2
E
—
—
=
—
—
—
—
_
—
—
—
—
—
—

 

THESIS

t
1

1111111111111111111111“ 1111111111111 1111111111?

31293 01771840 LIBRARY
Michigan crate
University

 

 

 

 

This is to certify that the

thesis entitled

SEQUENCING OF CANINE LOW MOLECULAR MASS PROTEASOMES (LMPS)
AND TRANSPORTERS ASSOCIATED WITH ANTIGEN PROCESSING (TAPS)
presented by

Sharon Keely Palmer

has been accepted towards fulfillment
of the requirements for

Master of Sciencedegree in Clinical Laboratory

 

 

 

Science
rprofessor
VIM/.0 GERW“

Date 5644/? 6’

0-7639 MS U is an Affirmative Action/Equal Opportunity Institution

 

 

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINE return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1/98 Cambium-M4

SEQUENCING OF CANINE LOW MOLECULAR MASS PROTEASOMES (LMPS)
AND TRANSPORTERS ASSOCIATED WITH ANTIGEN PROCESSING (TAPS)

BY

Sharon Keely Palmer

A THESIS

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degreee of

MASTER OF SCIENCE

Department of Medical Technology

1998

Abstract

SEQUENCING OF CANINE LOW MOLECULAR MASS PROTEASOMES (LMPS)
AND TRANSPORTERS ASSOCIATED WITH ANTIGEN PROCESSING (TAPS)

BY

Sharon Keely Palmer

The immune system is responsible for recognition of
self vs. non-self and the elimination of detected foreign
matter (Germain, Janeway). In humans, it is the Major
Histocompatibility Complex (MHC) genetic products that
regulates the immune responses. The MHC consists of three
separate genetic regions, MHC-I, -II and —III (Trowsdale).
Canines possess the Dog Leukocyte Antigens (DLA). The DLA
is the canine equivalent to the human MHC and can be divided
into the DLA-A, -B, -C and -D (Bull, Deeg).

Previous studies have shown genetic conservation can be
noted between the DLA and MHC. In humans the endogenous
immune response involves the genetic II region of the MHC,
more specifically the low molecular mass proteasomes (LMPs)
and transporter associated with antigen processing (TAPS)
genes. Using human primers to the two genes, we were able
to amplify canine genomic DNA via PCR. Purified amplicons
were sequenced using LPCR (linear polymerase chain
reaction). It was found that the canine LMP-2 has a 74%

homology to that of the human LMP-2.

Dedication

In loving memory of Minnie O. Keely, Isabel Dement and Rose
Starwasz.

May I always make you proud

in

.Acknowlodgnants

I would like to express my gratitude to Dr. John
Gerlach. His constant support, encouragement and valued
suggestions meant more than he could possibly realize.

I would like to say a special thanks to Dr. Robert Bull
and Doug Estry for their time and support. Their being a
part of my research was greatly appreciated.

Lastly, I would like to thank my husband for his
unconditional love and support. In some ways, this degree

is just as much his as it is mine.

Table of Contonts

LIST OF TABLES ........................................ Vi
LIST OF FIGURES ...................................... Vii
INTRODUCTION .......................................... 1
HUMAN MHC ........................................ 2
MHC GENE II MAPPING .............................. 3
PRESENTATIONS TO T CELLS ......................... 5
EXOGENOUS PATHWAY ................................ 5
ENDOGENOUS PATHYWAY .............................. 7
FUNCTION OF LMP .................................. 7
FUNCTION OF TAP .................................. 8
CHAPERONES ....................................... 10
COMPARISON STUDIES ............................... 13
HLA DISEASE STATES ............................... l4
OBJECTIVE ........................................ l6

MATERIAL AND METHODS

DNA ISOLATION .................................... 17
PCR PROTOCOLS .................................... l9
FIDELITY OF AMPLIFICATION ........................ 23
ELUTION OF PCR PRODUCTS .......................... 24
LINEAR CYCLING SEQUENCING ........................ 25
SEQUENCING GEL ELECTROPHORESIS ................... 26
AUTORADIOGRAPHS .................................. 27
SEQUENCE WALKING ................................. 28
ANALYSIS AND COMPARISON .......................... 28
RESULTS
PCR RESULTS ...................................... 29
SEQUENCING RESULTS ................................ 32
LMP-2 ............................................. 33
COMPARISONS CANINE TO HUMAN LMP-2 ................. 39
CANINE LMP, CANINE SINE ........................... 42
DISCUSSION
LMP-2 HOMOLOGY ................................... 43
DISCUSSION OF SINES .............................. 44
RECOMMENDATIONS ....................................... 48
LIST OF REFERENCES .................................... 50

Table 1.

Table 2.

Table 3.

LIST OF TABLES

PCR Primers .................................
PCR Cycling Protocols .......................

PCR Fragmentation Size, Human and Canine

Figure
Figure
Figure
Figure
Figure
Figure
Figure

Figure

Figure

Figure

Figure

10.

11.

LIST OF FIGURES

MHC CLASS II LOCI ......................... 4
Endogenous Pathway ........................ 12
6% PAGE of LMP PCR ........................ 30
Sequencing Autoradiograph ................ 32
Canine LMP-2 Sequence ..................... 36
Canine LMP-2 FastA Results ................ 38
Canine LMP-2 NIH Blast Results ............ 40

Bestfit Canine LMP-2 to Human
LMP-2 Part I ............................ 42

Bestfit Canine LMP-2 to Human
LMP-2 Part II ........................... 43

Bestfit of Canine LMP-2 and
Canine SINE ............................. 48

Bestfit of Mouse LMP-2 and
Mouse Repetitive Unit ................... 47

INTRODUCTION

The immune system is responsible for the recognition of
self, non-self and the elimination of foreign material
(Germain, Janeway). Detection of foreign material within a
host stimulates a sequence of signaling events which
assists/aids in the processing of antigens and invokes the
immune response. Transplantation of organs or invasion of
the host by pathogens can set into motion the immune
response.

The Major Histocompatibility Complex (MHC) plays a
central role in the immunological response to foreign
proteins (Trowsdale) as well as autoimmune disorders. The
MHC is the genetic region where the class I, II and III
genes are located. Genes in the MHC encode proteins that
process and present immunogenic peptides (Trowsdale). It is
believed that all vertebrates possess MHC genes (Trowsdale,
Powis).

Several comparative studies have shown that the MHC is
well conserved within vertebrates (Trowsdale, Polvi). The
species comparison includes cattle (Anderson), sheep
(Anderson), rat (Howard), goat (Anderson), rabbit (Chabbane)
chicken (Kroemer), red deer (Swarbrick), and canine
(Sarmiento). The MHC, however, is best known in humans and

mice (Trowsdale).

In humans, the MHC is also referred to as the human
leukocyte antigen complex or HLA (Klein). The human MHC is
located on the short arm of chromosome 6. It is estimated
the entire MHC spans over four million base pairs (Klein).
There are over one hundred known genes within the MHC. On
average, a gene can be located every 40 kilobase (kb),
though the kilobase may vary depending on the region of the
MHC (Marshall). As advances are made in detecting coding
sequences (Marshall), it is likely more genes will be
located.

The human MHC can be divided into three separate class
regions: MHC-I, MHC-II and MHC-III. The HLA genes are
important in tissue and organ transplantations as well as
both autoimmune and non-autoimmune disease associations
(Marshall). The highly polymorphic HLA genes A, B and C are
located within the MHC I region. The HLA DP, DQ and DR
genes, which are also highly polymorphic, are within the MHC
II region (Trowsdale). Other genes within region II include
TAP, transporter associated with antigen processing, and
LMP, low molecular mass proteasome (Monaco). Class I and
class II gene families are separated by approximately 1100
kb encoding gene of the class III region (Cross). Class III
region encodes proteins also involved in immune responses

(Trowsdale, Cross). Genes such as complement proteins C2,

Factor B and C4 and the tumor necrosis factors (TNF) A and B
(Cross).

The H2 complex, the MHC in mice, is organized similar
to that of the human MHC (Trowdales). Other than lacking
the DP loci and having two Mb genes, the class II region
resembles the human class II region.

Cattle MHC is termed BoLA or bovine lymphocyte antigen
and is divided into four regions: class I, IIa, IIb and III
(Anderson). In class IIa region, there are the DRA and DRB
genes as well and DO genes. The class IIb region is where
the LMP-7 gene can be located (Trowsdale).

The RLA or rabbit leukocyte antigen maintains a class
II region. Again like the species mentioned earlier the DP
and DR genes are represented (Trowsdale).

The MHC in the canine is termed DLA or Dog Leukocyte
antigens. The DLA is characterized by three serologically
defined loci, DLA—A, -B, & -C (Bull) and a fourth loci, DLA-
D (Deeg). The class I and class II DLA studies have
discovered genes which are homologous to the human MHC as
well as other species (Polvi, Trowsdale, Burnett).

The human class II region consist of the DP, DR and DO
genes with the TAPS and LMPs genes being located between DP
and DQ as shown in Figure 1. Previous studies have shown
canines possess DR, DP and DO genes similar to that of

humans (Sarmiento, Wagner). Seeing that the MHC is believed

Figure 1

 

RINGS
TAP]. MP7
DP GENES LMP2\ \fDOB DQ GENES DR GENE
W 111“ E1! ll W111 !
300kb 160m 1 900 kb

of the MHC

Figure 1. Human MHC Class II. Above is an illustration of
the MHC class II region. One can note the close proximity
of the genes. Comparison studies have shown that the canine
possess homologous the DP, DP and DQ genes in humans. Our
study was to detect and sequence the TAP and LMP genes of
the canine.

to be a conserved region processed by all vertebrates, it is
our hypothesis that canines also do maintain the genetic

backbone for the class II encoded region for TAPs and LMPs.

