v-

           

 
 
  
       

     

.
2', , .. , _v
3. 9 . .. .

'.‘ f -
». :va
.
3.

..wI--_

   
 
  

ELLE} ‘ ‘ .
15%.“;[952 » '
1:393? m’

.53
‘39,; 3
V ‘ 93999339933???

     
 
  
 

  
  
  

m

v-SLT.
no. ..
fr--- :-

:3...
rs-

7:1“. .
.. .... ,

211.2,, ..
'7“

w

    
  
 
 

 

:4“:

  
    
 
 

  
 
 
  
 
 

 
 
 
 
 
 

  
 
  

 
 
   

   
 
 
 
 

      
 
 
  
  
   
 
  

  
  
   
 
 
 
  
    
   
   
 

  

, 3 .~ 31' :
‘ ‘itnu? 35193": . 53:33.-
3 33 3:3 M 333.3333
[“9 9‘ 9 55 93999399913939” 9393195163. F‘éfl
2 3‘." 5", . “3%5’, 2;";
3‘" '33; 23393323 9“?
3 '5'? . 5 5 ‘91.: ' . .
. 99', (33.333393333 a? 3 v
I v. .93 "’5‘: ’1 L * ,‘
33.99933. 3? m3 39939393959393
"it“ 9.53.. £9319 9:399 :3?“ f!
. . 35 f: 33; .. . 3:33;”; 3333 3 : E"
99; ”39.33333 ’9399?“ .911359993139993959 ’39; 99 h: - 9.
9 99 33:3 393 4‘9

m.
I“.

  
    
  
 
 
 
 
   
 
  
 

{—Y‘
.5:

   
   

.31“
J 933:5.
m

“326,339?“ $9.:

”5m
3

3’
.

A- u. n-
" ..

     
 
   

    
  
 

, .
no . '3

     

    

   
 
   

    

.‘4’ 3?: .3 9993. "if
3.33.3 :13. 3335 3.;
It} 5 5; . ,3 la
5 ;,'.; .13: 9:5 7. ‘ I?!
3 Mi 1 'r :3; .' : a.
d“, n' :5:
l3 :1‘. v‘
‘ 9‘ ‘3!

--u-» v

d wu-

   
 
  

  
  

      
   

  
  
 

  

   
     
 
  
  

    
 
  
  
   

   
  
 
  
   
     
   
   
 
  

      
  
 

        

   

; 3313,5312. <' “
9 ‘I: 3 ’A- 1
. ,3 ;_3:.. 3e ,3; ”9%:
‘9“: 905%; 95%;! .»
s' 13! army 3;}:
‘\ '5 9 :5 U55 I 9 9:59: .9
“19'”. 35;; ._ . in“

       

3 '61
”399F9199313559599‘99 59 1:99.95 9:. I ‘9
1.2: 993.193.13399-9 “.9 9999 mi =3» 59'999'993’91995'9fli'95'c. 1;.
9 * 59::199 '9‘: 19::9' 'H‘ 99"“: 5: t' 9 3 995:9? 9.
. 9,3 333 33933 . '99. > m3“ ' .
999i 9' 9.51 9;". 9.955 9:91 sh: 9’ " ‘9. 9.9"“ 9" 9599-59 999' 59595. :9" 99591955. '9;
3 . ,« 3: .3. 33 . 3‘3 ~ 3 . .. 33.2.3
, :“ 99’:- t _~U _ 3
3,3.

   

.9r—V;
397919399‘ 333‘
“"33“”‘39‘929‘ .
33"“ . .. “9915.314 5

      

   

               
  
   
  
 
   

  

   

     
  

       
  
  
 
  

      
    
 

 

   
 

 

99:.l 3‘“? 9"" 9 ‘1 .95
".3 “$399233 999399999 63999:, is ' 93' 99339“ d- "If
‘9' 33 3;?
9J€

‘ i" > :2: . u 5. »
. 39.99;, ‘3 31399393 “3.999 33.3193} 9}.” 3 33,13 :3 ‘uv,
'go 3 '9 3 ‘ v “4. p | r
339“”: ”‘99959 999149999999339999 3939 59999 3’93! 9 9’
m9

 

’3
l

995959911399 .Iég'E

.33 I
9'33
1'19 ‘muW

  
 

       
  
  
 

 
 
      

   

     

       

    
   
   
     

v.
-c-v-

   

 

u .999'*'9149' 9, . 39309 9959” 9595359999 NH” - "993‘“
3199.931999331'9’ ;: "39993 333 »‘ .9'93139'9‘9'°99 99"“ “9 ”99’9""‘3'93 1‘“
.3 1,3 ‘ '33. h, . . is}. 9433;211:299: WNW“.
. fé93323911339'19 ‘ 929:9“33 33‘? 9'9??? . 333335323“.993’999€
393'.‘3‘33933399933.9:39.. W 333:“: 999: £9399 '9‘: 3
3339993339 39999931. 33399 91 ' 3:
929919994999 931937 ' 9‘"
93" i ..

 

"Jo.

 

5::

S

3:; llllIlllllIWIiiflifltitfiflfllillflllllHll

31293 01812 69 1

This is to certify that the

dissertation entitled

REGULATION OF CD45 ACTIVITY AND FUNCTION
BY PHOSPHORYLATION OF THE D2 DOMAIN ACIDIC
INSERT

presented by

Ying Wang

has been accepted towards fulfillment
of the requirements for

PhD. Microbiology

degree in

 

 

July 20, 1999

Date

 

 

 

LIBRARY

Michigan State

University

 

 

PLACE IN RETURN Box to remove this checkout from your record.
To AVOID FINES return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

we dClMfi-p.“

 

REGULATION OF CD45 ACTIVITY AND FUNCTION
BY PHOSPHORYLATION OF THE D2 DOMAIN ACIDIC INSERT

By

Ying Wang

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the Degree of

DOCTOR OF PHILOSOPHY
Department of Microbiology

1 999

ABSTRACT

REGULATION OF CD45 ACTIVITY AND FUNCTION
BY PHOSPHORYLATION OF THE D2 DOMAIN ACIDIC INSERT
By

Ying Wang

Initiation of T cell activation is a complicated process involving numerous
receptors, coreceptors and adaptor proteins. CD45, a protein tyrosine phosphatase, has
been known to play an important role in triggering signaling events upon antigen receptor
activation. However, the mechanism of regulation of CD45 itself is still unclear. In this
study, CD45 was shown to be regulated by a unique acidic insert in its second protein
tyrosine phosphatase (PTP) domain. This 19 amino acid insert was the target of serine
phosphorylation by casein kinase 2 (CK2), and phosphorylation increased the PTP
activity of CD45 toward myelin basic protein (MBP) by 3 fold. This was confirmed by
the observation that PP2A could reverse the effect of CK2 phosphorylation and that
serine to glutamate mutations in the insert mimicked the phosphorylation status and
modulated the PTP activity to the same extent.

In the second part of the study functional analysis of CD45 with mutations in the

acidic insert revealed that the insert acted as a regulatory element in T cell signaling.

Transfection of CD45' Jurkat-derived T cell line, 145.01, with wild type CD45 cDNA as
well as with CD45 DNA incorporating mutations in the 19 amino acid acidic insert of D2
domain revealed a potential role of the acidic insert in the regulation of CD45 function in

T cell activation. While mutations in the D2 acidic region did not affect the magnitude of

TCR-mediated NF-AT activation, the basal level of NF-AT activity in unstimulated cells
was elevated. Expression of CD45 with Ser to Ala mutations (S/A) at four acidic domain
sites in the D2 exhibited a 9-fold higher basal level of NF-AT activity. Ser to Glu
mutations (S/E) at the same sites and the deletion of 19 amino acids of the acidic region
(A19) exhibited intermediate basal NF-AT elevations of 5-fold and 3-fold respectively.

Isolation of stable clones derived from transfection of the CD45 S/A mutant into

HPB4S.1 (CD45', HPB-ALL) cells showed sustained calcium flux after TCR
engagement. The sustained calcium flux returned to baseline levels seconds after the
addition of EGTA, suggesting that the expression of the CD45 S/A mutant may have
prevented the deactivaiton of the plasma membrane calcium channel (CRAC). The stable
transfectants containing the CD45 S/A mutant showed virtually no difference in the
activation of Lck, ZAP-70 or MAPK. Consideration of both the transient and stable
transfection data suggests that, in addition to being essential for all T cell TCR triggering,
the CD45 D2 domain, acidic insert regulates the TCR-mediated calcium signaling
pathway. Taken together, these data suggest that the acidic insert in the D2 domain is a

unique module of CD45 that regulates its activity and function in T cell activation.

DEDICATION

To my husband, Wei Guo
&
to my parents and brother
Without their love and sustained support,

this could not be achieved.

iv

ACKNOWLEDGMENTS

First and foremost, I would like to thank my mentor, Dr. Walter J. Esselman, for
his guidance, understanding and encouragement through my graduate study. Without his
tremendous help and support, it would be impossible for me to overcome many of the
research-born fi'ustrations and move toward finishing up the dissertation. His wisdom
and generosity has made the past five years a great, joyful learning experience in my
career, I am very grateful for having such a wonderful advisor.

I also owe many thanks to Dr. Richard C. Schwartz, who has constantly provided
me helpful suggestions and assistance like a co-advisor. Also, I would like to express my
appreciation to Dr. Susan E. Conrad and Dr. Kathleen A. Gallo for sharing equipment
and reagents, and I have benefited a lot from the weekly group meeting with them.
Furthermore, I want to express my deep gratitude to all my committee members including
Dr. Pamela J. Fraker and Dr. Ronald Patterson for their invaluable discussion and
suggestions.

Finally, I would like to acknowledge all the past and present members in Dr.
Esselman’s laboratory for their collaboration and fiiendship. They include Dr. Julia
Wirth, Dr. Sanmao Kang, Dr. Liangzhu Liang, Mr. Wei Guo, Ms. Lanlan Li and Ms.

Jialu Zhang.

TABLE OF CONTENTS

Page

LIST OF TABLES ............................................................................................................. ix

LIST OF FIGURES... .......................................................................................................... x

LIST OF ABBREVIATIONS ........................................................................................... xii
CHAPTER 1.

LITERATURE REVIEW .................................................................................................... 1

INTRODUCTION ............................................................................................................... 2

A. T CELL ANTIGEN RECEPTOR AND ACCESSORY MOLECULES ........................ 3

l. The T cell antigen receptor complex ................................................................... 3

2. CD4/CD8 coreceptors .......................................................................................... 4

3. CD28 costimulator ............................................................................................... 5

B. ENZYMES and ADAPTOR MOLECULES IN TCR SIGNALING .............................. 7

1. PTKs .................................................................................................................... 7

1.1. Src family PTKs .......................................................................................... 7

1.2. Syk/ZAP-7O family PTKs ........................................................................... 9

1.3. Csk family PTK ........................................................................................ 10

1.4. Itk/Btk/I‘ec family PTKs ........................................................................... 11

2. PTPs ................................................................................................................... 11

2.1. CD45 PTP ................................................................................................. 13

2.2. HePTP ....................................................................................................... 13

2.3. SH2-containing PTPs ................................................................................ 13

2.4. PEP ............................................................................................................ 15

2.5. PAC-1 ....................................................................................................... 15

3. Adaptor molecules ............................................................................................. 15

3.1. Grb2 and She ............................................................................................. 16

3.2. SLP-76 ...................................................................................................... 16

3.3. LAT ........................................................................................................... 17

3.4. Cbl ............................................................................................................. 18

C. INTRACELLULAR SIGNALING EVENTS IN T CELL ACTIVATION ................. 18

1. Recruitment and activation of PTKs .................................................................. l8

2. Generation of calcium signals and other second messengers ............................ 20

3. Activation of MAPK and JN K pathways ........................................................... 21

4. Activation of transcription factors and cytokine production ............................. 23

D. STRUCTURE, FUNCTION AND REGULATION OF CD45 .................................... 25

1. Structural features of CD45 ............................................................................... 25

2. Functions of CD45 ............................................................................................. 27

vi

2.1. Function of CD45 in lymphocyte activation ............................................. 27

2.2. Function of CD45 in lymphocyte development ........................................ 27
2.3. Function of CD45 in cell adhesion ........................................................... 28
3. Substrates of CD45 and associated proteins ...................................................... 28
3.1. Substrates of CD45 ................................................................................... 28
3.2. CD45-associated proteins ......................................................................... 29
4. Regulation of CD45 ........................................................................................... 29
4.1. Regulation by localization ........................................................................ 29
4.2. Regulation by dimerization ....................................................................... 30
4.3. Regulation by phosphorylation ................................................................. 31
REFERENCE LIST ........................................................................................................... 33
CHAPTER 2.
PHOSPHORYLATION OF CD45 BY CASEIN KINASE 2:
MODULATION OF ACTIVITY AND MUTATIONAL ANALYSIS. ........................... 44
Abstract .............................................................................................................................. 45
Introduction ........................................................................................................................ 46
Materials and Methods ....................................................................................................... 48
Cells and cell culture .............................................................................................. 48
Site-directed mutagenesis ...................................................................................... 49
Purification of recombinant CD45 proteins and in-gel kinase assay ..................... 50
Immunoprecipitation and immunoblotting ............................................................ 51
PTP assay and kinetic analysis .............................................................................. 51
CK2 phosphorylation of 6His-cthD4S ................................................................ 52
In vitro kinase labeling of CD45 and PP2A treatment .......................................... 53
FPLC analysis ........................................................................................................ 53
Trypsin digestion and mass spectrometry .............................................................. 54
Results ................................................................................................................................ 54
Identification of CD45-kinase by in-gel kinase assay ........................................... 54
Distribution of CD45 in-gel kinase activity ........................................................... 56
CD45 in-gel kinase activity is inhibited by CK2 inhibitors ................................... 58
Immunoprecipitation of the CD45-targeted in—gel kinase with CK2 antibodies ...5 8
CD45 as a substrate for CK2 ................................................................................. 61
Mutation of the CK2 consensus phosphorylation sites blocks
phosphorylation by CD45-targeted in-gel kinase activity .............................. 61
Serine phosphorylation of the acidic insert in
the D2 domain increases CD45 activity .......................................................... 63
CK2 targeted sites in CD45 are phosphorylated in vivo ........................................ 68
Discussion .......................................................................................................................... 72

vii

Acknowledgment and Footnote ......................................................................................... 76

Reference List .................................................................................................................... 77
CHAPTER 3.
REGULATION OF THE CALCIUM/NF-AT T CELL
ACTIVATION PATHWAY BY THE D2 DOMAIN OF CD45 ....................................... 81
Abstract .............................................................................................................................. 82
Introduction ........................................................................................................................ 84
Materials and Methods .............................................. _ ......................................................... 8 8
Cells, Antibodies and Reagents .............................................................................. 88
DNA constructs and site-directed mutagenesis ...................................................... 89
Transient transfection and luciferase assay ............................................................. 90
Stable transfection and clone selection ................................................................... 91
FACS analysis ......................................................................................................... 91
PTP assay ................................................................................................................ 92
TCR stimulation and detection of MAPK activation .............................................. 93
In vitro kinase assay ................................................................................................ 94
Calcium flux analysis .............................................................................................. 94
Pulse chase analysis of CD45 ................................................................................. 95
Calcium-dependent degradation of in vitro translated CD45 protein ..................... 95
Results ................................................................................................................................ 96
Mutations in the CD45 D2 domain acidic insert .................................................... 96
Transient transfection with mutated CD45 increases basal NF-AT activity .......... 97
Stable transfectants expressing mutant CD45 ....................................................... 104
TCR stimulation of clones containing stably expressed CD45 mutants ............... 106
Acidic region S/A mutant exhibited the same turnover rate as the wild type ....... 112
S/A mutant CD45 was less susceptible to calcium-dependent degradation ......... 115
Discussion ........................................................................................................................ 116
Acknowledgments ............................................................................................................ 122
References ........................................................................................................................ 123

viii

LIST OF TABLES
Chapter 2

Table 1. Kinetic parameters of the CK2 site-mutated 6His-cthD45
with 32P MBP as substrate .................................................................................... 65

ix

LIST OF FIGURES

Chapter 1
1. Signaling pathways of T cells activated by antigen ...................................................... l9
2. Structure of CD45‘protein tyrosine phosphatase .......................................................... 26
Chapter 2
1. In-gel kinase assay of T cell lysates ............................................................................. 55
2. Expression of CD45 targeted in-gel kinase activity in various cell lines .................... 57
3. Inhibition of in-gel kinase activity with inhibitors of CK2 .......................................... 59
4. Immunoprecipitation of the CD45 targeted kinase with anti-CK2 antiserum ............. 60
5. CD45 sequence homology in the region of the 19 amino acid D2 insert. ................... 62
6. In-gel kinase analysis of CK2 immunoprecipitates using mutant CD45 as substrate. 64
7. Effect of mutation and CK2 phosphorylation on CD45 activity ................................. 66
8. Analytical FPLC separation of CK2 phosphorylated CD45 ...................................... 69
9. CD45 is phosphorylated in vivo ................................................................................... 71
Chapter 3
1. Schematic representation of mutant CD45 construct ................................................. 98
2. APl-luciferase and NF-AT-luciferase activity in CD45 transfected J45.01cells before
and after stimulation with anti-CD3/CD28 antibodies ................................................ 99
3. Mutations in the acidic insert of D2 domain lead to the elevation of basal level NF-
AT luciferase activity ................................................................................................. 101
4. Effect of wild type CD45, cyclosporin A (CsA) and EGTA on the basal level and
activated NF-AT luciferase activity ........................................................................... 103
5. CD45 and CD3 expression afier stable transfection of HPB45.1 cells ...................... 105
6. PTP activity of wild type and mutant CD45 in stable transfectants .......................... 107

7. Kinase activity of Lck and ZAP-70 after TCR ligation in HPB45.1 cells expressing
different mutated forms of CD45 ............................................................................... 108

8. Activation and phosphorylation of MAPK after TCR ligation of HPB45.1 cells
expressing different forms of CD45 .......................................................................... 110

9. Calcium flux afier TCR stimulation of HPB 45.1 (CD45) cells expressing wild type
or different mutant forms of CD45 ............................................................................ l 11

10. Measurement of intracellular calcium levels after TCR stimulation of HPB45.1
(CD45') cells expressing wild type or S/A mutant CD45 .......................................... 113

11. Analysis of in vivo and in vitro degradation of wild type and S/A mutant CD45 ..... 1 14

xi

LIST OF ABBREVIATIONS

PTP, protein tyrosine phosphatase; PTK, protein tyrosine kinase; SDS-PAGE, sodium
dodecylsulfate-polyacrylamide gel electrophoresis; PVDF, polyvinylidene difluoride;
CK2, casein kinase 2; HRP, horse radish peroxidase; MBP, myelin basic protein; His6-
cthD45, 6-His tagged form of cytoplasmic domain of CD45; pNPP, p-
nitrophenylphosphate; NF-AT, nuclear factor of activated T cells; CsA, cyclosporin A;
ZAP-70, Zeta-associated protein 70; MAP kinase, mitogen activated protein kinase; 1P3,

inositol 1,4,5-tn'sphosphate; CRAC, calcium release activated calcium channel.

xii

CHAPTER 1

Literature Review

INTRODUCTION

T and B lymphocytes are two major players of the immune system, which protects
vertebrates from various invading pathogens. Antigen recognition by the two
lymphocytes generates humoral and cell-mediated immune responses that will effectively
eliminate the encountered pathogen. B lymphocytes recognize surface-displayed
epitopes alone, while T lymphocytes recognize processed epitopes displayed with MHC
molecules on the membrane of antigen presenting cells. The specificity of recognition is
determined by the antigen receptors on these cells and the enormous diversity of
lymphocyte antigen receptor is generated by random gene rearrangement. In the case of
T cell receptor (TCR), a process of cell selection occurs in the thymus, ensuring T cells
that recognize self-antigens will be eliminated before maturation.

Extracellular binding of antigen or antigen/MHC complex to antigen receptors
initiates a biochemical cascade that induces the resting lymphocytes to progress through
the cell cycle and activate immune gene expression. Although T and B lymphocytes
have structurally different antigen receptors and recognize discrete forms of epitopes, the
signal transduction events initiated upon antigen stimulation are remarkably similar
(Weiss and Littrnan, 1994). In addition to the antigen receptors, other molecules such as
coreceptors (CD4, CD8, CD19/CD21), adhesion molecules (LFA-l, CD2) and
costirnulators (CD40, CD28) contribute together to the initiation of cell activation.

Activation of protein tyrosine kinases (PTKs) is among the earliest biochemical
events detectable following the engagement of antigen receptors. Neither TCR nor BCR
has intrinsic kinase activity, but both are associated with cytoplasmic PTKs and are able

to activate these PTKs after antigen binding. Activated PTKs then phosphorylate several

key intermediate enzymes and adapter proteins that activate second messenger pathways,
including the phosphatidylinositol pathway, Ras/MAPK pathway and Rac/JNK pathway.
These signaling events lead to transcriptional activation and cellular proliferation.

Much has been learned in recent years about the detailed intermolecular
connections between TCR engagement and cytokine production. Stimulation of the TCR
alters the equilibrium between PTKs and protein tyrosine phosphatases (PTPs), and
therefore induces the tyrosine phosphorylation of many cytoplasmic and membrane
proteins. The resulting network of phosphorylation events transduces the initial signals
to downstream effectors. This review will summarize our current understanding of the
molecular mechanisms of antigen receptor signaling in T lymphocytes. The first part of
the review focuses on features of antigen receptor complex and subsidiary molecules
including coreceptors and costimulators. The second part of the review describes the
structure and function of TCR-associated PTKs and PTPs as well as adaptor molecules.
The third part of the review addresses the multiple signaling pathways involved in T cell
activation. The fourth and last part of the review discusses in further details about the
transmembrane PTP CD45, which has been found to be critical for TCR function and
which forms the major focus of research in this thesis.

A. T CELL ANTIGEN RECEPTOR AND ACCESSORY MOLECULES

l. The T cell antigen receptor complex. The T cell antigen receptor is a multi-

subunit complex composed of a ligand-binding heterodimer (Ti chains; 043 or 76) (Wange

and Samelson, 1996), a TCRQ dimer and two CD3 dimers (88 and 81). The disulfide-

linked 043 or 75 heterodimer recognizes and binds to antigen/MHC molecule on an

antigen presenting cell (APC). The Ti chains only have short cytoplasmic domains of

five amino acids and are unable to transduce the antigen stimulation signals. Instead, the
Ti chains are noncovalently associated with the invariant CD3 and Q chains, the
cytoplasmic domains of which are considerably large and are responsible for coupling the
TCR to intracellular PTKs (Chan et a1., 1994). The signal transduction function of the
invariant chains is explained as the existence of multiple immunoreceptor tyrosine-based
activation motifs (ITAMs) in their cytoplasmic domains. TheSe ITAMs consist of paired
tyrosines and leucines in the consensus sequence (D/E)XXYXXL(X)6-3YXXL and each
TCR contains a total of ten lTAMs. The presence of multiple ITAM sequences in the
TCR complex lead to different patterns of tyrosine phosphorylation that may recruit
distinct signaling molecules, and amplify the signals upon antigen binding (Weiss and
Littrnan, 1994).

2. CD4/CD8 coreceptors. The coreceptor molecules CD4 and CD8 are
exclusively expressed on T lymphocytes. CD4+ T cells recognize antigen peptide bound
to MHC class-II molecules and function as helper T cells, while CD8+ T cells recognize
antigen peptide bound to MHC class-I molecules and function as cytotoxic T cells
(Janeway, 1992). As coreceptors, CD4 and CD8 bind to the same antigen-MHC complex
as recognized by the TCR for optimal signal transduction. CD4 molecule interacts with
the membrane-proximal [32 domain of the class II MHC molecule, and CD8 molecule
interacts with the membrane-proximal a; domain of the class I MHC molecule (Weiss
and Littrnan, 1994). Physical association of the corecptors with the TCR complex is
required for fully efficient activation of the T lymphocytes by antigen/MHC molecule.

Apparently one of the functions of coreceptors is to augment the binding of TCR to

antigen-MHC complex and to limit the amount of antigen for stimulation (Janeway,
1992)

In addition to their ligand binding capability, CD4 and CD8 also associate with
the Src family PTK, p56,“, and potentiate signal transduction by delivering the kinase
activity to the TCR complex. Lck binds to the cytoplasmic tail of the coreceptors, and its
kinase activity is facilitated by antibody-mediated aggregation of either CD4 or CD8.
However, the stoichiometry of Lek interaction with CD4 and CD8 is considerably
different, 75-95% and 5-10% of total Lck is estimated to be associated with CD4 and
CD8, respectively. Therefore, the cellular localization of Lck is probably regulated by
distinct mechanisms in the two lymphocyte lineages (Julius et al., 1993).

3. CD28 costimulator. Functional T cell responses to antigens also require a
nonantigen-driven cosignal provided by CD28 receptor on T cells and B7 ligand on
antigen presenting cells (APCs). CD28-B7 interaction in conjunction with TCR
stimulation markedly increases response longevity and augments the production of
multiple lymphokines, whereas TCR stimulation in the absence of CD28 ligation leads to
nonresponsiveness or clonal anergy of T cells (Rudd, 1996a). There are at least two
forms of B7 molecules existing on activated B cells, dendritic cells and monocytes: B7-l
(CD80) and B7-2 (B70/CD86). Both B7 and CD28 belong to the 1g gene superfamily
and comprise immunoglobulin-like extracellular domains. The MYPPPY hexamer motif
on CD28 molecule possibly mediates its binding with B7 ligand at the cell surface (June
et al., 1994). Efficient costimulation occurs when B7 and TCR ligand are presented on
the same rather than separated APC, suggesting that interaction between CD28 and TCR

complex is favored for antigen activation (Liu And Janeway, 1992). Resting T cells do

not proliferate in response to CD28 stimulation alone, but antigen primed T cells remain
highly responsive to CD28 triggering and can be induced to subsequent proliferation long
after the primary signal (Linsley and Ledbetter, 1993).

One mechanism by which CD28 augments lymphokine production is by
stabilizing mRNA for various lymphokines and therefore enhancing the translation and
protein secretion (June et al., 1994). CD28 ligation also induces transcriptional activation
of lymphokine genes by recruiting transcription factors to CD28-response element
(CD28RE). Recent studies indicate that proximal events of CD28 signaling are initiated
by tyrosine phosphorylation of CD28 via a pYMNM motif in the cytoplasmic tail,
followed by association and activation of phosphatidylinositol 3-kinase (PI 3-kinase)
(June et al., 1994). Both p56Lek and p59Fyn have been implicated in the phosphorylation
of CD28. The phosphotyrosine-mediated binding translocates PI 3-kinase to the plasma
membrane, where it can act on its lipid substrates and generate second-messenger signals
(Rudd et al., 1994). The CD28 pYMNM site also binds to the growth factor receptor-
bound protein-2 (Orb-2) which has been implicated in the activation of the
p21m/mitogen-activated protein (MAP) kinase pathway, however, the avidity of Grb-2
binding is much lower than that of PI 3-kinase (Schneider et al., 1995). In addition,
ligation of CD28 recruits and activates T cell-specific protein-tyrosine kinase (ITK)
independent of the pYMNM motif (Rudd, 1996a). By binding to multiple intracellular
proteins, CD28 regulates multiple signaling cascades in T cells. CD28 ligation triggers
two different pathways in T cells, a calcium-dependent and CsA~sensitive pathway and a
pathway that is CD28 specific, calcium independent and CsA resistant. Both pathways

seem to be initiated by PTK activity (Linsley and Ledbetter, 1993).

B. ENZYMES AND ADAPTOR MOLECULES IN TCR SIGNALING

1. Protein Tyrosine Kinases (PTKs). Four classes of PTKs have been shown to
participate in the functions of the T cell antigen receptor: the Src family kinases; the
Syk/ZAP-70 family kinases; the Csk kinase; and the Itk/Btk/Tec family kinases (Qian
and Weiss, 1997).

1.1. Src family PTKs. Src kinases are homologous to the transforming gene of
Rous sarcoma virus, and members of this family share common structural features (Chan
et al., 1994). They all contain an N-terminal region with a myristylation site, which
serves to anchor the kinases to the plasma membrane; and a C-terminal catalytic domain,
which contains kinase activity and a tyrosine autophosphorylation site. The internal two
domains are Src-homology domains. The SH3 domain is adjacent to the N-terminal
region, about 60 amino acid long and is involved in binding interactions with proline-rich
sequences. The SH2 domain is located proximal to the kinase domain, it consists of
approximately 100 amino acids and specifically mediates the recruitment of tyrosine
phosphorylated proteins. Another unique feature of Src family kinases is the existence of
a negative regulatory tyrosine residue in the carboxyl tail. Phosphorylation and
dephosphorylation of this residue directly regulates the kinase activity.

