 1). Population densities ranged from 0 to 49,352 eggs and juveniles per 100 cm3 of
soil (Appendix B). Cyst nematodes were recovered from 50% of the 109 sites that did not
exhibit symptoms, with a mean population density of 1088.9 eggs and juveniles (Table 2).
In the 105 sites exhibiting symptoms, cyst nematodes were recovered from 58% of the
samples, with a mean population density of 2595.8 eggs and juveniles. Heterodera spp.
were recovered from 9 of the 13 counties sampled in 1998. H. schachtii was positively
identified in 6 of the thirteen counties involved in this survey (Figure 1).

In addition to Heteradera spp., five other important genera of plant-parasitic
nematodes were recovered from Michigan sugarbeet fields: Pratylenchus; Paratylenchus;
Criconemella; Helicotylenchus and T ylenchorhynchus. The distribution of these

nematodes varied among counties (Table 3). The importance of these other plant-parasitic

10

nematodes in sugarbeet production in Michigan is not known at this time. Future
research will have to be conducted to determine their impact on sugarbeet production.

Frequency, density, and prominence values were calculated for six counties: Bay,
Gratiot; Huron; Saginaw; Sanilac; and Tuscola (Tables 4-9). Huron County had the
highest prominence value for Heterodera spp. (Table 6). The lowest prominence value of
0.0 came from Gratiot County where Pararylenchus spp. were the most prominent.
Stratified samples had a higher prominence value for Heterodera spp. than random
samples (Tables 10 and 11). The data also suggest that the more often you grow
sugarbeet the higher the Heterodera populations (Table 12).

All of the 214 survey samples submitted from both sugar companies were negative
for the presence of Pasteuria, a bacterial nematode parasite. Microscopic observations of

cysts and juveniles failed to detect spores of Pasteurr’a.

DISCUSSION

This project has helped to determine the occurrence and distribution of Heterodera
throughout the major sugarbeet production area in Michigan. There are now six
confirmed counties within Michigan that test positive for the presence of H. schachtr'i,
Arenac, Bay, Huron, Saginaw, Sanilac, and Tuscola. These six counties accounted for
approximately 80% of 1997 Michigan sugarbeet production. With the increase in
sugarbeet production in the state there is a risk of further spread to subsequent uninfected
fields and neighboring counties. This survey also gives initial information to suggest that
infestation from Heterodera spp. are related to cropping history and plant

symptomatology. The greater the number of sugarbeet crops planted since 1984, the

11

greater the amount of Heterodera spp. recovered. This increase in population densities
may be due to the shortening of rotation schemes. Samples taken using a stratified
method also appeared to have a greater amount of Heterodera spp. recovered. This
suggests that symptoms may be an indicator of H. schachtr'i infestations.

Future research will be done in Michigan on the bacterial nematode parasite
Pasteuria. Although it was not detected in the 1998 sugarbeet survey, it will still be
researched as a possible biological control agent for the management of H. schachtii in

Michigan sugarbeet production.

CONCLUSIONS

The presence of H. schachtii in the top sugarbeet producing counties in Michigan
suggests that this nematode may be related to the yield decline that Michigan has been
experiencing over the last 15 years. It is necessary that growers use management practices
to minimize the risk of spread to uninfected areas. Symptomatology may be an indicator
of nematode infestation. Future research may help to provide information on specific
symptoms caused by nematode infestation. Growers must also be sure to maintain proper

crop rotation schemes to reduce the impact of H. schachtir’ on sugarbeet yields.

12

Table 1. Number of Heterodera spp. positive samples from the 1998 sugarbeet survey in Michigan for

both stratified and random sampling methods.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

County Total County Stratified SamplesT Random Samples:

No. of No. of No. of No. of No. of No. of

samples positive samples positive samples positive
1. Arenac 9 4 5 4 4 0
2. Bay 51 36 31 21 20 15
3. Gratiot 20 2 12 1 8 1
4. Huron 30 21 15 ll 15 10
5. Isabella 1 O 0 0 1 0
6. Lenawee 10 l 4 l 6 0
7. Mecosta 1 0 1 0 0 0
8. Montcalm 3 0 1 0 2 0
9. Newaygo 1 1 1 1 0 0
10. Saginaw 23 19 10 9 13 10
11. Sanilac 29 13 15 6 l4 7
12. St. Clair 1 0 0 0 1 0
13. Tuscola 35 18 10 7 25 11
Total 214 115 105 61 109 54

 

 

 

 

 

 

 

‘Sttatified: Sampling from fields exhibiting foliar symptoms of suspected H. schachtii infestation.
Stratified samples were taken by collecting three different root-soil cores each fi'om three locations in the
field exhibiting symptoms. These samples were collected from the plant-soil rhizosphere near the margins
of the locations exhibiting symptoms.

2Random: Sampling from fields not exhibiting foliar symptoms of suspected H. schachtii infestation

Samples taken at random were a composite of nine root-soil cores from the plant-soil rhizoshere.

l3

 

Table 2. 1998 Heterodera spp. population densities associated with 214 Michigan sugrbeet fields sampled
using a stratified or random sampling method

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

County StratifiedI Random2

11 Mean 11 Mean
1. Arcane 5 34.0 4 0.0
2. Bay 31 2661.9 20 461.5
3. Gratiot 12 0.5 8 0.3
4. Huron 15 9064.3 15 909.9
5. Isabella -- -- 1 0.0
6. Lenawee 4 0.5 6 0.0
7. Mecosta 1 0.0 -- --
8. Montcalm 1 0.0 2 0.0
9. Newaygo 1 4.0 0 0.0
10. Saginaw 10 1654.0 13 1160.0
11. Sanilac 15 746.3 14 922.6
12. St. Clair -- -- 1 0.0
13. Tuscola 10 2616.2 25 2712.6
TOTAL 105 2595.8 109 1088.9

 

 

 

'Sttatilied: Sampling from fields exhibiting foliar symptoms of suspected H. schaclrm attestation.
Stratified samples were taken by collecting three different root-soil cores each from three locations in the
field exhibiting symptoms. These samples were collected from the plant-soil rhizosphere near the margins
of the locations exhibiting symptoms.

2Random: Sampling from fields not exhibiting foliar symptoms of suspected H. schachm' infestation
Samples taken at random were a composite of nine root-soil cores from the plant-soil rhizoshere.

14

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

I. ed 3 S: 2 3 23m scones .2
a... a... 3. 9m 3. 3 3. .30 3m .2
2. 2 3 Zn 2: mm 1mm 8.2% .:
o... 3 o... qt. 2 Z 35 $38 .c
a... 3. 9o 2. 3. ca 3. ogsoz .e
3 3 3. 3: S 2 2. 83.82 .m
a... 3. 2. 3. a... 3 2. 5882 s
a... e... 3 5.» an 4.3 3 8383 e
3. e... o... o.» 3.4 o... 2. 2.32 .n
o... 3 .3 c9. cm 3 2.3. .33: .4
a." no .3 9: man no 2. 6280 .n
3 2. S 4.2 «.8 S. 33: an .N
as I. 2 on. 24 2. 3: 882 ._
550 «afiebtetoesb ezusoeeothv gagefibeozut Eozfiaocscm §§§~b§m cxgufit £550

 

 

«$23 809393 £8— .25 Gnu mafiakfegoefikh
can ezufiueeetbgficuzeofih .3353c3k wacoeuzexm 6.35.8»: 3m 82:30 2 :5 no.“ :8 no n=5 8— 8n bum—.3 nous—anon 335—82 .m 033.

15

Table 4. Frequency, density, and prominence values for plant-parasitic nematodes collected from Bay
County as part ofthe1998 sugarbeet survey (n-51).

 

 

 

 

 

 

 

 

Nematode No of Absolute Relative Absolute Relative Prominence
spp. Positive Frequency' Frequency; Density? Density‘ Value’
Samples
Heterodera 36 70.6 33.0 1799.0 97.7 151.1
Pratylenchus 12 23.5 11.0 4.2 0.2 0.2
Paratylenchus 28 54.9 25.7 20.5 1. 1 1.5
Helicotylenchus 27 52.9 24.8 15.4 0.8 1. 1
Criconemella 4 7.8 3.7 1.3 0. l 0.0
blenchorlomdms 2 3.9 1.8 0.1 0.0 0.0

 

 

 

 

 

 

 

lAbsolute Frequency 3 (number of samples containing a species)/(number of samples collected) " 100

2Relative Frequency - (fi'equency of species)l(sum of frequency of all species)‘100
3Absolute Density = Sample Mean

‘Relative Density = (mlmber ofindividuals ofa species in a sample)/(tota1 ofall individuals in a

sample)"I 100

sProminence Value = density "‘ sqrt(absolute frequencyleO

Table 5. Frequency, density, and prominence values for plant-parasitic nematodes collected from Gratiot
County as part of the 1998 sugarbeet survey (n=20).

 

 

 

 

 

 

 

 

 

Nematode No of Absolute Relative Absolute Relative Prominence
spp. Positive FrequencyI Frequency2 Density’ Density‘ Values
Samples
Heterodera 2 10 5.6 0.4 0.6 0.0
Pratylenchus 35 19.4 6.5 10.2 0.4
Paragdenchus ll 55 30.6 35.2 55.1 2.6
Helicotylenchus 12 60 33.3 21.0 32.8 1.6
Criconemella 2 10 5.6 0.0 0.0 0.0
Tylenchorhjmchus 2 10 5.6 0.9 1.3 0.0

 

 

 

 

 

 

‘Absolute Frequency 8 (number of samples containing a species)l(number of samples collected) ‘ 100

2Relative Frequency = (frequency of species)/(sum of frequency of all species)*100
3Absolute Density = Sample Mean

‘Relative Density = (number of individuals of a species in a sample)/(total of all individuals in a

sample)‘I 100

’Ptominenoe Value = density * sqrt(absolute frequency)I100

16

 

 

Table 6. Frequency, density, and prominence values for plant-parasitic nematodes collected from Huron
Countyaspartot'the 1998 mgarbeetsurvey(n=30).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Nematode No of Absolute Relative Absolute Relative Prominence
spp. Positive Frequency' F Density’ Density‘ Value’
Samples
Heterodera 21 70.0 29.6 4987.1 98.9 417.3
Pratylenchus 8 26.7 11.3 1.0 0.0 0.1
Paratflenchus 17 56.7 23.9 9.0 0.2 0.7
Helicon/lend!” 23 76.7 32.4 46.0 0.9 4.0
Criconemella 0 0.0 0.0 0.0 0.0 0.0
Tylenchorhyndms 2 6.7 2.8 0.3 0.0 0.0

 

'Absolute Frequency -- (number of samples containing a species)/(number of samples collected) " 100

2Relative Frequency - (frequency ofspeciesmsum offrequency ofall species)*100
3Absolute Density 8 Sample Mean

‘RelativeDensity- (number ofindividuals ofa species inasample)/(total ofall individuals ina

sample)‘I 100

’Prominenee Value - density * sqrt(absolute frequency)I100

Table 7. Frequency, density, and prominence values for plant-parasitic nemtodes collected from Saginaw
County as part of the 1998 sugarbeet survey (n=23).