Processing and Presentation of Antigens to T Cells

T cells require antigens to be recognized in the
context of self-encoded cell surface molecules produced from
genes in the MHC (Monaco). Two immunological pathways,
endogenous and exogenous, exist within vertebrate cells to
generate antigenic peptides for recognition by T cells
(Monaco, Rudensky). The generation of antigenic peptides,
presenting molecules and lymphocyte recognition vary between

the two pathways (Neefjes).

Class II-Exogenous Pathway

 

Exogenous pathogens, such as Mycobacteria, enter the
antigen presenting cells (APC) via extracellular domains.
This process begins with the exogenous antigen being
engulfed by endocytosis (Janeway). The exogenous antigen
are degraded into antigenic peptides, usually 13-18 amino
acids in length, by the endosomal/lysosomal degradative
process (Monaco). The acidic pH in the endosome/lysosomes
contributes not only to the antigen degradation but also the
efficiency of the peptide binding to the MHC class II

molecule groove (Neefjes).

The MHC class II molecules are constructed in the

endoplasmic reticulum (ER). The Class II Molecules are
assembled from a, B and Ii (invariant) chains. The Ii chain

is associated transiently to the heterodimer and prohibits
the binding of peptides in the ER to the Class II molecule.

In the ER, the Ii chains associate as a homotrimer. The
homotrimer forms a complex with three a8 heterodimers.

(Neefjes). The nine subunit complex is transported from the
ER through the golgi apparatus to the trans-golgi reticulum
(Neefjes). As the unit is traveling from the ER to the
trans-golgi reticulum, Ii chain is degraded by endosomal
proteases. The MHC class II molecule remains associated
with a fragment of the Ii chain, referred to as CLIP
(Fremont). From the trans-golgi reticulum, the MHC II
molecule-CLIP travels via vesicular transport to the
lysosome where it can bind to the antigenic peptide (class
II-peptide). Foreign proteins enter this vesicular system
either from the golgi or via extracellular endocytosis
(Fremont) and are degraded into peptides. The peptide must
have the correct sequence motif in order to compete with the
CLIP for the binding groove. Once the peptide-class II
complex is formed, it then travels to the APC surface and is
presented to the CD4+ T lymphocytes. The CD4+ T helper
cells do not kill the infected cells directly (Janeway). T

helper cells, either Th1 or Th2, recognize the class II-

bound peptide and activate the immune response. Th1 cells
will activate the APC and the APC in turn will destroy the
invader. Th2 cells may activate B cells in order to have

antibodies produced.

Class I-Endogenous Pathway

 

The class I immune response involves the processing of
cytoplasmic pathogenic proteins by proteasomes, a multi-
subunit protease located in the cytoplasm of most cells.

The 26s protease complex is_made up in part by the 205
proteasome. This 205 proteasome has a cylindrical structure

with four layers of ring, each which is composed of seven

subunits (Kandil). The outer rings are the a subunits and
the inner two rings are composed of the B subunits. This is

where the proteolytic core/catalytic sites reside. The B

subunits are also known as the low molecular mass

polypeptide or LMP—2 and LMP-7.

Expression of LMPs is increased by 7—interferon or IFN—
Y (Kandil, Robertson). Cells, which have been stimulated by
IFN-y, will incorporate the two MHC encoded LMP-2 and LMP-7
subunits (Kandil). This is thought to occur by the

displacement of the housekeeping subunits 5 (subunit 2) and

M81 (subunit 10) within the proteasome (Kandil).

Proteasomes containing LMPs are able to cleave
antigenic peptides (Monaco). Antigenic peptides are usually
cleaved to be 8-15 amino acids in length with a hydrophobic
carboxy-terminal residue (Monaco, Kandil, Carreno). This
cleavage permits the binding in the F pocket of the MHC
class I molecule. The F pocket is the groove, which peptide

fragments of antigen interact with MHC molecule. More
specifically, the groove consists of the al and a2 heavy

chains. It is here that the antigen peptide will be
positioned so it will be available for recognition by the
CD8+ cells.

The next step for antigen processing/presentation
involves the class II genes TAP-1 and TAP-2 (transporter
associated with antigenic processing). The antigenic
peptides are translocated from the cytosol of the cell to
the lumen of the endoplasmic reticulum and possibly the cis-
Golgi. This action is completed by a TAP heterodimer. The
heterodimer contains two subunits, TAP—1 and TAP-2. Each
subunit consist of a transmembrane segment, which spans the
membrane 6-8 times, and a cytosolic domain containing ATP-
binding cassette (Androlewicz, Carreno, Suh).

The TAP transport of the ligand is ATP dependent.
Studies have shown that the peptides ranging from 8-15
residues are transported efficiently with some sequence

preferences (Suh, Carreno). Peptides with H (histidine) or

E (Glutamic acid) as the COOH-terminus residue are
translocated more efficiently than peptides with the residue
of T or Threonine (Momburg, Neefjes). Chemical
characteristics of the ligand, such as distance between N
and C terminus of the peptide, also influence TAP transport
(Germain). Each of these specific findings suggest that TAP
has some polymorphic features which influence the binding of
the ligands to the class I molecules.

Class I molecules are assembled in the ER. One
important characteristics of the class I molecule is that
the cell surface expression is distinguished by
extraordinary protein polymorphisms (Burnett). The

heterodimer consists of a polymorphic transmembrane heavy

chain (45kD) and a noncovalently associated Banicroglobulin
(Genmain). The Banicroglobulin is a 12kd non-MHC encoded,

soluble protein. The heavy chain consists of three a
domains, each of which has interactions with the
Bzmicroglobulin. The (11 and (12 domains together form the
antigenic peptide groove. Class I molecules will undergo a
complex series of interactions prior to presenting the
antigenic peptides to the CD8+ cells. These interactions
include chaperones molecules calnexin, tapasin and
calreticulin (Sadasivan).

The free class I molecule first assoiciates with

calnexin. Calnexin, also known as p88 molecule, is a

resident protein of the ER (Solheim, Song). Its role it to
assist with the assembly and/or folding of the heavy chain
(Solheim). It is also thought that calnexin plays a
protective role in that it stabilizes the heavy chain and
prevents intracellular degradation. Studies, however, have
shown that calnexin negative cell lines are able to process
and present antigens, proving calnexin may not be essential
(Sadasivan). The current opinion is that another chaperone
molecule similar to that of calnexin, such as BiP
(immunoglobulin binding protein) may functionally replace
calnexin when calnexin is not present.

Tapasin is a chaperone protein that is required for

class I assembly. Studies have shown that tapasin bridges
the heavy chain/Bzmicroglobulin dimers and TAP (Sadasivan) .

It has also been suggested that tapasin assists with peptide
loading and/or monitoring of the folding of the class I
molecule (Solheim).

Another chaperone molecule is calreticulin. It is

structurally related to calnexin. Calreticulin associates

with the heavy chain/anicroglobulin and TAP (Solheim). An

association of the class I heavy chain/anicroglobulin

dimers with calreticulin is a prerequisite for the

association with TAP via tapasin (Sadasivan).
Once the class I heavy chain/Bzmicroglobulin-antigenic

peptide complex is associated within the ER, the complex is

10

transported from the ER to the surface of the cell via a

constitutive secretory vesicle. The role of the class I
heavy chain/Bflnicroglobulin is to present the antigenic
peptide on the surface of the APC to cytotoxic lymphocyte
CDB+ cells. The a3 domain of the heavy chain associates

with the APC for specificity recognition. For further
illustration, see Figure 2. Polymorphic residues are
positioned so that when presented by the MHC class I
molecule, the antigenic peptide will line the floor and

sides of the peptide binding groove (Newton-Nash). The
groove itself consists of the al and a2 domains.

Polymorphisms of peptide sequences concerning the anchor
amino acids as well as side chains and the stoichiometry all
play a significant role in the antigen presentation and
recognition by APC.

It is possible for the endogenous antigenic peptides to
be presented to CD8+ without certain aspects of the pathway,
though the efficiency and effectiveness of the immune
response may be hindered. For instance, cells with impaired
TAP function express low levels for surface MHC class I
complexes (Wolpert). Most of the MHC class I molecules are
retained in the ER, few are transported to the surface.
These MHC class I molecules are often referred to as empty

or peptide receptive (Wolpert). Case studies have shown

1]

Figure 2

V

cns+ Lymphocyte

   
  
   
 

antigen presenting cell (APC)

transport vesicle

 

 

‘fr

tapasin g I; endoplasmic

3—» ... .

g ) Eire? \ reticulum

calreticulin Fifi \
Proteasome \ v MHC class I
(me2 & me-7) molecule
mmmmm:

AW

9.3.4,; ill. .._' peptjde
/ V"\_AA-_tl‘\r

Protein Tap
heterodimer

Calnexin

- _ , -t I
n -4 I." I
. ‘ I
I. . 2'!
, =. h. a, ’
t . .
'I}
"I b '.
I”
..
I I

heavy chain BzMicroglublin

cytosol

 

Figure 2. Endogenous Pathway. Above is an illustration of
the endogenous pathway, representing the processing of
antigenic protein and antigen presentation. The protein is
degraded within cytosolic proteasome, transported into the
ER via TAP heterodimer, binds to MHC class I molecule, which
travels to the cells surface to present the antigenic
peptide to the CD8+ cells.

12

that persons with defected or absent TAP heterodimer are
more susceptible to certain pathogens (Schmitt).

The 208 proteasome consist of 14 subunits, one of which
is LMP-7, another of which is LMP-2 (Groettrup). It is
possible for the 205 proteasome to cleave antigenic peptides
without LMP genes or with defective LMP genes. The
degradation and cleavage priority, however, may be altered
(Groettrup).

These types of defects in the MHC genes can lead to
severe immunodeficiency syndromes or predispose the person
to autoimmune afflictions. It is also possible however,
that the defects in the genes are so minor, that no

phenotypic changes can be noted in the patient.