The Src family contains nine kinase members, three of them are generally
expressed in T cells: Lck, Fyn and Yes. Lck is a 56 kDa lymphoid-specific PTK that
binds to the cytoplasmic tails of the TCR coreceptors through cysteine motif-mediated
interactions (Turner et al., 1990). The kinase activity of Lck increases following TCR
stimulation or CD4/CD8 crosslinking (Veillette et al., 1991; Danielian et al., 1992).

Since CD4 or CD8 bind to the same MHC molecules with the TCR during antigen

recognition, Lck translocates to the TCR subunits and phosphorylate the ITAMs in the
CD3 and C chains. The expression of active Lck and the association of Lck with
coreceptors are both critical for TCR-mediated signaling. Loss of functional Lck
markedly diminishes antigen-induced calcium mobilization, tyrosine phosphorylation and
IL-2 secretion (Karnitz et al., 1992; Straus and Weiss, 1992). In CD4-deficient T cell
lines, the TCR function is recovered after the introduction of wild type CD4, while
expression of mutant CD4 molecules that are unable to associate with Lck fails to restore
the signaling capacity (Glaichenhaus et al., 1991). Overexpression of a constitutively
activated form of Lck (Y505F), but not the wild type form of Lck, in a CD4-deficient
murine T cell hybridoma, leads to TCR-induced hyperresponsiveness (Abraham et al.,
1991). This effect requires the intact SH2 domain and the N-terminal myristylation site
in the mutant Lck.

The critical role of Lck in thymocyte maturation is illustrated by the observation
that mice deficient in Lck have an arrest in early thymocyte development (Molina et al.,
1992). There is a dramatic reduction in total thymocyte number, and the double-positive
thymocyte population was reduced 10-60 fold. Only a small number of single-positive
thymocytes were detected in Lck deficient mice, and the few peripheral T cells exhibit
diminished responses to TCR ligation.

Fyn is a PTK of 59 kDa expressed mainly in neuronal tissues and hematopoietic
cells. Fyn associates with the cytoplasmic tail of TCR C; chain at low stoichiometry
(Samelson et al., 1990; Sarosi et al., 1992). The kinase activity of F yn increases slightly
following TCR crosslinking (Tsygankov et al., 1992). Overexpression of wild type Fyn

in the thymus of transgenic mice increases the sensitivity of thymocytes to TCR

stimulation with respect to tyrosine phosphorylation, calcium influx, IL-2 secretion and
cell proliferation, whereas expression of a kinase—inactive form of F yn abrogates TCR-
mediated signaling events (Cooke et al., 1991). In contrast to the Lek-deficient mice,
mice lacking Fyn have grossly normal thymocyte maturation, except that single positive
thymocytes are hyporesponsive to TCR stimulation. Thus unlike Lck, Fyn contributes to
TCR signaling but is not critical for thymocyte development (Appleby et al., 1992; Stein
et al., 1992).

1.2. Syk/ZAP- 70 family PTKs. In contrast to the Ste-family kinases, the Syk/ZAP-
70 family kinases are not myristylated and do not have the C-terminal tyrosine residue
with negative regulatory function. The Syk/ZAP-70 kinases contain two tandemly
arranged SH2-domains in the N-terminus and a kinase domain in the C-terminus (Chan et
al., 1994).

ZAP-70 is a 70 kDa PTK expressed exclusively in T cells and natural killer cells,
while Syk is a 72 kDa PTK expressed predominantly in B cells, thymocytes, and myeloid
cells (Chan et al., 1992; Taniguchi et al., 1991). ZAP-70 does not interact with the TCR
in resting cells, it becomes associated with the TCR Q chain and CD3 subunits following
TCR stimulation (Chan et al., 1991; Wange et al., 1992). The association is
cooperatively mediated by the ZAP-70 SH2 domains and tyrosine phosphorylated
ITAMs, and therefore is dependent on upstream kinases that phosphorylate ITAMs in
stimulated T cells. Src family kinases, Lck and Fyn, have been implicated in the
phosphorylation of ITAMs and the consequent recruitment of ZAP-70 to the membrane
receptor complex. The catalytic activity of ZAP-70 is induced upon binding to the TCR,

possibly due to auto-phosphorylation and trans-phosphorylation by Src family kinase

(Chan and Shaw, 1996). The activated ZAP-70 then phosphorylates multiple substrates
involved in downstream signaling pathways. Several regulatory tyrosine phosphorylation
sites (Y292, Y492, Y493) have been identified on ZAP-70 isolated from activated T cells
(Watts et al., 1994). Y492 and Y493 reside in the kinase domain, and the
phosphorylation of Y493 by Src family kinase is shown to enhance the ZAP-70 kinase
activity, whereas phosphorylation of Y492 seems to play a negative regulatory role in
ZAP-70 (Wange et al., 1995). Y292 lies between the second SH2 domain and the kinase
domain, and phosphorylation of this site possibly serves as a docking site for SH2
domain-bearing molecules (Wange and Samelson, 1996).

ZAP-70 is critical for thymocyte development. ZAP-70 deficiency is observed in
mice and humans with severe combined immunodeficiency (SCID), which correlates
with the absence of peripheral CD8+ cells or functional CD4+ cells (Elder et al., 1994).
Mice lacking ZAP-70 have a thymocyte block at double-positive stage but can be rescued
I by human ZAP-70 as well as human Syk, indicating overlapping functions between ZAP-
70 and Syk (Gong et al., 1997; Negishi et al., 1995). Mice deficient in Syk have grossly
normal thymopoiesis, but exhibits impaired B cell maturation and BCR signaling (T akata
et al., 1994; Turner et al., 1995). However, expression of ZAP-70 in Syk-deficient B
cells reconstitutes the function of Syk in BCR activation, confirming a redundancy
between these two kinases (Kong et al., 1995).

1.3. Csk family PTK Csk is a 50 kDa PTK with domain structures similar to Src
family PTKs. It has adjacent SH3 and SH2 domains in the N-terminus and a kinase
domain in the C-terminus. There is no myristylation site in the molecule (Okada et al.,

1991). Csk specifically phosphorylates the inhibitory tyrosine residue in the carboxyl tail

10

of Src farme PTKs and consequently decreases the kinase activity. Overexpression of
Csk in a T cell hybridoma inhibits TCR-mediated signaling, and the inhibitory effects are
overcome by expression of a constitutively activated form of Fyn, confirming that Csk
plays a negative role‘in T cell signaling by phosphorylating Src family PTKs (Chow et
al., 1993).

1.4. Itk/Btk/T ec family PT Ks. The Itk/Btk/Tec family is a recently identified class
of PTKs that are involved in TCR signaling. They usually have an N-terminal pleckstrin
homology (PH) domain, a SH2 domain, a SH3 domain, and a C-terminal kinase domain
(Desiderio and Siliciano, 1994). Itk is expressed predominantly in T cells, while Btk is
expressed mainly in B lymphoid and myelomonocytic lineages. Itk is required for T cell
development as well as for TCR-mediated cell proliferation. Increased tyrosine
phosphorylation of Itk and activation of its kinase activity have been observed in TCR-
stimulated Jurkat T cells, indicating an as yet to be determined function of Itk in T cell
signaling (Gibson et al., 1996).

2. Protein Tyrosine Phosphatases (PTPs). Three families of enzymes comprise
the PTP superfamily of at least 75 members: classical PTPs, dual-specificity
phosphatases (DSPs), and atypical PTPs (Mustelin et al., 1998; Neel, 1997). All these
enzymes utilize the same general catalytic mechanism, although there is little overall
sequence similarity among them. Classical PTPs are characterized by the existence of
one or two conserved catalytic domains of 240 amino acids, each catalytic domain
contains a signature sequence motif [I/V]HCXXGXXR[S/T]G. According to the crystal
structure of PTPlB, the cysteine residue of the signature sequence resides at the bottom

of a deep hydrophobic catalytic pocket and is involved in the formation of a thio-

ll

phosphate intermediate with the phosphotyrosine residue in the substrates (Barford et al.,
1994; Jia et al., 1995). Classical PTPs consists of transmembrane (receptor-like) PTPs
and non-transmembrane (intracellular) PTPs. Most transmembrane PTPs possess an
extracellular domain and two tandem catalytic domains, of which only the membrane-
proximal domain (D1 domain) exhibits enzymatic activity. The function of the normally
inactive, membrane-distal domain (D2 domain) still remains to be determined.
Intracellular PTPs usually contain a single catalytic domain along with a regulatory
domain that modulates the activity or cellular localization of the enzyme.

DSPs, which include VH1, VHR, cdc25, MKP-l and PAC-l, are the group of
enzymes that not only dephosphorylate phosphotyrosine, but also phosphoserine and
phosphothreonine. The majority of the DSPs tend to dephosphorylate phosphotyrosine
and phosphothreonine within highly restricted sequence contexts. Atypical PTPs, which
include KAP, Low molecular weight (acid) phosphatases, PRL phosphatases, PTEN and
CEL-l, are more distantly related to classical PTPs, except that they contain the minimal
signature sequence motif noted above. Low molecular weight phosphatases, which are
only 18 kDa in size, negatively regulate normal and transformed cell growth (Ramponi et
al., 1992). PRL phosphatases are isoprenylated or famesylated nuclear enzymes,
overexpression of which have a positive effect on cell proliferation and can induce
transformation (Diamond et al., 1994). PTEN and CEL-l are recently identified as PTPs
specific for non-protein substrates. PTEN, which is encoded by a candidate tumor-
suppressor gene, dephosphorylates lipid substrates such as phosphatidylinositol (3,4,5)-

triphosphate and inositol (1,3,4,5)-tetrakisphosphate (Maehama and Dixon, 1998). CEL-

12

1 dephosphorylates RNA 5'-tn'phosphate in the mRNA capping process (Takagi et al.,
1997)

2.]. CD45 PTP. Some of the known PTPs play critical roles in the regulation of
lymphocyte functions. CD45, a transmembrane PTP expressed predominantly on
leukocytes, is known to activate Lck and Fyn by dephosphorylating their C-terminal
negative regulatory site (Weiss and Littrnan, 1994). T cell lines or clones deficient in
CD45 surface expression fail to proliferate or produce cytokines in response to antigen
stimulation, indicating that CD45 is a positive regulator of TCR activation (Pingel and
Thomas, 1989). A similar requirement for CD45 in BCR signaling is reported (Justement
et al., 1991). CD45 is also shown to be important for early thymocyte development and
T cell maturation (Byth et al., 1996; Kishihara et al., 1993). The molecular mechanisms
of CD45 regulation and function will be discussed in further detail later.

2. 2. HePTP. HePTP, the hematopoietic protein tyrosine phosphatase, is also
expressed mainly on leukocytes. In contrast to CD45, HePTP is a non-transmembrane
PTP and is a negative regulator of TCR activation (Saxena et al., 1998). Transient
expression of wild type HePTP, but not the catalytically inactive form of HePTP, reduces
TCR-mediated transcriptional activation of NFAT/APl-luciferase. HePTP also
diminishes TCR-mediated activation of the mitogen-activated protein kinase (MAPK) by
directly dephosphorylating the critical phosphotyrosine in the activation loop of MAPK.
HePTP does not affect the activation of the MAPK kinase (MEK) or the N-terminal c-Jun
kinase (JN K) upon antigen stimulation.

2. 3. SH2-containing PTPs. SHP-l and SI-[P-2 are SH2 domain-containing PTPs,

and both display two tandemly linked SH2 domains at the amino terminus followed by

13

the catalytic domain. The expression of SHP-l is restricted to hematopoietic cells, and
SHP-2 is expressed in a variety of tissue cells. The N-terminal SH2 domain seems to
suppress the catalytic activity of the enzymes by interacting with the catalytic domain,
while the second SH2 domain serves as a docking domain and regulates the subcellular
localization of the enzyme (Unkeless and Jin, 1997).

SHP-l plays a negative regulation role in most hematopoietic-specific signaling
systems. Motheaten mice, which are naturally occurring mouse mutants deficient in
SHP-l, have provided a good model for studying the function of SHP-l in signal
transduction (Bignon and Siminovitch, 1994). SHP-l is recruited to the immunoreceptor
tyrosine-based inhibition motif (ITIM, [V/I]XpYXX[LN]) of several inhibitory receptors
via its SH2 domains and is involved in abrogating B cell and NK cell activation
(Unkeless and Jin, 1997). Thymocytes from motheaten mice exhibit enhanced tyrosine
phosphorylation of TCR invariant chains as well as sustained activation of MAP kinase
upon TCR stimulation, indicating a negative role of SHP-l in T cell signaling (Pani et al.,
1996). In activated T cells, the SH2 domains of SHP-l binds to tyrosine phosphorylated
ZAP-70, followed by an increase in the PTP activity of SHP-l and a decrease in the
kinase activity of ZAP-70 (Plas et al., 1996). Overexpression of wild type SHP-l inhibits
IL-2 production in response to TCR stimulation, whereas overexpression of inactive form
of SHP-l (C453 S) enhances IL-2 production.

Despite of its structural similarity to SHP-l, SHP-Z has distinct functions. It
serves either as a positive regulator or a negative regulator in lymphocyte signaling. In T
lymphocytes, SI-[P-Z becomes associated with a 110 kDa tyrosine-phosphorylated protein

upon TCR stimulation (Frearson et al., 1996), and the expressionof SHP-2 augments

l4

TCR-induced MAP kinase activation (Frearson and Alexander, 1998). A negative
regulatory role of SHP-2 is implicated from the study that SHP-2 associates with the
cytotoxic T lymphocyte antigen-4 (CTLA-4) receptor and participates in the inhibition of
TCR signaling (Marengere et al., 1996).

2. 4. PEP. PEP is a PEST sequence-containing PTP expressed exclusively in
hematopoietic cells. It contains an N-terminal catalytic domain followed by a C-terrninal
domain of about 500 amino acids that is rich in proline, glutamate, serine, and threonine
residues. The PEST motif seems to mediate the association with SH3 domain of other
signaling molecules rather than facilitating degradation of the protein (Flores et al.,
1994). PEP is associated with the inhibitory PTK Csk, which inactivates Src family
kinases and inhibits T cell activation (Cloutier and Veillette, 1996).

2. 5. PAC-1. PAC-1 is a mitogen-inducible dual-specific PTP, localized
predominantly in the nucleus of hematopoietic cell lineage (Ward et al., 1994).
Candidate substrates of PAC-1 are interferon-stimulated gene factor 3 (ISGF 3), MAP
kinase and cyclin-dependent kinases (CDKs). Constitutive expression of PAC-1 inhibits
activation of MAP kinase following stimulation by grth factors or TCR crosslinking.

3. Adaptor Molecules. Adapator molecules are proteins that do not exhibit
intrinsic enzymatic activity but contain modular domain structures or amino acid motifs
responsible for protein-protein association and the formation of signaling complex
(Peterson et al., 1998). A number of adaptor molecules, including Grb2, Shc, SLP-76,
LAT and Cbl, have been shown to serve important roles in coupling antigen receptor

engagement to downstream signaling events.

15

3.1. Grb2 and Shc. Growth factor receptor binding protein 2 (Grb2) is a
ubiquitously expressed adaptor protein containing one SH2 domain and two SH3
domains. In non-hematopoietic cells, Grb2 associates with 805 via the interaction
between SH3 domains of Grb2 and proline-rich regions of 808, therefore facilitating
membrane localization of Sos and activation of R33 (Buday and Downward, 1993). In T
cells, the association of Grb2 with 803 is mediated by She and is significantly enhanced
upon TCR ligation (Ravichandran et al., 1995). She is an adaptor protein consisting of a
N-terminal phosphotyrosine-binding (PTB) domain, a glycine/proline-rich collagen
homology (CH) domains, and a C-terminal SH2 domain. Following TCR crosslinking,
She is recruited to the phosphorylated ITAMs in the TCR C chains and is rapidly
phosphorylated by TCR-associated PTKs. Tyrosine phosphorylated Shc binds to the SH2
domain of Grb2 and subsequently increases the association between Grb2 and S03.

3. 2. SLP-76. SLP-76 is a 76 kDa, SH2 domain containing leukocyte
phosphoprotein expressed exclusively in hematopoietic cells. SLP-76 possesses a
central proline-rich region with which it associates with the Grb2 SH3 domains, an N-
terminal tyrosine phosphorylation motif and a C-terminal SH2 domain (Motto et al.,
1996). Overexpression of SLP-76 in T cells significantly augments TCR-stimulated NF-
AT, AP-l and IL-2 gene activation, and it appears to enhance TCR-induced MAPK
activity with no effect on TCR-induced calcium flux (Motto et al., 1996; Musci et al.,
1997). SLP-76 is tyrosine phosphorylated upon TCR stimulation, and the phosphorylated
SLP-76 becomes associated with the SH2 domain of Vav, which is a 95 kDa guanine-
nucleotide exchange factor specific for Rho family GTPase (Lai And Tan, 1994). Vav

consists of a GEF catalytic domain, a pleckstrin homology (PH) domain, one SH2

16

domain and two SH3 domains. Vav is rapidly phosphorylated upon TCR ligation, and
the GEF activity of Vav is increased by tyrosine phosphorylation. Co-overexpression of
SLP-76 and Vav results in synergistic augmentation of NF-AT promoter activity,
indicating that SLP-7‘6 and Vav functionally overlap in T cell signaling pathways (Wu et
al., 1996).

Tyrosine phosphorylated SLP-76 also binds to nck, an adaptor molecule, therefore
providing a scaffold to bring Vav GEF activity to nck-associated Rho-dependent effector
proteins. ch interacts with p21-activated kinase 1 (Pakl) and Wiskott Aldrich
syndrome protein (WASP), both of which are Rho-GTPase-dependent proteins involved
in cytoskeleton organization. The nck:SLP-76:Vav trimeric complex is assembled after
TCR stimulation, resulting in the enzymatic activation of Pakl as well as the facilitation
of actin polymerization (Wardenburg et al., 1998).

3. 3. MT. LAT (Linker for activation of T cells) is a 36 kDa adaptor molecule
expressed predominantly in T cells, NK cells and mast cells. It is a membrane-anchoring
protein containing multiple tyrosine phosphorylation sites. LAT-deficient Jurkat T cells
(J .CaM2) exhibit normal tyrosine phosphorylation of the TCR Q chain and ZAP-70 after
TCR crosslinking, but fail to induce downstream activation of the calcium/calcineurin
pathway and the ras/MAPK pathway (Finco et al., 1998). LAT is phosphorylated by
activated ZAP-70, and tyrosine phosphorylated LAT recruits many signaling molecules
including Grb2, phosphatidylinositol 3-kinase (PI 3-kinase), and phosphatidylinositol
phospholipase C-y (PLC-y). Overexpression of LAT Y to F mutants in Jurkat cells
results in the inhibition of TCR-mediated AP-l and NF-AT activation, indicating an

important role of LAT in transducing T cell activation signals (Zhang et al., 1998).

17

3. 4. Cbl. Cbl (Casitas B-lineage lymphoma) is a 120 kDa adaptor protein which
serves as a negative regulator of lymphocyte signal transduction. Cbl is abundantly
expressed in thymus, testis and hematopoietic cells. It contains a N-terminal PTB
domain, a C-terminal leucine zipper domain, a zinc finger domain, multiple proline-rich
stretches and tyrosine phosphorylation sites. Cbl is rapidly phosphorylated on tyrosine
upon stimulation of antigen receptors in T and B cells and becomes associated with a
number of intracellular signaling molecules such as PI 3-kinase, Vav, Crk, Fyn kinase
and Syk/ZAP70 family kinases (Peterson et al., 1998). Phosphorylated Cbl interacts with
another adaptor protein Crk, which mediates the formation of Cbl-Crk-C3G complex and
facilitates the guanosine triphosphate exchange on the low molecular weight G protein
Rapl. Activated GTP-bound form of Rapl antagonizes Ras function by competing for
the same downstream effectors such as Raf-l, leading to the inhibition of IL-2
transcription in anergic T cells (Boussiotis et al., 1997). Overexpression of Cbl in Jurkat
T cells inhibits the activation of AP-l upon TCR stimulation, and the inhibitory effect
requires the presence of the proline-rich domain in Cbl (Rellahan et al., 1997). Cbl and
$03 bind to the N-terminal SH3 domain of Grb2 in a mutually exclusive manner. T cell
activation induces the dissociation of Cbl from Grb2, therefore Cbl could control the Ras
activation pathway in T lymphocytes by competing with $03 and regulating the
interactions between Grb2 and 803.

C. INTRACELLULAR SIGNALING EVENTS IN T CELL ACTIVATION

1. Recruitment and activation of PTKs. The earliest signaling event that

occurs after the ligation of TCR complex with antigen/MHC molecule is the activation of

Src family PTKs, Lck and Fyn. Antigen recognition brings CD4/CD8 coreceptors into

18

antigen I MHC B7

    
  
 
    

 

 

 

 

 

 

 

CsA-cyclophiiin
FKSOG-immunophilin

 

IL-2. lL-4, TNFog etc.

Figure 1. Activation of T cells by antigen. Initial tyrosine phosphorylation events are
shown with an asterisk indicating phosphotyrosine. Activation of parallel signaling
cascades are shown with ultimate activation of transcription factors and integration of the
signal by the IL-2 gene. Adapted from (Mustelin et al., 1998).

19

proximity with TCR, where the CD4/CD8 associated Lck gets activated and subsequently
phosphorylates tyrosine residues within the ITAMs of TCR multi-subunits. Fyn is
physically associated with TCR C chains in a constitutive manner and its PTK activity is
enhanced upon TCR ligation. Activated Fyn also phosphorylates the ITAMs in TCR Q
chain and CD3 subunits. It is unclear how TCR engagement triggers the activation of
Lck and Fyn. It has been proposed that conformational changes in the TCR complex
after binding to antigen/MHC could directly regulate the kinase activity of Lck and Fyn.
Also CD45 PTP is required for the initiation of TCR signaling by its ability to
dephosphorylate the inhibitory tyrosine residues in Src family PTKs and therefore to
activate the kinases, however, the regulation mechanisms of CD45 upon TCR ligation
still remain nebulous.

Tyrosine phosphorylated ITAMs then serve as docking sites and recruit ZAP-
70/Syk family PTKs to the plasma membrane via SH2 interaction. Recruited ZAP-70 is
rapidly phosphorylated and activated by another PTK, possibly by Lck. Activated ZAP-
70 undergoes autophosphorylation at additional tyrosine residues and bind to other SH2-
containing signaling molecules. Activated ZAP-70, Lck and Fyn are three major PTKs in
T cells that phosphorylate many downstream substrates and adaptor proteins that lead to
the activation of diverse signaling pathways.

2. Generation of calcium signals and other second messengers. Upon TCR
stimulation, ZAP-7O mediates the phosphorylation of membrane adaptor protein LAT,
and the phosphorylated LAT subsequently recruits PLCy to the plasma membrane where

the phospholipid substrates are located. PLCy is then phosphorylated and activated by

TCR-associated PTKs. Activated PLCy breaks down membrane phospholipid

20

phosphatidylinositol 4,5-bisphosphate (PIPz) into two important intermediate signals:
inositol 1,4,5-triphosphate (1P3) and diacylglycerol (DAG). 1P3 binds to the calcium
channel 1P3 receptor on the endoplasmic reticulum (ER) and stimulates release of calcium
fi'om intracellular stofes. Also it has been shown that the 1P3 receptor becomes associated
with F yn PTK in response to TCR crosslinking, and Fyn-mediated tyrosine
phosphorylation results in activation of the IP3—gated calcium channel (Jayaraman et al.,
1996). The initial calcium release from ER is followed by an influx of exogenous
calcium through calcium-release-activated calcium (CRAC) channels in the plasma
membrane, leading to a sustained increase in cytoplasmic calcium level. The elevated
calcium binds to and activates calmodulin, which is a calcium-dependent serine/threonine
kinase that modulates calcineurin. DAG, together with calcium, activates protein kinase
C (PKC), a serine/threonine kinase that activates many other enzymes and transcription
factors. PKC may subsequently stimulate Ras by reducing the activity of Ras-specific
GAP, the protein that renders Ras into the inactive GDP-bound form (Downward et al.,
1990)

3. Activation of MAPK and JNK pathways. In addition to the generation of
calcium and DAG signals, TCR-associated PTKs phosphorylate many adaptor molecules
that recruit and activate small GTP binding proteins such as Ras and Rac, which lead to
the activation of MAPK (mitogen activated protein kinase) and JN K (Jun arnino-tenninal
kinase) pathways. Activated MAPK and JN K phosphorylate and/or induce expression of
transcription factors such as c-Jun and c-fos, which form the AP] transcription factor to

activate cytokine gene transcription.

21

Shc has been implicated in T cells as an upstream adaptor molecule to transduce
signals from the TCR engagement to the activation of Ras/MAPK pathway. In response
to TCR stimulation, Shc is recruited to the TCR complex via the interactions between its
PTB domain and the [tyrosine phosphorylated ITAMs. She is rapidly phosphorylated by
PTKs and becomes associated with Grb2 adaptor protein, which subsequently brings $03,
the guanine-nucleotide exchange factor for Ras, to the plasma membrane. 803 catalyzes
the formation of active GTP-Ras, which in turn activates MAPK kinase kinase (MKKK,
e.g. Raf-1) and triggers the activation of MAP kinase cascade. MKKK sequentially
activates MAPK kinase (MKK) and then MAPK (Erk-l and Erk-2). MKKK and MAPK
are serine/threonine kinases, whereas MKK is a dual specific kinase that phosphorylates
both serine/threonine and tyrosine residues. In addition to She, LAT is also implicated in
the activation of Ras/MAPK activation by recruiting Grb2/Sos complex to the plasma
membrane (Finco et al., 1998).

While the MAPK pathway is fully activated by TCR ligation alone, activation of
JNK pathway appears to require simultaneous engagement of TCR and CD28 (Su et al.,
1994). CD28 has been shown to lower the threshold (the number of triggered TCRs)
needed for T cell response (Viola and Lanzavecchia, 1996), and TCR stimulation in the
absence of CD28 ofien results in T cell unresponsiveness (Rudd, 1996b). CD28 ligation
results in the phosphorylation of CD28 in the cytoplasmic tail, followed by the
recruitment of PI 3-kinase, Grb2 and Itk. However, it is unclear how the proximal events
are linked to the activation of JN K. One possible mechanism is through the activation of
Vav, which is a Rho-specific guanine nucleotide exchange factor. Engagement of CD28

with B7 molecule alone results in rapid phosphorylation and activation of Vavl in T

22

cells, indicating a role of Vav in transducing CD28 signals (Cantrell, 1998). The PH
domain of Vav binds to polyphosphoinositides and mediates its membrane localization,
while the SH2 domain of Vav associates with the adaptor protein SLP-76 in response to
TCR stimulation. vav has been shown to specifically activate the JNK pathway while
exhibiting no effect on the MAPK pathway (Crespo et al., 1996). This activation requires
tyrosine phosphorylation of Vav and is mediated by the Rho family of small GTPases.
Rac-l dominant inhibitory mutants, but not RhoA or Cdc42 mutants, block the activation
of JNK by Vav, indicating that Racl links the Vav signaling to the JNK pathway.

In addition to its potential role in the activation of JNK, Vav is also involved in
the calcium/calcineurin pathway. T lymphocytes deficient in Vavl expression fail to
maintain calcium signals or produce IL-2 in response to TCR crosslinking, while
overexpression of Vavl significantly augments basal and TCR-induced activation of NF-
AT. It is shown in Vavl-deficient B cells that Vavl is required to bring Racl to the
plasma membrane to activate PIPS-kinase, which phosphorylates PIP to generate PIPz,
the precursor of 1P3 and DAG. Therefore Vavl deficiency results in defective inositol
lipid biosynthesis and impaired calcium signaling.

4. Activation of transcription factors and cytokine production. Different
signaling pathways eventually converge on the expression, translocation and activation of
transcription factors, which bind to regulatory regions of T cell genes, enhance the
promoter activity and lead to the expression of cytokine genes as well as other effector
genes. The regulatory region of the IL-2 gene contains binding sites for several
transcription factor, including NF-AT, AP-l, NF-KB and Oct-1, all of which are required

to induce IL-2 gene transcription (Rooney et al., 1995). After TCR stimulation, different

23

signaling pathways integrate at the level of these transcription factors and cooperatively
induce the transcription of IL-2, the cytokine that serves as the major T cell growth
factor.

One major effect of the elevated intracellular calcium level is the activation of the
calcineurin, a serine/threonine phosphatase. The calcium-calmodulin complex binds to
the regulatory subunit of calcineurin and therefore activates the phosphatase activity of
calcineurin. Calcineurin dephosphorylates the cytoplasmic component of the T cell
transcription factor NF-AT and exposes a nuclear-localization signal (NLS), thus
allowing it to translocate into the nucleus.

