. Dru .r

111 1:5? 2.
i .

 

 

 

 

 

 

 

 

 

an! < .
. ..
1.... 1

. Raf/.1: .

ct n

.. fl...
.3. 1%
f

$

. .
C 9J“- .wl
Jfiu 4w:- V
1 . in).
. an
n 95.3

.5
wfia

2. :5 “m
‘ , 2m
.2 .. “an,
3 r... i.

.

’Fd: flu“
.n@_+h
. .i

«”21. .

5..-... ‘t .
33...; x}, :u aw
I ~',I\‘gun? L 5;.

4.... 3.14.“...B‘. :-

an?

fififiw. 5

is? ‘

 

.3
6mm.
...

‘0
Q

8! V 2.1....
.Iu :05.»

j J'"l'l’l'lilllllllllllilillll
LIBRARY

Michigan State
Universityfl

 

 

 

This is to certify that the

dissertation entitled
K c, v» l 6n 1’; O h o b
CSMO‘HC Sire $3. rug—,FOné'E’Si

presented by

63¢an H' st-wGQ—r rt

has been accepted towards fulfillment
of the requirements for

PHD degree in WPlant Pathology

 

W I
7' M
0 Major professor

 

Date 6/9/97

 

MS U i: an Aflirrmm‘ve Action/Equal Opportunity Institution 0- 12771

PLACE IN RETURN BOX to remove this checkout from your record.
TO AVOID FINE return on or before date due.
MAY BE RECALLED with earlier due date if requested.

 

DATE DUE

DATE DUE

DATE DUE

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

we chIFICJDdaDmpeS-pu

THE REGULATION OF OSMOTIC STRESS RESPONSES
By

Steven H. Schwartz

A DISSERTATION

Submitted to
Michigan State University
in partial fulfillment of the requirements
for the degree of

PHD

Botany and Plant Pathology

1997

ABSTRACT
By

Steven H.Schwartz

Osmotic stress may result from drought, high salinity, or freezing temperatures. All
three stresses cause a reduction in water potential, efilux of water from cells, and a loss of
turgor. Plants have evolved a variety of responses to cope with osmotic stress. The
regulation of these responses in higher plants and in a cyanobacterial model system are the
focus of this disseration.

Salt-induced genes were identified in the cyanobacterium, Anabaena Sp. PCC
7120, by promoter trapping with a Tn5zzluxAB construct. Second-site mutagenesis was
used to identify regulatory components necessary for the salt-induction of this gene. One
mutant which displays reduced luciferase activity during salt stress has an insertion in an
ORF with sequence similarity to response regulators from two-component regulatory
systems. The mutation was reconstructed with an interposon based vector and shown to
have the same phenotype.

In higher plants, the hormone abscisic acid (ABA) regulates many responses to
osmotic stress. ABA is formed by the oxidative cleavage of an epoxy-carotenoid. This is
the first committed reaction in ABA biosynthesis. The reaction is of general interest,
because the synthesis of other apocarotenoids, such as vitamin A in animals, may occur by
a similar mechanism. A new ABA-deficient mutant of maize has been identified and the
corresponding gene, VP14, has been cloned. The recombinant VP14 protein catalyzes the

cleavage of 9-cis-epoxy—carotenoids to form C25 apo-aldehydes and xanthoxin, a precursor

of ABA in higher plants.

Following the cleavage reaction, xanthoxin is oxidized to ABA in two steps. The
aba2 and aba3 mutants of Arabidopsis, are impaired in these later steps. The aba2 mutant
is blocked in the conversion of xanthoxin to ABA-aldehyde and aba3 is impaired in the
conversion of ABA-aldehyde to ABA. Extracts from the aba3 mutant also lack several
additional activities which require a molybdenum cofactor (Moco). Nitrate reductase
utilizes a Moco but its activity is unaffected in extracts from aba3 plants. Further
characterization of the aba3 mutant indicates that it is impaired in the introduction of

sulfur into the Moco.

ACKNOWLEDGMENTS

I would like to acknowledge and thank the following people for their contribution to the work
presented in this dissertation. Karen Le'on-Kloosterziel and Maarten Koornneef provided the
abaZ and aba3 mutants of Arabidopsis. Don McCarty and Bao-Cai Tan identified the va4
mutant in maize and cloned the corresponding gene. Mike Thomashow, Peter Wolk, and Ken
Pofl' served on my committee. I would also like to thank Jan Zeevaart for his guidance during my
graduate studies.

TABLE OF CONTENTS

List of Tables ................................................................................................................ viii
List of Figures ................................................................................................................. x
Introduction ..................................................................................................................... 1
References. ......................................................................................... ' ............................ 7

Chapter 2: Molecular analysis of salt stress responses in Anabaena sp. PCC 7120.

Abstract ......................................................................................................................... l 0
Introduction ................................................................................................................... 1 1
Materials and Methods ................................................................................................... 13
Results .......................................................................................................................... l 8
Discussion ...................................................................................................................... 30
References .................................................................................................................... 32

Chapter 3: Biochemical characterization of the aba2 and aba3 mutants in Arabidopsis.

Abstract ......................................................................................................................... 36
Introduction ................................................................................................................... 37
Material and Methods .................................................................................................... 40
Results ........................................................................................................................... 43
Discussion ...................................................................................................................... 55

vi

References ..................................................................................................................... 58

Chapter 4: VP14 catalyzes the carotenoid cleavage reaction of abscisic acid biosynthesis.

Abstract ......................................................................................................................... 60
Introduction ................................................................................................................... 61
Materials and Methods ................................................................................................... 64
Results and Discussion ................................................................................................... 66
References ..................................................................................................................... 80

Chapter 5: Future directions

References ..................................................................................................................... 9O

vii

 

LIST OF TABLES

Table 3.1-The conversion of xanthoxin (100 ng per assay) to ABA (ng) by cell-free

extracts of turgid and stressed leaves .............................................................................. 46

Table 3.2- Nitrate reductase activity (nmol NOz' min " mg protein" i SD.) in WT
Columbia and aba3

extracts ......................................................................................................................... 46

Table 4.]- ABA levels (ng/ g FW), measured according to Léon-Kloosterziel et al., 1997,

in embryos 16, 18, and 20 days after pollination (DAP) .................................................. 67

Table 4.2- ABA levels (ng/ g FW) in turgid and wilted leaves of the wild type and va4

mutant ............................................................................................................................ 67

Table 4.3- Conversion of xanthoxin to ABA by cell-free extracts of wild type and va4
mutant. Assays contained 100 ug protein, NADP, EDTA,PMSF, and 100 ng

xanthoxin ....................................................................................................................... 70

Table 4.4- The requirements for cleavage activity in vitro. The standard reaction

viii

contained 0.05% Triton X-100, 5 uM FeSO4, 10 mM ascorbate, and 1 mg/ml catalase in
100 mM Bis Tris buffer, pH 6.7 and 6 pg VP14 protein. Oxygen was eliminated by
degassing the reactions under vacuum and purging with H2 several

times .............................................................................................................................. 74

Table 4.5-The dependence of cleavage activity on ferrous iron. Iron was chelated from
the VP14 protein with 50 mM EDTA. The EDTA was subsequently removed on a G-25
Sephadex spin column equilibrated with 100 mM Bis-Tris and 0.05% Triton-X 100.
VP14 protein, 7 ug, was then added to reactions containing the indicated

cofactors ........................................................................................................................ 75

LIST OF FIGURES

Figure 1.1- The structure of abscisic acid (ABA) .............................................................. 4

Figure 2.1- Restructuring of Tn5-1063 insertions with pRL3 86a. The asterisk (*)

indicates where the second recombination event occurs .................................................. 15

Figure 2.2- Photonic images of Tn5-1063 mutagenized colonies prior to and following a
hyper-osmotic shift. The arrow indicates a mutant with an insertion in a salt-inducible

gene ............................................................................................................................... 19

Figure 2.3- Luciferase activity in the ABS mutant as a fiinction of the NaCl concentration.
Activity is expressed as a percentage of the maximum activity observed in this

experiment ..................................................................................................................... 20

Figure 2.4- Miscellaneous sequence data. The sequences were obtained from rescued

plasmids using primers from the left and right ends of the Transposon ............................ 21

Figure 2.5- An photographic image (A) and a photonic image (B) of ABSdrl colonies

mutagenized with pRL1058. Filter-grown colonies were transferred to high salt media

5 hrs prior to obtaining the photonic image. The photographic image and the photonic
image were superimposed (C) to identify mutants no longer displaying salt-induced

luciferase activity ............................................................................................................ 23

Figure 2.6- Southern analysis of genomic DNA from second-site mutants with pRL1063a
as the probe. The arrows indicates an EcoRI fragment containing the luxAB reporter

gene ............................................................................................................................... 24

Figure 2.7- Luciferase activity in ABSdrl and SA6 at different salt concentrations. The
activity is expressed as a percentage of the maximum activity observed in this

experiment ..................................................................................................................... 25

Figure 2.8- A silver stained SDS-PAGE gel. Samples are the wild type 7120, stressed
wild type 7120, stressed ABSdrl, and stressed SA6. Stressed cultures were incubated

with 150 mM NaCl and KC] (equimolar) for 8 hr ........................................................... 26

Figure 2.9- Growth of the ABSdrl and SA6 mutants at different salt concentrations. The

concentration of chlorophyll a was determined by measuring the absorption of methanol

extracts at 660 nm .......................................................................................................... 27

Figure 2.10- Northern analysis of luxAB expression in the SA6 and ABSdrl strains ....... 28

Figure 2.11- Nucleotide sequence at the site of the SA6 insertion. The proposed start
codon and stop codon are in bold and the site of the Tn5-1063 insertion is marked by

V ................................................................................................................................... 30

Figure 2.12- The deduced amino acid sequence of SA6 aligned with two hypothetical
ORFs from the Synechocystis genome (gi-1653479 and gi-1652813), an ORF from
Streptomyces Iividans (gi-1498492), and the product degU gene in Bacillus brevis (sp-

p54662). The CheY gene product from E. coli (gi-1736535) is also included, because the

“—“awn. ‘0 ‘A-IMM‘ .‘q
I 1. " h.

crystal structure is known and is often used as a reference in defining critical (Volz, 1993)

OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOO 32

Fig ure 3.1- Proposed pathway of ABA biosynthesis. The biochemical lesions in the abaI,

aba2, and aba3 mutants of Arabidopsis thaliana are indicated ....................................... 38

Figure 3.2- Carotenoid analysis of the WT Columbia, aba2, and aba3 plants.

9-cis-violaxanthin (9cV) and 9-cis-neoxanthin are indicated the chromato grams ................ 44

Figure 3.3- Conversion of xanthoxin to ABA by protein extracts from WT Columbia, aba2,

and aba3 plants. 100 ng of xanthoxin was added per assay ........................................... 47

Figure 3.4- Conversion of ABA-aldehyde to ABA by protein extracts of WT Columbia,

aba2, and aba3 plants. 50 ng of ABA-aldehyde was added per assay ............................. 48

xii

Figure 3.5- The accumulation of trans-ABA-alcohol in the aba3 mutant. (A) trans-ABA-
alcohol from the diethyl ether fraction was dissolved in 500 uL, and 1 uL was injected on the
GC; 100 pg/uL methyl-ABA was added as a reference standard. The trans-ABA-alcohol
hydrolyzed with glucosidase, 1 uL of 1000 uL was injected with 100pg/uL methyl-ABA as

a reference standard ........................................................................................................... 49

Figure 3.6- Aldehyde—oxidase activity gel with protein extracts of WT Columbia, abaZ, and
aba3 (80 ug of protein was loaded per lane). The aldehyde oxidase activities are indicated
with arrows. The most intense band (at the top of the gel) is a staining artifact, which also

occurs in the absence of the heptaldehyde substrate ........................................................ 50

Figure 3.7- Xanthine dehydrogenase activity gel with protein extracts of WT Columbia and

aba3: 50 ug of a 16-32% ammonium sulfate fraction were loaded per lane ................... 52

Figure 3.8- Reverse-phase HPLC chromatogram of aqueous extracts (see materials and
methods) from WT Columbia and aba3. The arrow indicates a compound which only

accumulates in the aba3 mutant ...................................................................................... 53

Figure 3.9- Inactivation of ABA-aldehyde oxidase activity in WT Columbia with KCN and

reconstitution of activity in aba3 by treatment with NaQS and dithionite. ND. (not detected).

50 ng of ABA-aldehyde was added per assay .................................................................. 55

xiii

Figure 3.10- The chemical modification of the Moco and the proposed genetic lesion in the

aba3 mutant ..................................................................................................................... 57

Figure 4.1- The proposed pathway of ABA biosynthesis in higher plants ........................ 63

Figure 4.2- Carotenoid composition of WT and va4 embryos. 9-cis-violaxanthin (9cV), 9-

cis-neoxanthin (9cN) and zeaxanthin (Z) are indicated on the chromatogram .................. 68

Figure 4.3- The reaction catalyzed by the lignostilbene dioxygenase (LSD) from

Pseudomonas paucimobil is ........................................................................................... 71

Figure 4.4- HPLC chromatogram of the cleavage reaction products using 9-cis-violaxanthin
as substrate. Absorbance was measured at 436 nm and 285 nm with a photodiode array

detector ........................................................................................................................... 72

Figure 4.5- Decrease in 9-cis-violaxanthin and the concomitant increase in xanthoxin and the
C25 apo-aldehyde as a function of the VP14 protein concentration. Assays were incubated

for 10 min. at 22-24°C, extracted, and quantified ............................................................ 77

Figure 4.6- Thin-layer chromatography of assays with VP14 protein (+) and without (-).
Assays contained approximately 5 pg of the indicated substrate: The 9-cis isomers (9c) and

the All—trans isomers (at) of Zeaxanthin (Z), Violaxanthin (V), and Neoxanthin (N).

xiv

 

Substrate and products were separated on a Silica gel 60 plate (EM Separations) developed
with 10% iso-propanol in hexane. The plates were sprayed with 2,4-dinitro-phenylhydrazine
to detect xanthoxin and other aldehydes. The C25 products are indicated by an (*) and the C15
products are indicated by an (T). The unlabeled Spots are the carotenoid

precursor ......................................................................................................................... 78

Figure 5.1- Cleavage substrates used in the characterization of VP14 activity ................. 87

Figure 5.2- Kinetic measurements for the cleavage of 9-cis-violaxanthin and 9-cis-

neoxanthin by VP14 ....................................................................................................... 89

XV

~Trr

 

INTRODUCTION

Drought and salinization are among the most serious problems facing food
production in the world. In the US, 25 % of the land has been classified as arid and
40 % of crop losses can be attributed to drought (Boyer, 1982). In addition, current
irrigation practices have led to the rapid salinization of agricultural lands. In recent years,
plant breeding for increased drought tolerance has provided some improvements (Yeo,
1994). Some major crops, however, lack the diversity in their gene pool for adaptation to
arid environments. In these instances, genetic engineering may allow proven strategies of
drought and salinity tolerance to be introduced into drought-sensitive plants (Bohnert and
Jensen, 1996). Therefore, an understanding of drought tolerance strategies and their
regulation should be beneficial for crop improvement. The work described in the
following chapters is intended to provide some insight into the regulation of osmotic stress
responses in higher plants and in the cyanobacterium, Anabaena sp. PCC 7120.
Mechanisms of drought stress tolerance.

Osmotic stress may result from drought, high salinity, or freezing temperatures. All
three stresses cause a reduction in water potential (‘1’), efflux of water fi'om cells, and a
loss of turgor. Plants have evolved a variety of mechanisms to survive in environments

with low water potentials. Many of these strategies involve complex biochemical,

2

morphological and phenological processes, which allow plants to utilize the available
water efliciently. For example, CAM photosynthetic plants temporarily fix carbon at night
when transpiration rates are low (Ting, 1985). In environments with predictable dry and
wet seasons, some annual plants remain dormant during the dry season and undergo rapid

growth and reproduction during the wet season (Aronson et al., 1992). Many plants

.3. d?- ."_‘i-’

increase the root to shoot ratio during water stress to elevate water uptake (Wu et al.,

1994)

 

Dessication tolerant plants such as the resurrection plant, Craterostigma E'-
plantagineum, are able to undergo severe dehydration and remain viable. A number of
genes are induced during osmotic stress in higher plants (Ingrams and Bartels, 1996). The
induction of specific transcripts during osmotic stress suggests that these genes have a
fimction in dessication tolerance. Engineering desiccation tolerance should be easier than
altering the complex morphological and developmental processes mentioned above. The
function of genes encoding the enzymes for the synthesis of compatible solutes is well
established (McCue and Hanson, 1990; Tarcynski et al., 1993; Bohnert and Jensen, 1996).