 

 

 

 

 

 

 

 

Nematode No of Absolute Relative Absolute Relative Prominence
spp. Positive Frequency' Frequency’ Density’ Density‘ Values
Samples
Heterodera 19 82.6 32.8 1375.0 96.1 125.0
Pratylenchus 11 47.8 19.0 2.7 0.2 0.2
Paratylenclms 10 43.5 17.2 5.7 0.4 0.4
Helicon/[enema 17 73.9 29.3 47.0 3.3 4.0
Criconemella 0.0 0.0 0.0 0.0 0.0
Tylenchorhynchus 1 4.3 1.7 0.2 0.0 0.0

 

 

 

 

 

 

 

lAbsolute Frequency = (number of samples containing a species)/(number of samples collected) "‘ 100

2Relative Frequency = (frequency of species)/(sum of fiequency of all species)*100
3Absolute Density = Sample Mean

4Relative Density 3 (number of individuals of a species in a sample)/(tota1 of all individuals in a

sample)‘ 100

’Prominenee Value 8 density " sqrt(absolute frequency)/100

17

 

 

Table 8. Frequency, density, and prominence values for plant-parasitic nematodes collected from Sanilac
County as part of the 1998 sugarbeet survey (n=29).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Nematode No of Absolute Relative Absolute Relative Prominence
spp. Positive Frequency' Frequer Density’ Density‘ Value’
Samples
Heterodera 13 44.8 18.8 831.4 92.8 55.7
Pratylenchus 14 48.3 20.3 9.8 1.1 0.7
Paratylenchus 18 62.1 26.1 10.4 1.2 0.8
Helicotylenchus 20 69.0 29.0 32. 1 3.6 2.7
Criconemella 3 10.3 4.3 9.8 1.1 0.3
Tylenchorhjmchus 1 3.4 1.4 2.3 0.3 0.0

 

1Absolute Frequency = (number of sarnples containing a species)l(number of samples collected) * 100

2Relative Frequency = (frequency of species)l(sum of frequency of all species)‘100
3Absolute Density = Sample Mean

‘Relative Density = (number of individuals of a species in a sample)l(total of all individuals in a

sample)’ 100

’Prominence Value = density "' sqrt(absolute frequencyyloo

Table 9. Frequency, density, and prominence values for plant-parasitic nematodes collected from Tuscola
County as part of the 1998 sugarbeet survey (n=35).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Nematode No of Absolute Relative Absolute Relative Prominence
spp. Positive Frequency' Frequency: Density’ Density‘ Values
Sainfis
Heterodera 18 51.4 24.7 2685.1 99.2 192.6
Pratylenchus 13 37.1 17.8 8.1 0.3 0.5
Paralylenchus 14 40.0 19.2 2.1 0.1 0.1
Helicotylenchus 24 68.6 32.9 10.0 0.4 0.8
Criconemella 1 2.9 1.4 0.2 0.0 0.0
Tylenchorhynchus 3 8.6 4. 1 0.6 0.0 0.0

 

lAbsolute Frequency = (number of samples containing a species)l(number of samples collected) “ 100

2Relative Frequency = (frequency of species)l(sum of frequency of all species)‘100

3Absolute Density = Sample Mean

4Relative Density = (number of individuals of a species in a sample)/(total of all individuals in a

sample)‘ 100

’Prominence Value = density "' sqrt(absolute fi'equencyyloo

18

 

 

Table 10. Frequency, density, and prominence values for plant-parasitic nematodes for all the stratified

amples collected fiom the 1998 sugarbeet survey.

 

 

 

 

 

 

 

Nematode No of Absolute Relative Absolute Relative Prominence
spp. Positive F requencyl Frequency’ Density; Density4 Values
Samples
Heterodera 61 58 24.83 2595.8 98 198
Pratylenchus 36 34 14.65 9.3 0.3 0.5
Paratylenchus 60 57 24.42 22 0.8 1.7
Helicoodenchus 75 71 30.53 29.23 1.1 2.5
Criconemella 8 7.6 3.256 1 0 0
Tylenchorlomdms 6 5.7 2.442 0.84 0 0

 

 

 

 

 

 

 

 

‘Absolute Frequency = (number of samples containing a species)l(number of samples collected) " 100

’Relative Frequency = (frequency of species)l(sum of frequency of all species)‘ 100
3Absolute Density = Sample Mean

‘Relative Density = (number of individuals of a species in a sample)/(tota1 of all individuals in a

sample)‘ 100

’Prominence Value = density " sqrt(absolute frequency)/100

Table 11. Frequency, density, and prominence values for plant-parasitic nematodes for all the random

samples collected from the 1998 sugarbeet survey.

 

 

 

 

 

 

 

 

Nematode No of Absolute Relative Absolute Relative Prominence
spp. Positive Frequency' Frequency2 Density’ Density‘ Values
Samples
Heterodera 54 49.541 24 1089 96.201 76.6
Pragdenchus 40 36.697 18 4.4 0.3887 0.27
Paratylenchus 53 48.624 24 6.3 0.5565 0.44
Helicon/[enables 63 57.798 28 27.1 2.394 2.06
Criconemella 3 2.7523 1.3 2.6 0.2297 0.04
rylenchorhynehus 10 9.1743 4.5 2.6 0.2297 0.08

 

 

 

 

 

 

 

‘Absolute Frequency = (number of samples containing a species)l(number of samples collected) * 100

2Relative Frequency = (frequency of species)l(sum of frequency of all species)*100

3Absolute Density = Sample Mean

‘Relative Density -= (number of individuals of a species in a sample)/(total of all individuals in a

sample)‘ 100

’Prominence Value = density " sqrt(absolute frequency)/100

19

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

ad :6 cd can v.2 ed n5 m Ania e
ed Nu— : 5.3 «.2 «a Nee—m Axis m
:6 .6 ed ”.2 v.2 ms «.82 cans v
o.~ he 3 0.3 5: «d :52 Gnu—c n
2 e... 3 3m 4.: 2 3: fits N
3 3 a: we" a.” m... cams Susi
ed e... 2. 2m 2 2 ed fits a
gamed
850 3533:0535 ozofiueeotu 30538:»: §u=u~beuem ua£o§~bet 953.325 5 §>

 

 

can .888 333 as means. 9.52» 2 as 23o .8 8.:st 5 at» o .832 .2 2.3

20

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

- infestations detected

 

- infestations not detected

 

 

 

 

 

 

 

infestations yet to
be determined

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Fig. 1. Detection of Hetemdera schachtii in a 1998 survey of Michigan sugarbeet
production.

21

CHEMCAL MANAGEMENT OF HE T ERODERA SGIACHT II IN MICHIGAN

SUGARBEET PRODUCTION

INTRODUCTION

Heterodera schachtii (sugarbeet cyst nematode) was first shown to reduce
sugarbeet yields under Michigan growing conditions over 50 years ago. Sugarbeet is the
only major field crop host for this nematode. In the past it has been mainly managed with
strict crap rotations. Crop rotation has worldwide acceptance as the most practical,
economical means of obtaining profitable yields on nematode-infested land (Steele 1984).
In nematode-infested fields, recommended rotational schemes may permit growing
sugarbeet once in three to seven years depending on the severity of infestation and local
conditions that influence population dynamics (Steele 1984). Soil fiimigants and non-
fiimigant nematicides are used for management of H. schachtii on only an extremely
limited basis.

The Michigan sugarbeet industry has undergone several major changes during the
past 10 years, including an increase in the number of acres planted annually, and a
shortening of crop rotation schemes. Increased sugarbeet production and shorter crop
rotations demand alternate strategies and tactics for managing H. schachtii population
levels.

Alternative methods of management include various chemical and cultural control
practices. Presently, there are no sugarbeet varieties that are resistance to H. schachtii
available for use in Michigan sugarbeet production. Cultural practices include sanitation,

early planting, and the use of trap crops. Sanitation, especially in relation to equipment

22

and tare soil, is very important to prevent the fiirther spread of H. schachtii fi'om infested
to non-infested fields. Growing a nematode-resistant cruciferous trap crop prior to
planting sugarbeet may decrease populations of H. schachtii (Miiller 1991). These trap
crops are planted after harvesting a summer crop, and in suitable soil conditions their root
exudates stimulate hatching of H. schachtii juveniles, which then invade the roots and
initiate the formation of syncytia at permanent feeding sites. The syncytia will break down
and prevent most of the nematodes fi'om completing their life cycles to form viable females
(Wyss et al. 1984). The practice of using trap crops in Michigan sugarbeet production
has not been extensively evaluated for its efi‘ectiveness. Chemical control involves the use
of fiimigant and non-fumigant nematicides.

The objective of this project was to evaluate two non-fumigant nematicides, one
fumigant, and one bio-nematicide for the control of H. schachtii. These nematicides

include Temiko, Counter', DiTera", and Vapam'.