The transcription factor Elkl is subsequently phosphorylated by MAPK and leads
to the enhanced transcription of fos proteins, while the transcription factor c-Jun is
phosphorylated and activated by JNK. Expression of c-Jun is induced by TCR
stimulation and augmented by CD28 costimulation. F05 and Jun dimerize to form the
AP-l transcription factor, which binds to the IL-2 enhancer region in association with
NF-AT. CD28 signaling may also enhance the nuclear translocation of Rel/NF-KB by
reducing the expression of inhibitor 11(th (Lai And Tan, 1994). The NFAT-API
complex, along with NF-KB and Oct-1, leads to the activation of IL-2 gene transcription.

Recently the STAT (signal transducer and activator of transcription) family has
also been implicated to participate in TCR signaling (Welte et al., 1999). TCR
stimulation induces the association of STATS with the tyrosine-phosphorylated TCR E,
chains. Recruited STATS is further phosphorylated and activated by Lck or other TCR-
associated PTKs, promoting T cell proliferation and possibly transcription activation of

CD69 genes. This suggests that STAT family transcription factors could be activated by

24

TCR ligation in a similar way to cytokine receptor signaling and could directly mediate
TCR-induced gene activation and cell proliferation. ’
D. STRUCTURE, FUNCTION AND REGULATION OF CD45

1. Structural features of CD45. CD45, previously known as Ly-S, T200, 8220,
or leukocyte common antigen, is the first identified transmembrane PTP (Trowbridge and
Thomas, 1994). It is abundantly and exclusively expressed on nucleated hematopoietic
cells. CD45 has a highly glycosylated extracellular domain, a single transmembrane
region, and a large cytoplasmic domain of 705 amino acids with PTP activity. Its
extracellular domain has a rod-like tertiary structure, containing a cysteine-rich region
and a fibronectin type 111 repeat. A specific region in the N-terminus of CD45, encoded
by exons 4 to 7, undergoes alternative splicing and results in the expression of at least
eight different isoforms ranging in size from 180 to 220 kDa (Chang et al., 1989).
Different isofonns of CD45 are orderly expressed in different cell lineages, or in different
stages of lymphocyte development or activation, indicating the potential regulation of
CD45 by its extracellular domain (Chang et al., 1991). The transmembrane region of
CD45 is important for mediating the association of CD45 with at least one associated
molecule, CD45AP (McFarland and Thomas, 1995; Verhagen et al., 1996). Like other
transmembrane PTPs, the intracellular region of CD45 possesses two tandemly arranged
PTP domains of 240 amino acids, of which the membrane-proximal domain (D1 domain)
exhibits PTP activity, while the membrane-distal domain (D2 domain) shows no
detectable PTP activity. Mutation of the essential cysteine in the signature motif of D1
domain completely abolishes the activity of CD45, whereas similar mutation in the D2

domain does not affect the enzymatic activity.

25

 

 

532, 1“ Li 232 L1 2.; .02 (31345 231712. 2.13:1 1‘1 ”1"3./‘l"u-;i.t:§si 23‘: Flinn-{4.11:211231431253 :12:
Alternate . .
exon use 011th glycosylatlon

(many Sites)
Extracellular , _
Q’s‘r'Ch N-linked glycosylation
(15 potential 811%)
Trans-
membrane
PTP PTP active site
Domain 1 (essential Cys
. (D1 - active) C 7
cytoplasmic I
PTP ‘— Casein kinase 2
. phosphorylation Sites
Domain 2
. . A 1132
(D2 - Inactive) b

 

 

T \ PTP homologous Cys
‘26“ (inactive)

Figure 2. Structure of CD45 protein tyrosine phosphatase.

26

2. Functions of CD45.

2.1. Function of CD45 in lymphocyte activation. Although CD45 is expressed on
all leukocytes, its function in lymphocytes is understood best (Okumura and Thomas,
1995). CD45 serves‘a positive regulator of lymphocyte signaling and it is required for
the normal thymocyte development (Kung and Thomas, 1997). The first evidence that
CD45 is involved in lymphocyte activation comes from the study in T cell clones that
lack surface expression of CD45. These CD45-deficient T cells fail to proliferate or
produce cytokines in response to antigen stimulation, and reconstitution of CD45 surface
expression could restore signaling capacity (Pingel and Thomas, 1989). Many proximal

biochemical events, such as tyrosine phosphorylation, phospholipid turnover and calcium

flux, are severely impaired in CD45' cells, indicating that CD45 participates in

lymphocyte activation cascade at an early stage. Later studies demonstrate an analogous
requirement for CD45 in receptor-mediated signal transduction on B cells and natural
killer cells. The ability to respond to antigen in CD45' cells could be rescued by
introduction of a chimeric molecule composed of the amino-terminal 15 amino acids of
p60’" and the cytoplasmic domain of CD45, suggesting that membrane targeting of
CD45 cytoplasmic domain is sufficient to support antigen receptor-mediated signaling.
2.2. Function of CD45 in lymphocyte development. In addition to its function in
lymphocyte activation, CD45 is also required for thymocyte development and T cell
maturation (Byth et al., 1996). CD45-null mice generated by gene targeting of exon 6 or
exon 9 exhibit defects in the transition from double negative (DN) to double positive
(DP) thymocytes'as well as defects in the transition from DP to single positive (SP)

thymocytes. Therefore there is only 5-10% of the normal level T cell maturation in

27

CD45-deficient mice. CD45 deficiency does not affect the generation of mature B cells.
However, signaling through BCR or CD38 is markedly inhibited in the CD45-null mature
B cells (Byth et al., 1996), and there is decreased deletion of self-reactive B cells during
the selection process, suggesting a role of CD45 in setting the threshold of BCR
activation (Cyster et al., 1996).

2. 3. Function of CD45 in cell adhesion CD45 is also involved in regulating cell
adhesion. Many receptor-type PTPs possess surface structural features such as
immunoglobulin domains, MAM domains and fibronectin type III repeats, indicating a
role in cell-cell or cell-matrix interaction. Engagement of CD45 with some monoclonal
antibodies inhibits LFA-l/ICAM-l-mediated adhesion by modulating tyrosine
phosphorylation of intracelluar proteins (Arroyo et al., 1994), while ligation of CD45
with other monoclonal antibodies induces homotypic cell adhesion (Bernard et al., 1994).
CD45 interacts with proteins that may modulate cell-cell adhesion. CD45 co-distributes
with the integrin, LFA-l, at the cell-cell contact sites (Zapata et al., 1995); it binds to
CD100 which synergistically enhance CD45-induced homotypic adhesion (Herold et al.,
1996); it also associates with stromal heparin sulfate and the B cell sialic acid binding
lectin, CD22 (Okumura and Thomas, 1995).

3. Substrates of CD45 and associated proteins.

3.]. Substrates of CD45. Major targets of CD45 in lymphocyte activation appear
to be Src family PTKs. All PTKs of the Src family contain a C-terminal tyrosine residue
which, when phosphorylated, is correlated with decreased kinase activity. CD45
dephosphorylates the negative regulatory tyrosine and therefore activates Src family

kinases in leukocytes. In CD45-deficient T cells, Lck and Fyn have decreased kinase

28

activity and are hyperphosphorylated on their negative regulatory site (McFarland et al.,
1993). CD45 could either directly associate with Lck (N g et al., 1996), or the association
could be indirectly mediated by CD45AP, which is a 30 kDa membrane protein
expressed selectively, in lymphocytes (Schraven et al., 1991). CD45AP serves as a
common substrate to both CD45 and Lck, and leads to the formation of
CD45chszD45AP fimctional complex. CD45AP interacts with CD45 through their
transmembrane domains and is subjected to degradation in the absence of CD45 (Kung
and Thomas, 1997).

3. 2. CD45-associated proteins. CD45 co-localizes with and regulated ZAP-70.
In resting CD45' T cells, ZAP-70 remains constitutively phosphorylated on tyrosine and
associated with the TCR Q chain (Mustelin et al., 1995). CD45 interacts with the
extracellular domain of CD2, which is also a membrane protein involved in T cell
activation (Verhagen et al., 1996). Physical association between catalytically inactive
CD45 and tyrosine-phosphorylated TCR c, chain has been observed, suggesting that
CD45 may directly terminate the T cell response by dephosphorylating ITAMs of TCR
complex (Furukawa et al., 1994). CD45 also associates with a 116 kDa tyrosine-
phosphorylated glycoprotein (Arendt and Ostergaard, 1995).

4. Regulation of CD45.

4.1 . Regulation by localization. There is little known about mechanisms
regulating CD45. One model suggests that CD45 has constitutively high PTP activity,
and is modulated by its localization, access to substrates, and/or association with other
signaling molecules. Surface CD45 associates with cytoskeletal protein fodrin in a 1:1

molar ratio, which also binds to calmodulin and actin, suggesting a possible linkage

29

between CD45 and the intracellular microfilament network (Bourguignon et al., 1985).
The binding of fodrin to CD45 is mediated by the sequence 930EENKKKNRNmS in the
amino-terminal region of CD45 D2 domain, and results in a significant increase in the
Vmax of CD45 enzymatic activity (Iida et al., 1994). Internal CD45 in the Golgi region
also undergoes rapid redistribution and translocates into the 200,000 x g sucrose pellet
fraction in response to TCR stimulation (Minami et al., 1991).

In regard to membrane localization, some studies suggest that CD45 is excluded
from the contact area between TCR and antigen-presenting cells, and therefore prevents
dephosphorylation of the ITAMs of TCR and other signaling molecules (Xavier et al.,
1998). Based on topological considerations it is proposed that the large extracellular
domain of CD45 contributes to the exclusion of CD45 from the contact point between T
cells and APCs (Shaw and Dustin, 1997). Conversely, other studies have used
fluorescent antibodies to show that CD45 is not excluded from the contact point between
antigen-presenting cells and T cells (Sperling et al., 1998).

4. 2. Regulation by dimerization. Another mechanism of CD45 regulation is
through ligand binding and dimerization. According to the crystal structure of murine
RPTPor D1 domain, a dimer is formed between two D1 domain monomers, with the N-
terrninal helix-tum-helix motif of one monomer inserted into the active site of the other.
This dimerization blocks the access of substrate to the catalytic site and therefore could
inhibit the PTP activity (Bilwes et al., 1996). Chimeric molecules containing the
ectodomain and transmembrane domain of EGF R and the cytoplasmic domain of CD45
is capable of restoring signaling capacity in CD45' cells, while prior or simultaneous

addition of EGF attenuates the signaling function, possibly through dimerization and

30

inhibition of CD45 PTP activity (Desai etal., 1993). The negative regulation by ligation
is further confirmed by a study in which mutation of a wedge region acidic residue
(E624) putatively involved in RPTP dimerization completely abolishes the inhibition of
EGFR-CD45 chimera signaling by EGF (Majeti et al., 1998). However, physiological
ligands of CD45 have not been identified to date, it is therefore difficult to test the
hypothesis in vivo that CD45 is downregulated by ligand-mediated dimerization.

4. 3. Regulation by phosphorylation. A third potential mechanism involved in the
regulation of CD45 is phosphorylation. CD45 isolated from calcium ionophore
ionomycin-treated T cells has inhibited PTP activity and reduced serine phosphorylation,
indicating that serine phosphorylation of CD45 could increase its enzymatic activity
(Ostergaard and Trowbridge, 1991). The inhibition in CD45 activity is possibly mediated
by serine kinases other than PKC, because the effect is only observed after ionomycin but
not PMA treatment. However in another study where serine phosphorylation of CD45 is
modulated by IL-2 stimulation, no alteration of its catalytic activity is detected (Valentine
et al., 1991). Transient phosphorylation of CD45 on tyrosine residues has been observed
in Jurkat cells after stimulation with phytohemagglutinin or anti-CD3 antibodies.
However, pretreatment of cells with PTP inhibitor phenylarsine oxide is required to
detect the tyrosine phosphorylation, making it impossible to examine the effect of
tyrosine phosphorylation on CD45 enzymatic activity (Stover et al., 1991).

CD45 is phosphorylated on tyrosine residues when cotransfected with Csk into
COS-1 cells. Csk-mediated phosphorylation augments the PTP activity of CD45, and
leads to an increased association of CD45 with the SH2 domain of Lck (Autero et al.,

1994). Phosphorylation of CD45 in vitro by single kinases, including protein kinase C,

31

glycogen synthase kinase 3, casein kinase 2, calcium-calmodulin-dependent kinase, v-
Abl, Lck and Src, does not affect its PTP activity (Stover and Walsh, 1994; Tonks et al.,
1990). However, sequential phosphorylation of CD45 by PTK and serine kinase, in
which tyrosine phosphorylation by v-Abl precedes serine phosphorylation by casein
kinase 2, specifically enhances the activity of CD45 toward RCML but not toward MBP
(Stover and Walsh, 1994). The sites of in vitro phosphorylation that modulate the
enzymatic activity of CD45 are all localized in the D2 domain.

Previous study in our laboratory has identified the major in vivo phosphorylation
sites in CD45, all of which reside in the inactive D2 domain and consist of
phosphorylation on Ser and Thr residues (Kang et al., 1997). This indicates that
phosphorylation or dephosphorylation of the D2 domain could serve as a potential
regulation mechanism for CD45 PTP. Work in this thesis identifies CK2 as the kinase
that phosphorylates CD45 and affects its PTP activity, and further explores the possibility

of CD45 regulation by serine phosphorylation in vivo.

REFERENCE LIST

Abraham, N., Miceli, M.C., Parnes, J .R., and Veillette, A. (1991). Enhancement of T-cell
responsiveness by the lymphocyte-specific tyrosine protein-kinase p561“. Nature
350, 62-66.

Appleby, M.W., Gross, J.A., Cooke, M.P., Levin, S.D., Qian, X., and Perlmutter, RM.
(1992). Defective T-cell receptor signaling in mice lacking the thymic isoform of
p596”. Cell 70, 751-763.

Arendt, C.W. and Ostergaard, H.L. (1995). CD45 protein-tyrosine phosphatase is
specifically associated with a 116-kDa tyrosine-phosphorylated glycoprotein. J.
Biol. Chem. 270, 2313-2319.

Arroyo, A.G., Campanero, M.R., Sanchezmateos, P., Zapata, J.M., Ursa, M.A., Delpozo,
M.A., And Sanchezrnadrid, F. (1994). Induction of tyrosine phosphorylation
during ICAM-3 and LFA-l- mediated intercellular-adhesion, and its regulation by
the CD45 tyrosine phosphatase. J. Cell. Biol 126, 1277-1286.

Autero, M., Saharinen, J., Pessa-Morikawa, T., Soula-Rothhut, M., Oetken, C.,
Gassmann, M., Bergman, M., Alitalo, K., Burn, P., Gahmberg, CG, and
Mustelin, T. (1994). Tyrosine phosphorylation of CD45 phosphotyrosine
phosphatase by p50” kinase creates a binding site for p56” tyrosine kinase and
activates the phosphatase. Mol. Cell. Biol. 14, 1308-1321.

Barford, D., Flint, A.J., and Tonks, N.K. (1994). Crystal structure of human protein
tyrosine phosphatase 13. Science. 263, 1397-1404.

Bernard, G., Zoccola, D., Ticchioni, M., Breittrnayer, J.P., Aussel, C., and Bernard, A.
(1994). Engagement of the CD45 molecule induces homotypic adhesion of human
thymocytes through a LFA-l/ICAM-3-dependent pathway. J. Immunol. 152,
5161-5170.

Bignon, IS. and Siminovitch, K.A. (1994). Identification of PTPlC mutation as the
genetic-defect in moth-eaten and viable moth-eaten mice - a step toward defining
the roles of protein-tyrosine phosphatases in the regulation of hematopoietic-cell

differentiation and function. Clinical Immunology and Immunopathology 73,
168-179.

Bilwes, A.M., den-Hertog, J., Hunter, T., and Noel, J.P. (1996). Structural basis for
inhibition of receptor protein-tyrosine phosphatase-alpha by dimerization.
Nature. 382, 555-559.

Bourguignon, L.Y., Suchard, S.J., Nagpal, ML, and Glenney, J.R., Jr. (1985). A T-

lymphoma transmembrane glycoprotein (gp180) is linked to the cytoskeletal
protein, fodrin. J. Cell. Biol. 101, 477-487.

33

Boussiotis, V.A., Freeman, G.J., Berezovskaya, A., Barber, D.L., and Nadler, L.M.
(1997). Maintenance of human T cell anergy: Blocking of IL-2 gene transcription
by activated Rapl. Science 278, 124-128.

Buday, L. And Downward, J. (1993). Epidermal growth-factor regulates P21(RAS)
through the formation of a complex of receptor, GRBZ adapter protein, and SOS
nucleotide exchange factor. Cell 73, 611-620.

Byth, K.F., Conroy, L.A., Howlett, S., Smith, A.J., May, J., Alexander, DR, and
Holmes, N. (1996). CD45-null transgenic mice reveal a positive regulatory role
for CD45 in early thymocyte development, in the selection of CD4+CD8+
thymocytes, and B cell maturation. J. Exp. Med. 183, 1707-1718.

Cantrell, D. (1998). Lymphocyte signalling: A coordinating role for Vav? Curr. Biol. 8,
R535-R538

Chan, A.C., Desai, D.M., and Weiss, A. (1994). The role of protein tyrosine kinases and
protein tyrosine phosphatases in T cell antigen receptor signal transduction.
Annu. Rev. Immunol. 12, 555-592.

Chan, A.C., Irving, B.A., Fraser, ID, and Weiss, A. (1991). The zeta-chain is associated
with a tyrosine kinase and upon T- cell antigen receptor stimulation associates
with ZAP-70, a 70- kDa tyrosine phosphoprotein. Proc. Natl. Acad. Sci. USA 88,
9166-9170.

Chan, A.C., Iwashima, M., Turck, C.W., and Weiss, A. (1992). ZAP-70 - a 70 kD
protein-tyrosine kinase that associates with the TCR zeta-chain. Cell 71, 649-662.

Chan, AC. and Shaw, AS. (1996). Regulation of antigen receptor signal transduction by
protein tyrosine kinases. Curr. Opin. Immunol. 8, 394-401.

Chang, H.L., Lefrancois, L., Zaroukian, M.H., and Esselman, W.J. (1991).
Developmental expression of CD45 alternate exons in murine T cells. Evidence of
additional alternate exon use. J. Immunol. 1 4 7, 1687-1693.

Chang, H.L., Zaroukian, M.H., and Esselman, W.J. (1989). T200 alternate exon use in
murine lymphoid cells determined by reverse transcription-polymerase chain
reaction. J. Immunol. 143, 315-321. ’

Chow, L.M.L., Foumel, M., Davidson, D., and Veillette, A. (1993). Negative regulation

of T-cell receptor signaling by tyrosine protein-kinase p506“. Nature 365, 156-
160.

Cloutier, J.P. and Veillette, A. (1996). Association of inhibitory tyrosine protein kinase

p50"" with protein tyrosine phosphatase PEP in T cells and other hemopoietic
cells. EMBO J. 15, 4909-4918.

34

Cooke, M.P., Abraham, K.M., F orbush, K.A., and Perlmutter, RM. (1991). Regulation of
T-cell receptor signaling by a Src family protein-tyrosine kinase (p59/y"). Cell 65,
281-291.

Crespo, P., Bustelo, X.R., Aaronson, D.S., Coso, O.A., LopezBarahona, M., Barbacid,
M., and Gutkind, J.S. (1996). Rae-1 dependent stimulation of the JNK/SAPK
signaling pathway by Vav. Oncogene 13, 455-460.

Cyster, J.G., Healy, J.I., Kishihara, K., Mak, T.W., Thomas, ML, and Goodnow, CC.
(1996). Regulation of B-lymphocyte negative and positive selection by tyrosine
phosphatase CD45. Nature 381, 325-328.

Danielian, S., Alcover, A., Polissard, L., Stefanescu, M., Acuto, O., Fischer, S., and
Fagard, R. (1992). Both T cell rece tor (TCR)-CD3 complex and CD2 increase
the tyrosine kinase activity of p56’c - CD2 can mediate TCR-CD3-independent
and CD45-dependent activation of p561ck. Eur. J. Immunol. 22, 2915-2921.

Desai, D.M., Sap, J., Schlessinger, J., and Weiss, A. (1993). Ligand-mediated negative
regulation of a chimeric transmembrane receptor tyrosine phosphatase. Cell 73,
541-554.

Desiderio, S. And Siliciano, JD. (1994). The Itk/Btk/Tec family of protein-tyrosine
kinases. Chem. Immunol. 59: 191-210.

Diamond, R.H., Cressman, D.E., Laz, T.M., Abrams, CS, and Taub, R. (1994). PRL-l, a
unique nuclear-protein tyrosine phosphatase, affects cell-growth. Mol. Cell. Biol.
14, 3752-3762.

Downward, J., Graves, J.D., Warne, P.H., Rayter, S., and Cantrell, DA. (1990).
Stimulation of p2 1"" upon T-cell activation. Nature 346, 719-723.

Elder, M.E., Lin, D., Clever, 1., Chan, A.C., Hope, T.J., Weiss, A., And Parslow, T.G.
~ (1994). Human severe combined immunodeficiency due to a defect in ZAP- 70, a
T-cell tyrosine kinase. Science 264, 1596-1599.

Finco, T.S., Kadlecek, T., Zhang, W.G., Samelson, LE, and Weiss, A. (1998). LAT is
required for TCR-mediated activation of PLC gamma 1 and the Ras pathway.
Immunity 9, 617-626.

Flores, E., Roy, G., Patel, D., Shaw, A., and Thomas, ML. (1994). Nuclear-localization
of the PEP protein-tyrosine-phosphatase. Mol. Cell. Biol. 14, 4938-4946.

Frearson, J .A. and Alexander, DR. (1998). The phosphotyrosine phosphatase SHP-2
participates in a multimeric signaling complex and regulates T cell receptor
(TCR) coupling to the Ras/Mitogen-activated protein kinase (MAPK) pathway in
JurkatT cells. J. Exp. Med. 187, 1417-1426.

35

Frearson, J.A., Yi, T.L., and Alexander, DR. (1996). A tyrosine-phosphorylated 110-
120-kDa protein associates with the C-terrninal SH2 domain of phosphotyrosine
phosphatase-1D in T cell receptor-stimulated T cells. Eur. J. Immunol. 26, 1539-
1543. ‘

Furukawa, T., Itoh, .M., Krueger, N.X., Streuli, M., and Saito, H. (1994). Specific
interaction of the CD45 protein-tyrosine phosphatase with tyrosine-
phosphorylated CD3 zeta chain. Proc. Natl. Acad. Sci. USA. 91, 10928-10932.

Gibson, 8., August, A., Kawakami, Y., Kawakami, T., Dupont, B., and Mills, GB.
(1996). The EMT/ITK/TSK (EMT) tyrosine kinase is activated during TCR
signaling - LCK is required for optimal activation of EMT. J. Immunol. 156,
2716-2722.

Glaichenhaus, N., Shastri, N., Littrnan, D.R., And Turner, J .M. (1991). Requirement for
association of p56“ with CD4 in antigen- specific signal transduction in T-cells.
Cell 64, 511-520.

Gong, Q., White, L., Johnson, R., White, M., Negishi, 1., Thomas, M., and Chan, AC.
(1997). Restoration of thymocyte development and function in zap-70(-/- ) mice
by the syk protein tyrosine kinase. Immunity 7, 369-377.

Herold, C., Elhabazi, A., Bismuth, G., Bensussan, A., and Boumsell, L. (1996). CD100 is
associated with CD45 at the surface of human T lymphocytes - Role in T cell
homotypic adhesion. J. Immunol. 15 7, 5262-5268.

Iida, N., Lokeshwar, V.B., and Bourguignon, L.Y. (1994). Mapping the fodrin binding
domain in CD45, a leukocyte membrane-associated tyrosine phosphatase. J. Biol.
Chem. 269, 28576-28583.

Janeway, GA. (1992). The T-cell receptor as a multicomponent signaling machine -
' CD4/CD8 coreceptors and CD45 in T-cell activation. Annu. Rev. Immunol. 10,
645-674.

Jayararnan, T., Ondrias, K., Ondriasova, E., and Marks, AR. (1996). Regulation of the

inositol 1,4,5-trisphosphate receptor by tyrosine phosphorylation. Science 2 72,
1492-1494.

Jia, Z., Barford, D., Flint, A.J., and Tonks, N.K. (1995). Structural basis for
phosphotyrosine peptide recognition by protein tyrosine phosphatase 1B.
Science. 268, 1754-1758.

Julius, M., Maroun, CR, and Haughn, L. (1993). Distinct roles for CD4 and CD8 as co-
receptors in antigen receptor signaling. Immunology Today 14, 177-183.

June, C.H., Bluestone, J.A., Nadler, L.M., and Thompson, CB. (1994). The B7 and
CD28 receptor families. Immunology Today 15, 321-331.

36

Justement, L.B., Campbell, K.S., Chien, NC, and Cambier, J.C. (1991). Regulation of B
cell antigen receptor signal transduction and phosphorylation by CD45. Science.
252, 1839-1842.

Kang, S.M., Liao, P.C., Gage, DA, and Esselman, W.J. (1997). Identification of in vivo
phosphorylation sites of CD45 protein-tyrosine phosphatase in 7OZ/3.12 cells. J.
Biol. Chem. 272, 11588-11596.

Karnitz, L, Sutor, S. L. Torigoe, T, Reed, J. C., Bell, M..,P Mckean, D.J., Leibson, P..,J
and Abraham, R. T. ( 1992) Effects Of p561“ deficiency on the growth and

cytolytic effector function of an interleukin-Z-dependent cytotoxic T- cell line.
Mol. Cell. Biol. 12, 4521-4530.

Kishihara, K., Penninger, J., Wallace, V.A., Kundig, T.M., Kawai, K., Wakeham, A.,
Tirnms, E., Pfeffer, K., Ohashi, P.S., Thomas, M.L., Furlonger, C., Paige, Cl,
and Mak, T.W. (1993). Normal B Lymphocyte Development by Impaired T Cell
Maturation in CD45-Exon6 Protein Tyrosine Phosphatase-Deficient Mice. Cell
74, 143-156.

Kong, G.H., Bu, J .Y., Kurosaki, T., Shaw, AS, and Chan, AC. (1995). Reconstitution of
Syk function by the ZAP-70 protein-tyrosine kinase. Immunity 2, 485-492.

Kung, C. and Thomas, M. L. ( 1997) Recent advances in lymphocyte signaling and
regulation. Froniers 1n Bioscience 2, 207- 221.

Lai, J .H. And Tan, TH. (1994). CD28 signaling causes a sustained down-regulation of I-
kappa-B-alpha which can be prevented by the immunosuppressant rapamycin. J.
Biol. Chem. 269, 30077-30080.

Linsley, RS. and Ledbetter, J.A. (1993). The role of the CD28 receptor during T-cell
responses to antigen. Annu. Rev. Immunol. 11, 191-212.

Liu, Y. And Janeway, CA. (1992). Cells that present both specific ligand and
costimulatory activity are the most efficient inducers of clonal expansion of
normal CD4 T-cells. Proc. Natl. Acad. Sci. USA. 89, 3845-3849.

Maeharna, T. and Dixon, LE. (1998). The tumor suppressor, PTEN/MMACI,
dephosphorylates the lipid second messenger, phosphatidylinositol 3,4,5-
trisphosphate. J. Biol. Chem. 273, 13375-13378.

Majeti, R., Bilwes, A.M., Noel, J.P., Hunter, T., and Weiss, A. (1998). Dimerization-
induced inhibition of receptor protein tyrosine phosphatase function through an
inhibitory wedge. Science 279, 88-91.

Marengere, L.E.M., Waterhouse, P., Duncan, G.S., Mittrucker, H.W., Feng, GS, and
Mak, T.W. (1996). Regulation of T cell receptor signaling by tyrosine
phosphatase SYP association with CTLA-4. Science 272, 1170-1173.

37

McFarland, E.D., Hurley, T.R., Pingel, J.T., Sefton, B.M., Shaw, A., and Thomas, ML.
(1993). Correlation between Src family member regulation by the protein-
tyrosine-phosphatase CD45 and transmembrane signaling through the T-cell
receptor. Proc. Natl. Acad. Sci. USA. 90, 1402-1406.

McFarland, ED. and Thomas, ML. (1995). CD45 protein-tyrosine phosphatase
associates with the WW domain-containing protein, CD45AP, through the
transmembrane region. J. Biol. Chem. 270, 28103-28107.

Minami, Y., Stafford, F.J., Lippincottschwartz, J., Yuan, L.C., And Klausner, RD.
(1991). Novel redistribution of an intracellular pool of CD45 accompanies T-cell
activation. J. Biol. Chem. 266, 9222-9230.