Comparison Studies

In 1967 the first report of HLA associated disease was
announced by Amiel (Thorsby). Today, the references include
more than 500 disease states. For many, the disease
associations are weak. Several, however, are strong. The
pathogenesis for the substantial HLA association may involve
one or more of the MHC genes (Thorsby). Strong HLA
associated disease states include: ankylosing spondylitis
(Ploski), Reiter's disease (Thorsby), acute anterior

uveitits (Thorsby), subacute thyroiditis (Thorsby),

l3

psoriasis vulgaris (Thorsby), narcolepsy(Thorsby) , Graves’
disease (Thorsby), myasthenia gravis (Thorsby), Addison's
Disease (Thorsby), rheumatoid arthritis (Thorsby), juvenile
rheumatoid arthritis (Ploski, Thorsby), celiac disease
(Tighe, Thorsby), multiple sclerosis (Moins-Teisserenc,
Middleton, Thorsby) and diabetes, type I (Thorsby).

Though canines are not subject to all of the
afflictions given above, advances in human genetics can
affect the progress in other species. Concerning the
disease states that do cause pathological conditions in
canines, such as diabetes, knowing the disease HLA
association may lead to advances in veterinary medical
diagnosis and treatments.

Each animal species has a specific number of
chromosomes, the arrangement of genes are similar for all
species. This is known as genetic conservation. Because of
genetic conservation, researchers are able to use animals
for human medical models and humans for animal medical
models.

Canines are an excellent model for medical comparative
studies. This is true for several reasons. 1. Canines can
possess phenotypic traits that might not be seen in smaller
animals (Das). 2. There are known genetic similarities
between humans and canines (Wagner) as well as other

species. 3. Certain pathological states, which are thought

14

to be genetically related to MHC mutations, can be seen in
human and as well as canines (Dean).

Canines maintain class I molecules which have the
arrangement of exons and introns, as well as expected
protein sequences (Burnett). Since the class I molecules
sustains an important role with regards to antigenic
presentation and the furthering of the immune response,
structural integrity is essential. Structural analysis
found 3 complete MHC class I genes. Each of the 3 genes was
shown to be transcribed in canine peripheral blood
leukocytes.

Other studies used HLA-monoclonal antibodies to canine
lymphocytes (Chouchane). With the use of flow cell
cytometry, they noted that a cross reactivity was detectable
to canine lymphocytes using anti—human CD8+, thus suggesting
that canines have CDB+ cells.

Other MHC related canine studies have been concentrated
in the regions of the DR, DP and DO genes. These studies
have confirmed that canines posses the DR, DP and DO genes
(Williamson).

Since canines have both CD8+ cells and functional MHC
class I molecules, we know that the end results of the
endogenous pathway is comparable to that in humans. There
is also further evidence of genetic conservation within the

DR, DP and DO regions. With the DR, DP and DQ genes being

15

located within close proximity to the TAPS and LMPs in
human, the theory of genetic conservation would lead us to
believe that canines should indeed have both the genes for
TAPS and LMPS.

Given our background knowledge, the objective of this
study was to detect and sequence canine TAPS and LMPS. This
was to be completed by the use of PCR. The PCR utilized
human primers specific for the TAP and LMP genes. These
primers were to amplify homologues in the canine species.
Amplicons generated were sequenced and compared to DNA in
Genbank to verify fidelity to that of the known sequences.

The percent homology was then calculated.

l6

MATERIAL AND METHODS

Obtaining Blood Samplaa

Blood samples from both canine and human subjects were
obtained via venipuncture. Samples were collected in ACD
tubes. Blood samples were centrifuged in a swinging bucket
rotor (IEC,USA) for 20 minutes at 750x gravity (g). Buffy
coats were transferred into 15 ml (milliliter) conical
polypropylene screw cap tubes (Corning, Inc.; Corning, NY).
Red cell lysis was accomplished by adding 100 millimolar

(mM) Tris ammonium chloride to the tubes (total volume of 15
ml) and incubated for 5 minutes at 37 degrees Celsius (°C).

After incubation, the samples were centrifuged at 200x g for
20 minutes. The supernatant was discarded and the white
cell pellet was retained for genomic deoxyribonucleic acid

(DNA) isolation.

DNA Isolation

A DNA salt extraction method (Trucco) was used to
obtain genomic DNA from purified peripheral white blood
cells. WBCS were washed once with DPBS (DPBS without
calcium or magnesium) and centrifuged at 225x g for 20
minutes. The supernatant was removed without disturbing the
pellet and the cells were resuspended in the residual

liquid. Lysis solution (0.375ml of per ml of whole blood

17

collected), 20% SDS (18.75ml per ml of lysis solution) and
1.5ul of Proteinase K were added to the cells. The tubes

were inverted and placed on a rotator for 30 minutes at 37

°C. The tubes were removed from the rotator and were

incubated 2-8 hours at 37 °C.

After the long incubation, 100 micrograms/milliliter

(ug/ml) of DNase free RNase was added and the samples
incubated for 1 hour at 37 °C. Next 0.125ml of saturated 6

Molar (M) NaCL solution (per ml of whole blood collected)
was added and the tubes were shaken for 10 second. The
samples were centrifuged at 850x g for 10 minutes. The
supernatant (DNA) was poured into sterile tube and the
remaining pellet (protein) was discarded. The supernatant
was centrifuged again at 850x g for 10 minutes.

The supernatant was transferred into a glass
borosilicate tube. A 2x volume of cold, absolute ETOH was
added to each sample to precipitate out the DNA. The DNA
samples were transferred to microtube with plastic transfer
pipette and washed twice with 90% ETOH. The pellet was
dried by dry vacuum for 5-17 minutes without heat. The DNA
was resuspended in 100 millimolar (mM) Tris HCL and
incubated overnight at room temperature.

The quantity and quality of DNA was determined by
spectrophotometric analysis. One microliter (ul) DNA was

diluted 1:200 with distilled deionized water (ddHfiN.

18

Absorbance (A) readings of the DNA solution were taken at

wavelengths of 280 nanometers (nm) and 260 nm. Quality of
DNA was determined by the absorbance ratio at 280 to 260 nm.
DNA was quantified at 260 nm. DNA samples were diluted with
ckflho for a final concentration of 1.0 microgram per
microliter (ug/ul) as calculated by the formula:

[(A260)/(200/1)(50 UQ)l/1000 ul= Xug/ul.

Genomic DNA Amplification by Polymraaa Chain Raaction

Both human and canine genomic DNA were amplified using
the same procedures and standard amounts of reagents. Human
DNA was the positive control. The negative control used
<nnno in replacement of the genomic DNA. 1.0 ug of DNA was
utilized for each of the polymerase chain reactions (PCR).
A combination of Hot Starts (Perkin Elmer) and Touchdown
methods (Becker, 1996) were used to produce higher yields of
specific PCR amplified products. PCR amplification was
performed with the Gene-Amp PCR system Perkin Elmer 9600
(Perkin Elmer Cetus; Norwalk, VA). The primers used are
illustrated in Table 1.

PCR amplification was completed in 0.2 ml thin walled
reaction tubes with a total volume of 100 ul. Reaction
mixture was set-up as follows: Part I 1). 10 ul of genomic

DNA (1 ug) samples or 10 ul ddHfiD for the negative control

19

Table 1

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Human Sans. Anticanaa Rafaranca
Primate
LMP 2 tctcctttgcatatcccaat cacagctctagggaaactc VanEndert
LMP 7 cagaaagggcacgctcttgt agagaacacgcagaacat Fruh
TAP 1
Set A ggcgtccgagtgccaatg gttctgttggaaaaactccg Colonna
tc
Set B gggtgacgggatctataaca cagcccctgtagcactaag
Set C agtggtctgttgactccctt gcgcaggtctgacaaggc
TAP 2
Set A agagacggagcggacctc atccgcaagttgattcgaga Colonna
Set B ccgaggaggctgcttcac accaggacgtagggtaaac
Set C tctcctttgcatatcccaat cacagctctagggaaactc
Table 1. PCR Primers. The above primers were used in the

PCR process.

gene,

to 3'

form.

Protocol for

TAP-l and TAP-2 primers expand the entire
whereas the LMP-2 and LMP-7 do not.
concentrate on a certain region of each gene.
and antisense are in 5’

The LMP primers
Both sense

cycling

for each primer listed above can be found in Table 2.

20

 

2). 65 ul of reaction mix consisting of 10 ul of 10x
reaction buffer (500 mM KCl; 100 mM Tris—HCl, pH 8.3; 15 mM
MgC12: 0.1% gelatin), 8 ul of deoxynucleotide 5'
triphosphate (dNTP mix), consisting of 100 mM deoxyadenosine
5’-triphosphate (dATP), 100 mM deoxycytosine 5' triphosphate
(dCTP), 100 mM deoxyguanosine 5' triphosphate (dGTP), 100 mM
deoxythymidine 5’ triphosphate (dTTP), 27 ul of ddH20 and 5
ul of each of the 20 uM paired sense and anti sense primers.
Part II Gem 5O wax beads (Perkin Elmer, Branchburg, New

JerseY), were then added to the each 0.2 ml reaction tubes.
Tubes were capped and placed in a heating block at 80 °C

until the wax melted (approximately 5 minutes). Tubes were
removed from the heating unit. Wax was allowed to cool at

room temperature. Part III Using the hot start methods, an

 

additional mixture of 34 ul ddHfiD and 1.0 ul (5 units)
Thermus aquaticus (Taq) DNA polymerase (Perkin Elmer,
Branchburg, New Jersey) were placed on top of the harden
wax in each reaction tube.