Many genes have been identified by differential screening techniques, but their function
has not yet been determined. Functions have been hypothesized for several stress inducible
genes, based on sequence similarity (summarized in Ingrarns and Bartels, 1996). Late
embryogenesis abundant genes (Lea), first identified in dessicated cotton seeds (Baker et
al., 1988), are ubiquitous in plants and are usually the most abundant osmotically induced
genes (Ingram and Bartels, 1996). Secondary structure predictions for LEA proteins

indicate randomly coiled motifs, which may serve a role in binding of water (Baker et al.,

3

1988) or hydration of proteins (McCubbin et al., 1985). However, there is little
experimental evidence to support either hypothesis.

Using heterologous probes, potential homologs of osmotically induced genes in
plants were tentatively identified in the cyanobacterium Anabaena sp. PCC 7120 (Curry
and Walker-Simmons, 1993; Lammers and Close, 1993). These genes are also induced by
osmotic stress in Anabaena. Following endosymbiosis, a number of stress responsive
genes may have been transferred to the plant nucleus. Cyanobacteria, which are more
amenable to genetic manipulation, may serve as a good model system in determining the
fimction of these genes. The Synechocystis genome (Kaneko et al., 1996) was searched
with the translated sequence of several LEA proteins. The ORFS which shared the highest
similarity with the Lea genes had Poisson probabilities of .002 and greater. From these
results it is uncertain why the Lea genes hybridized with osmotically induced genes in
cyanobacteria (Curry and Walker-Simmons, 1993; Lammers and Close, 1993). There is,
however, a potential homolog of another osmotically induced plant gene, the wheat esi3
gene (Gulick et a1. 1994), in the Synechocystis genome (Poisson probability of
3.52 x 10'”).

Abscisic acid function and biosynthesis.

The plant growth regulator, abscisic acid (ABA) (Figure 1.1), controls a number of
physiological processes in plants, such as embryo development, seed germination and
stress tolerance (Zeevaart and Creehnan, 1988). The various functions attributed to ABA
are based upon the effect of its exogenous application and correlations between the

endogenous concentrations of ABA and a given process. In more recent years, the

 

Figure l.l- The structure ofabscisic acid (ABA)

11-”, fl WI...”

5

identification and characterization of ABA-deficient has provided definitive evidence for
the role of ABA in various processes, such as seed dormancy (Koomneef, 1982).
Physiological responses to ABA may be regulated by changes in distribution,
concentration, or sensitivity. A redistribution of ABA in response to osmotic stress (Slovik
and Hartung, 1992) may be responsible for rapid changes such as stomatal closure. 1‘

Physiological changes associated with osmotic stress are also enhanced by increased ABA

 

levels (Zeevaart and Creelman, 1988). Different strains of wheat with distinctive
germination kinetics have varying sensitivities to exogenous ABA (Steinbach et al., 1995;
Walker-Simmons, 1987). A farnesyl transferase involved in ABA signal transduction
(Cutler et al., 1996) may be the molecular basis for this varying sensitivity.

The characteristics of the early steps in ABA biosynthesis have been inferred by
carotenoid analysis and 18O2 labeling experiments. The carotenoid content in leaves is in
great excess relative to the amount of ABA produced and no changes in the carotenoid
composition have been associated with elevated ABA biosynthesis. In etiolated tissue,
however, the carotenoid concentration is low and a decrease in Violaxanthin and
neoxanthin has been correlated with an increase in ABA and its catabolites (Li and
Walton, 1995). The derivation of ABA from xanthophst is also supported by 1802
labeling experiments. In the presence of '802, there is no incorporation of '80 into the 4'-
keto or the 1'-hydroxyl of ABA. This data indicates ABA is synthesized fiom a large
precursor pool with oxygen at these positions. '80 labeling does occur at one position in
the carboxyl group (Creelman and Zeevaart, 1984), while the other oxygen is derived fiom

water (Creelman et al., 1987). This is consistent with the oxidative cleavage of an epoxy-

6

carotenoid precursor and indicates that de novo synthesis of the precursor is not necessary
for ABA biosynthesis.

The immediate product of the cleavage reaction, xanthoxin, is rapidly converted to
ABA in vivo and in vitro (Sindhu and Walton, 1987) indicating that the later steps in the
pathway are not rate limiting. This conclusion is further supported by the incorporation of
'80 in the carboxyl group of ABA. If the aldehyde is not oxidized quickly, the oxygen
would exchange with water and the label would be lost (Zeevaart et al., 1989).

The experiments discussed above indicate that the early steps in ABA biosynthesis
(the formation of the epoxy-carotenoid precursor) is not rate limiting and the enzymes
catalyzing the later steps of ABA biosynthesis (the two step oxidation of xanthoxin to
ABA) are constitutively expressed. Therefore, the cleavage reaction in ABA biosynthesis
appears to be the rate limiting step.

The inhibition of stress-induced ABA biosynthesis by actinomycin D suggests that
the pathway is transcriptionally regulated (Guerrero and Mullet, 1986), perhaps by
increased expression of the cleavage enzyme. The compartmentation of carotenoids in the
chloroplast envelopes and the thylakoid membranes, however, complicates any
consideration of the role that substrate availability has in regulating this reaction. If the
cleavage reaction occurs in the envelopes, where only a small percentage of the total
carotenoids are contained, this reaction may be substrate limited. There does, however,
appear to be a rapid flux of carotenoids between the thylakoid and envelope membranes
(Siefermann-Harms et al., 1978).

Altering the expression of the cleavage enzyme is the most reasonable approach

 

7

for manipulating ABA levels in plants. Because ABA is an endogenous regulator of many
drought stress responses, altering its levels could have a dramatic effect on drought
tolerance.

REFERENCES

Aronson J, Kigel J, Shmida A, Klein J (1992) Adaptive phenology of desert and
Mediterranean populations of annual plants grown with and without water stress.
Oecologia 89: 17-26.

Baker J, Steele C, Dure L 111 (1988) Sequence and characterization of 6 Lea proteins
and their genes from cotton. Plant Mol Biol 11: 277-91

Bohnert HJ, Jensen RG (1996) Strategies for engineering water-stress tolerance in
plants.Trends Biotechnol 14: 89—97

Boyer JS (1982) Plant productivity and the environment. Science 218: 443-448
Close TJ, Lammers PJ (1993) An osmotic stress protein of cyanobacteria is
immunologically related to plant dehydrins. Plant Physiol 101: 773-779

Creelman RA, Gage DA, Stults JT, Zeevaart JAD (1987) Abscisic acid biosynthesis in
leaves and roots of Xanthium strumarium. Plant Physiol 85: 726-732

Creelman RA, Zeevaart JAD (1984) Incorporation of oxygen into abscisic acid and
phaseic acid from molecular oxygen. Plant Physiol 75: 166-169

Curry J, Walker-Simmons MK (1993) Sequence analysis of wheat cDNAs for abscisic
acid-responsive genes expressed in dehydrated wheat seedlings and the cyanobacterium,
Anabaena. In Plant Responses to Cellular Dehydration During Environmental Stress. Ed.
Close T.J., Bray E.A. American Society of Plant Physiologists, Rockville, MD

Cutler S, Ghassemian M, Bonetta D, Cooney S, McCourt P (1996) A protein

farnesyl transferase involved in abscisic acid signal transduction in Arabidopsis. Science
273: 1239-1240

Guerrero F, Mullet J (1986) Increased abscisic acid biosynthesis during plant
dehydration requires transcription. Plant Physi0180: 588-591

Gulick PJ, Shen W, An H (1994) ESI3, a stress-induced gene from Lophopyrum
elongatum. Plant Physiol 104: 799-800

8

Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N,
Hirosawa M, Sugiura M, Sasamoto S, Kimura T, Hosouchi T, Matsuno A, Muraki
A, Nakazaki N, Naruo K, Okumura S, Shimpo S,Takeuchi C, Wada T, Watanabe A,
Yamada M, Yasuda M, Tabata S (1996) Sequence analysis of the genome of the
unicellular cyanobacterium Synechocystis sp. strain PCC6803. 11. Sequence determination

of the entire genome and assignment of potential protein-coding regions. DNA Res
3: 185-209

Koornneef M, Jorna ML, Brinkhorst-van der Swan DLC, Karssen CM (1982) The E
isolation of abscisic acid (ABA) deficient mutants by selection of induced revertants in

non-germinating gibberellin-sensitive lines of Arabidopsis thaliana (L) Heynh. Theor Appl
Genet 61: 385-393

Li Y, Walton DC (1990) Violaxanthin is an abscisic acid precursor in water-stressed
dark-grown bean leaves. Plant Physiol 92: 551-559

 

McCubbin WD, Kay CM (1985) Hydrodynamic and optical properties of the wheat Em
protein. Can J Biochem 63: 803-810

McCue KF, Hanson AD (1990) Drought and salt tolerance: towards understanding and
application. Trends Biotechnol 8: 358-362

Siefermann-Harms D, Joyard J, Douce R (1978) Light-induced changes of the
carotenoid levels in chloroplast envelopes. Plant Physiol 61: 530-533

Sindhu RK, Walton DC (1987) The conversion of xanthoxin to abscisic acid by cell-free
preparations fiom bean leaves. Plant Physiol 85: 916-921

Slovik S, Hartung W (1992) Compartmental distribution and redistribution of abscisic
acid in intact leaves. 111. Analysis of the stress-signal chain. Planta 187: 37-47

Steinbach HS, Benech-Amold RL, Kristof G, Sanchez RA, Marcucci-Poltri S
(1995) Physiological basis of pre-harvest sprouting resistance in Sorghum bicolor (L.)
Moench. ABA levels and sensitivity in developing embryos of sprouting-resistant and
-susceptible varieties. J Exper Bot 46: 701-709

Tarczynski MC, Jensen RG, Bohnert HJ (1993) Stress protection of transgenic
tobacco by production of the osmolyte mannitol. Science 259: 508-510

Ting, IP (1985) Crassulacean acid metabolism. Annu Rev Plant Physiol 36: 595-622

Walker-Simmons M (1987) ABA levels and sensitivity in developing wheat embryos of
sprouting resistant and susceptible cultivars. Plant Physi0184: 61-66

9

Wu Y, Spollen WG, Sharp RE, Hetherington PR, Fry SC (1994) Root growth
maintenance at low water potentials. Increased activity of xyloglucan

endotransglycosylase and its possible regulation by abscisic acid. Plant Physiol 106: 607-
615

Yeo AR (1994) Physiological criteria in screening and breeding. Monographs on
Theor Appl Genet 21: 37-59

 

10

Chapter 2
Molecular analysis of salt stress responses in Anabaena strain PCC 7120
ABSTRACT
Salt-induced genes were identified in the cyanobacterium, Anabaena sp. PCC
7120, by promoter trapping with a Tn5::lwcAB construct. The genomic sequence adjacent
to one insertion was nearly identical with the lti2 gene from Anabaena variabilis,
previously identified in a differential screen for cold-induced transcripts. Second-site

mutagenesis was used to identify regulatory components necessary for the salt-induction

‘ ‘Iguza “g: Jm;.».l.~iipr Mn...”

of this gene. One mutant which displays reduced luciferase activity during salt stress has
an insertion in an ORF with sequence similarity to response regulators fiom two-
component regulatory systems. The mutation was reconstructed with an interposon based
vector and shown to have the same phenotype. Further biochemical and physiological
characterization indicates that several salt-induced proteins are absent and that the mutant

is more sensitive to salt stress.

11

INTRODUCTION
In cyanobacteria, a number of adaptations to salt stress have been characterized.
For example, the extrusion of ions that are detrimental to cellular processes is critical for
survival. Several potential H7Na+ antiport systems are present in the Synechocystis
genome (Kaneko et al., 1996) and there is biochemical evidence for a H’i/Na+ antiport
systems (Packer et al., 1987). A P-ATPase is involved in the efflux of Na+ from yeast

(Haro et al., 1991) and the disruption of genes encoding P-ATPases leads to decreased é,

 

salt tolerance in Synechococcus (Kamamaru et al., 1993).

‘LL. 1 '0

Compatible solutes decrease the intracellular water potential to reduce the efflux of
water and may also substitute for water in stabilizing membranes and proteins.
Cyanobacteria accumulate a variety of compatible solutes in response to osmotic stress
(Reed and Stewart, 1988; Reed et al., 1984). Uptake systems for compatible solutes
occur in a number of prokaryotes, including cyanobacteria (Mikkat et al., 1996).

AS many as 100 genes are induced by salt stress in Anabaena torulosa (Apte and
Haselkom, 1990). Some salt-induced genes may be involved in the adaptations discussed
above; the filflCthl‘I of most salt-inducible genes, however, is still unknown. Among these
genes there may be homologs of desiccation induced genes in higher plants (Close and
Lammers, 1993; Curry and Walker-Simmons, 1993). The function of these genes in
plants is also unknown.

The fimction of salt-inducible genes may be determined by disrupting the individual
genes and determining its effect on salt tolerance. Considering the large number of genes

induced by salt stress, the disruption of individual genes may not produce a visible

12

phenotype. Regulatory mutants impaired in the salt induction of multiple genes may be
more suitable for these studies.
Two-component regulatory systems mediate environmental responses in a wide
range of prokaryotes. Most two-component systems consist of a sensor and a response
regulator (Gross et al., 1989; Swanson et al., 1994). The sensor is usually a trans- r

membrane protein which perceives changes in the extracellular environment and auto- ‘

I.

phosphorylates a histidine in its cytoplasmic or "transmitter" domain. The phosphate is

subsequently transferred to an aspartate in the amino terminus of the cognate response

 

wnmnn_“’ .i-

regulator, which may then alter transcription or other cellular processes. Two-component
regulatory systems are often identified on the basis of sequence similarity. The cytoplasmic
domain of the sensor kinase is highly conserved and the amino terminus of response
regulators share 20-30% amino acid identity on average. While the carboxyl terminus of
response regulators is not conserved, the secondary structure often has a helix-loop-helix
DNA binding motif (Pabo and Sauer, 1992).

In cyanobacteria, several functions have been attributed to two-component
regulatory systems (Campbell et al., 1996; Chiang et al., 1992) including the regulation of
salt-stress responses in the cyanobacterium, Synechocystis (Hagemann et al., 1996). In
addition, changes in protein phosphorylation in response to salt stress have been reported
(Hagemann et al., 1993). A number of response regulators have been identified in the
Synechocystis genome sequence (Kaneko et al., 1996), but their fimction is not yet known.

An insertional mutant impaired in the induction of several salt—induced proteins has

been identified in Anabaena PCC 7120. At the site of the insertion there is an ORF which

13

shows sequence similarity to a number of response regulators from two-component
regulatory systems.
MATERIALS AND METHODS
Culture conditions.
Anabaena sp. PCC 7120 was grown on AA medium (Allen and Arnon, 1955) containing
1% bacto-agar (Difco) and supplemented with 10 mM N031 Liquid cultures were grown
in AA/8 medium plus 5 mM NO,‘ with continuous shaking. All cultures were grown at
30° C under fluorescent lights.
Transformation of Anabaena.
Plasmids were introduced into Anabaena sp. PCC 7120 by tri-parental matings on
membrane with E. coli strain J53 (RP—4) (Wolk et al., 1984). A second E. coli strain
contained the appropriate plasmid with a RK2 origin of transfer for conjugal transfer and
pRL528, which contains the methylases for AvaI and AvaII restriction sites (Elhai and
Wolk, 1988).
Identification of salt-induced genes.
Anabaena sp. PCC 7120 was mutagenized with pRL1063a (Wolk et al., 1991). Insertions
into salt-induced genes were identified by comparing photonic images luciferase acitivity
prior to and following a hyper-osmotic shift. For the hyper-osmotic shift, filters were
transferred to medium containing an additional 100 mM NaCl and a second photonic image
was taken after five hours.
Cloning genomic DNA adjacent to Tn5 insertions.

DNA was purified from the ABS mutant according to a published protocol (Cai and Wolk,

- V'.‘..-_£ll~.J.I,

 

VFW-1.;

14

1990), digested with EcoRI, and ligated in a 100 uL volume. The ligation mixture was
precipitated and used to transform E. coli DHIOB by electroporation. An origin of
replication and the neomycin marker allowed for selection of intra-molecular ligation
products, which contain the 1063-Tn5 insertion and the adjacent genomic DNA. A
genomic fiagment at the site of the SA6 insertion was cloned from this mutant in a similar
manner. Fragments of genomic DNA cloned in this manner will subsequently be referred
to as rescued plasmid.
Measurement of luciferase activity in liquid cultures.