Molina, T.J., Kishihara, K., Siderovski, D.P., Vanewijk, W., Narendran, A., Timms, E.,
Wakeham, A., Paige, C.J., Hartrnann, K.U., Veillette, A., Davidson, D., and Mak,
T.W. (1992). Profound block in thymocyte development in mice lacking p561“.
Nature 357,161-164.

Motto, D.G., Ross, S.E., Wu, J., HendricksTaylor, LR, and Koretzky, G.A. (1996).
Implication of the GRB2-associated phosphoprotein SLP-76 in T cell receptor-
mediated interleukin 2 production. J. Exp. Med. 183, 1937-1943.

Musci, M.A., Motto, D.G., Ross, S.E., Fang, N., and Koretzky, G.A. (1997). Three
domains of SLP-76 are required for its optimal function in a T cell line. J.
Immunol. 159, 1639-1647.

Mustelin, T., Brockdorff, J., Gjorloff-Wingren A., Tailor, P., Han.S, Wang, X., and
Saxena, M. (1998). Lymphocyte activation: The coming of the protein tyrosine
phosphatases. Froniers in Bioscience 3, 1060-1096.

Mustelin, T., Williams, S., Tailor, P., Couture, C., Zenner, G., Burn, P., Ashwell, J.D.,
and Altman, A. (1995). Regulation of the p702ap tyrosine protein kinase in T cells
by the CD45 phosphotyrosine phosphatase. Eur. J. Immunol. 25, 942-946.

Neel, B.G. (1997). Role of phosphatases in lymphocyte activation. Curr. Opin. Immunol.
9, 405-420.

Negishi, 1., Motoyarna, N., Nakayama, K., Senju, S., Hatakeyama, S., Zhang, Q., Chan,
A.C., And Loh, D.Y. (1995). Essential role for ZAP-70 in both positive and
negative selection of thymocytes. Nature 376, 43 5-438.

Ng, D.H., Watts, J .D., Aebersold, R., and Johnson, P. (1996). Demonstration of a direct
interaction between p56le and the cytoplasmic domain of CD45 in vitro. J. Biol.
Chem. 271, 1295-1300.

Okada, M., Nada, S., Yamanashi, Y., Yamarnoto, T., And Nakagawa, H. (1991). Csk - a

protein-tyrosine kinase involved in regulation of Src family kinases. J. Biol.
Chem. 266, 24249-24252.

38

Okumura, M. and Thomas, ML. (1995). Regulation of immune function by protein
tyrosine phosphatases. Curr. Opin. Immunol. 7, 312-319.

Ostergaard, H.L. and Trowbridge, LS. (1991). Negative regulation of CD45 protein
tyrosine phosphatase activity by ionomycin in T cells. Science. 253, 1423-1425.

Pani, 0., Fischer, KID, MlinaricRascan, 1., and Siminovitch, K.A. (1996). Signaling
capacity of the T cell antigen receptor is negatively regulated by the PTPlC
tyrosine phosphatase. J. Exp. Med. 184, 839-852.

Peterson, E.J., Clements, J.L., Fang, N., and Koretzky, G.A. (1998). Adaptor proteins in
lymphocyte antigen-receptor signaling. Curr. Opin. Immunol. 10, 337-344.

Pingel, J.T. and Thomas, ML. (1989). Evidence that the leukocyte-common antigen is
required for antigen-induced T lymphocyte proliferation. Cell 58, 1055-1065.

Plas, D.R., Johnson, R., Pingel, J.T., Matthews, R.J., Dalton, M., Roy, G., Chan, A.C.,
and Thomas, ML. (1996). Direct regulation of ZAP-70 by SHP-l in T cell
antigen receptor signaling. Science. 272, 1173-1176.

Qian, DR and Weiss, A. (1997). T cell antigen receptor signal transduction. Curr. Opin.
Cell Biol. 9, 205-212.

Ramponi, G., Ruggiero, M., Raugei, G., Berti, A., Modesti, A., Degl'Innocenti, D.,
Magnelli, L., Pazzagli, C., Chiarugi, VP, and Camici, G. (1992). Overexpression
of a synthetic phosphotyrosine protein phosphatase gene inhibits normal and
transformed cell growth. Int. J. Cancer. 51, 652-656.

Ravichandran, K.S., Lorenz, U., Shoelson, SE, and Burakoff, SJ. (1995). Interaction of
She With Grb2 regulates association of Grb2 with mSOS. Mol. Cell. Biol. 15,
593-600.

Rellahan, B.L., Graham, L.J., Stoica, B., DeBell, K.E., and Bonvini, E. (1997). Cbl-
mediated regulation of T cell receptor-induced APl activation - Implications for
activation via the Ras signaling pathway. J. Biol. Chem. 272, 30806-30811.

Rooney, J.W., Sun, Y.L., Glirncher, L.H., And Hoey, T. (1995). Novel NFAT sites that
mediate activation of the interleukin-2 promoter in response to T-cell receptor
stimulation. Mol. Cell. Biol. 15, 6299-6310.

Rudd, C.E. (1996a). Upstream-downstream: CD28 cosignaling pathways and T cell
function. Immunity 4, 527-534.

Rudd, C.E. (1996b). Upstream-downstream: CD28 cosignaling pathways and T cell
function. Immunity 4, 527-534.

39

Rudd, C.E., Janssen, 0., Cai, Y.C., Dasilva, A.J., Raab, M., And Prasad, K.V.S. (1994).
2-step TCR-zeta/CD3-CD4 and CD28 signaling in T-cells - SH2/SH3 domains,
protein-tyrosine and lipid kinases. Immunology Today 15, 225-234.

Samelson, L.E., Phillips, A.F., Luong, ET, and Klausner, RD. (1990). Association of
the Fyn protein-tyrosine kinase with the T-cell antigen receptor. Proc. Natl. Acad.
Sci. USA. 87, 4358-4362.

Sarosi, G.A., Thomas, P.M., Egerton, M., Phillips, A.F., Kim, K.W., Bonvini, E., and
Samelson, LE. (1992). Characterization of the T-cell antigen receptor-p60”
protein tyrosine kinase association by chemical cross-linking. Int. Immunol. 4,
1211-1217.

Saxena, M., Williams, S., Gilman, J., and Mustelin, T. (1998). Negative regulation of T
cell antigen receptor signal transduction by hematopoietic tyrosine phosphatase
(HePTP). J. Biol. Chem. 273, 15340-15344.

Schneider, H., Cai, Y.C., Prasad, K.V.S., Shoelson, S.E., And Rudd, CE. (1995). T-cell
antigen CD28 binds to the GRB-2/SOS complex, regulators of P21(RAS). Eur. J.
Immunol. 25, 1044-1050.

Schraven, B., Kirchgessner, H., Gaber, B., Samstag, Y., and Meuer, S. (1991). A
functional complex is formed in human T lymphocytes between the protein
tyrosine phosphatase CD45, the protein tyrosine kinase p56” and pp32, a
possible common substrate. Eur. J. Immunol. 21, 2469-2477.

Shaw, AS and Dustin, ML. (1997). Making the T cell receptor go the distance: A
topological view of T cell activation. Immunity 6, 361 -369.

Sperling, A.I., Sedy, J.R., Manjunath, N., Kupfer, A., Ardman, B., and Burkhardt, J.K.
(1998). Cutting edge: TCR signaling induces selective exclusion of CD43 from
the T cell-antigen-presenting cell contact site. J. Immunol. 161, 6459-6462.

Stein, P.L., Lee, H.M., Rich, S., And Soriano, P. (1992). pp59’5'" mutant mice display
differential signaling in thymocytes and peripheral t-cells. Cell 70, 741-750.

Stover, D.R., Charbonneau, H., Tonks, N.K., and Walsh, K.A. (19.91). Protein-tyrosine-
phosphatase CD45 is phosphorylated transiently on tyrosine upon activation of
Jurkat T cells. Proc. Natl. Acad. Sci. USA. 88, 7704-7707.

Stover, DR. and Walsh, K.A. (1994). Protein-tyrosine phosphatase activity of CD45 is

activated by sequential phosphorylation by two kinases. Mol. Cell. Biol. 14,
5523-5532.

Straus, DB. and Weiss, A. (1992). Genetic-evidence for the involvement of the Lck

tyrosine kinase in signal transduction through the T-cell antigen receptor. Cell 70,
585-593.

40

Su, B., Jacinto, E., Hibi, M., Kallunki, T., Karin, M., And Benneriah, Y. (1994). JNK is
involved in signal integration during costimulation of T-lymphocytes. Cell 77,
727-736.

Takagi, T., Moore, C.R., Diehn, F., and Buratowski, S. (1997). An RNA 5'-
triphosphatase related to the protein tyrosine phosphatases. Cell 89, 867-873.

Takata, M., Sabe, H., Hata, A., Inazu, T., Homma, Y., Nukada, T., Yamamura, H., and
Kurosaki, T. (1994). Tyrosine kinases Lyn and Syk regulate B-cell receptor-
coupled Ca2+ mobilization through distinct pathways. EMBO Journal 13, 1341-
1349.

Taniguchi, T., Kobayashi, T., Kondo, J., Takahashi, K., Nakamura, H., Suzuki, J ., Nagai,
K., Yamada, T., Nakamura, S., and Yamamura, H. (1991). Molecular-cloning of a
porcine gene Syk that encodes a 72-kDa protein-tyrosine kinase showing high
susceptibility to proteolysis. J. Biol. Chem. 266, 15790-15796.

Tonks, N.K., Diltz, CD, and Fischer, EH. (1990). CD45, an integral membrane protein
tyrosine phosphatase. Characterization of enzyme activity. J. Biol. Chem. 265,
10674-10680.

Trowbridge, LS. and Thomas, ML. (1994). CD45: an emerging role as a protein tyrosine
phosphatase required for lymphocyte activation and development. Annu. Rev.
Immunol. 12, 85-116.

Tsygankov, A.Y., Broker, B.M., Fargnoli, J., Ledbetter, J.A., and Bolen, J.B. (1992).
Activation of tyrosine kinase p60” following T-cell antigen receptor cross-
linking. J. Biol. Chem. 267, 18259-18262.

Turner, J.M., Brodsky, M.H., Irving, B.A., Levin, S.D., Perlmutter, R.M., and Littrnan,
DR. (1990). Interaction of the unique N-terminal region of tyrosine kinase p56,“

with cytoplasmic domains of CD4 and CD8 is mediated by cysteine motifs. Cell
60, 755-765.

Turner, M., Mee, F.J., Costello, P.S., Williams, 0., Price, A.A., Duddy, L.P., Furlong,
M.T., Geahlen, R.L., and Tybulewicz, V.L.J. (1995). Perinatal lethality and

blocked B-cell development in mice lacking the tyrosine kinase Syk. Nature 378,
298-302.

Unkeless, J .C. and Jin, J. (1997). Inhibitory receptors, ITIM sequences and phosphatases.
Curr. Opin. Immunol. 9, 338-343.

Valentine, M.A., Widmer, M.B., Ledbetter, J.A., Pinault, F., Voice, R., Clark, B.A.,
Gallis, B., and Brautigan, D.L. (1991). Interleukin 2 stimulates serine
phosphorylation of CD45 in CTLL-2.4 cells. Eur. J. Immunol. 21,913-919.

Veillette, A., Abraham, N., Caron, L., and Davidson, D. (1991). The lymphocyte-specific
tyrosine protein kinase p561ck. Semin. Immunol. 3, 143-152.

41

Verhagen, A.M., Schraven, B., Wild, M., Wallich, R., and Meuer, SC. (1996).
Differential interaction of the CD2 extracellular and intracellular domains with
the tyrosine phosphatase CD45 and the zeta chain of the TCR/CD3/zeta complex.
Eur. J. Immunol. 26, 2841-2849.

Viola, A. and Lanzavecchia, A. (1996). T cell activation determined by T cell receptor
number and tunable thresholds. Science 273, 104-106.

Wange, R.L., Guitian, R., Isakov, N., Watts, J.D., Aebersold, R., and Samelson, LE.
(1995). Activating and inhibitory mutations in adjacent tyrosines in the kinase
domain of ZAP-70. J. Biol. Chem. 270, 18730-18733.

Wange, R.L., Kong, A.N.T., and Samelson, LE. (1992). A tyrosine-phosphorylated 70-
kDa protein binds a photoaffinity analog of ATP and associates with both the
zeta-chain and CD3 components of the activated T-cell antigen receptor. J. Biol.

Chem. 267, 11685-11688.

Wange, R.L. and Samelson, LE. (1996). Complex complexes: Signaling at the TCR.
Immunity 5, 197-205.

Ward, Y., Gupta, S., Jensen, P., Wartmann, M., Davis, R.J., and Kelly, K. (1994).
Control of MAP kinase activation by the mitogen-induced threonine/tyrosine
phosphatase PACl. Nature 367, 651-654.

Wardenburg, J.B., Pappu, R., BU, J.Y., Mayer, B., Chemoff, J., Straus, D., and Chan,
AC. (1998). Regulation of PAK activation and the T cell cytoskeleton by the
linker protein SLP-76. Immunity 9, 607-616.

Watts, J.D., Affolter, M., Krebs, D.L., Wange, R.L., Samelson, LE, and Aebersold, R.
(1994). Identification By Electrospray-Ionization Mass-Spectrometry Of The
Sites Of Tyrosine Phosphorylation-Induced In Activated Jurkat T-Cells On The
Protein-Tyrosine Kinase Zap-70. J. Biol. Chem. 269, 29520-29529.

Weiss, A. and Littrnan, DR. (1994). Signal-Transduction By Lymphocyte Antigen
Receptors. Cell 76, 263-274.

Welte, T., Leitenberg, D., Dittel, B.N., al-Ramadi, B.K., Xie, B., Chin, Y.E., Janeway,
C.A., Bothwell, A.L.M., Bottomly, K., and Fu, X.Y. (1999). STATS Interaction
With The T Cell Receptor Complex And Stimulation Of T Cell Proliferation.
Science 283, 222-225.

Wu, J ., Motto, D.G., Koretzky, G.A., and Weiss, A. (1996). Vav and SLP-76 interact and
functionally cooperate in IL-2 gene activation. Immunity 4, 593-602.

Xavier, R., Brennan, T., Li, Q.Q., McCormack, C., and Seed, B. (1998). Membrane
compartrnentation is required for efficient T cell activation. Immunity 8, 723-
732.

42

Zapata, J.M., Campanero, M.R., Marazuela, M., Sanchezmadrid, F ., and Delandazuri,
MO. (1995). B-Cell Homotypic Adhesion Through Exon-A Restricted Epitopes
Of Cd45 Involves Lpa—l/Icam-l, loam-3 Interactions, And Induces Coclustering
Of Cd45 And Lfa-l. Blood 86, 1861-1872.

Zhang, W.G., Sloan-Lancaster, J., Kitchen, J., Trible, RP, and Samelson, LE. (1998).
LAT: The ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular
activation. Cell 92, 83-92.

43

CHAPTER 2.

Phosphorylation of CD45 by Casein Kinase 2:
Modulation of Activity and Mutational Analysis.

ABSTRACT

CD45 is a receptor-type PTP that is required for antigen specific stimulation and
proliferation in lymphocytes. This study was designed to determine the nature of specific
kinases in lymphocytes that phosphorylate CD45, and to determine the effect of
phosphorylation on CD45 PTP activity. A major cytoplasmic lymphocyte kinase that
phosphorylated CD45 was identified as casein kinase 2 (CK2) by use of an in-gel kinase
assay in combination with immunoprecipitation, immunodepletion and specific
inhibition. Mutational analysis of CK2 consensus sites showed that the target for CK2
was in an acidic insert of 19 amino acids in the D2 domain, and Ser to Ala mutations at
amino acids 965, 968, 969 and 973 abrogated CK2 phosphorylation of CD45. CK2
phosphorylation increased CD45 activity threefold toward phosphorylated myelin basic
protein and this increase was reversible by PP2A treatment. Mutation of Ser to Glu at the
CK2 sites had the same effect as phosphorylation and also tripled the Vmax of CD45.
CD45 isolated in vivo was highly phosphorylated and could not be phosphorylated by
CK2 without prior dephosphorylation with phosphatase PP2A. We conclude that CK2 is
a major lymphocyte kinase that is responsible for in vivo phosphorylation of CD45 and

phosphorylation at specific CK2 sites regulates CD45 PTP activity.

45

INTRODUCTION

The role of CD45 protein tyrosine phosphatase (PTP)I in lymphocyte signaling
has been the subject of extensive investigation (Ulyanova et al., 1997; Neel, 1997;
Koretzky, 1993; Trowbridge and Thomas, 1994). CD45 is a transmembrane PTP of
hematopoietic cells comprised of 1268 total amino acids with an external domain
containing alternately used exons which leads to the lymphocyte specific expression of at
least eight different isoforrns (Ulyanova et al., 1997; Chang et al., 1991; Bretz et al.,
1992). The cytoplasmic domain consists of 702 amino acids and contains two tandem
repeated PTP domains designated D1 and D2 (Ulyanova et al., 1997). The membrane
proximal PTP domain (D1) is constitutively active and the second PTP domain (D2) is
considered to be inactive (Felberg and Johnson, 1998). The catalytic activity of the D1
but not the D2 domain is required for TCR signal transduction in CD45-deficient cell
lines (Desai et al., 1994). The role of CD45 in the antigen specific activation of B and T
cells has been documented by demonstrating that T cells and B cells lacking CD45 fail to
respond to antigen stimulation (Koretzky et al., 1990; Pingel and Thomas, 1989). This
observation has been confirmed in CD45 knockout mice in which the antigen signaling
capacity of T and B cells was severely diminished and the transition of thymocytes to
maturity was impaired (Byth et al., 1996; Kishihara et al., 1993). CD45 is believed to
activate the Src family protein tyrosine kinases (PTKs) by dephosphorylating the
regulatory pTyr near the C terminus of T cell receptor or B cell receptor-associated Src
family kinases (Ostergaard et al., 1989; Hurley et al., 1993; Mustelin et al., 1992; Sieh et
al., 1993). However, recently it has become clear that the regulation of Src family

kinases is likely to be more complex since the discovery that the activating tyrosine

46

phosphorylation site in the kinase domain is also dephosphorylated by CD45 (D'Oro et
al., 1996). The importance of the CD45 PTP activity in the activation of T cells has been
demonstrated by showing that chimeric proteins containing only the cytoplasmic domain
of CD45 were capable of restoring normal T cell receptor activation (Hovis et al., 1993;
Desai etal., 1993; Volarevic et al., 1993). In spite of previous research there is still much
to be learned about the range of natural substrates of CD45, as well as about the nature of
other proteins that may interact with CD45.

Phosphorylation of CD45 may play an essential role in the function of CD45 and
may regulate PTP activity, substrate specificity, subcellular localization, and/or docking
with other signaling molecules. Decreased PTP activity of CD45 was found to correlate
with decreased serine phosphorylation after calcium ionophore treatment of T cells
(Ostergaard and Trowbridge, 1991) and serine residues on CD45 have been shown to be
phosphorylated in response to T cell treatment with phorbol esters (Autero and
Gahmberg, 1987) and afier IL-2 treatment of CTLL-2.4 cells (Valentine et al., 1991).
Little or no modulation in CD45 PTP activity was observed after phosphorylation in
these reports. In other studies serine phosphorylation was observed after lectin treatment
of T cells, and tyrosine phosphorylation of CD45 has been reported in phenylarsine oxide
treated T cells (Autero et al., 1994; Stover and Walsh, 1994). CD45 was phosphorylated
after in vitro treatment with casein kinase 2 (CK2) and other serine/threonine kinases

such as protein kinase C and glycogen synthase kinase (Tonks et al., 1990). Increased

CD45 PTP activity was found after phosphorylation with pSOCSk TK (Autero et al., 1994)
and after sequential tyrosine phosphorylation by v-Abl kinase (using ATPyS) followed by

serine phosphorylation with CK2 (Stover and Walsh, 1994).

47

Using two-dimensional TLC, HPLC and matrix-assisted laser
desorption/ionization mass spectrometry (MALDI-MS) we have identified several in vivo
phosphorylation sites of CD45 (Kang et al., 1997). One phosphorylation site identified in
that study, Ser939, is in a putative substrate-binding loop of the inactive D2 PTP domain.
Three other sites, Serum, Thr1246 and Ser1248 are in the C-terrninal tail of the molecule.
Another multiply phosphorylated region was tentatively localized to the 19 amino acid
acidic insert in the D2 domain (Kang et al., 1997). The importance of CD45
phosphorylation sites to PTP activity or to T cell activation remains unknown. The
present study was designed to evaluate the relationship of precise CD45 phosphorylation
events to the fimctional role of CD45. In this study, we have identified CK2 as a
lymphocyte kinase which targets CD45 and which is responsible for phosphorylation of
CD45 in the 19 amino acid acidic region of the D2 domain- of CD45. This region is a
unique insert in the D2 domain that is not found in the CD45 D1 domain, or in any other
PTP D1 or D2 domain. Investigation of the relationship of the CK2 phosphorylation sites
to the PTP activity of CD45 showed that phosphorylation of the D2 acidic region by CK2

increased CD45 activity threefold toward phosphorylated myelin basic protein.

MATERIALS AND METHODS
Cells~ and cell culture. CTLL-2 (murine cytolytic T cell line), D0-11.10 (murine
T cell hybridoma) and 70Z/3.12 (murine pre-B lymphocyte cell line) were obtained from
ATCC (Bethesda, MD). Jurkat (clone E6-l) (human acute T cell leukemia cell line) and
CD45 deficient Jurkat clone (J45.01) were obtained from Dr. Gary Koretzky (University

of Iowa). The cells were cultured in RPMI 1640 medium (Life Technologies, Inc.,

48

Gaithersburg, MD) supplemented with 10% heat-inactivated fetal bovine serum (Life
Technologies, Inc.), streptomycin/penicillin (100 units/ml, Life Technologies) and 50
mM B-mercaptoethanol (Sigma Chemical Co., St. Louis, MO). Recombinant IL-2 (Cetus
Corporation, Emeryville, CA) was added to the CTLL-2 cultures at 7 units/ml. BW5147
(murine T lymphoma), WEHI274.1 (murine monocyte), P815 (murine mastocytoma),
NIH3T3 (murine fibroblast) were obtained from ATCC and were grown in DMEM
medium (Life Technologies) containing 10% heat-inactivated fetal bovine serum,
streptomycin/ penicillin (100 units/ml) and 50 mM 2-mercaptoethanol. Cells were
maintained in an exponential growth state (0.1 to 5.0 x 105 cells/ml) and cultures with
viability greater than 97% were harvested for experimental use.

Site-directed mutagenesis. The bacterial expression vector pET3d-6HisCD45,
which expresses the cytoplasmic domain of murine CD45 with a 6His tag introduced to
the amino terminus, was kindly provided by Dr. Pauline Johnson of the University of
British Columbia (N g et al., 1995b). Multiple point mutations in the acidic insert of the
D2 domain of CD45 were made using QuickChange site-directed mutagenesis kit
(Stratagene, La Jolla, CA). Desired mutations (underlined) were incorporated into a pair
of oligonucleotide primers, each complementary to opposite strands of the parental DNA
template. The primers used for Ser to Ala (965, 968, 969 and 973) mutagenesis were as
follows: 5’GTGAGCCTGAA_G_CAGATGAGQCTQCAGATGATGAC_G§TGAC-
TCAGAAG3’ and 5’CTTCTGAGTCAflGTCATCATCTGCAGQCTCATCTGQTT-
CAGGCTCAC3’. The primers used for Ser to Glu (965, 968, 969 and 973) mutagenesis
were: 5’GTGAGCCTGAAG_A,AGATGAG%G_AAGATGATGACG_A_G_GACTCAGA-

AG3’ and 5’CTTCTGAGTCCTCGTCATCATCTTCCTCCTCATCT'LQTICAGGCTC-

49

AC3’. The primers were extended by pfil DNA polymerase during a short temperature
cycling (95°C for 30 sec, 55°C for 1 min, 65°C for 13.5 min (2 min/kb of plasmid length),
18 cycles) and the parental DNA template was then digested by Dpn I endonuclease.
Mutants were selected after the synthesized DNA was transformed into E. Coli XLl-Blue
and later verified by sequencing.

Purification of recombinant CD45 proteins and in-gel kinase assay.
Recombinant wild type and mutant cytoplasmic domain CD45 (designated 6His-
cthD45) was purified from E. coli BL21(DE3) as described (N g et al., 1995b). The size
of the purified proteins was determined on 10% SDS polyacrylamide gel and the
concentration was determined by the Bio-Rad protein assay (Bio-Rad Laboratories Inc.,
Melville, NY). The in-gel kinase assay was adapted from a previously described method
(Kameshita and Fujisawa, 1989). Briefly, 10% polyacrylamide gel was crosslinked with
50 pg/ml of 6-His-cthD45 substrate, while the stacking gel was prepared without the
substrate. Cell lysates (1x10° cells) or immunoprecipitates were loaded onto the gel for
electrophoresis. The gel was washed thoroughly with 20% 2-propanol to remove SDS
and the protein kinases in the gel were then denatured with two incubations with 6 M
guanidine HCl (Life Technologies) and renatured with five changes of 0.04% Tween 40
(Sigma) at 4°C. The gel was pre-incubated in the kinase assay buffer (40 mM HEPES,
pH 8.0, 2 mM DTT, 0.1 mM EGTA, 5 mM Mg(Ac)2, 0.2 mM Ca2+) for 30 min at room
temperature. The kinase reaction was started by incubating the gel in the kinase assay
buffer containing 5 uCi [y—32P]ATP (3000 Ci/mmol, Dupont NEN, Boston, MA) for 1 hr
at 30°C. After the reaction, the gel was washed four to five times with 5% (w/v)

trichloroacetic acid solution containing 1% sodium pyrophosphate, until the radioactivity

50

of the solution approached background. The gel was dried on 3MM Whatrnan paper and
subjected to phosphorimage analysis (Molecular Dynamics Inc., Sunnyvale, CA).
Immunoprecipitation and immunoblotting. Cells were washed twice with ice-
cold phosphate buffered saline (PBS) (137 mM NaCl, 3 mM KCl, 8 mM NazHPOa, 1
mM KHzPOa, pH 7.4) and then lysed in appropriate volume (5x107 cells/ml) of lysis
buffer (1% NP40 [Pierce Chemical Co., Rockford, IL], 20 mM Tris, pH 8.0, 137 mM

NaCl, 10% glycerol, 5 mM EDTA, 2 mM PMSF, 0.23 U/ml aprotinin, 0.5 ug/ml

leupeptin, 0.7 pg/ml pepstatin A, 10 ug/ml DNase I, 1 pM okadaic acid, 6 mM sodium
fluoride, 2 mM sodium orthovanadate and 4 mM sodium molybdate) for 30 min on ice.
Cell nuclei were pelleted by centrifugation at 12,000 rpm at 4°C for 15 min, and the
supematants were incubated with the antiserum to CK2a, CK2a' or CKZB kindly
provided by Dr. David Litchfield, University of Western Ontario (Gietz et al., 1995), or
with antibodies to CD45 (clone 9.4, ATCC) for 2 hours. GammaBind Plus Sepharose
(Pharmacia Biotech Inc., Piscataway, NJ) was added, followed by rocking at 4°C for 1 hr.
Immune complexes were washed sequentially with 1% NP40 lysis buffer, PBS (pH 7.4),
0.5 M LiCl (pH 7.4) and 20 mM Tris (pH 7.4). Immunoblotting was performed on
PVDF membrane with a mixture of anti-CK20t and CK20L' (1 :1000 dilution) (Gietz et al.,
1995) followed by incubation with HRP-conjugated goat anti-rabbit secondary antibody
(BioRad) and visualization with chemiluminescence (Amersham Co., Arlington Heights,
IL).