MATERIALS AND METHODS

In 1998, a sugarbeet cyst nematode control research trial was set up in Bay City,
Michigan, on the Gerald Appold Farm. This particular field site has been in a wheat,
soybean, and sugarbeet rotation for the last two decades. The research site used for this
trial was 0.96 acres (260 x 160 feet) in size had not been planted to sugarbeet since 1995.
This trial was set up as a random complete block design. It consisted of nine treatments
(Table 1) in six replicated blocks of four-row by 40 foot plots. Sugarbeet seeds were
planted in a silty loam soil in 30-inch rows with seed spacing of 4.5 inches on May 5,

1998. Because of a relatively poor stand establishment, some rows within the blocks were

23

replanted on June 6, 1998. The nine nematicides were applied at planting according to
pre-determined rates (Table 1). This research trial included four treatments for aphid
control; however, for the purpose of this thesis the data from treatments 10-13, where no
nematicide was applied, will not be included.

Soil samples for nematode analysis were taken three times during the growing
season, at- plant (5-06-98), mid-season (07-31-98), and at harvest (1 1-03-98). Soil
samples taken at- plant and at mid-season were collected 60111 the two outside rows of
each four row plot. Harvest soil was collected fi'om the two center rows after the beets
were removed at harvest. Soil samples consisted of several soil cores placed in one bulk
sample. Root samples were also collected at midseason. Three beets were dug from each
of the two center rows and root tissue was collected.

Nematodes were extracted from 100 cm3 of soil fi'om each of the samples with a
modified centrifiigal flotation procedure (625 g of sugar per 1 l of water) with nested
sieves with 710 um and 37 um openings (Jenkins 1964). Nematodes were extracted fi'om
midseason root tissue using the flask-shaker method (Bird 1971). H. schachtii extracted
from both soil and roots were identified (Mai et al. 1996) and counted using an inverted
microscope at 100x magnification.

Sugarbeet in the two 40-foot center rows of each four-row plot were harvested on
November 3, 1998. They were counted for each four-row plot and recorded as number
of sugarbeet per 80 fl (Table 5). Monitor Sugar Company used the harvested sugarbeet
to determine the amount of raw white sugar per acre (RWSA) and tons per acre.

Statistical analysis of the data was done using SYSTAT (SYSTAT 7.0 1998).

Regressions were done on the whole data set, and for DiTera", and Vapam", which were

24

the only two treatments applied at multiple rates. Cyst population levels determined from
collecting soil samples at-plant, mid-season, and harvest, were mapped to show H.

schachtii dispersal throughout the field over the length of the growing season.

RESULTS

There were no significant differences between population densities of cysts,
second-stage juveniles, and eggs in soil samples taken at planting, midseason, and harvest
among the nine treatments (Tables 2-4). Number of cysts in the soil ranged from O at-
plant (VapamO 0.5 gal/a) to 29.2 (Check) at harvest per 100 cm3 of soil. Eggs in the soil
were found at levels ranging from 0.3 at-plant to 3341.7 at harvest per 100 cm3 of soil.
Second-stage juvenile (J2) population levels ranged from a low of 1.7 at-plant to 1205 at
harvest per 100 cm3 of soil.

There were significant differences among the nematicide treatments in the number
of second-stage juveniles present in the mid-season roots (Table 3). DiTerao 12-inch
band, DiTeraQ 6-inch band, Vapam“ 0.5 gal/a, and Vapam" 1.0 gal/a, were significantly
different (p=0.05) from the check. Second-stage juvenile population levels in the root
ranged from 34 .3 to 146.4 per 1.0 g of root tissue. The number of second-stage
juveniles present in the root compared with the total amount of juveniles present in the
mid-seasons samples was calculated for each of the nine treatments (Table 6). Treatment
7 (Vapamo 0.5 gal/a) had the lowest amount of juveniles present in the root tissue.

Simple linear regression models were developed to explain variability in tons of
sugarbeet harvested per acre for the entire data set. Three independent variables were

analyzed (portion of 125 in root at mid-season, mid-season cyst counts, and harvest cyst

25

counts), and each had a p-value associated with it less that 0.05 (Table 7). The best
regression model used mid-season cysts as an indicator of final tons per acre. This model
was:

Ysa = 15.032 - 0.715CMS
Where:

Y5; = sugarbeet yield (tons/acre)

Cm = mid-season cyst counts (100 cm3 soil)

This model explained 10.8% of the variability in yield, with a p-value of 0.016. The
number of mid-season cysts in the soil was negatively correlated with yield.

Linear regression models for DiTerao suggest that the amount of active ingredient
applied correlated with the portion of second-stage juveniles found in the root system.
This model explained 18% of the variability in yield with a p-value of .039 (Table 8). The
DiTerao treatments also demonstrated that mid-season cyst populations can still be used as
a reasonably good predictor for yield (p= .054, r2= .158). The linear model associated
with mid-season and harvest cyst populations indicated that the higher the population of
cysts the lower the final tons per acre.

The best linear model for Vapam° indicated that the cyst population at harvest
explained 19.3% of the variability in the tons per acre with a p-value of .032 (Table 9).
Even though mid-season p-value was a little high it can still be used as a reasonably good
indicator of final yields.

Mapping the horizontal distribution of H. schachtii cysts at planting, mid-season,
and harvest demonstrate changes in the distribution of cysts throughout the growing

season (Figures 1-3). The at-plant populations were aggregated in the middle of the field.

26

As the season progressed, the population spread throughout the field, with the highest
population density of H. schachtii in the northwest corner. Cyst population densities for
the growing season ranged from a low of 0.0 cysts per 100 cm3 of soil at planting to 32.3

at harvest.

DISCUSSION

The at-plant cyst counts were not significantly different, which is an important
factor in setting up this nematicide trial. This shows that there was a relatively uniform
distribution of H. schachtii throughout the field and that this was a good site for the
nematicide trial. However, this site had low initial nematode population densities, which
did not explain a lot of the variability in yield. Late planting date and lack of precipitation
' in the spring of 1998 may help explain the poor sugarbeet emergence and some of the
variability in the nematode population densities. DiTera° (6 inch and 12 inch band) and
VapamO (0.5 and 1.0 gal/acre) had significantly fewer second-stage juveniles in the root
than the check. It is possible'that these two nematicides are interfering with the
nematode’s ability to penetrate the root system. The 1999 nematicide trial might provide
some additional data to support this theory. None of the nematicides used in this trial
provided season-long control of H. schachtii. Data suggest that there is a potential for
DiTerao and Vapam‘ to be effective, but with only one year of data, it was not possible to
get a sense of an optimal concentration. At the initial population density of H. schachtii
associated with this site, neither of the nematicides (Countero, Temiko) registered for use
in sugarbeet production provided detectable nematode control or sugarbeet yield

increases.

27

CONCLUSIONS

Management of H. schachtii must be accomplished using an integrated approach.
Data fiom the 1998 nematicide trial does not provide sufficient evidence to conclude that
chemical control alone can effectively reduce cyst populations. In addition to chemical
control, it is important to use cultural controls such as rotation with non-host crops and
proper seed and soil sanitation practices. It is important to have well established

pathogenicity thresholds for H. schachtii (Caswell et al. 1986).

28

Table 1. Nematicides and application procedures used in a 1998 sugarbeet cyst nematode

 

 

 

 

 

 

 

 

 

 

 

 

 

trial in Bay City, Michigan.
Treatment Application procedure and dosage1
1. Check Non-Treated Control
2. Temik 1562 5.0 lb ai/a in-furrow at-planting
3. Counter CR3 12 071 1,000 row 11 in-furrow at-planting
4. DiTera 13?V 11 gal/a lZ-inch band at-planting 1:3 water dilution
5. DiTera BS 11 gal/a 6-inch band atjlanting 1:3 water dilution
6. DiTera ES 11 gal/a broadcast at-plantinLl :3 water dilution
7. VaLamr 0.5 gal/a in-row at plantirw water dilution
8. Vap3m 1.0 gal/a in-row at-plantm 1:3 water dilution
9. Vapam 2.0 gal/a in-row at—planting 1:3 water dilution

 

'May 5, 1998 planting date.

2Trade name: Temik'; Common name: aldicarb; Chemical name: 2-Methyl-2-(methylthio)
propionaldehyde O-(methylcarbamoyl) oxime; Use: systemic pesticide.

3'1‘ rade name: Counter °; Common name: terbufos; Chemical name: S-[[(1,l-

dimethylethyl)thio]methyl] 0,0-diethyl phosphorodithioate; Use: systemic insecticide and
nematicide.

‘Trade name: DiTera'; Common name: ABG-9008; Biological name: Myrothecium vermcaria;
Use: biological nematicide.

5Trade name: Vapam'; Common name: metham; Chemical name: Sodium methyldithiocarbamate
(anhydrous); Use: soil firmigant (fungicide, insecticide, nematicide and herbicide).

29

Table 2. At-plant sugarbeet cyst nematode population densities associated with nine treatments in
a 1998 trial in Bay City, Michigan (soil sampling date: May 5, 1998).

 

 

 

 

 

 

 

 

 

 

 

 

TreatmentI Cysts2 12 Eggs
1. Check 1.2 25.3 165.0
2. Temik 156 1.7 30.7 75.0
3. Counter CR 1.3 8.0 46.7
4. DiTera ES 1.7 27.7 123.3
5. DiTera ES 0.7 15.7 20.3
6. DiTera ES 1.3 18.3 148.7
7. Vapam 0.0 1.7 0.3
8. Vapam 1.0 27.7 79.3
9. Vapam 2.3 55.0 212.7

ANOVA 0.724 0.533 0.561

 

 

 

 

 

1See Table 1 for detailed explanation of treatments.
2Cysts, 12s and eggs were extracted and counted per 100 cm3 of soil.

Table 3. Mid-season sugarbeet cyst nematode population densities associated with nine
treatments in a 1998 trial in Bay City, Michigan (soil and root sampling date: July 31, 1998).