Prior to cycling, tubes were incubated at 95 °C for 5
minutes to allow melting of the wax barrier and the mixing
of reagents. The Denaturing temperature was programmed for
94 °C for 30 seconds. Annealing temperatures and time

varied depending on the primer pairs (see table 2) in order

to obtain specific and high yielded products. Each primer

2]

Tabla 2

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Initial Incubation Denaturation Annealing Extension Cycles
950hold-5min 94C-11sec SQC-BOSec 720-303ec 12
940-11sec SBC-BOsec 72C-303ec 12
94C-11sec 57C-30sec 72C—30sec* 12
SSChold-Smin 94C-11sec 590-305ec 720-305ec 12
940-11sec 58C-303ec 720-305ec 12
94C-11sec 57C-303ec 72C-305ec’ 12
94Chold-5min 94C-305ec 530-60sec 720-60sec 12
940-30sec 520-605ec 720-605ec 12
94C-30sec 51C-603ec 72C-30sec* .12
950hold-5min 940-11sec 57C-305ec 72C-305ec 12
940-11sec SGC-BOsec 720-305ec 12
94C-11sec 55C-30sec 72C-30sec” 12
950hold-5min 940-11sec 590—30sec 72C-30sec 12
940-11sec 580-305ec 72C-305ec 12
94C-11sec 57C-30sec 72C-30sec" 12
95Chold-5min 940-11sec 590-303ec 72C-305ec 12
940-11sec 58C-303ec 72C-305ec 12
940-11sec 57C-3OSec 72C-30sec" 12
94ChoId-5min 940-11sec 59C-303ec 720-303ec 12
940-11sec 58C-305ec 72C-305ec 12
940-11sec 57C-303ec 72C-30sec* 12
QSChold-Smin 940-11sec 57C-30sec 72C—303ec 12
94C-11sec 56C-305ec 72C-303ec 12
94C-11sec 55C-303ec 72C-305ec‘ 12
Table 2. PCR Cycling Protocols. This table represents the

PCR cycling procedures that were used to obtain amplified

products for both the human and canine genomic DNA.

* A

final extension, 72I2f0r 10 minutes, was done to insure
completion of LPCR products.

22

 

amplification profile used the touchdown method (Hecker)

with 3 separate temperatures for annealing. An example of

the annealing temperatures is: 57 °C for 10 cycles, 56 °C
for 10 cycles and 55 °C for 10 cycles. Extension for each
of the touchdown cycles was completed at 72 °C. Following

the 30th cycle of PCR, an extension of 72 °C for 10 minutes

occurred.

Gal llactrophorasia for tidality of Amplification

Fidelity of the PCR procedure was determined by
polyacrylamide gel electrophoresis (PAGE). 5 ul of the PCR
amplified product was added to 1 ul of 6x loading buffer
(0.25% (percent) bromophenol blue, 0.25% xylene cyanol, 15%
ficoll in ddH20 (Sigma Chemicals; St. Louis, MO). The
product-loading buffer mixtures, along with molecular weight
marker VIII were loaded into separate lanes of a 6%
polyacrylamide gel (29 part acrylamide to 1 part
n,n'methylene bisacrylamide, Bio Rad; Hercules, CA). 1X
Tris acetate EDTA (TAE) buffer (40 mM Tris-acetate, 1 mM
EDTA; pH 8.0) was used in the mini-protean II gel system
(Bio Rad; Hercules, CA) for PAGE. Samples were
electrophesed by applying 200 V to the system for
approximately 15 minutes. Gels were stained with ethidium
bromide (0.5 ug/ml) for 15 minutes and destained with ddH20

for 5 minutes. DNA bands were visualized at 254 nm using

23

ultraviolet trans-illumination light source (UVP, Inc. t536:
San Gabriel, CA). A photograph was taken of the gel using
FCR-lO camera (Fotodyne, Inc.: New Berlin, WI) with 667

Polaroid film (Polaroid Corporation: Cambridge, MA).

Dul.llution of Amplicon

Two different procedures, DNA electroelution and mini-
column elutions, were used to purify the PCR amplified
products. DNA electroelution was as follows: 6% PAGE, yhe
product bands of interest were excised from the gel. The
gel fragments were electroeluted using deairated 1x TAE
buffer in the Micro Centrilutor System (Amicon; Beverly, MA)
with Centricon-lOO concentrators (Amicon; Beverly, MA) at
275 V for 2-8 hours. Purified DNA was rinsed 3 times in a
Centricon-IOO with ddHyOIby centrifugation using a fixed
angle rotor for 20-30 minutes at 1000x g. In order to
collect the DNA the Centricon-lOO assembly was inverted and
centrifuged for 5 minutes at 1000x g. Eluted samples were
then transferred to a microcontainer and stored at —20 °C.

The procedure using mini-column elutions was as
follows: PCR products were gel purified by using 1% low-
melting temperature agarose gel with 1x TAE buffer in an
agarose gel electrophoresis system (Bio-Rad, Hercules, CA).
The amplified bands of interest were excised from the gel

and purified using Promega Wizard PCR Preps Purification

24

Resin Kit (Madison, WI). Eluted samples were stored at -20
°C.
Linaar Cycla Sequancing

The elution purified dsDNA PCR products were used with
the appropriate primer(s) with the AmpliCyclem sequencing
Kit (Perkin Elmer, Foster City, CA) to perform Linear Cycle
sequencing. Components of the sequencing kits were: 10x
buffer (4 units AmpliTaq® DNA Polymerase, CS, 500 mM
(millimolar) Tris-HCl; pH 8.9, 100 mM KCl, 25 mM MgClZ
solution, 0.25% (v/v) Tween® 20), G termination mix (22.5 uM
(micromolar) c7 dGTP, 10 uM each dATP. dCTP, dTTP and 80 uM
ddGTP), A termination mix (22.5 uM C71dGTP, 10 uM each dATP.
dCTP, dTTP and 600 uM ddATP), C termination mix (22.5 uM C7
dGTP, 10 uM each dATP, dCTP, dTTP and 300 uM ddCTP), and T
termination mix (22.5 uM C7 dGTP, 10 uM each dATP, dCTP,
dTTP and 900 uM ddTTP). The sequencing set up was as
follows: 3-7 ul of dsDNA eluted product, 4 ul of sequencing
10x buffer, anti-sense or sense primer (20 uM) calculated at

0.0588 ul/base volume added, and 1.0 ul (10 mCi/ml or
millicurie/milliliter) of alpha-Phosphorus-33 (a-33P),(NEN

Life Science Products) and ddHflD to achieve total volume of
30 ul. The sequencing master mixture was mixed well. 6 ul
of the master mixture was added to 2 ul of each of the
ddNTPs termination mixtures. The sequence cycling was

completed with the Gene-AMP PCR system Perkin Elmer 9600

25

with 0.2 ml thin walled reaction tubes. The Denaturing step
was 96 °C for 30 seconds. The extension step was 72 °C for

1 minute 30 seconds. The annealing temperature was set at
the lowest of touchdown profile annealing temperature used
during PCR amplification. The LPCR was completed in a total
of 25 cycles. 4ul of stop solution (95% formamide, 20 mM
EDTA, 0.05% brompheol Blue and 0.02% Xylene cyanal FF) was

added to the tubes upon completion of the cycles (volume

totaled 12 ul). Reactions were stored at -20 °C (Celsius).

Saquancing Gal llactrophoraaia

The 40 cm (centimeters) long by 20 cm wide by 0.4 mm
(millimeters) thick sequencing gels consisted of 7.2%
polyacrylamide (35% acrylamide: 1 n,n’methylene
bisacrylamide), 6M urea and 1x Tris borate EDTA (TBE). The
gels were run on the Sequi-gen sequencing cell (Bio Rad,
Hercules, CA) with 1x TBE buffer. The gels were preheated
to a temperature of 55 °C by applying a voltage of 1700-1800
V (volts). Prerun time was approximately 45 minutes. Tubes
containing the sequencing reactions were heated at 100 °C

for 1 minute to denature dsDNA. 2 ul of each of the four
reactions were added to separate lanes on the gel. The

voltage was adjusted to maintain a constant temperature of
55 °C. After loading the gel, the voltage was applied for

approximately 90 minutes. This amount of time would allow

26

the loading dye front to completely run off the bottom of
the gel. At that point another 2 ul of each of the
reactions was loaded onto the gel into separate, unused
lanes. This process would be repeated until a total of 3 to
4 loadings had been completed. The gels were removed from
the glass plates and transferred to blotting paper and dried

using a heat vacuum dryer (Fisher-Biotech FB-GDS-4050;
Springfield, NJ) at 80 °C for 1 hour. The heat unit of the

vacuum dryer was turned off and the gel was allowed to cool

under vacuum for 30-45 minutes.

Autoradiograph:

The a-33P radiolabelled gels were exposed to x-ray

films (Kodak; Rochester, New York) for several hours to
several days, in order to obtain optimal signals. The films
were developed using Kodak developer and Kodak fixer and
replinisher (Kodak; Rochester, New York), then rinsed well
with distilJ.IbO. The wet radiographs were allowed to air
dry for at least one hour before being analyzed. The
sequences were obtained by reading the gels manually by use
of a light box (Science Accessories Corporation; Statford,
CT).
Sacondary Primara and Saquanca walking

Individual sequences were compiled to build a large

contiguous sequence. Secondary primers were needed to

27

compare the sense—antisense overlap. The DNA code for the
secondary primers was obtained from the autoradiograph
sequences. These secondary primers were used in the linear
sequencing reactions in place of the original PCR primers.

The same protocol was used as previously stated.

Saquanca Analysis and Comparison

Individual sequences were compiled to build a large
contiguous sequence. The sequencing data obtained was
analyzed using the Genetic Computer Group software (GCG;
Madison, WI). Programs used within GCG included: Seq Ed
(sequence data, reverse and complement), FastA (fidelity of
the sequences), Best Fit (comparison of known to unknown
sequence) and Pile Up (multiple sequence comparisons). GCG
incorporates known sequence data from Genbank. The data
base allows for the comparison of unknown sequence to that
of known sequence of several Prokaryotic and Eukaryotic

species.

28

RESULTS

Venipunture procedures for peripheral blood collection
were completed to obtain white blood cells (WBCS). WBCS
were used in the DNA salt extraction method for DNA
isolation (see material and methods). Purity and quantity
of each DNA sample was analyzed using a Spectrophotometer.
DNA samples that had a purity ratio of 1.8 or higher were
used for the PCR processes. DNA purity average was 1.84.