The indicated concentration of NaCl was added to early log phase cultures of the ABS
insertion. The cultures were incubated for 2 hr before luciferase activity was measured.
The luciferase substrate was prepared by sonicating 10 uL of n-decyl aldehyde in 5 mL of
water with 100 mg of BSA. The luciferase activity was measured in a scintillation counter
with 200 uL of the substrate.

Restructuring the ABS mutant and second-site mutagenesis.
The plasmid, pRL3 86a (unpublished plasmids from the lab of CF. Wolk) contains the
luxAB genes for recombination with the original Tn5-1063 insertion (Figure 2.1).
Following transfer of pRL3 86a to the ABS strain, the erythromycin (Em) resistance marker
allowed for selection of single recombinants. Adjacent to the resistance markers there is
portion of the Tn5 1850 R and a sacB gene which is conditionally lethal in Anabaena (Cai
and Wolk, 1990). Several single recombinants were grown in liquid culture and plated on
medium containing 5% sucrose and 10 ug/mL erythromycin to select for double

recombinants lacking the sacB gene. Selected double recombinants Showed the same

 

15

85:588.”: 05:03

$585888 Emcmm

EEEE @5me

.2300 Eo>o coszpEoR: 988m 2: 22?» 328%.: AL 53:28 2:. downs—Ma 5:5 22:85 32%: mo wctaoabmum -_ .N ennui

<75 3:850 .89 E8 avg: <20 2:550

QVRSN “03a. LED mVRSN

 

 

 

5.3: <ZQ 2:550
$3:
.50
2.5
new 3%
.50
Ste Moan
43am. Sea

16

luciferase induction as the initial insertion. One double recombinant, ABSdrl , was used for
second-Site mutagenesis with pRL1058 which contains a Tn5 derivative (Wolk et al.,
1991). Following mutagenesis, colonies growing on membranes were transferred from AA
N medium to medium containing an additional 100 mM NaCl. After five hours, a photonic
image of the colonies was taken and superimposed on an analog image to identify colonies
with reduced luciferase activity.

Screening for a genomic clone of SA6.
A plasmid rescue from SA6 was used as a template in a random prime labeling reaction
(Promega) and used to screen an EMBL3 library (Black and Wolk, 1994). Positive
plaques were isolated and phage DNA was prepared from plate lysates (Sambrook et al.,
1989) and digested with SalI. A 15 kb fragment of Anabaena DNA was isolated and
ligated into the S011 site of pRL171 (Elhai and Wolk, 1988). Fragments near the site of the
SA6 insertion were subcloned into pBluescript SK (Stratagene) and sequenced.

Reconstruction of the SA6 mutant.

A DraI plasmid rescue of SA6 was linearized and ligated to an FspI fragment from
pRL1130a (unpublished plasmids from the lab of CF. Wolk), containing a streptomycin
resistance marker and the sacB gene. The resulting plasmid was transferred to the ABSdrl
mutant and single recombinants were selected on medium containing neomycin (800
ug/mL). Several single recombinants were grown in liquid culture, then plated on media
containing 5% sucrose and 100 ug/mL neomycin to select for double recombinants.

Resulting double recombinants were Suc’, Nm’, Em’, Cm', and Sp"

17

Protein analysis.
Cultures of wild type 7120, the ABS mutant and the SA6 mutant were treated with a 150
mM mixture of NaCl and KCl (equimolar) for 8 hrs. Cells were harvested by
centrifugation, frozen in N2 (l), resuspended in 1x Laemmli loading buffer and heated to
100° C for 5 min. Proteins were resolved on a SDS-PAGE gel (7.5-1S% gradient) and

silver stained.

4-4V . '-

Northern analysis.

 

Cultures (50 mL) were harvested by centrifiigation and resuspended in 600 uL of 50 mM

Tris, 10 mM EDTA, and 1% SDS. An equal volume of buffer-saturated phenol was added
and the samples were mixed on a vortex mixer with sterile sand for 5 min. The phases
were separated by centrifugation. The aqueous phase was transferred to a new tube and
extracted twice with chloroform. Nucleic acids were precipitated on ice with Na—acetate
pH 5.0 (0.2 M final concentration) and an equal volume of 2-propanol. The precipitate
was sedimented by centrifugation in a micro-fuge at 14,000 rpm for 10 min. To remove
DNA, the samples were resuspended in 4 M LiCl2 and mixed on a vortex mixer for 5 min.
RNA was precipitated by centrifugation at 14,000 rpm in a micro-centrifuge for 10 min.,
while the DNA remains in solution. The LiCl2 step was repeated, then the RNA was
resuspended in 500 uL of water, extracted once with phenol, and once with chloroform.
The RNA was precipitated with Na-acetate and 2-propanol as before. RNA was subjected
to electrophoresis in formaldehyde gels, transferred to nylon membranes and hybridized

(Sambrook et al., 1989) with a luxAB probe.

18

Growth Curves.
Synchronously growing cultures of ABS and SA6 were used to inoculate AA/8 N medium
containing varying concentrations of an equimolar mixture of KCl and NaCl. After 7 days,
cells from 1 mL of the culture were harvested by centrifugation. The chlorophyll a
concentration was determined by measuring the absorption at 660 nm in one mL of 90%
methanol (v/v).

RESULTS

Selection of mutants with insertions in salt-induced genes.

Insertions into salt inducible genes were identified by promoter trapping with a Tn5
derivative containing a promoter lwcAB gene adjacent to the left border (Wolk et al.,
1991). A photonic image of luciferase activity was obtained for filter-grown colonies. The
filters were then transferred to medium containing an additional 100 mM NaCl. Colonies
displaying elevated luciferase activity were identified by comparing photonic images taken
prior to and subsequent to the hyper-osmotic shift (Figure 2.2). The luciferase activity in
the ABS mutant at different NaCl concentrations is shown in Figure 2.3. The genomic
sequence adjacent to the ABS insertion was nearly identical with the Iti2 gene (Figure 2.4),
which was previously identified as a cold-inducible transcript in a related cyanobacterium,
Anabaena variablis (Sato, 1993). Iti2 encodes a protein with similarity to a-
glucanotransferases, but its function is unknown.

Second-site mutagenesis to identify regulatory components.
Second-site mutagenesis of the ABSdrl strain was performed with the Tn5

derivative, pRL1058. Photonic images of salt-induced colonies were superimposed with

 

   

Figure 2.2- Photonic images of Tn5-1063 mutagenized colonies prior to and following a
hyper-osmotic shift. The arrow indicates a mutant with an insertion in a salt-inducible gene

20

 

100 ’1 l.———--.‘ l
1 ‘ t i
I
a l .“ l
o l l
m .
3 60 j , l
o x |
a ' .- .
P. .
|
i 40 4;
9 |
o .
a: 1 ,
l C |
20 1 l
l , ' |
l g” . l
o 1 7 '1 V l '7 '7 7' l' er T_- a: fi 'A i ’"l g 1
0 20 40 60 80 100 120 140 160 180 200 220
NaCI (mM)

Figure 2.3- Luciferase activity in the ABS mutant as a function
of the NaCl concentration. Activity is expressed as a percentage
of the maximum activity observed in this experiment.

21

ABitiahleerst
aacaagaccaatctaaaattgatt ggacactcttaggtaat gatcttaatcgtagtttttgattaccataaaggtttgattggtttac gt
aagaataataa

The sequence shown was identical with the nucleotide sequence of the Iti2 gene from
Anabaena variabilis.

SDI left mrdgr
atgttaattttagtcgttggaggttggcgggtaatggatgggaatctcagcattgggatgttggtggcatttcaaagcttgatgctg
agttttcagcagcctgtcaacgctttagtagatttcggtactactctccaggaattagaaggggatttaaatcgcttagatgatgat

gtgtt

The highest match from a blastx search of this sequence was: sp|q03727|coma_strpn
transport atp-binding protein coma

Poisson probability = 4.9e-06

Identities = 19/55 (34%), Positives = 34/55 (61%), Frame = +1

SALEM
gttaataataagggattacctgccagttcagcgatcgcatgggatgtatcaattccctatgcaggcgctctttttccgccttctatct
ccctcatcacaaaaagttaattcatgccagcgataaaatcttgaatttgttctggttctaaatcttg

No significant matches were found in the sequence databases.

S311

cagga cgctacttgt ntataagagt caggtctcag ggtctacgat tttaacttctgtnccgggaa ttggttgtcc
ggntgtcccg ataaanttnc gccagggacg gcgcacgtnggtgactgggg atgtttcggt taaaccataa ccttgcaaaa
nctgcacgcc aataatttcaaaaaatgtnt cgatgtgttt tggtaatgca ccgccaccgc taattacttg
tttaaatcttcctcctgttg cttccttgac tttnccatac actaactttn gtcctaaaac atggaagggtaaaaangcaa
attctagtac cttagcgatt aancgttcca acgatgaagc atggagatgatctaaacttg taccttgagc aattntttgg
gctttantaa tattttcnac ntcattgncccantaaaaac cttaatcagg ccgttgtttn gtttccnggg ttgttcgggg
gacttngttttcancntcct tcataaatcg gttcccacat gcgggggtca

The highest match from a blastx search of this sequence was: sp|p39002|1cf3_Yeast
long-chain-fatty-acid--coa ligase 3 (cc 6.2.1.3) (Long-chain acyl-coa synthetase 3) (fatty
acid activator 3).

Poisson probability = 1.5e-08

Identities = 28/79 (35%), Positives = 41/79 (51%), Frame = -2

Figure 2.4- Miscellaneous sequence data. The sequences were obtained from rescued plasmids using
primers fi'om the left and right ends of the Transposon

22

analog images to identify mutants with reduced luciferase expression (Figure 2.5). False
positive resulting fiom a Tn5 insertion near the luxAB reporter gene were identified by
Southern analysis (Figure 2.6). Several mutants had a reduced basal level of luciferase
activity, but the relative induction of activity during salt—stress was similar to ABS. These
mutants may be due spontaneous mutations in the luxAB. The SB12 mutant, which is F
impaired in phycobilisome synthesis (Cai et al., 1997), was also identified in this screen as a
result of reduced viability.

One mutant, designated SA6, contained a normal basal level of activity, but failed

 

flu"

to show any induction during salt stress (Figure 2.7). The mutation was reconstructed with
an interposon based vector and shown to have the same phenotype. Analysis of proteins in
this mutant revealed that several salt-induced proteins were no longer expressed in stressed
cultures (Figure 2.8). Preliminary experiments indicate that the SA6 mutant is more
sensitive to high salt concentrations than ABS (Figure 2.9).

The Iti2 gene is induced by cold in Anabaena variabilis (Sato, 1993). The
enhanced stability of luciferase at lower temperatures makes this a poor reporter gene for
monitoring temperature induced changes in gene expression. Therefore, the expression of
this gene in response to cold was investigated by northern analysis in the ABSdrl and SA6
strains. There was a small increase in the abundance of the luciferase reporter trasncript in
cold-stressed cultures, but there was no variation between the salt regulatory mutant, SA6,
and the original reporter strain, ABSdrl (Figure 2.10).

A genomic clone corresponding to the site of the SA6 insertion was identified and

sequenced (Figure 2.11). An open reading frame (ORF) encoding a protein with sequence

23

.b_>=o~ 380:2: vooavfiéfim main—3:. how—5— o: 3:82: £2.02 9 ADV vomantonsm 203 owe—E 02893 2: v5 owe—E

cinnamoaofi— 2:. awn—E 2:923 05 wEfiaSo 9 Sta 2: m «GB: :3 AME o. gunman... 9.03 325.8 =38w...8=n_
fine—4mg 5:5 unfinomfizfi EEO—co :39... mo 25 omen: 3:823 a v5 A<V own—E uEnEweosn :< -nd 23w."—

 

24

 

A2 A6 A7 A8 A10 All 811 312313 C2 C4 D1

Figure 2.6- Southem analysis of genomic DNA from second-site mutants with pRL1063a
as the probe. The arrows indicates an EcoRI fragment containing the luxAB reporter gene.

25

100 * 

80 9
g l
.>
‘8
a: 60 -.
33 ‘1 _
E . a
,9 a
6 .'
.2 4o . E
9
'3
E l
o i
a:

20 “3

 

 

 

AA/8N AA/8N +100 mM NaCl

Figure 2.7— Luciferase activity in ABSdrl and SA6 at different salt concentrations. The activity
is expressed as a percentage of the maximum activity observed in this experiment.

26

150 mM Na/KCl

0—.
WT WT ABS SA6

   

Figure 2.8— A silver stained SDS-PAGE gel. Samples are the wild type 7120, stressed wild type 7120,
stressed ABSdrl, and stressed SA6. Stressed cultures were incubated with 150 mM NaCl and KC]
(equimolar) for 8 hr.

7_"l

27

a [:3
il§i : «.2
.\ f ”AW 5
g r _ g - L *_ W

E 1 L 8
E l

g ‘ WW8

 

pc:
V

WW

 

N to m (engulfiudolluo N ‘- 0
Val ;
x L A » »——~ g
t 8
.g l 1
g 1 “WW 8

(5d) a Mudmomo

NaCl (mM)

 

NaCI (mM)
Figure 2.9- Growth of the ABSdrl and SA6 mutants at different salt concentrations. The concentration of chlorophyll a was determined by

measuring the absorption of methanol extracts at 660 nm.

28

Controls Cold treatments

ABSdrl SA6 ABSdrl SA6

    

3.0)} 2.35.

Figure 2.10- Northern analysis of luxAB expression in the SA6 and ABSdrl strains

29

AAAACATTACTACCCAAAAATGATTTTACCTTTGCCAAAACCAATATATTGTC
ACAGTATTCTATATTTTCTTGTAAAATAGCGATATATCTATAGCCAGATTTTTA
TCTCTATCTAGACCCAAAAAAAAATAGATTTATTATTTCTATCGGTGGATGCA
GGCGCATCAAGATATCATCTATCTTTGGTTTGGGAAAATAATAGAAGTGACTG
AAAAAATAGCTTAGTTTGCAAGAAGCAATTAGACAAAGAGTGAGTGTAACG
ATGAGTGAAATCAGCATTATTTTAATTGAAGATCATGACCTAACCAGAATGGG
GCTAAGAGCTGCGTTACAGGCCAACACTGGCATCAAAGTAATTGGTGAAGCG
GCTAACGCCACTCAAGGGCTGAAACTTTTGGAAACGGCGAAGCCGGATGTAG
CGGTGGTAGATATTGGCTTGCCGGACATGGATGGTATTGAACTCACTCGCAA
VGTTTAGGCGTTATCAAGCTGAGAGTGGGCAAACCCACACCAAGATTCTCAT
CCTGACAATGGATCATACCGAAGATGCGGTACTGGCGGCTTTTGCGGCTGGG
GCAGATTCTTACTACATGAAAGAAACCAGCATTAGTAGGCTAACAGAAGCAA
TTCAAGCTACTTTTGGTGGTAACTCATGGATTGATCCAGCGATCGCTAATGTA
GTATTACAGAAGATGCGCCAAGGCATCCCCGGAGAGAGCCAATCATCTGATA
AGCCCAAAACCGTCAAAATTGAGGCTCTGCCTTCTGAATACGAACAAGTATTA
GAAACCTACCCCCTTACACAACGGGAATTAGAAATTCTAGAGTTGATTGTTGC
TGGCTGTAGCAACGGTCAAATTGCGGAGAAACTTTATATTACTGTTGGTACGT
GCTTTGCGTTCTGGGTTAGTAGCTTAAACATGAAACCATAACGCACCTACCAA
AATTTAACACCCATACCCTAACCTTGGTTTCTCCGGCAATCAAGGTTTTAGCTT
TTTGCGCTAATTTCCTTAACGGTTATTACGGAATGGTTGCGAGTTGCTGAATA
ATTACCTTATAGCCCATCCACAGGTGTTAGAAGAGCTGCCATCATGCCAAACT
CCTGAGCGATAGGGTCTGCCAAGATAAGTAGTTGGTTCTGATGGTGAGAAATT

Figure 2.9- Nucleotide sequence at the site of the SA6 insertion. The start codon for the proposed start
codon and stop codon are in bold and the site of the Tn5-1063 insertion is marked by V.