PT P assay and kinetic analysis. The PTP activity of CD45 was determined as
described previously (Melkerson-Watson et al., 1994) using 32P-labeled myelin basic

protein (MBP) and Raytide as substrates. Briefly, 50 pg of Enhanced Raytide

51

(Calbiochem, San Diego, CA) or 250 pg of MBP (Sigma) was labeled with 50 pCi of
[y—32P]ATP by incubation with 500 ng of recombinant Src tyrosine kinase (obtained from
Dr. J. Dixon, University of Michigan) for 1 hr at 30°C, in 160 pl of reaction mixture
containing 500 pM ATP, 10 mM MgC12, 16 mM HEPES, pH 7.5, 0.03 mM EDTA,
0.07% B-mercaptoethanol. Labeled 32P-Raytide or MBP was added to 100 pl of 5 mg/ml
BSA and 70 p1 of 50% cold TCA followed by centrifugation at 12,000 rpm for 15 min.
The pellet was then washed twice with 10% cold TCA and resuspended in 200 pl of 200
mM Tris, pH 8.0. PTP assays were carried out at 30°C and each assay contained 5 pl of
10x PTP buffer (250 mM HEPES, pH 7.3, 50 mM EDTA, 100 mM DTT), 35 pl H20, 5
pl of 32P-labeled MBP and 5 pl of sample to be assayed. After incubation for various
times, aliquots of the reaction mixture were taken out and added to 0.75 ml acidic
charcoal suspension (0.9 M HCl, 90 mM Na4P207, 2 mM NaHzPO4, and 4% [w/v] active
charcoal [Sigrna]) to stop the reaction. After centrifugation, the amount of released 32F in
the supernatant was measured in a scintillation counter. For the 6His-cthD45 kinetics
specific activity is expressed as nmol/min/mg protein and was plotted against substrate
concentration. Kinetic parameters were calculated by nonlinear curve fitting of the data
to the Michaelis-Menten equation using Microcal Origin software (Microcal Software
Inc., Northampton MA). The kinetics parameters of CK2 (Boehringer Mannheim Co.,
Indianapolis, IN) with 6His-cthD45 as substrate were determined with a CK2 assay
using Whatrnan P81 phosphocellulose paper squares as described previously (Tonks et
al., 1990) .

CK2 phosphorylation of 6His-cthD45. Wild type and mutant 6His-cthD45

protein (1 pg) was either mock treated or treated with 0.04 mU recombinant CK2

52

(Boehringer Mannheim) at 30°C for 30 min in the presence of 20 mM Tris, pH 7.5, 5 mM
MgC12, 1 mM DTT and 5 pM ATP. Treatment with PP2A treatment was performed as
follows. 6His-cthD45 was phosphorylated as described above followed by the addition
of sufficient heparin (10 pg/ml) to inhibit CK2 without inhibiting CD45 (determined by
titration of heparin with each enzyme). The phosphorylated CD45 was then mock treated
or incubated with PP2A (0.5 units, Promega) for an additional 30 min at 30°C. The
mixture was then subjected to PTP assay as described above.

In vitro kinase labeling of CD45 and PP2A treatment. Immunoprecipitated
CD45 from Jurkat T cells (1x 107 cells for each sample) were either mock treated or
treated with PP2A (Promega, Madison, WI) for 1 hr at 30°C in 40 pl of reaction mixture
containing 20 mM MgC12, 50 mM Tris, pH 8.5, 1 mM DTT, 1 pl of PP2A (0.5 units/pl).
Treated immunoprecipitates were then washed with PBS (pH 7.4), 0.5M LiCl (pH 7.4)
and 20 mM Tris (pH 7.4). The in vitro kinase labeling by CK2 was performed at 30°C.
Each reaction contained 4 pl of 10x kinase buffer (200 mM Tris, pH 7.5, 50 mM MgC12,
10 mM DTT), 20 pl of immunoprecipitated CD45, 1 p1 of recombinant CK2 (0.2 mU/pl,
Boehringer Mannheim), 1 pl of 0.1 mM ATP, 10 pCi of [y—32P]ATP (3000 Ci/mmol,
Dupont NEN) and H20 to 40 pl. The reaction was incubated for 30 min, then terminated
by addition of SDS sample buffer at 100°C. Labeled CD45 immunoprecipitates were
loaded onto 7.5 % SDS-polyacrylamide gel, followed by electrophoresis and
phosphorimage analysis.

FPLC analysis. FPLC analysis was performed using a Mono-Q anion exchange
column (Pharmacia) using buffer systems described previously (N g et al., 1995b) and a

NaCl gradient from 150 mM to 600 mM. Eluted proteins were assayed by release of

53

phosphate using pNPP (Sigma) as substrate. CK2 phosphorylation of 6His-cthD45 for
FPLC analysis was performed as described above.

T rypsin digestion and mass spectrometry. CD45 trypsin digestion and mass
spectrometry were performed as described previously (Kang et al., 1997). Briefly, SDS-
PAGE purified, 32P-labeled CD45 was transferred to PVDF membrane, excised, and
subjected to tryptic digestion with 10 pg trypsin (Promega) at 37°C. Tryptic peptides
were recovered and subjected to HPLC fractionation using a rnicrobore reverse-phase
RP-HPLC system (Michrom BioResources, Inc., CA) (Kang et al., 1997). The
hydrophilic, multiply phosphorylated HPLC fraction 4 (Kang et al., 1997) was subjected
to MALDI-MS (Voyager Elite time-of-flight, PerSeptive Biosystems, Framingham, MA)
exactly as described previously (Kang et al., 1997). A computer program, MSU
MassMap (Liao et al., 1994) was used to calculate the average masses of all possible

peptide and phosphopeptide fragments from CD45.

RESULTS

Identification of CD45-kinase by in-gel kinase assay. In-gel kinase assays were
used in an effort to identify kinases from T cells with potential to phosphorylate CD45.
The in-gel kinase assay was performed by separating cytoplasmic lysates of CTLL-2 cells
in SDS-PAGE gels containing the 6His tagged recombinant cytoplasmic domain of CD45
(6His-cthD45) at a concentration of 50 pg/ml. The gel containing separated proteins
was renatured and [y—32P]ATP was added to detect kinase activity (Fig. 1). Without
incorporated in-gel substrate, several radioactive bands between 40 and 120 kDa were

present and most likely represent the autophosphorylation of some CTLL-2 kinases.

54

kDa CTLL—2 lysate
202— - _

116— i 5 p '33,.
84- t:

  

50-

36‘

29-
1 2 3 4
Substrate none CD45 MBP MBP
(pg/ml) 50 50 500

Fig. 1. In-gel kinase assay of T cell lysates. In-gel kinase analyses of CTLL-2
lysates were performed without in-gel substrate (lane 1), with 6His-cthD45 at 50
pg/ml of gel (lane 2) as substrate, and with MBP at 50 pg/ml (lane 3) and at 500
pg/ml (lane 4) as substrate. The positions of the radioactivity specifically associated
with CD45 substrate are indicated by arrows at 40 and 45 kDa. Protein size is
indicated by molecular weight markers in kDa The position of radioactive bands
was determined by phosphorimage analysis throughout this study.

With CD45 in-gel substrate, the electrophoretically separated CTLL-2 lysates exhibited
enhanced labeling of two major bands at 40 and 45 kDa (arrows) (Fig. 1A, lane 2), which
indicated phosphorylation of CD45 by a kinase doublet. Digestion and phosphoamino
acid analysis of both. phosphorylated bands showed that the proteins were exclusively
phosphorylated on serine residues (not shown). The enhanced labeling at 40 and 45 kDa
was selective for CD45 because the incorporation into other substrates such as myelin
basic protein (MBP) at 50 pg/ml or even at 500 pg/ml only resulted in basal level of
phosphorylation at the same position (Fig. 1A, lane 3 and 4).

Distribution of CD45 in-gel kinase activity. The CD45 in-gel kinase activity
was found to be broadly distributed among a panel of murine cell lines, including T cell
lines (CTLL-2, D0-11.10, BW5147), a B cell line (70Z/3.12), myeloid cells
(WEI-11274.1, P815), a fibroblast line (NIH3T3), and a human T cell line (Jurkat) (Fig.
2A). Each cell type exhibited two bands resulting from a CD45 selective kinase at 40
and 45 kDa. This indicated that the CD45 kinase was ubiquitously expressed in cell lines
derived from various tissues. Candidate serine/threonine kinases in this molecular weight
range included MAP kinase and CK2. Examination of the CD45 cytoplasmic domain
sequence showed that CD45 had several consensus sites for CK2 phosphorylation, while
there were few conserved serine or threonine residues that could serve as MAP kinase
substrates. Immunoblotting with a mixture of anti-CK20L and anti-CKZa' showed that
CK2 was widely expressed in these cell types and precisely overlapped with the in-gel
kinase activity (Fig. ZB). We then addressed the question of the identity of the CD45

kinase by use of CK2 specific inhibitors.

56

 

CD45
substrate
I - 36
.. , - » * -50
substrate ~- .., _ .1 .2 -. .;
I . ~36

 

h." —" 1"— ”, ; a
anh'CKZ h “‘“taP *” mm” ”T'ngba’
blot -36

Fig. 2. Expression of CD45 targeted in-gel kinase activity in various cell
lines. (A) Lysates were prepared from a panel of cell lines as indicated at the
top of the figure and subjected to electrophoretic separation with in-gel substrate
6His-cthD45 (50 pg/ml of gel) and subsequent in-gel kinase assay. A parallel
separation was performed without added substrate (middle panel). (B) Equivalent
amounts of cell lysates from panel A were subjected to electrophoresis and
immunoblot analysis with antisera specific for CK201 (45 kDa) and CK201' (40
kDa) as indicated by the arrows.

57

CD45 in-gel kinase activity is inhibited by CK2 inhibitors. In-gel kinase assays
were performed with 50 pg/ml 6His-cthD45 in presence of known CK2 inhibitors
(Allende and Allende, 1995; Tawfic et al., 1995; Litchfield and Luscher, 1993) to
determine whether the observed CD45 in-gel kinase activity was consistent with that of
CK2 (Fig. 3). The presence of CD45 in-gel kinase activity was almost completely
blocked by treatment with either 50 pg/ml heparin (Fig. 3, lane 3), 200 pM GTP (lane 4)
or 2 mg/ml poly-GluTyr (4:1) (lane 5). The activity of authentic recombinant CK2a was
also almost completely abrogated by the inhibitors (Fig. 3, lanes 7-9). Taken together,
the size of the in-gel kinase coupled with observed inhibition by specific CK2 inhibitors
strongly suggested that the kinase responsible for phosphorylation of CD45 in this assay
was CK2.

Immunoprecipitation of the CD45-targeted in-gel kinase with CK2 antibodies.
To confirm the nature of the CD45 kinase, CK2 immunoprecipitates from cell lysates
were subjected to in-gel kinase assays with 6His-cthD45 as substrate (Fig. 4A). CK2
consists of homotetrameric and heterotetrarneric complexes (01202, 062132, and 0101132)
containing two catalytically active alpha chains (45 kDa or chains and 40 kDa 01' chains)
and two non-catalytic, regulatory B chains (26 kDa each)(Gietz et al., 1995). In-gel
kinase analysis of anti-CK201 immunoprecipitates resulted in prominent labeling of CD45
substrate at 45 kDa (Fig. 4A lane 1). Analysis of CK201' immunoprecipitates resulted in
prominent labeling at 40 kDa (Fig. 4A, lane 2), and CKZB immunoprecipitates resulted in
the visualization of radioactive bands consistent in size to CK201 and CKZa' (Fig. 4A,
lane 3). Both a and or' are expected to exist in CK201, or' or [3 immunoprecipitates due to

the existence of heterotetramers as noted above. Precipitation with Sepharose G beads

58

 

CTLL-2 lysate

CK20.

 

 

 

   

 

 

Treatment none nme heparin GTP poly-Glu none heparin GTP pol y-Glu
-Tyr -Tyr
202-
84— .; . . -- . W
50— I . »- ' -
—-} was " =42 W?!“ t
36—
29— 1 2 3 4 5 6 7 8 9
no substratel CD45 substrate CD45 sulstrate

 

 

 

 

 

Fig. 3. Inhibition of in-gel kinase activity with inhibitors of CK2. CTLL-2
lysates (lanes 1-5) were subjected to in-gel kinase assay with 50 pg/ml 6His-
cthD45 as substrate (lanes 2-5) in presence of inhibitors of CK2. CTLL-2
lysates were also analyzed with no in-gel substrate (lane 1). Recombinant human
CK20L was also subjected to in gel kinase assay as a control (lanes 6-9). The
inhibitors used were heparin (lanes 3 and 7), GTP (lanes 4 and 8) and poly-GluTyr
(lanes 5 and 9). The positions of the CD45 targeted in-gel kinase bands are
indicated with arrows at 45 and 40 kDa. Protein size is in kDa.

59

A anti-CK2 IP B % anti-CK2 depletion

 

 

or or’ B beads 2‘ or 01’ B beads_',‘?:

”—84

 

1234 12345—29

 

 

 

CD45 substrate CD45 substrate

kDa
— 116
— s4
— 50
— 36
_ 29

l 2 3 4 l 2 3 4 5
no substrate

Fig. 4. Immunoprecipitation of the CD45 targeted kinase with anti-CK2
antiserum. (A) CTLL-2 cell lysates were subjected to immunoprecipitation with
anti-CK201 (lane 1), anti-CKZa' (lane 2) and anti-CKZB (lane 3) and separated with a
gel containing 6His-cthD45 as substrate. Control "precipitation" using beads alone
is shown in lane 4. Immunoprecipitates were also analyzed without in-gel substrate
(bottom panel). The positions of CK201 and CK201' are indicated with arrows at 45
and 40 kDa respectively. (B) CK2 was depleted from CTLL-2 lysates with anti-
CK2a (lane 2), anti-CK2a' (lane 3) and anti-CK20 (lane 4) and the depleted lysates
were subjected to in-gel kinase assay using 6His-cthD45 as substrate. The starting
lysate was analyzed in lane 1 and control depletion using beads alone is shown in
lane 5. Only one round of depletion was performed.

60

alone did not result in the isolation of in-gel kinases (Fig. 4A, lane 4). Parallel samples
subjected to in-gel analysis without added CD45 protein did not result in significant
activity (Fig. 4A, lower panel). To further confirm that CK2 was the CD45 kinase in
CTLL-2 cells, specific CK2 antisera were used to deplete CK2 from CTLL-2 lysates
(Fig. 48). After only one round of immunoprecipitation, the 40 kDa CD45 in-gel kinase
activity was preferentially depleted using anti-CKZa' (Fig. 4B, lane 3) while the CK2
activity was only slightly depleted with anti-CKZa (Fig. 4B, lane 2) or anti-CKZB (Fig.
4B, lane 4). The relatively prominent labeling of the CK2a' in-gel kinase band and
immunodepletion by anti-CK201' serum suggested that CK2a' was the primary form of
CK2 catalytic subunit that phosphorylated CD45 in these cells.

CD45 as a substrate for CK2. In order to further characterize the nature of CK2
phosphorylation of CD45, a kinetic analysis was performed. The Km was 0.51 pM and
the Vmax was 35.5 nmol/min/mg with CD45 as a substrate of CK2. These parameters
were comparable to reports of CK2 kinetics with other protein substrates (for example,
Km 1.1 pM and Vmax 82.5 nmol/min/mg with eIF-2 (Gonzatti-Haces and Traugh, 1982)).
With a Km in the sub-micromolar range, we conclude that CD45 is an excellent substrate
for CK2 (Tuazon and Traugh, 1991).

Mutation of the CK2 consensus phosphorylation sites blocks phosphorylation
by CD45-targeted in-gel kinase activity. When the 19 amino acid acidic insert of the D2
domain (Fig. 5, boxed) was compared for different species, four highly conserved CK2
phosphorylation sites consisting of the consensus sequence Ser-X-X-acidic group
(Pearson and Kemp, 1991) were noted (Fig 5, shaded residues). All four CK2 consensus-

site serines at position 965, 968, 969 and 973 were mutated to alanines in 6His-cthD45

61

Ser 965 968,969 973
E KESEPESD ESSDDDSDS TSKYINAS mouse
E KESEAESD ESSDEDSDS TSKYINAS rat
EL KESEHDSD ESSDEDSDS PSKYINAS human
EEE KEGEHDSE DSSDEDSDC SSRYINAS chicken
EDE KDGTSHSDSDLSSDDSED STKY NAS shark
acidic insert 131-81111“!

 

Fig. 5. CD45 sequence homology in the region of the 19 amino acid D2 insert.
Comparison of the interspecies homology of the CD45 D2 region containing the 19
amino acid acidic insert unique to CD45. The insert is boxed, and the serine
residues at 965, 968, 969 and 973 that are mutated in this study are shaded. The
position of the beginning of the [SI-strand (INAS) found in the family of PTP
molecules is shown by the arrow. The standard single letter amino acid code is
used. The accession numbers for the sequences are: mouse, P06800; rat, P04157;
human, P08575; chicken, 221960; and shark, U34750.

62

to preclude potential phosphorylation. The mutated protein was then incorporated into an
SDS-PAGE gel at 50 pg/ml of gel and an in-gel kinase assay was performed using
immunoprecipitates of anti-CKZOL, anti-CKZa' and anti-CKZB (Fig. 6A, lanes 1, 2 and 3,
respectively). Control experiments used the same immunoprecipitates with wild type
6His-cthD45 as substrate (Fig. 6B) and with no substrate (Fig. 6C). The reduction of
labeling with the serine to alanine mutated form of 6His-cthD45 was essentially
complete, showing that these sites represented the major CK2 phosphorylation sites in the
CD45 cytoplasmic domain.

Serine phosphorylation of the acidic insert in the D2 domain increases CD45
activity. The high conservation of the CK2 phosphorylation sites in the acidic insert
region of CD45 led us to hypothesize that phosphorylation (or introduction of additional
acidic residues) at this site would modulate CD45 activity. To test this hypothesis, we
compared the kinetics of the 6His-cthD45 mutant forms using 32P-MBP as a substrate.
MBP was used because it is an excellent substrate for CD45 (Tonks et al., 1990) and
because it was necessary to prepare it in sufficient quantity to perform repeated kinetic
analysis at substrate saturating levels. The kinetics of wild type 6His-cthD45 are shown
in Table I and are comparable to previous reports (Tonks et al., 1990). Ser to Ala (S/A)
mutations only slightly altered the basic kinetic parameters of 6His-cthD45 while the
introduction of acidic residues (Glu) into the Ser CK2 sites resulted in a three fold
increase in Vmax and a small increase in Km (Table I).

We then evaluated the effect of CK2 phosphorylation on CD45 activity at single
substrate concentrations (8 pM) as determined from Fig. 7A. Wild type 6His-cthD45

was phosphorylated with CK2 followed by comparison of the PTP activity to the

63

 

 

—36

l 2 3 4 1 2 3 4 l 2 3 4 — 29
CD45 S/A mutant CD45 substrate no substrate

 

Fig. 6. In-gel kinase analysis of CK2 immunoprecipitates using mutant CD45
as substrate. Anti-CKZa (lane 1), anti-CKZa' (lane 2) and anti-CKZB (lane 3)
immunoprecipitates from CTLL-2 cells were subjected to an in-gel assay system
containing the following substrates: (A) 6His-cthD45 with 4 Ser to Ala
mutations at residues 965, 968, 969 and 973; (B) wild-type 6His-cthD45; and (C)
no substrate. Control "precipitation" using beads alone is shown in each lane 4.
The size of SDS-PAGE markers is shown in kDa.

Table 1. Kinetic parameters of the CK2 site-mutated 6His-cthD45

 

 

 

 

with 32F MBP as substrate.
K... ' 14...,
CD45form (pM) (pmol/min/mg)
wt 0.94 a 0.47” 24.2 a 2.4
S/Ac 1.18 i 0.42 33.3 a 2.7
343 1.95 a 0.29 85.1 i 3.5

 

a. Km and Vmax were calculated using nonlinear curve fitting with
Microcal Origin Software.

b. Average and standard deviation of three determinations.

c. S/A and S/E refer to the corresponding Ala and Glu mutations at
Ser residues 965, 968, 969 and 973.

65

 

 

C [:1 no CK2 - +cn<2
60: 32P-Raytide

 

 

 

wt ' S/A SIE

 

 

 

4 a
[MBPlpM

 

 

B Dmcxz -+CK2

Specific activity (ng/min/mg x 103)
O

 

 

 

 

 

   

Fig. 7. Effect of mutation and CK2 phosphorylation on CD45 activity. (A)
Kinetics of the 6His-cthD45 mutant forms using 32P-MBP as substrate. Specific
activity of each CD45 CK2-site mutants (Se1965, 968, 969 and 973) Ser to Ala (S/A)
and Ser to Glu (S/E) was determined over the substrate concentration range. The ’
curves were calculated by nonlinear curve fitting of the data to the Michales-Menton
equation using Microcal Origin software. (B) PTP activity was determined using 32P-
MBP for 6His-cthD45 containing Ser to Ala (S/A) and Ser to Glu (S/E) mutations
and for wild type (wt) CD45 (open bars). In parallel, wild type and mutant CD45
proteins were phosphorylated with CK2 and ATP before PTP assay (shaded bars). (C)
PTP activity using 32P-Raytide as substrate was determined for the 6His-cthD45
forms as shown above. For B and C the average and standard deviation of three
separate experiments are shown. (D) Comparison of PTP activity (with 3JZP-MBP as
substrate) of CK2 phosphorylated, wild type 6His-cthD45 (+CK2) with PTP activity
afier sequential CK2 phosphorylation and subsequent dephosphorylation with PP2A
(+CK2 +PP2A). PP2A alone was added as a control (+PP2A).

66

unphosphorylated form of the protein. For 32P-MBP, wild type CD45 activity was
enhanced afier CK2 phosphorylation by about three-fold (Fig. 73 wt; gray bar).
Mutation of the four consensus Ser residues (965, 968, 969 and 973) to Ala (S/A) did not
increase the activity of CD45 and phosphorylation of the S/A mutant did not exhibit an
increase in activity (Fig. 7B, gray bar). Mutation of the four Ser residues to Glu (to
mimic phosphorylation) resulted in a three-fold activity increase toward MBP (Fig. 7B,
S/E, white bar) and there was no change in the activity of the S/E mutant afier
phosphorylation with CK2 (Fig. 7B, S/E, gray bar). Interestingly, the large increase in
activity upon phosphorylation of the acidic domain was only observed with MBP and not
with two other small substrates, for example 32P-Raytide (Fig. 7C) and pNPP (data not
shown). Only a small increase in activity toward 32P-Raytide was observed after
phosphorylation of wt 6His-cthD45 with CK2 (Fig. 7C, wt). Further, neither Ser to Ala
or Ser to Glu mutations or CK2 phosphorylation had significant effect on the activity of
CD45 with Raytide as substrate (Fig. 7C, S/A, S/E).

We then determined the activity of CK2 phosphorylated CD45 after removal of
phosphate with PP2A (Fig. 7D). Afier the CK2 phosphorylation we added heparin to
inhibit CK2 activity and then incubated with PP2A. The amount of heparin added (10
pg/ml) was determined by titration to achieve a balance in which the heparin inhibited
the CK2 without inhibiting CD45 or PP2A (data not shown). Using this protocol, we
were able to show, in the same set of experiments, that CK2 increased the activity of
CD45 and that subsequent dephosphorylation with PP2A reversed the activation.
Complete reversal may not have been achieved during the short incubation possibly due

to residual CK2 activity and the presence of excessive ATP.

67

In order to verify that treatment with CK2 resulted in the phosphorylation of all
the CD45 present, we subjected the CK2 treated, activated 6His-cthD45 from Fig. 7B to
analytical F PLC separation on a Mono-Q anion exchange column (Fig. 8). Mock treated
(ATP without added CK2) and CK2 phosphorylated wt 6His-cthD45 were separated
using NaCl gradient elution from 150 mM to 600 mM. Wild type 6His-cthD45 eluted
in about 14 ml at 240 mM NaCl (active fractions determined by pNPP hydrolysis are
shaded) and a large peak of ATP eluted at about 180 mM (about 10 ml)(Fig. 8A).
Analysis of CK2 phosphorylated 6His-cthD45 indicated that the active fractions were
retained by the column and required from 340 to 360 mM NaCl for elution (about 19
ml)(Fig. 8A). The phosphorylated CD45 appeared as two peaks likely resulting from
differently phosphorylated forms. One of these CD45 forms eluted at the same salt
concentration as the S/E mutant (340 mM NaCl) which contains 4 additional negative
charges out of 715 amino acids (shown in Fig. 8E). The FPLC elution profile of wt and
the S/A mutant are also shown for comparison (both eluted at 240 mM NaCl) (Fig. 8C
and D). Consideration of the FPLC data suggests that the two peaks represent CD45
forms containing different numbers of phosphates. In parallel experiments, the
stoichiometry of phosphorylation of 6His-cthD45 was estimated at 2.5 moles of
phosphate per mole of protein by quantitation of the incorporation of 32F of known
specific activity into CD45 (data not shown).

CK2 targeted sites in CD45 are phosph orylated in vivo. We found that CK2
immunoprecipitates from Jurkat T cells had constitutively high activity toward CD45,
and the overall activity of CK2 did not change after stimulation of Jurkat cells with anti-

TCR, PMA or ionomycin (data not shown). This result suggested that cytoplasmic CK2

68

 

 

 

§ § NaCI mo

 

 

'0

 

 

 

Absorbance 280 nm

 

 

 

 

 

 

 

 

 

 

'o ‘ 111 ' loT lo
Fraction (ml)

Fig. 8. Analytical FPLC separation of CK2 phosphorylated CD45. 6His-cthD45
was subjected to analytical FPLC separation on a Mono-Q anion exchange column using
NaCl gradient elution (fine line from 150 mM to 600 mM). (A) Elution profile of mock
treated 6His-cthD45 containing ATP without added CK2 (CD45 eluted at 240 mM
NaCl). (B) Elution profile of CK2-phosphorylated 6His-cthD45 (CD45 eluted at 340
to 360 mM NaCl). An absorbance scale of 0.01 was used and PTP active fractions were
determined by pNPP hydrolysis (shaded areas). ATP eluted at about 180 mM NaCl
(peak indicated by arrow). (C to E) FPLC elution profile of wt, S/A and S/E mutant
forms of 6His-cthD45 separated under conditions comparable to the previous panels.

69

maintained a high level of phosphorylation of CD45 in the acidic insert. To address the
question of whether CD45 CK2 sites were phosphorylated in vivo, immunoaffinity
purified CD45 from Jurkat T cells was subjected to in vitro kinase labeling by
recombinant CK201 and [y—32P]ATP (Fig. 9). It was found that immunoprecipitated
CD45 from Jurkat T cells could not be labeled easily by exogenous CK2 (Fig. 9A, lane
1). Since phosphorylation at the CK2 sites could have blocked the addition of firrther
phosphates, CD45 immunoprecipitates were pretreated with PP2A phosphatase before the
kinase labeling. PP2A treatment converted CD45 to a form that could be successfully
phosphorylated with CK2 (Fig. 9A, lane 2). Immunoprecipitates from a CD45-deficient
Jurkat clone (145.01) were used as controls (Fig. 9, lane 3-4). Further evidence for the V
existence of in vivo, multiple phosphorylations at the CD45 CK2 sites was obtained by
MALDI-MS analysis of tryptic peptides obtained from in vivo 32P-labeled CD45 (Fig.
9B). The hydrophilic CD45 tryptic peptides from HPLC fraction 4 (Kang et al., 1997)
was subjected to MALDI-MS analysis exactly as previously described (Kang et al.,
1997). Although these hydrophilic peptides typically presented weak signals (not
necessarily reflective of abundance), the MALDI-MS analysis revealed a tryptic peptide
at (M+H)+ of 2542 which correlated with the CD45 tryptic peptide from the acidic insert
with three phosphate residues (predicted (M+H)+ of 2545; expected error of about 0.1%).
Taken together, these results strongly support the notion that the CD45 CK2 sites are

multiply phosphorylated in vivo.

70

A Jurkat J45 .01
PP2A - + - +

 

CD45—v

 

 

 

ES EPES DES SD DDSD SEET SK
(w ith 3 phosphates)

 

 

 

 

 

500 1000 1500 2000 2500 3000
(M+H)*

Fig. 9. CD45 is phosphorylated in vivo. (A) Phosphorimage analysis of SDS-
PAGE separated CD45 immunoprecipitated from Jurkat cells that was subjected to
in vitro kinase phosphorylation with CK2 and [32P-y]ATP. CD45
immunoprecipitate was mock treated (lane 1) or treated with PP2A before an in
vitro kinase reaction. Identical analysis of the CD45' cell line, J45.01 was used as a
control (lanes 3 and 4). (B) MALDI-mass spectroscopic analysis of peptides
obtained from a tryptic digest of gel purified CD45 afier HPLC fractionation. The
peak at (M+H)+ 2542 (noted by an arrow) correlates with the calculated mass of the
peptide shown which contains the CD45 D2 acidic insert with three phosphates.