PCR amplified products were analyzed utilizing 6% PAGE.
Typical PCR amplification results can be found in Figure 3.
Any contamination of the fragment of interest, whether it be
because of excess primer, primer dimer, nonspecific
amplification of secondary PCR products, or residual genomic
DNA could corrupt the LPCR process. For these given
reasons, amplified products were purified by one of the
elution processes as described in material and methods.

LPCR's were completed using 3-7ul of purified PCR
product. Each sequencing run, 3 to 4 loadings of the
sequencing reaction, gave approximately 275-350 base pairs
of readable sequence. Figure 4 is representative of a

typical autoradiograph.

PCR.Rasults

Each set of the Homo sapien primers amplified canine

genomic DNA. Though partial sequencing data was obtained

29

Figure 3

H14
0111)

 

Figure 3. 6% PAGE. Above is a represenetation of a typical
6% PAGE of LMP-2 PCR products. The symbols are as follows:
M - Marker VIII. N - negative control (blank). H - human
genomic DNA (positive control), amplicon 1163 bp. C -
canine genomic DNA, amplicon approximately 1000 bp.

30

Figure 4. Sequencing Autoradiograph. This is a
represenation of a typical sequencing autoradiograph.
Sequencing gels were completed with LPCR and
radiolabelling. The radiolabelling was achieved via use of
a—Pfl. Sequencing gels were loaded left to right - A, C, G
and T

31

Figure 4

 

32

for what is believed to be the both the canine TAPS and LMPS
genes, LMP-2 was the only sequences in which a sense/anti-
sense overlap was established.

PCR products the human and canine DNA were obtained for
all of the given primer sets (see material and methods).
Each canine PCR product detected was equivalent in length to
that of the corresponding human product, except for primer
sets of TAPl-3 and TAP2-3, note Table 3.

An interesting observation was noted with both the
TAP1-3 and the TAP2-3 primer sets. The canine amplified
product was significantly shorter than that of the
comparative human products. DNA length of the genes will
vary from each species. A good example of this is a
comparison of the Homo sapien to that of the murine seen
with the MHC gene LMP2. The length of the genomic DNA of
murine is considerably longer than the human. Given the
same logical thought, it is possible that the length of the
canine TAP-1 and TAP-2 genes are significantly shorter in

length than that of the human.

Sequencing Results
we;

The PCR product amplified by the selected Human LMP-2
primers selected was known to be 1163 base pairs in length.

Canine LMP-2 was calculated to be between 1000-1032 base

33

Table

3

 

 

 

 

 

 

 

 

 

Primer Human Amplicon (bp) leanine Amplicon (bp)
Sat

TAPJrl 1494 1400

TAP 1-2 3647 1150

TAP 1-3 3196 350

TAP 2-1 3022 1800

TAP 2-2 5323 5000

TAP 2-3 1952 350

LMP-2 1163 1000

LMP¥7 3454 3300 & 3600

 

 

 

 

 

Table 3. PCR Fragmentation Size, Human and Canine. Each of
the primer sets listed above has the given amplicon for both
human and canine genomic DNA. The human amplicons are known
size fragments, confirmed by gel determinations. The canine
amplicon bp Sizes were determined by use of PAGE
fragmentation via use of the marker and the corresponding
human amplicon (Maniatis).

34

pairs in length via use of the gel calculations, actual
obtained sequence was 1008 base pairs in length. In order
to have sense and anti-sense strand overlap, secondary
primers were designed for sequence walking.

Primer 1 AAA TGA GTA TAT GGG

Primer 2 AGT CTA ACT TGG ATC ATT AC

The GCG program, Squd, was use to compile the 1000
plus base pairs of canine LMP-2 sequence.) The Squd program
permits a given sequence to be edited, reversed and
complemented. This provided the computer software that was
needed to determine the sense/anti-sense overlap. The
compiled Canine LMP-2 sequence can be seen in Figure 5.

Once the sequence was arranged, the GCG FastA program
was utilized for the comparison of the canine LMP—2 sequence
to that of known sequences. GCG FastA program identifies
the designated sequence to that of the known/published
sequence in Genbank data bases. The comparison(s) is/are
based on the similarity between sequences. The results of
the FastA LMP-2 Canine can be seen in Figure 6.

As expected, Homo sapiens LMP—2 gene corresponded to
the Canis familiaris were alignments of repetitive units
found in the canine genome. This led to the conclusion that

a portion of the canine LMP-2 gene was sequenced.

35

51
101
151
201
251
301
351
401
451
501
551
601
651
701
751
801
851
901
951

1001

Figure 5.

AATGTACCAG

TACATGATTT

CGGCAGAAAC

GGCAAGTGCT

TATGTGGCCT

GAAGAAGTAG

GAGATAGAGA

CACATGTTGA

GCAGAATGAG

GAACACGAGA

TTATTCTGAA

AAGAAGTCTA

TTTTTTCTTC

CCCTGGGTGG

CTGGAGTCCT

TTCTCCCTCC

CGTAAATAAA

GCTCTTCTCT

CTGGCGTTGC

GTGGGTAAAC

ACTGTGCT

Canine LMP2 Sequence.

Figure 5

TCAAGGTGAA

TTTCTTACCC

TGAGTTAACC

TGGGTCCCTA

GTCCCTGCAG

GATGCAAAGA

AGACGGCTCT

TCTGGTTCTG

TATATGGGAT

CTTTCTCARG

TTTACTATTT

ACTTGGATCA

CTGTTTGAAT

CTCGGCGGTT

GGGATCGAGT

TCCTGTGTCT

TGAGTAAATT

GTCAAATAAA

TAATGTTGCT

CGAGCATTTX

TGCTTGTXXA

ATTCATGAAC

TTTTAGAAAG

AATTCATGGA

GGATGGGTAT

TTTCAGGGGC

GCCAGGAAGA

TCTCCTCCAT

TAGGCAATAT

ATGGATAGAG

TTTTGTTTTA

TTACTTTCTG

CCAAGTATCC

TGGCACCTGC

CCCGCCTTGG

CTGCCTCTCT

TTAAAAAAAA

TTTGGGAAAC

GCCTGCTGAC

ACAAGCTGTC

AGAAAGCCAA

TTATTAGTAA

GCCCCTATAA

GAATCTGGGG

AGAACGATAG

CTGCCTTCCT

TATTCTGGTT

TCTGGCCAGT

CACTTACTTT

CGAGGAATTT

TTATGGAATC

TTTCATTTAT

AATATCATGG

CTTTGGCCCA

GCTCCCGGCA

CTCTCTCTGT

AAAAAATCAT

ACTGATTAAC

TCCTTCCCTG

CCCACTACAC

obtained by LPCR with a-P13radiolabeling.

36

TGGCCCCAAG

AGTGGAGCTT

TGAGATACTG

CCTAAAAGCT

GGTATGAGAA

TTTATGTTTA

TTTCATCCAG

TTCCCCCTAT

ACATCCCATA

CTGAGGAATA

GAAGCCGXXX

TGGAGATTAT

ACTCAGGGAT

GGGCGCGATC

TGGAGCCTGC

CTATGTCTAT

GGACTCCAGT

CTAAAAAATT

CAGAGAAGCA

CAACACATGT

The canine LMP-2 sequence

To verify the findings, the NIH web site was used. A
Blast search was completed using the same Canine LMP-2
sequence. Blast search is not as restrictive as the GCG
FastA program. This would allow for detection of any other
less limited results. The results obtained from the Blast
search, however, were comparable to that of the GCG FastA
findings. The finding led us to the same conclusions, that
a portion of the canine LMP-2 had been sequenced. These
results can be noted in Figure 7.

Another comparison study was completed with the
assistance of GCG using the Bestfit program. The Bestfit
program of GCG aligns and compares sequences based on the
similarity between the Specified segments. Once the
comparisons are completed, the alignments are able to be
visualized. The percent similarity, sequence gaps and
sequence contrasts with the two given sequences can be
noted. The LMP-2 Canine to LMP-2 Human sequence comparison
resulted in a percent similarity of 73.997. The results can
be noted in Figure 8.

It was observed that the Human and Canine sequence had
dissimilarity at the canine sequence, bases 639 to 893.

This promoted an inquiry into the known human LMP-2
sequence. It was found that the human sequence contained an
ALU repetitive unit within the LMP—2 region of PCR amplified

product. Because of the discoveries of the original Bestfit

37

Figure 6

 

X87344 H.sapiens DMA, DMB, HLA-Z1, IP
Z14977 H.sapiens gene for major histocom
M63427 Dog pancreatic colipase gene, comp
X66401 H.sapiens genes TAPl, TAP2, L
X57357 Canis familiaris (dog) repetitive

 

 

 

Figure 6. Canine LMP-2 FastA Results. Above are the GCG
FastA results for canine LMP-2. It should be noted, the
highest results of homology were detected to the human MHC
class II region, more specifically the human LMP-2 and to
the canine SINE (repetitive unit).

 

Figure 7
X66401|HSMHCAPG H.sapiens genes TAPl, TAP2,
LMP2, LMP7
Z14977|HSMHCPU15 H.sapiens gene for MHC...
X87344|HSEVMHC H.sapiens DMA, DMB,
HLA-Zl, IPP2, LMP2, TAPl...
U89607|CFU89607 Canis familiaris chymase gene,
complete cds
AJ003059|CFZUBECA2 Canis familiaris microsatellite
DNA

 

 

 

Figure 7. Canine LMP-2 NIH Blast Results. Above are the NIH
Blast result of the Canine LMP-2. AS with the FastA results
(Figure 6), the highest results of homology were found to be
to the human MHC class II region, more specifically the
human LMP—2, and to the canine SINE (repetitive unit).

38

Figure 8. Bestfit Canine LMP-2 to Human LMP-2 Part I.
Bestfit GCG program was utilized in the alignment of the
complied canine LMP-2 to the human LMP-2 sequence (214977).
The percent homology (from base pair 1 to 639 of the canine
LMP-2) was 73.997. Primers used were from exon 2 to exon 3

of the human LMP—2 gene.