 

30

similarity to response regulators from two-component regulatory systems. The closest
matches from the sequence databases were two hypothetical ORFS from the Synechocystis
genome and a response regulator which controls the expression of extracellular proteases in
Bacillus brevis (Louw et al., 1994) (Figure 2.12).
DISCUSSION
Analysis of proteins in stressed cultures of SA6 demonstrates that the expression of 1
multiple genes is affected by the SA6 insertion. There were, however, several salt-induced

proteins whose expression was unaffected in the SA6 mutant. This data indicates that

 

‘I'T

multiple signal transduction pathways regulate the expression of salt-induced genes in
Anabaena PCC 7120.

In the cyanobacterium Anabaena variabilis, the Iti2 transcript increases 40-fold
within an hour of a 16° C temperature downshift (Sato, 1992). The induction of the Iti2
gene by both cold and salt stresses raises some interesting questions about the regulation
and function of this gene. The expression of luxAB was analyzed by northern analysis in
the ABSdrl and SA6 mutants after a 14° C downshift. The increase in transcript levels was
only 3-fold with the temperature downshift. The induction of the lux AB gene by cold is
poor relative to the induction of Iti2 in Anabaena variabilis. This may indicate that this
gene is not induced by cold in Anabaena PCC 7120. Alternatively, if the accumulation of
In? is not transcriptionally regulated, the northern analysis of luxAB expression would not
properly reflect changes in the expression of this gene. In the cyanobacterium
Synechococcus, the induction of the desA and desB genes in response to cold is, in part,

due to changes in mRNA stability (Sakamoto and Bryant, 1997). This may also explain

31

 

   
           
    

1 ............. QANTSA6

1 DFTSPHRIKIEPCLpr/A‘x‘fl GAHESynl

1 1'5 ............. 15A 1!: 0 6.00 .TlfiE’ISynz

1 ‘----APE -------- Rm iApd‘QArfiv‘ Til-E‘fiLIis-sfi-AD Strep
1 N----EQ NEN---K?’lo UTEDDJQHFI EfiVKRI Aluéflaacinus
1 Aux ---------- litirtfiv'aarsr RIVHNLaK—ifii. CheY

 

I I l I

50 60 70 80

l
28 HIKE sautEATQcLKELxTAAPDdAfErDIGLPMDGIE1.5A6
41 *FEIIGRVDNGYGMQQAAVLRPDI INHDIGLPGLJJGISijnl
28 Siuwl'VGEAANGRLGLVHMQQ‘ZRPDVI‘I 1016.1.Ptmlriefl0v Syn2
28 EroszAWGisfiva ViaApnvarhonaumsLmqtmijscrep
34 EruoncsossNAJLLLJ—‘KYMIlefiNM’P‘Kvndrzflaacinus
29 EanufisujaofivoiLuxLQAcchrirsawNMmeLi- CheY

 

 

 

 
 
   

 

I j I T
90 100 110 120
I

68 hiKF-RMIfiESGQTHTEIEI ‘1. TMDHTMAMARFEJGiD SA6
81 'Kiar-g-1rrs, --- IHIVIVL'ASETIII PNEI iAaflss G DSan
68 _. —hK---cgcncncatl‘v1LILN'UQEET'VLAAESAGAD Syn2
68 TERILTGAPDAH ----- HFVLHLJ'I‘FDJIDUL. YMLuGAjStrep
74 051 ofi'ipov ------ .KVLvnsrianoflsyngvflKTcA Bacillus
53 ---kuLflTIRflDGAMSALPJuMVQAEAKKENIIlhhAQmGggAjCheY

I I 1 T

130 140 150 160

 

107 si'vn’x‘srsrcatl .AIQRTFqGGNSWIDPAIB‘IVVfiQKMflQ SA6
115ArcivchmLERLIL AIAAAQtiaArgiiancrAvavsuLxpsyn1
104 Adcu'ttdsaratc 1.1.1.1: 111—0.11" HhGFaNuPAIuIMAHAPGSynz
n
.-.t..-

 

 

 

 

 

 

103Er’fitixdv-Piflii \__AA_VRL1‘FRTGDA‘LLAPAJIT ------- IRRIStrep
108 G? LttcEMDADA 1.5: 5v1<va0mcatxiuaxerNL1Rsrmdaacuius
1osmvbr --------------------------------- -cner

I F I r

170 180 190 200
14751136 E“JDKPKTVKIEALPSEYEQEEEP‘LEO‘RELJI SA6
155 pittajcQonfsl --------------------- SUSIEREID’VESynl
144 Aauslpsupiarst --------------- SYGLTERBLE Syn2
136EjERHAErerAP--Nr ----- TAHRMQE--lLTiPIRBLEaStrep
148 NEDEEEEEEIGFKEV ----- EYRKPfiHI--1h_3RfiJCi§_fiBacillus
111 --------------------------------------- -CheY

r I V I

210 220 230 240
187i :1. il'Amcc SEGQIAuLtLramt’ ---------- _--5c'r---SA6
17411. 'L VITF-GTSNQIEIAQTLY sitari'iET'iivECEfzuiu'x"TsivID'nESyn1
169'LQLL30 GcsNAtJAEerITNGrvxravanrLRKLIAEIDRSynz
16711.01ch QGLSNAJLAEALtrsmrrvxruvlclaruAixuoLRDRisuep
immaturuRMLclAmaK'rvxnmsmrnoxMNELMEacnius
111 ------------------ ErAmLEEKLNKmEELflGM CheY

j

25:0
212---§FWVSSLNMKP SA6
214 it'd—i A {I 11? 1 537:1"! Synl
209 r'oAA.\£Ri_A.I.a.acL N Syn2
207I1_Qtiv;v_*riararisinqspx'rAc Strep
221 TMVWE SHK anm'x v R Bacillus
129 CheY

Decoration 'Decoration 81': Shade (with black at 40! till) residues that match the
Consensus exactly.

Figure 2.12- The deduced amino acid sequence of SA6 aligned with two hypothetical
ORFS from the Synechocystis genome (gi-l653479 and gi-1652813), an ORF from

Streptomyces lividans (gi-1498492), and the degU gene product from Bacillus brevis (Sp-p54662).

The CheY gene product from E. coli (gi-l736535) is also included, because the crystal structure
is known and is often used as a reference in defining critical (Volz, 1993).

32

the poor induction of the luxAB transcript by cold in the ABSdrl strain relative to the Iti2
transcript in Anabaena variablis.

The deduced sequence for the amino terminus of SA6 is similar to the sequence of
many response regulators. This domain interacts with the sensory kinase and is highly
conserved in other response regulators (Gross et al., 1989). The closest match from the
sequence databases is a Synechocystis ORF with unknown function (Kaneko et al., 1996).
It is uncertain wether this Synechocystis gene is a functional homolog of SA6. A potential
response regulator for salt stress responses in Synechocystis has previously been identified
(Hagemann et al., 1996), but shares only moderate sequence similarity with SA6. The
secondary structure predictions for the carboxy terminus of SA6 suggests a helix-loop-helix
DNA binding motif, which is found in other response regulators and is consistent with a
role in gene activation.

Other elements in the salt-induced signal transduction pathway have yet to be
identified. Since both ionic and and non-ionic osmotica induce the expression of ABS, the
sensory kinase regulating the expression of this gene may perceive changes in turgor. The
identification and characterization of the sensory kinase with the second-site mutagenesis
strategy would be useful for further studies.

REFERENCES

Allen MB, Amon D1 (1955) Studies on nitrogen-fixing blue-green algae. 1. Growth and
nitrogen fixation by Anabaena cylindrica Lemm. Plant Physiol. 30: 366-372

Anandan S, Nalty MS, Cogdell DE, Golden SS (1996) Identification of 2 classes of
transcriptional regulator genes in the cyanobacterium Synechococcus sp strain PCC 7942.
Arch Microbiol I66: 58-63

 

33

Apte SK, Bhagwat AA (1989) Salinity-stress-induced proteins in two nitrogen-fixing
Anabaena strains differentially tolerant to salt. J Bacteriol 171: 909-915

Apte S.K., Haselkorn R (1990) Cloning of salinity stress-induced genes from the salt-
tolerant nitrogen-fixing cyanobacterium Anabaena torulosa. Plant Mol Biol 15: 723-733

Black TA, Wolk CP (1994) Analysis of a Het' mutation in Anabaena sp. strain PCC 7120
implicates a secondary metabolite in the regulation of heterocyst spacing. J Bacteriol 176:
2282-2292

Campbell EL, Hagen KD, Cohen MF, Summers ML, Meeks JC (1996) The devR
gene product is characteristic of receivers of two-component regulatory systems and is

essential for heterocyst development in the filamentous cyanobacterium Nostoc sp. strain
ATCC 29133. J Bacteriol 178: 2037-2043

Chiang GG, Schaefer MR, Grossman AR (1992) Complementation of a
red-light-indifi‘erent cyanobacterial mutant. Proc Natl Acad Sci USA 89: 9415-9419

Close TJ, Lammers PJ (1993) An osmotic stress protein of cyanobacteria is
immunologically related to plant dehydrins. Plant Physiol 101: 773-779

Curry J, Walker-Simmons MK (1993) Sequence analysis of wheat cDNAs for abscisic
acid-responsive genes expressed in dehydrated wheat seedlings and the cyanobacterium,
Anabaena. In Plant Responses to Cellular Dehydration During Environmental Stress. Ed.
Close T.J., Bray E.A. American Society of Plant Physiologists, Rockville, MD

Elhai .1, Walk CP (1988) Conjugal transfer of DNA to cyanobacteria. Methods Enzymol
167:747-754

Fernandes TA, Iyer V, Apte SK(1993) Differential responses of nitrogen-fixing
cyanobacteria to salinity and osmotic stresses. Appl Env Micro 59: 899-904

Gross R, Aricb B, Rappuoli R (1989) Families of bacterial signal transducing proteins.
Mol Microbiol 3: 1661-1667

Hagemann M, Richter S, Zuther E, Schoor A (1996) Characterization of a
glucosylglycerol-phosphate-accumulating, salt-sensitive mutant of the cyanobacterium
Synechocystis sp. strain PCC-6803. Arch Microbiol 166: 83-91.

Hagemann M, Golldack D, Biggins J, Erdmann N (1993) Salt-dependent protein
phosphorylation in the cyanobacterium Synechocystis PCC 6803. FEMS Microbiol Lett
113: 205-210

34

Hagemann M, Zuther E (1992) Selection and characterization of mutants of the

cyanobacterium Synechocystis sp. PCC 6803 unable to tolerate high salt concentrations.
Arch Microbiol 158: 429-434

Haro R, Garciadeblas B, Rodriguez-Navarro A (1991) A novel P-type ATPase from
yeast involved in sodium transport. FEBS Lett 291: 189-191

Joset F, Jean jean R, Hagemann M (1996) Dynamics of the response of cyanobacteria to
salt stress: deciphering the molecular events. Physiol Plantarum 96: 738-744

Kamamaru K, Kashiwagi S, Mizumo T (1993) The cyanobacterium Synechococcus sp.
PCC 7942 possesses genes encoding cation-transporting P-type ATPases. F EBS Lett 330:
99-104

Mikkat S, Hagemann M, Shoor A (1996) Active transport of glucosylglycerol is involved
in salt adaptation of the cyanobacterium Synechocystis sp. PCC 6803. Microbiology 142:
1 725-1 732

Louw ME, Reid SJ, James DM, Watson TC (1994) Cloning and sequencing the

DegS-DegU operon from an alkalophilic Bacillus brevis. Appl Microbiol Biotechnol 42:
78-84

Maeda T, Wurgler-Murphy SM, Saito (1994) A two-component system that regulates
an osmosensing MAP kinase cascade in yeast. Nature 369: 242-245

Nagaya M, Aiba H, Mizuno T (1994) The .9th product, a two-component system
response regulator protein, regulates phosphate assimilation in Synechococcus sp. strain
PCC 7942 by binding to two sites upstream from the phoA promoter. J Bacteriol 176:
2210-2215

Pabo C0, Sauer RT (1992) Transcription factors: structural families and principles of
DNA recognition. Annu Rev Biochem 61: 1053-1095

Packer L, Spath S, Martin JB, Rory C, Bligny P (1987) 23Na and 3'P NMR studies of
the effects of salt stress on the freshwater cyanobacterium Synechococcus 6311. Arch
Biochem BiOphys 256: 354-361

Potts M (1994) Desiccation tolerance of prokaryotes. Microbiol Rev 58: 755-805

Reed RH, Richardson DL, Warr SRC, Stewart WDP (1984) Carbohydrate
accumulation and osmotic stress in cyanobacteria. J Gen Microbiol 130: 1-4

Reed RH, Stewart WDP (1988 ) The response of cyanobacteria to salt stress. Methods

35

Enzymol 167: 217-231

Sakamoto T, Bryant DA (1997) Temperature-regulated mRNA acumulation and
stabilization for fatty acid desaturase genes in the cyanobacterium Synechococcus sp. strain
PCC 7002. Mol Microbiol 23: 1281-1292

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning a laboratory manual.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Sato N (1992) Cloning of a low-temperature induced gene [(12 fi'om the cyanobacterium
Anabaena variabilis M3 that is homologous to alpha-amylases. Plant Mol Biol 18: 165-
170

Swanson RV, Alex LA, Simon MI (1994) Histidine and aspartate phosphorylation: two-
component systems and the limits of homology. Trends Biochem Sci 19: 485-490

Volz K (1993) Structural conservation in the CheY superfamily. Biochemistry 32: 11741-
11753

Wolk CP, Cai Y, Panoff J-M (1991) Use of a transposon with luciferase as a reporter to
identify environmentally responsive genes in a cyanobacterium. Proc Natl Acad Sci USA
88: 5355-5359

Wolk CP, Vonshak A, Kehoe P, Elhai J (1984) Construction of shuttle vectors capable
of conjugative transfer fi‘om Escherichia coli to nitrogen-fixing filamentous cyanobacteria.
Proc Natl Acad Sci USA 81: 1561-1565

36

Chapter 3
Biochemical characterization of the aba2 and aba3 mutants of Arabidopsis.
ABSTRACT
Abscisic acid (ABA) deficient mutants, in a variety of species, have been identified

by screening for precocious germination and a wilty phenotype. Two new mutants, aba2
and aba3, have recently been identified (Léon-Kloosterziel et al., [1996], Plant J 10: 655-
661). The biochemical characterization of these mutants is presented here. Protein
extracts from aba2 and aba3 plants displayed a greatly reduced ability to convert
xanthoxin to ABA relative to the wild type. The next putative intermediate in ABA
synthesis, ABA-aldehyde, was efficiently converted to ABA by extracts from aba2, but
not by extracts from aba3 plants. This indicates that the aba2 mutant is blocked in the
conversion of xanthoxin to ABA-aldehyde and aba3 is impaired in the conversion of
ABA-aldehyde to ABA. Extracts from the aba3 mutant also lacked several additional
activities which require a molybdenum cofactor (Moco). Nitrate reductase utilizes a
Moco but its activity was unaffected in extracts from aba3 plants. Moco hydroxylases in
animals require a desulfo moiety of the cofactor. Under anaerobic conditions, a sulfur
ligand can be added to the Moco by treatment with Na,S and dithionite. Treatment of
aba3 extracts with Na2S restored ABA-aldehyde oxidase activity. Therefore, the genetic

lesion in aba3 appears to be in the introduction of sulfur into the Moco.

37

INTRODUCTION

ABA is a sesquiterpenoid plant growth regulator involved in the induction of seed
dormancy and adaptation to a variety of stresses (Zeevaart and Creelman, 1988). The
regulation of these physiological processes is in part due to de novo synthesis of ABA.
Thus, an understanding of the ABA biosynthetic pathway and its regulation is essential for
an appreciation of the factors mediating plant stress responses. The characterization of
ABA-deficient mutants has been helpful in elucidating the biosynthetic pathway. For
example, the abaI mutant, which is impaired in the epoxidation of zeaxanthin and
antheraxanthin to Violaxanthin (Duckham et al., 1991; Rock and Zeevaart, 1991),
provided definitive evidence that ABA is derived from an epoxy-carotenoid precursor in
higher plants.

The first committed step in ABA biosynthesis appears to be the oxidative cleavage
of an epoxy-carotenoid precursor to form xanthoxin (Parry et al., 1988). Following the
cleavage reaction, xanthoxin is rapidly converted to ABA by a series of ring modifications
and the oxidation of the aldehyde to a carboxylic acid. Sindhu and Walton (1987)
proposed a pathway based upon feeding potential intermediates to a cell-free system and
monitoring their conversion to ABA. If a substrate was not efficiently converted to ABA
in the cell-free system it was considered an unlikely intermediate in vivo. The results from
these experiments suggest that the ring transformations occur first to produce ABA-
aldehyde and the oxidation of the aldehyde is the final step (Figure 3.1). During the
conversion of xanthoxin to ABA-aldehyde three modifications of the ring occur:

oxidation of the 4'-hydroxyl to a ketone, desaturation of 2'-3' bond, and opening of the

38

Zeaxanthin
abal t

Anthcraxanthln
abal

all-lmm-Vlolaxamhm

/ \

all-lrum-Neoxanthm c)-cn-V10|axanth1n

\

    

skis-Neoxanthin

ABA-aldehyde

 

aba3}
“c.
"on 5
(IX )H
AbsCIsic acid

Figure 3.1- Proposed pathway of ABA biosynthesis. The biochemical lesions in
the abaI, abaZ, and aba3 mutants of Arabidopsis thaliana are indicated.