71

DISCUSSION

In this report, we have positively identified the D2 acidic insert as containing the
sites for CK2 phosphorylation and have shown that phosphorylation at those sites leads to
a large increase in the Vmax of CD45. This increase in Vmam could lead to a major
alteration of the signaling capacity of CD45 in the initiation of antigen stimulation in
lymphocytes. Phosphorylation of CD45 at acidic domain CK2 sites increased the PTP
activity of CD45 about threefold using 32P-MBP as substrate. This activation was not
apparent with other substrates suggesting substrate selectivity for phosphorylated CD45.
A kinetic analysis of 6His-cthD45 found its Vmax and Km to be in general agreement
with previously determined values (Tonks et al., 1990; Ng et al., 1995a). By use of
analytical FPLC separation, we verified that all of the 6His-cthD45 was phosphorylated
after CK2 treatment as indicated by increased retention on an anion exchange column
(Fig. 8B). The fact that two FPLC peaks were observed after CK2 phosphorylation
indicated the presence of multiple phosphorylated forms. Importantly, although there are
other potential CK2 sites in CD45, the Ser to Ala mutation of the D2 acidic insert
blocked phosphorylation by CK2, as well as increased activity after such treatment. The
acidic insert contains four CK2 phosphorylation sites which are conserved in all species
examined and mutation of these four serine sites (965, 968, 969 and 973) abolished
greater than 95% of the ability of CK2 to phosphorylate CD45.

The increase in CD45 activity afier phosphorylation is consistent with a previous
report in which decreased PTP activity of CD45 was accompanied by a decrease in serine
phosphorylation (Ostergaard and Trowbridge, 1991). In other studies, PTP activity of

CD45 was not modulated by CK2 phosphorylation, possibly because the CD45 utilized in

72

these studies was already highly phosphorylated and therefore could not be further
activated (Tonks et al., 1990; Stover and Walsh, 1994). The modulation of serine
phosphorylation of CD45 has been demonstrated under various stimuli (Ostergaard and
Trowbridge, 1991; Autero and Gahmberg, 1987; Valentine et al., 1991). Some studies
have failed to detect a relationship between phosphorylation and PTP activity (Autero
and Gahmberg, 1987; Valentine et al., 1991), while others have shown modulation of
CD45 activity upon phosphorylation (Ostergaard and Trowbridge, 1991; Stover and
Walsh, 1994; Autero et al., 1994). The discrepancy between these studies may have
stemmed from the difficulty of isolating and assaying CD45 immediately after
stimulation, and from the lack of precise knowledge of in vivo phosphorylation states.
CK2 is a ubiquitous serine/threonine kinase which is expressed in virtually all cell
types (Litchfield et al., 1996; Litchfield and Luscher, 1993). CK2 has been reported to be
highly expressed in some transformed and proliferating cells and, when over-expressed in
transgenic mice, the CK2 gene acts as an oncogene in cooperation with myc (Seldin and
Leder, 1995; Seldin and Leder, 1994). CK2 exists as a tetramer composed of two
catalytic alpha chains (aa, aa' or a'a') and two regulatory beta chains (Litchfield et al.,
1996). The beta chain is almost identical among various mammalian species and the
CK20t and CK20t' chains are highly homologous to each other, as well as highly
conserved (Litchfield et al., 1996). CK2 is found in both the nucleus and the cytoplasm,
and it phosphorylates a nmnber of signaling proteins in both compartments (e.g., Jun,
Myc, Myb, Rb and p53) (Litchfield and Luscher, 1993) at consensus phosphorylation
sites comprised of Ser/Thr-X-X-Glu/Asp or Ser/Thr-X-X-acidic group (Pearson and

Kemp, 1991). Although there has been much work performed on the nature and activity

73

of CK2, a definitive role in signal transduction is still somewhat obscure (Litchfield et al.,
1996).

In this report, we showed that analysis of CK2 may be performed with an in-gel
kinase method using CD45 as a substrate. CD45 was an excellent substrate for CK2 and
became highly phosphorylated with only 50 pg of substrate per ml of gel, while most
other in—gel kinase methods have used from 500 pg/ml to 1 mg/ml of substrate
(Camposgonzalez and Glenney, 1992). The kinase that phosphorylates CD45 was
identified as CK2 by a combination of immunoprecipitation, immunodepletion, specific
inhibition and mutation of CK2 consensus sites. Our data demonstrated that while both
the 01 and 01' chains of CK2 phosphorylate CD45, CK201' is the most active form on
CD45. In addition, the relative ability of anti-CK201' to deplete CK2 from CTLL-2
lysates suggested that CK201' was the predominant form of CK2 that phosphorylated
CD45 in these cells. In the in-gel kinase assay, the CKZB chain was separated from the
CK2 catalytic subunit and thus was not necessary for CD45 phosphorylation.
Immunoprecipitated CK2 in its native state (containing both 01, 01' and B chains) also
efficiently phosphorylated 6His-cthD45 (data not shown). Our results have extended
previous reports that predicted that CD45 would be a substrate of CK2 and that CK2 was
able to phosphorylate CD45 in vitro (Tonks et al., 1990; Stover and Walsh, 1994; Stover
and Walsh, 1993).

The insert which contains the CK2 phosphorylation sites is a conserved, highly
acidic sequence of 19 amino acids which exists only in the D2 domain of CD45 and not
in other PTPs. Alignment of the D2 sequence of CD45 to the X-ray crystal structure of

other PTPs showed that the D2 acidic insert lies just N-terminal to the highly conserved

74

YINAS sequence that forms the Bl-helix (Fauman and Saper, 1996). This would place
the acidic insert of 19 amino acids in a loop near the opening of the inactive D2 catalytic
cleft. Phosphorylation of this insert could interfere with interdomain duplex formation
postulated to involve the binding of the N-tenninal wedge of one PTP domain to the
catalytic cleft of a second PTP domain (Bilwes et al., 1996; Majeti et al., 1998; Felberg
and Johnson, 1998). This could make the catalytic site of the D1 domain more accessible
to substrate and thus increase activity. It is also possible that the phosphorylation state
could directly influence catalytic activity by affecting interactions between the D1 and
D2 domains. The observation that CK2 phosphorylation increased the activity of CD45
is consistent with either hypothesis.

Future work will focus on functional analysis of the 19 amino acid acidic insert in
vivo. It will be of great interest to find out whether or not this unique insert serves as a
docking site for substrates or signaling molecules. Yet another question to be addressed
is why CD45 is endogenously phosphorylated to a high level in this already very acidic
region. Further investigation will be directed at the physiological relevance of the insert
and the phosphorylation sites. It is expected that phosphorylation and/or
dephosphorylation of the acidic insert might play a role in the activation and/or

desensitization of the T cell receptor complex.

75

ACKNOWLEDGMENTS

We wish to thank Dr. David Litchfield (University of Western Ontario, London,
Ontario) for providing the anti-CK2 antisera and Dr. Pauline Johnson (University of
British Columbia, British Columbia) for providing the expression construct containing
6His cytoplasmic domain of CD45. We thank Drs. S. Kang, P. Liao and D. Gage
(Michigan State University) for performing the mass spectral analysis, and Dr. Richard
Shwartz (Michigan State University) for many helpful discussions during the preparation
of this manuscript. We especially thank Wei Guo and Dr. Honggao Yan (Michigan State
University) for their assistance in the execution and interpretation of our kinetics

experiments.

FOOTNOTE
The work in this chapter has been published as noted below. Ying Wang was the major
contributor to every aspect of this work.
Wang, Y., Guo, W., Liang, L., and Esselman, W. J. (1999). Phosphorylation of CD45 by
casein kinase 2: Modulation of activity and mutational analysis. Journal of

Biological Chemistry, Volume 274, pages 7454-7461.

76

REFERENCES

Allende, J.E. and Allende, CC. (1995). Protein kinases. 4. Protein-kinase CK2 - an
enzyme with multiple substrates and a puzzling regulation. FASEB Journal 9,
313-323.

Autero, M. and Gahmberg, CG. (1987). Phorbol diesters increase the phosphorylation of
the leukocyte common antigen CD45 in human T cells. Eur.J.Immunol. I7, 1503-
1506.

Autero, M., Saharinen, J., Pessa-Morikawa, T., Soula-Rothhut, M., Oetken, C.,
Gassmann, M., Bergman, M., Alitalo, K., Burn, P., Gahmberg, CG, and
Mustelin, T. (1994). Tyrosine phosphorylation of CD45 phosphotyrosine
phosphatase by p50csk kinase creates a binding site for p56lck tyrosine kinase
and activates the phosphatase. Mol.Cell.Biol. 14, 1308-1321.

Bilwes, A.M., den-Hertog, J., Hunter, T., and Noel, J.P. (1996). Structural basis for
inhibition of receptor protein-tyrosine phosphatase-alpha by dimerization.
Nature. 382, 555-559.

Bretz, J.D., Chen, S.C., Redenius, D., Chang, H.L., Esselman, W.J., and Schwartz, RC.
(1992). Lineage switch macrophages can present antigen. Dev.Immunol. 2, 249-
261.

Byth, K.F., Conroy, L.A., Howlett, S., Smith, A.J., May, J., Alexander, DR, and
Holmes, N. (1996). CD45-null transgenic mice reveal a positive regulatory role
for CD45 in early thymocyte development, in the selection of CD4+CD8+
thymocytes, and B cell maturation. J .Exp.Med. 183, 1707-1718.

Camposgonzalez, R. and Glenney, IR. (1992). Tyrosine Phosphorylation Of Mitogen-
Activated Protein-Kinase In Cells With Tyrosine Kinase-Negative Epidermal
Growth-Factor Receptors. Journal Of Biological Chemistry 26 7, 14535-14538.

Chang, H.L., Lefrancois, L., Zaroukian, M.H., and Esselman, W.J. (1991).
Developmental expression of CD45 alternate exons in murine T cells. Evidence of
additional alternate exon use. J .Immunol. 1 4 7, 1687-1693.

D'Oro, U., Sakaguchi, K., Appella, E., and Ashwell, JD. (1996). Mutational analysis of
lck in CD45-negative T cells: Dominant role of tyrosine 394 phosphorylation in
kinase activity. Molecular And Cellular Biology 16, 4996-5003.

Desai, D.M., Sap, J., Schlessinger, J., and Weiss, A. (1993). Ligand-mediated negative
regulation of a chimeric transmembrane receptor tyrosine phosphatase. Cell 73,
541-554.

Desai, D.M., Sap, J., Silvennoinen, 0., Schlessinger, J., and Weiss, A. (1994). The
catalytic activity of the CD45 membrane-proximal phosphatase domain is
required for TCR signaling and regulation. EMBO Journal 13, 4002-4010.

77

Fauman, EB. and Saper, M.A. (1996). Structure and function of the protein tyrosine
phosphatases. Trends in Biochemical Sciences 21, 413-417.

Felberg, J. and Johnson, P. (1998). Characterization of recombinant CD45 cytoplasmic
domain proteins: evidence for intramolecular and intermolecular interactions.
J.Biol.Chem. 273, 17839-17845.

Gietz, R.D., Graham, K.C., and Litchfield, D.W. (1995). Interactions between the
subunits of casein kinase-II. Journal of Biological Chemistry 270, 13017-13021.

Gonzatti-Haces, M1. and Traugh, J .A. (1982). Kinetics of phosphorylation of eIF-2 by
the hemin controlled repressor and casein kinase 11. Journal Of Biological
Chemistry 257, 6642-6645.

Hovis, R.R., Donovan, J.A., Musci, M.A., Motto, D.G., Goldman, F.D., Ross, SE, and
Koretzky, G.A. (1993). Rescue of signaling by a chimeric protein containing the
cytoplasmic domain of CD45. Science. 260, 544-546. ‘

Hurley, T.R., Hyman, R., and Sefion, BM. (1993). Differential effects of expression of
the CD45 tyrosine protein phosphatase on the tyrosine phosphorylation of the lck,
fyn, and c-src tyrosine protein kinases. Mol.Cell.Biol. 13, 1651-1656.

Kameshita, I. and Fujisawa, H. (1989). A sensitive method for detection of calmodulin-
dependent protein kinase II activity in sodium dodecyl sulfate-polyacrylamide gel.
Anal.Biochem. 183, 139-143.

Kang, S.M., Liao, P.C., Gage, DA, and Esselman, W.J. (1997). Identification of in vivo
phosphorylation sites of CD45 protein-tyrosine phosphatase in 70Z/3.12 cells.
Journal Of Biological Chemistry 272, 11588-11596.

Kishihara, K., Penninger, J., Wallace, V.A., Kundig, T.M., Kawai, K., Wakeham, A.,
Timms, E., Pfeffer, K., Ohashi, P.S., Thomas, M.L., Furlonger, C., Paige, 01.,
and Mak, T.W. (1993). Normal B lymphocyte development by impaired t cell
maturation in CD45-exon6 protein tyrosine phosphatase-deficient mice. Cell 74,
143-156.

Koretzky, G.A. (1993). Role of the CD45 tyrosine phosphatase in signal transduction in
the immune system. Faseb.J. 7, 420-426.

Koretzky, G.A., Picus, J., Thomas, M.L., and Weiss, A. (1990). Tyrosine phosphatase
CD45 is essential for coupling T-cell antigen receptor to the phosphatidyl inositol
pathway. Nature. 346, 66-68.

Liao, P.C., Leykam, J., Andrews, P.C., Gage, DA, and Allison, J. (1994). An approach
to locate phosphorylation sites in a phosphoprotein: Mass mapping by combining
specific enzymatic degradation with matrix-assisted laser desorption/ionization
mass spectrometry. Anal.Biochem. 219, 9-20.

78

Litchfield, D.W. and Luscher, B. (1993). Casein kinase-II in signal-transduction and cell-
cycle regulation. Molecular And Cellular Biochemistry 128, 187-199.

Litchfield, D.W., Slominski, E., Lewenza, S., Narvey, M., Bose, D.G., and Gietz, RD.
(1996). Analysis of interactions between the subunits of protein kinase CK2.
Biochemistry And Cell Biology-Biochirnie Et Biologic Cellulaire 74, 541-547.

Majeti, R., Bilwes, A.M., Noel, J.P., Hunter, T., and Weiss, A. (1998). Dimerization-
induced inhibition of receptor protein tyrosine phosphatase function through an
inhibitory wedge. Science 279, 88-91.

Melkerson-Watson, L.J., Waldmann, M.E., Gunter, A.D., Zaroukian, M.H., and
Esselman, W.J. (1994). Elevation of lymphocyte CD45 protein tyrosine
phosphatase activity during mitosis. J .Immunol. 153, 2004-2013.

Mustelin, T., Pessa-Morikawa, T., Autero, M., Gassmann, M., Andersson, L.C.,
Gahmberg, CG, and Burn, P. (1992). Regulation of the p59fyn protein tyrosine
kinase by the CD45 phosphotyrosine phosphatase. Eur.J.Immunol. 22, 1173-
1178.

Neel, B.G. (1997). Role of phosphatases in lymphocyte activation. Current Opinion In
Immunology 9, 405-420.

Ng, D.H., Harder, K.W., Clark-Lewis, 1., Jirik, F., and Johnson, P. (1995a). Non-
radioactive method to measure CD45 protein tyrosine phosphatase activity
isolated directly from cells. J .Immunol.Methods. 1 79, 177-185.

Ng, D.H., Maiti, A., and Johnson, P. (1995b). Point mutation in the second phosphatase
domain of CD45 abrogates tyrosine phosphatase activity.
Biochem.Biophys.Res.Commun. 206, 302-309.

Ostergaard, H.L., Shackelford, D.A., Hurley, T.R., Johnson, P., Hyman; R., Sefton, B.M.,
and Trowbridge, LS. (1989). Expression of CD45 alters phosphorylation of the

lck-encoded tyrosine protein kinase in murine lymphoma T-cell lines.
Proc.Natl.Acad.Sci.U.S.A. 86, 8959-8963.

Ostergaard, H.L. and Trowbridge, LS. (1991). Negative regulation of CD45 protein
tyrosine phosphatase activity by ionomycin in T cells. Science. 253, 1423-1425.

Pearson, RB. and Kemp, BE. (1991). Protein-kinase phosphorylation site sequences and
consensus specificity motifs - tabulations. Methods In Enzymology 200, 62-81.

Pingel, J.T. and Thomas, ML. (1989). Evidence that the leukocyte-common antigen is
required for antigen-induced T lymphocyte proliferation. Cell 58, 1055-1065.

Seldin, DC. and Leder, P. (1994). Casein kinase-II-alpha is a novel lymphoid oncogene
in a mouse model of tropical theileriosis. Blood 84, A3 76-A376

79

Seldin, DC. and Leder, P. (1995). Casein kinase ii-alpha transgene-induced murine
lymphoma - relation to theileriosis in cattle. Science 26 7, 894-897.

Sieh, M., Bolen, J .B., and Weiss, A. (1993). CD45 specifically modulates binding of Lck
to a phosphopeptide encompassing the negative regulatory tyrosine of Lck.
EMBO Journal 12, 315-321.

Stover, DR. and Walsh, K.A. (1993). A novel method of identifying phosphorylation
sites using a thiophosphorylated peptide ESI-MS. In Techniques in protein
chemistry. R.H. Angeletti, ed. (San Diego: Academic Press), pp. 193-204.

Stover, DR. and Walsh, K.A. (1994). Protein-tyrosine phosphatase activity of CD45 is
activated by sequential phosphorylation by two kinases. Mol.Cell.Biol. 14, 5523-
5532.

Tawfic, 8., Olson, M.0.J., and Ahmed, K. (1995). Role of protein-phosphorylation in
posttranslational regulation of protein B23 during programmed cell-death in the
prostate-gland. Journal Of Biological Chemistry 270, 21009-21015.

Tonks, N.K., Diltz, CD, and Fischer, EH. (1990). CD45, an integral membrane protein
tyrosine phosphatase. Characterization of enzyme activity. J.Biol.Chem. 265,
10674-10680.

Trowbridge, LS. and Thomas, ML. (1994). CD45: an emerging role as a protein tyrosine
phosphatase required for lymphocyte activation and development.
Annu.Rev.Immunol. 12, 85-116.

Tuazon, RT. and Traugh, J.A. (1991). Casein kinase I and II - Multipotential serine
protein kinases: structure, function and regulation.
Adv.Second.Messenger.Phosphoprotein.Res. 23, 123-163.

Ulyanova, T., Blasioli, J., and Thomas, ML. (1997). Regulation of cell signaling by the
protein tyrosine phosphatases, CD45 and SHP-l. Immunologic Research 16, 101-
113.

Valentine, M.A., Widmer, M.B., Ledbetter, J.A., Pinault, P., Voice, R., Clark, B.A.,
Gallis, B., and Brautigan, D.L. (1991). Interleukin 2 stimulates serine
phosphorylation of CD45 in CTLL-2.4 cells. Eur.J.Immunol. 21,913-919.

Volarevic, S., Niklinska, B.B., Burns, C.M., June, C.H., Weissman, A.M., and Ashwell,

JD. (1993). Regulation of TCR signaling by CD45 lacking transmembrane and
extracellular domains. Science. 260, 541-544.

80

CHAPTER 3

Regulation of the T Cell Calcium / NF-AT Pathway

by the D2 Domain of CD45

81

ABSTRACT

CD45 tyrosine phosphatase activity is essential for the earliest activation events
accompanying ligation of the TCR. The necessity of PTP activity of the first phosphatase
domain (D1) is well established in TCR activation, but the role of the second,
catalytically inactive, phosphatase domain (D2) of CD45 remains unknown. This study

was designed to evaluate the potential role of a 19 amino acid, highly acidic insert in the

D2 which is unique to CD45. Transfection of the CD45‘ Jurkat-derived T cell line,
J45.01, with wild type or mutant CD45 cDNA incorporating mutations in the 19 amino
acid acidic insert of the D2 domain revealed a potential role of the acidic insert in the
regulation of T cell activation. While mutations in the D2 acidic region did not affect the
magnitude of TCR-mediated NF-AT activation, the basal level of NF-AT activity in
unstimulated cells was elevated. Cells expressing CD45 with Ser to Ala mutations (S/A)
at four sites in the D2 acidic domain exhibited a 9-fold higher basal level of NF-AT
activity. Cells expressing Ser to Glu mutations (S/E) at the same sites and the deletion of
19 amino acids of the acidic region (A19) exhibited intermediate basal NF -AT elevations
of S-fold and 3-fold respectively. The elevated NF-AT basal level was not observed in
CD45+ Jurkat T cells (clone E6-1) after transfection with CD45 S/A indicating that the
wild type CD45 overcame the effect of the mutant CD45. Increased basal NF-AT was
sensitive to EGTA treatment and cyclosporin A treatment, indicating that the activation
of NF-AT by mutant CD45 was dependent on extracellular Ca2+ stores and was mediated

through calcineurin.

82

Isolation of stable clones derived from transfection of the CD45 S/A mutant into

HPB45.1 (CD453 HPB-ALL) cells showed sustained calcium flux after TCR
engagement. The sustained calcium flux returned to baseline levels seconds after the
addition of EGTA, suggesting that the expression of the CD45 S/A mutant may have
prevented the deactivation of the plasma membrane calcium channels (e.g., the calcium-
release-activated calcium channel). The stable transfectants containing the CD45 S/A
mutant exhibited virtually no difference in the activation of Lck, ZAP-70 or MAPK. The
difference in Ca2+ flux was not due to CD45 stability since pulse chase analysis of
metabolically labeled transfectant cells revealed no difference in the CD45 turnover rate
between the wild type and the S/A mutant. However, in vitro translated CD45 S/A
mutant showed dramatically increased resistance to calcium-mediated degradation by
calpain or by hypotonic lysates, suggesting that mutations of the acidic insert altered the
conformation of the protein. Consideration of both the transient and stable transfection
data suggests that, in addition to being essential for initial events in T cell triggering, the

CD45 D2 domain acidic insert regulates the TCR-mediated calcium signaling pathway.

83

INTRODUCTION

CD45 is a transmembrane protein tyrosine phosphatase (PTP) required for the
initiation of antigen receptor-mediated signal transduction in T and B lymphocytes.
CD45 contains two tandem PTP domains designated D1 and D2. The membrane
proximal domain (D1) possesses all of the FTP activity, while the second domain (D2) is
catalytically inactive. The sequences of the D1 and D2 are highly homologous to the
large family of PTPs containing the CX5R motif (Fauman and Saper, 1996) and both
CD45 domains are highly conserved from shark to human (Okumura et al., 1996). The
D2 lacks PTP activity because of substitutions in three key amino acids in the active site
of the enzyme, which are also highly conserved in phylogeny(0kumura et al., 1996). The
CD45 D2 domain also contains a highly conserved, 19 amino acid insert in the PTP
sequence that is only found in the D2 of CD45 and not in any other PTP. This insert is
highly acidic and is a target for CK2 phosphorylation in T cells(Wang et al., 1999). In
spite of the high conservation of the D2, its function in T cell activation remains
unknown. The study of the role of the CD45 D2 in T cell activation has been
complicated by the fact that mutations that disrupt the PTP activity of the D1 domain also
disrupt any signal transduction from the TCR. Further, the precise conformational
relationship between the D1 and the D2 domains has been demonstrated by experiments
showing the loss of D1 PTP activity after the deletion of all or even small portions of the

D2 PTP domain (Johnson et al., 1992).

84

T cell activation proceeds through at least three parallel and interacting pathways
(Mustelin et al., 1998). The process of T cell activation is initiated by ligation of the
TCR and CD4 (CD8) by a MHC peptide antigen complex displayed on the surface of an
antigen presenting cell. The first steps leading to activation involve a wave of tyrosine
phosphorylation of the CD3 component of the TCR by the tyrosine kinase Lck. Other
tyrosine kinases (such as ZAP-70) and adaptor molecules (such as LAT (Zhang et al.,
1998) and SLP-76 (Motto et al., 1996)) are rapidly recruited to the TCR and each
becomes further phosphorylated and activated (Weiss and Littrnan, 1994; Mustelin et al.,
1998). Subsequently, the MAPK pathway is activated via Grb2, SOS and Ras; and the
JNK pathway is activated via small GTPases such as Rae/CDC42 and requires
costimulation via CD28 (SU et al., 1994). The third major pathway proceeds through
activation of PLCy and PKC and the release of Ca2+ from the endoplasmic reticulum
stores. The resulting Ca2+ flux activates calcineurin and results in the translocation of
NF -AT to the nucleus. Finally, signals from various pathways are integrated by the IL-2
promoter/enhancer and lL-2 is produced.

The critical role of CD45 in the TCR signaling process is in the initial tyrosine
phosphorylation events involving the tyrosine kinase, Lck. CD45 dephosphorylates the
C-terminal, inhibitory site at position Tyr505 and thus keeps Lek in an active state (Weiss
and Littrnan, 1994). CD45 negative cells have lowered Lck activity in the membrane-
associated pool of the PTK (Biffen et al., 1994). This paradigm predicts that the loss of
CD45 results in the loss of all signaling activity because of the lack of sufficient Lck in
an activated state. Support for the notion that Lck is a primary substrate for CD45 has

been provided by the observation that F 1 hybrids between CD45 knockout mice and mice

85

expressing an activated form of Lck regain the ability to be stimulated by antigen (Seavitt
et al., 1999). Lymphocytes isolated from CD45 knockout mice cannot be stimulated
through the TCR results in a block to early development (Byth et al., 1996). In addition
to Lek, CD45 is likely to have other substrates such as TCRC‘, or ZAP-70 (Furukawa et
al., 1994; Mustelin et al., 1995). In T cells CD45 is the most abundant membrane protein
comprising about 10% of the T cell membrane protein and greater than 90% of the
membrane associated PTP activity (Thomas, 1994). Other potential substrates
downstream from Lck have been difficult to detect since the absence of CD45 abrogates
all downstream signals.

T cell responses to antigens also require a cosignal provided by CD28 receptor on
T cells and B7 ligand on antigen presenting cells (APCs). CD28-B7 interaction in
conjunction with TCR stimulation increases the duration of the response and augments
the production of lymphokines, whereas TCR stimulation in the absence of CD28 ligation
leads to anergy of T cells (RUDD, 1996). While the MAPK pathway is fully activated
by TCR ligation alone, activation of the JNK pathway requires simultaneous engagement
of TCR and CD28 (SU et al., 1994)

The unique nature and high phylogenetic conservation of the 19 amino acid acidic
region in the CD45 D2 domain led us to hypothesize that this insert serves as a regulatory
module in lymphocyte activation. We have addressed the question of the role of the
CD45 D2 in downstream signaling in T cells by performing mutational analysis of certain

highly conserved sites in the 19 amino acid, acidic insert in the D2. The effect of

mutation was determined by reconstitution of CD45' cells followed by functional

86

analysis of various signaling pathways. A potential role for the D2 acidic insert has been

identified in the regulation of the Ca2+ / NF-AT pathway of resting and activated T cells.

87

MATERIALS AND METHODS

Cells, Antibodies and Reagents. Jurkat cells (clone E6-l) (a human acute T cell
leukemia line) and CD45 deficient Jurkat cells (clone 145.01) were obtained from Dr.
Gary Koretzky (University of Iowa). HPB45.1, a CD45-deficient variant of HPBALL
(human peripheral blood acute lymphoblastic leukemia cell), was obtained from Dr.
Arthur Weiss (University of California at San Francisco). The cells were maintained in
RPMI 1640 medium supplemented with 10% heat-inactivated fetal bovine serum (FBS),
100 units/ml streptomycin/penicillin (Life Technologies Inc., Gaithersburg, MD) and 50
mM 2-mercaptoethanol (Sigma Chemical Co., St. Louis, MO). Cyclosporin A was
purchased from Alexis Biochemicals (San Diego, CA). HRP-conjugated goat anti-rabbit
and goat anti-mouse secondary antibodies were purchased from Bio-Rad Laboratories
Inc. (Melville, NY). Chemiluminescent western blotting detection reagents were
purchased form Amersham Co. (Arlington Heights, IL).

Monoclonal anti-CD3 clone 235 (IgM type) and anti-CD28 clone NE51 (IgG
type) antibodies were kindly provided by Dr. Shu Man Fu (University of Virginia). Anti-
Lck antibody was obtained from Dr. Bart Sefton (Salk Institute). Phospho-p44/42 MAP
kinase antibody was purchased from New England Biolabs; MAP kinase antibody was
purchased from Sigma. Anti-phosphotyrosine antibody (4G10) was purchased from
Upstate Biotechnology. CD45 antibody for western blotting was purchased from
Transduction Laboratories, and CD45 antibody for immunoprecipitation was purified

from 9.4 hybridoma (ATCC, Rockville, MD). Fluorescent CD45 antibody, PE anti-

88

human CD45, was purchased from PharMingen (San Diego, CA). Anti-ZAP 70 antibody
and anti-PLC antibody were purchased from Santa Cruz (Santa Cruz, CA).

DNA constructs and site-directed mutagenesis. The expression vector hLCA-
NEO 3, which contained the intact wild type CD45 gene under the control of SFFV
promoter, was kindly provided by Dr. Arthur Weiss. The construct expresses full-length
CD45 with the low molecular weight form (RO isoform) extracellular domain. NF-AT-
luciferase vector, containing the IL-2 minimal promoter and three copies of NF-AT-l
binding sites, was kindly provided by Dr. G. Crabtree (Stanford University). PRSV-Bgal
reporter vector was purchased from Clontech (Palo Alto, CA).