39

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

Can

Hum

2496
54
2546
104
2594
154
2643
201
2693
244
2741
293
2787
343
2836
390
2886
439
2936
486
2984
536
3033
583
3083
632

3133

Figure 8

GTACCAGTCAAGGTGAATGCTTGTXXAAGAAAGCCAATGGCCCCAAGTAC

III III III II llll l |==|| llll ll|ll|| III III
GTAAAAGTGAAGATGTATGCATTTGGAAAGAAGCTAATGGCCTCAAATAC

ATGATTTTTTCTTACCCATTCATGAACTTATTAGTAAAGTGGAGCTTCGG

l l||||l||||||ll|l||l |||l|||||||||||
A..CACTTTCCTTACCCATTCATGAAAAGACTGGCAAACTGGAGCCTTGG

CAGAAACTGAGTTAACCTTTTAGAAAGGCCCCTATAATGAGATACTGGGC

llll llllllllll lllllllllllllllllll
.AGGAATGGAGTTGACCTTCCCCAAAAGCCACTATGATAAGCTATTTGGT

AAGTGCTTGGGTCCCTAAATTCAT...GGAGAATCTGGGGCCTAAAAGCT

lllllllllllllllll | lllllllllllllllll
GGGTGCTTGGGTCTCTGAATTTGTGGAGGAGGATCTGGGGTCTGAATGTG

TATGTGGCCTGTCCC ....... TGCAGGGATGGGTATAGAACGATAGGGT

Illlllllllllll ||||||||||||||| lllllll
TATGTGACCTGTCCCAGTAGTGTACAGGGATGAGTAAAGGA..ATAGGGT

ATGAGAAGAAGAAGTAGGATGCAAAGATTTCAG.GGGCCTGCCTTCCTTT

llllll II III llllll llllllllllll
CTGAGAGGGGGACAGGAGAT....AGATTTTTGAGGGTCTTCTTTCCATC

TATGTTTAGAGATAGAGAAGACGGCTCTGCCAGGAAGATATTCTGGTTTT

Ill llll III I llll l llll II I lllll |||l|l|
TGTGCTTAGGGATCAAAAAGATGATTCTGTCAAGCAGATA.CCTGGTTTC

TCATCCAGCACATGTTGATCTGGTTCTG.TCTCCTCC..ATTCTGGCCAG

llll lllllllllll ll llllllll III III
TCATTTACCATATATTGAACTATTTTGGCTCTTCTCCCACTCCTAACCAA

TTTCCCCCTATGCAGAATGAGTATATGGGATTAGG.CAATATCACTTACT

llllll Illll llllllllllllll Illll ||l||| III II
TTTCCTCACATGCAAAATGAGTATATGGGGTTAGGTCAATATTACTGACA

TTACATCCCATAGAACACGAGACTTTCTCARGATGGAT.AGAGCGAGG..

lll lllllllllll ||||||||:|||||||||||
TTATGTTCCATAGAACA..TAACTCTCTCAAGATTGTTAATAGCAAAGAA

AATTTCTGAGGAATATTATTCTGAATTTACTATTTTTTTGTTTTATTATG

Illl Illll ||||| lllll III ||||||l| Ill Illl
AATTGATGAGGCATATTTTTCTTACCTTAGCA.TTTTTTGCTTTGTTATA

GAATCGAAGCC.GXXXAAGAAGTCTAACTTGGATCATTACTTTC..TGTT

Illl lllll l:::l| Ill llll II III I l | I III
AAATCTAAGCCTGAAAAATAAGCCTAATTTTGATTAACATCTGCAGTGAT

TCAT.TTATTGGAGATTATTTTTTTCTTCCTGTTTGAATCCAAGTATCCA

III III ||||| III III | ||||l || llllllll II I
TAATAATATCTGAGATGATTATTTGCCTCCTGCTTTAATCCAAGCATTAA

ATATCATG 639

I Illll
ACTTCATG 3140

40

53
2545
103
2593
153
2642
200
2692
243
2740
292
2786
342
2835
389
2885
438
2935
485
2983
535
3032
582
3082
631

3132

and the ALU repeat, a second Bestfit was completed using the
canine LMP-2 sequence from the three prime end. The second
Bestfit found a percent similarity of 75.893 of canine to
human comparison. The results can be seen in Figure 9.

The region of nonidentity/nonsimilarity for the canine
LMP-2 sequence was found to the match the intronic canine
repetitive unit. Another Bestfit program was completed
using the canine LMP-2 to that of the canine intron
repetitive unit. The results of the Bestfit of the canine
LMP-2 to the Canine intron repeat (SINE) can be seen in

Figure 10.

41

Figure 9

Can 893 AAAAAATTCTGGCGTTGCTAATGTTGCTGCCTGCTGACTCCTTCCCTGCA 942

|||||| | I III II III II llllllllll III II
Hum 3498 AAAAAAAACCTGAGTT..TTAACTTGGTGACTGTTGACTCCCTCCTGACA 3545

Can 943 GAGAAGCAGTGGGTAAACCGAGCATTTXACAAGCTGTCCCCACTACACCA 992

I II II II III lllllll ||l=l|||||||||l|l ||||| l
Hum 3546 GCGAGGCGGT.GGTGAACCGAGTGTTTGACAAGCTGTCCCCGCTGCACGA 3594

Can 993 ACACATGTACTGTGC 1007

| l|||l||||||
Hum 3595 GCGCATCTACTGTGC 3609

Figure 9. Bestfit Canine LMP-2 to Human LMP-2 Part II.
Bestfit GCG program was utilized in the alignment of the
complied canine LMP-2 to the human LMP-2 sequence (Z14977).
The percent homology (from base pair 893 to 1007 of the
canine LMP-2) was 75.893. Primers used were from exon 2 to
exon 3 of the human LMP-2 gene.

42

Figure 10

LMP 656 GGTGGCTCGGCGGTTTGGCACCTGCCTTTGGCCCAGGGCGCGATCCTGGA 705

||l||| l I ll llll I III | | ||l|||||||ll|||||
SINE 6 GGTGGC.CAGTGGAATGGCGCTTGC..TCCGGCCAGAGCGCGATCCTGGA 52

LMP 706 GTCCTGGGATCGAGTCCCGCCTTGGGCTCCCG..GCATGGAGCCTGCTTC 753

ll |||||||||||| | ||||||||| llllllllllllHll
SINE 53 AACCCAGGATCGAGTCCCATGTCGGGCTCCCGGTGCATGGAGCCTGCTTC 102

LMP 754 TCCCTCCTCCTGTGTCTCTGCCTCTCTCTCTCTCTGTCTATGT..CTATC 801

IIIIII IllllllllIIIIlIIlHIIIIIIIIlI Ill Illll
SINE 103 TCCCTCTGCCTGTGTCTGTGCCTCTCTCTCTCTCTCTCTCTGTGACTATC 152

LMP 802 GTAAATAAATGAGTAAATTTT 822

l|l| |||| II II II
SINE 153 ATAAAAAAATATATATATATT 173

Figure 10. Bestfit of Canine LMP-2 and Canine SINE. Bestfit
GCG program was utilized in the alignment of the complied
canine LMP-2 to the canine SINE sequence (U17996). The
percent homology was 81.707. It should be noted that the
location of the canine SINE is comparable to the location of
the human ALU repeat seen in the human LMP-2 gene (214977).

43

DISCUSSION

The optimization of all the sets of primer, proved to
be troublesome. The reason that only the LMP-2 sequence
obtained was due to the fact that the LMP-2 primers seems to
be less problematic than the other sets of primers. With
the Size of the some of the PCR fragments being greater than
1.5kb, time became an important issue. Sequencing of the
LMP-2 fragment (1008bp) maintained a time frame of just over
6 months, that does not include the time required for
optimization the PCR cycling conditions. For this reason, a
decision was made to concentrate on obtaining the LMP-2

sequence exclusively.

Sequencing Canine LMP-2

The comparison of the canine LMP—2 determined there is
74% identity between the canine (base 4-639 LMP-2) and human
LMP-2 (base 2496-3609) homologue. A second region of
identity of the canine and human LMP-2 resulted in 76%
homology. The primers for the human genomic DNA were from
the second exon to that of the third exon for Human LMP-2
(see material methods of primer information).

One of the objectives for this study was to sequence
the LMP-2 Homologue in canines. The homology was found to
be 75 %. However, during the comparison studies, a region

of nonidentity between the human and canine LMP—2 was

encountered. The nonidentity was found to be located at the
human ALU repeat. This prompted us investigate further.

It was noted that the 173 bases of the nonidentity
canine sequence corresponded to a previously reported canine
SINE (U17996). The canine LMP-2 was found to have 81%
homology to the previously reported canine SINES (see Figure
10).

The interspersed repetitive sequences can be divided
into two groups, SINES and LINES (Nomura). SINES are Short
interspersed repetitive elements, LINES, on the other hand,
are long interspersed repetitive elements (Thomsen). The
major difference between SINES and LINES, besides the length
of the repeat, is that LINES are conserved over a wide range
of animal species whereas, SINES are conserved only in the
animals or related species (Nomura). Our discussion will
concentrate specifically with SINES since our research is
most clearly related to that repetitive unit

SINES are found thought the mammalian genome as well as
being detected in plants (Okada). Originally SINES were
thought to have evolved through DNA transposition, unequal
crossing over or gene conversion (Kass). Current evidence
suggests, however, that SINES are results of retroposons
being integrated into the genome (Okada).

SINES may vary from 70 to 300 base pairs in length

(Alexander) and can be present in more than 105 copies per

45

genome (Okada). Individual SINES are conserved within
animals of related species (Nomura) and can be utilized to
determine the order of Speciation (Murata).