 

 

 

 

 

 

 

 

 

 

 

 

 

 

TreatmentI In Soil2 I Root Samples3

Cysts 12 Eggs; 12‘ Males

1. Check 1.7 34.3 50.0 388.9 be 22.2
2. Temik 156 2.2 146.4 175.2 171.7 abc 20.3
3. Counter CR 2.3 38.3 75.0 183.3 abc 6.7
4. DiTera ES 2.2 58.7 45.0 111.7 a 18.3
5. DiTera ES 2.8 99.2 190.0 33.3 a 3.3
6. DiTera ES 2.3 88.7 166.0 422.2 c 7.8
7. Vapam 2.7 123.3 136.7 43.3 a 0.0
8. Vapam 2.2 71.0 178.3 36.7 a 3.3
9. Vapam 1.2 57.7 134.7 145.0 ab 13.3
ANOVA 0.867 0.477 0.559 0.042 0.629

 

 

 

 

 

 

 

1See Table l for detailed explanation of treatments.

2Cysts, 125 and eggs were extracted and counted per 100 cm3 of soil.

3Root samples were taken from one gram of root.

“Mean Separation: LSD. Those followed by the same letter are not statistically significantly
different at 0.05 level.

30

Table 4. At harvest sugarbeet cyst nematode population densities associated with nine treatments
in a 1998 trial in Bay City, Michigan (soil sampling date: November 3, 1998).

 

 

 

 

 

 

 

 

 

 

 

 

Treatmentr Cysts2 12 Eggs
1. Check 29.2 991.7 2561.7
2. Temik 15G 24.5 840.0 2236.7
3. Counter CR 22.2 826.7 2343.3
4. DiTera ES 32.3 1106.7 3230.0
5. DiTera ES 15.5 731.7 1436.7
6. DiTera ES 17.0 676.7 1723.0
7. Vapam 28.5 1205.0 3341.7
8. Vapam 26.7 1168.3 2915.0
9. Vapam 18.0 725.0 1940.0

ANOVA 0.189 0.627 0.101

 

 

 

 

1See Table l for detailed explanation of treatments.
2Cysts, 125 and eggs were extracted and counted per 100 cm3 of soil.

Table 5. Sugarbeet yields from a 1998 nematicide trial in Bay City, Michigan.

 

 

 

 

 

 

 

 

 

 

 

 

TreatmentI No of beets2 Yield (T ons/Acre) AvgyeiLht/Beet (lb)
1. Check 56.2 11.0 1.8
2. Temik 156 70.8 14.0 1.8
3. Counter CR 71.8 13.6 1.7
4. DiTera ES 63.3 12.1 1.8
5. DiTera ES 60.3 13.0 1.8
6. DiTera ES 76.3 14.7 1.8
7. Vapam 62.3 13.6 2.0
8. Vapam 70.7 16.0 2.1
9. Vapam 70.3 14.4 1.9

ANOVA 0.285 0.579 0.543

 

 

 

 

 

1See Table l for detailed explanation of treatments.
2Number of beets/80 fi row at harvest.

31

 

Table 6. Portion of second-stage juveniles of Hererodera schachtii recovered from midseason
root samples for the nine different treatments from the 1998 nematicide trial in Bay City,
Michigan.

 

 

 

 

 

 

 

 

 

 

 

 

TreatmentI Portion of 12 in Root: Yield (tons/a)
1. Check 0.597 11.0
2. Temik 15G 0.352 14.0
3. Counter CR 0.231 13.6
4. DiTera ES 0.322 12.1
5. DiTera ES 0.122 13.0
6. DiTera ES 0.374 14.7
7. Vapam 0.063 13.6
8. Vapam 0.193 16.0
9. Vapam 0.333 14.4
ANOVA 0.128 0.579

 

 

 

1See Table l for detailed explanation of treatments.
2Portion of 12 in root = (12 in root)/(12 in root + 12 in soil + Eggs in soil)

32

 

Table 7. Simple linear regression models that explain variability in yield (tons per acre) for the

1998 sugarbeet nematicide trial in Bay City, Michigan.

 

 

 

 

 

Dependent Independent 11 Constant Variable r2 p-value

Tons Acre Portion in 54 14.577 -3.831 0.089 0.030
Root

Tons Acre Mid Season 54 15.032 -0.715 0.108 0.016
Cysts

Tons Acre Harvest 54 16.176 -0. 108 0.097 0.022
Cysts

 

 

 

 

 

 

 

 

Table 8. Simple linw regression models that explain variability in yield, number of cysts, and

portion of nematode population in roots for the 1998 sugarbeet nematicide trial in Bay City,
Michigan for the control and DiTera treatments only.

 

 

 

 

 

 

 

 

 

 

Dependent Independent 11 Constant Variable r2 p-value

Tons Acre ai/A 24 12.410 0.143 0.003 0.796

Midseason ai/A 24 1.832 0.197 0.023 0.478

Cysts

Harvest ai/A 24 27.157 -1.721 0.042 0.339

Cysts

Portion in ai/A 24 0.536 -0.086 0.180 0.039

Root

Tons Acre Portion in 24 13.641 -2.624 0.043 0.334
root

Tons Acre 12 in root 24 13.217 -0.002 0.028 0.436

Tons Acre Mid Season 24 14.495 -0.791 0.158 0.054
Cysts

Tons Acre Harvest 24 16.367 -0. 155 0.260 0.011
Cysts

 

 

 

 

 

 

 

 

Table 9. Simple linear regression models that explain variability in yields, cyst populations and
portion of nematodes in root for the 1998 sugarbeet nematicide trial in Bay City, Michigan for the
control and Vapam treatments only.

 

 

 

 

 

 

 

 

 

 

Dependent Independent 11 Constant Variable r2 p-value

Tons Acre ai/A 24 12.382 1.567 0.071 0.209

Mid Season ai/A 24 2.267 -0.400 0.026 0.449

Cysts

Harvest ai/A 24 30.633 -5.771 0.117 0.102

Cysts

Portion in ai/A 24 0.355 -0.067 0.018 0.532

Root

Tons Acre Portion in 24 14.812 -3 .569 0.092 0.150
root

Tons Acre j2 in root 24 14.288 0.003 0.048 0.302

Tons Acre MS Cysts 24 15.459 -0.890 0.139 0.073

Tons Acre H Cysts 24 17.680 —0. 153 0.193 0.032

 

 

 

 

 

 

 

33

 

VVQCOVNO
Ill-III

mhw>o

.=8 mo hEu 00— be 8m»... 5538. Samoaautmo 5:39:36 iconic: «53-2

m
N

4.; r: .55 .

 

223E

34

s—FQDCOVNO
IIEIIII

mhm>0

.__om mo n:5 o2 .3 330 .5539... onegauautmo 5:25:36 3:055: .5386: .N unawE

m
N r

 

35

ooooo
mvmmwo
Ell-II

 

.=8 .«0 mu... 2: can 393 55648. 36323»: CO :osgtfiv Econto: “mots: 2 .m oSwE

a» 90.»

mum»
v.

36

PHYLOGENETIC ANALYSIS OF PAST E URIA BY SEQUENCIN G THE 16S

rRNA GENE

INTRODUCTION

The ontogeny and behavior of plant-parasitic nematodes are influenced by
temperature, moisture, aeration, and a vast array of living organisms including other
nematodes, bacteria, fiingi, algae, protozoan, insects and other soil animals (Stirling 1991).
Of these soil-borne organisms, the bacterium Pasteuria spp. has potential as an
economically and environmentally practical biological control agent of specific nematodes
(Hewlett et a1. 1994). Pasteuria is a Gram-positive endspore-forrning bacterium. It has
been found associated with a variety of nematode hosts and in many different climates and
environmental conditions throughout the world and appears to have the ability to suppress
plant-parasitic nematode populations in crop production systems (Sayre and Starr 1988).

Metchnikofl‘ described Pasteuria ramosa in 1888. It is a parasite of water fleas of
the genus Daphm'a. Three additional species have been described. They are all parasites
of nematodes classified in the order Tylenchida and include P. penetrans (Sayre and Starr
1985), P. thornei (Sayre and Starr 1988), and P. nishizawae (Sayre et al. 1991). P.
penetrans is a parasite of Melor’dogyne spp. (I-Ieteroderidae), P. thamei a parasite of
Pratylenchus spp. (Pratylenchidae) and P. nishizawae a parasite of Hererodera spp.
(Heteroderidae).

The life cycles, host ranges, and spore morphologies are important characters in
the classification of these bacteria (Sayre et a1. 1991; Ciancio et al. 1994). The taxonomy

of the hyperparasite remains unclear, but it is probably made up of a number of species

37

and strains which differ in their host range and virulence; many economically important
genera of plant-parasitic nematodes have been shown to have an association with these
bacteria (Sayre and Starr 1988). The taxonomic relationships within Pasteuria are still
poorly understood because cultures of various pathotypes are not readily available for
biochemical and genetic investigations (Ciancio 1995). With the success in DNA
sequencing of the 168 rRNA gene of P. ramosa (Ebert etal. 1996) and current genetic
work being done with P. penetrans and an undescribed Illinois species, might help answer
some of the questions concerning the molecular taxonomy of Pasteuria species.
Pasteuria spp. are Gram-positive with dichotomously branching, septate hyphae.
The terminal hyphae enlarge to form sporangia and eventually endospores (Sayre and
Starr 1985). Endosporesoccur in soil. As nematodes migrate through the soil, they
encounter endospores and when a suitable nematode host is present, endospores become
attached to the nematode cuticle. Attachment appears to be species specific. Penetration
of the nematode host is accomplished by the use of a germ tube produced by the
bacterium. This tube emerges through the central opening of the basal ring, penetrates the
cuticle and enters into the host’s hypoderrnal tissue. Eventually, hyphae grow into the
nematode pseudocoelm. Sporulation occurs when the nematode host has been almost
completely invaded by the vegetative growth (Ciancio 1995). The fecundity of infected
females is greatly reduced. Eventually the nematode body becomes completely filled with
mature endospores. These endospores are released back into the soil through
decomposition of the nematode cadaver. Endospores are resistant to heat and desiccation,

and remain viable in soil until a suitable host is encountered (Sayre and Starr 1985).