Simultaneous mutations of four serine residues in the acidic insert of the CD45
D2 domain were performed using Quickchange Site-Directed Mutagenesis Kit
(Stratagene, La Jolla, CA) as described by the manufacturer. Desired mutations
(underlined) were incorporated into a pair of oligonucleotide primers, each
complementary to opposite strands of the parental DNA template. The primers used for
Ser to Ala (815, 818, 819 and 823) mutagenesis were: S’GTGAGCATGATQCAGA-
TGAAQCCQCTGAT-GATGACQCTGATTCAGAGG 3’ and 5’CCTCTGAATCAQQ
GTCATCATCAGQGGQTTCATCTGQATCATGCTCAC3’. The mutagenesis of Ser to
Glu (965, 968, 969 and 973) was performed in two steps, each step substitutes two Ser
with Glu. The primers were: 5’ GTGAGCATGATGAQGATGAAGCCGLGG-
ATGATGACGCTG 3’ and 5’CAGCGTCATCATC_(_3_'_1_‘ CGGCTTCATCQI CATCAT-
CCTCAC 3’ for Ser to Glu (815, 819) replacement; 5’GATGAGGATGAAGA_G-
GAGGATGATGACGA_G_GATTCAGAGGAACC 3’ and 5’ GGTTCCTCTGAATCQ;

ICGTCATCATCCTCQCTTCATCCTCATCB’ for Ser to Glu (818 and 823)

89

replacement. Each pair of primers were extended by pfix DNA polymerase during a short
temperature cycling (95°C for 30 sec, 55°C for l min, 65°C for 13.5 min (2 min/kb of
plasmid length), 18 cycles) and the parental DNA template was then digested by Dpn I
endonuclease. Mutants were selected after the synthesized DNA was transformed into E.
Coli XLl-Blue and later verified by sequencing.

Deletion of the 19 amino acid acidic region (position 808 to 826) was performed
using GeneEditor in vitro Site-Directed Mutagenesis System (Promega, Madison, WI) as
described by the manufacturer. Briefly, double-stranded DNA template was denatured
and annealed with the phosphorylated mutagenic oligonucleotides and the modified drug
selection oligonucleotides. The mutagenic oligonucleotides with the desired deletion of
5 7 nucleotides was hybridized to the template DNA at a higher molar ratio compared to
the drug selection oligonucleotides. The mutant strand DNA was synthesized and ligated
in vitro and transformed into the repair minus strain of E. coli BMH 71-8 mutS.
Transformants in the presence of GeneEditor antibiotic selection mix contained enriched
mutant DNA and were used to purify plasmid DNA. The isolated DNA was transformed
into E. coli JM109 to segregate mutant and wild type plasmids. Transformants were
further analyzed by sequencing. The mutagenic oligonucleotide used for the acidic
region deletion was: 5’ GCCACTTAAACATGAGCTGGAAATGGAACCAAGCA-
AATACATAATGCATC3 ’.

Transient transfection and luciferase assay. Transient transfection of J urkat T
cells was performed using DMRIE-C reagent (Life Technologies) as described by the

manufacturer. Typically, 6 pl of DMRIE reagent was mixed with 3 pg of NF-AT-

luciferase reporter DNA, 4 pg of hLCA.neo CD45 DNA and 1 pg of PRSV-Bgal reporter

90

DNA for 45 min at room temperature to form lipid-DNA complexes. Each transfection
reaction contained 2x10° cells in 200 pl of serum-free medium, which was incubated
with the lipid-DNA complex for 5 hours at 37°C followed by addition of growth medium
containing 15% serum. Transfected cells were treated with anti-TCR antibodies two days
post-transfection and collected 8 hours after stimulation. B-galactosidase activity was
measured using a Turner ED 20c lurninometer afier incubating the lysate with the
chemiluminescent substrate Galacton-Star (Clontech) for 1 hour at room temperature, and
the luciferase activity of the cell lysate was measured by luciferase reporter gene assay
kit (Boeheringer Mannheim, Indianapolis, IN).

Stable transfection and clone selection. CD45-negative HPB cells (1x107) were

washed twice with cold PBS and resuspended in 500 p1 of RPMI 1640 meditun. Mutant

and wild type CD45 cDNA of 20 pg was linearized with Xho I digestion and mixed with
the cell suspension. Electroporation was performed using the BioRad Gene Pulser at 250
volts and 960 pF, followed by incubation in RPMI 1640 medium with 10% FCS. After
48 hours, transfected cells were placed into RPMI 1640 medium containing 2mg/ml
geneticin (Life Technologies), and seeded into 96 well plates by limited dilution. Drug-
resistant single colonies were screened by western blotting with CD45 specific antibody
(Transduction Laboratories). Positive clones were further confirmed by FACS analysis
using PE anti-hmnan CD45 (PharMingen). Clones that expressed comparable levels of
CD45 surface protein were chosen for further functional analysis.

FACS analysis. For CD45 staining, stable transfectant cells (1x10°) were
collected and washed twice with phosphate buffered saline (PBS) (137 mM NaCl, 3 mM

KCl, 8 mM Na2HP04, 1 mM KH2P04, pH 7.4) supplemented with 2% FBS and

91

resuspended in 50 pl of PBS/2% FBS. PE anti-human CD45 antibody (20 pl) was added
to the cell suspension and incubated at 4°C in the dark for 30-45 min. Labeled cells were
washed twice with PBS/2% FBS and resuspended in 50 pl of filtered PBS/ 2% FBS. For

fixation of the stained cells, 20pl of 1% formaldehyde was added and the samples were
stored at 4°C. Staining of HPB45.1 cells, which are CD45 negative, was used as a
negative control. Each sample was resuspended in 300 pl of PBS, 2% FBS prior to
FACS analysis. For CD3 staining, primary anti-CD3 mAb (clone 235) was diluted in
PBS/2% FBS (1: 500) and added to l x 10° cells. After incubation at 4°C in the dark for
30 min, the cells were washed twice with PBS/2% FBS and incubated with diluted
secondary antibody, FITC goat anti-mouse antibody (Sigma), for another 30 min at 4°C
in the dark. Samples were then washed, fixed and subjected to FACS analysis as
described above. Cells stained with secondary antibody alone were used as negative
controls. FACS was performed with a Becton Dickinson Vantage FACS (San Jose, CA)

at the Michigan State University Flow Cytometry Facility.

PTP assay. Stable transfectant cells (5 x 107) were washed twice with TBS (20
mM Tris, pH 8.0, 137 mM NaCl) and lysed for 30 min at 4°C in NP40 lysis buffer
containing 1% NP40 (Pierce Chemical Co., Rockford, IL), 20 mM Tris, pH 8.0, 137 mM
NaCl, 10% glycerol, 5 mM EDTA, 2 mM PMSF, 0.23 U/ml aprotinin, 0.5 pg/ml
leupeptin, 0.7 pg/ml pepstatin A and 10 pg/ml DNase 1. After removal of nuclei by
centrifugation, the lysate supernatant was incubated with anti-CD45 (clone 9.4, ATCC)
for 30 min followed by addition and incubation with GammaBind Plus Sepharose
(Pharmacia Biotech Inc., Piscataway, NJ) for another 30 min at 4°C. The

immunoprecipitates were washed once with TBS, once with LiCl, once with 20 mM Tris,

92

pH 8.0, once with 1x PTP buffer (25 mM HEPES, pH 7.3, 5 mM EDTA, 10 mM DTT),
and were resuspended in 40 pl of 1x PTP. The PTP assay (Promega Corp., Madison, WI)
was carried out at 30°C and each assay contained 5 pl of tyrosine phosphopeptide
substrate END(pY)INASL. After incubation for 30 min, the supernatant was added to
96-well plate and the reaction was stopped by a mixture of malachite green and
molybdate. The amount of released free phosphate was measured by the absorbance of
the dye-phosphate complex at 600 nm wavelength using a microtiter plate reader
(Molecular Devices) and the data were analyzed using SoftMaxPro (Version 2.1.0)
software. The Sepharose G bound CD45 was boiled in SDS sample buffer, loaded in
10% SDS polyacrylmide gel and transferred to nitrocellulose membrane after
electrophoresis. Western blotting was performed to confirm equal amount of CD45 in
the immunoprecipitates.

TCR stimulation and detection of MAPK activation. Cells were washed twice
with PBS, resuspended into RPMI 1640 medium at 1x10°/ml and incubated at 37°C for 5
minutes. Anti-CD3 mAb (clone 235, 1:500) and anti-CD28 (clone NE51, 1:1000)
antibody were added to the cell suspension and incubated for 5 minutes and 30 minutes,
respectively. Stimulated cells were washed with PBS once and lysed in 1% NP40 lysis
buffer containing PTP inhibitors (2 mM sodium orthovanadate and 4 mM sodium
molybdate) at 4°C for 30 minutes. The lysates were centrifuged at 12,000 rpm at 4°C to
remove nuclei. 40 pg of each lysate was boiled with SDS sample buffer and loaded onto
10% SDS polyacrylamide gels. Lysate proteins were transferred onto nitrocellulose
membrane following electrophoresis, and blotted with anti-phosphoMAPK antibody.

The same membrane was treated with membrane stripping buffer (2% SDS, 0.7% B-

93

mercaptoethanol, 62.5 mM Tris, pH 6.7) and specific proteins detected with anti-MAPK
and anti-CD45 antibodies.

In vitro kinase assay. Stable transfectant cells (5x10° cells) were stimulated with
antibodies and lysed. in 1% NP40 lysis buffer as described above. Each lysate was
incubated with anti-ZAP-70 or anti-Lek antibodies followed by the addition of protein A
agarose (Life Technologies). Immunoprecipitated ZAP-70 and Lck PTKs were washed
once with PBS, twice with 0.5 M LiCl (phosphorylation 7.4), once with 20 mM Tris (pH
7.4), once with 1 x kinase buffer (20 mM Tris, pH 7.4, 10 mM MnC12, 0.07% 2-
mercaptoethanol) and were resuspended in 50 pl of 1 x kinase buffer. The kinase assay
was performed by adding 10 pM of cold ATP and S pCi of [y-32P]ATP (3000 Ci/mmol,
NEN Life Science Products, Boston, MA) and incubated at 30°C for 20 min. The
reaction was stopped by adding 1 ml of washing buffer containing 20 mM Tris, pH 7.5,
150 mM NaCl and 20 mM EDTA. The pellet was boiled in SDS sample buffer and
subjected to electrophoresis on 10% SDS polyacrylamide gel followed by transferring
onto nitrocellulose membrane. Autophosphorylation of ZAP-70 and Lck PTKs was
detected by phosphorimage analysis (Molecular Dynamics Inc., Sunnyvale, CA), and the
same membrane was incubated with anti-ZAP-70 or anti-Lek antibody to assure the
presence of equal amount of proteins in each sample.

Calcium flux analysis. Cells (1x107) were washed with cell loading medium
(CLM; RPMI 1640, 2% F CS, 25 mM HEPES, pH7.4) and incubated with 1.5 pM indo-l
AM (Molecular Probes) at 37°C for 1 hour in the dark. The loaded cells were washed
twice with DMEM (Life Technologies) plus 2% FCS and resuspended in 10 ml CLM.

Aliquots of 1 ml loaded cells were analyzed relative to time by flow cytometry using a

94

Coulter Epics Elite Flow Cytometer (Coulter ). The ratio of fluorescence at 420 nM to
that at 510 nM was used to indicate changes in calcium flux. Some samples were treated
with 1 pM ionomycin or 8 mM EGTA, and stimulated with anti-CD3 and/or anti-CD28
antibodies (1 pg each/10° cells/ml). The flow cytometry data was analyzed using
WinMDI software written by Joe Trotter (Salk Institute Flow Cytometry Laboratory).
Pulse chase analysis of CD45. HPB45.1 cells (2 x 107) stably transfected with
wild type CD45 and S/A mutant CD45 were washed twice with cold PBS and
resuspended in methionine-free and cysteine-free RPMI 1640 medium containing 5%
dialyzed F BS (Life Technologies) and incubated for 1 hr at 37°C. The starved cells were
pulsed with 100 pCi of L-[35S]methionine/cysteine Express protein labeling mix (NEN
Life Science Products, Inc.) for 20 min at 37°C. The labeled cells were washed three
times with PBS, and resuspended in complete RPMI 1640 medium. After a cold chase
for 0 min, 30 min or 2 hr, cells were collected and lysed in 1% NP40 lysis buffer
containing protease inhibitors. The supernatant of the lysates were incubated with anti-
CD45 (clone 9.4, ATCC) and GammaBind Plus Sepharose to immunoprecipitate CD45.
After washing three times with 0.5M LiCl and once with PBS, the immunoprecipitates
were boiled in SDS sample buffer and subjected to electrophoresis on 10% SDS

polyacrylamide gels, followed by phosphorimage analysis.

Calcium-dependent degradation of in vitro translated CD45 proteins. Vector
pET3d-6HisCD45, which expresses the cytoplasmic domain of murine CD45 under the
control of T7 promoter, was kindly provided by Dr. Pauline Johnson of the University of
British Columbia. Mutations in the acidic insert (S/A, S/E, and A19) were incorporated

into the construct as described (Wang et al., 1999). In vitro translation of CD45 was

95

performed using Promega TNT T7 Quick Coupled Rabbit Reticulocyte
Transcription/Translation System as described by the manufacturer. Briefly, 1 pg wild
type or mutant CD45 plasmid DNA was added to the TNT T7 Quick Master Mix and
incubated in a 50 pl reaction volume containing 10 pCi of [35S]methionine (Amersham)
for 90 min at 30°C. 1 pl aliquot of 1:10 diluted translation product was subjected to
calpain (calcium activated neutral protease) degradation analysis. The translated proteins
were incubated with 0.05 unit of calpain (Sigma) at 30°C for 20 min in the presence of
100 mM Tris, pH7.5, 5 mM CaCl2, 0.5 mM DTT. The reaction was terminated by
addition of SDS sample buffer and boiled for 5 min. The protease treated proteins were
resolved on 10% SDS polyacrylamide gel followed by phosphorimage analysis. For
endogenous calcium-dependent degradation analysis, Jurkat Cells (5x10°) were washed
twice with cold PBS, lysed in 1x hypotonic extraction buffer (20 mM HEPES, pH7.5, 5
mM KCl, 1.5 mM MgCl2, 1 mM DTT) for 15 min on ice, with 10 strokes of a Dounce
homogenizer. The lysed cells were centrifuged at 12,000 rpm and the supernatant was
collected and supplemented to 5 mM CaCl2, In vitro translated proteins were incubated
with the lysate/5 mM CaCl2 at 30°C for 20 min, and the treated samples were collected as
described above.
RESULTS

Mutations in the CD45 D2 domain acidic insert. We have shown previously that
Ser phosphorylation of the D2 domain acidic insert by casein kinase 2 (CK2) augmented
the enzymatic activity of CD45 toward phosphorylated myelin basic protein (MBP).
Further, the alteration of Set residues in the insert to Glu residues mimicked the effect of

CK2 phosphorylation (Wang et al., 1999). 111 order to study the role of the acidic insert

96

and the D2 region in CD45-mediated lymphocyte signal transduction, mutations were
incorporated into expression vector hLCA.neo as shown in Fig. 1. These mutants are
designated: S/A, containing the simultaneous replacement of four Ser at position 815,
818, 819 and 823 to Ala; S/E, containing the simultaneous replacement of the four Ser to
Glu; and A19, deletion of position 808 to 826, the whole 19 amino acid insert. In some
situations, Ser to Glu may exhibit a charge effect similar to phosphorylation of Ser at the
same position, while the S/A mutation is expected to either block phosphorylation or
change conformation. The C°°7S mutant in the D1 domain alters the essential cysteine
residue and abolishes the PTP activity of CD45. Deletion of the entire D2 domain, AD2,
was also prepared but failed to express at the protein level, although mRN A was detected
by northern blot (data not shown).

Transient transfection with mutated CD45 increases basal NF -A T activity.
Mutant CD45 cDNA was transiently expressed into CD45-deficient Jurkat T cells
(J45.01), together with AP-l-luciferase or NF-AT-luciferase reporter constructs. PRSV-
Bgal reporter DNA was also co-transfected to normalize for transfection efficiency. Two
days post-transfection, cells were incubated with anti-CD3 and anti-CD28 antibodies for
8 hours, and luciferase activity was determined using a lurninometer. Consistent with the
very low expression of CD45 in J45.01 cells, they failed to activate AP-l or NF-AT-
luciferase after stimulation with anti-CD3/CD28 antibodies (Fig. 2A and 2B, vector),
confirming that efficient CD45 expression was required for TCR-mediated T cell
activation. Introduction of wild type CD45 into J45.01 cells restored the capacity of the
cells to activate AP-l and NF-AT-luciferase reporters upon TCR engagement (Fig. 2A

and 2B, wt), whereas introduction of the PTP inactive form of CD45 could not rescue

97

D1 D2
667 875 783 983 991 1120

are. *2 . -- .. n“ ‘. .'. n "\ f E .w rrun‘v, -‘t ”a." ‘b' ‘T v' ~, \
. . . . ._ i, 2 . . ’4
t ,’ . f \r, "1'
""‘JA'M'H ‘- . «- Dru—A — -',-. "1‘44 - ‘ s 4 2, vr“'; 't w‘. as” L. - “hr-f" .'-.~- r-vu

 

 

  

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 1. Schematic representation of mutant CD45 construct. (wt) Full
length construct showing, transmembrane region, the intact D1 and D2 domain.
The acidic insert (position 808-826 inclusive) is amplified to show the 19 amino
acids containing four Ser to be mutated (Ser 815, 818, 819 and 823; underlined).
(C6678) PTP inactive CD45 construct with Cys to Ser mutation in the D1 domain
catalytic center. (S/A) CD45 mutant containing simultaneous change of the
CK2 target Ser to Ala residues. (S/E) CD45 mutant containing simultaneous
change of the CK2 target Ser to Glu residues. (A19) CD45 mutant with the 19
amino acid acidic insert of D2 domain deleted (position 808-826 inclusive).
(AD2) CD45 construct with the whole D2 domain removed (containing the
spacer region between D1 and D2). The numbering system shown at the top
refers to the positions in the low molecular weight isoform (CD45 _R0) used in
these studies.

98

 

 

 

A. 1:] none fl anti-CD3/CD28
a,» 20
E A
g :33 16*
0 H
,8; g 12
:43 -o
:4 a 8:
a 42
O“

 

 

 

 

 

° 100 .4 .
3‘ [:1 none 1 antr-CD3/CD28
% 80 ’
8 A

Q.)
“Q § 60 3
:3 1° 40 ~
9 “3.
g 20-

0 -

 

 

 

 

 

vector wt C667S S/A S/E A19

Figure 2. APl-luciferase and NF-AT-luciferase reporter activity in CD45
transfected J45.01cells before and after stimulation with anti-CD3/CD28
antibodies. (A) APl-luciferase activity was determined in J45 .01 cells after
transient transfection with wt and mutant forms of CD45. (B) NF-AT-luciferase
activity in J45.01 cells was determined after transient transfection with wt and
mutant forms of CD45. Transfection with empty vector alone was performed as a

negative control. The average and standard deviation of three experiments is
shown.

99

signaling (Fig. 2A and ZB, C°°7S). In wild type CD45 transfectants, there was a small
increase of AP-l-luciferase activity after TCR crosslinking, whereas a 30-fold activation
of NF-AT-luciferase was observed.

When CD45 with S/A mutations in the D2 domain acidic region was transiently
expressed, AP-l and NF-AT luciferase were activated by the anti-CD3/CD28 stimulation
to the same extent as the wild type transfectant (Fig. 2A and 2B, S/A). However, an
elevated basal level of NF-AT activity was consistently observed in S/A transfectants.
An intermediate but reproducible basal elevation of NF-AT activity was also observed for
S/E and A19 transfectants without alteration in the overall magnitude of response to anti-
CD3/CD28 stimulation (Fig. 23, S/E and A19). Over several experiments the S/A mutant
exhibited an average 9-10 fold increase in basal activity, while intermediate values were
observed for the S/E mutant and for the A19 mutant (5 and 3-fold increase
respectively)(Fig. 3A). The success of transfection for each mutant was judged to be at
the same efficiency since all of the mutant constructs exhibited comparable overall
stimulation with anti-CD3/CD28, and comparable B-galactosidase activity was detected
in each transfectant (data not shown). Although the cells were clearly functionally
reconstituted, analysis using PE-anti-CD45 antibody staining of the transiently
transfected populations indicated an overall low level of CD45 expression - measured by
FACS to be 5 to 8% positive, compared to empty vector transfection (data not shown).

To further examine the elevated NF-AT activity, different amounts of S/A mutant
DNA were transfected into J45.01 cells, and the basal level luciferase activity was
compared to the wild type transfectants. As shown in Fig. 3B, the basal NF-AT activity

of S/A transfectant increased further when more mutant DNA was introduced into the

100

OJ
C

 

N
U"
1

e

N
O

NF-AT-luciferase activity ’
(fold Increase)
a

 

 

 

 

 

 

 

 

 

10-
51
0-
4969‘ A“
.>.~ 20
IE. B-
8,2151
80)
.232
_s1°‘
112
5:9; 5-
0__l:1.fl_.

CD45 DNA (pg) 1 4 15
wt

 

 

 

Figure 3. Mutations in the acidic insert of D2 domain lead to the elevation
of basal level NF-AT luciferase activity. (A) The basal level of NF-AT
activity was measured in J45.01 cells after transfection with different forms of
CD45. The average and standard deviation of three experiments is shown. (B)
The basal level of NF-AT activity was determined in J45.01 cells after
transfection with increasing amounts of CD45 wt and S/A DNA.

101

cells, suggesting that the S/A mutant protein regulated NF-AT activity in a dose-
dependent manner.

To determine whether the basal elevation of NF -AT induced by the CD45 S/A
mutant was dominant. over the wild type CD45, mutant DNA was transfected into Jurkat
cells (CD45) and NF-AT luciferase activity was measured 48 hours after transfection
(Fig. 4A). The basal NF-AT activity in Jurkat cells was not elevated by the transfection
of S/A mutant CD45 as compared to that observed upon transfection of J45.01 cells (Fig.
4B). This result indicates that the effect of S/A mutant was overcome by the presence of
an excess of wild type CD45 in Jurkat cells. The activation of NF-AT in Jurkat cells by
anti-CD3/CD28 was more intense compared to J45.01 cells, because of the high
endogenous CD45 expression in Jurkat cells.

NF-AT is directly activated by the serine/threonine phosphatase, calcineurin
(PP2B), which dephosphorylates cytoplasmic NF-AT and allows its translocation into the
nucleus. Cyclosporin A (CsA, 100ng/ml), an inhibitor of calcineurin, was incubated with
the transfectants and NF-AT activity was determined before and after TCR ligation. The
presence of CsA completely blocked the activation of NF-AT by TCR engagement, and it
also abolished the elevated basal NF-AT activity in S/A transfectants (Fig. 4C). Thus the
elevation of NF-AT in S/A transfected resting T cells depended on the function of the
Ca2+ pathway and calcineurin.

Cytoplasmic calcium flux after T cell activation is dependent on both intracellular
and extracellular stores (Crabtree, 1999). Since EGTA chelates the extracellular stores,
we then treated the CD45 S/A transfected cells with EGTA (8 mM) to determine if the

elevation of NF-AT depended on extracellular Ca2+ stores. EGTA completely abrogated

102

 

 

   
   

 

 

 

 

   

 

 

 

 

 

80 40

G? A. Jurkat B. J45.01
_ J
g 60 30
.S 40 - 20 -
'3
93-, 20 ~ 10 2
3:: vector wt S/A vector wt S/A
0
<6
G) 40 4o
:3 C- 145-01 +CSA D. J45.01+EGTA
4‘3. 30 a 30 -
'9
"7‘ 20 a 20 2
1?
% 10 ~ 10 ~
0 -m 0 -—--£——I=Ei——-fl—

 

 

vector wt S/A vector wt S/A
Treatment: [:1 none lanti-CD3/CD28

Figure 4. Effect of wild type CD45, cyclosporin A (CsA) and EGTA on the basal
level and activated NF-AT luciferase activity. (A) NF-AT-luciferase activity was
determined in untreated (light bar) and stimulated (shaded bar) Jurkat (CD45 positive)
cells after transient transfection with vector, CD45 wt or CD45 S/A DNA. (B) NF-AT-
luciferase activity was determined in untreated and stimulated J45.01 cells after
transient transfection with vector, CD45 wt or CD45 S/A DNA. (C) CD45 transfected
J45.01 cells were either untreated or stimulated with anti-CD3/CD28 in the presence of
100 ng/ml CsA, and the NF-AT-luciferase activity was measured 8 hr after CsA
treatment. (D) CD45 transfected J45.01 cells were either untreated or stimulated with
anti-CD3/CD28 in the presence of 8 mM EGTA, and the NF-AT-luciferase activity
was measured 8 hr after EGTA treatment. The average and standard deviation of three
experiments is shown.

103

the activation of NF-AT by TCR crosslinking, indicating that sustained calcium influx
was required for the activation of the transcription factor (F ig. 4D). At the same time, the
basal elevation of NF-AT activity in S/A transfectant decreased to the background levels,
suggesting that the effect of CD45 S/A expression was due to disregulated calcium
influx.

Stable transfectants expressing mutant CD45. The experiments described above
suggested that the alteration caused by mutation of CD45 were primarily in the Ca2+/NF-
AT pathway. However, this was difficult to study further in a Jurkat transient
transfection system because the overall expression of CD45 was quite low. We therefore
endeavored to develop a system in which stable cell lines expressing mutated CD45
could be evaluated for multiple TCR signaling pathways and for Ca2+ flux under various
experimental conditions.

CD45-negative HPB cells (HPB45.1) were transfected with mutant CD45
constructs by electroporation and single, stable transfectants were selected by limiting
dilution and G418-resistance. Selected clones were screened by immunoblotting with
anti-CD45, and CD45 expression was confirmed by flow cytometry of FITC-anti-CD45
labeled cells (Fig. 5A). For each CD45 mutant construct, three individual clones
expressing comparable levels of CD45 protein were chosen for functional analysis. The
data presented here are representative of different individual clones. CD45-expressing
HPB45.1 clones were also stained with anti-CD3 (235 mAb) and F ITC-goat anti-mouse
antibody and subjected to flow cytometric analysis. Each stable transfectant used was

shown to express essentially the same level of CD3 (Fig. 5B).

104

A. CD45 expression

Events

wt , S/A S/E A 19 HPB45.1

 

 

 

 

    

 

 

 

 

 

 

        

1234012340

 

   

l 2 3

anti-CD45 (log fluorescence) ———>

B. CD3 expression

Eve n6

wt S/A . S/E _ A19

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1234012340 401234
anti-CD3 (log fluorescence) ——_'

Figure 5. CD45 and CD3 expression after stable transfection of HPB45.1
cells. The expression of (A) CD45 and (B) CD3 was determined by FACS
analysis. The results shown are representative for selected clones used in the
study. For CD45, positive fluorescence was compared to that of HPB45.1 cells
(CD45 negative). CD3 positive fluorescence was compared to that obtained
with second antibody alone (right panel, light peak) and to HPB45. 1(right panel,
dark peak). The dashed line in each panel indicates the approximate
demarcation of positive and negative signals.

105

 

The overall PTP activity of stably transfected CD45 was compared in vitro. Wild
type and mutant CD45 was immunoprecipitated from individual transfectant clones (5 x
107 cells) and subjected to tyrosine phosphatase assay using tyrosine phosphopeptide
END(pY)INASL as substrate. The control immunoprecipitate obtained from HPB45.1
cells were used as a negative control. The acidic insert mutants (S/A, S/E, and A19
mutant) were shown to have comparable PTP activity as to wild type transfectants (Fig.
6), while the C°°7S mutant completely abrogated the PTP activity of CD45.

T CR stimulation of clones containing stably expressed CD45 mutanm. The
earliest signaling event upon TCR stimulation is the activation of TCR-associated PTKs.
The activated PTKs phosphorylate diverse downstream substrates, enzymes and adaptor
molecules, which eventually activate the MAP kinase pathway, the JNK pathway, and the
Ca2+ /calcineurin/NF-AT pathway, leading to the activation of transcription factors and
cytokine production. All these signaling events require the presence of CD45 PTP
activity. To determine the effect of CD45 mutation we first compared the
autophosphorylation and kinase activity of Lck and ZAP-70 after TCR stimulation (Fig.
7A and 7B). In the absence of CD45 (column HPB45.1), the kinase activity of Lck and
ZAP-70 was not enhanced by anti-CD3/CD28 crosslinking for 5 or 30 min. When wild
type CD45 was expressed, autophosphorylation of Lck and ZAP-70 was increased 4-5
fold after TCR ligation. All of the acidic insert mutations (S/A, S/E or A19) exhibited
similar activation patterns for both kinases, which peaked at 5 min after stimulation and
returned to basal level by 30 min. The overall increased tyrosine phosphorylation
patterns of the CD45 mutant clones after stimulation were not different from wild type

CD45 (data not shown).