Previous studies completed by Manjula et al determined
that a canine SINE can be detected at least once every 5-8.3
kbp, constituting 360,000-600,000 copies in the canine
genome. Their studies also located repeats approximately
150 base pair in length, including a 3’ (CT)n tandom and a
poly A region. Both the (CT)n and the poly A tail can be
noted in the canine LMP-2 SINE that we have reported.

Canine SINES have been found to be closely related to
the gray wolf-Canis lupus, side striped jakal-Canis adustus,
black jackal-Canis mesomelas and distantly related to the
arctic fox-Alopex lagopus (Das). These finding support the

theory of Speciation of SINES to relate animals.

LMP-2 SINES

 

It has been shown that both the canine and the human
contain the given species SINE within the LMP-2 gene. While
it has been demonstrated that other species, such as
zebrafish, have the LMP—2 gene, the only other species that
has known genomic sequence LMP-2 is the mouse. Using the
GCG program of Bestfit, the mouse LMP-2 and mouse repetitive
unit were aligned to detect if there was indeed an intron

repeat within LMP-2. The mouse specific SINE again can be

46

detected within the LMP-2 gene. This can be noted in Figure
11.

As more sequencing projects detect the LMP-2 gene, it
is possible to complete other Species comparison of the LMP-
2 SINE positioning. The function of this LMP-2 SINE is
unknown at this time. Again, with further research, the

function of the SINE may be defined.

47

Figure 11

LMP-2 4646 AATATTTTGGGTCTGGAGAGATGGCTCAGTGGTTAAGAGC 4685

II II I III III II I llllllllll III II
SINE 850 AAAATATGGGGGTTGGGGATTTAGCTCAGTGGTAAAGTGC 889

Figure 11. Bestfit of Mouse LMP-2 to Mouse Repetitive Unit.
Mouse LMP-2 (D14566) to Mouse repetitive DNA (Z49228. With
this alignment the detection of the mouse SINE can be noted
in the LMP-2 gene of the mouse.

48

RECOMMENDATIONS

Future TAP and LMP Studies

I would recommend for future studies sequencing the TAP
and LMP genes using cDNA. This would give the opportunity
to determine the entire gene sequence as well as the
opportunity for the protein sequence to be determined. Once
the cDNA sequence is determined, further investigations can
be completed concerning the intronic studies, such as
repetitive unit locations.

I would also recommend that one sequence the chaperons:
calexnin, tapasin and calreticulin. A comparison study
would be interesting to determine just how conserved the
endogenous pathway across Species.

If one would like to undertake the sequencing
project(s) as suggested above, I would suggest exploring the
use of automated sequencing. It seems to be the most
productive route. When comparing the time and cost issue of
manual sequencing to that of automated sequencing, the issue
seems mute. One can have automated sequencing results as
quickly as 24 hours, once the PCR product is purified.
Walking 2 kb can be completed as quickly as a week. Another
benefit of automated sequencing is that there is less error
in determining the actual sequence. Human error is possible

when determining sequence from a manual sequencing film.

49

With automated sequencing. the sequence is determined by the.
computer program. The program usually will derive a
sequence that is usually error free to 500 bases. Granted
problems can be encountered with automated sequencing, but
sequencing facilities are staff with professionals, which

can be of assistance when trouble-shooting is needed.

Future Studies of SINES

Another project to consider is that of SINES and MHC
linkage. It is known that mouse, human and canine all
maintain a Species specific repeat within an intron of LMP-
2. It is possible that other animals also possess this same

feature. It would be interesting fact to determine.

REFERENCES

51

REFERENCES

Alexander, L.J., Rohrer, R.T. and Beattie, C.W. 1995.
Porcine SINE-associated microsatellite markers: evidence for
new artiodactyl SINES. Mammalian Genome. 6,464-468.

Anderson, L. and Davies, C.J. The major histocompatibility
complex. In B.M. Goddeeris and W.I. Morrison (eds): Cell
Mediated Immunity in Ruminants, CRC press, in press.

Belich, M.P., Glynne, R.J. et a1. 1994. Proteasome
components with reciprocal expression to that of the MHC-
encoded LMP proteins. Current Biology. 4(9), 769-776.

Blanchet, 0., Bourge, J.F. et a1. 1991. DNA binding of
regulatory factors interacting with MHC-class-I gene
enhancer correlates with the MHC-class-I transcriptional
level in class-I defective cell lines. International
Journal of Cancer. 6, 138-145.

Bull, R.W., Vriesendorp, et al. 1987. Joint report of the
third international workshop on canine immunogenetics. II.
Analysis of the serologicel typing of cells.
Transplantation. 43, 154-161.

Burnett, R.C. and Geraghty, D.E. 1995. Structure and
expression of a divergent canine class I gene. The Journal
of Immunology. 155, 4278-4285.

Burnett. R.C., DeRose, S.A. et a1. 1997. Molecular
analysis of six dog leukocyte antigen class I sequences
including three complete genes, two truncated genes and one
full-length processed gene. Tissue Antigens. 49, 484-495.

Carreno, B.M., Solheim, J.C. et al. 1995. TAP associates
with a unique class I conformation, whereas calnexin
associates with multiple class I forms in mouse and man.
Journal of Immunology. 155, 4726-4733.

Chabanne, L., Kaplanski, C. et al. 1995. Screening of 78
monoclonal antibodies directed against human leukocyte
antigens for cross-reactivity with surface markers on canine
lymphocytes. Tissue Antigens. 43, 202-205.

Chouchane, L. and Kindt, T.J. 1992. Mapping of the rabbit
MHC reveals that class I genes are adjacent to the DR
subregion and defines an insertion/deletion-related
polymorphism in the class II region. Journal of Immunology.
149, 1216-1222.

52

Cibotti, R., Punt, J.A. et al. 1997. Surface molecules
that drive T cell development in vitro in the absence of
thymic epithelium and in the absence of lineage-specific
signals. Immunity. 6, 245-255.

Colonna, M., Bresnhan, M. et al. 1992. Allelic variants of
the human putative peptide transporter involved in antigen
processing. Immunology. 89, 3932-3936.

Cook, D.N., Beck, M.A. et al. 1995. Requirement of MIP-la

for an inflammatory response to viral infection. Science.
269, 1583-1587.

Cross, S., Tonks, S. et al. 1991. Novel detection of
restriction fragment length polymorphisms in the human major
histocompatibility complex. Immunogenetics. 34, 376-384.

Das, M., Lee Chu, L. et al. 1998. Characterization of an
abundant Short interspersed nuclear element (SINE) present
in Canis familiaris. Mammalian Genome. 9, 64-69.

Davies, J.L., Kawaguchi, Y. et al. 1994. A genome-wide
search for human type I diabetes susceptibility genes.
Nature. 371, 130-136.

Dean, R.R., Kildsuff, T.S. et al. 1989. Nacrolepsy without
unique MHC class II antigen association: studies in the
canine model. Human Immunology. 25, 27-35.

Deeg, H.J., Raff, R.F. et a1. 1986. Joint report of the
third international workshop on canine immunogenetics. I.

Analysis of homozygous typing cells. Transplantation. 41,
111-117.

Fearon, D.T. and Locksley, R.M. 1996. The instructive role

of innate immunity the acquired immune response. Science.
272(5258), 50-53.

Fraser, J.D., Straus, D. and Weiss, A. 1992. Signal
transduction events leading to T cell lymphokine gene
expression. Immunology Today. 14(357), .

Fremont, D.H., Crawford, F. et al. 1998. Crystal Structure
of mouse H2-M. Immunity. 9, 385-393.

Fruh, K., Yang, Y. et al. 1992. Alternative exon usage and
processing of the major histocompatibility complex-encoded
proteasome subunits. The Journal of Biological Chemistry.
267, 22131-22140.

53

Germain, R.N. 1994. MHC dependent antigen processing and
peptide presentation: providing ligands for T lymphocyte
activation. Cell. 76, 287-299.

Gorman, S.D., Frewin, S.P. et al. 1994. Isolation and

expression of cDNA encoding the canine CD4 and CD8a
antigens. Tissue Antigens. 43, 184-188.

Hecker, K.H. and Roux, K.H. 1996. High and low annealing
temperatures increase both specificity and yield in
touchdown and stepdown PCR. Biotechniques. 20(3), 478—85.

Hidenori, T. 1996. A population genetic study of the
evolution of SINES II. Sequence evolution under the master
copy model. Genetics. 143, 1033-1042.

Hong, S.C., Chelouche, A. et al. 1992. An MHC interaction
site maps to the amino-terminal half of the T cell receptor

a chain variable domain. Cell. 69, 999-1009.

Howard, J.C. 1993. Restrictions on the use of antigenic
peptides by the immune system. Proc Natl Acad Sci. USA.
90, 3777-3779.

Huang, J.H., Getty, R.R. et al. 1994. Protein transfer of
preformed MHC-peptide complexes sensitizes target cells to T
cells cytolysis. Immunity. 1, 607-613.

Innis, M.A., Mayambo, K.B. et al. 1988. DNA sequencing
with Thermus aquaticus DNA polymerase and direct sequencing
of polymerase chain reaction-amplified DNA. Proc. Natl.
Acad. Sci. USA. 85, 9436-9440.

Janeway,C.A. 1993. How the Immune system recognizes
invaders. Scientific American. Sept, 74-79.

Kandil, E., Namikawa, C. et al. 1996. Isolation of low
molecular mass polypeptide complementary DNA clones from
primitive vertebrates. Journal of Immunology. 156, 4245-
4253.

Kass, D.H., Batzer, M.A. and Deininger, P.L. 1995.
Molecular and Cellular Biology. 15 (1), 19-25.

Kaufman, J., Volk, H. and Wallny, H.J. 1993. A “minimal
essential th” and an “unrecognized th”; two extremes in

selection for polymorphism. Immunological Reviews. 143,
63-88.

54

Kelly, A., Powis, S.H. et al. 1992. Assembly and function
of the two ABC transporter proteins encoded in the human
major histocompatibility complex. Nature. 355, 641-644.