(02“.

1."..‘3'3 _ ‘

DJ.

 

‘11"

39

epoxide ring.

Mutants that are impaired in the ring transformation have not yet been reported.
A number of mutants have been identified in the final step of ABA biosynthesis, the
oxidation of the aldehyde to the carboxylic acid (Taylor, 1991 ): flc and sit in tomato, dr in
potato, abaI in Nicotiana plumbaginifolia, and nar2a in barley. The narZa mutant in
barley was shown to lack ABA-aldehyde oxidase, xanthine dehydrogenase, and nitrate
reductase activities (Walker-Simmons et al., 1989). This pleiotropic phenotype is the
result of a lesion in the synthesis of the Moco, which all three enzyme activities require.
Surprisingly, precocious germination and a wilty phenotype have not been reported for
Moco mutants, cnx, in Arabidopsis thaliana. Presumably, the lesions in the Arabidopsis
mutants are sufficiently leaky to allow for normal ABA biosynthesis.

In tobacco, an ABA-deficient mutant lacking aldehyde oxidase and xanthine
dehydrogenase, but not nitrate reductase, has been identified (Leydecker et al., 1995).
The phenotype of the tobacco mutant may be explained by the existence of two forms of
the Moco in eukaryotes (Wahl and Rajagopalan, 1982). Moco hydroxylases, such as
xanthine dehydrogenase and aldehyde oxidase, use a desulfo form of the Moco, while
reductive dehydroxylases, such as nitrate reductase, utilize a dioxo form of the Moco.
The lesion in the barley nar2a mutant must occur at an early step in the pathway, so that it
affects both forms of the Moco. The lesion in the tobacco mutant appears to be in the
modification of the Moco to form the desulfo moiety. In Drosophila, a mutant impaired
in the "sulfiiration" of the Moco has been identified (Wahl et al., 1982).

The characterization of ABA-deficient mutants has been valuable in elucidating the

 

A A-Hn

‘F’I‘T‘I‘JA ‘__‘_

40

function of ABA and the pathway of ABA biosynthesis. The biochemical characterization
of two new mutants in Arabidopsis thaliana, aba2 and aba3 (Léon—Kloosterziel et al.,
1996), is described below.
MATERIALS AND METHODS
Plant Material.
Columbia (WT) and the mutants aba2-I (isolation J14) and aba3-1 (isolation J25) were
grown in a 9-hour photoperiod as previously described (Rock and Zeevaart, 1991).
Rosettes were frozen in liquid N2 and stored at -80°C until extraction.
Preparation of enzyme extracts.
Leaves were ground with a mortar and pestle in 0.2 M KPi, pH 7.5, containing 10 mM
DTT (3 mL/g leaf material). The extracts were filtered through four layers of cheesecloth
and centrifuged at 12,000g for 10 min at 4°C. Proteins were precipitated from the
supernatant with ammonium sulfate (80% saturation). The ammonium sulfate precipitate
was resuspended in 50 mM KPi, pH 7.5, and desalted on a PD-10 Size exclusion column
according to the manufacturer's instructions (Pharmacia).
Activity gels.
Extracts were subjected to native gel electrophoresis and aldehyde oxidase activities were
detected with the substrate heptaldehyde (Walker-Simmons et al., 1989). As previously
reported, xanthine dehydrogenase activity is difficult to detect in crude extracts from
Arabidopsis thaliana (LaBrie et al., 1992). However, the activity was easily detected on

activity gels when a 16%-32% ammonium sulfate fraction was analyzed.

 

41

Preparation of substrates.

Violaxanthin and neoxanthin isolated from spinach leaves were oxidized with ZnMnO4
(Taylor and Burden, 1972). Xanthoxin was then purified by normal phase HPLC on a
uPorasil semipreparative column (0.78 x 30 cm) (Waters). Xanthoxin was eluted with a
linear gradient of 10 to 100% (v/v) ethyl acetate in hexane in 72 min at a flow rate of 2.5
mL min". A xanthoxin fraction was collected from 39-42 min and dried under a stream
of N2. Xanthoxin was further purified by reverse phase HPLC on a uBondapak C18
semipreparative column (Waters) with a linear gradient of 10 to 60% (v/v) ethanol in
water over 40 min at 2.5 mL min". A fraction containing cis-xanthoxin was collected
from 23 to 25 min . The identity and purity of xanthoxin was confirmed by GC-MS of
the TMSi derivative (Gaskin and MacMillan, 1992). ABA-aldehyde was provided by
Hofl'mann-LaRoche.

Conversion of xanthoxin and ABA-aldehyde to ABA.
Enzyme assays contained 50 mM KPi, 0.25 mM EDTA, 1 mM PMSF, 1 mM NADP, and
the appropriate substrate in a total volume of 200 uL. Following a l-hour incubation at
28°C, 400 11L of acetone was added to stop the reactions. Proteins were pelleted by
centrifugation at 10,000g and [3H-]ABA was added to the supernatant as an internal
standard. The acetone was evaporated under vacuum, one mL of 2% acetic acid (v/v)
was then added to each sample, and ABA was partitioned three times into ethyl acetate.
The ethyl acetate fractions were pooled, dried under a stream of N2, and ABA was
methylated with diazomethane. Me-ABA was purified by normal phase HPLC (Creelman

et al., 1987) and analyzed on a Hewlett Packard 6890 GC equipped with an electron

42

capture detector. Samples were injected on a HP-S capillary column (Hewlett-Packard)
and chromatographed iso-thermally at 188°C. Quantitation of Me-ABA was performed
as previously described (Cornish and Zeevaart, 1985).

Analysis of ABA-alcohol in the aba3 mutant.
Plant tissue, 0.5 g dry weight, was extracted in 80% MeOH (aq). The methanol was
evaporated under vacuum and the remaining water was partitioned three times with diethyl
ether. The diethyl ether fractions contained ABA-alcohol, while the ABA-alcohol
glucoside remained in the aqueous phase. The glucoside was hydrolyzed with almond
glucosidase (Sigma) in 0.1 M KPi pH 4.7 and ABA-alcohol was partitioned into diethyl
ether. The ABA-alcohol from both fractions was injected on a normal phase HPLC
column equilibrated with 90:10 hexane and ethyl acetate. The column was eluted with a

gradient to 80% ethyl acetate over 25 min at 2.5 mL min "

. A fraction corresponding to
ABA-alcohol was collected at 24-25 min. and dried under a stream of N2 . ABA-alcohol
was analyzed by GC equipped with an electron capture detector.

Inactivation and reconstitution of ABA-aldehyde oxidase activity.
In extracts of WT Columbia, aldehyde oxidase activity was inactivated by treating extracts
with 20 mM KCN for one hour at room temperature. Following the incubation, CN' was
removed on a spin column, which was prepared by filling a 1 mL syringe with G-25
Sephadex equilibrated in 50 mM KPi, pH 7.5. For reactivation, extracts were made
anaerobic by degassing under vacuum and purging with anaerobic hydrogen several times.

Anaerobic solutions of dithionite and NaQS were added through a septum and the extracts

were incubated at 37°C for 30 min. Following the incubation dithionite and NaQS were

 

43
removed on a G-25 Sephadex Spin column and ABA-aldehyde oxidase activity was
assayed as described above.
Analysis of polar metabolites in the aba3 mutant.
Rosettes were frozen in liquid N2 and lyophilized. The tissue was extracted with 80%
MeOH containing BHT (0.1 g/ L). The MeOH was evaporated under vacuum and the pH
of the remaining aqueous portion was adjusted to 3.5 with acetic acid. The extract was
then partitioned three times with an equal volume of diethyl ether. The aqueous phase
was concentrated under vacuum, filtered through a 0.45 pm HA filter (Millipore), and
injected on a semipreparative (0.78 x 30 cm) uBondapak Cl8 HPLC column (Waters).
The column was eluted with a linear gradient of O to 50% (v/v) ethanol in water over 35
min at a flow rate of2.5 mL min ".
RESULTS
Conversion of xanthoxin and ABA-aldehyde to ABA by cell-free extracts.

Previous work (Léon-Kloosterziel et al., 1996) has shown that the aba2 and aba3
mutants are ABA-deficient. Analysis of total carotenoids in aba2 and aba3 indicated no
variation when compared to the WT (Figure 3.2). This indicates that both mutants are
impaired in the later steps of ABA biosynthesis. Cell-free extracts of Arabidopsis thaliana
were prepared to monitor the conversion of xanthoxin to ABA. The requirements for
activity were similiar to those reported for cell-free preparations from other species
(Sindhu and Walton, 1987). NADP was the only cofactor necessary for activity. DTT,

glutathione, or cysteine enhanced the conversion of xanthoxin to ABA but were omitted

from the assays, because they caused the non-enzymatic cis, trans isomerization of

-_u_ ‘Qh‘.m‘l“

 

44

.mEEwSanEo 2:
328:2: 2a c_£§xoo=-m.8.o 2.8 $08 :_5§xa_o_>-n.8-a .353 menu can .Nuac £38200 H3 2: mo £9335 20:08.30 -N.m 03w:—

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

8 .52 1o 8 w .52 - b ow .52 o_
1.2. 15.11,; 1:133”
5.. a.

. . “ Km
4 _a . m
m
m
m

28 28 28
menu «new . 1 as
_ .

 

 

 

 

 

 

 

 

 

 

45

xanthoxin (data not shown). No variation in activity was observed when extracts were
made fiom turgid or dehydrated leaves (Table 3.1).

The conversion of xanthoxin to ABA by aba2, aba3, and WT extracts was
measured as a function of protein concentration (Figure 3.3). Cell-free extracts fiom the
two mutants, aba2 and aba3, showed a substantially reduced ability to convert xanthoxin
to ABA. ABA-aldehyde was also fed to cell-free extracts to monitor its conversion to
ABA. Extracts of aba2 converted ABA-aldehyde to ABA as efliciently as WT extracts
(Figure 3.4). No ABA was detected in assays with extracts from aba3 plants at the
protein concentrations indicated in figure 3.4. Tobacco and tomato mutants, which are
unable to oxidize ABA-aldehyde to ABA accumulate trans -ABA-alcohol and a glucoside
of trans-ABA-alcohol (Linforth et al., 1987; Leydecker et al., 1995). The flc and sit
mutants of tomato (Taylor et al., 1988) and the dr mutant in potato are capable of
converting exogenous cis-ABA-aldehyde to these compounds (Duckham et al., 1989).
The aba3 mutant also accumulates trans-ABA-alcohol and the gluco side of trans-ABA
alcohol (Figure 3.5). In wild type Columbia, trans-ABA-alcohol was also detectable, but
at much lower concentrations than in aba3 plants (data not shown).

The aba3 mutant has a pleiotropic phenotype.

The lesion in aba3 may result from a mutation in the apoprotein which converts
ABA-aldehyde to ABA or in an enzyme involved in the synthesis of the Moco ( Walker-
Simmons et al., 1989; Leydecker et al., 1995). The activities of aldehyde oxidase,
xanthine dehydrogenase, and nitrate reductase, which all require a Moco, were measured

in extracts from WT Columbia and aba3 plants. Aldehyde oxidase activity was tested on

46

Table 3.1- The conversion of xanthoxin (100 ng per assay) to ABA (ng) by cell-free
extracts of turgid and stressed leaves.

7 Protein

—-!'--!ll
6.04:1.2 7.69i1.0 '
55.712

7511.2

     
 

 

Turgid

     
 

 

     

Stseresd

Table 3.2- Nitrate reductase activity (nmol NOZ‘ min " mg protein" 1: SD.) in WT
Columbia and aba3 extracts.

    

Genot ‘0‘ fl Nitrate reductase activi
270.9 .
_-14.5 .

 
     

 

47

 

25

ABA (ng)

 

 

 

 

0 500 1000 1500 2000 2500
Protein (pg)

Figure 3.3- Conversion of xanthoxin to ABA by protein extracts from
WT Columbia, abaZ, and aba3 plants. 100 ng of xanthoxin was added per assay.

48

 

1‘74

—<

ABA (ng)
8
. g
8
\

20 /
.0- /

 

 

0 50 100 150 200 250 300
Protein (pg)

Figure 3.4- Conversion of ABA-aldehyde to ABA by protein extracts of
WT Columbia, abaZ, and aba3 plants. 50 ng of ABA-aldehyde was added per assay.

49

6.5233 3:20.32 a ma «am—$3506

1382 .23 38? as .2 82 .8 a: _ 832882» .23 8%er .28.a
-<m<-n§.= 2:125 .3356 35.8%.. a ma page 33 «Ear—>52: 43w; 2: ”DO 05
co 338? 33 A: _ can J: can 5 3203:. 83 shutout $5.... 1386 2: 8.5 .0383
Lea—«rash A3 3532: mace 05 E _o:oa_a.<m<-m§.e mo coca—38:03 2:. -m.m 2sz

O

VH .QHZ

O

«a ucHz

 

 

 

 

dmd axnume ¢m< a>zuws

 

teubts 033

Honooamu<m¢ mcmhu

 

Honooamemd mcmfiu

A ooflmoooam Hozooamndmd Honooamummd

m <

 

 

 

50

aba3 aba2 WT

 

Figure 3.6- Aldehyde-oxidase activity gel with protein extracts of WT Columbia, abaZ,
and aba3 (80 ug of protein was loaded per lane). The aldehyde oxidase activities are
indicated with arrows. The most intense band (at the top of the gel) is a staining artifact,
which also occurs in the absence of the heptaldehyde substrate.

51

an enzyme activity gel using heptaldehyde as substrate (Figure 3.6). Both Columbia and
aba2 extracts contained three activities capable of oxidizing heptaldehyde. All three
aldehyde oxidase activities were absent in aba3 extracts. Likewise, xanthine
dehydrogenase was not detectable in extracts from the aba3 mutant in an activity gel
(Figure 3.7). The activity of nitrate reductase, which was measured according to Wray
and F ilner (1970), was not affected in aba3 extracts (Table 3.2).

During the process of purifying trans-ABA-alcohol a large UV absorbing peak,
unique to aba3, was observed on HPLC chromatograms (Figure 3.8). The accumulation
of this compound, which has not been identified, is another example of the pleiotropic
phenotype of the aba3 mutant.

The pleiotropic phenotype of aba3 results from a defect in Moco biosynthesis. In
eukaryotes, a dioxo and a desulfo moiety of the Moco have been identified (Wahl and
Rajagopalan, 1982). Nitrate reductase activity is unaffected in the mutant; suggesting that
only one form of the Moco is absent. The two forms of the Moco can be chemically
converted fiom one to the other (Wahl and Rajagopalan, 1982). Treatment with CN' will
hydrolyze the sulfiir ligand. Under strictly anaerobic conditions a sulfur ligand may be
added to the Moco by treatment with dithionite and NaZS. Extracts of WT Columbia
incubated with CN‘ resulted in the inactivation of ABA-aldehyde oxidase activity, which
could subsequently be restored by treatment with NaQS (Figure 3.9). The activity of
ABA-aldehyde oxidase in aba3 could be activated by treating extracts with dithionite and

NaZS.

52

WT aba3

Figure 3.7- Xanthine dehydrogenase activity gel with protein extracts of WT Columbia
and aba3: 50 ug of a l6-32% ammonium sulfate fraction were loaded per lane.

53

3:33: Menu 05 E noun—assoc.“ 320 3023 25888 a 8:865 32.8 2.... .mcce
can 23 8200 #3 89¢ 3652: new £3.22: 33 38.58 252.3 mo EEwofiEE§ 0.5: emanaéegom -3” 2:3“.

 

is. .8: 5:53. 3...: 2.... 5:55.