106

 

1.00

3‘»- 0.75-—

:21;

8 a

g .: 050—

..,;

g a

U V 0.25..
0 _

 

 

 

wt S/A S/E A19 C/S

Figure 6. PTP activity of wild type and mutant CD45 in stable
transfectants. Wild type and mutant forms of CD45 were immunoprecipitated
from equivalent amount of CD45 transfected HPB45.01 clones and subjected to
in vitro PTP assays using tyrosine phosphopeptide END(pY)INASL as
substrate. The average PTP activity of multiple clones is shown (average and
standard deviation). Immunoprecipitate from I-IPB45.1 cells was used as a
negative control. PTP activity is expressed as nanomoles of free phosphate
released /10 min/CD45 immunoprecipitated from 5 x 107 cells.

107

HPB45.] wt S/A S/E A19
Anti-CD3/CD28

A activation(min) 0 5 30 O 5 30 0 5 30 0 5 30 0 5 30

 

 

 

 

 

 

Lckkinase aha-1n.- anuu 06685 may; and"

“kiln: 1::3 g; cit-14’9“?"

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

B. 7 52.;
ZAP-70 blot —> - - __

 

   

 

 

 

 

Figure 7. Kinase activity of Lck and ZAP-70 after TCR ligation in HPB45.1
cells expressing different mutated forms of CD45. (A) Lck and (B) ZAP-70
immunoprecipitates were collected from CD45 HPB45.1-transfected clones after
activation with anti-CD3/CD28. The immunoprecipitates were subjected to in vitro
kinase/autophosphorylation assay by the addition of y32P-ATP. The labeled proteins
were separated by SDS gel electrophoresis and detected by phosphorimage analysis.

The position of the labeled proteins is indicated by arrows and the position of
immunoglobulin H chain is indicated in the Lck blot.

108

We next examined the activation of p44/42 MAP kinase in the mutant
transfectants (Fig. 8A). TCR-mediated activation of MAP kinase was detected by a
phospho-MAP kinase-specific antibody that only recognizes catalytically activated Erkl

and Erk2. Minutes after TCR crosslinking, phospho-MAP kinase was detected in wild

type CD45 transfectants, while CD45' HPB45.] cells failed to induce the phosphorylated
form of MAP kinase (Fig. 8A). All three mutants of the D2 acidic region appeared to
activate p44/42 MAP kinase to approximately the same extent as wild type CD45 after
stimulation for 5 min, and phospho-MAP kinase also appeared to decrease after 30 min
of stimulation. We concluded therefore, that mutations in the D2 acidic region did not
affect the MAP kinase pathway.

The Ca2+/NF-AT pathway was then evaluated in mutant transfectants of HPB45.1
cells by Ca2+ flux analysis after TCR stimulation (anti-CD3/CD28). Stable transfectants
were loaded with cell permeable indo-l AM and cells were stimulated with anti-

CD3/CD28 antibodies. Cytoplasmic Ca2+ mobilization was determined by flow

cytometry (Fig. 9). HPB CD45— cells (I—IPB45.1) did not exhibit any detectable Ca2+ flux
upon stimulation (Fig. 9C). The intracellular calcium concentration of the wild type
CD45 transfectant increased about 1 minute after TCR crosslinking, peaked at about 5 to
6 min and then gradually decreased to the baseline after about 15 min (Fig. 9A). When
the CD45 S/A mutant transfectants were stimulated by anti-TCR, the calcium flux
observed was of the same magnitude as seen for cells expressing the wild type CD45
(Fig. 9B). However, the calcium flux in the S/A mutant appeared much more sustained
than that observed for the wild type transfectant and after longer incubation (up to two

hours) it was observed that the CD45 S/A mutant did not recover to the baseline (Fig.

109

HPB45.] wt SA SE A19

 

Anti-CD3/CD28

Activation(min) 0 5 30 0 S 30 0 5 30 0 5 30 0 5 30

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 
 

Immunoblot an... m, g, n u “a MS W w w w w w
A. Ph h »_ - f
-8212: I: I... a... s...
1w
B. K , f .
MAP 1 use as: sea

     

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

C. CD45 —>' “RI-F 1.0m 1"” “9.1

L I

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure 8. Activation and phosphorylation of MAPK after TCR ligation of
HPB45.1 cells expressing different forms of CD45. HPB45.1-transfected clones
were activated with anti-CD3/CD28 and subjected to lysis and separation by SDS
gel electrophoresis. (A) Phosphorylation of MAPK was detected by immunoblotting
with anti-phospho-MAPK antibody. Immunoblotting with (B) anti-MAPK and (C)
anti-CD45 were performed to verify expression levels.

110

A. CD45 wt B. CD45 S/A C. HPB45.]
+ 01TCR + 01TCR g + 01TCR

 

 

 

 

 

 

 

 

 

 

 

 

 

+ 01TCR

K

'_§ llllllllTlTllmllll
8 020040060080010000 200400 600 80010000 2004006008001000
{a

g D. CD45 S/E E. A19

T: +01TCR

O

8

C‘.

H

 

 

 

 

(ratio: Indo-l fluorescence, arbitrary units)

 

 

 

I l 1 T1 I l l l l l
0200 400 600 8001000 0200400600800le

time (seconds)

Figure 9. Calcium flux after TCR stimulation of HPB 45.1 (CD45') cells expressing
wild type or different mutant forms of CD45: (A) wt; (B) S/A; (C) empty vector; (D)
S/E; (E) A19. Cells (1 x 107) were loaded with 1. 5 pM indo-l AM, stimulated with anti-
CD3/CD28 antibodies (01TCR, arrow), and subjected to flow cytometry analysis. The
ratio of fluorescence at 420 nm to that of 510 nm was used to indicate changes in
calcium flux.

lll

10C plus additional clones shown in Fig. 101) and E). Ca2+ flux in cells expressing CD45
wt did return to the base line during this incubation (Fig. 10A and additional clone shown
in 10B). When EGTA was added to the medium containing the CD45 S/A clone, the
sustained calcium signal returned to base line immediately, indicating that the abnormally
sustained Ca2+ level required extracellular Ca2+. This result suggests that the CD45 S/A
mutant maintained the calcium level by affecting the calcium influx through a plasma
membrane calcium channel.

Interestingly, analysis of the CD45 S/E and A19 mutants showed that these clones
exhibited a partial return to the wild type pattern, i.e., a calcium flux which was only
somewhat sustained as compared to wild type CD45 (Fig. 9D and 9E). The intermediate
pattern was observed for several mutant clones that had CD45 expression levels
comparable to wild type CD45 expressing clones (data not shown).

Acidic region S/A mutant exhibited the same turnover rate as the wild type. The
sequence of the D2 domain acidic insert in CD45 contains a PEST motif, which might
serve as a target for protease degradation. To determine whether or not the effects we
observed of S/A mutant on calcium/NF-AT pathway were due to increased protein
stability in vivo, we performed pulse-chase analysis in cell lines stably expressing wild
type and S/A mutants. Transfectant cells were metabolically labeled with 35S-
methione/cystenine followed by a “chase” with "cold" Met/Cys. At various times of cold
chase CD45 was immunoprecipitated and subjected to SDS electrophoresis and auto-
radiography. The wild type and S/A mutant forms of CD45 appeared to have similar
turnover rates suggesting that the effect of CD45 S/A mutant on Ca2+ was probably not

due to the increased stability of CD45 in vivo (Fig. 11A).

112

C. CD45 S/A (clone 1)
+ 01TCR + [301' A

 

A. CD45 wt (clone 1)
+ 01TCR

 

 

I

I

\ P" D. CD45 S/A (clone 2)
f/ /+ 01TCR + EGTA

 

 

 

 

B. CD45 wt (clone 2) 9
1+ 01TCR + EGF A

 

 

1
II

E. CD45 S/A @one 3)

+EGT§

 

Intracellular calcrum
(ratio: Indo-l fluorescence, arbitrary units)

 

 

 

 
  

I I l l 1;?
0 200 400 600 800 1000after2hr
Time (seconds) hcubaion

 

 

 

 

l l I 1 17" j
0 200 400 600 800 1000 after hr
Time (seconds) 'ncubaion

Figure 10. Measurement of intracellular calcium levels after TCR stimulation of
HPB45.] (CD45') cells expressing wild type or S/A mutant CD45: (A,B) HPB45.]
cells expressing CD45 wt were stimulated with anti-CD3/CD28, and intracellular
calcium levels were measured for about 10-15 min and then 2 hr later (x-axis scale
break). (C-E) Independent clones of HPB45.1 cells expressing CD45 S/A were
stimulated and intracellular calcium levels were measured for 15 min and 2 hr later.

Addition of anti-CD3/CD28 antibodies (01TCR) and 8 mM EGTA are indicated by
arrows.

113

A CD45 form wt S/A
Timeofcold 0 30 120 0 30 120

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

cold (min)
CD45 3
B, CD45 form wt S/A
treatment a? ;.,$ :9" 43° «,3 is?
8’ \9 4° 2‘." \Q .9
e e? 9 '6 8’ °
9 s 9 c

Figure 11. Analysis of in viva and in vitro degradation of wild type and S/A
mutant CD45. (A) HPB45.] cells transfected with wild type and S/A mutant CD45
were labeled with 35S-Met/Cys and chased with cold Met/Cys for various times.
Radioactivity of CD45 immunoprecipitates were measured by phosphorimage
analysis. (B) Wild type and S/A mutant CD45 were translated and labeled with 358-
Met in a rabbit reticulocyte lysate and subjected to in vitro calcium-dependent
protease degradation. Two sources of proteases were used in the assay; calpain and
a hypotonic lysate of Jurkat cells. The products of 30 min protease treatment were
analyzed by SDS-PAGE electrophoresis and phosphorimage analysis.

114

S/A mutant CD45 was less susceptible to calcium-dependent degradation in
vitro. To test the possibility that S/A mutant might have conformational changes that
affect its sensitivity to calcium-dependent calpain-like proteases, wild type and S/A
mutant CD45 constructs were translated in vitro in the presence of 35S-Met and the
resulting protein products were subjected to calpain treatment (Fig. 11B, calpain). Wild
type CD45 translates were degraded to two minor bands of 80 and 90 kDa after
incubation with calpain for 30 min. Conversely, the CD45 S/A mutant was resistant to
calpain protease treatment. Protein degradation in the presence of cellular proteases was
assessed by examination of the stability of the in vitro translates after incubation with
Cari-supplemented, hypotonic lysates prepared from Jurkat cells (Fig. 113, hypotonic).
Interestingly, a similar resistance to Cay-dependent degradation was observed for the
CD45 S/A mutant. Since the intermediate proteolytic product of wild type CD45 was
about 10 kDa smaller than the full translated form, we concluded that the degradation did
not occur at the acidic region which would yield two products of about 35 and 45 kDa.
Rather, we concluded that the acidic region CD45 S/A mutation caused a conformational
change which reduced the sensitivity of CD45 to degradation at a site remote from the

acidic domain.

115

DISCUSSION

The cytoplasmic portion of most of the receptor-type PTPs consist of two
tandemly arranged PTP domains. The membrane-proximal domain (D1) exhibits
significant PTP activity, while the membrane-distal domain (D2) is usually enzymatically
inactive in spite of having high primary and secondary structural similarity to the FTP
family. Most previous studies have found that it is necessary for the D2 domain to be
largely intact for the expression of PTP activity of the D1 domain (Johnson et al., 1992).
Although this supports the notion that there is significant interaction between the D1 and
D2, the exact role of the D2 domain in CD45 function remains unknown (F elberg and
Johnson, 1998). It has been proposed that the D2 may have a distinct specificity for
unusual substrates; or that it may serve as a regulatory domain; or that it may serve as a
docking module for signaling proteins or adaptor molecules.

We have focused our study on the acidic domain in the D2 because: 1) among
PTPs, it is unique to CD45; 2) the insert is highly conserved among different species;
and 3) because the insert is a target of post-translational modification by casein kinase 2
(Wang et al., 1999). Based on the three dimensional crystal structure of the PTP family
of phosphatases, the loop containing the additional 19 amino acids found in the CD45 D2
would be expected to lie at the opening of the putative substrate binding cleft of the
inactive D2 enzyme(Fauman and Saper, 1996). This loop is believed to be exposed on
the outside of the molecule since it is available for CK2 phosphorylation and is
phosphorylated in viva (Wang et al., 1999). Phosphorylation of the acidic insert by CK2
has been proposed to modulate the PTP activity of CD45 for certain substrates (Wang et

al., 1999). In the present study, we have addressed the question of the function of the D2

116

domain of CD45 by mutation of four serines of the acidic insert that are the target of CK2

phosphorylation, followed by expression of CD45 mutated forms in CD45' cells and
assessment of downstream signaling pathways.

In summary, CD45 mutated in the acidic region appeared superficially to support
TCR mediated activation. The only mutant that did not support activation was the C°°7S
mutant that abrogated all CD45 activity. In the stable mutants, Lek, Zap-70, MAP kinase
and overall tyrosine phosphorylation were within the normal values obtained over
numerous experiments. For these signaling molecules, the expression of the mutated
CD45 did not seem to affect the magnitude or the duration of activation.

However, for the Ca2+ pathway, we concluded that the CD45 S/A mutant
significantly altered the inactivation of extracellular Ca2+ influx through membrane
channels (possibly the calcium-release-activated calcium channel, CRAC). Evidence for
CD45 regulation of the Ca2+ pathway is as follows. Cells expressing CD45 S/A exhibit a
sustained Ca2+ flux lasting for hours beyond the point when the wild type expressing cells
have returned to basal levels. The sustained Ca2+ level in CD45 S/A expressing cells
immediately returns to normal when EGTA is added to the medium. Since EGTA
chelates external Ca2+ and does not enter cells, we conclude that the flux was due to a
loss of ability to inactivate the Ca2+ channel and not to the release of internal stores of
Ca2+, which are usually depleted quickly after TCR activation. CD45 could interact
directly with the CRAC channel to prevent inactivation of the channel or there could be
other intermediates involved. Previous evidence supports the notion that inactivation of
Ca2+ channels is a regulated event. For example, the inactivation of L-type channels is

regulated by Ca2+/calmodulin and depends on specific short sequences in the channel

117

cytoplasmic tail (Zuhlke et al., 1999). Since very little is known about the physical
nature of the CRAC channel in lymphocytes, the interaction with CD45 described in this
report should provide new approaches to study this channel.

Corroboratiori of our results with the HPB45.1 stable clones described above was

provided by the observation of a similar deregulation of the Ca2+/NF-AT pathway in a

totally different cell line. In this system, we transiently transfected a CD45' Jurkat line,
J45.01, with the acidic insert mutants (S/A, S/E, and A19) and the effect on downstream
pathways was evaluated. The Ca2+/NF-AT pathway was deregulated in a way that led to
aberrantly high levels of active NF-AT in resting cells. We concluded that the high basal
levels of NF-AT were a result of disregulation of Ca2+ levels for two reasons. First, the
elevated basal level was completely abrogated by treatment with CsA, showing that
calmodulin/calcineurin pathway was involved in the generation of the high basal NF-AT
activation. Secondly, treatment of the cells with EGTA, which chelates external Ca”,
completely suppressed the high basal activity, suggesting that an influx of external Ca2+
is necessary to maintain the NF-AT levels.

NF-AT activity measurements in transfected HPB45.1 cells were not successful
due to the low expression of NF-AT in these cells [(Duncliffe et al., 1997) and R. Majeti,
personal communication]. Other reports have suggested that the HPB-ALL cell line
exhibits low activation of PLC and PKC, and low production of inositol phosphates upon
TCR stimulation (Shiroo et al., 1992; BRATTSAND et al., 1990). On the other hand,
Jurkat cells expressed NF-AT very efficiently, but it was difficult to measure Ca2+ flux in
these cells because of the low efficiency of transfection. In spite of the low rate of

transfection, Jurkat cells were clearly functionally reconstituted in our experiments and

118

 

responded well to TCR ligation with anti-CD3 and CD28. This robust response occurs in
spite of the fact that the overall levels of CD45 detected by FACS or immunoblot
analysis were only slightly higher than the low (but non-functional) expression of CD45
seen in J45.01 cells.‘ Conversely, HPB45.1 cells have no detectable CD45 expression
and, after transfection, the level of CD45 expression for most clones was only about one-
tenth the amount expressed in the wild type HPB-ALL cells. In spite of this modest
expression the transfectants were fully functionally reconstituted by CD45 and generally
exhibited response levels comparable to wild type cells.

One important feature of antigen receptor mediated T cell activation is an increase
of intracellular calcium concentration (reviewed in (Crabtree, 1999)). TCR engagement
results in the activation of phosphatidylinositol phospholipase Cyl (PI-PLC-yl), which
catalyzes the hydrolysis of phosphatidylinositol 4,5-bisphosphate into inositol 1,4,5-
tn'sphosphate (1P3) and diacylglycerol (DAG). 1P3 binds to 1P3 receptor on the end0plasm
reticulum and stimulates the release of calcium from intracellular stores. The rapid
calcium release further triggers the opening of plasma membrane calcium channel
(CRAC), causing an influx of extracellular calcium. It is the extracellular Ca2+ entering
through the CRAC channel that is largely responsible for the lengthy, sustained
cytoplasmic Ca2+ levels observed after TCR stimulation (Shiroo et al., 1992; Crabtree,
1999). Surprisingly, in CD3 stimulated HPB-ALL cells, the maximal Ca2+ influx was
observed in the absence of detectable inositol phosphate production (Shiroo et al., 1992).
It has also been proposed that the 1P3 receptor becomes associated with F yn PTK in
response to TCR crosslinking, and Fyn-mediated tyrosine phosphorylation may result in

activation of the IP3-gated calcium channel (Jayaraman et al., 1996). At the end of the

119

pathway cytoplasmic calcium binds to the calcium-dependent regulatory protein,
calmodulin, and the complex activates the phosphatase calcineurin, which activates NF -
AT by dephosphorylation (Crabtree, 1999).

The results described in this report are consistent with a number of recent
observations concerning the role of CD45 in the activation of T cells. For example,
Leitenberg and Bottomly (Leitenberg et al., 1995) examined the role of CD45 by
measuring Ca2+ flux during TCR activation and, based on anti-CD45 treatments,
concluded that CD45 plays a role in the regulation of influx of extracellular Ca2+.
Experiments performed by replacing the D2 domain of CD45 with the homologous D2 of
LAR PTP suggested that the CD45 D2 domain was required for the interaction between
CD45 and TCR; chain; for TCR-mediated ZAP-70 tyrosine phosphorylation; and, most
importantly, for Ca2+/NF-AT dependent IL-2 secretion (Basadonna et al., 1998). The
observation that the D2 domain of LAR (which does not contain the 19 amino acid insert
region) could not substitute the D2 domain of CD45 suggests that structural features of
CD45 D2 domain are essential for CD45 function and could directly modulate the
function of D1 domain.

Previous mutagenesis studies have revealed that the intact D2 domain is required
for the enzymatic activity of CD45 expressed in rabbit reticulocyte in vitro
transcription/translation system (Johnson et al., 1992). Our studies have also shown that
the intact D2 domain is essential for the CD45 expression in HPB45.1 cells used in the
current study (unpublished data). Most studies on the expression of the cytoplasmic
domain of CD45 have shown that the D2 domain is essential for the expression of D1

PTP activity and deletion of the D2 19 amino acid insert reduces activity of the D1

120

(Johnson et al., 1992). Only the very C-terminal tail seemed to be dispensable. More
recently, recombinant CD45 D1 domain alone was expressed in a bacterial system and
shown to have enzymatic activity, but the presence of D2 domain was found to increase
the thermo-stability of D1 domain (Felberg and Johnson, 1998). Taken together these
studies and the current study show that the D2 domain is important in the expression and
function of CD45.

Further work will determine the exact mechanism by which the CD45 S/A mutant
influences Ca2+ regulation. Ser to Ala mutation, which exhibited the strongest effect in
our studies, was expected to block phosphorylation but these substitutions could also
significantly change the conformation of the protein. The latter hypothesis is supported
by the observation that the Ser to Ala mutation in the acidic insert protects the CD45
from proteolytic degradation. Although this effect was not observed in viva, it suggests
the conformation of the protein may be important in the relationship of CD45 to the Ca2+
flux. It remains unknown why the Ser to Ala mutant exhibited the largest effect, while
the other mutations of the acidic domain exhibited intermediate effects.

Two distinct but complementary systems were used to elucidate the relationship
between CD45 and TCR mediated signaling in T cells. The results obtained with
transient transfection in Jurkat cells and stable transfection in HPB-ALL cells strongly
support the proposal that CD45 regulates external Ca2+ flux in T cells. Introduction of
mutant CD45 deregulates the Cay/NF-AT’ pathway resulting in heightened NF-AT levels
in Jurkat cells, and in heightened Ca2+ levels after TCR ligation in HPB cells. Since the
nature of the CRAC channel is virtually completely unknown it will be important to

direct future experiments toward elucidating the mechanism of interaction of CD45 with

121

Ca2+ regulation in the cell. It will be of interest to also determine the role of CD45 in

other events which are mediated through Ca2+, such TCR apoptosis.

122

ACKNOWLEDGMENTS

We would like to thank Dr. Arthur Weiss (University of California at San
Francisco) for providing the CD45-deficient HPB45.1 cell line and the expression vector
hLCA-NEO 3. We also wish to thank Dr. Gary Koretzky (University of Iowa) for
providing the Jurkat cell lines and Dr. G. Crabtree (Stanford University) for providing the
NF-AT-luciferase vector. We especiallythank Drs. Shu Man F u and Sun-Sang J. Sung
(University of Virginia) for providing monoclonal anti-CD3 clone 235 and anti-CD28
clone NE51 antibodies. We thank Dr. Bart Sefton (Salk Institute) for his generous gift of
anti-Lek antibody. We also thank Dr. Lewis King (Michigan State University) for

technical support and assistance with the F ACS analysis.

123

REFERENCES

Basadonna, G.P., Auersvald, L., Khuong, C.Q., Zheng, X.X., Kashio, N., Zekzer, D.,
Minozzo, M., Qian, H.Y., Visser, L., Diepstra, A., Lazarovits, A.I., Poppema, S.,
Strom, T.B., and Rothstein, D.M. (1998). Antibody-mediated targeting of CD45
isoforrns: A novel immunotherapeutic strategy. Proc.Natl.Acad.Sci.U.S.A. 95,
3821-3826.

Biffen, M., McMichael-Phillips, D., Larson, T., Venkitaraman, A., and Alexander, D.
(1994). The CD45 tyrosine phosphatase regulates specific pools of antigen

receptor-associated p59fyn and CD4-associated p56lck tyrosine in human T-cells.
EMBO Journal 13, 1920-1929.

Brattsand, G., Cantrell, D.A., Ward, 8., Ivars, P., and Gullberg, M. (1990). Signal
transduction through the T-cell receptor-CD3 complex - evidence for

heterogeneity in receptor coupling. Journal Of Immunology 144, 3651-3658.

Byth, K.F., Conroy, L.A., Howlett, S., Smith, A.J., May, J ., Alexander, DR, and
Holmes, N. (1996). CD45-null transgenic mice reveal a positive regulatory role
for CD45 in early thymocyte development, in the selection of CD4+CD8+
thymocytes, and B cell maturation. J .Exp.Med. 183, 1707-1718.

Crabtree, GR. (1999). Generic signals and specific outcomes: Signaling through Ca2+,
calcineurin, and NF ~AT. Cell 96, 611-614.

Duncliffe, K.N., Bert, A.G., Vadas, M.A., and Cockerill, P.N. (1997). A T cell-specific
enhancer in the interleukin-3 locus is activated cooperatively by Oct and NFAT
elements within a DNase I-hypersensitive site. Immunity 6, 175-185.

Fauman, EB. and Saper, M.A. (1996). Structure and function of the protein tyrosine
phosphatases. Trends in Biochemical Sciences 21 , 413-417.

F elberg, J. and Johnson, P. (1998). Characterization of Recombinant CD45 Cytoplasmic
Domain Proteins: Evidence for Intramolecular and Intermolecular Interactions.
J .Biol.Chem. 273, 17839-17845.

Furukawa, T., Itoh, M., Krueger, N.X., Streuli, M., and Saito, H. (1994). Specific
interaction of the CD45 protein-tyrosine phosphatase with tyrosine-
phosphorylated CD3 zeta chain. Proc.Natl.Acad.Sci.U.S.A. 91, 10928-10932.

Jayaraman, T., Ondrias, K., Ondriasova, E., and Marks, AR. (1996). Regulation of the

inositol 1,4,5-trisphosphate receptor by tyrosine phosphorylation. Science 272,
1492-1494.

124

Johnson, P., Ostergaard, H.L., Wasden, C., and Trowbridge, LS. (1992). Mutational
analysis of CD45. A leukocyte-specific protein tyrosine phosphatase.
J.Biol.Chem. 26 7, 8035-8041.

Leitenberg, D., Constant, 8., Lu, D.D., Smith, BR, and Bottomly, K. (1995). CD4 and
CD45 regulate qualitatively distinct patterns of calcium mobilization in individual
CD4+ T cells. Eur.J.Immunol. 25, 2445-2451.

Motto, D.G., Ross, S.E., Wu, J., HendricksTaylor, L.R., and Koretzky, G.A. (1996).
Implication of the GRBZ-associated phosphoprotein SLP-76 in T cell receptor-
mediated interleukin 2 production. Journal Of Experimental Medicine 183, 1937-
1943.

Mustelin, T., Brockdorff, J ., Gjorloff-Wingren A., Tailor, P., Han.S, Wang, X., and
Saxena, M. (1998). Lymphocyte activation: The coming of the protein tyrosine
phosphatases. Froniers in Bioscience 3, 1060-1096.

Mustelin, T., Williams, S., Tailor, P., Couture, C., Zenner, G., Burn, P., Ashwell, J .D.,
and Altman, A. (1995). Regulation of the p70zap tyrosine protein kinase in T cells
by the CD45 phosphotyrosine phosphatase. Eur.J.Immunol. 25, 942-946.

Okumura, M., Matthews, R.J., Robb, B., Litrnan, G.W., Bork, P., and Thomas, ML.
(1996). Comparison of CD45 extracellular domain sequences fiom divergent

vertebrate species suggests the conservation of three fibronectin type 111 domains.
Journal Of Immunology 15 7, 1569-1575.

Rudd, CE. (1996). Upstream-downstream: CD28 cosignaling pathways and T cell
function. Immunity 4, 527-534.

Seavitt, J.R., White, L.S., Murphy, K.M., Loh, D.Y., Perlmutter, R.M., and Thomas,
ML. (1999). Expression of the p56(lck) YSOSF mutation in CD45-deficient mice
rescues thymocyte development. Molecular And Cellular Biology 19, 4200-4208.

Shiroo, M., Goff, L., Biffen, M., Shivnan, E., and Alexander, D. (1992). CD45 tyrosine
phosphatase-activated p59fyn couples the T cell antigen receptor to pathways of

diacylglycerol production, protein kinase C activation and calcium influx. EMBO
Journal 11, 4887-4897.

Su, B., Jacinto, E., Hibi, M., Kallunki, T., Karin, M., and Benneriah, Y. (1994). JNK is
involved in signal integration during costimulation of T-lymphocytes. Cell 77,
727-736.

Thomas, ML. (1994). The regulation of B- and T-lymphocyte activation by the

transmembrane protein tyrosine phosphatase CD45. Curr.0pin.Cell.Biol. 6, 247-
252.

125

 

Wang, Y., Guo, W., Liang, L. and Essehnan, W.J. (1999). Phosphorylation of CD45 by
casein kinase 2: Modulation of activity and mutational analysis. J .Biol.Chem.
274, 7454-7461.

Weiss, A. and Littrnan, DR. (1994). Signal-transduction by lymphocyte antigen
receptors. Cell 76, 263-274.

Zhang, W.G., Sloan-Lancaster, J ., Kitchen, J ., Trible, RP, and Samelson, LE. (1998).
LAT: The ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular
activation. Cell 92, 83-92.

Zuhlke, R.D., Pitt, G.S., Deisseroth, K., Tsien, R.W., and Reuter, H. (1999). Calmodulin
supports both inactivation and facilitation of L- type calcium channels. Nature
399, 159-162.

 

126

 

"111111111111111111111