Klein, J., Takahata, N. and Ayala, F. 1993. MHC
polymorphism and human origins. Scientific American. Dec.,
78-85.

Kroemer, G.B., Behar, G.H. et al. 1990. Molecular genetics
of the chicken MHC: current status and evolutionary aspects.
Immunological Reviews. 113, 119-145.

Laud, P.R., Loflin, P.T. et al. 1996. Transporter
associated with antigen-processing-l (TAPl) alleles in
Gorilla gorilla: diversification of the locus
postspeciation. Human Immunology. 50, 91-102.

Lobigs, M., Rothenfluh, H.S. et al. 1995. Polymorphic
peptide transporter in MHC class I monomorphic Syrian
hamster. Immunogenetics. 42, 398-407.

Lupas, A., Koster, A. et al. 1993. Structural Features of
26s and 203 proteasomes. Enzyme Protein. 47, 252-273.

Maniatis, T., Fritsch, E.F., and Sambrook, R. 1989.
Molecular Cloning. A Laboratory Manual. Cold Spring Harbor
Laboratory, New York.

Marshall, B., Leelayuwat, C. et al. 1993. New major
histocompatibility complex genes. Human Immunology. 38,
24-29.

Middleton, D., Megaw, G. et al. 1994. TAPl and TAP2
polymorphism in multiple sclerosis patients. Human
Immunology. 40, 131-134.

Minnick, M.F., Stillwell, L.C. et al. 1992. A highly
repetitive DNA sequence possibly unique to canids. Gene.
110, 235-238.

Monaco, J.J. 1992. A molecular model of MHC class-I-

restricted antigen processing. Immunology Today. 13(5),
174-179.

Monaco, J.J. 1995. Pathways for the processing and
presentation of antigens to T cells. Journal of Leukocyte
Biology. 57, 543-547.

55

Moins-Teisserence, H., Semana, G. et al. 1995. TAP 2 gene
polymorphism contributes to genetic susceptibility to
multiple sclerosis. Human Immunology. 42, 195-202.

Neefjes, J.J., Momburg, F. and Hammerling, G.J. 1993.
Selective an ATP-depedent translocation of peptides by the
MHC-encoded transporter. Science. 261, 769-771.

Neefjes, J.J. and Ploegh, H.L. 1992. Intracellular
transport of MHC class II molecules. Immunology Today.
13(5), 179-183.

Neefjes, J.J. 1996. Antigen presentation by MHC class I
and II molecules. Immunobiology. 195, 436-460.

Newell, W.R., Trowsdale, J. and Beck, S. 1996. MHCDB-
database of the human MHC (release 2). Immunogenetics.
45(1), 6-8.

Nomura, 0., Lin, Z.H. et al. 1998. A SINE species from
hippopotamus and its distribution among animal species.
Mammalian Genome. 9, 550-555.

Okada, N., Mitsuhiro, H. et al. 1997. SINES and LINES Share
common 3' sequences: a review. Gene. 205, 229-243.

Ortmann, B., Copeman, J. et al. A critical role for tapasin
in the assembly and function of multimeric MHC class I-TAP
complexes. Science. 277, 1305-1308.

Ortmann, B., Androlewicz, M.J. et al. 1994. MHC class 1

Ih-microglobulin complexes associate with TAP transporter
before peptide binding. Nature. 368, 864-867.

Ploski, R., Flato, B. et al. 1995. Assoication to HLA-DRBl
*08, HLA-DPBl*0301 and homozygosity for an HLA-linked
proteasome gene in Juvenile ankylosing spondylitis. Human
Immunology. 44, 88-96.

Ploski, R., Undlien, D. et al. 1994. Polymorphism of human
major histocompatibility complex-encoded transporter
associated with antigen processing (TAP) genes and
susceptibility to juvenile rheumatoid arthritis. Human
Immunology. 39, 54-60.

Polvi, A., Garden, O.A. et al. 1997. Canine major

histocompatibility complex genes DQA and DBQ in irish setter
dogs. Tissue Antigens. 49, 236-43.

56

Powis. S.H., Mockridge, I. et al. 1992. Polymorphism in a
second ABC transporter gene located within the class II
region of the human major histocompatibility complex. Proc.
Natl. Acad. Sci. USA. 89, 1463-1467.

Powis, S.H., Tonks, S. et al. 1993. Alleles and haplotypes
of the MHC encoded ABC transports TAPl and TAP2.
Immunogenetics. 37, 373-380.

Powis, S.H., Cooper, M.D. et al. 1994. Major
histocompatibility haplotypes associated with
immunoglobulin-A deficiency and common variable
immunodeficiency: Analysis of the peptide transported genes
TAPl and TAP2. Tissue Antigens. 43, 261-265.

Powis, S.H. and Geraghty, D. 1995. What is the MHC?.
Immunology Today. 16 (10), 466-468.

Rast, J.P., Anderson, M.K. et al. a, B, y, and 5 T cell
antigen receptor genes arose early in vertebrate phylogeny.
Immunity. 6, 1-11.

Robertson, M. 1991. Proteasomes in the pathway. Nature.
353, 300-301.

Rudensky, A.Y., Preston-Hurlburt, P. et al. 1991.
Seuquence analysis of peptides bound to MHC class II
molecules. Nature. 353, 622-627.

Rudensky, A.Y., Macic, M. et al. 1994. Intracellur
assembly and transport of endogenous peptide-MHC class II
complexes. Immunity. 1, 585-594.

Sadasivan, B., Lehner, P.J. et al. 1996. Immunity. Roles
for calreticulin and a novel glycoprotein, tapasin, in the
interaction of MHC class I molecules with TAP. Immunity.
5, 103-114.

Sarmiento, U.M. and Rainer, S. 1990. Nucleotide sequence
of dog DRB cDNA clone. Immunogenetics. 31, 396-399.

Sarmiento, U.M, Sarmiento, J.I. et al. 1990. Allelic
variation in the DR subregion of the canine major
histocompatibility complex. Immunogenetics. 32, 13-19.

Schmitt, T.H., Dunbar, B.N. et al. 1997. A case of primary
immunodeficiency due to a defect of the major
histocompatibility gene complex class I processing and
presentation pathway. Immunology. 57(1-3), 183-7.

57

Suh, W.K., Cohen-Doyle, M.F. et al. 1994. Interaction of
MHC class I molecules with the transporter associated with
antigen processing. Science. 64, 1322-1326.

Suh, W.K., Mitchell, E.K. et al. 1996. MHC class I
molecules form ternary complexes with calnexin and TAP and
undergo peptide-regulated interaction with TAP via their
extracellular domains. J. Exp. Med. 184, 337-348.

Solheim, J.C., Carreno, B.M. and Hansen, T.H. 1997. Are
transporter associated with antigen processing (TAP) and
tapasin class I MHC chaperones? Journal of Immunology.
158, 541-543.

Song, R. and Harding, C.V. 1996. Roles of proteasomes,
(LMP) transporters for antigen presentation (TAP) and

[bmicroglobulin in the processing of bacterial or
particulate antigens via an alternate class I MHC processing
pathway. Journal of Immunology. 156, 4182-4190.

Spies, T., Bresnahan, M. et al. 1990. A gene in the human
major histocompatibility complex class II region controlling
the class I antigen presentation. Nature. 348, 744-747.

Swarbrick, P.A., Schwaiger, F.W. et al. 1995. Cloning and
sequencing of expressed DRB genes of the red deer (Cervus
elaphus) MHC. Immunogenetics. 42, 1-9.

Tighe, M.R., Hall, M.A. et al. 1994. Associations between
alleles of the major histocompatibility complex-encoded ABC
transporter gene TAP2, HLA class II alleles, and celiac
disease susceptibility. Human Immunology. 39, 9-16.

Thomsen, P.D. and Miller, J.R. 1996. Pig genome analysis:
differential distribution of SINE and LINE sequences is less
pronounced than in the human and mouse genomes. Mammalian
Genome. 7,42-46.

Thorsby, Erik. 1997. Invited anniversary review: HLA
associated disease. Human Immunology. 53, 1-11.

Trowsdale, J. 1995. “Both man and bird and beast”:

comparative organization of MHC genes. Immunogenetics. 41,
1-17.

Trucco, Massimo. Personal Communication. DNA Salt
Extraction. University of Pittsburgh Medical Center.
December 1991.

58

Udaka, K., Tsomides, T.J. et a1. 1992. A naturally
occurring peptide recognized by alloreactive CD8+ cytotoxic

T lymphocytes in association with a class I MHC protein.
Cell. 69, 989-998.

VanEndert, P.M., Liblau, R.S. et al. 1994. Major
histocompatibility complex-encoded antigen processing gene
polymorphism in IDDM. Diabetes. 43, 110-117.

Wange, R.L. and Samelson, L.E. 1996. Complex complexes:
signaling at the TCR. Immunity. 5, 197-205.

Wanger, J.L., Burnett, S.A., et al. 1996. Molecular
analysis and polymorphism of the DLA-DQA gene. Tissue
Antigens. 48, 199-204.

Wanger, J.L., Burnett, S.A. et al. 1996. Molecular
analysis and polymorphism of the DLA-DQA gene. Tissue
Antigens. 48, 554-561.

Watson, C.J., Cobbold, S.P. et al. 1994. Immunosuppression
of canine renal allograft recipients by CD4 and CD8
monoclonal antibodies. Tissue Antigens. 43, 155-162.

White, L.C., Wright, K.L. et al. 1996. Regulation of LMP2
and TAPl genes by IRF-l explains the paucity of CDB+ T cells
in IRF-l -/- mice. Immunity. 5, 365-376.

Wolpert, E.Z., Peterson, M. et al. 1997. Generation of
CDB+ T cells specific for transporter associated with
antigen processing deficient cells. Proc. Natl. Acad. Sci.
USA. 94. 11496-11501.

Wright, H., Redmond, J. et al. 1995. The nucleotide

sequence of the sheep MHC II DNA gene. Immunogenetics. 41,
131-133.

59