38

Pasteuria spp. have not been cultured in vitro. They are currently cultured on
their respective hosts under greenhouse or laboratory conditions. The inability to mass-
produce this bacterium under controlled conditions is partially responsible for its limited
development as a biological control agent.

The objective of this project was to sequence the 16s rDNA of Pasteuria for
phylogenetic analysis. This research may help to provide a genomic basis for the
relationship of species designated in the bacterial genus Pasterm'a, and for comparison to

other bacterial genera.

MATERIALS AND METHODS

A culture of Meloidogyne arenaria females infected with an isolate of P.
penetrans B4 was obtained from Dr. Don Dickson, University of Florida,
Entomology/Nematology Department. Approximately 15 endospore-filled females were
handpicked with forceps and place in a saline treated microfirge tube containing 50 111 of
sterile water. The females were then gently ground using a sterile Teflon microcentrifirge
tube sample pestle to release endospores, which were then enumerated on a
hemocytometer at 40x magnification.

To eliminate DNA fi'om any external contaminating microorganisms, spores were
treated with lysozyme, sodium dodecyl sulphate (SDS) solution, DNase, RNase, and
proteinase K (Ebert et al. 1996). The spores were then lysed by adding 1 volume of
phenol and 1 volume of 100 um glass beads to the microfuge tube containing the spores
and bead beating (Mini Beadbeater 8, Biospec Products) for 1 minute at 5,000 rpm

(Anderson, In press). The spore suspension was centrifuged for 5 minutes (Labnet

39

Hermle Z180, Fisher) and the aqueous layer was transferred to a new microfiige tube.
Adding 0.1 volume of 3M sodium acetate and 2 volumes of 95% ethanol to the microfuge
tube and placing the tube on ice for 10 minutes precipitated the DNA. The DNA was
collected by centrifirgation, air-dried and resuspended in 20 111 of TE buffer (pH 8.0). The
extracted DNA was then used as template for PCR amplification.

The 16s rDNA was amplified using the following primers (Rainey et al 1996): 27F
(5’ GAGTTTGATCCTGG CTCAG 3’), and 1385R (5’ CGGTGTGTRCAAGGCCC 3’),
which are both bacterial universal primers. Each reaction (25 ul) contained 1.0 ul of
purified DNA, 15 pmol of each primer, and 2.5 units of Taq polymerase (Gibco, Grand
Island, NY). The template DNA was amplified using a Gene Amp PCR System 2400
Therrno Cycler (Perkin Elmer, Norwalk, CT). The temperature conditions and cycles
were as follows: 4 minutes at 94 °C to activate the polymerase, 35 cycles of denaturation
(94 °C, 1 minute), annealing (48 °C, 1 minute), and extension (72 °C, 1 minute), and a
final extension (72 °C, 6 minutes). The final PCR products were treated with the Prep-A-
Gene DNA Purification Kit (Biorad) prior to sequencing. The PCR products were
checked using a 7% agarose gel stained with ethiduim bromide and viewed under an ultra
adangm

Sequencing reactions were performed using the Big Dye Terminator Cycle
Sequencing Kit (Perkin Elmer Applied Biosystems) following the manufacturers
instructions, using approximately 90 ng of purified PCR product per reaction. Primers
included 27F (5’ GAGTTTGATCCTGG 3’), 343R (5’ CTGCTGCCTCCCGTA 3’), and
1385R (5’ CGGTGTGTRCAAGGCCC 3’) (Rainey et al. 1996). Reactions were

precipitated in ethanol according to manufacturer’s instructions, resuspended in template

40

1385R (5’ CGGTGTGTRCAAGGCCC 3’) (Rainey et a1. 1996). Reactions were
precipitated in ethanol according to manufacturer’s instructions, resuspended in template
suppression reagent (Perkin Elmer Applied Biosystems) and analyzed on a Perkin Elmer
ABI 310 Genetic Analyzer (Applied Biosystems, Foster City, CA). Once sequences were
obtained, a BLAST net search of GenBank Sequence database was done for phylogenetic

analysis.

RESULTS

Partial 16s rDNA sequences were obtained for primer 27F and 1385R (Figure 1).
Primer 343R did not produce a usable sequence. The BLAST net search of the 16s rDNA
gene indicated that the sequence produced fiom P. penetrans B-4 was closely related to
Pseudomonas spp.

Although we were not successfirl in obtaining the sequence for the 16s gene,
several months of technique development and preliminary experiments did yield some
important information on how to work with Pasteurr‘a (Appendix C). This information
will be useful in fiiture research done on this bacterial parasite of plant-parasitic

nematodes.

DISCUSSION

The results of this Pasteuria sequencing research were inconclusive. The
amplified DNA did not produce a high quality sequence for phylogenetic analysis. It is
possible that the DNA extraction process was not effective. We were not able to

successfully establish a culture of this organism to use in this research. Because of this,

41

CONCLUSION

Additional research is needed to access the molecular taxonomy of the genus
Pasteuria. This is also important for development of a molecular probe for Pasteurr'a for
the use in survey work associated with biological control. A PhD. student in
Microbiology will continue this project, beginning in the summer of 1999. Success in the
development of a molecular probe may prove to be very effective in the detection of
Pasteurr'a in soil survey work done for the study of plant-parasitic nematodes in Michigan

crop production systems.

42

 

A. Primer 27F

 

GGCCTATCTGCAGTCGACCGGNAGAGAGGTGCTNGCNCCTCTCGAGAGCGNC
NGACGGGNGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACNGCTN
GGAAANGGACGCTAATACCGCATACCGTNCTACGGGAGAAAGCAGGGGACCT
TCGGGCCTTGCACACAC

 

 

 

 

B. Primer 1385R

 

CCCTCTCGACTAACCAGTGCCAGTANGCCTCAGNNGCATTACTCACCCGTGC
CGCTCGCTCTCAAGTAGGTGCAAGCACCTCGTCTACCGCTCGACTTGCATGT
GTTAGGCCTGCGCAGCGTNAANCTGAGCCGGATAAACTA

 

 

 

Figure 1. Partial 16s rDNA sequences from Pasteurr'a penetrans. Using primers 27F
and 1385R.

43

CONCLUDING DISCUSSION

Heterodera schachtii was detected in six of the top sugarbeet producing counties
in Michigan. The presence of this nematode may be a factor in the yield decline
Michigan has been experiencing over recent years. Increased sugarbeet production and
shorter crop rotations demand alternate strategies and tactics for managing H. schachtii
population levels. The research involved in this M.S. program investigated two
alternative methods of control, chemical and biological.

The nematicide trial demonstrated, after one year of data, that nematicides alone
will not provide sufficient control of H. schachtii. This indicates that management of H.
schachtii must be accomplished using an integrated approach, which is why I also looked
at the practice of using Pasteurr'a as possible biological control agent.

Pasteurr'a was not detected in Michigan populations of Heterodera schachtii
during the course of my M.S. program. However, with future research being done on this
bacterial parasite it may be possible to develop a molecular probe to aid in the detection
of Pasteuria in future soil survey work associated with plant-parasitic nematodes in
Michigan. Pasteuria may prove to have the ability to suppress nematode populations in
Michigan crop production systems.

Future research will be done to provide more information on the effectiveness of
nematicides for controlling H. schachtii populations. It is hopeful that more work will
be done in Michigan to help provide more information on the use of Pasteuria as a

biological control agent against plant-parasitic nematodes.

44

LITERATURE CITED

45

 

LITERATURE CITED

Anderson, 1. M., J. E. Maruniak, J. F. Preston, D. W. Dickson, and T. E. Hewlett. 1999.
Phylogenetic analysis of Pasteuria penetrans, a parasitic bacterium of root- knot
nematodes, by 16s r RNA Gene Cloning and Sequencing. Journal of
Nematology: 31 (In Press).

Anonymous. 1997. USDA Agricultural Statistics. Washington DC: US. Government
Printing Ofiice.

Anonymous. 1998. USDA Agricultural Statistics. Washington DC: US. Government
Printing Ofiice.

Berney, M. and G. W. Bird. 1998. Nematodes, pp. 71-79; IN: Cavigelli, M. A., S. R
Deming, L. K. Probyn and R. R. Harwood (Eds) Michigan Field Crop Ecology.
Michigan State University Extension Bulletin E-2646. 86 pp.

Bird, G. W. 1971. Influence of incubation solution on the rate of recovery of
Pratylenchus brachyurus from cotton roots. Journal of Nematology 3 :37 8-3 85.

Bockstahler, H. W. 1950. The sugarbeet nematode in Michigan. Proc. 6‘” General
Meeting of the Sugarbeet Technologists. pp. 479-480.

Caswell, E. P., A. E. MacGuidwin, K. Milne, C. E. Nelsen, I. 1. Thomason, and G. W.
Bird. 1986. A simulation model of Heterodera schachtii infecting Beta vulgaris.
Journal of Nematology 18(4):512-519.

Ciancio, A 1995. Phenotypic adaptations in Pasteuria spp. nematode parasites. Journal
of Nematology 27:328-338.

Ciancio, A., R. Bonsignore, N. Vovlas, and F. Lamberti. 1994. Host records and spore
morphometrics of Pasteuria penetrans group parasites of nematodes. Journal of
Invertebrate Pathology 63 2260-267.

46

Cooke, D. 1993. Chapter 4: Nematode parasites of sugarbeet IN: Evans, K. D. L.
Trudgill and 1. M. Webster (Eds) Plant Parasitic Nematodes in Temperate
Agriculture. CAB International, Wallingford. 648 pp.

Ebert, D., P. Rainey, T. M. Embley, and D. Scholz. 1996. Development, life cycle,
ultrastructure and phylogenetic position of Pasteurr'a ramosa Metchnikofi‘ 1888:
Rediscoery of an obligate endoparasite of Dcphm’a magna Straus. Philosophical
Transactions of the Royal Society of London Series B-Biological Sciences
351:1689-1701.

Grifiin, G. D. 1981. The relationship of plant age, soil temperature, and population
density of Heterodera schachtii on the growth of sugarbeet. Journal of
Nematology 13:184-190.