Infill all (i . i ll . OID'DrID '1‘ vitilro. 711.1111: I
- .11.... .l / L . a. _

 

 

 

 

 

 

 

 

 

ucmuoaqv

 

 

 

 

 

 

 

88 as 2;

 

 

 

 

 

 

 

 

 

 

54

 

 

 

 

 

 

 

 

 

7o -
60 - i
50 i
A ‘0 " 1g & i
E
a 30 3 «a
20 +— iW‘ 1
1o - (*1:
,. ND.
0 7"“ r
W M M
Treatment: CN'

 

Figure 3.9- Inactivation of ABA-aldehyde oxidase activity in WT Columbia with KCN
and reconstitution of activity in aba3 by treatment with Nazs and dithionite. ND. (not detected).
50 ng of ABA-aldehyde was added per assay.

. ‘ '- -u.:wln L.“

 

55

DISCUSSION
The biochemical lesions in the abaZ and aba3 mutants of Arabidopsis thaliana
were identified by feeding potential ABA precursors to cell-flee extracts and monitoring
their conversion to ABA. Both the aba2 and aba3 mutants are impaired in the later steps
of ABA biosynthesis.

The aba2 mutant was unable to convert xanthoxin to ABA, but did convert ABA-
aldehyde to ABA. Thus, aba2 represents a novel mutant impaired in the ring
modifications of xanthoxin to produce ABA-aldehyde. Chemical oxidation of the ring
hydroxyl with pyridinium chlorochromate is sufficient for the quantitative conversion of
xanthoxin to ABA-aldehyde (Schwartz and Zeevaart, unpublished results), indicating that
the ring modifications results from a Single enzymatic step and subsequent rearrangements.
Therefore, a single enzyme converts xanthoxin to ABA-aldehyde and any additional
mutants identified at this step Should be allelic to aba2.

The previously identified abaI mutant in Arabidopsis thaliana and the newly
isolated aba3 mutant have pleiotropic phenotypes, which are in part independent of their
ABA deficiency (Rock et al., 1991; unpublished observation). The abaZ mutant may be
useful for studying the physiological role of ABA, because the mutation appears to be
specific for ABA biosynthesis.

The aba3 mutant was unable to oxidize ABA-aldehyde to ABA. Lesions at this
step may result from a defect in the aldehyde oxidase apoprotein or the Moco, which the

aldehyde oxidase requires (Walker-Simmons et al., 1989; Leydecker et al., 1995).

56

Previously characterized eukaryotic Moco hydroxylases, such as xanthine dehydrogenase
and aldehyde oxidase, require a desulfo moiety of the Moco (Wahl and Rajagopalan,
1982). Xanthine dehydrogenase and three aldehyde oxidase activities were absent in aba3
extracts. The aba3 mutant also accumulated large quantities of an unidentified, polar
compound, which may be due to the loss of a Moco requiring enzyme. Nitrate reductase
utilizes a variant form of the Moco, which does not contain a sulfur ligand, and its activity
was unaffected in the aba3 mutant. The activity of xanthine dehydrogenase in the ma-I
mutant of Drosophila could be reconstituted by treatment of extracts with dithionite and
NaZS, which results in the addition of sulfur to the Moco (Wahl et al., 1982). The
inactivation of WT Columbia extracts with CN' and the subsequent re-activation with
N328 suggests that ABA-aldehyde oxidase activity requires a desulfo moiety of the Moco.
Treatment of extracts of aba3 with dithionite and N318 resulted in the activation of ABA-
aldehyde oxidase activity. Therefore, the genetic lesion in aba3 appears to affect the
introduction of a sulfur into the Moco (Figure 3.10).

The characterization of ABA-deficient mutants has been useful in elucidating the
pathway of ABA biosynthesis. In Arabidopsis multiple alleles of abaI have been
identified (Koomneef et al., 1982) and there are now two new mutants impaired in the
later steps of ABA biosynthesis. No mutants have been reported in the cleavage reaction,
which may be the key regulatory step in the pathway. Mutants impaired in the cleavage
reaction may not be viable or the existence of multiple isozymes may make it dificult to
identify these mutants. However, the apparent lability and low abundance of the cleavage

enzyme make it unlikely that the activity can be purified by classical biochemical methods.

57

H
2.
HN ! —(g-CHOH-—CH20PO3
HZN
H Nitrate reductase form
0 O
Na 2S _
+ 01303 CN
Dithionite
H 2
{ —(i-CHOH-—CH20PO3
S
“2 \
H )4 Moco hydroxylase form
3 0

Figure 3.10- The chemical modification ofthe Moco and the proposed genetic lesion in the aba3 mutant.

 

58

The search for additional mutants may be usefiJl in the characterization of this step.
REFERENCES

Cornish K, Zeevaart JAD (1985) Abscisic acid metabolism in relation to water stress
and leaf age in Xanthium strumarium. Plant Physiol 76: 1029-1035

Creelman RA, Zeevaart JAD (1984) Incorporation of oxygen into abscisic acid and
phaseic acid from molecular oxygen. Plant Physiol 75: 166-169

Creelman RA, Gage DA, Stults JT, Zeevaart JAD (1987) Abscisic acid biosynthesis in
leaves and roots of Xanthium strumarium. Plant Physiol 85: 726-732

Duckham SC, Taylor IB, Linforth RST, Al-Naieb RJ, Marples BA, Bowman WR
(1989) The metabolism of cis-ABA-aldehyde by the wilty potato, pea and Arabidopsis
thaliana. J Exp Bot 40: 901-905

Duckham SC, Linforth RST, Taylor 1B (1991) Abscisic acid-deficient mutants at the
aba gene locus of A rabidopsis thaliana are impaired in the epoxidation of zeaxanthin.
Plant Cell Environ 14: 601-606

Gaskin P, MacMillan J (1992) GC-MS of Gibberellins and Related compounds:
Methodology and a Library of Reference Spectra. Cantock's Press, Bristol, UK

Koornneef M, Joma ML, Brinkhorst-van der Swan DLC, Karssen CM (1982) The
isolation of abscisic acid (ABA) deficient mutants by selection of induced revertants in
non-germinating gibberellin-sensitive lines of Arabidopsis thaliana (L) Heynh. Theor Appl
Genet 61: 385-393

LaBrie ST, Wilkinson JQ, Tsat YF, Feldman KA, Crawford NM (1992)
Identification of two tungstate-sensitive molybdenum cofactor mutants, ch12 and ch17, of
Arabidopsis thaliana. Mol Gen Genet 233: 169-176

Léon-Kloosterziel KM, Alverez-Gil M, Ruijs GJ, Jacobsen SE, Olszewski NE,
Schwartz SH, Zeevaart JAD, Koornneef M (1996) Isolation and characterization of
abscisic acid-deficient Arabidopsis mutants at two new loci. Plant J 10: 65 5-661

Leydecker M-T, Moreaux T, Kraepiel Y, Schnorr K, Caboche M (1995)
Molybdenum cofactor mutants, specifically impaired in xanthine dehydrogenase activity

and abscisic acid biosynthesis, Simultaneously overexpress nitrate reductase. Plant Physiol
107: 1427-1431

Linforth RST, Bowman WR, Griffin DA, Marples BA, Taylor [B (1987) 2-Irans-

59

ABA-alcohol accumulation in the wilty tomato mutants flacca and sitiens. Plant Cell
Environ 10: 599-606

Parry AD, Neill SJ, Horgan R (1988) Xanthoxin levels and metabolism in the wild-type
and wilty mutants of tomato. Planta 173: 397-404

Rock CD, Zeevaart JAD (1991) The aba mutant of Arabidopsis thaliana is impaired in
epoxy-carotenoid biosynthesis. Proc Natl Acad Sci USA 88: 7496-7499

Rock CD, Bowlby NR, Hoffman-Benning S, Zeevaart JAD (1991) The aba mutant of
Arabidopsis thaliana (L.) Heynh. has reduced chlorophyll fluorescence yields and reduced
thylakoid stacking. Plant Physiol 100: 1796-1801

Sindhu RK, Walton DC (1987) The conversion of xanthoxin to abscisic acid by cell-free
preparations from bean leaves. Plant Physiol 85: 916-921

Taylor [B (1991) Genetics of ABA synthesis In Davies, WJ and Jones, HG (eds),
Abscisic Acid, Physiology and Biochemistry. Bios Scientific, Oxford, UK, pp 23-25

Taylor IB, Linforth RST, Al-Naieb RJ, Bowman WR, Marples BA (1988) The wilty
mutants flacca and sitiens are impaired in the oxidation of ABA-aldehyde to ABA. Plant
Cell Environ 11: 739-745

Taylor HF and Burden RS (1972) Xanthoxin, a recently discovered plant growth
inhibitor. Proc R Soc London Ser B 180: 317-346

Wahl RC, Warner CK, Finnerty V, Rajagopalan KV (1982) Drosophila
melanogaster ma-I mutants are defective in the sulfuration of desulfo Mo hydroxylases. J
Biol Chem 257: 3958-3962

Wahl RC, Rajagopalan KV (1982) Evidence for the inorganic nature of the
cyanolyzable sulfur in molybdenum hydroxylases. J Biol Chem 257: 1354-1359

Walker-Simmons M , Kudrna DA, Warner RL (1989) Reduced accumulation of ABA

during water stress in a molybdenum cofactor mutant of barley. Plant Physiol 90:
728-733

Wray J, Filner P (1970) Structural and functional relationships of enzyme activities
induced by nitrate in barley. Biochem J 119: 715-725

Zeevaart JAD, Creelman RA (1988) Metabolism and physiology of abscisic acid. Annu
Rev Plant Physiol Plant Mol Biol 39: 439-473

60
Chapter 4

VP14 catalyzes the carotenoid cleavage reaction of abscisic acid biosynthesis.
ABSTRACT
The plant growth regulator abscisic acid (ABA) is formed by the oxidative
cleavage of an epoxy-carotenoid. This is the first committed reaction in ABA biosynthesis
and is believed to be a key regulatory step. The reaction is of general interest, because
the synthesis of other apocarotenoids, such as vitamin A in animals, may occur by a similar
mechanism. However, carotenoid cleavage reactions remain controversial, due to
difficulties in demonstrating the activities in vitro. A new ABA-deficient mutant of maize
has been identified and the corresponding gene, VP14, has been cloned. Here, it is shown
that the recombinant VP14 protein catalyzes the cleavage of 9-cis-epoxy-carotenoids to
form C25 apo-aldehydes and xanthoxin, a precursor of ABA in higher plants. This is the

first carotenoid cleavage enzyme to be cloned and characterized fiom any organism.

61
INTRODUCTION

Apocarotenoids, compounds derived from the oxidative cleavage of carotenoids,
are widely distributed in nature and have important metabolic and hormonal fimctions in
diverse organisms. In Mucoraceous fungi, the hormone trisporic acid is a mediator of
sexual processes (Bu’Lock, 1983). Retinal serves as a photosensory pigment in animals

(Wald, 1968), green algae (Foster et al., 1984), and Halobacterium (Bibikov et al., 1993).

.4I ' .'_ E. T‘-‘luw

Retinoids, vitamin A derivatives, are morphogens in animals (Giguere et al., 1987) and
have clinical applications for cancer prevention and treatment (Hofiinan, 1992; Comic et
al., 1994). L
Apocarotenoids may be formed by random cleavage due to photo-oxidation or
lipoxygenase co-oxidation. However, regulating the synthesis of biologically active
apocarotenoids may require a more precise mechanism for their synthesis. Enzymatic
cleavage of carotenoids at a Specific position of the polyene chain has been proposed for
the synthesis of several apocarotenoids. The most definitive illustration of enzymatic
cleavage is the production of B-cyclocitral (Clo) from B-carotene by the cyanobacterium
Microcystis (Jiittner and Hfiflacher, 1985). In other organisms, however, such enzymatic
cleavage of carotenoids has been diflicult to demonstrate in vitro. For this reason, the
cleavage reaction in vitamin A biosynthesis remains controversial. Central cleavage of B-
carotene by a 15,15'-dioxygenase to produce two molecules of retinal has been reported
(Goodman et al., 1967; Olson, 1993). However, there is also evidence for excentric
cleavage of B-carotene. Following cleavage, additional carbons are removed from the

larger product, by a mechanism similar to B-oxidation, to form one molecule of retinoic

62
acid (Gerber and Simpson, 1990; Wang et al., 1992).

ABA is a plant growth regulator involved in the induction of seed dormancy and
adaptation to various stresses, such as drought (Zeevaart and Creelman, 1988). A loss of
cell turgor during desiccation results in the rapid synthesis of ABA. The elevated levels of
ABA are, in part, responsible for stomatal closure, changes in gene expression, and other
plant adaptations to stress.

Since the elucidation of the structure of ABA, a biosynthetic derivation from
carotenoids has been proposed (Taylor and Smith, 1967). There is now biochemical and
genetic evidence to support this hypothesis. Labeling experiments with '80, suggest that
ABA is synthesized from a large precursor pool, which already contains two of the four
oxygens found in the molecule (Creelman and Zeevaart, 1984). Oxygen derived from a
hydroxyl and epoxide of neoxanthin or Violaxanthin (Figure 4.1) could account for the
observed 18O labeling pattern. In addition, when etiolated bean seedlings are stressed
there is a decrease in the level of these xanthophst and a corresponding increase in ABA
and its catabolites (Li and Walton, 1990).

Direct evidence for a cleavage enzyme in ABA biosynthesis is lacking, due to the
apparent low abundance and labile nature of the enzyme. Development of an in vitro
assay has also been hindered by the presence of lipoxygenases and peroxidases, which
oxidatively cleave carotenoids in a non-specific manner. Several features of the cleavage
reaction have been inferred by analysis of the later steps in ABA biosynthesis (Figure 4.1).
The initial Cl, cleavage product, xanthoxin, is rapidly converted to ABA in vivo and in

vitro (Sindhu and Walton, 1987). In cell-free extracts, trans-xanthoxin is converted to

63

HO

     
  

9-cLs-Violaxanthin

 

O

I
I

 

Xanthoxin
H .
.s' "OH
OH HO (‘25allenic apo-aldehydc
C 2 5 epoxy ape-aldehyde 1 AB A-al dehy de

 

ABA

Figure 4.1- The proposed pathway of ABA biosynthesis in higher plants.

 

64
trans-ABA, indicating there is no cis/trans isomerization following cleavage (Sindhu and

Walton, 1987). Thus, the xanthophyll precursor must have a 9-cis configuration to
produce cis-xanthoxin and subsequently ABA, which is biologically active only in the cis
form.

ABA biosynthetic mutants impaired at several steps in the pathway have been
identified (Taylor, 1991). In maize, mutants with lesions in the early steps of carotenoid
biosynthesis are ABA-deficient and have a viviparous phenotype. The aba] mutant in
Arabidopsis thaliana (Rock and Zeevaart, 1991; Duckham et al., 1991) and the aba2
mutant in Nicotiana plumbagim’folia (Marin et al., 1996) are impaired in the epoxidation
of zeaxanthin and antheraxanthin to Violaxanthin. A mutant in tomato, notabilis, may
contain a lesion in the cleavage step (Parry et al., 1992). However, the difficulties of map-
based cloning in tomato make this mutant of limited utility.

MATERIALS AND METHODS

Preparation of carotenoid substrates.
Spinach leaves were homogenized with a Waring blender in 100. mM phosphate buffer, pH
7.5. The homo genate was filtered through four layers of cheese cloth and centrifuged at
4,000 g to sediment the thylakoid membranes. Thylakoid membranes were saponified for
three hours with a 10% solution of KOH (w/v) in methanol. Following saponification the
carotenoids were partitioned into diethyl ether. The carotenoids were then resolved on a
semiprep uPorasil HPLC column (30 x .078 cm) (Waters) eluted with a linear gradient of
10% ethyl acetate in hexane to 100% ethyl acetate over 72 min. The aba] mutant of

Arabidopsis thaliana was used as a source for all-trans-zeaxanthin, which was isomerized

 

65
with iodine (Zechmeister, 1962) and re-chromatographed to isolate 9-cis-zeaxanthin.

Enzyme assays.

VP14 was expressed as a GST-fiasion protein. The recombinant protein was adsorbed to
glutathione Sepharose and the VP14 protein was released by cleavage with thrombin
according to the manufacturer's instructions (Phamiacia). Enzyme assays contained 100
mM BisTris buffer pH 6.7, 0.05% Triton X-100, 10 mM ascorbate , 5 uM FeSO4, I
mg/ml catalase, and recombinant VP14 protein. Assays were performed at 22-24°C in a
total volume of 100 uL. The appropriate substrate was added in 3 uL ethanol. The
enzyme assay and all subsequent procedures were performed under red light to minimize
photo-oxidation of the precursors and products.