Hewlett, T. E., R. Cox, D. W. Dickson, and R. A Dunn. 1994. Occurrence of Pasteurr'a
spp. in Florida. Journal of Nematology 26:616-619.

Jenkins, W. F. 1964. A rapid centrifiigal-flotation technique for extracting nematodes
fiom soil. Plant Disease Reporter 48:692.

Knobloch, N. and G. W. Bird. 1981. Plant-parasitic nematodes of Michigan: With
special reference to the genera of the Tylenchorhynchinae (N ematoda). Michigan
Agricultural Experiment Station Research Report No. 419. 35pp.

Mai W. F., P. G. Mullin, H. H. Lyon, and K. Loefiler. 1996. Plant-parasitic Nematodes
A Pictorial Key to Genera (fifth edition). Cornell University Press, Ithaca, NY.
277 pp.

Miiller, J. 1991. Catch cropping for population control of Heterodera schachtii.
Proceedings of the 54m Winter Congress of the International Institute for Sugar
Beet Research, pp. 179-196.

Mulvey, R. H. and A. M. Golden. 1985. An illustrated key to the cyst-forming genera
and species of Heteroderidae in the western hemisphere with species
morphometrics and distribution. Journal of Nematology 15:1-59.

47

Norton, D. C. 1978. Chapter 4: Communities 1N: Ecology of Plant-parasitic Nematodes.
John Wiley & Sons, New York. 268 pp.

Rainey, F. A., N. Ward-Rainey, R. M. Krooppenstedt, and E. Stackenbrandt. 1996. The
genus Nocardiopsis represents a phylogenetically coherent taxon and a distinct
actinomycete lineage: proposal of Nocardiopsaceae fam. Nov. International
Journal of Systematic Bacteriology 46(4): 1088-1092.

Raski, D. J. 1949. The life history and morphology of the sugarbeet nematode,
Heterodera schachtii Schmidt. Phytopathology 40: 135-152.

Roberts, P. A. and I. J. Thomason. 1981. Sugarbeet Pest Management: Nematodes.
Special Publication 3272, Division of Agricultural Sciences, University of
California.

Sayre, R. M. and M. P. Starr. 1985. Pasteurr'a penetrans (ex Thome, 1940) nom. Rev.,
comb. N., sp. n., a mycelial and endospore-forming bacterium parasitic in plant-
parasitic nematodes. Proceedings of the Helminthological Society of Washington
52: 149-165.

Sayre, R. M. and M. P. Starr. 1988. Bacterial diseases and antagonisms of nematodes,
pp. 69-101; IN: G. O. Poinar, Jr., and H.-B. Jansson (Eds) Diseases of
Nematodes. CRC Press, Boca Raton, Florida.

Sayre, R. M., W. P. Wergin, T. Nishzawa, and M. P. Starr. 1991. Light and electron
microscopical study of a bacterial parasite from the cyst nematode, Heterodera
glycines. Journal Helmenthol. Soc. Wash. 58(1):69-81.

Schact, H. 1859a. Ueber einige Feinde der Riibenfelder. Ztschr. Ver. Riibenzucher-Ind.
Zollver. 9: 175-179.

Schact, H. 1859b. Ueber einige feinde and Krankheiten der Zucherrube. Ztschr. Ver.
Riibenzucher-Ind. Zollver. 9:239-250.

Shaw, H. B. 1915. The sugarbeet nematode and its control. Sugar Chicago, vol 17.

48

Steele, A. E. 1965. The host range of the sugar beet nematode Heterodera schachtii
Schmidt. Journal Am. Soc. Sugar Beet Technol. 30:573-603.

Steele, A E. 1984. Chapter 14: Nematode parasites of sugarbeet IN: Nickle, WR (Ed)
Plant and Insect Nematodes. Marcel Dekker, Inc., New York. 925 pp.

Stirling, G. R. 1991. Biological control of plant parasitic nematodes: Progress,
problems and prospects. Wallinford, UK: CAB International.

Thome, G. 1961. Principles of Nematology. McGraw-Hill Book Co. NY. 553 pp.

Tifit, M. J. 1935. The origin of strains of Heterodera schachtii occurring in Britain,
with special reference to the beet-strain. Journal Helm. 13:149-158.

 

Weischer, B. and W. Steudel. 1972. Chapter 3: Nematode diseases of sugarbeet 1N:
Webster 1. M. (Ed) Economic Nematology. Academic Press, London. 563pp.

Wyss, U., C. Stender, and H. Lehmann. 1984. Ultrastructure of feeding sites of the cyst
nematode Heterodera schachtii Schmidt in roots of susceptible and resistant
Raphamrs sativus L. var olerformr‘s Pers. cultivars. Physiological Plant Pathology
25:21-37.

49

APPENDICES

50

Appendix A

1998 SUGARBEET CYST NEMATODE SURVEY

AWWCW Monitor-Sugar Cow andlllclrlgan Slate (Jammy Cooperating

Site Information

Grower Name:

 

Address:

 

 

County: Township:
Section: Field ID:

Soil Texture

1997 Crop:

 

1996 Crop: .
1995 Crop:

Number of sugarbeet
crops since 1984

 

 

Sample Method Used (circle method) Symptoms-Signs Observed (check symptom-sign)

 

 

 

Stratified (No. 1) _Poor sugarbeet emergence‘or stand.
_Stunted or off-color shoot systeru.
Random (No. 2) _Underdeveloped or deformed taproots.
_Spots of wilted plants.
Fieldman Name: _Hairy-roots
_Low sugarbeet yield
Company: _Sugarbeet cyst females on root tissue
_None
Nematode Sample Results 100 cm3 soil 1.0 g root tissue

Sugarbeet cyst nematode cysts
Sugarbeet cyst nematode eggs and juveniles
Sugarbeet cyst nematode males

Other nematodes

 

Comments (Fieldman or MSU Nematode Diagnostician)

51

o o o 0 o . o 35.8% o .. 3.5... N 0.332 3.502 an
o o o . n o o 35.8% N m 3% 532 o .0380 3.502 N
. o c 2. n o o 35.8% . 3 5.0.50 m 5.8502 3.502 N
o . o o . v o 50031 N ON 3.30% o 550502 3.502 NN
. N o o o o o 50.58". N ON 3.30% o 5.8502 3.502 N
o 0 o 0 on o o 35.8% N N. 3% 532 n .0280 . 3.502 N
o o 0 v .3 m o 35.8% N 0 35.3... a .0280 3.502 «N
o o 0 m. .m o o 35.8% N N 3.6: 302 N .0380 3.502 N
o N o o .n N o 35.8% N m 008% 532 n .0280 3.502 N
0 v c N n o 0 E003”. v m 30.5... . 00.3.2 3.502 .N
o c 0 o o c on. 500.31 v N 5.302302 N Nam 3.502 8
o o o o N o 8N. 35.8% v NN 5.33.2.2 N Nam 3.502 o.
o o o o N. 0 EN 35.8% n N 5.33.38. N Nam 3.502 m.
o o o o c o . E0301 4 Nn 5.33.305 N Nam 3.502 N.
c o o c 0 o cow 50.50”. n m 3.502 N Nam 3.502 o.
0 o 0 o o o o 35.8% 4 Nn 550233. N Nam 3.502 m.
o o o «N NN o NvN 35.8% n m 3.502 N Nam 3.502 v.
o o o m. n c on 50.50.". v .. 3.502 N Nam 3.502 n.
o o o o. o o o 35.8% m 3 5.303.. N Nam 3.502 N.
o o 0 n N. . 0 85.23 4 cu 553.3: N 3m .2222 ..
o o o 0 on o 0 500:0”. m 0. 3:3» . 00.3.2 3.502 o.
o c o o o 0 we 35.8% v .. .080... . 0832 3.502 m
0 0 o 0 on o o 35.8% v .. 380.. . 00:02 3.502 o
o o .N «N .. o 0.. 35.8% m. 4. 3E3. . 00:02 3.502 N
o o 0 Nn N o o 35.8% v N 3:3... . 00:02 3.502 o
o o o 0 SN 0 N. 35.8% .. 8 3E0... . 0032 3.502 m
0 o 0 o m o 08.. 85.93 4 Nu Ease: N 3m 3522 v
o c 0 o o o 8N3 35.8% v NN 359.5 n. 0.003.. 3.50.2 n
o o o N .. o NNNv. 35.8% n o. 3.93... N 3% 3.502 N
o 0 o 0 .. o 0N3 E0000... v N 3.9.3... N New 3.502 .
350 53% 05m. 85% 5.. 3.3.. «.30 00502 80.6 .02 200% .93 023.500 >530 58500 .02

«50 32% .03 «3020.0... mam. .m 5032?.

52

 

o o o o o . o 35.8% 0 .. .35.... N 8332 3.502 on
o o o . n o o 35.8% N m 3% £32 n .0580 3.502 mN
. o 0 3 n o o 35.8% . X. .830 m 5.3502 3.502 mN
o . o o . v o .3053. N oN 353% m 5.30.32 3.502 NN
. N o o o o o .3003. N 0N 3.30% m 5.30.32 3.502 0N
o o o 0 on o o 35.8% N N. 3% .502 a 3:80 . 3.502 mN
o o o v .5 m o 35.8% N m 3.....3... n .0380 3.502 VN
o m o m. .w o o 35.8% N wN .33... 32 n 3.80 3.502 «N
o N o 0 .m N o 35.8% N m 308% .502 a 3.3.0 3.502 NN
o v o N n o o .303”. v m 3:3... . 3.32 3.502 .N
0 o o o o 0 on. .303... v NN 5.23232 N 3m 3.502 0N
o o o o mN o 3N. 35.8% v NN 5.2.3.3.. N Nam 3.502 m.
o o o o N. o omNN 35.8% n 3N 5.33.33. N 3m 3.502 w.
o o o o o o . .3053. v N.” 52323.. N Nam 3.502 N.
o o o o 0 0 00v .333. n m 3.502 N 3m 3.502 m.
o o o o 0 o o 35.8% v N» 5.2.3.33. N 3m 3.502 m.
o o o 3N NN o NvN 35.8% n o 3.502 N Nam 3.502 v.
o o o m. n 0 on .303... v .. 3.502 N Nam 3.502 n.
o o o o. o o o 35.8% a X. 5.2.3.33. N 3m 3.502 N.
o o o n N. . o 35.8% .. 3N 5.323.. N 3m 3.502 ..
o 0 o 0 on o o .303". m o. 3.3... . 033...... 3.502 o.
o o o o 0 0 9. 35.8% v .. 3.3.. . 083.2 3.502 o
o o o 0 on o n 35.8% v .. 3.3... . 3.32 3.502 w
o o .N vN .. o 0.. 35.8% n v. 3E3 . 3.32 3.502 N
o 0 o N... N o o 35.8% v 0N 3.3.. . 3.3.2 3.502 m
o 0 0 0 SN 0 N. 35.8% v 0N 3.3... . 3.32 3.502 m
o o 0 o m 0 30¢ 35.8% v NN 3.0.3... N Nam 3.502 v
o o o o o o owNo 35.8% v NN 3.35.. n. 3.03.... 3.502 n
o o o N c 0 NNNv. 35.8% o m. 3.0.3... N Nam 3.502 N
o 0 o o .. 0 ON: .303”. v NN 3.0.3... N 30 3.502 .
350 50% 3.1 8.0% c... 3.3.. «54.0 00.32 «00.0 .02 .30 .03... 023.300 >530 230.30 .02

3.30 32% .00» 33003.0... 33. .m 50.30%.

52

0 0 0 0 0 0 0N0N 85.2.0 . N 00.8.22“. N .00 0.20.... N0
0 0 0 0 0 N 0...... 20800 N N 0029.02“. N .00 .2202 .0
0 0 0 0 0 0 0N0N. 85.2.0 0 N. 00.8.22“. N .00 .220... 00
0 0 0 0 0 0 08 202.00 0 00 3.20.2 N .00 .220... 00
0 0 0 0 0 0 0N 20800 0 0 020.2 N .00 .220... 00
0 0 0 0 0 0 . 20800 N 0. 50022.00 N .00 .220... N0
0 0 0 0 0 0 . 202.00 N N. 205 2.2.0 0. 22.80 .220... 00
0 0 0 0 0 N. .. 20.200 v N .282 N .00 .220... 0...
0 0 0 0 0.. 0 0000 20800 0 0N 20> 2.000 0. 52.200 .2202 3,
0 0 0 0 . 0 008 85.2.0 0 N. 5002200 N .00 .220... 00
0 0 0 8 0 0 <NN0 85.2.0 .. 0. 50022.00 N .00 .220... N0
0 0 0 00 00. 0 00.0 85.2.0 0 0. 50022.00 N .00 .2202 .0
0 0 0 0N . 0 0N0. 85.2.0 N 0N 00.022. N .00 .220... 00
.. 0 0 0 0 N... 0 85.2.0 0 .N 020.... N .00 .2202 0..
00 0 0. 0 0 0 0 85.2.0 0 N. 8.02.2. 0 .0520 .220... 0..
0. 0 0 0 0 0 0 202.00 N 0. .2280 0 .220 0.20.... N0
0 0 0 0 0 0N 0 20800 0 N0 2.280 0 .0020 .220... 8
0 0 0 0 0 0 0 85.2.0 N 0 08.23 0 .0020 .220... 0..
0 0 0 0 0 0 0 2082... 0 N. 002020 0 .0020 .220... 3.
0 0 0 0NN 0 0 0 20800 v N. 0000.0 N .00 0.20.2 0..
0 0 0 8 0. N 0 20800 0 N . 02.0.... .220... N0
0 0 0 0 N. 0 0 20800 c 8 502.... . 02.02 .220... .0
0 v 0 N 00 0 0 85.2.0 0 N 5.33.300. N .00 .220... 0..
0 0 0 0 0.. 0 0 20800 0 ..N 0020 0 2.002.. .220... 00
0 0 0 0 0 0 0 85.2.0 0 0N .0280 N .00 .220... 00
0 0 0 NN 0 0 0 20800 c 0 .0800 N .00 .2202 N0
0 0 .. N0 00 0 0 85.2.0 0 0. .0280 N .00 .220... 00
0 0 .0 0. 0N0 0 0 85.2.0 0 0N 0.0200 N .00 .220... 00
0 0 0 0 0. 0 0 20080 0 0. 0.0200 N .00 .220... .0
0 0 0 0 0. N 0 20.200 v 0. .002“. N .00 .220... 00
0 0 0 0 00. 0 0 85.2.0 .. 0N .002“. N .00 .220... N0
0 0 0 0 00 0 0 20800 0 0N .002“. N .00 .220... .0
.050 20.0 00.0 .220 2.. 00.00.. 0.2.0 8.8.2 2.0.0 .02 .000 .03. 02.2000 .2000 5.2.200 .02

53

o N o o

o N o v

o 0. o o

o o o 0

o o o Np
o o c 3N
o o c 0'
o o o o

o o 0 ON w
o o o N

o 0 o o

o o o N

o c o o

o c c an
o o 0 ON?
o o 0 N0 F
o v o 0N
o o o 05
o c c 3N
o o {N v

c 00 v 3.
o o c on
o o o v

o c c #0
o c 0 N0
0 o o c

o N c c

o o o o

o c o o

o o o ON
a o o o

c o o N

.020 20.0 050 .220

VOOONNOSONOOO
P

@698”?
1-1-v- RN

OgOOOO’OOOO

OIDO

OOOV’V’OOOOO‘DOOOOOOOO

'- ('0

OONOOOOONOOON
F

own:

0 {NF
.3 _.
8N
mum?
awn

. _.
Non

0.00000 0
0.00000 0
800000 0
0.00000 0
0.00000 0
85.2.0 ..
005.050 0
0.00000 N
0.00000 0
0.00000 0
0.00000 .
E00000 0
85.2.0 0
005.020 N
005.020 V
85.2.0 N
00....an n
U055.“ N
69.5020 0
500000 .
00.50.20 0
00.5050 v
800030 0
00.5020 0
0.00000 .
0.00000 0
00.50.20 0
0.00000 0
00.50.20 0
0.00000 0
0.00000 0
00.50.20 0

ON

58*“2R"38“‘

NNPF'CDNv-Q
P

P

.02-Wing

SQ 00.00.. 3.30 00502 000.0 .02 .800

00.02 .0 0.
2002 .0 0.
00...... .z 0.
02.0.0.0“. 0
00.02 .0 0.
00220.00. 0
202.020 ..
0.000... 0
20028.0 0
0.000... 0
2000... 0
22.2020 ..
22.2020 0
20028.0 0
0000.2 0
20028.0 0
0.002020 ..
00220200000 ..
.2000 ..
.2000 ..
00220200000 ..
8.2.0 ..
00.002 ..
82.82... ..
82.825 ..
002.82... ..
00.8.22“. N
30002 N
2.0.8.22“. N
3209.000... N
00.8.02“. N
3200200.“. N

0230000

2000:...
2000:.—
2000:...
00......
20003..
00......
00......
00.3...
00......
00...:
00.5...
02:...
00......
00.2..
00.2..
00......
00......
02.000
02.000
02.000
02.000
02.000
02.000
02.000
02.000
02.000
>00
>00
>00
>00
>00
>00
30:00

=2 .0
=2 00
:2 N0
:2 .0
=2 00
:2 00
:2 00
=2 N0
=2 00
=2 00
:2 00
=2 00
=2 N0
=2 .0
=2 00
=2 2.
=2 0»
=2 2.
=2 2.
=2 0N
=2 1.
=2 0N
=2 NN.
=2 2.
=2 2.
.2 00
8000.2 00
02.022 N0
.2022 00
3000.2 00
3000.2 00
8000.2 00

>000500 .02

54

NOVOQOOQNOOV
.-

§8

0N0
3
Or

NV

9

OOOOODOOOOOOOOOOOOOOOOOOOOOOOOOD
OOOOOOOOOOOOOOQOOOOOOOOOOOOOOCOO
OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO

ONOQMOV’NONCD

.020 203 020 .220

SOOONVOOOONOOO
'- ‘-

ODODONzcccchGNOOW

OQOOOOOONNVONOQOOSENROVVooo
FNN

y.

OOOON

301
8.2
PNF

ONv
Ono _.
OOme
Ommoo
Out
00
monm
O

0..

0

O00
O03
O:
00

00.5050 p
£00000 0
00.5030 0
0055050 F
500000 .
0.00000 0
.000000 N
E0000”. 0
00.5050 0
00.5050 N
50000”. 0
00.5050 0
00.50.“ N
.000000 0
0.00000 0
00.5030 0
£00000 0
0.00000 0
0.00000 0
00.5050 0
00.5050 0
Eoucam 0
0.00000 0
0.00000 0
.000000 0
0.00000 0
800000 0
600000 0
£00000 0
00.5050 0

00.5050 0
0.00000 0

0w
0..
ON

c... 00.00.. 30>0 00505 000.0 .02 .500

.2005; n
c0>a>t_0n_ v
.000 ..
2.0.... ..
30.0000 2
8.2.0 ..
03000.02. ..
0.2.0 N.
.000 ..
00.2.20. ..
.000 ..
.000 ..
02202.0 0.
000.... 0.
050.0000 0.
02.2.0 .3 0.
000... 0.
000... 0.
5002.6. 0.
02202.0 0.
202.020 ..
00...... .z 0.
05030000 ..
00.030000 0
00...... .z 0.
02.2. .z 0.
.803) 9.
00...... .z 0.
02202.00 0
.005; v
202.020 0
00.02 .0 0.
.90—0

02.02.00

8.3.0
00.0...
02.000
02.000
02.000
02.000
02.000
..20 ..0
02.000
02.000
02.000
02.000
300.000
300.000
300.000
300.000
300.000
300.000
300.000
300.000
00...:
20000..
00.0:
00......
20000.0
20000..
2000:...
200005
00.0:
00.0:
00.0...
20000..