Identification of reaction products by mass spectromety.
The cleavage products were analyzed on a JEOL AX 505 double focusing mass
spectrometer, equipped with a 5890 Hewlett Packard capillary gas chromatogram, using
electron ionization at 70 eV. The trimethylsilyl derivative of xanthoxin was injected on a
DB-SMS capillary column (J&W Scientific). The column was held at 100° C for 1 min.,
heated to 230° C at 40° C min", and then at 8° C min" to 300° C. The C25 apo-aldehydes
were introduced via a direct insertion probe heated from ambient temperature to 200°C at
64°C min". The CI, cleavage product from zeaxanthin was analyzed as described above
except that the probe was heated at 2° C min“. Exact mass measurements were
performed as described above with the exception that the instrument's mass resolution was
increased from 1000 to 7500. Perfluorokerosene was introduced simultaneously with the

sample to provide reference ions to interpolate the exact mass assignments for sample

66
ions.

Quantitative analysis of reaction products.
Following the incubation, 1 mL of H20 was added to the reactions to dilute the detergent.
The assays were then partitioned three times into an equal volume of ethyl acetate with

vigorous stirring on a vortex-mixer. The ethyl acetate fractions were pooled, dried, and

 

methyl ABA was added as an injection standard. The samples were stored under Ar at - 5‘
80°C until analysis. Samples were injected on a uPorasil column (Waters) (30 x 0.4 cm)

equilibrated with 90% hexane and 10% ethyl acetate. The column was eluted with a linear

gradient to 20% hexane and 80% ethyl acetate over 15 minutes. A standard curve was i

constructed by injecting known quantities of the compounds analyzed and integrating the
peak area. The integrated peak area of methyl-ABA was used to correct for variations in
injections. The correlation coefficients were generally greater than 0.99.
RESULTS AND DISCUSSION

Characterization of the va4 mutant.

A new viviparous mutant in maize, va 4, has recently been identified (Tan et al.,
1997). Viviparous mutants may result from a lesion in ABA biosynthesis or signal
transduction (McCarty, 1996). Measurement of ABA levels in va4 embryos indicate that
the mutant is impaired in ABA biosynthesis (Table 4.1). Homozygous va4 plants have a
slightly wilty phenotype (Tan et al., 1997), which may also be accounted for by reduced
ABA levels (Table 4.2).

There are some qualitative variations in the carotenoid composition of mutant

embryos when compared to the wild type (Figure 4.2). Most notably, the level of

67

Table 4.1. ABA levels (ng/g F W), measured according to Leon-Kloosterziel et al., 1997, in
embryos l6, l8, and 20 days after pollination (DAP).

 

 

 

 

 

 

“‘5: , 5‘ -

Table 4.2- ABA levels (ng/g FW) in turgid and wilted leaves of the wild type and va4 mutant.

7.32.3.5 9.6i2.0
1-730*20,-4 - - - ,, _97-3*3-1

 

 

68

 

 

 

 

 

 

 

 

 

 

 

 

 

 

A B Z
z atV
atV
E
E
3
2
9cN
9cV
9cV ch
Time

Figure 4.2- Carotenoid composition of WT and va4 embryos. 9-cis-violaxanthin (9cV),
9-cis-neoxanthin (9cN) and zeaxanthin (Z) are indicated on the chromatogram.

69
zeaxanthin is higher in wild type embryos. Zeaxanthin is the most abundant carotenoid in

embryos, but is virtually undetectable in leaves. Therefore, decreases in zeaxanthin would
be expected with precocious germination The efficient conversion of xanthoxin to ABA
by cell-free extracts of the mutant (Table 4.3), indicates that the later steps in the pathway
are not impaired in va4.

The in vitro cleavage of carotenoids by recombinant VP14 protein.

The gene corresponding to the va4 mutant has been cloned (Tan et al., 1997) The
derived amino acid sequence of VP14 (Tan et al., 1997) shows significant sequence
similarity to lignostilbene dioxygenases (LSDs) from Pseudomonas paucimobilis (Kamoda
and Saburi, 1993). The LSDs catalyze a reaction similar to the proposed cleavage
reaction in ABA biosynthesis. Specifically, a double bond is oxidatively cleaved, yielding
two products with aldehyde groups at the site of cleavage (Figure 4.3).

Using 9-cis-violaxanthin as substrate, the recombinant VP14 protein was tested for
cleavage activity and the products were analyzed by HPLC (Figure 4.4). The expected
cleavage products, xanthoxin and the C25 epoxy apo-aldehyde, were identified by their
UV/V IS absorption spectra and mass spectra. The spectrum of xanthoxin was similiar to
a previously reported spectrum (Gaskin and McMillan, 1992).

The spectra of the C25 allenic apo-aldehyde (3,5-dihydroxy-6,7-didehydro-12'-apo-
B-caroten-12'-al): m/z (relative intensity): 382 [M]+ (100), 364 (20), 346 (18), 331 (9),
285 (27), 275 (7), 267 (22), 247 (18), 233 (67) 221 (24), 211 (50), 207 (36), 197 (43),
167 (83), 145 (71), 119 (33), 105 (68), 91 (86).

The spectra of the C25 epoxy apo-aldehyde (5,6-epoxy-3-hydroxy-12'-apo-B-

70

Table 4.3- Conversion of xanthoxin to ABA by cell-free extracts of wild type (NS-2274) and va4
mutant. Assays contained 100 pg protein, NADP, EDTA,PMSF, and 100 ng xanthoxin.

 

 

 

 

71

OH
OCH 3 OCH3
02
CH-==CH—COOH CH_CH—COOH

Figure 4.3- The reaction catalyzed by the lignostilbene dioxygenase (LSD) from Pseudomonas paucimobilis .

72

 

jg Cstpoxy apo-aldehyde

Absorbance

Xanthoxin
a 9-cis—V‘iolaxanthin
l

 

i

i

Methyl-ABA E
' i

i

I

 

 

 

5 {o {5 20

 

 

 

Figure 4.4- HPLC chromatogram of the cleavage reaction products using 9-cis-
Violaxanthin as substrate. Absorbance was measured at 436 nm and 285 nm with
a photodiode array detector.

73
caroten-12'-al): m/z (relative intensity): 382 [Mr (100), 364(10), 302 (45), 287 (28), 234

(13), 221 (29), 207 (35), 173 (47), 159 (39), 145 (49), 135 (57), 119 (50), 105 (54), 91
(59).

The fragmentation patterns for the epoxy- and allenic- C25 cleavage products were
nearly identical to published spectra for these compounds (Molnar and Szabolcs, 1979;
Parry and Horgan, 1991). The theoretical mass of the isomeric C25 cleavage products
from neoxanthin and Violaxanthin (C25H34O3) is 382.2508. The measured mass of the C25
product from neoxanthin was 382.2498 with an error of -2.6 ppm from the calculated
mass. The measured mass of the C25 product fiom Violaxanthin was 382.2501 with an
error of -1 .8 ppm.

Molecular oxygen (co-substrate), ferrous iron, and a detergent were all necessary
for the cleavage activity (Table 4.4). The detergent was probably necessary for
dispersion of the hydrophobic carotenoids. Catalase resulted in a slight increase in
xanthoxin, possibly by reducing the non-enzymatic degradation of the substrate by a
Fenton reaction (Chevion, 1988). A number of organic cofactors were initially added to
the assays, but none had any effect on the activity (data not shown).

The cleavage reaction was totally inhibited by EDTA, 3 chelator of divalent cations
(Table 4.5). Upon removal of the EDTA, the addition of equimolar concentrations of Fe2+
and the VP14 protein gave maximal activity; indicating tha the enzyme utilizes a single
F e2+ ion (data not shown). Because ferrous iron was necessary for activity, ascorbate was
also added to the assays to maintain iron in the proper redox state. The divalent cations,

such as addition of Ca2+, Mn 2+, Mg 2+ had no effect on the activity. Both ZnCl2 and

Nu: .mm a .6855 m:
3.5 0383.26 82

74

.. .nd
¢_Hmvm
mmflamh

.fid + +

 

 

 

 

 

 

 

 

o—flmcw +

+ +
EHIEE 3......

 

.88: _g>8
a: .23 $593 28 8:323 .625 3288. 05 wfimmawoc ,3 335820 was 3mg 330a 2.5 w: e 93 he in 5&3 mt... mmm 28 2: E 8288
Ewe _ 23 £3.83 28 2 30m»... 21 m .8; :95. $8... 855:8 858. @553 2: 8.: s 35.8 om232° é accuses? 2: -3. 29¢

75

Table 4.5- The dependence of cleavage activity on ferrous iron. Iron was chelated from the VP14 protein
with 50 mM EDTA. The EDTA was subsequently removed on a G-25 Sephadex spin column equilibrated
with 100 mM Bis-Tris and 0.05% Triton-X 100. VP14 protein,7 pg, was then added to reactions
containing the indicated cofactors.

Treatment

5 “M Fe” 416.1i8.1

 

5 pM Fe3+ n.d.
5_ _MFC3++1WaSC°Tba ,, , - 42*238-

 

 

76
CuCl2 were inhibitory, presumably by competing with iron for binding to the active site.

With increasing VP14 concentration, there is a decrease in 9-cis-violaxanthin and
an equimolar increase in xanthoxin and the C25 epoxy apo-aldehyde (Figure 4.5). Non-
enzymatic cleavage resulting from photo-oxidation or Fenton chemistry would result in
random cleavage at different double bond positions. However, the stoichiometric
conversion of 9-cis-violaxanthin to the two products illustrates the specificity of the
cleavage between the 11 and 12 positions of the polyene chain.

To determine the substrate specificity of the cleavage reaction, the all-trans and
the 9-cis isomers of neoxanthin and Violaxanthin were tested. The reaction products were
separated on TLC plates and sprayed with 2,4-dinitrophenyl hydrazine to detect
aldehydes (Figure 4.6). Xanthoxin and the predicted C25 products are present only in
reactions containing the 9-cis isomers. The mono-epoxy carotenoids, antheraxanthin and
lutein epoxide, are also potential precursors of ABA. In most plant tissues, these
xanthophylls exist in the all-trans configuration (Parry et al., 1990) and, as expected, their
all-trans isomers were not cleaved by VP14 (data not shown). The 9-cis isomer of
zeaxanthin, formed by iodine isomerization of the all-trans zeaxanthin (Zechmeister,
1962), was cleaved at the 11 and 12 positions by the VP14 protein (Figure 4.6).

The spectra of the C25 zeaxanthin apo-aldehyde (3-hydroxy-12'-apo-B-caroten-12'-
a1): m/z (rel. int.): 366 [M]+ (100), 348 (6), 255 (4), 213 (8), 197 (8), 147 (17), 119 (20),
105 (15), 91 (15).

The theoretical mass of the cleavage product (C25H3402) is 366.2559 and the

experimentally determined mass was 366.2564 with an error of 1.5 ppm from the

77

 

1
1
1 1
4 ;_ - 1
. Xanthoxin é ‘
v, 31‘ 1
g 1 _ : c25 Epoxy apo-aldehyde
a ‘
a 1 ' 1
2 -- .
1 ,-
i n .r’//
1 r .
I1 t’ x- ‘91-cis-Violaxanthin
ii 8 7’ e.
0‘ 1 i, 1 , : # 1 1 1___ i ,1
0 2 4 6 8 10 12 14
Protein (11g)

Figure 4.5- Decrease in 9-cis-violaxanthin and the concomitant increase in xanthoxin and
the C25 apo-aldehyde as a function of the VP14 protein concentration. Assays were incubated
for 10 min. at 22-24°C, extracted, and quantified.

78

 

uoegoa 30:39.3 2: Ba 32: 3332:: of. At 5 3 “.8865 2a $2603 20

2: was AL 5 .3 382?: 2a $260.5 20 of. .8933? .050 ES Exofifix 88% 9
oEnflvE.>=osn-2::_c-v.m .23 3.32% 225 883 2:. 6:88: 5 Banach—ea $3 5::
Ego—goo Amcocfianom 2m: 82; cc _ow 8:7. a :0 Banana 2?: 82.605 can 28535
.35 555x82 Ea A>V Eficmxfio; .ANV Efi—axcoN mo 38 FEES; ESE? on. 98

CS EoEo£ MGé 2:. ”oafiamnsm 3329: 05.3 m: w 303,535.? 358:8 939?.

.3 3223 BE At 5393 3.; .23 $8390 Eamhwofifieco Sam—.5: 1.1 .06 2am:—

Ex 28 23 >8 >3 Now Na 2988.0.
.Bm+.+-+-+-+-+-$a>

é. . u b . v r s . .. .. -

um

than“?

+—

79
calculated mass.

Cl, zeaxanthin apo-aldehyde (3-hydroxy-apo-B-caroten-1l-al): m/z (rel. int.) 234
[M]’ (67), 219 (17), 201 (48), 187 (35), 159 (34), 149 (79), 131 (43), 121 (52), 105 (52),
95 (100).

The compound (CISHnOZ) has a theoretical mass of 234. 1620 and the
experimentally determined mass was 234.1611 with an error of -3.7 ppm.

The cleavage of 9-cis zeaxanthin indicates that the 9-cis configuration is the
primary determinant of cleavage specificity for the in vitro assays. Cleavage of 9-cis-
epoxy carotenoids would result in the production of cis-xanthoxin, which would
subsequently be converted to the biologically active isomer of ABA in vivo.

The environment of the caroteno ids in the thylako id and envelope membranes
(Douce and Joyard, 1979) is very different from in vitro assays in which the carotenoid
substrates are solubilized by detergent. However, the characteristics of the cleavage
reaction, both in the substrate specificity and the position of cleavage, are consistent with
the proposed pathway (Parry, 1993). Current evidence suggests this cleavage reaction is
the key regulatory step in ABA biosynthesis (Parry, 1993). Further characterization of the
cleavage reaction and its regulation may allow the manipulation of ABA levels in planta,
which would affect such processes as seed dormancy, drought tolerance, and cold
hardening.

The lignostilbene dioxygenases from Pseudomonas (Kamoda and Sburi, 1993) and
VP14 comprise a novel class of dioxygenases that catalyze similar double bond cleavage

reactions. The conserved sequences have also been identified in several plant ESTs, two

80
ORFS from the Synechocystis genome sequencing project (Kaneko et al., 1996), and a

protein expressed in the retinal pigment epithilium of mammals, RPE65 (Hamel et al.,
1993). The function of the gene products has not yet been determined. The expression
pattern of the RPE gene is not consistent with a role in vitamin A biosynthesis, but it does
set a precedent for this class of proteins in animals. Conserved sequences my be useful in
identifying additional carotenoid cleavage enzymes necessary for the synthesis of other
important apocarotenoids, such as vitamin A.