30000

_5 0N?
_5 0N?
_5 .N.
.5 0N.
_5 NNF
_5 «NF
_5 ON_.
_5 0:.
_5 0:
_5 h:
_5 o:
_5 0:.
_5 v:
_5 n:
_5 N:
_5 F:
_5 O:
_5 0O.
_5 0O.
_5 so.
_5 wow
_5 09.
.5 3..
_5 now
_5 Now
.5 _.O—.
_5 OO—.
_5 00

_5 00

_5 NO

.5 mm

_5 ma

>0000.00 .02

55

OD
N‘-

”OOEONOQOO
P

N
F

8°3'3°83§3§§§3°

OOOOOOOOOOOOOOOOOOOOOOOOOOOOOCOO
P

OOOCOOOOOOOOVOONOOOOOOOOOOOOOOOO
ONOOOOOOOOOOOOOOOOOOOOOOOOOOOCOO

3888

.050 .00.0 00.0 .0000

F

P

VOQNQOQNOOOOOOOONONOOOOQCOO”

N‘-

ONO”

828
v- N

COOEOONONOO

OOOOOOONOOOOOOOOONOO

500000 0
00.50.50 9
00.5050 0
0.00000 0
0.00000 0
0.00000 N
.000000 N
0.00000 N
00.50.50 0
00.50.50 0
0.00000 N
00.5050 0
0.00000 0
E00000 0
0050.50 0
0.00000 N
0.00000 0
800000 0
00.50.50 0
0.00000 N
0050.50 0
0.00000 .
00.5050 0
0.00000 0
0.00000 0
0.00000 0
0.00000 0
0.00000 0
0000000 ..
00.50.50 0
00.0.2.0 0
00.50.50 0

0N
0N
0N

h F
N0
N0
N0
.. P

N0
3

m
0N
NN
0
00
NN
0N
N
0

0.0 00.00.. 0.0.0 000.00. 000.0 .02 .000

0.000.... 0.
.0005. N
0.6.00.0“. 0.
0.00000. 0.
0.0000... 0.

00...? 0..
0052 0..
0052 0..

5.02 N
.0005 N

00.02 or

2.002 N

£08000 0..

00.0 0
0.00.00 0
0.02.00 0
00.0 0
0.000000 0
0.0.0.00 0
0.000000 0
0.00000 0
00.0 0
00.0 0
00000.00 0
2.0.0.0.. 0
o..0>0.0.. 0
2.0.0.0.. 0
0.0002. 0
0000.00 0
0000.00 0.
0000.00 0
0.000.... 0

.gk

0250000

0.0003.

>0m
0.00000
0.0000...
0.0000...
0.00030
0.0000...
0.0000...

>00

000
0.0000...
>00
0.80:...
00.0000.
00.0000.
003000..
00.0000.
02.0000...
003000..
003000..
020000..
003000..
003000..
.0005
.0005
.0005
.0005
.0005
.0005
.0005
.0005
.0005
50:00

.2 on.
.2 0......
.5 on.
.2 mm.
.2 cm.
.2 00..
.2 N0.
.5 .0.
.5 an.
.2 m:
.2 00..
.5 50..
.2 00.
.2 m:
.2 03
.2 03.
.2 N:
_5 .3
.5 00..
.5 00..
.2 mm.
.5 >0.
.5 on.
.5 mm.
.5 00..
.2 an.
.5 N0.
.2 PM.
.2 an.
.5 0N.
.5 0N.
_5 5N.

>00900o .02

56

0:.

OOOOOOOOOOOOOOOOOOOOOOOOOOOOODO
OOOOOOOOOOODOOOOOOOOOOOOOOOOOCOO
CDOOOOOOOOOOOOOOOOOOOOOOOOOOOOODO

2
350 :56 8.x .28

ONNONNOQOOONOOOOV‘OOOOOONOONOV’NO

COO”?OCONOOONOOOONOOOV’NONNOOCOOONO

o w
En. 8.3..

o

320 8522 2.20 .oz .38

Eoucam v
“5.585 F
602.3. m
Eoucum v
Eoucam c
top—=85 v
“55.8% v
00.58“ m
3.585 v
8851 v
Eoucam ..
“.0585 m
Eoucum n
8.58“ 0
602.5. m
8038 m
coc=8am v
60.585 m
U358“ m
5033... v
8351 v
Eon—am v
30.585 v
00:38“ v
Eoucam v
8351 n
uo=_.8.w v
Eoucam n
U258“ v
Eoucum. p
02585 v
8033. N

3
vw
F

5N
3
FN

v.9

5N
3.”
mm
m..
g
n

2
a

km

N
X"
vw
N

3
2.
9
an
3
«N
3
ON
or
2.
3
mm

asecaxcat 2
53> 23m 2
538.5 2
23585 2
£52529“. 2
3.3.5 2
328.5“. N
£535. 2
22.585 2
39> «Sam 2
55%: v
32.2, v
3.2.20 2.
535.3“. v
3.220 v
5:205. v
2:380 2.
>250: e
SEER". v
32.5.. v
«3528 2
835m 2
335$ 2
«3528 2
835m 2
88.4. 2
8.2.3 2
222m 2
.3555 2
8:22 2
8:2 2
«38.: 2

.9»... 023.500

325mm
32.53
32.63
32.53
32.53
32.65
>3
32.33
32.33
32.wa
:23...
:23:
:23...
:95...
:83...
:05...
:95...
:23...
:23...
:93:
«.33..
«.83...
«.33...
«.82...
«.32....
«.33.?
«.33...
«.82....
«.32;
3.23
«.33...
«.83...

.958

.2 o2.
.2 map
.2 m2.
.2 he
.2 on?
.2 m9.
.2 v3
.2 m3.
.2 N3.
.2 .b.‘
.2 cow
.2 mt.
.2 m:
.2 t...
.2 m:
.2 ms...
.2 v:
.2 n:
.2 ND.
.2 I...
.2 at.
.2 m9.
.2 wow
.2 how
.2 00—.
.2 m9.
.2 v9
.2 new
.2 N9.
.2 5w
.2 00—.
.2 amp

3.2.600 .oz

57

58

OOOOOOOOOOOOOOOOOOOOOOOO

8 v N 8. 822.8 2. N3 .226 3 8.28 .0222 EN
2. 2. N «3 822.8 m N3 .230 3 8.28 .2222 «N
o N o c 82.28 m N .280 3 0228 .2222 NFN
c N o 8 2228 m N3 8282s 3 2228 .2222 3N
8N 8 o m 2228 m 2 2>2< 3 8.28 .2222 SN
N o. N 8 828.8 8 MN 8282s 3 8.28 .2...22 8N
N o o 8:. 822.8 v 8 2222 N >8 .2222 SN
N o o c 82.2.8 2. NN 22.288 2 3228 .2222 SN
N N o N 8.228 e v 283» 9 2822 2222 SN
o o N «3 2228 m .. 22.288 2 8228 .2222 «8
N. N o o 8228 n N 8280 2 2832 .2222 .8
o c o 2 2228 v 8 2222 N >8 22.22 8N
N c o m 82.28 c N. 22> 2.28 2 8228 .2222 22
o o a m 82.28 2. 2 2222 N >8 .2...22 EN
2. o o 2 82.28 n 8 22.288 2 .2228 .2222 SN
8 v c N 82.28 a 8 2.222 N >8 .2222 83
o N o o 2228 m 8 22.22 3 8.28 .2222 83
SN 83 m c 82.28 m 2N 2>2< 3 8.28 2222 33
c o o o 2228 v 3N 22.22 3 8.28 .282 83
8 2 o «3 2228 m m .230 3 8.28 .2222 83
c o N 2 822.8 a 8N 22.88 a 82.82 .2222 33
o o o o 2228 2. 3 8.22. 9 208.2 .2202 83
2 o 8 o 822.8 2. 3 .222 2 283.2 .2205. N9
2N o N 2228 n 8228 N >8 .2222 33
28 2.28 2“. 228.. 88 8.8.2 2.20 .oz .28 .2: >280 2.828 62

Appendix 0.

Preliminary Experiments and Techniques developed for work with Pasteur-fa

Cultures of Pasteuria penetrans were obtained from the following researchers:

Dr. D. W. Dickson, Department of Entomology and Nematology at the University of
Florida, Gainesville.

Dr. Ken Barker, Department of Plant Pathology at North Carolina State University,
Raleigh, North Carolina

Dr. Greg Noel, Department of Crop Sciences at the University of Illinois, Urbana, Illinois.
Enzyme solution for dissolving plant root tissue to release infected females

5 ml 0.5 M sodium acetate pH 4.5
50 ul 1.0 M CaClz

45 ml distilled water

.034 g cellulase

2.5 g pectinase

4 grams root tissue

Solution was added to 4 g of root tissue and place on a mechanical shaker for 24 hours at
room temperature. Afier 24 hours, remove from shaker and wash with a steady steam of
water over nested sieves with 710 um and 38 um openings to release and catch infected

females from degraded root tissue.

59

Culturing Methods
Crushed 3 infected females to release spores in a 1.5 ml microfuge tube, then added 1.25
ml of distilled water contained approximately 1500 juveniles of Meloidogyne arenaria.

Placed microfuge tube on rotating machine to attach spores to juveniles.

This technique was not successful. The volume was too high and the spore concentration
was too low. There needed to be a smaller volume of spores, juveniles and water to
ensure a higher rate of attachment. Also, the spore concentration needed to be much

higher, but with limited material this was not possible.

DNA Extraction Attempts

Alkaline Lysis Na OH 60 °C for 5 minutes

Microwave spores for 5 minutes

Mortar and Pestle with glass beads

Saline treated microfiige tube containing 50 pl of sterile water and ground up glass beads

Mini beadbeater with glass beads and phenol for 1 minute

All of these techniques were unsuccessfiil, however the mini beadbeater was the

recommended way to break open spores. It is possible that this technique could work

with some modifications.

60

 

"i888Wiiliiiii“