References
Bibikov SI, Grishanin RN, Kaulen AD, Marwan W, Oesterhelt D, Skulachev VP
(1993) Bacteriorhodopsin is involved in halobacterial photoreception. Proc Natl Acad Sci

USA 90: 9446-94450

Bu'Lock JD (1983) Trisporic acids. In Biosynthesis of Isoprenoid Compounds. JW
Porter & SL Spurgeon, Eds Vol 2: 437-462 John Wiley & Sons New York, NY

Chevion M (1988) A site-specific mechanism for free radical induced biological damage:
the essential role of redox-active transition metals. Free Radic Biol Med 5: 27-37

Comic M, Agadir A, Degos L, Chomienne C (1994) Retinoids and difi‘erentiation
treatment: a strategy for treatment in cancer. Anticancer Res 14: 2339-2346

Creelman RA, Zeevaart JAD (1984) Incorporation of oxygen into abscisic acid and
phaseic acid from molecular oxygen. Plant Physiol 75: 166-169

Douce R, Joyard J (1979) Structure and function of the plastid envelope. Adv Bot Res
7: 1-116

Duckham SC, Linforth RST, Taylor IR (1991) Abscisic-acid-deficient mutants at the
aba gene locus of Arabdiopsis thaliana are impaired in the epoxidation of zeaxanthin.
Plant Cell Environ 14: 601-606

Foster KW, Saranak J, Patel N, Zarrilli G, Okabe M, Kline T, Nakanishsi K (1984)
A rhodopsin is the functional photoreceptor for phototaxis in the unicellular eukaryote
Chlamydomonas. Nature 311: 756-759

Gaskin P, MacMillan, J (1992) GC-MS of Gibberellins and Related Compounds:

81
Methodology and a Library of Reference Spectra. Cantock's Press, Bristol, UK

Gerber LE, Simpson KL (1990) Carotenoid cleavage: alternative pathways. Methods
Enzymol 189: 433-436

Giguere V, Ong ES, Segui P, Evans RM (1987) Identification of a receptor for the
morphogen retinoic acid. Nature 330: 624-629

Goodman DS, Huang HS, Kanai M, Shiratori T (1967) The conversion of all-trans-B-
carotene into retinal. J Biol Chem 241: 1929-1932

Hamel CP, Tsilou E, Pfeffer A, Hooks JJ, Detrick B, Redmond TM (1993) molecular
cloning and expression of RPE65, a novel retinal pigment epithilium-specific microsomal
protein that is post-transcriptionally regulated in vitro. J Biol Chem 268: 15751-15757

Hoffman SL (1992) Retinoids—”difierentiation agents” for cancer treatment and
prevention. Am J Med Sci 304: 202-213

Jiittner F, Hoflacher B (1985) Evidence of B-carotene 7,8 (7',8') oxygenase (B-
cyclocitral, crocetindial generating) in Microcystis. Arch Microbiol 14: 337-343

Kamoda S, Saburi Y (1993) Cloning, expression, and sequence analysis of a
lignostilbene-a,B-dioxygenase gene from Pseudomonas paucimobilis TMY 1009. Biosc
Biotech Biochem. 57: 926-930

Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N,
Hirosawa M, Sugiura M, Sasamoto S, Kimura T, Hosouchi T, Matsuno A, Muraki
A, Nakazaki N, Naruo K, Okumura S, Shimpo S, Takeuchi C, Wada T, Watanabe
A, Yamada M, Yasuda M, Tabata S (1996) Sequence analysis of the genome of the
unicellular cyanobacterium Synechocystis sp strain PCC6803. II Sequence determination

of the entire genome and assignment of potential protein-coding regions. DNA Res 3:
185-209

Li Y, Walton DC (1990) Violaxanthin is an abscisic acid precursor in water-stressed
dark-grown bean leaves. Plant Physiol 92: 551-559

Marin E, Nussaume L, Quesada A, Gonneau M, Scotta B, Hugueney P, Frey A,
Marion-Poll A (1996) Molecular identification of zeaxanthin epoxidase of Nicotiana
plumbaginifolia, a gene involved in abscisic acid biosynthesis and corresponding to the
ABA locus inArabidopsis thaliana. EMBO J 15: 2331-2342

Molnar P, Szabolcs J (1979) Alkaline permanganate oxidation of carotenoid epoxides
and furanoids. Acta Chirn Acad Sci Hung 99: 155-173

82
Parry AD, Horgan R (1991) Carotenoid metabolism and the biosynthesis of abscisic
acid. Phytochemistry 30: 815-821

Parry AD, Griffiths A, Horgan R (1992) Abscisic acid biosynthesis in roots. II. The
effects of water stress in wild-type and an abscisic acid-deficient mutant (notabilis) plant
of Lycopersicon esculentum Mill. Planta 187: 192-197

Parry AD, Babiano MJ, Horgan R (1990) The role of cis-carotenoids in abscisic acid
biosynthesis. Planta 182: 118-128

Parry, AD (1992) Abscisic Acid Metabolism. In: Methods in Plant Biochemistry, Vol. 9,
ch. 15, P.J. Lea, ed. pp. 381-402. Academic, NY

Rock CD, Zeevaart JAD (1991) The aba mutant of Arabidopsis thaliana is impaired in
epoxy-carotenoid biosynthesis. Proc Natl Acad Sci USA 88: 7496-7499

Sindhu RK, Walton DC (1987) The conversion of xanthoxin to abscisic acid by cell-free
preparations from bean leaves. Plant Physiol 85: 916-921

Taylor [B (1991) Genetics of ABA synthesis. In Davies, WJ and Jones, HG (eds),
Abscisic Acid, Physiology and Biochemistry. Bios Scientific, Oxford, UK, pp 23-25

Taylor HF, Burden RS (1972) Xanthoxin, a recently discovered plant growth inhibitor.
Proc R Soc Lond Ser B 180: 317-346

Taylor HF, Smith TA (1967) Production of plant growth inhibitors from xanthophylls: a
possible source of dorrnin. Nature 215: 1513-1514

Wald G (1968) Molecular basis of visual excitation. Science 162: 230-239

Wang X, Krinsky NI, Tang G, Russell RM (1992) Retinoic acid can be produced from
the excentric cleavage of B-carotene in human intestinal mucosa. Arch Biochem Biophys
293: 298-304

Zechmeister L (1962) Cis-Trans Isomeric Carotenoids, Vitamin A, and Arylpolyenes.
Academic Press Inc. Publishers. New York pg. 85

Zeevaart JAD, Creelman RA (1988) Metabolism and physiology of abscisic acid. Annu
Rev Plant Physiol Plant Mol Biol 39: 439-473

Tfiiflrfim— ‘n‘ “.0“ V 1.1.1- .

 

 

83

Chapter 5
Future directions
Osmotic stress responses in Anabaena PCC 7120.

The focus of the current work was to study the fimction and regulation of salt-
induced genes in the cyanobacterium, Anabaena sp. PCC 7120. Although the function of
individual genes has not been determined, the properties of the SA6 regulatory mutant
indicate that salt-induced proteins may have a role in stress tolerance. If so, it may be
possible to increase salt-tolerance in Anabaena by cloning and over-expressing salt-
induced transcripts. It may also be possible to increase the expression of multiple proteins
simultaneously. A number of mutations have been identified in response regulators, which
result in hyperactivity or constitutive expression of genes (summarized in Volz, 1993). A
similar mutation in the SA6 response regulator might result in constitutive expression of
multiple salt-induced transcripts. The ABS plasmid rescue contains the luxAB genes
under the control of promoter elements recognized by the SA6 response regulator.
Therefore, it may be possible to identify mutations that lead to constitutive expression of
the luciferase reporter in an E. coli strain containing the ABS plasmid rescue and
expressing the response regulator. A 1.7-kb DNA fragment containing the coding region
for SA6 was cloned into pBluescript SK (Stratagene) and transformed into a mutator
strain of E. coli (MU53). Plasmid DNA isolated from the mutator strain was used to
transform E. coli DHlOB containing the ABS plasmid rescue. The transformants were
screened for elevated luciferase expression. To date, no positive colonies have been

identified in the screen.

 

84

In higher plants, signal transduction pathways similar to two-component regulatory
systems are involved in the regulation of responses to ethylene (Chang et al., 1993) and
cytokinin (Kamimoto, 1996). Additional genes with sequence similarity to two-
component systems have been identified in the plant dbest sequence database. In
Sacchromyces cerevisae, only one two-component regulatory system has been identified
(Maeda et al., 1994). In Neurospora crassa, the m‘k—I encodes a two-component hybrid
involved in hyphal development (Alex etal., 1996). The limited number of two-
component systems in lower eukaryotes may indicate that the plant regulatory systems
originated from endosymbiosis. In fact, an ORF with very high sequence similarity to the
err gene is present in the Synechocystis genome (Kaneko et al., 1996). The possibility that
a homolog of the SA6 gene exists in plants has not yet been explored. Further
clarification of the relationship between cyanobacterial and plant regulatory systems
should be possible as the plant sequencing projects generate more data. The
identification of similar sequences in cyanobacteria and plants, coupled with fimctional
analysis in cyanobacteria, may provide some insight into the function and evolution of
two-component systems in plants.

ABA biosynthesis.

Mutants have now been characterized in the first committed reaction of ABA
biosynthesis and all subsequent steps (chapters 3 and 4). However, there are several
interesting steps preceding the cleavage reaction. The epoxy-carotenoid precursor must
have a 9-cis configuration for cleavage and subsequent conversion to ABA, but nothing is

known about the mechanism of isomerization. If there is an isomerase that catalyzes this

- 7115';-

 

 

85

reaction, a loss of its activity would cause an ABA-deficient phenotype. The cellular
location of the cleavage reaction has not been determined, but it has been suggested that
the cleavage reaction occurs in the chloroplast envelopes, which contain small amounts of
carotenoids. Carotenoids are synthesized in the thylakoid membrane and subsequently
transported to the envelope; thus, a lesion in carotenoid transport to the envelopes may
also result in ABA-deficiency.

In collaboration with the lab of Maarten Koornneef, the characterization of
potential aba mutants in Arabidopsis has continued. Several mutants (DOR9, C3C, J45,
128, and A63) capable of germination on the gibberellin biosynthesis inhibitor,
paclobutrazol, have been identified. In vegetative tissues, the mutants do not show
reduced ABA levels, the conversion of xanthoxin to ABA is not impaired, and the
carotenoid composition is normal (data not shown). The lesion in these mutants my be in
a seed-specific ABA biosynthetic isozyme or the phenotype may not be associated with
ABA biosynthesis.

Biochemical evidence suggests that the cleavage reaction is the key regulatory step
in ABA biosynthesis (Parry, 1992). The induction of cleavage enzyme transcripts by
dehydration of maize leaves (Tan et al., 1997) is consistent with this hypothesis. Future
work should concentrate on testing this point directly by over-expressing the cleavage
enzyme in transgenic plants. By altering ABA levels in transgenic plants, it may be
possible to alter a number of physiological processes, such as cold hardiness, seed

dormancy, and drought tolerance.

 

 

 

86

Mechanistic studies of the cleavage reaction catalyzed by VP14.

VP14 and lignostilbene dioxygenases comprise a novel class of dioxygenases,
which oxidatively cleave double bonds. Additional genes with sequence similarity to this
class of dioxygenases have been identified in the sequence databases, but their fiinction has

yet to be determined. Nothing is known about the reaction mechanism this class of

'tfil::‘“l?'
I

enzyme catalyzes.
The all-trans carotenoids are not cleaved by the recombinant VP14 protein ,-

(chapter 4), nor do the all-trans isomers act as competitive inhibitors when included in

 

m: ‘

enzyme assays with the 9-cis isomers (data not shown). Therefore, it appears that the
VP14 protein is unable to bind the all-trans isomers. The binding characteristics of VP14
were explored in greater detail by testing additional carotenoid substrates1 in the cleavage
assay (Figure 5.1). The cleavage of 9-cis zeaxanthin indicates that the 5,6 ring epoxide is
not necessary for activity. To determine the necessity of the ring hydroxyl, an attempt was
made to test B-carotene as a substrate. B-Carotene, however, was insoluble in the reaction
buffer; it was not cleaved by VP14. The cleavage of 9- and 9'-cis capsanthin, which
contains a B-ring and a K-ring (five carbons), was also tested. In this reaction, the B-ring

C25 product was not observed indicating that VP14 cannot cleave adjacent to the K-ring.

 

1

All trans-carotenoids, purified from a variety of sources, were isomerized with I2 and the
cis/trans isomers were separated by normal phase HPLC (see chapter 3). The 9-, 13-, and
15-cis isomers are the only ones that are sterically allowed (Zechmeister, 1962). Of these,
the 9-cis isomer is usually the most abundant and the least polar, which makes it relatively
easy to identify on HPLC chromatograms. Further confirmation of a 9-cis configuration
was based on absorption spectrum. In particular, the 9-cis isomer has a small “cis-peak”
(absorption peak near 340 nm) relative to the 13- and lS-cis isomers (Zechmeister, 1962).

 

87

Freeman ofABA

O 0
O O
“O'CHII'III‘ "am...“
I'D
4330..
OH

Addtlonfl emanates cleaved by VP14

  
      
 

9' Luteln O Lubln Capunllln

    

Lubln
epoxide

Anthonxanthln Diabxamhln

OH

Figure 5.1- Cleavage substrates used in the characterization of VP14 activity.

88

Atmospheric oxygen concentrations are sufficient for maximal cleavage activity
(data not shown). Therefore, the cleavage reaction should display pseudo-first order
reaction kinetics with atmospheric concentrations of 0,. Kinetic measurements of the

cleavage reaction with 9-cis-neoxanthin and 9-cis-violaxanthin showed similar Km value

_ ' ._. ‘th"!flf‘h"I,'
v7?

 

of approximately 10 uM (Figure 5.2), indicating that the enzyme binds the two substrates

equally well. However, the Vmax for Violaxanthin was significantly higher. At the site of

cleavage, there are no structural variations to account for this difference. The electronic
0,

structure within the polyene chain may affect the rate of catalysis. The extent of photo- :1

and chemical-oxidation of a carotenoid at different positions in the molecule is
proportional to the electron density at a given position (Britton, 1995). By analogy, the
rate of cleavage at the same position in different carotenoids may also be dependent upon
the electron density. To determine if the rate of cleavage is proportional to electron
density, serni-empirical molecular orbital modeling will be performed on Violaxanthin and
neoxanthin. The kinetic parameters for additional substrates will also be determined. A
variety of asymmetric carotenoids exists in nature which contain a 5,6 epoxy and 4'
hydroxyl group (Figure 5.1). Following isomerization to the 9- or 9'-cis configuration,
these carotenoids should be cleaved by VP14 to produce xanthoxin. The structural
variations at the other end of the molecule should affect the electron density in the polyene
chain, so that the correlation with cleavage activity may be examined in greater detail.
Identification of inhibitors would also be beneficial in determining the reaction
mechanism of VP14. There is a previous report that lipoxygenase inhibitors such as

naproxen inhibit ABA biosynthesis (Creelman et al., 1992). At 10 mM, however, this

 

89

l 9-a's-violaxanth in

Xanthoxin (ng)
3
0
O
l. A

8004 p"

l ,
600 ”i .« ' " 9-a's-neoxanth in l

0 20 40 60 80 1 00
Substrate (uM)

Figure 5.2- Kinetic measurements for the cleavage of 9-cis-violaxanthin and 9-cis-neoxanthin by VP14.

90
inhibitor had no afl‘ect on the cleavage activity (data not shown). To date, the only
effective inhibitors are those which affect the binding of ferrous iron to the enzyme, such
as iron chelators. Copper also inhibits the activity of VP14, presumably by competing
with iron for binding to the active site (data not shown).

The nature of the iron coordination to the enzyme, determined by EPR
spectroscopy, would also provide some insight into the reaction mechanism. While F e2+
does not give a good EPR signal, it is possible to substitute Cu2+ in the active site. The
inhibition of cleavage activity by Cu2+ (data not shown), indicates that this metal will
compete with iron for binding to the active site.

REFERENCES
Alex LA, Borkovich KA, Simon MI (1996) Hyphal developement in Neurospora crassa:
involvement of a two-component histidine kinase. Proc Natl Acad Sci USA 93: 3416-

3421

Britton G (1995) Structure and properties of carotenoids in relation to fimction. F ASEB
J9: 1551-1558

Chang C, Kwok SF, Bleecker AB, Meyerowitz EM (1993) Arabidopsis
ethylene-response gene ETRl: similarity of product to two-component regulators. Science
262: 539-544

Creelman RA, Bell E, Mullet JE (1992) Involvement of a lipoxygenase-like enzyme in
abscisic acid biosynthesis. Plant Physiol 99: 1258-1260

Hansen G, Das A, Chilton MD (1994) Constitutive expression of the virulence genes
improves the efliciency of plant transformation by A grobacterium. Proc Natl Acad Sci
USA 91: 7603-7607

Kakimoto T (1996) CKIl, a histidine kinase homolog implicated in cytokinin signal
transduction. Science 274: 982-985

Kaneko T, Sato S, Kotani H, Tanaka A, Asamizu E, Nakamura Y, Miyajima N,
Hirosawa M, Sugiura M, Sasamoto S, Kimura T, Hosouchi T, Matsuno A, Muraki

91

A, Nakazaki N, Naruo K, Okumura S, Shimpo S,Takeuchi C, Wada T, Watanabe A,
Yamada M, Yasuda M, Tabata S (1996) Sequence analysis of the genome of the
unicellular cyanobacterium Synechocystis sp. strain PCC6803. II. Sequence determination

of the entire genome and assignment of potential protein-coding regions. DNA Res 3:
185-209

Maeda T, Wurgler-Murphy SM, Saito H (1994) A two-component system that
regulates an osmosensing MAP kinase cascade in yeast. Nature 369: 242-245

Parry, AD (1993) Abscisic Acid Metabolism. In: Methods in Plant Biochemistry, Vol. 9,
ch. 15, P.J. Lea, ed. pp. 381-402. Academic, New York

Tan BC, Schwartz SH, Zeevaart JAD, McCarty DR (1997) Submitted for publication.

Volz K (1993) Structural conservation in the CheY superfamily. Biochemistry 32: 11741-
11753

Wilde A, Churin Y, Schubert H, Borner T(1997) Disruption of a Synechocystis sp.
PCC 6803 gene with partial similarity to phytochrome genes alters growth under changing
light qualities. FEBS Lett 406: 89-92

Zechmeister L (1962) Cis-Trans Isomeric Carotenoids, Vitamin A, and Arylpolyenes.
Academic Press Inc. Publishers. New York pg. 85

"11111111111111.1111111111“